Flujo de genes en arroz - LAC Biosafety
Flujo de genes en arroz - LAC Biosafety
Flujo de genes en arroz - LAC Biosafety
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
América Latina: Desarrollo <strong>de</strong> capacidad multi-país <strong>en</strong> cumplimi<strong>en</strong>to <strong>de</strong>l Protocolo <strong>de</strong> Cartag<strong>en</strong>a <strong>en</strong><br />
Bioseguridad (COLOMBIA, PERU, COSTA RICA, BRASIL)<br />
<br />
NOMBRE DEL PROYECTO, PAÍS Y ÁREA TEMÁTICA<br />
Proyecto: <strong>Flujo</strong> <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>de</strong>l <strong>arroz</strong> cultivado (O. sativa) al <strong>arroz</strong> maleza (O. sativa) y a la especie silvestre (O. glumaepatula) <strong>en</strong><br />
un c<strong>en</strong>tro <strong>de</strong> diversidad tropical: <strong>de</strong>terminación <strong>de</strong> la estructura g<strong>en</strong>ética y capacidad <strong>de</strong> sobreviv<strong>en</strong>cia <strong>de</strong> los híbridos <strong>de</strong> <strong>arroz</strong><br />
cultivado maleza.<br />
País: Costa Rica<br />
Área temática: <strong>Flujo</strong> <strong>de</strong> <strong>g<strong>en</strong>es</strong>.<br />
<br />
INVESTIGADORES Y ESTUDIANTES PARTICIPANTES<br />
Griselda Arrieta Espinoza, MSc. Biología molecular y bioseguridad, CIBCM-UCR, investigadora y coordinadora <strong>de</strong>l proyecto<br />
Eric Fuchs Castillo, Ph.D. G<strong>en</strong>ética <strong>de</strong> poblaciones y estadística, Escuela <strong>de</strong> Biología y CIBCM-UCR, investigador<br />
Bernal E. Valver<strong>de</strong> M<strong>en</strong>a, Ph.D. Malherbología y flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong>, The University of Cop<strong>en</strong>hag<strong>en</strong>, D<strong>en</strong>mark/IDEA Tropical, Costa Rica, investigador<br />
Fe<strong>de</strong>rico Albertazzi Castro, Ph.D Biología Molecular, CIBCM-UCR, coordinador nacional <strong>LAC</strong>-<strong>Biosafety</strong>.<br />
Amanda Calvo Santana, Lic. Biología, <strong>Flujo</strong> <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>de</strong> <strong>arroz</strong> comercial a silvestre mediante AFLPs<br />
Cindy Aguilar Bartels, Lic. Agronomía, CIBCM-UCR, asist<strong>en</strong>te técnica <strong>de</strong> laboratorio<br />
Melania Muñoz Vargas, MSc.<strong>en</strong> Biotecnología, Estudio flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>de</strong> <strong>arroz</strong> comercial a silvestre mediante AFLPs<br />
Adriana Orozco Portuguez, estudiante <strong>de</strong> Lic<strong>en</strong>ciatura <strong>en</strong> Biología, Estudios <strong>de</strong> compet<strong>en</strong>cia híbridos producidos por el cruce <strong>en</strong>tre <strong>arroz</strong> comercial<br />
y maleza (Asist<strong>en</strong>te: 2011 – 2012)<br />
Eddier Villalobos Cascante, estudiante <strong>de</strong> Lic<strong>en</strong>ciatura <strong>en</strong> Biología, Estudios <strong>de</strong> habilidad combinatoria híbridos <strong>arroz</strong> comercial y silvestre<br />
(Asist<strong>en</strong>te: 2011 – 2012).<br />
El<strong>en</strong>a Vásquez Céspe<strong>de</strong>s, estudiante <strong>de</strong> Lic<strong>en</strong>ciatura <strong>en</strong> Biología, Estudios <strong>de</strong> habilidad combinatoria <strong>de</strong> híbridos <strong>arroz</strong> maleza y cultivado<br />
(Asist<strong>en</strong>te: 2011 – 2012).<br />
Daniela Salazar Espinoza, Asist<strong>en</strong>te investigación y coordinación labores <strong>de</strong> inverna<strong>de</strong>ro, cruces dirigidos (Asist<strong>en</strong>te: 2011 a 2012)<br />
Daniel Alejandro Corrales Valver<strong>de</strong>, estudiante agronomía apoyo cruces dirigidos y labores <strong>de</strong> inverna<strong>de</strong>ro (Asist<strong>en</strong>te: 2012).<br />
Fernando Vives Saborío, estudiante agronomía apoyo inverna<strong>de</strong>ro y laboratorio (Asist<strong>en</strong>te, 2011).<br />
José Pablo Castro Sánchez, estudiante agronomía apoyo inverna<strong>de</strong>ro y laboratorio (Asist<strong>en</strong>te, 2011).<br />
Mauricio Arce Guzmán, estudiante agronomía apoyo inverna<strong>de</strong>ro y laboratorio (Asist<strong>en</strong>te, 2011).<br />
Mario Quesada Lacayo, estudiante agronomía apoyo inverna<strong>de</strong>ro y laboratorio (Asist<strong>en</strong>te, 2011).
2<br />
<br />
CONTEXTO GENERAL Y JUSTIFICACIÓN DE LA INVESTIGACIÓN<br />
La utilización <strong>de</strong> cultivos g<strong>en</strong>éticam<strong>en</strong>te modificados (CGM) sin afectar los recursos naturales es una prioridad <strong>en</strong> América<br />
Latina y el Caribe (ALC) <strong>de</strong>bido a su condición <strong>de</strong> c<strong>en</strong>tros <strong>de</strong> orig<strong>en</strong> y diversidad. El proyecto Multi-país para la construcción <strong>de</strong><br />
capacidad para el cumplimi<strong>en</strong>to <strong>de</strong>l Protocolo <strong>de</strong> Cartag<strong>en</strong>a sobre Bioseguridad, está <strong>en</strong> armonía con el acuerdo multilateral<br />
respecto al movimi<strong>en</strong>to transfronterizo <strong>de</strong> organismos g<strong>en</strong>éticam<strong>en</strong>te modificados (OGM) que puedan implicar un riesgo a la<br />
diversidad biológica. La información sobre el flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>en</strong>tre el <strong>arroz</strong> cultivado (Oryza sativa) los posibles receptores <strong>de</strong><br />
<strong>g<strong>en</strong>es</strong> el <strong>arroz</strong> maleza (Oryza sativa) y el silvestre (O. glumaepatula) es muy importante previo a la liberación <strong>de</strong> un <strong>arroz</strong> GM.<br />
En forma similar a otras regiones <strong>de</strong>l mundo, la producción <strong>de</strong> <strong>arroz</strong> <strong>en</strong> los países <strong>de</strong> ALC se ve seriam<strong>en</strong>te limitada por varias<br />
<strong>en</strong>fermeda<strong>de</strong>s, plagas y, sobre todo, las malas hierbas. Por otra parte, los países <strong>de</strong> ALC son el hogar <strong>de</strong> cuatro especies<br />
silvestres <strong>de</strong> Oryza: O. alta, O. grandiglumis, O. latifolia todos tetraploi<strong>de</strong>s (g<strong>en</strong>oma tipo CCDD), y O. glumaepatula diploi<strong>de</strong><br />
(g<strong>en</strong>oma AA) este que es más prop<strong>en</strong>so a hibridar con el <strong>arroz</strong> cultivado (también AA). La ev<strong>en</strong>tual siembra <strong>de</strong> OGMs requiere<br />
<strong>de</strong> información previa sobre flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong>, o posible transfer<strong>en</strong>cia <strong>de</strong> características, <strong>de</strong>l OGM a un pari<strong>en</strong>te silvestre. En Costa<br />
Rica exist<strong>en</strong> tres especies silvestres <strong>de</strong> <strong>arroz</strong>, <strong>en</strong>tre ellas Oryza glumaepatula que podría ser una pot<strong>en</strong>cial receptora <strong>de</strong> pol<strong>en</strong><br />
<strong>de</strong>l <strong>arroz</strong> cultivado <strong>de</strong>bido a la similitud <strong>de</strong>l g<strong>en</strong>oma AA con el <strong>arroz</strong> cultivado. De ahí la importancia <strong>de</strong> obt<strong>en</strong>er información<br />
sobre O. glumaepatula <strong>en</strong> cuanto a la diversidad intrapoblacional e interpoblacional <strong>de</strong> la especie y cuantificar la magnitud <strong>de</strong>l<br />
flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> interespecífica <strong>en</strong> poblaciones naturales <strong>de</strong> Oryza <strong>en</strong> los c<strong>en</strong>tros <strong>de</strong> la biodiversidad tropical, ya que la<br />
información es escasa. El <strong>arroz</strong> transgénico resist<strong>en</strong>te a herbicidas (RH) pue<strong>de</strong> ser utilizado para facilitar el control selectivo <strong>de</strong><br />
malezas con herbicidas <strong>de</strong> amplio espectro. Sin embargo, su posible liberación comercial ha aum<strong>en</strong>tado la preocupación <strong>de</strong><br />
bioseguridad <strong>de</strong>bido a la posibilidad <strong>de</strong> flujo g<strong>en</strong>ético <strong>en</strong>tre varieda<strong>de</strong>s transgénicas y pari<strong>en</strong>tes silvestres y malezas<br />
relacionadas. Por lo tanto, los reguladores <strong>en</strong> bioseguridad requier<strong>en</strong> <strong>de</strong> estudios <strong>de</strong> refer<strong>en</strong>cia diseñados para <strong>en</strong>t<strong>en</strong><strong>de</strong>r la<br />
interacción <strong>en</strong>tre las especies <strong>de</strong> <strong>arroz</strong> cultivado malezas y silvestres, como pot<strong>en</strong>ciales receptores <strong>de</strong> trans<strong>g<strong>en</strong>es</strong>, y la<br />
posibilidad <strong>de</strong> híbridos que los port<strong>en</strong>.<br />
<br />
OBJETIVOS PLANTEADOS<br />
Objetivo 1: Estudiar la adaptabilidad <strong>de</strong> los híbridos <strong>arroz</strong> maleza y <strong>arroz</strong> resist<strong>en</strong>te a herbicida recolectados <strong>en</strong> campo <strong>en</strong><br />
condiciones <strong>de</strong> inverna<strong>de</strong>ro y compet<strong>en</strong>cia.<br />
Objetivo 2. Determinar la habilidad combinatoria <strong>en</strong>tre el <strong>arroz</strong> cultivado y maleza mediante cruces artificiales.<br />
Objetivo 3: Estudiar la adaptabilidad <strong>de</strong> los híbridos <strong>arroz</strong> maleza y <strong>arroz</strong> resist<strong>en</strong>te a herbicida producidos por cruces<br />
artificiales.<br />
Objetivo 4: Estudiar la diversidad g<strong>en</strong>ética y <strong>de</strong>terminar <strong>en</strong> forma indirecta el flujo génico histórico <strong>en</strong> las poblaciones <strong>de</strong> O.<br />
glumaepatula localizadas <strong>en</strong> el humedal <strong>de</strong>l río Medio Queso (Los Chiles, Alajuela) y Murciélago (Guanacaste) y el <strong>arroz</strong><br />
cultivado O. sativa.
3<br />
Objetivo 5. Transferir una metodología estandarizada <strong>de</strong>l C<strong>en</strong>tro Internacional <strong>de</strong> Agricultura Tropical (CIAT) para el monitoreo<br />
a gran escala <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>en</strong>tre O. sativa y las especies silvestres y malezas relacionadas.<br />
Objetivo 6. Diseñar y discutir estrategias <strong>de</strong> manejo para minimizar el flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>de</strong> un ev<strong>en</strong>tual <strong>arroz</strong> GM al <strong>arroz</strong> maleza<br />
(Oryza sativa) y silvestre (Oryza glumaepatula).<br />
Objetivo 7. Producir una guía <strong>de</strong> bioseguridad que compile la información g<strong>en</strong>erada por el subproyecto <strong>en</strong> relación a la<br />
<strong>de</strong>terminación <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> e introgresión <strong>de</strong> O. sativa al <strong>arroz</strong> maleza y silvestre.<br />
<br />
METODOLOGÍA GENERAL UTILIZADA<br />
Objetivo 1: Para estudiar la adaptabilidad <strong>de</strong> los híbridos producto <strong>de</strong>l cruce <strong>en</strong>tre el <strong>arroz</strong> maleza y <strong>arroz</strong> resist<strong>en</strong>te a herbicida<br />
recolectados <strong>en</strong> campo <strong>en</strong> condiciones <strong>de</strong> inverna<strong>de</strong>ro y compet<strong>en</strong>cia se recolectaron semillas <strong>de</strong> plantas <strong>de</strong> <strong>arroz</strong> maleza <strong>en</strong><br />
campos <strong>de</strong> <strong>arroz</strong> comercial. Estos materiales proce<strong>de</strong>n <strong>de</strong> los lotes Río Seco y Playitas (finca arrocera Pelón <strong>de</strong> la Bajura,<br />
Guanacaste). Es estos lotes se utilizó el sistema Clearfield con anterioridad, y se reportó la pres<strong>en</strong>cia <strong>de</strong> <strong>arroz</strong> maleza resist<strong>en</strong>te<br />
al herbicida imidazolinona lo cual es un indicador <strong>de</strong> la posible hibridación <strong>de</strong>l <strong>arroz</strong> maleza con esta variedad. Las semillas se<br />
sembraron y se evaluó la resist<strong>en</strong>cia o susceptibilidad al herbicida mediante bioanálisis con plantas <strong>en</strong>teras para <strong>de</strong>terminar la<br />
respuesta <strong>de</strong> los biotipos selectos a dosis creci<strong>en</strong>tes <strong>de</strong> imazapir, <strong>de</strong> modo que pudiera calcularse la dosis requerida para<br />
reducir el crecimi<strong>en</strong>to <strong>en</strong> un 50% (ED50). Los valores <strong>de</strong> ED50 <strong>de</strong> plantas <strong>de</strong> <strong>arroz</strong> maleza resist<strong>en</strong>tes al herbicida fueron<br />
equival<strong>en</strong>tes (altam<strong>en</strong>te resist<strong>en</strong>tes) o aproximadam<strong>en</strong>te la mitad (resist<strong>en</strong>cia intermedia) <strong>de</strong> los obt<strong>en</strong>idos con la variedad<br />
Clearfield <strong>de</strong> <strong>arroz</strong> comercial <strong>en</strong> concordancia con su naturaleza homocigota o heterocigota, respectivam<strong>en</strong>te. En los<br />
experim<strong>en</strong>tos <strong>de</strong> compet<strong>en</strong>cia se utilizó la prole <strong>de</strong> plantas individuales <strong>de</strong> <strong>arroz</strong> maleza, caracterizadas como susceptibles (S) y<br />
altam<strong>en</strong>te resist<strong>en</strong>tes (R) a imazapir. Se transplantó diez plántulas individuales, <strong>de</strong> tamaño uniforme, a macetas <strong>de</strong> 25 cm <strong>de</strong><br />
diámetro para que crecieran <strong>en</strong> compet<strong>en</strong>cia <strong>de</strong> acuerdo a un arreglo sustitutivo (serie <strong>de</strong> reemplazo). De esta forma,<br />
mant<strong>en</strong>i<strong>en</strong>do una <strong>de</strong>nsidad constante <strong>de</strong> plantas, se establecieron seis proporciones porc<strong>en</strong>tuales <strong>en</strong>tre individuos <strong>de</strong> <strong>arroz</strong><br />
maleza S y R correspondi<strong>en</strong>tes a (80:20, 60:40, 40:60, 80:20) y los respectivos monocultivos (100% S y 100% R). El<br />
experim<strong>en</strong>to contó con seis repeticiones <strong>en</strong> un diseño irrestrictam<strong>en</strong>te al azar. Se realizaron evaluaciones periódicas iniciando<br />
tres semanas <strong>de</strong>spués <strong>de</strong>l transplante para caracterizar el crecimi<strong>en</strong>to <strong>de</strong> los individuos (altura, número <strong>de</strong> culmos) y su<br />
morfología relacionada con la resist<strong>en</strong>cia al herbicida (textura <strong>de</strong> hojas, color <strong>de</strong> base <strong>de</strong> los culmos). Conforme las plantas<br />
maduraron se <strong>de</strong>terminó el número <strong>de</strong> culmos fértiles y a la conclusión <strong>de</strong>l experim<strong>en</strong>to la biomasa fresca individual separada<br />
<strong>en</strong>tre los compon<strong>en</strong>tes vegetativo y reproductivo. Para corroborar la respuesta a imazapir <strong>de</strong> los individuos empleados <strong>en</strong> el<br />
experim<strong>en</strong>to, los nuevos culmos que rebrot<strong>en</strong> posteriores a la cosecha se tratarán con dosis discriminantes <strong>de</strong>l herbicida <strong>de</strong>
4<br />
acuerdo con la resist<strong>en</strong>cia o susceptibilidad al herbicida <strong>de</strong> los materiales. Los datos se sometieron a análisis <strong>de</strong> varianza y<br />
pruebas <strong>de</strong> medias o <strong>de</strong> regresión no lineal según correspondiera.<br />
Objetivos 2 y 3: Con la finalidad <strong>de</strong> <strong>de</strong>terminar la habilidad combinatoria y adaptabilidad <strong>de</strong> los híbridos producidos mediante<br />
cruces artificiales <strong>en</strong>tre el <strong>arroz</strong> maleza y el cultivado, se inició con la producción <strong>de</strong> los híbridos. Para ello se utilizaron 10<br />
accesiones <strong>de</strong> <strong>arroz</strong> maleza <strong>de</strong>l banco <strong>de</strong> semillas <strong>de</strong>l C<strong>en</strong>tro <strong>de</strong> Investigación <strong>en</strong> Biología Celular y Molecular (CIBCM-UCR),<br />
pert<strong>en</strong>eci<strong>en</strong>tes a 5 morfotipos, tipo sativa e intermedio (Arrieta-Espinoza et al. 2005) y recolectadas <strong>en</strong> el 2000 previo a la<br />
liberación <strong>de</strong> las varieda<strong>de</strong>s resist<strong>en</strong>tes a imidazolinonas. La semilla <strong>de</strong> las varieda<strong>de</strong>s resist<strong>en</strong>tes a herbicida se sembró<br />
semanalm<strong>en</strong>te <strong>en</strong> el inverna<strong>de</strong>ro, para la sincronización <strong>de</strong> la floración <strong>en</strong>tre el <strong>arroz</strong> maleza y las varieda<strong>de</strong>s. Se realizaron<br />
cruces manuales dirigidos <strong>en</strong>tre los arroces maleza (líneas maternas) y las varieda<strong>de</strong>s Clearfield® (líneas paternas) y también<br />
se realizó el tipo <strong>de</strong> cruce inverso. Para su obt<strong>en</strong>ción, se utilizó el protocolo implem<strong>en</strong>tado por Sarkarung (1991), que se<br />
modificó y adaptó para mant<strong>en</strong>er las plantas <strong>en</strong> inverna<strong>de</strong>ro <strong>en</strong> macetas y la metodología empleada <strong>en</strong> el C<strong>en</strong>tro <strong>de</strong><br />
Investigación <strong>en</strong> Agricultura Tropical (CIAT). Semanalm<strong>en</strong>te, se sembraron plantas <strong>de</strong>l <strong>arroz</strong> maleza y comercial, para po<strong>de</strong>r<br />
contar cuatro meses <strong>de</strong>spués <strong>de</strong> la siembra con las plantas <strong>en</strong> floración y realizar los cruces. Una vez que las plantas iniciaron<br />
la floración temprana (panzoneo), se emascularon las espiguillas <strong>de</strong> las plantas que serian madre previo a la apertura <strong>de</strong> las<br />
mismas, se cortó el ápice <strong>de</strong> la lema y palea <strong>de</strong> cada espiguilla con una tijera <strong>de</strong> disección y con la ayuda <strong>de</strong> una lupa <strong>de</strong><br />
aum<strong>en</strong>to y con una pipeta <strong>de</strong> vidrio tipo Pasteur conectada a una bomba <strong>de</strong> vacío se extrajeron las anteras <strong>de</strong> cada una. Luego<br />
la panícula se cubrió con un sobre o bolsa <strong>de</strong> papel y al día sigui<strong>en</strong>te se elimin cualquier espiguilla que tuviera alguna antera y<br />
se realizó la polinización cuando se diera la liberación <strong>de</strong>l pol<strong>en</strong> con la planta que se utiliza como padre. Por último, se<br />
cubrieron <strong>de</strong> nuevo las panícula para proteger las espiguillas y la semilla se revisó tres a cuatro semanas <strong>de</strong>spués <strong>de</strong> realizado<br />
el cruce. Este procedimi<strong>en</strong>to se realizó para cruzar accesiones <strong>de</strong> <strong>arroz</strong> maleza (AR136, AR157, AR556, AR571, AR573,<br />
AR585, AR977, AR993, AR997, AR1002, AR-599, AR-) y las varieda<strong>de</strong>s <strong>de</strong> <strong>arroz</strong> resist<strong>en</strong>tes a herbicida CFX-18 y Puitá-Inta.<br />
Para lo cual, se utilizaron 3 plantas <strong>de</strong> cada accesión <strong>de</strong> <strong>arroz</strong> maleza por tipo <strong>de</strong> cruce. Se realizaron cruces utilizando el <strong>arroz</strong><br />
maleza como madre (receptoras <strong>de</strong> pol<strong>en</strong>) y las varieda<strong>de</strong>s comerciales resist<strong>en</strong>tes al herbicida como padres (donadoras <strong>de</strong><br />
pol<strong>en</strong>) y también el cruce inverso <strong>en</strong> el que el <strong>arroz</strong> maleza fue el donador <strong>de</strong> pol<strong>en</strong> y la variedad comercial la receptora.<br />
La semilla híbrida (F1) obt<strong>en</strong>ida se germinó in vitro con papel filtro y agua <strong>de</strong>stilada estéril, a una temperatura <strong>de</strong> 26 °C, 41%<br />
humedad y fotoperiodo 12/12, hasta alcanzar una altura aproximada <strong>de</strong> 10 cm cuando se trasplantó y se aclimató <strong>en</strong><br />
inverna<strong>de</strong>ro. Junto con esta semilla se germinó semilla <strong>de</strong> líneas par<strong>en</strong>tales <strong>de</strong> <strong>arroz</strong> maleza y las varieda<strong>de</strong>s. Se realizaron 7<br />
evaluaciones cada 15 días, hasta llegar a los 105 días <strong>de</strong> edad, <strong>en</strong> plantas híbridas y líneas par<strong>en</strong>tales. Las variables medidas<br />
fueron: altura <strong>de</strong> la planta (<strong>de</strong>s<strong>de</strong> base hasta hoja más larga), número <strong>de</strong> culmos por planta, número <strong>de</strong> hojas, ancho <strong>de</strong> la hoja
5<br />
ban<strong>de</strong>ra y se registró el tiempo requerido para iniciar la floración. Se comparó promedios <strong>de</strong> altura y número <strong>de</strong> brotes <strong>en</strong>tre los<br />
híbridos y padres por morfotipo y se realizaron curvas <strong>de</strong> crecimi<strong>en</strong>to <strong>de</strong> los híbridos y los padres por tipo sativa e intermedio.<br />
Para <strong>de</strong>terminar difer<strong>en</strong>cias significativas se realizó una prueba <strong>de</strong> difer<strong>en</strong>cia significativa honesta (DSH) <strong>de</strong> Tukey. Asimismo,<br />
se realizó un análisis multivariado <strong>de</strong> compon<strong>en</strong>tes principales (PCA). Una vez que se obtuvo la semilla (F2) una parte se<br />
guardó para las pruebas <strong>de</strong> compet<strong>en</strong>cia y la otra para continuar con el estudio <strong>de</strong> habilidad combinatoria <strong>en</strong> las sigui<strong>en</strong>tes<br />
g<strong>en</strong>eraciones. Para <strong>de</strong>terminar a nivel molecular la pres<strong>en</strong>cia <strong>de</strong>l g<strong>en</strong> <strong>de</strong> resist<strong>en</strong>cia <strong>en</strong> las plantas híbridas, se extrajo ADN<br />
g<strong>en</strong>ómico <strong>de</strong> todas las plantas evaluadas a partir <strong>de</strong> tejido foliar <strong>de</strong>shidratado por dos días <strong>en</strong> una estufa a 50°C. Las hojas se<br />
maceraron con un triturador <strong>de</strong> muestras FastPrep® a una velocidad <strong>de</strong> 6 m/s durante 40 s (2 veces) y se continuó con el<br />
procedimi<strong>en</strong>to <strong>de</strong>l protocolo <strong>de</strong> extracción <strong>de</strong> Lodhi y colaboradores (1994) modificado para <strong>arroz</strong>. El ADN g<strong>en</strong>ómico se visualizó<br />
mediante electroforesis <strong>en</strong> un gel <strong>de</strong> agarosa al 0.8% y fue cuantificado mediante un NanoDrop 2000c (Thermo Sci<strong>en</strong>tific). Se<br />
realizó la <strong>de</strong>tección <strong>de</strong> la mutación S 653 D <strong>en</strong> el g<strong>en</strong> que codifica para la <strong>en</strong>zima acetolactato sintetiza (ALS) pres<strong>en</strong>te <strong>en</strong> la<br />
variedad CFx-18, mediante una reacción <strong>en</strong> ca<strong>de</strong>na <strong>de</strong> la polimerasa (PCR, por sus siglas <strong>en</strong> inglés), utilizando los<br />
imprimadores alelo específicos ALS653ResF (CTGCCTATGATCCCAAGGGA) y ALSR3 REV (TGGGTCATTCAGGTCAAACA)<br />
diseñados por Kadaru y colaboradores (2005). Los productos <strong>de</strong> PCR se visualizaron mediante electroforesis <strong>en</strong> un gel <strong>de</strong><br />
agarosa al 2%. Asimismo, se realizó la <strong>de</strong>tección <strong>de</strong> los híbridos por medio <strong>de</strong> los microsatélites (RM-180, RM-234, RM-251),<br />
los cuales previam<strong>en</strong>te han sido utilizados <strong>en</strong> la i<strong>de</strong>ntificación <strong>de</strong> híbridos <strong>en</strong>tre <strong>arroz</strong> maleza y cultivado (Gealy et al. 2002,<br />
Raguro et al. 2005). Los productos <strong>de</strong> PCR se visualizaron un gel <strong>de</strong> agarosa al 2% <strong>en</strong> una electroforesis. Los protocolos e<br />
información molecular utilizada <strong>en</strong> esta parte <strong>de</strong> los objetivos se dió gracias a la capacitación y transfer<strong>en</strong>cia recibida por<br />
investigadoras y asist<strong>en</strong>tes <strong>de</strong>l CIBCM con la investigadora Luisa Fory <strong>de</strong>l CIAT.<br />
Objetivo 4: El estudio <strong>de</strong> la diversidad g<strong>en</strong>ética y la <strong>de</strong>terminación <strong>en</strong> forma indirecta <strong>de</strong>l flujo génico histórico <strong>en</strong> las<br />
poblaciones <strong>de</strong> <strong>arroz</strong> silvestre O. glumaepatula localizadas <strong>en</strong> el humedal <strong>de</strong>l río Medio Queso (Los Chiles, Alajuela) y<br />
Murciélago (Guanacaste) y el <strong>arroz</strong> cultivado O. sativa inició con la recolecta <strong>de</strong> material silvestre <strong>en</strong> el campo. Se recolectaron<br />
y georefer<strong>en</strong>ciaron las muestras <strong>de</strong> individuos <strong>de</strong> seis poblaciones <strong>de</strong> <strong>arroz</strong> silvestre <strong>de</strong>l humedal <strong>de</strong>l Río Medio Queso <strong>en</strong> Los<br />
Chiles, Alajuela y una <strong>de</strong> Murciélago, Cuajiniquil, Guanacaste <strong>en</strong> Costa Rica. El <strong>arroz</strong> cultivado, se obtuvo <strong>de</strong> plantas<br />
sembradas <strong>en</strong> inverna<strong>de</strong>ro y producidas con semilla g<strong>en</strong>ética <strong>de</strong> las varieda<strong>de</strong>s CR-5272 y CR-1821 donada por el C<strong>en</strong>tro <strong>de</strong><br />
Investigación <strong>en</strong> Granos y Semillas <strong>de</strong> la Universidad <strong>de</strong> Costa Rica (CIGRAS-UCR). Se recolectaron y georefer<strong>en</strong>ciaron 150<br />
muestras <strong>de</strong> O. glumaepatula distribuidas <strong>en</strong> seis poblaciones <strong>de</strong>l humedal <strong>de</strong>l Medio Queso y 20 muestras <strong>de</strong> una población <strong>en</strong><br />
Murciélago. En cada sitio <strong>de</strong> recolecta, se colectaron muestras <strong>de</strong> hoja, se colocaron <strong>en</strong> bolsas <strong>de</strong> plástico etiquetadas <strong>en</strong> una<br />
hielera con hielo, hasta ser trasladadas al laboratorio don<strong>de</strong> se almac<strong>en</strong>aron a -20°C. El ADN total <strong>de</strong> cada muestra se extrajo
6<br />
con un FastDNA ® Kit y con el triturador <strong>de</strong> hojas FastPrep ®. La cantidad y calidad <strong>de</strong>l ADN se visualizó <strong>en</strong> geles <strong>de</strong> agarosa al<br />
1% y se <strong>de</strong>terminó su conc<strong>en</strong>tración con una escalera cuantificación molecular. Un total <strong>de</strong> 150 muestras <strong>de</strong> O. glumaepatula y<br />
diez <strong>de</strong> las varieda<strong>de</strong>s cultivadas <strong>de</strong> <strong>arroz</strong> O. sativa. Se utilizó la técnica molecular AFLP (Amplified Fragm<strong>en</strong>t L<strong>en</strong>gth<br />
Polymorphism, por sus siglas <strong>en</strong> inglés) para hacer el análisis g<strong>en</strong>ético <strong>de</strong> todas las muestras <strong>de</strong> acuerdo con lo <strong>de</strong>scrito por<br />
Vos et al. 1995. Para ello, se siguió el protocolo <strong>de</strong> la compañía Applied Biosystems y se hizo una preamplificación con los<br />
imprimadores M-C y E-A y se evaluaron 32 combinaciones <strong>de</strong> imprimadores para la amplificación selectiva. Las amplificaciones<br />
se realizaron <strong>en</strong> un termociclador Hybaid Sprint. Los fragm<strong>en</strong>tos obt<strong>en</strong>idos <strong>de</strong> la amplificación selectiva fueron separados por<br />
su tamaño <strong>en</strong> un secu<strong>en</strong>ciador ABI 310 <strong>de</strong> Applied Biosystems. Los electroferogramas obt<strong>en</strong>idos se analizaron con el programa<br />
G<strong>en</strong>eMarker. Se analizaron los fragm<strong>en</strong>tos <strong>de</strong> un tamaño <strong>en</strong>tre 150 y 500 pares <strong>de</strong> bases (pb), y se realizó una matriz binaria<br />
según la pres<strong>en</strong>cia (1) o aus<strong>en</strong>cia (0) <strong>de</strong> dichos fragm<strong>en</strong>tos. Se calculó la diversidad g<strong>en</strong>ética <strong>de</strong> seis poblaciones <strong>de</strong> Oryza<br />
glumaepatula <strong>en</strong> Los Chiles y una <strong>de</strong> Guanacaste mediante el índice <strong>de</strong> Shannon y por métodos Bayesianos (Holsinger and<br />
Wallace, 2004). El programa Structure (Pritchard, 2000) se utilizó para confirmar si las poblaciones <strong>de</strong> la especie silvestre <strong>de</strong><br />
Oryza glumaepatula forma grupos que se han cruzado al azar (grupos panmíticos) y también para <strong>de</strong>terminar la exist<strong>en</strong>cia <strong>de</strong><br />
mezcla g<strong>en</strong>ética <strong>en</strong>tre las varieda<strong>de</strong>s comerciales y la especie silvestre.<br />
Objetivo 5. La transfer<strong>en</strong>cia <strong>de</strong> una metodología estandarizada por el C<strong>en</strong>tro Internacional <strong>de</strong> Agricultura Tropical (CIAT) para<br />
el monitoreo a gran escala <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>en</strong>tre O. sativa y las especies silvestres y malezas relacionadas se realizó<br />
mediante una capacitación. Esta actividad se coordinó con los investigadores Dr. Gerardo Gallego y MSc. Luisa Fory <strong>de</strong>l C<strong>en</strong>tro<br />
Internacional <strong>de</strong> Agricultura Tropical (CIAT) qui<strong>en</strong>es aportaron los protocolos <strong>de</strong> la capacitación, infraestructura y reactivos.<br />
Des<strong>de</strong> el punto <strong>de</strong> vista <strong>de</strong> la logística el CIAT cubrió los traslados y almuerzos. El pres<strong>en</strong>te subproyecto financió tiquetes<br />
aéreos, impuestos <strong>de</strong> salida, hospedaje y viáticos para el personal <strong>de</strong> Costa Rica. Para transferir la metodología estandarizada<br />
por el C<strong>en</strong>tro Internacional <strong>de</strong> Agricultura Tropical (CIAT) <strong>en</strong> primera instancia se seleccionaron las personas que recibirían la<br />
capacitación. Para ello, se seleccionaron <strong>en</strong> base a sus conocimi<strong>en</strong>tos <strong>en</strong> biología molecular y su perman<strong>en</strong>cia <strong>en</strong> la institución<br />
ejecutora <strong>de</strong>l proyecto, <strong>de</strong> tal manera que pudieran <strong>en</strong>t<strong>en</strong><strong>de</strong>r los conceptos y protocolos rápidam<strong>en</strong>te y a<strong>de</strong>más ser<br />
capacitadoras <strong>de</strong> la metodología a otros colegas e instituciones una vez finalizada la ejecución <strong>de</strong>l proyecto.<br />
El trabajo <strong>de</strong> laboratorio se coordinó <strong>en</strong> función <strong>de</strong>l objetivo planteado y se trabajó con muestras <strong>de</strong> ADN extraído <strong>de</strong> los<br />
híbridos producidos obt<strong>en</strong>idos <strong>en</strong> Costa Rica por medio <strong>de</strong>l cruce <strong>en</strong>tre las accesiones <strong>de</strong>l <strong>arroz</strong> maleza (madre) y la variedad<br />
<strong>de</strong> <strong>arroz</strong> CFX-18 resist<strong>en</strong>te a herbicida (padre). Se incluyeron como controles el <strong>arroz</strong> maleza, las varieda<strong>de</strong>s <strong>de</strong> Costa Rica, y<br />
la variedad CF205 resist<strong>en</strong>te al herbicida comercializada <strong>en</strong> Colombia y las varieda<strong>de</strong>s no resist<strong>en</strong>tes a herbicida CR-5272, CR-<br />
1821. A<strong>de</strong>más, se recibió capacitación <strong>en</strong> cuanto al protocolo <strong>de</strong> extracción masiva <strong>de</strong> ADN (96 muestras) utilizado <strong>en</strong> yuca por
7<br />
el laboratorio <strong>de</strong>l CIAT. Por último, se hicieron experim<strong>en</strong>tos con la metodología estandarizada para la <strong>de</strong>tección <strong>de</strong>l g<strong>en</strong> <strong>de</strong><br />
resist<strong>en</strong>cia al herbicida <strong>en</strong> el ADN <strong>de</strong> grupos masales <strong>de</strong> plantas <strong>en</strong> <strong>arroz</strong> y por medio <strong>de</strong> la utilización <strong>de</strong> diluciones seriadas<br />
que pue<strong>de</strong> implem<strong>en</strong>tarse para el monitoreo a gran escala <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>en</strong>tre el <strong>arroz</strong> cultivado O. sativa y el <strong>arroz</strong> maleza<br />
y silvestre.<br />
Objetivo 6. El diseño y discusión <strong>de</strong> estrategias <strong>de</strong> manejo para minimizar el flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> ante la ev<strong>en</strong>tual liberación <strong>de</strong> una<br />
<strong>arroz</strong> GM al <strong>arroz</strong> maleza (Oryza sativa) y silvestre (Oryza glumaepatula) se realizó mediante tres activida<strong>de</strong>s. En primera<br />
instancia, conjuntam<strong>en</strong>te con los productores <strong>de</strong> <strong>arroz</strong> que colaboraron con el proyecto, durante las visitas que se realizaron a<br />
los productores <strong>de</strong> <strong>arroz</strong> para la recolecta <strong>de</strong> <strong>arroz</strong> maleza resist<strong>en</strong>te al herbicida, también se procedió a discutir y recopilar<br />
información sobre el manejo que se realiza <strong>en</strong> estas fincas productoras y <strong>en</strong> los lotes <strong>en</strong> don<strong>de</strong> se han <strong>en</strong>contrado problemas <strong>de</strong><br />
resist<strong>en</strong>cia al herbicida <strong>en</strong> el <strong>arroz</strong> maleza. Las fincas colaboradoras fueron El Pelón <strong>de</strong> la Bajura, ubicada <strong>en</strong> Bagaces,<br />
Guanacaste, <strong>en</strong> proyecto contó con el apoyo <strong>de</strong> la Ing. Angélica Villegas Quesada <strong>en</strong>cargada <strong>de</strong> investigación<br />
(avillegas@grupopelon.com) y Ing. Leonel Fernán<strong>de</strong>z, Ger<strong>en</strong>te Agrícola (lfernan<strong>de</strong>z@grupopelon.com) y La Haci<strong>en</strong>da Mojica,<br />
Cañas, Guanacaste con el Ing. Hernán Rodríguez (hrodriar23@gmail.com). Estas dos fincas productoras <strong>de</strong> <strong>arroz</strong> fueron las<br />
primeras que utilizaron la variedad resist<strong>en</strong>te a herbidica <strong>de</strong>s<strong>de</strong> su liberación <strong>en</strong> Costa Rica <strong>en</strong> el 2005. A<strong>de</strong>más, se realizó la<br />
recopilación <strong>de</strong> artículos ci<strong>en</strong>tíficos (fechados <strong>de</strong>s<strong>de</strong> el 2000 hasta 2012) relacionados con el flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>de</strong> <strong>arroz</strong> cultivado<br />
(Oryza sativa) y el manejo <strong>de</strong> varieda<strong>de</strong>s <strong>de</strong> <strong>arroz</strong> resist<strong>en</strong>tes a herbicida. Se realizó un taller <strong>de</strong> dos días y dos días <strong>de</strong> visitas<br />
a las fincas colaboradores todo <strong>en</strong> coordinación con el proyecto <strong>de</strong> capacitación <strong>de</strong> Costa Rica <strong>de</strong>l <strong>LAC</strong>-<strong>Biosafety</strong>. En este<br />
taller, los investigadores <strong>de</strong>l proyecto <strong>de</strong> flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> y <strong>de</strong> los otros subproyectos pres<strong>en</strong>taron los resultados obt<strong>en</strong>idos y<br />
a<strong>de</strong>más se contó con el espacio para discutir y analizar las medidas y estrategias que <strong>de</strong>berían tomarse <strong>en</strong> cu<strong>en</strong>ta ante la<br />
ev<strong>en</strong>tual liberación <strong>de</strong> un <strong>arroz</strong> g<strong>en</strong>éticam<strong>en</strong>te modificado con resist<strong>en</strong>cia al herbicida para evitar y manejar el flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong>.<br />
Es importante <strong>de</strong>stacar que se contó con la visita <strong>de</strong>l Dr. David Gealy, especialista <strong>en</strong> flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>de</strong> <strong>arroz</strong> cultivado al <strong>arroz</strong><br />
maleza, Universidad Arkansas – USDA qui<strong>en</strong> impartió charlas sobre los estudios <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>de</strong>l <strong>arroz</strong> cultivado al <strong>arroz</strong><br />
maleza al utilizar varieda<strong>de</strong>s <strong>de</strong> <strong>arroz</strong> resist<strong>en</strong>tes a herbicidas producidos por mutación e híbridas. Con la finalidad <strong>de</strong> maximizar<br />
los recursos y el tiempo <strong>de</strong>l proyecto para obt<strong>en</strong>er la mayor difusión y posibilidad <strong>de</strong> discutir el tema con los distintos actores<br />
relacionados con el tema <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>en</strong> <strong>arroz</strong>, la estrategia fue t<strong>en</strong>er públicos distintos los tres días. El primer día, el<br />
público meta fue exclusivam<strong>en</strong>te la Comisión Nacional Técnica <strong>de</strong> Bioseguridad (CTNBio) y el segundo día se trató <strong>de</strong> un taller<br />
<strong>en</strong>focado a técnicos <strong>de</strong> empresas distribuidoras <strong>de</strong> agroquímicos, empresas productoras <strong>de</strong> semillas <strong>de</strong> <strong>arroz</strong>, personeros <strong>de</strong> la<br />
Corporación Arrocera Nacional (CONARROZ), <strong>de</strong> la Oficina Nacional <strong>de</strong> Semillas, <strong>de</strong> la Comisión Nacional para la Gestión <strong>de</strong> la
8<br />
Biodiversidad (CONAGEBIO) y la Universidad <strong>de</strong> Costa Rica y Universidad Nacional, Instituto Tecnológico <strong>de</strong> Costa Rica,<br />
estudiantes <strong>de</strong> pregrado y posgrado <strong>de</strong> las carreras <strong>de</strong> Agronomía, Biología y Biotecnología. El tercer y cuarto día, se visitaron<br />
las Finca el Pelón <strong>de</strong> la Bajura y Haci<strong>en</strong>da Mojica <strong>en</strong> don<strong>de</strong> se impartieron las charlas <strong>de</strong>l Dr. David Gealy y visitaron los lotes<br />
más problemáticos y discutió el manejo realizado. El taller, se realizó los días 7 y 8 <strong>de</strong> mayo <strong>de</strong> 2012 y la visita y reuniones <strong>de</strong><br />
campo los días 10 y 11 <strong>de</strong> mayo <strong>de</strong> 2012 (Anexo 2, programas y hojas <strong>de</strong> asist<strong>en</strong>cia).<br />
Objetivo 7. Para producir la guía <strong>de</strong> bioseguridad compilé la información g<strong>en</strong>erada por el subproyecto <strong>en</strong> relación a la<br />
<strong>de</strong>terminación <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> e introgresión <strong>de</strong> O. sativa al <strong>arroz</strong> maleza y silvestre, la información y productos <strong>de</strong>rivados <strong>de</strong><br />
cada objetivo <strong>de</strong>l proyecto se pres<strong>en</strong>tarán <strong>en</strong> el formato <strong>de</strong> una comunicación corta y se <strong>en</strong>tregarán a las autorida<strong>de</strong>s <strong>de</strong><br />
Bioseguridad ambi<strong>en</strong>tal. Por otra parte, esta sirvió <strong>de</strong> insumo para la valoración <strong>de</strong> riesgo ambi<strong>en</strong>tal realizada <strong>en</strong> el marco <strong>de</strong>l<br />
subproyecto “Fortalecimi<strong>en</strong>to <strong>de</strong> la capacidad técnica para la estimación <strong>de</strong>l riesgo ambi<strong>en</strong>tal pot<strong>en</strong>cial <strong>de</strong> cultivos <strong>de</strong> <strong>arroz</strong><br />
modificado g<strong>en</strong>éticam<strong>en</strong>te” por Sergio Bermú<strong>de</strong>z y Fe<strong>de</strong>rico Albertazzi Castro (CIBCM-UCR). Por último, se anexan los pdf <strong>de</strong><br />
las publicaciones
Altura (cm)<br />
Altura (cm)<br />
9<br />
<br />
RESULTADOS OBTENIDOS<br />
Objetivo 1: Adaptabilidad <strong>de</strong> los híbridos <strong>arroz</strong> maleza y <strong>arroz</strong> resist<strong>en</strong>te a herbicida recolectados <strong>en</strong> campo <strong>en</strong> compet<strong>en</strong>cia.<br />
El experim<strong>en</strong>to <strong>de</strong> compet<strong>en</strong>cia bajo series <strong>de</strong> reemplazo mostró que durante la etapa vegetativa <strong>de</strong> las plantas no hubo<br />
difer<strong>en</strong>cias <strong>en</strong> altura <strong>en</strong>tre individuos resist<strong>en</strong>tes (R) y susceptibles al herbicida (S) (Figura 1). La altura promedio <strong>de</strong> las<br />
plantas resist<strong>en</strong>tes fue 74 cm y <strong>en</strong> las susceptibles <strong>de</strong> 73 cm <strong>en</strong> la primera evaluación (1A) y mi<strong>en</strong>tras que <strong>en</strong> la evaluación<br />
realizada 15 días <strong>de</strong>spués la altura fue <strong>de</strong> 80 cm y 79 cm, respectivam<strong>en</strong>te.<br />
100<br />
90<br />
80<br />
70<br />
60<br />
50<br />
40<br />
30<br />
20<br />
10<br />
0<br />
73.74<br />
73.09<br />
0 R/ 100 S 20 R/ 80 S 40 R/ 60 S 60 R/ 40 S 80 R/ 20 S 100 R/ 0 S Promedio<br />
120<br />
100<br />
80<br />
60<br />
40<br />
20<br />
0<br />
79.99<br />
79.18<br />
0 R/ 100 S 20 R/ 80 S 40 R/ 60 S 60 R/ 40 S 80 R/ 20 S 100 R/ 0 S Promedio<br />
Tratami<strong>en</strong>to<br />
R<br />
S<br />
Tratami<strong>en</strong>to<br />
R<br />
S<br />
1A<br />
1B<br />
Figura 1: Altura <strong>de</strong> plantas <strong>de</strong> <strong>arroz</strong> maleza resist<strong>en</strong>tes (R) y susceptibles (S) al herbicida imidazolinona <strong>en</strong> los condiciones <strong>de</strong><br />
compet<strong>en</strong>cia <strong>en</strong> la fase vegetativa (1A: 1 <strong>de</strong> mayo <strong>de</strong> 2012, 1B: 17 <strong>de</strong> mayo 2012).<br />
Al comparar la altura <strong>de</strong> las plantas <strong>en</strong> las difer<strong>en</strong>tes proporciones utilizadas <strong>en</strong> el experim<strong>en</strong>to, tampoco se observan<br />
difer<strong>en</strong>cias importantes. Por lo cual el resultado evi<strong>de</strong>ncia que <strong>en</strong> las condiciones experim<strong>en</strong>tales estudiadas esta característica<br />
no se ve modificada por la resist<strong>en</strong>cia o susceptibilidad al herbicida y no confiere a los híbridos mayor adaptabilidad.<br />
En relación con el número <strong>de</strong> culmos, se observó que las plantas resist<strong>en</strong>tes al herbicida (R), produjeron una cantidad<br />
ligeram<strong>en</strong>te mayor 7,34 y 7,49 <strong>en</strong> promedio que las susceptibles 6,36 y 6,47, <strong>en</strong> todas las proporciones estudiadas <strong>en</strong> el<br />
experim<strong>en</strong>to. Ello evi<strong>de</strong>ncia la alta capacidad <strong>de</strong> las plantas resist<strong>en</strong>tes al herbicida para producir biomasa y ocupar un mayor<br />
espacio.
No. <strong>de</strong> culmos<br />
No. <strong>de</strong> culmos<br />
10<br />
10<br />
9<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
0<br />
7.34<br />
6.36<br />
0 R/ 100 S 20 R/ 80 S 40 R/ 60 S 60 R/ 40 S 80 R/ 20 S 100 R/ 0 S Promedio<br />
10<br />
9<br />
8<br />
7<br />
6<br />
5<br />
4<br />
3<br />
2<br />
1<br />
0<br />
7.49<br />
6.47<br />
`<br />
0 R/ 100 S 20 R/ 80 S 40 R/ 60 S 60 R/ 40 S 80 R/ 20 S 100 R/ 0 S Promedio<br />
Tratami<strong>en</strong>to<br />
R<br />
S<br />
Tratami<strong>en</strong>to<br />
R<br />
S<br />
2A<br />
2B<br />
Figura 2: Número <strong>de</strong> culmos producidos <strong>en</strong> las plantas <strong>de</strong> <strong>arroz</strong> maleza resist<strong>en</strong>tes (R) y susceptibles (S) al herbicida<br />
imidazolinona <strong>en</strong> los condiciones <strong>de</strong> compet<strong>en</strong>cia.<br />
Sin embargo, al inicio <strong>de</strong> la etapa reproductiva los biotipos susceptibles <strong>en</strong> promedio ti<strong>en</strong><strong>en</strong> un mayor número <strong>de</strong> hijos fértiles<br />
(2.44) que los resist<strong>en</strong>tes (1.88). La proporción <strong>de</strong> hijos fértiles también favorece al susceptible con 38% comparado con 26%<br />
<strong>de</strong> hijos fértiles <strong>en</strong> los biotipos resist<strong>en</strong>tes. Esta t<strong>en</strong><strong>de</strong>ncia, se observó <strong>en</strong> una segunda evaluación durante esta fase, <strong>en</strong> don<strong>de</strong><br />
los individuos resist<strong>en</strong>tes (R) <strong>en</strong> promedio t<strong>en</strong>ían un m<strong>en</strong>or número <strong>de</strong> hijos fértiles (3.03) que los susceptibles (4.11) (S) al<br />
herbicida.
11<br />
El éxito competitivo o fitness <strong>de</strong> las plantas R y S se <strong>de</strong>terminó con base <strong>en</strong> la fertilidad <strong>de</strong> las plantas y cantidad <strong>de</strong> semilla<br />
viable producida <strong>en</strong> relación con los cambios <strong>en</strong> la proporción relativa <strong>en</strong>tre individuos R y S <strong>en</strong> las mezclas evaluadas. En la<br />
figura 3 se observa como las plantas resist<strong>en</strong>tes al herbicida son más fértiles que las plantas susceptibles <strong>en</strong> condiciones no<br />
competitivas. La capacidad competitiva <strong>de</strong> las plantas resist<strong>en</strong>tes al herbicida fue muy evi<strong>de</strong>nte e importante al producir mayor<br />
semilla que las plantas susceptibles <strong>en</strong> dos condiciones extremas (80R/20S) y (20R/80S). No obstante, produjeron m<strong>en</strong>os<br />
semilla y por lo tanto fueron m<strong>en</strong>os competitivas que las plantas susceptibles al herbicida <strong>en</strong> proporciones similares (60R/40S y<br />
40R/60S). En términos g<strong>en</strong>erales, los resultados indican que no hay una p<strong>en</strong>alización <strong>en</strong> el éxito competitivo <strong>de</strong> las plantas <strong>de</strong><br />
<strong>arroz</strong> maleza al adquirir la resist<strong>en</strong>cia al herbicida y que las plantas R son más competitivas <strong>en</strong> términos <strong>de</strong> producción <strong>de</strong><br />
semillas que las susceptibles.<br />
Figure. 2. Porc<strong>en</strong>taje <strong>de</strong> fertilidad <strong>de</strong> las plantas resist<strong>en</strong>tes y susceptibles al herbicida imidazolinona según el tratami<strong>en</strong>to <strong>de</strong><br />
<strong>de</strong>nsidad <strong>en</strong> un experim<strong>en</strong>to <strong>de</strong> compet<strong>en</strong>cia <strong>de</strong> series <strong>de</strong> reemplazo.
12<br />
Objetivos 2 y 3: En relación con la habilidad combinatoria se obtuvo un total <strong>de</strong> 467 plantas, <strong>de</strong> las cuales 337 son híbridos<br />
resultantes <strong>de</strong> cruces manuales <strong>en</strong>tre arroces maleza y varieda<strong>de</strong>s CFx-18 (98 plantas) y Puitá INTA (239 plantas) (Cuadro 1).<br />
Lo cual correspon<strong>de</strong> a 10 líneas difer<strong>en</strong>tes <strong>de</strong> acuerdo con la accesión <strong>de</strong> <strong>arroz</strong> maleza que se obtuvieron. No se obtuvieron<br />
semillas híbridas <strong>de</strong> los cruces inversos ya que por un problema fitosanitario con un ataque <strong>de</strong> cochinilla y la pocas semilla<br />
producida se cubrió <strong>de</strong> hongos por lo que se perdieron todas las semillas obt<strong>en</strong>idas. Ante esta situación y por la limitación <strong>de</strong>l<br />
tiempo disponible se <strong>de</strong>cidió conc<strong>en</strong>trar los esfuerzos y evaluaciones <strong>en</strong> la semilla híbrida <strong>de</strong> los cruces obt<strong>en</strong>idos <strong>en</strong>tre el<br />
<strong>arroz</strong> maleza como madre y las varieda<strong>de</strong>s resist<strong>en</strong>tes como padres.<br />
Se evi<strong>de</strong>ncia que el <strong>arroz</strong> comercial y maleza muestran una alta habilidad combinatoria <strong>de</strong>bido a que se produc<strong>en</strong> híbridos con<br />
todos los morfotipos evaluados. Sin embargo esta es difer<strong>en</strong>cial y <strong>de</strong>p<strong>en</strong><strong>de</strong> <strong>en</strong> gran medida <strong>de</strong> las accesiones individuales <strong>de</strong><br />
<strong>arroz</strong> maleza y <strong>de</strong> la variedad comercial. En términos g<strong>en</strong>erales, la hibridación con la variedad Puitá es mayor que con la CFX-<br />
18.<br />
Cuadro 1: Líneas <strong>de</strong> híbridos arroces maleza x varieda<strong>de</strong>s Clearfield (CFx-18 y Puita INTA).<br />
Accesión Morfotipo Tipo<br />
Plantas híbridas<br />
Plantas<br />
par<strong>en</strong>tales<br />
x Puita<br />
x CFx-18<br />
INTA<br />
AR136 WM-023 intermedio 15 13 0<br />
AR157 WM-121 intermedio 18 5 26<br />
AR556 WM-020 sativa 9 9 58<br />
AR571 WM-020 sativa 12 9 2<br />
AR573 WM-020 sativa 16 14 21<br />
AR585 WM-020 sativa 15 28 14<br />
AR977 WM-073 intermedio 9 0 25<br />
AR993 WM-120 sativa 10 20 24<br />
AR997 WM-120 sativa 4 0 67<br />
AR1002 WM-120 sativa 8 0 2<br />
CFx-18 - O. sativa 9 - -<br />
Puita<br />
5<br />
- O. sativa<br />
INTA<br />
- -<br />
Total 130 98 239
13<br />
Las plantas crecieron y se evaluaron <strong>en</strong> condiciones <strong>de</strong> productividad a razón <strong>de</strong> dos plantas por pote. En la primera g<strong>en</strong>eración<br />
(F1) se observó claram<strong>en</strong>te un vigor hídrido <strong>en</strong> las plantas producto <strong>de</strong>l cruce <strong>en</strong>tre el <strong>arroz</strong> maleza (madre) y el <strong>arroz</strong> cultivado<br />
con resist<strong>en</strong>cia a herbicida (padre). La altura que <strong>en</strong> promedio fue <strong>de</strong> 100 a 120 cm, es mayor a la <strong>de</strong>l <strong>arroz</strong> cultivado cuya altura<br />
es <strong>en</strong> promedio 80 cm (Figura 4). Las plantas híbridas son muy similares <strong>en</strong> altura con las líneas maternas <strong>en</strong> ambos cruces<br />
(Puitá y CFx-18), y difier<strong>en</strong> <strong>en</strong> mayor grado con las líneas paternas <strong>en</strong> todos los casos. A<strong>de</strong>más, el promedio el ancho <strong>de</strong> la<br />
hoja ban<strong>de</strong>ra es muy similar <strong>en</strong>tre todos los materiales evaluados las líneas paternas, maternas e híbridos. El número <strong>de</strong><br />
brotes varió según el <strong>arroz</strong> maleza utilizado para el cruce. En el caso <strong>de</strong> los híbridos que tuvieron como madre los morfotipos<br />
(WM-073 y WM-120) se observó un mayor número <strong>de</strong> brotes comparado con sus prog<strong>en</strong>itores. Pero al analizar el número <strong>de</strong><br />
brotes y número <strong>de</strong> panículas no se <strong>en</strong>cu<strong>en</strong>tran difer<strong>en</strong>cias significativas <strong>en</strong>tre los materiales. No obstante se produc<strong>en</strong> 30 a<br />
50% <strong>de</strong> semillas <strong>en</strong> las panículas <strong>de</strong> los híbridos.<br />
a<br />
b b<br />
a<br />
b b<br />
a<br />
b b<br />
a<br />
b<br />
a<br />
a a a<br />
ab<br />
a<br />
b<br />
a<br />
b<br />
a<br />
a<br />
a a<br />
Figura 4. Altura promedio y número <strong>de</strong> brotes (a los 105 dias <strong>de</strong> edad) <strong>de</strong> la línea paterna (Puitá INTA), híbridos (F1) y línea<br />
materna (arroces maleza). Promedios conectados por la misma letra indican difer<strong>en</strong>cias no significativas.
14<br />
Al analizar la curva <strong>de</strong> crecimi<strong>en</strong>to <strong>de</strong> las plantas híbridas <strong>en</strong> comparación con sus prog<strong>en</strong>itores, se observa que los híbriodos<br />
crec<strong>en</strong> más rápidam<strong>en</strong>te sobre todo <strong>en</strong> etapas tempranas <strong>de</strong> la fase vegetativa <strong>en</strong>tre los 20 y 30 días, pero que ti<strong>en</strong><strong>de</strong> a<br />
estabilizarse <strong>en</strong> etapas tardías <strong>de</strong>l crecimi<strong>en</strong>to vegetativo 40 a 60 días (Figura 5). Los resultados muestran un alto vigor híbrido<br />
<strong>de</strong> las plantas <strong>en</strong> etapas tempranas <strong>de</strong>l crecimi<strong>en</strong>to vegetativo pero a<strong>de</strong>más inician su proceso <strong>de</strong> floración y producción <strong>de</strong><br />
semilla más tempranam<strong>en</strong>te.<br />
A) B)<br />
Figura 5. Curva <strong>de</strong> crecimi<strong>en</strong>to <strong>de</strong> los híbridos (línea punteada) y líneas par<strong>en</strong>tales: A) híbridos <strong>en</strong>tre <strong>arroz</strong> maleza y Puitá INTA,<br />
B) híbridos <strong>en</strong>tre <strong>arroz</strong> maleza y CFx-18.<br />
La pres<strong>en</strong>cia <strong>de</strong> la mutación S 653 D se <strong>de</strong>tectó <strong>en</strong> plantas <strong>de</strong> la variedad comercial CFx-18, don<strong>de</strong> se observa un fragm<strong>en</strong>to <strong>de</strong><br />
aproximadam<strong>en</strong>te 150pb. Mi<strong>en</strong>tras que <strong>en</strong> plantas <strong>de</strong> <strong>arroz</strong> maleza que sirvieron como plantas madre no fue <strong>de</strong>tectado ya que<br />
carec<strong>en</strong> <strong>de</strong> la resist<strong>en</strong>cia al herbicida (Figura 6). Una vez, estandarizadas las condiciones <strong>de</strong> amplificación para los controles<br />
positivos y negativos se utilizarán con los híbridos producto <strong>de</strong>l cruce <strong>en</strong>tre el <strong>arroz</strong> maleza con esta variedad. Para la <strong>de</strong>tección<br />
<strong>de</strong> los híbridos, con los microsatélites sólo se obtuvo amplificación con el RM-234. Sin embargo, este permite difer<strong>en</strong>ciar<br />
claram<strong>en</strong>te la variedad comercial CFX-18, el <strong>arroz</strong> maleza y los híbridos producto <strong>de</strong>l cruce <strong>en</strong>tre estas dos plantas (Figura 7).<br />
Mi<strong>en</strong>tras que los imprimadores RM-180 y RM-251 no se obtuvieron productos <strong>de</strong> amplificación. Sin embargo, este resultado<br />
obe<strong>de</strong>ce a que se requiere un cambio <strong>en</strong> la temperatura <strong>de</strong> annealing durante la reacción <strong>de</strong> PCR para obt<strong>en</strong>er la amplificación<br />
<strong>de</strong>seada.
15<br />
Figura 6: Detección <strong>de</strong> la mutación S 653 utilizando los iniciadores ALS653ResF (CTGCCTATGATCCCAAGGGA) y ALSR3 REV<br />
(TGGGTCATTCAGGTCAAACA)diseñados por Kadaru et al. (2005). Línea 1: control variedad CF (Colombia), línea 2: variedad<br />
CFx-18 (planta 1), línea 3: CFx-18 (planta 6), línea 4: CFx-18 (planta 8), línea 5: AR997 (planta 9), línea 6: AR136 (planta 16),<br />
línea 7: control negativo (agua), línea 8: marcador molecular (50 pb).<br />
Figura 7: Detección <strong>de</strong> los híbridos mediante tipo RM-234. Línea 1: CFx-18 (planta 3), línea 2: híbrido 5.1 (AR136 x CFx-18),<br />
línea 3: híbrido 27.10 (AR993 x CFx-18), línea 4: híbrido 28.1 (AR993 x CFx-18), línea 5: AR573 (planta 7), línea 6: AR993<br />
(planta 15), línea 7: control negativo (agua), línea 8: marcador molecular (50 pb).
16<br />
Al realizar un análisis <strong>de</strong> compon<strong>en</strong>tes principales con las variables medidas <strong>en</strong> las plantas, se observa que no hay una<br />
agrupación clara <strong>de</strong> los datos (Figura 8), los híbridos traslapan con las líneas maternas, y lo mismo ocurre <strong>en</strong>tre los arroces<br />
maleza y la variedad CFx-18. A<strong>de</strong>más, se observa una alta contribución por parte <strong>de</strong> las variables altura y ancho <strong>de</strong> hoja<br />
ban<strong>de</strong>ra <strong>en</strong> el compon<strong>en</strong>te 1, que explican 91% <strong>de</strong> la varianza y una baja contribución por parte <strong>de</strong>l número <strong>de</strong> brotes y número<br />
<strong>de</strong> panículas que explican un 5.8% <strong>de</strong> la varianza total <strong>de</strong> los datos <strong>en</strong> el compon<strong>en</strong>te 2. A<strong>de</strong>más, se <strong>en</strong>contró que cuatro<br />
variables que explican el 96% <strong>de</strong>l porc<strong>en</strong>taje <strong>de</strong> la varianza <strong>de</strong> los datos <strong>en</strong> la fase vegetativa. Al analizar estas variables, se<br />
observa que los híbridos <strong>en</strong> madurez pose<strong>en</strong> pocas difer<strong>en</strong>cias morfológicas <strong>en</strong>tre las líneas maternas y la variedad comercial.<br />
Figura 8: Análisis <strong>de</strong> compon<strong>en</strong>tes principales (PCA) para la comparación <strong>de</strong> los híbridos (F1) con las líneas maternas (Arroz<br />
maleza) y paternas (varieda<strong>de</strong>s comerciales) <strong>en</strong> relación con el número <strong>de</strong> brotes, longitud <strong>de</strong> la panícula, ancho <strong>de</strong> la hoja<br />
ban<strong>de</strong>ra y altura. Variación explicada por el compon<strong>en</strong>te 1 (91%), compon<strong>en</strong>te 2 (5.8%). La longitud <strong>de</strong> la línea ver<strong>de</strong> significa la<br />
magnitud <strong>de</strong>l cambio <strong>en</strong> la variable medida.
17<br />
Al analizar estas variables <strong>en</strong> forma in<strong>de</strong>p<strong>en</strong>di<strong>en</strong>te se <strong>en</strong>cu<strong>en</strong>tra que la altura es muy similar <strong>en</strong>tre los híbridos y las líneas<br />
maternas, difer<strong>en</strong>ciándose <strong>en</strong> mayor grado <strong>de</strong> las líneas paternas. A<strong>de</strong>más, el promedio <strong>de</strong>l ancho <strong>de</strong> la hoja ban<strong>de</strong>ra es muy<br />
similar <strong>en</strong>tre las líneas paternas, maternas e híbridos y al analizar el número <strong>de</strong> brotes y número <strong>de</strong> panículas, no se <strong>en</strong>cu<strong>en</strong>tran<br />
difer<strong>en</strong>cias significativas <strong>en</strong>tre sí Al no existir una agrupación clara <strong>de</strong> los datos indica que no hay difer<strong>en</strong>cias importantes <strong>en</strong>tre<br />
la morfología <strong>de</strong> los híbridos y las líneas maternas. Sin embargo, sí existe una ligera agrupación <strong>de</strong> los datos <strong>de</strong> las varieda<strong>de</strong>s<br />
comerciales. Esto concuerda con la gran variación que pose<strong>en</strong> los arroces maleza (Arrieta-Espinoza et al. 2005), así como los<br />
híbridos <strong>de</strong>sc<strong>en</strong>di<strong>en</strong>tes <strong>de</strong> estas líneas. Mi<strong>en</strong>tras que para las varieda<strong>de</strong>s comerciales es m<strong>en</strong>os variable <strong>de</strong>bido a los procesos<br />
<strong>de</strong> domesticación por el cual son seleccionadas estas plantas (Lawton-Rauh y Burgos 2010). A<strong>de</strong>más, este análisis se ve<br />
afectado por la cantidad <strong>de</strong> datos disponibles para la línea paterna (n=8), que <strong>en</strong> comparación con las líneas maternas o<br />
morfotipos es muy bajo por lo que, se recomi<strong>en</strong>da aum<strong>en</strong>tar el tamaño <strong>de</strong> muestra <strong>de</strong> la variedad comercial e igualar los datos<br />
disponibles.<br />
Objetivo 4: En cuanto a la diversidad g<strong>en</strong>ética, se <strong>en</strong>contró una mayor diversidad <strong>en</strong> la especie silvestre O. glumaepatula, que<br />
pres<strong>en</strong>ta 84.2% <strong>de</strong> polimorfismo <strong>en</strong>tre las plantas mi<strong>en</strong>tras que es <strong>de</strong> 34.3% para el <strong>arroz</strong> cultivado, confirmado con el índice <strong>de</strong><br />
Shannon para Oryza glumaepatula fue <strong>de</strong> H’ = 0.177 y para el <strong>arroz</strong> cultivado fue H’=0.135. Asimismo, se <strong>en</strong>contró una clara<br />
difer<strong>en</strong>ciación g<strong>en</strong>ética <strong>en</strong>tre ambas especies (Φ ST =0.161, p
18<br />
Figura 9. Nivel <strong>de</strong> mezcla g<strong>en</strong>ética <strong>en</strong>tre individuos <strong>de</strong> Oryza glumaepatula y la variedad comercial (O. sativa). El color rojo<br />
<strong>de</strong>nota los marcadores predominantes <strong>en</strong> O. glumaepatula y el ver<strong>de</strong> <strong>en</strong> el <strong>arroz</strong> cultivado. Los individuos <strong>de</strong>l “Muro” y<br />
“Guanacaste” pres<strong>en</strong>tan barras <strong>de</strong> dos colores.<br />
Se <strong>en</strong>contró que el 70% <strong>de</strong> los individuos recolectados <strong>en</strong> Muro <strong>de</strong> Los Chiles y Murciélago, Guanacaste pres<strong>en</strong>tan cierta<br />
mezcla g<strong>en</strong>ética con las varieda<strong>de</strong>s comerciales. Obsérvese que los individuos <strong>de</strong> estas dos poblaciones aunque ti<strong>en</strong><strong>en</strong> barras<br />
predominantem<strong>en</strong>te rojas, indicadoras <strong>de</strong> los marcadores <strong>de</strong> la especie silvestre, también pres<strong>en</strong>tan secciones ver<strong>de</strong>s que<br />
correspon<strong>de</strong>n a marcadores <strong>de</strong>l <strong>arroz</strong> cultivado. Los resultados <strong>de</strong> esta investigación permit<strong>en</strong> concluir que existe el pot<strong>en</strong>cial<br />
<strong>de</strong> flujo génico <strong>en</strong>tre la especie silvestre Oryza glumaepatula y el <strong>arroz</strong> cultivado Oryza sativa lo que conlleva una <strong>de</strong>bida<br />
consi<strong>de</strong>ración <strong>de</strong>s<strong>de</strong> el punto <strong>de</strong> vista <strong>de</strong> la bioseguridad ambi<strong>en</strong>tal.<br />
Así mismo, se <strong>de</strong>staca la necesidad <strong>de</strong> utilizar un marcador g<strong>en</strong>ético que permita <strong>de</strong>terminar la magnitud y dirección <strong>de</strong>l flujo <strong>en</strong><br />
forma directa ya que datos previos mostraron que los híbridos <strong>en</strong>tre estas especies <strong>en</strong> forma manual (glumaepatula x sativa) no<br />
son fértiles.<br />
Objetivo 5. Asistieron a la capacitación Cindy Aguilar Bartels y Griselda Arrieta-Espinoza, qui<strong>en</strong>es son parte <strong>de</strong>l personal <strong>de</strong>l<br />
CIBCM. A<strong>de</strong>más, se seleccionó a la estudiante <strong>de</strong> biología El<strong>en</strong>a Vásquez Céspe<strong>de</strong>s qui<strong>en</strong> actualm<strong>en</strong>te realiza su tesis <strong>de</strong><br />
lic<strong>en</strong>ciatura <strong>en</strong> biología <strong>en</strong> el marco <strong>de</strong>l proyecto <strong>de</strong> investigación pero qui<strong>en</strong> ingresará al sistema <strong>de</strong> estudios <strong>de</strong> Posgrado <strong>de</strong> la<br />
Universidad <strong>de</strong> Costa Rica una vez concluida su lic<strong>en</strong>ciatura. La capacitación <strong>de</strong>l personal <strong>de</strong>l C<strong>en</strong>tro <strong>de</strong> investigación <strong>en</strong><br />
Biología Celular y Molecular <strong>de</strong> la Universidad <strong>de</strong> Costa Rica (CIBCM-UCR) <strong>en</strong> el C<strong>en</strong>tro Internacional <strong>de</strong> Agricultura Tropical<br />
(CIAT) permitió obt<strong>en</strong>er metodologías para la confirmación molecular <strong>de</strong> los híbridos <strong>de</strong> <strong>arroz</strong> maleza x <strong>arroz</strong> con resist<strong>en</strong>cia a<br />
herbicida para las dos varieda<strong>de</strong>s <strong>de</strong> <strong>arroz</strong> con resist<strong>en</strong>cia a herbicida disponibles <strong>en</strong> el mercado. Asimismo, se transfirió al<br />
CIBCM una metodología estandarizada para la <strong>de</strong>tección <strong>de</strong>l g<strong>en</strong> <strong>de</strong> resist<strong>en</strong>cia al herbicida <strong>en</strong> el ADN <strong>de</strong> grupos <strong>de</strong> 7 plantas
19<br />
que pue<strong>de</strong> implem<strong>en</strong>tarse para el monitoreo a gran escala <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>en</strong>tre el <strong>arroz</strong> cultivado O. sativa y el <strong>arroz</strong> maleza<br />
y silvestre. Durante la capacitación se utilizó ADN extraído <strong>de</strong> los híbridos <strong>en</strong>tre el cruce <strong>de</strong>l <strong>arroz</strong> maleza y las varieda<strong>de</strong>s<br />
comerciales <strong>de</strong> <strong>arroz</strong> resist<strong>en</strong>tes al herbicida CFX-18 y Puitá producidos <strong>en</strong> Costa Rica. Se utilizó un set <strong>de</strong> imprimadores alelo<br />
específicos (Cuadro 2) que permitiera la amplificación <strong>de</strong> un producto relacionado con los sitios <strong>de</strong> la mutación <strong>en</strong> la <strong>en</strong>zima<br />
ALS (Acetolactato sintetasa) que es la misma para la variedad CFX-18 (Costa Rica) y CF 205 (Colombia) que se <strong>en</strong>cu<strong>en</strong>tra <strong>en</strong><br />
ambas <strong>en</strong> la posición S 653 D. A<strong>de</strong>más, permite la <strong>de</strong>tección <strong>de</strong> los alelos <strong>en</strong> forma homocigota o heterocigota (resist<strong>en</strong>te) y el<br />
susceptible.<br />
Cuadro 2: Información <strong>de</strong> los imprimadores relacionados con las mutaciones <strong>en</strong> la <strong>en</strong>zima ALS <strong>en</strong> las posiciones S654D y<br />
S653D. Tomado <strong>de</strong> Kaduro et al. 2005 y CIAT, 2005.<br />
Serina 654 Aspargina<br />
(susceptible)<br />
Serina 654 Aspargina<br />
(resist<strong>en</strong>te)<br />
ALS645Sus F: 5´- CTG CCT ATG ATC CCA AGG GG-3´<br />
ALS645ResF: 5´- CTG CCT ATG ATC CCA AGG GA-3´<br />
Detección<br />
homocigotas<br />
resist<strong>en</strong>tes<br />
(mutación S653D).<br />
CIAT, 2005.<br />
ALS-R1 12-76 FOR: 5´- AGCATGTGCTGCCTATGATCCCAAGTAA-3´<br />
ALS-R1 12-76 REV: 5´- TACATGATATCTTGTGATGCATATGCCTACGG-3´<br />
Ser 653 Asparagina<br />
(susceptible)<br />
Ser 653 Asparagina<br />
(resist<strong>en</strong>te)<br />
ALS653SusF: 5´- GTG CTG CCT ATG ATC CTA AG-3´<br />
ALS653ResF: 5´- CTG CCT ATG ATC CCA AGG GA-3´<br />
Detección <strong>de</strong><br />
heterocigotas<br />
(mutación S653D).<br />
CIAT, 2005.<br />
ALS-R2 14-74 FOR: 5´- CATGTGCTGCCTATGATCCCAAATGA -3´<br />
ALS-R2 14-74 REV: 5´- GTAGGACAAGAAACTTACATGATATCTTGTGATGCA-3´<br />
Imprimador reverse<br />
ALSR3 REV: 5´- TGG GTC ATT CAG GTC AAA CA-3´<br />
Detección<br />
homocigotas<br />
susceptibles<br />
2005.<br />
CIAT,<br />
ALS-S3 18-73 FOR: 5´- ATCATGTCCTTGAATGCGCGCC -3´<br />
ALS-S3 18-73 REV: 5´- GAGTTGGCATTGATCCGCATTGAGA-3´<br />
Es importante <strong>de</strong>stacar, que los protocolos se transfirieron efectivam<strong>en</strong>te al CIBCM-UCR ya los resultados moleculares que se<br />
pres<strong>en</strong>taron <strong>en</strong> la sección <strong>de</strong> los objetivos 2 y 3, son similares a los que se dieron durante la capacitación recibida <strong>en</strong> el CIAT.
Objetivo 6. Durante las visitas a los productores <strong>de</strong> <strong>arroz</strong> para la recolecta <strong>de</strong> <strong>arroz</strong> maleza resist<strong>en</strong>te al herbicida también se<br />
obtuvo información con respecto al manejo que se realiza <strong>en</strong> el campo al utilizar el <strong>arroz</strong> IMI, resist<strong>en</strong>te a imidazolinonas.<br />
Aunque hay pequeñas variaciones <strong>de</strong>p<strong>en</strong>di<strong>en</strong>do <strong>de</strong> las fincas, <strong>en</strong> términos g<strong>en</strong>erales los productores usuarios <strong>de</strong>l sistema <strong>de</strong><br />
<strong>arroz</strong> Clearfield, sigu<strong>en</strong> los procedimi<strong>en</strong>tos <strong>de</strong> administración y manejo establecidos (“stewardship”) por la compañía que<br />
distribuye la semilla. Básicam<strong>en</strong>te, el procedimi<strong>en</strong>to consiste <strong>en</strong> la firma <strong>de</strong> un compromiso por parte <strong>de</strong>l usuario cuando se<br />
compra la semilla <strong>de</strong> <strong>arroz</strong> y <strong>de</strong>l herbicida necesario para realizar únicam<strong>en</strong>te dos aplicaciones. Estas <strong>de</strong>b<strong>en</strong> servir para el<br />
control <strong>de</strong> malezas. Durante el ciclo <strong>de</strong> utilización <strong>de</strong> la variedad resist<strong>en</strong>te al herbicida se realiza un monitoreo para evaluar la<br />
efectividad <strong>de</strong> la aplicación. El otro punto importante es que sólo se pue<strong>de</strong> sembrar la variedad resist<strong>en</strong>te al herbicida durante<br />
dos ciclos consecutivos <strong>de</strong> producción. Después <strong>de</strong> este tiempo, <strong>de</strong>be realizarse una rotación con una variedad conv<strong>en</strong>cional.<br />
Ahora bi<strong>en</strong>, <strong>en</strong> base <strong>en</strong> las conversaciones con los productores y con los profesionales que asistieron a los talleres <strong>de</strong> flujo <strong>de</strong><br />
<strong>g<strong>en</strong>es</strong> <strong>en</strong> <strong>arroz</strong> se evi<strong>de</strong>ncia que este sistema es poco efectivo para prev<strong>en</strong>ir el flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> cuando no se está utilizando la<br />
variedad con la resist<strong>en</strong>cia al herbicida. Actualm<strong>en</strong>te, únicam<strong>en</strong>te se cu<strong>en</strong>ta con una variedad <strong>de</strong> <strong>arroz</strong> con un solo modo <strong>de</strong><br />
acción que inhibe la formación <strong>de</strong> aminoácidos y los monitoreos a gran escala <strong>en</strong> las fincas arroceras no son funcionales para la<br />
<strong>de</strong>tección <strong>de</strong> híbridos o <strong>de</strong> plantas que escap<strong>en</strong> a la aplicación <strong>de</strong>l herbicida. Por lo tanto, el manejo <strong>de</strong> una ev<strong>en</strong>tual variedad<br />
<strong>de</strong> <strong>arroz</strong> GM con resist<strong>en</strong>cia a herbicida <strong>de</strong>bería establecer un manejo integral y prev<strong>en</strong>tivo <strong>de</strong> eliminación y control <strong>de</strong> malezas<br />
y plantas voluntarias <strong>de</strong> <strong>arroz</strong> <strong>en</strong> los lotes antes y <strong>de</strong>spués <strong>de</strong> la utilización <strong>de</strong> una variedad <strong>de</strong> <strong>arroz</strong> resist<strong>en</strong>te al herbicida. No<br />
sólo <strong>de</strong>be <strong>en</strong>focarse <strong>en</strong> la resist<strong>en</strong>cia al herbicida como única fu<strong>en</strong>te <strong>de</strong> manejo y control <strong>de</strong> malezas, para disminuir la presión<br />
<strong>de</strong> selección sobre los posibles híbridos producto <strong>de</strong>l cruzami<strong>en</strong>to <strong>en</strong>tre el <strong>arroz</strong> maleza y la variedad comercial y evitar su<br />
establecimi<strong>en</strong>to. Actualm<strong>en</strong>te la producción <strong>de</strong> <strong>arroz</strong> con resist<strong>en</strong>cia al herbicida se <strong>en</strong>foca <strong>en</strong> la eliminación <strong>de</strong> plántulas<br />
prov<strong>en</strong>i<strong>en</strong>tes <strong>de</strong>l banco <strong>de</strong> semillas o reman<strong>en</strong>tes <strong>de</strong> la cosecha anterior. El método más efici<strong>en</strong>te, se c<strong>en</strong>tra <strong>en</strong> el manejo <strong>de</strong> la<br />
lámina <strong>de</strong> agua para inducir germinación y luego mediante aplicaciones <strong>de</strong> herbicida Glifosato o maquinaria que arranca las<br />
plántulas <strong>de</strong>l suelo disminuir el banco <strong>de</strong> semilla <strong>de</strong> <strong>arroz</strong>, también la utilización <strong>de</strong> antídotos <strong>de</strong>spués <strong>de</strong> la siembra, estos<br />
productos están <strong>en</strong> evaluación <strong>en</strong> el país. Por otra parte, sería imperante la utilización <strong>de</strong> semilla certificada que t<strong>en</strong>ga 0<br />
semillas <strong>de</strong> <strong>arroz</strong> maleza por kilogramo <strong>de</strong> <strong>arroz</strong> ya que actualm<strong>en</strong>te se permit<strong>en</strong> 2 semillas por kilo <strong>de</strong> <strong>arroz</strong> certificado lo cual<br />
sería inadmisible para el caso <strong>de</strong> un <strong>arroz</strong> GM con resist<strong>en</strong>cia a herbicida. Otra <strong>de</strong> las características que <strong>de</strong>b<strong>en</strong> contemplarse<br />
<strong>en</strong> el contexto <strong>de</strong> un posible manejo <strong>de</strong> un <strong>arroz</strong> GM es el arri<strong>en</strong>do <strong>de</strong> tierras para la producción <strong>de</strong> <strong>arroz</strong>. En las condiciones<br />
locales no todos los productores son propietarios y por lo tanto no necesariam<strong>en</strong>te emplean o inviert<strong>en</strong> <strong>en</strong> las medidas que<br />
asegur<strong>en</strong> un a<strong>de</strong>cuado control fitosanitario <strong>en</strong> las tierras. Sería una consi<strong>de</strong>ración importante que ante la ev<strong>en</strong>tual liberación <strong>de</strong><br />
un <strong>arroz</strong> GM que implica la necesidad previa <strong>de</strong>l <strong>de</strong>sarrollo <strong>de</strong> protocolos y experim<strong>en</strong>tos <strong>de</strong> manejo <strong>de</strong>l <strong>arroz</strong> <strong>en</strong> campo antes<br />
<strong>de</strong> la liberación <strong>de</strong> una variedad transgénica para evitar flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> e introgresión <strong>de</strong> la característica <strong>de</strong> resist<strong>en</strong>cia al<br />
herbicida hacia el <strong>arroz</strong> maleza.<br />
20
21<br />
Por otra parte, los resultados <strong>de</strong>l proyecto indican que existe la posibilidad <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>de</strong>l <strong>arroz</strong> comercial al silvestre, <strong>en</strong><br />
este esc<strong>en</strong>ario el manejo <strong>de</strong> una ev<strong>en</strong>tual liberación <strong>de</strong> <strong>arroz</strong> GM implicaría la <strong>de</strong>limitación <strong>de</strong> zonas <strong>de</strong> exclusión para la<br />
siembra <strong>de</strong> estos materiales <strong>en</strong> las zonas <strong>en</strong> don<strong>de</strong> crec<strong>en</strong> la especie silvestre O. glumaepatula compatible con el <strong>arroz</strong>.<br />
En cuanto a los resultados <strong>de</strong>l taller <strong>de</strong> Bioseguridad Ambi<strong>en</strong>tal, el día 7 <strong>de</strong> mayo asistieron ocho miembros <strong>de</strong> la Comisión<br />
Técnica Nacional <strong>de</strong> Bioseguridad, dos asist<strong>en</strong>tes <strong>de</strong> investigación, seis expositores y el coordinador nacional <strong>de</strong>l proyecto. En<br />
el caso <strong>de</strong>l segundo día, 8 <strong>de</strong> mayo <strong>de</strong> 2012 se contó con la pres<strong>en</strong>cia <strong>de</strong> 25 personas proce<strong>de</strong>ntes <strong>de</strong> empresas (BASF,<br />
INARROZ, DUWEST), instituciones públicas CONARROZ, Oficina Nacional <strong>de</strong> Semillas, Ministerio <strong>de</strong> Agricultura-INTA,<br />
investigadores y estudiantes <strong>de</strong> la Universidad <strong>de</strong> Costa Rica y Universidad Nacional. Se cumplió a cabalidad el objetivo <strong>de</strong> la<br />
actividad que era pres<strong>en</strong>tar y discutir por con las autorida<strong>de</strong>s <strong>en</strong> bioseguridad ambi<strong>en</strong>tal y con profesionales y actores <strong>de</strong>l sector<br />
arrocero <strong>de</strong>l país, los resultados <strong>de</strong>l proyecto, brindar y aclarar conceptos básicos sobre flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong>, resist<strong>en</strong>cia y tolerancia<br />
a herbicidas, dormancia <strong>de</strong> semillas <strong>de</strong> <strong>arroz</strong>, adaptabilidad <strong>de</strong> los híbridos (Anexo 1).<br />
Se realizó la recopilación <strong>de</strong> 100 artículos ci<strong>en</strong>tíficos relacionados con el flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>de</strong> <strong>arroz</strong> cultivado (Oryza sativa) y el<br />
manejo <strong>de</strong> varieda<strong>de</strong>s <strong>de</strong> <strong>arroz</strong> resist<strong>en</strong>tes a herbicida, que se <strong>en</strong>tregarán a las autorida<strong>de</strong>s <strong>de</strong> Bioseguridad Ambi<strong>en</strong>tal <strong>de</strong>l país,<br />
para la actualización <strong>de</strong> sus bases <strong>de</strong> datos. (Detalle <strong>en</strong> Anexo 2: Listado <strong>de</strong> artículos reci<strong>en</strong>tes para la actualización <strong>de</strong> las<br />
bases <strong>de</strong> datos <strong>de</strong>l Programa <strong>de</strong> Biotecnología <strong>de</strong>l Programa Fitosanitario <strong>de</strong>l Estado <strong>de</strong>l Ministerio <strong>de</strong> Agricultura).<br />
Objetivo 7. Para Producir una guía <strong>de</strong> bioseguridad que compile la información g<strong>en</strong>erada por el subproyecto <strong>en</strong> relación a la<br />
<strong>de</strong>terminación <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> e introgresión <strong>de</strong> O. sativa al <strong>arroz</strong> maleza y silvestre La información y productos <strong>de</strong>rivados <strong>de</strong><br />
cada objetivo <strong>de</strong>l subproyecto y que se están suministrando <strong>en</strong> el formato <strong>de</strong> informe final <strong>en</strong> este mom<strong>en</strong>to se <strong>en</strong>tregarán a<br />
finales <strong>de</strong>l 2012 <strong>en</strong> el formato <strong>de</strong> comunicación corta a las autorida<strong>de</strong>s <strong>de</strong> Bioseguridad Ambi<strong>en</strong>tal nacionales. A la fecha <strong>de</strong><br />
pres<strong>en</strong>tación <strong>de</strong> este informe, se <strong>en</strong>tregó y contribuyó activam<strong>en</strong>te <strong>en</strong> el planteami<strong>en</strong>to <strong>de</strong> preguntas y variables para la<br />
valoración <strong>de</strong> riesgo ambi<strong>en</strong>tal realizada por el consultor Sergio Bermú<strong>de</strong>z a cargo <strong>de</strong> ese subproyecto.
22<br />
<br />
LECCIONES APRENDIDAS<br />
1. Efecto <strong>de</strong> p<strong>en</strong>alización <strong>en</strong> la adaptabilidad <strong>de</strong> los híbridos producto <strong>de</strong>l cruce <strong>en</strong>tre el <strong>arroz</strong> maleza x <strong>arroz</strong> resist<strong>en</strong>te a<br />
herbicida y su competitividad.<br />
2. Determinación <strong>de</strong> las características que <strong>de</strong>terminan la habilidad combinatoria <strong>en</strong>tre el <strong>arroz</strong> cultivado y maleza mediante<br />
cruces artificiales.<br />
3. Información ci<strong>en</strong>tífica sobre la diversidad g<strong>en</strong>ética <strong>de</strong> la especie silvestre <strong>de</strong> <strong>arroz</strong> O. glumaepatula localizadas <strong>en</strong> el<br />
humedal <strong>de</strong>l río Medio Queso (Los Chiles, Alajuela) y Murciélago (Guanacaste) a nivel intrapoblacional e interpoblacional <strong>en</strong> un<br />
c<strong>en</strong>tro <strong>de</strong> diversidad tropical.<br />
4. Información indirecta sobre la posibilidad <strong>de</strong> flujo génico histórico <strong>en</strong>tre <strong>arroz</strong> cultivado O. sativa y el silvestre O.<br />
glumaepatula.<br />
5. La ejecución <strong>de</strong>l proyecto <strong>de</strong> flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>en</strong> <strong>arroz</strong> <strong>en</strong> el marco <strong>de</strong>l proyecto <strong>LAC</strong>-<strong>Biosafety</strong> permitió la obt<strong>en</strong>ción <strong>de</strong><br />
resultados sobre la diversidad <strong>de</strong> la especie silvestre Oryza glumaepatula que reflejan la necesidad <strong>de</strong> tomar las medidas<br />
para proteger importante recurso filog<strong>en</strong>ético <strong>de</strong> <strong>arroz</strong> <strong>de</strong>l humedal <strong>de</strong>l Río Medio Queso<br />
6. Transfer<strong>en</strong>cia <strong>de</strong> una metodología para la <strong>de</strong>tección alelo específica <strong>de</strong> la resist<strong>en</strong>cia al herbicida imidazolinona y el<br />
monitoreo a gran escala <strong>de</strong>l flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> O. sativa y el <strong>arroz</strong> maleza y silvestre <strong>de</strong>l C<strong>en</strong>tro Internacional <strong>de</strong> Agricultura Tropical<br />
(CIAT) al C<strong>en</strong>tro <strong>de</strong> Investigación <strong>en</strong> Biología Celular y Molecular.<br />
7. G<strong>en</strong>eración <strong>de</strong> información y metodologías ci<strong>en</strong>tíficas sobre flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>en</strong> <strong>arroz</strong> transferida a los reguladores <strong>en</strong> forma<br />
<strong>de</strong> talleres <strong>de</strong> discusión.<br />
8. Formación y capacitación <strong>de</strong> personal a distintos niveles, estudiantes, técnicos, profesionales <strong>en</strong> el área <strong>de</strong> flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> y<br />
la bioseguridad ambi<strong>en</strong>tal.<br />
9. Importancia <strong>de</strong> realizar un estudio para comparar la diversidad g<strong>en</strong>ética y el flujo <strong>de</strong> <strong>g<strong>en</strong>es</strong> <strong>de</strong> la especie silvestre <strong>de</strong> <strong>arroz</strong><br />
Oryza glumaepatula <strong>en</strong> los países latinoamericanos <strong>en</strong> don<strong>de</strong> se ha <strong>en</strong>contrado esta especie silvestre tales como Colombia,<br />
V<strong>en</strong>ezuela y Brasil.<br />
.
Jan 2010<br />
January 2010<br />
Programada<br />
September 2010<br />
Efectiva<br />
August 2011<br />
Sep 2010<br />
August 2010<br />
Programada<br />
September 2011<br />
Aug 2010<br />
September 2010<br />
Efectiva<br />
Jan 2011<br />
August 2011<br />
May 2012<br />
23<br />
2. Cuadro resum<strong>en</strong> avance <strong>de</strong> activida<strong>de</strong>s subproyecto<br />
Subproject: G<strong>en</strong>e flow from O. sativa cultivated rice to weedy (O. sativa) and wild (O. glumaepatula) rice in a tropical c<strong>en</strong>ter of diversity: g<strong>en</strong>etic structure of wild rice<br />
natural populations and fitness of hybrids betwe<strong>en</strong> crop and weedy forms.<br />
Fecha<br />
inicio<br />
Fecha<br />
final<br />
Indicadores <strong>de</strong> resultados por actividad<br />
Comprometidos<br />
Obt<strong>en</strong>idos a la fecha <strong>de</strong> pres<strong>en</strong>tación <strong>de</strong>l informe<br />
(20 junio 2012)<br />
Objective 1: To study the fitness of weedy-herbici<strong>de</strong> resistant IMI-rice hybrids in a gre<strong>en</strong>house controlled <strong>en</strong>vironm<strong>en</strong>t, from samples collected in<br />
rice fields un<strong>de</strong>r natural competitive conditions.<br />
1.a Monitoring of rice fields<br />
where commercial IMI rice is<br />
produced to collect plants<br />
surviving after commercial<br />
application of imidazolinone<br />
herbici<strong>de</strong>.<br />
Preliminary observations in commercial IMI rice fields<br />
have shown plants surviving after commercial application<br />
of imidazolinone herbici<strong>de</strong>.<br />
1. I<strong>de</strong>ntification and georefer<strong>en</strong>ce of t<strong>en</strong> rice fields where weedy<br />
rice plants escape herbici<strong>de</strong> treatm<strong>en</strong>ts. Perc<strong>en</strong>tage of execution:<br />
100% completed<br />
1.b Collecting of putative<br />
weedy-IMI rice hybrids in IMIrice<br />
fields.<br />
At least t<strong>en</strong> weedy rice plants surviving the application of<br />
imidazolinone herbici<strong>de</strong>s morphologically characterized<br />
in each selected field and their seed collected.<br />
1. T<strong>en</strong> weedy rice plants surviving the application of imidazolinone<br />
herbici<strong>de</strong>s were selected and morphologically i<strong>de</strong>ntified.<br />
Perc<strong>en</strong>tage of execution: 100% completed.<br />
1.c Determination of IMIherbici<strong>de</strong><br />
resistance and hybrid<br />
nature of plants collected in the<br />
field through rapid bioassay<br />
tests with imazapyr and<br />
molecular analyses (PCR with<br />
specific primers or Southern<br />
blot analyses).<br />
At least fifty weedy-IMI rice hybrids plants characterized<br />
morphologically and herbici<strong>de</strong> resistant.<br />
1. Fifty weedy-IMI rice hybrids plants resistant to herbici<strong>de</strong><br />
resistant were characterized morphologically. Perc<strong>en</strong>tage of<br />
execution 100%.<br />
2. Hybrid nature was <strong>de</strong>termined by using bioassay with herbici<strong>de</strong><br />
imazapyr. Perc<strong>en</strong>tage of execution: 100%<br />
3. The analysis by using PCR with specific primers was carried<br />
out. Perc<strong>en</strong>tage of execution: 100% completed
September<br />
2010<br />
May 2010<br />
May 2011<br />
June 2010<br />
January 2010<br />
August 2010<br />
February 2012<br />
March 2012<br />
December 2011<br />
September 2010<br />
August 2010<br />
January 2011<br />
April 2011<br />
Dec ember 2011<br />
Dec ember 2010<br />
April 2011<br />
Dec ember 2011<br />
June 2012<br />
May 2012<br />
July 2012<br />
24<br />
1.c Selfing of weedy-IMI rice<br />
hybrids and morphological<br />
characterization of the plants for<br />
one g<strong>en</strong>eration.<br />
Seed of the second g<strong>en</strong>eration the weedy-IMI rice<br />
obtained according to fertility of the hybrid.<br />
1. Seed (20 grams) of the second g<strong>en</strong>eration the weedy-IMI rice<br />
was obtained according to fertility of the hybrid. Perc<strong>en</strong>tage of<br />
execution: 100%<br />
1.e Determination of the<br />
competitive ability and fitness<br />
traits of selved weedy-IMI rice<br />
hybrids <strong>de</strong>rived from field<br />
collections un<strong>de</strong>r competitive<br />
conditions in the gre<strong>en</strong>house<br />
(experim<strong>en</strong>ts repeated in time).<br />
Two experim<strong>en</strong>ts showing the competitive ability and<br />
fitness traits of selved weedy-IMI rice hybrids compared<br />
to conv<strong>en</strong>tional and Clearfield varieties<br />
1. Experim<strong>en</strong>ts to <strong>de</strong>termine the competitive ability and fitness<br />
traits of selved weedy-IMI rice hybrids, resistant (RR and Rr) and<br />
susceptible (rr) to herbici<strong>de</strong> imazapyr were carried out<br />
.Perc<strong>en</strong>tage of execution: 100% .<br />
1.f Statistical analyses of data<br />
collected from experim<strong>en</strong>ts on<br />
competition.<br />
Two set of data and figures showing the results<br />
produced in the competition replacem<strong>en</strong>t experim<strong>en</strong>ts in<br />
terms of weedy-IMI rice fitness.<br />
1. The set of data and figures showing the results produced in the<br />
competition replacem<strong>en</strong>t experim<strong>en</strong>ts in terms of weedy rice<br />
resistant and susceptible to herbici<strong>de</strong> showed similar competitive<br />
abilities, in terms of plant high and number of culms are similar.<br />
Plants fertility did not varied significantly among weedy rice plants<br />
resistant and susceptible to herbici<strong>de</strong>. However, plants resistant to<br />
herbici<strong>de</strong> produces more seeds that susceptible wh<strong>en</strong> planted in<br />
low <strong>de</strong>nsities conditions (20 R / S 80). These results shows a<br />
higher fitness ability of those plants un<strong>de</strong>r competitive conditions<br />
compare to susceptible to herbici<strong>de</strong><br />
1.g Pres<strong>en</strong>tation of sci<strong>en</strong>tific<br />
reports every six months.<br />
A sci<strong>en</strong>tific report with the results obtained according to<br />
work plan and log frame (Annex A & B).<br />
Timely pres<strong>en</strong>tation of sci<strong>en</strong>tific reports according to the format<br />
established by CIAT and NC.<br />
Objective 2: To evaluate the fitness of artificial weedy-herbici<strong>de</strong> resistant rice hybrids un<strong>de</strong>r competitive and gre<strong>en</strong>house conditions.<br />
2.a Selection and seed increase<br />
of three weedy sativa, rufipogon<br />
and intermediate morphotypes<br />
from CIBCM seed bank<br />
germplasm collected before the<br />
commercialization of IMI-rice.<br />
Seed increase of weedy rice accessions characterized as<br />
sativa, rufipogon-like and intermediate morphotypes<br />
selected according their hybridization rates with O. sativa<br />
(Sánchez et al. 2009). Enough seed (100 g) of the weedy<br />
rice accessions from CIBCM seed bank.<br />
1. Enough seed (100 g) of the weedy rice accessions from CIBCM<br />
seed bank was produced in or<strong>de</strong>r to perform the crosses with<br />
herbici<strong>de</strong> resistant varieties. Perc<strong>en</strong>tage of execution: 100%
May 2010<br />
January 2010<br />
May 2010<br />
May 2010<br />
September 2010<br />
October 2011<br />
May 2011<br />
May 2011<br />
February 2012<br />
October 2011<br />
April 2010<br />
Aug 2010<br />
December 2010<br />
December 2010<br />
August 2010<br />
February 2012<br />
May 2012<br />
December 2011<br />
May 2012<br />
April 2012<br />
25<br />
2.b Training of CIBCM<br />
personnel in hand ma<strong>de</strong> crosses<br />
of rice at CIAT.<br />
Two persons trained on hand ma<strong>de</strong> crosses at CIAT. This<br />
training would be carried out in collaboration with the Rice<br />
Breeding Unit from CIAT.<br />
1. The training on hand ma<strong>de</strong> crosses at CIAT was not carried out<br />
because of the <strong>de</strong>lay starting the execution of the project. In or<strong>de</strong>r<br />
to assure the a<strong>de</strong>quate accomplishm<strong>en</strong>t of the activities, stu<strong>de</strong>nts<br />
and assistants were trained by Griselda Arrieta at UCR, who<br />
received training in this topic at CIAT in previous collaborations<br />
with this institution. The budget of this training was used in the<br />
training of objective <strong>de</strong>scribed in the fifth objective. Perc<strong>en</strong>tage of<br />
execution: 100%<br />
2.c Weekly planting of weedy<br />
rice plants and herbici<strong>de</strong><br />
resistant rice to obtain flowering<br />
overlap and perform the manual<br />
crosses.<br />
At least a total of 10 plants of each material by week at<br />
gre<strong>en</strong>house in CIBCM.<br />
1. Weedy and IMI-resistant rice were planted weekly (30 plants of<br />
each) to obtain flowering overlap and perform the manual crosses.<br />
Perc<strong>en</strong>tage of execution: 100%<br />
2.d Manual production of<br />
controlled weedy rice x IMI-rice<br />
hybrids using selected sativa,<br />
rufipogon and intermediate<br />
morphotypes as maternal lines<br />
un<strong>de</strong>r gre<strong>en</strong>house conditions.<br />
2.e Manual production of<br />
controlled IMI-rice x weedy rice<br />
hybrids using sativa, rufipogon<br />
and intermediate morphotypes<br />
as paternal lines un<strong>de</strong>r<br />
gre<strong>en</strong>house conditions.<br />
Three differ<strong>en</strong>t weedy-IMI rice hybrids lines, using sativa,<br />
rufipogon and intermediate weedy rice as poll<strong>en</strong> receptor<br />
Three differ<strong>en</strong>t weedy-IMI rice hybrids lines, using sativa,<br />
rufipogon and intermediate weedy rice as poll<strong>en</strong> donor.<br />
1. Two differ<strong>en</strong>t weedy-IMI rice hybrids lines were produced using<br />
sativa and intermediate weedy rice as poll<strong>en</strong> receptor. Hybrids<br />
using rufipogon type could not be inclu<strong>de</strong>d as seed did not<br />
germinate. Perc<strong>en</strong>tage of execution: 100%<br />
2. Sativa weedy rice morphotypes (AR1002, AR556, AR571,<br />
AR573, AR585 & AR993) and intermediate (AR136, AR157,<br />
AR977 & AR997) were cross with two IMI rice varieties (Puita and<br />
CFX-18) a total of 467 putative hybrids were produced.<br />
Perc<strong>en</strong>tage of execution: 100%<br />
1. The crosses betwe<strong>en</strong> weedy-IMI rice to produce hybrids lines,<br />
using sativa and intermediate weedy rice as poll<strong>en</strong> donor were<br />
produced. Perc<strong>en</strong>tage of execution: 100%<br />
2. Seed of these hybrids was not obtained on time because of<br />
phytosanitary problems on the gre<strong>en</strong>house. The crosses were<br />
repeated but the seed was not ready in or<strong>de</strong>r to pursue<br />
morphological evaluation and competitiv<strong>en</strong>ess study during the<br />
execution time of the project.<br />
2.f Determination of the hybrid<br />
nature of the plants using<br />
herbici<strong>de</strong> selection and<br />
molecular analyses (PCR or<br />
Southern blot).<br />
At least six lines of weedy-IMI rice hybrids characterized<br />
for herbici<strong>de</strong> resistant.<br />
1. T<strong>en</strong> hybrids lines weedy-IMI rice were produced and<br />
characterized by PCR. Southern blot analyses were not<br />
performed because a PCR with allele specific is <strong>en</strong>ough evi<strong>de</strong>nce<br />
to confirm herbici<strong>de</strong> resistance. Perc<strong>en</strong>tage of execution: 100%.
September 2010<br />
September 2010<br />
January 2011<br />
January 2011<br />
June 2010<br />
November 2011<br />
November 2011<br />
March 2012<br />
March 2012<br />
December 2011<br />
April 2011<br />
April 2011<br />
December 2011<br />
December 2011<br />
December 2010<br />
May 2012<br />
March 2012<br />
January 2012<br />
May 2012<br />
July 2012<br />
26<br />
2.g Morphological<br />
characterization of the weedy<br />
rice x IMI-rice hybrids produced<br />
by manual crosses.<br />
A set of morphological data (six) (vegetative and<br />
reproductive) for weedy-IMI rice hybrids line.<br />
1. Evaluation of vegetative and reproductive characters of hybrids<br />
produced by crossing weedy x IMI-rice was carried out (plant<br />
height, flag leaf l<strong>en</strong>gth and wi<strong>de</strong>, flowering time, panicle l<strong>en</strong>gth,<br />
number of seeds and seed shattering). Perc<strong>en</strong>tage of execution:<br />
100%.<br />
2.h Selfing of weedy-IMI rice<br />
and their hybrids and<br />
morphological characterization<br />
for one g<strong>en</strong>eration.<br />
Seed of the second g<strong>en</strong>eration the weedy-IMI rice the<br />
exact amount will <strong>de</strong>p<strong>en</strong>d on the fertility of the hybrids.<br />
1.First and second g<strong>en</strong>eration of selved pollinated weedy-IMI rice<br />
hybrids was produced in the plants characterized as <strong>de</strong>scribed in<br />
activity 2g. Perc<strong>en</strong>tage of execution: 100%<br />
2.i Determination of<br />
competitiv<strong>en</strong>ess betwe<strong>en</strong><br />
artificial weedy-IMI rice hybrids<br />
and par<strong>en</strong>tal IMI- and weedyrice<br />
lines un<strong>de</strong>r gre<strong>en</strong>house<br />
conditions in separate paired<br />
experim<strong>en</strong>ts.<br />
Two experim<strong>en</strong>ts showing the competitive ability and<br />
fitness traits of selved weedy-IMI rice hybrids compared to<br />
conv<strong>en</strong>tional<br />
1. These experim<strong>en</strong>ts will not be performed during the execution<br />
time of the project. The data about the competitiv<strong>en</strong>ess of the<br />
hybrids will be giv<strong>en</strong> by the experim<strong>en</strong>ts performed with hybrids<br />
found in rice fields in the first objective.<br />
2.j Statistical analyses of data<br />
collected from experim<strong>en</strong>ts on<br />
competition.<br />
Two set of analyzed data and figures showing the results<br />
obtained in competition replacem<strong>en</strong>t experim<strong>en</strong>ts in terms<br />
of weedy-IMI rice fitness.<br />
1.These experim<strong>en</strong>ts were not performed during the execution<br />
time of the project due to the <strong>de</strong>lay in receiving the funds.<br />
However the data related to the competitiv<strong>en</strong>ess of the hybrids<br />
will be giv<strong>en</strong> by the experim<strong>en</strong>ts performed with hybrids found in<br />
rice fields in the first objective. In this s<strong>en</strong>se the <strong>de</strong>livery of the<br />
data for the regulators will not be affected.<br />
2.k Pres<strong>en</strong>tation of sci<strong>en</strong>tific<br />
reports every six months<br />
A sci<strong>en</strong>tific report with the results obtained according to<br />
work plan (Annex A).<br />
1.Timely pres<strong>en</strong>tation of sci<strong>en</strong>tific reports according to the format<br />
established by CIAT and NC. A <strong>de</strong>lay in funds transfer<strong>en</strong>ce also<br />
<strong>de</strong>layed the initiation of the project and the pres<strong>en</strong>tation of reports.<br />
Objective 3. To <strong>de</strong>termine the combinatory ability betwe<strong>en</strong> O. sativa and weedy rice using artificial crosses and quantitative g<strong>en</strong>etics methods.
September 2010<br />
September 2010<br />
January 2011<br />
January 2010<br />
October 2010<br />
May 2011<br />
May 2011<br />
November 2011<br />
December 2011<br />
October 2010<br />
April 2011<br />
August 2010<br />
April 2011<br />
December 2010<br />
November 2011<br />
February 2012<br />
March 2012<br />
April 2012<br />
July 2012<br />
November 2011<br />
27<br />
3.a Production of IMI-rice x<br />
weedy rice hybrids using sativa,<br />
rufipogon and intermediate<br />
morphotypes as maternal or<br />
paternal lines on artificial<br />
crosses on gre<strong>en</strong>house<br />
conditions.<br />
Six differ<strong>en</strong>t weedy-IMI rice hybrids lines, using sativa,<br />
rufipogon and intermediate weedy rice as poll<strong>en</strong> donor and<br />
receptor.<br />
1. T<strong>en</strong> differ<strong>en</strong>t types of weedy-IMI rice hybrids lines were<br />
produced using sativa and intermediate weedy rice types as<br />
poll<strong>en</strong> receptor. Hybrids using rufipogon type will not be<br />
inclu<strong>de</strong>d as seed did not germinate. Perc<strong>en</strong>tage of execution:<br />
100%<br />
3.b Morphological<br />
characterization of IMI-rice x<br />
weedy rice hybrids to <strong>de</strong>termine<br />
the combinatory ability betwe<strong>en</strong><br />
both agronomic forms.<br />
Figures showing the recombination ability betwe<strong>en</strong> O.<br />
sativa and weedy rice g<strong>en</strong>omes using morphological traits<br />
evaluated.<br />
1. Evaluation of vegetative and reproductive characters of<br />
putative hybrids produced by crossing weedy x IMI-rice is in<br />
progress (plant height, flag leaf l<strong>en</strong>gth, flowering time, panicle<br />
l<strong>en</strong>gth, number of seeds and seed shattering). Perc<strong>en</strong>tage of<br />
execution: 100%.<br />
3.c Statistical analyses of<br />
morphological data of weedy<br />
rice x O. sativa hybrids using a<br />
quantitative g<strong>en</strong>etic analyses.<br />
Estimation of combinatorial ability based on multivariate<br />
statistical analysis.<br />
Estimation of combinatorial ability based on multivariate<br />
statistical analysis (PCA) was performed and showed no<br />
morphological differ<strong>en</strong>ces betwe<strong>en</strong> hybrids and weedy rice<br />
plants.<br />
3.e Pres<strong>en</strong>tation of sci<strong>en</strong>tific<br />
reports every six months.<br />
A sci<strong>en</strong>tific report with the results obtained according to<br />
work plan and log frame (Annex A & B).<br />
Timely pres<strong>en</strong>tation of sci<strong>en</strong>tific reports according to the format<br />
established by CIAT and NC. A <strong>de</strong>lay in funds transfer<strong>en</strong>ce also<br />
<strong>de</strong>layed the initiation of the project and the pres<strong>en</strong>tation of<br />
reports.<br />
Objective 4. To <strong>de</strong>termine historic levels of g<strong>en</strong>e flow in Oryza glumaepatula natural populations located at Medio Queso wetland (Los Chiles,<br />
Alajuela) and Murciélago (Guanacaste) by analyzing g<strong>en</strong>etic structure and using molecular markers.<br />
4.a Monitoring of the initiation of<br />
O. glumaepatula flowering<br />
period in Rio Medio Queso<br />
Wetland, Los Chiles (Alajuela)<br />
and in Murciélago,<br />
(Guanacaste) to plan the<br />
sampling.<br />
Description of flowering initiation and finish for at least 5<br />
populations in each site (Medio Queso and Murciélago).<br />
Estimation of synchronicity betwe<strong>en</strong> individuals.<br />
1. Initiation of flowering period was registered during two years.<br />
In 2010, it started at October and finished in December. In the<br />
case of year 2011, the flowering started also in September. The<br />
flowering was synchronic in all the sub-populations in both<br />
years. Perc<strong>en</strong>tage of execution: 100%
October 2010<br />
October 2010<br />
October 2010<br />
May 2010<br />
December 2010<br />
June 2010<br />
October 2010<br />
October 2010<br />
October 2010<br />
January 2011<br />
December 2011<br />
December 2011<br />
November 2010<br />
November2011<br />
November 2011<br />
December 2010<br />
April 2011<br />
December 2010<br />
November 2011<br />
November 2010<br />
December 2010<br />
December 2011<br />
May 2012<br />
July 2012<br />
28<br />
4.b Geo-refer<strong>en</strong>ced collecting of<br />
O. glumaepatula plants and<br />
prog<strong>en</strong>ies (seed and mother<br />
plant tissue) in Rio Medio Queso<br />
Wetland, Los Chiles (Alajuela)<br />
and in Murciélago,<br />
(Guanacaste).<br />
Complete plants, seeds and leaf tissue from each<br />
reproductive adult will be collected At least five populations<br />
per site with a minimum of 30 individuals per population.<br />
Collection of a minimum of 300 individuals. Seeds and<br />
plants will be transported to the gre<strong>en</strong>houses at CIBCM-<br />
UCR for germination<br />
1. Geo-refer<strong>en</strong>ced database with 125 samples of O.<br />
glumaepatula collected in sev<strong>en</strong> localities in Medio Queso and<br />
two in Guanacaste. Besi<strong>de</strong>s, 27 samples of O. sativa varieties<br />
were inclu<strong>de</strong>d for the study. In October 2011, 200 additional<br />
plants and their seeds were collected. Perc<strong>en</strong>tage of execution:<br />
100%<br />
4.c Freeze-drying of the<br />
vegetative samples and storage<br />
A collection of a minimum of 300 individuals freeze-dries<br />
tissue, i<strong>de</strong>ntified and storage.<br />
1. O. glumaepatula samples (125) and 27 samples of O. sativa<br />
freeze stored at CIBCM laboratory. In October 2011 an<br />
additional 200 plants and their seeds were collected. A total of<br />
342 plants were collected. Perc<strong>en</strong>tage of execution: 100%<br />
4.d DNA isolation from wild rice<br />
O. glumaepatula and rice<br />
cultivars.<br />
A collection of DNA of a minimum of the 300 individuals<br />
collected.<br />
1. DNA extraction methodology standardized using “FastDNA<br />
kit” and DNA isolated from 152 samples including O.<br />
glumaepatula and O. sativa plants. Perc<strong>en</strong>tage of execution:<br />
100%<br />
4.e Selection and optimization of<br />
Applied Biosystems' AFLP Plant<br />
G<strong>en</strong>ome Mapping Kits for O.<br />
glumaepatula and O. sativa<br />
g<strong>en</strong>ome. Polymerase Chain<br />
Reaction (PCR) using AFLPs Kit<br />
and ABI 310 g<strong>en</strong>otyper<br />
Optimized AFLPs protocol and a set of polymorphic loci for<br />
g<strong>en</strong>etic analysis of O. glumaepatula and O. sativa. A data<br />
set containing the most informative combinations.<br />
1. Twelve primer combinations were scre<strong>en</strong>ed for selective PCR<br />
amplifications Three of them were chos<strong>en</strong>: E-TC/M-CTC, E-<br />
AC/M-CTG and E-AG/M-CAT. PCR amplifications were<br />
performed in a ABI 310 g<strong>en</strong>otyper. Perc<strong>en</strong>tage of execution:<br />
100%<br />
4.f Statistical analysis for<br />
<strong>de</strong>termination of O.<br />
glumaepatula g<strong>en</strong>etic structure<br />
and diversity as an indirect<br />
method to infer g<strong>en</strong>e flow.<br />
An average estimate of population structure. Significance<br />
estimates of population structure, based on AMOVA<br />
calculations. A ph<strong>en</strong>ogram of population relationship<br />
based on pairwise g<strong>en</strong>etic structure estimates.<br />
1. A binary matrix was built with G<strong>en</strong>eMarker V1.97. A total of<br />
550 bands were inclu<strong>de</strong>d in the analysis. The estimation of<br />
population structure was <strong>de</strong>termined by using STRUCTURE<br />
program (Pritchard, 2000) and g<strong>en</strong>etic diversity using Shannon<br />
and Bayesian methods (Holsinger and Wallace, 2004).<br />
4.h Pres<strong>en</strong>tation of sci<strong>en</strong>tific<br />
reports every six months.<br />
A sci<strong>en</strong>tific report with the results obtained according to<br />
work plan and log frame (Annex A & B).<br />
Timely pres<strong>en</strong>tation of sci<strong>en</strong>tific reports according to the format<br />
established by CIAT and NC. A <strong>de</strong>lay in funds transfer<strong>en</strong>ce also<br />
<strong>de</strong>layed the initiation of the project and the pres<strong>en</strong>tation of reports.
January 2011<br />
January 2011<br />
January 2010<br />
June 2010<br />
September 2010<br />
December 2011<br />
January 2012<br />
March 2012<br />
January 2011<br />
December 2011<br />
April 2011<br />
April 2011<br />
April 2010<br />
December 2010<br />
April 2011<br />
April 2012<br />
March 2012<br />
April 2012<br />
July 2012<br />
April 2012<br />
29<br />
Objective 5. To transfer a regional standardized methodology from C<strong>en</strong>tro Internacional <strong>de</strong> Agricultura Tropical (CIAT) for large scale monitoring of<br />
g<strong>en</strong>e flow betwe<strong>en</strong> O. sativa and wild rice species.<br />
5.a Selection of two candidates<br />
for training at CIAT.<br />
Two candidates selected based on molecular biology<br />
background.<br />
1. Two candidates were selected in January 2012. Cindy<br />
Aguilar, CIBCM staff technician and El<strong>en</strong>a Vásquez, Master<br />
<strong>de</strong>gree Stu<strong>de</strong>nt. Perc<strong>en</strong>tage of execution: 100%<br />
5.b Training of personnel on<br />
the use of molecular protocols<br />
to monitor g<strong>en</strong>e flow at large<br />
scale.<br />
5.c Transferring of the protocol<br />
to Costa Rica molecular biology<br />
laboratories.<br />
Two persons trained on this protocol.<br />
Transfer<strong>en</strong>ce of the protocol to CIBCM-UCR where other<br />
professional and stu<strong>de</strong>nts will have access to it.<br />
1. Three persons, Griselda Arrieta, Cindy Aguilar and El<strong>en</strong>a<br />
Vásquez were trained on the large scale g<strong>en</strong>e flow analysis<br />
using molecular tools at CIAT, Cali Colombia by Luisa Fory and<br />
Gerardo Gallego. This training took place 3-11 th March 2012.<br />
The methods and protocols were transferred to CIBCM-UCR.<br />
Perc<strong>en</strong>tage of execution: 100%<br />
5.d Pres<strong>en</strong>tation of sci<strong>en</strong>tific<br />
reports every six months.<br />
A sci<strong>en</strong>tific report with the results obtained according to<br />
work plan and log frame (Annex A & B).<br />
Timely pres<strong>en</strong>tation of sci<strong>en</strong>tific reports according to the format<br />
established by CIAT and NC.<br />
Objective 6. To <strong>de</strong>sign crop managem<strong>en</strong>t strategies to minimize g<strong>en</strong>e flow from the GM rice to weedy rice and Oryza glumaepatula wild relative.<br />
Key aspects of stewardship program for Clearfield rice were<br />
assessed by the collaboration of two main rice producers in<br />
6.a Determination of<br />
Costa Rica, Finca el Pelón and Haci<strong>en</strong>da Mojica, located in<br />
managem<strong>en</strong>t procedures and<br />
Guanacaste. These two farms used herbici<strong>de</strong> resistant rice<br />
stewardship of IMI-cultivar in<br />
during all growing seasons and have in some places herbici<strong>de</strong><br />
Key aspects of stewardship program for Clearfield rice<br />
rice field conditions.<br />
resistant weedy rice. Therefore they shared with the researchers<br />
assessed through available writt<strong>en</strong> materials, interviews<br />
of this project though field visits and discussions the<br />
and field visits and in<strong>de</strong>p<strong>en</strong><strong>de</strong>nt evaluation of managem<strong>en</strong>t<br />
managem<strong>en</strong>t procedures employed in the rice plots in which<br />
procedures to verify their efficacy and acceptance by<br />
weedy rice herbici<strong>de</strong> resistant plants have be<strong>en</strong> i<strong>de</strong>ntified. A<br />
farmers and analysis of managem<strong>en</strong>t procedures of IMIrice<br />
in field conditions<br />
sci<strong>en</strong>ce and experi<strong>en</strong>ce-based strategy was discussed and<br />
pres<strong>en</strong>ted to <strong>Biosafety</strong> Regulators stressing key aspects for the<br />
managem<strong>en</strong>t of a GM rice in or<strong>de</strong>r to prev<strong>en</strong>t g<strong>en</strong>e flow as a<br />
requirem<strong>en</strong>t for the ev<strong>en</strong>tual <strong>de</strong>ploym<strong>en</strong>t of a GM rice. This<br />
information was pres<strong>en</strong>ted during the workshop <strong>de</strong>scribed in<br />
activity 6.c. Perc<strong>en</strong>tage of execution: 100%
September 2010<br />
September 2010<br />
June 2010<br />
January 2011<br />
May 2011<br />
December 2011<br />
January 2012<br />
February 2012<br />
January 2012<br />
January 2012<br />
December<br />
2011<br />
December 2011<br />
April 2011<br />
December 2010<br />
December 2011<br />
April 2012<br />
May 2012<br />
July 2012<br />
May 2012<br />
April 2012<br />
30<br />
6.b Compilation of information<br />
on g<strong>en</strong>e flow from cultivated<br />
Oryza sativa to weedy and wild<br />
relatives and its managem<strong>en</strong>t.<br />
An average estimate of g<strong>en</strong>e flow betwe<strong>en</strong> O. sativa and<br />
weedy relatives based on a meta-analysis.<br />
The meta-analysis was not carried out. However, a compilation<br />
of sci<strong>en</strong>tific paper related with g<strong>en</strong>e flow on rice was <strong>de</strong>livery to<br />
biosafety regulators. Perc<strong>en</strong>tage of execution: 100%<br />
6.c Pres<strong>en</strong>tation and discussion<br />
of the results obtained by the<br />
project with biosafety<br />
regulators.<br />
A workshop to pres<strong>en</strong>t and discuss the results obtained on<br />
g<strong>en</strong>e flow project will be carried out.<br />
A workshop to pres<strong>en</strong>t and discuss the data and results of the<br />
project was performed in May 7, 8 and 9 and 10 th May 2012.<br />
Perc<strong>en</strong>tage of execution: 100%<br />
6.e Pres<strong>en</strong>tation of sci<strong>en</strong>tific<br />
reports every six months.<br />
A sci<strong>en</strong>tific report with the results obtained according to<br />
work plan and log frame (Annex A & B)<br />
Timely pres<strong>en</strong>tation of sci<strong>en</strong>tific reports according to the format<br />
established by CIAT and NC<br />
Objective 7. To produce an operational biosafety gui<strong>de</strong>line compiling the information g<strong>en</strong>erated by the subproject in the assessm<strong>en</strong>t of g<strong>en</strong>e introgression from O.<br />
sativa to weedy/wild relatives.<br />
7.a Compilation of the results<br />
g<strong>en</strong>erated in each specific<br />
objective of this subproject<br />
Results of the subproject compile for its use in the<br />
biosafety gui<strong>de</strong>line.<br />
The compilation of the results will be pres<strong>en</strong>ted to the <strong>Biosafety</strong><br />
regulators in the form of short communication at the <strong>en</strong>d of 2012.<br />
7.b Layout of the biosafety<br />
gui<strong>de</strong>line with the information<br />
g<strong>en</strong>erated by the subproject<br />
A digital biosafety gui<strong>de</strong>line<br />
The results obtained with the execution of g<strong>en</strong>e flow project<br />
were transferred to the subproject coordinated by Sergio<br />
Bermú<strong>de</strong>z, for the risk and b<strong>en</strong>efit analysis evaluation to drafted<br />
a biosafety gui<strong>de</strong>lines for regulatory authorities.<br />
OBSERVATIONS: