O papel modulador do gene AIRE - capes

MANUSCRITOpBluescript and Lafmid) and were amplified in 384- or 96-well plates usingvector-PCR amplification with the following primers, which recognize the threevectors: LBP 1S GTGGAATTGTGAGCGGATACC forward and LBP 1ASGCAAGGCGATTAAGTTGG reverse.The microarrays were prepared based on published protocols using PCRproducts from the cDNA clones [Hedge et al., 2000] using a Generation III ArraySpotter (Amersham Molecular Dynamics, Sunnyvale, CA, USA). A completefile providing all genes and ESTs present in the microarrays used in this study isavailable on line at (www.rge.fmrp.usp.br/passos/mmu_array)Complex cDNA probe preparation and hybridizationThe cDNA complex probes derived from total RNA obtained of control orAire silenced 3.10 mTECs were prepared by reverse transcription using 10 µgof total RNA. For this study, we opted for monocolor labeling and then the cDNAsamples were labeled with Cy3 fluorochrome using the CyScribe post labelingkit (GE Healthcare Biosciences). The 15 hour period required for hybridizationwas allowed to elapse, followed by washing, using an automatic slide processorsystem (ASP, Amersham Biosciences) and microarrays were scanned using aGeneration III laser scanner (Amersham Biosciences).As a reference for the hybridization procedure, we used equimolarquantities of cDNAs obtained from unrelated total RNA (mouse thymus totalRNA). This approach allowed estimation of the amount of cDNA target in eachmicroarray spot.cDNA microarray data analysisThe microarray image quantification was performed using the Spotfindersoftware (http://www.tm4.org/spotfinder.html). The normalization process wascarried out using the R platform (http://www.r-project.org) and statistical data210