Transcriptómica - FBMC
Transcriptómica - FBMC
Transcriptómica - FBMC
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
El paradigma pre-genómico<br />
…codifican<br />
proteínas...<br />
>protein kunase<br />
acctgttgatggcgacagggactgtatgctgatct<br />
atgctgatgcatgcatgctgactactgatgtgggg<br />
gctattgacttgatgtctatc....<br />
Genes en el<br />
DNA...<br />
…cuya estructura<br />
influye en la función...<br />
Del genotipo al<br />
fenotipo<br />
…producen el<br />
fenotipo final<br />
…además el<br />
ambiente...