Variación - UNAM
Variación - UNAM
Variación - UNAM
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
MicrosatélitesSSR (Simple Sequence Repeated)Regiones de di, tri, tetra o poli nucleótidos repetidos en tandem.CTAGAGAGAGAGAGAGAGATTGA (GA)8CTAGAGAGAGAGAGA----TTGA (GA)6CTAGAGAGAGA--------TTGA (GA)4CTATCAGTCAGTCAGTCAGTCAGACA(TCAG)5Regiones específicas de DNA nocodificantes.Presentes en todos los genomas (-proc.)Segregan de manera codominante.Altamente variables (µ -> 10 -5 , 10 -6 )stoterFormación? Homoplasia?