O papel modulador do gene AIRE - capes

MANUSCRITOwere transfected with 10 nM of anti-Aire siRNA using Hiperfect reagent(Qiagen) following manufacturer’s instructions.After transfection, cells were cultured during 24 h in RPMI medium asabove mentioned and total RNA was extracted using the mirVana kit(Ambion), which served as template for cDNA synthesis. Gene knockdownwas confirmed by semi-quantitative reverse transcription PCR (RT-PCR)using the primers 5’ CATCCTGGATTTCTGGAGGA 3’ forward and 5’GCTCTTTGAGGCCAGAGTTG 3’ reverse, which allowed amplification of a253 bp PCR product corresponding to a segment of the Aire mRNA (cDNA).The PCR mix contained 200 uM dNTPs, 1.5 mM MgCl 2 , 50 mM KCl, 10 mMTRIS-HCl (pH 8.4), 10 uM each primer and 2 U Taq DNA polymerase. Thecycling temperature was: 35 x 30 sec each (94 o C, 57 o C and 72 o C).An anti-HPRT siRNA included in this kit but whose sequence was notfurnished was used in parallel to evaluate the efficiency of the geneknockdown assay on 3.10 mTEC cell line (data not shown).cDNA microarrayThe gene expression of 3.10 mTEC cell line was assessed using glassslide cDNA microarrays prepared on silane-coated UltraGAPS slides (# 40015,Corning ®, New York, NY, USA) containing a total of 4,500 target tissuerestricted antigen cDNA sequences representing most of murine tissue andorgans. These were from the Soares thymus 2NbMT normalized library,representing expressed sequence tag (ESTs) cDNA clones prepared from thethymus of a C57BL/6J 4-week-old male mouse, and available at the IMAGEConsortium (http://image.llnl.gov/image/html/iresources.shtml). The cDNAinserts were homogeneous in size (near 1 kb), cloned in three vectors (pT7T3D,209