Revista Peruana Biología v21n1

Universidad Nacional Mayor de San Marcos 

Facultad de Ciencias Biológicas 

Rev. peru. biol. ISSN 1561-0837 

Revista 

Peruana de 

Biología 

Volumen 21 Mayo, 2014 Número 1 

LIMA, PERÚ

Revista Peruana de Biología 

Publicación científica de la Facultad de Ciencias Biológicas de la 

Universidad Nacional Mayor de San Marcos 

Rector 

Dr. Pedro Atilio Cotillo Zegarra 

Vicerrector de Investigación 

Dr. Bernardino Ramírez Bautista 

Consejo Superior de Investigación 

Mg. Jesús Victoria Rumiche Briceño 

Decana de la Facultad de Ciencias Biológicas 

Mag. Olga Bracamonte Guevara 

Instituto de Investigación en Ciencias Biológicas Antonio Raimondi 

Mg. Joaquina Alban Castillo 

La Revista Peruana de Biología es una publicación científica arbitrada, 

producida por el Instituto de Ciencias Biológicas Antonio Raimondi, 

Facultad de Ciencias Biológicas de la Universidad Nacional Mayor de San 

Marcos, Lima, Perú, y auspiciada por el Vicerrectorado de Investigación. 

La Revista es publicada tres veces al año (abril, agosto y diciembre) y esta 

dedicada a la publicación de artículos científicos originales e inéditos 

de las áreas de biodiversidad, biotecnología, ecología y biomedicina. La 

Revista publica los trabajos realizados por académicos e investigadores 

nacionales y extranjeros, en idioma español o inglés. Los trabajos 

recepcionados son evaluados por árbitros según criterios internacionales 

de calidad, creatividad, originalidad y contribución al conocimiento. La 

Revista es publicada simultáneamente en la página web de la Universidad. 

Editor Jefe 

Leonardo Romero, Universidad Nacional Mayor de San Marcos. 

Editores asociados 

Dra. Rina Ramírez, Universidad Nacional Mayor de San Marcos. 

Dra. Mónica Arakaki-Makishi, Universidad Nacional Mayor de San Marcos. 

Dra. Diana Silva Dávila, Universidad Nacional Mayor de San Marcos. 

Maximilian Weigend 

Freie Universität Berlin- Alemania 

Hélio Ricardo da Silva 

Universidade Federal Rural do Rio de Janeiro, Brazil 

Carlos Frederico Duarte da Rocha 

Universidade do Estado do Rio de Janeiro- Brasil 

Fabrício Rodrigues dos Santos 

Universidade Federal de Minas Gerais- Brasil 

Davor Vrcibradic 

Universidade do Estado do Rio de Janeiro- Brasil 

Berta Calonge Camargo 

Pontificia Universidad Javeriana, Bogotá, Colombia 

Sergio Solari 

Universidad de Antioquia- Colombia 

Finn Borchsenius 

Aarhus University- Denmark 

Julissa Roncal 

Aarhus University- Denmark 

Arnaud Bertrand 

IRD. Institut de recherche pour le développement- Francia 

Francis Kahn 

IRD. Institut de recherche pour le développement, - Francia 

Jean-Christophe Pintaud 

Institut de Recherche pour le Développement- Francia 

Mutsunori Tokeshi 

Kyushu University - Japon 

Francisco Alonso Solís Marín 

Universidad Nacional Autónoma de México- México 

Comité Editor 

Dra. Blanca R. León, Profesora Honoraria, Universidad Nacional Mayor 

de San Marcos. The University of Texas at Austin, Geography and 

the Environment, Faculty Member, Estados Unidos. 

Dr. Carlos Peña, Laboratory of Genetics, Department of Biology, 

University of Turku, Finlandia. 

Cesar Arana, Universidad Nacional Mayor de San Marcos. 

José Roque, Universidad Nacional Mayor de San Marcos. 

Comité consultivo en los recientes números 

Mónica Romo 

Asociación Peruana para la Conservación de la Naturaleza- Perú 

Renato Guevara-Carrasco 

Instituto del Mar del Perú- Perú 

Reynaldo Linares-Palomino 

Universidad Nacional Agraria La Molina- Perú 

Marcel Gutiérrez-Correa 

Universidad Nacional Agraria La Molina - Perú 

Gretty K. Villena 

Universidad Nacional Agraria La Molina - Perú 

Gerardo Lamas 

Universidad Nacional Mayor de San Marcos- Perú 

Pablo Ramírez 


Juan Tarazona 


Armando Yarlequé 


Manuel Tantaleán 

Universidad Peruana Cayetano Heredia- Perú 

Nigel Pitman 

Duke University- USA 

Maria del Carmen Ulloa Ulloa 

University of Missouri- USA 

Kenneth Young 

University of Texas at Austin – USA 

Paul Velazco 

American Museum of Natural History, USA 

©Facultad de Ciencias Biológicas, UNMSM- La Revista Peruana de Biología 

publica artículos de acceso abierto, distribuido bajo los términos de la Licencia 

Creative Commons Atribución-NoComercial-CompartirIgual 4.0 Internacional. 

(http://creativecommons.org/licenses/by-nc-sa/4.0/), que permite el uso no 

comercial, distribución y reproducción en cualquier medio, siempre que la 

obra original sea debidamente citadas. Para uso comercial, por favor póngase en 

contacto con: editor.revperubiol@gmail.com / decanobio@gmail.com 

Resumida/Indizada (Abstracted/Indexed) en: 

Periódica (Índice de Revistas Latinoamericanas en Ciencias), 

LIPECS (Literatura Peruana en Ciencias de la Salud), Zoological 

Record (BIOSIS), Scielo (Scientific Electronic Library Online), 

Index to American Botanical Literature (The New York Botanical 

Garden), BIOSIS Previews, Biological Abstracts (BIOSIS), ProQuest 

(Biological Science Journals), Redalyc, CABI, AGRICOLA, Scopus. 

Foto en la caratula: Lycalopex griseus, cortesia de Helena Sisniegas © 


Hecho el Depósito Legal 98-3017 

Rev. peru. biol. - ISSN-L 1561-0837 

Rev. peru. biol. - ISSN 1561-0837 

Rev. peru. biol. - ISSN 1727-9933 (on line) 

http://revistasinvestigacion.unmsm.edu.pe/index.php/rpb/ 

http://sisbib.unmsm.edu.pe/BVRevistas/biologia/biologiaNEW.htm 

http://redalyc.uaemex.mx/ 

Información adicional a: 


Facultad de Ciencias Biológicas UNMSM 

Ciudad Universitaria, Av. Venezuela Cdra. 34 s/n. Lima 

Casilla Postal: 11-0058 Lima-11, Perú. 

Teléfono 619-7000-1502 / Telefax 619-7000-1509 

Editor Jefe, email: editor.revperubiol@gmail.com 

2


Rev. peru. biol. ISSN-L 1561-0837 


TRABAJOS ORIGINALES 

CONTENIDO 

3 Revision of the South American wasp genus Alophophion Cushman, 1947 (Hymenoptera: Ichneumonidae: Ophioninae) 

Revisión del genero de avipas sudamericanas Alophophion Cushman, 1947 (Hymenoptera: Ichneumonidae: Ophioninae) 

Mabel Alvarado 

61 Dieta de Leopardus colocolo (Carnivora: Felidae) en la Reserva Nacional de Junín, Junín, Perú 

Diet of Leopardus colocolo (Carnivora: Felidae) in the Reserva Nacional de Junín, Junín, Peru 

Ursula Fajardo, Daniel Cossíos y Víctor Pacheco 

71 Estado del zorro gris Lycalopex griseus (Gray, 1837) (Mammalia: Canidae) en el Perú 

Status of gray fox Lycalopex griseus (Gray, 1837) (Mammalia: Canidae) from Peru 

Elena Vivar y Víctor Pacheco 

79 Análisis morfológico del sistema reproductor e identificación molecular a través de los marcadores mitocondriales COI y 16S 

rRNA de Megalobulimus oblongus (Mollusca, Strophocheilidae) de Colombia 

Morphological analysis of the reproductive system and molecular identification by mitochondrial markers COI and 16S rRNA of 

Megalobulimus oblongus (Mollusca, Strophocheilidae) of Colombia 

Erika Jaramillo Roldán, Jessika López Martínez, Rina Ramírez, Luz Elena Velásquez Trujillo 

89 Caracterización molecular de la región determinante de resistencia a quinolonas (QRDR) de la topoisomerasa IV de Bartonella 

bacilliformis en aislados clínicos 

Molecular characterization of quinolones resistance determining region (QRDR) of Bartonella bacilliformis topoisomerasa IV 

in clinical isolates 

Abraham Espinoza-Culupú, Ruth Quispe-Gaspar, Michael Jaramillo, Melisa Icho, Anika Eca, Pablo Ramírez, Débora 

Alvarado, Juan Carlos Guerrero, Franklin Vargas-Vásquez, Ofelia Córdova, Ruth García-de-la-Guarda 

99 Patrones de coocurrencia y conducta alimentaria a escala local de Phlebotominae (Diptera: Psychodidae) del estado Falcón, 

Venezuela 

Co-ocurrence patterns and feeding behaviour at local scale of Phlebotominae(Diptera: Psychodidae) from Falcon state, Venezuela 

Dalmiro J. Cazorla, Elsa Nieves y Pedro Morales 

NOTA CIENTÍFICA 

105 Nueva especie de Hesperiidae (Lepidoptera) para Perú: Dalla granites (Mabille, 1898) 

A new skipper species for Peru: Dalla granites (Mabille, 1898) (Lepidoptera: Hesperiidae) 

José Alfredo Cerdeña, Erick Huamaní, Rómulo Delgado y Gerardo Lamas 

109 Two new butterfly records for Peru: Orophila cardases cardases and Pedaliodes garlaczi (Lepidoptera: Nymphalidae) 

Dos nuevos registros de mariposas para Perú: Orophila cardases cardases y Pedaliodes garlaczi (Lepidoptera: Nymphalidae) 

José Alfredo Cerdeña and Erick Huamaní 

111 Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae) para el Perú 

First record of Serratospiculum tendo (Nematoda: Diplotriaenidae) in Peru 

Luis A. Gomez-Puerta, Pedro A. Ospina, Mercy G. Ramirez, Nelly G. Cribillero 

1

Revista peruana de biología 21(1): 003 - 060 (2014) 

doi: http://doi.org/10.15381/rpb.v21i1.8245 

Revision of the South American wasp genus 

ISSN-L 1561-0837 

Alophophion 



Revision of the South American wasp genus Alophophion Cushman, 1947 (Hymenoptera: 

Ichneumonidae: Ophioninae) 

Revisión del genero de avipas sudamericanas Alophophion Cushman, 1947 (Hymenoptera: 

Ichneumonidae: Ophioninae) 

Mabel Alvarado 1,2 

1 Division of Entomology, Natural History Museum, 

and Department of Ecology & Evolutionary Biology, 

1501 Crestline Drive – Suite 140, University of 

Kansas, Lawrence, Kansas, 66045, USA 

2 Departamento de Entomología, Museo de 

Historia Natural, Universidad Nacional Mayor 

de San Marcos. Av. Arenales 1256 Jesús María, 

Lima 14, Perú 

Email Mabel Alvarado: malvarado@ku.edu 

Citación: 

Alvarado M. 2014. Revision of the South American 

wasp genus Alophophion Cushman, 1947 (Hymenoptera: 

Ichneumonidae: Ophioninae). Revista 

peruana de biología 21(1): 003 - 060 (Mayo 2014), 


Abstract 

The species of the strictly Neotropical ophionine wasp genus Alophophion Cushman, 1947 are 

revised. New descriptions of all previously named species are provided, except Alophophion 

holosericeus (Taschenberg, 1875) for which the type series is lost and the name is herein 

considered a nomen dubium. The female of A. flavorufus (Brullé, 1846) is described for the first 

time. Four informal species groups are proposed based on the morphology of the mandibles, 

development of the malar space, and general proportions of the head (i.e., development of 

the face and gena). Whereas the genus previously included only seven named species, it is 

here expanded to include 49 species (not including the aforementioned nomen dubium), 43 

of which are newly discovered and described and thereby increasing the diversity by over 

eight times. A key to the four species groups and their included taxa is provided. Alophophion 

is confined to cold and/or dry areas of subequatorial South America, with the exception of 

A. mancocapaci new species and A. pedroi new species which occur incloud forests around 

Cuzco, Peru. The genus is newly recorded from Bolivia and Ecuador, and more extensive and 

accurate distributions are summarized for A. chilensis, A. flavorufus, and A. politus. Alophophion 

flavorufus is newly recorded from Argentina. 

Keywords: Ichneumonoidea; taxonomy; new species; parasitoid; Euhymenoptera; Neotropical 

Resumen 

Las especies del genero de avispas neotropicales Alophophion Cushman, 1947 son revisadas. 

Se presenta nuevas descripciones para todas la especies previamente descritas, excepto 

Alophophion holosericeus (Taschenberg, 1875) debido a que los especímenes tipo están 

perdidos y el nombre es considerado nomen dubium. La hembra de A. flavorufus (Brullé, 1846) 

es descrita por primera vez. Cuatro grupos de especies informales son propuestos basados 

en la morfología de las mandíbulas, amplitud del espacio malar, y las proporciones de la cabeza 

(tales como la amplitud del rostro y gena). El género previamente incluía siete especies, 

aquí se amplía a 49 especies (sin incluir el nomen dubium), 43 de las cuales son nuevas 

para la ciencia. Claves para los cuatro grupos de especies son propuestas. Alophophion está 

confinado a áreas frías y/o secas de América del Sur subecuatorial, con la excepción de las 

especies A. mancocapaci new species y A. pedroi new species que ocurren en los bosques 

húmedos de Cuzco, Perú. El género es registrado por primera vez para Bolivia y Ecuador; 

distribuciones más precisas para A. chilensis, A. flavorufus, y A. politus son proporcionadas; 

y, A. flavorufus es registrado por primera vez para Argentina. 

Palabras clave: Ichneumonoidea; taxonomía; especies nuevas; parasitoides; Euhymenoptera; 

Neotrópico. 

Presentado: 02/03/2014 

Aceptado: 07/04/2014 

Publicado online: 26/05/2014 

Journal home page: http://revistasinvestigacion.unmsm.edu.pe/index.php/rpb/index 

© Los autores. Este artículo es publicado por la Revista Peruana de Biología de la Facultad de Ciencias Biológicas, Universidad Nacional Mayor de San 

Marcos. Este es un artículo de acceso abierto, distribuido bajo los términos de la Licencia Creative Commons Atribución-NoComercial-CompartirIgual 4.0 

Internacional.(http://creativecommons.org/licenses/by-nc-sa/4.0/), que permite el uso no comercial, distribución y reproducción en cualquier medio, siempre 

que la obra original sea debidamente citadas. Para uso comercial, por favor póngase en contacto con editor.revperubiol@gmail.com. 

Rev. peru. biol. 21(1): 003 - 060 (May 2014) 

3

Alvarado 

Introduction 

Alophophion Cushman is an endemic South American genus 

of parasitoid wasps in the diverse ichneumonid subfamily 

Ophioninae (Gauld & Lanfranco 1987). Currently compromising 

seven species distributed in Argentina, Brazil, Chile, 

and the Falkland Islands (Yu & Horstmann 1997), the genus 

is also known to include numerous undescribed species including 

several in the Andean region such as Peru and Ecuador 

(e.g., Gauld 1985, Gauld & Lanfranco 1987, Alvarado et al. 

2010). Species of Alophophion are not rare and can be found 

throughout South America. Even though it has been known 

that there are at least 30 species in the genus (e.g., Gauld 

1985, Gauld & Lanfranco 1987, Baudino 2005) no new 

species has been described formally during its 66-year history. 

Cushman (1947) established the genus by removing its type 

species from Ophion Fabricius, and Townes & Townes (1966) 

did the same by removing additional species from the latter 

genus and moving them to Alophophion without naming any 

additional taxa. Thus, despite a steady accumulation of new 

species the systematics of the group has only become more 

and more challenging given the lack of any taxonomic action 

to address the circumscription of the genus and identification 

of its included units. 

Gauld (1980, 1985) proposed the following characters to 

support the putative monophyly of Alophophion: complete absence 

of the occipital carina; Rs+2r joining the pterostigma near 

the its midpoint; the first subdiscal cell stouter than is typical 

for other ophionine genera; and the ramulus, when present, is 

directed more anteriorly than that of other ophionines (Gauld 

1980, 1985). These have never been tested in a formal cladistic 

analysis. Nonetheless, monophyly of the genus seems solid, 

particularly in relation to genera such as Ophion Fabricius 

which are undoubtedly holding genera for taxa not readily 

placed elsewhere (Gauld 1985). The proper classification of the 

numerous species presently placed within Ophion remains one 

of the more complicated and long-standing challenges for the 

systematics of the subfamily. 

The aim of the present paper is to clearly delineate the genus, 

redescribe the currently recognized species, and add the 

description of 43 new species. As will be discussed more below, 

resolving such taxonomic issues surrounding the biodiversity of 

Alophophion will also provide a solid basis for future biological 

investigation which is critical given the apparent importance 

of these wasps as biological control agents of critical crop pests 

(e.g., cutworms on alfalfa). This monograph will permit for the 

first time a more accurate perspective on the species and morphological 

diversity within Alophophion, a finer understanding 

of their distribution and ecological preferences, and allow for 

their identification by biologists and agronomists interested in 

further study of these wasps. 

Material and methods 

The present study was based on examination of 970 specimens 

of Alophophion and housed in the following institutions: 

AEIC: American Entomological Institute, Gainesville, 

Florida, USA (David Wahl) 

BMNH: Natural History Museum, London, England 

(Gavin Broad) 

MNHN: Muséum national d'histoire naturelle, Paris, France 

(Claire Villemant). 

MNNC: Museo Nacional de Historia Natural, Santiago, 

Chile (Mario Elgueta). 

MLP: Museo de La Plata, Argentina (Marta Loiacono). 

MUSM: Museo de Historia Natural, Universidad Nacional 

Mayor de San Marcos, Peru (Gerardo Lamas). 

SEMC: Snow Entomological Museum Collection, Kansas, 

USA (Michael Engel). 

UCDC: Bohart Museum of Entomology, University of California, 

California, USA (Steve Heydon). 

USNM: United States National Museum, Washington D.C., 

USA (Robert Kula) 

All of the descriptions were based of females, while information 

from males was provided only if they were confidently 

associated with females. 

Large portions of the specimens studied where collected in Peru 

and from the following localities: 

Monteseco is located between the basins of the Rio Zana 

and Chancay-Lambayeque Rivers; between the departments 

of Cajamarca and Lambayeque. It has a unique environment 

including montane cloud forests on the western slopes of 

the Peruvian Andes and associated ecosystems, such as dry 

forests and puna grasslands (DS-020-2011-MINAM). Three 

expeditions were conducted, the first during April 2009 at the 

following elevations: 1615 m, 2150 m, and 2841m; the second 

was during October 2009 at elevations of 1195 m, 1615 m, 

2150 m, and 2841m; and the last was in May 2010 at elevations 

of 1232 m, 1615 m, 2150 m, 2841 m, and 3116 m. At each 

locality 15 hours of clear light traps were used. 

The Polylepis forest located in Chaviña District, Lucanas 

Province, Ayacucho Department, between 4000m and 4200m 

Species of Polylepis Ruiz & Pav. (Rosaceae) are rosaceous 

shrubs or trees native to the mid- and high-elevation tropical 

Andes (Simpson 1979). The expedition was conducted in 

April 2010 and the following collecting methods were used: 

two malaise traps and four yellow pan traps working during 

five days; 10 pitfall traps during three days; and light traps 

during 12 hours. 

Measurements and morphological terminology.- The 

morphological terminology adopted in this work broadly 

follows Gauld & Mitchell (1981) and Gauld (1988). Indices 

used by Gauld & Mitchell (1981) were also followed, but some 

are further explained below. The following measurements were 

realized as suggested by Gauld & Mitchell (1981): the width of 

the face is the minimum distance between the compound eyes, 

and its height is the median vertical distance from the clypeal 

margin to the facial tubercle. The head in lateral view is measured 

perpendicularly to the torulus. Malar space is measured as the 

shortest distance between a point just above the anterior dorsal 

margin of the mandible and the compound eye. The indices for 

wing used are cubital index of fore wing (CI), intercubital index 

(ICI), second discoidal index (SDI) and nervellar index of hind 

wing (NI). The propodeal anterior area and posterior to the 

anterior transverse carina are referred respectively as propodeum 

4 

Rev. peru. biol. 21(1): 003 - 060 (Mayo 2014)

Revision of the South American wasp genus Alophophion 

anterior area and propodeum posterior area (Gauld & Mitchell, 

1981). The measurement of the flagellomeres were done in lateral 

view, the width of each was measured at its individual apex. The 

ventral face of the mesopleuron is described as “mesosternum” 

(Bennett 2008). Selected terms from Townes (1969) were used. 

For the purpose of indicating the level of accuracy, ratios are 

expressed to the nearest tenth and represent estimated values. 

Integumental sculpture terminology follows Harris (1979). 

Imaging.- Photomicrographs were prepared using a Canon 

7D digital camera attached to an Infinity K-2 long-distance 

microscopic lens. Digital photos were combined by using the 

program CombineZP. Plates were prepared using Adobe Fotoshop 

and Ilustrator CS3. 

Taxonomy 

Genus Alophophion Cushman 

Alophophion Cushman, 1947: 439. Type species: Ophion 

chilensis Spinola, 1851, by original designation. 

Diagnosis.- This lineage is characterized by the following 

putative apomorphies: occipital carina entirely absent (Fig. 2); 

Rs+2r joining pterostigma near center (Fig. 1); first subdiscal 

cell stouter than normal; ramulus, when present, directed more 

anteriorly than that of other ophionines (Gauld 1980, 1985). 

Description (modified from Gauld 1985).- Head. Mandibles 

not twisted, weakly narrowed apically, subequally bidentate; 

outer mandibular surface flat, usually punctate and hirsute; 

upper mandibular surface generally slightly convex or concave, 

with or without a diagonal groove extending from upper 

corner to middle of mandible. Maxillary palp 5-segmented, 

labial palp 4-segmented. Margin of clypeus often impressed, 

sometimes very narrowly so. Ocelli generally large, posterior 

(lateral) ocelli close to compound eyes; frontal carina absent; 

occipital carina absent. 

Mesosoma.- Pronotum unspecialized or mediodorsally 

somewhat flattened and quite long; spiracle longer than wide; 

Figures 1 – 3. Details of Alophophion atahualpai new species. 

(1) Fore wing, (2) Head, in dorsal view, (3) Mesosoma, 

in lateral view. 


spiracular sclerite exposed. Notauli present on anterior part 

of mesoscutum. Epicnemial carina generally strong. Mesopleural 

furrow varying in length, from absent to reaching the 

lower-posterior end of mesopleuron; diagonal, extending from 

episternal scrobe to near subalar prominence. Mesoscutellum 

very weakly convex, usually narrow and not carinate laterally. 

Posterior transverse carina of mesosternum absent except for 

lateral vestiges (Fig. 3). Propodeum with anterior area occluded, 

transverse and often lateromedian longitudinal carinae discernible, 

sometimes complete; posterior area smooth, rugulose or 

carinate. Fore wing with pterostigma broad; marginal cell long; 

Rs+2r slender, curved near proximal 0.3x before joining pterostigma 

near center; discosubmarginal cell with glabrous area anterior; 

1m-cu generally centrally angled, sometimes with a short 

ramulus which is directed more anteriorly than that of Ophion. 

Hind wing with Rs curved. Protibial spur with a membranous 

flange behind macrotrichial comb; meso- and metatrochantelli 

unspecialized; inner metatibial spur flattened, with a margin of 

long close setae; metapretarsal claws unspecialized; inner surface 

of tarsi with a margin of long close setae. 

Metasoma.- Gaster moderately slender; tergite II in profile 

elongate, thyridium oval, separated from anterior margin of 

tergite by its own length or less; umbo distinct; epipleuron upturned. 

Ovipositor sheath narrow. 

Comments.- Genus diagnosis remarks: 

The upper mandibular surface is described; the presence of 

a diagonal groove on the mandible is newly described for the 

genus. The description of the mesopleural furrow is included. 

The genus currently contains seven species, while here are 

presented 43 putative new species. Four informal species groups 

are proposed on the basis of their morphology, supported by 

the presence/absence and degree of development of a diagonal 

groove on the mandible, size of the compound eyes in relation 

to the face, coloration, and facial and genal proportions. 

Key to Species-groups of Alophophion 

(1) Mandibles with a diagonal groove extending from upper corner to middle 

of mandible, groove bears long setae (Figs. 4, 5) ......... Species-group B 

– Mandibles without a groove in upper surface (Figs. 10, 11); if there is a 

concavity basally them bears small setae (Figs. 6–9) ........................... 2 

(2) Malar space 0.4–0.8x as long as basal width of mandible; body bright yellow 

with reddish or black spots; diurnal activity ................ Species-group D 

– Malar space 0.1–0.3x as long as basal width of mandible; body brownish, 

olive green, or light straw yellow; nocturnal activity............................ 3 

(3) Face generally long, at least 1x as long as wide (Figs. 12–30); compound eyes 

at least 0.8x as wide as facial width; head, in lateral view, with gena 0.3–0.5x as 

wide as compound eyes (Figs. 31–49) ........................ Species-group A 

– Face at most 1.0x as wide as long (Figs. 118–139); compound eyes at most 

0.6x as wide as facial width; head, in lateral view, with gena at least 0.6x as wide 

as compound eyes (Figs. 140–161) …........................ Species-group C 

Biology.- Ophionines are solitary koinobiont endoparasitoids 

of the caterpillars of many conspicuous larger Lepidoptera 

(Fernandez-Triana 2005, Gauld 1985, Gauld & Lanfranco 

1987, Townes 1971). The parasitoid egg is apparently free in 

the host's haemocoel where it hatches to produce a caudate 

first instar larva; species attacking mature larvae undergo rapid 

development, but taxa that oviposit in very young larvae have 

a protracted first larval instar. The parasitoid larva completes 

development just prior to host-pupation, often after the host 

5

Alvarado 

Figures 4 – 20. 

Details of mandibles in ventral view. 

(4) A.capayan new species 

(5) A. flavorufus 

(6) A. yestay new species 

(7) A. pachacutii new species 

(8) A. jujuye new species 

(9) A. trauco new species 

(10) A. diaguita new species 

(11) A. inti new species. 

Details of face. 

(12) A. mancocapaci new species 

(13) A. picunche new species 

(14) A. mapuche new species 

(15) A. chango new species 

(16) A. alvarengai new species 

(17) A. ona new species 

(18) A. chono new species 

(19) A. alacalufe new species 

(20) A. pihuchen new species. 

6 



has constructed a cocoon. The ichneumonid larva spins a 

characteristic fibrous, ovoid cocoon which is generally dark 

brown with a pale equatorial band. Species may remain as 

mature larvae or even adults inside this cocoon for the greater 

part of the year in seasonal habitats (Gauld 1985). 

Alophophion have been recovered from Noctuidae (Baudino 

2005, Gauld & Lanfranco 1987). Baudino (2005) recovered 

species from larvae of the cutworms Agrotis malefida 

(Guenée), Feltia gypaetina (Guenée), and Peridroma saucia 

(Hübner) feeding on Medicago sativa L. (Fabaceae) during a 

survey conducted over four years (1999–2002) in La Pampa 

Province, Argentina. Alophophion was responsible for 80% 

of the parasitoidism of these cutworms, indicating them as 

potentially critical biological control agents. Pupal formation 

occurred between 18 September and 28 November of each year 

of sampling, and adults emerged between 5 May and 4 August 

the year after cocoon formation; the average date of adult 

emergence was 12 June. The period between adult emergences 

averaged 222.7 days (about 7 months), meaning that once the 

cocoon is formed, and the larva remains in diapause until early 

winter of the following year, so that emerging adults coincide 

with the birth of cutworms. Alophophion larseni (Enderlein, 

1912) was recovered from an undetermined noctuid (Gauld 

& Lanfranco 1987). 

Gauld & Lanfranco (1987) mentioned that Alophophion 

occurs in South America south of the equator and in cooler 

areas partially replaces Ophion, a cosmopolitan genus; that 

Alophophion is most diverse in southern Chile and Patagonia. 

Alophophion larseni (Enderlein, 1912) is the only ophionine 

present in the Falkland Islands (Yu & Horstmann 1997, Gauld 

& Lanfranco 1987). 

Most Ophionines, including Alophophion, are crepuscular or 

nocturnal and frequently come to light at night in large numbers 

(Gauld & Carter 1983). They may be collected using light traps 

which makes them particularly suitable for zoogeographic and 

ecological study; and large samples may be collected in terrain 

where sweep netting and Malaise traps yield poor results, or, as 

in the case of the rainforest canopy, where collections can only 

be achieved by cumbersome, expensive, and (for fast-flying 

insects) unproven techniques (Gauld 1985). 

Taxonomic history.- Cushmann (1947) proposed Alophophion 

on the basis of the lack of the occipital carina, a character 

that barely warranted generic distinction from Ophion and 

commented that “… several species before me, all from South 

America, present such uniformity of structure as to form a 

compact group more conveniently treated here as a genus”. He 

designated Ophion chilensis Spinola, 1851 as the type species 

but did not formally transfer any other species into Alophophion 

thereby leaving it monotypic for the time. 

Townes & Townes (1966) transferred O. filicornis (Morley, 

1912), O. flavorufus (Brullé, 1846), O. holosericeus (Taschenberg, 

1875), O. politus (Morley, 1912), O. porculatus (Morley, 

1912), and O. larseni (Enderlein, 1912) to Alophophion. It is 

unclear whether some or all of these species were those already 

mentioned by Cushman (1947) when he wrote, “... several 

species before me...” 

Townes (1971) proposed two tribes in Ophioninae, the 

Ophionini and Enicospilini. Alophophion was included in 


Ophionini, a group that was distinguished by the protibial spur 

with a longitudinal comb of short bristles on its front side, and 

on its hind side a longitudinal membranous scraper, the scraper 

similar in shape to the comb and parallel to it; protibial spur a 

little ticker than in the Enicospilini; and second tergite usually 

with a median triangular or semi-triangular raised area at the 

base that is bounded by a weak impression. He re-described 

Alophophion and mentioned that it occurs in South America and 

Falkland Islands and that it was a large genus despite including 

only seven described species. 

Gauld (1980) did an analysis of the classification of the 

Ophion genus-group, he disagree with Cushman (1947) that 

Alophophion scarcely warranted generic distinction from Ophion 

and despite the fact that Alophophion was undoubtedly close to 

Ophion, the combination of characters exhibited by this group 

separated it well from Ophion. Gauld did not consider the tribes 

proposed by Townes (1971) because he considered that the 

tribe Enicospilini was a heterogeneous assemblage of potentially 

unrelated genera. He also mentioned that Alophophion occurs in 

southern South America from Ecuador to the Falkland Islands 

and that it may potentially compromise about 30 species. 

Gauld & Lanfranco (1987) provided a key for genera occurring 

in South America, and suggested that Alophophion was not 

present north of 25 o S latitude and in cooler areas was partially 

replacing Ophion in such regions. Additionally, they noted that 

the genus was more diverse in the south part of Chile and Patagonia 

and that Alophophion was the only lineage of ophionines 

collected in the Falkland Island (Islas Malvinas). These authors 

also proposed that A. occidentalis should be considered as a 

synonym of A. larseni. 

Relationships to other genera.- Gauld (1985) made the 

first attempt to reconstruct the phylogeny of the genera of the 

Ophioninae using both parsimony and compatibility methods 

of analysis. He recognized within Ophioninae five major evolutionary 

lineages as the Ophion, Sicophion, Eremotylus, Thyreodon, 

and Enicospilus genus-groups for thirty-two genera and a scenario 

for the possible evolution of the subfamily was suggested. The 

Ophion group contained seven genera: Afrophion Gauld, Agathophiona 

Westwood, Alophophion, Xylophion Gauld, Sclerophion 

Gauld, Rhopalophion Seyrig, and Ophion. According to Gauld 

(1985) Ophion is apparently a paraphyletic stem-group from 

which all other genera in this group have arisen, and the genus 

was primarily a Holarctic taxon, originating in the temperate 

north. It is probable that at some period it was present in most 

regions and has gradually disappeared from equatorial regions 

leaving isolated relicts in South Africa (Afrophion), Australia 

(Xylophion), Madagascar (Rhopalophion), and Patagonia (Alophophion). 

The possibility that there has been repeated expansion 

into and extinction within the tropics is suggested by the presence 

of some groups of species of Ophion on isolated mountains 

in Southeast Asia, New Guinea, and South America, and by the 

occurrence of distinctive Ophion species-complexes in Australia 

and New Zealand (Gauld 1985). Obviously, if this scenario is 

correct, then Ophion s.str. requires a comprehensive and rigorous 

phylogenetic analysis and eventual division into monophyletic 

genera. Quicke et al. (2009) analyzed the internal phylogeny of 

the Ichneumonidae and found scant evidence for the Thyreodon 

genus group of Gauld (1985), though these taxa did tend to 

form a grade in the combined morphological and molecular trees 

7

Alvarado 

leading to a clade comprising Ophion, Alophophion, Afrophion, 

Xylophion, and Rhopalophion, and various additional genera in 

their gaps-informative tree. Unfortunately, their study was not 

specifically designed to fully resolve internal relationships within 

Ophioninae and this remains an area for critical investigation. 

Species-group A 

Diagnosis.- Face long, at least 1x as long as wide (Figs. 

12–30); compound eyes at least 0.8x as wide as face; head, in 

lateral view, with gena 0.3–0.4x as wide as compound eyes (Figs. 

31–49), exceptionally 0.5x in A. mancocapaci new species (Fig. 

45). Lateral ocellus separated from compound eye by usually less 

than 0.2x ocellar diameter (Figs. 50–52), exceptionally 0.3x in 

A. picunche new species (Figs. 53). Compound eyes and ocelli, 

in relation to vertex, larger than in other species groups. Upper 

margin of mandibles with a small concavity at base, glabrous in 

lateral edge; bearing small setae (Fig. 8–9), concavity longer in 

A. trauco new species (Fig. 8) but not reaching external surface 

of mandibles. Notaulus extending 0.4x length of mesoscutum, 

exceptionally reaching to 0.6x in A. maytacapaci new species. 

Color yellowish, brownish, some species brownish with cream 

or yellowish spots. 

Included species.- Nineteen species are presently included 

in this species-group, all of which are newly described: A. alacalufe 

new species, A. alvarengai new species, A. ananauca new 

species, A. chango new species, A. chono new species, A. jujuye 

new species, A. mallecoensis new species, A. mancocapaci new 

species, A. mapuche new species, A. mapudungun new species, 

A. maytacapaci new species, A. ona new species, A. pedroi new 

species, A. picunche new species, A. pihuchen new species, A. 

sinchirocai new species, A. sofiae new species, A. trauco new 

species, and A. viride new species. 

Comments.- Most of the species of species-group A are distributed 

along the western slopes of the Andes with the exception 

of A. alvarengai new species and A. jujuye new species and that 

occur in Brazil and Argentina and A. mancocapaci new species 

and A. pedroi new species which are distributed on the eastern 

slopes of the Andes of Peru. 

Key to species of species-group A 

(1) Mesopleuron furrow absent (Figs. 58–68, 75) ..........................… 2 

– Mesopleural furrow present (Figs. 69–74), projecting from upper epicnemial 

carina to posterior-lower end of mesopleuron, sometimes short, not reaching 

middle of mesopleuron .................................................................... 11 

(2) Propodeum without transverse carinae; hind wing with 9 hamuli on R1 

distally; gena 0.5x as wide as compound eyes in lateral view (Fig. 45) 

......................................... Alophophion mancocapaci new species 

– Propodeum with transverse carinae; hind wing with 6–8 hamuli on R1 distally; 

gena at most 0.4x wide as compound eyes in lateral view ................... 3 

(3) Lateral ocelli almost in contact with compound eyes, separated from compound 

eyes by less than 0.1x maximum diameter of lateral ocelli (Fig. 50) 

............................................ Alophophion alvarengai new species 

– Lateral ocelli separated from compound eyes by at least 0.1x as maximum 

diameter of posterior ocelli (Fig. 52–53)............................................. 4 

(4) Epicnemial carina oval in a lateral view (Fig. 61); metasomal tergite light 

straw yellow with a brownish spot apically … 

.............................................Alophophion pihuchen new species 

– Epicnemial carina forming an angle or strongly curved between mesopleuron 

and mesosternum (Figs. 61–68); metasomal tergite with a single color … 

................................................................................................. 5 

(5) Posterior transverse carina faintly indicated centrally; area superomedia + 

dentipara with longitudinal striate sculpture (Fig. 85) 

................................................... Alophophion chango new species 

– Posterior transverse carina well defined (Figs. 86–90); area superomedia 

discernible and smooth ...................................................................... 6 

(6) Lateromedian longitudinal carinae behind posterior transverse carinae 

separated, sometimes faint; area petiolaris present (Figs. 86–88) ......... 7 

– Lateromedian longitudinal carinae behind posterior transverse carinae confluent; 

area petiolaris absent (Figs.89–90) …........................................... 9 

(7) Marginal cell of fore wing with a glabrous area next to Rs+2r and cover by 

setae next to pterostigma (like Fig. 56) … 

................................................ Alophophion picunche new species 

– Marginal cell of fore wing with a glabrous area next to Rs+2r and pterostigma 

(Fig. 55) … 8 

(8) Compound eyes 0.7–0.8x as wide as face (Fig. 14); metasoma with tergite 

II with spiracle located at 0.6x length of tergite … 

................................................. Alophophion mapuche new species 

– Compound eyes 1.0x as wide as face (Fig. 18); metasoma with tergite II with 

spiracle located at 0.5x length of tergite … Alophophion chono new species 

(9) Compound eyes 1.0x as wide as face (Fig. 19); mesopleuron brownish red 

with cream colored spots ….......... Alophophion alacalufe new species 

– Compound eyes 0.8–0.9x as wide as face (Figs. 17, 28); mesopleuron homogeneously 

testaceous with or without few yellow spot ..................… 10 

(10) Face 0.8–0.9x as wide as long (Fig. 17); lateral ocellus separated from 

compound eye by 0.1–0.2x ocellar diameter … 

......................................................... Alophophion ona new species 

– Face 0.9–1.0x as wide as long (Fig. 28); lateral ocellus separated from compound 

eye by 0.3–0.4x ocellar diameter … 

........................................... Alophophion mallecoensis new species 

(11) Carinae on propodeum developed as lamellate (Figs. 91) … 

.................................................... Alophophion trauco new species 

– Carinae on propodeum not lamellate, sometime faint (Figs. 76–81, 92) … 

.................................................................................................... 12 

(12) Juxtacoxal carina present (Fig. 71) … 

............................................ Alophophion sinchirocai new species 

– Juxtacoxal carina absent ................................................................. 13 

(13) Head with pale mark on orbits; lower face and frons centrally brownish 

red (Fig. 24–25) ...........................................................................… 14 

– Head predominantly light straw yellow, except sometimes occiput testaceous, 

orbits not discernible (Fig. 21–23); lower face and frons sometimes centrally 

slightly brownish .............................................................................. 15 

(14) Mesoscutellum entirely cream colored; compound eyes 0.9x as wide as face 

(Fig. 25); gena, in lateral view, 0.2x as wide as compound eyes (Fig. 41) ... 

.............................................. Alophophion ananauca new species 

– Apical half of mesoscutellum yellowish; compound eyes 0.8x as wide as face 

(Fig. 24); gena, in lateral view, 0.4x as wide as compound eyes (Fig. 43) … 

........................................... Alophophion maytacapaci new species 

(15) Lateral ocelli almost in contact with compound eyes (Fig. 52) … 16 

– Lateral ocelli separated from compound eyes by at least 0.1x maximum 

diameter of lateral ocelli (Figs. 53) .................................................... 17 

(16) Lower edge of speculum scrobiculate (Fig. 70); metapleuron rugulose … 

.................................................... Alophophion jujuye new species 

– Lower edge of speculum and metapleuron imbricate with punctures (Fig. 75) 

................................................... Alophophion pedroi new species 

(17) Gena and occiput of the same color, olive green; face 0.9–1.0x as wide as 

long (Fig. 30); lower edge of speculum finely scrobiculate (Fig. 74) … 

.................................................... Alophophion viride new species 

– Gena yellowish and occiput glaucous; face 0.8x as wide as long (Fig. 40, 42); 

lower edge of speculum imbricate between punctures ....................... 18 

8 





(21) A. sofiae new species 


(23) A. mapudungun new species 

(24) A. maytacapaci new species 

(25) A. ananauca new species 

(26) A. sinchirocai new species 


(28) A. mallecoensis new species 

(29) A. pedroi new species. 


(30) A. viride new species 

Details of head in lateral view. 













(43) A. maytacapaci new species. 


9

Alvarado 

Figures 44 – 65 





(47) A. pedroi new species 


(49) A. pihuchen new species 

Details of head in dorsal view. 




(53) A. picunche new species. 

Details of fore wing. 



(56) A. trauco new species. 

(57) Details of mesosoma in lateral view. 

A. mancocapaci new species. 

Details of Mesosoma in lateral view. 


(59) A. maytacapaci new species 






(65) A. chono new species. 

10 




Details of mesosoma in lateral view. 








(73) A. ananauca new species. 




Details of propodeum. 






(81) A. maytacapaci new species. 


11

Alvarado 











(90) A. ona new species. 




(18) Metapleuron with punctate texture on apical half and rugulose on the 

lower half; mesopleuron glaucous with yellowish spots … 

........................................ Alophophion mapudungun new species 

– Metapleuron with rugulose texture on entire surface (Figs. 72); mesopleuron 

homogeneously glaucous …................ Alophophion sofiae new species 

12 

1. Alophophion alacalufe new species 

(Figs. 19, 35, 66, 89) 

Diagnosis.- This species can be recognized by this combination 

of the features: body mainly brownish red colored, 

nervellar index of hind wing 1.0 and compound eyes 1.0x as 

wide as face. 

Description.- ♀: Head. Face (Fig. 19) 0.9 x as wide as long; 

softly imbricate with punctures separated by 1–2x a puncture 

width; median portion weakly convex. Clypeus convex; upper 

half smooth and lower softly imbricate with punctures separated 

by 2–3x a puncture width; apical edge centrally straight and 

slightly convex laterally. Compound eyes 1.0x as wide as face. 

Malar space 0.1–0.2x as long as basal width of mandible. Gena, 

in lateral view (Fig. 35), 0.4x as wide as compound eyes, softly 

imbricate with shallow punctures separated by 1x a puncture 

width. Frons softly imbricate, softly striate between antennae 

and median ocellus. Vertex with texture as gena. Lateral ocellus 

separated from compound eye by 0.1x ocellar diameter; distance 

between ocelli 0.5–0.6x ocellar diameter. Antenna with 51–52 

flagellomeres. Ratio of length/width from first to seventh flagellomeres: 

5.3:2.7:2.4:2.3:2.2:2.1:2.1. Ratio of length/width of 

pre-apical flagellomeres: 1.5x. 

Mesosoma.- Pronotum on upper half softly imbricate with 

punctures separated by 1.0–2.0x a puncture width; lower half 

and collar striate. Mesoscutum smooth with shallow punctures 

separated by 6–8x a puncture width. Notaulus extending 0.3x 



length of mesoscutum, finely scrobiculate. Mesoscutellum evenly 

convex, with texture as that of mesoscutum; lateral carina reaching 

0.1x to posterior margin of mesoscutellum. Mesopleuron 

(Fig. 66) imbricate with punctures separated by 0.5–1x a puncture 

width; speculum smooth with shallow punctures separated 

by 2x a puncture width; mesopleural furrow absent. Epicnemial 

carina curved to meet anterior margin of mesopleuron at lower 

third of pronotum; forming an angulation between mesopleuron 

and mesosternum. Metapleuron softly imbricate with punctures 

separated by 0.5x a puncture width. Fore wing with CI=0.5; 

ICI=0.8–0.9; SDI=1.4–1.5; 1m-cu straight; ramulus present; 

Rs+M slightly curved; marginal cell with a glabrous area next 

to the upper half of Rs+2r; sub-basal cell glabrous with isolate 

setae in the apical half. Hind wing with 7 hamuli on R1 distally; 

NI=1.0; cu-a slightly curved. Propodeum (Fig. 89) softly imbricate 

with shallow punctures; anterior transverse carina present 

between lateral longitudinal carinae; posterior transverse carina 

present, reaching to pleural carinae; longitudinal carinae present; 

lateromedian longitudinal carinae confluent behind posterior 

transverse carina and absent before anterior transverse carinae; 

pleural carina present. 

Metasoma.- First tergite 5.6x as long as apical width. Tergite 

II with spiracle located at 0.5x length of tergite. 

Color.- Brownish red except following: face, gena, between 

ocelli, vertex, anterior upper half of pronotum, collar, lateral 

margins of mesoscutum, a longitudinal stripe from notaulus to 

the posterior end of mesoscutum, mesoscutellum, tegula, subalar 

prominence, anterior half of speculum, spot between subalar 

prominence and mesopleural furrow, a spot in posterior lower 

mesopleuron, and a spot in upper-apical third metapleuron. 

Wings grayish hyaline; veins brownish and pterostigma fulvous. 

♂: Unknown. 

Comments.- This species is distributed in the Chilean region 

of Coquimbo. 

Etymology.- The species epithet refers to the Alacalufes, 

a South American people living in the Chilean Patagonia. It is 

treated as a noun in apposition. 

Holotype: ♀, “CHILE: Prov. [Provincia] Elqui Choros Bajos 

25.X.1988 JEBarriga [J.E. Barriga]” (MNNC). 

Paratypes: ♀, same data as holotype (UCDC). 

2. Alophophion alvarengai new species 

(Figs. 16, 44, 60, 83) 

Diagnosis.- This species can be recognized by having the 

ocelli in contact with compound eyes, the mesopleural furrow 

absent, and olive green color. 

Description.- ♀: Head. Face (Fig. 16) 0.8x as wide as long; 


width; median portion weakly convex. Clypeus convex; softly 

imbricate with shallow punctures separated by 2–3x a puncture 

width; apical edge straight centrally, slightly convex laterally. 

Compound eyes 1.0x as wide as face. Malar space 0.1x as long as 

basal width of mandible. Gena imbricate with shallow punctures 

separated by 2x a puncture width; in lateral view (Fig. 44), 0.3x 

as wide as compound eyes. Frons bearing setae laterally between 

ocelli; imbricate, slightly striate between antennae and median 

ocellus. Vertex with texture as gena. Lateral ocellus separated 

from compound eye by less than 0.1x ocellar diameter; distance 

between ocelli 0.3–0.4x ocellar diameter (Fig. 50). Antenna with 

47–48 flagellomeres. Ratio of length/width from first to seventh 

flagellomeres: 3.9–4.0:2.4–2.6:2.2–2.4:2.1–2.2:2.1:2.1:2.0–2.1. 

Ratio of length/width of pre-apical flagellomeres: 2.0–2.1x. 

Mesosoma. Pronotum imbricate with shallow punctures separated 

by 3x a puncture width. Notaulus extending 0.3x length 

of mesoscutum. Mesoscutum and mesoscutellum imbricate with 

shallow punctures separated by 2–3x a puncture width. Mesoscutellum 

evenly convex lateral carina reaching 0.1x to posterior 

margin of mesoscutellum. Mesopleuron (Fig. 60) imbricate 

with shallow punctures separated by 1–2x a puncture width; 

mesopleural furrow absent. Epicnemial carina not joining to 

anterior margin of mesopleuron. Metapleuron imbricate between 

punctures. Fore wing with CI=0.7; ICI=0.8; SDI=1.5; 1m-cu 

slightly curved; ramulus present; Rs+M slightly curved; marginal 

cell apically glabrous, except by a row of setae next to upper 

margin; sub-basal cell glabrous. Hind wing with 6–8 hamuli on 

R1 distally; NI=0.8; cu-a slightly curved. Propodeum (Fig. 83) 

with anterior area imbricate with shallow punctures separated 

by 2–3x a puncture width, behind anterior transverse carina 

granulo-striate with punctures separated by 1–2x a puncture 

width; with anterior transverse carina present, reaching pleural 

carinae; posterior transverse carina absent centrally; lateromedian 

longitudinal carinae present before anterior transverse carina, 

converging at the middle; lateral longitudinal carinae faint. 



Color.- Olive green to light straw yellow except following: 

antennae, two diagonal stripes in externum, trochanter, 

trochantellus, femur, tibia, tarsomeres and ovipositor sheath 

ferruginous. 

♂: Similar to female except: Hind wing with 6–8 hamuli 

on R1 distally. 

Comments.- This species was been only collected in Bahia, 

Brazil. Its distribution is overlapping with A. jujuye new species; 

both species have predominately olive green color, and ocelli in 

contact with compound eyes; within the Species-group A are 

the only that share these features. Additionally, A. alvarengai 

new species and A. jujuye new species they have the easternmost 

distribution of the genus. 

Etymology.- Named in honor of the Brazilian entomologist 

M. Alvarenga, who collected the type material. 

Holotype: ♀ “Encruzilhada Bahia, Brazil XI.'74 [xi.1974] 

980m. M. Alvarenga” 

Paratypes: 2♂♂, 5♀♀: labeled as follows: 2♀♀, same data 

as holotype; and 2♂♂, 3♀♀ “Encruzilhada, Bah. [Bahia] XI.'72 

[xi.1972] 960m. Braz. [Brazil] M. Alvarenga” (AEIC). 

3. Alophophion ananauca new species 

(Figs. 25, 41, 51, 73, 79) 


of the features: body mainly reddish brown colored with 


13

Alvarado 

cream color spots, compound eyes 0.9x as wide as face and 

metapleuron softly rugulose. 


imbricate with punctures separated by 1–2x a puncture width; 

median portion weakly convex. Clypeus with punctures separated 

by 3–4x a puncture width; apical edge slightly straight, laterally 

slightly convex. Compound eyes 0.9x as wide as face. Malar 

space less than 0.1x as long as basal width of mandible. Gena, 

in lateral view (Fig. 41), 0.2x as wide as compound eyes; softly 

imbricate with punctures separated by 4x a puncture width. 

Frons imbricate, slightly striate between antennae and median 


from compound eye by 0.1x ocellar diameter; distance between 

ocelli 0.4–0.5x ocellar diameter. Antenna with 50–51 flagellomeres. 

Ratio of length/width from first to seventh flagellomeres: 

4.8–5.1:2.5–2.7:2.3–2.4: 2.3–2.4: 2.2–2.1:2.0–2.1: 2.0–2.1. 


Mesosoma.- Pronotum in upper half imbricate with punctures 

separated by 1x a puncture width and lower half rugulose; 

lower half of collar striate and upper half imbricate. Mesoscutum 

imbricate with punctures separated by 2x a puncture width, 

except smooth in the anterior margins between notaulus and 

tegula. Notaulus extending 0.3x length of mesoscutum of 

mesoscutum, basally scrobiculate. Mesoscutellum evenly convex; 

smooth between punctures; lateral carina reaching 0.1x 

to posterior margin of mesoscutellum. Mesopleuron (Fig. 73) 

smooth on upper half and imbricate on lower half with punctures 

separated by 1x a puncture width; speculum smooth between 

punctures; mesopleural furrow softly rugulose, reaching to posterior 

end. Epicnemial carina curved to meet anterior margin 

of mesopleuron at lower quarter of pronotum. Metapleuron 

softly rugulose. Fore wing with CI=0.7–0.8; ICI=0.8; SDI=1.5; 

1m-cu slightly curved; ramulus present; Rs+M slightly curved; 

marginal cell apically with a glabrous area next to pterostigma 

and Rs+2r; sub-basal cell glabrous with isolated setae apically. 

Hind wing with 7 hamuli on R1 distally; NI=1.0; cu-a slightly 

curved. Propodeum (Fig. 79) softly carinate texture, except areas 

basalis and externa imbricate with shallow punctures separated 

by 3–4x a puncture width; anterior transverse carina present, 

faint laterally; posterior transverse carina present between pleural 

carinae; lateral longitudinal carinae present before anterior 

transverse carina, faint between transverse carinae, well develop 

behind posterior transverse carina; lateromedian longitudinal 

carinae present between transverse carina, behind posterior 

transverse carina confluent; softly carinate texture, except: areas 

basalis and externa imbricate with punctures separated by 1–2x 

a puncture width; pleural carina present. 

Metasoma.- First tergite 5.0–5.2x as long as apical width. 

Tergite II with spiracle located at 0.5x length of tergite. 

Color.- Reddish brown except following: face laterally, frons 

laterally, between ocelli, vertex, gena, collar, a spot in upper 

margin of pronotum and lower half, tegula, subalar prominence, 

lateral margins of mesoscutum, a longitudinal stripe from 

notaulus to the posterior end of mesoscutum, mesoscutellum, 

anterior half of speculum, spot between subalar prominence 

and mesopleural furrow, a spot in posterior lower mesopleuron, 

metapleuron apical half, propodeum apical half and hind coxae 

dorsally yellowish. Wings grayish hyaline; veins brownish; pterostigma 

cream colored, centrally brownish. 

14 

♂: Similar to female. 

Comments.- There are variations in the marginal cell of some 

specimens; they have setae next to the pterostigma and posterior 

transverse carina weak centrally. This species is distributed on 

the western Andes north of Chile. 

Etymology.- The species epithet "ananauca" refers to Añañuca, 

a legend character from the north of Chile that gave the 

name to the red flower. It is treated as a noun in apposition. 

Holotype: ♀ “Q. El León [Quebrada El León], Atac. [Atacama] 

X.5.1980 [05.x.1980] Chile [,] Luis Peña” (AEIC) 

Paratypes: 4♂♂, 14♀♀ “Q. El León [Quebrada El León], 

Atac. [Atacama] X.5.1980 [05.x.1980] Chile [,] Luis Peña” 

(AEIC). 

4. Alophophion chango new species 

(Figs. 15, 31, 62, 85) 

Diagnosis.- This species is easy to recognize, within the 

Species-groups A, by having the propodeum with areas dentipara 

and superomedia faintly delimitated, with carinate texture. 


centrally smooth and softly imbricate laterally with shallow 

punctures separated by 1x a puncture width; median portion 

weakly convex. Clypeus convex; smooth basally and apically 


apical edge slightly convex. Compound eyes 0.8–0.9x as wide 

as face. Malar space 0.1x as long as basal width of mandible. 

Gena, in lateral view (Fig. 31), 0.4x as wide as compound eyes; 


width. Frons imbricate, softly striate between antennae and 

median ocellus. Vertex with texture as gena. Lateral ocellus 

separated from compound eye by 0.1x ocellar diameter; 

distance between ocelli 0.3–0.6x ocellar diameter. Antenna 

with 52–54 flagellomeres. Ratio of length/width from first to 

seventh flagellomeres: 4.5–4.9:2.4–2.6:2.1–2.3:2.0–2.2:2.0– 

2.1:2.0–2.1:1.9–2.1. Ratio of length/width of pre-apical 

flagellomeres: 1.5–1.6x. 

Mesosoma.- Pronotum on upper half punctate imbricate 

laterally with shallow punctures separated by 0.5–1x a puncture 

width; lower half striate; collar striate. Mesoscutum smooth 

centrally and imbricate laterally with shallow punctures separated 

by 1x a puncture width. Notaulus extending 0.3x length 

of mesoscutum, scrobiculate. Mesoscutellum evenly convex, 

smooth with shallow punctures separated by 1x a puncture 

width; lateral carina reaching 0.1x to posterior margin of 

mesoscutellum. Mesopleuron (Fig. 62) imbricate with punctures 

separated by 1–2x a puncture width; subalar prominence 

smooth with shallow punctures separated by 3–4x a puncture 

width; lower edge of speculum finely scrobiculate; mesopleural 

furrow absent. Epicnemial carina curved to meet anterior margin 


imbricate with punctures separated by 0.5–1x a puncture width. 

Fore wing with CI=0.4; ICI=0.8; SDI=1.3–1.4; 1m-cu slightly 

curved; ramulus present; Rs+M slightly curved; marginal cell 

homogeneously covered by setae; sub-basal cell glabrous, except 

row of setae next to vein 1A apically. Hind wing with 6–7 hamuli 

on R1 distally; NI=0.8–0.9; cu-a slightly curved. Propodeum 



(Fig. 85) with anterior transverse carina present, faint laterally; 

posterior transverse carina weak centrally; longitudinal carinae 

present, faint; longitudinal carinate texture, except areas basalis 

and externa imbricate with punctures separated by 1–2x a 

puncture width; pleural carina present. 


Tergite II with spiracle located at 0.6 of tergite. 

Color.- Testaceous except following: area surrounding compound 

eyes, between ocelli, vertex and gena light straw yellow. 

♂: Similar to female, except texture of propodeum softer 

than in female. 

Comments.- Alophophion chango new species is distributed in 

the Chilean region of Maule and Araucanía and the Argentinean 

province of Tucuman. 

Etymology.- The species epithet "chango" refers to the tribe 

of native South Americans, the Chango people, who appeared 

to have originally inhabited the Peruvian coast and spread south 

to the coast of Atacama, in northern Chile. It is treated as a 

noun in apposition. 

Holotype: ♀ “Curacautín, Malleco II.'64 [ii.1964] R. [Río] 

Blanco Chile Luis E. Peña” (AEIC). 

Paratypes: 1♂, 8♀♀: labeled as follows: ARGENTINA: 

1♂,1♀ “ARGENTINA: Tuc. [Tucuman], Tafi d. [del] Valle, 

2,500 m. 6-8.I.1970 [06-08.i.1970]. At light Vardy & Argulindeguy.B.M.1970-36” 

(BMNH) CHILE: 1♀ “Chovellen Maule 

Prov. [Province] XII.5.53 [05.xii.1953] Chile L Pena Guzman 

[Peña Guzman]”; and 4♀♀ “Curacautín, Malleco II.'64 [ii.1964] 

R. [Río] Blanco Chile Luis E. Peña” (AEIC). 2♀♀ “CHILE: 

[Araucania] Los Alpes–Nahuelbuta 17.i.1985 I.D. Gauld” 

(BMNH). 

5. Alophophion chono new species 

(Figs. 18, 34, 65, 88) 


of the features: the clypeus convex, the compound eyes 

1.0x as wide as face and hind wing with 6 hamuli on R1 distally. 

Description.- ♀: Head. Face (Fig. 18) 0.8–0.9x as wide as 

long; imbricate with punctures separated by 1x a puncture width; 

median portion weakly convex. Clypeus convex; imbricate with 

sparse punctures separated by 2–4x a puncture width; apical 

edge slightly convex. Compound eyes 1.0x as wide as face. Malar 

space less than 0.1x as long as basal width of mandible. Gena, 

in lateral view (Fig. 34), 0.4x as wide as compound eyes, softly 

imbricate with shallows punctures separated by 8x a puncture 

width. Frons imbricate, slightly striate between antennae and 

median ocellus. Vertex with texture as gena. Lateral ocellus separated 

from compound eye by 0.2x ocellar diameter; distance 



5.0:2.5–2.7:2.3:2.2:2.1–2.2:2.1:2.0–2.1. Ratio of 

length/width of pre-apical flagellomeres: 1.7–1.8x. 

Mesosoma.- Pronotum punctate, imbricate with punctures 

separated by 1x a puncture width; collar striate. Mesoscutum 

smooth with shallows punctures separated by 6x a puncture 

width. Notaulus extending 0.2x length of mesoscutum; softly 


scrobiculate. Mesoscutellum evenly convex, with texture as that 

of mesoscutum; lateral carina reaching 0.2x to posterior margin 

of mesoscutellum. Mesopleuron (Fig. 65) punctate, imbricate 

with punctures separated by 1–2.5x a puncture width; mesopleural 

furrow absent. Epicnemial carina curved to meet anterior 

margin of mesopleuron at lower quarter of pronotum. Metapleuron 

imbricate with punctures separated by 3–4x a puncture 

width. Fore wing with CI=0.4–0.5; ICI=0.7–0.9; SDI=1.4; 

1m-cu slightly curved; ramulus present; Rs+M slightly curved; 

marginal cell with glabrous area next to proximal half of Rs+2r 

and pterostigma; sub-basal cell with isolate setae in the third 

apical. Hind wing with 6 hamuli on R1 distally; NI=0.9; cu-a 

slightly curved. Propodeum (Fig. 88) with anterior transverse 

carina present, faint laterally; posterior transverse carina present, 

reaching to pleural carinae; lateromedian longitudinal carinae 

absent before anterior transverse carina, present and well defined 

between transverse carinae, behind posterior transverse carina 

faint; lateral longitudinal carinae faint; pleural carina present; 

softly rugulose-carinate texture, except anterior area imbricate 

with punctures separated by 1–2x a puncture width. 


Tergite II with spiracle located at 0.5x of tergite. 

Color.- Rufo-testaceous except following: face, frons laterally, 

vertex, gena, pronotum (except upper dorsal corner), lateral 

margins of mesoscutum, spot from notaulus to 3/4 of mesoscutum, 

mesoscutellum, tegula, subalar prominence, speculum, 

a spot between subalar prominence and mesopleural furrow, a 

spot in posterior lower mesopleuron, metapleuron apical half, 

propodeum apical half and hind coxae dorsally yellowish. Wings 

grayish hyaline; veins brownish; pterostigma fulvous. 

♂: Unknown. 

Comments.- One female has the mesopleuron with isolate 

holes in the surface. Alophophion chono new species is distributed 

in the Chilean region of Coquimbo. 

Etymology.- The species epithet "chono" refers to the 

language spoken by the indigenous people that of the Chiloé 

Archipelago. It is treated as a noun in apposition. 

Holotype: ♀ “El Calabazo Had. [Hacienda] Illapel Coquimbo 

Prov. [Provincia] XI.21-23.57 [21-23.xii.1957] Chile L Pena 

Guzman [L. Peña Guzmán]” (AEIC). 

Paratypes: 2♀♀: labeled as follows: 1♀ “Canela Baja, 

Coquimbo, Chile X.23 1961 [23.x.1961] Luis Peña”; and 1♀ 

“Rivadavia Elqui valley Coquimbo V.16.53 [16.v.1953] Chile 

L Pena Guzman [L. Peña Guzmán]” (AEIC). 

6. Alophophion jujuye new species 

(Figs. 8, 22, 38, 52, 76) 


of the features: light straw yellow to olive green colored, 

posterior ocelli almost in contact with compound eyes and 

distance between ocelli 0.2–0.3x ocellar diameter. 


long; imbricate with punctures separated by 1.0–1.5x a puncture 

width; median portion weakly convex; median portion weakly 

convex. Clypeus slightly convex; imbricate with punctures 

15

Alvarado 

separated by 2.0–3.5x a puncture width; apical edge slightly 

convex. Compound eyes 1.0x as wide as face. Malar space at 

most 0.1x as long as basal width of mandible. Gena, in lateral 

view (Fig. 38), 0.4x as wide as compound eyes; imbricate with 

shallow punctures separated by 4–6x a puncture width. Frons 

imbricate, slightly striate between antennae and median ocellus; 

setae present laterally and between ocelli. Vertex with texture as 

gena. Lateral ocellus separated from compound eye by less than 

0.1x ocellar diameter; distance between ocelli 0.2–0.3x ocellar 

diameter (Fig. 52). Antenna with 51–62 flagellomeres. Ratio of 

length/width from first to seventh flagellomeres: 4.0–4.6:2.3– 

2.7:2.1–2.5:2.0–2.4:1.9–2.4:1.9–2.3:1.9–2.2. Ratio of length/ 

width of pre-apical flagellomeres: 2.0–2.1x. 

Mesosoma.- Pronotum on upper half punctate, imbricate 

with punctures separated by 0.5–1x a puncture width; lower half 

striate; lower half of collar striate. Mesoscutum smooth and centrally 


Notaulus extending 0.2 length of mesoscutum, basally scrobiculate. 

Mesoscutellum evenly convex; smooth with punctures 

separated by 1–2x a puncture width; lateral carina reaching 0.2x 


with subalar prominence, speculum and area between subalar 

prominence and epicnemial carina smooth with punctures separated 

by 1–2x a puncture width; lower edge of speculum finely 

scrobiculate; mesopleural furrow rugulose-punctate reaching to 

the posterior end, finely scrobiculate upper epicnemial carina. 

Epicnemial carina curved to meet anterior margin of mesopleuron 

at lower quarter of pronotum. Metapleuron rugulose. 

Fore wing with CI=0.6; ICI=0.7; SDI=1.4–1.5; 1m-cu slightly 

sinuate; ramulus present; marginal cell cover by setae; sub-basal 

cell glabrous with isolated setae. Hind wing with 6–7 hamuli on 

R1 distally; NI=1.0–1.1; cu-a slightly curved. Propodeum (Fig. 

76) with rugulose texture, except area basalis imbricate-striate 

with soft punctures separated by 6–8x a puncture width; anterior 

transverse carina present, faint laterally; posterior transverse 

carina present between pleural carinae, weak centrally; lateral 


faint between transverse carinae, well develop behind posterior 

transverse carina with traces of an additional one next to it; 

lateromedian longitudinal carinae present, behind posterior 

transverse carina confluent with traces of an additional one 

between them; pleural carina present. 


II with spiracle located at 0.6x of tergite. 

Color.- Light straw yellow to olive green except following: 

mandibles, antennae, mesopleuron, trochanter, trochantellus, 

femur, tibia and tarsomeres rufo-testaceous. Wings grayish 

hyaline; veins brownish and pterostigma fulvous. 

♂: Unknown 

Comments.- There is some variation in the specimen from 

Brazil, it has posterior transverse carina homogeneously develop 

and longitudinal carinae behind simple. 

This species is distributed in the Argentinean regions of 

Jujuy, Salta, and Tucuman and the Brazilian state of Bahia. Its 

distribution overlaps with A. alvarengai new species. And they 

seem to be closely related, as both have the ocelli in contact with 

the compound eyes and have similar coloration. 

16 

Etymology.- The species epithet "jujuye" refers to the Jujuyes, 

a name of sedentary indigenous people that inhabited the valley 

of Jujuy. It is treated as a noun in apposition. 

Holotype: 1♀ “Horco Molle nr. Tucumán XII-26-65 [26. 

xii.1965] Arg. [Argentina] H. & M. Townes” (AEIC) 

Paratypes: 8♀♀: labeled as follows: ARGENTINA: 7♀♀: 

1♀ “Horco Molle nr. Tucumán I.28-II.3.66 [28.i-03.ii.1966] 

Arg. Lionel Stange”; 2♀♀ “Horco Molle nr. Tucumán I-8-15-66 

[08-15.i.1966] Arg. [Argentina] H. & M. Townes”; 1♀ “Jujuy, 

Argent. [Argentina] I-14-66 [14.i.1966] H. & M. Townes”; 

1♀ “Tartagal, Salta I.'72 [i.1972] Argentina Manfredo Fritz”; 

1♀ “Amaicha, Argent. [Argentina] Nov. 19-21, 1966 [19-21. 

xi.1966] Lionel Stange”; and, 1♀ “Capillitas, Catam. [Catamarca] 

I-II.70 [i-ii.1970] Argentina Luis Peña” (AEIC). BRAZIL: 

1♀ “Encruzilhada [,] Bahia, Brazil XI.'74 [xi.1974] 980m. M. 

Alvarenga” (AEIC). 

7. Alophophion mallecoensis new species 

(Figs. 28, 37, 68) 


of the features: face almost square, clypeus convex and 

posterior transverse carina present with M shape between lateral 

carinae. 

Description.- ♀: Head. Face (Fig. 28) 0.9–1.0x as wide 

as long; median portion weakly convex; softly imbricate with 

punctures separated by 1.0–2.0x a puncture width. Clypeus 

convex; softly imbricate with punctures separated by 2.0–3.0x 

a puncture width; apical edge slightly convex. Compound eyes 

0.7–0.8x as wide as face. Malar space 0.1x as long as basal width 

of mandible. Gena, in lateral view (Fig. 37), 0.3–0.4x as wide 

as compound eyes; imbricate with soft punctures separated by 

5.0–7.0x a puncture width. Frons imbricate, slightly striate between 

antennae and median ocellus. Vertex with texture as gena. 

Lateral ocellus separated from compound eye by 0.3–0.4x ocellar 

diameter; distance between ocelli 0.5–0.6x ocellar diameter. 

Antenna with 53–56 flagellomeres. Ratio of length/width from 

first to seventh flagellomeres: 4.3–4.4:2.3–2.5:1.9–2.1:1.8–2.0: 

1.8–1.9: 1.7–1.9: 1.7–1.8. Ratio of length/width of pre-apical 


Mesosoma.- Pronotum in upper half smooth with punctures 

separated by 1.5–2.0x a puncture width and lower half striate; 

lower half of collar striate and upper half imbricate. Mesoscutum 

smooth with punctures separated by 4.0–5.0x a puncture width. 

Notaulus extending 0.4x length of mesoscutum, basal half scrobiculate. 

Mesoscutellum evenly convex, smooth with punctures 

separated by 2.0–3.0x a puncture width; lateral carina reaching 

0.2x to posterior margin of mesoscutellum. Mesopleuron (Fig. 

68) imbricate with punctures separated by 1.0–2.0x a puncture 

width; mesopleural furrow absent; speculum softly imbricate 

with punctures separated by 3.0–5.0x a puncture width. Epicnemial 

carina curved to meet anterior margin of mesopleuron 

at lower quarter of pronotum. Metapleuron imbricate with 

punctures separated by 0.5–1.0x a puncture width; juxtacoxal 

carina present. Fore wing with CI=0.4–0.5; ICI=0.8–0.9; 

SDI=1.3–1.4; 1m-cu slightly curved; ramulus present; marginal 

cell basally with a glabrous area next to pterostigma and vein 

Rs+2r; sub-basal cell glabrous. Hind wing with 7 hamuli on R1 



distally; NI=0.8; cu-a slightly curved. Propodeum with leathery 

texture, except areas basalis and externa imbricate with punctures 

separated by 0.5–1.5x as a puncture width; anterior transverse 

carina present, faint laterally, strongly up-curved centrally; 

posterior transverse carina present between pleural carinae with 

a M shape between lateral carinae; lateral longitudinal carinae 

faint between transverse carinae, behind posterior transverse 

carina complete and well defined; lateromedian longitudinal 

carinae present before anterior transverse carina and between 

transverse carinae, behind posterior transverse carina forming 

a single carina (some specimens with additional, faint carinae 

next to lateromedian longitudinal carina); pleural carina present. 



Color.- Testaceous except following: face laterally, frons 

laterally, between ocelli, vertex, gena next to compound eyes 

cream colored. 

♂: similar to female. 

Comments.- Some specimens have irregular texture on mesopleuron 

that can resemble the mesopleural furrow but in this 

species this texture is not contacted to epicnemial carina. Other 

have sub-basal cell glabrous with isolate setae on distal half. 

Etymology.- The specific epithet is based on Malleco the 

type locality. 

Holotype: ♀ “CHILE MALLECO Vn. [¿] Louquimay 

[Lonquimay] 1400m 22.XII.1994 [22.xii.1994] J.E. Barriga” 

(MNNC) 

Paratypes: 2♂♂, 15♀♀ labeled as follows: ARGENTINA: 

1♀, “ARGENTINA. N.-W [NW] Patagonia. 1,000-3,000ft. 

[305-915m] Dec. 1919. H.E. Box” (BMNH). CHILE: 2♂♂, 

13♀♀ same data as holotype (UCDC); 1♀ “Curacautín, Malleco 

II.'64 [ii.1964] R. [Río] Blanco Chile Luis E. Peña” (AEIC). 

8. Alophophion mancocapaci new species 

(Figs. 12, 45, 54, 57, 82) 

Diagnosis.- This species is easy to recognize by its entirely 

yellow face; fore wing Rs+2r markedly sinuous just before the 

center of vein; and the hind wing with 9 hamuli on R1 distally. 

Description.- ♀: Head. Face (Fig. 12) 1.0 x as wide as 

long; coarsely punctate, imbricate with punctures separated by 

0.5–1x a puncture width; median portion weakly convex. Clypeus 

convex; with texture as face; apical edge straight centrally, 

slightly convex laterally. Compound eyes 0.8x as wide as face. 

Malar space 0.1x as long as basal width of mandible. Gena, in 

lateral view (Fig. 45), 0.5x as wide as compound eyes, softly 

imbricate with punctures separated by 1–2x a puncture width. 




ocelli 0.3x ocellar diameter. Antenna with 56 flagellomeres. 


4.1:2.3:2.1:2.0:1.9:1.8:1.7. Ratio of length/width of pre-apical 

flagellomeres: 2.7x. 

Mesosoma.- Pronotum in upper half punctate, imbricate 

with punctures separated by 0.5–1x a puncture width; collar 


striate-punctate. Mesoscutum softly imbricate laterally and 

smooth centrally with punctures separated by 1–2x a puncture 

width. Notaulus extending 0.3x length of mesoscutum, rugulose 

basally. Mesoscutellum evenly convex, imbricate with punctures 

separated by 1–2x a puncture width; lateral carina reaching 


57) softly imbricate with punctures separated by 0.5–1x a 

puncture width; mesopleural furrow absent. Epicnemial carina 

not curved to meet anterior margin of mesopleuron, reaching 

about lower third of pronotum. Metapleuron imbricate with 

punctures separated by 1x a puncture width. Fore wing (Fig. 

54) with CI=0.5; ICI=0.9; SDI=1.2; 1m-cu straight; ramulus 

present; Rs+M curved; Rs+2r markedly sinuous just before 

center of vein; marginal cell with a glabrous area next to Rs+2r; 

sub-basal cell glabrous with a row of setae next to M+Cu. Hind 

wing with 9 hamuli on R1 distally; NI=1.1; cu-a slightly curved. 

Propodeum (Fig. 82) imbricate with shallow punctures; 

transverse carinae absent; longitudinal carinae present only 

apically; pleural carina absent. 



Color.- Fulvous except following: face, gena, frons, vertex, 

subalar prominence and mesoscutellum yellowish, and apical 

quarter of tergite III and tergites IV to VIII brownish. Wings 

infuscate; veins and pterostigma brownish except next to Rs+2r 

fulvous. 

♂: Unknown. 

Comments.- The locality label mentions Quincemil near 

Macapata, but it should be Marcapata given that Macapata in 

Peru is in Lima Department. 

Etymology.- The species epithet "mancocapaci" refers to 

Manco Capac, the first ruler of the Tawantinsuyu 

Holotype: 1♀: labeled as follows: PERU: 1♀, “Quincemil, 

Perú 30 m. nr. Macapata [Marcapata] IX.1-3.62 Luis Peña 

[handwritten]” (AEIC). 

9. Alophophion mapuche new species 

(Figs. 14, 33, 55, 64, 87) 

Diagnosis.- This species has a similar appearance to A. picunche 

new species. Alophophion mapuche new species has the 

clypeus with the upper half convex and the lower half flat while 

A. picunche new species has the clypeus convex. 

Description.- ♀: Head. Face (Fig. 14) 0.9–1.0 x as wide 

as long; softly imbricate with punctures separated by 1–2x a 

puncture width; median portion weakly convex. Clypeus with 

upper half convex and lower half flat; imbricate with punctures 

separated by 2–3x a puncture width; apical edge straight 

centrally, laterally slightly convex. Compound eyes 0.7–0.8x 

as wide as face. Malar space 0.1x as long as basal width of 

mandible. Mandibles imbricate with irregularly distributed 

punctures. Gena, in lateral view (Fig. 33), 0.3–0.4x as wide as 

compound eyes; softly imbricate with punctures separated by 

4–5x a puncture width. Frons imbricate, softly carinate between 

antennae and median ocellus. Vertex with texture as gena. Lateral 

ocellus separated from compound eye by 0.2–0.3x ocellar 


17

Alvarado 


first to seventh flagellomeres: 4.5–4.6:2.3–2.7:2.1–2.3:2.0– 

2.2:1.9–2.1:1.9–2.0:1.9. Ratio of length/width of pre-apical 


Mesosoma.- Pronotum smooth with punctures separated 

by 2x a puncture width; collar striate; with a row of transverse 

carinae on posterior edge of pronotum. Mesoscutum smooth 

with shallow punctures separated by 10x a puncture width. 

Notaulus extending 0.2x length of mesoscutum, basally scrobiculate. 

Mesoscutellum evenly convex, smooth with punctures 

separated by 3x a puncture width; lateral carina reaching 0.1x to 

posterior margin of mesoscutellum. Mesopleuron (Fig. 64) on 

upper half smooth and lower half imbricate; coarsely punctate, 

punctures separated by 2x a puncture width; mesopleural furrow 

absent. Epicnemial carina curved to meet anterior margin of 

mesopleuron at lower third of pronotum. Metapleuron imbricate 

with punctures separated by 2x a puncture width. Fore wing 

(Fig. 55) with CI=0.4–0.5; ICI=0.8–1.0; SDI=1.3–14; 1mcu 

straight; ramulus present; Rs+M slightly curved; marginal 

cell with a glabrous area apically, extending next to Rs+2r and 

pterostigma; sub-basal cell glabrous, with isolate setae apically. 

Hind wing with 7–8 hamuli on R1 distally; NI=0.6–0.9; cu-a 

slightly curved. Propodeum (Fig. 87) areas lateralis, petiolaris 

and posteroexterna softly wavy-rugulose and areas anterior, 

dentipara and superomedia punctate, smooth with shallow 

punctures; anterior transverse carina present, faint laterally; 

posterior transverse carina present between pleural carinae, 

sometimes broken medially; lateromedian longitudinal carinae 

absent before anterior transverse carina, present and well defined 

between transverse carinae, behind posterior transverse carina, 

sometimes converging, when converging there are two lateral 

carinae; lateral longitudinal carinae faint between transverse 

carinae, behind posterior transverse carina present; pleural 

carina present. 




vertex, gena, lower pronotum, collar, lateral margins of 

mesoscutum, spot from notaulus to 3/4 of mesoscutum, mesoscutellum, 

tegula, subalar prominence, speculum, a diagonal 

stripe in mesopleuron, metapleuron apical half and propodeum 

apical half yellowish. Wings grayish hyaline; veins brownish and 

pterostigma testaceous. 


Comments.- Alophophion mapuche new species is distributed 

in the Chilean regions Biobío, Coquimbo and Valparaíso. This 

species overlaps its distribution with A. picunche new species. 

Etymology.- The species epithet "mapuche" refers to The 

Mapuche, a group of indigenous inhabitants of south-central 

Chile and southwestern Argentina. It is treated as a noun 

in apposition. 

Holotype: ♀ “El Pangue, Coquimbo, Chile XI.3-5 1961 

[03-05.xi.1961] Luis Peña” (AEIC). 

Paratypes: 2♂♂, 18♀♀: labeled as follows: 7♀♀ “El Pangue, 

Coquimbo, Chile XI.3-5 1961 [03-05.xi.1961] Luis Peña”; 1♀ 

“El Pangue, Coquimbo, Chile XI.4 1961 [04.xi.1961] Luis Peña”; 

1♀ “Las Vizcachas Chile 50 km. E Valparaiso X.20-21.51 [20- 

18 

21.x.1951] L. Peña”; 2♂♂, 6♀♀ “Río Los Chores [Los Choros], 

Coquimbo, Chile X.29-30 1961[29-30.x.1961] Luis Peña”; 1♀ 

“Rio los Molles [handwritten] Coquimbo, Chile XI.7-10.61 [07- 

10.xi.1961; handwritten] Luis Peña”; 1♀ “Rio los Molles [hand 

written] Coquimbo, Chile XI.7-10.61 [07-10.xi.1961; hand 

written] Luis Peña” and 1♀ “Rivadavia Elqui valley Coquimbo 

X.28-29.57 Chile L Pena Guzman [Peña Guzmán]” (AEIC). 

10. Alophophion mapudungun new species 

(Figs. 23, 42, 58, 80) 


of the features: face 0.8x as wide as long, clypeus convex 

with imbricate texture between punctures and metapleuron 

fulvous with apical half yellowish. 


median portion weakly convex; softly imbricate. Clypeus convex; 


apical edge slightly convex. Compound eyes 0.8–0.9x as wide as 

face. Malar space 0.1x as long as basal width of mandible. Gena, 

in lateral view (Fig. 42), 0.3–0.4x as wide as compound eyes, 

softly imbricate with punctures separated by 3–4x a puncture 


median ocellus. Vertex with texture as gena. Lateral ocellus separated 

from compound eye by 0.2x ocellar diameter; distance 



4.5–5.3:2.9–3.0:2.6:2.4–2.5: 2.4–2.5:2.4:2.2–2.3. 



separated by 1.0–2.0x a puncture width and lower half 

rugulose; lower half of collar striate and upper half imbricate 

with punctures separated by 1x a puncture width. Mesoscutum 

smooth with punctures separated by 1.0–2.0x a puncture 

width, punctures closer centrally. Notaulus extending 0.3x 

length of mesoscutum, basally scrobiculate. Mesoscutellum 

evenly convex, smooth with punctures separated by 4x a 

puncture width; lateral carina reaching 0.1x to posterior margin 

of mesoscutellum. Mesopleuron (Fig. 58) on upper half 

smooth and lower half imbricate; coarsely punctate, punctures 

separated by 0.5–1x a puncture width; speculum smooth 

between punctures; mesopleural furrow softly rugose, reaching 

to middle of mesopleuron. Epicnemial carina curved to meet 

anterior margin of mesopleuron at lower quarter of pronotum. 

Metapleuron softly imbricate with punctures separated by 

0.5–1x a puncture width; lower half softly rugose. Fore wing 

with CI=0.5–0.6; ICI=0.8–0.9; SDI=1.4–1.5; 1m-cu slightly 

curved; ramulus small; marginal cell apically with a glabrous 

area next to proximal half of Rs+2r; sub-basal cell glabrous. 


slightly curved. Propodeum (Fig. 80) softly carinate texture, 

except areas basalis and externa punctate imbricate with shallow 

punctures; anterior transverse carina present, faint laterally; 

posterior transverse carina present between pleural carinae; 

lateral longitudinal carinae present before anterior transverse 

carina, faint between transverse carinae, well develop behind 

posterior transverse carina; lateromedian longitudinal carinae 

present between transverse carina, behind posterior transverse 

carina confluent; pleural carina present. 





Color.- Testaceous except following: face laterally, frons laterally, 

between ocelli, vertex, gena, collar, a spot in upper margin 

of pronotum and lower half, tegula, subalar prominence, lateral 

margins of mesoscutum, a longitudinal stripe from notaulus to 

the posterior end of mesoscutum, mesoscutellum, anterior half 

of speculum, spot between subalar prominence and mesopleural 

furrow, a spot in posterior lower mesopleuron, metapleuron apical 

half, propodeum apical half and lateral and posterior margins 

of tergites III to VII yellowish. Wings grayish hyaline; veins 

brownish and pterostigma cream colored, centrally brownish. 


Comments.- There are variations in the texture of the face 

and clypeus whereby they are smooth instead of imbricate between 

the punctures. There is also variation in the propodeum 

with a few specimens having the lateromedian longitudinal 

carinae behind the posterior transverse carina close together 

forming a thin area petiolaris and with a smoother texture. 

This species is distributed in the Chilean regions of Atacama, 

Araucanía, and Coquimbo. 

Etymology.- The species epithet "mapudungun" refers to a 

language spoken in south-central Chile and west central Argentina 

by the Mapuche people. It is treated as a noun in apposition. 

Holotype: ♀ “Q. [Quebrada] Algodones Pr. [Provincia] 

Atacama CHILE Oct. 18, 1957 [18.x.1957] L.E. Pena [Peña]” 

(AEIC). 

Paratypes: 4♂♂, 7♀♀: labeled as follows: 1♀ “40 km. S. 

Copiapo CHILE Prov. [Provincia] Atacama Oct. 15, 1957 

[15.x.1957] L.E. Pena [Peña]”; 1♂ “El Pangue, Coquimbo, 

Chile Oct. 27, 1961 [27.x.1961] Luis Peña”; 3♂♂, ♀ “[Valparaíso, 

Petorca] Los Molles XI.20.65 [20.xi.1965] Chile Luis 

Peña”; 3♀♀ “[Araucanía] Q. [Quebrada] Boquerón Atacama 

Pr. [Provincia] X.18.57 Chile LPenaGuzman [Peña Guzmán]”; 

♀ “Q. [Quebrada] de CHANARAL [Chañaral] Pr. [Provincia] 

Atacama CHILE Oct.1957 [x.1957] 300m. L.E. Pena [Peña]”; 

and 1♀ “Río Los Chores [Los Choros], Coquimbo, Chile X.29- 

30 1961 [29-30.x.1961] Luis Peña” (AEIC). 

11. Alophophion maytacapaci new species 

(Figs. 24, 43, 59, 81) 


of the features: notaulus extending 0.6x length of 

mesoscutum and mesoscutellum with basal half brownish and 

apical half yellowish. 


median portion weakly convex; centrally smooth and laterally 

imbricate texture with punctures separated by 0.5–1x a puncture 

width. Clypeus convex; upper half smooth with punctures separated 

by 1–3x a puncture width and lower half imbricate with 

punctures separated by 0.5–1x a puncture width; apical edge 

slightly straight, laterally slightly convex. Compound eyes 0.8x 

as wide as face. Malar space 0.1x as long as basal width of mandible. 

Gena, in lateral view (Fig. 43), 0.4x as wide as compound 

eyes; imbricate with soft punctures separated by 6–8x a puncture 




separated from compound eye by 0.1–0.2x ocellar diameter; 

distance between ocelli 0.4–0.5x ocellar diameter. Antenna with 


flagellomeres: 4.8–5.1:2.8–2.9:2.5–2.6:2.4–2.5: 2.3–2.4: 2.3: 

2.2–2.3. Ratio of length/width of pre-apical flagellomeres: 1.9x. 


separated by 1x a puncture width; lower half rugulose; lower 

half of collar striate. Mesoscutum smooth punctures separated 

by 0.5–1x a puncture width. Notaulus extending 0.6x length of 

mesoscutum, basal half scrobiculate. Mesoscutellum evenly convex, 

smooth with punctures separated by 2–3x a puncture width; 

lateral carina reaching 0.1x to posterior margin of mesoscutellum. 

Mesopleuron (Fig. 59) smooth with punctures separated by 0.5x 

a puncture width; mesopleural furrow upper epicnemial carina finely 

scrobiculate, after that faintly scrobiculate reaching to middle 

of mesopleuron. Epicnemial carina weak anteriorly, curved to meet 


Metapleuron coarsely punctate, imbricate with punctures separated 

by 2–3x a puncture width; juxtacoxal carina absent. Fore wing 

with CI=0.5–0.6; ICI=0.7–0.8; SDI=1.5; 1m-cu slightly curved; 

ramulus present; marginal cell basally with a glabrous area next to 

pterostigma and proximal half of Rs+2r; sub-basal cell glabrous 

with one or two setae apically. Hind wing with 6 hamuli on R1 

distally; NI=0.8; cu-a slightly curved. Propodeum (Fig.81) with 

softly carinate texture, except areas basalis and externa punctate 

imbricate with punctures separated by 3–4x as a puncture width; 

anterior transverse carina present, faint laterally; posterior transverse 

carina faint or absent between lateromedian longitudinal 

carinae; lateral longitudinal carinae faint; lateromedian longitudinal 

carinae present between transverse carina, behind posterior 

transverse carina close to each other with traces of additional ones 

between them; pleural carina present. 




laterally, between ocelli, vertex, gena, upper half of collar, basal 

half of tegula, subalar prominence, anterior half of speculum, 

apical half of mesoscutellum yellowish; between subalar prominence 

and speculum blackish brown. Wings grayish hyaline; 

veins brownish and pterostigma cream colored, centrally 

brownish. 

♂: Unknown. 

Comments.- Alophophion sinchirocai new species and A. 

maytacapaci new species overlap in distribution in Lima. 

Etymology.- The species epithet "maytacapaci" refers to 

Mayta Cápac the fourth ruler of the Tawantinsuyu. 

Holotype: ♀ “PERU: AY [Ayacucho], Laramate 

14°50'44.1"S/ 74°44'13.4"W. 2100m. 14.ii.2009. Light Trap. 

L Figueroa” (MUSM) 

Paratypes: 4♀♀ labeled as follows: 2♀♀ “PERU: AY 

[Ayacucho], Laramate 14°50'44.1"S/74°44'13.4"W. 2100m. 

14.ii.2009. Light Trap. L Figueroa” (1♀ SEMC, 1♀ MUSM); 

1♀ “LIMA 20-V-68 N. ESPINOLA COL” (MUSM); and 1♀ 

“PERU: Dpto. [Departamento] Lima: Capillucas (R. [Rio] 

Cañete) 19:III:87 Pedro Hocking” (MUSM). 

19

Alvarado 

20 

12. Alophophion ona new species 

(Figs. 17, 46, 67, 90) 


of the features: lateral longitudinal carinae present between 

transverse carinae, area dentipara well defined and distance 

between ocelli 0.9–1.0x ocellar diameter. 


long; median portion weakly convex; centrally smooth with 

punctures separated by 2–3x a puncture width and laterally 


Clypeus convex; with upper half smooth with sparse punctures 

separated by 2–4x a puncture width and lower half imbricate 

with punctures separated by 2–4x a puncture width; apical edge 

slightly convex. Compound eyes 0.8–0.9x as wide as face. Malar 

space 0.2x as long as basal width of mandible. Gena, in lateral 

view (Fig. 46), 0.4x as wide as compound eyes, softly imbricate 

with shallows punctures separated by 4–5x a puncture width. 



from compound eye by 0.1–0.2x ocellar diameter; distance 

between ocelli 0.9–1.0x ocellar diameter. Antenna with 56 


5.1–5.2:2.5–2.6:2.3:2.2–2.3:2.1–2.2:2.0–2.2:1.9–2.1. 

Ratio of length/width of pre-apical flagellomeres: 1.6x. 

Mesosoma.- Pronotum on upper half smooth with shallow 

punctures separated by 2–3x a puncture width; lower half striate; 

collar striate. Mesoscutum smooth with shallow punctures 


length of mesoscutum. Mesoscutellum evenly convex, with 

texture as that of mesoscutum; lateral carina reaching 0.4x to 

posterior margin of mesoscutellum. Mesopleuron (Fig. 67) 


speculum punctate, smooth with punctures separated by 0.5– 

1x a puncture width; mesopleural furrow absent. Epicnemial 


quarter of pronotum. Metapleuron imbricate on anterior half 

with punctures separated by 0.5–1x a puncture width and on 

posterior half with punctures separated by 1–2x a puncture 

width. Fore wing with CI=0.3–0.5; ICI=0.8; SDI=1.4–1.5; 

1m-cu straight; ramulus present; Rs+M slightly curved; marginal 

cell apically with a glabrous area next to Rs+2r vein; 

sub-basal cell glabrous, with isolate hairs apically. Hind wing 

with 6 hamuli on R1 distally; NI=1.0–1.1; cu-a slightly curved. 

Propodeum (Fig. 90) softly rugulose with shallow punctures, 

except anterior area imbricate with punctures separated by 

1–2x a puncture width; anterior transverse carina present 

between lateral longitudinal carinae; posterior transverse 

carina present between pleural carinae; lateral longitudinal 

carinae, present before anterior transverse carina; lateromedian 

longitudinal carinae present between transverse carinae; 

lateromedian longitudinal carinae converge behind posterior 

transverse carina; pleural carina present. 



Color.- Rufo-testaceous except following: face laterally, frons 

laterally, between ocelli, vertex, gena, tegula, subalar prominence, 

anteriorly speculum and a spot between subalar prominence 

and mesopleural furrow yellowish. Wings grayish hyaline; veins 

brownish and pterostigma fulvous. 

♂: Unknown. 

Comments.- The propodeal carinae are well developed but 

not as much as trauco new species. Alophophion ona new species 

is distributed in the Chilean region of Biobio. 

Etymology.- The species epithet "ona" refers to the Ona 

people an indigenous people that inhabited in the Patagonian region 

of southern Argentina and Chile, including the Tierra del 

Fuego islands. It is treated as a noun in apposition. 

Holotype: ♀ “Las Trancas, Chile XII.1-15.75 [01-15. 

xii.1975] Chillán Luis Peña” (AEIC); 

Paratypes: 2♀♀: labeled as follows: CHILE: 1♀ “Las Trancas, 

Chile XII.1-15.75 [01-15.xii.1975] Chillán Luis Peña” (AEIC); 

and ARGENTINA: ♀ “CHILE [Argentina]: R.N. [Río Negro], El 

Bolson. 10.ii.1960. A. Kavocs. B.M.1964-193” (BMNH). 

13. Alophophion pedroi new species 

(Fig. 29, 47, 75, 92) 


of the features: mesopleuron imbricate with shallow 

punctures and the mesopleural furrow softly rugulose, and the 

areas dentipara and superomedia with carinate texture. 



width; median portion weakly convex. Clypeus convex imbricate 

with punctures separated by 1–2x a puncture width; 

apical edge slightly convex laterally. Compound eyes 0.9x as 

wide as face. Malar space less than 0.1x as long as basal width 


as compound eyes, imbricate with shallow, punctures separated 

by less than a puncture width. Frons imbricate, slightly striate 

between central ocelli and toruli. Vertex with texture as gena. 

Lateral ocellus separated from compound eye by less than 0.1x 

ocellar diameter; distance between ocelli 0.4x ocellar diameter. 



2.4:2.5–2.3:24–2.2:2.4–2.1. Ratio of length/width of pre-apical 


Mesosoma.- Pronotum and mesoscutum imbricate with 

shallow punctures separated by 1–2x a puncture width. Notaulus 

extending 0.6x length of mesoscutum, with same texture 

as mesoscutum. Mesoscutellum evenly convex, with texture as 

that of mesoscutum; lateral carina extending 0.3x length of 

mesoscutellum. Mesopleuron (Fig. 75) imbricate with shallow 

punctures separated by 1–2x a puncture width; lower edge of 

speculum imbricate, slightly shine; mesopleural furrow softly 

rugulose, extending 0.3x length of mesopleuron. Epicnemial 

carina curved to meet anterior margin of mesopleuron at 

lower third of pronotum. Metapleuron imbricate with shallow 

punctures separated by 1–2x a puncture width. Fore wing with 

CI=0.6; ICI=0.9–1.0; SDI=1.3; 1m-cu slightly curved; ramulus 

present; Rs+M slightly curved; marginal cell of fore wing cover 

by setae; sub-basal cell glabrous. Hind wing with 8 hamuli on 

R1 distally; NI=0.6–0.8; cu-a slightly curved. Propodeum (Fig. 

92) with area basalis imbricate with shallow punctures separated 



by 2x a puncture width, rest of propodeum finely imbricate with 

punctures separated by less than 1x a puncture width; anterior 

transverse carina strongly elevated and complete, slightly weaker 

laterally; posterior transverse carina strongly elevated, absent 

centrally; lateral longitudinal carinae absent; lateromedian 

longitudinal carinae present after anterior transverse carina, 

confluent behind posterior transverse carina; areas superomedia 

with triangular shape, centrally divided by a carina; posterior 

transverse carinae strongly elevated, centrally absent. 


II with spiracle located at 0.5–0.6x length of tergite. 

Color.- Light straw yellow except following: antennae, mandibles, 

palpi, legs (except fore coxa, mid coxa posteriorly) and metasoma 

after tergite II testaceous; and ovipositor sheath brownish. 

♂: Unknown. 

Comments.- This species was collected between 1400 and 

1700 m, in a secondary cloud forest pers. obs.). Structurally 

is quite similar to A. alvarengai new species; both species have 

similar arrangement of carinae and texture of the body. They 

can be differentiate by the proportion of the face, wider in A. 

pedroi new species (0.9x as wide as long) than in A. alvarengai 

new species (0.8x as wide as long). 

Etymology.- Named in honor of the naturalist Pedro Hocking. 

Holotype: ♀, “PERU: CU [Cuzco], La Convención, Echarate, 

C. [Comunity] Otsanampiato, 73º8’57.71”W/12º39’31.36”S 

1449m. 20-22.i.2010. Light. C. Carranza y C. Rossi” (MUSM) 

Paratype: ♀, “PERU: CU [Cuzco], La Convención, 

Echarate, CC. [Comunity] Otsanampiato, 12º39’43.50”[S] 

73º09’40.93”[W] 1687m. 16.ix.2010. Light. M. Alvarado y 

J. Peralta” (MUSM) 

14. Alophophion picunche new species 

(Figs. 13, 32, 53, 63, 86) 


of features: epicnemial carina oval, lateromedian longitudinal 

carinae converging behind posterior transverse carina, 

and tergites fulvous. 


long; imbricate with shallow punctures separated by 1–2x a 

puncture width; median portion weakly convex. Clypeus convex; 


width; apical edge straight centrally, laterally slightly convex. 

Compound eyes 0.8–0.9x as wide as face. Malar space 0.1x as 

long as basal width of mandible. Mandibles smooth texture 

between punctures. Gena, in lateral view (Fig. 32), 0.4x as wide 

as compound eyes, smooth with shallow punctures separated by 

4–6x a puncture width. Frons imbricate, softly striate between 

antennae and median ocellus. Vertex with texture as gena. 

Lateral ocellus separated from compound eye by 0.2x ocellar 



first to seventh flagellomeres: 4.2:2.4–2.5:2.2–2.3:2.1–2.2: 

2.0–2.1:1.9–2.0:1.9. Ratio of length/width of pre-apical flagellomeres: 

1.6–1.8x. 

Mesosoma.- Pronotum imbricate with shallow punctures 

separated by 2–4x a puncture width, getting smooth to 

anteriorly; collar striate. Mesoscutum smooth with shallow 

punctures separated by 6–8x a puncture width. Notaulus 

extending 0.3x length of mesoscutum. Mesoscutellum evenly 

convex, smooth with shallow punctures separated by 3–4x 

a puncture width; lateral carina reaching 0.1x to posterior 

margin of mesoscutellum. Mesopleuron (Fig. 63) upper half 

smooth and lower half imbricate imbricate with shallow 

punctures separated by 2–4x a puncture width; mesopleural 

furrow absent. Epicnemial carina oval in a lateral view, 

curved to meet anterior margin of mesopleuron at lower 

quarter of pronotum; faint next to pronotum. Metapleuron 

smooth between punctures. Fore wing (Fig. 53) with CI=0.5; 

ICI=0.6–0.7; SDI=1.4; 1m-cu slight curved; ramulus present; 

Rs+M slightly curved; marginal cell with a glabrous area next 

to Rs+2r; sub-basal cell glabrous. Hind wing with 7–8 hamuli 

on R1 distally; NI=1.0–1.1; cu-a slightly curved. Propodeum 

(Fig. 86) with area basalis imbricate with shallow punctures 

separated by 3x a puncture width, areas spiracularis, lateralis, 

dentipara, superomedia, posteroexterna and petiolaris 

imbricate with softly carinate texture, punctate; anterior 


carina present between pleural carinae; lateral longitudinal 

carinae present, faint between transverse carinae; lateromedian 

longitudinal carinae present, behind posterior transverse 

carina converging; anterior area imbricate between punctures; 





vertex, gena, pronotum, lateral margins of mesoscutum, spot 

from notaulus to posterior end of mesoscutum, mesoscutellum, 

tegula, subalar prominence, speculum, a diagonal stripe in 

mesopleuron, metapleuron apical half, propodeum apical half 

and tergites laterally yellowish. Wings grayish hyaline; veins 

brownish and pterostigma testaceous. 


Comments.- A few females have metapleuron and propodeum 

imbricate between punctures. Some specimens have, behind 

posterior transverse, the lateromedian longitudinal carinae 

present and with only one carina each one; while other specimens 

an additional carina next to lateromedian and lateral longitudinal 

carinae. This species was only collected in Coquimbo. 

Etymology.- The species epithet "picunche" refers to the 

Picunche, a mapudungun speaking Chilean people who lived 

to the north of the Mapuches or Araucanians and south of 

the Choapa River and the Diaguitas. It is treated as a noun in 

apposition. 

Holotype: ♀ “[Coquimbo, Valle de Elqui] Las Hedionditas 

[Termas Las Hediondas] I.10-11.66 [10-11.i.1965] Chile Luis 

Peña” (AEIC). 

Paratypes: 19♂♂, 15♀♀: labeled as follows: 19♂♂, 14♀♀ 

“[Coquimbo, Valle de Elqui] Las Hedionditas [Termas Las 

Hediondas] I.10-11.66 [10-11.i.1965] Chile Luis Peña”; 1♀ 

“Río Los Chores [Los Choros], Coquimbo, Chile X.29-30 1961 

[29-30.x.1961] Luis Peña” (AEIC). 


21

Alvarado 

22 

15. Alophophion pihuchen new species 

(Figs. 20, 49, 61, 84) 


epicnemial carina oval, and the metasomal tergite I–IV light 

straw yellow with an apical brownish spot. 


median portion weakly convex; smooth with punctures separated 

by 2–3x as a puncture width. Clypeus convex; with upper half 

punctate smooth with punctures separated by 5–6x as a puncture 

width, and lower half imbricate with shallow punctures separated 

by 4x as a puncture width; apical edge straight centrally, laterally 

slightly convex. Compound eyes 0.7–0.8x as wide as face. Malar 


view (Fig. 49), 0.4x as wide as compound eyes, smooth with 

shallow punctures separated by 4x as a puncture width. Frons 

smooth, slightly striate between antennae and median ocellus. 

Vertex with texture as gena. Lateral ocellus separated from compound 

eye by 0.2–0.3x ocellar diameter; distance between ocelli 

1.0x ocellar diameter. Antenna with 50 flagellomeres. Ratio of 



width of pre-apical flagellomeres: 1.2x. 

Mesosoma.- Pronotum with punctures separated by 1–2x 

a puncture width on upper half smooth and lower half of propodeum; 

collar imbricate-striate. Mesoscutum smooth with 

punctures separated by 3–4x as a puncture width. Notaulus 

extending 0.3x length of mesoscutum, smooth. Mesoscutellum 

evenly convex, with texture as that of mesoscutum; lateral carina 

reaching 0.1x to posterior margin of mesoscutellum. Mesopleuron 

(Fig. 61) smooth with punctures separated by 2–4x as a puncture 

width; mesopleural furrow absent. Epicnemial carina oval in a 

lateral view; curved to meet anterior margin of mesopleuron at 

lower third of pronotum. Metapleuron smooth with punctures separated 

by 2–3x as a puncture width. Fore wing with CI=0.4–0.5; 

ICI=0.7; SDI=1.5; 1m-cu straight; ramulus present; Rs+M slightly 

curved; marginal cell basally and next to Rs+2r glabrous; sub-basal 

cell glabrous with some isolate setae apically. Hind wing with 6–7 

hamuli on R1 distally; NI=0.9; cu-a slightly curved. Propodeum 

(Fig. 84) with carinate texture on areas superomedia and lateralis, 

areas basalis and externa smooth with punctures separated by 1–2x 

as a puncture width, and softly carinate-rugulose texture on areas 

dentipara, superomedia, posteroexterna and petiolaris; anterior 

transverse carina present, faint laterally; posterior transverse carina 

weak reaching to pleural carinae; longitudinal carinae present, 

faint; pleural carina present. 



Color.- Light straw yellow except following: except following: 

palpi, antenomeres, a posterior spot in fore coxae, an anterior 

spot in mid and hind coxae, basal 2/3 of trochanter, tibias, tarsomeres, 

axilla, mesopleuron with a longitudinal stripe between 

notaulus and lateral mesoscutum and one between notauli, a 

spot in posterior lower mesopleuron, metapleuron basal half, 

basal half of propodeum and hind coxae dorsally fulvous; and 

tergites I–IV with an apical central spot, tergites IV–VI basally 

and ovipositor sheath brownish. 

♂: Unknown. 

Comments.- One female has the lateromedian longitudinal 

carinae, behind posterior transverse, wavy; while the other 

specimen have these carinae straight. 

This species is distributed in the Chilean region of Metropolitana 

de Santiago. 

Etymology.- The species epithet "pihuchen" refers to the 

creature from the Mapuche and Chilote mythology, a much 

feared shapeshifting creature which could instantly change into 

animal form. It is treated as a noun in apposition. 

Holotype: ♀ “[Metropolitana de Santiago, Cordillera] Las 

Gunilias [Lagunillas] II.19.66 [19.ii.1966] Chile LPenaGuzman 

[L. Peña Guzmán]” (AEIC). 

Paratypes: 2♂♂, 1♀: labeled as follows 1♂, 1♀ “[Metropolitana 

de Santiago, Cordillera] Las Gunilias [Lagunillas] II.19.66 

[19.ii.1966] Chile LPenaGuzman [L. Peña Guzmán]” y 1♂ 

“[Maule Region] Rio Teno Curico, Chile III.8.62 [08.iii.1962] 

Luis Peña” (AEIC). 

16. Alophophion sinchirocai new species 

(Figs. 26, 39, 71, 77) 


of the features: metapleuron reddish brown, mesoscutellum 

cream colored, and, has the juxtacoxal carina developed. 


as long; median portion weakly convex; softly imbricate with 

punctures separated by 0.5–1x a puncture width. Clypeus 

convex; softly imbricate with punctures separated by 1–2x a 

puncture width; apical edge slightly convex. Compound eyes 

0.8x as wide as face. Malar space 0.2x as long as basal width 

of mandible. Gena, in lateral view (Fig. 39), 0.4x as wide as 

compound eyes, imbricate with punctures separated by 3–4x 

a puncture width. Frons imbricate, slightly striate between antennae 

and median ocellus. Vertex with texture as gena. Lateral 

ocellus separated from compound eye by 0.1x ocellar diameter; 


56 flagellomeres. Ratio of length/width from first to seventh flagellomeres: 

5.0–5.8:2.9–3.2:2.7–2.8:2.5–2.7: 2.4–2.6: 2.4–2.5: 

2.3–2.4. Ratio of length/width of pre-apical flagellomeres: 1.7x. 

Mesosoma.- Pronotum imbricate with punctures separated 

by 0.5–1x a puncture width; collar striate. Mesoscutum 

smooth with punctures separated by 1–1.5x a puncture width. 

Notaulus extending 0.3x length of mesoscutum. Mesoscutellum 

evenly convex, smooth with punctures separated by 02–3x a 


of mesoscutellum. Mesopleuron (Fig. 11) imbricate with 

punctures separated by 1x a puncture width; speculum smooth 

with punctures separated by 2x a puncture width; mesopleural 

furrow faintly scrobiculate reaching to posterior end. Epicnemial 


quarter of pronotum. Metapleuron imbricate with punctures 

separated by 0.5–1x a puncture width; juxtacoxal carina present. 

Fore wing with CI=0.6–0.7; ICI=0.7; SDI=1.4; 1m-cu straight; 

ramulus present as an angulation or absent; Rs+M slightly 

curved; marginal cell with a glabrous area next to Rs+2r; subbasal 

cell glabrous. Hind wing with 6–7 hamuli on R1 distally; 

NI=0.9–1.0; cu-a slightly curved. Propodeum (Fig. 77) imbrica- 



te with punctures separated by 2–3x a puncture width and softly 

rugose, except area basalis imbricate with punctures; anterior 


carina broke in the middle; lateral longitudinal carinae present, 

faint; lateromedian longitudinal carinae present, faint behind 

posterior transverse carina and with an additional longitudinal 

carina between them; pleural carina present. 




laterally, between ocelli, vertex, gena, collar, basal half of tegula, 

subalar prominence, postscutellum and mesoscutellum yellowish. 

Wings grayish hyaline; veins brownish and pterostigma fulvous. 

♂: Unknown. 

Comments.- Alophophion sinchirocai new species and A. maytacapaci 

new species occur in central Peru, on the eastern slopes 

of the Andes. They have a similar appearance, but can be differentiated 

by the color of speculum which is fulvous reddish in 

A. sinchirocai new species and is fulvous reddish with a yellowish 

spot in A. maytacapaci new species. Alophophion sinchirocai new 

species has the area superomedia imbricate between punctures 

while in A. maytacapaci new species this area this is carinate. 

Etymology.- The species epithet "sinchiroca" refers to Sinchi 

Roca the second ruler of the Tawantinsuyu. 

Holotype: ♀ “PERU: Dpto. [Departamento] Lima: Tornamesa 

(R. [Rio] Rimac) 25:II:12 [25.ii.2012] (1600 mt.) Pedro 

Hocking [Handwritten]” (MUSM) 

Paratype: ♀ “Huamachuco, PERU: 3200m. 23.II [23.ii.?] 

Coll. Weyrauch / MHN 3276 [Handwritten]” (MUSM) 

17. Alophophion sofiae new species 

(Figs. 21, 40, 72, 78) 


of the features: body mainly fulvous to light straw yellow 

colored, compound eyes 1.1x as wide as face and metapleuron 

softly rugulose. 




Clypeus convex; upper half smooth with punctures separated by 

4–5x a puncture width and lower half imbricate with punctures 

separated by 2–3x a puncture width, slightly striate; apical edge 

slightly convex. Compound eyes 1.1x as wide as face. Malar 


view (Fig. 40), 0.3x as wide as compound eyes, imbricate with 

punctures separated by 2–3x a puncture width. Frons imbricate, 

slightly striate between antennae and median ocellus. Vertex 

with texture as gena. Lateral ocellus separated from compound 

eye by 0.1x ocellar diameter; distance between ocelli 0.8x ocellar 

diameter. Antenna with 56 flagellomeres. Ratio of length/ 

width from first to seventh flagellomeres: 4.4–4.6:2.5–2.8:2.2– 

2.3:2.0–2.2:1.9–2.1:1.8–2.1:1.8–2.0. Ratio of length/width of 

pre-apical flagellomeres: 1.4x. 


separated by 1–2x a puncture width and lower half striate; lower 


half of collar striate. Mesoscutum smooth with punctures separated 

by 2x a puncture width. Notaulus extending 0.3x length of 

mesoscutum, basally scrobiculate. Mesoscutellum evenly convex, 



Mesopleuron (Fig. 72) imbricate (except between subalar prominence 

and epicnemial carina smooth) with punctures separated 

by 0.5–1.5x a puncture width; speculum smooth with punctures 

separated by 2–3x a puncture width; mesopleural furrow softly 

rugulose reaching to the posterior end. Epicnemial carina curved 

to meet anterior margin of mesopleuron at lower quarter of pronotum. 

Metapleuron softly rugulose. Fore wing with CI=0.7–0.8; 


marginal cell apically with a glabrous area next to pterostigma and 

Rs+2r; sub-basal cell glabrous with isolated setae in the apical half. 

Hind wing with 7–8 hamuli on R1 distally; NI=1.0; cu-a slightly 

curved. Propodeum (Fig. 78) with softly carinate texture, except: 

areas basalis and externa punctate, imbricate with punctures 

separated by 2–3x a puncture width; anterior transverse carina 

present, faint laterally; posterior transverse carina weak centrally 

and absent between lateromedian longitudinal carinae; lateral 


faint between transverse carinae, well develop behind posterior 

transverse carina; lateromedian longitudinal carinae present after 

anterior transverse carina; areas superomedia and petiolaris more 

less confluent, posterior transverse carinae rarely faintly indicated; 

behind posterior transverse carina with traces of an additional 

one between them; pleural carina present. 



Color.- Fulvous to light straw yellow except following: face, 

frons laterally, between ocelli, vertex and gena. Wings grayish 


♂: Unknown. 

Comments.- This species overlaps in distribution with A. 

ofeliae new species and both even seem to have the same seasonality, 

although sample sizes are quite small so this may reflect 

collecting bias. Both even seem have the same general appearance 

but they are easily differentiable by having the face longer than 

wide in A. sofiae new species and face 1.1x as wide as long in A. 

ofeliae new species. 

Etymology. Named in honor of Sofia Carranza. 

Holotype: ♀ “PERU: MO [Moquegua], General Sánchez 

Cerro, La Capilla, 71 o 20’56”W/ 16 o 45’37”S, 2739 m. 

16.iv.2011. C. Carranza” (MUSM). 

Paratypes: 3 ♀♀: labeled as follows: PERU: 2♀♀, same data 

as holotype (MUSM) and 1♀ “Arequipa [,] Peru Dr Esemel 

[handwritten] / Press. By Imp. Bur. Ent. Brit. Mus. 1921–472/ 

179 u [handwritten] / Ophion sp n [handwritten]” (BMNH). 

18. Alophophion trauco new species 

(Figs. 9, 27, 36, 56, 69, 91) 

Diagnosis. Alophophion trauco new species has propodeum 

with carinae lamellate as A. chiquiyane new species; but can be 

distinguished of them by having metapleuron and mesopleural 

furrow scrobiculate-rugulose. 

23

Alvarado 


as long; centrally smooth and softly imbricate laterally with 

shallow punctures separated by 1–2x a puncture width; median 

portion weakly convex. Clypeus convex; smooth basally and 

imbricate apically with shallow punctures separated by 3–4x a 

puncture width; apical edge slightly straight, laterally slightly 

convex. Compound eyes 0.7–0.9x as wide as face. Malar space 

0.1–0.2x (Fig. 9) as long as basal width of mandible. Gena, in 

lateral view (Fig. 36), 0.4–0.6x as wide as compound eyes, softly 







flagellomeres: 3.6–4.3:2.1–2.3:1.9–2.0:1.9:1.9:1.8:1.7. Ratio of 


Mesosoma.- Pronotum imbricate with shallow punctures 

separated by 0.5–1.5x a puncture width; collar striate. Mesoscutum 

smooth centrally and imbricate laterally with shallow 

punctures separated by 1x a puncture width. Notaulus extending 

0.2–0.3x length of mesoscutum, basally with a carina along 

notaulus. Mesoscutellum evenly convex, smooth with punctures 

separated by 2x a puncture width; lateral carina reaching 


69) smooth on upper half and imbricate on lower half with 

soft punctures separated by 3x a puncture width; speculum 

smooth with soft punctures separated by 2–3x a puncture width; 

mesopleural furrow scrobiculate- rugulose, reaching only 

next to epicnemial carina or reaching to the posterior end of 

mesopleuron. Upper part of epicnemial carina, at mesopleuron, 

indistinguishable from mesopleural furrow; epicnemial carina 

curved to meet anterior margin of mesopleuron at lower third 

of pronotum. Metapleuron scrobiculate- rugulose to softly 

scrobiculate. Fore wing (Fig. 56) with CI=0.3–0.6; ICI=0.7–0.9; 

SDI=1.2–1.5; 1m-cu straight; ramulus present; Rs+M slightly 

curved; marginal cell with a glabrous area next to 0.3 proximal 

of Rs+2r vein; sub-basal cell glabrous with isolate setae apically. 


slightly curved. Propodeum (Fig. 91) smooth with shallow 

punctures, except: areas spiracularis and lateralis with softly 

carinate-rugulose texture; with carinae lamellate; anterior transverse 

carina present, faint laterally; posterior transverse carina 

present between pleural carinae; lateromedian longitudinal 

carinae present before anterior transverse carina and between 

transverse carinae, behind posterior transverse carina confluent 

or close together, so area petiolaris thin; pleural carina present. 

Metasoma. First tergite 4.2–4.7x as long as apical width. 

Tergite II with spiracle located at 0.5–0.6x length of tergite. 

Color. Rufo-testaceous except following: face laterally, frons 

laterally, between ocelli, vertex and gena yellowish. Wings grayish 


♂: Similar to female but all males have a single lateromedian 

longitudinal carina behind the posterior transverse carina without 

traces next to it. 

Comments. There is some variation in the lateromedian 

longitudinal carinae behind the posterior transverse carina, in 

some specimens the carinae are close together forming a thin 

area petiolaris (Fig. 82) or confluent with or without traces of 

lateromedian longitudinal carinae next to it (Fig. 81); while one 

specimen has these carinae wavy. Specimens with metapleuron 

softly rugulose have smooth texture with punctures. The specimen 

from Paso de Pino Hachado is distinctly smaller than the 

remainder of the series and with a forewing CI=0.4, hind wing 

NI=0.7, and spiracle of tergite II near the middle, otherwise 

it agrees with the species. This size difference likely represents 

development in a slightly smaller or malnourished host. 

This species was collected at an elevation of 1080 m and 

1600 m in the Chilean regions Araucania, Biobío and Maule. 

Its distribution overlaps with A. chiquiyane new species. 

Etymology.- The species epithet "trauco" refers to the name 

of a mythical entity that inhabits the woods of Chiloé, an island 

in the south of Chile. It is treated as a noun in apposition. 


Blanco Chile Luis E. Peña” (AEIC) 

Paratypes: 15♂♂, 7♀♀ labeled as follows: CHILE: 7♂♂, 

8♀♀ “Curacautín, Malleco II.'64 [ii.1964] R. [Río] Blanco Chile 

Luis E. Peña”; 1♀ “Fundo El Coigo Cord [Cordillera] Curico 

Chile XII.20-31.59 [20-31.xii.1959] Luis Pena [Peña]”; 1♂ “Las 

Trancas Chillán, Chile I.19-22.79 [19-22.i.1979] 1600m. L. 

Peña”; 1♂ “Las Trancas Chillán, Chile April 1972 [iv.1979] Luis 

Peña”;1♂ “Las Trancas, Chile II.6-11.66 [06-11.ii.1966] Chillán 

Luis Peña”; 1♂ “Las Trancas, Chile XII.1-15.75 [01-15.xii.1975] 

Chillán Luis Peña”; 1♂ “Las Trancas, Ñuble, Chile, December 

1976 [xii.1976] Luis Peña”; 1♂ “Las Nieves XI.15.47 [12.xi.1947] 

Chile L. Pena Guzman”; 1♀ “El Pangue, Coquimbo, Chile XI.3- 

5 1961 [03-05.xi.1961] Luis Peña”; 2♂♂ “[Libertador General 

Bernardo O'Higgins, Cachapoal] Las Nieves XI.12.47 Chile L. 

Pena Guzman [Peña Guzmán]”; 1♂ “[Libertador General Bernardo 

O'Higgins, Cachapoal] Las Nieves XI.16.47 [16.xi.1947] 

Chile L. Pena Guzman [Peña Guzmán]” and 1♀ “Pino Hachado 

[Paso de Pino Hachado] Lonquimay, Mal. [Malleco] II.18.80 [18. 

ii.1980] Chile 1600m. L. Peña” (AEIC); and 4♂♂, 1♀ “CHILE: 

VIII Región [Biobío] Los Lleuques 14km w. Termas de Chillán 

1080m 36°54'S [/] 71°32'W 23-24.XI.1994 SLHeydon [S.L. 

Heydon] & EArias [E. Arias]” (UCDC). 

19. Alophophion viride new species 

(Figs. 30, 48, 74, 93) 

Diagnosis.- Alophophion viride resembles A. teushen new species 

in the general appearance and olive green coloration but A. 

viride can be distinguish by the rugulose texture of propodeum 

and lateromedian longitudinal carinae absent between transverse 

carinae which are well defined in A. teushen; additionally A. 

teushen has a predominantly smooth texture on the propodeum. 


long; smooth with punctures separated by 0.5–1x a puncture width; 

median portion weakly convex. Clypeus convex; upper half 

smooth and lower softly imbricate with isolated punctures; apical 

edge softly convex. Compound eyes 0.8x as wide as face. Malar 


view (Fig. 48), 0.5–0.6x as wide as compound eyes; smooth with 

punctures separated by 5–7x a puncture width. Frons smooth, 

softly striate between antennae and median ocellus. Lateral oce- 

24 



llus separated from compound eye by 0.2–0.3x ocellar diameter; 


46 flagellomeres. Ratio of length/width from first to seventh 

flagellomeres: 3.8–3.7:2.5:2.4:2.3–2.2:2.2–2.1:2.2–2.0:2.1–1.9. 


Mesosoma.- Pronotum on upper half softly imbricate with 


and collar striate. Mesoscutum smooth laterally and imbricate 

centrally with shallow punctures separated by 2–3x a puncture 

width. Notaulus extending 0.2x length of mesoscutum, finely 

scrobiculate. Mesoscutellum evenly convex; lateral carina reaching 

0.1x to posterior margin of mesoscutellum; smooth with 

punctures separated by 2–3x a puncture width. Mesopleuron 

(Fig. 74) softly imbricate with punctures separated by 1–2x a 

puncture width; lower edge of speculum finally scrobiculate; 

speculum smooth with shallow punctures separated by 4–6x 

a puncture width; mesopleural furrow rugulose, short. Epicnemial 

carina curved to meet anterior margin of mesopleuron 

at lower quarter of pronotum; forming an angulation between 

mesopleuron and mesosternum. Metapleuron imbricate with 

punctures separated by 0.5–1.0x a puncture width. Fore wing 

with CI=0.7; ICI=0.7–0.8; SDI=1.4; 1m-cu straight; ramulus 

present; Rs+M slightly curved; marginal cell cover by setae; subbasal 

cell glabrous rarely with a setae on apical quarter. Hind 

wing with 7 hamuli on R1 distally; NI=0.6–0.8x; cu-a slightly 

curved. Propodeum (Fig. 93) rugulose except imbricate with 

punctures separated by 1.0x a puncture width on anterior area; 

anterior transverse carina present between lateral longitudinal 

carinae, faint; posterior transverse carina present, faint; lateral 

longitudinal carina absent; lateromedian longitudinal carinae 

present behind posterior transverse carina, faint; pleural carina 

present. 




antennae, palpi, mandibles, two lateral and one central vittae 

on mesoscutum, scuto-scutellar groove, basal half of mesoscutellum, 

upper half of speculum, mesosternum, legs (except coxae 

dorsally) and tergites rufo-testaceous. 

♂: unknown 

Comments.- The specimens have metasoma brownish instead 

of olive green, this variation in the color was obtained probably 

because the killing method. 

Comments.- The paratype has the face thinner and lateromedian 

longitudinal carinae present but faint. Alophohion viride 

new species overlaps its distribution with A. teushen new species. 

Etymology.- The specific epithet viride, meaning “green”, in 

reference to the body coloration. 

Holotype: ♀, “CHILE [ARGENTINA]: Chubut. 18.vi.1962. 

A. Kovacs. B.M. 1964-193.” (BMNH). 

Paratypes: ♀, “Villa Regina Argentina Rio Negro X.7.61 

[07.X.1961] Luis Peña” (AEIC). 

Species-group B 

Diagnosis.- Face at most 1x as long as wide; compound eyes 

at most 0.5x wide as face; head, in lateral view, gena at least 0.7x 

as wide as compound eyes. Mandibles with a diagonal groove 


extending from upper corner to middle of mandible, bearing 

long setae. Notaulus reaching 0.3–0.8x of length of mesoscutum. 

Forewing with discosubmarginal cell cover by setae next 

to Rs+M. Color orange, brownish, some species brownish with 

cream spots. 

Included species.- Six species are included in this group, 

three of which are new: A. caleuche new species, A. capayan new 

species, A. filicornis (Morley, 1912), A. flavorufus (Brullé, 1846), 

A. politus (Morley, 1912), and A. yagane new species. 

Comments.- This species group is distributed in Argentina, 

the south of Brazil, and Chile, possibly also Uruguay and Paraguay 

but collections are lacking from that countries. 

Key to species of species-group B 

(1) Pre-apical flagellomeres wider than long; ramulus absent … 

.......................................... Alophophion filicornis (Morley, 1912) 

– Pre-apical flagellomeres longer than wide; ramulus present ….......... 2 

(2) Propodeum with posterior transverse carina when present faintly indicated; 

no trace of longitudinal carinae (Fig. 113)… 

.......................................... Alophophion flavorufus (Brullé, 1846) 

– Propodeum with transverse carinae well developed; longitudinal carinae 

delimiting dentipara area (Figs. 114–117) …...................................... 3 

(3) Lateral ocelli separated from compound eyes by 0.1x maximum ocellar 

diameter (Fig. 106); female with area petiolaris and posteroexterna confluent, 

without traces of longitudinal carinae (Fig. 115) … 

................................................. Alophophion capayan new species 

– Lateral ocelli separated from compound eyes by at least 0.2x maximum ocellar 

diameter (like Fig. 107); female with area petiolaris and posteroexterna separated 

by traces of longitudinal carinae …..................................................... 4 

(4) Mesopleural furrow reaching to posterior lower edge of mesopleuron (Fig. 

110); marginal cell homogeneously cover by setae; mesosoma entirely burnt 

orange; marginal cell of fore wing basally cover by setae … 

................................................... Alophophion yagane new species 

– Mesopleural furrow reaching at most to middle of mesopleuron (Fig. 111); 

marginal cell of fore wing basally glabrous; mesosoma fulvous or brownish with 

yellowish spots …............................................................................... 5 

(5) Hind wing length of Cu1 between M and cu-a 0.6–0.7x length of cu-a; 

metapleuron Testaceous …......... Alophophion politus (Morley, 1912) 

– Hind wing length of Cu1 between M and cu-a 0.9–1.0x length of cu-a; 

metapleuron with basal half brownish and apical half cream colored … 

................................................. Alophophion caleuche new species 

20. Alophophion caleuche new species 

(Figs. 96, 105, 117) 

Diagnosis. Within this species-group, A. caleuche new species 

is the only one with coloration brownish red with cream color 

spots, and the lateromedian longitudinal carinae after posterior 

transverse carinae well defined, not converging. 


softly imbricate with punctures separated by 0.5–1x a puncture 

width; median portion weakly convex. Clypeus imbricate with 

punctures separated by 1–2x a puncture width; upper half convex 

and lower half flat; apical edge straight centrally, slightly convex 

laterally. Outer mandibular surface smooth between punctures 

bearing long setae in the basal 2/3 and smooth between punctures 

in the apical 1/3. Compound eyes 0.5x as wide as face. Malar space 

0.2x as long as basal width of mandible. Gena, in lateral view 

(Fig. 105), 0.9x as wide as compound eyes, smooth with shallow 

punctures separated by 4–6x a puncture width. Frons carinate 

25

Alvarado 

Figures 94 – 111. 


(94) A. filicornis, holotype 


(96) A. caleuche new species 

(97) A. capayan new species 

(98) A. yagane new species 

(99) A. politus. 




(102) A. politus, holotype 

(103) A. capayan new species. 

Details of face in lateral view. 


(105) A. caleuche new species. 

Details of head in dorsal view. 


(107) A. flavorufus. 





(111) A. politus. 

26 



Figures 112 – 126. 



(113) A. flavorufus, holotype 

(114) A. politus, holotype 



(117) A. caleuche new species. 


(118) A. chilensis 

(119) A. larseni 

(120) A. porculatus 

(121) A. capacyupanquii new species 

(122) A. incarocai new species 

(123) A. yahuarhuacaci new species 

(124) A. waca new species 

(125) A. ofeliae new species 

(126) A. lloqueyupanquii new species. 

between antennae and median ocellus. Vertex smooth with shallow 

punctures separated by 3–4x a puncture width. Lateral ocellus 




flagellomeres: 5.0–5.2:2.3:2.1:2.0–1.9:2.0–1.9:1.9–1.8:1.8:1.7. 


Mesosoma.- Pronotum in upper posterior half smooth with 

punctures separated by 0.5–1x a puncture width; lower lateral 

half and collar dorsally striate-punctate. Mesoscutum smooth 

with punctures separated by 0.5–1x a puncture width. Notaulus 

extending 0.3x length of mesoscutum, scrobiculate basally. 

Mesoscutellum evenly convex, smooth with punctures separated 

by 1–2x a puncture width; lateral carina reaching 0.2x to 

posterior margin of mesoscutellum. Mesopleuron on upper half 

smooth and lower half imbricate; coarsely punctate, punctures 

separated by 0.5–1x a puncture width; lower edge of speculum 

scrobiculate; mesopleural furrow basally scrobiculate-rugose 

reaching usually to the middle of mesopleuron. Epicnemial 


27

Alvarado 


quarter of the pronotum. Metapleuron rugulose-punctate. Fore 

wing with CI=0.6; ICI=0.6–0.7; SDI=1.5–1.6; 1m-cu straight; 

ramulus present; Rs+M curved; marginal cell apically glabrous; 

sub-basal cell with isolated setae apically. Hind wing with 7 hamuli 

on R1 distally; NI=0.9–1.0; cu-a curved. Propodeum (Fig. 

117) with anterior transverse carina present and well defined, 

reaching to lateral longitudinal carina; posterior transverse carina 

present, reaching to pleural carina; longitudinal carinae present, 

except before anterior transverse carina; lateromedian longitudinal 

carinae after posterior transverse carina convergent, fused 

to form a single median longitudinal carina; rugulose texture, 

except punctate before anterior transverse carina. 



Color.- Brownish red except following: around to compound 

eyes, between ocelli, vertex, anterior half of upper half of pronotum, 

collar, lateral margins of mesoscutum, a central stripe, a 

longitudinal stripe from notaulus to 3/4 of mesoscutum, mesoscutellum, 

tegula, subalar prominence, speculum, spot between 

subalar prominence and mesopleural furrow, a spot in posterior 

lower mesopleuron, metapleuron apical half, propodeum apical 

half and tergite basal half. Wings grayish hyaline; veins brownish 

and pterostigma brownish, basally yellowish. 

♂: Similar to female except by the yellowish spots more 

expanded than in females. 

Comments.- This species is distributed in the Chilean regions 

of Atacama and Coquimbo. 

Etymology.- The species epithet "caleuche" refers to the name 

of the mythical ghost ship of the Chilote mythology. It is treated 

as a noun in apposition. 

Holotype: ♀ “Vista Alegre prov. [province] Huasco CHILE 

6.XI.1991 [06.xi.1991 leg. J.E. Barriga/Collection J.E. Barriga 

CHILE 26192 [other specimen 26193]” (MNNC). 

Paratypes: 2♂♂, 1♀: labeled as follows: ARGENTINA: 1♀, 

“Chubut Patagonia / From WFH Rosemberg/ [identification 

label: Ophion chilensis Spinola det C.W. Hooker 3.18.1909]” 

(USNM). CHILE: 1♂ “Canela Baja, Coquimbo, Chile X.23 

1961 [23.x.1961] Luis Peña” (AEIC); 1♂ “El Calabazo Had. 

[Hacienda] Illapel Coquimbo Prov. [Provincia] XI.29.59 [22. 

xii.1957] Chile L Pena Guzman [L. Peña Guzmán]”; and 1♀ 

same data as holotype (UCDC). 

28 

21. Alophophion capayan new species 

(Figs. 4, 97, 103, 106, 109, 115) 

Diagnosis.- Alophophion capayan new species is unique, within 

this species-group, in having the posterior ocelli separated 

from the compound eyes by 0.1x its maximum diameter and 

the distance between ocelli 0.6x ocellar diameter. 

Description.- ♀: Head. Face (Fig. 97) 1.2x as wide as 

long; softly imbricate with punctures separated by less than 

0.5x a puncture width; median portion weakly convex. Clypeus 

imbricate with punctures separated by less than 0.5–1x 

a puncture width; slightly convex; apical straight centrally, 

slightly convex laterally. Outer mandibular surface smooth 

bearing isolate long setae in the basal 1/2. Compound eyes 


of mandible (Fig. 4). Gena, in lateral view (Fig. 103), 0.7x 

as wide as compound eyes; smooth with shallow punctures 

separated by less than 6–8x a puncture width. Frons imbricate 

laterally; striate between antennae and median ocellus. Vertex 

with texture as that of gena. Lateral ocellus (Fig. 106) separated 


ocelli 0.6x ocellar diameter. Antenna with 53–59 flagellomeres. 


4.5–4.9:2.6:2.2:2.1–2.0:2.0:1.9:1.9. Ratio of length/width of 

pre-apical flagellomeres: 1.5–1.6x. 

Mesosoma.- Pronotum in upper posterior half imbricate 

with punctures separated between them by less than the 

puncture diameter; lower lateral half and dorsal to collar 

striate-carinate. Mesoscutum smooth with punctures separated 

between them by less than the puncture diameter. Notaulus 

extending 0.4x length of mesoscutum; scrobiculate. Mesoscutellum 

evenly convex, with texture as that of mesoscutum; lateral 

carina reaching 0.6x to posterior margin of mesoscutellum. 

Mesopleuron (Fig. 109) with speculum and subalar prominence 

smooth with punctures separated by 1–2x a puncture width, 

area between subalar prominence and mesopleural furrow rugulose, 

and lower edge of speculum scrobiculate; mesopleural 

furrow basally scrobiculate them becoming rugulose reaching 

to posterior lower mesopleuron. Epicnemial carina curved to 

meet anterior margin of mesopleuron at lower quarter of the 

pronotum. Metapleuron rugulose. Fore wing with CI=0.5–0.6; 

ICI=0.5–0.7; SDI=1.4; 1m-cu straight; ramulus present; Rs+M 

curved; marginal cell apically cover by setae; sub-basal cell 

usually without setae, at most with one or two isolate setae. 

Hind wing with 7 hamuli on R1 distally, rarely with 8 hamuli; 

NI=0.9; cu-a curved. Propodeum with anterior and posterior 

transverse carina present; longitudinal carinae present between 

transverse carinae; area petiolaris confluent with area posteroexterna 

(lateromedian longitudinal carinae faint if present), 

occupying more than half of propodeum (Fig. 115); with 

coarsely wavy carinate texture, except punctate before anterior 

transverse carinae; pleural carinae present. 



Color.- Rufo-testaceous except following: surrounding area of 

compound eyes, vertex, gena, pronotum, lateral margin of mesoscutum, 

notauli, tegula lower 1/3 and apical 1/3, axila, mesoscutellum, 

postscutellum centrally, subalar prominence, speculum, 

a diagonal stripe in mesopleuron, metapleuron, sternite I and II, 

sternite III to VI centrally yellowish and tarsomeres yellowish. 

♂: Similar to female except following: softer texture in 

propodeum, behind posterior transverse carinae with several 

longitudinal carinae and mesopleuron between mesopleural furrow 

and subalar prominence (under scrobiculate area) punctate, 

smooth between punctures, punctures separated between them 

by less than the puncture diameter. 

Comments.- Distributed on the Tucumán and Salta provinces 

in Argentina. 

Etymology.- The species epithet "capayan" refers to the Capayanes, 

an indigenous people nowadays extinct that lived in 

Argentine territory. It is treated as a noun in apposition. 



Holotype: ♀ “San Pedro de Colalao Tucumán, Argent. 

[Argentina] IX.1-11.68 [01-11.xi.1968] Lional Stange” (AEIC). 

Paratypes: 6♂♂, 6♀♀: labeled as follows: ARGENTINA: 

1♂, 1♀ “San Pedro de Colalao Tucumán, Argent. [Argentina] 

IX.1-11.68 [01-11.xi.1968] Lional Stange”, 5♂♂, 2♀♀ “Tacamas, 

Tucumán IX.11-X.5.68 [11.ix-05.x1968] Argent. [Argentina] 

Lionel Stange”, 2♀♀ “Tacamas, Tucumán X.5-30.68 

[05-30.x.1968] Argent. [Argentina] Lionel Stange”, and 1♀ “R. 

A. [Argentina] SALTA Cafayate 26.VII.944 [26.vii.1944] Col. 

R. Golbach” (AEIC). 

22. Alophophion filicornis (Morley, 1912) 

(Figs. 94, 100, 112) 

Ophion filicornis Morley, 1912: 57. Holotype ♀ BMNH 

[Morley’s use of “type” is herein regarded as an original holotype 

designation (ICZN 1999: Art. 73.1.1)] [description, key]. 

Alophophion filicornis (Morley): Townes & Townes, 1966: 

171 [generic transfer]; Yu & Horstmann, 1997: 730 [listed]. 

Diagnosis.- This species is easily differentiable of the rest 

member of this species-group due lack of ramulus and apical 

flagellomeres wider than long, this last feature is only found in 

this species within the genus. 


median portion weakly convex; smooth centrally and imbricate 

laterally with punctures separated by 1x a puncture width. Clypeus 

upper half of clypeus convex, smooth with punctures separated 

by 1x a puncture width; lower half with imbricate; apical 

edge straight centrally, slightly convex laterally. Compound eyes 

0.5x as wide as face. Outer mandibular surface smooth between 

punctures bearing long setae in the basal 2/3 and smooth between 

punctures in the apical 1/3. Malar space 0.3x as long as 

basal width of mandible. Gena, in lateral view (Fig. 100), 0.7x 

as wide as compound eyes, with fine punctate texture. Frons 

carinate between antennae and median ocellus. Vertex with 

texture as gena. Lateral ocelli separated from compound eye 

by 0.3x ocellar diameter; distance between ocelli 1.0x ocellar 

diameter. Antenna with 43 flagellomeres. Ratio of length/width 

from first to seventh flagellomeres: 3.8:1.9:1.6:1.4:1.4:1.4:1.3. 


Mesosoma.- Pronotum in upper posterior half with punctures 

separated between them by less than the puncture diameter, smooth 

between punctures; lower half and dorsal to collar striate-punctate. 

Mesoscutum smooth between punctures, punctures separated between 

them by less than the puncture diameter. Notaulus extending 

0.7x length of mesoscutum, scrobiculate. Mesoscutellum evenly 

convex, with texture as that of mesoscutum; lateral carina reaching 

to posterior margin of mesoscutellum. Mesopleuron with punctures 

separated between them by less than the puncture diameter, 

smooth between punctures; lower edge of speculum scrobiculate; 

mesopleural furrow basally scrobiculate them becoming areolaterugose, 

reaching to posterior lower mesopleuron; lower edge of 

speculum to subalar prominence, on area next to epicnemial carinae 

scrobiculate. Epicnemial carina curved to meet anterior margin of 

mesopleuron at lower quarter of the pronotum. Metapleuron with 

rugulose texture. Fore wing with CI=0.5; ICI=0.5; SDI=1.4; 1m-cu 

centrally curved and with ramulus absent; fenestra in a bead shape; 

sub-basal cell without setae; marginal cell marginal cell apically 

cover by setae. Hind wing with 7 hamuli on R1 distally; NI=0.7; 

cu-a curved. Propodeum (Fig. 112) with anterior and posterior 

transverse carina present, between them longitudinal carinae present 

but faintly indicated; with rugulose texture, except punctate before 

anterior transverse carinae; pleural carinae present. 


II with spiracle located at 0.5 of tergite 

Color.- Rufo-testaceous except following: laterally to compound 

eyes, between ocelli, mesoscutellum and subalar prominence 

yellowish. Wings grayish hyaline; veins and pterostigma 

brownish black. 

♂: unknown 

Type material examined. Holotype: ♀ labeled as follows: 

“Type [handwritten:] MS/B.M. TYPE HYM. [handwritten:] 

3.b.1304/ Name by Claude Morley [handwritten:] O. filicornis 

Morl. Slm Type ♀ ii.1911/ Argentina. O.W. Thomas 1904- 

148” (BMNH). 

23. Alophophion flavorufus (Brullé, 1846) 

(Figs. 5, 95, 101, 107, 108, 113) 

Ophion flavo-rufus Brullé, 1846: 144. [description] 

Ophion flavorufus Dalla Torre, 1902: 191 [listed]; Hooker, 

1912: 164 [translation of original description]. 

Neophion flavorufus (Brullé): Morley, 1912: 31 [generic 

transfer]. 

Alophophion flavorufus (Brullé): Townes & Townes, 1966:171. 

Lectotype ♂ MNHN [generic transfer, lectotype designation]; 

Yu & Horstmann, 1997: 730 [listed]. 


of the features: propodeum with anterior and posterior 

transverse carinae defined with carinate-rugose texture between 

them, ramulus present and apical flagellomeres longer than wide. 


long; softly imbricate with punctures separated by less than 1x a 

puncture width; median portion weakly convex. Clypeus softly 

imbricate with punctures separated by less than 1x a puncture 

width; slightly convex; apical edge straight centrally, slightly 

convex laterally. Outer mandibular surface smooth between 

punctures bearing long setae in the basal 1/2 and small setae 

in apical 1/2. Compound eyes 0.3–0.5x as wide as face. Malar 


view (Fig. 101), 0.7–0.8x as wide as compound eyes; smooth 

with shallow punctures separated by 3–4x as a puncture width. 

Frons carinate between antennae and median ocellus. Vertex 

with texture as gena. Lateral ocelli (Fig. 107) separated from 

compound eye by 0.2x ocellar diameter; distance between ocelli 

0.7–0.8x ocellar diameter. Antenna with 44–54 flagellomeres. 


4.1–4.2:2.1–2.8:1.8–2.1:1.6–2.1:1.6–2.1:1.5–2.1:1.6. Ratio 

of length/width of pre-apical flagellomeres: 1.2–1.3x. 


as a puncture width; in upper posterior half smooth or softly 

imbricate between punctures; lower half imbricate-punctate; 


29

Alvarado 

to collar striate-punctate. Mesoscutum smooth with punctures 

separated by 0.5–1x a puncture width; notauli extending 0.7x 

length of mesoscutum, scrobiculate basally and apically rugulose. 

Mesoscutellum evenly convex; lateral carina reaching ca. 0.2x 

to posterior margin of mesoscutellum; smooth with punctures 

separated by 3–4x as a puncture width. Mesopleuron (Fig. 

108) smooth with punctures separated by 1x as a puncture 

width; lower edge of speculum and subalar striate-punctate; 

mesopleural furrow basally (including area between speculum 

anteriorly to subalar prominence, on area next to epicnemial 

carinae) scrobiculate them becoming striate-punctate, reaching 

to posterior lower mesopleuron. Epicnemial carina not reaching 

anterior margin of mesopleuron. Metapleuron with rugulose 

texture. Fore wing with CI=0.5–0.7; ICI=0.6; SDI=1.4–1.6; 

1m-cu straight; ramulus present; Rs+M curved; marginal cell 

apically cover by setae; sub-basal cell without setae, rarely with 

one. Hind wing with 7 hamuli on R1 distally; NI=0.6–0.8; cu-a 

curved. Propodeum (Fig. 113) wavy-rugulose; anterior transverse 

carina present and well defined, not reaching to pleural carinae; 

posterior transverse carina present, longitudinal carinae bot 

discernible; pleural carinae present. 



Color.- Rufo- testaceous except following: around to compound 

eyes, something between ocelli, collar, mesoscutum 

basally between notauli and lateral edges, sometimes notauli, 

tegula, mesoscutellum, subalar prominence and posterior lower 

mesopleuron yellowish. Wings grayish hyaline; veins dorsally 

brownish black, veins ventrally and pterostigma yellowish 

brown. 

♂: Similar to female except by gena, in lateral view, 0.6x as 

wide as compound eyes. Hind wing with 7 hamuli on R distally 

but in a small male 6. 

Comments.- This species is distributed in the east of the 

Andes, in Argentina and southern Brazil, from 250 to 1000m. 

Brullé (1846) described the species from material collected 

in Brazil, but no type was designated. Townes & Townes (1966) 

designated a lectotype from Argentina. The specimens studied 

of A. flavorufus were distributed in the Argentinean provinces 

Catamarca, Buenos Aires, Mendoza, and San Juan; in Brazil it 

was only recorded from Rio Grande do Sul. 

Type material examined.- Lectotype: ♂ labeled as follows: 

“Muséum Paris EY6718/ del’emb. Del’uruguay jusqu'au missions/Ophion 

flavorufus"(MNHN). 

Non type examined material: 2♂♂ 29♀♀ 1?: labeled as 

follows: ARGENTINA: 2♂♂, 28 ♀♀, 1?: 1♂ 3♀♀ “16-18 

Km. N. La Merced IX.26-27.68 [26-27.ix.1968] 1000m Cat. 

[Catamarca] Argentina Luis Peña”, 4♀♀ “Alapachiri, Tuc. 

[Tucumán] X.1.68 [01.x.1968] Argent. [Argentina] Luis Peña”, 

1♀ “R. A. [Argentina] MENDOZA III.946 [, iii.1946] Col. 

Mansoner/Inst. M. Lillo [Instituto Miguel Lillo]”, 3♀♀ “San 

Luis Argentina Mendoza iv.4.62 [04.iv.1962] Luis Peña”, 2♀♀ 

“San Pedro de Colalao Tucumán, Argent. [Argentina] XI.8- 

XII.8.67 [08.xi-08.xii.1967] Lional Stange”, 1♀ “N. Aconquija, 

Cat. [Catamarca] X.1-2.68 [01-02.X.1968] Argent. [Argentina] 

Luis Peña”, 1♂ “Amaicha del Valle XII-30-65 [30.xii.1965] 

Argent. [Argentina] H. & M. Townes: and 1♀ “Tafi del Valle 

30 

[Tafí del Valle] I-2-66 [02.i.1960] Argent. [Argentina] H. & M. 

Townes” (AEIC); 5♀♀ “Tandil 250m. Bs. Aires [Buenos Aires] 

Argent. [Argentina] XII.1953 [xii.1953] F.H. Walz” 4 ♀AEIC; 

1♀ MNHN); 1♀ “[Argentina] Pergamino Buenos Aires -8-ix- 

1979 [08.ix.1979]”; 7♀♀ “[Argentina: San Juan] Villa Mercedes 

San Juan x-1979 [x.1979] Col Mansuz” (MLP); and, 1♀ 1? 

“ARG [Argentina]: S. d. Estero [Santiago del Estero] Colonia 

Dora 15-26.xi.1979 C. & M. Vardy B.M. 1980-76” (MNHN). 

BRAZIL: 1♀: “BRAZIL: R.G.S. [Rio Grande do Sul] Pelotas 16 

x 1952 [16.x.1952] C.M. Blezanko B.M. 1953-249” (BMNH). 

24. Alophophion politus (Morley, 1912) 

(Figs. 99, 102, 111, 114) 

Ophion politus Morley, 1912: 57 Holotype ♀ BMNH 

[Morley use of “type” is herein regarded as an original holotype 

designation (ICZN 1999: Art. 73.1.1)] [description, key]. 

Alophophion politus Townes & Townes, 1966:171 [generic 

transfer]; Yu & Horstmann, 1997: 730 [listed]. 


of the features: propodeum with longitudinal carinae well 

defined between transverse carinae defined and area dentipara 

and superomedia smooth with isolated punctures. 


long; smooth to softly imbricate with punctures separated by 

less than 1x a puncture width; median portion weakly convex. 

Clypeus with punctures separated by less than 1x a puncture 

width; upper half convex, smooth texture between punctures; 

lower half flat, imbricate texture between punctures; apical edge 

straight centrally, slightly convex laterally. Outer mandibular 

surface smooth between punctures; bearing long setae in the 

basal 2/3 and smooth between punctures in the apical 1/3. 

Compound eyes 0.4–0.5x as wide as face. Malar space 0.2x 

as long as basal width of mandible. Gena, in lateral view (Fig. 

102), 0.7–0.8x as wide as compound eyes; smooth with shallow 

punctures separated by 3–4x as a puncture width. Frons imbricate; 

convex between antennae and median ocellus. Vertex with 

texture as gena. Lateral ocellus separated from compound eye 

by 0.3–0.4x ocellar diameter; distance between ocelli 0.7-1.0x 

ocellar diameter. Antenna with 47 –55 flagellomeres. Ratio of 





as a puncture width; in upper posterior half smooth or softly 

imbricate between punctures; lower half granulo-punctate; to 

collar striate-punctate. Mesoscutum punctate, smooth between 

punctures, punctures separated between them less than the 

puncture diameter. Notaulus extending 0.4x length of mesoscutum, 

scrobiculate basally. Mesoscutellum evenly convex, with 

texture as that of mesoscutum; lateral carina reaching 0.2x to 

posterior margin of mesoscutellum. Mesopleuron (Fig. 111) with 

punctures separated by 1–2x as a puncture width; on upper half 

smooth between punctures and in lower half imbricate between 

punctures; with lower edge of subalar prominence punctate 

(smooth between punctures in big specimens and imbricate 

texture between punctures in small specimens); lower edge of 

speculum scrobiculate; area between speculum and mesopleural 



furrow imbricate between punctures. Mesopleural furrow basally 

scrobiculate-rugose reaching usually to the middle of mesopleuron, 

rarely reaching to posterior lower mesopleuron. Epicnemial 


quarter of the pronotum. Metapleuron punctate with rugulose 

texture. Fore wing with CI=0.5–0.7; ICI=0.6–0.7; SDI=1.3–1.5; 


apically glabrous; sub-basal cell with isolated setae apically. Hind 

wing with 7–8 hamuli on R1 distally; NI=0.6–0.7; cu-a curved. 

Propodeum (Fig. 114) with punctate before anterior transverse 

carinae, area dentipara and superomedia smooth with isolated 

punctures; anterior transverse carina present and well defined, up 

curved laterally, reaching to pleural carinae; posterior transverse 

carina present, reaching to pleural carina; sometimes with a longitudinal 

carina dividing area superomedia; carinae longitudinal 

present behind posterior transverse carina but faintly indicated, 

wavy carinate; pleural carinae present. 



Color.- Testaceous except following: around to compound 

eyes, between ocelli, vertex, pronotum laterally, mesoscutum 

basally between notauli and lateral edges, notauli, tegula, mesoscutellum, 

subalar prominence, posterior lower mesopleuron 

and metapleuron apically yellowish. Wings grayish hyaline; 

veins dorsally brownish black, veins ventrally and pterostigma 

yellowish brown. 

In small specimens yellowish spot largest, mesopleuron yellowish 

except lower edge of speculum and subalar prominence 

orange; in mesoscutum spots reaching to posterior edge and 

apical half of metapleuron. 

♂: Similar to female except some specimens with propodeal 

carinae less defined and with yellowish spot in the apical half 

of metapleuron and propodeum and a diagonal stripe in mesopleuron. 

Comments.- Alophophion politus is quite similar to A. carcanchoi 

new species. They are differentiated easily by the presence 

of a groove bearing longs hair on the mandibles and shorter 

mesopleural furrow in A. politus. 

The type locality only mentions Chile. On base of the material 

examined A. politus more precise distribution is found. 

It occurs at the center of Chile, regions of Araucanía, Biobío, 

Coquimbo, Los Ríos, Maule, Libertador General Bernardo 

O'Higgins Region, Metropolitana de Santiago and Valparaíso; 

and the Argentinian provinces of Chubut and Rio Negro. This 

is the first record of A. politus in Argentina. 

Type examined material.- Holotype: ♀ labeled as follows: 

“Type [handwritten:] MS/ B.M. TYPE HYM. 3.b.1301/Named 

by Claude Morley [handwritten:] Ophion politus Morl. Slm Type 

♀ ii.1911/Chili. E. Sanders. 93-49” (BMNH). 


Non type material examined.- 26♂♂, 121♀♀: labeled as follows: 

ARGENTINA: 7♂♂, 12♀♀: 5♀♀ “CHILE [Argentina]: 

Chubut. 18.vi.1962. A. Kovacs. B.M. 1964-193.”; 7♂♂, 2♀♀ 

“CHILE [Argentina]: R.N. [Río Negro], El Bolson. 30.xi.1960. 

A. Kavocs. B.M.1964-193”; and 1♀ “L. Gutierrez 3-14.xi.1926/ 

Argentina: Terr. Rio Negro. F. & M. Edwards. B. M. 1927-63” 

(BMNH). 3♀♀, “Chubut Patagonia / From WFH Rosemberg/ 

[identification label: Ophion chilensis Spinola det C.W. Hooker 

3.12-18.1909]”; and 1♀, “Chubut,-Gargo Blanco Valle 

Patagonia / Collection Rosenberg /[identification label: Ophion 

bilineatus Say det C.W. Hooker III.2.1909]” (USNM). CHILE: 

19♂♂, 109♀♀: 1♀ “Alto Vilches Tal. [Talca] XII.20.77 [20. 

xii.1977] Chile Luis Peña”; 1♂, 3♀♀ “Canela Baja, Coquimbo, 

Chile X.23 1961 [23.x.1961] Luis Peña”; 2♀♀ “Concepción, 

Chile Quebrada Pinares II-III. 1967 [ii-iii.1967] T. Cekalovic”; 

4♂♂ “[Chile] Cord. [Cordillera] Las Raices [,] Lonquimay, Chile 

III.22.79 [22.iii.1979], [L.] Peña”; 1♀ “Chevillen-Tregudema 

Chile I.25.67 [25.i.1967], [L.] Peña”; 1♀ “Curacautín, Malleco 

Chile XII.19-21.'50 [19-21.xii.1950] L. Pena [Peña]”; 1♀ “Curacautín, 

Malleco Chile XII.8.50 [08.xii.1950] L. Pena [Peña]”; 

4♀♀ “Curacautín, Malleco II.'64 [ii.1964] R. [Río] Blanco 

Chile Luis E. Peña”; 1♀ “El Coigual, Curico I.21-25.64 [21- 

25.i.1964] Chile Luis E. Peña”; 1♀ “El Marchan, Chile III.1971 

[iii.1971] Chillán Luis Peña”; 1♂, 1♀ “El Radal 1000-1500 Talca 

prov. [Provincia] XI.22.57 [22.xi.1957] Chile L Pena Guzman 

[L. Peña Guzmán]”; 7♀♀ “Estero La Jaula Los Quenes [Los 

Queñes] Curico I.4-18.64 [04-18.i.1964] Chile Luis E. Peña”; 

1♀ “Fundo El Coigo [,] Cord [Cordillera] Curico Chile XII.20- 

31.59 Luis Pena [Peña]”; 1♀ “Lago Italma Cord. [Cordillera] 

Lonquimay I.12-17.62 [12-17.i.1962] Chille Luis Peña”; 1♂ 

“Lago Puyehue, Pr. [Provincia] Osorno CHILE Feb.18, 1957 

[18.ii.1957] L.E. Pena [Peña]”; 1♂, 2♀♀ “Las Trancas, Chile 

April 1972 [vi.1972] Chillán Luis Peña”; 1♀ “Las Trancas, Chile 

II.6-11.66 [06-11.ii.1966] Chillán Luis Peña”; 1♂, 1♀ “Las 

Trancas, Chile I-II.71 [i-ii.1971] Chillán Luis Peña”; 12♀♀ “Las 

Trancas, Chile XII.1-15.75 Chillán Luis Peña”; 1♀ “Las Trancas, 

Chillán Chile Jan.1967 [i.1967], [L.] Peña”; 1♀ “Pucatrihue 

Chile Dec 1967 [xii.1967] 1966 (crossed out) Luis Peña”; 1♀ 

“Pucatrihue, Chile I.23-31.1966 [23-31.i.1966] Luis Peña”; 2♂♂ 

“Pucatrihue, Chile Sept.1967 [ix.1966] 1966 (crossed out) Luis 

Peña”; 1♂, 9♀♀ “Q. [Quebrada] Teniente, Coquimbo, Chile 

Oct. 26, 1961 [26.x.1961] Luis Pena [Peña]”; 1♀ “Recinto [,] 

Ñuble I.'76 [i.1976] Chile Luis Pena [Peña]; 4♀ “Rio Blanco, 

Aconcagua, Chile Dec. 5-8, 1961 [05-08.xii.1961] Luis Peña”; 

3♂♂, 5♀♀ “S. Pedro deQuile [San Pedro de Quiles] Coquimbo, 

Chile Nov. 16-17 [16-17.xi.1961], 1961 Luis Pena [Peña]”; 

and 1♀ “Vilches Alto Cord. [Cordillera] Talca I.'75 Chile [i. 

1975] Luis Peña” (AEIC). 2♀♀ “Cespedes Had. [Hacienda] 

Illapel Coquimbo Pr. [Provincia] XI.26.59 [26.xi.1959] Chile 

L Pena Guzman [L. Peña Guzmán]” (1♀ MNHN, 1♀ AEIC). 

1♂, Quebrada El Manzano Prov. [Provincia] Santiago Chile 

X.28.51 [28.x.1951] 1200 m Thra Walz” (MNHN). 1♂ “Casa 

Pangue. 4-10.xii.1926./ S. Chile: Llanquihue prov. F. & M. 

Edwards. B.M. 1927-63”; 1♀ “CHILE: Maipe [Maipo] Valley 

5.xi.1971 BM1973-192 [handwritten:]”; 1♀ “CHILE: Trata [¿] 

Victoria. 24.iii.1961. A. Kovacs. B.M. 1964-193” (BMNH). 

2♀♀ “CHILE MALLECO Vn. [¿] Louquimay [Lonquimay] 

1400m 22.XII.1994 [22.xii.1994] J.E. Barriga”; 1♀ “CHILE: 

CURICO Licancel [Licantén], Licnateú [Licantén] 22.XII.1993 

[22.xii.1993] JEBarriga [J.E. Barriga] & Lperalta [& L. peralta] 

black light”; 1♂, 3♀♀ “CHILE: IX Región [Araucanía] Salto 

El Puma ~ 28km SE Pucón 39°25'S 71°45'W 7.XII.1994 [07. 

xii.1994] SLHeydon [S.L. Heydon] & Earias [E. Arias]”; 1♂, 

5♀♀ “ CHILE: Prov. [Provincia] Curico 10km w. Licanten 

20.XII.1993 JEBarriga [J.E. Barriga] & LPeralta [& L. Peralta] 

at light”; 18♀♀ “ CHILE: TALCA Alto Vilches 27.XII.1987 

[27.xii.1987] J.E. Barriga”; 1♀ “CHILE: VII [Maule] Región 

Curicó Altos de Vilches 18.XII.1996 [18.xii.1996] E. Arias ligth 

trap”; 1♀ “CHILE: VIII Región [Biobío] Hotel de Montaña 

31

Alvarado 

Los Pirineos Termas de Chillán 36°54'S 71°29'W 22.XI.1994 

[22.xi.1994] 1200m SLHeydon [S.L. Heydon] & Earias [E. 

Arias]”; and 9♀♀ “CHILE: VIII Región Los Lleuques 14km 

w. Termas de Chillán 1080m 36°54'S 71°32'W 23-24.XI.1994 

[23-24.xi.1994] SLHeydon [S.L. Heydon] & Earias [E. Arias]”; 

(UCDC). 1♀ “MUSEUM PARIS CHILI GAY 1843 / Ophion 

intricatus” (USNM). 

25. Alophophion yagane new species 

(Figs. 98, 104, 110, 116) 

Diagnosis.- The most striking characteristic of this species, 

within the species-group, is the mesopleural furrow reaching 

to the posterior lower edge of the mesopleuron, and the lateromedian 

longitudinal carinae convergent behind posterior 

transverse carina. 


as long; softly imbricate with punctures separated by 0.5–1x 

a puncture width; median portion weakly convex; median 

portion weakly convex. Clypeus slightly convex, imbricate with 

punctures separated by 2–3x a puncture width; apical edge 

straight centrally, slightly convex laterally. Outer mandibular 

surface smooth bearing long setae in the basal 2/3. Compound 

eyes 0.5x as wide as face. Malar space 0.2x as long as basal 

width of mandible. Gena, in lateral view (Fig. 104), 0.7x as 

wide as compound eyes, smooth with punctures separated 

by 4x a puncture width. Frons striate between antennae and 

median ocellus. Vertex smooth with punctures separated by 2x 

a puncture width. Lateral ocellus separated from compound 

eye by 0.2–0.3x ocellar diameter; distance between ocelli 



4.1–4.2:2.4:2.2–2.1:2.1–2.0:1.9–2.0:1.8–1.9:1.7:1.8. Ratio of 


Mesosoma.- Pronotum in upper posterior half imbricate 

with punctures separated by less than a puncture diameter; lower 

half and dorsal to collar striate. Mesoscutum softly imbricate 

with punctures separated by less than the puncture diameter. 

Notaulus extending 0.3x length of mesoscutum, finely scrobiculate. 

Mesoscutellum evenly convex, with texture as that of 

mesoscutum; lateral carina reaching 0.4x to posterior margin of 

mesoscutellum. Mesopleuron (Fig. 110) smooth with punctures 

separated by 0.5x puncture diameter; lower edge of speculum 

scrobiculate; mesopleural furrow basally softly scrobiculate them 

becoming rugulose reaching to posterior lower mesopleuron. 


at lower quarter of the pronotum. Metapleuron with rugulose 

texture. Fore wing with CI=0.4–0.5; ICI=0.7; SDI=1.5–1.6; 


apically cover by setae; sub-basal cell usually without setae, at 

most with one or two isolate setae. Hind wing with 7 hamuli 

on R1 distally, rarely with 8 hamuli; NI=0.5–0.6; cu-a curved. 

Propodeum (Fig. 116) with coarsely wavy carinate texture, 

except punctate before anterior transverse carinae; anterior and 

posterior transverse carina present; longitudinal carinae present, 

except before anterior transverse carina; lateromedian longitudinal 

carinae after posterior transverse carinae convergent, fused to 

form a single median longitudinal carina, unusually longitudinal 

carinae getting close but not converging; pleural carinae present. 


Tergite II with spiracle located at 0.4–0.5x of tergite. 

Color.- Burnt orange except following: surrounding area of 

compound eyes, vertex and gena yellowish orange. 

♂: Similar to female 

Comments.- Some specimens have softer texture in the 

propodeum and the epicnemial carina is not well defined in 

mesopleuron, while other specimens have the median portion 

weakly and clypeus smooth between punctures; these variations 

are indistinct from the sex. The apical corner of marginal cell 

sometimes with the setae fallen down, but the hollows left by 

them allow them to be identify. 

There is one specimen determinate as Ophion luteus (Linnaeus, 

1758) examined by Morley (1912), he mentioned that 

he could not find distinction between this specimen and others 

distributed in Jamaica, Monte Video and Soriano in Uruguay. 

This specimen belongs to Alophophion and was misidentified. 

This species is distributed from Biobío in Chile and Neuquén 

in Argentina to the south of the continent. 

Etymology.- The species epithet "yagane" refers to the Yaghan 

indigenous peoples of the Southern Cone, who are regarded as 

the southernmost peoples in the world. 

Holotype: ♀ “CHILE: Chiloe Al Pacifico Road 7.ii.1985 

I.D. Gauld” (BMNH). 

Paratypes: 12♂♂, 13♀♀, 1?: labeled as follows: ARGEN- 

TINA: 3♂, 3♀♀: 1♀ “CHILE [Argentina]: R.N. [Río Negro], 

El Bolson. 20.i.1960. A. Kavocs. B.M.1964-193” and 1♀ 

“CHILE [Argentina]: R.N. [Río Negro], Rio Azul. 05.i.1960. 

A. Kavocs. B.M.1964-193” (BMNH); 1♀ “Pucará, Lago Lacar, 

Neuquen, Argentina February 4, 1968 [04.ii.1968] L & J Stange”; 

1♂ “R.A. TUCUMAN Qda [Quebrada] Amaicha El Molle 

2900m- XI.932 [XI.1932]”1♂ 1? “Alapachiri, Tuc. [Tucumán] 

X.1.68 [01.x.1968] Argent. [Argentina] Luis Peña” and 1♂ “Pto. 

[Puerto] Aqua, L. [Lago] Traful, Neuquen, Argentina January 

30, 1968 [30.i.1968] L & J Stange” (AEIC). CHILE: 9♂♂, 

10♀♀: labeled as follows: 1♂, 4♀♀ “Isla Riesco [,] Magallanes 

[Magallanes y de la Antártica Chilena, Magallanes] II-18-61 [18. 

ii.1961] Chile T. Cehalovick”; 1♂ “Pucatrihue Osomo Chile 

II.3-4.67 [03-04.ii.1967], [L.] Peña”; 1♀ “3 km. E Las Trancas 

Ñuble Chile I.16.67 [16.i.1967] Lionel Stange” and 5♂♂, 

2♀♀ “Dalcahue CHILE Prov. [Provincia] Chiloe Feb. 1957 

[ii.1957] L. E. Pena [Peña]” (AEIC); 1♂, 1♀ “Punta Arenas [,] 

Magallanes [Magallanes y de la Antártica Chilena, Magallanes] 

III-09-61 [09.iii.1961] Chile T. Cehalovick” (1♀ BMNH, 1♂ 

AEIC); and 1♂, 1♀ “CHILE: Chiloe Al Pacifico Road 7.ii.1985 

I.D. Gauld” (BMNH). Unknown location: 1♀ “6349/ Ophion 

luteus, Linn [handwritten:]/ Refered to Holiday Trans Linn. Soc. 

1836 p. 319” (BMNH). 

Species-group C 

Diagnosis.- Face at most 1x as long as wide or wider (Figs. 

118–139); compound eyes at most 0.6x wide as face; head, in 

lateral view (Figs. 140–161), gena 0.7 to 0.9 x wide as compound 

eyes. Mandible with upper surface with small groove (Figs. 

6–7), groove rarely reaches external surface of mandible, if so, 

then only in intersection between upper and external surface 

and never reaching to center of external surface; groove bears 

32 



small setae. Color yellowish, olive green, brownish, some species 

brownish with cream spots. 

Included species.- Twenty two species were found in this 

group – A. atahualpai new species, A. capacyupanquii new 

species, A. carcanchoi new species, A. chavinaensis new species, 

A. chilensis (Spinola, 1851), A. chiquiyane new species, A. coquimboensis 

new species, A. huascari new species, Alophophion 

huaynacapaci new species, A. incarocai new species, A. larseni 

(Enderlein, 1912), A. lloqueyupanquii new species, A. ofeliae 

new species, A. pachacutii new species, A. pincoya new species, 

A. porculatus (Morley, 1912), A. teushen new species, A. waca 

new species, A. wiracochai new species, A. yahuarhuacaci new 

species, A. yestay new species, and A. yupankii new species. 

Key to species of species group C 

(1) Propodeum with posterior transverse carina absent between lateral longitudinal 

carinae (Figs. 186–188), if present, then only present laterally forming 

area coxalis (Fig. 195) …..................................................................... 2 

– Propodeum with posterior transverse carina present between lateral longitudinal 

carinae; sometimes weaker centrally (Figs. 185, 189–194, 196–194, 

200–204) or only present between lateromedian longitudinal carinae (Figs. 

184, 199, 205) ...............................................................................… 6 

(2) Propodeum with anterior transverse carina absent, only with longitudinal 

carinae present apically (Fig. 186) … 

.................................... Alophophion capacyupanquii new species 

– Propodeum with anterior transverse carina present, sometimes only centrally 

(Figs. 187–188) …............................................................................. 3 

(3) Fore wing with ramulus present; sub-basal cell with a glabrous section next 

to pterostigma and Rs+2r vein (Fig. 210) … 

................................................ Alophophion huascari new species 

Fore wing with ramulus absent (Fig. 207-208) or only represented as an angle 

of Rs+M (Fig. 212), sub-basal cell with setae homogeneously covering … 

..................................................................................................... 4 

(4) Body color brownish with cream white spots (Fig. 178) … 

................................. Alophophion yupankii new species (in part) 

– Body predominantly brownish without cream spots …................... 5 

(5) Hind wing with sub-basal cell with a row of setae parallel to M+Cu; fore 

wing with fenestra comma-shaped (Fig. 207)… 

............................................... Alophophion incarocai new species 

– Hind wing with sub-basal cell without a row of setae parallel to M+Cu, if it 

is present with only two setae; fore wing with fenestra bead shaped (Fig. 208) 

...................................... Alophophion yahuarhuacaci new species 

(6) Clypeus with ventral-lateral edges angulate giving a square appearance (Fig. 

133) ............................................... Alophophion pincoya new species 

– Clypeus with ventral-lateral edges more or less curved (Figs. 127–129) … 

..................................................................................................... 7 

(7) Mesopleural furrow absent (Figs. 163, 165, 166–169); mesopleuron with 

surface homogeneously ornamented, generally punctate …................ 8 

– Mesopleural furrow present (Figs. 162, 164, 173–174, 182), mesopleural 

furrow scrobiculate, rugulose or areolate-rugose texture; rest of mesopleuron 

with surface generally punctate ....................................…................ 16 

(8) Propodeum with longitudinal carinae present between transverse carinae, 

enclosing area superomedia and dentipara (Figs. 185, 200, 202) ….... 9 

– Propodeum with lateral longitudinal carinae not distinguishable between 

transverse carinae (Figs. 184, 191, 199, 203) .................................... 11 

(9) Lateral ocellus separated from compound eye by 0.2x ocellar diameter … 

............................. Alophophion chilensis (Spinola 1851) (in part) 

– Lateral ocellus separated from compound eye by 0.3–0.4x ocellar diameter 

............................................................................................... … 10 

(10) Pronotum smooth with punctures separated by 2.5–4x a puncture width; 

legs homogeneously olive green … 

........................................ Alophophion porculatus (Morley, 1912) 

– Pronotum on the upper half smooth with punctures separated by 1–2x a 

puncture width and lower half rugulose; legs olive green with brownish spots 

.................................................… Alophophion yestay new species 

(11) Lower edge of speculum smooth between punctures (Fig. 172)… 

................................... Alophophion lloqueyupanquii new species 

– Lower edge of speculum scrobiculate, sometimes only in the proximal half 

(Figs. 163-164, 171, 180) ................................................................. 12 

(12) Propodeum with area superomedia not distinguishable; lateromedian longitudinal 

carinae absent between transverse carinae and present behind posterior 

transverse carinae but faint (Fig. 203) … Alophophion chavinaensis new species 

– Propodeum with area superomedia distinguishable; lateromedian longitudinal 

carinae present after anterior transverse carina and behind posterior transverse 

carinae convergent or fused to form a single median longitudinal carina (Figs. 

184, 190–199) ................................................................................. 13 

(13) Fore wing with marginal cell homogeneously cover by setae (like Fig. 

207-209); propodeum with posterior transverse carina faint only well-defined 

between lateromedian longitudinal carinae (Fig. 184) … 

........................................ Alophophion larseni (Enderlein, 1912) 

– Fore wing with marginal cell apically glabrous next to pterostigma and Rs+2r or 

just next to Rs+2r; propodeum with posterior transverse carina homogeneously 

defined ............................................................................................ 15 

(14) Anterior transverse carina present only centrally; lateral longitudinal carinae 

absent; shiny; lateral longitudinal carinae absent between transverse carinae 

(Fig.199) ........................................ Alophophion teushen new species 

– Anterior transverse carina present between pleural carinae; lateral longitudinal 

carinae present between transverse carinae (Fig. 190), sometimes faint 

(Fig. 205) ........................................................................................ 15 

(15) Propodeum predominantly light straw yellow (Fig. 190); fore wing with 

marginal cell glabrous next to upper half of Rs+2r (Fig. 206) … 

.................................................... Alophophion ofeliae new species 

– Propodeum predominantly brownish (Figs. 205); fore wing with marginal 

cell glabrous next to pterostigma and Rs+2r (like Fig. 210) … 

........................................ Alophophion huaynacapaci new species 

(16) Metapleuron rugulose (Figs. 3, 173–174) … ............................ 17 

– Metapleuron punctate, granulo-punctate, or punctate on upper half and 

rugulose on lower half (Figs. 162, 175, 182) …................................ 18 

(17) Mesopleuron furrow scrobiculate; epicnemial carina well delimited laterally 

(Fig. 173)................................... Alophophion atahualpai new species 

– Mesopleuron furrow rugulose, sometimes present only around epicnemial 

carina, generally reaching to posterior lower mesopleuron; epicnemial carina 

not well delimited laterally (Fig. 174) … 

............................................ Alophophion carcanchoi new species 

(18) Fenestra thin, wider transverse diameter narrower than area between fenestra 

and Rs+M vein (Fig. 209) …..... Alophophion wiracochai new species 

– Fenestra wide, transverse diameter wider than the area between fenestra and 

Rs+M vein (Fig. 211)........................................................................ 19 

(19) Propodeum with area superomedia well defined (Figs. 201–202), enclosed 

......................................................................................................… 20 

– Propodeum with area superomedia not well defined (Figs. 189, 196, 204); 

lateromedian longitudinal carinae not discernible from the texture between the 

transverse carinae …......................................................................... 21 

(20) Propodeum with lateromedian longitudinal carinae converging behind 

posterior transverse carina, area petiolaris absent; carinae lamellate (Fig. 201) .. 

.................................................. Alophophion chiquiyane new species 

– Propodeum with area petiolaris and area posteroexterna continuous (Fig. 202) 

................................... Alophophion chilensis (Spinola 1851) (in part) 

(21) Fore wing with marginal cell cover by setae (like Figs. 207–209); body 

predominantly rufo-testaceous ......… Alophophion waca new species 

– Fore wing with marginal cell basally glabrous next to proximal half of Rs+2r 

and pterostigma (Fig. 211) ............................................................... 22 


33

Alvarado 

Figures 127 – 145. 


(127) A. atahualpai new species 

(128) A. carcanchoi new species 

(129) A. wiracochai new species 


(131) A. yupankii new species 

(132) A. huascari new species 

(133) A. pincoya new species 

(134) A. teushen new species 

(135) A. yestay new species. 

Details of face, 

(136) A. chiquiyane new species 

(137) A. chavinaensis new species 

(138) A. coquimboensis new species 

(139) A. huaynacapaci new species 

Details of head in lateral view 

(140) A. chilensis 141 A. larseni 





34 



Figures 146 – 165. 











(155) A. lloqueyupanquii new species 


(157) A. carcanchoi new species. 










(165) A. coquimboensis new species. 


35

Alvarado 

Figures 166 – 181. 















(178) A. yupankii new species. 



(181) A. yestay new species. 

36 



Figures 182 – 198. 

Details of mesosoma in lateral view, 



Details of propodeum, 






(189) A. waca new species. 









(198) A. pincoya new species. 


37

Alvarado 

Figures 199 – 212. 








(205) A. huaynacapaci new species. 

Details of fore wing, 







(212) A. yupankii new species. 

38 



(22) Notaulus with same texture as mesoscutum; frons centrally testaceous and 

laterally light straw yellow … 

...................................... Alophophion coquimboensis new species 

– Notaulus basally scrobiculate; frons light straw yellow … 

............................................. Alophophion pachacutii new species 

26. Alophophion atahualpai new species 

(Figs. 1, 2, 3, 127, 156, 173, 192) 


of the features: speculum and mesopleural furrow are 

homogenously scrobiculate. 


long; smooth with punctures separated by 0.5x a puncture 

width; median portion weakly convex. Clypeus smooth with 

punctures separated by 0.5–1x a puncture width; slightly 

convex; apical edge straight. Compound eyes 0.5–0.6x as wide 


Gena, in lateral view (Fig. 156), 0.7–0.8x as wide as compound 

eyes; smooth with punctures separated by 0.5–1x a puncture 

width. Frons striate, between central ocelli and toruli. Vertex 


eye by 0.2x ocellar diameter; distance between ocelli 0.5–0.6x 

ocellar diameter. Antenna with 54 flagellomeres. Ratio of length/ 


2.8:2.5–2.6:2.4:2.3:2.2–2.3. Ratio of length/width of pre-apical 


Mesosoma.- Pronotum on the upper half smooth with 

punctures separated by 0.4–0.8x a puncture width and lower 

half scrobiculate; lower half of collar striate. Mesoscutum smooth 

with punctures separated by 0.4–0.8x a puncture width. Notaulus 

extending 0.7x length of mesoscutum, basally scrobiculate. Mesoscutellum 

evenly convex; lateral carina reaching 0.1x to posterior 

margin of mesoscutellum; smooth with punctures separated by 

1–2x a puncture width. Mesopleuron (Fig. 3, 173) smooth with 

punctures separated by 0.4–0.8x a puncture width; speculum 

smooth with punctures separated by 2x a puncture width lower 

edge of speculum scrobiculate; mesopleural furrow scrobiculate 

reaching to middle to the posterior lower mesopleuron. Epicnemial 

carina curved to meet anterior margin of mesopleuron at 

lower third of pronotum. Metapleuron rugulose; juxtacoxal carina 

present. Fore wing with CI=0.3–0.4; ICI=0.6; SDI=1.5–1.6; 1mcu 

straight; ramulus present; Rs+M curved; marginal cell cover by 

setae; sub-basal cell usually without setae. Hind wing with 6–7 

hamuli on R1 distally; NI=0.6–0.8; cu-a curved. Propodeum (Fig. 

192) wavy carinate with punctures except area basalis smooth with 

punctures separated by 0.5–1x a puncture width; anterior and 

posterior transverse carina present; longitudinal carinae present, 

also before anterior transverse; carinae forming areas petiolaris, 

posteroexterna and coxalis wavy; pleural carinae present. 



Color.- Brown reddish except following: surrounding area 

of compound eyes, vertex, gena mesoscutum, collar, subalar 

prominence, basal spot in speculum yellowish orange and a spot 

on posterior lower mesopleuron light straw yellow. 

♂: Similar to female except by the presence of isolate setae 

apically in sub-basal cell. 

Comments.- This species has a wide distribution and the 

most septentrional distribution for the genus, from Lima-Peru 

to Ecuador. It is present at elevations of 1700 to 3177 m. They 

are more abundant in higher elevations as was observed Udima 

collections; they were collected at elevations of 2150 to 3116m, 

and were absent at lower elevations (1195m and 1615 m). 

Etymology.- The species epithet "atahualpai" refers to Atahualpa 

the last ruler of the Tawantinsuyu. 

Holotype: ♀ “PERU, CA [Cajamarca]. S.N. [National Sanctuary] 

Udima, 4.6 Km al NE de Monteseco, 2841 m, 6º50’15.8” 

[S]/79 º04’16” [W], 12.v.2009 [12.v.2010]. J. Grados Leg.” 

Paratypes: 11♂♂, 126♀♀: labeled as follows: ECUADOR: 

7♂♂, 6♀♀: labeled as follows: 6♂♂, 5♀♀ “Río León, Ecuador 

III.21-22.65 [21-22.iii.1965] 1700m. Luis Peña”; 1♂, 1♀ 

“Río León 2100m. XI.30.70 [30.xi.1970] Ecuador Luis E. 

Peña” (AEIC). PERU: 4♂♂, 121♀♀: labeled as follows: 3♀♀ 

“PERU, CA [Cajamarca]. S.N. [Zona Reservada] Udima, 4.6 

Km al NE de Monteseco, 2841 m, 6º50’15.8” [S]/79 º04’16” 

[W], 19.x.2009. J. Grados Leg.” (MUSM); 1♀, “PERU: CA. 3.8 

Km al NE de Monteseco, 2150 m 06°50'37"[S] / 79°04'52"[W] 

16-19.v.2010 J. Grados leg” (MUSM); 5♀♀, “PERU, CA 

[Cajamarca, National Sanctuary Udima], 3.8 Km al NE de 

Monteseco, 2150 m, 6º50’37” [S]/79 º04’52” [W], 17.x.2009. 

J. Grados Leg.” (3♀♀ SEMC; 2♀♀ MUSM); 5♀♀, “PERU, 

CA [Cajamarca]. S.N. [National Sanctuary] Udima, 4.6 Km 

al NE de Monteseco, 2841 m, 6º50’15.8” [S]/79º04’16” [W], 

24-26.iv.2009. J. Grados Leg.” (3♀♀ SEMC; 2♀♀ MUSM); 

2♂♂, 9♀♀ “PERU, CA [Cajamarca]. S.N. [National Sanctuary] 

Udima, 4.6 Km al NE de Monteseco, 2841 m, 6º50’15.8” [S]/79 

º04’16” [W], 12.v.2009 [12.v.2010]. J. Grados Leg.” (1♂, 3♀♀ 

SEMC; 1♂, 6♀♀ MUSM); 1♂, 94♀♀ “PERU, CA [Cajamarca]. 

S.N. [Zona Reservada] Udima, Monteseco, 6º50’40.04” 

[S]/79 º03’45.53” [W], 3116m. 14-15.v.2010. J. Grados Leg.” 

(5♀♀ BMNH, 1♂, 89♀♀ MUSM); and 1♀ “PERU: AN. [Ancash] 

Huari, Chavin de Huantar 77°19'42.34"W/ 9°35'33.9"S. 

3177m. v.2010 L. Figueroa” (MUSM); 1♂, 1♀ “Lima Peru 

II.15.56 [15.ii.1956] Thra Walz” (AEIC); and 1♂ “PERU, 

Amazonas Chachapoyas, 2800 m. 26.iii.1984 [handwritten] 

M Cooper / M. Cooper BMNH (E) 2005-152” (BMNH) . 

27. Alophophion capacyupanquii new species 

(Figs. 121, 142, 167, 186) 


of the features: propodeum with the longitudinal carinae 

only present apically and the epicnemial carina faint. 


long; imbricate with punctures separated by 0.5–1x a puncture 

width; median portion weakly convex. Clypeus with upper half 

convex and lower half flat; imbricate with punctures separated 

by 1–2x a puncture width; apical edge straight centrally, slightly 

convex laterally. Compound eyes 0.5x as wide as face. Malar 

space 0.2–0.3x as long as basal width of mandible. Gena, in 

lateral view (Fig. 142), 0.8–0.9x as wide as compound eyes, 

softly imbricate texture between punctures. Frons imbricate 

softly striate between central ocelli and toruli. Vertex with 


by 0.7–0.8x ocellar diameter; distance between ocelli 0.9–1.1x 


39

Alvarado 

ocellar diameter. Antenna with 52–53 flagellomeres. Ratio of 


3.1:2.6–2.9:2.3–2.6:2.0–2.6: 2.0–2.5: 2.0–2.4. Ratio of length/ 


Mesosoma.- Pronotum in upper half punctate, imbricate 

with punctures separated by 0.5–1x a puncture width; median 

portion weakly convex; lower half striate. Mesoscutum smooth 

with punctures separated by 1–2x a puncture width. Notaulus 


convex; smooth with punctures separated by 0.5–1x a puncture 

width; lateral carina reaching 0.1x to posterior margin of mesoscutellum. 

Mesopleuron (Fig. 167) smooth with punctures separated 

by 1–1.5x a puncture width; mesopleural furrow absent. 

Epicnemial carina faint; not joining to anterior margin of mesopleuron. 

Metapleuron smooth with punctures separated by 1–2x 

a puncture width. Fore wing with CI=0.5–0.7; ICI=0.4–0.5; 

SDI=1.4–1.5; 1m-cu straight; ramulus absent; Rs+M curved; 

marginal cell apically glabrous; sub-basal cell glabrous. Hind 

wing with 5–6 hamuli on R1 distally; NI=0.8–0.9; cu-a slightly 

curved. Propodeum (Fig. 186) with punctures separated by 

2–3x a puncture width; without transverse carinae; longitudinal 

carinae present apically, faint; pleural carina present. 



Color.- Brownish except following: face laterally, gena, frons 

laterally, vertex, collar, lateral edges of mesoscutum, two longitudinal 

stripes at the level of notaulus, central-apically spot on 

mesoscutum, mesoscutellum, subalar prominence, a diagonal 

stripe on mesopleuron from the anterior edge to the middle, a spot 

on posterior lower mesopleuron, apical half of metapleuron, apical 

third of propodeum, yellowish colored. Wings apically infuscate. 

♂: Similar to female except metapleuron and propodeum 

completely brownish. 

Comments.- One female has, on sub-basal, cell one apical seta 

dorsally. Alophophion capacyupanquii new species is similar to A. 

huascari new species in appearance; they can be distinguished by 

the texture of the face imbricate texture between punctures in A. 

capacyupanquii and smooth in A. huascari. This species was collected 

in Polylepis forest using light trap and yellow pan traps. 

Etymology.- The species epithet "capacyupanqui" refers to 

Cápac Yupanqui the fifth ruler of the Tawantinsuyu. 

Holotype: ♀ “PERU: AY. [Ayacucho] Ayacucho, Chaviña, 

73°53'56.99"W/14°54'20.71"S, 4165m. 06-10.iv.2010. Bosque 

de Polylepis. Pan Trap [yellow]. N. Martinez Leg.” (MUSM). 

Paratypes: 18♂♂, 3♀♀: labeled as follows: 16♂♂ “PERU: AY. 

[Ayacucho] Ayacucho, Chaviña, 14°54'21.49"S/73°53'55.78"W, 

4153m. 05-12.iv.2010. Bosque de Polylepis. N. Martinez Leg. 

[Ligth trap]” (3♂♂, AEIC; 3♂♂, BMNH; 3♂♂, SEMC; 

7♂♂, MUSM); 1♂ “PERU: AY. [Ayacucho] Ayacucho, Chaviña, 

73°53'56.68"W/ 14°54'21.56"S, 4164m. 06-10.iv.2010. 

Bosque de Polylepis. Pan Trap [yellow]. N. Martinez Leg.”; 

and 1♂, 4♀♀ “PERU: AY. [Ayacucho] Ayacucho, Chaviña, 

73°53'56.99"W/14°54'20.71"S, 4165m. 06-10.iv.2010. Bosque 

de Polylepis. Pan Trap [yellow]. N. Martinez Leg.” (1♀ SEMC; 

1♂, 3♀♀ MUSM). 

40 

28. Alophophion carcanchoi new species 

(Figs. 128, 157, 174, 193) 


of the features: the epicnemial carina not well delimited 

laterally and confluent with the mesopleural furrow, and the 

areas dentipara and superomedia with carinate texture. 

Description.- ♀: Head. Face (Fig. 128) 1.0–1.2 x as 

wide as long; smooth with punctures separated by 0.5–1x a 

puncture width; median portion weakly convex. Clypeus with 

upper 2/3 convex and lower 1/3 flat; imbricate with punctures 

separated by 1–2x a puncture width; apical edge slightly 

convex. Compound eyes 0.5–0.6x as wide as face. Malar space 

0.1–0.2x as long as basal width of mandible. Gena, in lateral 

view (Fig. 157), 0.8–1.0x as wide as compound eyes, smooth 

with punctures separated by 3–4x a puncture width. Frons 

imbricate, striate between central ocelli and toruli. Vertex with 





2.8:2.4:2.3:2.2–2.3:2.1–2.2:2.0–2.1. Ratio of length/width of 

pre-apical flagellomeres: 1.3–1.7x. 

Mesosoma.- Pronotum in upper half imbricate with 

punctures separated by 0.5–1x a puncture width; lower half 

striate-carinate. Mesoscutum smooth with punctures separated 

by 1.5–2x a puncture width. Notaulus reaching from 1/4–1/2 

length of mesoscutum, basally scrobiculate. Mesoscutellum 

evenly convex; smooth with punctures separated by 2–3x a 


of mesoscutellum. Mesopleuron (Fig. 174) on upper half smooth 

and lower half imbricate with punctures separated by 0.5–1x a 

puncture width; lower edge of speculum scrobiculate; speculum 


mesopleural furrow scrobiculate weakly develop reaching to 

the posterior-lower margin of mesopleuron. Epicnemial carina 


of pronotum. Metapleuron usually scrobiculate, rarely imbricate 

with punctures separated by 0.5–1x a puncture width. Fore 

wing with CI=0.6; ICI=0.5–0.6; SDI=1.4–1.5; 1m-cu straight; 

ramulus present; Rs+M slightly curved; marginal cell of fore wing 

cover by setae, with a pre-apical glabrous area; sub-basal cell glabrous, 

rarely with one seta apically. Hind wing with 7–8 hamuli 

on R1 distally; NI=0.6; cu-a slightly curved. Propodeum (Fig. 

193) areas spiracularis, lateralis, petiolaris and posteroexterna 

with wavy-rugulose texture, areas dentipara and superomedia 

longitudinally carinate and areas externa and basalis imbricate 

with punctures separated by 0.3–0.7x a puncture width; anterior 


present, reaching pleural carinae; lateral longitudinal carinae 

present, faint; lateromedian longitudinal carinae present, wavy; 




Color.- Testaceous except following: surrounded area to compound 

eyes, between ocelli and subalar prominence yellowish. 

♂: Similar to female. Rarely propodeum predominantly 

smooth with punctures. 



Comments.- There is variation in the mesopleural furrow 

length, from scrobiculate only basally to reaching the posterior 

margin of the mesopleuron, and the metapleuron texture from 

punctate to scrobiculate. Some specimens have mesopleuron 

and metapleuron yellowish. 

Alophophion carcanchoi new species is distributed in the 

Chilean regions of Araucanía, Biobio, Coquimbo, Libertador 

General Bernardo O'Higgins, Los Rios, Maule, Metropolitana 

de Santiago and Valparaíso; and the Argentinean region of Río 

Negro. 

Etymology.- The species epithet "carcancho" refers to the 

legend character mentioned in the central zone of Chile, a man 

covered in hairs that are fed only tubers and walks tirelessly 

through the snow. 


Blanco Chile Luis E. Peña” 

Paratypes: 31♂♂, 184♀♀: labeled as follows: ARGENTI- 

NA: 6 ♀♀: 1♀ “CHILE [Argentina]: R.N. [Río Negro], El 

Bolson. 20.xii.1959. A. Kavocs. B.M.1964-193”; 1♀ “CHILE 

[Argentina]: R.N. [Río Negro], El Bolson. 22.xii.1959 A. Kavocs. 

B.M.1964-193”; 1♀ “CHILE [Argentina]: R.N. [Río Negro], 

El Bolson. 29.xii.1959 A. Kavocs. B.M.1964-193”; 1♀ “CHILE 

[Argentina]: R.N. [Río Negro], El Bolson. 13.ii.1961 A. Kavocs. 

B.M.1964-193”; 1♀ “CHILE [Argentina]: R.N. [Río Negro], 

El Bolson. 30.xi.1961 A. Kavocs. B.M.1964-193”; and, 1♀ 

“CHILE [Argentina]: R.N. [Río Negro], El Bolson. 25.i.1962 

A. Kavocs. B.M.1964-193” (BMNH). CHILE: 31♂♂, 178♀♀: 

1♂ “Angol, Malleco XI.16-21.70 [16-21.xi.1970] Chile T. 

Cekalovic”; 1♂ “Cord. [Cordillera] Lonquimay Chile I.9 1962 

[09.i.1962] Luis Peña/Lago Galletue [38.6833S/71.2833W]”; 

3♂♂, 59 ♀♀ “Curacautín, Malleco II.'64 [ii.1964] R. [Río] 

Blanco Chile Luis E. Peña”; 1♀ “El Coigual, Curico I.21-25.64 

[21-25.i.1964Chile Luis E. Peña”; 1♀ “El Coigual, Curico I.21- 

25.64 [21-25.i.1964] Chile Luis E. Peña”; 1♀ “[Libertador General 

Bernardo O'Higgins ] El Marchan, Chile III.1971 [iii.1971] 

Chillán Luis Peña”; 1♂, 11♀♀ “El Pangue, Coquimbo, Chile 

Oct. 27, 1961 [27.x.1961] Luis Peña”; 2♀♀ “Enco, Valdivia 

II.24.78 [24.ii.78] Chile Luis Peña”; 1♂, 1♀ “Estero La Jaula 

Los Quenes Curico I.4-18.64 [04-18.i.1964] Chile Luis E. Peña”; 

1♂, 2♀♀ “Hualpén, Concep. XII.26.70 [26.xii.1970] Chile T. 

Cekalovic”; 4♂♂, 3♀♀ “Concepción, Chile Quebrada Pinares 

II-III. 1967 [ii-iii.1967] T. Cekalovic”; 1♀ “[Biobío, Ñuble] Las 

Trancas Chile Jan.1968 Cord. [Cordillera] Chillán Luis Peña”; 

1♂, 2♀♀ “[Biobío, Ñuble] Las Trancas Chillán Chile Jan.1967 

[i.1967] Peña [L. Peña]”; 1♂, 2♀♀ “[Biobío, Ñuble] Las Trancas, 

Chile II.6-11.66 [06-11.ii.1966] Chillán Luis Peña”; 2♂♂, 7♀♀ 

“[Biobío, Ñuble] Las Trancas, Chile I-II.71 [i-ii.1971] Chillán 

Luis Peña”; 1♂, 2♀♀ “[Biobío, Ñuble] Las Trancas, Chile I- 

III.1972 [i-iii.1972] Chillán Luis Peña”; 2♂♂ “[Biobío, Ñuble] 

Las Trancas, Chile XII.1-15.75 [01-15.xii.1975] Chillán Luis 

Peña”; 1♀ “Macul, Stgo. [Metropolitana de Santiago, Santiago] 

IX.'74 [ix.1974] Chile Luis E. Peña”; 1♀ “3 km. E. Las Trancas, 

Ñuble, Chile I.16.67 [16.i.1967] Lionel Stange”; 10♀♀ “Pino 

Hachado [Paso de Pino Hachado] Lonquimay, Mal. [Malleco] 

II.18.80 [18.ii.1980] Chile 1600m. L. Peña”; 1♀ “Piscicultura, 

Chile R. [Río] Blanco, Aconcagua XI.10.64 [10.xi.1964] 1600m. 

Luis Peña”; 1♀ “Q. Sn. Ramón [Quebrada de San Ramón], 

Stgo. [Metropolitana de Santiago, Santiago] XII.'74 [xii.1974] 

Chile Luis Peña”, 1♂ “Rio Blanco III.5-27.195- Chile L Pena 


Guzman [Peña Guzmán]”; 6♀♀ “Rio Blanco, Aconcagua, Chile 

Dec. 5-8, 1961 [05-08.xii.1961] Luis Peña”; 4♀♀ “Río Blanco, 

C-tín [Curacautín] I.'74 [i.1974] Chile Luis Peña”; and 2♀♀ 

“Río Blanco, Cura. [Curacautín] Jan.1974 [i.1974] Chile Luis 

Peña” (AEIC). 3♀♀ “CHILE: IX Region [Araucanía] Lago 

Icalma nr. Icalma I. 1980 J.E. Barriga”; 1♂, 18♀♀ “CHILE: 

Prov. [Provincia] Curico 10km w. Licanten 20.XII.1993 JEBarriga 

[J.E. Barriga] & LPeralta [& L. Peralta] at light”; 25♀♀ 

“CHILE: CURICO Licancel, Licnateú [Licantén] 22.XII.1993 

JEBarriga [J.E. Barriga] & LPeralta [& L. Peralta] black ligth”; 

11♀♀ “CHILE: CURICO Licancel, Licnateú [Licantén] 

22.XII.1993 [22.xii.1993] L. Peralta”; 1♂ “CHILE: VII Región 

cordillera de Chillan 80 km ese. Chillan 10.XII.1993 E. Arias”; 

1♂ “CHILE: VIII Region Shangrilla 24.XI.1994 SEHeydon 

[S.E. Heydon] & EArias [E. Arias]”; 1♀ “CHILE: Los Angeles 

22.XII.1996 E. Arias”; and 1♀ “CHILE: CAUTIN Parque Los 

Pacaguas 1.XII.1984 JE Barriga [J.E. Barriga]”(UCDC). 1♂, 

1♀ “CHILE: Termas de Chillan 15.i.1985 I.D. Gauld 1600m., 

Nothofagus”; 2♀♀ “CHILE: Trata Victoria. 24.iii.1961. A. 

Kovacs. B.M. 1964-193.”; 1♂ “CHILE: [Biobio] Lago Laja 

19.i.1985 I.D. Gauld” (BMNH). 1♂ “MUSEUM PARIS CHILI 

[Chile] VALPARAISO R. MARTIN 1992/ OCTOBRE”; and 

1♀ “Chile EC Reed/Ophion luteus/Ophion bilineatus Say det. 

C.W. Hooker IV.2.1909” (USNM). 

29. Alophophion chavinaensis new species 

(Fig. 137, 158, 164, 203) 


of the features: propodeum with the transverse carinae 

well develop and fore wing with ramulus present. 


long; smooth with punctures separated by 1–2x a puncture 

width; median portion weakly convex. Clypeus with upper 

2/3 slightly convex, smooth with shallow punctures separated 

by 2–3x a puncture width; and lower 1/3 flat, imbricate with 

shallow punctures separated by 2–3x a puncture width; median 

portion weakly convex; apical edge straight centrally, slightly 

convex laterally. Compound eyes 0.6x as wide as face. Malar 


view (Fig. 158), 0.7x as wide as compound eyes; smooth with 

shallow punctures separated by 1–2x a puncture width. Frons 

imbricate softly striate between central ocelli and toruli. Vertex 




from first to seventh flagellomeres: 5.6:3.5:3.1:2.9:2.8:2.7:2.6. 


Mesosoma.- Pronotum softly striate with shallow punctures 

separated by 3–4x a puncture width. Mesoscutum smooth with 

punctures separated by 3–4x a puncture width. Notaulus extending 

0.5x length of mesoscutum. Mesoscutellum smooth with 

punctures separated by 3x a puncture width; lateral carina reaching 

0.2x to posterior margin of mesoscutellum. Mesopleuron 

(Fig. 164) smooth with punctures separated by 1–2x a puncture 




smooth with punctures separated by 3–4x a puncture width. 

41

Alvarado 

Fore wing with CI=0.4; ICI=0.4; SDI=1.6; 1m-cu softly curved; 

ramulus present; Rs+M softly sinuate; marginal cell apically 

glabrous; sub-basal cell glabrous. Hind wing with 7 hamuli on 

R1 distally; NI=0.8; cu-a slightly curved. Propodeum (Fig. 203) 

with shallow punctures separated by 3–4x a puncture width; 

anterior transverse carina present between lateral longitudinal 

carinae, centrally strongly curved; posterior transverse carina 

present, reaching pleural carinae; lateromedian carinae faint, 

present behind posterior transverse carina; lateral longitudinal 

carinae faint before posterior transverse carinae, well defined 

after posterior transverse carina; smooth between punctures; 




Color.- Testaceous except following: face laterally, gena, frons 

laterally, vertex, collar, lateral edges of mesoscutum, two longitudinal 

stripes at the level of notaulus, central-apically spot on 

mesoscutum, mesoscutellum and subalar prominence yellowish 

colored; and, ovipositor brownish. Wings hyaline. 

♂: unknown. 

Comments.- This species was described with a single specimen, 

because it occurs in the same locality as A. capacyupanquii, 

A. huascari, A. yupanquii and A. wiracochai, this will help to 

avoid confusing it with species distributed in the same locality. 

Etymology.- The specific epithet is based on Chaviña the 

type locality. 


14°54'21.49"S/73°53'55.78"W, 4153m. 05-12.iv.2010. Bosque 

de Polylepis. N. Martinez Leg. [Light trap] (MUSM). 

42 

30. Alophophion chilensis (Spinola 1851) 

(Figs. 118, 140, 162, 202) 

Ophion chilensis Spinola, 1851: 515. [description]; Dalla 

Torre, 1902: 188 [listed]; Hooker, 1912: 39. [translation of 

original description, key]; Morley, 1912: 55. [description, key]; 

Alophophion chilensis Cushman, 1947: 440 [genotype, generic 

transfer]; Townes & Townes, 1966:171 [listed]; Yu & Horstmann, 

1997: 730 [listed]. 

Diagnosis.- This species is easy to distinguish by the presence 

of the areas superomedia and dentipara enclosed by carinae, 

and body predominantly olive green colored with the legs 

ferruginous. 


smooth with punctures separated by 1–1.5x a puncture width; 

median portion weakly convex. Clypeus slightly convex; upper 

half smooth with punctures separated by 5x a puncture width; 

lower half imbricate with punctures separated by 3–5x a puncture 

width; apical edge straight centrally, curved laterally. Compound 

eyes 0.6x as wide as face. Malar space 0.1–0.2x as long as basal 

width of mandible. Gena, in lateral view (Fig. 140), 0.6–0.7x 

as wide as compound eyes, smooth with punctures separated by 

3–4x a puncture width. Frons striate between antennae and median 





3.7–4.2:2.4–2.4:2.1–2.3:2.0:1.9–2.0:1.8–1.9:1.7–1.9. Ratio of 



separated by 1–1.5x a puncture width; lower half striate-carinate; 

lower half of collar striate. Mesoscutum with punctures separated 

by 1–2x a puncture width, rarely imbricate between punctures 

in posterior half. Notaulus extending 0.3x length of mesoscutum, 

finely scrobiculate basally. Mesoscutellum evenly convex, 



Mesopleuron (Fig. 162) with upper half smooth and lower 

half imbricate with punctures separated by 1.5–2x a puncture 

width; lower edge of speculum usually with texture as upper 

half of mesopleuron, in some specimens with anterior half of 

speculum softly scrobiculate; mesopleural furrow absent or small 

and rarely reaching to posterior lower mesopleuron. Epicnemial 


quarter of pronotum. Metapleuron punctate, smooth between 

punctures, some specimens with punctate-rugulose texture in 

the lower half. Fore wing with CI=0.4–0.5; ICI=0.7; SDI=1.4; 


basally cover by setae; sub-basal cell glabrous. Hind wing with 

7 hamuli on R1 distally; NI=0.7–1.0; cu-a curved. Propodeum 

(Fig. 202) with anterior and posterior transverse carina present; 

lateral longitudinal carinae present, faint; lateromedian longitudinal 

carinae between transverse carinae present and well 

defined; area petiolaris and area posteroexterna continuous, 

longitudinally striate; area spiracularis and area lateralis continuous, 

transversally striate; area basalis smooth with punctures 

separated by 1–1.5x a puncture width; pleural carinae present. 




antennae, frons centrally, mesosternum, legs, lateral and apical 

metasomal tergites III to VI, and ovipositor sheath ferruginous. 

♂: Similar to female, face slightly wider 1.1x as wide as long. 

Comments.- Bigger specimens usually are greener and 

mesopleural furrow extending longer than smaller specimens; 

instead of having smooth texture as in small specimens, they 

have imbricate texture in the bigger specimens. 

Hooker (1912) re-described the species and mentioned that 

the localization of the type was unknown for him; Townes & 

Townes (1966) in their catalogue and reclassification of the 

Neotropic Ichneumonidae also mentioned that the type was 

lost; Casorali & Casorali Moreno (1980) assembled a catalogue 

of the Hymenoptera types of Massimiliano Spinola and in that 

document A. chilensis is not listed; therefore the type specimen 

is considered lost. Here is not designed a neotype, the species is 

easily differentiable from the rest of species of this species-group 

by the feature mentioned in the diagnosis. 

Hooker (1912) translated the original description of the species; 

and studied numerous specimens from “Largo Blanco Valle, 

Chubut Territory, Patagonia, Argentina”. He determinated them 

as A. chilensis, mentioning that there were some variations in the 

color, the size and presence of ramulus. I revised this material 

and none of them belong to A. chilensis, there are at least four 



species between them are A. politus, A. carcanchoi new species, 

A. diaguita new species and an undetermined species. 

Spinola (1851) mentioned as locality Chili. Alophophion chilensis 

is distributed in the Chilean regions of Atacama, Coquimbo 

and Valparaiso. This provides a more accurate distribution 

for the species, previously known only as Chile; the range of 

elevation where it is distributed ranges from sea level to 1600 m. 

Non type examined material: 3♂♂, 38♀♀, 2??: labeled as 

follows: CHILE: 2♀♀, 2♂♂ “Huasco, Atacama Pr. [Province], 

x.20-22.57 [20-22.x.1957], Chile L Pena [Peña] Guzman [Guzmán]”; 

4♀♀ “S. Pedro deQuile [San Pedro de Quiles],Coquimbo 

[Región], nov. 16-17, 1961 [16-17.x.1961], Luis Pena [Luis 

Peña]”; 3♀♀ “El Pangue, Coquimbo [Región],Chile, xi.4 

1961[4.xi.1961], Luis Peña; 1♀ “El Pangue, Coquimbo 

[Región],Chile, x.23 1961[23.x.1961], Luis Peña; 3♀♀ “El 

Pangue, Coquimbo [Región],Chile, xi.3-5 1961[3-5.xi.1961], 

Luis Peña; 14♀♀ “Rio Los Choros, Coquimbo [Región],Chile, 

x.29-30 1961[4.xi.1961], Luis Peña; 3♀♀ “Vicuna [Vicuña]/ 

Pangue, Coquimbo [Región],Chile, xi.2-3.61 [2-3.xi.1961], 

Luis Peña; 1♂ “Rivadavia, Elqui Valley, Coquimbo [Región], 

x.28-29.57 [28-29.x.1957], Chile, L Pena [Luis Peña] Guzman”; 

1♀ “CHILE: Prov. [Province] Elqui Choros Bajos 25.X.1988 

[25.x.1988] JEBarriga [J.E. Barriga]”; 1♀ “Rivadavia, Elqui 

Valley, Coquimbo [Region], v.16.53 [16.v.1953], Chile, L Pena 

[Luis Peña] Guzman”; 1♀ “Q.[Quebrada] Chañaral, Coquimbo 

[Region] 300 m, x.23.57 [23.x.1957], Chile, L Pena [Luis Peña] 

Guzman”; 2♀♀ “Rio Blanco, Aconcagua [Valaparaiso Region], 

Chile, Dec. 5-8, 1961 [5-8.x.1961], Luis Peña; 1♀ “Piscicultura, 

Chile, R. [Río] Blanco, Aconcagua, XI.10.64 [10.xi.1964], 1600 

m. Luis E. Peña”1♀ “Los Molles, [Valparaiso Region], XI.20.65 

[20.xi.1965], Chile, Luis Peña” (AEIC) and 1♀,2?? [metasoma 

lost] “Chili, 28 08 [reverse of label, 28 in the line and 08 below]” 

(BMNH). 1♀ “CHILE: Prov. [Province] Elqui Choros Bajos 

25.X.1988 JEBarriga [J.E. Barriga]” (UCDC). 

31. Alophophion chiquiyane new species 

(Figs. 136, 153, 182, 201) 

Diagnosis.- This species is the only one in the Species-group 

C that has the propodeal carinae lamellate. It is quite similar 

to A. trauco new species but can be distinguish of them by the 

presence of a glabrous area in the marginal cell next to pterostigma, 

beside of the head proportions. 


smooth with punctures separated by 1–1.5x a puncture width; 

median portion weakly convex. Clypeus convex; imbricate with 

punctures separated by 2–3x a puncture width; apical edge centrally 

straight, laterally slightly convex. Compound eyes 0.6–0.7x 

as wide as face. Malar space 0.1–0.2x as long as basal width of 

mandible. Gena, in lateral view (Fig. 153), 0.7–0.8x as wide as 

compound eyes; smooth with punctures separated by 1–3x a 

puncture width. Frons smooth, slightly striate between antennae 

and median ocellus. Vertex with texture as gena. Lateral ocellus 




flagellomeres: 4.7–4.8:2.3:2.1–2.2:2.1:2.0–2.1:1.9–2.1:1.8–2.0. 




separated by 1–1.5x a puncture width; lower half carinate; collar 

striate. Mesoscutum smooth laterally and imbricate centrally 

with punctures separated by 1–1.5x a puncture width Notaulus 

extending 0.3x length of mesoscutum, scrobiculate. Mesoscutellum 

evenly convex, without lateral carina; smooth with punctures 

separated by 2–4x a puncture width. Mesopleuron (Fig. 182) 

imbricate with punctures separated by 1–1.5x a puncture width, 

except smooth between punctures upper epicnemial carina; 

lower edge of speculum finely scrobiculate; mesopleural furrow 

scrobiculate-rugulose reaching to posterior edge. Epicnemial 


third of pronotum; forming an angulation between mesopleuron 

and mesosternum. Metapleuron rugulose. Fore wing with 

CI=0.6–0.8; ICI=0.8; SDI=1.3–1.6; 1m-cu straight; ramulus 

present, small, sometimes only as an angulation; Rs+M slightly 

curved; marginal cell basally glabrous next to vein Rs+2r and 

pterostigma; sub-basal cell glabrous with a row of setae next to 

1A. Hind wing with 6 hamuli on R1 distally; NI=0.8–1.4; cu-a 

slightly curved. Propodeum (Fig. 201) shiny, slightly carinate 

texture except areas basalis and externa smooth with punctures 

separated by 2–3x a puncture width; carinae lamellate; transverse 

carinae present reaching pleural carinae; longitudinal carinae 

present; lateromedian longitudinal carinae confluent behind 

posterior transverse carina; pleural carina present. 



Color.- Testaceous except following: surrounding area of 

compound eyes, between ocelli, vertex and in some specimens 

subalar prominence yellowish. Wings grayish hyaline; veins 

brownish and pterostigma fulvous. 

♂: Unknown. 

Comments.- Alophophion chiquiyane new species was consider 

in the Species-group C, but seems to be closely related with 

A. trauco new species. They share the same structure of the propodeal 

carinae, lamellate. Beside, its distribution overlaps with the 

other two species. This species is distributed in the Argentinean 

region of Neuquen and the Chilean region of Araucania. 

Etymology.- The species epithet "chiquiyane" refers to the 

nomadic tribe Chiquiyanes that inhabited the central area of 

the present territory of Chile, highlands between Los Andes 

and Chillán and in the Argentinean province of Mendoza. It is 


Holotype: ♀ “Pino Hachado [Paso de Pino Hachado] Lonquimay, 

Mal. [Malleco] II.18.80 [18.ii.1980] Chile 1600m. L. 

Peña” (AEIC). 

Paratypes: 3♀♀: labeled as follows: ARGENTINA: 1♀ “Pto. 

[Puerto] Aqua, L. [Lago] Traful Neuquen, Argentina January 

30, 1968 [30.x.1968] L & J Stange” (AEIC). CHILE: 2♀♀ 

“Curacautín, Malleco II.'64 [ii.1964] R. [Río] Blanco Chile 

Luis E. Peña” (AEIC). 

32. Alophophion coquimboensis new species 

(Figs. 138, 159, 165, 204) 


of features: propodeum with area superomedia not well defined, 

43

Alvarado 

fore wing with marginal cell basally glabrous next to proximal half 

of Rs+2r and predominantly light straw yellow colored. 


long; median portion weakly convex; imbricate with punctures 

separated by 0.3–0.6x a puncture width. Clypeus imbricate with 

punctures separated by 1.0–2.0x a puncture width; upper half 

convex and lower half flat; apical edge slightly curved. Compound 

eyes 0.6x as wide as face. Malar space 0.1–0.2x as long 

as basal width of mandible. Gena, in lateral view (Fig. 159), 

0.7x as wide as compound eyes, softly imbricate with shallow 

punctures separated by 2.0–3.0x a puncture width. Frons imbricate, 

softly striate between central ocelli and toruli. Lateral 


distance between ocelli 0.8x ocellar diameter. Antenna with 


flagellomeres: 4.8:2.8–2.7:2.4:2.3:2.2:2.1:2.0. Ratio of length/ 




scrobiculate and lower collar striate. Mesoscutum smooth with 

punctures separated by 0.5–1.0x a puncture width. Notaulus 


convex, smooth with punctures separated by 2.0–3.0x a puncture 

width; lateral carina reaching 0.1x to posterior margin of mesoscutellum. 

Mesopleuron (Fig. 165) smooth on upper half and 

imbricate on lower half with shallow punctures separated by 

0.5–1.0x a puncture width; speculum smooth with punctures 

separated by 2.0–3.0x a puncture width; lower edge of speculum 

softly scrobiculate; mesopleural furrow rugulose, short reaching 

to anterior third of mesopleuron. Epicnemial carina curved 

to meet anterior margin of mesopleuron at lower quarter of 

pronotum. Metapleuron imbricate with punctures separated 

by 0.5–1.0x a puncture width. Fore wing with CI=0.5–0.6; 

ICI=0.5–0.6; SDI=1.5–1.7; 1m-cu slightly curved; ramulus 

present; Rs+M curved; marginal cell basally glabrous next to 

proximal half of Rs+2r; sub-basal cell usually without setae, at 

most with one seta. Hind wing with 7–8 hamuli on R1 distally; 

NI=0.9–1.0; cu-a softly curved. Propodeum (Fig. 204) with 

wavy-longitudinal carinate texture, except area externa smooth 

with punctures separated by 1.0–2.0x a puncture width; anterior 

transverse carina present between lateral longitudinal carinae; 

posterior transverse carina present between pleural carinae; longitudinal 

carinae present, well defined before anterior transverse 

carina and faint between transverse carinae, and defined after 

posterior transverse carina; pleural carina present. 



Color.- Light straw yellow except following: mandibles, 

frons, antennae, occiput, a lateral spot (surrounded by a light 

straw yellow) and one between notauli to 3/4 of mesoscutum, 

mesopleuron, legs and metasoma testaceous. 

♂: Similar to female except following: mesopleural furrow 

absent and texture of propodeum smoother than in females. 

Comments.- There are variations in the structure of lateromedian 

longitudinal carinae behind posterior transverse, some 

specimens have the two carinae independent straight or wavy 

and/or has an additional carina between them. 

Etymology.- The specific epithet is based on Coquimbo 

the type locality. Holotype: ♀ “Río Los Chores [Los Choros], 

Coquimbo, Chile X.29-30 1961[29-30.x.1961] Luis Peña” 

Paratypes: 3♂♂, 19♀♀: labeled as follows: CHILE: 3♂♂, 

9♀♀ “[CHILE: Coquimbo, Valle de Elqui, Las Hedionditas 

[Las Hediondas] I.10-11.66 [10-11.i.1965] Chile Luis Peña”; 

2♀♀ “Río Los Chores [Los Choros], Coquimbo, Chile X.29- 

30 1961[29-30.x.1961] Luis Peña”; 2♀♀ “Rivadavia Elqui 

valley Coquimbo X.28-29.57 Chile L Pena Guzman [Peña 

Guzmán]”; 1♀ “Rio Turbio Prov. Coquimbo CHILE 1600m. 

Oct. 29, 1957 [29.x.1957] L.E Pena [Peña]”; 1♀ “Copiapó, 

Atac. [Atacama] X.3.80 [03.x.1980] Chile Luis Peña”; 1♀ “El 

Canelo Santiago Chile XI-1950 L. Pena [Peña]”; 1♀ “[Biobío, 

Ñuble] Las Trancas, Chile XII.1-15.75 [01-15.xii.1975] Chillán 

Luis Peña” and, 2♀♀ “El Marchan, Chile III.1971 [iii.1971] 

Chillán Luis Peña” (AEIC). 

33. Alophophion huascari new species 

(Figs. 132, 147, 176, 195, 210) 


of the features: propodeum with the posterior transverse 

carina present only laterally, ramulus present, face smooth and 

brownish colored. 


smooth with punctures separated by 1.5–2x a puncture width, 

except on area bellow toruli imbricate with punctures separated 

by 0.5x a puncture width; median portion weakly convex. Clypeus 

with upper half convex, smooth with punctures separated 

by 2–3x a puncture width; and lower half flat, imbricate with 

punctures separated by 0.5–1x a puncture width; apical edge 

centrally slightly concave. Compound eyes 0.5–0.6x as wide 


Gena, in lateral view (Fig. 147), 0.7x as wide as compound eyes, 


Frons smooth, softly striate between antennae and median ocellus. 

Vertex with texture as gena. Lateral ocellus separated from 

compound eye by 0.5–0.6x ocellar diameter; distance between 



5.3:2.9–3.0:2.4–2.6:2.4–2.6:2.2:2.2:2.2. Ratio of length/width 

of pre-apical flagellomeres: 1.3–1.6x. 

Mesosoma.- Pronotum smooth with punctures separated by 

1.5–2x a puncture width. Mesoscutum smooth with punctures 


length of mesoscutum, punctate. Mesoscutellum evenly convex, 




by 1.5–2x a puncture width; speculum smooth with punctures 

separated by 3–4x a puncture width; mesopleural furrow 

scrobiculate, small, usually not reaching to mid mesopleuron, 

rarely absent. Epicnemial carina not reaching anterior margin 

of mesopleuron. Metapleuron smooth with punctures separated 

by 4–5x a puncture width. Fore wing (Fig. 210) with CI=0.5; 

ICI=0.5; SDI=1.3–1.4; 1m-cu slightly sinuate; ramulus present; 

Rs+M slightly curved; marginal cell apically glabrous next to 

Rs+2r vein and pterostigma; sub-basal cell glabrous except api- 

44 



cally with isolate setae. Hind wing with 6 hamuli on R1 distally; 

NI=0.9–1.0; cu-a slightly curved. Propodeum (Fig. 195) smooth 

with punctures separated by 1–2x a puncture width; anterior 

transverse carina present, faint laterally; posterior transverse and 

lateromedian longitudinal carinae absent; lateral longitudinal 

carina present only apically; pleural carina present. 



Color.- Brownish except following: surrounding area of 

compound eyes, face centrally, gena, collar, lateral edges of 

mesoscutum, two longitudinal stripes at the level of notaulus, a 

longitudinal stripe at the center reaching to 2/3 length of mesoscutum, 

mesoscutellum laterally, subalar prominence, a diagonal 

stripe of mesopleuron, apical half of metapleuron, apical edge of 

tergites III–VII and legs brownish-cream colored. Wings hyaline, 

apically infuscate; veins and pterostigma brownish. 

♂: Similar to female; except some variation in face proportions 

1.0–1.2x as wide as long. 

Comments.- Alophophion huascari new species is similar 

in appearance to A. capacyupanquii new species. They can be 

distinguished by the presence of anterior transverse carinae in A. 

huascari new species. This species was collected in Polylepis forest. 

Etymology.- The species epithet "huascari" refers to Huascar 

the twelfth ruler of the Tawantinsuyu. 


14°54'21.36"S/ 73°53'56.87"W, 4170m. 06-10.iv.2010. Bosque 

de Polylepis. Pan trap [yellow]. N. Martinez Leg.” (MUSM). 

Paratypes: 3♂♂, 1♀ labeled as follows: PERU: 

3♂♂ “PERU: AY. [Ayacucho] Ayacucho, Chaviña, 

14°54'21.49"S/73°53'55.78"W, 4153m. 05-12.iv.2010. 

Bosque de Polylepis. N. Martinez Leg. [Light trap]”; and 1♀ 

“PERU: AY. [Ayacucho] Ayacucho, Chaviña, 14°54'21.36"S/ 

73°53'56.98"W, 4170m. 07-10.iv.2010. Bosque de Polylepis. 

N. Martinez Leg. [Light trap]” (MUSM). 

34. Alophophion huaynacapaci new species 

(Fig. 139, 160, 183, 205) 


of the features: gena, in lateral view, narrow, 0.6x as wide as 

compound eyes; and lateral ocellus separated from compound 

eye by 0.4x ocellar diameter. 


smooth with shallow punctures separated by 2.0x a puncture 

width; median portion weakly convex; punctate-striate before 

toruli and next to compound eyes. Clypeus with upper 2/3 

slightly convex, smooth with shallow punctures separated by 

4.0x a puncture width; and lower 1/3 flat, imbricate with shallow 

punctures separated by 4.0x a puncture width; median portion 

weakly convex; apical edge straight centrally, slightly convex 

laterally. Compound eyes 0.6x as wide as face. Malar space less 

than 0.1x as long as basal width of mandible. Gena, in lateral 

view (Fig. 160), 0.6x as wide as compound eyes, smooth with 

shallow punctures separated by 4x a puncture width. Frons imbricate, 

slightly convex between central ocelli and toruli. Vertex 




from first to seventh flagellomeres: 5.1:2.7:2.4:2.3:2.1: 2.0:1.9. 


Mesosoma.- Pronotum in upper half smooth with shallow 

punctures separated by 4x a puncture width; lower half imbricate 

with shallow punctures separated by 3–4x a puncture width. 

Mesoscutum with shallow punctures separated by 4x a puncture 

width. Notaulus extending 0.3x length of mesoscutum. Mesoscutellum 

evenly convex; punctate; lateral carina reaching 0.1x 


softly imbricate with shallow punctures separated by 1.0–3.0x a 

puncture width; lower edge of speculum with proximal half finely 

scrobiculate; epicnemial carina curved to meet anterior margin of 

mesopleuron at lower quarter of pronotum; mesopleural furrow 

absent. Metapleuron softly imbricate with shallow punctures 

separated by 1–3x a puncture width. Fore wing with CI=0.5; 

ICI=0.4; SDI=1.4; 1m-cu softly sinuate; ramulus absent; Rs+M 

softly sinuate; marginal cell apically glabrous next to pterostigma 

and Rs+2r; sub-basal cell with isolated setae distributed in the 

apical quarter. Hind wing with 6 hamuli on R1 distally; NI=0.8; 

cu-a slightly curved. Propodeum (Fig. 205) with softly rugose, 

shiny; anterior transverse carina present between lateral carinae, 

stronger centrally and faint laterally; posterior transverse carina 

complete reaching pleural carina, faint; lateral longitudinal carinae 

faint; lateromedian longitudinal carinae absent. 

Metasoma. First tergite 4.2x as long as apical width. Tergite 


Color.- Brownish except following: face, gena, frons laterally, 

vertex, collar, anterior-lateral of pronotum, lateral edges of 

mesoscutum, two longitudinal stripes at the level of notaulus, 

central-apically spot on mesoscutum, mesoscutellum, subalar 

prominence, a diagonal stripe on mesopleuron from the anterior 

edge to the middle, apical half of metapleuron, area coxalis 

yellowish colored; and antennae and frons centrally testaceous. 

Wings hyaline. 

♂: Unknown. 

Comments.- This species was described with a single specimen, 

because it occurs in the same locality as A. maytacapaci, 

A. lloqueyupanquii and A. pachacutii, this will help to avoid 

confusing it with species distributed in the same locality. 

Etymology.- The species epithet "huaynacapaci" refers to 

Huayna Cápac the eleventh ruler of the Tawantinsuyu. 


14°50'44.1"S/ 74°44'13.4"W. 2100m. 14.ii.2009 Light Trap. 


35. Alophophion incarocai new species 

(Figs. 122, 143, 168, 187, 207) 

Diagnosis.- This species can be recognized by the presence 

of a row of setae parallel to the M+Cu in sub-basal cell of fore 

wing, and the propodeum with the anterior transverse carina 

present centrally. 


imbricate with punctures separated by 0.3–0.8x a puncture wi- 


45

Alvarado 

dth; median portion weakly convex. Clypeus convex; imbricate 

with punctures separated by 0.5–1x a puncture width; apical 

edge almost truncate, laterally slightly convex. Compound eyes 


of mandible. Gena, in lateral view (Fig. 143), 0.9x as wide as 

compound eyes; imbricate with punctures separated by 1x a 

puncture width. Frons imbricate, striate between central ocelli 

and toruli. Vertex with texture as gena. Lateral ocellus separated 


ocelli 0.8x ocellar diameter. Antenna with 59 flagellomeres. 


6.3:3.4:3.0:2.8:2.6:2.5:2.4. Ratio of length/width of pre-apical 

flagellomeres: 1.8x. 

Mesosoma. Pronotum imbricate with punctures separated by 

0.5–1x a puncture width; lower half softly striate. Mesoscutum 


Notaulus extending 0.2x length of mesoscutum. Mesoscutellum 

evenly convex, imbricate with punctures separated by 1–1.5x a 


of mesoscutellum. Mesopleuron (Fig. 187) imbricate with 

punctures separated by 0.3–0.8x a puncture width; mesopleural 




Fore wing (Fig.207) with CI=0.5; ICI=0.6; SDI=1.4; 1m-cu 

straight; ramulus absent; Rs+M slightly curved; fenestra with 

comma shape; marginal cell cover by setae; sub-basal cell with 

a row of setae parallel to the M+Cu vein and triangular area 

formed by 1A and cu-a cover by setae. Hind wing with 6 hamuli 

on R1 distally; NI=0.6; cu-a slightly curved. Propodeum (Fig. 

187) imbricate with punctures separated by 0.3–0.8x a puncture 

width, softly striate longitudinally; anterior transverse carina 

present centrally; posterior transverse carina absent centrally, 

laterally present; longitudinal carinae present apically; pleural 




Color.- Reddish brown except following: surrounded area to 

compound eyes and between ocelli cream colored. 

♂: Similar to female except following: hind wing with 5–6 

hamuli on R1 distally; gena, occiput, tegula, lateral edges of 

mesoscutum, two longitudinal stripes at the level of notaulus, 

central-apically spot on mesoscutum and mesoscutellum cream 

colored; and, lateral longitudinal carinae longer, almost reaching 

anterior transverse carina. 

Comments.- One male has same color as female. Alophophion 

incarocai new species has similar appearance than A. yahuarhuacaci 

new species in structure both have the propodeum with the 

anterior transverse carina present centrally, the ramulus absent 

and the mesopleural furrow absent, but they can be distinguish 

by the presence of a row of setae parallel to the M+Cu vein in 

sub-basal cell of fore wing in Alophophion incarocai new species. 

All the specimens were collected in Polylepis forest; most of the 

specimens were collected using light traps. 

Etymology.- The species epithet "incarocai" refers to Inca 

Roca the sixth ruler of the Tawantinsuyu and first inca. 

46 


14°54'21.49"S/73°53'55.78"W, 4153m. 05-12.iv.2010. Bosque 

de Polylepis. N. Martinez Leg. [Light trap]” (MUSM) 

Paratypes: 7♂♂, labeled as follows: 6♂♂; “PERU: AY. [Ayacucho] 

Ayacucho, Chaviña, 14°54'21.49"S/73°53'55.78"W, 

4153m. 05-12.iv.2010. Bosque de Polylepis. N. Martinez Leg. 

[Light trap]” (2♂♂MUSM, 1♂ AEIC, 1♂ BMNH, 2♂♂ 

SEMC); and 1♂ “PERU: AY. [Ayacucho] Ayacucho, Chaviña, 

14°54'21.00"S/ 73°53'56.48"W, 4070m. 05-12.iv.2010. Bosque 

de Polylepis. T. [Trap] Malaise 1. N. Martinez Leg.” (MUSM). 

36. Alophophion larseni (Enderlein, 1912) 

(Figs. 119, 141, 163, 184) 

Ophion larseni Enderlein, 1912:41. [description]; Townes & 

Townes, 1966:170. [listed]. 

Ophion occidentalis Morley, 1912: 57. [description, key]. 

Alophophion occidentalis Townes & Townes, 1966:171. 

Lectotype ♀ BMNH [generic transfer, lectotype designation, 

list]; Gauld & Lanfranco, 1987:263. [generic transfer]; Gauld 

& Lanfranco, 1987:263. [synonymized with A. larseni]; and 

Alophophion larseni Gauld & Lanfranco, 1987:263; Yu & 

Horstmann, 1997: 730 [listed]. 

Diagnosis.- Alophophion larseni has transverse carinae faint, 

lateral longitudinal carinae absent but lateromedian longitudinal 

carinae well defined. 

Description.- ♀: Head. Face (Fig. 119) 1.1–1.2 x as wide as 

long; median portion weakly convex; centrally smooth and laterally 

imbricate, with punctures separated by 0.5–1x a puncture 

width. Clypeus slightly convex; centrally smooth and laterally 

imbricate, with punctures separated by 1–1.5x a puncture width 

apical edge straight. Compound eyes 0.4–0.5x as wide as face. 

Malar space 0.3x as long as basal width of mandible. Gena, in 

lateral view (Fig. 141), 0.7x as wide as compound eyes, smooth 

with punctures separated by 2–3x a puncture width. Frons finely 

striate. Vertex with texture as gena. Lateral ocellus separated from 


ocelli 0.7–1.0x ocellar diameter. Antenna with 51–56 flagellomeres. 


4.3–4.7:2.2–2.4:2.0:1.9:1.8–1.9:1.7–1.8:1.7. Ratio of length/ 



separated by 0.5–1x a puncture width and lower half and dorsal 

to collar striate. Mesoscutum smooth with punctures separated 

by 1x a puncture width. Notaulus extending 0.5x length of 

mesoscutum, finely scrobiculate. Mesoscutellum evenly convex; 




by 1–2x a puncture width; speculum smooth with punctures 

separated by 2–3x a puncture width, with proximal half finely 

scrobiculate; mesopleural furrow short, rugulose. Epicnemial 


third of pronotum. Metapleuron smooth with punctures separated 

by 1–2x a puncture width, except posterior half softly 

carinate. Fore wing with CI=0.4; ICI=0.8; SDI=1.3–1.4; 1mcu 

slightly curved; ramulus present, sometimes small; Rs+M 

curved; marginal cell homogeneously cover by setae; sub-basal 



cell with setae apically, distributed in a triangular area next to 

the intersection between veins 1A and cu-a. Hind wing with 7 

hamuli on R1 distally; NI=0.9–1.0; cu-a slightly curved. Propodeum 

(Fig. 184) smooth with punctures separated by 2–4x a 

puncture width, except area superomedia, postero-externa and 

petiolaris with longitudinal wavy carinate texture; anterior and 

posterior transverse carina present centrally and laterally defined, 

between longitudinal carinae complete or faintly indicated; area 

superomedia well enclosed; lateral longitudinal carinae faint or 

absent between transverse carinae; posterior transverse carina 

reaching pleural carina; areas behind posterior transverse carina 

not well defined, with longitudinal carinate texture; pleural 




Color.- Fulvous except following: surrounding area of compound 

eyes, vertex, gena, subalar prominence, a diagonal stripe in 

mesopleuron, mesoscutellum and apically metapleuron yellowish. 

♂: Similar to female 

Comments.- All the material studied suggests that there is 

only one species of Alophophion in Falkland Island; there is no 

doubt that A. occidentalis (Morley, 1912) is a synonym of A. 

larseni (Enderlein, 1912). Alophophion larseni was rear from an 

unknown Noctuid (Gauld & Lanfranco, 1987). 

Type material examined.- Lectotype of Alophophion occidentalis 

(Morley, 1912): 1♀ “East I. [East Falkland], Falkland 

Is. [Island], Nov.08,-Feb.09. [xi.1908-ii.1909], Col. [collector] 

A. M. Reid., 1909-277.” (BMNH). 

Non type examined material: 11 ♂♂, 8 ♀♀: labeled as 

follows: FALKLAND ISLANDS (ISLAS MALVINAS): 1♂, 

6♀♀ “Falkland Is [Island], ex [extracted] blowfly?, May 1979, 

Vet. Officer coll., No. 1, CIE a.11226”; 1♀, 4♂♂ “Falkland Is 

[Island]: Port Stanley, i-ii.1984, I.J. Strange; E. [East] Falkland: 

Port Stanley, III.1983 [iii.1983], N. Prendergast”; 2♂♂ “Falkland 

Island: -Elliot. [Maggie Elliot Rock], B.M. 1934-526”; 

2♂♂, 1♀ “Falkland Is [Island]: Stanley [Port Stanley]., A. G. 

Bennett., 1920-199; 1♀ “East I. [East Falkland], Falkland Is. 

[Island], Nov.08,-Feb.09. [xi.1908-ii.1909], Col. [collector] A. 

M. Reid., 1909-277.”; 1♀ “Falkland Isl [Island], [reverse of label, 

74 in the line and 49 below]”; 1♂ “Falkland Is [Island],20.12.60 

[20.xii.1960], I. Stange [in a second labe 1961-443]; Falklands 

Island, Stanley, vi.2010, Coll. [collector] P. Cornell, at night, 

FERA 21015606”; 1♂ “unlabelled-data presumably same as 

specimens eifler side? [Det. G. Broad 2012]” (BMNH). 

37. Alophophion lloqueyupanquii new species 

(Figs. 126, 155, 172, 191) 


of the features: the speculum with same texture as the 

mesopleuron, the mesopleural furrow absent, and the lateral 

longitudinal carina faint between the transverse carinae. 


long; imbricate with punctures separated by 0.5x a puncture 

width; median portion weakly convex. Clypeus with upper 

half convex and lower half flat; imbricate with punctures 

separated by 0.5–1x a puncture width; apical edge convex. 


Compound eyes 0.6x as wide as face. Malar space 0.1–0.2x 

as long as basal width of mandible. Gena, in lateral view 

(Fig. 155), 0.8x as wide as compound eyes, imbricate with 

punctures separated by 1–1.5x a puncture width. Frons 

imbricate striate between central ocelli and toruli. Vertex 


eye by 0.3x ocellar diameter; distance between ocelli 



4.3–4.7:2.6–2.7:2.5:2.2:2.2:2.2:2.1–2.2. Ratio of length/ 



punctures separated by 0.5–1x a puncture width; lower half 

rugulose-striate and lower half of collar striate. Mesoscutum 

smooth with punctures separated by 1–1.5x a puncture width. 

Notaulus extending 0.3x length of mesoscutum, scrobiculate. 

Mesoscutellum evenly convex, with texture as that of mesoscutum; 

lateral carina reaching 0.1x to posterior margin of 


separated by 0.5–1.0x a puncture width; mesopleural furrow 

absent; speculum smooth with punctures separated by 1–2x 

a puncture width. Epicnemial carina curved to meet anterior 

margin of mesopleuron at lower third of pronotum. Metapleuron 

smooth with punctures separated by 0.5x a puncture width. 

Fore wing with CI=0.5; ICI=0.8–0.9; SDI=1.5; 1m-cu slightly 

sinuate; ramulus present; Rs+M curved; marginal cell cover by 

setae; sub-basal cell usually with isolate setae apically or without 

setae. Hind wing with 7–8 hamuli on R1 distally; NI=0.8; cu-a 

curved. Propodeum (Fig. 191) area superomedia, coxalis and 

posteroexterna rugulose, and areas basalis, spiracularis, lateralis 

and dentipara imbricate with punctures separated by 1–1.5x 

a puncture width; anterior transverse carina present between 

lateral longitudinal carinae; posterior transverse carina present 

between pleural carinae; posterior transverse carina between 

lateral longitudinal carinae with “M” shape; lateral longitudinal 

carinae faint between transverse carinae; lateromedian longitudinal 

carinae faint; lateromedian longitudinal carinae after 

posterior transverse carinae convergent, fused to form a single 

median longitudinal carina; pleural carina present. 



Color.- Brownish fulvous except following: head (except frons 

centrally fulvous), collar, lower half of pronotum, apical edge 

of mesoscutum, notauli, mesoscutellum, tegula, subalar prominence, 

speculum, a diagonal stripe in mesopleuron, apical half 

of metasternum, dorsal view of coxae light straw yellow. Wings 


♂: Unknown. 

Comments.- Alophophion lloqueyupanquii new species is 

quite similar to A. ofeliae new species, beside the differences 

mentioned in the key; A. lloqueyupanquii new species has darker 

brownish color than A. ofeliae new species. 

Etymology.- The species epithet "lloqueyupanquii" refers to 

Lloque Yupanqui the third ruler of the Tawantinsuyu. 




47

Alvarado 

Paratypes: 7♀♀ same as holotype (3♀♀ MUSM, 1♀ AEIC, 

1♀ BMNH, 2♀♀SEMC). 

38. Alophophion ofeliae new species 

(Figs. 125, 154, 171, 190, 206) 


of the features: light straw yellow colored, propodeum 

with longitudinal carinae present delimiting the area dentipara 

and the gena 0.7x as wide as the compound eyes. 


smooth with punctures separated by 0.5x a puncture width; 

median portion weakly convex. Clypeus upper half convex and 

lower half flat, imbricate with punctures separated by 1–2x a 

puncture width; apical edge slightly curved. Compound eyes 

0.5–0.6x as wide as face. Malar space 0.1–0.2x as long as basal 

width of mandible. Gena, in lateral view (Fig. 154), 0.7x as wide 

as compound eyes; smooth with punctures separated by 2–3x a 

puncture width. Frons smooth, slightly striate between toruli and 

central ocelli. Vertex with texture as gena. Lateral ocellus separated 




4.2–4.3:2.5–2.4:2.1–2.2:2.0:1.8–2.0:1.7–1.9:1.7–1.9. 


Mesosoma.- Pronotum in upper posterior half smooth 

with punctures separated by 1–2x a puncture width; lower 

half and next to collar scrobiculate. Mesoscutum smooth with 

punctures separated by 3–4x a puncture width. Notaulus extending 

0.2x length of mesoscutum, finely scrobiculate in apical 

half. Mesoscutellum evenly convex, smooth with punctures 

separated by 2–3x a puncture width; lateral carina reaching 


171) smooth with punctures separated by 1–2x a puncture 

width; lower edge of speculum scrobiculate, becoming finer to 

posterior end; mesopleural furrow absent. Epicnemial carina 


of pronotum. Metapleuron smooth with punctures separated by 

1–2x a puncture width, upper–anteriorly with punctures closer 

separated by 1x a puncture width. Fore wing (Fig. 206) with 

CI=0.5–0.6; ICI=0.9; SDI=1.5; 1m-cu straight; ramulus present; 

Rs+M curved; marginal cell glabrous next to upper half of 

Rs+2r; sub-basal cell glabrous. Hind wing with 8 hamuli on R1 

distally; NI=0.7; cu-a curved. Propodeum (Fig. 190) rugulose, 

except: area superomedia longitudinally carinate and area basalis 

smooth with punctures separated by 0.5–1.5x a puncture width; 

anterior and posterior transverse carinae present, faint; anterior 

transverse carina not reaching pleural carina; longitudinal carinae 

present, except on anterior area; lateromedian longitudinal carinae 

faint between transverse carinae; lateromedian longitudinal 

carinae after posterior transverse carina convergent, fused to 

form a single median longitudinal carina; pleural carina present. 



Color.- Light straw yellow except following: vertex, antennae 

and three stripes on mesoscutum fulvous. 

♂: Unknown 

Comments.- Big specimens have slightly rugulose texture 

next to epicnemial carina. This species has the same appearance 

as A. sofiae new species; they were collected together, but can be 

easily differentiate by the proportion of the head. This species 

has the face wider face and gena. This species was collected at 

the westerns slope of the Andes. 

Etymology.- Named in honor of Ofelia Carranza. 

Holotype: ♀, “PERU: MO [Moquegua], General Sánchez 

Cerro, La Capilla, 71 o 20’56”W/ 16 o 45’37”S, 2739 m. 

16.iv.2011. C. Carranza” (MUSM). 

Paratypes: 2♀♀, same data as holotype (MUSM). 

39. Alophophion pachacutii new species 

(Figs. 7, 130, 148, 177, 196, 211) 


of the features: propodeum with the anterior and posterior 

transverse carina present and the longitudinal carinae faint; 

sub-basal cell of the fore wing glabrous; and body with light 

straw yellowish coloration. 


as long; smooth with punctures separated by 1–1.5x a puncture 

width; median portion weakly convex. Clypeus with upper half 

convex and lower half flat; smooth with punctures separated by 

1.5–2x a puncture width; apical edge slightly convex. Compound 

eyes 0.6x as wide as face. Malar space 0.2x as long as basal width 


as compound eyes, smooth with punctures separated by 1.5–2x 

a puncture width. Frons smooth, softly striate between central 

ocelli and toruli. Vertex with texture as gena. Lateral ocellus 




3.5–3.7:2.1–2.2:1.9–2.1:1.7–1.8:1.7:1.6–1.7:1.6–1.7. 



separated by 1–1.5x a puncture width; lower half striate. Mesoscutum 

smooth with punctures separated by 0.5–1.5x a puncture width. 

Notaulus extending 0.3x length of mesoscutum, scrobiculate. 


by 3–4x a puncture width; lateral carina reaching 0.1x to posterior 

margin of mesoscutellum. Mesopleuron (Fig. 177) smooth with 

punctures separated by 0.5–1x a puncture width; lower edge of 

speculum finely scrobiculate; speculum smooth with punctures 

separated by 1–2x a puncture width; mesopleural furrow scrobiculate 

or softly weakly development. Epicnemial carina curved to 

meet anterior margin of mesopleuron at lower third of pronotum. 

Metapleuron anterior half smooth with punctures separated by 

1–1.5x a puncture width, posterior half softly rugulose. Fore 

wing (Fig. 211) with CI=0.4–0.5; ICI=0.5–0.6; SDI=1.6; 1mcu 

straight; ramulus present; Rs+M slightly curved; marginal cell 

apically glabrous next to proximal half of pterostigma and Rs+2r 

vein; sub-basal cell glabrous. Hind wing with 6–8 hamuli on R1 

distally; NI=0.8–0.9; cu-a slightly curved. Propodeum (Fig. 196) 

carinate wavy-rugulose texture, except: areas basalis and externa 

punctate smooth with punctures separated by 1x a puncture width 

and area dentipara with softly wavy-rugulose texture; anterior 

48 




weak centrally, carina wavy-rugulose; longitudinal carinae present, 

faint; pleural carina present. 



Color.- Light straw yellow. 

♂: Similar to female except propodeal carinae straight and 

well develop and mesopleural furrow generally absent, rarely 

softly weakly development. One specimen with lateromedian 

longitudinal carina present behind posterior transverse carina 

well defined and straight. 

Comments.- One female has the propodeum with the carinae 

faint and the lower edge of speculum with same the texture as 

rest of the mesopleuron. 

This species was collected at the western slope of the Andes. 

This species has light straw yellow coloration as A. sofiae new 

species and A. ofeliae new species, also distributed in the western 

slope of the Andes in Peru but apparently their distribution does 

not overlap. Alophophion pachacutii new species were collected 

during most part of the year. 

Etymology.- The species epithet "pachacutii" refers to Pachacuti 

the ninth ruler of the Tawantinsuyu. 



L Figueroa” (MUSM). 

Paratypes: 5♂♂, 6♀♀: labeled as follows: PERU: 3♂♂, 

4♀♀ same data as holotype (2♂♂, 2♀♀ MUSM; ♂, 2♀♀ 

SEMC); 1♀ “PERU: IC. [Ica] Ica, Fdo. [Fundo] Yolanda 

14°09'17.4"S/ 75°40'27.7"W 434m 22.iv.2011. Ligth trap. L. 

Salinas Leg.” (AEIC); 1♀ “PERU: IC. [Ica] Ica, Fdo. [Fundo] 

Yolanda 14°09'17.4"S/ 75°40'27.7"W 434m i.2011. Malaise 

trap. L.” (BMNH).and 2♂♂ “PERU: IC. [Ica] Ica, Fdo. [Fundo] 

Yolanda 14°09'17.4"S/ 75°40'27.7"W 434m viii.2010. Light 

trap. L. Salinas Leg.” (♂ MUSM, ♂ BMNH). 

40. Alophophion pincoya new species 

(Figs. 133, 150, 179, 198) 

Diagnosis.- This species can be recognized by clypeus with 

ventral-lateral edges angulate giving a square appearance. 


long; imbricate with punctures separated by 1–1.5x a puncture 

width; median portion weakly convex. Clypeus convex; apical 

edge straight centrally, angulated laterally; imbricate with 

punctures separated by 4–6x a puncture width. Compound 



as wide as compound eyes; imbricate with punctures separated 

by 2–4x a puncture width. Frons concave between toruli and 

compound eyes; between toruli and ocelli imbricate-striate. 

Lateral ocellus separated from compound eye by 0.3–0.4 x 

ocellar diameter; distance between ocelli 0.6x ocellar diameter. 

Antenna with 46–47 flagellomeres. Ratio of length/width 

from first to seventh flagellomeres: 4.1–4.2:2.4–2.2:2.0– 

2.1:1.9:1.9–1.8:1.8:1.8. Ratio of length/width of pre-apical 



Mesosoma.- Pronotum with upper half smooth with punctures 

separated by 1–2x a puncture width; lower half striate; lower half 

of collar striate. Mesoscutum smooth with punctures separated 

by 2–4x a puncture width. Notaulus extending 0.3x length of 

mesoscutum; scrobiculate. Mesoscutellum evenly convex; lateral 

carina reaching 0.3x to posterior margin of mesoscutellum; with 

punctures separated by 4–6x a puncture width. Mesopleuron 

(Fig. 179) on upper half smooth and lower half imbricate with 

punctures separated by 0.5–1.5x a puncture width; lower edge of 

speculum finely scrobiculate, smooth with punctures separated by 

2–3x a puncture width; mesopleural furrow absent. Epicnemial 


quarter of pronotum. Metapleuron imbricate with punctures 

separated by 1–1.5x a puncture width. Fore wing with CI=0.4; 


Rs+M curved; marginal cell glabrous next to pterostigma and 

Rs+2r vein; sub-basal cell with or without setae apically. Hind wing 

with 6–7 hamuli on R1 distally; NI=0.6–0.9; cu-a slightly curved. 

Propodeum (Fig. 198) softly rugulose except areas externa and 

basalis imbricate with punctures separated by 1.5–2x a puncture 

width; anterior transverse carina present between lateral longitudinal 

carinae, convex; posterior transverse carina present between 

pleural carinae, between lateral longitudinal carinae with “M” 

shape; lateral longitudinal carinae faint between transverse carinae. 



Color.- Testaceous except following: head (except frons 

centrally Testaceous), collar, lower half of pronotum, apical 

edge of mesoscutum, notauli, mesoscutellum, tegula, subalar 

prominence, speculum, a diagonal stripe in mesopleuron, apical 

half of metasternum, apical half of propodeum, coxae apically 

and dorsally light straw yellow. 

♂: Unknown. 

Comments.- There is one specimen, from Pino Hachado, 

that is light straw yellow. All the specimens were collected in 

February during the wed season. 

Etymology.- The species epithet "pincoya" refers to a female 

mythologic character "water spirit" of the Chilotan Seas. It is 


Holotype: ♀ “Curacautín, Malleco II.'64 [ii.1964] R. Blanco 

Chile Luis E. Peña” (AEIC). 

Paratypes: 9♀♀: labeled as follows: CHILE: 7♀♀ same data as 

holotype; y 2♀♀ “Pino Hachado [Paso de Pino Hachado] Lonquimay, 

Mal. II.18.80 [18.ii.1980] Chile 1600m. L. Peña” (AEIC). 

41. Alophophion porculatus (Morley, 1912) 

(Figs. 120, 161, 166, 185) 

Ophion porculatus Morley, 1912: 55. Holotype [Morley use 

of “type” is herein regarded as an original holotype designation 

(ICZN 1999: Art. 73.1.1)] [description, key]. 

Alophophion porculatus Townes & Townes, 1966:171. [generic 

transfer, list]; Yu & Horstmann, 1997: 730. [listed]. 

Diagnosis.- This species can be distinguish by the lateral ocellus 

separated from the compound eye by 0.4x ocellar diameter, 

the mesopleural furrow absent and the body olive green colored. 

49

Alvarado 



median portion convex. Clypeus convex; smooth with punctures 

separated by 3–4x a puncture width; apical edge slightly curved. 

Compound eyes 0.4x as wide as face. Malar space 0.3x as long as 

basal width of mandible. Gena, in lateral view (Fig. 161), 0.7x 

as wide as compound eyes; smooth with punctures separated by 

5–7x a puncture width. Frons imbricate, slightly striate between 

antennae and median ocellus. Vertex with texture as gena. Lateral 


distance between ocelli 1.0x ocellar diameter. Ratio of length/ 

width of first flagellomere: 4.4x. 


2.5–4x a puncture width; collar striate. Mesoscutum smooth 

with punctures separated by 3–5x a puncture width. Notaulus 

extending 0.5x length of mesoscutum, finely scrobiculate 

basally. Mesoscutellum evenly convex, smooth with punctures 

separated by 4–6x a puncture width; lateral carina reaching 0.1x 



speculum with proximal half scrobiculate; mesopleural furrow 

absent. Epicnemial carina curved to meet anterior margin 


smooth between punctures. Fore wing with CI=0.6; ICI=0.9; 

SDI=1.4; 1m-cu slightly curved; ramulus present; Rs+M slightly 

curved; marginal cell basally glabrous next to pterostigma and 

Rs+2r; sub-basal cell with setae distributed in the apical quarter. 

Hind wing with 7 hamuli on R1 distally; NI=1.0; cu-a curved. 

Propodeum (Fig. 185) smooth with punctures separated by 

6–8x a puncture width, surrounding area of carinae with softly 

carinate texture; anterior and posterior transverse carina present; 

longitudinal carinae present, except before anterior transverse 

carina; lateromedian longitudinal carinae after posterior transverse 

carinae faint; pleural carina present. 


II with spiracle located at 0.5 of tergite. 

Color.- Olive green. 

♂: unknown 

Comments.- The collecting information only mentions 

Argentina, and this species is only known by the holotype. 

This species has small ocelli, a feature usually found in diurnal 

species. 

Type material examined.- Holotype: ♀ labeled as follows: 

“Type/ B.M. TYPE HYM. 3b.2009 [handwritten]/ “Argentina. 

Fitzgerald. 99 124.” / Named by Claude Morley porcellanus 

type [handwritten]/ Ophion porculata Morl [handwritten] J.F. 

Perkins 1958 [last number handwritten] type [handwritten]” 

(BMNH). 

50 

42. Alophophion teushen new species 

(Figs. 134, 151, 180, 199) 


of the features: propodeum with the posterior transverse 

carina present, lower edge of the speculum softly scrobiculate 

and the lateromedian longitudinal carinae converge behind 

posterior transverse carina. 


smooth with punctures separated by 2–4x a puncture width, 

upper half of face between toruli with imbricate; median portion 

weakly convex. Clypeus slightly convex; apical edge straight 

centrally, curved laterally; upper half smooth and lower half 


Compound eyes 0.6–0.7x as wide as face. Malar space 0.1x as 

long as basal width of mandible. Gena, in lateral view (Fig. 151), 

0.6–0.7x as wide as compound eyes smooth with isolates punctures. 

Frons smooth, softly striate dorsal toruli. Lateral ocellus separated 




4.1–4.4:2.7:2.3–2.4:2.2–2.3:2.2–2.3:2.1–2.3:2.0–2.1. 



6–8x a puncture width, collar with imbricate texture. Mesoscutum 

smooth with punctures separated by 4–6x a puncture width. Notaulus 

extending 0.3x length of mesoscutum, basally scrobiculate. 


by 4–5x a puncture width; lateral carina reaching 0.1x to posterior 

margin of mesoscutellum. Mesopleuron (Fig. 180) smooth with 

punctures separated by 4.0–5.0x a puncture width; lower edge of 

speculum softly scrobiculate; mesopleural furrow absent. Epicnemial 

carina weaker at join with anterior margin of mesopleuron 

to pronotum; joining on anterior margin of mesopleuron at lower 

quarter of pronotum. Fore wing with CI=0.7–0.8; ICI=0.5–0.6; 

SDI=1.3–1.4; 1m-cu straight; ramulus present; Rs+M curved; 

marginal cell basally glabrous next to proximal half of pterostigma 

and Rs+2r; sub-basal cell with isolate setae in the apical half, 

only distributed dorsally. Hind wing with 7–8 hamuli on R1 

distally; NI=0.6–0.7; cu-a curved. Propodeum (Fig. 199) smooth 

with isolate punctures, shiny; anterior transverse carina present 

centrally; posterior transverse carina complete, reaching pleural 

carina; lateral longitudinal carinae absent; lateromedian longitudinal 

carinae present between transverse carinae, faint sometimes 

absent; lateromedian longitudinal carinae after posterior transverse 

carinae convergent, fused to form a single median longitudinal 

carina, rarely separate. 




antennae, palpi, mandibles, two lateral vittaes distributed from 

¼ to posterior edge of mesoscutum, a central vittae distributed 

from anterior edge to ½ of mesoscutum, a spot between central 

vittae and posterior edge of mesoscutum, scuto-scutellar 

groove, axilla, posterior half of speculum, lower edge of subalar 

prominence, mesosternum, basal half of metasternum, basal half 

ventrally coxae, basal half of propodeum, a spot distributed from 

spiracles to pre-apical apical end of tergite I, tergites II–VII except 

lateral and posterior margins and ovipositor sheath fulvous. 

♂: unknown 

Comments.- Some specimens have metasoma brownish 

instead of olive green, this variation in the color was obtained 

probably because the killing method. 

Etymology.- The species epithet "teushen" refers to the 

Teushen, an indigenous hunter-gatherer people of Patagonia in 

Argentina. It is treated as a noun in apposition. 



Holotype: ♀ “Villa Regina Argentina Rio Negro 

X.7.61[07.x.1961] Luis Peña” (AEIC). 

Paratypes: 4♀♀: labeled as follows: 2♀♀ “Cipolleti Rio 

Negro IX.29.57 [29.ix.1957] Argent. [Argentina] F.H. Walz”; 

and 2♀♀ same data as holotype (AEIC). 

43. Alophophion waca new species 

(Figs. 124, 145, 170, 189) 


of the features in the propodeum: the presence of anterior 

and posterior transverse carinae; and striate-punctate texture 

behind anterior transverse carina. 


long; imbricate with punctures separated by 0.5–1x a puncture 

width; median portion weakly convex. Clypeus convex; imbricate 

with punctures separated by 1–1.5x a puncture width; 

apical edge almost truncate, laterally slightly convex. Compound 



as wide as compound eyes; smooth with punctures separated 

by 0.5–1x a puncture width. Frons imbricate, softly striate 

between central ocelli and toruli. Lateral ocellus separated from 


ocelli 0.7–0.8x ocellar diameter. Antenna with 51 flagellomeres. 


4.9–5.0:2.7–2.8:2.6:2.3–2.5:2.3–2.4:2.2:2.1. Ratio of length/ 

width of pre-apical flagellomeres: 1.4x. 

Mesosoma.- Pronotum with upper half imbricate with punctures 

separated by 0.5x a puncture width; lower half striate; lower half 

of collar striate. Mesoscutum smooth with punctures separated 

by 0.5–1x a puncture width; notaulus extending 0.2x length of 

mesoscutum. Mesoscutellum evenly convex, smooth with punctures 

separated by 0.5–1x a puncture width; lateral carina reaching 


170) smooth with punctures separated by 0.5x a puncture width; 

speculum smooth with punctures separated by 1–1.5x a puncture 


furrow softly rugulose, short, reaching to the anterior third of 

mesopleuron. Epicnemial carina weak laterally, joins to anterior 

margin of mesopleuron at lower third of pronotum. Metapleuron 

imbricate with punctures separated by 0.5x a puncture width. Fore 

wing with CI=0.4–0.5; ICI=0.8; SDI=1.5; 1m-cu straight; ramulus 

present, small; Rs+M slightly curved; marginal cell cover by setae; 

sub-basal cell glabrous with two setae apically. Hind wing with 6 

hamuli on R1 distally; NI=0.9–1.0; cu-a slightly curved. Propodeum 

(Fig. 189) wavy-carinate texture except basal area imbricate 

with punctures separated by 0.5–1x a puncture width; anterior 

transverse carina present between lateral longitudinal carinae; 

posterior transverse carina weak centrally, carina wavy- rugulose; 

lateral longitudinal carinae faint; lateromedian longitudinal carinae 

weak between transverse carinae, faint behind posterior transverse 

carina; pleural carina present. 



Color.- Rufo-testaceous except following: around to compound 

eyes and between ocelli yellowish. 

♂: Similar to female, except face smooth between punctures. 

Comments.- Alophophion waca new species is the only species 

collected in Bolivia. 

Etymology.- The species epithet "waca" refers to the Quechua 

name of Vacas, the locality where this species was collected. It 

is treated as a noun in apposition. 

Holotype: ♀ “Vacas BOLIVIA Dep. [Departamento] Cochabamba 

3000m Feb. 15, 1950 [15.ii.1950] Coll: [colector] 

L.E. Pena [Peña]” (AEIC). 

Paratypes: 1♂, 2♀♀: labeled as follows: BOLIVIA: 1♂, 

2♀♀ “N. E. Sacaba Cocha. [Cochabamba] Bolivia I.28.76 

[28.i.1976] 3300m Luis Peña” (AEIC). 

44. Alophophion wiracochai new species 

(Figs. 129, 146, 175, 194, 209) 


of the features: propodeum with the anterior and posterior 

transverse carina present and the longitudinal carinae faint; 

fenestra thin; the sub-basal cell of the fore wing with setae; and 

body with olive green coloration. 


as long; coarsely punctate, smooth with punctures separated 

by 0.5x a puncture width; median portion weakly convex. 

Clypeus with upper half convex and lower half flat; imbricate 

with punctures separated by 0.5x a puncture width; apical edge 

straight centrally, curved laterally. Compound eyes 0.4x as wide 



eyes, smooth with punctures separated by 1–2x a puncture 

width. Frons and vertex with texture as gena. Lateral ocellus 


between ocelli 0.6x ocellar diameter. Antenna with 46–51 flagellomeres. 


4.9–5.0:3.0:2.6–2.5:2.4–2.3:2.2–2.1: 2.2–1.9:2.2–1.9. 


Mesosoma.- Pronotum coarsely punctate, smooth with 

punctures separated by 1–2x a puncture width. Mesoscutum 


Notaulus extending 0.3x length of mesoscutum; basally coarsely 

punctate, smooth between punctures. Mesoscutellum evenly 

convex, smooth with punctures separated by 2–3x a puncture 

width; lateral carina reaching 0.3x to posterior margin of 


separated by 1x a puncture width; lower edge of speculum finely 

scrobiculate; mesopleural furrow shallowly scrobiculate, small, 

rarely absent. Epicnemial carina curved to meet anterior margin 

of mesopleuron at lower third of pronotum. Metapleuron 


Fore wing (Fig. 209) with CI=0.5; ICI=0.6–0.9; SDI=1.5–1.6; 

1m-cu straight; ramulus present, small; Rs+M curved; marginal 

cell basally cover by setae; sub-basal cell with a row of setae 

at center, parallel to the M+Cu vein and apically with setae 

between row of setae and 1A. Hind wing with 6 hamuli on R1 

distally; NI=0.6; cu-a slightly curved. Propodeum (Fig. 194) 

with anterior and posterior transverse carina present, reaching to 

pleural carina; longitudinal carinae faint; areas superomedia and 


51

Alvarado 

petiolaris with longitudinal carinate texture; rest of propodeum 

smooth between punctures; pleural carinae present. 



Color.- Olive green to light straw yellowish except following: 

two lateral vittaes distributed from ¼ to posterior edge of 

mesoscutum, central vittae distributed from anterior edge to 

½ of mesoscutum; mesosternum; and metasomal laterotergites. 

♂: Similar to female except by sub-basal cell with setae covering 

a bigger area; some specimens with anterior transverse 

carina faint. 

Comments.- All the specimens were collected in Polylepis 

forest; most of the specimens were collected using light traps. 

This is the only species olive green colored collected in this 

type of forest. 

Etymology.- The species epithet "wiracochai" refers to Wiracocha 

the eighth ruler of the Tawantinsuyu. 


14°54'9.12"S/73°53'55.77"W, 4120m. 07-10.iv.2010. Bosque 

de Polylepis. Pitfall trap. N. Martinez Leg.” (MUSM). 

Paratypes: 9♂♂, 1♀, 1? “PERU: AY. [Ayacucho] Ayacucho, 

Chaviña, 14°54'21.49"S/ 73°53'55.78"W, 4153m. 05-12. 

iv.2010. Bosque de Polylepis. N. Martinez Leg. [Ligth trap]” 

(2♂♂ BMNH, 2♂♂ SEMC, 2♂♂ AEIC, 3♂♂ MUSM). 

52 

45. Alophophion yahuarhuacaci new species 

(Figs. 123, 144, 169, 188, 208) 


anterior transverse carina of the propodeum present centrally; 

and the sub-basal cell with setae restricted to a triangular area 

formed by 1A and cu-a. 


imbricate with punctures separated by 0.5x a puncture width; 

median portion weakly convex. Clypeus convex; imbricate 

with punctures separated by 0.3–0.5x a puncture width; apical 

edge slightly convex. Compound eyes 0.5–0.6x as wide as 

face. Malar space 0.2–0.3x as long as basal width of mandible. 


eyes, imbricate with punctures separated by 1–1.5x a puncture 

width. Frons imbricate, softly striate between central ocelli and 

toruli. Vertex imbricate with punctures separated by 0.5–1x a 

puncture width. Lateral ocellus separated from compound eye 

by 0.5x ocellar diameter; distance between ocelli 1.0x ocellar 

diameter. Antenna with 59–62 flagellomeres. Ratio of length/ 


2.8:2.3–2.7:2.2–2.5: 2.2–2.5: 2.2–2.5. Ratio of length/width 

of pre-apical flagellomeres: 1.7–2.0x. 

Mesosoma.- Pronotum imbricate with punctures separated 

by 0.5–1x a puncture width, lower half softly striate. Mesoscutum 

smooth with punctures separated by 1–1.5x a puncture 

width. Notaulus extending 0.2x length of mesoscutum. Mesoscutellum 

evenly convex; smooth with punctures separated 

by 1.5–2x a puncture width; lateral carina reaching 0.4x to 

posterior margin of mesoscutellum. Mesopleuron (Fig. 169) 

imbricate with punctures separated by 0.5–1x a puncture width; 

mesopleural furrow absent. Epicnemial carina curved to meet 


Metapleuron imbricate with punctures separated by 0.5–1x a 

puncture width. Fore wing (Fig. 208) with CI=0.6; ICI=0.6; 

SDI=1.6; 1m-cu straight; ramulus absent; Rs+M slightly curved; 

fenestra in a bead shape; marginal cell cover by setae; sub-basal 

cell apically in triangular area formed by 1A and cu-a cover by 

setae. Hind wing with 6–7 hamuli on R1 distally; NI=0.7–0.8; 

cu-a slightly curved. Propodeum (Fig. 188) smooth with isolate 

punctures except area basalis softly imbricate with punctures 

separated by 0.5–1x a puncture width; anterior transverse carina 

present centrally, curve; posterior transverse carina absent 

centrally, laterally present; longitudinal carinae present apically; 




Color.- Reddish brown except following: surrounded area to 

compound eyes and between ocelli yellowish. 

♂: Similar to female except longitudinal carinae present 

absent or small apically. 

Comments.- This species is distributed at the north of Peru, 

probably overlapping its distribution with A. atahualpai new 

species but all the records A. yahuarhuacaci new species are at 

higher altitude. Morphologically are easily distinguished between 

them; A. atahualpai new species has the area superomedia of 

propodeum well develop while A. yahuarhuacaci new species 

lack of carinae behind anterior transverse carina. 

Etymology.- The species epithet "yahuarhuacaci" refers to 

Atahualpa the seventh ruler of the Tawantinsuyu and first inca. 

Holotype: ♀ “PERU: LL. [La Libertad] Bolivar, Condormarca 

Lag. [Laguna] Quishuar 77°32'15.13"W/7°36'17.33"S 

3482m 28-30.iii.2011[.] Ligth trap. C. Carranza” (MUSM). 

Paratypes: 5♂♂, 2♀♀: labeled as follows: 4♂♂, 1♀ same 

data as holotype (1♂, 1♀ MUSM; 1♂ AEIC; 1♂ BMNH; 

1♂ SEMC) and 1♂, 1♀ “PERU, CA, Cajamarca, Potererillo, 

E795943/N9233538 [78º19"27"W/6º55'48”S], 3641 msnm, 

20/ix/2006 [20.ix.2006], M. Alvarado” (MUSM). 

46. Alophophion yestay new species 

(Figs. 6, 135, 152, 181, 200) 


of features: lower edge of the speculum with the same 

texture as the mesopleuron, propodeum with the transverse 

carinae present and with rugulose texture except in the areas 

basalis and externa. 


as long; median portion weakly convex; smooth centrally and 

imbricate laterally with punctures separated by 1–2x a puncture 

width. Clypeus smooth centrally and imbricate laterally with 

punctures separated by 6.0x a puncture width; apical edge 

straight centrally, curved laterally. Compound eyes 0.4–0.6x 

as wide as face. Malar space 0.1–0.2x as long as basal width of 

mandible. Gena, in lateral view (Fig. 152), 0.6–0.7x as wide as 

compound eyes, softly imbricate with shallow punctures separated 

by 6x a puncture width. Frons softly striate between central 



ocelli and toruli. Vertex with texture as gena. Lateral ocellus 




flagellomeres: 3.6–4.3:1.8–2.1:1.6–2.0:1.5–1.9:1.5–1.8:1.4– 

1.7:1.4–1.7. Ratio of length/width of pre-apical flagellomeres: 

1.3–1.4x. 


punctures separated by 1–2x a puncture width, and lower half 

rugulose; lower collar striate. Mesoscutum smooth centrally 

and imbricate laterally with punctures separated by 1–2x a 

puncture width. Notaulus extending 0.2x length of mesoscutum, 

finely scrobiculate. Mesoscutellum evenly convex, smooth with 

punctures separated by 5–7x a puncture width; lateral carina 


(Fig. 181) smooth with shallow punctures separated 

by 3–4x a puncture width; lower edge of speculum and subalar 

prominence with the same texture as mesopleuron; mesopleural 


of mesopleuron at lower 0.4 of pronotum. Metapleuron smooth 

with punctures separated by 1–2x a puncture width. Fore wing 

with CI=0.4–0.5; ICI=0.7–0.9; SDI=1.3–1.4; 1m-cu straight; 

ramulus present; Rs+M curved; marginal cell basally glabrous; 

sub-basal cell usually without setae, at most with one seta. Hind 

wing with 7 hamuli on R1 distally; NI=0.8–1.0; cu-a straight. 

Propodeum (Fig. 200) rugulose, except areas basalis and externa 

punctate, smooth with punctures separated by 1–2x a puncture 

width; anterior transverse carina present between lateral longitudinal 

carinae; posterior transverse carina present between pleural 

carinae; lateromedian longitudinal carinae present, faint before 

anterior transverse carina; pleural carina present. 



Color. Olive green to light straw yellow except following: 

antennae, palpi, “M” form sport on mesosternum, metasternum, 

coxae basal-ventrally, trochanter, trochantellus, femurs ventrally 

and laterally, basally centrally on tergites II to III, laterotergites 

and ovipositor sheath rufo-testaceous to brownish. 

♂: Similar to female except following: antenna with 43 to 53 

flagellomeres. Rufo-testaceous spots on tergites II to III bigger, 

also sometime present basally centrally on tergites IV to VI. 

Comments.- There is variation in the texture of the areas 

petiolaris and posteroexterna of the propodeum, being more or 

less rugulose between specimens. The specimens present some 

variation in texture of the lower edge of speculum, from smooth 

with punctures to shallowly scrobiculate. 

This species is distributed in the Chilean regions Araucanía, 

Biobío, Libertador General Bernardo O'Higgins, Metropolitana 

de Santiago and Maule. All the species studied from Chile were 

collected between January and February. 

Etymology.- The species epithet "yestay" refers to the name 

of the mythical creature with the guanaco shape; is the protector 

of wild animals that inhabit the arid territories north of Chile. 

It is treated as a noun in apposition. 

Holotype: ♀ “Pino Hachado [Paso de Pino Hachado] 

Lonquimay, Mal. II.18.80 [18.ii.1980] Chile 1600m. L. Peña” 


Paratypes: 7♂♂, 17♀♀: labeled as follows: ARGENTINA: 

♂, 7♀♀ “Chubut Patagonia / From WFH Rosemberg/ [identification 

label: Ophion chilensis Spinola det C.W. Hooker 

3.12-18.1909]” (USNM); CHILE: 4♂♂, 7♀♀ same data 

as holotype; 1♂ “3 km. E. Las Trancas, Ñuble, Chile I.16.67 

[16.i.1967] Lionel Stange”; 1♂, 1♀ “Las Trancas Chillán, Chile 

I.19-22.79 [19-22.i.1979] 1600m. L. Peña”, 1♀ “Cord. [Cordillera] 

Lonquimay, Chile I.1.1962 [01.i.1962] Luis Peña”; and 

1♀ “Río Tinguiririca Colchagua, Chile II.17.78 [17.ii.1978] 

1400m Luis Peña” (AEIC). 

47. Alophophion yupankii new species 

(Figs. 131, 149, 178, 197, 212) 


of the features: lateral ocellus separated from the compound 

eye by 0.4–0.6x the ocellar diameter and body with cream color 

with brownish spots. 



imbricate with punctures separated by 1–1.5x a puncture width. 

Clypeus slightly convex, smooth centrally and laterally with 

punctures separated by 2–3x a puncture width; apical edge 

straight centrally, curved laterally. Compound eyes 0.5–0.6x as 

wide as face. Malar space 0.2x as long as basal width of mandible. 


eyes, smooth with punctures separated by 3–5x a puncture width. 

Frons striate between central ocelli and toruli. Vertex with 







Mesosoma.- Pronotum on the upper half coarsely punctate, 

smooth with punctures separated by 1.5–2x a puncture width; 

lower half and lower collar striate. Mesoscutum centrally smooth 

and laterally imbricate with punctures separated by 1.5–2x a 

puncture width. Notaulus extending 0.3x length of mesoscutum, 

finely scrobiculate. Mesoscutellum evenly convex, smooth with 



(Fig. 178) smooth with punctures separated by 0.5–1x a puncture 

width; lower edge of speculum and subalar prominence with the 

same texture as mesopleuron; speculum smooth with punctures 

separated by 1–2x a puncture width; mesopleural furrow absent. 


at lower 0.3 of pronotum. Metapleuron smooth with punctures 

separated by 1.5–2x a puncture width. Fore wing (Fig. 212) with 

CI=0.4–0.5; ICI=0.6; SDI=1.3–1.4; 1m-cu straight; ramulus 

present but small; Rs+M curved; marginal cell basally cover by 

setae; sub-basal cell usually without setae, at most with one to 

three setae. Hind wing with 6 hamuli on R1 distally; NI=0.7–1.2; 

cu-a straight. Propodeum (Fig. 197) softly rugulose except areas 

petiolaris and superomedia with softly longitudinal carinate texture 

and area basalis smooth with punctures separated by 4–5x a 

puncture width; anterior transverse carina present between lateral 

longitudinal carinae; posterior transverse carina absent centrally, 

reaching pleural carina; longitudinal carinae absent before trans- 

53

Alvarado 

verse carina; lateral longitudinal carinae faint between transverse 

carinae; pleural carina present. 



Color.- Cream color except following: antennae, palpi, mandibles, 

clypeus central-apically, surrounded area of anterior tentorial 

pit, vertex centrally, notauli, two lateral vittaes distributed from ¼ 

to posterior edge of mesoscutum, a central vittae distributed from 

anterior edge to ½ of mesoscutum, a spot between central vittae 

and posterior edge of mesoscutum, scuto-scutellar groove, axilla, 

surrounded area of speculum, mesosternum, basal half of metasternum, 

inner, anterior and posterior of pro and meso-coxae, a 

central vittae in external meso-coxae, basal-inner ¾ of hind coxae, 

anterior of hind coxae, ½ basal posterior and external of hind 

coxae, trochanter, trochantellus, femur, tibia, tarsomeres, basal 

half of propodeum, a spot distributed from spiracles to pre-apical 

apical end of tergite I, tergite II except laterally, tergites II to III 

except laterally and in posteriorly and ovipositor sheath brownish. 

♂: Similar to female except brownish spot smaller. 

Comments.- In small specimens the ramulus is present as 

an angulation of the vein; propodeum with the carinae faint 

and with the brownish spot smaller than in the big specimens. 

This is the only species that has cream color with brownish 

spots occurring in the Polylepis forest. 

Etymology.- The species epithet "yupankii" refers to Túpaq 

Inka Yupanki, the tenth ruler of the Tawantinsuyu. 


14°54'21.49"S/73°53'55.78"W, 4153m. 05-12.iv.2010. Bosque 

de Polylepis. N. Martinez Leg. [Ligth trap]” (MUSM). 

Paratypes: 2♂♂, 2♀♀: labeled as follows: 1♀ “PERU: AY. 

[Ayacucho] Ayacucho, Chaviña, 14°54'31.16"S/73°53'56.87"W, 

4115m. 07-10.iv.2010. Bosque de Polylepis. Pitfall trap. N. 

Martinez Leg.” (MUSM); and 1♂, 2♀♀ same data as holotype 

(1♂, 1♀ MUSM; 1♀ SEMC). 

Species-group D 

Diagnosis. Face at most 1x as long as wide; compound eyes 

at most 0.6x wide as face; head, in lateral view, gena at least 0.8x 

wide as compound eyes. Lateral ocellus separated from compound 

eye by 0.4–0.5x ocellar diameter, ocelli small. Mandible 

with upper margin more or less convex, without setae (Figs. 

10–11). Notaulus reaching about 0.3x of length of mesoscutum. 

Mesopleural furrow absent. Body bright yellow colored with 

reddish or black spots; diurnal activity. 

Included species. Two species are included in this species 

group: A. diaguita new species and A. inti new species. 

Comments. The species of this species group are presumably 

diurnal. They are geographically isolated, A. inti new species is 

distributed in the highlands of Peru while Alophophion diaguita 

new species is restricted to Patagonia. 

Key to species of species-group D 

(1) Malar space 0.7–0.8x (Fig. 11) as long as basal width of mandible (Peru) 

….......................................................... Alophophion inti new species 

– Malar space 0.4x (Fig. 10) as long as basal width of mandible (Chile and 

Argentina) …................................. Alophophion diaguita new species 

48. Alophophion diaguita new species 

(Figs. 10, 213–217) 

Diagnosis.- Alophophion diaguita new species can be distinguish 

of A. inti new species for its wider face and more robust 

body than in A. inti new species. 


as long, lateral margins almost parallel, smooth centrally and 

softly imbricate laterally with punctures separated by 0.5–1.5x a 

puncture width; median portion weakly convex. Clypeus evenly 

convex, with texture as that of face centrally; apical edge straight 

slightly convex. Mandible stout, very weakly narrowed apically, 

curveted, with upper tooth slightly broader and slightly longer 

than the lower tooth; outer mandibular surface smooth between 

punctures in the upper 2/3 and coriaceous between punctures 

in the basal 1/3. Malar space 0.4x as long as basal width of 

mandible (Fig. 10). Gena, in lateral view (Fig. 215), 0.8–0.9x 

as wide as compound eyes; softly imbricate with punctures separated 

by 2–3x a puncture width. Vertex and frons with texture 

as that of gena. Lateral ocellus separated from compound eye 


ocellar diameter (Fig. 216). Antenna with 47–56 flagellomeres; 


3.8–3.6:2.5–2.1:2.1–1.8:2.0–1.8:2.0–1.7:1.9–1.7:1.9–1.7. 

Mesosoma.- Pronotum and mesoscutum smooth with 

punctures separated by 2–3x a puncture width, centrally 

punctures centrally closer (separated by 0.5x a puncture width). 

Notaulus scrobiculate reaching ca. 0.2x to posterior margin of 

mesoscutellum. Mesoscutellum evenly convex, smooth with 


reaching ca. 0.2x to posterior margin of mesoscutellum. Mesopleuron 

weakly polished, smooth with punctures separated 

by 0.5–1x a puncture width; lower edge of speculum softly 

scrobiculate. Epicnemial carina curved to meet anterior margin 

of mesopleuron at lower third of the pronotum. Metapleuron 

with texture as mesopleuron; submetapleural carina complete. 

Fore wing with CI=0.3–0.6; ICI=0.6–0.7; SDI=1.1–1.2; 1m-cu 

centrally curveted and with ramulus absent or 1m-cu centrally 

angulate and with ramulus present. Hind wing with 6 hamuli 

on R1; NI=0.6; cu-a curveted. Propodeum (Fig. 217) with area 

anterior punctate smooth with punctures separated by 0.5–1x 

puncture diameter and area posterior with rugulose texture; 

with anterior and posterior transverse carina present, pleural 

carinae present. 



Color.- Head bright yellow except following: spot form 

around toruli and surrounded area of median ocellus, projected 

in front of toruli and facial tubercle by triangular expansions; 

dorsal part of vertex, behind lateral ocelli, with a “v” shape 

going to the occiput brownish red. Mesosoma bright yellow 

except following: upper transverse stripe in pronotum, three 

stripes in mesoscutum; axilla; a spot that runs from inferior 

edge of subalar prominence, speculum and anterior margin of 

mesopleuron; mesopleural suture; mesosternum; prosternum; 

metasternum; hind ring behind postscutellum and basal half 

of propodeum brownish red. Legs brownish red except coxae 

ventral-apically bright yellow; wings grayish hyaline; veins 

54 



Figures 213 – 217. 

Alophophion inti new species 

(213) Habitus 

(214) face 

(215) head in lateral view 

(216) head in dorsal view 

(217) propodeum. 

Figures 218 – 222. 

Alophophion diaguita new species 

(218) Habitus 

(219) face 

(220) head in lateral view 

(221) head in dorsal view 

(222) propodeum. 


55

Alvarado 

basally yellowish, rest brownish black; pterostigma dorsally 

yellowish brown. Metasoma with first sternite brownish red, 

first tergite bright yellow except brownish red area behind 

spiracle; tergite II–VI yellowish brownish red except laterally 

to the spiracle with yellow band; tergite VII brownish red; 

ovipositor and valve brownish red. 

♂: Fore wing length 9.5mm. Similar to female except by 

the spot not brownish red, dark brown. Antenna with 46 flagellomeres. 

Comments.- The proportions of the head of A. diaguita new 

species varied within the population especially with the male, 

additionally there are differences in the coloration of the spots 

this seems to be intrinsic of the species. The specimen collected 

in Patagonia has the punctures in face more scattered than the 

other specimens. This species was collected bellow 1000m. 

Etymology.- The species epithet "diaguita" refers to the 

group of South American indigenous people, called Diaguita- 

Calchaquí. It is treated as a noun in apposition. 

Holotype: ♀, “Prov. Valdivia Valdivia-Chile 15.xi.81 E. 

Krahmer” (BMNH) 

Paratypes: ♂, 5♀♀: labeled as follows: ARGENTINA: 

1♀, “ARGENTINA. N.-W [NW] Patagonia. 1,000-3,000ft. 

[305-915m] Dec. 1919. H.E. Box”; 1♀ “CHILE [ARGEN- 

TINA]: Chubut, Rio Turbio. 25.i.1962. A. Kovacs. B.M. 

1964-193.” (BMNH). 1♀, “Chubut Patagonia / From WFH 

Rosemberg/ [identification label: Ophion chilensis Spinola 

det C.W. Hooker 3.18.1909]” (USNM). CHILE: 1♂, 2♀♀: 

1♂ “Curacautín, Malleco II.'64 [ii.1964], R. Blanco Chile 

Luis E. Peña”; 1♀ “Las Nieves XI.12.47 [12.xi.1947] Chile L. 

Pena Guzman”, and 1♀, “Renco, Chile, nr. Santiago I.20.51 

[20.i.1951] L. Peña” (AEIC). 

56 

49. Alophophion inti new species 

(Figs. 11, 218–222) 

Diagnosis.- Alophophion inti new species and A. diaguita 

new species are quite similar but A. inti new species is thinner 

and has the malar pace wider. 


long, lateral margins almost parallel; imbricate with punctures 

separated by 0.5–1x a puncture width, median portion weakly 

convex. Clypeus evenly convex, with texture as that of face; 

apical edge slightly convex. Mandible stout, very weakly narrowed 

apically, curveted, with upper tooth slightly broader and 

slightly longer than the lower tooth; outer mandibular surface 


Malar space 0.7–0.8x as long as basal width of mandible (Fig. 

11). Gena, in lateral view (Fig. 220), 0.8x as wide as compound 

eyes; imbricate with punctures separated by 2–3x a puncture 

width. Vertex and frons with texture as that of gena. Lateral 


distance between ocelli 0.8–1.2x ocellar diameter (Fig. 221). 

Antenna with 48–49 flagellomeres; Ratio of length/width from 


1.9:2.0–1.9:1.8–1.7:1.7. 

Mesosoma.- Pronotum and mesoscutum softly imbricate 

with punctures separated by less than 0.5x puncture diameter. 

Notaulus scrobiculate extending 0.2x length of mesoscutum. 

Mesoscutellum evenly convex, imbricate with punctures separated 

by 2–3x puncture diameter; lateral carina reaching 

ca. 0.2x to posterior margin of mesoscutellum. Mesopleuron 

weakly polished; softly imbricate with punctures separated by 

1–2x puncture diameter, except speculum smooth, lower edge 

of speculum softly scrobiculate. Epicnemial carina curved to 

meet anterior margin of mesopleuron at lower third of the pronotum. 

Metapleuron softly imbricate with punctures separated 

by 1x puncture diameter; submetapleural carina complete. Fore 

wing with CI=0.4; ICI=0.7; SDI=1.2; 1m-cu centrally curveted, 

ramulus absent. Hind wing with 6 hamuli on R1; NI=0.4; cu-a 

curveted. Propodeum (Fig. 222) with area anterior punctate 

smooth with punctures separated by 0.5–1x puncture diameter 

and area posterior with rugulose texture; anterior transverse 

carina faint, centrally arcuate; pleural carinae present; other 

carinae absent. 



Color.- Head bright yellow except following: area of clypeal 

fovea and a spot form around inter-antennal tubercle, front 

centrally, area around ocelli and dorsal projection of posterior 

ocelli black; scape, mandibles teeth, maxillary and labial palpi 

yellowish brown; pedicel and flagellomere dark brown. Mesosoma 

bright yellow except following: a black transverse stripe in 

pronotum, three stripes in mesoscutum, axilla, a stain that runs 

from inferior edge of subalar prominence, speculum and anterior 

margin of mesopleuron, mesopleural suture, four stripes in 

mesosternum, prosternum, metasternum and hind ring behind 

postscutellum. Fore leg with coxae bright yellow; trochanter, 

trochantellus, femur and tibia yellowish brown; and, tarsomeres 

brown. Mid and hind leg with coxae dorsally bright yellow; 

coxae ventrally, trochantellus, femur and apical-ventral tibia 

yellowish brown; and trochanter, tibia and tarsomeres brown. 

Wings grayish hyaline; veins basally yellowish, rest brownish 

black; pterostigma dorsally yellowish brown; metasoma with first 

sternite brown, first tergite bright yellow except yellowish brown 

area behind spiracle; tergite II–VI yellowish brow, tergites III–VI 

with a lateral yellow spot; tergite VII bright yellow; ovipositor 

and valve yellowish brown. 

♂: Fore wing length 9.4mm. Similar to female except: four 

stripes in mesosternum wider forming “M” shape and claspers 

bright yellow. 

Comments.- This species was collected in puna grassland 

over 4000 m, actively flying during the day; all the specimens 

were collected during the rainy season. 

Etymology.- The specific epithet, inti, is the Quechua name 

of the sun. According to Incan mythology, Inti is the sun god, 

the main deity and also known as the Giver of Life. It is treated 

as a noun in apposition. 

Holotype: 1♀, PERU: CU. Espinar, Qbra [Quebrada] 

Chaisamayo 14°59'46.15"S/ 71°16'25.93"W, 4167 m. 16-17. 

iii.2011. Pastizal. M. Alvarado (MUSM). 

Paratypes: 1♂, 1 ♀: labeled as follows: 1♀, “PERU: AP. Cotabambas 

72º23'19"W/ 13º56'18"S, 4030 m, pajonal, colecta 

manual [sweeping], iii.2007, M. Alvarado & E. Quispitupac” 

and 1♂, same data as holotype (MUSM). 



Nomen dubium 

Alophophion holosericeus (Taschenberg, 1875) 

Ophion holosericeus Taschenberg, 1875: 427 Holotype ♀ 

ZMH [Taschenberg’s use of “type” is herein regarded as an 

original holotype designation (ICZN 1999: Art. 73.1.1)] [description]. 

Dalla Torre, 1900: 192 [listed]; Hooker, 1912: 164 

[translation of original description]; Morley, 1912: 57 [key]. 

Alophophion holosericeus (Taschenberg): Townes & Townes, 

1966: 171 [generic transfer]; Yu & Horstmann, 1997: 730 

[listed]. 

Description.- ♀: Based on the original description provided 

by Hooker (1912). Propodeum with anterior transverse carina 

present and well defined; posterior transverse carina weaker than 

anterior; lateral and lateromedian longitudinal carinae present 

before anterior transverse carina, faint after it. Fore wing with 

ramulus present in discosubmarginal cell. Reddish brown except 

following: head dorsally and mesoscutellum yellowish and apice 

of metasoma brownish (Hooker, 1912). 

Comments.- The type specimen was collected in Parana, 

Brazil and was deposited in the Zoologischen Instituts und 

Zoologischen Museums der Universität Hamburg (ZMH). 

This collection was largely destroyed by Allied bombing during 

World War II. In the available catalogue of Hymenoptera from 

the University of Hamburg collections (Weidner 1972), any 

material not listed in is considered to have been destroyed during 

the war (Kai Schütte, pers. comm.). 

According to the material examined there are three species 

of Alophophion occurring in Brazil: A. flavorufus, A. alvarengai 

new species, and A. jujuye new species. The last two are greenish 

while A. flavorufus has coloration similar to the description 

of A. holosericeus. However, A. flavorufus lacks the lateral and 

lateromedian longitudinal carinae which, according to Hooker 

(1912) description are present in A. holosericeus, so unlikely to 

be the same species. 

Among the species occurring in Argentina A. filicornis cannot 

be A. holosericeus because it lacks a ramulus and according 

to the original description of the latter it is present. Similarly, 

A. holosericeus cannot be A. caleuche new species, A. diaguita 

new species, A. viride new species, and A. teushen new species 

because of the body coloration; and cannot be A. politus, A. 

capayan new species, A. carcanchoi new species, A. chango new 

species, A. mallecoensis new species, A. ona new species, A. yagane 

new species, A. chiquiyane new species, or A. yestay new species 

since they have the longitudinal carinae well defined (absent in 

A. holosericeus behind anterior transverse carina). None of the 

available species before me suitably match the description of A. 

holosericeus and so its identity will have to await extensive new 

collections from Parana. 

Discussion 

Species of Alophophion are not rare and there is an abundance 

of specimens deposited in collections. Nonetheless, only seven 

species have been described prior to the present revision and 

this despite the fact that many of these new taxa were already 

recognized from collections (e.g., Gauld 1985, Gauld & Lanfranco 

1987, Baudino 2005). This situation begs the question 


as to why the genus was never revised or these species at least 

described since Cushman established the genus in 1947. One 

reason may be that the type material was deposited in Europe 

while Alophophion is restricted to South America, a situation leaving 

local researchers without access to the material necessary for 

suitably identifying which species were those named and which 

were truly novel. Another reason may be that ophionines are 

not charismatic, as reality suggested by Gauld (1980). Indeed, 

most species have a relatively uniform morphology, reduced 

sculpture, slender bodies, elongate rather featureless appendages, 

and uniform fulvous coloration; and they lack the taxonomically 

useful differences in thoracic and abdominal sculpture, color, 

etc., that are so widely used to characterize genera and species 

of other ichneumonid subfamilies. Such uniformity means that 

species within the group are more challenging to distinguish. 

The combination of this difficulty in species recognition and 

lack of access to critical type material clearly resulted in a long 

stagnation of much needed taxonomic work. 

The re-descriptions provided herein were necessitated by the 

poor status of earlier descriptions, which provided little morphological 

information. Earlier accounts used almost exclusively 

color as a discriminating feature and this is not necessarily a 

reliable feature, when taken in isolation from other traits, for 

ophionines. Moreover, body coloration can change depending 

on the sampling method used to kill specimens; specimens that 

were greenish in life could turn to yellowish or those yellowish 

in life turn to orange depending on the medium used to collect 

them. Coloration can be used, as was done herein, but must 

be evaluated carefully and placed in context with additional 

morphological traits. 

The species of Alophophion were segregated into in four species 

groups herein. The features used were in the head morphology, 

particularly in the structure of the mandible. Species-group B 

has a diagonal groove extending from the upper corner to the 

middle of the mandible and bearing numerous, distinctly long 

setae. This structure was used as main feature to separate this 

species group from the others. Species-groups A and C also have 

a groove in the upper margin of the mandible and bearing setae 

but the groove is rather small, rarely reaching to the external 

surface of the mandible, and the setae are distinctly short and 

typically not as numerous. Species-group A has the compound 

eyes and ocelli larger than in the other groups and a narrower 

gena, while species-group C has a broader gena and face. 

Although these features were used to separate species-groups A 

and C, in some species these differences are somewhat vague 

or difficult to discern, such as in A. chiquiyane new species 

(species-group C) which is similar to (perhaps closely related?) 

A. trauco new species (in species-group A). Either such features 

are convergent between these two species (if the species groups 

are monophyletic), or one of the species groups is paraphyletic 

with respect to the others. Alophophion chiquiyane new species 

was placed in species-group C due to the proportions of the 

compound eyes and gena, thereby facilitating the identification 

keys. Species-group D has the upper surface of mandibles slightly 

convex; but the most striking characteristic is the bright yellow 

color, unique for them. The size of the ocelli was not considered 

alone to establish this species-group because the presence of 

small ocelli was found in other species like A. porculatus and A. 

yupankii new species. Gauld (1985) suggested that ophionines 

that have adopted a diurnal habit have small ocelli, particularly 

57

Alvarado 

in areas where competition with other Ichneumonidae is low, 

such as the top of high mountains, deserts, and remote islands; 

and this seem to be the case. Overall species-group A and C 

seem more similar between them than any other species group. 

Clearly all of this requires testing by a phylogenetic analysis. 

Gauld (1985) mentioned that the Ophion genus-group originated 

in the temperate north and that the origin of Alophophion 

was in Patagonia. During the middle Miocene (about 10 million 

years ago), much of South America was covered by a seawater 

transgression inside the continent, ultimately dividing it into 

three portions of land corresponding to the Andes, Guayanan, 

and Brazilian shield (Peña 2004, Räsänen et al. 1995, Webb 

1995). This arrangement of landmasses persisted until the beginning 

of the Pleistocene (about 5 million years ago) (Räsänen 

et al., 1995, Webb, 1995). This transgression would have been 

one of the most important barriers to prevent the spread of Alophophion 

between these three high masses of land, and restricting 

it to the Andean region, only with subsequent opportunities for 

dispersal elsewhere after the sea levels had regressed sufficiently. 

Since the mountain ecosystems of the Andean region were formed 

in the early Pleistocene, several antarctic-austral elements 

are found in the highlands of the Andes. The Andes allowed the 

dispersion of these antarctic-austral elements northward into a 

cold environment and open plant formation which held to a 

certain similarity to the austral landscape (Moret 2005). The 

elevation of the Andes progressively increased the possibility 

of dispersal by creating cool and arid habitats near the equator 

(Michener 2000). These factors may have allowed the northward 

dispersion of species of Alophophion, particularly those treated 

herein in species-groups A, C, and D. Alophophion atahualpai 

new species is the species with the northernmost distribution 

and was collected through an elevational gradient (from ~1700 

to 3100m) and was most abundant at the higher elevations 

where the habitat is cooler and most arid. Alophophion may 

prefer the habitats that are cooler, arid and higher regions of 

South America. 

The afore mentioned distribution is not unique to Alophophion. 

The Trachysphyrus-Aeliopotes complex (Ichneumonidae: 

Cryptinae) is confined to subequatorial South America, with 

species ranging from Ecuador to Tierra del Fuego, and occurring 

in the Andean, subtropical, temperate, and Neantarctic habitats 

(Porter, 1985). Porter found that the species were confined to 

the Andean Puna and Altiplano (in Peru, Bolivia, northern 

Chile, and northwestern Argentina); on the western slopes of 

the Andes, they occur above 2800 m and more than 4000 m, 

however, and the eastward distribution of this complex is bounded 

by Andean peaks at 4000–6000 m elevation. Aeglocryptus 

(Cryptinae) is also a subequatorial genus; distributed from the 

central Peru to neantarctic Chile and through Bolivia, Uruguay 

and Argentina to the Strait of Magellan on the east. This genus 

is excluded from tropical wet forests and tropical deciduous 

forests, although it is represented in almost every habitat from 

sea level to 4000 m (Porter 1987). Another genus studied by 

Porter (1987) is Thymebatis (Ichneumoninae: Jopinni). It has 

many species concentrated in the Andean, Neantarctic, and 

subtropical regions of South America. It is found also from sea 

level to 4000 m but generally inhabits cooler, higher, and more 

arid regions than those preferred by other Joppini, although some 

Thymebatis have invaded the subtropical wet forests of northern 

Argentina and southeastern Brazil (Porter 1980). There are other 

58 

genera of Ichneumonidae that inhabit cooler, arid, and higher 

regions of South America, as does Alophophion, that follow the 

same pattern of distribution. 

The northern distribution of Alophophion seems to be limited 

by the equator. None of the specimens of Alophophion studied 

here were collected north of 3 o S latitude, but the distribution 

is certainly wider than the 25 o S latitude suggested by Gauld & 

Lanfranco (1987). A genus adapted to this cold and dry environments 

may give a rise to a species able to persist in humid 

habitats like seems to be the case of A. mancocapaci new species 

and A. pedroi new species, the only species found in the eastern 

slopes of the Andes. 

Another factor that may be limiting the distribution Alophophion 

along the eastern slopes of the Andes is competition 

with Enicospilus Stephens, an extremely species-rich genus 

that is represented in tropical America and most diverse in 

lower montane tropical forests (Gauld & Lanfranco 1987). 

Along the western slopes of the Andes Enicospilus has few 

species in deserts and a restricted number in areas that have a 

pronounced dry season (Gauld 1985), a stark contrast to that 

of Alophophion. 

The distributions of A. chilensis, A. politus, and A. flavorufus 

can be more fully characterized now, as each was previously 

known only from the type localities which only mentioned 

countries where were collected. For example, A. chilensis was 

known to be distributed in Chile, but seems to be restricted 

to the Chilean regions of Atacama, Coquimbo and Valparaiso. 

For A. politus was known to be distributed in Chile, but seems 

to be restricted to the Chilean regions of Araucanía, Biobío, 

Coquimbo, Los Ríos, Maule, Libertador General Bernardo 

O'Higgins Region, Metropolitana de Santiago and Valparaíso; 

and the Argentinian provinces of Chubut and Rio Negro. For 

A. flavorufus was known to be distributed in Argentina and 

Brazil, but seems to be restricted to the Argentinan provinces 

Catamarca, Buenos Aires, Mendoza, and San Juan; in Brazil 

it was only recorded from Rio Grande do Sul. For both A. 

filicornis and A. porculatus the type localities are in Argentina, 

but no other specimen of these species has been collected and 

so they remain poorly understood. This situation certainly 

inhibits our ability to ascertain what factors are influencing 

their distribution, such as an association with a particular vegetation, 

climate, or host species. Further collections are needed 

to help establish a more complete picture of the distribution of 

several species in Alophophion. The distribution of many species 

may be wider than presently understood since several are only 

known from one or two localities. With few locality records is 

difficult to determine to what degree they are endemic or tied 

to particular local factors. 

More collections will not only help to establish the distribution 

of the species but will assuredly increase the number of 

species. For example, during the last six years 14 species were 

collected in Peru of which those only three had been previously 

sampled. Clearly when targeted collecting is undertaken 

the number of species has risen rapidly. Given that there are 

many suitable regions for Alophophion where no collecting efforts 

have been made; there will undoubtedly be new species 

to discover. Most importantly, modern collections are needed 

which have accurate geo-reference coordinates, elevation, 

habitat data, collecting methods employed, and dates and time 



(for phenological information). Much of the material available 

is historical and lacks many of these important data elements, 

thereby hindering our ability to make inferences about the 

biology, ecology, and history of the lineage. 

Unfortunately, there are no definitive host associations 

for any species of Alophophion. Beside that Baudino (2005) 

recovered undeterninated species of Alophophion from larvae 

of the cutworms Agrotis malefida (Guenée), Feltia gypaetina 

(Guenée), and Peridroma saucia (Hübner) feeding on Medicago 

sativa L. (Fabaceae); no host-species and parasitoid-species 

relation was done. The species of Alophophion attaching these 

cutworms are unknown; as Baudino (2005) mentioned the 

main reason were the lack of revision for the Alophophion 

and that there were probably several new species, these were 

her two limitations to determinate them to species. Certainly 

the lack of any previous means of identifying the species has 

hindered researchers working on possible hosts from positive 

host-parasitoid associations. Going forward it is hoped that 

the keys provided herein will permit researchers studying the 

biology of regional Lepidoptera to identify parasitoids when 

they are reared from caterpillars. 

The present revision provides a significantly improved perspective 

of species diversity and distribution for Alophophion 

and sets the stage for future cladistic and biogeographic work 

on the lineage. The current also study highlights that species of 

Alophophion face two potential problems: several of the species 

are distributed in endangered habitats such as Polylepis forest 

and puna grassland, and most are likely to be susceptible to 

changes in climate. It is predicted that the distribution of most 

insect species will shift towards the poles and to higher elevations 

as our current era of climate change plays out (Regniere 

2009). Given that many species of Alophophion already inhabit 

these extremes, such as some of the highest portions of the 

Andes; it leaves one to wonder what recourse these taxa have 

as the climate shifts. Clearly the wasps and their hosts may 

be as endangered as, or more so, than the habitats in which 

they reside. 

Acknowledgements 

I am grateful to David Wahl (AEIC), Gavin Broad (BMNH), 

Claire Villemant (MNHN), Marta Loiacono (MLP), Steve Heydon 

(UCDC), and Gerardo Lamas (MUSM) for loaning material 

used in this study; to Kai Schütte for providing information 

about A. holosericeus; to Dan Bennett, Ismael Hinojosa-Díaz, 

Roxana Arauco, and Matthew Gimmel for reviewing portions 

and providing alternative perspectives; to Manuel Dieguez for 

locating difficult citations; to Luis Figueroa for helping with 

photography; to Norberta Martinez for her excellent collections 

in Chaviña; to Juan Grados and to Conservation International 

and the Asociación Peruana para la Conservación de la Naturaleza 

(APECO) for supporting his research; to Letty Salinas and 

to the Agrokasa for funding her research; and to my Peruvian 

colleagues for bringing to my attention a portion of the material 

discussed herein. I also thank my Master thesis committee at 

the University of Kansas, Caroline S. Chaboo, Kirsten Jensen, 

and Michael S. Engel for advice and support during this work. 

This is a contribution of the Division of Entomology, University 

of Kansas Natural History Museum and of the Department of 

Entomology of the Museo de Historia Natural, Universidad 

Nacional Mayor de San Marcos. 

Literature cited 

Alvarado M. 2011. Biodiversidad de Ichneumonidae (Hymenoptera) 

en tres hábitat de ecosistemas de costa, sierra y selva de Perú. 

Tesis de Maestria en Entomología, Universidad Nacional 

Agraria La Molina, Lima, Perú. 148 pp 

Alvarado M., A. Rodríguez-Berrío, & S. Bordera. 2010. Colección de 

Ichneumonidae (Hymenoptera) del Museo de Entomología 

"Klaus Raven B." y del Museo de Historia Natural de la 

UNMSM, Perú. In Toledo, V. H., A. M. Corona, A. P. Flores, 

E. Tovar, J. M. Coronado, & E Ruíz-Cancino, (Eds.). II 

Taller Internacional de Recursos Naturales. Red de Cuerpos 

Académicos: 57–65. México; viii+ 107 pp. 

Baudino E. 2005. Ichneumonoideos (Hymenoptera) parasitoides 

del complejo de orugas cortadoras en pasturas de alfalfa 

(Medicago sativa L.) en la Argentina Central. Neotropical 

Entomology 34(3): 407–414. 

Bennett D.J. 2008. The ophionine wasps of Hawaii (Hymenoptera: 

Ichneumonidae). Journal of Hymenoptera Research 17(1): 

1–43. 

Brullé M.A. 1846. Hyménoptères, 4. In: Lepeletier de Saint-Fargeau 

A (Ed.). Histoire Naturelle des Insectes. Paris: 56–521. 

Casorali C. & R. Casorali Moreno. 1980. Cataloghi I. Collezione 

Imenotterologica di Massimilano Spinola, Museo Regionale 

di Scienze Naturali, Torino. 

Cushman R.A. 1947. A generic revision of the ichneumon-flies of the 

tribe Ophionini. Proceeding of the United states Natural 

Museum 96: 417–482. 

Dalla Torre C.G. 1902 Catalogus Hymenopterorum. Volumen III. 

Trigonalidae, Megalyridae, Stephenidae, Ichneumonidae, 

Agriotypidae, Evaniidae, Pelecinidae. Guilelmi Engelmann. 

Lipsiae. 1901, 1–544. 1902, 545–1141. 

DS-020-2011-MINAM. 2011. Decreto Supremo de categorización 

definitiva de la Zona Reservada Udima en Refugio de Vida 

Silvestre Bosques. El Peruano, Normas Legales, 21 de julio 

de 2011: 446890 - 446896 

Enderlein G. 1912. Die Insekten des Antarkto-Archiplata-Gebietes 

(Feuerland, Falklands-Inseln, Sued-Georgien). Kongliga 

Svenska Vetenskapsakademiens Handlingar 48(3): 41–42. 

Stockholm: Almqvist & Wiksell. 

Fernandez-Triana J.L. 2005. The taxonomy and biogeography of Cuban 

Ophioninae (Hymenoptera: Ichneumonidae). Zootaxa 

1007: 1–60. 

Gauld I.D. & J.M. Carter. 1983. The Ophioninae of the Galápagos 

Islands (Hymenoptera: Ichneumonidae). Journal of Natural 

History 17:2, 145-155 

Gauld I.D. & D. Lanfranco. 1987. Los géneros de Ophioninae de Centro 

y Sudamérica. Revista de Biologia Tropical 35: 257–267. 

Gauld I.D. & P.A. Mitchell. 1981. The taxonomy, distribution and host 

preferences of IndoPapuan parasitic wasps of the subfamily 

Ophioninae. Commonwealth Institute of Entomology. 

Slough, England, UK; 611pp. 

Gauld I.D. 1980. An analysis of the classification of the Ophion genusgroup 

(Ichneumonidae). Systematic Entomology, 5: 59–82. 

doi: 10.1111/j.1365-3113.1980.tb00400.x 

Gauld I.D. 1985. The phylogeny, classification and evolution of parasitic 

wasps of the subfamily Ophioninae (Ichneumonidae). 

Bulletin of the British Museum Natural History (Entomology) 

51: 61–185. 

Harris R.A. 1979. A glossary of surface sculpturing. Occasional Papers 

in Entomology 28:1-31. 

Hooker C.W. 1912. The Ichneumon flies of America belonging to the 

tribe Ophionini. Transactions of the American Entomological 

Society 38(1–2):1–176. 

Michener C.D. 2000. The Bees of the World. Johns Hopkins University 

Press; Baltimore, MD. 

Moret P. 2005. Los coleópteros Carabidae del páramo en los Andes 

del Ecuador. Sistemática, ecología y bio-geografía. Quito, 

Pontifia Universidad Católica del Ecuador, Centro de Biodiversidad 

y Ambiente, Monografía 2, 306 pp. 

Morley C. 1912. A revision of the Ichneumonidae based on the 

collection in the British Museum (Natural History) with 

descriptions of new genera and species Part I. Tribes Ophionides 

and Metopiides. London, UK; vi + 88 pp. 


59

Alvarado 

Peña C. 2004. Sistematica del Genero Forsterinaria Gray, 1973 

(Lepidoptera: Nymphalidae, Satyrinae).Lima, Universidad 

Nacional Mayor de San Marcos. Bachelor’s thesis. 

Porter C.C. 1980 Joppini (Hymenoptera: Ichneumonidae) of Tarapaca 

The Florida Entomologist 63(2):226-242. 

Porter C.C. 1985. Trachysphyrus and the new genus Aeliopotes in 

the coastal desert of Peru and north Chile (Hymenoptera: 

Ichneumonidae). Psyche 92(4):513-545. 

Porter C.C. 1987. A revision of the Chilean Mesostenini (Hymenoptera: 

Ichneumonidae). Contributions to the American 

Entomological Institute 23(3):1-164. 

Quicke D.L.J., N.M. Laurenne, M.G. Fitton, & G.R. Broad. 2009. A 

thousand and one wasps: a 28S rDNA and morphological 

phylogeny of the Ichneumonidae (Insecta: Hymenoptera) 

with an investigation into alignment parameter space and 

elision, Journal of Natural History 43:1305–1421. 

Räsänen, M.E., A.M., Linna, J.C.R. Santos, & F.R. Negri. 1995. Late 

Miocene tidal deposits in the Amazonian foreland basin. 

Science 269: 386-390. 

Regniere J. 2009. Predicting insect continental distributions from species 

physiology. Unasylva 60:37-42. [accessed 05 April 2013] 

Scherrer M.V. & A.P. Aguiar. 2012. A review of Debilos Townes (Hymenoptera, 

Ichneumonidae, Cryptinae) with description of 

twenty-seven new species. Zootaxa, 3469: 1–76. 

Simpson B.1979. A revision of the genus Polylepis (Rosaceae: Sanguisorbeae) 

Smithsonian Contributions to Botany 43:1–62 

Spinola M. 1851. Icneumonitos. In: Gay, C. Historia física y politica 

de Chile (Zoologia). 6:471–550 Paris. 572 pp. 

Townes H.K. & M. Townes. 1966. A catalogue and reclassification of 

the Neotropic Ichneumonidae. Memoirs of the American 

Entomological Institute 8: 1–367. 

Townes H.K. 1971. The genera of Ichneumonidae, Part IV. Memoirs 

of the American Entomological Institute 17: 1–372. 

Webb S.D. 1995. Biological Implications of the Middle Miocene 

Amazon Seaway. Science 269: 361-362. 

Weidner H. 1972. Die Entomologischen Sammlungen des Zoologisches 

Intituts und Zoologischen Museums der Universität 

Hamburg. Mitteilungen aus dem Zoologischen Museum 

Hamburg 68:107–134. 

Yu D.S. & K. Horstmann. 1997. A catalogue of world Ichneumonidae 

(Hymenoptera). Memoirs of the American Entomological 

Institute, 58, 1–1558. 

60 




Dieta de Leopardus colocolo en la Reserva Nacional 

ISSN-L 1561-0837 

de Junín 



Dieta de Leopardus colocolo (Carnivora: Felidae) en la Reserva Nacional de Junín, 

Junín, Perú 


Ursula Fajardo 1,2 , Daniel Cossíos 3 y Víctor Pacheco 1,4 

1 Departamento de Mastozoología, Museo de 

Historia Natural, Universidad Nacional Mayor de 

San Marcos, Av. Arenales 1256, Jesús María, 

Lima. Aptdo. 14-0434, Lima-14, Perú. 

2 Laboratorio de Estudios en Biodiversidad 

(LEB). Universidad Peruana Cayetano Heredia. 

Lima, Perú. 

3 Department of Genetics and Evolution, University 

of Geneva. 1211, Genève 4, Switzerland. 

4 Facultad de Ciencias Biológicas, Universidad 

Nacional Mayor de San Marcos. Lima, Perú. 

Email Ursula Fajardo: ursula_fajardo@yahoo.com 

Email Daniel Cossíos: dcossios@yahoo.com 

Email Víctor Pacheco: vpachecot@unmsm.edu.pe 

Citación: 

Fajardo U., D. Cossíos y V. Pacheco. 2014. Dieta 

de Leopardus colocolo (Carnivora: Felidae) en la 

Reserva Nacional de Junín, Junín, Perú. Rev. peru. 

biol. 21(1): 061- 070 (Mayo 2014). doi: http://doi. 

org/10.15381/rpb.v21i1.8248 

Resumen 

Este estudio caracteriza la dieta de Leopardus colocolo en los alrededores del lago Junín, en 

el centro del Perú, a partir de los restos de las presas presentes en 43 heces. El origen de 

las heces del predador se determinó a partir del ADN mitocondrial de las células epiteliales 

intestinales adheridas a la superficie de las heces, utilizando como marcador la región de 

control. Los restos de las presas fueron identificados utilizando literatura especializada y la 

comparación con especímenes de colección, identificando un total of 14 ítems alimenticios 

pertenecientes a mamíferos de las familias Cricetidae (6), Chinchillidae (1) y Caviidae (1) y 

aves de las familias Anatidae (3) y Rallidae (2), y un grupo de aves no identificadas (1). Los 

roedores fueron el principal componente de la dieta de L. colocolo, en frecuencia y biomasa, 

seguido por las aves. Entre los ítems alimenticios consumidos, el roedor cricétido pequeño 

Calomys sp. fue el más frecuente; sin embargo, el mayor aporte de biomasa relativa fue 

proporcionado por el roedor mediano Cavia tschudii. La amplitud de nicho obtenida fue baja 

(B sta 

= 0.17), indicando una dieta especializada. Nuestros resultados confirman que, como 

ocurre con la mayoría de felinos pequeños neotropicales, L. colocolo es un predador especializado 

en la captura de vertebrados, principalmente mamíferos pequeños. No se registró 

variación estacional en la dieta y el análisis de las clases de edad de los roedores cricétidos 

mostró que los adultos fueron los más consumidos. Se infiere que L. colocolo tiene un patrón 

de actividad diurno y nocturno. 

Palabras clave: Leopardus colocolo; heces; dieta; Reserva Nacional de Junín; Perú. 

Abstract 

This study characterized the diet of Leopardus colocolo from the surroundings of Junín lake, 

in the center of Peru, from prey remnants found within 43 scats. Origin of predator scats was 

determined from mitochondrial DNA from intestinal epithelial cells existing on the surface 

of the scats, using as a marker the control region. The prey remnants were identified using 

specialized literature and comparison with a voucher collection, identifying a total of 14 food 

items belong to mammals of Cricetidae (6), Chinchillidae (1) and Caviidae (1) families, birds 

of Anatidae (3) and Rallidae (2) families and one group of unidentified birds. The rodents were 

the main component of the diet of L. colocolo, in frequency and biomass, followed by birds. 

Among the food items consumed, the small cricetine rodent Calomys sp. was the most frequent; 

however, the greatest relative biomass contribution was provided by the medium rodent Cavia 

tschudii. The niche breadth obtained was low (B sta 

= 0.17), indicating a specialized diet. Our 

results confirm that, as with most neotropical small felids, L. colocolo is a predator specialized 

in capturing vertebrates, mainly small mammals. No seasonal variation was recorded in the 

diet and the analysis of the age class of the cricetine rodents showed that the adults were 

the most consumed. It is inferred that L. colocolo have diurnal and nocturnal activity patterns. 

Keywords: Leopardus colocolo; scats; diet; Reserva Nacional de Junín; Peru. 


Aceptado: 15/12/2013 







Rev. peru. biol. 21(1): 061- 070 (May 2014) 

61

Fajardo et al. 

Introducción 

El gato del pajonal Leopardus colocolo (Molina 1782) es 

un felino pequeño ampliamente distribuido en Sudamérica, 

cuyo rango de distribución se extiende desde Ecuador hasta 

la Patagonia en Argentina, incluyendo parte de Perú, Bolivia, 

Brasil, Chile, Paraguay y Uruguay (Wozencraft 1993, Sunquist 

& Sunquist 2002). En el Perú, se distribuye a lo largo de la 

Cordillera de los Andes y en la vertiente del Pacífico, desde el 

departamento de Tumbes (en el norte) hasta el departamento de 

Tacna (en el sur), ocupando una gran variedad de hábitats que 

incluyen la ceja de selva, páramo, pajonal de puna, humedales 

altoandinos, valles interandinos, bosques secos, colinas costeras y 

algunos humedales costeros, en un rango de elevación comprendido 

entre el nivel del mar y los 4982 m (Cossíos et al. 2007a, 

García-Olaechea et al. 2013, Grimwood 1969). 

A pesar de ser considerada una especie relativamente común 

(Nowell & Jackson 1996), el estudio de sus hábitos alimenticios 

ha recibido poca atención, existiendo pocos trabajos publicados 

a lo largo de su distribución. Estudios cuantitativos realizados en 

Argentina (Walker et al. 2007, Palacios 2006), Chile (Napolitano 

et al. 2008) y Bolivia (Viscarra 2008) documentan la importancia 

de los roedores de pequeño y mediano tamaño como principal 

componente de su dieta, seguido por las aves en la mayoría de 

los casos. En el centro de Brasil, Silveira et al. (2005) reportan 

de forma cualitativa el consumo de roedores y aves terrestres, 

mientras que Bagno et al. (2004), adicionalmente al consumo 

de estos ítems, reportan la presencia de reptiles en la dieta de este 

felino pequeño. Los libros de consulta de Sunquist y Sunquist 

(2002) e Iriarte y Jaksic (2012) documentan que la dieta de esta 

especie se encuentra constituida principalmente por vertebrados 

pequeños como roedores, lagomorfos, marsupiales y aves. 

En el Perú, el conocimiento sobre la dieta de L. colocolo 

proviene de los estudios de investigación realizados por Romo 

(1995) en el páramo del Parque Nacional Río Abiseo, en el norte 

del país, y por Cossíos et al. (2013) en los pastizales de altura de 

Ayacucho y Huancavelica, siendo este último un estudio de los 

felinos simpátricos L. colocolo y L. jacobita, sin distinción de la 

especie. Ambos estudios determinaron, a partir del análisis de 

heces, que los roedores pequeños constituyen el principal componente 

de la dieta de los pequeños felinos altoandinos. Además, 

es importante destacar el registro de frutos de Vaccinium sp. y 

restos del “majaz de montaña” Cuniculus taczanowskii en la dieta 

de L. colocolo, reportado únicamente por Romo (1995). Otra 

información sobre su dieta proviene de la observación casual 

de un individuo cuando se encontraba cazando vizcachas, en el 

altiplano del sur del país (Pearson 1951). 

Los estudios sobre la dieta de los carnívoros son importantes 

para comprender su rol como reguladores de las poblaciones 

de sus presas (Estes 1996, Roemer et al. 2009, Farias 2012) 

y obtener información sobre su comportamiento de forrajeo, 

relaciones interespecíficas con otros carnívoros y, además tienen 

implicancias en conservación (Manfredi et al. 2004, Novack et 

al. 2005, Walker et al. 2007, Napolitano et al. 2008). El uso 

de técnicas no invasivas como el análisis de heces es una alternativa 

viable y efectiva que permite obtener información sobre 

hábitos alimenticios de especies esquivas, de hábitos nocturnos 

o crepusculares y con poblaciones generalmente poco abundantes 

como los carnívoros (Korschegen 1987, Klare et al. 2011, 

Lagos & Villalobos 2012). Sin embargo, en casos de simpatría 

de especies congéneres es recomendable que el uso de características 

morfológicas para la identificación de las heces (forma, 

diámetro, etc.) vaya acompañado de un método de identificación 

más consistente, como los análisis genéticos moleculares que 

permiten identificar especies a partir de ADN de baja calidad 

procedente de heces, pieles de museo o pelos (Cossíos & Angers 

2006, Napolitano et al. 2008). 

En cuanto a su conservación, L. colocolo se encuentra categorizada 

como especie Casi Amenazada (NT) por la Unión 

Internacional para la Conservación de la Naturaleza y Recursos 

Naturales (IUCN 2014) y se encuentra listada en el Apéndice II 

de la Convención sobre el Comercio Internacional de Especies 

Amenazadas de Fauna y Flora Silvestres (CITES 2013). En 

el Perú, recientemente ha sido incluida en la categoría Datos 

Insuficientes (DD) mediante DS Nº. 004-2004-MINAGRI 

(2014). Entre las amenazas que afectan negativamente a las 

poblaciones distribuidas en el Perú se han identificado la caza y 

la fragmentación y alteración/pérdida de hábitat (Cossíos et al. 

2007a, Villalba et al. 2004). Un estudio reciente realizado por 

Cossíos et al. (2013), en los Andes de Ayacucho y Huancavelica, 

identificó como factores que pueden afectar negativamente a los 

gatos silvestres la presencia de animales domésticos y ganado, 

la quema de pastos y el uso de cuevas de gatos por parte de los 

pobladores locales. 

El objetivo del presente estudio fue determinar la dieta de 

L. colocolo en los alrededores del lago Junín, en la ecorregión 

Puna del centro del Perú, a partir del análisis de los restos de 

las presas contenidos en sus heces. El conocimiento generado 

sobre el nicho trófico de esta especie ayudará a comprender la 

importancia de los carnívoros en este ecosistema, a la vez que 

podrá ser empleado como información básica en la elaboración 

de planes de manejo para su conservación. 

Área de estudio 

El presente estudio se realizó en los alrededores del lago 

Junín, dentro de los límites de la Reserva Nacional de Junín 

(RNJ) (11º0’54”S y 76º06’27”W) y su zona de amortiguamiento 

(ZA), ubicadas en los distritos de Carhuamayo, Ondores 

y Junín (provincia y departamento de Junín) y los distritos 

de Ninacaca y Vicco (provincia y departamento de Pasco), 

sobre los 4100 msnm (Fig. 1). El área de estudio se encuentra 

ubicada en la ecorregión Puna (Brack 1986), destacando 

como principales formaciones vegetales los humedales alto 

andinos, el césped de puna y el pajonal (INRENA 2008). La 

temperatura media mensual oscila entre 4.6° y 6.7°C durante 

el día (estación Upamayo), disminuyendo por debajo de los 

0ºC durante la noche; las precipitaciones anuales alcanzan los 

940 mm en promedio; y su relieve comprende zonas planas en 

la parte central y colinas con afloramientos rocosos hacia los 

alrededores del lago (INRENA 2008). 

Materiales y métodos 

Se realizaron evaluaciones mensuales de 3 a 4 días de duración 

entre agosto del 2005 y julio del 2006, efectuando una búsqueda 

intensiva de letrinas de felinos pequeños en roquedales, afloramientos 

rocosos, peñas, casas abandonadas y pequeños islotes 

en el borde del lago, donde se recolectó un total de 50 heces. 

Las letrinas son acumulaciones de heces depositadas en lugares 

protegidos como pequeñas cuevas rocosas, debajo de rocas 

grandes, casas abandonadas y capillas (Cossíos et al. 2007b). 

62 

Rev. peru. biol. 21(1): 061 - 070 (Marzo 2014)

Dieta de Leopardus colocolo en la Reserva Nacional de Junín 

Figura 1. Área de estudio mostrando las localidades de muestreo 

(ʘ) 1: Casa Ondores Km 16, 2: Ondores, 3: Palomayo, 

4: Upamayo, 5: Ninacaca, 6: Huayre lago, 7: Huayre cerro, 

8: Condorpunta, 9: Shutipunta, 10: Antacocha, 11: Piñoc, 12: 

Chaupi. Las líneas punteadas alrededor del lago indican el 

límite de la Reserva Nacional de Junín, en los departamentos 

de Pasco y Junín. 

Figure 1. Study area showing the sampled localities (ʘ) 1: 

Casa Ondores Km 16, 2: Ondores, 3: Palomayo, 4: Upamayo, 

5: Ninacaca, 6: Huayre lago, 7: Huayre cerro, 8: Condorpunta, 

9: Shutipunta, 10: Antacocha, 11: Piñoc, 12: Chaupi. The dotted 

lines around the lake indicate the limit of the Reserva Nacional 

de Junín, in Pasco and Junín department. 

Figura 2. A) Heces de Leopardus colocolo, B) letrina de felino 

pequeño. La escala es 10 mm. 

Figure 2. A) Scats of Leopardus colocolo, B) latrine of small 

feline. Scale is 10 mm. 

En el campo, las heces de L. colocolo fueron discriminadas 

de las de otros carnívoros utilizando las características descritas 

por Palacios (2007) para heces de felinos pequeños, según las 

cuales las heces asemejan la forma de “un rosario” por la cercanía 

y profundidad de sus constricciones (Fig. 2A), presentan 

un diámetro promedio de 18 mm, contienen restos de origen 

animal y generalmente se ubican en lugares protegidos (Fig. 

2B). Posteriormente, las heces colectadas fueron secadas al sol, 

preservadas en bolsas de papel rotuladas, y dispuestas dentro de 

contenedores herméticos provistos de desecantes para evitar el 

ataque de hongos. 

La identificación de la especie de felino que produjo las heces 

colectadas fue realizada a partir del ADN de las células epiteliales 

intestinales adheridas a la superficie de las heces, utilizando 

como marcador la región de control del ADN mitocondrial, 

mediante la técnica PCR-RFLP (Polymerase Chain Reaction – 

Restriction Fragment Length Polymorphisms) que proporciona 

un patrón de bandas único para cada especie, visualizado en geles 

de poliacrilamida (Cossíos et al. 2009). Los análisis genéticos 

fueron realizados en el Departamento de Ciencias Biológicas de 

la Universidad de Montréal, Canadá. 

Para la caracterización de la dieta de L. colocolo se siguió la 

metodología de Korschgen (1987): las heces fueron sometidas a 


un proceso de ablandamiento con agua durante 2 horas, posteriormente 

los restos no digeridos de las presas fueron separados 

con ayuda de un microscopio estereoscópico realizando una 

disección longitudinal de las heces para rescatar porciones diferenciables 

de las presas (cintura pélvica, cintura escapular, etc.), 

mientras que los demás restos fueron lavados con agua corriente, 

utilizando coladores de 1 y 0.5 mm de apertura de malla. Las 

plumas encontradas en las heces fueron lavadas con champú, 

secadas y montadas en láminas para su posterior identificación. 

Los restos de las presas fueron identificados hasta el nivel 

taxonómico más bajo posible, partiendo de una lista de especies 

potenciales de roedores y aves, elaborada a partir de la base de 

datos de la colección científica de mamíferos del Museo de 

Historia Natural de la Universidad Nacional Mayor de San 

Marcos (MUSM), estudios realizados en el área de evaluación o 

localidades cercanas y otra literatura especializada (Hershkovitz 

1962, Dourojeanni et al. 1968, Myers et al. 1990, Musser & 

Carleton 2005, Schulenberg et al. 2007). Para la identificación 

de los roedores cricétidos, se utilizó como primer criterio discriminante 

el patrón de pentalofodoncia y tetralofodoncia de 

los molares (Hershkovitz 1962). Se utilizó la descripción de 

Reig (1987) para identificar individuos de la tribu Akodontini 

(Akodon) y la diagnosis de Olds y Anderson (1989) para identificar 

individuos de las tribus Phyllotini (Auliscomys y Calomys) 

63


Figura 4. Vista oclusal de las filas molares superior derecha 

e inferior izquierda de Lagidium peruanum (A y B, respectivamente) 

y Cavia tschudii (C y D). La escala es 10 mm. 

Figure 4. Occlusal view of upper right and lower left molar 

rows of Lagidium peruanum (A y B, respectively) and Cavia 

tschudii (C y D). Scale is 10 mm. 

Figura 3. Vista oclusal de las filas molares superior derecha 

(superior) e inferior izquierda (inferior) de: A) Akodon juninensis, 

B) Auliscomys pictus, C) Calomys sorellus y D) Neotomys 

ebriosus. La escala es 1 mm. 

Figure 3. Occlusal view of upper right (top) and lower left 

(bottom) molar rows of: A) Akodon juninensis, B) Auliscomys 

pictus, C) Calomys sorellus y D) Neotomys ebriosus. Scale 

is 1 mm. 

y Reithrodontini (Neotomys), todas ellas con un patrón de tetralofodoncia 

en los molares. Para la identificación específica de las 

presas mamíferas se utilizaron las descripciones de Hershkovitz 

(1962) y Myers et al. (1990) sobre la morfología de los dientes 

de roedores cricétidos, la clave dicotómica de Reise (1973) y 

la comparación con especímenes de la colección científica de 

mamíferos del MUSM (Fig. 3 y 4). 

En el caso de las aves, se realizó una primera identificación 

a nivel de Orden, utilizando las descripciones de Day (1965) y 

Rau y Martínez (2004), basadas en la microestructura (forma, 

distribución y pigmentación) de los nodos de las bárbulas de las 

plumas, con ayuda de un microscopio con ocular micrométrico. 

Se prepararon láminas de las plumas de especies de aves distribuidas 

en el Perú, representantes de los órdenes más comunes 

presentes en el área de estudio (Fig. 5). Para la identificación 

específica de las aves se utilizó la comparación con especímenes 

de la colección ornitológica del MUSM, considerando el tamaño, 

forma, textura y color de las plumas. 

Según Klare et al. (2011), la frecuencia de ocurrencia es 

el método usualmente empleado para la determinación de la 

importancia de los ítems alimenticios de la dieta en estudios de 

carnívoros; sin embargo, no recomiendan su uso como único 

estimador debido a que tiende a sobrestimar la importancia de 

presas pequeñas y subestimar la de las presas de mayor tamaño. 

Figura 5. Bárbulas de las plumas de los Órdenes Anseriformes 

(A) y Gruiformes (B), representados por las especies Anas 

flavirostris y Fulica gigantea, respectivamente. La escala es 

50 µm. 

Figure 5. Barbules of the feather of the Anseriformes (A) 

and Gruiformes (B) orders, represented by the species Anas 

flavirostris and Fulica gigantea, respectively. Scale is 50 µm. 

64 



Estos autores sugieren el cálculo de la biomasa basada en factores 

de corrección (ecuaciones de conversión especie-específica) 

como el método que proporciona la mejor aproximación de la 

dieta; sin embargo, las ecuaciones de conversión se encuentran 

disponibles principalmente para carnívoros grandes o medianos 

como el puma (Ackerman et al. 1984), zorros (Lockie 1959) y 

coyotes (Weaver & Hoffman 1979, Monroy-Vilchis & Frieven 

2006), siendo una limitante para los estudios dietarios de pequeños 

felinos neotropicales. En forma alternativa, algunos estudios 

dietarios emplean el cálculo de la biomasa relativa para especies 

presa pequeñas (


Finalmente, se utilizó la información sobre los patrones de 

actividad temporal de las presas consumidas para deducir el horario 

de alimentación aproximado de L. colocolo. Esta información 

fue obtenida a partir de Pearson (1948, 1951), Pizzimenti y De 

Salle (1980), Ferro y Barquez (2008), Iriarte (2008) y Eisenberg 

y Redford (1999). Para esta aproximación solo se incluyeron 

aquellos ítems plenamente identificados. 

Los análisis estadísticos de los datos fueron realizados con el 

programa Systat versión 11.0. 

Resultados 

De un total de 50 heces colectadas, solo 41 fueron analizadas 

genéticamente, resultando que 34 pertenecieron a Leopardus 

colocolo y 7 dieron un resultado negativo para la especie, siendo 

éstas últimas excluidas de los análisis. Las 9 heces restantes fueron 

asignadas a L. colocolo por provenir de letrinas donde en más de 

una oportunidad las heces fueron identificadas genéticamente 

como pertenecientes a esta especie, siendo incluidas en el análisis 

de la dieta. 

A partir de 43 heces analizadas se obtuvieron restos de 248 

individuos vertebrados, identificándose 14 ítems alimenticios 

pertenecientes a mamíferos de las familias Cricetidae (6), Chinchillidae 

(1) y Caviidae (1), y aves de las familias Anatidae (3) 

y Rallidae (2) y un grupo de aves no identificadas (Tabla 1). 

Los restos vegetales encontrados (hojas de gramínea) no fueron 

incluidos en los análisis, debido a que fueron considerados 

de consumo incidental por su bajo porcentaje de ocurrencia y 

escasa cantidad hallada en cada una de las heces. 

Nuestros resultados muestran que los roedores como grupo 

constituyen el principal componente de la dieta de L. colocolo, 

representando el 87.1% del total de presas consumidas y estando 

presentes en el 97.7% de las heces examinadas. Las aves representaron 

únicamente el 12.9% del total de presas consumidas, pero 

fueron registradas en el 58.1% de las heces examinadas (Tabla 1). 

Es importante destacar que en este estudio se reporta por primera 

vez la presencia de aves de las familias Anatidae y Rallidae 

en la dieta de L. colocolo. 

Entre los ítems consumidos, el roedor cricétido Calomys sp. 

fue el más frecuente, representando el 52.8% del total de presas 

consumidas y fue registrado en el 79.1% de las heces examinadas 

(Tabla 1). Estadísticamente, la prueba no paramétrica Kruskall- 

Wallis detectó diferencias significativas en el consumo de Calomys 

sp. respecto a los demás ítems alimenticios (Kruskall-Wallis 

Statistic = 69.163, df=3, p< 0.001). Así mismo, la Prueba U de 

Mann-Whitney aplicada por pares a los ítems más consumidos 

también evidenció diferencias significativas en el consumo del 

roedor Calomys sp. respecto a Akodon juninensis (Prueba U de 

Mann-Whitney de 249.000, p< 0.001), Calomys sp. respecto a 

Auliscomys pictus (Prueba U de Mann-Whitney de 471.500, p< 

0.001) y Calomys sp. respecto a Neotomys ebriosus (Prueba U de 

Mann-Whitney de 1600.000, p< 0.001). 

Los roedores también constituyen el principal componente de 

la dieta de L. colocolo en términos de biomasa relativa, aportando 

el 58.2% de la biomasa total, seguido por las aves con un aporte 

del 41.8% (Tabla 1). Entre los ítems alimenticios registrados, el 

roedor de mediano tamaño Cavia tschudii fue el que proporcionó 

el mayor aporte de biomasa (25.3%), a pesar de encontrarse poco 

representado en términos de frecuencia (Tabla 1). 

La amplitud de nicho trófico de L. colocolo fue estimada en 

0.17 (B sta 

), indicando una dieta especialista, dominada por el 

roedor cricétido Calomys sp. 

Tabla 1: Composición de la dieta de Leopardus colocolo en la RNJ. Para cada ítem alimenticio se indica su peso promedio 

en gramos (P), el número de individuos registrados en las heces (n), porcentaje de ocurrencia (%n), número de heces que 

presentaron el ítem (F), porcentaje de heces (%F) y porcentaje de biomasa relativa que aporta (%B). 

Table 1. Diet composition of Leopardus colocolo in the RNJ. For each food item indicated their average body mass in grams 

(P), the number of individuals found in scats (n), percentage of occurrence (%n), number of scats that contained the food item 

(F), percentage of scats (%F) and percentage of relative biomass that provides (%B). 

Ítems alimenticios (presas) P (g) n %n F %F %B 

Akodon juninensis 27.9 7 2.8 5 11.6 1.0 

Auliscomys pictus 53.8 35 14.1 23 53.5 9.7 

Calomys sp. 19.8 131 52.8 34 79.1 13.4 

Neotomys ebriosus 65 7 2.8 5 11.6 2.3 

Lagidium peruanum 1236 1 0.4 1 2.3 6.4 

Cavia tschudii 446.3 11 4.4 7 16.3 25.3 

Cricétidos muy pequeños NI - 21 8.5 13 30.2 - 

Cricétidos pequeños NI - 3 1.2 3 7 - 

Total Roedores - 216 87.1 42 97.7 58.2 

Anas flavirostris 470 4 1.6 4 9.3 9.7 

Anas georgica 683 2 0.8 2 4.7 7.1 

Anas puna 527 6 2.4 6 14 16.3 

Gallinula chloropus 565 3 1.2 3 7 8.7 

Rallidae - 5 2 5 11.6 - 

Aves NI - 12 4.8 9 20.9 - 

Total aves - 32 12.9 25 58.1 41.8 

Total individuos registrados 248 

Total heces examinadas 43 

Total biomasa relativa 19375.4 

NI: no identificado 

66 



Por otro lado, se determinó que entre los roedores cricétidos 

los adultos fueron los más consumidos (X 2 =8.4; df=3; p 0.05); sin embargo, debido al tamaño 

reducido de la muestra (época seca=8, época húmeda=6), este 

resultado debe ser considerado de forma referencial. El pequeño 

tamaño de la muestra se debió a que las letrinas monitoreadas 

inicialmente fueron quemadas por los pobladores locales, por lo 

que se tuvo que evaluar nuevas letrinas de las que no se conocía 

la fecha exacta de deposición de las heces. Los roedores fueron 

los más consumidos, tanto en la época seca (%n=88, %F=100) 

como en la húmeda (%n=86.4, %F=100), seguido por las aves 

con %n=12 y %F=62.5 en la época seca y %n=13.6 y %F=50 

en la época húmeda (Tabla 2), siendo importante destacar que 

el consumo de aves acuáticas fue registrado principalmente entre 

los meses de agosto y diciembre. El roedor Calomys sp. fue el 

ítem alimenticio más frecuente, tanto en la época seca (%n= 52, 

%F= 75) como en la húmeda (%n= 40.9, %F= 83.3) (Tabla 2). 

En relación al patrón de actividad temporal de L. colocolo, se 

infiere que éste utiliza tanto horas del día como de la noche para 

alimentarse, ya que no se observó diferencias significativas en 

el consumo de presas con actividad nocturna como Calomys sp. 

(81%) respecto al consumo de presas con actividad nocturnadiurna 

como Akodon juninensis, Auliscomys pictus, Neotomys 

ebriosus y Cavia tschudii) (73.8%), y las presas con actividad 

diurna como Lagidium peruanum, Anas spp., Gallinula chloropus 

y Rallidae estuvieron bien representadas (47.6%). 

Discusión 

Los resultados obtenidos muestran que L. colocolo depreda 

principalmente sobre roedores pequeños y medianos, concordando 

con lo documentado en Perú (Romo 1995, Cossíos et 

al. 2013) y en otros países rango de su distribución (Napolitano 

et al. 2008, Viscarra 2008, Walker et al. 2007, Palacios 2006). 

Nuestros resultados son consistentes con lo documentado para 

la mayoría de pequeños felinos neotropicales, cuya dieta se basa 

principalmente en el consumo de vertebrados pequeños y, especialmente, 

en mamíferos pequeños como roedores, lagomorfos 

y marsupiales (Bisceglia et al. 2008, Silva-Pereira et al. 2011, 

Iriarte & Jaksic 2012). 

De manera similar a este estudio, diversos trabajos han mostrado 

la importancia de las aves en la dieta de L. colocolo, siendo 

el segundo componente más consumido (Viscarra 2008, Walker 

et al. 2007, Napolitano et al. 2008, Cossíos et al. 2013). Este 

estudio reporta por primera vez el consumo de aves acuáticas de 

las familias Anatidae y Rallidae en la dieta de L. colocolo, resultado 

documentado únicamente para el “gato montés argentino” 

Leopardus geoffroyi en los humedales de los alrededores de la 

Laguna Mar Chiquita, en la Reserva de Biósfera Mar Chiquita, 

Argentina, (Manfredi et al. 2004). 

La alta representatividad del roedor Calomys sp. en la dieta 

de L. colocolo podría estar relacionada con una mayor abundancia 

de éste respecto a otras especies presa presentes en el 

área de estudio, a la facilidad con la que puede ser capturado 

o a una mayor sincronicidad entre su patrón de actividad y el 

del predador. En este trabajo no se evaluó la abundancia de las 

presas, pero se tiene conocimiento de que las dos especies del 

género Calomys potencialmente presentes en el área de estudio 

son comunes en la ecorregión Puna de Perú y en otros países 

donde se distribuyen. Calomys sorellus es considerada relativamente 

común en ambientes altoandinos y arbustivos de Perú 

(Hershkovitz 1962) y Calomys lepidus ha sido reportada común 

en la región Altoandina de Bolivia (Tarifa & Yensen 2001) y 

una de las especies dominantes en las estepas altoandinas de las 

Cumbres Calchaquíes y Nevados del Aconquija, en la provincia 

de Tucumán, en Argentina (Ferro & Barquez 2008). Ambas 

especies de roedores presentan una estrecha asociación con zonas 

abiertas como pastizales y matorrales, en el caso de Calomys 

sorellus (Hershkovitz 1962) y pastizales y vegas, en el de Calomys 

lepidus (Tarifa & Yensen 2001, Ferro & Barquez 2008), lo cual 

podría hacerlas más vulnerables que otras especies presa. Sobre 

Tabla 2: Comparación estacional de la dieta de Leopardus colocolo en la RNJ. Para cada ítem alimenticio se indica el número 

de individuos registrados en las heces examinadas (n), porcentaje de ocurrencia (%n), número de heces que presentaron el 

ítem (F) y el porcentaje de heces (%F). 

Table 2. Seasonal comparison of the diet of Leopardus colocolo in the RNJ. For each food item indicated the number of individuals 

found in scats (n), percentage of occurrence (%n), number of scats that contained the food item (F) and percentage 

of scats (%F). 

Ítems alimenticios (presas) Época Seca Época Húmeda 

n %n F %F n %n F %F 

Akodon juninensis 3 6 1 12.5 1 4.5 1 16.7 

Auliscomys pictus 6 12 4 50 6 27.3 3 50 

Calomys sp. 26 52 6 75 9 40.9 5 83.3 

Neotomys ebriosus 1 2 1 12.5 2 9.1 2 33.3 

Cavia tschudii 1 2 1 12.5 - - - - 

Cricétidos muy pequeños NI 7 14 3 37.5 1 4.5 1 16.7 

Total Roedores 44 88 8 100 19 86.4 6 100 

Anas flavirostris 1 2 1 12.5 - - - - 

Anas georgica - - - - 1 4.5 1 16.7 

Anas puna 3 6 3 37.5 1 4.5 1 16.7 

Gallinula chloropus - - - - 1 4.5 1 16.7 

Aves NI 2 4 2 25 - - - - 

Total aves 6 12 5 62.5 3 13.6 3 50 

Total individuos registrados 50 22 

Total heces examinadas 8 6 


67


este punto, la teoría de Schoener (1971) señala que muchos 

carnívoros seleccionan sus presas por la facilidad con la que éstas 

pueden ser capturadas más que por su abundancia. En general, 

los roedores cricétidos son más vulnerables a la depredación que 

las aves acuáticas quienes, además de su mayor tamaño, tienen 

la capacidad de correr o volar y refugiarse durante el día en el 

lago (Fjeldså & Krabbe 1990, Schulenberg et al. 2007). Por otro 

lado, Napolitano et al. (2008) en su estudio realizado en el norte 

de Chile sugirieron que el patrón de actividad de las presas fue 

el factor que determinó su depredación por parte de L. colocolo, 

basados en el mayor consumo de roedores nocturnos del género 

Phyllotis sobre especies diurnas que presentaron una mayor 

abundancia. Posteriores estudios son necesarios para identificar 

el factor o factores que ocasionan que el roedor Calomys sp. sea 

el ítem más consumido. 

El consumo de aves acuáticas de los géneros Anas y Gallinula, 

sugiere que L. colocolo aprovecha alguna situación particular que 

las convierte en presas vulnerables. En la Reserva de Biósfera Mar 

Chiquita, en Argentina, Canepuccia et al. (2007) encontraron 

que la abundancia de las aves acuáticas, la distancia entre la presa 

y el predador previo al ataque y el tamaño de la presa determinan 

el consumo de aves acuáticas por parte de Oncifelis geoffroyi. 

Estos autores señalan que la vegetación que rodea las áreas de 

descanso de las aves acuáticas permite al predador aproximarse 

sin ser visto muy cerca de su presa. En las costas de Virginia 

(Erwin et al. 2001) y en España (Ruiz-Olmo et al. 2003) se ha 

reportado la depredación de aves acuáticas por parte del zorro 

rojo Vulpes vulpes, durante la época de reproducción de éstas. 

En el presente estudio se obtuvieron indicios que sugieren que 

L. colocolo aprovecha la vulnerabilidad que muestran las aves 

acuáticas durante la época reproductiva, ya que éstas fueron 

registradas en las heces colectadas entre finales de agosto y 

diciembre, coincidiendo con parte de la época de reproducción 

de las especies de Anatidae y Rallidae registradas. 

La “vizcacha peruana” Lagidium peruanum estuvo muy poco 

representada, en términos de frecuencia, en la dieta de L. colocolo, a 

diferencia de lo documentado en el sur de Bolivia (Viscarra 2008) y 

norte de Chile (Napolitano et al. 2008) donde la “vizcacha chilena” 

Lagidium viscacia constituye el principal ítem alimenticio de su 

dieta o es parte importante de ella. Se presume que este resultado 

podría estar relacionado con las características del área de estudio, 

que presenta solo algunos afloramientos rocosos dispersos donde 

habitan pequeñas poblaciones de vizcachas. En el presente estudio, 

los roedores también constituyen el principal componente de la 

dieta de L. colocolo en términos de biomasa relativa, siendo el “cuy 

silvestre” Cavia tschudii el ítem alimenticio que proporciona el 

mayor aporte de biomasa a la dieta, concordando con lo reportado 

en Chile por Napolitano et al. (2008), donde la especie Lagidium 

viscacia representa el principal ítem alimenticio en aporte de 

biomasa. Estos resultados evidencian la importancia de las presas 

de mayor tamaño en aporte de biomasa a la dieta de L. colocolo. 

A pesar de encontrarse numéricamente poco representadas en 

la dieta de L. colocolo, las aves mostraron un aporte importante en 

biomasa relativa (41.8%), mayor al reportado por Napolitano et 

al. (2008) para flamencos y perdices (21.3%). El alto porcentaje 

de biomasa relativa que aportan las aves en el presente estudio se 

debe al consumo de aves acuáticas cuyo tamaño y peso superan 

ampliamente el de las presas más frecuentes como los roedores 

cricétidos. 

La estrecha amplitud de nicho trófico obtenida para L. colocolo 

sugiere una dieta especializada, constituida exclusivamente 

por roedores y aves, particularmente por el roedor cricétido 

Calomys sp. La especialización en su dieta ha sido documentada 

en otros países rango de su distribución (Palacios 2006, Walker 

et al. 2007, Napolitano et al. 2008), siendo las especies presa 

más consumidas los roedores de los géneros Ctenomys, Phyllotis 

y Lagidium viscacia. Estos resultados discrepan con lo reportado 

por Viscarra (2008) en Bolivia, quien la considera una 

especie generalista. Sin embargo, con la finalidad de interpretar 

adecuadamente los datos de un estudio dietario y determinar 

el comportamiento de forrajeo de una especie, se recomienda 

conocer la abundancia de las presas en el área de estudio (Korschgen 

1987, Jaksic 1989). 

La mayor proporción de roedores cricétidos adultos en 

la dieta de L. colocolo podría deberse a que las campañas de 

muestreo realizadas en el área de estudio no coincidieron con 

la etapa de reclutamiento, por lo cual no se encontraron individuos 

juveniles en las heces. También podría estar relacionada 

a la mayor movilidad que muestran los roedores en la etapa 

adulta respecto a la etapa juvenil, lo cual los hace fácilmente 

detectables por el predador, como lo sugieren Castro y Jaksic 

(1995). Los roedores, durante la etapa juvenil, permanecen 

protegidos dentro de sus madrigueras. Iriarte (2008) reporta 

que el roedor Calomys lepidus alcanza su madurez sexual entre 

los 72 y 82 días, lo cual da una idea de la corta duración de 

la etapa juvenil. Por otro lado, en una población de roedores 

los individuos viejos se encuentran naturalmente en baja 

abundancia debido a la competencia, enfermedades, presión 

de depredación, etc. 

Por otra parte, no se observó variación estacional en la dieta 

de L. colocolo; sin embargo, se recomienda el uso de una muestra 

de mayor tamaño para confirmar estos resultados. 

Finalmente, se infiere que L. colocolo tiene un patrón de 

actividad nocturno y diurno, ya que su dieta incluye especies 

presa con actividad tanto nocturna como diurna. Sin embargo, 

esta deducción se basa en información procedente de estudios 

realizados en los Andes del sur de Perú (Pearson 1948, 1951), 

Chile (Iriarte 2008) y las altas cumbres de la provincia de Tucumán, 

en Argentina (Ferro & Barquez 2008), siendo necesario 

obtener información sobre la historia natural de los roedores del 

área de estudio para confirmar este resultado. Nuestros resultados 

concuerdan con lo reportado por Bagno et al. (2004), en el 

Cerrado de Brasil, y por Napolitano et al. (2008), en el norte de 

Chile. Reportes de actividad diurna han sido documentados por 

Silveira et al. (2005), en el Cerrado de Brasil; García-Olaechea 

et al. (2013), en la costa norte del Perú y Pacheco (com. pers. 

2014) en los departamentos de Lima, Ancash y La Libertad. 

Actividad nocturna ha sido reportada por Lucherini et al. 

(2009) en el norte de Argentina, a partir de fototrampeos, y 

por Pearson (1951) en el Altiplano del sur de Perú, a partir de 

un avistamiento casual. Al parecer, el patrón de actividad de L. 

colocolo varía de acuerdo a la localidad; al respecto, Lucherini et 

al. (2009) sugieren que esta variación puede estar relacionada 

con las diferencias existentes entre cada zona o ser el resultado 

de un comportamiento para evadir otros carnívoros que viven 

en simpatría. Posteriores estudios utilizando cámaras trampa son 

necesarios para obtener una mejor aproximación sobre el patrón 

de actividad de L. colocolo en el área de estudio. 

68 



Agradecimientos 

Esta investigación fue parte del proyecto “Ecología y conservación 

de pequeños félidos andinos en la Reserva Nacional 

de Junín, el Santuario Nacional de Huayllay y alrededores”, 

liderado por Daniel Cossíos y desarrollado gracias al financiamiento 

de Wildlife Conservation Network y el apoyo de 

la Alianza Gato Andino. Agradecemos al ex Director de la 

Reserva Nacional de Junín Ing. Marco Arenas, por el apoyo 

logístico brindado y al Sr. Melecio Arias por su apoyo como 

guía en el trabajo de campo. Agradecemos a las Directoras 

del Departamento de Ornitología del Museo de Historia 

Natural-UNMSM, Dra. Irma Franke y Blga. Letty Salinas 

por permitirnos el uso de la colección científica de aves, y a 

las biólogas Sonia Salazar y Yisela Quispe por su orientación 

en la identificación de las muestras de aves. Igualmente, agradecemos 

a Cecilia Barriga por su ayuda en la elaboración del 

mapa del área de estudio, y a Jessica Amanzo, Marina Villalobos 

y José Pérez por la revisión del manuscrito y comentarios que 

ayudaron a su mejora. 

Contribución de los autores 

Ursula Fajardo diseñó el estudio, obtuvo los datos de campo, 

realizó los análisis y la interpretación de datos y se encargó de la 

redacción del artículo. Daniel Cossíos lideró el proyecto del cual 

se tomó parte de la información para este estudio, realizó los 

análisis de genético para la identificación de las heces, contribuyó 

en la interpretación de datos y realizó una revisión crítica del 

contenido intelectual del trabajo. Víctor Pacheco contribuyó en 

el diseño del estudio, la interpretación de los datos y realizó una 

revisión crítica de su contenido intelectual. Todos los autores 

aprobaron el manuscrito final. 

Literatura citada 

Ackerman B.B., F.G. Lindzey & T.P. Hemker. 1984. Cougar food 

habits in southern Utah. Journal Wildlife Management 

48(1): 147-155. 

Bagno M.A., F.G.H. Rodrigues, M.P. Villalobos, et al. 2004. Notes 

on the Natural History and Conservation Status of Pampas 

Cat, Oncifelis colocolo, in the Brazilian Cerrado. Mammalia 

68: 75-79. 

Brack-Egg E. 1986. Las Ecorregiones del Perú. Boletín de Lima 44: 

57-70. 

Canepuccia A., M. Martinez & A. Vassallo. 2007. Selection of waterbirds 

by geoffroy’s cat effects of prey abundance, size and 

distance. Mammalian Biology 72(3): 163-173. 

CITES 2013. (en línea). Apéndices I, II y III. < www.cites.org/esp/ 

app/appendices.shtml>. Acceso 20/06/2013. 

Cossíos D.E. & B. Angers. 2006. Identification of Andean felid 

feces using PCR-RFLP. Mastozoología Neotropical 13(2): 

239-244. 

Cossíos D.E., M. Lucherini, M. Ruiz-García & B. Angers. 2009. 

Influence of ancient glacial periods on the Andean fauna: 

the case of the pampas cat (Leopardus colocolo). BMC 

Evolutionary Biology 9: 68. doi:10.1186/1471-2148-9-68. 

Cossíos E.D., A. Madrid, J.L. Condori & U. Fajardo. 2007a. An update 

on the distribution of Andean cat Oreailurus jacobita 

and pampas cat Lynchailurus colocolo in Peru. Endangered 

Species Research 3: 313-320. doi: 10.3354/esr00059. 

Cossíos D.E., F. Beltrán, M. Bennet, et al. 2007b. Manual de metodologías 

para relevamientos de carnívoros alto andinos. Alianza 

Gato Andino. Buenos Aires, Argentina. 72pp. 

Cossíos D.E., L. Maffei & U. Fajardo. 2013. Ecología de pequeños 

félidos en los Andes de Ayacucho y Huancavelica, Perú. En: 

A. Alonso, F. Dallmeier and G. Servat, eds. Monitoreo de 

biodiversidad: lecciones de un megaproyecto transandino. 

Smithsonian Institution Scholarly Press, Washington, D.C. 

Pp. 341-350. 

Colwell R.R. & D.J. Futuyma. 1971. On the measurement ofniche 

breadth and overlap. Ecology 52: 567–572. 

Day M.G. 1966. Identification of hair and feather remains in the gut 

and faeces of stoat and weasels. Journal of Zoology (London) 

148: 201-217. doi: 10.1111/j.1469-7998.1966.tb02948.x 

Dourojeanni M.R., R. Hofmann, R. Garcia, et al. 1968. Observaciones 

preliminares para el manejo de las aves acuáticas del Lago de 

Junín, Perú. Revista Forestal del Perú 2(2): 3-52. 

DS Nº. 004-2004-MINAGRI. 2014. Decreto Supremo que aprueba la 

actualización de la lista de clasificación y categorización de las 

especies amenazadas de fauna silvestre legalmente protegidas. 

El Peruano, Normas Legales, 08.04.2014:520497-520504. 

Eisenberg J.F. & K.H. Redford. 1999. Mammals of the Neotropics. 

Volume 3. The Central Neotropics: Ecuador, Peru, Bolivia, 

Brazil. University of Chicago Press, Chicago. 609 pp. ISBN. 

0-226-19541-4 (cloth), ISBN. 0-226-19542-2 (paper). 

Erwin R.M., B.R. Truitt & J.E. Jiménez. 2001. Ground-nesting 

waterbirds and mammalian carnivores in the Virginia Barrier 

Island Region: Running out of options. Journal of Coastal 

Research 17(2): 292-296. 

Estes J.A. 1996. Predators and ecosystem management. Wildlife Society 

Bulletin 24: 390-396. 

Farias A.A. 2012. Los Carnívoros y su papel en el Ecosistema. En: A. 

Iriarte and F. Jaksic, eds. Los Carnívoros de Chile. Ediciones 

Flora y Fauna Chile y CASEB, P.U. Católica de Chile. Pp. 

30-36. 

Ferro L. & R. Barquez. 2008. Comentarios sobre la distribución de 

Abrothrix andinus y Calomys lepidus (Rodentia: Cricetidae) 

en la provincia de Tucumán, Argentina. Mastozoología 

Neotropical 15(2): 197-201. 

Fjeldså J. & N. Krabbe. 1990. Birds of the high Andes. Zoological 

Museum, University of Copenhagen and Apollo Books, 

Copenhagen. 

Grimwood I.R. 1969. Notes on the distribution and status of some 

Peruvian mammals. American Commitee for International 

Wild Life Protection and New York Zoological Society, 

Special Publication 21: 1-86. 

Hershkovitz P. 1962. Evolution of Neotropical Cricetine rodents 

(Muridae) with special reference to the Phyllotine group. 

Fieldiana: Zoology 46: 1-524. 

INRENA. 2008. Reserva Nacional de Junín. Plan Maestro 2008-2012. 

Lima. 273pp. 

Iriarte A. 2008. Mamíferos de Chile. Lynx Edicions. Barcelona, 

España. 420pp. 

Iriarte A. & F. Jaksic. 2012. Los Carnívoros de Chile. Ediciones Flora 

y Fauna Chile y CASEB, P.U. Católica de Chile. 260pp. 

IUCN 2014. (en línea). IUCN Red list of threatened species. Version 

2014 . Acceso 20/04/2014. 

Jaksic F. 1989. What do carnivorous predators cue in on: size or abundance 

of mamalian prey? A crucial test in California, Chile 

and Spain. Revista Chilena de Historia Natural 62: 237-249. 

Jaksic F. 2001. Ecología de comunidades. Ediciones Universidad Católica 

de Chile. Santiago, Chile. 233 p. 

Klare U., J.F. Kamler & D.W. Macdonald. 2011. A comparison and 

critique of different scat-analysis methods for determining 

carnivore diet. Mammal Review 41(4): 294-312. doi: 

10.1111/j.1365-2907.2011.00183.x 

Koepcke H.W. & M. Koepcke. 1963. Las aves silvestres de importancia 

económica del Perú. Servicio Forestal y de Caza y Servicio 

de Pesquería, Lima. 

Korschegen L.J. 1987. Procedimientos para el análisis de los hábitos 

alimentarios. In: R. Rodríguez (Ed). Manual de técnicas de 

gestión de vida silvestre. The Wildlife Society. Inc. Bethesda. 

Pp.119-134. 

Levins R. 1968. Evolution in changing environments: some theoretical 

explorations. Princeton University Press, Princeton, 

New Jersey. 

Lockie J.D. 1959: The estimation of the food of the foxes. Journal of 

Wildlife Management 23: 224-227. 

Lucherini M., J.I. Reppucci, R.S. Walker, et al. 2009. Activity Pattern 

Segregation of Carnivores in the High Andes. Journal of 

Mammalogy 90(6): 1404-1409. doi: 10.1644/09-MAMM- 

A-002R.1 


69


Manfredi C., M. Lucherini, A. Canepuccia & E. Casanave. 2004. 

Geographical variation in the diet of Geoffroy’s cat (Oncifelis 

geoffroyi) in pampas grassland of Argentina. Journal of 

Mammalogy 85(6): 1111-1115. 

Monroy-Vilchis O. & C. Frieven. 2006. Dejection and expulsion rates 

of coyotes (Canis latrans) in Captivity. The Southwestern 

Naturalist 51(2): 272-276. dx.doi.org/10.1894/0038- 

4909(2006)51[272:DAEROC]2.0.CO;2 

Musser G.G. & M.D. Carleton. 2005. Superfamily Muroidea, In: 

D.E. Wilson and D.A.M. Reeder, eds. Mammal species of 

the World: A taxonomic and geographic reference. 3rd edn. 

Johns Hopkins University Press, Baltimore. Pp. 894–1531. 

Myers P. 1989. A preliminary revision of the varius group of Akodon 

(A. dayi, dolores, molinae, neocenus, simulator, toba and 

varius). In: K.H. Redford and J.F. Eisenberg, eds. Advances 

in Neotropical Mammalogy. Sandhill Crane Press, Inc., 

Gainesville, Florida. Pp. 5–54. 

Myers P., J.L. Patton & M.F. Smith. 1990. A review of the boliviensis 

group of Akodon (Muridae: Sigmodontinae), with emphasis 

on Peru and Bolivia. Miscellaneous Publication of the 

Museum of Zoology, University of Michigan 177: 1-104. 

Napolitano C., M. Bennett, W.E. Johnson, et al. 2008. Ecological 

and biogeographical inferences on two sympatric and 

enigmatic Andean cat species using genetic identification 

of faecal samples. Molecular Ecology 17: 678-690. doi: 

10.1111/j.1365-294X.2007.03606.x 

Novack A., M. Main, M. Sunquist & R. Labisky. 2005. Foraging ecology 

of jaguar (Panthera onca) and puma (Puma concolor) 

in hunted and non-hunted sites within the Maya Biosphere 

Reserve, Guatemala. J. Zool., Lond. 267: 167–178. 

Nowell K. & P. Jackson. 1996. Status Survey and Conservation Action 

Plan: Wild Cats. IUCN/SSC Cat Specialist Group, Gland, 

Switzerland. 421 pp. 

Olds, N. & S. Anderson. 1989. A diagnosis of the Tribe Phyllotini 

(Rodentia, Muridae). In: K.H. Redford and J.F. Eisenberg, 

eds. Advances in the Neotropical Mammalogy. Sandhill 

Crane Press, Gainesville, Florida. Pp. 55-75. 

Palacios R. 2006. Análisis de dieta y superposición de nicho trófico 

de un ensamble de carnívoros en la Patagonia Argentina. 

Tesina de licenciatura en Biología. Facultad de Ciencias 

Exactas Físicas y Naturales, Ciencias biológicas Universidad 

Nacional de Córdoba, Argentina. 

Palacios R., 2007. Manual para identificación de carnívoros andinos. 

Alianza Gato Andino, Córdoba, Argentina. 40 pp. 

Pearson O. 1948. Life history of mountain vizcachas in Peru. Journal 

of Mammalogy 29: 345-374. 

Pearson O. 1951. Mammals in the highlands of southern Peru. Bulletin 

of the Museum of comparative Zoölogy 106(3). 

Pizzimenti J.J. & R. De Salle. 1980. Dietary and morphometric 

variation in some Peruvian rodent communities: the effect 

of feeding strategy on evolution. Biological Journal of the 

Linnean Society 13(4): 263-285. 

Rau J. & D. Martínez. 2004. Identificación de los órdenes de aves 

chilenas a través de la microestructura de sus plumas. En: A. 

Muñoz, J. Rau y J. Yañes, eds. Aves rapaces de Chile. CEA 

Ediciones, Santiago, Chile. Pp. 229-234. 

Reig O.A. 1987. An assessment of the systematic and evolution of 

the Akodontini, with the description of new fossil species 

of Akodon (Cricetidae: Sigmodontinae). In: B.D. Patterson 

and R.M. Timm, eds. Studies in Neotropical mammalogy. 

Essays in honor of Philips Hershkovitz Fieldiana, Zoology, 

new series 39. Pp. 347-399. 

Reise D. 1973. Clave para determinación de los cráneos de marsupiales 

y roedores chilenos. Gayana Zoología (Chile) 27: 1-20. 

Roemer G.W., M.E. Gompper & B.V. Valkenburgh. 2009. The Ecological 

Role of the Mammalian Mesocarnivore. BioScience 

59: 165–173. doi.10.1525/bio.2009.59.2.9 

Romo M.C. 1995. Food habits of the Andean fox (Pseudalopex culpaeus) 

and notes on the mountain cat (Felis colocolo) and 

puma (Felis concolor) in the Río Abiseo National Park, Perú. 

Mammalia 59(3): 335-343. 

Ruiz-Olmo J., F. Blanch & F. Vidal. 2003. Relationships between the 

red fox and waterbirds in the Ebro Delta Natural Park, N.E. 

Spain. Waterbirds 26(2): 217-225. 

Schoener T.W. 1971. Theory of Feeding Strategies. Annual Review of 

Ecology and Systematics 2: 369-404. 

Schulenberg T.S., D.F. Stotz, D.F. Lane, et al. 2007. Aves de Perú. 

Field Museum of Natural History. 660pp. 

Silva-Pereira J.E., R.F. Moro-Ríos, D.R. Bilski & F.C. Passos. 2011. 

Diets of three sympatric Neotropical small cats: Food niche 

overlap and interspecies differences in prey consumption. 

Mammalian Biology 76: 308-312. doi:10.1016/j.mambio.2010.09.001 

Silveira L., A.T.A. Jácomo & M. Malzoni Furtado. 2005. Pampas cat 

ecology and conservation in the Brazilian grasslands. Project 

of the Month, Cat Specialist Group Web site. http://www. 

catsg.org/catsgportal/project-o-month/02_webarchive/ 

grafics/sept2005.pdf. Accessed 11/06/2013. 

Sunquist M. & F. Sunquist. 2002. Wild cats of the world. University 

of Chicago Press, Chicago, Illinois. 

Taifa T. & E. Yensen. 2001. Mamíferos de los bosques de Polylepis de 

Bolivia. Rev. Bol. Ecol. 9: 29- 44. 

Villalba L, M. Lucherini, S. Waker, et al. 2004. El Gato Andino: 

Plan de Acción para su Conservación. La Paz: Alianza Gato 

Andino. 83pp. 

Viscarra M.E. 2008. Evaluación de la distribución, densidad y dieta 

de carnívoros en cuatro tipos de hábitats en un área de la 

provincia Sud Lípez (Potosí-Bolivia). Tesis, título de Licenciatura 

en Ciencias Biológicas. Facultad De Ciencias Puras 

y Naturales, Carrera De Biología. Universidad Mayor De 

San Andrés. 

Voss R.S. 1991. An introduction to the Neotropical muroid rodent 

genus Zygodontomys. Bulletin of the American Museum 

of Natural History 210: 1–113. 

Walker R.S., A.J. Novaro, P. Perovic, et al. 2007. Diets of three species 

of Andean carnivores in high-altitude deserts of Argentina. 

Journal of Mammalogy 88: 519-525. 

Weaver J.L. & S.W. Hoffman. 1979. Differential detectability of rodents 

in coyote scats. The Journal of Wildlife Management 

43: 783-786. 

Wozencraft W.C. 1993. Carnivores. In: D.E. Wilson and D.M. Reeder, 

eds. Mammal Species of the World. 2nd ed. Smithsonian 

Institution Press, Washington, D.C. Pp. 279–348. 

70 




El zorro gris 

ISSN-L 

Lycalopex griseus en 

1561-0837 

el Perú 



Estado del zorro gris Lycalopex griseus (Gray, 1837) (Mammalia: Canidae) en el Perú 



Museo de Historia Natural, Universidad Nacional 

Mayor de San Marcos, Apartado 14-0434, Lima 

14, Perú. 

Email Elena Vivar: elenavivarp@gmail.com 

Email Víctor Pacheco: vpachecot@unmsm.edu.pe 

Citación: 

Vivar E. & V. Pacheco. 2014. Estado del zorro gris 

Lycalopex griseus (Gray, 1837) (Mammalia: Canidae) 

en el Perú. Revista peruana de biología 21(1): 

071- 078 (Mayo 2014), doi: http://doi.org/10.15381/ 

rpb.v21i1.8249 

Resumen 

Se sustenta la presencia del zorro gris Lycalopex griseus (Gray, 1837) en la costa sur del 

Perú en base a información morfológica externa y craneal. Esta especie es de similar tamaño 

a L. sechurae (Thomas, 1900) pero diferenciable en una mayor longitud del hocico y menor 

amplitud del cráneo; esta diferencia es respaldada en un Análisis de Componentes Principales. 

Se sugiere que la población del zorro gris en el Perú podría constituir una subespecie nueva 

de L. griseus por encontrarse más al norte de su distribución tradicionalmente conocida y 

separada de otras subespecies por el Desierto de Atacama en el norte de Chile, notable 

barrera biogeográfica. 

Palabras claves: Canidae; Lycalopex; morfología; morfometría; poblaciones. 

Abstract 

The presence of the gray fox Lycalopex griseus (Gray, 1837) in the southern coast of Peru is 

supported based on external and cranial morphological information. This species is compared 

with L. sechurae (Thomas, 1900), a fox of similar size, but distinguished from it by a snout 

greater length and a smaller breadth of the skull. A Principal Component Analysis supports 

this difference. It is suggested that the gray fox populations in Peru could be a new subspecies 

of L. griseus because its disjunt distribution with respect to other subspecies from which 

are separated by the Atacama Desert, a remarkable biogeographical barrier in northern Chile. 

Key words: Canidae; Lycalopex; morphology; morphometrics; populations. 


Aceptado: 12/04/2014 


Introducción 

Los cánidos silvestres en el Perú, están representados por seis especies: Atelocynus 

microtis (Sclater, 1882), Chrysocyon brachyurus (Illiger, 1815), Lycalopex culpaeus (Molina, 

1782), L. griseus (Gray, 1837), L. sechurae (Thomas, 1900) y Speothos venaticus 

(Lund, 1842) según Pacheco et al. (2009). La mayoría de ellos con caracteres morfológicos 

externos muy distintivos que permiten discriminar una especie de otra; sin 

embargo, la presencia de Lycalopex griseus en el Perú es aun un tema controversial. Si 

bien la especie fue reconocida en nuestro medio (Grimwood 1969, Pearson y Pearson 

1978, Zeballos et al. 2000, Quintana et al. 2000, Zeballos et al. 2001, Pacheco et 

al. 2009), otros autores dudan de que este zorro esté distribuido en el Perú o lo han 

omitido sin mayor comentario (Know 2003, González del Solar y Rau 2004, Wozencraft 

2005, Jiménez et al. 2008). Pacheco et al.(2009) documentó la existencia de 

varios especímenes procedentes del Perú que sustentan inequívocamente la presencia 

de esta especie desde Lima central hasta Tacna, a lo largo de la Costa y Vertiente Occidental. 

El objetivo principal de este trabajo es contribuir con información adicional 

para sustentar la presencia del zorro gris en el Perú, diferenciándola de las otras dos 

especies peruanas (i.e., L. culpaeus y L. sechurae) en base a un análisis morfológico y 

morfométrico craneal y dental. 







71

Vivar & Pacheco 

72 

Especies de Lycalopex 

El zorro andino Lycalopex culpaeus es una especie mediana, 

que pesa de 7 – 12 kilos. Tiene una amplia distribución en 

América del sur, desde el sur de Argentina hasta Colombia 

(Knop 2003, Wozencraft 2005), aunque prefiere las elevaciones 

altas también se le suele encontrar en las bajas como en Lomas 

de Atiquipa y Mejía (Zeballos 2000), San Juan de Marcona 

(Tantaleán et al. 2007), Lomas de San Fernando (Vivar 2008) 

y Lomas de Lachay (INRENA 2002). 

El zorro gris Lycalopex griseus es pequeño, pesa de 3 – 4 kg; 

en Argentina se distribuye desde los 23° sur hasta Tierra de 

Fuego; mientras que en Chile se distribuye desde Atacama hasta 

el Estrecho de Magallanes (González del Solar y Rau 2004). 

De acuerdo a Osgood (1943) y Cabrera (1958) existen cuatro 

subespecies de L. griseus: L. g. griseus, distribuido en las Pampas 

del oeste de Argentina desde el Estrecho de Magallanes hasta 

Chubut; L. g. gracilis, desde Santiago de Estero y Catamarca 

hasta oeste del Río Negro, Argentina; L. g. domeykoanus, en 

Chile central desde Concepción hasta la parte sur de la Provincia 

de Atacama; y L. g. maullinicus, en la parte centro sur de Chile, 

en la Región del Bosque de Valdivia. En el Perú, la especie se 

distribuye desde San Bartolo, Lima hasta Tacna (Pacheco et al. 

2009, MINAM 2011). 

El zorro costeño Lycalopex sechurae, de tamaño pequeño (2 - 6 

kg) se distribuye mayormente en la región costera y vertiente 

occidental de los Andes, desde el extremo suroeste de Ecuador 

hasta el centro de Lima (Asa y Cossíos 2004; Cossíos 2004, 

2008; INRENA, 2002), desde el nivel de mar (Cossíos 2010), 

hasta los 2250 m en Mital, Bosque de Zárate, Prov. Huarochirí, 

Lima. (E. Díaz, comm. pers.). 

En la costa del Perú Lycalopex griseus y L. sechurae presentan 

distribuciones contiguas y al parecer parapátricas; sin embargo 

en las costas de Chile L. griseus se encuentra en simpatría con 

Lycalopex fulvipes (Martin, 1837), especie restringida a la Isla 

de Chiloé y la parte costera del Parque Nacional Nahuelbuta 

(Jiménez et al. 2004, Wozencraft 2005). 

Material y métodos 

Se examinaron pieles, cráneos y registros fotográficos de 

Lycalopex griseus procedentes del Museo de Historia Natural de 

la Universidad Nacional Mayor de San Marcos Lima, MUSM; 

del Museo de la Universidad de San Agustín Arequipa, MUSA; 

y del Museum of Vertebrate Zoology Berkeley, MVZ (Anexo 1). 

Se midieron once ejemplares de L. griseus, cinco de L. sechurae 

y cuatro de L. culpaeus. Todos fueron considerados adultos, en 

base a la presencia de suturas fusionadas entre el basiesfenoide 

y occipital. 

Se utilizaron las siguientes medidas craneométricas de Zunino 

et al.(1995): Longitud condilobasal (LCB), Longitud palatal 

(LP), Longitud mínima del rostro(LMR), Longitud del rostro 

(LR), Longitud de la bula (LB), Longitud de la fila de dientes 

del maxilar (LFDMx), Longitud entre el P4-M2 (LP4-M2), 

Altura mínima del rostro (AlMR), Altura de la caja craneana 

(AlCC), Constricción interorbital (CI), Constricción postorbital 

(CP), Ancho del rostro en caninos (ARC), Ancho del rostro en 

primeros molares superiores (ARPM), Ancho cigomático (AC), 

Ancho del mastoide (AM), Ancho de la caja craneana (ACC), 

Ancho a través de los cóndilos occipitales (ACO), Ancho entre 

procesos postglenoideos (APG), Longitud P4 (LP4),ancho P4 

(AP4), Longitud m1 (Lm1), Ancho m1 (Am1), Altura del rostro 

en P2-P3 (AlRP2-P3), Longitud mandibular (LM), Longitud 

de la fila de dientes mandibulares (LFDMa), Longitud m1-m3 

(Lm1-m3), Longitud alveolar de caninos superiores (LACS), 

Longitud de fosas nasales (LFN), Ancho a través de los procesos 

postorbitales (APPO), Longitud entre procesos postorbitales y 

constricción postorbital (LPPCP) y Ancho de fosa mesopterigoidea 

(AFM). 

Para cada variable se obtuvo los estadísticos descriptivos de 

promedio, desviación estándar, máximos, mínimos y número 

de muestra. Se presenta también un Análisis de Componentes 

Principales (ACP) con las medidas craneométricas tomadas en L. 

griseus y L. sechurae, usándose 21 de las 31 mediciones craneales 

arriba mencionadas. Ambos análisis, estadísticos y multivariados 

fueron ejecutados con el programa PAST: Paleontological Statistics 

Software Package for Education and Data Análisis (Hammer 

et al. 2001). El ACP fue desarrollado con siete especímenes de L. 

griseus, en tres de ellos los valores de una o dos variables fueron 

obtenidos por promedio por tener datos perdidos. 

Para la comparación a nivel subespecífico, se utilizó material 

fotográfico de especímenes de L. griseus domeykoanus y L. griseus 

gracilis pertenecientes al Field Museum of Natural History de 

Chicago (FMNH) y al Natural History Museum de Londres 

respectivamente (Anexo 1), por estar éstas más cercanas a la 

distribución de los ejemplares estudiados del Perú. 

Resultados 

Externamente, Lycalopex griseus (Fig. 1) es un zorro pequeño 

(LT: 79 cm, LC: 26, LP: 12.5, LO: 9) con orejas grandes y cola 

frondosa; la longitud de esta última sobrepasa la distancia que 

hay entre su origen y la base de sus dedos traseros, además esta 

cola ostenta una conspicua mancha negra en el extremo terminal. 

La coloración general del manto, cabeza, patas y cola es 

beige grisáceo con una banda longitudinal oscura en el dorso. 

La parte superior del hocico presenta tonalidades ligeramente 

más oscuras alcanzando las mistaciales. También es evidente una 

mancha negra en la barbilla y una banda longitudinal delgada a 

manera de collar a la altura del pecho de menor tonalidad. Las 

patas delanteras y traseras presentan tonalidades más oscuras 

tanto en la parte anterior del brazo como en la base posterior 

del muslo, siendo ésta última una mancha bastante oscura en 

forma triangular. La coloración de la parte ventral es crema, 

que se extiende al interior de las patas, cuerpo, cuello y base del 

hocico, incluyendo comisuras y base de la nariz. Esta coloración 

ventral es evidente aún cuando el animal este de costado. 

El tamaño de un pelo de guardia de la espalda es aproximadamente 

de 59 mm, y la disposición de sus bandas de color 

es la siguiente: base crema (32%), beige oscuro (20%), crema 

(27%) y beige oscuro (20%) en el extremo. Los pelos de borda 

son más cortos y en conjunto muy densos, llegando a un tamaño 

de 56 mm. 

Lycalopex griseus (Fig. 2) tiene el rostro angosto y la porción 

anterior del arco cigomático presenta bordes afilados. El hueso 

lacrimal es estrecho y moderadamente alto. Los bordes exteriores 

del agujero infraorbitario tienden a formar un ángulo agudo. El 

agujero auditivo es amplio, siendo la distancia entre el borde del 

agujero y perfil del borde de la bula menor. El borde anterior 

del palatino es en forma de herradura pasando entre los agujeros 

palatinos superiores e inferiores, continuando en bordes laterales 


El zorro gris Lycalopex griseus en el Perú 

Figura 1.- Ejemplares de Lycalopex griseus. Ica: San Fernando a) y b) fotos tomadas por Helena Sisniegas, c) tomada por 

Hugo Castillo, d) tomada por Erik Ramirez. Tacna: Tacahuay e) y f) tomadas por Joel Córdova. 

Figure 1.- Samples of Lycalopex griseus. Ica: San Fernando a) and b) photos taken by Helena Sisniegas, c) by Hugo Castillo, 

d) by Erick Ramirez. Tacna: Tacahuay e) y f) by Joel Córdova. 


73


Figura 2.- Vista dorsal, ventral y lateral del cráneo y mandíbula 

de Lycalopex griseus (MUSM 39070). Escala es 10 mm. 

Figure 2.- Dorsal, ventral and lateral wiew of the skull and lower 

jaw of Lycalopex griseus (MUSM 39070). Scale is 10 mm. 

Figura 3.- Vista dorsal, ventral y lateral del cráneo y mandíbula 

de Lycalopex sechurae (MUSM 15377). Escala es 10 mm. 

Figure 3.- Dorsal, ventral and lateral wiew of the skull and lower 

jaw of Lycalopex sechurae (MUSM 15377). Scale is 10 mm 

rectos. Los dientes P4, M1 y M2 son grandes. El P4 (carnasial) 

presenta un protocono que sobresale medianamente del resto 

del diente. El hipocono de M1 es pronunciado y junto con el 

cíngulum lingual le dan una forma curvada casi aguda al diente. 

El borde posterior de M2 termina después del borde anterior de 

la fosa mesopterigoidea, la cual es angosta y no presenta espina. 

La porción anterior de la bula timpánica es menos prominente 

que la parte posterior. La altura del proceso coronoide de la 

mandíbula es casi el doble del grosor de la mandíbula. El borde 

anterior de la cresta coronoide tiende a ser curva. El perfil de la 

base del proceso angular es horizontal. 

Comparaciones 

Lycalopex griseus se diferencia de L. sechurae (Fig. 3) por las 

siguientes características. El rostro es más angosto. La porción 

anterior del arco cigomático presenta bordes dorsales afilados 

y no redondeados como en L. sechurae. El hueso lacrimal es 

estrecho (5.44 mm) con una altura de (11.68 mm), mientras 

que en L. sechurae es más amplio (8.80 mm) y algo alto (12.61 

mm). Los bordes exteriores del agujero infraorbitario tienden 

a formar un ángulo agudo, mientras que en L. sechurae forman 

un ángulo recto. El agujero auditivo es algo más amplio (6.78 

mm) que en L. sechurae (5.27 mm), siendo la distancia entre el 

borde del agujero y perfil del borde de la bula menor (4.90 mm) 

74 

que en L. sechurae (6.83 mm). 

El borde anterior de los palatinos es en forma de herradura 

pasando entre los agujeros palatinos superiores e inferiores, continuando 

en bordes laterales rectos, a diferencia de L. sechurae 

donde el borde anterior de los palatinos tiene forma semicircular, 

pasando por los agujeros palatinos anteriores, pero los bordes 

laterales se expanden y no tocan los agujeros palatinos inferiores. 

Los dientes PM4, M1 y M2 son más grandes que en sechurae. El 

protocono del P4 (carnasial) sobresale medianamente del resto 

del diente, mientras que en L. sechurae sobresale notoriamente. 

El hipocono de M1 es pronunciado y junto al cíngulum lingual 

le dan una forma casi aguda al diente, en cambio en L. sechurae 

el hipocono es poco desarrollado y con el cingulum lingual le 

dan una forma curvada al diente. El borde posterior de M2 

termina después del borde anterior de la fosa mesopterigoidea, 

en L. sechurae éste termina antes. El ancho de la fosa mesopterigoidea 

generalmente es angosta y no presenta espina, en L. 

sechurae siempre es amplia con bordes anteriores curvados para 

dar lugar a una espina. La porción anterior de la bula timpánica 

es menos prominente que la parte posterior, en L. sechurae ambas 

porciones son prominentes. La altura del proceso coronoide de 

la mandíbula es casi el doble del grosor de la mandíbula, en L. 

sechurae es más del doble del grosor de la mandíbula. El borde 



Tabla 1.- Estadísticas descriptivas de medidas craneométricas de Lycalopex culpaeus, L. griseus y L. sechurae (en mm). 

Promedio más menos desviación estándar, rango observado (en paréntesis) y número de especímenes. Significado de abreviatura 

de medidas, ver texto. 

Table 1.- Descriptive statistics of craniometric measures of Lycalopex culpaeus, L. griseus and L. sechurae (in mm). Mean plus 

minus standard deviation, observed range (in parentheses) and number of specimens. Meaning of abbreviation measures, 

see text. 

Medidas Lycalopex culpaeus Lycalopex griseus Lycalopex sechurae 

LCB 159,32 ± 5,32(166,00-153,71)4 111,31 ± 5,65(120,49-104,03)9 112,94 ± 4,36(119,94-108,64)5 

LP 84,97 ± 1,83(87,25-82,84)4 57,89 ± 2,69(62,74-54,08)11 60,21 ± 3,13(63,83-56,04)5 

LMR 70,54 ± 1,75(72,42-68,40)4 47,40 ± 2,41(51,95-44,42)11 46,52 ± 2,20(49,47-43,34)5 

LR 80,46 ± 1,73(82,22-77,75)4 52,53 ± 2,56(858,15-49,06)11 52,31 ± 2,33(55,68-49,26)5 

LB 23,52 ± 1,41(25,74-21,83)4 21,22 ± 1,80(23,08-17,56)10 19,39 ± 1,63(21,38-17,69)5 

LFDMx 71,47 ± 1,60(73,99-69,53)4 50,90 ± 2,33(54,66-47,07)10 49,07 ± 1,06(50,59-47,96)5 

LP4-M2 29,74 ± 1,83(31,60-26,70)4 22,40 ± 1,78(24,50-19,78)10 21,39 ± 1,18(22,52-19,76)5 

AlMR 20,15 ± 1,38(21,95-18,09)4 13,22 ± 0,94(14,36-11,10)11 14,48 ± 0,84(15,70-13,51)5 

AlCC 46,98 ± 1,58(49,10-44,95)4 33,07 ± 1,27(35,09-31,36)10 34,33 ± 1,07(35,80-32,95)5 

CI 29,55 ± 1,46(31,25-27,22)4 20,11 ± 1,05(21,59-18,70)11 20,70 ± 0,55(21,46-20,07)5 

CP 26,45 ± 1,04(28,17-25,49)4 22,41 ± 0,99(24,70-21,35)10 22,34 ± 1,01(23,50-20,82)5 

ARC 26,50 ± 1,79(28,23-24,12)4 16,95 ± 1,13(18,66-15,49)11 18,77 ± 0,69(19,43-18,00)5 

ARPM 46,71 ± 3,27(50,36-42,08)4 33,37 ± 1,29(35,56-31,48)11 33,87 ± 1,33(35,10-31,60)5 

AC 89,82 ± 4,27(95,81-85,70)4 58,78 ± 2,27(62,53-56,10)8 63,34 ± 2,31(65,97-60,95)5 

AM 53,44 ± 2,39(56,58-50,71)4 38,24 ± 2,42(41,18-34,38)10 41,07 ± 1,33(43,30-39,81)5 

ACC 49,18 ± 1,33(51,23-47,59)4 40,69 ± 1,31(42,64-38,27)10 41,63 ± 0,87(42,78-40,55)5 

ACO 28,63 ± 0,97(29,83-27,14)4 20,59 ± 1,19(22,55-19,37)9 22,42 ± 0,75(23,21-21,59)5 

APG 36,91 ± 1,51(39,18-35,32)4 25,79 ± 1,22(27,67-24,33)8 29,96 ± 1,06(31,14-28,69)5 

LP4 15,48 ± 0,55(16,00-14,58)4 10,50 ± 0,82(11,60-9,08)11 9,63 ± 0,54(10,36-9,06)5 

AP4 7,87 ± 0,65(8,54- 7,11)4 5,19 ± 0,54(5,77-4,38)11 5,30 ± 0,38(5,79-4,91)5 

Lml 16,61 ± 0,65(17,22-15,54)4 11,43 ± 1,34(12,90-9,00)10 10,24 ± 0,49(10,89-9,51)5 

Aml 6,65 ± 0,64(7,36-5,66)4 5,95 ± 1,32(8,32-4,48)10 4,87 ± 0,14(5,03-4,69)5 

AlRP2-P3 24,40 ± 0,82(25,60-23,29)4 16,92 ± 0,61(18,41-16,38)10 19,17 ± 0,82(20,60-18,63)5 

LM 125,17 ± 4,60(130,31-119,44)4 84,64 ± 4,46(92,47-79,31)10 85,90 ± 2,98(89,78-83,12)5 

LFDMa 81,13 ± 2,00(83,64-78,31)4 57,76 ± 3,51(63,79-53,13)11 54,95 ± 1,71(57,34-52,60)5 

Lm1-m3 29,33 ± 1,41(30,69-27,14)4 22,50 ± 1,09(24,30-20,60)11 19,96 ± 1,36(21,96-18,27)5 

LACS 10,02 ± 0,73(11,05-9,24)4 5,46 ± 0,62(6,38-4,45)11 5,85 ± 0,51(6,22-4,96)5 

LFN 19,34 ± 0,72(20,34-18,42)4 13,39 ± 1,32(15,73-11,22)11 14,49 ± 1,37(15,83-12,57)5 

APPO 39,21 ± 0,94(40,26-38,16)4 27,90 ± 1,69(31,57-25,80)10 31,64 ± 1,65(34,09-29,77)5 

LPPCP 13,48 ± 1,70(15,88-11,11)4 4,66 ± 0,66(5,99-3,76)10 6,10 ± 1,03(7,85-5,29)5 

AFM 12,53 ± 0,64(13,60-11,88)4 9,09 ± 0,77(10,25-7,97)7 10,45 ± 1,03(11,52-9,02)5 

anterior de la cresta coronoide tiende a ser curva, en L. sechurae 

es casi recta. El perfil de la base del proceso angular es horizontal, 

en L. sechurae es oblicuo. 

Lycalopex griseus se diferencia de L. culpaeus por las siguientes 

características. La porción anterior del arco cigomático en 

L. griseus presenta bordes dorsales afilados mientras que en L. 

culpaeus los bordes son redondeados. 

El hueso lacrimal es estrecho (5.44 mm) con una altura de 

(11.68 mm), mientras que en L. culpaeus que es más amplio 

(8.54 mm) y más alto (14.37 mm). Los bordes exteriores del 

agujero infraorbitario forman un ángulo agudo como en L. 

culpaeus. El agujero auditivo es casi tan amplio (6.78 mm) como 

en L. culpaeus (6.58 mm), siendo la distancia entre el borde del 


agujero y perfil del borde de la bula menor (4.90 mm) que en 

L. culpaeus (7.85 mm). 

El borde anterior del palatino es en forma de herradura 

pasando entre los agujeros palatinos superiores e inferiores, 

continuando en bordes laterales rectos, a diferencia de L. culpaeus 

donde el borde anterior del palatino tiene forma semicircular o 

angular, pasando por los agujeros palatinos anteriores e inferiores. 

Los dientes PM4, M1 y M2 son más pequeños que en culpaeus. 

El P4 (carnasial) como en L. culpaeus presenta el protocono que 

sobresale medianamente del resto del diente. El hipocono de M1 

es pronunciado y conjuntamente con el cingulum lingual le dan 

una forma casi aguda al diente, en L. culpaeus el hipocono es 

bastante pronunciado y con el cingulum lingual forman un borde 

curvado. El borde posterior de M2 termina después del borde 

75


Tabla 2.- Coeficientes, autovalores, porcentaje de la varianza, 

y varianza acumulada de dos primeros Componentes Principales 

de 21 variables morfométricas de Lycalopex griseus 

y L. sechurae. 

Table 2.- Coefficients, eigenvalues, percentage of variance 

and cumulative variance of first two Principal Components 

of 21 morphometric variables of Lycalopex griseus and L. 

sechurae. 

Variables CP 1 CP 2 

LCB 0.984 -0.100 

LP 0.942 0.182 

LMR 0.882 -0.404 

LFDMx 0.603 -0.659 

AlMR 0.712 0.550 

Component 2 

1.6 

1.2 

0.8 

0.4 

0.0 

-0.4 

-0.8 

-1.2 

CI 0.568 0.252 

ARC 0.746 0.516 

AC 0.612 0.701 

AM 0.700 0.560 

ACC 0.607 0.362 

ACO 0.808 0.550 

APG 0.359 0.884 

AP4 0.163 0.170 

Am1 0.070 -0.643 

AlRP2-P3 0.226 0.907 

LFDMa 0.696 -0.678 

-1.6 

-2.0 

-2.0 -1.6 -1.2 -0.8 -0.4 0.0 0.4 0.8 1.2 1.6 

Component 1 

Figura 4.- Gráfico de dispersión mostrando los resultados 

de un Análisis de Componentes Principales aplicados a 21 

variables morfométricas de Lycalopex griseus (■) y Lycalopex 

sechurae (●). 

Figure 4.- Scatter plot showing the results of Principal componets 

Analyses applied to 21 morphometric variables of 

Lycalopex griseus (■) and Lycalopex sechurae (●). 

Lm1-m3 0.409 -0.867 

LACS 0.766 0.163 

APPO 0.332 0.887 

LPPCP 0.319 0.769 

AFM 0.098 0.707 

Autovalores 57.096 32.069 

% varianza 56.754 31.877 

Varianza acumulada 56.754 88.631 

anterior de la fosa mesopterigoidea, en L. culpaeus éste termina 

a la misma altura. El ancho de la fosa mesopterigoidea es más 

angosta y no presenta espina, en L. culpaeus es amplia con bordes 

anteriores curvados para dar lugar a una o dos espinas. La porción 

anterior de la bula timpánica es menos prominente que la parte 

posterior, en L. culpaeus ambas porciones son prominentes. La 

altura del proceso coronoide de la mandíbula es casi el doble 

del grosor de la mandíbula, en L. culpaeus es más del doble. El 

borde anterior de la cresta coronoide de la mandíbula tiende a 

ser curva, en L. culpaeus es casi recta. 

Lycalopex culpaeus se diferencia de las otras dos especies en 

casi todas sus dimensiones de largo, ancho y altura. En cambio, 

las mediciones de L. griseus y L. sechurae son similares entre ellas 

(Tabla 1). Un cráneo de un L. culpaeus juvenil (con PM4 y M1 

en desarrollo) es casi tan largo pero a la vez más amplio (LCB: 

105, ACC: 46.39) que un adulto de L. griseus o L. sechurae. 

En el análisis de Componentes Principales, donde se confrontan 

L. griseus y L. sechurae, los porcentajes de los autovalores 

resultantes para los dos primeros componentes principales fueron 

56.7% y 31.87% (Tabla 2). Los coeficientes del primer componente 

fueron todos positivos y el segundo tuvo una alta carga 

negativa en: Lm1-m3 (-0.8672), LFDMa (-0.6776), LFDMx 

(-0.6590), Am1 (-0.6428) y LMR (-0.4041), esto indica que 

hacia abajo del plot las proporciones de estas medidas aumentan; 

al contrario, los coeficientes con alta carga positiva fueron: 

ALRP2-P3 (0.9070), APPO (0.8874), APG (0.8842), Lm1-m3 

(0.8672), LPPCP (0.7690), AFM (0.7070), AC (0.7009), ACO 

(0.5501), AM (0.5604), ARC (0.5158), ALMR (0.5496) y ACC 

(0.3617)(Tabla 2). 

En el gráfico de dispersión de los componentes 1 y 2 (Figura 

4) se observa dos grupos discretos que corresponden a las dos 

especies. L. sechurae se encuentra sobre el eje de las abscisas y L. 

griseus debajo de ella. Con estos resultados se corrobora mediante 

análisis multivariante las observaciones morfológicas indicadas 

anteriormente, en cuanto a las dimensiones de amplitud de los 

ejemplares de L. griseus, como: Ancho entre procesos postorbitales, 

Ancho cigomático, Ancho mastoideo y Ancho entre 

procesos postglenoideos, a la vez en las dimensiones de longitud 

como: Longitud mínima del rostro, Fila de dientes maxilares, 

Fila de dientes mandibulares y Longitud de m1 y m3. Estas nos 

indican que L. griseus presenta un cráneo más angosto, a la vez 

que un hocico más largo que L. sechurae. 

El material fotográfico de L. griseus domeykoanus (FMNH 

23826) (Fig. 5) nos muestran que este presenta un cráneo ligeramente 

más robusto con un hueso lacrimal más amplio, además 

las bullas auditivas son muy prominentes en su totalidad con 

reducido conducto auditivo óseo, a diferencia de los especímenes 

de L. griseus de Perú. Por otro lado L. griseus gracilis (BM [NH] 

18-11-11-85) presenta un cráneo más alto con perfil cóncavo 

76 



para las poblaciones peruanas no coinciden con domeykoanus ni 

con L. g. gracilis. Por ello, se puede sostener que las poblaciones 

peruanas podrían corresponder a una subespecie diferente, 

sin nombre aún. Esta hipótesis estaría acorde también con 

la distribución disyunta de las poblaciones peruanas y las del 

norte de Chile separadas ambas por el desierto de Atacama, 

que si bien en el Pleistoceno este desierto presentaba una 

diversidad de plantas propias de estepas, en el Holoceno 

llegó a ser hiperárido convirtiéndose en una efectiva barrera 

de dispersión (Latorre et al., 2002). Un mayor número de 

muestras y posiblemente análisis moleculares son necesarios 

para caracterizar la población peruana, comparándola con las 

subespecies existentes de L. griseus. 

En el Perú L. griseus ha sido muy poco estudiada, por lo que 

no se sabe apropiadamente sobre su estado de conservación. Los 

escasos y esporádicos registros visuales (Anexo 2) y la existencia 

de algunos pocos ejemplares en Museos de Historia Natural 

nos sugieren que sus poblaciones son bajas y debe ser protegida. 

Figura 5.- Vista dorsal, ventral y lateral del Cráneo y mandíbula 

de Lycalopex griseus domeykoanus. FMNH 23826. 

Escala es 10 mm 

Figure 5.- Dorsal, ventral and lateral wiew of the skull and 

lower jaw of Lycalopex griseus domeykoanus. FMNH 23826. 

Scale is 10 mm. 

notorio, bulas timpánicas más pequeñas y arcos cigomáticos 

menos amplios, pero al igual que los ejemplares de Perú presenta 

un hueso lacrimal angosto. 

Discusión 

Las diferencias en caracteres de las especies examinadas son 

claras por lo que podemos afirmar que existen dos especies de 

zorros pequeños en el lado occidental de los Andes peruanos, 

L. sechurae en el norte y centro y L. griseus en el centro y sur, 

sustentando así la propuesta de Pacheco et al. (2009). Ambas 

especies ocupan mayormente ambientes costeros, aunque al 

parecer L. sechurae sube hasta los 2000 m. 

Como en Pacheco et al. (2009), apoyamos el uso del nombre 

genérico Lycalopex propuesto por Zunino et al. (1995), pero 

manteniendo a griseus como taxón independiente de gymnocercus 

(Wozencraft 2005), conservando no obstante sus respectivas 

subespecies originales. 

Quintana et al. (2000) y González del Solar y Rau (2004) 

presumieron que individuos avistados en Arequipa y Tacna 

pertenecerían a L. g. domeykoanus, sin presentar mayor sustento. 

Sin embargo, los caracteres morfológicos descritos aquí 



Agradecemos especialmente a los Curadores Bruce D. Patterson 

del Field Museum of Natural History, Chicago; Evaristo López 

del Museo de Historia Natural de la Universidad San Agustín, 

Arequipa; James L. Patton del Museum of Vertebrate Zoology, 

Berkeley; y Paula Jenkins del Natural History Museum of London, 

por facilitarnos especímenes o información de las colecciones a 

su cargo. A los investigadores y amigos: Alfonso Orellana, Carlos 

Jiménez, Delsy Trujillo, Erik Ramirez, Giuseppy Calizaya, Helena 

Sisniegas, Horacio Zeballos, Hugo Castillo, Jaime Pacheco, Jéssica 

Amanzo, Joel Córdova, Mario Tenorio, Richard Cadenillas, Richy 

Tomairo, Rodolfo Salas y Sandra Velazco que nos proporcionaron 

diversas ayudas como testimonios, especímenes y fotografías. A los 

Doctores Alfred Gardner del National Museum of Natural History 

y Gerardo Lamas del Museo de Historia Natural (UNMSM) por 

apoyarnos con bibliografía y consejo. 


Asa CH. & E.D. Cossíos. 2004. Sechuran fox (Pseudalopex sechurae). 

In: C. Sillero-Zubiri, M. Hoffmann & D.W. Macdonald, 

eds. Canids: foxes, wolves, jackals and dogs. Status Survey 

and Conservation Action Plan. IUCN/SSC Canid Specialist 

Group. Gland, Suitzerland and Cambridge. Pp. 69-72. 

Cabrera A. 1958. Catálogo de los mamíferos de América del Sur. Museo 

Argentino de Ciencias Naturales Bernardino Rivadavia 

4(1): 1-733. 

Cossíos D. 2004. Relaciones entre el zorro de Sechura, Pseudalopex 

sechurae (Thomas), y el hombre en el Perú. 2004. Ecología 

Aplicada 3(1 y 2): 134-138. 

Cossíos D. 2010. Lycalopex sechurae (Carnivora: Canidae). 

Mammalian Species 42(848): 1–6. doi: http://dx.doi. 

org/10.1644/848.1 

González del Solar R. & J. Rau. 2004. Chilla. Pseudalopex griseus. 

In: Sillero-Zubiri C, M. Hoffman & D. Macdonald, eds. 

Canids: Foxes, Wolves, Jackals and Dogs. Status Survey 

and Conservation Action Plan. IUCN/SSC Canid Specialist 

Group. Gland, Suitzerland and Cambridge. Pp. 

56-63. Acceso 

02/06/13. 

Grimwood J.R.1969. Notes on the distribution and status of some 

Peruvian mammals 1968. American Committee for International 

a Wildlife Protection and New York Zoological 

Society, Special publication 21: 1-86. 

Hammer Ø., D.A.T. Harper & P. D. Ryan, 2001. PAST: Paleontological 

Statistics Software Package for Education and Data 

Analysis. Palaeontologia Electronica 4(1): 1-9. . Acceso 

02/06/13. 

77


INRENA 2002. Plan Maestro de La Reserva Nacional de Lachay 

2003-2007. Lima, 67 pp, 5 mapas. 

Jiménez J.E., M. Lucherini & A.J. Novaro. 2008a. (en línea) Pseudalopex 

culpaeus. In: IUCN 2011. IUCN Red List of Threatened 

Species. Version 2011.2. . 

Acceso 02/06/2013. 

Jiménez J., E. McMahon. 2004. Darwin's fox Pseudalopex fulvipes 

(Martin, 1837). In: Sillero-Zubiri C., Hoffmann M., 

Macdonald D.W. (eds). Canids: foxes, wolves, jackals and 

dogs. Status survey and conservation action plan. IUCN/ 

SSC Canid Specialist Group. Gland, Switzerland and Cambridge, 

UK, pp. 50-55. 

Jiménez J.E., M. Lucherini, & A.J. Novaro, 2008b. (en línea) Pseudalopex 

griseus. In: IUCN 2011. IUCN Red List of Threatened 


Acceso 02/06/2013. 

Jiménez J.E., M. Lucherini & A.J. Novaro, 2008c. (en línea) Pseudalopex 

fulvipes. In: IUCN 2011. IUCN Red List of Threatened 


Acceso 02/06/2013. 

Knop K. 2003. (en línea) "Lycalopex griseus" Animal Diversity 

Web. . Acceso 

02/06/2013. 

Latorre C., J.L. Betancourt, K.A. Rylander & J. Quade. 2002. Vegetation 

invasions into absolute desert: A 45 000 yr rodent 

midden record from the Calama-Salar de Atacama basins, 

northern Chile (lat 22°-24°S). Geographical Society American 

Bulletin 114(3): 349-366. doi: 10.1130/0016-7606. 

MINAM 2011. Informe Final del Estudio de Especies CITES de 

Carnivoros Peruanos. . Acceso 

01/05/2014. 

Osgood W.H. 1943. Mammals of Chile. Fieldiana Zoology 30: 1-268. 

Pacheco V., R. Cadenillas E. Salas, C. Tello & H. Zeballos. 2009. Diversidad 

y conservación de los mamíferos del Perú. Revista 

Peruana de Biología 16(1): 5-32. 

Pearson O.P. & C. Pearson, 1978. The diversity and abundance of 

vertebrate along an altitudinal gradient in Peru. Memorias 

del Museo de Historia Natural “Javier Prado” 18: 1-97. 

Quintana V., J. Yáñez & M. Valdebenito. 2000. Orden Carnivora. In: 

A. Muñoz-Pedreros y J. Yáñez-Valenzuela, eds. Mamíferos 

de Chile. CEA Ediciones, Valdivia. Pp. 155-188. 

Tantaleán M., L. Mendoza & F. Riofrío. 2007. El zorro Andino, 

Pseudalopes culpaeus, un nuevo huésped para Corynosoma 

obtuscens (Acanthocephala) en el Perú. Revista Peruana de 

Biología 14(1): 51-52. 

Vivar E. 2008. Evaluación de mamíferos en las Lomas de San Fernando 

y zonas adyacentes a nivel continental. Boletín de la Sociedad 

Geográfica del Lima 121: 41-46. 

Wozencraft W.C. 2005. Order Carnivora. In: Wilson, D.E. & D.M. 

Reeder, eds. Mammal Species of the World: A Taxonomic 

and Geographic Reference. 3rd ed. Johns Hopkins University 

Press. Pp. 532-628. 

Zeballos H., L. Villegas, R. Gutiérrez, K. Caballero & P. Jiménez. 

2000. Vertebrados de las Lomas de Atiquipa y Mejía, sur 

del Perú. Revista de Ecología Latino Americana 7(3): 11-18. 

Zeballos H., V. Pacheco & L. Baraybar. 2002 (2001). Diversidad y 

conservación de los mamíferos de Arequipa, Perú. Revista 

Peruana de Biología 8(2): 94-104. 

Zunino G., O.B. Vaccaro, M. Canevari & A.L. Gardner. 1995. 

Taxonomy of the genus Lycalopex (Carnivora: Canidae) in 

Argentina. Proceedings of the Biological Society of Washington 

108(4): 729-745. 

Anexo 1.- Ejemplares examinados: 

Los siguientes ejemplares fueron examinados en base a piel 

y cráneo, excepto los ejemplares con * que son registros 

fotográficos. 

Lycalopex culpaeus: Perú: Junín, Jauja, Canchayllo, SAIS 

Túpac Amaru, Cochas, 4100 m. (MUSM 8469, 8471, 

8722). Moquegua: Mariscal Nieto, Torata, Mina Toquepala, 

Quebrada Cocotea, 3420 m. (MUSM 13071). 

Lycalopex griseus: Perú: Arequipa, (MUSM 413); Uchumayo, 

148 km de carretera Camaná a Arequipa (MUSM 5997); 

Camaná, Región de Lomas (MUSM 407); Caravelí, 

Pampa Pongo, Qda. El Jaguay (MUSM 39066); Lomas 

de Atiquipa, Quebrada de Vaca (MUSA 1650); Islay, 

Lomas de Matarani, Quebrada de Guerrero (MUSA 

836); Mollendo (MUSM 406). Ica: Nazca, 5 km S Nazca 

(MVZ 116316); Lomas de San Fernando (MUSM 

39070). Tacna: Jorge Basadre, Lomas de Tacahuay 

(MUSM 39108, MVZ 141627). 

Lycalopex sechurae: Perú: La Libertad, Trujillo, carretera 

(MUSM 2083, 2084). Lambayeque, Chiclayo, cerca de 

Pataz (MUSM 402). Lima, Huarochirí, Tapicara, 1300 

m (MUSM 2093). Piura, Carretera Piura-Chiclayo km 

928, Pampa Las Salinas (MUSM 15377). 

Lycalopex griseus gracilis: Argentina: Catamarca (BM [NH] 

18-11-11-85*) 

Lycalopex griseus domeykoanus: Chile: Atacama, Domeyko 

(FMNH: 23826*). 

Anexo 2.- Registros visuales: 

Algunos de los registros visuales de estos últimos años, fueron 

localizados en: 

Lima: Cañete, Río Topará 13°17’39.77”S, 76°11’58.52”W 

(V. Pacheco y E. Salas, comm. pers. 2005). 

Ica: Pisco, cerca de zona de Lomas 13°46’15.85”S, 

75°46’01”W (J. Amanzo, comm. pers. 2004). Nazca, Cerro 

Blanco 14°53’2.69”S, 74°49’21.56”W (R. Tomairo, comm. pers. 

2009). Lomas de San Fernando: Figura 1a y 1b 15°07’41.8”S, 

75°19’16.4”W (Vivar 2008, H. Sisniegas comm. pers. 2008). 

Figura 1c 15°19’47.70”S, 75°07’29.34”W (H. Castillo comm. 

pers. 2013), 15°06’47.38”S, 75°20’01.15”W (D. Trujillo comm. 

pers. 2013), Figura 1d 15°6’50.94”S, 75°20’3.79”W (E. Ramirez 

comm. pers. 2013). 

Tacna: Quebrada de Tacahuay 17°47’35.73”S, 71°06’18.50”W 

(J. Córdova, comm. pers. 2010). Figura 1e y 1f, Lomas del Morro 

de Sama 18°01’20.08”S, 70°50’1.32”W (G. Calizaya comm. 

pers. 2008); Quebrada de Burros (G. Calizaya y S. Velazco 

comm. pers. 2013). 

78 



Identificación morfológica y molecular de 

ISSN-L 1561-0837 

Megalobulimus oblongus de Colombia 




Análisis morfológico del sistema reproductor e identificación molecular a través de 

los marcadores mitocondriales COI y 16S rRNA de Megalobulimus oblongus (Mollusca, 

Strophocheilidae) de Colombia 

Morphological analysis of the reproductive system and molecular identification by mitochondrial 

markers COI and 16S rRNA of Megalobulimus oblongus (Mollusca, Strophocheilidae) of Colombia 

Erika Jaramillo Roldán 1,3 , Jessika López Martínez 1,3 , Rina Ramírez 2 , Luz Elena Velásquez Trujillo 1,3 

1 Grupo de Microbiología Ambiental, Escuela de 

Microbiología, Universidad de Antioquia, Medellín, 

Colombia. 

2 Laboratorio de Sistemática Molecular y Filogeografía, 

Facultad de Ciencias Biológicas; y Museo 

de Historia Natural, Universidad Nacional Mayor 

de San Marcos, Av. Arenales 1256, Lima-11, Perú. 

3 Programa de Estudio y Control de Enfermedades 

Tropicales – PECET, Sede de Investigación Universitaria 

– SIU, Medellín, Colombia. 

Autora para correspondencia: Rina Ramírez, 

Email: rina_rm@yahoo.com 

Email Jessika López: lopezmartinezjesica@gmail.com 

Email Erika Jaramillo: tatajaramillo217@gmail.com 

Email Luz Velásquez: luzelena333@yahoo.com 

Citación: 

Jaramillo Roldán E., J. López Martínez, R. 

Ramírez, L.E. Velásquez Trujillo. 2014. Análisis 

morfológico del sistema reproductor e identificación 

molecular a través de los marcadores 

mitocondriales COI y 16S rRNA de Megalobulimus 

oblongus (Mollusca, Strophocheilidae) de Colombia. 

Revista peruana de biología 21(1): 079- 088 

(Mayo 2014), doi: http://doi.org/10.15381/rpb. 

v21i1.8250 

Resumen 

En este trabajo se hizo el análisis morfológico y molecular a 28 caracoles terrestres de Megalobulimus 

oblongus, colectados en diferentes departamentos de Colombia, depositados en 

una colección de referencia. Para la caracterización morfológica, los animales se disecaron 

al estéreomicroscopio. Se describieron el sistema reproductor y la concha. Del sistema reproductor 

se tomaron medidas a las estructuras que lo componen. De la concha se describió 

la forma, el color, el número de espiras y la ornamentación e igualmente se tomaron medidas 

básicas usando un calibrador digital. Para el análisis molecular se usaron dos marcadores 

mitocondriales, el 16S rRNA y el gen Citocromo Oxidasa C subunidad I (COI). Ambos marcadores 

confirmaron la presencia de un único haplotipo en los ejemplares, aun para individuos 

situados en regiones biogeográficas diferentes y distantes. Este estudio sugiere que 

en Colombia M. oblongus se encuentra en peligro, por lo que urgen investigaciones sobre 

reproducción, genética poblacional y biogeografía que esclarezcan su situación en el país. 

Demuestra además que las colecciones de referencia y los bancos de tejidos son fuentes 

de información de gran valor, ya que permiten conocer aspectos relacionados con el riesgo 

en que se encuentran las especies y que sirven de insumo para el diseño de acciones de 

conservación. 

Palabras claves: 16S rRNA; COI; caracterización morfológica; Megalobulimus oblongus; 

Colombia. 

Abstract 

In this work was done morphological and molecular analysis to 28 land snails of Megalobulimus 

oblongus, collected in different departments of Colombia, deposited in a reference collection. 

For morphological characterization, the animals were dissected in a stereomicroscope. The 

reproductive system and the shell were described. Measures were taken to structures of 

the reproductive system. Of the shell were described its shape, color, number of whorls and 

ornamentation and equally basic measures were taken using a digital caliper. For molecular 

analysis were used two mitochondrial markers, 16S rRNA and cytochrome C oxidase subunit 

I (COI). Only one haplotype was obtained for each marker, even for individuals of different and 

distant biogeographical regions. This study suggests that M. oblongus is in danger, therefore 

are urgent investigations about reproduction, population genetics and biogeography to clarify 

its situation in Colombia. It also demonstrates that the reference collections and tissue banks 

are sources of valuable information since they allow knowing aspects related with the species´ 

risk that serve as an input for the design of conservation actions. 

Keywords: 16S rRNA; COI; morphology; Megalobulimus oblongus; Colombia. 


Aceptado: 16/03/2014 








79

Jaramillo Roldán et al. 

Introducción 

La familia Strophocheilidae (Hausdorf & Bouchet 2005) (Mollusca: 

Gastropoda: Stylommatophora) de origen gondwánico, 

incluye los moluscos terrestres del género Megalobulimus Miller 

1878, endémicos de la región Andina y Amazónica Suramericana 

(Leme 1975), considerados los más grandes del continente. 

Las clasificaciones taxonómicas de las especies de Megalobulimus, 

realizadas en los siglos XVIII y XIX, con base en los 

caracteres morfológicos de la concha, describieron 50 especies, 

siete de las cuales fueron registradas para Colombia: M. popelairianus 

(Nyst 1845), M. thammianus (Martens 1876), M. senezi 

(Jousseaume, 1887), M. oblongus (Müller 1774), M. auritus, 

M. valenciennesii (Pfeiffer 1842) y M. pudicus (Müller, 1774). 

La distribución geográfica en Colombia varía según la especie, 

por ejemplo M. thammianus se señala para la región andina, M. 

oblongus y M. popelairianus para las regiones Caribe, Andina, 

Amazonia y Orinoquia. En tanto que M. valenciennesii solo se 

reporta para la amazonia; se desconoce la procedencia de M. 

auritus, M. pudicus y M. senezi (Daniel 1942, Bequaert 1948, 

Vera 2008, Restrepo 2009, Linares & Vera 2012). 

La validez de las determinaciones taxonómicas específicas de 

los Megalobulimus fue cuestionada por Bequaert (1948) quien 

consideró que la conquiliología era insuficiente para permitir este 

diagnóstico. Desde entonces se busca incluir las descripciones de 

la anatomía interna, con énfasis en el sistema reproductor (Leme 

1973, 1989, 1993, Leme & Indrusiak 1990). Sin embargo, 

en Colombia no ha sido estudiada la morfología de las partes 

blandas de los Megalobulimus mencionados. 

Si bien los caracteres morfológicos dan una buena resolución 

para la identificación taxonómica específica, se ha demostrado 

que algunos marcadores moleculares ofrecen de manera rápida 

y confiable la información necesaria para identificar las especies, 

por ello en la última década se ha propuesto un segmento 

del gen mitocondrial COI (Citocromo C Oxidasa Subunidad 

I) como marcador estándar global, ya que amplifica para una 

gran diversidad de especies, a través de un par de secuencias 

universales de iniciadores (Hebert et al. 2003). 

No obstante, en algunos grupos de animales como los bivalvos, 

el marcador COI no amplifica, problema que se ha resuelto 

usando el gen mitocondrial 16S rRNA (Feng et al. 2011), el 

cual también provee suficiente variabilidad como para formar 

grupos monofiléticos con distancias intraespecíficas menores a 

las interespecíficas (Vences et al. 2005). En el caso particular de 

los Megalobulimus, se ha encontrado que este marcador amplifica 

mejor que el COI, con una eficacia del 100% (Congrains 2010, 

Ramírez et al. 2012). 

Por lo tanto nuestra investigación se propuso establecer el estatus 

taxonómico de los caracoles terrestres, identificados a priori 

como Megalobulimus oblongus (Müller 1774) y depositados en la 

colección de Moluscos Vectores de la Universidad de Antioquia, 

utilizando la caracterización morfológica de las partes blandas 

del caracol, además de la identificación molecular con base en 

los marcadores mitocondriales 16S rRNA y COI. 


Material biológico.- Para esta investigación se analizaron 28 

ejemplares de Megalobulimus oblongus adultos, ya que las conchas 

de todos tenían una altura total mayor de 90 mm y el labio 

externo doblado hacia afuera y rosado. Los especímenes forman 

parte de la colección de Moluscos Vectores de la Universidad 

de Antioquia VHET N°37 y provienen de seis localidades de 

Colombia (Tabla 1). Las partes blandas de los caracoles estaban 

conservadas en Railliet-Henry, las conchas almacenadas en seco 

y un trozo de tejido del pie conservado en alcohol al 96%. 

Descripción morfológica del aparato reproductor y la 

concha de Megalobulimus.- Para la descripción del sistema 

reproductor se disectaron los 28 ejemplares de M. oblongus 

bajo estéreo microscopio (Nikon SMZ 745T); a cada una de 

las estructuras que lo componen se le midió el largo y el ancho, 

con la reglilla ocular. A las conchas se les midió el largo y ancho 

total y de la apertura, usando un calibrador digital (Uiustools® 

MT-0085cun, precisión de ±0.02 mm). Las dimensiones se 

dan en milímetros. Se realizaron registros fotográficos (Cámara 

Sony de 7.2 MP y ZOOM 2,8-5,2/ 6,3- 18,9 mm) y el aparato 

reproductor se ilustró en el software Corel Draw X3. 

Extracción y amplificación de las secuencias 

Extracción de ADN total.- El ADN se extrajo de un centímetro 

de tejido muscular del pie de cada uno de los 28 ejemplares 

de M. oblongus, usando el kit Qiagen DNeasy Blood & Tissue 

siguiendo las especificaciones del fabricante. La concentración 

de ADN extraído se comprobó por espectrofotometría en un 

nanodrop 1000 y se almacenó a -20 °C hasta la amplificación. 

Amplificación de marcadores mitocondriales.- La amplificación 

se realizó por la técnica de reacción en cadena de la polimerasa 

(PCR) con los iniciadores del gen mitocondrial 16S rRNA: 

16SFL104 (GACTGTGCTAAGGTAGCATAAT) y 16SRL472 

(TCGTAGTCCAACATCGAGGTCA), diseñados especialmente 

para moluscos, que amplifican aproximadamente 330 pb (Ramírez 

2004). Además, se usaron los iniciadores universales LCO 1490 

(5’L GGTCAACAAATCATAAAGATATTGGL3’) y HCO 2198 

(5’L TAAACTTCAGGGTGACCAAAAAATCAL3’) publicados 

por Folmer et al. (1994), que amplifican 700 pb, correspondientes 

a la Citocromo Oxidasa C subunidad I (COI). 

Tabla 1. Procedencia de los especímenes de Megalobulimus oblongus de este estudio que reposan en la colección de Moluscos 

Vectores de la Universidad de Antioquia-VHET N°37. 

Código Coordenadas (LN/LW) Procedencia Región 

66 05°20'24.0" / 74º31'39.0" Norcasia, Caldas Andina 

76 a 80 02º09'49.7" / 72°37'42.13" El Retorno, Guaviare Amazónica 

81 a 90 06º27'27.6" / 74º25'21.6" Puerto Berrío, Antioquia Andina 

104 a 113 03°58'49.72" / 73°45'58.64" Acacias, Meta Orinoquía 

114 06°30'1.95" / 75°44'30" Sopetrán, Antioquia Andina 

115 05°55'39.54" / 75°40'11.50" Fredonia, Antioquia Andina 

80 


Identificación morfológica y molecular de Megalobulimus oblongus de Colombia 

Tabla 2. Códigos de acceso de las especies de Megalobulimus y del grupo externo empleados en este estudio disponibles en 

el GenBank, para los marcadores mitocondriales 16S rRNA y COI. Las secuencias proceden de Ramírez et al. 2012, Moussalli 

et al. 2009, Breure y Romero 2012. 

Especie Gen n PB Localidad GenBank 

M. capillaceus 16S rRNA 3 327 San Martín; Perú JN604725; JN604726; JN604727 

M. lichtensteini 16S rRNA 3 329 Cajamarca y Amazonas; Perú JN604731; JN604732; JN604733 

M. maximus 16S rRNA 3 333 Madre de Dios; Perú JN604734; JN604735; JN604736 

M. maximus huascari 16S rRNA 3 329 Junín; Perú JN604728; JN604729; JN604730 

M. popelairianus 16S rRNA 12 330 

San Martín, Loreto, Madre 

de Dios y Junín; Perú 

JN604737; JN604738; JN604739; JN604740; JN604741 

JN604742; JN604743 

M. thammianus 16S rRNA 5 

330 

Junín y Madre de Dios; Perú JN604745; JN604746; JN604747; JN604748; JN604749 

M. separabilis 16S rRNA 1 332 Huánuco; Perú JN604744 

M .parafragilior COI 1 653 ------ JF514645 

Natalina kraussi 16S rRNA 1 865 Eastern Cape; Sudáfrica FJ262234 

Natalina kraussi COI 1 982 Eastern Cape; Sudáfrica FJ262300 

Natalina beyrichi 16S rRNA 1 842 Eastern Cape; Sudáfrica FJ262179 

Natalina beyrichi COI 1 982 Eastern Cape; Sudáfrica FJ262245 

n: número de secuencias por especie 

pb: longitud del fragmento en pares de bases 

-----: dato no disponible 

La amplificación se llevó a cabo en un termociclador C1000 

de Biorad. El volumen final fue de 30 µL, los cuales contenían: 

3 µL de buffer de reacción de PCR a 10X, 2 µL de MgCl 2 

a 25 

mM, 1 µL de cada dNTP a 5 mM, 1.8 µL de cada iniciador a 

5 µM, 0.2 µL de Taq polimerasa a 0.5 unidades por reacción y 

3 µL de ADN. 

La PCR para el marcador 16S rRNA se llevó a cabo con una 

desnaturalización inicial de 96 ºC por 1', seguida de 35 ciclos de: 

desnaturalización a 94 ºC por 1', hibridación de los iniciadores 

a 45 ºC por 1' y extensión a 72 ºC durante 1', terminando con 

una extensión final a 72 ºC por 5'. Para el marcador COI, se 

realizó una desnaturalización inicial de 94 ºC por 4’, seguida de 

35 ciclos de: desnaturalización a 92 ºC por 2', hibridación de 

los iniciadores a 45 ºC por 1' y extensión a 72 ºC durante 1', 

terminando con una extensión final a 72 ºC por 10'. 

Visualización del ADN por electroforesis.- Para comprobar 

la amplificación de los marcadores mitocondriales, se hizo una 

electroforesis en gel de agarosa al 1% con bromuro de etidio; 

se utilizó un marcador de tamaño molecular Hyperladder® de 

100 a 1000pb. La electroforesis se corrió durante 45 minutos 

a 100 voltios. Las bandas se visualizaron y fotografiaron en un 

transiluminador. 

Purificación y secuenciación del ADN.- Los productos de 

amplificación se purificaron usando el sistema Wizard® PCR 

Preps DNA Purification System Kit (Promega); 25 µL de los 

productos se enviaron a la compañía MACROGEN Inc. Korea 

(www.macrogen.com) para su secuenciación. Las secuencias 

están depositadas en el GenBank bajo los números de accesión 

KJ546457 (16S rRNA) y KJ546458 (COI). 

Edición y análisis de las secuencias.- Los cromatogramas 

producto del secuenciamiento, se editaron manualmente 

usando el programa BioEdit v7.0.9 (Hall 1999), y se formó una 

secuencia consenso de cada individuo. Para garantizar que los 

resultados fueran verídicos y no producto de amplificación de 

contaminantes con ADN de otros organismos, se realizó una 


comparación de cada una de las secuencias contra la base de datos 

del GenBank (Benson et al. 2013) con la herramienta BLASTn. 

Para los alineamientos múltiples se incluyeron las secuencias 

registradas y disponibles en el GenBank (Tabla 2) y se utilizó el 

programa ClustalX 2.0 (Larkin et al. 2007). Como grupo externo 

se utilizaron las secuencias de Natalina kraussi (16S rRNA 

FJ262234, COI FJ262300) y N. beyrichi (16S rRNA FJ262179, 

COI FJ262245). Finalmente, con el programa MEGA v4.02 

(Kumar et al. 2008) se construyeron árboles filogenéticos por el 

método de Neighbour-Joining (NJ) con corrección de distancias 

genéticas bajo el modelo de substitución nucleotídica Kimura 

2-parámetros y un bootstrap de 1000 réplicas. 

Resultados 

Descripción de la concha de M. oblongus de Colombia 

La concha de los 28 M. oblongus analizados es dextrógira, 

oblonga y más larga que ancha (Tabla 3). De color beige a marrón 

claro. Tiene de 5 a 6 vueltas que aumentan de tamaño del 

ápice a la apertura. Estos anfractos se encuentran delimitados por 

suturas bien definidas y forman ángulos de 145º a 180º. Entre 

sutura y sutura se observan líneas tenues de crecimiento de tono 

más claro que el resto de la concha. La apertura de la concha es 

oval-semilunar, con un labio externo, doblado hacia afuera, de 

color rosa brillante, muy grueso en el adulto. La pared parietal 

es rosa, presenta un ligero pliegue y se encuentra revestida por 

un callo transparente y brillante. El ombligo está cubierto casi 

en su totalidad por el borde inferior de la apertura (Fig. 1). 

Descripción del sistema reproductor 

La ovotestis está localizada en la cara interna de la glándula 

digestiva entre el segundo y tercer anfracto, es relativamente 

pequeña y está conformada por 5 a 7 acinos de color marrón; 

de la parte inferior de la ovotestis sale el ducto hermafrodita, 

delgado, liso y de aspecto translúcido, en cuanto evoluciona a 

la región distal toma apariencia tortuosa de aspecto sinusoide. 

El complejo de fertilización está caracterizado por un pequeño 

81


Figura 1: Megalobulimus oblongus de Colombia, (A) Vista lateral de la concha; (B) Vista dorsal de la concha; (C) Vista ventral 

de la concha; (escala de 1 cm). La concha fotografiada pertenece a un ejemplar procedente de Norcasia cuyo código es 66. 

Las medidas son: largo total 104,87 mm y ancho total 57,64 mm, con 6 vueltas. Foto: Any Carolina Garcés. 

talón adosado a la parte basal de un saco prominente, ovalado, 

de superficie granular y blancuzco, denominado “saco glandular 

anexo” (Baker 1926, Borda & Ramírez 2013), está embebido 

parcialmente en la glándula del albumen. 

La glándula del albumen es una estructura verde oliva, de 

aspecto sólido y homogéneo, con surcos transversales en la 

superficie y un ducto interno muy delgado que la atraviesa. 

Adosada al costado se encuentra la región posterior de una gran 

estructura plegada en forma de “S”, conformada por la próstata 

y el espermoviducto, que se extiende hasta el oviducto libre. 

En un corte transversal de esta estructura se evidencia: (1) El 

espermoviducto compuesto por dos paredes, la externa gruesa y 

rugosa, y la interna delgada y lisa, con un pequeño lumen entre 

ambas; además una glándula accesoria con forma de gancho. (2) 

La próstata como una masa sólida y lisa. (3) El surco seminal, 

entre el espermoviducto y la próstata, conformado por dos ductos 

estrechamente unidos. El surco seminal viaja longitudinalmente 

hasta el extremo posterior del oviducto libre, en donde se divide 

en un ducto delgado que se une a la pared de este y en un ducto 

grueso que da origen al conducto deferente. 

El oviducto libre se inicia en la región anterior del espermoviducto, 

éste es un ducto robusto de paredes gruesas que 

internamente se encuentra totalmente plegado, en el lado 

derecho posee una dilatación ovoide llamada saco ciego. Al 

lado opuesto se desprende la porción más amplia del ducto de 

la bolsa copulatrix; ésta es una estructura periforme u oval. La 

vagina es una porción delgada contigua al oviducto libre que 

converge en el atrio genital, donde también desemboca el pene; 

el atrio culmina en el poro genital, ubicado en la región cefálica 

del caracol, detrás del tentáculo superior derecho. 

La primera porción del conducto deferente se encuentra inmersa 

en la superficie del oviducto libre, y emerge al lado derecho 

de éste, para recorrer la superficie del oviducto libre, la vagina y el 

pene, hasta unirse al epifalo. Durante su recorrido disminuye su 

diámetro, siendo más delgado en el extremo que se une al epifalo. 

82 

El complejo peneal está compuesto por el pene y el epifalo 

plegado sobre el pene, con paredes sólidas de color crema; 

estos aumentan su diámetro en el extremo donde se encuentra 

la papila apical. Respecto a su tamaño, el pene es 1.94 veces 

más largo y 1.33 veces más ancho que el epifalo. En la región 

externa del epifalo cerca de donde se inserta el ducto deferente, 

se observa una pequeña extensión denominada flagelo. En la 

región interna se observa que el conducto deferente se fusiona 

con una pilastra que lo continúa hasta su extremo terminal para 

unirse a la papila apical del pene; dicha pilastra tiene forma de 

“Y” y pliegues sinuosos. 

Al interior del pene se observan cuatro pilastras definidas, que 

disminuyen su diámetro en la región basal donde se conecta con 

el atrio genital; las pilastras tienen pliegues sinuosos y presentan 

un ensanchamiento en la región apical. La papila apical del 

pene es una estructura sólida de paredes lisas, localizada en la 

región proximal del pene, dicha estructura establece un puente 

entre el pene y el epifalo. El músculo retractor del pene viene 

del diafragma y se adhiere al pene con dos cortos haces, mide 

15 mm de longitud (Fig. 2, Tabla 3). 

Todos los especímenes estudiados correspondieron a Megalobulimus 

oblongus (Müller 1774), debido a que sus características 

morfológicas y conquiliológicas coincidieron con la descripción 

realizada para esta especie por Baker (1926). 

En las conchas de los especímenes estudiados no se hallaron 

mayores diferencias. En cuanto a las estructuras que componen 

el sistema reproductor, las características típicas descritas por 

Baker (1926) se encontraron mejor expresadas en el ejemplar 

366 proveniente de Puerto Berrío-Antioquia, a su vez el ejemplar 

más divergente fue el 114, proveniente de Sopetrán-Antioquia. 

Análisis genético 

En el 100% (28) de los caracoles estudiados, los iniciadores 

utilizados amplificaron un segmento de 328 pb del gen mitocondrial 

16S rRNA. En tanto que solo en el 35% (10/28) de 

los mismos ejemplares los iniciadores “Folmer” amplificaron un 



Figura 2. Morfología del sistema reproductor de Megalobulimus oblongus de Colombia. A. Sistema reproductor de M. oblongus, 

escala 1 cm. B. Ampliación del Saco de Fertilización, escala 5 mm. C. Corte transversal del Espermoviducto (CTE), escala 5 

mm. D. Corte longitudinal complejo peneal, escala 5 mm. E. Corte transversal del Musculo retractor en la región próxima a 

la papila apical, escala 1 mm. Abreviaturas: OV: Ovotestis, DH: Ducto hermafrodita, TA: Talón, SGA: Saco glandular anexo, 

GA: Glándula de albumen, P: Próstata, ES: Espermoviducto, SSR: Saco ciego del sistema reproductor femenino, BC: Bolsa 

copulatriz, DBC: Ducto de la bolsa copulatriz, ODL: Oviducto libre, VA: Vagina, MR: Músculo retractor, PE: Pene, EP: Epífalo, 

FL: flagelo, CD: Conducto deferente, PG: Poro genital, GAC: Glándula Accesoria, SS: surco seminal, LE: Lumen del espermoviducto, 

PIE: Pared interna del espermoviducto, PEE: Pared externa del espermoviducto, PA: Papila apical, PAP: Pilastras 

apicales del pene, LPE: Lumen del pene, CD: Conducto deferente, PY: Pilastra en Y, LEP: Lumen del epifalo. 


83


Tabla 3. Medidas y estadísticos de los órganos del sistema reproductor de Megalobulimus oblongus, de diferentes localidades 

de Colombia. 

Variable 

Valor mínimo 

Valor máximo 

Mediana General 

Mediana El Retorno 

Mediana Acacías 

Mediana Puerto berrío 

Mediana Norcasia 

Mediana Sopetrán 

Valor p Kruskal-Wallis 

Crestas ovotestis n 4 8 6 5 6 7 7 6 0.318 

Glándula del albumen 

L 8 36 20 21 22 19 16 15.5 0.213 

A 2 16 7 8 11 5.5 5 4.5 0.011 

Saco de fertilización 

L 3 22 10 11 11 10 10 6.5 0.022 

A 2 5 4 4 4 4 4 3.5 0.570 

Epifalo 

L 5 29 18 19 15 19 20 20 0.106 

A 1 4 3 3 2 3 3 3 0.154 

Pene 

L 15 48 35 35 27 35 36 37.5 0.085 

A 1 6 4 5 4 4 4 4.5 0.378 

Músculo retractor del pene L 8 45 15 15 15 15 16 22.5 0.351 

Próstata 

L 19 55 35.5 45 33 35 38 37 0.263 

A 4 10 8 10 8 8 9 7 0.124 

Espermoviducto 

L 20 55 36 50 40 35 49 34 0.051 

A 2 11 6.5 7 9 7 7 4.5 0.171 

Bolsa copulatriz 

L 5 21 10 10 10 9 12 7.5 0.489 

A 4 17 7 7 7 6 7 12.5 0.160 

Ducto de bolsa copulatriz 

L 20 41 33 33 35 29.5 35 35 0.142 

A 1 3 2 2 2 2 2 2 0.446 

Ducto hermafrodita 

L 10 50 31 35 22 30 32 37.50 0.147 

A 1 5 3 5 3 3 3 3 0.059 

Ovotestis A 12 24 15 18 12 16 14 13 0.009 

Ducto deferente L 10 50 30 38 37.5 25 40 35.5 0.026 

Oviducto y vagina 

L 15 40 29 30 27.5 26.5 27 30 0.394 

A 5 22 8.5 8 7.5 9.5 8 8.5 0.478 

Concha 

L *101.1 *90.4 NC *91.7 96.3 90.4 *100.3 *101.1 NC 

A 55.8 48.0 50.3 *48 49.4 51.95 *49.3 *53.7 NC 

Periostoma 

L 59.6 47.8 52.3 *52.2 52.3 51.9 *55.5 *59.6 NC 

A 45.9 32.4 40.1 *40.1 36.5 410.5 *41.8 *44.3 NC 

n: número; A: ancho; L: largo 

*: Solo se contaba con el dato de un ejemplar, las medias hacen referencia a ese único dato. NC: no calculado. 

fragmento de 672 pb, del gen mitocondrial Citocromo Oxidasa 

subunidad I (COI). De cada gen se obtuvo un único haplotipo. 

En cuanto al contenido nucleotídico, las secuencias del 

marcador mitocondrial 16S rRNA presentan una relación de 

T+A de 66.4% y C+G de 33.5% y las del marcador COI una 

relación de T+A de 64.4% y C+G de 35.5%. 

El alineamiento de las secuencias del marcador 16S rRNA, 

con las 30 secuencias de Megalobulimus del GenBank, mostró 

que existen 182 sitios conservados (20.56%) y 161 sitios variables 

(18.19%), de los cuales ninguno corresponde a sitios parsimoniosamente 

informativos. Para las secuencias obtenidas del 

COI también se realizó el alineamiento con la única secuencia de 

Megalobulimus encontrada en el GenBank mostrando que existen 

556 sitios conservados (55.05%) y 116 sitios variables (11.48%) 

y tampoco presentó sitios parsimoniosamente informativos. 

En relación a la distancia genética interespecífica mostrada 

por el marcador 16S rRNA, la menor divergencia se presentó 

con M. capillaceus (0.173), y la más alta divergencia se presentó 

con M. maximus (0.253). Con las demás especies los valores de 

Kimura 2 parámetros varían de 0.188 (M. lichtensteini) a 0.252 

(M. huascari). Las secuencias del gen COI de M. oblongus y M. 

parafragilior presentan una distancia genética de 0.207 (Tabla 4). 

El dendrograma Neighbour Joining-NJ del marcador mitocondrial 

16S rRNA, construido con las secuencias de M. oblongus 

de Colombia, las secuencias de seis especies de Megalobulimus 

disponible en el Genbank y las dos secuencias del grupo externo, 

se muestra en la Figura 3. Éste evidenció la formación de dos 

grupos monofiléticos; las secuencias del haplotipo de M. oblongus 

de Colombia presente en los 28 ejemplares estudiados, tienen 

una clara relación con M. capillaceus al compartir un clado con 

un valor de bootstrap de 73%. El otro clado, con un bootstrap del 

84 



M. oblongus Acacias Meta 108 

M. oblongus Puerto Berrio Antioquia 81 

M. oblongus Retorno Guaviare 77 




M. oblongus Sopetran Antioquia 114 


M. oblongus Norcasia Caldas 66 





100 


M. oblongus Fredonia Antioquia 115 






73 









M. capillaceus JN604725 

100 



92 

100 

M. maximus JN604735 

M. maximus JN604736 

M.maximus JN604734 

85 

73 

100 

69 

M. lichtensteini JN604732 



100 

99 

M. maximus huascari JN604730 



M. separabilis JN604744 

50 

M. popelairianus JN604742 


68 

M. popelarianus JN604747 

83 

99 M. popelairianus JN604746 

55 


37 



100 

32 

44 

77 


94 

74 

N. beyrichi FJ262179 





N. kraussi FJ262234 

0.05 

Figura 3. Dendrograma Neighbour Joining-NJ para un segmento del gen mitocondrial 16S rRNA. Se muestra el soporte de 

bootstrap en los nodos, la escala representa 5% de distancia. Las secuencias de M. oblongus reportadas en este estudio 

corresponden a un solo haplotipo. 


85


Tabla 4. Variabilidad nucleotídica de M. oblongus y las especies 

de Megalobulimus disponibles en el GenBank, para los 

marcadores COI y 16S rRNA. 

Especies de Megalobulimus 

y grupo externo 

85%, contiene las demás especies (M. popelairianus, M. huascari, 

M. lichtensteini, M. maximus y M. separabilis). 

El dendrograma NJ del marcador mitocondrial COI construido 

con las secuencias de M. oblongus de Colombia, junto con 

la única secuencia de Megalobulimus disponible en el Genbank 

para este marcador y las dos secuencias del grupo externo, se 

muestra en la Figura 4. El haplotipo de M. oblongus de Colombia 

presente en los 10 individuos en los que se pudo amplificar el 

segmento “Folmer” del gen mitocondrial COI se agrupó con la 

única secuencia del género presente en el GenBank, correspondiente 

a la especie brasilera M. parafragilior. 

Discusión 

Esta es la primera publicación sobre una especie de Megalobulimus 

de Colombia, que establece el estatus taxonómico 

específico a partir de las características morfológicas del sistema 

reproductor de los especímenes objeto de esta investigación, los 

cuales fueron designados como Megalobulimus oblongus (Müller 

1774), debido a que sus características morfológicas y conquiliológicas 

coinciden con las mencionadas para esta especie por 

Baker (1926), Bequaert (1948) y Leme (1973). También es la 

primera inclusión en el genbank de secuencias de M. oblongus de 

los marcadores mitocondriales 16S rRNA y COI, con los cuales 

se confirma que todos los especímenes de esta investigación corresponden 

a un mismo haplotipo. 

De acuerdo con ambos marcadores, M. oblongus es más cercano 

a M. capillaceus que a otras especies con distribución en 

las vertientes orientales de los Andes. Este mismo resultado fue 

encontrado usando un marcador nuclear (Ramírez et al. 2012). 

86 

M. oblongus de Colombia 

SC SV SPI DK2P 

COI (n=10) 

M. parafragilior 55.05 11.48 0 0.207 

Natalina kraussi -- -- 0 0.202 

Natalina beyrichi -- -- 0 0.202 

16S rRNA (n=28) 

M. capillaceus 20.56 16.5 0 0.173 

M. lichtensteini 20.45 16.61 0 0.188 

M. maximus 18.87 18.19 0 0.253 

M. Maximus huascari 19.20 17.85 0 0.247 

M. popelairianus haplotipo 1 19.66 17.40 0 0.219 





M. separabilis 20.0 17.02 0 0.215 

Natalina kraussi -- -- 0 0.407 

Natalina beyrichi -- -- 0 0.335 

n: número de secuencias 

SC: sitios conservados 

SV: sitios variables 

SPI: sitios parsimoniosamente informativos 

DK2P: distancias genéticas según Kimura 2 Parámetros 

--:Datos de grupo externo, no se estiman ya que no son informativos 

El único haplotipo encontrado en cada uno de los dos 

marcadores mitocondriales utilizados, contrasta con la variación 

estadísticamente significativa entre las dimensiones de la 

glándula del albumen, el saco glandular anexo del complejo de 

fertilización, la ovotestis y el ducto deferente, de M. oblongus procedentes 

de diferentes localidades. Ello puede estar relacionado 

con el estado reproductivo de los especímenes y la expresión 

de la variabilidad genética. 

Por ello, cuando los caracteres morfológicos son insuficientes 

para clasificar individuos a nivel de especie, se recurre a la taxonomía 

molecular, siendo el COI el marcador estándar universal. 

Sin embargo, los resultados de esta investigación mostraron 

que el marcador mitocondrial 16S rRNA es más exitoso en la 

amplificación de secuencias de Megalobulimus que el COI, lo 

que concuerda con los hallazgos de Congrains (2010). 

Al considerar los resultados de los análisis moleculares 

realizados a nuestros especímenes clasificados como M. oblongus, 

encontramos nula diversidad genética, evidenciada 

en la existencia de un solo haplotipo para ambos loci mitocondriales, 

aunque los animales hayan habitado lugares 

geográficamente distantes y en ecosistemas muy diferentes. 

Esto se debe quizás a la sinantropía que tiene esta especie y al 

beneficio económico que las personas obtienen de ella; como 

consecuencia especímenes son transportados para su comercio 

ilegal contribuyendo de esta manera a su dispersión por el 

territorio colombiano. 

De otro lado, M. oblongus no es criado ni reproducido 

en cautiverio en Colombia, por lo que todos los ejemplares 

comercializados son extraídos de las poblaciones silvestres, 

hecho que merma las densidades naturales potenciando la 

endogamia, lo que reduce la variabilidad genética y conlleva a 

la disminución considerable de su capacidad de adaptación a 

los cambios del ambiente y conduce a un “cuello de botella” 

genético; como el que Bonnel y Selander (1974) observaron 

en una población del elefante marino Mirounga angustirostris, 

que mostraba baja diversidad genética debido a la caza desmedida 

(Hoelzel et al. 1993). Otro ejemplo de cuello de botella 

natural es el que sufrió el guepardo Acinonyx jubatus durante 

las glaciaciones del Pleistoceno; esta especie de guepardo se 

originó a partir de la especie Acinonyx pardinensis la cual fue 

sometida a condiciones medio ambientales complejas. La nueva 

especie resultante, Acinonyx jubatus, es un mamífero con muy 

baja diversidad génica, viéndose reflejado esto en la alta tasa 

de contagio de enfermedades, comparándolo con otros felinos 

(Ruiz et al. 2007). 

Este estudio sugiere que M. oblongus se encuentra en peligro, 

por lo que urgen estudios sobre reproducción, genética poblacional 

y biogeografía, para impedir su extinción en Colombia. 

Demuestra además que las colecciones de referencia y los bancos 

de tejidos son fuentes de información de gran valor, ya que posibilitan 

la obtención de información relacionada con el riesgo 

en que se encuentran las especies y que sirven de insumo para 

el diseño de acciones de conservación. 

Finalmente, disponer de información taxonómica es fundamental 

para la conservación biológica, ya que proporciona 

la base para el reconocimiento y la protección de las especies 

amenazadas. Da una percepción de la organización de los seres 

vivos (Avise 2004) y es la base para el desarrollo de programas 





M. oblongus Norcasia Caldas 66 


100 


M. oblongus Fredonia Antioquia 115 



M. oblongus Retonor Guaviare 80 


Megalobulimus parafragilior JF514645 

Natalina beyrichi FJ262245 

98 

Natalina kraussi FJ262300 

0.02 

Figura 4. Dendrograma Neighbour Joining-NJ para un segmento del gen mitocondrial COI. Se muestra el soporte de bootstrap 

en los nodos, la escala representa 2% de distancia. 

de conservación y manejo de los recursos biológicos. Una clasificación 

errónea puede conducir a una gestión inadecuada y 

provocar la pérdida de especies (Avise 1989, May 1990, O´Brien 

& Mayr 1991). 


Al CODI por la financiación (acta de Inicio IMB-046- 

2012). Al Dr. Iván Darío Vélez director del PECET-Programa 

de Estudio y Control de Enfermedades Tropicales, por su apoyo 

permanente a las investigaciones en malacología. A los integrantes 

de la unidad de Biología Molecular del PECET, por su 

colaboración en la estandarización de las PCR. A las personas 

que donaron los ejemplares de Megalobulimus a la colección de 

Moluscos Vectores de la Universidad de Antioquia VHET N°37 


Avise J.C. 1989. A role of molecular genetics in the recognition and 

conservation of endangered species. Trends in Ecology & 

Evolution 4: 279-281. doi: 10.1016/0169-5347(89)90203- 

6 

Avise J.C. 2004. Molecular Markers, Natural History, and Evolution 

(Second Edition). Sinauer, Sunderland, MA. 684pp. 

Baker H.B. 1926. The Mollusca collected by the University of Michigan 

– Williamson Expedition in Venezuela. Part IV. 

Occasional Papers of the Museum of Zoology, University 

of Michigan 167: 1-49. 

Benson D.A., I. Karsch-Mizrachi, K. Clark, et al. 2013. GenBank. 

Nucleic Acids Research 41(D1): D36-42. doi: 10.1093/ 

nar/gkq1079 

Bequaert J. 1948. Monograph of the Strophocheilidae, a Neotropical 

family of terrestrial mollusks. Bulletin of the Museum of 

Comparative Zoology 1: 1 – 210. 

Bonnell M.L. & R.K. Selander. 1974. Elephant seals: genetic variation 

and near extinction. Science 184: 908-909. doi:10.1126/ 

science.184.4139.908 

Borda V. & R. Ramírez. 2013. Re-characterization of the Red-lip 

Megalobulimus (Gastropoda: Strophocheilidae) from Peru 

with description of a new species. Zoologia 30(6): 675–691. 

http://dx.doi.org/10.1590/S1984-46702013005000008 

Breure A.S.H. & P. Romero. 2012. Support and surprises: molecular 

phylogeny of the land snail superfamily Orthalicoidea using 

a three-locus gene analysis with a divergence time analysis 

and ancestral area reconstruction (Gastropoda: Stylommatophora). 

Archiv für Molluskenkunde: International 

Journal of Malacology, 141(1): 1-20. doi: 10.1127/arch. 

moll/1869-0963/141/001-020 

Congrains C. 2010. Ayudando a descifrar el enigma taxonómico, el 

código de barras de ADN de Megalobulimus spp. (Mollusca, 

Gastropoda) del Departamento de San Martín - Perú. Tesis, 

Título Profesional de Biólogo Genetista y Biotecnólogo. 

Facultad de Ciencias Biológicas, Universidad Nacional 

Mayor de San Marcos. 

Daniel H. 1942. Apuntes sobre algunos moluscos colombianos. Revista 

de la Academia Colombiana de Ciencias Exactas, Físicas y 

Naturales 4 (15-16): 372 – 379. 

Feng Y., Li Q., L. Kong & X. Zheng. 2011. DNA barcoding and phylogenetic 

analysis of Pectinidae (Mollusca: Bivalvia) based on 

mitochondrial COI and 16S rRNA genes. Molecular Biology 

Reports 38: 291 - 299. doi: 10.1007/s11033-010-0107-1 

Folmer O., M. Black, W. Hoeh, et al. 1994. DNA primers for 

amplification of mitochondrial cytochrome c oxidase subunit 

I from diverse metazoan invertebrates. Molecular Marine 

Biology and Biotechnology 3 (5): 294-299. 

Hall T. 1999. BioEdit: a user-friendly biological sequence alignment 

editor and analysis program for Windows 95/98/NT. Nucleic 

Acids Symposium Series 41: 95-98. 

Hausdorf B. & P. Bouchet. 2005. Working classification of the 

Gastropoda. Pulmonata. In: P. Bouchet and J.P. Rocroi, 

eds. Classification and nomenclator of gastropod families. 

Malacologia 47 (1/2): 263-283. 

Hebert P., A. Cywinska, S. Ball & J. Waard. 2003. Biological 

identifications through DNA barcodes. Proceedings B of 

the Royal Society, London. 270: 313 - 321. doi: 10.1098/ 

rspb.2002.2218 


87


Hoelzel A.R., J. Halley, S.J. O’Brien, et al. 1993. Elephant seal genetic 

variation and the use of simulation models to investigate 

historical population bottlenecks. Journal of Heredity 84: 

443-449. 

Jousseaume F. 1887. Mollusques nouveaux de La Republiquedel Equateur. 

Bulletin de la Société Zoologique de France 12:165-186 

Kumar S., J. Dudley, M. Nei & K. Tamura 2008. MEGA: A biologistcentric 

software for evolutionary analysis of DNA and 

protein sequences. Briefings in Bioinformatics 9: 299-306. 

doi: 10.1093/bib/bbn017 

Larkin M., G. Blackshields, N. Brown, et al. 2007. Clustal W and 

Clustal X version 2.0. Bioinformatics 23: 2947-2948. doi: 

10.1093/bioinformatics/btm404 

Leme J. 1973. Anatomy and systematics of the neotropical Strophocheiloidea 

(Gastropoda, Pulmonata) with the description 

of a new family. Arquivos de Zoologia 23(5): 295 – 337. 

Leme J. 1975. Ensaios filogenéticos em Pulmonata e sua importância 

na nova conceituação da Superfamília Strophocheiloidea 

(Gastropoda, Stylommatophpra). Archivos do Museu Nacional 

do Rio de Janeiro 55: 79 – 84. 

Leme J. 1989. Megalobulimus lopesi sp. n., uma nova espécie de 

Pulmonata terrestre da Mata Atlântica brasileira (Mollusca, 

Gastropoda, Megalobulimidae). Memórias do Instituto 

Oswaldo Cruz 84(4): 313 – 318. http://dx.doi.org/10.1590/ 

S0074-02761989000800055 

Leme J. 1993. Estúdio anatômico sobre Megalobulimus auritus 

(Sowerby, 1838) (Gastropoda, Megalobulimidae). Papéis 

Avulsos de Zoologia 38(7): 95 – 105. 

Leme J. & L. Indrusiak 1990. Megalobulimus parafragilior sp.n., 

uma nova espécie de Pulmonata terrestre da Serra do Mar 

(Gastropoda, Megalobulimidae). Papéis Avulsos de Zoologia 

37(5): 97 – 105. 

Linares E.L. & M. Vera. 2012. Catálogo de moluscos continentales de 

Colombia. Bogotá: Instituto de Ciencias Naturales, Facultad 

de Ciencias Universidad Nacional de Colombia. 360 pp. 

Martens E. 1876. Vorläufige Mittheilungen über die Molluskenfauna 

von Süd-Georgien. Sitzungs-Bericht der Gesellschaft Naturforschender 

Freunde 3: 89 - 94. 

May R.M. 1990. Taxonomy as destiny. Nature 347: 129-130. 

doi:10.1038/347129a0 

Miller K. 1878. Die Binnenmollusquen von Ecuador. Malakozoologische 

Blätter 25: 153 – 159. 

Moussalli A., D.G. Herbert & D. Stuart-Fox. 2009. A phylogeny of the 

cannibal snails of southern Africa, genus Natalina sensu lato 

(Pulmonata: Rhytididae): assessing concordance between 

morphology and molecular data. Molecular Phylogenetics 

and Evolution 52 (1): 167-182. http://dx.doi.org/10.1016/j. 

ympev.2009.02.018 

Müller O. 1774. Vermiunm terrestium et fluviatilium, seu animalium 

infosurior Helmithicorum et Testaceorum, non marinorun 

succincta historia. Havniae et Lipsiae 14: 214. 

Nyst H. 1845. Notice sur quelques Bulimus nouveaux ou peu connus. 

Bulletin de l’Academie Royale de Belgique 12: 146 – 153. 

O’Brien, S.J. & Mayr, E. 1991. Bureaucratic mischief: recognizing 

endangered species and subspecies. Science. 251: 1187- 

1188. DOI:10.1126/science.251.4998.1187 

Pfeiffer L. 1842. Symbolae ad historiam heliceorum: Sectio Altera. 

Cassellis: Fischeri. 147pp. 

Ramírez R. 2004. Sistemática e Filogeografía dos Moluscos do Ecossistema 

de “Lomas” do Deserto da Costa Central do Peru. 

Tese, Doutorado. Faculdade de Biociências, Pontificia Universidade 

Católica do Rio Grande do Sul, Brasil. 

Ramírez R., V. Borda, P. Romero, et al. 2012. Biodiversidad y endemismo 

de los caracoles terrestres Megalobulimus y Systrophia 

en la Amazonia occidental. Revista peruana de biología 

19(1): 059 – 074. 

Restrepo M. 2009. Descripción morfológica de Megalobulimus 

oblongus (Müller, 1774) para Norcasia, Caldas. Tesis. 

Facultad de Ciencias Exactas y Naturales, Universidad de 

Antioquia, Colombia. 

Ruiz García M., A. Murillo, C. Corrales, et al. 2007. Genética de 

poblaciones amazónicas: la historia evolutiva del jaguar, 

ocelote, delfín rosado, mono lanudo y piurí, reconstruida a 

partir de sus genes. Animal Biodiversity and Conservation 

30.2: 115–130. 

Vences M., M. Thomas, A. van der Meijden, et al. 2005. Comparative 

performance of the 16S rRNA in DNA barcoding of 

amphibians. Frontiers in Zoology 2: 5. doi:10.1186/1742- 

9994-2-5 

Vera M. 2008. Lista de los géneros de moluscos terrestres de Colombia 

(Mollusca: Gastropoda: Prosobranchia: Mesogastropoda y 

Pulmonata: Stylommatophora). Biota Colombiana 9(1): 

39 – 62 

88 



Caracterización molecular de resistencia a quinolonas en 

ISSN-L 1561-0837 

Bartonella bacilliformis 




Caracterización molecular de la región determinante de resistencia a quinolonas 

(QRDR) de la topoisomerasa IV de Bartonella bacilliformis en aislados clínicos 

Molecular characterization of quinolones resistance determining region (QRDR) of Bartonella 

bacilliformis topoisomerasa IV in clinical isolates 

Abraham Espinoza-Culupú 1 , Ruth Quispe-Gaspar 1 , Michael Jaramillo 1 , Melisa Icho 1 , Anika Eca 1 , Pablo 

Ramírez 1 , Débora Alvarado 1 , Juan Carlos Guerrero 2 , Franklin Vargas-Vásquez 3 , Ofelia Córdova 4 , Ruth 

García-de-la-Guarda 1 * 

1 Laboratorio de Microbiología Molecular y Biotecnología 

– Facultad de Ciencias Biológicas – 

Universidad Nacional Mayor de San Marcos, Perú. 

Apartado postal 110058, Lima-11, Perú. 

2 Establecimiento de Salud I-4 Huancabamba, 

Piura, Perú. 

3 Instituto de Investigación en Microbiología y 

Parasitología Tropical - Universidad Nacional de 

Trujillo, Perú. 

4 Laboratorio de Biología Celular y Molecular - 

Dpto. de Ciencias - Universidad Privada Antenor 

Orrego, Trujillo, Perú. 

*Autor para correspondencia R. García-de-la- 

Guarda: rgarciad@unmsm.edu.pe 

Email A. Espinoza: aespinozac20@gmail.com 

Email R. Quispe: ruty_lilly@yahoo.es 

Email M. Jaramillo: maycol776@yahoo.es 

Email M. Icho: m.biomicro@gmail.com 

Email A. Eca: anikaeca@gmail.com 

Email P. Ramírez: pramirezr@unmsm.edu.pe 

Email D. Alvarado: dalvaradoi@unmsm.edu.pe 

Email J.C. Guerrero: guerreroruizjc@hotmail.com 

Email F. Vargas-Vásquez: frvargasv@yahoo.es 

Email O. Córdova: omacop@hotmail.com 

Citación: 

Espinoza-Culupú A., R. Quispe-Gaspar, M. Jaramillo, 

M. Icho, A. Eca, P. Ramírez, D. Alvarado, 

J.C. Guerrero, F. Vargas-Vásquez, O. Córdova, 

R. García-de-la-Guarda. 2014. Molecular characterization 

of quinolones resistance determining 

region (QRDR) of Bartonella bacilliformis topoisomerasa 

IV in clinical isolates. Revista peruana 

de biología 21(1): 089-098 (Mayo 2014), doi: http:// 

doi.org/10.15381/rpb.v21i1.8251 

Resumen 

Bartonella bacilliformis es el agente etiológico de la Enfermedad de Carrión, endémica del 

Perú. Pocas investigaciones han sido realizadas acerca de los genes asociados a la resistencia 

antimicrobiana en aislados clínicos de este patógeno. Estos genes no están caracterizados 

molecularmente, ni se conoce la región asociada a dicha resistencia. Por ello, el objetivo del 

este trabajo fue caracterizar molecularmente la región determinante de la resistencia a las 

quinolonas (QRDR) en la topoisomerasa IV, que está codificada por los genes parC y parE, así 

como también desarrollar una prueba de susceptibilidad antimicrobiana para B. bacilliformis. 

Las muestras sanguíneas de 65 pacientes procedentes de La Libertad, Cusco, Ancash y Piura, 

se sembraron en placas de agar sangre e incubaron a 30 °C con 5% CO 2 

. Luego se procedió 

a: (1) determinar la susceptibilidad antimicrobiana y (2) extraer el DNA genómico, amplificar 

los genes mencionados, secuenciarlos y analizarlos mediante herramientas bioinformáticas. 

Se obtuvieron 6 cultivos positivos. Los aislados fueron sensibles a la ciprofloxacina (excepto 

uno procedente de Quillabamba-Cusco, que presentó susceptibilidad disminuida) y resistentes 

al ácido nalidíxico. Del análisis de las secuencias aminoacídicas de ParC y ParE de 

B. bacilliformis se concluye que presentan diferencias aminoacídicas en comparación con las 

secuencias de las proteínas respectivas de E. coli K12 MG1655, que probablemente confieran 

resistencia al ácido nalidíxico pero no a la ciprofloxacina. Se determinó que las QRDR de las 

proteínas ParC y ParE de B. bacilliformis están comprendidas entre los aminoácidos 67 al 118 y 

473 al 530, respectivamente. El antibiograma y la concentración mínima inhibitoria se evalúan 

mejor usando inóculos a escala 1 de McFarland y a los 6 días de incubación. 

Palabras clave: Susceptibilidad antimicrobiana; Bartonella bacilliformis; ParC; ParE; quinolonas. 

Abstract 

Bartonella bacilliformis is the etiologic agent of Carrion's disease, which if endemic to Peru. 

Studies on antimicrobial resistance genes from clinical isolates of this pathogen are scarce, 

and the molecular characteristics of these genes and their region resistance-associated are 

currently unknown. In this work we made the molecular characterization of the quinoloneresistance, 

and establish the region (QRDR) for the topoisomerase IV, which is encoded by the 

parC and parE genes, as well as develop an antimicrobial susceptibility test for B. bacilliformis. 

65 Blood samples from La Libertad, Cusco, Ancash and Piura were processed on Blood Agar 

plates and incubated at 30 °C, 5% CO 2 

. The antimicrobial susceptibility was determined, then 

the genomic DNA extracted, aforementioned genes amplified, their sequence determined and 

it analyzed using bioinformatics tools. Six positive cultures were obtained. The isolates were 

susceptible to Ciprofloxacin (except one strain from Quillabamba – Cusco, which showed 

decreased susceptibility) and were resistant to Nalidixic Acid. From the sequence analysis of 

B. bacilliformis ParC and ParE there have been shown amino acid differences compared to the 

respective protein sequences from E. coli K12 MG1655, which is likely to confer resistance to 

Nalidixic Acid but not to Ciprofloxacin. It was determined that B. bacilliformis ParC and ParE 

proteins QRDRs are comprised between amino acids 67 to 118 and 473 to 530, respectively. 

The antibiogram and the minimal inhibitory concentration are best assessed using the #1 

McFarland standards after a 6-day incubation period. 

Keywords: antimicrobial susceptibility; Bartonella bacilliformis; ParC; ParE; quinolones. 


Aceptado: 30/04/2014 








89

Espinoza-Culupú et al. 

Introducción 

Bartonella bacilliformis es el agente etiológico de la Enfermedad 

de Carrión, endémica de los valles interandinos del Perú. 

Esta enfermedad es de notificación obligatoria en el Perú y sus 

tasas de incidencia por regiones han variado a lo largo de décadas, 

con un número elevado de casos en Amazonas, Ancash y 

Piura en los últimos años (DGE, 2013). Se han usado diferentes 

antibióticos para el tratamiento de infecciones con B. bacilliformis, 

tales como eritromicina, cloranfenicol, ciprofloxacina, 

rifampicina, entre otros (MINSA 2006, Rolain et al. 2004). El 

tratamiento con estos antibióticos produce una rápida reducción 

de la bacteremia, sin embargo, se ha reportado casos en que la 

bacteremia persiste después de suspender el tratamiento con 

antibióticos (Rolain et al. 2004, Henriquez et al. 2004, Perez 

et al. 2010, Biswas 2010). 

Actualmente, la ciprofloxacina (Cip) es considerada como 

el tratamiento de primera línea en Perú, debido a su buena 

penetración celular (MINSA 2006, Tarazona et al. 2006). 

Existen reportes donde se menciona que el 22.6% de los pacientes 

presentaron bacteremia asintomática crónica después del 

tratamiento con Cip (Pachas 2000), a pesar que este antibiótico 

aparentemente es exitoso (Maguiña et al. 2001, Maguiña et al 

2008, Rolain et al. 2004). Además estudios previos han demostrado 

una susceptibilidad disminuida de B. bacilliformis a la Cip, 

también como a otras fluoroquinolonas (Flores 2008, Dörbecker 

et al. 2006, Sobraques et al. 1999). Asimismo, se ha determinado 

que las fluoroquinolonas usadas en monoterapias pueden 

ser inefectivas porque se han aislado fácilmente B. bacilliformis 

resistentes a Cip in vitro (Biswas et al. 2007). Recientemente, 

se ha determinado que B. bacilliformis presenta resistencia constitutiva 

a la quinolona ácido nalidíxico (Nal) (Del Valle et al. 

2010). Asimismo, se ha demostrado que existen aislados de B. 

bacilliformis que están adquiriendo resistencia a rifampicina y 

eritromicina además de Cip (Minnick et al. 2003, Biswas et al. 

2007). Maguiña et al. (2008), afirman que la mayoría de estos 

tratamientos se han definido basándose en opinión de expertos o 

estudios pequeños controlados, haciéndose necesaria la ejecución 

de ensayos clínicos randomizados controlados para la búsqueda 

de un mejor tratamiento. 

Actualmente existen pocas investigaciones acerca de la susceptibilidad 

a antimicrobianos in vitro de B. bacilliformis. No existe 

un antibiograma estandarizado para esta bacteria y tampoco se 

conocen los mecanismos de resistencia ni las secuencias de los 

genes asociados a dicha resistencia. La base molecular de la resistencia 

a las quinolonas, como ocurre en otros microorganismos, 

reside en mutaciones en la región determinante de resistencia a 

quinolonas (QRDR) de los genes gyrA, gyrB de la topoisomerasa 

II y los genes parC y parE de la topoisomerasa IV (Law et al. 

2010, Serra 2008, Hopkins et al. 2005). 

Por consiguiente, el objetivo del presente estudio fue caracterizar 

la secuencia de la QRDR de ParC y ParE de aislados clínicos 

de B. bacilliformis de zonas endémicas, así como estandarizar un 

procedimiento para realizar el antibiograma y la concentración 

mínima inhibitoria (CMI). 


Pacientes y muestras.- Se colectaron 65 muestras de sangre 

venosa en tubos al vacío con anticoagulante EDTA, a personas 

con síntomas de la Enfermedad de Carrión (DGE 2013), según 

su historia clínica, para lo cual nos asistía el personal del centro 

de salud de la zona, con autorización verbal del Jefe de la Región 

de Salud respectiva dada después de haberle presentado el 

proyecto de la investigación. 

Los muestreos fueron realizados en las siguientes zonas endémicas 

de la Enfermedad de Carrión (DGE 2013): a) Sondor 

(n=8), Sondorrillo (n=12) y Carmen de la Frontera (n=23), 

Departamento de Piura, b) Urubamba (n=5) y Quillabamba 

(n=10), Departamento de Cusco, c) Calipuy (n=4), Departamento 

de La Libertad, y d) Caraz (n= 3), Departamento de 

Ancash. 

Declaración de ética.- El estudio fue aprobado bajo los 

lineamientos del Comité de Ética de la Facultad de Ciencias 

Biológicas de la Universidad Nacional Mayor de San Marcos. 

Todos los pacientes o adultos responsables firmaban por escrito 

el consentimiento informado para la toma de muestra y su posterior 

análisis. Los pacientes fueron informados que la muestra 

de sangre sería utilizada para fines de investigación y tomaban 

la decisión si aceptaban o rechazaban la toma de muestra. 

Aislamiento de B. bacilliformis.- Para el aislamiento de 

esta bacteria a partir de sangre de pacientes, se emplearon placas 

de agar Columbia suplementado con 5% de glóbulos rojos de 

ovino y 2% de suero bovino fetal, así como tubos con medio 

bifásico compuestos por una fase sólida del mismo medio antes 

descrito y una fase líquida de caldo infusión cerebro corazón 

(BHI) (Colichón & De Bedon 1973; Coleman & Minnick 

2001). Las placas se sembraron por diseminación con 200 µL 

de sangre homogeneizada y los tubos con medio bifásico con la 

adición de 800 a 1000 µL de sangre, siguiendo la metodología 

de Quispe (2009). Los cultivos se incubaron a 30 °C con 5% 

de CO 2 

a una humedad relativa de 100% (Quispe 2009; Minnick 

et al. 2003) por seis a ocho días hasta su crecimiento. Los 

subcultivos y los ensayos de susceptibilidad antimicrobiana se 

realizaron en agar Columbia base (Merck) suplementado con 

8% de glóbulos rojos de ovino. 

Determinación de la susceptibilidad antimicrobiana en 

Bartonella bacilliformis.- Se empleó la técnica de Kirby-Bauer 

(CLSI 2011, Restrepo 2002; Perilla et al. 2003) modificada 

según lo indicado por Pendle et al. (2006) para los ensayos de 

difusión en disco, y la prueba Épsilon para la CMI. Los cultivos 

de B. bacilliformis aislados de pacientes y las cepas del Instituto 

Pasteur de Francia CIP57.17 y CIP57.18, se resuspendieron 

en un volumen de 3 mL de solución salina fisiológica a pH 7.2 

a una concentración celular equivalente a las escalas 0.5, 1 y 2 

de McFarland. Se inoculó un volumen de 1.5 mL de las suspensiones 

bacterianas en las placas, bañando toda la superficie 

y aspirando el exceso con una micropipeta. Luego se procedió a 

colocar los discos de antibiótico (Oxoid) e incubar a 30 °C con 

5% de CO 2 

y a una humedad relativa de 100%. La evaluación 

del crecimiento e inhibición bacteriana en las placas se realizaron 

desde el día 5 hasta el 12. Para la susceptibilidad bacteriana se 

emplearon los siguientes antimicrobianos: discos de Cip (5 μg) y 

de Nal (30 µg), y tiras de Cip con una gradiente de concentración 

de 0.02 a 32 µg/ µL (tiras MICE de Oxoid). 

Extracción de DNA.- La extracción del DNA genómico de 

las bartonelas, provenientes de cultivos en placas, se realizó usando 

el kit Miniprep de Wizard Genomic Purification (Promega), 

siguiendo las indicaciones del fabricante. 

90 


Caracterización molecular de resistencia a quinolonas en Bartonella bacilliformis 

Lavado del paquete celular.- Se hicieron 3 lavados de las 

células bacterianas con agua de grado molecular para eliminar 

los restos de medio de cultivo, centrifugando a 13000 rpm por 

2 minutos y descartando el sobrenadante. 

Lisis celular y acción de la RNasa.- Al sedimento de células 

bacterianas se le adicionó 600 µl de la solución de lisis e incubó 

a 80 °C por 5 minutos, luego se dejó a temperatura ambiente 

por 5 minutos para adicionarle 3 µL de RNasa (4mg/mL) y se 

incubó a 37 °C por 1 hora. 

Precipitación de proteínas.- Se agregó 200 µL de solución 

de precipitación de proteínas al lisado tratado con RNasa, se 

homogeneizó vigorosamente por 20 segundos e incubó por 5 

minutos en hielo. Luego se centrifugó a 13000 rpm por 3 minutos 

colocando el sobrenadante a un tubo de microcentrifuga 

de 1.5 mL. 

Precipitación de DNA.- Al tubo de microcentrifuga con 

sobrenadante, se adicionó 600 µL de isopropanol absoluto mezclando 

suavemente por inversión, hasta formar una masa visible 

de DNA, para luego centrifugar a 13000 rpm por 2 minutos, 

eliminando el sobrenadante cuidadosamente y escurriendo el 

tubo en papel absorbente limpio. 

Lavado del DNA.- Al microtubo que contenía el sedimento 

de DNA se adicionó 600 µL de etanol al 70%, se mezcló por 

inversión varias veces para lavar el sedimento, luego se centrifugó 

a 13000 rpm por 2 minutos, se eliminó el sobrenadante 

cuidadosamente y se dejó secar el tubo de 10 a 15 minutos. 

Hidratación del DNA.- El DNA fue rehidratado con 100 

µL de solución de rehidratación de DNA por incubación a 65°C 

por 1 hora, periódicamente se golpeaba el tubo suavemente para 

mezclar la solución. Finalmente se guardó a -20°C hasta su uso. 

Ensayo de PCR.- La amplificación por PCR del gen ialB de 

B. bacilliformis se realizó para confirmar la especie (Mitchell & 

Minnick 1995, Flores 2008). Posteriormente, se amplificó las 

regiones QRDR de los genes parC y parE de la topoisomerasa IV. 

Los iniciadores usados fueron ParC F: TCTTATGCTAAGTG- 

TGCACGGA y ParC R: TACCAACAGCAATCCCTGAAGAA 

(Flores, 2008), ParE F: GAAGTCGCACGAGAGCGCAA y 

ParE R: AGCGGAACCGTTCTTCCGGT (diseñados en este 

estudio). El parámetro de ciclaje fue: desnaturalización a 95 °C 

durante 3 minutos (1 ciclo), seguido de 29 ciclos a 94 °C por 

30 segundos, hibridación a 57 °C (parC), 58 °C (ialB) y 62 °C 

(parE) por 30 segundos, extensión a 72 °C por 30 segundos y 

extensión final a 72 ºC por 7 minutos. La mezcla de reacción en 

un volumen de 50 μL fue: 1.5 μL de cada iniciador (10 μM), 5 

μL de dNTPs (2mM), 5 μL de buffer Kod Hot Start (10X), 3 

μL de MgSO 4 

(25mM), 1.5 μL de Taq KOD Hot Start (Novagen 

® ), 31.5 μL de agua grado molecular y 1 μL de DNA molde. 

Para visualizar el DNA y los productos de amplificación, se 

hicieron electroforesis en gel de agarosa al 1% en buffer TAE 

0,5X, mezclando las muestras con solución de carga 6X (Novagen 

® ). Se utilizó el marcador de tamaño molecular Perfect 

DNA TM 50 bp Ladder (Novagen ® ). Luego de la electroforesis, 

los geles se tiñeron con bromuro de etidio (0.5 µg/mL), por 45 

segundos, para visualizarlos en el transiluminador UV. 

Secuenciamiento y análisis bioinformático.- Los amplificados 

fueron secuenciados por la empresa Macrogen, con secuenciamiento 

estándar y por ambas direcciones. El análisis in silico 

se realizó mediante herramientas bioinformáticas empleando 

Bioedit (Hall 1999) y MEGA 5.2 (Tamura et al. 2011) para 

evaluar y obtener la secuencia consenso de los genes. Posteriormente 

se usó CLUSTALW 2.1 (Thompson et al. 1994) para los 

alineamientos múltiples y determinar las posibles mutaciones 

en la secuencias nucleotídicas y aminoacídicas, comparando 

nuestras secuencias con las depositadas en la base de datos 

GenBank para los genes parC y parE de B. bacilliformis KC583 

y E. coli K-12 MG1655. 

Modelamiento por homología del dominio QRDR de 

ParC y ParE de B. bacilliformis relacionadas a la resistencia 

antimicrobiana.- Con las secuencias aminoacídicas de B. 

bacilliformis se realizaron los modelamientos para localizar, en 

la estructura, los aminoácidos involucrados en la resistencia 

antimicrobiana. Para estos modelamientos se empleó el servidor 

online SWISS-MODEL (http://swissmodel.expasy.org/). Los 

modelos fueron obtenidos en formato pdb y las estructuras 

tridimensionales se visualizaron con Swiss-Pdb Viewer 4.1.0 

y Jmol13. 

Obtención de las secuencias de genes relacionados a 

resistencia antimicrobiana en el GenBank.- Se accedió al 

GenBank para obtener las secuencias de los genes de la topoisomerasa 

IV de B. bacilliformis KC583 parC y parE (Gene 

ID: 4684170 y 4684565), y para E. coli cepa K-12 MG1655 

(Gene ID: 947499 y 947501) para compararlas con nuestras 

secuencias obtenidas. 

Finalmente las secuencias nucleotídicas de los aislados de B. 

bacilliformis, obtenidos en el presente estudio, fueron ingresadas 

a la base de datos EBI (http://www.ebi.ac.uk/) con los números 

de acceso siguientes: HG315965, HG315966, HG315967 

para el gen parC y HG315962, HG315963, HG315964 para 

el gen parE 

Resultados 

De los muestreos realizados se obtuvieron seis cultivos positivos 

(9%) con características culturales compatibles con B. bacilliformis. 

A los cultivos positivos se les codificó con USM-LMMB 

(Universidad Nacional Mayor de San Marcos – Laboratorio de 

Microbiología Molecular y Biotecnología), seguido del número 

del aislado: USM-LMMB-001 (Calipuy - La Libertad); USM- 

LMMB-002 y USM-LMMB-006 (Quillabamba – Cuzco); 

USM-LMMB-003 (Urubamba- Cuzco); USM-LMMB-005 

(Sondor- Piura); USM-LMMB-007 (Carmen de la frontera 

– Piura). Los seis cultivos fueron positivos a la amplificación 

del gen ialB, indicando que los cultivos corresponden a B. 

bacilliformis. 

Susceptibilidad antimicrobiana en Bartonella bacilliformis.- 

Se ha estandarizado el procedimiento para realizar 

el antibiograma y la CIM (mediante la prueba Épsilon) para 

determinar la susceptibilidad antimicrobiana de B. bacilliformis. 

Se obtuvieron crecimientos uniformes en las placas, siendo el 

inóculo con el que se visualizaron mejor los halos de inhibición 

del crecimiento bacteriano, el que estaba a una concentración 

celular equivalente al tubo N° 1 de la escala de McFarland (Fig. 

1, Tabla 1, Fig. 2 y Tabla 2). En cuanto al tiempo de incubación 

óptimo para hacer la medición del diámetro de dichos halos, éste 

resultó ser el día 6 después de la siembra de las placas, debido a 

que fue el menor tiempo en el que se observaron los halos mejor 

definidos (Tablas 1 y 2). 


91


Figura 1.- Estandarización del procedimiento para realizar 

el antibiograma mediante difusión en agar con disco de Cip 

(5µg) para determinar la susceptibilidad antimicrobiana de 

B. bacilliformis. Los ensayos se hicieron con la cepa USM- 

LMMB-005, ajustando los inóculos a los tubos N° 0.5 (placa 

superior), 1 (placa de la izquierda) y 2 (placa de la derecha) 

de la escala de McFarland. Las lecturas se hicieron hasta 

los 12 días. 

Figura 2.- Estandarización del procedimiento para realizar 

la CIM mediante la prueba Épsilon con tiras de Cip con una 

gradiente de concentración de 0.02 a 32 µg/ µL para determinar 

la susceptibilidad antimicrobiana de B. bacilliformis. Los 

ensayos se hicieron con la cepa USM-LMMB-005, ajustando 

los inóculos a los tubos N° 0.5 (placa superior), 1 (placa de la 

izquierda) y 2 (placa de la derecha) de la escala de McFarland. 

Las lecturas se hicieron hasta los 12 días. 

Figura 3.- Susceptibilidad antimicrobiana de B. bacilliformis USM-LMMB-005: En A, mediante disco difusión en agar para el ácido 

nalidixico (6mm, resistente) y en B, para la Cip (52mm, sensible). En C, prueba Épsilon para Cip (0.023 mg/L). Los ensayos se 

hicieron usando una suspensión celular equivalente a la escala 1 de McFarland, evaluándose hasta los 12 dias de incubación. 

Tabla 1.- Valores del diámetro en milímetros de los halos de 

inhibición del crecimiento bacteriano de B. bacilliformis en la 

prueba de susceptibilidad antimicrobiana a la Cip, mediante 

difusión por disco en agar, con inóculos ajustados a tres tubos 

de la escala de McFarland y mediciones de los halos en 

diferentes tiempos de incubación. 

Tiempo de incubación (días) 

Escala McFarland 5 6 7 12 

0,5 N.D 52(ED) 52 52 

1 52(ED) 52 52 52 

2 52(ED) 52 52 52 

ND: No definido. 

ED: Empezando a definirse el halo. 

Tabla 2.- Valores para B. bacilliformis de la CIM en mg/L 

mediante la prueba Épsilon con tiras de Cip, con inóculos 

ajustados a tres tubos de la escala de McFarland y evaluaciones 

en diferentes tiempos de incubación. 

Tiempo de incubación (días) 

Escala McFarland 5 6 7 12 

0,5 N.D 0.023(ED) 0.023 0.023 

1 0.023(ED) 0.023 0.023 0.023 

2 0.032(ED) 0.032 0.032 0.032 

ND: No definido. 

ED: Empezando a definirse el halo. 

92 



Figura 5.- Amplificados de la QRDR de los genes de la topoisomerasa 

IV: gen parC con tamaño de 349 pb correspondientes 

a los carriles del 1 al 4 y gen parE con tamaño de 1495 

pb correspondiente a los carriles del 5 al 8. Se utilizaron las 

siguientes cepas: CIP57.17, carriles 1 y 5; USM-LMMB-005, 

carriles 2 y 6; USM-LMMB-006 carriles 3 y 7; USM-LMMB-007, 

carriles 4 y 8. M1 corresponde al marcador Perfect DNA TM 50 

bp Ladder Novagen ® . 

Figura 4. Susceptibilidad disminuida a la ciprofloxacina de 

la cepa Bartonella bacilliformis USM-LMM-002: A. Prueba 

Épsilon que determinó una CMI de 2 mg/L con tiras de Cip 

(gradiente de concentración de 0.02 a 32 µg/ µL), B. Halo de 

inhibición del crecimiento de 19 mm con disco de Cip (5 μg). 

Con respecto a la susceptibilidad de los aislados obtenidos, 

todos mostraron resistencia al Nal (Fig. 3A), y fueron sensibles 

a Cip (Fig. 3B y 3C), a excepción del aislado USM-LMM-002 

procedente de Quillabamba - Cusco, que mostró susceptibilidad 

disminuida a Cip (Fig. 4). 

Amplificación de genes de la topoisomerasa IV de Bartonella 

bacilliformis.- Las amplificaciones de las QRDR de los genes 

de la topoisomerasa IV se evidenciaron mediante electroforesis 

en gel de agarosa al 1%. Los carriles del 1 al 4 corresponden al 

amplificado de la QRDR del gen parC con un tamaño de 349 

pb, y los carriles del 5 al 8 al amplificado de la QRDR del gen 

parE con un tamaño de 1495pb como se muestra en la Fig. 5. 

Análisis in silico de la subunidad A (ParC) y subunidad B 

(ParE) de la topoisomerasa IV de Bartonella bacilliformis.- El 

análisis se hizo comparando las secuencias de ParC y ParE de B. 

bacilliformis con las de E. coli K12 debido a que en esta bacteria 

se conocen mejor las QRDR y las sustituciones de aminoácidos 

en las posiciones que alteran la susceptibilidad a las quinolonas. 

De esta manera hemos deducido las posiciones equivalentes en 

B. bacilliformis. 

Secuencias aminoacídicas de ParC.- En el análisis de las secuencias 

aminoacídicas de ParC de los aislados de B. bacilliformis, 

se encontró que existen diferencias a nivel de los aminoácidos 

80 y 94 (Ser por Ala) dentro de la QRDR, comparando con la 

QRDR de ParC de E. coli K12. Además se encontraron otros 

cambios muy cercanos al sitio activo en los aminoácidos 123 

y 129 también de Ser por Ala. El aislado USM-LMMB-003 

presentó diferencias aminoacídicas (Tyr por Asp) fuera de la 

QRDR (color celeste, Fig. 6) en los aminoácidos 124, 149, 

164, 167 y 175 (numeración correspondiente a B. bacilliformis) 

incluso en el sitio activo. 

Secuencias aminoacídicas de ParE.- En el análisis de las secuencias 

aminoacídicas de ParE, no se encontró ninguna diferencia 

dentro de la QRDR entre los aislados, pero sí se encontraron 

diferencias en relación a E. coli K12, en el aminoácido 441 (Lys 

por Arg), que es el más reportado para cepas con resistencia a 

fluoroquinolonas en E. coli. También en el aminoácido 451 se 

puede observar un cambio de Ser por Ala como se muestra en la 

Fig. 7B. Analizando las secuencias nucleotídicas del gen parE de 

los aislados de B. bacilliformis, se encontraron en USM-LMMB- 

005dos mutaciones puntuales a nivel nucleotídico, las cuales no 

produjeron cambios en los aminoácidos 328 y 458 (Fig. 7A). 

Modelamiento por homología del dominio QRDR de 

ParC y ParE de B. bacilliformis relacionadas a la resistencia 

antimicrobiana.- En la estructura terciaria del QRDR de 

ParC y ParE de B. bacilliformis se pudo apreciar cambios en la 

estructura terciaria en las posiciones donde existe una diferencia 

aminoacídica de Ser por Ala, cuando se le compara con E. 

coli K12. Estos cambios sugieren una débil interacción con la 

quinolona, los cambio son resaltados en círculo rojo como se 

observan en la Figuras 8 y 9 

Discusión 

La Enfermedad de Carrión aún continúa siendo un problema 

de salud pública en Perú, a pesar de su importancia actualmente 

existen pocos estudios sobre la resistencia antimicrobiana de este 

patógeno. El presente estudio es a nuestro entender el primer 

trabajo sobre caracterización molecular de genes asociados a la 

resistencia antimicrobiana de aislados de B. bacilliformis de zonas 

endémicas del Perú. Este trabajo es de gran importancia, porque 

a pesar que las especies de Bartonella son altamente susceptibles a 

pruebas de antibióticos (Dörbecker et al. 2006), existen reportes 


93


Figura 6.- Alineamiento múltiple de las secuencias aminoacídicas de ParC de la cepa de Bartonella bacilliformis KC 583 y de 

las aisladas, comparadas con ParC de E. coli K12, utilizando el programa ClustalW 2.1. Las sustituciones aminoacídicas (Ser 

por Ala) están resaltadas en color negro. La numeración en la parte inferior corresponde a las posiciones de los aminoácidos 

de la proteína ParC de E. coli (NP_417491.1) y en la parte superior su equivalente en B. bacilliformis (YP_989154.1). 

Figura 7.- Alineamiento múltiple de secuencias nucleotídicas de los aislados de Bartonella bacilliformis y de la cepa KC583. En 

A, el alineamiento muestra las mutaciones puntuales del aislado USM-LMMB-005 que no produjeron cambios en el aminoácido 

respectivo y en B, el alineamiento muestra las secuencias aminoacídicas de ParE de la cepa de Bartonella bacilliformis 

KC583 y las aisladas, comparadas con ParE de E. coli K12, utilizando el programa ClustalW 2.1. Se indica sus respectivos 

aminoácidos cambiantes (Lys por Arg) resaltado en color negro. La numeración en la parte inferior corresponde a las posiciones 

de los aminoácidos de la proteína ParE de E. coli (NP_417502.1) y en la parte superior su equivalente para B. bacilliformis 

(YP_989184.1). 

94 



Figura 8.-. Estructura tridimensional de la QRDR de ParC de Bartonella bacilliformis por homología con ParC de Escherichia 

coli K12 (Protein Data Base (PDB): 1ZVU). En A, se muestra la QRDR de B. bacilliformis y en B, la QRDR de E. coli K12 

MG1655. Las flechas de color negro indican la posición donde existen diferencias aminoacídicas entre B. bacilliformis y E. coli 

K12, observando un cambio en la estructura para B. bacilliformis, que se resalta en un círculo rojo. Las flechas rojas indican 

las posiciones correspondientes al sitio activo. 

Figura 9.- Estructura tridimensional de la QRDR de ParE de Bartonella bacilliformis por homología con ParE de Acinetobacter 

baumannii (PDB: 2XKK). En A, se muestra la región de la QRDR de B. bacilliformis y en B, la QRDR de E. coli K12 

MG1655. Las flechas de color negro indican la posición donde existen diferencias aminoacídicas entre B. bacilliformis y E. 

coli K12, observando un cambio en la estructura para B. bacilliformis, que se resalta en un círculo rojo. La flecha azul indica 

la localización del aminoácido Asp, que es importante porque se han reportado cepas resistentes a quinolonas cuando hay 

mutación en esta posición. 

Tabla 3.- Valores obtenidos de la susceptibilidad antimicrobiana de las cepas de 

Bartonella bacilliformis ensayadas para ciprofloxacina y ácido nalidíxico. 

E- KirbyBauer (mm) 

CEPAS Cip Cip AN 

CIP 57.17 0.125 46 6 

CIP 57.18 0.015 55 6 

USM-LMMB-001 0.125 50 6 

USM-LMMB-002 2 19 6 

USM-LMMB-003 0.125 50 6 

USM-LMMB-005 0.023 52 6 

USM-LMMB-006 0.023 50 6 

USM-LMMB-007 0.19 78 6 


95


de fallas en la monoterapia para las enfermedades relacionadas 

a Bartonella usando beta-lactámicos, macrólidos, tetraciclina, 

rifampicina o fluoroquinolonas (Biswas et al. 2007). Los aislados 

de B. bacilliformis presentaron una CIM para Cip que oscilaba 

entre 0.19 y 0.023 mg/L (Tabla 3), la que concuerda con los 

valores de CIM descritos en la literatura (Sobraquès et al. 1999, 

Döbecker et al. 2006, Angelakis et al. 2008). En cuanto a la 

susceptibilidad mediante Kirby-Bauer, los aislados analizados 

mostraron resistencia al Nal (primera quinolona) y sensibilidad 

a la Cip (Fig. 3). 

El análisis in silico de las secuencias aminoacídicas de ParC 

y ParE de B. bacilliformis se hizo comparando las secuencias de 

éstas en E. coli K12 debido a que en esta bacteria se conocen 

mejor las QRDR y las sustituciones de aminoácidos que alteran 

la susceptibilidad a las quinolonas. Mediante esta comparación 

hemos deducido las posiciones equivalentes de los aminoácidos 

entre E. coli y B. bacilliformis tal como lo realizaron Del Valle 

et al. (2010). 

De acuerdo con nuestros resultados, la QRDR de la proteína 

ParC (subunidad A de la topoisomerasa IV) de Bartonella 

bacilliformis comprendería desde el aminoácido 67 al 118 

(Fig. 7). El análisis de la QRDR de ParC revela que todos los 

aislados de B. bacilliformis presentan sustituciones de Ser por 

Ala en los aminoácidos 85 y 99 (numeración equivalente a 80 

y 94 en E. coli) en comparación a ParC de E. coli K12 (Fig. 6). 

Las mutaciones en los aminoácidos 78, 80 y 84 de la QRDR 

de ParC de E. coli K12, son las más descritas y relacionadas a la 

resistencia a quinolonas (Hopkins et al. 2005, Serra 2008). En 

las posiciones 119 (Arg) y 120 (Tyr) que corresponden al sitio 

activo de esta enzima, no se encontraron sustituciones aminoacídicas. 

Además, las posiciones 123 y 129 cercanas al sitio activo, 

también presentan cambios de Ser por Ala. Estas sustituciones 

dentro de la QRDR también han sido encontradas en Bartonella 

spp. y otras bacterias intracelulares como Tropheryma whipplei 

en la que se ha reportado heterogeneidad de la susceptibilidad 

frente a las fluoroquinolonas (Masselot et al. 2003, Angelakis 

et al. 2008, Angelakis et al. 2009). Varios estudios mencionan 

que las mutaciones de Ser por Ala en dichas posiciones están 

asociadas a la resistencia natural a las fluoroquinolonas (Cambau 

et al. 1994, Rodríguez et al. 2001, Del Valle et al. 2010). Estos 

estudios explicarían la resistencia al Nal en todos los aislados de 

B. bacilliformis obtenidos en el presente trabajo. Es importante 

señalar que a pesar de encontrar las mutaciones para la resistencia 

a la quinolona Nal, posiblemente otras mutaciones en el gen 

parC de estas bacterias o en otros genes deberían ser necesarias 

para que ocurra la resistencia a las fluoroquinolonas (como por 

ejemplo a la Cip). Actualmente, la Cip parece ser efectiva en el 

tratamiento recomendado por el MINSA, sin embargo existe 

adquisición de resistencia por mutaciones acumuladas en estos 

genes. Por tanto, como fue recomendado en otros estudios (Angelakis 

et al. 2008, Del Valle et al. 2010) se debe de evitar el uso 

de Cip como monoterapia en el tratamiento de esta enfermedad. 

Los resultados de este estudio sugieren que la QRDR de ParE 

(subunidad B de la DNA topoisomerasa IV) de B. bacilliformis 

está comprendida entre los aminoácidos 473 y 530, como se 

muestra en la Fig. 7. La mayoría de mutaciones descritas en la 

QRDR de ParE de E. coli K12, que es homóloga es GyrB (Ruiz 

et al. 1987), están entre los aminoácidos 412 y 469. El análisis 

de las secuencias aminoacídicas de ParE de B. bacilliformis no 

96 

reveló cambios entre las secuencias, sin embargo, dentro de la 

QRDR se presentaron dos sustituciones aminoacídicas en las 

posiciones 441 (Lys por Arg) y 451 (Ser por Ala) en comparación 

con E. coli K12. La posición 420, resaltada en amarillo (Fig. 7), 

se encontró sin cambios. Los cambios tanto en la posición 420 

como 441 y sus equivalentes en B. bacilliformis (481 y 502, 

respectivamente), son las más citadas en cepas resistentes a quinolonas 

en E .coli (Hopkins et al. 2005, Sorlozano et al. 2007, 

Jiménez et al. 2009). También se han reportado cambios en los 

aminoácidos 416 (Leu por Phe), 445 (Leu por His) y 458 (Ser 

por Ala). Estas mutaciones ya descritas (Hopkins et al. 2005, 

Sorlozano et al. 2007, Jiménez et al. 2009) no fueron encontradas 

en las secuencias de B. bacilliformis del presente estudio. Las 

mutaciones en otras posiciones podrían ser importantes para la 

resistencia o disminución de la susceptibilidad, como lo es el 

cambio en el aminoácido 451, que en E coli K12 es una Ser y su 

equivalente en B. bacilliformis es Ala. Las sustituciones del mismo 

tipo (Ser por Ala) reportadas en el aminoácido 458, confieren 

resistencia en cepas de E. coli productoras de β lactamasas de 

espectro extendido (Sorlozano et al. 2007). De los aislados de B. 

bacilliformis, USM-LMMB-005 presentó mutaciones puntuales 

en el nucleótido de la tercera posición, las que no produjeron 

cambios en el aminoácido respectivo (328 y 458). El aminoácido 

458 se encuentra cercano a la QRDR de ParE, por lo que 

es probable que los cambios nucleotídicos adicionales a éstos 

puedan contribuir a generar resistencia. Justamente este aislado, 

USM-LMMB-005 procedente de la localidad de Sondorillo es 

donde se reportaron fallas al tratamiento con Cip. Es posible 

que en las cepas de B. bacilliformis circulantes en esta localidad 

se acumulen mutaciones en las secuencias de estos genes asociados 

a la resistencia a Cip, lo que podría estar contribuyendo 

a la resistencia para este grupo de antibióticos; es por ello que 

en esta localidad se trata a los pacientes con la Enfermedad de 

Carrión, con ceftriaxona en vez de Cip. 

Mediante herramientas bioinformáticas se realizó el modelamiento 

de la probable estructura tridimensional de la QRDR 

de las proteínas ParC y ParE de B. bacilliformis (Fig. 8 y 9). 

Para esto, se realizó una comparación con la estructura de la 

topoisomerasa IV de Escherichia coli y A. baumannii, mostrando 

las sustituciones que existen en relación con E. coli K12, sin 

embargo, al evaluar la estructuras terciarias de las QRDR se 

apreciaron cambios estructurales colocando un círculo punteado 

de color rojo en éstos, sugiriendo una débil interacción de la 

quinolona y su blanco, los cambios observados de Ser por Al, 

podrían estar alterando los patrones de hidrofobicidad que se 

relacionan con la estructura de la proteína. 

En conclusión, se obtuvieron seis aislados de B. bacilliformis, 

todos fueron resistentes al Nal, sensibles a Cip y uno de ellos, 

USM-LMMB-002 procedente de Quillabamba – Cusco, presentó 

susceptibilidad disminuida a la Cip. Se determinó que las 

QRDR de las proteínas ParC y ParE de B. bacilliformis están 

comprendidas entre los aminoácidos 67 al 118 y 473 al 530, 

respectivamente. Se sugiere que el cambio con relación a E. coli 

K12 de Ser por Ala en ParC de B. bacilliformis determinaría la 

resistencia al Nal pero no a la Cip. Con respecto al antibiograma 

y a la CMI (con tiras de la prueba Épsilon) para B. bacilliformis, 

concluimos que los halos de inhibición del crecimiento bacteriano 

se visualizan mejor cuando las placas Petri se siembran por 

“inundación” bañándolas con inóculos de 1.5 mL a la escala 1 

de McFarland, e incubándolas durante 6 días. 




Al Consejo Nacional de Ciencia y Tecnología (CONCYTEC) 

por el financiamiento al proyecto N° 323-2010-CONCYTEC- 

OAJ y al VRI-UNMSM Proyecto N° 111001032. A los técnicos 

de laboratorio Nexar Alvarado, Jesús Paico y Rosa Pintado del 

Centro de Salud de Huancabamba - Piura. Al Dr. Jorge Cortez 

y a Teófanes Paredes del Centro de Salud de Calipuy – Stgo. 

de Chuco, La Libertad; al Dr. Manuel Montoya del Cusco; al 

Biólogo Paul Pacheco Román del Centro de Salud de Urubamba- 

Cusco; a la Técnica de laboratorio Flor Céspedes del Centro de 

Salud de Uchumayo - Quillabamba, Cusco; y a los biólogos 

José Luis Ramos Coveñas y Martín Nizama Teixeira; todos ellos 

por brindarnos su apoyo en la toma de muestras. A los Dres. 

Joaquim Ruiz del Hospital Clinic de Barcelona y Luis Del Valle 

de la Universitat Politècnica de Catalunya, por su apoyo en la 

revisión del manuscrito de la tesis de Ruth Quispe, algunos de 

cuyos resultados están incluidos en el presente artículo. Esta 

publicación es parte de la tesis para optar al grado de Magíster 

en Biología Molecular de Abraham Espinoza Culupú, bajo la 

asesoría de Ruth García de la Guarda. 


Angelakis E., S. Biswas, C. Taylor, et al. 2008. Heterogeneity of susceptibility 

to fluoroquinolones in Bartonella isolates from 

Australia reveals a natural mutation in gyrA. J Antimicrob 

Chemother. 61(6):1252-1225. doi: 10.1093/jac/dkn094 

Angelakis E., D. Raoult&J.M. Rolain. 2009. Molecular characterization 

of resistance to fluoroquinolones in Bartonella 

henselae and Bartonella quintana. J Antimicrob Chemother. 

63(6):1288-1289. doi: 10.1093/jac/dkp133. 

Biswas S., D. Raoult, & J.M. Rolain. 2007. Molecular mechanisms 

of resistance to antibiotics in Bartonella bacilliformis. J 

Antimicrob Chemother. 59(6):1065-1070. doi: 10.1093/ 

jac/dkm105 

Biswas S. & J.M. Rolain. 2010. Bartonella infection: treatment 

and drug resistance. Future Microbiol. 5(11):1719-1731. 

doi:10.2217/fmb.10.133. 

Cambau E., W. Sougakoff, M. Besson, et al. 1994. Selection of a 

gyrA mutant of Mycobacterium tuberculosis resistant to 

fluoroquinolones during treatment with ofloxacin. J Infect 

Dis. 170(5):1351. 

CLSI (Clinical and Laboratory Standards Institute). 2011. Performance 

Standards for Antimicrobial Susceptibility Testing; Twenty- 

First Informational Supplement.M100-S21 Vol. 31 N°. 1. 

Wayne, Pensylvania, USA. 

Coleman S.A. & M.F. Minnick. 2003. Differential expression of 

the invasion-associated locus B (ialB) gene of Bartonella 

bacilliformis in response to environmental cues. Microb 

Pathog. 34(4):179-186. http://dx.doi.org/10.1016/S0882- 

4010(03)00005-6 

Colichon H. & C.F. De Bedon. 1973. Carrion's disease: useful 

nutrients for the growth of Bartonella bacilliformis. Rev 

Latinoam Microbiol. 15(2):75-79. 

Del Valle L.J., L. Flores, M. Vargas, R. Garcia-de-la-Guarda, et al. 

2010. Bartonella bacilliformis, endemic pathogen of the 

Andean region, is intrinsically resistant to quinolones. Int J 

Infect Dis. 14(6):506-510. doi:10.1016/j.ijid.2009.07.025 

DGE (Dirección General de Epideniología). 2013. Sala situacional para 

el Análisis de Situación de Salud. Enfermedad de Carrión 

 

Dörbecker C., A. Sander, K. Oberle, et al. 2006. In vitro susceptibility 

of Bartonella species to 17 antimicrobial compounds: 

comparison of E-test and agar dilution. J Antimicrob Chemother.58(4):784-788. 

doi: 10.1093/jac/dkl341 

Flores L. 2008.Estudios moleculares en Bartonella bacilliformis para 

el control de la Enfermedad de Carrión. Tesis para optar el 

grado académico de Magíster en Biología Molecular. Facultad 

de Ciencias Biológicas, Universidad Nacional Mayor de 

San Marcos. 156 pp. 

Hall T.A.1999. BioEdit: a user-friendly biological sequence alignment 

editor and analysis. . [accedido 18/02/13]. 

Henriquez C., C. Hinojosa & P. Ventosilla. 2004. Report of an unusual 

case of persistent bacteremia by Bartonella bacilliformis in 

a splenectomized patient. The American Society of Tropical 

Medicine and Hygiene 71(1): 53-55. 

Hiroshi Y. & R. Katsumata. 2006. Antibiotic resistance in bacteria 

and its future for novel antibiotic development. Journal of 

Bioscience Biotechnology and Biochemistry. 70(5): 1060- 

1075. http://dx.doi.org/10.1271/bbb.70.1060 

Hopkins K.L., R.H. Davies & E.J. Threlfall. 2005. Mechanisms of 

quinolone resistance in Escherichia coli and Salmonella: 

recent developments. Int J Antimicrob Agents. 25(5):358- 

373. doi:10.1016/j.ijantimicag.2005.02.006 

Jiménez A., A. Jimenez, M. Arrabal, et al. 2009. Resistencias a quinolonas 

en aislados clínicos de Escherichia coliproductores 

de betalactamasas de espectroextendido. Higiene y Sanidad 

Ambiental. 9: 449-466. 

Law DK, M Shuel, S Bekal, et al. 2010. Genetic detection of quinolone 

resistance in Haemophilus parainfluenzae: Mutations in 

the quinolone resistance-determining regions of gyrA and 

parC. Canadian Journal of Infectious Diseases & Medical 

Microbiology. 21:e20–2. 

Maguiña C., P.J. Garcia, E. Gotuzzo, et al. 2001. Bartonellosis 

(Carrion’s disease) in the modern era. Clinical Infectious 

Diseases 33(6): 772-779. doi: 10.1086/322614 

Maguiña C., C. Ugarte-Gil, P. Breña, et al. 2008. Actualización de la 

Enfermedad de Carrión. Update of Carrion’s disease. Rev 

Med Hered.19 (1): 036-041. 

Masselot F., A. Boulos, M. Maurin, et al. 2003. Molecular evaluation 

of antibiotic susceptibility: Tropheryma whipplei paradigm. 

Antimicrobial Agents and Chemotherapy 47(5):1658-1664. 

doi: 10.1128/AAC.47.5.1658-1664.2003 

Minnick M.F., Z.R. Wilson, L.S. Smitherman, et al. 2003. gyrA 

mutations in ciprofloxacin-resistant Bartonella bacilliformis 

strains obtained in vitro. Antimicrobial Agents and Chemotherapy 

47(1): 383-386. doi: 10.1128/AAC.47.1.383- 

386.2003 

MINSA. 2006. Norma Técnica Nº 048-MINSA/DGSP-V.01. 

“Atención de la Bartonelosis o Enfermedad de Carrión en 

el Perú”.74 pp. 

Mitchell S.J &M.F Minnick. 1995. Characterization of a two-gene 

locus from Bartonella bacilliformis associated with the ability 

to invade human erythrocytes. Infection and Immunity 

63(4):1552-62. 

Pachas P. 2000. Epidemiología de la Bartonelosis en el Perú.Módulos 

Técnicos - Serie documentos monográficos.Lima, PE: 

Oficina General de Epidemiología/InstitutoNacional de 

Salud.83 pp. 

Pendle S., A. Ginn & J. Iredell. 2006. Antimicrobial susceptibility of 

Bartonella henselae using Etest methodology. Antimicrobial 

Agents and Chemotherapy 57(4):761-3. doi:10.1093/jac/ 

dki485 

Perez-Martinez L., J.R. Blanco & J.A. Oteo. 2010. Treatment of human 

infections caused by Bartonella spp. Revista española 

de quimioterapia 23(3):109-114. 

Perilla M., G. Ajello, Ch. Bopp, et al. 2003. Manual for the Laboratory 

Identification and Antimicrobial Susceptibility Testing 

of Bacterial Pathogens of Public Health Importance in the 

Developing World. CDC and WHO.186 pp. 

Quispe R. 2009. Caracterización molecular de los genes asociados a 

la resistencia antimicrobiana en Bartonella bacilliformis. 

Tesis de Pre-Grado. Facultad de Ciencias Biológicas. E.A.P. 

Microbiología y Parasitología -Universidad Nacional Mayor 

de San Marcos. 65 pp. 

Restrepo M., M. Robledo& E. Bedoya. 2002. “Enfermedades Infecciosas”, 

5 Ed , Editorial Corporaciones para las Investigaciones 

Biológicas. Medellín-Colombia. 506 pp. 

Rodríguez J.C., M. Ruíz, A. Climent, et al. 2001. In vitro activity of 

four fluoroquinolones against Mycobacterium tuberculosis. 

International Journal of Antimicrobial Agents 17(3):229- 

231. doi.org/10.1016/S0924-8579(00)00337-X 


97


Rolain J.M., P. Brouqui, J.E. Koehler, et al. 2004. Recommendations 

for treatment of human infections caused by Bartonella species. 

Antimicrobial Agents and Chemotherapy 48(6):1921- 

1933. doi: 10.1128/AAC.48.6.1921-1933.2004 

Ruiz J., S. Casellas, M.T. Jimenez de Anta, et al. 1997. The region 

of the parE gene, homologous to the quinolone-resistant 

determining region of the gyrB gene, is not linked with 

the acquisition of quinolone resistance in Escherichia coli 

clinical isolates. Antimicrobial Agents and Chemotherapy 

39(6):839-840. 

Serra A. 2008. Quinolonas. Facultad de Medicina UBA. Separata 

2008- Vol 16 N° 3. 

Sobraques M., M. Maurin, R.J. Birtles, et al. 1999. In vitro susceptibilities 

of four Bartonella bacilliformis strains to 30 antibiotic 

compounds. Antimicrobial Agents and Chemotherapy 

43(8):2090-2092. 

Sorlozano A., J. Gutierrez, A. Jimenez, et al. 2007. Contribution of a 

new mutation in parEto quinolone resistance in extendedspectrum-beta-lactamase-producing 

Escherichia coli isolates. 

Journal of Clinical Microbiology 45(8):2740-2742. doi: 

10.1128/JCM.01093-07 

Tarazona A., C. Maguiña, D. López de Guimaraes, et al. 2006. Terapia 

antibiótica para el Manejo de la Bartonelosis o Enfermedad 

de Carrión en el Perú. Rev Perú MedExp Salud Pública 

23(3): 188-200. 

Tamura K., D. Peterson, N. Peterson, et al. 2011.MEGA5: molecular 

evolutionary genetics analysis using maximum likelihood, 

evolutionary distance, and maximum parsimony methods. 

Molecular Biology and Evolution 28(10):2731-2739. doi: 

10.1093/molbev/msr121. 

Thompson J., D.G. Higgins & T.J. Gibson. 1994. CLUSTAL W: 

improving the sensitivity of progressive multiple sequence 

alignment through sequence weighting, position-specific gap 

penalties and weight matrix choice. Nucleic Acids Research 

22(22):4673-80. doi:10.1093/nar/22.22.4673. 

98 



Patrones de coocurrencia y conducta alimentaria de Phlebotominae 

ISSN-L 

enVenezuela 

1561-0837 




Patrones de coocurrencia y conducta alimentaria a escala local de Phlebotominae 

(Diptera: Psychodidae) del estado Falcón, Venezuela 

Co-ocurrence patterns and feeding behaviour at local scale of Phlebotominae(Diptera: Psychodidae) 

from Falcon state, Venezuela 

Dalmiro J. Cazorla 1 *, Elsa Nieves 2 y Pedro Morales 1 

*Autor para correspondencia: 

1 Laboratorio de Entomología, Parasitología y 

Medicina Tropical, Centro de Investigaciones 

Biomédicas, Universidad Nacional Experimental 

“Francisco de Miranda” (UNEFM), Apdo. 7403, 

Coro 4101, Estado Falcón, Venezuela. 

2 Laboratorio de Parasitología Experimental, 

Facultad de Ciencias, Departamento de Biología, 

Universidad de Los Andes, Mérida, Estado Mérida, 

Venezuela 

Email Dalmiro J. Cazorla: lutzomyia@hotmail.com 

Email Elsa Nieves: nievesbelsa@gmail.com 

Email Pedro Morales: 

pemoralesmoreno@hotmail.com 

Citación: 

Cazorla D.J., E. Nieves & P. Morales. 2014. Patrones 

de coocurrencia y conducta alimentaria a 

escala local de Phlebotominae (Diptera: Psychodidae) 

del estado Falcón, Venezuela. Rev. peru. 

biol. 21(1): 099-104 (Mayo 2014). doi: http://doi. 

org/10.15381/rpb.v21i1.8253 

Resumen 

Los flebotominos son transmisores de los protozoarios parásitos del genero Leishmania, 

agentes causales de las leishmaniasis en humanos y otros mamíferos. Mediante modelos 

nulos, se estudio la estructura de las comunidades flebotominas en focos endémicos de 

leishmaniasis del estado Falcón, en el nor-occidente de Venezuela, a una escala reducida o 

local: en el domicilio, peridomicilio y el área silvestre de una zona de vida o en una localidad 

en particular. La aplicación de los modelos nulos reveló que a escala local las comunidades 

flebotominas se encuentran agregadas, sugiriendo que las especies coexisten y no compiten. 

Los estudios de co-ocurrencia con el análisis de estructura gremial y la prueba de la hipótesis 

de los estados favorecido mostró que los resultados obtenidos no son estadísticamente 

significativos (p> 0.05), lo que sugiere que las especies flebotominas pertenecen a un mismo 

gremio en sus preferencias alimentarias, lo que podría deberse a que la hematofagia se 

trata de un evento heterogéneo, circunstancial y oportunista. Se discuten aspectos sobre los 

posibles factores, como por ejemplo la transformación y homogenización de los hábitats por 

el impacto sinantrópico, que pudieran estar determinando el ensamble de los flebotominos 

en la región falconiana. 

Palabras clave: Flebotominos; modelos nulos; Leishmaniasis; Venezuela. 

Abstract 

The phlebotomine sandfly are vectors of protozoan parasites Leishmania genus, the causative 

agents of leishmaniasis in humans and several mammalian hosts. The structure of the 

phlebotomine sandfly community at the local scale: domicile, peridomicile and sylvatic habitats 

from a reduced area, was assessed using null models analysis in endemic foci of leishmaniasis 

from Falcon state, in north-western region of Venezuela. Implementation of null model 

tests revealed that to a local scale the phlebotomine sandfly communities are aggregated, 

suggesting that the species co-occurred and did not compete. The assays of co-ocurrence 

patterns with guild structure analysis and favored states hypothesis showed statistically nonsignificant 

results (p> 0.05), suggesting that sandfly species belong to a same guild in relation 

to their feeding preferences, as hematophagy appears to be an heterogeneous, circumstantial 

and opportunist event. We discussed aspects of the possible factors, for example sinantropic 

effects on environmental transformation and its homogenization, that could be determining 

the phlebotomine sanfly assemblage in the Falcon state region. 

Keywords: Sandflies; Null models; Leishmaniasis; Venezuela. 


Aceptado: 13/03/2014 








99

Cazorla et al. 

Introducción 

Las leishmaniasis son entidades nosológicas producidas por 

varias especies de protozoarios flagelados del género Leishmania 

sp., y que se transmiten a varios hospedadores vertebrados 

(Mammalia) y al humano por la picadura de insectos dípteros 

(Psychodidae) de la subfamilia Phlebotominae (Young & Duncan 

1994, Herrera 2010). Estas dolencias se encuentran presentes 

prácticamente en toda la geografía venezolana, realidad a la que 

no escapa el estado Falcón (región nor-occidental), al cual se le 

considera un foco activo tanto de leishmaniasis tegumentaria 

(LT) como de su forma visceral (LV). En el estado Falcón se han 

detectado tasas de incidencia de LT de 2.09 por cada 100000 

habitantes (De Lima et al. 2010), y varios casos activos de kalaazar, 

especialmente en infantes, patología que si no es tratada a 

tiempo es potencialmente mortal (Añez et al. 2012). 

En los focos endémicos de LT y LV del estado Falcón se ha 

registrado una co-ocurrencia de hasta 24 especies del género 

Lutzomyia França 1924, algunas de las cuales poseen conductas 

alimentarias consideradas como antropofilícas y otras como 

zoofílicas (Young & Duncan 1994, Añez et al. 2012, Cazorla 

& Morales 2012). Se considera que el balance entre estas dos 

conductas alimentarias debe jugar un papel importante en la 

dinámica de transmisión de las leishmaniasis, al ser las especies 

flebotominas zoofílicas las que introducen a Leishmania en los 

ambientes sinantrópicos, y luego las especies antropofílicas 

esparcen la infección a los humanos (Chaves & Añez 2004). 

Uno de los tópicos que ecología de comunidades presta a más 

atención es la identificación de los mecanismos generales que 

gobiernan la estructura de las comunidades biológicas (“reglas 

de ensamble”), y aunque se han propuesto varias reglas se le ha 

dado mayor relevancia a las interacciones interespecíficas (competencia, 

mutualismo) (Vilchis 2000, Chase 2003, Feeley 2003). 

Sin embargo, es necesario indicar que la coexistencia entre las 

especies puede estar gobernada por fuerzas competitivas y no 

competitivas (Gordon 2000). 

Los modelos nulos son métodos estadísticos y simulaciones 

computarizadas que se usan para indagar o analizar si existe el 

azar en los procesos de la naturaleza que generan algún patrón 

ecológico, de aquí que se han implementado para estudiar los 

patrones de coocurrencia (Gotelli 2000, Gotelli & Entsminger 

2003). Los modelos nulos trabajan con datos ecológicos aleatorizados 

procedentes de un modelo conocido o imaginario, de 

manera tal que se puede determinar si los patrones observados 

en las comunidades biológicas son gobernados por eventos 

o sucesos ecológicos o evolutivos, o simplemente por el azar 

(Gotelli 2000, Gotelli & Entsminger 2003). 

El análisis de las fuentes bibliográficas relacionadas con los 

estudios ecológicos sobre la dinámica de transmisión de las 

leishmaniasis en Venezuela, revela que tan sólo se ha realizado 

un trabajo que involucra la estructura del ensamble de las comunidades 

flebotominas, el cual fue realizado en la región andina 

a diferentes pisos altitudinales y zonas bioclimáticas (i.e., a gran 

escala o regional) (Chaves & Añez 2004). Por lo tanto, existe un 

desconocimiento de los patrones de coocurrencia de las comunidades 

flebotominas a escala local en el territorio de Venezuela, y 

particularmente en el estado Falcón. En este sentido, a sabiendas 

de que el bosque primario tropical es un factor relevante para 

la presencia de Lutzomyia (González-Salazar et al. 2013), es 

importante conocer el efecto que pudiera tener la alteración de 

estas áreas silvestres (e.g, construcción de asentamientos humanos) 

sobre la estructura de las comunidades flebotominas, tal 

como se ha documentado en focos endémicos de leishmaniasis 

del Paleotrópico (Italia) y Neotrópico (Panamá) (Chaves 2011). 

Este tipo de información puede aportar conocimiento útil para 

diseñar eficientemente un plan para el control vectorial de estas 

parasitosis (Chaves 2011). 

A la luz de lo expuesto, en el presente trabajo mediante 

modelos nulos se determinó la estructura de las comunidades 

de especies flebotominas en focos endémicos de LT y/o LV 

del estado Falcón, Venezuela, a una escala reducida, i.e. en el 

domicilio, peridomicilio y el área silvestre de una zona de vida 

o en una localidad en particular (escala local). 


Área de estudio y datos.- Para estimar la estructura de comunidades 

flebotominas a escala local se tomaron los datos de 

un trabajo previo (Cazorla & Morales 2012), el cual se realizó 

en 41 localidades ubicadas a diferentes pisos altitudinales y zonas 

bioclimáticas del estado Falcón (10°18’08” y 12°11’46”N y los 

68°14’28” y 71°18’21”W), en la región noroccidental de Venezuela. 

Para ello, se escogieron las especies flebotominas capturadas 

en ambientes del domicilio, peridomicilio y silvestre de diez 

localidades incluyendo Guamacho 11°21’15”N y 69°04’32”W), 

Tocópero (11°30’19,40”N y 69°13’29,17”W), La Cienaguita 

(11°26’51,31”N y 69°15’29,19”W), El Guayabo (11°29’23”N 

y 69°15’33”W), Píritu (11°21’58,13”N y 69°8’10,26”W), 

El Caballo (11°29’9,79”N y 69°10’50,90”W), Guaibacoa 

(11°24’39”N y 69°28’17”W), Río Chiquito (10°22’48,27”N y 

70°38’58,64”W), La Ciénaga (11°25’47,93”N y 69°27’34,20”W) 

y Chipare (11°25’47,95”N y 69°27’34,21”W), ubicadas entre 

66 - 330 m de un área bioclimática en particular: bosque muy 

seco tropical (BMST); así mismo, se indagó los patrones de coocurrencia 

de las comunidades flebotominas en una localidad en 

particular: “San Francisco” (11°26’42,46”N y 69°16’26,31”W), 

ubicada a 198 m, similarmente en el BMST de la región falconiana 

(Ewel et al. 1976). 

En las Tablas 1 y 2 se da el listado de las especie flebotominas 

estudiadas, así como datos acerca de su distribución por sitio de 

captura (domicilio, peridomicilio, área silvestre), preferencias 

alimentarias y métodos de captura (Young & Duncan 1994, 

Cazorla & Morales 2012). Tomándose como base la información 

de las Tablas 1 y 2, para cada especie flebotomina se organizaron 

los datos empleando matrices presencia (1)-ausencia (0), las 

cuales son las unidades básicas fundamentales en los estudios 

biogeográficos y de ecología de comunidades (Gotelli 2000). 

Modelos nulos.- Como índice de coocurrencia para determinar 

y cuantificar la estructura de las comunidades flebotominas, 

se utilizó el C-score o índice tablero de damas (checkerboard) de 

la matriz (Stone & Roberts 1990, Gotelli 2000). 

Se hicieron simulaciones computacionales tomándose los datos 

para todos los sitios de captura (domicilio, peridomicilio, área 

silvestre), con la totalidad de los métodos de captura (Cazorla & 

Morales 2012). Para detectar si hubo sesgo debido a los métodos 

de captura empleados, similarmente se hicieron cálculos computacionales 

pero con datos particulares de los sitios de captura, 

para cada una de las técnicas de captura (Chaves & Añez 2004). 

Adicionalmente, se indagaron los patrones de coocurrencia en 

100 


Patrones de coocurrencia y conducta alimentaria de Phlebotominae enVenezuela 

Tabla 1. Registro de preferencias alimentarias de especies flebotominas y su distribución por sitio de captura en 10 localidades 

endémicas de leishmaniasis del Bosque Muy Seco Tropical (BMST) del estado Falcón, Venezuela. 

Especie de Lutzomyia Preferencia Alimentaria* Sitio de captura** Técnica de captura+ 

L. evansi A S, P, D TL; CH; AD 

L. gomezi A P TL; CH; AD 

L. longipalpis s.l. A S, P, D TL; PA 

L. lichyi A S AD 

L. atroclavata Z S AD; PA 

L. c. cayennensis Z S, P TL; AD; PA 

L. trinidadensis Z S, P TL; AD; PA 

L. venezuelensis Z S AD; PA 

*Preferencias alimentarias: antropofílico (A); zoofílico (Z) datos basados en Young & Duncan (1994) y Cazorla & Morales (2012). +Técnica de captura: papel 

aceitado (PA); Aspiración Directa (AD); Trampa Lumínica (TL); Cebo Humano (CH). ** Sitios de captura: área selvática (S), peridomicilio (P) y domicilio 

(D); datos basados en Cazorla & Morales (2012). 

Tabla 2. Registro de preferencias alimentarias de especies flebotominas y su distribución por sitio de captura en “San Francisco”, 

estado Falcón, Venezuela. 

Especie de Lutzomyia Preferencia Alimentaria* Sitio de captura** Técnica de captura+ 

L. evansi A S, P, D TL; CH; AD 

L. gomezi A P TL; CH; AD 

L. longipalpis s.l. A D,P TL; PA 

L. atroclavata Z S AD; PA 

L. c. cayennensis Z P,S TL; AD; PA 

L. trinidadensis Z P,S TL; AD; PA 

*Preferencias alimentarias: antropofílico (A); zoofílico (Z); datos basados en Young y Duncan (1994) y Cazorla y Morales (2012). +Técnica de captura: papel 

aceitado (PA); Aspiración Directa (AD); Trampa Lumínica (TL); Cebo Humano (CH). ** Sitios de captura: área selvática (S), peridomicilio (P) y domicilio 

(D); datos basados en Cazorla y Morales (2012). 

las comunidades flebotominas para todos los sitios de captura 

con la totalidad de las técnicas, y para los sitios de captura y las 

técnicas de muestreo por separado, pero determinándose si existe 

sesgo con las preferencias alimentarias de las hembras flebotominas 

(Chaves & Añez 2004). Para ello se realizó un análisis de 

estructura gremial (guild structure analysis), empleándose como 

índice para cuantificar los patrones de coocurrencia la variación 

del C-score (si la variación es baja, entonces los gremios poseen 

patrones de coocurrencia muy similares), siendo los gremios 

(guilds) las preferencias “antropofílicas” y las “zoofílicas” de las 

hembras flebotominas. Los gremios ecológicos son grupos de 

especies dentro de una comunidad que comparten recursos que 

les son comunes: es más probable que especies dentro de un 

mismo gremio interactúen o compitan por recursos que las de 

diferentes gremios (Gotelli 2000; Gotelli & Entsminger 2003). 

Asimismo, se realizó la prueba de la hipótesis de los estados 

favorecidos (Fox 1987), y que no es más que una variante más 

estricta del modelo de gremios (Feeley 2003). Un estado favorecido 

correspondería si la distribución de las especies entre los 

gremios es uniforme dentro de las comunidades (Feeley 2003, 

Gotelli & Entsminger 2003). Es importante indicar que para 

la realización de estas dos últimas pruebas, se excluyeron los 

datos obtenidos con la aplicación de las técnicas de captura de 

cebo humano y trampa lumínica de Shannon, ya que al utilizar 

atrayentes se genera un sesgo hacia las especies flebotominas 

“antropofílicas” y/o fotofílicas (Chaves & Añez 2004). 

Como algoritmo de aleatorización para la simulación, se escogió 

el “filas fijas- columnas fijas” (SIM9: fixed-fixed) (modelos 

nulos), en el cual las sumas de las filas y las de las columnas se 

mantienen fijas para la simulación, siendo un algoritmo menos 

proclive a cometer Errores Tipo I y II (Gotelli 2000, Gotelli & 

Entsminger 2003). Se generaron 5000 matrices aleatorizadas 

usando un algoritmo tipo swap, el cual comienza con las matrices 

originales observadas y permuta sucesivamente sus subelementos, 

creando de esta manera nuevas matrices aleatorizadas y barajeadas 

(Stone & Roberts 1990, Gotelli & Entsminger 2003). 

Las pruebas de los modelos nulos de los C-score se llevaron a 

cabo utilizando el programa (software) de simulación ECOSIM 

versión 7.0 (Gotelli & Entsminger 2004). 

Resultados 

Los análisis de simulación de los patrones de coocurrencia de 

las comunidades flebotominas realizados para diez poblaciones 

ubicadas en la zona bioclimática del BMST, y la localidad de 

“San Francisco” (escala reducida o local: domicilio, peridomicilio 

y área silvestre), revelaron que no existen resultados estadísticamente 

significativos (p> 0.05) entre las diferencias del C-score, 

su variación y los estados favorecidos y las medias del C-score, su 

variación y de los estados favorecidos del proceso de simulación; 

datos estos que se muestran en las Tablas 3, 4, 5 y 6. 

Discusión 

A una escala más amplia o regional, Chaves y Añez (2004) detectaron 

patrones de coocurrencia no agregados en comunidades 

flebotominas del estado Mérida, en la región andino-venezolana, 

al aplicar de igual modo modelos nulos, indicando que esto 

podría deberse a varios factores: competencia interespecífica, 


101


Tabla 3. Valores del índice C-score para las comunidades flebotominas a diferentes sitios de captura en 10 localidades endémicas 

ubicadas en el Bosque Muy Seco Tropical (BMST) del estado Falcón, Venezuela. 

Datos 

C-Score 

Media ± Varianza del 

Índice C-Score simulado 

Sitios de captura, incluyendo todas las técnicas de captura 0.10714 0.10714 ± 0.00000 1.00000 

Sitios de captura, aspiración directa 0.26667 0.26667 ± 0.00000 1.00000 

Sitios de captura, papel aceitado 0.06667 0.06667 ± 0.00000 1.00000 

P 

Tabla 4. Varianza del índice C-score y los valores del estado favorecido para las comunidades flebotominas con una estructura 

de gremio en especies antropofílicas (A) y zoofílicas (Z), a diferentes sitios de captura en 10 localidades endémicas ubicadas 

en el Bosque Muy Seco Tropical (BMST) del estado Falcón, Venezuela. 

Datos 

Varianza 

del 

C-Score 

Media ± Varianza 

simulada del 

C-Score simulado 

P 

Estados 

favorecidos 

Media ± Varianza de 

los estados favorecidos 

simulados 

P 

Sitios de captura, incluyendo 

todas las técnicas de captura 

Sitios de captura, aspiración 

directa 

0.01389 0.03046 ± 0.00081 0.88900 1.00000 1.44600 ± 0.43352 0.90700 

0.22222 0.10560 ± 0.01519 0.88900 1.00000 1.06000 ± 0.51892 0.76900 

Tabla 5. Valores del índice C-score para las comunidades flebotominas a diferentes sitios de captura en “San Francisco”, 

estado Falcón, Venezuela. 

Datos C-Score Media ± Varianza del Índice C-Score simulado P 

Sitios de captura, incluyendo todas 

las técnicas de captura 

0.33333 0.38508 ± 0.00290 0.46360 

Sitios de captura, aspiración directa 0.33333 0.33333 ± 0.00000 1.00000 

Sitios de captura, papel aceitado 0.90000 0.77296 ± 0.00639 0.22080 

Tabla 6. Varianza del índice C-score y los valores del estado favorecido para las comunidades flebotominas con una estructura 

de gremio en especies antropofílicas (A) y zoofílicas (Z), a diferentes sitios de captura en “San Francisco”, estado Falcón, 

Venezuela. 

Datos 

Varianza 

del C-Score 

Media ± Varianza 

simulada del C-Score 

simulado 

P 

Estados 

favorecidos 

Media ± Varianza de 

los estados favorecidos 

simulados 

P 

Sitios de captura, incluyendo 

todas las técnicas de captura 

Sitios de captura, aspiración 

directa 

0.0000 0.18828 ± 0.04498 1.0000 0.0000 0.00000 ±1.24202 1.0000 

0.0000 0.43189 ± 0.12811 1.0000 0.0000 1.51000 ± 0.45636 1.0000 

diversidad de requerimientos ambientales o por los procesos 

históricos de especiación particulares (Stone & Roberts 1990). 

Por su parte, Chaves (2011) detectó a escala local que las comunidades 

flebotominas pueden cambiar de patrones de coocurrencia 

segregados en un bosque primario no intervenido, a uno agregado 

en una granja, sugiriendo que esto pudiera explicarse por 

el ajuste ecológico (ecological fitting) de los flebotominos en la 

selección de sitios de reposo diurno en ambientes intervenidos 

(Janzen 1985, Chaves 2011). Contrastando con estos hallazgos, 

cuando se hace el análisis de los patrones de coocurrencia a nivel 

local en el estado de Falcón, se revela que las comunidades 

flebotominas en los ambientes naturales y sinantrópicos (peri 

e intradomicilio) a nivel del BMST y de la población de “San 

Francisco” se encuentran agregadas, o sea existe mayor coocurrencia, 

tal como lo sugiere el hallazgo de que las diferencias entre 

los C-score calculados y los simulados no son estadísticamente 

significativas. En un intento por tratar de explicar este patrón de 

agregación (coocurrencia positiva), debemos indicar en primer 

lugar que las leishmaniasis no deberían considerarse en los actuales 

momentos como una parasitosis que el humano adquiere 

exclusivamente al adentrarse a sus ciclos enzooticos naturales, 

o ser considerada como una dolencia ocupacional relacionada 

con actividades profesionales en áreas zoonóticas; las evidencias 

actuales parecieran apuntar hacia cambios desde un punto de 

vista multidimensional, en los patrones geográficos, ecológicos, 

climáticos, socio-económicos y epidemiológicos en los patrones 

de trasmisión (Desjeux 2001, Chaves et al. 2008a, Miranda et al. 

2009). La creciente urbanización producto de la descontrolada 

migración humana hacia la periferia de las ciudades, hace que 

la diferencia entre el peridomicilio y los ambientes naturales 

desaparezcan o sean más tenues: los flujos migratorios han 

pasado a ser en gran parte del medio urbano a medio urbano, 

102 


Patrones de coocurrencia y conducta alimentaria de Phlebotominae enVenezuela 

y cada vez menos un flujo medio rural-medio rural o medio 

rural-medio urbano (Campbell-Lendrum et al. 2001, Desjeux 

2001; Bejarano et al. 2001, 2002). Por lo tanto, el medio natural 

y los ambientes sinantrópicos pueden considerarse un espacio 

continuo, constituyéndose probablemente en ambientes más 

homogéneos, disminuyendo de este modo la segregación espacial 

y temporal (i.e, coocurrencia negativa) que puede ocasionar la 

heterogeneidad ambiental (Rosenzweig 1995). Estos cambios 

hacen que la conducta y composición de las comunidades de 

los transmisores y de los reservorios animales también se modifiquen, 

y éstos invadan a los nuevos ambientes sinantrópicos, 

sin la necesidad de una adaptación extrema, especialmente de las 

especies que poseen un amplio ajuste ecológico (Janzen 1985, 

Chaves 2011). Así, existen vectores o especies flebotominas 

con una alta fotofilia y que además pueden reposar en una gran 

variedad de sitios, que al ser atraídos a los ambientes humanos 

hacen más probable un mayor contacto flebotomino-humanoreservorios 

domésticos (Bejarano et al. 2001, 2002, Dos Santos 

et al. 2003, Chaves 2011). En este mismo orden de ideas, los 

reservorios silvestres, como por ejemplo Didelphis marsupialis 

(Marsupialia), poseen una amplia plasticidad en su adaptación 

a la vivienda humana donde merodean para alimentarse, convirtiéndose 

en un excelente reservorio domiciliario animal de 

Leishmania (Travi et al. 1994). Así mismo, deben evaluarse los 

animales domésticos, incluyendo aquellos que pueden ser reservorios 

domésticos del protozoo (e.g. perros) y otros vertebrados 

no susceptibles a Leishmania como las aves de corral, y que sirven 

de fuente alimentaria atrayente para las hembras flebotominas 

(Desjeux 2001, Alexander et al. 2002). 

Por otra parte, la consideración del humano como hospedador 

incidental (i.e. vertedero) o posible reservorio (i.e. fuente y vertedero) 

intradomiciliar de leishmaniasis, es un factor a considerar 

en los nuevos esquemas eco-epidemiológicos de transmisión de 

las leishmaniasis (Chaves et al. 2008b). Estos nuevos cambios en 

los patrones epidemiológicos de las leishmaniasis en el continente 

americano ha llevado a Rotureau (2006) a preguntarse hipotéticamente 

en el título de su artículo: “Are New World leishmaniases 

becoming anthroponoses?”, tal como ha ocurrido esporádicamente 

en casos focalizados de la región paleotrópica (Reyburn et al. 

2003). Lo discutido anteriormente, apoyaría la tesis según la cual 

las medidas para el control de las leishmaniasis deben implementarse 

o enfocarse desde un punto de vista de evitar el contacto 

con las hembras flebotominas, en vez de la intervención de las 

áreas silvestres (Chaves et al. 2008a, Chaves 2011). 

En cuanto a la estructura de gremios (especies “antropofílicas” 

y “zoofílicas”), se encontró que la variación de C-score calculada 

no es significativamente diferente a la del modelo nulo simulado, 

lo que sugiere que todas las especies pertenecen a un mismo gremio. 

Similares hallazgos a los del presente estudio encontraron 

Chaves y Añez (2004) en la región andino-venezolana, aunque 

a escala regional. Es un hecho tangible en las áreas endémicas de 

leishmaniasis del Neotrópico, observar la coexistencia temporal 

y espacial, de especies flebotominas que pican al humano como 

otras que no, además de muchas clases de hospedadores vertebrados 

(Feliciangeli 1987, Young y Duncan 1994), pudiendo las 

hembras flebotominas adoptar una conducta de alimentación 

versátil y variable de amplia plasticidad, que depende de la 

disponibilidad de animales vertebrados (Bejarano et al. 2001, 

Travi et al. 2002). 

Por ello, se puede indicar que la “preferencia” de una hembra 

flebotomina hacia un determinado hospedador (e.g. antropofilia), 

pudiera interpretarse como un evento heterogéneo, circunstancial 

y oportunista, donde las densidades de las hembras 

flebotominas (e.g. variaciones estacionales) y de los hospedadores 

vertebrados (movimientos) juegan un papel más fundamental 

(Kelly & Thompson 2000, Chaves & Añez 2004). Por lo tanto, 

como bien lo establecen Chaves y Añez (2004), no pareciera 

tener sentido utilizar la simple dicotomía discriminatoria de 

“especies antropofílicas” y “especies zoofílicas”. 

Por su parte, el análisis de los estados favorecidos indicó que 

las especies flebotominas no tienen a nivel local una regla de 

ensamble de uniformidad para la sustitución de los gremios. Por 

lo tanto, los resultados obtenidos en las comunidades flebotominas 

en diez localidades del BMST y de “San Francisco” de la 

región falconiana no parecieran apoyar la hipótesis de Chaves 

y Añez (2004), acerca de la probable existencia a escala local 

de especies introductoras (intruders) y especies esparcidoras 

(spreaders), al considerar que posiblemente las especies “zoofílicas” 

que se alimentan de los reservorios silvestres introducen 

(especies introductoras) los parásitos de Leishmania hacia los 

ambientes sinantrópicos, encargándose las especies “antropofílicas” 

de esparcir (especies esparcidoras) al protozoo dentro de 

las poblaciones humanas. 

A pesar de lo discutido, se necesita indagar de una manera 

global y con mayores detalles los aspectos de la historia natural, 

biología y ecología del ecosistema para explicar con mayor eficacia 

y aproximación los patrones detectados. 


Fundacite-Falcón (Proyecto S197-012, Decanato de Investigación, 

UNEFM, Coro, estado Falcón, Venezuela, y Tecana 

American University, Miami, Florida. 


Alexander B., R. de Carvalho, H. McCallum, et al. 2002. Role of the 

domestic chicken (Gallus gallus) in the epidemiology of 

urban visceral leishmaniasis in Brazil. Emerging Infectious 

Diseases 8:1480-1485. 

Añez N., A. Rojas, E. Vargas, et al. 2012. Estudio epidemiológico 

sobre leishmaniasis visceral en la región semiárida del occidente 

de Venezuela con especial referencia a la detección 

de infecciones inaparentes. Boletín de Malariología y Salud 

Ambiental. 52: 245–256. 

Bejarano E., S. Uribe, W. Rojas, et al. 2001. Presence of Lutzomyia 

evansi, a vector of American visceral leishmaniasis, in an 

urban area of the Colombian Caribbean coast. Transactions 

of the Royal Society of Tropical Medicine and Hygiene 95: 

27-28. doi:10.1016/S0035-9203(01)90320-7 

Bejarano E., S. Uribe, W. Rojas, et al. 2002. Phlebotomine sand flies 

(Diptera: Psychodidae) associated with the appearance of 

urban Leishmaniasis in the city of Sincelejo, Colombia. 

Memórias do Instituto Oswaldo Cruz 97: 645-647. doi: 

http://dx.doi.org/10.1590/S0074-02762002000500010 

Campbell-Lendrum D., J. Dujardin, E. Martinez, et al. 2001. Domestic 

and peridomestic transmission of American cutaneous 

leishmaniasis: changing epidemiological patterns present 

new control opportunities. Memórias do Instituto Oswaldo 

Cruz 96: 159-162. doi: http://dx.doi.org/10.1590/S0074- 

02762001000200004 

Cazorla D. & P. Morales. 2012. Fauna flebotomina del estado Falcón, 

Venezuela (Diptera: Psychodidae). Revista peruana de biologia 

19: 075 – 080. 

Chase J. 2003. Community assembly: when should history matter? 

Oecologia. 136: 489 – 498. doi: 10.1007/s00442-003- 

1311-7 


103


Chaves L. & N. Añez. 2004. Species co-occurrence and feeding behavior 

in sand fly transmission of American cutaneous leishmaniasis 

in western Venezuela. Acta Tropica 92: 219-224. 

doi: http://dx.doi.org/10.1016/j.actatropica.2004.08.001 

Chaves L., J. Cohen, M. Pascual, et al. 2008a. Social exclusion modifies 

climate and deforestation impacts on a vector borne disease. 

PLOS Neglected Tropical Diseases 2: e176. doi: 10.1371/ 

journal.pntd.0000176 

Chaves L., M. Hernández & S. Ramos. 2008b. Simulación de modelos 

matemáticos como herramienta para el estudio de 

los reservorios de la Leishmaniasis Cutánea Americana. 

Divulgaciones Matemáticas. 16: 125-154. 

Chaves L. 2011. Phlebotomine sand fly species co-occurrence at the 

local scale: differences between agricultural and forested 

areas. Boletín de Malariología y Salud Ambiental 51: 35-39. 

De Lima H., R. Borges, J. Escobar, et al. 2010. Leishmaniasis cutánea 

americana en Venezuela: un análisis clínico epidemiológico 

a nivel nacional y por entidad federal, 1988-2007. Boletín 

de Malariología y Salud Ambiental 50: 283-300. 

Desjeux P. 2001. The increase in risk factors for leishmaniasis worldwide. 

Transactions of the Royal Society of Tropical Medicine 

and Hygiene 95: 239-243. doi: http://dx.doi.org/10.1016/ 

S0035-9203(01)90223-8 

Dos Santos T., M. de Mello Gaia, R. Brazil, et al. 2003. Attraction 

of sand flies (Diptera: Psychodidae) to light traps in rural 

areas of Minas Gerais State, Brazil. Journal of the American 

Mosquito Control Association 19: 74-78. 

Ewel J., A. Madriz & Jr J. Tosi. 1976. Zonas de Vida de Venezuela. 

Memoria explicativa sobre el mapa ecológico. 4 a Ed. Caracas, 

Venezuela: Editorial Sucre. 

Feeley K. 2003. Analysis of avian communities in Lake Guri, Venezuela, 

using multiple assembly rule models. Oecologia. 137: 104 

– 113. doi: 10.1007/s00442-003-1321-5 

Feliciangeli M. 1987. Ecology of sandflies (Diptera: Psychodidae) in a 

restricted focus of cutaneous leishmaniasis in nothern Venezuela. 

I. - Description of the study area, catching methods 

and species composition. Memórias do Instituto Oswaldo 

Cruz 82: 119 – 124. doi: http://dx.doi.org/10.1590/S0074- 

02761987000100019 

Fox B. 1987. Species assembly and evolution of community structure. 

Evolutionary Ecology 1: 201 – 213. doi: 10.1007/ 

BF02067551 

González-Salazar C., C. Stephens & P. Marquet. 2013. Comparing 

the relative contributions of biotic and abiotic factors as 

mediators of species’ distribution. Ecological Modeling. 

248: 57-70. doi: http://dx.doi.org/10.1016/j.ecolmodel.2012.10.007 

Gordon C. 2000. The coexistence of species. Revista Chilena de Historia 

Natural 73: 175-198. 

Gotelli N. 2000. Null model analysis of species co-occurrence patterns. 

Ecology. 81: 2606-2621. 

Gotelli N. & G. Entsminger. 2003. Swap algorithms in null model 

analysis. Ecology. 84: 532–535. doi: http://dx.doi. 

org/10.1890/0012-9658(2000)081[2606:NMAOSC]2. 

0.CO;2 

Gotelli N. & G. Entsminger. 2004. ECOSIM: Null models software 

for ecology, Version 7.0. Acquired Intelligence Inc. and 

Kesey-Bear, Jericho, VT 05465. . Acceso 11/01/2008. 

Herrera L. 2010. Una revisión sobre reservorios de Trypanosoma 

(Schizotrypanum) cruzi (Chagas, 1909), agente etiológico de 

la Enfermedad de Chagas. Boletín de Malariología y Salud 

Ambiental. 50: 3-15. 

Janzen D. 1985. On ecological fitting. Oikos. 45: 308–310. 

Kelly D. & C. Thompson 2000. Epidemiology and optimal foraging: 

modelling the ideal free distribution of insect vectors. Parasitology. 

120: 319 – 327. 

Miranda A., R. Carrasco, H. Paz, et al. 2009. Molecular Epidemiology 

of American Tegumentary Leishmaniasis in Panama. The 

American Journal of Tropical Medicine and Hygiene 81: 

565–571. doi: 10.4269/ajtmh.2009.08-0265 

Reyburn H., M. Rowland, M. Mohammmed, et al. 2003. The prolonged 

epidemic of anthroponotic cutaneous leishmaniasis 

in Kabul, Afghanistan: ‘bringing down the neighbourhood’. 

Transactions of the Royal Society of Tropical Medicine and 

Hygiene 97: 170-176. doi: http://dx.doi.org/10.1016/ 

S0035-9203(03)90111-8 

Rotureau B. 2006. Are New World leishmaniases becoming anthroponoses? 

Medical Hypotheses 67: 1235-1241. 

Rosenzweig M. 1995. Species diversity in space and time. Cambridge, 

England: Cambridge University Press. 

Stone L. & A. Roberts. 1990. The checkerboard score and species distributions. 

Oecologia. 85: 74–79. doi: 10.1007/BF00317345 

Travi B., C. Jaramillo, J. Montoya, et al. 1994. Didelphis marsupialis, 

an important reservoir of Trypanosoma (Schizotrypanum) 

cruzi and Leishmania (Leishmania) chagasi in Colombia. 

The American Journal of Tropical Medicine and Hygiene 

50: 557-565. 

Travi B., G. Adler, M. Lozano, et al. 2002. Impact of habitat degradation 

on phlebotominae (Diptera: Psychodidae) of tropical 

dry forests in Northern Colombia. Journal of Medical Entomology 

39: 451-456. doi: http://dx.doi.org/10.1603/0022- 

2585-39.3.451 

Vilchis O. 2000. Modelos nulos en interacciones biológicas, una 

propuesta: depredación en Crirostoma riojai-zooplancton. 

Ciencia Ergo Sum. 7: 153 – 156. 

Young D. & M. Duncan. 1994. Guide to the identification and 

geographic distribution of Lutzomyia sand flies in Mexico, 

the West Indies, Central and South America (Diptera: 

Psychodidae). Memories of the American Entomological 

Institute, Number 54. Associated Publishers, Gainesville, 

Florida, Estados Unidos de América. 

104 




Nueva especie de Hesperiidae para Perú: 

ISSN-L 1561-0837 

Dalla granites 



Nueva especie de Hesperiidae (Lepidoptera) para Perú: Dalla granites (Mabille, 1898) 


José Alfredo Cerdeña 1 , Erick Huamaní 1 , Rómulo Delgado 2 y Gerardo Lamas 3 

1 Museo de Historia Natural, Universidad Nacional 

de San Agustín, Av. Alcides Carrión s/n, 

Arequipa, Perú. 

2 Santuario Nacional Megantoni, SERNANP, Jirón 

Puno R-4, Quillabamba, Cuzco, Perú. 

3 Museo de Historia Natural, Universidad Nacional 

Mayor San Marcos, Apartado 14-0434, Lima-14, 

Perú. 

Email Jose Cerdeña: cerdenajoseal@yahoo.es 

Email Erick Huamani: zoología_@hotmail.com 

Email Gerardo Lamas: glamasm@unmsm.edu.pe 

Resumen 

Se registra por primera vez para Perú al raro hespérido Dalla granites (Mabille, 1898) (Lepidoptera: 

Hesperiidae), previamente citado de Ecuador y Bolivia. 

Palabras clave: Nuevo registro; Dalla; Hesperiidae; Parque Nacional del Manu; Perú. 

Abstract 

The rare skipper Dalla granites (Mabille, 1898) (Lepidoptera: Hesperiidae), previously cited 

from Ecuador and Bolivia is reported for the first time in Peru. 

Keywords: New record; Dalla; Hesperiidae; Manu National Park; Peru. 

Citación: 

Cerdeña J.A. & E. Huamaní, R. Delgado y G. 

Lamas. 2014. Nueva especie de Hesperiidae 

(Lepidoptera) para Perú: Dalla granites (Mabille, 

1898). Rev. peru. biol. 21(1): 105-107 (Mayo 2014). 



Aceptado: 23/01/2014 


El género neotropical Dalla Mabille, 1904 (Lepidoptera: Hesperiidae) contiene 

97 especies actualmente reconocidas como válidas (Mielke 2005, Viloria et al. 2008, 

Warren & Maza 2011), de las que 51 han sido registradas hasta el momento en Perú 

(Lamas 2003 y datos inéditos), además de otras dos aún no descritas. El género está 

distribuido desde México hasta el sudeste de Brasil y norte de Argentina, asociado 

preferentemente a bosques montanos y nublados (Lamas 2003, Viloria et al. 2008). 

Los machos se observan con frecuencia congregados en charcos de barro, a los que las 

hembras muy rara vez acuden (Steinhauser 2002), siendo estas últimas hasta ahora 

desconocidas para la mayoría de las especies (Warren & Maza 2011). 

Una de las especies menos conocidas, y muy escasamente representada en colecciones 

científicas, es Dalla granites (Mabille), descrita originalmente de Ecuador como Butleria 

granites (Mabille 1898). En su obra monográfica sobre los hespéridos americanos, 

Evans (1955) citó granites como una de las 75 especies que reconoció en Dalla. Evans 

(op. cit.) consideró a granites como una especie politípica y, sin mayor evidencia que 

una semejanza fenotípica, incluyó a Dalla privata Draudt, descrita de Bolivia, como 

subespecie de la primera. Butleria granites fue descrita por Mabille (1898) con base 

en un único macho (el holotipo) proveniente de Ecuador, “environs [= alrededores] 

de Loja”, probablemente recolectado por Théophile Gaujon. Dicho holotipo, y cinco 

machos adicionales de la misma localidad se encuentran depositados en el Natural 

History Museum, Londres, Inglaterra (BMNH); imágenes electrónicas del holotipo se 

pueden examinar en Warren et al. (2013). Posteriormente, Draudt (1923) describió la 

especie Dalla privata, con base en aparentemente un único macho de Bolivia, [La Paz], 

“Cuesta von Cillutincara” [= Cerro Sillutincara, ca. 3600 m, ca. 16°17’S, 67°54’W], de 







105

Cerdeña et al. 

Figura 1. Dalla granites privata Draudt, 1923. Macho, Parque Nacional del Manu, Cuzco, Perú. Izquierda, faz dorsal; derecha, 

faz ventral. Barra = 1 cm. 

la colección [Anton] Fassl, posiblemente capturado por Gustav 

Garlepp hacia 1895 – 1896. El “tipo” de privata no ha podido ser 

hallado hasta el momento (Mielke 1993), pero fue ilustrado por 

Draudt (op. cit.) en la lámina 179, fila i, fig. [3], lo que permite 

su reconocimiento. A pesar que Evans (1955) nunca examinó 

un ejemplar de privata, solo la ilustración publicada por Draudt 

(op. cit.), intuitivamente la consideró como una subespecie de 

granites, basándose exclusivamente en diferencias fenotípicas 

superficiales y separación espacial. Entretanto, en la colección 

Olaf Mielke (Curitiba, Brasil) se encuentra depositado un macho 

que es muy semejante (pero no idéntico) al ejemplar ilustrado 

por Draudt, y que proviene de la misma localidad tipo. Dicho 

ejemplar, cuya imagen electrónica puede ser examinada en Warren 

et al. (2013), podría ser un sintipo de privata. Asumiendo 

que granites y privata realmente sean coespecíficas, y dado que en 

las referencias bibliográficas sobre estos dos taxones, reunidas por 

Mielke (2005), no se cita ningún ejemplar adicional de la especie, 

aparte de los seis machos de granites en el BMNH (Evans 1955), 

el macho no hallado de privata, ilustrado por Draudt (1923), y 

el segundo macho de privata ilustrado por Warren et al. (2014), 

hasta al presente solo se conoce la existencia de ocho machos de 

la especie (siete de ellos depositados en colecciones científicas). 

En setiembre de 2012, en una evaluación de mariposas diurnas 

realizada por JC, EH y RD, en las altas cumbres del Parque 

Nacional del Manu, sureste de Perú, como parte del proyecto 

“Mariposas Altoandinas de la Reserva de Biosfera Manu: Diversidad, 

Endemismo y Conservación”, se capturó un macho adulto 

de Dalla granites privata (Fig. 1), en el sector denominado “Incatambo”, 

Provincia Calca, Departamento Cuzco (12°30’30”S 

72°05’05”W) a 3700 m de altitud, que está depositado en el 

Figura 2. Sector “Incatambo” del Parque Nacional del Manu; la flecha indica la cumbre donde se capturó el macho de Dalla 

granites privata. 

106 


Nueva especie de Hesperiidae para Perú: Dalla granites 

Museo de Historia Natural de la Universidad Nacional Mayor 

de San Marcos (MUSM), Lima. El área donde se recolectó el 

ejemplar corresponde a una cima de colina (Fig. 2), a unos 200 

m en distancia vertical desde el límite del bosque nublado más 

cercano, siendo capturado alrededor de las 13:00 horas en pleno 

vuelo. Por el tipo de hábitat donde fue registrada esta especie, 

pastizal altoandino de Puna Húmeda del sur de Perú (atípico para 

especies de Dalla), se presume que el individuo posiblemente 

exhibía comportamiento de “cumbreo” (hilltopping en inglés), 

utilizado por muchas especies de mariposas y otros insectos que 

vuelan hacia las cimas o cumbres de colinas y montañas para 

formar agregaciones que incrementen la probabilidad de hallar 

pareja para el apareamiento (Shields 1968, Alcock 1987, Pe’er 

et al. 2004). 

Con este hallazgo se confirma la presencia de Dalla granites 

en Perú, representando el tercer ejemplar hasta ahora conocido 

de D. granites privata. 


Los autores agradecen al Servicio Nacional de Areas Naturales 

Protegidas por el Estado (SERNANP), Ministerio del 

Ambiente, Perú, por el permiso otorgado (R.J. Nº 0011-2012 

SERNANP-PNM) para la realización de los trabajos de campo 

en el Parque Nacional del Manu, y a MBZ Fund Conservation 

por el financiamiento otorgado al primer autor para la realización 

del proyecto “Mariposas Altoandinas de la Reserva de Biosfera 

del Manu: Diversidad, Endemismo y Conservación”. 


Alcock J. 1987. Leks and hilltopping in insects. Journal of Natural History 

21(2): 319-328. DOI: 10.1080/00222938700771041 

Draudt M. 1921-1924. B. Grypocera, breitköpfige Tagfalter. In: Seitz 

A. (Ed.), Die Gross‐Schmetterlinge der Erde. Alfred Kernen, 

Stuttgart. 5: 836-1011, pls. 160-191. 

Evans W.H. 1955. A catalogue of the American Hesperiidae indicating 

the classification and nomenclature adopted in the 

British Museum (Natural History). Part IV. Hesperiinae 

and Megathyminae. British Museum (Natural History), 

London. 499 pp. 

Lamas G. 2003. Las Mariposas de Machu Picchu. Guía ilustrada de 

las mariposas del Santuario Histórico Machu Picchu, Cuzco, 

Perú. PROFONANPE, Lima. 221 pp., 34 pls. 

Mabille P. 1898. Description de lépidoptères nouveaux. Annales de la 

Société entomologique de France 66(2/3): 182-231. 

Mielke O.H.H. 1993. Sobre os tipos de Hesperiidae (Lepidoptera) 

neotropicais descritos por M. Draudt. Revista brasileira de 

Entomologia 37(3): 611-638. 

Mielke O.H.H. 2005. Catalogue of the American Hesperioidea: 

Hesperiidae (Lepidoptera). Sociedade Brasileira de Zoologia, 

Curitiba. 6: 1385-1536. 

Pe’er G., D. Saltz, H.-H. Thulke & U. Motro. 2004. Response to 

topography in a hilltopping butterfly and implications for 

modelling nonrandom dispersal. Animal Behaviour 68(4): 

825-839. 

Shields O. 1968. Hilltopping. An ecological study of summit congregation 

behavior of butterflies on a Southern California 

hill. Journal of Research on the Lepidoptera 6(2): 69-178. 

Steinhauser S.R. 2002. Five new species of Dalla from Colombia 

and Ecuador (Hesperiidae). Journal of the Lepidopterists’ 

Society 56(2):53-61. 

Viloria A.L., A.D. Warren & G.T. Austin. 2008. A spectacular new Dalla 

Mabille, 1904 from Venezuela-Colombia (Hesperiidae: 

Heteropterinae). Bulletin of the Allyn Museum 156: 1-12. 

Warren A.D. & R.G. de la Maza. 2011. A new species of Dalla from 

Chiapas, Mexico (Lepidoptera, Hesperiidae, Heteropterinae). 

Tropical Lepidoptera Research 21(1): 7-11. 

Warren A.D., K.J. Davis, E.M. Stangeland, J.P. Pelham & N.V. Grishin. 

2013. Illustrated lists of American butterflies (North and 

South America). . 

Acceso 15/01/2014. 


107

Cerdeña et al. 

108 


Revista peruana de biología 21(1): 109 - 110 

Two 

(2014) 

new butterfly records for Peru: Orophila cardases cardases and 

ISSN-L 1561-0837 

Pedaliodes garlaczi 




Two new butterfly records for Peru: Orophila cardases cardases and Pedaliodes garlaczi 

(Lepidoptera: Nymphalidae) 

Dos nuevos registros de mariposas para Perú: Orophila cardases cardases y Pedaliodes garlaczi 

(Lepidoptera: Nymphalidae) 


Museo de Historia Natural, Universidad Nacional 

de San Agustín, Av. Alcides Carrión s/n, Arequipa, 

Perú. 

Email Jose Cerdeña: cerdenajoseal@yahoo.es 

Email Erick Huamani: zoología_@hotmail.com 

Citación: 

Cerdeña J.A. & E. Huamaní. 2014. Two new butterfly 

records for Peru: Orophila cardases cardases 

and Pedaliodes garlaczi (Lepidoptera: Nymphalidae). 

Rev. peru. biol. 21(1): 109-110 (Mayo 2014). 


Abstract 

We report to Peru, for the first time, two butterfly species, Orophila cardases cardases (Hewitson, 

1869) and Pedaliodes garlaczi Pyrcz & Cerdeña, 2013, based on specimens collected in 

the Tabaconas-Namballe National Sanctuary and neighboring areas. 

Keywords: New records; Orophila; Pedaliodes; Nymphalidae; Peru. 

Resumen 

Se registra por primera vez la presencia en Perú de las especies Orophila cardases cardases 

(Hewitson, 1869) y Pedaliodes garlaczi Pyrcz & Cerdeña, 2013, con base en especimenes 

recolectados en el Santuario Nacional Tabaconas-Namballe y áreas adyacentes. 

Palabras Clave: Nuevos registros; Orophila; Pedaliodes; Nymphalidae; Perú. 


Aceptado: 27/02/2014 


The Tabaconas-Namballe National Sanctuary (TNNS), located in San Ignacio 

Province, Cajamarca, northern Peru, was established in 1988 to conserve and protect 

páramo-like open vegetation formations and cloud forest relicts, as well as their associated 

fauna and flora. The TNNS cloud forest is characterized by its high diversity, many 

of the species being endemic and exhibiting remarkable turnover along an elevational 

gradient (Mena & Valdivia 2010). 

In a rapid evaluation of butterfly diversity in the TNNS, conducted in October 2009 

by one of us (EH), adult specimens of Orophila cardases cardases (Hewitson 1869) and 

Pedaliodes garlaczi Pyrcz & Cerdeña, 2013 were collected, both species having been 

previously recorded only from southeastern Ecuador. 

Orophila Staudinger, 1886 is an Andean genus containing two species (O. cardases 

and O. diotima Hewitson, 1852), distributed from northwestern Venezuela to Bolivia 

and intimately associated to montane forests (Lamas 2003). Until now, only O. diotima 

was known to occur in Peru (Lamas 2003, 2004). Orophila cardases is distributed from 

northwestern Venezuela to southern Ecuador (Neild 1996), contains five subspecies 

(two still unnamed – Lamas 2004), and the nominate subspecies O. cardases cardases 

had only been found in southern Ecuador. One adult male of O. cardases cardases (Fig. 

1) was collected in the TNNS, at the Miraflores sector (05°09’05”S, 79°11’40”W), 2257 

m. This specimen has been deposited in the Museo de Historia Natural, Universidad 

Nacional Mayor de San Marcos (MUSM), Lima, Peru. In addition, another male of 

this subspecies was found and examined in the MUSM, bearing the following collection 

data: “PERU, PI [Piura], Ayabaca, Ramos, 0442/7928 [04°42’S / 79°28’W], 







109

Cerdeña & Huamaní 

Figure 1. Orophila cardeses cardeses (Hewitson, 1869). Male, National Sanctuary Tabaconas-Namballe, Miraflores sector, 

October 2009. a. dorsal view; b. ventral view. 

Figure 2. Pedaliodes garlaczi Pyrcz & Cerdeña 2013. Male, National Sanctuary Tabaconas-Namballe, Lagunas Arrebatiadas, 

October 2009. a. dorsal view; b. ventral view. 

03.ix.2007, leg. W. Zelada”. This locality is situated some 50 

km NW of the TNNS. 

Pedaliodes garlaczi was described very recently, based on two 

adult specimens collected in the Podocarpus National Park 

southern Ecuador (Pyrcz et al. 2013). We confirm its presence 

in Peru based on a male (Fig. 2) collected in the TNNS sector 

of Lagunas Arrebatiadas (05°14’05”S, 79°17’05”W), 3072 m, 

also the mentioned species was obtained in a transitional area 

between open, páramo-like vegetation and cloud forest. 

Acknowledgements 

Field work was performed under authorization R.J. Nº 005- 

2009 SERNANP-SNTN issued by the Servicio Nacional de 

Areas Naturales Protegidas por el Estado (SERNANP), Ministerio 

del Ambiente, Perú. We thank Dr. G. Lamas (MUSM) for 

access to collections under his care, information and comments 

on the manuscript. 

Literature cited 

Lamas G. 2003. Las Mariposas de Machu Picchu. Guía ilustrada de 

las mariposas del Santuario Histórico Machu Picchu, Cuzco, 

Perú. PROFONANPE, Lima. 221 pp., 34 pls. 

Lamas G. 2004. Nymphalidae. Biblidinae, pp. 234-247. In: Lamas 

G. (Ed.), Checklist: Part 4A. Hesperioidea-Papilionoidea. 

In: Heppner, J. B.(Ed.) Atlas of Neotropical Lepidoptera. 

Volume 5A. Association for Tropical Lepidoptera/ Scientific 

Publishers, Gainesville, 428 pp. 

Mena J. L. & G. Valdivia. 2010. Conociendo el Santuario Nacional 

Tabaconas Namballe. World Wildlife Fund, Lima, 162 pp. 

Neild A. F. 1999. The Butterflies of Venezuela, Part 1: Nymphalidae I 

(Limenitidinae, Apaturinae, Charaxinae). Meridian Publications, 

Greenwich, London, 144 pp. 

Pyrcz T., J. Cerdeña & E. Huamani. 2013. Systematics, bionomics and 

zoogeography of high Andean pedaliodines. Part 14: Two 

new species of Pedaliodes Butler from the Huancabamba 

Deflection in southern Ecuador and northern Peru (Lepidoptera: 

Nymphalidae: Satyrinae). Genus 24(2): 131-141. 

110 




Primer registro del nemátodo 

ISSN-L 

Serratospiculum tendo para 

1561-0837 

el Perú 



Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae) para el Perú 


Luis A. Gomez-Puerta 1 , Pedro A. Ospina 2 , Mercy G. Ramirez 2 , Nelly G. Cribillero 3 

1 Laboratorio de Medicina Veterinaria Preventiva. 

Facultad de Medicina Veterinaria. Universidad 

Nacional Mayor de San Marcos. Av. Circunvalación 

2800, San Borja. Lima, Perú. 

2 Laboratorio de Microbiología y Parasitología. 

Facultad de Medicina Veterinaria. Universidad 

Nacional Mayor de San Marcos. 

3 Laboratorio de Patología Aviar. Facultad de 

Medicina Veterinaria. Universidad Nacional Mayor 

de San Marcos. 

Email Luis Gómez-Puerta: lucho92@yahoo.com 

Email Pedro Ospina: pedrospinasal@hotmail.com 

Email Mercy Ramírez: mramirezv@unmsm.edu.pe 

Email Nelly Cribillero: giovanna06@yahoo.com 

Resumen 

Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 

1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771). 

Seis nematodos (2 machos y 4 hembras) fueron colectados e identificados como S. tendo. 

El hallazgo de este nematodo constituye el primer registro en el Perú. 

Palabras clave: Serratospiculum tendo; Nematodo; Halcón peregrino; Falco peregrinus. 

Abstract 

We report for first time the presence of nematode, Serratospiculum tendo Nitzsch, 1819, 

parasitizing air sacs of a Peregrine Falcon (Falco peregrinus Tunstall, 1771). Six nematodes 

(2 males and 4 females) were collected and identified as S. tendo. The discovery of this 

nematode is the first record in Peru. 

Keywords: Serratospiculum tendo; Nematode; Peregrine Falcon; Falco peregrinus. 

Citación: 

Gomez-Puerta L.A., P.A. Ospina, M.G. Ramirez, 

N.G. Cribillero. 2014. Primer registro de Serratospiculum 

tendo (Nematoda: Diplotriaenidae) para 

el Perú. Revista peruana de biología 21(1): 111 

- 114 (Mayo 2014). doi: http://doi.org/10.15381/ 

rpb.v21i1.8256 


Aceptado: 25/04/2014 








111

Gomez-Puerta et al. 

Introducción 

Los nematodos de la familia Diplotriaenidae comprenden 

a nematodos de ciclo de vida heteroxeno (Anderson 2000). El 

estadío adulto de estos nematodos, llamados también filarias, se 

van a localizar en los sacos aéreos de aves y reptiles (Anderson et 

al. 2009). Dentro de esta familia ubicamos al género Serratospiculum 

Skrjabin, 1915, el cual tiene como hospederos definitivos 

a aves del orden Falconiforme (Lopez-Neyra 1956). Las hembras 

de estos nematodos producen huevos larvados, estos pasarán por 

el tracto respiratorio para ser regurgitados y expulsados con las 

heces del hospedero. Los huevos expulsados serán ingeridos por 

algunas especies de escarabajos coprófagos, que actuarán como 

hospederos intermediarios (Bain & Vassiliades 1969). 

Existen al menos nueve especies de Serratospiculum, siendo 

Serratospiculum verrucosum (Molin, 1858) Skrjabin, 1915 la 

única especie registrada para Sudamérica en Buteo swainsoni 

de Brasil (Bain & Mawson 1981, Skrjabin 1991, Vicente et al. 

1995). El objetivo del presente trabajo es documentar el primer 

hallazgo de Serratospiculum tendo Nitzsch, 1819, para el Perú, así 

como realizar una breve descripción morfológica del nematodo. 

Materiales y métodos 

En abril del 2012, un ejemplar de halcón peregrino (Falco 

peregrinus) fue hallado muerto en el distrito de Bellavista, Callao. 

Al realizar la necropsia, un total de 6 nematodos fueron 

colectados de los sacos aéreos. Los nematodos fueron fijados y 

preservados en etanol al 70%. Para el estudio morfológico, los 

nematodos fueron aclarados en una solución etanol-fenol (1:2 

v/p). Las figuras se realizaron usando un microscopio Carl Zeiss 

Axioskiop-40. Las medidas fueron obtenidas usando el programa 

Leica IM50 Version, 4.0 R117. Las medidas se expresan en 

milímetros y micras con sus respectivos rangos. 

Para la identificación de los especímenes se utilizaron las 

claves propuestas por Bain y Mawson (1981). La nomenclatura 

taxonómica sigue a Anderson et al. (2009). Parte de las 

muestras examinadas se encuentran depositadas en la Colección 

Helmintológica y de Invertebrados Relacionados del Museo 

de Historia Natural de la Universidad Nacional Mayor de San 

Marcos (MUSM 3197) Lima, Perú. 

Resultados 

Orden: Spirurida Chitwood, 1933 

Familia: Diplotriaenidae (Skrjabin, 

1916 subfamilia) Anderson, 1958 

Género: Serratospiculum Skrjabin, 1915 

Serratospiculum tendo (Nitzsch, 1819) 

El estudio morfológico está basado en la revisión de 6 especímenes, 

2 machos y 4 hembras. 

Nematodos filariformes con una cutícula ligeramente lisa 

y de color blanquecino. Presentan una boca sencilla, la cual 

se encuentra formada por dos estructuras trilobuladas y labios 

prominentes. El esófago esta divido en dos partes, la anterior 

o muscular es corto y delgado mientras que el posterior o 

glandular es largo y ancho. Los machos presentan las espículas 

desiguales, siendo la izquierda casi el doble de tamaño que la 

derecha (Fig. 1). 

Machos: Longitud total del cuerpo 132 – 154 mm, con un 

ancho máximo de 405 – 500 μm. Deiridios y anillo nervioso 

Figura 1. Serratospiculum tendo. (A). Extremo anterior del macho. (B). Extremo posterior del macho. (C). Vista apical de la 

cabeza de hembra. (D). Extremo posterior del macho, vista lateral. Escala: A = 500 μm, B = 100 μm, C = 250 μm, D = 500 μm. 

112 


Primer registro del nemátodo Serratospiculum tendo para el Perú 

Tabla 1. Medidas morfológicas de Serratospiculum tendo y S. amaculata. 

Serratospiculum tendo Serratospiculum tendo Serratospiculum amaculata 

Acuerdo con: Presente estudio Bain y Mawson, 1981 Wehr, 1938 

Cuerpo (macho) L a 132 – 154 mm 148 mm 65 – 88 mm 

Cuerpo (hembra) L a 198 – 248 mm 190 mm 200 – 225 mm 

Espicula izquierda L a 1004 – 1164 μm 1120 μm 2.1 mm 

Espicula derecha L a 459 – 498 μm 505 μm 720 μm 

Huevos LxA ab 53 – 55 x 32 – 35 μm — 54 x 29 μm 

Distribucion Peru Australia USA 

a 

Largo, b Ancho 

situado a 198 – 230 μm y 295 – 310 μm de la parte anterior, 

respectivamente. Longitud total del esófago 9.6 – 11.2 mm, 

siendo la longitud de la parte muscular 596 – 605 μm. Longitud 

de la espícula izquierda 1004 – 1164 μm, con un ancho máximo 

de 100 – 121 μm. Longitud de la espícula derecha 459 – 498 

μm, con un ancho máximo de 61 – 68 μm. Cola 127 – 131 μm 

de longitud (Fig. 1). 

Hembras: Longitud total del cuerpo 198 – 248 mm, con un 

ancho máximo de 830 – 912 μm. Deiridios y anillo nervioso 

situado a 206 – 227 μm y 298 – 321 μm de la parte anterior, 

respectivamente. Longitud total del esófago 17.8 – 21.4 mm, 

siendo la longitud de la parte muscular 601 – 612 μm. La vulva 

se sitúa a 1598 – 1666 μm de la parte anterior. Cola 97 – 110 

μm de longitud. Huevos ovalados y larvados 53 – 55 μm de 

longitud por 32 – 35 μm de ancho. 

Discusión 

Según las características morfoanatómicas descritas en el 

presente estudio, y coincidiendo con las descripciones brindadas 

por Bain y Mawson (1981), se concluye que la especie 

corresponde a S. tendo. 

El presente hallazgo representa el primer registro de de S. 

tendo para el Perú. Por lo tanto, es muy probable asumir que 

este nematodo haya sido introducido al Perú, debido a que ha 

sido registrada anteriormente parasitando halcones del género 

Falco sp. de Australia, Francia y otras partes del viejo mundo 

(Bain y Vassiliades 1969, Bain y Mawson 1981, Samour y Naldo 

2001, Green et al. 2006). 

Dentro de las especies de Serratospiculum tenemos a S. thoracis 

Tubangui, 1934 y S. lii Ezzat & Tadros, 1958, probables 

“species inquirenda” (Bain y Mawson 1981). Estas especies han 

sido registradas para Falco ernesti en Filipinas y Falco peregrinus 

del Congo Belga (Tubangui 1934, Ezzat y Tadros 1958). Bain 

y Mawson (1981) al realizar una re-descripción de S. tendo, 

observaron que las medidas de los especímenes estudiados eran 

muy semejantes a las medidas mencionadas para S. thoracis y S. 

lii, y concluyen que estas especies podrían ser sinónimas. 


Los hallazgos de especies de Serratospiculum se deben generalmente 

a hallazgos accidentales en necropsias de aves (Cooper 

1969). Sin embargo, existen varios reportes sobre casos clínicos 

de serratospiculosis en aves rapaces en cautiverio y silvestres de 

diversas ciudades del mundo (Bigland et al. 1964, Green et al. 

2006, Tarello 2006, Al-Timimi et al. 2009). La infección por 

este parasito está asociada directamente con la carga parasitaria, 

siendo las lesiones principales aerosaculitis, neumonía, infecciones 

secundarias y muerte del ave (Samour y Naldo 2001). En 

nuestro estudio, no se descarta que la muerte del animal pudiera 

deberse a la infección ocasionada por S. tendo. 

Los casos sobre serratospiculosis en halcones peregrinos documentadas 

para el continente Americano, se deben principalmente 

a Serratospiculum amaculata (Mawson 1957, Bigland et 

al. 1964, Cooper 1969, Ward y Fairchild 1972). Las diferencias 

morfológicas de esta especie con S. tendo se da en el tamaño del 

cuerpo y las espículas, principalmente (Tabla 1). 

Será necesario realizar futuros estudios que indiquen la situación 

actual de la serratospiculosis en aves falconiformes del Perú. 


Al-Timimi F., P. Nolosco & B. Al-Timimi. 2009. Incidence and treatment 

of serratospiculosis in falcons from Saudi Arabia. Veterinary 

Record 165: 408-409. doi:10.1136/vr.165.14.408 

Anderson R.C. 2000. Nematode parasites of vertebrates: Their development 

and transmission, 2nd ed. CABI Publishing, 

Wallingford, Oxon (UK), 650 p. 

Anderson R.C., A.G. Chabaud & S. Willmott. 2009. Keys to 

the nematode parasites of vertebrates. Archival volume. 

CAB International, Oxfordshire, UK, 463 p. doi: 

10.1186/1756-3305-2-42 

Bain O. & G. Vassiliades. 1969. Cycle évolutif d’un Dicheilonematinae, 

Serratospiculum tendo, Filaire parasite du faucon. Annales 

de Parasitologie Humaine et Comparée 44: 595-604. 

Bain O. & M. Mawson. 1981. Oviparous filarial nematodes mainly 

from Australian birds. Records of The South Australian 

Museum (Adelaide) 18: 265-284. 

Bigland C.H., S.K. Liu & M.R. Perry. 1964. Five Cases of Serratospiculum 

amaculata (Nematoda: Filarioidea) Infection in 

Prairie Falcons (Falco mexicanus). Avian Dis. 8: 412-419. 

Cooper J.E. 1969. Some diseases of birds of prey. Veterinary Record 

84: 454-457. doi:10.1136/vr.84.18.454 

Ezzai M.A.E. & G. Tadros. 1958. Contribution to the helminth fauna 

of Belgian Congo birds. Ann. Mus. hist. nat. Belgique. 

Serie in 8°, 69: 1-81. 

Green C.H., B.D. Gartrell & W.A. Charleston. 2006. Serratospiculosis 

in a New Zealand Falcon (Falco novaeseelandiae). 

New Zealand Veterinary Journal 54(4): 198-201. 

DOI:10.1080/00480169.2006.36696 

Lopez-Neyra C.R. 1956. Revisión de la superfamilia Filarioidea 

(Weinland, 1858). Rev. Iber. Parasitol. 16: 3-212. 

Mawson P.M. 1957. Filariid nematodes from Canadian birds. Canadian 

Journal of Zoology. 35: 213-219. doi: 10.1139/ 

z57-018 

Samour, J.H. & J.N. Naldo. 2001. Serratospiculiasis in captive 

falcons in the Middle East: a review. Journal of Avian 

Medicine and Surgery 15(1): 2–9. doi: http://dx.doi. 

org/10.1647/1082-6742(2001)015[0002:SICFIT]2.0. 

CO;2 

Skrjabin K.I. 1991. Key to parasitic nematodes, Vol. 1: Spirurata and 

Filariata. E.J. Brill, Leiden, New York, New York, 497 p. 

113

Gomez-Puerta et al. 

Tarello W. 2006. Serratospiculosis in falcons from Kuwait: incidence, 

pathogenicity and treatment with melarsomine and ivermectin. 

Parasite. 13: 59-63. http://dx.doi.org/10.1051/ 

parasite/2006131059 

Tubangui M.A. 1934. Nematodes in the collection of the Philippine 

Bureau of Science, II: Filarioidea. Philippine Journal of 

Science 55(2): 115-124. 

Vicente J.J., H.O. Rodrigues, D.C. Gomez & R.M. Pinto. 1995. 

Nematóides do Brasil. Parte IV: Nematóides de aves. Revista 

Brasileira de Zoologia 12 (Supl. 1): 1 – 273. http://dx.doi. 

org/10.1590/S0101-81751995000500001 

Ward F.P. & D.G. Fairchild. 1972. Air sac parasites of the genus Serratospiculum 

in falcons. Journal of Wildlife Diseases 8(2): 165- 

168. doi: http://dx.doi.org/10.7589/0090-3558-8.2.165 

Wehr E.E. 1938. New genera and species of the nematode superfamilia 

Filarioidea I. Serratospiculum amaculata n. sp. Proceedings 

of the Helminthological Society of Washington 5(2): 59-60. 

114 


Colofón 

115

Suscripciones y Canje 

Subscriptions and Exchange programs 

La Revista Peruana de Biología es publicada en abril. agosto y diciembre y esta dedicada a la publicación de los resultados de 

investigaciones originales e inéditas en las áreas de Biodiversidad, Biotecnología, Manejo ambiental, Ecología y Biomédicas. Los 

trabajos recibidos son evaluados por árbitros según criterios internacionales de calidad, creatividad, originalidad y contribución al 

conocimiento. 

The Revista Peruana de Biología is published in April, August and December, the aims is to disseminate the results of original 

research in Biodiversity, Biotechnology, Environmental management, Ecology and Biomedical areas. Papers in Spanish or English are 

peer-reviewed using international criteria of quality, creativity, originality and the knowledge contribution. 


Suscripción anual, costo incluye envío. 

Annual subscription, mailing is included. 

Perú 300 nuevos soles 

Other countries US$ 250 

Nombre/name:…………………………………………………………….. 

Dirección postal/Full postal address: …………………………………………… 

………………………………………………………………………………… 

………………………………………………………………………………… 

………………………………………………………………………………… 

………………………………………………………………………………… 

Favor de extender Cheque certificado u orden de pago a nombre de la Facultad de Ciencias Biológicas-UNMSM. 

Please make check or money order payable to Facultad de Ciencias Biológicas-UNMSM. 

Enviar a: 

Send to: 

Leonardo Romero 

Editor, Revista Peruana de Biología 

Facultad de Ciencias Biológicas-UNMSM 

Casilla Postal: 11-0058 

Lima-11, 

Perú 

Mayor información dirigirse a: 

For futher information contact: 

Editor Jefe, Leonardo Romero 

Teléfono (511) 619-7000-1502/ Telefax (511) 619-7000-1509 

email: editor.revperubiol@gmail.com 

116

PAUTAS PARA LA PRESENTACIóN DE TRABAJOS A LA REVISTA PERUANA DE BIOLOGíA 

Mayo 2014 

Identidad y propósito 

La Revista Peruana de Biología es una publicación científica arbitrada producida por el Instituto de Investigaciones 

de Ciencias Biológicas Antonio Raimondi, Facultad de Ciencias Biológicas, Universidad Nacional Mayor de San Marcos, 

Lima, Perú; es publicada tres veces al año y los números aparecen en abril, agosto y diciembre, tanto en su versión impresa 

como online. 

La Revista Peruana de Biología publica artículos completos, originales e inéditos que contribuyan al conocimiento 

científico en los temas de biodiversidad, biotecnología, ecología, manejo ambiental y biomedicina elaborados según 

las normas indicadas en las presentes pautas. 

Evaluación de los trabajos 

Los trabajos que cumplan con las pautas solicitadas serán incluidos en el la lista para evaluación. Un editor será encargado 

de conducir el proceso enviando el trabajo a árbitros. El trabajo será evaluado según criterios internacionales de 

calidad, creatividad, originalidad y contribución al conocimiento. El artículo será aceptado luego del proceso de revisión 

por árbitros y de realizadas las modificaciones indicadas. El artículo aceptado será editado y una prueba enviada 

al autor para la aceptación y consentimiento de publicación. 

Sumisión para edición y Licencia de uso 

1. Consideraciones sobre la edición 

El envío del trabajo a la Revista Peruana de Biología, implica el consentimiento de los autores para la revisión por 

pares, la corrección, la edición y posteriormente el consentimiento de la publicación del trabajo tal como se presentará 

después de la Prueba Final del trabajo. 

Los autores reconocen que la Revista Peruana de Biología se adhiere a la política de acceso abierto dando inmediato 

acceso libre a su contenido bajo el principio de: hacer disponible gratuitamente la investigación al público fomenta 

un mayor intercambio de conocimiento global. 

Todos los autores garantizan la calidad del trabajo mediante una carta de presentación, la carta será considerada 

una declaración jurada y debe afirmar que: 

a. Garantizan que han leído las pautas de presentación y entendido los requerimientos legales y éticos que se mencionan 

en las PAUTAS PARA PRESENTACIÓN DE TRABAJOS. 

b. Garantizan que todos los datos contenidos son exactos y todos los hechos declarados proceden de observaciones 

o investigaciones realizadas por los autores. 

c. Garantizan la autoría de todos los nominados en el trabajo y su participación de manera relevante en el diseño, 

ejecución y análisis y se responsabilizan por el trabajo publicado. 

d. Garantizan que el trabajo presentado no presenta problemas de competencia en los resultados o conclusiones 

vertidas. 

e. Garantizan que el manuscrito enviado, nunca ha sido publicado en su totalidad o en parte, en el idioma presentado 

o en cualquier otro idioma, y no se encuentra sometido otra revista. 

f. Los autores garantizan que no infringieron leyes ni normas éticas o bioéticas nacionales ni internacionales en la 

elaboración del artículo. 

g. Esta carta debe ser enviada por cada uno de los autores, por email debidamente firmada. 

2. Entendimientos sobre la licencia de uso 

Entrando en vigencia en el momento de su consentimiento para publicación, los autores convienen que el artículo 

será publicado por la Revista Peruana de Biología, en medio impreso y digital, además de ser adaptado a sistemas 

informáticos que amplíen su visibilidad y difusión, incluyendo su reproducción o publicación en formatos aptos para 

ser leídos por máquinas y su incorporación en sistemas de recuperación y bases de datos bibliográficos. 

Los autores, en conocimiento que la Revista Peruana de Biología tiene una política de Acceso Abierto (Open Access) 

aceptan las condiciones de la LICENCIA Creative Commons Attribution-Non Commercial-Share Alike 4.0 

International (CC BY-NC-SA 4.0) [http://creativecommons.org/licenses/by-nc-sa/4.0/] que permite copiar, distribuir 

y comunicar públicamente la obra. Esta Licencia será colocada en toda forma y medio en los cuales el artículo se 

publique por la Revista Peruana de Biología. 

Todas las copias de los artículos de la Revista Peruana de Biología, en papel o digitales, o cualquier otro uso 

de la información deberán incluir una cita de la fuentes de publicación en su totalidad. 

Una vez terminado el proceso de edición, el Editor Jefe de la Revista Peruana de Biología enviará a los autores una 

Prueba Final del trabajo en formato PDF, para su revisión final; deberán efectuar los cambios pertinentes, corregirán 

117

los errores de impresión y una vez subsanados los errores el autor enviara la carta de consentimiento para publicación 

del artículo, en la cual: acepta la publicación del trabajo en la Revista Peruana de Biología y está de acuerdo con la 

LICENCIA de uso. 

3. Los autores retienen sus derechos como: 

a. Los derechos de marca y patente y derechos sobre cualquier proceso o procedimiento descrito en el artículo. 

b. El derecho de compartir, copiar, distribuir (v.g.: en sus repositorios institucinales), ejecutar y comunicar públicamente 

la obra. 

c. El derecho posterior a la publicación, de utilizar el artículo o cualquier parte de aquel, en una compilación impresa 

de sus propios trabajos, como ser una selección de escritos o notas para conferencias, en una tesis, o para ampliar 

el artículo a formato de libro para publicación, siempre que se haga cita de las fuentes de la publicación en su totalidad. 

Cartas de presentación 

Las coordinaciones se llevaran entre el Editor Jefe y el responsable del trabajo. 

El trabajo será acompañado de una carta del responsable y dirigido al Editor Jefe, indicando haber leído las presentes 

Pautas para Presentación de Trabajos; asegurando la originalidad, carácter inédito y completo del trabajo presentado 

y su disposición para que sea revisado y editado. Esta carta tendrá carácter de declaración jurada según lo estipulan 

las directivas del Vicerrectorado de Investigación de la Universidad Nacional Mayor de San Marcos referidos a las 

autorías de trabajos publicados. 

Cada autor del trabajo deberá de enviar por correo electrónico una Carta de Presentación del trabajo dando las garantías 

mencionadas anteriormente. 

Presentación de los trabajos 

Los archivos del trabajo serán enviados por correo electrónico al editor: editor.revperubiol@gmail.com 

Los trabajos pueden ser presentados en idioma inglés o castellano. 

Los autores deben asegurarse que las ecuaciones matemáticas sean editables, no imágenes. 

El trabajo debe tener tres partes básicas: (a) identificación, (b) cuerpo y (c) literatura citada 

(a) La identificación debe contener obligatoriamente todos los siguientes items: 

• Título (en inglés y castellano), escrito en altas y bajas, con una longitud no mayor a 150 caracteres, incluidos 

espacios. 

• Nombre y apellido del autor o los autores. 

• Afiliación institucional de los autores, dirección postal de la institución, correo electrónico de cada uno 

de los autores, e indicar la dirección postal del autor para correspondencia. 

• Resumen no mayor de 250 palabras (en inglés y castellano), 

• Palabras clave, cinco (en inglés y castellano). 

• Información adicional, debe contener: 

• Información sobre la contribución de cada uno de los autores en el trabajo presentado y una 

declaracion sobre en conflicto de intereses (). 

• Fuente de financiamiento. Debe indicarse la fuente de financiamiento del trabajo, e incluir el 

código o numero de referencia. 

• Agradecimientos. Deben dedicarse solamente a las personas e instituciones que colaboraron 

directamente en la realización del trabajo. 

(b) El cuerpo del trabajo. Variará según la sección de la Revista: 

Trabajos originales. Son artículos primarios, inéditos que exponen los resultados de trabajos de investigaciones 

completas y finales, y que constituyen aportes al conocimiento. Aquí también se incluyen las 

descripciones de especies nuevas, que cumplan con las Normas y características de la información en 

los trabajos (ver abajo). El cuerpo está organizado en: Introducción, Material y métodos, Resultados y 

discusión (Resultados, Discusión). Debe abarcar un texto promedio de 30 páginas, las ilustraciones (Tablas 

y Figuras) deben ser sólo las necesarias para una mejor exposición de los resultados. 

La introducción: proporciona el contexto y permite a los lectores que no son del campo comprender 

el propósito y la importancia del estudio. Define el problema abordado y por qué es importante. 

Presenta la literatura mas relevante sobre el problema. Señala las controversias o desacuerdos relevantes 

en el tema. Concluye con una declaración del objetivo general del trabajo y un comentario 

de los resultados y conclusión. 

118

Citas en el texto 

Material y métodos: debe proporcionar suficiente detalle como para permitir a otros investigadores 

replicar completamente su estudio. Los protocolos de los nuevos métodos deben ser incluidos en 

detalle. Si los materiales, métodos y protocolos están bien establecidos, los autores pueden citar 

artículos en los que esos protocolos se describen en detalle, pero la presentación deberán incluir 

información suficiente para ser entendido independiente de estas referencias. Protocolos detallados 

de los métodos nuevos o no muy conocidos pueden incluirse en Apéndices como información de 

apoyo. Las investigaciones con humanos, tejidos humanos, animales de laboratorio deben incluir 

declaraciones de los procedimientos de ética pertinentes y la aprobación de los comités de bioética. 

En los casos pertinentes, los trabajos con colectas deben declarar los permisos de las autoridades 

correspondientes. 

Resultados y discusión: Esta sección puede presentarse como dos secciones separadas, es decir una 

sobre Resultados y otra sobre Discusión. En general esta sección puede dividirse en subsecciones 

más especificas, según sea apropiado. El lenguaje debe ser claro y conciso. Esta sección debe discutir 

y contrastar los resultados, interpretarlos y mostrar las conclusiones que se pueden extraer. Los 

autores deben explicar cómo los resultados se refieren a la hipótesis presentada y proporcionar una 

explicación sucinta de las implicaciones de los resultados, y en particular establecer la relación con 

los estudios previos relacionados y posibles direcciones futuras para la investigación. 

Notas científicas. Son artículos primarios, se incluyen aquí: (a) Trabajos de interés taxonómico como reportes 

de distribución, inventarios taxonómicos, notas taxonómicas, con la información necesaria para cubrir los 

estándares de Darwin core. También se incluyen resultados de ensayos de laboratorio, cuya información es 

de interés para la comunidad científica. La extensión del texto no será mayor de 15 páginas. El cuerpo de la 

Nota puede estar organizada: Introducción, Material y métodos, Resultados y Discusión y Agradecimientos. 

Comentarios. Son artículos donde se discute y exponen temas o conceptos de interés para la comunidad científica. 

Se incluyen aquí ensayos de opinión y monografías. Deben contar con las siguientes partes: cuerpo 

del comentario y Agradecimientos. Todo el artículo debe tener un texto promedio de 10 páginas. 

Comentarios de Libros. Son artículos que comentan recientes publicaciones de interés para la comunidad 

científica. Puede solicitarse al Comité Editor la elaboración de un comentario enviando dos copias del libro 

a la dirección postal de la Revista Peruana de Biología. 

Las citas en el texto deben incluir el apellido del autor y año sin comas que los separen. Ejemplos: 

... (Carrillo 1988) o «... de acuerdo a Sánchez (1976) …» 

Cuando dos autores son citados en el texto se usa la conjunción “y”: 

…la concentración de nitrógeno fue medida según Rios y Castro (1998)…. 

Cuando son citados entre paréntesis se usa el símbolo “&”: 

…de nitrógeno se midió por el método colorimétrico (Rios & Castro 1998)…. 

Citas de varias referencias entre paréntesis, van separadas por comas, en secuencia de importancia: 

… la diversidad de especies es considerada elevada (Simoniz 1968, Perez 2012, Aquino 1988). 

Si hay varios trabajos de un autor en un mismo año, se citará con una letra en secuencia adosada al año, ejemplo: 

... Castro (1952a) ... (Rojas 2000a, 2003c) 

Autores institucionales (FAO, MINAM, etc.) se citan con sus siglas o iniciales y las fechas (por ejemplo: FAO 

2009, MINAM 2012), en las referencias se colocaran estas iniciales y en paréntesis el significado. 

Citas de leyes y normas: se citan indicando su categoría y el número. Por ejemplo: "tal como se indica en la Ley 

N.° 26821..." 

Cuando hay más de dos autores se citará al primer autor y se colocará “et al.” sin itálicas: (e.g. Smith et al. 1981) 

o “… según Smith et al. (1981)”). 

Citas directas o literales se deben hacer entre comillas dentro del texto cuando son menos de 40 palabras, idiomas 

diferentes al texto en itálicas, indicar página del extracto: 

… en cambio Robert Francis lo describe equivocadamente “con costillas radiales muy poco insinuadas cruzadas 

por estrías concéntricas de crecimiento muy finas lo que le da aspecto liso” (Francis 1971, p: 234). 

Citas directas o literales de más de 40 palabras, deben separarse del texto en un párrafo sangrado, ejemplo: 

… Accioly (2003), señala que: 

“In many animal groups, early sex identification has enormous biotechnological value 

and is related with management practices that increase production. Moreover, dimorphic 

characters are useful in the taxonomic and ecological aspects. The sexual dimorphism 

119

is associated with functional structures related to adaptation in this species … Subsequent 

researches based on these data will enable to estimate sexual differentiation 

during early ontogenetic phases subsidizing protocols to obtain monosex stocks with 

significant impact on commercial production” (p: 20). 

(c) La Literatura Citada incluirá todas las referencias citadas en el texto dispuestas solamente en orden alfabético y sin 

numeración. La cita se inicia con el apellido del primer autor a continuación, sin coma, las iniciales del nombre separadas 

con puntos y sin espacio. El segundo y tercer autor deben de tener las iniciales de los nombre y a continuación 

el apellido. El último autor se diferenciara por que le antecede el símbolo &. Si hubiesen más de tres autores pueden 

ser indicados con la abreviatura et al. 

Los nombres de las publicaciones periódicas (revistas) deben colocarse en extenso, no abreviadas. 

El código DOI debe ser colocado al final de la referencia, por ejemplo: 

• doi: http://dx.doi.org/10.1590/S1679-62252006000200004 [forma extendida] 

• doi:10.1111/j.2007.0906-7590.05171.x. [forma corta] 

En referencias electronicas que procedan de repositorios o paginas Web que no tengan identificadores persistentes 

(v.g.: Sistema Handle) debe de indicarse la fecha de acceso. 

Las normas legales peruanas deben de referirse a su version impresa publicada en las separatas de Normas Legales del 

Peruano. 

En la literatura citada solamente se usa letra tipo normal, no itálica, no versalita. Ejemplos: 

Andrén H., & H. Andren. 1994. Effects of Habitat Fragmentation on Birds and Mammals in Landscapes 

with Different Proportions of Suitable Habitat: A Review. Oikos 71(3):355-366. 

doi:10.2307/3545823. 

Dormann C., J.M. McPherson, M.B. Araújo, et al. 2007. Methods to Account for Spatial Autocorrelation 

in the Analysis of Species Distributional Data: a Review. Ecography 30(5):609–628. 

doi:10.1111/j.2007.0906-7590.05171.x. 

Lozano R., C. Merino y G. Orjeda. 2014. Identificación de genes relacionados a sequía en papas 

nativas empleando RNA-Seq. Revista Peruana de Biología 20(3):211-214. 

Buhrnheim C.M. & L.R. Malabarba. 2006. Redescription of the type species of Odontostilbe Cope, 

1870 (Teleostei: Characidae: Cheirodontinae), and description of three new species from 

the Amazon basin. Neotropical Ichthyology. 4 (2): 167-196. http://dx.doi.org/10.1590/ 

S1679-62252006000200004 

Laub B.G. & M.A. Palmer. 2009. Restoration Ecology of Rivers, in: G.E. Likens (Ed.), Encyclopedia 

of Inland Waters. Academic Press, Oxford, pp. 332–341. dx.doi.org/10.1016/B978- 

012370626-3.00247-7 

Rohde K. 2002. Ecology and biogeography of marine parasites, in: Advances in Marine Biology. 

Academic Press, pp. 1–83. dx.doi.org/10.1016/S0065-2881(02)43002-7, 

McLachlan A. & A.C Brown. 2006. The Ecology of Sandy Shores. Elsevier Science & Technology 

Books. 373pp. 

Crawford D.J. 1983. Phylogenetic and systematic inferences from electrophoretic studies. In: S.D. 

Tanksley and T.J. Orton, eds. Isozymes in Plant Genetics and Breeding, Part A. Elsevier, 

Amsterdam. Pp. 257-287. 

Pianka E.R. 1978. Evolutionary ecology. 2nd edn. New York: Harper & Row. 

Carroll S.B. 2005. Evolution at Two Levels: On Genes and Form». PLoS Biol 3 (7): e245. doi:10.1371/ 

journal.pbio.0030245. 

Ashe K. 2012. Elevated Mercury Concentrations in Humans of Madre de Dios, Peru. PLoS ONE 7 

(3): e33305. doi:10.1371/journal.pone.0033305. 

FDA (Food and Drug Administrations). 2001. Fish and Fishery Products Hazards and Controls Guidance. 

Third Edition June 2001. (Acceso 

24/12/07). 

CONAM. 2005. (en línea). Informe nacional del estado del ambiente 2001. . Acceso 31/07/2005. 

IMARPE. 2002. (en línea). Segundo informe del BIC José Olaya Balandra. Paita – Salaverry. 24 febrero- 

05 Marzo 2002. . 

Acceso 01/07/2005. 

Solari S.A. 2002. Sistemática de Thylamys (mammalia: didelphimorphia: marmosidae). Un estudio 

120

de las poblaciones asignadas a Thylamys elegans en Perú. Tesis, Magíster en Zoología, 

mención Sistemática y Evolución. Facultad de Ciencias Biológicas Universidad Nacional 

Mayor de San Marcos. [SISBIB, tesis] . Acceso 31/07/2005 

Sánchez G. 1988. Algunos aspectos bio-ecológicos del “Muy Muy” Emerita analoga (Stimpson, 

1857) (DECAPODA: ANOMURA) en playas al sur de Lima». Tesis para optar el grado 

de Doctor. Facultad de Ciencias Biológicas Universidad Nacional Mayor de San Marcos. 

[repositorio del IMARPE] http://localhost:8080/xmlui/handle/123456789/2247. 

Page R.A. 2008. Foraging Flexibility in the Frog-Eating Bat, Trachops Cirrhosus. Doctor of Philosophy 

Dissertation. Faculty of the Graduate School of The University of Texas at Austin. 

http://repositories.lib.utexas.edu/handle/2152/17996. 

Reyes C.A. 2003. Potencial antibacteriano de extractos etanólicos de macroalgas marinas de la costa 

central del Perú. Tesis para el grado de Bachiller en Ciencias Biológicas. Facultad de Ciencias 

Biológicas Universidad Nacional Mayor de San Marcos. http://cybertesis.unmsm.edu. 

pe/handle/cybertesis/1422. 

Cowan J. 2014. The Role of the Thymic Medulla in T Cell Development and Tolerance Induction. 

Ph.D. thesis. College of Medical and Dental Sciences, University of Birmingham. http:// 

etheses.bham.ac.uk/5066/. (Acceso 27/01/2014) 

Ley N°. 26821. 1997. Ley orgánica para el aprovechamiento sostenible de los recursos naturales. 

Compendio de la legislación ambiental peruana. Volumen I. Marco normativo general. Ministerio 

del Ambiente –MINAM, Editado por la Dirección General de Políticas, Normas e 

Instrumentos de Gestión Ambiental del Ministerio del Ambiente. Actualizado al 30 de junio 

de 2010. pp: 85-91 

DS N°. 012-2001-PE. 2001. Aprueban el Reglamento de la Ley General de Pesca, Ministerio de la 

Producción. 13 de marzo de 2001. El Peruano Normal Legales: 199905-199921. 

DS N° .179-2004-EF. 2004. Texto único ordenado de la ley del impuesto a la renta. 08 de diciembre 

de 2004. El Peruano Normas Legales: 281912-281940 

Las citas de artículos en prensa deben incluir el volumen, el año, el nombre de la revista y el DOI respectivo; de lo 

contrario deberán ser omitidos. 

No se deben citar resúmenes de eventos académicos (congresos y otros). 

No se debe citar literatura gris. 

Normas y características de la información en los trabajos 

La Revista Peruana de Biología se guía de los conceptos éticos (códigos de conducta ) 

y buenas prácticas () de publicación mencionados 

en los lineamientos del Committee on Publication Ethics (COPE - http://publicationethics.org/). Respecto de 

la autoria, la Revista Peruana de Biología asume la veracidad de la carta de presentación y de la carta de consentimiento 

de publicación. 

Cuando el artículo exponga sobre experimentos con humanos y animales, los procedimientos deben de ceñirse a la 

Declaración de Helsinki de 1975 y a las leyes peruanas vigentes (Ley 27265). Deben ser presentadas las declaraciones 

pertinentes y mencionadas explicitamente en el texto. 

Cuando el artículo exponga sobre nuevas especies, nuevos registros, ampliaciones biogeográficas o inventarios taxonómicos 

debe tomarse en cuenta la información requerida en el Darwin Core. También debe indicarse el depósito de 

los ejemplares en una institución taxonómica reconocida, comprometida en la preservación del material, que permita 

el libre acceso al material, publique constantemente la relación del material que posee en custodia y que brinde la 

información necesaria sobre los ejemplares cuando sea requerido. No son consideradas las colecciones particulares. 

Los nombres científicos del género y especie irán en cursivas. La primera vez que se cita un organismo deberá hacerse 

con su nombre científico completo (género, especie y autor); posteriormente podrá citarse solamente la inicial del 

nombre genérico y el nombre específico completo. Para el caso de las abreviaturas de autores en nombres botánicos 

pueden referirse al International Plant Names Index (IPNI - http://www.ipni.org/), la base de datos TROPICOS (http:// 

www.tropicos.org/) y AlgaeBase (http://www.algaebase.org/). 

Las localidades y puntos de colecta deben ser referenciadas geográficamente, usando coordenadas cartesianas sexagesimales, 

tanto en el texto como en las ilustraciones. 

Deben usarse los símbolos de las unidades del Sistema Internacional de Medidas. Si fuera necesario agregar medidas en 

otros sistemas, las abreviaturas correspondientes deben ser definidas en el texto. 

Debe usarse el punto decimal (ejemplo correcto: 0.5; incorrecto: 0,5). Las cifras deben mantenerse juntas (ejemplo 

correcto: 1994, 30302; incorrecto: 1,994; 30 302). 

121

Ilustraciones 

Las ilustraciones deben ser creación de los autores, en caso contrario deben indicar los permisos necesarios, procedencia 

y créditos. 

Las Figuras (mapas, esquemas, diagramas, dibujos, gráficos, fotos, etc.) serán numeradas correlativamente con números 

arábigos; de igual manera las Tablas. 

Las leyendas de las Figuras y Tablas deben presentarse a continuación del texto y ser suficientemente explicativas, y 

con toda la información necesaria para que se puedan entenderse independientemente del texto. 

Las fotos y dibujos escaneados deben guardarse en archivos TIFF, tamaño del original a 300 dpi. 

Los gráficos estadísticos y diagramas deben de enviarse en formato nativo editable (achivo.xls, archivo.svg, archivo. 

eps), no como imágenes (JPGE, TIFF, PNG). 

Los mapas pueden enviarse en formatos vectoriales (v.g.: Ai, EPS) o imágenes de alta resolución (300 dpi). 

Pueden enviar las fotos de cámaras digitales mayor a 3 Mpixel en su formato de salida. 

Otros archivos de imágenes en TIFF, BMP, JPGE de alta resolución y tamaño, y figuras vectoriales en Ai, EPS. 

Formatos procedentes de software como R, en formatos editables de PDF, EPS (Postscript). 

Costos por ilustraciones a color serán asumidos por el autor. 

Presentación de los archivos 

Los archivos deben presentarse por separado, esto es: 

• Un archivo con el texto y al final leyendas en formato MS-Word. 

• Otro archivo con las tablas en MS-Excel o como tablas en MS-Word. 

• Otros archivos en formatos nativos, NO como imágenes insertadas NI pegadas en una hoja de MS-Word o 

Excel. 

Consentimiento de publicación 

El autor responsable recibirá una prueba del trabajo en formato PDF, el cual deberá revisarlo cuidadosamente, y consultarlo 

con los otros autores. Una vez solucionados errores de edición, el autor responsable enviará una carta o email confirmando 

que el trabajo fue revisado por todos los autores y están conformes, y mencionar explícitamente su consentimiento para la 

publicación del trabajo como artículos de la Revista Peruana de Biología y están de acuerdo con la LICENCIA de uso. 

Este es un requisito para la publicación del trabajo. Con la prueba, el autor responsable recibirá el costo por publicación en 

los casos que corresponda. 

Costo por publicación y ejemplares para el autor responsable 

Si los trabajos no incluyen ilustraciones a color, la Revista Peruana de Biología no realizará ningún cobro. El costo 

por publicación de láminas a color es aproximadamente de 90 US dólar, el total de láminas a color en un artículo es 

determinado al final de la diagramación del artículo. 

Los pagos se realizan en las oficinas de Economía la Facultad de Ciencias Biológicas de la Universidad Nacional Mayor 

de San Marcos, o en coordinación con el Editor Jefe. La Revista Peruana de Biología no cuenta con presupuesto 

para envíos de correo a los autores. El autor responsable podrá solicitar cuatro ejemplares de cortesía de la revista en 

las oficinas de la Facultad de Ciencias Biológicas de la Universidad Nacional Mayor de San Marcos. 

Comité Editor 

Email: editor.revperubiol@gmail.com 

Correo postal: 

Leonardo Romero (Editor Jefe) 


UNMSM-FCB 

Apartado 11-0058 

Lima 11, Perú 

122


Rev. peru. biol. ISSN-L 1561-0837 



CONTENIDO 

3 Revision of the South American wasp genus Alophophion Cushman, 1947 (Hymenoptera: Ichneumonidae: Ophioninae) 

Revisión del genero de avipas sudamericanas Alophophion Cushman, 1947 (Hymenoptera: Ichneumonidae: Ophioninae) 

Mabel Alvarado 

61 Dieta de Leopardus colocolo (Carnivora: Felidae) en la Reserva Nacional de Junín, Junín, Perú 


Ursula Fajardo, Daniel Cossíos y Víctor Pacheco 

71 Estado del zorro gris Lycalopex griseus (Gray, 1837) (Mammalia: Canidae) en el Perú 



79 Análisis morfológico del sistema reproductor e identificación molecular a través de los marcadores mitocondriales COI y 16S 

rRNA de Megalobulimus oblongus (Mollusca, Strophocheilidae) de Colombia 

Morphological analysis of the reproductive system and molecular identification by mitochondrial markers COI and 16S rRNA of 

Megalobulimus oblongus (Mollusca, Strophocheilidae) of Colombia 

Erika Jaramillo Roldán, Jessika López Martínez, Rina Ramírez, Luz Elena Velásquez Trujillo 

89 Caracterización molecular de la región determinante de resistencia a quinolonas (QRDR) de la topoisomerasa IV de Bartonella 

bacilliformis en aislados clínicos 

Molecular characterization of quinolones resistance determining region (QRDR) of Bartonella bacilliformis topoisomerasa IV 

in clinical isolates 

Abraham Espinoza-Culupú, Ruth Quispe-Gaspar, Michael Jaramillo, Melisa Icho, Anika Eca, Pablo Ramírez, Débora 

Alvarado, Juan Carlos Guerrero, Franklin Vargas-Vásquez, Ofelia Córdova, Ruth García-de-la-Guarda 

99 Patrones de coocurrencia y conducta alimentaria a escala local de Phlebotominae (Diptera: Psychodidae) del estado Falcón, 

Venezuela 

Co-ocurrence patterns and feeding behaviour at local scale of Phlebotominae(Diptera: Psychodidae) from Falcon state, Venzuela 

Dalmiro J. Cazorla, Elsa Nieves y Pedro Morales 


105 Nueva especie de Hesperiidae (Lepidoptera) para Perú: Dalla granites (Mabille, 1898) 


José Alfredo Cerdeña, Erick Huamaní, Rómulo Delgado y Gerardo Lamas 

109 Two new butterfly records for Peru: Orophila cardases cardases and Pedaliodes garlaczi (Lepidoptera: Nymphalidae) 

Dos nuevos registros de mariposas para Perú: Orophila cardases cardases y Pedaliodes garlaczi (Lepidoptera: Nymphalidae) 


111 Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae) para el Perú 


Luis A. Gomez-Puerta, Pedro A. Ospina, Mercy G. Ramirez, Nelly G. Cribillero

Revista Peruana Biología v21n1

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?