Turkish Journal of Hematology Volume: 31 - Issue: 1

Volume 31 Issue 1 March 2014 40 TL
ISSN 1300-7777
History of Turkish Journal of Hematology
Review Article
β-Thalassemia Intermedia: A Bird’s-Eye View
Anthony Haddad et al.; Beirut, Lebanon
Research Articles
A Polymorphism in the IL-5 Gene is Associated with Inhibitor Development in
Severe Hemophilia A Patients
İnanç Değer Fidancı, et al.; İstanbul, İzmir, Adana, Turkey
Evaluation of Red Cell Membrane Cytoskeletal Disorders Using a Flow Cytometric Method in South Iran
Habib Alah Golafshan, et al.; Shiraz, Iran
Childhood Immune Thrombocytopenia: Long-term Follow-up Data Evaluated by the Criteria of the
International Working Group on Immune Thrombocytopenic Purpura
Melike Sezgin Evim, et al.; Bursa, Turkey
NPM1 Gene Type A Mutation in Bulgarian Adults with Acute Myeloid Leukemia: A Single-Institution Study
Gueorgui Balatzenko et al.; Sofia, Bulgaria
Leukocyte Populations and C-Reactive Protein as Predictors of Bacterial Infections in
Febrile Outpatient Children
Zühre Kaya, et al.; Ankara, Turkey
FIP1L1-PDGFRA-Positive Chronic Eosinophilic Leukemia: A Low-Burden Disease with Dramatic
Response to Imatinib - A Report of 5 Cases from South India
Anıl Kumar N. et al; Karnataka, Delhi, India
The Association between Obesity and Insulin Resistance and Anemia and Iron Metabolism:
A Single-Center, Cross-Sectional Study
Esma Altunoğlu; İstanbul, Turkey
The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity
Ayşenur Bahadır et al; İstanbul, Trabzon, Ankara, Turkey
Cover Picture:
Güçhan Alanoğlu
Gölcük, Isparta

Editor-in-Chief
Aytemiz Gürgey
Ankara, Turkey
Associate Editors
Ayşegül Ünüvar
İstanbul University, İstanbul, Turkey
Celalettin Üstün
University of Minnesota, Minnesota, USA
Cem Ar
İstanbul University Cerrahpaşa Faculty of
Medicine, İstanbul, Turkey
İbrahim Haznedaroğlu
Hacettepe University, Ankara, Turkey
İlknur Kozanoğlu
Başkent University, Adana, Turkey
Hale Ören
Dokuz Eylül University, İzmir, Turkey
Mehmet Ertem
Ankara University, Ankara, Turkey
Muzaffer Demir
Trakya University, Edirne, Turkey
Reyhan Diz Küçükkaya
İstanbul Bilim University, İstanbul, Turkey
Assistant Editors
A. Emre Eşkazan
İstanbul University Cerrahpaşa Faculty of
Medicine, İstanbul, Turkey
Ali İrfan Emre Tekgündüz
Dr. A. Yurtaslan Ankara Oncology Training
and Research Hospital, Ankara, Turkey
Nil Güler
On Dokuz Mayıs University, Samsun, Turkey
Olga Meltem Akay
Osmangazi University, Eskişehir, Turkey
Selami Koçak Toprak
Ankara University, Ankara, Turkey
Şule Ünal
Hacettepe University, Ankara, Turkey
Ümit Üre
Bakırköy Dr. Sadi Konuk Training and
Research Hospital, İstanbul, Turkey
Veysel Sabri Hançer
İstanbul Bilim University, İstanbul, Turkey
Zühre Kaya
Gazi University, Ankara, Turkey
International Review Board
Nejat Akar
Görgün Akpek
Serhan Alkan
Çiğdem Altay
Koen van Besien
Ayhan Çavdar
M.Sıraç Dilber
Ahmet Doğan
Peter Dreger
Thierry Facon
Jawed Fareed
Gösta Gahrton
Dieter Hoelzer
Marilyn Manco-Johnson
Andreas Josting
Emin Kansu
Winfried Kern
Nigel Key
Korgün Koral
Abdullah Kutlar
Luca Malcovati
Robert Marcus
Jean Pierre Marie
Ghulam Mufti
Gerassimos A. Pangalis
Antonio Piga
Ananda Prasad
Jacob M. Rowe
Jens-Ulrich Rüffer
Norbert Schmitz
Orhan Sezer
Anna Sureda
Ayalew Tefferi
Nükhet Tüzüner
Catherine Verfaillie
Srdan Verstovsek
Claudio Viscoli
Past Editors
Erich Frank
Orhan Ulutin
Hamdi Akan
Senior Advisory Board
Yücel Tangün
Osman İlhan
Muhit Özcan
TOBB Economy Technical University Hospital, Ankara, Turkey
Maryland School of Medicine, Baltimore, USA
Cedars-Sinai Medical Center, USA
Ankara, Turkey
Chicago Medical Center University, Chicago, USA
Ankara, Turkey
Karolinska University, Stockholm, Sweden
Mayo Clinic Saint Marys Hospital, USA
Heidelberg University, Heidelberg, Germany
Lille University, Lille, France
Loyola University, Maywood, USA
Karolinska University Hospital, Stockholm, Sweden
Frankfurt University, Frankfurt, Germany
Colorado Health Sciences University, USA
University Hospital Cologne, Cologne, Germany
Hacettepe University, Ankara, Turkey
Albert Ludwigs University, Germany
University of North Carolina School of Medicine, NC, USA
Southwestern Medical Center, Texas, USA
Georgia Health Sciences University, Augusta, USA
Pavia Medical School University, Pavia, Italy
Kings College Hospital, London, UK
Pierre et Marie Curie University, Paris, France
King’s Hospital, London, UK
Athens University, Athens, Greece
Torino University, Torino, Italy
Wayne State University School of Medicine, Detroit, USA
Rambam Medical Center, Haifa, Israel
University of Köln, Germany
AK St Georg, Hamburg, Germany
Memorial Şişli Hospital, İstanbul, Turkey
Santa Creu i Sant Pau Hospital, Barcelona, Spain
Mayo Clinic, Rochester, Minnesota, USA
Istanbul Cerrahpaşa University, İstanbul, Turkey
University of Minnesota, Minnesota, USA
The University of Texas MD Anderson Cancer Center, Houston, USA
San Martino University, Genoa, Italy
Language Editor
Leslie Demir
Statistic Editor
Hülya Ellidokuz
Editorial Office
İpek Durusu
Bengü Timoçin
A-I
Publishing
Services
GALENOS PUBLISHER
Molla Gürani Mah. Kaçamak Sk. No: 21, Fındıkzade-İstanbul
Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information
Editorial Correspondence should be addressed to Dr. Aytemiz Gürgey
Editor-in-Chief
Address: 725. Sok. Görkem Sitesi
Yıldızevler No: 39/2, 06550 Çankaya, Ankara / Turkey
Phone : +90 312 438 14 60
E-mail : agurgey@hacettepe.edu.tr
All other inquiries should be adressed to
TURKISH JOURNAL OF HEMATOLOGY
Address: İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara / Turkey
Phone : +90 312 490 98 97
Fax : +90 312 490 98 68
E-mail : info@tjh.com.tr
ISSN: 1300-7777
Turkish Society of Hematology
Teoman Soysal, President
Muzaffer Demir, General Secretary
Hale Ören, Vice President
İbrahim Haznedaroğlu, Research Secretary
Fahir Özkalemkaş, Treasurer
Zahit Bolaman, Member
Mehmet Sönmez, Member
Online Manuscript Submission
http://mc.manuscriptcentral.com/tjh
Web page
www.tjh.com.tr
Owner on behalf of the Turkish Society of Hematology
Türk Hematoloji Derneği adına yayın sahibi
Teoman Soysal
Publishing Manager
Sorumlu Yazı İşleri Müdürü
Muzaffer Demir
Management Address
Yayın İdare Adresi
Türk Hematoloji Derneği
İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550
Çankaya, Ankara / Turkey
Publishing House / Yayınevi
Molla Gürani Mah. Kaçamak Sk. No: 21, 34093 Fındıkzade, İstanbul
Tel: +90 212 621 99 25 Faks: +90 212 621 99 27
E-posta: info@galenos.com.tr
Baskı: Senk Ofset Matbaacılık Reklam Promosyon ve Tan. Hiz. San.
Dış. Tic. Ltd. Şti. Tel.: +90 212 493 26 26 Topkapı Litros yolu, No: 24,
Zeytinburnu, İstanbul
Printing Date / Basım Tarihi
25.02.2014
Cover Picture
Güçhan Alanoğlu was born in 1959, Turkey. She is currently
working at Süleyman Demirel University,
Department of Hematology, Isparta.
Üç ayda bir yayımlanan İngilizce süreli yayındır.
International scientific journal published quarterly.
Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish Journal of Hematology’nin
Türk Hematoloji Derneği İktisadi İşletmesi tarafından yayınlanmasına karar vermiştir.
A-II

AIMS AND SCOPE
The Turkish Journal of Hematology is published quarterly
(March, June, September, and December) by the Turkish Society
of Hematology. It is an independent, non-profit peer-reviewed
international English-language periodical encompassing subjects
relevant to hematology.
The Editorial Board of The Turkish Journal of Hematology adheres
to the principles of the World Association of Medical Editors
(WAME), International Council of Medical Journal Editors (ICMJE),
Committee on Publication Ethics (COPE), Consolidated Standards
of Reporting Trials (CONSORT) and Strengthening the Reporting of
Observational Studies in Epidemiology (STROBE).
The aim of The Turkish Journal Hematology is to publish original
hematological research of the highest scientific quality and
clinical relevance. Additionally, educational material, reviews on
basic developments, editorial short notes, case reports, images in
hematology, and letters from hematology specialists and clinicians
covering their experience and comments on hematology and related
medical fields as well as social subjects are published.
General practitioners interested in hematology and internal medicine
specialists are among our target audience, and The Turkish Journal
of Hematology aims to publish according to their needs. The Turkish
Journal of Hematology is indexed, as follows:
- PUBMED Central
- Science Citation Index Expanded
- EMBASE
- Scopus
- CINAHL
- Gale/Cengage Learning
- EBSCO
- DOAJ
- ProQuest
- Index Copernicus
- Tübitak/Ulakbim Turkish Medical Database
- Turk Medline
Impact Factor: 0.494
Subscription Information
The Turkish Journal of Hematology is sent free-of-charge to members
of Turkish Society of Hematology and libraries in Turkey and
abroad. Hematologists, other medical specialists that are interested
in hematology, and academicians could subscribe for only 40 $ per
printed issue. All published volumes are available in full text free-ofcharge
online at www.tjh.com.tr.
Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8,
Çankaya, Ankara, Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: info@tjh.com.tr
Permissions
Requests for permission to reproduce published material should be
sent to the editorial office.
Editor: Professor Dr. Aytemiz Gürgey
Adress: Ilkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8,
Çankaya, Ankara, Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: info@tjh.com.tr
Publisher
Galenos Yayinevi
Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul
Telefon : 0212 621 99 25
Fax : 0212 621 99 27
info@galenos.com.tr
Instructions for Authors
Instructions for authors are published in the journal and at www.
tjh.com.tr
Material Disclaimer
Authors are responsible for the manuscripts they publish in The
Turkish Journal of Hematology. The editor, editorial board, and
publisher do not accept any responsibility for published manuscripts.
The journal is printed on acid-free paper.
Editorial Policy
Following receipt of each manuscript, a checklist is completed by
the Editorial Assistant. The Editorial Assistant checks that each
manuscript contains all required components and adheres to the
author guidelines, after which time it will be forwarded to the Editor
in Chief. Following the Editor in Chief’s evaluation, each manuscript
is forwarded to the Associate Editor, who in turn assigns reviewers.
Generally, all manuscripts will be reviewed by at least three reviewers
selected by the Associate Editor, based on their relevant expertise.
Associate editor could be assigned as a reviewer along with the
reviewers. After the reviewing process, all manuscripts are evaluated
in the Editorial Board Meeting.
Turkish Journal of Hematology’s editor and Editorial Board
members are active researchers. It is possible that they would desire
to submit their manuscript to the Turkish Journal of Hematology.
This may be creating a conflict of interest. These manuscripts will
not be evaluated by the submitting editor(s). The review process
will be managed and decisions made by editor-in-chief who will act
independently. In some situation, this process will be overseen by an
outside independent expert in reviewing submissions from editors.
A-III

TURKISH JOURNAL OF HEMATOLOGY
INSTRUCTIONS TO AUTHORS
The Turkish Journal of Hematology accepts invited review articles,
research articles, brief reports, case reports, letters to the editor, and
hematological images that are relevant to the scope of hematology,
on the condition that they have not been previously published
elsewhere. Basic science manuscripts, such as randomized, cohort,
cross-sectional, and case control studies, are given preference. All
manuscripts are subject to editorial revision to ensure they conform
to the style adopted by the journal. There is a single blind kind of
reviewing system.
Manuscripts should be prepared according to ICMJE guidelines
(http://www.icmje.org/). Original manuscripts require a structured
abstract. Label each section of the structured abstract with the
appropriate subheading (Objective, Materials and Methods, Results,
and Conclusion). Case reports require short unstructured abstracts.
Letters to the editor do not require an abstract. Research or project
support should be acknowledged as a footnote on the title page.
Technical and other assistance should be provided on the title page.
Original Manuscripts
Title Page
Title: The title should provide important information regarding the
manuscript’s content. The title must specify that the study is a cohort
study, cross-sectional study, case control study, or randomized study
(i.e. Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative
bioavailability of ferrous succinate tablet formulations without
correction for baseline circadian changes in iron concentration in
healthy Chinese male subjects: A single-dose, randomized, 2-period
crossover study. Clin Ther. 2011; 33: 2054-2059).
The title page should include the authors’ names, degrees, and
institutional/professional affiliations, a short title, abbreviations,
keywords, financial disclosure statement, and conflict of interest
statement. If a manuscript includes authors from more than one
institution, each author’s name should be followed by a superscript
number that corresponds to their institution, which is listed separately.
Please provide contact information for the corresponding author,
including name, e-mail address, and telephone and fax numbers.
Running Head: The running head should not be more than 40
characters, including spaces, and should be located at the bottom of
the title page.
Word Count: A word count for the manuscript, excluding abstract,
acknowledgments, figure and table legends, and references, should
be provided not exceed 2500 words. The word count for an abstract
should be not exceed 300 words.
Conflict-of-Interest Statement: To prevent potential conflicts of
interest from being overlooked, this statement must be included in
each manuscript. In case there are conflicts of interest, every author
should complete the ICMJE general declaration form, which can be
obtained at: http://www.icmje.org/coi_disclose.pdf.
Abstract and Keywords: The second page should include an abstract
that does not exceed 300 words. For manuscripts sent by authors
in Turkey, a title and abstract in Turkish are also required. As most
readers read the abstract first, it is critically important. Moreover, as
various electronic databases integrate only abstracts into their index,
important findings should be presented in the abstract.
Objective: The abstract should state the objective (the purpose of the
study and hypothesis) and summarize the rationale for the study.
Materials and Methods: Important methods should be written
respectively.
Results: Important findings and results should be provided here.
Conclusion: The study’s new and important findings should be
highlighted and interpreted.
Other types of manuscripts, such as case reports, reviews, perspectives,
and editorials, will be published according to uniform requirements.
Provide 3-10 keywords below the abstract to assist indexers. Use
terms from the Index Medicus Medical Subject Headings List
(for randomized studies a CONSORT abstract should be provided
(http://www.consort-statement.org).
Introduction: The introduction should include an overview of the
relevant literature presented in summary form (one page), and what
ever remains interesting, unique, problematic, relevant, or unknown
about the topic must be specified. The introduction should conclude
with the rationale for the study, its design, and its objective(s).
Materials and Methods: Clearly describe the selection of observational
or experimental participants, such as patients, laboratory animals, and
controls, including inclusion and exclusion criteria and a description
of the source population. Identify the methods and procedures in
sufficient detail to allow other researchers to reproduce your results.
Provide references to established methods (including statistical
methods), provide references to brief modified methods, and provide
the rationale for using them and an evaluation of their limitations.
Identify all drugs and chemicals used, including generic names,
doses, and routes of administration. The section should include only
information that was available at the time the plan or protocol for
the study was devised (http://www.strobe-statement.org/fileadmin/
Strobe/uploads/checklists/STROBE_checklist_v4_combined.pdf).
A-IV

Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
the reported results. Statistically important data should be given in the
text, tables and figures. Provide details about randomization, describe
treatment complications, provide the number of observations, and
specify all computer programs used.
Results: Present your results in logical sequence in the text, tables, and
figures. Do not present all the data provided in the tables and/or figures in
the text; emphasize and/or summarize only important findings, results,
and observations in the text. For clinical studies provide the number
of samples, cases, and controls included in the study. Discrepancies
between the planned number and obtained number of participants
should be explained. Comparisons, and statistically important values
(i.e. P value and confidence interval) should be provided.
Discussion: This section should include a discussion of the data.
New and important findings/results, and the conclusions they lead
to should be emphasized. Link the conclusions with the goals of
the study, but avoid unqualified statements and conclusions not
completely supported by the data. Do not repeat the findings/results
in detail; important findings/results should be compared with those of
similar studies in the literature, along with a summarization. In other
words, similarities or differences in the obtained findings/results with
those previously reported should be discussed. Limitations of the
study should be detailed. In addition, an evaluation of the implications
of the obtained findings/results for future research should be outlined.
References
Cite references in the text, tables, and figures with numbers in
parentheses. Number references consecutively according to the
order in which they first appear in the text. Journal titles should be
abbreviated according to the style used in Index Medicus (consult List
of Journals Indexed in Index Medicus). Include among the references
any paper accepted, but not yet published, designating the journal
and followed by, in press.
Examples of References:
1. List all authors.
Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for
marrow transplantation from unrelated donors for patients with
aplastic anemia after failure immunosuppressive therapy. Blood
2006;108:1485-1491.
2.Organization as author
Royal Marsden Hospital Bone Marrow Transplantation Team. Failure
of syngeneic bone marrow graft without preconditioning in posthepatitis
marrow aplasia. Lancet 1977;2:742-744.
3.Book
Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea &
Febiger, 1961.
4. Book Chapter
Perutz MF. Molecular anatomy and physiology of hemoglobin. In:
Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of
Hemoglobin: Genetics, Pathophysiology, Clinical Management. New
York, Cambridge University Press, 2000.
5.Abstract
Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand
(thrombopoietin) stimulates tyrosine phosphorylation. Blood
1994;84:390a (abstract).
6.Letter to the Editor
Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further
definition of 20q deletion in myeloid leukemia using fluorescence in
situ hybridization. Blood 1994;84:2821-2823.
7. Supplement
Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr
Transplant. 2005;9(Suppl 7):81-86
Brief Reports
Abstract length: Not to exceed 300 words.
Article length: Not to exceed 1200 words.
Introduction: State the purpose and summarize the rationale for the
study.
Materials and Methods: Clearly describe the selection of the
observational or experimental participants. Identify the methods
and procedures in sufficient detail. Provide references to established
methods (including statistical methods), provide references to brief
modified methods, and provide the rationale for their use and an
evaluation of their limitations. Identify all drugs and chemicals used,
including generic names, doses, and routes of administration.
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
the reported findings/results. Provide details about randomization,
describe treatment complications, provide the number of observations,
and specify all computer programs used.
Results: Present the findings/results in a logical sequence in the text,
tables, and figures. Do not repeat all the findings/results in the tables
and figures in the text; emphasize and/or summarize only those that
are most important.
Discussion: Highlight the new and important findings/results of the
study and the conclusions they lead to. Link the conclusions with the
goals of the study, but avoid unqualified statements and conclusions
not completely supported by your data.
Case Reports
Abstract length: Not to exceed 300 words.
Article length: Not to exceed 1200 words.
Case reports should be structured as follows:
Abstract
An unstructured abstract that summarizes the case.
A-V

Introduction: A brief introduction (recommended length: 1-2
paragraphs).
Case Presentation: This section describes the case in detail, including
the initial diagnosis and outcome.
Discussion:This section should include a brief review of the relevant
literature and how the presented case furthers our understanding to
the disease process.
Invited Review Articles
Abstract length: Not to exceed 300 words.
Article length: Not to exceed 4000 words.
Review articles should not include more than 100 references.
Reviews should include a conclusion, in which a new hypothesis or
study about the subject may be posited. Do not publish methods for
literature search or level of evidence. Authors who will prepare review
articles should already have published research articles on therel
evant subject. The study’s new and important findings should be
highlighted and interpreted in the Conclusion section. There should
be a maximum of two authors for review articles.
Images in Hematology
Article length: Not exceed 200 words.
Authors can submit for consideration an illustration and photos that
is interesting, instructive, and visually attractive, along with a few
lines of explanatory text and references. Images in Hematology can
include no more than 200 words of text, 5 references, and 3 figure or
table. No abstract, discussion or conclusion are required but please
include a brief title.
Letters to the Editor
Article length: Not to exceed 500 words.
Letters can include no more than 500 words of text, 5-10 references, and
1 figure or table. No abstract is required, but please include a brief title.
Tables
Supply each table on a separate file. Number tables according to the
order in which they appear in the text, and supply a brief caption
for each. Give each column a short or abbreviated heading. Write
explanatory statistical measures of variation, such as standard deviation
or standard error of mean. Be sure that each table is cited in the text.
Figures
Figures should be professionally drawn and/or photographed.
Authors should number figures according to the order in which they
appear in the text. Figures include graphs, charts, photographs, and
illustrations. Each figure should be accompanied by a legend that
does not exceed 50 words. Use abbreviations only if they have been
introduced in the text. Authors are also required to provide the level
of magnification for histological slides. Explain the internal scale and
identify the staining method used. Figures should be submitted as
separate files, not in the text file. High-resolution image files are not
preferred for initial submission as the file sizes may be too large. The
total file size of the PDF for peer review should not exceed 5 MB.
Authorship
Each author should have participated sufficiently in the work to assume
public responsibility for the content. Any portion of a manuscript that
is critical to its main conclusions must be the responsibility of at least 1
author.
Contributor’s Statement
All submissions should contain a contributor’s statement page. Each
manuscript should contain substantial contributions to idea and
design, acquisition of data, or analysis and interpretation of findings.
All persons designated as an author should qualify for authorship,
and all those that qualify should be listed. Each author should
have participated sufficiently in the work to take responsibility for
appropriate portions of the text.
Acknowledgments
Acknowledge support received from individuals, organizations,
grants, corporations, and any other source. For work involving a
biomedical product or potential product partially or wholly supported
by corporate funding, a note stating, “This study was financially
supported (in part) with funds provided by (company name) to
(authors’ initials)”, must be included. Grant support, if received,
needs to be stated and the specific granting institutions’ names and
grant numbers provided when applicable.
Authors are expected to disclose on the title page any commercial or
other associations that might pose a conflict of interest in connection
with the submitted manuscript. All funding sources that supported
the work and the institutional and/or corporate affiliations of the
authors should be acknowledged on the title page.
Ethics
When reporting experiments conducted with humans indicate that
the procedures were in accordance with ethical standards set forth
by the committee that oversees human experimentation. Approval of
research protocols by the relevant ethics committee, in accordance
with international agreements (Helsinki Declaration of 1975, revised
2002 available at http://www.wma.net/e/policy/b3.htm, “Guide for
the Care and use of Laboratory Animals” www.nap.edu/catalog/5140.
html/), is required for all experimental, clinical, and drug studies.
Patient names, initials, and hospital identification numbers should
not be used. Manuscripts reporting the results of experimental
investigations conducted with humans must state that the study
protocol received institutional review board approval and that the
participants provided informed consent.
Non-compliance with scientific accuracy is not in accord with scientific
ethics. Plagiarism: To re-publish-whole or in part-the contents
of another author’s publication as one’s own without providing a
reference. Fabrication: To publish data and findings/results that
do not exist. Duplication: Use of data from another publication,
which includes re-publishing a manuscript in different languages.
Salamisation: To create more than one publication by dividing the
results of a study preternaturally.
A-VI

We disapprove of such unethical practices as plagiarism, fabrication,
duplication, and salamisation, as well as efforts to influence the review
process with such practices as gifting authorship, inappropriate
acknowledgements, and references. Additionally, authors must
respect participant right to privacy.
On the other hand, short abstracts published in congress books that
do not exceed 400 words and present data of preliminary research,
and those that are presented in an electronic environment are not
accepted pre-published work. Authors in such situation must declare
this status on the first page of the manuscript and in the cover letter.
(The COPE flowchart is available at: http://publicationethics.org)
Turkish Journal of Hematology uses plagiarism screening service
to verify the originality of content submitted before publication.
Conditions of Publication
All authors are required to affirm the following statements before their
manuscript is considered: 1. The manuscript is being submitted only
to The Turkish Journal of Hematology; 2. The manuscript will not be
submitted elsewhere while under consideration by The Turkish Journal
of Hematology; 3. The manuscript has not been published elsewhere,
and should it be published in The Turkish Journal of Hematology it
will not be published elsewhere without the permission of the editors
(these restrictions do not apply to abstracts or to press reports for
presentations at scientific meetings); 4. All authors are responsible for
the manuscript’s content; 5. All authors participated in the study concept
and design, analysis and interpretation of the data, drafting or revising
of the manuscript, and have approved the manuscript as submitted. In
addition, all authors are required to disclose any professional affiliation,
financial agreement, or other involvement with any company whose
product figures prominently in the submitted manuscript.
Authors of accepted manuscripts will receive electronic page proofs and
are responsible for proofreading and checking the entire article within
two days. Failure to return the proof in two days will delay publication.
If the authors cannot be reached by email or telephone within two weeks,
the manuscript will be rejected and will not be published in the journal.
Copyright
At the time of submission all authors will receive instructions for
submitting an online copyright form. No manuscript will be considered
for review until all authors have completed their copyright form. Please
note, it is our practice not to accept copyright forms via fax, e-mail, or
postal service unless there is a problem with the online author accounts
that cannot be resolved. Every effort should be made to use the online
copyright system. Corresponding authors can log in to the submission
system at any time to check the status of any co-author’s copyright
form. All accepted manuscripts become the permanent property of The
Turkish Journal of Hematology and may not be published elsewhere-in
whole or in part-without written permission.
Note: We cannot accept any copyright that has been altered, revised,
amended, or otherwise changed. Our original copyright form must
be used as is.
Units of Measurement
Measurements should be reported using the metric system, according
to the International System of Units (SI). Consult the SI Unit
Conversion Guide, New England Journal of Medicine Books, 1992.
An extensive list of conversion factors can be found at http://www.
unc.edu/~rowlett/units/scales/clinical_data.html. For more details, see
http://www.amamanualofstyle.com/oso/public/jama/si_conversion_
table.html . Example for CBC.
Hematology component SI units
RBC 6.7-11 x 10 12 /L
WBC 5.5-19.5 x10 9 /L
Hemoglobin 116-168 g/L
PCV 0.31-0.46 L/L
MCV 39-53 fL
MCHC 300-360 g/L
MCH 19.5-25 pg
Platelets 300-700 x 10 9 /L
Source: http://www.vetstream.com/felis/Corporate/993fhtm/ha-mat.htm
Abbreviations and Symbols
Use only standard abbreviations. Avoid abbreviations in the title and
abstract. The full term for an abbreviation should precede its first use in
the text, unless it is a standard abbreviation. All acronyms used in the
text should be expanded at first mention, followed by the abbreviation
in parentheses; thereafter the acronym only should appear in the text.
Acronyms may be used in the abstract if they occur 3 or more times
therein, but must be reintroduced in the body of the text. Generally,
abbreviations should be limited to those defined in the AMA Manual of
Style, current edition. A list of each abbreviation (and the corresponding
full term) used in the manuscript must be provided on the title page.
Online Manuscript Submission Process
The Turkish Journal of Hematology uses submission software powered
by ScholarOne Manuscripts. The website for submissions to The Turkish
Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This
system is quick and convenient, both for authors and reviewers.
Setting up an account
New users to the submission site will need to register and enter their
account details before they can submit a manuscript. Log in, or click
the “Create Account” button if you are a first-time user. To create a
new account: After clicking the “Create Account” button, enter your
name and e-mail address, and then click the “Next” button. Your
A-VII

e-mail address is very important. Enter your institution and address
information, as appropriate, and then click the “Next” Button. Enter
a user ID and password of your choice, select your area of expertise,
and then click the “Finish” button.
If you have an account, but have forgotten your log-in details, go to
“Password Help” on the journal’s online submission system and enter
your e-mail address. The system will send you an automatic user ID
and a new temporary password.
Full instructions and support are available on the site, and a user ID
and password can be obtained during your first visit. Full support
for authors is provided. Each page has a “Get Help Now” icon that
connects directly to the online support system. Contact the journal
administrator with any questions about submitting your manuscript
to the journal (info@tjh.com.tr). For ScholarOne Manuscripts
customer support, click on the “Get Help Now” link on the top right
hand corner of every page on the site.
The Electronic Submission Process
Log in to your author center. Once you have logged in, click the
“Submit a Manuscript” link in the menu bar. Enter the appropriate
data and answer the questions. You may copy and paste directly from
your manuscript. Click the “Next” button on each screen to save your
work and advance to the next screen.
Upload Files
Click on the “Browse” button and locate the file on your computer.
Select the appropriate designation for each file in the drop-down
menu next to the “Browse” button. When you have selected all the
files you want to upload, click the “Upload Files” button. Review
your submission before sending to the journal. Click the “Submit”
button when you are finished reviewing. You can use ScholarOne
Manuscripts at any time to check the status of your submission. The
journal’s editorial office will inform you by e-mail once a decision has
been made. After your manuscript has been submitted, a checklist will
then be completed by the Editorial Assistant. The Editorial Assistant
will check that the manuscript contains all required components
and adheres to the author guidelines. Once the Editorial Assistant is
satisfied with the manuscript it will be forwarded to the Senior Editor,
who will assign an editor and reviewers.
The Review Process
Each manuscript submitted to The Turkish Journal of Hematology is
subject to an initial review by the editorial office in order to determine
if it is aligned with the journal’s aims and scope, and complies with
essential requirements. Manuscripts sent for peer review will be
assigned to one of the journal’s associate editors that has expertise
relevant to the manuscript’s content. All manuscripts are single-blind
peer reviewed. All accepted manuscripts are sent to a statistical and
English language editor before publishing. Once papers have been
reviewed, the reviewers’ comments are sent to the Editor, who will
then make a preliminary decision on the paper. At this stage, based on
the feedback from reviewers, manuscripts can be accepted, rejected, or
revisions can be recommended. Following initial peer-review, articles
judged worthy of further consideration often require revision. Revised
manuscripts generally must be received within 3 months of the date of
the initial decision. Extensions must be requested from the Associate
Editor at least 2 weeks before the 3-month revision deadline expires;
The Turkish Journal of Hematology will reject manuscripts that are
not received within the 3-month revision deadline. Manuscripts with
extensive revision recommendations will be sent for further review
(usually by the same reviewers) upon their re-submission. When a
manuscript is finally accepted for publication, the Technical Editor
undertakes a final edit and a marked-up copy will be e-mailed to the
corresponding author for review and to make any final adjustments.
Submission of Revised Papers
When revising a manuscript based on the reviewers’ and Editor’s feedback,
please insert all changed text in red. Please do not use track changes, as
this feature can make reading difficult. To submit revised manuscripts,
please log into your author center at ScholarOne Manuscripts. Your
manuscript will be stored under “Manuscripts with Decisions”. Please
click on the “Create a Revision” link located to the right of the manuscript
title. A revised manuscript number will be created for you; you will
then need to click on the “Continue Submission” button. You will then
be guided through a submission process very similar to that for new
manuscripts. You will be able to amend any details you wish. At stage
6 (“File Upload”), please delete the file for your original manuscript and
upload the revised version. Additionally, please upload an anonymous
cover letter, preferably in table format, including a point-by-point
response to the reviews’ revision recommendations. You will then need
to review your paper as a PDF and click the “Submit” button. Your
revised manuscript will have the same ID number as the original version,
but with the addition of an R and a number at the end, for example,
TJH-2011-0001 for an original and TJH-2011-0001.R1, indicating a first
revision; subsequent revisions will end with R2, R3, and so on. Please do
not submit a revised manuscript as a new paper, as revised manuscripts
are processed differently. If you click on the “Create a Revision” button
and receive a message stating that the revision option has expired, please
contact the Editorial Assistant at info@tjh.com.tr to reactivate the option.
English Language Editing
All manuscripts are professionally edited by an English language
editor prior to publication.
Online Early
The Turkish Journal of Hematology publishes abstracts of accepted
manuscripts online in advance of their publication in print. Once an
accepted manuscript has been edited, the authors have submitted
any final corrections, and all changes have been incorporated, the
manuscript will be published online. At that time the manuscript
will receive a Digital Object Identifier (DOI) number. Both forms
can be found at www.tjh.com.tr. Authors of accepted manuscripts
will receive electronic page proofs directly from the printer, and are
responsible for proofreading and checking the entire manuscript,
including tables, figures, and references. Page proofs must be returned
within 48 hours to avoid delays in publication.
A-VIII

CONTENTS
History of Turkish Journal of Hematology
1 Turkish Journal of Hematology: From “Istanbul Contribution to Clinical Science” to “Pubmed Central”
Hamdi Akan, Bengü Timoçin, İpek Durusu, Aytemiz Gürgey
Review Article
5 β-Thalassemia Intermedia: A Bird’s-Eye View
Anthony Haddad, Paul Tyan, Amr Radwan, Naji Mallat, A1i Taher
Research Articles
17 A Polymorphism in the IL-5 Gene is Associated with Inhibitor Development in Severe Hemophilia A Patients
İnanç Değer Fidancı, Bülent Zülfikar, Kaan Kavaklı, M. Cem Ar, Yurdanur Kılınç, Zafer Başlar, Server Hande Çağlayan
25 Evaluation of Red Cell Membrane Cytoskeletal Disorders Using a Flow Cytometric Method in South Iran
Habib Alah Golafshan, Reza Ranjbaran, Tahereh Kalantari, Leili Moezzi, Mehran Karimi,
Abbas Behzad- Behbahani, Farzaneh Aboualizadeh, Sedigheh Sharifzadeh
32 Childhood Immune Thrombocytopenia: Long-term Follow-up Data Evaluated by the Criteria of the International Working
Group on Immune Thrombocytopenic Purpura
Melike Sezgin Evim, Birol Baytan, Adalet Meral Güneş
40 NPM1 Gene Type A Mutation in Bulgarian Adults with Acute Myeloid Leukemia: A Single-Institution Study
Gueorgui Balatzenko, Branimir Spassov, Nikolay Stoyanov, Penka Ganeva, Tihomit Dikov, Spiro Konstantinov, Vasil Hrischev,
Malina Romanova, Stavri Toshkov, Margarita Guenova
49 Leukocyte Populations and C-Reactive Protein as Predictors of Bacterial Infections in Febrile Outpatient Children
Zühre Kaya, Aynur Küçükcongar, Doğuş Vurallı, Hamdi Cihan Emeksiz, Türkiz Gürsel
56 FIP1L1-PDGFRA-Positive Chronic Eosinophilic Leukemia: A Low-Burden Disease with Dramatic
Response to Imatinib - A Report of 5 Cases from South India
Anıl Kumar N, Vishwanath Sathyanarayanan, Visweswariah Lakshmi Devi, Namratha N. Rajkumar, Umesh Das,
Sarjana Dutt, Lakshmaiah K Chinnagiriyappa
61 The Association between Obesity and Insulin Resistance and Anemia and Iron Metabolism:
A Single-Center, Cross-Sectional Study
Esma Altunoğlu, Cüneyt Müderrisoğlu, Füsun Erdenen, Ender Ülgen, M. Cem Ar
68 The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity
Ayşenur Bahadır, Nilgün Kurucu, Mine Kadıoğlu, Engin Yenilmez
Case Reports
75 Central Nervous System Involvement of T-cell Prolymphocytic Leukemia Diagnosed with Stereotactic Brain Biopsy: Case Report
Selçuk Göçmen, Murat Kutlay, Alev Erikçi, Cem Atabey, Özkan Sayan, Aptullah Haholu
79 Epstein-Barr Virus-Negative Post-Transplant Lymphoproliferative Diseases: Three Distinct Cases from a Single Center
Şule Mine Bakanay, Gülşah Kaygusuz, Pervin Topçuoğlu, Şule Şengül, Timur Tunçalı, Kenan Keven,
Işınsu Kuzu, Akın Uysal, Mutlu Arat
A-IX

84 Serum Level of Lactate Dehydrogenase is a Useful Clinical Marker to Monitor Progressive
Multiple Myeloma Diseases: A Case Report
Hava Üsküdar Teke, Mustafa Başak, Deniz Teke, Mehmet Kanbay
88 Isolated Granulocytic Sarcoma of the Breast after Allogeneic Stem Cell Transplantation:
A Rare Involvement Also Detected by 18 FDG-PET/CT
Eren Gündüz, Meltem Olga Akay, Mustafa Karagülle, İlknur Sivrikoz Ak
Letters to the Editor
92 Chronic Myeloid Leukemia as a Secondary Malignancy Following Treatment of Diffuse Large B-Cell Lymphoma
Itır Şirinoğlu Demiriz, Emre Tekgündüz, Sinem Civriz Bozdağ, Fevzi Altuntaş
95 Acute Myocardial Infarction after First Dose of Rituximab Infusion
Ajay Gogia, Sachin Khurana, Raja Paramanik
97 An Updated Review of Abnormal Hemoglobins in the Turkish Population
Nejat Akar
99 Lenalidomide-Induced Pure Red Cell Aplasia
Tuphan Kanti Dolai, Shyamali Dutta, Prakas Kumar Mandal, Sandeep Saha, Maitreyee Bhattacharyya
101 Early Postnatal Hemorrhagic Shock Due to Intraabdominal Hemorrhage in a Newborn with Severe Hemophilia A
Sara Erol, Banu Aydın, Dilek Dilli, Barış Malbora, Serdar Beken, Hasibe Gökçe Çınar, Ayşegül Zenciroğlu, Nurullah Okumuş
103 Severe Adenovirus Infection Associated with Hemophagocytic Lymphohistiocytosis
Ferda Özbay Hoşnut, Figen Özçay, Barış Malbora, Şamil Hızlı, Namık Özbek
Images in Hematology
106 Cystinosis: Diagnostic Role of Bone Marrow Examination
Shahla Ansari, Ghasem Miri-Aliabad, Yousefian Saeed
107 Deviation from Normal Values of Leukocyte and Erythroblast Parameters in Complete
Blood Count Is a Messenger for Platelet Abnormalities
Cengiz Beyan, Kürşat Kaptan
MRI in Hematology
109 Intrathecal Methotrexate-Induced Posterior Reversible Encephalopathy Syndrome (PRES) İntratekal Metotreksat
Tülay Güler, Özden Yener Çakmak, Selami Koçak Toprak, Seda Kibaroğlu, Ufuk Can
A-X

History of Turkish Journal of Hematology
DOI: 10.4274/Tjh.31.01
Turkish Journal of Hematology: From
“Istanbul Contribution to Clinical Science”
to “Pubmed Central”
Turkish Journal of Hematology: “İstanbul Contribution To
Clinical Science”’dan “Pubmed Central”’a
Hamdi Akan, Bengü Timoçin, İpek Durusu, Aytemiz Gürgey
Ord. Prof. Erich Frank
We respectfully commemorate Prof. Dr. Erich Frank,
who pioneered landmark advances in Turkish medicine
and established the predecessor of the Turkish Journal of
Hematology, on the 130 th anniversary of his birth (1884-
1957) (Figure 1). Dr. Frank completed his doctorate in
Strasburg after graduating from the Breslau University
School of Medicine and earned the title of professor in 1919.
Oscar Minkowski, who was the most influential among his
teachers, directed him toward clinical and experimental
medicine. Throughout his life, Dr. Frank evaluated clinical
and laboratory studies, defined entities such as essential
thrombocytopenia, and led the discovery of synthalin, the
precursor of oral anti-diabetics. He was a very well-known
and respected scientist on an international scale, receiving
an invitation from the United States for the original studies
that he conducted. Along with publications related to many
other diseases, he concentrated his studies on diabetes,
hypertension, and hematologic disorders. He suffered in
the early 1930s in Germany as pressure was being applied
to people of Jewish descent. Upon recommendations by
Mustafa Kemal Atatürk, universities in Turkey were reformed
in 1933, ten years after the establishment of the modern
Turkish Republic. While Turkish universities were striving
to adopt Western standards of learning and a contemporary
level of education, scientists of Jewish origin in Europe were
simultaneously preparing to leave their countries [1]. Turkey
embraced these scientists who were facing persecution at
home and work permits were granted to about 100 faculty
members and assistants in various scientific branches [2]. Dr.
Frank, one such scientist, came to Turkey in 1934 and began
to work as director of second Internal Clinic in Istanbul
University School of Medicine’s (Vakıf Gureba Hospital). Dr.
Frank made much progress in internal medicine during the
23-year period from his arrival in Turkey to his death (1934-
1957) [3]. Patients received modern treatment services and
clinical research was done. The students that he taught, who
later became faculty members themselves, praised Dr. Frank’s
courses and legendary conferences. One of Dr. Frank’s most
important services was unquestionably the establishment of
the medical journal Istanbul Contribution to Clinical Science,
first published in 1951 in English, German, and French. The
first four volumes were also published in Turkish under
the title of Klinik İlmi. The journal initially focused on
advancements in internal medicine. After Dr. Frank’s death,
during the period in which Prof. Orhan Ulutin was the longterm
(1962-2002) editor, studies began to be published with
a primary focus on the hematologic sciences. Prof. Ulutin
(1924-2011) worked in Frank’s clinic and laboratory. He
was interested in hematology, particularly qualitative platelet
disorders and coagulation factors, and he founded the
Address for Correspondence: Hamdi Akan, M.D.,
Ankara University School of Medicine, Department of Hematology, Ankara, Turkey
E-mail: hamdiakan@gmail.com
Received/Geliş tarihi : April 20, 2013
Accepted/Kabul tarihi : August 1, 2013
1

Turk J Hematol 2014;31:1-4
Akan H, et al: Turkish Journal of Hematology: From “Istanbul Contribution To Clinical Science” To “Pubmed Central”
Department of Hematology in the Internal Clinic of Istanbul
University in 1963. Ulutin and his colleagues established the
Turkish Society of Hematology in 1967. The journal then
became the official publication of that association in 1971,
under the name of New Istanbul Contribution to Clinical
Science. It was indexed in Index Medicus between 1965 and
1982 until the last volume, Volume 13 [4]. The name of the
journal was changed to Turkish Journal of Hematology in
1995.
Dr. Frank was committed to Turkey during his lifetime
and he became a Turkish citizen. After the Second World
War, he received brilliant offers from American and
German universities because of his scientific capability and
creativity, but he declined these opportunities, stating that:
“While I was experiencing the bitter astonishment of being
thrown out from my country, only Turkey opened its arms
and embraced me. This is my country, and I cannot show
ingratitude”. Dr. Frank was buried with a state funeral in the
Istanbul Aşiyan Cemetery according to his wishes after he
passed away in 1957. Prof. Dr. Orhan Ulutin, who had been
Dr. Frank’s assistant, gave a conference in 2006 entitled “The
Place of Prof. Dr. Erich Frank in the World of Science and
His Contributions to Turkish Medicine” and then prepared a
book including other information about Dr. Frank [5].
THE JOURNAL NOW
The Turkish Journal of Hematology (TJH) is published
quarterly by the Turkish Society of Hematology. It is an
independent, non-profit, peer-reviewed international
English-language periodical encompassing subjects relevant
to hematology.
The Editorial Board of TJH adheres to the principles
of the World Association of Medical Editors (WAME),
International Council of Medical Journal Editors (ICMJE),
Committee on Publication Ethics (COPE), Consolidated
Standards of Reporting Trials (CONSORT), and
Strengthening the Reporting of Observational Studies in
Epidemiology (STROBE).
The aim of TJH is to publish original hematological
research of the highest scientific quality and clinical
relevance. Additionally, educational material, reviews on
basic developments, editorial short notes, case reports,
images in hematology, and letters from hematology
specialists and clinicians covering their experience and
comments on hematology and related medical fields as well
as social subjects are published (Table 1 and Table 2).
TJH is indexed as follows:
• PubMed Central (August 2013)
• ProQuest (2010)
• Science Citation Index Expanded (March 2009)
• CINAHL (2008)
• Gale/Cengage Learning (2008)
• EBSCO (2008)
• DOAJ (2008)
• TÜBİTAK/ULAKBİM Turkish Medical Database (2008)
• Scopus (2007)
• EMBASE (1999)
• Index Copernicus (1999)
Table 1. Manuscripts submitted to the Turkish Journal of
Hematology.
Year Total Accepted Rate
2006 50 42 84%
2007 73 50 68%
2008 105 53 50%
2009 162 73 45%
2010 198 74 39%
2011 202 83 41%
2012 214 80 37%
2013 432 125 29%
Table 2. Details of the manuscripts submitted and
published between January 2012 and November 2013 (2
years).
Manuscript Type
Total
Brief Reports 11
Case Reports 154
Commentaries 2
Images in Hematology 28
Invited Reviews 11
Letters to the Editor 88
Original Articles 231
Total 585
Accepted 197
The journal is published by Galenos and online
manuscript submission is done via the Thomson-Reuters
Scholar One system.
The journal has a wide readership and currently receives
manuscripts from roughly 40 different countries around the
world. The total number of reviewers in 2013 was 3355. Past
and current editors are:
1951-1957: Prof. Dr. Erich Frank
1962-2002: Prof. Dr. Orhan Ulutin
2002-2005: Prof. Dr. Hamdi Akan
2006-present: Prof. Dr. Aytemiz Gurgey
Turkish Journal of Hematology and Open Access
Since the Internet has become a cornerstone of academic
life, new concepts have accordingly been introduced to our
daily life, such as “open access”. Enormous amounts of
information that we never had the chance to reach in the past
2

Akan H, et al: Turkish Journal of Hematology: From “Istanbul Contribution To Clinical Science” To “Pubmed Central”
Turk J Hematol 2014;31:1-4
can now be accessed immediately, and this has brought about
new opportunities in medical journalism. Open access is not
only a concept but also a movement. Open access in terms of
literature is defined as “free availability on the public internet,
permitting any users to read, download, copy, distribute,
print, search, or link to the full texts of these articles, crawl
them for indexing, pass them as data to software, or use them
for any other lawful purpose, without financial, legal, or
technical barriers other than those inseparable from gaining
access to the internet itself” [6]. This movement first started
in Budapest, followed by Bethesda and Berlin. Although
the open access movement also covers music and book
publishing, these areas depend on their financial structures,
limiting their borders of open access. While these industries
can only survive by financial expansion, this is not the case
for medical journals. Most of the time, the only expense
related to online publishing is limited to the server cost,
domain name, and salaries for personnel. The automation
in on-line publishing makes the process very easy and very
cost-effective, reducing manpower and time. The number
of journals available with open access is increasing rapidly
and the availability of gold and green open access copies by
scientific discipline is shown in Table 3 [7].
Open access brought about radical changes in
medical journals. The availability of medical journals
on the Internet made it possible to reach contents
directly from the web pages of the journals, from the
domains of publishing companies such as Springer Link
or Elsevier, or from journal depositories. In this way,
the limited number of readers of a journal increased
exponentially. The most important improvement in this
area was the addition of PubMed Central (PMC) to the
National Library of Medicine; this index became the main
repository for journals published online [8]. PMC was
launched in 2000 and is a free archive of biomedical and
life sciences journal literature. Although the standard
Table 3. Publication bias of included nested case-control
studies analysed by funnel plot.
Figure 1. Prof. Dr. Erich Frank (1885-1957)
criteria for indexing medical journals are also valid here,
an additional requirement is the sending of the articles in
a required format (mostly XML or SGML).
The Directory of Open Access Journals (DOAJ) is a good
example of such repositories [9]. Not only PubMed but also
other indexes are covered here. If we look at the number of
journals in the DOAJ according to the country of origin, we
see that Turkey is the 12th country on the list (Table 4) [9].
Interestingly, Iran is the 11 th country on the list. This can
be explained by the fact that all Iranian biomedical journals
(n=163) have an open access mode [10]. In South Korea,
one-third of the open access medical journals are archived
in PMC [9]. Some privileged journals such as the BMJ and
PLOS have a very significant online impact. Although a
journal being indexed in PMC does not necessarily mean
that it is also indexed in Medline, all PMC journals can be
reached in PubMed. The reason for this is that
PubMed covers: 1) MEDLINE indexed journals,
2) journals/manuscripts deposited in PMC, and 3)
the NCBI Bookshelf [6].
During the transition of TJH to an international
journal in the 1990s, main targets were to become
an open access journal and to be indexed in the
major databases. The first target was achieved
in a short time, followed by indexing in various
indexes such as the Science Citation Index
Expanded, EMBASE, Scopus, CINAHL, Gale/
Cengage Learning, EBSCO, DOAJ, ProQuest,
Index Copernicus, and the TÜBİTAK/ULAKBİM
Turkish Medical Database [11]. During this
process, TJH was one of the first medical journals
in Turkey to publish on the Internet with the full
text of articles available to readers.
TJH made its first application to PMC
immediately in 2000, as soon as PMC was launched.
At that time, technical difficulties obstructed the
path, but in 2013, TJH became indexed in PMC.
TJH is the third journal indexed from Turkey and
this number is increasing. Although this is a good
3

Turk J Hematol 2014;31:1-4
Akan H, et al: Turkish Journal of Hematology: From “Istanbul Contribution To Clinical Science” To “Pubmed Central”
Table 4. Publication bias of included nested case-control studies analysed by funnel plot.
Country
Total number of journals in DOAJ
2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013
1- United States 15 196 275 353 401 473 593 667 799 1008 1098 1249
2- Brazil 0 7 123 168 213 262 331 372 502 630 771 923
3- India 0 13 29 42 57 73 95 142 268 356 450 651
4- United Kingdom 5 110 151 188 222 253 284 339 454 498 563 633
5- Spain 0 5 21 79 125 150 212 238 312 383 432 507
6- Egypt 3 3 4 8 16 33 61 127 158 284 350 415
7- Germany 4 16 36 70 96 127 153 176 211 239 256 349
8- Romania 0 4 5 5 12 17 28 64 142 210 243 302
9- Italy 0 3 12 30 44 53 64 91 135 183 220 285
10- Canada 0 22 32 42 54 69 94 123 168 210 244 276
11- Iran 0 0 0 5 10 21 32 41 71 116 163 260
12- Turkey 0 4 11 32 42 51 72 95 128 172 202 258
13- Colombia 0 2 4 9 28 46 64 88 107 140 199 241
14- France 0 10 15 34 41 51 68 77 110 128 167 184
15- Poland 0 9 13 21 31 37 55 61 76 124 140 171
achievement, compared to countries such as South Korea,
India, or Iran, there is still a long way to go. One-third of
the open access medical journals in South Korea are also
indexed in PMC. This is also true for India, where nearly all
biomedical journals are open access and some have found
their way into PMC [10]. Supporting open access journalism
is also an accepted strategy in developed countries such as
the United Kingdom. In the UK, the government adopted a
national strategy in 2012 that supports research funds for
open access publishing.
Despite these achievements, there are also problems with
open access journals. The main criticism is directed toward
the peer-review process. A recent paper published in the 4
October 2013 volume of Science [12] underlines one such
important problem. Three hundred and four versions of a
fake, non-existent study were sent to open access journals
and nearly half of these peer-review journals accepted the
study with minor or no revisions. This shows that as the
stress of publishing online journals increases, the quality of
the peer-review process decreases. Of course, this problem
may also exist for non-open access journals. Another
problem in open access journalism is the fee charged for
manuscripts to be published. It looks as if the pressure
on medical doctors for publishing new articles opened an
avenue for financial benefit among companies that own or
host open access journals.
In the medical sciences, open access is a revolutionary
approach to sharing and distributing research, development,
and innovation, provided that strict rules for quality control
are maintained all throughout the process. TJH now fulfills
this requirement and is proud to be a member of the open
access community.
4
References
1. Önsöz Z. Türkiye’ye sığınan Almanlar (Asylum-seeking
Germans in Turkey). Available at www.zekionsoz.com,
posted on 16 September 011.
2. Aksel S. Soykırımdan kaçan Yahudi Hocalar Türkiye’ye
sığındı (Jewish academicians running away from genocide
take shelter in Turkey). Available at http://blog.radikal.
com.tr/Sayfa/soykirimdan-kacan-yahudi-hocalar-turkiyeyesigindi-27309,
posted on 10 July 2013.
3. Sever SM, Namal A, Eknoyan G. Erich Frank (1884-
1957): Unsung pioneer in nephrology. Am J Kidney Dis
2011;58:654-665.
4. May H. Yayıncının süreli yayına katkısı (Contribution of
the publisher to periodicals). Sağlık Bilimlerinde Süreli
Yayıncılık Ulusal Sempozyumu, 28 March 2003, Ankara.
Available at http://www.ulakbim.gov.tr/dokumanlar/
sempozyum1/, accessed on 19 November 2013.
5. Ulutin ON. Ord. Prof. Dr. ERICH FRANK’ın dünya
tıbbındaki yeri ve Türk tıbbına katkıları (The place of Ord.
Prof. ERICH FRANK in the medical world and contribution
to Turkish medicine). Istanbul, Istanbul Üniversitesi
Istanbul Tıp Fakültesi Deontoloji ve Tıp Tarihi Anabilim
Dalı Yayın Serisi, 2007.
6. Suber P, Open Access Overview, Richmond, IN, USA,
Earlham College, 2013. Available at http://legacy.earlham.
edu/~peters/fos/overview.htm, accessed on 12 March 2013.
7. Björk BC, Welling P, Laakso M, Majlender P, Hedlund T,
Gunason G. Open access to the scientific journal literature:
situation 2009. PLoS One 2010;5:11273.
8. US National Library of Medicine. PMC Overview. Available
at http://www.ncbi.nlm.nih.gov/pmc/about/intro/, accessed
on 11 September 2013.
9. DOAJ. Directory of Open Access Journals. Available at http://
www.doaj.org/, accessed on 13 October 2013.
10. Gasparyan AY, Ayvazyan L, Kitas GD. Open access: changing
global science publishing. Croat Med J 2013;54:403-406.
11. Turkish Journal of Hematology. Available at http://www.tjh.
com.tr, accessed on 13 October 2013.
12. Bohannon J. Who’s afraid of peer review? Science
2013;342:60-65.

Review
DOI: 10.4274/Tjh.2014.0032
β-Thalassemia Intermedia: A Bird’s-Eye View
β-Talasemi İntermedya: Kuşbakışı
Anthony Haddad1, Paul Tyan2, Amr Radwan1, Naji Mallat1, A1i Taher1
1American University of Beirut Medical Center, Department of Internal Medicine, Beirut, Lebanon
2American University of Beirut Faculty of Medicine, Department of Physiology, Beirut, Lebanon
Abstract:
Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective
erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor,
which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end
is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular
transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients
with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past
decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information
as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications
associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related
to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these
patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications
include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems.
Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize
morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of
each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally,
health-related quality of life is discussed in these patients with a direct comparison to the more severe β-thalassemia major.
Key Words: Thalassemia, Thalassemia intermedia, Iron chelation, Ineffective erythropoiesis, Iron overload
Özet:
Beta talasemi beta globin zincirlerinin sentezindeki defekt sonucu gelişen alfa/beta dengesizliği, inefektif eritropoez ve
kronik aneminin sonucudur. Talasemi spektrumu geniş olup, bir uçta hiçbir klinik bulgusu olmayan bireyler varken, diğer
uçta bulunan talasemi majorlu hastalar hayatın birinci yılında derin anemi ve hayatta kalabilmek için düzenli transfüzyon
gereksinimi ile karakterize şekilde ağır seyirli olabilir. Bu iki ucun arasında ise talasemi major hastaları kadar ağır olmayan,
ancak çok da hafif bir seyir göstermeyen hastaları tanımlamada talasemi intermedia terminolojisi kullanılmaktadır. Son
on yılda β-talasemi intermedianın moleküler genetiği ve patofizyolojisi hakkındaki bilgilerimiz hızla artmıştır. β-talasemi
intermedianın, β-talasemi majorden farklı, kendine özgü klinik başvuru özellikleri ve komplikasyonları olduğu netlik
kazanmıştır. Bu derlemede β-talasemi intermedianın temel tanımlamalarından hastaların yaşam kalitesi gibi paramedikal
konulara kadar meseleler ele alınmıştır. Genetiği, patofizyolojisi ve bu hastalığa özgü komplikasyonlarına değinilmiştir.
Bu komplikasyonlar arasında kardiovasküler, hepatik, endokrin, renal, beyin ve kemiklerle ilgili olanlar vurgulanmıştır.
Ekstramedüller hematopoez de bu makalede tartışılmıştır. Risk faktörleri özellikle vurgulanmış ve β-talasemi intermedialı
hastalarda morbiditeleri minimuma indirebilmek için kritik eşik değerler belirtilmiştir. Değişik tedavi yaklaşımlarının iyi
ve kötü taraflarına ışık tutulmaya çalışılmış ve bazı spesifik farmakolojik ajanların hastalığın progresyonu ve morbiditeleri
üzerine etkisi tartışılmıştır. Son olarak bu hastalardaki sağlık ilişkili yaşam kalitesi, çok daha ağır seyirli β-talasemi majorlu
hastalardaki ile karşılaştırılmıştır.
Anahtar Sözcükler: Talasemi, Talasemi intermedya, Demir şelasyonu, İnefektif eritropoez, Demir yükü
Address for Correspondence: Ali Taher, M.D.,
American University of Beirut Medical Center, Department of Internal Medicine, Beirut, Lebanon
Phone: +961 1 350000 E-mail: ataher@aub.edu.lb
Received/Geliş tarihi : January 23, 2014
Accepted/Kabul tarihi : February 17, 2014
5

Turk J Hematol 2014;31:5-16
Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
Introduction
The first reports of thalassemic disorders date back to as
early as 1925. The first cases were described in the pediatric
population among subjects with anemia, peculiar facies, and
other bony changes. The constellation of symptoms led to
the hypothesis of a single disease entity back then [1]. Later
on, the term “thalassemia” was coined by George Whipple
[2]. Throughout the years, research focused on genetics
and pathophysiology, and the theory of imbalance in globin
chain production as a major culprit was revealed after Sir
David Weatherall used labeled reticulocytes with radioactive
amino acids to prove the defective production of alpha and
beta chains [3,4,5]. Despite that theory being postulated a
while ago, this pioneering work led to the modern definition
of beta-thalassemia. It is nowadays considered as a defect in
the synthesis of the beta-globin chains, leading to alpha/beta
imbalance, ineffective erythropoiesis, and chronic anemia
[6]. The diversity of the phenotypes in thalassemia make it
diagnostically challenging. The spectrum of thalassemias is
wide, with one end comprising thalassemia minor, which
consists of mild hypochromic microcytic anemia with no
obvious clinical manifestations, while on the other end
thalassemia major is characterized by patients who present
in their first years of life with profound anemia and regular
transfusion requirements for survival [7].
In the middle lies thalassemia intermedia (TI), a term
developed to describe patients with manifestations too mild
to be considered thalassemia major and too severe to be called
thalassemia minor. It was first used by Sturgeon, who suggested
the term for those who fit into this category [8]. TI belongs
to the non-transfusion-dependent thalassemia (NTDT)
group, which also includes hemoglobin E/β-thalassemia and
α-thalassemia intermedia (hemoglobin H disease). NTDTs
extend from sub-Saharan Africa to the Mediterranean region
and are also present in South and Southeast Asia.
Despite a decreasing worldwide trend in the past few
years, especially among the Mediterranean population,
where prevalence and carrier rates were considerably high,
thalassemias still remain a major public health burden [9].
Genetics: Grasping the Concept
Despite the considerable knowledge gained from
research about TI in the past few years, diagnosis is still
made on clinical grounds. The wide clinical spectrum
of beta-thalassemia intermedia entails a wide range of
presentations. Some patients remain asymptomatic for most
of their lives with hemoglobin levels ranging between 7 and
10 g/dL, while others present during childhood and require
transfusions for normal sustained growth (Table 1) [10].
One of the fundamental concepts of hematology is the
fact that an equal number of alpha and beta chains should
be present for proper hemoglobin physiology. While betathalassemia
major arises from the total absence of the beta
chains, TI arises from defective gene function leading to
partial suppression of beta-globin protein production.
It usually results from a homozygous or a compound
heterozygous mutation [11]. In some instances, only one
gene may be affected, making it dominantly inherited [12].
In most cases, the reason behind the milder phenotype
of TI as compared to thalassemia major usually results from
the interplay among 3 different mechanisms. The first is the
inheritance of a mild or silent beta-chain mutation, which
keeps a low level of beta chains, as opposed to its absence in
more severe cases making less of an alpha/beta imbalance.
The second is the inheritance of determinants associated
with increased gamma chain production, which pair with
unbound alpha chains. The third is the co-inheritance
of alpha-thalassemia, which decreases the number of
unpaired chains due to decreased alpha chain synthesis
[13]. It is possible to inherit a triplicated or quadruplicated
alpha genotype with beta heterozygosity and have a TI
phenotype as a result. Many other factors come into play,
with polymorphisms affecting bone, iron, and bilirubin
metabolism affecting the disease. They are grouped under
the umbrella of tertiary modifiers.
Table 1. Characteristics and manifestations of β-thalassemia intermedia.
Hemoglobin level 7-10 g/dL
HPLC electrophoresis HbA2 > 4%
HbF 10%-50%
Molecular characteristics
Mild/silent mutation
Co-inheritance of α-thalassemia may be present
Hereditary persistence of HbF, δβ-thalassemia, Gγ XMN1 polymorphism
Pertinent findings on physical exam
Splenomegaly
Moderate to severe hepatomegaly
Growth retardation
Expansion of facial bones
Obliteration of maxillary sinuses
Protrusion of lower jaw
6

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
Turk J Hematol 2014;31:5-16
Pathophysiology
The hemoglobin molecule being usually composed
of 2 alpha chains and 2 beta chains, any imbalance in
the coupling of these fragments will naturally lead to an
abnormal physiology, as equal alpha and beta chains need
to be present for proper function. In beta-thalassemia in
general, the absence or underproduction of the beta chain
causes an imbalance with excess alpha chains deposited
inside red blood cells. The latter process leads to oxidative
damage to the membranes and eventually cell lysis [14].
This sequence of events is behind the concept of
ineffective erythropoiesis. The resulting extra medullary
hematopoiesis and marrow hypertrophy lead to expansion
of the facial bones and obliteration of the maxillary sinuses,
causing protrusion of the upper jaw and the peculiar
thalassemic facies. It may also cause cortical thinning and
pathologic fractures in long bones [15,16,17].
The resulting anemia is a consequence of ineffective
erythropoiesis; however, hemolysis, in addition to being
a contributor to the anemia, also has a role in other
outcomes. Chronic anemia eventually leads to a state
of continuous iron absorption, leading to iron overload
and all of its resulting complications (cardiac, hepatic,
endocrine, etc.). The triad of ineffective erythropoiesis,
chronic anemia, and iron overload is at the heart of all
morbidities related to TI. a contributor to the anemia, also
vhas a role in other
Complications
When TI patients were compared to thalassemia major
patients, many complications exclusive to TI suddenly
Indications for transfusion
Occasional
More regular
l Infections
l Pregnancy
l Surgery
l Poor growth and development
during Childhood
l Prevention/management
of specific complications
(mentioned earlier)
Figure 1. Indications for transfusion.
Figure 2. Algorithm for iron chelation
Abbreviations: NTDT: non-transfusion dependent thalassemia, LIC: liver iron concentration, SF: serum ferritin, DFX: deferasirox.
7

Turk J Hematol 2014;31:5-16
Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
surfaced. At the heart of these complications lies the
triad of chronic anemia, ineffective erythropoiesis, and
iron overload [18,19,20,21,22]. It is important to grasp a
solid understanding of these complications in order to
tailor management accordingly. A brief summary of the
complications is provided in Figure 1, followed by specific
complications and management in Table 2.
Hepatobiliary Complications
The accelerated hemolysis that occurs because of the
instability in red blood cells leads to the formation of
gallstones. For this reason, any symptomatic gallstone should
be treated by a cholecystectomy. One additional consideration
is the need to inspect the gallbladder in any patient who is
undergoing splenectomy and consider intervention, since
cholecystitis may be life-threatening in any splenectomized
patient [23]. Since the majority of iron accumulation is in
the liver in TI patients, there is an increased risk, mainly in
non-chelated patients, of developing complications such as
fibrosis, cirrhosis, and eventually hepatocellular carcinoma.
This risk has been shown to be evident with higher iron loads
and increased serum ferritin. Case reports from Lebanon and
Italy have suggested a link between hepatocellular carcinoma
and liver iron loading in hepatitis C-negative patients with TI
[24,25].
Table 2. Specific complications of thalassemia intermedia and their management.
Specific Complication Management Disease related or Iron and
Disease related
Pulmonary Hypertension Sildenafil citrate, bosentan (small
studies suggest moderate benefit)
Iron and Disease related
Extramedullary haemopoietic
pseudotumors
Bone Disorders
Endocrinopathies
Thrombosis and
cerebrovascular disease
Leg ulcers
Radiation
Surgery
Hydroxyurea
Transfusion
Calcium and Vitamin D supplemetation,
other preventive measures
Bisphosphonates- Practice dependent
Hormonal therapy as with β-TM
Proper Iron chelation
Risk-assesment models
Acetyl salicylic acid or anti-platelets
for thrombocytosis
LMWH for previous thrombosis
Hypertransfusion
Supportive measures; Topical GF,
Pentoxyfylline, zinc supplementation,
leg elevation
Disease related
Disease related
Iron and Disease related
Iron and Disease related
Cholelithiasis Cholecystectomy Disease related
Splenomegaly Splenectomy when indicated Disease related
Iron Overload
Liver complications (fibrosis,
cirrhosis, cancer)
Proper Iron chelation with regular
monitoring
Adequate transfusion regimen to
avoid hepatitis
Adequate iron chelation
Adequate monitoring for malingnancy
Iron and Disease related
Iron and Disease related
8
TM: Thalassemia major, LMWH: low-molecular-weight heparin, GF: growth factor.

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
Turk J Hematol 2014;31:5-16
Extramedullary Hematopoiesis
Extramedullary hematopoiesis is a physiological
compensatory phenomenon occurring because of
insufficient bone marrow function that becomes unable
to meet circulatory demands [26]. Its occurrence in
chronic hemolytic anemias remains highest, particularly
in transfusion-independent TI [26,27]. Almost all body
sites may be involved, including the spleen, liver, lymph
nodes, thymus, heart, breasts, prostate, broad ligaments,
kidneys, adrenal glands, pleura, retroperitoneal tissue,
skin, peripheral and cranial nerves, and spinal canal
[28,29,30,31,32]. These sites are thought to normally engage
in active hematopoiesis in the fetus during gestation. The
incidence of extramedullary hematopoiesis in patients with
TI may reach up to 20% compared to polytransfused TM
patients, for whom the incidence remains 1% [26,33,34].
A paraspinal location for the hematopoietic tissue occurs
in 11%-15% of cases with extramedullary hematopoiesis
[27,35]. Paraspinal extramedullary hematopoiesis mainly
presents as pseudo-tumors, which may cause a variety
of neurological symptoms due to spinal compression.
However, it is thought that more than 80% of cases may
remain asymptomatic, and the lesions are usually discovered
incidentally by radiological techniques [36,37,38].
The male-to-female ratio reaches 5:1 [39]. Various clinical
presentations have been reported, including back pain,
lower extremity pain, paresthesia, abnormal proprioception,
exaggerated or brisk deep tendon reflexes, Babinski response,
Lasègue sign, paraparesis, paraplegia, ankle clonus, spastic
gate, urgency of urination, and bowl incontinence [40].
Leg Ulcers
Leg ulcers are a common complication of TI, occurring
in as many as one-third of patients with untreated or poorly
controlled disease. They usually appear in the second
decade of life and are generally located on the medial or
lateral malleoli. The ulcers emerge after minor trauma and
tend to expand rapidly [41]. They are slow to heal and tend
to recur or become chronic, causing severe pain, disability,
and esthetic problems that are difficult to manage for both
patients and physicians [42].
The etiology of thalassemic leg ulcers seems to be
multifactorial, with the main pathogenic mechanism
appearing to be tissue hypoxia secondary to the anemia and
the high affinity of fetal hemoglobin for oxygen [43].
Others factors contributing to ulcer formation include:
a) Abnormal rheological behavior of the diseased
erythrocytes characterized by increased rigidity of their
cellular membrane and enhanced adherence to endothelial
cells,
b) Local edema due to venous stasis and possibly right
heart insufficiency,
c) Repetitive local trauma and skin infections,
d) Hypercoagulability and prothrombotic tendency [44].
A Hypercoagulable State
The largest epidemiological study to date analyzed data
from 8860 thalassemia patients (6670 with thalassemia
major and 2190 with TI) and demonstrated that
thromboembolic events (TEEs) occurred 4.38 times more
frequently in TI than in thalassemia major patients [45].
The hypercoagulability in TI has been attributed to several
factors, including a procoagulant activity of hemolyzed
circulating red blood cells, increased platelet activation,
coagulation factor defects, depletion of antithrombotic
factors, and endothelial inflammation, among others
[46]. These factors have been observed at a higher rate in
splenectomized patients [46]. Clinical studies also confirmed
that splenectomized TI patients have a higher incidence of
TEE than non-splenectomized controls [45,47,48,49]. In
the OPTIMAL CARE study, 73/325 (22.5%) splenectomized
patients developed TEEs compared with 9/259 (3.5%) nonsplenectomized
patients (p

Turk J Hematol 2014;31:5-16
Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
characterized by endothelial dysfunction, increased vascular
tone, inflammation, hypercoagulability, and, finally, vascular
remodeling and destruction of the pulmonary vasculature,
which ultimately results in hemolytic anemia-associated
PHT [56,58].
Autopsies of a large series of patients with TI revealed
thrombotic lesions in the pulmonary arteries, which may
have been due to circulating platelet aggregates [59]. Similar
findings of multiple microthrombi, which were composed
mainly of platelets, were seen in the pulmonary arterioles and
microcirculation in autopsies of 2 splenectomized patients
with thalassemia [60]. A high rate of PHT in splenectomized
TI patients has been documented and attributed to a chronic
thromboembolic state [61,62]. Moreover, elevated levels
of circulating red blood cell-derived microparticles were
detected in splenectomized patients with TI [63]. Whether
they contribute to the development of PHT in this patient
population warrants evaluation. A recent study by Derchi et
al. established for the first time the presence of PHT by right
heart catheterization in thalassemic patients. It also showed
that the prevalence was higher in TI patients compared to
those with thalassemia major [64].
Renal Complications
Different renal cell types have different resistances to the
decrease of oxygen supply [65]. In vitro and animal models
have shown that hypoxia may cause apoptosis of tubular
and endothelial cells [66,67,68]. Other in vitro studies
showed that hypoxia can induce a fibrogenic phenotype. A
final result may be represented by activation of fibroblasts
and accumulation of an extracellular matrix of resident
renal cells [69,70,71,72]. Hence, it is apparent that chronic
hypoxia causes proximal tubular cell dysfunction and
interstitial fibrosis, which, in the presence of other renal risk
factors, may lead to progressive renal disease.
Anemia causes renal defects through mechanisms
different from those employed in hypoxia. Anemia affects
the glomerulus by inducing renal hyper perfusion and
glomerular hyper filtration [73,74,75]. The mechanism is
thought to be a decrease in systemic vascular resistance and
a subsequent increase in renal plasma flow [76]. This may
represent a benefit in the short term [77]. However, over
the long term, glomerular hyper perfusion may theoretically
mediate progressive renal damage, as reported by
experimental and clinical data [78]. Thus, it is theoretically
possible that persistent anemia, such as that seen in
thalassemia major patients, may contribute to a progressive
decrease of the glomerular filtration rate [79].
Iron is a source of oxidative stress in biological systems.
In thalassemic patients, the increased intracellular content
of non-hemoglobin iron generates free oxygen radicals
that bind to different membrane proteins, altering the
morphology, function, and structure of membrane proteins
[80]. Free iron can also directly catalyze lipid peroxidation
by removing hydrogen atoms from the fatty acids that
constitute the lipid bilayer of organelles [81].
Iron Overload
Three main factors are responsible for the clinical
sequelae of TI: ineffective erythropoiesis, chronic anemia,
and iron overload. Iron overload occurs primarily as a result
of increased intestinal iron absorption but can also result
from occasional transfusion therapy, which may be required
to manage certain disease-related complications [18,19]. The
pathophysiology of iron loading in TI appears similar to that
observed in patients with hereditary forms of hemochromatosis
[56] and is different from that seen in thalassemia major,
where there is a predilection for NTBI accumulation. NTBI is
a powerful catalyst for the formation of hydroxyl radicals from
reduced forms of O2 [20]. Labile or “free” iron can convert
relatively stable oxidants into powerful radicals. A recent
cross-sectional study of 168 non-chelated patients with TI
aimed to establish an association between LIC and a variety
of serious morbidities noted in this patient population. Each 1
mg Fe/g DW increase in LIC was significantly associated with
an increased risk of thrombosis, pulmonary hypertension,
hypothyroidism, hypogonadism, and osteoporosis. LIC
values of at least 6-7 mg Fe/g DW discriminated patients who
developed morbidity from those who did not [21]. A more
recent longitudinal follow-up over a 10-year period confirmed
these findings in 52 non-chelated patients with TI, and a serum
ferritin level of 800 ng/mL was the threshold above which all
patients were at risk of developing morbidity [22].
Management
General Considerations
One way to approach management of TI is by dividing
therapy into 3 broad categories. These include conventional
modalities such as transfusion and iron chelation therapy,
splenectomy, supportive therapies, and psychological
support [82]. The non-conventional methods comprise
gene therapy and fetal hemoglobin modulation, while stem
cell transplantation remains the only curative and radical
treatment. Quality of life in patients with TI has been a topic
of interest lately, and it is clear that without any treatment,
patients are at risk of experiencing more morbidities and
poorer health-related quality of life [83,84,85]. Many of
the standards of treatment nowadays are derived from
years of experience and the evolving concept of evidencebased
medicine. Despite many modalities being available,
some of them remain experimental in nature or are at
an early investigational stage. The most important ones
are transfusion therapy, iron chelation, fetal hemoglobin
induction, and stem cell transplantation.
Transfusion Therapy
Although regular blood transfusions are the cornerstone
of medical therapy in beta-thalassemia major, one of the
most challenging therapeutic decisions in TI is when to
initiate transfusion [86].
10

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
Turk J Hematol 2014;31:5-16
The main factors guiding the decision to transfuse are
usually the development of signs and symptoms of anemia
including growth failure and development failure. Despite
a sporadic need for transfusions in many TI patients in
situations such as infection, pregnancy, or surgery, patients
should never be committed to a regular transfusion program
unless the clinical picture dictates it. The main indications
for a regular transfusion program remain growth failure,
skeletal deformity, exercise intolerance, and declining
hemoglobin levels because of progressive splenomegaly
(Figure 1) [86,87,88].
The greatest impact of blood transfusions is in the
pediatric group, where, in addition to reversing the anemia, it
also carries the risk of alloimmunization. This phenomenon
was found to be relatively common if a transfusion regimen
was started after 12 months of age [89].
Some authorities recommend Rhesus and Kell
phenotyping prior to transfusion [90], with the role
of steroids for a short period (3-5 days) in preventing
alloimmunization yet to be elucidated.
Iron Chelation
With transfusion therapy comes another very important
consideration, that of iron overload. In addition to the natural
iron-absorbing state of NTDT patients, the transfusional iron
burden is also significant. In the OPTIMAL CARE study,
patients who received both transfusions and chelation therapy
had a lower incidence of complications than those who
received transfusion alone or no treatment at all [47], hence
showing the importance of appropriate therapy. The rate of
iron loading in patients who do not receive transfusions is
thought to be around 2-5 g/year [91], as opposed to 7.5-15.1
g/year in transfused patients [92]. The challenging matter
in NTDT in general is the determination of the appropriate
time for the initiation of chelation therapy. In 2008, a study
by Taher et al. determined that serum ferritin in TI often
underestimates the real iron burden. In comparison with
MRI, ferritin was found to underestimate LIC [93].
Later findings emphasized the need for a reliable measure
of body iron, and the MRI R2 and R2* showed a valid
correlation between liver iron and body iron, becoming the
preferred modality to guide therapy [93,94,95].
Until recently, the cutoff for starting chelation was an
LIC of 7 mg Fe/g DW or above. A recent study, however,
by Musallam et al. showed that complications were more
likely to occur at an LIC of 7 mg Fe/g DW, hence signaling
the need to start chelating patients earlier [95]. The latest
recommendations by the Thalassemia International
Federation advocate LIC of 5 mg Fe/g DW and serum
ferritin of 800 µg/L (Figure 2). Deferoxamine remains
the gold standard in TI but the limitations of its use and
its side effects have pushed pharmaceutical industries to
look for other options. The main limitations reside in the
fact that it needs to be administered either intravenously
or subcutaneously, therefore increasing patient discomfort
and negatively impacting quality of life [96,97]. Many
studies evaluated deferoxamine in TI patients, and in 1988
Pippard and Weatherall concluded that the need for an oral
chelator was very important despite deferoxamine delivering
promising results in the studied group. Deferiprone (L1,
Ferriprox) was the first oral chelator to be made available
on the market. Small clinical trials demonstrated effective
management of iron levels [98], but the lack of large-scale,
placebo-controlled trials on deferiprone made the available
data very limited. One of the recent products is deferasirox,
an oral chelator with a once-daily dosage. It was developed
to provide day-long chelation coverage with a suitable
safety and efficacy profile [99,100]. The THALASSA trial
was the first multicenter placebo-controlled double-blinded
randomized trial to be conducted on TI patients, and it
showed a sustained reduction in iron burden with deferasirox
[101]. Further studies about its safety and efficacy are still
ongoing. The latest new entry to the family of oral chelators
was developed by Shire Pharmaceuticals, but it is still at an
experimental stage with promising results on the horizon
[102,103].
HbF Inducers
One postulated mechanism of action of hemoglobin F
inducers is based on reducing the imbalance between alphaglobin
chains and non-alpha chains [86]. These inducers
may in fact increase the expression of gamma chain genes.
The rationale behind inducing hemoglobin F is to decrease
anemia symptoms and improve the clinical status of patients
with TI [104].
In the Middle East, experience with HbF inducers
is limited. Large series, however, come from Iran and
India, where results have been promising, with some
patients becoming completely transfusion-independent
[105,106,107].
Table 3. Indications for splenectomy.
Indication
Poor growth and development due to anemia
Hypersplenism
Splenomegaly
Comment
Generally avoided in patients less than 5 years old
Leucopenia and thrombocytopenia
Left upper quadrant pain, massive splenomegaly with concern
about rupture
11

Turk J Hematol 2014;31:5-16
Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
Splenectomy
All guidelines agree that physicians should adopt a
guarded approach and restrict splenectomy to certain
indications. Splenectomy should be avoided in children
of

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
Turk J Hematol 2014;31:5-16
11. Galanello R, Cao A. Relationship between genotype and
phenotype. Thalassemia intermedia. Ann N Y Acad Sci
1998;850:325-333.
12. Weatherall DJ. Thalassaemia: the long road from bedside to
genome. Nat Rev Genet 2004;5:625-631.
13. Camaschella C, Mazza U, Roetto A, Gottardi E, Parziale A,
Travi M, Fattore S, Bacchiega D, Fiorelli G, Cappellini MD.
Genetic interactions in thalassemia intermedia: analysis
of β-mutations, alpha-genotype, gamma-promoters, and
β-LCR hypersensitive sites 2 and 4 in Italian patients. Am J
Hematol 1995;48:82-87.
14. Olivieri NF. The β-thalassemias. N Engl J Med 1999;341:99-
109.
15. Cappellini M, Musallam K, Cesaretti C, Taher A. Thalassemia
intermedia. In: Disorders of Erythropoiesis, Erythrocytes
and Iron Metabolism. Genoa, Italy, Forum Service Editore,
2009.
16. Camaschella C, Cappellini MD. Thalassemia intermedia.
Haematologica 1995;80:58-68.
17. Cappellini MD, Cerino M, Marelli S, Fiorelli G. Thalassemia
intermedia: clinical aspects and management. Haematologica
2001;86:194-196.
18. Taher A, Hershko C, Cappellini MD. Iron overload in
thalassaemia intermedia: reassessment of iron chelation
strategies. Br J Haematol 2009;147:634-640.
19. Origa R, Galanello R, Ganz T, Giagu N, Maccioni L, Faa G,
Nemeth E. Liver iron concentrations and urinary hepcidin
in β-thalassemia. Haematologica 2007;92:583-588.
20. Hershko C. Pathogenesis and management of iron toxicity
in thalassemia. Ann N Y Acad Sci 2010;1202:1-9.
21. Musallam KM, Cappellini MD, Wood JC, Motta I, Graziadei
G, Tamim H, Taher AT. Elevated liver iron concentration is a
marker of increased morbidity in patients with β thalassemia
intermedia. Haematologica 2011;96:1605-1612.
22. Musallam KM, Cappellini MD, Daar S, Karimi M, El-Beshlawy
A, Taher AT. Serum ferritin levels and morbidity in beta
thalassemia intermedia: a 10-year cohort study [abstract].
Blood 2012;120:1021.
23. Musallam KM, Taher AT, Rachmilewitz EA. β-Thalassemia
intermedia: a clinical perspective. Cold Spring Harb Perspect
Med 2012;2:a013482.
24. Musallam KM, Motta I, Salvatori M, Fraquelli M, Marcon
A, Taher AT, Cappellini MD. Longitudinal changes in serum
ferritin levels correlate with measures of hepatic stiffness
in transfusion-independent patients with β-thalassemia
intermedia. Blood Cells Mol Dis 2012;49:136-139.
25. Maakaron JE, Cappellini MD, Graziadei G, Ayache JB, Taher
AT. Hepatocellular carcinoma in hepatitis-negative patients
with thalassemia intermedia: a closer look at the role of
siderosis. Ann Hepatol 2013;12:142-146.
26. Taher A, Isma’eel H, Cappellini MD. Thalassemia intermedia:
revisited. Blood Cells Mol Dis 2006;37:12-20.
27. Dore F, Cianciulli P, Rovasio S, Oggiano L, Bonfigli S,
Murineddu M, Pardini S, Simonetti G, Gualdi G, Papa G.
Incidence and clinical study of ectopic erythropoiesis in
adult patients with thalassemia intermedia. Ann Ital Med
Int 1992;7:137-140.
28. Aessopos A, Tassiopoulos S, Farmakis D, Moyssakis I, Kati
M, Polonifi K, Tsironi M. Extramedullary hematopoiesisrelated
pleural effusion: the case of β-thalassemia. Ann
Thorac Surg 2006;81:2037-2043.
29. Chuang CK, Chu SH, Fang JT, Wu JH. Adrenal extramedullary
hematopoietic tumor in a patient with
β-thalassemia. J Formos Med Assoc 1998;97:431-433.
30. Kumar A, Aggarwal S, de Tilly LN. Case of the season.
Thalassemia major with extramedullary hematopoiesis in
the liver. Semin Roentgenol 1995;30:99-101.
31. Brannan D. Extramedullary hematopoiesis in anemias. Bull
Johns Hopkins Hosp 1927;41:104-135.
32. Ross P, Logan W. Roentgen findings in extramedullary
hematopoiesis. AJR Am J Roentgenol 1969;106:604-613.
33. Logothetis J, Constantoulakis M, Economidou J, Stefanis C,
Hakas P, Augoustaki O, Sofroniadou K, Loewenson R, Bilek
M. Thalassemia major (homozygous beta-thalassemia).
A survey of 138 cases with emphasis on neurologic and
muscular aspects. Neurology 1972;22:249-304.
34. Prabhakar S, Chopra J, Khosla VK, Dash S, Banerijee AK.
Spinal compression in homozygous β thalassemia. Surg
Neurol 1980;13:351-354.
35. Shin KH, Sharma S, Gregoritch SJ, Lifeso RM, Bettigole
R, Yoon SS. Combined radiotherapeutic and surgical
management of a spinal cord compression by extramedullary
hematopoiesis in a patient with hemoglobin E β-thalassemia.
Acta Haematol 1994;91:154-157.
36. Parsa K, Oreizy A. Nonsurgical approach to paraparesis due
to extramedullary hematopoiesis. J Neurosurg 1995;82:657-
660.
37. Richter E. Extramedullary hematopoiesis with intraspinal
extension in thalassemia. Aktuelle Radiol 1993;3:320-322.
38. Dore F, Pardini S, Gaviano E, Longinotti M, Bonfigli S,
Rovasio S, Tomiselli A, Cossu F. Recurrence of spinal
cord compression from extramedullary hematopoiesis
in thalassemia intermedia treated with low doses of
radiotherapy. Am J Hematol 1993;44:148.
39. Salehi SA, Koski T, Ondra SL. Spinal cord compression
in β-thalassemia: case report and review of the literature.
Spinal Cord 2004;42:117-123.
40. Haidar R, Mhaidli H, Taher AT. Paraspinal extramedullary
hematopoiesis in patients with thalassemia intermedia. Eur
Spine J 2010;19:871-878.
41. Gimmon Z, Wexler MR, Rachmilewitz EA. Juvenile leg
ulceration in β-thalassemia major and intermedia. Plast
Reconstr Surg 1982;69:320-325.
13

Turk J Hematol 2014;31:5-16
Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
42. Levin C, Koren A. Healing of refractory leg ulcer in a patient
with thalassemia intermedia and hypercoagulability after 14
years of unresponsive therapy. IMAJ 2011;13:316-318.
43. Galanello R, Barella S, Turco MP, Giagu N, Cao A, Dore F,
Liberato NL, Guarnone R, Barosi G. Serum erythropoietin
and erythropoiesis in high- and low-fetal hemoglobin
β-thalassemia intermedia patients. Blood 1994;83:561-565.
44. Brandt HRC, De Lorenzo Messina MC, Hirayama JT, Belda
W Jr, Benabou JE, Criado PR. Prevalence of thrombophilia
associated with leg ulcers. Br J Dermatol 2009;160:202-203.
45. Taher A, Isma’eel H, Mehio G, Bignamini D, Kattamis
A, Rachmilewitz EA, Cappellini MD. Prevalence of
thromboembolic events among 8,860 patients with
thalassaemia major and intermedia in the Mediterranean
area and Iran. Thromb Haemost 2006;96:488-491.
46. Taher AT, Otrock ZK, Uthman I, Cappellini MD. Thalassemia
and hypercoagulability. Blood Rev 2008;22:283-292.
47. Taher AT, Musallam KM, Karimi M, El-Beshlawy A, Belhoul
K, Daar S, Saned MS, El-Chafic AH, Fasulo MR, Cappellini
MD. Overview on practices in thalassemia intermedia
management aiming for lowering complication rates across
a region of endemicity: the OPTIMAL CARE study. Blood
2010;115:1886-1892.
48. Crary SE, Buchanan GR. Vascular complications
after splenectomy for hematologic disorders. Blood
2009;114:2861-2868.
49. Cappellini MD, Robbiolo L, Bottasso BM, Coppola R,
Fiorelli G, Mannucci AP. Venous thromboembolism
and hypercoagulability in splenectomized patients with
thalassaemia intermedia. Br J Haematol 2000;111:467-473.
50. Taher AT, Musallam KM, Karimi M, El-Beshlawy A, Belhoul
K, Daar S, Saned M, Cesaretti C, Cappellini MD. Splenectomy
and thrombosis: the case of thalassemia intermedia. J
Thromb Haemost 2010;8:2152-2158.
51. Manfre L, Giarratano E, Maggio A, Banco A, Vaccaro G, Lagalla
R. MR imaging of the brain: findings in asymptomatic patients
with thalassemia intermedia and sickle cell-thalassemia
disease. AJR Am J Roentgenol 1999;173:1477-1480.
52. Taher AT, Musallam KM, Nasreddine W, Hourani R, Inati
A, Beydoun A. Asymptomatic brain magnetic resonance
imaging abnormalities in splenectomized adults with
thalassemia intermedia. J Thromb Haemost 2010;8:54-59.
53. Taher AT, Musallam KM, Wood JC, Cappellini MD.
Magnetic resonance evaluation of hepatic and myocardial
iron deposition in transfusion-independent thalassemia
intermedia compared to regularly transfused thalassemia
major patients. Am J Hematol 2010;85:288-290.
54. Origa R, Barella S, Argiolas GM, Bina P, Agus A, Galanello
R. No evidence of cardiac iron in 20 never- or minimallytransfused
patients with thalassemia intermedia.
Haematologica 2008;93:1095-1096.
55. Li X, Jankovic J, Le W. Iron chelation and neuroprotection in
neurodegenerative diseases. J Neural Transm 2011;118:473-
477.
56. Gladwin MT, Vichinsky E. Pulmonary complications of
sickle cell disease. N Engl J Med 2008;359:2254-2265.
57. Gladwin MT, Lancaster JR Jr, Freeman BA, Schechter AN.
Nitric oxide’s reactions with hemoglobin: a view through
the SNO-storm. Nat Med 2003;9:496-500.
58. Aessopos A, Farmakis D, Tsironi M, Diamanti-Kandarakis
E, Matzourani M, Fragodimiri C, Hatziliami A, Karagiorga
M. Endothelial function and arterial stiffness in sicklethalassemia
patients. Atherosclerosis 2007;191:427-432.
59. Sonakul D, Pacharee P, Laohapand T, Fucharoen S, Wasi P.
Pulmonary artery obstruction in thalassaemia. Southeast
Asian J Trop Med Public Health 1980;11:516-523.
60. Sumiyoshi A, Thakerngpol K, Sonakul D. Pulmonary
microthromboemboli in thalassemic cases. Southeast Asian
J Trop Med Public Health 1992;23:29-31.
61. Atichartakarn V, Likittanasombat K, Chuncharunee S,
Chandanamattha P, Worapongpaiboon S, Angchaisuksiri P,
Aryurachai K. Pulmonary arterial hypertension in previously
splenectomized patients with β-thalassemic disorders. Int J
Hematol 2003;78:139-145.
62. Phrommintikul A, Sukonthasarn A, Kanjanavanit
R, Nawarawong W. Splenectomy: a strong risk
factor for pulmonary hypertension in patients with
thalassaemia. Heart 2006;92:1467-1472.
63. Habib A, Kunzelmann C, Shamseddeen W, Zobairi F,
Freyssinet JM, Taher A. Elevated levels of circulating
procoagulant microparticles in patients with β-thalassemia
intermedia. Haematologica 2008;93:941-942.
64. Derchi G, Galanello R, Bina P, Cappellini MD, Piga A,
Lai ME, Quarta A, Casu G, Perrotta S, Pinto V, Musallam
KM, Forni GL; Webthal Pulmonary Arterial Hypertension
Group. Prevalence and risk factors for pulmonary arterial
hypertension in a large group of β-thalassemia patients using
right heart catheterization: A Webthal ® Study. Circulation
2014;129:338-345.
65. Brezis M, Rosen S. Hypoxia of the renal medulla: its
implications for disease. N Engl J Med 1995;332:647-655.
66. Tanaka T, Miyata T, Inagi R, Kurokawa K, Adler S, Fujita
T, Nangaku M. Hypoxia-induced apoptosis in cultured
glomerular endothelial cells: involvement of mitochondrial
pathways. Kidney Int 2003;64:2020-2032.
67. Khan S, Cleveland RP, Koch CJ, Schelling JR. Hypoxia
induces renal tubular epithelial cell apoptosis in chronic
renal disease. Lab Invest 1999;79:1089-1099.
68. Heyman SN, Khamaisi M, Rosen S, Rosenberger C. Renal
parenchymal hypoxia, hypoxia response and the progression
of chronic kidney disease. Am J Nephrol 2008;28:998-
1006.
14

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
Turk J Hematol 2014;31:5-16
69. Norman JT, Orphanides C, Garcia P, Fine LG. Hypoxiainduced
changes in extracellular matrix metabolism in renal
cells. Exp Nephrol 1999;7:463-469.
70. Norman JT, Clark IM, Garcia PL. Hypoxia promotes
fibrogenesis in human renal fibroblasts. Kidney Int
2000;58:2351-2366.
71. Zeisberg M, Strutz F, Müller GA. Role of fibroblast activation
in inducing interstitial fibrosis. J Nephrol 2000;13(Suppl
3):111-120.
72. Nangaku M. Chronic hypoxia and tubulointerstitial injury:
a final common pathway to end-stage renal failure. J Am Soc
Nephrol 2006;17:17-25.
73. Ricchi P, Ammirabile M, Costantini S, Di Matola T, Spasiano
A, Genna ML, Cinque P, Prossomariti L. Splenectomy is a
risk factor for developing hyperuricemia and nephrolithiasis
in patients with thalassemia intermedia: a retrospective
study. Blood Cells Mol Dis 2012;49:133-135.
74. Quinn CT, Johnson VL, Kim HY, Trachtenberg F, Vogiatzi
MG, Kwiatkowski JL, Neufeld EJ, Fung E, Oliveri N, Kirby
M, Giardina PJ; Thalassemia Clinical Research Network.
Renal dysfunction in patients with thalassaemia. Br J
Haematol 2011;153:111-117.
75. Mastrangelo F, Lopez T, Rizzelli S, Manisco G, Corlianò
C, Alfonso L. Function of the kidney in adult patients
with Cooley’s disease: a preliminary report. Nephron
1975;14:229-236.
76. Davis LE, Hohimer AR. Hemodynamics and organ blood
flow in fetal sheep subjected to chronic anemia. Am J
Physiol 1991;261:R1542-R1548.
77. Lafferty HM, Anderson S, Brenner BM. Anemia: a potent
modulator of renal hemodynamics in models of progressive
renal disease. Am J Kidney Dis 1991;17(Suppl 1):2-7.
78. Brenner BM, Lawler EV, Mackenzie HS. The hyperfiltration
theory: a paradigm shift in nephrology. Kidney Int
1996;49:1774-1777.
79. Ponticelli C, Musallam KM, Cianciulli P, Cappellini MD.
Renal complications in transfusion-dependent beta
thalassaemia. Blood Rev 2010;24:239-244.
80. Sumboonnanonda A, Malasit P, Tanphaichitr VS, Ongajyooth
S, Petrarat S, Vongjirad A. Renal tubular dysfunction
in alpha-thalassemia. Pediatr Nephrol 2003;18:257-260.
81. Halliwell B, Gutteridge JM. Role of free radicals and catalytic
metal ions in human disease: an overview. Methods Enzymol
1990;186:1-85.
82. Maakaron JE, Cappellini MD, Taher AT. An update on
thalassemia intermedia. J Med Liban 2013;61:175-182.
83. Taher AT, Musallam KM, El-Beshlawy A, Karimi M, Daar
S, Belhoul K, Saned MS, Graziadei G, Cappellini MD. Agerelated
complications in treatment-naive patients with
thalassaemia intermedia. Br J Haematol 2010;150:486-489.
84. Musallam KM, Khoury B, Abi-Habib R, Bazzi L, Succar J,
Halawi R, Hankir A, Koussa S, Taher AT. Health-related
quality of life in adults with transfusion-independent
thalassaemia intermedia compared to regularly transfused
thalassaemia major: new insights. Eur J Haematol
2011;87:73-79.
85. Musallam KM, Taher AT, Duca L, Cesaretti C, Halawi R,
Cappellini MD. Levels of growth differentiation factor-15
are high and correlate with clinical severity in transfusionindependent
patients with β thalassemia intermedia. Blood
Cells Mol Dis 2011;47:232-234.
86. Taher AT, Musallam KM, Cappellini MD, Weatherall DJ.
Optimal management of beta thalassaemia intermedia. Br J
Haematol 2011;152:512-523.
87. Borgna-Pignatti C. Modern treatment of thalassaemia
intermedia. Br J Haematol 2007;138:291-304.
88. Borgna-Pignatti C, Marsella M, Zanforlin N. The natural
history of thalassemia intermedia. Ann N Y Acad Sci
2010;1202:214-220.
89. Spanos T, Karageorga M, Ladis V, Peristeri J, Hatziliami
A, Kattamis C. Red cell alloantibodies in patients with
thalassemia. Vox Sang 1990;58:50-55.
90. Hmida S, Mojaat N, Maamar M, Bejaoui M, Mediouni M, Boukef
K. Red cell alloantibodies in patients with haemoglobinopathies.
Nouv Rev Fr Hematol 1994;36:363-366.
91. Pippard MJ, Callender ST, Finch CA. Ferrioxamine excretion
in iron-loaded man. Blood 1982;60:288-294.
92. Thalassemia International Federation. Guidelines for the
Clinical Management of Thalassemia. Strovolos, Cyprus,
Thalassemia International Federation, 2004.
93. Taher A, El Rassi F, Isma’eel H, Koussa S, Inati A, Cappellini
MD. Correlation of liver iron concentration determined
by R2 magnetic resonance imaging with serum ferritin
in patients with thalassemia intermedia. Haematologica
2008;93:1584-1586.
94. Wood JC, Enriquez C, Ghugre N, Tyzka JM, Carson S,
Nelson MD, Coates TD. MRI R2 and R2* mapping accurately
estimates hepatic iron concentration in transfusiondependent
thalassemia and sickle cell disease patients.
Blood 2005;106:1460-1465.
95. St Pierre TG, Clark PR, Chua-anusorn W, Fleming AJ,
Jeffrey GP, Olynyk JK, Pootrakul P, Robins E, Lindeman
R. Noninvasive measurement and imaging of liver iron
concentrations using proton magnetic resonance. Blood
2005;105:855-861.
96. Treadwell MJ, Weissman L. Improving adherence with
deferoxamine regimens for patients receiving chronic
transfusion therapy. Semin Hematol 2001;38(Suppl 1):
77-84.
97. Cappellini MD. Overcoming the challenge of patient
compliance with iron chelation therapy. Semin Hematol
2005;42(Suppl 1):19-21.
15

Turk J Hematol 2014;31:5-16
Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View
98. Pootrakul P, Sirankapracha P, Sankote J, Kachintorn
U, Maungsub W, Sriphen K, Thakernpol K, Atisuk K,
Fucharoen S, Chantraluksri U, Shalev O, Hoffbrand AV.
Clinical trial of deferiprone iron chelation therapy in
β-thalassaemia/haemoglobin E patients in Thailand. Br J
Haematol 2003;122:305-310.
99. Cappellini MD, Cohen A, Piga A, Bejaoui M, Perrotta S,
Agaoglu L, Aydinok Y, Kattamis A, Kilinc Y, Porter J, Capra
M, Galanello R, Fattoum S, Drelichman G, Magnano C,
Verissimo M, Athanassiou-Metaxa M, Giardina P, Kourakli-
Symeonidis A, Janka-Schaub G, Coates T, Vermylen C,
Olivieri N, Thuret I, Opitz H, Ressayre-Djaffer C, Marks P,
Alberti D. A phase 3 study of deferasirox (ICL670), a oncedaily
oral iron chelator, in patients with β-thalassemia.
Blood 2006;107:3455-3462.
100. Vichinsky E, Onyekwere O, Porter J, Swerdlow P, Eckman
J, Lane P, Files B, Hassell K, Kelly P, Wilson F, Bernaudin
F, Forni GL, Okpala I, Ressayre-Djaffer C, Alberti D,
Holland J, Marks P, Fung E, Fischer R, Mueller BU, Coates
T; Deferasirox in Sickle Cell Investigators. A randomized
comparison of deferasirox versus deferoxamine for the
treatment of transfusional iron overload in sickle cell
disease. Br J Haematol 2007;136:501-508.
101. Taher AT, Porter JB, Viprakasit V, Kattamis A, Chuncharunee
S, Sutcharitchan P, Siritanaratkul N, Galanello R, Karakas
Z, Lawniczek T, Habr D, Ros J, Zhu Z, Cappellini MD.
Deferasirox effectively reduces iron overload in nontransfusion-dependent
thalassemia (NTDT) patients:
1-year extension results from the THALASSA study. Ann
Hematol 2013;92:1485-1493.
102. Rienhoff HY Jr, Viprakasit V, Tay L, Harmatz P, Vichinsky
E, Chirnomas D, Kwiatkowski JL, Tapper A, Kramer W,
Porter JB, Neufeld EJ. A phase 1 dose escalation study:
safety, tolerability, and pharmacokinetics of FBS0701, a
novel oral iron chelator for the treatment of transfusional
iron overload. Haematologica 2011;96:521-525.
103. Karimi M, Darzi H, Yavarian M. Hematologic and
clinical responses of thalassemia intermedia patients to
hydroxyurea during 6 years of therapy in Iran. J Pediatr
Hematol Oncol 2005;27:380-385.
104. Neufeld EJ, Galanello R, Viprakasit V, Aydinok Y, Piga A,
Harmatz P, Forni GL, Shah FT, Grace RF, Porter JB, Wood
JC, Peppe J, Jones A, Rienhoff HY Jr. A phase 2 study of the
safety, tolerability, and pharmacodynamics of FBS0701,
a novel oral iron chelator, in transfusional iron overload.
Blood 2012;119:3263-3268.
105. Olivieri NF. Reactivation of fetal hemoglobin in patients
with β-thalassemia. Semin Hematol 1996;33:24-42.
106. Dixit A, Chatterjee TC, Mishra P, Choudhry DR, Mahapatra
M, Tyagi S, Kabra M, Saxena R, Choudhry VP. Hydroxyurea
in thalassemia intermedia–a promising therapy. Ann
Hematol 2005;84:441-446.
107. Panigrahi I, Dixit A, Arora S, Kabra M, Mahapatra M,
Choudhry VP, Saxena R. Do alpha deletions influence
hydroxyurea response in thalassemia intermedia?
Hematology 2005;10:61-63.
108. Pakbaz Z, Treadwell M, Yamashita R, Quirolo K, Foote D,
Quill L, Singer T, Vichinsky EP. Quality of life in patients
with thalassemia intermedia compared to thalassemia
major. Ann N Y Acad Sci 2005;1054:457-461.
109. Khoury B, Musallam KM, Abi-Habib R, Bazzi L, Ward
ZA, Succar J, Halawi R, Hankir A, Koussa S, Taher AT.
Prevalence of depression and anxiety in adult patients with
β-thalassemia major and intermedia. Int J Psychiatry Med
2012;44:291-303.
110. Musallam KM, Taher AT, Karimi M, Rachmilewitz EA.
Cerebral infarction in β-thalassemia intermedia: breaking
the silence. Thromb Res 2012;130:695-702.
16

Research Article
DOI: 10.4274/Tjh.2012.0197
A Polymorphism in the IL-5 Gene is Associated with
Inhibitor Development in Severe Hemophilia A Patients
Ağır Hemofili A Hastalarında İnhibitör Gelişimi ile IL-5
Genindeki Bir Polimorfizmin İlişkilendirilmesi
İnanç Değer Fidancı 1 , Bülent Zülfikar 2 , Kaan Kavaklı 3 , M. Cem Ar 4 , Yurdanur Kılınç 5 , Zafer Başlar 6 ,
Server Hande Çağlayan 1
1Boğaziçi University, Department of Molecular Biology and Genetics, İstanbul, Turkey
2İstanbul University Medical School, Institute of Oncology, İstanbul, Turkey
3Ege University Medical School, Department of Pediatric Hematology, İzmir, Turkey
4İstanbul Training and Education Hospital, Department of Hematology, İstanbul, Turkey
5Çukurova University Medical School, Department of Pediatric Hematology, Adana, Turkey
6İstanbul University Cerrahpaşa Medical Faculty, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey
Abstract:
Objective: A severe complication in the replacement therapy of hemophilia A (HA) patients is the development of
alloantibodies (inhibitors) against factor VIII, which neutralizes the substituted factor. The primary genetic risk factors
influencing the development of inhibitors are F8 gene mutations. Interleukins and cytokines that are involved in the regulation
of B-lymphocyte development are other possible targets as genetic risk factors. This study assesses the possible involvement
of 9 selected single nucleotide gene polymorphisms (SNPs) with interleukins (IL-4, IL-5, and IL-10), transforming growth
factor beta 1 (TGF-β1), and interferon gamma (IFN-γ) in inhibitor development in severely affected HA patients carrying a
null mutation in the F8 gene.
Materials and Methods: A total of 173 HA patients were screened for intron 22 inversion and null mutations (nonsense
and deletions). Genotyping of a total of 9 SNPs in genes IL-4, IL-5, IL-10, TGF-β1, and IFN-γ in 103 patients and 100 healthy
individuals was carried out.
Results: An association analysis between 42 inhibitor (+) and 61 inhibitor (-) patients showed a significant association with the
T allele of rs2069812 in the IL-5 gene promoter and patients with inhibitors (p=0.0251). The TT genotype was also significantly
associated with this group with a p-value of 0.0082, odds ratio of about 7, and confidence interval of over 90%, suggesting that
it is the recessive susceptibility allele and that the C allele is the dominant protective allele.
Conclusion: The lack of other variants in the IL-5 gene of patients and controls suggests that rs2069812 may be a regulatory
SNP and may have a role in B-lymphocyte development, constituting a genetic risk factor in antibody development.
Key Words: Hemophilia A, Inhibitor formation, F8 gene mutation, Single nucleotide gene polymorphisms, Interleukins/
cytokines, Association study
Address for Correspondence: Server Hande Çağlayan, M.D.,
Boğaziçi University, Department of Molecular Biology and Genetics, İstanbul, Turkey
E-mail: hande@boun.edu.tr Phone: +90 212 359 68 81
Received/Geliş tarihi : December 15, 2012
Accepted/Kabul tarihi : July 31, 2013
17

Turk J Hematol 2014;31:17-24
Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene
Özet:
Amaç: Hemofili A hastalarının replasman tedavisinde FVIII’i nötralize eden FVIII antikorların (inhibitör) oluşması ciddi
bir komplikasyondur. F8 mutasyonları ile birlikte başka genetik risk faktörleri de inhibitor gelişimini etkilemektedir. Bunlar
arasında B-lenfositlerinin regülasyonunda yer alan IL-4, IL-5, IL-10, TGF-β1 ve IFN-γ gibi interlökin ve sitokinler diğer genetik
risk faktörleri olabilecek hedeflerdir. Bu çalışmanın amacı inhibitor geliştiren ağır hemofili hastalarında çeşitli yöntemlerle F8
mutasyon profilini ortaya çıkarmak ve bunu takiben, FVIII yapılmaması ile sonuçlanan F8 mutasyonlu inhibitör geliştiren HA
hastalarında 9 seçilmiş interlökin ve sitokin gen polimorfizmleri ile inhibitor gelişimi arasındaki ilişkiyi irdelemektir.
Gereç ve Yöntemler: Toplam 173 hasta intron 22 inversiyon mutasyonu ve null mutasyonlar (nonsense ve delesyon
mutasyonları) için genetik anlamda taranmıstır. Daha sonra hasta (103) ve sağlıklı birey grupları (100) IL-4, IL-5, IL-10, TGFβ1
ve IFN-γ genlerinde bulunan 9 SNP bölgesi için araştırılmıştır.
Bulgular: İnhibitörlü hastalarda en sık rastlanan FVIII işlevini önemli ölçüde etkileyen mutasyonlar, sırasıyla, intron 22
inversiyonu, anlamsız mutasyon ve büyük delesyonlardır. Bu sebeple, bir hasta-kontrol ilişkisi çalışması şeklinde inhibitor (+)
ve inhibitor (-) hasta altgrupları oluşturmak için ağır HA hastalarında intron 22 inversiyonu taranmıştır. IL-5 geni promotör
bölgesinde yer alan rs2069812’nin T-aleli ile inhibitörlü hastalar arasında p-değeri 0,0251 olan önemli bir ilişki bulunmuştur.
TT genotipinin de 0,0082 p-değeri, OR=7 ve %90 ustu CI ile inhibitör (+) grubu ile ilişkili olması T-alelinin çekinik yatkınlık
aleli ve C-alelinin baskın koruyucu alel olduğunu düşündürmektedir.
Sonuç: Bu bulgular B lenfosit gelişiminde yer alan gen polimorfizmlerinin FVIII yapımı olmayan inhibitörlü ağır HA
hastalarında oynadığı rol hakkında önemli bilgi vermekte ve bu alanda ileri çalışmalara önderlik etmektedir.
Anahtar Sözcükler: Hemofili A, İnhibitör oluşumu, F8 Gen Mutasyonu, Tek Nükleotid Gen Polimorfizmleri,
İnterlökinler /Sitokinler, İlişkilendirme çalışması
Introduction
The major complication of replacement therapy is
the development of antibodies (inhibitors), which inhibit
factor VIII (FVIII) activity in hemophilia A (HA). Inhibitor
formation occurs in 20%-30% of patients with severe HA.
Both genetic and non-genetic factors play crucial roles in the
development of inhibitors against FVIII protein [1]. Genetic
factors including mutations or polymorphisms within the
factor 8 (F8) gene, some immune response genes like major
histocompatibility complex (MHC) class I/II, interleukins
(ILs), and cytokines were shown to be decisive risk factors
in inhibitor development [2]. However, the same type of F8
gene mutation can be seen in HA patients both with and
without inhibitors. Patients with large deletions affecting
more than one domain of the FVIII protein are at the highest
risk of inhibitor development (75%). Nonsense mutations
on the light chain increase the risk of inhibitor development
much more than those on the heavy chain. The third highest
risk mutation is the intron 22 inversion, with an inhibitor
risk about 30%-35% [3]. We have previously reported that
the most prevalent F8 gene mutation in severe HA patients
with inhibitors is intron 22 inversion, with a frequency of
50% [4]. Risk of inhibitor development increases at times
of severe bleeding, trauma, or surgery, especially when high
doses of FVIII are used for treatment. This occurs as a result
of complicated immune reactions leading to the up-regulation
of T- and B-cell responses [5]. In the presence of foreign
FVIII, CD4+ T-cells are induced to differentiate into T helper
(Th1 and Th2) cells by secreting IL-12 and IL-18. Cytokines
secreted by the Th1 [(IL-2 and interferon gamma (INF-γ)]
and Th2 (IL-4, IL-5, and IL-10) cells direct B-cell synthesis for
antibodies that function as inhibitors against FVIII. However,
Th2 cells can also down-regulate B-cell antibody synthesis
under certain circumstances [6]. A strong association with
increased risk of inhibitor development and the presence of
a 134-bp allele in one of the cytosine adenine (CA) repeat
microsatellites (IL-10G) located in the promoter region of the
IL-10 gene has been recently reported. IL-10 was the first gene
located outside the causative F8 gene mutations shown to be
linked to inhibitor development [7]. The single nucleotide
polymorphism (SNP) in the promoter region of tumor necrosis
factor alpha (TNF-α) was shown to be strongly associated with
inhibitor formation in HA siblings in the Malmö International
Brother Study [8]. A C/T SNP in the promoter region of the
cytotoxic T-lymphocyte antigen-4 (CTLA-4) gene was found
to be associated with inhibitor formation in 31.2% of T allele
carriers (p=0.012) [9]. The aim of this study was to search for
other genetic risk factors that may be associated with inhibitor
development. For this purpose, informative SNPs of cytokine
genes (IL-4, IL-5, IL-10, TGF-β1, and IFN-γ) involved in the
regulation of B-cell responses were studied in a group of HA
patients with null mutations (mutations with a major effect).
Materials and Methods
Patients
A total of 173 HA patients were screened for the presence
of intron 22 inversion and other null mutations. Three patients
18

Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene
Turk J Hematol 2014;31:17-24
had moderate phenotypes with FVIII activity of 2%-4%, while
the remaining 170 patients had severe phenotypes with FVIII
activity of 0%-3% [1]. One hundred and fourteen patients
(66%) had no inhibitor history. Forty-two (24%) and 17
patients (10%) of the remaining 59 patients had high and low
titer inhibitors, respectively. The median age was 22.6 years
(range: 4-50 years). Individual phenotypic characteristics of
the 173 unrelated HA patients are given as supplementary
information. Intron 22 inversions were detected in 95 patients
(54%), of whom 34 had inhibitors and 61 had no inhibitors.
Three nonsense mutations and 5 deletions were detected as
other types of null mutations, and all of these patients had
developed inhibitors. Forty-two and 61 patients, therefore,
constituted the 2 groups with and without inhibitors,
respectively, for the association analysis (Table 1).
The peripheral blood samples from 173 unrelated severe
HA patients with and without inhibitors were collected from
various hematology clinics within Turkey. The diagnosis of
HA was based on clinical and hematological data. One-stage
clotting assay was used for measurement of FVIII activity
(Sigma Diagnostic, St. Louis, MO, USA). All measurements
were performed in duplicate. The mean±standard deviation
value for FVIII was 113.98±33.86 U/dL in control subjects.
Values over 150 U/dL were accepted as high. The clinical
criteria of Eyster et al. were used to determine disease
severity [10]. The level of inhibitors was measured as
Bethesda units (BU/mL). Patients with 5
BU/mL were defined as having “low titer” and “high titer”
inhibitors, respectively [6]. The study was approved by
the Ethics Committee of Ege University Medical School.
All included patients and healthy volunteers gave written
consent before entering the study.
DNA Extraction
DNA was extracted from 10 mL of peripheral blood
of patients by the NaCl method with 2 mL of peripheral
blood using a MagNA Pure Compact instrument (Roche
Diagnostics, Mannheim, Germany) and from saliva samples
of some of the control individuals with the ORAGENE saliva
kit (DNA Genotek, Kanata, ON, Canada).
Detection of Intron 22 Inversion
Intron 22 inversion was detected by inverse polymerase
chain reaction (PCR) [11] and long PCR techniques [12].
Detection of F8 Nonsense and Deletion Mutations
Intron 22 (-) patients were also screened for missense
mutations with exon-specific PCR amplifications. All 26
exons of those patients were amplified and sequenced by
automated Sanger sequencing.
Selection of the SNPs in Immune Response Genes for
Association Study
Nine SNPs in genes IL-2, IFN-γ, IL-4, IL-5, IL-10, and
TGF-β1 were selected with average heterozygote frequency
close to 0.5 in different populations from HapMap and NCBI
data.
Genotyping for the Case-Control Association Study
Genotyping of a total of 9 SNPs in 173 patients and 100
healthy individuals was carried out using hybridization
probes designed by TIB MOLBIOL (Berlin, Germany) on
an LC480 platform (Roche Diagnostics) based on melting
curve analysis.
DNA Sequence Analysis
The IL-5 gene was divided into 7 regions for highresolution
melting analysis (HRM) and DNA sequencing.
Five regions consisting of promoter and coding regions of
the IL-5 gene were amplified in PCR reactions that contained
50 ng of genomic DNA, 0.2 pmol of each primer, 0.2 mM of
each dNTP, 1X reaction buffer with 2 mM Mg2+, and 1.25 U
Taq polymerase in 25 µL. The PCR products of these regions
were directly sequenced (Macrogen, Seoul, Korea), whereas
the remaining 2 regions were analyzed by HRM on an
LC480 platform. The HRM mixture was prepared in a 20 µL
volume containing 1X master mix with FastStart Taq DNA
polymerase, reaction buffer, dNTP mix, and high-resolution
melting dye; 0.2-0.5 mM Mg 2+ ; 0.2-0.5 pmol of each primer
pair; and 20-40 ng of genomic DNA.
Copy Number Variation Analysis by qPCR
A quantitative PCR (qPCR) assay was used to detect
copy number variations (CNVs) of the IL-5 gene rs2069812
region in patients. Absolute quantification using the “Fit
Points Method” is an analysis used to quantify the target
sequence and reference sequence and gives a concentration
value. Real-time qPCRs were performed with a LightCycler
480 instrument and a LightCycler 480 SYBR Green I Master
Kit and target and reference sequence-specific primers. The
target sequence was the IL-5 rs2069812 region and the
reference sequence was exon 6 of the sodium channel 1
alpha (SCN1A) gene (Ex6F-5’ CACACGTGTTAAGT, Ex6R-
5’ AGCCCTCAAGTAT).
Statistical Analysis
Case-control association analysis was carried out with
Haploview 4.1, which calculated the chi-square statistics of
SNP alleles between 2 groups at a 0.05 significance level.
Genotype frequencies were calculated in patients for 9 SNPs
by using the chi-square test on a webpage of the University of
Kansas (http://people.ku.edu/~preacher/chisq/chisq.htm).
Multiple test correction was done by 100.000 permutations
(p=0.0294). Other association tests were performed by using
crude, recessive, or dominant models [13]. Power analysis
was carried out by assuming an inhibitor development rate
of 0.00018 in the general population and a type I error rate
of 0.05. The power was over 90% for a recessive genotype
effect with a relative risk (RR) of 6.86 for rs2069812. All
power calculations were carried out by QUANTO [14,15].
Results
SNP Genotyping in Immune Response Genes
Genotyping of 1 SNP failed for healthy controls, but 8
SNPs were genotyped in 100 healthy Turkish individuals
19

Turk J Hematol 2014;31:17-24
Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene
by HybProbe probes. All SNPs were in Hardy-Weinberg
equilibrium and each had a minor allele frequency of >0.120.
Genotyping of 9 SNPs in 42 inhibitor (+) and 61 inhibitor (-)
severe HA patients revealed that they were in Hardy-Weinberg
equilibrium in both patient groups. They had a minor allele
frequency of higher than 0.19 and 0.13 for the inhibitor (-) and
inhibitor (+) patient groups, respectively. These 2 subgroups,
both with known F8 null mutations, comprised the cases and
controls, and the association analysis was carried out using
Haploview 4.1. The associated alleles and p-values are given
in Table 2. The T allele of rs2069812, which resides in the
IL-5 gene promoter region, was found to be associated with
inhibitor (+) patients with a p-value of 0.0251. Multiple test
correction was done with 100.000 permutations (p=0.0294).
The test for association was repeated using all patients [i.e.
inhibitor (+) and inhibitor (-) groups] against healthy
individuals and no significant associations were detected,
supporting the association of rs2069812 with inhibitor
formation. Genotype frequencies were calculated in 2 patient
groups for 9 SNPs by using the chi-square test a webpage of the
University of Kansas (http://people.ku.edu/~preacher/chisq/
chisq.htm). The TT genotype of rs2069812 was found to be
associated with inhibitor (+) patients with a p-value of 0.0082
(Table 3). These results were compatible with the results of
the Haploview 4.1 case-control association analysis. A similar
association test run between inhibitor (+) patients and healthy
individuals did not reveal any significant associations. The
pattern of inheritance of rs2069812 indicated a similar and
reduced risk for CT and CC genotypes in inhibitor (+) patients
in the crude genetic model (Table 4) [13]. In the model where
the T allele was recessive, the TT genotype carried a risk of
6.86-fold compared to CT or CC genotypes, indicating that
the T allele was the susceptibility allele. On the other hand,
considering that the C allele has a dominant inheritance, CT
or CC genotypes reduced the disease risk by 0.02% (odds
ratio=0.14). Therefore, the C allele could be considered to
have a dominant protective effect.
HRM and DNA Sequence Analysis of the IL-5 Gene
The IL-5 gene is composed of 4 exons spanning a
2078-bp coding region. In order to detect any pathological
changes segregating with the associated rs2069812, the IL-5
gene was divided into 7 regions for HRM and direct DNA
sequencing. The promoter region containing rs2069812 was
divided into 3 regions. Two of the promoter regions and
exons 1, 2, and 4 were amplified by PCR and sequenced in
103 patients. The promoter 1 region and exon 3 of the IL-5
gene were analyzed by HRM in real time in the same patients.
Sequence analysis revealed the genotypes of 14 other known
SNPs located in the IL-5 gene, but no other rare variants.
There were no haplotype associations between these SNPs
when tested by the Haploview program.
CNV Analysis of rs2069812 Region
In order to investigate the presence of CNVs, realtime
qPCR analysis was applied to patients who had
homozygote and heterozygote genotypes for associated
SNP region rs2069812. Absolute quantification analysis
was used to quantify the target sequence and reference
sequences. Relative quantification was used to compare
these targets and reference sequence concentrations. The
target sequence was the IL-5 promoter, including the
rs2069812 region, and the reference sequence was exon
6 of the SCN1A gene. qPCR assay was performed for 28
homozygous (for rs2069812) inhibitor (+) patients and 30
homozygous inhibitor (-) patients in 2 groups. The ratio of
the normalized target sequence to the reference sequence
was near 1, which meant that there were no copy number
changes in this region. qPCR assay was also performed for
14 heterozygous (for rs2069812) inhibitor (+) patients and
31 heterozygous inhibitor (-) patients in 2 groups. The ratio
of the normalized target sequence to the reference sequence
was also near 1 (data not shown).
Discussion
Genetic variants including SNPs, CNVs, or mutations
in immune response genes other than F8 gene mutations
may affect inhibitor development in patients with severe
HA and cause major complications. It has been proposed
that immune response can be up-regulated in most patients
with null mutations like intron 22 inversion [3]. In studies
of patients with autoimmune disease, polymorphisms in the
immune response genes have been found to be associated
with antibody formation [21]. In HA patients certain
alleles in the promoter regions of the IL-10, TNF-α, and
CTLA-4 genes were found to be associated with inhibitor
development [7,8,9].
In this study, in order to further understand the role of
immune response genes on inhibitor development, patients
with a null F8 gene mutation with high prevalence, like
intron 22 inversion, were grouped as patients with and
without inhibitors and an association analysis was carried
out between them using 9 SNPs located in the IL-2,
IFN-γ, IL-4, IL-5, IL-10, and TGF-β1 genes. A significant
association was seen with the T allele of rs2069812 in the
IL-5 promoter and inhibitor positivity in patients with HA.
The analysis for the inheritance pattern revealed that carrying
the TT genotype for rs2069812 meant a 6.86 times greater
probability of developing inhibitors. On the other hand,
patients carrying CT or CC had that risk at a rate of 0.02%
(OR=0.14) as compared to the TT genotype. Therefore, the
T allele was considered as a recessive susceptibility allele and
the C allele as a dominant protective allele. The resulting
association of the T allele of rs72069812 with over 90%
power for a recessive genotype effect indicated a possible
role in inhibitor development in inhibitor (+) patients. DNA
sequencing analysis of the IL-5 gene promoter and coding
sequences and qPCR analysis of the region involving the
associated SNP in 103 patients did not reveal any common/
rare variants segregating with the associated SNP.
20

Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene
Turk J Hematol 2014;31:17-24
IL-5 is an immune response gene whose product plays
a role in B-cell antibody synthesis. The IL-5 gene expresses
the IL-5 glycoprotein, which plays a pleiotropic role in
the immune system and inflammation. It supports growth
and differentiation of B cells and has a key mediator role
in eosinophil activation. It is produced by Th2 cells and
masT-cells. IL-5 cytokines are the key molecules in allergy
and eosinophilic inflammation [16]. In previous studies,
rs2069812 was found to be associated with diseases like
atopic bronchial asthma [17], gastric cancer risk [18],
and atopic dermatitis [19]. The IL-5 gene is expressed in
CD4+ T-cells, masT-cells, and eosinophils, and in allergic
reactions the expression level of the IL-5 gene can be varied
[16]. It may be suggested that rs2069812 localized in the
gene promoter could be a regulatory SNP and play a role
in the up-regulation or down-regulation of the IL-5 gene
and influence the level of IL-5 protein. It could further be
suggested that the T variant in inhibitor (+) patients causes
increased or decreased production of IL-5 protein, leading
to inhibitor formation. In order to see the specific IL-5
gene expression against exogenous FVIII protein, CD4+
T-cells with the T and C alleles of rs72069812 responding
to FVIII antigens need to be isolated from peripheral blood
and treated with FVIII protein in cell culture studies. In
Table 1. Clinical information of patient groups used in the association analysis.
Patient
groups
Inhibitor (+)
patients
Inhibitor (-)
patients
HR: high responder
LR: low responder
No. FVIII:C (%)
average
HR no.
(%)
LR no.
(%)
Age
average
Intron 22
inversion
(%)
42 0.85 36 (86) 6 (14) 20.8 34 (80) 8 (20)
61 0.76 - - 24.9 61 (100) -
Other
mutations
Table 2. Test of association between inhibitor (+) and inhibitor (–) patient subgroups.
SNP name Gene Position Associated allele χ 2 p-value
rs2069812 IL-5 Promoter T
rs2069705 IFNγ Promoter C
rs2241715 TGF-β1 IVS1 T
rs3024496 IL-10 E5 C
rs1800871 IL-10 Promoter T
rs1554286 IL-10 IVS3 T
rs1861494 IFN-γ IVS3 T
rs2243267 IL-4 IVS2 C
rs2243282 IL-4 IVS3 A
5.019 0.0251
0.022 0.8828
0.875 0.3496
0.288 0.5915
1.221 0.2692
4.016 0.1342
0.037 0.8484
1.254 0.2628
1.654 0.1984
IVS: intervening sequence variation
χ 2 : chi-square
21

Turk J Hematol 2014;31:17-24
Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene
Table 3. Test of association of genotypes of 9 SNPs.
Allele Genotype frequency (%)
frequency (%)
rs2069812
Missing
C T CC CT TT
Total χ
data
p-value
Inhibitor (+) patients 30 (53) 26 (46) 16 (38) 15 (35) 11 (27) - 42
Inhibitor (-) patients 87 (71) 35 (29) 29 (47) 29 (47) 3 (5) - 61
9.603 0.0082
rs1554286
Allele
Genotype frequency (%)
frequency (%)
Missing
C T CC CT TT
Total χ
data
p-value
Inhibitor (+) patients 42 (75) 24 (32) 16 (56) 10 (35) 2 (7) 14 42
Inhibitor (-) patients 93 (84) 17 (15) 42 (70) 9 (16) 4 (7) 6 61
4.016 0.1342
rs2241715
Allele
Genotype frequency (%)
frequency (%)
Missing
T G GG TG TT
Total χ
data
p-value
Inhibitor (+) patients 20 (40) 30 (60) 9 (36) 12 (48) 4 (16) 17 42
Inhibitor (-) patients 49 (48) 53 (52) 18 (35) 17 (33) 16 (31) 10 61
2.455 0.2930
rs3024496
Allele
Genotype frequency (%)
frequency (%)
Missing
T C TT TC CC
Total χ
data
p-value
Inhibitor (+) patients 34 (60) 22(40) 10 (36) 14 (50) 4 (14) 14 42
Inhibitor (-) patients 63 (57) 47 (43) 18 (33) 27 (49) 10 (18) 6 61
0.219 0.8962
rs1800871
Allele
Genotype frequency (%)
frequency (%)
Missing
C T CC CT TT
Total χ
data
p-value
Inhibitor (+) patients 38 (70) 16 (30) 13 (48) 12 (44) 2 (8) 15 42
Inhibitor (-) patients 82 (77) 24 (23) 33 (62) 16 (30) 4 (8) 8 61
1.659 0.4362
rs2069705
Allele
frequency (%)
Genotype fr equency (%)
T C TT CT CC
Missing
data
Total χ 2 p-value
Inhibitor (+) patients 39 (70) 17 (30) 14 (50) 11 (39) 3 (11) 14 42
Inhibitor (-) patients 76 (72) 30 (28) 27 (51) 22 (42) 4 (8) 9 61
0.238 0.8878
22

Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene
Turk J Hematol 2014;31:17-24
Table 3. Test of association of genotypes of 9 SNPs (continued).
rs1861494
Allele
Genotype frequency (%)
frequency (%)
Missing
C T TT CT CC
Total χ
data
p-value
Inhibitor (+) patients 11 (20) 45 (80) 17 (61) 11 (39) 0 (0) 14 42
Inhibitor (-) patients 24 (22) 86 (78) 35 (64) 16 (29) 4 (7) 6 61 1.659 0.4362
rs2243267
Allele
frequency (%)
Genotype frequency (%)
C A CC CA CC
Missing
data
Total χ 2 p-value
Inhibitor (+) patients 35 (62) 21 (38) 17 (61) 1 (4) 10 (36) 14 42
Inhibitor (-) patients 86 (78) 24 (22) 42 (76) 2 (4) 11 (20) 6 61 2.45 0.2937
rs2243267
Allele
frequency (%)
Genotype frequency (%)
G C GG GC CC
Missing
data
Total χ 2 p-value
Inhibitor (+) patients 44 (79) 12 (21) 17 (61) 10 (36) 1 (4) 14 42
Inhibitor (-) patients 95 (86) 15 (14) 42 (76) 11 (20) 2 (4) 6 61
2.45 0.2937
Table 4. Test of association between rs2069812 genotypes and inhibitor development.
Genotypes df χ 2 p-value
Genetic model
CC CT TT
Crude OR (vs. TT) 0.15 0.14 1 2 9.603 0.0082
Dominant T allele OR (vs. CT+CC) 0.68 1 1 1 0.902 0.3422
Recessive T allele OR (vs. CT+CC) 1 1 6.86 1 9.584 0.0019
Dominant C allele OR (vs. TT) 0.14 0.14 1 1 9.584 0.0019
χ 2 : chi-square
OR: odds ratio
df: degrees of freedom
silico analysis, however, does not reveal any alteration in
the transcription factor binding scores of either the T or
the C allele of rs2069812 (http://alggen.lsi.upc.es/cgi-bin/
promo_v3/).
In addition, SNPs may be involved in epigenetic
regulation since some SNPs and CpG sites show significant
cis- or trans-associations. It was hypothesized that a
considerable proportion of CpG sites may be quantitative
traits with regard to regulation by specific genetic variants
[20]. rs2069812 is not located at a CpG site and a CpG island
was not detected within approximately 5000 bases of the 5’
region of the IL-5 gene (http://www.ualberta.ca/~stothard/
javascript/cpg_islands.html), suggesting that it is not a cisregulatory
SNP. However, the IL-5 gene, together with genes
IL-4, IL-13, and colony stimulating factor 2 (CSF-2), form a
cytokine gene cluster on chromosome 5q31. CSF-2, IL-4, and
IL-13 are regulated coordinately by long-range regulatory
elements of 120 kb in length on chromosome 5q31. When
this region was scanned for CpG islands, approximately 70
CpG islands were found. Whether rs2069812 is in cis- or
trans-association with a distant CpG island remains to be
studied further.
In conclusion, the associated T allele of the promoter
SNP in the IL-5 gene may be part of the complex genetic
background involved in the development of inhibitors in
severe HA patients.
Acknowledgments
We thank Dr. Tiraje Celkan, Department of Pediatrics,
Cerrahpaşa Medical School, İstanbul University, İstanbul,
Turkey; Dr. Çetin Timur, Department of Pediatrics and
23

Turk J Hematol 2014;31:17-24
Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene
Hematology, Göztepe State Hospital, İstanbul, Turkey; Dr.
Canan Vergin, Dr. Behçet Uz Pediatric Hospital, İzmir, Turkey;
and Dr. Canan Uçar, Department of Pediatric Hematology,
19 Mayıs University Medical School, Samsun, Turkey, for
providing patient samples. We greatly appreciate the help of
Dr. Fikret Bezgal from the Turkish Hemophilia Society and
the technical help of Aslı Gündoğdu, and we are grateful to
all patients for their participation in this study. This study
was financially supported by TÜBİTAK (the Scientific and
Technological Research Council of Turkey) project number
108S095; Boğaziçi University Research Foundation projects
09HB101D, 08HB104D, and 07HB103D; and Eczacıbaşı-
Baxter, İstanbul, Turkey.
İnanç D. Fidancı designed the study, performed the
experiments, performed the analysis, and wrote the
manuscript. Bülent Zülfikar, Kaan Kavaklı, Yurdanur Kılınç,
and Cem Ar provided the patient samples and clinical
information. Zafer Başlar followed up on the inhibitor
development in most of the patients. S. Hande Çağlayan
designed the study, performed the analysis, and wrote the
manuscript.
None of the authors have any conflict of interest to
disclose
We confirm that we have read the journal’s position on
issues involved in ethical publication and affirm that this
report is consistent with those guidelines.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
1. Kavaklı K, Aktuğlu G, Kemahlı S, Başlar Z, Ertem M, Balkan
C, Ar C, Karapınar DY, Bilenoğlu B, Gülseven M, Gürman C.
Inhibitor screening for patients with hemophilia in Turkey.
Turk J Hematol 2006;23:25-32.
2. Oldenburg J. Mutation profiling in haemophilia A. Throm
Haemost 2001;85:577–579.
3. Oldenburg J, El-Maarri O, Schwaab R. Inhibitor development
in correlation to factor VIII genotypes. Hemophilia
2002;2:23-29.
4. Fidanci ID, Kavakli K, Ucar C, Timur C, Meral A, Kilinc
Y, Sayilan H, Kazanci E, Caglayan SH. Factor 8 (F8) gene
mutation profile of Turkish hemophilia A patients with
inhibitors. Blood Coagul Fibrinolysis 2008;19:383-388.
5. Coppola A, Santoro C, Tagliaferri A, Franchini M, Di Minno
G. Understanding inhibitor development in haemophilia
A: towards clinical prediction and prevention strategies.
Haemophilia 2010;16:13-19.
6. Key N. Inhibitors in congenital disorders. Br J Haematol
2004;127:379-391.
7. Astermark J, Oldenburg J, Pavlova A, Berntorp E, Lefvert
AK. Polymorphisms in the IL10 but not IL1beta and IL4
genes are associated with inhibitor development in patients
with hemophilia A. Blood 2006;107:3167-3172.
8. Astermark J, Oldenburg J, Carlson J, Pavlova A, Kavakli K,
Berntop E, Lefvert AK. Polymorphisms in the TNFA gene
and the risk of inhibitor development in patients with
hemophilia A. Blood 2006;108:3739-3745.
9. Astermark J, Wang X, Oldenburg J, Berntorp E, Lefvert
AK. Polymorphisms in the CTLA-4 gene and inhibitor
development in patients with severe hemophilia A. J
Thromb Haemost 2007:5:263-265.
10. Eyster ME, Lewis JH, Shapiro SS. The Pennsylvania
hemophilia program 1973-78. Am J Hematol 1980;9:77-86.
11. Rosetti LC, Radic CP, Larripa IP, De Brasi CD. Genotyping
the hemophilia inversion hotspot by use of inverse PCR.
Clin Chem 2005;7:1154-1158.
12. Liu Q, Sommer SS. Subcycling-PCR for multiplex long
distance amplification of regions with high and low GC
content: application to the inversion hotspot in the factor
VIII gene. Biotechniques 1998;25:1022-1028.
13. Lunetta KL. Genetic association studies. J Am Heart Assoc
2009;118:96-101.
14. Gauderman WJ. Sample size requirements for matched
case-control studies of gene-environment interaction. Stat
Med 2002;21:35-50.
15. Gauderman WJ, Morrison JM. QUANTO 1.1: A Computer
Program for Power and Sample Size Calculations for
Genetic-Epidemiology Studies. 2006. Available at http://
hydra.usc.edu/gxe.
16. Takatsu K. Interleukin 5 and B-cell differentiation. Cytokine
Growth Factor Rev 1998;9:25-35.
17. Freidin MB, Kobyakova OS, Ogorodova LM, Puzyrev VP.
Association of polymorphisms in the human IL4 and IL5
genes with atopic bronchial asthma and severity of the
disease. Comp Funct Genomics 2003;4:346-350.
18. Mahajan R, El-Omar EM, Lissowka J, Grillo PG, Rabkin CS.
Genetic variants in T helper cell type 1, 2 and 3 pathways
and gastric cancer risk in a Polish population. Jpn J Clin
Oncology 2008;9:626-633.
19. Yamamoto N, Suguira H, Tanaka K, Uehara M. Heterogeneity
of interleukin 5 genetic background in atopic dermatitis
patients: significant difference between those with blood
eosinophilia and normal eosinophil levels. J Dermatol Sci
2003;33:121-126.
20. Zhang D, Cheng L, Badner JA, Chen C, Chen Q, Wei L, Craig
DW, Redman M, Gershon EM, Chunyu L. Genetic control
of individual differences in gene-specific methylation in
human brain. Am J Hum Genet 2010;86:411-419.
21. Bioque G, Crusius JB, Koutroubakis I. Allelic polymorphism
in IL-1 beta and IL-1 receptor antagonist (IL-1Ra) genes
in inflammatory bowel disease. Clin Exp Immunology
1995;102:379-383.
24

Research Article
DOI: 10.4274/Tjh.2012.0146
Evaluation of Red Cell Membrane Cytoskeletal Disorders
Using a Flow Cytometric Method in South Iran
Güney İran’da Eritrosit Zarı Hücre İskelet Bozukluklarının
Akım Sitometri ile Değerlendirilmesi
Habib Alah Golafshan1,2, Reza Ranjbaran1,2, Tahereh Kalantari1,2, Leili Moezzi1,2, Mehran Karimi3,
Abbas Behzad- Behbahani1,2, Farzaneh Aboualizadeh1,2, Sedigheh Sharifzadeh1,2
1Diagnostic Laboratory, Sciences and Research Technology Center, Shiraz University of Medical Sciences, Shiraz, Iran
2School of Para Medical Sciences, Shiraz University of Medical Sciences, Shiraz, Iran
3Hematology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran
Abstract:
Objective: The diagnosis of hereditary red blood cell (RBC) membrane disorders, and in particular hereditary spherocytosis
(HS) and Southeast Asian ovalocytosis (SAO), is based on clinical history, RBC morphology, and other conventional tests such
as osmotic fragility. However, there are some milder cases of these disorders that are difficult to diagnose. The application of
eosin-5’-maleimide (EMA) was evaluated for screening of RBC membrane defects along with some other anemias. We used EMA
dye, which binds mostly to band 3 protein and to a lesser extent some other membrane proteins, for screening of some membrane
defects such as HS.
Materials and Methods: Fresh RBCs from hematologically normal controls and patients with HS, SAO, hereditary
elliptocytosis, hereditary spherocytosis with pincered cells, severe iron deficiency, thalassemia minor, and autoimmune
hemolytic anemia were stained with EMA dye and analyzed for mean fluorescent intensity (MFI) using a flow cytometer.
Results: RBCs from patients with HS and iron deficiency showed a significant reduction in MFI compared to those from
normal controls (p

Turk J Hematol 2014;31:25-31
Golafshan AH, et al: Diagnosis of RBC Membrane Defects
Özet:
Amaç: Kalıtsal eritrosit zarı bozukluklarının ve özellikle kalıtsal sferositoz ve Güneydoğu Asya ovalositozunun tanısı klinik
öykü, eritrosit morfolojisi ve ozmotik frajilite gibi konvansiyonel testlere dayanmaktadır. Ancak bu hastalıkların tanı koymada
zorlanılan daha hafif formları bulunmaktadır. Eozin-5-malemid’in (EMA) kullanımı diğer anemiler yanında eritrosit zarı
bozukluklarının taramasında değerlendirilmiştir. Biz HS gibi bazı zar bozukluklarının değerlendirilmesinde, öncelikle band 3
proteinini ve daha az oranda diğer zar proteinlerini bağlayan, EMA boyasını kullandık.
Gereç ve Yöntemler: Hematolojik açıdan normal kontrollerin ve HS, SAO, kalıtsal eliptositoz, kıskaç hücreli kalıtsal
sferositoz, ağır demir eksikliği anemisi, talasemi minor ve otoimmun hemolitik anemi hastalarının taze eritrositleri EMA ile
boyandı ve akım sitometri kullanılarak ortalama floresan yoğunluğu (MFI) değerlendirildi.
Bulgular: HS ve demir eksikliği olan hastaların eritrositleri normal kontrollere kıyasla MFI açısından anlamlı düşüklük
gösterirken (sırasıyla p

Golafshan AH, et al: Diagnosis of RBC Membrane Defects
Turk J Hematol 2014;31:25-31
the acidified glycerol lysis test. Nevertheless, these tests
have been shown to have lower sensitivity and specificity.
Diagnosis of these cell membrane disorders has been shown
to be confirmed by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE) [12].
Recently, the fluorescence intensity of intact red cells
has been measured by a flow cytometric approach using the
dye eosin-5’-maleimide (EMA), which binds specifically in
higher amounts to lysine-430 on the first extracellular loop
of the band 3 protein and in lower amounts to Rh blood
group proteins and CD47 of the RBC membrane [13,14].
The aim of this study was evaluation of this flow
cytometric method for screening of membrane protein
disorders such as HS and SAO from other hematological red
cell disorders. An ethics committee approved this study.
Material and Methods
Patient and Control Groups
The patient group included 20 cases of HS, 2 cases of
HSPR, 22 cases of HE, 2 cases of HPP, and 2 cases of SAO,
along with 36 cases of other RBC disorders including
macrocytosis with megaloblastic anemia (14 cases),
thalassemia minor (7 cases), severe iron deficiency with
mean corpuscular volume (MCV) of lower than 70 fL (13
cases), and autoimmune hemolytic anemia (AIHA) (2
cases). Fifteen healthy subjects with normal hematological
parameters and red cell morphology were investigated as a
normal control group.
Laboratory Investigations
Hematological indices were measured on a Sysmex
automated cell counter (Sysmex KX-21, Japan). Red cell
morphology was studied on Wright-stained peripheral
smears. Diagnostic criteria for HS patients were increased
red-cell turnover (reticulocytosis/polychromasia), typical
spherocytes, and associated absence of an immune cause
(negative direct antiglobulin test or Coombs test). The
results of peripheral smears and hematological indices were
evaluated by 2 expert scientists. SDS-PAGE analysis of RBC
membrane proteins was carried out using a modification of
Laemmli’s method [15].
Flow Cytometric Analysis of Red Cells
The method described by King et al. [13] was used.
Briefly, RBCs were washed twice with phosphate buffered
saline (PBS) of pH 7.4. Five microliters of packed RBCs
was incubated with 25 µL of EMA (0.5 mg/mL PBS; Fluka,
USA) for 1 h at room temperature in the dark. The cell
suspension was centrifuged for 1 min in a microcentrifuge
and the supernatant containing unbound dye was
removed. The labeled RBCs were washed 3 times with 500
µL of PBS-bovine serum albumin (BSA) solution (0.5%
BSA in PBS). The RBC pellet was suspended again in 0.5
mL of PBS-BSA solution and a 100-µL aliquot of the cell
suspension was added to 1.4 mL of PBS-BSA solution for
analysis. Fluorescence intensity, as mean fluorescence
intensity (MFI), was determined for 10,000 events in the
FL1 channel of a BD FACS caliber flow cytometer (BD
FACSCalibur, USA).
Statistical Analysis
The means and standard deviations (SDs) were
calculated using SPSS 17.0 for Windows and mean±SD
values were compared using a 2-tailed Student t-test. The
correlation between MFI and MCV was compared with the
Pearson correlation test. A p-value of

Turk J Hematol 2014;31:25-31
Golafshan AH, et al: Diagnosis of RBC Membrane Defects
and negative likelihood ratios of the test were 14 and 0.05,
respectively.
Assessment of MFI/MCV Correlation
Correlations between MCV and MFI in each group were
studied (Table 1). There was a significant correlation between
MCV and MFI within each group among the normal control
(MCV: 92±4.4, MFI: 337±44, p=0.045), HE (MCV: 84±7.5,
MFI: 335±35, p=0.039), macrocytosis (MCV: 113±10.2,
MFI: 416±82, p=0.033), and iron deficiency (MCV: 66±5.8,
MFI: 280±19, p=0.028) groups. No significant correlation
was seen between MCV and MFI in HS (MCV: 88±9.5, MFI:
252±57, p>0.5) or thalassemia minor (MCV: 67±6.6, MFI:
344±35, p>0.5) patients.
Discussion
Red cell membrane disorders are generally diagnosed
based on clinical history of the disease and peripheral
smear examination, along with some routine hematologic
tests such as the osmotic fragility test [16]. However, these
methods have not shown precise specificity and sensitivity
for detection of milder or atypical cases of cytoskeletal
disorders. On the other hand, measuring the amount of
cytoskeletal proteins in the red cell membrane is difficult,
because small variations from normal must be accurately
measured. In line with this, some patients with HS have only
a 10% to 15% decrease in the affected membrane protein.
Therefore, for this purpose, SDS-PAGE of red cell membranes
is done in a few specialized laboratories. However, it does not
have the required precision and accuracy to measure small
reductions in the membrane proteins of mild cases [17].
Our results from SDS-PAGE did not show significant
differences between HS patients and the control group.
Most of the HS patients had only 10% to 15% or even
lower percentages of spherocytes, which may lead to poor
diagnosis with SDS-PAGE as the result of small reductions
in their affected membrane proteins. This was a motivation
to find an easy approach, such as flow cytometry using EMA
dye, for diagnosis of cytoskeletal disorders. This method
only takes 2 h and has higher sensitivity and specificity than
general methods such as osmotic fragility, which is used for
screening of HS patients.
Our flow cytometric results from labeled RBCs of HS,
HSPR, SAO, HPP, and iron deficiency patients showed lower
MFIs as compared to the control group, which was significant
only for HS and iron deficiency patients (p

Golafshan AH, et al: Diagnosis of RBC Membrane Defects
Turk J Hematol 2014;31:25-31
Figure 1. Blood morphology of red cell membrane defects
of patients with HS (A), HSPR (B), HPP (C), SAO (D), and
HE (E). HS (A) and HSPR (B): The peripheral blood smear
of a patient with HS shows spherocytosis, anisocytosis,
and polychromasia (increased reticulocytes). Spherocytes
are developed due to a loss of RBC membrane, resulting in
small, round, dense red cells without central pallor. HPP (C):
The red cells of hereditary pyropoikilocytosis demonstrate
bizarre forms, anisocytosis, fragments, micropoikilocytosis,
microspherocytosis, and budding red blood cells. SAO
(D): The red cells of Southeast Asian ovalocytosis are
often described as being stomatocytic elliptocytes. The
red cells have a slit-like area of central pallor instead of
being discocytes. A small proportion of these stomatocytes
have 2 transverse slits, giving the appearance of double
stomatocytes. HE (E): The peripheral smear of a patient
with hereditary elliptocytosis shows elliptical rather than
typically biconcave disc-shaped RBCs. Abbreviations: HS:
hereditary spherocytosis, HSPR: hereditary spherocytosis
with pincered RBC, HPP: hereditary pyropoikilocytosis,
SAO: Southeast Asian ovalocytosis, and HE: hereditary
elliptocytosis.
RBCs of patients with HE, thalassemia minor, and AIHA
showed no significant differences from the control group.
On the other hand, patients with macrocytic RBCs showed
higher and significantly different MFIs compared to the
normal control group (p0.5) or thalassemia minor
patients (MCV: 67±6.6, MFI: 344±35, p>0.5). It seems that
there is a direct correlation between MCV and MFI (increased
MCV may lead to increased MFI and vice versa), which also
results in a direct correlation between MCV and the surface
29

Turk J Hematol 2014;31:25-31
Golafshan AH, et al: Diagnosis of RBC Membrane Defects
area of RBCs and expression of band 3. Therefore, there is
no direct relationship between MCV and MFI in HS and
thalassemia minor patients and exceptions to this finding
occurred in the HS and thalassemia minor anemia patients.
Although spherocytes appear as red blood cells that are
smaller than normal on a blood smear (because the diameter
of the cells can be assessed on a smear, but noT-cell volume),
they have normal volumes and do not have a change in MCV
due to cell membrane rigidity. Moreover, in most cases,
spherocytes have normal volumes and no change in MCV,
while only rare cases show low MCV due to the production
of microspherocytes with lower cell volumes. Therefore, in
spherocytosis, the defect in RBC membranes and therefore
the lowered MFI cannot be affected by the MCV. On the other
hand, in spite of the lower MCV in thalassemia minor, which
is because of low hemoglobin levels, there is no variation
in MFI. Therefore, the normal level of MFI in thalassemia
minor patients could be due to absence of a defect in the
expression of band 3.
Some studies have reported variable sensitivity of the
osmotic fragility test from 48% to 95%, independent of the
cytoskeletal abnormality and of the amount of protein deficiency
for diagnosis of HS [21]. However, a sensitivity of 99% was
obtained when the osmotic fragility test was done along with
the acidified glycerol lysis test on incubated blood [21].
In this study, our emphasis was on patients’ history, and
morphological changes in RBCs reported by experts from
blood smear examinations can give useful information about
RBC membrane defects (Figure 1). All patients suspected of
HS with reported spherocytes in their blood smears showed
significant decreases in MFI.
Taken together, it seems that the fluorescence dyebased
method is a reliable diagnostic assay with higher
sensitivity and specificity (95% and 93%, respectively) than
conventional routine tests for HS patients.
We propose that this approach will contribute a rapid
screening and confirmation test for diagnosis of HS, HSPR,
SAO, and HPP patients before performing further specific
membrane protein molecular tests.
Acknowledgment
This study was done at and supported by Shiraz
University of Medical Sciences (grant no. 90-5697).
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
1. Zeman K, Engelhard H, Sackmann E. Bending undulations
and elasticity of the erythrocyte membrane: effects of
cell shape and membrane organization. Eur Biophys J
1990;18:203-219.
2. Palek J. Hereditary elliptocytosis, spherocytosis and related
disorders: consequences of a deficiency or a mutation of
membrane skeletal proteins. Blood Rev 1987;1:147-168.
3. Cynober T, Mohandas N, Tchernia G. Red cell abnormalities
in hereditary spherocytosis: relevance to diagnosis and
understanding of the variable expression of clinical severity.
J Lab Clin Med 1996;128:259-269.
4. Gallagher PG. Update on the clinical spectrum and genetics
of red blood cell membrane disorders. Curr Hematol Rep
2004;3:85-91.
5. Gallagher PG. Red cell membrane disorders. Hematology
Am Soc Hematol Educ Program 2005:13-18.
6. Gallagher PG. Hereditary elliptocytosis: spectrin and protein
4.1R. Semin Hematol 2004;41:142-164.
7. Bain BJ. Blood Cells: A Practical Guide, 4th ed. Oxford,
Blackwell, 2006.
8. Zhang Z, Weed SA, Gallagher PG, Morrow JS. Dynamic
molecular modeling of pathogenic mutations in the spectrin
self-association domain. Blood 2001;98:1645-1653.
9. Mohandas N, Lie-Injo LE, Friedman M, Mak JW. Rigid
membranes of Malayan ovalocytes: a likely genetic barrier
against malaria. Blood 1984;63:1385-1392.
10. Liu SC, Palek J, Prchal J, Castleberry RP. Altered spectrin
dimer-dimer association and instability of erythrocyte
membrane skeletons in hereditary pyropoikilocytosis. J Clin
Invest 1981;68:597-605.
11. Schofield AE, Tanner MJA, Pinder JC, Clough B, Bayley
PM, Nash GB, Dluzewski AR, Reardon DM, Cox TM,
Wilson RJM, Gratzer WB. Basis of unique red cell
membrane properties in hereditary ovalocytosis. J Mol Biol
1992;223:949-958.
12. Fairbanks G, Steck TL, Wallach DF. Electrophoretic analysis
of the major polypeptides of the human erythrocyte
membrane. Biochemistry 1971;10:2606-2617.
13. King MJ, Behrens J, Rogers C, Flynn C, Greenwood D,
Chambers K. Rapid flow cytometric test for the diagnosis of
membrane cytoskeleton-associated haemolytic anaemia. Br
J Haematol 2000;111:924-933.
14. King MJ, Smythe JS, Mushens R. Eosin 5 maleimide binding
to band 3 and Rhrelated proteins forms the basis of a
screening test for hereditary spherocytosis. Br J Haematol
2004;124:106-113.
15. Laemmli UK. Cleavage of structural proteins during
the assembly of the head of bacteriophage T4. Nature
1970;227:680-685.
16. Bolton-Maggs PH, Langer JC, Iolascon A, Tittensor P,
King MJ, General Haematology Task Force of the British
Committee for Standards in Haematology. Guidelines for
the diagnosis and management of hereditary spherocytosis.
Br J Haematol 2004;126:455-474.
30

Golafshan AH, et al: Diagnosis of RBC Membrane Defects
Turk J Hematol 2014;31:25-31
17. Eber S, Lux SE. Hereditary spherocytosis-defects in proteins
that connect the membrane skeleton to the lipid bilayer.
Semin Hematol 2004;41:118-141.
18. Reinhardt D, Witt O, Miosge N, Herken R, Pekrun A.
Increase in band 3 density and aggregation in hereditary
spherocytosis. Blood Cells Mol Dis 2001;27:399-406.
19. Li JY, Li JX, Yang ZM. Abnormalities of ion-exchange
proteins of the red cell membrane in iron deficiency anemia.
Chin Med J (Engl) 1992;105:116-119.
20. Huang Q, Li J, Feng W, Xu Y, Huang Z, Lv S, Zhou H,
Gao L. Erythroid 5-aminolevulinate synthase mediates the
upregulation of membrane band 3 protein expression by
iron. Cell Biochem Funct 2010;28:122-125.
21. Mariani M, Barcellini W, Vercellati C, Marcello AP, Fermo E,
Pedotti P, Boschetti C, Zanella A. Clinical and hematologic
features of 300 patients affected by hereditary spherocytosis
grouped according to the type of the membrane protein
defect. Haematologica 2008;93:1310-1317.
31

Research Article
DOI: 10.4274/Tjh.2012.0049
Childhood Immune Thrombocytopenia:
Long-term Follow-up Data Evaluated by the Criteria
of the International Working Group on Immune
Thrombocytopenic Purpura
Çocukluk Çağında İmmun Trombositopeni: Uluslararası
İmmun Trombositopeni Çalışma Grubunun Kriterlerine Göre
Uzun İzlem Verilerinin Değerlendirilmesi
Melike Sezgin Evim, Birol Baytan, Adalet Meral Güneş
Uludağ University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bursa, Turkey
Abstract:
Objective: Immune thrombocytopenia (ITP) is a common bleeding disorder in childhood, characterized by isolated
thrombocytopenia. The International Working Group (IWG) on ITP recently published a consensus report about the
standardization of terminology, definitions, and outcome criteria in ITP to overcome the difficulties in these areas.
Materials and Methods: The records of patients were retrospectively collected from January 2000 to December 2009 to
evaluate the data of children with ITP by using the new definitions of the IWG.
Results: The data of 201 children were included in the study. The median follow-up period was 22 months (range: 12-131
months). The median age and platelet count at presentation were 69 months (range: 7-208 months) and 19x10 9 /L (range:
1x10 9 /L to 93x10 9 /L), respectively. We found 2 risk factors for chronic course of ITP: female sex (OR=2.55, CI=1.31-4.95)
and age being more than 10 years (OR=3.0, CI=1.5-5.98). Life-threatening bleeding occurred in 5% (n=9) of the patients.
Splenectomy was required in 7 (3%) cases. When we excluded 2 splenectomized cases, complete remission at 1 year was
achieved in 70% (n=139/199). The disease was resolved in 9 more children between 12 and 90 months.
Conclusion: Female sex and age above 10 years old significantly influenced chronicity. Therefore, long-term follow-up is
necessary in these children.
Key Words: Thrombocytopenia, Long-term survival, Children
Özet:
Amaç: İmmün trombositopeni (ITP), izole trombositopeni ile karakterize çocukluk çağında yaygın görülen bir kanama
hastalığıdır. Uluslar arası ITP çalışma grubu (IWG), zorlukların üstesinden gelmek için ITP’de terminolojinin, tanımların ve
sürecin standardizasyonu hakkında bir uzlaşı raporu yayınlamıştır.
Address for Correspondence: Melike Sezgİn Evİm M.D.,
Uludağ University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bursa, Turkey
Phone: +90 224 295 05 64 E-mail: melikevim@yahoo.com
Received/Geliş tarihi : April 13, 2012
Accepted/Kabul tarihi : January 17, 2013
32

Evim SM, et al: Childhood Immune Thrombocytopenia
Turk J Hematol 2014;31:32-39
Gereç ve Yöntemler: ITP’li hastalarımıza ait kayıtlar Ocak 2000’den Kasım 2009’a kadar, geriye yönelik olarak, IWG’nin
yeni kriterleri kullanılarak değerlendirilmek üzere toplandı.
Bulgular: İki yüz bir çocuğun verileri çalışmaya dahil edildi. Ortanca takip süresi 22 ay (12-131 ay) idi. Başvuru anında
ortanca yaş ve trombosit sayısı, sırası ile 69 ay (7-208 ay) ve 19x10 9 /L (1-93x10 9 /L) idi. Hastalığın kronikleşmesi açısından
iki risk faktörü saptadık: Kız cinsiyet (OR=2,55, CI=1,31-4,95) ve yaşın 10’dan büyük olması (OR=3,0, CI=1,5-5,98). Hayatı
tehdit edici kanama, hastaların 5%’inde (n=9) görüldü. Splenektomi yapılması,7 hastada (3%) gerekti. İlk bir yılda splenektomi
yapılan 2 hasta göz ardı edildiğinde, tam remisyon (CR) 70% (n=139/199) hastada görüldü. Hastalık, kronik ITP’li olguların
9’unda (%15; 9/60) daha tanıdan itibaren12 ile 90 ay içerisinde düzeldi.
Sonuç: Kız cinsiyet ve yaşın 10’dan büyük olması, kronikleşmeyi belirgin olarak etkiledi. Ancak bu çocuklarda uzun sureli
takip gereklidir.
Anahtar Sözcükler: Trombositopeni, Çocuk, Uzun dönem takip
Introduction
Immune thrombocytopenia (ITP) is one of the most
frequent acquired bleeding diseases in children. It is
characterized by destruction of the antibody-sensitized
platelets by the reticuloendothelial system and the presence
of isolated thrombocytopenia in the absence of splenomegaly
[1,2]. In the majority of the children, it is a self-limiting
disease with complete recovery of the platelets. However,
20% to 30% of children develop the chronic form of the
disease [3].
Clinical definition, terminology in evaluating patient
characteristics, treatment responses, and outcome in both
adults and children with ITP show great variety from one
study to another. Therefore, a new revision in children and
adults has been made for standardization of terminology,
definition, and outcome [4].
The aim of this study was to evaluate the data, and longterm
outcome in children with ITP according to the recent
International Working Group (IWG) report.
Materials and Methods
The records of patients diagnosed with ITP from
January 2000 to December 2009 at the Department of
Pediatric Hematology of Uludağ University Hospital were
retrospectively collected. The study was approved by the
local ethics committee. The data were evaluated according
to the recent consensus report of the IWG on ITP [4].
Patients with the following criteria were excluded: 1)
thrombocytopenia due to systemic disease or medication,
2) children less than 6 months old, 3) patients with
incomplete clinical data. The diagnosis was made with
the history, physical examination, complete blood count,
and examination of the peripheral blood smear [5].
The diagnosis of ITP and the management, treatment,
complications, and outcome of the disease was discussed
with each family individually during their outpatient
appointments, and written informed consent was obtained
from all.
Age, sex, history of preceding infection and vaccination
platelet count, bleeding manifestations, seasonal difference,
treatment and treatment response at first presentation were
recorded. All children had a minimum of 1 year of followup.
Treatment was given to children with either platelet
count of less than 10x109/L and/or severe bleeding
symptoms. Children with minor and/or mucous bleeding
symptoms with platelet count of less than 20x109/L to
30x109/L were closely observed and received treatment
on demand [5,6,7]. Prednisone at 3-5 mg kg-1 day-1 for
3-7 days or intravenous immunoglobulin G (IVIG) at 0.8-
1 g kg-1 day-1 were the initial therapeutic options. IWG
criteria were used for assessing response to treatment;
“complete response” (CR) was defined as platelet count
greater than 100x109/L. “Response” was defined as platelet
count between 30x109/L and 100x10 9 /L or doubling of the
baseline count. Any platelet count lower than 30x109/L or
less than doubling of the baseline count was described as
“no response”. “Refractory” patients included either those
with failed splenectomy or those with either severe ITP or
increased risk of bleeding requiring frequent therapeutic
intervention [4].
The new terms “newly diagnosed” and “persistent”
replaced the previous term “acute” for children diagnosed
with ITP within the last 3 months and for cases lasting
between 3 and 12 months from diagnosis, respectively.
Chronic ITP was defined as persisting thrombocytopenia of
less than 100x109/L lasting for more than 12 months [4].
The effects of age at diagnosis in progression to chronic
ITP were evaluated by classifying the study group into 3
different age groups [8,9]. The groups were as follows: group
1: between ≥6 and ≤12 months, group 2: between >1 year
and ≤10 years, and group 3: >10 years. Autoimmune tests
such as antinuclear antibody (ANA) and antiphospholipid
antibodies (APAs), direct antiglobulin test, hepatitis B (HBV)
and hepatitis C (HCV) viruses, and antigenemia were also
tested in children with chronic ITP. Helicobacter pylori was
also looked for with the urea breath test in the same group.
33

Turk J Hematol 2014;31:32-39
Evim SM, et al: Childhood Immune Thrombocytopenia
Life-threatening bleeding was defined as intracranial
hemorrhage (ICH) and/or severe hemorrhage at any site
requiring blood transfusion. The indication of splenectomy
and recovery following the operation were separately
addressed for each case.
Two patients had splenectomy within the first 12 months
of diagnosis. After excluding these cases, the rates of platelet
recovery according to patients’ platelet count were evaluated
at the 3rd, 6 th , and 12 th months of diagnosis.
Statistical calculations were performed using SPSS
16 for Windows. Normal distribution was tested using the
Shapiro-Wilk test. Numerical data and categorical variables
were analyzed by the Mann-Whitney U or t-tests and the
chi-square test, respectively. The odds ratio (OR) and
95% confidence interval (CI) were used to determine the
increased relative risk. The results are reported as median,
maximum, and minimum values. Statistical significance was
accepted as p0.05).
There was no previous history of infection and vaccination
for 39% of the children (n=78). History of upper respiratory
tract infection, viral exanthemas, and acute gastroenteritis
was seen in 50% (n=101), 6% (n=12), and 4% (n=8) of the
patients, respectively. Two patients (1%) had a history of
recent vaccination (rabies and diphtheria-tetanus-pertussis)
The most frequent symptoms were petechia and
ecchymosis (71%). Thirty-six children (18%) were admitted
with epistaxis and/or gum bleeding along with petechia and
ecchymosis. Twenty-three patients (11%) had no bleeding
manifestations. No significant seasonal fluctuation in the
incidence of disease was found (p>0.05).
Therapy was given to 102 (51%) children at first
presentation. The rest (n=99; 49%) were observed
according to their clinical symptoms. Initial age and sex
did not differ between the treatment and nontreatment
arms (p>0.05). IVIG was administered to 66 (65%)
children, whereas 36 (35%) received corticosteroids as
the first therapeutic choice. The features of the different
treatment arms at diagnosis are given in Table 1. Treatment
response was found similar for both drugs (p>0.05). Drugrelated
acute complications were seen in 2 (1%) children.
Aseptic meningitis due to IVIG was observed in one of
these patients, and the other developed severe tonsillitis
following corticosteroid treatment.
Within the first 12 months, 2 children required urgent
splenectomy. When we excluded these cases, the rest of the
patients (30%; n=60) had chronic ITP lasting more than 12
months. Platelet counts and bleeding symptoms at diagnosis,
history of preceding infections, and treatment response were
found similar between the persistent and chronic groups
(p>0.05). However, females had a significantly higher
incidence of developing chronic ITP than males (p=0.007)
(Figure 1).
The median age of children with chronic ITP was higher
than children with persistent ITP (88 months (range: 10-196
months) and 61 months (range: 7-208 months) respectively,
p=0.002). When we evaluated children in 3 different age
groups according to their presenting age, children older than
10 years had a significantly higher incidence of developing
chronic ITP than the others (Figure 2).
Among the possible predicting factors for developing
chronic ITP, the major predictors were found to be age of
more than 10 years old at presentation (OR=3.0, CI=1.5-
Table 1. The features of the different treatment arms at diagnosis.
34
IVIG group,ª
(n=66)
Steroid group, b
(n=36)
No treatment
group, c (n=99)
Age (months) 56.5 (7-200) 77.5 (14-202) 70 (7-208)
p-value
Sex (male/female) 33/33 12/24 48/51 >0.05
Platelet count
(mean±standard
deviation)
13.328±11.784 16.297±15.813 40.255±23.756
Mucosal bleeding 15 (22.7%) 9 (25%) 13 (13.1%) >0.05
Chronic course 16 (24.2%) 14 (38.9%) 30 (30.3%) >0.05
a vs. b, 0.05
a vs. c,

Evim SM, et al: Childhood Immune Thrombocytopenia
Turk J Hematol 2014;31:32-39
5.98) and female sex (OR=2.55, CI=1.31-4.95). When we
excluded children above 10 years of age, females still had a
significantly higher risk of chronicity than males (OR=4.01,
CI=1.70-9.50).
The rate of recovery according to patients’ platelet counts
at the 3rd, 6th, and 12th months of diagnosis excluding the
2 splenectomized cases are shown in Figure 3. Eleven (15%)
out of 71 children with platelet counts lower than 100x109/L
at 6 months achieved CR at 12 months. In total, the platelet
count in 139 (70%) out of 199 children gradually rose to
normal levels (≥100x109/L) during 12 months of follow-up.
Figure 1. The number of children with persistent versus
chronic ITP according to sex.
Figure 2. The number of children with persistent versus
chronic ITP according to different age groups at diagnosis.
*Group 1: between ≥6 and ≤12 months,
**Group 2: between >1 year and ≤10 years,
***Group 3: >10 years.
Figure 3. The rate of platelet recovery during 12 months of
follow-up (excluding 2 splenectomized patients).
In addition, platelet recovery subsequently occurred
during 20 months (range: 14-90 months) of follow-up in
9 (15%) out of 60 children who were previously defined as
“chronic” at 12 months of diagnosis. The sex, age, and initial
platelet counts of these children did not differ from those of
the nonresponders (p>0.05).
In total, 15 out of 201 (7.5%) children were refractory,
including cases with severe bleeding (n=9) and 6 other
children with high risk of bleeding requiring frequent
therapy intervention. The characteristics of children with
severe bleeding are given in Table 2. Splenectomy had to
be performed in 7 of them due to insufficient treatment
response to control bleeding symptoms. Splenectomy had
to be performed urgently in 2 of them within the first 12
months of diagnosis. CR was achieved immediately in 4 of
the 7 splenectomized cases.
Autoimmune diseases were screened in children with
chronic ITP. ANA was found positive in 10% (n=6, 3 females
and 3 males) of the children, whereas 8% (n=5) of them had
APA positivity. Direct antiglobulin test was also found positive
in 3% (n=2) of them without any clinical or laboratory signs
of hemolytic anemia. Only one child developed microscopic
hematuria. Viral diseases as HBV, and HCV were also screened
in 87% (n=52) of the chronic patients, and 4% (n=2) were
found positive for the hepatitis B antigen. Eleven out of 60
patients with chronic ITP were screened for H. pylori. Six
out of 11 children (67%) were found positive and H. pylori
eradication was commenced. None had an increase in platelet
count following the eradication.
Discussion
The IWG in 2009 published a consensus report on
standardization of terminology, definition, and outcome
criteria in ITP for both adults and children [4]. One of the
changes in the criteria of defining ITP was the platelet count;
the threshold for diagnosis was established as less than
100x109/L instead of the previously used platelet count of
150x109/L [10,11,12].
Another change made by the IWG was in the term “chronic
ITP”. The group reserved this term for children with ITP
lasting more than 12 months instead of 6 months [4]. Various
studies also report that thrombocytopenia resolves in around
70% of children with ITP by 6 months [3,13]. However,
complete remission could be achieved in a time longer than
this period [14]. The chances of spontaneous remissions are
still significant during long-term follow-up, both in adults
and children [15,16]. Imbach et al. [2] reported that 25% of
children with persistent thrombocytopenia at 6 months had
recovered by 12 months. In our study, 11 (15%) out of 71
children with low platelet count at 6 months achieved CR
at 12 months (Figure 3). In addition, when the follow-up
period was prolonged beyond 12 months, recovery in platelet
counts occurred in 9 (15%; n=9/60) more children who were
35

Turk J Hematol 2014;31:32-39
Evim SM, et al: Childhood Immune Thrombocytopenia
Table 2. The features of the children with severe bleeding symptoms and characteristics of splenectomized patients.
Sex Age at diagnosis/age
at
the time of
splenectomy
(years)
Time interval
between diagnosis
and splenectomy
(months)
Time interval
between diagnosis
and severe
bleeding episode
(months)
Platelet
count x10 9 /L
at time of
bleeding
episode
Bleeding
site
Need of
transfusion Splenectomy Outcome
F 16.6 - 3 6.4 Menorrhagia Yes No CR
M 5.5 - 20 12 Melena Yes No NR
F 9.6/18.6 108 83 6.8 Epistaxis Yes Yes CR
M 14.3/20.7 77 29 6 Hematuria Yes Yes RNR
M 6.2/10.6 53 7 9.8 Melena Yes Yes CR
F 1.7/8 76 5.5 11 Hematuria +
melena
Yes Yes CR
F* 10.3/11 8 8 3 Menorrhagia +
intraabdominal
hemorrhage
Yes Yes RNR
F* 6.2/6.5 3 3 1.8 Melena +
intracranial
hemorrhage
Yes Yes CR
M 2.3/14.8 125 108 14.4 Hematochezia Yes Yes NR
*Splenectomy was performed within the first 12 months of diagnosis.
CR: complete response, R: response, NR: no response.
36

Evim SM, et al: Childhood Immune Thrombocytopenia
Turk J Hematol 2014;31:32-39
defined as chronic at 12 months. Watts [13] also reported that
thrombocytopenia resolved spontaneously in 37 (37%) out of
99 patients with persistent thrombocytopenia between 7 and
96 months from the initial diagnosis.
The largest study about childhood ITP including 2540
children reported that the mean age and the male/female
ratio of the cases of acute and chronic disease were similar
[17]. However, it showed that chronic ITP was seen less
frequently in infants than in children above 10 years of
age [8]. Yaprak et al. [18] from Turkey also reported that
children older than 10 years of age had an at least 2-fold
increased probability of a chronic outcome. Similar findings
were also determined by other reports, revealing that older
age is an important predictor of the chronic disease [13,14].
In the current study, we also supported this result, indicating
that the risk of developing chronic ITP significantly
increased in children older than 10 years of age (OR: 3.0,
CI: 1.5-5.98). The other predictor for chronic ITP in our
data was female sex. A significant increase of chronicity was
noted in females (OR: 2.55, CI: 1.31-4.95). Several studies
noted no difference in the incidence of chronic ITP in male
versus female patients [13,19]. However, females older than
10 years of age have been reported to develop a more chronic
course [6,20,21]. In our study, when we excluded children
above 10 years of age, females still had a significantly higher
risk of chronicity than males (OR=4.01, CI=1.70-9.50).
In our cohort, 51% of the patients were treated at
diagnosis either with corticosteroids or IVIG. Treatment
response did not differ by therapy. Many other studies also
supported our finding [13,19]. Various studies from Turkey
also reported that the therapy response to prednisolone and
IVIG treatments were similar [22,23,24]. The ASH guidelines
of 1996 suggested treatment for children with platelet counts
of

Turk J Hematol 2014;31:32-39
Evim SM, et al: Childhood Immune Thrombocytopenia
4. Rodeghiero F, Stasi R, Gernsheimer T, Michel M, Provan D,
Arnold DM, Bussel JB, Cines DB, Chong BH, Cooper N,
Godeau B, Lechner K, Mazzucconi MG, McMillan R, Sanz
MA, Imbach P, Blanchette V, Kühne T, Ruggeri M, George
JN. Standardization of terminology, definitions and outcome
criteria in immune thrombocytopenic purpura of adults and
children: report from an international working group. Blood
2009;113:2386-2393.
5. George JN, Woolf SH, Raskob GE, Wasser JS, Aledort LM,
Ballem PJ, Blanchette VS, Bussel JB, Cines DB, Kelton
JG, Lichtin AE, McMillan R, Okerbloom JA, Regan DH,
Warrier I. Idiopathic thrombocytopenic purpura: a practice
guideline developed by explicit methods for the American
Society of Hematology. Blood 1996;88:3-40.
6. Sutor AH, Harms A, Kaufmehl K. Acute immune
thrombocytopenia (ITP) in childhood: retrospective and
prospective survey in Germany. Semin Thromb Hemost
2001;27:253-267.
7. British Committee for Standards in Haematology General
Haematology Task Force. Guidelines for the investigation
and management of idiopathic thrombocytopenic purpura
in adults, children and in pregnancy. Br J Haematol
2003;120:574-596.
8. Kühne T, Buchanan GR, Zimmerman S, Michaels LA, Kohan
R, Berchtold W, Imbach P, Intercontinental Childhood ITP
Study Group, Intercontinental Childhood ITP Study Group.
A prospective comparative study of 2540 infants and
children with newly diagnosed idiopathic thrombocytopenic
purpura (ITP) from the Intercontinental Childhood ITP
Study Group. J Pediatr 2003;143:605-608.
9. ElAlfy M, Farid S, Abdel Maksoud A. Predictors of chronic
idiopathic thrombocytopenic purpura. Pediatr Blood
Cancer 2010;54:959-962.
10. Stasi R, Amadori S, Osborn J, Newland AC, Provan D.
Long-term outcome of otherwise healthy individuals with
incidentally discovered borderline thrombocytopenia. PLoS
Med 2006;3:388-394.
11. Bain BJ. Ethnic and sex differences in the total and
differential white cell count and platelet count. J Clin Pathol
1996;49:664-666.
12. Adibi P, Faghih Imani E, Talaei M, Ghanei M. Populationbased
platelet reference values for an Iranian population. Int
J Lab Hematol 2007;29:195-199.
13. Watts RG. Idiopathic thrombocytopenic purpura: a 10-year
natural history study at the Children’s Hospital of Alabama.
Clin Pediatr 2004;43:691-702.
14. Donato H, Picón A, Martinez M, Rapetti MC, Rosso A,
Gomez S, Rossi N, Bacciedoni V, Schvartzman G, Riccheri C,
Costa A, Di Santo J. Demographic data, natural history, and
prognostic factors of idiopathic thrombocytopenic purpura
in children: a multicentered study from Argentina. Pediatr
Blood Cancer 2009;52:491-496.
15. Stasi R, Stipa E, Masi M, Cecconi M, Scimò MT, Oliva F,
Sciarra A, Perrotti AP, Adomo G, Amadori S, Papa G. Longterm
observation of 208 adults with chronic idiopathic
thrombocytopenic purpura. Am J Med 1995;98:436-442.
16. Sailer T, Lechner K, Panzer S, Kyrle PA, Pabinger I. The course
of severe autoimmune thrombocytopenia in patients not
undergoing splenectomy. Haematologica 2006;91:1041-1045.
17. Imbach P, Kühne T, Müller D, Berchtold W, Zimmerman S,
Elalfy M, Buchanan GR. Childhood ITP: 12 months followup
data from the prospective registry I of the Intercontinental
Childhood ITP Study Group (ICIS). Pediatr Blood Cancer
2006;46:351-356.
18. Yaprak I, Atabey B, Durak İ, Türker M, Öniz H, Arun
Özer E. Variant clinical courses in children with immune
thrombocytopenic purpura: sixteen year experience of a
single medical center. Turk J Hematol 2010;27:147-155.
19. Roganovic J, Letica-Crepulja M. Idiopathic thrombocytopenic
purpura: a 15-year natural history study at the Children’s
Hospital Rijeka, Croatia. Pediatr Blood Cancer 2006;47:662-
664.
20. Rosthøj S, Hedlund-Treutiger I, Rajantie J, Zeller B, Jonsson
OG, Elinder G, Wesenberg F, Henter JI, NOPHO ITP
Working Group. Duration and morbidity of newly diagnosed
idiopathic thrombocytopenic purpura in children: a
prospective Nordic study of an unselected cohort. J Pediatr
2003;143:302-307.
21. Wong MS, Chan GC, Ha SY, Lau YL. Clinical characteristics
of chronic idiopathic thrombocytopenia in Chinese children.
J Pediatr Hematol Oncol 2002;24:648-652.
22. Koçak U, Aral YZ, Kaya Z, Oztürk G, Gürsel T. Evaluation
of clinical characteristics, diagnosis and management in
childhood immune thrombocytopenic purpura: a single
center’s experience. Turk J Pediatr 2007;49:250-255.
23. Duru F, Fisgin T, Yarali N, Kara A. Clinical course of
children with immune thrombocytopenic purpura
treated with intravenous immunoglobulin G or megadose
methylprednisolone or observed without therapy. Pediatr
Hematol Oncol 2002;19:219-225.
24. Demircioğlu F, Saygi M, Yilmaz S, Oren H, Irken G. Clinical
features, treatment responses, and outcome of children with
idiopathic thrombocytopenic purpura. Pediatr Hematol
Oncol 2009;26:526-532.
25. Segel GB, Feig SA. Controversies in the diagnosis and
management of childhood acute immune thrombocytopenic
purpura. Pediatr Blood Cancer 2009;53:318-324.
26. Provan D, Stasi R, Newland AC, Blanchette VS, Bolton-
Maggs P, Bussel JB, Chong BH, Cines DB, Gernsheimer TB,
Godeau B, Grainger J, Greer I, Hunt BJ, Imbach PA, Lyons
G, McMillan R, Rodeghiero F, Sanz MA, Tarantino M,
Watson S, Young J, Kuter DJ. International consensus report
on the investigation and management of primary immune
thrombocytopenia. Blood 2010;115:168-186.
38

Evim SM, et al: Childhood Immune Thrombocytopenia Turk J Hematol 2014;31:32-39
27. Neunert C, Lim W, Crowther M, Cohen A, Solberg L Jr,
Crowther MA, American Society of Hematology. The
American Society of Hematology 2011 evidence-based
practice guideline for immune thrombocytopenia. Blood
2011;117:4190-4207.
28. Neunert CE, Buchanan GR, Imbach P, Bolton-Maggs PH,
Bennett CM, Neufeld EJ, Vesely SK, Adix L, Blanchette VS,
Kühne T, Intercontinental Childhood ITP Study Group
Registry II Participants. Severe hemorrhage in children
with newly diagnosed immune thrombocytopenic purpura.
Blood 2008;112:4003-4008.
29. Lilleyman JS. Intracranial haemorrhage in idiopathic
thrombocytopenic purpura. Paediatric Haematology Forum
of the British Society for Haematology. Arch Dis Child
1994;71:251-253.
30. Aronis S, Platokouki H, Avgeri M, Pergantou H, Keramidas
D. Retrospective evaluation of long-term efficacy and safety
of splenectomy in chronic idiopathic thrombocytopenic
purpura in children. Acta Paediatr 2004;93:638-642.
31. Schwartz J, Leber MD, Gillis S, Giunta A, Eldor A, Bussel
JB. Long term follow-up after splenectomy performed for
immune thrombocytopenic purpura (ITP). Am J Hematol
2003;72:94-98.
32. Kühne T, Blanchette V, Buchanan GR, Ramenghi U, Donato
H, Tamminga RY, Rischewski J, Berchtold W, Imbach P,
Intercontinental Childhood ITP Study Group. Splenectomy
in children with idiopathic thrombocytopenic purpura: a
prospective study of 134 children from the Intercontinental
Childhood ITP Study Group. Pediatr Blood Cancer
2007;49:829-834.
33. Perez HD, Katler E, Embury S. Idiopathic thrombocytopenic
purpura with high-titer, speckled pattern antinuclear
antibodies: possible marker for systemic lupus
erythematosus. Arthritis Rheum 1985;28:596-597.
34. Hazzan R, Mukamel M, Yacobovich J, Yaniv I, Tamary
H. Risk factors for future development of systemic lupus
erythematosus in children with idiopathic thrombocytopenic
purpura. Pediatr Blood Cancer 2006;47:657-659.
35. Zimmerman SA, Ware RE. Clinical significance of the
antinuclear antibody test in selected children with
idiopathic thrombocytopenic purpura. J Pediatr Hematol
Oncol 1997;19:297-303.
38. Groshiede P, van Damme P. Epidemiology of hepatitis B
infection and prevention and control of hepatitis B in the
community. Communicable Disease Series 1996;1:17-26.
39

Research Article
DOI: 10.4274/Tjh.2013.0023
NPM1 Gene Type A Mutation in Bulgarian Adults with
Acute Myeloid Leukemia: A Single-Institution Study
Akut Miyeloid Lösemi Olan Erişkin Bulgar Hastalarda NPM1 Geni
Tip A Mutasyonu: Tek Merkez Çalışması
Gueorgui Balatzenko 1,2 , Branimir Spassov 2,3 , Nikolay Stoyanov 2,4 , Penka Ganeva 2,3 , Tihomit Dikov 4 ,
Spiro Konstantinov3,5, Vasil Hrischev 3 , Malina Romanova 1 , Stavri Toshkov 1 , Margarita Guenova 2,4
1National Specialized Hospital for Active Treatment of Hematological Diseases, Laboratory of Cytogenetics and Molecular Biology, Sofia, Bulgaria
2Center of Excellence for Translational Research in Hematology, Sofia, Bulgaria
3National Specialized Hospital for Active Treatment of Hematological Diseases, Hematology Clinic, Sofia, Bulgaria
4 National Specialized Hospital for Active Treatment of Hematological Diseases, Laboratory of Hematopathology and Immunology, Sofia, Bulgaria
5 Medical University of Sofia, Faculty of Pharmacy, Department of Pharmacology, Toxicology and Pharmacotherapy, Sofia, Bulgaria
Abstract:
Objective: Mutations of the nucleophosmin (NPM1) gene are considered as the most frequent acute myeloid leukemia (AML)-
associated genetic lesion, reported with various incidences in different studies, and type A (NPM1-A) is the most frequent type.
However, since most series in the literature report on the features of all patients regardless of the type of mutation, NPM1-A(+)
cases have not been well characterized yet. Therefore, we evaluated the prevalence of NPM1-A in Bulgarian AML patients and
searched for an association with clinical and laboratory features.
Materials and Methods: One hundred and four adults (51 men, 53 women) were included in the study. NPM1-A status was
determined using allele-specific reverse-transcription polymerase chain reaction with co-amplification of NPM1-A and β-actin
and real-time quantitative TaqMan-based polymerase chain reaction. Patients received conventional induction chemotherapy
and were followed for 13.2±16.4 months.
Results: NPM1-A was detected in 26 (24.8%) patients. NPM1-A mutation was detected in all AML categories, including in
one patient with RUNX1-RUNX1T1. There were no differences associated with the NPM1-A status with respect to age, sex,
hemoglobin, platelet counts, percentage of bone marrow blasts, splenomegaly, complete remission rates, and overall survival.
NPM1-A(+) patients, compared to NPM1-A(-) patients, were characterized by higher leukocyte counts [(75.4±81.9)x10 9 /L
vs. (42.5±65.9)x10 9 /L; p=0.049], higher frequency of normal karyotype [14/18 (77.8%) vs. 26/62 (41.9%); p=0.014], higher
frequency of FLT3-ITD [11/26 (42.3%) vs. 8/77 (10.4%); p=0.001], and lower incidence of CD34(+) [6/21 (28.8%) vs. 28/45
(62.2%); p=0.017]. Within the FLT3-ITD(-) group, the median overall survival of NPM1-A(-) patients was 14 months, while
NPM1-A(+) patients did not reach the median (p=0.10).
Conclusion: The prevalence of NPM1-A mutation in adult Bulgarian AML patients was similar to that reported in other
studies. NPM1-A(+) patients were characterized by higher leukocyte counts, higher frequency of normal karyotypes and FLT3-
ITD, and lower incidence of CD34(+), supporting the idea that the specific features of type A mutations might contribute to the
general clinical and laboratory profile of NPM1(+) AML patients.
Key Words: Acute myeloid leukemia, NPM1 gene type A mutation, FLT3-ITD, allele-specific polymerase chain reaction
Address for Correspondence: Gueorgui Balatzenko, MD, PhD,
National Specialized Hospital for Active Treatment of Hematological Diseases, Laboratory of Cytogenetics and Molecular Biology, Sofia, Bulgaria
Phone: +3592 9701137 E-mail: balatzenko@hotmail.com
Received/Geliş tarihi : January 23, 2013
Accepted/Kabul tarihi : June 10, 2013
40

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients
Turk J Hematol 2014;31:40-48
Özet:
Amaç: Nukleofosmin (NPM1) genine ait mutasyonlar değişik çalışmalarda farklı insidanslar bildirilmekle birlikte, akut
miyeloid lösemi (AML)-ilişkili genetik bozuklukların en sık görülenidir ve bunlar arasında tip A (NPM1-A) en sık rastlanan
tipidir. Ancak literatürdeki serilerin çoğu mutasyon tipinden bağımsız olarak tüm hastaların özelliklerini sunmakta olup,
NPM1-A(+) olgular bundan önce ayrıntılı olarak tanımlanmamıştır. Bu yüzden, Bulgar AML hastalarında NPM1-A prevalansı
değerlendirilmiş, klinik ve laboratuvar özellikler ile ilişkileri araştırılmıştır.
Gereç ve Yöntemler: Çalışmaya yüz dört hasta (51 erkek, 53 kadın) dahil edilmiştir. NPM1-A durumu allel-özgül polimeraz
zincir reaksiyonu ile NPM1-A ve b-aktinin birlikte amplifikasyonu ve gerçek-zamanlı TaqMan-bazlı polimeraz zincir reaksiyonu
ile belirlenmiştir. Hastalar konvansiyonel indüksiyon kemoterapisi almış ve 13,2±16,4 ay takip edilmişlerdir.
Bulgular: NPM1-A 26 hastada (%24,8) tespit edildi. NPM1-A mutasyonu, RUNX1-RUNX1T1 taşıyan bir hastayı da içeren tüm
AML kategorilerinde gösterilmiştir. Yaş, cinsiyet, hemoglobin, trombosit sayısı, kemik iliğindeki blast yüzdesi, splenomegali,
tam remisyon oranları ve genel sağkalım ile NPM1-A durumu ile ilişkili farklılık saptanmadı. NPM1-A(+) hastalar, NPM1-A(-)
hastalar ile karşılaştırıldıklarında daha yüksek lökosit sayısına [(75,4±81,9)x10 9 /L vs. (42,5±65,9)x10 9 /L; p=0,049], daha sık
normal karyotipe [14/18 (%77,8) vs. 26/62 (%41,9); p=0,014], daha sık FLT3-ITD’ye [11/26 (%42,3) vs. 8/77 (%10,4); p=0,001]
sahipti ve daha seyrek CD34 (+) [6/21 (%28,8) vs. 28/45 (%62,2); p=0,017] idi. FLT3-ITD(-) grup içinde, NPM1-A(-) hastaların
ortanca genel sağkalımı 14 aydı, ancak NPM1-A(+) hastalar ortancaya ulaşmadı (p=0,10).
Sonuç: Erişkin Bulgar hastalarda NPM1-A mutasyonunun prevalansı diğer çalışmalarda bildirilenlerle benzer bulundu.
NPM1-A(+) hastalar, tip A mutasyonların spesifik özelliklerinin NPM1(+) AML hastaların genel klinik ve laboratuvar profiline
katkıda bulunabileceği fikrini destekler nitelikte yüksek lökosit sayısı, daha sık normal karyotip ve FLT3-ITD ile daha seyrek
CD34(+) sıklığı ile karakterizeydi.
Anahtar Sözcükler: Akut miyeloid lösemi, NPM1 geni tip A mutasyonu, FLT3-ITD, allel-özgül polimeraz zincir reaksiyonu
Introduction
Acute myeloid leukemia (AML) is a heterogeneous
group of clonal disorders with great variability in
terms of pathogenesis; morphological, genetic, and
immunophenotypic characteristics of the leukemic blast
population; clinical course; and response to therapy. It is
believed that this heterogeneity is largely related to variations
in the spectrum of the underlying molecular abnormalities
that alter normal cellular mechanisms of self-renewal,
proliferation, and differentiation [1].
Several lines of evidence support the idea that
hematopoietic precursor cells in AML undergo malignant
transformation in a multistep process of acquisition of
different genetic abnormalities that might range from
relatively large chromosome alterations to single nucleotide
changes, deregulated gene expression, or epigenetic changes
[2]. Some of these abnormalities exhibit strong correlations
with the phenotypic features of the disease and/or treatment
outcome and define biologically and prognostically different
subtypes of AML, as recognized in the latest World Health
Organization (WHO) classification system in 2008. The
category of “AML with recurrent genetic abnormalities”
consists of 6 subtypes, characterized by specific chromosome
translocations that lead to the formation of fusion genes.
Additionally, 2 provisional entities, AML with mutated
nucleophosmin (NPM1) and AML with mutated CCAAT/
enhancer binding protein alpha (CEBPA), have also been
recognized [3]. The former is considered as the most
frequent AML-associated genetic lesion.
The NPM1 gene maps to chromosome 5q35 and encodes
a ubiquitously expressed chaperone protein that shuttles
between the nucleus and cytoplasm but predominantly
resides in the nucleus. It is involved in multiple functions
and plays key roles in ribosome biogenesis, centrosome
duplication, genomic stability, cell cycle progression, and
apoptosis [4].
NPM1 is frequently overexpressed in solid tumors [5],
while in hematological malignancies, the NPM1 locus is
lost [6] or translocated, leading to the formation of fusion
genes and proteins [7]. Recently somatic mutations in exon
12 of the NPM1 gene have been found in approximately
one-third of all adult patients with AML [4,8]. Mutations of
the NPM1 gene induce delocalization of the NPM1 protein
in AML, while in solid tumors, only NPM1 overexpression,
but not delocalization, has been reported so far [9]. Some
differences in the incidence of NPM1 mutations were
observed, suggesting the possible influence of ethnic and
geographic factors [10,11]. Therefore, data concerning
the incidence of the molecular abnormality in particular
countries might be helpful in the analysis of the impact of
local factors.
As reported so far, NPM1-mutation-positive patients are
more often females, with a normal karyotype, and usually
present with high white blood cell (WBC) counts and
higher percentages of bone marrow blasts, frequently with
myelomonocytic or monocytic morphology, with absent or
low expression of CD34, and with frequent FLT3 mutations
[12,13]. The presence of NPM1 mutations is associated with
41

Turk J Hematol 2014;31:40-48
Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients
unique gene expression [14] and microRNA profiles [15].
NPM1 mutations predict an excellent response to induction
therapy [12] and provide important prognostic information
as stable markers for minimal residual disease monitoring in
AML patients [16,17].
Currently there are 55 described mutations of NPM1
exon 12 in AML that result in similar alterations at the
C-terminus of the mutant proteins. The most prevalent
types of mutations are mutation A (75%-80%), mutation
B (10%), and mutation D (5%), while all other mutations
are very rare [4,18]. To date, most studies have focused
on the clinical and laboratory profile of all NPM1-mutated
AML patients regardless of the type of the mutation, and,
therefore, the clinical and laboratory characteristics of
patients, particularly those with the most frequent type
A mutations, have not been precisely recorded. Certain
differences might be expected since some studies suggested
that the outcome and prognosis in patients with type A and
non-A mutations might not be identical [19,20]. Therefore,
in this study we performed molecular screening aiming at
establishing the prevalence of type A mutation of the NPM1
gene in Bulgarian adult AML patients and searched for an
association with major clinical and laboratory features
commonly reported in literature.
Material and Methods
Patients
The NPM1 type A [NPM1-A] mutation was studied in the
bone marrow cells of 104 adults (51 men, 53 women) at a
mean age of 53.7±15.8 years (range: 22-82 years), diagnosed
and treated at the National Specialized Hospital for Active
Treatment of Hematological Diseases, Sofia, Bulgaria, after
receiving informed consent.
The diagnosis of AML was based on WHO 2008
classification criteria using a combination of clinical data
and morphological, cytochemical, flow cytometric, and/or
immunohistochemical, cytogenetic, and molecular features.
Analysis of NPM1-A Mutation by Reverse-Transcription
Polymerase Chain Reaction (RT-PCR)
At the time of diagnosis, bone marrow mononuclear
cells were separated after red blood cell destruction with
a lysis buffer (155 mM NH4Cl, 10 mM KHCO 3 , 0.1 mM
EDTA). Total cellular RNA was isolated using TRIzol
Reagent (Invitrogen, Karlsruhe, Germany) according to the
manufacturer’s protocol. cDNA was synthesized by reverse
transcription of 1 µg of RNA in a reaction medium with a
final volume of 20 µL containing 1X first-strand buffer, 200
U of MMLV reverse transcriptase (USB Products, Affimetrics,
Cleveland, OH, USA), 1 mM of each deoxynucleoside-5’-
triphosphate (dNTP), 20 U of RNase Inhibitor (Invitrogen),
and 5 µM of random hexamers (Thermo Scientific, Waltham,
MA, USA), by consecutive incubation of the samples at 37 °C
for 1 h and at 99 °C for 3 min.
The presence of NPM1-A mutation was determined
using 2 different PCR approaches. In the first, allelespecific
PCR was carried out by simultaneous amplification
of NPM1-A with allele-specific primers and β-actin
cDNA as an internal control. Briefly, 3 µL of cDNA was
amplified in a reaction medium with a final volume of 25
µL containing 1X PCR buffer, 2.5 mM MgCl2, 200 µM of
each dNTP, 1 U of Taq polymerase (Promega, Madison,
WI, USA), and 10 pmol of each of the following primers:
NPM1-mutA (F): 5′-caagaggctattcaagatctctgtctg-3’ and
NPM-REV-6 (R): 5’-accatttccatgtctgagcacc-3’ (NPM1-A),
together with b-actin (S) 5’-ggcatcgtgatggactccg-3’ and
b-actin (AS) 5’-gctggaaggtggacagcga-3’ (β-actin). The
reaction started with denaturation at 95 °C for 7 min;
proceeded with 35 cycles of amplification at 95 °C for 45
s, at 67 °C for 45 s, and at 72 °C for 45 s; and terminated
at 72 °C for 7 min on a Veriti Thermal Cycler (Applied
Biosystems, Foster City, CA, USA). Amplification products
were run in 2% (w/v) agarose gel, stained with ethidium
bromide, and visualized after UV exposure. The second
approach employed real-time quantitative TaqManbased
PCR using the MutaQuant ® Kit NPM1 mutation A
(Ipsogen, Marseille, France) following the manufacturer’s
instructions on a Rotor-Gene 6000 thermocycler (Corbett
Life Science, Mortlake, Australia).
Treatment
Sixty-three patients with non-acute promyelocytic
leukemia (non-APL) received conventional induction
chemotherapy with one of the anthracyclines (doxorubicin
or idarubicin) for 3 days and cytosine arabinoside for 7
days. Patients with APL received all-trans retinoic acid
with or without concurrent induction chemotherapy.
After complete remission was achieved, patients received
consolidation chemotherapy with conventional doses of
cytosine arabinoside and one anthracycline or with highdose
cytosine arabinoside. The mean period of follow-up of
treated patients was 13.2±16.4 months.
Five of the patients died before the start of any treatment.
Early death during the first induction course occurred in 16
(15.4%) patients. Due to old age and/or poor performance
status, no chemotherapy or only low-dose cytosine
arabinoside was given in 16 patients. One patient was lost
from contact.
Statistical Analysis
All statistical analysis was performed using SPSS
16.0.1. The Wilcoxon Mann-Whitney test was used to
compare the distributions of numerically valued variables.
Univariate differences between categorical variable
subsets were evaluated with Fisher’s exact test. Overall
survival (OS) was estimated for patients who received at
least one induction course of therapy using the Kaplan-
Meier method. Two-sided p

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients
Turk J Hematol 2014;31:40-48
Results
A positive reaction for NPM1-A mutation [NPM1-A(+)]
by both approaches was detected in 26 of 104 (24.8%)
patients (Figure 1). No discrepancies in the results generated
by the 2 methods were observed.
There were no significant differences between
NPM1-A(+) and NPM1-A(-) patients with respect to age,
sex, hemoglobin, platelet counts, percentage of bone
marrow blasts, or the presence of splenomegaly (Table 1).
However, the mean WBC count was significantly higher in
NPM1-A(+) compared to NPM1-A(-) patients at (75.4±81.9)
x10 9 /L versus (42.5±65.9)x10 9 /L, respectively (p=0.049).
The statistical analysis did not show any significant
differences in the frequency of the molecular abnormality
in the defined AML categories. However, the incidence
of NPM1-A(+) was clearly lower in AML with recurrent
genetic abnormalities, at 1/11 (9.1%), compared to AML
with myelodysplasia-related changes (AML-MRC) at
4/11 (36.4%), therapy-related myeloid neoplasms at 3/15
(20.0%), and AML not otherwise specified (NOS) at 15/65
(27.7%).
The tendency for a lower frequency of NPM1-A
mutations in patients with recurrent genetic abnormalities
was even more prominent when all patients regardless of
previous chemo- and/or radiotherapy were analyzed. Thus,
a total of 17 patients comprising 11 de novo cases and 6
therapy-related AML cases with fusion transcripts (PML-
RARA, n=2; RUNX1-RUNX1T1, n=3; CBFb-MYH11, n=1)
included only 1 (5.9%) positive case, versus 25/87 (28.7%)
in the remaining group of patients (p=0.064).
Among the different subtypes of AML and NOS cases, no
statistical differences in the prevalence of NPM1-A(+) were
observed, with a relatively higher value in AML without
maturation [6/13 (46.2%)] and in AML with maturation and
acute myelomonocytic leukemia [4/11 (36.4%) and 5/16
(31.2%), respectively]. No positive reaction for NPM1-A was
found in patients with AML with minimal differentiation,
acute erythroid leukemia, and acute megakaryoblastic
leukemia; however, the number of studied cases was too low
for more general conclusions.
Immunophenotyping of patients with and without
NPM1-A revealed statistically lower frequency of CD34(+)
in NPM1-A(+) compared to NPM1-A(-) patients, at 6/21
(28.8%) versus 28/45 (62.2%), respectively (p=0.017),
while no differences were observed in regard to aberrant coexpression
of lymphoid antigens or CD56.
Figure 1. Pattern of detection of NPM1-A mutation by
reverse-transcription polymerase chain reaction (RT-PCR).
A) Detection of NPM1-A mutation by allele-specific
RT-PCR:1=negative control; 5,7=NPM1-A(+) patients;
2,3,4,6,8=NPM1-A(-) patients.
B) Detection of NPM1-A mutation by quantitative real-time
RT-PCR.
Figure 2. Kaplan-Meier survival curves.
A) OS of NPM1-A(+) and NPM1-A(-) AML patients.
B) OS of NPM1-A(+) and NPM1-A(-) AML patients within
the group of patients without FLT3-ITD.
43

Turk J Hematol 2014;31:40-48
Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients
44
Table 1. Patient characteristics according to NPM1-A mutation status. NS: Not significant.
Variable
Gender: Males
Females
NPM1-A
(+)
12 [23.5%]
14 [25.9%]
NPM1-A
(-)
39 (76.5%)
40 (74.1%)
Age [years] 54.8±11.0 53.7±17.3 0.76
White Blood Cells count [x10 9 /L] 75.4±81.9 42.5±65.9 0.049
Platelets count [x10 9 /L] 83.5±86.4 84.7±88.8 0.95
Hemoglobin concentration [g/L] 84.1±21.3 88.3±21.4 0.41
Blasts/blasts equivalents in bone marrow [%] 77.8±21.0 71.2±22.2 0.38
Splenomegaly 6/19 (31.6%) 12/62 (19.4%) 0.34
WHO categories:
AML with recurrent genetic abnormalities
AML with t(8;21); RUNX1-RUNX1T1
AML with inv(16) or t(16;16); CBFB-MYH11
APL with t(15;17);PML-RARA
AML with t(9;11); MLLT3-MLL
AML with t(6;9); DEK-NUP214
1/11 (9.1%)
1/5
0/1
0/3
0/1
0/1
10/11(90.9%)
4/5
1/1
3/3
1/1
1/1
AML with myelodysplasia-related changes 4/11 (36.4%) 7/11 (63.6%) NS
Therapy-related myeloid neoplasms 3/15 (20.0%) 12/15 (80.0%) NS
Acute Myeloid Leukemia, Not Otherwise Specified
AML with minimal differentiation
AML without maturation
AML with maturation
Acute myelomonocytic leukemia
Acute monoblastic and monocytic leukemia
Acute erythroid leukemia
Acute megakaryoblastic leukemia
18/65 (27.7%)
0/5 (0%)
6/13 (46.2%)
4/11 (36.4%)
5/16 (31.2%)
3/16 (18.7%)
0/3 (0%)
0/1 (0%)
47/65 (72.3%)
5/5 (100%)
7/13 (53.8%)
7/11 (63.6%)
11/16 (68.7%)
13/16 (81.3%)
2/2 (100%)
1/1 (100%)
AML unknown 0/2 (0.0%) 2/2 (100.0%) NS
Immunophenotype
CD34(+)
CD56
Lymphoid Antigens
6/21 (28.8%)
8/21 (38.1%)
6/20 (30.0%)
28/45 (62.2%)
14/43 (32.6%)
17/44 (38.6%)
P
0.82
p=0.463
NS
NS
0.017
0.78
0.58
Normal Katyotype 14/18 (77.8%) 26/62 (41.9%) 0.014
FLT3-ITD(+) [n=] 11/26 (42.3%) 8/77 (10.4%) 0.001
MLL-PTD(+) 0/23 (0%) 7/61 (11.5%) 0.18
EVI1-overexpression 4/20 (20.0%) 5/51 (9.8%) 0.26
Early deaths 5/24 (20.8%) 11/75 (14.7%) 0.16
Complete remission 11/16 (68.7%) 27/50 (54.0%) 0.24
Mean OS (months) 17.4 11.3 0.62
Mean OS within the FLT3-ITD(-) group (months) 27.28 30.41 0.10
Median OS within the FLT3-ITD(-) group (months) Not reached 14.00

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients
Turk J Hematol 2014;31:40-48
The overall incidence of NPM1-A mutation among patients
with a normal karyotype was 14/40 (35%). Interestingly,
within the NPM1-A(+) group, a distinct overrepresentation
of patients with a normal karyotype [14/18 (77.8%) vs.
26/62 (41.9%); p=0.014] and internal tandem duplication of
the FLT3 gene (FLT3-ITD) [11/26 (42.3%) vs. 8/77 (10.4%);
p=0.001] was observed compared to patients without the
mutation. No association between NPM1-A status and the
presence of partial tandem duplication of the MLL gene
(MLL-PTD) and overexpression of the EVI1 gene was
detected.
Sixteen patients (15.4%) died within the first month
after diagnosis; however, no differences in the early death
rates between the NPM1-A(+) and NPM1-A(-) groups were
observed [5/24 (20.8%) and 11/75 (14.7%), respectively;
p=0.16].
Overall, a complete remission was achieved in 38
of 66 (57.6%) patients, including 11 out of 16 (68.7%)
NPM1-A(+) patients and 27 out of 50 (54.0%) NPM1-A(-)
patients (p=0.24).
The median OS for NPM1-A(+) non-APL patients was
18.0 months, compared to 12.0 months for NPM1-A(-) non-
APL patients [log rank test, p=0.322]. When patients were
additionally stratified according to their FLT3-ITD status, we
found that, within the FLT3-ITD(-) group, the median OS
of patients without the NPM1-A mutation was 14 months,
while NPM1-A(+) patients did not reach this median. Due
to the relatively small number of patients, this tendency
was still not statistically significant (p=0.10). Within the
FLT3-ITD(+) group, the median OS for NPM1-A(+) and
NPM1-A(-) was 12 months and 5 months, respectively
(p=0.88) (Figure 2).
Discussion
In this study, we screened 104 adult Bulgarian patients
with AML for NPM1 gene type A mutation using 2 different
RT-PCR based approaches and positive results by both
methods were found in 24.8% of patients. This result was
similar to previously reported frequencies of 19.1%-20.3%
for NPM1-A [21,22], while the incidence of all forms of
NPM1 mutations in adults varied from 24.9% to 34.5% in
the literature [22].
Several studies, including ours, clearly demonstrated
that the frequency of NPM1 gene mutations is significantly
higher in AML patients with a normal karyotype [22],
despite results being heterogeneous and varying from
38.1% to 63.8% [22,23]. The data concerning the incidence
of NPM1-A mutation in particular within the category of
patients with normal karyotypes are still scarce, mainly
because the reported data encompass the whole spectrum of
NPM1 gene mutations in most of the studies and only in a
few of them did the authors specify the frequency of type A
mutation. In our study, we found NPM1-A mutations in 35%
of normal-karyotype patients, similar to the results reported
by Schnittger et al. (41.4%) [24] and Döhner et al. (36.7%)
[13].
The group of NPM1-A(+) patients in our study was
characterized by a higher WBC count at diagnosis (p=0.049),
higher frequency of normal karyotypes (p=0.012) and FLT3-
ITD (p=0.001), and lower incidence of CD34(+) (p=0.017).
These results corresponded to the characteristics of patients
with NPM1 gene mutations generally described in the
literature regardless of the type of mutation [25,26].
In contrast, several other findings in our study differed
from those of other reports. According to some authors,
NPM1 mutations occur almost exclusively in de novo AML
cases [25], while, in our study, the abnormality was observed
in 20% of therapy-related AML cases, confirming recently
published data that 16% of patients with therapy-related
AML are also positive for NPM1 mutations [27]. Presumably
the presence of NPM1 mutations in some cases might be
associated with the development of de novo AML, regardless
of the impact of the prior radio-/chemotherapy [28].
Earlier, it was suggested that NPM1 mutations and
recurrent genetic abnormalities are mutually exclusive
in AML patients [29]. However, our study demonstrated
at least one patient with simultaneous co-expression of
NPM1-A and RUNX1-RUNX1T1 transcripts. Occasionally,
similar cases were reported by others, both in adults and
children [18,21,23,30]. Errors in sample registration, PCR
contamination, or other technical factors might explain
these findings in some [29], but not all, of these cases.
Therefore, several questions, such as whether NPM1
mutations and concurrent genetic abnormalities occur in
the same or different leukemic cell populations and whether
the occurrence of 2 or more specific genetic markers in
exceptional cases is just coincidental or represents a true
association, are still not understood [29].
Other variables that are still a subject of controversy are
the sex- and age-associated differences in the incidence of
NPM1 mutation. Previously, a significantly higher incidence
of NPM1 mutations in females was reported by Thiede et al.
[18] and Falini et al. [7]; however, these observation were
not confirmed by our study or others [21,31]. Similarly,
according to Schneider et al. [32], NPM1 mutations
significantly decreased with age, while others reported
that patients with NPM1 mutations were older than those
without the mutation [11,21,33]. In our study, as well as
in those of Döhner et al. [13] and Luo et al. [31], no ageassociated
differences in the NPM1-A mutation status were
found. Several factors might contribute to the heterogeneity
of the obtained results, such as variations in the biological
characteristics of patients (whole AML group vs. AML
patients with normal cytogenetics) or in the applied method
for NPM1 gene mutation detection and the methodological
technical variables [29].
45

Turk J Hematol 2014;31:40-48
Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients
In our study, in addition to AML-MRC and therapyrelated
AML, NPM1-A has been also detected in AML without
maturation, AML with maturation, acute myelomonocytic
leukemia, and acute monoblastic/monocytic leukemia within
the category of AML-NOS without significant differences
in the incidence among the various subtypes (p=0.50).
Previously, it has been suggested that NPM1 mutations
could be found in different AML French-American-British
(FAB) entities [23], with a higher frequency in the M4/M5
subtypes [13,24]. Mutations were never found in FAB M3
and were less common in M0, M4eo, M6, and M7 [18], in
agreement with our data. However, according to Luo et al.,
in AML patients with normal cytogenetics, there was no
correlation between NPM1 mutations and FAB morphologic
subtypes, with a positive reaction for NPM1 predominantly
in M2 and M5 cases [31]. Interestingly, in a study of 252
NPM1-positive patients, those with AML M5 represented
only 12.7% of the whole group, while the majority of
patients had AML M1 (21.9%), AML M2 (25.1%), and AML
M4 (27.9%) morphology [34].
Within the category of AML-MRC, we found NPM1-A(+)
in 36.4% of patients, similarly to Döhner et al., who found
5 patients with NPM1 mutations out of 13 (38.5%) with
secondary AML following myelodysplastic syndrome [13].
In contrast, Devillier et al. reported positive results in only
8% of AML-MRC cases [35], while Falini et al. initially
reported that NPM1 gene mutations were found only in
de novo AML and not in the 135 AML cases arising from
myelodysplasia [12]. It is difficult to explain the reasons for
these differences. First, the number of analyzed cases in our
cohort of patients, as well as in that reported by Döhner et
al. [13], was too low for definitive conclusions concerning
the real incidence. On the other hand, the category of
AML-MRC consists of 3 subtypes, including cases with
previous history of Myelodysplastic syndrome, cases with
Myelodysplastic syndrome-related cytogenetic abnormality,
and cases with multilineage dysplasia [36]. Depending on the
prevalence of the particular subtype, the incidence of NPM1
mutations may vary. Regardless of the precise frequency, the
identification of these patients is important from a clinical
point of view in 2 aspects: first, in regard to the classification
as AML-MRC (applying the WHO morphologic criteria)
or as AML with NPM1 mutation (using the WHO genetic
criteria), and second, because multilineage dysplasia has no
impact on the biologic, clinicopathologic, and prognostic
features of AML with mutated nucleophosmin [37].
In a number of studies, a favorable impact of NPM1 gene
mutations, particularly of type A mutations, on the outcome
was reported [21]. In this study we did not find significant
differences between NPM1-A(+) and NPM1-A(-) patients
with regard to achievement of complete remission (CR) and
OS, despite a clear tendency for better treatment response
being observed in the group of patients with concomitant
FLT3-ITD. Similarly, no differences in CR rates between
NPM-mutated and NPM wild-type patients were reported
by Boissel et al. [38]. Several factors might have an impact
on these results, such as the overall efficiency of the applied
treatment protocols, the rate of intensive induction course
approaches [38], the patients’ ages [39], or the presence of
other molecular abnormalities.
In conclusion, the prevalence of NPM1-A mutations in
adult Bulgarian AML patients was similar to that reported
by other studies. NPM1-A(+) patients in our study were
characterized by higher leukocyte counts at diagnosis, higher
frequency of normal karyotypes, higher frequency of FLT3-
ITD, and lower incidence of CD34(+) immunophenotypes,
supporting the idea that the specific features of type A
mutations of the gene might contribute to the general clinical
and laboratory profiles of AML patients with NPM1 mutations.
Acknowledgments
This study was supported by a grant from the
National Research Fund, Bulgarian Ministry of Education
and Science (D02-35/2009).
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
1. Döhner K, Döhner H. Molecular characterization of acute
myeloid leukemia. Haematologica 2008;93:976-982.
2. Wertheim GB, Hexner E, Bagg A. Molecular-based
classification of acute myeloid leukemia and its role in
directing rational therapy: personalized medicine for
profoundly promiscuous proliferations. Mol Diagn Ther
2012;16:357-369.
3. Arber DA, Brunning RD, Le Beau MM, Falini B, Vardiman JW,
Porwit A, Thiele J, Bloomfield CD. Acute myeloid leukaemia
with recurrent genetic abnormalities. In: Swerdlow SH,
Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele
J, Vardiman JW (eds). WHO Classification of Tumours
of Haematopoietic and Lymphoid Tissues, 4th ed. Lyon,
France, International Agency for Research on Cancer, 2008.
4. Rau R, Brown P. Nucleophosmin (NPM1) mutations in adult
and childhood acute myeloid leukaemia: towards definition
of a new leukaemia entity. Hematol Oncol 2009;27:171-
181.
5. Grisendi S, Mecucci C, Falini B, Pandolfi PP. Nucleophosmin
and cancer. Nat Rev Cancer 2006;6:493-505.
6. La Starza R, Matteucci C, Gorello P, Brandimarte L, Pierini V,
Crescenzi B, Nofrini V, Rosati R, Gottardi E, Saglio G, Santucci
A, Berchicci L, Arcioni F, Falini B, Martelli MF, Sambani C,
Aventin A, Mecucci C. NPM1 deletion is associated with
gross chromosomal rearrangements in leukemia. PLoS One
2010;5:e12855.
46

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients
Turk J Hematol 2014;31:40-48
7. Falini B, Nicoletti I, Bolli N, Martelli MP, Liso A, Gorello
P, Mandelli F, Mecucci C, Martelli MF. Translocations and
mutations involving the nucleophosmin (NPM1) gene in
lymphomas and leukemias. Haematologica 2007;92:519-
532.
8. Falini B, Gionfriddo I, Cecchetti F, Ballanti S, Pettirossi
V, Martelli MP. Acute myeloid leukemia with mutated
nucleophosmin (NPM1): any hope for a targeted therapy?
Blood Rev 2011;25:247-254.
9. Pianta A, Puppin C, Passon N, Franzoni A, Romanello
M, Tell G, Di Loreto C, Bulotta S, Russo D, Damante G.
Nucleophosmin delocalization in thyroid tumour cells.
Endocr Pathol 2011;22:18-23.
10. Falini B, Mecucci C, Tiacci E, Alcalay M, Rosati R,
Pasqualucci L, La Starza R, Diverio D, Colombo E, Santucci
A, Bigerna B, Pacini R, Pucciarini A, Liso A, Vignetti M,
Fazi P, Meani N, Pettirossi V, Saglio G, Mandelli F, Lo-
Coco F, Pelicci PG, Martelli MF; GIMEMA Acute Leukemia
Working Party. Cytoplasmic nucleophosmin in acute
myelogenous leukemia with a normal karyotype. N Engl J
Med 2005;352:254-266.
11. Döhner K, Schlenk RF, Habdank M, Scholl C, Rücker FG,
Corbacioglu A, Bullinger L, Fröhling S, Döhner H. Mutant
nucleophosmin (NPM1) predicts favorable prognosis in
younger adults with acute myeloid leukemia and normal
cytogenetics: interaction with other gene mutations. Blood
2005;106:3740-3746.
12. Alcalay M, Tiacci E, Bergomas R, Bigerna B, Venturini E,
Minardi SP, Meani N, Diverio D, Bernard L, Tizzoni L,
Volorio S, Luzi L, Colombo E, Lo Coco F, Mecucci C, Falini
B, Pelicci PG. Acute myeloid leukemia bearing cytoplasmic
nucleophosmin (NPMc+ AML) shows a distinct gene
expression profile characterized by up-regulation of genes
involved in stem-cell maintenance. Blood 2005;106:899-
902.
13. Garzon R, Garofalo M, Martelli MP, Briesewitz R, Wang L,
Fernandez-Cymering C, Volinia S, Liu CG, Schnittger S,
Haferlach T, Liso A, Diverio D, Mancini M, Meloni G, Foa
R, Martelli MF, Mecucci C, Croce CM, Falini B. Distinctive
microRNA signature of acute myeloid leukemia bearing
cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U
S A 2008;105:3945-3950.
14. Kristensen T, Møller MB, Friis L, Bergmann OJ, Preiss B.
NPM1 mutation is a stable marker for minimal residual
disease monitoring in acute myeloid leukaemia patients
with increased sensitivity compared to WT1 expression.
Eur J Haematol 2011;87:400-408.
15. Thiede C, Koch S, Creutzig E, Steudel C, Illmer T, Schaich
M, Ehninger G. Prevalence and prognostic impact of NPM1
mutations in 1485 adult patients with acute myeloid
leukemia (AML). Blood 2006;107:4011-4020.
16. Koh Y, Park J, Bae EK, Ahn KS, Kim I, Bang SM, Lee JH,
Yoon SS, Lee DS, Lee YY, Park S, Kim BK. Non-A type
nucleophosmin 1 gene mutation predicts poor clinical
outcome in de novo adult acute myeloid leukemia:
differential clinical importance of NPM1 mutation according
to subtype. Int J Hematol 2009;90:1-5.
17. Park BG, Chi HS, Park SJ, Min SK, Jang S, Park CJ, Kim
DY, Lee JH, Lee JH, Lee KH. Clinical implications of
non-A-type NPM1 and FLT3 mutations in patients with
normal karyotype acute myeloid leukemia. Acta Haematol
2012;127:63-71.
18. Yan L, Chen S, Liang J, Feng Y, Cen J, He J, Chang W,
Zhu Z, Pan J, Wu Y, Xue Y, Wu D. Analysis of NPM1 gene
mutations in Chinese adults with acute myeloid leukemia.
Int J Hematol 2007;86:143-146.
19. Ghosh K, Swaminathan S, Madkaikar M, Gupta M, Kerketta
L, Vundinti B. FLT3 and NPM1 mutations in a cohort of
AML patients and detection of a novel mutation in tyrosine
kinase domain of FLT3 gene from western India. Ann
Hematol 2012;91:1703-1712.
20. van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi
V, Saglio G, Gottardi E, Rambaldi A, Dotti G, Griesinger F,
Parreira A, Gameiro P, Diáz MG, Malec M, Langerak AW,
San Miguel JF, Biondi A. Standardized RT-PCR analysis of
fusion gene transcripts from chromosome aberrations in
acute leukemia for detection of minimal residual disease.
Report of the BIOMED-1 Concerted Action: investigation
of minimal residual disease in acute leukemia. Leukemia
1999;13:1901-1928.
21. Suzuki T, Kiyoi H, Ozeki K, Tomita A, Yamaji S, Suzuki
R, Kodera Y, Miyawaki S, Asou N, Kuriyama K, Yagasaki
F, Shimazaki C, Akiyama H, Nishimura M, Motoji T,
Shinagawa K, Takeshita A, Ueda R, Kinoshita T, Emi N,
Naoe T. Clinical characteristics and prognostic implications
of NPM1 mutations in acute myeloid leukemia. Blood
2005;106:2854-2861.
22. Boonthimat C, Thongnoppakhun W, Auewarakul CU.
Nucleophosmin mutation in Southeast Asian acute myeloid
leukemia: eight novel variants, FLT3 coexistence and
prognostic impact of NPM1/FLT3 mutations. Haematologica
2008;93:1565-1569.
23. Verhaak RG, Goudswaard CS, van Putten W, Bijl MA, Sanders
MA, Hugens W, Uitterlinden AG, Erpelinck CA, Delwel
R, Löwenberg B, Valk PJ. Mutations in nucleophosmin
(NPM1) in acute myeloid leukemia (AML): association
with other gene abnormalities and previously established
gene expression signatures and their favorable prognostic
significance. Blood 2005;106:3747-3754.
24. Schnittger S, Schoch C, Kern W, Mecucci C, Tschulik
C, Martelli MF, Haferlach T, Hiddemann W, Falini B.
Nucleophosmin gene mutations are predictors of favorable
prognosis in acute myelogenous leukemia with a normal
karyotype. Blood 2005;106:3733-3739.
47

Turk J Hematol 2014;31:40-48
Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients
25. Renneville A, Roumier C, Biggio V, Nibourel O, Boissel N,
Fenaux P, Preudhomme C. Cooperating gene mutations in
acute myeloid leukemia: a review of the literature. Leukemia
2008;22:915-931.
26. Falini B, Martelli MP, Bolli N, Sportoletti P, Liso A, Tiacci
E, Haferlach T. Acute myeloid leukemia with mutated
nucleophosmin (NPM1): is it a distinct entity? Blood
2011;117:1109-1120.
27. Kayser S, Döhner K, Krauter J, Köhne CH, Horst HA, Held
G, von Lilienfeld-Toal M, Wilhelm S, Kündgen A, Götze
K, Rummel M, Nachbaur D, Schlegelberger B, Göhring
G, Späth D, Morlok C, Zucknick M, Ganser A, Döhner
H, Schlenk RF; German-Austrian AMLSG. The impact of
therapy-related acute myeloid leukemia (AML) on outcome
in 2853 adult patients with newly diagnosed AML. Blood
2011;117:2137-2145.
28. Andersen MT, Andersen MK, Christiansen DH, Pedersen-
Bjergaard J. NPM1 mutations in therapy-related acute
myeloid leukemia with uncharacteristic features. Leukemia
2008;22:951-955.
29. Falini B, Mecucci C, Saglio G, Lo Coco F, Diverio D, Brown
P, Pane F, Mancini M, Martelli MP, Pileri S, Haferlach T,
Haferlach C, Schnittger S. NPM1 mutations and cytoplasmic
nucleophosmin are mutually exclusive of recurrent genetic
abnormalities: a comparative analysis of 2562 patients with
acute myeloid leukemia. Haematologica 2008;93:439-442.
30. Braoudaki M, Papathanassiou C, Katsibardi K, Tourkadoni
N, Karamolegou K, Tzortzatou-Stathopoulou F. The
frequency of NPM1 mutations in childhood acute myeloid
leukemia. J Hematol Oncol 2010;3:41.
31. Luo J, Qi C, Xu W, Kamel-Reid S, Brandwein J, Chang H.
Cytoplasmic expression of nucleophosmin accurately
predicts mutation in the nucleophosmin gene in patients
with acute myeloid leukemia and normal karyotype. Am J
Clin Pathol 2010;133:34-40.
32. Schneider F, Hoster E, Schneider S, Dufour A, Benthaus T,
Kakadia PM, Bohlander SK, Braess J, Heinecke A, Sauerland
MC, Berdel WE, Buechner T, Woermann BJ, Feuring-
Buske M, Buske C, Creutzig U, Thiede C, Zwaan MC,
van den Heuvel-Eibrink MM, Reinhardt D, Hiddemann
W, Spiekermann K. Age-dependent frequencies of NPM1
mutations and FLT3-ITD in patients with normal karyotype
AML (NK-AML). Ann Hematol 2012;91:9-18.
33. Chen W, Rassidakis GZ, Medeiros LJ. Nucleophosmin gene
mutations in acute myeloid leukemia. Arch Pathol Lab Med
2006;130:1687-1692.
34. Schnittger S, Kern W, Tschulik C, Weiss T, Dicker F, Falini
B, Haferlach C, Haferlach T. Minimal residual disease
levels assessed by NPM1 mutation-specific RQ-PCR
provide important prognostic information in AML. Blood
2009;114:2220-2231.
35. Devillier R, Gelsi-Boyer V, Brecqueville M, Carbuccia N,
Murati A, Vey N, Birnbaum D, Mozziconacci MJ. Acute
myeloid leukemia with myelodysplasia-related changes
are characterized by a specific molecular pattern with high
frequency of ASXL1 mutations. Am J Hematol 2012;87:659-
662.
36. Arber DA, Brunning RD, Orazi A, Bain BJ, Porwit A, Vardiman
JW, Le Beau MM, Greenberg PL. Acute myeloid leukaemia
with myelodysplasia-related changes. In: Swerdlow SH,
Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele
J, Vardiman JW (eds). WHO Classification of Tumours
of Haematopoietic and Lymphoid Tissues, 4th ed. Lyon,
France, International Agency for Research on Cancer, 2008.
37. Falini B, Macijewski K, Weiss T, Bacher U, Schnittger S,
Kern W, Kohlmann A, Klein HU, Vignetti M, Piciocchi A,
Fazi P, Martelli MP, Vitale A, Pileri S, Miesner M, Santucci
A, Haferlach C, Mandelli F, Haferlach T. Multilineage
dysplasia has no impact on biologic, clinicopathologic, and
prognostic features of AML with mutated nucleophosmin
(NPM1). Blood 2010;115:3776-3786.
38. Boissel N, Renneville A, Biggio V, Philippe N, Thomas X,
Cayuela JM, Terre C, Tigaud I, Castaigne S, Raffoux E, De
Botton S, Fenaux P, Dombret H, Preudhomme C. Prevalence,
clinical profile, and prognosis of NPM mutations in AML
with normal karyotype. Blood 2005;106:3618-3620.
39. Becker H, Marcucci G, Maharry K, Radmacher MD, Mrózek
K, Margeson D, Whitman SP, Wu YZ, Schwind S, Paschka
P, Powell BL, Carter TH, Kolitz JE, Wetzler M, Carroll
AJ, Baer MR, Caligiuri MA, Larson RA, Bloomfield CD.
Favorable prognostic impact of NPM1 mutations in older
patients with cytogenetically normal de novo acute myeloid
leukemia and associated gene- and microRNA-expression
signatures: a Cancer and Leukemia Group B study. J Clin
Oncol 2010;28:596-604.
48

Research Article
DOI: 10.4274/Tjh.2013.0057
Leukocyte Populations and C-Reactive Protein
as Predictors of Bacterial Infections in Febrile
Outpatient Children
Polikliniğe Başvuran Ateşli Çocuklarda Bakteriyel Enfeksiyonu
Belirlemek için CRP Düzeyi ve Lökosit Popülasyonu
Zühre Kaya, Aynur Küçükcongar, Doğuş Vurallı, Hamdi Cihan Emeksiz, Türkiz Gürsel
Gazi University Medical School, The Pediatric Hematology Unit, Department of Pediatrics, Ankara, Turkey
Abstract:
Objective: Infections remain the major cause of unnecessary antibiotic use in pediatric outpatient settings. Complete blood
count (CBC) is the essential test in the diagnosis of infections. C-reactive protein (CRP) is also useful for assessment of young
children with serious bacterial infections. The purpose of the study was to evaluate leukocyte populations and CRP level to
predict bacterial infections in febrile outpatient children.
Materials and Methods: The values of CBC by Cell-DYN 4000 autoanalyzer and serum CRP levels were evaluated in 120
febrile patients with documented infections (n:74 bacterial, n:46 viral) and 22 healthy controls.
Results: The mean CRP, neutrophil and immature granulocyte (IG) values were significantly higher in bacterial infections
than in viral infections and controls (p

Turk J Hematol 2014;31:49-55
Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children
(r:0,76, p

Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children Turk J Hematol 2014;31:49-55
Seven (5.8%) of the 120 children had definitive and 67 had
(56.0%) probable bacterial infections. Probable viral infections
comprised 44 patients (36.6%) with upper respiratory tract
infections along with flu-like symptoms and negative bacterial
markers (no viral cultures were performed), one patient with
documented EBV, and one with Parvo-B19 (1.6%).
CBC and CRP Levels
The mean levels of CRP and the leukocyte populations
are demonstrated in Table 2. At the time of diagnosis,
patients with bacterial infections had increased serum
CRP level, neutrophil, lymphocyte, and monocyte percent
compared with the control group (p

Turk J Hematol 2014;31:49-55
Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children
Table 1. Demographic features and clinical characteristics of patients.
n (%)
Age
2-7y 87 (72.5)
8-18y 33 (27.5)
Gender (Female/Male) 44/76
Clinical Diagnosis
Definitive bacterial
Strep. tonsillitis 2 (1.6)
Urinary tract infection 5 (4.2)
Probable bacterial
Otitis 6 (5.0)
Sinusitis 11 (9.2)
Tonsillitis 33 (27.6)
Lymphadenitis 6 (5.0)
Bacterial pneumonia 4 (3.4)
Urinary tract infection 7 (5.8)
Definitive virus
EBV 1 (0.8)
Parvo B19 1 (0.8)
Probable virus
Upper respiratory tract infections 38 (31.6)
Viral pneumonia 6 (5.0)
White Blood count (x10 9 /L) (Age, Normal range)
1-3 yr (5.5-17.5) Low 11 (9.2)
4-7 yr (5.0-17.0) Normal 95 (79.2)
8-13 yr (4.5-13.5) High 14 (11.6)
>13 yr (4.5-11.5)
Neutrophil percent (%) (Age, Normal range)
1-3 yr (22-46) Low 12 (10.0)
4-7 yr (30-60) Normal 68 (56.6)
8-13 yr (35-65) High 40 (33.4)
>13 yr (50-70)
Lymphocyte percent (%) (Age, Normal range)
1-3 yr (37-73) Low 37 (30.8)
4-7 yr (29-65) Normal 77 (64.2)
8-13 yr (23-53) High 6 (5.0)
>13 yr (18-42)
Monocyte percent (%) (Age, Normal range)
1-18 yr (2-11) Normal 79 (65.8)
High 41 (34.2)
Variant lymphocyte (%) (n:89)
Absent 67 (75.3)
Present 22 (24.7)
Immature granulocyte (%) (n:89)
Absent 75 (84.3)
Present 14 (15.7)
C-reactive protein (mg/L) (n:62)
≤6 32 (51.8)
>6 30 (48.2)
52

Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children
Turk J Hematol 2014;31:49-55
Table 2. Changes in variables from baseline to two weeks following antibiotic treatment.
Control
(mean±SD) n:22
Baseline values
(mean±SD) (n:55)
At 2 week values
(mean±SD) (n:55)
WBC(x10 9 /L) 9.6±2.1 10.1±5.2 8.6±3.5 -1.4±6.2
Neutrophil (%) 43.1±12.3 51.3±19.1* 42.1±13.3* -9.2±18.8
Lymphocyte (%) 45.3±12.1 31.3±17.9* 45.7±13.6* 9.4±19.1
Monocyte (%) 6.9±2.1 9.1±3.1* 7.8±2.4* -1.1±2.9
Variant
lymphocyte (%)
Immature
Granulocyte (%)
- 1.4±4.6* 0.42±1.7* -1.9±7.1
- 0.37±1.1* 0.14±0.64* -0.25±1.1
CRP(mg/L) 2.1±5.8 49.9±56.8* 8.3±11.8* -63.4±76.5
Data are expressed at mean±standard deviation
*p

Turk J Hematol 2014;31:49-55
Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children
Table 4. Diagnostic accuracy of C-reactive protein (CRP) and leukocyte populations in viral and bacterial infections.
Sensitivity Specificity Positive predictive
value
Bacterial infections
Neutrophil 52% 56% 77% 29%
Immature granulocyte(IG) 19% 94% 90% 28%
C-reactive protein(CRP) 90% 18% 76% 38%
Neutrophil+IG 13% 100% 100% 29%
Neutrophil+CRP 52% 69% 83% 34%
IG+CRP 20% 93% 90% 29%
Neutrophil+CRP+IG 13% 100% 100% 29%
Viral infections
Lymphocyte 5% 95% 66% 62%
Negative predictive
value
Variant lymphocyte
(

Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children
Turk J Hematol 2014;31:49-55
C-reactive protein, interleukin 6 and interferon alpha in the
differentation between bacterial and viral infections. Presse
Med 2000;29:128-134.
6. Putto A, Ruuskanen O, Meurman O, Ekblad H, Korvenranta
H, Mertsola J, Peltola H, Sarkkinen H, Vijanen MK, Halonen
P. C-reactive protein in the evaluation of febrile illness. Arch
Dis Child 1986;61:24-29.
7. Isaacman DJ, Burke BL. Utility of the serum C-reactive
protein for detection of occult bacterial infection in children.
Arch Pediatr Adolesc Med 2002;156:905-909.
8. Al-Gwaiz LA, Babay HH. The diagnostic value of absolute
neutrophil count, band count and morphologic changes
of neutrophils in predicting bacterial infections. Med Princ
Pract 2007;16:344-347.
9. Peltola V, Toikka P, Irjala K, Mertsola J, Ruuskanen O.
Discrepancy between total white blood cell counts and
serum C-reactive protein levels in febrile children. Scand J
Infect Dis 2007;39:560-565.
10. Isaacman DJ, Shults J, Gross TK, Davis PH, Harper M.
Predictors of bacteriemia in febrile children 3 to 36 months
of age. Pediatrics 2000;106:977-982.
11. Pulliam PN, Attia MW, Cronan KM. C-reactive protein
in febrile children 1 to 36 months of age with clinically
undetectable serious bacterial infection. Pediatrics
2001;108:1275-1279.
12. Pratt A, Attia MW. Duration of fever and markers of serious
bacterial infection in young febrile children. Pediatr Int
2007;49:31-35.
13. Chan YK, Tsai MH, Huang DC, Zheng ZH, Hung KD.
Leukocyte nucleus segmentation and nucleus lobe counting.
BMC Bioinformatics 2010;11.558.
14. Roehrl MH, Lantz D, Sylvester C, Wang JY. Age dependent
reference ranges for automated assessment of immature
granulocytes and clinical significance in an outpatient
setting. Arch Pathol Lab Med 2011;135:471-477.
15. Senthilnayagam B, Kumar T, Sukumaran J, MJ, Rao KR.
Automated measurement of immature granulocytes:
performance characteristics and utility in routine clinical
practice. Patholog Res Int. 2012; DOI:10.1155/2012/483670.
16. Chaves F, Tierno B, Xu D. Quantitative determination of
neutrophil VCS parameters by the Coulter automated
hematology analyzer: new and reliable indicators for
acute bacterial infection. Am J Clin Pathol 2005;124:440-
444.
17. HPA. Management of infection guidance for primary care
for consultation and local adaptation.http://www.hpa.org.
uk/webc/HPAwebFile/HPAweb_C/1279888711402 (5 July
2010, date last accessed).
18. Dallman PR. Blood and blood-forming tissues, In Rudolph
AM, editor. Pediatrics. 16th ed. New York, Appleton-
Century-Crofts, 1977. p. 1178.
19. Baraff LJ. Management of fever without source in infants and
children. Ann Emerg Med. 2000;36.602-614.
20. Friedman JF, Lee GM, Kleinman KP, Finkelstein JA. Acute
care and antibiotic seeking for upper respiratory tract
infections for children in day care. Parental knowledge
and day care center policies. Arch Pediatr Adolesc Med
2003;157:369-374.
21. Brent AJ, Lakhanpaul M, Thompson M, Collier J, Ray S,
Ninis N, Levin M, MacFaul R. Risk score to stratify children
with suspected serious bacterial infection: observational
cohort study. Arch Dis Child 2011;96:361-367.
22. Hatherill M, Tibby SM, Sykes K, Turner C, Murdoch
IA. Diagnostic markers of infection: Comparison of
procalcitonin with C reactive protein and leucocyte count.
Arch Dis Child 1999;81:417-421.
23. Andreola B, Bressan S, Callegaro S, Liverani A, Plebani M, Da
Dalt L. Procalcitonin and C-reactive protein as diagnostic
markers of severe bacterial infections in febrile infants and
children in the emergency department. Pediatr Infect Dis J
2007;26:672-677.
24. Pourakbari B, Mamishi S, Zafari J, Khairkhah H, Ashtiani
MH, Abedini M, Afsharpairman S, Rad SS. Evaluation of
procalcitonin and neopterin level in serum of patients with
acute bacterial infection. Braz J Infect Dis 2010;14:252-255.
25. Sanders S, Barnett A, Correa-Velez I, Coulthard M, Doust J.
Systematic review of the diagnostic accuracy of C reactive
protein to detect bacterial infection in nonhospitalized
infants and children with fever. J Pediatr 2008;153:570-
574.
26. McCarthy PL, Jekel JF, Dolan TF Jr. Comparison of acute
phase reactants in pediatric patients with fever. Pediatrics
1978;62:716-720.
27. Tejani NR, Chonmaitree T, Rassin DK, Howie VM, Owen
MJ, Goldman AS. Use of C-reactive protein in differentiation
between acute bacterial and viral otitis media. Pediatrics
1995;95:664-669.
28. dos Anjos BL, Grotto HZ. Evaluation of C-reactive protein
and serum amyloid A in the detection of inflammatory
and infectious disease in children. Clin Chem Lab Med
2010;48:493-499.
29. Nixon DF, Parsons AJ, Elgin RP. Routine full blood counts
as indicators of acute viral infections. J Clin Pathol
1987;40:673-675.
30. Van den Bruel A, Thompson MJ, Haj-Hassan T, Stevens
R, Moll H, Lakhanpaul M, Mant D. Diagnostic value of
laboratory tests in identifying serious infections in febrile
children: systematic review. BMJ. 2011; 342:3082.
55

Research Article
DOI: 10.4274/Tjh.2013.0086
FIP1L1-PDGFRA-Positive Chronic Eosinophilic Leukemia:
A Low-Burden Disease with Dramatic Response to
Imatinib - A Report of 5 Cases from South India
FIP1L1-PDGFRA Pozitif Kronik Eozinofilik Lösemi:
İmatinib için Dramatik Yanıt ile Bir Düşük Yük
Hastalığı-Güney Hindistan’dan 5 Olgu Sunumu
Anıl Kumar N.1, Vishwanath Sathyanarayanan1, Visweswariah Lakshmi Devi2, Namratha N. Rajkumar2,
Umesh Das1, Sarjana Dutt3, Lakshmaiah K Chinnagiriyappa1
1Kidwai Memorial Institute of Oncology, Department of Medical Oncology, Karnataka, India
2Kidwai Memorial Institute of Oncology, Department of Pathology, Karnataka, India
3Oncquest Laboratories Ltd., New Delhi, India
Abstract:
Objective: Eosinophilia associated with FIP1L1-PDGFRA rearrangement represents a subset of chronic eosinophilic leukemia
and affected patients are sensitive to imatinib treatment. This study was undertaken to learn the prevalence and associated
clinicopathologic and genetic features of FIP1L1-PDGFRA rearrangement in a cohort of 26 adult patients presenting with
profound eosinophilia (>1.5x10 9 /L).
Materials and Methods: Reverse-transcriptase polymerase chain reaction and gel electrophoresis were used for the detection
of FIP1L1-PDGFRA rearrangement.
Results: Five male patients with splenomegaly carried the FIP1L1-PDGFRA gene rearrangement. All patients achieved complete
hematological response within 4 weeks of starting imatinib. One patient had previous deep vein thrombosis and 1 patient had
cardiomyopathy, which improved with steroids and imatinib. Conventional cytogenetics was normal in all these patients. No
primary resistance to imatinib was noted.
Conclusion: This study indicates the need to do the FIP1L1-PDGFRA assay in patients with hypereosinophilic syndrome.
Prompt treatment of this condition with imatinib can lead to complete hematological response and resolution of the organ
damage that can be seen in this setting.
Key Words: PDGFRA, Chronic eosinophilic Leukemia, Imatinib, India
Özet:
Amaç: FIP1L1-PDGFRA rearranjmanı ilişkili eozinofili, kronik eozinofilik löseminin bir alt grubunu temsil eder ve etkilenen
hastalar imatinib tedavisine duyarlıdır. Bu çalışma, şiddetli eozinofili ile başvuran 26 erişkin hastadan oluşan bir grupta
FIP1L1-PDGFRA rearranjmanının klinikopatolojik ve genetik yaygınlığını, ve özelliklerini öğrenmek için yapıldı.
Gereç ve Yöntemler: FIP1L1-PDGFRA rearranjmanının tespiti için revers-transkriptaz polimeraz zincir reaksiyonu ve jel
elektroforezi kullanıldı.
Address for Correspondence: Anıl Kumar N, M.D.,
Kidwai Memorial Institute of Oncology, Department of Medical Oncology, Karnataka, India
Phone: +91 9980446774 E-mail: anianeel@gmail.com
Received/Geliş tarihi : March 08, 2013
Accepted/Kabul tarihi : July 08, 2013
56

Kumar A, et al: FIP1L1-PDGFRA-positive Chronic Eosinophilic Leukemia
Turk J Hematol 2014;31:56-60
Bulgular: Splenomegaliye sahip beş erkek hasta FIP1L1-PDGFRA gen yeniden düzenlenmesini taşıyordu. İmatinib
başlangıcından 4 hafta içinde tüm hastalarda tam hematolojik yanıt elde etti. Bir hastada önceden var olan derin ven trombozu
ve 1 hastada steroid ve imatinib ile düzelen kardiyomiyopati vardı. Tüm bu hastalarda konvansiyonel sitogenetik normaldi.
İmatinibe karşı birincil direnç kaydedilmedi.
Sonuç: Bu çalışma hipereozinofilik sendromlu hastalarda FIP1L1-PDGFRA testinin yapılması gerektiğini gösterir. Imatinib
ile bu durumun acil tedavisi tam hematolojik yanıta ve bu durumda görülebilecek organ hasarının engellenmesine yol açabilir.
Anahtar Sözcükler: PDGFRA, Kronik eozinofilik lösemi, İmatinib, Hindistan
Introduction
Hypereosinophilic syndrome (HES) is an uncommon
disorder with persistent eosinophilia and multiple organ
dysfunction due to eosinophilic infiltration [1]. The
spectrum of clinical manifestations are variable and patients
may be asymptomatic or may have endomyocardial fibrosis
or restrictive lung disease. Clonal or neoplastic eosinophilia
is defined as eosinophilia originating from the malignant
clone in hematopoietic stem cells and myeloid neoplasms.
Myeloproliferative neoplasm with eosinophilia and plateletderived
growth factor receptor-alpha gene and Fip1-like
1 gene mutation (FIP1L1-PDGFRA; F/P) is a low-burden
disease with dramatic response to imatinib therapy. Various
classifications over the last 20 years, and especially from the
Year 2011 Working Conference on Eosinophil Disorders
and Syndromes, have tried to give us a better understanding
of the pathophysiology and management of this rare but
clinically important and treatable hematological malignancy
[1]. There are numerous reports indicating an ongoing effort
for treatment of this condition in patients of different genetic
backgrounds, such as those of Özbalcı et al. from Turkey
[2], Loules et al. from Greece [3], Arai et al. from Japan [4],
and Helbig et al. from Poland [5]. There are very few reports
from India, including those of Kumar et al. [6], Sreedhar
Babu et al. [7], and Arora [8]. Hence, we undertook this
study to learn the clinical profile and outcome in our region.
Materials and Methods
This study was done at the Kidwai Memorial Institute
of Oncology, Bangalore, Karnataka, India, a tertiary care
oncology center in southern India. During the period
from January 2008 to December 2011, among the patients
attending our hematology clinic, cases of eosinophilia were
reviewed. he clinical profile, history, physical examination
findings, hemogram investigations and metabolic panels were
reviewed. Patients underwent bone marrow aspiration and
biopsy when required. Where indicated in the investigation,
F/P fusion assay was done by Oncquest Laboratory, New
Delhi, India, using the protocol described below (Figure 1).
Informed consent was obtained.
RNA Isolation
RNA was extracted from bone marrow or peripheral
blood using the RNeasy Mini Kit supplied by QIAGEN as
per the manufacturer’s instructions. RNA was quantified
using a SmartSpec 3000 spectrophotometer (Bio-Rad). The
quality of RNA was ascertained by resolving it on 1.2%
formaldehyde MOPS gel. The purified RNA was stored at
-80 °C until further processing.
cDNA Preparation
cDNA was prepared using the RevertAid First Strand
cDNA Kit supplied by MBI Fermentas. First, 1 µg of total
RNA was taken in a thin-walled, 0.2 mL tube and the volume
was made up to 12 µL with nuclease-free water. The RNA
was denatured by incubating at 65 °C for 5 min in a Dyad
Peltier Thermal Cycler (Bio-Rad). The denatured RNA was
snap-chilled by keeping it on ice for 2 to 4 min, and then 1
µL of dNTPs, 1 µL of random hexamer primer, 4 µL of 5X
RT buffer, and 1 µL of RNase inhibitor was added to the
tube. This was incubated at 20 °C for 4 min in the thermal
cycler; 1 µL of reverse transcriptase was then added and this
was incubated at 42 °C for 50 min. The cDNA hybrid was
denatured by incubating at 93 °C for 5 min. The cDNA was
stored at -80 °C in a deep freezer until further processing.
PCR and Analysis
Fusion of FIP1L1 to PDGFRA was analyzed in an endpoint
polymerase chain reaction (PCR) using the following
primers: FIP1L1 FP (5’ ACCTGGTGCTGATCTTTCTGAT 3’)
and PDGFRA RP (5’ TGAGAGCTTGTTTTTCACTGGA 3’).
Briefly, 3 µL of cDNA was taken in a 0.2 mL PCR tube.
To this was added 2 µL each of 5 µM forward and reverse
primers (Sigma), 0.5 µL of 10 mM dNTP mix, 2.5 µL of 10X
buffer, and 0.5 µL of DyNAzyme II DNA polymerase (all
from Finnzymes). The final reaction volume was made up
to 25 µL with nuclease-free water (Ambion). After an initial
denaturation at 94 °C for 3 min, the PCR was run for 45 cycles
with these conditions: 94 °C for 30 s; 60 °C for 30 s; and
72 °C for 30 s followed by a final extension at 72 °C for 2 min.
PCR directed at the amplification of a housekeeping gene was
used as an internal control to ensure mRNA quality. A “no
template control” (NTC) was used to detect the incidence
of false-positive reactions. All reactions were carried out
in a Dyad Peltier Thermal Cycler (Bio-Rad). The amplicon
was resolved on 2% agarose gel to ascertain the specificity
of amplification. The resolved PCR products were visualized
under UV illumination and documented on a gel doc system
(UVP). Presence of the FIP1L1-PDGFRA deletion mutation
resulted in varying amplicons of 700-1000 bp.
57

Turk J Hematol 2014;31:56-60
Kumar A, et al: FIP1L1-PDGFRA-positive Chronic Eosinophilic Leukemia
1 2 3 4 5 6 7 8 9 10 11 12
Lanes 1 and 2: NTC for housekeeping control and
FIP1L1.
Lanes 3 and 4: Amplicon for housekeeping gene (330
bp) and FIP1L1-PDGFRA (700-1000 bp) of patient A.
Lanes 5 and 6: Amplicon for housekeeping gene (330
bp) and FIP1L1-PDGFRA (700-1000 bp) of patient B.
Lane 7: 100-bp marker.
Lanes 8 and 9: Amplicon for housekeeping gene (330
bp) and FIP1L1-PDGFRA (700-1000 bp) of positive control.
Lanes 10 and 11: Amplicon for housekeeping gene (330
bp) and FIP1L1-PDGFRA (700-1000 bp) of negative control.
Lane 12: 100-bp marker.
Results
During the time period mentioned, 26 patients had
analysis for the F/P mutation, with 5 positive cases
representing 19.2% of total cases. This is probably a falsely
high figure and does not reflect the true incidence, as our
hospital is a reference center for oncology. All 5 patients
were male. The median age was 43.8 years (range: 21-52).
Palpable splenomegaly was seen in all patients, which was
confirmed by ultrasound.
The clinical and laboratory parameters are included in
Table 1.
Bone marrow showed a marked increase in eosinophils.
These were mostly mature; however, eosinophils with sparse
purple granules, vacuolation, and hyposegmented forms
were seen. Few or no blasts and an increase in masT-cells
were seen. Conventional cytogenetics, done in all cases,
showed normal karyotypes.
All patients were started on imatinib at 100 mg or 400
mg per day as per the physician’s preference. All patients
achieved complete hematological response within 4
weeks. One patient was symptomatic with pedal edema
Figure 1. PCR analysis of FIP1L1-PDGFRA fusion isolated
from one of our patients.
and dyspnea. Two-dimensional echocardiogram revealed
cardiomyopathy with left ventricular thrombus. The patient
showed significant improvement in symptoms with imatinib
and steroids. Another patient had pre-existing deep vein
thrombosis, which also resolved with imatinib therapy.
Discussion
The Year 2011 Working Conference on Eosinophil
Disorders and Syndromes (Vienna, Austria) was a
multispecialty discussion held in order to formulate a
consensus statement on the classification of eosinophil
disorders and related syndromes [1].
HES is characterized by persistent eosinophilia and
is associated with damage to multiple organs. Hardy and
Anderson first described this entity in 1968 [9]. Later, in
1975, Chusid et al. defined the prerequisites for the diagnosis
of HES [10] as follows:
1. Absolute eosinophil count of greater than >1500/
µL persisting for longer than 6 months. Outcomes of the
Year 2011 Working Conference on Eosinophil Disorders
and Syndromes suggested that at least 2 occasions with a
minimum time interval of 4 weeks of eosinophilia can also
be considered persistent [1].
2. No identifiable etiology for eosinophilia.
3. Patients must have signs and symptoms of organ
involvement.
Other causes of eosinophilia, like familial eosinophilia,
and acquired causes that are subcategorized as secondary,
clonal, and idiopathic eosinophilia should be considered [1].
The rational algorithm for a patient with eosinophilia
includes peripheral blood smear to rule out an underlying
myeloid malignancy (eg., circulating blasts and dysplastic
cells) and serum tryptase level. Peripheral blood testing for
the F/P mutation should also be done as an initial test. The
next step would be to do a bone marrow aspiration to rule
out myeloid neoplasm or chronic eosinophilic leukemia not
otherwise specified (CEL-NOS) [11,12].
In CEL-NOS, persistent eosinophilia associated with
blasts in the peripheral blood or bone marrow of 20%
or clonality of the eosinophils must be proven [11]. A
separate category has been made for myeloid and lymphoid
neoplasms with eosinophilia and abnormalities of PDGFRA,
PDGFRB, or FGFR1. In neoplasms with F/P mutation, the
presentation is usually CEL and less often acute myeloid
leukemia or T-lymphoblastic lymphoma [12].
After the tremendous success of imatinib therapy in BCR-
ABL-positive chronic myelogenous leukemia, imatinib was
tried in various myeloproliferative disorders and patients
with eosinophilia were found to be particularly sensitive.
A translational research effort led to the identification
of a constitutively activated fusion tyrosine kinase on
chromosome 4q12, derived from an interstitial deletion,
that fuses with PDGFRA to an uncharacterized human gene,
FIP1L1, first described by Cools et al. in 2003 [13]. They
58

Kumar A, et al: FIP1L1-PDGFRA-positive Chronic Eosinophilic Leukemia Turk J Hematol 2014;31:56-60
Table 1. Clinical and laboratory profiles of 5 patients.
Complications
CHR
within 4
weeks
Duration of
treatment
Imatinib
dosage/day
Platelets
(10 9 /L)
Hb
(g/L)
Eosinophils
in PB
(10 9 /L)
Sex Clinical features WBC in
PB
(10 9 /L)
Age,
years
3.30 2.24 113 194 100 mg 3 months +
1 52 M Cough, pain in abdomen,
firm spleen 3 cm
below LCM
4.83 3.86 123 188 100 mg 13 months +
2 21 M Cough, dyspnea, firm
spleen 5 cm below
LCM
5.24 3.24 102 193 100 mg 11 months + Cardiomyopathy and
LV thrombus
3 51 M Lower limb edema,
cough, firm spleen
5 cm below LCM
5.84 4.09 118 178 400 mg 18 months + Deep vein thrombosis
of left lower extremity
4 46 M Pain in abdomen, rash,
firm spleen 8 cm below
LCM
4.80 3.36 211 195 400 mg 10 months +
5 49 M Cough, firm spleen
7 cm below LCM
Abbreviations: M- male; WBC- white blood cell count; PB- peripheral blood; Hb- hemoglobin; CHR- complete hematological response; LV- left ventricle; LCM- left costal margin.
used a nested PCR approach, but our used method was
reverse-transcriptase PCR.
There have been reports from around the world
regarding the treatment of F/P-positive CEL with
imatinib [2,3,4,5]. In most of the reports, all patients
were male, except for 2 of 27 patients reported by Helbig
et al. [5]. All patients had splenomegaly, which is also
reflected in our series. All of our patients achieved
complete hematologic response within 4 weeks, which
is on par with the results of other studies. The optimal
dose of imatinib has been a subject of debate. Successful
treatment regimens have ranged from 100 mg/week
to 400 mg/day [5,14]. The frequency of emergence of
imatinib resistance in F/P-positive disease is currently
unclear [15,16]. We observed no hematologic relapses
among our patients, although our follow-up time was
short. The concentration of imatinib required to inhibiTcells
transformed by FIP1L1-PDGFRA by 50% (IC50)
was 3.2 nM, whereas the IC50 for BCR-ABL was 582
nM. Hence, complete remission even with low doses
of imatinib is seen, which is also evident in our case
series. One of our patients showed a resolution of cardiac
complications similar to that reported by Arai et al. [4].
Few cases have been reported from India and ours is
the largest reported Indian series. The patient reported
by Arora [8] had a cytogenetic abnormality, t (1; 4) (q24;
q35). In all other cases, diagnoses were made on clinical
and morphological grounds and the F/P mutation was not
analyzed. Due to this, the true incidence of CEL in India
is not known.
Conclusion
PDGFRA-positive myeloid neoplasm with
eosinophilia is a rare disease and this study indicates
the need to do the PDGFRA assay in patients with
HES. A high index of suspicion among clinicians and
awareness of this condition is essential for prompt
initiation of therapy. The response is dramatic and can
lead to complete hematological response and prevention
or resolution of organ damage due to eosinophilic
infiltration.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
1. Valent P, Klion AD, Horny HP, Roufosse F, Gotlib J,
Weller PF, Hellmann A, Metzgeroth G, Leiferman KM, Arock
M, Butterfield JH, Sperr WR, Sotlar K, Vandenberghe P,
Haferlach T, Simon HU, Reiter A, Gleich GJ. Contemporary
consensus proposal on criteria and classification of
eosinophilic disorders and related syndromes. J Allergy
Clin Immunol 2012;130:607-612.
59

Turk J Hematol 2014;31:56-60
Kumar A, et al: FIP1L1-PDGFRA-positive Chronic Eosinophilic Leukemia
2. Özbalcı D, Ergene Ü, Yazgan H. A chronic eosinophilic
leukemia patient presenting with blurred vision. Turk J
Hematol 2011;28:239-240.
3. Loules G, Kalala F, Giannakoulas N, Papadakis E, Matsouka
P, Speletas M. FIP1L1-PDGFRA molecular analysis in the
differential diagnosis of eosinophilia. BMC Blood Disorders
2009;9:1.
4. Arai A, Yan W, Wakabayashi S, Hayashi S, Inazawa J, Miura
O. Successful imatinib treatment of cardiac involvement
of FIP1L1-PDGFRA-positive chronic eosinophilic
leukemia followed by severe hepatotoxicity. Int J Hematol
2007;86:233-237.
5. Helbig G, Moskwa A, Swiderska A, Urbanowicz A, Calbecka
M, Gajkowska J, Zdziarska B, Brzezniakiewicz K, Pogrzeba J,
Krzemien S. Weekly imatinib dosage for chronic eosinophilic
leukaemia expressing FIP1L1-PDGFRA fusion transcript:
extended follow-up. Br J Haematol 2009;145:132-134.
6. Kumar A, Sinha S, Tripathi AK. Chronic eosinophilic
leukemia: a case report and review of literature. Indian J
Hematol Blood Transfus 2007;23:112-115.
7. Sreedhar Babu KV, Chowhan AK, Rukmangadha N,
Kumaraswamy Reddy M. Chronic eosinophilic leukaemia:
a case report. J Clin Sci Res 2012;1:46-48.
8. Arora RS. Chronic eosinophilic leukemia with a unique
translocation. Indian Pediatr 2009;46:525-527.
9. Hardy WR, Anderson RE. The hypereosinophilic syndromes.
Ann Intern Med 1968;68:1220-1229.
10. Chusid MJ, Dale DC, West BC, Wolff SM. The
hypereosinophilic syndrome: analysis of fourteen cases
with review of the literature. Medicine (Baltimore)
1975;54:1-27.
11. Vardiman J, Hyjek E. World Health Organization
classification, evaluation, and genetics of the
myeloproliferative neoplasm variants. Hematology Am Soc
Hematol Educ Program 2011;2011:250-256.
12. Bain BJ, Gilliland DG, Horny HP, Vardiman JW.
Myeloid and lymphoid neoplasms with eosinophilia
and abnormalities of PDGFRA, PDGFRB or FGFR1. In:
Swerdlow S, Campo E, Lee Harris N, Jaffe E, Pileri S, Stein
H, Thiele J, Vardiman J (eds). WHO Classification of
Tumors of Hematopoietic and Lymphoid Tissues. Lyon,
France, IARC, 2008.
13. Cools J, DeAngelo DJ, Gotlib J, Stover EH, Legare RD,
Cortes J, Kutok J, Clark J, Galinsky I, Griffin JD, Cross NC,
Tefferi A, Malone J, Alam R, Schrier SL, Schmid J, Rose
M, Vandenberghe P, Verhoef G, Boogaerts M, Wlodarska
I, Kantarjian H, Marynen P, Coutre SE, Stone R, Gilliland
DG. A tyrosine kinase created by fusion of the PDGFRA
and FIP1L1 genes as a therapeutic target of imatinib in
idiopathic hypereosinophilic syndrome. N Engl J Med
2003;348:1201-1214.
14. Klion AD. How I treat hypereosinophilia syndromes. Blood
2009;114:3736-3741.
15. Seifert M, Gerth J, Gajda M, Pester F, Pfeifer R, Wolf G.
[Eosinophilia - a challenging differential diagnosis]. Med
Klin (Munich) 2008;103:591-597.
16. Gleich GJ, Leiferman KM. The hypereosinophilic
syndromes: current concepts and treatments. Br J Haematol
2009;145:271-285.
60

Research Article
DOI: 10.4274/Tjh.2012.0187
The Impact of Obesity and Insulin Resistance on
Iron and Red Blood Cell Parameters: A Single Center,
Cross-Sectional Study
Obezite ve İnsulin Direncinin Demir ve Eritrosit Parametreleri
Üzerine Etkisi: Kesitsel, Tek Merkezli Bir Çalışma
Esma Altunoğlu 1 , Cüneyt Müderrisoğlu 1 , Füsun Erdenen 1 , Ender Ülgen 1 , M. Cem Ar 2
1İstanbul Training and Research Hospital, Department of Internal Medicine, İstanbul, Turkey
2Istanbul University, Cerrahpaşa Medical Faculty, Department of Internal Medicine, Division of Haematology, Istanbul, Turkey
Abstract:
Objective: Obesity and iron deficiency (ID) are the 2 most common nutritional disorders worldwide causing significant
public health implications. Obesity is characterized by the presence of low-grade inflammation, which may lead to a number
of diseases including insulin resistance (IR) and type 2 diabetes. Increased levels of acute-phase proteins such as C-reactive
protein (CRP) have been reported in obesity-related inflammation. The aim of this study was to investigate the impact of
obesity/IR on iron and red blood cell related parameters.
Materials and Methods: A total of 206 patients and 45 control subjects of normal weight were included in this crosssectional
study. Venous blood samples were taken from each patient to measure hemoglobin (Hb), serum iron (Fe), ironbinding
capacity (IBC), ferritin, CRP, fasting blood glucose, and fasting insulin. Body mass index (BMI) and waist-to-hip ratio
(WHR) were calculated for each patient. IR was determined using the HOMA-IR formula.
Results: Subjects were divided into 3 groups according to BMI. There were 152 severely obese (BMI: 42.6±10.1), 54 mildly
obese (BMI: 32.4±2.1), and 45 normal-weight (BMI: 24.3±1.3) patients. Hb levels in severely obese patients and normal controls
were 12.8±1.3 g/dL and 13.6±1.8 g/dL, respectively. We found decreasing Fe levels with increasing weight (14.9±6.9 µmol/L,
13.6±6.3 µmol/L, and 10.9±4.6 µmol/L for normal controls and mildly and severely obese patients, respectively). Hb levels
were slightly lower in patients with higher HOMA-IR values (13.1±1.5 g/dL vs. 13.2±1.2 g/dL; p=0.36). Serum iron levels were
significantly higher in the group with low HOMA-IR values (13.6±5.9 µmol/L vs. 11.6±4.9 µmol/L; p=0.008). IBC was found to
be similar in both groups (60.2±11.4 µmol/L vs. 61.9±10.7 µmol/L; p=0.23). Ferritin was slightly higher in patients with higher
HOMA-IR values (156.1±209.5 pmol/L vs. 145.3±131.5 pmol/L; p=0.62).
Conclusion: Elevated BMI and IR are associated with lower Fe and hemoglobin levels. These findings may be explained by
the chronic inflammation of obesity and may contribute to obesity-related co-morbidities. People with IR may present with
ID without anemia.
Key Words: Obesity, Insulin resistance, Anemia, Inflammation
Address for Correspondence: Esma Altunoğlu, M.D.,
İstanbul Training and Research Hospital, Department of Internal Medicine, İstanbul, Turkey
Phone: +90 212 459 67 79 E-mail: esmaaltunoglu@yahoo.com
Received/Geliş tarihi : November 30, 2012
Accepted/Kabul tarihi : May 8, 2013
61

Turk J Hematol 2014;31:61-67
Altunoğlu E, et al: Anemia and Iron Parameters in Obesity
Özet:
Amaç: Dünyada en sık görülen beslenme bozukluklarından olan obezite ve demir eksikliği önemli halk sağlığı sorunlarına
yol açmaktadır. Kronik, düşük dereceli inflamasyon ile karakterize olan obezite insülin direnci ve tip 2 diyabetes mellitus gibi
ciddi hastalıklara zemin hazırlar. Obezite ile ilişkili inflamasyonun C reaktif protein (CRP) ve bazı sitokinler gibi akut faz
yanıtı oluşturan proteinlerin düzeyinde artışa neden olduğu gösterilmiştir. Bu çalışmada obezite ve insülin direncinin demir
ve eritrosit ile ilişkili parametreler üzerindeki etkisinin araştırılması amaçlanmıştır.
Gereç ve Yöntemler: Bu tek merkezli, kesitsel çalışmaya obezite polikliniğine başvuran 206 hasta ve 45 normal kilolu
sağlıklı kontrol dahil edilmiştir. Hastalardan alınan venöz kan örneklerinde hemoglobin (Hb), demir, demir bağlama kapasitesi
(DBK), ferritin, CRP, açlık şekeri ve insülin düzeyleri çalışılmıştır. Ayrıca çalışmaya alınan her hastanın vücut kütle indeksi
(VKİ), bel/kalça oranı (BKO) hesaplanmış, insülin direnci HOMA-IR formülü ile bulunmuştur.
Bulgular: Hastalar VKİ’lerine göre 3 gruba ayrıldı. Buna göre ileri derecede obez olan 152 hasta (VKİ: 42,6±10,1), hafif obez
54 hasta (VKİ: 32,4±2,1) ve normal kilolu 45 kontrol (VKİ: 24,3±1,3) vardı. İleri derecede obezlerle karşılaştırıldığında normal
kilolu hastalarda Hb düzeyleri daha yüksek (sırasıyla 12,8±1,3 g/dL ve 13,6±1,8 g/dL) saptandı. Serum demir düzeylerinin
artan kilo ile birlikte azaldığı görüldü (normal, hafif ve ileri derecede kilolu hastalarda sırasıyla 14,9±6,9 µmol/L, 13,6±6,3
µmol/L ve 10,9±4,6 µmol/L) HOMA-IR değeri yüksek hastalarda düşük olanlara nazaran Hb düzeyleri hafif azalmış bulundu
(13,1±1,5 g/dL’ye karşılık 13,2±1,2 g/dL; p=0,36). Serum demir düzeyleri düşük HOMA-IR’lı hastalarda anlamlı olarak daha
yüksekti (13,6±5,9 µmol/L’ye karşılık 11,6±4,9 µmol/L; p=0,008). DBK her iki grupta da benzerdi (60,2±11,4 µmol/L’ye
karşılık 61,9±10,7 µmol/L; p=0,23). Ferritin düzeyleri yüksek HOMA-IR’lı grupta anlamlı olmasa da daha yüksek bulundu
(156,1±209,5 pmol/L’ye karşılık 145,3±131,5 pmol/L; p=0,62).
Sonuç: Artmış VKİ ve insülin direnci, düşük hemoglobin ve serum demir düzeyleri ile ilişkili bulunmuştur. Bu bulgular
kısmen obezitede görülen düşük dereceli inflamasyon ile açıklanabilir ve obezite ile ilişkili ek hastalıkların oluşmasına katkı
sağlıyor olabilir. İnsülin direnci bulunan hastalarda anemi gözlenmeksizin subklinik demir eksikliği görülebilir.
Anahtar Sözcükler: Obezite, İnsülin direnci, Anemi, İnflamasyon
Introduction
Obesity and iron deficiency (ID) are 2 of the most common
nutritional disorders worldwide [1]. ID, in developed
countries, is the most common nutritional deficiency and
has been linked to obesity in adults and children [2]. The
association between iron status and obesity is one that
should be explored further, as obesity and ID are diseases that
continue to evolve globally, and both have significant public
health implications [3]. The global incidence of obesity has
increased dramatically over the past 50 years. Currently
more than 1 billion people are thought to have a body
mass index (BMI) of more than 30 kg/m2, and the number
is expected to increase dramatically over the next 30 years
[4]. The prevalence of ID and iron deficiency anemia (IDA)
is highest in the developing world; however, suboptimal
iron status continues to exist in the developed countries.
Epidemiological studies have shown that the prevalence of
anemia increases with age [5]. Among micronutrients, iron
plays a major role not only for hemoglobin synthesis alone,
but also for oxidative metabolism and energy production.
ID and IDA have been shown to underlie important public
health issues; diminished iron reserves affect cognitive
development and behavior, energy metabolism, immune
function, bone health, and work capacity in humans [6].
The inverse correlation between plasma iron and
adiposity in children and adolescents was recently reported
by Pinhas-Hamiel et al. They showed that low iron levels
were present in 38.8%, 12.1%, and 4.4% of obese, overweight,
and normal-weight children, respectively [7]. Obesity is
characterized by the presence of low-grade inflammation and
the risk of developing a number of chronic diseases, such as
insulin resistance (IR) and type 2 diabetes. Obesity-related
inflammation increases plasma levels of many acute-phase
proteins such as C-reactive protein (CRP), hepcidin, and
several cytokines [8]. We hypothesized that IR and obesity
may be associated with decreased hemoglobin and changes
in the iron parameters, including serum iron levels, ironbinding
capacity (IBC), and serum ferritin. Obesity-related
inflammation is expected to result in reduced hemoglobin
and serum iron levels in obese adults and subjects with IR.
The purpose our study was to examine the relation among
hemoglobin, serum iron, total IBC, CRP, and IR in obese
patients and compare this to normal-weight adults.
Materials and Methods
This cross-sectional study included 251 subjects (203
females and 48 males) comprising 206 patients, with no
established chronic or hematologic diseases, and 45 normalweight
healthy controls without any prior personal history
of obesity or diet. None of the patients had undergone gastric
bypass surgery or an intervention for the surgical treatment
of obesity. Menstrual cycles and reproductive history were
obtained in premenopausal women. Women with menstrual
62

Altunoğlu E, et al: Anemia and Iron Parameters in Obesity
Turk J Hematol 2014;31:61-67
irregularities were excluded. People on iron therapy or
consuming dietary supplements or vitamins containing iron,
and subjects having received non-steroidal anti-inflammatory
drugs 48 h prior to blood sampling, were also exempted. None
of the included subjects had a history of blood donation or
transfusion. Neither patients nor the healthy controls were
regular alcohol drinkers. All patients were weighed using a
digital weighing scale with light clothing on, and without
shoes. Their heights were measured standing on a fixed
stadiometer. BMI was calculated by dividing body weight
in kilograms by body height squared in meters and patients
were divided according to the World Health Organization
recommended cut-off points into 5 groups: normal weight
(BMI of

Turk J Hematol 2014;31:61-67
Altunoğlu E, et al: Anemia and Iron Parameters in Obesity
Table 2. Laboratory characteristics of the patients according to BMI.
Normal controls Mildly obese Severely obese
n 45 54 152
Hemoglobin (g/dL) 13.6±1.1 13.3±1.6 12.8±1.3
Hematocrit (%) 41.0±3.8 40.1±4.8 38.5±3.6
Iron (µmol/L) 14.9±6.9 13.6±6.3 10.9±4.6
IBC (µmol/L) 52.8±9.4 63.2±9.1 63.2±10.8
Ferritin (pmol/L) 232.1±145.2 172.1±224.3 112.6±174.8
CRP (nmol/L) 15.2±14.3 9.5±9.5 10.5±9.5
CRP, C-reactive protein; IBC, iron binding capacity
Table 3. Haematologic laboratory characteristics of patients according to gender.
Normal male Obese male Normal female Obese female
n 13 35 15 188
Hemoglobin (g/dL) 14.2±0.8 14.7±1.1 13.1±0.6 12.7±1.2
Hematocrit (%) 14.0±2.6 44.0±3.1 39.0±2.4 38.1±3.5
Iron (µmol/L) 103.0±33.4 88.8±37.3 82.0±23.8 61.1±24.2
IBC (µmol/L) 283.8±59.9 345.1±53.6 296.2±43.7 349.9±60.1
Ferritin (pmol/L) 149.3±73.1 114.8±110.2 72.9±45.7 55.1±72.9
subjects, those with normal weight had lower levels of IBC.
The cut-off value for HOMA-IR was accepted as 2.5. There
were 86 and 165 patients with HOMA-IR levels of ≤2.5 and
>2.5, respectively. Hemoglobin levels in people with higher
IR (as indicated by increased HOMA-IR) were slightly lower
as compared to those with lower HOMA-IR values (13.1±1.5
g/dL vs. 13.2±1.2 g/dL; p=0.36). No difference in hematocrit
levels was observed between patients with >2.5 and ≤2.5
HOMA-IR values (39.8±3.7% vs. 39.1±4.3%; p=0.20).
Serum iron levels were significantly higher in the group
with HOMA-IR values of ≤2.5 (11.6±4.9 µmol/L vs. 13.6±5.9
µmol/L; p=0.008). IBC was found similar in both groups
(60.2±11.4 µmol/L vs. 61.9±10.7 µmol/L; p=0.23). Ferritin
levels were slightly higher in the group with >2.5 HOMA-
IR values (156.1±209.5 pmol/L vs. 145.3±131.5 pmol/L;
p=0.62). CRP levels in the group with high HOMA-IR values
were higher than those in the group with low HOMA-IR
values, but the difference was not significant (11.1±10.1
nmol/L vs. 11.3±11.4 nmol/L; p=0.83). Demographic and
hematological characteristics of the groups according to IR
are shown in Table 3.
Discussion
Obesity and related complications as well as ID are 2
major issues that affect significant proportions of the global
population [9]. This is of considerable concern for the wellbeing
of the population given that overweight and obese
people are at increased risk for co-morbidities, functional
decline, impaired quality of life, increased use of health care
resources, and increased mortality. Iron plays a vital role in
hemoglobin production and erythrocyte maturation. Two of
the most common causes of anemia, IDA and the anemia
of chronic inflammation, result from abnormalities in iron
homeostasis [10]. Iron homeostasis in the body is controlled
by a very complex mechanism, the main components of
which are erythropoietic activity, hypoxia, iron stores, and
inflammation [6].
However, iron may also function in the maintenance of
body weight and composition, as a number of studies have
suggested an association between iron status and obesity.
The first such study, published in 1962 by Wenzel et al.,
demonstrated significantly lower serum iron concentrations
in obese adolescents in comparison to normal controls [11].
Subsequently, Selzer and Mayer reported similar findings
in 1963 [12]. More recently, in a cross-sectional study,
overweight Israeli children and adolescents had lower iron
status compared with normal-weight individuals [7]. Data
from NHANES III support these findings, as multivariate
regression analysis determined that overweight American
children were twice as likely to be iron deficient than normalweight
children and adolescents [13]. Similar associations
have also been reported in adults [10].
Menzie et al. found significantly lower levels of serum
iron and transferrin saturation in obese people when
64

Altunoğlu E, et al: Anemia and Iron Parameters in Obesity Turk J Hematol 2014;31:61-67
compared to non-obese adult volunteers. They reported that
the obese and the non-obese subjects did not differ in total
daily iron consumption but that fat mass was a significant
negative predictor of serum iron level [14].
Our study resulted in similar findings. We found
significantly lower serum iron levels in severely obese
patients than in the mildly obese group, and the mildly
obese group had levels that were lower than those of the
normal controls. IBC levels were lower in normal-weight
individuals compared to obese patients. The mechanism
underlying the reduced iron status in obese individuals
remains to be clarified. Iron depletion might result from
the increased iron requirement of obese people because
of their larger blood volume and/or their consumption of
energy-dense, nutrient-poor foods [3,7,14]. Another cause
of hypoferremia may be the chronic inflammation seen
in obesity [15]. Hepcidin levels are usually anticipated to
increase due to the low-grade inflammation together with
other acute phase markers, including ferritin. However,
ferritin levels were unexpectedly lower in our obese patient
group when compared to normal controls. This may partly
be explained by the disproportionately higher male-tofemale
ratio in the control group. On the other hand, low
ferritin levels in our obese patient group might also reflect
the low total iron body stores. Although IDA was one of the
exclusion criteria of this study, we might have missed cases
of occult ID due to low-iron diets, poor absorption, etc. as
the study was of cross-sectional design and no bone marrow
biopsies were performed to confirm iron body stores. Yanoff
et al. found similar results and stated that the hypoferremia
of obesity appears to be explained both by true ID and by
inflammatory-mediated functional ID [15].
As previously stated, obesity is characterized by
the presence of low-grade inflammation and the risk
of developing a number of chronic diseases such as IR,
impaired glucose tolerance, and type 2 diabetes [16]. As
expected, we observed a higher rate of IR in people with
higher BMIs. We found a negative correlation between IR
and serum iron levels. In the group with high HOMA-IR,
serum iron and hemoglobin levels were low and serum IBC
and ferritin values were high.
Insulin causes a rapid stimulation of iron uptake by
faT-cells and hepatocytes. Reciprocally, iron interferes with
insulin action in the liver [17,18]. In addition, iron is a
potent pro-oxidant that increases cellular oxidative stress,
causing inhibition of insulin internalization and action,
which results in hyperinsulinemia, IR, and abnormal β-cell
function through iron toxicity [16,20,21,22,23,24,25].
Furthermore, iron overload may lead to IR disorders such
as the metabolic syndrome and type 2 diabetes [26,27]. This
involvement appears to be bidirectional: on one hand, iron
accumulation favors IR and thus contributes to pancreatic
beta cell dysfunction and diabetes; on the other hand, IR
seems to facilitate iron accumulation within the body [27].
Several studies have shown that IR is closely related to the
total body iron stores [26]. Oxidative stress and inflammation
are involved in the interplay between iron overload and IR
[27]. Ferritin levels have been shown to correlate positively
with blood glucose and fasting serum insulin and negatively
with insulin sensitivity [28]. In our study, serum ferritin
levels were higher in patients with IR. Ferritin is an index
of body iron stores and is also an inflammatory marker.
Increased serum ferritin concentrations and excessive iron
can contribute to hyperinsulinemia and reduced insulin
function [20,24]. High levels of serum ferritin have been
suggested to be a component of IR. High ferritin levels in
insulin-resistant patients are thought to be mainly the result
of a chronic inflammatory state. Lee et al. recently reported
a significant relationship between IR and ferritin levels [29].
The estrogen binding protein levels may be reduced with
increasing adiposity with concomitant increase in insulin.
Therefore levels of free estrogen may rise up which may cause
suppression of erythropoesis in female [30]. In our study we
found that both normal and obese female subjects had lower
hemoglobin levels than male. This is in accordance with
the knowledge that women have lower hemoglobin values
than male subjects as determined by reference interwals of
WHO. CRP values were higher in this group. Adipose tissue,
especially visceral adipose tissue, releases pro-inflammatory
cytokines such as interleukin-6, tumor necrosis factor-α, and
plasminogen activator inhibitor-I, which lead to increased
plasma levels of acute-phase proteins such as CRP [10,30,31].
Inflammation has been reported to be mild, but it can promote
anemia [32]. The low-grade inflammation induced by the
aforementioned cytokines may contribute to the development
of obesity-associated anemia, which is characterized by
hypoferremia and high to normal serum ferritin levels. We
used CRP as an inflammatory marker in this study. CRP
levels were increased in correlation with BMI, although the
association was not statistically significant. However, earlier
studies showed a strong association between high levels of
BMI and elevated CRP as a surrogate marker of low-grade
inflammation [9,15]. Proinflammatory cytokine release might
lead to the increased production and secretion of hepcidin from
liver and adipose tissue [33,34]. Hepcidin inhibits intestinal
iron absorption and sequesters iron within the macrophages,
thereby restricting iron availability for erythrocyte production
by inducing hypoferremia [24]. Recent studies have shown
that dietary iron absorption is impaired in obese individuals
despite adequate dietary intake and bioavailability [31,35].
Limitations of our study include the lack of additional
tests required for evaluation of iron status, such as transferrin
receptor concentration, reticulocyte count, hepcidin levels,
and bone morrow iron stores. Bone morrow aspirates for
stainable iron are sometimes required to confirm ID in
obese subjects with high IBC. As our aim was to investigate
the hematological parameters in patients with IR, we did
not evaluate hepcidin and the aforementioned parameters.
65

Turk J Hematol 2014;31:61-67
Altunoğlu E, et al: Anemia and Iron Parameters in Obesity
Another limitation is that this study was cross-sectional
in design and therefore no conclusions regarding causal
relationships could be drawn. The duration of obesity could
not be calculated in our study population.
Although obese patients had lower values for iron, they
were not anemic. Given the cross-sectional design of this
study, subjects were not followed to determine whether they
would develop IDA over time.
Conclusion
Increasing BMI has been associated with low serum iron
and hemoglobin as well as elevated serum ferritin levels.
These findings may be explained by the low-grade chronic
inflammation of obesity and have been implicated in many
obesity-related problems, such as IR. Subjects with IR may
have subclinical abnormalities in iron status without anemia.
Thus, routine screening for serum ferritin and serum iron
in people with IR and obese patients should be considered
to assess the body iron store and the risk for developing
anemia. IR should be included in the differential diagnosis
of hyperferritinemia. We recommend close monitoring of
the iron status for people with IR and/or obesity who are
on strict diet programs since hypoferremia appears to be
the result of both true ID and the inflammatory-mediated
functional ID. The patients with identified ID should receive
iron supplements.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
1. del Giudice EM, Santoro N, Amato A, Brienza C, Calabrò
P, Wiegerinck ET, Cirillo G, Tartaglione N, Grandone A,
Swinkels DW, Perrone L. Hepcidin in obese children as a
potential mediator of the association between obesity and
iron deficiency. J Clin Endocrinol Metab 2009;94:5102-
5107.
2. Amato A, Santoro N, Calabro P, Grandone A, Swinkels
DW, Perrone L, del Giudice EM. Effect of body mass index
reduction on serum hepcidin levels and iron status in obese
children. Int J Obes 2010;34:1772-1774.
3. McClung JP, Karl JP. Iron deficiency and obesity: the
contribution of inflammation and diminished iron
absorption. Nutr Rev 2009;67:100-104.
4. Chung B, Matak P, McKie AT, Sharp P. Leptin increases the
expression of the iron regulatory hormone hepcidin in
HuH7 human hepatoma cells. J Nutr 2007;137:2366-2370.
5. Przybyszewska J, Zekanowska E, Kedziora-Kornatowska
K, Boinska J, Cichon R, Porzych K. Prohepcidin and iron
metabolism parameters in the obese elderly patients with
anemia. J Nutr Health Aging 2011;15:259-264.
6. Choudhry VP. Hepicidin and its role in iron metabolism.
Indian J Pediatr 2010;77:787-789.
7. Pinhas-Hamiel O, Newfield RS, Koren I, Agmon A, Lilos
P, Phillip M. Greater prevalence of iron deficiency in
overweight and obese children and adolescents. Int J Obes
Relat Metab Disord 2003;27:416-418.
8. Dandona P, Aljada A, Bandyopadhyay A. Inflammation: the
link between insulin resistance, obesity and diabetes. Trends
Immunol 2004;25:4-7.
9. Cheng HL, Bryant C, Cook R, O’Connor H, Rooney
K, Steinbeck K. The relationship between obesity and
hypoferraemia in adults: a systematic review. Obes Rev
2012;13:150-161.
10. Ausk KJ, Ioannou GN. Is obesity associated with anemia
of chronic disease? A population-based study. Obesity
2008;16:2356-2361.
11. Wenzel BJ, Stults HB, Mayer J. Hypoferraemia in obese
adolescents. Lancet 1962;2:327-328.
12. Seltzer CC, Mayer JC. Serum iron and iron binding capacity
in adolescents. II. Comparison of obese and non-obese
subjects. Am J Clin Nutr 1963;13:341-361.
13. Nead KG, Halterman JS, Kaczorowski JM, Auinger P,
Weitzman M. Overweight children and adolescents: a risk
group for iron deficiency. Pediatrics 2004;114:104-108.
14. Menzie CM, Yanoff LB, Denkinger BI, McHugh T, Sebring
NG, Calis KA, Yanovski JA. Obesity-related hypoferremia is
not explained by differences in reported intake of heme and
nonheme iron or intake of dietary factors that can affect iron
absorption. J Am Diet Assoc 2008:108:145-148.
15. Yanoff LB, Menzie CM, Denkinger B, Sebring NG, McHugh
T, Remaley AT, Yanovski JA. Inflammation and iron
deficiency in the hypoferremia of obesity. Int J Obes (Lond)
2007;31:1412-1419.
16. Tuomainen TP, Nyyssönen K, Salonen R, Tervahauta A,
Korpela H, Lakka T, Kaplan GA, Salonen JT. Body iron
stores are associated with serum insulin and blood glucose
concentrations. Population study in 1,013 eastern Finnish
men. Diabetes Care 1997;20:426-428.
17. Lecube A, Carrera A, Losada E, Hernandez C, Simo R, Mesa
J. Iron deficiency in obese postmenopausal women. Obesity
2006;14:1724-1730.
18. de Luca C, Olefsky JM. Inflammation and insulin resistance.
FEBS Lett 2008;582:97-105.
19. Suarez-Ortegon MF, Arbelaez A, Mosquera M, Mendez F, de
Plata CA. Body iron stores as predictors of insulin resistance
in apparently healthy urban Colombian men. Biol Trace
Elem Res 2012;145:283-285.
20. Senghor A, Bharathya N, Kumar JS, William E,
Balasubramaniam. Serum ferritin, iron, TIBC, Hb in male
patients with dysglycemia. Int J Biol Med Res 2012;3:1609-
1611.
66

Altunoğlu E, et al: Anemia and Iron Parameters in Obesity
Turk J Hematol 2014;31:61-67
21. Dandona P, Hussain MA, Varghese Z, Politis D, Flynn DM,
Hoffbrand AV. Insulin resistance and iron overload. Ann
Clin Biochem 1983;20:77-79.
22. Ferrannini E. Insulin resistance, iron, and the liver. Lancet
2000;355:2181-2282.
23. Wilson JG, Lindquist JH, Grambow SC, Crook ED, Maher JF.
Potential role of increased iron stores in diabetes. Am J Med
Sci 2003;325:332-339.
24. Kang HT, Linton JA, Shim JY. Serum ferritin level is
associated with the prevalence of metabolic syndrome in
Korean adults: The 2007-2008 Korean National Health
and Nutrition Examination Survey. Clin Chim Acta
2012;413:636-641.
25. Fargion S, Dongiovanni P, Guzzo A, Colombo S, Valanti
L, Fracanzani L. Iron and insulin resistance. Aliment
Pharmacol Ther 2005;22(Suppl. 2):61-63.
26. Ford ES, Cogswell ME. Diabetes and serum ferritin
concentration among U.S. adults. Diabetes Care
1999;22:1978-1983.
27. Martinez-Garcia MA, Luque-Ramirez M, San-Millan
JL, Escobar-Morreale HF. Body iron stores and
glucose intolerance in premenopausal women: role of
hyperandrogenism, insulin resistance, and genomic
variants related to inflammation, oxidative stress, and iron
metabolism. Diabetes Care 2009;32:1525-1530.
28. Zafon C, Lecube A, Simo R. Iron in obesity. An ancient
micronutrient for a modern disease. Obes Rev 2010;11:322-
328.
29. Lee JY, Park JM, Hong JA, Lee DC, Im JA, Lee JW. Serum
ferritin is differentially associated with anti-oxidative status
and insulin resistance in healthy obese and non-obese
women. Korean J Fam Med 2012;33:205-210.
30. Zeyda M, Stulnig TM. Obesity, inflammation and insulin
resistance-a mini-review. Gerontology 2009;55:379-386.
31. Tussing-Humphreys LM, Nemeth E, Fantuzzi G, Freels S,
Holterman AX, Galvani C, Ayloo S, Vitello J, Braunschweig
C. Decreased serum hepcidin and improved functional iron
status 6 months after restrictive bariatric surgery. Obesity
2010;18:2010-2016.
32. Roy CN. Anemia of inflammation. Hematology Am Soc
Hematol Educ Program 2010;2010:276-280.
33. Escobar-Morreale HF. Iron metabolism and the polycystic
ovary syndrome. Trends Endocrinol Metab 2012;23:509-
515.
34. Hintze KJ, Snow D, Nabor D, Timbimboo H. Adipocyte
hypoxia increases hepatocyte hepcidin expression. Biol
Trace Elem Res 2011;143:764-771.
35. Aeberli I, Hurrell RF, Zimmermann MB. Overweight
children have higher circulating hepcidin concentrations
and lower iron status but have dietary iron intakes and
bioavailability comparable with normal weight children. Int
J Obes 2009;33:1111-1117.
67

Research Article
DOI: 10.4274/Tjh.2012.0013
The Role of Nitric Oxide in Doxorubicin-Induced
Cardiotoxicity: Experimental Study
Doksorubisine Bağlı Kardiyotoksisitede Nitrik Oksitin Rolü:
Deneysel Çalışma
Ayşenur Bahadır1, Nilgün Kurucu2, Mine Kadıoğlu3, Engin Yenilmez4
1 Karadeniz Technical University, School of Medicine, Department of Pediatric Hematology, Trabzon, Turkey
2 Ankara Oncology Hospital, Department of Pediatric Oncology, Ankara, Turkey
3 Karadeniz Technical University, School of Medicine, Department of Pharmacology, Trabzon, Turkey
4 Karadeniz Technical University, School of Medicine, Department of Histology, Trabzon, Turkey
Abstract:
Objective: We evaluated the myocardial damage in rats treated with doxorubicin (DOX) alone and in combination with
nitric oxide synthase (NOS) inhibitors.
Materials and Methods: Twenty-four male Sprague Dawley rats (12 weeks old, weighing 262±18 g) were randomly
assigned into 4 groups (n=6). Group I was the control group. In Group II, rats were treated with intraperitoneal (ip) injections
of 3 mg/kg DOX once a week for 5 weeks. In Group III, rats received weekly ip injections of 30 mg/kg L-NAME (nonspecific
NOS inhibitor) 30 min before DOX injections for 5 weeks. In Group IV, rats received weekly ip injections of 3 mg/kg L-NIL
(inducible NOS inhibitor) 30 min before DOX injections for 5 weeks. Rats were weighed 2 times a week. At the end of
6 weeks, hearts were excised and then fixed for light and electron microscopy evaluation and tissue lipid peroxidation
(malondialdehyde). Blood samples were also obtained for measuring plasma lipid peroxidation.
Results: Weight loss was observed in Group II, Group III, and Group IV. Weight loss was statistically significant in the
DOX group. Findings of myocardial damage were significantly higher in animals treated with DOX only than in the control
group. Histopathological findings of cardiotoxicity in rats treated with DOX in combination with L-NAME and L-NIL were
not significantly different compared with the control group. The level of plasma malondialdehyde in the DOX group (9.3±3.4
µmol/L) was higher than those of all other groups.
Conclusion: Our results showed that DOX cardiotoxicity was significantly decreased when DOX was given with NO
synthase inhibitors.
Key Words: Doxorubicin, Nitric oxide, Nitric oxide synthase inhibitors
Özet:
Amaç: Bu çalışmada sıçanlarda doksorubisinin (DOX) tek başına ve nitrik oksit sentaz (NOS) inhibitörleri ile birlikte
kullanımının kalp kası üzerinde yarattığı hasar araştırıldı.
Address for Correspondence: Ayşenur Bahadır, M.D.,
Karadeniz Technical University School of Medicine, Department of Pediatric Hematology, Trabzon Turkey
Phone: +90 462 377 57 76 E-mail: aysenurkbr@yahoo.com
Received/Geliş tarihi : January 23, 2012
Accepted/Kabul tarihi : April 8, 2013
68

Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity
Turk J Hematol 2014;31:68-74
Gereç ve Yöntemler: Çalışmada 12 haftalık 24 adet erkek “Sprague Dawley” sıçanı (ortalama ağırlık 262±18 gr) rastgele
dört gruba (n=6) dağıtıldı. Grup I kontrol grubu olarak ayırıldı. Grup II’ye haftada bir kez intraperitoneal (ip) 3 mg/kg, beş
hafta DOX uygulandı. Grup III’e DOX enjeksiyonundan 30 dakika önce ip 30 mg/kg L-NAME (nonselektif NOS inhibitörü) 5
hafta uygulandı. Grup IV’e DOX enjeksiyonundan 30 dakika önce ip 3 mg/kg L-NIL (indüklenebilir NOS inhibitörü) 5 hafta
uygulandı. Çalışma süresince sıçanlar haftada iki kez tartıldı. Altıncı haftada kalbin sol ventrikülünden alınan parçalardan
elektron ve ışık mikroskobik inceleme ve lipit peroksidasyonu tayini (malondialdehid) yapıldı. Plazma lipit peroksidasyonunun
belirlenmesi amacı ile sıçanlardan kan alındı.
Bulgular: Grup II, Grup III ve Grup IV’te kilo kaybı gözlendi. DOX uygulanan grupta istatistiksel olarak anlamlı kilo kaybı
saptandı. Miyokard hasarı bulguları tek başına DOX alan hayvanlarda kontrol grubuna oranla daha yüksek oranda izlendi.
DOX’le beraber L-NAME ve L-NIL verilen sıçanlarda kardiyotoksitenin histopatolojik bulguları kontrol grubundan farklı
değildi. Plazma malondialdehid düzeyi DOX grubunda (9,3± 3,4), diğer tüm gruplara göre daha yüksek olarak ölçüldü.
Sonuç: Bizim çalışmamızda DOX’la beraber NOS inhibitörleri uygulandığında DOX’a bağlı kardiyak toksisite bulgularında
anlamlı azalma olduğu gösterilmiştir.
Anahtar Sözcükler: Doksorubisin, nitrik oksit, nitrik oksit sentaz inhibitörleri
Introduction
Doxorubicin (DOX) is an anthracycline-group antibiotic
that is commonly used in the treatment of childhood tumors,
and 60% of the treatment protocols include anthracyclinegroup
agents. The most significant side effect of these drugs
cardiotoxicity [1,2]. Today, long-term side effects such as
cardiac toxicity are more frequently observed due to the
increased rates of survival in childhood cancers.
Cardiotoxicity secondary to anthracyclines is dependent
on the cumulative dose. The patients may consequently
experience irreversible chronic cardiomyopathy and
congestive cardiac failure [1,3]. Several trials have
been performed on the mechanism of DOX-associated
cardiotoxicity. Currently the most widely accepted opinion
is the injury of myocardial cells by free radicals occurring
during DOX metabolism [1,4,5]. Trials have demonstrated
that the risk of cardiotoxicity could be decreased by using
free radical scavengers [6,7,8].
Nitric oxide (NO) is a potent vasodilator and a
significant mediator in myocardial contraction, and it is
shown to be involved in the pathogenesis of cardiac diseases
such as cardiac failure, ischemia/perfusion injury, and
cardiomyopathy [9]. Recent trials have demonstrated that
NO is involved in the cardiotoxicity associated with DOX.
It was shown that DOX increased NO synthesis in plasma
and cardiac tissue [10,11]. NO increase is believed to be
mediated by inducible NO synthase (iNOS) and endothelial
NO synthase (eNOS) enzymes [12,13].
This trial was designed to investigate the role of NO in
the cardiotoxicity induced by DOX in rats. For this purpose,
the extend of the myocardial injury in the rat heart and the
level of lipid peroxide products were assessed.
Materials and Methods
Twenty-four 12-week-old male Sprague Dawley rats
were used in the study. The animals were housed in cages
with free access to food and water. The cages were placed
in a quiet and temperature- and humidity-controlled room
(22±2 °C and 60±5%, respectively) in which a 12:12-h lightdark
cycle was maintained. The weight of the rats varied
between 240 and 320 g (mean: 262±18 g). During the trial,
the rats were evaluated for their health status twice daily and
any changes in their activity were recorded. The rats were
also weighed twice weekly. Experiments were conducted
between 09:00 and 17:00 hours to minimize diurnal
variation. The experimental protocol was approved by the
Institutional Animal Ethics Committee of the Karadeniz
Technical University Medical School. Animals were allowed
a 1-week acclimatization period before being used in
experiments.
The cardiac toxicity results obtained by the use of DOX
alone (Carlo Erba, Turkey) and in combination with NOS
inhibitors were evaluated. Among the NOS inhibitors,
NG-nitro-L-arginine methyl ester (L-NAME, Sigma), a
nonselective inhibitor, and N6-(1-iminoethyl)-L- lysine
(L-NIL, Sigma), an inducible NO inhibitor, were used.
The rats were randomized into 4 groups, each consisting
of 6 rats.
Group I: Control group. The rats in this group received
saline injection at a dose of 10 mL/kg via intraperitoneal
route once a week for 5 weeks.
Group II: DOX group. In this group, the rats received
DOX injection at a dose of 3 mL/kg via intraperitoneal route
once a week for 5 weeks (total cumulative dose: 15 mg/kg).
Group III: DOX + L-NAME group. Differently from the
rats in the second experimental group, the rats in this group
69

Turk J Hematol 2014;31:68-74
Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity
were also injected with L-NAME at a dose of 30 mg/kg via
intraperitoneal route for 5 weeks 30 min before the injection
of DOX once a week.
Group IV: DOX + L-NIL group. Differently from the rats
in the second experimental group, the rats in this group
were also injected with L-NIL at a dose of 3 mg/kg via
intraperitoneal route for 5 weeks 30 min before the injection
of DOX once a week.
Surgical Excision of the Heart
The animals were observed for 1 week after the last
injection and the heart was surgically excised at the end of
6 weeks in the pharmacology department. Blood samples
were drawn from the renal artery for determining the
plasma lipid peroxidation products. The left ventricle of the
excised heart was divided into 3 pieces and placed in the
appropriate solutions for electron microscopic investigation,
light microscopic examination, and lipid peroxidation assay.
Light Microscopy and Electron Microscopy Study
A portion of the excised left ventricle was placed in 10%
formalin for light microscopy examination and another
portion was placed in 2% glutaraldehyde fixative for electron
microscopy examination. The preparations were examined
and evaluated by a single histologist blind to the study using
an Olympus BH2 light microscope and JEOL 1010 electron
microscope, and pictures were subsequently taken.
The findings related to myocardial injury occurring
secondarily to the toxic effect of DOX, including edema in
the myocytes and interstitium, edema in the sarcoplasmic
reticulum, vacuolization in the myocytes, loss of myofibrils,
and injury of mitochondria (edema, atrophy, crista
clustering, and loss of crista), were evaluated by using light
and electron microscopy; the results were recorded either as
absence (-) or presence (+) of injury.
Lipid Peroxide Assay
For an indirect evaluation of the free radicals produced
in each of the experimental groups, the experimental
groups, lipid peroxidation products were measured in the
rat heart and plasma. The level of malondialdehyde (MDA),
a thiobarbiturate reagent, was determined via measurement
in the biochemistry department.
Statistical Method
The statistical analyses were performed using SPSS for
Windows. SPSS 13 (Statistical Package for Social Screnu)
for Windows © ” The results were expressed in terms of
means±standard deviations and percentages. The toxicity results
detected by electron microscopy and light microscopy in the
DOX, DOX + L-NAME, and DOX + L-NIL groups were compared
to the results from the control group. The DOX + L-NAME and
DOX + L-NIL groups were also compared to each other.
The comparison of the numeric data (means) within
the same group and for different groups was done using
the Wilcoxon test followed by the Mann-Whitney U test
for post-hoc analysis, while the nominal data (ratios) were
compared using the Fisher test. Values of p≤0.05 were
considered statistically significant.
Results
During the 6-week monitoring period of the rats, 1 rat
in the DOX + L-NIL group died after 2 weeks. The autopsy
did not reveal the cause of death. During the monitoring
period, the rats receiving DOX showed a marked reduction
in their activity relative to the control group, while the rats
in the DOX + L-NAME and DOX + L-NIL groups had better
activity compared to the rats receiving only DOX. The rats
did not exhibit any changes in health status except for the
reduced activity.
The comparison of the weights revealed a 12% increase
in rat weight from baseline to the end of the study in the
control group (p=0.02), while the rats in Group II, Group
III, and Group IV exhibited respective reductions in weight
of 12%, 7%, and 6%. The highest weight reduction was
detected in the group receiving DOX alone; there was a
statistically significant difference between the initial and
final weighing (p=0.02). The rates of weight loss were
similar between Group III and Group IV and no statistically
significant difference was detected between the initial and
final weights of the rats in these groups (p=0.20 and p=0.78,
respectively).
The myocardial toxicities occurring with the use of DOX
alone and in combination with the NOS inhibitors were assessed
histopathologically by light and electron microscopy. Photos
obtained in relation to the electron microscopic examination
are presented in Figures 1, 2, 3, 4.
While no findings of myocardial toxicity were detected in
the rats in the control group, all the rats in Group II had at least
one myocardial injury finding histopathologically. In 50% of
the Group II rats, myocyte edema, vacuolization in myocytes,
and loss of myofibrils were detected, while 83% had interstitial
edema. Mitochondrial injury was detected in all rats.
In Group III and Group IV, myocardial toxicity was
detected at a lower rate. None of the rats in Group III
were detected to have myocyte edema, interstitial edema,
Figure 1. Group I=control; normal histopathological
morphology, no findings of myocardial toxicity.
70

Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity
Turk J Hematol 2014;31:68-74
Figure 2. Group II =DOX; arrow shows the myocyte edema,
‘a’ shows mitochondrial injury, and ‘b’ shows sarcoplasmic
reticulum edema. There is also loss of myofibrils.
Figure 3. Group III=DOX + L-NAME; there is less
mitochondrial injury.
Figure 4. Group IV=DOX + L-NIL; less myocyte edema is
observed.
vacuolization in the myocytes, or loss of fibrils, while 66% of
the rats were observed to have sarcoplasmic reticulum edema
and mitochondrial injury. As for Group IV, 80% of the rats did
not have interstitial edema, sarcoplasmic reticulum edema, or
vacuolization in the myocytes; 40% had myocyte edema and
mitochondrial injury. There was no loss of fibrils (Table 1).
The comparison of the histopathological cardiac toxicity
findings (Table 2) revealed significantly increased rates of
interstitial edema, sarcoplasmic reticulum edema, myocyte
vacuolization, and mitochondrial injury in the group
receiving DOX alone compared to the control group. There
was no difference in the comparison of the myocyte edema
and loss of myofibrils. In the group receiving L-NAME in
combination with DOX, only the presence of sarcoplasmic
reticulum edema was statistically significantly higher
compared to the control group. There was no statistically
significant difference in the toxicity findings of the group
receiving L-NIL in combination with DOX when compared
to the control group.
With respect to the histopathological toxicity findings,
the group receiving DOX alone had more marked findings;
however, the difference from between the groups receiving
L-NAME and L-NIL with DOX was not statistically
significant. Binary comparison of the DOX + L-NAME and
DOX + L-NIL groups revealed no statistically significant
difference in the toxicity findings.
Upon comparison of the tissue and plasma MDA levels
measured for demonstrating lipid peroxidation, the mean
plasma MDA level (9.3±3.4 µmol/L) was detected to be
higher in the DOX group compared to the other groups; the
difference was statistically significant compared to the control
group and the DOX + L-NAME group (p=0.03 for both).
However, there was no marked difference between the groups
with regard to the MDA values obtained from tissue. This was
attributed to the difficulty of preparing homogenate from the
cardiac tissue and the technical difficulty of the MDA assay.
Discussion
Several trials have been performed to determine the
mechanisms involved in DOX-associated toxicity. The
most widely accepted mechanism is the myocardial injury
secondary to free radical formation. Anthracyclines were
detected to increase the superoxide anion and hydrogen
peroxide formation in the heart sarcosome, mitochondria,
and cytoplasm depending on the drug concentration [1,5,6].
NO as the major regulator of the vascular tonus is
significantly involved in cardiac functions and diseases.
Cardiac NO production is mediated by the eNOS and
iNOS enzymes [14,15,16]. While the basal NO production
regulates the cardiomyocyte contractility and the blood
flow, the excessively produced NO is involved in cardiac
pathologies such as dilated cardiomyopathy and congestive
cardiac failure [9,17,18,19]. Recent trials reported that NO
was involved in the cardiotoxicity of DOX [10,11,13,20,21].
71

Turk J Hematol 2014;31:68-74
Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity
Table 1. Histopathological evaluation of myocardial toxicity findings.
Histopathological findings Group I*
+ (n) - (n)
Group II*
+ (n) - (n)
Group III*
+ (n) - (n)
Group IV*
+ (n) - (n)
Myocyte edema 0 6 3 3 0 6 2 3
Interstitial edema 0 6 5 1 0 6 1 4
Sarcoplasmic reticulum edema 0 6 6 0 4 2 1 4
Vacuolization in the myocytes 0 6 3 3 0 6 1 4
Loss of myofibrils 0 6 4 2 0 6 0 5
Mitochondrial injury 0 6 6 0 4 2 2 3
* Group I =Control, Group II =DOX, Group III =DOX + L-NAME, Group IV =DOX + L-NIL; n =number of rats. All groups contained 6 rats, except Group IV,
which had 5 rats.
Table 2. The comparison of the histopathological cardiac
toxicity findings in the control group and drug groups.
Histopathological
p value
findings
Group
I vs. II
Group
I vs. III
Group
I vs. IV
Myocyte edema >0.05 >0.05 >0.05
Interstitial edema 0.02 >0.05 >0.05
Sarcoplasmic reticulum edema 0.002 0.02 >0.05
Vacuolization in the myocytes 0.02 >0.05 >0.05
Loss of myofibrils >0.05 >0.05 >0.05
Mitochondrial injury 0.002 >0.05 >0.05
*Group I =Control, Group II =DOX, Group III =DOX + L-NAME,
Group IV =DOX + L-NIL.
This trial was designed to investigate the role of NO
in the DOX-associated cardiac toxicity. A higher rate of
weight loss was detected in the rats receiving DOX alone
in comparison to the rats receiving additional L-NIL and
L-NAME. In addition, marked reduction in activity was
detected. The literature data included reduced activity, weight
loss, and acid formation as the clinical findings for DOXassociated
toxicity. Guerra et al. reported that those with
cardiomyopathy findings among rats that were administered
a cumulative DOX dose of 13.5 mg/kg had significantly lower
weight gain relative to the control group [11]. In the trial by
Hirano et al., the rats receiving intravenous DOX weekly at
a dose of 1.25 mg/kg (total dose: 5 mg/kg) and 2.5 mg/kg
for 4 weeks (total dose: 10 mg/kg) exhibited reduction in
weight in line with the cardiomyopathy findings; this was
particularly marked in the group receiving the dose of 2.5
mg/kg/week [22].
The histopathological findings obtained in the
cardiotoxicity models in empirical studies established by
administering an intravenous or intraperitoneal dose of 1.5-
3 mg/kg/week for 5 to 9 weeks (at cumulative doses of 10-
20 mg/kg) were similar to findings in humans. The light
and electron microscopy examination of rat heart resulted
in reports of cytoplasmic vacuolization, myofibril loss,
sarcoplasmic edema, and mitochondrial injury [4,23]. In
our study, the histopathological investigation of the rat heart
revealed marked findings of cardiac injury in the group
receiving DOX. In particular, the interstitial edema (p=0.02),
sarcoplasmic reticulum edema (p=0.002), vacuolization in the
myocytes (p=0.02), and mitochondrial injury (p=0.002) were
statistically significant compared to the control group. While
toxicity findings were also detected in the groups receiving
DOX + L-NAME and DOX + L-NIL, there was no statistically
significant difference compared to the control group.
One of the first trials reported in the literature to
investigate the contribution of NO to DOX-associated
cardiac injury was performed by Guerra et al. Rats were
administered 1.5 mg/kg of DOX for 9 weeks (total dose:
13.5 mg/kg) and the plasma NO levels were measured. The
histopathological investigation of the rat hearts revealed
findings of cardiac injury, and the plasma NO level was
markedly higher compared to the control group. This study
detected a positive correlation between the cardiomyopathy
score and the NO level [11]. Sayed-Ahmed et al. measured
the cardiac NO level after administering a single high dose
(20 mg/kg) and gradually increasing daily doses of DOX (5-
25 mg/kg) in rats. They reported that the cardiac NO levels
were increased in cardiotoxicity induced with DOX at single
and increasing doses. However, they were unable to detect
any increase in the NO level and suggested that NO increase
secondary to DOX was specific to the tissue [10]. In a trial
where the culture of the rat cardiac cell was incubated with
DOX for 24 h, DOX was reported to cause marked increase
in NOS activity in the cells and the amount of NO in the
supernatant, and this increase was inhibited by the addition
of iron. This study concluded that DOX increased NO
synthesis in the cardiomyocytes by affecting iron hemostasis
[12]. However, we could not directly measure cardiac or
plasma NO level due to lack of related laboratory systems.
72

Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity
Turk J Hematol 2014;31:68-74
The cardiac NO increase secondary to DOX was found to
be mediated by iNOS. Aldieri et al. showed that the increase
in the NO amount following treatment of the cardiac cells
with DOX was associated with the increase in the iNOS gene
expression [12]. Pacher et al. demonstrated that following
DOX administration in mice with iNOS gene deletion,
cardiac functions were better conserved [24]. The trial by
Weinstein et al. demonstrated immunohistochemically
that the myocardial iNOS was increased upon DOX
administration [25]. Cardiac iNOS induction was shown to
increase the myocardial injury secondary to oxidative stress
by leading to the inactivation of the glutathione peroxidase,
an intrinsic antioxidant [26].
After the contribution of myocardial NO formation to
DOX cardiotoxicity was shown, the mechanism through
which NO causes myocardial injury has been started to
be investigated. The relevant trials have indicated that NO
contributed to the peroxynitrite formation together with
the superoxide formed by DOX. DOX toxicity is related to
free radical formation. Oxygen and hydroxyl free radicals
are produced via the DOX redox cycle catalyzed by flavor
enzymes such as NADPH, cytochrome P450 reductase,
and mitochondrial NADH dehydrogenase. These enzymes
contribute to cardiomyopathy development secondary to
DOX. NO is structurally similar to P450 reductase and was
suggested to be involved in DOX metabolism [13,14,27].
All 3 isoforms of NOS have the capacity to catalyze
the DOX redox cycle in the tumor tissue and form free
radicals. DOX binds to the reductase domain of e-NOS and
is reduced to the semiquinone form. Semiquinone causes
formation of superoxide by reacting with the oxygen at a
radical rate. All NOS isoforms form superoxide by reducing
DOX under hypoxic conditions [13,14]. The high amount
of NO produced by the iNOS enzyme causes formation of
peroxynitrite by reacting with the superoxide anion. The
resulting peroxynitrite oxides the cellular structures and
contributes to myocardial oxidative injury, apoptosis, and
necrosis by leading to lipid peroxidation [14,26,28,29].
Various studies demonstrated that NOS inhibitors
prevented DOX cardiotoxicity. Administration of
aminoguanidine, an iNOS inhibitor, with DOX to rats
reduced the DOX mortality and acid formation and enhanced
the histopathological changes in the rat heart [30]. Similarly,
a trial by Pacher et al., performed on mice that were
administered DOX in combination with aminoguanidine,
showed a reduction in the cardiac dysfunction and mortality
induced by DOX and improvement of the histopathological
changes in the cardiac tissue [24]. Barnabe et al. added
NOS inhibitors L-NAME and NG-monomethyl-L-arginine
(L-NMMA) to medium before incubation with DOX in their
study on cell cultures obtained from neonatal rat cardiac
myocytes. They reported that pre-treatment administration
of L-NAME and L-NMMA could prevent the myocyte
injury associated with DOX [31]. In our study, we also
observed reduction in the histopathological toxicity findings
associated with DOX by L-NIL, a specific-selective iNOS
inhibitor, and L-NAME, a nonspecific NOS inhibitor.
Packer et al. showed that MDA increased in the
cardiac tissue as the lipid peroxidation product in
mice that were administered DOX and were detected
to have impairment in the left ventricle function; FP15,
a peroxynitrite decomposition catalyst, prevented this
increase [24]. In their trials, Fadılloğlu et al. administered
an antioxidant, erdosteine, as a protective agent together
with DOX, and they observed a marked increase in lipid
peroxidation in the plasma and platelets in the group
receiving DOX alone. Administration of erdosteine with
DOX was shown to prevent intracellular and extracellular
lipid peroxidation, thus exhibiting a protective effect.
In addition, erdosteine was considered to inhibit the
iNOS enzyme, thereby preventing NO production and
thus peroxidation formation [32,33]. In our study, we
also observed significantly increased MDA levels (a lipid
peroxidation product) in rats receiving DOX relative to
the control group. The L-NAME and L-NIL groups had a
statistically significantly decreased MDA level compared to
the DOX group. This represents a finding supporting the
hypothesis that prevention of NO synthesis is protective
against DOX cardiotoxicity.
Conclusion
The assessment of both our results and the literature data
suggest that NO, and especially that produced by iNOS, was
involved in cardiac toxicity by leading to lipid peroxidation
via peroxynitrite formation. An attempt to prevent NO
production via inhibition of iNOS may be a solution for
cardiac toxicity due to DOX in humans.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
1. Minotti G, Menna P, Salvatorelli E, Cairo G, Gianni L.
Anthracyclines: molecular advances and pharmacologic
developments in antitumor activity and cardiotoxicity.
Pharmocol Rev 2004;56:185-229.
2. Paulides M, Kremers A, Stöhr W, Bielack S, Jürgens
H, Treuner J, Beck JD, Langer T; German Late Effects
Working Group in the Society of Pediatric Oncology and
Haematology (GPOH). Prospective longitudinal evaluation
of doxorubicin-induced cardiomyopathy in sarcoma
patients: a report of the late effects surveillance system
(LESS). Pediatr Blood Cancer 2006;46:489-495.
3. Kremer LC, van Dalen EC, Offringa M, Ottenkamp J, Voûte
PA. Anthracycline-induced clinical heart failure in a cohort
of 607 children: long-term follow-up study. J Clin Oncol
2001;19:191-196.
4. Doroshow JH. Effect of anthracycline antibiotics on oxygen
radical formation in rat heart. Cancer Res 1983;43:460-472.
5. Keizer HG, Pinedo HM, Schuurhuis GJ, Joenje H. Doxorubicin
(adriamycin): a critical review of free radical-dependent
mechanisms of cytotoxicity. Pharmacol Ther 1990;47:219-231.
73

Turk J Hematol 2014;31:68-74
Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity
6. Iarussi D, Indolfi P, Casale F, Coppolino P, Tedesco MA, Di
Tullio MT. Recent advances in the prevention of anthracycline
cardiotoxicity in childhood. Curr Med Chem 2001;8:1649-
1660.
7. Morishima I, Matsui H, Mukawa H, Hayashi K, Toki Y,
Okumura K, Ito T, Hayakawa T. Melatonin, a pineal hormone
with antioxidant property, protects against adriamycin
cardiomyopathy in rats. Life Sci 1998;63:511-521.
8. Villani F, Galimberti M, Monti E, Piccinini F, Lanza E, Rozza
A, Favalli L, Poggi P, Zunino F. Effect of glutathione and
N-acetylcysteine on in vitro and in vivo cardiac toxicity of
doxorubicin. Free Radic Res Commun 1990;11:145-151.
9. Vallance P, Hingorani A. Endothelial nitric oxide in humans in
health and disease. Int J Exp Pathol 1999;80:291-303.
10. Sayed-Ahmed MM, Khattab MM, Gad MZ, Osman AM.
Increased plasma endothelin-1 and cardiac nitric oxide during
doxorubicin-induced cardiomyopathy. Pharmacol Toxicol
2001;89:140-144.
11. Guerra J, De Jesus A, Santiago-Borrero P, Roman-Franco A,
Rodríguez E, Crespo MJ. Plasma nitric oxide levels used as
an indicator of doxorubicin-induced cardiotoxicity in rats.
Hematol J 2005;5:584-588.
12. Aldieri E, Bergandi L, Riganti C, Costamagna C, Bosia A, Ghigo
D. Doxorubicin induces an increase of nitric oxide synthesis
in rat cardiac cells that is inhibited by iron supplementation.
Toxicol Appl Pharmacol 2002;85:85-90.
13. Vásquez-Vivar J, Martasek P, Hogg N, Masters BS, Pritchard
KA Jr, Kalyanaraman B. Endothelial nitric oxide synthasedependent
superoxide generation from adriamycin.
Biochemistry 1997;36:11293-11297.
14. Garner AP, Paine MJ, Rodriguez-Crespo I, Chinje EC, Ortiz
De Montellano P, Stratford IJ, Tew DG, Wolf CR. Nitric
oxide synthases catalyze the activation of redox cycling and
bioreductive anticancer agents. Cancer Res 1999;59:1929-
1934.
15. Habib FM, Springall DR, Davies GJ, Oakley CM, Yacoub MH,
Polak JM. Tumour necrosis factor and inducible nitric oxide
synthase in dilated cardiomyopathy. Lancet 1996;347:1151-
1155.
16. Balligand JL, Cannon PJ. Nitric oxide synthases and cardiac
muscle. Autocrine and paracrine influences. Arterioscler
Thromb Vasc Biol 1997;17:1846-1858.
17. Moncada S. Nitric oxide: discovery and impact on clinical
medicine. J R Soc Med 1999;92:164-169.
18. Palmer RM, Ferrige AG, Moncada S. Nitric oxide release
accounts for the biological activity of endothelium-derived
relaxing factor. Nature 1987;327:524-526.
19. Kröncke KD, Fehsel K, Kolb-Bachofen V. Inducible nitric
oxide synthase in human diseasesc. Clin Exp Immunol
1998;113:147-156.
20. Kalivendi SV, Kotamraju S, Zhao H, Joseph J, Kalyanaraman
B. Doxorubicin-induced apoptosis is associated with increased
transcription of endothelial nitric-oxide synthase. Effect
of antiapoptotic antioxidants and calcium. J Biol Chem
2001;276:47266-47276.
21. Deng S, Kruger A, Schmidt A, Metzger A, Yan T, Gödtel-
Armbrust U, Hasenfuss G, Brunner F, Wojnowski L. Differential
roles of nitric oxide synthase isozymes in cardiotoxicity and
mortality following chronic doxorubicin treatment in mice.
Naunyn Schmiedebergs Arch Pharmacol 2009;380:25-34.
22. Hirano S, Wakazono K, Agata N, Iguchi H, Tone H. Comparison
of cardiotoxicity of pirarubicin, epirubicin and doxorubicin in
the rat. Drugs Exp Clin Res 1994;20:153-160.
23. Zhou S, Starkov A, Froberg MK, Leino RL, Wallace KB.
Cumulative and irreversible cardiac mitochondrial dysfunction
induced by doxorubicin. Cancer Res 2001;61:771-777.
24. Pacher P, Liaudet L, Bai P, Mabley JG, Kaminski PM, Virág L,
Deb A, Szabó E, Ungvári Z, Wolin MS, Groves JT, Szabó C.
Potent metalloporphyrin peroxynitrite decomposition catalyst
protects against the development of doxorubicin-induced
cardiac dysfunction. Circulation 2003;107:896-910.
25. Weinstein DM, Mihm MJ, Bauer JA. Cardiac peroxynitrite
formation and left ventricular dysfunction following
doxorubicin treatment in mice. J Pharmacol Exp Ther
2000;294:396-401.
26. Igarashi J, Nishida M, Hoshida S, Yamashita N, Kosaka H,
Hori M, Kuzuya T, Tada M. Inducible nitric oxide synthase
augments injury elicited by oxidative stress in rat cardiac
myocytes. Am J Physiol 1998;274:245-252.
27. Drummond GR, Cai H, Davis ME, Ramasamy S, Harrison
DG. Transcriptional and posttranscriptional regulation of
endothelial nitric oxide synthase expression by hydrogen
peroxide. Circ Res 2000;86:347-354.
28. Radi R, Beckman JS, Bush KM, Freeman BA. Peroxynitrite
oxidation of sulfhydryls. The cytotoxic potential of superoxide
and nitric oxide. J Biol Chem 1991;266:4244-4250.
29. Adams V, Jiang H, Yu J, Möbius-Winkler S, Fiehn E, Linke
A, Weigl C, Schuler G, Hambrecht R. Apoptosis in skeletal
myocytes of patients with chronic heart failure is associated
with exercise intolerance. J Am Coll Cardiol 1999;33:959-
965.
30. Mostafa AM, Nagi MN, Al Rikabi AC, Al-Shabanah OA,
El-Kashef HA. Protective effect of aminoguanidine against
cardiovascular toxicity of chronic doxorubicin treatment in
rats. Res Commun Mol Pathol Pharmocol 1999;106:193-
202.
31. Barnabé N, Marusak RA, Hasinoff BB. Prevention of
doxorubicin-induced damage to rat heart myocytes by
arginine analog nitric oxide synthase inhibitors and their
enantiomers. Nitric Oxide 2003;9:211-216.
32. Fadillioglu E, Erdoğan H. Effects of erdosteine treatment
against doxorubicin-induced toxicity through erythrocyte
and plasma oxidant/antioxidant status in rats. Pharmocol
Res 2003;47:317-322.
33. Fadillioglu E, Yilmaz HR, Erdogan H, Sogut S. The activities
of tissue xanthine oxidase and adenosine deaminase and
the levels of hydroxyproline and nitric oxide in rat hearts
subjected to doxorubicin: protective effect of erdosteine.
Toxicology 2003;191:153-158.
74

Case Report
DOI: 10.4274/Tjh.2012.0028
Central Nervous System Involvement of T-cell
Prolymphocytic Leukemia Diagnosed with
Stereotactic Brain Biopsy: Case Report
Stereotaktik Beyin Biyopsisi ile Tanı Koyulan T-hücreli Prolenfositik
Löseminin Santral Sinir Sistemi Tutulumu: Olgu Sunumu
Selçuk Göçmen1, Murat Kutlay2, Alev Erikçi3, Cem Atabey1, Özkan Sayan3, Aptullah Haholu4
1Gülhane Military Medical Academy, Haydarpaşa Training Hospital, Department of Neurosurgery, İstanbul, Turkey
2Gülhane Military Medical Academy, Department of Neurosurgery, Ankara, Turkey
3Gülhane Military Medical Academy, Haydarpaşa Training Hospital, Department of Hematology, İstanbul, Turkey
4Gülhane Military Medical Academy, Haydarpaşa Training Hospital, Department of Pathology, İstanbul, Turkey
Abstract:
Prolymphocytic leukemia (PLL) is a generalized malignancy of the lymphoid tissue characterized by the accumulation
of monoclonal lymphocytes, usually of B cell type. Involvement of the central nervous system (CNS) is an extremely
rare complication of T-cell prolymphocytic leukemia (T-PLL). We describe a case of T-PLL presenting with symptomatic
infiltration of the brain that was histopathologically proven by stereotactic brain biopsy. We emphasize the importance
of rapid diagnosis and immediate treatment for patients presenting with CNS involvement and a history of leukemia or
lymphoma.
Key Words: T-cell prolymphocytic leukemia, Cerebral involvement, Central nervous system, Stereotactic biopsy
Özet:
Prolenfositik lösemi (PLL), genellikle B hücre tipi monoklonal lenfositlerin birikimi ile karakterize lenfoid dokunun
genel malign bir hastalığıdır. Santral sinir sistemi (SSS) tutulumu T-hücreli Prolenfositik löseminin (T-PLL) çok nadir
görülen bir komplikasyonudur. Biz, beyinin semptomatik infiltrasyonu ile ortaya çıkan, stereotaktik beyin biopsisi ile
tanı koyulmuş T-PLL’li bir olgu sunuyoruz. Geçmişte lösemi veya lenfoma nedeni ile tedavi edilmiş ve SSS tutulumu ile
başvuran hastalar için, hızlı tanı ve acil tedavinin önemini açıkladık.
Anahtar Kelimeler: T-hücreli prolenfositik lösemi, Serebral tutulum, Santral sinir sistemi, Stereotaktik biyopsi
Address for Correspondence: Selçuk Göçmen, M.D.,
Gülhane Military Medical Academy, Haydarpaşa Training Hospital, Department of Neurosurgery, İstanbul, Turkey
Phone: +90 216 542 28 15 E-mail: s_gocmen@yahoo.com
Received/Geliş tarihi : February 17, 2012
Accepted/Kabul tarihi : November 06, 2012
75

Turk J Hematol 2014;31:75-78 Göçmen S, et al: T-PLL Presenting with CNS Involvement
Introduction
Symptomatic central nervous system involvement (CNS)
is a rare complication in T-cell prolymphocytic leukemia
(T-PLL), although it is common in acute leukemia and
non-Hodgkin’s lymphoma [1,2,3,4,5]. We report a case of
T-PLL with symptomatic infiltration of the brain that was
histopathologically proven with stereotactic brain biopsy.
Case Report
A 56-year-old man was admitted due to recent onset
of severe headache. He was also noted to have multiple
lymphadenopathy and hepatosplenomegaly. He had a history
of T-PLL diagnosed 2 years ago. Bone marrow aspiration
was a dry tap. Imprint was hypercellular and consisted
of medium-sized prolymphocytes with single nuclei and
basophilic cytoplasm with occasional blebs or projections.
Laboratory data revealed leukocytosis (53x109/mm 3 )
with normal values for hemoglobin (13.8 g/dL) and platelets
(263x10 6 /mm 3 ). Differential blood count revealed 73%
lymphocytes, 25% neutrophils, and 2% monocytes. In the
flow cytometric examination of bone marrow, 80% of the
lymphocytes were T-cells with co-expression of CD5, CD3,
and CD52, as well as weak expression of CD7. No CD4, CD8,
or other B cell markers were detected. β2-Microglobulin
was elevated up to 2519 mg/L (normal:1310 mg/L). Direct
Coombs test was negative and serum immunoglobulins
were within normal limits. T lymphocytes were considered
as leukemic infiltration. Lymphocytes demonstrated normal
morphology. Surface marker analysis showed typical features
of T-cell chronic lymphocytic leukemia (CLL) (83% of the
cells CD3/CD5-positive). Biochemical profile was within
normal limits. Informed consent was obtained.
Bone marrow biopsy revealed hypercellular bone
marrow that was totally infiltrated by immatureappearing
lymphocytes with prominent nucleoli (Figure
1). Immunohistochemical analysis demonstrated CD3
expression of the infiltrating cells (Figure 2). MPO
expression was scarce in the myeloid cells entrapped in the
leukemic infiltrate (Figure 3).
The patient was given 3 courses of systemic chemotherapy
consisting of fludarabine at 30 mg/m2 daily for 3 days
intravenously and cyclophosphamide at 250 mg/m 2 daily
for 3 days on a 28-day cycle. He achieved hematological
remission with no evidence of splenomegaly and had
normal complete blood count values. In the interval between
the third and fourth chemotherapy, the patient, who was
previously asymptomatic, was admitted to the emergency
unit with confusion, dysarthria, urinary incontinence, and
generalized muscle weakness. His neurological examination
was otherwise unremarkable.
Emergency cranial computerized tomography (CT)
was done, showing an infiltrating mass lesion and a right
76
Figure 1. Hypercellular bone marrow infiltrated by the
leukemia.
Figure 2. Immunohistochemistry staining CD3 expression
of the leukemic cells.
Figure 3. MPO expression in entrapped myeloid cells, while
leukemic cells are negative.

Göçmen S, et al: T-PLL Presenting with CNS Involvement
Turk J Hematol 2014;31:75-78
temporal arachnoid cyst. Magnetic resonance imaging
of the brain revealed a focal lesion in the left frontal lobe
with surrounding edema (Figure 4). Finally, the diagnostic
work-up was completed with cervical-thoracic-abdominal
CT that did not reveal any changes with respect to the
patient’s previous condition. A stereotactic brain biopsy was
performed. Brain tissue was also infiltrated by leukemia,
which was especially prominent in the perivascular areas
(Figure 5). Unexpectedly the immunohistochemistry
revealed marked expression of T-cell markers (CD3, CD5,
CD7). At that time, treatment with alemtuzumab was
planned; however, the patient died before treatment could
be started.
Discussion
T-PLL is rare, representing approximately 2% of cases
of mature lymphocytic leukemias in adults over the age of
30, with a median age of 65 at presentation [6]. T-PLL is an
aggressive T-cell leukemia characterized by the proliferation
of small to medium-sized prolymphocytes with a mature
post-thymic T-cell phenotype involving the peripheral blood,
bone marrow, lymph nodes, liver, spleen, and skin [6].
Figure 4. T1-weighted image (A) and T2-weighted magnetic
image (B) show a focal lesion in the left frontal lobe.
Figure 5. Prominently perivascular leukemic infiltration in
the brain.
Most patients present with hepatosplenomegaly and
generalized lymphadenopathy. Skin infiltration is seen in
20% of patients, with occasional serous pleural effusions
[6]. Anemia and thrombocytopenia are common and the
lymphocyte count is usually >100x109/L; it is >200x10 9 /L in
half of the patients [6]. Serum immunoglobulins are normal
[6]. The course of the disease is aggressive, with a median
survival of usually less than 1 year [2]. The disease is often
refractory to conventional chemotherapy (eg., alkylating
agents or CHOP regimens), and it is considered incurable [2].
Direct symptomatic invasion of the CNS by CLL is
extremely rare. To date, less than 30 cases have been reported
in the literature, with various initial clinical manifestations,
including headaches, confusional state, cranial nerve palsies,
optic neuropathy, cerebellar dysfunction, or motor deficits,
most often associated with leukemic meningitis [7]. In
contrast, autopsy series have reported brain or spinal cord
tumoral CLL involvement in 17% to 71% of cases, but with
few clinical correlations [7]. Most of the CNS involvements
were asymptomatic [7]. Garderet et al. reported that all
cases with CNS involvement of PLL are of B cell origin; they
have not been found to be associated with T-PLL. T-PLL
of CNS is treated with non-myeloablative allogeneic stem
cell transplantation [2]. Non-invasive diagnostic imaging
techniques are usually inadequate for diagnosis.
In spite of the most recent advances in diagnostic
imaging, precise histopathological diagnosis is still critical
for optimum treatment of these intracranial lesions. Many
non-neoplastic lesions of the CNS may be misinterpreted to
be tumors due to their clinical and radiological presentation,
with patients subjected to unnecessary surgical treatment,
until histopathological diagnosis is established [8]. Most of
these patients are best managed with medical therapy alone.
Likewise, certain neoplastic processes, such as lymphoma or
germinoma, respond very well to chemotherapy. Surgery is
also of minimal benefit in most brain metastasis or advanced
primary tumors (glioblastoma multiforme). These patients
can be better served with radiation and/or chemotherapy.
Stereotactic needle biopsy is a safe approach to establish
the histopathological diagnosis for most intracranial lesions,
especially for deep-seated, adjacent to eloquent areas, brain
stem, or multiple small lesions [9,10,11]. Patients’ general
medical condition and co-morbidities should also play a role
in preferring stereotactic biopsy over open surgery [11].
Frame-based or frameless image-guided stereotactic
brain biopsies were reported to have high diagnostic yields,
ranging between 85% and 98% [10]. Complication rates
range from 2% to 6.5%, and most complications did not
result in clinically significant consequences [10].
Dammers et al. reported that frame-based and frameless
image-guided stereotactic brain biopsy techniques are not
different (i. e. equivalent) [12]. Reported overall morbidity
rate is 6.9% and mortality rate 1.3% for frame-based
77

Turk J Hematol 2014;31:75-78
Göçmen S, et al: T-PLL Presenting with CNS Involvement
stereotactic biopsy [13]. Intracranial hemorrhage rates from
0% to 9% have been reported in the literature [13]. Framebased
or frameless stereotactic brain biopsy of an intracranial
lesion is a safe surgical technique with high diagnostic yield
and low morbidity and mortality [10,11,12,13]. It should
be the procedure of choice in establishing histopathological
diagnosis and planning the extent of surgical treatment.
CNS leukemia is a rapidly progressive disease with risk of
dismal outcome. Treatment of CNS leukemia is by steroids,
intrathecal or systemic chemotherapy, cranial irradiation, or
a combination of these [14,15,16,17,18]. Nucleoside analogs
and immunotargeting therapies are the most widely used
types of treatment, but the results are frequently temporary.
There is no standard treatment for CNS involvement of
T-cell lymphoid malignancies, and generally this condition
is considered incurable. Our patient had a rare presentation
of relapse appearing in the CNS. Immediate and accurate
histopathological diagnosis is crucial for treatment in
patients presenting with CNS involvement and a history of
leukemia or lymphoma. A stereotactic biopsy should also be
considered for medically unstable patients and patients with
inoperable CNS malignancies.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
1. Kuwabara H, Kanamori H, Takasaki H, Takabayashi M,
Yamaji S, Tomita N, Fujimaki K, Fujisawa S, Ishigatsubo Y.
Involvement of central nervous system in prolymphocytoid
transformation of chronic lymphocytic leukemia. Leuk
Lymphoma 2003;44:1235-1237.
2. Garderet L, Bittencourt H, Kaliski A, Daniel M, Ribaud P,
Socié G, Gluckman E. Treatment of T-prolymphocytic
leukemia with nonmyeloablative allogeneic stem cell
transplantation. Eur J Haematol 2001;66:137-139.
3. Pamuk GE, Puyan FO, Unlü E, Oztürk E, Demir M. The first
case of de novo B-cell prolymphocytic leukemia with central
nervous system involvement: description of an unreported
complication. Leuk Res 2009;33:864-867.
4. Wang ML, Shih LY, Dunn P, Kuo MC. Meningeal involvement
in B-cell chronic lymphocytic leukemia: report of two cases.
J Formos Med Assoc 2000;99:775-778.
5. Brito-Babapulle F, Huang D, Lavender P, Galton D, Catovsky
D. Regression of intracerebral lesions in T prolymphocytic
leukaemia treated with intravenous deoxycoformycin. Eur J
Haematol 1988;40:185-187.
6. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein
H, Thiele J, Vardiman JW. WHO Classification of Tumors
of Hematopoietic and Lymphoid Tissues. 4th ed. Lyon,
France: IARC, 2008:270.
7. Denier C, Tertian G, Ribrag V, Lozeron P, Bilhou-Nabera C,
Lazure T, Abbed K, Lacroix C, Adams D. Multifocal deficits
due to leukemic meningoradiculitis in chronic lymphocytic
leukemia. J Neurol Sci 2009;277:130-302.
8. Aker FV, Hakan T, Karadereler S, Erkan M. Accuracy and
diagnostic yield of stereotactic biopsy in the diagnosis of
brain masses: comparison of results of biopsy and resected
surgical specimens. Neuropathology 2005;25:207-213.
9. Schwartz TH, Sisti MB. Stereotactic biopsy. In: Sekhar LN,
Fessler RG, editors. Atlas of Neurosurgical Techniques:
Brain. 1st ed. New York, Thieme, 2006;422-428.
10. Air EL, Leach JL, Warnick RE, McPherson CM. Comparing
the risks of frameless stereotactic biopsy in eloquent and
noneloquent regions of the brain: a retrospective review of
284 cases. J Neurosurg 2009;111:820-824.
11. Greenberg MS. Handbook of Neurosurgery. 6th ed. New
York, Thieme, 2006;545.
12. Dammers R, Haitsma IK, Schouten JW, Kros JM, Avezaat CJ,
Vincent AJ. Safety and efficacy of frameless and frame-based
intracranial biopsy techniques. Acta Neurochir (Wien)
2008;150:23-29.
13. Kongkham PN, Knifed E, Tamber MS, Bernstein M.
Complications in 622 cases of frame-based stereotactic
biopsy, a decreasing procedure. Can J Neurol Sci 2008;35:79-
84.
14. Miller K, Budke H, Orazi A. Leukemic meningitis
complicating early stage chronic lymphocytic leukemia.
Arch Pathol Lab Med 1997;121:524-527.
15. Cash J, Fehir KM, Pollack MS. Meningeal involvement
in early stage chronic lymphocytic leukemia. Cancer
1987;59:798-800.
16. Law IP, Blom J. Adult central nervous system leukemia:
incidence and clinicopathologic features. South Med J
1976;69:1054-1057.
17. Morrison C, Shah S, Flinn IW. Leptomeningeal involvement
in chronic lymphocytic leukemia. Cancer Pract 1998;6:223-
223-238.
18. Elliott MA, Letendre L, Li CY, Hoyer JD, Hammack JE.
Chronic lymphocytic leukaemia with symptomatic diffuse
central nervous system infiltration responding to therapy
with systemic fludarabine. Br J Haematol 1999;104:689-
694.
78

Case Report
DOI: 10.4274/Tjh.2012.0010
Epstein-Barr Virus-Negative Post-Transplant
Lymphoproliferative Diseases: Three Distinct
Cases from a Single Center
Epstein-Barr Virüs-Negatif Post-Transplant Lenfoproliferatif
Hastalık: Tek Merkezden Üç Farklı Olgu
Şule Mine Bakanay¹, Gülşah Kaygusuz2, Pervin Topçuoğlu¹, Şule Şengül3,Timur Tunçalı4, Kenan Keven3,
Işınsu Kuzu2, Akın Uysal¹, Mutlu Arat¹
1Ankara University School of Medical, Department of Hematology, Ankara, Turkey
2Ankara University School of Medical, Department of Pathology, Ankara, Turkey
3Ankara University School of Medical, Department of Nephrology, Ankara, Turkey
4Ankara University School of Medical, Department of Medical Genetics, Ankara, Turkey
Abstract:
Three cases of Epstein-Barr virus (EBV)-negative post-transplant lymphoproliferative disease that occurred 6 to 8 years after
renal transplantation are reported. The patients respectively had gastric mucosa-associated lymphoid tissue lymphoma, gastric
diffuse large B-cell lymphoma, and atypical Burkitt lymphoma. Absence of EBV in the tissue samples was demonstrated by both
in situ hybridization for EBV early RNA and polymerase chain reaction for EBV DNA. Patients were treated with reduction in
immunosuppression and combined chemotherapy plus an anti-CD20 monoclonal antibody, rituximab. Despite the reduction
in immunosuppression, patients had stable renal functions without loss of graft functions. The patient with atypical Burkitt
lymphoma had an abnormal karyotype, did not respond to treatment completely, and died due to disease progression. The other
patients are still alive and in remission 5 and 3 years after diagnosis, respectively. EBV-negative post-transplant lymphoproliferative
diseases are usually late-onset and are reported to have poor prognosis. Thus, reduction in immunosuppression is usually not
sufficient for treatment and more aggressive approaches like rituximab with combined chemotherapy are required.
Key Words: Renal transplantation, Post-transplant lymphoproliferative disease, Lymphoma, Immunosuppression, Rituximab,
Abnormal karyotype
Özet:
Böbrek naklinden 6-8 yıl sonra Epstein-Barr virus (EBV) negatif posttransplant lenfoproliferatif hastalık geliştiren 3 olgu rapor
edilmektedir. Hastaların tanıları gastrik MALT lenfoma, gastrik diffüz büyük B hücreli lenfoma ve atipik-burkitt lenfoma idi.
Hem EBV early RNA için yapılan in-situ hibridizasyon yöntemi hem de EBV DNA için yapılan polimeraz zincir reaksiyonu
ile doku örneklerinde EBV saptanamamıştır. Hastalara immünsupresyonun azaltılması ile birlikte rituksimab içeren kombine
kemoterapi protokolleri verilmiştir. İmmünsupresyonun azaltılmasına rağmen böbrek fonksiyonlarında önemli bir kayıp
gözlenmemiştir. Anormal karyotipe sahip atipik Burkitt lenfomalı hasta tedaviye rağmen hastalık ilerlemesi ile erken dönemde
kaybedilmiştir. Diğer hastalar hala remisyonda takip edilmektedir. EBV negatif posttransplant lenfoproliferatif hastalıkların
genellikle geç başlangıçlı ve kötü prognozlu olduğu bilinmektedir. Bu hastalarda immünsupresyonun azaltılması tek başına
yeterli bir tedavi olmadığı gibi rituksimab içeren kombine kemoterapilerle daha agresif tedaviler gerekli olmaktadır.
Anahtar Sözcükler: Böbrek nakli, Posttransplant lenfoproliferatif hastalık, Lenfoma, İmmünsupresyon, Rituksimab,
Anormal karyotip
Address for Correspondence: Şule Mine Bakanay, M.D.,
Ankara University School of Medical, Department of Hematology, Ankara, Turkey
GSM: +90 312 291 25 25/4812 E-mail: sulemine.ozturk@yahoo.com
Received/Geliş tarihi : January 14, 2012
Accepted/Kabul tarihi : November 22, 2012
79

Turk J Hematol 2014;31:79-83
Bakanay MŞ et al: Post-Transplant Lymphproliferative Disease
80
Introduction
Post-transplant lymphoproliferative diseases (PTLDs)
are a heterogeneous group of diseases that develop as
early or late-onset disease in solid organ or bone marrow
transplant recipients with an incidence ranging between
1% and 20% [1,2]. It is reported that in renal transplant
recipients PTLD is the second most common malignancy
after skin cancer [3,4,5]. Pathogenesis of PTLD is not
well understood. Epstein-Barr virus (EBV) infection and
prolonged immunosuppression (IS) are the 2 major factors
in pathogenesis. Inhibition of cytotoxic T-cell functions
due to IS removes the control over EBV-infected B cells,
which results in expansion of B cells, acquisition of genetic
mutations, and clonal proliferation [6,7]. The highest risk of
developing PTLD is within the first year after transplantation.
EBV is found to be positive in 60%-80% of PTLDs and is
usually associated with early-onset PTLD. However, EBVnegative
PTLD is mainly late-onset [8,9,10,11,12].
Three patients who had received renal transplantation at
other centers were admitted to our department, where they
received the diagnosis of PTLD and were further followed.
The presence of EBV could not be demonstrated in any of
the samples by in situ hybridization for EBV early RNA or
polymerase chain reaction (PCR) analysis of EBV DNA.
Informed consent was obtained.
Case Reports
Case 1
A 28-year-old female patient was diagnosed with
Helicobacter pylori (HP)-positive gastric mucosa-associated
lymphoid tissue (MALT) lymphoma (stage IE) 6 years
after receiving renal transplantation from her mother.
She had been on mycophenolate mofetil, tacrolimus, and
prednisolone for the last 3 years. After the diagnosis of
lymphoma, the immunosuppressive therapy was modified
with cessation of mycophenolate mofetil and dose reduction
of tacrolimus. The patient received HP eradication therapy
and was followed with endoscopic biopsies every 3 months.
The HP infection was persistent and all biopsies supported
the presence of a MALT lymphoma histologically. One
year after the diagnosis, IgH chain clonality analysis by
nested PCR revealed 2 separate clones on the polyclonal
background, which was consistent with oligoclonal
proliferation. The follow-up endoscopy revealed a larger
ulcer and the pathology revealed MALT lymphoma
invading the muscularis mucosa (Figure 1). The patient
responded to combined chemotherapy with rituximab,
cyclophosphamide, vincristine, and methyl prednisolone
(R-CVP). Five years after diagnosis, she is being followed
in complete remission. She is on prednisolone at 5 mg/day
per os and tacrolimus at 2 mg/day per os, and her renal
functions are stable with serum creatinine levels in the
range of 1.3-1.6 mg/dL.
Case 2
A 31-year-old male patient presented with anemia due to
chronic blood loss from the gastrointestinal tract. Endoscopic
examination revealed a large ulcerated mass of the stomach. A
computerized tomography (CT) scan demonstrated an 8.5x4
cm mass extending outside the stomach wall, suggesting an
aggressive lymphoma, but endoscopic biopsy revealed MALT
lymphoma with lambda monoclonal atypical B cell infiltration.
The patient had received renal transplantation 7 years before
diagnosis and had been on immunosuppressive therapy with
cyclosporine A, azathioprine, and prednisolone since then.
After the diagnosis of stage IE PTLD, IS drugs were tapered
and stopped. Anti-HP treatment and 6 cycles of combined
chemotherapy with R-CVP were administered. Prednisolone
at 5 mg/day was resumed due to the deterioration of his renal
functions. A CT scan of the abdomen revealed thickening
of the stomach wall and perigastric lymphadenopathy. The
endoscopy demonstrated the persistence of the giant ulcer
in the stomach, with the biopsy revealing diffuse large B-cell
lymphoma (DLBCL) (Figure 2). He was treated with total
gastrectomy followed by combined chemotherapy with
rituximab, cyclophosphamide, vincristine, doxorubicin, and
methyl prednisolone, and he is in complete remission 3 years
after diagnosis. His serum creatinine levels are in the range of
1.5-2.0 mg/dL with prednisolone at 5 mg/day every other day.
Case 3
A 28-year-old male patient was admitted to the hospital
with ptosis of the left eyelid, diplopia, and extreme sweating
for the last few weeks. He had received a renal allograft
from a living donor 8 years before. The immunosuppressive
regimen consisted of azathiopurine, cyclosporine A, and
prednisolone. His complete blood count revealed a white
blood cell count of 11.3x109/L, hemoglobin of 15.3 g/dL, and
platelet count of 49x10 9 /L. On the peripheral blood smear,
60% of the leukocytes were atypical lymphoid cells with
Figure 1. MALT lymphoma. Small monocytoid lymphocytes
and some plasma cells in the lamina propria of the gastric
mucosa (1a, 1b, 1c). These cells were diffusely positive for
CD20 and CD79a, forming a lymphoepithelial lesion. Kappa
light chain restriction was demonstrated on neoplastic cells.
Bcl10 was negative by immunohistochemistry.

Bakanay MŞ et al: Post-Transplant Lymphproliferative Disease
Turk J Hematol 2014;31:79-83
cytoplasmic vacuoles. Bone marrow examination revealed
the diagnosis of atypical Burkitt lymphoma (aBL) (Figure
3). Flow cytometric analysis revealed that the immature cells
were positive for HLA-DR and the B cell antigens CD19,
CD10, cytoplasmic CD22 (+/-), surface CD22, FMC7,
CD52, cytoplasmic CD79a, and surface IgM (+/-), and were
negative for T-cell antigen CD5. The patient had a complex
karyotype consisting of clonal trisomy X, add1 (q25), t(3;6)
(q23;q23), trisomy 7, t(8;14) (q22;q32), der (10), der
(11), der (16), trisomy 18, trisomy 20, and monosomy 22.
Fluorescence in situ hybridization analysis revealed positive
results for t(8;14), trisomy 7, and MLL gene amplification.
Cerebrospinal fluid examination was negative for malignanTcells
but the magnetic resonance imaging of the brain
showed disease infiltration at multiple sites. The patient
was treated with discontinuation of the immunosuppressive
drugs and with combined chemotherapy that contained
rituximab, cyclophosphamide, vincristine, dexamethasone,
and L-asparaginase. Central nervous system disease was
treated with 6 courses of intrathecal chemotherapy followed
Figure 2. Diffuse large B cell lymphoma diffusely infiltrating
the stomach wall. There were also cells that had anaplastic
features (2a, 2b). The tumor cells were positive for CD20,
were partially positive for MUM-1 and Bcl-6, and had a high
proliferation index of around 60% with Ki-67.
Figure 3. Atypical Burkitt lymphoma. Atypical cells infiltrating
the bone marrow had large cytoplasmic vacuoles consistent
with L3 morphology (3a, 3b, 3c). The cells were positively
stained with CD20, CD79a, and Bcl-6, and were negative for
MUM-1 and Bcl-2. The proliferation index examined by Ki-
67 was around 100%.
by cranial irradiation. His renal functions remained within
normal ranges. There was a dramatic clinical response after
cessation of IS and initiation of the chemotherapy, and the
follow-up bone marrow biopsy after chemotherapy did
not reveal any atypical cells. However, several weeks after
discharge, he died of disease progression in the central
nervous system and medullary relapse.
Discussion
Three patients with PTLD demonstrating distinct
pathologies as well as distinct clinical properties are
reported. In all patients, the PTLD occurred long after renal
transplantation, and all were EBV-negative. Post-transplant
lymphoproliferative diseases may occur as early-onset (≤1
year) or late-onset (>1 year) disease after transplantation
[9]. Studies comparing EBV-positive and EBV-negative
PTLD patients have demonstrated that EBV-negative PTLD
occurred later than EBV-positive PTLD [9,10,14,15,16]. The
rarity and the heterogeneity of the disease have prevented
large randomized studies to compare the overall survival and
treatment outcomes. While some of the studies have shown
significantly decreased survival of EBV-negative patients,
others could not demonstrate a survival difference [3,9,10,15].
Leblond et al. reported that median survival of EBV-negative
patients was significantly shorter than that of EBV-positive
patients (1 month vs. 37 months) and identified EBV negativity
as an adverse prognostic indicator [9]. On the other hand, Tsai
et al. could not demonstrate any significant difference between
EBV-positive and EBV-negative PTLD patients both in terms
of response to reduction in IS and estimated 1-year overall
survival (68% vs. 60% for EBV-positive and EBV-negative
groups, respectively) [3]. In accordance with these reports,
our cases also had different outcomes: patients 1 and 2 are still
alive without disease, while patient 3 had incomplete response
to therapy and poor survival.
Post-transplant lymphoproliferative diseases are very
heterogeneous, ranging from early lesions like infectious
mononucleosis-like disease to monoclonal monomorphic
diseases like malignant lymphomas. The most common
type of monomorphic PTLD is DLBCL [14,15]. On the
other hand, MALT lymphoma and atypical or Burkitt-like
lymphoma are very rarely observed as PTLD [12,13,14].
Immunohistochemical studies demonstrate that PTLD
lesions presenting as DLBCL usually express a late germinal
center (CD10+/-/bcl-6+/MUM-1-/CD138-) or early postgerminal
center (CD10-/bcl-6+\-/MUM-1+/CD138+) profile,
but the germinal center profile is more commonly expressed
in EBV-negative cases. This may suggest that EBV-negative
PTLDs actually resemble the lymphomas that develop in
immunocompetent hosts [7,17].
Burkitt lymphoma (BL) or aBL patients typically present
with advanced-stage disease and high tumor burden with
generalized lymphadenopathy and frequent bone marrow
involvement. Typical BL usually has c-myc rearrangement
81

Turk J Hematol 2014;31:79-83
Bakanay MŞ et al: Post-Transplant Lymphproliferative Disease
as a sole abnormality. Complex chromosomal abnormalities
in addition to c-myc are reported in patients with aggressive
B-cell lymphoma with features intermediate between DLBCL
and BL, which is also referred to as aBL. In accordance with
the literature, patient 3 had very aggressive disease and did
not respond to the therapy well [18,19,20,21].
Helicobacter pylori can be demonstrated in the gastric
mucosa in a majority of MALT lymphomas, and HP
eradication with antibiotics usually results in complete
regression. It is not clear whether the risk of MALT
lymphoma is increased due to immunosuppression after
solid organ transplantation or if it is completely due to HP
infection, or both. Similar to case 1, the reported cases in the
literature were all negative for EBV and positive for HP, and
most developed as late-onset PTLD. They were clinically and
histologically identical to conventional MALT lymphomas,
which occur in immunocompetent patients [22,23].
Although most post-transplant MALT lymphomas are
clinically indolent and do not require aggressive treatment,
it is not known whether anti-HP therapy alone is sufficient
to treat the post-transplant gastric lymphomas. Nelson et
al., in their series of PTLD, reported that a single gastric
PTLD that could represent a high-grade MALT lymphoma
responded to only reduction in IS [11]. However, our patient
did not sufficiently respond to reduction in IS and anti-HP
therapy and eventually required combined chemotherapy.
Reduction in IS should be the first line of approach in
treatment of PTLD [3]. In the case of kidney transplantation,
it is recommended that immunosuppressive therapy should
be reduced to a minimum dosage and even ceased as long as
the graft rejection is compatible with life. Early lesions and
polymorphic PTLD have favorable response to reduction
in IS alone, but the monoclonal/monomorphic forms
require more aggressive treatment. During the last decade,
anti-CD20 monoclonal antibody, rituximab, has become
increasingly used in the treatment of CD20+ PTLD with
better response rates of up to 60%-70%. Patients who do
not respond to reduction in IS and rituximab can be given
combined chemotherapy. However, combined chemotherapy
with rituximab should be considered as first-line therapy for
patients who are not suitable for reduction in IS or who have
EBV-negative, late-onset aggressive disease, or for patients
who have high tumor burden requiring an upfront rapid
intervention [24,25,26,27,28]. In conclusion, EBV-negative
PTLDs can be considered as a distinct group of PTLD
resembling lymphomas of immunocompetent subjects due
to late occurrence, higher proportion of monomorphic
cases, and clinically more aggressive behavior.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
82
References
1. Penn I. Cancers complicating organ transplantation. N Engl
J Med 1990;323:1767-1769.
2. Opelz G, Henderson R. Incidence of non-Hodgkin
lymphoma in kidney and heart transplant recipients. Lancet
1993;342:1514-1516.
3. Tsai DE, Hardy CL, Tomaszewski JE, Kotloff RM, Oltoff KM,
Somer BG, Schuster SJ, Porter DL, Montone KT, Stadtmauer
EA. Reduction in immunosuppression as initial therapy for
posttransplant lymphoproliferative disorder: analysis of
prognostic variables and long-term follow-up of 42 adult
patients. Transplantation 2001;71:1076-1088.
4. Penn I. Cancers in renal transplant recipients. Adv Ren
Replace Ther 2000;7:147-156.
5. Winkelhorst JT, Brokelman WJ, Tiggeler RG, Wobbes T.
Incidence and clinical course of de-novo malignancies in
renal allograft recipients. Eur J Surg Oncol 2001;27:409-413.
6. Lim WH, Russ GR, Coates PT. Review of Epstein-Barr virus
and post-transplant lymphoproliferative disorder post-solid
organ transplantation. Nephrology (Carlton) 2006;11:355-
366.
7. Capello D, Rossi D, Gaidano G. Post-transplant
lymphoproliferative disorders: molecular basis of
disease histogenesis and pathogenesis. Hematol Oncol
2005;23:61-67.
8. Thompson MP, Kurzrock R. Epstein-Barr virus and cancer.
Clin Cancer Res 2004;10:803-821.
9. Leblond V, Davi F, Charlotte F, Dorent R, Bitker MO, Sutton
L, Gandjbakhch I, Binet JL, Raphael M. Posttransplant
lymphoproliferative disorders not associated with Epstein-
Barr virus: a distinct entity? J Clin Oncol 1998;16:2052-2059.
10. Nelson BP, Nalesnik MA, Bahler DW, Locker J, Fung JJ,
Swerdlow SH. Epstein-Barr virus-negative post-transplant
lymphoproliferative disorders: a distinct entity? Am J Surg
Pathol 2000;24:375-385.
11. Dotti G, Fiocchi R, Motta T, Gamba A, Gotti E, Gridelli
B, Borleri G, Manzoni C, Viero P, Remuzzi G, Barbui T,
Rambaldi A. Epstein-Barr virus-negative lymphoproliferate
disorders in long-term survivors after heart, kidney, and
liver transplant. Transplantation 2000;69:827-833.
12. Jaffe ES, Harris N, Stein H, Vardiman JW (eds). WHO
Classification of Neoplastic Diseases of the Hematopoietic
and Lymphoid Tissues. Lyon, IARC Press, 2001.
13. Weissmann DJ, Ferry JA, Harris NL, Louis DN, Delmonico F,
Spiro I. Posttransplantation lymphoproliferative disorders in
solid organ recipients are predominantly aggressive tumors
of host origin. Am J Clin Pathol 1995;103:748-755.
14. Knight JS, Tsodikov A, Cibrik DM, Ross CW, Kaminski MS,
Blayney DW. Lymphoma after solid organ transplantation:
risk, response to therapy, and survival at a transplantation
center. J Clin Oncol 2009;27:3354-3362.

Bakanay MŞ et al: Post-Transplant Lymphproliferative Disease
Turk J Hematol 2014;31:79-83
15. Ghobrial IM, Habermann TM, Maurer MJ, Geyer SM,
Ristow KM, Larson TS, Walker RC, Ansell SM, Macon WR,
Gores GG, Stegall MD, McGregor CG. Prognostic analysis
for survival in adult solid organ transplant recipients with
post-transplantation lymphoproliferative disorders. J Clin
Oncol 2005;23:7574-7582.
16. Nalesnik MA. Clinicopathologic features of posttransplant
lymphoproliferative disorders. Ann Transplant 1997;2:33-
40.
17. Johnson LR, Nalesnik MA, Swerdlow SH. Impact of
Epstein-Barr virus in monomorphic B-cell posttransplant
lymphoproliferative disorders: a histogenetic study. Am J
Surg Pathol 2006;30:1604-1612.
18. Ferrari A, Perotti D, Giardini R, Ghio L, Riva S, Massimino
M. Disseminated Burkitt’s lymphoma after kidney
transplantation: a case report in a boy with Drash syndrome.
J Pediatr Hematol Oncol 1997;19:151-155.
19. Nathanson S, Lucidarme N, Landman-Parker J, Deschenes
G. Long-term survival of renal graft complicated with
Burkitt lymphoma. Pediatr Nephrol 2002;17:1066-1068.
20. Xicoy B, Ribera JM, Esteve J, Brunet S, Sanz MA, Fernández-
Abellán P, Feliu E. Post-transplant Burkitt’s leukemia or
lymphoma. Study of five cases treated with specific intensive
therapy (PETHEMA ALL-3/97 trial). Leuk Lymphoma
2003;44:1541-1543.
21. Gong JZ, Stenzel TT, Bennett ER, Lagoo AS, Dunphy CH,
Moore JO, Rizzieri DA, Tepperberg JH, Papenhausen P,
Buckley PJ. Burkitt lymphoma arising in organ transplant
recipients: a clinicopathologic study of five cases. Am J Surg
Pathol 2003;27:818-827.
22. Hsi ED, Singleton TP, Swinnen L, Dunphy CH, Alkan
S. Mucosa-associated lymphoid tissue-type lymphomas
occurring in post-transplantation patients. Am J Surg Pathol
2000;24:100-106.
23. Wotherspoon AC, Diss TC, Pan L, Singh N, Whelan J,
Isaacson PG. Low grade gastric B-cell lymphoma of mucosa
associated lymphoid tissue in immunocompromised
patients. Histopathology 1996;28:129-134.
24. Blaes AH, Peterson BA, Bartlett N, Dunn DL, Morrison
VA. Rituximab therapy is effective for posttransplant
lymphoproliferative disorders after solid organ
transplantation: results of a phase II trial. Cancer
2005;104:1661-1667.
25. Choquet S, Leblond V, Herbrecht R, Socié G, Stoppa AM,
Vandenberghe P, Fischer A, Morschhauser F, Salles G,
Feremans W, Vilmer E, Peraldi MN, Lang P, Lebranchu Y,
Oksenhendler E, Garnier JL, Lamy T, Jaccard A, Ferrant
A, Offner F, Hermine O, Moreau A, Fafi-Kremer S, Morand
P, Chatenoud L, Berriot-Varoqueaux N, Bergougnoux
L, Milpied N. Efficacy and safety of rituximab in B-cell
post-transplantation lymphoproliferative disorders:
results of a prospective multicenter phase 2 study. Blood
2006;107:3053-3057.
26. Elstrom RL, Andreadis C, Aqui NA, Ahya VN, Bloom RD,
Brozena SC, Olthoff KM, Schuster SJ, Nasta SD, Stadtmauer
EA, Tsai DE. Treatment of PTLD with rituximab or
chemotherapy. Am J Transplant 2006;6:569-576.
27. Svoboda J, Kotloff R, Tsai DE. Management of patients with
post-transplant lymphoproliferative disorder: the role of
rituximab. Transpl Int 2006;19:259-269.
28. Taylor AL, Bowles KM, Callaghan CJ, Wimperis JZ,
Grant JW, Marcus RE, Bradley JA. Anthracycline-based
chemotherapy as first-line treatment in adults with
malignant posttransplant lymphoproliferative disorder after
solid organ transplantation. Transplantation 2006;82:375-
381.
83

Case Report
DOI: 10.4274/Tjh.2012.0044
Serum Level of Lactate Dehydrogenase is a Useful Clinical
Marker to Monitor Progressive Multiple
Myeloma Diseases: A Case Report
Progresif Multiple Myeloma Hastalığında Serum Laktat
Dehidrogenaz Düzeyi Kullanışlı Bir Klinik Belirteçdir:
Bir Olgu Sunumu
Hava Üsküdar Teke1, Mustafa Başak2, Deniz Teke3, Mehmet Kanbay4
1Kayseri Education and Research Hospital, Department of Hematology, Kayseri, Turkey
2Kayseri Education and Research Hospital, Department of Internal Medicine, Kayseri, Turkey
3Kayseri Education and Research Hospital, Department of Cardiology, Kayseri, Turkey
4Kayseri Education and Research Hospital, Department of Nephrology, Kayseri, Turkey
Abstract:
To follow the progression of multiple myeloma (MM) disease, serum lactate dehydrogenase (LDH) levels are as useful markers
as beta-2 microglobulin and monoclonal immunoglobulin. With this study, we have presented a case of a patient with a multiple
myeloma which was fulminant course, whose LDH levels were normal at the onset of diagnosis increasing as 27 times more than
normal as the disease progressed and who showed the development of extramedullary plasmacytomas. The patient, an 80-yearold
female, was diagnosed with stage IIIA IgA type multiple myeloma and melphalan-prednisolon (MP) treatment was started.
Although the LDH levels were low during the diagnosis and chemotherapy, the LDH levels increased up to 7557 U/L following
the progression and occurrence of extramedullary plasmacytomas and the patient died. During the observation of the patient
with MM, if the LDH levels are abnormally high, the progression of the disease should be considered after eliminating the other
causes. Bone marrow aspiration and biopsy should be examined and the progression or relapse should be shown. On the other
hand, the patients with LDH levels are high should be considered to have added plasmacytomas, the whole body should be
examined at an early stage before the development of clinical symptoms and early treatment should be started.
Key Words: Multiple myeloma, LDH, Prognosis
Özet:
Serum laktat dehidrogenaz (LDH) düzeyleri, multiple myeloma (MM) hastalık ativitesinin takibi için beta-2 mikroglobulin ve
monoklonal immunglobulin kadar kullanışlı bir markırdır. Bu yazıda tanı aşamasında LDH değerleri normal iken, takibinde LDH
seviyeleri normalin 27 katı kadar artan ve ekstramedüller plazmasitom gelişen, fulminan seyirli bir multiple myeloma olgusunu
sunduk. Seksen yaşındaki bayan hasta, Evre3A IgA tipi multiple myeloma tanısı konularak MP (melphalan-prednizolon) tedavisi
başlanan hasta, tanı dönemi ve kemoterapi süresince LDH düzeyleri düşük seyretmesine rağmen progresyon sonrası ve kliniğe
eklenen ekstramedüller plazmasitomlar ile LDH düzeyleri 7557 U/L düzeyine kadar çıkmış ve hasta fatal seyretmiştir. MM’li
hastaların takibi sırasında LDH değerlerinde olan anormal yüksekliklerde diğer nedenler ekarte edildikten sonra hastalık
progresyonu düşünülmelidir. Kemik iliği ve laboratuvar değerlendirmeleri ile progresyon veya nüks gösterilmelidir. LDH
seviyeleri yüksek olan hastalarda ise mutlaka ilave olmuş plazmasitomların varlığı düşünülmeli, klinik bulgular gelişmeden
erken dönemde tüm vücut taraması yapılmalı ve erken tedavi başlanmalıdır.
Anahtar Sözcükler: Multiple myeloma, LDH, Prognoz
Address for Correspondence: Hava Üsküdar Teke M.D.,
Kayseri Education and Research Hospital, Department of Hematology, Kayseri, Turkey
Phone: +90 352 336 88 84/1518 E-mail: havaus@yahoo.com
Received/Geliş tarihi : March 28, 2012
Accepted/Kabul tarihi : November 30,2012
84

Teke ÜH, et al: Multiple Myeloma Lactate Dehydrogenase
Turk J Hematol 2014;31:84-87
Introduction
Multiple myeloma is a malignant hematological disease
which is characterized by monoclonal immunoglobulin
production and malignant proliferation of plasma cells in
bone marrow. Serum beta2-microglobulin, serum albumin,
platelet count, serum creatinine and age are important
markers for survival during the course of disease [1].
Moreover; among these prognostic markers, elevated
LDH is correlated with beta2-microglobulin [2]. Elevated
LDH levels are observed rarely at the onset of the multiple
myeloma; however, as the disease progresses LDH levels
increase to levels higher than those at diagnosis [3]. The
median overall survival of the patients whose LDH levels
are high is shorter than those patients whose LDH levels are
normal [4]. As LDH gives an idea about the level of tumor
mass, the increase of LDH during the course of the disease
may refer to the increased levels of tumor, relapse or the
existence of extra plasmacytomas [5].
With this study, we have presented a case of a patient with
a multiple myeloma which was fulminant course, whose LDH
levels were normal at the onset of diagnosis increasing as 27
times more than normal as the disease progressed and who
showed the development of extramedullary plasmacytomas.
Case Report
An 80 years-old female patient. The patient, who was led
to hematology policlinic following the findings of anemia
(hemoglobin 8.16 gr/dl) and leucopenia (White blood cell
2.9x103/uL) with the complaints of fatigue in May 2011,
had no any other disease except from hypertension. As the
patient who was examined for bicytopenia had higher level of
Ig A and suspicious monoclonal peak was observed in serum
protein electrophoresis was evaluated. Immunofixation
electrophoresis results have shown ‘IgA/k’ monoclonal band
with IgA levels of 2610 mg/dl and kappa levels of 2040 mg/dl.
After the patient was examined for bone marrow aspirationbiopsy
and flow cytometry, in the bone marrow biopsy the
patient was found to have CD38, CD138 with the level 30%,
and kappa positive plasma cells. Direct radiographies did
not show any lytic lesions. The levels of C-reactive protein
(CRP) and LDH were normal, beta-2 microglobulin level
was 8.5 mg/L. The patient was diagnosed with stage IIIA IgA
type multiple myeloma and MP treatment was started. The
patient’s levels of IgA and monoclonality who was treated
with five cures MP decreased during the treatment. Levels
of LDH did not increase. The patient was not treated with
6 th cure chemotherapy because of the infection. Thorax
tomography did not show any pathology related to infection.
Blood culture results were negative, E. coli has grown in urine
culture. The patient’s LDH levels, whose fever decreased
with the treatment of antibiotics, increased. Hemolysis tests
which were done because of the high LDH levels (1808
U/L) were normal and fragmentation was not observed
in peripheral blood smear. Ultrasonography results have
showed that liver, pancreas and spleen were normal. As the
patient had thrombocytopenia and bone pain, bone marrow
aspiration-biopsy was examined to confirm the presence of
resistance multiple myeloma. Bone marrow biopsy results
have showed that plasma cells with kappa monoclonality
have increased to the levels of 50%. The patient’s cerebral
magnetic resonance (MR), who showed sudden loss of mass
strength around the right lower extremity, was normal.
Lumbar MR has showed that there has been a soft tissue
mass around sacral 3-4 vertebra anterior paravertebral field
and increasing numbers of tissue around the L1-L2 vertebra
corpus anterior field were observed. Thoracal MR has
showed that there has been soft tissue mass around T 5-9
vertebra which causes invasion in posterior units (Figure 1,
Figure 2). Informed consent was obtained.
Our patient’s laboratory results were given in the Graphic 1.
The patient was taken for operation by neurosurgery.
Following the pathology results, the patient was diagnosed
with plasmacytoma. The patient was treated with weekly
dexamethasone. During the dexamethasone treatment
Figure 1. The patient plasmocytomas in the Lomber MR.
Figure 2. Plasmocytomas in the lomber, thorakal area in MR.
85

Turk J Hematol 2014;31:84-87
Teke ÜH, et al: Multiple Myeloma Lactate Dehydrogenase
86
the LDH levels decreased from 7557 U/L to 2000 U/L.
Radiotherapy treatment was planned for the patient;
however, sudden onset of dyspnea and loss of consciousness
were observed with the patient. The cerebral CT results
did not show any sign of hemorrhage and emboli, edema
was observed. The patient, who had been observed to have
diffuse lung edema following the X-ray, was put under
dialysis. Afterwards, the patient died of lung edema during
the dialysis.
Discussion
Symptoms of multiple myeloma which are caused by
plasma cells in bone marrow are heterogeneous and related
to tumor mass. While the most common symptom of MM
is bone pain, the most common laboratory result is anemia.
In our case, also, anemia was observed which is the most
common symptom of MM; however, laboratory results
showed leukopenia which is rarely seen. Being associated
with prognosis, the levels of beta2-microglobulin, plasma
cell labeling index, CRP and IL-6 are parameters with
MM patients. High levels of LDH are associated with
advanced disease and poor survival. At the onset of MM,
high levels of LDH are seen rarely; however, as the disease
advanced, the levels of LDH increase to levels higher than
those at diagnosis [3]. Also in our case; at the onset of the
disease, the levels of LDH were normal and the levels of
LDH increased as the disease progressed. According to the
research; LDH, international staging systems, performance
status, age and platelet counts were shown as independent
prognostic factors. The median overall survival of the
patients with high and normal LDH was 15 vs. 44 months
[6]. While the overall survival of the patients with MM
whose LDH levels were above 250 U/L was 4 months that
of the patients with lower LDH levels was 20 months [7].
Although in our case the LDH levels were low during the
diagnosis and chemotherapy, the LDH levels increased to
7557 U/L following the progression and occurrence of
extramedullary plasmacytomas and the patient died. LDH
is a cytoplasmic enzyme and may have been observed in
nearly all major organ cells. If cells lysis occurs, or cells
and membranes are damaged, cytoplasmic enzymes,
Graphic 1. Our patient’s laboratory results.
such as LDH are released into the extracellular area [8].
LDH isoenzymes are present in brain, kidney, liver, lung,
lymph nodes, myocardium, skeletal muscle, spleen,
erythrocytes, leucocytes and also platelets and divided into
5 components [9]. LDH-3 isoenzyme is especially present
in lung diseases and special tumors; LDH-4 is observed in
kidney, placenta and pancreas and especially can be found
high in pancreatitis. Researches have shown that total
LDH, LDH-2, LDH-3 and LDH-4 isoenzymes are high with
untreated leukemia patients [10]. In our case, total LDH
level was found as 7557 U/L which has never occurred in
the literature. Other clinical situations such as hemolytic
anemia, pneumonia, pancreatitis which cause the high
levels of LDH have been eliminated. LDH-3 and LDH-4
isoenzymes are found at high levels in our case. According
to these results, it may be concluded that prognosis will be
poor, when the total LDH, LDH-3 and LDH-4 isoenzymes
are high with the patients of MM. New studies about LDH
isoenzymes of the patients with MM, whose LDH levels are
high, are required to confirm this hypothesis.
To conclude, to follow the progression of MM
disease, serum LDH levels are as useful markers as beta-2
microglobulin and monoclonal immunoglobulin. During
the observation of the patient with MM, if the LDH
levels are abnormally high, the progression of the disease
should be considered after eliminating the other causes.
Bone marrow aspiration and biopsy should be examined
and the progression or relapse should be shown. On the
other hand, the patients with high levels of LDH should
be considered to have added plasmacytomas, the whole
body should be examined at an early stage before the
development of clinical symptoms and early treatment
should be started.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
1. Greipp PR, San Miguel J, Durie BG, Crowley JJ, Barlogie
B, Bladé J, Boccadoro M, Child JA, Avet-Loiseau H, Kyle
RA, Lahuerta JJ, Ludwig H, Morgan G, Powles R, Shimizu
K, Shustik C, Sonneveld P, Tosi P, Turesson I, Westin J.
International staging system for multiple myeloma. J Clin
Oncol 2005;23:6281.
2. Simonsson B, Brenning G, Kallander C, Ahre A. Prognostic
value of serum lactic dehydrogenase (S-LDH) in multiple
myeloma. Eur J Clin Invest 1987;17:336-339.
3. Dimopoulus MA, Barlogie B, Smith TL, Alexanian R. High
serum lactate dehydrogenase level as a marker for drug
resistance and short survival in multiple myeloma. Ann
Intern Med 1991;115:931-935.

Teke ÜH, et al: Multiple Myeloma Lactate Dehydrogenase
Turk J Hematol 2014;31:84-87
4. Gkotzamandou M, Kastritis E, Gavriatopoulou MR, Nikitas
N, Gika D, Mparmparousi D, Matsouka C, Terpos E,
Dimopoulos MA. Increased serum lactate dehydrogenase
should be included among the variables that define veryhigh-risk
multiple myeloma. Clin Lymphoma Myeloma
Leuk 2011;11:409-412.
5. Sanal SM, Yaylacı M, Mangold KA, Pantazis CG. Extensive
extramedullary disease in myeloma. An uncommon variant
with features of poor prognosis and dedifferentiation.
Cancer 1996;77:1298-1302.
6. Terpos E, Katodritou E, Roussou M, Pouli A, Michalis
E, Delimopasi S, Parcharidou A, Kartasis Z, Zomas
A, Symeonidis A, Viniou NA, Anagnostopoulos N,
Economopoulos T, Zervas K, Dimipoulos MA. High
serum lactate dehydrogenase adds prognostic value to the
international myeloma staging system even in the era of
novel agents. Eur J Haematol 2010;85;114-119.
7. Suguro M, Kanda Y, Yamamato R, Chizuka A, Hamaki T,
Matsuyama T, Takezako N, Miwa A, Togawa A. High serum
lactate dehyrdogenase level predicts short survival after
vincristine-doxorubicin, dexamethasone (VAD) salvage for
refractory multiple myeloma. Am J Hematol 2000;65:132-
135.
8. Drent M, Cobben NAM, Hnderson RF, Wouters EFM,
Diejen-Visser M. Usefulness of lactate dehyrogenase and its
isoenzymes as indicators of lung damage or inflammation.
Eur Respir J 1996;9:1736-1742.
9. Lott JA, Nemensanszky E. Lactate dehydrogenase. In: Lott
JA, Wolf PL, eds. Clinical Enzymology, a case-orianted
Aprroach 1987. p. 213-244.
10. Patel PS, Adhvaryu SG, Balar DB. Serum lactate
dehydrogenase and its isoenzymes in leukemia patients:
possible role in diagnosis and treatment monitoring.
Neoplasma 1994;41:55-59.
87

Case Report
DOI: 10.4274/Tjh.2012.0106
Isolated Granulocytic Sarcoma of the Breast after
Allogeneic Stem Cell Transplantation: A Rare
Involvement Also Detected by 18FDG-PET/CT
Allogeneik Kök Hücre Nakli Sonrası Memede İzole
Granülositik Sarkom: 18FDG-PET/CT ile de Saptanan
Nadir Bir Tutulum
Eren Gündüz1, Meltem Olga Akay1, Mustafa Karagülle1, İlknur Sivrikoz Ak2
1Eskişehir Osmangazi University School of Medicine, Department of Hematology, Eskişehir, Turkey
2Eskişehir Osmangazi University School of Medicine, Nuclear Medicine, Eskişehir, Turkey
Abstract:
Granulocytic sarcoma is a tumor consisting of myeloid blasts with or without maturation that occurs at an anatomical site other
than bone marrow. Most frequently affected sites are skin, lymph nodes, gastrointestinal tract, bone, soft tissue and testes. AML
may manifest as granulocytic sarcoma at diagnosis or relapse. Although it has been considered to be rare relapse as granulocytic
sarcoma after stem cell transplantation is being increasingly reported. However it is rare without bone marrow involvement
and in AML M6 subtype. Breast is also a rare involvement. We report a 30-year-old woman with AML M6 relapsed 16 months
after allogeneic stem cell transplantation as a granulocytic sarcoma in right breast without bone marrow involvement. She
was treated with systemic chemotherapy but died of sepsis. 18 FDG-PET/CT images were also obtained and detected lesions
other than detected by breast ultrasound. The incidence of granulocytic sarcoma may increase if suspected or new diagnostic
modalities are performed.
Key Words: Granulocytic sarcoma, Breast, Stem cell transplantation, 18 FDG-PET/CT
Özet:
Granülositik sarkom matürasyonlu ve matürasyonsuz miyeloid blastlardan oluşan ve kemik iliği dışındaki anatomik bölgelerde
yerleşen bir tümördür. En sık etkilenen bölgeler cilt, lenf nodları, gastrointestinal sistem, kemik, yumuşak doku ve testistir.
AML tanı ya da relaps anında granülositik sarkom olarak ortaya çıkabilir. Nadir olduğu düşünülmekle birlikte kök hücre
nakli sonrası granülositik sarkom olarak relaps giderek artan biçimde bildirilmektedir. Fakat kemik iliği tutulumu olmaksızın
ve AML M6 alt tipinde nadirdir. Yazımızda AML M6 tanısıyla takip edilen ve allogeneik kök hücre naklinden 16 ay sonra
kemik iliği tutulumu olmaksızın sağ memede granülositik sarkom şeklinde relaps görülen 30 yaşındaki kadın hastayı sunduk.
Hastaya sistemik kemoterapi verildi ancak sepsis nedeniyle kaybedildi. 18 FDG-PET/CT görüntülerinde meme ultrasonunda
saptanmayan lezyonlar izlendi. Şüphe edildiği takdirde ya da yeni tanı modaliteleri kullanıldığında granülositik sarkom
insidansının artabileceği kanaatindeyiz.
Anahtar Sözcükler: Granülositik sarkom, Meme, Kök hücre nakli, 18 FDG-PET/CT
Address for Correspondence: Eren GÜndÜz, M.D.,
Eskişehir Osmangazi University School of Medicine, Department of Hematology, Eskişehir, Turkey
Phone: +90 222 239 84 66 E-mail: erengunduz@hotmail.com
Received/Geliş tarihi : August 10, 2012
Accepted/Kabul tarihi : October 19, 2012
88

Gündüz E, et al: Granulocytic Sarcoma of the Breast
Turk J Hematol 2014;31:88-91
Introduction
Allogeneic hematopoietic stem cell transplantation
(allo SCT) decreases relapse risk and improves survival in
unfavorable-risk acute myeloid leukemia (AML) patients
[1]. Some patients with advanced AML can also achieve
long-term survival [2]. Transplant-related mortality has
decreased, but relapse after transplantation has emerged as
the principle cause of treatment failure [3]. Extramedullary
(EM) relapse of AML occurs in 5% to 7% of allo SCT recipients
and accounts for 7% to 46% of total relapses [4]. AML M6
represents less than 5% of AML cases and its EM presentation
is extremely rare [5,6,7]. We report a case of AML French-
American-British (FAB) classification type M6 with relapse
16 months after allo SCT as a granulocytic sarcoma in the
right breast without bone marrow involvement. 18Fluorodeoxy-glucose
positron emission tomography ( 18 FDG-PET)/
computed tomography (CT) images were also obtained as a
tool for detection of EM relapse of AML. Informed consent
was obtained.
Case Report
In December 2009, a 30-year-old woman was referred
to our hospital because of pancytopenia, and a diagnosis of
AML M6 type was made. At the time of diagnosis hemoglobin
was 93 g/L, white blood cell count was 1.5x109/L, and
platelet count was 60x10 9 /L. Biochemical tests other than
lactate dehydrogenase (LDH) level were normal (LDH: 485
U/L, range: 240-480). Blasts in the bone marrow aspirate
were negative for CD56. Cytogenetic analysis showed
normal karyotype. EM leukemia was not demonstrated. She
was treated with idarubicin at 12 mg/m 2 /day intravenously
(iv) on days 1-3 and cytarabine (ara-C) at 100 mg/m 2 /day
iv on days 1-7. Since complete remission (CR) was not
detected, a second course of the same therapy was given.
After achieving CR, consolidation therapy with ara-C at 3
g/m 2 /day iv on days 1.3 and 5 was administered. A bone
marrow aspiration was performed in August 2010 because
of thrombocytopenia. The result was compatible with AML
relapse and she received ara-C at 6 g/m 2 /day iv on days 1,
3, 5, and 7; etoposide at 75 mg/m 2 /day iv on days 1-7; and
idarubicin at 12 mg/m2/day iv on days 1-3.
In November 2010 the patient underwent an allo
SCT from her human leukocyte antigen (HLA)-matched
brother after a conditioning regimen of busulfan (16 mg/
kg) and cyclophosphamide (120 mg/kg). Graft-versus-host
disease (GVHD) prophylaxis consisted of cyclosporine
and cyclophosphamide at 50 mg/kg/day on days 3 and
4. Full donor chimerism was obtained on day 28. Acute
hepatic GVHD disappeared with methyl prednisolone
therapy. Chronic GVHD confined to skin was treated with
mycophenolate mofetil.
In April 2012 she was admitted with a palpable mass
in the right breast. The breast ultrasound showed an
approximately 33-mm irregular mass with heterogeneous
internal echo suggesting carcinoma of the breast. She
underwent an excisional biopsy and the diagnosis was
granulocytic sarcoma. Bone marrow aspiration and biopsy
revealed no involvement. Chimerism was still of the full
donor type. 18FDG-PET/CT was performed after biopsy. The
time between 18 FDG-PET/CT and the biopsy was 32 days.
There were 2 focal lesions with moderate metabolic activity
(standardized uptake value maximum [SUV max] of 3.6) in
the upper inner quadrant of the right breast (Figure 1). CT
images alone were not definitive. Since the time between
18FDG-PET/CT and the biopsy was 32 days and the margin
of the hyperactive lesions were regular, the nuclear medicine
physician concluded that the lesions were not related with
postoperative changes but that they were true masses.
In May 2012 she was given high-dose ara-C, etoposide,
and idarubicin combination chemotherapy again. Invasive
aspergillosis developed despite posaconazole prophylaxis
and she died of sepsis 25 days after chemotherapy.
Discussion
Recent studies have suggested that EM relapse accounts
for a significant proportion of relapses after allo SCT and
is particularly associated with the induction of graft-versusleukemia
(GVL) effect [4]. Younger age, EM involvement
before SCT, advanced disease at SCT, unfavorable
cytogenetics, and M4 and M5 FAB subtypes are factors
Figure 1. The patient was scanned by an integrated PET/
CT camera (one hour after the administration of 465 MBq
FDG), which consists of a 6-slice CT gantry integrated on a
LSO based full ring PET scanner (Siemens Biograph 6, IL,
Chicago, USA). MIP PET, CT and fusion PET/CT images
were obtained. There were 2 focal lesions with moderate
metabolic activity (SUV max of 3.6) in the upper inner
quadrant of the right breast.
89

Turk J Hematol 2014;31:88-91
Gündüz E, et al: Granulocytic Sarcoma of the Breast
reported to be associated with EM relapse after SCT [8,9].
The significance of chromosomal abnormalities such as
t(8;21) and inv (16), CD56 expression in leukemic cells,
T-cell depletion of grafts, stem cell sources, HLA disparities,
kinetics of T-cell chimerism, and the preventive role of total
body irradiation remains unclear [4]. None of the reported
factors except younger age were recognized in our patient,
and so further studies are needed to clarify the role of other
factors in EM relapse.
The median time from SCT to EM relapse has been
reported as 10 to 17 months [8,10,11]. This time was 16
months in our patient. Lee et al. [12] indicated that the
GVL effect associated with an occurrence of GVHD is less
effective in preventing an EM relapse than a bone marrow
relapse. This seems also true for our patient because acute
hepatic and chronic skin GVHD granulocytic sarcoma
occurred without bone marrow involvement. Unfortunately,
we were unable to evaluate the occurrence of bone marrow
relapse because the patient died early.
Since the diagnosis of EM relapse is often delayed, new
diagnostic modalities such as 18FDG-PET/CT are discussed
with several limitations. This method can identify new
extramedullary manifestations that were not clinically
detectable, but it should be applied not just during diagnosis
but also for the assessment of treatment response and for
detecting recurrence [13]. Reported 18FDG uptake ranges
between SUV max 2.6 and 9.7 [14]. The SUV max was 3.6 in
our patient. Although the breast ultrasound showed just one
mass and 18FDG-PET/CT was performed after excisional
biopsy, two different lesions were detected by 18 FDG-
PET/CT. This seems to be an advantage because masses
that cannot be demonstrated with conventional methods
can be seen in 18FDG-PET/CT, and this is an important
issue, especially for isolated EM relapses. Unfortunately,
ultrasound is known to be a user-dependant method and
we did not use any more specific methods like magnetic
resonance imaging.
Although local therapy, including surgical excision and
radiotherapy, can offer long-term survival for some patients,
most patients develop systemic relapse. Thus, systemic
or combined modality therapy should be considered,
particularly in patients with good performance status [10].
Donor lymphocyte infusion (DLI) has limited efficacy [14]
and a second transplant often results in repeated relapse [15].
Our patient’s performance was good enough for combined
modality treatment and we planned systemic chemotherapy
followed by DLI. The combination was chosen as the one
that we managed best before transplantation. However,
the patient died of sepsis after chemotherapy although she
tolerated the same combination well before transplantation.
This may be because the combination has become more
toxic after the effects of allo SCT and its complications.
In conclusion, the prognosis of patients who develop
EM relapse after allo SCT remains poor. The number of
EM relapses will be increasing as the number of transplant
patients increases. Transplant physicians should be aware
of EM relapses and the diagnosis should be made as early
as possible. New diagnostic modalities such as 18FDG-PET/
CT for early diagnosis and new agents may improve clinical
outcome.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
1. Koreth J, Schlenk R, Kopecky KJ, Honda S, Sierra J,
Djulbegovic BJ, Wadleigh M, DeAngelo DJ, Stone RM,
Sakamaki H, Appelbaum FR, Döhner H, Antin JH, Soiffer
RJ, Cutler C. Allogeneic stem cell transplantation for acute
myeloid leukemia in first complete remission: systematic
review and meta-analysis of prospective clinical trials. JAMA
2009;301:2349-2361.
2. Duval M, Klein JP, He W, Cahn JY, Cairo M, Camitta BM,
Kamble R, Copelan E, de Lima M, Gupta V, Keating A, Lazarus
HM, Litzow MR, Marks DI, Maziarz RT, Rizzieri DA, Schiller
G, Schultz KR, Tallman MS, Weisdorf D. Hematopoietic stem
cell transplantation for acute leukemia in relapse or primary
induction failure. J Clin Oncol 2010;28:3730-3738.
3. Pavletic SZ, Kumar S, Mohty M, de Lima M, Foran JM,
Pasquini M, Zhang MJ, Giralt S, Bishop MR, Weisdorf D. NCI
First International Workshop on the Biology, Prevention
and Treatment Relapse after Allogeneic Hematopoietic Stem
Cell Transplantation: Report from the Committee on the
Epidemiology and Natural History of Relapse Following
Allogeneic Cell Transplantation. Biol Blood Marrow
Transplant 2010;16:871-890.
4. Yoshihara S, Ando T, Ogawa H. Extramedullary relapse
of acute myeloid leukemia after allogeneic hematopoietic
stem cell transplantation: an easily overlooked but
significant pattern of relapse. Biol Blood Marrow Transplant
2012;18:1800-1807.
5. Kasyan A, Medeiros LJ, Zuo Z, Santos FP, Ravandi-Kashani
F, Miranda R, Vadhan-Raj S, Koeppen H, Bueso-Ramos CE.
Acute erythroid leukemia as defined in the World Health
Organization classification is a rare and pathogenetically
heterogeneous disease. Mod Pathol 2010;23:1113-1126.
6. Keifer J, Zaino R, Ballard JO. Erythroleukemic infiltration
of a lymph node: use of hemoglobin immunohistochemical
techniques in diagnosis. Hum Pathol 1984:15:1090-1093.
7. Wang HY, Huang LJ, Liu Z, Garcia R, Li S, Galliani CA.
Erythroblastic sarcoma presenting as bilateral ovarian
masses in an infant with pure erythroid leukemia. Hum
Pathol 2011;42:749-758.
90

Gündüz E, et al: Granulocytic Sarcoma of the Breast
Turk J Hematol 2014;31:88-91
8. Lee KH, Lee JH, Choi SJ, Lee JH, Kim S, Seol M, Lee YS,
Kim WK, Seo EJ, Park CJ, Chi HS, Lee JS. Bone marrow
vs extramedullary relapse of acute leukemia after allogeneic
hematopoietic cell transplantation: risk factors and clinical
course. Bone Marrow Transplant 2003;32:835-842.
9. Porter DL, Alyea EP, Antin JH, DeLima M, Estey E,
Falkenburgh JH, Hardy N, Kroeger N, Leis J, Levine J,
Maloney DG, Peggs K, Rowe JM, Wayne AS, Giralt S, Bishop
MR, van Beslen K. NCI First International Workshop on
the Biology, Prevention and Treatment of Relapse after
Allogeneic Hematopoietic Stem Cell Transplantation:
Report from the Committee on Treatment of Relapse after
Allogeneic Hematopoietic Stem Cell Transplantation. Biol
Bone Marrow Transplant 2010;16:1467-1503.
10. Solh M, DeFor TE, Weisdorf DJ, Kaufman DS. Extramedullary
relapse of acute myelogenous leukemia after allogeneic
hematopoietic stem cell transplantation: better prognosis
than systemic relapse. Biol Blood Marrow Transplant
2012;18:106-112.
11. Cunningham I. Extramedullary sites of leukemia relapse
after transplant. Leuk Lymphoma 2006;47:1745-1767.
12. Lee JH, Choi SJ, Lee JH, Seol M, Lee YS, Ryu SG, Park CJ,
Chi HS, Lee MS, Yun S, Lee JS, Lee KH. Anti-leukemic
effect of graft versus host disease on bone marrow and
extramedullary relapses in acute leukemia. Haematologica
2005;90:1380-1388.
13. Stölzel F, Röllig C, Radke J, Mohr B, Platzbecker U, Bornhauser
M, Paulus T, Ehninger G, Zöphel K, Schaich M. 18FDG-PET/
CT for detection of extramedullary acute myeloid leukemia.
Haematologica 2011;96:1552-1556.
14. Kolb HJ. Graft versus leukemia effects of transplantation
and donor lymphocytes. Blood 2008;112:4371-4383.
15. Yoshihara S, Ikegame K, Kaida K, Taniguchi K, Kato R,
Inoue T, Fujioka T, Tamaki H, Okada M, Soma T, Ogawa
H. Incidence of extramedullary relapse after haploidentical
SCT for advanced AML/myelodysplastic syndrome. Bone
Marrow Transplant 2012;47:669-676.
91

Letter to the Editor
DOI: 10.4274/Tjh.2013.0180
Chronic Myeloid Leukemia as a Secondary Malignancy
Following Treatment of Diffuse Large B-Cell
Lymphoma
Yaygın Büyük B hücreli Lenfoma Tedavisi Sonrası Sekonder
Malignite Olarak Kronik Myeloid Lösemi
Itır Şirinoğlu Demiriz1, Emre Tekgündüz1, Sinem Civriz Bozdağ1, Fevzi Altuntaş2
1Ankara Oncology Hospital, Department of Hematology and Stem Cell Transplantation Unit, Ankara, Turkey
2 Ankara Oncology Education and Research Hospital, Ankara, Turkey
To the Editor,
Philadelphia (Ph) chromosome (t(9; 22)(q34; q11))-
positive chronic myeloid leukemia (CML) occurring as
a secondary malignancy in patients who were treated for
non-Hodgkin lymphoma (NHL) is very rare [1,2]. The
association between B-cell–derived lymphoid neoplasias and
myeloproliferative disorders is not clear [1]. Until now, CML
has been reported after treatment for Hodgkin disease (HD),
hairy cell leukemia, or chronic lymphocytic leukemia (CLL).
It is not clear whether development of CML as a secondary
malignancy represents a therapy-induced complication or
possibly a genetic susceptibility to malignancy in which the
host may be able to bear 2 different clonal malignanT-cells
[3,4]. There is also a possibility that the 2 malignant clones
derive from a common malignant stem cell [4].
A 45-year-old female was admitted to our hospital in July
2006. An undifferentiated malignant tumor was detected
following upper gastrointestinal system endoscopy. Biopsy
revealed a high-grade, CD20-positive malignant lymphoma.
The general surgery department performed a near-total
gastrectomy for the mass lesion, of 8x6 cm in size. She was
referred to our hematology clinic with a diagnosis of diffuse
large B-cell lymphoma (DLBCL). Computerized tomography
scans, bone marrow aspiration, and biopsy results revealed
Ann Arbor stage IEB disease with a normal karyotype, and
fluorescence in situ hybridization (FISH) analysis results
were negative for t(8,14) and t(14,18). Informed consent
was obtained.
Six courses of R-CHOP chemotherapy were completed in
December 2006 with achievement of complete remission (CR).
She was followed in CR until December 2010, at which point
the patient presented with leukocytosis and thrombocytosis
(white blood cell count: 61.5x109/L, neutrophils: 5.1x10 9 /L,
hemoglobin: 12.7 gr/dL,platelet count: 754x109/L).
Physical examination was normal. Peripheral blood smear
showed leukoerythroblastosis and mild basophilia with
32% metamyelocytes and 21% myelocytes. Bone marrow
aspiration and biopsy revealed hypercellular bone marrow
and myeloid hyperplasia (M/E: 6/1), and 1.4% basophilia, but
no blastic infiltration or fibrosis. FISH analysis showed 93%
Ph chromosome positivity, whereas JAK-2 mutation was not
detected. She was diagnosed with CML in the chronic phase.
Her Sokal score was 0.73 (low) and imatinib mesylate therapy
at 400 mg/day was initiated in January 2011. Complete
hematological response was achieved in March 2011, followed
by complete cytogenetic and major molecular responses in
June 2011. She is still being followed in our outpatient clinic
with major molecular response.
Primary DLBCLs are aggressive tumors accounting for
approximately 40% of all B-cell malignancies. Up to 40% of
Address for Correspondence: Itır Şİrİnoğlu Demİrİz, M.D.,
Ankara Oncology Hospital, Department of Hematology and Stem Cell Transplantation Unit, Ankara, Turkey
Phone: +90 312 336 09 09 E-mail: dritir@hotmail.com
Received/Geliş tarihi : May 23, 2013
Accepted/Kabul tarihi : August 5, 2013
92

Demiriz ŞI: Chronic Myeloid Leukemia as a Secondary Malignancy Following Treatment of Diffuse Large B-Cell Lymphoma
Turk J Hematol 2014;31:92-94
Table 1. Reported cases of CML developing after NHL.
Case Reference Therapy received for
NHL
Latency
(months)
CML phase Survival
(months)
1 Auerbach et al. [14] Cy+VCR+ADR+RT 57 Chronic 3
2 Whang-Peng et al. [10] COP NA Chronic 7
3 Cazzola et al. [12] COP +RT 84 Chronic 17
4 Mele et al. [11] CTX+VCR+RT 84 Lymphoid blast
crisis
5 Bolaños-Meade et al. [7] CHL+PDN 96 Chronic NA
6 Breccia et al. [13] Various CT regimens+RT 228 Chronic 24
7 Present case R-CHOP 88 Chronic 24+
CHL: chlorambucil; Cy: cyclophosphamide, VCR: vincristine, ADR: adriamycin, RT: radiotherapy, COP: cyclophosphamide-vincristine-prednisolone,
PDN: prednisolone, CT: chemotherapy, R-CHOP: rituximab-cyclophosphamide-anthracycline-vincristine-prednisolone.
9
the masses are extranodal. The most common extranodal
site is the stomach. Patients who have been treated for NHL
have an increased risk of developing secondary malignancies,
including acute myeloid leukemia, CLL, and solid tumors of
various types.
Epidemiologic studies performed in large series have
shown the possibility of secondary CML occurrence in cases
of HD, NHL, and various solid tumors [5,6,7,8,9]. Usually,
the median latency of time between the 2 diseases was 60
months, and the majority of the patients were diagnosed with
CML in the chronic phase. Secondary CML characteristics
were similar to those of de novo cases in a series by Bauduer
et al. [5]; however, another report suggested a lower
incidence of splenomegaly and hyperleukocytosis associated
with therapy-related CML.
Whang-Peng et al. [10] reported secondary leukemia
in patients with different types of malignancies. CML was
observed in 8 patients. In 1 patient, CML developed after
treatment for NHL. The remaining patients had cancer of
the breast, CLL, HD, or acute lymphoblastic leukemia.
Several explanations appear possible for the occurrence
of CML in DLBCL. CML is a disease of the pluripotent stem
cells that involves not only myeloid but also lymphoid cell
compartments. First, the cytostatic drugs used in treatment
of DLBCL may be directly involved in the pathogenesis of
CML. Second, therapy-induced immune dysregulation,
such as radiotherapy, may contribute to the evolution of
CML. Third, theoretically but not yet proven, the neoplastic
transformation of a progenitor cell, capable of differentiation
into either lymphoid or myeloid cell lines, might lead to the
association of lymphoproliferative and myeloproliferative
disorders. Therefore, it might have been likely that the Bcrabl
rearrangement was present in the DLBCL cells [2].
Secondary CML patients receiving treatment for NHL
that have been reported so far are presented in Table 1. In
all patients, prior chemotherapy and/or radiotherapy and
latency time between the 2 diseases strongly suggested the
secondary nature of CML [7,10,11,12,13,14].
On the other hand, this case report implies that
patients treated for NHL require close follow-up for years
after completing therapy. In conclusion, patients with
lymphoproliferative malignancies like DLBCL can present
many years later after successful treatment of their disease
with a clonal myeloproliferative disease like CML. Molecularly
targeted therapy with tyrosine kinase inhibitors seems to be
effective and well tolerated in patients with secondary CML.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
Key Words: Lymphoma, Chronic myeloid leukemia, Secondary
malignancy
Anahtar Kelimeler: Lenfoma, Kronik myeloid lösemi, Sekonder
malignite
References
1. Alsop S, Sanger WG, Elenitoba-Johnson KS, Lim MS.
Chronic myeloid leukemia as a secondary malignancy after
ALK-positive anaplastic large cell lymphoma. Hum Pathol
2007;38:1576-1580.
2. Specchia G, Buquicchio C, Albano F, Liso A, Pannunzio A,
Mestice A, Rizzi R, Pastore D, Liso V. Non-treatment-related
chronic myeloid leukemia as a second malignancy. Leuk Res
2004;28:115-119.
3. Ramanarayanan J, Dunford LM, Baer MR, Sait SN, Lawrence
W, McCarthy PL. Chronic myeloid leukemia after treatment
of lymphoid malignancies: response to imatinib mesylate
and favorable outcomes in three patients. Leuk Res
2006;30:701-705.
93

Turk J Hematol 2014;31:92-94
Demiriz ŞI: Chronic Myeloid Leukemia as a Secondary Malignancy Following Treatment of Diffuse Large B-Cell Lymphoma
4. Maher VE, Gill L, Townes PL, Wallace JE, Savas L, Woda BA,
Ansell JE. Simultaneous chronic lymphocytic leukemia and
chronic myelogenous leukemia. Evidence of a separate stem
cell origin. Cancer 1993;71:1993-1997.
5. Bauduer F, Ducout L, Dastugue N, Marolleau JP. Chronic
myeloid leukemia as a secondary neoplasm after anti-cancer
radiotherapy: a report of three cases and a brief review of the
literature. Leuk Lymphoma 2002;43:1057-1060.
6. Zahra K, Ben Fredj W, Ben Youssef Y, Zaghouani H,
Chebchoub I, Zaier M, Badreddine S, Braham N, Sennana
H, Khelif A. Chronic myeloid leukemia as a secondary
malignancy after lymphoma in a child. A case report and
review of the literature. Onkologie 2012;35:690-693.
7. Bolaños-Meade J, Sarkodee-Adoo C, Khanwani SL. CML
after treatment for lymphoid malignancy: therapy-related
CML or coincidence? Am J Hematol 2002;71:139.
8. Verhoef GEG, Demuynck H, Stul MS, Cassiman JJ.
Philadelphia chromosome-positive chronic myelogenous
leukemia in treated Hodgkin’s disease. Cancer Genet
Cytogenet 1990;49:171-176.
9. Boivin IF, O’Brien K. Solid cancer risk after treatment of
Hodgkin’s disease. Cancer 1988;61:2541-2546.
10. Whang-Peng J, Young RC, Lee EC, Longo DL, Schechter GP,
DeVita VT. Cytogenetic studies in patients with secondary
leukemia/dysmyelopoietic syndrome after different
treatment modalities. Blood 1988;71:403-414.
11. Mele L, Pagano L, Equitani F, Chiusolo P, Rossi E, Zini G,
Teofili L, Leone G. Lymphoid blastic crisis in Philadelphia
chromosome positive chronic granulocytic leukemia
following high-grade non-Hodgkin’s lymphoma. A case
report and review of literature. Haematologica 2000;85:544-
547.
12. Cazzola M, Bergamaschi G, Melazzini M, Ponchio L, Rosti
V, Molinari E. Chronic myelogenous leukemia following
radiotherapy and chemotherapy for non-Hodgkin
lymphoma. Haematologica 1990;75:477-479.
13. Breccia M, Martelli M, Cannella L, Russo E, Finolezzi E,
Stefanizzi C, Levi A, Frustaci A, Alimena G. Rituximab
associated to imatinib for coexisting therapy-related chronic
myeloid leukaemia and relapsed non-Hodgkin lymphoma.
Leuk Res 2008;32:353-355.
14. Auerbach HE, Stelmach T, LaGuette JG, Glick JH, Kant JA,
Nowell PC. Secondary Ph-positive CML with a minority
monosomy 7 clone. Cancer Genet Cytogen 1987;28:173-
178.
94

Letter to Editor
DOI: 10.4274/Tjh.2013.0247
Acute Myocardial Infarction after First Dose of
Rituximab Infusion
İlk Doz Rituksimab İnfüzyonu Sonrasında Gelişen Akut Miyokard
İnfarktüsü
Ajay Gogia, Sachin Khurana, Raja Paramanik
B. R. A. Institute Rotary Cancer Hospital, All India Institute of Medical Sciences, Department of Medical Oncology, New Delhi, India
To the Editor,
Rituximab (anti-CD20) is a chimeric monoclonal
antibody and is commonly used in treatment of various
lymphomas and nonmalignant immune disorders. Infusion
reactions are common following rituximab administration.
Cardiotoxicity with rituximab is less frequent, but
occasionally arrhythmia is reported. We report here an
acute myocardial infarction following the first rituximab
infusion for the treatment of splenic lymphoma with villous
lymphocytes (SLVL).
A previously healthy 65-year-old male presented to our
hospital in May 2013 with a 6-month history of fatigue and a
feeling of fullness over the left side of his abdomen. Clinical
examination revealed ECOG performance status of 1 at the
time of first visit, mild pallor, and massive splenomegaly
(12 cm below the costal margin). His hemogram showed
a hemoglobin level of 10.5 g/dL, total leukocyte count of
3.4x10 9 /L, and platelet count of 50x10 9 /L. Peripheral blood
smear examination showed normochromic normocytic
anemia and leucopenia with normal differential count. Renal
and liver functions were within normal limits. Coomb’s
test results were negative and there were no features of
hemolysis. Electrocardiogram and 2D echo results were
normal. Further diagnostic and staging workup including
bone marrow biopsy, touch, and imaging revealed stage IV
splenic lymphoma with villous lymphocytes. It was planned
to start BR (bendamustine and rituximab) combination
chemo/immunotherapy, in which rituximab was the initial
therapy. Rituximab was administered as per standard
prescribing recommendations with acetaminophen,
diphenhydramine, and steroids. The patient complained
of uneasiness and sweating for a few minutes after 5 min
of controlled infusion. Electrocardiogram revealed ST
elevation in inferior leads, which did not subside even after
stopping the rituximab infusion. The troponin T level was
elevated. The patient was shifted to the coronary care unit
(CCU) and angiography showed a complete thrombotic
occlusion of the right coronary artery, in the absence of
abnormalities in the other coronary arteries. Angioplasty
was done and he was discharged from the CCU after 2 days
in stable condition.
Rituximab is generally well tolerated if given with
adequate premedication. Grade 1/2 infusion-related
drug reactions are well known, which include fever,
chills, hypotension, and dyspnea; pretreatment with
acetaminophen, antihistamines, and, on occasion,
corticosteroids minimizes these symptoms. Cardiovascular
toxicities described with rituximab include tachycardia,
hypotension, hypertension, hypoxemia, arrhythmias,
bradycardia, and atrial fibrillation. Myocardial infarction
as a complication of rituximab infusion is listed in the
package insert but is not clearly described in the literature
[1]. Myocardial infarction after rituximab infusion is
extremely rare and was described in only 4 cases of
lymphoid malignancy (Table 1) and 2 cases of immune-
Address for Correspondence: Ajay GogIa M.D.,
B. R. A. Institute Rotary Cancer Hospital, All India Institute of Medical Sciences, Department of Medical Oncology, New Delhi, India
E-mail: ajaygogia@gmail.com
Received/Geliş tarihi : July 12, 2013
Accepted/Kabul tarihi : September 04, 2013
95

Gogia A, et al: Acute Myocardial Infarction after First Dose of Rituximab Infusion Turk J Hematol 2014;31:95-96
Table 1. Patients with acute myocardial infarction after first infusion of rituximab in lymphoid malignancies.
Reference Age Sex Diagnosis Cardiac
enzymes
Outcome
Armitage et al. [2] 58 M Chronic lymphocytic leukemia Increased Recovered
Armitage et al. [2] 61 M Burkitt lymphoma Increased Recovered
Armitage et al. [2] 72 M Burkitt-like lymphoma Increased Died
Arunprasath et al. [3] 60 M Diffuse large B-cell lymphoma Increased Recovered
Present case 65 M Splenic lymphoma with villous lymphocytes Increased Recovered
mediated disorders [2,3,4]. The proposed mechanism for
Acute Coronary syndrome following rituximab infusion
is the release of cytokines, which cause vasoconstriction,
platelet activation, and/or rupture of atherosclerotic plaque
[5]. In our case it is likely that the patient had preexisting
vulnerable plaque in light of his advanced age as a risk
factor. Meticulous screening for ischemic heart disease may
be necessary in high-risk subsets before starting rituximab
therapy. Awareness of this complication is important to
minimize the risk of treatment-related morbidity.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
Key Words: Myocardial infarction after rituximab
Anahtar Kelimeler: Rituximab’den sonra myokard infarktı
References
1. Genentech. Rituxan® (Rituximab) [Prescribing Information].
South San Francisco, CA, USA: Genentech; 2001.
2. Armitage JD, Montero C, Benner A, Armitage JO, Bociek G.
Acute coronary syndromes complicating the first infusion of
rituximab. Clin Lymphoma Myeloma 2008;8:253-255.
3. Arunprasath P, Gobu P, Dubashi B, Satheesh S, Balachander
J. Rituximab induced myocardial infarction: a fatal drug
reaction. J Cancer Res Ther 2011;7:346-348.
4. van Sijl AM, van der Weele W, Nurmohamed MT. Myocardial
infarction after rituximab treatment for rheumatoid arthritis:
is there a link? Curr Pharm Des 2013 [Epub ahead of print].
5. Winkler U, Jensen M, Manzke O. Cytokine-release syndrome
in patients with B-cell chronic lymphocytic leukemia and
high lymphocyte counts after treatment with an anti-CD20
monoclonal antibody (rituximab, IDEC-C2B8). Blood
1999;94:2217-2224.
96

Letter to the Editor
DOI: 10.4274/TJH.2012.0202
An Updated Review of Abnormal Hemoglobins in the
Turkish Population
Anormal Hemoglobinlerin Türk Popülasyonunda Güncellenmesi
Nejat Akar
TOBB-ETU Hospital, Ankara, Turkey
To the Editor,
Two previous reviews by Altay and Akar concerning the
“Abnormal Hemoglobins in Turkey” appeared in the journal
several years ago [1,2]. Since then, several other variants
have been reported in both international and national
journals. The aim of this mini-review was to compile the
newly published abnormal hemoglobins in the Turkish
population since these two previous papers [1,2].
During the last five years, several variants, each belonging
to one family, confirmed with DNA sequencing were reported
(Table 1) [3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,
21,22]. Two further new variants (Hb İzmir and Hb Edirne)
was reported in Turkish population for the first time [18,21].
It is interesting that although almost six decades had
passed since the first determination of a hemoglobin variant,
there are still reports on hemoglobin variants mainly related
to clinical and genetic counselling.
Altay and Akar pointed out that the exact number of
subjects having abnormal hemoglobins in Turkish population
is not known due to the absence of a national registry system
for these conditions [1,2]. So a national registry system
collecting clinical and molecular data is needed.
This aim can be achieved under the auspices of the
Turkish Hematology Association.
Conflict of Interest Statement
The author of this paper have no conflicts of interest,
including specific financial interests, relationships, and/ or
affiliations relevant to the subject matter or materials included.
Key Words: Hemoglobin, Variant, Hemoglobinopathy
Anahtar Kelimeler: Hemoglobin, Varyant, Hemoglobinopati
Table 1. Abnormal hemoglobin variants in the Turkish
population published since 2007.
a. Variants of the alpha chain (single base changes)
Hb Adana alpha 2(59)(E8)Gly-->Asp
Hb Westeinde [α125(H8)Leu→Gln combined with α2
IVS-I (-5 nt) deletion
Hb Q-Iran [a 75 (EF4) Asp-His]
b. Variants of the beta chain (single base changes)
Hb South Florida [beta 1(NA1) Val>Met
Hb Yaizu [beta 79(EF3) Asp>Asn]
Hb Sarrebourg [β131(H9)Gln→Arg, CAG>CGG]
Hb Crete [Beta129(H7) Ala>Pro]
Hb Izmir [β86(F2)Ala→Val, GCC>GTC
Hb E Saskatoon (B22 Glu-Lys)
Hb Ernz [β123(H1) Thr>Asn]
Hb D Punjab [B121 Glu-Gln]
Hb Beograd [B121 Glu-Val]
Hb G-Coushatta [B22 (B4) Glu-Ala]
Hb M Saskatoon (ß63 (E7) His>Tyr(C-T))
c. Variants of the delta chain (single base changes)
Hb Noah Mehmet Oeztuerk delta143 (H21) His-->Tyr
Hb A2 Yialousa (D82 C-T Ala28Ser)
d. Abnormal hemoglobin variants that have been
Reported in compound heterozygote state with
thalassemia or sickle cell
Hb Ernz [β123(H1) Thr>Asn]
Address for Correspondence: Nejat Akar, M.D.,
TOBB-ETU Hospital, Ankara, Turkey
E-mail: nejatakar@hotmail.com
Received/Geliş tarihi : December 20, 2012
Accepted/Kabul tarihi : January 10, 2013
97

Turk J Hematol 2014;31:97-98
Akar N: An Update Review of Abnormal Hemoglobins in Turkish Population
References
1. Altay Ç. Abnormal hemoglobins in Turkey. Turk J Hematol
2002;19:63-74.
2. Akar E, Akar N. A review of abnormal hemoglobins in
Turkey. Turk J Hematol 2007;24:143-145
3. Atalay A, Koyuncu H, Köseler A, Ozkan A, Atalay EO.Hb
Beograd [beta121(GH4)Glu-->Val, GAA-->GTA] in the
Turkish population. Hemoglobin 2007;31:491-493.
4. Atalay EO, Atalay A, Ustel E, Yildiz S, Oztürk O, Köseler A,
Bahadir A.Genetic origin of Hb D-Los Angeles [beta121(GH4)
Glu-->Gln, GAA-->CAA] according to the beta-globin gene
cluster haplotypes. Hemoglobin 2007;31:387-391.
5. Bissé E, Schaeffer C, Hovasse A, Preisler-Adams S, Epting
T, Baumstark M, Van Dorsselaer A, Horst J, Wieland
H.Haemoglobin Noah Mehmet Oeztuerk (alpha(2)
delta(2)143 (H21)His-->Tyr: A novel delta-chain variant in
the 2,3-DPG binding site. J Chromatogr B Analyt Technol
Biomed Life Sci 2008;871:55-59.
6. Koseler A, Bahadır A, Koyuncu H, Atalay A, Atalay AO. First
observation of Hb D-Ouled Rabah [beta19(B1)Asn>Lys] in
the Turkish population. Turk J Hematol 2008;25:51-53.
7. Atalay EO, Atalay A, Koyuncu H, Oztürk O, Köseler A,
Ozkan A, Demirtepe S. Rare hemoglobin variant Hb Yaizu
observed in Turkey. Med Princ Pract 2008;17:321-324.
8. Kaufmann JO, Phylipsen M, Neven C, Huisman W, van Delft
P, Bakker-Verweij M, Arkesteijn SG, Harteveld CL, Giordano
PC. Hb St. Truiden [’68(E17)Asn’His] and Hb Westeinde
[’125(H8)Leu’Gln]: two new abnormalities of the α2-
globin gene. Hemoglobin 2010;34:439-444.
9. Keser I, Yeşilipek A, Canatan D, Lülec G. Abnormal
hemoglobins associated with the beta-globin gene in Antalya
province, Turkey. Turk J M Sci 2010:40:127-131.
10. Köseler A, Koyuncu A, Öztürk O, Bahadır A, Demirtepe
S, Atalay A. First observation of Hb Tunis [beta124(H2)
Pro>Ser] in Turkey. Turk J Hematol 2010;27:120-122.
11. Curuk MA, Cavusoglu AÇ, Arıcan H, Uzuncan N, Karaca B.
Hb Sarrebourg [β131(H9)Gln→Arg, CAG>CGG] in Turkey.
Hemoglobin 2010;34:572-575.
12. Zur B, Hildesheim A, Ludwig M, Stoffel-Wagner BA. First
report on Hb Q-Iran in association with alpha-thalassemia
in a case of spinal ischemia. Clin Lab 2011;57:221-224.
13. Arslan C, Kahraman S, Özsan H, Akar N. First observation
of hemoglobin Crete [Beta129(H7) Ala>Pro] in the Turkish
population |. Turk J Hematol 2011;28:346-347.
14. Genç A, Çürük MA. Two rare hemoglobin variants in the
Çukurova Region of Turkey: Hb E-Saskatoon and Hb
G-Coushatta. Turk J Hematol 2011;28:323-326.
15. Akar N, Arslan Ç, Kürekçi E. First Observation of
Hemoglobin M Saskatoon (ß63 (E7) His>Tyr(C-T)) in the
Iraqi Population Turk J Hematol 2012:36;287-288.
16. Köseler A, Atalay A, Atalay E Ö. HbA2-Yokoshima (delta
25(B7)Gly >Asp) and Hb A2-Yialousa (delta 27(B9)Ala>Ser)
in Turkey. Turk J Hematol 2012:36;289-290.
17. Genc A, Tastemir Korkmaz D, Urhan Kucuk M,
Rencuzogullari E, Atakur S, Bayram S, Onderci M, Koc
T, Aslan S, Mutalip A, Faruk M, Sevgiler Y, Tuncdemir
A. Prevalence of beta-thalassemia trait and abnormal
hemoglobins in the province of Adıyaman, Turkey. Pediatr
Hematol Oncol. 2012 ;29:620-3.
18. Celebiler A, Aksoy D, Ocakcı S, Karaca B.A new hemoglobin
Variant: Hb Izmir [beta’86(F2)Ala’Val, GCC>GTC;
HBB:c.260C>T. Hemoglobin 2012;36:474-479.
19. Gunesacar R, Celik MM, Ozturk OH, Celik M, Tümer C,
Celik T. Investigation of the clinical and hematological
significance of the first observed hemoglobin Ernz variant
[β123(H1) Thr>Asn] in the Turkish population. Turk J Med
Sci 2012;42(Suppl 2):1471-1475.
20. Aslanger AD, Akbulut A, Tokgöz G, Türkmen S, Yararbaş
K. First Observation of Hb South Florida [beta 1(NA1)
Val>Met] in Turkey Turk J Hematol 2013;37:223-224.
21. Tabakçıoğlu K, Demir M. Hb-Edirne: A NewdChain Variant:
[d53 (D4)Asp> His; HBD c. 160G>C]. Hemoglobin, 2013.
22. Durmaz AA, Akin H, Ekmekci AY, Onay H, Durmaz B,
Cogulu O, Aydinok Y, Ozkinay F.A severe alpha thalassemia
case compound heterozygous for Hb Adana in alpha1 gene
and 20.5 kb double gene deletion. J Pediatr Hematol Oncol.
2009 ;31(8):592-4.
98

Letter to the Editor
DOI: 10.4274/Tjh.2013.0207
Lenalidomide-Induced Pure Red Cell Aplasia
Lenalidomid ile Uyarılmış Eritroid Dizi Aplazisi
Tuphan Kanti Dolai, Shyamali Dutta, Prakas Kumar Mandal, Sandeep Saha, Maitreyee Bhattacharyya
NRS Medical College and Hospital, Department of Hematology, Kolkata, India
To the Editor,
Pure red cell aplasia (PRCA) is a bone marrow failure
disorder. Several drugs have been reported as having
induced PRCA, but lenalidomide-induced PRCA is rarely
reported. Here we present a patient with myelodysplastic
syndrome (MDS) who developed PRCA after treatment
with lenalidomide.
A 47-year-old male presented with a history of weakness
with effort intolerance for 5 months. Examination showed
pallor and mild splenomegaly. Blood count showed Hb
level of 86 g/L, total WBC count of 5.2x10 9 /L, normal
differential counts, and platelet count of 223x10 9 /L.
MCV was 101 fL and reticulocyte count was 1%. Serum
chemistries were normal. Bone marrow aspiration and
biopsy results showed mild hypercellularity with evidence
of megaloblastic erythropoiesis and dyserythropoiesis.
Cytogenetics showed loss of the Y chromosome. Iron
stores were normal. Serum B12, folic acid, and serum
ferritin levels were normal. Tests for antinuclear antibodies,
HIV-1 and HIV-2 antibodies, hepatitis B surface antigen,
and anti-hepatitis C virus were negative. Expressions of
CD55 and CD59 on granulocytes were in the normal
range. He received vitamin B12 with no success. With the
diagnosis of MDS with refractory anemia, he was started
on lenalidomide at 5 mg daily.
In the next 3 weeks, he presented with severe weakness
and the Hb level dropped to 53 g/L with normal WBC
and platelets. Reticulocyte count was

Turk J Hematol 2014;31:99-100
Dolai KT, et al: Lenalidomide-Induced PRCA
References
1. Raza A, Reeves JA, Feldman EJ, Dewald GW, Bennett JM,
Deeg HJ, Dreisbach L, Schiffer CA, Stone RM, Greenberg
PL, Curtin PT, Klimek VM, Shammo JM, Thomas D, Knight
RD, Schmidt M, Wride K, Zeldis JB, List AF. Phase 2 study
of lenalidomide in transfusion-dependent, low-risk, and
intermediate-1–risk myelodysplastic syndromes with
karyotypes other than deletion 5q. Blood 2008;111:86-93.
2. Thompson DF, Gales MA. Drug induced pure red cell aplasia.
Pharmacotherapy 1996;16:1002-1008.
3. Fisch P, Handgretinger R, Schaefer HE. Pure red cell aplasia.
Br J Haematol 2000;111:1010-1022.
4. Ammus SS, Yunis AA. Acquired pure red cell aplasia. Am J
Hematol 1987;24:311-326.
100

Letter to the Editor
DOI: 10.4274/Tjh.2013.0279
Early Postnatal Hemorrhagic Shock Due to
Intraabdominal Hemorrhage in a Newborn
with Severe Hemophilia A
Yenidoğan Döneminde Intraabdominal Kanama ile Erken
Postnatal Hemorajik Şoka Neden Olan Hemofili A Vakası
Sara Erol1, Banu Aydın1, Dilek Dilli1, Barış Malbora2, Serdar Beken1, Hasibe Gökçe Çınar3,
Ayşegül Zenciroğlu1, Nurullah Okumuş1
1Dr. Sami Ulus Maternity and Children Training and Research Hospital, Neonatal Intensive Care Unit, Ankara, Turkey
2Dr. Sami Ulus Maternity and Children Training and Research Hospital, Pediatric Hematology Unit, Ankara, Turkey
3Dr. Sami Ulus Maternity and Children Training and Research Hospital, Pediatric Radiology Unit, Ankara, Turkey
To the Editor,
Hemophilia A, which is an X-linked recessive disorder,
is one of the most common causes of congenital bleeding
diathesis in newborns. Four hemophilic newborns with
liver hematoma have been reported in the literature [1,2,3].
Herein, we present a newborn with hemophilia A who
presented with hemorrhagic shock at the 8th hour of life
subsequent to hematoma of the liver.
A male infant weighing 3025 g was born via normal
vaginal delivery at 39 weeks. He was the first child of a
23-year-old mother. The birth was uneventful and the
mother did not have any trauma history. Although the baby
was normal at birth, he had severe respiratory distress at the
8th hour of life. On examination, the patient was pale and
had poor capillary refill. He had bilateral cephalohematomas
of about 3x2.5x2.5 cm in size in the parieto-occipital
regions. Ecchymosis was noted on the scrotum and in the
left inguinal regions. The parents were found to be firstdegree
cousins and family history revealed a maternal uncle
with a diagnosis of hemophilia A. Laboratory investigation
revealed a hemoglobin 8.5 g/dL, hematocrit 24.8%,
leukocyte count 15000/mm3, platelet count 117000/mm3,
the prothrombin time was 18 s, international normalized
ratiowas 1.6, and activated partial thromboplastin time
was 81 s. Further tests showed a factor VIII level of 0.2%.
Abdominal ultrasound showed subcapsular hematoma of
40x30 mm on the posterior right lobe of the liver (Figure
1). Erythrocyte and fresh frozen plasma transfusions were
made. He received an injection of vitamin K and continuous
recombinant factor VIII infusion. Serial ultrasonographies
showed that the size of the liver hematoma was significantly
decreased. The patient was discharged from the hospital at
18 days of life and is currently on weekly recombinant factor
VIII prophylaxis. Informed consent was obtained.
In severe hemophilia A (in which the level of factor VIII
activity is less than 1.0% of normal), spontaneous bleeding
Figure 1. A) Hematoma located on posterior segment of
the right liver lobe. B) Hypoechoic cystic lesion located on
posterior segment of the right liver lobe on axial plane. C)
Control ultrasonography revealed hypoechoic hematoma in
the subhepatic region.
Address for Correspondence: Serdar Beken, M.D.,
Dr. Sami Ulus Maternity and Children Training and Research Hospital, Neonatal Intensive Care Unit, Ankara, Turkey
Gsm: +90 532 671 31 96 E-mail: serbeken@yahoo.com
Received/Geliş tarihi : August 19, 2013
Accepted/Kabul tarihi : September 4, 2013
101

Turk J Hematol 2014;31:101-102
Erol S, et al: Newborn Diagnosed with Hemophilia
into the joints, soft tissues, and vital organs is frequent [4].
In our patient, the factor VIII level was 0.2% when checked at
the 36th hour of life, and he had multiple hematomas without
trauma. This situation might be due to birth trauma invaginal
delivery. The optimal mode of delivery for a fetus at risk of
hemophilia remains the subject of debate due to continuing
uncertainty regarding the risk of intracranial and extracranial
bleeding; opinions and recommendations vary [5].
Liver hematoma is uncommon in newborns. It has
been reported in fetuses and low-birth-weight infants, and
it is frequently an autopsy finding [6]. This condition is
generally associated with trauma, coagulopathies, hypoxia,
sepsis, maternal disease such as preeclampsia, drugs, and
placental lesions [7].
In the previous literature, 4 patients were described with
presentation of liver hematoma and all were successfully
treated with factor VIII concentrates [1,2,3]. Finally,
hemophilia may be present with vital organ bleeding in the
newborn period. Any neonate with unexplained bleeding,
and especially males, should be investigated for hemophilia.
Early diagnosis and treatment can be life-saving.
Key Words: Newborn, Liver, Hemorrhage, Hemophilia A,
Postnatal hemorrhagic shock, Bleeding
Anahtar Kelimeler: Yenidoğan, Karaciğer, Hemoraji,
Hemofili A, Kanama
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
1. Le Pommelet C, Durand P, Laurian Y, Devictor D.
Haemophilia A: two cases showing unusual features at
birth. Haemophilia 1998;4:122-125.
2. Hamilton M, French W, Rhymes N, Collins P. Liver
haemorrhage in haemophilia--a case report and review of
the literature. Haemophilia 2006;12:441-443.
3. Anjay MA, Sasidharan CK, Anoop P. Hepatic subcapsular
hematoma: two neonates with disparate presentations.
Pediatr Neonatol 2012;53:144-146.
4. Bolton-Maggs PH, Pasi KJ. Haemophilias A and B. Lancet
2003;361:1801-1809.
5. Dunkley SM, Russell SJ, Rowell JA, Barnes CD, Baker RI,
Sarson MI, Street AM. Australian Haemophilia Centre
Directors’ Organisation. A consensus statement on the
management of pregnancy and delivery in women who
are carriers of or have bleeding disorders. Med J Aust
2009;191:460-463.
6. Singer DB, Neave C, Oyer C, Pinar H. Hepatic
subcapsularhaematomas in fetuses and neonatal infants.
Pediatr Dev Pathol 1999;2:215-220.
7. Shankaran S, Elias E, Ilagan N. Subcapsular hemorrhage of
the liver in the very low birthweight infant. Acta Paediatr
Scand 1991;80:616-619.
102

Letter to the Editor
DOI: 10.4274/Tjh.2013.0218
Severe Adenovirus Infection Associated with
Hemophagocytic Lymphohistiocytosis
Ağır Adenovirüs Enfeksiyonu ile İlişkili Hemofagositik
Lenfohistiyositoz
Ferda Özbay Hoşnut1, Figen Özçay1, Barış Malbora2, Şamil Hızlı3, Namık Özbek4
1Başkent University Faculty of Medicine, Department of Pediatric Gastroenterology, Hepatology, and Nutrition, Ankara, Turkey
2Dr. Sami Ulus Research and Training Hospital of Women’s and Children’s Health and Diseases, Ankara, Turkey
3Dr. Sami Ulus Research and Training Hospital of Women’s and Children’s Health and Diseases, Department of Pediatric Gastroenterology,
Hepatology, and Nutrition, Ankara, Turkey
4Başkent University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey
To the Editor,
In healthy children adenoviral infection causes a benign,
self-limited illness [1]. However, in immunocompromised
patients, adenovirus can cause fulminant or disseminated
disease such as colitis, pneumonitis, pancreatitis, nephritis,
encephalitis, and hemophagocytic lymphohistiocytosis
(HLH) [1,2]. Herein, we report the clinical course and
the treatment of an infant who had no history of immune
defects, familial HLH, or malignant disease and suffered
from adenoviral pneumonia with progressive clinical
deterioration due to onset of virus-associated HLH. In the
literature there are few reports about adenovirus-associated
HLH in healthy children.
A previously healthy 11-month-old boy was admitted to a
state hospital with fever and cough. His chest roentgenogram
showed bilateral pneumonic infiltrates. The child was treated
with ceftriaxone and amikacin but the pneumonia progressively
worsened. Therefore, on the fifth day, his antibiotic therapy
was changed to imipenem, amikacin, and vancomycin. The
same day, a generalized myoclonic seizure was observed. The
seizure was controlled by phenytoin. His liver function test
results were elevated and the coagulation profile was deranged.
Subsequently he was admitted to our hospital.
On admission, he was confused. There was no response
to verbal stimulus but he did respond to localized painful
stimulus. His body temperature was 38.9 °C. He was tachypneic
with retractions. Coarse crackles were audible in the right
hemithorax, and in the left hemithorax, bronchial breathing was
heard. The liver was enlarged 5 cm below the right subcostal
margin. His spleen was 2 cm below the left subcostal margin.
Complete blood count findings were as follows:
hemoglobin, 7.1 g/dL; red blood cell distribution width,
18.3%; mean corpuscular volume, 68 fL; mean corpuscular
hemoglobin, 18.9 pg; mean corpuscular hemoglobin
concentration, 321.5 g/L; leukocyte count, 4.05x10 9 /L;
absolute neutrophil count, 1.5x10 9 /L; and platelet count,
79.4x10 9 /L. Microcytic hypochromic anemia was shown in
the peripheral blood smear examination. His reticulocyte
count and vitamin B12 and folate levels were normal. His
direct Coombs test results were negative. Fibrinogen levels
were 209 mg/dL (reference range: 200-400). Biochemical
findings revealed aspartate aminotransferase level of 641 U/L
(reference range: 0-40), alanine aminotransferase of 219 U/L
(reference range: 0-41), ferritin of 1820 ng/mL (reference
level: 20), and triglyceride of 373 mg/dL (reference range:
35-110). Informed consent was obtained.
Address for Correspondence: Barış Malbora, M.D.,
Dr. Sami Ulus Research and Training Hospital of Women’s and Children’s Health and Diseases, Ankara, Turkey
Phone: +90 312 305 60 00 E-mail: barismalbora@gmail.com
Received/Geliş tarihi : June 27, 2013
Accepted/Kabul tarihi : July 08, 2013
103

Turk J Hematol 2014;31:103-105
Hoşnut ÖF, et al: Severe Adenovirus Infection and HLH
Chest computerized tomography demonstrated pleural
effusion in the left hemithorax and bilateral consolidation.
In diagnostic thoracentesis there were no visible pathologic
findings. Serologies for chlamydial pneumonia, mycoplasma
pneumonia, and respiratory syncytial virus were all negative.
On the first day of admission, a localized myoclonic seizure
was observed in his right arm. The patient required calciummagnesium
therapy because of his low levels of serum
calcium and magnesium. Cerebrospinal fluid test showed
that the protein and glucose levels were in the normal range
with no pleocytosis.
Bone marrow aspiration revealed increased numbers
of histiocytes and hemophagocytosis (Figure 1). The
serum study was positive for anti-adenovirus IgM and IgG.
Adenovirus positivity was detected in the serum at 1.3x105
copies/mL by a very sensitive, commercially available realtime
PCR assay. These findings indicated that the patient
had developed HLH, associated with primary adenovirus
infection.
Intravenous immunoglobulin (IVIG) was given for 2
days (0.5 g/kg/day). After the second dose of IVIG therapy,
his general condition improved. Within 3 days, fever and
hepatosplenomegaly disappeared and transaminase levels
returned to the normal range. Complete blood count revealed
hemoglobin of 10.2 g/dL, leukocyte count of 8.35x109/L,
absolute neutrophil count of 3.8x10 9 /L, and platelet count
of 151.2x10 9 /L on day 21 of hospitalization. After 24 days,
the patient was discharged without any problems. He
is currently 27 months old and has no problems. On the
tests done to enlighten the etiology of microcytosis, he
was diagnosed as iron deficiency anemia. Ferrous sulphate
therapy was started with a proper dosing.
Although many viruses, such as the Epstein-Barr virus,
human immunodeficiency virus, parvovirus, and hepatitis
viruses, have been reported to cause infection-associated
HLH, severe hemophagocytosis due to acute adenovirus
infection is unusual [3]. There have been a limited
number of case reports describing adenovirus pneumonia
complicated with HLH [2,4,5,6]. In these reports, adenoviral
pneumonia with HLH was successfully treated with IVIG and
clarithromycin, dexamethasone and cyclosporine, or pulse
methylprednisolone [2,4,6]. Antiviral treatment with cidofovir
or ribavirin in adenovirus infections is being increasingly
used, especially in immunocompromised patients; however,
the efficacy of these drugs is not established [7,8].
We chose IVIG therapy for treatment of HLH in our
patient. Because virus-associated HLH is rare, no certain
treatment protocols have been described, and the role
of IVIG in the treatment of HLH is unclear [3]. However,
several studies have shown the beneficial effect of IVIG.
Chen et al. [9] noted remission in only 2 of 9 children with
virus-associated HLH treated with IVIG alone. Similarly,
Goulder et al. [10] reported a 1-year-old boy with virusassociated
HLH successfully treated with IVIG. In our
patient, progressive deterioration was reversed into marked
improvement after IVIG, suggesting the therapeutic benefit
of this treatment.
In our patient we were able to control infection-associated
HLH with IVIG administration. We wanted to emphasize this
good clinical and hematologic response. In conclusion, when
a patient suffering from adenovirus is seen with prolonged
fever unresponsive to antibiotics, hepatosplenomegaly, and
cytopenias, HLH should be considered in the differential
diagnosis.
Key Words: Acquired hemophagocytic
lymphohistiocytosis, Intravenous immunoglobulin,
Adenovirus-associated hemophagocytic
lymphohistiocytosis
Anahtar Kelimeler: Edinsel hemofagositik
lenfohistiyositoz, İntravenöz immunoglobulin,
Adenovirus ilişkili hemofagositik lenfohistiyositoz
Authors’ Contributions
All authors planned and performed experiments and
collaboratively wrote the manuscript.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
References
Figure 1. Wright staining of a bone marrow smear shows
hemophagocytosis.
1. Hough R, Chetwood A, Sinfield R, Welch J, Vora A. Fatal
adenovirus hepatitis during standard chemotherapy for
childhood acute lymphoblastic leukemia. J Pediatr Hematol
Oncol 2005;27:67-72.
2. Seidel MG, Kastner U, Minkov M, Gadner H. IVIG treatment
of adenovirus infection-associated macrophage activation
syndrome in a two-year-old boy: case report and review of
the literature. Pediatr Hematol Oncol 2003;20:445-451.
104

Hoşnut ÖF, et al: Severe Adenovirus Infection and HLH Turk J Hematol 2014;31:103-105
3. Fisman DN. Hemophagocytic syndromes and infection.
Emerg Infect Dis 2000;6:601-608.
4. Takahashi I, Takahashi T, Tsuchida S, Mikami T, Saito H,
Hatazawa C, Takada G. Pulse methylprednisolone therapy
in type 3 adenovirus pneumonia with hypercytokinemia.
Tohoku J Exp Med 2006;209:69-73.
5. Mistchenko AS, Diez RA, Mariani AL, Robaldo J, Maffey
AF, Bayley-Bustamante G, Grinstein S. Cytokines in
adenoviral disease in children: association of interleukin-6,
interleukin-8, and tumor necrosis factor alpha levels with
clinical outcome. J Pediatr 1994;124:714-720.
6. Morimoto A, Teramura T, Asazuma Y, Mukoyama A,
Imashuku S. Hemophagocytic syndrome associated with
severe adenoviral pneumonia: usefulness of real-time
polymerase chain reaction for diagnosis. Int J Hematol
2003;77:295-298.
7. Doan ML, Mallory GB, Kaplan SL, Dishop MK, Schecter
MG, McKenzie ED, Heinle JS, Elidemir O. Treatment of
adenovirus pneumonia with cidofovir in pediatric lung
transplant recipients. J Heart Lung Transplant 2007;26:883-
889.
8. Gavin PJ, Katz BZ. Intravenous ribavirin treatment for severe
adenovirus disease in immunocompromised children.
Pediatrics 2002;110;119.
9. Chen CJ, Huang YC, Jaing TH, Hung IJ, Yang CP, Chang LY,
Lin TY. Hemophagocytic syndrome: a review of 18 pediatric
cases. J Microbiol Immunol Infect 2004;37:157-163.
10. Goulder P, Seward D, Hatton C. Intravenous immunoglobulin
in virus associated haemophagocytic syndrome. Arch Dis
Child 1990;65:1275-1277.
105

Images in Hematology
DOI: 10.4274/Tjh.012.0194
Image- 1A. Morphology in Hematology
Cystinosis: Diagnostic
Role of Bone Marrow
Examination
Sistinozis: Kemik İliği İncelemesinin
Tanısal Rolü
Figure 1. Widespread deposition of crystals in bone marrow
fragment.
Shahla Ansari, Ghasem Miri-Aliabad,
Yousefian Saeed
Tehran University of Medical Sciences, Department of Pediatric
Hematology-Oncology, Tehran, Iran
The patient was a 1.5-year-old boy who presented with
growth failure, inability to walk, polyuria, and polydipsia.
On physical examination, he had fair skin and blond hair. He
did not have organomegaly. Ophthalmologic examination
by an ophthalmologist was normal. Hypophosphatemia,
hypovitaminosis D, mild acidosis, glucosuria, proteinuria,
and generalized aminoaciduria were found upon laboratory
studies. He underwent bone marrow aspiration that revealed
increased numbers of macrophages containing polygonal
crystals.
Severe and widespread deposition of crystals in bone
marrow particles (Figure 1) was observed, which was
pathognomonic for cystinosis. Cystinosis is a rare autosomal
recessive disorder caused by a defect in cystine transport
outside the lysosomes, leading to accumulation of cystine
crystals in various organs including the kidneys, liver, eyes,
and brain [1]. It has 3 forms and infantile nephrophatic
cystinosis is the most common and most severe type. Clinical
manifestations of this variant include polyuria, polydipsia,
dehydration, acidosis, rickets, and failure to thrive due to
tubular dysfunction and Fanconi’s syndrome [1,2]. The
diagnosis is made by observing corneal cystine crystals and/
or measuring the cystine content of leukocytes [1]; however,
typical crystals in the bone marrow are diagnostic. Early
diagnosis and treatment of these patients can prevent kidney
function impairment and other complications secondary to
deposition of cystine crystals in various tissues. Informed
consent was obtained.
Conflict of Interest Statement
The authors of this paper have no conflicts of interest,
including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials
included.
Key words: Cystinosis, Bone marrow, Examination
Anahtar Kelimeler: Sistinozis, Kemik iliği, İnceleme
References
1. Gahl WA, Thoene JG, Schneider JA. Cystinosis. N Engl J
Med 2002;347:111-121.
2. Gebrail F, Knapp M, Perrotta G, Cualing H. Crystalline
histiocytosis in hereditary cystinosis. Arch Pathol Lab Med
2002;126:1135.
Address for Correspondence: Miri-Aliabad Ghasem, M.D.,
Tehran University of Medical Sciences, Department of Pediatric Hematology-Oncology,
Tehran, Iran Phone: +982123046411 E-mail: gh_miri@yahoo.com
Received/Geliş tarihi : December 12, 2012
Accepted/Kabul tarihi : January 28, 2013
106

Images in Hematology
DOI: 10.4274/Tjh.2012.0170
Image-1B. Morphology in Hematology
Deviation from Normal
Values of Leukocyte and
Erythroblast Parameters
in Complete Blood Count
is a Messenger for Platelet
Abnormalities
Tam Kan Sayımında Lökosit ve
Eritroblast Parametrelerinin Normal
Değerlerden Sapması Trombosit
Anormallikleri için bir Habercidir
Automated blood cell counters have undergone
a formidable technological evolution owing to the
introduction of new physical principles for cellular analysis
and the progressive evolution of software [1,2]. The results
have been an improvement in analytical efficiency and an
increase in information provided with new parameters.
A 61-year-old male patient had the diagnosis of diffuse
large B-cell lymphoma 6 years ago, and after chemotherapy,
he was still in remission. He was hospitalized for high fever,
fatigue, acute renal failure, and bibasilar crepitant rales.
Complete blood count measured with a Beckman Coulter
LH 780 hematology analyzer revealed an uncorrected
leukocyte count (UWBC) of 63.5x109/L, leukocyte count
(WBC) of 22.1x10 9 /L, erythroblast count (NRBC) of
21.4x10 9 /L, and platelet count of 197x10 9 /L (Figure 1).
Upon peripheral blood smear examination, we detected
5% neutrophils, 22% band forms, 61% metamyelocytes,
5% myelocytes, 1% promyelocytes, 2% myeloblasts, 2%
lymphocytes, and 2% eosinophils. We also detected rare
erythroblasts and large platelets with profuse platelet
clumps (Figures 2 ). Routine biochemical analysis revealed
high fasting glucose, blood urea nitrogen, creatinine,
serum glutamic oxaloacetic transaminase, alkaline
phosphatase, direct and indirect bilirubin, albumin, and
lactate dehydrogenase. The erythrocyte sedimentation
rate was 100 mm/h, and serum ferritin was 2944 ng/mL.
High-resolution computed tomography of the thorax
revealed bilateral diffuse infiltrations, nodular opacities,
right pleural effusion, and mediastinal lymphadenopathies.
Clarithromycin and imipenem/cilastatin were administered
Figure 1. Complete blood count.
Cengiz Beyan, Kürşat Kaptan
Gülhane Military Medical Academy, Department of Hematology,
Ankara, Turkey
Address for Correspondence: Cengiz BEYAN, M.D.,
Gülhane Military Medical Academy, Department of Hematology, Ankara, Turkey
Phone: +90 312 304 41 03 E-mail: cengizbeyan@hotmail.com; cbeyan@gata.edu.tr
Received/Geliş tarihi : November 08, 2012
Accepted/Kabul tarihi : January 21, 2013
Figure 2. Peripheral smear. Large platelets with profuse
platelet clumps are noteworthy.
107

Turk J Hematol 2014;31:107-108
Beyan C, et al: Images in Hematology
for a probable diagnosis of pneumonia. Bone marrow
examination revealed myeloid hyperplasia but nothing
else significant. No endobronchial mass was detected in
bronchoscopy, but mucopurulent secretion was present in
the right upper and lower lobes. Biopsy reports showed nonneoplastic
bronchial mucosa epithelium. Sputum, blood,
and urine cultures; sputum mycobacterial examination;
and serum galactomannan antigen were all negative. After
the general condition, fever, acute renal failure, signs,
and symptoms were relieved, the patient was discharged.
Informed consent was obtained.
When we subtracted the WBC and NRBC from the UWBC
(=20.0x10 9 /L), a significanT-cell group was composed of big
platelets. It is probable that this ratio was higher than calculated.
Rare erythroblasts in the peripheral blood smear with high
NRBC values support the idea of large platelets as cellular
origin. In fact, the peripheral blood smear revealed large,
profuse platelet clumps, contradictory to the platelet count.
We conclude that complete blood counts should be examined
carefully; despite the essential role of automation in the modern
hematology laboratory, microscopic control of pathologic
samples (i. e. peripheral blood smear) remains indispensable,
so much so that in certain cases, it alone is diagnostic.
Key words: Blood cell count, Blood platelets, Blood
platelet disorders, Peripheral blood smear
Anahtar Kelimeler: Kan hücresi sayımı, Kan
trombositleri, Kan trombosit bozuklukları, Periferik kan
yayması
References
1. Briggs C. Quality counts: new parameters in blood cell
counting. Int J Lab Hematol 2009;31:277-297.
2. Zandecki M, Genevieve F, Gerard J, Godon A. Spurious
counts and spurious results on haematology analysers:
a review. Part II: white blood cells, red blood cells,
haemoglobin, red cell indices and reticulocytes. Int J Lab
Hematol 2007;29:21-41.
108

MRI in Hematology
DOI: 10.4274/Tjh.2012.0191
Image-2.MRI in Hematology
Intrathecal Methotrexate-
Induced Posterior
Reversible Encephalopathy
Syndrome (PRES)
İntratekal Metotreksat İlişkili
Posterior Reversible Ensefalopati
Sendromu (PRES)
Posterior reversible encephalopathy syndrome (PRES) is an
acute neuroradiological diagnosis presenting with headache,
vomiting, seizure, abnormalities of the mental status, and
visual disturbances associated with a breakdown in cerebral
vasculature regulation. It has a unique neuroradiological
pattern of symmetrical parietooccipital vasogenic edema
[1]. The most common causes of this syndrome are sudden
arterial hypertension, preeclampsia, eclampsia, uremia,
immunosuppressive drugs, and cancer chemotherapies such
as cyclosporine, tacrolimus, L-asparaginase, vincristine,
gemcitabine, cytarabine, and cisplatin, typically used in cases
of hematopoietic malignancies [2,3,4,5,6,7]. Intrathecal
methotrexate-induced PRES in an adult is exceedingly rare
[8].
A 43-year-old woman was admitted to gynecology with
metrorrhagia. Cervical cancer was diagnosed and radical
hysterectomy with lymph node dissection was performed.
Final pathology and immunohistochemical analyses revealed
B-cell phenotype malign lymphoma, which is consistent with
Burkitt lymphoma. A chemotherapy treatment protocol with
R-Hyper CVAD, consisting of rituximab, cyclophosphamide,
vincristine, adriamycin, and dexamethasone plus 12 mg of
intrathecal methotrexate without preservative, was then
started. Twelve days after chemotherapy she had severe
analgesic-irresponsive headache, nausea, motor agitation,
and cooperation failure. Her vital signs and laboratory
findings were normal. Cranial computed tomography
revealed hypodense areas due to edema in the bilateral
cerebral hemispheres, predominantly in the posterior regions.
Magnetic resonance imaging (MRI) of the brain showed
Figure 1a. MRI FLAIR images show bilateral multiple
subcortical and cortical hyperintense lesions.
Tülay Güler1, Özden Yener Çakmak1,
Selami Koçak Toprak2, Seda Kibaroğlu1, Ufuk Can1
1Başkent University School of Medicine, Department of
Neurology, Ankara, Turkey
2Başkent University School of Medicine, Department of
Hematology, Ankara, Turkey
Address for Correspondence: Tülay Güler, M.D.,
Başkent University School of Medicine, Department of Neurology, Ankara, Turkey
Phone: +90 312 212 68 68 E-mail: drtulis@yahoo.com
Received/Geliş tarihi : December 04, 2012
Accepted/Kabul tarihi : February 18, 2013
Figure 1b. MRI images 3 weeks after developing PRES
revealed significant improvement.
109

Turk J Hematol 2014;31:109-110
Güler T, et al: MRI in Hematology
multiple confluent hyperintense lesions in T2-weighted and
fluid-attenuated inverse recovery (FLAIR) sequences (Figure
1a), with no contrast enhancement in T1-weighted sequences.
PRES was diagnosed and she was admitted to the intensive
care unit (ICU) because of decreased alertness and agitation.
Intrathecal methotrexate treatment was discontinued. On the
second day in the ICU her blood pressure rose and was then
normalized by diltiazem infusion. On the third day in the ICU,
myoclonic jerks were seen in all extremities. Levetiracetam was
started. Myoclonic symptoms were no longer observed. After
treatment she had no neurological symptoms. Three weeks later,
cranial MRI showed significantly improved brain lesions (Figure
1b). The 6-month follow-up was uneventful. Informed consent
was obtained.
During chemotherapy for hematopoietic malignancies,
possible causes of neurological symptoms (cerebrovascular
disease, metabolic disturbances, neoplasia, and infections)
must be excluded by clinical, biological, and imaging findings.
During chemotherapy, various types of anticancer drugs are
administered, and it is difficult to identify which drug induces
PRES. In our case, intrathecal methotrexate treatment was
stopped, and the patient’s symptoms were relieved and did
not reoccur while her treatment was continued with other
anticancer drugs.
In treatment, the causal factor must be discontinued. The
treatment of overdose of intrathecal methotrexate is dilution
and removal from the cerebrospinal fluid with specific antidotal
therapy. Leucovorin and anti-inflammatory agents are useful
[9]. Although PRES is usually reversible with patient recovery
and resolution of the imaging findings, it might be recurrent or
result in permanent damage [10,11].
Key words: Posterior reversible encephalopathy syndrome
(PRES), Methotrexate, Magnetic resonance imaging, Fluidattenuated
inversion recovery
Anahtar Kelimeler: Arka geri dönüşümlü ensefalopati
sendromu (PRES), Ensefalopati, Metotreksat, Manyetik
rezonans görüntüleme, Sıvı zayıflatılmış dönüşüm kazanımı
(FLAIR)
References
2. Bartynski WS. Posterior reversible encephalopathy syndrome,
part 1: fundamental imaging and clinical features. AJNR Am J
Neuroradiol 2008;29:1036-1042.
3. Bartynski WS. Posterior reversible encephalopathy syndrome,
part 2: controversies surrounding pathophysiology of vasogenic
edema. AJNR Am J Neuroradiol 2008;29:1043-1049.
4. Bartynski WS, Zeigler ZR, Shadduck RK, Lister J.
Pretransplantation conditioning influence on the occurrence
of cyclosporine or FK-506 neurotoxicity in allogeneic bone
marrow transplantation. AJNR Am J Neuroradiol 2004;25:261-
269.
5. Burnett MM, Hess CP, Roberts JP, Bass NM, Douglas
VC, Josephson SA. Presentation of reversible posterior
leukoencephalopathy syndrome in patients on calcineurin
inhibitors. Clin Neurol Neurosurg 2010;112:886-891.
6. Russell MT, Nassif AS, Cacayorin ED, Awwad E, Perman
W, Dunphy F. Gemcitabine-associated posterior reversible
encephalopathy syndrome: MR imaging and MR spectroscopy
findings. Magn Reson Imaging 2001;19:129-132.
7. Tsukamoto S, Takeuchi M, Kawajiri C, Tanaka S, Nagao Y,
Sugita Y, Yamazaki A, Kawaguchi T, Muto T, Sakai S, Takeda Y,
Ohwada C, Sakaida E, Shimizu N, Yokote K, Iseki T, Nakaseko
C. Posterior reversible encephalopathy syndrome in an adult
patient with acute lymphoblastic leukemia after remission
induction chemotherapy. Int J Hematol 2012;95:204-208.
8. Aradillas E, Arora R, Gasperino J. Methotrexate-induced
posterior reversible encephalopathy syndrome. J Clin Pharm
Ther 2011;36:529-536.
9. Vezmar S, Becker A, Bode U, Jaehde U. Biochemical and
clinical aspects of methotrexate neurotoxicity. Chemotherapy
2003;49:92-104.
10. Hagemann G, Ugur T, Witte OW, Fitzek C. Recurrent posterior
reversible encephalopathy syndrome (PRES). J Hum Hypertens
2004;18:287-289.
11. Antunes NL, Small TN, George D, Boulad F, Lis E. Posterior
leukoencephalopathy syndrome may not be reversible. Pediatr
Neurol 1999;20:241-243.
1. Hinchey J, Chaves C, Appignani B, Breen J, Pao L, Wang A,
Pessin MS, Lamy C, Mas JL, Caplan LR. A reversible posterior
leukoencephalopathy syndrome. N Engl J Med 1996;334:494-
500.
110

Advisory Board of This Issue (March 2014)
Ahmet Emre Eşkazan, Turkey
Ana Boban, Croatia
Aytemiz Gürgey, Turkey
Barbara Bain, United Kingdom
Bülent Kantarcıoğlu, Turkey
Çağlar Berk, Turkey
Can Boğa, Turkey
Dilber Talia İleri, Turkey
Edit Bardi, Hungary
Elif Ünal, Turkey
Engin Kelkitli, Turkey
Engin Özcivici, Turkey
Fatih Mehmet Azık, Turkey
Fatih Mehmet Erdur, Turkey
Feride Duru, Turkey
Feridun Acar, Turkey
Ferit Avcu, Turkey
Friedrich Stölzel, Germany
Giorgia Saccullo, Italy
Güldane Seval Cengiz, Turkey
Gülderen Yanıkkaya Demirel,
Turkey
Güray Saydam, Turkey
Hamdi Akan, Turkey
Hava Teke, Turkey
Hülya Ellidokuz, Turkey
Lale Olcay, Turkey
Mehmet Ali Erkurt, Turkey
Mehmet Yılmaz, Turkey
Meryem Albayrak, Turkey
Mualla Çetin, Turkey
Muhlis Cem Ar, Turkey
Mustafa Pehlivan, Turkey
Muzaffer Demir, Turkey
Muzaffer Keklik, Turkey
Nurcan Arat, Turkey
Olga Meltem Akay, Turkey
Reyhan Diz Küçükkaya, Turkey
Şule Ünal, Turkey
Tülay Kansu, Turkey
Tunç Fışgın, Turkey
Türkan Patıroğlu, Turkey
Ülker Koçak, Turkey
Utpal Chaudhuri, India
Yeşim Aydınok, Turkey
Yi Le, USA
Zeynep Gözde Özkan, Turkey