Turkish Journal of Hematology Volume: 34 - Issue: 1

Volume 34 Issue 1 March 2017 80 TL
ISSN 1300-7777
Review
Iron Overload in Hematopoietic Stem Cell Transplantation
Erden Atilla, et al.; Ankara, Turkey
Research Articles
Predictive Ability of the European Treatment Outcome Study
Jing Huang, et al.; Changsha, China
Allogeneic Transplantation in Chronic Myeloid Leukemia
Mehmet Özen, et al.; Ankara, İstanbul, Turkey, Minneapolis, USA
Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms
Nur Soyer, et al.; İzmir, Ankara, Sakarya, Gaziantep, Kayseri, Malatya, Turkey
TP53 Alterations in Chronic Lymphocytic Lymphoma Patients
İbrahim Kulaç, et al.; Ankara, Turkey, Baltimore, USA
Endocrine Late Complications in Childhood Leukemia Survivors
Cengiz Bayram, et al.; Ankara, Turkey
FLAG Therapy in Relapsed/Refractory Childhood Leukemia
Şebnem Yılmaz Bengoa, et al.; İzmir, Turkey
Red Blood Cell Transfusion in Greece
Serena Valsami, et al.: Athens, Greece
Evaluation of Schistocyte Quantitation
Elise Schapkaitz and Michael Halefom Mezgebe; Johannesburg, South Africa
Increasing the Awareness of Cryopreserved Platelets in Turkey
İbrahim Eker, et al.; Ankara, İstanbul, Turkey
Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia
Fehmi Hindilerden, et al.; İstanbul, Turkey
Discrepancies in Lymphoma Diagnosis Over the Years
Neval Özkaya, et al.; İstanbul, Turkey, New York, USA
Hypogammaglobulinemia and Poor Performance for Vancomycin-Resistant Enterococci Colonization
Elif Gülsüm Ümit, et al.; Edirne, Turkey
Antibacterial Activities of Ankaferd Hemostat
Ahmet Koluman, et al.; Ankara, Turkey
Cover Picture:
Ahmet Koluman et al.
Effect of ABS on Survival of S.
Typhimurium (FISH Technique
Using Vermicon Kit)
1

Editor-in-Chief
Reyhan Küçükkaya
İstanbul, Turkey
rkucukkaya@hotmail.com
Associate Editors
Ayşegül Ünüvar
İstanbul University, İstanbul, Turkey
aysegulu@hotmail.com
Cengiz Beyan
TOBB University of Economics and Technology,
Ankara, Turkey
cengizbeyan@hotmail.com
Hale Ören
Dokuz Eylül University, İzmir, Turkey
hale.oren@deu.edu.tr
İbrahim C. Haznedaroğlu
Hacettepe University, Ankara, Turkey
haznedar@yahoo.com
M. Cem Ar
İstanbul University Cerrahpaşa Faculty of
Medicine, İstanbul, Turkey
mcemar68@yahoo.com
Selami Koçak Toprak
Ankara University, Ankara, Turkey
sktoprak@yahoo.com
Semra Paydaş
Çukurova University, Adana, Turkey
sepay@cu.edu.tr
Assistant Editors
A. Emre Eşkazan
İstanbul University Cerrahpaşa Faculty of
Medicine, İstanbul, Turkey
Ali İrfan Emre Tekgündüz
Dr. A. Yurtaslan Ankara Oncology Training and
Research Hospital, Ankara, Turkey
Elif Ünal İnce
Ankara University, Ankara, Turkey
İnci Alacacıoğlu
Dokuz Eylül University, İzmir, Turkey
Müge Sayitoğlu
İstanbul University, İstanbul, Turkey
Nil Güler
Ondokuz Mayıs University, Samsun, Turkey
Olga Meltem Akay
Koç University, İstanbul, Turkey
Şule Ünal
Hacettepe University, Ankara, Turkey
Veysel Sabri Hançer
İstanbul Bilim University, İstanbul, Turkey
Zühre Kaya
Gazi University, Ankara, Turkey
International Review Board
Nejat Akar
Görgün Akpek
Serhan Alkan
Çiğdem Altay
Koen van Besien
Ayhan Çavdar
M. Sıraç Dilber
Ahmet Doğan
Peter Dreger
Thierry Facon
Jawed Fareed
Gösta Gahrton
Dieter Hoelzer
Marilyn Manco-Johnson
Andreas Josting
Emin Kansu
Winfried Kern
Nigel Key
Korgün Koral
Abdullah Kutlar
Luca Malcovati
Robert Marcus
Jean Pierre Marie
Ghulam Mufti
Gerassimos A. Pangalis
Antonio Piga
Ananda Prasad
Jacob M. Rowe
Jens-Ulrich Rüffer
Norbert Schmitz
Orhan Sezer
Anna Sureda
Ayalew Tefferi
Nükhet Tüzüner
Catherine Verfaillie
Srdan Verstovsek
Claudio Viscoli
Past Editors
Erich Frank
Orhan Ulutin
Hamdi Akan
Aytemiz Gürgey
Senior Advisory Board
Yücel Tangün
Osman İlhan
Muhit Özcan
Teoman Soysal
TOBB Economy Technical University Hospital, Ankara, Turkey
Maryland School of Medicine, Baltimore, USA
Cedars-Sinai Medical Center, USA
Ankara, Turkey
Chicago Medical Center University, Chicago, USA
Ankara, Turkey
Karolinska University, Stockholm, Sweden
Mayo Clinic Saint Marys Hospital, USA
Heidelberg University, Heidelberg, Germany
Lille University, Lille, France
Loyola University, Maywood, USA
Karolinska University Hospital, Stockholm, Sweden
Frankfurt University, Frankfurt, Germany
Colorado Health Sciences University, USA
University Hospital Cologne, Cologne, Germany
Hacettepe University, Ankara, Turkey
Albert Ludwigs University, Germany
University of North Carolina School of Medicine, NC, USA
Southwestern Medical Center, Texas, USA
Georgia Health Sciences University, Augusta, USA
Pavia Medical School University, Pavia, Italy
Kings College Hospital, London, UK
Pierre et Marie Curie University, Paris, France
King’s Hospital, London, UK
Athens University, Athens, Greece
Torino University, Torino, Italy
Wayne State University School of Medicine, Detroit, USA
Rambam Medical Center, Haifa, Israel
University of Köln, Germany
AK St Georg, Hamburg, Germany
Memorial Şişli Hospital, İstanbul, Turkey
Santa Creu i Sant Pau Hospital, Barcelona, Spain
Mayo Clinic, Rochester, Minnesota, USA
İstanbul Cerrahpaşa University, İstanbul, Turkey
University of Minnesota, Minnesota, USA
The University of Texas MD Anderson Cancer Center, Houston, USA
San Martino University, Genoa, Italy
Language Editor
Leslie Demir
Statistic Editor
Hülya Ellidokuz
Editorial Office
İpek Durusu
Bengü Timoçin
A-I
Publishing
Services
GALENOS PUBLISHER
Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey
Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information
Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya
E-mail : rkucukkaya@hotmail.com
All Inquiries Should be Addressed to
TURKISH JOURNAL OF HEMATOLOGY
Address : İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No: 8 06550 Çankaya, Ankara / Turkey
Phone : +90 312 490 98 97
Fax : +90 312 490 98 68
E-mail : info@tjh.com.tr
ISSN: 1300-7777
Publishing Manager
Sorumlu Yazı İşleri Müdürü
Güner Hayri Özsan
Management Address
Yayın İdare Adresi
Türk Hematoloji Derneği
İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk.
No: 8 06550 Çankaya, Ankara / Turkey
Online Manuscript Submission
http://mc.manuscriptcentral.com/tjh
Web page
www.tjh.com.tr
Owner on behalf of the Turkish Society of Hematology
Türk Hematoloji Derneği adına yayın sahibi
Ahmet Muzaffer Demir
Üç ayda bir yayımlanan İngilizce süreli yayındır.
International scientific journal published quarterly.
Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish
Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi
tarafından yayınlanmasına karar vermiştir.
Publishing House / Yayınevi
Molla Gürani Mah. Kaçamak Sk. No: 21, 34093
Fındıkzade, İstanbul, Turkey
Tel: +90 212 621 99 25 Faks: +90 212 621 99 27
E-posta: info@galenos.com.tr
Baskı: Özgün Ofset Ticaret Ltd. Şti.
Yeşilce Mah. Aytekin Sk. No: 21 34418 4. Levent / İstanbul
Printing Date / Basım Tarihi
01.03.2017
Cover Picture
Ahmet Koluman et al.,
Effect of Ankaferd Blood Stopper (ABS) on survival of Salmonella Typhimurium
(fluorescence in situ hybridization technique using Vermicon kit). Top: Survival
of Salmonella Typhimurium with 2 mL of sterile distilled water at 37 °C. There is
no visible change. Plating of the homogenate indicates the stability in the viable
counts. Bottom: Survival of Salmonella Typhimurium with 2 mL of ABS at 37
°C. There is 3 log 10
cfu/mL decrease, which indicates a statistical significance (see
page 95).
A-II

AIMS AND SCOPE
The Turkish Journal of Hematology is published quarterly (March, June,
September, and December) by the Turkish Society of Hematology. It is an
independent, non-profit peer-reviewed international English-language
periodical encompassing subjects relevant to hematology.
The Editorial Board of The Turkish Journal of Hematology adheres to
the principles of the World Association of Medical Editors (WAME),
International Council of Medical Journal Editors (ICMJE), Committee on
Publication Ethics (COPE), Consolidated Standards of Reporting Trials
(CONSORT) and Strengthening the Reporting of Observational Studies in
Epidemiology (STROBE).
The aim of The Turkish Journal of Hematology is to publish original
hematological research of the highest scientific quality and clinical
relevance. Additionally, educational material, reviews on basic
developments, editorial short notes, images in hematology, and letters
from hematology specialists and clinicians covering their experience and
comments on hematology and related medical fields as well as social
subjects are published. As of December 2015, The Turkish Journal of
Hematology does not accept case reports. Important new findings or data
about interesting hematological cases may be submitted as a brief report.
General practitioners interested in hematology and internal medicine
specialists are among our target audience, and The Turkish Journal of
Hematology aims to publish according to their needs. The Turkish Journal
of Hematology is indexed, as follows:
- PubMed Medline
- PubMed Central
- Science Citation Index Expanded
- EMBASE
- Scopus
- CINAHL
- Gale/Cengage Learning
- EBSCO
- DOAJ
- ProQuest
- Index Copernicus
- Tübitak/Ulakbim Turkish Medical Database
- Turk Medline
Impact Factor: 0.827
Open Access Policy
Turkish Journal of Hematology is an Open Access journal. This journal
provides immediate open access to its content on the principle that
making research freely available to the public supports a greater global
exchange of knowledge.
Open Access Policy is based on the rules of the Budapest Open Access
Initiative (BOAI) http://www.budapestopenaccessinitiative.org/.
Subscription Information
The Turkish Journal of Hematology is sent free-of-charge to members
of Turkish Society of Hematology and libraries in Turkey and abroad.
Hematologists, other medical specialists that are interested in hematology,
and academicians could subscribe for only 40 $ per printed issue. All
published volumes are available in full text free-of-charge online at www.
tjh.com.tr.
Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya,
Ankara, Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: info@tjh.com.tr
Permissions
Requests for permission to reproduce published material should be sent to
the editorial office.
Editor: Professor Dr. Reyhan Küçükkaya
Adress: İlkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya,
Ankara, Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: info@tjh.com.tr
Publisher
Galenos Yayınevi
Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey
Telephone : +90 212 621 99 25
Fax : +90 212 621 99 27
info@galenos.com.tr
Instructions for Authors
Instructions for authors are published in the journal and at www.tjh.com.tr
Material Disclaimer
Authors are responsible for the manuscripts they publish in The Turkish
Journal of Hematology. The editor, editorial board, and publisher do not
accept any responsibility for published manuscripts.
If you use a table or figure (or some data in a table or figure) from another
source, cite the source directly in the figure or table legend.
The journal is printed on acid-free paper.
Editorial Policy
Following receipt of each manuscript, a checklist is completed by the
Editorial Assistant. The Editorial Assistant checks that each manuscript
contains all required components and adheres to the author guidelines,
after which time it will be forwarded to the Editor in Chief. Following the
Editor in Chief’s evaluation, each manuscript is forwarded to the Associate
Editor, who in turn assigns reviewers. Generally, all manuscripts will be
reviewed by at least three reviewers selected by the Associate Editor, based
on their relevant expertise. Associate editor could be assigned as a reviewer
along with the reviewers. After the reviewing process, all manuscripts are
evaluated in the Editorial Board Meeting.
Turkish Journal of Hematology’s editor and Editorial Board members are
active researchers. It is possible that they would desire to submit their
manuscript to the Turkish Journal of Hematology. This may be creating
a conflict of interest. These manuscripts will not be evaluated by the
submitting editor(s). The review process will be managed and decisions
made by editor-in-chief who will act independently. In some situation, this
process will be overseen by an outside independent expert in reviewing
submissions from editors.
A-III

TURKISH JOURNAL OF HEMATOLOGY
INSTRUCTIONS FOR AUTHORS
The Turkish Journal of Hematology accepts invited review articles, research
articles, brief reports, letters to the editor, and hematological images that
are relevant to the scope of hematology, on the condition that they have
not been previously published elsewhere. Basic science manuscripts,
such as randomized, cohort, cross-sectional, and case-control studies,
are given preference. All manuscripts are subject to editorial revision
to ensure they conform to the style adopted by the journal. There is a
double-blind reviewing system. Review articles are solicited by the Editorin-Chief.
Authors wishing to submit an unsolicited review article should
contact the Editor-in-Chief prior to submission in order to screen the
proposed topic for relevance and priority.
The Turkish Journal of Hematology does not charge any article submission
or processing charges.
Manuscripts should be prepared according to ICMJE guidelines (http://
www.icmje.org/). Original manuscripts require a structured abstract. Label
each section of the structured abstract with the appropriate subheading
(Objective, Materials and Methods, Results, and Conclusion). Letters to
the editor do not require an abstract. Research or project support should
be acknowledged as a footnote on the title page. Technical and other
assistance should be provided on the title page.
Original Manuscripts
Title Page
Title: The title should provide important information regarding the
manuscript’s content. The title must specify that the study is a cohort
study, cross-sectional study, case-control study, or randomized study (i.e.
Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability
of ferrous succinate tablet formulations without correction for baseline
circadian changes in iron concentration in healthy Chinese male
subjects: A single-dose, randomized, 2-period crossover study. Clin Ther
2011;33:2054-2059).
The title page should include the authors’ names, degrees, and institutional/
professional affiliations and a short title, abbreviations, keywords, financial
disclosure statement, and conflict of interest statement. If a manuscript
includes authors from more than one institution, each author’s name
should be followed by a superscript number that corresponds to their
institution, which is listed separately. Please provide contact information
for the corresponding author, including name, e-mail address, and
telephone and fax numbers.
Running Head: The running head should not be more than 40 characters,
including spaces, and should be located at the bottom of the title page.
Word Count: A word count for the manuscript, excluding abstract,
acknowledgments, figure and table legends, and references, should be
provided and should not exceed 2500 words. The word count for the
abstract should not exceed 300 words.
Conflict of Interest Statement: To prevent potential conflicts of
interest from being overlooked, this statement must be included in each
manuscript. In case there are conflicts of interest, every author should
complete the ICMJE general declaration form, which can be obtained at
www.icmje.org/downloads/coi_disclosure.pdf.
Abstract and Keywords: The second page should include an abstract
that does not exceed 300 words. For manuscripts sent by authors in
Turkey, a title and abstract in Turkish are also required. As most readers
read the abstract first, it is critically important. Moreover, as various
electronic databases integrate only abstracts into their index, important
findings should be presented in the abstract.
Objective: The abstract should state the objective (the purpose of the
study and hypothesis) and summarize the rationale for the study.
Materials and Methods: Important methods should be written
respectively.
Results: Important findings and results should be provided here.
Conclusion: The study’s new and important findings should be
highlighted and interpreted.
Other types of manuscripts, such as reviews, brief reports, and
editorials, will be published according to uniform requirements.
Provide 3-10 keywords below the abstract to assist indexers. Use
terms from the Index Medicus Medical Subject Headings List
(for randomized studies a CONSORT abstract should be provided: http://
www.consort-statement.org).
Introduction: The introduction should include an overview of the
relevant literature presented in summary form (one page), and whatever
remains interesting, unique, problematic, relevant, or unknown about
the topic must be specified. The introduction should conclude with the
rationale for the study, its design, and its objective(s).
Materials and Methods: Clearly describe the selection of observational
or experimental participants, such as patients, laboratory animals, and
controls, including inclusion and exclusion criteria and a description of the
source population. Identify the methods and procedures in sufficient detail
to allow other researchers to reproduce your results. Provide references
to established methods (including statistical methods), provide references
to brief modified methods, and provide the rationale for using them and
an evaluation of their limitations. Identify all drugs and chemicals used,
including generic names, doses, and routes of administration. The section
should include only information that was available at the time the plan
or protocol for the study was devised (http://www.strobe-statement.org/
fileadmin/Strobe/uploads/checklists/STROBE_checklist_v4_combined.
pdf).
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
A-IV

the reported results. Statistically important data should be given in the
text, tables, and figures. Provide details about randomization, describe
treatment complications, provide the number of observations, and specify
all computer programs used.
Results: Present your results in logical sequence in the text, tables, and
figures. Do not present all the data provided in the tables and/or figures
in the text; emphasize and/or summarize only important findings, results,
and observations in the text. For clinical studies provide the number of
samples, cases, and controls included in the study. Discrepancies between
the planned number and obtained number of participants should be
explained. Comparisons and statistically important values (i.e. p-value
and confidence interval) should be provided.
Discussion: This section should include a discussion of the data. New and
important findings/results and the conclusions they lead to should be
emphasized. Link the conclusions with the goals of the study, but avoid
unqualified statements and conclusions not completely supported by
the data. Do not repeat the findings/results in detail; important findings/
results should be compared with those of similar studies in the literature,
along with a summarization. In other words, similarities or differences in
the obtained findings/results with those previously reported should be
discussed.
Study Limitations: Limitations of the study should be detailed. In
addition, an evaluation of the implications of the obtained findings/
results for future research should be outlined.
Conclusion: The conclusion of the study should be highlighted.
References
Cite references in the text, tables, and figures with numbers in square
brackets. Number references consecutively according to the order in
which they first appear in the text. Journal titles should be abbreviated
according to the style used in Index Medicus (consult List of Journals
Indexed in Index Medicus). Include among the references any paper
accepted, but not yet published, designating the journal followed by “in
press”.
Examples of References:
1. List all authors
Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow
transplantation from unrelated donors for patients with aplastic anemia
after failure of immunosuppressive therapy. Blood 2006;108:1485-1491.
2. Organization as author
Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of
syngeneic bone marrow graft without preconditioning in post-hepatitis
marrow aplasia. Lancet 1977;2:742-744.
3. Book
Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger,
1961.
4. Book Chapter
Perutz MF. Molecular anatomy and physiology of hemoglobin. In:
Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin:
Genetics, Pathophysiology, Clinical Management. New York, Cambridge
University Press, 2000.
5. Abstract
Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin)
stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).
6. Letter to the Editor
Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further
definition of 20q deletion in myeloid leukemia using fluorescence in situ
hybridization. Blood 1994;84:2821-2823.
7. Supplement
Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant
2005;9(Suppl 7):81-86.
Brief Reports
Abstract length: Not to exceed 150 words.
Article length: Not to exceed 1200 words.
Introduction: State the purpose and summarize the rationale for the study.
Materials and Methods: Clearly describe the selection of the observational
or experimental participants. Identify the methods and procedures in
sufficient detail. Provide references to established methods (including
statistical methods), provide references to brief modified methods, and
provide the rationale for their use and an evaluation of their limitations.
Identify all drugs and chemicals used, including generic names, doses, and
routes of administration.
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
the reported findings/results. Provide details about randomization,
describe treatment complications, provide the number of observations,
and specify all computer programs used.
Results: Present the findings/results in a logical sequence in the text,
tables, and figures. Do not repeat all the findings/results in the tables and
figures in the text; emphasize and/or summarize only those that are most
important.
Discussion: Highlight the new and important findings/results of the
study and the conclusions they lead to. Link the conclusions with the
goals of the study, but avoid unqualified statements and conclusions not
completely supported by your data.
Invited Review Articles
Abstract length: Not to exceed 300 words.
Article length: Not to exceed 4000 words.
Review articles should not include more than 100 references. Reviews
should include a conclusion, in which a new hypothesis or study about the
A-V

subject may be posited. Do not publish methods for literature search or
level of evidence. Authors who will prepare review articles should already
have published research articles on the relevant subject. The study’s new
and important findings should be highlighted and interpreted in the
Conclusion section. There should be a maximum of two authors for review
articles.
Images in Hematology
Article length: Not to exceed 200 words.
Authors can submit for consideration illustrations or photos that are
interesting, instructive, and visually attractive, along with a few lines of
explanatory text and references. Images in Hematology can include no
more than 200 words of text, 5 references, and 3 figures or tables. No
abstract, discussion, or conclusion is required, but please include a brief
title.
Letters to the Editor
Article length: Not to exceed 500 words.
Letters can include no more than 500 words of text, 5-10 references, and
1 figure or table. No abstract is required, but please include a brief title.
Tables
Supply each table in a separate file. Number tables according to the order
in which they appear in the text, and supply a brief caption for each.
Give each column a short or abbreviated heading. Write explanatory
statistical measures of variation, such as standard deviation or standard
error of mean. Be sure that each table is cited in the text.
Figures
Figures should be professionally drawn and/or photographed. Authors
should number figures according to the order in which they appear in the
text. Figures include graphs, charts, photographs, and illustrations. Each
figure should be accompanied by a legend that does not exceed 50 words.
Use abbreviations only if they have been introduced in the text. Authors
are also required to provide the level of magnification for histological
slides. Explain the internal scale and identify the staining method used.
Figures should be submitted as separate files, not in the text file. Highresolution
image files are not preferred for initial submission as the file
sizes may be too large. The total file size of the PDF for peer review should
not exceed 5 MB.
Authorship
Each author should have participated sufficiently in the work to assume
public responsibility for the content. Any portion of a manuscript that
is critical to its main conclusions must be the responsibility of at least
one author.
Contributor’s Statement
All submissions should contain a contributor’s statement page. Each
statement should contain substantial contributions to idea and design,
acquisition of data, and analysis and interpretation of findings. All
persons designated as an author should qualify for authorship, and all
those that qualify should be listed. Each author should have participated
sufficiently in the work to take responsibility for appropriate portions of
the text.
Acknowledgments
Acknowledge support received from individuals, organizations, grants,
corporations, and any other source. For work involving a biomedical
product or potential product partially or wholly supported by corporate
funding, a note stating, “This study was financially supported (in part)
with funds provided by (company name) to (authors’ initials)”, must
be included. Grant support, if received, needs to be stated and the
specific granting institutions’ names and grant numbers provided when
applicable.
Authors are expected to disclose on the title page any commercial or
other associations that might pose a conflict of interest in connection
with the submitted manuscript. All funding sources that supported the
work and the institutional and/or corporate affiliations of the authors
should be acknowledged on the title page.
Ethics
When reporting experiments conducted with humans indicate that
the procedures were in accordance with ethical standards set forth
by the committee that oversees human subject research. Approval of
research protocols by the relevant ethics committee, in accordance
with international agreements (Helsinki Declaration of 1975, revised
2002 available at http://www.wma.net/en/30publications/10policies/b3/;
“Guide for the Care and Use of Laboratory Animals” available at www.
nap.edu/catalog/5140.html/), is required for all experimental, clinical, and
drug studies. Patient names, initials, and hospital identification numbers
should not be used. Manuscripts reporting the results of experimental
investigations conducted with humans must state that the study protocol
received institutional review board approval and that the participants
provided informed consent.
Non-compliance with scientific accuracy is not in accord with scientific
ethics. Plagiarism: To re-publish, in whole or in part, the contents of
another author’s publication as one’s own without providing a reference.
Fabrication: To publish data and findings/results that do not exist.
Duplication: Use of data from another publication, which includes republishing
a manuscript in different languages. Salami slicing: To create
more than one publication by dividing the results of a study unnecessarily.
We disapprove of such unethical practices as plagiarism, fabrication,
duplication, and salami slicing, as well as efforts to influence the
review process with such practices as gifting authorship, inappropriate
acknowledgments, and references. Additionally, authors must respect
participants‘ right to privacy.
On the other hand, short abstracts published in congress books that do
not exceed 400 words and present data of preliminary research, and
A-VI

those that are presented in an electronic environment, are not considered
as previously published work. Authors in such a situation must declare
this status on the first page of the manuscript and in the cover letter.
(The COPE flowchart is available at http://publicationethics.org.)
We use iThenticate to screen all submissions for plagiarism before
publication.
Conditions of Publication
All authors are required to affirm the following statements before their
manuscript is considered: 1. The manuscript is being submitted only
to The Turkish Journal of Hematology; 2. The manuscript will not be
submitted elsewhere while under consideration by The Turkish Journal
of Hematology; 3. The manuscript has not been published elsewhere,
and should it be published in The Turkish Journal of Hematology it will
not be published elsewhere without the permission of the editors (these
restrictions do not apply to abstracts or to press reports for presentations
at scientific meetings); 4. All authors are responsible for the manuscript’s
content; 5. All authors participated in the study concept and design,
analysis and interpretation of the data, and drafting or revising of the
manuscript and have approved the manuscript as submitted. In addition,
all authors are required to disclose any professional affiliation, financial
agreement, or other involvement with any company whose product
figures prominently in the submitted manuscript.
Authors of accepted manuscripts will receive electronic page proofs and
are responsible for proofreading and checking the entire article within
two days. Failure to return the proof in two days will delay publication. If
the authors cannot be reached by email or telephone within two weeks,
the manuscript will be rejected and will not be published in the journal.
Copyright
At the time of submission all authors will receive instructions for
submitting an online copyright form. No manuscript will be considered
for review until all authors have completed their copyright form. Please
note, it is our practice not to accept copyright forms via fax, e-mail, or
postal service unless there is a problem with the online author accounts
that cannot be resolved. Every effort should be made to use the online
copyright system. Corresponding authors can log in to the submission
system at any time to check the status of any co-author’s copyright form.
All accepted manuscripts become the permanent property of The Turkish
Journal of Hematology and may not be published elsewhere, in whole or
in part, without written permission.
Note: We cannot accept any copyright form that has been altered,
revised, amended, or otherwise changed. Our original copyright form
must be used as is.
Units of Measurement
Measurements should be reported using the metric system, according
to the International System of Units (SI). Consult the SI Unit Conversion
Guide, New England Journal of Medicine Books, 1992.
An extensive list of conversion factors can be found at https://www.unc.
edu/~rowlett/units/. For more details, see http://www.amamanualofstyle.
com/oso/public/jama/si_conversion_table.html.
Abbreviations and Symbols
Use only standard abbreviations. Avoid abbreviations in the title and
abstract. The full term for an abbreviation should precede its first use
in the text, unless it is a standard abbreviation. All acronyms used in the
text should be expanded at first mention, followed by the abbreviation
in parentheses; thereafter the acronym only should appear in the text.
Acronyms may be used in the abstract if they occur 3 or more times
therein, but must be reintroduced in the body of the text. Generally,
abbreviations should be limited to those defined in the AMA Manual of
Style, current edition. A list of each abbreviation (and the corresponding
full term) used in the manuscript must be provided on the title page.
Online Manuscript Submission Process
The Turkish Journal of Hematology uses submission software powered
by ScholarOne Manuscripts. The website for submissions to The Turkish
Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This
system is quick and convenient, both for authors and reviewers.
Setting Up an Account
New users to the submission site will need to register and enter their
account details before they can submit a manuscript. Log in, or click
the “Create Account” button if you are a first-time user. To create a
new account: After clicking the “Create Account” button, enter your
name and e-mail address, and then click the “Next” button. Your e-mail
address is very important. Enter your institution and address information,
as appropriate, and then click the “Next” Button. Enter a user ID and
password of your choice, select your area of expertise, and then click the
“Finish” button.
If you have an account, but have forgotten your log-in details, go to
“Password Help” on the journal’s online submission system and enter your
e-mail address. The system will send you an automatic user ID and a new
temporary password.
Full instructions and support are available on the site, and a user ID
and password can be obtained during your first visit. Full support for
authors is provided. Each page has a “Get Help Now” icon that connects
directly to the online support system. Contact the journal administrator
with any questions about submitting your manuscript to the journal
(info@tjh.com.tr). For ScholarOne Manuscripts customer support, click
on the “Get Help Now” link on the top right-hand corner of every page
on the site.
The Electronic Submission Process
Log in to your author center. Once you have logged in, click the “Submit a
Manuscript” link in the menu bar. Enter the appropriate data and answer
the questions. You may copy and paste directly from your manuscript.
A-VII

Click the “Next” button on each screen to save your work and advance
to the next screen.
Upload Files
Click on the “Browse” button and locate the file on your computer. Select
the appropriate designation for each file in the drop-down menu next to
the “Browse” button. When you have selected all the files you want to
upload, click the “Upload Files” button. Review your submission before
sending to the journal. Click the “Submit” button when you are finished
reviewing. You can use ScholarOne Manuscripts at any time to check
the status of your submission. The journal’s editorial office will inform
you by e-mail once a decision has been made. After your manuscript
has been submitted, a checklist will then be completed by the Editorial
Assistant. The Editorial Assistant will check that the manuscript contains
all required components and adheres to the author guidelines. Once the
Editorial Assistant is satisfied with the manuscript it will be forwarded to
the Senior Editor, who will assign an editor and reviewers.
The Review Processs
Each manuscript submitted to The Turkish Journal of Hematology is
subject to an initial review by the editorial office in order to determine
if it is aligned with the journal’s aims and scope and complies with
essential requirements. Manuscripts sent for peer review will be assigned
to one of the journal’s associate editors that has expertise relevant to the
manuscript’s content. All accepted manuscripts are sent to a statistical
and English language editor before publishing. Once papers have been
reviewed, the reviewers’ comments are sent to the Editor, who will then
make a preliminary decision on the paper. At this stage, based on the
feedback from reviewers, manuscripts can be accepted or rejected, or
revisions can be recommended. Following initial peer-review, articles
judged worthy of further consideration often require revision. Revised
manuscripts generally must be received within 3 months of the date of
the initial decision. Extensions must be requested from the Associate
Editor at least 2 weeks before the 3-month revision deadline expires;
The Turkish Journal of Hematology will reject manuscripts that are not
received within the 3-month revision deadline. Manuscripts with extensive
revision recommendations will be sent for further review (usually by the
same reviewers) upon their re-submission. When a manuscript is finally
accepted for publication, the Technical Editor undertakes a final edit
and a marked-up copy will be e-mailed to the corresponding author for
review and any final adjustments.
Submission of Revised Papers
When revising a manuscript based on the reviewers’ and Editor’s feedback,
please insert all changed text in red. Please do not use track changes, as
this feature can make reading difficult. To submit revised manuscripts,
please log in to your author center at ScholarOne Manuscripts. Your
manuscript will be stored under “Manuscripts with Decisions”. Please click
on the “Create a Revision” link located to the right of the manuscript title.
A revised manuscript number will be created for you; you will then need
to click on the “Continue Submission” button. You will then be guided
through a submission process very similar to that for new manuscripts.
You will be able to amend any details you wish. At stage 6 (“File Upload”),
please delete the file for your original manuscript and upload the revised
version. Additionally, please upload an anonymous cover letter, preferably
in table format, including a point-by-point response to the reviews’
revision recommendations. You will then need to review your paper as
a PDF and click the “Submit” button. Your revised manuscript will have
the same ID number as the original version, but with the addition of an R
and a number at the end, for example, TJH-2011-0001 for an original and
TJH-2011-0001.R1, indicating a first revision; subsequent revisions will
end with R2, R3, and so on. Please do not submit a revised manuscript
as a new paper, as revised manuscripts are processed differently. If you
click on the “Create a Revision” button and receive a message stating that
the revision option has expired, please contact the Editorial Assistant at
info@tjh.com.tr to reactivate the option.
English Language Editing
All manuscripts are professionally edited by an English language editor
prior to publication.
Online Early
The Turkish Journal of Hematology publishes abstracts of accepted
manuscripts online in advance of their publication in print. Once an
accepted manuscript has been edited, the authors have submitted any
final corrections, and all changes have been incorporated, the manuscript
will be published online. At that time the manuscript will receive a Digital
Object Identifier (DOI) number. Both forms can be found at www.tjh.
com.tr. Authors of accepted manuscripts will receive electronic page
proofs directly from the printer and are responsible for proofreading
and checking the entire manuscript, including tables, figures, and
references. Page proofs must be returned within 48 hours to avoid delays
in publication.
A-VIII

CONTENTS
Review
1 Current Review of Iron Overload and Related Complications in Hematopoietic Stem Cell Transplantation
Erden Atilla, Selami K. Toprak, Taner Demirer
Research Articles
10 Changing Treatment May Affect the Predictive Ability of European Treatment Outcome Study Scoring for the Prognosis of Patients with
Chronic Myeloid Leukemia
Jing Huang, Leyan Wang, Lu Chen, He Qun, Xu Yajing, Chen Fangping, Zhao Xielan
16 Allogeneic Transplantation in Chronic Myeloid Leukemia and the Effect of Tyrosine Kinase Inhibitors on Survival:
A Quasi-Experimental Study
Mehmet Özen, Celalettin Üstün, Bengi Öztürk, Pervin Topçuoğlu, Mutlu Arat, Mehmet Gündüz, Erden Atilla, Gülşen Bolat,
Önder Arslan, Taner Demirer, Hamdi Akan, Osman İlhan, Meral Beksaç, Günhan Gürman, Muhit Özcan
27 Multicenter Retrospective Analysis of Turkish Patients with Chronic Myeloproliferative Neoplasms
Nur Soyer, İbrahim C. Haznedaroğlu, Melda Cömert, Demet Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir,
Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural, Güray Saydam
34 TP53 Staining in Tissue Samples of Chronic Lymphocytic Lymphoma Cases: An Immunohistochemical Survey of 51 Cases
İbrahim Kulaç, Çetin Demir, Yahya Büyükaşık, Tezer Kutluk, Ayşegül Üner
40 Evaluation of Endocrine Late Complications in Childhood Acute Lymphoblastic Leukemia Survivors: A Report of a Single-Center
Experience and Review of the Literature
Cengiz Bayram, Neşe Yaralı, Ali Fettah, Fatma Demirel, Betül Tavil, Abdurrahman Kara, Bahattin Tunç
46 FLAG Regimen with or without Idarubicin in Children with Relapsed/Refractory Acute Leukemia: Experience from a Turkish Pediatric
Hematology Center
Şebnem Yılmaz Bengoa, Eda Ataseven, Deniz Kızmazoğlu, Fatma Demir Yenigürbüz, Melek Erdem, Hale Ören
52 Red Blood Cell Transfusions in Greece: Results of a Survey of Red Blood Cell Use in 2013
Serena Valsami, Elisavet Grouzi, Abraham Pouliakis, Leontini Fountoulaki-Paparisos, Elias Kyriakou, Maria Gavalaki,
Elias Markopoulos, Ekaterini Kontopanou, Ioannis Tsolakis, Argyrios Tsantes, Alexandra Tsoka, Anastasia Livada, Vassiliki Rekari,
Niki Vgontza, Dimitra Agoritsa, Marianna Politou, Stavros Nousis, Aspasia Argyrou, Ekaterini Manaka, Maria Baka,
Maria Mouratidou, Stavroula Tsitlakidou, Konstantinos Malekas, Dimitrios Maltezos, Paraskevi Papadopoulou, Vassiliki Pournara,
Ageliki Tirogala, Emmanouil Lysikatos, Sousanna Pefani, Konstantinos Stamoulis
59 The Clinical Significance of Schistocytes: A Prospective Evaluation of the International Council for Standardization in Hematology
Schistocyte Guidelines
Elise Schapkaitz, Michael Halefom Mezgebe
64 Generation of Platelet Microparticles after Cryopreservation of Apheresis Platelet Concentrates Contributes to Hemostatic Activity
İbrahim Eker, Soner Yılmaz, Rıza Aytaç Çetinkaya, Aysel Pekel, Aytekin Ünlü, Orhan Gürsel, Sebahattin Yılmaz, Ferit Avcu,
Uğur Muşabak, Ahmet Pekoğlu, Zerrin Ertaş, Cengizhan Açıkel, Nazif Zeybek, Ahmet Emin Kürekçi, İsmail Yaşar Avcı
72 Rituximab Therapy in Adults with Refractory Symptomatic Immune Thrombocytopenia: Long-Term Follow-Up of 15 Cases
Fehmi Hindilerden, İpek Yönal-Hindilerden, Mustafa Nuri Yenerel, Meliha Nalçacı, Reyhan Diz-Küçükkaya
81 Discrepancies in Lymphoma Diagnosis Over the Years: A 13-Year Experience in a Tertiary Center
Neval Özkaya, Nuray Başsüllü, Ahu Senem Demiröz, Nükhet Tüzüner
A-IX

89 Hypogammaglobulinemia and Poor Performance Status are Predisposing Factors for Vancomycin-Resistant Enterococcus
Colonization in Patients with Hematological Malignancies
Elif Gülsüm Ümit, Figen Kuloğlu, Ahmet Muzaffer Demir
93 Antibacterial Activities of Ankaferd Hemostat (ABS) on Shiga Toxin-Producing Escherichia coli and Other Pathogens Significant in
Foodborne Diseases
Ahmet Koluman, Nejat Akar, İbrahim C. Haznedaroğlu
Letters to the Editor
99 Wernicke’s Encephalopathy in a Child with Acute Lymphoblastic Leukemia
Hande Kızılocak, Gül Nihal Özdemir, Gürcan Dikme, Zehra Işık Haşıloğlu, Tiraje Celkan
100 Comment: In Response to “Megaloblastic Anemia with Ring Sideroblasts is not Always Myelodysplastic Syndrome”
Smeeta Gajendra
101 Therapeutic International Normalized Ratio Monitoring
Beuy Joob, Viroj Wiwanitkit
102 Iron Overload in Hematopoietic Stem Cell Transplantation
Sora Yasri, Viroj Wiwanitkit
103 Sole Infrequent Karyotypic Aberration Trisomy 6 in a Patient with Acute Myeloid Leukemia and Breast Cancer in Remission
Mürüvvet Seda Aydın, Süreyya Bozkurt, Gürsel Güneş, Ümit Yavuz Malkan, Tuncay Aslan, Sezgin Etgül, Yahya Büyükaşık,
İbrahim Celalettin Haznedaroğlu, Nilgün Sayınalp, Hakan Göker, Haluk Demiroğlu, Osman İlhami Özcebe, Salih Aksu
105 Premarital Genetic Diagnosis Revealed Co-heredity Nature of Beta Globin Gene 25-26 del AA and 3’UTR+101 G-C Variants in Two Beta
Thalassemia Heterozygotes
Kanay Yararbaş, Yasemin Ardıçoğlu, Nejat Akar
107 Acute Myocardial Infarction Due to Eltrombopag Therapy in a Patient with Immune Thrombocytopenic Purpura
Sena Sert, Hasan Özdil, Murat Sünbül
109 Candida-Related Immune Response Inflammatory Syndrome Treated with Adjuvant Corticosteroids and Review of the Pediatric Literature
Dildar Bahar Genç, Sema Vural, Nafiye Urgancı, Tuğçe Kurtaraner, Nazan Dalgıç
111 Posttranslational Modifications of Red Blood Cell Ghost Proteins as “Signatures” for Distinguishing between Low- and High-Risk
Myelodysplastic Syndrome Patients
Klara Pecankova, Pavel Majek, Jaroslav Cermak, Jan E. Dyr
113 Intradiploic Hematoma in a Hemophilic Patient: Hemophilic Pseudotumor of Calvarium
Hakan Hanımoğlu, Zafer Başlar
114 The Second and Third Hemoglobin Kansas Cases in the Turkish Population
Zeynep Kayra Tanrıverdi, Arzu Akyay, Aşkın Şen, Çağatay Taşkapan, Ünsal Özgen
116 Leukocytoclastic Vasculitis Associated with a New Anticoagulant: Rivaroxaban
Nuri Barış Hasbal, Taner Baştürk, Yener Koç, Tuncay Sahutoğlu, Feyza Bayrakdar Çağlayan, Abdülkadir Ünsal
Images in Hematology
118 Bullous Sweet’s Syndrome: Report of an Atypical Case Presenting with Ring-Like, Figurate Lesions
Andaç Salman, Aida Berenjian, Ali Eser, Fatma Dilek Kaymakçı, Leyla Cinel, Işık Kaygusuz Atagündüz, Deniz Yücelten, Tülin Ergun
120 Griscelli Syndrome Presented with Status Epilepticus and Hemophagocytic Lymphohistiocytosis
Fatih Demircioğlu, Hilal Aydın, Mustafa Erkoçoğlu, Hüseyin Önay, Emine Dağıstan
122 Acute Monoblastic Leukemia Presenting with Multiple Granulocytic Sarcoma Nodules
Asude Kara, Aslı Akın Belli, Yelda Dere, Volkan Karakuş, Şükrü Kasap, Erdal Kurtoğlu, Mine Hekimgil
124 Internuclear Bridging of Erythroid Precursors in the Peripheral Blood Smear of a Patient with Primary Myelofibrosis
Roger K. Schindhelm, Marije M. van Santen, Arie C. van der Spek
A-X

REVIEW
DOI: 10.4274/tjh.2016.0450
Turk J Hematol 2017;34:1-9
Current Review of Iron Overload and Related Complications in
Hematopoietic Stem Cell Transplantation
Güncel Derleme: Hematopoietik Kök Hücre Naklinde Demir Yüklenmesi ve İlişkili Komplikasyonlar
Erden Atilla, Selami K. Toprak, Taner Demirer
Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey
Abstract
Iron overload is an adverse prognostic factor for patients undergoing
hematopoietic stem cell transplantation (HSCT). In the HSCT setting,
pretransplant and early posttransplant ferritin and transferrin
saturation were found to be highly elevated due to high transfusion
requirements. In addition to that, post-HSCT iron overload was shown
to be related to infections, hepatic sinusoidal obstruction syndrome,
mucositis, liver dysfunction, and acute graft-versus-host disease.
Hyperferritinemia causes decreased survival rates in both pre- and
posttransplant settings. Serum ferritin levels, magnetic resonance
imaging, and liver biopsy are diagnostic tools for iron overload. Organ
dysfunction due to iron overload may cause high mortality rates and
therefore sufficient iron chelation therapy is recommended in this
setting. In this review the management of iron overload in adult HSCT
is discussed.
Keywords: Iron overload, Hematopoietic stem cell transplantation,
Ferritin, Iron chelation
Öz
Demir yüklenmesi, hematopoietik kök hücre nakli (HKHN) yapılan
hastalarda görülen olumsuz prognostik göstergedir. Pretransplant
ve erken posttransplant ferritin ve transferrin satürasyonlarının
yüksekliği, transfüzyon ihtiyacına bağlıdır. Posttransplant demir
yüklenmesi; enfeksiyonlar, hepatik sinüzoidal obstrüksiyon sendromu,
mukozit, karaciğer disfonksiyonu ve akut graft versus host hastalığı
ile ilişkili olarak bulunmuştur. Hiperferritinemi, pre ve posttransplant
sağkalım oranlarında düşüklüğe neden olur. Demir yüklenmesinin
tanısında serum ferritin düzeyleri, magnetik rezonans görüntüleme
ve karaciğer biyopsisi kullanılır. Demir yüklenmesine bağlı organ
disfonksiyonu yüksek mortalite oranlarıyla ilişkilidir ve bu durumda
yeterli demir şelasyon tedavisi önerilmektedir. Bu derlemede erişkin
HKHN’de demir yüklenmesine yaklaşım tartışılmıştır.
Anahtar Sözcükler: Demir yüklenmesi, Hematopoietik kök hücre
nakli, Ferritin, Demir şelasyonu
Introduction
Hematopoietic stem cell transplantation (HSCT) is an established
treatment approach in a variety of hematological disorders
but is still complicated with excessive mortality and morbidity
despite advances in conditioning regimens and infectious
disease management [1,2,3,4,5]. Today high-dose therapy and
auto-HSCT is a treatment option in selected hematopoietic and
nonhematopoietic tumors [4]. The common early complications
include infections and mucositis [5]. Allo-HSCT is recommended
in congenital or acquired bone marrow failures and
hematological malignancies. Sinusoidal obstruction syndrome
(SOS), hemorrhagic cystitis, engraftment failure, idiopathic
pneumonia syndrome, infection, and graft-versus-host disease
(GVHD) are major causes of morbidity and non-relapse mortality
(NRM) [6]. Late complications of HSCT mainly involve skin,
oral mucosa, ocular, gastrointestinal, pulmonary, endocrine,
metabolic, infectious, renal, neurological, psychosocial, and
cardiovascular systems, as well as secondary malignancies [6,7].
Iron overload is a common condition in patients with
hematological malignancies and HSCT recipients. The incidence
of iron overload in auto-HSCT is around 34%, less frequent
than in allo-HSCT [8]. In the allo-HSCT setting, the incidence
of iron overload varies between 30% and 60% [9,10]. Sucak et
al. retrospectively investigated 24 liver biopsies for evaluation
of the cause of liver dysfunction after allo-HSCT. Iron overload
was detected in a total of 75% of these liver biopsy samples and
as a sole histopathologic abnormality in 33% of recipients [11].
The main factor in the high incidence of iron overload in both
transplants is exposure to red blood cell (RBC) transfusions both
during initial treatment and in the posttransplant period [10].
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Taner DEMİRER, M.D.,
Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey
Phone : +90 532 325 10 65
E-mail : demirer@medicine.ankara.edu.tr
Received/Geliş tarihi: November 19, 2016
Accepted/Kabul tarihi: December 08, 2016
1

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation
Turk J Hematol 2017;34:1-9
This review will focus on normal iron hemostasis and
mechanisms of iron overload in HSCT recipients and the effects
and management of excess iron in the setting of HSCT.
Iron Homeostasis and the Mechanisms of Iron
Overload
Iron is an essential element for many enzymatic functions and
hemoglobin synthesis. There are four major cell types determining
the iron content and distribution: duodenal enterocytes,
erythroid precursors, reticuloendothelial macrophages, and
hepatocytes. The iron cycle in the body starts with duodenal
enterocyte absorption of 1 to 2 mg of iron per day. Iron binds
to transferrin and is taken up by erythroid precursors for heme
synthesis. Reticuloendothelial macrophages clear erythrocytes
and release the iron from heme in order to export it to the
circulation and store it in the form of ferritin. Hepatocytes are
the major cells for iron storage as ferritin and the production
of the peptide hormone hepcidin. However, in the state of an
excess of iron, reactive oxygen species (ROS) affect the functions
of organs such as the liver, heart, and endocrine glands [12]. In
patients receiving regular transfusions, tissue iron deposition
can begin within 1-2 years; however, clinically evident cardiac
or hepatic dysfunction may not occur for 10 years or more [10].
Excess iron is also associated with the prooxidant effects that
contribute to DNA damage and the promotion of oncogenesis.
There are many ongoing studies related to erythroid regulators
of iron homeostasis. Hepcidin is the main regulator of iron
absorption and tissue distribution that controls iron in
the plasma by absorption of dietary iron in the intestines,
recycling of iron by macrophages, and mobilization from
hepatocyte storage. Hepcidin promotes the degradation of
ferroportin, leading to retention of iron in iron-exporting cells
and decreased flow of iron into the plasma [13]. In inherited
anemias with ineffective erythropoiesis, beta-thalassemia, and
congenital dyserythropoietic anemia, pathological suppression
of hepcidin synthesis and hyperabsorption of dietary iron occurs
[14]. In thalassemia, twisted-gastrulation 1 was proposed as
pathological suppressors of hepcidin [15]; however, its role was
not defined. Kautz et al. [16] reported a new erythroid regulator,
which is essential for early suppression of hepcidin after
erythropoietic stimulation and named “erythroferrone” (ERFE).
If it is confirmed in clinical studies, ERFE neutralization could
be a new treatment strategy in iron overload in iron-loading
anemias.
Several clinical reports showed that iron chelation therapy
improved hematopoiesis in iron-overloaded patients with
myelodysplastic syndrome (MDS) [17,18]. Recently, for
investigating the impact of iron deposition on hematopoiesis,
researchers initiated studies in vivo. Okabe et al. examined
iron-overloaded mice and hematopoietic parameters as well
as the bone marrow microenvironment. They showed that
hematopoietic parameters of the peripheral blood did not
change; however, myeloid progenitor cells in the bone marrow
were increased. The number and the function of erythroid
progenitors remained the same. Bone marrow transplantation
to iron-overloaded mice resulted in delayed hematopoietic
reconstitution. The levels of erythropoietin and thrombopoietin
were significantly low in iron-overloaded mice compared
to the normal group. The authors concluded that excess iron
disrupts the hematopoietic microenvironment [19]. Zhang
et al. evaluated the effect of iron overload on the bone
marrow microenvironment in mice and found that chemokine
stromal cell-derived factor-1, stem cell factor-1, and vascular
endothelial growth factor-1 expressions were decreased. The
decreased hematopoietic functions were influenced by elevated
phosphatidylinositol 3 kinase and reduced forkhead box protein
mRNA expression, which could induce generation of ROS. These
data showed that iron overload could impair the bone marrow
microenvironment [20]. Chai et al. showed that iron overload
markedly decreased the ratio and clonogenic function of
murine hematopoietic stem and progenitor cells by elevation
of ROS [21].
Iron Overload and Related Complications in
Hematopoietic Stem Cell Transplantation
Iron overload is a prominent problem in HSCT recipients. HSCT
recipients receive large RBC transfusions both during the
pre- and peritransplant periods. In addition to that prolonged
dyserythropoiesis, increased intestinal iron absorption due
to chemotherapy-associated mucositis and release of iron
from damaged tissues raise iron to undesired levels [10].
Chemotherapy and radiotherapy-associated hepatic damage
may also contribute to the release of iron stores and diminish
transferrin synthesis [22,23]. In an autologous HSCT mice model,
iron overload was detected to be associated with increased
melphalan and busulfan toxicities through a pharmacodynamic
interaction [24]. In a recent study, the interacting effects of
total body irradiation and cell transplantation on the expression
of iron regulatory genes had contributed to iron overload in
murine recipients [25].
Armand et al. [26] retrospectively analyzed the impact of elevated
pretransplant serum ferritin levels in 590 patients undergoing
myeloablative stem cell transplantation. In that analysis, a
strong relationship was detected between pretransplant ferritin
levels and survival rates. The 5-year overall survival (OS) for
patients with pretransplant ferritin levels in the first quartile
(0-231 ng/mL) was 54% (95% confidence interval [CI], 45%-
63%); in the second quartile (232-930 ng/mL), it was 50% (95%
CI, 41%-59%); in the third quartile (931-2034 ng/mL), it was
37% (95% CI, 27%-46%); and in the fourth quartile (>2034
ng/mL), it was 27% (95% CI, 18%-36%) (p

Turk J Hematol 2017;34:1-9
Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation
disease-free survival rates, from the lowest to highest quartile,
were 43% (95% CI, 33%-53%), 44% (95% CI, 35%-54%), 34%
(95% CI, 24%-43%), and 27% (95% CI, 19%-36%) (p399 ng/mL) showed a lower 4-year OS (HR,
1.8; CI, 1.2-2.8; p=0.008) and higher NRM (HR, 1.8; CI, 1.1-3.2;
p=0.03) than those without hyperferritinemia [27]. Mahindra
et al. studied hyperferritinemia in an autologous HSCT setting
in 315 patients with Hodgkin or non-Hodgkin lymphoma. In
multivariate analysis, a pretransplant ferritin level of >685 ng/
mL was associated with significantly lower OS (p=0.002) and
relapse-free survival (p=0.021) but increased risk of relapse
(p=0.005) and relapse-related mortality (p

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation
Turk J Hematol 2017;34:1-9
of at least 2 of the following features: hyperbilirubinemia,
painful hepatomegaly, and weight gain [45]. SOS was diagnosed
in 88 patients (21%) at a median of 10 days (range, 2-29 days)
in 427 HSCT recipients. Pretransplant serum ferritin level higher
than 1000 ng/dL (OR, 1.78; 95% CI, 1.02-3.08) was found to be
a risk factor for SOS [46]. This finding was also confirmed by
a prospective cohort study of 180 patients receiving HSCT by
Morado et al. [34].
Data for determining the role of iron overload in the
pathogenesis of GVHD are conflicting and should be confirmed
by further studies. Pullarkat et al. evaluated the effect of
pretransplant ferritin levels on acute GVHD in a prospective
cohort study of 190 allo-HSCT patients. Acute GVHD was more
common in patients with high ferritin levels (>1000 ng/mL).
The initiating event of pathogenesis was defined as the antigen
exposition following increased ROS-mediated tissue injury [35].
However, Mahindra et al. demonstrated the decreased incidence
of chronic GVHD associated with pretransplant ferritin levels
of >1910 µg/L in 222 patients who underwent myeloablative
allo-HSCT [47]. In another study of 264 patients with allo-HSCT,
there was no relation detected between serum ferritin levels and
acute/chronic GVHD [46]. In fact, elevated pretransplant ferritin
levels of >400 µg/L were associated with a lower risk of chronic
GVHD (HR, 0.51; 95% CI, 0.33-0.79; p=0.003) in 309 allo-HSCT
recipients. The authors hypothesized that ferritin might show
an immunosuppressive effect and thus reduce the incidence of
GVHD following HSCT [48].
It should be kept in mind that, although advances in supportive
care and techniques have improved the survival of HSCT
recipients [49,50,51,52], iron overload is still a challenging
issue and may be associated with liver fibrosis, heart failure,
hypogonadism, diabetes, and an endocrinopathy known as
“bronze diabetes” in HSCT recipients as long-term complications
[53].
Diagnosis of Iron Overload
The European Group for Blood and Marrow Transplantation,
Center for International Blood and Marrow Transplant Research,
and American Society of Blood and Marrow Transplantation
(ASBMT) guidelines promoted screening of serum ferritin levels
in the post-HSCT period for determining the risk of iron overload
[54]. In the 2012 ASBMT guidelines, ferritin measurement is
recommended in patients who received transfusions in the
pre- and posttransplant settings. Generally, the threshold for
serum ferritin level is accepted as 1000 µg/L for detection of
iron overload [55]. It is recommended in these guidelines that
patients with high liver function tests, high transfusion needs,
or hepatitis C infection should be monitored subsequently until
ferritin levels are below 500 ng/mL [53].
Ferritin level continues to be the mainstay for the clinical
evaluation of iron overload and macrophages and T cells
are the main sources of ferritin. Both over transfusion and
inflammatory reactions may accompany high ferritin levels.
In addition to inflammation, ineffective erythropoiesis and
liver disease can also be associated with high ferritin levels
[13,56]. Researchers hypothesized whether highly increased
ferritin concentrations might be related to GVHD-associated
inflammation in pediatric patients, but they concluded that
ferritin could not be a biomarker of chronic or acute GVHD [57].
In fact, serum ferritin levels appeared to have a poor correlation
with liver iron concentration (LIC) in pediatric patients with
thalassemia and sickle cell disease [58]. There was a modest
correlation (p=0.47) detected by Majhail et al. between serum
ferritin and LIC by MRI in allo-HSCT recipients. They indicated
that ferritin can be a good screening test but a poor predictor
of tissue iron overload and they recommended estimation of
LIC before initiating chelation therapy [9]. It was reported that
ferritin, in combination with transferrin saturation, has superior
prognostic value in determining iron overload when compared
to ferritin alone [53].
An alternative marker for determining iron overload is
nontransferrin-bound iron (NTBI), which is a low-molecularweight
form of iron. NTBI is formed when transferrin becomes
saturated and unable to bind excess iron [59]. There are studies
conducted that showed that the level of NTBI was significantly
increased in iron overload and might be used to assess the
efficacy of chelation in patients with beta-thalassemia major
[60]. However, Goto et al. studied the prevalence of iron
overload in adult allo-HSCT patients by serum ferritin and NTBI
and stated that ferritin was well correlated with NTBI but NTBI
was found to be a weaker marker than ferritin in terms of iron
overload outcomes. The major issue for this finding was that
NTBI only refers to iron in the plasma binding to ligands other
than transferrin. Ferritin was confirmed to be correlated with
the number of packed RBCs received in patients without active
infection, relapse, or second malignancy [61].
Liver biopsy is the gold standard in evaluating iron overload.
LIC exceeding 80 µmol/g of liver dry weight is consistent with
iron overload with a hepatic index greater than 1.9 mmol/kg/
year [55]. The hepatic iron index is the ratio of hepatic iron
concentration to the age of the patient in years. Even though
liver biopsy can exclude an alternative diagnosis of hepatic
dysfunction such as GVHD and infections, the use is limited in
HSCT patients because the procedure is invasive and patients
usually have low platelet counts.
LIC measurement by MRI has gained importance since it is
noninvasive, rapid, and widely available. Today MRI techniques
T2 and R2 are reported to have sensitivity and specificity of 89%
and 80% in determination of LIC, respectively [62,63]. Ferritin
4

Turk J Hematol 2017;34:1-9
Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation
levels of more than 1000 ng/mL were found to be correlated
with LIC of >7 mg/g in HSCT survivors [10].
The superconducting quantum interference device (SQUID)
can assess total body iron with biomagnetic susceptometry by
detecting the paramagnetic materials ferritin and hemosiderin.
Although it is the reference standard for estimation of LIC, the
technique is complex, expensive, and very limited [64]. Busca
et al. showed that LIC measurements obtained by SQUID in
the presence of moderate (LIC 1000-2000 µg Fe/g wet weight)
or severe (LIC >2000 µg Fe/g wet weight) iron overload were
associated with high ferritin levels in 69% of patients [62].
Commonly used diagnostic methods for determining iron
overload are summarized in Table 2 [10].
Management of Iron Overload
There is no consensus in the literature on when or how to treat
iron overload in HSCT settings. Management of iron overload
should be individualized based on several factors such as the
need for ongoing RBC transfusion therapy, ability to tolerate
iron-depleting therapy, cost-effectiveness, or urgency to reduce
body iron stores. Therapy may not be needed in mild cases of
iron overload; avoidance of alcohol and iron supplements can
be recommended [65]. Phlebotomy and iron chelation agents
are two treatment approaches for protecting recipients from
long-term end-organ toxicities. As a recommendation, patients
with LIC of >15 mg/g dry weight should be treated aggressively
with both phlebotomy and chelation; when LIC is 7-15 mg/g
dry weight, phlebotomy is indicated; and when LIC is under 7
mg/g dry weight treatment is only indicated if there is evidence
of liver disease [53].
In adult survivors of allo-HSCT, unlike large pediatric cohorts,
case series were reported regarding the safety and feasibility
of phlebotomy [63,64]. In a routine phlebotomy program,
approximately 250 mg of iron is removed once or twice weekly
[54]. Although phlebotomy has the advantage of better
compliance, fewer side effects, and lower costs, the efficacy is
limited [53]. Phlebotomy did not have a statistically significant
effect on the reduction of ferritin levels before chelation
treatment compared with ferritin levels after chelation
treatment in a small cohort of patients after allo-HSCT [66].
Phlebotomies were repeated every 1-2 weeks until a serum
ferritin level of

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation
Turk J Hematol 2017;34:1-9
and effective with or without phlebotomy in the posttransplant
setting [66]. Majhail et al. included only patients with ferritin
levels of >1000 ng/mL and LIC of ≥5 mg/g on liver R2 MRI in
a prospective study of iron overload management in 147 adult
allo-HSCT survivors, and 16 out of 147 patients had significant
iron overload. Based on physician and patient preference the
patients were divided into 3 different treatment modality
groups: 5 of the patients were followed by observation only,
8 patients had phlebotomy, and 3 patients were treated by
deferasirox. Deferasirox decreased the LIC after 6 months of
therapy in all 3 patients. The authors concluded that phlebotomy
and deferasirox appeared to be effective alternative treatments
of iron overload in post allo-HSCT [69]. A phase IV open-label
study showed a significant reduction in serum ferritin and LIC
over 1 year in allo-HSCT recipients treated with deferasirox [70].
In a recent study of 76 nonthalassemic patients, the authors
reported a deferasirox-induced negative iron balance in 84% of
patients after initiating it at a median of 168 days after HSCT.
The drug-related adverse events were increased blood creatinine
(26%), nausea (9%), and abdominal discomfort (8%) [71].
Deferasirox has also been tried during the administration of
conditioning regimens and it was found to be safe and reduced
the appearance of labile plasma iron shortly after allo-HSCT in
a preliminary study [72]. The studies of deferasirox in post-HSCT
survivors with iron overload are summarized in Table 3. Visani
et al. evaluated the effect of deferasirox on the restoration
of normal hematopoiesis in 8 HSCT recipients and all patients
experienced an increase in hemoglobin levels with a reduction
of transfusions, followed by transfusion independence. This
Table 3. Management of iron overload with deferasirox in
hematopoietic stem cell transplantation recipients.
Authors/Year
Number
of
Patients
Comments
Sivgin et al., 2012 [66] 23 In the posttransplant
setting, median treatment
duration was 94 days;
significantly reduced iron
parameters; 13% of patients
had side effects
Majhail et al., 2010 [69] 3 Well tolerated and decreased
LIC after 6 months of
therapy in all patients
Vallejo et al., 2014 [70] 30 No drug-related serious
adverse events; significant
reduction in ferritin and LIC
Jaekel et al., 2016 [71] 76 Negative iron balance in
84% of patients; serum
blood creatinine increased
in 26.5% of recipients with
a manageable safety profile
even in patients receiving
cyclosporine
LIC: Liver iron concentration.
interesting result shows us that deferasirox might have a
beneficial effect on hematopoietic recovery after allo-HSCT
[73].
In conclusion, iron overload is a common complication and
this possibility should be considered in all HSCT recipients.
Patients will benefit from careful screening and diagnostic
tools such as serum ferritin and transferrin saturation levels
and LIC by MRI or biopsy. The initiation of phlebotomy and/
or iron chelation therapy if needed will prevent patients from
end-organ toxicities. Further studies should be conducted in
order to determine better preventive measures and to avoid iron
overload, as well as to improve survival in HSCT settings.
Authorship Contributions
Concept: Erden Atilla, Selami K. Toprak, Taner Demirer;
Design: Erden Atilla, Selami K. Toprak, Taner, Demirer; Data
Collection or Processing: Erden Atilla, Selami K. Toprak, Taner
Demirer; Analysis or Interpretation: Erden Atilla, Selami K.
Toprak, Taner Demirer; Literature Search: Erden Atilla, Selami K.
Toprak, Taner Demirer; Writing: Erden Atilla, Selami K. Toprak,
Taner Demirer.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. De Giorgi U, Rosti G, Slavin S, Yaniv I, Harousseau JL, Ladenstein R,
Demirer T, Dini G; European Group for Blood and Marrow Transplantation
Solid Tumours and Paediatric Disease Working Parties. Salvage high-dose
chemotherapy for children with extragonadal germ-cell tumours. Br J
Cancer 2005;93:412-417.
2. Pedrazzoli P, Ferrante P, Kulekci A, Schiavo R, De Giorgi U, Carminati O,
Maragolo M, Demirer T, Siena S, Rosti G; European Group for Blood and
Marrow Transplantation (EBMT), Solid Tumors Working Party. Autologous
hematopoietic stem cell transplantation for breast cancer in Europe:
critical evaluation of data from the European Group for Blood and Marrow
Transplantation (EBMT) Registry 1990-1999. Bone Marrow Transplant
2003;32:489-494.
3. Pedrazzoli P, Ledermann JA, Lotz JP, Leyvraz S, Aglietta M, Rosti G, Champion
KM, Secondino S, Selle F, Ketterer N, Grignani G, Siena S, Demirer T; European
Group for Blood and Marrow Transplantation (EBMT) Solid Tumors Working
Party. High dose chemotherapy with autologous hematopoietic stem cell
support for solid tumors other than breast cancer in adults. Ann Oncol
2006;17:1479-1488.
4. Berry DA, Ueno, NT, Johnson MM, Lei X, Caputo J, Smith DA, Yancey LJ, Crump
M, Stadtmauer E, Biron P, Crown JP, Schmid P, Lotz JP, Rosti G, Bregni M,
Demirer T. High-dose chemotherapy with autologous hematopoietic stemcell
transplantation in metastatic breast cancer: overview of six randomized
trials. J Clin Oncol 2011;29:3224-3231.
5. Passweg JR, Halter J, Bucher C, Gerull S, Heim D, Rovo A, Buser A, Stern
M, Tichelli A. Hematopoietic stem cell transplantation: a review and
recommendation for follow-up care for the general practitioner. Swiss Med
Wkly 2012;142:13696.
6. Jagasia MH, Greinix HT, Arora M, Williams KM, Wolff D, Cowen EW, Palmer J,
Weisdorf D, Treister NS, Cheng GS, Kerry H, Stratton P, Duarte RF, McDonald
6

Turk J Hematol 2017;34:1-9
Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation
GB, Inamoto Y, Vigorito A, Arai S, Datiles MB, Jacobsohn D, Heller T, Kitko
CL, Mitchell SA, Martin PJ, Shulman H, Wu RS, Cutler CS, Vogelsang GB,
Lee SJ, Pavletic SZ, Flowers ME. National Institutes of Health Consensus
Development Project on Criteria for Clinical Trials in Chronic Graft-versus-
Host Disease: I. The 2014 Diagnosis and Staging Working Group report. Biol
Blood Marrow Transplant 2015;21:389-401.
7. Kröger N, Damon L, Zander AR, Wandt H, Derigs G, Ferrante P, Demirer
T, Rosti G; Solid Tumor Working Party of the European Group for Blood
and Marrow Transplantation; German Adjuvant Breast Cancer Study Group;
University of California, San Francisco. Secondary acute leukemia following
mitoxantrone-based high-dose chemotherapy for primary breast cancer
patients. Bone Marrow Transplant 2003;32:1153-1157.
8. Majhail NS, DeFor TE, Lazarus HM, Burns LJ. Iron-overload after autologous
hematopoietic cell transplantation. Leuk Res 2009;33:578-579.
9. Majhail NS, DeFor T, Lazarus HM, Burns LJ. High prevalence of iron overload
in adult allogeneic hematopoietic cell transplant survivors. Biol Blood
Marrow Transplant 2008;14:790-794.
10. Majhail NS, Lazarus HM, Burns LJ. Iron overload in hematopoietic cell
transplantation. Bone Marrow Transplant 2008;41:997-1003.
11. Sucak GT, Yegin ZA, Ozkurt ZN, Aki SZ, Karakan T, Akyol G. The role of liver
biopsy in the workup of liver dysfunction late after SCT: is the role of iron
overload underestimated? Bone Marrow Transplant 2008;42:461-467.
12. Fleming RE, Ponka P. Iron overload in human disease. N Eng J Med
2012;366:348-359.
13. Ganz T, Nemeth E. Hepcidin and iron homeostasis. Biochim Biophys Acta
2012;1823:1434-1443.
14. Ramos P, Melchiori L, Gardenghi S, Van-Roijen N, Grady RW, Ginzburg
Y, Rivella S. Iron metabolism and ineffective erythropoiesis in betathalassemia
mouse models. Ann N Y Acad Sci 2010;1202:24-30.
15. Tanno T, Porayette P, Sripichai O, Noh SJ, Byrnes C, Bhupatiraju A, Lee YT,
Goodnough JB, Harandi O, Ganz T, Paulson RF, Miller JL. Identification
of TWSG1 as second novel erythroid regulator of hepcidin expression in
murine and human cells. Blood 2009;114:181-186.
16. Kautz L, Jung G, Valore EV, Rivella S, Nemeth E, Ganz T. Identification of
erythroferrone as an erythroid regulator of iron metabolism. Nat Genet
2014;46:678-684.
17. Di Tucci AA, Murru R, Alberti D, Rabault B, Deplano S, Angelucci E. Correction
of anemia in a transfusion-dependent patient with primary myelofibrosis
receiving iron chelation therapy with deferasirox (Exjade®, ICL670). Eur J
Haematol 2007;78:540-542.
18. Gattermann N, Finelli C, Della Porta M, Fenaux P, Stadler M, Guerci-Bresler
A, Schid M, Taylor K, Vassilieff D, Habr D, Marcellari A, Roubert B, Rose
C. Hematologic responses to deferasirox therapy in transfusion-dependent
patients with myelodysplastic syndromes. Hematologica 2012;97:1364-
1371.
19. Okabe H, Suzuki T, Uehara E, Ueda M, Nagai T, Ozawa K. The bone marrow
hematopoietic microenvironment is impaired in iron-overloaded mice. Eur J
Haematol 2014;93:118-128.
20. Zhang Y, Zhai W, Zhao M, Li D, Chai X, Cao X, Meng J, Chen J, Xiao X, Li
Q, Mu J, Shen J, Meng A. Effects of iron overload on the bone marrow
microenvironment in mice. PLoS One 2015;10:0120219.
21. Chai X, Li D, Chao X, Zhang Y, Mu J, Lu W, Xiao X, Li C, Meng J, Chen
J, Li Q, Wang J, Meng A, Zhao M. ROS-mediated iron overload injures
the hematopoiesis of bone marrow by damaging hematopoietic stem/
progenitor cells in mice. Sci Rep 2015;5:10181.
22. Sahlstedt L, Ebeling F, von Bonsdorff L, Parkkinen J, Ruutu T. Nontransferrin-bound
iron during allogeneic stem cell transplantation. Br J
Haematol 2001;113:836-838.
23. Dürken M, Nielsen P, Knobel S, Finckh B, Herrnring C, Dresow B, Kohlschütter
B, Stocksclader M, Krüger WH, Kohlschütter A, Zander AR. Nontransferrinbound
iron in serum of patients receiving bone marrow transplants. Free
Radic Biol Med 1997;22:1159-1163.
24. Boulingand J, Richard C, Valteau-Couanet D, Orear C, Mercier L, Kessari R,
Simmonnard N, Munier F, Daudigeous-Dubus E, Tou B, Opolon P, Deroussent A,
Paci A, Vassal G. Iron overload exacerbates busulfan-melphalan toxicity through
a pharmacodynamic interaction in mice. Pharm Res 2016;33:1913-1922.
25. Karoopongse E, Marcondes AM, Yeung C, Holman Z, Kowdley KV, Campbell
JS, Deeg HJ. Disruption of iron regulation after radiation and donor cell
infusion. Biol Blood Marrow Transplant 2016;22:1173-1181.
26. Armand P, Kim HT, Cutler CS, Ho VT, Koreth J, Alyea EP, Soiffer RJ, Antin JH.
Prognostic impact of elevated pretransplantation serum ferritin in patients
undergoing myeloablative stem cell transplantation. Blood 2007;109:4586-
4588.
27. Barba P, Valcarcel D, Perez-Simon JA, Fernandez-Aviles F, Pinana JL, Martino
R, Lopez-Anglada L, Rovira M, Garcia-Cadenas I, Novelli S, Carreras E, Lopez
Corral L, Sierra J. Impact of hyperferritinemia on the outcome of reducedintensity
conditioning allogeneic hematopoietic cell transplantation for
lymphoid malignancies. Biol Blood Marrow Transplant 2013;19:597-601.
28. Mahindra A, Bolwell B, Sobecks R, Rybicki L, Pohlman B, Dean R, Andersen
S, Sweetenham J, Kalaycio M, Copelan E. Elevated ferritin is associated
with relapse after autologous hematopoietic stem cell transplantation for
lymphoma. Biol Blood Marrow Transplant 2008;14:1239-1244.
29. Wang Z, Jia M, Zhao H, Cheng Y, Luo Z, Chen Y, Xu X, Tang Y. Prognostic
impact of pretransplantation hyperferritinemia in adults undergoing
allogeneic hematopoietic SCT: a meta-analysis. Bone Marrow Transplant
2014;49:1339-1340.
30. Nakamae M, Nakamae H, Koh S, Nishimoto M, Nakashima Y, Nakane T, Hirose
A, Hino M. Prognostic value and clinical implication of serum ferritin levels
following allogeneic hematopoietic cell transplantation. Acta Haematol
2015;133:310-316.
31. Meyer SC, O’Meara A, Buser AS, Tichelli A, Passweg JR, Stern M. Prognostic
impact of posttransplantation iron overload after allogeneic stem cell
transplantation. Biol Blood Marrow Transplant 2013;19:440-444.
32. Armand P, Sainvil MM, Kim HT, Rhodes J, Cutler C, Ho VT, Koreth J, Alyea EP,
Neufeld EJ, Kwong RY, Soiffer RJ, Antin JH. Does iron overload really matter
in stem cell transplantation? Am J Hematol 2012;87:569-572.
33. Maertens J, Demuynck H, Verbeken EK, Zachee P, Vandenberghe P, Boogaerts
MA. Mucormycosis in allogeneic bone marrow transplant recipients: report
of five cases and review of the role of iron overload in the pathogenesis.
Bone Marrow Transplant 1999;24:307-312.
34. Morado M, Ojeda E, Garcia-Bustos J, Aguado MJ, Arrieta R, Quevedo E, Navas
A, Hernandez-Navarro F. Serum ferritin as risk factor for veno-occlusive
disease of the liver: prospective cohort study. Hematology 1999;4:505-512.
35. Pullarkat V, Blanchard S, Tegtmeier B, Dagis A, Patane K, Ito J, Forman SJ.
Iron overload adversely affects outcome of allogeneic hematopoietic cell
transplantation. Bone Marrow Transplant 2008;42:799-805.
36. Altes A, Remacha AF, Sarda P, Baiget M, Sureda A, Martino R, Briones J,
Brunet S, Canals C, Sierra J. Early clinical impact of iron overload in stem
cell transplantation. A prospective study. Ann Hematol 2007;86:443-447.
37. Lee SH, Yoo KH, Sung KW, Koo HH, Kwon YJ, Kwon MM, Park HJ, Park BK, Kim
YY, Park JA, Im HJ, Seo JJ, Kang HJ, Shin HY, Ahn HS. Hepatic veno-occlusive
disease in children after hematopoietic stem cell transplantation: incidence,
risk factors and outcome. Bone Marrow Transplant 2010;45:1287-1293.
38. Hissen AH, Wan AN, Warwas ML, Pinto LJ, Moore MM. The Aspergillus
fumigatus siderophore biosynthetic gene sidA, encoding L-ornithine N5-
oxygenase, is required for virulence. Infect Immun 2005;73:5493-5503.
39. Maertens J, Demuynck H, Verbeken EK, Zachee P, Verhoef GE, Vanderberghe
P, Boogaerts MA. Mucormycosis in allogeneic bone marrow recipients: report
of five cases and review of the role of iron overload in the pathogenesis.
Bone Marrow Transplant 1999;24:307-312.
40. Sivgin S, Baldane S, Kaynar L, Kurnaz F, Pala C, Sivgin H. Keklik M, Demiraslan
H, Cetin M, Eser B, Unal A. Pretransplant iron overload may be associated
with increased risk of invasive fungal pneumonia (IFP) in patients that
underwent allogeneic hematopoietic stem cell transplantation (alloHSCT).
Transfus Apher Sci 2013;48:103-108.
7

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation
Turk J Hematol 2017;34:1-9
41. Tunçsan OG, Yegin ZA, Ozkurt ZN, Erbaş G, Akı SZ, Senol E, Yağcı M, Sucak
G. High ferritin levels are associated with hepatosplenic candidiasis in
hematopoietic stem cell transplant candidates. Int J Infect Dis 2010;14(Suppl
3):104-107.
42. Azar N, Valla D, Abdel-Samad I, Hoang C, Fretz C, Sutton L, Fournel JJ,
Le Charpentier Y, Binet JL, Leblond V. Liver dysfunction in allogeneic bone
marrow transplantation recipients. Transplantation 1996;62:56-61.
43. Videla LA, Fernandez V, Tapia G, Varela P. Oxidative stress-mediated
hepatotoxicity of iron and copper: role of Kupffer cells. Biometals
2003;16:103-111.
44. Ramm GA, Ruddell RG. Hepatotoxicity of iron overload: mechanisms of
iron-induced hepatic fibrogenesis. Semin Liver Dis 2005;25:433-449.
45. Kumar S, DeLeve LD, Kamath PS, Tefferi A. Hepatic veno-occlusive
disease (sinusoidal obstruction syndrome) after hematopoietic stem cell
transplantation. Mayo Clin Proc 2003;78:589-598.
46. Maradei SC, Maiolino A, de Azevedo AM, Colares M, Bouzas LF, Nucci M.
Serum ferritin as risk factor for sinusoidal obstruction syndrome of the
liver in patients undergoing hematopoietic stem cell transplantation. Blood
2009;114:1270-1275.
47. Mahindra A, Bolwell B, Sobecks R, Rybicki L, Pohlman B, Dean R, Andresen
S, Sweetenham J, Kalaycio M, Copelan E. Elevated pretransplant ferritin
is associated with a lower incidence of chronic graft-versus host-disease
and inferior survival after myeloablative allogeneic hematopoietic stem cell
transplantation. Br J Haematol 2009;146:310-316.
48. Wahlin A, Lorenz F, Fredriksson M, Remberger M, Wahlin BE, Hägglund H.
Hyperferritinemia is associated with low incidence of graft versus host
disease, high relapse rate and impaired survival in patients with blood
disorders receiving allogeneic hematopoietic stem cell grafts. Med Oncol
2011;28:552-558.
49. Demirer T, Gooley T, Buckner CD, Peterson FB, Lilleby K, Rowley S, Sanders J,
Storb R, Appelbaum FR, Besinger WI. Influence of total nucleated cell dose
from marrow harvests on outcome in patients with acute myelogenous
leukemia undergoing autologous transplantation. Bone Marrow Transplant
1995;15:907-913.
50. Demirer T, Celebi H, Arat M, Ustun C, Demirer S, Dilek I, Ozcan M, Ilhan O,
Akan H, Gurman G, Koç H. Autoimmune thrombocytopenia in a patient
with small cell lung cancer developing after chemotherapy and resolving
following autologous peripheral blood stem cell transplantation. Bone
Marrow Transplant 1999;24:335-337.
51. De Giorgi U, Demirer T, Wandt H, Taverna C, Siegert W, Bornhauser M,
Kozak T, Papiani G, Ballardini M, Rosti G; Solid Tumor Working Party of
the European Group for Blood and Marrow Transplantation. Second-line
high-dose chemotherapy in patients with mediastinal and retroperitoneal
primary non-seminomatous germ cell tumors: the EBMT experience. Ann
Oncol 2005;16:146-151.
52. Brunvand MW, Bensinger WI, Soll E, Weaver CH, Rowley SD, Appelbaum
FR, Lilleby K, Clift RA, Gooley TA, Press OW, Fefer A, Storb R, Sanders JE,
Martin PL, Chauncey T, Maziarz RT, Zuckerman N, Montgomery P, Dorn
R, Weiden PL, Demirer T, Holmberg LA, Schiffman K, McSweeney PA,
Buckner CD. High-dose fractionated total-body irradiation, etoposide and
cyclophosphamide for treatment of malignant lymphoma: comparison of
autologous bone marrow and peripheral blood stem cells. Bone Marrow
Transplant 1996;18:131-141.
53. Yegin A, Sucak G, Demirer T. Iron overload and hematopoietic stem cell
transplantation. In: Demirer T, (ed). Innovations in Stem Cell Transplantation.
Rijeka, InTech, 2013.
54. Rizzo JD, Wingard JR, Tichelli A, Lee SJ, Van Lint MT, Burns LJ, Davies SM,
Ferrara JL, Socie G. Recommended screening and preventive practices
for long-term survivors after hematopoietic cell transplantation:
joint recommendations of the European Group for Blood and Marrow
Transplantation, the Center for International Blood and Marrow Transplant
Research, and the American Society of Blood and Marrow Transplantation.
Biol Blood Marrow Transplant 2006;12:138-151.
55. Knovich MA, Storey JA, Coffman LG, Torti SV, Torti FM. Ferritin for the
clinician. Blood Rev 2009;23:95-104.
56. Gordon LI, Brown SG, Tallman MS, Rademaker AW, Weitzman SA,
Lazarus HM, Kelley CH, Mangan C, Rubin H, Fox RM, Creger RJ, Winter
JN. Sequential changes in serum iron and ferritin in patients undergoing
high-dose chemotherapy and radiation with autologous bone marrow
transplantation: possible implications for treatment related toxicity. Free
Radic Biol Med 1995;18:383-389.
57. Großekatthöfer M, Güclü ED, Lawitschka A, Matthes-Martin S, Mann G,
Minkov M, Peters C, Seidel MG. Ferritin concentrations correlate to outcome
of hematopoietic stem cell transplantation but do not serve as biomarker of
graft-versus-host disease. Ann Hematol 2013;92:1121-1128.
58. Brittenham GM, Cohen AR, McLaren CE, Martin MB, Griffith PM, Nienhuis
AW, Young NS, Allen CJ, Farrell DE, Harris JW. Hepatic iron stores and plasma
ferritin concentration in patients with sickle cell anemia and thalassemia
major. Am J Hematol 1993;42:81-85.
59. Breuer W, Ronson A, Slotki IN, Abramov A, Hershko C, Cabantchik ZI. The
assessment of serum nontransferrin-bound iron in chelation therapy and
iron supplementation. Blood 2000;95:2975-2982.
60. Al-Refaie FN, Wickens DG, Wonke B, Kontoghiorghes GJ, Hoffbrand AV.
Serum non-transferrin-bound iron in beta-thalassaemia major patients
treated with desferrioxamine and L1. Br J Haematol 1992;82:431-436.
61. Goto T, Ikuta K, Inamoto Y, Kamoshita S, Yokohata E, Koyama D, Onodera
K, Seto A, Watanabe K, Imahashi N, Tsukamoto S, Ozawa Y, Sasaki K,
Ito M, Kohgo Y, Miyamura K. Hyperferritinemia after adult allogeneic
hematopoietic cell transplantation: quantification of iron burden by
determining non-transferrin-bound iron. Int J Hematol 2013;97:125-134.
62. Busca A, Falda M, Manzini P, Dántico S, Valfre A, Locatelli F, Calabrese R,
Chiappella A, D’Ardia S, Longo F, Piga A. Iron overload in patients receiving
allogeneic hematopoietic stem cell transplantation: quantification of iron
burden by superconducting quantum interference device (SQUID) and
therapeutic effectiveness of phlebotomy. Biol Blood Marrow Transplant
2010;16:115-122.
63. Kamble RT, Selby GB, Mims M, Kharfan-Dabaja MA, Ozer H, George JN. Iron
overload manifesting as apparent exacerbation of hepatic graft-versushost
disease after allogeneic hematopoietic stem cell transplantation. Biol
Blood Marrow Transplant 2006;12:506-510.
64. McKay PJ, Murphy JA, Cameron S, Burnett AK, Campbell M, Tansey P, Franklin
IM. Iron overload and liver dysfunction after allogeneic or autologous bone
marrow transplantation. Bone Marrow Transplant 1996;17:63-66.
65. Majhail NS, Rizzo JD, Lee SJ, Aljurf M, Atsuta Y, Bonfim C, Burns LJ, Chaudhri
N, Davies S, Okamoto S, Seber A, Socie G, Szer J, Van Lint MT, Wingard JR,
Tichelli A; Center for International Blood and Marrow Transplant Research
(CIBMTR); American Society for Blood and Marrow Transplantation (ASBMT);
European Group for Blood and Marrow Transplantation (EBMT); Asia-Pacific
Blood and Marrow Transplantation Group (APBMT); Bone Marrow Transplant
Society of Australia and New Zealand (BMTSANZ); East Mediterranean
Blood and Marrow Transplantation Group (EMBMT); Sociedade Brasileira
de Transplante de Medula Ossea (SBTMO). Recommended screening and
preventive practices for long-term survivors after hematopoietic cell
transplantation. Biol Blood Marrow Transplant 2012;18:348-371.
66. Sivgin S, Eser B, Bahcebasi, Kaynar L, Kurnaz F, Uzer E, Pala C, Deniz K,
Ozturk A, Cetin M, Unal A. Efficacy and safety of oral deferasirox treatment
in the posttransplant period for patients who have undergone allogeneic
hematopoietic stem cell transplantation (alloHSCT). Ann Hematol
2012;91:743-749.
67. Novartis. Deferoxamine, Desferal, Novartis. Package Insert. Basel, Novartis,
2016.
68. Novartis. Deferasirox, Exjade, Novartis. Package Insert. Basel, Novartis, 2016.
69. Majhail NS, Lazarus HM, Burns LJ. A prospective study of iron overload
management in allogeneic hematopoietic cell transplantation survivors.
Biol Blood Marrow Transplant 2010;16:832-837.
8

Turk J Hematol 2017;34:1-9
Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation
70. Vallejo C, Battle M, Vazquez L, Salono C, Sampol A, Duarte R, Hernandez D,
Lopez J, Rovira M, Jimenez S, Valcarcel D, Belloch V, Jimenez M, Jarque I;
Subcommittee of Non-Infectious Complications of the Grupo Español de
Trasplante Hematopoyético (GETH). Phase IV open-label study of efficacy
and safety of deferasirox after allogeneic stem cell transplantation.
Haematologica 2014;99:1632-1637.
71. Jaekel N, Lieder K, Albrecht S, Leismann O, Hubert K, Bug G, Kröger N,
Platzbecker U, Stadler M, de Haas K, Altamura S, Muckenthaler MU,
Niederwieser D, Al-Ali HK. Efficacy and safety of deferasirox in nonthalassemic
patients with elevated ferritin levels after allogeneic
hematopoietic stem cell transplantation. Bone Marrow Transplant
2016;51:89-95.
72. Fritsch A, Langebrake C, Nielsen P, Bacher U, Baehr M, Dartsch DC, Kroeger
N. Deferasirox (Exjade) given during conditioning regimen (FLAMSA/
busulfan/ATG) reduces the appearance of labile plasma iron in patients
undergoing allogeneic stem cell transplantation. Blood 2011;118:3023.
73. Visani G, Guiducci B, Giardini C, Loscocco F, Ricciardi T, Isidori A. Deferasirox
improves hematopoiesis after allogeneic hematopoietic SCT. Bone Marrow
Transplant 2014;49:585-587.
9

RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0156
Turk J Hematol 2017;34:10-15
Changing Treatment May Affect the Predictive Ability of European
Treatment Outcome Study Scoring for the Prognosis of Patients
with Chronic Myeloid Leukemia
Kronik Miyeloid Lösemi Hastalarında Tedavinin Değiştirilmesi Avrupa Tedavi İzlem Çalışması
Prognoz Skorlamasındaki Tahmin Başarısını Etkileyebilir
Jing Huang, Leyan Wang, Lu Chen, He Qun, Xu Yajing, Chen Fangping, Zhao Xielan
Xiangya Hospital, Central South University, Department of Hematology, Changsha, China
Abstract
Objective: Previous studies compared the predictive ability of the
European Treatment Outcome Study (EUTOS), Sokal, and Hasford
scoring systems and demonstrated inconsistent findings with
unknown reasons. This study was conducted to determine a useful
scoring system to predict the prognosis of patients with chronic
myeloid leukemia (CML) and identify the probable factors that affect
the scoring.
Materials and Methods: This is a retrospective cohort study. The
predictive ability of EUTOS and the factors that affect scoring were
analyzed in 234 Chinese chronic-phase CML patients treated with
frontline imatinib, including a few patients temporarily administered
hydroxyurea for cytoreduction before imatinib. Patients were stratified
into different risk groups according to each scoring system to assess
the treatment outcomes and the predictive ability of EUTOS scores
between patients who received imatinib during the entire followup
period and patients who received altered treatment because of
intolerance, progression, and treatment failure.
Results: Sixty-one (26.0%) patients received altered treatments
during the follow-up. In the EUTOS low- and high-risk groups, the
5-year overall survival was 94.6% and 84.7% (p=0.011), 5-year eventfree
survival was 92.6% and 77.6% (p=0.001), and 5-year progressionfree
survival (PFS) was 95.3% and 82.4% (p=0.001), respectively.
The predictive ability of EUTOS was better than that of the Sokal
and Hasford scores (p=0.256, p=0.062, p=0.073) without statistical
significance. All three scoring systems were valid in predicting early
optimal response. Kaplan-Meier analysis showed a high association
between overall PFS and the EUTOS scores in the standard-dose
imatinib group (p

Turk J Hematol 2017;34:10-15
Huang J, et al: Predictive Ability of the European Treatment Outcome Study
Introduction
As the firstline treatment for chronic myeloid leukemia (CML),
imatinib is widely used after diagnosis and dramatically
improves the overall survival (OS) of CML patients [1].
Predicting the prognosis is significant for the management
of CML patients. Currently, the European Treatment Outcome
Study (EUTOS), Hasford, and Sokal prognostic scoring systems
are used for predicting the prognosis of CML patients [2,3,4].
The EUTOS scoring system is a novel prognostic scoring system
that challenges the conventional Sokal and Hasford scoring
systems in predicting the outcome of CML patients. However,
recent studies examining the effectiveness of the EUTOS scoring
system in predicting the prognosis of CML patients showed
controversial results. For example, several studies from different
regions of the world compared the clinical significance of the
three prognostic scoring systems. Five studies found that EUTOS
was better than the Hasford and Sokal systems in predicting
the prognosis of CML patients [1,2,3,5,6]. In contrast, 3 studies
showed that the EUTOS score does not predict prognosis in CML
patients [7,8,9]. It is currently unknown what factors caused
these controversial findings.
The purpose of this study was to compare the predictive ability
of the Sokal, Hasford, and EUTOS prognostic scoring systems
by stratifying CML-chronic-phase (CP) patients who received
firstline imatinib mesylate at diagnosis into different risk groups.
The possible factors that affect the prognostic ability of EUTOS
were further explored according to the three scoring systems.
Materials and Methods
Patients
A total of 234 CML-CP patients (162 males, 72 females) who
received imatinib mesylate (Novartis Oncology, Novartis Pharma
Stein AG, Stein, Switzerland) treatment within 6 months of
diagnosis at X Hospital between January 2004 and July 2014
were recruited for this study. CML-CP was diagnosed according
to published diagnostic criteria [10], and all patients were
treated with a standard dose of imatinib (400 mg/day) over 3
months. No other treatment was given, except for hydroxyurea
temporarily administered for cytoreduction before imatinib in
9 patients.
Calculations of the Chronic Myeloid Leukemia Prognostic
Indexes
The Sokal score was calculated using the following formula:
Exp 0.0116 × (age in years-43.4) + 0.0345 × (spleen size-7.51)
+ 0.188 × [(platelet count/700) 2 -0.563] + 0.0887 × (blast
cells-2.10). Patients with a score of less than 0.8 were assigned
to the low Sokal risk group, patients with a score from 0.8 to 1.2
were assigned to the intermediate Sokal risk group, and patients
with a score greater than 1.2 were assigned to the high Sokal
risk group [11]. The Hasford score was calculated as follows:
0.666 (when age >50 years) + (0.042×spleen size) + 1.0956
(when platelet count >1500×10 9 /L) + (0.0584×blast cell count)
+ 0.20399 (when basophil count >3%) + (0.0413×eosinophil
count) × 100. Patients with a score of less than 780 were
assigned to the low Hasford risk group, patients with a score
from 781 to 1480 were assigned to the intermediate Hasford
risk group, and patients with a score higher than 1480 were
assigned to the high Hasford risk group [12]. The EUTOS score
was calculated as follows: (7×basophil count) + (4×spleen size),
where the spleen was measured in centimeters below the costal
margin and basophils as a percentage rate. Patients with a
EUTOS score higher than 87 were assigned to the high EUTOS
risk group, while patients with a EUTOS score of less than or
equal to 87 were assigned to the low EUTOS risk group [10].
Definitions
OS: the length of time from the date of diagnosis to the date of
death or final follow-up (1 July 2014).
Event-free survival (EFS): the length of time from the date of
initiating imatinib therapy to the date of failure according to the
European Leukemia Net criteria, the date of stopping treatment
due to imatinib intolerance, or the date of last follow-up in
patients whose treatments did not fail [13].
Progression-free survival (PFS): the length of time from the
date of imatinib therapy initiation to the date of progression
to accelerated phase (AP)/blastic phase (BP) or to the date of
death.
Complete cytogenetic response (CCyR): no Philadelphia
chromosome was detected in the patient by G-banding analysis
of bone marrow and no Philadelphia cell was detected in the
patient when using fluorescence in situ hybridization analysis
of peripheral blood.
Partial cytogenetic response (PCyR): 1%-35% Philadelphia
chromosome in a patient’s bone marrow.
Major molecular response (MMR): the achievement of ≥3 logs
reduction in BCR-ABL mRNA from the standardized baseline
[14,15,16,17].
Statistical Analysis
Data were analyzed using SPSS 17.0 (SPSS Inc., Chicago, IL,
USA). Normally distributed continuous variables were presented
as mean ± standard deviation, and non-normally distributed
continuous variables were presented as medians with
interquartile ranges. Kaplan-Meier methods and log rank tests
were applied to analyze the time-to-event data. The 5-year
EFS, PFS, and OS and the cumulative incidence of PCyR, CCyR,
11

Huang J, et al: Predictive Ability of the European Treatment Outcome Study
Turk J Hematol 2017;34:10-15
and MMR were compared using the chi-square test. A value of
p

Turk J Hematol 2017;34:10-15
Huang J, et al: Predictive Ability of the European Treatment Outcome Study
found between Sokal groups (p=0.335, p=0.123, p=0.170 for
low, intermediate-, and high-risk groups) or Hasford groups
(p=0.135, p=0.057, p=0.052 for low-, intermediate-, and highrisk
groups).
The overall rates of PCyR at 3 months, CCyR at 12 months and
18 months, and MMR at 18 months for all CML patients were
18.4%, 56.4%, 65.4%, and 46.2%, respectively. Furthermore,
131 patients (87.9%) and 22 patients (25.9%) achieved CCyR at
18 months in the low and high EUTOS risk groups (p

Huang J, et al: Predictive Ability of the European Treatment Outcome Study
Turk J Hematol 2017;34:10-15
a positive effect of EUTOS, but lower than that of studies
supporting a negative effect. In this study, we found that 5-year
PFS and OS had no significant correlations with EUTOS scores
in patients who received altered treatments, but they were
significantly associated with EUTOS scores in patients without
altered treatments. Thus, changing treatment may be a key
factor that affects the predictive ability of EUTOS. In addition,
the percentage of patients in the high EUTOS risk group was
small in the three negative studies (11.2% in the Marin et al.
[9] study, 8% in the Jabbour et al. [8] study, and 11% in the
Yamamoto et al. [7] study), while it was high (36.3%) in the
present study. We propose that the small number of patients
in the high-risk group in the three negative studies may have
caused a bias.
Figure 2. Progression-free survival using European Treatment
Outcome Study score for chronic myeloid leukemia-chronicphase
patients who received imatinib or altered treatment. (A)
Progression-free survival using European Treatment Outcome
Study score for chronic myeloid leukemia-chronic-phase patients
treated with standard-dose imatinib. There was a significant
difference between the risk groups (p

Turk J Hematol 2017;34:10-15
Huang J, et al: Predictive Ability of the European Treatment Outcome Study
Authorship Contributions
Concept: Zhao Xielan; Design: Zhao Xielan; Data Collection or
Processing: Jing Huang, Leyan Wang, Lu Chen, He Qun, Xu Yajing,
Chen Fangping, Zhao Xielan; Analysis or Interpretation: Jing
Huang, Leyan Wang, Lu Chen, He Qun, Xu Yajing, Chen Fangping,
Zhao Xielan; Literature Search: Jing Huang; Writing: Jing Huang.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Yahng SA, Jang EJ, Choi SY, Lee SE, Kim SH, Kim DW. Prognostic
discrimination for early chronic phase chronic myeloid leukemia in imatinib
era: comparison of Sokal, Euro, and EUTOS scores in Korean population. Int
J Hematol 2014;100:132-140.
2. Tao Z, Liu B, Zhao Y, Wang Y, Zhang R, Han M, Zhang L, Li C, Ru K, Mi Y, Wang
J. EUTOS score predicts survival and cytogenetic response in patients with
chronic phase chronic myeloid leukemia treated with first-line imatinib.
Leuk Res 2014;38:1030-1035.
3. Bonifacio M, Binotto G, Calistri E, Maino E, Tiribelli M; Gruppo Triveneto
LMC. EUTOS score predicts early optimal response to imatinib according to
the revised 2013 ELN recommendations. Ann Hematol 2014;93:163-164.
4. Uz B, Buyukasik Y, Atay H, Kelkitli E, Turgut M, Bektas O, Eliacik E, Isik
A, Aksu S, Goker H, Sayinalp N, Ozcebe OI, Haznedaroglu IC. EUTOS CML
prognostic scoring system predicts ELN-based ‘event-free survival’ better
than Euro/Hasford and Sokal systems in CML patients receiving front-line
imatinib mesylate. Hematology 2013;18:247-252.
5. Hoffmann V, Baccarani M, Hasford J, Guilhot J, Saussele S, Rosti G, Guilhot
F, Porkka K, Ossenkoppele G, Lindoerfer D, Simonsson B, Pfirrmann M,
Hehlmann R. The EUTOS CML score aims to support clinical decisionmaking.
Blood 2012;119:2966-2967.
6. Hasford J, Baccarani M, Hoffmann V, Guilhot J, Saussele S, Rosti G, Guilhot
F, Porkka K, Ossenkoppele G, Lindoerfer D, Simonsson B, Pfirrmann M,
Hehlmann R. Predicting complete cytogenetic response and subsequent
progression-free survival in 2060 patients with CML on imatinib treatment:
the EUTOS score. Blood 2011;118:686-692.
7. Yamamoto E, Fujisawa S, Hagihara M, Tanaka M, Fujimaki K, Kishimoto K,
Hashimoto C, Itabashi M, Ishibashi D, Nakajima Y, Tachibana T, Kawasaki
R, Kuwabara H, Koharazawa H, Yamazaki E, Tomita N, Sakai R, Fujita H,
Kanamori H, Ishigatsubo Y. European Treatment and Outcome Study score
does not predict imatinib treatment response and outcome in chronic
myeloid leukemia patients. Cancer Sci 2014;105:105-109.
8. Jabbour E, Cortes J, Nazha A, O’Brien S, Quintas-Cardama A, Pierce S,
Garcia-Manero G, Kantarjian H. EUTOS score is not predictive for survival
and outcome in patients with early chronic phase chronic myeloid leukemia
treated with tyrosine kinase inhibitors: a single institution experience.
Blood 2012;119:4524-4526.
9. Marin D, Ibrahim AR, Goldman JM. European Treatment and Outcome Study
(EUTOS) score for chronic myeloid leukemia still requires more confirmation.
J Clin Oncol 2011;29:3944-3945.
10. Kantarjian HM, Talpaz M, O’Brien S, Smith TL, Giles FJ, Faderl S, Thomas
DA, Garcia-Manero G, Issa JP, Andreeff M, Kornblau SM, Koller C, Beran
M, Keating M, Rios MB, Shan J, Resta D, Capdeville R, Hayes K, Albitar M,
Freireich EJ, Cortes JE. Imatinib mesylate for Philadelphia chromosomepositive,
chronic-phase myeloid leukemia after failure of interferon-alpha:
follow-up results. Clin Cancer Res 2002;8:2177-2187.
11. Sokal JE, Cox EB, Baccarani M, Tura S, Gomez GA, Robertson JE, Tso CY,
Braun TJ, Clarkson BD, Cervantes F, Rozman C; Italian Cooperative CML
Study Group. Prognostic discrimination in “good-risk” chronic granulocytic
leukemia. Blood 1984;63:789-799.
12. Hasford J, Pfirrmann M, Hehlmann R, Allan NC, Baccarani M, Kluin-Nelemans
JC, Alimena G, Steegmann JL, Ansari H. A new prognostic score for survival
of patients with chronic myeloid leukemia treated with interferon alfa.
Writing Committee for the Collaborative CML Prognostic Factors Project
Group. J Natl Cancer Inst 1998;90:850-858.
13. Baccarani M, Cortes J, Pane F, Niederwieser D, Saglio G, Apperley J, Cervantes
F, Deininger M, Gratwohl A, Guilhot F, Hochhaus A, Horowitz M, Hughes
T, Kantarjian H, Larson R, Radich J, Simonsson B, Silver RT, Goldman J,
Hehlmann R; European LeukemiaNet. Chronic myeloid leukemia: an update
of concepts and management recommendations of European LeukemiaNet.
J Clin Oncol 2009;27:6041-6051.
14. Ohnishi K, Nakaseko C, Takeuchi J, Fujisawa S, Nagai T, Yamazaki H, Tauchi
T, Imai K, Mori N, Yagasaki F, Maeda Y, Usui N, Miyazaki Y, Miyamura K,
Kiyoi H, Ohtake S, Naoe T; Japan Adult Leukemia Study Group. Long-term
outcome following imatinib therapy for chronic myelogenous leukemia,
with assessment of dosage and blood levels: the JALSG CML202 study.
Cancer Sci 2012;103:1071-1078.
15. Yagasaki F, Niwa T, Abe A, Ishikawa M, Kato C, Ogura K, Sasaki H, Kyo T,
Jinnai I, Bessyo M, Miyamura K. Correlation of quantification of major bcrabl
mRNA between TMA (transcription mediated amplification) method and
real-time quantitative PCR. Rinsho Ketsueki 2009;50:481-487 (in Japanese
with English abstract).
16. O’Brien SG, Guilhot F, Larson RA, Gathmann I, Baccarani M, Cervantes
F, Cornelissen JJ, Fischer T, Hochhaus A, Hughes T, Lechner K, Nielsen JL,
Rousselot P, Reiffers J, Saglio G, Shepherd J, Simonsson B, Gratwohl A,
Goldman JM, Kantarjian H, Taylor K, Verhoef G, Bolton AE, Capdeville R,
Druker BJ; IRIS Investigators. Imatinib compared with interferon and
low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid
leukemia. N Engl J Med 2003;348:994-1004.
17. Langabeer SE, Gale RE, Harvey RC, Cook RW, Mackinnon S, Linch DC.
Transcription-mediated amplification and hybridisation protection assay
to determine BCR-ABL transcript levels in patients with chronic myeloid
leukaemia. Leukemia 2002;16:393-399.
18. Hoffmann VS, Baccarani M, Lindoerfer D, Castagnetti F, Turkina A, Zaritsky
A, Hellmann A, Prejzner W, Steegmann JL, Mayer J, Indrak K, Colita A, Rosti
G, Pfirrmann M. The EUTOS prognostic score: review and validation in 1288
patients with CML treated frontline with imatinib. Leukemia 2013;27:2016-
2022.
15

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0346
Turk J Hematol 2017;34:16-26
Allogeneic Transplantation in Chronic Myeloid Leukemia and the
Effect of Tyrosine Kinase Inhibitors on Survival:
A Quasi-Experimental Study
Kronik Myeloit Lösemide Allojenik Nakil ve Tirozin Kinaz İnhibitörlerinin Sağkalıma Etkisi Bir
Öncesi-Sonrası Çalışması
Mehmet Özen 1 , Celalettin Üstün 2 , Bengi Öztürk 3 , Pervin Topçuoğlu 1 , Mutlu Arat 4 , Mehmet Gündüz 1 , Erden Atilla 1 , Gülşen Bolat 1 ,
Önder Arslan 1 , Taner Demirer 1 , Hamdi Akan 1 , Osman İlhan 1 , Meral Beksaç 1 , Günhan Gürman 1 , Muhit Özcan 1
1Ankara University Faculty of Medicine, Department of Hematology and Bone Marrow Transplantation Unit, Ankara, Turkey
2University of Minnesota, Department of Medicine, Division of Hematology-Oncology and Transplantation, Minneapolis, USA
3Ankara University Faculty of Medicine, Department of Internal Medicine, Ankara, Turkey
4Şişli Florence Nightingale Hospital, Clinic of Hematology, İstanbul, Turkey
Abstract
Objective: Tyrosine kinase inhibitors (TKIs) have changed the
indications for allogeneic hematopoietic stem cell transplantation
(allo-HSCT) in chronic myeloid leukemia (CML). Therefore, we aimed
to evaluate the effect of TKIs on allo-HSCT in CML.
Materials and Methods: In this quasi-experimental study, we
compared patient, disease, and transplantation characteristics as well
as allo-HSCT outcomes between the pre-TKI era (before 2002) and the
post-TKI era (2002 and later) in patients with CML. A total of 193 allo-
HSCTs were performed between 1989 and 2012.
Results: Patients in the post-TKI era had more advanced disease
(>chronic phase 1) at the time of transplant and more frequently
received reduced-intensity conditioning compared to patients in the
pre-TKI era. Relapse/progression occurred more frequently in the year
≥2002 group than in the year

Turk J Hematol 2017;34:16-26
Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia
Introduction
Chronic myeloid leukemia (CML) is a clonal disease that
originates from a translocation between chromosomes 9 and 22
(Philadelphia chromosome). This translocation fuses ABL1 at 9q34
with BCR at 22q11.2, resulting in a chimeric gene that encodes
an abnormal fusion protein. Before the discovery of tyrosine
kinase inhibitors (TKIs), the median survival of CML patients
in the blastic (BP), accelerated (AP), and chronic (CP) phases
of disease who did not undergo transplant was 4-6 months,
1-1.5 years, and 3-8 years, respectively [1]. The only curative
therapeutic option for CML was allogeneic hematopoietic stem
cell transplantation (allo-HSCT), and all CML patients who had
suitable human leukocyte antigen (HLA)-matched donors were
considered candidates for allo-HSCT until 2002 [2].
It has been shown that imatinib treatment is superior to
interferon alpha and low-dose cytarabine treatments in
patients with CML [3], and later, TKI treatment was shown to
result in long-term hematologic, cytogenetic, and molecular
remission [4,5,6]. Therefore, the therapeutic landscape for CML
has changed, and TKIs have become the first-line treatment
for patients with CML. In 2002, TKIs became available for CML
patients in Turkey [7,8]. Since 2002, allo-HSCT has remained the
only proven curative option for CML, but it is currently indicated
only for patients who have failed to respond to TKIs, those who
have mutations associated with TKI resistance (e.g., T315I), and
those who are intolerant to TKIs [8,9].
Although the discovery of TKIs has changed the indications for
allo-HSCT in CML patients, allo-HSCT outcomes may have also
been affected by the year of allo-HSCT due to the development
of more successful transplantation techniques and supportive
treatment options [10]. TKIs may also be used after allo-HSCT
to treat relapse after transplantation in CML patients. Therefore,
in this retrospective study, we compared allo-HSCT outcomes
as well as patient, disease, and transplantation characteristics
in the pre- and post-TKI eras and pretransplant TKI usage,
posttransplant therapeutic TKI usage, and rates of reaching
hematologic complete remission (CR) at 3 months in patients
with CML.
Materials and Methods
We conducted this study after it was approved by the institutional
ethics committee. A total of 188 CML patients underwent 193
allo-HSCTs (a second allo-HSCT was performed for five patients)
at the Ankara University Department of Hematology and Bone
Marrow Transplantation Unit between 1989 and 2012. CML
clinical phases were defined according to the 2008 WHO criteria
[11]. For this study, we defined the advanced phase as any phase
other than CP1 (e.g., >chronic phase 1 (>CP1), AP, or BP). The
majority of CML patients in the AP or BP of disease received
acute myelogenous leukemia-type induction regimens before
undergoing allo-HSCT.
We divided the patients into 2 groups: patients receiving allo-
HSCT before TKIs were available (the pre-TKI era group, before
2002, n=128) and patients receiving allo-HSCT after TKIs
were available (the post-TKI era group, 2002 and after, n=65)
(Supplement 1).
In the post-TKI era, 48 of 65 patients (73%) received TKIs before
allo-HSCT. We also evaluated these patients separately with
regards to TKI effect on survival with two groups, a TKI-using
group and a group not using TKIs, to differentiate the effect of
pretransplant TKIs on allo-HSCT (Supplement 1).
Details about conditioning regimen, HLA matching status,
graft-versus-host disease (GVHD) prophylaxis, definition and
treatment of relapse, and supportive therapy are given in
Supplement 1.
Statistical Analysis
Numeric variables are presented as medians. Categorical
variables were compared by the chi-square test or Fisher exact
test. The nonparametric Mann-Whitney U test was used for
noncategorical variables. GVHD was considered a categorical
variable. Relapse and transplant-related mortality rates were
calculated as time-dependent variables. Overall survival (OS)
and disease-free survival (DFS) were calculated from the date
of allo-HSCT. OS after relapse was calculated from the date of
relapse. The distributions of OS and DFS durations in the two
groups were estimated using the Kaplan-Meier method and
compared using the log-rank test.
Recipient age, recipient sex, donor sex, stem cell source,
conditioning regimen intensity, CML clinical phase, hematologic
remission 3 months after allo-HSCT, and time from diagnosis to
transplant were included in the multivariate analyses of survival.
Logistical regression and a Cox model were used for risk factor
analysis in DFS and OS. All reported p-values were two-sided,
and p

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia
Turk J Hematol 2017;34:16-26
Table 1. Patient and transplantation characteristics in the pre-tyrosine kinase inhibitor and post-tyrosine kinase inhibitor eras
with and without pretransplant tyrosine kinase inhibitor usage.
Time from diagnosis to transplantation
Median
(range), months
Recipient age
Pre-TKI era
(n=128)
9.2
(1.6-129)
Median (range), years 34
(14-48)
Recipient sex
Male, n (%)
Female, n (%)
Intensity of conditioning regimen
Ablative, n (%)
RIC, n (%)
Stem cell source
BM, n (%)
PB, n (%)
CB, n (%)
CD34 count in product
73 (57)
55 (43)
118 (92)
10 (8)
64 (50)
64 (50)
0 (0)
Post-TKI era
(n=65)
15.8
(3.3-266)
34
(18-58)
39 (60)
26 (40)
43 (66)
22 (34)
19 (29)
44 (68)
2 (3)
p
No TKIs used before
transplant (n=145)

Turk J Hematol 2017;34:16-26
Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia
A
Survival Survival Functions Functions
B
Survival Survival Functions Functions
1.0
1.0
0.8
0.8
Cum
Cum
Survival
Survival
0.6
0.4
Cum Survival
0.6
0.4
0.2
0.2
0.0
0.0
0.00 50.00 100.00 150.00 200.00 250.00
OS_months
0.00 50.00 100.00 150.00 200.00 250.00
OS_months
C
Survival Functions
D
Survival Functions
1.0
1.0
0.8
0.8
Cum Survival
0.6
0.4
Cum Survival
0.6
0.4
0.2
0.2
0.0
0.00 50.00 100.00 150.00 200.00 250.00
DFS_months
0.0
0.00 50.00 100.00 150.00 200.00 250.00
DFS_months
Figure 1. A. Overall survival in the tyrosine kinase inhibitor era. B. Overall survival in relation to tyrosine kinase inhibitor use. C. Diseasefree
survival in the tyrosine kinase inhibitor era. D. Disease-free survival in relation to tyrosine kinase inhibitor use.
rate of acute and chronic GVHD, and rate of treatment-related
mortality were similar in all groups. Hemorrhagic cystitis was
more common in the pre-TKI era group (28.9%) than in the
post-TKI era group (13.8%) (p=0.003) and more common in the
group not using pretransplant TKIs (27.6%) than in the group
using pretransplant TKIs (12.5%) (p=0.01) (Table 2).
Outcomes
Relapsed/refractory disease after allo-HSCT was observed in
57 patients (relapse in 49 patients and refractory disease in 8
patients). Relapse was more common in the post-TKI era group
(Table 2). DFS and OS were similar between the pre- and post-
TKI era groups and between the groups using and not using TKIs
before transplant (Figure 1; Table 2). DFS and OS were also similar
in CP1 and AP CML patients between the pre- and post-TKI era
groups and between the groups using and not using TKIs before
transplant (Table 2). However, pre-TKI patients with disease stage
>CP1 had the worst OS rate, and this was significantly different
from the OS rates of the other groups of patients (Figure 2).
months). Patients received donor lymphocyte infusion (DLI) or
TKIs, DLI plus TKI, or supportive therapy for the treatment of
relapse. Most relapses (83%) in the pre-TKI era patients occurred
before 2002, during which time TKIs were unavailable. The
mean survival rates of patients receiving therapeutic TKI after
relapse with DLI (86.8 months) and without DLI (95.5 months)
were longer than those for patients receiving DLI alone (58.3
months). Patients who only received supportive treatment had
the worst survival (6.5 months) (Table 3).
The median OS survival at 5 years after relapse was higher
in the post-TKI era patients than in the pre-TKI era patients
(respectively 67% vs. 28% in all patients, p=0.003; 83% vs. 32%
in patients with CP1 CML, p=0.006; and 53% vs. 0% in patients
with advanced disease, p=0.04) (data not shown).
Late relapses (9-12 years after allo-HSCT) occurred in 3 patients
(one in the post-TKI era group and 2 in the pre-TKI era group).
Two of these patients achieved CR with TKI treatment and
survived. However, the third patient, who was diagnosed in the
pre-TKI era, was resistant to TKI treatment and died.
OS after relapse in the post-TKI era group (mean: 94.2 months)
was better than that in the pre-TKI era group (mean: 44.4
In univariate analysis, recipient sex and phase of CML had a
significant impact on DFS and OS (Table 4). Male recipients
19

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia
Turk J Hematol 2017;34:16-26
Table 2. Outcomes of transplantation regarding tyrosine kinase inhibitor era and tyrosine kinase inhibitor use.
Engraftment
Pre-TKI
(n=128)
Post-TKI
(n=65)
p
No TKIs used
before transplant
(n=145)
TKIs used before
transplant (n=48)
Engraftment, % 94.5 96.9 0.7 94.5 97.9 0.5
Neutrophil engraftment, mean ± SD, days 16±5 17±6 0.8 16±5 17±7 0.8
Platelet engraftment, mean ± SD, days 18±9 18±12 0.2 18±9 18±13 0.4
GVHD
Acute GVHD in 100 days, % 50.4 50.8 1.0 52.1 45.8 0.5
Grade 2-4 acute GVHD in 100 days, % 33.1 27.7 0.5 34.0 22.9 0.2
Chronic GVHD in 2 years, % 66.1 72.2 0.4 68.0 68.4 1.0
Transplantation complications
Hemorrhagic cystitis, % 28.9 13.8 0.003 27.6 12.5 0.01
SOS, % 4.7 9.2 0.2 4.1 12.5 0.08
Hematologic CR after allo-HSCT
All patients, n (%) 108 (84) 57 (88) 0.5 122 (84) 43 (90) 0.4
CP1, n (%) 99 (85) 31 (97) 0.1 111 (86) 19 (100) 0.1
>CP1, n (%) 9 (75) 26 (79) 1.0 11 (69) 24 (83) 0.5
Overall survival
All patients
At 1 year, % ± SE
At 5 years, % ± SE
At 10 years, % ± SE
CP1 patients
At 1 year, % ± SE
At 5 years, % ± SE
At 10 years, % ± SE
>CP1 patients
At 1 year, % ± SE
At 5 years, % ± SE
At 10 years, % ± SE
TRM
All patients
At 3 months, % ± SE
At 1 year, % ± SE
At 5 years, % ± SE
CP1 patients
At 3 months, % ± SE
At 1 year, % ± SE
At 5 years, % ± SE
>CP1 patients
At 3 months, % ± SE
At 1 year, % ± SE
At 5 years, % ± SE
67.8±4.1
50.8±4.5
47.8±4.6
70.5±4.2
54.5±4.8
51.2±4.8
41.7±14.2
16.7±10.8
16.7±10.8
16.4±3.3
27.3±4.0
39.0±4.5
13.8±3.2
25.4±4.1
36.8±4.7
33.3±13.6
51.2±14.8
63.5±15.3
69.2±5.7
59.5±6.2
56.8±6.4
81.2±6.9
68.6±8.2
64.3±8.8
57.6±8.6
49.6±9.2
49.6±9.2
13.8±4.3
23.7±5.4
32.7±6.1
6.2±4.3
15.8±6.5
28.9±8.2
21.2±7.2
31.4±8.3
35.0±8.6
0.3 69.5±3.8
54.0±4.2
51.3±4.3
0.2 71.9±4.0
56.9±4.5
53.9±4.6
0.07 50.0±12.5
31.2±11.6
31.2±11.6
0.5 15.2±3.0
25.9±3.7
36.4±4.2
0.5 13.2±3.0
23.6±3.8
34.6±4.4
0.1 31.2±11.6
44.4±12.6
53.4±13.1
64.6±6.9
52.5±7.5
48.1±8.1
78.9±9.4
62.7±11.2
NR
55.2±9.2
45.3±10.1
NR
16.7±5.4
27.9±6.6
38.1±7.4
10.5±7.0
21.1±9.4
37.3±11.2
21.7±7.5
32.5±9.0
37.7±9.4
p
0.7
0.8
0.4
0.7
0.6
0.3
20

Turk J Hematol 2017;34:16-26
Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia
Table 2. Continued.
Relapse/progression
All patients
At 1 year, % ± SE
At 5 years, % ± SE
CP1 patients
At 1 year, % ± SE
At 5 years, % ± SE
>CP1 patients
At 1 year, % ± SE
At 5 years, % ± SE
Disease-free survival
All patients
At 1 year, % ± SE
At 5 years, % ± SE
At 10 years, % ± SE
CP1 patients
At 1 year, % ± SE
At 5 years, % ± SE
At 10 years, % ± SE
>CP1 patients
At 1 year, % ± SE
At 5 years, % ± SE
At 10 years, % ± SE
17.3±3.7
32.4±5.0
13.7±3.5
29.0±5.1
59.5±17.5
73.0±16.0
62.3±4.3
44.3±4.5
41.2±4.6
66.2±4.4
47.2±4.8
43.7±4.8
25.0±12.5
16.7±10.8
16.7±10.8
31.2±6.2
48.6±7.6
23.9±7.9
40.7±9.6
37.1±9.5
60.8±13.8
52.0±6.2
32.9±6.1
22.7±8.0
62.5±8.6
40.6±8.7
27.4±10.3
41.7±8.7
23.8±9.3
NR
0.01 19.9±3.7
35.7±4.7
0.07 16.6±3.6
32.1±4.9
0.3 51.4±15.0
70.8±14.0
0.08 61.2±4.1
43.4±4.2
39.5±4.3
0.3 64.9±4.2
46.4±4.5
42.1±4.6
0.2 31.2±11.6
18.8±9.8
18.8±9.8
27.4±7.2
46.2±9.9
12.6±8.4
28.5±12.3
38.0±14.3
63.3±16.8
51.7±7.3
30.9±7.3
27.1±7.4
68.4±10.7
42.1±11.3
NR
40.5±9.2
21.8±10.7
NR
Allo-HSCT: Allogeneic hematopoietic stem cell transplantation, CP1: first chronic phase, CR: complete remission, GVHD: graft-versus-host disease, SD: standard deviation, SE: standard
error, SOS: sinusoidal obstruction syndrome, TKI: tyrosine kinase inhibitor, TRM: treatment-related mortality, NR: Not reached
0.3
0.7
0.4
0.1
0.7
0.4
A
Survival Functions
B
Survival Functions
C
Survival Functions
1.0
1.0
1.0
0.8
0.8
0.8
Cum Survival
0.6
0.4
Cum Survival
0.6
0.4
Cum Survival
0.6
0.4
0.2
0.2
0.2
0.0
0.00 50.00 100.00 150.00 200.00 250.00
OS_months
0.0
0.0
0.00 50.00 100.00 150.00 200.00 250.00 0.00 50.00 100.00 150.00 200.00 250.00
OS_months
DFS_months
Figure 2. A) Overall survival by tyrosine kinase inhibitor era and phase of chronic myeloid leukemia. B) Overall survival by conditioning
regimens and phase of chronic myeloid leukemia. C) Disease-free survival by conditioning regimens and phase of chronic myeloid
leukemia.
receiving grafts from female donors had the worst DFS and OS
rates (Table 4), most likely because of the higher incidence of
chronic GVHD in those patients (61% vs. 76% for sex-matched
and mismatched conditions, respectively, p=0.03). The receipt of
RIC regimens did not significantly affect OS but was associated
with lower DFS in patients with advanced CML (Figure 2; Table
4). Although allo-HSCT from an unrelated donor was performed
only in post-TKI era patients, donor type did not affect DFS or
OS (Table 4). Additionally, the univariate analysis showed that
TKI use and era of allo-HSCT did not affect OS or DFS (Tables 2
and 4; Figure 1). Hematologic CR at 3 months after allo-HSCT
was also associated with better survival (Table 4).
In the multivariate analysis, male recipients (RR: 1.7, CI 95%: 1.2-
2.5, p=0.007) and patients with advanced disease (RR: 1.8, CI 95%:
1.2-2.8, p=0.005) were associated with worse DFS. Male recipients
(RR: 1.7, CI 95%: 1.1-2.6, p=0.02) were also associated with worse
OS. However, advanced disease phase was not associated with
worse OS. DFS and OS rates were similar between the pre- and
21

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia
Turk J Hematol 2017;34:16-26
Table 3. Treatment and survival after relapse.
Treatment
after relapse
Total, n=57
OS after relapse, mean ± SE
Pre-TKI era relapse, n=32
OS after relapse, mean ± SE
Post-TKI era relapse, n=25
OS after relapse, mean ± SE
p-value
for TKI era
DLI alone, n=15 58.3±19.0 42.4±18.2 67.2±17.0
Therapeutic TKI alone, n=10 95.5±18.6 14.9±14.6 117.5±15.6
Therapeutic TKI+DLI, n=18 86.8±14.4 105.7±13.8 82.4±18.5
Supportive therapy, n=14 6.5±2.9 4.7±2.5 11.4±8.6
Total, n=57 72.1±10.4 44.4±11.7 94.2±10.4 0.003
p-value for treatment

Turk J Hematol 2017;34:16-26
Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia
Table 4. Univariate analysis for all patients for disease-free survival and overall survival.
DFS
OS
Clinical phase
CP1
>CP1
5-year survival,
% ± SD, months
45.9±4.2
23.1±7.1
Hematologic CR at 3 months after allo-HSCT
Reached
Not reached
Stem cell source
PB
BM
TKI era
Pre-TKI
Post-TKI
Pretransplant TKI usage
No
Yes
Recipient sex
Male
Female
Recipient age
1 year
Conditioning regimen
Ablative
RIC
Donor type
Related
Unrelated
Donor sex
Male
Female
Acute GVHD in 100 days, presence
No
Yes
46.2±4.0
0.0±0.0
42.1±5.0
40.0±5.5
44.3±4.5
32.9±6.1
43.4±4.2
30.9±7.3
34.2±4.7
49.3±5.7
39.1±4.9
42.6±5.4
44.8±4.9
35.2±5.4
43.1±4.1
28.1±7.9
41.1±3.7
NR
43.1±4.9
37.5±5.4
47.3±5.3
34.9±4.9
Grade 2-4 acute GVHD in 100 days, presence
No
Yes
Chronic GVHD in 2 years, presence
No
Yes
Donor/recipient sex match
F-M
F-F
M-M
M-F
43.8±4.5
34.3±6.2
29.1±6.9
55.1±4.8
28.2±6.9
48.7±8.3
38.6±6.3
50.2±7.7
10-year survival,
% ± SD, months
41.0±4.3
23.1±7.1
41.5±4.1
0.0±0.0
35.5±5.2
38.3±5.5
41.2±4.6
22.7±8.0
39.5±4.3
27.1±7.4
30.1±4.7
44.9±6.0
33.5±5.0
40.0±5.5
40.4±5.1
31.8±5.4
38.9±4.2
24.6±7.7
36.9±3.8
NR
40.1±5.0
32.4±5.5
43.7±5.5
30.5±4.9
41.4±4.6
27.0±6.2
24.3±7.3
50.1±5.0
22.2±6.6
44.6±8.6
36.2±6.3
45.7±8.3
p
5-year survival,
% ± SD, months

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia
Turk J Hematol 2017;34:16-26
The complications of allo-HSCT were similar in the pre-TKI and
post-TKI era groups, except in regards to hemorrhagic cystitis.
Hemorrhagic cystitis occurred more frequently in the pre-TKI
era, possibly due to the greater frequency of myeloablative
conditioning regimen use during that period [27].
We found that pretransplant administration of TKIs has no
negative impact on engraftment. Furthermore, we considered
the fact that most of the patients in the post-TKI era group
were challenged with an important drug, a TKI. This may have
created clinically or biologically difficult cases, as observed in
lymphoma patients with disease relapse shortly after being
treated with chemotherapy regimens containing rituximab [28].
Conclusion
In conclusion, as expected, the frequency of allo-HSCT for CML
patients sharply decreased after the introduction of TKIs. In
recent years, this rate slightly increased, most likely due to TKI
failure. Although CML patients who underwent allo-HSCT in the
post-TKI era had more advanced disease, early and late outcomes
were comparable between the pre- and post-TKI eras, mostly due
to the high efficiency of TKIs for the treatment of relapses after
allo-HSCT and advancements in the stem cell transplantation
field. In addition, CR after allo-HSCT has improved survival rates
and is the most prominent factor affecting OS and DFS.
Ethics
Ethics Committee Approval: It was approved by the institutional
ethics committee; Informed Consent: Restrospective study.
Authorship Contributions
Concept: Muhit Özcan; Design: Mehmet Özen, Celalettin
Üstün, Bengi Öztürk, Muhit Özcan; Data Collection or
Processing: Mehmet Özen, Celalettin Üstün, Bengi Öztürk,
Pervin Topçuoğlu, Mutlu Arat, Mehmet Gündüz, Erden Atilla,
Gülşen Bolat, Önder Arslan, Taner Demirer, Hamdi Akan, Osman
İlhan, Meral Beksaç, Günhan Gürman, Muhit Özcan; Analysis or
Interpretation: Mehmet Özen, Celalettin Üstün, Bengi Öztürk,
Pervin Topçuoğlu; Literature Search: Mehmet Özen, Celalettin
Üstün, Muhit Özcan; Writing: Mehmet Özen, Celalettin Üstün,
Muhit Özcan.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
Supplement 1. TKI treatment before allogeneic hematopoietic stem cell transplantation.
From 2002 to 2006, although TKIs were available for clinical use, their long-term effects were unknown; therefore, allo-HSCT was performed
for all CML patients during that time period. After 2006, allo-HSCT was mainly considered for TKI-resistant/intolerant CML patients or CML
patients in advanced phases of the disease. In the post-TKI era, allo-HSCT was performed in 65 CML patients: 6 patients in BP, 5 patients in AP,
22 patients in the second chronic phase (CP2), and 32 patients in the first chronic phase (CP1) (7 patients were resistant/intolerant to TKIs, 12
patients were sensitive to TKIs, and 13 patients did not receive TKIs based on the physician’s or patient’s preference due to the lack of knowledge
regarding their long-term effects).
Most patients using TKIs before allo-HSCT were treated with imatinib alone (n=41), 4 patients received both imatinib and dasatinib, and 3
patients were treated with imatinib, dasatinib, and nilotinib before transplantation. Mutational analysis was performed for 9 patients, and only
one patient was positive for the T315I mutation.
Conditioning Regimen
The most frequently used myeloablative conditioning (MAC) regimen contained combined cyclophosphamide (CY) (120 mg/kg i.v.) and busulfan
(3.2 mg/kg i.v. or 4 mg/kg p.o., 4 days) treatment with or without antithymocyte globulin (ATG) (10 mg/kg/day, 4 days) and combined CY (120
mg/kg) and fractionated total-body irradiation (12 Gy) treatment with or without ATG (10 mg/kg/day, 4 days).
Fludarabine-based regimens have been used as RIC regimens: combined fludarabine (30 mg/m 2 i.v., 6 days) and busulfan (3.2 mg/kg i.v. or 4 mg/
kg p.o., 2 days) treatment with or without ATG (10 mg/kg/day, 4 days) or combined fludarabine (30 mg/m 2 , 6 days) and cytarabine (3 g/m 2 b.i.d.,
4 days) treatment with or without ATG (10 mg/kg/day, 4 days). We did not perform in vitro T-cell depletion; however, in vivo T-cell depletion was
accomplished by ATG administration in cases of a mismatched and/or unrelated donor (URD) after both MAC and RIC conditioning regimens.
HLA Matching Status
HLA matching status was defined as follows: well matched if recipient/donor pairs had either no identified HLA mismatches and informative data
for at least 6 loci or matching alleles at HLA-A, -B, and -DRB1; partially matched if recipient/donor pairs had a defined, single-locus mismatch
and/or missing HLA data; and mismatched if recipient/donor pairs had ≥2 allele or antigen mismatches [12,13]. URD was started at our institution
after 2002 for patients who had no HLA-matched donor or related donor with 1 allele mismatched and HLA match statuses were studied for
URD transplants with at least 10 loci or alleles including HLA-A, -B, -C, -DQ, and -DRB1. After 1998, RIC regimens were administered to 21
patients due to either advanced age (≥50 years) or comorbidity. Eleven patients received RIC transplant in a clinical trial comparing the intensity
of conditioning regimens in CP CML patients.
24

Turk J Hematol 2017;34:16-26
Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia
GVHD Prophylaxis
GVHD prophylaxis consisted of methotrexate (Mtx) at 15 mg/m 2 on day +1 and 10 mg/m 2 on days +3 and +6 (and additionally on day +11
for unrelated donor allo-HSCT) and daily cyclosporine (CSA) from day -1 (or -3 for unrelated donor allo-HSCT) to day +180.
Defining and Treating Relapse
Relapse after allo-HSCT was defined by molecular, cytogenetic, or hematologic findings. Between 1989 and 1999, patients were followed
cytogenetically, and molecular evaluation was not the main technique for remission assessment of CML patients. By 1999, molecular techniques
were primarily used in place of cytogenetic techniques. Both molecular and cytogenetic data after allo-HSCT were only available after 1999;
thus, these data were not included in the study. After 1999, patients were followed molecularly by testing BCR-ABL transcripts in RNA samples of
peripheral blood or bone marrow starting at the time of allo-HSCT using a RQ-PCR method (T922, LightCycler Quantification, Roche Diagnostics,
Munich, Germany). The molecular methods for BCR-ABL1 and chimerism studies were performed every 3 months until 1 year, every 6 months
until 5 years, and every 1 year until 10 years after allo-HSCT. Logarithmically increasing levels of BCR-ABL transcript levels in at least 2
consecutive tests were defined as molecular relapse. Hematologic complete remission was defined as the detection of leukocytes at

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia
Turk J Hematol 2017;34:16-26
14. Hughes WT, Armstrong D, Bodey GP, Brown AE, Edwards JE, Feld R, Pizzo P,
Rolston KV, Shenep JL, Young LS. 1997 guidelines for the use of antimicrobial
agents in neutropenic patients with unexplained fever. Infectious Diseases
Society of America. Clin Infect Dis 1997;25:551-573.
15. Febril Nötropeni Çalışma Grubu. Febril nötropenik hastalarda tanı ve tedavi
kılavuzu. Flora 2004;9:5-28 (in Turkish).
16. Gratwohl A, Baldomero H, Aljurf M, Pasquini MC, Bouzas LF, Yoshimi A,
Szer J, Lipton J, Schwendener A, Gratwohl M, Frauendorfer K, Niederwieser
D, Horowitz M, Kodera Y; Worldwide Network of Blood and Marrow
Transplantation. Hematopoietic stem cell transplantation: a global
perspective. JAMA 2010;303:1617-1624.
17. Lee SJ, Kukreja M, Wang T, Giralt SA, Szer J, Arora M, Woolfrey AE, Cervantes
F, Champlin RE, Gale RP, Halter J, Keating A, Marks DI, McCarthy PL,
Olavarria E, Stadtmauer EA, Abecasis M, Gupta V, Khoury HJ, George B, Hale
GA, Liesveld JL, Rizzieri DA, Antin JH, Bolwell BJ, Carabasi MH, Copelan E,
Ilhan O, Litzow MR, Schouten HC, Zander AR, Horowitz MM, Maziarz RT.
Impact of prior imatinib mesylate on the outcome of hematopoietic cell
transplantation for chronic myeloid leukemia. Blood 2008;112:3500-3507.
18. Pavlu J, Szydlo RM, Goldman JM, Apperley JF. Three decades of
transplantation for chronic myeloid leukemia: what have we learned? Blood
2011;117:755-763.
19. Speck B, Bortin MM, Champlin R, Goldman JM, Herzig RH, McGlave PB,
Messner HA, Weiner RS, Rimm AA. Allogeneic bone-marrow transplantation
for chronic myelogenous leukaemia. Lancet 1984;1:665-668.
20. Oyekunle A, Zander AR, Binder M, Ayuk F, Zabelina T, Christopeit M, Stübig T,
Alchalby H, Schafhausen P, Lellek H, Wolschke C, Müller I, Bacher U, Kröger
N. Outcome of allogeneic SCT in patients with chronic myeloid leukemia in
the era of tyrosine kinase inhibitor therapy. Ann Hematol 2013;92:487-496.
21. Khoury HJ, Kukreja M, Goldman JM, Wang T, Halter J, Arora M, Gupta V,
Rizzieri DA, George B, Keating A, Gale RP, Marks DI, McCarthy PL, Woolfrey
A, Szer J, Giralt SA, Maziarz RT, Cortes J, Horowitz MM, Lee SJ. Prognostic
factors for outcomes in allogeneic transplantation for CML in the imatinib
era: a CIBMTR analysis. Bone Marrow Transplant 2012;47:810-816.
22. Jabbour E, Kantarjian H, O’Brien S, Shan J, Quintas-Cardama A, Faderl S,
Garcia-Manero G, Ravandi F, Rios MB, Cortes J. The achievement of an
early complete cytogenetic response is a major determinant for outcome
in patients with early chronic phase chronic myeloid leukemia treated with
tyrosine kinase inhibitors. Blood 2011;118:4541-4546.
23. Branford S, Yeung DT, Parker WT, Roberts ND, Purins L, Braley JA, Altamura
HK, Yeoman AL, Georgievski J, Jamison BA, Phillis S, Donaldson Z, Leong M,
Fletcher L, Seymour JF, Grigg AP, Ross DM, Hughes TP. Prognosis for patients
with CML and >10% BCR-ABL1 after 3 months of imatinib depends on the
rate of BCR-ABL1 decline. Blood 2014;124:511-518.
24. Hehlmann R, Müller MC, Lauseker M, Hanfstein B, Fabarius A, Schreiber
A, Proetel U, Pletsch N, Pfirrmann M, Haferlach C, Schnittger S, Einsele
H, Dengler J, Falge C, Kanz L, Neubauer A, Kneba M, Stegelmann F,
Pfreundschuh M, Waller CF, Spiekermann K, Baerlocher GM, Ehninger G,
Heim D, Heimpel H, Nerl C, Krause SW, Hossfeld DK, Kolb HJ, Hasford J,
Saußele S, Hochhaus A. Deep molecular response is reached by the majority
of patients treated with imatinib, predicts survival, and is achieved more
quickly by optimized high-dose imatinib: results from the randomized CMLstudy
IV. J Clin Oncol 2014;32:415-423.
25. Savani BN, Montero A, Kurlander R, Childs R, Hensel N, Barrett AJ. Imatinib
synergizes with donor lymphocyte infusions to achieve rapid molecular
remission of CML relapsing after allogeneic stem cell transplantation. Bone
Marrow Transplant 2005;36:1009-1015.
26. Chalandon Y, Passweg JR, Schmid C, Olavarria E, Dazzi F, Simula MP,
Ljungman P, Schattenberg A, de Witte T, Lenhoff S, Jacobs P, Volin L,
Iacobelli S, Finke J, Niederwieser D, Guglielmi C; Chronic Leukemia Working
Party of European Group for Blood and Marrow Transplantation. Outcome
of patients developing GVHD after DLI given to treat CML relapse: a study by
the Chronic Leukemia Working Party of the EBMT. Bone Marrow Transplant
2010;45:558-564.
27. Topcuoglu P, Arat M, Ozcan M, Arslan O, Ilhan O, Beksac M, Gurman G. Casematched
comparison with standard versus reduced intensity conditioning
regimen in chronic myeloid leukemia patients. Ann Hematol 2012;91:577-
586.
28. Gisselbrecht C, Glass B, Mounier N, Singh Gill D, Linch DC, Trneny M, Bosly A,
Ketterer N, Shpilberg O, Hagberg H, Ma D, Brière J, Moskowitz CH, Schmitz
N. Salvage regimens with autologous transplantation for relapsed large
B-cell lymphoma in the rituximab era. J Clin Oncol 2010;28:4184-4190.
26

RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0005
Turk J Hematol 2017;34:27-33
Multicenter Retrospective Analysis of Turkish Patients with
Chronic Myeloproliferative Neoplasms
Kronik Miyeloproliferatif Neoplazi Tanılı Türk Hastaların Geriye Dönük ve Çok Merkezli Analizi
Nur Soyer 1 , İbrahim C. Haznedaroğlu 2 , Melda Cömert 1 , Demet Çekdemir 3 , Mehmet Yılmaz 4 , Ali Ünal 5 , Gülsüm Çağlıyan 6 , Oktay Bilgir 6 ,
Osman İlhan 7 , Füsun Özdemirkıran 8 , Emin Kaya 9 , Fahri Şahin 1 , Filiz Vural 1 , Güray Saydam 1
1Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey
2Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey
3Sakarya University Training and Research Hospital, Clinic of Hematology, Sakarya, Turkey
4Gaziantep University Faculty of Medicine, Department of Hematology, Gaziantep, Turkey
5Erciyes University Faculty of Medicine, Department of Hematology, Kayseri, Turkey
6İzmir Bozyaka Training and Research Hospital, Clinic of Hematology, İzmir, Turkey
7Ankara University Faculty of Medicine Hospital, Department of Hematology, Ankara, Turkey
8İzmir Atatürk Training and Research Hospital, Clinic of Hematology, İzmir, Turkey
9İnönü University Faculty of Medicine Hospital, Department of Hematology, Malatya, Turkey
Abstract
Objective: Chronic myeloproliferative neoplasms (CMPNs) that
include polycythemia vera (PV), essential thrombocythemia (ET), and
primary myelofibrosis (PMF) are Philadelphia-negative malignancies
characterized by a clonal proliferation of one or several lineages. The
aim of this report was to determine the demographic features, disease
characteristics, treatment strategies, and survival rates of patients
with CMPNs in Turkey.
Materials and Methods: Across all of Turkey, 9 centers were enrolled
in the study. We retrospectively evaluated 708 CMPN patients’ results
including 390 with ET, 213 with PV, and 105 with PMF.
Results: The JAK2V617F mutation was found positive in 86% of
patients with PV, in 51.5% of patients with ET, and in 50.4% of patients
with PMF. Thrombosis and bleeding at diagnosis occurred in 20.6%
and 7.5% of PV patients, 15.1% and 9% of ET patients, and 9.5% and
10.4% of PMF patients, respectively. Six hundred and eight patients
(85.9%) received cytoreductive therapy. The most commonly used
drug was hydroxyurea (89.6%). Leukemic and fibrotic transformations
occurred at rates of 0.6% and 13.2%. The estimated overall survival
in PV, ET, and PMF patients was 89.7%, 85%, and 82.5% at 10 years,
respectively. There were no significant differences between survival in
ET, PV, and PMF patients at 10 years.
Conclusion: Our patients’ results are generally compatible with the
literature findings, except for the relatively high survival rate in PMF
patients. Hydroxyurea was the most commonly used cytoreductive
therapy. Our study reflects the demographic features, patient
characteristics, treatments, and survival rates of Turkish CMPN
patients.
Keywords: Chronic myeloproliferative neoplasms, Treatment, Survival,
JAK2 mutation
Öz
Amaç: Polisitemia vera (PV), esansiyel trombositemi (ET) ve primer
miyelofibrozu (PMF) içeren kronik miyeloproliferatif neoplaziler
(KMPN), bir ya da birden fazla serinin klonal proliferasyonu ile
karakterize Philadelphia kromozomu negatif olan malignitelerdir. Bu
çalışmanın amacı, Türkiye’de KMPN’li hastaların demografik özellikleri,
hastalık karakteristikleri, tedavi stratejileri ve yaşam oranlarını
belirlemektir.
Gereç ve Yöntemler: Türkiye’nin her yanından 9 merkez çalışmaya
katıldı. Biz geriye dönük olarak ET’li 390, PV’li 213 ve PMF’li 105 hasta
olmak üzere toplam 708 KMPN’li hastanın verisini değerlendirdik.
Bulgular: JAK-2 mutasyonu PV’li hastaların %86’sında, ET’li hastaların
%51,5’inde ve PMF’li hastaların %50,4’ünde pozitif bulundu. Tanıda
tromboz ve kanama, PV’li hastaların sırasıyla %20,6 ve %7,5’inde, ET’li
hastaların %15,1 ve %9’unda ve PMF’li hastaların %9,5 ve %10,4’ünde
saptandı. Altı yüz sekiz hasta (%85,9) sitoredüktif tedavi almıştı.
En sık kullanılan ilaç hidroksiüre (%89,6) idi. Lösemik ve fibrotik
transformasyon sıklığı %0,6 ve %13,2 idi. 10 yıllık hesaplanan toplam
sağkalım PV, ET ve PMF hastalarında sırasıyla %89,7, %85 ve %82,5
idi. 10 yıllık toplam sağkalım açısından ET, PV ve PMF hastalarında
anlamlı fark yoktu.
Sonuç: Sonuçlarımız, PMF hastalarının yüksek sağkalımı hariç
literatürle benzerdir. Hidroksiüre ülkemizdeki en sık kullanılan
sitoredüktif ajandır. Bizim çalışmamız, Türk KMPN hastalarının
demografik özelliklerini, hastaların karakteristiklerini, tedavilerini ve
sağkalım oranlarını yansıtmaktadır.
Anahtar Sözcükler: Kronik miyeloproliferatif neoplaziler, Tedavi,
Sağkalım, JAK2 mutasyonu
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Nur SOYER, M.D.,
Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey
Phone : +90 232 390 42 87
E-mail : drakadnur@yahoo.com
Received/Geliş tarihi: January 04, 2016
Accepted/Kabul tarihi: March 25, 2016
27

Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms
Turk J Hematol 2017;34:27-33
Introduction
Chronic myeloproliferative neoplasms (CMPNs) are
Philadelphia-negative malignancies characterized by a clonal
proliferation of one or several lineages. According to the World
Health Organization (WHO) classification, CMPNs include
polycythemia vera (PV), essential thrombocythemia (ET), and
primary myelofibrosis (PMF) [1]. Their natural history is marked
by thrombohemorrhagic complications and a propensity to
transform into myelofibrosis and acute leukemia [2].
The JAK2V617F mutation is present in a majority of PV patients
(90%-98%), whereas only about 50% of patients with ET
and PMF are affected [3,4]. Mutations other than JAK2 are
calreticulin (CALR) and the myeloproliferative leukemia (MPL)
virus oncogene. CALR mutations occur in 25%-35% of patients
with PMF and 15%-24% with ET. These are rarely seen in PV.
MPL mutations occur in 4% of ET patients, 8% of PMF patients,
and rarely in PV [5].
Thrombotic complications have been reported in 30%-50%
of PV cases and 11%-45% of ET cases [6,7,8]. The incidence
of cardiovascular complications was found to be higher in
PV patients aged >65 years or with a history of thrombosis
than in younger subjects with no history of thrombosis [9].
Leukocytosis was found to be an independent risk factor for
arterial thrombosis in both PV and ET [10,11,12,13]. Thrombotic
complications have been reported in between 7.2% and 11% of
PMF patients [14,15]. Bleeding complications are less common
than thrombotic complications in PV. They were reported in
4.2% of 1545 patients with PV and in 3%-25.7% of patients
with ET [16,17].
Long-term survival in CMPNs is significantly shorter compared
to control populations. In a large study, median survivals were
approximately 20 years for ET, 14 years for PV, and 6 years for
PMF. The incidence of leukemic transformation was 3.8% for
ET, 6.8% for PV, and 14.2% for PMF. Fibrotic transformation
rates were reported as 10.3% in ET and 12.5% in PV [18]. History
of thrombosis, leukocytosis, and advanced age are responsible
for poor survival in both PV and ET [19,20,21,22]. In PMF, poor
survival is predicted by advanced age, leukocytosis, anemia,
transfusion dependency, thrombocytopenia, circulating blasts,
constitutional symptoms, and unfavorable karyotypes [23].
Current treatment in ET and PV is directed primarily at minimizing
the risk of thrombosis and secondarily at alleviating vasomotor
symptoms. According to these goals, patients with PV and ET
are stratified into risk categories and the treatment is tailored
to the patient’s risk group [5]. Low-dose aspirin, hydroxyurea,
interferon-α, and anagrelide can be used for the treatment of
PV and ET. In PMF, the International Prognostic Scoring System
(IPSS) and Dynamic IPSS are used for assessing survival at
diagnosis and at any time in the disease course, respectively.
Therapy is planned according to patients’ risk groups [4].
There has not been a large multicenter study that evaluated the
demographic features, treatments, and survival of patients with
CMPNs in Turkey. The aim of this report was to determine the
demographic features, patient characteristics, treatments, and
survival rates of patients with CMPNs in Turkey.
Materials and Methods
This study was designed as a retrospective multicenter study
from Turkey and was approved by the Ege University Ethics
Committee (Number 13-5.1/6). Across all of Turkey, 9 centers
were enrolled in the study. The primary objective of the study
was to evaluate the demographic features, treatments, and
survival of patients with CMPNs in Turkey. For data collection
from the centers, a case report form was prepared by the primary
investigator. This form consisted of demographic features and
patient characteristics, laboratory data at diagnosis, treatments,
and the last status of patients. The case report forms were
completed by each center’s investigators.
Patients of ≥18 years old with the diagnosis of PV, ET, or PMF
according to WHO criteria were enrolled in the study [24]. Each
center reevaluated their patients who were diagnosed before
acceptance of the WHO criteria. The study population was also
selected based on the availability of clinical and laboratory
information at the time of initial diagnosis. Patients were
excluded if they did not fulfill WHO criteria for PV, ET, or PMF
and if they did not attend follow-ups regularly.
Major arterial thrombosis included transient ischemic attacks,
thrombotic cerebrovascular accidents, angina pectoris,
myocardial infarction, and peripheral arterial thromboembolism.
Major venous thrombosis included deep venous thrombosis of
the peripheral vasculature, pulmonary embolism, and abdominal
vein thrombosis. Bleeding events included gastrointestinal tract
bleeding, intracerebral hemorrhage, and soft tissue hematoma.
Cardiovascular risk factors included hypertension, tobacco use,
diabetes mellitus, and hyperlipidemia.
Patients who were diagnosed with PV without a JAK2V617F
assay were evaluated as “not available” (NA) patients. If we
excluded NA patients from the analysis, JAK2 mutation status
was evaluated in only verified PV patients that had a JAK2V617F
assay.
Risk factors of PMF patients were evaluated with the IPSS at
diagnosis [25]. ET and PV patients were classified into high-risk
and low-risk categories according to their age and history of
thrombosis [26].
Treatment data were obtained according to specific therapies
including cytoreductive therapy, antiplatelet therapy,
28

Turk J Hematol 2017;34:27-33
Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms
androgens, steroids, thalidomide, erythropoiesis-stimulating
agents, splenectomy, ruxolitinib, and red blood cell transfusions.
If there was more than one specific treatment in the patient’s
history, these therapies were also recorded. If allogeneic stem
cell transplantation was performed it was also recorded.
Leukemic transformation was defined according to the WHO
criteria for acute leukemia [24]. The WHO diagnostic criteria
for PMF were applied to assign the disease transformation into
post-PV and post-ET myeloproliferative categories.
Statistical Analysis
All the statistical analyses were performed by using the data
obtained from the patients’ files. Demographic and disease
characteristics of the patients were summarized for all patients
using descriptive statistics.
Statistical analyses were performed using SPSS 16.0 and Excel
2007. The variables were first assessed by Kolmogorov-Smirnov/
Shapiro-Wilk testing in terms of normal distribution. The results
were provided as mean ± standard deviation for normally
distributed variables and as median (minimum-maximum) for
abnormally distributed parameters. All analyses were based on
the laboratory parameters obtained at the time of diagnosis. All
p-values were two-tailed and statistical significance was set at
the level of p

Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms
Turk J Hematol 2017;34:27-33
1.0 ET
PMF
PV
ET-consored
PMF-consored
PV-consored
0.8
1.0
0.8
Survival Functions
Cum Survival
0.6
0.4
Cum Survival
0.6
0.4
0.2
0.2
0.0
0.0
0.00 100.00 200.00 300.00 400.00
Time (Month)
Figure 1. Overall survival of chronic myeloproliferative neoplasm
patients.
ET: Essential thrombocythemia, PMF: primary myelofibrosis, PV: polycythemia vera.
0 50 100 150 200 250
Time (Month)
Figure 2. Overall survival of primary myelofibrosis patients
according to the International Prognostic Scoring System.
Table 1. Clinical and hematological data of patients at diagnosis.
CMPN PV ET PMF
No. of patients 708 213 390 105
Age at diagnosis, years (range) 55.5 (17-89) 47.5 (17-86) 41.5 (17-89) 69.5 (19-87)
Sex, M/F
M/F ratio
339/369
1/1.08
132/81
1/0.61
151/239
1/1.58
Family history, yes/no 14/694 6/207 7/383 1/104
Thrombosis at diagnosis/before diagnosis, yes/no
56/49
1/0.87
113/595 44/169 59/331 10/95
Arterial thrombosis 21 30 7
Venous thrombosis 23 27 3
Both arterial and venous 0 2 0
Bleeding at diagnosis, yes/no 62/646 16/197 35/355 11/94
White blood cell count, x10 9 /L (range) 10.2 (1.5-73) 11.05 (3.7-73) 8.25 (2.76-48) 9.45 (2-51.1)
Platelet count, x10 9 /L (range) 734 (15-2600) 239 (63-1413) 573 (35-2600) 291 (15-2500)
Hemoglobin level, g/L (range) 14.3 (3.4-23.9) 18.5 (9.5-23.9) 14.3 (3.4-18.5) 10.75 (6.6-17.7)
LDH levels, normal/high 341/367 73/140 247/143 21/84
Constitutional symptoms, yes/no 150/558 38/175 67/323 45/60
Pruritus, yes/no 159/549 83/130 55/335 16/89
Splenomegaly, yes/no 307/401 135/78 77/313 95/10
Hepatomegaly, yes/no 129/579 44/169 45/345 40/65
JAK2V617F mutation, positive/negative/NA 414/203/91 160/26/27 201/133/56 53/44/8
MPL mutation, yes/no/NA 3/200/505 0/39/174 3/112/275 0/49/56
History of secondary malignancies, yes/no 10/691 4/206 4/382 2/103
M: Male, F: female, LDH: lactate dehydrogenase, NA: not available, CMPN: chronic myeloproliferative neoplasm PV: polycythemia vera, ET: essential thrombocythemia, PMF: primary
myelofibrosis.
30

Turk J Hematol 2017;34:27-33
Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms
Table 2. First-line treatment choices and risk stratification of patients.
CMPN PV ET PMF
n=708 % n=213 % n=390 % n=105 %
Cytoreductive therapy, yes 608 85.9 185 86.8 354 90.7 69 65.7
Hydroxyurea 545 89.6 174 94 306 86.4 65 94.2
Anagrelide 29 4.8 0 0 27 7.6 2 2.9
Interferon 34 5.6 11 6 21 6.0 2 2.9
Antiplatelet therapy 553 78.1 177 83 327 83.8 49 46.7
Risk stratification
Low 105 49.2 202 51.8 30 28.5
Intermediate-1 45 42.9
Intermediate-2 22 21
High 108 50.8 188 48.2 8 7.6
CMPN: Chronic myeloproliferative neoplasm PV: polycythemia vera, ET: essential thrombocythemia, PMF: primary myelofibrosis.
Discussion
The aim of this study was to determine the demographic
features, patient characteristics, treatments, and survival rates
of patients with CMPNs in Turkey. We evaluated 708 patients
from 9 centers across all of Turkey. This study was planned as
a multicenter and retrospective trial so that we might evaluate
CMPN practices in Turkey.
In our study, the incidence of JAK2 mutation, the history of
thrombosis, and the median age at diagnosis were lower than in
the literature [3,4,9]. After excluding NA patients from analysis,
the incidence of JAK2 mutation (86%) was closer to that of
other studies. The incidence of bleeding was comparable to
that reported in the literature [6,16]. Thrombotic complications
were reported in 30% to 50% of PV patients in other studies
[6,7]. Epidemiological studies have reported that the incidence
of thrombosis increases with age [27]. Lower median age at
diagnosis might be related to a lower incidence of thrombosis.
Almost all patients with PV harbor a JAK2 mutation that
includes JAK2V617F and JAK2 exon 12 [4]. Additionally, JAK2
exon 12 mutation has been associated with younger age at
diagnosis [28]. The lower incidence of JAK2V617F in our series
might be associated with younger age at diagnosis, preanalytical
mistakes, and problems of laboratory analysis, such as the exon
12 mutation not being analyzed in all centers routinely. The
type of sample, the cellular fraction of the sample, and the
nucleic acid template were considered for the detection of the
JAK2 mutation. Additionally, some qualitative methods like
the Sanger sequencing method used for detection of the JAK2
mutation underestimated the number of patients harboring
the mutation [29]. The inability of qualitative assays to identify
those patients with lower allele burdens is another problem.
All of these factors seem to be related to low JAK2 mutation
positivity.
Another issue is that we determined a low hemoglobin value
at diagnosis in one patient who was diagnosed with PV. This
patient was evaluated because of portal vein thrombosis and
at the time of evaluation had gastrointestinal bleeding due to
warfarin use. JAK2V617F mutation was found positive.
MPL mutation was reported in approximately 4% of ET patients
and 8% of PMF patients [5]. The frequency of MPL mutation in
ET patients (2.6%) was similar to rates reported in the literature.
We did not detect MPL mutations in our PMF and PV patients.
These results might be related to the low number of patients
who were detected with this mutation.
In our ET patients, median age at diagnosis, the incidence of
thrombosis and bleeding at diagnosis, and JAK2 mutation
positivity were compatible with literature findings [4,8,17]. In
our PMF patients, the incidence of thrombosis and bleeding at
diagnosis and JAK2 mutation positivity were compatible with
the literature but median age at diagnosis was slightly higher
[14,15,18].
The estimated OS was 86.7% at 10 years in our CMPN patients.
The 10-year and 3-year OS of CMPN patients was 72% and
80%, respectively [30,31]. The 10-year OS in PV patients was
reported to be between 56% and 83% [32,33]. In our ET and PV
patients, OS rates were similar to those of previous studies. The
10-year OS in PMF patients (21%-46%) was significantly worse
than that of patients with ET or PV [32,33]. In our PMF patients,
we found that the 10-year survival was 82.5% with a median 19
months of follow-up. It is important that 71.4% of PMF patients
in our study had low or intermediate-1 risk. This finding might
explain our high survival rate in PMF patients.
Previous studies suggested that survival in myeloproliferative
neoplasm patients can be influenced by several factors such
as increased age, male sex, and PMF subtype of CMPN, which
are associated with decreased survival in myeloproliferative
31

Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms
Turk J Hematol 2017;34:27-33
neoplasms [30,31,32,34,35]. Geography and ethnicity can also
impact survival [32,36].
Although approximately 50% of patients with ET and PV were
classified into the low risk group according to risk stratification
in our series, 86.8% of PV patients and 90.7% of ET patients
received cytoreductive therapy. This might be associated with
cardiovascular risk factors that were determined in 42.8% of
603 patients with ET and PV.
The incidence of secondary malignancy was reported to be
between 8% and 20% [37,38]. Our secondary malignancy
incidence was lower than that in the literature. It is possible
that secondary malignancies were underestimated in our series.
In our study, the leukemic transformation rate was lower than
in the literature. Leukemic and fibrotic transformation rates
were reported as 3.8%-14.2% in CMPNs and 10.3%-12.5% in
ET and PV, respectively [18]. The low leukemic transformation
rate might be associated with several factors. First, this was a
retrospective study, so some data were not found because of
inadequate records. Second, PMF incidence is highest in elderly
patients. In our study, patients were excluded if they did not
have regular follow-ups and this resulted in the exclusion of
some patients diagnosed with CMPNs at older ages who could
not attend regular appointments because of socioeconomic
conditions.
Conclusion
Our patients’ results are generally compatible with literature
findings, except for the relatively high survival rate in
PMF patients. Hydroxyurea was the most commonly used
cytoreductive therapy in our study. This study reflects the
demographic features, patient characteristics, treatments, and
survival rates of patients with CMPNs in Turkey.
Ethics
Ethics Committee Approval: Ege University Ethics Committee
(Number 13-5.1/6); Informed Consent: Retrospective study.
Authorship Contributions
Concept: Nur Soyer, İbrahim C. Haznedaroğlu, Melda Cömert, Demet
Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir,
Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural,
Güray Saydam; Design: Nur Soyer, İbrahim C. Haznedaroğlu, Melda
Cömert, Demet Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan,
Oktay Bilgir, Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin,
Filiz Vural, Güray Saydam; Data Collection or Processing: Nur Soyer,
İbrahim C. Haznedaroğlu, Melda Cömert, Demet Çekdemir, Mehmet
Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir, Osman İlhan, Füsun
Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural, Güray Saydam;
Analysis or Interpretation: Nur Soyer, İbrahim C. Haznedaroğlu,
Melda Cömert, Demet Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm
Çağlıyan, Oktay Bilgir, Osman İlhan, Füsun Özdemirkıran, Emin Kaya,
Fahri Şahin, Filiz Vural, Güray Saydam; Literature Search: Nur Soyer,
İbrahim C. Haznedaroğlu, Melda Cömert, Demet Çekdemir, Mehmet
Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir, Osman İlhan, Füsun
Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural, Güray Saydam;
Writing: Nur Soyer, İbrahim C. Haznedaroğlu, Melda Cömert, Demet
Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir,
Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural,
Güray Saydam.
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials included.
References
1. Tefferi A, Vardiman JW. Classification and diagnosis of myeloproliferative
neoplasms: the 2008 World Health Organization criteria and point-of-care
diagnostic algorithms. Leukemia 2008;22:14-22.
2. Barbui T, Finazzi G, Falanga A. Myeloproliferative neoplasms and thrombosis.
Blood 2013;122:2176-2184.
3. Tefferi A, Vainchenker W. Myeloproliferative neoplasms: molecular
pathophysiology, essential clinical understanding, and treatment strategies.
J Clin Oncol 2011;29:573-582.
4. Tefferi A. Myeloproliferative neoplasms 2012: the John M. Bennett 80th
birthday anniversary lecture. Leuk Res 2012;36:1481-1489.
5. Tefferi A, Barbui T. Polycythemia vera and essential thrombocythemia: 2015
update on diagnosis, risk-stratification and management. Am J Hematol
2015;90:162-173.
6. Marchioli R, Finazzi G, Landolfi R, Kutti J, Gisslinger H, Patrono C, Marilus R,
Villegas A, Tognoni G, Barbui T. Vascular and neoplastic risk in a large cohort
of patients with polycythemia vera. J Clin Oncol 2005;23:2224-2232.
7. Gruppo Italiano Studio Policitemia. Polycythemia vera: the natural history
of 1213 patients followed for 20 years. Ann Intern Med 1995;123:656-664.
8. Elliott MA, Tefferi A. Thrombosis and hemorrhage in polycythemia vera and
essential thrombocythemia. Br J Haematol 2005;128:275-290.
9. Landolfi R, Marchioli R, Kutti J, Gisslinger H, Tognoni G, Patrono C, Barbui
T; European Collaboration on Low-Dose Aspirin in Polycythemia Vera
Investigators. Efficacy and safety of low dose aspirin in polycythemia vera.
N Engl J Med 2004;350:114-124.
10. Landolfi R, Di Gennaro L, Barbui T, De Stefano V, Finazzi G, Marfisi R,
Tognoni G, Marchioli R; European Collaboration on Low-Dose Aspirin in
Polycythemia Vera (ECLAP). Leukocytosis as a major thrombotic risk factor
in patients with polycythemia vera. Blood 2007;109:2446-2452.
11. Wolanskyj AP, Schwager SM, McClure RF, Larson DR, Tefferi A. Essential
thrombocythemia beyond the first decade: life expectancy, long term
complication rates, and prognostic factors. Mayo Clin Proc 2006;81:159-
166.
12. Carobbio A, Finazzi G, Guerini V, Spinelli O, Delaini F, Marchioli R, Borrelli G,
Rambaldi A, Barbui T. Leukocytosis is a risk factor for thrombosis in essential
thrombocythemia: interaction with treatment, standard risk factors, and
Jak2 mutation status. Blood 2007;109:2310-2313.
13. Palandri F, Polverelli N, Catani L, Ottaviani E, Baccarani M, Vianelli N. Impact
of leukocytosis on thrombotic risk and survival in 532 patients with essential
thrombocythemia: a retrospective study. Ann Hematol 2011;90:933-938.
14. Cervantes F, Alvarez-Larrán A, Arellano-Rodrigo E, Granell M, Domingo
A, Montserrat E. Frequency and risk factors for thrombosis in idiopathic
myelofibrosis: analysis in a series of 155 patients from a single institution.
Leukemia 2006;20:55-60.
32

Turk J Hematol 2017;34:27-33
Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms
15. Barbui T, Carobbio A, Cervantes F, Vannucchi AM, Guglielmelli P, Antonioli
E, Alvarez-Larrán A, Rambaldi A, Finazzi G, Barosi G. Thrombosis in primary
myelofibrosis: incidence and risk factors. Blood 2010;115:778-782.
16. Tefferi A, Rumi E, Finazzi G, Gisslinger H, Vannucchi AM, Rodeghiero F,
Randi ML, Vaidya R, Cazzola M, Rambaldi A, Gisslinger B, Pieri L, Ruggeri
M, Bertozzi I, Sulai NH, Casetti I, Carobbio A, Jeryczynski G, Larson DR,
Müllauer L, Pardanani A, Thiele J, Passamonti F, Barbui T. Survival and
prognosis among 1545 patients with contemporary polycythemia vera: an
international study. Leukemia 2013;27:1874-1881.
17. Chim CS, Kwong YL, Lie AK, Ma SK, Chan CC, Wong LG, Kho BC, Lee HK,
Sim JP, Chan CH, Chan JC, Yeung YM, Law M, Liang R. Long-term outcome
of 231 patients with essential thrombocythemia: prognostic factors
for thrombosis, bleeding, myelofibrosis, and leukemia. Arch Intern Med
2005;165:2651-2658.
18. Tefferi A, Guglielmelli P, Larson DR, Finke C, Wassie EA, Pieri L, Gangat N,
Fjerza R, Belachew AA, Lasho TL, Ketterling RP, Hanson CA, Rambaldi A, Finazzi
G, Thiele J, Barbui T, Pardanani A, Vannucchi AM. Long-term survival and
blast transformation in molecularly annotated essential thrombocythemia,
polycythemia vera, and myelofibrosis. Blood 2014;124:2507-2513.
19. Gangat N, Strand J, Li CY, Wu W, Pardanani A, Tefferi A. Leucocytosis
in polycythaemia vera predicts both inferior survival and leukaemic
transformation. Br J Haematol 2007;138:354-358.
20. Passamonti F, Rumi E, Pungolino E, Malabarba L, Bertazzoni P, Valentini
M, Orlandi E, Arcaini L, Brusamolino E, Pascutto C, Cazzola M, Morra E,
Lazzarino M. Life expectancy and prognostic factors for survival in patients
with polycythemia vera and essential thrombocythemia. Am J Med
2004;117:755-761.
21. Gangat N, Wolanskyj AP, McClure RF, Li CY, Schwager S, Wu W, Tefferi A.
Risk stratification for survival and leukemic transformation in essential
thrombocythemia: a single institutional study of 605 patients. Leukemia
2007;21:270-276.
22. Passamonti F, Rumi E, Arcaini L, Boveri E, Elena C, Pietra D, Boggi S, Astori
C, Bernasconi P, Varettoni M, Brusamolino E, Pascutto C, Lazzarino M.
Prognostic factors for thrombosis, myelofibrosis, and leukemia in essential
thrombocythemia: a study of 605 patients. Haematologica 2008;93:1645-
1651.
23. Gangat N, Caramazza D, Vaidya R, George G, Begna K, Schwager S, Van
Dyke D, Hanson C, Wu W, Pardanani A, Cervantes F, Passamonti F, Tefferi
A. DIPSS Plus: A refined Dynamic International Prognostic Scoring System
for primary myelofibrosis that incorporates prognostic information from
karyotype, platelet count, and transfusion status. J Clin Oncol 2011;29:392-
397.
24. Vardiman JW, Thiele J, Arber DA, Brunning RD, Borowitz MJ, Porwit A, Harris
NL, Le Beau MM, Hellström-Lindberg E, Tefferi A, Bloomfield CD. The 2008
revision of the World Health Organization (WHO) classification of myeloid
neoplasms and acute leukemia: rationale and important changes. Blood
2009;114:937-951.
25. Cervantes F, Dupriez B, Pereira A, Passamonti F, Reilly JT, Morra E,
Vannucchi AM, Mesa RA, Demory JL, Barosi G, Rumi E, Tefferi A. New
prognostic scoring system for primary myelofibrosis based on a study of
the International Working Group for Myelofibrosis Research and Treatment.
Blood 2009;113:2895-2901.
26. Barbui T, Barosi G, Birgegard G, Cervantes F, Finazzi G, Griesshammer M,
Harrison C, Hasselbalch HC, Hehlmann R, Hoffman R, Kiladjian JJ, Kröger
N, Mesa R, McMullin MF, Pardanani A, Passamonti F, Vannucchi AM, Reiter
A, Silver RT, Verstovsek S, Tefferi A; European LeukemiaNet. Philadelphianegative
classical myeloproliferative neoplasms: critical concepts and
management recommendations from European LeukemiaNet. J Clin Oncol
2011;29:761-770.
27. Landolfi R, Di Gennaro L, Falanga A. Thrombosis in myeloproliferative
disorders: pathogenetic facts and speculation. Leukemia 2008;22:2020-
2028.
28. Passamonti F, Elena C, Schnittger S, Skoda RC, Green AR, Girodon F, Kiladjian
JJ, McMullin MF, Ruggeri M, Besses C, Vannucchi AM, Lippert E, Gisslinger H,
Rumi E, Lehmann T, Ortmann CA, Pietra D, Pascutto C, Haferlach T, Cazzola
M. Molecular and clinical features of the myeloproliferative neoplasm
associated with JAK2 exon 12 mutations. Blood 2011;117:2813-2816.
29. Langabeer SE, Andrikovics H, Asp J, Bellosillo B, Carillo S, Haslam K,
Kjaer L, Lippert E, Mansier O, Oppliger Leibundgut E, Percy MJ, Porret N,
Palmqvist L, Schwarz J, McMullin MF, Schnittger S, Pallisgaard N, Hermouet
S; MPN&MPNr-EuroNet. Molecular diagnostics of myeloproliferative
neoplasms. Eur J Haematol 2015;95:270-279.
30. Hultcrantz M, Kristinsson SY, Andersson TM, Landgren O, Eloranta S, Derolf
AR, Dickman PW, Björkholm M. Patterns of survival among patients with
myeloproliferative neoplasms diagnosed in Sweden from 1973 to 2008: a
population-based study. J Clin Oncol 2012;30:2995-3001.
31. Rollison DE, Howlader N, Smith MT, Strom SS, Merritt WD, Ries LA, Edwards
BK, List AF. Epidemiology of myelodysplastic syndromes and chronic
myeloproliferative disorders in the United States, 2001-2004, using data
from the NAACCR and SEER programs. Blood 2008;112:45-52.
32. Maynadié M, Girodon F, Manivet-Janoray I, Mounier M, Mugneret F, Bailly
F, Favre B, Caillot D, Petrella T, Flesch M, Carli PM. Twenty-five years of
epidemiological recording on myeloid malignancies: data from the
specialized registry of hematologic malignancies of Cote d’Or (Burgundy,
France). Haematologica 2011;96:55-61.
33. Malak S, Labopin M, Saint-Martin C, Bellanne-Chantelot C, Najman A;
French Group of Familial Myeloproliferative Disorders. Long term follow
up of 93 families with myeloproliferative neoplasms: life expectancy and
implications of JAK2V617F in the occurrence of complications. Blood Cells
Mol Dis 2012;49:170-176.
34. Cervantes F, Dupriez B, Passamonti F, Vannucchi AM, Morra E, Reilly
JT, Demory JL, Rumi E, Guglielmelli P, Roncoroni E, Tefferi A, Pereira A.
Improving survival trends in primary myelofibrosis: an international study. J
Clin Oncol 2012;30:2981-2987.
35. Passamonti F, Rumi E, Pungolino E, Malabarba L, Bertazzoni P, Valentini
M, Orlandi E, Arcaini L, Brusamolino E, Pascutto C, Cazzola M, Morra E,
Lazzarino M. Life expectancy and prognostic factors for survival in patients
with polycythemia vera and essential thrombocythemia. Am J Med
2004;117:755-761.
36. Xu Z, Gale RP, Zhang Y, Qin T, Chen H, Zhang P, Zhang T, Liu L, Qu S, Xiao Z.
Unique features of primary myelofibrosis in Chinese. Blood 2012;119:2469-
2473.
37. Khanal N, Giri S, Upadhyay S, Shostrom VK, Pathak R, Bhatt VR. Risk
of second primary malignancies and survival of adult patients with
polycythemia vera: a United States population-based retrospective study.
Leuk Lymphoma 2016;57:129-133.
38. Stein BL, Moliterno AR, Tiu RV. Polycythemia vera disease burden:
contributing factors, impact on quality of life, and emerging treatment
options. Ann Hematol 2014;93:1965-1976.
33

RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0115
Turk J Hematol 2017;34:34-39
TP53 Staining in Tissue Samples of Chronic Lymphocytic
Lymphoma Cases: An Immunohistochemical Survey of 51 Cases
Kronik Lenfositik Lenfoma Hastalarının Doku Örneklerinde TP53 Boyaması: Elli Bir Hastanın
İmmünohistokimya ile Değerlendirilmesi
İbrahim Kulaç 1 *, Çetin Demir 2 , Yahya Büyükaşık 3 , Tezer Kutluk 2 , Ayşegül Üner 1
1Hacettepe University Faculty of Medicine, Department of Pathology, Ankara, Turkey
2Hacettepe University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Oncology, Drug Resistance Laboratory, Ankara, Turkey
3Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey
*Author is currently appointed at Johns Hopkins University Faculty of Medicine, Baltimore, USA
Abstract
Objective: Chronic lymphocytic leukemia (CLL) is the most common
lymphoproliferative disease in adults. The aim of this study is to find
out if the extent of proliferation centers or the immunohistochemical
expression of p53 is related to disease prognosis.
Materials and Methods: In the scope of this study, 54 biopsy
specimens from 51 patients (50 of lymph nodes; the others of spleen,
tonsil, orbit, and liver) diagnosed with CLL at the Hacettepe University
Department of Pathology in 2000-2013 were reevaluated. The clinical
and demographic data of the patients were obtained from our patient
database. Biopsy samples were assessed semi-quantitatively for the
percentage of proliferation center/total biopsy area (PC/TBA) and an
immunohistochemical study was performed on representative blocks
of tissues for p53 expression.
Results: When the patients were divided into two categories according
to Rai stage as high and low (stages 0, 1, and 2 vs. stages 3 and 4), it
was seen that patients with low Rai stage had a better prognosis than
those with high stages (p=0.030). However, there was no statistically
significant correlation between overall survival and PC/TBA ratio or
p53 expression levels.
Conclusion: In our cohort, PC/TBA ratio and immunopositivity of p53
did not show correlations with overall survival.
Keywords: TP53, Immunohistochemistry, Chronic lymphocytic
lymphoma, Proliferation centers
Öz
Amaç: Kronik lenfositik lösemi (KLL) erişkin bireylerde en sık görülen
lenfoproliferatif hastalıktır. Bu çalışmanın amacı KLL tanısı almış
hastaların doku örneklerindeki proliferasyon merkezlerinin yaygınlığı
ve p53 ekspresyonu ile prognozları arasında bağlantı olup olmadığını
araştırmaktır.
Gereç ve Yöntemler: Bu çalışma kapsamında Hacettepe Üniversitesi
Tıp Fakültesi Hastanesi Patoloji Anabilim Dalı’nda 2000-2013 yılları
arasında KLL tanısı almış 51 hastanın 54 biyopsi örneği yeniden
değerlendirilmiştir. Hastaların klinik ve demografik verileri hasta veri
tabanından elde edilmiştir. Yapılan incelemede biyopsi örneklerinde
proliferasyon merkezlerinin tüm biyopsi alanına oranı (PM/TBA) yarı
niceleyici olarak değerlendirilmiş ve seçilen temsili bloklardan elde
edilen kesitlerde immünohistokimyasal yöntemle p53 ekspresyonuna
bakılmıştır.
Bulgular: Hastalar Rai evrelerine göre düşük ve yüksek olmak üzere iki
gruba ayrıldığında düşük evreli hastaların genel sağkalım sürelerinin
yüksek evreli hastalara göre daha uzun olduğu görülmüştür (p=0,030).
Ancak, proliferasyon merkezi oranı veya p53 ekspresyon düzeyleri
arasında istatistiksel olarak anlamlı ilişki gösterilememiştir.
Sonuç: Çalışmamıza dahil edilen hasta grubunda PM/TBA oranı ve p53
immünpozitifliginin sağkalım ile ilişkisi olmadığı görülmüştür.
Anahtar Sözcükler: TP53, İmmünohistokimya, Kronik lenfositik
lenfoma, Proliferasyon merkezleri
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: İbrahim KULAÇ, M.D.,
Johns Hopkins University Faculty of Medicine, Baltimore, USA
Phone : +1 410 502 7354
E-mail : dribrahimkulac@gmail.com
Received/Geliş tarihi: March 20, 2016
Accepted/Kabul tarihi: May 09, 2016
34

Turk J Hematol 2017;34:34-39
Kulaç İ, et al: TP53 Alterations in Chronic Lymphocytic Lymphoma Patients
Introduction
Chronic lymphocytic leukemia (CLL) is the most common
lymphoproliferative disorder of adults in Western countries
[1]. A vast majority of the patients present at Rai stage 0 or
1, most incidentally diagnosed during routine blood work-up
[2]. Although lymph node biopsy is not a standard first-line
diagnostic tool, in some instances such as transformation or
an unexpected clinical course, it is indicated. In hematoxylin
and eosin-stained sections of involved lymph nodes it is
characterized by a diffuse infiltrate of small uniform cells
with occasional segregation of relatively larger cells (Figure
1). It is well known that a large percentage of patients will be
followed for a long time without progression, but some will
eventually progress and require treatment. For decades several
different parameters have been used to identify patients with
a predisposition to progression. lymphocyte doubling time or
several biochemical and flow cytometry-based markers are
widely used for this purpose [3,4,5,6]. Though these are still
important, novel molecular tests offer a wide range of highly
impactful markers [7]. Several chromosomal abnormalities
have also been shown as considerable prognosticators, such
as del13q14, trisomy12, del11q22-23, and del17p13, as well as
translocations that include 14q32 and are the most commonly
used ones in routine hematology/pathology practice [8,9].
Mutations on the short arm of chromosome 17 have also been
studied extensively and shown as some of the most important
cytogenetic alterations associated with adverse prognosis
[10,11,12]. Patients with 17p13 deletion tend to have the worst
outcome compared to patients with any other cytogenetic or
mutational anomalies and they also have a better response to
certain types of treatments [13,14]. The 17p13 locus harbors
TP53, one of the most important genes in cancer pathogenesis.
The presence of TP53 alterations in CLL patients has been
reported at between 7% and 33% in the literature [14,15,16,17].
Immunohistochemical methods, by using anti-p53 antibody,
have been utilized for detection of p53 alterations for years.
Although interpretation varies in different tumor types, it is
highly reliable as a surrogate marker. However, there are no
Figure 1. Representative images of a lymph node with chronic lymphocytic leukemia involvement. On low power, lightly colored areas
represent proliferation centers (A). Proliferation centers are rich in prolymphocytic cells (C). Other areas are predominantly composed of
small lymphocytic cells (B and D).
35

Kulaç İ, et al: TP53 Alterations in Chronic Lymphocytic Lymphoma Patients
Turk J Hematol 2017;34:34-39
studies on immunohistochemical assessment of p53 alteration
using formalin-fixed paraffin-embedded (FFPE) solid organ
samples of CLL patients.
In this study, our aim was to identify the frequency and the
effect on overall survival (OS) of TP53 abnormalities in FFPE
tissue samples in a cohort of 51 patients from a single institution,
and we also evaluated the impact of some clinical parameters
on clinical outcome.
Materials and Methods
Fifty-four solid organ biopsies from 51 patients, which were
evaluated between 2000 and 2013 at the Hacettepe University
Department of Pathology, were included in the study. Patients’
date of initial diagnosis, date of the biopsy procedure, followup
time, date of death if applicable, and platelet, leukocyte,
hemoglobin, lactate dehydrogenase, and absolute lymphocyte
levels were recorded.
Because of potential decalcification artifacts and the paucity
of neoplastic cells in bone marrow samples, we decided to use
samples from solid organ biopsies (especially lymph nodes),
which are larger in size and free of decalcification artifacts.
Morphological Evaluation
All the biopsy samples were reevaluated by two pathologists
(A.Ü., İ.K.). The percentage of the area of proliferation centers
(PCs) was determined semi-quantitatively for each biopsy sample
using hematoxylin and eosin-stained slides after selecting the
most representative slide. Tru-Cut biopsies and liver and spleen
biopsy samples were excluded from this particular scoring.
Immunohistochemical Studies
For the detection of p53 protein in samples, immunohistochemical
studies were performed on sections of 5 µm obtained from one
representative block from each sample. All stainings were done
automatically by using anti-p53 antibody (ScyTek, Logan, UT,
USA; Clone: DO-7, Lot: 23081) and the iView TM DAB Detection
Kit (Ventana, Tucson, AZ, USA) on the Ventana Benchmark
XT platform. Figure 2 demonstrates p53 staining of two
representative cases.
The p53 staining was scored semi-quantitatively as the
percentage of nuclear-positive cells among all cells by selecting
10 random areas on each slide, counting at least 500 cells in
each selected area, and calculating the mean of each individual
value.
Statistical Analysis
Numeric variables were analyzed by their mean and minimummaximum
values, while categorical variables were included
in analysis as numbers and percentages. Categorical and
continuous data were compared by the chi-square test (or
Fisher exact test if required by sample size) and Mann-Whitney
U test, respectively. The Spearman correlation coefficient was
used for the comparison of two numeric variables. OS was
calculated from diagnosis to the date of mortality of any reason.
The patients who did not die were censored at the last followup
for OS computation. Survival analyses were computed by
Figure 2. p53 expression detected by immunohistochemistry: A) a case with >90% p53 positivity; B) a case with 10% p53 positivity.
36

Turk J Hematol 2017;34:34-39
Kulaç İ, et al: TP53 Alterations in Chronic Lymphocytic Lymphoma Patients
the Kaplan-Meier method. Comparisons of survival rates were
done by log-rank test. The statistical significance threshold was
accepted as p5%. Survival analysis between these two groups did not
show a statistically significant difference, as displayed in Figure
5 (log rank, χ 2 =0.08, p=0.7771).
Five of the biopsies showed focal prolymphocytic transformation;
while two of these biopsies showed no p53 staining, the other
three had p53 scores of 15%, 60%, and 100%. Because the
number of biopsies with transformation was small, statistical
analysis could not be performed to evaluate the correlation of
p53 alteration and prolymphocytic transformation.
Morphological and Immunohistochemical Findings
Fifty of the 54 samples were from lymph node biopsies and
the rest were from tonsil, liver, orbit, or spleen. Samples were
evaluated and the percentages of the area of PCs were recorded
using hematoxylin and eosin slides. The percentage of PCs
as a continuous variable did not seem to have a relationship
with the death rate. Another survival analysis was performed
after dividing patients into two groups using a cut-off of 40%.
Figure 4. Distribution of p53 expression through biopsy samples.
1.0
Early RAI stage
Advanced RAI stage
1.0
p53 expression

Kulaç İ, et al: TP53 Alterations in Chronic Lymphocytic Lymphoma Patients
Turk J Hematol 2017;34:34-39
Discussion
CLL is a substantial health problem for the entire world, but
specifically for developed countries as it is mainly a disease
of the elderly. With the increase of overall life expectancy the
number of CLL patients will increase accordingly. Although
the vast majority of CLL patients remain in a dormant state,
some will rapidly (and sometimes unexpectedly) progress and
display an aggressive course. Some prognostic factors have been
proposed over the years; among them, alterations in the TP53
gene (including cytogenetic alterations in chromosome 17)
stand out as those with the most impact.
Among clinical parameters, Rai staging seems to be a reliable
and consistent indicator for CLL patients, and in our study, we
also showed that advanced Rai stage is associated with a worse
disease outcome.
PCs in CLL are predominantly composed of larger cells with open
chromatin, larger nuclei, and relatively prominent nucleoli. For
years, researchers believed that the extent of PCs was associated
with worse prognosis since PCs are metabolically and mitotically
active zones. So far, however, only a limited number of studies
showed findings that supported this hypothesis [18], while
others usually failed to demonstrate a correlation between the
extent of PCs and prognosis [19,20,21]. In our study, we also
could not show a significant correlation. Larger cohorts are
needed to clarify this issue.
Studies in various tumor types showed variable patterns of p53
staining that correlated with alterations in TP53 at the genomic
level. In one study, it was reported that >5% of p53 staining
in hepatocellular carcinoma is a reliable surrogate marker for
TP53 gene alterations [22]. In a different study published in
2011, Yemelyanova et al. showed that diffuse positivity of p53
staining in ovarian carcinoma cases is highly correlated with
TP53 mutation [23]. Thus, setting a threshold for p53 positivity
and enabling immunohistochemistry to reflect TP53 mutation
requires a high number of cases and a more detailed analysis,
but our sample size was not sufficient for such a comprehensive
work-up.
There are limited numbers of studies focusing on the
immunohistochemical evaluation of p53 and clinical outcome
in CLL patients. Schlette et al. showed that an extent of 40%
or more p53 staining in bone marrow samples of CLL patients
correlated with shorter survival [24]. One study by Cordone
et al. showed that p53 positivity correlated with a shorter
treatment-free interval using neoplastic lymphocytes obtained
from peripheral blood and setting a cut-off of 1% of the
lymphoid cells [25]. In our study, however, we could not show
any significant correlation between p53 immunopositivity in
the involved solid organ samples that could be due to problems
in specimen handling, tissue fixation, and/or processing, or in
short all the steps of the pre-analytic phase of a biopsy. Another
possible explanation is that solid organ samples are not as
representative as circulating neoplastic cells in the peripheral
circulation. Neoplastic cells, which reside in lymph nodes, might
represent only a subset of the entire CLL population.
In this study we also made a morphological observation that we
thought could be interesting. The p53 positivity was stronger
and more prevalent in prolymphocytic cells within the PCs
compared to small lymphocytic cells. Although this raises the
possibility that initial alterations might be originating from the
PCs, this observation needs further investigation.
There are some weaknesses of our study. We did the p53 scoring
semi-quantitatively, although quantitative analysis using image
analyzer software would provide a more precise evaluation of
p53 expression. Another important point is that a sequence
analysis of the p53 gene in the samples could be very helpful
for correlation with p53 staining. Our samples were FFPE tissues
and some were more than 10 years old, which makes obtaining
a good quality of DNA almost impossible.
Conclusion
In conclusion, our study is one of the first studies that aimed to
assess the impact of p53 staining in solid organ biopsy samples
and overall survival in CLL patients. Contrary to the wellconfirmed
prognostic value of del17p in FISH analysis, TP53
immunohistochemistry does not have a similar impact. This
finding should be confirmed with larger series.
Acknowledgment
This project was funded by the Hacettepe University Scientific
Research Projects Coordination Center (Project No: 012 D09 101
003).
Ethics
Ethics Committee Approval: This study was approved by
Hacettepe University Ethics Committee (Approval Number:
11/44-16); Informed Consent: This study was performed on
archived tissue samples. There was no obligation for informed
consent.
Authorship Contributions
Concept: İbrahim Kulaç, Çetin Demir, Yahya Büyükaşık, Tezer
Kutluk, Ayşegül Üner; Design: İbrahim Kulaç, Çetin Demir,
Yahya Büyükaşık, Tezer Kutluk, Ayşegül Üner; Data Collection
or Processing: İbrahim Kulaç and Çetin Demir; Analysis or
Interpretation: İbrahim Kulaç, Çetin Demir, Ayşegül Üner;
Literature Search: İbrahim Kulaç; Writing: İbrahim Kulaç, Yahya
Büyükaşık, Ayşegül Üner.
38

Turk J Hematol 2017;34:34-39
Kulaç İ, et al: TP53 Alterations in Chronic Lymphocytic Lymphoma Patients
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Howlader N, Noone AM, Krapcho M, Garshell J, Miller D, Altekruse SF,
Kosary CL, Yu M, Ruhl J, Tatalovich Z, Mariotto A, Lewis DR, Chen HS, Feuer
EJ, Cronin KA (eds). SEER Cancer Statistics Review, 1975-2012. Bethesda,
National Cancer Institute, 2013.
2. Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Döhner
H, Hillmen P, Keating MJ, Montserrat E, Rai KR, Kipps TJ; International
Workshop on Chronic Lymphocytic Leukemia. Guidelines for the diagnosis
and treatment of chronic lymphocytic leukemia: a report from the
International Workshop on Chronic Lymphocytic Leukemia updating
the National Cancer Institute-Working Group 1996 guidelines. Blood
2008;111:5446-5456.
3. Gentile M, Cutrona G, Neri A, Molica S, Ferrarini M, Morabito F. Predictive
value of β2-microglobulin (β2-m) levels in chronic lymphocytic leukemia
since Binet A stages. Haematologica 2009;94:887-888.
4. Hallek M, Wanders L, Ostwald M, Busch R, Senekowitsch R, Stern S, Schick
HD, Kuhn-Hallek I, Emmerich B. Serum β2-microglobulin and serum
thymidine kinase are independent predictors of progression-free survival
in chronic lymphocytic leukemia and immunocytoma. Leuk Lymphoma
1996;22:439-447.
5. Hallek M; German CLL Study Group. Prognostic factors in chronic
lymphocytic leukemia. Ann Oncol 2008;19(Suppl 4):51-53.
6. Reinisch W, Willheim M, Hilgarth M, Gasché C, Mader R, Szepfalusi S, Steger
G, Berger R, Lechner K, Boltz-Nitulescu G, Schwarzmeier JD. Soluble CD23
reliably reflects disease activity in B-cell chronic lymphocytic leukemia. J
Clin Oncol 1994;12:2146-2152.
7. Pflug N, Bahlo J, Shanafelt TD, Eichhorst BF, Bergmann MA, Elter T, Bauer
K, Malchau G, Rabe KG, Stilgenbauer S, Döhner H, Jäger U, Eckart MJ,
Hopfinger G, Busch R, Fink AM, Wendtner CM, Fischer K, Kay NE, Hallek
M. Development of a comprehensive prognostic index for patients with
chronic lymphocytic leukemia. Blood 2014;124:49-62.
8. Zenz T, Frohling S, Mertens D, Döhner H, Stilgenbauer S. Moving from
prognostic to predictive factors in chronic lymphocytic leukaemia (CLL).
Best Pract Res Clin Haematol 2010;23:71-84.
9. Dunphy CH. Molecular Pathology of Hematolymphoid Diseases, 1st ed. New
York, Springer, 2010.
10. Zenz T, Eichhorst B, Busch R, Denzel T, Häbe S, Winkler D, Bühler A, Edelmann
J, Bergmann M, Hopfinger G, Hensel M, Hallek M, Döhner H, Stilgenbauer S.
TP53 mutation and survival in chronic lymphocytic leukemia. J Clin Oncol
2010;28:4473-4479.
11. Zenz T, Kröber A, Scherer K, Häbe S, Bühler A, Benner A, Denzel T, Winkler
D, Edelmann J, Schwänen C, Döhner H, Stilgenbauer S. Monoallelic TP53
inactivation is associated with poor prognosis in chronic lymphocytic
leukemia: results from a detailed genetic characterization with long-term
follow-up. Blood 2008;112:3322-3329.
12. Gonzalez D, Martinez P, Wade R, Hockley S, Oscier D, Matutes E, Dearden CE,
Richards SM, Catovsky D, Morgan GJ. Mutational status of the TP53 gene
as a predictor of response and survival in patients with chronic lymphocytic
leukemia: results from the LRF CLL4 trial. J Clin Oncol 2011;29:2223-2229.
13. Badoux XC, Keating MJ, Wierda WG. What is the best frontline therapy for
patients with CLL and 17p deletion? Curr Hematol Malig Rep 2011;6:36-46.
14. Döhner H, Stilgenbauer S, Benner A, Leupolt E, Kröber A, Bullinger L,
Döhner K, Bentz M, Lichter P. Genomic aberrations and survival in chronic
lymphocytic leukemia. N Engl J Med 2000;343:1910-1916.
15. Döhner H, Fischer K, Bentz M, Hansen K, Benner A, Cabot G, Diehl D, Schlenk
R, Coy J, Stilgenbauer S, Volkman M, Galle PR, Poustka A, Hunstein W, Lichter
P. p53 gene deletion predicts for poor survival and non-response to therapy
with purine analogs in chronic B-cell leukemias. Blood 1995;85:1580-1589.
16. Lai YY, Huang XJ. Cytogenetic characteristics of B cell chronic lymphocytic
leukemia in 275 Chinese patients by fluorescence in situ hybridization: a
multicenter study. Chin Med J (Engl) 2011;124:2417-2422.
17. Tam CS, Shanafelt TD, Wierda WG, Abruzzo LV, Van Dyke DL, O’Brien S,
Ferrajoli A, Lerner SA, Lynn A, Kay NE, Keating MJ. De novo deletion 17p13.1
chronic lymphocytic leukemia shows significant clinical heterogeneity: the
M. D. Anderson and Mayo Clinic experience. Blood 2009;114:957-964.
18. Giné E, Martinez A, Villamor N, López-Guillermo A, Camos M, Martinez
D, Esteve J, Calvo X, Muntañola A, Abrisqueta P, Rozman M, Rozman C,
Bosch F, Campo E, Montserrat E. Expanded and highly active proliferation
centers identify a histological subtype of chronic lymphocytic leukemia
(“accelerated” chronic lymphocytic leukemia) with aggressive clinical
behavior. Haematologica 2010;95:1526-1533.
19. Ciccone M, Agostinelli C, Rigolin GM, Piccaluga PP, Cavazzini F, Righi S,
Sista MT, Sofritti O, Rizzotto L, Sabattini E, Fioritoni G, Falorio S, Stelitano C,
Olivieri A, Attolico I, Brugiatelli M, Zinzani PL, Saccenti E, Capello D, Negrini
M, Cuneo A, Pileri S. Proliferation centers in chronic lymphocytic leukemia:
correlation with cytogenetic and clinicobiological features in consecutive
patients analyzed on tissue microarrays. Leukemia 2012;26:499-508.
20. Asplund SL, McKenna RW, Howard MS, Kroft SH. Immunophenotype does
not correlate with lymph node histology in chronic lymphocytic leukemia/
small lymphocytic lymphoma. Am J Surg Pathol 2002;26:624-629.
21. Garcia CF, Hunt KE, Kang H, Babb A, Gale JM, Vasef MA, Reichard KK. Most
morphologic features in chronic lymphocytic leukemia/small lymphocytic
lymphoma (CLL/SLL) do not reliably predict underlying FISH genetics or
immunoglobulin heavy chain variable region somatic mutational status.
Appl Immunohistochem Mol Morphol 2010;18:119-127.
22. Lee SN, Park CK, Sung CO, Choi JS, Oh YL, Cho JW, Yoo BC. Correlation of
mutation and immunohistochemistry of p53 in hepatocellular carcinomas
in Korean people. J Korean Med Sci 2002;17:801-805.
23. Yemelyanova A, Vang R, Kshirsagar M, Lu D, Marks MA, Shih IM, Kurman
RJ. Immunohistochemical staining patterns of p53 can serve as a surrogate
marker for TP53 mutations in ovarian carcinoma: an immunohistochemical
and nucleotide sequencing analysis. Mod Pathol 2011;24:1248-1253.
24. Schlette EJ, Admirand J, Wierda W, Abruzzo L, Lin KI, O’Brien S, Lerner
S, Keating MJ, Tam C. p53 expression by immunohistochemistry is an
important determinant of survival in patients with chronic lymphocytic
leukemia receiving frontline chemo-immunotherapy. Leuk Lymphoma
2009;50:1597-1605.
25. Cordone I, Masi S, Mauro FR, Soddu S, Morsilli O, Valentini T, Vegna
ML, Guglielmi C, Mancini F, Giuliacci S, Sacchi A, Mandelli F, Foa R. p53
expression in B-cell chronic lymphocytic leukemia: a marker of disease
progression and poor prognosis. Blood 1998;91:4342-4349.
39

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0332
Turk J Hematol 2017;34:40-45
Evaluation of Endocrine Late Complications in Childhood Acute
Lymphoblastic Leukemia Survivors: A Report of a Single-Center
Experience and Review of the Literature
Akut Lenfoblastik Lösemili Çocuklarda Endokrin Geç Komplikasyonların Değerlendirilmesi:
Tek Merkez Deneyimi ve Literatür Derlemesi
Cengiz Bayram 1 , Neşe Yaralı 1 , Ali Fettah 1 , Fatma Demirel 2 , Betül Tavil 1 , Abdurrahman Kara 1 , Bahattin Tunç 1
1Ankara Children’s Hematology and Oncology Hospital, Clinic of Pediatric Hematology, Ankara, Turkey
2Private Doctor
Abstract
Objective: Improvement in long-term survival in patients with acute
lymphoblastic leukemia (ALL) in childhood has led to the need for
monitorization of treatment-related morbidity and mortality. In
the current study, we aimed to evaluate endocrine side effects of
treatment in ALL survivors who were in remission for at least 2 years.
Materials and Methods: Sixty patients diagnosed with ALL, who
were in remission for at least 2 years, were cross-sectionally evaluated
for long-term endocrine complications.
Results: The median age of the patients at the time of diagnosis,
at the time of chemotherapy completion, and at the time of the
study was 5 years (minimum-maximum: 1.7-13), 8 years (minimummaximum:
4.25-16), and 11.7 years (minimum-maximum: 7-22),
respectively, and median follow-up time was 4 years (minimummaximum:
2-10.1). At least one complication was observed in 81.6%
of patients. Vitamin D insufficiency/deficiency (46.6%), overweight/
obesity (33.3%), and dyslipidemia (23.3%) were the three most
frequent endocrine complications. Other complications seen in our
patients were hyperparathyroidism secondary to vitamin D deficiency
(15%), insulin resistance (11.7%), hypertension (8.3%), short stature
(6.7%), thyroid function abnormality (5%), precocious puberty (3.3%),
and decreased bone mineral density (1.7%). There were no statistically
significant correlations between endocrine complications and age, sex,
and radiotherapy, except vitamin D insufficiency/deficiency, which
was significantly more frequent in pubertal ALL survivors compared
to prepubertal ALL survivors (57.5% and 25%, respectively, p=0.011).
Conclusion: A high frequency of endocrine complications was
observed in the current study. The high frequency of late effects
necessitates long-term surveillance of this population to better
understand the incidence of late-occurring events and the defining
of high-risk features that can facilitate developing intervention
strategies for early detection and prevention.
Keywords: Acute lymphoblastic leukemia, Endocrine, Late effects,
Children
Öz
Amaç: Akut lenfoblastik lösemili (ALL) hastalardaki sağ kalım
oranlarının artışı, tedavi sonrası ortaya çıkan morbidite ve mortalite
problemlerinin takip edilme ihtiyacını beraberinde getirmiştir.
Çalışmamızda, en az iki yıldır remisyonda olan ALL’li hastalarda,
tedavi sonrası ortaya çıkabilecek endokrin komplikasyonların
değerlendirilmesi amaçlandı.
Gereç ve Yöntemler: ALL tanısı ile tedavi almış ve tedavisi üzerinden
en az iki yıl geçmiş ve remisyonda olan 60 hastada endokrin geç
komplikasyonlar kesitsel olarak değerlendirildi.
Bulgular: Hastaların tanı aldıkları andaki median yaşları 5 yıl
(minimum-maksimum: 1,7-13), kemoterapi sonlandırıldığı andaki
median yaşları 8 yıl (minimum-maksimum: 4,25-16), çalışma
sırasındaki median yaşları ise 11,7 yıl (minimum-maksimum: 7-22)
olarak tespit edildi. Hastaların tedavi sonrası median takip süresi ise
4 yıl (minimum-maksimum: 2-10,1) idi. Hastaların %81,6’sında en
az bir endokrin komplikasyon geliştiği görüldü. D vitamini eksikliği/
yetersizliği (%46,6), obezite/fazla kiloluluk (%33,3) ve dislipidemi
(%23,3) en sık gelişen üç komplikasyon olarak tespit edildi. D vitamini
eksikliğine sekonder gelişen hiperparatiroidi (%15), insülin direnci
(%11,7), hipertansiyon (%8,3), boy kısalığı (%6,7), tiroid fonksiyon
bozukluğu (%5), puberte prekoks (%3,3) ve azalmış kemik mineral
yoğunluğu (%1,7) gelişen diğer endokrin komplikasyonlardı. Hastalarda
gelişen endokrin komplikasyonlar arasında cinsiyet, yaş, radyoterapi
bakımından farklılık saptanmaz iken, D vitamini yetersizliği/eksikliği
saptanan hasta sayısı pubertal grupta, prepubertal gruba göre anlamlı
derecede fazlaydı (%57,5 ve %25, sırasıyla, p=0,011).
Sonuç: Çalışmamızda yüksek oranda endokrin komplikasyon saptandı.
Bu komplikasyonlar, geç yan etkilerin ortaya çıkmasına neden
olabilecek yüksek risk özellikleri ve sıklığı tanımlayabilmek, erken tanı
ve önleyici stratejileri geliştirmek açısından hastaların uzun dönem
izlenmelerini gerektirmektedir.
Anahtar Sözcükler: Akut lenfoblastik lösemi, Endokrin, Geç yan
etkiler, Çocuk
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Cengiz BAYRAM, M.D.,
Ankara Children’s Hematology and Oncology Hospital, Clinic of Pediatric Hematology, Ankara, Turkey
Phone : +90 505 839 60 92
E-mail : cengizbayram2013@gmail.com
Received/Geliş tarihi: September 21, 2015
Accepted/Kabul tarihi: November 18, 2015
40

Turk J Hematol 2017;34:40-45
Bayram C, et al: Endocrine Late Complications in Childhood Leukemia Survivors
Introduction
Despite the increase in the prevalence of childhood malignancies,
the 5-year survival rate for acute lymphoblastic leukemia (ALL)
in childhood has approached 90% as a result of advances in
chemotherapy and supportive care. This increase in survival
has increased the importance of long-term treatment-related
morbidity and mortality [1]. One of the consequences of cancer
or its therapy is that many long-term survivors of childhood
cancer are at an increased risk of developing chronic physical or
psychosocial problem [2]. It is estimated that about two-thirds
of cancer survivors will experience at least one late adverse
effect and more than 40% may have a severe, disabling, or lifethreatening
condition or may die 30 years after the cancer is
diagnosed [3]. There have been numerous chemotherapy agents
used for the treatment of ALL; however, a few of them have
been implicated as causing late effects, including anthracyclines
(e.g., doxorubicin, daunorubicin), oxazaphosphorine alkylating
agents (e.g., cyclophosphamide), corticosteroids (e.g.,
prednisone, dexamethasone), and high-dose methotrexate [2].
The adverse effects of prophylactic cranial irradiation, including
acute neurotoxicity, neurocognitive deficits, endocrinopathies,
secondary malignant disease, and excess late mortality, have led
to its reduction or elimination from treatment protocols for ALL
[4,5,6].
Endocrine complications during therapy for ALL include
bone demineralization, disordered growth, adrenocortical
insufficiency, diabetes mellitus, the syndrome of inappropriate
secretion of antidiuretic hormone, and changes in thyroid
hormone concentration, whereas late complications, those
that occur after completion of all radiation and chemotherapy,
include bone demineralization, short stature, growth hormone
deficiency, obesity, hypothyroidism, gonadal dysfunction, and
infertility [7]. The present study aimed to evaluate long-term
endocrine complications in ALL survivors that were in remission
for at least 2 years.
Materials and Methods
Sixty patients diagnosed with ALL between January 2003 and
February 2009 at the Pediatric Hematology Clinic of Ankara
Children’s Hematology and Oncology Education and Research
Hospital, who were in remission for at least 2 years, were
included in the study and were evaluated cross-sectionally. All
patients with ALL were treated according to the St. Jude Total-
XIIIA protocol [8] and received 12 or 18 cGy cranial radiotherapy
(CRT) as a part of prophylaxis or treatment as appropriate.
Pubertal status was assessed at the time of the study using
Tanner staging and patients were divided into two groups as
pubertal or prepubertal. Body weight and height were measured
and evaluated according to Turkish children’s growth data [9].
Body mass index (BMI) was calculated as weight in kilograms
divided by the square of the height in meters. Overweight
was defined as BMI for age and sex between the 85 th and
95 th percentiles, and BMI for age and sex higher than the 95 th
percentile was defined as obesity.
Hormonal analysis was carried out by the chemiluminescence
method using a BIO-DPC hormone autoanalyzer with commercial
kits, and a Roche/Hitachi Modular P Chemistry Analyzer was
used for biochemical analysis. Serum lipid profiles, including
cholesterol, triglyceride, low-density lipoprotein cholesterol
(LDL-C), high-density lipoprotein cholesterol (HDL-C), and blood
glucose, were obtained after at least 8 h of fasting. Dyslipidemia
was defined as cholesterol of >200 mg/dL, or triglyceride of
>150 mg/dL, or LDL-C of >130 mg/dL, or HDL-C of 10 µU/mL with clinical symptoms were defined as
hypothyroidism, and normal free T4 level and TSH level between
5 and 10 µU/mL without clinical symptoms were defined as
subclinical (compensated) hypothyroidism [14]. Parathyroid
hormone (PTH) values between 6 and 65 pg/mL were accepted
as normal. High PTH levels with vitamin D deficiency were
diagnosed as “secondary hyperparathyroidism”. Patients having
hypocalcemia, hyperphosphatemia, and decreased PTH levels
were diagnosed with “primary hypoparathyroidism”. Serum
adrenocorticotropic hormone (ACTH) and cortisol levels were
simultaneously measured at 09:00 hours. ACTH levels between
7 and 28 pg/mL for prepubertal children and between 2 and
49 pg/mL for postpubertal children were accepted as normal.
Cortisol levels between 8 and 22 µg/dL were accepted as
normal, whereas

Bayram C, et al: Endocrine Late Complications in Childhood Leukemia Survivors Turk J Hematol 2017;34:40-45
Continuous variables are expressed as median (minimummaximum)
and categorical variables as number (percentage).
The clinical parameters and laboratory values of the patients
were evaluated using the chi-square method and Student’s
t-test, as appropriate. All statistical tests were two-sided and
p

Turk J Hematol 2017;34:40-45
Bayram C, et al: Endocrine Late Complications in Childhood Leukemia Survivors
Table 3. Correlation between endocrine complications and pubertal status.
Endocrine complications, n (%) Total (n=60) Pubertal (n=40) Prepubertal (n=20) p
Vitamin D insufficiency/deficiency 28 (46.6) 23 (57.5) 5 (25) 0.011*
Overweight/obesity 20 (33.3) 12 (30) 8 (40) 0.439
Dyslipidemia 14 (23.3) 10 (25) 4 (20) 0.666
Hyperparathyroidism secondary to vitamin D deficiency 9 (15) 7 (17.9) 2 (10) 0.443
Insulin resistance 7 (11.7) 5 (12.5) 2 (10) 0.591
Hypertension 5 (8.3) 4 (10) 1 (5) 0.509
Short stature 4 (6.6) 2 (5) 2 (10) 0.464
Thyroid function abnormality 1 (1.7) 2 (5) 1 (5) 1
*Significant.
BMD deficits compared to the general population, associated
with their treatment, including high cumulative doses of
steroids/methotrexate and radiation therapy. Because vitamin
D has a positive influence on calcium balance for building
bone and attaining peak bone mass, vitamin D deficiency or
insufficiency can contribute to BMD deficit [22]. The prevalence
of 25-hydroxyvitamin D (25-OH-D) insufficiency is reported
to be 14-49% in the general population and was reported to
be between 33.5% and 40% in healthy Turkish children and
adolescents in two recent studies [23,24,25,26]. In a recent
study of 484 childhood cancer survivors, 17.6% of whom
had leukemia, Choudhary et al. reported a prevalence of 29%
of 25-OH-D insufficiency, and the risk factors for 25-OH-D
insufficiency were race, pubertal status, and seasonality [27].
The prevalence of 25-OH-D deficiency or insufficiency was
46.6% in our study, which was higher than in the latter study
and two recent studies from Turkey but similar to what has been
described in the general population. Pubertal status was the
only significant risk factor in the present study, while 23 of 28
patients (82.1%) with 25-OH-D deficiency or insufficiency were
pubertal ALL survivors. Forty percent of bone mass is obtained
during puberty, and by the end of puberty, 90% of total adult
bone mass has already been acquired in the normal population
[22]. In this regard, in addition to chemotherapy agents and
radiation therapy, 25-OH-D deficiency or insufficiency can
additionally contribute to failure to recover to a normal
BMD after completion of therapy, and thus surveillance and
intervention strategies should also include assessment of 25-
OH-D levels during puberty.
Overweight or obesity has been identified as a potential late
adverse effect of therapy in childhood ALL survivors [2,3]. The
largest study evaluating the risk of being overweight in ALL
survivors was conducted by the Childhood Survivor Cancer
Study. That study showed that survivors who received greater
than 20 Gy CRT were significantly more likely than their siblings
to be overweight, and female survivors treated before the age
of 4 years were also more likely to be overweight in comparison
with siblings [28]. Studies about the risk of being overweight
or obese in ALL survivors have conflicting results. In a study of
618 ALL survivors, reported by Dalton et al., they found that
children treated before the age of 13 years had a significant
decrease in their height z-scores and an increase in their BMI
z-scores, regardless of cranial radiation therapy [29]. Razzouk et
al. observed that young age (

Bayram C, et al: Endocrine Late Complications in Childhood Leukemia Survivors Turk J Hematol 2017;34:40-45
general population. In addition to cardiomyopathy associated
with anthracyclines, ALL survivors have also been shown to
have atherosclerotic disease, which led to an investigation of
conventional risk factors for cardiovascular disease including
diabetes mellitus, dyslipidemia, obesity, and metabolic syndrome
[13]. In the present study, the second and third most common
endocrine complications were overweight/obesity (33.3%) and
dyslipidemia (23.3%), whereas insulin resistance (11.7%) and
hypertension (8.3%) were the fourth and fifth most common
endocrine complications. Because childhood ALL survivors will be
young at the time of completion of treatment, as in the present
study (median age: 11.7 years), many treatment-related adverse
events may not become clinically apparent until the survivor
gets older in the context of cardiovascular disease development,
and thus preventive strategies including medical interventions
and lifestyle modifications such as eating a healthful diet,
regular physical activity, and avoiding cancer-associated habits
including smoking or excessive alcohol consumption can help
reduce the risk factors leading to cardiovascular late events.
ALL survivors treated with conventional CRT doses do not usually
develop other central endocrinopathies, such as central adrenal
insufficiency, hyperprolactinemia, gonadotropin insufficiency,
or central (secondary) hypothyroidism. However, primary
hypothyroidism can occur after cranial, craniospinal, and total
body irradiation because of direct exposure of the thyroid
gland to radiation, even at low doses [2]. Precocious puberty is
another late effect of CRT in doses of 18 to 24 Gy, and it is more
common in girls. However, most female ALL survivors experience
menarche at a normal age, which was confirmed in two large
cohorts [34,35]. Reduction or elimination of CRT in treatment of
childhood ALL in recent protocols is another reason for favorable
outcome in the context of central endocrinopathy development
[4,5,6]. In the present study, there were no patients diagnosed
with adrenal insufficiency, and the frequency of patients with
hypothyroidism and subclinical hypothyroidism (compensated)
was 1.7% and 3.3%, respectively. Only two of 60 ALL survivors
developed precocious puberty; both were girls and one received
CRT.
Conclusion
In conclusion, a high frequency of endocrine long-term
adverse events occurred in the current study. In achieving
>90% of 5-year survival rates for children with ALL diagnosed
at 14 years of age or younger, there has been an increase in
the number of children and adolescents cured of ALL. In this
context, considering the high prevalence of late adverse effects
as a consequence of ALL or its therapy as compared to the
general population, long-term surveillance of this population is
important to better understand the incidence of late-occurring
events and define high-risk features that can facilitate the
development of intervention strategies for early detection and
prevention, which can lead to an improvement of care and
quality of life for this growing population.
Ethics
Ethics Commitee Approval: The research has been approved by
Ankara Children’s Hematology and Oncology Hospital’s ethics
commitee (approval number 2013-051) and informed consent
was obtained from the parents of the patients. The manuscript
has been seen and approved by all of the authors.
Author Contributions
Concept: Cengiz Bayram, Neşe Yaralı, Betül Tavil; Design: Cengiz
Bayram, Neşe Yaralı, Betül Tavil, Fatma Demirel; Data Collection
or Processing: Cengiz Bayram, Neşe Yaralı, Ali Fettah, Fatma
Demirel; Analysis or Interpretation: Cengiz Bayram, Neşe Yaralı,
Ali Fettah, Fatma Demirel; Literature Search: Cengiz Bayram,
Neşe Yaralı, Ali Fettah, Fatma Demirel, Betül Tavil, Abdurrahman
Kara, Bahattin Tunç; Writing: Cengiz Bayram, Neşe Yaralı, Ali
Fettah, Fatma Demirel, Betül Tavil, Abdurrahman Kara, Bahattin
Tunç.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Ness KK, Armenian SH, Kadan-Lottick N, Gurney JG. Adverse effects of
treatment in childhood acute lymphoblastic leukemia: general overview and
implications for long-term cardiac health. Expert Rev Hematol 2011;4:185-
197.
2. Nathan PC, Wasilewski-Masker K, Janzen LA. Long-term outcomes in
survivors of childhood acute lymphoblastic leukemia. Hematol Oncol Clin
North Am 2009;23:1065-1082.
3. Shankar SM, Marina N, Hudson MM, Hodgson DC, Adams MJ, Landier
W, Bhatia S, Meeske K, Chen MH, Kinahan KE, Steinberger J, Rosenthal
D; Cardiovascular Disease Task Force of the Children’s Oncology Group.
Monitoring for cardiovascular disease in survivors of childhood cancer:
report from the Cardiovascular Disease Task Force of the Children’s
Oncology Group. Pediatrics 2008;121:e387-396.
4. Inaba H, Greaves M, Mullighan CG. Acute lymphoblastic leukaemia. Lancet
2013;381:1943-1955.
5. Veerman AJ, Kamps WA, van den Berg H, van den Berg E, Bökkerink JP,
Bruin MC, van den Heuvel-Eibrink MM, Korbijn CM, Korthof ET, van der Pal
K, Stijnen T, van Weel Sipman MH, van Weerden JF, van Wering ER, van der
Does-van den Berg A; Dutch Childhood Oncology Group. Dexamethasonebased
therapy for childhood acute lymphoblastic leukaemia: results of
the prospective Dutch Childhood Oncology Group (DCOG) protocol ALL-9
(1997-2004). Lancet Oncol 2009;10:957-966.
6. Pui CH, Campana D, Pei D, Bowman WP, Sandlund JT, Kaste SC, Ribeiro
RC, Rubnitz JE, Raimondi SC, Onciu M, Coustan-Smith E, Kun LE, Jeha S,
Cheng C, Howard SC, Simmons V, Bayles A, Metzger ML, Boyett JM, Leung
W, Handgretinger R, Downing JR, Evans WE, Relling MV. Treating childhood
acute lymphoblastic leukemia without cranial irradiation. N Engl J Med
2009;360:2730-2741.
7. Howard SC, Pui CH. Endocrine complications in pediatric patients with
acute lymphoblastic leukemia. Blood Rev 2002;16:225-243.
44

Turk J Hematol 2017;34:40-45
Bayram C, et al: Endocrine Late Complications in Childhood Leukemia Survivors
8. Pui CH, Boyett JM, Rivera GK, Hancock ML, Sandlund JT, Ribeiro RC, Rubnitz
JE, Behm FG, Raimondi SC, Gajjar A, Razzouk B, Campana D, Kun LE, Relling
MV, Evans WE. Long-term results of Total Therapy studies 11, 12 and 13A
for childhood acute lymphoblastic leukemia at St Jude Children’s Research
Hospital. Leukemia 2000;14:2286-2294.
9. Neyzi O, Furman A, Bundak R, Gunoz H, Darendeliler F, Bas F. Growth
references for Turkish children aged 6 to 18 years. Acta Paediatr
2006;95:1635-1641.
10. William AN. Disorders of lipoprotein metabolism and transport. In: Kliegman
RM, Stanton BF, St. Geme JW, Schor NF, Behrman RE, (eds). Nelson Textbook
of Pediatrics, 19th ed. Philadelphia, Elsevier Saunders, 2011.
11. Kurtoğlu S, Hatipoğlu N, Mazıcıoğlu M, Kendirici M, Keskin M, Kondolot
M. Insulin resistance in obese children and adolescents: HOMA-IR cut-off
levels in the prepubertal and pubertal periods. J Clin Res Pediatr Endocrinol
2010;2:100-106.
12. Keskin M, Kurtoglu S, Kendirci M, Atabek ME, Yazici C. Homeostasis model
assessment is more reliable than the fasting glucose/insulin ratio and
quantitative insulin sensitivity check index for assessing insulin resistance
among obese children and adolescents. Pediatrics 2005;115:e500-503.
13. Nottage KA, Ness KK, Li C, Srivastava D, Robison LL, Hudson MM. Metabolic
syndrome and cardiovascular risk among long-term survivors of acute
lymphoblastic leukaemia - from the St. Jude Lifetime Cohort. Br J Haematol
2014;165:364-374.
14. Canaris GJ, Manowitz NR, Mayor G, Ridgway EC. The Colorado Thyroid
Disease Prevalence Study. Arch Int Med 2000;160:526-534.
15. Greenspan FS. Greenspan’s Basic & Clinical Endocrinology, 9th ed. New York,
McGraw-Hill Medical, 2011.
16. Misra M, Pacaud D, Petryk A, Collett-Solberg PF, Kappy M; Drug and
Therapeutics Committee of the Lawson Wilkins Pediatric Endocrine Society.
Vitamin D deficiency in children and its management: review of current
knowledge and recommendations. Pediatrics 2008;122:398-417.
17. Goksen D, Darcan S, Coker M, Kose T. Bone mineral density of healthy
Turkish children and adolescents. J Clin Densitom 2006;9:84-90.
18. Haddy TB, Mosher RB, Reaman GH. Late effects in long-term survivors after
treatment for childhood acute leukemia. Clin Pediatr (Phila) 2009;48:601-
608.
19. Oeffinger KC, Mertens AC, Sklar CA, Kawashima T, Hudson MM, Meadows
AT, Friedman DL, Marina N, Hobbie W, Kadan-Lottick NS, Schwartz CL,
Leisenring W, Robison LL; Childhood Cancer Survivor Study. Chronic
health conditions in adult survivors of childhood cancer. N Engl J Med
2006;355:1572-1582.
20. Geenen MM, Cardous-Ubbink MC, Kremer LC, van den Bos C, van der
Pal HJ, Heinen RC, Jaspers MW, Koning CC, Oldenburger F, Langeveld NE,
Hart AA, Bakker PJ, Caron HN, van Leeuwen FE. Medical assessment of
adverse health outcomes in long-term survivors of childhood cancer. JAMA
2007;297:2705-2715.
21. Blaauwbroek R, Groenier KH, Kamps WA, Meyboom-de Jong B, Postma A.
Late effects in adult survivors of childhood cancer: the need for life-long
follow-up. Ann Oncol 2007;18:1898-1902.
22. Wasilewski-Masker K, Kaste SC, Hudson MM, Esiashvili N, Mattano LA,
Meacham LR. Bone mineral density deficits in survivors of childhood cancer:
long-term follow-up guidelines and review of the literature. Pediatrics
2008;121:e705-e713.
23. Looker AC, Dawson-Hughes B, Calvo MS, Gunter EW, Sahyoun NR. Serum
25-hydroxyvitamin D status of adolescents and adults in two seasonal
subpopulations from NHANES III. Bone 2002;30:771-777.
24. Saintonge S, Bang H, Gerber LM. Implications of a new definition of vitamin
D deficiency in a multiracial US adolescent population: the National Health
and Nutrition Examination Survey III. Pediatrics 2009;123:797-803.
25. Akman AO, Tumer L, Hasanoglu A, Ilhan M, Caycı B. Frequency of vitamin D
insufficiency in healthy children between 1 and 16 years of age in Turkey.
Pediatr Int 2011;53:968-973.
26. Andıran N, Çelik N, Akça H, Doğan G. Vitamin D deficiency in children and
adolescents. J Clin Res Pediatr Endocrinol 2012;4:25-29.
27. Choudhary A, Chou J, Heller G, Sklar C. Prevalence of vitamin D insufficiency
in survivors of childhood cancer. Pediatr Blood Cancer 2013;60:1237-1239.
28. Oeffinger KC, Mertens AC, Sklar CA, Yasui Y, Fears T, Stovall M, Vik TA, Inskip
PD, Robison LL; Childhood Cancer Survivor Study. Obesity in adult survivors
of childhood acute lymphoblastic leukemia: a report from the Childhood
Cancer Survivor Study. J Clin Oncol 2003;21:1359-1365.
29. Dalton VK, Rue M, Silverman LB, Gelber RD, Asselin BL, Barr RD, Clavell LA,
Hurwitz CA, Moghrabi A, Samson Y, Schorin M, Tarbell NJ, Sallan SE, Cohen
LE. Height and weight in children treated for acute lymphoblastic leukemia:
relationship to CNS treatment. J Clin Oncol 2003;21:2953-2960.
30. Razzouk BI, Rose SR, Hongeng S, Wallace D, Smeltzer MP, Zacher M, Pui
CH, Hudson MM. Obesity in survivors of childhood acute lymphoblastic
leukemia and lymphoma. J Clin Oncol 2007;25:1183-1189.
31. Zhang FF, Rodday AM, Kelly MJ, Must A, MacPherson C, Roberts SB,
Saltzman E, Parsons SK. Predictors of being overweight or obese in survivors
of pediatric acute lymphoblastic leukemia (ALL). Pediatr Blood Cancer
2014;61:1263-1269.
32. Asner S, Ammann RA, Ozsahin H, Beck-Popovic M, von der Weid NX. Obesity
in long-term survivors of childhood acute lymphoblastic leukemia. Pediatr
Blood Cancer 2008;51:118-122.
33. Shaw MP, Bath LE, Duff J, Kelnar CJ, Wallace WH. Obesity in leukemia
survivors: the familial contribution. Pediatr Hematol Oncol 2000;17:231-237.
34. Mills JL, Fears TR, Robison LL, Nicholson HS, Sklar CA, Byrne J. Menarche
in a cohort of 188 long-term survivors of acute lymphoblastic leukemia. J
Pediatr 1997;131:598-602.
35. Chow EJ, Friedman DL, Yasui Y, Whitton JA, Stovall M, Robison LL, Sklar
CA. Timing of menarche among survivors of childhood acute lymphoblastic
leukemia: a report from the Childhood Cancer Survivor Study. Pediatr Blood
Cancer 2008;50:854-858.
45

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0411
Turk J Hematol 2017;34:46-51
FLAG Regimen with or without Idarubicin in Children with
Relapsed/Refractory Acute Leukemia: Experience from a Turkish
Pediatric Hematology Center
Nüks/Refrakter Akut Lösemili Çocuklarda İdarubisin Eklenerek veya Eklenmeden FLAG
Tedavisi: Bir Türk Pediatrik Hematoloji Merkezi Deneyimi
Şebnem Yılmaz Bengoa, Eda Ataseven, Deniz Kızmazoğlu, Fatma Demir Yenigürbüz, Melek Erdem, Hale Ören
Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey
Abstract
Objective: The optimal therapy to achieve higher rates of survival
in pediatric relapsed/refractory acute leukemia (AL) is still unknown.
In developing countries, it is difficult to obtain some of the recent
drugs for optimal therapy and mostly well-known drugs proven to
be effective are used. We assessed the efficacy of the combination
of fludarabine, high-dose cytarabine, and granulocyte colonystimulating
factor (FLAG regimen) with or without idarubicin (IDA) in
children with relapsed/refractory acute lymphoblastic leukemia and
acute myeloid leukemia.
Materials and Methods: Between September 2007 and May 2015,
18 children with refractory/relapsed AL attending our center, treated
with a FLAG regimen with or without IDA, were included. The primary
end point was the remission status of the bone marrow sampled after
the first/second course of chemotherapy. The second end point was
the duration of survival after hematopoietic stem cell transplantation
(HSCT).
Results: Complete remission (CR) was achieved in 7 patients (38.8%)
after the first cycle, and at the end of the second cycle the total
number of patients in CR was 8 (42.1%). All patients in CR underwent
HSCT. The CR rate in patients who had IDA in combination therapy
was 28.6%, and it was 50% in patients treated without IDA (p=0.36).
Mean survival duration in transplanted patients was 24.7±20.8
months (minimum-maximum: 2-70, median: 25 months), and it was
2.7±1.64 months (minimum-maximum: 0-5, median: 3 months) in
nontransplanted patients. Five of them (27.7%) were still alive at the
end of the study and in CR. The median time of follow-up for these
patients was 33 months (minimum-maximum: 25-70 months).
Conclusion: FLAG regimens with or without IDA produced a CR of
>24 months in 27.7% of children with relapsed/refractory AL and can
be recommended as therapeutic options prior to HSCT in developing
countries.
Keywords: Relapsed/refractory leukemia, FLAG regimen,
Chemotherapy, Childhood
Öz
Amaç: Nüks/refrakter akut lösemili (AL) çocuklarda daha yüksek
sağkalımı sağlayabilecek en uygun tedavi yaklaşımı halen
bilinmemektedir. Gelişmekte olan ülkelerde bu hasta grubunda etkin
olduğu iyi bilinen ve yakın zamanda geliştirilmiş bazı ilaçlara ulaşımda
güçlük yaşanmaktadır. Biz relaps/refrakter akut lenfoblastik lösemili
ve akut miyeloid lösemili çocuklarda idarubisin (İDA) eklenmiş veya
eklenmemiş, fludarabin, yüksek doz sitarabin ve granülosit koloni
stimüle edici faktör (FLAG tedavisi) kombinasyonunun etkinliğini
değerlendirdik.
Gereç ve Yöntemler: Çalışmaya Eylül 2007 ve Mayıs 2015 arasında
merkezimizde izlenen, İDA eklenmiş veya eklenmemiş FLAG tedavisi
verilen, 18 relaps/refrakter AL’li çocuk dahil edilmiştir. Birincil sonlanım
noktası kemoterapi sonrası alınan kemik iliği örneğinin remisyon
durumu ve ikinci sonlanım noktası ise hematopoetik kök hücre nakli
(HKHN) sonrası sağkalım süresi olarak belirlenmiştir.
Bulgular: Çocukların yedisinde (%38,8) ilk siklus, toplam olarak
sekizinde (%42,1) ise ikinci siklus sonrasında tam remisyon (TR) elde
edildi. TR’deki tüm hastalara HKHN yapıldı. Kombinasyon tedavisine
IDA eklenmiş olan hastalarda TR oranı %28,6, İDA eklenmemiş
olanlarda %50 idi (p=0,36). HKHN yapılmış hastalarda ortalama
sağkalım süresi 24,7±20,8 ay (minimum-maksimum: 2-70, medyan:
25 ay), yapılmamış olanlarda 2,7±1,64 ay (minimum-maksimum: 0-5,
medyan: 3 ay) idi. Bu hastaların beşi (%27,7) halen sağ ve TR’dedir.
Yaşayan hastaların median izlem süresi 33 ay (minimum-maksimum:
25-70 ay) idi.
Sonuç: IDA eklenmiş veya eklenmemiş FLAG tedavisi nüks/refrakter
AL’li çocukların %27,7’sinde 24 aydan daha uzun süreli sağkalım
sağlamıştır ve gelişmekte olan ülkelerde HKHN öncesi tedavi seçeneği
olarak önerilebilir.
Anahtar Sözcükler: Nüks/refrakter lösemi, FLAG tedavisi, Kemoterapi,
Çocukluk çağı
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Şebnem YILMAZ BENGOA, M.D.,
Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey
Phone : +90 505 5252163
E-mail : sebnemyilmaz14@yahoo.com
Received/Geliş tarihi: November 30, 2015
Accepted/Kabul tarihi: December 25, 2015
46

Turk J Hematol 2017;34:46-51
Yılmaz Bengoa Ş, et al: FLAG Therapy in Relapsed/Refractory Childhood Leukemia
Introduction
Despite the improved prognosis in pediatric acute leukemias
(ALs), survival rates are low for patients with relapsed or
refractory disease [1,2]. Treatment approaches for these
patients are not uniform. Effective reinduction regimens are
needed and it has been shown that hematopoietic stem cell
transplantation (HSCT) can offer long survival times [2,3]. In
developing countries, it is difficult to obtain some of the more
recent drugs for optimal therapy, and mostly well-known drugs
proven to be effective are used. Regimens with the combination
of fludarabine (FL), cytarabine, idarubicin (IDA), and granulocyte
colony-stimulating factor (G-CSF) have been widely used for
poor-risk acute myeloid leukemia (AML), myelodysplastic
syndrome (MDS), and relapsed or refractory acute lymphoblastic
leukemia (ALL) in adults [4,5]. Pediatric series of AL cases with
poor prognosis treated with these regimens are limited in the
literature [6,7,8,9].
FL, a fluorinated purine analog, and high-dose cytarabine are
effective in the treatment of ALs [10]. The combination of FL
with cytarabine appears to have a synergistic effect. A positive
correlation has been found between the intracellular level of
the active metabolite of cytarabine, Ara-C 5’-triphosphate
(Ara-CTP), and remission rates. FL triphosphate, the active
metabolite of FL, inhibits ribonucleotide reductase and increases
intracellular Ara-CTP. Administration of fludarabine prior to
cytarabine may enhance the clinical efficacy of cytarabine [11].
IDA has also been added to the combination to increase the
antileukemic effect [6,7,8,9]. G-CSF prior to FL may increase the
efficacy of chemotherapy by increasing the fraction of leukemic
cells in the S-phase [12].
The combination regimen of FL, high-dose cytarabine, and
G-CSF (FLAG) with or without IDA has been used in relapsed/
refractory acute AML and ALL patients since 2007 in our clinic.
Our aim was to evaluate the rate of complete remission (CR) and
duration of survival after HSCT with this regimen.
Materials and Methods
Patients
Between September 2007 and May 2015, 18 children (15 boys
and 3 girls) with refractory/relapsed AL attending our center
were treated with a FLAG regimen with or without IDA. The
median age at treatment was 12 years (minimum-maximum:
9 months to 17 years). Ten patients had a diagnosis of ALL (6
precursor B-cell and 4 T-cell ALL) and 8 had AML (2 AML-M2, 2
AML-M4, 1 AML-M5, 2 secondary AML, and 1 myeloid sarcoma).
Of the 10 children with ALL, 3 cases were primary refractory,
3 first-relapsed, and 4 second-relapsed (all of them were
refractory to the ALL relapse protocol), while of the 8 children
with AML, 5 cases were first-relapsed and 3 primary refractory.
One patient with myeloid sarcoma received the FLAG regimen
after his first relapse, underwent allogeneic HSCT, relapsed 20
months after transplantation, and received the second course
of the FLAG regimen.
At the time of treatment 13 patients had isolated bone marrow
infiltration, 3 had isolated extramedullary disease, and 3 had
combined disease. The extramedullary disease site was the
central nervous system in 4 patients, testis in 1 patient, and
lymph node in 1 patient.
All parents signed written informed consent forms before the
start of the regimens.
Treatment
Fludarabine at 30 mg/m 2 /day was administered intravenously
over 30 min and cytarabine at 2 g/m 2 /day was administered
intravenously over 3 h starting 3.5 h after completing the
fludarabine infusion for 4 consecutive days (days 1-4). IDA was
given at 12 mg/m 2 /day by a 1-h infusion for 3 consecutive days
(days 2-4) starting 1 h before the cytarabine infusion [7]. G-CSF
was given at 200 or 400 µg/m 2 /day from day 0 to the first day
of absolute neutrophil count (ANC) of >1000/µL in 10 patients,
while it was started 48 h after completion of treatment in 8
patients.
Nineteen courses and 30 cycles were administered to 18 patients.
In 9 courses 1 cycle, in 9 courses 2 cycles, and in 1 course 3 cycles
of treatment regimen were administered. Detailed information
is given in Table 1.
IDA was not given to the previously heavily treated 12 patients
to decrease the rate of cardiotoxicity. If CR could not be achieved
after the first cycle, then IDA was added to the FLAG regimen.
All patients routinely received trimethoprim/sulfamethoxazole
and antifungal prophylaxis. Patients with response to treatment
underwent allogeneic HSCT if they had an eligible donor.
The toxicity of the regimen was assessed according to the
Common Toxicity Criteria of the World Health Organization [13].
Assessment of Response
Bone marrow examination was performed when ANC was
>1000/µL or at day 30 after chemotherapy. CR was defined as
the absence of physical signs of leukemia, no extramedullary
blasts, no blasts in peripheral blood,

Yılmaz Bengoa Ş, et al: FLAG Therapy in Relapsed/Refractory Childhood Leukemia Turk J Hematol 2017;34:46-51
Table 1. Patient characteristics, treatment regimen, response to treatment, duration of survival, and outcome.
Patient
No.
Age at
FLAG
course
(years)/sex
Diagnosis Duration of
remission before
relapse (first/
second relapse)
Treatment regimen and response Duration of
remission after
FLAG/FLAG-
IDA
Duration of
survival/outcome
1 16/M Precursor B-cell ALL/first relapse 12 months 1 st FLAG-IDA: Aplasia _ 3 months/died with relapse
2 7/M Precursor B-cell ALL/first relapse 17 months 1 st FLAG: No response _ 4 months/died with relapse
3 12/F Precursor B-cell ALL/refractory after first relapse 10 months 1 st FLAG-IDA: Aplasia _ 3 months/died with relapse and
infection
4 14/M T-cell ALL/refractory _ 1 st FLAG: Not evaluated, died at 15 th day
after chemotherapy
5 12/M Precursor B-cell ALL/second relapse 21 months/16 months 1 st FLAG: PR
2 nd FLAG-IDA: Aplasia
6 11.5/M Precursor B-cell ALL/first relapse 23 months 1 st FLAG: CR
Allo-HSCT
7 15/M T-cell ALL/refractory _ 1 st FLAG: CR
2 nd FLAG: CR
Allo-HSCT
8 14/F Precursor B-cell ALL/second relapse 18 months/17 months 1 st FLAG: CR
2 nd FLAG: CR
Allo-HSCT
9 16/M T-cell ALL/refractory _ 1 st FLAG: CR
2 nd FLAG: CR
Allo-HSCT
10 14/M T-cell ALL/first relapse 9 months 1 st FLAG: No response
2 nd FLAG-IDA: CR
Allo-HSCT
11 4.5/M AML-M4/first relapse 10 months 1 st FLAG: CR
2nd FLAG: CR
Allo-HSCT
12 15/M AML-M2/first relapse 10 months 1 st FLAG-IDA: Not evaluated, died at 17 th
day after chemotherapy
13 9/F AML-M4 2.5 months 1 st FLAG: No response
2 nd FLAG: No response
_ - /died with infection
_ 3 months/died with infection
10 months 10 months/died with GVHD and
infection
25 months 25 months/alive
2 months 2 months/died with GVHD and
infection
33 months 33 months/alive
5 months 5 months/died with infection and
multiorgan failure
33 months 33 months/alive
_ - / died with infection
_ 4 months/died with refractory
leukemia and infection
14 8.5/M AML secondary to MDS/refractory _ 1 st FLAG-IDA: No response _ 3 months/died with refractory
leukemia and infection
15 0.8/M AML-M5/first relapse 10.5 months 1 st FLAG: No response _ 2 months/died with relapse
16 5/M AML secondary to MDS/refractory _ 1 st FLAG: Aplasia
Allo-HSCT
17 15/M AML-M2/first relapse 9 months 1 st FLAG-IDA: CR
18, first
course
18,
second
course
2 nd FLAG: CR
Allo-HSCT
11.5/M Myelosarcoma/first relapse 36 months 1 st FLAG: CR
2 nd FLAG: CR
Allo-HSCT
14/M AML 20 months 1 st FLAG: CR
2 nd FLAG: CR
3 rd FLAG: Relapsed
M: Male, F: female, AML: acute myeloid leukemia, ALL: acute lymphoblastic leukemia, CR: complete remission, Allo-HSCT: allogeneic hematopoietic stem cell transplantation, IDA: idarubicin
_ 25 months/alive
70 months 70 months/alive
24 months After 20 months of posttransplant
remission, he relapsed with AML
_ 5 months/died with relapse and
infection
48

Turk J Hematol 2017;34:46-51
Yılmaz Bengoa Ş, et al: FLAG Therapy in Relapsed/Refractory Childhood Leukemia
The primary end point was status of the bone marrow sampled
after the first/second course of chemotherapy. The second end
point was the duration of survival after HSCT.
Duration of survival was calculated from the start of the
treatment regimen up to the last follow-up or mortality.
Statistical Analysis
SPSS 15.0 (SPSS Inc., Chicago, IL, USA) was used for statistical
analysis. Analytical characteristics were given as percentage,
mean and SD, or median. Data were analyzed for statistically
significant differences using the Mann-Whitney U test and the
chi-square test. Group differences with p500/µL) was 24 days (minimum-maximum: 15-
45), and that of platelet recovery (>20,000/µL) was 20 days
(minimum-maximum: 15-73). Febrile neutropenia (FN) occurred
after 26 (86.6%) cycles of regimens. FN was observed after 6
(85.7%) cycles with additional IDA and after 20 (87%) cycles
without IDA. There was no difference in FN rate according to
additional IDA (p=0.677). Most patients developed grade 3-4
mucositis. Seven children had transient mild hepatotoxicity
(36.8%). There was no serious cardiotoxicity. Two patients
(11.1%) had documented infections (blood cultures showed
Escherichia coli and a yeast-like organism in 1 patient, and
Klebsiella pneumoniae in 1 patient). Two patients, a primary
refractory T-cell ALL patient and a relapsed AML patient with
documented infection, died before the time of remission
evaluation. Two patients (11.1%) had pulmonary invasive fungal
infection.
Duration of Survival
All patients in CR and one patient with AML secondary to MDS
who had aplasia after the regimen, in total 9 (50%) patients,
underwent subsequent allogeneic HSCT. Four patients were
transplanted from matched sibling donors, 2 from matched
unrelated donors, and 3 from haploidentical donors. Four
patients died after HSCT; in 3 patients, the cause of death was
infection. The fourth patient (case 18) relapsed after HSCT and
had a second course with 3 cycles of FLAG; he was in remission
after the first 2 cycles but relapsed after the third cycle and
died.
Mean duration of survival in transplanted patients was 24.7±20.8
months (minimum-maximum: 2-70, median: 25 months) and
it was 2.7±1.64 months (minimum-maximum: 0-5, median: 3
months) in the nontransplanted patients.
As a result, 5 (27.7%) patients who underwent HSCT are still
alive and in CR. Two patients underwent allogeneic HSCT from
their siblings, 2 underwent allogeneic HSCT from unrelated
matched donors, and 1 underwent haploidentical HSCT from his
mother. The median time of follow-up for these patients was 33
months (minimum-maximum: 25-70 months). Three were AML
(one case secondary to MDS) and 2 were ALL patients.
Discussion
The treatment of children with relapsed or refractory AL is still
challenging. Regimens containing FL and high-dose cytarabine
with or without IDA have been used in this patient group, and
the first results were published in 1996 [6]. In our study, the CR
rate after 2 cycles was 42.1% (most of these patients were in CR
after the first cycle), all of these patients could proceed to HSCT,
and 27.7% survived. Fleischhack et al. reported a CR rate of
73.9% in patients with poor-prognosis AML; 47.8% underwent
HSCT and 39.1% remained in CR [7]. In the study conducted by
McCarthy et al., in a group of ALL, AML, and biphenotypic AL
patients using the FLAG regimen the CR rate was 70%; 68.4% of
the patients underwent HSCT and 36.8% were alive at the end
of the study [15]. Tavil et al. from Turkey presented the results
of 25 relapsed/refractory AL patients. The CR rate was 60%, 49%
of their patients could proceed to HSCT, and 20% survived [8].
Yalman et al., also from Turkey, reported a CR rate of only 17.6%
in 17 poor-prognosis AL patients; 2 underwent HSCT and only
1 child with a previous HSCT survived after donor lymphocyte
infusion [9].
49

Yılmaz Bengoa Ş, et al: FLAG Therapy in Relapsed/Refractory Childhood Leukemia Turk J Hematol 2017;34:46-51
The CR rate in our patients who had IDA in combination therapy
was 28.6% and it was 50% in patients treated without IDA; the
difference was not statistically significant. Patients who received
IDA-FLAG were mostly those who had refractory disease. This
might be the reason for the lower response rate.
All of our patients experienced severe myelosuppression, FN
developed after 86.6% of the cycles, and 2 patients (11.1%) died
early with infection, shortly after chemotherapy (15 th and 17 th
days). The addition of IDA to the FLAG regimen did not change
the risk of FN. Invasive fungal infection was observed in a total
of 3 patients (16.6%). The reported toxicity of these regimens is
similar to rates reported in the literature [8,15].
In some recent studies, it was demonstrated that with the
addition of agents like liposomal forms of daunorubicin and
doxorubicin instead of IDA to treatment regimens containing
FL and high-dose cytarabine, CR can be achieved in higher rates
with less systemic toxicity in children with refractory/relapsed
AL [16,17]. In developing countries such as Turkey, liposomal
forms of these anthracyclines are not available and cannot be
used due to economic reasons.
Because of the increased use of unrelated and haploidentical
donors nowadays, even when a suitable family donor is lacking,
the chance of transplantation with alternative stem cell sources
in a short time after CR is better. Therefore, achieving CR in
poor-prognosis AL with effective treatment regimens may result
in better outcomes. Five of our patients achieved a CR of >24
months after HSCT.
The role of G-CSF in the management of relapsed/refractory AL
has been tested widely and remains controversial [18]. Most of
the trials demonstrated a modest reduction in the duration, but
not the depth, of neutropenia [16,18,19]. The effects of G-CSF on
duration of survival, incidence of severe infection, and duration
of hospitalization are variable, but in developing countries, the
death rates due to FN are higher than in developed countries,
and G-CSF given with chemotherapy or after chemotherapy
is still common. Even though a trend towards an increased
incidence of relapses with G-CSF treatment in children with AML
that overexpress the differentiation-defective G-CSFR isoform
IV has been reported, the number of these cases is very low and
G-CSF continues to be a part of the FLAG regimen [16,20]. We
used G-CSF in all of our patients since the FN risk is high in our
clinic. We did not find any statistically significant difference in
CR rate whether we started G-CSF at day 0 or after completion
of chemotherapy.
Conclusion
In conclusion, FLAG regimens with or without IDA produced a
CR of >24 months in 27.7% of children with refractory/relapsed
AL and can be recommended as a therapeutic option prior to
HSCT with appropriate supportive measurements in developing
countries.
Ethics
Ethics Committee Approval: The study was a retrospective
analysis, and we used data from hospital records; Informed
Consent: All parents signed written informed consent forms
before the start of the regimens.
Authorship Contributions
Concept: Şebnem Yılmaz Bengoa, Hale Ören; Design: Şebnem
Yılmaz Bengoa; Data Collection or Processing: Şebnem Yılmaz
Bengoa, Eda Ataseven, Deniz Kızmazoğlu, Fatma Demir
Yenigürbüz, Melek Erdem; Analysis or Interpretation: Şebnem
Yılmaz Bengoa, Hale Ören; Literature Search: Şebnem Yılmaz
Bengoa; Writing: Şebnem Yılmaz Bengoa, Hale Ören.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Stahnke K, Ritter J, Schellong G, Beck JD, Kabisch H, Lampert F, Creutzig
U. Treatment of recurrence of acute myeloid leukemia in childhood. A
retrospective analysis of recurrence in the AML-BFM-83 study. Klin Padiatr
1992;204:253-257.
2. Einsiedel HG, von Stackelberg A, Hartmann R, Fengler R, Schrappe M, Janka-
Schaub G, Mann G, Hählen K, Göbel U, Klingebiel T, Ludwig WD, Henze G.
Long-term outcome in children with relapsed ALL by risk-stratified salvage
therapy: results of trial acute lymphoblastic leukemia-relapse study of
the Berlin-Frankfurt-Münster Group 87. J Clin Oncol 2005;23:7942-7950.
Erratum in: J Clin Oncol. 2008;26:2238.
3. Sander A, Zimmermann M, Dworzak M, Fleischhack G, von Neuhoff C,
Reinhardt D, Kaspers GJ, Creutzig U. Consequent and intensified relapse
therapy improved survival in pediatric AML: results of relapse treatment in
379 patients of three consecutive AML-BFM trials. Leukemia 2010;24:1422-
1428.
4. Virchis A, Koh M, Rankin P, Mehta A, Potter M, Hoffbrand AV, Prentice HG.
Fludarabine, cytosine arabinoside, granulocyte-colony stimulating factor
with or without idarubicin in the treatment of high risk acute leukaemia or
myelodysplastic syndromes. Br J Haematol 2004;124:26-32.
5. Yavuz S, Paydas S, Disel U, Sahin B. IDA-FLAG regimen for the therapy of
primary refractory and relapse acute leukemia: a single-center experience.
Am J Ther 2006;13:389-393.
6. Fleischhack G, Graf N, Hasan C, Ackermann M, Breu H, Zernikow B, Bode
U. IDA-FLAG (idarubicin, fludarabine, high dosage cytarabine and G-CSF)-
-an effective therapy regimen in treatment of recurrent acute myelocytic
leukemia in children and adolescents. Initial results of a pilot study. Klin
Padiatr 1996;208:229-235.
7. Fleischhack G, Hasan C, Graf N, Mann G, Bode U. IDA-FLAG (idarubicin,
fludarabine, cytarabine, G-CSF), an effective remission-induction therapy
for poor-prognosis AML of childhood prior to allogeneic or autologous
bone marrow transplantation: experiences of a phase II trial. Br J Haematol
1998;102:647-655.
8. Tavil B, Aytac S, Balci YI, Unal S, Kuskonmaz B, Yetgin S, Gurgey A, Tuncer M,
Gumruk F, Uckan D, Cetin M. Fludarabine, cytarabine, granulocyte colonystimulating
factor, and idarubicin (FLAG-IDA) for the treatment of children
50

Turk J Hematol 2017;34:46-51
Yılmaz Bengoa Ş, et al: FLAG Therapy in Relapsed/Refractory Childhood Leukemia
with poor-prognosis acute leukemia: the Hacettepe experience. Pediatr
Hematol Oncol 2010;27:517-528.
9. Yalman N, Sarper N, Devecioğlu O, Anak S, Eryilmaz E, Can M, Yenilmez
H, Ağaoğlu L, Gedikoğlu G. Fludarabine, cytarabine, G-CSF and idarubicin
(FLAG-IDA) for the treatment of relapsed or poor risk childhood acute
leukemia. Turk J Pediatr 2000;42:198-204.
10. Keating MJ, O’Brien S, Robertson LE, Kantarjian H, Dimopoulos M,
McLaughlin P, Cabanillas F, Gregoire V, Li YY, Gandhi V, Estey E, Plunkett
W. The expanding role of fludarabine in hematologic malignancies. Leuk
Lymphoma 1994;14:11-16.
11. Gandhi V, Estey E, Keating MJ, Plunkett W. Fludarabine potentiates
metabolism of cytarabine in patients with acute myelogenous leukemia
during therapy. J Clin Oncol 1993;11:116-124.
12. Tosi P, Visani G, Ottaviani E, Manfori S, Zinzani PL, Tura S. Fludarabine +
Ara-C + G-CSF: cytotoxic effect and induction of apoptosis on fresh acute
myeloid leukemia cells. Leukemia 1994;8:2076-2082.
13. National Cancer Institute. Common Terminology Criteria for Adverse Events
(CTCAE) Version 4.0. Available online at: http://evs.nci.nih.gov/ftp1/CTCAE/
CTCAE_4.03_2010-06-14_QuickReference_5x7.pdf.
14. Redner A. Leukemias. In: Lanzkowsky P, (ed). Manual of Pediatric Hematology
and Oncology, 5th ed. New York, Academic Press, 2011.
15. McCarthy AJ, Pitcher LA, Hann IM, Oakhill A. FLAG (fludarabine, high-dose
cytarabine, and G-CSF) for refractory and high-risk relapsed acute leukemia
in children. Med Pediatr Oncol 1999;32:411-415.
16. Kaspers GJ, Zimmermann M, Reinhardt D, Gibson BE, Tamminga RY,
Aleinikova O, Armendariz H, Dworzak M, Ha SY, Hasle H, Hovi L, Maschan
A, Bertrand Y, Leverger GG, Razzouk BI, Rizzari C, Smisek P, Smith O, Stark
B, Creutzig U. Improved outcome in pediatric relapsed acute myeloid
leukemia: results of a randomized trial on liposomal daunorubicin by the
International BFM Study Group. J Clin Oncol 2013;31:599-607.
17. Quarello P, Berger M, Rivetti E, Galletto C, Masetti R, Manicone R, Barisone
E, Pession A, Fagioli F. FLAG-liposomal doxorubicin (Myocet) regimen for
refractory or relapsed acute leukemia pediatric patients. J Pediatr Hematol
Oncol 2012;34:208-216.
18. Milligan DW, Wheatley K, Littlewood T, Craig JI, Burnett AK; NCRI
Haematological Oncology Clinical Studies Group. Fludarabine and cytosine
are less effective than standard ADE chemotherapy in high-risk acute
myeloid leukemia, and addition of G-CSF and ATRA are not beneficial:
results of the MRC AML-HR randomized trial. Blood 2006;107:4614-4622.
19. Usuki K, Urabe A, Masaoka T, Ohno R, Mizoguchi H, Hamajima N, Miyazaki
T, Niitsu Y, Yoshida Y, Miura A, Shibata A, Abe T, Miura Y, Ikeda Y, Nomura
T, Nagao T, Saitou H, Shirakawa S, Ohkuma M, Matsuda T, Nakamura T,
Horiuchi A, Kuramoto A, Kimura I, Irino S, Niho Y, Takatsuki K, Tomonaga M,
Uchino H, Takaku F; Gran AML Study Group. Efficacy of granulocyte colonystimulating
factor in the treatment of acute myelogenous leukaemia: a
multicentre randomized study. Br J Haematol 2002;116:103-112.
20. Ehlers S, Herbst C, Zimmermann M, Scharn N, Germeshausen M, von
Neuhoff N, Zwaan CM, Reinhardt K, Hollink IH, Klusmann JH, Lehrnbecher
T, Roettgers S, Stary J, Dworzak M, Welte K, Creutzig U, Reinhardt D.
Granulocyte colony-stimulating factor (G-CSF) treatment of childhood
acute myeloid leukemias that overexpress the differentiation-defective
G-CSF receptor isoform IV is associated with a higher incidence of relapse.
J Clin Oncol 2010;28:2591-2597.
51

RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0188
Turk J Hematol 2017;34:52-58
Red Blood Cell Transfusions in Greece: Results of a Survey of Red
Blood Cell Use in 2013
Yunanistan’da Eritrosit Transfüzyonu: 2013’de Eritrosit Kullanımı Anketinin Sonuçları
Serena Valsami, Elisavet Grouzi, Abraham Pouliakis, Leontini Fountoulaki-Paparisos, Elias Kyriakou, Maria Gavalaki, Elias Markopoulos,
Ekaterini Kontopanou, Ioannis Tsolakis, Argyrios Tsantes, Alexandra Tsoka, Anastasia Livada, Vassiliki Rekari, Niki Vgontza, Dimitra
Agoritsa, Marianna Politou, Stavros Nousis, Aspasia Argyrou, Ekaterini Manaka, Maria Baka, Maria Mouratidou, Stavroula Tsitlakidou,
Konstantinos Malekas, Dimitrios Maltezos, Paraskevi Papadopoulou, Vassiliki Pournara, Ageliki Tirogala, Emmanouil Lysikatos, Sousanna
Pefani, Konstantinos Stamoulis
On Behalf of the Working Committee of Transfusion Medicine & Apheresis of the Hellenic Society of Hematology
Abstract
Objective: Greece is ranked as the second highest consumer of blood
components in Europe. For an effective transfusion system and in
order to reduce variability of transfusion practice by implementing
evidence-based transfusion guidelines it is necessary to study and
monitor blood management strategies. Our study was conducted
in order to evaluate the use of red blood cell units (RBC-U) in
nationwide scale mapping parameters that contribute to their proper
management in Greece.
Materials and Methods: The survey was conducted by the Working
Committee of Transfusion Medicine&Apheresis of the Hellenic Society
of Hematology from January to December 2013. The collected data
included the number, ABO/D blood group, patients’ department, and
storage age of RBC-U transfused.
Results: The number of RBC-U evaluated was 103,702 (17.77%) out
of 583,457 RBC-U transfused in Greece in 2013. RBC-U transfused
by hospital department (mean percentage) was as follows: Surgery
29.34%, Internal Medicine 29.48%, Oncology/Hematology 14.65%,
Thalassemia 8.87%, Intensive Care Unit 6.55%, Nephrology 1.78%,
Obstetrics/Gynecology 1.46%, Neonatal&Pediatric 0.31%, Private
Hospitals 8.57%. RBC-U distribution according to ABO/D blood group
was: A: 39.02%, B: 12.41%, AB: 5.16%, O: 43.41%, D+: 87.99%, D-:
12.01%. The majority of RBC-U (62.46%) was transfused in the first 15
days of storage, 25.24% at 16 to 28 days, and 12.28% at 29-42 days.
Conclusion: Despite a high intercenter variability in RBC transfusions,
surgical and internal medicine patients were the most common groups
of patients transfused with an increasing rate for internal medicine
patients. The majority of RBC-U were transfused within the first 15
days of storage, which is possibly the consequence of blood supply
insufficiency leading to the direct use of fresh blood. Benchmarking
transfusion activity may help to decrease the inappropriate use of
blood products, reduce the cost of care, and optimize the use of the
voluntary donor’s gift.
Keywords: Red blood cell, Transfusion practice, Blood storage age
Öz
Amaç: Avrupa’daki kan bileşenlerini en çok tüketen ülkeler arasında
Yunanistan ikinci sıradadır. Etkili bir transfüzyon sistemi için ve
transfüzyon uygulamasının değişkenliğini azaltmak için kanıta dayalı
transfüzyon kılavuzlarını uygulayarak kan yönetimi stratejilerini
incelemek ve izlemek gereklidir. Çalışmamız, Yunanistan’da doğru kan
transfüzyon yönetimine katkıda bulunmak için, ülke çapında ölçek
eşleştirme parametrelerinde eritrosit süspansiyonu (ES) kullanımını
değerlendirmek amacıyla yürütülmüştür.
Gereç ve Yöntemler: Anket, Ocak-Aralık 2013 tarihleri arasında
Hellenic Hematoloji topluluğunun, Transfüzyon Tıbbı ve Aferez
Çalışma Komitesi tarafından yürütülmüştür. Toplanan veriler, ABO/D
kan grubu, hasta bölümleri ve transfüze edilen ES depolama yaşını
içermektedir.
Bulgular: 2013 yılında Yunanistan’da transfüzyon yapılan 583,457
ES’nin, ES sayısı 103,702 (%17,77) idi. Hastanedeki bölümlerde
transfüze edilen ES (ortalama oran) şöyleydi: Cerrahi %29,34, Dahiliye
%29,48, Onkoloji/Hematoloji %14,65, Talasemi %8,87, Yoğun bakım
ünitesi %6,55, Nefroloji %1,78, Kadın Hastalıkları ve Doğum %1,46,
Yenidoğan ve Çocuk bölümü %0,31, Özel Hastaneler %8,57. ABO/D
kan grubuna göre ES dağılımıysa şöyleydi: A: %39,02, B: %12,41,
AB: %5,16, O: %43,41, D+: %87,99, D-: %12,01. ES’nin çoğunluğu
(%62,46) depolamanın ilk 15 günü, 16 ile 28 günleri arası %25,24’ü ve
29 ile 42 gün arasında ise %12,28’i, transfüze edildi.
Sonuç: Eritrosit transfüzyonlarında merkezler arası yüksek
değişkenliğe rağmen, en fazla transfüzyon yapılan hasta grubunu
cerrahi ve dahili tıp hastaları oluşturmaktaydı, dahili tıp hastalarında
transfüzyon oranları daha yüksekti. ES’nin çoğunluğu depolamanın ilk
15 gününde transfüze edildi; bu da muhtemelen kan depolamadaki
yetersizliğinin sonucunda taze kan kullanımına yol açtı. Transfüzyon
aktivitesinin standartları, kan ürünlerinin uygun olmayan kullanımını
azaltmaya, bakım maliyetini düşürmeye ve gönüllü vericilerin hediye
kullanımını optimize etmeye yardımcı olabilir.
Anahtar Sözcükler: Kırmızı kan hücresi, Transfüzyon uygulamaları,
Kan depolama yaşı
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Serena VALSAMI, M.D., Aretaieio Hospital, Kapodistrian
University of Athens Medical School, Department of Blood Transfusion, Athens, Greece
Phone : +306944602629
E-mail : serenavalsami@yahoo.com
Received/Geliş tarihi: May 24, 2016
Accepted/Kabul tarihi: November 15, 2016
52

Turk J Hematol 2017;34:52-58
Valsami S, et al: Red Blood Cell Transfusion in Greece
Introduction
Greece is a member of the European Union, which has
established guidelines for blood donation and inspection of
blood establishments, but so far no uniform rules for treatment
with blood and blood products have been adopted by the
European Union. Accordingly, Greek authorities and blood
donor associations adhere strictly to the principle of selfsufficiency
that was laid out by the Council of Europe. The only
source of blood in Greece is non-remunerated blood donors. In
a blood system based on voluntary donation the potential for
blood shortage is an ongoing risk [1]. A number of emergency
scenarios, including natural or man-made disasters, pandemic
outbreaks, extremes of weather, and seasonal variations of blood
donations, could contribute to extremely low blood inventory
levels. It seems clear that the proportion of the population
eligible to donate blood is likely to fall over the coming decades
while the proportion requiring these products is likely to rise.
Further attention is therefore required both to manage the
supply and influence the demand for existing blood and blood
products.
Greece is ranked as the second highest consumer of blood
components in Europe. Blood utilization in Greece exceeds
600,000 red blood cell (RBC) units annually according to data
provided by the national competent authority (Hellenic National
Blood Transfusion Center). Adequate transfusion practice is
essential in order to cover transfusion demands. Assessing data
regarding RBC units transfused at medical institutions nationally
could provide the data needed for developing plans to manage
the demand and supply for blood units [2,3,4]. The aim of our
study was to assess and evaluate the use of RBC units in Greece
in order to identify parameters that contribute to proper RBC
management, which can ensure blood sufficiency, taking into
account the geographical particularities of our country, the
large number of transfusion-dependent thalassemia patients,
and the large number of car accident victims.
Materials and Methods
The study was conducted by the Working Committee of
Transfusion Medicine&Apheresis of the Hellenic Society of
Hematology. A preprinted data collection form was used and
all transfusion services in hospitals all over Greece were invited
to participate in the study. The survey was conducted from
January to December 2013. Data collection was prospective,
using preprinted forms that were filled out monthly by the
participating transfusionists. Monthly collected data included
the number of RBC units transfused, the ABO/D blood group,
and the departments of the patients who received the RBC
units. According to storage age (SA) on the day of transfusion
the RBC units were sorted into groups as SA1: 0-15 days (SA on
the day of transfusion), SA2: 16-28 days, and SA3: 29-42 days
[5,6]. Data regarding national RBC transfusion supplies were
provided by the Hellenic National Blood Transfusion Center.
Data forms were manually entered into an electronic database
(Excel 2007, Microsoft Corp., Redmond, WA, USA), which was
also used to perform part of the analysis. Additional statistical
analysis was performed using SAS software (version 9.3 for
Windows, SAS Institute Inc., Cary, NC, USA) [7,8]. Proportion
comparisons were performed via the Z-test, and mean values
were compared via the t-test, the accepted significance level
was p

Valsami S, et al: Red Blood Cell Transfusion in Greece
Turk J Hematol 2017;34:52-58
Table 1. Number of red blood cell units transfused,
percentages, and confidence intervals for the participating
hospitals in declining order according to blood consumption.
Participating
Hospital
RBC Units
Transfused
(n)
% Number of Beds
AH1 20,133 19.4±0.2 947
AH2 14,152 13.6±0.2 562
AH3 13,357 12.9±0.2 615
AH4 10,142 9.8±0.2 596
HOA1 8509 8.2±0.2 566
AH5 4440 4.3±0.1 346
HOA2 4045 3.9±0.1 256
AH6 3983 3.8±0.1 279
HOA3 3682 3.6±0.1 303
AH7 3194 3.1±0.1 380
AH8 3136 3.0±0.1 150
HOA4 2268 2.2±0.1 161
AH9 2255 2.2±0.1 268
AH10 2242 2.2±0.1 736
AH11 2228 2.1±0.1 106
HOA5 2139 2.1±0.1 394
HOA6 1163 1.1±0.1 136
HOA7 895 0.9±0.1 155
HOA8 837 0.8±0.1 98
HOA9 409 0.4±0.0 120
HOA10 271 0.3±0.0 89
HOA11 135 0.1±0.0 85
HOA12 87 0.1±0.0 102
TOTAL 103,702 100% 7450
AH: Athens Hospital, HOA: Hospital Outside Athens, AH1: Evangelismos Hospital, AH2:
Laikon Hospital, AH3: General Hospital “Saint Panteleimon”, AH4: General Hospital
“ATTIKON”, HOA1: Larissa University Hospital, AH5: St. Savvas Oncology Hospital,
HOA2: General Hospital of Xanthi, AH6: General Hospital Nea Ionia “Agia Olga”, HOA3:
General Hospital of Trikala, AH7: Thriasio Hospital, AH8: Aretaieio University Hospital,
HOA4: General Hospital Edessa, AH9: “Amalia Fleming” Hospital, AH10: “Sotiria”
Hospital, AH11: “Saints Anargyroi” Hospital, HOA5: General Hospital of Kavala, HOA6:
General Hospital of Agrinio, HOA7: General Hospital of Messologgi, HOA8: General
Hospital of Livadia, HOA9: General Hospital of Florina, HOA10: General Hospital
of Zakynthos, HOA11: General Hospital of Kalymnos, HOA12: General Hospital of
Kefalonia, RBC: red blood cell.
peripheral, small non-university hospitals (100-300 beds),
two groups were created: university urban hospitals (AH1,
AH2, and AH4) and general peripheral hospitals (HOA2, HOA3,
HOA4, HOA5, HOA6, HOA7, and HAO9). The number of units
transfused in urban university hospitals was 44,427 and in
peripheral hospitals it was 14,601. Interestingly, university
hospitals consumed “fresher” blood compared to peripheral
hospitals (SA1 group: 78.9% vs. 38.2%, p

Turk J Hematol 2017;34:52-58
Valsami S, et al: Red Blood Cell Transfusion in Greece
of RBC units of the SA1 group for the rest of the RBC types was
62.4% (difference: 0.76%, p=0.26).
The mean number of RBC units transfused per month in all
hospitals was 8642±604 (CI=95%). Monthly distribution of
transfusions and SA data, as depicted in Table 4, show that older
blood (SA3) was issued during the summer months of May, June,
and July. Specifically, 4615 SA3 RBC units were issued during
these three months [mean: 1538.3, standard deviation (SD):
349.3], while 8117 SA3 RBC units were issued during the rest
of the year (mean: 901.9, SD: 295.6) (p

Valsami S, et al: Red Blood Cell Transfusion in Greece
Turk J Hematol 2017;34:52-58
Figure 1. Percentages of red blood cell consumption for the three storage age groups (SA1: 0-15 days, SA2: 16-28 days, and SA3: 29-42
days) for the participating hospitals. Abbreviations: AH: Athens Hospital, HOA: Hospital Outside Athens, AH1: Evangelismos Hospital,
AH2: Laikon Hospital, AH3: General Hospital “Saint Panteleimon”, AH4: General Hospital “ATTIKON”, HOA1: Larissa University Hospivtal,
AH5: St. Savvas Oncology Hospital, HOA2: General Hospital of Xanthi, AH6: General Hospital Nea Ionia “Agia Olga”, HOA3: General
Hospital of Trikala, AH7: Thriasio Hospital, AH8: Aretaeio University Hospital, HOA4: General Hospital Edessa, AH9: “Amalia Fleming”
Hospital, AH10: “Sotiria” Hospital, AH11: “Saints Anargyroi” Hospital, HOA5: General Hospital of Kavala, HOA6: General Hospital of
Agrinio, HOA7: General Hospital of Messologgi, HOA8: General Hospital of Livadia, HOA9: General Hospital of Florina, HOA10: General
Hospital of Zakynthos, HOA11: General Hospital of Kalymnos, HOA12: General Hospital of Kefalonia.
Table 4. Red blood cell units transfused, percentages, and confidence intervals for each month during the study and the storage
age groups (SA1, SA2, and SA3).
Month SA1 (0-15 days) SA2 (16-28 days) SA3 (29-42 days) n %
January 68.9±0.1% 19.9±0.7% 11.2±0.7% 8224 7.9±0.2%
February 73.6±1.0% 20.9±0.9% 5.5±0.5% 8317 8.0±0.2%
March 62.0±1.0% 25.5±0.9% 12.6±0.7% 8499 8.2±0.2%
April 58.5±1.1% 26.9±1.0% 14.6±0.8% 8108 7.8±0.2%
May 54.2±1.0% 27.7±0.9% 18.1±0.8% 9011 8.7±0.2%
June 58.2±1.0% 29.9±0.9% 12.0±0.7% 9618 9.3±0.2%
July 44.3±1.0% 35.4±1.0% 20.3±0.8% 9011 8.7±0.2%
August 61.7±1.1% 26.1±1.0% 12.2±0.7% 7874 7.6±0.2%
September 78.7±0.9% 15.7±0.8% 5.6±0.5% 7847 7.6±0.2%
October 71.2±0.9% 21.0±0.8% 7.8±0.5% 9610 9.3±0.2%
November 64.1±1.0% 23.7±0.9% 12.2±0.7% 8807 8.5±0.2%
December 57.1±1.0% 28.6±0.0% 14.3±0.7% 8776 8.5±0.1%
Total 62.5±0.29% 25.2±0.3% 12.3±0.2% 103,702 100%
provided by the Hellenic National Blood Transfusion Center.
Blood insufficiency in Greece is related not only to increased
demands but also to poor implementation of patient blood
management programs, and to the fact that central inventory
56

Turk J Hematol 2017;34:52-58
Valsami S, et al: Red Blood Cell Transfusion in Greece
management (i.e. an online system) across the country has not
been applied yet.
In our study, data from 23 blood transfusions services regarding
103,702 RBC units transfused during the year 2013 were
evaluated. The sample size was considered representative and
thus the analysis led to safe conclusions (with a 95% confidence
interval, margin of error was 0.28%).
The number of units reported by the 12 hospitals in Athens
was 2.75 times greater than the units reported by the 11
hospitals outside Athens (73.35% vs. 26.65%). Interestingly,
the majority of RBCs were transfused in the first 15 days of
storage (62.49±0.29). In this case, the use of fresh blood possibly
highlights the problem of blood sufficiency in our country,
which leads to the direct use of fresh blood. Transfusion of blood
in the first 15 days of storage (SA1) was a phenomenon more
pronounced in hospitals with the highest blood consumption,
mainly urban university hospitals (Figure 1). These hospitals
have extended Surgical departments also treating multipletrauma
patients as reference centers. However, according to
the last census results of 2011, Athens contains 35% of the
population of Greece [15]. This reverse percentage in relation
to the population is indicative of the fact that health care
services focus on the country’s capital. Accordingly, increased
consumption of “older” blood (SA3) takes place mainly in small
hospitals, including countryside ones, with limited inventory that
mostly treat chronic patients. These small hospitals often use
RBC units close to the expiry date supplied by other hospitals in
order to decrease time expiry losses, according to data provided
by the Hellenic National Blood Transfusion Center.
Regarding the total number of RBC units transfused by hospital
department and despite intercenter variability, reflecting the
existing variability in transfusion practice in our country, the
vast majority of RBC units i.e. 75,138 units (73.47±0.27%, 95%
CI) were transfused for patients in Surgery and Internal medicine
departments, including Hematology/Oncology patients. The lack
of strong evidence supporting specific transfusion practices
could explain the overuse of blood products in specific patient
populations [16,17]. Neonates and thalassemia patients received
RBCs of the younger SA group in a statistically significant
higher proportion (p

Valsami S, et al: Red Blood Cell Transfusion in Greece
Turk J Hematol 2017;34:52-58
Abraham Pouliakis, Elias Markopoulos, Ekaterini Kontopanou,
Ioannis Tsolakis, Argyrios Tsantes, Alexandra Tsoka, Anastasia
Livada, Vassiliki Rekari, Niki Vgontza, Dimitra Agoritsa, Marianna
Politou, Stavros Nousis, Aspasia Argyrou, Ekaterini Manaka, Maria
Baka, Maria Mouratidou, Stavroula Tsitlakidou, Konstantinos
Malekas, Dimitrios Maltezos, Paraskevi Papadopoulou, Vassiliki
Pournara, Ageliki Tirogala, Emmanouil Lysikatos, Sousanna
Pefani; Analysis or Interpretation: Serena Valsami, Elisavet
Grouzi, Abraham Pouliakis, Elias Kyriakou, Maria Gavalaki,
Konstantinos Stamoulis; Literature Search: Serena Valsami,
Elisavet Grouzi, Konstantinos Stamoulis; Writing: Serena
Valsami, Elisavet Grouzi, Konstantinos Stamoulis.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. World Health Organization. Global Database on Blood Safety. Summary
Report 2011. Geneva, WHO, 2011.
2. Cotton S. Blood Stocks Management Scheme Annual Report 2010/11.
Summary Report. 2011 ed. London, BSMS, 2011.
3. Kim V, Kim H, Lee K, Chang S, Hur M, Kang J, Kim S, Lee SW, Kim YE. Variation
in the numbers of red blood cell units transfused at different medical
institution types from 2006 to 2010 in Korea. Ann Lab Med 2013;33:331-
342.
4. Tinegate H, Chattree S, Iqbal A, Plews D, Whitehead J, Wallis JP; Northern
Regional Transfusion Committee. Ten-year pattern of red blood cell use in
the North of England. Transfusion 2013;53:483-489.
5. Thurer RL, Precopio T, Popovsky A. Age of blood transfused in the United
States: data for 166,208 transfusions. Transfusion 2012;52:53.
6. Desmarets M, Bardiaux L, Benzenine E, Dussaucy A, Binda D, Tiberghien P,
Quantin C, Monnet E. Effect of storage time and donor sex of transfused
red blood cells on 1-year survival in patients undergoing cardiac surgery: an
observational study. Transfusion 2016;56:1213-1222.
7. DiMaggio C. SAS for Epidemiologists: Applications and Methods. New York,
Springer-Verlag, 2013.
8. SAS Institute. SAS User Guide. Cary, SAS Institute, 2014.
9. Lialiaris T, Digkas E, Kareli D, Pouliliou S, Asimakopoulos B, Pagonopoulou
O, Simopoulou M. Distribution of ABO and Rh blood groups in Greece: an
update. Int J Immunogenet 2011;38:1-5.
10. Valsami S, Papakonstantinou M, Papadopoulos G, Katsadorou E, Stefanakou
S, Kourenti K. ABO and RH(D) phenotype frequencies of blood donors in
Greece. Poster Abstracts. Vox Sang 2007;93:54-274.
11. Roubinian NH, Escobar GJ, Liu V, Swain BE, Gardner MN, Kipnis P, Triulzi DJ,
Gottschall JL, Wu Y, Carson JL, Kleinman SH, Murphy EL; NHLBI Recipient
Epidemiology and Donor Evaluation Study (REDS-III). Trends in red blood
cell transfusion and 30-day mortality among hospitalized patients.
Transfusion 2014;54:2678-2686.
12. Fischer DP, Zacharowski KD, Müller MM, Geisen C, Seifried E, Müller
H, Meybohm P. Patient blood management implementation strategies
and their effect on physicians’ risk perception, clinical knowledge and
perioperative practice -the Frankfurt Experience. Transfus Med Hemother
2015;42:91-97.
13. European Council. Directive 2002/98/EC of the European Parliament and
of the Council of 27 January 2003 Setting Standards of Quality and Safety
for the Collection, Testing, Processing, Storage and Distribution of Human
Blood and Blood Components and Amending. Brussels, European Council,
2003.
14. Politou M, Gialeraki A, Valsami S, Nearchakos N, Tsantes A, Travlou A,
Maniatis A. Integration in groups of donors may modify attitudes towards
blood donation. Blood Transfus 2015;13:336-337.
15. Hellenic Statistical Authority. 2011 Population-Housing Census. Athens,
Hellenic Statistical Authority, 2016.
16. Carson JL, Carless PA, Hebert PC. Transfusion thresholds and other strategies
for guiding allogeneic red blood cell transfusion. Cochrane Database Syst
Rev 2012;4:CD002042.
17. Valero-Elizondo J, Spolverato G, Kim Y, Wagner D, Ejaz A, Frank SM, Pawlik
TM. Sex- and age-based variation in transfusion practices among patients
undergoing major surgery. Surgery 2015;158:1372-1381.
18. Priddee NR, Pendry K, Ryan KE. Fresh blood for transfusion in adults with
beta thalassaemia. Transfus Med 2011;21:417-420.
19. Quinn K, Quinn M, Moreno C, Soundar E, Teruya J, Hui SK. Neonatal
transfusion models to determine the impact of using fresh red blood cells
on inventory and exposure. Blood Transfus 2015;13:595-599.
20. National Blood Transfusion Committee, National Health Service. The
Appropriate Use of Group O RhD Negative Red Cells. London, National
Blood Transfusion Committee, 2008.
58

RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0359
Turk J Hematol 2017;34:59-63
The Clinical Significance of Schistocytes: A Prospective
Evaluation of the International Council for Standardization in
Hematology Schistocyte Guidelines
Şistositlerin Klinik Önemi: Hematoloji Standardizasyon Uluslararası Komitesi Şistosit
Kılavuzlarının Prospektif Bir Değerlendirmesi
Elise Schapkaitz, Michael Halefom Mezgebe
University of Witwatersrand Medical School, Department of Molecular Medicine and Hematology, Johannesburg, South Africa
Abstract
Objective: The presence of ≥1% schistocytes on a peripheral blood
smear (PBS) is an important criterion for the diagnosis of thrombotic
microangiopathy (TMA). The reporting of schistocytes has been
standardized by the International Council for Standardization in
Hematology (ICSH). Despite the availability of guidelines, however,
the assessment of schistocytes remains subjective. More recently, the
automated fragmented red cell (FRC) parameter has been evaluated.
However, local studies are not available.
Materials and Methods: A prospective study was performed at
the Charlotte Maxeke Johannesburg Academic Hospital in order to
evaluate the ICSH recommendations for schistocyte measurement in
146 PBSs with schistocytes. Schistocytes were evaluated by microscopy
and ADVIA 2120 automated hematology analyzers.
Results: Schistocytes were frequently observed in patients with
TMA (n=76), infection (n=20), hematologic malignancy (n=10), renal
failure (n=5), and hemoglobinopathy (n=15), and in neonates (n=11).
Schistocytes were ≥1% in all PBSs with TMA (n=76) with a mean of
3.44±1.84. Schistocytes of ≥1% were also observed in cases of renal
failure and hemoglobinopathy, and in neonates. In these conditions,
schistocytes were mainly observed in conjunction with moderate red
blood cell changes. The agreement between two morphologists gave a
correlation coefficient of 0.63 [confidence interval (CI): 0.52-0.75], while
the correlation coefficient between the average of the morphologists
and the FRC percentage was -1.97 (CI: -1.60 to -2.34). The ADVIA 2120
underestimated the schistocyte count in patients with TMA.
Conclusion: Observer bias can be decreased by implementing the
standardized procedures recommended by the ICSH. However,
estimation of schistocytes by the ADVIA 2120 analyzer requires further
evaluation as a screening tool. A higher threshold for schistocytes in
thrombotic thrombocytopenic purpura is recommended to distinguish
this hematological emergency from other conditions associated with
≥1% schistocytes.
Keywords: Schistocyte, thrombotic microangiopathy, Microscopy,
ADVIA 2120, Standardization
Öz
Amaç: Periferk kan yaymasında (PKY) ≥%1 şistosit varlığı trombotik
mikroanjiopati (TMA) tanısı için önemli bir kriterdir. Şistositlerin
raporlanması Hematoloji Standardizasyon Uluslararası Komitesi
[International Council for Standardization in Hematology (ICSH)]
tarafından standardize edilmiştir. Kılavuzların mevcudiyetine
rağmen, şistositlerin değerlendirmesi Öz yine de subjektif kalmaktadır.
Son zamanlarda, otomatize fragmente eritrosit (FE) parametresi
değerlendirilmektedir. Ne var ki, lokal çalışmalar mevcut değildir.
Gereç ve Yöntemler: ICSH önerilerini değerlendirmek için, Charlotte
Maxeke Johannesburg Akademik Hastanesi’nde şistosit saptanan
146 PKY’da şistosit ölçümünü değerlendiren prospektif bir çalışma
gerçekleştirildi. Şistositler mikroskop ve ADVIA 2120 otomatize
hematoloji analizörü ile değerlendirildi.
Bulgular: Şistositler, TMA (n=76), enfeksiyon (n=20), hematolojik
malignite (n=10), renal yetmezlik (n=5) ve hemoglobinopati (n=15)
hastalarında ve yenidoğanlarda (n=11) sıklıkla izlendi. Tüm TMA’lı
hastaların (n=76) PKY’lerinde şistositler 3,44±1,84 ortalama ile ≥%1
idi. Şistositler ayrıca renal yetmezlik ve hemoglobinopati olguları
ve yenidoğanlarda ≥%1 olarak izlendi. Bu durumlarda, şistositler
çoğunlukla ılımlı eritrosit değişiklikleri ile ilişkili olarak gözlendi. İki
morfolojist arasındaki anlaşma 0,63 [güven aralığı (GA): 0,52-0,75]
korelasyon katsayısı verirken, morfolojistlerin ortalaması ve FE yüzdesi
arasındaki korelasyon katsayısı -1.97 (GA: -1,60 - -2,34) idi. ADVIA
2120 ile TMA’lı hastalarda şistosit sayısı daha düşük ölçüldü.
Sonuç: ICSH tarafından önerilen standardize prosedürlerin
uygulanması ile gözlemci önyargısı azaltılabilir. Ne var ki, tarama aracı
olarak ADVIA 2120 analizörü ile şistosit ölçümü daha ileri değerlendirme
gerektirmektedir. Trombotik trombositopenik purpurada, şistositlerin
≥%1 olduğu diğer durumlardan bu hematolojik acili ayırt etmek için
daha yüksek bir şistosit eşik değeri önerilmektedir.
Anahtar Sözcükler: Şistosit, trombotik mikroanjiopati, Mikroskop,
ADVIA 2120, Standardizasyon
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Elise SCHAPKAITZ, M.D.,
University of Witwatersrand Medical School, Department of Molecular Medicine and Hematology, Johannesburg, South Africa
Phone : +27824592238
E-mail : elise.schapkaitz@nhls.ac.za
Received/Geliş tarihi: September 05, 2016
Accepted/Kabul tarihi: October 24, 2016
59

Schapkaitz E and Mezgebe MH: Evaluation of Schistocyte Quantitation
Turk J Hematol 2017;34:59-63
Introduction
Schistocytes are red blood cell (RBC) fragments. The presence
of schistocytes on a peripheral blood smear (PBS) according
to laboratory policies is a hematological emergency that
requires prompt review and investigation for thrombotic
microangiopathy (TMA). Schistocytes, however, are not specific
to TMA [1]. Fragmentation of RBCs is produced by mechanical
damage in the circulation and can also be seen in patients with
mechanical heart valves or those receiving dialysis. In addition,
schistocytes occur in cytoskeletal RBC abnormalities such as
acquired and inherited RBC disorders in association with marked
anisopoikilocytosis.
Furthermore, observer bias has been described when identifying
and enumerating schistocytes by microscopy [2]. Recently,
the identification and diagnostic value of schistocytes was
standardized by the International Council for Standardization
in Hematology (ICSH) Schistocyte Working Group. According to
the ICSH recommendations, the presence of ≥1% schistocytes
on a PBS in the absence of other moderate RBC changes is an
important criterion for the diagnosis of TMA [3]. Despite the
availability of guidelines, laboratory surveys in France indicated
that the morphologic identification of schistocytes remained
difficult and subjective [4]. More recently, measurement of
the automated fragmented red cell (FRC) parameter has been
evaluated. Studies have demonstrated that the automated
FRC parameter offers advantages such as improved precision,
immediate availability, and good agreement with microscopy
[5,6,7]. As such, the ICSH Working Group recommended the
automated counting of RBC fragments as a useful routine
screening tool in the laboratory [3].
A study was performed at the Charlotte Maxeke Johannesburg
Academic Hospital (CMJAH) in order to evaluate the
ICSH recommendations for schistocyte identification and
enumeration in referred PBSs with schistocytes.
Materials and Methods
Study Design
A laboratory-based prospective study of the PBSs referred for
microscopy was performed at the National Health Laboratory
Service Hematology Laboratory at the CMJAH, South Africa,
from November 2015 to June 2016. One hundred and fortysix
PBSs with schistocytes were included. Aged samples
were excluded. Clinical information was obtained from the
laboratory information system, namely patient characteristics
and diagnoses and laboratory investigations including lactate
dehydrogenase (LDH) and full blood count (FBC).
Study Protocol
Laboratory Methods
Schistocytes were identified on PBSs stained according to the
May-Grünwald-Giemsa technique. Schistocytes were defined
and counted according to ICSH recommendations [3]. Blinded
review of the studied PBSs was independently performed by
two competent morphologists (ES and MHM). The schistocyte
percentage was estimated by counting 10,000 RBCs at 50 x
power magnification.
The microscopic schistocyte percentage was compared with
the automated FRC percentage measured by ADVIA 2120
hematology analyzers. The automated FRC percentage was
determined from measurement of light scatter at two different
angles. This corresponded to the refractive index and volume on
the platelet scatter plot, which allowed for distinction between
platelets and small RBCs. The threshold for the automated FRC
parameter was a volume of 1.4 above a threshold of 10,000 events/µL. The percentage of
schistocytes was determined from the number of RBCs measured
by the analyzer (reference interval for FRC parameter: between
0.2% and 0.3%) [5]. The FBC parameters were measured using
ADVIA 2120 hematology analyzers.
Statistical Analysis
Statistical analysis was performed using the intraclass
correlation coefficient (ICCC) as determined by the Bland and
Altman method. Statistical comparisons were performed using
the parametric paired t-test and nonparametric Wilcoxon
matched pairs test for continuous parameters depending upon
normality between the TMA and non-TMA groups. Statistical
significance was set at a p-value of 0.05 or less.
Ethics
This study was approved by the Human Research Ethics
Committee of the University of the Witwatersrand (M090688).
Results
The average age of the patients in the study was 26±21 years,
with a male-to-female ratio of 1:1.4. Patients were categorized
according to diagnosis. Schistocytes were observed in patients
with TMA (n=76), infection (n=20), hematologic malignancy
(n=10), mechanical heart valves (n=2), renal failure (n=10),
hemoglobinopathy (n=15), iron deficiency anemia (n=1), and
megaloblastic anemia (n=1) and in neonates (n=11) (Table
1). Patients with TMA had diagnoses such as thrombotic
thrombocytopenic purpura (TTP), hemolytic uremic syndrome
(HUS), disseminated intravascular coagulopathy (DIC), and
hemolysis with elevated liver enzymes and low platelets (HELLP).
60

Turk J Hematol 2017;34:59-63
Schapkaitz E and Mezgebe MH: Evaluation of Schistocyte Quantitation
The schistocyte counts were normally distributed in the TMA
and non-TMA groups with mean (±SD) values of 3.44±1.84%
and 1.11±0.83%, respectively (p

Schapkaitz E and Mezgebe MH: Evaluation of Schistocyte Quantitation
Turk J Hematol 2017;34:59-63
Table 2. Presentation laboratory investigations (n=146).
Presentation Laboratory Investigations Patients with TMA (n=76) Patients without TMA (n=70) p-value
Hemoglobin (g/L) 93.5±24.8 85.6±23.4 0.049*
Platelet count (x10 9 /L) 122±103 187±103 0.001*
Red cell distribution width (%) 22.34±4.29 19.83±3.21 0.0001*
Lactate dehydrogenase (IU/L) 368 (range: 201-2093) 292 (range: 164-980) 0.256
TMA: Thrombotic microangiopathy. Parametric tests are expressed as mean ± standard deviation, nonparametric tests are expressed as median (range). *: Statistically significant.
CMJAH is the second largest university hospital in Africa that offers
specialist medical and surgical treatment including hematology
and oncology. In this study, the ICSH recommendations for
schistocyte identification and enumeration in 146 referred PBSs
with schistocytes were evaluated.
In South Africa, there is a high incidence of TTP secondary to
human immunodeficiency virus [9]. If the diagnosis is delayed,
its clinical course can be rapidly fatal. According to the ICSH
recommendations, the presence of ≥1% schistocytes on a PBS
in the absence of other moderate RBC changes is a clinically
significant criterion for the diagnosis of a TMA [3]. In this study,
the mean schistocyte percentage in the TMA group (n=76) was
3.44±1.84%. This included 68 patients with a diagnosis of TTP.
Studies have demonstrated that PBSs with the diagnosis of TTP
present higher schistocyte counts when compared with other
TMAs [2].
Schistocytes of ≥1% were, however, also observed in other
nonfatal conditions. The mean schistocyte percentages of PBSs
with the diagnosis of renal failure (n=10) or hemoglobinopathy
(n=15) and in neonates (preterm, n=7; term, n=4) were
1.1±0.55%, 1.2±0.78%, and 1.55±0.8%, respectively. However,
in the majority of the aforementioned conditions, schistocytes
were observed in conjunction with additional moderate RBC
abnormalities. This is consistent with the findings of Huh et
al. [1]. Schistocytes in neonates are not pathological. A higher
percentage is usually found in preterm neonates owing to liver
immaturity. However, in this study, the term neonates presented
with concomitant conditions that resulted in a slightly higher
percentage than previously reported [1].
The diagnosis of TTP is based on clinical history, examination,
and PBS review. However, according to the revised diagnostic
criteria, the diagnosis of TTP should be considered in the presence
of thrombocytopenia and microangiopathic hemolytic anemia
alone [10]. In this study, the platelet count was significantly
lower in the TMA group (p

Turk J Hematol 2017;34:59-63
Schapkaitz E and Mezgebe MH: Evaluation of Schistocyte Quantitation
Japan) analyzers underestimated the schistocyte count after
a threshold of 1.5% [6,7,14]. However, conditions such as
hemoglobinopathies and renal failure represented a small
percentage of the study population. Other studies also reported
platelet interference in samples after platelet transfusions as
another cause for overestimation of the automated FRC [14].
The automated FRC percentage requires further evaluation as
a screening test.
Conclusion
In conclusion, this study confirms that observer bias can
be decreased by implementing the standardized procedures
recommended by the ICSH. However, estimation of schistocytes
by the ADVIA 2120 automated analyzer requires further
evaluation as a routine diagnostic tool. A higher threshold for
schistocytes in TTP should be considered in order to distinguish
this hematological emergency from other conditions associated
with ≥1% schistocytes.
Ethics
Ethics Committee Approval: Human Research Ethics Committee
of the University of the Witwatersrand (M090688).
Authorship Contributions
Concept: Elise Schapkaitz, Michael Halefom Mezgebe;
Design: Elise Schapkaitz, Michael Halefom Mezgebe; Data
Collection or Processing: Elise Schapkaitz, Michael Halefom
Mezgebe; Analysis or Interpretation: Elise Schapkaitz, Michael
Halefom Mezgebe; Literature Search: Elise Schapkaitz, Michael
Halefom Mezgebe; Writing: Elise Schapkaitz, Michael Halefom
Mezgebe.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Huh HJ, Chung JW, Chae SL. Microscopic schistocyte determination
according to International Council for Standardization in Hematology
recommendations in various diseases. Int J Lab Hematol 2013;35:542-547.
2. Lesesve JF, Salignac S, Lecompte T. Laboratory measurement of schistocytes.
Int J Lab Hematol 2007;29:149-151.
3. Zini G, d’Onofrio G, Briggs C, Erber W, Jou JM, Lee SH, McFadden S, Vives-
Corrons JL, Yutaka N, Lesesve JF; Internatiol Council for Standardization in
Haematology (ICSH). ICSH recommendations for identification, diagnostic
value, and quantitation of schistocytes. Int J Lab Hematol 2012;34:107-116.
4. Lesesve JF, El Adssi H, Watine J, Oosterhuis W, Regnier F. Evaluation of
ICSH schistocyte measurement guidelines in France. Int J Lab Hematol
2013;35:601-607.
5. Banno S, Ito Y, Tanaka C, Hori T, Fujimoto K, Suzuki T, Hashimoto T, Ueda
R, Mizokami M. Quantification of red blood cell fragmentation by the
automated hematology analyzer XE-2100 in patients with living donor liver
transplantation. Clin Lab Haematol 2005;27:292-296.
6. Lesesve JF, Salignac S, Alla F, Defente M, Benbih M, Bordigoni P, Lecompte T.
Comparative evaluation of schistocyte counting by an automated method
and by microscopic determination. Am J Clin Pathol 2004;121:739-745.
7. Saigo K, Jiang M, Tanaka C, Fujimoto K, Kobayashi A, Nozu K, Lijima K,
Ryo R, Sugimoto T, Imoto S, Kumagai S. Usefulness of automatic detection
of fragmented red cells using a hematology analyzer for diagnosis of
thrombotic microangiopathy. Clin Lab Haematol 2002;24:347-351.
8. Lesesve JF, Martin M, Banasiak C, Andre-Kerneis E, Bardet V, Lusina
D, Kharbach A, Genevieve F, Lecompte T. Schistocytes in disseminated
intravascular coagulation. Int J Lab Hematol 2014;36:439-443.
9. Opie J. Haematological complications of HIV infection. S Afr Med J
2012;102:465-468.
10. Moake JL. Thrombotic microangiopathies. N Engl J Med 2002;347:589-600.
11. Cohen JA, Brecher ME, Bandarenko N. Cellular source of serum lactate
dehydrogenase elevation in patients with thrombotic thrombocytopenic
purpura. J Clin Apher 1998;13:16-19.
12. Yoo JH, Lee J, Roh KH, Kim HO, Song JW, Choi JR, Kim YK, Lee KA. Rapid
identification of thrombocytopenia-associated multiple organ failure
using red blood cell parameters and a volume/hemoglobin concentration
cytogram. Yonsei Med J 2011;52:845-850.
13. Rümke CL. The statistically expected variability in differential counting. In:
Koepke JA, (ed). Differential Leukocyte Counting CAP Conference/Aspen,
1977. Skokie, College of American Pathologists, 1978.
14. Lesesve JF, Asnafi V, Braun F, Zini G. Fragmented red blood cells automated
measurement is a useful parameter to exclude schistocytes on the blood
film. Int J Lab Hematol 2012;34:566-576.
63

RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0049
Turk J Hematol 2017;34:64-71
Generation of Platelet Microparticles after Cryopreservation of
Apheresis Platelet Concentrates Contributes to Hemostatic Activity
Aferez Trombosit Konsantrelerinin Kriyoprezervasyonu Sonrası Ortaya Çıkan Trombosit
Kaynaklı Mikropartiküllerin Hemostatik Aktivite ile İlişkisi
İbrahim Eker 1 , Soner Yılmaz 2 , Rıza Aytaç Çetinkaya 3 , Aysel Pekel 4 , Aytekin Ünlü 5 , Orhan Gürsel 1 , Sebahattin Yılmaz 3 , Ferit Avcu 6 ,
Uğur Muşabak 4,* , Ahmet Pekoğlu 3 , Zerrin Ertaş 7 , Cengizhan Açıkel 8,* , Nazif Zeybek 5 , Ahmet Emin Kürekçi 1,* , İsmail Yaşar Avcı 9
1University of Health Sciences Gülhane Faculty of Medicine, Division of Pediatric Hematology, Ankara, Turkey
2University of Health Sciences Gülhane Faculty of Medicine, Blood Training Center and Blood Bank, Ankara, Turkey
3University of Health Sciences Gülhane Faculty of Medicine, Haydarpaşa Sultan Abdülhamid Training and Research Hospital, Department of
Infectious Disease, İstanbul, Turkey
4University of Health Sciences Gülhane Faculty of Medicine, Division of Immunology and Allergy, Ankara, Turkey
5University of Health Sciences Gülhane Faculty of Medicine, Department of General Surgery, Ankara, Turkey
6Memorial Hospital, Division of Hematology, Ankara, Turkey
7University of Health Sciences Gülhane Faculty of Medicine, Division of Hematology, Ankara, Turkey
8University of Health Sciences Gülhane Faculty of Medicine, Division of Biostatistics, Ankara, Turkey
9University of Health Sciences Gülhane Faculty of Medicine, Department of Infectious Disease and Clinical Microbiology, Ankara, Turkey
*Retired
Abstract
Objective: In the last decade, substantial evidence has accumulated
about the use of cryopreserved platelet concentrates, especially in
trauma. However, little reference has been made in these studies to the
morphological and functional changes of platelets. Recently platelets
have been shown to be activated by cryopreservation processes and to
undergo procoagulant membrane changes resulting in the generation
of platelet-derived microparticles (PMPs), platelet degranulation, and
release of platelet-derived growth factors (PDGFs). We assessed the
viabilities and the PMP and PDGF levels of cryopreserved platelets,
and their relation with thrombin generation.
Materials and Methods: Apheresis platelet concentrates (APCs) from
20 donors were stored for 1 day and cryopreserved with 6% dimethyl
sulfoxide. Cryopreserved APCs were kept at -80 °C for 1 day. Thawed
APCs (100 mL) were diluted with 20 mL of autologous plasma and
specimens were analyzed for viabilities and PMPs by flow cytometry,
for thrombin generation by calibrated automated thrombogram, and
for PDGFs by enzyme-linked immunosorbent assay testing.
Results: The mean PMP and PDGF levels in freeze-thawed APCs were
significantly higher (2763±399.4/µL vs. 319.9±80.5/µL, p

Turk J Hematol 2017;34:64-71
Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey
potential (ETP) of freeze-thawed APCs was significantly higher than
that of the fresh APCs (3406.1±430.4 nM.min vs. 2757.6±485.7
nM.min, p

Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey
Turk J Hematol 2017;34:64-71
packs of 100 mL each. Before freezing, APCs were preserved in
an automatic shaker (horizontal plane, at 20-24 °C) for 1 day.
Freezing Process of Apheresis Platelet Concentrates
Due to the fact that plasma-reconstituted cryopreserved
platelets are more procoagulant than those reconstituted in
PAS-G or 0.9% NaCl [3], all of the APCs were collected/stored
and diluted with autologous plasma rather than the additive
solution used for the cryopreservation procedure. The methods
used for freezing in our study were based on the previously
published methods of Valeri et al. [9]. Plasma collected by
apheresis from each donor (41 mL) and 9 mL of 27% DMSO were
mixed in an empty blood bag located on a rigid ice pack. The
resultant 50 mL mixture and 100 mL of APCs were collected in
a 750 mL ethyl vinyl acetate freezing bag through a sterile hose
combining device. The final DMSO concentration in the freezing
bag was 6% and the bag was centrifuged at 22 °C and 1250
g for 10 min (Thermo Fisher Scientific RC12BP, Asheville, NC,
USA). A platelet pellet of 20-25 mL was obtained after removal
of the supernatant and the bag was put in a cardboard freezing
box and stored at -80 °C [9].
Thawing of Frozen Apheresis Platelet Concentrates
Cryopreserved platelets were stored for 24 h at -80 °C and then
thawed by immersion in 37 °C water for 10 min. According
to Valeri et al. [9], 50 mL of plasma is to be added after the
thawing of 200-300 mL of cryopreserved APCs. However, in
the current study, the volume of the APCs that underwent
cryopreservation was 100 mL. Thus, we added 20 mL of freshly
thawed plasma. Prior to testing, the thawed platelets were kept
at room temperature for 30 min without agitation, as explained
by Valeri et al. [9].
In Vitro Measurements
All analyses were performed in the fresh state before freezing
and after diluting the APCs in the post-thaw period. The fresh
and frozen APCs were analyzed for the determination of platelet
counts with a whole blood analyzer device (ABX Pentra XL80,
HORIBA ABX SAS, Montpellier, France).
Thrombin Generation Testing
Thrombin generation tests (TGTs) were performed with a
calibrated automated thrombogram (CAT ® , Thrombinoscope BV,
Maastricht, the Netherlands) device that uses a slow-acting
fluorogenic substrate instead of a chromogenic substrate for
the latest TGTs. Thrombin generation closely correlates with
platelet concentration. Thus, prior to testing, the platelet counts
were normalized for the TGT. In TGTs, thrombin generation
occurs in the presence of both phospholipid and tissue factor,
which are present in either the platelet supernatant and/or the
reagents. The platelet-rich plasma reagent (Thrombinoscope BV,
the Netherlands) contains 1 pmol/L tissue factor and is used to
assess the presence of phospholipid in the sample. The thrombin
generation assays were performed 30 min after the thawing
process.
A sample of 80 µL was collected from both dilution groups. Each
sample was transferred to three different microtitrated plates
(Immulon 2HB, Thermo Electron Corporation, Milford, MA, USA)
that involved 20 µL of platelet-rich plasma reactant and 20 µL of
thrombin calibrator. After the incubation of the mixture at 37 °C
for 15 min, a sample of 20 µL was collected and added to 20 µL
of Fluo-Buffer ® solution, and the reaction was monitored with a
fluorometer. Using the Trombinoscope ® program, thrombogram
curves, endogenous thrombin potentials (ETPs), and peak heights
were measured. The area under the curve, which indicates the
total amount of endogenous thrombin generated, was recorded
as nmol/L x minute. The peak height, which indicates the highest
thrombin value measured, was shown as nmol/L [10].
Isolation and Quantitation of Microparticles
Flow cytometric analysis was used to quantify and characterize
PMPs, which were identified by their size and the use of
monoclonal antibodies (mAb) to determine the cellular
origin. Analysis of PMPs was performed by adding 20 µL of
CD41a fluorescein isothiocyanate (FITC; BD, USA) and CD62P
phycoerythrin (PE; BD, USA) antibodies and 50 µL of sample
to Trucount tubes (BD, USA). Tubes were incubated in the dark
at room temperature for 20 min. After incubation, samples
were suspended with 1 mL of phosphate buffered saline, which
contained 1% paraformaldehyde. All samples were analyzed
immediately with a FACSCanto II flow cytometer and FACSDiva
software (Becton Dickinson, USA). The platelet microparticles
express phosphatidylserine, which is detected by annexin V
labeling [3]. During the process with the Annexin V Apoptosis
Detection Kit (BioLegend, USA), 5 µL of annexin V and 10 µL
of 7-AAD solutions were added over 100 µL of sample and
incubated in the dark at room temperature for 15 min. Annexin
V binding buffer (400 µL) was added and analyzed by flow
cytometry.
Flow cytometric determination of PMPs was performed by using
1.0 µL beads (LB 8, Sigma, St. Louis, MO, USA). These beads were
used to mark microparticle gates in order to confirm the PMP
size. Forward scatter (FSC) and side scatter (SSC) were set to
logarithmic gain for sample assessment. For the calculation
of PMP absolute number, 20,000 event measurements were
performed in Trucount tubes. Annexin V-positive, CD41apositive,
and CD62P-negative microparticles were defined
as PMPs (Figure 1). The absolute number of PMPs per µL was
66

Turk J Hematol 2017;34:64-71
Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey
calculated from the appropriate dot-plot values entered into
the following formula [11]:
Number of events in the PMP region (P1) x Total number of
beads per tube
Number of beads collected (P2) x Test volume (µL)
Viability Evaluation Assays
Assays were performed with 7-AAD (actinomycin D analog),
which binds to DNA and was initially used in chromosome
analysis, cell cycle studies, and the quantification of apoptosis.
To date, 7-AAD staining followed by flow cytometry analysis
is one of the most widely established assays for viability
evaluation. 7-AAD has the ability to penetrate the cell
membrane and complex; the DNA of dead cells, however, cannot
be penetrated. Platelets do not contain a nucleus, but they are
rich in mitochondria [12]. Cell death and injury often lead to
release or exposure of intracellular molecules called damageassociated
molecular patterns (DAMPs) or cell death-associated
molecules. The mitochondrial DNA (mtDNA) can also function
as a DAMP [13]. The mtDNA is released from dying or dead cells,
with which 7-AAD has the ability to complex [14]. Cell viability
was assessed by an assay using FITC-conjugated annexin V and
7-AAD. Briefly, samples were suspended in 100 µL of annexin
binding buffer containing 5 µL of FITC-conjugated annexin V
(1:5 dilution) and 10 µL of 7-AAD (100 µg/mL) and incubated at
room temperature for 15 min. After the incubation period, 400
µL of annexin binding buffer was added. Samples were then
immediately analyzed with a FACSCanto II flow cytometer and
FACSDiva software (Becton Dickinson, USA) (Figure 2). In the
total cell population analyzed, cells unstained and stained with
7-AAD were reported as a percentage of live and dead cells,
respectively (Table 1).
Platelet-Derived Growth Factors
An enzyme-linked immunosorbent assay (ELISA) test was
performed to analyze PDGFs by using Human PDGF-BB ELISA
kits (RayBiotech, Norcross, GA, USA). Absorbance of the ELISA
plate was read and concentrations were assessed on an EL800x
microplate reader [15].
Figure 1. Isolation and quantitation of microparticles in freeze-thawed apheresis platelet concentrate samples. A) P1 is showing the gate
of annexin-bound microparticles, which are selected in comparison with 1.0 µm latex beads (P2). B) Q1 is showing CD62P (+) and CD41a
(-) platelet-derived microparticles, Q4 is showing CD62P (-) and CD41a (+) platelet-derived microparticles. C) Q4 is showing CD62P (-)
and CD41a (+) and annexin V (+) platelet-derived microparticles.
Table 1. Comparison of the test results of fresh and freeze-thawed apheresis platelet concentrates.
Apheresis Platelet Suspensions
Test Parameter Fresh (n=20) Freeze-Thawed (n=20) p-value
Thrombin
Generation Tests
Lag time (s) 9±2.2 7.5±6.3

Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey
Turk J Hematol 2017;34:64-71
Statistical Analysis
Data were analyzed using computer software (IBM SPSS
Statistics 22, licensed SPSS program of University of Health
Sciences Gülhane Faculty of Medicine). Descriptive statistics
were reported as frequencies and percentages for categorical
variables and as mean ± standard deviation (SD) for continuous
variables. As the one-sample Kolmogorov-Smirnov test showed
that the variables were normally distributed, parametric analyses
were performed. The Student t-test was used to compare
continuous variables between groups. The Pearson correlation
coefficient was calculated to evaluate the relationships between
variables. Statistical significance was set at 0.05.
fresh APCs. According to ELISA test results, the mean PDGF levels
of freeze-thawed APCs were statistically significantly higher
(550.96±73.6 pg/mL vs. 96.4±49 pg/mL, respectively; p

Turk J Hematol 2017;34:64-71
Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey
and earlier thrombin formation was occurring in the samples
analyzed despite the significant decrease in viability.
Discussion
In this study, platelets were cryopreserved in 6% DMSO at -80 °C
and reconstituted in plasma upon thawing. Results demonstrated
that cryopreserved platelets generate high numbers of annexin
V (phosphatidylserine)-expressing microparticles and PDGFs.
Furthermore, our results suggest that cryopreservation of
APCs increases their hemostatic activity via the PMP-related
formation of significantly earlier and higher thrombin, despite
the significant decrease in their viabilities.
It was demonstrated that phosphatidylserine-expressing PMPs
support normal coagulation through the assembly of the FXaand
thrombin-generating coagulation enzyme complexes [16].
It has also been suggested that PMPs are up to 100-fold more
procoagulant than platelets [17]. Our results, similar to those of
Johnson et al. [3], confirmed the contribution of PMPs to the
global coagulation potential of cryopreserved APCs.
TGTs have been used for identifying bleeding and
hypercoagulability disorders in patients [18]. Our results suggest
that cryopreserved platelets are hypercoagulable, as evidenced
by a reduced lag time and time to peak and an increased
thrombin generation potential (ETP) compared to the prefreeze
period. Moreover, there were statistically significantly
positive correlations between the ETPs and PMPs, as well as
statistically significantly negative correlations between PMP
levels and time to peak thrombin. Thus, our results showed that,
after cryopreservation, while levels of PMPs were increasing,
significantly higher and earlier thrombin formation was
occurring in the samples analyzed.
Besides the generation of PMPs, platelet activation via the
cryopreservation process also leads to the release of granule
contents within platelets. These granules are repositories
for PDGFs and many coagulation factors [3,8,19]. After the
freezing/thawing process, the levels of PDGFs in the APCs were
5.6-fold higher than those of the fresh APCs. Our results,
similar to those of Ronci et al., also provide a rationale
for using cryopreserved platelets in regenerative medicine
[20]. Ronci et al. studied the release kinetics of PDGFs in
homologous platelet-rich plasma, which was obtained from a
platelet-apheresis procedure, and used it for the treatment of
persistent ocular epithelial defects. To activate the platelets,
they only used a cycle of freezing/thawing, without using a fibrin
matrix as a support element or calcium chloride or thrombin
for platelet activation. Similar to the results of our study, the
levels of PDGF in the homologous platelet-rich plasma obtained
from the platelet-apheresis procedure were 6.3-fold higher
than the levels before the freezing/thawing process. All patients
improved clinically during the follow-up period and the authors
suggested that high levels of platelet counts were not required
to treat corneal lesions when platelet-rich plasma was activated
by a cycle of freezing/thawing.
While our study and that of Johnson et al. [3] suggest that
cryopreserved platelets may have greater hemostatic potential
than liquid-stored platelets, there are deleterious effects that
the processes of freezing and thawing have on platelet functions,
as demonstrated by in vitro tests. Frozen platelet adhesion is
significantly decreased when compared to both fresh platelets
and platelets stored for >5 days [21]. Recovery, survival, and other
in vitro function markers, such as stimulus-response coupling,
aggregation, granule release, and pH, are also impaired in frozen
platelets [22,23,24]. It has also recently been reported that
frozen and thawed platelets showed reduced surface expression
of GPIIb and GPIbα and diminished aggregation response
to agonists [25]. In a more recent study designed to evaluate
the in vitro hemostatic efficacy of frozen versus fresh platelet
transfusions by rotational thromboelastometry, a dual effect
in frozen platelet transfusion was found: a hypercoagulable
state (shortening of clotting time) and a more predominant
impairment of frozen platelet functions when compared to
fresh platelets (shorter maximum clot firmness/maximum clot
elasticity and longer clot formation time) [26].
Despite these conflicting results, cryopreserved platelets have
been used with great success in military operations since 2001,
with more than 1000 units transfused to at least 333 patients
[27]. Khuri et al. reported that the in vivo hemostatic functions
of cryopreserved platelets in cardiopulmonary bypass surgery
patients were superior to those of fresh liquid-preserved
platelets [28]. On the other hand, cryopreserved platelets have
also been transfused prophylactically [2,29], and although
increments in platelet counts were reported, it is not clear
whether the platelets were hemostatically active and safe.
The possible failure of traditional in vitro indicators to truly
represent the in vivo potential may be the cause of this
discrepancy between the results of in vivo and in vitro studies
on cryopreserved platelets. In 2013, Dumont et al.’s randomized
controlled study provided support for this hypothesis [30]. They
evaluated the recovery and survival of 6% dimethyl sulfoxidefrozen
autologous platelets in healthy volunteers. They showed
that there were no significant differences in functional,
morphologic, or in vivo 24-h recovery rates of cryopreserved
platelets derived from fresh or 2-day-old irradiated apheresis
platelets. They suggested that the accumulating literature
knowledge supports proceeding with additional studies to
evaluate the clinical effectiveness of cryopreserved platelets
69

Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey
Turk J Hematol 2017;34:64-71
[30]. In 2016, Cid et al. revealed that cryopreserved platelets
present a phenotype supporting a moderate increase in the rate
of clot formation, form stable platelet clots, and do not present a
hypercoagulable phenotype during in vitro functional tests [31].
Conclusion
Considering the damage caused by the freezing process and
scarce evidence for in vivo superiority, perhaps frozen platelets
should be recommended for austere environments such as
combat casualty care, reserving fresh platelets for daily use in
blood banks. Therefore, establishment of cryopreserved platelet
banks as a part of national contingency plans (natural disasters,
large-scale military conflicts, etc.) may be an appropriate
strategy. If the utilities of cryopreserved platelets are to be
expanded beyond the treatment of combat trauma, such as
prophylactic platelet transfusions or regenerative medicine,
prospective clinical studies are required to determine their
safety and efficacy in well-defined patient cohorts.
Ethics
Ethics Committee Approval: University of Health Sciences
Gülhane Faculty of Medicine Ethics Committee, Decision of
session dated in August 2013; Informed Consent: It was taken.
Authorship Contributions
Concept: İbrahim Eker, Soner Yılmaz; Design: Orhan Gürsel,
Ferit Avcu, Nazif Zeybek, Ahmet Emin Kürekçi, İsmail Yaşar Avcı;
Data Collection or Processing: Rıza Aytaç Çetinkaya, Cengizhan
Açıkel; Analysis or Interpretation: Aysel Pekel, Zerrin Ertaş,
Ahmet Pekoğlu; Literature Search: Sebahattin Yılmaz, Uğur
Muşabak; Writing: Aytekin Ünlü, İbrahim Eker, Soner Yılmaz.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: We are grateful to the Turkish Society of
Hematology for the full funding of this study.
References
1. Klein E, Toch R, Farber S, Freeman G, Fiorentino R. Hemostasis in
thrombocytopenic bleeding following infusion of stored, frozen platelets.
Blood 1956;11:693-698.
2. Schiffer CA, Aisner J, Wiernik PH. Clinical experience with transfusion of
cryopreserved platelets. Br J Haematol 1976;34:377-385.
3. Johnson L, Coorey CP, Marks DC. The hemostatic activity of cryopreserved
platelets is mediated by phosphatidylserine-expressing platelets and
platelet microparticles. Transfusion 2014;54:1917-1926.
4. Valeri CR, Srey R, Lane JP, Ragno G. Effect of WBC reduction and storage
temperature on PLTs frozen with 6 percent DMSO for as long as 3 years.
Transfusion 2003;43:1162-1167.
5. Valeri CR, Ragno G. Cryopreservation of human blood products. Transfus
Apher Sci 2006;34:271-287.
6. Neuhaus SJ, Wishaw K, Lelkens C. Australian experience with frozen blood
products on military operations. Med J Aust 2010;192:203-205.
7. Navarro Suay R, Tamburri Bariain R, Vírseda Chamorro I, Pérez Ferrer A.
Use of frozen platelets in massive limb trauma. Rev Esp Anestesiol Reanim
2015;62:233-234.
8. Klüter H, Bubel S, Kirchner H, Wilhelm D. Febrile and allergic transfusion
reactions after the transfusion of white cell-poor platelet preparations.
Transfusion 1999;39:1179-1184.
9. Valeri CR, Ragno G, Khuri S. Freezing human platelets with 6 percent
dimethyl sulfoxide with removal of the supernatant solution before
freezing and storage at -80 °C without postthaw processing. Transfusion
2005;45:1890-1898.
10. Dargaud Y, Wolberg AS, Luddington R, Regnault V, Spronk H, Baglin
T, Lecompte T, Ten Cate H, Negrier C. Evaluation of a standardized
protocol for thrombin generation measurement using the calibrated
automated thrombogram: an international multicenter study. Thromb Res
2012;130:929-934.
11. Raynel S, Padula MP, Marks DC, Johnson L. Cryopreservation alters the
membrane and cytoskeletal protein profile of platelet microparticles.
Transfusion 2015;55:2422-2432.
12. Collins ML, Eng S, Hoh R, Hellerstein MK. Measurement of mitochondrial
DNA synthesis in vivo using a stable isotope-mass spectrometric technique.
J Appl Physiol 2003;94:2203-2211.
13. Krysko DV, Agostinis P, Krysko O, Garg AD, Bachert C, Lambrecht BN,
Vandenabeele P. Emerging role of damage-associated molecular patterns
derived from mitochondria in inflammation. Trends Immunol 2011;32:157-
164.
14. Lecoeur H, de Oliveira-Pinto LM, Gougeon ML. Multiparametric flow
cytometric analysis of biochemical and functional events associated with
apoptosis and oncosis using the 7-aminoactinomycin D assay. J Immunol
Methods 2002;265:81-96.
15. Kaetzel DM Jr, Morgan D 3rd, Reid JD 4th, Fenstermaker RA. Site-directed
mutagenesis of the N-linked glycosylation site in platelet-derived growth
factor B-chain results in diminished intracellular retention. Biochim Biophys
Acta 1996;1298:250-260.
16. Keuren JF, Magdeleyns EJ, Govers-Riemslag JW, Lindhout T, Curvers J.
Effects of storage-induced platelet microparticles on the initiation and
propagation phase of blood coagulation. Br J Haematol 2006;134:307-313.
17. Sinauridze EI, Kireev DA, Popenko NY, Pichugin AV, Panteleev MA, Krymskaya
OV, Ataullakhanov FI. Platelet microparticle membranes have 50- to 100-
fold higher specific procoagulant activity than activated platelets. Thromb
Haemost 2007;97:425-434.
18. Al Dieri R, De Laat B, Hemker HC. Thrombin generation: what have we
learned? Blood Rev 2012;26:197-203.
19. Blair P, Flaumenhaft R. Platelet alpha-granules: basic biology and clinical
correlates. Blood Rev 2009;23:177-189.
20. Ronci C, Ferraro AS, Lanti A, Missiroli F, Sinopoli S, Del Proposto G, Cipriani
C, De Felici C, Ricci F, Ciotti M, Cudillo L, Arcese W, Adorno G. Platelet-rich
plasma as treatment for persistent ocular epithelial defects. Transfus Apher
Sci 2015;52:300-304.
21. Owens M, Cimino C, Donnelly J. Cryopreserved platelets have decreased
adhesive capacity. Transfusion 1991;31:160-163.
22. Valeri CR. The current state of platelet and granulocyte cryopreservation.
Crit Rev Clin Lab Sci 1981;14:21-74.
23. Dullemond-Westland AC, Van Prooijen HC, Riemens MI, Akkerman JW.
Cryopreservation disturbs stimulus-response coupling in a platelet
subpopulation. Br J Haematol 1987;67:325-333.
24. Spector JI, Skrabut EM, Valeri CR. Oxygen consumption, platelet aggregation
and release reactions in platelets freeze-preserved with dimethylsulfoxide.
Transfusion 1977;17:99-109.
70

Turk J Hematol 2017;34:64-71
Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey
25. Johnson LN, Winter KM, Reid S, Hartkopf-Theis T, Marks DC. Cryopreservation
of buffy-coat-derived platelet concentrates in dimethyl sulfoxide and
platelet additive solution. Cryobiology 2011;62:100-106.
26. Pérez-Ferrer A, Navarro-Suay R, Viejo-Llorente A, Alcaide-Martín MJ, de
Vicente-Sánchez J, Butta N, de Prádena Y Lobón JM, Povo-Castilla J. In
vitro thromboelastometric evaluation of the efficacy of frozen platelet
transfusion. Thromb Res 2015;136:348-353.
27. Noorman F, Badloe J. -80°C frozen platelets, efficient logistics: available,
compatible, safe and effective in the treatment of trauma patients
with or without massive blood loss in military theatre. Transfusion
2012;52(Suppl):33A.
28. Khuri S, Healey N, MacGregor H, Barnard MR, Szymanski IO, Birjiniuk
V, Michelson AD, Gagnon DR, Valeri CR. Comparison of the effects of
transfusions of cryopreserved and liquid preserved platelets on hemostasis
and blood loss after cardiopulmonary bypass. J Thorac Cardiovasc Surg
1999;117:172-183.
29. Rumjantseva V, Hoffmeister KM. Novel and unexpected clearance
mechanisms for cold platelets. Transfus Apher Sci 2010;42:63-70.
30. Dumont LJ, Cancelas JA, Dumont DF, Siegel AH, Szczepiorkowski ZM, Rugg
N, Pratt PG, Worsham DN, Hartman EL, Dunn SK, O’Leary M, Ransom JH,
Michael RA, Macdonald VW. A randomized controlled trial evaluating
recovery and survival of 6% dimethyl sulfoxide-frozen autologous platelets
in healthy volunteers. Transfusion 2013;53:128-137.
31. Cid J, Escolar G, Galan A, López-Vilchez I, Molina P, Díaz-Ricart M, Lozano
M, Dumont LJ. In vitro evaluation of the hemostatic effectiveness of
cryopreserved platelets. Transfusion 2016;56:580-586.
71

RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0086
Turk J Hematol 2017;34:72-80
Rituximab Therapy in Adults with Refractory Symptomatic
Immune Thrombocytopenia: Long-Term Follow-Up of 15 Cases
Refrakter Semptomatik İmmün Trombositopeni Tanılı Erişkinlerde Rituksimab Tedavisi:
15 Olgunun Uzun Süreli İzlemi
Fehmi Hindilerden 1 , İpek Yönal-Hindilerden 2 , Mustafa Nuri Yenerel², Meliha Nalçacı², Reyhan Diz-Küçükkaya 3
1Bakırköy Sadi Konuk Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey
2İstanbul University İstanbul Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey
3İstanbul Bilim University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey
Abstract
Objective: This paper prospectively evaluates the long-term followup
[mean ± standard deviation (SD) duration: 89.7±19.4 months] data
of 15 patients (13 females and 2 males) with refractory symptomatic
immune thrombocytopenia (ITP) treated with rituximab.
Materials and Methods: Rituximab was administered at 375 mg/m2
weekly for a total of 4 doses. Complete response (CR) was defined as a
platelet count of ≥100,000/mm 3 and partial response (PR) as a platelet
count of ≥30,000/mm 3 but less than 100,000/mm 3 . Early response (ER)
and late response (LR) were defined as response within 42 days and
after 42 days of initiation of rituximab therapy, respectively. Sustained
response (SR) was defined as response lasting for at least 6 months.
Results: Mean age (±SD) at the start of rituximab was 46.6±11.3
years. Mean platelet count (±SD) prior to rituximab treatment was
17,400±8878/mm 3 . The mean time (±SD) between rituximab therapy
and response to rituximab in early responders and late responders was
1.8±1.3 weeks and 10±2.8 weeks, respectively. Mean durations (±SD)
of ER and LR were 51±47.2 months and 6±4.2 months, respectively.
Seven of the 15 patients (46.7%) showed an initial response to
rituximab (5 ER and 2 LR). The rate of SR over 6 months was 26.7%
(4/15). Among the responders to rituximab, 3 (3/7, 42.9%) maintained
their response 1 year after rituximab treatment and 2 (2/7, 28.6%)
had ongoing response 5 years after initiation of rituximab. Two of the
7 patients (28.6%) still maintained their response 98 months after
initiation of rituximab. All 5 initial responders with subsequent relapse
achieved response from subsequent treatment modalities (3 CR, 2 PR).
Conclusion: Our data confirm, over a long period of observation, that
rituximab is safe and effective in the management of patients with
chronic refractory primary ITP.
Keywords: Immune thrombocytopenia, Rituximab, Early response,
Late response, Sustained response
Öz
Amaç: Çalışmamızda rituksimab ile tedavi edilen refrakter
semptomatik immün trombositopeni (İTP) tanılı 15 olgunun (13 kadın
ve 2 erkek) uzun süreli izlemi sonucundaki [ortalama ± SD (standart
deviasyon) süresi: 89,7±19,4 ay] verileri incelenmiştir.
Gereç ve Yöntemler: Rituksimab haftada bir 375 mg/m2 dozunda
toplam 4 doz uygulanmıştır. Tam yanıt (TY) trombosit sayısının
≥100,000/mm 3 olması ve parsiyel yanıt (PY) trombosit sayısının
≥30,000/mm 3 olması fakat 100,000/mm 3 ’ün altında olması olarak
tanımlanmıştır. Erken yanıt (EY) ve geç yanıt (GY) ise sırasıyla
rituksimab başlangıcından 42 gün içinde ve 42 gün sonra yanıt elde
edilmesi olarak tanımlanmıştır. Sürekli yanıt (SY), yanıtın en az 6 ay
sürmesi olarak tanımlanmıştır.
Bulgular: Rituksimab tedavisinin başladığı sırada ortalama yaş (±SD)
46,6±11,3 yıldır. Rituksimab tedavisi öncesinde ortalama trombosit
sayısı (±SD) 17,400±8878/mm 3 ’dür. Erken ve geç yanıt edilen
olgularda rituksimab başlangıcı ile yanıta kadar geçen ortalama süre
(±SD) sırasıyla 1,8±1,3 hafta ve 10±2,8 hafta olarak saptanmıştır. EY
ve GY elde edilen olgularda ortalama yanıt süresi sırasıyla 51±47,2 ay
ve 6±4,2 aydır. On beş olgunun 7’sinde (%46,7) rituximab tedavisine
başlangıçta yanıt elde edilmiştir (5 EY, 2 GY). SY oranı %26,7’dir (4/15).
Rituksimab tedavisine yanıt veren olgular arasında 3’ü (3/7, %42,9)
yanıtını bir yıldan fazla ve 2’si (2/7, %28,6) yanıtını 5 yıldan fazla
sürdürmüştür. Yedi olgunun ikisi (%28,6) rituksimab başlangıcından
98 ay sonra halen yanıtını korumaktadır. Başlangıçta yanıt veren 5
olgunun hepsi relaps sonrasında ardışık tedavilere yanıt vermiştir (3
TY, 2 PY).
Sonuç: Çalışmamız uzun bir gözlem sonucunda kronik refrakter primer
İTP olgusunda rituksimab tedavisinin güvenilir ve etkili olduğunu
desteklemektedir.
Anahtar Sözcükler: İmmün trombositopeni, Rituksimab, Erken yanıt,
Geç yanıt, Sürekli yanıt
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Fehmi HİNDİLERDEN, M.D.,
Bakırköy Sadi Konuk Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey
Phone : +90 212 414 71 71
E-mail : drfehmi_hindi@yahoo.com
Received/Geliş tarihi: March 01, 2016
Accepted/Kabul tarihi: March 28, 2016
72

Turk J Hematol 2017;34:72-80
Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia
Introduction
Immune thrombocytopenia (ITP) is an autoantibody-mediated
disorder characterized by a plateletcount of less than 100,000/
mm 3 and increased risk of bleeding [1]. B cells play an important
role in the pathophysiology of ITP, making B-cell depletion with
rituximab a rational therapeutic option [2].
Glucocorticosteroids still remain the standard initial therapy
for patients with symptomatic disease. Second-line treatment
options include splenectomy, azathioprine, cyclosporine A,
cyclophosphamide, danazol, mycophenolate mofetil, rituximab,
and thrombopoietin-receptor (TPO-receptor) agonists [3]. In
approximately 80% of patients, splenectomy results in response
maintained at 10 years in 70% of patients, but it is associated
with a life long infection risk in 1%-3% of patients [4]. Chronic
refractory ITP has been defined as failure to respond to splenectomy
[5]. There is no standard of care for patients with refractory or
relapsing ITP after splenectomy. Although spontaneous remissions
may occur in some cases, these patients carry a significant risk of
bleeding and have increased morbidity and mortality [5]. Further
treatment is considered in chronic refractory ITP patients with
low platelet counts and bleeding symptoms [5].
Over the last decades, rituximab has been widely used to treat
primary ITP patients resistant to one or more treatment lines
[6,7,8,9,10,11,12,13,14,15]. Rituximab is still used off-label as
a second- or third-line option in many countries. Only a few
systematic reviews on the efficacy of rituximab for adult ITP
patients have been published [6,16]. In the meta-analysis by
Arnold et al., overall response (OR) and complete response (CR)
rates with rituximab were 62.5% and 46.2%, respectively, with a
median response duration of 10.5 months and a median followup
of 9.5 months [6]. In a recent systematic review and metaanalysis
including non-splenectomized ITP patients treated
with rituximab, a CR rate of 46.8% was reported after a median
follow-up of 6 months [16]. Khellaf et al. conducted a prospective
multicenter registry of adult patients with ITP who were refractory
to corticosteroids (97%), IVIG (71%), and splenectomy (10%) and
were treated with rituximab [17]. After a median follow-up of
24 months, 61% showed an overall initial response and 39% had
sustained response (SR) [17]. Data on the long-term efficacy of
rituximab in adult ITP are limited [13,18,19,20,21]. Several studies
reported SR rates ranging from 21% to 40% after a median
follow-up period ranging from 2 to 5 years [13,18,19,20,21]. Here
we prospectively assess the overall initial response and SR rates to
rituximab in 15 chronic refractory symptomatic ITP patients with
a follow-up duration of 7 years.
Materials and Methods
We prospectively evaluated 15 patients (13 females and 2
males) diagnosed with chronic refractory ITP, all of whom
had been treated with corticosteroids and splenectomy and
received various immunosuppressive agents. Rituximab was
offered to the sepatients as an off-label treatment following
the approval of the Ministry of Health. Informed consent for
study participation was obtained from all patients. Rituximab
was administered intravenously at 375 mg/m 2 once weekly for
4 weeks between November 2007 and March 2008. Selective
spleen scintigraphy was performed to rule out accessory
spleens. Baseline platelet count spriortoinitial administration
of rituximab and before each weekly infusion were recorded.
During the follow-upperiod, platelet counts were obtained at
the 1 st , 3 rd , 6 th , 12 th , 18 th , 24 th , 32 nd , 40 th , 48 th , 56 th , 64 th , 72 nd , 80 th ,
88 th , and 96 th months of rituximab therapy. CR was defined as
any platelet count of at least 100,000/mm 3 and the absence of
bleeding, partial response (PR) as any platelet count between
30,000 and 100,000/mm 3 and absence of bleeding, and no
response (NR) as any platelet count lower than 30,000/mm 3 or
the presence of bleeding [1]. Early response (ER) was defined
as a response within 42 days of rituximab infusion and late
response (LR) was defined as response occurring 42 days after
initiation of rituximab. OR to rituximab was the summation of
ER and LR. SR was defined as response lasting for a minimum
of 6 months [11,22]. Loss of response was defined as losing
response to rituximab with any platelet count lower than
30,000/mm 3 or the presence of bleeding and need for other
therapy during follow-up. Time to response was defined as time
from commencement of treatment to either CR or PR. Duration
of response was defined as time from CR or PR until loss of CR
or PR.
Statistical Analysis
Data were processed using SPSS 21 (University of Sussex).
Characteristics of patients were described with mean ± standard
deviation. Comparisons between groups were performed by chisquare
test and Fisher’s exact test. The analysis of continuous
variables among the groups was performed using the Mann-
Whitney U test. Odds ratios are accompanied by Cornfield
95% confidence interval limits (CIs). A curve showing the
proportion of patients with continuing response to rituximab
was constructed by the Kaplan-Meier method. A general linear
model for repeated measures was used to compare platelet
values after the initiation of rituximab in responders vs. nonresponders.
Probability values of p

Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia Turk J Hematol 2017;34:72-80
Table 1. Characteristics of the patients.
Characteristics
Number of patients 15
Sex
Female
Male
Mean ± SD
13 (86.7%)
2 (13.3%)
Age at diagnosis (years) 29.6±15.8
Age at the time of splenectomy (years) 31.7±16
Age at rituximab infusion (years) 46.6±11.3
Actual age (years) 54±11.6
Number of previous therapies 3.6±1.04
Previous therapies, n (%)
Steroids
Splenectomy
Azathioprine
Vincristine
IVIG
Other therapies
Accompanying diseases, n (%)
Diabetes mellitus
Hypertension
Response to initial corticosteroid treatment, n (%)
NR
R
15 (100%)
15 (100%)
11 (73.3%)
5 (33.3%)
2 (13.3%)
5 (33.3%)
3 (20%)
3 (20%)
7 (46.7%)
8 (53.3%)
Presence of accessory spleen before rituximab, n (%) 5 (33.3%)
Initial response to rituximab therapy, n (%)
NR
ER
LR
8 (53.3%)
5 (33.3%)
2 (13.3%)
Loss of response to rituximab, n (%) 5/7 (71.4%)
SR to rituximab therapy, n (%) 4 (26.7%)
Disease status at final observation, n (%)
CR
PR
NR
Deceased
5 (33.3%)
6 (40%)
2 (13.3%)
2 (13.3%)
Platelet count at diagnosis (/mm 3 ) 10100±4251
Hemoglobin level at diagnosis (g/dL) 11.2±1.01
WBC count at diagnosis (/mm 3 ) 8513±2146
Platelet count before rituximab treatment (/mm 3 ) 17,400±8878
Platelet count at 1 st month after the initial dose of rituximab (/mm 3 ) 68,733±95,213
Time from diagnosis to splenectomy (months) 24.6±19.3
Time from splenectomy to rituximab therapy (months) 179±103.8
Time from diagnosis to rituximab therapy (months) 204±106.2
Time to response to rituximab of early responders (weeks) 1.8±1.3
Time to response to rituximab of late responders (weeks) 10±2.8
Duration of ER (months) 51±47.2
Duration of LR (months) 6±4.2
Duration of OR (ER+LR) (months) 38.1±44.4
Follow-up period after rituximab treatment (months) 89.7±19.4
Death 2 (13.3%)
NR: No response, R: response, ER: early response, LR: late response, SR: sustained response, CR: complete response, PR: partial response, OR: overall response, SD: standard deviation.
74

Turk J Hematol 2017;34:72-80
Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia
Table 2. List of responders to rituximab therapy (n=7).
Early responders to rituximab therapy (n=5)
Number Sex Actual
age
Previous therapies
1 F 37 Steroids,
splenectomy
2 F 56 Steroids,
splenectomy, IVIG
TTR
(weeks)
Relapse
DOR
(months)
FU period
after first
R therapy
(months)
Treatment after R
therapy
4 Yes 52 98 Steroids, IVIG CR
1 No 98 98 No CR
ITP final
status
3 F 56 Steroids,
splenectomy
4 F 42 Steroids,
splenectomy,
azathioprine,
vincristine, danazol
5 F 58 Steroids,
splenectomy,
azathioprine,
vincristine
Late responders to rituximab therapy (n=2)
Number Sex Actual
age
Previous therapies
1 F 48 Steroids,
splenectomy,
azathioprine,
vincristine,
danazol
1 No 98 98 No CR
2 Yes 2 98 Steroids, azathioprine,
vincristine,
eltrombopag
1 Yes 5 96 Steroids CR
TTR
(weeks)
Relapse
DOR
(months)
FU period
after
first R
therapy
(months)
Treatment
after R therapy
8 Yes 3 96 Steroids, danazol CR
PR
ITP final
status
2 M 60 Steroids,
splenectomy,
azathioprine
12 Yes 9 96 Eltrombopag PR
TTR: Time to response, DOR: duration of response, FU: follow-up, R: rituximab, CR: complete response, PR: partial response, ITP: immune thrombocytopenia.
was 3.6±1.04. The mean duration of follow-up after rituximab
was 89.7±19.4 months. Seven of the patients (46.7%) showed
an initial response (5 ER and 2 LR). The cumulative response rate
was 46.7%. Four of the 15 patients (26.7%) achieved SR with
a duration of more than 6 months. Patients with SR included
3 early responders and 1 late responder. During follow-up, 2
of the patients who obtained SR lost their response 9 months
and 52 months after the initiation of rituximab, respectively.
Durations of ER and LR were 51±47.2 months and 6±4.2 months,
respectively. The duration of OR (ER+LR) was 38.1±44.4 months.
One patient succumbed to intracranial hemorrhage and another
to myocardial infarction. Patient characteristics of early and late
responders are summarized in Table 2.
Comparison of Immune Thrombocytopenia Patients According to
Their Response Status to Rituximab Therapy
Clinical and laboratory features of ITP patients stratified by
response status to rituximab are outlined in Table 3. The presence
of comorbid diseases was more frequent in non-responders
compared to responders, but the difference was not statistically
significant (62.5% and 14.3%, respectively, p=0.117).
The presence of response did not correlate with actual age, age
at diagnosis, age at time of splenectomy, age at initiation of
rituximab, sex, hemoglobin level and platelet count at diagnosis,
initial response to corticosteroids, number of previous therapies,
interval between diagnosis and initiation of rituximab, and time
between splenectomy and rituximab therapy (r

Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia Turk J Hematol 2017;34:72-80
Table 3. Comparison of characteristic features of immune thrombocytopenia patients stratified by response status to rituximab
therapy.
Chronic refractory ITP patients
Patients with OR, n=7
(Mean ± SD)
Patients with NR, n=8
(Mean ± SD)
Age, at diagnosis, years 26.1±13.9 32.7±17.7 0.602
Actual age, years 51±8.8 56.7±13.6 0.685
Age at the time of splenectomy, years 28.7±13.5 34.3±18.4 0.817
Age at rituximab infusion, years 44.2±8.4 48.7±13.7 0.772
Female, n (%) 6 (85.7%) 7 (87.5%) 1
Hemoglobin at diagnosis, g/dL 11.4±0.9 11±1 0.363
WBC count at diagnosis, /mm 3 9514±2150 7637±1837 0.083
Platelet count at diagnosis, /mm 3 10,428±4613 9812±4208 0.861
Number of previous therapies 3.4±1.2 3.8±0.83 0.435
Time from diagnosis to splenectomy, months 30±22.5 19.8±16.1 0.293
Time from diagnosis to rituximab therapy, months 217±140 192±73.6 0.728
Time from splenectomy to rituximab therapy, months 187.8±130 171.2±82.8 0.728
Presence of accessory spleen before rituximab, n (%) 2 (28.6%) 3 (37.5%) 1
Response to initial corticosteroids, n (%)
R (n, %)
NR (n, %)
Accompanying diseases, n (%)
Hypertension (n, %)
Diabetes mellitus (n, %)
7 (100%)
3 (42.9%)
4 (57.1%)
1 (14.3%)
0
1 (14.3%)
8 (100%)
5 (62.5%)
3 (37.5%)
5 (62.5%)
3 (37.5%)
2 (25%)
Follow-up period after rituximab treatment, m 97.1±30.1 83.2±25.4 0.282
Death, n (%) 0 2 (25%) 0.467
ITP: Immune thrombocytopenia, WBC: white blood cell, OR: overall response, NR: no response, R: response.
p
0.619
-
-
0.117
-
-
Status of Patients at the Final Observation
Figure 1. Proportion of patients with ongoing response during
long-term follow-up. Two of the 7 patients (28.6%) still
maintained their response 98 months after initiation of rituximab.
52 months (Figure 1). Figure 2 demonstrates the mean platelet
counts in the whole population after initiation of rituximab.
The mean platelet counts showed a trend to be higher in initial
rituximab responders (n=7) compared to non-responders (n=8)
(112,201±29,008/mm 3 vs. 33,750±31,332/mm 3 , p=0.060, odds
ratio: 7.8; 95% CI 35,212-176,049) (Figure 3).
Seven of the 15 patients (46.7%) showed an initial response (5
ER and 2 LR). However, 3 of the 5 early responders (20%) and
all of the late responders lost their response, leaving 2 patients
with long-lasting remissions with a mean follow-up of 89.7±19.4
months. Relapsed patients and patients with NR subsequently
received various types of treatment, including steroids (n=12),
eltrombopag (n=4), azathioprine (n=2), vincristine (n=1), danazol
(n=1), IVIG (n=1), and accessory spleen operation (n=1). All of the
initial 7 responders to rituximab achieved long-term remission
even after relapse (5 CR, 2 PR), irrespective of subsequent
treatment modalities (4: steroids, 2: eltrombopag, 1: azathioprine,
1: vincristine, 1: danazol, 1: IVIG) (Figure 4). In contrast, of the
8 non-responders, 2 patients still showed NR and 2 died (1 of
intracranial hemorrhage and 1 of myocardial infarction). In total,
11 of the 15 patients (73.3%) achieved CR or PR during long-term
observation with a mean follow-up time of 89.7±19.4 months.
Discussion
The algorithm for managing adult ITP has changed with the
advent of rituximab and TPO-receptor agonists as options
76

Turk J Hematol 2017;34:72-80
Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia
Table 4. Review of the published data and our results in adults with immune thrombocytopenia treated with rituximab.
Ref. Number
of
patients
ITP duration before
rituximab
Previous
therapies
Splenectomizedpatients Overall response Sustained response Duration of
response
Follow-up
duration
Stasi et al.
[11]
Cooper et al.
[7]
Peñalver et
al. [24]
Braendstrup
et al. [12]
25 Median: 22 months
(9-56)
57 Median: 34 months
(3-360)
89 Median: 31 months
(1-305)
35 Median: 49 months
(1-288)
2-5 different
regimens
Median: 3
(2-8)
8 (32%) 13 (52%) 7 (28%)
for more than 6
months
31 (54%) 31 (54%) 17 (29.8%) for more
than 1 year
Median: 5 (2-13) 47 (53%) 49 (55.1%) 12 (13.4%) for more
than 1 year
Several different
treatments
16 (45.7%) 17/39 treatments (40%) 5/39 treatments
(12.8%) for more
than 1 year
- -
Median: 72.5 weeks
(24-165)
- Median: 9
months (2-42)
Median: 47 weeks -
-
Santoro et al.
[13]
Zaja et al.
[25]
Aleem et al.
[26]
Zaja et al.
[27]
Pasa et al.
[28]
19 Median: 2.1 years
(0.33-33.1)
Median: 3
(2-6)
20 - At least one
treatment
24 - Median: 3
(1-8)
37 Median: 34.5 months
(1-264)
At least a full
course of steroid
therapy
17 - Median: 5
(3-11)
Present study 15 Mean±SD:
204±106.2 months
Mean±SD:
3.6±1.04
2 (10.5%) 9 (47.4%) 6 (31.6%)
at last follow-up
2 (10%) 13 (65%) 9 (45%) at last
follow-up
11 (45.8%) 19/29 treatments (66%) 10 (24%)
for more than 6
months
5 (13.5%) 27 (73%) 15 (40.5%) at last
follow-up
17 (100%) 14 (82.3%) 10 (58.8%) for more
than 6 months
15 (100%) 7 (46.7%) 4 (26.7%)
for more than 6
months
- Median: 53.2
months (9.2-
92.9)
- Median: 180
days (60-480)
Median:
13 weeks
(1 week to 55
months)
- Median: 25
months
(3-55) in
responding
patients
Median:
19 months (9-41)
Mean±SD:
38.1±44.4 months
-
-
Mean±SD:
89.7±19.4
months
77

Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia Turk J Hematol 2017;34:72-80
Figure 2. Mean platelet counts in the whole study group after
initiation of rituximab. Relapsed patients and non-responders were
treated with various other therapies. Mean platelet counts at times of
first, second, third, and fourth doses of rituximab and 1 st , 3 rd , 6 th , 12 th ,
18 th , 24 th , 32 no , 40 th , 48 th , 56 th , 64 th , 72 nd , 80 th , 88 th , and 96 th months
of rituximab (±SD) were 17,400±8878/mm 3 , 70,666±122,495/mm 3 ,
42,266±53,518/mm 3 , 53,533±79,974/mm 3 , 68,733±95,213/mm 3 ,
54,333±81,260/mm 3 , 50,400±85,816/mm 3 , 50,266±79,408/mm 3 ,
62,666±110,205/mm 3 , 59,880±116,443/mm 3 , 62,920±103,727/mm 3 ,
76,746±101,374/mm3 3 , 94,707±103,763/mm 3 , 118,607±128,846/
mm 3 , 108,315±119,597/mm 3 , 83,384±107,987/mm 3 , 95,230±104,396/
mm 3 , 97,846±98,858/mm 3 , and 99,153±99,049/mm 3 , respectively.
for second-line treatment. The lack of studies comparing
splenectomy to other second-line therapy options presents an
important dilemma. Rituximab may be a curative therapy with
an initial response in 50%-60% of ITP patients and a SR of 3-5
years in 20% of patients [23]. The primary aim of our study was
to evaluate the long-term efficacy of rituximab treatment in 15
patients with chronic refractory ITP. The patients described in
this study had persistent, severe ITP and had received a mean of
3.6±1.04 previous therapies.
Table 4 summarizes our results as well the results of previous
studies describing adult ITP patients treated with rituximab.
Seven of our 15 patients achieved an initial response to rituximab
(46.7%) (5 ER and 2 LR). Various studies have used different
criteria to define response to ITP treatment. Our results are
comparable with those of several studies that reported response
rates between 40% and 55.1% [7,11,12,13,24]. However, our
results are less favorable compared to several other reports
[6,25,26,27,28]. In the systematic review by Arnold et al., the
overall platelet count response to rituximab was 62.5% in adult
ITP patients [6]. Zaja et al. in 2 different studies reported an
initial response rate of 65% (13/20 patients) and 73% (27/37
patients), respectively [25,27]. The latter study hypothesized
that earlier administration of rituximab enables higher rates of
long-lasting response in adult ITP [27]. Moreover, our results are
inferior to those of other studies reporting an OR of 66% and
82.3%, respectively [26,28].
Figure 3. Comparison of mean platelet counts in responders
and non-responders following rituximab therapy. There was
a trend towards higher mean platelet counts (±SD) in initial
rituximab responders (n=7) compared to non-responders (n=8)
(112,201±29,008/mm 3 vs. 33,750±31,332/mm 3 , p=0.06, odds
ratio: 7.8; 95% CI 35,212-176,049). In rituximab responders mean
platelet counts at times of first, second, third, and fourth doses
of rituximab and 1 st , 3 rd , 6 th , 12 th , 18 th , 24 th , 32 nd , 40 th , 48 th , 56 th ,
64 th , 72 nd , 80 th , 88 th ,and 96 th months of rituximab (±SD) were
20,000±2905/mm 3 , 110,000±47,594/mm 3 , 73,000±18,886/mm 3 ,
98,000±28,684/mm 3 , 132,714±30,811/mm 3 , 90,000±31,195/mm 3 ,
83,857±33,795/mm 3 , 82,428±31,051/mm3, 115,428±41,586/mm 3 ,
98,028±46,959/mm 3 , 111,571±39,294/mm 3 , 127,342±37,568/
mm 3 , 142,657±35,001/mm 3 , 137,228±50,189/mm 3 ,
150,571±43,329/mm 3 , 125,571±38,298/mm 3 , 145,142±34,753/
mm 3 , 142,428±33,638/mm 3 , and 145,857±33,156/mm 3 ,
respectively. In non-responders mean platelet counts at times
of first, second, third, and fourth doses of rituximab and 1 st ,
3 rd , 6 th , 12 th , 18 th , 24 th , 32 nd , 40 th , 48 th , 56 th , 64 th , 72 nd , 80 th , 88 th ,
and 96 th months of rituximab (±SD) were 15,000±3138/mm 3 ,
22,500±51,407/mm 3 , 18,166±20,399/mm 3 , 17,666±30,983/mm 3 ,
13,666±33,279/mm 3 , 28,833±33,695/mm 3 , 23,666±36,502/mm 3 ,
26,500±33,539/mm 3 , 20,166±44,918/mm 3 , 32,500±50,722/mm 3 ,
25,633±42,442/mm 3 , 40,633±40,578/mm 3 , 38,766±37,805/mm 3 ,
96,883±54,210/mm 3 , 59,016±46,800/mm 3 , 34,166±41,367/mm 3 ,
37,000±37,537/mm 3 , 45,833±36,334/mm 3 , and 44,666±35,812/
mm 3 , respectively.
Figure 4. Algorithm of long-term outcome of 15 adults with
immune thrombocytopenia after treatment with rituximab. ER,
LR, CR, PR, and NR denote early response, late response, complete
response, partial response, and no response, respectively.
78

Turk J Hematol 2017;34:72-80
Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia
The strength of our study lies in the long follow-up period of our
patients with a mean duration of 89.7±19.4 months. We showed
that 5 of the 7 responding patients (71.4%) (3/5 ER, 2/2 LR)
relapsed after 2, 3, 5, 9, and 52 months, respectively. Four relapses
occurred within 1 year after initial response. These findings are
largely in line with previous data [9,29]. Patel et al. reported
late relapses 2 years after the initiation of rituximab in adults
and suggested that regular follow-up at 3-month intervals is
indicated at least for the first 5 years in adults [20]. In our study, 2
adult patients showed continued response after 98 months and 1
patient relapsed 52 months after initiation of rituximab. A higher
relapse rate occurred among our patients with LR compared to
those with ER (100% vs. 60%). However, due to the small size
of our study population, patients with ER and LR could not be
compared. This issue will be the subject of our further studies.
We evaluated the relationship between clinical and laboratory
variables and response to rituximab. Our results are in line with
findings of several studies, which reported that splenectomy,
age, sex, number of previous treatments, and pretreatment
platelet count were not associated with response to rituximab
[7,12]. In line with the study by Santoro et al., we demonstrated
that the time between diagnosis and the start of rituximab
therapy did not correlate with response to rituximab [13].
Further studies are needed to determine the best scheduling of
rituximab in the course of ITP.
Considering the entire population, the SR rate in our study
was 26.7% (4/15 patients) with a duration over 6 months
and a mean follow-up of 89.7±19.4 months. The disease-free
survival of these 4 patients at 98 months was 50%. Several
other authors reported SR rates ranging from 28% to 40.5%
[7,11,13,19,27]. Garcia-Chaves et al. reported a SR rate of 67%
over a duration of 6 months, a finding superior to our results
[30]. In that study, the mean number of therapies was 5.5 and
83% of patients had failed to respond to splenectomy [30]. In
the pilot study by Arnold et al., the OR rate to rituximab at
6 months in non-splenectomized adults with newly diagnosed
or relapsed primary ITP was 62.5% [31]. The aforementioned
study is crucial in evaluating whether rituximab could be a
valuable therapeutic alternative to splenectomy [31]. Godeau
et al. evaluated the efficacy of rituximab in adult chronic ITP
patients who had received at least 1 previous therapy and were
potential candidates for splenectomy and reported that at 2
years the response rate was 40% [19]. Patel et al., in their study
on long-term outcome after initiation of rituximab, reported
that 21% of adults maintained response for at least 5 years [20].
Expert consensuses reported that 80% of ITP patients respond
to splenectomy, and the response is sustained in approximately
two-thirds of patients over 5-10 years [10,32]. Taking into
account our results and literature review on efficacy and longlasting
response rate, we think that rituximab treatment has a
role in a subset of chronic ITP patients.
Conclusion
To conclude, in 15 chronic refractory ITP patients, we showed an
initial response rate and SR of 46.7% and 26.7%, respectively,
while 71.4% of responders subsequently relapsed in a mean
follow-up period of 89.7 months. The continuing effect of
rituximab had declined to 13.3% (2/15 patients) at the last followup.
Of importance in clinical practice is the observation that all
initial responders to rituximab achieved long-lasting remission
even after relapse, independent of subsequent therapies. Over a
very long period of immunosuppression, we did not record any
serious adverse events. In the era of TPO-receptor agonists, we
think that rituximab still has a role in the treatment of chronic
refractory ITP. Our data, based on a long period of observation,
confirm the efficacy of rituximab in refractory primary ITP.
Future randomized studies including large case series are needed
to determine the optimal role of rituximab and which subgroup
of ITP patients can most benefit from this therapy.
Ethics
Ethics Committee Approval: Rituximab was offered to these
patients as an off-label treatment following the approval of
the Ministry of Health; Informed Consent: Informed consent for
study participation was obtained from all patients.
Authorship Contributions
Research Design: Fehmi Hindilerden, İpek Yönal-Hindilerden,
Meliha Nalçacı, Reyhan Diz-Küçükkaya; Concept: Fehmi
Hindilerden, Mustafa Nuri Yenerel, Reyhan Diz-Küçükkaya;
Data Collection or Processing: Fehmi Hindilerden, İpek Yönal-
Hindilerden; Analysis or Interpretation: Fehmi Hindilerden;
Literature Search: Fehmi Hindilerden, İpek Yönal-Hindilerden;
Writing: Fehmi Hindilerden, İpek Yönal-Hindilerden, Mustafa
NuriYenerel, Meliha Nalçacı, Reyhan Diz-Küçükkaya.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Rodeghiero F, Stasi R, Gernsheimer T, Michel M, Provan D, Arnold DM, Bussel
JB, Cines DB, Chong BH, Cooper N, Godeau B, Lechner K, Mazzucconi MG,
McMillan R, Sanz MA, Imbach P, Blanchette V, Kühne T, Ruggeri M, George
JN. Standardization of terminology, definitions and outcome criteria in
immune thrombocytopenic purpura of adults and children: report from an
international working group. Blood 2009;113:2386-2393.
2. Godeau B, Stasi R. Is B-cell depletion still a good strategy for treating
immune thrombocytopenia? Presse Med 2014;43:e79-85.
3. George JN, Woolf SH, Raskob GE, Wasser JS, Aledort LM, Ballem PJ, Blanchette
VS, Bussel JB, Cines DB, Kelton JG, Lichtin AE, McMillan R, Okerbloom JA, Regan
DH, Warrier I. Idiopathic thrombocytopenic purpura: a practice guideline
developed by explicit methods for the American Society of Hematology. Blood
1996;88:3-40.
79

Hindilerden F, et al: w Therapy in Refractory Symptomatic Immune Thrombocytopenia Turk J Hematol 2017;34:72-80
4. Kojouri K, Vesely SK, Terrell DR, George JN. Splenectomy for adult patients with
idiopathic thrombocytopenic purpura: a systematic review to assess long-term
platelet count responses, prediction of response, and surgical complications.
Blood 2004;104:2623-2634.
5. George JN. Management of patients with refractory immune thrombocytopenic
purpura. J Thromb Haemost 2006;4:1664-1672.
6. Arnold DM, Dentali F, Crowther MA, Meyer RM, Cook RJ, Sigouin C, Fraser GA,
Lim W, Kelton JG. Systematic review: efficacy and safety of rituximab for adults
with idiopathic thrombocytopenic purpura. Ann Intern Med 2007;146:25-33.
7. Cooper N, Stasi R, Cunningham-Rundles S, Feuerstein MA, Leonard JP,
Amadori S, Bussel JB. The efficacy and safety of B-cell depletion with anti-
CD20 monoclonal antibody in adults with chronic immune thrombocytopenic
purpura. Br J Haematol 2004;125:232-239.
8. Zaja F, Iacona I, Masolini P, Russo D, Sperotto A, Prosdocimo S, Patriarca F,
de Vita S, Regazzi M, Baccarani M, Fanin R. B-cell depletion with rituximab
as treatment for immune hemolytic anemia and chronic thrombocytopenia.
Haematologica 2002;87:189-195.
9. Bennett CM, Rogers ZR, Kinnamon DD, Bussel JB, Mahoney DH, Abshire TC,
Sawaf H, Moore TB, Loh ML, Glader BE, McCarthy MC, Mueller BU, Olson TA,
Lorenzana AN, Mentzer WC, Buchanan GR, Feldman HA, Neufeld EJ. Prospective
phase 1/2 study of rituximab in childhood and adolescent chronic immune
thrombocytopenic purpura. Blood 2006;107:2639-2642.
10. Provan D, Stasi R, Newland AC, Blanchette VS, Bolton-Maggs P, Bussel JB,
Chong BH, Cines DB, Gernsheimer TB, Godeau B, Grainger J, Greer I, Hunt BJ,
Imbach PA, Lyons G, McMillan R, Rodeghiero F, Sanz MA, Tarantino M, Watson
S, Young J, Kuter DJ. International consensus report on the investigation and
management of primary immune thrombocytopenia. Blood 2010;115:168-186.
11. Stasi R, Pagano A, Stipa E, Amadori S. Rituximab chimeric anti-CD20 monoclonal
antibody treatment for adults with chronic idiopathic thrombocytopenic
purpura. Blood 2001;98:952-957.
12. Braendstrup P, Bjerrum OW, Nielsen OJ, Jensen BA, Clausen NT, Hansen PB,
Andersen I, Schmidt K, Andersen TM, Peterslund NA, Birgens HS, Plesner T,
Pedersen BB, Hasselbalch HC. Rituximab chimeric anti-CD20 monoclonal
antibody treatment for adult refractory idiopathic thrombocytopenic purpura.
Am J Hematol 2005;78:275-280.
13. Santoro C, Biondo F, Baldacci E, De Propris MS, Guarini A, Paoloni F, Foà
R, Mazzucconi MG. Rituximab in previously treated primary immune
thrombocytopenia patients: evaluation of short- and long-term efficacy and
safety. Acta Haematol 2014;132:24-29.
14. Schweizer C, Reu FJ, Ho AD, Hensel M. Low rate of long-lasting remissions after
successful treatment of immune thrombocytopenic purpura with rituximab.
Ann Hematol 2007;86:711-717.
15. Al-Habsi K, Al-Khabori M, Al-Muslahi M, Pathare A, Al-Farsi K, Al-Huneini M,
Al-Lamki S, Al-Kindi S. Rituximab leads to long remissions in patients with
chronic immune thrombocytopenia. Oman Med J 2015;30:111-114.
16. Chugh S, Darvish-Kazem S, Lim W, Crowther MA, Ghanima W, Wang G, Heddle
NM, Kelton JG, Arnold DM. Rituximab plus standard of care for treatment of
primary immune thrombocytopenia: a systematic review and meta-analysis.
Lancet Haematol 2015;2:e75-81.
17. Khellaf M, Charles-Nelson A, Fain O, Terriou L, Viallard JF, Cheze S, Graveleau
J, Slama B, Audia S, Ebbo M, Le Guenno G, Cliquennois M, Salles G, Bonmati C,
Teillet F, Galicier L, Hot A, Lambotte O, Lefrère F, Sacko S, Kengue DK, Bierling
P, Roudot-Thoraval F, Michel M, Godeau B. Safety and efficacy of rituximab in
adult immune thrombocytopenia: results from a prospective registry including
248 patients. Blood 2014;124:3228-3236.
18. Medeot M, Zaja F, Vianelli N, Battista M, Baccarani M, Patriarca F, Soldano F,
Isola M, De Luca S, Fanin R. Rituximab therapy in adult patients with relapsed
or refractory immune thrombocytopenic purpura: long-term follow-up results.
Eur J Haematol 2008;81:165-169.
19. Godeau B, Porcher R, Fain O, Lefrère F, Fenaux P, Cheze S, Vekhoff A, Chauveheid
MP, Stirnemann J, Galicier L, Bourgeois E, Haiat S, Varet B, Leporrier M, Papo
T, Khellaf M, Michel M, Bierling P. Rituximab efficacy and safety in adult
splenectomy candidates with chronic immune thrombocytopenic purpuvra:
results of a prospective multicenter phase 2 study. Blood 2008;112:999-1004.
20. Patel VL, Mahévas M, Lee SY, Stasi R, Cunningham-Rundles S, Godeau B, Kanter
J, Neufeld E, Taube T, Ramenghi U, Shenoy S, Ward MJ, Mihatov N, Patel VL,
Bierling P, Lesser M, Cooper N, Bussel JB. Outcomes 5 years after response to
rituximab therapy in children and adults with immune thrombocytopenia.
Blood 2012;119:5989-5995.
21. Zaja F, Volpetti S, Chiozzotto M, Puglisi S, Isola M, Buttignol S, Fanin R. Longterm
follow-up analysis after rituximab salvage therapy in adult patients with
immune thrombocytopenia. Am J Hematol 2012;87:886-889.
22. Gudbrandsdottir S, Birgens HS, Frederiksen H, Jensen BA, Jensen MK, Kjeldsen
L, Klausen TW, Larsen H, Mourits-Andersen HT, Nielsen CH, Nielsen OJ, Plesner
T, Pulczynski S, Rasmussen IH, Rønnov-Jessen D, Hasselbalch HC. Rituximab and
dexamethasone vs dexamethasone monotherapy in newly diagnosed patients
with primary immune thrombocytopenia. Blood 2013;121:1976-1981.
23. Ghanima W, Godeau B, Cines DB, Bussel JB. How I treat immune
thrombocytopenia: the choice between splenectomy or a medical therapy as a
second-line treatment. Blood 2012;120:960-969.
24. Peñalver FJ, Jiménez-Yuste V, Almagro M, Alvarez-Larrán A, Rodríguez L,
Casado M, Gallur L, Giraldo P, Hernández R, Menor D, Rodríguez MJ, Caballero
D, González R, Mayans J, Millán I, Cabrera JR; Multi-institutional Retrospective
Spanish Study Group on the Use of Rituximab in Refractory ITP. Rituximab in the
management of chronic immune thrombocytopenic purpura: an effective and
safe therapeutic alternative in refractory patients. Ann Hematol 2006;85:400-
406.
25. Zaja F, Vianelli N, Sperotto A, De Vita S, Iacona I, Zaccaria A, Masolini P,
Tomadini V, Tani M, Molinari AL, Baccarani M, Fanin R. B-cell compartment
as the selective target for the treatment of immune thrombocytopenias.
Haematologica 2003;88:538-546.
26. Aleem A, Alaskar AS, Algahtani F, Rather M, Almahayni MH, Al-Momen A.
Rituximab in immune thrombocytopenia: transient responses, low rate of
sustained remissions and poor response to further therapy in refractory
patients. Int J Hematol 2010;92:283-288.
27. Zaja F, Vianelli N, Battista M, Sperotto A, Patriarca F, Tomadini V, Filì C, Tani M,
Baccarani M, Fanin R. Earlier administration of rituximab allows higher rate of
long-lasting response in adult patients with autoimmune thrombocytopenia.
Exp Hematol 2006;34:571-572.
28. Pasa S, Altintas A, Cil T, Danis R, Ayyildiz O. The efficacy of rituximab in patients
with splenectomized refractory chronic idiopathic thrombocythopenic purpura.
J Thromb Thrombolysis 2009;27:329-333.
29. Mueller BU, Bennett CM, Feldman HA, Bussel JB, Abshire TC, Moore TB, Sawaf
H, Loh ML, Rogers ZR, Glader BE, McCarthy MC, Mahoney DH, Olson TA, Feig
SA, Lorenzana AN, Mentzer WC, Buchanan GR, Neufeld EJ; Pediatric Rituximab/
ITP Study Group; Glaser Pediatric Research Network. One year follow-up of
children and adolescents with chronic immune thrombocytopenic purpura (ITP)
treated with rituximab. Pediatr Blood Cancer 2009;52:259-262.
30. Garcia-Chavez J, Majluf-Cruz A, Montiel-Cervantes L, Esparza MG, Vela-Ojeda
J; Mexican Hematology Study Group. Rituximab therapy for chronic and
refractory immune thrombocytopenic purpura: a long-term follow-up analysis.
Ann Hematol 2007;86:871-877.
31. Arnold DM, Heddle NM, Carruthers J, Cook DJ, Crowther MA, Meyer RM, Liu Y,
Cook RJ, McLeod A, MacEachern JA, Mangel J, Anderson D, Vickars L, Tinmouth
A, Schuh AC, Kelton JG. A pilot randomized trial of adjuvant rituximab or
placebo for nonsplenectomized patients with immune thrombocytopenia.
Blood 2012;119:1356-1362.
32. Neunert C, Lim W, Crowther M, Cohen A, Solberg L Jr, Crowther MA; American
Society of Hematology. The American Society of Hematology 2011 evidencebased
practice guideline for immune thrombocytopenia. Blood 2011;117:4190-
4207.
80

RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0344
Turk J Hematol 2017;34:81-88
Discrepancies in Lymphoma Diagnosis Over the Years: A 13-Year
Experience in a Tertiary Center
Lenfoma Tanısında Üst Merkezle Olan Tutarsızlıklarda Yıllar İçinde Gözlenen Değişiklikler:
Konsültasyon Merkezinin 13 Yıllık Deneyimi
Neval Özkaya¹*, Nuray Başsüllü², Ahu Senem Demiröz¹, Nükhet Tüzüner¹
1İstanbul University Cerrahpaşa Faculty of Medicine, Department of Pathology, İstanbul, Turkey
2İstanbul Bilim University Faculty of Medicine, Department of Pathology, İstanbul, Turkey
*The current affiliation for N.Ö. is Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA
Abstract
Objective: In the past, accurate diagnosis of lymphoma was
challenging since there were multiple competing classification
systems that caused confusion and debate. After establishment of
the World Health Organization lymphoma classification, lymphomas
still remain a diagnostic challenge among general pathologists. The
purpose of this study was to examine whether the discordance among
centers has declined over the years.
Materials and Methods: All lymphoma or lymphoma-suspected
specimens that had been sent to the Cerrahpaşa Faculty of Medicine
between 2000 and 2013 for a second opinion were deemed eligible. To
evaluate the change in the discrepancy rates over time we compared
the rates of revision between 2000-2008 and 2009-2013.
Results: A total of 1824 patients in two time periods met the
inclusion criteria. The overall discordance rate was 45.6%. This rate
showed significant variations between different histologic subtypes.
Discordance rates also varied significantly over time and decreased
from 51.3% in 2000-2008 to 38.7% in 2009-2013 (p

Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years Turk J Hematol 2017;34:81-88
Introduction
Accurate histologic diagnosis is the most crucial step for the
appropriate management of patients with lymphoma. In the
past this was challenging since there were numerous competing
classification systems, which caused conflict and discussion
[1,2]. In 2000, a new unified diagnostic classification system was
recommended by the World Health Organization (WHO) based
on the Revised European-American Classification of Lymphoid
Neoplasms (REAL) with an emphasis on the importance of
morphologic, immunophenotypic, molecular, and genetic
features in defining different subtypes of disease [3,4]. The
WHO classification was updated in 2008, further reinforcing the
integration of these four elements in the diagnosis of lymphoma
[5].
The WHO lymphoma classification is now well known and
widely used by hematopathologists, making the approach to
diagnosis more consistent. However, lymphomas still remain a
diagnostic challenge among general pathologists. The literature
on this topic reveals that widely varying agreement values have
been reported recently [6,7,8,9,10]. These studies encompassed
short periods and/or assessed relatively small numbers of
cases. Furthermore, a vast majority of these studies included
case samples from 2008 and before; therefore, information
regarding the situation for more recent years is not known. We
thus designed our study to investigate the situation in Turkey
with many more cases to cover a longer period.
The İstanbul University Cerrahpaşa Faculty of Medicine (CFM)
Hematopathology Service is a reference center receiving
specimens from several hospitals. In order to test the validity
of the hypothesis that adoption of the WHO classification
by pathologists resulted in less discrepancy among centers in
correctly diagnosing lymphoma, we carried out a retrospective
study by reviewing all lymphoma or lymphoma-suspected
specimens that had been sent to our laboratory for a second
opinion between 2000 and 2013.
Materials and Methods
All specimens that had been referred to the CFM between 2000
and 2013 (excluding those with cutaneous biopsies only) for
a second opinion were deemed eligible if the records of the
original biopsy results were available.
Biopsy specimens with a definite or suspected initial diagnosis
of lymphoma were reevaluated at the CFM by an expert in
hematopathology (N.T.). Initial diagnoses were not considered
discordant if they defined the lymphoma type correctly but
failed to give additional features related to grade (e.g., follicular
lymphoma grades 1 to 2) or subtype [e.g., germinal center vs.
activated B-cell types of diffuse large B-cell lymphoma (DLBCL)].
Divergent diagnoses among subtypes of T-cell lymphomas were
not considered discordant since they would only minimally
affect the clinical approach.
During the course of this study, 206 benign samples were
received. These typically were cases in which the primary
pathologist could not definitively rule out lymphoma or cases
in which the patient had a history of lymphoma and displayed
suggestive clinical features.
To evaluate whether diagnostic discrepancy had an effect on
the clinical management of the patients, we reviewed the
discordant samples and confined them into one of three groups
according to the differences between the referral and revised
diagnoses (Table 1). Cases were grouped depending on whether
the revisions would alter treatment and management according
to the National Comprehensive Cancer Network guidelines, as
previously described [6,11,12].
Cases where the primary pathologist or second opinion failed to
reach a definitive diagnosis were also included in the study and
classified as non-diagnostic. A case that was initially diagnosed
as non-diagnostic was included in group B if it received a
benign diagnosis upon second opinion and in group C if it
received a malignant diagnosis, since it caused a delay in the
commencement of therapy. Cases classified as non-diagnostic
after a second opinion were considered neither concordant nor
discordant and were not included in statistical analysis.
To evaluate the change in the discrepancy rates of lymphoma
diagnosis over time we compared the rates of revision between
2000-2008 (group 1) and 2009-2013 (group 2). Specimens from
1 January 2000 to 31 December 2008 (group 1) and from 1
January 2009 to 31 December 2013 (group 2) were evaluated
using the WHO 2001 and 2008 classifications, respectively.
However, our purpose in doing so was not to compare the
two WHO classifications, which are essentially very similar,
but rather to assess the adoption of the WHO classification by
general pathologists over time.
Statistical analysis was done using SPSS 15.0 for Windows. The
comparison of the diagnostic revision rates was carried out
using chi-square or Fisher’s exact tests.
Results
A total of 1824 patients in two time periods (1008 between
2000 and 2008 and 816 between 2009 and 2013) met the
inclusion criteria and were assessed. A definite diagnosis could
not be attributed to 126 cases after a second opinion due to
various reasons. These cases were not included in the statistical
analysis. Analyses were conducted based on 1698 cases that had
a definitive diagnosis following a second opinion.
Initially 1372 patients had an initial diagnosis of one of the
lymphoid malignancies. This number increased to 1450 after
revision at the CFM. All cases diagnosed as lymphoma after a
second opinion are listed together with the initial diagnoses in
Table 2.
82

Turk J Hematol 2017;34:81-88
Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years
Table 1. Grouping of discrepant diagnoses according to their effect on treatment.
Group
A
B
C
Effect of second opinion
Major revisions are those associated with definite changes in clinical management according to National Comprehensive Cancer
Network guidelines [6,11,12]: the initial diagnosis would lead to suboptimal treatment or overtreatment.
Minor revisions are those with possible changes in clinical management: the secondary diagnosis would not lead to a major
change of rendered therapy.
Delayed treatment: the initial diagnosis provided inadequate information to allow possible treatment to be started safely.
Example: Specimen diagnosed as unspecified lymphoma or atypical lymphoid infiltration.
Table 2. Referral and final pathologic diagnoses in period of 2000-2008 (n=810) (A) and period of 2009-2013 (n=640) (B).
Table 2A. Referral and final pathologic diagnoses in 2000-2008 (n=810).
Diagnosis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Total
1 DLBCL 1266 4 1 8 4 0 0 3 0 0 0 0 0 0 0 0 146
2 cHL 16 144 10 0 0 0 0 1 0 8 0 0 6 0 0 0 185
3 TCL 3 8 25 0 0 0 1 0 0 1 0 0 2 0 0 0 40
4 BL 4 0 0 17 0 0 1 0 0 0 0 1 0 0 0 0 23
5 FL G1-2 5 0 0 0 12 5 0 1 3 1 2 0 0 0 0 0 29
6 FL G3 7 0 0 0 3 6 0 0 0 0 0 0 0 0 0 0 16
7 LBL 2 0 0 1 0 0 15 0 0 0 1 0 1 0 0 0 20
8 CLL/SLL 0 0 0 0 0 0 0 10 0 1 0 2 0 0 0 0 13
9 MZL 2 0 1 2 0 0 0 0 5 0 1 0 1 0 0 0 12
10 NLPHL 5 6 0 0 1 1 0 0 0 10 0 0 1 0 0 0 24
11 LL-NOS 0 0 0 1 1 0 1 9 6 1 5 5 0 1 0 0 30
12 MCL 0 0 0 0 0 0 0 1 1 0 1 5 0 0 0 0 8
13 GZL 4 2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 7
14 PCN 0 0 0 0 0 0 0 0 0 0 0 0 0 13 0 0 13
15 L-NOS 29 7 4 7 0 0 5 1 6 0 2 1 2 0 3 0 67
16 LPL 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
17 HL-NOS 24 1 3 1 0 1 3 1 0 0 1 2 1 0 0 0 38
18 IL-NOS 5 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 7
19 Benign 3 9 4 0 1 0 1 0 2 0 2 0 0 0 0 0 22
20 ALI 9 12 4 1 2 1 1 1 2 0 2 1 0 0 1 0 37
21 UMT 17 4 5 0 0 0 2 0 0 0 0 0 0 0 0 0 28
22 Non-lym 9 1 2 2 0 0 1 0 0 0 0 0 0 1 0 0 16
23 B-NHL 6 3 0 1 1 0 0 0 2 0 3 3 0 0 0 1 20
24 Non dx 2 2 0 0 0 3 0 0 0 0 0 0 1 0 0 1 9
Total cases 278 203 59 42 25 17 31 28 27 22 21 20 16 15 4 2 810
Conc (%) 45 71 42 40 48 35 48 36 19 45 24 25 6 87 75 0
The majority of group A was composed of lymphoma typing
discrepancies in both periods (Table 3). Even with the improved
concordance rate in histological subtypes over time, the
histological subtypes that frequently mimic these diagnoses
were generally similar. DLBCLs, the most common diagnosis,
were frequently misdiagnosed as classical Hodgkin lymphoma
(cHL) (n=24) in both periods. All of those cases were T-cell rich
B-cell lymphoma (TCRBCL), a subtype of DLBCL. cHL, the second
most common diagnosis, was frequently misdiagnosed as T-cell
lymphoma (TCL) (n=11) in both periods. The majority of those
83

Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years
Turk J Hematol 2017;34:81-88
Table 2. Referral and final pathologic diagnoses in period of 2000-2008 (n=810) (A) and period of 2009-2013 (n=640) (B).
Table 2B. Referral and final pathologic diagnoses in 2009-2013 (n=640).
Final diagnosis
Diagnosis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Total
1 DLBCL 1226 1 2 5 5 6 0 3 4 1 1 3 2 0 0 0 155
2 cHL 8 121 0 0 0 0 0 0 1 3 0 0 1 0 0 0 134
3 TCL 1 3 26 0 0 0 1 0 0 0 0 0 0 0 0 0 31
4 BL 0 0 0 7 0 0 0 0 0 0 0 0 0 0 0 0 7
5 FL G1-2 0 0 0 0 22 3 0 0 0 1 1 0 0 0 0 0 27
6 FL G3 3 0 0 0 1 10 0 0 1 0 1 0 0 0 0 0 16
7 LBL 0 0 0 0 0 0 7 0 0 0 0 0 0 0 0 0 7
8 CLL/SLL 0 0 0 0 0 0 0 14 1 0 1 0 0 0 0 0 16
9 MZL 3 0 0 0 0 0 0 0 17 0 3 2 0 0 0 0 25
10 NLPHL 1 2 1 0 0 0 0 0 0 7 0 0 0 0 0 0 11
11 LL-NOS 1 0 0 0 1 2 0 6 2 0 7 3 0 0 0 0 22
12 MCL 0 0 0 0 0 0 0 1 0 0 0 9 0 0 0 0 10
13 GZL 0 0 1 0 0 0 0 0 0 0 0 0 2 0 0 0 3
14 PCN 0 0 0 0 0 0 0 0 0 0 0 1 0 17 0 1 19
15 L-NOS 20 4 4 1 1 1 1 0 3 0 3 0 2 0 2 0 42
16 LPL 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
17 HL-NOS 13 0 2 1 0 1 0 0 2 0 0 0 0 0 0 0 19
18 IL-NOS 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1
19 Benign 4 4 3 0 0 0 0 1 1 0 1 0 0 0 1 0 15
20 ALI 8 8 2 2 3 1 0 1 2 2 2 0 1 1 1 0 34
21 UMT 11 1 3 0 0 0 0 0 0 0 1 0 0 2 0 0 18
22 Non-lym 4 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 5
23 B-NHL 8 0 0 0 2 0 0 1 0 0 1 2 0 0 0 1 15
24 Non dx 2 3 0 0 0 0 0 0 1 0 1 0 0 0 1 0 8
Total cases 209 147 44 16 35 24 9
Conc (%) 58 82 59 44 63 42 78
27
52
36 14 23 20 8 21 5 2 640
47 50 30 45 25 81 40 0
LBL: Lymphoblastic lymphoma, CLL/SLL: chronic lymphocytic leukemia/small lymphocytic lymphoma, LPL: lymphoplasmacytic lymphoma, PCN: plasma cell neoplasia, MZL: marginal
zone lymphoma, FL G1-2: follicular lymphoma grades 1 and 2, FL G3: follicular lymphoma grade 3, MCL: mantle cell lymphoma, DLBCL: diffuse large B-cell lymphoma, BL: Burkitt
lymphoma, TCL: T-cell and NK-cell lymphomas, NLPHL: nodular lymphocyte predominant Hodgkin lymphoma, cHL: classical Hodgkin lymphoma, GZL: gray zone lymphoma, HL-NOS:
high-grade lymphoma not otherwise specified, IL-NOS: intermediate-grade lymphoma not otherwise specified, ALI: atypical lymphoid infiltration, LL-NOS: low-grade lymphoma not
otherwise specified, L-NOS: lymphoma not otherwise specified, UMT: undifferentiated malign tumor, Non-lym: non-lymphoid malign tumor, B-NHL: B-cell non-Hodgkin lymphoma,
Non dx: non-diagnostic, Conc: concordance.
84

Turk J Hematol 2017;34:81-88
Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years
Table 3. Summary of the diagnostic discrepancies in lymphoma diagnosis by category in 2000-2008 and 2009-2013.
2000-2008
(n=927)
2009-2013
(n=771)
Group A n=229 (24.7%) n=114 (14.8%)

Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years
Turk J Hematol 2017;34:81-88
Table 4. Comparison of distributions of diagnostic revision,
2000-2008 and 2009-2013.
Category 2000-2008 2009-2013 p
A 229 (24.7%) 114 (14.7%)

Turk J Hematol 2017;34:81-88
Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years
inappropriate treatment without the second opinion review
(group C).
Discordance rates also varied substantially over time. The overall
discordance rate decreased from 51.3% in 2000-2008 to 38.7%
in 2009-2013 (p

Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years
Turk J Hematol 2017;34:81-88
and/or affiliations relevant to the subject matter or materials
included.
References
1. No authors listed. National Cancer Institute sponsored study of
classifications of non-Hodgkin’s lymphomas: summary and description of
a working formulation for clinical usage. The Non-Hodgkin’s Lymphoma
Pathologic Classification Project. Cancer 1982;49:2112-2135.
2. No authors listed. Classification of non-Hodgkin’s lymphomas.
Reproducibility of major classification systems. NCI non-Hodgkin’s
Classification Project Writing Committee. Cancer 1985;55:91-95.
3. Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman J.
Lymphoma classification--from controversy to consensus: the R.E.A.L. and
WHO Classification of lymphoid neoplasms. Ann Oncol 2000;11(Suppl 1):3-
10.
4. Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman
J, Lister TA, Bloomfield CD. The World Health Organization classification
of hematological malignancies report of the Clinical Advisory Committee
Meeting, Airlie House, Virginia, November 1997. Mod Pathol 2000;13:193-
207.
5. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J,
Vardiman JW. WHO Classification of Tumours of Haematopoietic and
Lymphoid Tissues. Lyon, IARC, 2008.
6. Matasar MJ, Shi W, Silberstien J, Lin O, Busam KJ, Teruya-Feldstein J,
Filippa DA, Zelenetz AD, Noy A. Expert second-opinion pathology review of
lymphoma in the era of the World Health Organization classification. Ann
Oncol 2012;23:159-166.
7. Proctor IE, McNamara C, Rodriguez-Justo M, Isaacson PG, Ramsay
A. Importance of expert central review in the diagnosis of lymphoid
malignancies in a regional cancer network. J Clin Oncol 2011;29:1431-1435.
8. LaCasce AS, Kho ME, Friedberg JW, Niland JC, Abel GA, Rodriguez MA,
Czuczman MS, Millenson MM, Zelenetz AD, Weeks JC. Comparison of
referring and final pathology for patients with non-Hodgkin’s lymphoma in
the National Comprehensive Cancer Network. J Clin Oncol 2008;26:5107-
5112.
9. Chang C, Huang SW, Su IJ, Chang KC. Hematopathologic discrepancies
between referral and review diagnosis: a gap between general pathologists
and hematopathologists. Leuk Lymphoma 2014;55:1023-1030.
10. Bowen JM, Perry AM, Laurini JA, Smith LM, Klinetobe K, Bast M, Vose
JM, Aoun P, Fu K, Greiner TC, Chan WC, Armitage JO, Weisenburger DD.
Lymphoma diagnosis at an academic centre: rate of revision and impact on
patient care. Br J Haematol 2014;127:464-473.
11. Hoppe RT, Advani RH, Ai WZ, Ambinder RF, Aoun P, Bello CM, Bierman
PJ, Blum KA, Chen R, Dabaja B, Duron Y, Forero A, Gordon LI, Hernandez-
Ilizaliturri FJ, Hochberg EP, Maloney DG, Mansur D, Mauch PM, Metzger M,
Moore JO, Morgan D, Moskowitz CH, Poppe M, Pro B, Winter JN, Yahalom
J, Sundar H; National Comprehensive Cancer Network. Hodgkin lymphoma,
version 2.2012 featured updates to the NCCN guidelines. J Natl Compr Canc
Netw 2012;10:589-597.
12. Zelenetz AD, Abramson JS, Advani RH, Andreadis CB, Byrd JC, Czuczman MS,
Fayad L, Forero A, Glenn MJ, Gockerman JP, Gordon LI, Harris NL, Hoppe RT,
Horwitz SM, Kaminski MS, Kim YH, Lacasce AS, Mughal TI, Nademanee A,
Porcu P, Press O, Prosnitz L, Reddy N, Smith MR, Sokol L, Swinnen L, Vose
JM, Wierda WG, Yahalom J, Yunus F. NCCN clinical practice guidelines in
oncology: non-Hodgkin’s lymphomas. J Natl Compr Canc Netw 2010;8:288-
334.
13. Herrera AF, Crosby-Thompson A, Friedberg JW, Abel GA, Czuczman MS,
Gordon LI, Kaminski MS, Millenson MM, Nademanee AP, Niland JC, Rodig SJ,
Rodriguez MA, Zelenetz AD, LaCasce AS. Comparison of referring and final
pathology for patients with T-cell lymphoma in the National Comprehensive
Cancer Network. Cancer 2014;120:1993-1999.
88

RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0108
Turk J Hematol 2017;34:89-92
Hypogammaglobulinemia and Poor Performance Status are
Predisposing Factors for Vancomycin-Resistant Enterococcus
Colonization in Patients with Hematological Malignancies
Hematolojik Maliniteli Hastalarda Hipogamaglobulinemi ve Kötü Performans Durumu
Vankomisin Dirençli Enterokok Kolonizasyonu için Bir Risk Faktörüdür
Elif Gülsüm Ümit 1 , Figen Kuloğlu 2 , Ahmet Muzaffer Demir 1
1Trakya University Faculty of Medicine, Department of Hematology, Edirne, Turkey
2Trakya University Faculty of Medicine, Department of Infectious Diseases, Edirne, Turkey
Abstract
Objective: Vancomycin-resistant enterococci (VRE) are common pathogens
of hospital-acquired infection. Long hospitalization periods, use of broadspectrum
antibiotics, and immunosuppression are major risks for VRE
colonization. We aimed to evaluate patients’ characteristics and factors
that may contribute to VRE colonization.
Materials and Methods: Data of 66 patients with colonization
and 112 patients without colonization who were hospitalized in the
hematology clinic were collected. Hematological malignancies, preexisting
gastrointestinal complaints, the presence of hypogammaglobulinemia
at the time of diagnosis, complications like neutropenic enterocolitis
(NEC), and Eastern Cooperative Oncology Group (ECOG) and Karnofsky
performance statuses were recorded.
Results: Ages of the patients ranged between 19 and 95 years (mean: 55.99).
Karnofsky and ECOG scores were statistically related to VRE colonization
(p

Ümit EG, et al: Hypogammaglobulinemia and Poor Performance for Vancomycin-Resistant Enterococci Colonization
Turk J Hematol 2017;34:89-92
Introduction
Vancomycin-resistant enterococci (VRE) cause colonization
or infection, especially in immunocompromised patients. Risk
factors of VRE colonization include long periods of hospital
stay, socioeconomic status, use of broad-spectrum antibiotics,
and immunosuppression (neutropenia or immunosuppressive
therapy) [1,2]. Since the treatment options for VRE infections
are very limited, building up effective approaches to prevent VRE
colonization is vital. Intensified infection-control measures like
mandatory alcohol-based hand sanitation and use of disposable
gloves and gowns, patient cohorting and isolation of colonized
patients thorough VRE screening (for rectal colonization), and
regular training of the staff and patients are crucial.
First described in the 1980s, the prevalence of VRE infections
increased from 4.6 to 9.4 hospitalizations per 100,000 population
in 2003-2006 [3]. Related to adverse outcomes, mortality is
significantly higher in infections with resistant isolates [1].
From this point of view, we aimed to evaluate additional risk
factors for VRE colonization in patients with hematological
malignancies and contribute our perspective.
Materials and Methods
Trakya University Hospital is a 1042-bed tertiary-care teaching
hospital in Edirne with an annual inpatient admission of
23,000. The annual rate of hospitalization in the hematology
inpatient clinic is 550-600. The first case of VRE colonization in
our hospital was recognized in 2007 in the intensive care unit.
We reviewed all cases of VRE colonization in the hematology
inpatient clinic between 2011 and 2014. Systematic surveillance
was performed in our hospital for the detection of VRE
colonization. Routine swabs for cultures were obtained from
the rectum of all patients on admission and twice weekly until
discharge. Colonization of VRE was defined as positive results at
any time during hospitalization. Decolonization or a negative
test was defined as two consecutive negative cultures.
Medical records of patients were reviewed and data regarding
age, sex, primary diagnosis for hospitalization, the presence
of hypogammaglobulinemia at the time of diagnosis, total
leukocyte count, Eastern Cooperative Oncology Group (ECOG)
[4] and Karnofsky performance statuses [5] at the time
of hospitalization, previous antibiotic use, and history of
gastrointestinal complaints were recorded.
Statistical analysis was performed with IBM SPSS Software.
Categorical variables were compared using chi-square and Fisher
exact tests while non-parametric variables were analyzed with
the Mann-Whitney U test. Logistic regression was performed
for all significant values and p-values 7 days. Patients with MDS,
myeloma, and benign hematologic diseases with colonization
were not taking antibiotics. Mean time from hospitalization
(and also a hematological diagnosis) to colonization was 8.5
days (3-14 days).
Performance statuses of the patients were evaluated by the
ECOG and Karnofsky performance systems. Forty-six of the
VRE-colonized patients (69.66%) had ECOG scores of 3 or 4
while 25 of the not-colonized group (22%) had ECOG scores
of 3 or 4 (p

Turk J Hematol 2017;34:89-92
Ümit EG, et al: Hypogammaglobulinemia and Poor Performance for Vancomycin-Resistant Enterococci Colonization
were not in remission (69.69%), while among the not-colonized
group, 42 patients (37.5%) were not in remission (p1
week) in the environment, can be transferred by hands, and may
be isolated from almost every object in health care facilities.
Maintaining infection control measures is vital, such as
educating staff and patients to use single-use disposable gloves
and gowns and frequent hand sanitation. A more detailed list
of control measures is available from the Centers for Disease
Control and Prevention [9].
Table 1. General features of the patients with vancomycin-resistant Enterococcus colonization.
VRE colonization, positive VRE colonization, negative Total
Age (Mean, years) 56.7 54.4 55.9
Sex (Female/Male) 28 (42.42%) / 38 (57.57%) 50 (44.6%) / 62 (55.3%) 78 (43.8%) / 100 (56.2%)
Diagnosis (Number of patients) AML 25 AML 12 AML 37
ALL 7 ALL 5 ALL 12
Lymphoma 12 Lymphoma 36 Lymphoma 48
Myeloma 11 Myeloma 16 Myeloma 27
CLL 3 CLL 15 CLL 18
CML 1 CML 4 CML 5
MDS 5 MDS 14 MDS 19
Benign 2 Benign 10 Benign 12
Total 66 Total 112 Total 178
VRE: Vancomycin-resistant enterococci, AML: acute myeloid leukemia, ALL: acute lymphoblastic leukemia, CLL: chronic lymphocytic leukemia CML: chronic myeloid leukemia,
MDS: myelodysplastic syndrome, NEC: neutropenic enterocolitis.
Table 2. Performance status, hypogammaglobulinemia, and vancomycin-resistant Enterococcus colonization.
VRE colonization, positive VRE colonization, negative p-values Logistic regression
odds ratio
Hypogammaglobulinemia 46 (69.6%) 27 (24.1%) 0.000 4.62
NEC development 27 (24.1%) 2 (1.7%) 0.000 39.35
Preexisting gastrointestinal complaints 28 (42.4%) 5 (4.4%) 0.000 2.31
ECOG performance ≥3 46 (69.6%) 25 (22.3%) 0.000 1.7
Karnofsky performance ≤40% 50 (757%) 16 (14.2%) 0.000 29.0
Remission status (not in remission) 46 (69.6%) 42 (37.5%) 0.000 1.8
VRE: Vancomycin-resistant enterococci, ECOG: Eastern Cooperative Oncology Group, NEC: neutropenic enterocolitis.
91

Ümit EG, et al: Hypogammaglobulinemia and Poor Performance for Vancomycin-Resistant Enterococci Colonization
Turk J Hematol 2017;34:89-92
Besides the known risk factors, hypogammaglobulinemia is
a distinct state of immunodeficiency, with various causes
and manifestations and complications. A common and
important clinical consequence of hypogammaglobulinemia
is predisposition toward infections that are otherwise
prevented by antibody-related immune responses (including
encapsulated bacteria Streptococcus pneumoniae and
Haemophilus influenzae). Acquired or secondary major
causes of hypogammaglobulinemia include drugs, renal and
gastrointestinal protein loss, B-cell-related malignancies,
and severe burns. The majority of renal diseases leading to
hypogammaglobulinemia are nephrotic syndrome, where IgG is
lost accompanied by albumin. Gastrointestinal conditions include
protein-losing enteropathy and intestinal lymphangiectasia. The
clinical manifestations are related to the type and severity of
the immunoglobulin lost. In general, hypogammaglobulinemia
results in recurrent infections with encapsulated bacteria
primarily localized to the upper or lower airways. An agent
used in both lymphoproliferative and rheumatic diseases,
rituximab, an anti-CD20 antibody, was recently reported to
cause significant hypogammaglobulinemia [10]. In our study,
hypogammaglobulinemia was observed in 69.7% of the
patients at the time of diagnosis. In hypogammaglobulinemic
patients, 50% had a B-cell-related lineage malignancy, such
as lymphoma or myeloma. Without the burden of treatment,
hypogammaglobulinemia is observed to be an independent risk
factor in VRE colonization.
Assessment of performance of a patient brings many potential
benefits. First, it helps physicians to document how the disease
affects the daily living abilities of a person and to determine
appropriate risk-adapted treatment and also predict the
prognosis. The most generally used performance scores are the
Karnofsky and ECOG scores [4,5]. Performance status is also
related to a lack of personal hygiene and requirements for
constant assistance. Since colonization of VRE is associated with
the caregiver’s use of hospital equipment and the surroundings,
the increase of colonization in patients with poorer performance
is to be expected.
There are limitations of our study. First of all, the number of
patients is small. In a larger patient group, both positive and
negative colonization groups may demonstrate more credible
results. The second limitation is the lack of globulin quantitation.
Since the study was not designed as a prospective study in
the first place, quantitative immunoglobulin analysis was not
performed. Finally, the most important limitation may be the
study design. A prospective observational study with a large
number of patients is needed to assess our findings.
Conclusion
In clinics dealing with patients with VRE colonization, isolation
of the patient as well as related materials, the extra work of
disinfecting, active surveillance, and repeated education of staff
complicates the management, both economically and socially.
Prevention of colonization must be the first goal of all hospitals.
Ethics
Ethics Committee Approval: Approval from the local ethics
committee was obtained for this retrospective study; Informed
Consent: Retrospective study.
Authorship Contributions
Concept: Elif Gülsüm Ümit; Design: Elif Gülsüm Ümit; Data
Collection or Processing: Elif Gülsüm Ümit, Figen Kuloğlu;
Analysis or Interpretation: Elif Gülsüm Ümit, Figen Kuloğlu,
Ahmet Muzaffer Demir; Literature Search: Elif Gülsüm Ümit;
Writing: Elif Gülsüm Ümit.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Diaz Granados CA, Jernigan JA. Impact of vancomycin resistance on
mortality among patients with neutropenia and enterococcal bloodstream
infection. J Infect Dis 2005;191:588-595.
2. Padiglione AA, Wolfe R, Grabsch EA, Olden D, Pearson S, Franklin C, Spelman
D, Mayall B, Johnson PD, Grayson ML. Risk factors for new detection of
vancomycin-resistant enterococci in acute-care hospitals that employ strict
infection control procedures. Antimicrob Agents Chemother 2003;47:2492-
2498.
3. Ramsey AM, Zilberberg MD. Secular trends of hospitalization with
vancomycin-resistant enterococcus infection in the United States, 2000-
2006. Infect Control Hosp Epidemiol 2009;30:184-186.
4. Oken MM, Creech RH, Tormey DC, Horton J, Davis TE, McFadden ET,
Carbonne PP. Toxicity and response criteria of the Eastern Cooperative
Oncology Group. Am J Clin Oncol 1982;5:649-655.
5. Karnofsky DA, Burchenal JH. The clinical evaluation of chemotherapeutic
agents in cancer. In: MacLeod CM, (ed). Evaluation of Chemotherapeutic
Agents. New York, Columbia University Press, 1949.
6. Murray BE. Vancomycin-resistant enterococcal infections. N Engl J Med
2000;342:710-721.
7. Wong MT, Kauffman CA, Standiford HC, Linden P, Fort G, Fuchs HJ,
Porter SB, Wenzel RP; Ramoplanin VRE2 Clinical Study Group. Effective
suppression of vancomycin-resistant Enterococcus species in asymptomatic
gastrointestinal carriers by a novel glycolipodepsipeptide, ramoplanin. Clin
Infect Dis 2001;33:1476-1482.
8. Rand KH, Houck H. Daptomycin synergy with rifampicin and ampicillin
against vancomycin-resistant enterococci. J Antimicrob Chemother
2004;53:530-532.
9. Knelson LP, Williams DA, Gergen MF, Rutala WA, Weber DJ, Sexton DJ,
Anderson DJ; Centers for Disease Control and Prevention Epicenters
Program. A comparison of environmental contamination by patients
infected or colonized with methicillin-resistant Staphylococcus aureus or
vancomycin-resistant enterococci: a multicenter study. Infect Control Hosp
Epidemiol 2014;35:872-875.
10. Casulo C, Maragulia J, Zelenetz AD. Incidence of hypogammaglobulinemia
in patients receiving rituximab and the use of intravenous immunoglobulin
for recurrent infections. Clin Lymphoma Myeloma Leuk 2013;13:106-111.
92

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0073
Turk J Hematol 2017;34:93-98
Antibacterial Activities of Ankaferd Hemostat (ABS) on Shiga
Toxin-Producing Escherichia coli and Other Pathogens Significant
in Foodborne Diseases
Ankaferd Hemostat’ın (ABS) Shiga Toksijenik Escherichia coli ve Diğer Gıda Patojenleri
Üzerine Antibakteriyel Etkisi
Ahmet Koluman 1 , Nejat Akar 2 , İbrahim C. Haznedaroğlu 3
1Republic of Turkey Ministry of Food, National Food Reference Laboratory, Department of Mineral Analyses, Agriculture, and Livestock, Ankara,
Turkey
2TOBB-ETU Hospital, Clinic of Pediatric Hematology, Ankara, Turkey
3Hacettepe University Faculty of Medicine, Department of Adult Hematology, Ankara, Turkey
Abstract
Objective: Ankaferd hemostat (Ankaferd Blood Stopper®, ABS)-
induced pharmacological modulation of essential erythroid proteins
can cause vital erythroid aggregation via acting on fibrinogen
gamma. Topical endoscopic ABS application is effective in the
controlling of gastrointestinal (GI) system hemorrhages and/or
infected GI wounds. Escherichia coli O157:H7, the predominant
serotype of enterohemorrhagic E. coli, is a cause of both outbreaks
and sporadic cases of hemorrhagic colitis. The aim of this study is
to examine the effects of ABS on 6 different Shiga toxigenic E. coli
serotypes including O26, O103, O104, O111, O145, and O157 and on
other pathogens significant in foodborne diseases, such as Salmonella
Typhimurium, Campylobacter jejuni, and Listeria monocytogenes,
were also assessed.
Materials and Methods: All strains were applied with different
amounts of ABS and antimicrobial effect was screened. S. Typhimurium
groups were screened for survival using the fluorescence in situ
hybridization technique.
Results: The relative efficacy of ABS solutions to achieve significant
logarithmic reduction in foodborne pathogens E. coli O157:H7 and
non-O157 serogroups and other emerging foodborne pathogens is
demonstrated in this study. ABS has antibacterial effects.
Conclusion: Our present study indicated for the first time that ABS
may act against E. coli O157:H7, which is a cause of thrombotic
thrombocytopenic purpura, hemolytic-uremic syndrome, and
hemorrhagic colitis. The interrelationships between colitis, infection,
and hemostasis within the context of ABS application should be
further investigated in future studies.
Keywords: Ankaferd Blood Stopper, Shiga-toxigenic Escherichia coli,
Salmonella, Campylobacter, Listeria monocytogenes
Öz
Amaç: Ankaferd hemostat (Ankaferd Blood Stopper®, ABS) gamma
fibrinojene etki ederek eritroid agregasyonuna neden olan farmakolojik
modülasyondur. Topikal endoskopik ABS uygulaması gastrointestinal
(Gİ) kanamalarda ve enfekte Gİ yaralarında etkili olmaktadır. Escherichia
coli O157:H7, en sık karşılaşılan enterohemorajik Escherichia coli
tipi olup sporadik veya salgınlar şeklinde hemorajik kolitin önemli
bir etkenidir. Bu çalışmanın amacı ABS ile 6 farklı Shiga Toksijenik
Escherichia coli serotipi (O26, O103, O104, O111, O145 ve O157) ve
diğer önemli gıda kaynaklı patojenlerden Salmonella, Campylobacter
ve Listeria monocytogenes üzerine etkisi değerlendirilmiştir.
Gereç ve Yöntemler: Tüm patojenler hazırlanarak ABS’nin farklı
miktarları uygulanmış ve antimikrobiyel etki izlenmiştir. Salmonella
canlılığı floresan in situ hibridizasyon tekniği ile izlenmiştir.
Bulgular: ABS uygulamalarının sadece Escherichia coli O157 ve non-
O157’ler üzerine değil aynı zamanda diğer patojenlerde de logaritmik
azalma tetiklediği izlenmiştir. Bu çalışmada ABS ile farklı patojenler
üzerine antibakteriyel etki gözlemlenmiştir.
Sonuç: Bu çalışma özellikle trombositopenik purpura, hemolitik
üremik sendrom ve hemorajik kolit yönünden önemli Escherichia
coli O157:H7’nin üzerine ABS’nin antimikrobiyel etkisi olduğunu
belirleyen ilk çalışmadır. ABS uygulamalarının kolitis, enfeksiyon ve
hemostaz ilişkisi daha ileri seviyede araştırılmalıdır.
Anahtar Sözcükler: Ankaferd Blood Stopper, Shigatoksijenik
Escherichia coli, Salmonella, Campylobacter, Listeria monocytogenes
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Ahmet KOLUMAN, M.D.,
Republic of Turkey Ministry of Food, National Food Reference Laboratory, Department of Mineral Analyses,
Agriculture, and Livestock, Ankara, Turkey
E-mail : ahmetkoluman@hotmail.com
Received/Geliş tarihi: February 05, 2015
Accepted/Kabul tarihi: May 04, 2015
93

Koluman A, et al: Antibacterial Activities of Ankaferd Hemostat
Turk J Hematol 2017;34:93-98
Introduction
Ankaferd hemostat [Ankaferd Blood Stopper ® , (ABS)]; http://
www.ncbi.nlm.nih.gov/pubmed/?term=ankaferd) is the first
topical hemostatic agent regarding red blood cell (RBC)-
fibrinogen interactions tested in clinical trials [1]. ABS is
composed of standardized plant extracts including Alpinia
officinarum, Glycyrrhiza glabra, Thymus vulgaris, Urtica dioica,
and Vitis vinifera [2]. ABS-induced pharmacological modulation
of essential erythroid proteins (ankyrin, spectrin, actin) can cause
vital erythroid aggregation by acting on fibrinogen gamma [3].
ABS also has pleiotropic effects, particularly in tissue healing,
and has significant antiinfective properties [4,5,6,7,8]. The use
of ABS in gastrointestinal (GI) system hemorrhages to control
bleeding and/or infected GI wounds is also evident [9].
Escherichia coli O157:H7, the predominant serotype of
enterohemorrhagic E. coli (EHEC), is a cause of both outbreaks
and sporadic cases of hemorrhagic colitis [10]. Infection with
E. coli O157:H7 presents with many complicated clinically
abnormal hemostatic manifestations such as bloody diarrhea,
hemolytic-uremic syndrome, or thrombotic thrombocytopenic
purpura [11].
The aim of this study is to determine the effects of ABS on 6
different Shiga toxigenic E. coli (STEC) serotypes including O26,
O103, O104, O111, O145, and O157. Moreover, the effects of
ABS on other pathogens significant in foodborne diseases, such
as Salmonella Typhimurium, Campylobacter jejuni, and Listeria
monocytogenes, were also assessed. Elucidation of the effects
of ABS on enterohemorrhagic bacteria is clinically important
since there is a close pathobiological interrelationship between
hemorrhages and hemostasis in terms of both diagnosis and
management.
Materials and Methods
Thirty milliliters of ABS (Immune Drug Company, İstanbul,
Turkey) was transferred to the laboratory under cold chain in
a residue-free sterile tube. The sample was used for analyses
within 30 min of arrival. Six different STEC serotypes, including
O26, O103, O104, O111, O145, and O157 ATCC 43895 (obtained
from Istituto Superiore di Sanita, Rome, and the Public Health
Institution of Turkey), and Salmonella typhimurium ATCC
14028 (Microbiologics, UK), Campylobacter jejuni ATCC 33560
(Microbiologics, UK), and Listeria monocytogenes ATCC 19115
(Microbiologics, UK) were used in this study in order to assess
the effects of ABS.
The cultures were stored at -80 °C. After thawing on ice,
each strain (excluding Campylobacter jejuni) was incubated
separately in 5x10 mL of brain-heart infusion (BHI) broth
(Oxoid, UK) at 37 °C overnight. The cultures were passaged
in BHI 3 times. The final cultures (5x10 mL) were centrifuged
(Eppendorf) at 4200 rpm and 4 °C for 5 min. The supernatants
were discarded, and pellets were resuspended and washed with
10 mL of sterile 0.9% NaCl. After washing, all suspensions were
recentrifuged to remove organic residues. The resulting pellets
were resuspended using sterile normal saline, and all strains
were collected separately in a single tube. This stock culture was
further diluted with 50 mL of sterile BHI broth to achieve a
target level of 10 7 to 10 8 cfu/mL, which is accepted as sufficient
for decontamination studies.
Campylobacter jejuni was streaked on 10 plates with charcoal
cefoperazone deoxycholate modified agar (Oxoid, UK) with a
sterile swab and incubated under microaerophilic conditions
(Campygen, Oxoid, UK) at 42 °C for 48 h. The grayish colonies were
collected into a centrifuge tube with a swab and the mixtures
were centrifuged (Eppendorf) at 4200 rpm and 4 °C for 5 min.
The supernatants were discarded, and pellets were resuspended
and washed with 10 mL of sterile 0.9% NaCl. After washing,
all pellets were recentrifuged to remove organic residues. The
resulting pellets were resuspended using sterile normal saline,
and all strains were collected separately in a single tube. This
stock culture was further diluted with 50 mL of sterile Bolton
broth (Oxoid, UK) to achieve a target level of 10 7 to 10 8 cfu/mL,
which is accepted as sufficient for decontamination studies. All
tubes were labeled and grouped into 2 separate groups. Tubes
in group 1 were inoculated with 500 µL of ABS (per 50 mL,
1% v/v), and tubes in group 2 were inoculated with 1000 µL
of ABS (per 50 mL, 2% v/v). All tubes were incubated at 37
°C under microaerophilic conditions to demonstrate the gut
conditions, and samplings from these tubes were made at 5, 15,
30, and 60 min after inoculation. Next, 100 µL of these mixtures
were spread-plated using a Spiral Plater (IUL, UK) on duplicate
petri dishes of xylose lysine deoxycholate agar (Oxoid, UK)
for Salmonella; MacConkey agar with sorbitol, cefixime, and
tellurite agar (Oxoid, UK) for STEC; and chromogenic Listeria
agar (Oxoid, UK) for L. monocytogenes and incubated at 37
°C aerobically for 24 h for all strains except Campylobacter
jejuni, which was incubated under microaerophilic conditions
(Campygen, Oxoid, UK) at 42 °C for 48 h. At the end of incubation
period all typical colonies were counted and recorded.
S. Typhimurium groups were screened for survival using the
fluorescence in situ hybridization (FISH) technique. Vermicon
kits were used for this step. The study was composed of 3
independent trials and 9 tubes were analyzed at each step.
The numbers of pathogens were converted to log 10
cfu/g. The
data were subjected to one-way analysis of variance (ANOVA)
according to a (pathogen x treatment) 9x2 factorial design. The
means were separated using Fisher’s least square differences
method according to general linear models. Statistical
significance level was accepted as 0.05. Statistical analyses were
performed using Statistical Analysis System Software version 8
(SAS Inc., USA).
94

Turk J Hematol 2017;34:93-98
Koluman A, et al: Antibacterial Activities of Ankaferd Hemostat
Results
The results indicating the effects of ABS on the studied
bacteria are depicted in Tables 1 and 2. The relative efficacy of
ABS solutions to achieve significant logarithmic reduction in
foodborne pathogens E. coli O157:H7 and non-O157 serogroups
and other emerging foodborne pathogens is also presented in
Tables 1 and 2. According to the tables, 1% (v/v) application
of ABS is not sufficient to obtain a significant decrease in the
numbers of pathogens. On the contrary, 2% (v/v) application
causes a dramatic decrease of the pathogens of concern. It was
shown that by the end of the 60 th minute of application 2%
(v/v) ABS causes a 4 log 10
cfu/mL decrease, which was significant
for all pathogens. The most significant decrease was recorded in
Campylobacter jejuni, which is known for higher susceptibility
to environmental and chemical changes.
In Figure 1, photographs of two different applications on S.
Typhimurium are provided. In the first group it can be clearly seen
that sterile distilled water application had no effect on the survival
of the pathogen. On the contrary, the second group of images
clearly indicates the death of the pathogens with 2 mL of ABS.
Figure 1. Effect of Ankaferd Blood Stopper, (ABS) on survival of
S. Typhimurium (fluorescence in situ hybridization technique
using Vermicon kit): a) Survival of S. Typhimurium with 2 mL of
sterile distilled water at 37 °C. There is no visible change. Plating
of the homogenate indicates the stability in the viable counts. b)
Survival of S. Typhimurium with 2 mL of ABS at 37 °C. There is 3
log 10 cfu/mL decrease, which indicates a statistical significance.
Table 1. The Shiga toxigenic Escherichia coli results of the study in group 1 (sterile distilled water application) and group 2
[Ankaferd hemostat (ABS) application].
Group 1
STEC
Time (min)
0 5 15 30 60
O103 7.74±0.03 A 7.47±0.29 A 7.38±0.53 A 6.65±0.15 B 5.59±0.28 C
O104 7.65±0.04 A 7.49±0.18 A 7.41±0.38 A 6.60±0.30 B 5.64±0.24 C
O111 7.92±0.03 A 7.72±0.19 A 7.33±0.49 A 6.68±0.12 B 5.58±0.23 C
O145 7.85±0.03 A 7.59±0.29 A 7.34±0.52 A 6.51±0.51 B 5.68±0.21 C
O157 7.84±0.02 A 7.59±0.27 A 7.27±0.27 AB 6.70±0.17 B 5.51±0.24 C
O26 7.63±0.33 A 7.58±0.26 A 7.46±0.39 A 6.53±0.24 B 5.51±0.21 C
Group 2
STEC
Time (min)
0 5 15 30 60
O103 7.75±0.03 A 6.83±0.07 B 6.48±0.33 B 5.14±0.40 C 3.45±0.23 D
O104 7.74±0.09 A 6.62±0.26 B 6.11±0.23 B 4.96±0.70 C 3.55±0.26 D
O111 7.92±0.02 A 6.77±0.15 B 6.09±0.34 B 4.93±0.38 C 3.41±0.19 D
O145 7.83±0.02 A 6.61±0.24 B 6.12±0.18 B 5.16±0.33 C 3.43±0.30 D
O157 7.83±0.03 A 6.49±0.30 B 6.11±0.26 B 5.32±0.34 C 3.43±0.27 D
O26 7.86±0.03 A 6.62±0.19 B 6.28±0.19 B 5.06±0.59 C 3.57±0.21 D
ABCD: These legends are applied to show statistical difference between results shown in the same column (vertical difference) (p

Koluman A, et al: Antibacterial Activities of Ankaferd Hemostat
Turk J Hematol 2017;34:93-98
Table 2. The in vitro results regarding Salmonella Typhimurium, Listeria monocytogenes, and Campylobacter jejuni in group 1
(sterile distilled water application) and group 2 [Ankaferd hemostat (ABS) application].
S. Typhimurium
Volume of ABS Applied
Time (min)
0 5 15 30 60
Group 1 7.85±0.04 AX 7.70±0.18 AX 7.35±0.29 ABX 6.77±0.10 BX 5.60±0.25 CX
Group 2 7.82±0.09 AX 6.62±0.24 BY 5.94±0.34 CY 5.08±0.46 DY 3.33±0.43 EY
Listeria monocytogenes
Volume of ABS Applied
Time (min)
0 5 15 30 60
Group 1 7.94±0.04 AX 7.80±0.16 AX 7.40±0.51 AX 6.25±0.36 BX 5.52±0.29 BX
Group 2 7.94±0.02 AX 6.58±0.26 BY 6.01±0.50 BY 4.65±0.13 CY 3.65±0.33 DY
Campylobacter jejuni
Volume of ABS Applied
Time (min)
0 5 15 30 60
Group 1 7.23±0.02 AX 6.93±0.10 AX 6.65±0.34 ABX 6.04±0.21 BX 5.48±0.30 BX
Group 2 7.25±0.03 AX 6.55±0.29 BX 5.59±0.38 CY 4.51±0.76 DY 2.56±0.35 EY
ABCDE: These legends are applied to show statistical difference between results shown in the same column (vertical difference) (p

Turk J Hematol 2017;34:93-98
Koluman A, et al: Antibacterial Activities of Ankaferd Hemostat
that ABS is effective in wound healing [39,42,43,44,45,46,47].
The results of our present study disclosed that ABS has
antimicrobial effects against bacteria that are active in wound
and burn complications.
The use of plant extracts and phytochemicals with established
antimicrobial properties could be of great significance in
preventive and/or therapeutic approaches. The increasing
prevalence of multidrug-resistant strains of bacteria and
the recent appearance of strains with reduced susceptibility
to antibiotics raised the specter of “untreatable” bacterial
infections and adds urgency to the search for new infectionfighting
strategies. Besides broad-spectrum activity against
gram-positive and gram-negative bacteria, including human
pathogens and food-spoilage bacteria, ABS was found to
be more stable than nisin in different heat and enzyme
treatments by Akkoç et al. [5,48]. Furthermore, as indicated
by Akkoç et al., the antibacterial activity of ABS can proceed
in extreme environmental conditions such as the potential
use of the preparation for the therapy of infectious diseases
and preservation of different types of foods from foodborne
pathogens or food-spoilage bacteria [5,48]. Our present results
support the idea that the antiinfective properties of ABS should
be tested in in vivo experiments [4,5,6,7,8].
The mechanism of action regarding the antiinfective actions
of ABS is currently unknown. Several proteins (Homo sapiens
malic enzyme 1, dynactin 5, cofilin, utrophin, mucin16 (CD164-
sialomucin-like-2 protein), chalcone flavanone isomerase 1,
chalcone flavanone isomerase 2, helezonal bundle transporter
protein-141, hypothetical protein LOC283638 isoform 1,
hypothetical protein LOC283638 isoform 2, complex 1
intermedia related protein 30) in ABS functional proteomic
analyses represent an important step to elucidate how ABS
biologically affects the components of numerous pathogens
[41]. Comparative molecular studies covering proteomics,
genomics, transcriptomics, and metabolomics of ABS are
essentially important to shed light on this extremely vital area.
Conclusion
The pleiotropic effects of ABS on the vascular endothelium, blood
cells, angiogenesis, cellular proliferation, vascular dynamics,
and cellular mediators should be investigated to determine its
potential role in many pathological states, including infectious
diseases, wound healing, and inflammation. ABS, as a unique
hemostatic agent within many crossroads of hemostasis,
infection, and neoplasia, casts future experimental and clinical
research to be placed into clinical management.
Ethics
Ethics Committee Approval: Is not needed for microbiological
studies; Informed Consent: Not needed in this study.
Authorship Contributions
Microbiological Analyses: Ahmet Koluman; Concept: Ahmet
Koluman, Nejat Akar, İbrahim C. Haznedaroğlu; Design:
Ahmet Koluman, Nejat Akar, İbrahim C. Haznedaroğlu; Data
Collection or Processing: Ahmet Koluman, Nejat Akar, İbrahim
C. Haznedaroğlu; Analysis or Interpretation: Ahmet Koluman,
Nejat Akar, İbrahim C. Haznedaroğlu; Literature Search: Ahmet
Koluman, Nejat Akar, İbrahim C. Haznedaroğlu; Writing: Ahmet
Koluman, Nejat Akar, İbrahim C. Haznedaroğlu.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Haznedaroglu BZ, Beyazit Y, Walker SL, Haznedaroglu IC. Pleiotropic cellular,
hemostatic, and biological actions of Ankaferd hemostat. Crit Rev Oncol
Hematol 2012;83:21-34.
2. Beyazit Y, Kurt M, Kekilli M, Goker H, Haznedaroglu IC. Evaluation of
hemostatic effects of Ankaferd as an alternative medicine. Altern Med Rev
2010;15:329-336.
3. Ozel-Demiralp D, İğci N, Ayhan B, Eğin Y, Haznedaroglu IC, Akar N.
Prohemostatic and antithrombin activities of Ankaferd hemostat are linked
to fibrinogen gamma chain and prothrombin by functional proteomic
analyses. Clin Appl Thromb Hemost 2012;18:604-610.
4. Deveci A, Çoban AY, Tanrıverdi Çaycı Y, Acicbe Ö, Taşdelen Fışgın N, Akgüneş
A, Ozatlı D, Uzun M, Durupınar B. In vitro effect of Ankaferd Blood Stopper®,
a plant extract against Mycobacterium tuberculosis isolates. Mikrobiyol Bul
2013;47:71-78.
5. Akkoç N, Akçelik M, Haznedaroğlu İC, Göker H, Turgut M, Aksu S, Kirazlı
Ş, Fırat HC. In vitro anti-bacterial activities of Ankaferd medicinal plant
extract. Turkiye Klinikleri J med Sci 2009;29:410-415.
6. Ciftci S, Keskin F, Keceli Ozcan S, Erdem MA, Cankaya B, Bingol R, Kasapoglu
C. In vitro antifungal activity of Ankaferd Blood Stopper against Candida
albicans. Curr Ther Res Clin Exp 2011;72:120-126.
7. Tasdelen Fisgin N, Tanriverdi Cayci Y, Coban AY, Ozatli D, Tanyel E, Durupinar
B, Tulek N. Antimicrobial activity of plant extract Ankaferd Blood Stopper®.
Fitoterapia 2009;80:48-50.
8. Saribas Z, Sener B, Haznedaroglu IC, Hascelik G, Kirazli S, Goker H.
Antimicrobial activity of Ankaferd Blood Stopper® against nosocomial
bacterial pathogens. Cent Eur J Med 2010;5:198-202.
9. Beyazit Y, Kekilli M, Haznedaroglu IC, Kayacetin E, Basaranoglu M. Ankaferd
hemostat in the management of gastrointestinal hemorrhages. World J
Gastroenterol 2011;17:3962-3970.
10. Cohen MB, Giannella RA. Hemorrhagic colitis associated with Escherichia
coli O157:H7. Adv Intern Med 1992;37:173-195.
11. Su C, Brandt LJ. Escherichia coli O157:H7 infection in humans. Ann Intern
Med 1995;123:698-714.
12. Barkun AN, Moosavi S, Martel M. Topical hemostatic agents: a systematic
review with particular emphasis on endoscopic application in GI bleeding.
Gastrointest Endosc 2013;77:692-700.
13. Beyazit Y, Kekilli M, Kurt M, Sayilir A, Haznedaroglu IC. Ankaferd hemostat
for the management of tumoral GI bleeding. Gastrointest Endosc
2011;73:1072-1073.
14. Boškoski I, Familiari P, Costamagna G. New and emerging endoscopic
therapies for gastrointestinal bleeding. Curr Opin Gastroenterol
2014;30:439-443.
97

Koluman A, et al: Antibacterial Activities of Ankaferd Hemostat
Turk J Hematol 2017;34:93-98
15. Jacques J, Legros R, Chaussade S, Sautereau D. Endoscopic haemostasis: an
overview of procedures and clinical scenarios. Digest Liver Dis 2014;46:766-776.
16. Karaman A, Baskol M, Gursoy S, Torun E, Yurci A, Çelikbilek M, Guven K,
Ozbakir O, Yucesoy M. Endoscopic topical application of Ankaferd Blood
Stopper® in gastrointestinal bleeding. J Altern Complem Med 2012;18:65-
68.
17. Kurt M, Akdogan M, Onal IK, Kekilli M, Arhan M, Shorbagi A, Aksu S, Kurt
OK, Haznedaroglu IC. Endoscopic topical application of Ankaferd Blood
Stopper for neoplastic gastrointestinal bleeding: a retrospective analysis.
Digest Liver Dis 2010;42:196-199.
18. Kurt M, Disibeyaz S, Akdogan M, Sasmaz N, Aksu S, Haznedaroglu IC.
Endoscopic application of Ankaferd blood stopper as a novel experimental
treatment modality for upper gastrointestinal bleeding: a case report. Am J
Gastroenterol 2008;103:2156-2158.
19. Kurt M, Onal I, Akdogan M, Kekilli M, Arhan M, Sayilir A, Oztas E,
Haznedaroglu I. Ankaferd Blood Stopper for controlling gastrointestinal
bleeding due to distinct benign lesions refractory to conventional
antihemorrhagic measures. Can J Gastroenterol 2010;24:380-384.
20. Ozaslan E, Purnak T, Haznedaroglu IC. Ankaferd Blood Stopper in GI
bleeding: alternative for everything? Gastrointest Endosc 2011;73:185-186.
21. Ozaslan E, Purnak T, Yildiz A, Haznedaroglu IC. A new candidate as a
hemostatic agent for difficult situations during variceal bleeding: Ankaferd
Blood Stopper. Saudi J Gastroenterol 2011;17:145-148.
22. ASGE Technology Committee, Wong Kee Song LM, Banerjee S, Barth BA,
Bhat Y, Desilets D, Gottlieb KT, Maple JT, Pfau PR, Pleskow DK, Siddiqui
UD, Tokar JL, Wang A, Rodriguez SA. Emerging technologies for endoscopic
hemostasis. Gastrointest Endosc 2012;75:933-937.
23. Yarali N, Oruc M, Bay A, Dalgıc B, Bozkaya IO, Arıkoglu T, Kara A, Tunc
B. Correction to: A new haemostatic agent—Ankaferd Blood Stopper:
management of gastrointestinal bleeding in an infant and other experiences
in children. Pediatr Hemal Oncol 2014;31:107.
24. Wan CS, Zhou Y, Yu Y, Peng LJ, Zhao W, Zheng XL. B-cell epitope KT-12
of enterohemorrhagic Escherichia coli O157:H7: a novel peptide vaccine
candidate. Microbiol Immunol 2011;55:247-253.
25. Griffin PM, Ostroff SM, Tauxe RV, Greene KD, Wells JG, Lewis JH, Blake
PA. Illnesses associated with Escherichia coli O157:H7 infections. A broad
clinical spectrum. Ann Intern Med 1988;109:705-712.
26. Aslan E, Akyüz Ü, Pata C. The use of Ankaferd in diverticular bleeding: two
case reports. Turk J Gastroenterol 2013;24:441-443.
27. Beyazit Y, Köklü S, Akbal E, Kurt M, Kekilli M, Haznedaroglu IC. Successful
treatment of endoscopic sphincterotomy-induced early hemorrhage with
application of Ankaferd Blood Stopper. Gastrointest Endosc 2010;72:1325-
1326.
28. Beyazit Y, Kurt M, Sayilir A, Suvak B, Ozderin YO. Successful application of
Ankaferd Blood Stopper in a patient with lower gastrointestinal bleeding.
Saudi J Gastroenterol 2011;17:424-425.
29. Beyazit Y, Onder FO, Torun S, Tas A, Purnak T, Tenlik I, Turhan N. Topical
application of Ankaferd hemostat in a patient with gastroduodenal
amyloidosis complicated with gastrointestinal bleeding. Blood Coagul
Fibrinolysis 2013;24:762-765.
30. Kurt M, Akdogan M, Ibis M, Haznedaroglu IC. Ankaferd Blood Stopper for
gastrointestinal bleeding. J Invest Surg 2010;23:239.
31. Kurt M, Oztas E, Kuran S, Onal IK, Kekilli M, Haznedaroglu IC. Tandem oral,
rectal, and nasal administrations of Ankaferd Blood Stopper to control
profuse bleeding leading to hemodynamic instability. Am J Emerg Med
2009;27:631.
32. Ozaslan E, Purnak T, Yildiz A, Haznedaroglu IC. A new practical alternative
for tumoural gastrointestinal bleeding: Ankaferd blood stopper. Digest Liver
Dis 2010;42:594-595.
33. Ozaslan E, Purnak T, Yildiz A, Haznedaroglu IC. The effect of a new hemostatic
agent for difficult cases of non-variceal gastrointestinal bleeding: Ankaferd
Blood Stopper. Hepatogastroenterology 2010;57:191-194.
34. Ozseker B, Shorbagi A, Efe C, Haznedaroglu IC, Bayraktar Y. Controlling
of upper gastrointestinal bleeding associated with severe immune
thrombocytopenia via topical adjunctive application of Ankaferd blood
stopper. Blood Coagul Fibrinolysis 2012;23:464.
35. Purnak T, Ozaslan E, Beyazit Y, Haznedaroglu IC. Upper gastrointestinal
bleeding in a patient with defective hemostasis successfully treated with
Ankaferd Blood Stopper. Phytother Res 2011;25:312-313.
36. Shorbagi A, Sivri B. Successful management of a difficult case of radiation
proctopathy with Ankaferd Blood Stopper: a novel indication (with video).
Gastrointest Endosc 2010;72:666-667.
37. Ozaslan E, Purnak T, Özyigit G, Akyol F, Yildiz A, Haznedaroglu IC. No
prolonged effect of Ankaferd Blood Stopper on chronic radiation proctitis.
Endoscopy 2010;42:E271-E272.
38. Ozaslan E, Purnak T, Yildiz A, Akar T, Avcioglu U, Haznedaroglu IC. The
effect of Ankaferd blood stopper on severe radiation colitis. Endoscopy
2009;41:E321-E322.
39. Aktaş A, Er N, Korkusuz P, Zeybek D, Onur MA, Tan G, Özdemir O,
Karaismailoğlu E, Karabulut E. Ankaferd-induced early soft tissue wound
healing in an experimental rat model. Turkiye Klinikleri J Med Sci
2013;33:1344-1353.
40. Huri E, Beyazit Y, Mammadov R, Toksoz S, Tekinay AB, Guler MO, Ustun H,
Kekilli M, Dadali M, Celik T, Astarci M, Haznedaroglu IC. Generation of chimeric
“ABS Nanohemostat” complex and comparing its histomorphological in vivo
effects to the traditional Ankaferd hemostat in controlled experimental
partial nephrectomy model. Int J Biomater 2013;2013:949460.
41. Özel Demiralp D, Haznedaroğlu İC, Akar N. Functional proteomic analysis of
Ankaferd® Blood Stopper. Turk J Hematol 2010;27:70-77.
42. Akalin C, Kuru S, Barlas AM, Kismet K, Kaptanoglu B, Demir A, Astarci HM,
Ustun H, Ertas E. Beneficial effects of Ankaferd Blood Stopper on dermal
wound healing: an experimental study. Int Wound J 2014;11:64-68.
43. Cancan G, Teksoz S, Aytac E, Arikan AE, Erman H, Uzun H, Ozden F, Aydin O,
Ozcan M. Effects of Ankaferd on anastomotic healing of colon. J Invest Surg
2014;27:1-6.
44. İşler SC, Demircan S, Cakarer S, Cebi Z, Keskin C, Soluk M, Yüzbaşioğlu E.
Effects of folk medicinal plant extract Ankaferd Blood Stopper® on early
bone healing. J Appl Oral Sci 2010;18:409-414.
45. Kaya H, Gokdemir MT, Sogut O, Demir T, Koçarslan S. Effects of folk
medicinal plant extract Ankaferd Blood Stopper on burn wound healing.
Acta Medica Mediterr 2013;29:497-502.
46. Tek M, Akkas I, Toptas O, Ozan F, Sener I, Bereket C. Effects of the topical
hemostatic agent Ankaferd Blood Stopper on the incidence of alveolar
osteitis after surgical removal of an impacted mandibular third molar. Niger
J Clin Pract 2014;17:75-80.
47. Yüce S, Çandirli C, Yenidünya S, Muslu B. New hemostatic agent: the effect
of Ankaferd Blood Stopper on healing wounds in experimental skin incision
model. Turk J Med Sci 2014;44:288-294.
48. Akkoç N, Akçelik M, Haznedaroglu I, Goker H, Aksu S, Kirazli S, Fırat HC. In
vitro anti-bacterial activities of Ankaferd blood stopper. Int J Lab Hematol
2008;30:95.
98

LETTERS TO THE EDITOR
Turk J Hematol 2017;34:99-117
Wernicke’s Encephalopathy in a Child with Acute Lymphoblastic
Leukemia
Akut Lenfoblastik Lösemili Bir Çocuk Hastada Wernicke Ensefalopatisi
Hande Kızılocak 1 , Gül Nihal Özdemir 1 , Gürcan Dikme 1 , Zehra Işık Haşıloğlu 2 , Tiraje Celkan 1
1İstanbul University Cerrahpaşa Faculty of Medicine, Department of Pediatric Hematology-Oncology, İstanbul, Turkey
2İstanbul University Cerrahpaşa Faculty of Medicine, Department of Radiology, İstanbul, Turkey
To the Editor,
We read with great interest the article “A rare complication
developing after hematopoietic stem cell transplantation:
Wernicke’s encephalopathy” by Solmaz et al. [1]. Wernicke’s
encephalopathy (WE) is an acute syndrome requiring emergent
treatment to prevent death and neurologic morbidity [2]. While
most often associated with alcoholism, WE also occurs in the setting
of prolonged intravenous feeding without adequate thiamine
supplementation, prolonged starvation or unbalanced nutrition,
gastrointestinal surgery, systemic malignancy, and transplantation
[3]. The classic triad of WE includes encephalopathy, oculomotor
dysfunction, and gait ataxia. In their article, Solmaz et al. reported
a patient who developed WE following hematopoietic stem cell
transplantation (HSCT) and they concluded that this was due to
prolonged total parental supplementation and lack of thiamine
supplementation. The only other suggested cause was the
use of busulfan in the conditioning regimen. In the literature
there is a link of WE to HSCT, malignancies, or chemotherapies.
Here we report a new patient who developed WE during acute
lymphoblastic leukemia (ALL) treatment.
A 13-year-old female patient diagnosed with intermediate risk group
ALL developed severe neutropenia after a high-dose methotrexate
block and oral Purinethol (BFM protocol M). Ceftazidime and
fluconazole treatment was started due to fever. After 3 days the
patient had poor oral intake and received total parenteral nutrition
(TPN) containing protein and dextrose. On the 6 th day of TPN
she had fever, abdominal pain, nausea, and bilious vomiting. Her
abdominal ultrasound revealed typhlitis. Ceftazidime-fluconazole
treatment was switched to meropenem and L-amphotericin and oral
intake was stopped. On the 8 th day of TPN, the patient developed
confusion, altered mental status, horizontal nystagmus, and lateral
gaze paralysis in the right eye. Her brain computed tomography
(CT) was normal. However, brain magnetic resonance imaging (MRI)
showed increased signal in the bilateral thalamic pulvinar and
mammillary bodies in the axial fluid-attenuated inversion recovery
(FLAIR) sequence (Figure 1). These were concluded to be classic
findings of WE [4]. Intramuscular thiamine at 200 mg three times a
day for the first 3 days (600 mg/day total), 100 mg two times a day
for the next 3 days (200 mg/day total), and 100 mg thiamine daily
for the last 3 days was given. A rapid improvement of neurologic
symptoms was observed on the third day of thiamine treatment.
The patient’s thiamine level was 55 mg/L and 125 mg/L before and
after the treatment, respectively (normal range: 25-75 mg/L). She
was discharged from the hospital with good oral intake and normal
neurological examination.
Figure 1. Increased signal in the bilateral thalamic pulvinar
and mammillary bodies in the axial fluid-attenuated inversion
recovery sequence.
99

LETTERS TO THE EDITOR
Turk J Hematol 2017;34:99-117
WE is primarily a clinical diagnosis. Response to treatment may
be diagnostic. The sensitivity and specificity of serum thiamine
level in symptomatic patients is unclear, as the blood level may
not reflect the brain thiamine level. A normal blood thiamine
level, as in our patient, does not exclude the possibility of WE
with MRI findings [5]. MRI is more sensitive than CT in WE [6]. In
conclusion, all at-risk patients with undiagnosed altered mental
status, oculomotor disorders, or ataxia must be evaluated for
WE. Further studies are needed for examining the possible role
of chemotherapeutics in the development of WE.
Keywords: Wernicke’s encephalopathy, Thiamine deficiency,
Pediatric leukemia
Anahtar Sözcükler: Wernicke ensefalopatisi, Tiamin eksikliği,
Pediatrik lösemi
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Solmaz S, Gereklioğlu Ç, Tan M, Demir Ş, Yeral M, Korur A, Boğa C,
Özdoğu H. A rare complication developing after hematopoietic stem cell
transplantation: Wernicke’s encephalopathy. Turk J Hematol 2015;32:367-
370.
2. Park SW, Yi YY, Han JW, Kim HD, Lee JS, Kang HC. Wernicke’s encephalopathy
in a child with high dose thiamine therapy. Korean J Pediatr 2014;57:496-
499.
3. Parkin AJ, Blunden J, Rees JE, Hunkin NM. Wernicke-Korsakoff syndrome of
nonalcoholic origin. Brain Cogn 1991;15:69-82.
4. Beh SC, Frohman TC, Frohman EM. Isolated mammillary body involvement
on MRI in Wernicke’s encephalopathy. J Neurol Sci 2013;334:172-175.
5. Davies SB, Joshua FF, Zagami AS. Wernicke’s encephalopathy in a nonalcoholic
patient with a normal blood thiamine level. Med J Aust
2011;194:483-484.
6. Elefante A, Puoti G, Senese R, Coppolo C, Russo C, Tortoro F, de Divitiis O,
Brunetti A. Non-alcoholic acute Wernicke’s encephalopathy: role of MRI in
non typical cases. Eur J Radiol 2012;81:4099-4104.
Address for Correspondence/Yazışma Adresi: Hande KIZILOCAK, M.D.,
İstanbul University Cerrahpaşa Faculty of Medicine, Department of Pediatric Hematology-Oncology,
İstanbul, Turkey Phone : +90 533 648 21 88
E-mail : handekizilocak2@yahoo.com
Received/Geliş tarihi: January 25, 2016
Accepted/Kabul tarihi: September 06, 2016
DOI: 10.4274/tjh.2016.0044
Comment: In Response to “Megaloblastic Anemia with Ring
Sideroblasts is not Always Myelodysplastic Syndrome”
Yorum: “Halka Sideroblastlı Megaloblastik Anemi Her Zaman Miyelodisplastik Sendrom
Olmayabilir”e Yanıt
Smeeta Gajendra
Medanta-the Medicity, Department of Pathology and Laboratory Medicine, Gurgaon, India
To the Editor,
I read the letter “Megaloblastic Anemia with Ring Sideroblasts is
not Always Myelodysplastic Syndrome” by Narang et al., recently
published in this journal [1]. The manuscript is well written
with a description of a very informative case of megaloblastic
anemia with ring sideroblasts in a young female of 18 years
old. Ring sideroblasts are associated with abnormal expression
of several genes of heme synthesis or mitochondrial iron
processing [2]. After exclusion of non-neoplastic causes of ring
sideroblasts such as congenital/hereditary sideroblastic anemia
and acquired reversible sideroblastic anemia (drugs, toxins, or
nutritional deficiency), myelodysplastic syndrome (MDS) can be
strongly suspected, particularly in elderly patients. The presence
of ring sideroblasts alone is not sufficient for a diagnosis
MDS; the presence of refractory cytopenia(s) is a prerequisite.
Refractoriness can only be established after exclusion of
secondary causes, most importantly nutritional deficiencies.
After that, a complete evaluation of the erythroid, myeloid,
and megakaryocytic lineages of bone marrow is essential. At
least 15% ring sideroblasts are required for the diagnosis of
MDS with ring sideroblasts (MDS-RS) in cases lacking mutations
in the spliceosome gene SF3B1. SF3B1 mutations are found
in 60%-80% of patients with refractory anemia with ring
sideroblasts (RARS) or RARS with thrombocytosis (RARS-T) and
are associated with favorable prognosis [3]. In the recent World
Health Organization (WHO) 2016 classification, cases with ring
sideroblasts and multilineage dysplasia without excess blasts or
isolated del (5q) abnormality are categorized as MDS-RS. Recent
100

Turk J Hematol 2017;34:99-117
LETTERS TO THE EDITOR
studies have shown that the percentage of ring sideroblasts
in MDS is not prognostically important. Thus, in the revised
WHO classification, a diagnosis of MDS-RS may be made even
in the presence of only 5% of ring sideroblasts in cases with
SF3B1 mutation. MDS-RS cases will be subdivided into cases
with single lineage dysplasia (previously classified as RARS)
and cases with multilineage dysplasia (previously classified as
refractory cytopenia with multilineage dysplasia). Furthermore,
RARS-T has been accepted as an entity and termed MDS/
myeloproliferative neoplasm (MPN) with ring sideroblasts and
thrombocytosis (MDS/MPN-RS-T) in the 2016 classification.
Unlike MDS-RS, the number of ring sideroblasts required for a
diagnosis of MDS/MPN-RS-T is 15%, irrespective of the presence
or absence of a SF3B1 mutation [4]. As described in the case
of Narang et al., in a young female of 18 years old without a
history of persistent refractory cytopenia(s), a diagnosis of MDS
can only be established after exclusion of secondary causes such
as nutritional deficiencies [1]. An adequate trial with hematinics
(vitamin B12, folic acid, and pyridoxine) is needed in such cases.
After exclusion of secondary causes, if cytopenia(s) still persists,
a repeat bone marrow examination with cytogenetic and
molecular studies can be considered to establish the diagnosis
of a clonal hematopoietic disease such as MDS or MDS/MPN.
Keywords: Refractory anemia with ring sideroblasts, RARS with
thrombocytosis, Myelodysplastic syndrome/myeloproliferative
neoplasm with ring sideroblasts and thrombocytosis
Anahtar Sözcükler: Halka sideroblastlı refrakter anemi,
Trombositoz ile birlikte RARS, Halka sideroblast ve trombositoz
ile birlikte miyelodisplastik sendrom/miyeloproliferatif neoplazi
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Narang NC, Kotru M, Rao K, Sikka M. Megaloblastic anemia with ring
sideroblasts is not always myelodysplastic syndrome. Turk J Hematol
2016;33:358-359.
2. Cazzola M, Invernizzi R. Ring sideroblasts and sideroblastic anemias.
Haematologica 2011;96:789-792.
3. Papaemmanuil E, Cazzola M, Boultwood J, Malcovati L, Vyas P, Bowen D,
Pellagatti A, Wainscoat JS, Hellstrom-Lindberg E, Gambacorti-Passerini C,
Godfrey AL, Rapado I, Cvejic A, Rance R, McGee C, Ellis P, Mudie LJ, Stephens
PJ, McLaren S, Massie CE, Tarpey PS, Varela I, Nik-Zainal S, Davies HR, Shlien
A, Jones D, Raine K, Hinton J, Butler AP, Teague JW, Baxter EJ, Score J, Galli
A, Della Porta MG, Travaglino E, Groves M, Tauro S, Munshi NC, Anderson KC,
El-Naggar A, Fischer A, Mustonen V, Warren AJ, Cross NC, Green AR, Futreal
PA, Stratton MR, Campbell PJ; Chronic Myeloid Disorders Working Group of
the International Cancer Genome Consortium. Somatic SF3B1 mutation in
myelodysplasia with ring sideroblasts. N Engl J Med 2011;365:1384-1395.
4. Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM,
Bloomfield CD, Cazzola M, Vardiman JW. The 2016 revision to the World
Health Organization classification of myeloid neoplasms and acute
leukemia. Blood 2016;127:2391-2405.
Address for Correspondence/Yazışma Adresi: Smeeta GAJENDRA, M.D.,
Medanta-the Medicity, Department of Pathology and Laboratory Medicine, Gurgaon, India
Phone : +09013590875
E-mail : drsmeeta@gmail.com
Received/Geliş tarihi: December 02, 2016
Accepted/Kabul tarihi: December 06, 2016
DOI: 10.4274/tjh.2016.0466
Therapeutic International Normalized Ratio Monitoring
Terapötik Uluslararası Normalleştirilmiş Oran İzlemi
Beuy Joob 1 , Viroj Wiwanitkit 2
1Sanitation 1 Medical Academic Center, Bangkok, Thailand
2Hainan Medical University, Haikou, China
To the Editor,
The report on “Warfarin dosing and time required to reach
therapeutic international normalized ratio in patients with
hypercoagulable conditions” was very interesting [1]. Kahlon
et al. concluded that “Patients with hypercoagulable conditions
require approximately 10 mg of additional total warfarin dose
and also require, on average, 2 extra days to reach therapeutic
international normalized ratio (INR) as compared to controls.”
The big concern in this report regards the technique used for INR
measurement. Kahlon et al. did not mention this and might not
have noted the problem of measurement of INR in the followup
of the patient. The quality control of the measurement is
very important and measurements from different laboratory
techniques and settings can be a factor leading to error in
laboratory results [2,3]. It is noted that the local calibration
in correcting the variability in INR determination and the
difference between batches has to be controlled [4].
101

LETTERS TO THE EDITOR
Turk J Hematol 2017;34:99-117
Keywords: Monitoring, International normalized ratio,
Hemostasis
Anahtar Sözcükler: İzlem, Uluslararası normalleştirilmiş oran,
Hemostaz
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Kahlon P, Nabi S, Arshad A, Jabbar A, Haythem A. Warfarin dosing and time
required to reach therapeutic international normalized ratio in patients
with hypercoagulable conditions. Turk J Hematol 2016;33:299-303.
2. Favaloro EJ, McVicker W, Lay M, Ahuja M, Zhang Y, Hamdam S, Hocker N.
Harmonizing the international normalized ratio (INR): standardization of
methods and use of novel strategies to reduce interlaboratory variation and
bias. Am J Clin Pathol 2016;145:191-202.
3. Sølvik UØ, Petersen PH, Monsen G, Stavelin AV, Sandberg S. Discrepancies in
international normalized ratio results between instruments: a model to split
the variation into subcomponents. Clin Chem 2010;56:1618-1626.
4. Wongtiraporn W, Opartkiattikul N, Tientadakul P. The value of local ISI
calibration in correcting the variability in INR determination. Siriraj Hosp
Gaz 2003;55:381-384.
Address for Correspondence/Yazışma Adresi: Beuy JOOB, M.D.,
Sanitation 1 Medical Academic Center, Bangkok, Thailand
E-mail : beuyjoob@hotmail.com
Received/Geliş tarihi: December 03, 2016
Accepted/Kabul tarihi: December 06, 2016
DOI: 10.4274/tjh.2016.0467
Iron Overload in Hematopoietic Stem Cell Transplantation
Hematopoetik Kök Hücre Transplantasyonunda Aşırı Demir Yüklenmesi
Sora Yasri 1 , Viroj Wiwanitkit 2
1KMT Primary Care Center, Bangkok, Thailand
2Wiwanitkit House, Bangkok, Thailand
To the Editor,
We read the publication entitled “Current Review of Iron
Overload and Related Complications in Hematopoietic Stem Cell
Transplantation” with great interest [1]. As summarized by Atilla
et al. [1], “Organ dysfunction due to iron overload may cause
high mortality rates and therefore a sufficient iron chelation
therapy is recommended”. We would like to share the experience
from our settings where there is a very high prevalence of
thalassemia and transplantation is the only curative treatment.
Iron overload is common among transfusion-dependent
thalassemia patients and transfusion during transplantation
might increase the risk of the complication of iron overload.
However, in clinical practice, the problem is not common and
improvement of the patients after transplantation is reported.
According to the recent report by Inati et al. [2], with standard
chelation therapy, the outcome of thalassemic patients
undergoing stem cell transplantation is usually favorable. The
use of the standard dosage of deferoxamine, with or without
phlebotomy, accompanied with close iron status monitoring can
be effective [2,3]. It can be seen that stem cell transplantation can
be problematic despite there being a need of hypertransfusion
during the process even though the patient might have an
underlying severe iron overload condition such as thalassemia.
Keywords: Iron, Overload, Hematopoietic stem cell,
Transplantation
Anahtar Sözcükler: Demir, Aşırı yüklenme, Hematopoietik kök
hücre, Transplantasyon
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Atilla E, Toprak SK, Demirer T. Current review of iron overload and related
complications in hematopoietic stem cell transplantation. Turk J Hematol
2016 [Epub ahead of print].
2. Inati A, Kahale M, Sbeiti N, Cappellini MD, Taher AT, Koussa S, Nasr TA,
Musallam KM, Abbas HA, Porter JB. One-year results from a prospective
randomized trial comparing phlebotomy with deferasirox for the treatment
of iron overload in pediatric patients with thalassemia major following
curative stem cell transplantation. Pediatr Blood Cancer 2017;64:188-196.
3. Angelucci E, Pilo F. Management of iron overload before, during, and after
hematopoietic stem cell tranplantation for thalassemia major. Ann N Y
Acad Sci 2016;1368:115-121.
102

Turk J Hematol 2017;34:99-117
LETTERS TO THE EDITOR
Reply
Dear Sora Yasri,
Thank you very much for your valuable comments and sharing
your experience. We agree for your contribution. In thalassemia
patients, several transplantation centers categorised risk factors
prior to allogenic hematopoietic stem cell transplantation.
Pesaro classification assigned patients to three arms according
to the absence or presence of one, two or three risk factors:
hepatomegaly > 2 cm, portal fibrosis, and irregular chelation
history [1]. It should be kept in mind that in a study by
Ghavamzadeh et al., liver iron overload did not change after
transplant (p=0.61) but hepatic fibrosis progressed (p=0.01)
[2]. Allogeneic stem cell transplantation did not reduce liver
iron overload and in fact liver fibrosis increased. Also steps for
reducing iron overload should be taken in the post transplant
setting [3]. Iron overload is still an essential issue in both pre
and post transplant settings. Survival in transfusion-dependent
thalassemia patients can be improved with proper understanding
of the pathophysiology of thalassemia and iron toxicity.
Regards,
Erden Atilla, Selami K. Toprak, Taner Demirer
References
1. Lucarelli G, Weatherall DJ. FFor debate: bone marrow transplantation for
severe thalassaemia (1). The view from Pesaro (2). To be or not to be. Br J
Haematol 1991;78:300-303.
2. Ghavamzadeh A, Mirzania M, Kamalian N, Sedighi N, Azimi P. Hepatic
iron overload and fibrosis in patients with beta thalassemia major after
hematopoietic stem cell transplantation: a pilot study. Int J Hematol Oncol
Stem Cell Res 2015;9:55-59.
3. Bayanzay K, Alzoebie L. Reducing the iron burden and improving survival in
transfusion-dependent thalassemia patients: current perspectives. J Blood
Med 2016;7:159-169.
Address for Correspondence/Yazışma Adresi: Sora YASRI, M.D.,
KMT Primary Care Center, Bangkok, Thailand
Phone: 6622578963
E-mail : sorayasri@outlook.co.th
Received/Geliş tarihi: December 23, 2016
Accepted/Kabul tarihi: December 26, 2016
DOI: 10.4274/tjh.2016.0493
Sole Infrequent Karyotypic Aberration Trisomy 6 in a Patient with
Acute Myeloid Leukemia and Breast Cancer in Remission
Akut Miyeloid Lösemi ve Remisyonda Meme Kanserli Hastada Nadir İzole Karyotipik Bozukluk
Mürüvvet Seda Aydın 1 , Süreyya Bozkurt 2 , Gürsel Güneş 1 , Ümit Yavuz Malkan 1 , Tuncay Aslan 1 , Sezgin Etgül 1 , Yahya Büyükaşık 1 ,
İbrahim Celalettin Haznedaroğlu 1 , Nilgün Sayınalp 1 , Hakan Göker 1 , Haluk Demiroğlu 1 , Osman İlhami Özcebe 1 , Salih Aksu 1
1Hacettepe University Faculty of Medicine, Department of Adult Hematology, Ankara, Turkey
2Hacettepe University Cancer Institute, Basic Oncology, Ankara, Turkey
To the Editor,
Cytogenetic abnormalities play important roles in the diagnosis
and prognosis of leukemias [1]. Trisomy 6 as the sole karyotypic
aberration is infrequent in leukemias [1,2]. A 50-year-old
female patient presented with fatigue. She had been treated by
mastectomy and given chemotherapy (no further information
available) for breast cancer 3 years ago. She had been using
tamoxifen for 3 years. Her breast cancer was in remission.
Physical examination was consistent with a pale appearance.
Hemoglobin, neutrophils, and platelet count were 8.5 g/dL, 900/
µL, and 11,000/µL, respectively, on admission. In the peripheral
blood smear, there were dysplastic features in monocytes and a
few blasts were reported. In flow cytometry, CD13, CD33, CD34,
CD45, CD117 (c-kit), HLA-DR, and MPO were positive. Bone
marrow aspiration and biopsy revealed hypercellularity with
dysplastic and megaloblastic features in erythroid series, grade
1/3 reticulin fibrosis, and 24% blasts without ring sideroblasts,
which in turn with cytometry findings were accepted as
evidence of acute myeloid leukemia (AML). Bone marrow
cytogenetic analysis revealed trisomy 6 (47,XX, +6 [20]) in all
the metaphases (Figure 1). The patient was not in remission
after the first induction treatment and she passed away due to
septic shock during the second induction treatment.
Chromosome aberrations detected in therapy-related AML
(t-AML) and de novo AML cases are identical but their frequencies
may differ [3]. In a series at the University of Chicago, normal
karyotypes were seen in 9.6% of t-AML cases [4]. In the report
of Godley and Larson, among 306 patients with t-AML, 32 had
solid breast cancer as the primary diagnosis [5]. Alkylating
exposures and topoisomerase II inhibitors are associated with
103

LETTERS TO THE EDITOR
Turk J Hematol 2017;34:99-117
that there were no direct correlations between the number of
blasts and the percentage of abnormal metaphases. They could
not identify any correlation between morphology or prognosis
and trisomy 6 [7].
Under these circumstances, as in our case, we lack information
on the impact of trisomy 6 on prognosis in secondary AML
patients.
Keywords: Trisomy 6, acute myeloid leukemia, Breast cancer
Anahtar Sözcükler: Trizomi 6, Akut miyeloid lösemi, Meme
kanseri
Figure 1. Bone marrow cytogenetic analysis revealed trisomy 6
(47,XX, +6 [20]) in all the metaphases.
t-AML [3,6]. Godley and Larson mentioned granulocyte colonystimulating
factor usage as a risk factor in t-AML after breast
cancer [5]. Unfortunately, we do not know which agents were
given for our patient’s breast cancer.
Autosomal trisomies have been described in several hematologic
malignancy cases. The first case of sole trisomy 6 was reported
in aplastic anemia. Other reports showed that trisomy 6 was
associated with hypoplastic bone marrow, dyserythropoiesis,
and AML [7]. Mohamed et al. reviewed 7 patients with trisomy
6. Patients presenting with overt AML had hyperplastic marrows
[8]. Our patient had hypercellular marrow, as well. Mohamed et
al. also reviewed the literature and found 4 MDS cases among
22 patients with trisomy 6 [8]. The marrow examination of this
case revealed secondary dysplastic leukemia. The patient of
Gupta et al. had de novo AML and did not respond to the first
remission induction treatment [1].
Yu et al. reviewed ten reports in PubMed describing 18 cases
of AML presenting with trisomy 6 as the sole karyotypic
abnormality along with 3 cases of their own [7]. They concluded
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Gupta M, Radhakrishnan N, Mahapatra M, Saxena R. Trisomy chromosome
6 as a sole cytogenetic abnormality in acute myeloid leukemia. Turk J
Hematol 2015;32:77-79.
2. Choi J, Song J, Kim SJ, Choi JR, Kim SJ, Min YH, Park TS, Cho SY, Kim MJ.
Prognostic significance of trisomy 6 in an adult acute myeloid leukemia
with t(8;21). Cancer Genet Cytogenet 2010;202:141-143.
3. Pedersen-Bjergaard J, Andersen MT, Andersen MK. Genetic pathways in
the pathogenesis of therapy-related myelodysplasia and acute myeloid
leukemia. Hematology Am Soc Hematol Educ Program 2007:392-397.
4. Qian Z, Joslin JM, Tennant TR, Reshmi SC, Young DJ, Stoddart A, Larson RA,
Le Beau MM. Cytogenetic and genetic pathways in therapy-related acute
myeloid leukemia. Chem Biol Interact 2010;184:50-57.
5. Godley LA, Larson RA. Therapy-related myeloid leukemia. Semin Oncol
2008;35:418-429.
6. Zhang L, Wang SA. A focused review of hematopoietic neoplasms occurring
in the therapy-related setting. Int J Clin Exp Pathol 2014;7:3512-3523.
7. Yu S, Kwon MJ, Lee ST, Woo HY, Park H, Kim SH. Analysis of acute myeloid
leukemia in Korean patients with sole trisomy 6. Ann Lab Med 2014;34:402-
404.
8. Mohamed AN, Varterasian ML, Dobin SM, McConnell TS, Wolman SR,
Rankin C, Willman CL, Head DR, Slovak ML. Trisomy 6 as a primary
karyotypic aberration in hematologic disorders. Cancer Genet Cytogenet
1998;106:152-155.
Address for Correspondence/Yazışma Adresi: Mürüvvet Seda AYDIN, M.D.,
Hacettepe University Faculty of Medicine, Department of Adult Hematology, Ankara, Turkey
E-mail : muruvvetseda.balaban@hacettepe.edu.tr
Received/Geliş tarihi: January 17, 2016
Accepted/Kabul tarihi: November 15, 2016
DOI: 10.4274/tjh.2016.0030
104

Turk J Hematol 2017;34:99-117
LETTERS TO THE EDITOR
Premarital Genetic Diagnosis Revealed Co-heredity Nature of Beta
Globin Gene 25-26 del AA and 3’UTR+101 G-C Variants in Two
Beta Thalassemia Heterozygotes
İki Heterozigot Beta Talasemi Taşıyıcısında Evlilik Öncesi Genetik Tanı ile Beta Globin Geni 25-
26 del AA ve 3’UTR+101GC Varyant Kalıtımının Gösterilmesi
Kanay Yararbaş 1 , Yasemin Ardıçoğlu 2 , Nejat Akar 3
1Düzen Laboratories Group, Ankara, Turkey
2TOBB-ETU Hospital, Clinic of Biochemistry and Clinical Biochemistry, Ankara, Turkey
3TOBB-ETU Hospital, Clinic of Pediatrics, Ankara, Turkey
To the Editor,
Over 2000 gene variants were reported in the beta globin gene,
including hemoglobin variants. These variants are important from
clinical and genetic counseling points of view [1,2]. Recently a
genetically related Turkish couple was referred to our department
for genetic counseling for beta thalassemia carrier status. During
premarital screening they were both diagnosed as beta thalassemia
carriers by high pressure liquid chromatography analysis and
whole blood count (Table 1). Genomic DNAs of both patients were
extracted using the QIAamp DNA Blood Midi Kit (QIAGEN, Germany).
The HBB gene was amplified using the following polymerase chain
reaction (PCR) primers: forward (5’GCCAAGGACAGGTACGGCTG3’),
reverse (5’CCCTTCCTATGACATGAACTTAACCAT3’) and
forward (5’CAATGTATCATGCCTCTTTGCACC3’), reverse
(5’GAGTCAAGGCTGAGGATGCGGA3’). Purifications were done
using the ExoSAP purification program (Affymetrix Inc., USA).
The BigDye Sequencing PCR technique was used for the analysis
(Applied Biosystems, USA). Samples were analyzed with the
SeqScape v2.5 analysis program. Common alpha globin gene
deletions were analyzed according to the previously reported
technique [3,4].
Two different gene alterations were found in the beta globin
gene of both partners (Table 1). One of them was a deletion at
25-26AA (rs35497102) (Figure 1). The other gene alteration was a
single nucleotide polymorphism at 3’UTR+101 G-C +233 relative
to the termination codon (rs12788013) (Figure 2). Neither of the
individuals carried the common alpha thalassemia deletions.
Beta globin gene 3’UTR+101 G-C alteration is a single nucleotide
polymorphism that was not previously classified and reported
as a pathogenic variant [1,2]. It seems that carrying 3’UTR+101
G-C does not cause any additional clinical features in 25-26 del
AA carriers. In this situation there is certainly more than one
possibility to be mentioned in genetic counseling. 3’UTR+101
G-C being a single nucleotide variant resulting in a decreased
expression of the gene causing the beta thalassemia major
clinical picture is the most likely one. This is more evident
when combined with a disease causing mutation, as previously
reported by us and others [3,4,5,6,7]. However, from our family’s
data, this is not valid, because they are beta thalassemia carriers.
The main problem in this case is that an expression study was
not performed for these individuals.
Table 1. Whole blood count, hemoglobin A2 levels, and HBB gene mutation profile of the couple.
Hb RBC MCV MCH MCHC RDW HbA2 HbF HBB gene variant
Male 10.7 5.78 55.5 18.5 33.3 18.5 4.8 1.4 Variant 1:
c.25_26AA (rs35497102)
Variant 2:
3’UTR+101 G-C +233 relative to
termination codon (rs12788013)
Female 11.3 5.93 56.8 19.1 33.5 18.2 4.4 2.9 Variant 1:
c.25_26AA (rs35497102)
Variant 2:
3’UTR+101 G-C +233 relative to
termination codon (rs12788013)
Hb: Hemoglobin, RBC: red blood cell, MCV: mean corpuscular volume, MCH: mean corpuscular hemoglobin, MCHC: mean corpuscular hemoglobin concentration, RDW: red cell
distribution width.
105

LETTERS TO THE EDITOR
Turk J Hematol 2017;34:99-117
Figure 1. Sequencing data of the deletion at 25-26 AA
(rs35497102).
One of the possibilities for the inheritance pattern in this
situation is that these two gene variants will be inherited in the
“cis” position. In this case, from the genetic point of view, “in
cis” is the only acceptable solution for the fetus, which will be
similar to the parents. However, if it does not come in the “cis”
position, there will be a possibility that the fetus may inherit
3’UTR+101 G-C in the homozygous state (from both parents).
Unfortunately, not many publications have discussed similar
conditions. For prenatal screening of the fetus, only the del 25-
26 AA /3’UTR+101 G-C heterozygote state should be accepted
as normal.
This case report highlights the need for investigating partnered
beta thalassemia carriers by complete sequencing analysis of the
beta globin gene if only one pathogenic mutation is detected
by first-tier methods for the possibility of providing appropriate
genetic counseling for couples at risk during prenatal genetic
diagnosis.
Keywords: Thalassemia, Variant, Genetic counseling, Prenatal
diagnosis, Beta globin gene, Turkish
Anahtar Sözcükler: Talasemi, Varyant, Genetik danışmanlık,
Prenatal tanı, Beta globin geni, Türk
Address for Correspondence/Yazışma Adresi: Nejat AKAR, M.D.,
TOBB-ETU Hospital, Clinic of Pediatrics, Ankara, Turkey
Phone: +90 532 285 73 14
E-mail : akar@medicine.ankara.edu.tr
Figure 2. Single nucleotide polymorphism at 3’ UTR +101 G-C
(+233 relative to termination codon).
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. HbVar: A Database of Human Hemoglobin Variants and Thalassemias.
Available online at http://globin.bx.psu.edu/hbvar/menu.html.
2. Human Gene Mutation Database (HGMD) Professional Version 2016.1.
Available online at https://portal.biobase-international.com/hgmd/pro/
gene.php?gene=HBB.
3. Oron-Karni V, Filon D, Oppenheim A, Rund D. Rapid detection of the
common Mediterranean alpha-globin deletions/rearrangements using PCR.
Am J Hematol 1998;58:306-310.
4. Tan AS, Quah TC, Low PS, Chong SS. A rapid and reliable 7-deletion multiplex
polymerase chain reaction assay for alpha-thalassemia. Blood 2001;98:250-251.
5. Başak AN, Ozer A, Kirdar B, Akar N. A novel 13 Bp deletion in the 3’UTR
of the beta-globin gene causes beta-thalassemia in a Turkish patient.
Hemoglobin 1993;17:551-555.
6. Vinciguerra M, Passarello C, Leto F, Cassarà F, Cannata M, Maggio A,
Giambona A. Identification of three new nucleotide substitutions in the
β-globin gene: laboratoristic approach and impact on genetic counseling
for beta-thalassemia. Eur J Haematol 2014;92:444-449.
7. Bilgen T, Clark OA, Ozturk Z, Akif Yesilipek M, Keser I. Two novel mutations in
the 3’ untranslated region of the beta-globin gene that are associated with
the mild phenotype of beta thalassemia. Int J Lab Hematol 2013;35:26-30.
Received/Geliş tarihi: February 18, 2016
Accepted/Kabul tarihi: October 03, 2016
DOI: 10.4274/tjh.2016.0069
106

Turk J Hematol 2017;34:99-117
LETTERS TO THE EDITOR
Acute Myocardial Infarction Due to Eltrombopag Therapy in a
Patient with Immune Thrombocytopenic Purpura
İmmün Trombositopenik Purpurası Olan Bir Hastada Eltrombopag Tedavisine Bağlı Akut
Miyokard İnfarktüsü
Sena Sert, Hasan Özdil, Murat Sünbül
Marmara University Faculty of Medicine, Department of Cardiology, İstanbul, Turkey
To the Editor,
Immune thrombocytopenic purpura (ITP) is an autoimmune
disease characterized by anti-platelet antibody-mediated
platelet destruction and anti-megakaryocyte antibody-mediated
impairment of platelet production, which may cause bleeding [1].
Coexistence of ITP and coronary artery disease (CAD) is rare. Patients
with ITP have increased risk of thrombosis and atherosclerosis
associated with larger platelets more adhesive to vascular
surfaces, direct endothelial damage [2], and negative effects of
therapy with steroids [3] or intravenous immunoglobulin [4].
We present here a 61-year-old male patient who was diagnosed
with ITP and presented with acute myocardial infarction while
undergoing eltrombopag therapy.
A 61-year-old man was admitted to our emergency room with
typical chest pain lasting for last 3 days. He had been diagnosed
with ITP 5 years ago. His medical history was remarkable for
splenectomy 6 months after the diagnosis of ITP. He was in
remission for 4 years after the splenectomy and he was not on
any medication for 5 years. Four months before, during a routine
check-up, relapse of disease had been noticed. Steroid therapy
was initiated after relapse and administered with a tapering
dosage for 3 months. The clinician did not observe adequate
increase in the amount of platelets; therefore, eltrombopag (1x50
mg tablet) was initiated as a newline therapy 1 month ago. In
the first 3 weeks, the platelet count did not increase adequately
(platelets were about 13,000/mL), but in the last week before his
admission to the emergency room his platelet count escalated to
about 105,000/mL. The patient was admitted to our emergency
room with typical chest pain. His baseline cardiovascular risk
factors, among smoking, hyperlipidemia, hypertension, diabetes
mellitus, and family history, were not remarkable. The patient
was not on any medication apart from eltrombopag therapy. On
his admission, electrocardiography showed ST segment elevation
in leads DII-III-AVF and V5-6 with pathological Q waves, which
gave rise to consideration of sub-acute inferolateral myocardial
infarction. Primary percutaneous coronary intervention (PCI) was
performed immediately. Coronary angiography demonstrated the
anomalous origin of the coronary artery. The circumflex coronary
artery (CX) originated from the right aortic root. There was plaque
on the proximal and middle portion of the left anterior descending
artery and proximal portion of the CX, and subtotal occlusion at
the distal portion of the right coronary artery (RCA). A bare metal
stent was implanted at the lesion site and post-dilatation was
performed (Figures 1A-1D). After PCI, thrombolysis in myocardial
infarction grade 3 flow was obtained as an optimal angiographic
result in the RCA. Platelet counts were assessed daily and showed
a stable trend. At the suggestion of the hematology department,
the eltrombopag therapy was stopped. The patient was examined
for an underlying hypercoagulable state. His homocysteine level
was within normal limits. Antinuclear antibodies, antiphospholipid
and anticardiolipin antibodies, lupus-like anticoagulant, and
mutations of factor V Leiden were negative. The patient was
discharged on the 5 th day with a platelet count of 125,000/mL,
with advice to continue dual anti-platelet therapy (acetylsalicylic
acid 100 mg and clopidogrel 75 mg). There was no relapse for ITP
during the 1-year follow-up period (Table 1).
Figure 1. A) Non-critical plaque on the proximal and middle
portion of the left anterior descending artery, B) arrow shows
sub-total occlusion at the distal portion of the right coronary
artery, C) circumflex coronary artery originates from the right
aortic root, D) bare metal stent (3.0x20 mm) was implanted at
the lesion site and post-dilatation was performed with a noncompliant
balloon (3.5x15 mm).
107

LETTERS TO THE EDITOR
Turk J Hematol 2017;34:99-117
Table 1. The relationship between medical treatments and platelet counts during follow-up periods.
Time
Platelet
Count
4 months
ago
2 months
ago
1 month
ago
2 weeks
ago
1 week
ago
Admission
to ED
5 days later 1 month
later
6 months
later
1 year
later
60,000 93,000 5000 13,000 105,000 107,000 125,000 105,000 272,000 292,000
Therapy
P-16 mg
initiated
P-64 mg E-50 mg
initiated
E-50 mg E-50 mg E-50 mg C-75 mg,
ASA-100 mg
C-75 mg,
ASA-100 mg
C-75 mg C-75 mg
Events Relapse Follow-up Newline
therapy
Followup
Followup
Myocardial
infarction
P: Prednisolone; E: eltrombopag; C: clopidogrel; ASA: acetylsalicylic acid; ED: emergency department.
Discharge Follow-up Follow-up Follow-up
Eltrombopag is an orally available, small, non-peptide organic
molecule that enhances platelet production by binding to and
activating c-Mpl, the thrombopoietin receptor, on megakaryocytes
and their progenitors [5]. The main issue in our case is that, as we
mentioned the importance of evaluating risk factors, our patient
had no risk factors for CAD and we recognized the coincidence
between acute coronary syndrome and the beginning of a new
agent of thrombopoietin receptor agonist (TPO-A) therapy. TPO-A
therapy has important side effects including thromboembolic
events [6,7,8]. A recent study demonstrated that an important
percentage of ITP patients undergoing eltrombopag therapy
achieve complete response after cessation of the therapy. There is
no reliable marker for predicting this response so far [9].
Coexistence of ITP and CAD presents complex problems. The
crucial point in handling these problems is a balance between
hemorrhagic risk and prevention of thrombotic events. Although
eltrombopag is more effective in the treatment of patients with
ITP, clinicians should pay more attention to side effects including
thrombotic events, as we demonstrated in our case report.
Keywords: Acute myocardial infarction, Immune thrombocytopenic
purpura, Eltrombopag
Anahtar Sözcükler: Akut miyokard infarktüsü, İmmün
trombositopenik purpura, Eltrombopag
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials included.
References
1. Cines DB, Bussel JB, Liebman HA, Luning Prak ET. The ITP syndrome:
pathogenic and clinical diversity. Blood 2009;113:6511-6521.
2. Fruchter O, Blich M, Jacob G. Fatal acute myocardial infarction during
severe thrombocytopenia in a patient with idiopathic thrombocytopenic
purpura. Am J Med Sci 2002;323:279-280.
3. Paolini R, Zamboni S, Ramazzina E, Zampieri P, Cella G. Idiopathic
thrombocytopenic purpura treated with steroid therapy does not prevent
acute myocardial infarction: a case report. Blood Coagul Fibrinolysis
1999;10:439-442.
4. Elkayam O, Paran D, Milo R, Davidovitz Y, Almoznino-Sarafian D, Zeltser D,
Yaron M, Caspi D. Acute myocardial infarction associated with high dose
intravenous immunoglobulin infusion for autoimmune disorders. A study
of four cases. Ann Rheum Dis 2000;59:77-80.
5. Erickson-Miller CL, DeLorme E, Tian SS, Hopson CB, Landis AJ, Valoret EI,
Sellers TS, Rosen J, Miller SG, Luengo JI, Duffy KJ, Jenkins JM. Preclinical
activity of eltrombopag (SB-497115), an oral, nonpeptide thrombopoietin
receptor agonist. Stem Cells 2009;27:424-430.
6. Saleh MN, Bussel JB, Cheng G, Meyer O, Bailey CK, Arning M, Brainsky A;
EXTEND Study Group. Safety and efficacy of eltrombopag for treatment of
chronic immune thrombocytopenia: results of the long-term, open-label
EXTEND study. Blood 2013;121:537-545.
7. Hassn AMF, Al-Fallouji MA, Ouf TI, Saad R. Portal vein thrombosis following
splenectomy. Br J Surg 2000;87:362-373.
8. Harker LA, Hunt P, Marzec UM, Kelly AB, Tomer A, Hanson SR, Stead RB.
Regulation of platelet production and function by megakaryocyte growth
and development factor in nonhuman primates. Blood 1996;87:1833-1844.
9. González-López TJ, Pascual C, Álvarez-Román MT, Fernández-Fuertes
F, Sánchez-González B, Caparrós I, Jarque I, Mingot-Castellano ME,
Hernández-Rivas JA, Martín-Salces M, Solán L, Beneit P, Jiménez R, Bernat S,
Andrade MM, Cortés M, Cortti MJ, Pérez-Crespo S, Gómez-Núñez M, Olivera
PE, Pérez-Rus G, Martínez-Robles V, Alonso R, Fernández-Rodríguez A,
Arratibel MC, Perera M, Fernández-Miñano C, Fuertes-Palacio MA, Vázquez-
Paganini JA, Gutierrez-Jomarrón I, Valcarce I, de Cabo E, Sainz A, Fisac R,
Aguilar C, Paz Martínez-Badas M, Peñarrubia MJ, Calbacho M, de Cos C,
González-Silva M,Coria E, Alonso A, Casaus A, Luaña A, Galán P, Fernández-
Canal C, Garcia-Frade J, González-Porras JR. Successful discontinuation of
eltrombopag after complete remission in patients with primary immune
thrombocytopenia. Am J Hematol 2015;90:40-43.
Address for Correspondence/Yazışma Adresi: Murat SÜNBÜL, M.D.,
Marmara University Faculty of Medicine, Department of Cardiology, İstanbul, Turkey
Phone: +90 506 581 90 15
E-mail : drsunbul@yahoo.com.tr
Received/Geliş tarihi: May 10, 2016
Accepted/Kabul tarihi: December 06, 2016
DOI: 10.4274/tjh.2016.0169
108

Turk J Hematol 2017;34:99-117
LETTERS TO THE EDITOR
Candida-Related Immune Response Inflammatory Syndrome
Treated with Adjuvant Corticosteroids and Review of the Pediatric
Literature
Adjuvan Kortikosteroid ile Tedavi Edilen Candida-İlişkili İmmün Yanıt Enflamatuvar Sendromu
ve Pediatrik Literatür Derlemesi
Dildar Bahar Genç 1 , Sema Vural 1 , Nafiye Urgancı 2 , Tuğçe Kurtaraner 3 , Nazan Dalgıç 4
1Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Oncology, İstanbul, Turkey
2Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Gastroenterology, İstanbul, Turkey
3Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatrics, İstanbul, Turkey
4Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Infectious Disease, İstanbul, Turkey
To the Editor,
Chronic disseminated candidiasis (CDC) is a potentially fatal
complication observed in febrile neutropenia [1]. The diagnosis
is usually made after neutrophil recovery and microbiological
proof has been often negative [2]. Granulomatous histopathology,
radiological lesions coincident with resolution of granulocytopenia,
and rapid response to corticosteroids favors immune-mediated
pathogenesis. Recently, CDC has been suggested to be related to
Immune response inflammatory syndrome (IRIS), an exacerbated
response to a preexisting antigenic stimulus in patients with rapid
immune restoration [1,3]. IRIS has been mostly documented in
HIV-infected patients with immune recovery after antiretroviral
therapy [4]. Here, we present a case of Candida-related IRIS and
review the current literature on children.
A male, aged 6 years and 7 months, with B-cell acute
lymphoblastic leukemia was treated for presumed typhlitis with
meropenem, teicoplanin, and amphotericin B during induction
Figure 1. Coronal and axial computed tomography images (a, b);
coronal and axial magnetic resonance images of circumscribed
typical hepatic Candida lesions (c, d).
therapy. Thoracoabdominal CT scans revealed hepatosteatosis/
hepatomegaly. Fever subsided on the 2 nd day. During steroid
tapering and on the 8th day of antibiotics, the patient developed
fever and abdominal pain with marked elevation of liver enzymes,
predominantly of GGT. Bone marrow examination showed no
evidence of blasts or hemophagocytosis and the blood count
was normal. Control imaging showed typical widespread hepatic
bull’s eye lesions (Figure 1). The liver biopsy demonstrated
granulomatous inflammation, but no fungus was detectable.
According to European Organization for Research and Treatment
of Cancer/Mycoses Study Group criteria, the diagnosis was possible
invasive fungal infection, most likely candidiasis. Reappearance of
symptoms after neutrophil recovery indicated IRIS. We empirically
administered dexamethasone for 14 days. Fever disappeared
after 24 h and liver function tests improved in 1 week. He was
discharged with oral voriconazole. During vincristine therapy,
voriconazole was replaced with amphotericin B to avoid toxicity.
In the 13 th month of voriconazole, the liver lesions showed
partial regression and calcification. As re-biopsy was negative
for microorganisms and showed only rare microgranulomas, we
stopped the voriconazole. The patient completed chemotherapy
and has been without any exacerbation for 32 months since the
initial diagnosis of IRIS.
Clinical and/or radiological deterioration after neutrophil recovery
is a well-known entity in patients treated for opportunistic
infections [4]. The immune system shifts towards Th-1 type
response and amplifies proinflammatory cascades [1]. Therefore,
the severity of radiological/clinical findings might depend on the
immune status of the patient [5,6]. IRIS is a diagnosis of exclusion;
other possible causes of persistent fever should be evaluated. If
the clinical scenario is not consistent with preexisting disease,
treatment side effects, or a possible newly acquired pathogen,
IRIS deserves diagnostic consideration. In the previous Candidarelated
IRIS reports on children with cancer, all patients had
fever and liver dysfunction accompanying normal neutrophil
counts. Liver biopsies showed granuloma formation. Tissue
cultures for fungi were negative in all samples except one. The
109

LETTERS TO THE EDITOR
Turk J Hematol 2017;34:99-117
Table 1. Review of pediatric cases of Candida-related Immune response inflammatory syndrome treated with corticosteroids.
Authors
Age
(years)
Diagnosis Proof of Candida ANC/mm 3 Biopsy
Liver
Dysfunction
Antifungal
Treatment
Steroid Dose and
Duration
Outcome
Saint-
Faust et al.
[11]
Saint-
Faust et al.
[11]
De Castro
et al. [10]
Conter et
al. [8]
Legrand et
al. [3]
Bayram et
al. [7]
Current
case
12 AML
Candida antigen and
serology (+)
2800
8 ALL Candida serology (+) 2580
Median:
46
(2-76)
Granulomatous
lesion, Candida
(-)
Granulomatous
lesion, Candida
(-)
(+)
(+)
AmB
(1 mg/kg)
L-AmB
(3 mg/kg)
14 mixed * Unknown Unknown Mostly (+) *
17 Lymphoma Candida serology (+) 12,000
Median:
18.6
(2-65)
16
months
10
hematological
malignancies
Blood culture (+),
1/10; stool culture
(+), 7/10; urine
culture (+), 1/10
Median:
19,372
Granulomatous
lesion,
pseudomycelia
(+)
Yeast positive
in smear
(5/10), culture
positive (1/10),
granulomas
ALL (-) WBC: 36,100 (-) (+)
6.5 ALL (-) 2750
Granulomatous
lesion, Candida
(-)
(+) AmB (1 mg/kg)
(+) *
(+)
Fluconazole,
voriconazole
L-AmB
(3 mg/kg), then
voriconazole
Pred
1 mg/kg, 60 days
Pred
1 mg/kg, 90 days
Mean:
1 mg/kg/day*
Median: 1.5 (1-10
months)
Pred
1 mg/kg, 120 days
Median**
0.66 mg/kg/day (0.4-2)
Median 109 (49-240
days)
DXM
0.5 mg/kg, 14 days
DXM
0.4 mg/kg, 14 days
Radiological
improvement in 30
days. At 24 h, fever
and pain disappeared
and liver dysfunction
improved.
Fever and pain
disappeared in 2
days. radiological
improvement in 30
days.
Fever disappeared
in 24 h, clinical
improvement in 7
days, radiological
improvement in 6
weeks.
Clinical
improvement at
median 4.5 days
(1-30). Radiological
improvement in 107
days (mean: 30-210
days).
Fever disappeared
in 3 days, liver tests
normalized in 7
days, USG findings
normalized in 30
days.
Fever disappeared in
24 h, liver function
tests improved in 1
week. Radiological
improvement in 2
months.
*
*Case series studies, i.e. details unspecified. ALL: Acute lymphoblastic leukemia, ANC: absolute neutrophil count, AmB: amphotericin B, L-AmB: liposomal amphotericin B, Pred: prednisolone, DXM: dexamethasone, **: prednisone equivalent.
110

Turk J Hematol 2017;34:99-117
LETTERS TO THE EDITOR
most commonly administered antifungal agent was amphotericin
B. Details of steroid therapy and the outcomes are presented in
Table 1 [3,7,8,9,10,11]. Increased susceptibility to infection might
be a drawback for prolonged corticotherapy. However, neither
Candida reactivation nor other new opportunistic infections have
been reported [3].
Candida-related IRIS has been rarely reported in children.
Early recognition and appropriate management of IRIS might
prevent unnecessary diagnostic procedures, antibiotic usage, and
chemotherapy delays.
Acknowledgment
This work was partially presented at the 9th Biennial Childhood
Leukemia Symposium, Prague, Czech Republic, 28-29 April 2014.
Keywords: Leukemia, Febrile neutropenia, Candida, Immune
response inflammatory syndrome
Anahtar Sözcükler: Lösemi, Febril nötropeni, Candida, İmmün
yanıt enflamatuvar sendromu
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials included.
References
1. Rammaert B, Desjardins A, Lortholary O. New insights into hepatosplenic
candidosis, a manifestation of chronic disseminated candidosis. Mycoses
2012;55:74-84.
2. Fleischhacker M, Schulz S, Jöhrens K, von Lilienfeld-Toal M, Held T, Fietze
E, Schewe C, Petersen I, Ruhnke M. Diagnosis of chronic disseminated
candidosis from liver biopsies by a novel PCR in patients with haematological
malignancies. Clin Microbiol Infect 2012;18:1010-1016.
3. Legrand F, Lecuit M, Dupont B, Bellaton E, Huerre M, Rohrlich PS, Lortholary
O. Adjuvant corticosteroid therapy for chronic disseminated candidiasis.
Clin Infect Dis 2008;46:696-702.
4. Manabe YC, Campbell JD, Sydnor E, Moore RD. Immune reconstitution
inflammatory syndrome: risk factors and treatment implications. J Acquir
Immune Defic Syndr 2007;46:456-462.
5. Karthaus M, Huebner G, Geissler RG, Heil G, Ganser A. Hepatic lesions of
chronic disseminated systemic candidiasis in leukemia patients may become
visible during neutropenia: value of serial ultrasound examinations. Blood
1998;91:3087-3089.
6. Pestalozzi BC, Krestin GP, Schanz U, Jacky E, Gmür J. Hepatic lesions of
chronic disseminated candidiasis may become invisible during neutropenia.
Blood 1997;90:3858-3864.
7. Bayram C, Fettah A, Yarali N, Kara A, Azik FM, Tavil B, Tunc B. Adjuvant
corticosteroid therapy in hepatosplenic candidiasis-related iris. Mediterr J
Hematol Infect Dis 2012;4:e2012018.
8. Conter CD, Thiesse P, Bienvenu A. Persistent fever and hepatosplenic
candidiasis, efficiency of a corticoid therapy. J Mycol Med 2007;17:194-
197.
9. Chaussade H, Bastides F, Lissandre S, Blouin P, Bailly E, Chandenier J, Gyan E,
Bernard L. Usefulness of corticosteroid therapy during chronic disseminated
candidiasis: case reports and literature review. J Antimicrob Chemother
2012;67:1493-1495.
10. De Castro N, Mazoyer E, Porcher R, Raffoux E, Suarez F, Ribaud P, Lortholary
O, Molina JM. Hepatosplenic candidiasis in the era of new antifungal drugs:
a study in Paris 2000-2007. Clin Microbiol Infect 2012;18:185-187.
11. Saint-Faust M, Boyer C, Gari-Toussaint M, Deville A, Poiree M, Weintraub M,
Sirvent N. Adjuvant corticosteroid therapy in 2 children with hepatosplenic
candidiasis-related IRIS. J Pediatr Hematol Oncol 2009;31:794-796.
Address for Correspondence/Yazışma Adresi: Dildar Bahar GENÇ, M.D.,
Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Oncology, İstanbul, Turkey
Phone: +90 212 373 66 57
E-mail : baharbeker@yahoo.com
Received/Geliş tarihi: June 20, 2016
Accepted/Kabul tarihi: October 03, 2016
DOI: 10.4274/tjh.2016.0237
Posttranslational Modifications of Red Blood Cell Ghost Proteins
as “Signatures” for Distinguishing between Low- and High-Risk
Myelodysplastic Syndrome Patients
Düşük ve Yüksek Risk Miyelodisplastik Sendrom Hastalarını Ayıran “İşaretler” Olarak Kırmızı
Kan Hücre Zarı Proteinlerinin Posttranslasyonel Modifikasyonları
Klara Pecankova, Pavel Majek, Jaroslav Cermak, Jan E. Dyr
Institute of Hematology and Blood Transfusion, Prague, Czech Republic
To the Editor,
Myelodysplastic syndrome (MDS) comprises a heterogenic
group of oncohematological diseases that affect hematopoiesis.
Although the precise cause of MDS is unknown, multiple factors
are involved, one of the most widely implicated of which is
oxidative stress. However, it is unclear whether oxidative stress
is a cause of MDS or an effect of other pathological mechanisms.
Red blood cells (RBCs) are the first cells exposed to stress stimuli.
They are highly vulnerable to free radical accumulation, which
leads to the oxidative stress that induces damage in proteins and
111

LETTERS TO THE EDITOR
Turk J Hematol 2017;34:99-117
other biomacromolecules [1]. In MDS, the RBC proteome can be
affected by effects of the peripheral blood environment and/or
by abnormal processes possibly caused by oxidative stress during
hematopoiesis in bone marrow. Therefore, we chose red cell
membranes (ghosts) as a model biological material.
Patient characteristics are summarized in Table 1. All individuals
tested agreed to participate in the study on the basis of informed
consent. All samples were obtained and analyzed in accordance
with the Ethics Committee regulations of the Institute of
Hematology and Blood Transfusion. The RBCs were isolated from
whole blood by differential centrifugation and frozen at -80 °C.
The red cell ghosts were isolated according to the method of Dodge
et al. [2]. Proteins were separated using 2D SDS-PAGE followed
by silver staining [3]. The gels were digitized and processed using
Progenesis SameSpots software. Significantly differing spots
(p

Turk J Hematol 2017;34:99-117
LETTERS TO THE EDITOR
4. Manno S, Takakuwa Y, Nagao K, Mohandas N. Modulation of erythrocyte
membrane mechanical function by beta-spectrin phosphorylation and
dephosphorylation. J Biol Chem 1995;270:5659-5665.
5. Ideguchi H, Yamada Y, Kondo S, Tamura K, Makino S, Hamasaki N.
Abnormal erythrocyte band 4.1 protein in myelodysplastic syndrome with
elliptocytosis. Br J Haematol 1993;85:387-392.
6. Majumder D, Banerjee D, Chandra S, Banerjee S, Chakrabarti A. Red
cell morphology in leukemia, hypoplastic anemia and myelodysplastic
syndrome. Pathophysiology 2006;13:217-225.
Address for Correspondence/Yazışma Adresi: Klara PECANKOVA, M.D.,
Institute of Hematology and Blood Transfusion, Prague, Czech Republic
Phone: +420 221 977 349
E-mail : klara.pecankova@uhkt.cz
Received/Geliş tarihi: June 28, 2016
Accepted/Kabul tarihi: September 06, 2016
DOI: 10.4274/tjh.2016.0251
Intradiploic Hematoma in a Hemophilic Patient: Hemophilic
Pseudotumor of Calvarium
Hemofilik Bir Hastada İntradiploik Hematom: Kraniyumun Hemofilik Psödotümörü
Hakan Hanımoğlu 1 , Zafer Başlar 2
1İstanbul Bilim University Faculty of Medicine, Department of Neurosurgery, İstanbul, Turkey
2İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey
To the Editor,
Pseudotumors are results of repeated hemorrhage into soft tissues,
the subperiosteum, or a site of bone fracture with inadequate
resorption of the extravasated blood. We describe a patient with
a huge hemophilic pseudotumor of calvarium, which occurs very
rarely.
of seizures and a CT scan of the patient showed that acceptable
calvarial remodeling had occurred (Figure 1, C-1 and C-2).
Proximal pseudotumors may destroy the soft tissues, erode
the bone, and cause serious vascular and/or nerve damage [1].
A 14-year-old boy with mild hemophilia A (FVIII coagulant
activity: 5.8%) without inhibitor presented with epileptic seizure
7 years ago. The patient was known to be hemophiliac from
birth after a birth injury and brain damage had occurred. He was
mentally retarded and had habitual head-hitting behavior. His
family noticed progressively enlarging painless scalp swelling on
his head.
There was obvious asymmetry of the head and face (Figure 1,
A-3). His neurological examination was normal and radiological
investigations did not reveal any other pathology. A computed
tomography (CT) scan showed a large lesion with a mass effect
over the underlying brain (Figure 1, A-1 and A-2).
Surgery was carried out with coagulation factor replacement
(FVIII). During surgery a skin flap was done and the thinned outer
table was incised (Figure 1, B-1). Mud-like material and a liquefied
clot were evacuated (Figure 1, B-2). The thin and elastic inner wall
was not removed to avoid postoperative complications (Figure 1,
B-3).
Following surgery, antiepileptic medication was continued and
short-term prophylaxis (30 IU/kg, three times a week) was applied
for 8 weeks. At the 7-year follow-up of the patient, he was free
Figure 1. A-1, A-2, A-3: Multidetector computed tomography
scan with reconstruction shows large lytic intradiploic lesion
with expansion and scalloping of the bony margins; please note
that the inner and outer tables are separated and destructed.
B-1, B-2, B-3: Intraoperative images; evacuated lesion was mudlike,
inner table was protected. C1, C2: Sagittal and coronal
computed tomography images after 7 years; good and acceptable
remodeling of the calvarium is seen.
113

LETTERS TO THE EDITOR
Turk J Hematol 2017;34:99-117
Reduction of the pseudotumor and chronic joint disease is
achieved by prophylactic treatment in severe hemophilia.
Calvarial localization of a pseudotumor is unusual [2].
Inflammation due to hematoma causes immune reaction and
affects nearby tissues. The skull tables provide natural protection
from soft tissues being eroded [3]. All intradiploic lesions should
be suspected to be hematomas unless proven otherwise in patients
with coagulopathies [2].
Total surgical removal of the hematoma is the treatment of choice.
Some authors recommend cosmetic cranioplasty within the same
surgical procedure [4]. However, most of them prefer to preserve
the intact inner table [5]. According to us, the elastic inner
table must be preserved to avoid postoperative complications.
Acceptable bone remodeling was seen in the seventh year of
follow-up in control CT images. However, a noncompressible inner
table must be excised.
In summary, intradiploic hematoma must be expected when an
intradiploic lesion is seen with hemophilia. The main part of the
surgery is the preservation of the inner table of the cranium in
hemophilic patients. Bone remodeling gives good results with
time.
Keywords: Hemophilia A, Intradiploic hematoma, Coagulopathy,
Intraosseous
Anahtar Sözcükler: Hemofili A, İntradiploik hematom,
Koagülopati, İntraosseoz
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials included.
References
1. Rodriguez-Merchan EC. Musculo-skeletal manifestations of haemophilia.
Blood Rev 2016;30:401-409.
2. Mobbs RJ, Gollapudi PR, Fuller JW, Dahlstrom JE, Chandran NK. Intradiploic
hematoma after skull fracture: case report and literature review. Surg
Neurol 2000;54:87-91.
3. Reeves A, Brown M. Intraosseous hematoma in a newborn with factor VIII
deficiency. AJNR Am Neuroradiol 2000;21:308-309.
4. Tokmak M, Ozek E, Iplikçioğlu C. Chronic intradiploic hematomas of the
skull without coagulopathy: report of two cases. Neurocirugia (Astur)
2015;26:302-306.
5. Dange N, Mahore A, Avinash KM, Joshi V, Kawale J, Goel A. Chronic
intradiploic hematoma in patients with coagulopathy. J Clin Neurosci
2010;17:1047-1049.
Address for Correspondence/Yazışma Adresi: Hakan HANIMOĞLU, M.D.,
İstanbul Bilim University Faculty of Medicine, Department of Neurosurgery, İstanbul, Turkey
Phone: +90 533 544 69 00
E-mail : drhakanhanimoglu@hotmail.com
Received/Geliş tarihi: June 29, 2016
Accepted/Kabul tarihi: September 09, 2016
DOI: 10.4274/tjh.2016.0254
The Second and Third Hemoglobin Kansas Cases in the Turkish
Population
Türk Popülasyonundaki İkinci ve Üçüncü Hemoglobin Kansas Olguları
Zeynep Kayra Tanrıverdi 1 , Arzu Akyay 2 , Aşkın Şen 3 , Çağatay Taşkapan 4 , Ünsal Özgen 2
1İnönü University Faculty of Medicine, Department of Pediatrics, Malatya, Turkey
2İnönü University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Malatya, Turkey
3Fırat University Faculty of Medicine, Department of Medical Genetics, Elazığ, Turkey
4İnönü University Faculty of Medicine, Department of Biochemistry, Malatya, Turkey
To the Editor,
We read with great interest the article by Keser et al. [1] regarding
the first observation of hemoglobin Kansas in Turkey. The authors
described a patient from Malatya as the first case of hemoglobin
Kansas in the Turkish population. After the publication of this
paper, we had two other hemoglobin Kansas cases from the
Malatya region.
Case 1: A 16-year-old female patient was admitted with the
complaint of cyanosis of her lips and nails since birth, but she
had no problems in her daily life. In her family history, there were
other relatives who had the same complaints (Figure 1a). Physical
examination of our patient indicated slight cyanosis of her lips,
nail beds, and skin (Figure 2). Other system examinations were
normal. Transcutaneous oxygen saturation was detected as 50%.
Her complete blood count, electrocardiogram, echocardiogram,
methemoglobin level, and peripheral blood smear were normal.
In blood gas values, pH was 7.39, PCO 2
was 41.1 mmHg, PO 2
was
66.3 mmHg, and the P50 value was 66.94 (normal value: 24-
114

Turk J Hematol 2017;34:99-117
LETTERS TO THE EDITOR
Figure 1. a) Family tree of the patients (transcutaneous oxygen
saturations of the affected individuals are shown in parentheses);
b) hemoglobin Kansas in DNA sequencing of case 1; c) hemoglobin
Kansas in DNA sequencing of case 2.
29). Hemoglobin electrophoresis revealed HbA1 of 56.3%, HbA2
of 43.5%, and HbF of 2%. In beta-globulin gene DNA sequence
analysis, c.308 A>C (β102(G4) Asn>Thr) (Hb Kansas) mutation was
detected (Figure 1b).
Case 2: A 43-year-old patient, the mother of Case 1, was admitted
with the same complaints as her daughter. Transcutaneous
oxygen saturation showed low oxygen levels (PO 2
57%). Complete
blood count, blood chemistry, and cardiac echocardiography were
within normal limits. High-performance liquid chromatography
results were as follows: HbA1 57.2%, HbA2 42.5%, HbF 0.2%. DNA
sequencing revealed the same A to C substitution at nucleotide
position 308 as in the first case (Figure 1c).
Hemoglobin Kansas is a rare, unstable, abnormal hemoglobin
variant with low oxygen affinity in which asparagine is replaced
with threonine in the 102 nd position of the β-globin chain [2,3].
In these patients, hemoglobin leaves more than the normal
amount of oxygen to extrapulmonary tissues. Therefore, tissues
get oxygenated even at low hematocrit levels and patients appear
to be healthy. However, cyanosis is seen because the unsaturated
hemoglobin amount in the capillaries and veins is higher than 5 g/
dL [4]. The P50 values of these patients are also high [5,6].
In total, six hemoglobin Kansas cases were reported from 1968 to
date in the world literature [2,3,4,5]. The first hemoglobin Kansas
case in Turkey was reported in 2015 [1]. Our patients and 17 other
family members who had the same phenotype are more than
all of the reported cases in the world literature. We could not
perform hemoglobin electrophoresis and genetic evaluations of
the other 17 family members because they were living in other
Figure 2. A photograph of case 1 showing cyanosis of her lips.
cities. However, these patients had low transcutaneous oxygen
saturations, as shown in parentheses in Figure 1a. Hemoglobin
Kansas and other unstable hemoglobinopathies with low oxygen
affinity should be considered in the differential diagnosis of
patients with unexplained peripheral cyanosis.
Keywords: Abnormal hemoglobins, Hb Kansas
Anahtar Sözcükler: Anormal hemoglobinler, Hb Kansas
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials included.
References
1. Keser İ, Öztaş A, Bilgen T, Canatan D. First observation of hemoglobin Kansas
[β102(G4)Asn→Thr, AAC>ACC] in the Turkish population. Turk J Hematol
2015;32:371-375.
2. Bonaventura J, Riggs A. Hemoglobin Kansas, a human hemoglobin with a
neutral amino acid substitution and an abnormal oxygen equilibrium. J Biol
Chem 1968;243: 980-991.
3. Morita K, Fukuzawa J, Onodera S, Kawamura Y, Sasaki N, Fujisawa K, Ohba Y,
Miyaji T, Hayashi Y, Yamazaki N. Hemoglobin Kansas found in a patient with
polycythemia. Ann Hematol 1992;65:229-231.
4. Bonini-Domingos CR, Calderan PH, Siqueira FA, Naoum PC. Hemoglobin
Kansas found by electrophoretic diagnosis in Brazil. Rev Bras Hematol
Hemoter 2002;24:37-39.
5. Zimmermann-Baer U, Capalo R, Dutly F, Saller E, Troxler H, Kohler M,
Frischknecht H. Neonatal cyanosis due to a new Gγ-globin variant causing
low oxygen affinity: Hb F-Sarajevo [Gγ102 (G4) Asn→ Thr, AAC> ACC].
Hemoglobin 2012;36:109-113.
6. Riggs A, Gibson QH. Oxygen equilibrium and kinetics of isolated subunits from
hemoglobin Kansas. Proc Natl Acad Sci U S A 1973;70:1718-1720.
Address for Correspondence/Yazışma Adresi: Arzu AKYAY, M.D.,
İnönü University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Malatya, Turkey
Phone: +90 422 341 06 60/5319
E-mail : arzuakyay@yahoo.com
Received/Geliş tarihi: July 29, 2016
Accepted/Kabul tarihi: January 03, 2017
DOI: 10.4274/tjh.2016.0297
115

LETTERS TO THE EDITOR
Turk J Hematol 2017;34:99-117
Leukocytoclastic Vasculitis Associated with a New Anticoagulant:
Rivaroxaban
Yeni bir Antikoagülanla İlişkili Lökositoklastik Vaskülit: Rivaroksaban
Nuri Barış Hasbal, Taner Baştürk, Yener Koç, Tuncay Sahutoğlu, Feyza Bayrakdar Çağlayan, Abdülkadir Ünsal
Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Nephrology, İstanbul, Turkey
To the Editor,
Rivaroxaban, an oral direct factor Xa inhibitor, is one of the nonvitamin
K antagonist anticoagulants and has been approved
for various thrombotic diseases. Here we present a patient who
developed leukocytoclastic vasculitis (LCV) associated with
rivaroxaban as a rare non-bleeding side effect.
A 28-year-old man who was being treated with diltiazem (60 mg/
day) and oral methylprednisolone (32 mg on alternate days) (6 th
month of Pozzi protocol [1]) for IgA nephropathy was admitted to
our hospital with bilateral lower extremity non-blanching palpable
purpura that occurred 10 days following the addition of 20 mg of
rivaroxaban once daily for acute deep venous thrombosis in the
right popliteal vein by another physician. There was no significant
finding in the physical examination except for purpura. The
complete blood count, metabolic panel, urine analysis, coagulation
studies, infectious serologies, rheumatologic work-up, and serum
immunoglobulin E level were all within normal limits. Rivaroxaban
was replaced with subcutaneous enoxaparin sodium at 6000 IU
twice a day, and the skin lesions disappeared within 1 week. Two
weeks later, the patient was prescribed rivaroxaban at 10 mg a
day again by the same physician who was following the patient
for deep venous thrombosis because of the rarity of LCV due to
rivaroxaban in the literature. Bilateral lower extremity purpura
(Figure 1) reoccurred within 3 days of retreatment and a skin
biopsy revealed neutrophil-predominant infiltrations within
and surrounding the dermal small vessels, nuclear dust, vessel
wall damage, erythrocyte extravasation, and fibrin deposition
concurrent with vasculitis. Rivaroxaban was discontinued and
enoxaparin was administered again, and the skin lesions resolved.
The patient was in a clinically steady state for IgA nephropathy
during the two episodes of vasculitis.
LCV is associated with the deposition of the immune complex in
small vessels that brings about loss of vessel wall integrity and
extravasation of erythrocytes by immune response resulting in
purpura. Although drugs and infections are the most common
etiologies for LCV, idiopathic forms of the disease account for
approximately half of all cases [2]. Connective tissue diseases, other
systemic diseases, and hematologic or solid organ malignancies
are other remaining causes of LCV [3]. The interval between
administration of the suspected agent and the onset of symptoms
is variable, symptoms mostly occur 7 to 10 days after exposure.
Treatment of LCV starts with cessation of the causative drug and
palliation of symptoms after systemic involvement is excluded.
Systemic therapies such as colchicine, dapsone, corticosteroids,
and some other immunosuppressive medications are used for
managing serious and refractory disease [3,4].
There is only one similar report in the literature, from Chaaya
et al., in which they presented a 68-year-old male patient with
multiple comorbidities who developed signs of LCV after 7 days of
rivaroxaban treatment due to deep venous thrombosis [5]. In that
report, the findings of LCV disappeared within 1 week following
the discontinuation of rivaroxaban and allopurinol plus a short
course of intravenous methylprednisolone.
In conclusion, this report is the second case of rivaroxabanassociated
LCV in the literature and this adverse event should be
included in the list of significant adverse reactions to rivaroxaban.
Figure 1. Non-blanching palpable purpura is seen on the right
lower leg.
116

Turk J Hematol 2017;34:99-117
LETTERS TO THE EDITOR
All procedures performed in this study involving human
participants were in accordance with the ethical standards of the
institutional research committee and the 1964 Helsinki Declaration
and its later amendments or comparable ethical standards.
Keywords: Vasculitis, Anticoagulants, Rivaroxaban
Anahtar Sözcükler: Vaskülit, Antikoagülan, Rivaroksaban
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials included.
References
1. Pozzi C, Bolasco PG, Fogazzi GB, Andrulli S, Altieri P, Ponticelli C, Locatelli
F. Corticosteroids in IgA nephropathy: a randomised controlled trial. Lancet
1999;353:883-887.
2. Carlson JA, Ng BT, Chen KR. Cutaneous vasculitis update: diagnostic
criteria, classification, epidemiology, etiology, pathogenesis, evaluation and
prognosis. Am J Dermatopathol 2005;27:504-528.
3. Micheletti RG, Werth VP. Small vessel vasculitis of the skin. Rheum Dis Clin
North Am 2015;41:21-32.
4. Grau RG. Drug-induced vasculitis: new insights and a changing lineup of
suspects. Curr Rheumatol Rep 2015;17:71.
5. Chaaya G, Jaller-Char J, Ghaffar E, Castiglioni A. Rivaroxaban-induced
leukocytoclastic vasculitis: a challenging rash. Ann Allergy Asthma Immunol
2016;116:577-578.
Address for Correspondence/Yazışma Adresi: Nuri Barış HASBAL, M.D.,
Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Nephrology, İstanbul, Turkey
E-mail : nbhasbal@gmail.com
Received/Geliş tarihi: October 31, 2016
Accepted/Kabul tarihi: August 31, 2016
DOI: 10.4274/tjh.2016.0353
117

IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.2015.0202
Turk J Hematol 2017;34:118-119
Bullous Sweet’s Syndrome: Report of an Atypical Case Presenting
with Ring-Like, Figurate Lesions
Büllöz Sweet Sendromu: Halka Benzeri, Figüre Lezyonlarla Ortaya Çıkan Atipik Bir Olgu Sunumu
Andaç Salman 1 , Aida Berenjian 1 , Ali Eser 2 , Fatma Dilek Kaymakçı 3 , Leyla Cinel 3 , Işık Kaygusuz Atagündüz 2 , Deniz Yücelten 1 , Tülin Ergun 1
1Marmara University Faculty of Medicine, Department of Dermatology, İstanbul, Turkey
2Marmara University Faculty of Medicine, Department of Hematology, İstanbul, Turkey
3Marmara University Faculty of Medicine, Department of Pathology, İstanbul, Turkey
Figure 1. Widespread, erythematous, ring-like plaques with
peripheral blisters on the trunk (A and B).
Figure 2. Dermal infiltrate rich in neutrophils with subepidermal
blister formation (H&E, 20 x ).
A 68-year-old woman presented with a 2-month history of
erythematous, blistering lesions refractory to systemic antibiotic
treatment. Her medical history was insignificant except for longstanding
diabetes mellitus, hepatitis C infection, and recently
diagnosed myelodysplastic syndrome, refractory anemia with
excess blasts-1 (MDS-RAEB-1). She denied any recent intake
of drugs prior to the onset of skin lesions. Dermatological
examination revealed widespread, erythematous, concentric,
circinate large plaques with peripheral bullae formation over
the trunk and extremities (Figures 1A and 1B). Laboratory tests
disclosed leukocytosis (32x10 9 /L) with neutrophilia (7.2x10 9 /L),
anemia (hemoglobin: 76 g/L), thrombocytopenia (16x10 9 /L),
elevated levels of C-reactive protein (1133.36 nmol/L) and
erythrocyte sedimentation rate (111 mm/h), normal levels
of aspartate aminotransferase (0.17 µkat/L) and alanine
aminotransferase (0.22 µkat/L), and hepatitis C virus-ribonucleic
acid (HCV-RNA) negativity. A punch biopsy was obtained with
a differential diagnosis of bullous Sweet’s syndrome (SS) and
erythema gyratum repens. Histopathology showed diffuse,
dermal inflammatory infiltrate rich in neutrophils with
subepidermal blister formation (Figure 2). Clinical and laboratory
findings confirmed the diagnosis of bullous SS associated with
MDS-RAEB-1. In addition to topical corticosteroids and oral
colchicine, treatment with azacitidine led to rapid resolution of
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Andaç SALMAN M.D.,
Marmara University Faculty of Medicine, Department of Dermatology, İstanbul, Turkey
Phone : +90 216 657 06 06-3533
E-mail : asalmanitf@gmail.com, andac.salman@marmara.edu.tr
Received/Geliş tarihi: May 16, 2015
Accepted/Kabul tarihi: June 15, 2015
118

Turk J Hematol 2017;34:118-119
Salman A, et al: Bullous Sweet’s Syndrome
the lesions. There was no recurrence of SS until the patient’s
death before the second azacitidine cycle.
SS is characterized by erythematous, tender plaques and
papules involving the head, neck, and upper extremities [1,2].
It may be associated with infections, hematologic malignancies,
inflammatory bowel disease, and drugs [2]. SS may also be
associated with chronic active hepatitis; however, normal
liver function tests, HCV-RNA negativity, and the temporal
relationship between skin lesions and hematological findings
in our case make this unlikely. Although pseudovesicular
appearance due to severe edema can be seen in SS, bullae
formation with figurate and ring-like lesions is rare [3,4,5].
Figurate lesions without bullae in SS were previously reported
in a patient with no associated disease [3]. In conclusion, the
diagnosis of SS should be kept in mind in patients with erythema
gyratum repens-like or concentric blistering lesions.
Keywords: Bullous, Figurate erythema, Myelodysplastic
syndrome, Sweet’s syndrome
Anahtar Sözcükler: Büllöz, Figüre eritem, Miyelodisplastik
sendrom, Sweet sendromu
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Anzalone CL, Cohen PR. Acute febrile neutrophilic dermatosis (Sweet’s
syndrome). Curr Opin Hematol 2013;20:26-35.
2. Paydas S. Sweet’s syndrome: a revisit for hematologists and oncologists. Crit
Rev Oncol Hematol 2013;86:85-95.
3. Behm B, Schreml S, Landthaler M, Babilas P. Sweet’s syndrome masquerading
as figurate erythema. Int J Dermatol 2012;51:1101-1103.
4. Neoh CY, Tan AWH, Ng SK. Sweet’s syndrome: a spectrum of unusual clinical
presentations and associations. Br J Dermatol 2007;156:480-485.
5. Voelter-Mahlknecht S, Bauer J, Metzler G, Fierlbeck G, Rassner G. Bullous
variant of Sweet’s syndrome. Int J Dermatol 2005;44:946-947.
119

IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.2015.0416
Turk J Hematol 2017;34:120-121
Griscelli Syndrome Presented with Status Epilepticus and
Hemophagocytic Lymphohistiocytosis
Status Epileptikus ve Hemofagositik Lenfohistiyositoz ile Başvuran Griscelli Sendromu
Fatih Demircioğlu 1 , Hilal Aydın 2 , Mustafa Erkoçoğlu 3 , Hüseyin Önay 4 , Emine Dağıstan 5
1Abant İzzet Baysal University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bolu, Turkey
2Abant İzzet Baysal University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Neurology, Bolu, Turkey
3Abant İzzet Baysal University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Immunology and Allergy, Bolu, Turkey
4Ege University Faculty of Medicine, Department of Molecular Biology and Genetics, İzmir, Turkey
5Abant İzzet Baysal University Faculty of Medicine, Department of Radiology, Bolu, Turkey
Figure 1. (a) Partial albinism with silvery gray hair. (b) Bone marrow
examination showing hemophagocytosis. (c) Hair examination
showing irregularly scanty melanin pigments.
Figure 2. Griscelli syndrome: cerebral involvement. (a) Axial T1-
weighted magnetic resonans (MR) image shows bilateral lowsignal-intensity
areas in white matter of cerebellum. (b) Axial
fluid attenuation inversion recovery MR image demonstrates
high-signal-intensity in this area. (c) Axial T2-weighted MR image
at lateral ventricle level. (d, e) Axial and coronal T2-weighed
images showing cerebral atrophy and diffuse high-signalintensity
in cerebral white matter. (f) Contrast-enhanced coronal
T1-weighted MR image demonstrates no contrast uptake.
A 12-month-old female infant was referred to our hospital
with prolonged fever and status epilepticus. Her weight
and height were below the 5 th percentile for age. Physical
examination revealed marked hypotonia, fever, pallor, partial
albinism with silvery gray hair, and hepatosplenomegaly
(Figure 1A). Laboratory investigations showed anemia,
thrombocytopenia, hypofibrinogenemia, hyperferritinemia, and
hemophagocytosis at bone marrow examination (Figure 1B).
Lymphocyte subsets and serum immunoglobulin levels were
normal. Hair examination showed irregularly scanty melanin
pigments (Figure 1C). Electroencephalographic study revealed
encephalopathic findings, including decreased background
activity with continuous slow wave discharges. Brain magnetic
resonance imaging showed diffuse cerebral involvement
(Figure 2). RAB27A encoding gene C.149delG mutation
was detected. We diagnosed Griscelli syndrome (GS) with
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Fatih DEMİRCİOĞLU, M.D.
Abant İzzet Baysal University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bolu, Turkey
Phone : +90 374 270 45 75-3463
E-mail : fatih_demircioglu@yahoo.com
Received/Geliş tarihi: December 03, 2015
Accepted/Kabul tarihi: January 15, 2015
120

Turk J Hematol 2017;34:120-121
Demercioğlu F, et al. Griscelli Syndrome Presented with Status Epilepticus and Hemophagocytic Lymphohistiocytosis
hemophagocytic lymphohistiocytosis (HLH). She received the
HLH-2004 treatment protocol. The patient showed complete
hematological response to treatment and was discharged after
1 month with persistent neurological involvement. Although
bone marrow transplantation is the only curative therapy for
GS, we did not plan bone marrow transplantation due to the
severe neurological sequela. The patient died due to progressive
disease after 6 months.
GS is an autosomal recessive disorder characterized by the
silvery gray sheen of the hair and hypopigmentation of the
skin, which can be associated with neurological impairment,
psychomotor retardation, HLH, and immunodeficiency [1].
Both GS and Chediak-Higashi syndrome may present with
oculocutaneous albinism, neutropenia, immune dysfunction,
and accelerated phase. In differential diagnosis, the absence of
bleeding disorders and giant granules in leukocytes, and finally
gene analysis, helped us to exclude Chediak-Higashi syndrome
[2]. GS type 1 is caused by a mutation in the myosin Va (MYO5A)
gene, GS type 2 is caused by mutations in the RAB27A encoding
gene, and GS type 3 is due to mutations in the MLPH gene,
which forms a protein complex with Rab27a and myosin Va
[3,4]. Hematopoietic stem cell transplantation is the only
curative treatment for GS with HLH [3,4].
Keywords: Children, Griscelli syndrome, Status epilepticus,
Hemophagocytic lymphohistiocytosis
Anahtar Sözcükler: Çocuk, Griscelli sendromu, Status
epileptikus, Hemofagositik lenfohistiyositoz
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Patıroğlu T, Özdemir MA, Patıroğlu TE. Griscelli’s syndrome: clinical and
immunological features of two siblings. Turk J Hematol 2000;17:85-87.
2. Dotta L, Parolini S, Prandini A, Tabellini G, Antolini M, Kingsmore SF,
Badolato R. Clinical, laboratory and molecular signs of immunodeficiency
inpatients with partial oculo-cutaneous albinism. Orphanet J Rare Dis
2013;8:168.
3. Aslan D, Sari S, Derinöz O, Dalgiç B. Griscelli syndrome: description of a case
with Rab27A mutation. Pediatr Hematol Oncol 2006;23:255-261.
4. Meeths M, Bryceson YT, Rudd E, Zheng C, Wood SM, Ramme K, Beutel K,
Hasle H, Heilmann C, Hultenby K, Ljunggren HG, Fadeel B, Nordenskjöld M,
Henter JI. Clinical presentation of Griscelli syndrome type 2 and spectrum
of RAB27A mutations. Pediatr Blood Cancer 2010;54:563-572.
121

IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.2015.0354
Turk J Hematol 2017;34:122-123
Acute Monoblastic Leukemia Presenting with Multiple
Granulocytic Sarcoma Nodules
Granülositik Sarkom Nodülleri ile Ortaya Çıkan Bir Akut Monoblastik Lösemi Olgusu
Asude Kara 1 , Aslı Akın Belli 1 , Yelda Dere 2 , Volkan Karakuş 3 , Şükrü Kasap 4 , Erdal Kurtoğlu 5 , Mine Hekimgil 6
1Muğla Sıtkı Koçman University Training and Research Hospital, Department of Dermatology, Muğla, Turkey
2Muğla Sıtkı Koçman University Faculty of Medicine, Department of Pathology, Muğla, Turkey
3Muğla Sıtkı Koçman University Training and Research Hospital, Department of Hematology, Muğla, Turkey
4Muğla Sıtkı Koçman University Faculty of Medicine, Department of Plastic Surgery, Muğla, Turkey
5Antalya Training and Research Hospital, Clinic of Hematology, Antalya, Turkey
6Ege University Faculty of Medicine, Department of Pathology, İzmir, Turkey
Figure 1. Violaceous nodules with central pustules and scaling on
the right leg.
Figure 2. (A) Bone marrow biopsy showing hypercellularity (H&E,
100x). (B) Bone marrow aspiration smear showing erythroblasts
and blastic cells with nuclear indentation (Giemsa, 400 x ). (C) CD34
(+) blastic cells (200 x ). (D) Myeloperoxidase (+) blastic cells (200 x ).
A 76-year-old male presented to the department of plastic
surgery with multiple nodules on his legs for 1 month. On
examination, there were five discrete, violaceous nodules with a
size of 0.5-3 cm on the legs (Figure 1). Laboratory tests revealed
the following: white blood cell count of 3.6x10 9 /L, red blood cell
count of 1.54x10 12 /L, platelet count of 82x10 9 /L, hemoglobin
of 4.45 g/dL, and lactate dehydrogenase of 266 U/L. Due to
pancytopenia, the patient was referred to the department of
hematology before the excision. Peripheral blood smear showed
50% neutrophils, 40% lymphocytes, 8% monocytes, and 2%
atypical cells. An excisional biopsy of skin lesions and a bone
marrow biopsy (BMB) were performed. The BMB revealed
monoblastic cell infiltration (40%) and immunohistochemical
stains were positive with CD34 and myeloperoxidase (Figures
2A-2D). CD13, CD34, CD117, CD4, CD33, myeloperoxidase,
CD38, and CD11c were detected in the blastic cells, which
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Yelda DERE, M.D.,
Muğla Sıtkı Koçman University Faculty of Medicine, Department of Pathology, Muğla, Turkey
Phone : +90 505 465 31 98
E-mail : yeldamorgul@gmail.com
Received/Geliş tarihi: October 09, 2015
Accepted/Kabul tarihi: January 09, 2016
122

Turk J Hematol 2017;34:122-123
Kara A, et al: Acute Monoblastic Leukemia Presenting with Multiple Granulocytic Sarcoma Nodules
lymphoplasmacytic infiltration in the dermis, including
occasional blastic cells with morphologic features similar to the
BMB findings like folded nuclei (Figures 3A-3D), was detected
and diagnosed as granulocytic sarcoma (GS). However, the
patient refused chemotherapy with azacitidine. Since cutaneous
involvement of GS is rare and indicates poor prognosis, GS
should be remembered in the differential diagnosis of suddenly
emerging nodules and pustules [1,2].
Keywords: Granulocytic sarcoma, Acute monoblastic leukemia,
CD34, Myeloperoxidase
Anahtar Sözcükler: Granülositik sarkom, Akut monoblastik
lösemi, CD34, Miyeloperoksidaz
Figure 3. (A) Ulceration and pseudo-epitheliomatous hyperplasia
in the epidermis, and inflammatory infiltration with capillary
vessel proliferation under the epidermis (H&E, 40 x ). (B, C)
Occasional blastic cells with folded nuclei that show monoblastic
morphology similar to the bone marrow and plasma cells with
thin-walled capillaries (H&E, 400 x ). (D) CD34 staining showing
positivity in the endothelial cells intensely and scattered blasts
(400 x ).
formed 31.4% of the population, by flow cytometry. The
results were compatible with monoblastic leukemia and no
genetic abnormalities were found. Histopathologically reactive
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Yilmaz AF, Saydam G, Sahin F, Baran Y. Granulocytic sarcoma: a systematic
review. Am J Blood Res 2013;3:265-270.
2. Hurley MY, Ghahramani GK, Frisch S, Armbrecht ES, Lind AC, Nguyen TT,
Hassan A, Kreisel FH, Frater JL. Cutaneous myeloid sarcoma: natural history
and biology of an uncommon manifestation of acute myeloid leukemia.
Acta Derm Venereol 2013;93:319-324.
123

IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.2016.0258
Turk J Hematol 2017;34:124-125
Internuclear Bridging of Erythroid Precursors in the Peripheral
Blood Smear of a Patient with Primary Myelofibrosis
Primer Miyelofibroz Tanılı Bir Hastanın Çevre Kanı Yaymasında Eritroid Öncüllerin
Nükleuslar Arası Köprüleşmesi
Roger K. Schindhelm 1 , Marije M. van Santen 2 , Arie C. van der Spek 3
1Northwest Clinics, Department of Clinical Chemistry, Hematology and Immunology, Den Helder, the Netherlands
2Symbiant Pathology Expert Center, Alkmaar, the Netherlands
3Northwest Clinics, Department of Internal Medicine, Den Helder, the Netherlands
Figure 1. Bone marrow biopsy showing marked increase in
reticulin fibers, especially in the areas of megakaryocyte clustering
(Gomori, 10 x ).
Figure 2. Blood smear demonstrating teardrop cells, erythroid
precursor with internuclear bridging, and one blast cell (May-
Grünwald-Giemsa, 50 x ).
An 84-year-old male diagnosed with primary myelofibrosis
based on WHO grade 2-3 fibrosis (Figure 1) and the presence
of the JAK2-V617F mutation was treated with supportive
care. During 2 years of follow-up, his hemoglobin level was
maintained at approximately 6.5 mmol/L and platelet count
declined from 128x10 9 /L at presentation to 50x10 9 /L. White
blood cells did not exceed 12.0x10 9 /L, while the fraction of
blast cells increased to 10%. Elevated levels of teardrop cells
were observed and the nucleated red blood cell count gradually
increased from non-detectable to 2.4x10 12 /L. Recent peripheral
blood smears showed bi- and tri-nucleated red blood cells,
and even more notably, erythroid precursors with internuclear
chromatin and cytoplasmic bridging (Figures 2 and 3). In
concurrence with laboratory findings, physical examination
revealed progressive splenomegaly (8 cm palpable below
the rib margin) and weight loss. Erythroid precursors with
internuclear bridging in a blood smear is a rare morphological
finding and is considered a diagnostic morphologic feature
in patients with congenital dyserythropoietic anemia type I
and a morphological manifestation of dyserythropoiesis in
©Copyright 2017 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Roger K. SCHINDHELM Ph.D.,
Northwest Clinics, Department of Clinical Chemistry, Hematology and Immunology, Den Helder, the Netherlands
Phone : +31 72 548 44 44
E-mail : r.k.schindhelm@nwz.nl
Received/Geliş tarihi: July 04, 2016
Accepted/Kabul tarihi: September 19, 2016
124

Turk J Hematol 2017;34:124-125
Schindhelm RK, et al: Erythroid Precursors’ Internuclear Bridging
patients with myelodysplastic syndrome [1,2]. In patients with
myeloproliferative neoplasms, erythroid precursors’ internuclear
bridging may indicate the transition to a more aggressive phase.
Keywords: Primary myelofibrosis, Internuclear bridging,
Erythrocytes
Anahtar Sözcükler: Primer miyelofibroz, Nükleuslar arası
köprüleşme, Eritrositler
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/or
affiliations relevant to the subject matter or materials included.
Figure 3. Blood smear demonstrating erythroid precursor with
internuclear and cytoplasmic bridging (May-Grünwald-Giemsa,
100 x ).
References
1. Iolascon A, Esposito MR, Russo R. Clinical aspects and pathogenesis of
congenital dyserythropoietic anemias: from morphology to molecular
approach. Haematologica 2012;97:1786-1794.
2. Head DR, Kopecky K, Bennett JM, Grenier K, Morrison FS, Miller KB, Grever
MR. Pathogenetic implications of internuclear bridging in myelodysplastic
syndrome. An Eastern Cooperative Oncology Group/Southwest Oncology
Group Cooperative Study. Cancer 1989;64:2199-2202.
125

Advisory Board of This Issue (March 2017)
Ahmet Emre Eşkazan, Turkey
Akif Selim Yavuz, Turkey
Alphan Küpesiz, Turkey
Amir Steinberg, USA
Antonio Perez-Ferrer, Spain
Ayşegül Ünüvar, Turkey
Aytemiz Gürgey, Turkey
Burak Deveci, Turkey
Burak Uz, Turkey
Burhan Ferhanoğlu, Turkey
Cem Ar, Turkey
Ceyhun Bozkurt, Turkey
Deniz Karapınar, Turkey
Dimitrios Tsakiris, Switzerland
Emre Tekgündüz, Turkey
Erol Erduran, Turkey
Francesco Onida, Italy
Gerard Chaaya, USA
Giuseppe Saglio, Italy
Gonce Gökdemir, Turkey
Guillaume Moulis, France
Gülden Gökçay, Turkey
Gwo-Shing Chen, Taiwan
Halis Akalın, Turkey
Işınsu Kuzu, Turkey
Jan Stasko, Slovakia
Jean François Lesesve, France
Joan Cid, Spain
John Bennett, USA
Kaan Kavaklı, Turkey
Lacey Johnson, Australia
Malgorzata Kus-Liskiewicz, Poland
Maria Papaioannou, UK
Marie Ambroise, India
Meltem Aylı, Turkey
Murat Akova, Turkey
Mutlu Arat, Turkey
Nil Güler, Turkey
Nükhet Tüzüner, Turkey
Ovidlu Oprea, Romania
Ozan Salim, Turkey
Pervin Topçuoğlu, Turkey
Piotr Szweda, Poland
Qianli Jiang, China
Rıdvan Ali, Turkey
Semra Paydaş, Turkey
Serap Karaman, Turkey
Serdar Şıvgın, Turkey
Sergey Kulikov, Russia
Steven Lane, UK
Şule Ünal, Turkey
Tahsin Özpolat, Turkey
Tamojit Chaudhuri, India
Tiraje Celkan, Turkey
Tomas Jose Gonzalez Lopez, Spain
Tunç Fışgın, Turkey
Türkan Patıroğlu, Turkey
Vildan Özkocaman, Turkey
Wolfgang Sperr, Austria
Yeşim Aydınok, Turkey
Yuh-Tai Wang, Taiwan
Yuhong Shi, USA
Zahit Bolaman, Turkey
Zeynep Karakaş, Turkey
Zühre Kaya, Turkey