continuación de parasitología latinoamericana y revista ibérica de ...

REVISTA IBERO-LATINOAMERICANA DE PARASITOLOGIAEditorHéctor Alcaíno Contador (Chile)Editor AlternoPablo Diez Baños (España)Co-Editores (Receiving Editors)A. Martínez Fernández (UCM - España)F. Martínez Ubeira (USC - España)Mª D. Bargues (UV - España)F. Rojo Vazquez (ULE - España)W. Apt (Universidad de Chile)Secretaria de EdiciónMª Patrocinio Morrondo Pelayo(Secretaria Científica de la Soc. Española de Parasitología. USC)Comité EditorialAna Espino (Univ de Puerto Rico)Anne F. Petavy (Lyon, Francia)Benjamín Cimerman (Brasil)César Náquira (Perú)Claudio Genchi (Italia, Milán)Christian Epe (Hannover, Alemania)David Rollinson (Natural History MuseumLondon, UK)Douglas Colwell (Lethbridge, Alberta. Canadá)David Botero (Colombia)Edoardo Pozio (Roma, Italia)Els Meeusen (Monash University, Australia)George Hillyer (Puerto Rico, USA)Guillermo Denegri (Argentina)Heinz Mehlhorn (Bochum, Alemania)Hernán Reyes (Chile)Jacques Cabaret (INRA, Tours, Francia)Jack Frenkel (Nueva México, USA)Jean Dupouy-Camet (Paris)Jorge Guerrero (Philadelfia, USA)Jorge Sapunar (Chile)J. Barret (Presidente Sociedad Británica deParasitología)J.P. Dubey (Iowa. USA)JM Correia da Costa (Portugal)J. Guisantes del Barco (Univ. del País Vasco, España)Luca Rossi (Turín, Italia)Michel Tibayrenc (Montpellier, Francia)Naftale Katz (Belo Horizonte, Brasil)Osvaldo Ceruzzi (Uruguay)Pascal Boireau (Francia)Paul de Rycke (Gent, Bélgica)Peter Schantz (Atlanta, USA)Philippe Dorchies (Touluse, Francia)Ramón Carreño Passow (Ohio WesleyanUniversity, USA)Ramón Lazo (Ecuador)Raúl Romero Cabello (México)Rodrigo Zeledón (Costa Rica)Thomas Schnieder (Director Institute forParasitology, Hannover, Alemania)Yves Carlier (Bruselas, Bélgica)5

ContenidoPanadero R., Díez-Baños P., Morrondo P., Paz-Silva A. y Sánchez-Andrade R............................ 109- Infestación múltiple por ácaros ectoparásitos en conejos de crianza.Calderón-Arguedas O., Troyo A., Avendaño A., Aymerich R., Berrocal B. yCoto-Morales T............................................................................................................................... 114COMUNICACIONES- Primer reporte de Dracunculus spp. en la provincia de Santa Argentina.Bono Battistoni M.F ., Orcellet., Plaza D., Gutiérrez G., Ciepielak M. y Peralta J.L.................... 119- Occurrence of Cryptosporidium spp. oocysts in mammals at a zoo in southern Brazil.Ludwig R. and Marques S.M.T........................................................................................................ 122SEMBLANZA- In memoria del Prof. Sr. Víctor Muñoz Flores............................................................................... 48- In memorian del Prof. Dr. Antonio Atías MartinWerner Apt...................................................................................................................................... 129Normas de publicación......................................................................................................................... 1307

PREGNANCY AND HUMORAL IMMUNE RESPONSE AGAINST T. CRUZIcolas. A los 10 días de infección las ratas fueron apareadas y a los 21 días de gestación fueron sacrificadas.La parasitemia fue significativamente (P < 0,05) más alta en las ratas preñadas infectadas con la cepa Y(PY n = 10) en comparación con las ratas preñadas infectadas con la cepa ASM (PASM n = 10) y que enlas vírgenes infectadas con T. cruzi. La evaluación inmunológica mediante la aplicación de inmunofluorescenciaindirecta confirmó resultados positivos para las inmunoglobulinas (Igs) IgA e IgM anti-T. cruzi en elcerebro (C) de 15 (75%) de las 20 ratas infectadas preñadas. La mayor frecuencia de Igs fue observada enel C de 8 ratas (80%) PASM y en 7 ratas preñadas (70%) PY. En la médula espinal (ME) las Igs de los isotiposIgA e IgM anti-T. cruzi fueron observadas en 9 (45%) de las 20 ratas infectadas preñadas y con mayorfrecuencia en la región sacra de la ME de 5 ratas preñadas (50%) PASM seguida de 4 ratas preñadas (40%)PY. El análisis histológico con Hematoxilina y Eosina y la inmunotinción con Peroxidasa anti Peroxidasadel C, ME, corazón y musculo esquelético de las ratas preñadas, mostró infiltrado de células mononucleares,nidos de amastigotes y reacción antigénica de T. cruzi. Las lesiones inflamatorias y destrucción delos tejidos cardíaco y muscular esquelético confirmaron miocarditis chagásica aguda y miositis en las rataspreñadas. En los tejidos nerviosos de las ratas vírgenes infectadas no se observó Igs específicas anti-T. cruzi,ni parasitismo, ni alteraciones histológicas. Estos resultados son indicativos de que la preñez incrementa lasusceptibilidad del sistema nervioso central de las ratas de adquirir infecciones debido a la modificación dela respuesta inmune humoral. El hallazgo de IgA e IgM específicos fueron marcadores de la infección agudapor T. cruzi en el C y ME de las ratas preñadas.Palabras clave: Trypanosoma cruzi, inmunoglobulina, cerebro, Medula espinal, ratas preñadas.INTRODUCCIÓNLa enfermedad de Chagas o tripanosomiasis americanaes una entidad clínica causada por el protozoariohemoflagelado digenético de la Familia Trypanosomatidaedenominado Trypanosoma (Schizotrypanum)cruzi (Chagas, 1909), el cual se multiplica en los tejidosde hospedadores vertebrados.La infección constituye un problema de saludpública en América Latina donde 18 millones depersonas aproximadamente se encuentran infectadasy otras 100 millones en riesgo de infección,principalmente en el medio rural donde las condicionesecológicas son favorables para el alojamientoy desarrollo de los insectos vectores hematófagostransmisores de T. cruzi (OPS, 2003).En la naturaleza la principal vía de transmisióndel parásito ocurre a través del contacto directo delas excretas postprandiales conteniendo tripomastigotesmetacíclicos de los triatominos vectores de laFamilia Reduviidae, durante la ingesta sanguíneasobre humanos y otros vertebrados (Rodríguez etal, 2004). Una vez en el hospedador vertebrado lainfección por T. cruzi desarrolla una fase aguda inicialcon duración de varias semanas, una fase indeterminaday una fase crónica que persisten de porvida en el hospedador infectado.Durante la fase aguda se reconoce la presenciade parasitemias patentes, períodos febriles, inflamaciónde los ganglios linfáticos, hepatoesplenomegaliay elevados niveles de inmunoglobulinasIgM. Con el progreso de la infección de Chagasagudo se elevan los niveles de anticuerpos IgA eIgG y se intensifica el parasitismo tisular afectandofrecuentemente los tejidos cardíaco, muscular esqueléticoe intestinal (Scorza y Scorza, 1972ª; Guillenet al, 2001). La infección causa severos dañospor acción directa del parásito sobre las célulasinfectadas e indirectamente por inducción del desarrollode hipersensibilidad, de fenómenos autoinmunes,producción de intensos procesos inflamatoriosy en algunos casos se desarrollan patologíasneurológicas ( Lorca et al, 1989).La naturaleza sistémica de la infección por T.cruzi durante la interacción parásito-hospedadorafectan la modulación de la respuesta inmunológicadel paciente, favoreciendo la activación endotelialde la microvasculatura cerebral y en ocasionesla infección de los tejidos nerviosos (Forbes et al,1983; Lugo de Yarbuh et al, 2006).Otras investigaciones han revelado que la infecciónde los tejidos cerebrales puede ser rápidamenteactivada en humanos debido a la presencia deotra enfermedad severa, como los que sufren el síndromede inmunodeficiencia adquirida, meningoencefalitisaguda con focos múltiples de encefalitisRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 6-159

A. LUGO de YARBUH et al.descritos como nódulos o granulomas glial/microglialo en pacientes sometidos a terapias inmunosupresorasen los cuales es frecuente el desarrollo delesiones tumorales, necrosis y hemorragias cerebrales(Leiguarda et al, 1990; Antunes et al, 2002).Por otro lado, bajo ciertas condiciones patológicasse produce la reactivación de la infección por T.cruzi, afectando los tejidos muscular esqueléticoy cardíaco en pacientes con enfermedades autoinmuneso en mujeres embarazadas con infecciónchagásica crónica, las cuales se encuentran expuestasa frecuentes picadas de los insectos vectores deT. cruzi en regiones endémicas para la enfermedadde Chagas. En estos casos se ha registrado aumentode la parasitemia patente principalmente durante eltercer trimestre de gestación así como la transmisiónde T. cruzi a nivel placentario o sistémico (Torricoet al, 2006).En este sentido es posible considerar que lagestación estaría asociada con la variación de ciertosparámetros inmunológicos humorales y celulares,por lo que los efectos de la infección por T.cruzi sobre el Sistema Nervioso Central (SNC) sepotencian durante el período de gestación, favoreciéndoseel alcance de los parásitos del parénquimacerebral en fagocitos mononucleares y el paso porla barrera sanguínea formada por la estrecha uniónentre las células endoteliales de la microvasculaturacerebral de los animales infectados durante elperíodo de gestación (Drevets y Lleenen, 2000).En base a las investigaciones antes mencionadasen el presente estudio se propuso estudiar el efectode la preñez sobre la circulación de los tripanosomasal sistema nervioso central de ratas gestantes, através de la expresión de inmunoglobulinas específicasde los isotipos IgA e IgM anti-T. cruzi medianteinmuofluorescencia indirecta convencional (IFI) y lareacción antigénica específica por inmunotinción conPeroxidasa anti-Peroxidasa (PAP) en el cerebro ymédula espinal de las ratas con infección aguda producidapor dos aislados de T. cruzi. Las alteracioneshistopatológicas en el corazón y músculo esqueléticode las ratas gestantes fueron analizadas mediante lacoloración con Hematoxilina y Eosina (HE).MATERIAL Y MÉTODOSParásitos: Se utilizaron tripomastigotes sanguícolasde las cepas M/HOM/Ve/92/ASM aislada deun caso agudo con enfermedad de Chagas en Venezuelay M/HOM/BRA/53/Y de T. cruzi aislada deun caso agudo en Brasil con linajes filogenéticosTcI y TcII respectivamente. La caracterización molecularde las formas flageladas de los aislados deparásitos fue realizada mediante ADN específicopor la Reacción en Cadena de la Polimerasa (PCR)(González et al, 1994) y el linaje de los parásitoscultivados fue analizado mediante Random Amplificationof Polymorphic DNA (RAPD) (Carrasco etal, 1996).Animales: Un total de 40 ratas albinas cepa Wistarde 3 meses de nacidas y con 200 gr de pesofueron separadas en cuatro grupos. Las ratas fueronidentificadas como infectadas preñadas con la cepaASM (PASM, n = 10), infectadas preñadas con lacepa Y (PY, n = 10) y ratas controles vírgenes infectadas(IASM, n = 10) e (IY, n = 10).Infección de las ratas y apareamiento: Lostripanosomas usados en la infección de las ratasfueron obtenidos de la sangre de ratones machosNMRI que presentaron alta parasitemia patente.Un inoculo de 2 x 10 5 tripanosomas en 0,05 mL desuspensión de cada cepa de T. cruzi fue estimadosiguiendo la técnica de Brener (1962). . Las 40 ratasfueron separadas en dos grupos de 20 ratas cadauno para ser infectadas por inyección intraperitoneal(ip) de 0,05 mL de la suspensión de parásitosde la cepas ASM y Y respectivamente.A los 12 días post-infección (pi) a 20 de las ratasinfectadas con las diferentes cepas de T. cruziles fue revisado el contenido vaginal el cual fuecolocado en láminas portaobjeto y coloreado conazul de metileno. La presencia de células nucleadasy epiteliales cornificadas en el moco vaginal comprobóque las ratas se encontraban en estro o proestrodel ciclo estral (Marcondes et al, 2002). En jaulasindividuales fueron colocadas 2 ratas hembrascon 1 macho durante tres días para que ocurriera elapareamiento y una vez comprobada la presenciade espermatozoides en el frotis del contenido vaginal,las hembras fueron separadas de los machosy revisadas para controlar la preñez. Los animalesfueron mantenidos en condiciones controladas detemperatura, humedad relativa y alimentadas conRatarina® y agua ad libitum.Análisis de la parasitemia patente: El curso dela parasitemia patente (PP) en las ratas infectadaspreñadas fue evaluado revisando muestras de 5 µLde sangre de cada rata ligeramente anestesiada con10Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 6-15

PREGNANCY AND HUMORAL IMMUNE RESPONSE AGAINST T. CRUZIvapores de cloroformo. La sangre fue obtenida delplexo retro orbital con capilares heparinizados alos 10; 20; 25 y 35 días post-infección (pi) y con0; 16; 18 y 21 días de gestación respectivamente.La PP en las 20 ratas vírgenes infectadas con lasdiferentes cepas de T. cruz fue determinada en losmismos días pi que las ratas infectadas preñadas.El resultado de la PP fue expresado con el númerode Tripanosomas/mm (Rodríguez et al, 2004)(Trips/mm 3 ) de sangre y las diferencias entre lasmedias de la PP entre los grupos de ratas infectadaspreñadas y vírgenes infectadas con T. cruzi, fueroncomparadas mediante un análisis de varianza noparamétrico de un factor (Kruskal y Wallis, 1952).Obtención de los tejidos: Para la evaluación dela infección en el C, ME, corazón y músculo esqueléticode las ratas preñadas PASM y PY con 35días de infección y 21 días de gestación así como enlas vírgenes infectadas con las diferentes cepas deT. cruzi, las ratas fueron anestesiadas con vaporesde cloroformo. Luego se expuso la caja torácica yse bloqueó la arteria aorta descendiente, se cortó lavena cava y se introdujo 300 mL de solución fisiológicaa través del ventrículo izquierdo, seguido dela solución de fijación del tejido compuesta de 500mL de paraformaldehido al 4% en tampón PBS apH 7,2 durante 10 min. Los tejidos fueron extraídospara realizar los estudios histopatológico con HE yla evaluación inmunológica por IFI y PAP.Estudio histopatológico: Una vez fijada laporción anterior del animal se extrajo el cerebrocompleto, las regiones cervical (RC), lumbar (RL),torácica (RT) y sacra (RS) de la ME, el corazóny músculo esquelético. Los tejidos fueron fijadosen formalina neutra al 10% durante 48 hr, sedeshidrataron en alcohol isopropílico entre 70% y100%, alcohol-acetona 1:1, acetona-xilol 1:1 y xiloly se impregnaron con Paraplast a 56 o C (MonojectScientific, St. Louis, MO. USA) durante 12 hr a 60 0C. Los cortes de 7 µm de espesor fueron coloreadoscon Hematoxilina y Eosina (HE).Tinción con Hematoxilina y Eosina: Los cortesde 7 µm del C, ME, corazón y músculo esqueléticofueron colocados sobre láminas portaobjetos tratadascon Poly-L-Lisina (Sigma Aldrich, St. Louis,USA) al 0,1% en agua deionizada, luego fuerondesparafinados, rehidratados en alcohol isopropílicoentre 100% y 70% y agua destilada, coloreadoscon Hematoxilina de Mayer, contra-coloreados conEosina, deshidratados con alcohol isopropílico entre70% y 100% y cubiertos con Mar-Tex y cubreobjeto.Inmunotinción: Peroxidasa anti-Peroxidasa:Los cortes de C y ME de las ratas infectadas preñadasy vírgenes infectadas, fueron desparafinados,hidratados, incubados con peróxido de hidrógeno al3% en metanol durante 45 min y lavados con PBS apH 7,2. Luego fueron incubados con suero normalde cabra al 30% diluido en solución de Buffer Fosfatoa pH 7,2 por 30 min, lavados con PBS, incubadoscon suero de conejo anti-T. cruzi diluido 1:100por 1 hr y con suero de conejo anti-IgG conjugadoa Peroxidasa diluido 1:500 durante 45 min. Lasmuestras se revelaron con 3,3ʹDiaminobenzidina-Urea, se lavaron con PBS y se contracolorearon conHematoxilina de Mayer. Los cortes se cubrieroncon Mar-tex y cubreobjeto (Sell y Burton, 1981).Análisis de inmunoglobulinas IgA e IgM anti-T. cruzi: IFI: Los cortes de C y de la ME desparafinadosy rehidratados se cubrieron con soluciónde Tritón al 0,1% en PBS a pH 7,2 por 30 min, selavaron con PBS y se incubaron con suero normalde cabra al 30% en PBS por 30 min. Luego se incubaroncon suero de conejo anti T. cruzi diluido1:300 en una solución de PBS-SAB (Suero Albuminade Bovino) al 0,05% por 45 min y con suerode conejo anti-rata IgA o anti-rata IgM conjugadoa Isotiocianato de Fluoresceína (Sigma, St. Louis,USA) diluido 1:500. Los cortes se cubrieron conglicerina en PBS a pH 7,2 en una relación 9:1 y concubreobjeto.Los animales utilizados en este estudio fuerontratados siguiendo las normas establecidas para elmanejo de animales experimentales en el laboratorio,por el comité de Bioética y Seguridad del FondoNacional de Ciencias y Tecnología en su capítulo 2y Bioética animal en Venezuela (De Jesús, 2002).RESULTADOSLos valores de la parasitemia patente (PP) en lasratas preñadas infectadas con la cepa Y fueron de10 ± 9,2; 22 ± 8,3; 20 ± 16,5 y 11 ± 3,1 Trips/mm 3de sangre obtenidos a los 10; 20; 25 y 35 días deinfección y con 0; 16; 18 y 21 días de gestación respectivamente.En las ratas vírgenes IY infectadascon la cepa Y los valores de la PP fueron de 8 ± 2,1;10 ± 7,2; 11 ± 2,2 y 3 ± 0,7 Trips/mm 3 de sangre yregistrados en los mismos días pi que la PP de lasRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 6-1511

A. LUGO de YARBUH et al.ratas preñadas PY (Figura 1).Los valores de la PP en las ratas preñadas infectadascon la cepa ASM fueron de 3 ± 1,3; 11 ±4,8; 13 ± 5,1 y 4 ± 1,7 Trips/mm 3 de sangre obtenidosa los 10; 20; 25 y 35 días de infección y con0; 16; 18 y 21 días de gestación respectivamente.En las ratas vírgenes IASM infectadas con la cepaASM la PP fue de 2 ± 0,41; 6 ± 3,5; 4 ± 2,9 y 2 ±0,40 Trips/mm 3 de sangre y registradas en los mismosdías pi que la PP de las ratas preñadas PASM(Figura 2).Las diferencias en el promedio de las PP entrelos grupos de ratas infectadas preñadas y vírgenesinfectadas resultaron significativas (P < 0,05).Evaluación de la respuesta humoral: Laevaluación inmunológica por IFI mostró resultadospositivos para las inmunoglobulinas (Igs) IgA eIgM anti-T. cruzi en el cerebro de 15 (75%) ratasy en la médula espinal de 9 (45%) ratas de las 20ratas infectadas preñadas analizadas.Al analizar la frecuencia de las Igs específicasen el C de las ratas se observó la IgM en 8 (80%)ratas PASM y en 7 (70%) ratas PY de las 10 ratasinfectadas preñadas en cada grupo.Para la IgA anti-T. cruzi los resultados fueronpositivos en el C de 5 (50%) ratas PASM y en el Cde 3 (30%) ratas PY de las 10 ratas analizadas encada grupo.En relación con la respuesta inmune humoralespecífica inducida por T. cruzi en la médula espinalde las ratas preñadas e infectadas con las diferentescepas de parásitos, la evaluación inmunológicamostró resultados positivos para las Igs de losisotipos IgA e IgM anti-T. cruzi en las regiones RC,RT, RL y RS de la ME de 9 de las 20 ratas infectadaspreñadas analizadas.La IgA fue detectada en 5 (50%) ratas PASM yen 4 (40%) ratas PY de cada 10 ratas de los gruposanalizados mientras que la IgM fue detectada 3(30%) ratas PASM y en 3 (30%) ratas PY de cada10 ratas de los grupos analizados.Las Igs se observaron con más frecuencia enla RL de las ratas preñadas infectadas con la cepaASM de T. cruzi y con distribución similar en lasregiones RC y RT de la ME de ambos grupos deratas PASM y PY. La mayor frecuencia de IgA eIgM fue detectada en la RS de la ME de 5 ratasPASM seguida de 4 ratas PY.Ninguna reacción positiva de IgA e IgM fueobservada en las muestras de los tejidos nerviososde las ratas vírgenes infectadas con las diferentescepas de T. cruzi.En la Figura 3 se destacan las células neuronalesdel C de rata preñada marcadas con inmunofluorescenciaque representan las inmunoglobulinas delos isotipos IgA e IgM anti-T. cruzi y en el GráficoFigura 1. Parasitemia patente en las ratas infectadas preñadas(PY) a los 10, 20, 25 y 35 días de infección con lacepa Y de T. cruzi y con 0, 16, 18 y 21 días de gestación(▬■▬) y en las ratas vírgenes infectadas (IY) entre 10 y35 días de infección (--♦--) ± Desviación estándar.Figura 2. Parasitemia patente en las ratas infectadaspreñadas PASM a los 10, 20, 25 y 35 de infección con lacepa ASM de T. cruzi y con 0, 16, 18 y 21 días de gestación(▬■▬) y en las ratas vírgenes infectadas (IASM) entre10 y 35 días de infección (--♦--) ± Desviación estándar.12Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 6-15

PREGNANCY AND HUMORAL IMMUNE RESPONSE AGAINST T. CRUZIFigura 3. Neuronas del cerebro de ratas preñadas que muestran células marcadas con inmunofluorescencia y presentaninmunoglobulinas de los isotipos A) IgA y B) IgM anti- T. cruzi en las ratas infectada con las cepas Y y ASM de T. cruzirespectivamente. (IFI. 400X y 1000X).Gráfico 1. Número de ratas PASM y PY con 21 días depreñadas y 35 días de infección con las cepas ASM y Yde T. cruzi que mostraron inmunoglobulinas específicasde los isotipos IgA e IgM en el cerebro y en la médulaespinal.Figura 4. Sección de cerebro de rata preñada PASMe infectada con la cepa ASM de T. cruzi en la que seobservan amastigotes, fuerte reacción antigénica de T.cruzi y linfocito activado cerca a cuerpos neuronales ygliales con histología conservada (→) (PAP. 1000X).1 se representa el número de ratas preñadas quemostraron respuesta inmune humoral IgA e IgMespecífica anti-T. cruzi.Detección de antígeno de T. cruzi: La inmunotincióncon PAP del tejido nervioso reveló intensareacción antigénica de T. cruzi en el cerebrode 12 (60%) de las 20 ratas preñadas infectadas conlas distintas cepas de parásitos. En estas muestrasfue frecuente observar la presencia de amastigoteslibres e intensa reacción antigénica en el parénquimacerebral de las ratas infectadas preñadas. Porotro lado, es importante destacar la presencia delinfocitos entre los cuerpos neuronales y gliales delcerebro de las ratas preñadas infectadas con la cepaASM de T. cruzi (Figura 4).Estudio histopatológico: En los cortes del corazónde las ratas PY preñadas infectadas con la cepaY de T. cruzi se destaca el marcado miotropismocon destrucción de células cardíacas, denso infiltradoinflamatorio de naturaleza linfoplasmohistiocitarioen las áreas de daño cardíaco y nidos de amastigotesen las fibras musculares cardíacas indicandomiocarditis chagásica aguda (Figura 5 A y B).En el músculo esquelético de las ratas preñadasinfectadas con las diferentes cepas de parásitos fuefrecuente la presencia de infiltrado inflamatorio decélulas mononucleares y polimorfonucleares juntoa nidos de amastigotes y destrucción de la fibraRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 6-1513

A. LUGO de YARBUH et al.Figura 5. Secciones del miocardio de rata preñada PY infectada con la cepa Y de T. cruzi que muestran A) nido deamastigotes en la fibra cardíaca. En B) se observa denso infiltrado inflamatorio linfoplasmohistiocitario ocupando elespacio de las fibras cardíacas parcialmente destruidas. (HE. 1000X).Figura 6. Secciones de músculo esquelético de rata preñada PY y PASM infectadas con las cepas Y y ASM de T.cruzi que muestran A) nido de amastigotes. En A y B) se destacan áreas con intensa destrucción de la fibra muscularesquelética sustituida por infiltrado inflamatorio (HE. 1000X, 400X).muscular esquelética indicando miosistis aguda(Figura 6 A y B).En las secciones de los tejidos cardíaco y muscularesquelético de las ratas vírgenes IASM e IYinfectadas con las diferentes cepas de T. cruzi seobservaron leves alteraciones histopatológicas,discreta parasitosis y moderados procesos inflamatoriosen comparación con las severas alteracioneshistopatológicas encontradas en los tejidos de lasratas infectadas preñadas.DISCUSIÓNEn años recientes las investigaciones han llamadola atención sobre el resurgimiento de la enfermedadde Chagas, la cual provoca una gran diversidadde manifestaciones clínicas con afecciones en lostejidos cardíaco, muscular esquelético, digestivo ymuy pocas veces compromete el sistema nerviosocentral. Sin embargo, existen evidencias en otraspatologías cerebrales provocadas por virus y bac-14Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 6-15

PREGNANCY AND HUMORAL IMMUNE RESPONSE AGAINST T. CRUZIterias que revelan que la célula endotelial de lamicrovasculatura cerebral, elemento esencial en labarrera sanguínea cerebral puede ser alterada facilitandola infiltración de microorganismos en monocitosy macrófagos activados circulantes (Drevetsy Lleenen, 2000). En este estudio, el análisis dela parasitemia por T. cruzi en el cerebro y médulaespinal de las ratas preñadas e infectadas con lasdiferentes cepas de T. cruzi, reveló la presenciade amastigotes cercanos a procesos inflamatoriosneuroinmunes de células mononucleares, hechoque pudiera explicar la posibilidad de entrada de T.cruzi en leucocitos infectados al SNC de las rataspreñadas. Por otro lado, estos resultados posiblementese relacionen con un conjunto de factorestales como, la respuesta inmune supresora desarrolladaen las ratas gestantes con infección chagásicaaguda debido al incremento de la parasitemia, porla duración del estímulo antigénico, la liberación decitocinas y hormonas en la sangre durante la gestación,hechos que sugieren la modificación de larespuesta inmunológica durante la preñez, produciendoen consecuencia la exacerbación de la parasitemiay la participación del sistema inmune en lagénesis de lesiones neuronales (Silva et al, 1999),como ocurre en pacientes con esclerosis múltiple ocon enfermedades neurodegenerativas (Menezes etal, 1992).Por otro lado, el hallazgo de inmunoglobulinasespecíficas de los isotipos IgA e IgM lo han relacionadocon la presencia de células microgliales activadasque facilitan la entrada de parásitos al SNCen macrófagos periféricos (Giulian et al, 1993),estimulando la respuesta inmune humoral con incrementosignificativo de Ig del isotipo IgM anti-T.cruzi marcador indicativo de infección aguda y deIgA específica la cual contribuye con informaciónadicional de una infección aguda por T. cruzi enel cerebro y médula espinal de las ratas durante elperíodo de gestación.En este estudio la infección por T. cruzi revelódiferentes patrones en la parasitemia patente enlas ratas preñadas, la cual se mantuvo alta por mástiempo y produjo mayores efectos histopatológicoscon características de respuesta inmunológica celularen los tejidos nervioso, cardíaco y muscularesquelético de las ratas preñadas PY y PASM infectadascon T. cruzi. En ese sentido es importanteconsiderar que existen una serie de factores que serelacionan con el incremento de la parasitemia porT. cruzi en mujeres embarazadas, como el desarrollode la respuesta inmune humoral y celular debidoa la presencia del parásito durante la fase aguda dela infección, generando reacciones inflamatoriasde leucocitos mononucleares, linfocitos con signosde activación, macrófagos, neutrófilos, miocarditisy miosistis chagásica aguda y la presencia de Igsen los tejidos nerviosos de las ratas preñadas PY yPASM, resultados que confirman la gran variabilidaden la infectividad y patogenicidad de las cepasde T. cruzi frente a los diferentes patrones de parasitemiade las ratas preñadas (Moreno et al, 2006).La fase aguda inicial de la infección con T. cruzies usualmente asintomática y en muy pocos casosse desarrolla encefalitis chagásica, por lo que lascomplicaciones cerebrovasculares de origen cardioembólicose presentan con más frecuencia enla fase crónica de la infección, en la que aumentala susceptibilidad de adquirir nuevas infeccioneso reactivación de la infección crónica durante lapreñez como ocurre en malaria murina por Plasmodiumbergei (Van Zon y Eling, 1980).Por otro lado, las variaciones de la respuestahumoral específica anti-T. cruzi con incremento deIgM en las ratas preñadas, la disminución de losniveles de inmunoglobulinas particularmente delos isotipos IgG2a e IgG3 en ratones preñadas crónicamenteinfectados con T. cruzi y la activaciónpoliclonal de las células B, revelan el efecto de lapreñez sobre la infección de los tejidos maternales(Carlier et al, 1987; Moreno et al, 2005). En ocasionesla fase aguda de la enfermedad de Chagasse manifiesta como una meningoencefalitis agudaen niños nacidos de madres con infección chagásicaaguda y en pacientes inmunosuprimidos coninfecciones virales, en los que se han detectado formaciónde masas tumorales en el sistema nerviosocentral, sin embargo, no es frecuente observar losparásitos dentro de las neuronas y por otro lado sedesconoce el tipo de célula glial de la microglía infectadapor T. cruzi (Del Castillo et al, 1990).Otras observaciones han revelado que las afeccionesen los tejidos nerviosos se producen cuandofragmentos de trombos formados en el ventrículoizquierdo, migran junto con los parásitos por víasanguínea al cerebro de pacientes con insuficienciacardiaca (Spina-Franca et al, 1988; Pittella, 1993),a diferencia de lo que ocurre con la penetración activade T. brucei brucei a ciertas áreas del cerebroen el que se produce acumulación de parásitos en elRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 6-1515

A. LUGO de YARBUH et al.área perivascular entre las membranas basales endotelialesy parenquimales (Masocha et al, 2004).Algunos autores han relacionado la presenciade tripanosomas y los signos neurológicos con elhallazgo de IgM el cual se presenta como un indicadorde infección en el SNC con producción delesiones neuronales. En ese sentido la presencia deamastigotes y antígenos de T. cruzi cerca de neuronasinflamadas ocurre debido a mecanismos inmunológicos,hallazgos soportados por el encuentrode anticuerpo monoclonal citotóxico en neuronasde mamíferos in vitro y por la activación de reaccióninflamatoria y destrucción de neuronas en elcerebro y de motoneuronas en la médula espinal acausa del efecto directo de la activa replicación delparásito en ratones con infección aguda (Bisser etal, 2002; Lugo de Yarbuh et al, 2006).Otros estudios han revelado que durante el embarazose producen alteraciones en algunos factoresen la respuesta inmune, relacionados con lasupresión transitoria de la inmunidad celular paraprevenir el rechazo al feto (Hermann et al, 2004),incrementándose la posibilidad de infecciones pororganismos patógenos en mujeres durante la gestación,en las que se ha observado inmunodepresiónde tipo celular e incremento de la inmunoglobulinaM en el curso del embarazo. Estos hechos han sidointerpretados como evidencia de infección (Eastonet al, 1998), asociadas con las modificaciones inmunológicasy con cambios hemodinámicos en ellecho endotelial, factores que condicionan la susceptibilidada la infección en el sistema cerebrovascular(Easton et al, 1998). En este estudio la detecciónsimultánea de anticuerpos específicos IgA eIgM anti-T. cruzi confirmó la presencia del parásitoen los tejidos nerviosos de las ratas que mostraronelevadas parasitemia y en las que desarrollaronprocesos inflamatorios en los tejidos cerebrales ymedulares, por lo que se sugiere que la barrera sanguíneaendotelial sufre alteraciones o modificacionescelulares las cuales facilitan el transporte y laentrada de parásitos al SNC de las ratas gestantesen leucocitos infectados con T. cruzi.En relación con mujeres embarazadas infectadascon T. cruzi se ha determinado que en algunoscasos no se presentan síntomas o signos atribuiblesa la enfermedad de Chagas y probablemente noocurre infección del SNC, en este sentido se ha reportadoque un bajo porcentaje de mujeres desarrollanencefalitis con cambios inflamatorios discretosen el SNC mientras que en otros casos se produceun incremento de la parasitemia patente con detecciónde IgM específico considerado marcadorindicativo de infección aguda de la enfermedad deChagas maternal, mientras que en algunos casos laIgM se ha observado durante el último trimestre degestación período durante el cual las células hospedadorasson atacadas por T. cruzi y destruidas porlos antígenos (Vieira et al, 1983).Finalmente concluimos afirmando la importanciaque requiere conocer las modificaciones que seproducen en la respuesta inmune humoral en lasmujeres embarazadas que residen en áreas ruralesendémicas para la enfermedad de Chagas, en dondela transmisión del parásito puede efectuarse por lasdiferentes especies de triatominos y en las que seencuentran en zonas urbanas no endémicas dondeel parásito circula entre la población humana,vectores intradomiciliarios, reservorios silvestres yanimales domésticos (Lugo de Yarbuh et al, 2010).REFERENCIAS1. ANTUNES AC, CECCHINI F, BOLLI F, POLANCYKDE OLIVEIRA P, GURGEL R, LAMPERT T, FRICKED. 2002. Cerebral trypanosomiasis and aids. ArqNeurom Psiquiatr 60: 730-733.2. BISSER S, LEJON V, PREUX P, et al. 2002. Bloodcerebrospinal fluid barrier and intrathecal immunoglobulinscompared to field diagnosis of central nervoussystem involvement in sleeping sichness. J Neurol Sci15: 127-135.3. BRENER Z. 1962; Observações sobre a imunidade asuperinfecçoes em camundongos experimentalmenteinoculados com Trypanosoma cruzi e submetidos atratamento. Inst Med Trop São Paulo 4: 119-123.4. CARLIER Y, RIVERA M T, TRUYENS C, GOLGMANM, LAMBERT P, FLAMENT J, BAUWENS D, VRAYB. 1987. Pregnancy and humoral responses in micechronically infected by Trypanosoma cruzi. InfectImmunol 55: 2496-2501.5. CARRASCO HJ, FRAME I, VALENTE S, MILES M.1996. Genetic exchange as a possible source of genomicdiversity in sylvatic population on Trypanosoma cruzi.Am J Trop Med Hyg 54: 418-424.6. CHAGAS C. 1909. Nova trypanosomiasis humana. Estudosobre a morfologia e o ciclo evolutivo do Schizotrypanumcruzi, N. Gen. Mem Inst Oswaldo Cruz 1:159-218.7. DE JESÚS R. 2002. Bioética animal en Venezuela. RevFac Farm ULA 43: 15-18.8. DEL CASTILLO M, MENDOZA G, OVIEDO J, PÉ-REZ-BIANCO RP, ANSELMO AE, SILVA M. 1990.AIDS and Chagasʹdisease in central nervous systemtumor-like lesion. Am J Trop Med Hyg 88: 693-694.16Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 6-15

PREGNANCY AND HUMORAL IMMUNE RESPONSE AGAINST T. CRUZI9. DREVETS DA, LLEENEN PJ. 2000. Leukocyte-facilitatedentry intracellular pathogens into the centralnervous system. Microb Infect 2: 1609-1618.10. EASTON JD, HAUSER SL, MARTIN JB. 1998.Cerebrovascular diseases. In: Harrison, TR. Principlesof internal medicine. 14th ed. New York. McGrawHill;p. 2325-2348.11. FORBES RD, GUTTMANN RD, GOMERSALL M,HIBBERD JA. 1983. A controlled serial ultrastructuraltracer study of first-set cardiac allograft rejection in therat. Evidence that the microvascular endothelium is theprimary target of graft destruction. Am J Pathol 111:184-196.12. GIULIAN D, VACA K, CORPUZ M. 1993. Brain gliarelease factors with opposing actions upon neuronalsurvive. Neurosci 13: 29-37.13. GONZÁLEZ N, GALINDO I, GUEVARA P, SCOR-ZA JV, et al. 1994. Identification and detection of Trypanosomacruzi using a DNA amplification fingerprintobtained from the ribosomal intergenic spacer. J ClinMicrobiol 32: 153-158.14. GUILLÉN PB, LUGO DE YARBUH A, MORENOE. 2001. Dilatación del tracto digestivo de ratonesinfectados con Trypanosoma cruzi. Invest Clin 42: 195-209.15. HERMANN E, TRUYENS C, VEGA C, EVEN J, RO-DRÍGUEZ P, et al. 2004. Human congenital infectionwith Trypanosoma cruzi is associated with maternalenhanced parasitemia and decreases production of interferongamma in response to parasite antigens. J InfDis 189: 1274-1281.16. KRUSKAL W, WALLIS W A. 1952. Use of ranks inone-criterion variance analysis. J Am Statist Asso 47:583-621.17. LEIGUARDA R, RONCORONI A, TARATUTO A,JOST L, BERTHIER M, NOGUES M, FREILIJ H.1990. Acute CNS infection by Trypanosoma cruzi(Chagasʹdisease) in immunosupressed patients. Neurol40: 850-851.18. LORCA M, VELOSO C, SPORRONG L, ANGSTROMA. 1989. Synthetic peptides of Trypanosoma cruziantigens in the diagnosis congenital of Chagasʹdisease.Res. Rev Parasitol 58: 43-47.19. LUGO DE YARBUH A, COLASANTE C, ALARCÓNM, MORENO E. 2006. Gastrocnemius skeletal musclemicrovasculature and neuromuscular junction alterationsin mice with experimental acute Chagas infection.Rev Cient FCV-LUZ 6: 593-603.20. LUGO DE YARBUH A, ARAUJO S, COLASANTEC, ALARCÓN M. MORENO E. 2006. Effects ofacute Chagasʹdisease on mice central nervous system.Parasitol Latinoam 61: 3-11.21. LUGO DE YARBUH A, ARAUJO S, ALARCÓN M,MORENO E, De ASCENCÃO A, CARRASCO HJ.2010. Efectos de la infección aguda por diferentescepas de Trypanosoma cruzi en fetos de ratas. RevCient FCV-LUZ 4: 353-361.22. MASOCHA W, ROBERTSON B, ROTTENBER ME,MALANGA J, SOROKIN L, KRISTENSSON K.2004. Cerebral vessels laminis and IFN-gamma defineTrypanosoma brucei brucei penetration of the bloodbrainbarrier. J Clin Invest 114: 689-694.23. MARCONDES FK, BIANCHI FJ, TANNO AP. 2002.Determination of the estrous cycle phases of rats: Somehelpful considerations. Braz J Biol 62: 609-614.24. MENEZES CA, BITTERCOURT AL, MOTA E,SHERLOCK I, FERREIRA J. 1992. Avaliação da parasitemiaem mulheres portadoras de infecção peloTrypanosoma cruzi durante e após a gestação. Evaluationof parasitaemia in women who are carriers ofTrypanosoma cruzi infection during and after pregnancy.Rev Soc Bras Med Trop 2: 109-113.25. MORENO E, ARAUJO M, ALARCÓN M, LUGO DEYA, ARAUJO S, BORGES R. 2006. Efecto de la infecciónchagásica aguda en ratas Wistar gestantes. RevCientif FCV-LUZ 5: 506-516.26. MORENO E, MÉNDEZ M, ALARCÓN M, ARAUJOS, LUGO DE YARBUH A. 2005. Reactivation of theChagasic infection in Wistar rats in gestation. Kasmera33: 51-63.27. OPS. 2003. Definición de caso. Tripanosomiasis americana(Enfermedad de Chagas). Bol Epidemiol 24: 3.28. PITTELLA JE. 1993. Central nervous system involvementin Chagasʹdisease. An updating. Inst Med TropSão Paulo 35: 111-116.29. RODRÍGUEZ E, BRICEÑO L, CHIURILLO M,MOSCA W, CAMPOS Y. 2004. Tripanosomiasis americana:Aspectos teóricos. Instituto de BiomedicinaUCV. Caracas, Venezuela. 3.30. SCORZA C. SCORZA JV. 1972. Acute myocarditisin rats inoculated with Trypanosoma cruzi study ofanimals sacrificed between the fourth and twenty ninthday after infection. Rev Inst Med Trop São Paulo 14:171-177.31. SELL P, BURTON M. 1981. Identification of Leishmaniaamastigotes and their antigens in formalin fixed tissueby immunoperoxidase staining. Trans R Soc TropMed Hyg 75: 461-468.32. SILVA AA, ROFFED E, MARINO AP, DOS SANTOSPV, QUIRICO-SANTOS T, PAIVA CN, LANNES-VIEIRA J. 1999. Chagasʹdisease encefalitis: intenseCD8+ lymphocytic infiltrate is restricted to the acutephase, but is not related to the presence of Trypanosomacruzi antigens. Clin Immunol 1: 56-66.33. SPINA-FRANCA A, LIVRAMENTO J, MACHADOL, YASUDA N. 1988. Trypanosoma cruzi antibodies inthe cerebrospinal fluid: a search using complement. ArqNeuropsiquiatr 4: 374-378.34. TORRICO F, VEGA CA, SUÁREZ E, TELLEZ T,BRUTUS L, RODRÍGUEZ P, TORRICO MC, SCH-NEIDER D, TRUYENS C, CARLIER Y. 2006. Arematernal re-infections with Trypanosoma cruzi associatedwith higher mobility and mortality of congenitalChagasʹdisease? Trop Med Int Health 11: 628-635.35. VAN ZON AA, ELING WM. 1980. Pregnancy associatedrecrudescence in murine malaria (Plasmodiumberghei). Tropenmed Parasitol 31: 402-408.36. VIEIRA G, MAGUIRE J, BITTENCOURT AL, SILVAFONTES JA. 1983. Doença de Chagas congĕnita apresentaçãode um caso paralisia cerebral. Rev Inst MedTrop São Paulo 25: 305-309.Agradecimientos: Al Consejo de Desarrollo Científico,Humanístico y Tecnológico de la Universidad de losAndes (CDCHT) proyecto C-1527-07-03-B por el apoyo alpresente trabajo de investigación.Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 6-1517

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 16-24Characterization of cutaneous isolates of Leishmaniain Colombia by isoenzyme typing and kDNArestriction analysisURBANO J. 1 , SÁNCHEZ-MORENO M. 1 , E. OVALLE C.E. 2 , ROSALES M.J. 1 , CAMARGO Y.C. 2 , GUTIÉRREZ-SÁNCHEZ R. 3 and MARÍN C. 11Department of Parasitology. University of Granada, Severo Ochoa s/n, E-18071 Granada (Spain).2Centro Dermatológico Federico Lleras Acosta, E.S.E., Bogotá, D. C., Colombia.3Department of Statistics, University of Granada, Severo Ochoa s/n, E-18071 Granada (Spain).ABSTRACTIn Colombia, leishmaniasis is an endemic disease for which efforts are currently being made to establishthe geographic distribution and identification of the species circulating in the country. Sixteen stocks ofLeishmania isolated from patients of the National Dermatology Institute of Bogotá (Colombia) have beencharacterized by means of isoenzymatic characterization and kDNA analysis by restriction enzymes. Theseisolates were compared with 8 reference stocks: L. braziliensis, L. guyanensis, L. panamensis, L. mexicana,L. amazonensis, L. colombiensis, L. peruviana, and L. chagasi. The statistical study of the results gave3 clusters. The dominant species was L. panamensis, with 44% and distributed throughout the country,followed by L. amazonensis with 25%, distributed preferentially along the Pacific coast and to the south ofthe country. L. braziliensis, with 19%, was distributed mainly in the centre and east of the country, while12% remained undetermined. None of the isolates were identified as belonging to L. mexicana.Key words: Leishmaniasis, Colombia, isoenzymatic characterization, kDNA analysis by restrictionenzymes, PCR.RESUMENEn Colombia, la leishmaniasis es una enfermedad endémica para la cual actualmente se están dedicadomuchos esfuerzos para establecer la distribución geográfica y la identificación de las especies circulantesen el país. Dieciséis aislados de Leishmania aisladas de pacientes del Instituto Nacional de Dermatologíade Bogotá (Colombia) han sido caracterizadas mediante estudio de isoenzimas y análisis por enzimas derestricción. Estos aislados fueron comparados con 8 cepas de referencia: L. braziliensis, L. guyanensis,Received: 21 December 2010. Accepted: 14 March 2011.Corresponding: Clotilde Marín Sánchez.Department of Parasitology.University of Granada, Severo Ochoa s/n, E-18071 Granada (Spain).Tel.: +34 958 242369; fax: +34 958 243174.E-mail address: cmaris@ugr.es.18

new Leishmania isolates from ColombiaL. panamensis, L. mexicana, L. amazonensis, L. colombiensis, L. peruviana, y L. chagasi. El estudioestadístico de los resultados mostró 3 grupos. La mayoría de los aislados, el 44%, fueron identificadoscomo L. panamensis, que se distribuyen de manera bastante uniforme por el país, y como segunda especiepredominante aparece L. amazonensis con el 25%, distribuida preferentemente a lo largo de la costadel Pacífico y en el sur del país. L. braziliensis, con el 19%, se distribuye principalmente en el centro yeste del país, y el 12% restante no pudo ser determinado. Ninguno de los aislados fue identificado comoperteneciente a L. mexicana.Palabras clave: Leishmaniasis, Colombia, caracterización isoenzimática, análisis del ADNk por enzimasde restricción, PCR.INTRODUCTIONThe diverse clinical forms of leishmaniasis constitutea serious public health problem worldwide.According to the WHO, 350 million people are atrisk of contracting the disease, with nearly 12 millionpeople already infected, and some 2 millionnew cases yearly showing different clinical formsof leishmaniasis, classified in category I as anemerging disease without control (WHO, 2004).In Latin America, primarily in Andean countriesand those sharing the Amazon basin, the disease ispresent in three main clinical forms: cutaneous,mucocutaneous, and visceral (Herwaldt, 1999). InColombia, leishmaniasis is considered an endemicdisease throughout the country, except for somezones and the capital, Bogotá D.C. (Ovalle et al,2006). In 2005, the number of leishmaniasis casesrose by 3,794 (21.9%), i.e. 18,097 reported cases.Of these, 17,983 cases (99.4%), were cutaneous,60 cases (0.3%) mucocutaneous, and 54 (0.3%)visceral leishmaniasis (Zambrano, 2006).In the Americas, two taxonomic groups ofLeishmania exist, the subgenera Leishmania andViannia, which are also known as the BrazilensisComplex. This complex includes the species L.brazilensis, L. peruviana, L. panamensis, L. lainsoniand L. guyanensis. The subgenus Leishmaniamay be further divided into species complexes: theMexicana Complex (L. mexicana, L. amazonensis,L. garnhami, L. aristidesi, and L. pifanoi), and theDonovani Complex (L. chagasi) (Lainson & Saw,1987). For more than 20 years efforts have beenmade to determine the geographic distribution ofthe Leishmania species in Colombia. To date, numerousspecies of Leishmania have been identified:L. braziliensis, L. guyanensis, L. panamensis,L. mexicana, L. amazonensis, L. chagasi, and otherLeishmania spp. remaining uncharacterized (Corredoret al, 1990; Saravia et al, 1998; Ovalle et al,2006).The marked phenotypic diversity of Leishmaniahas given rise to a complex taxonomy of morethan 20 species described, most in Latin America(Lainson & Shaw, 1987). Given the epidemiologicalcomplexity in some regions in Colombian, it isnecessary to determine the species in circulation(Lucas et al, 1998). Due to, the strongly heterogeneousdistribution of parasites, where the transmissioncycles of the different species can overlap andseveral species can be found at the same focal pointof the disease, broad human migration, as well astourism, can spread Leishmania beyond its traditionalecological distribution (Victoir et al, 2003).That is, the ability to distinguish between Leishmaniaspecies is crucial when prescribing treatmentas well as when determining possible controlmeasures in epidemiological studies. Frequently,Leishmania species are identified based on theirgeographical distribution and on clinical manifestationsof the resulting disease. However, geographicalorigin is an inadequate criterion in non-endemicareas, as well as endemic regions where multiplespecies of Leishmania may coexist. Identificationof the infectious species based on clinical symptomscan be problematic, because several speciescause both cutaneous and mucocutaneous diseasewhile others cause visceral and cutaneous disease(Schönian et al, 2003).Diverse characterization methods have beenapplied to the study of this genus, such as electrophoresisand isoenzymes (Chance & Walton, 1982;Shamsuzzaman et al, 2000; Belhadj et al, 2003;Rodríguez-González et al, 2006 and 2007), DNAanalysis of the kDNA (Gramiccia et al, 1992; Rodríguez-Gonzálezet al, 2006 and 2007), the tech-Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 16-2419

URBANO J.et al.nique of randomly amplified polymorphic DNA(RAPD) (Tybairenc et al, 1993; Giuziani et al,2002).The National Dermatology Institute of BogotáD. C. (Colombia) attends patients from the entirecountry with different clinical forms of leishmaniasis,from which the etiological agent is isolated.The present study attempts provide new data on thedistribution as well as the characterization of 16new Leishmania isolated obtained from patients ofthe National Institute of Dermatology (Colombia)during the period 1995-2005. The characterizationwas made in comparison with reference stocks: L.braziliensis, L. guyanensis, L. panamensis, L. mexicana,L. amazonensis, L. colombiensis, L. peruviana,and L. chagasi, by isoenzyme analysis and restrictionkDNA analysis using different restrictionendonucleases.MATERIALS AND METHODSParasite isolation and in vitro culture: The16 isolated were isolated from patients treated bydermatologists in the special leishmaniasis clinic ofthe National Dermatology Institute of Bogotá D.C.(Colombia). All the patients had a confirmed diagnosisof cutaneous leishmaniasis, and their clinicalhistories were reviewed to gather information relatedto the clinical form: probable site of infection,patient’s age, sex, and origin (Table 1).The sample was taken by aspiration of the edgeof the cutaneous lesions characterized by multipleulcerated plaques with violet edges of differentsizes and at various locations of the patient’sanatomy. The sample was placed in Senekjie medium(Senekjie, 1943), incubated at 27ºC, andmonitored for 5 weeks. The parasites isolated werecultured in Schneider Drosophila medium (Sigma)supplemented to 10% with inactivated foetal bovineserum (LabClinics). Once in the logarithmicgrowth phase, these isolates were sent from theNational Dermatology Institute of Bogotá D.C. toour laboratory (Granada, Spain) and were culturedin vitro in MTL medium supplemented with 10%inactivated foetal bovine serum kept in an air atmosphereat 27ºC (Fernández-Ramos et al, 1999).As reference Leishmania stocks, we used L. peruvi-Table 1. Details of 16 Leishmania strain isolated from patients of the National Institute of Dermatology (BogotáD.C., Colombia) during the period 1995-2005Patient’ detailsCode Clinical manifestation Sex† Years Place of originLL001 Cutaneous F 31 GuaviareLL003 Cutaneous M 25 CaucaLL004 Cutaneous M 20 CasanareLL005 Cutaneous M 34 Valle del CaucaLL008 Cutaneous M 20 SantanderLL009 Cutaneous F 36 CundinamarcaLL012 Cutaneous M 39 CundinamarcaLL035 Cutaneous F 48 CundinamarcaLL092 Cutaneous M 24 CasanareLL104 Cutaneous M 50 VichadaLL106 Cutaneous M 38 GuaviareLL109 Cutaneous F 13 CundinamarcaLL110 Cutaneous M 20 VichadaLL113 Cutaneous M 33 SantanderLL119 Cutaneous M 31 BoyacaLL125 Cutaneous M 55 Boyaca†F = female, M = male.20Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 16-24

new Leishmania isolates from Colombiaana (MHOM/PE/1984/LC26) from department ofLa Libertad (Peru), L. guyanensis (MHO/BR/1975/M4147) from the Brazilian Amazon, L. colombiensis(IHAR/CO/1985/CL500) from Colombia, L.brazilensis (MHOM/BR/1975/M2903) from Pará,Brazil, L. panamensis (MHOM/PA/1971/LS94)isolated in Canal Zone (Panama), L. mexicana(MHOM/BZ/1982/BEL21) from Belize, L. amazonensis(MHOM/BR/1973/PH8) from Brazil, andL. chagasi (MHOM/BR/1974/PP75 (M2682)). Thereference stocks and new isolates were maintainedin our laboratory by cryopreservation and a maximumof 4 subcultures in NNN medium modifiedwith a liquid phase of minimal essential medium(MEM) plus 10% inactivated foetal bovine serumkept in an air atmosphere at 27ºC.Isoenzyme characterization: Crude homogenateswere obtained from 300 mL of culture mediumcontaining 2 x 10 7 cells.mL -1 . Cells were harvestedby centrifugation at 600 x g 10 min, washedtwice in a phosphate-buffered saline (pH 7.4), andresuspended in a hypotonic enzyme stabilizer solutioncontaining 2mM dithiothreitol, 2mME-aminocaproicacid, and 2mM EDTA (Fernández-Ramoset al, 1999). The samples were frozen at -80ºC for15 min and thawed at 25ºC. After several freezingthawingcycles, cell lysates were centrifuged at8000 x g for 20 min at 4ºC, and the supernatantswere stored in liquid nitrogen until used. The proteinconcentration was determined using the Bradfordmethod and stored at a final concentration of1mg.mL -1 of protein.The enzymes were separated by isoelectricfocusing in a PhastSystem apparatus, using PhastgelIEF 3-9 (Pharmacia, Freiburg, Germany).The following enzymes were tested: malic enzyme(EM), glucose 6-phosphate dehydrogenase(G6PDH), isocitrate dehydrogenase (IDH), malatedehydrogenase (MDH), glucose phosphate isomerase(GPI), and superoxide dismutase (SOD). Thestaining procedures are described in Fernández-Ramos et al (1999).kDNA isolation: Promastigotes were collectedby centrifugation of 300 mL of culture medium,when their concentrations had reached about 2x 10 7 cells.mL -1 , after about 5 days. They werewashed twice in 50mL of 0.15M NaCl, 0.015Msodium citrate, and once with SE buffer (0.15MNaCl, 0.1M EDTA, pH 8.0). Kinetoplast DNA wasobtained according to the procedure described byGonçalves (Gonçalves et al, 1984).Restriction-enzyme digestion and electrophoresisanalysis: The kDNA extracts (3 mg.mL - 1)were completely digested with restriction endonucleases(Hae III, BamH I, Hinf I, Hind III, EcoRI, and Msp I) according to the manufacturer’s prescribedbuffer conditions (Boehringer-Ingelheim,Barcelona, Spain). The digestion products wereelectrophoresed in 1.3% agarose slab gels as describedelsewhere (Riou & Yot, 1977) and the fragmentsizes were estimated by comparing their mobilitieswith those of a 100-bp DNA ladder (Gibco-BRL, Gaithersburg, USA). The gels were stainedwith ethidium bromide (10 mg.mL -1 for 10 min)and photographed under UV light with an OlympusCamedia digital camera, C-4000 Zoom.Statistical study: The statistical methods werebased on individual hierarchical cluster analysis, selectingthe Euclidean distance to the square as thebasis for measuring the associations between individuals.The Euclidean distance was calculated bythe following grouping procedures of simple linkage(Rk 0.7355), average linkage among groups(Rk 0.7518), average linkage (Rk 0.7726), centroidmethod (Rk 0.7586), median method (Rk 0.7204),and the Ward method (Rk 0.7570). The copheneticcoefficient (Rk) measures the degree of distortionbetween relationships, means in terms of originaldistances between individuals and those existing atthe end of the analysis. The one with the highest copheneticcorrelation was chosen as the optimal method.In the selection procedures, the average linkagebetween groups was considered using the coefficientRk of Rand, which is an index of the similarity betweenclassifications. This analysis was made withthe STATGRAPHICS program, version 5.0.Ethical considerations: All the patients attendedin the clinic of the National DermatologyInstitute of Bogotá were informed on the inclusionof the isolates in an institutional biological bank forsubsequent research. The protocol of the presentstudy was submitted to the ethical committee thatcatalogued it as risk-free research, according to theHelsinki Declaration.RESULTSA total of 16 new stocks of Leishmania speciesfrom patients in the National Dermatology InstituteRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 16-2421

URBANO J.et al.the rest of the reference stocks (Figure 2 C and D,lanes1). L. colombiensis was identified with the endonucleasesHinf I and EcoR I (Figure 2 B and D,lane 3), and L. chagasi with EcoR I and Hind III(Figure 2 D and F, lane 8). The stocks belongingto L. braziliensis and L. guyanensis were identifiedwith the endonuclease Hind III (Figure 2 F, lanes2 and 4), and finally the stocks of L. amazonensisy L. panamensis were unidentifiable with any ofthe 6 endonucleases. The 16 new isolates presentedtwo restriction patterns when their kDNA wassubmitted to the endonuclease BamH I: the isolatesLL001, LL003, LL004, LL005, LL008, LL012LL106, LL109; LL110, LL113, LL119, and LL125had profiles similar to those of the stocks L. panamensisand L. amazonensis (Figure 2 A; lanes: 9-13,15, and 19-24), while the rest of the isolates presenteda profile similar to that of L. braziliensis andL. guyanensis (Figure 2. A). When the kDNA of thenew isolates was digested by the endonuclease HinfI, it gave 5 different restriction patterns: the isolateLL004 presented 2 fragments similar to that of L.colombiensis, the isolates LL008, LL035, LL119,and LL125 a single fragment. There was no correspondenceto the reference stocks (Figure 2B, lanes13, 16, 23, and 24), as happened with the isolatesLL012 and LL110, which presented 6 and 4 kDNAfragments, respectively, without correspondence tothe reference stocks (Figure 2 B, lanes 15 and 21).The rest of the isolates had a profile similar to thoseof L. peruviana, L. braziliensis, L. panamensis, L.amazonensis, and L. guyanensis (Figure 2 B). Withthe enzyme Hae III, 2 profiles related some of theisolates to some of the reference stocks, e.g. isolatesLL003, LL004, LL009, LL106, LL119, andLL125 to stocks L. braziliensis, L. panamensis andL. chagasi (Figure 2 C lanes 10-11, 14, 18-20, 23,and 24; lanes 4-5 and 8, respectively). The otherprofile, which included the group of the isolatesLL005, LL008, LL012, LL035, LL092, LL104,and LL113 (Figure 2 C, lanes 12, 13, 15-17, and22), resembled the profiles of the stocks L. colombiensisand L. amazonensis (Figure 2 C, lanes 3 and7); the isolates LL001 and LL110 presented a profilethat was similar to none of the reference stocks(Figure 2 C, lanes 9 and 21). With the enzyme EcoRI, the isolate LL008 presented a profile that did notresemble any of the reference stocks (Figure 2 D,lane 13), as occurred with the enzyme MspI, whichgave a different restriction pattern to the referencestocks for the isolates LL005 and LL109 (Figure2 E, lane 12 and 20). When the kDNA of the isolatesLL009 and LL012 was subjected to the actionof the enzyme Hind III, the profiles differed fromthose of the reference stocks (Figure 2 F, lanes 14and 15).DISCUSSIONIt is known that one technique alone makesthe exact identification of an isolate difficult, andtherefore we analysed the results by the two techniquesused (Figure 3), grouping the isolates intothree large clusters. Cluster 1 in turn contained twosubclusters: on the one hand, L. chagasi, which,according to Lainson & Saw (1987) would formthe Donovani Complex (subcluster 1-1), whileSubcluster 1-2 was comprised of L. guyanensis,L. peruviana, and L. braziliensis, together withthe isolates LL104, LL092, and LL035. Phyloge-Figure 3. Dendrogram based on individual hierarchicalcluster analysis (Program Stat-Graphics version 5.0).24Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 16-24

new Leishmania isolates from Colombianetically, these are very close to L. braziliensis, andthus can be considered L. braziliensis. From thisanalysis, we deduce that L. peruviana and L. braziliensisare related, supporting the observation ofprevious authors who related the two species byisoenzyme studies (Sierra et al, 2006). Cluster 2is formed by another two subclusters: Subcluster2-1 would include L. panamensis and the isolatesLL113, LL001, LL106, LL125, LL004, LL119,and LL009; and Subcluster 2-2 formed by L. colombiensis.Subcluster 1-2 and Cluster 2 wouldform the traditional Braziliensis Complex. Cluster3 would be composed of Subcluster 3-1, whichincludes L. amazonensis and the isolates LL003,LL005, LL109, and LL110, which we consider tobe L. amazonensis; Subcluster 3-2, composed ofthe isolates LL008 and LL012; and finally Subcluster3-3, formed by L. mexicana. This Cluster3 would form the Mexicana Complex. IsolatesLL008 and LL012 are loosely related to L. amazonensis,although they cannot be considered as thisspecies and perhaps would be a variation within thespecies or some other species of this same complexnot included in this study and therefore we do nothave the patterns for comparisons.Isolates LL003, LL004, LL005, LL008, andLL009, were classified at the level of a complex bymonoclonal antibodies, isoenzymatic analysis, andPCR (Ovalle et al, 2006). The results provided inthe present study partially agree with those of theprevious work in that the isolates LL003, LL005,and LL008 belong to the Mexicana complexand we can identify them as L. amazonensis;and we identify isolates LL004 and LL009 as L.panamensis.The dominant species in Colombia was L.panamensis (44%), followed by L. amazonensis(25%), and L .braziliensis (19%), with a portion yetto be determined (12%). These data are consistentwith those reported by other authors (Corredor etal, 1990; Cupolillo et al, 1998; Ovalle et al, 2006).The small number of stocks analysed does not leadus to draw conclusions concerning the geographicdistribution of this species (Figure 4). Nevertheless,we can suggest that L. panamensis was distributeduniformly throughout the country, L. braziliensiswas located in the centre and east, while L. amazonensiswas found along the Pacific coast and in thesouth of the country. Until now, L. amazonensis hasbeen isolated at a very low percentage (GrimaldiFigure 4. Distribution map of the new isolates in Colombia.et al, 1989) and with a geographic distribution coincidentalwith our results. Despite that differentauthors have reported the presence of L. mexicanathroughout Colombia (Ovalle et al, 2006), we havenot identified any new isolates as belonging to L.mexicana. This does not mean that the species L.mexicana does not exist in Colombia, but rather indicateus that the monoclonal antibodies or the isoenzymatictyping and even the PCR are of limitedvalue by themselves in differentiating L. amazonensisfrom L. mexicana. However, the combineduse of phenotypic and genotypic characteristics candifferentiate the two species. This leads us to concludethat it is necessary to use several techniquesto identify the species level, such as isoenzymaticanalysis together with a kDNA study by means ofendonucleases that in most cases identify the specieslevel.REFERENCES1. BELHADJ S, PRATLONG F, HAMMAMI M, KA-LLEL K, DEDET JP, CHAKER E. 2003. Human cutaneouslesihmaniasis due to Leishmania infantum in theRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 16-2425

URBANO J.et al.Sidi Bourouis focus: epidemiological study and isoenzymaticcharacterization of the parasites. Acta Trop 85:83-86.2. BRUIJN DE MHL, BARRER DC. 1992. Diagnosisof the New World leishmaniasis: specific detectionof species of the Leishmania braziliensis complex byamplification of kinetoplast DNA. Acta Trop 52: 145-158.3. CHANCE ML, WALTON BC. 1982. Biochemicalcharacterization of Leishmania. In: Biochemical characterizationof Leishmania (M.L. Chance, and B.C.Walton, Eds.). Proceed ings of a workshop held the Pan.Am. Health Org., Washing ton D.C. 1980. Undp/WorldBank/ WHO/TDR, STIDR.Geneve, Switzerland, pp.1-275.4. CORREDOR A, KREUTZER RD, TESH RB, BO-SHELL J, PALAU MT, CÁCERES E. 1990. Distributionand etiology of leishmaniasis in Colombia. Am. J.Trop Med Hyg 42: 206-214.5. CUPOLILLO E, MOMEN H, GRIMALDI G.Jr. 1998.Genetic diversity in natural populations of New WorldLeishmania. Memorias do Instituto Oswaldo Cruz 93:6663-668l.6. FERNÁNDEZ-RAMOS C, LUQUE F, FERNÁN-DEZ-BECERRA C, OSUNA A, JANKEVICIUSSI, JANKEVICIUS V, ROSALES MJ, SÁNCHEZ-MORENO M. 1999. Biochemical characterisation offlagellates isolated from fruits and seeds from Brazil.FEMS Microbiology Letters 170: 343-348.7. GONÇALVES AM, NEHME NS, MOREL CM. 1984.Trypanosomatid characterization by schizodeme analysis.In: Genes and antigens of parasites (A laboratorymanual) 2nd. Edn. (C.M. Morel, Ed). Fundaçao OswaldoCruz, Rio de Janeiro, Brazil., 95-109.8. GRAMICCIA M, SMITH DF, ANGELICI MC,RAEDY PD, GRADONI L. 1992. A kinetoplast DNAprobe diagnostic for L. infantum. Parasitology 105: 29-34.9. GRIMALDI G Jr, TESH RB, McMAHON-PRATTD. 1989. A review of the geographic distribution andepidemiology of leishmaniasis in the New World. Am.J. Trop Med Hyg 41: 687-725.10. HERWALDT BL. 1999. Leishmaniasis. Lancet 354,1191-1199.11. GIUZIANI I, DELLAQI K, ISMAIL RB. 2002. Randomamplified polymorphic DNA technique for identificationand differentiation of Old World Leishmaniaspecies. Am. J. Trop Med Hyg 66: 152-156.12. LAINSON R, SHAW JJ. 1987. Evolution, classificationand geographical distribution. In: The Leishmaniasisin Biology and Medicine. (W. Peters and R. Kendrick,Eds). London: Academic Press. 1-120.13. LUCAS CM, FRANKE ED, CACHAY MI, TEJADAA, CRUZ ME, KREUZER RD. 1998. Geographicdistribution and clinical description of leishmaniasiscases in Peru. Am.J. Trop Med Hyg 59: 312-317.14. OVALLE CE, PORRAS L, REY M, RIOS M, CA-MARGO YC. 2006. Distribución geográfica de especiesde Leishmania aisladas de pacientes consultantesal Instituto Nacional de Dermatología Federico LlerasAcosta, E.S.E., 1995-2005. Biomédica 26: 145-151.15. RIOU G, YOT P. 1977. Heterogeneity of the kinetoplastDNA molecules of Trypanosoma cruzi. Biochemistry16: 2390-2396.16. RODRÍGUEZ-GONZÁLEZ I, MARÍN C, VARGASF, CÓRDOVA O, BARRERA M, GUTIÉRREZ-SÁN-CHEZ R, ALUNDA JM, SÁNCHEZ-MORENO M.2006. Identification and biochemical characterizationof Leishmania strains isolated in Peru, Mexico andSpain. Exp Parasitol 112: 44-51.17. RODRÍGUEZ-GONZÁLEZ I, MARÍN C, LONGONISS, MATEO H, ALUNDA JM, MINAYA G, GUTIÉ-RREZ-SÁNCHEZ R, VARGAS F, SÁNCHEZ-MORE-NO M. 2007. Identification of New World LeishmaniaSpecies From Peru By Biochemical Techniques andMultiplex PCR Assay. FEMS Microbiology Letters267: 9-16.18. SARAVIA NG, SEGURA I, HOLGUÍN AF, SANT-RICH C, VALDERRAMA L, OCAMPO C. 1998. Epidemiologic,genetic and clinical associations amongphenotypically distinct populations of Leishmania (Viannia)in Colombia. Am. J.Trop Med Hyg 59: 86-94.19. SENEKJIE HA. 1943. Biochemical Reactions, CulturalCharacteristics and Growth Requirements of Trypanosomacruzi. Am. J. Trop Med Hyg s1-23(5): 523-531.20. SHAMSUZZAMAN SM, FURUYA M, SHAMSUZ-ZAMAN C, KORENAGA M, HASHIGUCHI Y. 2000.Characterisation of Bangladeshi Leishmania isolatedfrom kala-azar patients by isoenzyme electrophoresis.ParasitolInt 49: 139-145.21. SIERRA D, OCHOA M, CALLE JI, GARCÍA COLO-RADO D, VÉLEZ ID. 2006. Leishmania (Leishmania)mexicana en el corregimiento de 2006. San Matías,municipio de Gómez Plata, Antioquia, Colombia. Biomédica26: 232-235.22. SCHÖNIAN G, NASEREDDIN A, DINSE N, SCH-WEYNOCH C, SCHALLIG H, PRESBER W, JAFFECL. 2003. PCR diagnosis and characterization ofLeishmania in local and imported clinical samples.Diagnostic Microbiol Inf Dis 47: 349-358.23. TYBAIRENC M, NEUBAUER K, BARNABE C,GUERRINI F, SKARECKEY D, AYALA FJ. 1993.Genetic characterization of six parasitic protozoa paritybetween random primer DNA typing and multilocusenzyme electrophoresis. Proceedings of the NationalAcademy of Sciences of the United States of America90: 1335-1339.24. WORLD HEALTH ORGANIZATION (WHO). 2004.Control of the leishmaniases. Report of the scientificworking group on leishmaniasis. Geneva, WHO/TDR/SWG.25. VICTOIR K, BAÑULS J, DE DONCKER S, CABRE-RA L, ÁLVAREZ E, ARÉVALO J. 2003. Direct Identificationof Leishmania species in biopsies from patientswith american tegumentary leishmaniasis. Trans RoySoc Trop Med Hyg 97: 80-87.26. ZAMBRANO P. 2006. Informe de leishmaniasis,Colombia semanas 1 a 52 de 2005. Informe QuincenalEpidemiológico Nacional, 11, 40-43.Acknowledgments: We wish to thank Encarnación Guerrerofor technical help in culture media preparation. Thiswork was supported by grants from the Project CGL-2006-27889-E and CGL-2008-03687-E of the Ministerio de Cienciay Tecnología (Spain).26Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 16-24

A. CLAVEL et al.INTRODUCCIÓNGiardia duodenalis es un protozoo parásitoflagelado, enteropatógeno de distribución mundial.La infección en el hombre está causada por G.duodenalis (sinónimo G. lamblia, G. intestinalis).Se han identificado 7 genotipos, denominados A(AI, AII), B, C, D, E, F, G (Monis et al, 2003;Eligio-García et al, 2005; Monis et al, 2009; Cacciòet al, 2010). En el hombre se han identificado losgenotipos A y/o B, que también han sido detectadosen una gran variedad de mamíferos (Monis et al,2009).Recientemente se ha descrito el hallazgo en humanos,de los genotipos C, D, E y F cuyos hospedadoreshabituales son perros (C, D), rumiantes (E) ygatos (F) (Gelanew et al, 2007; Foronda et al, 2008;Traub et al, 2009; Feng y Xiao, 2011) demostrandola capacidad zoonótica de este parásito.En algunos países tropicales y subtropicales,como Guatemala, el clima y las condiciones socioeconómicasfavorecen la alta prevalencia de lagiardiosis. Los estudios realizados en comunidadesguatemaltecas, señalan valores que oscilan entre el15 y el 30%, según se trate de ambientes rurales ourbanos respectivamente (Gupta et al, 1982; Farthinget al, 1986; Anderson et al, 1993; Jensen etal, 2009). En otros países de América Latina, lasprevalencias son similares. Así, en Argentina es del4% en áreas rurales y del 10 % en las áreas urbanas(Gamboa et al, 1998; Minvielle et al, 2004), enPerú, del 23,8% (Pérez-Cordón et al, 2008) y enColombia de un 27,6% (Botero-Garcés et al, 2009).En todos los casos, los niños menores de 5 añosrepresentan el sector de población más afectado poresta parasitosis (Thompson, 2000; Adam, 2001).Teniendo en cuenta lo anteriormente comentado,se planteó como objetivo de este trabajo, determinarlos genotipos de G. duodenalis predominantesen los niños de ámbito urbano de Ciudad deGuatemala.MATERIAL Y MÉTODOSCuarenta y cuatro muestras de heces, de niñosprocedentes de zonas marginales de la Ciudad deGuatemala (Guatemala), con edades comprendidasentre los 0 y los 5 años, fueron seleccionadas porhaber detectado en ellas formas parasitarias correspondientesa G. duodenalis. Dicho análisis se llevóa cabo en el Laboratorio Multidisciplinario de laFacultad de Ciencias Médicas de la Universidad deSan Carlos de Guatemala (Guatemala), en el mes dejulio del año 2007, mediante observación microscópicaa partir de concentración con formalina-acetatode etilo. Alícuotas de las muestras fecales sinconservantes se enviaron, manteniéndolas a 4ºC, alLaboratorio de Parasitología del Departamento deMicrobiología, Medicina Preventiva y Salud Públicade la Facultad de Medicina de la Universidad deZaragoza (España), donde se llevó a cabo el genotipado.El ADN se extrajo a partir de las muestras deheces por el método de Boom et al, 1990. Un fragmentodel gen tpi se amplificó por PCR, utilizandolos cebadores y condiciones descritos por Amar etal, 2002. La diferenciación de los subgenotipos AIy AII se realizó mediante RFLP con la enzima derestricción RsaI de los amplicones del genotipo A(Amar et al, 2002).RESULTADOS Y DISCUSIÓNTodas las muestras estudiadas corresponden apacientes del ámbito urbano, pertenecientes a familiasque viven en zonas satélites de la capital deGuatemala, cuyo nivel socioeconómico se puedeclasificar como medio/bajo, con disponibilidad dealcantarillado y de agua de red, no necesariamentepotable.Veintiocho (63,6%) de las 44 muestras estudiadascontenían G. duodenalis genotipo B, 9 (20,5%)contenían G. duodenalis genotipo AII, y las 7 restantes(15,9%) presentaron ambos genotipos, AII yB. El método utilizado no permite la detección deotros genotipos de Giardia que podrían encontrarsepresentes, por lo que no podemos asegurar su ausencia.Estos resultados son similares a los obtenidosen otros países de América Latina. Así, el genotipoB aparece como predominante en estudios realizadosen León, Nicaragua (76%) (Lebbad et al, 2008)y en Argentina (93%) (Minvielle et al, 2008), y elresto de las muestras pertenecen al genotipo AII.Por el contrario, Pérez Cordón et al, (2008) reportaron,en un estudio realizado en Perú, predominiodel genotipo AI, seguido por el genotipo BIV y luegopor el AII, resultados similares a los referidospor Cedillo-Rivero et al, (2003), en México, donde28Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 25-28

GENOTIPOS DE GIARDIA DUODENALIS EN NIÑOS DE GUATEMALAexistía un mayor porcentaje de muestras con genotipoA. El predominio del genotipo B frente al A enlas infecciones humanas de Giardia no es algo exclusivode las zonas mencionadas sino también deotros países, como Noruega, en los que la giardiosisno se considera una enfermedad endémica, pero enlos que se han publicado brotes debidos al genotipoB (Robertson et al, 2006) y recientemente en Españase ha descrito también la prevalencia del genotipoB sobre el A (Goñi et al, 2010). En este trabajo,Giardia genotipo B alcanza el 80%. No se conocenlas razones por las que los genotipos aparecen geográficamentelocalizados, sin embargo, si que pareceque el genotipo B presenta una mayor capacidadde diseminación, que puede ser debida a una mejoradaptación al medio. Por otra parte, el genotipo Bse ha descrito asociado a infección asintomática enalgunos lugares (Sahagún et al, 2008), aspecto esteque facilitaría su mayor prevalencia, por la presenciade un importante reservorio de pacientes sanos.Por el contrario, el tratamiento de las infeccionesproducidas por el genotipo AII, asociado con sintomatología,haría que este genotipo, de transmisiónantroponótica disminuya su presencia. En este trabajono hemos podido comprobar una asociaciónentre sintomatología y genotipo de Giardia por nodisponer de datos respecto a la posible presenciade otros patógenos que pudieran causar los mismossíntomas.Es interesante señalar, que ninguno de estosestudios realizados en Centro y Sur de Américadescribe la presencia de muestras con variosgenotipos. En este estudio, se ha detectado una altaproporción de la combinación de genotipos AII+B(16%), aunque menor a la detectada en otras zonasgeográficas en pacientes de la misma edad (Goñi etal, 2010).Esta infección puede tener su explicación en lavía de transmisión, pudiendo pensar en una fuentede infección de origen medioambiental como lamás lógica. Una vez adquirida esta infección, latransmisión de persona a persona puede incluir auno de los genotipos o a ambos. No existen, sinembargo, datos que confirmen esta posibilidad.Por ello, serán necesarios más estudios para poderprofundizar en el origen de estas infecciones.Este trabajo de genotipificación de Giardia,que se llevó a cabo en Guatemala, sienta las basespara posteriores estudios que permitan definir suevolución y ayuden en el control de la giardiosis.REFERENCIAS1. ADAM R. 2001. Biology of Giardia lamblia. ClinMicrobiol Rev 14: 447-475.2. AMAR CFL, DEAR PH, PEDRAZA-DÍAZ S,LOOKER N, LINNANE E, MCLAUCHLIN J. 2002.Sensitive PCR-restriction fragment length polymorphismassay for detection and genotyping of Giardiaduodenalis in human feces. J Clin Microbiol 40: 446-452.3. ANDERSON TJ, ZIZZA CA, LECHE GM, SCOTTME, SOLOMONS NW. 1993. The distribution ofintestinal helminth infection in a rural village inGuatemala. Memorias do Instituto Oswaldo Cruz 88:53-65.4. BOOM R, SOL CJA, SALIMANS MMM, JANSENCL, WERTHEIM-VANDILLEN PME, VAN DER NO-ORDAA J. 1990. Rapid and Simple Method for Purificationof Nucleic Acids J Clin Microbiol 28: 495-503.5. BOTERO-GARCÉS JH, GARCÍA-MONTOYA GM,GRISALES-PATIÑO D, AGUIRRE-ACEVEDO DC,ALVAREZ-URIBE MC. 2009. Giardia intestinalis andnutritional status in children participating in the complementarynutrition program, Antioquia, Colombia,May to October 2006. Rev Inst Med Trop Sao Paulo51: 155-162.6. CACCIÒ SM, SPRONG H. 2010. Giardia duodenalis:genetic recombination and its implications for taxonomyand molecular epidemiology. Exp Parasitol 124:107-112.7. CEDILLO-RIVERA R, DARBY J, ENCISO-MO-RENO J, ORTEGA-PIERRES G, EY PETER. 2003.Genetic homogeneity of axenic isolates of Giardiaintestinalis derived fom acute and chronically infectedindividuals in Mexico. Parasitol Res 90: 119-123.8. ELIGIO-GARCÍA L, CORTES-CAMPOS A, JIMÉ-NEZ-CARDOSO E. 2005. Genotype of Giardia intestinalisisolates from children and dogs and its relationshipto host origin. Parasitol Res 97: 1-6.9. FARTHING M, MATA L, URRUTIA J, KRONMALR. 1986. Natural History of Giardia infection of infantsand children in rural Guatemala and its impact on physicalgrowth. The American Journal of Clinical Nutrition43: 395-405.10. FENG Y, XIAO L. 2011. Zoonotic potential and molecularepidemiology of Giardia species and giardiasis.Clin Microbiol Rev 24: 110-140.11. FORONDA P, BARGUES MD, ABREU-ACOSTAN, PERIAGO MV, VALERO MA, VALLADARESB, MAS-COMA S. 2008. Identification of Genotypesof Giardia intestinales of human isolates in Egypt.Parasitol Res 103: 1177-1181.12. GAMBOA MI, BASUALDO JA, KOZUBSKY L,COSTAS E, CUETO RUA E, LAHITTE HB. 1998.Prevalence of intestinal parasitosis within three populationgroups in La Plata, Argentina. Eur J Epidemiol 14:55-61.13. GELANEW T, LALLE M, HAILU A, POZIO E, CAC-CIÒ SM. 2007. Molecular characterization of humanisolates of Giardia duodenalis from Ethiopia. ActaTrop 102: 92-99.14. GOÑI P, ALDANA DE, CLAVEL A, SERAL C, RE-Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 25-2829

A. CLAVEL et al.MACHA MA, CASTILLO FJ. 2010. Prevalence ofGiardia duodenalis assemblage B in humans in Zaragozaand León, Spain. Enferm Infecc Microbiol Clin28: 710-712.15. GUPTA M, URRUTIA J. 1982. Effect of periodicantiascaris and antigiardia treatment on nutritionalstatus of preschool children. The American Journal ofClinical Nutrition 36: 79-86.16. JENSEN L, MARLIN J, DYCK D, LAUBACH H.2009. Effect of tourism and trade on intestinal parasiticinfections in Guatemala. J Community Health 34: 98-101.17. LEBBAD M, ANKARKLEV J, TELLEZ A, LEIVAB, ANDERSSON JO, SVÄRD S. 2008. Dominance ofGiardia assemblage B in León, Nicaragua. Acta Tropica106: 44-53.18. MINVIELLE MC, MOLINA N, POLVERINO D, BA-SUALDO J. 2008. First genotyping of Giardia lambliafrom human and animal feces in Argentina, SouthAmérica. Mem Inst Oswaldo Cruz, Río de Janeiro 103:98-103.19. MINVIELLE MC, PEZZANI BC, CORDOBA MA,DE LUCA MM, APEZTEGUIA MC, BASUALDOJA. 2004. Epidemiological survey of Giardia spp.and Blastocystis hominis in an Argentinian ruralcommunity. Korean J Parasitol 42: 121-127.20. MONIS PT, ANDREWS RH, MAYRHOFER G, EYPL. 2003. Genetic diversity within the morphologicalspecies Giardia intestinalis and its relationship to hostorigin. Infect Genet Evol 3: 29-38.21. MONIS PT, CACCIÓ SM, THOMPSON RCA. 2009.Variation in Giardia: towards a taxonomic revision ofthe genus. Trends in Parasitol 25: 93-100.22. PÉREZ-CORDÓN G, CORDOVA O, VARGAS E, VE-LASCO R, SEMPERE L, SÁNCHEZ M, ROSALESMJ. 2008. Prevalence of enteroparasites and genotypingof Giardia lamblia in Peruvian children. ParasitolRes 103: 459-465.23. ROBERTSON LJ, HERMANSEN L, GJERDE BK,STRAND E, ALVSVAG JO, LANGELAND N. 2006.Application and genotyping during an extensive outbreakof waterborn giardiasis in Bergen, Norway, duringautumn and winter 2004. Appl Environ Microbiol72: 2212-2217.24. SAHAGÚN J, CLAVEL A, GOÑI P, SERAL C, LLO-RENTE MT, CASTILLO FJ, CAPILLA S, ARIAS A,GÓMEZ-LUS R. 2008. Correlation between the presenceof symptoms and the Giardia duodenalis genotype.Eur J Clin Microbiol Infect Dis 27: 82-83.25. THOMPSON RC 2000. Giardiasis as a re-emerginginfectious disease and its zoonotic potential Int JParasitol 30: 1259-1267.26. TRAUB RJ, INPANKAEW T, REID SA, SUTTHIKOR-NCHAI C, SUKTHANA Y, ROBERTSON ID, THMP-SON RC. 2009. Transmission cycles of Giardia duodenalisin dog and humans in temple communities inBangkok-a critical evaluation of its prevalence usingthree diagnostic test in the field in absence of a goldstandard. Acta Trop 111: 125-132.Agradecimientos: Este trabajo fue financiado por el proyectoFIS PI 09/1585 (Instituto Aragonés de Ciencias de laSalud). E. Aldana recibió una beca de la Fundación Carolinay de la Universidad San Carlos de Guatemala. Agradecemosa Operon SA (Zaragoza, España), su colaboración en la importaciónde las muestras.30Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 25-28

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 29-34Risk factors and prevalence of IgG antibodies toToxoplasma gondii in domestic cats. La Matanza,Buenos Aires, ArgentinaLÓPEZ, C. 1 , DAPRATO B. 1 , ZAMPOLINI S. 2 , MAZZEO C. 2 , CARDILLO N. 1 , SOMMERFELT I. 11Facultad de Ciencias Veterinarias-Universidad de Buenos Aires.2Centro de Zooantroponosis de La Matanza, Provincia de Buenos Aires.ABSTRACTThe objective of this study was to estimate the prevalence of IgG antibodies anti Toxoplasma gondiiand identify the risk factors present in a population of healthy cats. Blood samples were obtained fromcats that arrived at Surgery for neutering. Detection of IgG antibodies was carried out using indirectimmunofluorescence (IFAT) starting with a 1/25 dilution and successive dilutions in media until theendpoint. An epidemiological survey was carried out, obtaining information on age, gender, origin (catsfrom households with a responsible owner or stray cats) and the habits of the animals (where they defecated,raw meat consumption, hunting habits, whether or not they stayed in the household and coexistence withother animals). A total of 513 cat blood samples were collected, obtaining a seroprevalence of 22.6% (IC0.18 - 0.26). Significant statistical association was found for the variable age (p = 0.003), with the habit ofwandering outside of the home (p = 0.0007) and the habit of hunting (p = 0.004). Of the animals sampled,77.4% were negative, with potential to become infected and shed oocysts into the environment. Theyrepresent a potential source of infection, especially for pregnant women and for inmunosuppressed people.Key words: Toxoplasma gondii; cats; seroprevalence; indirect inmunofluorescence antibody test.RESUMENEl objetivo fue estimar la prevalencia de IgG anti Toxoplasma gondii e identificar los factores de riesgopresentes, en una población de felinos sanos. Las muestras de sangre se obtuvieron de felinos que ingresaronal Servicio de Cirugía para la esterilización quirúrgica. La detección de anticuerpos IgG se realizó a través dela técnica de inmunofluorescencia indirecta (IFI) a partir de una dilución 1/25 y con diluciones sucesivas almedio hasta punto final. Se realizó una encuesta epidemiológica recolectándose datos de edad, sexo, origen(provenientes de una vivienda con tenedor responsable o recogidos de la vía pública) y hábitos del animalRecibido: 9 de Febrero 2011. Aprobado: 15 de Mayo 2011.Correspondencia: Clara M. López. Área Salud Pública. Facultad de Ciencias Veterinarias-Universidad de BuenosAires. Chorroarín 280-(1427) Ciudad Autónoma de Buenos Aires-Argentina.Tel: +54 11 45248453E-mail: claramlopez@yahoo.com.ar31

C. LÓPEZ et al.(lugares de defecación, consumo de carne cruda, predación, permanencia en la vivienda y convivencia conotros animales). Se recolectaron 513 muestras de sangre de felinos, obteniéndose una seroprevalencia de22,6% (IC 0,18 - 0,26). Se encontró asociación estadística significativa con la variable edad (p = 0,003),con el hábito de deambular fuera de la vivienda (p = 0,0007) y el hábito de cazar (p = 0,004). El 77,4% delos animales muestreados fueron negativos, con capacidad potencial de infectarse y eliminar ooquistes almedio, representando una potencial fuente de infección particularmente para las mujeres embarazadas opersonas inmunocomprometidas.Palabras clave: Toxoplasma gondii, gatos, seroprevalencia, inmunofluorescencia indirecta.INTRODUCTIONToxoplasmosis is a zoonosis caused by parasitesthat is acknowledged worldwide. In Argentina, it isestimated that the prevalence of serum antibodiesagainst the Toxoplasma gondii parasite in pregnantwomen varies between 21.5 and 60% (Schinchiriminiand Oller, 2007; Durlach et al, 2008). Thesedifferences would be attributed to the eating habits,to the different socioeconomic strata or environmentalcharacteristics. (Afonso et al, 2008; GilotFromont et al, 2009).In domestic and wild felines, definitive hosts,both the intestinal (sexual) stage of the cycle andthe extra-intestinal (asexual) stage are carried out.In other warm blooded animals and in man onlythe extra-intestinal stage occurs (Acha and Szyfres,2003). Cats are the only hosts that excrete resistantoocysts into the environment with their faeces(Jones and Dubey, 2010), thus representing animportant source of infection.The probability of transmission of the parasiteto man is related to the presence of oocysts in theenvironment (environmental contamination) andwith the possibility of their coming into contactwith the human population (Afonso et al, 2008).Oocysts are rarely found in the faeces of animalswith parasitic infection (Dabritz et al., 2007;Schares et al, 2008; Jones and Dubey, 2010). Indirectinmunofluorescence (IFAT) is recommendedas serological assay (Ovalle et al, 2000) to recognizeif a cat is seronegative because of not havinghad contact with the parasite; or seropositive becauseof currently eliminating the agent or havingeliminated oocysts in the past (Elmore et al, 2010).Identifying seropositive animals would helpevaluation of environmental contamination in agiven geographical area (Lopes et al, 2008; Lucaset al, 1999; Dos Santoa et al, 2010). Negativeanimals that have not had contact with the agent,form the susceptible population and are capable ofgetting infected and of eliminating the agent intothe environment. In this way they represent a riskfor the human population that comes into contactwith them (Haddadzadeh et al, 2006).The objective of this study was to estimate theprevalence of IgG antibodies anti T: gondii and toidentify the risk factors present in a population ofhealthy cats.MATERIALS AND METHODSBlood samples were obtained from clinicallyhealthy cats that arrived for surgical neutering byjugular vein puncture, at the Zoonosis Centre of theLa Matanza, Province of Buenos Aires, Argentina,from December 2007 to December 2008.The people responsible for the animal receivedinformation concerning the characteristics of thedisease and their consent was requested for bloodsampling. Those that accepted to participate completedan epidemiological survey consisting ofthe following data: age, gender, origin (householdcats or stray cats), habits of the animal (where theydefecated, raw meat consumption, hunting habits,whether or not they stayed in the household and coexistencewith other animals).Samples were processed immediately after collection,obtaining the serum after centrifugation,followed by storage at -20º C. IgG antibodies weredetected by indirect immunofluorescence (IFAT),starting with a 1/25 dilution, followed by successivedilutions until the endpoint. Slides with Toxoplasmagondii tachyzoites were provided by theNational Administration of Health Institutes and32Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 29-34

TOXOPLASMA GONDII IN DOMESTIC CATS. BS AIRES, ARGENTINALaboratories “Dr. Carlos G. Malbrán”. The anti-Cat IgG-FICT, produced in goat (Sigma) was usedin a dilution of 1/100. The presence or absence offluorescence was observed using a fluorescencemicroscope (Zeiss). Control serum for the IFATstandarization was supplied by ImmunoparasitologyLaboratory (National University of La Plata,Argentina).To process the information and carry out statisticalanalysis, a data base was made using theEPIINFO 3.5.1 programme (2008). Either the Chisquared test (c 2 ) or the Fisher’s exact test wereused to compare seroprevalence in relation to thesurveyed factors. A p value ≤ 0.05 was consideredsignificant.RESULTSThe administrative area of La Matanza is thelargest municipality of the Province of BuenosAires (Argentina), having a total area of 325.71km 2 and approximately 1.250.000 inhabitants. Thesocioeconomic level is medium to medium-low(INDEC, 2001), with an estimated ratio of humanbeing/cat of 1/15 (Fernández et al, 1995).It is a municipality where the environmentalconditions include humid areas with streams and theriver Matanza-Riachuelo. The climate is template,with an average temperature of 13 to 18° C, withregular rains (70 annual millimeters) (Municipalityof La Matanza, 2009).A total of 513 cat blood samples were collected,obtaining a seroprevalence of 22.6% (IC 0.18-0.26). Of the animals sampled, 87% (n = 446)came from households with responsible ownersand 13% were collected from the public places(by protectionists from an ONG) with the aim ofgiving them away in adoption or taking them to arefuge. A statistically significant association wasfound between the origin of the animal (householdor public places) and a seropositive result (21%and 34.3% respectively) (c 2 = 6.35; p = 0.011).The proportion of seropositive individuals wassignificantly higher in animals found on the publicplaces (z = 2.38, p = 0.008, IC 95%: 0.01-0.26).Distribution according to gender and age showedthat 40.7% of the population that requiredsurgical neutering was under 1 year old and 82.3%were female.Specific prevalence by age and gender ispresented in Table 1.The variable age was categorized as under andover 1 year old, and the 19 animals of unknownage were separated. A statistically significantassociation was found (c 2 = 13.87, p = 0.003),with the proportion of seropositive animals beingsignificantly greater in the over 1 year old age groupwhen compared to those under 1 year old (z = 3.70,p = 0.001; IC95%: 0.069-0.209). No associationwas found between seroprevalence and gender (p >0.05).Analysis of the habits of the animals was carriedout using the information of the animals withowners (n = 446). The results according to the differentvariables studied are presented in Figure 1.Cats were classified according to whether theyused a specific place to defecate or not. Cat traylitter, earth or sand was used by 83%. No significantassociation was found between the place used todefecate and seroprevalence (p > 0.05).The variable of raw meat consumption wasclassified as either consumption or non consumption.Raw meat was consumed by 54.2% of the cats, andno statistically significant association was foundwith seroprevalence (p > 0.05).With regard to the habit of hunting (present orabsent), 43% responded that their animals hunted,AgeTable 1. IgG antibody prevalence in the feline population according to age and gender.La Matanza, Bs. As. (2008)Females(n)Prevalence(%)Males(n)Prevalence(%)Total(n)Prevalence(%)< 1 year 175 14,8 34 11,8 209 14,3>1 year 230 28,3 55 38,2 285 28,4Without data 17 29,4 2 0 19 26,3Total 422 21,6 91 27,5 513 22,6Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 29-3433

C. LÓPEZ et al.Figure 1. IgG antibody prevalence in the cat populationaccording to habits of defecation, raw meat consumption,hunting, permanence within the household and coexistencewith other animals. La Matanza, Bs. As. (2008).Figure 2. Percentage of IgG antibody titres in the catpopulation with responsible owners according to agegroup. La Matanza, Bs. As. (2008).and a statistical association was found (p= 0.004).Seroprevalence was significantly higher in cats thathabitually hunted (z = 2.82, p = 0.002, IC 95%:0.03-0.18).A 32% manifested that their cats remained allthe time within their home, while the remainingowners allowed their cat’s access to the outside.The difference in seroprevalence was significant(p = 0.0007), with the probability of being positivegreater in the group that was free to roam outsidethe dwelling (z = 3.23, p 0.0006, IC 95%: 0.06-0.21).A 90% of the cats coexisted with other animals(cats or dogs) and no significant association wasfound with seroprevalence (p > 0.05).Of the total of positive samples (n = 116) 76%corresponded to cats belonging to homes.A 39% presented titres that were lower than1/100, 51% were between 1/200 and 1/800 and10% were equal to or greater than 1/1600. Thepercentages of titres found by age group arepresented in Figure 2.Differences can be found in the titres under1/100, where the proportion of animals under 1year old was significantly greater than those over1 year old (z = 2.47, p = 0.006, IC95% 0.05-0.54).Titres over 1/200 did not show differences withregard to age group.DISCUSSIONVarious authors have studied seroprevalence incats, observing variable results which have beenattributed to the different characteristics of thepopulations under study, the geographical area andthe laboratory methods used (García-Marquez et al,2007).Using indirect immunofluorescence, reportedseroprevalences have varied between 17.7% (Lucaset al, 1999) and 36% (Moro et al, 2004; Haddadzadehet al, 2006; De Craeye et al, 2008;) inhousehold cats and 36.9% (Moro et al, 2004) to90% (Haddadzadeh et al, 2006) in stray animals.The IgG antibody prevalence’s found in this study(20.8% for animals with a responsible owner and34.3% for cats collected on the public places) aresimilar to those reported in the references. Previousstudies in Argentina reported a 25% seroprevalenceusing the same technique, but without specifyingif the animals were strays or not (Venturini et al,1995); and a 19.5% using indirect hemoagglutinationin animals with owners (Fernandez et al,1995). In this study 22.6% global seroprevalencewas observed, showing that these values have notchanged over the years in the cat population, despitethe health strategies implemented in the lastten years.The variable gender did not show a significantassociation with seroprevalence, similar to that reportedby other authors (Lucas et al, 1999; Haddadzadehet al, 2006; Lopes et al, 2008). Antibodyprevalence in animals over a year old was significantlygreater (28.4%) compared to those under ayear old (14.3%), coinciding with that reported inother studies (Moro et al, 2004; Lopes et al, 2008)and being attributed to the higher probability of exposurethroughout their lifetime.34Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 29-34

TOXOPLASMA GONDII IN DOMESTIC CATS. BS AIRES, ARGENTINANo significant differences were found with regardto defecation habits. A 17% of the cats studieddid not use a specific place to defecate, a potentiallyrisky situation for humans that share the environmentwith them. Soil contamination dependson the concentration of the infected faeces and thesurvival and spreading of the oocysts, which in turnis regulated by the local environment conditions(Afonso et al, 2008).Approximately half the population under studyconsumed raw meat; nevertheless this fact did notshow a significant association with seroprevalence.Some authors have found differences when comparingraw meat consumption with consumption ofconcentrates (Lucas et al, 1999; Lopes et al., 2008).The findings in our study could be attributed to thefact that the cat population belonging to low socioeconomiclevels is frequently fed homemade food,and the way it is prepared and/or preserved couldinfluence the incidence of infection (Jones andDubey, 2010; Lucas et al, 1999; García-Marquez etal, 2007).The access to the outside and the habit of huntingboth showed significant association with theprevalence of antibodies, coinciding with resultsobtained by other authors (Lucas et al, 1999; Moroet al, 2004; Lopes et al, 2008). Free roaming offersa greater possibility of consuming oocysts presentin the environment or in infected intermediaryhosts (Dubey and Jones, 2008).Finding low titres in animals under a year oldcoincides with that reported in other studies (Lucaset al, 1999) and is attributed to the shorter time ofexposure.Knowing the prevalence of circulating antibodiesallows identification of animals that have beenin contact with the parasite (Elmore et al, 2010),and this is considered of greater epidemiologicalsignificance than searching for oocysts in faeces(Dubey and Jones, 2008). It is estimated that a millionoocysts are eliminated per naturally infectedcat at the initial infection stage (Dabritz et al, 2007;Dubey, 2009). A 77.4% of the animals sampledwere negative, having the potential capacity to becomeinfected and eliminate oocysts to the environment(Ovalle et al, 2000), suggesting the need toperiodically control this group as it represents a potentialsource of infection, particularly for pregnantwomen or for immunosuppressed people.The area under study possesses the climaticconditions (temperature and humidity) that favourthe survival of the oocysts (Dumetre and Darde,2003; Afonso et al, 2006; Elmore et al, 2010; Jonesand Dubey, 2010). This would allow one to considerthat an important environment contaminationexists and that this would increase the risk to thehuman population that shares that physical spaceand therefore common sources of exposure (Afonsoet al, 2008; Gilot Fromont et al. 2009).Research carried out in Argentina in pregnantwomen show seroprevalences that vary between20.6% (Schinchirimini and Oller, 2007) and 51.7%(Durlach et al, 2008) depending on the eating habits,socioeconomic level, environment conditionsand the presence of a definitive host. This scenariomakes it necessary to pay attention to the behaviourpatterns of the human population and identify theexisting environmental conditions in order to recommendinstructive and educational activities todecrease the risk of infection in man.REFERENCES1. ACHA P, SZYFRES B. (2003) Zoonosis y enfermedadestransmisibles comunes al hombre y a los animales.Vol. N°1, Nº3, 53-98. 3° Edición OrganizaciónPanamericana de la Salud.2. AFONSO E, LEMOINE M, POULLE ML, RAVATMC, ROMAND S, THULLIEZ P, VILLENA I,AUBERT D, RABILLOUD M, RICHE B, GILOTFROMONT E. (2008). Spatial distribution of soilcontamination by Toxoplasma gondii in relation to catdefecation behaviour in an urban area. Int J Parasitol,38: 1017-1023.3. AFONSO E, THULLIEZ P, GILOT-FROMONTE. (2006) Transmission of Toxoplasma gondii in anurban population of domestic cats (Felis catus). Int. J.Parasitol 36: 1373-1382.4. DABRITZ H, MILLER M, ATWILL R, GARDNERI, LEUTENEGGER C, MELLI A, CONRAD P.(2007). Detection of Toxoplasma gondii- like oocystsin cat feces and estimates of the environmental oocystburden. JAVMA, 231: (11), 1676-1684.5. DABRITZ H, MILLER M, GARDNER I, PACKHAMA, ATWILL R, CONRAD P. (2008) Risk factors forToxoplasma gondii infection in wild rodents fromcentral coastal California and a review of T gondiiprevalence in rodents. J Parasitol 94 (3): 675-683.6. DE CRAEYE S, FRANCART A, CHABAUTY J, DEVRIENDT V, VAN GUCHT S, LEROUX I, JONGERTE. (2008). Prevalence of Toxoplasma gondii infectionin Belgian house cats. Vet. Parasitol 157: 128-132.7. DOS SANTOS T, NUNES C, RUI LUVIZOTTOM, MOURA A, ZANETTI LOPES W, COSTA A,BRESCIANI K. (2010) Detection of Toxoplasma gondiiRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 29-3435

C. LÓPEZ et aloocysts in environmental samples from public schools.Vet Parasitol, doi: 10.1016/J.vetpar 2010.02.045.8. DUBEY J. (2009). History of the discovery of the lifecycle of Toxoplasma gondii. Int. J. Parasitol, 39: 877-882.9. DUBEY J, JONES J. (2008) Toxoplasma gondiiinfection in humans and animals in the United States.International Journal for Parasitology, 38: 1257-1278.10. DUMETRE A, DARDE ML. (2003). How to detectToxoplasma gondii oocysts in environmental samples?FEMS Microbiol Rev, 27: 651-661.11. DURLACH R, KAUFER F, CARRAL L, FREULERC, CERIOTTO M, RODRÍGUEZ M, et al. (2008).Consenso argentino de toxoplasmosis congénita. RevistaArgentina de Zoonosis y Enfermedades InfecciosasEmergentes. 5: (4), 109-123.12. ELMORE S, JONES J, CONRAD P, PATTON S,LINDSAY D, DUBEY J. (2010) Toxoplasma gondii:epidemiology, feline clinical aspects, and prevention.Trends in Parasitology. 26: (Issue 4), 190-196.13. FERNÁNDEZ F, OUVIÑA G, CLOT E, FERNANDESGUIDO R, CODONI C. (1995). Prevalence ofToxoplasma gondii antibodies in cats in the westernpart of Great Buenos Aires, Argentina, 1993. Vet.Parasitol 59: 75-79.14. GARCÍA-MARQUEZ L, GUTIÉRREZ-DÍAZ M,CORREA D, LUNA-PASTEN H, PALMA J. (2007).Prevalence of Toxoplasma gondii antibodies and therelation to risk factors in cats of Colima, Mexico. JParasitol. 93 (6): 1527-1528.15. GILOT FROMONT E, RICHE B, RABILLOUD M.(2009). Toxoplasma seroprevalence in a rural populationin France: detection of a household effect. BMCInfectious Diseases. vol 9: 76. http://www.biomedcentral.com/1471-2334/9/76.16. Instituto Nacional de Estadísticas y Censos. (INDEC).http://www.indec.gov.ar17. HADDADZADEH H, KHAZRAIINIA P, ASLANIM, REZAEIAN M, JAMSHIDI S, TAHERI M,BAHONAR A. (2006). Seroprevalence of Toxoplasmagondii infection in stray and household cats in Teheran.Vet Parasitol 138: 211-216.18. JONES J, DUBEY J. (2010). Waterborne toxoplasmosis- Recent developments. Exp Parasitol. 124: 10-25.19. LOPES A, CARDOSO L, RODRIGUES M. (2008).Serological survey of Toxoplasma gondii infection indomestic cats from northeastern Portugal. Vet Parasitol155: 184-189.20. LUCAS S, HAGIWARA M, SOUZA LOUREIRO V,IKESAKI J, BIRGEL E. (1999). Toxoplasma gondiiinfection in Brazilian domestic outpatient cats. Ver.Inst. Med. Trop. S. Paulo 41. (4): Julio-Agosto.21. MORO G, MONTOYA A, JIMENEZ S, FRISUELOSC, MATEO M, FUENTES I. (2004) Prevalence of antibodiesto Toxoplasma gondii and intestinal parasites instray, farm and household cats in Spain. Vet Parasitol126: 249-255.22. Municipalidad de La Matanza. Buenos Aires. (http://www.lamatanza.gov.ar)23. OVALLE F, GARCÍA A, THIBAUTH J, LORCA M.(2000). Frecuencia de anticuerpos anti Toxoplasmagondii en gatos de la ciudad de Valdivia, Chile. BolChile Parasitol 55: (3-4). Julio.24. SCHARES G, GLOBOKAR VRHOVEC M, PANT-CHEV N, HERRMANN D, CONRATHS F. (2008).Occurrence of Toxoplasma gondii and Hammondiahammondi oocysts in the faeces of cats from Germanyand other European countries. Vet Parasitol 152: 34-45.25. SCHINCHIRIMINI M, OLLER E. (2007). Seroprevalenciade Toxoplasmosis en mujeres embarazadasatendidas en el Hospital Provincial Neuquén y Centrosde Salud. Rev Argentina de Zoonosis y EnfermedadesInfecciosas Emergentes. 4 (3): 109-112.26. VENTURINI M, DI LORENZO C, CASTELLANOM, UNZAGA J, VENTURINI L. (1995). Detección deanticuerpos anti Toxoplasma gondii en gatos mediantelas pruebas de inmunofluorescencia y de aglutinaciónde látex. Vet Arg 12 (111): 48-50.Acknowledgements: This study was supported by Universidadde Buenos Aires, Secretaría de Ciencia y Técnica (SubsidioV029).36Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 29-34

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 35-41Prevalencia de Blastocystis sp en niños yadolescentes de comunas periurbanas dela ciudad de Córdoba, ArgentinaDÍAZ CAJAL, M.A. 1 , VARENGO, H.T. 1 , MARINI, V. 1 y ORSILLES, M.A. 21Cátedra de Parasitología, Facultad de Ciencias Químicas, Universidad Católica de Córdoba, Argentina.2Área Investigación en Enfermedades Transmisibles y Emergentes, Facultad de Ciencias Químicas, UniversidadCatólica de Córdoba, Argentina.ABSTRACTPREVALENCE OF BLASTOCYSTIS SP IN CHILDREN AND ADOLESCENTS OFPERIURBAN COMMUNITIES OF CÓRDOBA CITY, ARGENTINAThe objective of the present study was to learn the distribution of Blastocystis sp in children andadolescents of periurban communities of Cordoba city, Argentina. 204 individuals aged 0-21 from thecommunes Los Cedros and Villa del Prado were included. The socio-environmental characteristics wereevaluated by means of a survey, and the parasitological analysis was performed by means of a macroscopicand microscopic examination. The characteristics of the communes were: rural work and brick manufactureas a source of income for their inhabitants, lack of drinking water and deficit of environmental sanitation.74% of individuals were infected with enteroparasites; 33% with one species and 41% with more thanone species. Blastocystis sp was found in 39% of cases and with a higher prevalence among poliparasitedchildren over 5 yr old. This microorganism was significantly associated to infection with Giardia lamblia,Entamoeba coli and Enterobius vermicularis in poliparasited individuals. These findings show a highprevalence of enteroparasites and Blastocystis sp as a main intestinal protozoan in preschool and schoolchildren in these periurban communes. These data could help to establish and consolidate epidemiologicalcontrol and vigilance programmes as well as to intensify the educational work carried out with the membersof these communes in order to avoid transmission, dissemination and persistence of parasitic infections.Key words: Intestinal parasites, Blastocystis sp, protozoan.RESUMENEl objetivo de este estudio fue conocer la distribución de Blastocystis sp en niños y adolescentes deRecibido: 13 de Abril 2011. Aprobado: 29 de Mayo 2011.Correspondencia: Orsilles, Miguel Ángel. Área Investigación en Enfermedades Transmisibles y Emergentes, Facultadde Ciencias Químicas, Universidad Católica de Córdoba. Avenida Armada Argentina 3555, (5016),Córdoba, Argentina.E-mail: cqhemato@uccor.edu.ar37

M. A. DÍAZ CAJAL et al.Comunas periurbanas de la ciudad de Córdoba, Argentina. Se incluyeron 204 individuos de 0 a 21 años delas Comunas Los Cedros y Villa del Prado en quienes se evaluaron características socioambientales y serealizó análisis parasitológico (examen macroscópico y microscópico). Las Comunas se caracterizaron portrabajo rural y fabricación de ladrillos como fuente de ingresos de sus miembros, carencia de agua potable ydéficit de saneamiento ambiental. El 74 % de los individuos estuvo parasitado con una (33%) o más (41%)especies de enteroparásitos. Blastocystis sp estuvo presente en el 39% de los casos y con mayor prevalenciaen niños poliparasitados mayores de 5 años. Este microorganismo estuvo significativamente asociado ainfección por Giardia lamblia, Entamoeba coli y Enterobius vermicularis. Estos hallazgos evidencian unaelevada prevalencia de enteroparásitos y de Blastocystis sp como principal protozoo intestinal en individuosde edad pre-escolar y escolar de estas Comunas periurbanas. Estos datos podrían ayudar a establecer yconsolidar programas de control y vigilancia epidemiológica así como intensificar el trabajo educativo alos miembros de estas Comunas a fin de evitar la transmisión, diseminación y persistencia de infecciónparasitaria.Palabras clave: Parásitos intestinales, Blastocystis sp, protozoo.INTRODUCCIÓNLas enfermedades parasitarias intestinales constituyenun problema de salud pública en numerosospaíses. Aunque afectan a todos los grupos etarios,la población infantil es la más perjudicada debidoa su inmadurez inmunológica y al poco desarrollode hábitos higiénicos. En la mayoría de estas infecciones,tanto las producidas por protozoos comopor helmintos, la vía digestiva es el mecanismo deentrada más frecuente. Los mecanismos de transmisiónde los enteroparásitos guardan relación consus respectivos ciclos evolutivos. La presencia ytransmisión efectiva de un parásito es consecuenciade un entorno que le resulta favorable, por ello suepidemiología posee un marcado determinante ambiental.La infección puede producirse por la contaminaciónfecal del suelo, el agua y los alimentos(Schulz y Kroeger, 1992; Córdoba et al., 2002), lasdeficientes condiciones de vida, la falta de hábitoshigiénicos adecuados y un bajo nivel de instrucción(Ejezie et al, 1987; Kasprzak et al, 1989). Debido aello, la Organización Mundial de la Salud consideraa la parasitosis una de las principales causas demorbilidad estrechamente ligada a la pobreza.Actualmente, un área de interés lo constituyenlos parásitos oportunistas o emergentes como elBlastocystis sp. Este microorganismo es un protozoointestinal anaerobio cuyo modo de transmisiónpuede ser de humano a humano, de animal a humanoy de animal a animal a través del contagiointerpersonal, ingestión de alimentos o agua contaminadosy falta de saneamiento ambiental (Doyleet al, 1990; Logar et al, 1994; Stenzel y Boreham,1996). Es el enteroparásito más frecuente enheces humanas y la prevalencia de esta infecciónen países en vías de desarrollo alcanza entre 30%hasta más del 50% (Amato et al, 2004; Díaz et al,2006). La infección por este protozoo no parecerestringirse a condiciones climáticas, grupos socioeconómicosni áreas geográficas. Blastocystissp es un microorganismo polimórfico que presentaseis formas principales: avacuolar, vacuolar, multivacuolar,granular, ameboide y quística, siendo laforma vacuolar la que se observa mayoritariamenteen las heces (Zierdt, 1991; Velásquez et al, 2005).Los estudios moleculares han identificado al menos10 subtipos en humanos y animales (Stensvold etal, 2007 y 2009).En cuanto al potencial patogénico de Blastocystissp no hay un consenso definido. Algunos autoressugieren que se considere patogénico únicamenteen personas sintomáticas, especialmente niños, ocuando el número de microorganismos exceda decinco por campo en el examen microscópico deheces (Cirioni et al, 1999; Giacometti et al, 1999;Graczyk et al, 2005). Recientes datos indican quela patogenicidad del parásito depende del subtipo;siendo el uno y siete los más prevalentes entrepacientes con síntomas mientras que el subtipo 3predominan en portadores asintomáticos (Eroglu etal, 2009).En Argentina, las condiciones económicas delos últimos años han favorecido un marcado incre-38Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 35-41

BLASTOCYSTIS EN NIÑOS Y ADOLESCENTESmento de la pobreza y por ende, un impacto negativoen las condiciones de vida. Las infecciones porenteroparásitos no constituyen motivo de denunciaobligatoria y los datos con que se cuenta provienende estudios realizados por instituciones de salud y/ogrupos de investigación. La ciudad de Córdoba experimentóuna marcada expansión con numerososasentamientos en los distintos Departamentos quecircundan la capital lo que han dado origen al GranCórdoba. Esta conurbación representa la segundaaglomeración urbana de Argentina en cuanto a poblacióny superficie se refiere. Debido a la falta deregistros actualizados de enfermedades parasitariasen comunas periurbanas de la ciudad de Córdoba,este estudio tuvo como objetivos detectar parásitosintestinales, conocer la distribución de Blastocystissp en niños y adolescentes de las Comunas Los Cedrosy Villa del Prado, y determinar relaciones conla edad, sexo y condiciones socioambientales.MATERIAL Y MÉTODOSTipo de investigación: Fue descriptiva, prospectivay de corte transversal realizada entre abrilde 2009 y noviembre de 2010 y se incluyeron individuossin evidencia de enfermedad parasitariaintestinal que asistieron voluntariamente al Dispensariode las Comunas.Áreas de estudio: La cobertura geográficacorrespondió a las Comunas Los Cedros (31°31’34.90” latitud sur 64°16’55.31” latitud oeste)y Villa del Prado (31°37’03.62” latitud sur64°23’26.75” latitud oeste) ubicadas a 14 km y a25 km al suroeste de la ciudad de Córdoba en elDepartamento de Santa María. Estas Comunastienen aproximadamente 2000 habitantes con unapoblación cercana a los 900 niños y adolescentesconforme a los datos del censo 2001. Cuentan conuna escuela primaria a la que asisten 270 alumnos,un Instituto de Enseñanza Media y además, un dispensario.No tienen agua potable y sus habitantesse dedican a la fabricación de ladrillos y a tareas deservicios en la ciudad de Córdoba y Alta Gracia.Muestra: Se incluyeron 204 individuos (133 deLos Cedros y 71 de Villa del Prado) de 0 a 21 años(104 mujeres y 100 varones). Los mismos fueronestratificados en tres grupos etarios según afinidadbiológica de acuerdo a la Organización Mundial dela Salud en: Grupo 1: 0 a 4 años, Grupo 2: 5 a 11años y Grupo 3: 12 a 21 años.Evaluación coproparasitológica: En una primeraconsulta se instruyó a los padres o tutorespara la recolección de las muestras necesarias parael coproparasitológico y para el método de Grahamacompañado de una explicación verbal. Además, seentregó impresos gráficos descriptivos y materialnecesario para la recolección de las muestras.Se recolectaron muestras seriadas por al menos5 días durante una semana en frascos de boca anchay tapa a rosca, recogiendo una porción de cadadeposición diaria. Se utilizó como conservador unasolución de formol al 5% para el coproparasitológicoy formol al 10% para el método de Graham.La detección de parásitos se realizó por mediode:- Examen macroscópico: Mediante filtrado condoble gasa a fin de buscar la presencia de Helmintosadultos o restos de los mismos (proglótides).- Examen microscópico: Se realizó en muestrasseriadas formoladas a través de un examendirecto por concentración de Ritchie y de Willis(Schulz y Kroeger, 1992).- Escobillado anal: Por la técnica de Graham a finde buscar la presencia de Enterobius vermicularis(Córdoba et al, 2002).Las muestras de materia fecal que no fueronremitidas en tiempo y forma, o en los casos dondelos padres o tutores no respondieron a la encuestasocioambiental, no fueron incluidas en este estudio.Evaluación socioambiental: A cada padre o tutorse le realizó una encuesta en la que se considerarondatos ambientales a fin de recabar informaciónsobre: el tipo de vivienda, eliminación de excretas,abastecimiento de agua potable, saneamiento y presenciade animales domésticos (perro, gato).Análisis estadístico: Para el análisis de losresultados se utilizaron frecuencias relativas (%),prueba de Chi cuadrado y test exacto de Fisher conun margen de seguridad de 95% para demostrar laindependencia entre las variables: parasitosis, sexoy edad. Los datos fueron analizados utilizando losprogramas SPSS 15.1 y GraphPad Prism 5.00. Unap < 0,05 fue considerada estadísticamente significativa.Aspectos éticos: Para la realización de esteestudio se respetaron todas las normas nacionalese internacionales (Helsinki 2002, CIOMS, BuenasRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 35-4139

M. A. DÍAZ CAJAL et al.Prácticas Clínicas y Resolución 5330 del ANMAT)referidas a la investigación en seres humanos. Losindividuos fueron invitados a participar en esteestudio de investigación y, luego de brindarles lainformación pertinente, fueron incluidos quienesmanifestaron su consentimiento por escrito.RESULTADOSPrevalencia de enteroparásitos: El 74% (150/204) de los niños y adolescentes estuvo parasitado.Cuando se analizó la relación entre parasitosisy grupo etario, el Grupo 2 (5 a 11 años) evidenció elmayor porcentaje de parasitosis (80 %, p < 0,05) enrelación a los Grupos 1 (0 a 4 años) (72%) y Grupo3 (12 a 21 años) (58 %) (Tabla 1).No hubo variación significativa en la presenciade parásitos entre mujeres y varones (mujeres: 37%vs varones: 37%) y no se evidenciaron asociacionesestadísticamente significativas entre parasitosis ysexo en los distintos grupos etarios (p = 0,29).La prevalencia de monoparasitados y poliparasitadosfue de 33% y 41%, respectivamente. Elporcentaje de mujeres y varones monoparasitadoso poliparasitados fue el mismo (16% y 21%, respectivamente).No hubo diferencia significativaentre mono y poliparasitados por grupo etario (p =0,15) y entre mono o poliparasitados con el sexo (p= 0,52 y p = 0,12 respectivamente).Las especies identificadas, incluyendo patógenosy comensales, fueron: Blastocystis sp, Enterobiusvermicularis, Giardia lamblia, Entamoebacoli, Endolimax nana, Chilomastix mesnilii, Hymenolepisnana e Iodamoeba butschlii (Tabla 2). Enel 61% de los individuos parasitados se detectaronprotozoos y en el 40% se detectaron helmintos.Prevalencia de Blastocystis sp: el protozoode mayor prevalencia (39%) fue Blastocystis sp,observado principalmente en su forma vacuolar. Lesiguieron en orden de prevalencia Giardia lamblia(22%) y Entamoeba coli (17%). La Figura 1muestra la prevalencia de Blastocystis sp asociadoo no a otros enteroparásitos en los distintos gruposetarios. Los niños con edades entre 0 y 4 añosevidenciaron mayor prevalencia de monoinfeccióncon Blastocystis sp. En niños mayores de 5 años,la prevalencia de infección con Blastocystis sp conotras especies parasitarias fue dos veces mayorque aquellos individuos infectados solamente conBlastocystis sp. Estas prevalencias fueron similaresen ambos sexos.Hubo asociación estadística significativa parala coexistencia de Blastocystis sp-Giardia lamblia(p < 0,01), Blastocystis sp-Entamoeba coli (p

BLASTOCYSTIS EN NIÑOS Y ADOLESCENTESTabla 2. Prevalencia de especies de enteroparásitos según grupos de edad en niños y adolescentes delas Comunas de Villa del Prado y Los Cedros. Córdoba, ArgentinaTotal(n= 204)0-4 años(n= 64)Prevalencia (%)5-11 años(n= 102)12-21 año(n= 38) sProtozoosBlastocystis sp 39 39 42 29Giardia duodenalis 22 30 15 26Entamoeba coli 17 12 18 21Endolimax nana 8 5 10 8Chilomastix mesnilii 3 3 5 0Iodamoeba butschlii 2 3 2 0HelmintosEnterobius vermicularis38 20 54 26Hymenolepis nana 2 2 3 3Condición socioambiental: Las calles de lasComunas son de tierra y las viviendas correspondenfundamentalmente a casas con techos de ladrillo ypiso de cemento (89%). El baño está ubicado dentrode la mayoría de las viviendas (73%) sin sistemade arrastre de agua y sin conexión a desagüe dered pública (cloacas). En el 27% de las viviendas,la eliminación de excretas es a cielo abierto. Laprincipal forma de abastecimiento de agua es através de bidones con agua potabilizada por laComuna.DISCUSIÓNLa parasitosis intestinal constituye un serioproblema de salud pública en aquellos ambientescaracterizados por la pobreza, precariedad de lasviviendas, prácticas sanitarias inadecuadas y hacinamiento(Fontbonne et al, 2001; Gamboa et al,2003). En este contexto, nos propusimos evaluar lapresencia de enteroparásitos en niños y adolescentesde Comunas periurbanas de la ciudad de Córdobaasí como la prevalencia de Blastocystis sp.Los resultados obtenidos demuestran una elevadaprevalencia (74 %) de parasitosis intestinales en lasComunas de Villa del Prado y de Los Cedros. Estehallazgo es similar a lo informado en estudios realizadosen distintas regiones de la Argentina, talescomo Buenos Aires (Zonta et al, 2007), Corrientes(Milano et al, 2007), Chaco (Matzkin et al, 2001),Mendoza (Salomón et al, 2007), Salta (Menghi etal, 2007) y Misiones (Navone et al, 2006), tantoen zonas rurales, periurbanas y urbanas. Los parásitosintestinales resultaron más frecuentes en niñosde 0 a 11 años con una disminución a medida queaumenta la edad. Resultados similares han sido informadospreviamente (Guignard et al, 2000; Costamagnaet al, 2002; Milano et al, 2007; Solano etal, 2008).En nuestro estudio, hubo una mayor prevalenciade protozoos en relación a los helmintos a diferenciade lo que fue detectado en otros estudios (Navoneet al, 2006; Requena et al, 2007). Esta diferenciaen la distribución de los enteroparásitos puede serconsecuencia de las condiciones ambientales quecaracterizan a las distintas regiones estudiadas denuestro país, como es el caso de la provincia de Misionesdonde se observaron elevadas prevalenciasde geohelmintos, favorecidas por las condicionesde suelo que caracterizan a esta región (Navone etal, 2006).El protozoo encontrado con mayor frecuencia(39%), tanto en mujeres como varones, fue Blastocystissp. La prevalencia mundial de este parásitovaría en márgenes muy amplios (0,3% hasta54,0%) debido a que la infección está estrechamenteligada a un deficiente saneamiento básico,hacinamiento y malnutrición. Hallazgos similaresa los encontrados en este estudio han sido informa-Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 35-4141

M. A. DÍAZ CAJAL et al.dos previamente en ciudades en vías de desarrollo(Matzkin et al, 2001; Soriano et al, 2005; Menghiet al, 2007; Milano et al, 2007). Con respecto a laedad, se observó que los niños menores de 5 añostuvieron mayor prevalencia de monoinfección conBlastocystis sp mientras que los niños mayores de5 años manifestaron mayor prevalencia de poliparasitismo.Blastocystis sp estuvo asociado con otrosenteroparásitos en el 28% de la población estudiada.La infección asintomática con Blastocystissp es común (Taamasri et al, 2000 y 2002) y porello, la habilidad de este parásito para causarenfermedad es bastante controvertido. Numerosasmanifestaciones clínicas han sido descriptas (Doyleet al, 1990; Giacometti et al, 1999) y asociadas alnúmero de parásitos. Sin embargo, la eliminaciónde Blastocystis sp en materia fecal es irregular ydiscontinua, por lo cual el número de formas porcampo no puede relacionarse con sintomatología(Stenzel et al, 1996). Además, Blastocystis spcomprende un grupo de organismos genéticamentediversos, alguno de los cuales puede causar infecciónaguda o crónica en individuos inmunocompetentes.Por ello, la expresión de síntomas parece dependerdel genotipo de parásito y del huésped, el estadoinmune del huésped y de la edad (Boorom et al,2008).En este estudio, todos los sujetos incluidos fueronasintomáticos lo que indica la posibilidad de infecciónsin enfermedad parasitaria. En este contexto,la presencia de este parasito indica deficientescondiciones sanitarias. La transmisión de Blastocystissp por vía hídrica pareciera ser el factor principalde la aparición de este protozoo (Leelayoovaet al, 2004). La detección de coinfección con otrosparásitos intestinales que se transmiten por vía oralfecalrefuerza este modo de transmisión, esto es,por la ingestión de agua, alimentos contaminadoscon excremento de animales, así como a través demanos sucias.La evaluación socioambiental de las Comunasde Villa del Prado y de Los Cedros permitió determinarque las poblaciones presentan condicionessanitarias y ambientales desfavorables, que sumadoa las posibles malas prácticas de higiene, favoreceríauna mayor infección por enteroparásitos. Estoqueda demostrado por la elevada prevalencia deenteroparásitos encontrada en este trabajo. Por otrolado, la falta de conocimiento sobre la presencia yforma de contagio de los parásitos serían los motivosprincipales para el grado de poliparasitismodetectado (41%). La elevada y sostenida prevalenciade enteroparásitos en poblaciones que se multiplicanconsiderablemente, determina un númeroelevado de personas con parasitosis intestinal laque produce un aumento progresivo de la carga parasitariaambiental que, a su vez, se constituye enfuente de infección para más personas. Por último,a pesar de que existe medicación antiparasitaria,su administración no sería suficiente para lograr laerradicación definitiva ya que es necesario asociaral tratamiento medidas de higiene y sanidad básicaspara interrumpir los diferentes ciclos biológicos decada parásito y su propagación.En conclusión, nuestro estudio determinó unaelevada prevalencia de enteroparásitos y de Blastocystissp como el principal protozoo intestinal enniños y adolescentes de Comunas periurbanas dela provincia de Córdoba. Esta situación refleja unarelación directa con las condiciones socioambientalesdesfavorables que facilitarían los procesoscontinuos de infestación. Estos datos pueden ayudara establecer y consolidar programas de controly vigilancia epidemiológica así como intensificar eltrabajo educativo a los miembros de estas Comunasa fin de evitar la transmisión, diseminación y persistenciade infección parasitaria.REFERENCIAS1. AMATO NETO V, ALARCÓN RSR, GAYIKA E, FE-RREIRA SC, BECERRA CR, SANTOS GA. 2004.Elevada porcentagem de blastocistose em escolares deSao Paulo, SP. Rev Soc Bras Med Trop, 37: 354-356.2. BOOROM KF, SMITH H, NIMRI L, VISCOGLIOSIE, SPANAKOS G, PARKAR U. et al. 2008. Oh myaching gut: irritable bowel syndrome, Blastocystis, andasymptomatic infection. Parasit Vectors, 21: 1-40.3. CIRIONI O, GIACOMETTI A, DRENAGGI D, AN-CARANI F, SCALISE G. 1999. Prevalence and clinicalrelevance of Blastocystis hominis in diverse patientcohorts. Eur J Epidemiol, 15: 389-393.4. CÓRDOBA A, CIARMELA ML, PESAN B, GAM-BOA MI, DE LUCA MM, MINVIELLE M. et al. 2002.Presence of intestinal parasites in public places fromurban areas (Argentina). Parasitol Latinoam, 57: 25-29.5. COSTAMAGNA S, GARCÍA S, VISCIARELLI E,CASAS N. 2002. Epidemiología de las parasitosis enBahía Blanca (Provincia de Buenos Aires) Argentina -1994/1999. Parasitol Latinoam, 57: 103-110.6. DÍAZ AI, RIVERO RZ, BRACHO MA, CASTELLA-NOS SM, ACURERA E, CARCHI LM. et al. 2006.Prevalence of intestinal parasites in children of Yukpa42Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 35-41

BLASTOCYSTIS EN NIÑOS Y ADOLESCENTESethnia in Toromo, Zulia State, Venezuela. Rev MedChile, 134: 72-78.7. DOYLE PW, HELGASON MM, MATHIAS RG,PROCTOR EM. 1990. Epidemiology and pathogenicityof Blastocystis hominis. J Clin Microbiol, 28: 116-121.8. EJEZIE GC, ONYEZILI NI, OKEKE GC, ENWONWUCO. 1987. Ijanikin: a study of environmental health in arural Nigerean community. J Hyg Epidemiol MicrobioImmunol, 31: 163-172.9. EROGLU F, GENC A, ELGUN G, KOLTAS IS. 2009.Identification of Blastocystis hominis isolates fromasymptomatic and symptomatic patients by PCR.Parasitol Res, 105: 1589-1592.10. FONTBONNE A, FREESE-DE-CARVALHO E,ACIOLI MD SÁ GA, Y CESSE EAP. 2001. Fatoresde risco para poliparasitismo intestinal em umacomunidade indígena de Pernambuco, Brasil. CadSaúde Pública, 17: 367-373.11. GAMBOA MI, BASUALDO JA, CÓRDOBA MA,PESAN BC, MINVILLE MC, LÍATE HB. 2003.Distribution of intestinal parasitoses in relation toenvironmental and sociocultural parameters in LaPlata, Argentina. J Helminthol, 77: 15-20.12. GIACOMETTI A, CIRIONI O, FIORENTINI A,FORTUNA M, SCALISE G. 1999. Irritable bowelsyndrome in patients with Blastocystis hominisinfection. Eur J Clin Microbiol Infect Dis, 18: 436-439.13. GRACZYK TK, SHIFF CK, TAMANG L, MUNSAKAF, BEITIN AM, MOSS WJ. 2005. The associationof Blastocystis hominis and Endolimax nana withdiarrheal stools in Zambian school-age children.Parasitol Res, 98: 38-43.14. GUIGNARD S, ARIENTI H, FREYRE L, LUJAN H,RUBINSTEIN H. 2000. Prevalence of enteroparasitesin a residence for children in the Córdoba province,Argentina. Eur J Epidemiol, 16: 287-293.15. KASPRZAK W, MAZUR T, KARLEWICZOWA R.1989. Prevalence of Entamoeba histolytica and otherintestinal protozoa among the inhabitans of Pozmanprovince over a period of 30 years. Wiad Parazytol, 35:535-545.16. LEELAYOOVA S, RANGSIN R, TAAMASRI P,NAAGLOR T, THATHAISONG U, MUNGTHIN M.2004. Evidence of waterborne transmission of Blastocystishominis. Am J Trop Med Hyg., 70: 658-662.17. LOGAR J, ANDLOVIC A, POLJSAK-PRIJATELJ M.1994. Incidence of Blastocystis hominis in patients withdiarrhoea. J Infect, 28: 151-154.18. MATZKIN RJ, GALVAN M, MIRANDA OA, MERI-NO D, BALBACHÁN S. 2001. Parasitosis entéricas enuna población escolar periurbana de Resistencia, Chaco,Argentina. Doc Medical Rev Científica, 1: 2-4.19. MENGHI CI, IUVARO FR, DELLACASA MA,GATTA CLK. 2007. Investigación de parásitos intestinalesen una comunidad aborigen de la provincia deSalta. Medicina (Buenos Aires), 67, 705-708.20. MILANO AM, OSCHEROV EB, PALLADITO AC,BAR AR. 2007. Enteroparásitos infantil en un áreaurbana del nordeste argentino. Medicina (BuenosAires), 67: 238-242.21. NAVONE GT, GAMBOA MI, OYHENART EE, OR-DEN AB. 2006. Parasitosis intestinales en poblacionesMbyá-Guaraní de la Provincia de Misiones, Argentina:aspectos epidemiológicos y nutricionales. Cad. SaúdePública, Rio de Janeiro, 22: 1089-1100.22. REQUENA I, JIMÉNEZ Y, RODRÍGUEZ N,SANDOVAL M, ALCALA F, BLANCO Y. et al. 2007.Enterobius vermicularis en pre-escolares de un áreasuburbana en San Félix, Estado Bolívar, Venezuela.Invest Clin, 48, 277-286.23. SALOMÓN MC, TONELLI RL, BORREMANS CG,BERTELLO D, DE JONG LI, JOFRÉ CA. et al. 2007.Prevalencia de parásitos intestinales en niños de laciudad de Mendoza, Argentina. Parasitol Latinoam, 62:49-53.24. SCHULZ S, KROEGER A. 1992. Soil contaminationwith Ascaris lumbricoides eggs as an indicator of environmentalhygiene in urban areas of northeast Brazil. JTrop Med Hyg, 95: 95-103.25. SOLANO L, ACUÑA I, BARÓN MA, MORÓN DESALIM A, SÁNCHEZ A. 2008. Influencia de lasparasitosis intestinales y otros antecedentes infecciosossobre el estado nutricional antropométrico de niños ensituación de pobreza. Parasitol Latinoam, 63: 12-19.26. SORIANO SV, MANACORDA AM, PIERANGELINB, NAVARRO MC, GIAYETTO AL, BARBIERILM. et al. 2005. Parasitosis intestinales y su relacióncon factores socioeconómicos y condiciones de hábitaten niños de Neuquén, Patagonia, Argentina. Parasitollatinoam, 60: 154-161.27. STENSVOLD AR,SURESH GK, TAN KSW, THOMP-SON RCA, TRAUB RJ, VISCOGLIOSI, E. et al. 2007.Terminology for Blastocystis subtipes - a consensus.Trends Parasitolol, 23: 93-96.28. STENSVOLD CR, NIELSEN HV, SMITH HV. 2009.Pursuing the clinical impact of Blastocystis-diagnosticlimitations. Trends Parasitol, 25: 23-29.29. STENZEL DJ, BOREHAM PF. 1996. Blastocystis hominisrevisited. Clin Microbiol Rev, 9: 563-584.30. TAAMASRI P, LEELAYOOVA S, RANGSIN R,NAAGLOR T, KETUPANYA A, MUNGTHIN M.2002. Prevalence of Blastocystis hominis carriage inThai army personnel based in Chonburi, Thailand. MilMed, 167: 643-646.31. TAAMASRI P, MUNGTHIN M, RANGSIN R, TON-GUPPRAKARN B, AREEKUL W, LEELAYOOVA S.2000. Transmission of intestinal blastocystosis relatedto the quality of drinking water. Southeast Asian J TropMed Public Health, 31: 112-117.32. VELÁSQUEZ V, CALDERA R, WONG W, CERME-ÑO G, FUENTES M, BLANCO Y. et al. 2005. Elevadaprevalência de blastocistose em pacientes do Centro deSaúde de Soledad, Estado Anzoátegui, Venezuela. RevSoc Bras Med Trop, 38: 356-357.33. ZIERDT CH. 1991. Blastocystis hominis - Past and Future.Clin Microbiol Rev, 4: 61-69.34. ZONTA ML, NAVONE GT, OYHENART EE. 2007.Parasitosis intestinales en niños de edad preescolary escolar: situación actual en poblaciones urbanas,periurbanas y rurales en Brandsen, Buenos Aires,Argentina. Parasitol Latinoam, 62: 54-60.Agradecimientos: Los autores expresan su agradecimientoal Vicerrectorado de Medio Universitario de la UniversidadCatólica de Córdoba por el apoyo financiero para larealización de este estudio.Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 35-4143

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 42-48Detection of Anaplasma platys and other pathogens inectoparasites from urban hosts in Northeast ArgentineOSCHEROV E. B. 1 , MILANO A. M. F. 1 , LOBO B. 2 , ANDA P. 2 , ESCUDERO R. 21Laboratory of Biologia de los Parasitos, Facultad de Ciencias Exactas y Naturales y Agrimensura, UniversidadNacional del Nordeste, Corrientes, Argentine.2Laboratory of Espiroquetas y Patógenos Especiales, Servicio de Bacteriología, Centro Nacional de Microbiología,Instituto de Salud Carlos III, Madrid, Spain.ABSTRACTThe main aim of the present study was to assess the rate of arthropod-borne bacteria in ticks andfleas collected from domestic dogs in an urban area of Corrientes, Northeastern Argentina. For themolecular analyses we selected a total of 79 Rhipicephalus sanguineus, one Amblyomma tigrinum and 15Ctenocephalides felis. Three sets of duplex PCR were used, one targeting Anaplasma/Ehrlichia and Coxiella,another one Bartonella and Francisella, and a third one targeting Borrelia and Rickettsia. Positive sampleswere confirmed by hybridization using reverse line blotting and/or automated sequencing. Anaplasmaplatys, A. phagocytophilum, Borrelia sp. and the spotted fever group of Rickettsias were detected in R.sanguineus and Francisella-like endosymbionts in A. tigrinum. Two specimens of C. felis were positive forR. felis and Bartonella spp., respectively. It has to be highlighted that the arthropod specimens tested werecollected form dogs in a human environment and they are well known as agents of severe human zoonoses.Key words: arthropod vectors, zoonoses, Anaplasma platys, Rickettsia felis, Bartonella.RESUMENEl objetivo del presente estudio fue detectar la presencia de patógenos en garrapatas y pulgas decanes domésticos en un área urbana de Corrientes, Nordeste de Argentina. Para el análisis molecularfueron seleccionados 79 ejemplares de Rhipicephalus sanguineus, uno de Amblyomma tigrinum y 15 deCtenocephalides felis. Fueron utilizados tres sets duplex de PCR, dirigidos contra el genoma de Anaplasma/Ehrlichia y Coxiella, Bartonella y Francisella, y Borrelia y Rickettsia, respectivamente. Las muestraspositivas fueron confirmadas por hibridación utilizando un soporte de línea reversa y/o secuenciación.Anaplasma platys, A. phagocytophilum, Borrelia sp. y el grupo de las fiebres manchadas Rickettsia fuerondetectados en R. sanguineus y Francisella como endosimbiontes en A. tigrinum. Dos ejemplares de C. felisfueron positivos para R. felis y Bartonella spp., respectivamente. Se destaca que los artrópodos evaluadosRecibido: 25 de Febrero de 2011. Aprobado 12 de Mayo de 2011.Correponding: Elena Beatriz Oscherov, Laboratorio de Biología de los Parásitos, Departamento de Biología,Facultad de Ciencias Exactas y Naturales y Agrimensura, Universidad Nacional del Nordeste.Campus Universitario. Avenida Libertad 5470. 3400 Corrientes, Argentina.E-mail: ebosche@exa.unne.edu.ar44

ANAPLASMA PLATYS, RICKETTSIA FELIS, ARGENTINEfueron colectados de perros domésticos, conviviendo con humanos y los patógenos detectados son bienconocidos como agentes de zoonosis graves.Palabras clave: Artrópodos vectores, zoonosis, Anaplasma platys, Rickettsia felis, BartonellaINTRODUCTIONThe Public Health importance of the haematophagousectoparasites, ticks (Arachnida: Parasitiformes)and fleas (Insecta: Siphonaptera), stemsfrom that they parasitize both wild and domesticreservoirs and humans and have become one of themost important vectors of human pathogens worldwide,including viruses, bacteria, protozoa, cestodsand nematodes (Guglielmone & Nava, 2006; Labrunaet al, 2007).The rickettsiosis caused by Rickettsia felis isconsidered an emerging zoonosis. In Argentina,R. felis has been recently detected in fleas(Ctenocephalides felis) from domestic dogs (Navaet al, 2007). Also, a serological study performedin Jujuy, Northwest Argentina, found antibodiesagainst spotted fever and typhus groups (using R.rickettsii and R. typhi antigens), whose possiblevector would be Amblyomma cajennense (Ripollet al, 1999); more recently, R. parkeri has beendetected in 7.6% of A. triste specimens collectedin the lower Paraná River Delta (Nava et al, 2008),and R. rickettsii in A. cajennense in the provinceof Jujuy and in a patient retrospectively studied(Paddock et al, 2008); finally, R. massiliae has beendetected in the area both in vectors (Ciccutin et al,2004) and in a patient (García-García et al, 2010).Ehrlichia chaffeensis has been recently detectedin Argentinian A. parvum (Tomassone et al, 2008).Canine ehrlichiosis, transmitted by Rhipicephalussanguineus, was previously described in Chileand, recently, Anaplasma platys was identified asits causative agent in the area (Abarca et al, 2007).Finally, previous serological surveys in humans inBrazil and Argentina found anti-anaplasma/ehrlichiaantibodies (Ripoll et al, 1999; Calic et al, 2004).Taking into account all these antecedents, theobjective of the present study was to assess theoccurrence of arthropod-borne pathogens in ticksand fleas collected from domestic dogs in an urbanarea of the province of Corrientes, NortheastArgentina.MATERIAL AND METHODSThis study was performed in Santa Ana de losGuacaras, Corrientes, Argentina (27º 27’ S, 58º 45’W). It is a village characterized by unpaved streetsand extensive areas covered in autochthonousvegetation. It has 1497 permanent residents.There is little variation between summer (mean:27º C) and fall (mean: 16º C) temperatures in thearea, with 5-6 days below freezing, determininga mesothermal climate. The pluviosity is of up to1500 mm per year, with frequent rainfalls in falland scarce in January (Carnevalli, 1994).Seventy four dogs (Canis familiaris) from 45houses were included in the study. Ticks and fleaswere collected with tweezers and preserved in96º ethanol at room temperature until use; fromheavily parasitized animals, only 1 sample ofectoparasites was collected, following a humaneprotocol ethically approved by our institution.Specimens were sent to the Laboratorio de Biologíade los Parásitos, Facultad de Ciencias Exactasy Naturales y Agrimensura, of the UniversidadNacional del Nordeste. Specimens were studiedunder magnification with a Leica Zoom 2000stereomicroscope, identified at the species levelusing taxonomic keys, and counted and classifiedby sex and stage.For the molecular analyses, only one or twonon-engorged ticks were selected from each animal,making a total of 79 R. sanguineus and a femalespecimen of A. tigrinum. Adults were testedindividually and nymphs from the same host werepooled in groups of 6 and tested together. Fifteenspecimens of C. felis, collected from 15 dogs werealso studied. The methodology used consisted of 3sets of duplex PCR, targeting Anaplasma/Ehrlichiaand Coxiella (16S rRNA and IS1111, respectively),Bartonella and Francisella (16S-23S rRNA ITSand lpnA), and Borrelia and Rickettsia (16S rRNAand 5S-23S rRNA ITS), respectively, as describedelsewhere (Barandika et al, 2008; Toledo et al,2009a; Toledo et al, 2009b) (Table 1). PositiveRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 42-4845

ANAPLASMA PLATYS, RICKETTSIA FELIS, ARGENTINETable 1. Sequences of primers and probes used in this study.Bacterium Oligonucleotide Target gene Sequence (5´-3’)a ReferencePrimersA. phagocytophilum 16S/AEFmod 16S rRNA CAGAACGAACGCTRGCGGYARG (Anda et al., 2006)Ehrlichia spp. 16S/AE-Rmod 16S rRNA b-GCRTTACKCACCCGTCTGCCAC (Anda et al., 2006)Bartonella P24Emod 16S rRNA CCTTCAGTTMGGCTGGATC (García-Esteban etal., 2008)16S-R 16S rRNA b-GCCYCCTTGCGGTTAGCACAGCA (García-Esteban etal., 2008)Borrelia BORF 16S rRNA CGCTGGCAGTGCGTCTTAA (Gil et al., 2005)16S3B 16S rRNA b-GCGGCTGCTGGCACGTAATTAGC (Gil et al., 2005)Coxiella burnetii Trans 1 htpAB TATGTATCCACCGTAGCCAGTC (Bandarika et al.,2008)Trans 2 htpAB b-CCCAACAACACCTCCTTATTC (Bandarika et al.,2008)Francisella spp. FT593 lpnA GYAGGTTTAGCKAGCTGTTCTAC (Escudero et al.,2008)FT825 lpnA b-GGAGCYTGCCATTGTAATCTTAC (Escudero et al.,2008)Rickettsia RCK/23-5-F 23S-5S rRNA GATAGGTCRGRTGTGGAAGCAC (Jado et al., 2006)RCK/23-5-R 23S-5S rRNA b-TCGGGAYGGGATCGTGTGTTTC (Jado et al., 2006)ProbesA. phagocytophilum P-PHA 16S rRNA a-GGMTTATTCTTTATAGCTTGCT (Anda et al., 2006)E. chaffeensis P-CHA 16S rRNA a-ATTGCTTATAACCTTTTGGTT (Anda et al., 2006)E. ewingii P-EWI 16S rRNA a-GAACAATTCCTAAATAGTCTC (Anda et al., 2006)A. platys P-PLA 16S rRNA a-GATTTTTGTCGTAGCTTGCTATG (Anda et al., 2006)Bartonella S-BART16S 16S rRNA a-CTCGCCCTTAGTTGCCAGCATT (García-Esteban etal., 2008)Borrelia P-16S-BOR 16S rRNA a-GAGGAATAAGCTTTGTAGGAAAT-GACA(Gil et al., 2005)F. tularensis P-FRAG lpnA a-TAAAATAAAAGCAACTGTATATA-CARC(Escudero et al.,2008)Coxiella burnetii C. burnetii htpAB a-GCAAGAATACGGACTCACGA (Bandarika et al.,2008)Rickettsia spp. GP-RICK 23S-5S rRNA a-TAGCTCGATTGRTTTACTTTG (Jado et al., 2006)SFG Rickettsia GP-SFG 23S-5S rRNA a-ACTCACAARGTTATCAGGT (Jado et al., 2006)R. felis P-FEL 23S-5S rRNA a-TAATGTTATACCGTGGTCCCGC (Jado et al., 2006)a: b: biotin modification; a: C6 aminolink modificationDISCUSSIONIn Argentina, the study of tick-borne pathogenshas intensified during the last decade, detectingantibodies against spotted fever group rickettsiae inpatients (Ripoll et al, 1999; Seijo et al, 2007), aswell as R. rickettsii and R. typhi in A. cajennense(Ripoll et al, 1999), R. massiliae in R. sanguineus(Cicuttin et al, 2004), E. chaffeensis en A. parvumand A. cajennense (Tomassone et al, 2008) and R.parkeri in A. triste (Nava et al, 2008). In this studywe added A. platys, A. phagocytophilum, BorreliaRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 42-4847

E.B. OSCHEROV et al.PathogensTable 2. Arthropod-borne bacteria detected in Rhipicephalus sanguineus sorted by stageNymphsn = 40Malen = 17Femalen = 7TotalPositive (%)Anaplasma platys 2 pools (2-12a) 4 1 7-17 (10.9-26.6)aA. phagocytophilum 0 2 0 2 (3.1)Borrelia sp. 0 1 1 2 (3.1)SFG Rickettsia 0 3 0 3 (4.7)Total 2 pools (2-12 a) 10 2 14-24 (21.9-37.5)aa: Maximum number of positive and percentages would correspond to the case in which all the six nymphs fromeach pool were positivesp. and SFG Rickettsia found in R. sanguineus.We were unable to confirm whether the Borreliadetected in 1 specimen belongs to B. burgdorferisensu lato or not. Further studies will be performedto confirm this point. Also, the vectorial role of R.sanguineus for this Borrelia could not be directlyinferred from these data and it needs to be furtherassessed, although these findings confirm thatBorrelia sp. is circulating in Argentina.A. platys is the causative agent of canine anaplasmosis,infecting platelets with the subsequentproduction of thrombocytopenia (Dumler et al,2001). Evidence of the zoonotic potential of A.platys is scarce, although some authors suggest ahypothetical pathogenic role for A. platys in humans,based on serological results (Abarca et al,2008). However, this has not been further confirmed.A. phagocytophilum infects granulocytes,causing human granulocytic anaplasmosis (Abarcaet al, 2008). In consultations made at health primaryassistance and veterinarian centers of thestudy area, no information about suspected cases ofthe diseases studied here was obtained; serologicalstudies would be needed to assess their impact onhuman and veterinarian health.The detection of R. felis in C. felis is the secondcitation for this agent in Argentina and the first inthe Corrientes province. This pathogen was foundby Nava et al, (2007) in fleas collected from dogs inthe Santa Fe province. Also, in México, Brazil andUruguay C. felis specimens were found infected byR. felis (Zavala-Velázquez et al, 2002; Horta et al,2005; Venzal et al, 2006). The distribution of thisrickettsiosis is wide, with human cases reported indifferent continents (Nava et al, 2007; Horta et al,2005; Pérez-Arellano et al, 2005). However, therehave been no reports of human cases in Argentina,probably due to underdiagnosis.No previous reports were found regardingBartonella spp. in C. felis in Argentina. Its detectiontogether with R. felis in C. felis has been previouslydescribed in Spain and the Democratic Republic ofthe Congo (Blanco et al, 2006; Sackal et al, 2008),highlighting the risk of a possible simultaneoustransmission of both pathogens by the same bite.Finally, based on 16S rRNA sequences, severalorganisms have been classified as probable membersof the Francisellaceae family, including theso-called Francisella-like endosymbionts (FLEs)(Sun et al, 2000; Scoles, 2004). There are no publisheddata regarding the pathogenic role of FLEsto humans, although their pathogenicity to guineapigs and hamsters was demonstrated earlier (Burgdorferet al, 1973). These data provide the first descriptionof a member of the Francisellaceae familycirculating in Argentina.It has to be highlighted that the arthropodspecimens tested in this study were collectedform dogs in a human environment and are wellknown as agents of severe human zoonoses suchas spotted fevers, haemolytic processes and typhuslikediseases in several parts of America. Giventheir importance in human disease, a more throughinvestigation is necessary, along with actions tocontrol the vectors.REFERENCES1. ABARCA K, LÓPEZ J, GONZÁLEZ P, DABANCHJ, TORRES M, SOLARI V, et al. 2008. Evidenciaserológica de exposición humana a Anaplasma sp. enSantiago, Chile. Rev Chil Infect, 25: 358-361.48Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 42-48

ANAPLASMA PLATYS, RICKETTSIA FELIS, ARGENTINE2. ABARCA K, LÓPEZ J, PERRET C, GUERRERO J,GODOY P, VELOZ A, et al. 2007. Anaplasma platys indogs, Chile. Emerg Infect Dis, 13: 1392-1395.3. ANDA P, ESCUDERO R, RODRÍGUEZ-MORENO I,JADO I, JIMÉNEZ-ALONSO MI. 2006. Method andkit for the detection of bacterial species by means ofDNA. U.S. patent WO/2006/136639.4. BARANDIKA JF, HURTADO A, GARCÍA-SAN-MARTÍN J, JUSTE RA, ANDA P, GARCÍA-PÉREZAL. 2008. Prevalence of tick-borne zoonotic bacteria inquesting adult ticks from northern Spain. Vector BorneZoonotic Dis, 8: 829-835.5. BLANCO JR, PÉREZ-MARTÍNEZ L, VALLEJO M,SANTIBÁÑEZ S, PORTILLO A, OTEO JA. 2006.Prevalence of Rickettsia felis and Bartonella spp. inCtenocephalides canis from La Rioja (Northern Spain).Ann N Y Acad Sci, 1078: 270-274.6. BURGDORFER W, BRINTON LP, HUGHES LE.1973. Isolation and characterization of symbiontsfrom the Rocky Mountain wood tick, Dermacentorandersoni. J Invertebrate Pathol, 22: 424-434.7. CALIC SB, GALVÃO MAM, BACELLAR F, ROCHACM, MAFRA CL, LEITE RC, WALKER DH. 2004.Human ehrlichiosis in Brazil: First suspect cases. BrazJ Infect Dis, 8: 259-262.8. CARNEVALLI R. 1994. Fitogeografía de la Provinciade Corrientes. Inst Nac Tec Agrop Corrientes, Argentina.9. CICUTTIN GL, RODRÍGUEZ VARGAS M, JADOI, ANDA P. 2004. Primera detección de Rickettsiamassiliae en la ciudad de Buenos Aires. Resultadospreliminares. Rev Argentina Zoonosis, 1: 8-10.10. DUMLER JS, BARBET AF, BEKKER CP, DASCHGA, PALMER GH, RAY SC, et al. 2001. Reorganizationof genera in the families Rickettsiaceae and Anaplasmataceaein the order Rickettsiales: unifications ofsome species of Ehrlichia with Anaplasma, Cowbriawith Ehrlichia and Ehrlichia with Neorickettsia, descriptionsof six new species combinations and designationof Ehrlichia equi and HE agent’ as subjectivesynonyms of Ehrlichia fhagocytophila. Int J Syst EvolMicrobiol, 51: 2145-2165.11. ESCUDERO R, TOLEDO A, GIL H, KOVÁCSOVÁK, RODRÍGUEZ-VARGAS M, JADO I, et al. 2008.Molecular method for discrimination between Francisellatularensis and Francisella-like endosymbionts.J Clin Microbiol, 46: 3139-3143.12. GARCÍA-ESTEBAN C, GIL H, RODRÍGUEZ-VARGAS M, GERRIKAGOITIA X, BARANDIKAJF, ESCUDERO R, et al. 2008. Molecular methodfor Bartonella species identification in clinical andenvironmental samples. Appl Environ Microbiol, 46:776-779.13. GARCÍA-GARCÍA JC, PORTILLO A, NÚÑEZ MJ,SANTIBÁÑEZ S, CASTRO B, OTEO JA. 2010.A patient from Argentina infected with Rickettsiamassiliae. Am J Trop Med Hyg, 82: 691-692.14. GIL H, BARRAL M, ESCUDERO R, GARCÍA-PÉREZ AL, ANDA P. 2005. Identification of a newBorrelia species among small mammals in endemicLyme disease areas in northern Spain. Appl EnvironMicrobiol, 71: 1336-1345.15. GUGLIELMONE AA, NAVA S. 2006. Las garrapatasdel género Amblyomma como parásitos de humanos enla Argentina. In: Temas de Zoonosis III. Buenos Aires:Asociación Argentina de Zoonosis, 269-277.16. HORTA MC, PINTER A, CORTÉZ A, SOARES RM,GENNARI SM, SCHUMAKER TTS, et al. 2005.Rickettsia felis (Rickettsiales: Rickettsiaceae) inCtenocephalides felis felis (Siphonaptera: Pulicidae)in the States of São Paulo, Brazil. Arq Bras Med VetZootec, 57: 321- 325.17. JADO I, ESCUDERO R, GIL H, JIMÉNEZ-ALONSOMI, SOUSA R, GARCÍA-PÉREZ AL, et al. 2006. Amolecular method for the identification of Rickettsiaspecies in clinical and environmental samples. J ClinMicrobiol, 44: 4572-4576.18. LABRUNA MB, MCBRIDE JW, CAMARGO LMA,AGUIAR DM, YABSLEY MJ, DAVIDSON WR, et al.2007. A preliminary investigation of Ehrlichia speciesin ticks, humans, dogs and capybaras from Brazil. VetParasitol, 143: 189-195.19. NAVA S, ELSHENAWY Y, EREMEEVA ME,SUMNER JW, MASTROPAOLO M, PADDOCK CD.2008. Rickettsia parkeri in Argentina. Emerg InfectDis, 14: 1894-1897.20. NAVA S, PÉREZ-MARTÍNEZ L, VENZAL JM,PORTILLO A, SANTIBÁÑEZ S, OTEO JA. 2007.Rickettsia felis in Ctenocephalides felis from Argentina.Vector Borne Zoonotic Dis, 8: 465-466.21. PADDOCK CD, FERNÁNDEZ S, ECHENIQUE GA,SUMNER JW, REEVES WK, ZAKI SR, et al. 2008.Rocky Mountain spotted fever in Argentina. Am J TropMed Hyg, 78: 687-692.22. PÉREZ-ARELLANO JL, FENOLLAR F, ANGEL-MORENO A, BOLAÑOS M, HERNÁNDEZ M,SANTANA E, et al. 2005. Human Rickettsia felisinfection, Canary Islands, Spain. Emerg Infect Dis, 11:1961-1964.23. RIPOLL CM, REMONDEGUI CE, ORDONEZ G,ARAZMENDI R, FUSARO H, HYMAN, et al. 1999.Evidence of rickettsial spotted fever and ehrlichialinfections in a subtropical territory of Jujuy, Argentina.Am J Trop Med Hyg, 6: 350-354.24. SACKAL C, LAUDISOIT A, KOSOY M, MASSUNGR, EREMEEVA ME, KARPATHY SE, et al. 2008.Bartonella spp. and Rickettsia felis in fleas, DemocraticRepublic of Congo. Emerg Infect Dis, 14: 1972-1974.25. SCOLES GA. 2004. Phylogenetic analysis of theFrancisella-like endosymbionts of Dermacentor ticks.J Med Entomol, 41: 277-286.26. SEIJO A., PICOLLO M., NICHOLSON W.,PADDOCK C. 2007. Rickettsial spotted fever in theParaná Delta. An emerging disease. Medicina (BuenosAires), 67: 723-726.27. SUN LV, SCOLES GA, FISH D, O’NEILL SL. 2000.Francisella-like endosymbionts of ticks. J InvertebrPathol, 76: 301-303.28. TOLEDO A, JADO I, OLMEDA AS, CASADO-NISTAL MA, GIL H, ESCUDERO R, ANDA P. 2009a.Detection of Coxiella burnetii in ticks collected fromCentral Spain. Vector Borne Zoonotic Dis, 9: 465-468.29. TOLEDO A, OLMEDA AS, ESCUDERO R, JADOI, VALCÁRCEL F, CASADO-NISTAL MA, RODRÍ-GUEZ-VARGAS M, GIL H, ANDA P. 2009b Tickbornezoonotic bacteria in ticks collected from centralRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 42-4849

E.B. OSCHEROV et al.Spain. Am J Trop Med Hyg, 81: 67-74.30. TOMASSONE L, NÚÑEZ P, GÜRTLER RE, CEBA-LLOS LA, OROZCO MM, KITRON UD. et al. 2008.Molecular detection of Ehrlichia chaffeensis in Amblyommaparvum ticks, Argentina. Emerg Infect Dis, 14:1953-1955.31. VENZAL JM, PÉREZ-MARTÍNEZ L, FELIX ML,PORTILLO A, BLANCO JR, OTEO JA. 2006. Prevalenceof Rickettsia felis in Ctenocephalides felis andCtenocephalides canis from Uruguay. Ann N Y AcadSci, 1078: 305-308.32. ZAVALA-VELÁZQUEZ JE, ZABALA-CASTROJE, VADO-SOLÍS I, RUIZ-SOSA JA, MORON CG,BOUYER DH. et al. 2002. Identification of Ctenocephalidesfelis fleas as host of Rickettsia felis, the agentof spotted fever rickettsiosis in Yucatan, México. VectorBorne Zoonotic Dis, 2: 69-75.Acknowledgements: The authors are grateful to FrankM. Hodgkins for reviewing the English version of thismanuscript. This study was supported by grants from theSecretaría General de Ciencia y Técnica, UniversidadNacional del Nordeste, Argentina and from INIA (FAU2006-00002-C04-04), Spain.In memorian del Sr. Víctor Muñoz Flores(Q.E.P.D.)1949 - Enero 2011El jueves 13 de febrero falleció en forma trágica a los62 años el Profesor Asociado Víctor Muñoz Flores,quien fuera un docente y académico ejemplar de laFacultad de Medicina de la Universidad de Chile.Nació y se crío en Antofagasta, posteriormente setraslado a Santiago donde se recibió de TecnólogoMédico, carrera a la cual le dedicó gran parte de suvida. Desde sus inicios académicos siempre estuvorelacionado con la disciplina de Parasitología,en un comienzo en la Sede Oriente dirigida porel profesor Dr. Hernán Reyes y después en laSede Norte a cargo del suscrito. Por sus méritosacadémicos y su constante esfuerzo llegó a serProfesor Asociado de la Facultad de Medicina dela Universidad de Chile. Su dedicación, alegría devivir, espíritu de lucha, siempre con una sonrisa,le valieron de admiración de sus alumnos, de suspares y de todos los académicos de la Facultad deMedicina. Su tenacidad lo llevó a ser elegido comotesorero de la Sociedad Chilena de Parasitología,como tal colaboró siempre en esta disciplina. Comomuestra podemos referirnos al último SimposioInternacional de Parasitología efectuado del 18 al19 de Noviembre de 2010 en el auditorio LorenzoSazíe de la Facultad de Medicina, allí participó nosólo como tesorero de SOCHIPA sino como maestrode ceremonia y expositor, lo que es fiel reflejo delcarácter de Víctor Muñoz, es decir, solidario, buenamigo y gran colaborador. Estaba muy contentode participar en el libro de Parasitología Humanadel cual el suscrito es su editor. Nunca pensé queVíctor Muñoz podría pasar a mejor vida antes queel texto se publicara, pero así es la vida.Con la ida de Víctor Muñoz la Facultad deMedicina pierde a un excelente académico, muyquerido por sus alumnos y colegas de la Carrera deTecnología, de la asignatura de Parasitología y de laSociedad Chilena de Parasitología.Le damos a su esposa e hijos nuestro mássentido pésame, esperando que el tiempo atenúe eldolor de su pronta partida.Prof. Dr. Werner Apt B.PresidenteSociedad Chilena de Parasitología50Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 42-48

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 49-57Serological detection of Trichinella spiralis andTrichinella britovi in wild boar by ELISA usingan excretor-secretor antigen and a crude antigenGAMITO-SANTOS J.A., BLANCO-CIUDAD J., SUÁREZ-LÓPEZ I., SERRANO-AGUILERA F.J.and PÉREZ-MARTÍN J.E.Parasitology, Animal Health Department, Veterinary Faculty, 10071 Cáceres, Spain.ABSTRACTThe enzyme-linked immunosorbent assay (ELISA) method is extensively used in epidemiologicalstudies in order to establish Trichinella negligible areas. In this study, we examined the sensitivity obtainedby the ELISA method using different antigens and the two Trichinella species found in Spain. We analyzedthe humoral evolution that is produced with the Excretor-Secretor (ES) and Crude Larval (CWE) antigens,in two species of Trichinella. The results confirm greater precocity and persistence of antibodies when facedwith higher infective doses and better detection of Trichinella spp. when using the antigen homologous tothe infected species. The sensitivity obtained with ELISA is at least equal to that of digestion and greater ifTrichinella britovi antigens are used. We have demonstrated a distinct kinetic pattern in the two species ofTrichinella studied. Our results support the usefulness of this method in epidemiological surveillance andits optimization for the use as a serological test in the detection of this zoonosis.Key words: Trichinella, ELISA, Excretor-Secretor antigen, Crude antigen, wild boar, Spain.RESUMENEl método ELISA (enzyme-linked immunosorbent assay) es muy utilizado en estudios epidemiológicospara establecer áreas libres de Trichinella. En este estudio, vemos la sensibilidad que se obtiene por el métodoELISA utilizando diferentes antígenos y las dos especies de Trichinella presentes en España. Analizamos laevolución humoral que se produce ante los antígenos Excretor-Secretor (ES) y Bruto Larvario (CWE) y enlas dos especies de Trichinella. Para esto, utilizamos 22 jabalíes encuadrados en cuatro grupos: infectadoscon 200 larvas de Trichinella spiralis/Trichinella britovi, infectados con 1.000 larvas de T. spiralis/T.britovi, infectados con 20.000 larvas de T. spiralis/T. britovi y grupo control. Los resultados concluyen unamayor precocidad y persistencia de anticuerpos ante dosis infectivas más elevadas y una mejor detecciónde Trichinella al utilizar el antígeno homólogo a la especie infectante. La sensibilidad que se obtiene conReceived: 20 December 2010. Accepted: 15 February 2011.Corresponding: J E Pérez MartínE-mail: juanerpm@gmail.comTelephone: 34-927257115, Fax: 34-92725711051

J. A. GAMITO SANTOS et al.el ELISA es como mínimo igual a la de la digestión y, mayor si se utiliza antígenos de T. britovi. Hemosevidenciado un diferente patrón cinético en las dos especies de Trichinella estudiadas. Nuestros resultadosavalan la utilidad de este método en vigilancia epidemiológica y su optimización para su utilización comotest serológico en la detección de esta zoonosis.Palabras clave: Trichinella, ELISA, Antígeno Excretor-Secretor, Antígeno bruto larvario, jabalí,España.INTRODUCTIONImmunological diagnostic techniques are beingused with greater frequency in the study of diseases.In the case of trichinellosis, immunologicaldiagnosis is not used as the method of reference;according to Regulation 2075/2005 of the EuropeanUnion, the official method is magnetic artificialdigestion. The first studies were promising, serologicalmethods being found to be superior to directmethods (Van Knapen et al, 1980, 1981a,b, 1984).The high sensitivity detected surpasses that of otherserological techniques (Van Knapen et al, 1976).However, in spite of all this, following deficienciesfound in terms of possible cross-reactivity, false negatives,etc., these authors arrive at the conclusion thatELISA should be accepted only in epidemiologicalstudies. The antigen of choice for the study of trichinellosisin swine has been the excretor-secretor T. spiralis(Murrell et al, 1986; Van der Leek et al, 1992;Reiterová et al, 1999; Gamble 1996, 1998; Nöckleret al, 1995; Kapel et al, 1998; Ribicich et al, 2000).In terms of superiority of one antigen over another,there is no unanimity. Thus Gamble et al, (1983) statedthat it is better to use the ES antigen rather thanthe crude antigen, given that while with the latteralmost 9% of false positive animals were obtained,with the former type of antigen this does not occur.These results are also confirmed by other researcherssuch as Arriaga (1989a, b) or Bolás Fernández et al.(1993). On the other hand, Lind et al, (1991) arriveat the conclusion that the crude antigen is more sensitive,given that earlier sero-conversions are obtainedthan with other more purified antigens, pointing outthat with the latter the sensitivity of the techniquecould be reduced.We carried out an ELISA using Excretor-Secretor antigen and crude Antigen of the twospecies of Trichinella found in Spain: T. spiralisand T. britovi. Our study focused on wild boar, animportant species that can act as a source of bothwild and domestic trichinellosis and for which thereare few previous studies.MATERIALS AND METHODSTest animals and blood recovery22 wild boars from various estates from theregion of Cáceres (Spain), of both sexes, aged between2 and 4 months at the beginning of the experiment,weighing between 3.95 and 22 kg, wereused in the experiment. They were captured accordingto authorized methods with the required officialpermits.For the duration of the experiment the animalswere held in the facilities designed for infectiousand contagious diseases in the Clinical Hospital ofthe Veterinary Faculty of Cáceres, the University ofExtremadura (Spain).The two isolates used were obtained from wildboars shot in hunts that took place in the AutonomousRegion of Extremadura (Spain). For T. spiralis, (T1)the isolate ISS-512, from a wild boar shot in 1997in Deleitosa (Cáceres, Spain) was used, and for T.britovi (T3), the isolate ISS-308, from a wild boarshot in 1993 in Carrascalejo (Cáceres, Spain). Bothisolates were maintained by periodic passage inSwiss NBC mice. The infectious dose was appliedto the wild boars through a gastric tube. The dosesadministered and the division into groups are shownin Table 1.Blood samples were collected by jugular venipuncture.Wild boars were anesthetized usingblowgun. We use Zoletil 100® whose compositionper milliliter is: Teletamina 50 milligram and Zolacepam50 milligram. We inject 10 milligram per kilogramof weight. From each wild boar blood wastaken on days -5, 0, 5, 10, 15, 20, 25, 30, 40, 50, 60,75, 90, 105 and 125 d.pi (days post infection). Serawere isolated by centrifugation and frozen at -60º Cuntil used.52Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 49-57

DETECTION OF TRICHINELLA SPP. IN WILD BOAR BY ELISATable 1. Distribution in groups and dosesGroups Wild boar Species Dose1 1, 2 & 3 T. spiralis 2002 4, 5 & 6 T. spiralis 1,0003 7, 8 & 9 T. spiralis 20,000Control A, B, C & D ******* *******4 13, 14 & 15 T. britovi 2005 16, 17 & 18 T. britovi 1,0006 19, 20 & 21 T. britovi 20,000Larval recovery and countingThe numbers of muscle larvae were determinedin the diaphragm. Muscles were examined by theartificial digestion procedure for the presence of T.spiralis or T. britovi. We digested approximately25g of muscular tissue, with the exception of lowinfection loads for which the tissue digested wasincreased. The larvae were isolated and the muscularload was calculated in larvae per gram (LPG).Preparation of antigens• Preparation of crude muscle larva antigen.We followed the guidelines proposed by theCEE workgroup on trichinellosis (Ruitenberg etal, 1976), with slight modifications. The larvaeobtained following artificial digestion werecleaned of tissue residues with 10 washes in PBS(Phosphate Buffer Saline) to which one gramof streptomycin sulphate and 1,000,000 I.U. ofpenicillin G sodium per liter of PBS was added.For approximately 30 seconds, sedimentationof the larvae was carried out using gentlecentrifugation, aspirating the supernatant witha vacuum pump. They were then homogenizedin PBS with ultrasound at 4º C for one hour.With this, the soluble fraction of the antigenwas obtained through centrifugation at 2,000gdiminishing the insoluble part. In order todetermine protein concentration, a modifiedversion of the Bradford method (CoomassiePlus Protein Assay, of Pierce), was carried out,according to commercial instructions.• Preparation of E/S antigen.The obtaining of larvae 1, and the post washwith sterile antibiotic PBS were carried out asdescribed for crude larva antigen. They werethen transferred to a RPMI 1640 Mediumsupplemented with L-Glutamine and with 20mM HEPES, to which penicillin (500 I.U./ ml)and streptomycin (500 I.U./ml) were addedin the ratio of 5,000 larvae 1/ml. The culturewas incubated in a heater at 37º C with 90%humidity and 10% CO 2for 48 hours. At 24and 48 hours, the viability of the larvae waschecked through observation of the culturein an inverted microscope, those displayingmore than 5% dead larvae being discarded.The medium was then centrifuged at 1,000g,obtaining and filtering the supernatant througha sterile membrane of 0.20 µm pore diameter.The protein content was assessed.ELISA testAn indirect double-antibody micro-ELISA(enzyme-linked immunosorbent assay) method wasused in order to detect circulating antibodies fromthe serum of the wild boars.Micro-ELISA 96-well flat bottomed polystyreneplates (Corning Incorporated), of 300 µl capacity,were used. The protocol used was based on thestandardization carried out by Pérez Martín etal, (1994). In each well, 100 µl of antigen at aconcentration of 3µg/ml was placed, dissolved ina 0.1 M carbonate buffer pH 9.6. They were thenincubated with forced air at 37 ºC for 4 hours.Following the incubation, washing was carriedout with a solution of 0.01 M PBS pH 7.2-7.3 with0.05% Tween-20 (PBS-Tw20), with the help of anautomatic washer (AM60 Multi-Reagent Washer,Dinex Technologies), performing three washes of30 seconds. Following the first wash, 5% bovineserum albumin (BSA) was added (200 µl) in PBSpH 7.2, the plates being incubated at 37 ºC for30 minutes. A further wash was then carried out.Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 49-5753

J. A. GAMITO SANTOS et al.Once the plates were coated, we filled each wellwith 100µl of prediluted serum. This predilutionwas obtained by diluting the serum in PBS-Tw20 to 1/1000. We incubated the serum in thewells for 45 minutes at 37 ºC and then washedit. Following this step we added 100 µl ofimmuno-conjugate (anti-pig IgG conjugate withperoxidase) per well, diluted to 1/25000 in PBS-Tw20. It was incubated again for 45 minutes at37 º C, being washed three more times. Finally,100µl of substrate was added per well (0.01%3,3´, 5,5´- Tetramethylbenzidine dihydrochloridein a 0.1 M pH 5 citrate buffer, also adding 3µl/ml ofH 2O 2of vol. 10) and incubated at 37ºC in darknessfor approximately 8-10 minutes. The reaction wasstopped by applying 50 µl of H 2SO 43N per well.We carried out a measurement of the plates usingthe spectrophotometer (MRX Microplate Reader,Dinex Technologies), at a wavelength (λ) of 450nm.The percentage of reactivity was expressed inaccordance with Pérez Martín et al, (1994) according%reactivity = [ ODsample -ODnegative control] x 100ODpositivecontrol - ODnegativecontrolto the formula:Diagnostic limits used in the studyThe diagnostic limits used in this study wereobtained from the analysis of 1,000 wild boarsshot in various hunts in the Autonomous Region ofExtremadura (Spain).From statistical data from the Junta deExtremadura on animals shot in previous years, wecalculated an average of 11,902 wild boars huntedper season, this being used as a reference for thecalculation of the representative sample.90% and 99% confidence limits are obtainedwith the help of the average and the standarddeviation of the wild boars studied. Thus:• 90% is the Average of the Reactivity percentage+1,645 x Standard Deviation (DS). This isthe limit up to which the serum is considerednegative (cut-off 1).• 99% is the Average of the Reactivity percentage+3 x Standard Deviation (DS). This is the limitfrom which the serum is considered positive(cut-off 2).• Between both limits, the wild boars areTable 2. Confidence limits99% confidencelimit(cut-off 2 value)considered doubtful.Diagnostic limits used for ELISA are shown inTable 2.RESULTS% Reactivity90% confidencelimit(cut-off 1 value)ES T1 Antigen 47.41% 29.71%ES T3 Antigen 51.16% 30.77%Crude T1 Antigen 37.97% 22.92%Crude T3 Antigen 45.48% 25.82%Artificial digestionThe results obtained are shown in Table 3.All the wild boars of the experiment wereparasitized with larvae 1 Trichinella spp., with theexception of number 17, infected with T. britovi,for which no larva was detected using artificialdigestion.Wild boar number 19 showed a negative resultin digestion, although a humoral reaction wasobserved. On carrying out trichinelloscopy, weobserved calcified cysts which, due to infectioneffects, would lead to this animal being consideredpositive.ELISAThe results of the humoral evolution are shownin Figures 1, 2, 3 and 4.The four wild boars included in the controlgroup were free from Trichinella followingartificial digestion of more than 500g of muscletissue, and were shown to be negative for the fourantigens used by the ELISA technique throughoutthe experiment.In groups 3 and 6, higher infective doses wereapplied (20,000 larvae 1) and we have obtainedhigher infective loads. In groups 3 and 6 serologicalresponse increase from 15 d.p.i. and the globalreactivity was significantly higher than in otherinfected groups. In groups 2, 3 and 6, we obtain thehighest persistence of high reactivity, up until the54Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 49-57

DETECTION OF TRICHINELLA SPP. IN WILD BOAR BY ELISATable 3. Artificial digestion resultsGroups and doses Wild boar l.p.g. a1 1 0.28T. spiralis 2 0.15(200 L1) 3 0.322 4 4.49T. spiralis 5 91.16(1,000 L1) 6 134.513 7 1276.19T. spiralis 8 206.77(20,000 L1) 9 1673.064 13 0.12T. britovi 14 0.04*(200 L1) 15 0.45 16 0.48**T. britovi 17 0(1,000 L1) 18 0.26 19 0T. britovi 20 203.28(20,000 L1) 21*** 196.35* The larvae were detected only in abdominal muscles(following standard procedure, on non-detection oflarvae in the diaphragm, we analyzed the rest of themuscles using artificial digestion).** The larvae were detected only in inter-costal muscles.*** Died at 30 days PI. Thus, it has not been includedin humoral evolution graphics.al.p.g., larvae per gram muscle tissueFigure 1. Antibody level of groups of wild boarsmeasured by ELISA employing crude antigen from T.spiralis.Figure 2. Antibody level of groups of wild boars measuredby ELISA employing crude antigen from T. britovi.Figure 3. Antibody level of groups of wild boars measuredby ELISA employing ES antigen from T. spiralis.Figure 4. Antibody level of groups of wild boars measuredby ELISA employing ES antigen from T. britovi.Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 49-5755

J. A. GAMITO SANTOS et al.Table 4. Sensitivity found depending of the techniqueTechnique Wild Boar SensitivityDigestion method(5 gr.)1 2 3 4 5 6 7 8 9 13 14 15 16 18 19 20+ - + + + + + + + - - + + - - + 68.75 %ES T1 Antigen - + - - + + + + + - + - + + + + 68.75 %40 d.piES T1 Antigen - + - + + + + + + - D - - D D D 68.75 %125 d.piES T3 Antigen - + D + + + + + + - + + + + + + 87.5 %40 DPIES T3 Antigen - + D + + + + + + D + D D D + + 93.75 %125 d.piCrude T1 Antigen- + - + + + + + + - + + + + + + 81.25 %40 d.piCrude T1 - + - + + + + + + D - - - + + D 68.75 %Antigen 125d.piCrude T3 Antigen- + D + + + + + + - + + + + + + 87.5 %40 d.piCrude T3 - + D + + + + + + + D D D + + + 93.75 %Antigen 125d.piD, doubtful; d.pi, days post infection; ES, Excretor Secretor; T1, T. spiralis; T3, T. britovi.end of the experiment. Other groups reach levels ofdoubtful with some of the antigens used.We observed greater precocity and persistenceof antibodies using antigens homologous to theinfected species. This can be seen in figure 3 and4 where we observed greater precocity and higherpersistence of antibodies in groups of wild boars infectedwith T. britovi (groups 4, 5 and 6) as opposedto the ES T3 Antigen (Figure 4). This precocityand persistence is lower if we compare these samegroups as opposed to the ES T1 Antigen (Figure 3).The sensitivity found at 40 and 125 d.pi for eachantigen is displayed in Table 4.DISCUSSIONThe results obtained show a greater susceptibilityof wild boar to T. spiralis. This finding in wild boaris in accordance with results published by Kapel in2001 and Gamito-Santos et al, (2009).The immunoenzymatic diagnostic techniquesare more sensitive than artificial digestion, coincidingwith studies undertaken in porcine livestock,such as that of Van Knapen et al. (1980, 1981a,b,1984), Madden and Murrell (1990) or that of Nöckleret al, (2000). Thus, with ES T1 Antigen at 40d.pi, and ES T1 Antigens and crude T1 Antigen,both at 125 d.pi, the same sensitivity as digestionis obtained. The rest surpass digestion in terms ofsensitivity.Assessing both antigens, in our study ES T1Antigen is less sensitive than the crude T1 Antigenat 40 d.pi, contradicting studies by Gamble et al, in1983 and corroborating other studies in pigs suchas that of Lind et al, (1991), Bolás Fernández etal, (1993) or Pozio et al, (2003). ES T3 Antigenand crude T3 Antigen have the same sensitivity at40 d.pi as at 125 d.pi. We agree with Serrano et al,(1992) in a study of pigs.We have demonstrated a tendency for serologicalresponse to be more intense and earlier in wildboars infected with 20,000 larvae 1 (groups 3 and6) in comparison to those infected with 200 larvae 156Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 49-57

DETECTION OF TRICHINELLA SPP. IN WILD BOAR BY ELISA(groups 1 and 4). In fact, the greatest delay in positivityof an infected wild boar with 20,000 larvae1, was placed at 40 d.p.i using ES T1 Antigen. Onaverage, wild boars infected with 200 L1 are normallypositive around 40-50 d.pi, ups and downsbeing produced in the kinetics, attributable to thelow infection load and the idiosyncrasy of the animalitself. These results do not coincide with thoseobtained by Smith (1987) or Van der Leek et al,(1992); for them, pigs infected with a dose of 100L1 reached positivity at 79-86 d.pi and at 49-54 d.pirespectively. These differences are due fundamentallyto the animal study is different. We are talkingabout research on pigs and not wild boars. Inaddition, the methodology of the ELISA techniquecan vary as can the diagnostic limit, type of antigenused and the variability of the phenomenon studied.Wild boars infected with 20,000 L1 (groups 3 and6) are positive around 15-20 d.pi coinciding withstudies in pigs by Ruitenberg et al. (1976), Ruitenbergand Van Knapen (1977), Van Knapen etal, (1980), Kociecka (1981), Rapic et al, (1981),Gamble et al, (1983, 1989), Takada et al, (1985),Serrano et al, (1992) or Kapel and Gamble (2000).We agree with Møller et al, (2005), that detectedseroconversion in wild boar infected with 10,000L1 around 21 d.pi.We observed a lower humoral response in wildboars infected with T. spiralis so we can deducethat this species is less immunogenic in wild boar.The greater adaptation of T. spiralis in wild boar isseen to Gamito-Santos et al, (2009).In general, we observed two types of kineticsthat correspond depending on the species ofTrichinella that infected the wild boar. Thus, inwild boars infected with T. spiralis (groups 1, 2and 3), the increase in antibodies is constant fromthe first week post-infection until the end of theexperiment. Therefore, the maximum response inthe production of antibodies was found from 30-40d.pi until the end of the experiment. In wild boarsinfected with T. britovi (groups 4, 5 and 6), a clearpeak in the production of antibodies around day 30-50 p.i. was observed, later decreasing until the endof the experiment. We coincide with a study carriedout by Kapel (2001) in wild boar. The kinetic ofantibodies according to the species of Trichinellahas been studied in pigs by Kapel and Gamble(2000). They considered unlike our study that T.spiralis and T. britovi have the same kinetic patron;the level of antibodies increasing from between 21and 35 d.pi and remaining stable until experimentend (week 40 post infection). These differencesin the kinetics of antibodies could be explainedby the distinct larval behavior of the two speciesof Trichinella. Thus, when faced with T. spiralis,the organism responds gradually and it is capableof forming a cyst in musculature and remainingviable. On the other hand, T. britovi provokes amore intense immune reaction, that possibly givesrise to fewer larvae getting to the muscle, or beingcalcified and destroyed once formed into cysts.A better detection of antibodies using thehomologous antigen is also reflected in studies inpigs such as that by Kapel and Gamble (2000).The presence of infection in our wild boars byprotozoa (Balantidium coli and Sarcocystis spp.),acanthocephala (Macracanthorhynchus hirudinaceus)and nematodes (Metastrongylus spp., Strongylidaspp., Ascarops strongylina and Oesophagostomumdentatum), although able to producea slight increase in the percentage of reactivity,did not affect the final result of the technique, notcausing even one false positive result. No cross reactivitywas found and thus we coincide with authorssuch as Ruitenberg et al, (1975), Taylor andKenny (1978), Rapic et al, (1981), Van Knapen etal, (1984), Navarrete et al, (1991), Serrano et al,(1992), Bolás Fernández et al, (1993), Frontera etal, (2007) or Kořínková et al, (2008) who indicatethat the effect of other infections in the result of thisimmunoenzymatic technique is zero or very slight.With our results we can affirm that the ELISAimmunoenzymatic technique has greater sensitivitythan artificial digestion and it is useful in epidemiologicalsurveillance. In investigation, we mustcontinue studying for the validation of a serologicaltest for the official detection of Trichinella in wildboar.REFERENCES1. ARRIAGA C, MUÑIZ E, MORILLA A, ORTEGA‐PIERRES MG. 1989a. Evaluation of purified surfacestichosomal components of Trichinella spiralis musclelarvae for diagnosis of swine trichinellosis. In: Trichinellosis.(Tanner, C.E.; Martínez Fernández, A.R.; BolásFernández, F., Eds.). C.S.I.C. Press. Madrid. España.,182‐187.2. ARRIAGA C, MUÑIZ E, MORILLA A, ORTEGA‐PIERRES MG. 1989b. Trichinella spiralis: recognitionRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 49-5757

J. A. GAMITO SANTOS et al.of muscle larva antigens during experimental infection ofswine and its potential use in diagnosis. Exp Parasitol 69:363-372.3. BOLÁS-FERNÁNDEZ F, ALBARRÁN-GÓMEZ E,NAVARRETE I, MARTÍNEZ-FERNÁNDEZ AR. 1993.Dynamics of Porcine Humoral Responses to ExperimentalInfections by Spanish Trichinella Isolates: Comparisonof Three Larval Antigens in ELISA. J Vet Med 40:229-238.4. EUROPEAN COMMUNITY, 2005. Regulation (EC)No 2075/2005 of the European Parliament and of theCouncil of 5 December 2005 laying down specific ruleson official controls for Trichinella in meat. Off. J. EC, L338, 60-82.5. FRONTERA E, ALCAIDE M, BOES J, HERNÁNDEZS, DOMÍNGUEZ-ALPÍZAR JL, REINA D. 2007. Concurrentinfection with Trichinella spiralis and other helminthsin pigs. Vet Parasitol 146: 50-57.6. GAMBLE HR. 1996. Detection of trichinellosis in pigsby artificial digestion and enzyme immunoassay. J FoodProt 59: 295-298.7. GAMBLE HR. 1998. Sensitivity of artificial digestionand enzyme immunoassay methods of inspection fortrichinae in pigs. J Food Prot 61: 339-343.8. GAMBLE HR, ANDERSON WR, GRAHAM CE,MURRELL KD. 1983. Diagnosis of swine trichinosisby enzyme‐linked immunosorbent assay (ELISA) usingand excretory‐secretory antigen. Vet Parasitol 13 (4):349‐361.9. GAMBLE HR, RAPIC D, MARINCULIC A, MU-RRELL KD. 1989. Factors influencing the efficacy of excretory‐secretoryantigens in the serodiagnosis of swinetrichinellosis. In: Trichinellosis. (Tanner, C.E.; MartínezFernández, A.R.; Bolás Fernández, F., Eds.). C.S.I.C.Press. Madrid. España., 202‐209.10. GAMITO-SANTOS JA, GÓMEZ L, CALERO-BER-NAL R, ROL-DÍAZ JA, GONZÁLEZ RUIBAL L,GÓMEZ-BLÁZQUEZ M, PÉREZ MARTÍN JE. 2009.Histopathology of trichinellosis in wild boar. Vet Parasitol165: 165-169.11. KAPEL CMO, WEBSTER P, LIND P, POZIO E,HENRIKSEN SA, MURRELL KD, NANSEN P. 1998.Trichinella spiralis, T. britovi and T. nativa: infectivity,larval distribution in muscle, and antibody response afterexperimental infection of pigs. Parasitol Res 84 (4): 264-271.12. KAPEL CM. 2001. Sylvatic and domestic Trichinellaspp. in wild boars; infectivity, muscle larvae distribution,and antibody response. J Parasitol 87 (2): 309-314.13. KAPEL CMO, GAMBLE HR. 2000. Infectivity, persistenceand antibody response to domestic and sylvaticTrichinella spp. in experimentally infected pigs. Int JParasitol 30 (2): 215-221.14. KOCIECKA W. 1981. Clinical picture of trichinellosis asrelated to the species and strain of Trichinella and to theintensity of invasion. W Parazyt 27(3): 399-482.15. KOŘÍNKOVÁ K, KOVAŘČÍK K, PAVLÍČKOVÁ Z,SVOBODA M, KOUDELA B. 2008. Serological detectionof Trichinella spiralis in swine by ELISA (enzyme-linkedimmunosorbent assay) using an excretorysecretory(E/S) antigen. Parasitol Res 102: 1317-1320.16. LIND P, ERIKSEN L, HENRIKSEN SA, HOMAN WL,VAN KNAPEN F, NANSEN P, STAHL-SKOV P. 1991.Diagnostic tests for Trichinella spiralis infection in pigs.A comparative study of ELISA for specific antibodyand histamine release from blood cells in experimentalinfections. Vet Parasitol 39: 241-252.17. MADDEN KB, MURRELL KD. 1990. Inmunodiagnosisof nematode infections and prospects for vaccination,with especial reference to Trichinella spiralis. Rev SciTech OIE 9(2): 519-532.18. MØLLER LN, PETERSEN E, GAMBLE HR, KAPELCMO. 2005. Comparison of two antigens for demonstrationof Trichinella spp. antibodies in blood andmuscle fluid of foxes, pigs and wild boars. Vet Parasitol132: 81-84.19. MURRELL KD, ANDERSON WR, SCHAD GA, HAN-BURY RD, KAZACOS KR, GAMBLE HR, BROWN J.1986. Field evaluation of the enzyme‐linked immunosorbentassay for swine trichinosis: Efficacy of the excretory‐secretoryantigen. Am J Vet Res 47 (5): 1046‐1049.20. NAVARRETE I, CALERO R, REINA D, SERRANOFJ. 1991. Programas de acciones contra la trichinellosis.Servicio de Publicaciones Universidad de Extremadura.Cáceres/Badajoz.21. NÖCKLER K, POZIO E, VOIGT WP, HEIDRICH J.2000. Detection of Trichinella infection in food animals.Vet Parasitol 93: 335-350.22. NÖCKLER K, VOIGT WP, PROTZ D, MIKO A,ZIEDLER K. 1995. Intravitale Diagnostik der Trichinellosebeim Schwein mit dem indirekten ELISA [indirectELISA for the diagnosis of trichinellosis in living pigs].Berl Münch Tierärztl Wochenschr 108: 167-174.23. PÉREZ-MARTÍN JE, SERRANO F, REINA D, NA-VARRETE I. 1994. Evolution of swine humoral responseto CWE and ES antigens in ligth Trichinella infection byELISA test. In: Trichinellosis (Campbell, W.C.; Pozio,E.; Bruschi, F., Eds.). Istituto Superiore di Sanitá Press.Roma., 359-364.24. POZIO E, GÓMEZ-MORALES MA, DUPOUY-CA-MET J. 2003. Clinical aspect, diagnosis and treatment oftrichinellosis. Expert Rev Anti-infect Ther 1(3): 471-482.25. RAPIC D, DZACULA N, ZUKOVIC M. 1981. A studyof the cross reaction between trichinellosis and metastrongylosisin pigs by Enzyme Linked ImmunosorbentAssay (ELISA). Vet Arch 51: 223‐227.26. REITEROVÁ K, DUBINSKÝ P, KLIMENKO VV,TOMAŠOVIČOVÁ O, DVOROŽŇÁKOVÁ E. 1999.Comparison of Trichinella spiralis larva antigens for thedetection of specific antibodies in pigs. Vet Med-Czech44: 1-5.27. RIBICICH M, MIGUEZ M, FRANCA A, BASSON, GAMBLE RH, SANTILLAN G, MOLINA V,GUARNERA E. 2000. Evaluation of ELISA test for thediagnosis of porcine trichinellosis. Pig J 46: 24-34.28. RUITENBERG EJ, STEERENBERG PA, BROSI BJM,BUYS J. 1975. ELISA (enzyme‐liked immunosorbentassay) as preventive and representative control methodfor the detection of Trichinella spiralis infections inslaughter pigs. W Parazyt 21(4‐5): 747‐751.29. RUITENBERG EJ, STEERENBERG PA, BROSI BJM,BUYS J. 1976. Reliability of the enzyme‐linked immunosorbentassay (ELISA) for the serodiagnosis of Trichinellaspiralis infections in conventionally raised pigs. JImmunol Methods 101(2): 57-70.30. RUITENBERG EJ, VAN KNAPEN F. 1977. En-58Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 49-57

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 58-64Immunisation of rabbits with house dust miteextract does not protect against infection byGraphidium strigosumCUQUERELLA M., FAWZI E.M., PARAMIO R. and ALUNDA J.M. 11Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, 28040 Madrid, Spain.ABSTRACTThe effect of prior immunisation of rabbits with house dust mite extract (DpSE) on the challenge with750 L3 of Graphidium strigosum, and the effect of immunisation with DpSE on a chronic gastric infectionof rabbits with G. strigosum were studied. Immunisation did not provoke any significant variation in thehaematological (packed cell volume, leukocyte and eosinophil counts) and parasitological (prepatency period,parasite egg output and parasite burden) parameters determined in the infected rabbits. However, immunisationwith DpSE elicited a significant increase in IgG levels against both DpSE and G. strigosum soluble extract(ASE Gs). Higher levels of circulating anti-ASE Gs antibodies in immunised rabbits with a chronic helminthinfection could be related to the cross-reactivity between DpSE and ASE Gs (ELISA and Western blotting).Key words: Graphidium strigosum, rabbits, house dust mite extract, helminths, Westernblotting.RESUMENSe ha estudiado el efecto de la inmunización previa de conejos con extracto de ácaro del polvo (DpSE)sobre la infestación con 750 L3 de Graphidium strigosum, así como el efecto de la inmunización al seradministrada en conejos con una infestación crónica por G. strigosum. La inmunización no provocóvariaciones significativas en los parámetros hematológicos (valor hematocrito, recuentos de leucocitosy eosinófilos) y parasitológicos (duración del período de prepatencia, eliminación fecal de huevos delhelminto, carga parasitaria) determinados en los conejos infestados. Sin embargo, la inmunización conDpSE indujo un incremento significativo de los niveles de Ig G séricos tanto frente a DpSE como frente aun extracto soluble de adultos de G. strigosum (ASE Gs). Los niveles elevados de anticuerpos circulantesanti-ASE Gs podrían estar relacionados con la antigenicidad cruzada entre DpSE y ASE Gs (ELISA yWestern blotting).Palabras clave: Graphidium strigosum, rabbits, house dust mite extract, helminths, Western blotting.Received: 28 January 2011. Accepted: 15 February 2011.Correspondence: J.M. Alunda. Dpto. Sanidad Animal. Facultad de Veterinaria. Universidad Complutense de Madrid.28040 Madrid, Spain.E-mail: jmalunda@vet.ucm.es.Phone: +34 91 3943701. Telefax: +34 91 394390860

IMMUNISATION WITH MITE EXTRACT AGAINST GRAPHIDIUMINTRODUCTIONHelminth infections, particularly gastrointestinal(GI) infections, which are among the mostprevalent human diseases (Horton, 2003), are alsoof primary concern in the veterinary field becauseof the large number of animals affected and thepathogenicity linked to some parasitic species thatinfect livestock. Ostertagia infections, for example,are an important constraint for cattle breedingin temperate regions in both hemispheres; whiletrichostrongylid infections in sheep and goats, particularlyby Haemonchus contortus, are found allover the world and under certain circumstancesare often the limiting factor for profitable smallruminant production (Waller, 1994). With the notableexception of zoonotic and parasitic infectionsfound in pets, low-level multispecific GI infectionsin livestock, where maximum economic output ataffordable cost is the goal, tend to be the rule inmost management systems. Under these prevailingconditions, it is expected that inter-specific interactions(synergy, antagonism) would appear, thusaffecting pathogenicity and the immune responseelicited.The potential interest of interactions betweenparasitic populations affecting the same animal hosthas been recognised (Petney and Andrews, 1998;Lello et al., 2004; Bordes and Morand, 2009), althoughthe mechanisms involved are unclear. Forexample, it has been reported that the infestationof lambs with the nasal bot Oestrus ovis affects GIhelminths living in the abomasum (H. contortus;Terefe et al, 2005; Yacob et al, 2008) and the smallintestine (Trichostrongylus colubriformis; Yacobet al., 2004, 2006). The disappearance of myasistherefore induces a down-regulation of the hostresponse against the helminth infection related toan unspecific eosinophilic response (Yacob et al,2006). To the best of our knowledge, no informationon the effect of skin parasitism or skin parasiteproducts on a helminth infection has been reportedto date, despite the frequency of mite infestationsand helminth infections in livestock. The aetiologicalagent of sarcoptic mange, Sarcoptes scabiei,presents cross-reactivity with the house dust miteDermatophagoides pteronyssinus (Hejduk et al,2010). On these grounds, a soluble extract of thismite (DpSE) was used to determine its effect onthe experimental infection of rabbits by the gastricnematode Graphidium strigosum. As part of theexperiment, immunisation was carried out, eitherprior to infection with the nematode or on animalswith a chronic helminth infection.MATERIAL AND METHODSParasites: An isolate of the gastric nematode G.strigosum recently obtained from naturally infectedwild rabbits in the Autonomous Community of Madrid(Spain) and maintained in our animal facilitiesby serial passage in donor rabbits was employed forthe experimental helminth infections. Third-stagelarvae (L3) were obtained by coproculture (26 C,10 days), Baermannized and kept under refrigerationuntil used. Rabbits were infected experimentallyusing a bucoesophagic catheter as describedpreviously (Cuquerella and Alunda, 2009).Experimental animals and design: Twenty-twotwo-month-old female New Zealand X CaliforniaGiant rabbits (average weight: 2 kg) were purchasedfrom a local animal supplier (Granja SanBernardo, Spain). Coproscopic analysis showed aslight intestinal Eimeria infection; therefore the animalswere treated with Solprim® (sulfamethoxazole+ trimetoprim) (Almirall). Rabbits were maintainedin individual cages with water and pelletedfeed (Harlan) ad libitum for the entire experiment.The effect of prior immunisation of rabbits withD. pteronyssinus extract (DpSE) on the challengewith G. strigosum (Experiment 1), and the effectof the immunisation on a chronic gastric helminthinfection (Experiment 2) were evaluated. Immunisationwas performed by subcutaneous injectionof 100 µg (100 µL) of DpSE (Inmunotek, batch7Y01L) in physiological saline (100 µL). The animalswere randomly allocated to four groups. Inexperiment 1, group 1 (5 rabbits) was inoculatedwith DpSE once a week for three consecutiveweeks (-3, -2, -1), whereas rabbits in group 2 (6animals) were kept untreated; one week later bothgroups (group 1 and group 2) were infected with750 L3 of G. strigosum. The infection was allowedto progress and all animals were euthanised at week16 post-infection. In experiment 2, rabbits in group4 (5 animals) were infected with the same numberof G. strigosum L3, whereas rabbits in group 3 (6animals) were used as the uninfected control. Bothgroups were inoculated with DpSE at weeks 18, 19Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 58-6461

M. CUQUERELLA et al.and 20 of the experiment. Rabbits (groups 3 and 4)were euthanised at week 26 of the experiment.Parasitological determinations: The faecal eggoutput of G. strigosum was evaluated using a modifiedMcMaster technique (MAFF, 1971). Stomachswere removed immediately after euthanasia,opened, the contents collected, and adult wormsrecovered from the gastric mucosa and counted.Haematological parameters, ELISA and Westernblotting: Weekly blood samples were obtainedfrom all animals by venipuncture of the marginalvein of the ear, with and without anticoagulant.Packed cell volume (PCV), the leukocyte and eosinophilcounts were determined using standardlaboratory techniques (Schalm et al, 1981). Serumspecificantibody levels against D. pteronyssinuswere determined using ELISA. Optimal assay conditionswere determined in a checkerboard manner.Polystyrene microtitre plates were coated with dustmite antigen (DpSE) (1 µg/mL) or adult solubleextract of G. strigosum (ASE Gs) (5µg/mL) and incubatedat 4 C overnight. Rabbit sera were used at1:100 dilution. Alkaline phosphatase-labelled goatanti-rabbit IgG (Sigma) at 1:1000 was used as secondantibody, with 1,4-p-nitrophenyl phosphate (1mg/mL, Boehringer Mannheim) as substrate. Microtitreplates were read at 405 nm and results weregiven as optical density (OD) values. ASE Gs andDpSE were fractionated by polyacrylamide (12%)gel electrophoresis under denaturing and reducingconditions (SDS-PAGE), as described by Cuquerellaand Alunda (2009). Proteins were electroblottedonto Immobilon P (Millipore) membranes.Membrane strips were incubated with rabbit sera(1:100) and the second antibody was peroxidaselabelledgoat anti-rabbit IgG (Sigma). The colourreaction was carried out with 0.5 mg/mL 4-chloro-1-naphthol (Bio Rad).Statistical analysis: Haematological, serologicaland parasitological data were analysed using meanand standard deviations. Inter-group comparisons todetermine significant differences (PCV, eosinophiland leukocyte counts, IgG, epg) were performedusing a repeated measures GLM analysis, one- andtwo-way ANOVA, post hoc Duncan’s multiplerange test, and a T-test. Statistical analysis wascarried out using SPSS software. Differences wereconsidered significant when P < 0.05.RESULTSEffect of prior immunisation of rabbits withD. pteronyssinus extract on the challenge with G.strigosum.The prepatent period of infection was long (over6 weeks), and maximum epg counts were reachedat week 12 post-infection in both groups of animals(Figure 1). Wide variations in epg values were foundwithin each experimental group, with no significantdifferences between rabbits immunised with DpSE(Group 1) and non-immunised rabbits (Group2). PCV values remained in the physiologicalrange and there was no significant variation ineosinophil counts, irrespective of immunisationor the helminth infection administered. Leukocytecounts in peripheral blood increased throughout theexperimental period (not shown).The immunisation of Group 1 rabbits withthree DpSE inoculations elicited a significant (PFigure 1. Faecal egg output of G.strigosum during the experimentalperiod for DpSE-immunised rabbits(filled squares) and non-immunisedrabbits (empty squares) (experiment1). Data are given as average ± standarddeviation.62Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 58-64

IMMUNISATION WITH MITE EXTRACT AGAINST GRAPHIDIUMTable 1. Serum IgG response against G. strigosumsoluble extract in rabbits from experiment 1, asestimated by ELISA. G-1: animals immunisedwith dust house mite extract (DpSE) and challengedwith G. strigosum larvae (week 0). G-2: rabbitsnon-immunised and challenged. Values aremeans ± standard deviation.Week Group 1 Group 2-4 0 00 0.537 ± 0.30 0.076 ± 0.10 *4 0.531 ± 0.49 0.228 ± 0.10 *8 0.626 ± 0.36 0.238 ± 0.10 *9 0.579 ± 0.25 0.309 ± 0.1312 0.655 ± 0.27 0.538 ± 0.29* Statistically significant (P 0.05)nematode burdens and female/male ratios wereobserved upon euthanisation of the animals (Figure2a).Effect of immunisation with D. pteronyssinusextract on a chronic helminth infection (G. strigosum)Figure 3 shows the faecal egg output (epg) ofGroup 4 rabbits subjected to a chronic infection withG. strigosum and immunised with dust mite extract(DpSE). The prepatent period of the infection waslong (6-8 weeks) and an increase of epg counts wasobserved over the experimental period. Uninfectedcontrol rabbits (Group 3) did not show any helmintheggs during this period. None of the animalsdisplayed significant deviations of PCV valuesor leukocyte counts (not shown). Examination ofthe animals after euthanisation at week 26 postinfectionshowed an absence of nematodes in thecontrol rabbits, and that the average gastric burdenof helminths in Group 4 (Figure 2b) was higherthan the one found in the previous experiment,although the differences were not significant.Infection of Group 4 rabbits with the helminthwas accompanied by a steady increase in anti-G.strigosum serum IgG antibodies up to week 17post-infection (Table 2). Immunisation of rabbitsfrom both groups with DpSE (weeks 18, 19 and 20)elicited a significant (P < 0.05) response against dustmite extract when compared to pre-immunisationvalues but no differences were observed betweenthe groups (F = 46.98, P = 0.751). Interestingly, inthe infected group (Group 4) there was a significantincrease (P < 0.05) in the anti-ASE Gs IgG responsefollowing immunisation with DpSE (weeks 21 and23 post-infection). Sera from uninfected and DpSEFigure 2. Adult parasite burdens of G.strigosum in the stomachs of infectedrabbits at the end of experiment 1(Groups 1 & 2; G-1 and G-2) (Figure2a) and experiment 2 (Group 4;G-4) (Figure 2b). White columns:total burden; black columns: malehelminths; grey columns: femalehelminths. Data are given as average± standard deviation.Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 58-6463

M. CUQUERELLA et al.Table 2. Serum IgG response against G. strigosum soluble extract (ASE Gs) and D. pteronyssinus (DpSE),along the experimental period, of rabbits immunised with DpSE (weeks 1 8, 19 and 20) with a chronic infectionwith the helminth (Group 4) or uninfected control animals (Group 3), as estimated by ELISA. Meanoptical density values ± standard deviationGroup 4 Group 3Week IgG anti-ASE Gs IgG anti-DpSE IgG anti-DpSE0 -4 0.028 ± 0.16 -8 0.082 ± 0.51 0.038 ± 0.02 0.055 ± 0.0117 0.244 ± 0.55 0.053 ± 0.03 0.050 ± 0.0121 0.729 ± 0.42 a 0.408 ± 0.19 b 0.433 ± 0.17 b23 0.604 ± 0.45 a 0.356 ± 0.19 b 0.277 ± 0.09 bDifferent superscripts within each row represent statistically significant differences (P < 0.05).Figure 3: Faecal egg output of G.strigosum during the experimentalperiod for rabbits immunised withhouse dust mite extract (Dp SE).Arrows: days of immunisation withDp SE (experiment 2). Data are givenas average ± standard deviation.immunised rabbits (Group 3) cross-reacted withASE Gs in ELISA (not shown). Western blottinganalysis (Figure 4) showed that soluble extractof the nematode was recognised only by infectedrabbits (Figure 4A, lanes 4 & 5), whereas noninfectedand DpSE immunised animals did notreact with the helminth extract. However, pooledsera from infected and non-immunised rabbitsreacted with dust mite extract (ca. 72 KDa) (Figure4B, lane 2’).DISCUSSIONThe experimental infections of rabbits with G.strigosum showed long prepatent periods, as observedin previous trials with this nematode species(Nickel and Haupt, 1986). The lack of significantvariations in the haematological parameters (leukocytes,PCV) determined during the experimentalinfections is in agreement with the low pathogenicityassociated with moderate parasite burdens inthis host-parasite model (Cuquerella and Alunda,2009). The comparable parasite egg output valuesfrom Groups 1 and 2, and the similar gastricadult helminth burdens at the end of the experimentprovided evidence of the lack of effect of prior immunisationwith house dust mite extract on the helminthchallenge. Similarly, immunisation (DpSE)of animals with a previously established chronicnematode infection had no apparent effect on thefinal number of gastric helminths or the epg patternfound (Group 4). Moreover, the absence of intergroupdifferences in the haematological parameters,irrespective of the treatment received by theanimals (immunisation and/or nematode infection),supports the non-significant effect of the heterologousimmunisation (DpSE) on this gastric helminthinfection.Information concerning the effect of heterolo-64Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 58-64

IMMUNISATION WITH MITE EXTRACT AGAINST GRAPHIDIUMFigure 4. 4A: Immune recognition patterns (Western blotting) of adult soluble extracts of G. strigosum (ASE Gs) inexperimental rabbits. Lane 1: pooled sera from uninfected control rabbits; lane 2: pooled sera from immunised anduninfected rabbits (group 1, week 0); lane 3: pooled sera from immunised and uninfected control rabbits (Group 3,week 21); lane 4: positive control rabbit (infected with G. strigosum); lane 5: pooled sera from infected (G. strigosum)and immunised rabbits (Group 4, week 21). 4B: Immune recognition patterns (Western blotting) of house dust miteextract (DpSE) in experimental rabbits. Lane 1’: immunised and uninfected rabbits (Group 3, week 23); lane 2’: pooledsera from infected and non-immunised rabbits (Group 4, week 12); lane 3’: positive control rabbit (immunised withDpSE); lane 4’: negative control rabbit. MW: molecular weight markers in kilodaltons.gous immunisation on GI helminth populations isvery scarce. It has been shown that infestations ofO. ovis (nasal bot) in sheep induce lower developmentand fertility in H. contortus (Terefe et al,2005; Yacob et al, 2008) and t. colubriformis (Yacobet al, 2006). Moreover, some evidence of interactionhas been found in Sarcoptes infestations andGI helminth parasitism (Balestrieri et al, 2006). Inour experiment, it is interesting to note that, despitethe limited numbers of experimentally immunisedand infected rabbits, inoculation of dust mite extractinduced an increase in serum-specific antibodiesagainst the helminth. This increase was foundboth when immunisation was administered beforeinfection (Group 1) and, particularly, in chronicallyinfected animals (Group 4). The lack of effect ofthese antibodies against helminth development isconsistent with the limited role played by IgG antibodiesin other parasitic infections with gastric helminths(e.g. H. contortus in lambs, Gómez-Muñozet al, 1999).At least two reasons, which are not necessarilymutually exclusive, could account for the observedincrease in antibody response against ASEGs after immunisation with DpSE, namely crossantigenicityof the extracts and immune modulationinduced by DpSE inoculation. Apparently, ASE Gsand dust mite extract share some antigenic components.However, despite Western blotting not beinga quantitative technique, we found that the degreeof cross-reactivity was low. On the other hand, ithas been shown that helminth infections induce animmune modulation involving, among other mechanisms,Th2 and regulatory responses (i.e. Maizelset al, 2009; Figueiredo et al, 2010). In addition,some findings are consistent with protection againstenteric infections (viral and bacterial) elicited byallergic sensitisation (Black, 2005). The possibilityof host immune modulation by immunisation withDpSE has not been specifically addressed in ourexperiments. Whatever the underlying mechanismand its relative contribution (cross antigenicity and/or immunomodulation), our results make a strongcase for exploring the possibility of inducing a protectiveresponse against GI helminths with heterologoussubcutaneous immunisation, using differentschedules and adjuvants.REFERENCES1. Balestrieri A, Remonti L, Ferrari N, Fer-Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 58-6465

M. CUQUERELLA et al.rari A, Lo Valvo T, Robetto S, Orusa R.2006. Sarcoptic mange in wild carnivores and its cooccurrencewith parasitic helminths in the Western ItalianAlps. Eur J Wildl Res 52: 196-201.2. Black PN. 2005. Does atopy protect against entericinfections? Allergy 60: 30-34.3. Bordes F, Morand S. 2009. Coevolution betweenmultiple helminth infestations and basal immune investmentin mammals: cumulative effects of polyparasitism?Parasitol Res 106: 33-37.4. Cuquerella M, Alunda JM. 2009. Immunobiologicalcharacterization of Graphidium strigosumexperimental infection in rabbits (Oryctolagus cuniculus).Parasitol Res 104: 371-376.5. Figueiredo CA, Barreto ML, RodriguesLC, Cooper PJ, Silva NB, Amorim LD, Alcantara-NevesNM. 2010. Chronic intestinal helminthinfections are associated with immune hyporesponsivenessand induction of a regulatory network. Infect Imm78: 3160-3167.6. Gómez-Muñoz MT, Cuquerella M, Gómez-Iglesias LA, Méndez S, Fernández-PérezFJ, de la Fuente C, Alunda JM. 1999. Serumantibody response of Castellana sheep to Haemonchuscontortus infection and challenge: relationship toabomasal worm burdens. Vet Parasitol 15:7. Hejduk G, Hofstätter K, Löwenstein M,Peschke R, Miller I, Joachim A. 2010. Characterisationof Sarcoptes scabiei antigens. Parasitol Res.DOI 10.1007/s00436-010-2063-z.8. Horton J. 2003. Human gastrointestinal helminthinfections: are they now neglected diseases? TrendsParasitol 19: 527-531.9. Lello J, Boag B, Fenton A, StevensonIR, Hudson PJ. 2004. Competition and mutualismamong the gut helminths of a mammalian host. Nature428: 840-844.10. Maizels RM, Pearce EJ, Artis D, YazdanbakhshM, Wynn TA. 2009. Regulation of pathogenesisand immunity in helminth infections. J ExpMed 206: 2059-2066.11. Ministry of Agriculture, Fisheries andFood, MAFF. 1971. Manual of Veterinary ParasitologicalLaboratory Techniques, HMSO, London.12. Nickel EA, Haupt W. 1986. Experimental studieson the course and consequences of infection withGraphidium strigosum (Nematoda, Trichostrongylidae)in Oryctolagus cuniculus (domestic rabbit). AngewParasitol 27: 215-219.13. Petney TN, Andrews RH. 1998. Multiparasitecommunities in animals and humans: frequency,structure and pathogenic significance. Int J Parasitol28: 377-393.14. SCHALM OW, JAIN NC, CARROL EJ. 1981. HematologíaVeterinaria. Edit. Hemisferio Sur S.A. BuenosAires, Argentina.15. Terefe G, Yacob HT, Grisez C, Prevot F, DumasE, Bergeaud JP, Dorchies Ph, Hoste H,Jacquiet P. 2005. Haemonchus contortus egg excretionand female length reduction in sheep previouslyinfected with Oestrus ovis (Diptera: Oestridae) larvae.Vet Parasitol 128: 271-283.16. Waller PJ. 1994. The development of anthelminticresistance in ruminant livestock. Acta Tropica 56: 233-243.17. Yacob HT, Dorchies Ph, Jacquiet Ph,Bleuart C, Prevot F, Grisez C, BergeaudJP, Hoste H. 2004. Concurrent parasitic infections ofsheep: Depression of Trichostrongylus colubriformispopulations by a subsequent infection with Oestrusovis. Vet Parasitol 121: 297-306.18. Yacob HT, Terefe G, Jacquiet Ph, Hoste H,Grisez C, Prévot F, Bergeaud JP, DorchiesPh. 2006. Experimental concurrent infection of sheepwith Oestrus ovis and Trichostrongylus colubriformis:Effects of parasitic treatments on interactions betweenparasite populations and blood eosinophilic responses.Vet Parasitol 137: 184-188.19. Yacob HT, Basazinew BK, Basu AK. 2008.Experimental concurrent infection of Afar Breed goatswith Oestrus ovis (L1) and Haemonchus contortus(L3): Interaction between parasite populations, changesin parasitological and basic haematological parameters.Exp Parasitol 120: 180-184.Acknowledgements: English revision by Valerie Stacey isacknowledged. EMF has a predoctoral studentship from theSpanish Ministry of Science and Innovation .This researchwas partially funded by CICYT (AGL2006-10589 grant).66Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 58-64

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 65-73Cystic echinococcosis in cattle in UruguayHERNÁNDEZ Z. 1 , FERRAGUT G. 2 , IRABUENA O. 2 and CABRERA P. 31Parasitología, Facultad de Veterinaria Regional Norte Universidad de la República. Rivera 1350 Salto, Uruguay.2Laboratorio de Inmunología Regional Norte - Salto U. de la República. Uruguay.3Parasitología, Facultad de Veterinaria Universidad de la República. Uruguay.ABSTRACTIn Uruguay the Echinococcus granulosus sheep strain, agent of cystic echinococcosis, mainly occursin the sheep - dog cycle, but cattle are commonly infected. The objective of this work was to study thecharacteristics of the presence of the larva of E. granulosus in cattle in the northwestern region in Uruguay.Livers and lungs of 1987 slaughtered animals were examined. Metacestodes were found in 10.8% and66.7% of cattle and herds, respectively. Larvae were more frequently found in lungs followed by the liverand localization in both organs simultaneously. The number of larvae per animal showed an over-disperseddistribution. Among the metacestodes, 97.6% were under 10 cm, 28% located deep in the parenchyma, andhyaline unilocular presentations prevailed compared to caseous septate and calcified presentations. Theproportion of fertile hydatid cysts was estimated at 12% and the viability of protoscolices at 85%, but thesefeatures were not associated with the organ and did not depend on the size of the larvae. Infection ratesand fertility of the cysts support the participation of cattle in the epidemiology of cystic echinococcosis inUruguay.Key words: Echinococcus granulosus, cattle, epidemiology, Uruguay.RESUMENEn Uruguay Echinococcus granulosus cepa ovina, agente de la echinococcosis quística, se presentaprincipalmente en un ciclo ovino - perro, pero los bovinos se encuentran comúnmente infectados. Este trabajotiene como objetivo estudiar las características de la presentación de las larvas de E. granulosus en bovinosen la región noroeste de Uruguay. Se examinaron postmortem los hígados y pulmones de 1987 bovinos. Losmetacestodes se encontraron en el 10,8% y 66,7% de los bovinos y tropas bovinas respectivamente. En lospulmones se ubicaron más frecuentemente, seguido por el hígado y las localizaciones simultáneas en ambosórganos. El número de larvas por bovino presentó una distribución sobredispersa. En los metacestodes el97,6% fueron menores de 10 cm, el 28% ubicados profundamente en el parénquima y predominaron laspresentaciones uniloculares hialinas con respecto a las tabicadas caseificadas y calcificadas. Se estimó unRecibido: 20 de Febrero de 2011. Aprobado 22 de Mayo de 2011.Corresponding: Zully Hernández Russo, Departamento de Parasitología Facultad de Veterinaria Regional Norte,Universidad de la República. Rivera 1350, Salto Uruguay. Tel 598 473 34816 int 133; Fax: 598 47322154E-mail address: zhernan@unorte.edu.uy67

Z. HERNÁNDEZ et al.12 % de quistes hidáticos fértiles y un 85% de viabilidad de los protoescólices, pero estas características noestán asociadas al órgano ni dependen del tamaño de las larvas. Los índices de infección y fertilidad quísticaavalan la participación de los bovinos en la epidemiología de la echinococcosis quística en Uruguay.Palabras clave: Echinococcus granulosus, bovinos, epidemiología, Uruguay.INTRODUCTIONCystic echinococcosis is a parasitic zoonosiscaused by Echinococcus granulosus and is associatedwith a predator prey relationship between finaland intermediate host. Cystic echinococcosis inUruguay occurs in an endemic state affecting publichealth, economic and social areas. The sheepstrain has been identified and involves primarilysynanthropic hosts and involves the dog and domesticungulates, accidentally infecting man (Cabreraet al, 1995; FAO, 2007).National studies indicate a prevalence of cysticechinococcosis in cattle of 6.5% and in adult sheepof 18% (Cabrera et al, 2003, 2005). Records showa 4.3% of positive dogs detected by coproantigenand, in rural areas, a 1 to 3% of infected humansdetected by ultrasound examination (Comision deZoonosis, 2008).The main cycle reported is the sheep - dog cycle,but cattle is commonly infected and represent apotential reservoir for the infection of the dog. Theaim of this work was to study the characteristics ofthe presence of the larva of E. granulosus in cattlein the northwestern region in Uruguay.MATERIALS AND METHODSThe study was conducted on cattle from differentfarms of the northwest region of Uruguay (30º - 33ºSL and 54º - 58º WL), covering an area of 55451km 2 , which represents 31.5% of the total area ofthe country. In this area the main source of incomeis represented by beef cattle (78%), followed bysheep (11%), forestation (4%), cereal and industrialcrops (3.2%), dairy cattle (1.9%) and horticulture(1.4%) (Ministerio de Ganadería, Agricultura yPesca, 2000).Climate patterns correspond to a moderateclimate with an average temperature of 18.3ºC andaverage annual rainfall of 1330 mm (DirecciónNacional de Meteorología, 1996).Sample description: All of the animals belongingto 60 troops herds were examined post mortemat the slaughterhouse “La Caballada” in 2004. Thesampling was random, cluster and single-stage. Atotal of 1987 animals were analyzed, 94% werecomplete dentition and 6% were four to six teeth.Parasitological examination: Livers and lungswith lesions were removed and identified by troopsherd and animal for further evaluation and confirmationof diagnosis at the Northern Regional Laboratory,Universidad de la República. Visualization,palpation and cuts of the respective parenchymawere performed and macro and microscopic morphologicalcharacteristics of the pathologic findingswere recorded. For each herd the topographiclocation of the lesions were mapped for each animal,discriminated by costal and mediastinal faceof the left and right lung and the visceral and diaphragmaticface of the liver, as well as the number,size, location and evolutionary stage of cystic larvaenumber. The evolution of the cysts were classifiedas hyaline, caseous, calcified, hemorrhagic,unilocular or loculated. Fertility was determined bythe presence of protoscolices and their viability byvital staining with eosin 0.1%. Histopathologicalexamination was used where macroscopic diagnoseof some pathologies was difficult to perform.Statistical analysis: The confidence level ofcystic echinococcosis prevalence in the samplewas estimated at 95% in cattle. The E. granulosuslarva frequency distributions were described andthe measures of the summary of the characteristics(topographic location, number, size, evolutionarystage, fertility and viability) were estimated. Theassociations between the evolutionary stage andfertility of hydatid cysts and the organ in which theywere located were tested by χ 2 and for the viabilityassociation of protoscolices and the parasited organthe exact test of Fisher was used.Logistic regression was used to study the possibleinfluence of the size factor of the hydatid cystson the dependent variables fertility and viability ofprotoscolises. The significance level was an alpha68Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 65-73

CYSTIC ECHINOCOCCOSIS IN CATTLE IN URUGUAYof 0.05 and the Statgraphics plus version 5.1 programwas used.RESULTSPrevalence of cystic echinococcosis in cattle:The prevalence of cystic echinococcosis in thesample was 10.8% (CI: 9.4% - 12.1%) and 66.7%(CI: 54.8% - 78.6%) in cattle and herds, respectively.Characteristics of the of E. granulosus larvain cattleTopographic location of the E. granulosuslarvae: The total number of cattle infected accordingto the topographical location of the hydaticcysts is shown in Table 1. Eighty % of the cattle hadlocations in lungs, 16.27% in liver and 3.72% inliver and lung simultaneously. In turn, the distributionof the animals according to the topographicallocation of the metacestodes in each organ was asfollows, 149 in the right lung (137 in the costal faceand 12 in the mediastinal face), 103 in the left lung(95 in costal face and eight in mediastinal face) and48 in liver (38 in the visceral face and 10 in diaphragmaticface).Of the 541 analyzed hydatid cysts, 480 werelocated in the lung, of which 281 were in the rightlung (254 in the costal face and 27 in mediastinalface) and 199 were in the left lung (179 in thecostal face and 20 in the mediastinal face) and theremaining 61 were located in the liver (50 in thevisceral face and 11 in the diaphragmatic face).Twenty-eight % of the metacestodes were locateddeeply in the corresponding parenchyma (invisibleat inspection from the surface).Number of larvae of E. granulosus per animal:The number of metacestodes per animal wasbetween one and 60, and 61.4% of the cattle showedonly one cyst and 3.3% had more than eight. Themean number of lesions was 2.51 (Table 2).Size of the E. granulosus larvae: The size ofTable 1. Distribution of the animals according tothe topographic location of hydatid cystsLocation ofhydatic cysts*Number ofanimalsRelative frequency(%)1 78 36.282 2 0.933 39 18.144 1 0.475 26 12.096 5 2.331,3 44 20.471,5 3 1.403,5 1 0.475,6 4 1.861,2,3 2 0.931,2,5 1 0.471,3,5 2 0.931,2,3,4 6 2.791,2,3,4,5,6 1 0.471: costal face right lung, 2: mediastinal face right lung,3: costal face left lung, 4: mediastinal face left lung, 5:visceral face liver, 6: diaphragmatic face liver.Table 2. Distribution of the total number of animalsaccording to the number of hydatid cystshostedNumberofcystsNumber ofanimalsRelativefrequency(%)Accumulatedrelativefrequency%1 132 61.40 61.402 50 23.26 84.653 14 6.51 91.164 2 0.93 92.095 6 2.79 94.886 1 0.47 95.357 2 0.93 96.288 1 0.47 96.7412 1 0.47 97.2113 1 0.47 97.6714 1 0.47 98.1427 1 0.47 98.6033 1 0.47 99.0742 1 0.47 99.5360 1 0.47 100.00Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 65-7369

Z. HERNÁNDEZ et al.Table 3. Distribution of hydatid cysts according to size (cm)Size Number of cysts Relative frequency (%) Accumulated relativefrequency (%)0 - 2 259 47.88 47.882 - 4 164 30.31 78.194 - 6 54 9.98 88.176 - 8 33 6.10 94.278 - 10 18 3.33 97.6010 - 12 5 0.92 98.5212 - 14 2 0.37 98.8914 - 16 5 0.92 99.8216 - 18 0 0.00 99.8218 - 20 1 0.18 100.00Over 20 0 0.00 100.00the larvae of E. granulosus varied between 0.5 to20.0 cm of diameter with an average of 3.34 (±2.76). The percentage of metacestodes under 10 cmwas 97.6% (Table 3).Evolutionary stage of the larvae of E. granulosus:The evolutionary stages of the larvae of E.granulosus taking the cyst and the animal as unit ofanalysis are summarized in Tables 4 and 5, respectively.The majority of the animals (85.6%) had metacestodesin a single evolutionary form, while 1.4%hosted larvae in four different states.A significant association between the evolutionarystage of hydatid cysts and the organ where theyare located was found (Table 6).Fertility of the larva of E. granulosus andviability of protoscolices: The proportion offertile hydatid cysts was estimated at 12% and theviability of protoscolices at 85%. The proportionsof fertile and infertile hydatid cysts did not differsignificantly between liver and lung locations, sofertility was not correlated with the organ (Table7), nor did it depend on the size of the larvaeaccording to the logistic regression model (χ 2 =1.52; p = 0.2168).The viability of protoscolices did not differsignifficantly between the parasitized organs;therefore, viability was not associated with theorgan (Fisher’s exact test p = 1.000), nor did itdepend on the size of the larvae according to thelogistic regression model (χ 2 = 0.26; p = 0.6088).Table 4. Evolutionary stages of hydatid cystsEvolutionary stageNumber ofcystsDISCUSSIONRelativefrequency(%)Unilocular hyaline 256 47.32Unilocular caseous 122 22.55Unilocular calcified 75 13.86Unilocular hemorrhagic17 3.14Septate hyaline 10 1.85Septate caseous 27 4.99Septate calcified 26 4.81Septate hemorrhagic 8 1.48Prevalence of cystic echinococcosis in cattle:In this study, the percentage of cattle presentingcystic echinococcosis (10.8%) was lower thanbefore the National Programme for Control ofHydatidosis was instated in 1990 (64.8%). Cabreraet al, (2005) found a 6,5% of the cattle positiveto hydatid cyst, but it was lower in the completedentition population than in our study (67% vs 94%,respectively). Cystic echinococcosis in 66.7% ofthe herds could be explained by the continuity ofthe endemic state of the parasite and that 33.3% ofthe herds contained animals from different origens.70Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 65-73

CYSTIC ECHINOCOCCOSIS IN CATTLE IN URUGUAYTable 5. Distribution of animals as per the evolutionarystage of the metacestodesEvolutionarystage *Number ofanimalsRelative frequency(%)1 66 30.702 43 20.003 33 15.354 8 3.725 7 3.266 14 6.517 10 4.658 3 1.401,2 6 2.791,3 1 0.471,4 4 1.861,8 1 0.472,3 5 2.332,6 1 0.472,8 1 0.473,7 1 0.473,8 1 0.474,7 2 0.931,2,3 1 0.471,2,6 2 0.931,6,7 1 0.472,3,5 1 0.472,3,4,7 1 0.472,3,7,8 1 0.472,4,6,7 1 0,47*1: Unilocular hyaline, 2: unilocular caseous, 3: unilocularcalcified , 4: unilocular hemorrhagic, 5: septatehyaline, 6: septate caseous, 7: septate calcified, 8:septate hemorrhagic.The prevalence of echinococcosis in cattle in Chileis 22%, in Brazil 25% and in the endemic regionof Argentina 7% (Muñoz and Sievers, 2005; Moroand Schantz, 2006). The difficulty of comparinginfection rates among countries is due to thevariability in the epidemiological, social, technicaland economic conditions, which depends on theage of the animals, the levels of exposure and thematurity and viability of eggs (Njoroge et al, 2002;Bardonnet et al, 2003; Azlaf and Dakkak, 2006).Characteristics of the larva of E. granulosusin cattleTopographic location of the larvae of E.granulosus: The location of hydatid cysts showedthe same topographical distribution, considering asthe analytical unit either the total number of cattleor the metacestodes.The higher frequency of parasitized lungscompared to liver in cattle, as well as the infectionof both organs being less common than the uniquepresentations, is in accordance with other studies(Njoroge et al, 2002; Bardonnet et al, 2003; Muñozand Sievers, 2005). However, Azlaf and Dakkak(2006) showed that most of the cattle presented cystsin the liver and the lungs simultaneously. Sheep, incomparison, show higher rates of infection in theliver than in lungs (Cabrera et al, 2003; Scala etal, 2006). However, Dueger and Gilman (2001)in Peru, reported as the lungs as main locationif infection for the sheep, which was attributedto a variation of the strain of E. granulosus withpulmonary tropism and/or to an increase in capillarydilation and pulmonary blood volumes as a resultof living at high altitudes. Likewise, Tassinari dosSantos et al, (2008) found the majority of cysts inlungs after experimental infection in young sheep.The differences in localization between sheep andcattle could be due to anatomical and physiologicalfactors of the host, to the parasite’s ability to passthe tisular barriers and to resist the inflammatoryand immune responses, and to the strain involved.The higher number of hydatid cysts in the rightlung could be explained by its greater size andnumber of lobes than the left lung (in a ratio of 3-2),as well as the tracheal bronchus and its respectivevessels have a second smaller branch in the rightlung (Dyce et al, 1999).Number of larvae of E. granulosus per animal:The number of hydatid cysts per animal agreeswith the over-dispersed distribution described forE. granulosus. In this distribution few hosts holda large load of metacestodes (3.3% of the animalshad more than eight cysts) and a large proportion ofthe population had a very limited number of parasites(61.4% of the animals showed only one cyst)(Gemmell and Lawson, 1986; Christodoulopouloset al, 2008).Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 65-7371

Z. HERNÁNDEZ et al.Table 6. Evolutionary stage of hydatid cysts according to the parasitized organEvolutionary stage*1 2 3 4 5 6 7 8 TotalLiver 31 8 4 0 7 10 0 2 62Lung 223 106 69 17 3 15 26 6 465Total 254 114 73 17 10 25 26 8 527* 1: Unilocular hyaline, 2: unilocular caseous , 3: unilocular calcified, 4: unilocular hemrrhagic, 5: septate hyaline ,6: septate caseous, 7: septate calcified, 8: septate hemorrhagic χ 2 = 64.25; p = 0.0001.Table 7. Fertility and infertility of hydatid cysts according to the parasitized organInfertile Fertile TotalLiver 32 7 39Lung 217 27 244Total 249 34 283c 2 = 1.51; p = 0.2196.The mean number of 2.51 (minimum one,maximum 60) metacestodes per animal is similarto the average of three found by Bardonnet et al.(2003), and Capuano et al, (2006) mentionned anaverage of 4.3 (minimum one, maximum 45) perbuffalo (Bubalus bubalis). In sheep the averagereported by Scala et al, (2006) was 5.3 (minimumone, maximum 114) and Cabrera et al, (1995)found that the number of cysts increased with age,reaching an average of 4.69 at 54 months.Size of the larvae of E. granulosus: The thoroughnessof the diagnostic technique of palpationand visualization in the present study revealed that47.9% of the larvae were smaller than two cm and28% were located deeply in the parenchyma. Muñozand Sievers (2005) consider the absence of hydatidcysts smaller than 10 mm in adult cattle tobe due to the development of immunity which preventsformation of new cysts in constant reinfections.However, in this study we found a 18.7% ofcystic structures of Echinococcus spp. of less than1 cm and Sakamoto and Cabrera (2003) reportedsizes of 1 mm in the same age groups.Evolutionary stage of the larvae of E. granulosus:Among the evolutionary stages of cysticechinococcosis unilocular presentations prevailedover the septate, when considering either the totalnumber of cysts (86.9% vs 13.1%) or the totalnumber of parasitized animals (181 vs 48 animals).The classification of hydatid cyst in adult catlle describedby Sakamoto and Cabrera (2003), showed58% of unilocular cysts, followed by 22% polymorphics,0.5% multicystics and 1.5% involutedcysts.The most frequent evolutionary stage of unilocularcysts was hyaline (47.3%), followed bycaseous (22.5%), calcified (13.9%) and hemorrhagic(3.1%), whereas the distribution of septatecysts was caseous (4.9%), calcified (4.8%), hyaline(1.8%) and hemorraghic (1.48%).The higher frequency of unilocular hyalinehydatid cysts could indicate recent infection ofcattle and/or the slow evolution of the larvae.The possible acquired immunity after the naturalintake of oncospheres does not seem to preventthe development of the metacestodes, especiallyconsidering that over 90% of the animals hadcomplete dentition. In this regard, Cabrera et al.(1995), Torgerson et al, (2003) showed no evidenceof protective immunity induced by the parasite insheep and cattle due to natural infections. A highproportion of viable cysts in cattle in which thebovine strain was involved was found by Thompsonand Mac Manus (2002) and Torgerson et al, (2003).The association of evolutionary stage with ageof the animal could not be established due to the72Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 65-73

CYSTIC ECHINOCOCCOSIS IN CATTLE IN URUGUAYage composition of the cattle population, but it wassignificantly correlated with the organ. Dueger andGilman (2001) found 13% and 5% of calcified anddegenerated cysts, respectively, in sheep, whichincreased with the age. Likewise Cabrera et al,(2003) showed 29% calcified and 71% hyalinecysts in young sheep, while 34% of the cysts werecalcified and 65% hyaline in adults. Muñoz andSievers (2005) found 28% of abscessed or alteredcystic larvae which 67% in lungs in cattle. Scalaet al, (2006) reported in sheep, 4.5% caseous and57.5% calcified cysts mainly in the liver. The highproportion of calcified cysts and the early death ofmetacestode in horses, suggest that the strain of E.granulosus is not adapted to this species (Azlaf andDakkak, 2006).The presence of metacestodes in different evolutionarystages in the same animal could be dueto the time of acquiring the infection and/or therelationship host-parasite. The development of themetacestode after ingestion of the eggs varies andreflects the heterogeneity in the genetics, immunology,physiology and nutrition that influences thesusceptibility of individuals, and possibly the intrinsicand extrinsic features of the parasite (Breijoet al, 2008).Fertility of the larva of E. granulosus: Thefertility of metacestodes in cattle in this study(12%) was close to that reported by Cabrera etal, (1995) (13.5%) in sheep aged 54 months inUruguay. However, higher rates of fertility havebeen registered in sheep than in other animal speciesin the same geographical area of different countries(Dalimi et al, 2002; Muñoz and Sievers, 2005). M’rad et al, (2005) reported fertility rates of 67% and47% in sheep and cattle respectively, therefore thesheep strain seems very adapted to cattle, whichconstitute a host of high risk for contamination ofdogs and, consequently, for human infection.Cystic fertility in cattle in the region was 21.3%in Argentina and 26% in Chile (Schantz et al, 1995,Muñoz and Sievers, 2005).The susceptibility to infection and cysticfertility are considered key factors in determiningthe importance of intermediate hosts in themaintenance and spread of the life cycle andcan affect the stability of the parasite. Witht thisstudy we have shown that prevalence and cysticfertility rates in cattle were similar to those ofsheep (Cabrera et al, 1995; Cabrera et al, 2003).Variations in fertility among and within differentanimal species depend on the strain, geography,ecology, host, organic location and type of cysts(Thompson, 1995).Andresiuk et al, (2005) suggest that the G1 genotypemay have epidemiological and phenotypicadaptations; in Spain it is mainly transmitted betweensheep and dogs and in Argentina cattle seemsto be the main intermediate host. The size and externalappearance of bovine cysts was similar inboth regions, while hyaline cysts reached 2.4% and46.3% and fertile cysts 1.5% and 10.7% in Spainand Argentina, respectively.The low prevalence, fertility, viability and calcificationof cysts in cattle could be explained bythe sheep strain which is not well adapted (Schantzet al, 1995; Bardonnet et al, 2003). However, thehigh proportion of viable and fertile cysts with rateshigher than 90%, and which are primarily locatedin lungs in cattle, might indicate correspondance tothe bovine strain (Thompson and Mc Manus, 2002,Torgerson et al, 2003).The fertility of the larva of E. granulosus incattle was not associated with the organ in whichit is located, nor did it depends on the size of thecyst. Ponce Gordo and Cuesta Bandera (1998)confirmed the lack of relation between cyst size,location, viability and fertility. However, Scala etal, (2006) and Muñoz and Sievers (2005) showedfertile cysts mainly in lungs of sheep and cattle. Onthe other hand, Dueger and Gilman (2001) reported47 to 59% of cystic fertility in sheep and for everycentimeter increase of the size of the larvae, theprobability of protoscolices increased 7.5 timesand only 4% of degenerated cyst were associatedwith living protoscolices. Regarding the time ofdevelopment of protoscolices, research has shownthat it usually requires at least one year and due tothe slow growth of larvae in sheep only 50% reachfertility at six years (Gemmell and Roberts, 1995).Muñoz and Sievers (2005) demonstrated thathydatid cysts in cattle generate protoscolices whenthey reach a diameter of 15-20 mm, at 5-6 monthsafter eating the eggs, and in young categories allcysts under 10 mm were infertile.Viability of protoscolices: The viability of theprotoscolices (85%) is consistent with other studies(Dalimi et al, 2002; Muñoz and Sievers, 2005). Theproportion of animals with viable and fertile cystsis an indicator of the significance of the species asRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 65-7373

Z. HERNÁNDEZ et al.propitious intermediate host in the transmission ofthe disease.REFERENCES1. ANDRESIUK M, PONCE GORDO F, CUESTA BAN-DERA C, ELISSONDO M, DOPCHIZ M, ROSSIN M,DENEGRI G. 2005. Echinococcus granulosus: posiblesadaptaciones fenotípicas en relación con la importanciaepidemiológica del hospedador. XVII CongresoLatinoamericano de Parasitología, 23-26 de noviembre,Mar del Plata, Argentina, p 271.2. AZLAF R, DAKKAK A. 2006. Epidemiological studyof the cystic echinococcosis in Morocco. Vet Parasitol137: 83-93.3. BARDONNET K, BENCHIKH–ELFEGOUN MC,BART JM, HARRAGA S, HANNACHE N, HADDADS, DUMON H, VUITTON DA, PIARROUX R. 2003.Cystic echinococcosis in Algeria: cattle act as reservoirsof a sheep and may contribute to human contamination.Vet Parasitol 116: 35-44.4. BREIJO M, ANESETTI G, MARTÍNEZ L, SIM R,FERREIRA A. 2008. Echinococcus granulosus: Theestablishment of the metacestode is associated withcontrol of complement-mediated early inflammation.Exp Parasitol 118: 188-196.5. CABRERA P, HARAN G, BENAVIDES U, VALLE-DOR S, PERERA G, LLOYD S, GEMMELL M,BARAIBAR M, MORANA A MAISSONAVE J,CARBALLO M. 1995. Transmission dynamics ofEchinococcus granulosus, Taenia hydatigena and Taeniaovis in sheep in Uruguay. Int J Parasitol 25: 807-813.6. CABRERA P, IRABEDRA P, ORLANDO D, RISTA L,HARAN G, VIÑALS G, BLANCO M, ALVAREZ M,ELOLA S, MOROSOLI D, MORAÑA A, BONDADM, SAMBRÁN Y, HEINZEN T, CHANS L, PIÑEYROL, PEREZ D, PEREYRA I. 2003. National prevalenceof larval echinococcosis in sheep in slaughtering plantsOvis aries as an indicator in control programmes inUruguay. Acta Tróp 85: 281-285.7. CABRERA P, IRABEDRA P, ORLANDO D, DOSSANTOS C, CHAPPUIS E, ALVAREZ M, ELOLA S,BLANCO M, AGUIRRE J, ZAMORA C, MUTTESR, MORAÑA A, PEREYRA I, LAZANEO H. 2005.Estudio de la prevalencia nacional de Echinococcusgranulosus en bovinos en playa de faena. 12°International symposium of the world associationof veterinary laboratory diagnosticians. 16-19 denoviembre, Montevideo, Uruguay.8. CAPUANO F, RINALDI L, MAURELLI M, PERU-GINI A, VENEZIANO V, GARIPPA G, GENCHI C,MUSELLA V, CRINGOLI G. 2006. Cystic echinococcosisin water buffaloes: Epidemiological survey andmolecular evidence of ovine (G1) and buffalo (G3)strains. Vet Parasitol 137: 262-268.9. CHRISTODOULOPOULOS G, THEODOROPOU-LOS G, PETRAKOS G. 2008. Epidemiological surveyof cestode-larva disease in Greek sheep flocks. VetParasitol 153: 368-373.10. COMISIÓN ZOONOSIS. 2008. Diagnóstico desituación 2004. www.zoonosis.gub.uy11. DALIMI A, MONTAMEDI GH, HOSSEINI M,MOHAMMADIAN B, MALAKI H, GHAMARI Z,GHAFFARI FAR F. 2002. Echinococcosis/hydatidosisin western Iran. Vet Parasitol 105: 161-171.12. DIRECCIÓN NACIONAL DE METEOROLOGÍA.1996. Normales climatológicas. Período 1961-1990.Ed. Ministerio de Defensa Nacional. Montevideo, p 20.13. DUEGER E, GILMAN R. 2001. Prevalence, intensityand fertility of ovine cystic echinococcosis in thecentral Peruvian Andes. Trans Roy Soc Trop Med Hyg95: 379-383.14. DYCE K, SACK W, WENSING C. 1999. AnatomíaVeterinaria. Mc Graw Hill Interamericana Editores.México. 2° ed., 952p.15. FAO. 2007. Estimación del aspecto económico dela equinococosis quística en el cono sur (Argentina,Brasil, Chile y Uruguay). Organización de las NacionesUnidas para la Agricultura y la Alimentación. OficinaRegional para América Latina y el Caribe FAO/RLC.16. GEMMELL MA, LAWSON JR. 1986. Epidemiologyand control of hydatid disease. En: Thompson RCA(ed). The biology of Echinococcus and hydatid disease.George Allen and Unwin. London, U.K., Cap. 7, pp.189-216.17. GEMMELL M, ROBERTS M. 1995. Modelling Echinococcuslife cycles. En: Thompson RCA and LymberyAJ (eds). Echinococcus and hydatid disease. CAB International,Wallingford, UK, Cap 8, pp 333-354.18. M’ RAD S, FILISETTI D, OUDNI M, MEKKI M,BELGUITH M, NOURI A, SAYADI T, LAHMAR S,CANDOLFI E, AZAIEZ R, MEZHOUD H, BABBAH. 2005. Molecular evidence of ovine (G1) and camel(G6) strains of Echinococcus granulosus in Tunisiaand putative role of cattle in human contamination. VetParasitol 129: 267-272.19. MINISTERIO DE GANADERÍA, AGRICULTURA YPESCA. 2000. Censo General Agropecuario. GráficaDigital. Montevideo, vol 2, p 121.20. MORO P; SCHANTZ P. 2006. Cystic echinococcosisin the Americas. Parasitol Int 55: S181-S186.21. MUÑOZ J, SIEVERS G. 2005. Study of the fertilityand viability of bovine hidatid cysts in Chile. ParasitolLatinoamer 60: 69-73.22. NJOROGE EM, MBITHI PMF, GATHUMA JM, WA-CHIRA TM, GATHURA PB, MAGAMBO JK, ZEYH-LE E. 2002. A study of cystic echinococcosis in slaughteranimals in three selected areas of northern Turkana,Kenya. Vet Parasitol 104: 85-91.23. PONCE GORDO F, CUESTA BANDERA C. 1998.Observations on the Echinococcus granulosus horsestrain in Spain. Vet Parasitol 76: 65-70.24. SAKAMOTO T, CABRERA P. 2003. Immunohistochemicalobservations on cellular response in unilocularhydatid lesions and lymph nodes of cattle. Acta Tróp85: 271-279.25. SCALA A, GARIPPA G, VARCASIA A, TRANQUIL-LO V, GENCHI C. 2006. Cystic echinococcosis inslaughtered sheep in Sardinia (Italy). Vet Parasitol 135:33-38.26. SCHANTZ PM, CHAI J, CRAIG PS, ECKERT J,JENKINS DJ, MACPHERSON CNL, THAKUR A.74Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 65-73

CYSTIC ECHINOCOCCOSIS IN CATTLE IN URUGUAY1995. Epidemiology and control of hydatid disease. In:Echinococcus and hydatid disease. Ed. RCA Thompsonand AJ Lymbery. CAB International, Wallingford, UK,Cap. 7, pp. 233-331.27. TASSINARI DOS SANTOS H, FAGUNDES DOSSANTOS A, MOISINHO A, PEREIRA M, FIGUEIRE-DO M. 2008. Infecção experimental em ovinos comEchinococcus granulosus: viabilidade dos ovos, quantidadee localização dos cistos hidáticos. 35 CongressoBrasileiro de Medicina Veterinaria, 19-22 de octubre,Gramado, Brasil.28. THOMPSON RCA. 1995. Biology and systematics ofEchinococcus. In: Echinococcus and hydatid disease.Ed. Thompson RCA, Lymbery AJ, Wallingford, Oxon,UK, CAB International, Cap 1, pp. 1-50.29. THOMPSON R, MC MANUS D. 2002. Towards a taxonomicrevision of the genus Echinococcus. TRENDSin Parasitology 18: 452-457.30. TORGERSON P, BURTISURNOV K, SHAIKENOVB, RYSMUKHAMBETOVA A, ABDYBEKOVA A,USSENBAYEV A. 2003. Modelling the transmissiondynamics of Echinococcus granulosus in sheep andcattle in Kazakhstan. Vet Parasitol 114: 143- 153.Acknowledgements: We would like to thank the RegionalNorte Salto, Universidad de la República for their supportand for providing the facilities. We are very grateful to theTechnicians and staff at the "La Caballada" Slaughterhousefor facilitating the study and particularly to Prof. LuisLavarello for his support with the statistical analysis and theProf. Silvia Gallo and Dr. Elize van Lier for her assistancewith the translation.Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 65-7375

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-84Epidemiology and approach treatment of humancystic echinococcosis: case seriesDOPCHIZ M.C. 1,2 , ALBANI C. 1,2 , RIVA E. 2,3 , ELISSONDO M.C. 1,2 , LAVALLÉN C.M. 1,2 and DENEGRI G. 1,21Laboratorio de Zoonosis Parasitarias, Departamento de Biología, Facultad de Ciencias Exactas y Naturales,Universidad Nacional de Mar del Plata, Mar del Plata, Buenos Aires, Argentina.2Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Argentina.3Departamento de Sanidad Animal y Medicina Preventiva, Facultad de Ciencias Veterinarias, Universidad Nacionaldel Centro de la Provincia de Bs Aires, Tandil, Bs Aires, Argentina.ABSTRACTCystic echinococcosis (CE) is a zoonoses of worldwide distribution caused mainly by the metacestodeEchinococcus granulosus. In Argentina, its distribution reaches endemic levels. The aims of this study wereto investigate the trends in confirmed cases of human CE recorded in “Hospital Privado de Comunidad”(HPC) in Mar del Plata city during a period of 28 years (1974-2002) and to study demographic and clinicalcharacteristics of cases together with epidemiological factors associated with the disease. Clinical recordsof operated and/or diagnosed patients were reviewed with regard to this disease. One hundred and fifteencases (57.4% women; mean age 61.3 + 17.1 years) were included in this retrospective study, 80% of whichlived in urban areas. In 76.5% of the cases, ultrasonography was used to diagnose the disease. Hepaticlocation was the most frequently seen. Ninety point four per cent of the total diagnosed CE patients receivedany approach due to illness, 47.1% received surgical treatment and 19.2% pharmacological treatment. Themean length of hospital stay was 15 days. The average incidence for the period 1997-2001 was 3.6 and 1.3in HPC and Official Notification respectively. Our study showed that since the permanence of CE in theregion is mainly due to the natural transmission of the parasite in the absence of control and preventionmeasures, health authorities should implement the necessary strategies in the study area.Key words: Cystic echinococcosis, Echinococcus granulosus, Epidemiology, Treatment, Zoonoses.RESUMENLa echinococosis quística (EC) es una zoonosis de distribución mundial, causada principalmentepor el metacesto de Echinococcus granulosus. En Argentina, su distribución alcanza niveles endémicos.Received: 30 December 2010. Accepted 05 de Mayo 2011.Corresponing: Dra. Marcela Cecilia DopchizLaboratorio de Zoonosis Parasitarias, Departamento de Biología, Facultad de Ciencias Exactas yNaturales, Universidad Nacional de Mar del Plata. Funes 3350, 7600, Mar del Plata, Buenos Aires,Argentina. Tel 54 0223 475 2426 int450, Fax: 54 0223 475-3150.E-mail: mdopchiz@mdp.edu.arSponsorships: This work was supported by Fundación Roemmers and Universidad Nacional deMar del Plata (15/E353), Argentina.76

CYSTIC ECHINOCOCCOSIS: EPIDEMIOLOGY AND TREATMENTLos objetivos de este estudio fueron investigar las tendencias en los casos confirmados de EC humanosregistrados en el Hospital Privado de Comunidad (HPC) de la ciudad de Mar del Plata durante un períodode 28 años (1974-2002) y estudiar las características demográficas y clínicas de los casos, junto con losfactores epidemiológicos asociados a la enfermedad. Se revisaron todas las historias clínicas de pacientesoperados y/o diagnosticados. Ciento quince casos (57,4% mujeres, promedio de edad 61,3+17,1 años)fueron incluidos en este estudio retrospectivo, el 80% de los cuales vivía en zonas urbanas. En el 76,5%de los casos, se utilizó la ultrasonografía para diagnosticar la enfermedad. La localización hepática fuela más frecuente. Noventa punto cuatro por ciento del total de pacientes diagnosticados con EC recibióalgún tratamiento debido a la enfermedad, el 47,1% recibió tratamiento quirúrgico y 19,2% tratamientofarmacológico. La media de días de internación fue de 15 días. La incidencia promedio para el período1997-2001 fue de 3.6 y 1.3 en HPC y según Notificación Oficial respectivamente. Nuestro estudio mostróque la permanencia de la EC en la región se debe principalmente a la transmisión natural del parásitoen ausencia de medidas de control y prevención. Se recomienda que las autoridades de salud debieranimplementar las estrategias necesarias en el área de estudio.Palabras clave: Echinococcosis quística, Echinococcus granulosus, Zoonosis, Epidemiología, Tratamiento.INTRODUCTIONCystic echinococcosis (CE) is an infection ofhumans and herbivorous animals caused by thelarval stage of the parasite Echinococcus granulosus(Batsch 1786), which has worldwide importanceand a broad distribution (Thompson, 2002; Xiao etal, 2005; FAO, 2007). This parasite requires twomammalian hosts to complete its life cycle. Thehermaphroditic adult commonly develops in thedog’s or fox’s intestine, whereas the metacestodelarva (hydatid cyst containing protoscolecesproduced by asexual multiplication) develops inthe viscera of many ungulates and man. The CEhas spread to all continents and is an importantpublic health and economic problem in many areasthroughout the world, including the Pampas region.Three provinces of central Argentina are located inthis region: Buenos Aires, the south of Santa Fe andCórdoba (MSAL-OPS, 2009).The southeast of the Buenos Aires province hasimportant touristic centres which result attractiveto elderly people. The economic and geographicalstructure contributes to the high immigration. Theresult is that people from 60 years-old represent the60% of the population pyramid.This area also constitutes an excellent agriculturalregion with abundant extensive breeding ofbovine cattle and ovine livestock. Close contact betweenman, dog and livestock, home slaughteringfor human consumption and feeding dogs with offalare widespread habits that ensure the maintenanceof the parasite’s cycle in Buenos Aires rural areas.In urban areas the transmission is favored by poorsanitary conditions in some slaughter houses andillegal home slaughtering. Thus, climate and socioculturalfactors contribute to the endemic status ofCE in the southeast of Buenos Aires province. Inendemic regions the major part of infections is acquiredduring childhood but can occur at any age.Human infection has socio-economic consequencesrelated to costs of hospitalization and diagnosis,surgical fees, loss of working days, disability andmortality. Livestock infection reduces yield andquality of meat, milk and wool. The precise quantificationof losses caused by CE depends on theknowledge about the rates of infection in humanand animal populations (Batelli, 2001).The most commonly used index of humaninfection is the review of hospital records of CEcases. Although this method has limitations, dataof annual rates have proved to be of great value forproviding epidemiological information that can beuseful to show the disease evolution (Pierangeli etal, 2007).Brunetti and co-workers (2010) proposed a newCE classification which summarizes the previouslygiven by Gharbi et al, (1981) and WHO-IWGE(1996). The aim was to establish an expert consensusfor diagnosis and treatment of CE in humansRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-8477

M. C. DOPCHIZ et al.and facilitate the interpretation of epidemiologicaland clinical studies through the world. This classificationdivides the cyst type in 3 groups: undifferentiated:CL (cyst lesion), actives: CE1 and CE3which may be differentiated into CE3a (with detachedendocyst) and CE3b (predominantly solidwith daughter vesicles) and inactive CE4 and CE5.CE1 and CE3a are early stages and CE4 and CE5late stages (Brunetti et al, 2010).More than 2000 cases of human CE are reportedin South America every year (Eckert and Deplazes,2004). In Argentina, the CE is a notifiable diseaseand confirmed cases are reported weekly to theMinistry of Health of the Nation by completingthe official form (C2 Form). The global annualincidence of surgical/treatment cases of human CEin Argentina in 2004 was one per 100000 inhabitantsaccording to official reports (Echegoyen, 2004).However, national incidence rates of surgical casesdo not show an accurate picture since the wholepopulation is considered, including a large numberof people with low risk of infection (FAO, 2007).In Argentina, CE is widespread and some areasare considered endemic. In 2001, 355 cases werenotified using the C2 form, of which 46.5% camefrom Patagonian provinces, 38% from the centralprovinces (Buenos Aires, Córdoba, San Luis andMendoza) and 15.5% from the northern provincesof Argentina (MSAL, 2001). In Buenos Aires, 294new cases were reported between 1997 and 2001,with an annual incidence rate of 0.3/100000 in2000 and 4/100000 in 2001 (MSAL, 2001).Epidemiological studies of CE were carried outin the south east region of Buenos Aires showing aserious situation in health centres in Mar del Platacity due to the number of diagnosed cases between1992-1998 (Elissondo et al, 2002; 2003). Thereare case studies on pediatric CE and CE in adultpeople in two state hospitals covering the period1992-2002 (Dopchiz et al, 2007; 2009). However,there have not been cases of CE reported in privatehospitals of reference for over 10 years. The diseaseis also endemic in the region for cattle and pigs.Prevalence according to post-mortem inspectionin abattoirs ranged between 12% to 16% for cattleand pig respectively. E. granulosus antigens werealso detected in dog’s feces, in fields and squaresfrom General Pueyrredón district (Dopchiz, 2006;Dopchiz et al., 2002).Although there have been cases of CE, there arecurrently no provincial control programmes.In order to gain a better knowledge about theepidemiology of hydatidosis in the southeast ofBuenos Aires province, the purposes of this studywere to investigate the trends in confirmed casesof human CE recorded in“Hospital Privado deComunidad” (HPC) in Mar del Plata city duringa period of 28 years (1974-2002) and to studydemographic and clinical characteristics of casestogether with epidemiological factors associatedwith the disease.MATERIAL AND METHODSStudy area and population The study areawas in Mar del Plata and its surrounding, a majortourist sea town located in General Pueyrredón,on the southeast coast of Buenos Aires province,Argentina (38° S; 57°33´W) (Figure 1).The study was carried out in HPC, a 240-bedacute hospital which serves more than 20% of thepopulation from the study area, 61% of whom areolder than 60 years. The hospital currently offersservices in the three levels of care that correspondto a general acute hospital, a service of preventiveFigure 1. Geographic procedence of the examined cases.78Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-84

CYSTIC ECHINOCOCCOSIS: EPIDEMIOLOGY AND TREATMENTmedicine and a special program for the elderly.During summer, the hospital also serves retiredpeople in transit and those affiliated to other medicalinstitutions that have pre-paid contracts with theHospital Foundation. HPC is also a referencecentre for patients from several areas counties thatcompound the Sanitary Region VIII.The total population considered for this studyconsisted in 20% of the population of the regionestimated in 2002 to be 207764 inhabitants, ofwhich 99727 were males and 108037 females(INDEC, 2001).Study design and data collection: A retrospective,observational and analytical study of casesseries was carried out in HPC. Data was obtainedfrom secondary information source. The inclusioncriterion was to consider all the medical records ofpatients of HPC with CE confirmed between 1974and 2002. A data file was completed for each patient,containing personal information: age and occupationat hospitalary admission, sex, domicile,origin (rural/urban), diagnostic methods, number,characteristics and location of cysts as well as typeof treatment received. When was possible the cyststype was classified according to proposed fromBrunetti et al, (2010). All records were provided forthe statistics service with permission of Teachingand Investigation Department.Data analysis: The mean annual incidence(MAI) of CE in HPC was calculated using datafrom the National Population and HouseholdCensus, 2001 (INDEC, 2001). Official notification(ON) records were used to compare the MAI of CEbetween 1998 and 2002 with the MAI of CE in HPCduring the same period (INE, 2002). For analyticalpurposes, the population was divided by age groupsof 10 years each and in some cases the study periodwas restricted to a span of five years: 1997–2001.Epi Info 2000 (Centers for Disease Control,Atlanta, USA) was used for single variate analysis.Differences between groups were compared bythe Chi-square (χ 2 ) test or the Kruskal Wallis testin case of non parametric distribution and it wasconsidered statistically significant when p < 0.05.Linear regression studies were undertaken using theR statistical software (R Development Core Team,2007). Differences in cyst location frequencies andage media were analyzed by Student’s t test. Fromanalysis of media comparison between two groupsthe F statistic was obtained.RESULTSIn this retrospective, observational and analyticalstudy of cases series, a total of 115 patient recordswith confirmed CE in HPC were identifiedand examined over the 28 year period (1974-2002).The average incidence for the period was 1,98 per100000 inhabitants when the total population wasconsidered.Distribution of cases by sex, occupation, ageand place of residence: Women represented 57.4%of cases although did not show any statisticallysignificant difference by sex (c 2 = 2.44; p = 0.12).According to reading of the records at time of thestudy, the most prevalent occupations were: retired(23.5%), homemaker (20.9%), rural worker(5.2%), student (3.5%), several occupations, like:truck driver, trader, employed, gastronomic worker,freelancer, metalworker, hairdresser, plumber(24.3%).Age and sex distribution and the male/femaleratio by age groups are shown in Figure 2. Theage of the cases ranged from 9 to 86 years, witha mean age of 61.3 ± 17.1 years and a median of65 years. Age groups 60-69 and 70–79 were themost frequents and represented 28% and 29%respectively of the total number of cases. Agegroups between 60 and 89 showed the highest MAI.The male/female ratio among total cases was0.74, while the gender ratio in the population was0.93 showing no gender significative differences(χ 2 = 1.39, p>0.05).Distribution of the cases by place of residenceindicated that 80% of the patients lived in an urbanFigure 2. Distribution of the 115 CE cases by humanCE cases by age, sex and mean annual incidence (MAI).*was calculated considering 20% of Sanitary RegionVIII population using data from the National Populationand Household Census, 2001 (INDEC, 2001).Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-8479

M. C. DOPCHIZ et al.Table 1. Distribution of the 115 cases of CE by cystlocation diagnosed in HPC during 1974-2002Location Frequency %Liver 90 78.3Lung 8 7.0Liver - othera 6 5.2Bone 4 3.5Epigastric 1 0.9Gallbladder 1 0.9Hypochondric 1 0.9Lung - liver 1 0.9Liver - kidney 1 0.9Peritoneum 1 0.9Soft tisúes 1 0.9Total 115 100aothers: hypochondric, groin, pelvis, pleura, gallbladder.area, 18% in a rural area and 2% on the outskirts ofurban areas.Cyst location, diagnostic techniques and treatmentchose: To diagnose the disease, ultrasonographyalone or combined with other diagnostictechniques was the chosen method in 76.5% of thepatients. In 34.8% of the cases, a combination ofaxial computed tomography and ultrasonographywas used. The use of X-ray alone or combined withother diagnostic techniques was the chosen methodin 13.1% of the patients. The immunological techniquesof Arco5 or latex were used with others imagenologictechnics in 21.7% of the patients. Othersdiagnostic methods used in lower proportion werenuclear magnetic resonance, fluoroscopy and cholecystography.As regards cyst location, the average ratioliver-lung infection was 11:1. Eighty eight (76.5%)patients presented only 1 cyst, 16 (13.9%) patients2 cysts, 8 (7%) patients 3 cysts and 3 (2.67%)patients multiple cysts (Table 1).Ninety point four per cent of the total diagnosedCE patients received any approach due to illness,47.1% received surgical treatment and 19.2% pharmacologicaltreatment. All patients who receiveddrug therapy underwent surgery except one withCE4 type cyst who received albendazole for threecycles of thirty days. Table 2 summarizes the typeof treatment received. In 77.4% of diagnosed patients,it was possible to obtain information aboutthe cyst type. Within this group, 100% of the patientswith cyst type CE1 and CE3b were operatedand 33.4% and 52.6% received drug treatment respectively.To the type CE4 20% (2/10) of the casesreceived surgical and drug treatment. Interestingly70% and 88.7% of the cases with cyst type CE4 andCE5 respectively received the watch and wait approach.In relation to patients with cysts type CE5,11.3% were operated and none received drug treatment.Nine point six per cent of the total diagnosedCE patients not received treatment due to illness.The cysts of one of those patients were typified.The approach received for the CE patientstreated was analyzed considering the most frequentlocalizations (liver and lung). Eighty seven pointseven per cent (79/90) and 100% (8/8) patients withliver and lung localization respectively were treatedfor CE. For liver localization, in 86% of the caseswas possible to obtain information about the cysttype. Within this group, 100% of the patients withTable 2. Distribution of the diagnosed and treated cases of CEaccording cysts type and the approach carried out in HPC during 1974-2002Approach Cyst type a TotalCE1 CE3b CE4 CE5 N/CSurgical6 19 2 6 16 49TreatmentWatch and- - 7 47 - 54waitNº Cases 6 19 10 53 16 104a patients with at least one cyst type based on Brunetti et al., 2010.N/C non classified80Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-84

CYSTIC ECHINOCOCCOSIS: EPIDEMIOLOGY AND TREATMENTcyst type CE1 and CE3b were operated and 100%and 38.5% received drug treatment respectively.To the type CE4 20% (2/10) of the cases receivedsurgical and drug treatment. Interestingly 62.5%and 86.9% of the cases with cyst type CE4 and CE5received the watch and wait approach. In relation topatients with cysts type CE5 in liver localization,13% were operated and none received drugtreatment. In reference to eight patients with lunglocalization, in seven of them (87.5%) was possibleto obtain information about the cyst type. Withinthis group, all of the patients with cyst type CE1and CE3b were operated and one and two receiveddrug treatment respectively.Analysis of age-group distribution of treatedpatients by cyst type classification showed statisticallysignificative differences (X (3) Kruskal-Wallis=23.4, p < 0.00001). When the age-group were analyzedseparately we found only statically significativedifferences between cyst type CE4 and CE5 (F= 4.37, p < 0,05) and also when we analyzed CE1+ CE3b and CE4 + CE5 differences (X (1) Kruskal-Wallis =17.5, p < 0.00001) (Figure 3).The mean number of operations per patient was1.7, with a range from 1 to 8 making a total of 82surgeries, and one non operated patient receivedpharmacological treatment with albendazole.Forty nine per cent of the treated patients wereadmitted into the hospital and stayed for differentperiods, ranging from four to 50 days with a meanof 15 days (25th percentile = 8; 75th percentile =20). From a total of 115 patients, 13.9% died ofother diseases like cancer, general deterioration,cardio-respiratory arrest, acute bronchitis. In fourcases, cause of death was not filed in the medicalrecords.Figure 3. Boxsplot by age of CE treated cases accordingto the cyst type classification in HPC. The ends of thebox represent the first and third quartile, - - - -: range, º:extreme value, ______ :Age mean a patients with at leastone cyst classified according to Brunetti et al, 2010.Figure 4. Annual incidence of human CE registered and annual incidence according to on in the study region.Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-8481

M. C. DOPCHIZ et al.Temporal distribution of HPC and ON cases:MAI of CE in HPC and from the ON during theperiod covered by this study was shown in Figure4. MAI in HPC ranged between zero to 5.3, whenvariations of MAI were analyzed within 5 yearsperiod, a significant increase was determinedbetween 1974 and 2002 (c 2 = 4.3 p < 0.01). Theanalysis showed a positive correlation in the MAIthrough the time (Pearson* = 0.0671, p < 0.0001CI 95%).The average incidence for the period 1997–2001was 3.6 and 1.3 in HPC and ON respectively. HPCincidence was significantly different comparedwith the ON (c 2 = 6.86 p < 0.01).DISCUSSIONThe present study is a retrospective, observationaland analytical study of cases series of humanCE epidemiological data carried out in the HPCof Mar del Plata city and surrounding areas, in theBuenos Aires province.The HPC is an important hospital in this areawhich attends 20% of Mar del Plata´s populationand also is an important reference centre for patientsfrom several surrounding areas.The average annual incidence of CE for the1974-2002 period was 1.98 per 100000 inhabitantsin the HPC. This rate could be under-estimated andthe number of cases could be higher as it only reflectssymptomatic cases that reach medical attention orsurgery and represents a small proportion of theactual number of cases. This situation could be dueto CE is a chronic disease and frequently generatesasymptomatic cases that can represent up to 60% ofthe total number of cases (Pawlowski et al, 2001;Frider and LarriAge-group distribution showed thatthe etiological agent was present in all age groups.The finding of a low frequency in children in HPCdoes not reflect the situation because for the period1993-2002 were reported 44 cases of pediatric CE(Dopchiz et al, 2009). The most diagnosticated agegroup was 60-89 years-old since it evidenced thehighest frequencies and MAI. This could be due tothe slow course of development for the CE and alsocoincides with the age pyramid of the populationin the studies area, which is constituted for a highpercentage of adult people (INDEC, 2001).In the case of human CE, the high frequencyof exposure at an early age could be explainedby behavioral characteristics (close child-dogrelationship). The potential of parasitism as abiological phenomenon is related primarily toecological barriers and then to phylogenetic and/or physiological constraints (Wisnivesky, 2003;Denegri, 2008).Although the distribution of cases by sexshowed no statistically significant differences,women cases had more frequency. This agrees withElissondo et al, (2002; 2003) and Dopchiz et al,(2007), who studied this illness in health centres inthe same region. These results also are consistentwith reports from Palestine, Iraq, Jordan, UnitedKingdom, China, Middle East and North Africa(Dowling and Torgerson, 2000; Saeed et al, 2000;Abu-Hasan et al, 2002; Al Qaoud et al, 2003; Yanget al, 2006). However, this finding contrasts withrecent reports from pediatric study in the sameregion (Dopchiz et al, 2009) and in Kyrgystanwhere CE is an emerging disease and the numberof surgical cases in adult men is higher than inwomen (Torgerson et al, 2003). In the presentstudy, we observed that within the female group,most of the cases occurred in women who didhousehold chores; while within the male group,retired workers presented most of the cases. Morethan a matter of gender, CE infection is closelyrelated to people with high risk factors such ascontaminated soil or contact with infected dogswith parasite eggs. Nonetheless, the transmissionof this illness through water and inadequatewashing of raw vegetables cannot be ruled out,since zoonotic parasites have been reported tobe present in vegetables for human consumption(Slifko et al, 2000, Martínez Fernández, 2002). CEis generally considered a rural disease because ofthe characteristics of its transmission cycle, whichinvolves dogs and domestic herbivorous animals(cattle, sheep, pigs and so on) (McManus et al,2003). This study reported that the occupationsof 21% of the study patients were unknown dueto the fact that in many cases the anamnesis wasincomplete. To find association between occupationand the adquisition time of the disease must beavailable the information of the occupation at thetime of first diagnosis and in this study are notgiven in the records.With respect to the distribution of the patientsaccording to their place of residence, it was ob-82Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-84

CYSTIC ECHINOCOCCOSIS: EPIDEMIOLOGY AND TREATMENTserved that the majority of them lived in urbanareas. It is possible that urban residents may havebeen in contact with E. granulosus eggs in the city.Dopchiz (2006) and Dopchiz et al, (2002) reportedthe presence of antigens of E. granulosus in soilsamples from squares and dogs feces in Mar delPlata city. We cannot ruled out the possibility thatthe disease was diagnosed in people who have acquiredit previously while they lived in other regions,and later settled down in this city.Ultrasound alone or in combination with othertechniques (such as axial computed tomography,immunological techniques etc.) is the method mostfrequently used to diagnose the disease. Ultrasoundis widely known because of its low cost, speed inobtaining results and high sensitivity and specificity(Eckert and Deplazes, 2004; Frider and Larrieu,2010). In this study, serological techniques havebeen little used.The cysts had more frequently a hepatic locationfollowed by pulmonary and hepatic-other locations(Table 1), in agreement with other studies inArgentina (Elissondo et al, 2002; 2003; Pierangeliet al, 2007; Dopchiz et al, 2007; 2009) and othercountries throughout the world as Palestine, Australia,Chile, Iraq, Jordan, China and Kyrgystan(Jenkins and Power, 1996; Aliaga and Oberg, 2000;Saeed et al, 2000; Abu-Hasan et al, 2002; Al-Qaoudet al, 2003; Torgerson et al, 2003; Yang et al,2006). In reference to the liver/lung ratio found inthis study, it is one of the highest values reportedby Larrieu and Frider (2001) in a bibliographicalreview considering 9770 hydatidosis patients fromUruguay, Argentina, Tanzania, New Zealand, Israel,Jordan, Australia, Bulgaria, Turkey and Iran.They informed a general ratio of 2.5:1, which includedvalues ranging from 0.89:1 to 12:1. In manycases, the resistance shown by the liver tissue surroundingthe cyst determines a slow growth or evenavoids the growth for many years. Therefore, thisexplains the high percentage of hepatic cysts thatremain asymptomatic while supporting a balanceparasite/host during the hosts’ life (Frider 2002;Frider and Larrieu, 2010). The lungs show lowresistanceto the growth of the hydatid cyst due totheir elasticity. This situation allows a proportionalincrease of the cyst size, and its consequence is themanifestation of clinical symptomatology in a greatpercentage of the total cases (Salviti et al, 2002).Studies of longitudinal follow up by ultrasonographyin patients with asymptomatic hydatid cysts,have demonstrated that in a period of 14 years, 67%of the carriers persisted without developing symptoms(Frider et al, 1999).To date there is no better approach of treatmentfor CE. Treatment indications are complex and arebased on cyst characteristics, available medical/surgical expertise and equipment, and adherence ofpatients to long-term monitoring.In this study the CE diagnosed cases were dividedin treated and untreated for the disease. Surgerywas the chosen method in 47% of the treatedpatients while pre and post-surgical chemotherapytreatment was relatively limited in the health centre.It is important to note that in the years of thisstudy drug use was relatively new and very limited.In addition, the availability of albendazole was verylimited in Argentina. The application of disease approachwas significant in relation to the cyst typeand localization. In general most of the patientswith cyst type CE1 and CE3b received any surgicalor drug treatment and with cyst type CE4 andCE5 underwent the watch and wait approach. Thissituation coincides with the stage specific treatmentsuggested by Brunetti et al. (2010).As regards to the treatment strategy the worldwideexperts propose that although surgery must becarefully evaluated in relation with other options, itis the first choice for complicated cyst. In the liver,it is indicated for: (1) removal of large CE2-CE3bcysts with multiple daughter vesicles; (2) single livercysts situated superficially, that may be brokenspontaneously or as a result of trauma when protoscolicesare not available; (3) infected cysts, whenprotoscolices are not available; (4) cysts communicatingwith the biliary tree and (5) cysts exertingpressure on adjacent vital organs. With regard tothe drug treatment benzimidazole (BMZ) are indicatedfor inoperable patients with liver or lung CE;patients with multiple cysts in two or more organs,or peritoneal cysts. Small (< 5 cm) CE1 and CE3acysts in the liver and lung respond favorably toBMZ alone (Vutova et al, 1999; Dogru et al, 2005).However not all the cases need surgical or drugtreatment. It has seen that when inactive cysts arenot complicated, mostly CE4 and CE5 cyst type,the best option is a long-term follow-up of patientswith US imaging (Frider and Larrieu, 2010).If we take into account the length of hospitalstay, the total number of operations and the numberRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-8483

M. C. DOPCHIZ et al.of operations per patient, we can observe the highcost of this disease for the institution and the importantsocial impact (Larrieu et al, 2004; FAO 2007).The annual incidence values for the entireregion had a positive correlation through thestudy period. More over the incidence value wassignificantly higher in 2002 when it was comparedwith 1974 year. At a certain period of time, theincidence values can increase or decrease and theymight be used as indicators of the efficiency ofcontrol programmes. This fact is shown by manyauthors in the worldwide literature. For the lastdecade variable annual incidences were describedin the Patagonic provinces of Argentina like Tierradel Fuego, Chubut, Neuquen, and Rio Negro. Allof them, are provinces under control programs andthese incidence values are decreasing (Larrieu etal, 2000; Eckert et al, 2001; Pierangeli et al, 2007;Zanini et al, 2009). The above mentioned indicatesthe progress achieved in control programs that weredesigned for and are being implemented in theseregions. However, despite the existence of controlprograms, CE remains an important public healthproblem in several countries of South America.In Chile MAI is stable since 1992 (between 2 and2.5/100000) although values up to 38.5/100000were reported in the IX Region of Araucania,bounding with Neuquén, in the 1991-1998 period(Aliaga and Oberg, 2000). In Uruguay annualincidence was 6.5/100000 in 1997; in Perú (1992)1.1 and in Rio Grande do Sul, Brazil (1991) 0.54(Eckert et al, 2001).It is important to note that although CE is a diseaseof obligatory notification in Argentina, not allcases are reported, as we showed in Figure 4 wherethe MAI was compare between the HPC and theON. Whereas data from public hospitals are systematicallyrecorded in Mar del Plata, private hospitalsfail in notification to the sanitary authorities.Thus deficiencies in official records should also betaken into account. Despite the above mentionedlimitations, data of annual incidence remain a usefultool to evaluate the regional epidemiologicalsituation of the disease (Jenkins and Power, 1996).The fact that in this study incidence rates hadan increased growth show that CE is transmittednaturally in the absence of control and preventionmeasures. This conclusion is supported by previouslypublished results for the study area wherewere shown new pediatric cases, high prevalencerate in cattle and presence of eggs parasites (Dopchiz,2006, Dopchiz et al, 2009).In order to have a real view of the situation of thiszoonoses and if there is actual disease transmission,more epidemiological studies must be conducted toknow the characteristics of the local transmissioncycle in the bovine cattle, in other intermediatehosts as well as in the definitive host, and to knowbetter the cultural behaviours of the communities.REFERENCES1. ABU-HASAN N, DARAGMEH M, ADWAN K, AL-QOUAD K, ABDEL-HAFEZ SK. 2002. Human cysticechinococcosis in the West Bank of Palestine: surgicalincidence and seroepidemiological study. Parasitol Res88: 107-112.2. AL-QAOUD KM, CRAIG PS, ABDEL-HAFEZSK. 2003. Retrospective surgical incidence and casedistribution of cystic echinococcosis in Jordan between1994 and 2000. Acta Trop 87: 207-214.3. ALIAGA F, OBERG C. 2000. Epidemiología de lahidatidosis humana en la IX Región de la Araucanía,Chile. 1991-1998. Bol Chile Parasitol 55: 54-58.4. BATTELLI G. 2001. Socio-economic impact of theEchinococcus granulosus infection. In: WHO/OIEManual on echinococcosis in humans and animals(Eckert, J.; Gemmell, M.A.; Meslin, F.X. andPawlowski, Z., Eds). Geneva, Paris. 225-229.5. BRUNETTI E, KERN P, VUITTON DA. 2010.Writing Panel for the WHO-IWGE. Expert consensusfor the diagnosis and treatment of cystic and alveolarechinococcosis in humans. Act Trop 114: 1-16.6. DENEGRI G. 2008. Fundamentación epistemológicade la parasitología. Epistemologic Foundation of Parasitology)(Bilingual Edition). Editorial de la UniversidadNacional de Mar del Plata (EUDEM)-EditorialMartin, Mar del Plata, Argentina, 208 pp.7. DOGRU D, KIPER N, OZCELIK U, YALCIN E, GOC-MEN A. 2005. Medical treatment of pulmonary hydatiddisease: for which child? Parasitol Int 54: 135-138.8. DOPCHIZ MC. 2006. Aspectos epidemiológicos de lahidatidosis/echinococcosis en el sudeste de la provinciade Buenos Aires. Mar del Plata, Buenos Aires, Argentina,PhD Thesis, Universidad Nacional de Mar del Plata,Martín press, Mar del Plata, Argentina, 201 pp.9. DOPCHIZ MC, ELISSONDO MC, ANDRESIUKMV, MAIORINI E, GUTIERREZ A, MUZULIN P,ROSENZVIT M, LAVALLÉN CM, DENEGRI G.2009. Study of hydatidosis pediatric cases in the Southeastregion of the Buenos Aires province, Argentina.Rev Argent Microbiol 41: 105-111.10. DOPCHIZ MC, ELISSONDO MC, DENEGRI G. 2002.Consideraciones epidemiológicas de la hidatidosisechinococcosisen el sudeste de la provincia de BuenosAires. In: Situación de la hidatidosis-echinococcosis enla República Argentina (Denegri, G.; Elissondo, M.C.and Dopchiz M.C., Eds). Martin, Mar del Plata. 65-75.84Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-84

CYSTIC ECHINOCOCCOSIS: EPIDEMIOLOGY AND TREATMENT11. DOPCHIZ MC, ELISSONDO MC, ROSSIN MA,DENEGRI G. 2007. Hydatidosis cases in one of Mardel Plata City Hospitals, Buenos Aires, Argentina. RevSoc Bras Med Trop 40(6): 635-639.12. DOWLING PM, TORGERSON PR. 2000. A crosssectional survey to determine the risk factors associatedwith human cystic echinococcosis in an endemic areaof mid-Wales. Ann Trop Med Parasitol 94: 241-245.13. ECHEGOYEN MC. 2004. Situación de los Países. Argentina.In: Informe del Proyecto Subregional ConoSur de Control y Vigilancia de la hidatidosis. Argentina,Brasil, Chile y Uruguay (Pan American Health Organization,Eds), Montevideo, Uruguay, PHAO. 28-30.14. ECKERT J, DEPLAZES P. 2004. Biological, epidemiological,and clinical aspects of echinococcosis, azoonosis of increasing concern. Clin Microbiol Rev 17:107-135.15. ECKERT J, SCHANTZ PM, GASSER RB, TOR-GERSON PR, BESSONOV AS, MOVSESSIAN SO,THAKUR A, GRIMM F, NIKOGOSSIAN MA. 2001.Geographic distribution and prevalence. In: WHO/OIE Manual on echinococcosis in humans and animals(Eckert, J.; Gemmell, M.A.; Meslin, F.X. and Pawlowski,Z., Eds). Geneva, Paris. 101-143.16. ELISSONDO MC, DOPCHIZ MC, DENEGRI G.2002. Human hydatidosis in Mar del Plata, BuenosAires province, Argentina, (1992-1995): A preliminarystudy. Parasitol Latinoam 57: 124-128.17. ELISSONDO MC, DOPCHIZ MC, DENEGRI G.2003. Retrospective study of human hydatid diseasein health centers of Mar del Plata city, Buenos Airesprovince, Argentina, (1996-1998). Rev Iber Parasitol63: 17-22.18. FAO, Proyecto Cono Sur de Vigilancia y Control deHidatidosis: Argentina, Brasil, Chile y Uruguay. 2007.Estimación del impacto económico de la Equinococosisquística en el Cono Sur (Argentina, Brasil, Chile yUruguay). [Cited 2007 Jul 15] Available from: http://www.paho.org/spanish/ad/dpc/vp/hidatidosis-impactoecon-07-fao.pdf19. FRIDER B. 2002. Aporte de la ultrasonografía alconocimiento de la hidatidosis. In: Situación de lahidatidosis-echinococcosis en la República Argentina(Denegri, G.; Elissondo, M.C. and Dopchiz, M.C.,Eds). Martin, Mar del Plata. 79-106.20. FRIDER B, LARRIEU E. 2010. Treatment of liverhydatidosis: How to treat an asymptomatic carrier?World J Gastroenterol 16: 4123-4129.21. FRIDER B, LARRIEU E, ODRIOZOLA M. 1999.Long-term outcome of asymptomatic liver hydatidosis.J Hepatol 30: 228-231.22. GHARBI HA, HASSINE W, BRAUNER MW, DU-PUCH K. 1981. Ultrasound examination of the hydaticliver. Radiology 139: 459-463.23. INDEC (Instituto Nacional de Estadísticas y Censosde la República Argentina). 2001. Censo Nacionalde Población, Hogares y Viviendas. [Cited 2002 Sept12] Available from: http://www.indec.gov.ar/censo2001s2_2/ampliada_index.asp?mode=0724. INE (Instituto Nacional de Epidemiología). 2002.Notificación Epidemiológica Región Sanitaria VIIIINE 1998-2002. Ministerio de Salud de la Nación,Argentina 43 pp.25. JENKINS DJ, POWER K. 1996. Human hydatidosis inNew South Wales and the Australian Capital Territory,1987-1992. Med J Aust 164: 18-21.26. LARRIEU E, BELLOTO A, ARÁMBULO III P,TAMAYO H. 2004. Echinococcosis quística: Epidemiologíay control en América del Sur. Parasitol Latinoam59: 82-89.27. LARRIEU EJ, COSTA MT, CANTONI G, LABANCHIJL, BIGATTI R, PÉREZ A, ARAYA D, MANCINI S,HERRERO E, TALMON G, ROMERO S, THACURA. 2000. Control program of hydatid disease in theprovince of Río Negro Argentina. 1980-1997. Bol ChilParasitol 55: 49-53.28. LARRIEU EJ, FRIDER B. 2001. Human cysticechinococcosis: contributions to the natural history ofthe disease. Ann Trop Med Parasitol 95: 679-687.29. MARTÍNEZ FERNÁNDEZ AR. Agua y transmisiónalimentaria. In: Monografía XI: La Salud, prioridaden el VI Programa de Medio Ambiente de la UniónEuropea (Villanua Fungairiño, L., Ed). Madrid, RealAcademia Nacional de Farmacia press; 2002 [cited2006 Jul 22]. Available from: http://www.ranf.com/publi/mono/011/011htm, 45 pp.30. MCMANUS DP, ZHANG WLIJ, BARTLEY PB.2003. Echinococcosis. J Lancet 362: 1295-1304.31. MSAL (Ministerio de Salud de la Nación) 2001.Boletín Epidemiológico Nacional. 2000-2001. [Cited2002 May 5] Available from: http://www.msal.gov.ar/htm/site/estadísticas.asp.32. MSAL-OPS (Ministerio de Salud de la Nación –Oraganización Panamericana de la Salud). 2009.Norma técnica y manual de procedimientos para elcontrol de la hidatidosis en la República Argentina.MSAL-OPS press. 50 pp.33. PAWLOWSKI ZS, ECKERT DA, VUITTON DA, AM-MANN RW, KERN P, CRAIG PS, DAR KF, DE ROSAF, FILICE C, GOTTSTEIN B, GRIMM F, MACPHER-SON CNL, SATO N, TODOROV T, UCHINO J, VONSINNER W, WEN H. 2001. Echinococcosis in humans:clinical aspects, diagnosis and treatment. In: WHO/OIE Manual on echinococcosis in humans and animals(Eckert, J.; Gemmell, M.A.; Meslin, F.X. and Pawlowski,Z., Eds). Geneva, Paris. 20-66.34. PIERANGELI NB, SORIANO SV, ROCCIA I, GI-MÉNEZ J, LAZZARINI LE, GRENÓVERO MS,MENESTRINA C, BASUALDO JA. 2007. Heterogeneousdistribution of human cystic echinococcosis aftera long-term control program in Neuquén, PatagoniaArgentina. Parasitol Int 56: 149-155.35. R Development Core Team 2007. R: A language andenvironment for statistical computing. R Foundationfor Statistical Computing, Vienna, Austria, [Cited 2007Jun 7] Available from: http://www.R-project.org.36. SAEED I, KAPEL C, SAIDA LA, WILLINGHAML, NANSEN P. 2000. Epidemiology of Echinococcusgranulosus in Arbil province, Northern Iraq, 1990-1998. J Helminthol 74: 83-88.37. SALVITTI JC, MERCAPIDE CH, SUSTERSIC J,DEL CARPIO M, ODRIOZOLA M, PEREYRA R,PÉREZ A 2002. Tratamiento de la hidatidosis humana.In: Situación de la hidatidosis-echinococcosis en laRepública Argentina (Denegri, G.; Elissondo, M.C. andDopchiz, M.C., Eds). Martin, Mar del Plata. 205-214.Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-8485

M. C. DOPCHIZ et al.38. SLIFKO TR, SMITH HV, ROSE JB. 2000. Emergingparasite zoonoses associated with water and food. Int JParasitol 30: 1379-1393.39. THOMPSON RCA. 2002. Rediscovering parasitesusing molecular tools-towards revising de taxonomyof Echinococcus, Giardia and Criptosporidium. Int JParasitol 32: 493-496.40. TORGERSON PR, KARAEVA RR, CORKERI N, AB-DYJAPAROV TA, KUTTUBAEV OT, SHAIKENOVBS. 2003. Human cystic echinococcosis in Kyrgystan:an epidemiological study. Acta Trop 85: 51-61.41. VUTOVA K, MECHKOV G, VACHKOV P, PETKOVR, GEORGIEV P, HANDJIEV S, IVANOV A, TODO-ROV T. 1999. Effect of mebendazole on human cysticechinococcosis: the role of dosage and treatment duration.Ann Trop Med Parasitol 93: 357-365.42. WHO-Informal Working Group on Echinococcosis.1996. Guidelines for treatment of cystic and alveolarechinococcosis in humans. Bull. WHO 74, 231-242.43. WISNIVESKY C. 2003. Ecología y epidemiologíade las infecciones parasitarias, Libro UniversitarioRegional, Cartago 398 pp.44. XIAO N, QIU J, NAKAO M, LI T, YANG W, CHENX, SCHANTZ PM, CRAIG PS, ITO A. 2005. Echinococcusshiquicus n. sp., a taeniid cestode from Tibetanfox and plateau pika in China. Int J Parasitol 35: 69345.YANG YR, CHENG L, YANG SK, PAN X, SUN T,LI X, HU S, ZHAO R, CRAIG PS, VUITTON DA,MCMANUS DP. 2006. A hospital-based retrospectivesurvey of human cystic and alveolar echinococcosis inNingxia Hui Autonomous Region, PR China. Acta Trop97: 284-291.46. ZANINI F, SUÁREZ C, PÉREZ H, ELISSONDO MC.2009. Epidemiological surveillance of cystic echinococcosisin rural population of Tierra del Fuego, Argentina,1997-2006. Parasitol Int 58: 69-71.Acknowledgments: The authors express there gratitude toDr. Maxit from the “Hospital Privado de Comunidad”. Wealso thank Lic. Natalia Fredes and Dr. Nahuel Farias fortheir contribution in statistics and Prof. Liliana Bordoni andDr. Edmundo Larrieu for revising critical this manuscript.This study formed part of the doctoral thesis of Dr. MarcelaDopchiz.86Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 74-84

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 85-92Hipocromia y diagnóstico de talla en niños yadolescentes con parasitosis intestinales delMunicipio Guacara. Estado Carabobo. VenezuelaACUÑA I. 1 y MORÓN DE SALIM A. 21Médico Pediatra, Magíster en Nutrición, Profesor del Departamento de Morfología, Escuela de CienciasBiomédicas y Tecnológicas. Facultad de Ciencias de la Salud. Universidad de Carabobo. Investigador Asociado delINVESNUT. Sede Valencia.2Bióloga, Magíster en Bioquímica Nutricional y Metabolismo. Profesor Titular. Departamento de Bioquimica.Escuela de Ciencias Biomédicas y Tecnológicas. Facultad de Ciencias de la Salud. Universidad de Carabobo.Investigador Asociado del INVESNUT. Sede Valencia.ABSTRACTHIPOCROMIA AND STATURE IN CHILDREN AND ADOLESCENTS INFECTED BYINTESTINAL PARASITISM IM GUACARA COUNTY ; STATE OF CARABOBO, VENEZUELAIt was determine the presence or no of hypochromia and diagnosis of stature in children and adolescentsfrom Guacara Municipality, State Carabobo, Venezuela, and the relationship with types and combinationsof parasites. In 395 children, infant, preschool, school and teen, attending at three rural hospitals wereevaluated, without disease apparent, aged between 1 and 18 years. Haematological, parasitological andsocio-economic were done. Haematological by automated counter, Beckman Coulter, model Ac.T 5diff;copro-parasitological a stool from children, by direct method and Kato-Katz; socioeconomic Graffaraccording Méndez Castellano. Was found: median age 6.64 ± 1.78; 51.4% male, 48.6% female; etariogroup predominance pre-school 30.9% and 25.6% teenagers; socio-economic strata IV (69.1%). Parasitizedpopulation 77,2% with prevalence of Blastocystis hominis 34.4% in pre-school (31.1%), adolescents(27.7%). Found significant relationship between hypochromia and parasites, type being B. hominis themore closely related to this condition (42.3%). Type of parasite by etario group: Giardia lamblia in nursing36.4%, combination G. lamblia and B. hominis in pre-school, 47.1%, Endolimax nana in school 40,45%,combination of E. nana and B. hominis in teenage 34.5%. No significant relationship between parasitism,type of parasite and diagnosis of stature. We concluded that in preschool children from low socioeconomicthe parasitic intestinal by B. hominis are prevalent and significantly related hypochromia, but not withstature.Key words: Hypochromia, socioeconomic level, Blastocystis hominis, Giardia lamblia.Recibido: 30 de Agosto de 2010. Aprobado: 16 de Abril de 2001.Correspondencia: Dra. Iraima AcuñaINVESNUT. Apartado postal 3458. Valencia 2002-A, Venezuela.E-mail: ciberfamilia14@hotmail.com87

I. ACUÑA y A. MORÓN DE SALIMRESUMENSe estudió la presencia de hipocromía y diagnóstico de talla, en niños y adolescentes del MunicipioGuacara, Estado Carabobo, Venezuela, y su relación con tipos y combinaciones de parásitos. Se examinaron395 niños, entre lactantes, preescolares, escolares y adolescentes, que asistieron a tres ambulatorios ruralesde Guacara, sin enfermedad aparente, edad entre 1-18 años. Se les realizó evaluación hematológica,parasitológica y socioeconómica. Hematológica, contador hematológico automatizado, marca BeckmanCoulter, modelo Ac.T 5diff; copro-parasitológica una muestra de heces por niño, método directo y Kato-Katz; socioeconómica Graffar según Méndez Castellano. Se obtuvo: edad promedio 6,64 ± 1,78 años; 51,4%género masculino y 48,6% femenino; predominio de preescolares 30,9%, adolescentes 25,6%; estratosocioeconómico predominante IV (69,1%). Población parasitada 77,2% con prevalencia de Blastocystishominis 34,4%; preescolares (31,1%), adolescentes (27,7%); con p < 0,05 entre los grupos etarios. Seencontró relación significativa entre hipocromía y tipo de parásitos, siendo el B. hominis el más relacionadocon esta condición (42,3%) y entre tipo de parásito y grupo etario: Giardia lamblia en lactantes 36,4%;combinación G. lamblia y B. hominis en preescolares, 47,1%; Endolimax nana en escolares 40,45%,combinación de E. nana y B. hominis en adolescentes 34,5%. No hubo relación significativa entre parasitosis,tipo de parásito y diagnóstico de talla. Se concluye que en preescolares de bajo nivel socioeconómico, lasparasitosis intestinales por B. hominis son prevalentes y relacionadas significativamente con hipocromía,mas no con la talla.Palabras clave: Parasitosis, hipocromía, nivel socioeconómico, Blastocystis hominis, Giardia lamblia.INTRODUCCIÓNLa prevalencia de las parasitosis intestinales enniños y adolescentes venezolanos, no se diferenciade las registradas en otros países latinoamericanoscon características climáticas, condiciones de insalubridady pobreza semejantes (Simoes et al, 2000).La pobreza y las condiciones sanitarias deficientesson uno de los mayores agentes de infección porenteroparásitos los cuales a través de diferentes mecanismos,privan al organismo de nutrientes. Estudiosa nivel nacional refieren altas incidencias deinfestaciones parasitarias en comunidades escolares,que a pesar de su baja mortalidad, pueden ocasionarimportantes problemas sanitarios y socialesdebido a su sintomatología y complicaciones. Lasparasitosis intestinales se producen en el hombrecuando sus hábitos y costumbres se interrelacionancon los ciclos de vida de los enteroparásitos, presentándosemás comúnmente, durante los primerosaños de vida cuando aún no se han adquirido loshábitos higiénicos y no se ha desarrollado la inmunidadfrente a los diferentes tipos de parásitos. (Riveroet al, 2000, Guevara et al, 2003).Las enteroparasitosis pueden transcurrir asintomáticasdurante largo tiempo, aunque también puedenllegar a provocar cuadros digestivos, inclusivecon repercusión en el crecimiento y desarrollo deniños y adolescentes, por pérdida del apetito con unefecto deletéreo sobre el metabolismo de las proteínas.Un mecanismo involucrado es el efecto queproducen sobre la absorción intestinal de nutrientes,debido a un aumento en la velocidad del tránsitointestinal por lesiones de la mucosa y por reducciónde la secreción de sales biliares (Marquezet al, 2005, Michelli y De Donato, 2001, Marcos etal, 2003, Ibáñez et al, 2004, Bórquez et al, 2004,Quihui-Cota et al, 2004). Las infestaciones porÁscaris lumbricoides, Trichuris trichiura y Giardialamblia pueden acelerar el tránsito intestinal yalterar el equilibrio de nitrógeno, lo que producemalabsorción e intolerancia a azúcares y vitaminas.Las infecciones helmínticas pueden producir malnutriciónproteinocalórica, siendo los niños preescolareslos más susceptibles a este tipo de desnutrición(Northrop-Clewes et al, 2001).La disminución del crecimiento en niños, ha sidoasociada con infestaciones por G. lamblia, mientrasque la infestación por T. trichiura se ha asociadocon déficit de peso para la talla y con déficit detalla para la edad (Sackey et al, 2003, Simsek etal, 2004). El objetivo del presente trabajo fue el88Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 85-92

HIPOCROMIA Y TALLA Y SU RELACIÓN CON PARASITOSIS INTESTINALESde evaluar la incidencia de parasitosis, sus tiposy combinaciones y su relación con la presencia ono de hipocromía y diagnóstico de talla, en niñosy adolescentes del Municipio Guacara del EstadoCarabobo.MATERIAL Y MÉTODOInvestigación descriptiva, de corte transversal yde observación de campo, cuya población estuvoconstituida por niños lactantes, preescolares, escolaresy adolescentes, que asistieron a tres ambulatoriosrurales del Municipio Guacara del EstadoCarabobo, Venezuela. Cada representante fue informadosobre los objetivos del estudio, así como,los beneficios que le aportaría a su hijo la participaciónen la investigación. La información fuedada sin presiones ni distingo de raza o condiciónsocioeconómica y se mantuvo en estricta confidencialidadla identificación de los participantes; losdatos recolectados en el estudio fueron utilizadoscon fines científicos y para beneficio de los niñosparticipantes. El estudio recibió la aprobación delComité de Ética de la Universidad de Carabobo yla participación de los niños se obtuvo por consentimientoescrito de los padres o representantes.La muestra estuvo representada por 395 niños,sin enfermedad aparente, con edades entre 1 y 18años. A todos los niños se les realizó evaluación hematológicay parasicológica. En ayuno se tomaron3 ml de sangre periférica, mediante punción venosa;se depositaron 2 ml en tubos de vidrio que contenían25 μl de EDTA como anticoagulante, paralas determinaciones hematológicas: hemoglobina,hematocrito, concentración de hemoglobina corpuscularmedia (CHCM) y volumen corpuscularmedio (VCM); los cuales se midieron en un contadorhematológico automatizado, marca BeckmanCoulter, modelo Ac.T 5diff.La evaluación copro-parasitológica se realizóen una sola muestra para cada niño o adolescenteparticipante mediante el método directo (soluciónsalina y lugol) y el método de concentración (Kato-Katz), el cual determina el número de huevos dehelmintos por gramo de heces y permite establecerla intensidad de infestación parasitaria; que segúnlos criterios de la Organización Mundial de la Saludse clasifican en infestaciones leves, moderadas oseveras (Incani, 1996). Se consideró hipocromía avalores de CHCM inferiores al 32% (WHO 2001).Se definió como normalidad en talla cuandoésta se encontraba por encima del percentil 10 ymenor o igual al percentil 90; riesgo de talla bajaa todo valor ubicado por encima del percentil 3 ymenor o igual al percentil 10; talla baja leve todovalor menor o igual al percentil 3 y por encima de- 3 desviaciones estándar; talla baja moderada todovalor menor o igual a

I. ACUÑA y A. MORÓN DE SALIMTabla 1. Distribución de frecuencia de parasitosisy tipos de parásitos en la población en estudio (n =395). Municipio de Guacara, VenezuelaParasitosis n %Niños parasitados 305 77,2Niños no parasitados90 22,8Tipo y combinaciones de parásitos en niños parasitados(n = 305)Blastocystis hominis105 34,4Endolimax nana55 18,0y BlastocyistishominisEndolimax nana 47 15,4Giardia lamblia y 17 5,6blastocystis hominisGiardia lamblia 11 3,6Otros tipos y combinaciones70 23,0el grupo de adolescentes (27,2%), y una relaciónsignificativa entre grupo etario y presencia o no deparásitos. El 9,2% de los parasitados presentaronanemia.La Tabla 3 muestra la presencia o no dehipocromía en la población parasitada, según tipoy combinaciones de parásitos. Según los análisisestadísticos aplicando las pruebas de Sommer yKendall, para p < 0,10, se encontró una relaciónestadísticamente significativa entre hipocromíay tipo de parásitos, siendo el B. hominis el másrelacionado con esta condición (42,3%).Hubo relación estadísticamente significativa entretipo de parásitos y grupos etarios, con predominiode G. lamblia en el grupo de lactantes (36,4%);de la combinación de G. lamblia y B. hominis en elgrupo de preescolares (47,1%); E. nana en el grupode escolares (40,4%) y la combinación de E. nanay B. hominis en el grupo de adolescentes (34,5%)(Tabla 4).La Tabla 5 muestra la relación entre tipo y combinacionesde parásitos y diagnóstico de talla en lapoblación parasitada, donde se observa que por encimadel 75% de los niños parasitados se encontrabandentro del rango de talla normal; de igual formase encontró una relación estadísticamente significativaentre diagnóstico de talla y tipo y combinacionesde parasitosis.DISCUSIÓNLas parasitosis intestinales, en la mayoría de loscasos, son asintomáticas, lo que permite no sólo supersistencia en el individuo sino también su diseminación.Las condiciones del subdesarrollo favorecenlas llamadas “enfermedades de la pobreza”,siendo las parasitosis las de mayor prevalencia, deallí que estudios hayan apuntado que el nivel socioeconómicoestá estrechamente relacionado conla prevalencia de infestación por parásitos intestinales(Michelli y De Donato, 2001). En este estudiose encontró una alta prevalencia de parasitosisintestinales en la población infantil, similar a lareportada por otros autores a nivel nacional, principalmenteen los estratos socioeconómicos de pobrezarelativa (IV), (Rivero et al, 2000b, Barón etal, 2007, Solano et al, 2008); siendo el preescolarel grupo etario más afectado, hallazgo este que noTabla 2. Relación entre grupo etario y presencia o no de parasitosis. Municipio de Guacara, VenezuelaNiños conparasitosisNiños sinparasitosisχ 2 27,869: p < 0,005Grupos etariosLactantes Preescolares Escolares Adolescentes Totaln % n % n % n %53 17,4 95 31,1 74 24,3 83 27,2 30529 32,2 27 30 16 17,8 18 20 9090Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 85-92

HIPOCROMIA Y TALLA Y SU RELACIÓN CON PARASITOSIS INTESTINALESTabla 3. Hipocromía y Normocromía en la población con parasitosis (n = 305) según tipo y combinaciones deparásitos Municipio de Guacara, VenezuelaTipo y combinacionesHipocromíaNormocromíade parásitosn % n %Blastocystis hominis 30 42,3 75 32,1Endolimax nana y6 8,5 49 20,9Blastocyistis hominisEndolimax nana 5 7 42 17,9Giardia lamblia y7 9,9 10 4,3Blastocystis hominisGiardia lamblia 4 5,6 7 3Entamoeba coli y8 11,3 13 5,6Blastocystis hominisEntamoeba coli. 3 4,2 4 1,7Otros tipos y combinaciones8 11,3 34 14,5Total 71 100 234 100Kendall: 0,096 p = 0,05; Sommer: 0,089 p = 0,05; p < 0,10Tabla 4. Relación entre tipo y combinación de parásitos según grupo etario en la población parasitada(n = 305). Municipio de Guacara, VenezuelaTipo y combinacióndeparásitosBlastocystishominisEndolimaxnana yBlastocyistishominisGrupos etariosLactantes Preescolares Escolares Adolescentesn % n % n % n % Total22 21,0 33 31,4 20 19,1 30 28,6 1055 9,1 20 36,4 11 20,0 19 34,5 55Endolimax nana 8 17,0 14 29,8 19 40,4 6 12,8 47Giardia lamblia3 17,6 8 47,1 3 17,6 3 17,6 17yBlastocystishominisGiardia lamblia 4 36,4 5 45,5 2 18,2 0 0 11Otros tipos y 11 15,7 15 21,4 19 27,1 25 35,7 70combinacionesKendall: 0,107 p = 0,02; Somer: 0,107 p = 0,02coincide con lo reportado por otros autores, quienesindican que la mayor prevalencia de parasitosisse presenta el grupo de edad escolar (Simoes et al,2000, Rivero et al, 2000b, Iannacone et al, 2006,).Esta prevalencia de infestaciones parasistarias principalmentedel tipo de protozoarios, encontrada enel grupo de preescolares pudo ser debida a la faltade agua potable, a las inadecuadas condiciones sa-Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 85-9291

I. ACUÑA y A. MORÓN DE SALIMTabla 5. Relación entre tipo y combinaciones de parásitos y diagnóstico de talla en la población parasitada(n = 305). Municipio de Guacara, VenezuelaRiesgo detalla bajaTalla bajaLeveDiagnóstico de tallaTalla bajaModeradaTallaNormalRiesgo detalla altaTallaaltan % n % n % n % n % n %Tipo y combinacionesde parásitosTotalBlastocystis hominis7 6,7 9 8,6 0 0 84 80,0 5 4,8 0 0 105Endolimax nana y 5 9,1 1 1,8 2 3,6 47 85,5 0 0 0 0 55Blastocyistis hominisEndolimax nana 6 12,8 4 8,5 0 0 33 70,2 2 4,3 2 4,3 47Giardia lamblia y 2 11,8 1 5,9 0 0 14 82,4 0 0 0 0 17Blastocystis hominisGiardia lamblia 1 9,1 1 9,1 1 9,1 8 72,7 0 0 0 0 11Otros tipos y combinaciones10 14,3 4 5,7 1 1,4 53 75,8 1 1,4 1 1,4 70Kendall:-0,032; Somer: -0,029.nitarias existentes donde viven, asi como tambienal consumo de alimentos contaminados con materiafecal, principal via de transmisión de este tipo deparásitos.El protozoario de mayor prevalencia encontradoen este estudio fue B. hominis, cuya infecciónha sido asociada principalmente a sintomatologíagastrointestinal inespecífica (Doyle et al, 1990, AlTawil et al, 1994). Barahona et al, (2002), y Deveraet al, 2003) pudieron demostrar que el consumo deagua potable no hervida, con ausencia de medidasadecuadas de saneamiento básico, son factores deriesgo determinantes importantes en la prevalenciade B. hominis considerado como un patógeno potencial,especialmente en niños y cuando el númerode éste en muestras de heces excede a cinco microorganismospor campo (400X), así como también,la aparición de enfermedad dependerá de la interacciónparásito y hospedero (Nimri, 1993, Devera etal, 2006).En el presente estudio B.s hominis representó,como parasitosis única el 34,4% y se relacionó demanera significativa con la presencia de hipocromía,sugiriendo un papel patógeno más que de comensalintestinal; sin embargo, no ha sido reportadauna relación estadísticamente significativa entreblastoscitosis y anemia. En cuanto a G. lambia,se ha sugerido que en países en desarrollo, noindustrializados, su incidencia es 4 veces mayorque la reportada en los países industrializados,siendo el parásito más frecuentemente encontrado(De Abreu et al, 2002, Simsek et al, 2004). Enel presente estudio, en el grupo de lactantes, seevidenció un alto grado de infestación parasitariapor G. lamblia, lo cual puede estar relacionadocon la introducción de fórmulas infantiles, debidoa la escasa o nula lactancia materna. La mayorprevalencia de giardiasis sola y en combinacióncon blastocistosis encontrada en el grupo depreescolares probablemente se deba a que ambosparásitos comparten el mismo mecanismo detransmisión, agua y alimentos contaminados. Laalta prevalencia de E. nana encontrada en el grupode escolares y en combinación con B. hominis en elgrupo de adolescentes, es semejante a la reportadapor otros autores (Salomón et al, 2007), quienesreportaron altas prevalencias de este protozoarioen todos los grupos de edades, principalmente enescolares y adolescentes.Entre los parásitos asociados con B. hominis,hallados en este estudio fueron: E. nana en elgrupo de adolescentes y G. lamblia en el grupode preescolares; siendo G. lamblia el parasitoreportado por otros investigadores como el más92Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 85-92

HIPOCROMIA Y TALLA Y SU RELACIÓN CON PARASITOSIS INTESTINALESfrecuentemente asociado con B. hominis (Mercadoet al, 2003, Holder et al, 2006); su asociaciónpudiera deberse a algún sinergismo en el mecanismode daño, incluso en el mecanismo de transmisión.Holder et al, (2006) afirman que B. hominis seasocia aun más frecuente con otros parásitos patógenostales como Entamoeba histolytica y Cristoporidumparvum, lo cual dificulta con exactitudconocer su potencial patogénico.Investigadores han reportaron que las asociacionesparasitarias más frecuentes, son la de B. hominiscon E. nana y con G. lamblia, (Beauchampet al, 1995, Mayo y Moreno, 1997). Estas asociacionessugieren un modo similar de transmisión(oro-fecal), lo cual es de gran importancia epidemiológica,ya que su presencia indica ingestión dealimentos y/o agua contaminada con materias fecales,lo cual permite la implementación de medidassanitarias específicas para su control.Los entero-parásitos pueden llegar a provocarademás cuadros digestivos de mal absorción intestinal,tránsito acelerado, reducción de las sales biliaresy lesiones en la mucosa intestinal (Guevara etal, 2003, Márquez et al, 2005), aunque sigue siendocontroversial si estas alteraciones influyen sobreel estado nutricional y crecimiento de los niños, debidoa la diversidad de edades, estado nutricional,tipo de parásitos e intensidad de las parasitosis enlos grupos estudiados (Dickson et al, 2000). En esteestudio se encontró una relación estadísticamentesignificativa entre parasitosis y alteración en la talla,lo cual no coincide con lo reportado por otrosautores (Solano et al, 2008), pudiendo considerarsela combinación y tipo de parásito un factor contribuyentemás no determinante, en el cual influyeademás la ingesta alimenticia, estado nutricional yfactores socioeconómicos entre otros.Se concluye que B. hominis es el parásito másprevalente en la población estudiada y su presenciase relacionó significativamente con hipocromíay trastornos de talla, por lo que, se puede inferir,que este parásito puede ser considerarlo comopotencial patógeno intestinal, pudiendo conducircomo factor contribuyente a alteraciones en la tallae hipocromía.REFERENCIAS1. AL- TAWIL Y, GILGER M, GOPALAKRISHMA G,LANGSTON C, BOMMER K. 1994. Invasive Blastocystishominis infection in a child. Arch, Pediatr. Adolesc.Med 148: 882-885.2. BARAHONA L, MAGUINA C, NAQUIRA C,TERASHIMA A, TELLO R. 2002. Sintomatología yfactores epidemiológicos asociados al parasitismo porBlastocystis hominis. Parasitol Latinoam 57(3- 4): 96-102.3. BARÓN M, SOLANO L, PÁEZ M, PABÓN M. 2007.Estado nutricional de hierro y parasitosis intestinal enniños de Valencia, Estado Carabobo, Venezuela AnalesVenezolanos de Nutrición 20 (1): 5-11.4. BEAUCHAMP S, FLORES T, TARAZÓN S. 1995.Blastocystis hominis: Prevalencia en alumnos de unaEscuela Básica. Maracaibo, Estado Zulia, Venezuela.Kasmera 23: 43-67.5. BÓRQUEZ C, LOBATO I, MONTALVO MT,MARCHANT P, MARTÍNEZ P. 2004. Enteroparasitosisen niños escolares del Valle de Lluta. Arica-Chile.Parasitol. Latinoam. 59: 175-178.6. DE ABREU J, SANTOS C, BORNO S, MONTILLAME, ARENAS O, DINI GOLDING E. 2002. Deficienciade vitamina A en niños desnutridos moderados de unapoblación urbano-marginal de Caracas. An Venez Nutr15(2): 76-86.7. DEVERA R, CERMEÑO J, BLANCO Y, BELLO M,GUERRA X, SOUSA M, MAITAN E. 2003. Prevalenciade blastocitosis y otras parasitosis intestinales en unacomunidad rural del Estado Anzoátegui, Venezuela.Parasitol Latinoam 58: 95-100.8. DEVERA R, MAGO Y, AL RUMHEIN F. 2006.Parasitosis intestinales y condiciones socio-sanitariasen niños de una comunidad rural del Estado Bolívar,Venezuela Rev Biomed 17: 311-313.9. DICKSON R, AWASTHI S, WILLIAMSON P,DEMELLWEEK C, GARNER P. 2000. Effects oftreatment for intestinal helminth infection on growthand cognitive performance in children: systematicreview of randomised trials. BMJ 320 (7251): 1697-1701.10. DOYLE O, HELGASON M, MATHIAS R, PROC-TOR E. 1990. Epidemiology and pathogenicity of Blastocystishominis. J. Clin. Microbiol. 28: 116-121.11. GUEVARA Y, DE HARO I, CABRERA M, GARCÍADE LA TORRE G, SALAZAR SCHETTINO P. 2003.Enteroparasitosis en poblaciones indígenas y mestizasde la Sierra de Nayarit, México. Parasitol Latinoam 58:30-34.12. HENRÍQUEZ G. 1999. Evaluación del estado nutricional.en: Nutrición en Pediatría. Centro de AtenciónNutricional Infantil Antímano (CANIA); pág 29.13. HOLDER R, ZELADA A, JÉREZ Y. 2006. Pacientescon Blastocystis hominis atendidos en el HospitalPediátrico Docente William Soler. La Habana Cuba.Julio 2006. Disponible en: Disponible en: http://www.revistaciencias.com/publicaciones/14. IANNACONE J, BENITES M, CHIRINOS L. 2006.Prevalencia de infección por parásitos intestinales enescolares de primaria de Santiago de Surco, Lima, Perú.Parasitol. Latinoam. 61: 54-62 FLAP.15. IBÁÑEZ NH, JARA CC, GUERRA AM, DÍAZ EL.2004. Prevalencia del enteroparasitismo en escolaresde comunidades nativas del Alto Marañon, Amazonas,Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 85-9293

I. ACUÑA y A. MORÓN DE SALIMPeru. Rev Peru Med Exp Salud Pública. 21: 126-133.16. INCANI RN 1996. (Comp.). Parasitología. Universidadde Carabobo. Facultad de Ciencias de la Salud.Departamento de Parasitología. Valencia. Venezuela.Segunda Edición; p. 23-44.17. MARCOS L, MACO V, TERASHIMA A, SAMALVI-DES E, MIRANDA E, GOTUZZO E. 2003. Parasitosisintestinal en poblaciones urbanas y rural en Sandia,Departamento de Puno. Perú. Parasitol. Latinoam 58:35-40.18. MARQUEZ SMT, BANDEIRA C, DE CUADROSRM. 2005. Prevalencia de enteroparasitoses en Concordia,Santa Catarina, Brazil. Parasitol Latinoam. 60:78-81.19. MAVO L, MORENO A. 1997. Prevalencia de Blastocystishominis en pacientes atendidos en el LaboratorioClínico de la Escuela de Bioanálisis, L:U:Z, en el lapso1992-1995. Trabajo especial de grado. Escuela de Bioanálisis,Facultad de Medicina, Universidad del Zulia,Maracaibo, Venezuela. 1997: 42.20. MÉNDEZ-CASTELLANO H. DE MÉNDEZ M. 1994.Sociedad y estratificación. Método Graffar- MéndezCastellano. Caracas. Venezuela. p 7-35.21. MICHELLI E, DE DONATO M. 2001. Prevalenciade Blastocystis hominis en habitantes de Rio Caribe,Estado Sucre, Venezuela. Saber. 13: 105-112.22. MERCADO R, CASTILLO D, MUÑOZ V, SANDO-VAL L, JERCIC M I, GIL JC, UETA MT, SCHENO-ME H. 2003. Infecciones por protozoos y helmintosintestinales en pre-escolares y escolares de la Comunade Colina, Santiago, Chile.23. NIMRI L. 1993. Evidence of an epidemic of Blastocystishominis infections in preschool children in NorthernJordan. J. Clin. Microbiol. 31: 2706-270824. NORTHROP-CLEWES CA, ROUSHAM EK, MAS-CIE-TAYLOR CN, LUNN PG. 2001. Anthelmintictreatment of rural bangladeshi children: effect on hostphysiology, growth, and biochemical status. Am J ClinNutr 73(1): 53-60.25. QUIHUI-COTA L, VALENCIA ME, CROMPTONDW T. 2004. Prevalence and intensity of intestinalparasitic infections in relation to nutritional status inMexican schoolchildren. Trans Roy Soc Trop MedHyg. 98: 653-659.26. RIVERO Z, CHOURIO G, DÍAZ I, CHENG R,RUCSÓN G. 2000a. Enteroparasitosis en escolaresde una Institución Pública del Municipio Maracaibo,Venezuela. Invest. Clin. 41: 27-57.27. RIVERO RODRÍGUEZ Z, CHOURIO-LOZANO G,DÍAZ I, CHENG R, RUCSON G. 2000b. Enteroparásitosen escolares de una institución pública del municipioMaracaibo, Venezuela. Inves Clín 41: 37-57.28. SACKEY ME, WEIGEL MM, ARMIJOS RX. 2003.Predictors and nutritional consequences of intestinalparasitic infections in rural ecuadorian children. J. TropPediatr 49(1):17-23.29. SALOMÓN M, TONELLI R, BORREMANS C,BERTELLO D, DE JONG L, JOFRÉ C, ENRÍQUEZ V,CARRIZO L, COSTAMAGNA S. 2007. Prevalenciade parásitos intestinales en niños de la Ciudad deMendoza, Argentina. Parasitol. Latinoam. 62 (1-2):30. SIMOES M, RIVERO Z, CEDEÑO G, LUGO M,MALDONADO A, CHACÍN I, PARRA M, MÉNDEZY, MARQUINA M. 2000. Prevalencia de enteroparasitosisen una Escuela Urbana en el Municipio San Francisco,Estado Zulia, Venezuela. Kasmera. 28: 27-34.31. SIMSEK Z, ZEYREK FY, KURCER MA. 2004.Effect of giardia infection on growth and psychomotordevelopment of children aged 0-5 years. J Trop Pediatr50(2): 90-93.32. SOLANO RL, ACUÑA GI, BARON MA, MORÓNDE SALIM A, SÁNCHEZ JA. 2008. Asociaciónentre pobreza e infestación parasitaria intestinal enpreescolares, escolares y adolescentes del sur deValencia Estado Carabobo-Venezuela. Kasmera, 36,(2): 137-147.33. WORLD HEALTH ORGANIZATION (WHO) (2001).Iron deficiency anaemia. Assessment prevention andcontrol. a guide for programme managers. Report ofWHO/UNICEF/UNU. 2001. Geneva: document WHO/nhd/01.3.[en línea] 2001. http://www.who.int/nut/documents/ida_assessment_prevention_control.pdf94Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 85-92

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 93-100Anemia ferropriva e sua correlaçao comparasitos intestinais em uma populaçãoda área periurbana de ManausMOTTA DE OLIVEIRA C.L. 1 , ANTUNES FERREIRA W. 2 , DA MATA A. 3 e VALE BARBOSA M G. 41Centro Universitário Nilton Lins, Fundação de Hematologia e Hemoterapia do Amazonas - HEMOAM - (AM) eSecretaria Municipal de Saúde - SEMSA.2Fundação de Dermatologia e Venereologia Tropical Alfredo da Mata FUAM - (AM). Felicien Gonçalves Vasquez- Fundação de Dermatologia e Venereologia Tropical. FUAM - (AM)3Fundação de Hematologia e Hemoterapia do Amazonas - HEMOAM - (AM).4Fundação de Medicina Tropical do Amazonas - FMTAM - (AM).ABSTRACTANEMIA OF IRON DEFICIENCY AND YOUR CORRELATION WITH INTESTINALPARASITES IN A POPULATION OF THE AREA NEAR URBAN OF MANAUSAccording to the WHO more than two billion people are infected with some worm type or parasite.Is considered that 60% of those infections can be responsible for deficiencies nutrition’s, mainly lack ofiron and of vitamins. With the objective of associating the prevalence of Iron anaemia deficiency with theoccurrence of intestinal parasites, in a population of the urban area, they were accomplished collection ofblood for evaluation of Iron deficiency Anaemia and exam feces to detect the intestinal parasites in patientsof the spontaneous demand of a tertiary unit of health in Manaus. 400 samples were analyzed, in 271(67,75%) intestinal parasites were detected, being 197 (49,25%) for protozoa and 148 (37%) for helminths.In the blood count of 83 (20.75%) samples, Hematocrit was below 35%, in 131 (32,75%), the Hemoglobinwas below 12%. In relation of Transferrin assay, 76 (19,3%) to the samples were with values above 360µg/dL, 14 (3,5%) they were with values of the concentration of the Iron below 40% and 14 (3,5%) with thevalues of smaller Ferritin than 12%., 14 (3,5%) they were with values of the concentration of the Iron bassof 40% and 14 (3,5%) with the values of smaller Ferritin than 12%.Key words: Anemia of iron deficiency, Serum iron, Parasites intestinal. Survey.Recibido: 17 de Octubrede 2010. Aceptado: 13 de Abril de 2011.Este trabajo fue financiado pela Fundação de Amparo a Pesquisa do Estado do Amazonas - FAPEAM, SecretariaMunicipal de Saúde - SEMSA - Fundação de Hematologia e Hemoterapia do Amazonas, Diagnocel Comercio eepresentações Ltda e ABAM-Assessoria Bioquímica aplicada a Medicina. Forma parte da dissertação de MestradoAcadêmico em Biologia Urbana do primeiro autor, título: Parasitoses intestinais e fatores sócio-ambientais de umapopulação da área periurbana de Manaus, desenvolvido no Centro Universitário Nilton Lins, defendido em 31/07/2008,65 pag.Correspondencia: Cecília Leite Motta de Oliveira - Rua Billie Holiday, 36, Condomínio Jardim Itapoã, bloco H, apto.601, CEP 69050-440.E-mail: cecília.motta@globo.com, telefone: (92) 88148462.95

C. L. MOTTA et al.RESUMOSegundo a Organização Mundial de Saúde, mais de dois bilhões de pessoas estão infectados com algumtipo de verme ou parasito. Estima-se que 60% dessas infecções podem ser responsáveis por deficiênciasnutricionais, principalmente carência de ferro e de vitaminas. Com o objetivo de associar à prevalência deAnemia Ferropriva com a ocorrência de Parasitos Intestinais, em uma população da área urbana, foramrealizada coleta de sangue para dosagem de Anemia Ferropriva e exame coprocitológicos para detectar osParasitos Intestinais em pacientes da demanda espontânea de uma unidade terciária de saúde em Manaus.Foram analisadas 400 amostras, em 271 (67,75%) detectaram-se parasitos intestinais, sendo 197 (49,25%)por protozoários e 148 (37%) por helmintos. Foram registras 154 (38,5%) amostras monoparasitadas, 58(14,5%) biparasitadas e 12 (3%) poliparasitadas. No hemograma de 83 (20.75%) amostras o Hematócritoestava abaixo de 35%, em 131 (32,75%) a Hemoglobina estava abaixo de 12% 76 (19,3%) a dosagem deTransferrina estava com valores acima de 360 µg/dL, 14 (3,5%) estavam com valores da concentração doFerro abaixo de 40% e 14 (3,5%) com os valores de Ferritina menor que 12%.Palavras chaves: Anemia ferropriva, Parasitos intestinais, Brazil.INTRODUÇÃONas regiões onde a prevalência de parasitosintestinais é elevada, observa-se incidência de diferentesdoenças, como a obstrução intestinal (Ascarislumbricoides), a desnutrição (A. lumbricoidese Trichuris trichiura), quadros de diarréia e máabsorção de nutrientes (Entamoeba histolytica eGiardia lamblia), anemia por deficiência de Ferro(ancilostomídeos), cujos sinais e sintomas sofreminfluencia da intensidade da resposta imune e da relaçãoparasito-hospedeiro (Grilo et al, 2000).A Anemia Ferropriva (AF), é a diminuiçãoou ausência das reservas de Ferro, com baixaconcentração férrica no soro, fraca saturação daTransferrina, concentração da Hemoglobina baixae uma redução do Hematócrito. É definida pelaOrganização Mundial de Saúde (OMS) como umprocesso patológico, em que a concentração dehemoglobina está abaixo do normal, entretanto,sabe-se que sua concentração no sangue pode variarconforme a idade, sexo e altitude. Em crianças comidade entre seis meses e seis anos, a OMS propôs olimite de normalidade em 11 g/dl (Chandra, 1973).A AF eleva o esforço cardíaco, para manutençãodos níveis normais de oxigenação, e reduz a capacidadefísica para o trabalho, resultando em sintomascomo dismenorréia, anorexia, cefaléia, vertigem,sonolência, fraqueza muscular, formigamento e, amaior seqüela, o aborto espontâneo. (Bashini et al,2003).Vários aspectos como idade, sexo e carênciade um ou mais nutrientes essenciais, necessários àformação da Hemoglobina (Hb) devem ser consideradosna caracterização de AF (Paiva et al, 2000;Silva L.M et al, 2001). Entre os determinantes dessetipo de anemia estão certos parasitos intestinais,que podem reduzir em até 20%, o ferro ingeridona dieta, sendo que a causa orgânica imediata é adeficiência de Ferro circulante (Grilo et al, 2000),cuja carência chega a ser responsável por 95% dasanemias. (Silva e Santos, 2001; Cantos et al, 2003).A detecção da AF proveniente de parasitos intestinaispode ser obtida com a dosagem da concentraçãodo Ferro corporal, especialmente a Ferritinano soro, que indica a situação dos depósitos corporaisde ferro, onde pode ser observado, se houveou não quelação pelos parasitos intestinais. Quandoisso ocorre, estes são exauridos, antes de ocorrerà diminuição da concentração da Hemoglobina,podendo ser caracterizada a depleção das reservascorporais de Ferro sem Anemia, etapa inicial da deficiênciade Ferro. Devido a sua elevada especificidade,a concentração da Ferritina sérica, pode comprovara etiologia ferropriva da Anemia. (Neves etal, 2005).Desta forma a elevada prevalência de parasitosIntestinais pode contribuir para o desenvolvimentode diferentes doenças, cujos sinais e sintomas sofreminfluencia da intensidade da resposta imune eda relação parasito-hospedeiro, que pode culminarcom a morbidade e alterações físico-nutricionais,96Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 93-100

ANEMIA FERROPRIVA E CORRELAÇAO COM PARASITOS INTESTINAISem crianças e adultos- (Grilo et al, 2000) Este quadro,pode ter relação com as condições de moradia,falta de tratamento de água e esgoto e se consolida,como um agravo à saúde pública (Chandra, 1973).O objetivo desse estudo foi associar à prevalênciade AF com a ocorrência de parasitos intestinais,em uma população da área urbana.MATERIAL E MÉTODOA pesquisa foi realizada em uma UnidadeBásica de Saúde (UBS), localizada na ZonaNorte de Manaus Amazonas, onde são realizadoscerca de 35.000 procedimentos anuais, com umatendimento Laboratorial de 11.000 pessoas. Nessaregião existem problemas estruturais dentre elesdeficiência de saneamento básico. A populaçãode estudo foi constituída a partir da demandaespontânea de pacientes que procuraram o Serviçode Saúde para a realização de Hemograma e examesparasitológicos de fezes, após consulta médica, noperíodo entre 12 de abril a 17 de julho de 2007 e queaceitaram e assinaram o Termo de ConsentimentoLivre e Esclarecido. Os pacientes com idade inferiora 18 anos foram incluídos a partir da autorizaçãodos pais ou responsáveis. Foram excluídas aspessoas que não concordaram em participar doestudo, que fizeram uso de medicamentos contraHelmintos ou Protozoários e para o tratamento deAnemia em até 30 dias anterior à data do exame ouque não residiam na região próxima à UBS.Para a investigação de infestação por parasitosintestinais foi solicitado material para realização deexame coprológico e O exame parasitológico foirealizado através do método de sedimentação deLutz et al (1934), sendo esse método o de escolhapor ser usado nas atividades de rotina do Laboratório.Após manipulação das amostras, as mesmasforam examinadas em duplicata, em microscópioóptico binocular, utilizando a solução parasitológicade Lugol (1% de Iodo Metálico + 2% de Iodetode potássio) para diferenciação morfológica dosparasitos e cistos de protozoários. Para o Controlede Qualidade utilizou-se amostras cegas.Para o Hemograma coletou-se 5 mL de sanguerealizado no Laboratório de Análises Clínicas(LAC) Fundação de Hematologia e Hemoterapiado Amazonas / FHEMOAM em contador automático(Pentra 120 Retic da ABX®), seguindo-se oprocedimento do fabricante Horiba, utilizando osvalores de referência padronizados por Moura et al(2004), que preconiza 40 a 54% para sexo masculino,37 a 47% para o feminino e 35 a 37% paracrianças.Para o diagnóstico de anemia foram utilizadosos valores de referência padronizados pelo CDC(1998), que preconizam a concentração de Hemoglobinainferior a 13 g/dL para homens, 12 g/dLpara mulheres e 11 g/dL para crianças na faixa etáriade seis meses a seis anos, 6 a 14 anos 12 g/dL. Osdados obtidos foram submetidos à análise estatísticae os resultados dos testes foram entregues aos pacientese/ou responsáveis, para o retorno médico.O estudo do Ferro foi realizado no LAC/FHE-MOAM, em equipamento automatizado (Architect®da Abbott e AutoDelphia MC da PerkinElmer,respectivamente), através da dosagem deFerro sérico, Capacidade total de ligação do Ferro,Saturação de Transferrina e Ferritina sérica. Emrelação ao ferro sérico os valores de referência foramos padronizados pelo fabricante (Diasys DiagnosticSystems GmbH & Co. KG.), metodologia:colorimétrico utilizando Ferene. Para o diagnósticode anemia utilizou-se a concentração de Ferro séricoinferior a 40 µg/dl o preconizado por Lorenzi(Monteiro et al, 2000). Em relação à Ferritina, ametodologia utilizada foi Imunoturbidimetria e ovalor utilizado para o diagnóstico de A F foi inferiora 10 ng/mL.Para a dosagem da Transferrina, utilizou-semetodologia automatizada por imunoturbidimetria(Labtest Diagnóstica S.A.), com valores superioresa 410 µg/dL para a hipótese de anemia. A saturaçãoda Transferrina foi obtida pelo cálculo do Ferrosérico, dividido pela Transferrina, multiplicado por100 e para os casos com diagnóstico de AF foramconsiderado os valores inferiores a 16%.Análise Estatística: Os dados foram analisadosutilizando-se o Teste do qui-quadrado de Pearsone o Teste exato de Fisher e o Teste t de Studentconsiderando-se significância no valor do p em 5%.RESULTADOSForam coletadas 400 amostras de fezes e desangue total, destas, 181 (45,25%) do sexo feminino,117 (29,25%) foram crianças e adolescentes nafaixa etária entre um e dezoito anos e 154 (38,5%)Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 93-10097

C. L. MOTTA et al.a faixa etária entre 19 e 85 anos (Tabela 1).Em 271 (67,75%) detectaram-se parasitos intestinais,sendo 197 (49,25%) por protozoários e 148(37%) por helmintos. Foram registras 154 (38,5%)amostras monoparasitadas, 58 (14,5%) biparasitadase 12 (3%) poliparasitadas. Dentre as 154 amostrasmonoparasitadas, detectou-se em 46 (11,50%)E. histolytica; nas 58 (15%) amostras biparasitadas,12 (3%) foram por E. histolytica e A. lumbricoides,9 (2,25%) por E. histolytica e E. vermicularis equatro (1%) por E. histolytica e G. lamblia. Nas 12(3%) amostras poliparasitadas, foram identificadasG lamblia, E. histolytica e A. lumbricóides (Tabela2).Com relação ao Hematócrito, 147 (36,75%)apresentaram valores abaixo do de referência, sendo35 (8,75%) pacientes crianças na faixa etária entreum e 12 anos, prevalecendo o sexo masculino, 98(24,5%) pacientes do sexo feminino com valoresabaixo de 37% e 14 (3.50%) do sexo masculinocom valores abaixo de 40%. Em 54/147 (13,5%)das amostras, foram identificados monoparasitismopor helmintos e em 39 (9,75%) por protozoários ebiparasitismo em 15 (3,75%), prevalecendo o sexofeminino. (Tabela 3).Registrou-se dosagem de Hemoglobina apresentandovalores ≤ 11%, em 11 (2,75%) das amostrasde crianças na faixa etária entre um e seis anos.Em 88 (22%) das amostras de pacientes do sexofeminino, valores ≤ 12% e em 32 (8%) pacientes dosexo masculino apresentaram valores ≤ 13% destes(Tabela 3). Não se observou diferença significativaentre a presença de parasitos e a dosagem de Hemoglobina.Na dosagem de Ferro detectaram-se valores 19 anos. Não foiobservada diferença significativa entre a presençade parasitos e a dosagem de Ferro (Tabela 5).Na dosagem de Ferritina foram encontradosvalores < 10ng/L, em 44 (11,00%) das amostrassendo 7 (1,6%) crianças na faixa etária entreum e doze anos (Tabela 4). Observou-se que 15(3,75%) estavam sem parasito intestinal e Ferritinaalteradas. Observou-se que não houve significânciaestatística entre Ferritina e poliparasitos (Tabela 5).Em relação à dosagem de Transferrina, 41 (10,25%)pacientes estavam com valores acima de 360 µg/dL,destes, 17 (4,25%), eram crianças com idade entreum e doze anos (Tabela 4). Observou-se que nãohouve significância estatística entre Transferrina ePoliparasitos (Tabela 5).Registrou-se Saturação da Transferrina apresentandovalores < 16%, em 81 (20,3%) das amostrassendo 37 (10,.25%) crianças na faixa etária entreum e doze anos. (Tabela 5).Na análise do Hemograma foram correlacionadasa prevalência de parasitos intestinais coma quantificação do Hematócrito, Hemoglobina,Transferrina, Ferro, Ferritina e Saturação da Transferrinae foram encontrados pacientes com dosagensanormais e presença de poliparasitos, destacando-sea presença de parasitos patogênicos comoA. lumbricoides E. histolytica, G. lamblia e E. vermicularisconforme (Tabela 2).DISCUSSÃOA taxa de parasitos intestinais registrada nesseestudo é considerada alta e a faixa etária maisacometida é semelhante ao de outros estudos comoAraújo e Fernández em Eirunepé (AM), comTabela 1. Distribuição por faixa etária dos 400 participantes, atendidos no Posto UBS/PA MJ Sálvio Belotaconforme resultado parasitológicoFaixa etáriaPositivo% Feminino % Masculino %1 a 6 2.25 20 5 21 5.257 a 12 2.75 18 4.5 20 513 a 18 0.75 31 7.75 7 1.75> 19 4.75 112 28 42 10.5Total 10.5 181 45.25 90 22.598Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 93-100

ANEMIA FERROPRIVA E CORRELAÇAO COM PARASITOS INTESTINAISTabela 2. Correlação dos parasitos patogênicos em relação à faixa etária e sexo dos pacientes atendidos noPosto UBS/PA MJ Sálvio BelotaEspéciesMonoparasitismoAscaris lumbricoides1 a 6 7 a 12 13 a 18 ≥ 19 TotalF M F M F M F M n %4 0 3 0 3 0 11 1 22 5.50Ancilostomídeos 1 1 0 2 0 2 13 5 24 6.00E. vermicularis* 2 3 3 1 1 0 8 1 19 4.75S. stercoralis* 0 0 1 0 0 0 2 6 9 2.25Trichuris trichiura 0 0 1 0 1 1 3 1 7 1.75Entamoeba histolytica3 1 2 4 8 1 18 9 46 11.50Giardia lamblia 3 4 1 4 2 0 7 6 27 6.75Biparasitismo 1 a 6 7 a 12 13 a 18 ≥ 19 TotalF M F M F M F M n %A. l + T trichiura 0 1 1 0 0 0 2 0 4 1E. h + A. L 0 3 1 1 1 0 4 2 12 3E. h + E. v 1 1 0 0 3 1 3 0 9 2.25G lamblia + E 0 0 1 0 1 1 1 0 4 1histolyticaPoliparasitismo 1 a 6 7 a 12 13 a 18 ≥ 19 TotalF M F M F M F M n %E h + Ancilostomideos0 0 0 0 0 0 1 0 1 0.25+ E vG lamblia + E h 0 0 0 1 0 0 1 0 2 0.5+ E vG lamblia + E h 0 0 0 0 0 0 1 0 1 0.25+ S sG lamblia + E h 0 0 1 0 0 0 1 1 3 0.75+ A l*A l = Ascaris lumbricóides, E.v=Enterobius vermicularis, S.stercoralis=Strongyloides stercoralis, H. nana= Hymenolepisnana, T. trichiura= Trichuris trichiura, E. h = Entamoeba histolytica, G. lamblia = Giardia lamblia64,41%, e o de Silva e Santos (2001). em BeloHorizonte, com taxas de 62,3%, caracterizando-acomo um grave problema de saúde pública, reafirmandoa necessidade de medidas de controle eprevenção adequadas.Para se determinar a prevalência de anemia emuma população, levam-se em conta entre outrosfatores, a idade, a renda familiar e a escolaridade.A falta de saneamento básico, a precariedade geraldas condições de habitação de pessoas que vivemna periferia das cidades e na zona rural, concorrecom a produção, circulação e a infestação dasparasitoses intestinais e estas vão competir em nívelde absorção orgânica, com o ferro disponível nadieta, para a produção da Hb ( Palupi et al, 1997). Aassociação de enteroparasitoses com anemia, podecomprometer a função cognitiva, da habilidade parao aprendizado e até atraso do crescimento Monteiroet al ( 2000).Nas regiões onde há alta freqüência de parasitointestinal e a população vive com uma dieta pobrede ferro, a AF está sempre presente (Queiroz eTorres, 2000).Não foi observada anormalidade em relação aRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 93-10099

C. L. MOTTA et al.Tabela 3. Descrição da contagem dos valores mínimos de referência do Hematócrito por faixa etária, sexodos pacientes parasitadosFaixaetária n= 400Criança(1 a 12)< 35%Adolescentes(13 a 18) e Mulheres< 37%Homens < 40% Helmintos Protozoários H+PF M F M M F M F M F M1 a 6 8 16 0 0 0 3 5 3 3 1 17 a 12 7 4 0 0 0 3 0 2 2 0 013 a 18 0 0 21 1 0 10 0 7 1 5 0≥ 19 0 0 77 0 13 30 3 20 1 7 1Total 15 20 98 1 13 46 8 32 7 13 2% 3,75 5 24,5 0,25 3,25 11,5 2 8 1,75 3,25 0,5(H+P) = Helmintos + ProtozoáriosTabela 4. Freqüência de Parasitismo com os valores de referência baixo do Hematócrito e Hemoglobina, porfaixa etária, sexo dos pacientes atendidos no Posto UBS/PA MJ Sálvio BelotaFaixaEtárian = 400Hematócrito %Crianças 360 µg/dLSaturação da Transferrina< 16 %F M F M F M F M1 a 6 5 8 1 3 6 1 6 137 a 12 1 3 0 0 5 5 9 913 a 18 2 0 0 0 5 1 5 1≥19 21 3 11 0 14 5 34 4Total 29 14 12 3 30 12 54 27% 7,2 3,5 3 0,8 7,5 3 14 6,8100Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 93-100

ANEMIA FERROPRIVA E CORRELAÇAO COM PARASITOS INTESTINAISmedia percentual da concentração do Hematócritona população estudada, entretanto, registrou-sebaixa concentração na dosagem de Hemoglobina,em 32,5% do total dos pacientes, sendo que destes,38,46 foram crianças e adolescentes, podendo-seinferir que essas pessoas, podem ser diagnosticadascomo anêmicas. De acordo com a OMS, consideraseAF quando a concentração de hemoglobina estáabaixo de 12 g/dL (13 g/dL para homem, 12 g/dLpara mulher e 11g/dL para crianças entre 6 mesesa 6 anos). Em pesquisas realizadas em crianças,de outras regiões, foram encontrados diferentesresultados no total da população avaliada, tais como82,8% em Pernambuco, 65,6% em Porto Alegre,54,0 no Rio de Janeiro (Demayor et al, 1989).A dosagem de Ferritina, Transferrina e Saturaçãodo Ferro, são indicadores dos depósitos corporaisde Ferro. Embora tenha sido registrada aocorrência de pessoas com alterações na dosagemde Ferritina, a maioria da população estudada, apresentouníveis normais. O nível da Ferritina séricaé mais preciso como um marcador da deficiênciaou sobrecarga de ferro, não é sensível e específica,pelo fato de que além de refletir o estoque de ferrono organismo, também é uma proteína de fase aguda,podendo aumentar na inflamação aguda ou crônica,permitindo ainda, caracterizar a depleção dasreservas corporais de ferro (Silva e Santos, 2001).O registro de quatro pacientes com Hemoglobinanormal e Ferritina bastante diminuída, sugere umaindicação de um estado de depleção inicial dosdepósitos de Ferro, nesses pacientes, que ainda nãose refletiu na Hb. A correlação entre a presença deparasitos e a alteração nos níveis de Hemoglobinae Ferritina podem levar a Anemia. Nesse estudo,42,4% dos pacientes estavam com Ferritina alterada(≤ 12) e foram positivos para A. lumbricoides, E.histolytica, ancilostomídeos e E. vermicularis.Observou-se que 45,5% dos casos de parasitismoque podem causar anemia, como S. stercoralis,ancilostomídeos, G. lamblia, E. histolytica e T.trichiura, apresentaram Hb dentro da normalidade,porém com Ferritina muito baixa, < 10, sugerindoque esses pacientes apresentam Ferropenia semAnemia. Nesse caso é possível que com o decorrerdo tempo, se esses pacientes não forem tratados,possam desenvolver AF com alterações clínicolaboratoriais.Segundo Lorenzi (2003), os pacientes que apresentamFerritina ≤ 12, têm carência de Ferro, porém,casos de Ferritina entre 10 e 20 ng/mL, podemnão ser considerados verdadeiramente como casosdecorrentes de AF devido à possibilidade de Anemiater origem em outras causas, como as AnemiasInflamatórias, Síndromes Displásicas, Tumores ouainda casos de AF em recuperação medular. Nesseestudo foi observada a ocorrência de pacientes comdosagem de Ferritina em níveis anormais, negativosno diagnóstico de parasitos intestinais, nessecaso é provável que outra etiologia possa ser a responsávelpela manutenção desses níveis de Ferritina,entre 10 e 20.A freqüência de Anemia encontrada no presenteestudo foi inferior à estimativa da OrganizaçãoMundial de Saúde (OMS). Segundo Saloojee ePettifor (2001), em países subdesenvolvidos, metadedos casos de Anemia existentes em crianças egestantes, principais grupos vulneráveis, é decorrenteda deficiência de Ferro (AF). Admite-se quea ocorrência de AF na infância, seja provenienteda combinação de necessidades excepcionalmenteelevadas de Ferro, impostas pelo crescimento,dietas pobres nesse mineral e da alta freqüência deenfermidades infecto-parasitárias.A deficiência de Ferro ainda continua sendo umproblema de Saúde Pública, não só nos países emdesenvolvimento, como nos países desenvolvidos.No Brasil, segundo dados da OMS, estima-se que adeficiência de Ferro acomete cerca de 20% da populaçãofeminina e 5% da masculina, com tendênciasa ser mais elevadas nas regiões mais pobres,como o Norte e Nordeste (Cancado et al, 2001).REFERENCIAS1. ARAÚJO CF, FERNÁNDEZ CL. Incidência de enteroparasitosesem localidades atendidas pelo Comando daAeronáutica no Estado do Amazonas. RMAB. Jan/Dez.05; 55(1/2).2. BASHIRI A, BURSTEIN E, SHEINER E, MAZORM. Anemia during pregnancy and treatment withintravenous iron: review of the literature. European JObstrect Gynecol Reproductivel Biol. 2003; 110(1):2-7.3. CANTOS GA, DUTRA RL, HILSENDEGER T.Ocorrência de amostras intestinais em um laboratóriode Criciúma/SC. Rev NewsLab. 2003; 56: 78-87.4. CANÇADO RD, CHIATTONE CS, LANGHI DM.Deficiência de ferro em doadores de sangue. Rev BrasHematol Hemoter. 2001; 23(2): 108-109.5. CDC - CENTERS FOR DISEASE CONTROL ANDPREVENTION. Recommendations to prevent andRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 93-100101

C. L. MOTTA et al.control iron deficiency in the United States. MMWR1998, 47 (No. RP-3). Atlanta (GA): CDC; 1998.6. CHANDRA RK. Reduced bactericidal capacity ofpolymorphs in iron deficiency. Archives of Diseases inChildhood. 1973; 48: 864-866.7. DEMAYER EM, DALLMAN P, GURNEY JM, HA-LLBERG L, SOOD SK, SRIKANTIA SG. Preventingand controlling iron deficiency anemia through primaryhealth care: a guide for health administrators and programmemanagers. Geneva. World Health Organization.1989. 58 p.8. GRILO L P, CARVALHO L R, SILVA A C, VERRS-CHI ITN, SAWAYA AL. Influência das condiçõessócio-econômicas nas alterações nutricionais e na taxade metabolismo de repouso em crianças escolares moradorasem favelas no município de São Paulo. Rev AssocMed Bras. 2000; 46: 7-14.9. LORENZI TF. Manual de Hematologia Propedêutica eClínica. 3ª Ed. São Paulo, SP: Medsi; 2003.10. LUTZ, 1919, HOFFMAN WA, PONS JA & JANERJL, 1934. The Sedimentation concentration method inschistosomiasis mansoni. Journal Public Health, PuertoRico, 2: 283-298, 1934.11. MONTEIRO CC, SZARFARC SC, MONDINI L.Tendência secular de anemia na infância na cidade deSão Paulo (1984-1996). Rev Saúde Pub. 2000; 34(6):62-72.12. MOURA RA, WADA CS, PURCHIO A, ALMEIDATV. Técnicas de Laboratório. 3ª. Ed. São Paulo: EditoraAtheneu, 2004.13. NEVES MBP, SILVA EMK, MORAIS MB. Prevalênciae fatores associados à deficiência de ferro em lactentesatendidos em um centro de saúde-escola em Belém,Pará, Brasil. Cad Saúde Pública. Rio de Janeiro, novdez2005; 21(6): 1911-1918.14. PAIVA AA, RONDO PHC, GUERRA SSM. Parametersfor the assement of iron status. Rev Saúde Púb. 2000;34(4) 421-426.15. PALUPI L, SCHULTINK W, ACHADI E. Effectivecommunity intervention to improve haemoglobinstatus in pre-schoolers receiving once-weekly ironsupplementation. Am J Clin Nutr. 1997; 65: 1057-1061.16. QUEIROZ SS, TORRES MAA. Anemia ferropriva nainfância. J Pediat. 2000; 76(3): 298-304.17. SALOOJEE H, PETTIFOR JM. Iron deficiency andimpaired child development. Br J Nutr 2001; 323:1377-1378.18. SILVA LM, GIUGLIARI ERJ, AERTES DRGC.Prevalência e determinantes de anemia em criançasde Porto Alegre, RS, Brasil. Rev Saúde Publica. 2001;35(1): 21-26.19. SILVA CG, SANTOS HA. Ocorrência de parasitosesintestinais da área de abrangência do Centro de SaúdeCícero Idelfonso da Regional Oeste da PrefeituraMunicipal de Belo Horizonte, Minas Gerais. RevBiologia e Ciências da Terra. 2001; 1(1). ISSN 1519-5228.Agradecimentos: A FAPEAM-Fundação de Amparo a Pesquisano Amazonas, SEMSA-Secretaria Municipal de Saúde,FHEMOAM-Fundação de Hematologia e Hemoterapiado Amazonas, DIAGNOCEL Comércio e RepresentaçõesLtda, Laboratório Bioclínico e ABAM-Assessoria BioquímicaAplicada a Medicina, pelo apoio prestado na realizaçãodos testes laboratoriais. Aos professores, funcionários ealunos do Centro Universitário Nilton Lins, bem como todaa comunidade de Santa Etelvina e toda a equipe do Laboratóriodo Posto pela contribuição para a realização destapesquisa.102Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 93-100

Artículo OriginalRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 101-108Nematophagous fungi from Mexico with activityagainst the sheep nematode Haemonchus contortusACEVEDO-RAMÍREZ P.M.C. 1 , QUIROZ-ROMERO H. 1 , VALERO-COSS R.O. 2 ,MENDOZA-DE GIVES P. 2 and GÓMEZ J.L 31Departamento de Parasitología, Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Autónoma deMéxico UNAM.2Laboratorio de Helmintología, CENID-Parasitología Veterinaria, Instituto Nacional de Investigaciones Forestales,Agrícolas y Pecuarias, Jiutepec, Morelos.3Departamento de Bioquímica, Facultad de Medicina, UNAM.ABSTRACTThe use of nematophagous fungi (NF) is a biological control alternative for gastrointestinal parasiticnematodes (GIN) in ruminants. The aim to the present work was to isolate and to identify nematophagousfungi with potential predatory activity against Haemonchus contortus larvae (L 3) in some regions ofMexico. Two hundred and fifty-nine samples from the soil, roots and ovine, caprine, bovine and porcinefeces were collected from diverse zones of the country. Samples were transferred into agar plates,sprinkling technique was carried out and H. contortus L 3were used to determine in vitro nematophagousfungi predatory effect. Plates were incubated at room temperature and were revised under a stereoscopicmicroscope at 7, 14 and 28 days. The taxonomic identification revealed the presence of seven species ofnematophagous fungi: Arthrobotrys oligospora, A. musiformis, A. kirghizica, A. brochopaga, A. conoides,A. superba and Monacrosporium gephyropagum. This is the first report on the presence of A. kirghizica andM. gephyropagum in Mexico. All species had predatory effect against H. contortus L 3however, A. conoidesand M. gephyropagum showed the highest predatory activity with 93% and 83%, respectively.Key words: Nematophagous fungi, Arthobotrys, Monacrosporium, Haemonchus contortus.RESUMENEl propósito del presente trabajo fue aislar e identificar hongos nematófagos con potencial actividadcontra larvas 3de Haemonchus contortus en algunas regiones de México. Para ello se recolectaron 259muestras de suelos, raíces y excrementos de ovinos, caprinos, bovinos y porcinos en diferentes localidadesdel país. Estas muestras se transfirieron a placas Petri en delgadas capas y larvas 3de H. contortus se usaronpara determinar “in vitro” efectos nematófagos predatorios de hongos. Las placas Petri se incubaron atemperatura ambiente y se revisaron bajo microscopio estereoscópico a los 7, 14 y 28 días. La taxonomíaRecibido: 24 de Febrero de 2011. Aprobado: 08 de Mayo de 2001.Correspondencia: Av. Universidad 3000, Coyoacan, C.P. 04510, México D. F., México.Phone, fax : 52(55) 5622-5898.E-mail: hquiroz@unam.mx, pedromdegives@yahoo.com, perlacevedoram@hotmail.com103

P. M. C. ACEVEDO et al.reveló la presencia de 7 especies de hongos nematófagos Arthrobotrys oligospora, A. musiformis, A.kirghizica, A. brochopaga, A. conoides, A. superba y Monacrosporium gephyropagum. Este es el primerinforme de A. kirghizica y M. gephyropagum en México. Todas las especies tuvieron efecto predatoriocontra l 3de H. contortus, sin embargo, A. conides y M. gephyropagum mostraron la mayor actividadpredatoria con un 93% y 83% respectivamente.Palabras clave: Nematophagus fungi, Arthrobotrys, Monacrosporium, Haemonchus contortus.INTRODUCTIONGastrointestinal nematode (GIN) control isbased on the use of a therapeutic chemical strategy;nevertheless, the periodical and irrational useof anthelmintics, subtherapeutic doses administrationand short periods of applications, as well asthe scarce alternation of different family of drugs,have resulted in rapid appearance of parasites resistantto chemicals. Haemonchus is no the exception,there are resistant strains to bencimidazoles, imidazathiazolesand macrocyclic lactones, speciallyto ivermectin (Campos et al,1992; 2001; Torres etal, 2003; Encalada-Mena et al, 2008). Thus, the useof nematophagous fungi is a biological control alternativefor this parasite.Although in Mexico, some nematophagous fungispecies have been identified (Lappe and Ulloa,1982; Llerandi-Juarez and Mendoza de Gives,1998); it remains as fundamental to perform studiesthat allow to know adittional genera and species ofnematophagous fungi with potential against GIN ofruminants. The aim of this work was to isolate andto identify nematophagous fungi from diverse substratesof several localities in Mexico with predatoryactivity against H. contortus third stage larvae.MATERIAL AND METHODSArea of study. Material collection (soil, roots,and ruminant and pig feces) was carried out fromSeptember 2008 to June 2009 in several federalentities of Mexico (Morelos, Puebla, Veracruz,Estado de México, Guanajuato, Sinaloa, Hidalgoand Distrito Federal). Samples were collected andplaced into polyethylene bags for shipment andprocess at the laboratory.Sampling of different substrates for the isolationof nematophagous fungi. Samples consistingof soil, roots and ovine, bovine and caprine feceswere taken from the soil surface and from a depthof 5 cm. Samples were collected from different localitiesof Mexico (Table 1). The collected materialwas placed in separate sterile plastic bags, with itsrespective identification. They were sent to the laboratoryof Helmintology at CENID-PAVET and tothe Department of Parasitology at the Facultad deTable 1. Sampling collection site for predatory nematophagous fungi searchStudy areasJardines del Cenid-Pavet, Jiutepec, MorelosRancho Experimental Las Margaritas, Hueytamalco, PueblaCentro de Enseñanza, Investigación y Extensión en Ganadería Tropical(CEIEGT), Martínez de la Torre, VeracruzCentro de Enseñanza, Investigación y Extensión en Producción Agro-Silvo-Pastoril (CEiepasp), Chapa de Mota, Edo. de MéxicoCentro de Enseñanza, Práctica e Investigación en Producción y SaludAnimal (CEPIPSA); facultad de Estudios Superiores Zaragoza; TlapanSan Miguel de Allende, GuanajuatoFacultad de Veterinaria de la Universidad Autónoma de Sinaloa, Culiacán,SinaloaIxmiquilpan, HidalgoClimate (García 1987)SemiwarmWarm tropical rainWarm tropical rainTemplate cool and log summerTemplate cool and long summerDry, warm summerDry, cool summerDry, semiwarm104Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 101-108

NEMATOPHAGOUS FUNGI AGAINST HAEMONCHUS CONTORTUSMedicina Veterinaria y Zootecnia de la UniversidadNacional Autónoma de México for further analysis.Samples were stored at 4ºC until their processing(Su et al, 2007).Nematophagous fungi isolation. The soilsprinkling on water-agar plates technique describedby Barron, 1977 was used to isolate nematophagousfungi. Chloramphenicol (500 mg/L) was added tothe culture media to avoid bacteria growth. The assaywas done by duplicate. Seven days after seeding,an aqueous suspension with an undeterminednumber of H. contortus larvae was added, theywere incubated at room temperature for another7 days (Wyborn et al, 1969). For identification offungal structure (rings, nets, conidia) as well as thedetection of trapped nematodes, a stereoscopic microscopewas used for observation at 7, 14 and 28days of incubation.Taxonomic identification of nematophagousfungi. Fungi identification was carried out byobservation of morphometric characteristics undera light microscope. The taxonomic identificationcodes published by Cooke and Godfrey (1964), VanOorschot (1985) and Rubner (1996) were used.Sheep faecal cultures to obtain Haemonchuscontortus infective larvae. For the obtainment ofH. contortus larvae, fecal samples from a sheep,previously infected with H. contortus L 3,were used.Feces were collected and a coproculture preparedduring 10 days at room temperature. Afterwards,larvae were collected using Baermann fondle werestored at 4ºC until their use (Hendrix, 1999).Evaluation of the in vitro trapping capabilityof nematophagous fungi against Haemonchuscontortus third stage larvae. Each fungus specieswas grown into Petri dishes of 6 cm in diameterwith agar-water medium. Plates were incubatedfor 3 weeks at room temperature (25-28°C). Afterthis period, one hundred H. contortus infectivelarvae were placed on the surface of each plateand incubated for 5 days at room temperature.Ten replicates were made for each fungus species;besides, agar-water dishes without fungus wereplaced and used as control. After 5 days, the surfaceof the Petri dishes were scrapped with a spatulaand washed with distilled water and the liquidwas collected into assay tubes and refrigerated for2 hours at 4ºC to allow larvae migrate to the tubebottom. The volume of the tubes was adjusted to 2mL where larvae were found. Ten aliquots of 20 µLwere taken and the recovered larvae were countedwith the aid of a stereoscopic microscope.Data interpretation. Statistical analyses.Recovered larvae were counted and a capture percentagewas estimated. A non-parametric U-Mann-Witney test was carried out to identify trapping differencebetween species.RESULTSNematophagous fungi identification: FromFigure 1. Arthobotrys oligospora. A: conidia (40X). B. Trapped larva (40X)..Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 101-108105

P. M. C. ACEVEDO et al.Figure 2. Arthobotrys misifprmis. A: conidia (40X). B. Three-dimensional networks (10X).Figure 3. Arthobotrys kirghizica. A: conidia (40X). B. Three-dimensional networks (10X).Figure 4. Arthobotrys brochopaga. A: conidia, constrictor rings (10X). B. Trapped Haemonchus contortus (40X).106Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 101-108

NEMATOPHAGOUS FUNGI AGAINST HAEMONCHUS CONTORTUSFigure 5. Monacrosporium gephyropagum. A: conidia (40X). B: Scalariform net (40X).the total of 259 samples, in 29 (11.2%) it waspossible to isolate nematophagous fungi belongingto 7 species. All species showed predatory effectagainst H. contortus infective larvae. In Table2, the number of collected samples that resultedpositive to predatory nematophagous fungi andcorresponding species is summarized.In Figures 1-7, the different nematophagousfungi identified in different study areas of Mexicoare shown. The majority of the positive samplesfor nematophagous fungi were from warm weatherzones. In the temperate regions, positive sampleswere found only in the Distrito Federal. In the lat-Figure 6. Arthrobotrys superba conidia (40X).Figure 7. Arthrobotrys conoides A: conidia (40X). B: Trapped Haemonchus contortus in three-dimensional network(10X).Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 101-108107

P. M. C. ACEVEDO et al.Figure 8. Haemonchus contortus larvae 3 (L 3) trapping percentage by nematophagous fungi. Different species ofnematophagous fungi were in Petri dishes with agar-water (2%), at room temperature and after twenty-one days, 100 H.contortus L 3were added. Seven days later, the dishes were washed and the surface scrapped. Free larvae were collectedand trapping percentage was calculated.StudyareasTable 2. Nematophagus fungi isolation in different study areasPositives samples/ Total samplesSpeciesSamples1 1/10 ArthrobotrysBovine feces colected gardenoligospora (Figure 1)2 6/47 A. musiformis (Figure 2) Soil from garden, decaying soilfrom coffee, orange tree and mintpot3 6/33 A. oligosporaA. musiformisA. kirghizica (Figure 3)Monacrosporium sp4 0/555 2/34 Arthrobotrys spA. brochopaga (Figure 4)6 40/9 A. oligosporaMonacrosporium gephyropagum(Figure 5)A. superba (Figure 6)A. conoide (Figure 77 4/25 No identifiedSoil from garden, decaying soilDecaying soilSheep feces colected from soilSoil from gardenSheep feces with soilSoil from garden, compostSoil from gardenSoil from garden8 1/15 A. oligospora Soil from gardenTotal 29/259 (11,2%) 7 different speciester region, four different species were identifiedand the highest quantity of samples with predatorynematophagous fungi was recorded. A. oligosporawas the most frequent species observed, since it wasfound in several localities, followed by A. musiformis.A. brochopaga fungi (producer of constrictorrings) and A. kirghizica were identified in samplescollected from Sinaloa and Veracruz, respectively.A. superba, A. conoides and Monacrosporium gephyropagumwere recorded in the Distrito Federal.108Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 101-108

NEMATOPHAGOUS FUNGI AGAINST HAEMONCHUS CONTORTUSTrapping capability of nematophagous fungi:All the fungi species shown predatory effectagainst H. contortus infective larvae. There wasstatistical difference in trapping capability betweenspecies (P < 0.05). All species were different to thecontrol; there was no statistical difference betweenA. oligospora, A. kirghizica, A. brochopaga and A.musiformis, but A. conoides and M. gephyropagumstatistically differed from all other species (P

P. M. C. ACEVEDO et al.REFERENCES1. BARRON G. 1977. The nematode-destroying fungi.Canadian Biological Publications Ltd. Canada. 140 p.2. CAMPOS R, HERRERA D, QUIROZ R. 1992. Diagnósticoin vitro de Haemonchus contortus resistente alalbendazol, fenbendazol, oxfendazol y febantel en tresrebaños ovinos Tabasco o Pelibuey. Vet Mex 23, 51-56.3. COOKE RC, GODFREY BES. 1964. A key to the nematode-destroyingfungi. Transactions British MycologicalSociety. 47(1), 61-74.4. ENCALADA L, LÓPEZ M, MENDOZA P, LIÉBANOE, VÁZQUEZ V, VERA G. 2008. Primer informe enMéxico sobre la presencia de resistencia a ivermectinaen bovinos infectados naturalmente con nematodosgastrointestinales Vet. Méx. 39 (4).5. GARCÍA E. 1988. Modificaciones al sistema de clasificaciónclimática de Köppen. (Para adaptarlo a laRepública Mexicana). 4a ed. México.6. GONZÁLEZ-CRUZ M, MENDOZA DE GIVES P,QUIROZ-ROMERO H. Comparison of the trappingabililty of Arthrobotrys robusta and Monacrosporiumgephyropagum on infective larvae of Strongyloidespapillosus. J. Helminthol. 1998; 72: 209-213.7. HENDRIX CM. 1999. Diagnóstico ParasitológicoVeterinario. Harcourt-Brace. 2nd Ed. España.8. KELLY P, GOOD B, HANRAHAN J, FITZPATRICKR, WAAL T. 2009. Screening for the presence of nematophagousfungi collected from Irish sheep pastures.Vet. Parasitol. 165: 345-349.9. LAPPE P, ULLOA M. 1982. Hongos destructores denematodos en algunos suelos de México. Bol. Soc.Mex. Mic. 17, 99-113.10. LARSEN M, FAEDO M, WALLER P. 1994. Thepotential of nematophagous fungi to control the freelivingstages of nematode parasites of sheep: surveyfor the presence of fungi in fresh faeces of grazinglivestock in Australia. Vet. Parasitol. 53: 275-281.11. LLERANDI- JUÁREZ R, MENDOZA DE GIVES P.1998. Resistence of chamydospores of nematophagousfungi to the digestive processes of sheep. J. Helminthology.72: 209-213.12. RUBNER A. 1996. Revision of predacious Hyphomycetesin the Dactylella-Monacrosporium complex. Taxonomy.Studies in Micology. 39: 134 pp.13. SAXENA G, LYSEK G. 1993. Observation of nematophagousfungi in natural soils by fluorescence microscopyand their correlation with isolation. Mycol.Res. 97(8): 1005-1011.14. SAXENA G. 2008. Observations on the occurrenceof nematophagous fungi in Scotland. Applied soilecology. 39: 352-357.15. SU H, HAO Y, MO M, ZHANG K. 2007. The ecologyof nematodo-trapping hyphomycetes in cattle dungfrom three plateau pastures. Vet. Parasitol. 144: 293-298.16. TORRES J, ROBERTS B, CANTO J, MARTÍNEZC, RODRÍGUEZ J, CANUL L, COB L, TIRADO F,AGUILAR A. 2003. Prevalence of sheep herds withgastrointestinal nematodes resistant to benzimidazoles,imidazothiales and macrocyclic lactones in Yucatan. VInternational Seminar of Animal Parasitology, Yucatan,Mexico. 48-52.17. VAN OORSCHOT C. 1985. Taxonomy of the Dactylariacomplex V. A review of Arthrobotrys and alliedgenera. Studies in Micology, 26: 61-122.18. WALLER P, FAEDO M. The potential of nematophagousfungi to control the free-living stages of nematodeparasites of sheep: screening studies. Vet. Parasitol.1993; 49: 285-297.19. WYBORN CHE, PRIEST D, DUDDINGTON CL.1969. Selective technique for the determination ofnematophagous fungi in soils. Soil Bid. Eiochem. 1,101-102.Acknowledgements: Special thanks to CONACYT for thescholarship granted to Perla Maria del Carmen Acevedo-Ramirez, to Dr. Enrique Liebano for to provide H. contortusL 3and to Ana Arana Contreras, Esau Villarreal Olvera,Karina Leon Lopez and Elvia Lopez Martinez for their kindcollaboration in the collection and handling of samples.110Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 101-108

Experiencia ClínicaRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 109-113Hallazgo de infección por nematodos delgénero Thelazia (Boso, 1819) en un perrode Salamanca (España)DACAL V. 1 , VÁZQUEZ L., PATO F.J., FRANCISCO I., CAZAPAL-MONTEIRO C., ROMASANTA A.,ARIAS M.S., PANADERO R., DÍEZ-BAÑOS P., MORRONDO P., PAZ-SILVA A. y SÁNCHEZ-ANDRADE R.1Parasitología y Enfermedades Parasitarias, Departamento de Patología Animal, Facultad de Veterinaria de Lugo,Universidad de Santiago de Compostela, 27002-Lugo (España).ABSTRACTFINDING OF THE THELAZIA NEMATODE IN A DOG FROM SALAMANCA; SPAINHerein the case of one dog from San Martín del Castañar (Salamanca, Spain) with itching in the lefteye which provoked a frequent scratching is presented. By the ocular examination five white worms inthe conjunctival sac were observed, and collected by means of a forceps after anaesthesia. The stainingwith cotton-blue lactophenol allowed the identification of the worms as belonging to the genus Thelaziaspp. The presence of embryonated eggs in the uterus indicated all the specimens were females, hypothesissupported by the absence of the cloacal papilles belonging to the males. This finding underlines the need fortaking into account the infection by Thelazia in the differential diagnosis of ocular troubles affecting dogs,especially during the summer periods.Key words: Thelazia, dog, Spain, ocular itching.RESUMENSe presenta el caso de un perro de la localidad de San Martín del Castañar (Salamanca, España) quemanifestaba prurito en el ojo izquierdo, que trataba de mitigar con el rascado continuo de la región ocular.La inspección ocular reveló la presencia de 5 nematodos de color blanquecino en el saco conjuntival, quefueron extraídos con ayuda de unas pinzas previa anestesia. Tras su obtención y tinción con lactofenol azulde algodón, se observó una cápsula bucal con una apertura hexagonal que condujo a su identificación comoejemplares del género Thelazia spp. La observación de huevos embrionados en el útero reveló que todoslos ejemplares eran hembras, aspecto que se corroboró por la ausencia de las papilas cloacales propias delos machos.Este hallazgo indica la necesidad de tener en cuenta la infección por Thelazia en el diagnósticodiferencial de trastornos oculares que aparezcan en cánidos, en especial en los períodos estivales.Palabras clave: Thelazia, cánidos, España, prurito ocular.Recibido: 21 de Noviembre de 2010. Aceptado: 23 de Marzo de 2011.Correspondencia: Sánchez-Andrade R.E-mail: rita.sanchez-andrade@usc.es111

V. DACAL et al.INTRODUCCIÓNLa thelaziosis es una infección causada por parásitosnematodos de la superfamilia Thelazioidea,género Thelazia (Spirurida: Thelaziidae), cuyaslarvas son depositadas por moscas en la cavidadesorbital, saco conjuntival o conjuntiva de diferentesespecies de mamíferos silvestres y domésticos (cánidos,félidos, rumiantes y équidos), e incluso deseres humanos (Otranto y Traversa, 2005).Los parásitos se transmiten de un animal a otro,o del animal al hombre, por diversas especies demoscas que pueden actuar como hospedadoresintermediarios, por este motivo, la propagación deesta infección es de tipo estacional y se producecuando hay abundancia de vectores.Se han identificado varias especies de Thelaziaen los sacos conjuntival y lagrimal de mamíferos.T. callipaeda (Railliet y Henry, 1910) transmitidapor Phortica variegata que infecta carnívoros yhumanos (Otranto et al, 2006).Los ejemplares machos de T. callipaeda tienenuna longitud de 7-12 mm, y las hembras 7-17 mm.(Otranto et al, 2006). Se han encontrado L-1 de T.callipaeda en las secreciones lagrimales de perrosinfectados de forma natural, esencialmente duranteel periodo estival, época que facilita el vuelo delas moscas y con ello la ingestión de larvas aldepositarse alrededor de los ojos y alimentarse desecreciones (Otranto et al, 2006). Los parásitos seobservan como hilos blancos en la conjuntiva o elsaco conjuntival.El ciclo se caracteriza porque las hembras depositanhuevos embrionados en el saco conjuntival delos mamíferos, donde eclosionan las larvas de primerestadio y se sitúan sobre la conjuntiva ocular,siendo ingeridas por moscas cuando se aproximanpara succionar las secreciones conjuntivales que lessirven de alimento.En el interior del hospedador intermediariotienen lugar dos mudas, y los nematodos alcanzanla fase infectiva de larva de tercer estadio (L-3),que migra hacia la probóscide de las moscas y esdepositada en el saco conjuntival cuando estosinsectos merodean por las proximidades del ojode nuevos hospedadores, y tras un periodo de 2-3semanas completa su desarrollo hasta adulto ycomienza la oviposición (Otranto et al, 2004).La presencia de formas larvarias y adultas delgénero Thelazia provocan la aparición de una seriede signos subclínicos o clínicos como lagrimeo ehipersecreción ocular, debido a la presencia depequeñas espinas cuniculares que posee dichonematodo, responsables del daño mecánico enla conjuntiva y en el epitelio de la córnea. Comoresultado se originan alteraciones oculares entrelas que destacan conjuntivitis, queratitis, opacidadcorneal y úlceras. Es importante tener en cuenta quela hipersecreción ocular estimula la aproximaciónde nuevos ejemplares de moscas que acuden aalimentarse, facilitando de este modo la difusión delas larvas de primer estadio (L-1) y la continuidaddel ciclo de Thelazia.En el hombre estos nematodos se alojan en elsaco conjuntival y causan irritación, lagrimeo,conjuntivitis, que en ocasiones evolucionan haciala escarificación de la córnea e incluso su opacidad(Doezie et al, 1996; Cheung et al, 1998); noobstante, algunas infecciones se manifiestan sólopor sensación molesta como de cuerpo extraño enel ojo.En otros animales, el parásito se aloja bajola membrana nictitante y la sintomatología essimilar. La conjuntivitis se agrava muchas vecespor el prurito, que obliga a los animales a frotarsecontinuamente con la pata o contra diferentesobjetos. Las lesiones cornéales son más comunesen los animales que en el hombre, aunque no estábien establecido si se deben a los parásitos o aotras causas concurrentes. La intensidad del cuadroclínico es muy variable y depende de la especie deThelazia, siendo T. rhodesii que afecta a ruminatesy es transmitida por Musca autumnalis la máspatógena (Geden y Stoffolano, 1982).CASO CLÍNICOEn septiembre de 2010, se recibió en una clínicaveterinaria de Salamanca un perro macho adultode raza mestiza, de 11 años y 7 kg de peso, queresidía en la localidad de San Martín del Castañar(Salamanca, España).Al realizar la anamnesis se averiguó que desdehacía tres días el perro experimentaba un intensoprurito, que le llevaba a rascarse el ojo izquierdocon las extremidades anteriores de forma reiterada.Se trataba de un cánido que residía en casa consus dueños, y que no convivía con ganado vacuno,aunque acudía con frecuencia al Pico Cervero112Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 109-113

INFECCIÓN POR THELAZIA EN UN PERRO DE SALAMANCA (ESPAÑA)Figura 1. Localización geográfica de la procedencia del caso descrito.(Peña de Francia; 1.700 metros sobre el nivel delmar), acompañando a su propietaria en su trabajode vigilancia contra-incendios en la comarca.(Figura 1).En esta zona situada al sur de la provincia deSalamanca no hay ganado doméstico, aunque enlas proximidades se han detectado abundantespoblaciones de cabra montés (Capra pyrenaica),corzo (Capreolus capreolus) y jabalí (Sus scrofa).La exploración ocular de la mascota mostró laexistencia de 5 nematodos de color blanquecino(Figura 2), con una longitud media de 14-20 mm.No se apreciaron otras alteraciones clínicas.Debido al carácter agresivo del perro fuenecesaria la sedación con medetomidina (0,03 ml/kgi.m.), se realizó una preanestesia con buprenorfina(0,02 ml/kg i.m.), y anestesia con ketamina(0,05 ml/kg i.m.), tras la cual se extrajeron losnematodos con unas pinzas. Con el fin de reducir laconjuntivitis se aplicó una solución de gentamicinay dexametasona.Una vez extraídos los nematodos se preservaronen etanol al 70%, se enviaron al laboratorio deParasitología y Enfermedades parasitarias de laFacultad de Veterinaria de Lugo (Universidad deSantiago de Compostela), donde se procedió a sutinción con lactofenol azul de algodón al 0,1%, yposteriormente a su identificación al microscopio,siguiendo las claves morfológicas descritas porSkrjabin et al (1967).Dificultades surgidas por el deterioro de losFigura 2. Ejemplar de Thelazia en el ojo de un perro enSalamanca (España).nematodos y por su reducido número impidieronla identificación de la especie, pero su tamaño, lapresencia de una cápsula bucal con una apertura enforma hexagonal (Figura 3) posibilitó su inclusiónen el género Thelazia (Skrjabin et al, 1967). Laobservación de huevos embrionados en el útero(Figura 4) indicó que todas eran hembras, aspectoque se corroboró con la ausencia de las papilascloacales propias de los machos.La combinación de moxidectina con imidaclopridspot on se considera un tratamiento de elecciónpara la thelaziosis canina (Bianciardia y Otranto2005); no obstante, una vez realizado el diagnósticoetiológico, el veterinario clínico consideró apropiadala administración de ivermectina (250 mg/kgRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 109-113113

V. DACAL et al.Figura 3. Detalles de la cápsula bucal de la hembra deThelazia recuperada del saco conjuntival de un perroen Salamanca (España). Nótese el borde serrado de lacutícula, responsable del daño mecánico.Figura 4. Imagen de la hembra de Thelazia recuperadadel saco conjuntival de un perro en Salamanca (España),que presenta en el interior del útero huevos embrionadoscon larvas 1 en su interior.p.v.) de forma subcutánea. El seguimiento del perrodurante 10 días mostró una evolución favorable, ylos síntomas iniciales remitieron completamente.DISCUSIÓNUna gran parte de las afecciones oculares de losperros cursan con alteraciones como hipersecreción,lagrimeo o conjuntivitis. Aunque las conjuntivitisno suelen ser dolorosas, sí pueden producirmolestias, que los animales manifiestan por dificultadespara mantener los ojos abiertos. En ocasiones,también cursa con prurito, que tratan de mitigar conel rascado continuo de la región ocular.Las infecciones oculares en perros están ocasionadaspor diversos agentes etiológicos, entre ellosciertos hongos (principalmente Aspergillus sp., Fusariumsp., Mucor sp. y Candida sp.). En cachorros,el virus del moquillo puede producir conjuntivitis,al igual que ciertos parásitos como Leishmania spp.o Ehrlichia spp. Cabe destacar que como en laspersonas, los cánidos pueden presentar conjuntivitisalérgicas debido a agentes ambientales (polen,determinadas plantas, etc.). También pueden cursarcon conjuntivitis otro tipo de alergias, como las alimentarias(ingestión de determinados alimentos) olas alergias por contacto (por contacto con algunosproductos de limpieza).Por todo ello, la colaboración del propietarioresulta imprescindible para identificar la posiblecausa de la afección ocular. Es importante registrarla historia clínica para comprobar su posiblecoincidencia con alguna salida al campo, con laintroducción de una planta nueva en la casa, conel empleo de nuevos productos de limpieza, u otrascircunstancias que pueden justificar la alteraciónocular.En el caso que se describe, la estacionalidaddificulta el diagnóstico de la parasitosis, dado que enprimavera y verano es muy frecuente la presentaciónde alergias por inhalación a alérgenos ambientalesen individuos potencialmente alérgicos. Tambiénes importante tener en cuenta que la thelaziosispuede cursar de forma asintomática, y que lasmanifestaciones clínicas dependen del númerode nematodos presentes en el ojo, localización,respuesta inmunitaria del hospedador, y sobre todode posibles infecciones secundarias por bacterias(Pasteurella spp., Chlamydia spp. y Staphylococcusspp.).La mayoría de los casos de thelaziosis canina sehan diagnosticado en países europeos como Italia(Otranto et al, 2003), Francia (Dorchies et al, 2007)o Alemania (Hermosilla et al, 2004). En España,recientemente se ha detectado en Andalucía (Guisadoy Sanz, 2010) y en la región de la Vera (nortede Cáceres) (Montoya et al, 2011). En este últimocaso, el empleo de la técnica PCR permitió identificarlos ejemplares como T. callipaeda.El hallazgo de la infección por nematodos deThelazia en un perro (Canis familiaris) oriundo deSalamanca (España) indica que esta parasitosis hade tenerse en cuenta en el diagnóstico diferencial114Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 109-113

INFECCIÓN POR THELAZIA EN UN PERRO DE SALAMANCA (ESPAÑA)de trastornos oculares de los cánidos, sobre todoen los periodos estivales. Aunque Montoya et al,(2011) manifestaron que en España los perros conthelaziosis podían tener dos orígenes: a) presenciade canes infectados procedentes de zonas endémicas(Francia e Italia) que habían venido a pasarperíodos estivales a la región de La Vera, o b) perrosque viajaron a zonas endémicas de otros paísesdel sur de Europa. En el caso que nos ocupa, no secumple ninguno de estos supuestos, lo que destacala necesidad de realizar más estudios epidemiológicosen nuestro país.REFERENCIAS1. BIANCIARDI P, OTRANTO D. (2005). Treatment ofdog thelaziosis caused by Thelazia callipaeda (Spirurida,Thelaziidae) using a topical formulation of imidacloprid10% and moxidectin 2.5%.Vet Parasitol 129:89-93.2. CHEUNG WK, LU HJ, LIANG CH, PENG ML,LEE HH. (1998). Conjunctivitis caused by Thelaziacallipaeda infestation in a woman. J Formos MedAssoc. 97: 425-427.3. DOEZIE AM, LUCIUS RW, ALDEEN W, HALED V, SMITH DR, MAMALIS N. (1996). Thelaziacaliforniensis conjunctival infestation. OphthalmicSurg Lasers. 27: 716-719.4. DORCHIES PH, CHAUDIEU G, SIMEON LA, CA-ZALOT G, CANTACESI C, OTRANTO D. (2007).First reports of autochthonous eyeworm infection byThelazia callipaeda (Spirurida, Thelaziidae) in dogsand cat from France. Vet Parasitol 149: 294-207.5. GEDEN CJ, STOFFOLANO JG. (1982). Developmentof the bovine eyeworm. Thelazia gulosa Railliet andHenry, in experimentally infected female Musca autumnalis.De Geer. J. Parasitol. 68: 287-292.6. GUISADO A, SANZ F. (2010). Conjuntivitis en unperro por Thelazia callipaeda. 6º Congreso Andaluzde Veterinarios. Benalmádena (Málaga, España), 5 denoviembre.7. HERMOSILLA C, HERMANN B, BAUER C. (2004).First case of Thelazia callipaeda infection in a dog inGermany. Vet Rec 154: 568-569.8. MONTOYA A, VÁZQUEZ MV, PULIDO P, HER-NÁNDEZ L, DADO D, OTRANTO D, MIRÓ G.(2011). Thelaziosis ocular canina. ¿Una parasitosisemergente en España? Consulta Difus Vet 178: 43-48.9. OTRANTO D, TRAVERSA D. (2005). Thelazia eyeworm:an original endo and ecto-parasitic nematode.Trends Parasitol 21:1-4.10. OTRANTO D, LIA RP, TRAVERSA D, GIANETTO,S. (2003). Thelazia callipaeda (Spirurida, Thelaziidae)of carnivores and humans: morphological study bylight and scanning electron microscopy. Parassitologia45: 125-133.11. OTRANTO D, LIA RP, BUONO V, TRAVERSA D,GIANGASPERO A. (2004). Biology of Thelazia callipaeda(Spirurida, Thelaziidae) eyeworms in naturallyinfected definitive hosts. Parasitol 129: 627-633.12. OTRANTO D, CANTACESSIA C, TESTINIA G,LIAA RP. (2006). Phortica variegata as an intermediatehost of Thelazia callipaeda under natural conditions:Evidence for pathogen transmission by a male arthropodvector. Int J Parasito l36: 1167-1173.13. SKRJABIN KI, SOBOLEV AA, IVASHKIN VM.(1967). Principles of Nematology, vol. IX. Spirurata ofAnimals and Man and the Disease Caused by Them.Part. 4: Thelazioidea. Izdatel’stvo Akademii Nauk SSSR,Moscow, 1967. English translation Published by IsraelProgram for Scientific Translations, Jerusalem, 1971.Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 109-113115

Experiencia ClínicaRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 114-118Infestación múltiple por ácaros ectoparásitosen conejos de crianzaCALDERÓN-ARGUEDAS O. 1 , TROYO A. 1 , AVENDAÑO A. 1 , AYMERICH R. 2 ,BERROCAL B. 3 y COTO-MORALES T. 21Centro de Investigación en Enfermedades Tropicales (CIET), Departamento de Parasitología, Facultad deMicrobiología, Universidad de Costa Rica (UCR).2Laboratorio de Ensayos Biológicos, Vicerrectoría de Investigación (UCR).3Médico Veterinario.ABSTRACTmultiple infestation by ectoparasitic mites in breeding rabbitsSix breeding rabbits (New Zealand strain) were observed with crusted and pruritic dermal lesions.These lesions were located predominantly in ears, nose, nails and feet. Dermal material collected byscraping showed the presence of three species of mange producer acari: Sarcoptes scabiei var. cuniculi(Acaridida: Sarcoptidae, Psoroptes cuniculi (Acaridida: Psoroptidae), and Cheyletiella parasitivorax(Actinedida: Cheyletiellidae). In addition, rabbits were also infested with Leporacarus gibbus (Acaridida:Listrophoridae).The infestation of rabbits by each of these etiologic agents individually is currentlycommon, but multiple infestation is rare and strongly exacerbates symptoms.Key words: Sarcoptes scabiei, Psoroptes cuniculi, Cheyletiella parasitivorax, Leporacarus gibbus,rabbits.ResumenSeis conejos de crianza de la cepa New Zealand fueron observados con un cuadro dérmico descamativo,altamente prurítico con lesiones severas en orejas, nariz, uñas y patas. Material colectado por raspadopermitió el diagnóstico de tres especies de ácaros ectoparásitos productores de sarna: Sarcoptes scabiei var.cuniculi (Acaridida: Sarcoptidae), Psoroptes cuniculi (Acaridida: Psoroptidae) y Cheyletiella parasitivorax(Actinedida: Cheyletiellidae). Adicionalmente los conejos estuvieron infestados con ácaros de la especieLeporacarus gibbus (Acaridida: Listrophoridae). Si bien es cierto estos cuatro agentes etiológicos sonrelativamente comunes en lo que respecta a infestar conejos, la infestación múltiple constituye un eventorelativamente raro, generando una marcada exacerbación de la sintomatología.Palabras clave: Sarcoptes scabiei, Psoroptes cuniculi, Cheyletiella parasitivorax, Leporacarus gibbus,rabbits.Recibido: 4 de Septiembre de 2010. Aprobado: 15 de Marzo 2011.Correspondencia: Olger Calderón ArguedasE-mail: olger.calderon@ucr.ac.cr116

INFESTACIÓN MÚLTIPLE POR ÁCAROS EN CONEJOS DE CRIANZAIntroducciónLos conejos son animales utilizados por el serhumano en diferentes ámbitos de su vida cotidiana.La crianza de conejos ha sido una actividad parala procura de pieles y carne. También estos animaleshan sido utilizados como animales de compañía(Mederle, 2010).Existen diversas enfermedades infecciosas queafectan comúnmente a este grupo de animales;dentro de ellas son frecuentes la pasteurelosis, lamicrosporidiosis por Encephalitozoon cuniculi, ylas parasitosis por coccidios (González et al, 2005;Smith et al, 2009). Con respecto a los ectoparásitos,las garrapatas Haemaphysalis leporispalustris, H.longicornis, Hyaloma marginatum e Ixodes ricinus(Ixodida: Ixodidae) se destacan como los más frecuentes( González et al, 2005).Diversos ácaros también han sido asociados conla infestación de conejos. Posiblemente los más comunescorresponden a Sarcoptes scabiei var. cuniculiy Notoedres mange (Acaridida: Sarcoptidae),los cuales pueden generar infestaciones subdérmicasen las que las hembras grávidas excavan galeríasen el estrato córneo de la piel donde colocan sushuevos (Mullen et al, 2002). También son comunesPsoroptes cuniculi (Acaridida: Psoroptidae), agenteproductor de sarna superficial costrosa, altamenteprurítica y localizada preferencialmente en lasorejas (Lapage, 1983) y Cheyletiella parasitivorax(Actinedida: Cheyletiellidae), que se ha vinculadocon procesos irritativos dérmicos, prurito, alopeciay descamación (Mederle, 2010). Los ácaros de lafamilia Listrophoridae han sido considerados pormuchos como comensales, sin embargo, los del géneroLeporacarus también se han relacionado concuadros pruríticos y de pérdida de pelo en conejos(Mullen et al, 2002).Aunque las infestaciones por ácaros, suelendarse comúnmente de forma individual de acuerdoal agente etiológico, en el presente informe sepresenta la descripción de un cuadro clínico coninfestación múltiple por este tipo de ectoparásitos.Materiales y métodosSeis conejos de la Cepa New Zealand de tresmeses de edad fueron observados con lesiones dérmicasseveras localizadas predominantemente enla cara interna y externa de las orejas, nariz, uñasy patas (Figura 1). Estos conejos fueron obtenidosde un sistema de crianza semiabierta y luego fueronconfinados a una unidad de bioterio donde permanecieronen jaulas de acero inoxidable cuyas dimensionesson 50 cm de alto, 45 cm de ancho y 60 cmde fondo. Se les suministró además agua y alimentoad libitum. Una muestra de material descamativofue tomada mediante raspado dérmico y procesadode acuerdo a la metodología descrita por Calderón ySánchez (1995). El material fue colocado en tubosde ensayo de 13 x 100 y se suspendió en 3,0 mL deKOH al 10%. Dicha suspensión fue calentada suavementepor cinco minutos y de seguido se agregósolución saturada de azúcar hasta 1,0 cm antes delborde del tubo. La suspensión se centrifugó a 4 000RMP por 15 minutos y el material del sobrenadantefue transferido a placas de Petri. De éste se tomaronácaros para su evaluación por microscopia de luz.Dichos ácaros fueron colocados en medio Hoyercomo medio de aclaración y montaje.Algunos ácaros presentes en pelos fueron colectadosdirectamente del animal utilizando pinzasy montados en el mismo medio para su evaluación.La identificación de los ejemplares se realizó deacuerdo a la clave de Pratt y Stojanovich (1969) y alas descripciones de Kirwan et al, (1998).ResultadosEl cuadro clínico observado en los conejos fueel típico de una dermatosis altamente descamativa.Las lesiones observadas en orejas fueron las másextensas. Éstas fueron hiperqueratósicas, con ampliaszonas de alopecia y descamación (Figura 1).La nariz se observó seca con su cara dorsal endureciday levantada (Figura 1). Las patas tuvieron lesionesdiscretas en las almohadillas (Figura 1). Enellas se advirtió la ocurrencia de zonas de sangradoposiblemente ocasionadas por rascado. Adicionalmentefue posible observar distrofia de las uñas(Figura 1). El análisis de los ácaros encontrados enel material descamativo permitió la identificaciónde tres especies de ectoparásitos: Sarcoptes scabieivar. cuniculi, P. cuniculi y Ch. parasitivorax (Figura2). Los ácaros obtenidos puntualmente de lospelos correspondieron a ácaros listrofóridos de laespecie Leporacarus gibbus (Figura 2). S. scabieivar. cuniculi se encontró en una mayor abundan-Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 114-118117

O. CALDERÓN et al.Figura 1. Lesiones costrosas observadas en los conejos. a: cara interna de pabellón auricular, b: nariz, c: uñas, d: caraventral de las patas.cia que las otras especies observadas. De este ácarose pudo observar, huevos, larvas, ninfas, adultos ymaterias fecales en todas las zonas con lesiones.Una vez conocido el diagnóstico, los conejosfueron tratados con Ivermectina (0,3 mg/Kg por semana)y con Amitraz® como tratamiento tópico.DiscusiónLos conejos, al igual que otras especies de mamíferos,pueden sufrir problemas dérmicos cuyaetiología se encuentra asociada con diversas especiesde ácaros parásitos. En el presente reportese informa sobre una infestación simultánea porácaros de diferentes especies, pero que tienen encomún su modo de transmisión. En este caso elcontacto directo entre hospedadores sanos e infestadosresulta fundamental para la propagación deeste tipo de agentes etiológicos Mullen et al, 2002).Las orejas fueron los sitios donde se manifestaronlas lesiones más extensas. P. cuniculi se relacionaclásicamente con lesiones costrosas en orejas deconejos; sin embargo el análisis de las muestrasobtenidas a partir de estas lesiones permitió observar,en su mayoría, ácaros de la especie S. scabiei118Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 114-118

INFESTACIÓN MÚLTIPLE POR ÁCAROS EN CONEJOS DE CRIANZAFigura 2. Ectoparásitos identificados en los conejos: a: Sarcoptes scabaiei var. cuniculi (barra = 37 mm), b: Psoroptescuniculi (barra = 100 mm) c: Cheyletiella parasitivorax (barra = 80 mm), d: Leporacarus gibbus (barra = 60 mm).var cuniculi. Estos ácaros estuvieron en muy altaabundancia. En el ser humano, S. scabiei se puederelacionar con un cuadro hiperqueratósico y descamativosimilar denominado “escabiosis noruega”o “escabiosis costrosa” la cual se caracterizapor una exacerbación en las poblaciones de estosácaros (Green, 1989). En perros han sido descritoscuadros similares asociados con S. scabiei var.canis (Anderson, 1981). Este tipo de infestacionesse han relacionado con disfunciones en el sistemainmunológico o con problemas neurológicos enlos hospedadores que sufren la afección (Green,1989). En el caso presentado no se realizó ningunainvestigación para determinar el estatus fisiológicoo inmunológico de los conejos, sin embargo, elestrés asociado con su papel como animales de experimentaciónpodría haber generado afectación dela fisiología normal facilitando la proliferación deestos ectoparásitos.La nariz fue otro de los sitios donde se pudieronobservar alteraciones tisulares evidentes. Por logeneral la nariz y los labios son los sitios dondesuelen ocurrir las lesiones primarias en la infestaciónpor S. scabiei var. cuniculi (Millán, 2010). EnRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 114-118119

O. CALDERÓN et al.los conejos estudiados, la cara dorsal de la nariz seobservó hiperqueratósica y endurecida generándoseuna especie de coraza sobre la misma (Figura 1).Este tipo de lesiones también han sido observadasen conejos silvestres (Orytolagus cuniculus) infestadospor S. scabiei (Millán, 2010).En las patas las lesiones tuvieron lugar en almohadillasdonde se observaron francas excoriacionesy además tuvo lugar el fenómeno de distrofia delas uñas (Figura1). Este fenómeno es muy poco frecuenteen conejos y ha sido explicado como un resultadode la disminución en el desgaste natural porfalta de uso; esto debido a una decaimiento en elestado general del hospedador (Millán, 2010). Estaexplicación, aunque puede ser válida, no explicacompletamente este hallazgo, ya que en seres humanoscon escabiosis noruega también se ha observadoel fenómeno de distrofia de la uñas (Calderóny Sánchez, 1995). Este fenómeno puede obedecera una respuesta fisiológica a la infestación, que dacomo resultado un aumento en la producción dequeratina. De hecho, el fenómeno de hipertricosis,en el cual se da un aumento en la producción depelo, ha sido observado también en conejos infestadoscon S. scabiei (Millán, 2010).Cheyletiella. parasitivorax se observó en muchomenos cantidad que S. scabiei var. cuniculi y P. cuniculi.Este ácaro vive en la capa de queratina de lapiel pero no forma surcos como S. scabiei. Ha sidorelacionado con la ocurrencia de dermatitis exfoliativapruriginosa no supurativa, cuadro conocido poralgunos como “caspa caminante” (Jofré et al, 2009).Otros ectoparásitos encontrados fuero ácarosde la familia Listrophoridae de la especie L. gibbuslos cuales fueron observados de forma evidente enel dorso de los animales y sobre las patas traseras.Algunos autores han asociado este ácaro con la ocurrenciade alopecia, dermatitis húmeda y prurito. Sinembargo su estatus como parásito o comensal no hasido completamente dilucidado (Kirwan et al, 1998).El manejo de animales como los referidos suponeun riesgo para el personal que manipula dichosanimales, ya que si bien es cierto, estos ectoparásitosson especie específica en lo que respecta alhospedador pueden generar cuadros transitorios dedermatitis en humanos que ciertas ocasiones llegana ser relativamente prolongados (Thomsett, 1968;Jofré et al, 2009;).El tratamiento con Ivermectina ha sido indicadocomo el de elección para este tipo de afecciones(Mederle, 2010). Como en otros estudios (Mederle,2010), la aplicación de Ivermectina intramuscularcon Amitraz® como agente tópico resultó efectivapara tratar la infestación y a las cuatro semanas deiniciado dicho tratamiento prácticamente hubo unaremisión completa de los ácaros así como de laslesiones.Referencias1. Anderson RK. Norwegian scabies in a dog: A casereport. J. Am Animal Hosp Ass 1981; 17: 101-104.2. Calderón O, Sánchez C. Diagnóstico de demodicosiscanina mediante cuatro métodos parasitológicos.Rev. Ciencias Ves 1995; 18: 65-69.3. Calderón O, Sánchez C. Análisis de las poblacionesde Sarcoptes scabiei (Acaridida:Sarcoptidae) enun paciente con Escabiosis Noruega de Costa Rica. Parasitolgíaal día 1995; 19: 57-60.4. González-Acuña D, Rebolledo P, SkewesO, Moreno L, Castro D. Parásitos de la liebre (Lepuseuropeus Pallas, 1778): estudio en dos zonas geográficasde Chile. Parasitol Latinoam 2005; 60: 174-177.5. Green M. Epidemiology of scabies. Epidemiol Rev1989; 11: 127-150.6. Jofré L, Noemí I, Neira P, Saavedra U, DíazL. Acarosis y zoonosis relacionadas. Revista Chilenade Infectología 2009; 26: 248-257.7. Kirwan A, Middleton PB, McGarry JW.Diagnosis and prevalence of Leporacarus gibbus in thefur of domestic rabbits in the UK. Vet Rec 1998; 142:20-21.8. Lapage G. Parasitología Veterinaria. CIA editorialcontinental, SA: De C. V., México. México D. F. 1983.790 pp.9. Mederle N. Parasitical identification of Cheyletiellain a rabbit breeding farm. Lucrari stiitinfice medicinaveterinaria 2010; XLIII: 57-60.10. Millan E. First description of sarcoptic mange inwild European rabbit (Oryctolagus cuniculus). EuropJ. Wld Res. 2010; 56: 455-457.11. Mullen GR, Oconnor BM. Mites (Acari). En:Mullen GR, Durden L. Medical and VeterinaryEntomology. Academic Press. London. 2002. 587 pp.12. Pratt HD, Stojanovich J. Acarina: Illustratedkey to some common adult female mites and adultticks. En: Pictorial Keys to Arthorpod, reptiles, birdsand mammals of public health significance. US DeptHealth, Education and Welfare. 1969. 192 pp.13. Smith MH, Meeham CL, Ma JM, HisakawaN, Dasher HS, Camarillo JD, Techanum J.Rabbit disease: What you need to know. University ofCalifornia. Agricul Natl Resour. Pub 8377. 2009. 48 pp.14. Thomsett LR. Mite infestations of man contractedfrom dogs and cats. Br. Med J 1968; 3: 93-95.Agradecimientos: Deseamos agradecer a la Sección de ExtensiónDocente de la Vicerrectoría de Acción Social de la Universidadde Costa Rica por su apoyo logístico al proyecto ED 548.120Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 114-118

ComunicacionesRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 119-121Primer reporte de Dracunculus spp.en la provincia de Santa Fe ArgentinaBONO BATTISTONI M. F. 1 , ORCELLET V. 1 , PLAZA D. 1 , GUTIERREZ G. 1 , CIEPIELAK M. 2 y PERALTA J. L. 11Cátedra de Parasitología, Facultad de Ciencias Veterinarias, UNL. Esperanza, Santa Fe.2Actividad privada, Reconquista, Santa Fe.ABSTRACTFIRST REPORT OF DRACUNCULUS SPP IN THE PROVINCE OF SANTA FE, ARGENTINA.Dracunculosis is a parasitic disease caused by Dracunculus medinensis, which can affect both humansand animals. Very few cases have been reported in Argentina, all of them in Formosa province. Humancases were first reported in 1903. We are describe a case of a 2-year-old canine with skin nodules located atseveral body regions. Pinkish helminths were obtained from these lesions, the length of which ranged from15 to 57 cm. Larvae were obtained from one of the helminthes. They had a filiform end, striated cuticleand a length of approximately 700 µm. From our observations support the conclusion that this is a case ofdracunculosis.Key words: Dracunculus spp., Dog parasites, Argentina, first report.RESUMENLa dracunculosis es una enfermedad parasitaria causada por Dracunculus medinensis que puede afectartanto a humanos como animales. En la República Argentina se han reportado pocos casos en animales,todos en la provincia de Formosa y los casos en seres humanos comunicados datan del 1903. El casoque describimos es de un canino de dos años de edad con nodulaciones en varias partes del cuerpo. Delas mismas se extrajeron vermes de color blanco rosáceo, con una longitud que varió entre 15 y 57 cm.Al comprimir uno de los vermes, se puso de manifiesto la presencia de larvas, con el extremo caudalfiliforme, la cutícula estriada y una longitud de aproximadamente 700 µm. Las observaciones realizadas,hacen concluir que se trataría de un caso de dracunculosis.Palabras clave: Dracunculus spp., parásitos del perro, Argentina, Primer reporte.Recibido: 20 de Agosto de 2010. Aprobado: 13 de Abril de 2011.Correspondencia: F M Bono Battistone.UNL. Esperanza, Santa Fe. Kreder 2805E-mail: mfbono@fcv.unl.edu.ar121

M. F. BONO BATTISTONI et al.INTRODUCCIÓNLa dracunculosis o dracontosis es una enfermedadparasitaria causada por Dracunculus medinensis(Linneaus, 1758). Este nematode, también conocidocomo “gusano de Guinea” o “gusano de Medina”,es un parásito del humano aunque también puedeparasitar a perros, gatos, caballos, vacas y otrosmamíferos (no humanos) (Soulsby, 1987; Bimi etal, 2005). En los años ochenta, veinte países eranendémicos para la Dracunculosis; actualmente laenfermedad solo es endémica en Etiopía, Ghana,Mali y Sudan (WHO, 2000). En América, la OMSclasificó algunos países como del grupo C, “países yterritorios con posible historia de dracunculosis endémica”.Esta lista incluía Brasil, Colombia, Cuba,República Dominicana, Guyana Francesa, Granada,Haití, México y Surinam, aunque en 1998 algunosde ellos fueron certificados como libres de la enfermedad(Watts, 2000). En la República Argentinaexisten pocos reportes de hallazgo de este parásito(Ringuelet,1954; Rovela 1957; Hoyos et al, 1995).Riveros, et al, (1981) diagnosticaron D. medinensisen un perro con una nodulación a la altura de la articulaciónhúmero radio cubital con orificios de losque se extrajo parte del verme y un líquido en el quese visualizaron las larvas características. Rossister, etal, (1981) hallaron el parásito en un nódulo ulceradoque presentaba un puma (Puma concolor concolor)en la piel del muslo izquierdo. Todos estos hallazgosfueron registrados en la provincia de Formosa. Enhumanos solo se citan dos casos en la provincia deSantiago del Estero en el año 1903. En los paísesdonde esta parasitosis es endémica constituye unserio problema para la salud pública, ya que causaimposibilidad para caminar o trabajar, reduce la productividadde los granjeros y el desempeño académicoen niños (Okoye et al, 1995; Joshi et al, 1997).Dracunculus es un nematode que pertenece alorden Spirurida, suborden Camallanina, y a la familiaDracunculidae (Soulsby, 1987). Este parásitose ubica en el tejido subcutáneo de los carnívorosy del hombre (Bowman, 2004). Los machos midende 12 a 29 mm y mueren 3 a 7 meses pos infección(PI). Las hembras pueden llegar a medir 400 cmde largo y son las responsables de las manifestacionesclínicas ( Hoyos et al, 1995). Las hembrasson fecundadas 3 a 4 meses PI y entre los 8 y 10meses PI migran al tejido conectivo subcutáneo delas extremidades. De ahí emerge a través de una ulceray por la cual sale el extremo anterior del verme(Soulsby, 1987; Hoyos et al, 1995). Cuando estasúlceras entran en contacto con un medio acuoso, lahembra prolapsa la totalidad de su útero descargandouna masa de larvas que miden de 500 a 700 µ.Estas larvas son ingeridas por especies de Ciclops,vulgarmente llamados “pulgas de agua”, en los quedesarrollan hasta L 3infestantes en la cavidad hemocelómica.El hospedador definitivo se infectacuando ingiere los Ciclops infectados con el aguade bebida. Las larvas se liberan en el intestino yatraviesan la pared del mismo, completando su desarrollohasta llegar a la superficie cutánea (Soulsby,1987; Hoyos et al, 1995; Bowman 2004).DESCRIPCIÓN DEL CASOCorresponde a un canino proveniente de FortínOlmos (28°46’59’’S y 61°40’59’’O), en el DepartamentoVera, de la provincia de Santa Fe, Argentina.Se trató de un macho, de aproximadamente dosaños de edad, de raza Braco Húngaro que desde elmes de enero de 2008 presentaba nodulaciones queluego se ulceraban y de las cuales el propietarioextrajo un tejido blanquecino de aproximadamente20 cm de longitud. Cuando el animal llegó a laconsulta presentaba nódulos subcutáneos de 1 a 4mm de diámetro en miembros anteriores y posteriores,región pectoral, xifoidea, costal izquierday en hombro derecho. Las nodulaciones variabanen su consistencia de blanda a fibrosa y la mayoríapresentaba lesiones con diferente grado de cicatrización.Al realizar la incisión con bisturí delos nódulos, drenó un líquido mucopurulento y dealgunas nodulaciones se extrajo un verme de colorblanco rosáceo, de 1 mm de diámetro y con unalongitud que varió entre 15 y 57 cm (Figuras 1 y 2).Doce de los vermes extraídos fueron remitidosal Laboratorio de Estudios Parasitológicos de laFacultad de Ciencias Veterinarias de la UniversidadNacional del Litoral. En el laboratorio al observarlos especímenes con lupa estereoscópica pudodeterminarse un cuerpo surcado por estriacionestransversales, el extremo caudal curvado en dosespecímenes solamente y ausencia de la porcióncefálica. Al comprimir entre dos portaobjetos unode los vermes, se puso de manifiesto la presencia delarvas, con el extremo caudal filiforme, la cutículaestriada y una longitud de aproximadamente 700122Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 119-121

DRACUNCULUS EN LA PROVINCIA DE SANTA FE, ARGENTINAFigura 1. Verme emergiendo de una úlcera.Figura 2. Verme emergiendo de una úlcera en miembroanterior.µm (Figura 3).Las observaciones clínicas, más las característicasmorfológicas de los hallazgos, que son coincidentescon las descripciones de Levine (1978) y Lapage(1971), hacen concluir que se trataría de un caso dedracunculosis. No podemos asegurar que se trate de laespecie D. medinensis por no contar con un espécimencompleto. De acuerdo a las características morfológica,este parásito se puede clasificar hasta nivel de especiesolo con los vermes machos, los cuales raramenteestán disponibles para su estudio, con las hembras sólopodemos identificar hasta el nivel de género (Bimi etal, 2005). Debido a la sequía que azotó la región no sepudieron investigar los sitios con agua para constatarla presencia de los hospedadores intermediarios y lainfección de los mismos. Además se debe tomar encuenta el tiempo que demoran las hembras en llegaral tejido subcutáneo y que las larvas descargadas en elagua, sobreviven sólo por 72 horas (Joshi, 1992).REFERENCIAS1. BIMI L, FREEMAN AR, EBERHARD ML, RUIZ-TIBEN E, PIENIAZEK NJ. 2005. Differentiating Dracunculusmedinensis from D. insignis, by the sequenceanalysis of the 18S rRNA gene. Ann Trop Med. Parasitol,99 (5): 511-517.2. BOWMAN DD. 2004. Parasitología para veterinarios.Cap. 3. Octava edición. Editorial Elsevier.3. HOYOS CB, JARA GA, MONZÓN CM. 1995.Reporte de un caso de dracunculosis en un canino en laprovincia de Formosa-Argentina. Rev. Inst. Med. Trop.São Paulo, 37 (3): 273-275.4. JOSHI V. 1992. Dracunculiasis in Jodhpur district:Studies on some epidemiological and parasitologicalFigura 3. Larva 1 de Dracunculus spp.aspects. J. Communicable Dis., 24: 191-193.5. JOSHI V, SINGHI M, CHAUDHARY RC. 1997. Studieson dracunculiasis in the Indian desert. J. Arid Environ.37: 181-191.6. LAPAGE G. 1971. Parasitología Veterinaria. 1º Ed.Compañía Editorial Continental S.A.7. LEVINE ND. 1978. Tratado de parasitología veterinaria.Cap. 20. Editorial Acribia.8. OKOYE SN, ONWULIRI COE, ANOSIKE JC. 1995.A survey of predilection sites and degree of disabilityassociated with guineaworm (Dracunculus medinensis).Int J. Parasitol. 25 (9): 1127-1129.9. RINGUELET R. 1954. Zooparásitos de interés veterinario.MAGN, Nº 28, Bs. Aires.10. RIVEROS CE, MORIENA RA, BULMAN GM,LOMBARDERO OJ. 1981. Dracunculosis en perros dela provincia de Formosa (República Argentina). Gac.Vet. Nº359: 255-258.11. ROSSISTER A, BRUNEL CM, BULMAN GM. 1981.Primera cita de dracunculosis en un puma (Pumaconcolor concolor). Gac. Vet. Nº358: 164-166.12. ROVEDA RJ. 1957. Zooparásitos de interés veterinarioen la R. Argentina. RIG, MAGN, Nº1, Bs. Aires.13. SOULSBY EJL. 1987. Parasitología y EnfermedadesParasitarias de los animales domésticos. 7ª Ed. NuevaEditorial Interamericana S.A de C.V.14. WATTS S. 2000. Dracunculiasis in the Caribbean andSouth America: a contribution to the history of dracunculiasiseradication. Medical History, 45: 227-250.15. (WORLD HEALTH ORGANIZATION ( WHO). 2010.Programmes and proyects,Dracunculiasis: erradication,epidemiology http://www.who.int/dracunculiasis/epidemiology/en/Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 119-121123

ComunicacionesRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 122-128Occurrence of Cryptosporidium spp.oocysts in mammals at a zoo in southern BrazilLUDWIG R. 1 and MARQUES, S. M. T. 21Ciências Biológicas, Universidade do Vale do Rio dos Sinos, São Leopoldo, Rio Grande do Sul (Brasil).2Departamento de Patologia Clínica Veterinária, Faculdade de Veterinária, Universidade Federal do Rio Grande doSul, Rio Grande do Sul (Brasil).ABSTRACTThe aim of the present study was to investigate the presence of Cryptosporidium spp. oocysts in captivewild mammals at the zoo of the Zoobotanical Foundation of the state of Rio Grande do Sul, Brazil. A totalof 41 species from 46 enclosures were studied. Ninety-two fecal samples were collected from a pool of 208mammals and analyzed using a modified Ziehl-Neelsen’s acid fast method. The analysis of double samples(92) revealed that Alouatta caraya, Aotus nigriceps, Ateles chamek, Puma concolor, Coendou prehensilis,Dama dama, Cervus unicolor, Kobus ellipsiprymnus and Myrmecophaga tridactyla shed Cryptosporidiumspp oocysts. The overall occurrence of crypstosporidial infection amounted to 19.56%. The morphometricanalysis of oocysts showed short and subspherical oocysts measuring, on average, 5.7 µm X 4.9 µm, witha shape index of 1.16. This is the first report of Cryptosporidium spp. in A. caraya, A. chamek, D. dama,C. unicolor and K. ellipsiprymnus in Brazil, and the first report of cryptosporidiosis in A. nigriceps, C.prehensilis and M. tridactyla in the world.Key words: Cryptosporidium spp., Oocysts, Mammals, Zoo, Brazil.ResumenEl objetivo de este estudio fue establecer la presencia de ooquistes de Cryptosporidium spp. en mamíferossilvestres mantenidos en cautiverio en el zoológico de la Fundación Zoobotánica del estado de Rio Grandedo Sul, Brasil. Un total de 41 especies alojadas en 46 recintos fueron estudiadas. Noventa y dos muestrasde heces fecales provenientes de 208 mamíferos fueron analizadas por el método modificado de Ziehl-Neelsen ácido alcohol resistente. El examen microscópico reveló que Alouatta caraya, Aotus nigriceps,Ateles chamek, Puma concolor, Coendou prehensilis, Dama dama, Cervus unicolor, Kobus ellipsiprymnusy Myrmecophaga tridactyla eliminaron ooquistes de Cryptosporidium spp, con una incidencia general de19,56%. El análisis morfométrico mostró ooquistes pequeños, subesféricos con un tamaño promedio 4,9Recibido: 23 de Octubre de 2010. Aprobado: 15 de Abril de 2011.Corresponding: Sandra M. T. Marques. Departamento de Patologia Clínica Veterinária. Faculdade de Veterinária.Universidade Federal do Rio Grande do Sul - Rio Grande do Sul (Brasil). Av. BentoGonçalves,9090, CEP: 91540-000. Phone: +55 51 33086136; fax: +55 51 33087305.E-mail address: sandra.marques@ufrgs.br; smtmuni@hotmail.com124

CRYPTOSPORIDIUM SPP. OOCYSTS IN MAMMALS AT A ZOO IN BRAZILμm x 5,7 μm, e índice de forma 1,16. Este es el primer reporte de Cryptosporidium spp. en A. caraya, A.chamek, D. dama, C. unicolor y K. ellipsiprymnus en Brasil, y el primero en A. nigriceps, C. prehensilis yM. tridactyla en el mundo.Palabras clave: Cryptosporidium spp., Ooquistes, Mamiferos, Zoo, Brasil.IntroduCTIONZoonotic diseases have been observed ingeographical regions and in animal species inwhich they had not been detected before. Thereasons for such trend are complex and includeenvironmental changes, amount and distributionof some animal species; growth of the humanpopulation and of animal population in urbanareas; growing movement of people as well as thetrade of wild animals, their rearing in captivity, andreduction in surveillance and control actions forseveral zoonotic diseases (Meslin, 1997).Many zoos, conservation parks and rehabilitationcenters for wildlife have shown concern for thepresence, and level, of contamination of their animalcollections. A zoo, due to the concentration ofdifferent animal species in a restricted space, plusthe stress caused by captivity and the contact withman, predisposes to the dissemination of pathogens(Appelbee et al, 2005).Protozoa of the genus Cryptosporidium areobligatory coccidia that infect the intestinal epithelialcells or the respiratory tract of four vertebrategroups - fishes, reptiles, birds and mammals.They are ubiquitous and infect around 170 animalspecies, and so far 19 species have been identified(Fayer, 2010). The fecal-oral route is the majormode of transmission and it is associated with theintake of water and food or contact between susceptiblehosts (Xiao and Ryan, 2008).Occurrence of Cryptosporidium spp. throughparasitological tests were evaluated in several zoos,such as in Lisbon, Barcelona, Prague, Japan, Argentinaand Malaysia (Alves et al, 2005; Appelbeeet al, 2005; Matsubayashi et al, 2005; Venturiniet al, 2006; Lim et al, 2008). However, in Brazil,there is no research on this parasite in animals thatare kept in captivity by organizations that strugglefor the preservation of the wild fauna.The present study aims to investigate thepresence of Cryptosporidium spp. oocysts amongmammals at the zoo of the Zoobotanical Foundationof the State of Rio Grande do Sul, in Sapucaia doSul, southern Brazil.MATERIAL AND METHODSStudy area and animals: The zoo of theZoobotanical Foundation of the State of Rio Grandedo Sul was opened to the public in 1962 and is oneof Brazil’s most widely visited conservation units.Approximately 600,000 people visit the zoo everyyear. The visiting area extends over 160 hectares.This zoo manages and exhibits living collections ofwild animals in environments that seek to mimicthe living conditions each species would find in itsnatural habitat, in compliance with governmentallaws, for the survival, reproduction and welfareof animals, allowing for their preservation andresearch, and for the education and leisure of zoovisitors (FZB/RS, 2008).The zoo is located in the metropolitan region ofPorto Alegre (29º48’05.28”S and 51º09’58.87”O),in Sapucaia do Sul, state of Rio Grande do Sul,southern Brazil. It contains 1,013 animals (reptiles,birds and mammals), including native and endangeredspecies (FZB/RS, 2008).The study was conducted between March andMay 2008, and included 41 species distributed into46 different enclosures. A total of 92 fecal sampleswere obtained from a pool of 208 animals (Table1). The fecal samples belonged to adult and youngmammals (male and female) whose health andnutritional statuses were considered to be goodduring the experimental period. All mammalsthat were exhibited to the public were assessed,totaling seven different orders: Primata, Carnivora,Rodentia, Artiodactyla, Perissodactyla, Xenarthraand Proboscidea. Only five species were exhibitedin more than one enclosure, namely: Cebus apella,Callithrix penicillata, Panthera onca, Tremarctosornatus and Sus scrofa, in an attempt to complywith the law that regulates the population densityof individuals per enclosure area or due toRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 122-128125

R. LUDWIG and S M. T. MARQUESreproduction issues.Samples: A total of 92 fecal samples werecollected. Two collections, consisting of two fecalpools, were made on a weekly basis. The feces werecollected as they were found on the soil. Only freshtools were collected. The fecal pool was chosenbecause physical space or isolation areas were notenough to house the animals during the experiment,and also to preserve the safety of animals andhandlers, thus precluding the necessity for animalrestraint and reducing stress.The feces were placed in vials, identified andhomogenized before they were smeared on toslides. Fecal smears were dried at room temperatureand fixed in absolute alcohol for five minutes. Inthe laboratory, the smears were stained with themodified Ziehl-Neelsen’s technique (Henricksenand Pohlenz, 1981) and analyzed under a lightmicroscope, with 1000 X magnification.The morphometric analysis (I) of oocysts wasperformed with a micrometric eyepiece (LeitzWetzlar, Germany), coupled to the light microscope,taking into account length (L) and width (W), usingthe formula I= L/W (Majewska et al, 2000).RESULTSCryptosporidium spp.oocysts were detected in19.56% (18/92) of the analyzed samples (Table1). Nine species showed oocysts in their feces:Alouatta caraya, Aotus nigriceps, Ateles chamek,Puma concolor, Coendou prehensilis, Damadama, Cervus unicolor, Kobus ellipsiprymnus eMyrmecophaga tridactyla. Oocysts averaged 5.7 X4.9µm in size, with a shape index of 1.16.The presence of Cryptosporidium spp. oocystsin the first collection was confirmed by the secondcollection. In the enclosures occupied by onlyone animal, as in the case of A. nigriceps, C.prehensilis, K. ellipsiprymnus and M. tridactyla,infection is evident. However, in the enclosuresoccupied by several animals, it is not possible toidentify which animals were shedding oocysts intheir feces.Cryptosporidiosis has not been described inA. nigriceps, C. prehensilis and M. tridactylaanywhere in the world; and for all investigatedmammal species, except for P. concolor, this is thefirst report in Brazil.DISCUSSIONCryptosporidium spp. oocysts were detected in19.56% of the fecal samples obtained from captivemammals belonging to the zoo assessed in thepresent study.One of the first studies undertaken by the BarcelonaZoo, in 1998, with fecal samples monthlycollected from all vertebrates, detected cryptosporidiosisin D. dama, and reinfection cycles throughoutthe year (Gracenea et al, 2002). In another investigationin the Barcelona Zoo has characterizedthe endemic satuts to D. dama and C. unicolor,and other species of the orders Primates, Artiodactyla,Perissodactyla and Proboscidea (Gómez etal, 2000). A study carried out in San Diego WildAnimal Park (USA) showed a 25% prevalence ofCryptosporidium spp. oocysts in fecal samples ofD. dama, but the result was negative for K. ellipsiprymnus(Heuschele et al, 1986), unlike the resultsobtained at the Brazilian zoo for these two species.In deer from a Korean farm, the prevalence ofCryptosporidium spp. amounted to 69.2% (9/13)(Yu et al, 2004). The investigation of cryptosporidiosisat Osaka Municipal Tennoji Zoological Gardens,in Japan, yielded negative results for Cryptosporidiumspp. oocysts in P. concolor and D. dama(Matsubayashi et al, 2005), unlike the results obtainedby the Brazilian zoo and those reported byHeuschele et al, (1986), Gómez et al, (2000) andby Gracenea et al, (2002).A study conducted at the Lisbon Zoo in Portugal,with wild ruminants yielded positive results formammals of the Bovidae Family, more specificallyfor Connochaetes gnou and Bison bison (Americanbison), but negative results for K. ellipsiprymnus(Alves et al, 2005). In Brazil, a previous studycarried out with captive mammals at Parque doSabiá, in the state of Minas Gerais, also detectedCryptosporidium spp. in P. concolor, showing aprevalence of 3.84% (Cabral et al, 2001).With regard to the shedding of oocysts and toprevalence estimates, two situations may occur: oneshowing that the prevalence of cryptosporidiosis canbe underestimated due to the intermittent sheddingof oocysts, as demonstrated by Guselle et al, (2003),and another one showing that the regular sheddingof oocysts was reported in zoo and in farm animals(Xiao and Herd, 1994; O´Handley et al, 1999; Noordenet al, 2001, 2002; Gracenea et al, 2002).126Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 122-128

CRYPTOSPORIDIUM SPP. OOCYSTS IN MAMMALS AT A ZOO IN BRAZILTherefore, there is a consensus that good hygienepractices at the animal facilities may reduceenvironmental contamination; delaying or preventinginfection (Xiao et al, 1994) and that such practiceshould always be followed. Approximately 10C. parvum oocysts are enough to be regarded asinfectious; oocysts can be shed by asymptomaticanimals and their remaining in the environment forweeks favors dissemination and infection (Olson etal, 1999; Fayer et al, 2000).The morphometric analysis revealed small pinkoocysts, which were positive to the modified Ziehl-Neelsen staining and averaged 5.70 µm X 4.90 µmin size, with a shape index of 1.16. In the presentstudy, we did not identify Cryptosporidium species,but the morphometric analysis of oocysts yieldedmean values that are similar to those described byother authors; for example, the mean size of C.parvum was 5.0 X 4.5 µm for Upton et al, (1985);4.5 - 7.9 X 4.2 -6.5 µm for O’Donoghue (1995);4.2 X 4.6 µm for Fayer et al. (2000); 4.4 X 4.1µm for Majewska et al, (2000); 5.3 X 4.6 µm forIrwin (2002) and 4.4 to 6.3 µm for Watanabe et al,(2005). For Cryptosporidium spp., Chalmers et al,(2002) found a mean size of 4.7 µm (4.4 - 5.5 µm)X 4.8 µm (4.5 - 5.5 µm) where as Jongwutiwes etal, (2002) reported 4.5 and 5.5 µm as mean widthand length, respectively. We observed that theindex obtained for Cryptosporidium in this studyfalls within the index interval (1-1.4).Factors that are potentially associated withCryptosporidium infection in the sampled animalsare important for those which are housed in groups,as well as for those with free access to water sources,as they can disseminate oocysts by carrying themalong to other places. Moreover, the increase inpopulation density in certain areas may augment therisk of infection and contribute to the maintenanceof infection among animals that share the sameenvironment, as described in other studies (Miller etal, 1990; Olson et al, 1999; Fayer et al, 2000).In the past, C. parvum was the only speciesthat infected humans. Nevertheless, recent studieshave shown that immunocompromised patientsare especially susceptible to a wide variety ofCryptosporidium species and their genotypes, thusdemonstrating how important they are in publichealth (Del Coco et al, 2009).Out of nine species infected by Cryptosporidiumspp. four belong to the native fauna of the stateof Rio Grande do Sul: A. caraya, P. concolor, C.prehensilis and M. tridactyla. Among these, threeare on the list of endangered animal species of RioGrande do Sul, each of which under a differentendangerment category: A. caraya - vulnerable; P.concolor - endangered; and M. tridactyla - criticallyendangered (Marques et al, 2002).Parasitic diseases in these endangered speciesare important because zoos serve as places forpreservation of biodiversity, and as genetic banks,whose animals can be used in programs forreintroduction into their natural habitat. The presenceof parasites in captive wild animals alows for morecomprehensive studies on the ecoepidemiology ofparasitic diseases, and is of utmost importance forpreserving biodiversity, provinding subsidies forany immediate intervention, whenever necessary.This study is the first extensive and quantitativeinvestigation on the shedding of Cryptosporidiumspp. oocysts in the feces of animals in a Brazilianzoo. It is difficult to compare the present data withthose reported in other similar studies around theworld because the conditions between studies andprevalence rates are different. The actual prevalenceof infection may even be underestimated becauseonly two fecal specimens were collected per place,when intermittent shedding of oocysts is considered.This result also underlines the importance ofinvestigating the possibility that other animals alsoact as reservoirs for Cryptosporidium spp.This is the first report of protozoa of the genusCryptosporidium in A. nigriceps, C. prehensilisand M. tridactyla in the world. In Brazil, this is thefirst report of cryptosporidiosis in other parasitizedmammalian species, except P. concolor.In Brazil, molecular identification is still inthe process of being implemented at researchand diagnostic centers, unlike in other countries,where methods for diagnosing this disease andtracing sources of infection and environmentalcontamination are readily available. However,there is a consensus that studies of the genusCryptosporidium need internationally acceptedstandardization to boost confidence in the results,to establish standards of performance and toincrease the knowledge of analysts and researchers(Carvalho, 2009).Further studies are needed to identify the speciesand to assess the importance of zoo animals in theepidemiology of cryptosporidiosis in mammals.Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 122-128127

R. LUDWIG and S M. T. MARQUESTable 1. Classification of orders, families number of individuals at the Zoo of the Zoobotanical Foundationof the state of Rio Grande do Sul, Brazil, and amount of fecal samples collected and identified as containingCryptosporidium spp. occystsMammals Numbers of Individuals Numbers of samplesCollectedPositivesOrder: PrimatasFamily CebidaeAlouatta caraya 4 2 2Alouatta fusca 5 2 -Cebus apella 11 4 -Aotus nigriceps 1 2 2Family AtelidaeAteles chamek 3 2 2Family CercopithecidaePapio hamadryas 2 2 -Mandrillus sphinx 10 2 -Family CallitrichidaeCallithryx geoffroyi 2 2 -Callithryx jacchus 2 2 -Callithryx penicillata 7 4 -Family HominidaePan troglodytes 3 2 -Order CarnivoraFamily ProcyonydaeNasua nasua 5 2 -Family FelidaePanthera onca 2 4 -Panthera tigris 2 2 -Panthera leo 2 2 -Panthera pardus 1 2 -Leopardus pardalis 1 2 -Puma concolor 2 2 2Family CanidaeChrysocyon brachyurus 2 2 -Pseudalopex gymnocercus 2 2 -Family UrcidaeTremarctos ornatus 2 4 -Family MustelidaeLontra longicaudis 2 2 -Orden RodentiaFamily HrydrochaeridaeHydrochaeris hydrochaeris 15 2 -128Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 122-128

CRYPTOSPORIDIUM SPP. OOCYSTS IN MAMMALS AT A ZOO IN BRAZILContinuación Table 1Family ErethizontidaeCoendou prehensilis 1 2 2Orden ArtiodactylFamily Cervidae aCervus elaphus 20 2 -Dama dama 8 2 2Cervus unicolor 5 2 2Family GiraffidaeGiraffa cameloipardalis 3 2 -Family BovidaeKobus ellipsiprymnus 1 2 2Ammotragus lervia 1 2 -Family CamelidaeLama guanicoe 5 2 -Camelus bactrianus 5 2 -Lama glama 4 2 -Family SuidaeSus scroffa 6 4 -Family TayassuidaePecari tajacu 30 2 -Family HippopotamidaeHippopotamus amphibious 5 2 -Orden PerissodactylaFamily RhinocerotidaeCeratotherium simum 2 2 -Family EquidaeEquus burchelli bohemi 2 2 -Equus asinus 20 2 -Order XenarhraFamily MyrmecophagidaeMyrmecophaga tridactyla 1 2 2Order ProboscideaElephas maximus 1 2 -Total 208 92 18REFERENCES1. ALVES M, XIAO L, LEMOS V, ZHOU L, CAMAV, CUNHA MB, MATOS O, ANTUNES F. 2005.Occurrence and molecular characterization ofCryptosporidium spp. in mammals and reptiles at theLisbon Zoo. Parasitol Res, 97: 108-112.2. APPELBEE AJ, THOMPSON RC, OLSON ME. 2005.Giardia and Cryptosporidium in mammalian wildlifecurrentstatus and future needs. Trends Parasitol, 21:370-376.3. CABRAL DD, BARBOSA FC, STRASSER C, BAR-SOTTI SRH. 2001. Exame de fezes de mamíferos silvestrespara verificação de parasitismo por Cryptospo-Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 122-128129

R. LUDWIG and S M. T. MARQUESridium sp. Biosci J, 17: 77-83.4. CHALMERS RM, ELWYN K, REILLY WJ, IRVINE H,THOMAS AL, HUNTER PR. 2002. Cryptosporidiumin farmed animals: detection of a novel isolated insheep. Intern J Parasitol, 32: 21-26.5. CARVALHO TTR. 2009. Estudo atual do conhecimentode Cryptosporidium e Giardia. Revista de PatologiaTropical, 38: 1-16.6. DEL COCO VF, CÓRDOBA MA, BASUALDO JA.2009. Criptosporidiosis: uma zoonosis emergente.Revista Argentina de Microbiologia, 41: 185-196.7. FAYER R, MORGAN U, UPTON SJ. 2000. Epidemiologyof Cryptosporidium: transmission, detection andidentification. Int J Parasitol, 30: 1305-1322.8. FAYER R. 2010. Taxonomy and species delimitation inCryptosporidium. Exp Parasitology, 124: 90-97.9. FUNDAÇÃO ZOOBOTÂNICA DO RIO GRANDEDO SUL - FZB/RS. http://www.fzb.rs.gov.br/zoologico/.10. GÓMEZ MS, TORRES J, GRACENEA M, FERNÁN-DEZ-MORÁN J, GONZALES-MORENO O. 2000.Further report on Cryptosporidium in Barcelona zôomammals. Parasitol Res, 86, 318-323.11. GRACENEA M, GÓMEZ MS, TORRES J, CARNÉE, FERNÁNDEZ-MORÁN J. 2002. Transmission dynamicsof Cryptosporidium in primates and herbivoresat the Barcelona zoo: a long-term study. Vet Parasitol,104, 19-26.12. GUSELLE NJ, APPLEBEE AJ, OLSON ME. 2003.Biology of Cryptosporidium parvum in pigs: fromweaning to market. Vet Parasitol, 113: 17-18.13. HENRICKSEN SA, POHLENZ JFL. 1981. Staining ofCryptosporidia by a modified Ziehl-Neelsen technique.Acta Vet Scand, 22: 594-596.14. HEUSCHELE WP, OOSTERHUIS J, JANSSEN D,ROBINSON PT, ENSLEY PK, MEIER JE, OLSONT, ANDERSON MP, BENIRSCHKE K. 1986.Cryptosporidial infections in captive wild animals. JWildl Dis, 22: 493-496.15. IRWIN PJ. 2002. Companion animal parasitology: aclinical perspective. Int J Parasitol, 32: 581-593.16. JONGWUTIWES S, TIANGTIP R, YENTAKARM S,CHANTACHUM N. 2002. Simple method for longtermcopro-preservation of Cryptosporidium oocystsfor morphometric and molecular analysis. Trop MedIntern Health, 7: 257-264.17. LIM YAL, NGUI R, SHUKRI J, ROHELA N, MATNAIM HR. 2008. Intestinal parasites in various animalsat a zoo in Malaysia. Vet Parasitol, 157: 154-159.18. MAJEWSKA AC, WERNER A, SULIMA P, LUTYT. 2000. Prevalence of Cryptosporidium in sheep andgoats bred on five farms in West-Central Region ofPoland. Vet Parasitol, 89: 269-275.19. MARQUES AAB, FONTANA CS, VÉLEZ E,BENCKE GA, SCHNEIDER M, REIS RE. 2002. Listadas Espécies da Fauna Ameaçada de Extinção no RioGrande do Sul. Decreto 41.672 de 11 junho de 2002.FZB/MCT–PUCRS/PANGEA, 52 p.20. MATSUBAYASHI M, TAKAMI K, KIMATA I,NAKANISHI T, TANI H, SASAI K, BABA E. 2005.Survey of Cryptosporidium spp. and Giardia spp.infections in various animals at a zoo in Japan. J ZooWildl Med, 36: 331-335.21. MESLIN F-X. 1997. Global Aspects of Emerging andPotential Zoonoses: a WHO perspective. Emerg InfectDis, 3 (2): 223-228.22. MILLER RA, BRONSDON MS, KULLER L, MOR-TON WR. 1990. Clinical and parasitologic aspects ofcryptosporidiosis in nonhuman primates. Lab AnimSci, 40: 42-46.23. NOORDEEN F, FAIZAL AC, RAJAPAKSE RP,HORADAGODA NU, ARULKANTHAN A. 2001.Excretion of Cryptosporidium oocysts by goats in relationto age and season in the dry zone of Sri Lanka.VetParasitol, 99: 79-85.24. NOORDEEN F, HORADAGODA NU, FAIZAL AC,RAJAPAKSE RP, RAZAK MA, ARULKANTHAN A.2002. Infectivity of Cryptosporidium parvum isolatedfrom asymptomatic adult goats to mice and goat kids.Vet Parasitol, 103: 217-225.25. O´DONOGHUE PJ. 1995. Cryptosporidium andcryptosporidiosis in man and animals. Int J Parasitol,25: 139-195.26. O’HANDLEY RM, COCKWILL C, MCALLISTERTA, JELINSKI M, MORCK DW, OLSON ME.1999. Duration of naturally acquired giardiosis andcryptosporidiosis in dairy calves and their associationwith diarrhea. J Am Vet Med Assoc, 214: 391-396.27. OLSON ME, GOH J, PHILLIPS M, GUSELLIN, MCALLISTER TA. 1999. Giardia cyst andCryptosporidium oocyst survive in water, soil andcattle faces. J Environm Qual, 28: 1991-1996.28. UPTON SJ, CURRENT WL. 1985. The species ofCryptosporidium (Apicomplexa: Cryptosporiidae) infectingmammals. J Parasitol, 71: 625-629.29. VENTURINI L, BACIGALUPE D, BASSO W,UNZAGA JM, VENTURINI MC, MORE G. 2006.Cryptosporidium parvum em animales domésticos y enmonos de um zoológico. Parasitol Latinoam, 61: 90-93.30. XIAO L, HERD LP. 1994. Infection pattern of Cryptosporidiumand Giardia in calves. Vet Parasitol, 55:257-262.31. XIAO L, HERD RP, MCCLURE KE. 1994. Periparturientrise in the excretion of Giardia sp. cysts and Cryptosporidiumparvum oocysts as a source of infection forlambs. J Parasitol, 80: 55-59.32. XIAO L, RYAN UM. 2008. Molecular epidemiology.In: Fayer, R., Xiao, L. (Eds.), Cryptosporidium andCryptosporidiosis. CRC Press and IWA Publishing.Boca Raton. USA., 119-163.33. YU JR, LEE JK, SEO M, IL KIM S, SOHN WN. 2004.Prevalence of cryptosporidiosis among the villagersand domestic animals in several rural areas of Korea.Korean J Parasitol, 42: 1-6.34. WATANABE Y, YANG CH, OOI HK. 2005. Cryptosporidiuminfection in livestock and first identificationof Cryptosporidium parvum genotype in cattle feces inTaiwan. Parasitol Res, 97: 238-241.130Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 122-128

In memorian del ProfesorDr. Antonio Atías Martín (Q.E.P.D.)(1927 - 2011)El sábado 28 de Mayo del 2011, después depresentar una larga y penosa enfermedad dejo deexistir el Dr. Antonio Atías.El Profesor Atías nació en Santiago el 12de Septiembre de 1927, estudio medicina enla Universidad de Chile entre 1947 y 1953. Sutesis para obtener el título de médico cirujanofue “Contribución al estudio de la enfermedadde Chagas experimental del ratón”, durantes susestudios de medicina fue ayudante alumno dela Cátedra de Parasitología del Prof. Dr. AmadorNeghme junto a una pléyada de investigadoresy científicos, que posteriormente al igual que elllegarían a ser profesores titulares de esa facultad.El Dr. Atías tuvo una carrera científica de grannivel, es así como obtuvo becas de la OPS y otras degran importancia para nuestro país. Publicó cercade 180 trabajos científicos tanto en Chile como enel extranjero. Culminando esta actividad con laelaboración junto al Profesor Dr. Amador Neghmede un texto de parasitología “Parasitología Clínica”,que fue pionero en América Latina del cual tuveel honor de comentar. Tres ediciones del texto sealcanzaron a publicar antes del fallecimiento delprofesor Atías.En su labor profesional desarrolló funcionesasistenciales y asesorías de Parasitólogos en elHospital San Juan de Dios de Santiago (1954-1988) y posteriormente en la Clínica INDISA hastasu deceso.El Dr. Atías formó a numerosos profesionalesculminando su carrera en la sede occidente de la cualfue Profesor y Jefe de la Unidad de Parasitología.Recibió numerosos premios, tanto por su laborasistencial como docente entre el de la Academia deMedicina de 1979 junto a la Dra. Erika Thierman.Sus discípulos y alumnos lo consideraron siemprecomo un excelente docente, agradable y ameno ensus clases.Se destaco por su espíritu jovial y humor atoda prueba, tenía gran capacidad de redacción.Creo sin lugar a dudas que fue uno de los grandesescritores del área parasitológica. Su alejamientoenluta no sólo a la Parasitología chilena sino a laParasitología Latinoamericana.A nombre de la Sociedad Chilena de Parasitologíadamos el más sentido pésame a su esposa, hijosy familiares. Descansa en Paz Antonio.Prof. Dr. Werner Apt B.PresidenteSociedad Chilena de Parasitología131

Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 130-132NORMAS DE PUBLICACIÓN1. Los trabajos serán remitidos a:1.1 Secretaria de Edición, Prof. Patrocinio MorrondoPelayo, Cátedra de Parasitología, Facultad de Veterinaria.27071 Lugo, España. E-mail: patrocinio.morrondo@usc.es1.2 Editor Prof. Héctor Alcaíno, Casilla 9183, Santiago1, Chile. E-mail: hectoralcaino@gmail.com2. Los autores deberán remitir el manuscrito deltrabajo, que será original y aceptado por todos losautores, mediante un soporte informático, a ser posibleen formato RTF, Microsoft Word (DOC) u Openoffice(ODT).3. La Revista Ibero-Latinoamericana de Parasitologíano dispone limitación en el número de páginasde los trabajos, siempre que la información aportadalo justifique.4. ESTILO:- Los trabajos podrán ser escritos en español, portuguéso inglés (la Comisión Editorial aconseja esteúltimo idioma), deben remitirse usando una fuenteTimes New Roman tamaño 12 y con márgenes derechoe izquierdo de 3 cm, normas que deben guardartambién las cabeceras de tablas y pies de figuras. Todaslas páginas deberán ser numeradas consecutivamente,tablas y figuras incluidas.- Las letras en cursiva se utilizarán para los nombrescientíficos de géneros y especies, así como parapalabras en idioma distinto al que se escribe.- Cuando se cite una especie por primera vez en eltexto, se hará con su nombre científico completo.- Para nombrar las enfermedades se seguirán lasnormas publicadas por Kassai T., Cordero M.,Euzeby J., Gaafar, S., Hiepe Th. and Himonas,C.A. 1988. Standardized Nomenclature of AnimalParasitic Diseases (SNOAPAD). Vet Parasitol 29:299-326, las cuales están aceptadas por la SEP.- Los números del uno al diez, se escribirán conletras (nueve), salvo si preceden a una unidad demedida (4 m) o se utilizan como marcadores (día3). Los números mayores de diez se escribirán conletras únicamente cuando vayan al principio de unpárrafo. Los números que sobrepasen las unidadesde millar se anotarán, uniformemente en ambaslenguas, sin signos de puntuación, ejemplo “10000y no 10.000 o 10,000”. Por su parte los númerosdecimales se anotarán siguiendo la forma “xx’xx(xx.xx), según se trate de textos en español o inglés”.Igualmente, deben evitarse números muy largos,como “(250000000), escribiendo 250 millones o 2,5x 10 8 ”.- Las horas del día se nombrarán de “0 a 24 (18 h yno 6 p.m.)”.- Los años se expresarán de forma completa (porejemplo “1999-2000 y no 1999-00”).- Las abreviaturas podrán usarse, siempre claras ycarentes de ambigüedad. Las abreviaturas de usomuy frecuente, no necesitarán deletrearse previamente:“ADP, AMP, ATP, bp, kDa, cpm, D.F., ADN,Fig., g, h, i.m., i.p., mAb, min, NAD, NADH, no.,pH, p.i., %, ARN, sec, sp., spp., s.c., s.d., s.e., OMS,etc.”- Los artículos constarán de los siguientes apartados,a menos que la naturaleza del trabajo requiera otraestructura:A) Página de título: Constará de:- Título.- Título abreviado ( A running title)- Nombre(s) de autor(es) y su centro de trabajo,subrayando el autor para correspondencia:REINA D., SERRANO F.J. y NAVARRETE I.Parasitología. Facultad de Veterinaria. 10071 Cáceres.España.- Autor para correspondencia: Nombre, direccióncompleta, teléfono, fax y dirección electrónica.B) Resumen y Abstract (siempre en español einglés), no excediendo de 200 palabras; PalabrasClave y Key words (en número máximo de seis encada idioma),C) Introducción, Material y Métodos, Resultados- Discusión.D) Referencias:Se relacionarán únicamente los artículos citadosen el texto.Las referencias de las publicaciones deberán irnumeradas y se hará de la manera siguiente:1. ALLENDE A, SELMA MV, LÓPEZ-GÁLVEZ F,VILLAESCUSA R, GIL MI. 2008. Impact of washwater quality on sensory and microbial quality,including Escherichia coli cross-contamination, offresh-cut escarole. J Food Prot 71: 2514-2518.Cuando varios artículos del mismo o de losmismos autores hayan sido publicados el mismo añoserán citados como “Brown (1980 a, b). Las referenciasa observaciones no publicadas, resúmeneso publicaciones en preparación, deberán serexcepcionales, apareciendo sólo en el texto como“com. pers.”. La relación bibliográfica deberá serordenada alfabéticamente por autores, incluyendoel título completo del trabajo y según los modelossiguientes:Artículos en revistas:SERRANO F., PÉREZ-MARTÍN J.E., REINA D.,NAVARRETE I., KAPEL C.M.O. 2000. Influence132

NORMAS DE PUBLICACIÓNof infection intensity on predilection sites in swinetrichinellosis. J Helminthol 73: 251-254.Libros y publicaciones no periódicas:NAVARRETE I., CALERO R., REINA D., SERRA-NO F. 1989. Programa de Acciones contra la Trichinellosis.Servicio de Publicaciones Universidad deExtremadura. Cáceres/Badajoz.Artículos en libros:ARROWOOD M.J. 1997. Diagnosis. In: Cryptosporidiumand Cryptosporidiosis (Ronald Fayer,Ed.). CRC Press. Boca Ratón. USA., 43-64.Tesis Doctorales:FRONTERA E. 2000. Repercusiones orgánicas dela infección experimental por Ascaris suum en elcerdo ibérico. Tesis Doctoral, Universidad de Extremadura.España.Trabajos no publicados: (Se citarán únicamente sihan sido aceptados para su publicación).SERRANO F.J., REINA D., FRONTERA E.,NAVARRETE I., ROEPSTORFF A. Resistanceagainst migrating Ascaris suum larvae in pigsimmunized with adult worm antigens. Parasitology(en prensa).Las abreviaturas de los nombres de las revistasestarán de acuerdo con las indicaciones de losJournal Citation Reports (JCR); en caso de no estarincluidas en esa relación, se citará con el nombrecompleto.E) Tablas y Figuras:Se presentarán en página aparte, perfectamentenumeradas y con referencia, en el reverso, al primerautor y al título del trabajo. Deberán tener suficientecalidad para que cuando se reduzcan a los formatosde una o dos columnas (8 ó 16 cm, respectivamente)conserven suficiente nitidez. En el manuscritodeberá aparecer una llamada destacada (ejemplo:AQUÍ TABLA 2), para la colocación de cada tabla ofigura en su lugar en el texto.5. El autor, una vez aceptado para su publicación eltrabajo, recibirá una prueba de imprenta para que seacorregida, y deberá devolverla antes de diez días. Encaso de que el autor introduzca modificaciones sustancialesen el texto aceptado por el comité editorial,los gastos correrían a su cargo.6. El autor podrá recibir separatas de su trabajo, previopago de su importe. Así mismo, las reproduccionesde figuras en color, serán por cuenta de los autores.7. El Comité de Redacción se reserva el derechode hacer algunas correcciones de forma cuando loestime necesario8. Los autores deberán pagar la suma de 10 USpor cada página impresa que ocupe el trabajoen la revista. Esta cantidad se pagará cuando secomunique a los autores que el trabajo está aceptadopara su publicación.INSTRUCTION TO AUTHORS.1. Papers should be sent to:1.1 Edition Secretary, Prof. Patrocinio MorrondoPelayo, Cátedra de Parasitología, Facultad de Veterinaria.27071 Lugo, España. E-mail: patrocinio.morrondo@usc.es1.2 Editor Prof. Héctor Alcaíno, Casilla 9183, Santiago1, Chile. E-mail: hectoralcaino@gmail.com2. Authors should be submitted the manuscript,which will be original and accepted by all thenamed authors, in an electronic copy. The format isMS Word (DOC), Openoffice (ODT) or Ritch TextFormat (RTF).3. Ibero-Latin American Journal of Parasitologyhaven’t lower limit on manuscript size, providedthat sufficient essential information is given. Unnecessarilylong papers will be returned to the authorsfor revision.4. STYLE:- Manuscripts should be in Spanish, Portuguese orEnglish, typewritten using Times New Roman 12,with 3 cm left and right margin, including figureand table headings. All pages should be numberedconsecutively, figures and tables included.- The italic typeface should be reserved for scientificnames of genera and species, and also for wordstypewritten in a different to the mean paper language.- Species names should be given in full on firstappearance in the text.- Parasitic disease will be named according to: KassaiT., Cordero M., Euzeby J., Gaafar S., Hiepe Th.and Himonas C.A. 1988. Standardized Nomenclatureof Animal Parasitic Diseases (SNOAPAD). VetParasitol 29: 299-326.- Numbers one to ten should be written as wordsunless they precede a measurement unit (e.g. 4 m) orserve as markers (e.g. day 3). Numbers larger thanten should only be written as words at the beginningof a sentence.- Large numbers should be set out without commas,uniformly and in both languages (e.g. 10000 not10,000 or 10.000). On the other hand, decimalnumber will appear following the type xx.xx.Equally, very large numbers should be avoided, e.g.250 million or 2.5 x 10 8 and not 250 000 000.- Times should be expressed according to a 24-hRev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 130-132133

NORMAS DE PUBLICACIÓNclock (e.g. authors should write 18.00 rather than 6p.m.).- Years should not be abridged to the last two figures(e.g. 1999-2000 rather than 1999-00 should be used).- Abbreviations should be used sparingly andunambiguously. The following abbreviations arecommonly used and need not be spelled out: ADP,AMP, ATP, bp, kDa, cpm, D.F., DNA, Fig., g, h(hour), i.m., i.p., mAb, min, NAD, NADH, no., pH,p.i., %, RNA, sec, sp., spp., s.c., s.d., s.e., WHO.- Articles will consist of the following sections,unless its structure makes any of them redundant:A) Title-page:- A concise but informative full title.- A running title- Name(s) of author(s) and working Centre. Correspondingauthor’s name should be underlined.REINA D., SERRANO F.J. and NAVARRETE I.Parasitología. Facultad de Veterinaria. 10071Cáceres. España.- Corresponding author: Name, complete address,phone, fax and e-mail address.B) Abstract and Resumen.Always in English and Spanish, no more than 200words; Key words and Palabras Clave (a maximumof six key words for each language).C) Introduction, Material and Methods, Results,Discussion.D) References:The list of references will be composed only byarticles cited in the text.References should be numbered and will be cited asfollow:1. ALLENDE A, SELMA MV, LÓPEZ-GÁLVEZ F,VILLAESCUSA R, GIL MI. 2008. Impact of washwater quality on sensory and microbial quality,including Escherichia coli cross-contamination, offresh-cut escarole. J Food Prot 71: 2514-2518.When several papers by the same author(s) havebeen published in the same year, they should be citedas “Brown (1980 a, b). References to unpublishedobservations, abstracts or papers in preparationshould only be cited in exceptional circumstances,and should be cited only as “pers. com.” (personalcommunication). References must be listed inalphabetical order of the author’s name and the titleof the paper should be given in full.Articles should conform to the following formats:Journal articles:SERRANO F., PÉREZ-MARTÍN J.E., REINA D.,NAVARRETE I.,KAPEL C.M.O. 2000. Influenceof infection intensity on predilection sites in swinetrichinellosis. J Helminthol 73: 251-254.Books and other non-periodical publications:NAVARRETE I., CALERO R., REINA D., SE-RRANO F. 1989. Programa de Acciones contra laTrichinellosis. Servicio de Publicaciones Universidadde Extremadura. Cáceres/ Badajoz.Chapter in edited books:ARROWOOD M.J. 1997. Diagnosis. In: Cryptosporidiumand Cryptosporidiosis (Ronald Fayer,Ed.). CRC Press. Boca Ratón. USA., 43-64.Doctoral Theses:FRONTERA E. 2000. Repercusiones orgánicasde la infección experimental por Ascaris suum enel cerdo ibérico. Tesis Doctoral, Universidad deExtremadura.Unpublished works: (This should only be cited if ithas been accepted for publication and be styled asfollows).SERRANO F.J., REINA D., FRONTERA E.,NAVARRETE I., ROEPSTORFF A. Resistanceagainst migrating Ascaris suum larvae in pigsimmunized with adult worm antigens. Parasitology(In press).Abbreviations of Journal titles should conformto those of the Journal Citation Reports (JCR); ifJournal is not indexed full name of Journal shouldbe noted.E) Figure and Table headings:In a separate page, perfectly numbered and with areference in the reverse to both the first author andthe title of the paper. Their approximate intendedlocation in the text should be marked clearly in themanuscript (eg. HERE FIG. 2). Figures and tablesmay be accepted provided that they are of a highquality such us to fit neatly into one column (80 mm)or two columns (166 mm) maintaining its quality.5. The gallery proofs of each paper will be sent in duecourse to the author(s) for correction and should bereturned within ten days of receipt. Expenses incurredas results of substantial modifications to the originaltext at this stage will be charged to the author(s).6. Authors could be supplied with offprints of theirpaper, charging its full value.7. The Redaction Committee reserves its right tomake some form corrections when necessary.8. Authors must pay the equivalent sum of 10 USDper each printed page in the Journal. This amountmust be paid when the paper is accepted.134 Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 130-132

ARTÍCULOS ORIGINALES· Parasitemia and humoral responses in the brain and spinal cord of pregnantrats with infection by Trypanosoma cruzi.REVISTA IBERO-LATINOAMERICANA DE PARASITOLOGÍA - Volumen Nº 70 - Nº 1 ENERO - JUNIO 2011· Characterization of cutaneous isolates of Leishmania in Colombia byisoenzyme typing and kDNA restriction analysis.· Identificación de genotipos. de Giardia duodenalis niños de Guatemala.· Risk factors and prevalence of IgG antibodies to Toxoplasma gondii indomestic cats.· Blastocystis sp en niños y adolescentes de la ciudad de Córdoba,Argentina.· Anaplasma platys and other pathogens in urban ectoparasites ofNortheast Argentine.· Serological detection of Trichinella spiralis and Trichinella britovi in wild boarby ELISA using an excretor-secretor antigen and a crude antigen.· Immunisation of rabbits with house dust mite extract against Graphidiumstrigosum.· Cystic echinococcosis in cattle in Uruguay.· Epidemiology and approach treatment of human cystic echinococcosis:Case Series.· Hipocromia y diagnóstico de talla en niños y adolescentes con parasitosisintestinales.· Anemia ferropriva e sua correlaçao com parasitos intestinais em Manaus,Brasil.· Nematophagous fungi with activity against the sheep nematodeHaemonchus contortus .EXPERIENCIAS CLINICAS· Hallazgo de infección por nematodos del género Thelazia (Boso, 1819) enun perro de Salamanca (España).· Infestación múltiple por ácaros ectoparásitos en conejos de crianza.COMUNICACIONES· Primer reporte de Dracunculus spp. en la provincia de Santa Argentina.· Occurrence of Cryptosporidium spp. oocysts in mammals at a zoo insouthern Brazil.Volumen 70 ENERO - JUNIO 2011 Núm. 1135