Annual Report 2011 - Indian Agricultural Research Institute

Annual Report
2011-12
Indian Agricultural Research Institute
(Indian Council of Agricultural Research)
New Delhi-110 012
ISSN 0972-6136

(Deemed University)
Indian Agricultural Research Institute
New Delhi - 110 012

Printed : July, 2012
Supervision and Guidance
H.S. Gupta
Director
Malavika Dadlani
Joint Director (Research)
Compilation Committee and Publication Team
A.K. Singh, T.K. Behera, R.K. Rattan, Rashmi Aggarwal, C. Vishwanathan
V.C. Mathur, K.M. Manjaiah, R.L. Sapra, Kehar Singh and D.K. Parashar
Correct citation : IARI. Annual Report 2011-12, Indian Agricultural Research Institute,
Copies printed : 1500
ISSN 0972-6136
IARI website : www.iari.res.in
New Delhi - 110 012, India.
Published by the Director, Indian Agricultural Research Institute, New Delhi - 110 012, India, and printed at Venus Printers and Publishers,
B-62/8, Naraina Indl. Area, Phase-II, New Delhi, Ph.: 45576780, 9810089097, E-mail: pawannanda@gmail.com

PREFACE
The Indian Agricultural Research Institute was the harbinger of India’s ‘Green Revolution’ and continues its
efforts to bring Evergreen Revolution for sustainable food security and alleviation of malnutrition in the
country. During this year, the institute has developed new crop varieties and technologies to enhance the
productivity and profitability, resource use efficiency, environmental sustainability, and climate resilience in
agriculture.
A number of crop varieties were developed with enhanced productivity, quality, and resistance to biotic and
abiotic stresses. Two new basmati rice genotypes, namely, Pusa 1509-03-1-7-2 and Pusa 1509-03-3-9-5 superior to
Pusa 1121 are in the final year of evaluation. A high yielding bread wheat variety Pusa Chaitanya (HD 3043) with
stripe and leaf rusts resistance was released for cultivation under restricted irrigated conditions of North
Western Plains Zone. In addition, three new wheat varieties HI 1572, HI 8704 and HS 514 have been identified
for cultivation in different agro-climatic zones. Two extra bold chickpea varieties Pusa 5023 (Kabuli) and Pusa
5028 (the first extra bold desi type) have been developed for release in the NCR. In mustard, variety, Pusa
Mustard 28 with seedling stage heat tolerance was released for September sowing as an additional crop between
kharif and rabi. In soybean, YMV, Rhizoctonia blight and bacterial pustule resistant and bold seeded variety Pusa
12 was identified for Northern Plains Zone. In vegetables, an onion variety, Sel 126, a cauliflower variety Pusa
Shukti, a ridge gourd variety Pusa Nutan and the first heat stress tolerant carrot variety Pusa Vristi were
released during this year.
Several genetic stocks possessing unique traits have been identified, characterized and developed in crops,
microbes and insects. QTLs for grain number and quality in rice; leaf rust resistance in wheat; grain quality in
maize; fertility restoration in pigeonpea; black rot resistance in cauliflower; and ToLCNDV resistance in tomato
and sponge gourd were mapped. Novel techniques for diagnostics and management of crop pests, eco-friendly
technologies for conservation agriculture, crops and resources management were developed. Significant
achievements have been made in developing remote sensing and GIS-based methods for assessing and
managing crops and resources. New farm machineries, namely, aqua-ferti-seed drill for chickpea, mechanical
hydrogel applicator, mechanical carrot planter, semi-automatic and automatic metering system for garlic
cloves, high capacity Pusa compost sieving machine and basmati rice thresher were developed.
The Institute also made significant contribution by providing excellent human resource to NARS and
CGIAR system, and continuing its leadership role in agricultural education. The Golden Jubilee Convocation of
the Institute was held on February 20, 2012 with the Hon’ble Prime Minister of India, Dr. Manmohan Singh as
the chief guest who was conferred with the D.Sc. (Honoris Causa) degree. During this year, the Institute received
the prestigious “Sardar Patel Outstanding ICAR Institution Award” for the year 2010 for its outstanding
contribution to agriculture, in addition to several awards and recognitions received by the scientists and
students. The Institute made a special effort during this year to develop technologies and strategies for
increasing the profitability and livelihood security of the small farmers and transfer these to the farmers
through its extension programmes across the country in partnership with a number of SAUs, NGOs and other
ICAR institutions.
The report was compiled by a multidisciplinary team of the scientists under the guidance of Dr. Malavika
Dadlani, Joint Director (Research). I express my appreciation to this team for bringing out this report.
July 5, 2012 (H.S. Gupta)
New Delhi Director

Preface
IARI: An Introduction
Executive Summary
1. Crop Improvement
2. Genetic Resources
3. Crop and Resource Management and Environment
4. Crop Protection
5. Basic and Strategic Research
CONTENTS
1.1 Cereals 9
1.2 Millet 12
1.3 Grain legumes 12
1.4 Oilseed crops 13
1.5 Fibre crop 14
1.6 Vegetable crops 15
1.7 Fruit crops 20
1.8 Ornamental crops 21
1.9 Seed science and technology 23
2.1 Crop genetic resources 27
2.2 Biosystematics and identification services 33
3.1 Agronomy 36
3.2 Soil management 40
3.3 Water management 43
3.4 Integrated nutrient management 46
3.5 Nutrient management 49
3.6 Orchard management 49
3.7 Protected cultivation technology 50
3.8 Agricultural engineering 55
3.9 Rice-wheat cropping system 59
3.10 Post-harvest technology and management 60
3.11 Microbiology 64
3.12 Environment science and climate resilient agriculture 70
4.1 Plant pathology 75
4.2 Entomology 80
4.3 Nematology 84
4.4 Agricultural chemicals 85
4.5 Weed management 90
5.1 Plant biotechnology 93
5.2 Biochemistry 96
1
3
9
27
36
75
93

5.3 Plant physiology 97
5.4 Genetics 100
5.5 Agricultural physics, remote sensing and GIS 103
6. Social Sciences and Technology Transfer
6.1 Agricultural economics 106
6.2 Agricultural extension 111
6.3 Technology assessment and transfer 116
7. Empowerment of Women and Mainstreaming of Gender Issues
7.1 Capacity building of self help groups for gender empowerment 130
7.2 Impact of SHGs on women empowerment 131
8. Post-Graduate Education and Information System
8.1 Post-graduate education 132
8.2 Information and database 139
8.3 Library services 140
9. Publications
9.1 Research/symposia papers 141
9.2 Books/chapters in books 141
9.3 Popular articles 141
9.4 Inhouse publications 141
10. Commercialization and IPR Activities
10.1 Intellectual property rights 143
10.2 Technology commercialized 145
10.3 Other activities 147
11. Linkages and Collaboration
12. Awards and Recognitions
13. Budget Estimates
14. Staff Position
15. Miscellany
Appendices
Appendix 1: Members of Board of Management of IARI
Appendix 2: Members of Research Advisory Committee of IARI
Appendix 3: Members of Academic Council of IARI
Appendix 4: Members of Extension Council of IARI
Appendix 5: Members of Staff Research Council of IARI
Appendix 6: Members of the Executive Council of IARI
Appendix 7: Members of Institute Joint Staff Council (IJSC)
Appendix 8: Members of Grievance Committee of IARI
Appendix 9: Personnel
106
130
132
141
143
149
150
153
155
156

Originally established in 1905 at Pusa (Bihar) with
the financial assistance of an American Philanthropist, Mr.
Henry Phipps, the Indian Agricultural Research Institute
(IARI) started functioning from New Delhi since 1936
when it was shifted to its present site after a major
earthquake damaged the Institute’s building at Pusa
(Bihar). The Institute’s popular name ‘Pusa Institute’ traces
its origin to the establishment of the Institute at Pusa.
The Indian Agricultural Research Institute is the
country’s premier national Institute for agricultural
research, education and extension. It has the status of a
‘Deemed-to-be-University’ under the UGC Act of 1956,
and awards M.Sc. and Ph.D. degrees in various
agricultural disciplines.
The growth of India’s agriculture during the past
more than 100 years, is closely linked with the researches
done and technologies generated by the Institute. The
Green Revolution stemmed from the fields of IARI.
Development of high yielding varieties of all major crops
which occupy vast areas throughout the country,
generation and standardization of their production
techniques, integrated pest management and integrated
soil-water-nutrient management have been the hallmarks
of the Institute’s research. The Institute has researched and
developed a large number of agrochemicals which have
been patented and licensed and are being widely used in
the country. Over the years, IARI has excelled as a centre
of higher education and training in agricultural sciences
at national and international levels.
The mandates of the Institute are as follows:
● To conduct basic and strategic research with a view
to understanding the processes, in all their
complexity, and to undertake need based research,
that lead to crop improvement and sustained
agricultural productivity in harmony with the
environment
● To serve as a centre for academic excellence in the
area of post-graduate and human resources
development in agricultural sciences
IARI : AN INTRODUCTION
1
● To provide national leadership in agricultural
research, extension, and technology assessment and
transfer by developing new concepts and approaches
and serving as a national referral point for quality
and standards
● To develop information systems, add value to
information, share the information nationally and
internationally, and serve as a national agricultural
library and database
The present campus of the Institute is a self-contained
sylvan complex spread over an area of about 500 hectares.
It is located about 8 km west of New Delhi Railway Station,
about 7 km west of Krishi Bhavan, which houses the
Indian Council of Agricultural Research (ICAR), and
about 16 km east of Indira Gandhi International Airport
at Palam. The location stands at 28.08 o N and 77.12 o E, the
height above mean sea level being 228.61m. The climate
is sub-temperate and semi-arid. The mean maximum daily
temperature during the hot weather (May-October) ranges
from 32.2 o C to 40 o C and the mean minimum temperature
from 12.2 o C to 27.5 o C. June to September are rainy months
during which about 500 mm of rainfall is received. Winter
sets in from mid-November and is delightful. The mean
maximum temperature during winter (November-March)
ranges from 20.1 o C to 29.1 o C and the mean minimum
temperature from 5.6 o C to 12.7 o C. During winter, a small
amount of rainfall (about 63 mm) is received.
The Institute has 19 divisions, 2 multi-disciplinary
centres situated in Delhi, 8 regional stations, 2 off-season
nurseries, one krishi vigyan kendra at Shikohpur, 2 all
India coordinated research projects with headquarters at
IARI, and 16 national centres functioning under the all
India coordinated research projects. It has a sanctioned
staff strength of 3073 comprising scientific, technical,
administrative and supporting personnel. The revised
budget estimates of the Institute constituted a total
amount of ` 30323.98 lakh (Plan & Non-Plan) for the year
2011-12.

Registrar &
Jt. Director
(Admn.)
Comptroller
Priortisation,
Monitoring &
Evaluation Cell
ITMU
ZTM & BPDU
Publication
Unit
2
Agronomy
Agricultural Physics
Soil Science & Agril. Chemistry
Microbiology
CESCRA
Post Harvest Technology
Agricultural Engineering
Water Technology Centre
Unit of Simulation and Informatics

The Indian Agricultural Research Institute (IARI)
maintained its pioneering role in agricultural research,
education and extension, and developed several crop
varieties, farm machineries and agro-technologies for
crop production, crop protection and natural resource
management. The significant contributions of IARI
during the year 2011-12 are summarized below:
Crop Improvement programmes of the institute
resulted in the development of an array of improved
crop varieties and hybrids with enhanced productivity,
quality, adaptability to different agro-ecosystems, and
inbuilt resistance to biotic and abiotic stresses. In wheat,
a bread wheat variety Pusa Chaitanya (HD 3043)
possessing resistance to stripe and leaf rusts, and an
average yield of 4.28 t/ha under restricted irrigated
conditions was released for commercial cultivation in
North Western Plains Zone. Another bread wheat
variety, HI 1572 and a durum variety HI 8704 have been
identified for rainfed and restricted irrigation
conditions, and irrigated timely-sown conditions of
Central Zone, respectively. In addition, a promising
genotype HS 514 with a yield potential of 6.1 t/ha under
irrigated and 4.5 t/ha under rainfed conditions has been
identified for Northern Hills Zone.
In rice, two elite basmati genotypes, namely, Pusa
1509-03-1-7-2 and Pusa 1509-03-3-9-5, and two near
isogenic lines in the background of Pusa Sugandh 5,
namely, Pusa 1592-06-5-2 with bacterial blight
resistance genes (Xa21 and xa13), and Pusa 1612-07-6-
5 with blast resistance genes (Piz5 and Pi54) have been
promoted to final year of testing in the All India
Coordinated Rice Improvement Programme. In
addition, two elite basmati lines in the background of
PRR78, namely, Pusa 1601-05-1-46-1-1 with xa13 and
Xa21 genes, and Pusa 1609-09-9-4 with Piz5 and Pi54
genes were promoted to AVT 1-Basmati. A set of
improved short grain aromatic rice lines and promising
rice hybrids have also been developed, and are being
tested in station trials.
EXECUTIVE SUMMARY
3
In maize, several inbreds with high yield potential
as well as TLB resistance have been identified. A MAS
breeding programme for the development of QPM
with altered starch and increased pro-vitamin A
content is in progress. In barley, two elite genotypes,
namely, BHS 398 and BHS 400 were promoted to the
second year of testing under AVT-rainfed of All India
Coordinated Trials. In pulses, seven promising
chickpea genotypes and two pigeonpea genotypes
have been nominated for testing in coordinated trials.
Two extra bold seeded chickpea varieties were
developed for NCR release.
A mustard variety, Pusa Mustard 28 (NPJ 124),
suitable for early sown (September), irrigated
conditions in the states of Haryana, Rajasthan, Punjab,
plains of J&K, Delhi and Western UP was released. It
matures in 107 days with an average seed yield of 1.99
t/ha. In soybean, a bold seeded high yielding variety
Pusa 12 (DS 12-13) resistant to YMV, Rhizoctonia aerial
blight and bacterial pustule was identified for release
in Northern Plains Zone.
In vegetable crops, an onion variety Sel 126 was
identified for release by AINRP on Onion and Garlic,
for commercial cultivation in the states of Delhi, UP,
Haryana, Bihar, Punjab, Rajasthan, Gujarat, Madhya
Pradesh, Chattisgarh and Orissa. It has compact, flat
globe, and brownish colored bulbs with 17±2 0 Brix TSS
and an average bulb weight of 70 to 100 g. A cauliflower
variety Pusa Shukti (DC 5) with cream white, compact
curd having semi-blanching of inner leaves has been
developed for NCR. It is tolerant to downy mildew and
black rot diseases and yields 42-44 t/ha in 80-85 days.
One ridge gourd variety Pusa Nutan was also
developed for cultivation in NCR. Pusa Vristi, the first
high heat and humidity tolerant tropical carrot variety,
was recommended for early sowing in July under north
Indian plains. It yields 25 t/ha with an average root
size of 150-200 g.

Three hybrids of grape, namely, BA × Per-75-32,
Hur × Card-76-1 and (Hur × BE) × BS showed better
performance in terms of berry maturity,
competitiveness and other quality characters. In
mosambi, selection MOS 1 was found to be promising
for fruit weight, juice recovery and TSS, whereas MOS
2 recorded highest fruit yield per plant.
Gladiolus hybrids, Pusa Manmohak, Pusa Red
Valentine and Pusa Vidushi were recommended for
cultivation in NCR, Delhi. Pusa Manmohak is a midmaturing
variety which flowers in about 100-105 days.
This variety has saffron red florets and is excellent for
vase decoration, bouquet preparation, floral
arrangements and garden display. Pusa Red Valentine
is also mid-maturing variety with straight and long
spikes. The florets are brick or blood red in color with
sun ray like small lines on the lower tepals. Pusa
Vidushi is an early-maturing variety with straight spike
and good rachis length. Its florets are purplish white
in color with grey purple spots on the base of the throat.
Inter-varietal lilium hybrids PKLH 1, PKLH 3 and
PKLH 8 were found promising in flowering characters.
Several genetic stocks possessing unique traits have
been identified, characterized and developed in crops,
microbes and insects. In rice, two improved lines of
PRR 78, namely, Pusa 1602-06-24-5-45 with Piz5 gene
and Pusa 1603-06-11-4-19 with Pi54 gene for blast
disease resistance were developed. A predominately
gynoecious line (PreGy 1) of bitter gourd with high
female:male ratio (5:1 to 7:1) was developed. Two
sponge gourd lines IC-0588956 and IC-0588957 resistant
to Tomato leaf curl New Delhi virus (ToLCNDV) were
registered with NBPGR. In chickpea, the first true
breeding determinate genotype, BGD 9971 with bushy,
compact, dwarf habit, and an extra bold seeded desi
chickpea BGD 2608 have been developed.
In fungal biodiversity eight new species, viz.,
Asteridiella mellittiicola, Asterina homonoiae,
Asterostomella enogeissil, Circosla listae, Maheshwaroncyces
coclilii, Meliola dysoxyligena, M. mulabilides and M.
premnigena were added. The fungal culture collection
was further enriched with 58 new cultures including
Coprinus disseminatum, Corynespora cassicola, Pyricularia
setariae and Sporothrix fungorum. A new leafhopper
species, Goniagnathus (Tropicognathus) keralaensis sp.
4
nov., and a new deltocephaline species Scaphoideus
subsculptus sp. nov. were isolated from Kerala and
characterized. A new species of entomopathogenic
nematode, Steinerne maharryi n. sp. was recovered from
a soil sample collected from Ambattur region of
Chennai was characterized.
The School of Crop and Resource Management
focused its research on eco-friendly management of
crops and resources for conservation agriculture and
cropping systems. In mungbean-mustard cropping
system, significantly higher mustard equivalent yield
(>4.0 t/ha) was recorded under flat-bed with mulch,
broad bed and furrow systems of planting as compared
with conventional flat-bed planting. In wheat-based
cropping systems, cotton gave almost three times more
maize equivalent yield than maize, and about 1.5 to 2
times more than pigeonpea. The yield of maize and
cotton grown on flat-bed with zero tillage was
equivalent to that of these crops grown on broad beds
with residues. Preceding legume crop effected a saving
of 50 kg N/ha in wheat. In maize-wheat cropping
system, application of 25 kg ZnSO 4 /ha to both maize
and wheat proved to be an effective Zn fortification
strategy for wheat. Application of 60 kg K 2 O/ha
through muriate of potash and 30 kg K 2 O/ha through
FYM to both the crops maximized the productivity of
maize-wheat cropping system.
Application of super optimal NPK (150% NPK) or
optimal NPK (100% NPK) + FYM continued to
maximize the grain yield of maize and wheat, but the
soil health was sustained in 100% NPK+FYM
application. In pearl millet-wheat cropping system,
instead of conventional 3-split application of N,
replacing basal N for one additional top-dressing led
to substantial increase in yield, agronomic efficiency
and recovery efficiency of N in pearl millet and wheat.
The highest grain yields of pearl millet (2.85 t/ha) and
wheat (5.32 t/ha) were recorded under soil test crop
response-based integrated fertilizer recommended
dose plus 10 t FYM/ha.
Planting of potato and cauliflower on flat-bed and
irrigation in furrows resulted in significantly higher
economic yields, water-use efficiency and B:C ratios.
Onion crop geometry with 3 rows per bed recorded
significantly higher average yield (21.05 t/ha) than that

with 2 rows per bed (19.05 t/ha) in L 28, Pusa Red, AFLR
and Indam Synth 3 varieties.
Protected cultivation technologies were developed
for growing off-season vegetables and flowers. Insectproof
net house cultivation method was developed to
produce summer squash mosaic virus free crop in the
summer season in north Indian plains. Cultivation of
mint and coriander cultivation under shade net house
during peak summer months and that of tomato
cultivation under insect-proof net house during
October to May was found to be techno-economically
feasible.
In micro-irrigation studies, highest productivity of
baby corn, water use efficiency and nitrogen use
efficiency were recorded in bi-weekly fertigation
schedule followed by weekly fertigation schedule. In
the drip-irrigated chrysanthemum, application of Pusa
Hydrogel reduced the number of irrigations from 18
to 12 during January to March. Drip fertigation system
was optimized to produce healthy bulbs and cormels
of gladiolus free of Fusarium wilt incidence.
Laser leveling in 15 ha area led to the saving of
about 15-20% water. In Mewat district, about 3.07 km
underground pipeline (UGPL) was laid in the farmers’
fields, which enhanced the water delivery efficiency
and irrigated area by 40 and 45%, respectively, and
reduced the irrigation time by 28%. Outputs of
ClimGen and CROPWAT incorporated in AquaCrop
model helped in precise estimation of future maize
yields and irrigation water requirements under
changing climatic conditions. Variably saturated model
HYDRUS-1D and groundwater model MODFLOW
evaluated the effect of climatic parameters on
groundwater recharge and availability more effectively.
New farm machineries, namely, aqua-ferti-seed
drill for chickpea, mechanical hydrogel applicator,
mechanical carrot planter, semi-automatic and
automatic metering system for garlic cloves, high
capacity Pusa compost sieving machine and basmati
rice threshing machine were developed and evaluated.
The farm operation service unit (FOSU) in collaboration
with other divisions and Biomass Utilization Unit led
to an efficient farm management with complete
utilization of farm residues and other biomass on the
5
campus and their conversion to the compost/FYM. This
initiative has led to self-sufficiency in terms of total
compost/FYM requirement for the IARI experimental
farm as well as resource generation.
Value-addition and development of functional
foods continued to be the thrust areas of post-harvest
technology research. A technology was developed for
production of functional ingredients from black carrots
and capsicum, and its use to make bread enriched with
carotenoids and anthocyanin. A ready-to-eat functional
food was developed from quality protein maize and
finger millet through extrusion processing. Technology
for the production of fruit based carbonated beverages
as “Pusa Sparkling Fruit Drink” was transferred for
commercialization. A gamma radiation based method
was developed to extend the shelf life of tomato.
Bioprospecting of novel molecules and genes from
microbes collected from extremely harsh environments
of Sundarbans and Bhitarkanika mangroves led to the
isolation of superoxide dismutase (SOD) gene that
confers salt tolerance cyanobacteria SL-8. A HSP22 gene
was isolated from heat and salt tolerant Chaetomium
globosum. Microbial inputs-sustained organic farming
in rice-based cropping systems resulted in significantly
higher microbial biomass carbon, and enzyme activities
as compared to integrated nutrient management and
chemical fertilization. Trichoderma–Bacillus biofilm
proved to be the most promising PGP and biocontrol
agent for the cotton crop. Anabaena–Aspergillus awamori
biofilm exhibited highest activity of �-1, 3 glucanase
and ranked second in terms of chitosanase activity.
Fungicidal activity was highest in Anabaena sp.- Bacillus
and Anabaena–Psuedomonas biofilms. Glucosesupplementation
was found to be the most promising
strategy for generating high value biodiesel from algae
because it significantly reduced poly unsaturated fatty
acids and enhanced saturated fatty acids.
Assessment of regional impact of climate change
on rice yield using the InfoCrop-Rice model projected
that irrigated rice yields in India may decrease by ~4%
in 2020, 7% in 2050 and ~10% in 2080 scenarios. Rainfed
rice yields in India are likely to be reduced by ~6% in
2020 scenario, but in 2050 and 2080 scenarios they are
projected to decrease only marginally (

use and application of 25% of additional nitrogen can
offset the adverse impacts of climate change, and
increase the rice production by 6-17% in irrigated and
20-35% in rainfed conditions in future climate
scenarios. Rice, chickpea, mustard, potato and green
gram appears to be more suitable crops for future
climatic scenarios with elevated temperature and CO 2 .
Growing of direct-seeded rice followed by zero-till
wheat can reduce global warming potential by 41% as
compared to the transplanted-rice followed by
conventionally tilled-wheat. Zero tillage, integrated
nutrient management, use of nitrification inhibitor and
site-specific nutrient management are recommended
to reduce GHG emission in the Indo-Gangetic plains.
The School of Crop Protection has developed novel
techniques in diagnostics and management of crop
pests. Genetic diversity studies using DNA markers in
Puccinia species and Bipolaris sorokiniana infecting
wheat; Fusarium spp. infecting rice and chickpea, and
Rhizoctonia solani led to the development of specific
diagnostic PCR markers. Multilocus sequence typing
of Xanthomonas axonopodis pv. punicae, which causes
pomegranate blight, revealed a single virulence lineage.
Studies on the etiology of chirke disease of large
cardamom led to the identification of a new virus
species, Large cardamom chirke virus (LCCV).
Resistance sources and effective chemicals were
identified for integrated pest management in rice and
soybean. Emamectin benzoate combined with neem
baan proved effective against brinjal fruit borers.
Laboratory rearing techniques for Spodoptera litura and
cotton mealy bug parasitoid, Aenasius bambawalei were
developed. Novel green labeled insecticides have been
identified. Pasteuria isolated from Heterodera cajani
showed attachment to Globodera spp., indicating cross
generic affinity. A combined strategy of biofumigation,
soil solarization and azadirachtin–A nano formulation
was developed for effective management of nematodes.
RNAi silencing of Famide like peptide (FLPs) genes,
namely, FLP14 and FLP18, and one sub ventral
esophageal gland specific gene 16D10 significantly
reduced nematode attraction and penetration of the
root-knot nematode, Meloidogyne incognita. Novel
natural and synthetic molecules with antifungal and
nematicidal activity were developed. Extracts from
6
Clerodendron infortunatum and Tagetes erecta were
characterized and found to have antifungal activity.
Regional thematic map was developed for
prediction of yellow rust of wheat. Wheat yellow rust
pathotype, 78S84 was reported for the first time from
IARI, Regional station, Wellington. Non structural
proteins (NSPs) were identified as suppressor of RNA
silencing in ground nut bud necrosis virus (GrBNN).
Analytical methods for pesticide residue analysis
were standardized. Residue analysis for
chlorantranipole on mustard and cabbage revealed a
safe waiting period of 3 days, while a safe waiting
period of 5 days is suggested for chlorfenapyr on
brinjal. Metal oxides and nano-clay materials were
developed to decontaminate pesticides and herbicides
from water. Controlled release nano-formulation of
azadirachtin-A prepared using polymer matrix
effectively decreased Callosobruchus analis insect
populations in soybean. In weed management studies,
tank-mix application of pendimethalin with
imazethapyr significantly reduced Cyperus rotundus in
maize fields, giving higher weed control index.
Combined application of clodinatop and carfentrazone
significantly controlled weeds in wheat field.
The School of Basic Sciences mapped/isolated
genes for disease resistance, grain quality, grain
number, fertility restoration and abiotic stress tolerance
in different crops. Leaf rust resistance gene Lr45 was
mapped in wheat. A single dominant gene in the
genetic stock FLW 13 was found to confer resistance to
stripe rust pt. 46S119 and 78S84 pathotypes. In
cauliflower, a RAPD marker “RAPD 04833” linked to
black rot resistance gene was identified. ToLCNDV
resistance gene was mapped using interspecific crosses
in tomato and two SCAR markers, namely, TGO 302
and P6-6 that are linked to the ToLCNDV resistance
gene were identified. Similarly, four SRAP (Sequencerelated
amplified polymorphism) markers closely
linked to ToLCNDV were identified in sponge gourd.
These markers will be useful in the MAS breeding for
disease resistance.
In rice, 24 QTLs for various grain quality traits were
mapped using a F 2 population from the cross between
short grain aromatic landrace Sonasal with Pusa

Basmati 1121. Fine mapping of grains per panicle QTL
in rice led to the narrowing down of this QTL within a
30 kb region. In maize, mgussr061 and mgussr276
markers were found to be closely linked to the sugary1
(su1) and shrunken2 (sh2) locus, respectively, and hence
useful for stacking these genes in MAS breeding. In
pigeonpea, an SSR marker linked to male fertility
restorer (MFR) gene was identified.
High expression levels of HSFA4a (Heat Shock Factor
4a), HSP17.3 and HSP101c were found be associated
with heat tolerance in wheat. Complete coding
sequence of HSFA4a from wheat and HSP17.3 from
heat tolerant pearl millet were cloned and sequenced.
Studies on VIGS (Virus-induced gene silencing)
mediated silencing of Fatty Acid Desaturase 7 (FAD7)
gene in tobacco showed that reduction in linolenic acid
and increased linoleic acid content in the membranes
is a potential approach to enhance thermotolerance of
plants. Comparison of kinetic properties of soluble
starch synthases (SSS) from wheat and maize grains
revealed that maize SSS has a lower Km, higher Vmax
and thus higher catalytic efficiency (Vmax/Km) as
compared with wheat SSS.
Soybean quality improvement studies focused on
off-flavor reduction and development of low phytate
soybean. Eleven off-flavor causing volatile compounds
comprising of short chain aldehydes, ketones and their
alcoholic counterparts were identified by using a Solidphase
Micro-Extraction and GC-MS analysis. Gammaradiation
treatment was found to significantly enhance
anthocyanin content and decrease in the LOX activity,
and thus reduced the off-flavor in dark-seeded
soybeans. Gene constructs for silencing myo-inositol-3phosphate
synthase 1 gene and over expression of
PHYTASE specifically in seeds were made, and are
being used for genetic transformation to develop low
phytate soybean.
Phenotyping for abiotic stress tolerance and
nutrient use efficiency focused on development of high
throughput phenotyping techniques, identification of
contrasting genotypes and development of mapping
populations that will be useful for mapping genes and
genetic improvement. Hyperspectral remote sensing
based high throughput, real-time and non-destructive
methods were developed for phenotying for different
7
traits. Hyperspectral reflectance based continuum
removal factor (CR � ) at 1450 and 1930 nm was found
to be effective in measurement of relative water content
of rice under lab conditions. A “red edge” technique
based on hyperspectral remote sensing was developed
for non destructive measurement of N stress in wheat.
Similarly, pulsed NMR longitudinal relaxation time
measurement technique was developed for nondestructive
and high throughput phenotyping of
drought tolerance of wheat.
Evaluation of 71 rice genotypes for heat tolerance
during summer season under field conditions resulted
in identification of NERICA-L-44, which is more heat
tolerant than Nagina 22 in survival, spikelet fertility
and grain yield. Maize inbred lines with contrasting
waterlogging tolerance were identified based on cup
and field phenotyping of a set of 264 diverse maize
inbred lines, and were used to make 16 different
crosses. Phenotyping results of Vigna spp. showed that
ricebean and urdbean were highly tolerant to
aluminium (Al) stress, and hence interspecific crosses
were made to transfer Al tolerance from these plants
to mungbean. Phenotyping for organic acids exudation
from roots that help solubilize non-available P in the
soil led to the identification of PDM 139 in green gram.
Twenty three wheat genotypes with high NUE were
identified from field phenotyping of 110 wheat
genotypes. A high affinity nitrate transporter from
B. juncea was cloned and sequenced (GenBank #
JQ305139.1).
During this year several mapping populations
were developed. In maize, based on waterlogging
tolerance and genetic distance, crosses among the
highly tolerant inbreds such as LM16 × Pant1393, LM16
× HKI1105, LM16 × CML425, Pant122 × Pant 1393,
Pant122 × HKI1105, Pant122 × CML425 and HKI1105 ×
CML425 are selected for testing under multiple
locations. In pearl millet, five mapping populations,
namely, PPMI 683 × PPMI 627, 5054 × TPR 14, 5141 ×
TPR 14, PPMI 627 × PPMI 813 and PPMI 813 × 15040
for high iron and zinc content and spike thickness were
advanced. In mustard, to develop ‘0’ and ‘00’ varieties,
55 BC 3 F 1 were made based the genotypic data for
glucosinolate and erucic acid. Further, phenotyping for
erucic acid and glucosinolate content in a large number

of breeding lines led to the identification of 23 breeding
lines with “double zero” trait.
Geophysical and GIS techniques were developed
for crop and natural resource management. Soil
adjusted vegetation index was found to be a better
measure for irrigation scheduling in wheat over large
areas. In wheat, reduction of 18% irrigation water was
found to improve both water use efficiency (WUE) and
nitrogen use efficiency without yield loss. Further,
“WUE Predictor” software was developed to predict
WUE of wheat under water deficit stress.
Hyperspectral signatures based green normalized
difference vegetation index measured at milk stage was
found to be useful to predict grain yield and protein
concentration in wheat.
A study on the impact of climate change,
specifically the effect of increase in temperature on the
crop water requirement (CWR), predicted that the
CWR and net irrigation requirement will decline 4-7%
in 2020-21 and 6-17% in 2050-51 due to high
temperature stress induced reduction in crop
phenophases. Yield gap analysis for major crops were
carried out for western Uttar Pradesh by using
geophysical and GIS techniques. This will help develop
strategies to reduce yield gap in these area.
The School of Social Sciences continued to make
significant contributions in the areas of agricultural
economics, extension and technology dissemination,
transfer and assessment. Policy options for inclusive
agricultural growth, regional trade, agricultural
investments, energy use and development of non-farm
sector were some areas in which economic analysis
were undertaken. Research in the area of extension
focused on assessing extension strategies and
developing innovative and alternative approaches
besides conducting research on entrepreneurship
development. Dissemination of the IARI technologies
and assessment of the performance of new technologies
8
in the field, training of farmers in production
technologies and vocational enterprises, and
dissemination of information were carried out by the
CATAT, ATIC and KVK. The Institute also initiated a
programme with an independent organization (ITC-
Choupal Pradarshan Khet programme) for validation
of its technologies at farmers’ fields in a large number
of villages in U.P.
The Golden Jubilee Convocation of the Post
Graduate School of IARI was held on February 20, 2012.
The Hon’ble Prime Minister of India, Dr. Manmohan
Singh, was the chief guest. At this convocation, a total
of 120 M.Sc. and 82 Ph.D. students were awarded
degrees, and Dr. Manmohan Singh was conferred with
the Degree of Doctor of Science (Honoris Causa). The
first A.B. Joshi Award was conferred upon Dr. R.S.
Paroda, former Director-General, ICAR & Chairman,
Farmers’ Commission of Haryana for his outstanding
contributions in agriculture research. The Institute
strengthened student amenities in a major way. Besides
PG degree education, the Institute also conducted 127
regular and short-term training courses. Agriinformation
and bioinformatics continued to receive
the Institute’s attention. The IARI Library continued
to provide services to the students and the scientific
community of IARI and other institutions in the
country. The Institute brought out several quality
publications in the form of scientific peer reviewed
research papers, symposia papers, books/chapters in
books, popular articles, regular and ad-hoc publications,
both in English and Hindi, to disseminate information
on the Institute’s mandated activities. During the year
under report, the Institute won the Sardar Patel
Outstanding ICAR Institution Award for the year 2010,
as well as the Environment Leadership Award of
Agriculture Today, 2011. In addition to this, many
faculties, scientists and students of the Institute
received prestigious awards and recognitions, and
brought laurels to the Institute.

1. CROP IMPROVEMENT
The crop improvement programme of the Institute is primarily targeted towards enhancing productivity in
crops through judicious combination of conventional and molecular breeding approaches for genetic enhancement
and pre-breeding, developing crops with resistance/ tolerance to biotic and abiotic stresses, improved nutritional
quality and breeding crop varieties capable of coping with the changes in climate.
1.1 CEREALS
1.1.1 Wheat
1.1.1.1 Variety released
Pusa Chaitanya (HD 3043). A wheat variety, Pusa
Chaitanya (HD 3043) with an average yield of 4.28 t/ha
and a genetic potential of 6.6 t//ha was released for
commercial cultivation under restricted irrigated
conditions of North Western Plains Zone. HD 3043 has
high level of resistance against stripe and leaf rusts. It
has the best HMW sub-units combination for bread
making with Glu-1 score, 8/10.
Wheat variety Pusa Chaitanya
9
1.1.1.2 Varieties identified for release
HI 1572. A wheat variety HI 1572 developed at
Regional Station, Indore was identified for release for
rainfed and restricted irrigation conditions of Central
Zone. It is a widely adapted genotype combining early
maturity with stable high yield. It gave 17% higher yield
under rainfed and almost 10% higher under restricted
irrigation over HI 1500 (Amrita), a popular bread wheat
variety.
HI 8704. A durum wheat variety HI 8704 was
identified for release for irrigated, timely sown
conditions of Central Zone. It is a widely adapted
genotype with average yield of 4.9 t/ha, being 1.4 % to
7.0 % higher over the checks, viz., HI 8498, MPO 1215,
Lok 1 and HI 1544. It showed high levels of seedling
and field resistance to stem and leaf rusts in addition
to the African stem rust race ‘Ug99’ and its variants.
1.1.1.3 Entries in coordinated trials
A large number of wheat genotypes were tested in
coordinated trials under various production conditions
throughout the country.
Trials Entry name/ number (Zone)
Advanced Varietal AVT II: HD 3059, HD 3065 (NWPZ),
Trials (AVT) HD 3070 (NWPZ & NEPZ), HD 3075 (SHZ)
AVT I: HD 3075 (SHZ), HD 3076, HD 3078,
HD 3079 (NEPZ), HD 3077, HD 3080, HD
3081, HD 3091, HD 3098 (NWPZ), HD 3095
(CZ), HD 3086 (NWPZ & NEPZ), HD 3090,
HD 3093, HD 3096 (PZ)
Durum: HI 8724(NWPZ, CZ & PZ), HI 8725
(CZ & PZ), HI 8726 (CZ, NWPZ), HI 8728
(NWPZ, CZ & PZ), HI8730 (CZ),
HI 8731(CZ).

Trials Entry name/ number (Zone)
National Initial NIVT-1A: HD 3104 (NWPZ), HD 3105,
Evaluation Trials HD 3106, HD 3107, HD 3108, HD 3109,
(NIVT) HD 3110 (All Zones)
NIVT-1B: HD 3311, HD 3112, HD 3113,
HD 3116 (All Zones)
NIVT-2: HD 3114, HD 3115 (CZ & PZ)
NIVT-3 : HD 3117 (NWPZ), HD 3118,
HD 3119 (All Zones)
NIVT-4 : HD 4727 (All Zones)
NIVT-5A : HD 3120, HD 3121, HD 3122,
HD 3123 (All Zones)
1.1.1.4 Promising genotype identified
A genotype HS 514 developed at Regional Station
(Tutikandi), Shimla has shown a yield potential of
6.1 t / ha under irrigated and 4.5 t/ ha under rainfed
condition. It gave higher grain yield ranging from 8.8%
to 28.7% against the checks, HS 240, VL 738, VL 804,
VL 907 and TL 2942 under irrigated condition and also
recorded a yield gain 5.8% to 27.7% against checks, TL
2942, VL 804, VL 738, HS 240 and VL 907 under rain
fed condition in three years of testing in Northern Hills
Zone under AICW & BP. It has shown superiority over
the checks for iron content and resistance against hill
bunt and flag smut.
1.1.1.5 Breeding for cropping system under
different production conditions and
conservation agriculture
Thirteen entries selected for their adaptation to zero
till condition under various cropping system, viz., ricewheat,
maize–wheat and pearl millet-wheat were
contributed for evaluation under a multi location trial
Wheat under maize-wheat cropping system on permanent bed
10
across seven locations in the northern plain zone and
four entries, namely, CSW1, CSW 15, CSW 16 and CSW
18 were found to be promising.
1.1.2 Rice
1.1.2.1 Promising genotypes
Pusa 1509-03-1-7-2 (IET21959), an elite Basmati
genotype developed from the cross Pusa 1301/ Pusa
1121 was tested in Advanced Varietal Trial 1-Basmati
during kharif 2011 and has been promoted to
Advanced Varietal Trial 2-Basmati. It has semi-dwarf
plant stature (95 - 100 cm), 120 days seed to seed
maturity and average yield of 4.14 t/ha. Pusa 1509-
03-1-7-2 showed significant superiority over Taraori
Basmati (32.87 %) across 10 locations in the Basmati
growing region. In the panel test in the AICRIP, this
entry was rated as first based on appearance
cohesiveness, elongation and aroma comparable to
Pusa Basmati 1 and Taroari Basmati, while in taste it
was superior to the aforementioned check varieties.
Compared to Pusa Basmati 1121, this genotype has
an advantage of 20 days earliness, non-shattering and
non-lodging habit.
Pusa Basmati 1509 Pusa Basmati 1121
Additionally, Pusa 1509-03-3-9-5 (IET21960), a
sister line of Pusa 1509-03-1-7-2, was rated second in
the grain and cooking quality traits in the coordinated
trial. Based on its grain quality which is on a par with
Pusa Basmati 1121 and added advantage of 20 days
earliness, non-shattering and non-lodging habit and
superior grain shape after cooking, these two entries
have been promoted to final year of testing in the All
India Coordinated Rice Improvement Programme.

1.1.2.2 Entries in coordinated trials
Two Near Isogenic Lines (NILs) in the background
of Pusa Sugandh 5, namely, Pusa 1592-06-5-2 (IET
22289) possessing two bacterial blight resistance genes
(Xa21 and xa13) and Pusa 1612-07-6-5 (IET 22290)
possessing two blast resistance genes (Piz5 and Pi54),
were tested in Advanced Varietal Trial 1-Basmati (NILs)
during kharif 2011 and based on their desirable basmati
quality and yield performance, and resistance to BLB
and blast diseases, respectively, these two NILs have
been promoted to second year of testing. Two elite lines
with BB and blast resistance in the background of
PRR78 namely, Pusa 1601-05-1-46-1-1 (IET 22777)
possessing BB resistance genes xa13 and Xa21, and Pusa
1609-09-9-4 (IET 22778) possessing blast resistance
genes Piz5 and Pi54 were tested in Initial Varietal Trial
- Basmati during kharif, 2011 and exhibited significant
yield superiority over Pusa Basmati 1, Taroari Basmati
and Pusa Basmati 1121. Based on yield, physicochemical
quality and panel acceptability scores these
two cultures have been promoted to Advanced Varietal
Trial 1-Basmati.
1.1.2.3 Development of dwarf high-yielding
short grain aromatic rice lines
Advanced breeding lines from the cross between
Kalanamak and a semi-dwarf short grain aromatic rice
breeding line, Pusa 1176 were raised and tested during
kharif 2011. Several single plant selections with earliness
and dwarf growth habit, along with grain and cooking
quality similar to Kalanamak have been identified for
further evaluation. These lines will be further tested in
order to identify promising cultures which could be
utilized in enhancing the production and productivity
of short grain aromatic rices in Kalanamak belt of Uttar
Pradesh.
1.1.2.4 Evaluation of newly identified potential
hybrids
A set of 19 hybrids identified during kharif 2010
with more than 10% higher yield over the commercial
hybrids Pusa RH 10, PA 6444 and PHB 71, were
evaluated during kharif 2011 at two locations, namely,
New Delhi and Hyderabad. The hybrid NPRH 5 and
NPRH 11 have been identified promising, as their
11
performance was on a par with or better than the
leading hybrid PA 6444.
1.1.3 Maize
1.1.3.1 Promising inbred lines and hybrids
developed
Two hundred fifty inbred lines, developed at the
Regional Station, Dharwad, , were evaluated for their
per se performance and Turcicum leaf blight (TLB). Ten
inbreds, BM 91, BM 109, BM 127, BM 188, BM 196, BM
253, BM 257, BM 258, BM 260 and BM 423 with yield
potential of more than 3.5 t/ha and a TLB score of < 2.0
were found promising for use in the production of
single cross hybrids. In addition, three hybrids, viz.,
TM 103, TM 124, TM 135 with 20.5 to 45.6% under late
maturity group and three hybrids, viz., TH 302, TH
269, TH 305 with 38.4 to 49.9% heterosis have been
developed. Five sweet corn hybrids have been
identified with 9.84 to 21.09% heterosis over popular
sweet corn variety Priya.
1.1.3.2 Maize improvement for nutritional
quality and specialty traits
A total of 184 different F 1 combinations were
developed from inter-crosses between 100 diverse
normal inbreds with two QPM donors (HKI 161 and
HKI 193-1) for transferring QPM trait into maize.
A set of 523 families/sub-families possessing
variability for kernel colour, texture, plant types and
maturity in sh2 and su1 background were advanced
to S 3 .
Diversity for plant architecture and ear colour, shape, texture
among newly developed sweet corn inbreds

A set of 95 inbred lines were analyzed for the
carotenoid content, the analysis indicated that Indian
inbreds are poor in beta-carotene and betacryptoxanthin,
while they were rich in in lutein and
zeaxanthin. The inbreds found to be rich in pro-vitamin
A components are being used as donor in the provitamin
A enrichment programme. A set of 18 F 1
combinations were produced by crossing Indian inbreds
positive for crtRB1 locus with CIMMYT inbreds having
crtRB1 gene, for diversification of maize inbreds.
1.1.4 Barley
1.1.4.1 Entries in coordinated trials
Two genotypes, namely, BHS 398 and BHS 400
were promoted to second year of testing under AVTrainfed
of All India Coordinated Trials. Four genotypes,
viz., BHS 402, BHS 403, BHS 404 and BHS 405 under
AVT-rainfed and six genotypes, viz., BHS 407, BHS 408,
BHS 409, BHS 410, BHS 411 and BHS 412 under AVT
dual purpose were entered in Northern Hills Zone on
the basis of their agronomic superiority and disease
resistance under AICW & BP.
1.2 MILLET
1.2.1 Pearl Millet
1.2.1.1 Development of high yielding dual
purpose hybrids with early maturity and downy
mildew resistance
Three hundred test crosses were attempted using
different cytoplasmic male sterile lines and restorers
High yielding pearl millet hybrids (from left to right Hybrid 7807,
Proagro 9444 and hybrid 7893)
12
during kharif, 2010 and summer 2011(off-season at
ICRISAT), and were evaluated in Initial Station Trial
during kharif, 2011 and 10 best hybrids were identified
for further testing. One hundred fifty new hybrid
combinations were also developed in line × tester fashion.
1.3 GRAIN LEGUMES
1.3.1 Chickpea
1.3.1.1 Entries in coordinated trials
Three entries, namely, BG 3012, BG 3021 and BG
3022 were tested in IVT (extra-large seeded Kabuli) and
four entries, namely, BGD 1063, BGD 1064, BG 3017,
and BG 3018 were tested in IVT (late sown) in
coordinated trials during rabi 2011-2012.
1.3.1.2 Development of high yielding desi and
Kabuli genotypes resistant to Fusarium wilt
A set of 469 wilt resistant single plants were
identified from the segregating generations and the wilt
resistant single plants were evaluated in progeny rows
in two preliminary yield trials along with checks during
rabi 2011-12. Additionally, 222 lines F 6-8 wilt resistant
progenies with >10% yield advantage over the best
check, large to extra-large seed size and attractive seed
color were promoted for testing in replicated yield trials
during 2011-12. Another set of 74 (39 desi and 35 Kabuli)
entries were tested in advance trials during 2011-12.
1.3.1.3 Breeding high yielding extra-large seeded
Kabuli genotypes
In PYT-1, 121 large to extra-large seeded Kabuli
chickpea lines (F 8 ), which were earlier than or as early
as the check, were evaluated for phenology, seed size
and yield along with 2 checks (BG 1108 and BG 5023)
and 34 lines were found to be on a par with or better
than the best check.
1.3.1.4 Development of early maturing desi and
Kabuli genotypes suitable for late planting
A set of 115 early maturing lines were evaluated in
an unreplicated yield trial along with checks (BG 372
and JG 11) during 2010-11. Based on yield, seed size
and seed color, 14 early maturing lines were identified
for evaluation in station trial during 2011-12 under
normal and late sown conditions.

1.3.1.5 Promising large seeded short duration
Kabuli chickpea genotypes
At Regional Station, Dharwad, four large seeded
Kabuli genotypes BGD 2207-14-1-SB-B-B, BGD 2601-20-
B-B, BGD 2602-3-B-B, BGD 2602-22-B-B with high yield
under rainfed residual moisture conditions were
identified.
1.3.2 Mungbean
1.3.2.1 Promising genotypes
Six mungbean genotypes, namely, Pusa 1131, Pusa
1072, Pusa 1171, Pusa 1172, Pusa 1231 & Pusa 1232 were
identified to be promising.
1.3.2.2 Pre-breeding
Sixty-three crosses including both inter-varietal
and inter-specific were made to combine earliness with
bold seed size and MYMV resistance.
1.3.3 Lentil
1.3.3.1 Promising genotypes
Five lentil genotypes, namely, L 4588, L 4590, L
4591, L 4706, L 4707 were found promising in the
evaluation.
1.3.3.2 Pre-breeding
Forty-five crosses were made utilizing
microsperma, macrosperma and mediterranean lines
to combine earliness, bold seed size, wilt and rust
resistance and higher Fe and Zn content.
1.3.4 Pigeonpea
1.3.4.1 Entries in coordinated trial
Two genotypes, namely, Pusa 2011-1 and Pusa
2011-2 were tested under all Indian Pigeonpea
Coordinated Trial during kharif 2011-12.
1.3.4.2 Hybridization and breeding
In order to develop early variety and bold seeded
material, 51 crosses were made during 2011, out of
which 14 crosses were promising for early maturity and
higher seed yield while 7 crosses were promising for
bold seed size. In F 2 generation, only 13 out of 33 crosses
were found to be promising on the basis of seed yield
and early maturity. At Regional station, Pusa, 333
13
desirable single plants and 55 lines were selected in F 5
derived from progenies of different crosses.
1.3.4.3 Breeding for development of hybrids
Based on performance of F s for male fertility
1
restoration over environments GTR 11, GTR 9, AKPR
100, AKPR 9, AKPR 417 were found to be stable
restorer.
BC 4 F 1 s were generated for transferring A 2
cytoplasm into 16 genotypes and A 4 cytoplasm into 25
genotypes. Male sterility has been incorporated into
Pusa Dwarf. Parents involved in 12 highly heterotic
crosses are being included in conversion programme.
A total of 70 progenies of inter-specific crosses
involving C. scarabaeoides × Pusa 33 including bold
seeded lines were evaluated for identification of new
A and R lines.
1.3.4.4 Promising elite lines
Six elite lines, namely, Df E.E.1, Df sel-3, Pusa 2011-
1 Pusa 2011-2, Hbr-5 and IDT-5 were found to be
promising and has been earmarked for evaluation in
station trial.
1.4 OILSEED CROPS
1.4.1 Brassicas
1.4.1.1 Variety released
Pusa Mustard 28 (NPJ 124). This variety is suitable
for early sown (September), irrigated conditions in the
Pusa Mustard 28

states of Haryana, Rajasthan, Punjab, plains of J&K,
Delhi and Western UP. It matures in 107 days with an
average seed yield of 1.99 t/ ha. Its per day productivity
is very high (18.63 kg/day/ha) in comparison to all
released varieties with 41.5% oil content. It possesses
high temperature tolerance at seedling and grain filling
stage and fits well in multiple cropping system. This
variety can be grown as an additional (catch) crop
between kharif and rabi seasons in NWPZ when fields
generally remain vacant during September (after
harvest of kharif crops) to mid-December (sowing of
rabi crops). It is a good substitute of toria.
1.4.1.2 Entries in coordinated and common trials
Entries were tested in coordinated and common
trials.
AICRP RM trial Entry designation
IVT-Toria/ Early Mustard NPJ 162, NPJ 163
(Irrigated/ Rainfed)
IVT-Timely Sown Mustard NPJ 153, NPJ 156
(Irrigated/ Rainfed)
IVT - Late Sown Mustard NPJ 161
IVT- Mustard Quality LES 44, LES 45
AVT-I Mustard Quality LES 42, LES 43
AVT-II Quality Mustard LET 36
(Agronomic evaluation)
1.4.1.3 Conversion of CMS and restorers for
hybrid development
Above 192 backcrosses were attempted to transfer
different male sterility inducing cytoplasm, viz.,
Moricandia arvensis, Diplotaxis erucoides and Diplotaxis
berthautii in the nuclear background of 19 genotypes
To transfer the fertility restorer genes, in Moricandia
arvensis, Diplotaxis erucoides and Diplotaxis berthautii
cytoplasms, in 8 genetic background, viz., NPJ 93, NPJ
112, LES 1-27, LES 39, Pusa Jagannath, Pusa Agarni,
RH 30, LET 17, and 313 BC 1 crosses were attempted in
paired fashion.
1.4.1.4 Promising short duration elite lines
Out of 31 lines tested in Station Trial, four
genotypes, viz., MSTE 11-1 (NPJ-102/PJ//NPJ102),
MSTE 11-7 (SEJ-8/RGN-48), MSTE 1-26 (DHR-991/PA)
14
and MSTE 11-29 (DHR-991/PA) out yielded Pusa
Mustard 28 with less than 100 days maturity.
1.4.2 Soybean
1.4.2.1 Variety identified
Pusa 12 (DS 12-13). This variety was identified for
release in Northern Plains Zone (comprising states of
Delhi, Haryana, Punjab, Uttrakhand, U.P. and Bihar).
It demonstrated significantly higher yield over the best
check SL 688 (32.44%). DS 12-13 has resistance against
yellow mosaic virus (YMV), Rhizoctonia arial blight (RAB)
and bacterial pustule (BP). It is moderately resistant to
stem fly, and defoliators. It is a bold seeded variety
having 100-seed weight of 10.53 g, good seed longevity
and high oil content (19.60%).
Soybean variety Pusa 12
1.4.2.2 Entries in coordinated trials
In soybean, one entry DS 12 5 was promoted to
AVT II in Northern Plains Zone and two entries DS
2706 and DS 2708 to AVT I.
1.5 FIBRE CROP
1.5.1 Cotton
1.5.1.1 Entry in coordinated trials
Genotype ‘P 2151’ ranked 1 st in Central Zone and
4 th in South Zone in national trial under rainfed

conditions. It produced 1.37 t/ ha seed cotton yield in
Central Zone, out yielding zonal check by 48.4% and
local check by 15.7%.
1.5.1.2 Evaluation of advance genotypes
A set of 92 promising genotypes were evaluated
in station trials and P 11-1 was found to be one of the
most promising with seed cotton yield of 2.90 t/ha,
2.5% span length of 29.3 mm and 24.9 g/ tex fibre
strength.
A set of promising strains, namely, P 5616, P 5618,
P 5623, P 5612, P 5630, P 5644, P 5634, P 5642 with
high yield and superior fibre quality were identified.
Additionally, 12 progenies in F 6 also showed good
performance with high yield and superior fibre
quality.
1.6 VEGETABLE CROPS
1.6.1 Cole Crops
1.6.1.1 Cauliflower
Variety released. A cauliflower variety Pusa Shukti
(DC 5) was released by the Delhi State Seed Subcommittee
for NCR Delhi. This variety has cream white,
compact curd having semi-blanching of inner leaves.
It takes 80-85 days to reach to marketable stage and
duration of harvesting lasts for 14-15 days. It produces
approx. 30-33 t/ha of curd yield and 42-44 t/ha of
marketable yield. It is also tolerant to downy mildew
and black rot diseases.
Pusa Shukti
15
Promising genotypes. In early group, out of 282
genotypes (including hybrids) evaluated from June
transplanting, the hybrid CC-12 x Pusa Deepali
recorded the highest marketable and curd weight (537
and 433 g). Out of 116 hybrids evaluated from July end
transplanting, VV × 41-5 was found to be the earliest in
maturity (2 nd fortnight of September) with 570 g net
curd weight. In mid-early group, out of 141 genotypes,
CCM-5 × 310-22 P 4 recorded the highest marketable
weight (2.37 kg). In mid-late group, out of 138
genotypes CCM 8 × (PHJ × BR 2 × PHJ) gave the highest
marketable yield of 113.58 t/ha. The curd yield,
however, was found to be the highest in 8410 × PU P 1
(57.45 t/ha). In snowball group, out of 9 F 1 hybrids
evaluated, the highest marketable yield and curd yield,
were recorded in KTH 27.
At IARI Regional Station, Katrain, 3 CMS lines
KTH 27 (68.6 t/ha) and KTH 52 (55 t/ha) and KTH 109
(45.2 t/ha) were found to be promising.
1.6.1.2 Cabbage
Out of 14 F hybrids evaluated, KTCBH 651
1
recorded the highest head weight (2.45 kg) followed
by KTCBH 883 (1.95 kg), whereas, hybrids KTCBH 997
(1.84 kg) and KTCBH 621 (1.80 kg) have highly compact
curds. The red cabbage hybrid KTCH 905 had the
highest (130.52 mg/100 g fw) anthocyanin followed by
KTCH 931 (125.42 mg/100 g fw).
Two cabbage hybrids KTCBH 51 and KTCBH 81
of IARI Regional Station, Katrain were promoted to
AVT-II under the AICRP (VC) trials. KTCBH 81 gave
the highest yield of 67.7 t/ha followed by KTCBH 51
(61.4 t/ha) at the station in the AVT-I. One CMS based
cabbage hybrid KTCBH 84 has been entered in IET
under the AICRP (VC) trials during this year. In red
cabbage, 11 hybrids were produced by using 4 CMS
lines and hybrid 931 × RCGA was found to be the most
promising.
1.6.1.3 Other cole crops
Variety released. A knol khol variety Pusa Virat
developed at the Regional Station, Katrain was released
by the H.P. State Seed Sub Committee. The variety has
44% higher yield than ‘White Vienna’ and possesses
little or no fibre at maturity. Harvesting can be started
from 55 to 60 days after transplanting. A kale variety

KTK 64 were evaluated in IET under the AICRP (VC)
trials. It gave the highest leaf yield of 57.6 t/ha. Five
CMS lines were used to produce 7 hybrids of broccoli.
Test hybrid BRH 2 gave highest head weight followed
by BRH 6 and BRH 2. The CMS lines and their
respective maintainers were suitably maintained.
1.6.2 Cucurbitaceous Crops
1.6.2.1 Bitter gourd
Promising genotypes. Two entries (DBGS 37 and
DBGS 57) were promoted to AVT-I under AICRP-VC
trial. One variety DBGS 102 and two hybrids DBGH 12
(gyn × mon) and DBGH 263 (mon × mon) were
contributed to coordinated trials. Twelve new
gynoecious × monoecious and 2 monoecious ×
monoecious hybrids
were evaluated and
compared with 5
hybrids of private seed
companies. Among
these hybrids, DBGy
201 × S 2 (Gy × Mon)
gave maximum yield
(1.3 kg/plant) followed
by S 2 × S 63 (Mon ×
Mon; 1.1 kg/plant). The
hybrid DBGy 201 × S 2
produces fruits Fruits of DBGH 12
two weeks earlier
compared to monoecious × monoecious hybrids
including hybrids of private seed companies. It requires
only 48 days after sowing for the first female flower
appearance.
In BC 2 F 5 population derived from a DBGy-201
(gynoecious) × Pusa Do Mausami (monoecious), one
predominately gynoecious line (PDMGy) was extracted
which had a very high percentage of pistillate (female)
flowers and high yield potential. It was named as
‘PreGy 1’ which showed high female: male ratio (5:1 to
7:1) with a yield of 28.0 t/ha as against 18.8 t/ha in Pusa
Do Mausami (check). The proposal for registration of
this line as predominantly gynoecious line was
submitted to NBPGR.Two earlier developed selections
DBGS 32 and DBGS 54 were again evaluated and found
promising for greenhouse cultivation as they produced
16
optimum fruit size without pollination. For attaining
maximum fruit size, however, pollination is necessary.
1.6.2.2 Cucumber
Two selections DC 54 and DC 78 yielding 18.9 t/ha
and 18.2 t/ha showed increase of 18.8% and 14.6 % over
check Pusa Uday (15.9 t/ha), respectively. During kharif
season, DC 82 was found promising with a yield of 19.3
t/ha, an increase of 23.6 per cent over check Pusa Uday
(15.6 t/ha) and it matures in 40-45 days. Two tropical
gynoecious lines DGC 3 and DGC 10 showed stable
performance at higher temperature. Two monoecious
hybrid DCH 6 and DCH 9 and one gynoecious hybrid
DCHG 10 yielded 21.8 t/ha, 20.9 t/ha and 21.3 t/ha,
respectively.
Under low cost polyhouse, individual plant
selections on the basis of gynoecious parthenocarpic
characters were carried out in F 3 generation they were
advanced to F 4. . The parthenocarpic lines Sel. DPaC 6,
DPaC 9 and DPaC 10, and gherkin lines DG 5, DG 8
and DG 11 were observed to be highly promising.
1.6.2.3 Luffa
Fruits of PreGy 1 Cross section of Fruis of
DBGS 54
Variety released. One ridge gourd variety Pusa
Nutan (DRG 2) was released by Delhi State Seed Subcommittee
for NCR Delhi. Its fruits are
long (25-30 cm), straight, attractive green with ten
longitudinal angular ridges and average fruit weight
is 105 g. It is suitable for spring-summer and kharif
season. Average yield: 18.5 t/ha and 17.5 t/ha during
spring summer and kharif. It is field tolerant to Luffa
yellow mosaic virus.

Promising genotypes.
Sponge gourd selections
DSG 43 (15.9. t/ha), DSG 48
(15.2 t/ha), DSG 104 (16.1 t/
ha) and F 1 hybrids DSGH 3
(17.1 t/ha) and DSGH 9 (16.7
t/ha) were found to be
promising. DSG 48, DSG
104 and F 1 hybrids DSGH 3
and DSGH 9 were
promoted to AVT-1 of AICRP (VC) trial. The proposal
of two Tomato leaf curl New Delhi virus resistant lines
DSG 6 (IC-0588956 ) and DSG 7 (IC-0588957) was
submitted to NBPGR for their registration as resistant
source. In ridge gourd DRG74 was found promising
having long light green fruits with an average yield of
18.8 t/ha.
1.6.2.4 Pumpkin
In pumpkin, selections DPU 48, DPU 12 and DPU
37 yielded 39.36 t/ha, 35.11 t/ha and 34.16 t/ha, showing
an increase of 31.4%, 17.2% and 14.0 % over the check
Pusa Vishwas (29.96 t/ha), respectively.
1.6.2.5 Muskmelon and watermelon
In muskmelon, selection DM 148 (23.2 t/ha)
followed by DM 151 (22.4 t/ha) which gave about 22%
and 18% higher yield over the check Pusa Madhuras
(19 t/ha), respectively, were found promising. Sixteen
newly developed F 1 hybrids were evaluated for yield
and fruit quality, and DMH 3, DMH 5 and DMH 12
were found promising. Three snap melon lines DSM
10-5, DSM 11-2 and DSM 119-2 were identified as
resistant for both wilt and virus. In watermelon, two
lines PWMH 25-4 (7.6 mg/100 g) and IPWM 34-1(7.3
mg/100 g) were selected for high lycopene content.
1.6.2.6 Minor cucurbits
Pusa Nutan
In summer squash, selection DS 8 (15.8 t/ha) was
found most promising and the yield advantage was
27.4 % higher than that of the local check (12.4 t/ha). In
long melon, selections DLM 27, DLM 34 and DLM 8
yielded 27.69 t/ha, 25.63 t/ha and 23.32 t/ha showing
an increase of 34.6%, 24.6% and 13.4% over the check
Punjab Long melon (20.57 t/ha), respectively. In round
melon, selections DRM 26, DRM 44 and DRM 3 yielded
17
7.38 t/ha, 7.02 t/ha and 5.77 t/ha showing an increase of
49.26%, 41.96% and 16.78% over check Punjab Tinda
(4.94 t/ha), respectively.
1.6.3 Solanaceous Crops
1.6.3.1 Brinjal
In long fruited varietal trial, DBL 309 was found
promising with an yield of 43.6 t/ha. Its fruits are long
and white in colour. The line DBR 190, in round fruited
varietal trial, yielded 42.9 t/ha and its fruits are green
oval with an average fruit weight is 225 g. Out of 27 F 1
combinations, tested in long fruited hybrid trial, DBHL
115 and DBHL 150 were found better than the national
check ARBH 201. F 1 combinations DBHR 49 and DBHR
38 were found superior among all the combinations in
round fruited hybrid trial. In resistance breeding trial,
lines DBR 569 and Bl 1 were found tolerant against
Phomopsis blight. Out of 34 lines/varieties/species
tested, the highest total phenolics was found in Solanum
torvum (234.5 mg GAE/100 g fw) and the highest
flavonoids in S. incanum (25.9 mg/100 g fw). However,
in cultivated brinjal, the highest total phenolics was
found in green fruited line JBR-99 (90.8 mg GAE/100 g
fw) and the highest flavonoids in a green fruited
promising line Sel. G190 (12.7 mg/100 g fw).
1.6.3.2 Tomato
Fifty-four old and 13 new germplasm lines of
tomato are being evaluated for yield, biotic and abiotic
stresses. Two lines namely EC 717586 and EC 717587
were found setting fruits at low temperature during
December-January. These lines have been crossed with
cultivated variety of tomato for the development of prebreeding
material. Tomato breeding lines were
screened for resistance against Tomato leaf curl virus
(ToLCV). Lines TH 348-9, TH 348-4 and TH 348-3-7
were found resistant to ToLCV under field conditions
with good fruit yield. In cherry tomato, 20 selected lines
were screened for setting fruits during kharif season
and 2 were found resistant to ToLCV and could set
fruits of good quality during October-November.
Eighty-six F 1 s and 45 breeding lines of tomato were
screened for setting fruits under low temperature
regimes during December-January. Genotypes Pusa
Sadabahar, Pusa Sheetal, FEB 2 and F 1 combinations

P.S. × Pusa Rohini, Lab. × FEB-2 and Lab. × BS were
found setting fruits and ripening under low
temperature conditions during December-January.
Among 32 genotypes, antioxidant CUPRAC
(� moltrolax/g fruit weight) value was the highest in
Pusa Sadabahar × H-36 (5.47) followed by BS×H-24
(4.64), PSH×699(4.51), Pusa Sadabahar (4.20) and TH
348 (4.08).
1.6.3.3 Chilli
Out of 55 genotypes evaluated DCH 09-07, DCH
09-09 and DCH 09-11 were found promising with yield
of 20.5 t/ha, 19.38 t/ha and 18.85 t/ha, respectively. The
cluster bearing and pendant fruited lines isolated from
F 3 generation of Pusa Sadabahar × Pusa Jwala were
advanced to F 4 generation.
1.6.4 Root and Bulbous Crops
1.6.4.1 Carrot
Variety/hybrid released. One carrot variety Pusa
Vristi (IPCHt2) and a temperate carrot hybrid Pusa
Nayanjyoti were released by Delhi State Seed Subcommittee
for NCR Delhi.
Pusa Vristi is the first high heat and humidity
tolerant tropical carrot variety. The roots are triangular
in shape with purple pigmentation on shoulders and
self-red coloured. It is suitable for early sowing
beginning in July under North Indian plains. It takes
90-95 days to harvesting. The average root size is
150-200 g with 25 t/ha root yield.
Pusa Vristi
18
The temperate carrot hybrid Pusa Nayanjyoti, the
first F 1 hybrid of orange colour, is suitable for all carrot
growing areas in temperate and tropical regions. The
roots get ready for harvesting in 75-85 days. It is rich
in �-carotene content (7.552 mg/100 g fw) with an
average root yield of 39.6 t/ha.
Promising tropical genotypes. Out of 21 genotypes
evaluated in July sowing, the highest root weight was
recorded in IPC 5 and Pusa Meghali Green Shoulder
(125 g). Out of 10 hybrids, the highest root weight was
recorded in IPC Ht-2 × IPC-116 (166.7 g). Thirty-five
genotypes were evaluated under normal, the highest
root weight was recorded in IPC 54 (215 g) followed
by IPC 11 red (168 g each). The maximum root length
was obtained in IPC 126 (24.8 cm) and root diameter in
IPC 92 (4.72 cm) Out of 23 CMS lines evaluated for root
weight, root length and root diameter, the root weight
was the highest in IPC 55-1 P-2 (200 g). The maximum
root length was noted in IPC 91-14 P-4 (25.20 cm) and
root diameter in IPC 55-1 P-2 (4.36 cm). Among 105
hybrid combinations evaluated, IPC-124-6 P-4 × IPC-
16 Red (317 g) gave the highest root weight. Root length
was maximum in IPC-11-1 Red P-11 × IPC-116 Red P-
1 (33.17 cm) and root diameter in IPC-53-2 P-11 × IPC-
96 Red (5.82 cm).
Promising temperate genotypes. Out of the 13
temperate carrot hybrids evaluated for root weight and
root length, KTCH 750 and KTCH 813 (105 g) gave the
highest root weight. The maximum root length was
obtained in KTCH 122 (21.06 cm) followed by KTCH 8
(20.06 cm).
1.6.4.2 Radish
Promising genotypes. Among 6 genotypes, Green
Shoulder [DC (G-S)] gave the highest root weight (400
g) followed by White White [DC (W-W)] (370.0 g),
whereas, Pink Pink [DC (P i – P i )] and Purple Purple
[DC (P u - P u )] genotypes gave average root weight
(336.67, 236.67 g), root length (18.43, 17.13 cm) and
root diameter (5.60, 5.00 cm), respectively. Out of 9
genotypes, DC (P u -P u ) (8.51 mg/100 g fw) had the
highest anthocyanin and maximum total carotenoids
was recorded in Pink Pink [DC (P i – P i )] (1560 �g/100
g fw) and ascorbic acid in Palam Hriday (56.94 mg/
100 g fw).

1.6.4.3 Onion
Variety identified. One variety Sel 126 was
identified for release in the II nd group meeting of
All India Network Research Project on Onion and
Garlic, for commercial cultivation during rabi season
in the zone III (Delhi, UP, Haryana, Bihar and
Punjab), zone IV (Rajasthan and Gujrat) and zone V
(MP, Chattishgarh and Orissa). It has compact, flat
globe, and brownish coloured bulbs. The average
equatorial diameter of bulbs ranges from 4.5 to 6.0
cm, polar diameter ranges from 4.8 to 6.5 cm and
single bulb weight ranges from 70 to 100 g.The
variety has high TSS, average around 17 ± 2 0 Brix.
The variety is suitable for storage, drying, processing
and export.
Sel 126
The average yield recorded is 25 t/ha and the
variety gave an average 64.08 % increase over check
(15.26 t/ha).
Promising genotypes. The genotype Sel 383 gave
consistently the best performance at multi-locational
trial with an average yield of 32.23 t/ha. The CMS based
hybrids, H 60 showed the best performance with 39.3%
yield increase compared to the best commercial hybrid
Flare (33.50 t/ha) followed by H 9 (26.4% increase) and
H 21 (23.13% increase). In bunching onion, Sel BO 4
was found promising for year round availability of
green onion with an average yield of 29.3 t/ha from a
single harvest.
19
1.6.5 Leguminous Crops
1.6.5.1 Garden pea
In garden pea, GP 17 was identified as early
maturing, high temperature tolerant with better plant
stand and resistant to wilt with good horticultural traits.
Five genotypes GP 17, GP 6, GP 55, GP 473, Sugar Bon
and 4 crosses were found resistance against Fusarium
wilt. An early maturing genotype GP 901 was identified
as powdery mildew resistant along with better
horticultural traits like attractive green colour, long
curved pod with 8-9 seeds, and GP 473 was found
resistant to powdery mildew. Two edible podded lines
GPE 1 and GPE 4 were found promising for fresh
consumption besides resistant to powdery mildew.
1.6.5.2 Minor legumes
In dolichos bean, 4 creeper types Sel 5(purple-red
pod), Sel 7 (dark green with purple sutures), Sel 10 (long
white straight pod), and Sel 9 (long green straight pod)
were identified as promising genotypes. In cowpea, 11
genotypes were found promising as vegetable type, 12
resistant to mosaic virus, 10 resistant to Cercospora and
10 were tolerant to cold. In Faba bean, a promising high
yielding line Sel 1 (16.58 t/ha) was evaluated against
Pusa Sumeet (check) (9.16 t/ha) having longer fleshy
pods and almost double pod width as compared to that
of Pusa Sumeet l.
1.6.6 Malvaceous Crop
1.6.6.1 Okra
The genotype DOV 66 was found completely free
form YVMV disease during whole cropping season,
whereas, genotypes DOV 64 and DOV 62, and hybrids
Sonal and 1004 recoded YVMV disease after 90 days
of sowing. Seventy-nine IC & EC lines of wild okra were
evaluated for YVMV resistance and 10 lines of two wild
species (A. moschatus and A. tetraphyllus) were found
resistant to YVMV.
1.6.7 Leafy Vegetables
1.6.7.1 Amaranth
Eight amaranth genotypes were evaluated for 8
nutritional/quality traits. The genotypes showed
variation in anthocyanin ranging from 5.33 mg/100 g

(Renu Sree) to 40.81 mg/100 g (Pusa Lal Chaulai).
Maximum ascorbic acid was recorded in CO 1 (81.2
mg/100g leaf sample) followed by Pusa Kirti (78.4 mg/
100g of leaf sample). The highest antioxidant activity
was recorded in Pusa Lal Chaulai (13.157μ mol ascorbic
acid/g sample) followed by Pusa Kirti (13.033μ mol
ascorbic acid/g sample). Total phenolic content was
recorded maximum in CO 1 (1411.62 μg gallic acid eq./
g of sample) followed by Pusa Lal Chaulai (1138.5 μg
gallic acid eq./g of sample).
1.6.7.2 Lettuce
The highest leaf weight was observed in Romaine
Rouge D Hiver (1.03 kg, cos lettuce) followed by curled
lettuce (1.01 kg, leaf lettuce) and Valmaine cos (0.93
kg, cos lettuce). Maximum Vitamin C was found in
Iceberg Dublin F 1 hybrid (2.55 mg/100 g). The total
carotenoids content was maximum in Balmoral (47.63
mg/100 g) followed by HRI 10:006619 (45.42) and
maximum anthocyanin in Lolla Rosa (182.43 mg/100
g). Total chlorophyll was the highest in NVRS 10:001818
(1.68 mg/g fw) followed by Iceberg Dublin F 1 hybrid
(1.86 mg/g fw).
1.7 FRUIT CROPS
1.7.1 Mango
1.7.1.1 Evaluation of hybrids
Twenty mango hybrids were evaluated for
different physico-chemical parameters. Fruit weight
ranged from 147.4 g in H 2-11 to 377.2 g in H 11-4. Pulp
percentage ranged from 50.2 in H 2-11 to 71.5% in H
11-2. Intense red pigmentation on fruit surface was
observed in H 11-2. Hybrid H 3-2 also showed red
colour on the fruit surface.
1.7.2 Citrus
1.7.2.1 Malta sweet orange
Among 16 Malta accessions, heavier fruits were
recorded in MS 3 (262.09 g) and MS 13 (252.3 g) as
compared to Jaffa (108.5 g) and juice content varied
from 47.29% in MS 18 to 62.82% in MS 16 as compared
to 44.24% in Jaffa. Total soluble solids (TSS) content
was found to be the highest in MS 2 (11.3%) as
compared to Jaffa (8.4%), whereas, the lowest acidity
20
was recorded in MS 6 (0.89%) and highest in MS 18
(1.34%). Ascorbic acid content was found highest in
MS 13 (41.25 mg/100 ml juice) followed by MS 3 and
MS 18 (40.7 mg/100 ml juice). The highest yield per
plant was recorded in MS 13 (33.04 kg) followed by
MS 8 (26.4 kg).
1.7.2.2 Mosambi sweet orange
The maximum fruit weight (178.3 g) was recorded
in MOS 1 with the highest juice recovery (60.03%), TSS
(11.7%) and the lowest acidity (0.74%). However, per
plant yield was recorded the highest in MOS 2 (21.6
kg) followed by MOS 1 (18.2 kg) as compared to 10.8
kg in Malta Blood Red, 6.02 kg in Jaffa and 3.68 kg in
Valencia. Seed number varied from 7.8 in MOs 4 to 11.7
seeds/fruit in MOS 1.
Promising sweet orange cultivars (MOS 1, MOS 13, MOS 7 and
MOS 16)
1.7.2.3 Acid lime
The maximum fruit weight was recorded in ALC
2 (94.32 g) followed by Konkan seedless (72.82 g), while
the lowest weight was found in ALC 5 (44.35 g).
However, ALC 5 had the highest juice recovery (51.1%),
the lowest seeds (3.0 seeds/fruit), the highest acidity
(5.62%) and the maximum fruits per plant (65).
1.7.2.4 Grapefruit
Among 6 grapefruit cultivars, the maximum fruit
weight was found in Foster (444.7 g) followed by
Duncan (400.6 g) and Imperial (363.5 g), whereas, juice
recovery was recorded the highest in Marsh Seedless
(50.9%).

Promising grapefruit cultivars (Star Ruby, Foster Seedless and
Marsh Seedless)
1.7.2.5 Pummelo
Thirteen pummelo genotypes were evaluated for
physico-chemical traits. The heaviest fruit was
observed in P 7 (1402.60 g) and segment weight varied
from 290.4 g in P 1 to 653.5 g in P 11. The number of
seeds varied from 55 (P 8) to 160 (P 2). The TSS ranged
between 8.57% (P-1) to 10.3% (P-11).
1.7.3 Grape
Nineteen cultivars along with hybrids were
evaluated for their performance under Delhi
conditions. Out of these, Tas-e-Ganesh and Centennial
Seedless performed well. Three hybrids, namely, BA ×
Per-75-32, Hur × Card-76-1 and (Hur × BE) × BS showed
better performance in terms of berry maturity and other
desired characters.
1.7.4 Guava
Hybrid_75-32
Thirty-six genotypes were evaluated for different
physico-chemical traits. The maximum fruit weight
21
was observed in Thai guava (354 g). Hundred-seed
weight was minimum in AS 12 and NS 1(0.87g each).
TSS was found to be the highest in Arka Amulya
(11.88%) and total antioxidants (14.25 �mol Trolax g -1 )
was the highest in Black guava.
1.7.5 Papaya
Sixteen genotypes of papaya were evaluated for
their yield and fruit quality traits. The variety Sinta was
the earliest (78 days after planting) flowering genotype
followed by Pusa Nanha (89 DAP) and Pusa Dwarf
(93 DAP).
At IARI Regional Station, Pusa, Pusa Majesty had
minimal plant height (1.30 m) while CO 6 was the tallest
(2.14 m) cultivar. Maximal collar diameter was
exhibited by CO 6 (15.18 cm) and minimal in CO 2
(11.59 cm). Time required for flowering was minimal
in Red Lady (55 days after transplanting) and maximal
in CO 2 (69 days after planting). Flowering height was
minimal in Pusa Nanha (44 cm) and maximal in Red
Lady (81 cm). Fruiting height was minimal in Pusa
Nanha (52 cm) and maximal in CO 7 (87 cm). Maximal
fruit yield was obtained in Pusa Nanha (39.459 kg/
plant) Minimal fruit yield was obtained in Pusa Majesty
(14.063 kg/Plant). Average fruit weight was minimal
in Pusa Majesty (815 g) and maximal in CO 2 (1055 g).
1.8 ORNAMENTAL CROPS
1.8.1 Rose
1.8.1.1 Promising genotypes
Two new seedlings were found promising. SD 6 is
a Hybrid Tea seedling of the variety Queen Elizabeth
with dark red coloured flowers, and SD 7 is a
Floribunda seedling of the variety Andorra and with
orange coloured flowers in clusters and is ideal for
garden display.
SD 6: Seedling of cv. Queen
Elizabeth
SD 7: Seedling of cv. Andorra

1.8.2 Chrysanthemum
Six new seedlings, namely, chacko, gazania, magic,
red spoon and S4 from cv Lal Pari and yellow seedling
from cv Sadbhawana were successfully isolated using
in vitro tools. The regeneration percentage was the
highest in chocolate brown coloured seedling from cv
Lal Pari. A large number of regenerated plantlets were
transferred to the greenhouse conditions.
1.8.3 Gladiolus
1.8.3.1 Hybrids identified
Three hybrids, namely, Pusa Manmohak, Pusa Red
Valentine and Pusa Vidushi were identified by the IARI
Variety Identification Committee.
Pusa Manmohak. Pusa Manmohak is a selection
among the progeny obtained from the cross of Mayur
x Hunting Song. This is a mid-maturing variety
flowering in about 100-105 days. The florets are saffron
red (40B) with thin whitish stripes on the throat of two
oppositely placed lower tepals. Spikes are more than
93 cm in length with good rachis length (55 cm) and
about 19-21 number of florets per spike. About 5-6
florets remain open at a time making it excellent for
vase decoration, bouquet preparation, floral
arrangements and for garden display.
Pusa Red Valentine. Pusa Red Valentine is a
selection among the open pollinated population of the
variety ‘Regency’. This is a mid-maturing variety
flowering in about 95 days. Spikes are straight and long
with good rachis length (50-55 cm) and has close
arrangement of 18-19 florets on spike. Florets are brick
or blood red (53B) in colour with sun ray like small
lines on the lower tepals.
Pusa Vidushi. Pusa Vidushi is a selection among
the progeny obtained from the cross of Melody ×
Pusa Manmohak Pusa Red Valentine Pusa Vidushi
22
Berlew. It is an early and mid-maturing variety,
flowering in 80-85 days after planting. Spikes are
straight with good rachis length and about 15-16
number of florets per spike. Florets are purplish white
in colour with grey purple spots on the base of the
throat.
1.8.4 Marigold
1.8.4.1 Morphological characterization of male
sterile lines
Apetalous male sterile lines of marigold, i.e.,
MS 5 and MS 8 were characterized based on
morphological characters. MS 5 produces yellow
flowers, whereas MS 8 produces orange flowers. Data
for various vegetative and floral characters was
recorded and documented.
MS 5 MS 8
1.8.4.2 Promising genotypes
Among African marigold, selection Af/R-
19-1(152.33) was found better producing maximum
flower per plant followed by Af/R-47 (112.67). In French
marigold, selections numbered as Fr./R-2 and Fr./R-5
were found very promising and produced 197.3 and
250.3 flowers per plant, respectively. They produced
medium size compact flowers which were excellent for
garland making.
1.8.5 Lilium
1.8.5.1 Promising hybrids
At IARI Regional Station, Katrain inter-varietal
lilium hybrids were developed first time in India and
evaluated. Hybrids PKLH 1, PKLH 3 and PKLH 8 were
found promising in respect of vegetative and flowering
characters. Hybrid PKLH 1 (Pollyanna × Prato)
produces orange coloured compact flowers (15.5 cm)

PKLH 1
(Pollyanna × Prato)
on long and sturdy spikes, and suitable for cut flower
production. Hybrid PKLH 3 (Shiraj × Sumplon)
produces pink with yellow tinted center coloured
flowers (17.6 cm) compact arrangement on short and
sturdy stem with good individual flower longevity. It
is highly suitable for pot culture. Hybrid PKLH 8
(Navona × Brunello) produces orange red flowers with
medium plant height of 48.2 cm and suitable for cut
flower production.
1.8.6 Tulip
PKLH 3
(Shiraj × Sumplon)
At IARI Regional Station, Katrain, tulip genotypes
were evaluated for vegetative, floral and bulb related
traits. Apeldoorn, Blushing Apeldoorn, Golden Melody
Montecarlo and Pretty Women are the promising
genotypes ideal for growing in Kullu-valley. One
species of local tulip, i.e., Tulipa clusiana was collected,
domesticated and utilized in tulip improvement
program.
Promising cultivars of tulip
PKLH 8
(Navona × Brunello)
23
1.9 SEED SCIENCE AND
TECHNOLOGY
1.9.1 Hybrid Seed Production Technology of
Indian Mustard Hybrid, NRCHB 506
Hybrid seed production technology for the first
Indian mustard hybrid NRC Sankar Sarson, NRCHB
506, released by the Directorate of Rapeseed-Mustard
Research, Bharatpur in 2008 for cultivation primarily
in Rajasthan and U.P. was standardized. The hybrid
NRCHB 506 gave 9.4, 14.3 and 12.8 per cent higher seed
yield over Maya, Kranti and Varuna, respectively.
Hybrid seed production through sowing in the third
week of October and following the planting ratio of
2:8 (male: female) produced hybrid seed yield of 2 t/
ha.
1.9.2 Comparison of Hybrid Seed Production
between Open Field and Insect Proof Net
House Conditions in Bitter Gourd
Hybrid seed production technology of bitter gourd
hybrids, Pusa hybrid 1 and 2 was compared under open
field and net house conditions. On an average, under
net house conditions, 12-14 fruits/vine with fruit weight
of 160-200 g were borne as compared to 8-10 fruits with
fruit weight of 80-120 g under open conditions. The
mean seed yield of 2.0-2.5 kg of hybrid seed/100 sq m
area of net house can be harvested per season. A farmer
can earn ` 10,000 [5 kg seed /year (2 seasons) @ ` 2000/
kg of seed]. The net house can be retained for 3-4 years
Production of hybrid seeds of bitter gourd hybrids under net house
conditions

with minor repair, thus the returns on seed production
increases in the following years. The estimated costbenefit
ratio is 1:1.6.
1.9.3 Standardization of Procedure for
Maintenance of CMS Lines in Wheat
In order to develop hybrid wheat seed production
technology, 3 sets of CMS and corresponding
maintainer lines (B line) were grown in different row
ratios (1:1, 1:2, 1:3, 1:4) to study flowering time, stigma
receptivity, pollen movement and seed set at different
rows from pollen parent rows. Stigma receptivity in
the CMS ear heads was found to be maximum on 5 th
day after secondary floret opening. Maximum seed set
in the CMS line was obtained with a planting ratio of
1:2 (B:A).
1.9.4 Development of Seed Standards for
Kalonji
Nigella is commonly known as kalonji or black
cumin, used for food seasoning and also for various
medicinal purposes. Seed standards as well as seed
testing protocols formulated in seed spice, Nigella sativa
L. (Ranunculaceae) were standardized which will be
helpful in seed quality assurance, seed certification and
seed trade.
1.9.5 Identification of Molecular Markers to
Assess Hybrid Purity in Brinjal
Among the 110 brinjal SSR markers screened, nine
markers were identified that could be used to ensure
the genetic purity of brinjal hybrid (Pusa-9, Pusa-5 and
Kashi Komal) seed lot.
1.9.6 Evaluation of Vigour Tests to Predict
Seedling Emergence in Carrot
The emergence of eight commercial seed lots of
carrot (Daucus carota L.) was compared by standard
tests. Germination tests were conducted at standard
(20 °C) and non-standard temperatures of 15 °C, 25 °C
and 30 °C. The accelerated ageing (AA) and saturated
salt accelerated ageing (SSAA) tests were performed
using four relative humidities, viz., standard AA
(RH100%), NaCl (RH75%), Mg(No 3 ) 2 (RH53%) and
CaCl 2 (RH29%). The seedling emergence percentage
24
M 1 2 3 4 5 6 7 8 9 M
SSR markers identified for ensuring the hybridity in hybrid seed
lots of respective brinjal hybrids. M: Molecular marker (20bp)1:
Female parent of Pusa-9, 2 : Male parent of Pusa-9, 3 : Pusa hybrid-
9, 4: Female parent of Pusa-5, 5: Male parent of Pusa-5, 6 : Pusa
hybrid-5, 7: Female parent of KK, 8: Male parent of KK, and 9:
Kashi Komal (KK).
of the seed lots in the field was positively and
significantly correlated with standard germination (r=
0.937**), germination at non-standard temperature of
15 °C (r= 0.954**) and saturated salt accelerated ageing
using NaCl-RH75% (r= 0.952**). The results suggested
that non- standard temperatures of 15 °C and saturated
salt accelerated ageing using NaCl (RH75%) could be
used further to predict seedling emergence of carrot
seed lots in the field conditions.
1.9.7 Seed Production
The Seed Production Unit (Delhi) and the Institute’s
regional stations at Karnal, Indore, Pusa, Katrain,
Dharwad and Wellington produced nucleus, breeder
and IARI seeds of different crops during the year under
strict quality control.
Nucleus Seed Production of wheat (HD 2851) at IARI Regional
Station, Karnal

Production of seeds and planting material (tonnes)
Crop group Nucleus seed Breeder seed IARI seed Total seed
Seed production Unit, Delhi
Wheat - 5.146 1.582 13.937
Paddy - 11.160 2.823 11.372
Chickpea 0.484 - - 0.484
Mustard - 0.181 11.717 11.888
Vegetables 0.012 0.253 2.457 2.722
Fruit saplings - - 1249 Nos. 1249 Nos.
Regional station, Karnal
Paddy 2.112 110.823 127.150 240.085
Maize - 0.350 - 0.350
Barley - - 0.370 0.370
Bajra - 0.185 0.013 0.198
Sorghum 0.043 2.201 - 2.244
Berseem - - 0.062 0.062
Mustard 0.013 0.950 0.480 1.443
Pulses 0.101 5.901 0.319 6.321
Dhaincha - - 0.620 0.620
Vegetables 0.253 11.325 4.006 15.584
Regional Station, Indore
Bread wheat - 1.103 - 1.103
Durum wheat - 1.618 - 1.618
Maize - 0.010 - 0.010
Soybean - 0.036 - 0.036
Papaya - 0.006 - 0.006
Regional Station, Pusa
Wheat 3.025 96.040 9.376 19.283
Paddy - 0.110 20.769 20.879
Maize - 0.257 4.885 5.142
Papaya - - 0.024 0.024
Tobacco 0.002 - 1.225 1.227
25

Crop group Nucleus seed Breeder seed IARI seed Total seed
pulses 0.051 0.430 1.326 1.807
Toria - - 1.454 1.454
Vegetables 0.0005 - 0.0565 0.057
Regional Station, Katrain
Vegetables - 0.100 3.349 3.449
Regional Centre, Dharwad
Pearlmillet - - 0.030 0.030
Chickpea - 0.280 - 0.280
Regional Station, Wellington
Wheat - 6.000 - 6.000
Monitoring of seed production in maize (CM 150)
26
Seed production of rice (Pusa Sugandh 5) at IARI Regional
Station, Karnal

3. CROP AND RESOURCE MANAGEMENT
AND ENVIRONMENT
Green revolution during the mid-sixties, followed by the progress made in crop improvement and production
research led to the achievement of food security of the country. However, intensive use of land and water, the two
key natural resources, over a period of time resulted in decline in total and partial factor productivity; and
deterioration of soil, water and environmental quality. Enhanced mechanization, application of higher rates of
pesticides and reduced availability of organics accentuated the degradation of the natural resource base. With a
commitment to achieve sustainable food, nutritional, environmental and livelihood security, IARI has in place a
strong programme on sustainable management of key natural resources, soil, water, energy (in particular renewable
energy) and climate.
3.1 AGRONOMY
3.1.1 Combined Application of Phosphorus
and Zinc for Improved Productivity of
Aerobic Rice
A field experiment conducted during kharif 2011
in an aerobic rice-wheat sequence showed that rice
hybrid PRH 10 responded significantly to the P and
Zn application. Highest yield was recorded at 80 kg
P 2 O 5 and 10 kg Zn/ha, which was on a par with 80 kg
P 2 O 5 and 5 kg Zn/ha. In general, magnitude of response
to phosphorus was more than that of zinc.
3.1.2 Effect of Legume on Nitrogen Economy,
Soil Properties and System Productivity of
Wheat-based Cropping System
A fixed-plot field experiment was conducted for
two consecutive years (2009-10 to 2010-11) to evaluate
the effect of legumes and incorporation of their stover
on wheat-based cropping system. Grain yield of wheat
after groundnut or soybean was significantly superior
to the yield obtained after maize. Stover incorporation
further increased grain yield of wheat over no-stover
incorporation. Mean effect of N was significant up to
150 kg/ha. Significant interaction was noted between
N levels and preceding crops and management of their
residues.A preceding legume crop effected a saving of
50 kg N/ha in wheat. Incorporation of the residues of
36
the preceding legume crop improved microbial
biomass carbon, dehydrogenase activity, organic C
content and bulk density compared to maize residues.
In terms of system productivity, groundnut-wheat with
groundnut stover incorporation @ 5 t/ha was found to
be superior to all other systems.
3.1.3 Fortification of Wheat through
Micronutrient Application in Maize-Wheat
Cropping System
In a field experiment four treatments of Zn (Control
or no-Zn; soil application of 12.5 kg ZnSO 4 /ha; soil
application of 25 kg ZnSO 4 /ha; and foliar application
of 0.5% ZnSO 4 at flag-leaf stage and one week after Ist
spray) applied to maize hybrid PEHM 2 and a similar
set of treatments were superimposed in succeeding
wheat (DBW 17) and (PBW 343) to assess the
productivity and quality of wheat. Grain and total
biological yield of both the varieties of wheat increased
significantly due to direct application of 25 kg ZnSO 4 /
ha. Direct application of 25 kg ZnSO 4 /ha to wheat
significantly increased gluten strength in DBW 17.
Grain concentration of Fe, Zn, Cu and Mn in both the
varieties of wheat was significantly higher due to soil
application of ZnSO 4 to preceding maize crop and
direct application of ZnSO 4 to wheat. The highest
concentration of the micronutrients was recorded with
the application of 25 kg ZnSO 4 / ha, followed by 12.5 kg

ZnSO 4 /ha and foliar application. Among varieties, PBW
343 was more responsive and had contained higher
levels of Fe, Zn and Cu whereas, Mn content was higher
in DBW 17.
At the IARI Regional Station, Indore, Madhya
Pradesh, application of 10 kg Zn/ha in wheat recorded
significantly higher biomass yield (12.3 t/ha), grain
yield (4.28 t /ha) and crude protein content (13.6%) over
5.0 kg Zn/ha and control. Similarly, application of 2.0
kg B/ha increased the biological (13.4 t/ha) and grain
yield (4.97 t/ha) which was significantly higher than
that obtained from 1.0 kg B/ha and control.
3.1.4 Effect of Integrated Potassium
Fertilization on Yield and Quality of Maize–
Wheat Cropping System
The effect of potassium application on the yield
and rhizospheric parameters of maize-wheat cropping
system was studied. Significant response to K
application was observed in both maize and wheat
crops; all the K treatments were superior to control with
respect to grain, straw and biological yields of maize
and wheat. Significantly higher grain and stover yields
of maize were recorded when 60 kg K 2 O/ha was applied
through muriate of potash (MOP) and an additional
dose of 30 kg K 2 O/ha was applied through FYM in
comparison with other treatments. Superior root
growth (length, volume, dry weight and average
diameter) of maize at 0-15 cm depth was recorded and
the population of soil bacteria, P solubilizers,
actinomycetes and cellulose degraders was found to
be significantly higher in this treatment. Activities of
acid and alkaline phosphatase, FDA, dehydrogenase
and �-glucosidase were also enhanced with the
Effect of potassium fertilization on rhizospheric microbes in maize
37
application of 60 kg K 2 O/ha through MOP and 30 kg
K 2 O/ha through FYM or application of 30 kg K 2 O/ha
through MOP and 30 kg K 2 O/ ha through FYM.
Application of 60 kg K 2 O/ha through MOP and 30
kg K 2 O/ha through FYM to the wheat crop and to
preceding maize, gave significantly higher grain and
total biological yields of wheat. Similarly, wheat
fertilized with 30 kg K 2 O/ha through MOP and 30 kg
K 2 O/ha through FYM and preceding maize fertilized
with 60 kg K 2 O/ha through MOP produced almost
equal yields of wheat as were obtained from 60 kg K 2 O/
ha through MOP and 30 kg K 2 O/ha through FYM given
to wheat only and no K applied to preceding maize.
3.1.5 Performance of Mungbean-Mustard
Cropping System under Various Nutrient
and Moisture Conservation Practices
In mungbean-mustard cropping system
significantly higher mustard equivalent yield (>4.0 t/
ha) was recorded under flat-bed with mulch, broad bed
and furrow systems of planting compared to
conventional flat planting during kharif 2010-11.
Application of 15 kg N+30 kg P 2 O 5 /ha + biofertilizer
(PSB+VAM) to mungbean gave significantly higher
grain yield of both mungbean and mustard. Direct
application of 60 kg N + 60 kg P 2 O 5 /ha gave significantly
higher grain yield of mustard than control and 30 kg
N + 30 kg P 2 O 5 /ha.
3.1.6 Nutrient Management and Moisture
Conservation Studies in Pearl Millet and
Cluster Bean under Sole and Intercropping
Systems in Rainfed Conditions
A field experiment was conducted to identify ideal
sole/ intercropping system for rainfed areas under
various moisture conservation and nutrient management
practices. Pearl millet (Pusa composite 443) and cluster
bean (HG 563) were planted as sole and intercropping
systems (1:1 ratio) under two moisture conservation
practices in main plots. Four nutrient management
treatments, viz., control, 100% recommended dose of
fertilizer (RDF), leaf and cow dung mixture compost (10
t/ha) and leaf-compost (10 t/ha) were applied in sub-plots.
Higher pearl millet equivalent yield (3.35 t/ha) was
recorded when pearl millet was intercropped with cluster

ean compared to the sole pearl millet and sole cluster
bean. Among nutrient management practices, leaf
compost produced higher pearl millet equivalent yield
than the rest of the treatments.
3.1.7 Water Economization through Planting
and Irrigation Methods
3.1.7.1 Potato
Field experiment conducted during rabi 2010-11
showed that planting on flat-bed and irrigation in
furrows recorded significantly higher tuber yield (33.1
t/ha) and water-use efficiency (853.16 kg/ha/cm);
consumptive use of water (CUW) was less (38.8 cm)
and net return and B:C ratio were higher under this
treatment. Further, irrigation at 50 mm cumulative pan
evaporation (CPE) recorded significantly higher tuber
yield (31.3 t/ ha). However, CUW was less where
irrigation had been applied at 70 mm CPE (41.3 cm)
resulting in the higher water-use efficiency (WUE). Net
return was higher with irrigation at 70 mm CPE. Potato
yield was significantly higher (32.4 t/ha) with irrigation
at 6.0 cm depth. However, CUW was less under 4.0 cm
irrigation depth, resulting in the higher WUE. Net
return and B:C ratio were higher under the treatment
where 6.0 cm irrigation was applied.
3.1.7.2 Cauliflower
Planting cauliflower on flat bed and irrigation in
furrows recorded significantly higher curd yield (22.1
t/ha). Consumptive use of water (CUW) was less in this
treatment (crop consumed 27.5% less water), but WUE
was higher. Net return and B:C ratio were higher under
this treatment. Irrigation at 25 mm CPE recorded
significantly higher curd yield (22.2 t/ha), net returns
and B:C ratio. However, WUE was higher in this
treatment. Irrigation at 6.0 cm depth recorded
significantly higher curd yield (22.7 t/ha). However,
CUW was less under 4.0 cm irrigation depth but WUE
was higher with 6.0 cm irrigation depth. Net return
and B:C ratio were higher under the treatment where
6.0 cm irrigation was applied.
3.1.8 Response of Newly Released Soybean
Varieties to Date of Sowing
A field investigation was carried out over a period
of three years (kharif 2009 to 2011) to assess the response
38
of soybean varieties to different weather conditions by
sowing the crop at variable dates. During all the study
years, July 5 and July 20 sown crops produced
significantly higher seed yield than the June 5 and June
20 sown crops. Between July 5 and July 20, seed yield
obtained from July 5 sown crop was significantly higher
during 2010 and 2011, but the trend was reverse during
2009 (drought year). Mean seed yield (1.37 t/ha) was
also the highest with July 5 sowing date, which was
significantly higher than yield recorded with June 5
and June 20 sowing dates. Net returns followed the
same trend as yield. On an average DS 9814 (1.30 t/ha)
produced 18 and 4.4% higher seed yield than PS 1347
and SL 525, respectively. The net returns were also the
highest with this. Interaction effects of sowing dates
and varieties were significant for average (average of 3
years) yield and economics. The yield and net returns
from PS 1347 were the highest when sown on July 20,
while SL 525 and DS 9814 gave the highest yield and
net returns when sown on July 5. Thus, it may be
concluded that under climatic conditions of Delhi, first
week of July is the right sowing time for all the three
varieties though the sowing of DS 9814 and PS 1347
can be delayed up to July 20 without significant yield
reduction.
3.1.9 Conservation Agriculture for
Improving Resource-Use Efficiency and
Productivity of Wheat-Based Cropping
System
With an objective to diversify the rice-wheat
cropping system, three major non-rice cropping
systems, viz., maize-wheat, cotton-wheat, pigeonpeawheat
were assessed in an experiment with
conservation agriculture practices. Among the three
kharif crops, cotton was the best in terms of maize
equivalent yield (11.2 t/ha), followed by pigeonpea (6.4
t/ha) and maize (3.53 t/ha). Cotton gave almost three
times more maize equivalent yield than maize, and
about 1.5 to 2 times more than pigeonpea. Growing of
maize and cotton on flat bed with zero tillage was
comparable to growing of these crops under broad beds
with residues, and all the methods of sowing were
better than the conventional flat sowing of these crops
except pigeonpea. Per cent increase in yields of maize,
cotton and pigeonpea under zero till flat bed without

and with residues was 46.4 and 55.1, 71.3 and 73.7 and
2.2 and 8.0, respectively, over that of the conventional
till flat sown crops.
3.1.10 Yield Evaluation Trial of
Recommended and Popular Late Sown
Varieties of Wheat in Eastern India
Evaluation trials of the late sown wheat varieties
recommended for north Bihar, conducted at the IARI
Regional Station, Pusa, Bihar, revealed that the varietal
group comprising of HD 2985, HD 2643, PBW 373,
HUW 234 and K 9533 were higher yielders with the
yields varying from 4.38 to 4.86 t/ha; inter-varietal yield
differences within this group were statistically nonsignificant.
But the other group comprising of NW 2036,
DBW 17 and HP 1633 varieties were significantly lower
yielders as compared to HD 2985, the highest yielder
of the first group. These results offer options to the
farmers to go in for the potentially higher yielding
varieties depending on availability of their seed.
3.1.11 Field Performance of Maize Hybrids
in Different Seasons
Five Vivek hybrids of maize recommended for
north Bihar were evaluated in spring and kharif seasons
against common local hybrids of maize at the IARI
Regional Station, Pusa, Bihar. During spring of 2011,
all the five Vivek hybrids attained physiological
maturity between 90-95 days and produced
significantly higher yield than local hybrids Shaktiman
1 and Shaktiman 3 with the exception of VQPM 9. Vivek
Hybrid 25 produced highest yield of 10.4 t/ha and
Shaktiman 3 produced the lowest yield of 7.16 t/ha.
During kharif season, yield levels were uniformly lower
compared to spring season. Vivek Hybrid 25 produced
the highest yield of 4.52 t/ha, followed by Vivek Hybrid
43, Vivek Hybrid 21 and Vivek Hybrid 17. Shaktiman
1 produced the lowest yield of 3.66 t/ha.
3.1.12 Performance of Wheat Varieties under
Early Sown Conditions in Madhya Pradesh
Five wheat varieties, viz., HD 4672, HI 1531, HI
8627, HI 8638, and Lok 1 were evaluated on farmers’
fields at Dhar and Kannaud districts to identify suitable
varieties for very early (October 1 st week ) sowing for
the optimum utilization of available irrigation water
39
as most of the irrigation sources in central India dry
out by December-January. At Dhar, grain yield of HI
1531 (3.51 t/ha) and HI 8627 (3.41 t/ha) was statistically
on a par but was significantly higher than others. At
Kannaud, HI 8627 gave the highest grain yield (3.04/ t
ha) which was significantly higher than the grain yield
of Lok 1 (1.67 t/ha) and on a par with others.
3.1.13 Effect of Sowing and Closure Dates
on Forage and Seed Yield of Berseem
Influence of sowing dates and closure date on
forage and seed yield of berseem (Trifolium alexenderium)
was studied at the IARI Regional Station, Karnal during
rabi 2010-11. Reduction in green forage yield was 19.7%
and 37.4% in 15 th and 25 th November sown crops,
compared to the 25 th October sown one. Highest green
forage yield was recorded with 5 th May closure date for
forage, whereas highest seed yield was obtained when
closure date for forage crop was 15 th April.
3.1.14 Agronomic Performance of Rice
Variety Pusa 1509
Agronomic trials were conducted during kharif
seasons of 2010 and 2011 with three transplanting dates
(5 th July, 20 th July and 5 th August), three spacings
Influence of transplanting dates, spacing and nitrogen on
seed yield of rice cultivar Pusa 1509
Treatment Plant height (cm) Seed yield (t/ha)
Transplanting date
5th July 76.9 4.82
20th July 67.5 3.73
5th August 57.9 2.73
CD (P = 0.05)
Spacing
2.72 0.19
15 cm × 20 cm 67.6 3.89
20 cm × 20 cm 67.9 3.75
25 cm × 20 cm 68.8 3.63
CD (P = 0.05)
Nitrogen rate
NS 0.17
40 kg/ha 66.3 3.35
80 kg/ha 68.5 3.98
120 kg/ha 69.5 3.95
CD (P = 0.05) 2.47 0.18

(15 cm × 20 cm, 20 cm × 20 cm and 25 cm × 20 cm) and
three doses of nitrogen (40, 80 and 120 kg N/ ha) in
split plot design with three replications. Significantly
higher yield was recorded on 5 th July transplanted crop
which was 22.6% and 43.4% higher than 20 th July and
5 th August transplanted crops, respectively. Spacing of
15 cm × 20 cm was superior to 25 cm × 20 cm ,whereas
it was on a par with 20 cm × 20 cm spacing. Highest
yield was recorded at 120 kg N/ha which was on a par
with the yield obtained at 80 kg N/ha.
3.2 SOIL MANAGEMENT
3.2.1 Generation of Soil Information
Database of IARI Farm
Grid soil samples from IARI farm were collected
from 297 grid intersection points in 100 m × 100 m grid
from surface (0-15 cm) and sub-surface (15-30 cm) layer
using Trimble GPS and analyzed for important soil
properties.
Map of IARI’s research farm with block boundary. The yellow
points are locations of grid (100 m × 100 m) samples
Data generated on various soil properties indicated
that most of the soils are alkaline and non-saline.
Interestingly, a spatial movement of CaCO 3 (soil free
and nodules) were noticed, which is contrast to earlier
soil survey report (1976) of the farm. The range of soil
40
properties estimated in the grid samples collected from
the IARI farm is given below:
Variability in soil properties of IARI farm
Soil properties Range
pH of surface soil 5.9 – 9.1
EC (dS/ m) of surface soil 0.08 – 1.04
Bulk density (Mg/m 3 ) of surface soil 1.50 – 1.60
Bulk density (Mg/m 3 ) of sub-surface soil 1.60 – 1.75
Hydraulic conductivity (mm/hr) of surface soil 8.0 – 10.0
Hydraulic conductivity (mm/hr) of sub-surface soil 3.0 – 7.0
Organic carbon (g/kg) of surface soil 0.6 – 11.1
Organic carbon (g/kg) of sub-surface soil 0.3 – 7.6
Microbial biomass carbon (g/kg) of surface soil 158 – 778
Dehydrogenase activity (�g TPF/ g/hr) of surface soil 1.4 – 14.0
3.2.2 Crop Productivity and Soil Health
under Long-term Fertilizer Experiment
In a long-term experiment at IARI farm since 1971,
effect of different nutrient management practices
comprising sub-optimal (50% of recommended rate)
to super-optimal (150% of recommended rate) doses
of NPK, NP or N alone, NPK supplemented with FYM,
S or Zn, and unfertilized-control on crop productivity
and soil health was evaluated. Optimal (RDF) NPK for
maize or wheat was 120-26-33 kg NPK/ha. Farmyard
manure @15 t/ha was applied to maize, and ZnSO 4
@ 10 kg/ha was applied to wheat each year. The grain
yield trends of maize and wheat computed for the last
five years revealed that application of super optimal
NPK or optimal NPK + FYM out-yielded the rest of the
treatments. The yields in these treatments were
significantly higher than the optimal (recommended)
NPK indicating the inadequacy of the present fertilizer
recommendations. Over the years, crop response to
P and K, and enhanced rate of NPK application showed
substantial increase, whereas the response to FYM
remained almost consistent. These data indicate the
emerging inadequacy of P and K in the soil owing to
continuous nutrient mining, which could be offset only
through an enhanced rate of NPK application or
inclusion of FYM in the fertilizer schedule. Soil organic
C was either maintained at initial level (0.44%) or
showed a build-up in all the treatments, except for 50%

NPK, N alone or unfertilized plots. The highest organic
C (0.54%) was recorded under NPK+FYM, followed by
0.51% under 150% NPK. Soil bulk density (BD) was
lowest under NPK+FYM, followed by 150% NPK
whereas highest BD was recorded in the control plot.
The microbial biomass carbon and dehydrogenase
activity were the highest under NPK+FYM, followed
by 150% NPK plots.
3.2.3 Effect of Nano-Clay on Humus Stability
in Soil
A chemical method was developed to assess the
stability of humus carbon in soil consisting shaking a
certain amount of clay–humus complex with sodium
hydroxide-pyrophosphate solution and replenishing
with fresh extractant every two hours and analyzing
humus desorbed in each extraction. Carbon content of
a clay humus complex, C t , at a time t, after desorption
of humus from clay-humus complex was fitted to the
following first order equation:
Soil nano-clay and humus stability under rice-wheat and maize-wheat cropping systems
41
C t = C 1 exp(-k 1 t) + C 2 exp(-k 2 t) + C 3 exp(-k 3 t)
where, C 1 , C 2 and C 3 are different carbon pools with
desorption rate coefficients, k 1 , k 2 and k 3 , respectively.
Inverse of a rate constant, having dimension of time
taken was an index of the stability of a particular
carbon pool. This method was applied to assess the
stability of clay-humus complexes from two soil
profiles under long-term cultivation of rice-wheat and
maize-wheat cropping system. The two systems
showed contrasting differences in humus stability
trend along the depth of the profiles. On an average,
rice-wheat system showed more humus stability than
the maize-wheat system.
3.2.4 Effects of Short-Term Resource
Conserving Technologies on Soil Carbon
Retention under Irrigated Wheat-Based
Cropping Systems
In a maize-wheat-green gram rotation, plots under
residue incorporation had about 9% higher total C in
Soil XRD- small angle band (SAB) Organic Stability Stability of Stability
Depth (Mg/air-dry) carbon of labile intermediate of resistant
(cm) (g /kg) pool (hr) pool (hr) pool (years)
Peak Band Particle size Fractional area
position (2�����) width(2�����) (nm) of small
angle band
Rice-wheat system
0-7.5 6.37 4.73 1.8 0.467 24.1 1.35 7.8 204
7.5-15 6.09 2.93 2.9 0.358 18.8 1.20 37.0 0.14
15-30 6.22 2.13 4.1 0.237 8.8 0.75 5.6 114
30-45 6.26 1.99 4.4 0.229 8.3 0.91 11.4 1141
45-60 6.40 2.02 4.4 0.172 9.0 0.25 3.8 1141
60-75 6.40 1.98 4.4 0.169 12.3 0.37 3.7 114
Maize-wheat system
0-7.5 6.27 3.67 2.3 0.409 21.2 0.25 4.2 114
7.5-15 6.03 3.65 2.3 0.392 17.1 0.25 4.3 114
15-30 6.07 3.22 2.6 0.408 12.2 0.60 8.3 114
30-45 6.15 2.72 3.2 0.382 8.5 0.71 7.1 114
45-60 6.13 3.08 2.8 0.382 9.0 0.81 14.3 114
60-75 6.18 2.12 4.1 0.38 6.3 0.71 11.1 114

the 0-5 cm soil layer compared to no-residue treated
plots (7.6 g /kg in 0.05) in total C content over
conventionally tilled plots. However, zero tillage and
bed planting had no impact on total C content in the
15-30 cm soil layer even after three and a half years. In
another experiment under a rice-wheat system, plots
under direct seeded rice (DSR) + green gram residue
had about 11% higher very labile C than the plots under
transplanted rice (with no residue) in the 0-5 cm soil
layer (0.53 g/kg bulk soil) after rice harvest (second year
of a rice-wheat rotation). Plots under DSR + brown
manuring had labile and recalcitrant pools to the plots
under DSR + green gram residue incorporation. The
above-mentioned treatments had no impact on soil
bulk density, total C and total soil organic C content in
42
the 0-5 and 5-15 cm soil layers even after growing three
crops in sequence.
3.2.5 Prediction of Solubility of Zinc, Copper,
Nickel, Cadmium and Lead in Metal
Contaminated Soils
Free metal ion activity in contaminated soils
represents the bioavailability and eco-toxicity of metals
to a large extent. In a study the free ion activity of Zn,
Cu, Ni, Cd and Pb in the metal-contaminated soil was
predicted as a function of pH, extractable metals and
soil organic carbon content.
Free metal ion activities expressed as pZn 2+ , pCu 2+ ,
pNi 2+ , pCd 2+ and pPb 2+ as estimated by Baker soil test
ranged from 5.44 to 11.7, 8.62 to 15.2, 8.11 to 14.5, 7.04
to 14.6 and 8.12 to 13.5, respectively. Results indicated
that solubility model as a function of pH, Walkley and
Black carbon and EDTA extractable metals explained
59, 56, 46, 52 and 51% variation in pZn 2+ , pCu 2+ , pNi 2+ ,
pCd 2+ and pPb 2+ , respectively. Over all, the
predictability of solubility model based on EDTA was
superior to that based on DTPA or CaCl 2 extractable
metals.
Model parameters for prediction of free ion activity of Zn, Cu, Ni, Cd and Pb in soil as a function of pH, Walkley and
Black organic carbon and extractable metals

3.2.6 Effect of Lime on the Release of Zinc,
Copper, Nickel, Cadmium and Lead from
Contaminated Soils
In an incubation study, the effect of lime on the
release of metals from contaminated soils was studied
at varying levels of temperature and moisture. For this
purpose, two surface (0-15 cm) soil samples were
collected from the agricultural lands irrigated with
industrial effluents emanating from ATLAS cycle
factory, Sonepat, Haryana and Zn-smelter areas,
Debari, Udaipur, Rajasthan. At the end of each
incubation period, soil was extracted with 0.5 M
Ca(NO 3 ) 2 solution and data on calcium nitrate
extractable metal content in soil were fitted to the
exponential equation. Results indicated that potential
extractable metal (M 0 ) content in soils was reduced due
to application of lime; extent of reduction being 25.5,
20.8, 18.4 and 5.96% in case of Zn, Cu, Ni and Pb,
respectively in the Sonepat soil. In case of Debari soil,
23.1, 10.6, 2.59, 26.5 and 3.81% reduction in M 0 was
recorded in case of Zn, Cu, Ni, Cd and Pb, respectively.
Increase in temperature from 20 to 35 °C had negative
effect on potential extractable Zn in the lime-treated
soil, while potential extractable Cu, Cd and Pb were
increased due to increase in temperature. As compared
to lime and temperature, the effect of moisture on M 0
was more metal-specific.
3.2.7 Effect of Irrigation with Multi-Quality
Waters on Soil Quality and Yield of Indian
Mustard
A field experiment was conducted to study the
effect of irrigation with multi-quality waters on soil
quality and yield of Indian mustard (Brassica juncea var.
Pusa Jagannath) during rabi 2010-11. Six irrigation
treatments, viz., irrigation with 100% tubewell water
(T 1 ), irrigation with 100% wastewater (T 2 ), irrigation
with 100% saline water with EC-8.0 dS /m (T 3 ),
irrigation with 50% tubewell water + 50% wastewater
(T 4 ), irrigation with 50% saline water + 50% tubewell
water (T 5 ), irrigation with 50% saline water + 50%
wastewater (T 6 ) were tested. The results revealed that
bulk density, saturated hydraulic conductivity and pH
were not significantly influenced by the different
quality water. However, available N, P and K content,
43
Effect of irrigation with multi-quality water on seed yield of Indian
mustard
soil organic C and microbial biomass carbon (MBC)
were significantly higher in the waste water treatments
than in tubewell and saline water. Seed yield of mustard
was also significantly higher under the wastewater
treatment (T 2 ). Initial investigations indicate that
mixing of saline water with waste water has more
positive effects than mixing of saline water with
tubewell water for dilution.
3.3 WATER MANAGEMENT
3.3.1 Irrigation Water Management
3.3.1.1 Evaluation of maize hybrids for water use
efficiency
A field experiment was conducted to evaluate 24
maize hybrids for water use efficiency (WUE) under
irrigated and rainfed conditions. Based on total
biomass/plant, the hybrids were categorized into three
groups, viz., biomass 300 g (III). Under irrigated conditions, most
of the hybrids got grouped under class II while only
one fell in class I (Super 900) and three in class III (PHM
1, HQPM 7 and HQPM 1). However, under rainfed
conditions the distribution of hybrids followed entirely
different pattern, i.e., 5 were in group I, 11 in group II
and 8 in group III. This indicates that under normal
irrigated conditions the genetic potential in biomass
or WUE could not be expressed whereas under waterdeficit
conditions potential was expressed fully.
Cultivars PHM 1 and HQPM 1 showed higher biomass
under both the conditions, while hybrid Prakash
showed moderate biomass under irrigated conditions
and higher biomass under rainfed conditions.

3.3.1.2 Effect of quantity and quality of irrigation
water on growth and yield of tomato under
partial root zone drying condition
Field investigations were carried out in a sandy
loam soil to study the suitability of tomato var. Pusa
Rohini under partial root drying (PRD) irrigation
system. The results indicated that PRD system was
successful for tomato. The PRD irrigation conditions
improved the fresh fruit weight under fresh water
irrigation; however, fruit numbers were not affected
by PRD. The PRD irrigation system also increased the
irrigation water use efficiency (IWUE) by about 100%,
over the other irrigation treatments compared to the
conventional deficit irrigation.
3.3.1.3 Determination of optimum crop geometry
and maximum water use efficiency for onion
A field experiment was conducted to determine
optimum crop geometry and maximum water use
efficiency (WUE) of onion under two irrigation
methods, three-crop geometries and four-varieties of
onion. Results showed that the crop geometry with 3
rows per bed recorded significantly higher yield (21.05
t/ha) than the crop geometry with 2 rows per bed (19.05
t/ha). However, these were not significantly different
from the crop geometry with 4 rows per bed (21.03 t/
ha). The variety Indam Synth 3 yielded a minimum of
17.67 t/ha compared to the other varieties, viz., L 28,
Pusa Red, AFLR which yielded 21.66, 19.67, 22.50 t/ha,
respectively. Average bulb size was not significantly
affected by either the irrigation systems or the crop
geometry. Variety Indam Synth 3 recorded significantly
less bulb size (58.6 g) compared to the varieties L 28
(91.3 g) and AFLR (76.2g).
Effect of crop geometry and variety on bulb yield (t/ha) of
onion crop
Crop geometry Variety
L28 Pusa AFLR Indam Mean
Red Synth 3
2 rows/bed 21.36 18.15 20.18 16.50 19.05 a
3 rows/ bed 21.03 20.13 23.70 19.20 21.05 b
4 rows/bed 22.55 20.73 23.66 17.23 21.03 b
Mean 21.66 c 19.67 b 22.50 c 17.67 a 20.37
Means followed by same letter are not significantly (P < 0.05) different
according to Duncan’s Multiple Range Test.
44
3.3.2 Climate Change and Modeling
3.3.2.1 Hydrological drought pattern of Dhar
(MP) and Mewat (Haryana) districts and
introduction of water related interventions
Hydrological drought pattern of Dhar and Mewat
districts was studied to assess venerability to climate
change by analyzing the change in the groundwater
levels of the study area through a Standardized
Groundwater Level Index (SWI), which was computed
by dividing the difference between the seasonal ground
water level and its long-term seasonal mean, by
standard deviation. The SWI maps developed using
last 10 years pre- and post-monsoon ground water level
data were used for prioritizing blocks affected with
hydrological drought.
Using this information, suitable interventions for
enhancing usable water supplies and efficient water
utilization techniques were introduced in these
districts. Laser leveling in 15 ha area led to a saving of
about 15-20% water. Laying of about 3.07 km
underground pipeline (UGPL) in the farmers’ field in
the Mewat district was associated with an increase in
water delivery efficiency and a 40% saving in irrigation
water, 45% increase in irrigated area and 28% reduction
in the irrigation time. Deepening of open wells, rain
gun, sprinkler and drip systems, were also introduced
in the Dhar district.
3.3.2.2 Prediction of maize yield under future
water availability scenarios using AquaCrop
Model
An effort was made to integrate AquaCrop model
with a climatic data generator, ClimGen, and an
irrigation water requirement predicting model,
CROPWAT, to simulate grain yield predictions of kharif
maize. It was observed that sowing date of the crop
played a significant role in the maize yield variations,
under future climate change scenarios. The ClimGen
generated rainfall depths during the years 2012 (739
mm) and 2014 (596 mm), resulted in significant
variations (from 1.60 to 5.67 t/ha) in yield of kharif
maize under rainfed conditions with full fertilization
levels. This variation may be attributed to the amount
of rainfall and its distribution during entire crop

growing season in general and sensitive crop growth
stages in particular pertaining to the same sowing date
(22 nd July) of 2009 and 2010. During sensitive maize
growth stages, viz., tasseling and flowering, the
predicted rainfall depths are 5 and 57 per cent of the
total rainfall during the entire growth period of 2012
and 2014, respectively. Maize yield predicted by the
ClimGen-CROPWAT-AquaCrop modes, for the year
2011, was 5.46 t/ha. The grain yield under rainfed
condition predicted for 2012 is less than that of 2011
due to probably lower rainfall during the grain
formation stage in 2012. The predicted maize grain
yield, under full irrigation condition will be 5.8 t/ha
during the year 2014. Thus, combining the outputs of
ClimGen and CROPWAT in AquaCrop model was
observed to be a novel technique for estimating future
maize yields and irrigation water requirements under
changing climatic conditions.
3.3.2.3 Climate variability, crop water
requirement and groundwater
Time series analysis of important climatic
parameters, viz., minimum and maximum
temperature, relative humidity, wind speed and
sunshine hours; that control the crop water
requirement, was done to investigate the change in local
climate and its impact on the crop water requirement
of an agriculturally dominant South-West District of
National Capital Territory of Delhi. Mann-Kendall test
and Auto Regressive Integrated Moving Average
(ARIMA) models were used to establish the trend and
predict the weather parameters in 2030s. CROPWAT
model was used to estimate the water requirement of
the major crops and cropping systems, under the
climate change scenarios for the study area. The
scenarios considered predicted changes in climatic
parameters during 2030s using local weather data
(ARIMA prediction), INCCA predictions for 2030s and
IPCC predictions for 2100s.
The ARIMA predictions for 2030s showed an
increase in the average temperature by 0.26 o C, relative
humidity by 4%, and a decrease in wind speed and
daily sunshine hours. Crop water requirement under
all climate change scenarios increased except that
45
under the scenario generated using local climatic
parameters. Variably saturated model HYDRUS-1D
and groundwater model MODFLOW were calibrated
to assess the effect of climatic parameters on
groundwater behaviour. The study area was divided
into 11 land units based on the land use, soil type and
salinity levels using ArcGIS 9.3.1. The HYDRUS-1D
was used to simulate recharge flux from each land
unit. Simulations were done on daily basis to predict
groundwater recharge during pre-monsoon and postmonsoon
periods. The recharge fluxes obtained from
HYDRUS-1D simulations were given as input in
MODFLOW to predict the water table elevations.
Comparisons of observed and predicted water table
elevations (hydraulic heads) in different land units
and cells showed that they were fairly close and that
these models can be used to evaluate the effect of
climatic parameters on groundwater recharge and
availability.
3.3.3 In-situ Moisture Conservation in
Rainfed Area
3.3.3.1 Moisture and crop water stress based
evaluation of bio-engineering conservation
techniques for enhancement of productivity in
pearl millet-mustard cropping system under
rainfed condition
An experiment on evaluation of in-situ moisture
conservation techniques was started during kharif 2011
in WTC farm using bio-engineering measures, viz.,
trench-cum-bund (20 cm depth of trench and 20 cm
height of bund), bund (30 cm height), ridge and furrow
(15 cm height), skip row (3:1), basin tillage (45 cm × 45
cm) and control with three replications, so that moisture
stress and ultimately crop stress could be reduced and
productivity of the system enhanced. The test crops
were pearl millet in kharif and mustard in rabi and plot
size was 20 m × 3 m. It was found that basin tillage
method was better followed by ridge and furrow,
trench-cum-bund, bund, skip row and control in that
sequence with respect to availability of soil moisture,
less crop water stress, high relative water content and
grain and biomass yield. Crop water stress index of
0.42 was lowest and relative water content of 80.5%

Grain and biomass yield of pearl millet under various in-situ
moisture conservation measures
was highest in case of basin tillage method. Similarly,
grain and biomass yield of pearl millet in basin tillage,
ridge and furrow, trench-cum-bund, only bunds and
skip row was 80.7 and 66.3%; 58.8 and 55.9%; 51.5 and
26.7%; 38.5 and 4.0%; and 12.3 and 1.3%, respectively,
higher than control. Root length was highest in control
followed by skip row and was lowest in basin tillage.
Surface area and volume of root were highest in ridge
and furrow followed by skip row and control and was
lowest in basin tillage.
3.3.4 Micro-Irrigation Studies
3.3.4.1 Water management and fertigation in
bottle gourds through micro-irrigation
Micro-irrigation has been considered worldwide
as a way of maximizing water use efficiency (WUE)
by enhancing productivity. Optimal crop geometry
was developed to minimize lateral length and
system cost without affecting the crops yield. The
optimal crop geometry for bottle gourd (1.2 m × 0.60
m) was associated with the maximum overall
reduction of the cost of the drip system. The highest
yield of bottle gourd was recorded under weekly
fertigation (37.6 t/ ha) with 60% of crop ET c in microirrigation
system.
3.3.4.2 Yield of baby corn (Zea mays L.) under
different drip operating pressures and
fertigation schedules
Field experiments were conducted during October
2010- January 2011 and April 2011-July 2011 to evaluate
46
drip irrigation vis-à-vis furrow irrigation on
productivity of baby corn (hybrid maize, HM 4).
Highest yields of cob (8.98 t/ha), baby corn (1.82 t/ha)
and fodder (6.31 t/ ha) were recorded in bi-weekly
fertigation schedule followed by weekly fertigation
schedule (8.7, 1.76 and 6.22 t/ha), respectively. The
lowest yields of cob, baby corn and fodder were 7.64,
1.49 and 6.00 t/ha, respectively) under fortnightly
fertigation frequency. The higher values of WUE were
recorded during October 2010 to January 2011 season.
The highest value of WUE was 6.3 kg/ha/ mm under
bi-weekly fertigation frequency schedule. Highest
fertilizer nitrogen use efficiency of 6.9 kg yield/kg urea
was recorded under the same fertigation frequency
schedule during April 2011- July 2011.
3.4 INTEGRATED NUTRIENT
MANAGEMENT
3.4.1 Enhancing N-Use Efficiency in Pearl
Millet-Wheat System
A field experiment was conducted with pearl
millet-wheat cropping system to study the effect of
different organic manures, viz., FYM or sulphitation
pressmud (SPM) at 10 t/ha, or Sesbania green manuring,
N rates (pearl millet: 0, 40, 80 and 120 kg N/ha and
wheat: 0, 80, 120 and 180 kg N/ha) and N scheduling
(i.e. conventional and modified N-split) on N use
efficiency (NUE) on a sandy loam Typic Haplustept of
IARI Farm. The results indicated that instead of
conventional N application in 3-splits, i.e., basal
dressing + 2 top-dressings, skipping of basal N for one
additional top-dressing led to substantial increase in
yield, agronomic efficiency and recovery efficiency of
N in pearl millet and wheat. The yield of crops also
increased with different organic manures and the
highest grain yield was recorded with SPM followed
by green manuring. The optimum rate of fertilizer N
was relatively smaller with the modified N splits as
also with inclusion of organics. The mineral N content
of surface soil was higher under modified N scheduling
compared to conventional application, wherein NO 3 -
N moved to deeper soil layers.

Effect of organics, N rates and N scheduling on the yield of pearl millet and wheat
3.4.2 Effect of Integrated Nutrient Supply on
Yield, Nutrient Uptake and Soil Health
under Maize-Wheat Cropping System
Effect of different manures, viz., vermicompost,
NADEP compost and FYM on crop productivity and
soil health was evaluated after completion of 4 th
cropping cycle under maize-wheat cropping system.
Treatments consisted of T 1 : Control; T 2 :
Recommended dose of NPK fertilizers (100%); T 3 :
Vermicompost @ 5 t/ha; T 4 : NADEP compost @ 5 t/
ha; T 5 : FYM @ 5 t/ ha; T 6 : 50% RDF + Vermicompost
47
@ 5 t/ha; T 7 : 50% RDF + NADEP compost @ 5 t/ha;
and T 8 : 50% RDF + FYM @ 5 t/ha. Integrated use of
manure and 50% RDF (recommended dose of
fertilizers) was superior to 100% RDF as far as
nutrient uptake and yield of crops were concerned.
Addition of composts and chemical fertilizers
improved Walkley and Black C (WBC), microbial
biomass C (MBC), labile C (LBC) and mineralizabale
C as well as biological properties like dehydrogenase
activity (DHA), �-glucosidase activity and
fluorescein diacetate hydrolase activity (FDA)
compared to control at harvest of both the crops.

Soil organic carbon pools as affected by value-added organic manures and chemical fertilizers in a maize-wheat cropping
system (after 4 cropping cycles)
Treatment Walkley Microbial biomass C Labile C Mineralizable C
Black C (%) (mg/ kg) (mg/ g) (mg /kg/ d)
Maize Wheat Maize Wheat Maize Wheat Maize Wheat
T1 0.36 0.38 212 217 0.96 0.80 8.9 8.7
T2 0.53 0.54 262 284 0.84 1.06 12.7 11.3
T3 0.61 0.63 282 290 1.19 1.17 18.7 15.1
T4 0.59 0.62 276 284 1.20 1.40 15.5 13.8
T5 0.60 0.63 277 281 1.74 1.19 18.1 12.9
T6 0.65 0.64 292 298 1.88 1.55 19.7 16.4
T7 0.62 0.63 283 288 0.96 0.92 17.5 15.6
T8 0.63 0.60 302 305 1.85 1.01 18.4 13.5
CD (P=0.05) 0.06 0.17 33 37 0.12 0.11 1.78 1.31
T : Control; T : Recommended dose of NPK fertilizers (100%); T : Vermicompost @ 5 t/ ha; T : NADEP compost @ 5 t/ha; T : FYM @ 5 t/ha; T : 50% RDF +
1 2 3 4 5 6
Vermicompost @ 5 t/ha; T : 50% RDF + NADEP compost @ 5 t/ha; T : 50% RDF + FYM @ 5 t/ha
7 8
3.4.3 Evaluation of STCR-Based Fertilizer
Recommendations for Targeted Yields of
Pearl Millet–Wheat Cropping Sequence
In a field experiment, soil test crop response (STCR)
correlation based fertilizer recommendations for
targeted yield were evaluated in pearl millet–wheat
cropping system. The treatments were T 1 : 20 t FYM/ha
in each crop; T 2 : STCR-based integrated fertilizer dose
with 10 t FYM/ha; T 3 : STCR-based fertilizers dose; and
T 4 : Control. The results indicated that increase in grain
yield due to treatments T 1 , T 2 and T 3 over control was
121, 203 and 159%, respectively. The highest grain
yields of pearl millet (2.85 t/ha) and wheat (5.32 t/ha)
were recorded under STCR-based integrated fertilizer
recommended dose plus 10 t FYM/ha (T 2 ). The STCR–
based fertilizer recommendation (T 3 ) alone failed to
attain the targeted grain yield (5.0 t/ha) of wheat, which
fall short by 7% of the target.
3.4.4 STCR-Based Fertilizer Prescription for
Aromatic Hybrid Rice
In a field trial, mean nutrient requirement for
producing one quintal of grain of hybrid rice (variety
48
PRH 10) was worked out as 1.93 kg of N, 0.33 kg of P
and 0.21 kg of S. The mean per cent contributions from
soil N, P and S were computed as 25.8, 35.9 and 15.8,
respectively; the corresponding figures for applied
fertilizers were 35.6, 34.81 and 31.7. The mean per cent
contributions of N, P and S from FYM were 22.1, 10.7
and 11.0, respectively. Based on these basic data, STCRbased
fertilizer prescription equations for aromatic
hybrid rice (PRH 10) were developed for Inceptisol,
New Delhi.
Soil test based fertilizer prescription equations involving
IPNS for targeted yield of aromatic hybrid rice
Nutrient supply Fertilizer prescription equation
NPS alone FN = 5.41 T – 0.72 SN
FP = 0.94 T – 1.03 SP
FS = 0.67 T – 0.50 SS
NPS + FYM FN = 5.41 T – 0.72 SN – 0.62 FYMN
FP = 0.94 T – 1.03 SP – 0.31 FYMP
FS = 0.67 T – 0.50 SS – 0.35 FYMS
Note: FN, FP and FS – fertilizer N, P and S in kg/ha, respectively; T- target
yield in q/ ha; SN, SP and SS – Alkaline KMnO – N, Olsen’s-P and 0.15%
4
CaCl extractable S in kg/ha, respectively; FYMN, FYMP and FYMS - FYM
2
N, P and S in kg/ha, respectively.

3.4.5 Enrichment of Indian Spinach (Beta
vulgaris) with Soil Application of Zinc along
with Organics
In a greenhouse experiment, effect of four levels
of Zn (0, 5, 50 and 100 mg/kg soil) and three levels of
organics (control, 3% FYM and 3% sewage sludge) was
evaluated on Zn content in shoot of Indian spinach
grown on acid and alkaline soils. Results indicated that
shoot Zn content increased to the tune of 1.49, 4.08,
and 5.01 fold due to application of 5, 50 and 100 mg
Zn/kg, respectively over control. As far as dry matter
yield is concerned, the crop responded positively to
application of 5 mg Zn/kg in alkaline soil, while such
response was conspicuously absent in acid soil. In case
of alkaline soil, significant reduction in dry matter yield
occurred only at 100 mg Zn/kg, whereas such reduction
in acid soil was recorded even at 50 mg Zn/kg.
Application of Zn even at highest level in alkaline soil
proved to be safe in relation to risk associated with the
consumption of this Zn-enriched spinach by humans.
In acid soil, Zn application rate should to be restricted
to below 50 mg/kg.
3.5 NUTRIENT MANAGEMENT
3.5.1 Standardization of Leaf Colour Chart,
SPAD and Fieldscout CM 1000 Meter for
Fixed Time Adjustable Nitrogen
Management for Aromatic Hybrid Rice
Leaf colour chart (LCC) and non-destructive
chlorophyll meters (SPAD and Fieldscout CM 1000
chlorophyll meter) were evaluated for site-specific
nitrogen management in aromatic rice hybrid PRH 10.
For this purpose, a field experiment was conducted
with four levels of nitrogen (0, 70, 140 and 210 kg/ha).
A positive and significant (R 2 =0.98,) quadratic response
between N levels and grain yield was observed.
Quadratic equation was used to determine economic
optimum grain yield (6.39 t/ha) corresponding to
economic optimum dose of 144 kg N/ha for PRH 10.
Nitrogen concentration in fully expanded youngest leaf
correlated significantly and positively with LCC score,
Minolta SPAD value, Fieldscout CM 1000 value and
total chlorophyll content at tillering, panicle initiation
and flowering. Two chlorophyll meters were calibrated
49
and a significant linear response was obtained as ‘CM
1000 reading = 10.71SPAD – 195.6’ (R 2 =0.84) based on
observations at three critical growth stages. The average
optimum LCC score, Minolta SPAD, CM 1000 values,
chlorophyll content and leaf N concentration to fetch
economic optimum yield were found to be 4.4, 45.1,
279.2, 2.0 mg/g fresh weight and 2.8%.
3.6 ORCHARD MANAGEMENT
3.6.1 Ameliorating Salt Stress in Kinnow
using Triazole Compounds
To examine the comparative protective potential
of triazole compounds in mitigating the salinity stress
in Kinnow plants. One and a half-year-old Kinnow
(Citrus nobilis × C. deliciosa) plants budded on Jatti khatti
(Citrus jambhiri Lush) were irrigated with 0 or 50 mM
NaCl with or without triazoles compounds.
Paclobutrazol (PBZ) at 100 mg L -1 and triazole (TRZ),
tria-dimefon (TDM) and hexaconazole (HEX) at 20 mg
L -1 were soil-drenched one week prior to NaCl
treatment. Leaf area was reduced by triazoles
treatments, while LWR increased under both
conditions. Maximum (1.4-fold) improvement in LWR
was observed in the PBZ-treated plants in the presence
of NaCl. PBZ, TRZ and TDM were equally effective in
preventing chlorophyll degradation under NaCl stress.
The improvement in catalase (CAT) activity was higher
in the TRZ- and TDM-treated plants under stress, while
TRZ, PBZ and TDM were equally effective on
superoxide dismutase (SOD) activity. Influence on the
peroxidase (POX) activity was more in the TDM-treated
plants. Application of TDM and HEX had more
pronounced effect on up-regulation of proline content
under stress. Triazole compounds increased
accumulation of K + and Ca 2+ ions and inhibited
accumulation of Na + and Cl - ions. In the PBZ-treated
plants, K + /Na + and K + /Cl - ratios in leaf tissues increased
by 2.4 and 2.1-fold, respectively, compared to plants
treated with NaCl alone, while HEX had more striking
effect on Ca 2+ upregulation and caused 1.5-fold increase
in the leaf Ca 2+ content. Among different triazole
compounds, PBZ and TRZ seem to be more effective
in protecting Kinnow plants budded on Jatti khatti
under NaCl stress.

3.7 PROTECTED CULTIVATION
TECHNOLOGY
3.7.1 Vegetable Crops
3.7.1.1 Evaluation of insect-proof net house for
hybrid seed production in summer squash
Seed production of summer squash is limited to
the hills of Himachal Pradesh and Uttarakhand mainly
because of the problem of summer squash mosaic virus
incidence during summer season in northern plains of
India. Therefore, insect-proof net house and open field
conditions were evaluated for seed production of
summer squash. Twenty-day old seedlings of summer
squash (var. Australian Green) were transplanted on
12 th February , 2011 under insect- proof net house and
open field conditions on raised beds equipped with
drip fertigation system. Insect-proof net house grown
seed crop was found to be completely free from the
incidence of summer squash mosaic virus, whereas
there was 60% incidence of summer squash mosaic
virus under open field seed crop. Insect-proof net house
50
grown seed crop produced significantly higher number
of fruits per plant (1.2 fruits/plant), seed yield per fruit
(57.7 g/fruit), seeds per fruit (406.6 seeds/fruit) and seed
yield (692 kg/ha) compared to the seed crop grown
under open field condition. Open field grown seed crop
could produce only 0.5 fruits /plant, 23.05 g seed yield/
fruit, 144 numbers of seeds/fruit and 115 kg seed yield/
ha. It was concluded that summer squash seed can be
produced successfully under northern plains of India
during summer season under Insect-proof net house
conditions.
3.7.1.2 Techno-economic feasibility of shade net
house for mint and green coriander cultivation
during peak summer season
Techno-economic feasibility of shade net house
fabricated by covering black colour shade net of 60%
shading intensity was evaluated for mint cultivation
during peak summer months (April to July) of 2011.
Mint and coriander crops were planted on 5 th April,
2011 on raised beds equipped with drip fertigation
system. Harvesting of mint was started in the 2 nd week
Open field cultivation of summer squash Insect-proof net house cultivation
Virus infestation in open field Fruit development under net house

of May and continued up to 2 nd week of July 2011.
Harvesting of green coriander was started on 20 th May,
2011 and continued up to 15 th June, 2011. Total period
of mint harvesting was 75 days, whereas it was only 25
days for green coriander. Total green leaf yield of mint
was 4.06 t/ ha, whereas as it was 3.20 t/ha in green
coriander. Mint and coriander cultivation under shade
net house during peak summer months is highly
profitable, giving a cost benefit ratio of 1:2.50 and 1:2.4,
respectively, in the northern plains of India.
Mint cultivation under shade net house
3.7.1.3 Techno-economic suitability of insectproof
net house for tomato cultivation
Insect-proof net house, fabricated in a design of a
greenhouse only with less than half of the fabrication
cost spent on a naturally ventilated greenhouse, was
evaluated for its techno-economic suitability for tomato
cultivation. Thirty-day old tomato (var. G.S. 600)
seedlings were transplanted on 26 th October 2010 on
raised beds equipped with drip irrigation system like
greenhouse at a spacing of 40 cm × 50 cm. Tomato plants
were vertically trained and pruned like greenhouse
tomato crop. October-transplanted tomato crop
51
Insect proof net house design
Tomato cultivation in insect proof net house
continued up to the end of May 2011 and produced
7.0 t of tomato fruit yield in around 7 months duration
from 1000 m 2 insect- proof net house with a cost benefit
ratio of 1:2.40. In conclusion tomato cultivation under
insect-proof net house (fabricated in greenhouse
design) is highly suitable and economical for tomato
cultivation during October - May in northern plains of
India.
3.7.1.4 Management of root-knot nematodes in
greenhouse tomato
An experiment was undertaken to address the
problem of root-knot nematode, Meloidogyne incognita,
of tomato in greenhouse with the application of FYM
and three fumigants, namely, STTC, metam sodium
and dazomet either alone or in combination with each
other. Results revealed that the combined treatment of
FYM and fumigants significantly reduced the mortality
including root gall index caused by Meloidogyne
incognita. Treatment with metam sodium gave
significant results wherein the gall index was reduced
significantly at 2.27 compared to 4.93 in control. The

final nematode population was the least in the
treatment of metam sodium + FYM at 1.17 /cm 3 soil
compared to 4.77/ cm 3 soil in control.
3.7.1.5 Evaluation of parthenocarpic cucumber
varieties under newly designed naturally
ventilated greenhouse
Four varieties of parthenocarpic cucumber, viz.,
Kian, Satis, Asma and Aviva were evaluated in a newly
designed naturally ventilated greenhouse equipped
with low pressure drip fertigation system during rainy
and winter seasons. The rainy season crop was
transplanted on 5 th July 2011. Out of four varieties, Kian
took minimum period for first harvesting (30 days)
after transplanting and produced highest fruit yield
(2.08 kg/plant and 74.9 t/ha) with maximum cost benefit
ratio of 1:2.20 compared to other three varieties during
rainy and post-rainy seasons. On the other hand, Satis
produced highest fruit yield (1.70 kg/plant and 61.2 t/
ha) with maximum cost benefit ratio of 1:2.12 during
winter season.
Cucumber cultivation in newly designed naturally ventilated
greenhouse
3.7.1.6 Evaluation of summer squash varieties
under plastic low-tunnels during winter season
Six summer squash varieties, viz., Australian
Green, Pusa Alankar, Ducato (long-shaped fruits),
Chand, Chandrika and DS 8 (round-shaped fruits) were
evaluated under plastic low-tunnels for their off-season
cultivation during winter season. Twenty five-day old
seedlings of all the varieties/hybrids were transplanted
52
on raised beds equipped with drip fertigation system
on 15 th December 2011 and same day plastic low tunnels
were stretched over the beds in the afternoon. The
plastic of low tunnels was removed from the crop in
first week of February. Among the long-fruit shaped
varieties, hybrid Ducato produced highest fruit yield
(68 t/ha), whereas among the round-shaped varieties,
hybrid Chand produced highest fruit yield (40 t/ha)
compared to other varieties/hybrids.
3.7.2 Flower Crops
3.7.2.1 Evaluation of chrysanthemum varieties
suitable for cut flowers
Thirty-two chrysanthemum (10 standard and 22
spray type) cultivars were evaluated for cut flower
production under low cost polyhouse condition.
Cultivars, Casagranda, Silk Brokect, Kangriku, Frosty
Wisher, Diamond Jubilee and Yellow Star recorded the
required stem length (> 60 cm) and flower size (>55
cm 2 ). However, among the spray type varieties, Jaya,
Liliput, Little Orange, Pusa Anmol, Sunny and Yellow
Charm proved to be suitable, followed by Haldighati,
Aprajita and Little Pink.
3.7.2.2 Standardization of techniques for rooting
of cuttings in chrysanthemum
In chrysanthemum 5-7 cm long soft terminal
cuttings were taken from healthy mother stock plants
during June-July. Basal leaves were removed and upper
leaves retained for photosynthetic activities. The basal
ends of terminal cuttings were treated with rooting
hormone indole butyric acid (IBA) (500 ppm) for 20
minutes and planted in a four different types of
media,viz., T 1 : Coco peat, vermiculite and perlite mixed
in 3:1:1 ratio (v/v), filled in multi-celled plastic protrays;
T 2 : Soil + sand + FYM (1:1:1); T 3 : Sand; and T 4 :
Soil. Minimum of 70% relative humidity was
maintained. Out of four treatments tried, terminal
cuttings propagated in media consisting of coco peat,
vermiculite and perlite in 3:1:1 ratio (T 1 ) gave the best
results with 95-100% survival rate of the rootings. These
artificial media being porous in nature provides better
aeration to roots, maintain optimum moisture level and
maintain sustained supply of nutrients for healthy
growth of cuttings.

Rooted cuttings being raised in multi-celled plug trays
3.7.2.3 Evaluation of gladiolus varieties under
drip fertigation
Three varieties of gladiolus, viz., Spic and Span
(pink), Amsterdam (white), and Peter-Pears (peach)
were evaluated for production of corms and cormels
under drip fertigation on raised beds under open field
conditions during winter season.
Comparative performance of gladiolus varieties under Delhi conditions
Variety Plant Days to Days to Duration of No. of Floret Spike Rachis
height spike first floret flowering florets/ size (cm) length length
(cm) initiation opening (days) spike (cm) (cm)
(days) (days)
Peter Pears 87 84 103 17 14.2 11.0 79 47
Amsterdam 112 91 105 13 15.2 10.5 90 49
Spic and Span 99 96 104 10 16.2 10.8 85 48
Evaluation of gladiolus production parameters of corms and cormels
Variety/Flower No. of No. of Weight of Weight of Corm
colour Corms/plant Cormels/plant corms/plant (g) cormels/plant (g) diameter (cm)
Peter Pears (Peach) 1.4 16.8 32.25 2.48 4.22
Amsterdam (White) 1.4 23.2 36.96 3.21 4.06
Spic and Span (Pink) 1.6 22 39.42 3.71 4.28
Out of these varieties, Amsterdam produced
good number of cormels (23) and quality flowers
with spike length of 90 cm with rachis length of 49
cm compared to other varieties. It is concluded that
healthy bulbs and cormels can be produced with no
incidence of Fusarium wilt under drip fertigation in
gladiolus crop.
53
3.7.2.4 Effect of shading on tuberose flower
production
Effect of 50% shading on tuberose flower crop (var.
Prajwal) was assessed during summer and rainy season
under drip fertigation system. Results revealed that the
crop under 50% shading delayed flowering (Aug. -
Nov.) compared to control (without shading). The other
major impact of shading observed was in terms of
minimum emergence of weeds during rainy season
compared to control. Thus, providing shade may be a
beneficial technology for farmers to control enormous
Effect of shading on tuberose crop during summer and
rainy seasons
Particulars Weed intensity Months Flowering
Control (No shade net) High July - Oct. Early (July
to Oct.)
50% Shade net Very low July - Oct. Delayed
(Sept. to Dec.)
growth of weeds; it also helps in regulating flower
supply to avoid surplus of cut flower in the market.
3.7.3 Drip Irrigation
3.7.3.1 Studies on evaporation control measures
at lined-reservoir
Experiments were carried out in the lined-reservoir

located at the CPCT farm for evaporation control
measures during peak summer of May and June, 2011.
Cetyl alcohol was tested along with black and white
shade net and control condition. Black shade net
followed by white shade net was found to be most
effective in controlling evaporation from the linedreservoir
during peak summer. Black shade net was
able to control up to 50 per cent while white shade up
to 30 per cent evaporation in comparison to open
control condition. Cetyl alcohol was not able to
significantly control evaporation due to breaking of film
on the top surface of the reservoir due to frequent
strong winds blowing during the peak summer.
Experimental set up and results for evaporation control measures
study
3.7.3.2 Standardization of crop water
productivity (CWP) and fertigation scheduling
of brinjal
The total crop water requirement (CWR) was found
to be 2430 m 3 /ha for brinjal cv. Pusa Uttam grown under
pressurized drip fertigation system. Two sets of
tensiometers installed at the depth of 30 and 60 cm were
found to be suitable for fertigation-scheduling of one
hectare area. Fertigation dosage and scheduling were
standardized. The total number of irrigations during
the entire duration of crop were 34. The crop water
productivity was found to be 16.67 kg /m 3 and the total
yield was 40 t/ha.
3.7.3.3 Studies on soil-less cultivation for
vegetables in greenhouse
Hydroponic studies in the form of soil-less
cultivation of tomato, capsicum and cucumber were
conducted in greenhouse. Black plastic trays were filled
with coco-peat, perlite and vermiculite in the ratio of
90:5:5, respectively. Drip fertigation was laid out in the
80 cm wide tray. Two rows of crops were laid out with
two laterals of 16 mm line with 2 lph dripper. The total
54
Layout of soil-less system for growing vegetables in a greenhouse
crop water requirement was found to be 60, 50 and 15
cm, which was 3.0, 2.5 and 3.0 times higher than crop
water requirement, respectively, for soil-less tomato,
capsicum and cucumber grown in winter season (Nov.
- Jan.) under protected cultivation.
3.7.3.4 Effect of Pusa Hydrogel on drip-irrigated
chrysanthemum
Trials were conducted to study the response of
Pusa Hydrogel on drip irrigated chrysanthemum var.
White Star and Thia Chen Queen. Pusa Hydrogel was
basally applied @ 10 g/hole before the planting of the
rooted cuttings. Planting geometry was maintained at
15 cm × 15 cm and one lateral per row was used with
dripper discharge of 2.0 lph. The volumetric moisture
content (�) was found to be about 10 per cent higher in
the soil applied with Pusa Hydrogel. The tensiometer
reading (centi bars) was found to be about 9-10 per cent
lower in the soil treated with hydrogel.
Experimental layout for Pusa Hydrogel on drip irrigated
chrysanthemum

Effect of Pusa Hydrogel on soil characteristics under drip irrigated chrysanthemum
Date With Pusa Hydrogel Without Pusa Hydrogel
Volumetric EC(dS m -1 ) Soil moisture Volumetric EC(dS m -1 ) Soil moisture
moisture tension moisture tension
content (�����) (centi bars) content (�����) (centi bars)
15-1-12 20.3 1.20 21 18.5 1.25 23
24-1-12 19.2 1.28 20 18.7 1.29 22
05-2-12 21.5 1.18 22 20.2 1.20 24
20-2-12 21.4 1.16 22 20.3 1.24 23
04-3-12 21.6 1.18 21 20.2 1.20 24
15-3-12 21.5 1.17 22 20.1 1.20 23
3.8 AGRICULTURAL ENGINEERING
3.8.1 Development of Aqua-Ferti-Seed Drill
for Chickpea
In a laboratory experiment, the Rhizobiuminoculated
seeds and uncoated seeds were sown at three
levels of moisture content of 100, 75 and 50% of field
capacity. At the 50% field capacity, the time of emergence
was prolonged to 8-12 days. Aqua-fertilizer seed drill
was evaluated for chickpea using both coated and
uncoated seeds. Physical properties of uncoated and
biofertilizer coated chickpea seeds were determined for
design of metering mechanism. Uncoated and
biofertilizer coated chickpea seeds had length, breadth
and thickness of 9.01±0.62 mm, 7.059±0.69 mm, 6.57±0.54
mm and 9.06±0.44 mm, 7.14±0.90 mm, 6.90±0.22 mm,
respectively; roundness and sphericity 87.23±2.13%,
87.36±2.72% and 81.6±3.07%, 82±4.15%; geometric mean
diameters 7.32±0.45 mm and 7.33±.45 mm; angle of
repose for mild steel surface 26.9±5.61 and 29.51±4.23
degree, respectively. For uncoated seed, average visible
seed damage was 6.16, 7.28 and 12.3% for nylon,
wooden and mild steel rollers, respectively; whereas
for coated seed, average visible damage was 7.56, 8.38
and 14.0%, respectively. The average field capacity and
field efficiency of the machine was 0.32 ha/h and 71%,
respectively.
3.8.2 Development of Mechanical Hydrogel
Applicator
Physical properties of hydrogels relevant to
machine design were determined for designing suitable
55
mechanical hydrogel applicator. The hopper was
designed based on average angle of repose, coefficient
of friction and bulk density of the different sizes of
hydrogel granules and sand. Free flow of granules in
the hopper was influenced by angle of repose and
coefficient of static friction. Geometric mean diameter
was maximum of 1.41±0.06 mm for MS18 size hydrogel
and it was 1.17±0.10 mm and 0.66±0.06 mm for MS25
and MS36, respectively. A mechanical hydrogel
applicator was designed and developed for uniform
application of hydrogel at the rate of 3.0 kg/ha. In
laboratory, three metering mechanisms, namely, star
wheel, screw feed and brush feed were tested for three
treatments, viz., hydrogel mixed with soil, fertilizer and
sand, respectively. The screw feed made of nylon rod
(48 mm × 50 mm) having nine grooves, was the best
metering mechanism for optimum application of
hydrogel. The other components of the hydrogel
applicator, viz., power transmission, ground wheel,
hydrogel feed hopper, and transparent hydrogel feed
tubes were also designed. The applicator was finally
mounted with the existing aqua-ferti-seed drill and
calibrated with different combinations of hydrogel
mixed with sand, soil and fertilizer. The hydrogel and
sand mixture was the best among three levels of
mixture based on the performance of uniform
scattering of granules over sticky belt. The average
granules obtained per ha for the screw feed metering
mechanism were 2667, 2917 and 2942 g when hydrogel
and sand mixture were used. The effect of hydrogel on
crop growth and yield parameter was significant. The
average hydrogel size of MS36 maximized the yield

Mechanical Hydrogel Applicator Carrot Planter in operation
and crop growth parameters. The applicator was
evaluated for sowing of wheat variety WR 544 (Pusa
Gold). The forward speed of tractor machine system
was 3.0 km/hr with sowing depth of 5 cm; and
recommended practices of wheat cultivation were
followed. Yield of wheat with hydrogel mixed with
sand was 180% higher than that of control plot.
3.8.3 Evaluation of Carrot Planter
The mechanical carrot planter was field-evaluated
for its performance with uncoated carrot (S 1 ), biogas
slurry coated (S 2 ) and thirame coated (S 3 ) seeds. It
recorded a draft of 3.78 kN during the operation as the
machine was single bed only. The average depth of seed
placement was 2.03 cm, against the recommended
depth of 2.50 cm; average field capacity 0.22 ha /hr for
continuous operation at an average speed of 1.56 kmph
and field efficiency of 76.4 per cent. The multiple and
missing indices both were large (15.7%) for the
treatment S 1 .
For the treatment S 3 , the quality of feed index was
higher (82.9%) with the coefficient of variation of 0.032
and standard deviation of 2.63. The optimum plant
population per meter length of bed was 72 for biogas
slurry-coated seed (S 2 ) against theoretical population
of 80 plants per meter length of bed. The higher carrot
root dimensions (length and diameter) were observed
56
for treatment S 2 (21.92 cm and 3.37 cm) as t-test showed
significant difference between all the treatments. There
was a significant difference in the yield between the
treatments S 1 and S 2 , S 2 and S 3 . The highest yield of 20.14
t/ha was observed for treatment S 2 . Saving of 56% in
the cost of planting was obtained in comparison to
manual planting.
3.8.4 Development of Semi-Automatic and
Automatic Metering System for Garlic
Cloves
The semi-automatic system was developed for
precision metering of garlic cloves. Two types of seed
plates were tested over sticky belt for quality of feed
index, multiple index, miss index and clove damage.
The seed plates were 235 mm in diameter and 24 mm
in thickness having 21 equally spaced cells. One plate
had 17.5 mm × 17.5 mm square cells and second plate
had 15.5 mm circular cells. The quality of feed index
was more than 90% for both the seed plates without
any seed damage. The miss index for the seed plate
with circular hole was 4% compared to 9% for the seed
plate with square holes. Though the singulation of
garlic cloves was achieved by the metering system, the
operational difficulties for change of seed plates while
the machine is still in operation makes the use of
automatic metering system more favourable. Hence,

the automatic metering system was designed using
inclined plate. The cell size was designed considering
the shape and size of the garlic cloves. The automatic
metering system was tested over sticky belt and the
clove spacing was recorded. The quality of feed index
obtained was 81%, the miss index and multiple indexes
were 8 and 11%, respectively. The inclined plate
metering system has been selected for use in the final
prototype development.
3.8.5 High Capacity Pusa Compost Sieving
Machine
Compost making by heap method and its handling
needed to be mechanized. The mechanization of unit
operations like mixing of different substrates including
water and microbial culture for fast decomposition and
turning of heap of cow dung and biomass and other
Seed plates of the semi-automatic metering system
Testing of automatic metering system over greased belt
57
materials were accomplished earlier by developing
compost mixer cum turner, tractor front mounted
loader and sieving machine with low capacity. These
equipments were intensively used in biomass
enrichment centre. During the year 2011-12 the machine
for sieving the compost for separating the finer grades
with 5 t per day capacity was developed. The machine
is provided with automatic belt feeding mechanism,
compost separator unit and hopper for safe feeding and
belt conveyor based unit for conveying the finished
quality compost. The specifications of the machine were
as follows:
Utility: Sieving of compost for separating the finer
grade from coarse grade
Power source: Three-phase electric motors (2 hp, 3 hp
and 3 hp)

Pusa Compost Sieving Machine Basmati Rice Thresher
Capacity (estimated): 5 t per day
Approximate Cost: Rs. 5,00,000/-
Advantages: Separation in different sizes for value
addition (smaller grades are used in pots)
Payback period (estimated): 30 months
3.8.6 Development of Basmati Rice
Threshing System
The basmati rice cultivar is very sensitive to
mechanical abuses. Considering the operational
(labour, time and quality) as well as economic aspects
of basmati threshing, Basmati Rice Threshing system
has been developed. It is an axial flow type threshing
system. In order to minimize mechanical injury to rice
kernel, spike tooth type HDPE lined beater was
optimized. Thresher was tested for different
operational parameters, e.g., cylinder rotation speed,
concave grate clearance, blower speed to optimize
operational parameters for the best performance. It was
found that 610 rpm with 5 degree gradual decreased
concave grate clearance of 8 mm and 5.2 m/s air speed
of cylinder rotation and concave grate clearance and
air velocity of blower, respectively was optimum for
threshing and separation. The through put capacity of
thresher was found to be 1600 to 1800 kg/hr. It could
be operated through tractor PTO so that threshing
could be completed at field. It reduces the cost of
transportation of harvested mass as well as reduces the
transportation and handling losses. The threshed
58
product was assessed with X-ray radiography for
internal injury level. The x-ray radiographic analysis
depicted that the thresher was able to control the
mechanical abuses during threshing efficiently.
3.8.7 Farm Operation Services
3.8.7.1 Farm operation management
The farm operation service unit (FOSU) acquired
experimental plot combine harvester (Zurn make)
which is able to harvest and thresh simultaneously
many crops such as rice, wheat, soybean, mungbean,
urdbean and pearl millet. The combine was tested and
used successfully in the kharif season of 2011 and rabi
season of 2011-12 for wheat, gram, etc.
Experimental Plot Combine Harvester in operation

3.8.7.2 Irrigation system management
The FOSU has reduced the dependence on canal
water through development and renovation of old tube
wells at IARI farm. For efficient distribution of
irrigation water and to improve the conveyance
efficiency of irrigation system at IARI farm,
construction of 2850 m of pucca channel with check
gates at every 10 m was completed. These channels
would save 20 to 30% of irrigation water which was
wasted due to seepage/conveyance of water in unlined
field channels. Further, the FOSU introduced online
indenting facility through IARI intranet for operations
of farm machinery/equipments and irrigation system
on the IARI experimental farms.
3.8.7.3 Biomass /crop residue management
The FOSU, with close collaborative efforts of
Divisions of Agronomy and Agricultural Engineering,
has initiated work on collection and transportation of
crop residues and other biomass produced at the IARI
experimental farm for preparing compost/FYM.
Approximately 1000 t of crop residue/biomass from
various corners of IARI farm was lifted and
transported to the site of “Biomass Utilization Unit”,
IARI for value addition. This innovation has led to
the complete utilization of farm residues and other
biomass on the campus and their conversion to the
compost/FYM. This initiative has led to selfsufficiency
in term of periodic need of compost/FYM
for the IARI experimental farm.
3.9 RICE-WHEAT CROPPING
SYSTEM
3.9.1 Influence of Nutrient Management and
Growing Conditions on Rhizospheric Traits,
Productivity and Quality of Rice Varieties
in Rice–Wheat Cropping System
A field experiment was conducted to evaluate the
effect of growing conditions (puddled and aerobic) and
nutrient management (control, 100% RDF and 50% RDF
+ 50% N through FYM) on productivity and
rhizospheric environment of three rice varieties, viz.,
PRH 10, Pusa Sugandh 5 and IR 64) grown in rice-wheat
cropping system.
59
A comparative view of direct seeded and transplanted rice
Higher grain yield of rice was recorded under
transplanted (puddled) condition (4.8 t/ha) compared
to direct seeded (aerobic) rice (4.58 t/ha). The highest
grain yield was recorded under the treatment which
was supplied 50% RDF+50% N through FYM (5.18 t/
ha) compared to 100% RDF (5.10 t/ha) and the yield
was lowest in control (3.79 t/ha). Among rice varieties,
the highest grain yield was recorded with PRH 10 (5.08
t/ha) followed by Pusa Sugandh 5 (4.75 t/ha) and IR 64
(4.24 t/ha).
Higher activity of acid and alkaline phosphatase
enzyme were found under transplanted rice (TPR) than
direct seeded rice (DSR), while higher dehydrogenase
activity was recorded under DSR compared to TPR.
The highest activity of acid phosphatase and
dehydrogenase were found in 50% RDF+50% N
through FYM application compared to 100% RDF and
it was lowest in control. Highest activity of alkaline
phosphatase was recorded in the conjoint use of 50%
RDF and 50% N through FYM followed by control and
100% RDF. The acid phosphatase activity was the
highest in Pusa Sugandh 5 grown soil followed by PRH
10 and IR 64, while alkaline phosphatase activity was

the highest in PRH 10 grown soil followed by IR 64
and was lowest under Pusa Sugandh 5. The
dehydrogenase activity was the highest under IR 64
and Pusa Sugandh 5 grown soil. The higher root length,
root volume and root surface area were recorded in
DSR compared to TPR; however, the root diameter
followed the reverse trend. The highest root length, root
diameter and root volume were recorded with 50%
RDF+50% N through FYM compared to control; the
shortest roots were recorded with 100% RDF. Among
varieties, the maximum root length was found in Pusa
Sugandh 5 and the minimum in IR 64.
3.9.2 Conservation Agriculture for
Improving Resource-Use Efficiency and
Productivity in Rice-Based Cropping System
In an experiment studied in 2010, the performance
of several conservation agriculture practices like directseeded
rice (DSR) with or without Sesbania brown
manuring, rice residues mulch in wheat and summer
mungbean grown for grains and stover incorporated
as green manure was compared. In the rice-wheat
cropping system, rice yields obtained under
conventional puddled transplanted rice (TPR) – zerotill
wheat (ZTW); TPR – conventional till wheat (CTW);
mungbean residues (MBR) + DSR - ZTW + rice residues
(RR) + summer mungbean (SMB); DSR + brown
manuring (BM) - ZTW + RR; and DSR – zero-till wheat
(ZTW) were comparable among themselves, but higher
than other treatments, indicating that DSR with suitable
practices could be a possible alternative to TPR. Sesbania
for brown manuring in DSR, producing about 12 t/ha
biomass (fresh weight) and 1.5 t/ha (dry weight) at 25
days of growth had shown smothering effect on weeds,
but also slightly suppressed the initial seedlings growth
of rice, which resulted in relatively lower yields than
in DSR without Sesbania. However, the yield was
improved considerably when this very treatment was
supplemented with rice residues. Similar result was
obtained with mungbean residues (MBR) incorporation
+ DSR - ZTW + RR + relay mungbean (RMB) treatment,
where rice residue was supplemented. TPR required
twice more irrigation water and had lower irrigation
water productivity than that of DSR. It had three times
greater global warming potential than the direct-seeded
crop.
60
3.9.3 Global Warming Potential of Direct
Seeded Rice – Zero Till Wheat Cropping
System
In a field experiment it was observed that direct
seeded rice (DSR) reduced methane emission compared
to conventionally transplanted rice (TPR). Nitrous oxide
emission increased marginally under DSR. Zero till
wheat reduced emission of carbon dioxide but increased
emission of nitrous oxide and lowered the global
warming potential (GWP) compared to conventionally
tilled wheat. Residue incorporation reduced the nitrous
oxide emission. Cumulative GWP in the rice–wheat
system ranged from 1141 to 1935 kg CO 2 eq./ha in the
different treatments, and direct seeded rice followed by
zero till wheat reduced GWP by 41% compared to the
conventional transplanted rice followed by tilled-wheat.
Effect of tillage on global warming potential (GWP) under
rice-wheat system
Treatments in rice-wheat GWP (kg CO 2 eq./ha)*
TPR- CTW 1935a
TPR - ZTW 1799b
DSR - ZTW 1141d
DSR- ZTW+ RR 1167d
DSR + GM - ZTW 1295c
DSR +GM – ZTW+RR 1304c
TPR- Transplanted puddle rice, DSR – direct seeded rice, CTWconventionally
tilled wheat, ZTW-Zero tilled wheat, RR- rice residue,
GM – green manure.
*In a column, values followed by the same letter are not significantly
different at P

�����-glucosidase inhibitory activity in different varieties of red and green capsicum
prepared from different maturity stages. All the pepper
extracts exhibited strong �-glucosidase inhibitory
ability (> 50%) at various concentrations tested (10, 25
and 50 mg/ml). The inhibitory potential of extracts from
mature cultivars (red/yellow) was higher than their
green counterparts; the percentage inhibition ranged
from 62 to 73% and 85 to 86% at green (GS) and mature
(MS) stages, respectively. There were no significant
differences with respect to cultivars; however,
pronounced differences with respect to maturity stages
were noticed. All ethanolic extracts (10, 25 and 50 mg/
ml) inhibited the yeast �-glucosidase in a dosedependent
manner.
3.10.2 Antioxidant and Sensory Properties of
Novel Bread Rich in Carotene and
Anthocyanins
For the first time, technology for production of
purple and orange coloured breads rich in carotene and
anthocyanins was developed using natural colours as
functional ingredients for improving the nutraceutical
and sensory properties of wheat bread. Anthocyanin
and carotene-rich breads with characteristic purple and
red hues had higher sensory scores than the normal
wheat bread. Consumer preference tested among
children and adults was on a par. The results indicated
that black carrot anthocyanins and capsicum powder
can be used as functional ingredients to develop high
quality breads with high sensory appeal and healthpromoting
ingredients.
61
3.10.3 Ready-to-Eat Pusa Round Breakfast
Cereals From Maize and Finger Millet
A ready-to-eat functional food was developed as
breakfast cereals from quality protein maize (QPM),
and finger millet through extrusion processing. The
product also was incorporated with carrot powder
which provided natural attractive colour. It is round
Pusa Round Breakfast Cereal without carrot
Pusa Round Breakfast Cereal with carrot

in shape and has very soft texture. It could be consumed
with/without milk. The product has been rated highly
acceptable on organoleptic evaluation by people of
different age groups.
3.10.4 Light Reflectance Pattern in Apple
Fruit Bags
Light reflectance pattern in bags of different
colours, which were used to cover apple fruits in the
orchard, was studied by using radio-spectral
photometer in the visible, far red and infrared regions.
The reflectance in yellow-coloured bags was uniform
in visible region, which might have contributed to the
better quality of apples and reduction in physiological
disorders (bitter pit, brown core and cork pit).
Light reflectance pattern in coloured bags used in apple
3.10.5 Non-Destructive Method for Quality
Evaluation of Mangoes
An image acquisition system has been developed
using different cameras (UV, visible and NIR) for
surface and sub-surface imaging. Images obtained
62
using the system in combination with the developed
algorithms parameters like size, perimeter, volume,
weight, surface and sub-surface damages of mangoes
can be detected non-destructively. Additionally, the
colour values (L, a & b) were correlated to the quality
parameters (TSS, acidity and total carotenoid content)
of the mangoes in order to predict the maturity indices
of nine varieties of mangoes. A detailed flavour
profiling of all the nine varieties of mangoes has been
done with respect to the stage of harvest (raw and ripe)
in order to understand the flavour components, which
are responsible for the characteristic flavour of each of
the variety and when the said compound is expressed.
3.10.6 Standardization of Fruit-Based
Carbonated Beverages Pusa Sparking Fruit
Drinks
A process for production of fruit-based carbonated
drinks has been developed for litchi, pineapple, orange
and lemon-pudina. The technical know-how has been
transferred to M/s Goldwin Agro Foods for commercial
production and marketing.
Pusa Sparkling Fruit Drink
(a) (b) (c)
Sequential analysis of mango image for extraction of required physical and qualitative information (a) Original color image, (b)
Blue image, (c) Segmented image, and (d) Outline of the image

3.10.7 Drying Technique for Different
Cultivars of Chrysanthemum and Rose
Drying technique for different cultivars of
chrysanthemum was standardized. It was observed
that the flowers of cvs. Kundan and Pusa Centenary
when embedded in silica gel and dried in hot air oven
for 48 hours at 45 and 40 o C, respectively showed best
quality in terms of retention of flower colour and shape,
while in case of cv. Jayanti embedding of flowers in
63
sand and drying in hot air oven at a temperature of
45 o C gave better results.
Rose cultivars, namely, Pusa Muskan, Imperator
Farah, Cherry Perfait were embedded in sand and
dried in hot air oven at 40-45 o C for 48 hours showed
better flower colour and shape retention.
Pre-treatment of rose cvs. Pusa Bahadur, Pusa
Gaurav, Angelique with citric acid followed by
embedding of flowers in river sand and drying in hot
Kundan Pusa Centenary Jayanti
Pusa Muskan Imperator Farah Cherry Perfait
Pusa Bahadur after drying
Angelique after drying

air oven for 48 hours at 45 o C resulted in better colour
and quality.
3.10.8 Post-Harvest Studies of Cut
Chrysanthemum
Studies were conducted to delay the leaf yellowing
of chrysanthemum. The uniform cut flowers of cv.
White Regan were subjected to various concentration
of preservatives like cobalt chloride (50, 100 and 150
ppm); salicylic acid (50 and 100 ppm); sodium
nitroprusside (50 and 100 ppm); aluminum sulphate
(300 ppm + sucrose 1.5 %); 8-hydroxyquinoline
citrate (HQC) (300 ppm) + sucrose 1.5%, and
8-hydroxyquinoline citrate (400 ppm) + sucrose 1.5 %;
and were compared with control (double distilled
water). The results revealed that minimum weight loss
(9.85 g) and vaselife of 29 days was observed when the
flowers were held in a preservative solution containing
50 ppm cobalt chloride. The solution containing 400
ppm HQC + 1.5% sucrose resulted in maximum vase
life of 33 days, maximum solution uptake (103.67 ml)
and maximum flower opening (4.75 cm) followed by
the flowers held in solution containing 300 ppm HQC
and 1.5% sucrose. It was observed that after 15 days of
laying the experiment, the flowers held in solution
containing 100 ppm sodium nitroprusside showed 100
per cent foliage yellowing while minimum foliage
discolouration (17.1%) was observed in flowers held
in a solution containing 400 ppm HQC + 1.5% sucrose
followed by 50 ppm cobalt chloride. At the time of
termination of experiment the minimum foliage
discolouration (45.9%) was observed with 400 ppm
HQC + 1.5% sucrose followed by 50 ppm salicylic acid.
3.11 MICROBIOLOGY
3.11.1 Diversity Analysis of Microbes in
Extreme Environments and Bioprospecting
for Novel Molecules and Genes
3.11.1.1 Bacterial diversity in Sundarbans and
Bhitarkanika Mangroves
Soil and water samples collected from different
sites in Sundarbans and Bhitarkanika mangroves were
used for isolation of bacteria employing ten different
growth media. The average population of bacteria at
64
different locations of Sundarban and Bhitarkanika
mangroves ranged between 2.4 × 10 3 - 3.4 × 10 6 per g of
sediment and 1.2 × 10 - 3.9 × 10 7 cfu per mL water or
per g of soil, respectively. Based on the varied colony
morphology, 99 and 91 different morphotypes were
selected from Sundarban and Bhitarkanika mangroves,
respectively. Of the 99 isolates from Sundarban, all
isolates could grow at 5% NaCl, 12 cultures at 15% NaCl
and 2 cultures at 20% NaCl. Of the 91 isolates from
Bhitarkanika, 43 could grow at 5% NaCl while 2
cultures could grow at 15% NaCl. Based on 16S rDNA
sequencing, the isolates from Sundarban mangroves
were identified as Arthrobacter nicotianae, Arthrobacter
sp., Bacillus cereus, B. cibi, B. marisflavi, B. megaterium,
B. mycoides, Bacillus sp., B. subtilis, B. thuringiensis,
Kocuria sp., Paenibacillus sp., Pseudomonas gessardii,
Pseudomonas sp. and Staphylococcus sp. The sequences
were submitted to NCBI GenBank with Accession
numbers from JN411476 - JN411495. Based on 16S
rDNA sequencing, the isolates from Bhitarkanika
mangroves were identified as B. amyloliquefaciens,
B. cereus, B. megaterium, Bacillus sp., B. subtilis,
B. mojavensis, B. thuringiensis, Enterobacter sp.,
Lysinibacillus sp., Lysinibacillus sphaericus, Pseudomonas
sp., Rhodococcus equi, Rhodococcus sp., and
Stenotrophomonas sp. The sequences were submitted to
NCBI GenBank with Accession numbers JN411376 -
JN411399.
3.11.1.2 Bioprospecting for molecules and genes
for antibacterial/ antifungal activity against
charcoal rot and bacterial blight disease in
soybean
Five potential bacterial isolates (non-fluorescent
pseudomonads) showing inhibition against Rhizoctonia
bataticola and Xanthomonas oryzae, causative agents for
charcoal rot and bacterial blight diseases in soybean
and rice, respectively were selected for further
characterization of the strains as well as compounds
present in their metabolites. The metabolite was found
to be extracellular, as the concentrated supernatant of
the all the five isolates inhibited the pathogens. When
subjected to physical and chemical agents like low (pH
2.0) and high pH (pH 13.0), low (-20 o C) and high
temperatures (121 o C), SDS (1%), glycerol (50%) and
proteinase K, the metabolite mixture from bacterial

isolate WI-9 was found to be stable and did not lose its
antagonistic activity. WI-9 and W1-2, exhibiting broad
spectrum antagonism (against bacterial and fungal
pathogens) and positive for siderophore production
were selected for metabolite analysis. Butanol-extracted
crude metabolite of one isolate (WI-9) resolved into 8
spots with different R f values in prep TLC. Three of
the prep TLC resolved spots showed positive bioassay
against rice pathogen X. oryzae.
In order to identify and understand the genetic
determinants of antagonism of the isolates, PCR
approach was used. All the five isolates were screened
by PCR using gene-specific primers for phenazines,
DAPG, pyrrolnitrin and pyoluetorin antibiotics, which
are the antibiotics produced commonly by fluorescent
pseudomonads. Only W1-2 isolate gave positive
amplicon for phenazine. This indicates that the
antagonistic mechanisms in the other isolates may be
due to some other novel metabolites.
3.11.1.3 Allele mining in cyanobacteria for
gene(s) involved in salt stress
Superoxide dismutase gene was PCR-amplified
from cyanobacterial isolate SL-8 obtained from
Sambhar salt lake and tolerant to 3% NaCl. The PCR
product was ligated in pGEMT vector and used to
transform competent cells of Escherichia coli strain
DH5á. Plasmid was isolated from clones tolerant to 3-
5% NaCl and the 600 bp insert was sequenced. BLAST
results showed similarity of the sequence with SOD
genes of Nostoc, Lyngbya and Plectonema. Analysis of
the sequence using ORF finder showed the presence
of two ORFs at position 71 and 128. The results
confirmed that SOD gene is involved in tolerance to
salt in cyanobacterial isolate SL-8.
Two cyanobacterial isolates (SL16 and SL17), and
one isolate (SL6) obtained from Sambhar salt lake
showed PCR amplification of genes encoding 3-deoxy-
D-arabino-heptulosonate-7-phosphate (DAHP)
synthase and ecotoine, respectively. Based on 16S rDNA
sequencing the isolate SL6 was identified as
Phormidium. The DAHP synthase amplicon was
sequenced and BLAST results showed similarity with
DAHP synthase gene of Lyngbya, Synechocystis and
Cyanothece. The ORF finder result showed possible ORF
at position 242 of cloned fragment.
65
3.11.1.4 Diversity and functions of anaerobic
microorganisms involved in ammonia oxidation,
iron- and manganese reduction
The rhizosphere of many plants provides
microaerophilic or anoxic conditions for microbial
processes such as anaerobic ammonium oxidation, iron
reduction and manganese reduction, which contribute
significantly to elemental cycling and thereby plant
productivity. To facilitate the isolation of
microorganisms which mediate anaerobic ammonium
oxidation, flooded soil microcosms (1:1.25 ratio, w/v)
were prepared and enriched by adding N at two
different levels (10 and 100 mM). Potential ammonia
oxidation rates, when assayed in soil samples, as
accumulated nitrate, according to a short incubation
chlorate inhibition technique, ranged between 16 to 214
ng NO -N /g dry soil /hr. With increase in N addition
2
rate, the potential ammonium oxidation rates declined
gradually. When pH was maintained at 4, the rates
declined by about four folds of those without or with
low N addition rates. Potential ammonium oxidation
proceeded rapidly in the surface and interface between
the surface and the floodwater. Obligate anaerobic
organisms were selected after exposure to aerobic and
anaerobic conditions. About forty isolates were selected
for further characterization. Iron reducing
microorganisms were isolated using the medium
containing ferric citrate (50 mM) as the electron
acceptor and varying concentrations of acetate as the
electron donor. Microbially reducible iron in soil ranged
between 41 and 213 μmol /g which declined during
,
incubation suggesting its reduction and oxidation.
When nitrate was added at 0, 100, and 1000 μmol /g,
nitrate was found to be stimulatory to iron reduction
at the highest concentration.
3.11.1.5 Extraction and purification of
phycobilins (PC, PE) from cyanobacteria
Phycobilin pigments of cyanobacteria are water
soluble, strongly fluorescent, which possess
antioxidant property and find applications in food,
agriculture, cosmetics, biotechnology, diagnostics and
pharmaceuticals. The extraction of phycobilins from
selected cyanobacteria, viz., Anabaena variabilis, A.
oryzae and Nostoc commune was standardized and an
efficient method for purifying phycocyanin (PC) and

Separation of phycocyanins and phycoerythrin by DEAE-Cellulose
column chromatography. SDS-PAGE analysis of purified
phycocyanins showing both ����� and ����� subunits. M: Protein
molecular weight marker; 1: PC purified from N. commune; 2: PC
purified from A. variabilis; 3: PC purified from A. oryzae
phycoerythrin (PE) from these cyanobacteria
developed. The extraction was carried out by repeated
freezing and thawing in acetate buffer followed by
purification using ammonium sulphate precipitation,
dialysis and anion exchange chromatography with
DEAE-Cellulose column, aided in purifying both PC
and PE separately. Among three cultures studied, PC
from A. oryzae was obtained with a final purity of 4.75
followed by N. commune PC with purity of 3.99 whereas
a 6.37 purity of PE was obtained from N. commune
followed by Anabaena variabilis PE with purity of 4.95.
Such high purity PC and PE obtained by this method
could be used for pharmaceutical purpose. The purified
phycocyanins were further characterized for their
molecular weight using SDS PAGE. All the three
phycocyanins purified from respective cyanobacteria
consisted of two subunits (� and �). The PC from N.
commune and A. variabilis had same molecular weight
of respective sub units, whereas � subunit of A. oryzae
showed higher molecular weight.
3.11.2 Microbes for Nutrient Management
3.11.2.1 Organic farming in rice-based cropping
system through microbial inputs
In kharif season, basmati rice (cv. Pusa Basmati 6)
was grown under organic management, integrated
nutrient management (INM) and chemical fertilization
and it was found that the grain yield under organic
management, i.e., application of four organic inoculants
(blue green algae, Azolla, vermicompost and FYM) was
the highest (4.72 t/ha), followed by the yield under INM
(4.58 t/ha) and chemical fertilization (4.36 t/ha). The
concentration and uptake of micronutrients, viz., Fe,
Zn and Mn in rice grain increased significantly due to
66
organic farming over INM and chemical fertilization.
Lower incidence of brown plant hopper (BPH) in
organic management (2-4 larvae/hill) was observed
compared to INM (8-10 larvae/hill) and chemical (17-
20 larvae/hill) fertilization. An increase in population
of beneficial insects like spiders was recorded under
organic farming. Vegetable crops like cauliflower,
broccoli, cabbage and carrot grown under organic
management using microbial inputs, viz., biofertilizers
(Azotobacter/ Rhizobium), vermicompost and FYM gave
yield on a par with INM and chemical fertilization. The
highest value of organic C was observed in 0-5 cm soil
depth followed by values at 5-15 cm and 15-30 cm soil
depth. Significant variation in bulk density (BD) and
saturated hydraulic conductivity (HC) was observed
under INM and organic treatments compared to
chemical treatment for surface layer (0-15 cm). There
was not much variation in BD and HC among the
treatments at the lower depth (15-30 cm). Similar types
of results were observed in wheat crop also. Analysis
of change in microbial parameters in rice indicated that
MBC, dehydrogenase, FDA hydrolase, acid
phosphatase and alkaline phosphatase were higher
under organic nutrition compared to INM and chemical
fertilization. In rice-based system carrot crop showed
highest MBC and ß–glucosidase activity compared to
other crops under INM and organic practices.
3.11.2.2 Development and evaluation of novel
Trichoderma based biofilms
An investigation was undertaken to optimize in
vitro development of biofilms using fungal mycelia
(Trichoderma viride) as matrices and N-fixing and Psolubilizing
bacteria as partners, as a prelude to their
use as biofertilizers (biofilmed biofertilizers, BBs) and
biocontrol agents for different crops. Microscopic
observations revealed that bacteria and Trichoderma
grew in a coordinated manner and a thick mat like
growth was formed in 16d. In vitro studies were
conducted for evaluating the PGP traits of biofilms
developed. Trichoderma–Bacillus and Trichoderma–
Pseudomonas biofilms exhibited enhanced antifungal
activity, ammonia, indole acetic acid (IAA) and
siderophore production, compared to the other
treatments. Trichoderma–Azotobacter recorded highest
nitrogenase activity, while 1-aminocyclopropane-1-

carboxylic (ACC) deaminase activity was highest in
Trichoderma–Bacillus biofilm. The synergism in terms
of the PGP traits in the biofilms revealed the possibility
of inter-organism signalling among the partners and
their promise for use as PGP inoculants. Evaluation of
the biocontrol potential of these biofilms in
Macrophomina sp. challenged cotton crop revealed
significant reduction in mortality and enhanced plant
vigour. Trichoderma–Bacillus biofilm was found to be
most promising as a PGP and biocontrol agent in the
cotton crop.
3.11.2.3 Development and evaluation of novel
cyanobacterium-based biofilms with superior
establishment traits
A set of fifteen bacterial and four fungal strains
were selected on the basis of their agricultural
significance as PGPR, N-fixers, P-solubilizers,
hydrolytic enzyme producers or production of biocidal
metabolites. The biofilms were generated using the
cyanobacterium Anabaena torulosa as the matrix. Such
biofilms were evaluated in terms of the activity of
hydrolytic enzymes and fungicidal activity against
phytopathogenic fungi. The activity of �-1,3 glucanase
in general, showed a gradual increasing trend up to 9
weeks, while endoglucanase activity was highest after
6 weeks of incubation. Observations revealed that the
Anabaena sp. - fungus biofilms (especially Anabaena–
Inhibition zone produced by biofilms against phytopathogenic
fungi - a-c, Pythium debaryanum and d-f, Macrophomina
phaseoliona (a and d represent control plates of the fungi,
respectively); C1-C15 denote the different biofilms
67
Aspergillus awamori) exhibited highest activity of �-1,3
glucanase and ranked second in terms of chitosanase
activity. Fungicidal activity was recorded up to 9 weeks
in most of the biofilms and highest values were
recorded in Anabaena sp.- Bacillus and Anabaena–
Psuedomonas biofilms (C1/C2/C3/C4/C5/C11/C12).
The widespread use of cyanobacteria as
biofertilizers is hampered by their poor establishment
as a result of grazing by invertebrate grazers, especially
earthworms, snails, nematodes, etc. Therefore, the
biofilms were also tested for their anti-grazer traits in
microcosm experiments, which revealed no negative
interactions of earthworms and selected nematode on
biofilm growth. The biocontrol activity of such
biofilmed preparations against phytopathogenic fungi,
and proliferation in the presence of selected
microfaunal grazers illustrates their promise in
agriculture as potential inoculants, which can
effectively establish in soil.
3.11.2.4 Profiling of Azolla in relation to crop
improvement
The Anabaena-Azolla system, which is utilized as
biofertilizer/green manure for rice crop produces a lot
of biomass that is rich in nutrients and can be exploited
for plant growth promotion. Methanolic extracts
prepared from Azolla microphylla harvested during
summer and winter season were screened for the
presence of antimicrobial activity against several strains
of plant pathogenic bacteria and fungi. The extracts
exhibited antibacterial properties against several
pathogenic strains of Xanthomonas, despite significant
differences in the phytochemical constituents in the
Azolla biomass from different seasons. However, the
extracts did not exhibit any antifungal activity against
the fungal pathogens tested. A preliminary
phytochemical analysis of the extracts showed the
presence of several compounds with known
antibacterial activity. Significant differences in the
content of total phenolics and flavonoids were observed
with respect to the seasons and the extracts also showed
significant antioxidant activity. The TLC profile of the
extracts revealed the presence of glycosidic flavonoids
and the HPTLC profile of the extracts showed the
presence of rutin and quercetin, compounds having
known antibacterial activity, along with several other

compounds. Thus, the results show the potential of
aquatic pteridophyte Azolla microphylla as a rich source
of antimicrobials which can be exploited in integrated
pest management.
3.11.2.5 Genotypic influence on chickpea
Rhizobium interaction
The root exudates of leguminous plants influence
the outcome of legume-Rhizobium interaction. High
and low nodulating chickpea genotypes, BG 256 and
BG 2024, respectively were selected to study their root
exudates profile. Root exudates of both the chickpea
genotypes showed similar sugar and amino acid
profiles by TLC. However, variations were observed
in the flavonoid profiles of both the genotypes. HPLC
analysis of ethyl acetate fraction dissolved in methanol
revealed the presence of daidzein and formononetin
in BG 256 which is below detectable limit in the root
exudates of BG 2024. Chemotactic study with these
flavonoids is in progress to confirm the influence of
root exudates on nodulation potential of
Mesorhizobium.
3.11.2.6 Development of Azotobacter bioinoculants
for saline soils
For use as bioinoculant under salt stress conditions,
Azotobacter strains were isolated and screened for salt
tolerance and plant growth promoting activities. Ten
Azotobacter strains tolerant to salt were evaluated in a
pot culture experiment to alleviate the effect of salt
stress on growth and yield of wheat. Azotobacter strains
H15, H16, A11 and A 24 performed well under saltstress
conditions and significantly improved grain and
straw yields of wheat. Strain A32 performed well under
normal soil conditions but could not perform well
under saline-stress conditions.
These four Azotobacter strains were also found to
improve per cent seed germination and seedling vigour
of wheat under salt-stress. There was an increase in
ethylene production by the wheat seedlings under
stress conditions. However, inoculation with salttolerant
Azotobacter sp. strains decreased ethylene
production, indicating alleviation of salt stress due to
inoculation. The IAA production was also enhanced in
the root exudates of wheat seedlings inoculated with
Azotobacter strains under salt-stress conditions.
68
3.11.3 Microbial Degradation of Plastics and
Agro-Wastes
Three bacterial cultures identified as Enterobacter
cloacae, Brucella sp. and Alcaligenes for degradation of
polyethene were biochemically characterized along
with two new cultures isolated from sewage site,
Karnal bypass. All the five isolates were tested for aryl
esterase, alkaline phosphatase, dehydrogenase and
fluorescein diacetate (FDA) hydrolysis. Enterobacter
cloacae (P-6) showed highest FDA activity of 1.33 μg
fluorescein liberated /mLculture/hr. The new isolate E
showed highest aryl esterase activity whereas alkaline
phosphatase activity was highest for isolate F.
SEM of polyethene sheet degraded due to action of bacteria:
(a) Colonization of rod shaped bacteria and (b) Breakdown of
intact matrix of polyethene
(a)
(b)
Scanning electron microscopy (SEM) of the
polyethene sheet incubated with isolate Enterobacter
cloacae for more than two years revealed that the isolate
had colonized the surface of the plastic in the

hydrophobic region. The degradation of the plastic was
initiated from the periphery and the plastic matrix was
broken down to form crystal like structure. The results
indicated that the bacteria could survive solely on
plastic (with no external C and N source) for more than
two years indicating that the intermediates of
polyethene degradation served as source for the
nutrients.
3.11.3.1 Development of formulation of effective
microorganisms (EM) for production of enriched
compost for peri-urban agriculture
Effective microorganism (EM) technology, which
uses indigenous effective microorganisms, is being
proposed as a useful tool for managing systems
pertaining to agriculture and environment. Use of EM
acts as an activator and brings down the composting
period. The EM consortium was developed using
indigenous isolates of yeast, lactic acid bacteria,
photosynthetic bacteria, fungal and actinomycete
strains, namely, Phanerochaete chrysosporium VV18,
Streptomyces sp. C3, Rhodotorula glutinis Y6, Lactobacillus
plantarum, and a strain of photosynthetic bacteria. Rice
straw amended with poultry manure was inoculated
with EM consortium; fungal compost inoculum alone
and in combination and process was carried out in open
pits for 90 days. Analysis of physicochemical
parameters after 30 and 60 days incubation indicated
slight increase in pH and the values ranged between
8.9 and 9.1. There was a decrease in organic matter
content from 30 to 60 days. Noticeable increase in
humus content was observed in all the treatments and
the highest was in treatment inoculated with
combination of EM and compost inoculum, in which
two folds enhancement from 2.1 to 4.7% on incubation
from 30 days to 60 days was observed.
3.11.3.2 Rapid composting technology of agrowaste
at low and high temperatures
High weather temperature (>40 o C) during summer
and low temperature (

isolates (Eupenicillium crustaceum and Penicillium
citrinum) along with cow dung, poultry dropping and
urea was used. Sampling at regular intervals was done
for organic carbon, humic acid, fulvic acid, nutrients
and hydrolytic enzymes. An increase of 16% in organic
C was recorded within 45 days of composting with
maximum enzyme activity in rice straw + cow dung +
bacterial consortium (124.1 IU) treatment followed by
rice straw + fungal consortium + poultry dropping
(105.9 IU).
3.11.4 Bioprospecting Microbes for
Production of Biodiesel and Bioethanol
3.11.4.1 Enhancing lipid productivity of
microalgae using nutritional factors
Microalgae are a promising source for maximumyield
of biofuels, because they exhibit fast reproductive
cycles and their oils range from 15 to 35%, besides being
rich in essential fatty acids. A set of ten microalgal
isolates from selected extreme habitats of India,
belonging to five genera (three species each of Chlorella
and Chlorococcum, one each of Scenedesmus,
Chlamydomonas, Kirchneria and Ulothrix) were evaluated
for their lipid accumulating potential. Highest values
of 18% lipids were recorded in Chlorella sp. MIC-G6,
followed by Chlorella sp. MIC-G4 (14%) and
Scenedesmus sp. MIC-G8 (13%). These three strains were
selected for analyzing the effect of different nitrogen
sources and their limitation at different stages of growth
on lipid accumulation. A biphasic nutritional strategy
was employed for enhancing lipid accumulation in the
three selected microalgae, involving supplementation
with different nitrogen sources, viz., NaNO 3 , KNO 3 ,
urea and (NH 4 ) 2 CO 3 , followed by their limitation.
Sodium nitrate (NaNO 3 ) was found to be the best for
enhancing lipid accumulation. An enhancement of 40-
50% in lipids on dry weight basis was recorded in
Chlorella sp. MIC-G4 and Scenedesmus sp. MIC-G8, in
the treatment involving 24 d growth in nitrogen-rich
medium, followed by 8 d in nitrogen- limited medium.
Fatty acid methyl esters (FAME) analyses revealed an
abundance of 92-97% of C16-C18 fatty acids, with
palmitic, linoleic and alpha linolenic acids being most
abundant. MIC-G6 recorded the highest content of
�-linolenic acid (43.7 and 36.0%) under nitrogenenriched
and limited conditions. This study illustrated
70
the promise of MIC-G4 and MIC-G8 for enhanced lipid
productivity using the biphasic mode of cultivation,
and MIC-G6 as a rich source of �-linolenic acid.
In order to develop cost-effective algal oil
production, screening of a set of twenty strains was
undertaken under the nutritional modes of
phototrophy, mixotrophy and heterotrophy. Lipid
productivity ranged from 2 to 13% under
photoautotrophic conditions, 1.7 to 36.5% under
mixotrophic conditions and 0.9 to 32% under
heterotrophic conditions. MIC-G5 Chlorella sp. followed
by MIC-G11 Chlorella sp. exhibited the highest cellular
lipid content (355 and 271 μg/mL) and lipid
productivity of 32 and 28%, respectively, under
mixotrophic condition. In the glucose-supplemented
conditions (heterotrophic), a significant reduction in
PUFA (poly unsaturated fatty acids) from 25.1 to 9.4,
29.2 to 12.4 and 44.7 to 10.2 was observed in MIC-G4,
MIC-G5 and MIC-G11, respectively. A remarkable
enhancement of 33 to70% in SFA (saturated fatty acids)
was recorded under mixotrophic conditions. As the
quality of biodiesel is based on high SFA and low PUFA,
results of this study illustrate the significance of
glucose-supplemented condition as a promising
strategy for generating high value biodiesel from algae.
3.12 ENVIRONMENT SCIENCE
AND CLIMATE RESILIENT
AGRICULTURE
3.12.1 Response of Field Crops to Elevated
Temperature and Carbon Dioxide
A five year study showed that rise in atmospheric
CO 2 level up to 560 ppm caused 15-20% increase in the
yields of wheat, rice, chickpea, groundnut, green gram,
mustard and potato. Rise of temperature by 1 to 4 o C,
on the other hand, decreased the yields of these crops
by 4-40%. Wheat registered highest degree of thermal
sensitivity followed by groundnut, green gram, rice,
potato, chickpea and mustard. Wheat lost grain yield
beyond 1.5 o C rise in temperature while chickpea and
mustard exhibited loss in yield only beyond 4.5 and
5.0 o C even at the atmospheric CO 2 level of 560 ppm.
Thus, rice, chickpea, mustard, potato and green gram
may be more suitable crops for future climatic scenarios
of enhanced temperature and CO 2 levels.

3.12.2 Regional Impacts of Climate Change
on Rice
Regional impact of climate change on yields of
irrigated and rainfed rice was assessed using the
InfoCrop-Rice model. On an aggregated scale, irrigated
rice yields are projected to reduce by ~4% in 2020, 7%
in 2050 and by ~10% in 2080 scenarios. On the other
hand, rainfed rice yields in India are likely to be
reduced by ~6% in 2020 scenario, but in 2050 and 2080
scenarios they are projected to decrease only marginally
(

Vulnerability of different districts of the Indo Gangetic Plain to
climate change
exposure (E), sensitivity (S) and adaptive capacity (A)
approach with the help of principal component analysis
(PCA). Ranking of all 161 IGP districts spread in 5 states
(Punjab, Haryana, UP, Bihar and West Bengal), was
done according to their vulnerability index. The
districts showing high vulnerability index were more
vulnerable to climate change variations. According to
their vulnerability index all districts were classified into
4 classes, viz., extreme, high, moderate and low. Most
of districts of Punjab and Haryana fell in the category
of low or moderately vulnerable compared to the
districts of Bihar and Uttar Pradesh. Average
productivity of crop was an important indicator
deciding the vulnerability of the district. The other
important indicators with respect to vulnerability
included mean changes in minimum and maximum
temperatures in rabi season over the years.
3.12.6 Enhancing Adaptive Capacity to
Climate Change in Vulnerable Regions
Introduction of terminal heat tolerant wheat variety
WR 544 increased yield at Dhar by 12 to 18% over the
conventional variety Lok 1. Early heat and drought
tolerant varieties of wheat, viz., HI 8627 and HI 8638
also showed better performance than the local variety.
At Mewat, the current local variety of mustard
Rajasthan Lahar replaced by Pusa Mehak resulting in
an increase of 5 to 7% in yield.
72
In Mewat, backyard vegetable cultivation saved
‘15/day on household vegetable consumption for 90
days. Livestock inteventions such as deworming,
nutritional mixture and fodder for animlas increased
milk yield by 2.0 L/animal/day in the intervened
households.
A combination of UG pipeline and sprinkler in
wheat crop could reduce 75 kg CO 2 emission/ha.
Introduction of high yielding short duration
composite varieties, viz., JM216 and PC3 at bridal areas
of Dhar facilitated quality seed production and
improved the availability of maize seeds. High quality
protein maize (HQPM 1) will ensure better nutrition.
3.12.7 Impact of Air Pollutants on
Productivity of Crops and Pest Incidence
Field experiments in the open-top chambers
(OTCs) were carried out with rice (vars. Pusa 1401, Pusa
1121, Pusa 1460 and Taraori Basmati) and mustard (var.
Pusa Tarak). These crops were exposed to different
levels of O 3 alone and along with elevated CO 2. Elevated
O 3 (AOT 40 of 12.6 ppm/hr) level led to a 12-15% yield
reduction across the rice varieties; the highest yield
reduction occurred in the traditional Taraori Basmati.
The yields increased by 17 to 21% in the presence of
elevated CO 2 (500±50 ppm) along with sub-ambient O 3
levels (charcoal filtered air). Exposure to O 3 and CO 2
negatively affected the virulence potential of blast
disease pathogen, Magnaporthe oryzae, in rice var. Pusa

1401. Significant increase in activities of b-1,3-glucanase
(33-45%) and chitinase (10-14%) enzymes (responsible
for synthesis of defense related PR proteins) in Pusa
1401 at vegetative and tillering growth stages were
observed during post-exposure period. Activities of the
enzymes were maximum in plants exposed to elevated
O 3 at tillering stage.
During rabi 2010-11, the elevated O 3 level (EO,
ambient + 25-30 ppb O 3 ) decreased the seed yield of
mustard by 26%. In EO+CO 2 treatment, seed yield
increased by 11% over EO alone. There was a 18%
decrease in oil content due to EO; however the presence
of elevated CO 2 increased the oil content by 12% over
the EO alone. Spectral signatures generated for aphid
population dynamics on mustard plants under
different treatments showed that the photochemical
reflectance index (PRI) was best correlated (r = 0.71)
with the aphid population dynamics. The PRI value
was minimum (0.03) for maximum aphid population
on twig and stem of mustard plants exposed to O 3 +
CO 2 compared to other treatments.
3.12.8 Evaluation of Cellulolytic Fungal
Strains for Fermentable Sugar Production
Rice straw is composed of heterogeneous complex
of carbohydrate polymers, especially cellulose and
hemicellulose which can be converted to fermentable
sugars by cellulolytic fungal strains. Microorganisms
can subsequently utilize and convert these sugars into
ethanol and biohydrogen. Nine promising fungal
strains belonging to Aspergillus, Trichoderma and
Fusarium sp. were evaluated on the basis of their
enzymatic activities and production of sugar. The FPase
Enzymatic activity and production of reducing sugar from rice
straw by different fungal strains
73
(filter paper) and CMCase (carboxy-methylcellulose)
activities produced from Trichoderma reesei NCIM 1052
exhibited maximum potential for production of
fermentable sugar from rice straw.
3.12.9 Physiological and Biochemical
Characterization of Ionizing and Non-
Ionizing Radiation Responses on Shelf-Life
Extension and Quality of Tomato Fruit
Studies conducted to assess the effect of gamma
radiation and static magnetic field, alone and in
combination, on the post-harvest storage behaviour of
tomato showed that less than 1 kGy gamma radiation
dose could be used to extend the shelf life of tomato as
it was associated with increased firmness, significantly
lower ethylene production, and delayed redness in
post-harvest irradiated fruits of tomato.
3.12.10 Persistence of Gamma Irradiation
Effect during Prolonged Storage of Exposed
Bhindi Seeds
The GI 50 value observed for bhindi (Abelmoschus
esculentum) seeds was found to be ~0.55 kGy. Radiation
treatment effect persisted even after 4 months of seed
storage. Days to 50% flowering increased with an
increase in radiation dose and at low dose (< 0.05 kGy)
yields were improved. An improvement in plant and
leaf mass, and leaf area was observed at gamma
radiation dose of ~0.05 kGy. Only magnitude of
radiation response got altered with the two seed storage
treatments but the pattern of response remained
Effect of gamma irradiation on economic yield of bhindi cv. Pusa
A 4 sown immediately and after four months of seed treatment in
field

unchanged. Gas exchange attributes such as
photosynthesis were improved at low dose;
transpiration rate and stomatal conductance of
irradiated plants, in general, were higher than control.
Field performance up to 0.2 kGy was rated as excellent
by vegetable breeders.
3.12.11 Agricultural Meteorology
3.12.11.1 Weather-based agro-advisory services
Weather based agro-advisories for farmers of Delhi
and NCR are sent twice a week by the agro-advisory
unit located in the Division of Agricultural Physics of
the Institute. The advisories are based on mediumrange
weather forecast data for next five days, received
twice a week on Tuesday and Friday from IMD, New
Delhi, on different weather parameters, viz., maximum
and minimum temperatures, rainfall, cloud cover, wind
speed and wind direction. The advisories are prepared
by a team consisting of expert from different
disciplines. Weather information and crop wise
weather-based agro-advisories are passed on to the
farmers on real time basis through print, electronic
media and speed-post. Bi-weekly agromet advisory
74
bulletins are prepared in Hindi as well as in English
and published in the newspapers, uploaded on IARI
website (http://www.iari.res.in) and sent to IMD for use
in their website for district agro-advisory and also for
preparing national agro-advisory bulletin. The bulletin
is sent through e-mail to ATIC, KVK Shikohpur and
Ujawa, IFFCO, State Departments of Agriculture,
Agricultural Technology Management Association,
NGOs and e-chopal. A web page was also developed
and maintained on IARI website for issuing advisories
and real time weather data along with medium range
weather forecast. The agromet advisory bulletin
contains summary of previous week’s weather, value
added medium range weather forecast information (for
the next 5 days), crop management based on weather
forecast and warning to farmers much in advance on
rainfall variation, its amount and other weather
variables including pest/disease problems, etc., so that
farmers can decide about sowing, crop management,
application of nutrients, irrigation scheduling,
harvesting, etc. During 2011-12, 105 agro-advisory
bulletins were prepared in Hindi as well as in English
and given coverage in 26 newspapers.

2. GENETIC RESOURCES
Genetic resources are invaluable source of genes/ alleles which could play a vital role in improvement of
crops. Therefore, the Institute has a vibrant programme not only on the collection and conservation of genetic
resources in crops but also on utilization of genetic resources in different crops for widening the genetic base as
well as developing new varieties with improved productivity. Large set of new germplasm lines, including
landraces, released varieties, wild and related species of various crops, were collected from different sources,
maintained as active germplasm and utilized in the pre-breeding and genetic enhancement of crops at the Institute.
2.1 CROP GENETIC RESOURCES
2.1.1 Wheat
2.1.1.1 Maintenance and utilization of wild
relatives
About 5050 accessions of wild relatives of wheat are
being maintained at IARI and its regional stations, which
include diploid, tetraploid as well as hexaploid species.
The work is at an advanced stage on introgression of
rust resistance genes from several wild species such
Aegilops markgrafii (2n=2 x =14, genome CC), Ae. Speltoides
(2n=2x=14, genome SS), Triticum militinae (2n=4x=28,
genome AAGG) and T. turgidum (2n=4x=28, genome
AABB). Cytologically stable plants were identified in
T. turgidum derivatives for stripe rust resistance, while
T. militinae derivatives were screened at seedling stage
as well as at adult plant stage in BC 3 generation.
2.1.1.2 Sources of resistance to African stem rust
race Ug99 and its variants
Durum wheat varieties HD 4672, HI 8498, HI 8627
and HI 8663, and bread wheat varieties DL 788-2, HD
2987 and HI 1531 showed resistance to the African stem
rust race Ug99 and its variants during screening in
Kenya. Besides this, 52 F 4 cross bulks in bread wheat
were sent to Njoro, Kenya for evaluating them against
Ug99, of which progenies from 7 crosses showed high
level of resistance.
2.1.1.3 Screening for stripe rust resistance
One hundred seventy seven CVT entries of wheat
were evaluated at Regional Station (Tutikandi), Shimla
27
for seedling resistance against 46S119 and 78S84
pathotypes of stripe rust. Fifty-nine genotypes were
recorded as resistant against 46S119, 58 were resistant
to 78S84 and 28 entries were resistant against both of
the pathotypes. Besides, 65 advanced bulks were also
evaluated for resistance against most virulent
pathotype121R63-1, 21 were recorded as resistant.
2.1.1.4 Screening elite lines for presence of rust
resistance genes
A set of 137 backcross derived lines were analyzed
for the presence of rust resistance genes Sr2, Sr24, Sr25,
Sr26, Sr36 and Lr34 using gene linked markers. Several
lines carrying these in different combinations in the
background of 21 popular wheat cultivars developed
at the Regional Station, Wellington have been
identified. In addition to this, genotypes carrying Yr9,
Yr15 and Pm8 in addition to the rust resistance genes
also have been identified.
2.1.2 Rice
2.1.2.1 Registration of genetic stocks resistant to
blast disease
Using marker assisted foreground and background
selection, two blast resistance genes, Pi54 and Piz-5
were transferred into PRR 78, the male parent of Pusa
RH 10. Two improved versions of PRR 78, namely,
Pusa1602-06-24-5-45 carrying gene Piz5 and Pusa1603-
06-11-4-19 carrying gene Pi54, conferring resistance to
blast disease, have been submitted for registration as
genetic stocks with NBPGR, New Delhi.

2.1.2.2 Enrichment of germplasm and
maintenance of genetic resources
A total of 44 germplasm including 40 released
varieties and four trait specific germplasm including
donors for bacterial blight and blast diseases
were obtained from different sources. A set of
1450 germplasm lines were multiplied during kharif
2011.
28
2.1.3 Maize
2.1.3.1 Resistance sources for maize foliar diseases
The newly developed and elite maize inbreds were
screened against Maydis leaf blight (MLB), banded leaf
and sheath blight (BLSB) and Turcicum leaf blight under
natural and artificial epiphytotics at IARI, New Delhi
and IARI Centre, Dharwad and several resistant
genotypes were identified.
S. No. Disease No. of lines Resistant sources identified
screened (Disease score < 1.5)
1. Maydis leaf blight (MLB) 1129 120 lines including DK 1103, DK 1118, DK 1122,
DK 111541, DK 110181, DK 110448, DK 110540,
DK 110042, DK 110077, DK 110079, DK 110097
2. Banded leaf and sheath blight (BLSB) 109 DK 111519, DK 111532, DK 111534, DK 111540,
DK 111513, DK 111522, DK 111515
3. Turcicum leaf blight (TLB) 250 A total of 75 lines including BM 196, BM 193,
BM 194, BM 195, BM 197, BM 51, BM 8, BM-52,
BM 48, BM 202, BM 185
Two inbreds (DK 1103 and DK 111541) resistant to both MLB and
BLSB
2.1.2.3 Sources for specialty traits
More than 1500 inbreds mostly in QPM
background and 38 populations in the genetic
background of waxy, sweet corn, pop corn type were
procured from CIMMYT, Mexico. These 38 populations
were selfed during kharif 2011 to derive new inbreds in
the given genetic background.
(2.0) (3.0) (4.5)
Reaction of crosses to TLB
2.1.4 Pearl millet
2.1.4.1 Maintenance of CMS, restorers and
inbreds
Thirty-eight CMS lines and 142 inbred/restorer
lines of pearl millet were indented from ICRISAT. Fortyone
diverse cytoplasmic male sterile lines belonging
to A 1 , A 4 and A 5 sources were maintained by

undertaking 910 paired crosses (A/B). 351 inbred/
restorers were maintained by selfing and single panicle
selections.
2.1.4.2 Evaluation for Nutritional Quality traits
in pearl millet lines
Forty promising pearl millet parent lines were
analysed for the nutritional quality traits like oil content,
protein content, reducing sugars, amino acids, namely,
lysine and tryptophan and low phytic acid content.
Variability in nutritional quality traits
Nutrient Nutrient Genotype with
range maximum value*
Protein content (%) 7.41 to 12.37 PPMI 721(7.41%)
Tryptophan (mg/100g) 164.5 to 338.5 PPMI 872
(338.50 mg/100 g)
Lysine mg/100g 154 to 356 PPMI 654
(356 mg/100 g)
Oil content (%) 1.47 to 4.43 PPMI 69 (4.43%)
Reducing sugar (%) 1.25 to 3.56 WGI 145 (3.56%)
Phytic acid (g/100 g) 0.53 to 1.68 PPMI 775
(0.53 g/100 g)
* Lowest in case of phytic acid
2.1.5 Chickpea
2.1.5.1 Pre-breeding and germplasm
enhancement
Diversity analysis among the wild species carried
out using 35 STMS markers generated on an average
3.433 amplicons per primer pair. Polymorphic
Information content (PIC) ranged from 0.246 to 0.775
and genetic similarity between cultivars ranged from
0.10 to 0.77. Based on the diversity indices, 3 parents
were selected and two crosses were made with C.
reticulatum (ILWC 118) as male parent crossed with
Pusa 1053 and KAK 2 and advanced to F 2 .
2.1.5.2 Evaluation of chickpea lines for Raffinose
Family Oligosaccharides (RFO)
HPLC analysis of RFO contents (as % dry weight
of seeds) of eighteen chickpea genotypes identified only
three RFO fractions, viz., raffinose, stachyose and
ciceritol. The verbascose content was extremely low in
the genotypes. The analysis revealed that sucrose
29
ranged from 0 mg/g (Pusa 1105) to 48.91 mg/g (Pusa
1108); raffinose from 0 mg/g (Pusa 1105) to 14.75 mg/g
(Pusa 362); ciceritol from 0 mg/g (Pusa 1105) to 61.11
mg/g (Pusa 362); stachyose from 0 mg/g (Pusa 1105) to
42.38 mg/g (Pusa 391) and total sugars from 0 mg/g
(Pusa 1105) to 153.99 mg/g (Pusa 1108). In general it
was observed that the desi types had more RFOs than
the kabuli types.
2.1.5.3 Development of first true breeding
determinate chickpea genotype
A true breeding determinate chickpea genotype,
BGD 9971, developed at Regional Centre, Dharwad
is bushy, compact and dwarf in its morphology. The
stem growth is terminated by a flower bud or a fully
opened flower and produces 1-4 seeds per pod. The
Centre also developed BGD 2608, the first true
breeding, extra large seeded desi chickpea with
100-seed weight of 54-55 g.
BGD 9971 showing 1-4 seeds per pod
Seeds of BGD 2608

2.1.6 Mungbean
2.1.6.1 Screening against MYMV
Two hundred ninety-six mungbean lines were
screened against MYMV using PS 16 as infector row.
Five genotypes, M 523, M 700, M 1312, M 1354 and M
1314 were identified as resistant lines.
2.1.7 Brassicas
2.1.7.1 Maintenance of germplasm
A total of 721 germplasm lines including B. juncea
(434), B. carinata (170), B. napus (38), B. rapa (39), B.
oleracea (6), B. nigra (14), B. tournifortii (3), B. caudatus
(3), R. caudatus (1), R. sativa (1), S. alba (2), Eruca sativa
(6), Crambe spp. (2), Lepidium spp. (1), Camellina spp.
(1) were maintained.
2.1.7.2 Phenotypic characterization of Brassica
juncea germplasm
A set of 434 germplasm lines of Brassica juncea were
characterized for eleven morphological traits for
studying the diversity for development of heterotic
pools.
Germplasm maintenance of different Brassica spp.
2.1.7.3 Protocol standardized for screening heat
tolerance at seedling stage and donors identified
The temperature, light and relative humidity
regimes for identification of high temperature tolerant
genotypes at seedling stage were standardized under
Phytotron conditions. The cycle of light and
temperature was: 20 o C with dark for 8 h, 32 o C with
light for 5 h, 42+1 o C with light for 6 h followed by 32
o C with light for 5 h. A set of 104 genotypes of B. juncea
30
including released varieties, advance breeding lines
and identified donors for high temperature tolerance
were screened using the above protocol under
controlled conditions in the phytotron as well as under
the field conditions at high temperatures. The results
of both the experiments were corresponding but the
Phytotron screening was more reliable for
differentiating between heat tolerant and susceptible
genotypes. Based on this, three genotypes, viz.,
NPJ 124, EJ 22 and NPJ 113 were found to be highly
tolerant to high temperature at seedling stage.
2.1.8 Soybean
2.1.8.1 Iron Deficiency Chlorosis (IDC) tolerance
One hundred and four soybean genotypes were
screened in hydroponics for identification of IDC
tolerant genotypes. Genotypes PK 1169, UPSV 27 and
EC 439608 were identified as IDC tolerant. A set of 14
EST-based SSR markers were designed, out of which
IRT1 gene based EST-SSR marker and GmFRD3a-based
SSR markers produced amplifications indicating
presence of homologous genes in the genotypes studied.
2.1.8.2 Charcoal rot resistance
Two mapping populations (F 2 ) for charcoal rot
resistance have been advanced to F 4 stage through
single seed descendent (SSD) method. Artificial
screening in the control condition was performed to
establish the genetics of charcoal rot resistance through
first node inoculation has been performed to estimate
the genetics of charcoal rot resistance.
2.1.8.3 Creation of genetic diversity
The F 3 seeds from the inter-specific hybrids of
Glycine max and Glycine soja were grown in single rows
Genetic variability created through inter-specific (G. max x G. soja)
hybridization

and the families were found to vary in flower color,
maturity duration, pod size, pod color and plant type.
Two families with erect plant type were identified and
advanced. Additionally, new crosses in 10 combinations
for biotic and abiotic stress tolerance, shorter duration,
yield and quality were attempted.
2.1.9 Vegetable Crops
2.1.9.1 Cole crops
Cauliflower. Eighteen early group and 43 midgroup
genotypes were evaluated and promising plants
were advanced through selfing and sib pollination. Ten
genotypes collected from China were also added to the
existing gene pool. A total of 69 genotypes germinated,
out of which 51 were found promising and were further
advanced.
Cabbage. At IARI Regional Station, Katrain, 100
new germplasm of cabbage received from NBPGR,
New Delhi were evaluated for different horticultural
and yield traits. Accession EC-646345 exhibited
maximum individual head weight of 2.44 kg followed
by EC-616592 (2.25 kg) and EC-616610 (2.00 kg). All
the 3 accessions had flat head shape.
Broccoli. Thirty-three introductions were
evaluated and promising selections were advanced for
further evaluation. At IARI Regional Station, Katrain,
out of 17 new germplasm of sprouting broccoli,
received from NBPGR, accessions EC-676711, EC-
676710 and EC-676712 were found promising.
2.1.9.2 Solanaceous crops
Tomato. Two hundred ninety-seven germplasm of
two wild tomato species L. peruvianum (114) and L.
pimpinellifolium(183) received from NBPGR, New Delhi
were sown and 275 lines germinated in the field which
are under evaluation. Five ToLCV resistant germplasm
received from AVRDC, Taiwan through IIHR,
Bangalore were planted in the field for their evaluation.
Brinjal. A total of 102 germplasm including 17 new
genotypes were evaluated and maintained.
Chilli. Twenty germplasm of chilli were collected
and maintained.
Capsicum. Thirty-four germplasm of bell pepper
and 17 of paprika were purified and maintained.
31
2.1.9.3 Root crop
Carrot. Thirty-five elite genotypes, 23 CMS lines
and 69 fertile inbreds were evaluated. Selected
lines were planted for maintenance and seed
multiplication.
2.1.9.4 Leguminous crop
Garden pea. One hundred ten germplasm
including six new pea germplasm were evaluated and
multiplied. Three new entries, GP 801 and GP 901 in
early maturity IET and GP 473 in powdery mildew
resistance IET, were included in AICRP trials for
testing.
2.1.9.5 Cucurbits
Bitter gourd. Forty-seven breeding lines were
evaluated and maintained.
Cucumber. Two hundred and sixty-four germplasm
/advanced breeding lines including 23 new collections
were evaluated during spring-summer and
kharif seasons and promising lines maintained.
Sixty-one germplasm/breeding lines of
gynoeciousparthenocarpic cucumber, gherkin,
carotene rich cucumber, Cucumishytivusand other
exotic lines with novel characters are being evaluated
under polyhouse.
Luffa. One Hundred and fifty germplasm/
advanced breeding and virus resistant lines of sponge
gourd and 147 germplasm of ridge gourd including
Satputia types (hermaphrodite) were evaluated during
spring-summer and kharif seasons and promising lines
maintained.
Pumpkin. Fifty-five germplasm/advanced
breeding lines of pumpkin were evaluated and
maintained.
Muskmelon and Watermelon. One hundred seven
lines of muskmelon and sixty-five lines of watermelon
were evaluated in summer 2011 and superior
genotypes with respect to fruit yield and quality
maintained.
Minor cucurbits. Forty-five, 32 and 22 germplasm/
advanced breeding lines of summer squash, long melon
and round melon, respectively, were evaluated and
maintained.

2.1.9.6 Bulb crop
Onion. Thirteen germplasm of onion were
collected and different species of Alliums are being
maintained.
2.1.9.7 Okra
Two hundred okra lines received from NBPGR,
New Delhi were evaluated for yield and YVMV
resistance during kharif 2011. Four lines showed
resistance to YVMV disease up to 60 day of sowing
and one showed resistance up to 90 days.
2.1.9.8 Minor leafy vegetables
Palak. Six genotypes were evaluated for 7 yield
contributing traits and 7 quality traits. Maximum yield
and better leaf quality was recorded in Palak-GS both
under cutting and pulling (one time harvest), i.e., 46.8
t/ha and 29.9 t/ha, respectively. Maximum amount of
total carotenoids and ascorbic acid was recorded in
Pusa Bharati (29.12 and 22.5 mg/100 g fresh weight,
respectively).
Chenopodium. Seventeen genotypes of
chenopodium were evaluated for 5 yield and 8 quality
traits. Bathua Selection G-2, G-12, G-13 and G-14 were
found high yielding with better leaf quality. Leaf yield
per plant ranged from 25 to 275 g. Total carotenoids
content was the highest in Bathua-NS (91.31 mg/100g).
Bathua Selection G-12 also recorded highest phenolic
as well as antioxidant content (936.4 �g gallic acid eq./
g of sample and 2.57 � mol ascorbic acid/g sample,
respectively)
2.1.10 Fruit Crops
2.1.10.1 Grapes
Thirty-eight germplasm collected from NRC on
Grapes, Pune and PAU, Ludhiana were planted in
nursery for further field evaluation.
2.1.10.2 Guava
A Survey was conducted in Muzzafarnagar area
of UP for collecting the diversity in guava. Forty-five
plants of six local varieties/germplasm including black
guava (red pulp) and white guava were collected and
planted for evaluation.
32
2.1.10.3 Papaya
At IARI Regional Station, Pune, a closely related
genus of papaya, Vasconcellea cauliflora was maintained
which showed plant height of 1.56 m and collar
diameter 15.09 cm in the first year. It flowered in 60
days after planting attaining a flowering height of 29
cm. The average length of fruiting column was 94 cm
and fruiting height was 24 cm. Fruit yield in one season
was 4.3 kg and 90 fruits per plant, and average fruit
weight was 48 g.
2.1.10.4 Apple
Grafted scion wood of elite mother plant collected
from. YSPUHF,Nauni was indexed for four viruses
(ACLSV, ApMv, ASGV, ASPV) by ELISA technique and
after virus indexing of elite mother plants five varieties
from Rohroo and eight from Kullu were found free
from the four viruses.
2.1.11 Ornamental Crops
2.1.11.1 Rose
In rose, 350 varieties and 15 species are being
maintained. Forty-one new varieties were added this
year.
2.1.11.2 Chrysanthemum
Above 100 cultivars are being maintained and 53
known cultivars of chrysanthemum were characterized
as per new revised guidelines for Distinctiveness
Uniformity and Stability (DUS).
2.1.11.3 Gladiolus
Thirteen new germplasm were collected in
addition to routine maintenance of 153 varieties.
2.1.11.4 Marigold
Thirty-five new genotypes of marigold were
collected and added to the existing germplasm.
2.1.11.5 Lilium
At IARI Regional Station, Katrain, 5 cultivars each
of Lilium Asiatic (LA) and Oriental hybrid lilies were
collected and assessed under open field conditions for
various traits. LA-hybrids ‘Pavia’ and ‘Diabolo’ and
Oriental hybrids ‘Stargazer’, ‘Barnini’ and ‘Casendra’
were superior in vegetative and floral characters, and
suitable for cut flower production.

2.1.11.6 Tulip
At IARI Regional Station, Katrain, 15 germplasm
of tulip were maintained and four new were
introduced.
2.1.11.7 Bougainvillea
Eight new varieties, namely, Jawahar Lal Nehru,
Purple Prince, Mauve Queen, Sylvia Delap, Srinivasa,
Smoky, Scarlet Queen Variegated and Ceylon hybrid
were added to the collection. Maintenance of 120
germplasm was also carried out.
2.1.11.8 Annual flowers
Sixty-one genotypes in different annual flowers
were collected and maintained
2.1.11.9 Lawn grasses
Eleven species of lawn grasses, viz., Paspalum
notatum, Lolium perene, Agrostis palustris, Poa pratensis,
Argentine Bahia, Eragrostis curvula, Dichondra repens,
Cynodon dactylon var. Bargusto, Cynodon dactylon var.
Palma, Cynodon dactylon var. Panam and
Cynodondactylon var. Panama were collected and added
to the germplasm for evaluation.
2.2 BIOSYSTEMATICS AND
IDENTIFICATION SERVICES
2.2.1 Herbarium Cryptogamae Indiae
Orientalis (HCIO)
Enrichment of repository of fungal biodiversity.
Seven hundred ten specimens of fungal diseases of
various groups were accessioned in HCIO, raising the
total number of specimens to 49,871. Fungal
biodiversity was documented by adding eight new
species, viz., Asteridiella mellittiicola, Asterina
homonoiae,Asterostomella enogeissil, Circosla listae,
Maheshwaroncyces coclilii, Meliola dysoxyligena, M.
mulabilides and M. premnigena.
2.2.2 Indian Type Culture Collection (ITCC)
Maintenance and new additions. Over 3800 fungal
cultures belonging to Mastigomycotina,
Zygomycotina, Ascomycotina and Deuteromycotina
were maintained at ITCC. The culture collection was
further enriched with 58 different fungal cultures
33
including Coprinus disseminatum, Corynespora cassicola,
Pyricularia setariae and Sporothrix fungorum.
Culture supply and identification services. Six
hundred fifty-five authentic fungal cultures belonging
to different groups viz., Zygomycetes (56),
Hyphomycetes (210), Ascomycetes(45), Penicilli(52),
Aspergilli (63), Coelomycetes (64) and Fusaria (165)
were supplied to various users. Besides, 543 cultures
were identified up to species level, including plant
pathogens, bio-control agents and industrial use fungi
Characterization of fungal species. Trichoderma(35)
and Colletotrichum (41) isolates were characterized
using ITS region. Comparative sequence analysis
differentiated Trichoderma isolates into seven species,
viz.,T.aggressivum, T. asperellum, T. atroviride,
T. erinaceum, T. hamatum, T. harzianum and
T. longibrachiatum. Similarly, Colletotrichum isolates were
grouped into eight species, viz., C. capsici (12),
C. fragaraie (1), C. gleoesporioides (23), C. lini (1), C. musae
(1), C. sublineolum (1), C. truncatum (1) and C. species
(1). 278 Fusarium isolates were identified as Fusarium
acuminatum(7), F. anguioides(1), F. avenaceum(1),
F. brachygibbosum(3), F. chlamydosporum(17),
F. compactum(5), F. culmorum(3), F. decemcellulare(4),
F. equiseti(15), F. fusaroides(3), F. graminearum(8),
F. heterosporum(1), F. lateritium(5), F. erismoides(1),
F. moniliforme (47), F. nygamai(2), F. oxysporum(105),
F. pallidoroseum(44), F. subglutinans(6) based on cultural,
phialide and spore characters.
To identify a suitable DNA barcode marker for
delineation of Fusarium species, Cytochrome Oxidase
subunit I (COX I, 567bp); Internal Transcribed Spacer
(ITS, 600bp); Translation elongation factor 1 (tef-I, 700
bp) and NADH dehydrogenase subunit 6 (ND 6,
900bp) from 22 Fusarium isolates representing
eleven different species (Fusarium acuminatum,
F. chlamydosporum, F. graminearum, F. oxysporum,
F. pallidoroseum F. poae, F. solani, F. sporotrichioides,
F. subglutinans, F. udum and F. verticillioides), were
compared. Comparative sequence analyses suggested
COX I to be a better marker for intraspecific and
interspecific variability because of greater Transition/
Transversion ratio (1.48) and evolutionary divergence
(0.495).

Validation of Aspergillus flavus SCAR marker. The
specific primers Asp F 1 (5’ CCC GTG AAG TTG CCC
AGGT 3’) and Asp R2 (5’ GTC GTT TGG TGA GTG
GGA A 3’) were designed and amplified product of
490bp was obtained from all the Aspergillus flavus
isolates tested. No amplification was observed with
other Aspergillus species.
2.2.3 Insect Biosystematics
A new leafhopper species from Kerala,
Goniagnathus (Tropicognathus) keralaensis sp. nov.was
described with the following distinguishing features ,
viz., aedeagal shaft convex at distal caudoventral
margin and acute at apex with a pair of small ventral
subapical processes, pair of long subapical processes
on posterior dorsal margin, large gonopore located
apically on the ventral side.
A new deltocephaline species Scaphoideus
subsculptus sp. nov.was described from Nelliampathy,
Kerala with the following distinguishing features viz.,
aedeagus with longitudinal keel in both sides laterally,
shaft in lateral aspect broad distally, strongly bent
dorsally without a recurved process on either side of
base, narrow apically with forked shaft in caudal view,
gonopore subapically on ventral side, a pair of curved
processes on dorsal connective directed caudoventrally;
paraphyses with broad base and arms widely separated
with anterior 2/3 rd sculpted with short spicule, in dorsal
view innner margin with small hair like microsetae.
Biosystematic studies were undertaken on the
parasitoid Diaeretiella rapae (M’Intosh), a common
parasitoid (Hymenoptera: Braconidae: Aphidinae)
associated with various species of aphids in all the
major agroecosystems in India and described as one of
the most important factors for natural control of
mustard aphid, Lipaphis erysimi(Kaltenbach).Forty
quantitative characters were studied in three hundred
specimens of D. rapae for redescriptionand its concept
was streamlined with suitable illustrations and addition
of several new characters, viz., width of central
propodeal areola, number of lateral carina on
anterolateral area of petiole, length of median
longitudinal carina, metacarp (R 1 ), radial (r) vein, etc.
Eleven populations of D. rapae collected from various
parts of India were also compared to quantify the
34
interpopulation morphological variations. Field studies
were conducted during two consecutive rabi seasons,
viz., 2009-10 and 2010-11 for assessing the seasonal
occurrence and spatial distribution of D. rapae vis-a vis
its aphid hosts on Brassica junceavariety Pusa Bold. D.
rapaewas found to dominate over another closely
related aphidiine parasitoid Aphidius colemani Viereck
on L. erysimiduring both the crop seasons. High L.
erysimidensitieswere recorded during the second
fortnight of February for both years while
mummification rate showed an increasing trend late
in the season, i.e., first half of March and reached 53.2
and 65.5 per cent during crop seasons of 2009-10 and
2010-11, respectively.
2.2.4 Nematode Biosystematics and
Identification Services
A new species of entomopathogenic nematode,
Steinernema harryi n. sp. was recovered from a soil
sample collected from Ambattur region of Chennai. A
combination of morphological characteristics and
morphometrical measurements of all stages
distinguishes S. harryi n. sp. from rest of the members
of Steinernema. On the basis of body length 486 (435-
508 μm) of infective juveniles, this new species belongs
to the “carpocapsae group” of small infectives. The
infective juveniles are characterized by the much
posterior position of excretory pore 38 (35-41 μm),
relatively longer oesophagus 105 (97-110 μm), D % 36
(35-39), E % 82 (73-89) and the lateral field with 6 or 7
incisures. First generation males are differentiated from
other species of the carpocapsae group by having the
largest GS ratio 0.79 (0.71-0.85) and also differ in the
number and general disposition of genital papillae.
Females of this species are recognized by the presence
of well developed, double flapped epiptygmata and
protruding vulval lips.
In research farms of IARI, the plant parasitic genera
Tylechorhinchus spp were dominated as it encountered
in 53 soil samples followed by Hoplolaimus(in 50
samples) and Rotylenchulus (in 47 samples). In addition
Pratylenchus spp in 38 samples, Trichodorus in 11
samples, Quinisulcius in 8 samples, Heterodera in 7
samples, Meloidogyne in 6 samples, Xiphinema in 6
samples, Helicotylenchus in 6 samples, Longidorus in 4

samples, Hirshmaniella in 3 samples, Tylenchulus in one
sample, Hemicriconemoides in one sample and
Aphelenchoides in one sample were also recorded.
The infestation of root lesion nematode
Pratylenchus thornei was observed for the first time in
the aerobic rice in IARI fields. The infected plants were
yellow and stunted with brown lesions on the root
system hampering the nutrient translocation.
Plants with chlorotic leaves and stunted growth
35
National Nematode Collection of India (NNCI)
was augmented with the addition of 68 type slides
comprising of 85 specimens including males, females
and infective juveniles of Steinernema meghalayensis sp.
and accession number has increased from 2303 to 2371.
In addition to this a total of 112 wet suspensions were
deposited from various locations and cropping
systems.
Pratylenchus thornei juveniles
in rice root system

4. CROP PROTECTION
Insect-pests, plant pathogens, nematodes and weeds are the major biotic constraints in achieving self sufficiency
in food production. During the year under report, major pests/pathogens have been characterized and reliable
diagnostic procedures developed; efficacy of several newer molecules/formulations and alternative control
measures have been tested. Progress has also been made in the management of diseases through identification
and synthesis of novel molecules and RNAi approach.
4.1 PLANT PATHOLOGY
4.1.1 Genetic Diversity
Puccinia spp. (wheat rusts). Seven races of wheat
rusts (leaf rust: pt- 77-5, 104-2 and 12-2; stem rust : pgt
40A and 40-1; and stripe rust : pst-78S84 and 46S119)
were characterized using ITS region and compared
with known sequences from different parts of the
world. Comparative sequence analyses revealed that
100
88
77
97
0.12 0.10 0.08 0.06 0.04 0.02 0.00
Pst IRAN 11497 F Iran
Pst 52/99 USA
Pst PSH78 USA
Pst HSZ0725 USA
60
Pst t5-1 China
Pst DAOM 240069 Canada
Pst R205 clone 01 Belgium
Pst tb-2 China
100
Pst HSZ1872 USA
Pst HSZ0728 USA
Pst 46S119 India
Pst 78S84 India
Pgt NYPI 1 USA
Pt HZZ0748 USA
Pt HSZ0741 USA
Pt EGY98A USA
Puccinia persistens subsp. triticina…
Pt HSZ0744 USA
Pt HSZ0745 USA
52 Pt HSZ0746 USA
Pt RN-22 USA
Pt R206 clone 03 Belgium
Pt 98 EGY151C USA
Pt ANK9538 USA
Pt EGY98A USA(2)
Pt 77-5 India
Pgt 40-1 India c
Pgt 40A India
Pt 104-2 India
d
Pt 12-2 India
Phylogenetic tree based on ITS region sequences from thirty wheat
rust races
a
b
75
both the Indian races of stripe rust (pst- 46S119, 78S84)
clustered with pst races from USA, Belgium and Iran.
In contrast, with the exception of race pt 77-5, other
leaf rust races, pt 104-2 and 12-2 and stem rust races,
pgt 40A and 40-1, from India formed a separate cluster.
Bipolaris sorokiniana (spot blotch of wheat). B.
sorokiniana isolates (40) collected from different
locations with varying pathogenicity were checked for
melanin production. BS-75 isolate identified as the most
virulent, possessed maximum melanin content
3.2x10 3 μg/g mycelium, while least virulent BS-41 isolate
possessed minimum melanin content 42�g/g
mycelium, showing positive correlation (r=0.7) with
pathogenicity. BRN 1gene involved in melanin
biosynthetic pathway was sequenced from BS-75
isolate (600bp, Accession no. JF735998), which
shared 98-99% nucleotide sequence identity with
corresponding known sequences from other Bipolaris
spp. isolates.
Fusarium spp. (Bakanae disease of rice). Fusarium
isolates (55) associated with bakanae disease of rice
differing in pathogenicity were characterized for
gibberellin (GA 3 ) production using HPLC. F. fujikuroi
causing elongation was identified as maximum
gibberellin producer (> 1000-3500 �g g -1 ), followed by
F. proliferatum causing rotting and elongation (501-1000
�g g -1 ), and F. moniliforme causing rotting alone
(0-500 �g g -1 ), showing a positive correlation (r=0.7)
with pathogenicity.
Rhizoctonia solani. Genetic diversity up to 35%
was observed in Rhizoctonia solani isolates (89)
belonging to seven anastomosis groups (AGs) from

different pulse crops and locations when compared
using URPs, RAPD and ISSR markers. Though, 95%
isolates shared common grouping patterns, their
grouping did not correlate with their place and host of
origin.
Fusarium oxysporum f. sp. ciceris (chickpea wilt).
Genetic diversity in FOC isolates (70) originating from
13 locations was assessed by comparing translation
elongation factor-1� (TEF-IX, 720bp), � tubulin (500bp)
and internal transcribed spacer (ITS) region (550bp).
Sequence analysis suggested that the three nuclear
regions TEF-1X (accession nos. JN231134 to JN231186),
� tubulin (JN231187 to JN231236), and ITS (JN400675
to JN400720) were highly conserved (95-100% identity).
Though, 90% isolates shared similar grouping pattern,
their grouping did not correlate with their place of
origin and race pattern.
Sclerotinia sclerotiorum (chickpea stem rot).
Genetic diversity in S. sclerotiorum isolates (24)
originating from 10 different locations was determined
by comparing ITS region (515-553 bp), and the isolates
shared 75-97% identity.
Xanthomonas axonopodis pv. punicae (Xap)
(Pomegranate blight). Several growth parameters were
determined for bacterial isolates from blight affected
pomegranate samples (8) collected from Andhra
Pradesh. The type strain of Xap (NCPPB 466) deposited
by IARI in 1959 also shared similar growth characters.
Biolog assay also suggested that the type strain shared
several phenotypes with Xanthomonas arboricola pv.
juglandis, the causal agent of walnut bacterial blight.
Multilocus sequence typing (MLST) of Xap isolates
(6) including NCPPB 466 based on dnaK, fyuA, gyrBI,
rpoD, fusA gap-1, gltA, GyrB2, lacF, and lepA revealed
that eight of the nine alleles analysed were novel to
Xap. Xap population originating from different
locations could be a single virulence lineage without
any genetic variability. Comparison of concatenated
sequence of 5713bp revealed maximum similarity of
Xap with X. citri pv. citri and X. citri pv. malvacearum.
16S rDNA analysis confirmed these observations.
Ralstonia solanacearum. MLST of Ralstonia
solanacearum isolates (21) originating from tomato
(Solanum lycopersicum), chilli (Capsicum annuum),
76
eggplant (Solanum melongena), potato (Solanum
tuberosum), weed (Chromolaena odorata) ginger (Zingiber
officinale), and cardamom (Elettaria cardamomum) based
on adk, gyrB, gdhA, gapA, ppsA, fliC, hrpB, and egl
revealed the prevalence of single virulence lineage of
race 4 /biovar 3, causing wilt in Zingiberaceae hosts.
The allelic profile of the genes confirmed this
observation.
4.1.2 Race Profiling
Virulence typing of Puccinia species (Wheat).
Pathotype 78S84 of P. striiformis tritici was recorded for
the first time at IARI Regional Station, Wellington.
Brown rust race 77-5 (121R63-1) was found to be the
most dominant, followed by 77-8 (253R31) and 77-7
(121R127) in the Nilgiri hills. Two pathotypes of black
rust 40A (62G29) and 40-1(62G29-1) prevailed in equal
proportions. Ug99 was not traced at the above locations
so far.
Fusarium oxysporum fsp. ciceris (FoC). Eight
distinct races of Fusarium oxysporum fsp. ciceris were
identified in 70 FOC isolates originating from 13
locations.
4.1.3 Molecular Diagnosis
Fusarium spp. The association of F. fujikuroi, F.
moniliforme and F. proliferatum with bakanae disease of
rice was established by comparing translation
elongation factor (TEF 700bp) sequences.
Rhizoctonia solani. Specific primers (AG2-
2F:CAACGGATCTCTTGGCTCTC;AG2-
2R:GGTGTCCTCGGCGATAGATA) designed for R.
solani detected the fungus at 24 h and 6 h postinoculation
under field and in vitro conditions,
respectively. The primers failed to amplify the other
seed- and soil-borne plant pathogens of chickpea. The
detection limit was 0.025 ng fungal DNA and Southern
blot analysis showed specificity.
Alternaria brassicicola. A PCR based assay was
developed for the identification of A. brassicicola from
pure culture and infected seeds using primers derived
from conserved ITS regions. The sensitivity limit for
detection (100pg) was verified through quantitative
Real Time PCR.

4.1.4 Biological Control
Performance of Pusa 5SD (Trichoderma
harzianum) formulation. The efficacy of Pusa 5SD
(Trichoderma harzianum) formulation alone or in
combination with Pseudomonas fluorescens (Pf-80),
Mesorhizobium ciceri and fungicide vitavax power as
seed treatment was determined under glass house
conditions. Seed treatment with a combination of Pusa
5SD (T. harzianum) + P. fluorescens + M. ciceri + vitavax
power provided the highest seed germination (100%)
and the lowest wilt incidence (18%).
Validation of Trichoderma based bioformulation.
Pusa 5SD (T. harzianum) formulation (@4g/kg seeds) in
combination with vitavax power (1g/kg) as seed
treatment showed significant efficacy for the
management of chickpea wilt (F. oxysporum f. sp. ciceris)
at three different locations (Sehore, Delhi and Rahuri),
and dry root rot (R. bataticola) and collar rot (S. rolfsii)
at Jabalpur.
Expression of a novel heat shock and salt tolerant
protein (Hsp22) from Chaetomium globosum. A small
heat shock & salt tolerant protein gene (603 bp;
Accession no. JQ 520149) was cloned and sequenced
from C. globosum (6). Comparative sequence analysis
showed varying degree of identity with corresponding
gene from Neurospora spp. (60%), Myceliophthora sp. (59
%), Glomerella sp. (50%), Hypocrea sp. (52%), and
Fusarium spp. (51%). A 30 kDa bacterium expressed
recombinant protein displayed significantly greater
resistance to NaCl and Na 2 CO 3 stresses. Besides,
another gene responsible for the production of xylanase
(1000 bp) was sequenced from C. globosum and other
species (C.cochlioides and C.cupreum).
Expression of Endochitinase (ech42) gene from
Trichoderma spp. ech42 gene (1100bp), involved in
mycoparasitism, was conserved in T. harzianum, T. viride
and T. atroviride.
4.1.5 Evaluation of Genotypes for Resistance
Wheat. Presence of leaf rust resistance genes Lr 1,
Lr 10, Lr 24, Lr 26 and Lr 34 in wheat genotypes (25)
was confirmed using molecular markers. Lr1 gene
(560bp) was available in all wheat genotypes tested
except HD 2888 and MACS 6145. Genotypes, viz, HD
77
2985, VL 804, Raj 3765, HI 977, PBW 343, HS 240 and
NI 5439 showed the presence of 282 bp fragment
specific to Lr10 gene. The presence of Lr24 gene was
confirmed by specific amplification of a single fragment
of 719 bp in six genotypes ,viz., HD 2888, C 306, HI
1531, HS 240, NI 5439, and HW 2004. A 267 bp fragment
specific to Lr 26 gene was amplified in genotypes, viz.,
HD 2687, HD 2733, HD 2824, VL 804, UP 2425, and
DBW 17, PBW 343, PBW 550 and HS 240. Six genotypes,
viz., HD 2985, VL616, UP 2425, Raj 3765, DBW 16 and
PBW 550 showed the presence of 150 bp fragment
specific to Lr 34 gene.
Of 98 wheat entries screened against Karnal bunt
(KB), 44 showed disease severity ranging from 1 - 42%
and 54 remained free from KB infection. Fifteen of 84
entries in AVT 2 nd year and 35 of 105 entries in AVT 1 st
year showed least infection (up to 5S) of yellow rust at
adult plant stage. IARI entries, viz, HS507, HD2967,
HD2888, HI8498 (d) and HI1571 were free from
infection of two yellow rust pathotypes (78S84 and
46S119). Out of 110 durum wheat genotypes, 57 showed
field resistance to both stem and leaf rusts when tested
with five durum-specific stem rust pathotypes. Genetic
diversity for field resistance to stem rust pathotype 40A
and leaf rust pathotype 77-5 in GW 322, GW 326,
HI 1418, HI 1479 and HI 1539 showed presence of one
to two dominant genes. Diversity for resistance to both
stem and leaf rusts was observed in HI 1418 / HI 1479,
HI 1418 / HI 1539, HI 1479 / HI 1539, HI 1539 / GW 322,
and HI 1539 / GW 326.
Rice. Of 20 rice blast isolates evaluated on a set of
monogenic rice differentials (24), Delhi isolate was most
virulent, compatible with most of the R-genes (18).
Pathotyping of near isogenic lines developed in Pusa
Basmati 1 background has led to the identification of
lines carrying major blast resistance genes, viz., PiZ 5 ,
Pi9 and Pi54. Out of 373 entries from Directorate of
Rice Research, Hyderabad evaluated against sheath
blight, 39 showed resistance. Evaluation of 12 aromatic
rice varieties against bakanae disease, Pusa Basmati 1
showed resistance to foot rot symptoms, and Pusa
Basmati 1, Pusa 146, Pusa Sugandha 5 and Pusa 1401
showed resistance to elongation symptoms. Out of 494
entries evaluated against bacterial leaf blight, 83
showed resistance.

Maize. Out of 281 elite maize genotypes evaluated
against maydis leaf blight (MLB, Bipolaris maydis) and
banded leaf and sheath blight (BLSB, Rhizoctonia solani),
15 entries showed resistance against both the diseases.
Out of 286 entries from DMR & 109 entries from IARI,
6 entries each from DMR and IARI were found resistant
against MLB & BLSB both. Out of 50 inbreds and 40
hybrids from ICAR-CIMMYT collaborative
programme, 8 entries were identified as resistant and
sib-mated for the development of hybrids.
Legumes. In chickpea, six genotypes BG 3010, BG
3020, BG 3012, GLK 26167, GLK 28127 and ICCV 93706
were resistant against wilt. Three genotypes DKG 986,
GLK 26167 and GLK 24092 were resistant against
Ascochyta blight and one Kabuli entry GLK 26167
showed resistance against both wilt and blight. Four
urdbean entries (P 719, P 723, P 728 and P 729) and one
mungbean entry (P 532) showed multiple disease
resistance against Cercospora leaf spot, web blight,
Macrophomina blight and YMV. Besides, of 80 genotypes
of Vigna spp. procurred from NBPGR, 37 showed
resistance against YMV through Agroinoculaton.
Papaya for PRSV resistance. In June and October
plantings, Pusa Selection 3 (PS 3) showed resistance to
PRSV with minimum incidence, 28.7% and 22.9%,
respectively, as compared to Red lady (100%), while in
April planting, incidence was minimum (3.2%) in PS
4. Multilocation impact assessment of Pune Selections
revealed that PRSV incidence was minimum on PS 3
at Gulbarga (Karnataka) and Aurangabad
(Maharashtra).
4.1.6 Epidemiology and Disease Management
Regional thematic maps were developed for
predictive management of yellow rust of wheat and
then matched with ground truthing. Weather indices
based on the infection criteria [Tmin =2°C, Topt= 9°C,
Tmax=18°C and daily RH (90% and above) for several
consecutive days, at least 15 hours daily] were
continuously yellow rust favourable from December
15, 2011 to January 11, 2012 and then decreased in parts
of Punjab - Gurdaspur, Hoshiarpur, Nawansahar and
Ropar. Ground truth survey at Gurdaspur, Hoshiarpur
and Ropar also showed yellow rust infection in
susceptible wheat varieties, namely, DBW 17, WH 711
78
and PBW 343 (3.8-5.7 disease severity). Weather based
monitoring and ground truth matching of yellow rust
infection in wheat for North West India proved useful
for development of surveillance system to provide
timely forewarning to the growers.
Presence of CTV and Citrus Greening in citrus and
4 banana viruses, viz., BSV, BBTV, CMV and BBrMV in
banana was detected in samples collected from
different regions of Maharashtra, Bihar and Karnataka.
A phytoplasma infected papaya was confirmed
through PCR and partial genome sequence submitted
to GenBank (JQ 346525), which is the first report of a
phytoplasma causing axillary shoot proliferation from
India. Survey of cucurbits in and around Pune revealed
occurrence of PRSV-W in bottle gourd and muskmelon,
CMV in cucumber, muskmelon and bottle gourd,
GBNV in muskmelon and phytoplasma in bottle gourd.
In tomato, occurrence of ToMV, CMV, GBNV and
ToLCV was observed. In capsicum, occurrence of
PoMMV, PoMV, PVY and CMV was observed. The
viruses were identified by DAC-ELISA, PCR/RT-PCR,
nested PCR, and electron microscopy.
Management of viral diseases. GBNV and PRSV-
W were effectively managed in muskmelon and bottle
gourd using silver color polythene mulching, neem oil
(1.0%) and dimethioate (0.1%). Incidence of CMV,
GBNV, ToLCV in tomato could be lowered by 13.33%,
9.33% and 8.0% by spray of Neembicidine and
Imidacloprid (0.01%), respectively.
4.1.7 Viral and Phytoplasmal Diagnosis
Chirke disease of large cardamom. The 3’ terminal
genome sequence containing partial NIb, complete
capsid protein gene and 3’ untranslated region of the
virus associated with the disease revealed identity of a
new virus species named, Large cardamom chirke virus
(LCCV) under the genus Macluravirus, family
Potyviridae. The virus was closely related to Cardamom
mosaic virus causing katte disease of small cardamom
and other close relatives were Alpinia mosaic virus and
Chinese yam necrotic mosaic virus. Chirke disease was
known to affect large cardamom for over 50 years and
the genome sequence unfolded for the first time the
etiology of the disease.

Symptoms of chirke of large cardamom (a), and association of
filamentous virus particles (b). The bar indicates 100nm
Production of polyclonal antibodies using
recombinant protein. Polyclonal antibodies developed
against bacterial expressed recombinant coat protein
of Apple chlorotic leaf spot virus (ACLSV;60 kd); Onion
yellow dwarf virus (OYDV; 75kd). Garlic virus X (Gar V-
X ;27 kd) and Peanut mottle virus (PeMoV) effectively
detected ACLSV in apple; OYDV on onion; GarV-X on
onion and garlic; and PeMoV on peanut.
Expressed recombinant core coat protein (22 kDa) of PeMoV in E.
coli (left) and Western bolt analysis (right). Lane 1: Soluble fraction
after 5 h of induction; Lane 2: Insoluble fraction of culture after 5
h of induction. Lane M: Pre-stained protein marker
Wheat streak mosaic virus (WSMV). Of 31
symptomatic wheat samples showing mosaic, mottling,
and streaks on leaves, and stunting and drying of
infected clumps collected from Indore, Pune and
Junagarh, 17 samples reacted with polyclonal
antibodies (PAb) to WSMV in DAC – ELISA.
Phytoplasma. The nested PCR based on the
amplification of gyrA, gyr B and dnaB genes was
developed for the detection of phytoplasma in
79
sugarcane grassy shoot, Catharanthus little leaf, toria
phyllody, brinjal little leaf and sesame phyllody
phytoplasmas. The amplicons of 1.4kb, 1.5kb and 0.96
kb representing partial gyrA, gyr B and dnaB genes,
were confirmed by sequencing.
4.1.8 Viral Genomics
Citrus tristeza virus (CTV). Comparative sequence
analysis based on coat protein (CP) gene from CTV
isolates originating from different locations (19 isolates
from central; 51 from north east; 24 from south and 17
from north India) revealed that the Indian isolates are
extensively diverse showing 89- 99% identity with six
phylogroups. Potential recombination events
responsible for extensive diversity of CTV in India and
evolution of several variants were identified.
Plumeria mosaic virus (Plu MV). The complete
genome of a Tobamovirus isolated from a temple tree
(Plumeria rubra fsp. acutifolia) showing mosaic disease
in New Delhi was 6675 nt (JN555602) and shared 82.9%
identity with Frangipani mosaic virus (FrMV) and

Grapevine leafroll-associated virus 3. Survey of
vineyards of Nashik and Pune regions revealed the
association of an Ampelovirus, antigenically related to
Grapevine leafroll-associated virus 3 (GLRaV-3) with seven
cultivars of grapevine. The CP gene of the GLRaV-3
(Indian isolate) was 942 nt long and could potentially
encode a protein of 313 aa (accession number
JN616386). The partially amplified HSP70h gene of the
GLRaV-3 isolate under study was 546 bp long and could
encode 181 amino acids (accession number JN859074).
4.1.9 Viral Pathogenesis
Role of non-structural protein (NSs). NSs as a
suppressor of RNA silencing from Groundnut bud
necrosis virus (GBNV) was demonstrated using the
Characterisation of the RNA silencing suppression activity of
GBNV NSs protein and of two NSs mutants (NSs-L172R; NSs-
S189R): (A) patch assay of GBNV-NSs and its mutants for RNA
silencing activity. In the left side of each Nicothiana benthamiana
leaf a binary vector expressing green fluorescent protein (GFP)
under the control of the 35S promoter was agroinfiltrated, together
with an empty binary vector. In the right side of the leaf, the same
binary vector expressing GFP was agroinfiltrated together with a
binary vector expressing NSs protein, intact or mutant. The
suppressor of silencing activity of the Tomato bushy stunt P19
protein is shown for comparison. (B) Quantification by western
blotting of the steady-state level of accumulation of GFP in the
infiltrated patch using a GFP rabbit polyclonal antiserum. Lower
panel shows a ponceau S stained membrane. (C) Location of
mutation 1 and of mutation 2 in the NSs gene.
80
Agroinfiltration patch assay. As leaf senescence is
controlled by miR319 regulation of the transcription
factor TCP1, accumulation of both RNAs in transgenic
NSs-expressing and GBNV-infected tomato plants was
assessed. Decreased levels of miR319 and increased
levels of TCP1 transcripts in both GBNV infected
tomato plants and transgenic tomato expressing NSs
suggested that GBNV-NSs affects miRNA biogenesis
through its RNA silencing suppressor activity and
interferes with TCP1-regulated leaf developmental
pathways.
4.1.10 Transgenic Resistance
Rhizoctonia solani. To develop RNAi based
management strategy for sheath blight of rice,
endopolygalactouranase gene (1058bp) was cloned in
pGEMT easy vector.
Transformation of citrus. An efficient and
reproducible plant regeneration (organogenesis)
protocol for acid lime cv kagzi lime (Citrus aurantifolia)
was standardized using epicotyls explants (0.8-1 cm)
and Agrobacterium-mediated transformation using CP
gene construct (K9) was attempted.
4.2 ENTOMOLOGY
4.2.1 Insect Pest Management
4.2.1.1 Cereals
Out of thirty five rice germplasm lines evaluated
against brown plant hopper (BPH), two lines, Mudgo
(ACC 6663) and Pokkali were observed resistant (0-3
damage score), while Rathu Heenati, T12 and IR77542-
551-1-1-1-1-2 were found to be moderately resistant (3-
5 damage score).
Triazophos 40 EC @ 300 and 500 g a.i./ha, and
sulfoxaflor 21.8 SC @ 68 and 82 g a.i./ha were evaluated
against rice insect pests on Pusa Basmati 1401. Owing
to lower population of BPH and of other pests,
treatment with sulfoxaflor 21.8 SC @ 82 g a.i./ha gave
the highest yield followed by triazophos 40 EC @ 500 g
a.i./ha.
Development threshold and thermal constant of
pink borer, Sesamia inferens were determined by
regressing development rate on temperature. The
thermal constants for eggs, small larvae (1st-3rd instar),

large larvae (4th-5th instar) and pupae were 47.6, 500.0,
200.0 and 166.7 degree days (DD), respectively with
corresponding development threshold being 13.8 o C,
10.0 o C, 11.2 o C and 12.7 o C. Using thermal requirements,
and various biotic and abiotic mortality factors,
population simulation model of S. inferens was
developed and validated using field data. The
simulated S. inferens egg, larval, pupal and adult
populations were found to be close to the observed ones
(RMSE=1.68%).
Insect Meloe violaceus
feeding on wheat leaf
Nature of damage on leaves
Infestation of a new insect identified as Meloe
violaceus was observed in the experimental area of IARI
Regional Station at Pusa (Bihar) in December, 2011 in
four bread wheat varieties. This is the first report of
Meloe violaceus, the violet oil beetle on wheat from India.
4.2.1.2 Vegetables
Emamectin benzoate (10g a.i./ha) combined with
Neem Baan (@7ml/L water)proved effective against
fruit borer, Leucinodes orbonalis on brinjal, as the lowest
per cent fruit infestation, i.e., 5.39 on number basis and
5.77 on weight basis was observed.
Various border crops were evaluated against
incidence of major insects of cabbage. Minimum
population of aphids was recorded with coriander
(46.05) as border crop. Maximum population of
coccinellids/plant was noticed on cabbage (2.80) when
bordered with fenugreek.
A field trial laid out with ten treatments with
cabbage var. Golden Acre comprising of four spray
schedules indicated that the treatment with
acetamiprid- acetamiprid- fipronil- spinosad, gave
significantly high population reduction over control
(PROC) of Lipaphis erysimi, viz., 82.92% and 76.04% on
3 rd and 7 th day, respectively. Chlorantraniliprole (18.5%
81
SC @10 g a.i./ha) showed the highest PROC of diamond
back moth (DBM) Plutella xylostella (82.08%) in
treatment having acetamiprid -acetamipridchlorantraniliprole-
emamectin benzoate with
maximum marketable yield (32.17 t/ha). Neem Baan,
spinosad, emamectin benzoate and chlorantraniliprole
proved safe to natural enemies in cabbage.
Different cole crops at IARI Regional Station,
Katrain when evaluated against DBM under net house
conditions showed minimum infestation in turnip
followed by radish, cabbage. Out of ten cauliflower
cultivars evaluated against DBM, minimum infestation
was recorded in Pusa Himjyoti.
Synthetic organic insecticides evaluated against the
aphid, Myzus persicae infesting capsicum crop showed
that spray of imidacloprid 200 SL @ 0.25 ml/L (72.71 t /
ha) produced maximum capsicum fruit yield. Among
the different pest and disease management modules
tested, module comprising of the use of yellow
coloured seeds, nursery root dipping with Bavistin
(0.5%), Trichoderma viride enriched compost application
after 15 days of transplanting and need based
fungicide/insecticide application was considered
promising in raising the seed crop of capsicum.
Management of sucking pests in Capsicum under protected
cultivation
Treatment Percent aphid Vegetable
infestation yield (t/ ha)
Plants Twigs
Acephate-75
SP (0.5 g/L)
37.10 (37.42) 27.77 (30.75) 66.68
Imidacloprid200
SL (0.25 ml/L)
37.10 (34.11) 6.67 (11.67) 72.71
Control 88.23 (74.52) 47.30 (42.97) 38.57
CD(P=0.05) 24.60 30.61 34.94
Figures in the parenthesis are arc sin transformed values
4.2.1.3 Soybean
Out of sixty two soybean lines including IVT (41)
and AVT II (21) evaluated against stem fly and yellow
mosaic virus (YMV) disease transmitted by white fly,
two varieties DS –1213 and DS 2614 showed resistance
continuously for the last three years and were identified
as promising sources of resistance.

Triazophos 40 EC @ 800ml/ha and profenophos 50
EC @ 1250ml/ha were effective against stemfly of
soybean. The YMV scores were also lower with
significantly higher yield.
4.2.2 Storage Entomology
Freshly harvested seeds of eight green gram
cultivars screened against the behaviour pattern of
three bruchids, viz., Callosobruchus maculatus, C.
chinensis and C. analis revealed that C. maculatus caused
minimum loss and recorded minimum population in
Pusa Baisakhi after 75 days of storage, while the
maximum loss was observed in cultivar PS 16; C.
chinensis caused minimum loss in Pusa Vishal but
maximum loss along with highest population in Pusa
9072. C. analis caused maximum loss to Pusa Baisakhi,
while maximum number of insects were observed on
Pusa 9531.
4.2.3 Biological Control
A laboratory rearing technique was developed for
cotton mealybug parasitoid, Aenasius bambawalei. The
parasitoid could be reared successfully for more than
12 generations on mealy bug, Phenacoccus solenopsis
multiplied on potato tubers, and adult fed on honey
(20%) at 25±2 0 C and 65±5% RH. Besides, newly
introduced papaya mealybug, Paracoccus marginatus
multiplied on potato sprouts in the laboratory was
found to be a suitable host for rearing of cocophagous
predators viz., Cryptolaemus montrouzieri, Nephus
regularis, Scymnus coccivora and Hyperaspis maindroni,
indicating their potential for field releases.
Nucleopolyhedrosis virus of Spodoptera litura
collected from Nava Sahar (Punjab), Kaithal (Haryana),
Bharatpur (Rajasthan) and Aligarh (Uttar Pradesh)
purified and bioassayed against 4, 5 and 7 days old
larvae of S. litura indicated that the strains differed
significantly in their ability to cause mortality. The LC 50
values for 4 day old larvae of S. litura were 231.316 x
10 6 , 294.946 x 10 6 , 355.390 x 10 6 and 421.726 x 10 6 PIBs,
respectively, while for 5 day old larvae were 259.656 x
10 6 , 307.722 x 10 6 , 368.168 x 10 6 and 453.325 x 10 6 PIBs,
respectively. The NPV strain from Nava Sahar (Punjab)
was the most effective.
Safety evaluation studies conducted for different
group of insecticides, viz., neonicotinoids, synthetic
82
pyrethroids, carbamates, newer insecticides and a
botanical in field recommended doses by dry film
residue method, against various developmental stages
of different predators, viz., Chrysoperla sp., Coccinella
septumpunctata and Cheilomenes sexmaculata showed
that the per cent mortality of grubs of Chrysoperla sp.
varied from 0.00 to 80.00. However, the highest per cent
mortality was observed due to carbosulfan 24 hours
after treatment. The lowest adult emergence was
recorded from pupa exposed to synthetic pyrethroids,
viz., cypermethrin and bifenthrin.
The grubs and adults of C. septumpunctata recorded
the highest percent mortality (100 %) in grubs due to
cypermethrin, bifenthrin and carbosulfan, whereas no
mortality was observed from control group. The percent
pupal mortality was highest in thiamethoxam. Highest
per cent adult formation from treated grubs was
recorded from control followed by pymetrozine. The
adult mortality was high against carbosulfan, bifenthrin
and cypermethrin, whereas control group showed no
mortality. The mortality in grubs of C. sexmaculata after
24 hours was highest in imidacloprid, cypermethrin and
carbosulfan treatments, whereas buprofezin was on a
par with control with zero mortality.
The effect of green labelled insecticides, viz,
chlorantraniliprole and flubendiamide when tested
against the egg parasitoids, Trichogramma chilonis and
T. brasiliensis showed lowest percent parasitisation and
adult emergence in flubendiamide at all the
concentrations. However, chlorantraniliprole was
observed to be safer than flubendiamide.
4.2.4 Insect Physiology
Bacterial isolation from the midgut of adult
Bactrocera zonata and their identification based on
morphological, cultural and biochemical characteristics
and further confirmation by 16S rRNA sequences
revealed that the bacterial isolates belonged
to Enterobacteriaceae, Bacillaceae and
Xanthomonadaceae. The two bacterial isolates, viz.,
Stenotrophomonas (Pseudomonas) maltophilia and
Enterobacter asburiae were obtained from the adult
population of wild colony, while laboratory reared
colony harboured Bacillus thuringiensis and B. subtilis.
The � tocopherol in combination with ascorbic acid
or �-carotene showed better growth of Spodoptera litura

and enhanced the reproductive potential of the adult.
The effect of glutathion was on a par with control, while
gallic acid had significant inhibitory effect on the
developmental stages of insect.
A field trial was conducted to evaluate different
levels of refugia (non-Bt cotton) by using refuge-in-bag
concept wherein non-Bt seeds were mixed with Bt to
ensure presence of refugia in the field. Dual stacked Bt
cotton hybrid MRC 7017 belonging to Bollgard II was
sown in the kharif season of 2011. Bt cotton was infested
significantly by whitefly amongst all other sucking
pests. The whitefly infestation started from beginning
and was highest at 46 days and thereafter declined.
There was no definite difference between Bt and non-
Bt treatments. The shoot damage due to Earias increased
from 0.5 to 11.9% at 51; 0.5 to 34.9% at 74 and 0.5 to
60.9% at 91 days after sowing. Although, incidence of
bollworms was less, damage to seed cotton (in terms of
kapas weight) did not show any definite trend as the
proportion of n-Bt refuge planting increased. There was
no definite trend of yield among treatments ranging
from 5% to 40% refuge. The 100% non-Bt and Bt cotton
yielded seed cotton of 1.58 t/ha and 2.50 t/ha,
respectively. Pink bollworm incidence was observed for
the first time in bolls of Bt cotton this year.
The effect of shoot damage (top as well as side
branches) on the damage to cotton plant and total yield
was assessed. It was observed that Bt plants without
top and side branches damage yielded 284.6 g/plant,
n-Bt plant with top and side branches damage yielded
141.6 g, n-Bt plants without any damage yielded 165
Effect of damage to top and side branches of cotton on
damage to the productivity and cotton quality
Treatments Yield (g/plant) % damage
Bt T(N) SB(N) 284.6 50.84
n-Bt T(N) SB(Y) 80.4 66.29
n-Bt T(Y) SB(N) 80.2 66.51
n-Bt T(Y) SB(Y) 141.6 52.99
n-Bt T(N) SB(N) 165.8 51.35
Mean 155.7 57.34
LSD 5% 74.63 13.21
T= top shoot; SB= side branch; Y=presence of damage; N= absence of damage,
Bt= plants of MRC7017BGII; n-Bt= plants of non-Bt MRC7017
83
g/plant, n-Bt plants with top or side branches damage
yielded 80.2 and 80.4 g/plant, respectively. This shows
that Bt plants are superior, and damage due to Earias
affected yields adversely.
On examination of green bolls from each treatment,
loculi damage was evident and green boll damage
increased with increase in age of crop. Treatment where
all plants were non-Bt cotton had maximal boll damage.
Of the bollworms examined, only Earias and
Pectinophora gossypiella larvae could be seen and
incidence of pink bollworm was the highest on Bt
cotton. There was no incidence of H. armigera or S. litura
on Bt cotton. However, leaf roller incidence was
observed only on non-Bt cotton.
Five stem borer tolerant and agronomically
desirable maize genotypes selected from a set of 20
diverse genotypes resistant to spotted stem borer, Chilo
partellus were characterized for stem borer dead hearts;
polyphenols, viz., ferulic acid and p-coumaric acid;
morphological plant traits such as leaf glossiness,
anthocyanin pigmentation; and seedling vigor. There
were significant differences in stem borer deadhearts
among the test genotypes, being lowest in CPM 15
(8.0%) and highest in CML 334 (22.0%). The differences
among the selected lines for leaf glossiness,
anthocyanin pigmentation, and seedling vigor were
statistically significant. Seedlings of all the selected
genotypes had high to moderate anthocyanin
pigmentation and seedling vigor. The correlation
coefficients of ferulic and p-coumaric acids with stem
borer dead hearts were positive but nonsignificant.
However, the correlation coefficients of anthocyanin
pigmentation with ferulic (r = 0.69) and p-coumaric
(r = 0.89) acids were significant and positive.
Five selected sorghum germplasm lines were
characterized for different morphological and
biochemical parameters against stem borer damage.
Based on the dead hearts, the sorghum line IS 2205 was
found to be resistant and concentrations of ferulic and
p-coumaric acids were also highest in this line. There
were highly significant and positive correlations of
ferulic and p-coumaric acids with number of stem borer
larvae per stem (r = 0.58 and 0.66), number of exit holes
per stem (r = 0.61 and 0.71), number of tunnels per stem
(r = 0.61 and 0.71), and per cent stem length tunneled
(r = 0.83 and 0.79), respectively.

4.2.5 Insect Toxicology
Antifeedant (AI 50 ) activity of various extracts of
Clerodendron infortunatum leaves and pure compounds,
Clerodin, 15-methoxy-14, 15-dihydroclerodin and 15hydroxy-14,
15-dihydroclerodin when evaluated
against third instar larvae of H. armigera through no
choice method showed that the pure compounds
clerodin (CI 5), 15-methoxy-14,15-dihydrocleroin (CI
9) and 15-hydroxy-14,15-dihydroclerodin (CI 10) and
their mixture (CI 4) had the best antifeedant activity as
their AI 50 was 0.53, 0.6, 0.73 and 0.47 times lower than
azadirachtin, respectively. Similarly growth inhibitory
activity of these extracts when tested through diet
incorporation method showed complete growth
inhibition with azadiracthin, CI 4 and CI 13 even at the
lowest concentration (0.001%).
In vitro tests of termicidal treatments using wheat
seed revealed that seed-treatments with double
recommended dose (i.e. chlorpyriphos 20% EC, &
fipronil 5% SC; 10 & 12 ml/kg seeds) are detrimental to
the wheat seedlings. Double dose resulted in least
germination (89%) and minimum root and shoot length.
4.3 NEMATOLOGY
4.3.1 Nematode Management
The juveniles of Globodera spp encumbered with
Pasteuria spores when inoculated to 10 days old potato
seedlings (cv. Kufri Jyoti) raised in sterilized soil
revealed that white females were infected with
Pasteuria development stages and none of the infected
females contained eggs. These observations suggested
that Pasteuria isolated from the pigeon pea cyst
nematode, H. cajani had cross-generic attachment.
4.3.2 Biofumigation for Management of
Root-Knot Nematode in the Soil
Fresh leaves of Brassica juncea (cv. MC 27 and Pusa
Jagannath) incorporated in root-knot infested soil (30J2/
cc soil @ 10%, 20% and 30% w/w) for 30 days did not
show root-knot J2 in any of the treatments. The bioassay
of the soil using moong seedlings did not show the
development of galls. In polyhouse study also, B. juncea
when incorporated in root-knot infested soil showed
undetectable levels of root-knot juveniles.
84
4.3.3 Bioefficacy of Controlled Release
Nano- formulations of Azadirachtin-A
against Meloidogyne incognita in Tomato
Penetration and development of second stage
juveniles of Meloidogyne incognita in tomato roots
decreased with the increase in the concentration level
of Aza from 5 to 40 ppm. AP2 @ 10 ppm improved the
plant growth in terms of shoot length followed by @ 5
ppm. The Aza-A-PEG 1500 (AP2) which showed the
lowest population of nematodes provided significantly
superior control.
4.3.4 Interactive Effect of Herbicide and
Nematicides on Cereal Cyst Nematode,
Heterodera avenae Infecting Wheat under
Field Conditions
A field trial conducted at IARI, New Delhi on the
effect of post-emergence herbicide, pinoxaden and
other chemicals (carbofuran and phorate) on the cereal
cyst nematode, Heterodera avenae infecting wheat
revealed that combined application of carbofuran and
phorate both @ 1kg a.i./ha followed by spray with
pinoxaden @ 60g/ha effectively reduced cyst
population.
4.3.5 Management of Rice Root-knot
Nematode, Meloidogyne graminicola in Rice
Nursery
Management of rice root-knot nematode,
Meloidogyne graminicola using soil solarization and
fumigation treatments showed that solarization for 15
days was effective in improving the plant growth of
rice plant. However, the application of carbofuran
Effect of different treatments on number of galls in rice infected
with Meloidogyne graminicola in nursery bed

@1 kg a.i./ha applied in solarized bed most effectively
reduced the number of galls on rice seedlings at 24DAS.
Thus, with this treatment, 24 days old seedling could
be transplanted for effective management of
M. graminicola under nursery conditions.
4.3.6 Effect of Chemical Treatment on the
Preceding Crop of Gram on the Population
of Nematode in the Succeeding Crop of
Mungbean
The effect of chemical treatment with carbofuran
@ 1 and 2 kg a.i/ha, Trichoderma harzianum @10 and 15
kg/ha, and seed soaking in triazophos at 125 and
250 ppm for 20 minutes with untreated control on the
preceding crop of gram on the nemic population in
succeeding crop of mungbean was investigated. There
was significant increase in population of reniform
nematode. Minimum increase was found with
triazophosh @ 250 ppm treatment (4 pre-adult/g soil)
in comparison to control. The population of stunt
nematode was low in all the treatments in relation to
control with respect to final population. The pod yield
was better in treated plots than the untreated control.
Maximum pod yield was recorded in triazophos (0.5
kg/16m 2 ) followed by Trichoderma sp. (0.45 kg/16m 2 ).
The yield performance was improved by 18-45%
depending upon the treatment.
4.3.7 Management through Transgenic
Approach
The functional validation using RNAi carried out
for two FMR, Famide like peptide genes (FLPs), flp14
and flp18 and one sub ventral esophageal gland specific
gene 16D10 showed that RNAi silencing of all three
genes significantly reduced the nematode attraction at
different time intervals. Single gene silencing and also
their combinations interfered with the host finding
mechanism as the silenced worms were delayed in
reaching the roots. Flp18 was the most effective in
preventing the penetration as there was about 67 per
cent reduction over control in penetration at 24 hrs after
inoculation and 21 per cent at 72 hrs.
The tomato, Solanum esculentum, cv. Pusa Ruby was
transformed using Agrobacterium tumefaciens mediated
method to express dsRNA of the subventral esophageal
85
gland parasitism gene AF531170. The host-induced RNAi
of the root knot nematode parasitism gene led to a
significant reduction to the range of 54.79 to 59.89% in the
development of adult females over control. Further,
reduction in the galls and in eggs per egg mass was also
observed. These observations demonstrate the relevance
of the targeted parasitism gene during the nematode life
cycle and potentiality of obtaining viable level of resistance
in crop plants using RNAi technology against root knot
nematode.
In silico search for potential gene targets of rootknot
nematode for functional validation through RNA
interference, led to identification of a unique 366 bp
conserved region of Mi-cpl-1 which has been amplified
taking total RNA from J2 of M. incognita followed by
cDNA synthesis through RT-PCR. The gene has been
cloned into the RNAi vector, PBC 6 which is of 14 kb in
size having CaMV 35S promoter.
4.3.8 Entomopathogenic Nematode
The virulence of the infective juveniles of
entomopathogenic nematode Steinernema thermophilum
exposed to the highest recommended doses of 26
pesticidal formulations were evaluated against the 4 th
instar larvae of Galleria mellonella. The bioassay study
showed the retention of virulence by the infective
juveniles and a synergistic interaction of S. thermophilum
and the biopesticide spinosad was observed.
4.4 AGRICULTURAL CHEMICALS
4.4.1 Chemo and Bio-prospecting for
Agrochemicals through Design, Discovery
and Development of Novel Processes and
Products
Chemical characterization and antifungal activity
of Clerodendron infortunatum extracts and
constituents. Three compounds isolated from the
hexane extract of Clerodendron infortunatum leaves
identified as clerodin, 15-hydroxy-14,15dihydroclerodin
(M + - 466) and 15-methoxy-14,15dihydroclerodin
(MH + - 452) exhibited moderate
antifungal activity (EC 50 156.2 – 206.7 ppm).
Antioxidant and antifungal activity of extracts of
Tagetes erecta. Forty one major compounds extracted

from Tegetes erecta representing more than 90% of the
total detected constituents of essential oil were
identified which included limonene (11.16%), dllimonene
(4.26%), E-tagetone (10.56%), E-oscimene
(18.65%), �– caryophyllene (6.9%), and cis-ocimene
(44.21%). The essential oil had significant antioxidant
and antifungal activity.
Synthesis of Schiff bases of 4-amino-3-mercapto-
5-pyridin-2-yl-4H-1,2,4-triazole. A series of 20 Schiff
bases of 4-amino-3-mercapto-5-pyridin-2-yl-4H-1,2,4triazole
having different substitutions in the aryl ring
attached to imine group were synthesized and
characterized by IR, H-NMR and 13 C-NMR
spectroscopy. It was observed that microwave synthesis
was much faster and efficient than the conventional
methods.
Fungicidal activity of substituted aryl aldehydes.
Out of twenty four substituted aryl aldehydes
evaluated for fungicidal activity in vitro, 2-Cl
substituted aldehyde showed highest activity (ED 50 100
�g/ml) against Rhizoctonia solani.
Field evaluation of potential nematicidal Schiff
bases of 4-amino-3-mercapto-5- phenyl-1,2,4-triazole.
Two compounds, viz., GA-1 & GA-5, which have
shown potential nematicidal activity in vitro, pot
studies and in micro plots (1m × 1m) when further
evaluated in field (2mx2m plots) on okra (var. A 4) at
150 (750 g a.i./ha) and 300 ppm concentration showed
considerable reduction in number of galls caused by
root knot nematode and increased plant growth.
N N
N SH
N
C
H
Microwave accelerated solvent-free synthesis and
antifungal evaluations of flavanones. Microwave
irradiation of 2-hydroxy chalcones with trifluoroacetic
acid (TFA) over silica gel was used to synthesize 11
known flavanones, out of which, 2-(4 fluorophenyl)-
2, 3-dihydrochromen-4-one was found to be the most
potent having maximum antifungal activity (LC 50 12.0
mgL -1 ).
R
86
Ar
O
O
Flavanone
Isolation and bioassay of secondary metabolites
of Fusarium oxysporum. Ethyl acetate concentrate of
Fusarium oxysporum proved most active component
against pathogenic fungi, Rhizoctonia bataticola,
Macrophomina phaseolina, Pythium aphanidermatum;
showing maximum activity against R. bataticola (ED 50
326.51 ppm) and S. rolfsii (ED 50 338.37 ppm). 500ppm
concentrate of ethyl acetate showed complete mortality
against second instar larvae of root-knot nematode
(M. incognita).
Synthesis of potential picolinic acid Schiff bases.
Picolinic acid Schiff bases synthesized in the laboratory
had significant antifungal activity against soil borne
pathogens, Rhizoctonia bataticola and Rhizoctonia solani.
N-phenyl-(3-chloro)-imino-picolinamide exhibited
maximum antifungal activity against R. bataticola (ED 50
53.90 mg L -1 ) followed by R. solani (ED 50 59.08 mg L -1 ).
Extraction and antifungal activity of essential oils
of Ocimum chemotypes. Camphor (85%) and chavicol
(69%) characterized by GC-MS were the major
constituents of essential oil extracted from Ocimum sp.
varieties OEC 2 and OIC 4, respectively, while linalool
was most abundant in OIC 1, OIC 3 and OEC 3. Selinene
was one of the major sesquiterpenes present in other
chemotypes. All the chemotypes contained linalool
ranging from 3.68 to 41.63%. Essential oils of OIC
exhibited higher antifungal activity against R. solani
(ED 50 115.32-202.51 ppm) followed by M. phaseolina
(ED 50 165.20-247.11 ppm).
Synthesis and characterization of new
azomethine derivatives as new antifungal agents and
nitrification inhibitors. Twenty three new azomethine
compounds derived from 2,4,5-trichloro aniline
synthesized by condensing aniline and different
aldehydes, were characterized on the basis of spectral
data.
Ar`

CI
CI
CI
NH 2 + RCHO MeOH
The maximum antifungal activity was observed
with 3, 4, 5-trimethoxy benzylidene-(2, 4, 5trichlorophenyl)
amine (ED 50 9.4 �g/ml) against R.
bataticola while, 4-tert-butyl benzylidene-(2, 4, 5trichlorophenyl)
amine was the best against S. rolfsii
(ED 50 - 10.6 �g/ml). Nitrification inhibition (NI) studies
revealed that all test compounds were highly effective
as nitrification inhibitors.
Synthesis, antifungal evaluation and QSAR
analysis of nalidixic acid based 1,2,4-triazole
derivatives. Thirty three new nalidixic acid based 1,2,4triazole
derivatives synthesized and characterized
using spectral techniques were screened for antifungal
activity against two pathogenic fungi, Aspergillus niger
and Fusarium oxysporum taking hexaconazole as a
standard antifungal agent. All the compounds showed
moderate to weak activity against both fungi. Based
on Quantitative Structure Activity Relationship (QSAR)
analysis, it was observed that steric parameters of the
molecules strongly influenced the antifungal activity
than hydrophobic and other topological parameters.
4.4.2 Food Safety, Risk Assessment of Crop
Protection Products and Residue
Management
4.4.2.1 Supervised field trials for pesticide risk
assessment
Persistence of chlorantranipole on mustard and
cabbage. Persistence of chlorantranipole, a new class of
anthranilic acid diamide used for the control of
lepidopteron insects, was studied on mustard and
cabbage at 10 and 20 g a.i./ha using HPLC-UV detector.
The insecticides dissipated with half-life of 1.3 to 1.7 days
and 92.3 -95.0% dissipation was recorded on 7 th and 5 th
day, respectively. A safe waiting period of 3 days has
been suggested for mustard leaves and cabbage heads.
Persistence of ethion and cypermethrin on
vegetables following use of ready mix formulation. A
CI
R = alkenyl, aryl, heterocyclyl
CI
CI
N
R
87
ready mix formulation of ethion amd cypermethrin
(Nagata; 40% cypermethrin + 4% ethion) when applied
on chili fruits at 50% flowering followed by second
application at 50% fruiting at 1 and 2 L/ha, ethion and
cypermethrin persisted till 5 days, with a half life of
1.30 and 1.20 days, respectively. Residues of both ethion
and cypermethrin were below the prescribed Codex
MRL on chili by day 3.
Persistence of deltamethrin and endosulfan
following use of combination mix pesticide on okra.
Commercial combination mixture of deltamethrin+
endosulfan (Cobra-5000) when sprayed @ 1 and 2 L/ha
on okra at fruit formation stage, up to 15 days at regular
time intervals showed half-life of dissipation for
endosulfan and deltamethrin to be 2.4-3.2 days and 2.7-
3.4 days, respectively. A safe waiting period of 3 days
has been suggested.
Persistence of chlorfenapyr on brinjal.
Chlorfenapyr formulation (Intrepid 10% SC) when
sprayed on brinjal crop @ 100 and 200 g a.i./ha at 50%
fruit formation stage revealed that residues persisted
in fruits beyond 15 days with the half-life of dissipation
of 4.5-4.9 days. A safe waiting period of 5 days has been
suggested.
Persistence of chlorfenapyr in okra fruits and field
soil. Persistence of chlorfenapyr when sprayed on okra
@ 100 and 200 g a.i./ha at flowering/fruit showed initial
deposits of 0.120 and 0.171 μg/g in okra fruits and 0.162
and 0.207 μg/g in surface soil, respectively. The residues
persisted up to 15 days on okra fruits and dissipated
with a half-life of 1.8-2.2 days, while in soil residues
persisted beyond 15 days. For consumer safety, a
waiting period of 5 days is suggested.
Residues of penoxulam in rice field soil. Persistence
of penoxulam herbicide was studied in rice crop after
post emergent application on 15 days after
transplanting at 20 and 25 g a.i./ ha. Residues of
penoxulam (initial deposit 0.117-0.158 g/g) dissipated
with a half-life of 5.2 to 6 days in soil. At harvest
residues were below detectable limits (0.01 �g /g).
Residues of diclosulam in soybean field soil.
Residue analysis of diclosulam applied at pre emergent
stage indicated an initial deposit 0.092-0.148 �g/g in
soil dissipated with a half-life of 8.4 to 9.7 days. At

harvest residues were below detectable limits
(0.01 �g /g).
Degradation of clodinafop propargyl in
susceptible and resistant Phalaris minor. Degradation
of clodinafop propargyl applied as post emergent spray
to susceptible and resistant biotypes of P. minor, were
analysed for clodinafop propargyl and clodinafop acid,
an active and translocative form of this herbicide. In
resistant biotype, traces of the herbicide were detected
in roots as ester while nothing was detected in shoots.
In susceptible biotype the maximum amount of
clodinafop acid was detected both in shoot and root
on 4 th day and thereafter plants died due to herbicide
phytotoxicity.
4.4.2.2 Environmental fate of pesticides
Effect of organic amendments on the persistence
of bifenthrin, fipronil, metribuzin and atrazine in soil.
Sludge amendment drastically decreased atrazine half
life from 150 days in un-amended soil to 30.0-37.6 days.
Similarly, bifenthrin half life decreased from 100 days
(unamended control) to 50.0-75.2 days. Results
suggested that sludge amendments increased the rate
of fipronil dissipation as the half life decreased from
150.5 days (control) to 60.2-100.3 days. In case of
metribuzin half-life in amended soil was found to be
higher as compared to unamended soil.
Sorption and leaching of metsulfuron-methyl,
metolachlor and atrazine in fly ash amended soils.
Effect of Indraprastha (IP) fly ash on metsulfuronmethyl
sorption-desorption and leaching was studied
in IARI, Jhargram and Almora soils. Application of fly
ash significantly increased metsulfuron methyl
sorption in all the three soils and sorption increased
with increasing dose of fly ash. The K oc values for
metsulfuron methyl sorption in fly ash-amended soils
showed 6 to 50 times variation suggesting that the OC
content was not the main fraction of fly ash responsible
for the increased metsulfuron methyl sorption in the
amended soils. The slope (1/n) values of metsulfuron
methyl adsorption in the control soils are nonlinear and
values are less than unity suggesting L-type isotherms.
However, application of fly ash slightly decreased the
isotherm slope values in IARI soil, while slope values
increased in Jhargram and Almora soils.
88
Leaching behaviour of metsulfuron-methyl
studied in IP fly ash amended IARI and Jhargram soils
indicated that application of fly ash to soil reduced the
metsulfuron-methyl downward mobility in the both
soil columns and affected both metsulfuron-methyl
breakthrough time and its maximum concentration.
Similarly, metsulfuron-methyl breakthrough from 1%
fly ash amended Jhargram soil column occurred after
passing 2.62 pore volumes of water. No metsulfuronmethyl
leached out of the 5% fly ash amended IARI
and 2 and 5% fly ash amended Jhargram soil columns.
Application of fly ash to soil retained higher amounts
of metsulfuron-methyl in the application zone and
upper soil layers because of greater sorption and
irreversibility of metsulfuron-methyl sorption in fly
ash-amended soils.
An increase in the sorption of metolachlor and
atrazine in fly ash amended soils was observed which
increased with increase in the amount of fly ash
amendment. Inderprastha fly ash was found to be more
effective in enhancing the metolachlor sorption than
the Badarpur fly ash in both soils.
Effect of elevated CO 2 on azoxystrobin
degradation. Elevated CO 2 (580±20 μmol mol -1 ) did not
have any significant effect on the persistence of
azoxystrobin in rice planted soil. The half life values
for the azoxystrobin in rice soils were 20.3 days in
control (rice grown at ambient CO 2 outdoor), 19.3 days
in rice grown under ambient CO 2 atmosphere in OTC
and 17.5 days in rice grown under elevated CO 2
atmosphere in OTC. Elevated CO 2 enhanced soil
microbial biomass (MBC) and alkaline phosphatase
activity of soil. Higher MBC in soil at elevated CO 2
could be attributed to increased carbon availability in
the rhizosphere via plant metabolism and root
secretion. However, it did not significantly increased
azoxystrobin degradation suggesting that pesticide
degradation was not the result of soil MBC alone.
4.4.2.3 Analytical methods
Method standardisation for analysis of ethion,
fenpropathrin, endosulfan, �����-cyhalothrin,
cypermethrin, hexaconazole, dicofol and bifentrin in
tea. Extraction by shaking with acetonitrile followed
by florisil column cleanup gave the best recoveries for

estimation of ethion, fenpropathrin, endosulfan and
l-cyhalothrin in tea using GLC-ECD. At the fortification
level of 1.0 and 0.5 �g the average recovery ranged
between 82.8 and 90.6%. The method was found to be
reproducible with RSD of 3.1 – 7.3%. Similar method
was found suitable for estimation of cypermethrin,
hexaconazole, dicofol and bifentrin in tea. The method
was accurate with the average recovery ranging from
83.7-90.5% at the fortification level of 1.0 and 0.5 �g
and reproducible (RSD 3.9-4.5%).
Gas chromatography method for metsulfuron
methyl herbicide analysis in soil. Gas
Chromatographic method was developed for the
determination of metsulfuron methyl herbicide
residues from soil by its derivatization to a dimethyl
derivative and using diazomethane. Using GC-ECD
method, recovery of metsulfuron methyl from soil was
above 80%. Mono and dimethyl derivatives of
metsulfuron methyl had Rt of 5.72 and 14.56 min,
respectively. Limit of detection (LOD) and limit of
quantification (LOQ) of the method were 0.1 �g mL -1
and 0.2 �g g -1 , respectively.
Multiresidue methodology for analyzis of PAHs
in water. A multiresidue method for the analysis of
PAHs (naphthalene, acenaphthalene, phenanthrene,
fluanthrene, anthracene and pyrene) in water by HPLC
was standardized. The linearity range was 0.01-100 mg/
L and the limit of detection (LOD) varied from 0.01-
0.05 �g/mL with injection volume of 10 �L. Among the
three solvents used in liqud-liquid partitioning for
extraction, dichloromethane gave maximum extraction
efficiency (70.3-91.7%). For the cleanup of water extract,
a florisil column using 20:80 acetone:hexane as the
eluting solvent gave recovery of 89.2-97.2%. The limit
of quantification varied from 0.01-0.05 �g/mL.
4.4.2.4 Decontamination of pesticides
Removal of pesticides and herbicides from water.
Out of three modified clays and two metal oxides
having size range between 20-50�m tested for the
decontamination of water, metal oxides performed
better than modified clays. Out of the two metal oxides,
removal efficiency of ZnO 2 was higher as it removed
57-100% of the pesticides as compared to 41-76%
removal efficiency recorded for ZnO. Sonication with
89
clays (montmorillonite) was found to be the best for
removal of pendimethalin and flufenacet.
Remediation of 4 pesticides from water.
Adsorption-desorption of atrazine, metribuzin,
alachlor and metolachlor studied on granular carbon
using batch method indicated that triazines are more
strongly adsorbed than acetanilides. When a mixture
of all the four herbicides was used for adsorption
studies, the trend of adsorption was metribuzin>
atrazine> alachlor> metolachlor. Desorption studies in
three cycles showed that alachlor was the most
desorbing herbicide followed by metolachlor. Atrazine
and metribuzin were not desorbed in any study.
Optimization of method for removal of triazine
herbicides from water. For removal of triazine
herbicides, atrazine and metribuzin from water,
treatment process was modified by incorporating
treatment with nano and surface modified clays which
increased the efficiency to 94-100%. The optimized
treatment process involved chlorination followed by
treatment with clay nano-montmorillonite modified
with 15-35 wt % octadecylamine and 0.5-5 wt%
aminopropyl triethoxy silane and then coagulation/
flocculation with alum and PAC gave maximum
removal of atrazine (100%) and metribuzin (94.1%).
4.4.3 Innovations in Agricultural
Formulations and Application Technology
for Safety and Efficacy
4.4.3.1 Bio-efficacy of nanoformulations of
�����-cyfluthrin against Callosobruchus maculates
Controlled release formulation of �-cyfluthrin
developed by utilizing PEG-1500 and PEG-2000
showed greater efficacy after 14 days as evident from
EC 50 values of 2.2 and 1.58 mg L -1 , respectively, while
EC 50 for commercial �-cyfluthrin formulation (025SC)
were 129.81 mg L -1 .
4.4.3.2 Bioefficacy of controlled release
formulations based on amphiphilic nanopolymer
of carbofuran against Meloidogyne
incognita infecting tomato
A formulation of carbofuran developed using PEG-
900 (CP2) proved effective against M. incognita infecting
tomato even up to 14 days, recording maximum shoot

and root length at 20 ppm concentration and decrease
in nematode penetration (3.6-4.6 J2s) under field
conditions.
4.4.3.3 Development of nano-formulation of
azadirachtin-A
The diffusion exponent (n value) of controlled
release formulations of azadirachtin-A, in water ranged
from 0.108 to 0.401. The release mechanism was found
to follow Fickian diffusion and time taken to release
50% a.i. (t 1/2 ) ranged between 6.6 to 55.8 hrs in water
from different polymeric matrices. The results suggest
that depending upon the polymer matrix used the
application rate of azadirachtin-A can be optimized to
achieve insect control at the desired level and period.
4.4.3.4 Development of polymeric seed coats
based on color and azadirachtin-A for soybean
seed quality enhancement
Twenty-four polymeric seed coat formulations
developed based on amphiphilic polymers and
azadirachtin-A without and with grapes anthocyanin
when tested for soybean seed quality parameters, viz.,
seed germination, vigour, moisture, health and
storability, etc. indicated that polymeric seed coats
prepared using aza-A and anthocyanin performed
better than aza-A seed coats.
The repellent and anti-oviposition effect of twelve
polymeric seed coats containing azadirachtin-A alone
and another twelve polymeric seed coats containing
both azadirachtin-A and anthocyanin when evaluated
against Callosobruchus analis in soybean revealed that
repellency effect was higher in azadirachtin-A
containing formulations than the coloured
formulations. The highest repellent effect (94%) was
found on the malic acid and polyethylene glycol-1000
based polymeric formulation containing azadirachtin-
A. All polymer coated seeds significantly reduced
oviposition of C. analis.
4.4.3.5 Field evaluation of CR formulations of
imidacloprid in soybean
Bioefficacy of controlled release (CR) formulations
of imidacloprid prepared using amphiphilic polymers
evaluated against major pests of soybean, namely, stem
fly, Melanagromyza sojae and white fly, Bemisia tabaci
90
showed that there was significantly better control of
the pests compared to its commercial formulations, and
amphiphilic polymer [poly (oxyethylene-1000)-oxy
suberoyl] based formulation was found to be the best.
4.4.3.6 Release of thiram from poly ethylene
glycol based nano formulations
Controlled released nano-formulation of thiram
was developed. The diffusion exponent (n value) of
thiram in water ranged from 0.34 to 0.54 in the tested
formulations. The release was diffusion controlled with
a half-release time (t 1/2 ) of 14.8 to 25.2 days in water
from different formulations, and the period of
optimum availability (POA) of thiram ranged from 12.2
to 25.2 days. The results suggest that the application
rate of thiram can be optimized to achieve control at
the desired level and period.
4.4.3.7 Hydrogel based combo formulations of
Tagetes extract and MgSO4 Formulations of tagetes extract and MgSO were 4
prepared by impregnation and adsorption on Pusa
hydrogel. The half release time (t ) of �-T in water
1/2
and soil was 23 and 36.9 days, respectively. In vitro
Tagetes+MgSO hydrogel formulation exhibited
4
maximum mortality against M. incognita. LC values
50
of extract alone, gel+extract and gel+extract+MgSO4 were observed as 17.03, 17.29 and 5.43 ppm,
respectively. In vivo evaluation under polyhouse
conditions suggested that in extract and magnesium
based test formulations, the nematode population
remained suppressed throughout the observation
period ranging from 4-8 nematodes per gram soil as
compared to control which registered an increase in
nematode population from initial number 6 to 13 on
60th day.
4.5 WEED MANAGEMENT
4.5.1 Efficient Management of Weeds
including Cyperus rotundus in Maize using
Tank-mix Application of Imazethapyr and
Pendimethalin
Bio-efficacy of tank-mix and sequential
applications of herbicides on weeds including Cyperus
rotundus in maize was studied and it was observed that

all tank-mix and sequential applications of
pendimethalin with imazethapyr or chlorimuron-ethyl
caused significant reduction in weed dry weight and
gave higher weed control index (WCI). Maize yield in
atrazine 1.0 kg/ha + mustard residue mulch (5 t/ha) was
significantly higher and comparable with that in weedfree
check. Total chlorophyll content and soluble
protein were reduced due to tank-mixes of
pendimethalin with imazethapyr or chlorimuron-ethyl,
but the activity of ascorbate peroxidase increased in
response to these applications, indicating a possible
defence mechanism operating in maize to scavenge the
ill-effects. This could be a new recommendation for
weed management in maize.
4.5.2 Tank-mix Herbicide Application
Supplemented with Dormancy Breaker for
Efficient Weed Control in Soybean
An experiment, involving 0%, 3% and 6% of KNO 3
(a dormancy breaker) supplemented with 7 weed
control treatments, namely, pendimethalin 1.0 kg/ha
PRE, pendimethalin + imazethapyr (0.75 +0.050) kg/ha
PRE; pendimethalin + imazethapyr (0.75 +0.075) kg/ha
PRE; pendimethalin + imazethapyr (0.75 +0.100) kg/ha
PRE; imazethapyr 0.100 kg/ha POST; hand weeding
twice (20 and 40 DAS); and unweeded control was laid
out under field conditions to optimize the dose of
dormancy breaker and tank-mix application of
pendimethalin and imazethapyr for weed control in
soybean. All tank-mixes of pendimethalin +
imazethapyr (0.75 +0.050; 0.75 +0.075; 0.75+0.100) kg/
ha PRE caused complete control of broad-leaved and
grass weeds and a significant reduction in perennial
Cyperus rotundus which consequently resulted in
significantly higher soybean seed yield in these tankmixes
compared to only post-emergence application
Pendimethalin + imazethapyr
(0.75 + 0.100 kg/ha)
Unweeded control
91
of imazethapyr (0.100 kg/ha) at 20 DAS and unweeded
control.
4.5.3 Characterization of Phalaris minor
Biotypes towards Cross-resistance Across
Low-dose Wheat Herbicides
Twenty Phalaris minor biotypes, including a
susceptible check biotype were tested in the field for
their resistance against eight herbicides with the
objective to find out a suitable herbicide for controlling
the resistant populations of Phalaris minor. Isoproturon
and clodinafop-propargyl were adopted as check
herbicides for confirming the resistance of Phalaris
biotypes against these two herbicides. All biotypes
showed resistance against clodinafop-propargyl @ 60
g/ha, carfentrazone-p-ethyl @ 30 g/ha, pinoxaden @ 50
g/ha and isoproturon @ 1.0 kg/ha, while pendimethalin
0.75 kg/ha, Atlantis 400 g/ha (product), and
pendimethalin 0.75 kg/ha + carfentrazone-p-ethyl 30
g/ha controlled 17, 12 and 14 biotypes, respectively and
were superior to other herbicides. Pendimethalin @ 0.75
kg/ha and Atlantis 400 g/ha (product) could be better
options for controlling the resistant populations of
Phalaris minor.
4.5.4 Evaluation of Pinoxaden and
Carfentrazone for Weed Management in
Wheat
The impact of alone and tank mix application of
pinoxaden and carfentrazone in wheat against Phalaris
minor and Avena ludoviciana was studied. Besides these
weeds, the experimental field was heavily infested with
Fumaria perviflora, Rumex dentatus, Chenopodium album,
Chenopodium murale and Melilotus indica. Carfentrazone
@ 20 g/ha recorded the lowest weed population and
the highest grain yield (5.9 t/ha) of wheat. Tank mix
application of pinoxaden @ 50 g/ha + metsulfuron 4 g/
ha, pinoxaden 50 g/ha + carfentrozone 15 g/ha were
found effective in controlling all weeds in wheat.
Pinoxaden @ 50-60 g/ha and carfentrazone 20 g/ha
caused significant reduction in the population of both
grassy weeds. However, poor efficacy of sulfosulfuron
and clodinofop against grassy weeds was noted. Tank
mix application of clodinafop propargyl +carfentrazone
ethyl showed 92.9% weed control efficiency with a seed
yield of 3.9 t/ha in wheat.

4.5.5 Impact of Weed Control Practices on
Productivity of Wheat
Post-emergence application of clodinofop
propargyl @ 0.06 kg a.i./ha recorded maximum grain
yield of wheat (5.27 t/ha), which was statistically on a
par with the application of affinity @ 0.020 kg a.i. /ha
(5.15 t/ha), 2, 4-D @ 1.0 kg a.i./ha (5.12 t/ha) and Atlantis
@ 400 mL/ha (5.11 t/ha) but was significantly higher
than the rest of the treatments. However, application
of metsulfuron @ 0.016 g a.i./ha recorded maximum
biological yield (11.31 t/ha), which was significantly
higher over control, hand weeding, and 2,4-D
application but statistically on a par with other
treatments. None of the weed control treatments had
any significant effect on protein content of wheat grain.
4.5.6 Evaluation of Bio-efficacy and
Selectivity of Penoxsulam for Weed
Management in Direct Seeded and
Transplanted Rice
The efficacy and selectivity of penoxsulam in direct
seeded and transplanted rice against Echinochloa
crusgalli, Echinochloa colona, Leptochloa chinensis, Eclipta
alba and Cyperus difformis was studied. Pre-emergence
application of Penoxsulam @ 25 g/ha at 15 days crop
caused the highest reduction in the growth of weeds
and produced significantly higher grain yield over
92
weedy check. There was significant effect of methods
of rice culture and weed control measures on the crop
growth at all stages. Transplanted method of rice
culture significantly increased all growth parameters
and yield attributes compared to direct-seeded.
Season-long weed-free situation recorded 73.77%
increase in the grain yield. Herbicidal treatments
provided a yield advantage of 65.98% to 72.63% over
weedy check. HPLC method for analysis of
penoxsulam herbicide residue was standardized using
CH 3 CN:0.1% ortho phosphoric acid (40:60) at a flow
rate of 1 ml/min at 204 nm wavelength using PDA
detector. The residue at harvest was found below the
detectable limits.
4.5.7 Integrated Weed Management in
Soybean
A field experiment was conducted to evolve
integrated weed management practices in soybean.
Two cono weeding at 20 and 40 DAS brought higher
reduction in the growth of all weeds resulting in higher
weed control efficiency. Pre-emergence application of
diclosulam @ 26 g/ha achieved lower density and dry
weight of weeds at 30 DAS. Season long weed free
situation recorded 76.96 % increase in seed yield.
Herbicide treatments provided a yield advantage of
54.4 to 74.5 % over weedy check.

5. BASIC AND STRATEGIC RESEARCH
During this year, the basic and strategic research carried out at IARI made significant progress in the areas of
molecular characterization of genetic resources, genetic diversity analysis, isolation of new genes for stress tolerance
and nutrient use efficiency, development of molecular markers, maping of genes for agronomically important
traits, the physiological basis of crop yield, mitigation studies on climate change, development of remote sensing
and GIS techniques for assessment and management of crops and natural resources. This chapter briefly covers
some of the significant achievements in these areas.
5.1 PLANT BIOTECHNOLOGY
5.1.1 Cloning and Functional Validation of
Genes
Isolation and characterization of genes are
important to understand the molecular basis of gene
expression and genotypic differences in productivity.
Towards this goal, several genes were cloned from crop
plants and characterized.
5.1.1.1 Abscisic acid (ABA) receptors from rice
The abscisic acid receptors (ABAR) perceive the
plant stress hormone ABA and regulate plant
development and stress tolerance. Therefore, cloning
and functional validation of ABARs will help
develop stress tolerant crops. Towards this goal, 11
genes constituting the ABAR family were identified
in rice. A semi-quantitative RT-PCR analysis was
carried out to study the expression pattern of ABAR
genes under normal and drought stress conditions
in rice. Constitutive expression levels of ABAR6,
ABAR7, ABAR8, ABAR10 and ABAR11 were higher
in drought tolerant rice cv. Nagina 22 as compared
with drought susceptible IR64. Full length coding
sequences of OsABAR6, OsABAR7, OsABAR8,
OsABAR9 and OsABAR11 were cloned and
sequenced. Further, OsABAR6 gene was cloned
under the transcriptional control of stress-inducible
RD29A promoter in a modified pCAMBIA1300 plant
transformation vector.
93
Expression pattern of ABAR genes in rice at active tillering stage
under drought stress (RWC%: N22, C=94; N22, S=64.8; IR64,
C=90; IR64, S=66.5)
5.1.1.2 HSP17 gene from pearl millet
The full length coding sequence of PgHSP17 gene
was cloned from pearl millet genotype WGI 126.
Multiple sequence alignment revealed that PgHSP17
is 100% similar to a previously reported HSP17 from
pearl millet (X94191.1) and 90% similar to maize
HSP16.9 (ACG24656.1) at the amino acid level. This
PgHSP17 sequence was submitted to NCBI GenBank
(accession # JQ627835).
5.1.1.3 High-affinity nitrate transporter from
Brassica juncea (L.)
High affinity nitrate transporters (HANTs)
contribute to nitrogen use efficiency in plants. Towards

Expression of BjHANT in mustard roots (0.01, 0.02 and 5.0 = nitrate
concentrations in mM; BjACT, RT-PCR control gene)
the objective of developing wheat and mustard crops
with constitutive HANT, we cloned a HANT gene from
B. juncea that expresses at very low (0.01 mM) nitrate
concentration. This HANT showed high homology to
Arabidopsis AtNRT2.1, and hence it was named as
BjNRT2.1 (GenBank # JQ305139.1).
5.1.2 Development of Transgenic Plants
5.1.2.1 Gladiolus ethylene receptor gene delays
flower senescence
Transgenic tobacco constitutively overexpressing
gladiolus ethylene receptor GgERS1b gene under
CaMV35S promoter was developed by using
Agrobacterium-mediated genetic transformation.
Physiological analysis on T 1 tobacco confirmed the
ability of GgERS1b gene in delaying senescence. The
transgenic lines showed higher photosynthetic rate,
MSI, antioxidant enzymes activity and chlorophyll
content, and lower levels of oxidative stress as
compared to non-transformed wild type plants. Flower
senescence was delayed by four days in transgenic
tobacco as compared with wild type plants.
5.1.2.2 Regeneration of soybean through somatic
embryogenesis
Three cultivars, namely, PI 542044, Sipani 104 and
Sipani 192 were selected for evaluation of their capacity
for somatic embryo differentiation and plantlet
regeneration. The immature cotyledon explants (4-5
mm) were cultured on embryo induction medium (pH
7.0) comprising Murashige and Skoog (MS) salts, B5
vitamins, 3% sucrose, 40 mg/l 2,4-D, gellan gum (0.2%).
Sipani 104 gave the highest response (40.8%) followed
by PI 542044 (28.7%) and Sipani 192 (20.5%).
94
Regeneration of soybean through somatic embryogenesis from
immature cotyledons: a) primary somatic embryos (SE) from
cotyledons; b) cluster of SE; c) SE in maturation medium; d) SE
desiccation; e) germination of SE; and f) plantlet development
Germinated embryos were transferred to plantlet
conversion media. Sipani 104 exhibited highest
conversion frequency (33.8%) when cultured on MS
medium (pH 5.8) supplemented with B5 vitamins, 2%
sucrose, 4 mg/l ABA and 0.2% AC. This efficient system
of regeneration through direct somatic embryogenesis
will be useful in genetic transformation.
5.1.2.3 Development of low phytate soybean
Development of low phytate soybean is important
to enhance its nutritive value. The myo-inositol-3phosphate
synthase (MIPS) is the key enzymes in
phytate synthesis. Hence, to gain insight into phytate
synthesis, expression profiles of MIPS family genes
were studied in developing seeds and seedlings of
soybean cv. Pusa 16 by using quantitative real-time RT-
PCR. The MIPS1 expression was highest in the early
developing cotyledons, while MIPS3 and MIPS4
showed higher expression in flower and leaf tissues as
compared with other tissues. This suggested that
MIPS1 is the major gene involved in phytate
accumulation in developing seeds. The full length
cDNA of MIPS1 was cloned from soybean and
sequenced.

Spatial and temporal expression pattern of MIPS family genes in
soybean. Transcript levels were measured relative to the reference
gene eEF-1�����
For silencing MIPS1 gene in developing seeds,
RNAi and antisense gene constructs were developed.
The intron spliced hairpin (ihp) cassette of MIPS1 gene
was cloned under a seed-specific VICILIN promoter in
pBIN vector to develop RNAi vector. An antisense
construct (pBIN-MIPS-AS) was also prepared cloning
the full length MIPS1 in an antisense orientation under
a seed specific-VICILIN promoter. For overexpression
of phytase gene, the full length PHYTASE cDNA (1.6kb)
was cloned under a seed-specific VICILIN promoter in
the pAKVS vector. These three constructs were
mobilized into Agrobacterium, and are being used for
genetic transformation of soybean.
5.1.2.4 VIGS-mediated modification of fatty
acids enhances heat tolerance
Cell membrane stability is one of the key
components of high temperature stress tolerance. To
study the effect of reduction in trienoic fatty acid (18:3)
PSII yield in tobacco plants exposed to normal and high
temperatures. Control: wild plants, Mock: vector control plants,
and FAD7-VIGS: FAD7 silenced plants
95
in the cell membrane on thermotolerance, Fatty Acid
Desaturase 7 (FAD7) gene was downregulated by using
VIGS (Virus-induced gene silencing) method in
tobacco. The FAD7 silenced plants exhibited marked
reduction in linolenic acid (18:3) and increase in linoleic
acid (18:2). These plants showed higher photosynthetic
rate and PSII yield, and lower levels of H 2 O 2 content
and membrane leakage than that of non-VIGS plants
at 42°C heat stress. Thus, increasing the ratio of 18:2/
18:3 fatty acids in membrane lipids can enhance
membrane stability and heat tolerance of plants.
5.1.3 Molecular Markers, QTLs and Gene
Mapping
5.1.3.1 Mapping of leaf rust resistance gene in
wheat
Leaf rust resistance gene Lr45 was mapped using
molecular markers in two F 2 populations and validated
in F 3 . Robust molecular markers designed and
developed are at the final stage of validation. Similarly
work is in progress to map stem rust resistance gene
identified in bread wheat genetic stock WR95.
5.1.3.2 Identification of polymorphic molecular
markers in wheat
Several SSR markers spanning different
chromosomes were used to survey polymorphism in
20 wheat genotypes with contrasting heat and drought
tolerance, and 300 polymorphic markers were
identified. These markers will be used for mapping
drought and heat tolerance in mapping populations
derived from these genotypes.
5.1.3.3 Mapping of shrunken and sugary genes
in maize
Three F 2 populations of maize, namely, V390 x
MGSU-201, V390 x MGSU-202 and V359 x MGSU-201
were generated, and bulk segregant analysis (BSA) was
carried out using SSR markers. The mgussr061 was
identified as the effective marker with an average
genetic distance of 0.8 cM from the sugary (su) gene.
Linkage analyses in two F 2 mapping populations of
normal × shrunken crosses (V334 × MGSH-101, and V364
× MGSH-101) revealed that mgussr276 is closely linked
to the shrunken2 (sh2) gene with an average genetic
distance of 1.3 cM. Combination of mgussr061 and

mgussr276 holds promise for stacking su1 and sh2 genes
in MAS breeding.
5.1.3.4 SNP genotyping of maize mini-core
An association mapping panel consisting of 240
maize genotypes was genotyped using Illumina SNP
array with 56000 SNPs. The SNPs were distributed all
over the maize genome and covered all chromosomes
uniformly. Each of these 240 inbreds was genotyped at
56000 SNP loci and about 134,400,000 SNP data were
generated. This genotypic resource will be useful for
association mapping of genes for various agronomics
traits.
Chromosome-wise haplotypes and minor allele frequency
extracted from genome-wide SNPs in maize
5.1.3.5 Tagging of black rot resistance in
cauliflower
F 2 mapping population derived from a cross
between Pusa Sharad (susceptible to black rot and
downy mildew) x BR-207 (resistant to black rot and
downy mildew) was phenotyped for black rot
resistance and genotyped with RAPD markers. The
RAPD 04 833 marker was found to be closely linked
(1.6 cM) to black rot resistance gene.
5.1.3.6 Tomato leaf curl New Delhi virus
(ToLCNDV) resistance
Tomato. Sixteen genotypes of wild relatives of
tomato including S. pimpinellifolium, S. peruvianum and
S. habrochaites were evaluated for ToLCNDV resistance.
Genotypes LA 1777, EC 368644-3 and EC 379243-2 were
identified as ToLCNDV resistant, and were used to
develop inter specific crosses. A SCAR marker, TGO
96
302, was found to be linked to TY-2 locus introgressed
from S. habrochaites for resistance to ToLCNDV. The P6-
6 SCAR marker was validated for resistance conferred
by TY1 locus which was introgressed from S. Chilense.
The degree of resistance conferred to ToLCNDV by TY1
is higher than that of TY2 locus.
Cucurbits. Sponge gourd (Luffa cylindrica Roem.)
genotypes were screened for resistance to ToLCNDV
by both natural epiphytotic and challenge inoculation
experiments. DSG 6, an advanced inbred breeding line,
was found to be resistant to ToLCNDV. Inheritance
study in F 2 and backcross (B 1 and B 2 ) populations of a
cross between DSG 6 and Pusa Sneha (susceptible)
revealed that ToLCNDV resistance is conferred by a
single dominant gene. Two SRAP (sequence-related
amplified polymorphism) markers closely linked to
ToLCNDV susceptibility and two SRAP markers
closely linked to ToLCNDV resistance were identified.
These SRAP markers will be useful in the MAS
breeding of ToLCNDV resistance.
5.2 BIOCHEMISTRY
5.2.1 Heat Stress Affects Starch Granule
Formation in Wheat
High temperature adversely affects starch
biosynthesis in the endosperm and thus, reduces grain
quality and yield in wheat. Electron microscopic studies
showed that thermotolerant cv. C306 maintained high
number of endosperm cells with bold and well defined
starch granules, while thermosensitive cv. PBW343 had
(A) (B)
(C) (D)
Scanning electron micrograph of endosperm in developing wheat
seeds: Morphology of starch granules in C 306 (A) and PBW 343
(C) under normal temperature; morphology of starch granules in
C 306 (B) and PBW 343 (D) under 40°C heat stress

less number of endosperm cells with small, nonspherical
and loosely packed granules.
5.2.2 Reduction of Off-flavor in Soybean
5.2.2.1 Identification of off-flavor causing
volatiles in soybean
The volatile compounds produced by lipoxygenase
(LOX) impart off-flavor to soybean. To identify these
volatile compounds, a Solid-phase Micro-Extraction
and Gas Chromatography Mass Spectrometry analysis
was carried out in three substrate combinations with
high, medium and low poly unsaturated fatty acids
(PUFA) ratios mimicking the natural variation. Eleven
volatile compounds predominantly comprising of short
chain aldehydes, ketones and their alcoholic
counterparts were identified. An inverse relationship
was found between PUFA ratios and hexanal to trans-
2-hexenal ratios. Three LOX isozymes were purified
to 105-fold with the help of ammonium sulphate
precipitation followed by Sephadex-G-150, DEAE-
Cellulose and DEAE-Sephacel column purification.
This purified LOX isozymes are being used for
studying the inhibitory effect of natural antioxidants
from soybean, namely, isoflavonoids, �-tocopherol and
ascorbic acid.
5.2.2.2 Storability of soybean seeds correlates
with LOX enzymes
Fourteen soybean genotypes differing in seed
viability were analyzed for LOX and hydroperoxide
lyase (HPL) enzyme activities. Good storer genotypes
exhibited significantly lower isozymes of LOX (L1, L2
and L3) and HPL activities than the poor storer
genotypes. This observation was validated by
determining the total antioxidant potential, antioxidant
enzyme status, fatty acid profiling, and the oxidation
determining parameters of these good and poor storer
seeds.
5.2.2.3 Gamma-radiation suppresses off-flavor in
soybean
Three different doses (0.25, 0.5 and 1.0 KGy) of �radiation
treatments on off-flavor generation in soybean
revealed that �-radiation treatment significantly
enhanced anthocyanin content in dark-seeded soybean
varieties BS 1 and BR 2, but not in yellow seeded
97
soybeans. In �-radiation treated dark-seeded soybeans,
reduction in off-flavor was associated with a decrease
in the LOX activity, thiobarbituric acid number and
carbonyl value. The results suggested that �-radiation
induced increase in anthocyanins play a major role in
controlling off-flavor generation in soybean.
5.3 PLANT PHYSIOLOGY
5.3.1 Physiological Basis of Crop Yield
5.3.1.1 Genotypic variation for P-deficiency
induced organic acids secretion in green gram
Organic acids (OAs) exuded from roots help
solubilize non-available P in the soil, and thus, enhance
P uptake efficiency of plants. Genotypic variations for
OAs exudation from the roots of green gram genotypes
were evaluated in low (2 mM) and sufficient (100 mM)
P conditions in hydroponics for 15 days at National
Phytotron Facility, IARI. Plants were treated with 14 CO 2
and the total exudation was assessed by the quantity
of 14 C in the rhizosphere. Significant genotypic variation
was obtained for OAs exudation from roots. OAs
released from the roots mainly consisted of oxalic and
citric acids, while high concentrations of oxalic, succinic
and lactic acids were present in the root apices. Among
the 44 genotypes, PDM 139 produced highest oxalic
acid (5092.5 �g g -1 root FW) at low P conditions.
5.3.1.2 Catalytic efficiencies of soluble starch
synthases from maize and wheat
Previously we have shown that developing grains
of maize have a 3-4 fold higher activity of soluble starch
synthases (SSS) as compared to wheat under normal as
well high temperature stress. Further, the kinetics of
SSS enzyme from developing grains of maize (HQPM7
and HM10) and wheat (T. aestivum cv. HD 2987 and
T. durum cv. HD 4719) were compared. Maize SSS
Kinetic properties of soluble starch synthases from wheat
and maize grains
Genotype V max [nmol mg -1 K m for V max /K m
(protein) min -1 ] ADPG (mM)
T. aestivum cv. HD 2987 17.20 0.56 30.71
T. durum cv. HD 4719 22.60 0.54 41.85
Z. mays HQPM 7 28.00 0.40 70.00
Z. mays HM 10 38.00 0.30 126.66

showed a lower K m , higher V max and thus higher
catalytic efficiency (V max /K m ) as compared with wheat
SSS.
5.3.1.3 Identification of wheat genotypes with
contrasting nitrogen use efficiency (NUE)
A set of 110 wheat genotypes were evaluated for
NUE under zero N (N 0 ) and 120 kg N (N 120 ) application
treatments in the field conditions. The recommended
fertilizer dose of 120:60:40 kg NPK/ha, respectively, was
applied in N 120 treatment. Significant differences in
biomass and yield components were found among
genotypes. PBW 347 and Stretton produced the
maximum biomass, while Bevy1 (Med) produced the
lowest shoot biomass. In terms of relative change in grain
yield at N 0 over N 120 , Lira and Bevy1 (Med) recorded
the maximum and minimum grain yield, respectively.
Out of 110 genotypes, 23 were categorized as N efficient
at N 0 , while 17 were categorized as inefficient.
5.3.1.4 Storability of magnetoprimed cucumber
seeds
Storability of primed seed is important in
determining the time lag between priming and sowing
of seeds in the farmer’s field. Hence, the storage
potential of magnetoprimed (200 mT, 1h static magnetic
field) seeds of cucumber cv. Barsati was evaluated by
subjecting them to accelerated ageing (45 ° C, 100% RH).
After six days of ageing, primed seeds showed
significant decline in germination and vigor index as
compared to unprimed seeds. Faster aging of primed
seeds was associated with higher H 2 O 2 levels, lower
levels of ROS scavenging peroxidases and enhanced
loss of membrane integrity. This study suggests that
primed seeds should be sown without delay to harness
the benefits of magnetopriming.
5.3.2 Physiological Basis of Abiotic Stress
Tolerance
5.3.2.1 Role of heat shock proteins in high
temperature tolerance of wheat
The role of heat shock proteins (HSPs) and heat
shock transcription factors (HSFs) in high temperature
tolerance was examined in wheat cultivars, namely,
Halna, DBW 14 and HD 2687 under pot culture
conditions. Based on the heat susceptibility index of
98
RT-PCR expression analysis of HSFA4a, HSP17.3 and HSP101c genes
in wheat (M1: 100bp DNA marker; C: 25/15°C day/night
temperatures; T1 and T2 are 40/35°C day/night temperatures for 24
and 48h, respectively; and M2: 1kb DNA marker)
grain yield HD 2687 was classified as heat susceptible
as compared with Halna and DBW 14. To study the
expression of HSPs and HSFs, plants were raised in
NPF, IARI in a temperature regime of 25/15 °C day/
night temperature (control). Heat stress treatment was
given at vegetative and anthesis stages by subjecting
plants to 40/35 °C day/night temperature for 24 or 48h.
Heat stress inducible expression of HSFA4a and HSPs
were significantly higher in heat tolerant Halna and
DBW 14 as compared with heat sensitive HD 2687.
5.3.2.2 Development of high throughput
methods for drought phenotyping
Non-availability of real-time, high throughput and
non-destructive methods for quantification of relative
water content (RWC) is one of the major bottlenecks in
phenotyping for drought tolerance. To develop
hyperspectral signature-based high throughput
method to quantify RWC, hyperspectral signatures,
excised leaf water loss and RWC were analyzed in 18
Relationship between continuum removal factor (CR ����� ) and RWC
in rice under laboratory conditions

ice genotypes. Reflectance, band depth and continuum
removal factor (CR � ) at 1450 and 1930nm showed very
high and significant correlation with RWC. The CR �
was identified as the best method to determine RWC
in rice under lab conditions.
5.3.2.3 Chemical growth regulators to mitigate
abiotc stress effects in crops
To understand the mechanisms of cytokinin (CK)
mediated drought tolerance, the effect of foliar spray
of synthetic CK, 6-benzylaminopurine (BAP, 40 �M)
was examined in wheat cultivars C 306 and PBW 343
under drought stress. Drought stress significantly
reduced RWC, MSI, chlorophyll and carotenoid
contents, photosynthesis rate, stomatal conductance,
photochemical efficiency and total starch content.
Drought stress also decreased the activities of nitrogen
assimilation pathway enzymes but enhanced protease
activity. Foliar spray of BAP significantly reduced these
adverse effects of drought, and thus enhanced the yield
stability.
Exogenous application of salicylic acid (10 mM)
also enhanced the yield stability of wheat cv. C 306 and
HD 2687 due to delay in drought-induced leaf
senescence, stabilization of photosynthesis and nitrate
reductase activity under drought. Similarly, a field trial
with chickpea var. Pusa 372 showed that foliar spray
of BAP (40 ppm) with tannic acid (50 ppm) enhanced
yield (> 15%) under both rainfed and irrigated
conditions due to improved membrane stability, water
relations, nitrate reductase activity, and photosynthesis.
5.3.3 Post-harvest Physiology
5.3.3.1 Cold induced sweetening in potato
Cold-induced sweetening (CIS) in potato is caused
by accumulation of reducing sugars during cold
storage. Reducing sugars react with asparagine to yield
acrylamide during fries and chips making. To
understand the molecular basis of genotypic difference
in CIS, expression analysis of genes involved in
asparagine synthesis and reducing sugar accumulation
was carried out in potato tubers stored at room
temperature, 4°C and 12°C for 30 and 60 days. CIS
resistant Kufri Chipsona 2 showed relatively less
expression of AS1 (asparagine synthetase 1) gene
specifically under cold storage. Further, Kufri Chipsona
99
RT-PCR expression analysis of genes involved in CIS in potato.
The 18S rRNA gene was used as RT-PCR control
2 showed high expression of UDP-glucose
pyrophosphorylase (UGP, involved in diversion of
sugars to glycolytic pathway) and low expression of
vacuolar invertase (INV, involved in hydrolysis of
sucrose into reducing sugars) genes under cold storage.
Thus, CIS tolerance of Kufri Chipsona 2 was associated
with low expression levels of AS1 and INV (Vacuolar
Invertase), and high expression of UGPase genes as
compared with CIS sensitive Kufri Khanchan during
cold storage.
5.3.3.2 Change in mineral composition during
fruit ripening in tomato
Changes in the endogenous levels of mineral
nutrients were analyzed during ripening of tomato
fruits after harvest. With the progress of ripening, P, K,
Fe, Zn and Cu content in the outer pericarp of tomato
fruits increased, while Mg, Ca, B and Mn contents
remained the same. This indicated remobilization of
nutrients within the tomato fruits from inner parts to
the outer pericarp. The relationship between
redistribution of different nutrients and shelf-life is
being investigated.
5.3.4 Strategies for Development of Climate
Resilient Crops
5.3.4.1 Phenotyping for high temperature
tolerance in rice
Heat tolerance of 71 rice genotypes (including
Nagina 22 as a check) was evaluated in the field
conditions during summer season. The air temperature
during vegetative stage was above 40 o C. Only 33
genotypes survived and reached flowering. Maximum
day temperature during the flowering ranged from 32

to 44 o C, which is approximately 10 o C higher than the
optimum temperature for anthesis. Genotypes were
raked based on spikelet fertility and grain yield per
hill. NERICA-L 44 was identified as the most heat
tolerant genotype based on survival percentage,
spikelet fertility (85%), 1000 - grain weight and grain
yield. The grain quality of Nerica-L 44 was the best
among the genotypes evaluated under high
temperature stress. Thus, Nerica-L 44 can be used for
introgression of thermotolerance to develop climate
change resilient rice cultivars.
Effect of high temperature on grain cooking quality of rice
genotypes
Genotypes Amylose % Head % Chalky Alkali
% recovery grains spreading
value
Nerica-L 5 28.7 57.93 76.7 3.33
Nerica-L 22 27.6 48.83 33.3 2.67
Nerica-L 23 28.3 55.50 15.9 1.67
Nerica-L 25 27.7 50.48 27.8 2.33
Nerica-L 44 26.2 66.26 12.6 1.67
Nerica-L 57 28.1 59.53 32.9 2.67
N 22 28.6 50.73 36.4 2.00
IR 6 27.7 63.38 48.5 5.67
5.3.4.2 Physiological analysis of drought
tolerance in wheat
Wheat RIL population derived from C 306 and WL
711 were evaluated under drought stress at tillering
and post anthesis stage. Grain number, 1000 grain
weight and drought susceptibility index showed high
heritability and significant correlation with yield under
drought stress. Eight RILs that performed better than
C 306 were identified for high yield and stability with
good grain quality under drought stress.
5.4 GENETICS
5.4.1 Wheat
5.4.1.1 Genetics of fertility restoration
Mode of inheritance of fertility restorer gene(s) for
T type (T. timopheevi Zhuk.) sterile cytoplasm in wheat
(T. aestivum L.) was studied in fertility restorer lines
100
EC368169 and T2003R. The segregation pattern of F 2
and BC 1 segregants in to fertile and sterile classes
revealed that both the restorer lines carried a single
dominant gene for fertility restoration. However, the
frequency distribution of plants for pollen fertility and
seed set in the F 2 indicated that fertility restoration is
affected by modifiers.
5.4.1.2 Stripe rust resistance
Genetic analysis of parents, F 1 , F 2 , and back cross
generations of wheat crosses viz., HS 240/FLW 13, HS
295/FLW 13 and HS 420/FLW 13 revealed the presence
of single dominant gene in the genetic stock FLW 13
for resistance against stripe rust pt. 46S119. The BC 1
seedlings of test crosses, namely, HS 240/FLW 13//HS
240, HS 295/ FLW 13//HS 295, and HS 420/ FLW 13//HS
420 were inoculated with a mixture of stripe rust 46S119
and 78S84 pathotypes. These plants showed 1:1
segregation for resistance and susceptibility indicating
that the stripe rust resistance gene is contributed by
the genetic stock FLW 13.
5.4.2 Rice
5.4.2.1 Mapping QTLs for grain dimension in
basmati rice
An F 2 population consisting of 300 individuals was
developed by crossing a short grain aromatic landrace
Sonasal with Pusa Basmati 1121, an extra long grain
variety with very high elongation ratio (ER), and used
for QTL mapping of grain dimension traits such as
grain length (GL), grain breadth (GB), cooked kernel
length (CKL) and ER. The phenotype of the segregating
individuals ranged from 3.63-8.01 mm for GL, 1.60-2.40
mm for GB, 1.79-4.70 mm for L/B ratio, 5.76-15.23 mm
for CKL and 1.00-2.30 for ER. Based on linkage map of
154 microsatellite markers, a total of 24 QTLs were
mapped on 6 different chromosomes including 4 QTLs
for GL and 7, 5, 4 and 4 each for GB, L/B ratio, CKL and
ER, respectively, explaining phenotypic variance
ranging from 9.4 to 65%. In addition, 4 QTLs were
identified for grain weight.
5.4.2.2 Fine mapping of QTLs for grain number
in rice
Previously we have mapped a QTL for grains per
panicle between RM3276 and RM5709 marker interval.

To fine map this QTL, a trait performance based NILs
(TP NIL) were developed by crossing two QTL NILs
with a mean grains per panicle of 373 and 150. Among
these F 2 individuals, grains per panicle ranged from
95 to 435, showing uniform segregation among the
individuals. A set of 324 recombinants were
genotyped using five polymorphic markers in the
mapped QTL region that narrowed down the QTL to
a 30 kb region.
5.4.3 Maize
P 1 P 2 F 2 Plants
Variation in spikelets per panicle among the contrasting grain
number QTL NILs and their F 2 progenies
5.4.3.1 Genetic diversity of genotypes with varied
waterlogging tolerance
A set of 24 inbred lines with diverse pedigree and
water logging tolerance were assessed for genetic
diversity using SSRs. The genetic similarity coefficient
varied from 0.23 to 0.53, exhibiting diverse nature of
the pedigree of the inbred lines. Among 56 SSR markers
analyzed, umc1552 had the highest PIC value of 0.88,
while it was 0.79 and 0.78 for bnlg1014 and umc219,
respectively. Cluster analysis differentiated the 24
diverse genotypes into four major clusters. Among the
genotypes, HKI1105 was found to be completely distant
pedigree as compared with other inbreds. Based on the
phenotypic response and genetic distance, crosses
among the highly tolerant inbreds such as LM16 ×
Pant1393, LM16 × HKI1105, LM16 × CML425, Pant122
× Pant 1393, Pant122 × HKI1105, Pant122 × CML425 and
HKI1105 × CML425 are selected for testing under
multiple locations.
101
5.4.3.2 Phenotyping for water-logging tolerance
A set of 264 diverse maize inbred lines were
evaluated for waterlogging tolerance in field conditions
during kharif 2011. At pre-flowering stage (10-12 days
before flowering), waterlogging was imposed by
stagnating the field with 10 cm depth of water
continuously for 10-12 days. Based on the last two years
evaluation in both ‘cup’ and ‘field’ based screening
methods, inbreds CML425, CA00106 and HKI1105
were identified as highly tolerant, while inbreds
CM212, V360, V364 and CM140 were identified as the
highly susceptible to waterlogging. A set of 16 different
cross combination were made during kharif 2010 at
IARI, Delhi and F 1 s of these cross combinations were
selfed to generate F 2 seeds, and three selected mapping
populations were forwarded to generate F 3 .
Contrasting phenotypic responses of inbred lines under waterlogging
stress
5.4.4 Mapping Population for Agronomic
Traits in Pearlmillet
Five mapping populations, namely, PPMI 683 ×
PPMI 627, 5054 × TPR 14, 5141 × TPR 14, PPMI 627 ×
PPMI 813 and PPMI 813 × 15040 for high iron and zinc
content and spike thickness were advanced.
5.4.5 Diversity Analysis of Chickpea Wild
Species
Thirty STMS markers were used to dissect the
genetic diversity and relationship of 14 wild and one
cultivated accessions of chickpea. These STMS markers
generated an average 3.433 amplicons/marker.
Polymorphic Information content (PIC) ranged from

0.246 to 0.775 and genetic similarity between cultivars
ranged from 0.10 to 0.77. Dendrogram constructed with
STMS marker data showed 4 distinct clusters.
5.4.6 Aluminium Tolerance of Mungbean
Thirty six genotypes were evaluated for aluminium
(Al) tolerance during seedling stage at 0, 2 and 5 mg/l
Al levels in hydroponics. The tolerance was determined
on the basis of root length, shoot length, dry weight of
roots and shoots, score of root staining and root regrowth
after staining. Ricebean (V. unguiculata)
exhibited the highest tolerance followed by urdbean
and mungbean. Efforts are being made to transfer Al
tolerance from ricebean and urdbean to mungbean by
interspecific hybridization.
5.4.7 Genetic Diversity of A, B and R Lines
and Tagging of MFR Genes in Pigeonpea
Eight A lines (2 with A 4 cytoplasm and 6 with A 2
cytoplasm), two B lines and 19 R lines were genotyped
with 390 EST-SSR markers. Parental combinations,
ICPA2047 and ICPR2740, ICPA2043 and ICPR3472,
ICPA2043 and ICPR4013, MS10A and AKPR9, MS10A
and AKPR100, and GT288A and AKPR417 were
identified as most divergent.
Linkage group carrying male fertility restorer
(MFR) gene was identified in pigeonpea. One SSR
marker linked with MFR gene was identified. Studies
on inheritance of MFR gene revealed that two
complementary genes control MFR in 3 crosses, and a
single dominant gene in other 4 crosses.
5.4.8 Brassicas
5.4.8.1 Nylon-net cover for maintenance breeding
Nylon nets were used to cover the plants to
prevent bee activity in the field, and the effect of
selfing/open pollination under the net was evaluated.
No significant change in erucic acid content was
observed between base material, and selfed and open
pollinated plants grown under nets upto two cycles
of maintenance breeding. However, significant
increase in erucic acid was observed after first and
second cycles of open pollination. This study suggests
that maintenance breeding of Brassica varieties can be
102
carried out by checking the bee activity in seed plots
through nylon nets even when sufficient isolation is
not available.
5.4.8.2 Identification of ‘0’ and ‘00’ genotypes and
development of RILs
A total of 2194 plants in two BC 3 populations were
genotyped for glucosinolate and erucic acid, and 55
backcrosses were made. These 55 BC 3 F 1 s were
advanced to BC 3 F 2 . For development of ‘0’ and ‘00’
breeding lines, erucic acid content was evaluated in
7700 lines. About 1840 single plants with low erucic
acid content (

Dendrogram based on UPGMA analysis of 48 mango hybrids using
SSR markers (P = Pusa)
5.5 AGRICULTURAL PHYSICS,
REMOTE SENSING AND GIS
5.5.1 Estimation of Crop Coefficients and
Evapotranspiration of Wheat
A field water balance approach was used to quantify
crop evapotranspiration (ET) in wheat cultivars (DBW
17, PBW 502, and HD 2987) under adequate (6 cm each
irrigation) and limited (4 cm each irrigation) irrigations.
Leaf area index (LAI) was monitored by using thermal
reflectance. Basal crop coefficient (K cb ) showed very high
correlation with LAI. Hence, LAI measured with
vegetation indices can be useful for quantification of
transpiration and light absorption. Soil adjusted
vegetation index (SAVI) showed a linear response to
K cb , and also did not saturate until LAI reached to 4.5,
while normalized difference vegetation index (NDVI)
103
saturated at LAI 3.5. Thus, SAVI has significant potential
for irrigation scheduling over large areas, especially
with the availability of high resolution earth observation
satellite data.
5.5.2 Effect of Increase in Temperature on
Evapotranspiration in Wheat
The effect of elevated temperature on ET c in wheat
was studied using a temperature gradient tunnel.
Elevated temperature increased the rate of water
depletion from the root zone and ET c by 16.7% and
18.4%, respectively. To estimate the crop water
requirement (CWR), a long-term weather data (1984
to 2010) of IARI were analyzed using ARIMA model.
IPCC-SRES of HADCM3 global climate model
scenarios were used to calculate the potential
evapotranspiration in 2020-21 and 2050-51. The CWR
and net irrigation requirement are predicted to decline
in under increased temperatures by 4-7% in 2020-21
and 6-17% in 2050-51 due to temperature stress induced
reduction in crop phenophases.
5.5.3 Soil Water and Nitrogen Deficits Affect
Water and Nitrogen Use Efficiencies in Wheat
The effect of soil water and nitrogen deficits on
water use efficiency (WUE) and nitrogen use efficiency
(NUE) of wheat (HD 2932) were quantified by
developing stress factor for water (SFW) and stress
factor for nitrogen (SFN) under semi-arid conditions.
Water deficit stress up to18% improved WUE as well
as NUE with no significant yield loss, suggesting that
an 18% reduction in the recommended water
application is useful to improve both WUE and NUE.
Further, “WUE Predictor” software was developed to
predict WUE of wheat under water deficit stress.
5.5.4 Hyporheic Zone Groundwater Potential
in Yamuna Flood Plains and Recharge in
Northern India
Conservation of flood water in the hyporheic
ground water (GW) in the flood plains can help manage
flood. Water dynamics model was developed using 18 O
and 2 H isotope signatures of the rainfall, GW and river
water, and seepage to hyporheic zone was estimated
as ~ 83-97 MCM and GW recharge potential 160 MCM.
The recharge potential in Punjab, Haryana, Delhi and

Rajasthan is assessed to be 14800 + 2500 m 3 /year which
is less than withdrawal, making GW vulnerable.
5.5.5 Nuclear Magnetic Resonance
Technique for Assessing Drought Tolerance
of Wheat
The pulsed NMR measurements of longitudinal
relaxation time (NMR-T 1 ) and transverse relaxation
time (NMR-T 2 ) were used to characterize drought
tolerance of wheat genotypes. Significant correlation
between NMR-T 1 and leaf water status (relative water
content, leaf water potential, osmotic potential and
moisture content) was observed at 8 th leaf stage. NMR-
T 1 was found to be better than NMR-T 2 for
characterizing drought tolerance. Further, in another
set of 44 wheat genotypes, significant correlation was
found between NMR-T 1 and yield reduction under
drought. Thus, NMR-T 1 techniques can be used as nondestructive
and high throughput technique to assess
drought tolerance of wheat.
5.5.6 Hyperspectral Indices to Estimate Grain
Protein and Yield in Wheat
Wheat crop was grown with 4 different
irrigation levels (0.4, 0.6, 0.8 and 1.0 IW/CPE) and 3 N
management strategies (120 kg/ha as urea, 60 kg/ha as
urea + 60 kg/ha as FYM and 120 kg/ha as FYM) and the
hyperspectral signatures were recorded at seven
phenophases (CRI, tillering, booting, flowering,
milking, soft dough and harvesting) in wheat. The
correlation between the water deficit stress, spectral
indices and the grain yield showed that at all the growth
stages the grain yield was significantly and negatively
correlated with these spectral indices, with the highest
correlation at the milk stage. Further, green normalized
difference vegetation index (GNDVI) at milking stage
Regression between grain yield and spectral indices in wheat
Parameters Regression equations R 2
WI (R 970 /R 900 ) Y = 32667 – 32055.7 (WI) 0.91**
NWI-1 [(R 970 – R 900 )/(R 970 + R 900 )] Y = 712.7 – 58686.5 (NWI-1) 0.91**
NWI-2 [(R 970 – R 850 )/(R 970 + R 850 )] Y = 1009.5 – 544220.1 (NWI-2) 0.87**
NWI-3 [(R 970 – R 920 )/(R 970 + R 920 )] Y = 624.8 – 62976.1 (NWI-3) 0.91**
NWI-4 [(R 970 – R 880 )/(R 970 + R 880 )] Y = 798.9 – 54598.2 (NWI-4) 0.89**
104
showed highest correlation with grain yield (y = 10016x
– 2512.6; R 2 = 0.94) and grain protein concentration
(y = 14.80x + 0.752; R 2 = 0.81).
5.5.7 Evaluation of Natural Resources and
Potential Agricultural Productivity
Geospatial techniques were used to generate spatial
and temporal patterns of land use change in the Meerut,
Muzaffarnagar and Saharanpur districts of western
Uttar Pradesh. The Indian satellite imageries showed a
shift of land from agricultural to non-agricultural uses
to the tune of 4.41%, of which conversion of agricultural
land to built-up area was 2.89% during 1998-2008. GIS
was used to capture the spatial patterns of soil and
rainfall characteristics and integrated them into 38
homogeneous agroecological classes, which were
further classified in to 417 land units and yield gap for
major crops was calculated for these land units. Yield
gaps ranged between 3.87 to 6.64 t/ha in rice, 2.85 to
4.89 t/ha in wheat, 4.09 to 6.02 t/ha in maize and 30 t/ha
in sugarcane. This will help develop strategies to reduce
yield gap in these land units.
5.5.8 Red Edge Technique for N Stress
Monitoring in Wheat
Hyperspectral remote sensing data from wheat
plants grown at different nitrogen levels revealed that
stressed plants have higher reflectance in the red region
as compared with non-stressed plants. The change in
reflectance per unit change in wavelength (slope) in
red to NIR region (called red edge) showed high
Spectral reflectance of wheat crop and REV at different N stress
levels in wheat

correlation with level of N stress in plant. The
wavelength corresponding to maximum slope is called
red edge position (REP) and the slope value is called
red edge value (REV). REP shows blue shift in N
stressed plants, while it shows red shift in healthy
plants. Both REP and REV showed positive correlation
with N stress levels and thus, can be used as non
destructive in situ measurement of N stress in crop for
site specific N management in wheat.
5.5.9 Effect of Source and Sensor Geometry
on Spectral Reflectance of Crops
Effect of relative position of light source and sensor
(i.e., zenith and azimuth angle) on reflectance of soybean
crop was studied using a goniometer to find out the best
sensor position relative to sun’s position. Bidirectional
reflectance of soybean was measured keeping the
spectroradiometer in varying zenith and relative
Goniometer with spectroradiometer for bidirectional reflectance
measurement in soybean field
105
azimuth conditions. A polar plot with varying zenith
and azimuth position of sensor revealed that highest
reflectance is obtained at relative azimuth 0° and 40°
sensor zenith position, and around 40° sun’s position.
This position is called hotspot position. Comparison of
measured spectra at hot spot and simulated reflectance
spectra from radiative transfer model (PROSAIL)
showed that the hot spot position was the best position
to measure hyperspectral reflectance, and retrieve leaf
area index. Thus, the senor and source geometry plays
important role in remote sensing, and there by crop
parameters estimated from the sensor.
5.5.10 Assessment of Agricultural
Vulnerability to Climate Change in Indo-
Gangetic Plains
Indo-Gangetic plains comprising the states of
Punjab, Haryana, Uttar Pradesh, Bihar and West
Bengal was studied for the agricultural vulnerability
to climate change using the three core components,
namely, exposure to hazards, sensitivity to climate
change and adaptive capacity. Eight indicators were
computed using meteorological data of 1951-2009.
Sensitivity was computed from six indicators based
on crop and soil characteristics, and adaptive capacity
was calculated based on socioeconomic indicators of
agricultural technology, infrastructure and human
development. The indicators were ranked and their
weights were computed using multi-criteria decision
making analytic hierarchal process technique. The
Sheohar, Sitamarhi, Madhubani and Purba
Champaran districts of Bihar and Shrawasti districts
of UP were found the most vulnerable to climate
change in Indo-Gangetic plains.

6. SOCIAL SCIENCES AND TECHNOLOGY TRANSFER
The School of Social Sciences continued to focus its research on current issues of national importance in the
areas of agricultural economics, extension and technology dissemination, transfer and assessment. Policy options
for inclusive agricultural growth, regional trade, agricultural investments, energy use and development of nonfarm
sector were some areas in which economic analysis was undertaken. Research in the area of extension
focused on assessing extension strategies and developing innovative and alternative approaches besides conducting
research on entrepreneurship development. Dissemination of the technologies developed at the Institute and the
assessment of the performance of new technologies in the field; training in production technologies and vocational
enterprises and dissemination of information were undertaken by the Institute.
6.1 AGRICULTURAL ECONOMICS
6.1.1 Policy and Institutional Options for
Inclusive Agricultural Growth
Given the current state of agricultural development
in India, technological innovations are crucial for
enhancing agricultural productivity. This calls for the
strengthening of the innovation system for which a
primary requirement is to increase in the public
investment in R&D. The annual growth in the public
investment has slowed down from close to 6 per cent
in the 1980s to 3 per cent during the last two decades.
The investment intensity, i.e., public investment as a
percentage of agricultural gross domestic product
(AgGDP), is nearly 0.6 per cent for research and around
0.15 per cent for extension. Not only is this much below
the level of investment made by other countries
including China and Brazil, but it is also low
considering the increase in capital-intensity of R&D.
Though, private investment is growing fast, it continues
to be meager with an overall share of just 15 per cent in
the total investment. It is also confined to a few
profitable areas and sectors. Biotechnology research,
for example, is attracting private investment, but this
is concentrated in the pharmaceutical sector, with agribiotech
commanding only 14 per cent of the total
turnover. In order to attract private investment and to
foster partnership with the public sector, an
institutional mechanism for cost and benefit sharing
in the framework of intellectual property rights is
106
evolving. In the new IPR mechanisms, benefits are
shared with the innovator, whilst protecting the rights
of farmers and local communities. Although, the
institutional mechanism is in place, the actors are
learning to use this regime to realize their objectives.
The bottom line shall be determined by the cost
effectiveness and the credibility of the IPR mechanisms,
and capacity of the participating institutions.
Trends in public investment in agricultural research
( At 2004-05 prices )
Indicator 1991 2001 2009
Public investment (` in crore) 1,597 2,472 3,376
Public investment as percentage 0.45 0.47 0.58
of AgGDP
Investment per hectare of 118 174 240
agricultural land
Note: Investment intensity data are triennium averages ending in the year
indicated in the column.
6.1.2 Inter-Regional Trade Agreements in
Agriculture
With problems that crept up in the multilateral
trading system under the WTO regime still waiting to
be resolved, there has been a substantial increase in
regional trade. The number of regional as well as interregional
free and preferential trade agreements of
which India is also a partner, have multiplied in the
last few years. The Asia Pacific Trade Agreement
(APTA), of which India is a member shows an increase

of over 600 per cent in exports during 2000-2010.
Exports of the SAARC group of countries expanded
by over 400 per cent during the same decade. India’s
trade with Asian partners has been increasing. Its share
of exports to Asian partners has increased to 32 per
cent in 2010 from 23 per cent in 1995. Imports also have
increased from 16 to 30 per cent. Analysis of market
and commodity composition of India and other
member countries of SAARC and APTA showed that
while India has been able to maintain a diversified
market and commodity portfolio with diversification
and concentration indices ranging between 0.571 to
0.505 and 0.146 to 0.149, respectively during 2000 and
2010. Some of the other countries like Afghanistan,
Bangladesh, Bhutan, and Maldives have high index
values indicating less diversified market and
commodity base. East Asian countries like China,
Republic of Korea and Thailand have low indices
indicating greater diversification in terms of both
markets and commodities. This indicates the potential
for furthering external trade for India in the region.
6.1.3 Agricultural Investments in the Post-
Liberalization Period
The spatial dimensions of agricultural
expenditures and their linkages with growth were
analysed using data on government expenditure under
different expenditure heads. The relevant expenditure
heads under agriculture included actual revenue and
capital expenditure incurred on rural infrastructure
(rural roads and electricity), irrigation (major and
medium, minor and command area development),
rural development and rural employment programmes
including land reforms, expenditure on crop
husbandry, soil and water conservation, animal and
dairy husbandry and fishery sectors including
agricultural research and education and extension and
training. The state-wise database was developed for
1991-92 to 2009-10 Analysis of the data showed that
the total real (2004-05 prices) government expenditure
for agriculture and allied sectors increased from
` 716 billion in the mid nineties to ` 1954 billion in 2009-
10, increasing at an annual rate of 7 per cent.
Government expenditure on agriculture as a
percentage of agricultural gross domestic product,
which measures the amount spent on the sector relative
107
to its size, increased from 21 per cent in 1995 to 35 per
cent in 2009-10. Agricultural expenditure as a share of
total development expenditure indicates the level of
priority a country gives to its agriculture sector. This
share also showed an impressive increase from 23 per
cent in the early nineties to 33 per cent in the later
period. In recent years, the country has witnessed two
noteworthy changes in funding and use of funds.
Firstly, there has been a consistent rise in share of the
Union Government in total agricultural and allied
sector expenditure, which rose from 26 per cent in 1995
to 44 per cent in 2009. Second, the proportion of capital
expenditure out of total expenditure has also shown
an increase over the years indicating higher priorities
for capital formation in agriculture.
Intensity indicators of Government expenditure on
agriculture and allied sectors
(All India, 2004-05 prices)
Particulars TE - 1995 TE - 2010
Government expenditure on agriculture 716 1954
(` in billions)
Share of capital expenditure in 20 22
agricultural expenditure (%)
Share of Union Government in 26 44
agricultural expenditure (%)
Share of agricultural expenditure 21 35
in AgGDP (%)
Share of agricultural expenditure in 23 33
development expenditure (%)
Agricultural expenditure per capita of 1138 2346
rural population (`)
Agricultural expenditure per ha (NSA) (`) 5025 13884
Share of agricultural research and 0.45 0.58
education in AgGDP (%)
Share of agricultural extension 0.14 0.15
in AgGDP (%)
In addition to the absolute expenditure levels, the
composition of expenditure indicates the relative
priorities placed across sectors and regions. Of the total
expenditure, the highest share went to agri-inputs and
support services (34%), followed by rural development
(26%), rural infrastructure (20%), irrigation (17%), and
agricultural research, education and extension (3%)
during the triennium ending 2010. The expenditure

items that grew most rapidly during the current decade
were rural infrastructure, agri-input and support
services and rural development. The impressive
growth in rural infrastructure (22%) during the current
decade was mainly on account of rural roads and rural
electrification. The other expenditure item which grew
rapidly was agri-input and support services (13%),
comprising mainly expenditure on crop and animal
husbandry, and soil and water conservation, and
included incentives and subsidies related to agriculture
and allied sectors followed by rural development and
major and medium irrigation. This trend clearly
revealed that government expenditure pattern has
become broad based overtime.
Bulk of the capital expenditure is being made by
various state governments. This includes expenditures
financed from the states’ own revenues as well as
central government’s fund channelled through the state
governments. Wide disparity was observed among the
states in expenditure on agriculture and allied sectors.
On absolute basis, Andhra Pradesh had the largest
share in all India expenditure (16%) followed closely
by Maharashtra (15%), Uttar Pradesh (13%) and
Karnataka (9%) during 2009. However, on per capita
rural population basis, north-eastern states like
Arunachal Pradesh, Sikkim, Mizoram, and states of
Maharashtra and Andhra Pradesh showed relatively
higher expenditures. Agriculturally backward states
like Assam, Bihar, Madhya Pradesh, Orissa, and West
Bengal still spend relatively less than the progressive
states. The inability of these states to substantially raise
the level of their agricultural expenditures may have
serious implications for food security and poverty
reduction.
6.1.4 Energy Use in Indian Agriculture
The use and costs of energy in agriculture are
increasing. Spatial and temporal trends of commercial
energy share in the cost of production during 1980 to
2007 showed wide variation in the increase of
commercial energy share in the cost of production,
ranging from 9 per cent to 139 per cent in groundnut
and sugarcane, respectively. The share of energy cost
ranges from 45 per cent in rapeseed & mustard to 68
per cent in potato. The significant share of energy in
the cultivation cost of different crops, implies that
108
agriculture is vulnerable to energy price increase. The
traditional relationship between energy and
commodity prices has always been through the prices
of inputs that is, the prices of fertilizers, pesticides,
irrigation and transport. However, due to increasing
trends towards commercialization and diversification
to high value crops, there is higher use of direct and
indirect energy and therefore, energy prices strongly
affect agricultural output prices through opportunity
costs. The comparison of the relative pace of changes
in the price index of food grains and commercial energy
sources during 1994-95 and 2009-10 revealed that while
the wholesale price index (WPI) of high speed diesel
increased 171 per cent to 488.5 in 2008-09 from just 176.4
in 1999-2000, the foodgrains price index rose by just a
moderate 47 per cent from 176 to 234.1 during the same
period. As a majority of Indian farmers are price-takers
and lack the capacity to quickly pass on higher cost
through the marketing chain, any rise in the production
cost reduces the farm profitability, at least in the short
run. Higher fuel costs also increase marketing costs
which further reduces the agriculture sector’s net
returns. In the long run, a sustained rise in energy prices
shall affect the prices and use of inputs. On the output
side, it will raise the output prices which has serious
implications for food security, poverty and the cost of
industrial production.
6.1.5 Productivity Divide and Instability in
Rice-Wheat System
Conjunctive use of surface and ground water can
improve the sustainability of agricultural production
systems. Analysis of the temporal variations in the
growth pattern of different sources of irrigation water
can be useful for developing efficient strategies to
improve the system. Decadal growth rates in surface
and ground water irrigation in Indo Gangetic Plains
(IGP) showed a negative growth in area under surface
water irrigation since 1980s which needs to be curtailed
because water policies focus on conjunctive use for
sustainability. It is important to explore ways to
augment the share of surface water sources and that is
possible through construction of farm ponds,
revitalization of defunct tanks, and resuscitation of
community based water management in canal and tank
command areas. Water harvesting during monsoon

season can be a good strategy for water augmentation
for use of water during lean season. Watershed method
of water augmentation and conservation may be
undertaken and use of frontier technologies of remote
sensing and GIS can be helpful for efficient water
resource management and decision making. Growth
of tube well irrigation in IGP during 1970-80 was 8.76
per cent supported by a favourable policy environment
in agricultural sector, especially credit. The growth was
around 5 per cent till last decade but has now come
down to 1.27 per cent. This indicates that although
ground water irrigation occupies a major share in total
irrigation and it is now poised towards a potential
threshold. Recent decline in growth could be due to
combined effect of reduced availability of water and
increasing awareness among farmers on judicious use
of irrigation water. Over use of ground water needs to
be curbed by encouraging conjunctive use of water.
Even though the rate of growth of installation of new
tube wells has come down during the last few years,
deepening of existing wells has been increasing in IGP,
which can emanate negative externalities.
Trends in surface and ground water irrigation in IGP
109
is maximum, followed by casual labourers. Regular
wage earners comprise the least population. The
concern here is that rural self-employment is on the
decrease and the rural casual labourers are increasing,
underlining the need to create self employment
opportunities in rural areas.
Growth rate of rural employment in non-agricultural sector
(Per cent)
State 1983-84 / 1993-94 / 2004-05 /
1993-94 1999-2000 2007-08
Andhra Pradesh 1.1 0.6 -0.24
Uttar Pradesh 1.0 3.6 3.63
Bihar -2.5 8.8 6.08
Gujarat 3.2 1.4 4.51
Haryana 2.9 2.5 3.33
Maharashtra 2.0 0.2 3.88
Orissa -0.5 3.1 -3.65
Punjab 2.0 3.4 10.43
Tamil Nadu 1.2 -0.2 3.33
India 1.79 2.31 3.52
(CGR /annum %)
Period Surface Ground Canals Tanks Tube Other Other Total
Water Water wells wells sources Irrigation
1970-80 1.07 4.11 1.79 -0.58 8.76 1.19 0.65 2.51
1981-90 -0.11 2.24 0.80 -1.93 4.25 1.55 2.19 1.78
1991-00 -1.47 2.73 -0.06 -2.38 4.93 2.18 -0.01 1.97
2001-08 -1.34 1.07 -1.13 -1.82 1.27 2.37 11.15 1.75
6.1.6 Agricultural Growth and Non-farm
Employment
With declining capacity of the agricultural sector
to absorb the growing rural labour force in agriculture,
a situation of disguised unemployment in rural areas
is arising leading to migration from rural to urban
areas. Thus the development of the rural non-farm
sector is essential to generate opportunities for the rural
people to augment their incomes. Some states like
Punjab and Gujarat have performed well in the
development of this sector, whereas, other states are
lagging. However, the overall composition of rural nonfarm
employment reveals that rural self-employment
Education-wise, the number employed per
thousand population were high for either the least

educated or those who are well educated and skilled.
However, the wage was considerably high for the rural
educated population indicating the need for improving
literacy and making the rural folk better educated.
6.1.7 Developing a Decision Support System
for Agricultural Commodity Market
Outlook
Estimation of rice production is useful for
generating outlook information for better supply and
demand management. Rice production was projected
to be 124.6 mt in 2020 and 150.4 mt in 2030 The area
under rice crop appears to have reached a plateau and
horizontal expansion of rice area is expected to be
limited. It is predicted that there would be a marginal
decline in area under rice in India owing to diversion
of land for other purposes and area shift towards high
value crops. The yield of rice crop is predicted to be
around 3.5 t/ha in 2030, which could be achieved by
increasing investment in rice research and varietal
development.
Estimated rice production in India
Year Production Yield Area
(mt) (kg/ha) (m.ha)
2011 105.2 2398 43.8
2015 113.4 2597 43.6
2020 124.6 2869 43.3
2025 136.9 3169 43.0
2030 150.4 3500 42.8
Rice exports from India have been increasing since
1960 and today stand at around 4.5 mt. Milled rice is
exported to various countries around the world and
Indian basmati rice has good demand in international
market. Basmati rice constitutes a major proportion of
total rice exports. Nearly two-third of basmati rice
produced in India is exported. Majority of basmati rice
is exported to Saudi Arabia, UK, Kuwait and UAE.
Non-basmati rice is exported to countries like
Bangladesh, Nigeria, Russia, Saudi Arabia, Somalia and
South Africa. India of late is facing stiff competition
with other rice producing countries in the world. India
was in the second place after Thailand in rice exports
110
till 2006. But Vietnam surpassed India in rice exports
in both quantity and value terms after 2006.
6.1.8 Innovations in Credit Delivery and
Farmer’s Access to Institutional Credit
Analysis of the performance of Self Help Group
(SHG)-Bank linkage programme over the past 18 years
showed that the number of credit-linked SHGs has
increased from 255 1992 to 48.5 lakh currently. The
number of savings-linked SHGs stands at 69.5 lakhs.
In terms of households, about 9.7 crore households are
covered under the programme. Commercial Banks lead
in loan disbursement to SHGs with a share of 61.6 %
followed by Regional Rural Banks (23.7 %) and
Cooperative Banks (14.7 %). The average bank loan
disbursed per SHG was ` 91,083. The average loan per
SHG ranged from of ` 1.00 lakhs per SHG by
Commerciaal Banks to ` 0.58 lakhs per SHG by
Cooperative Banks. Principal component analysis
revealed that the most important feature of
performance is the “Spread of microfinance”, followed
by “Depth of microfinance”, “Thrift behavior”,
“Performance of SHPIs”, “Performance of microenterprise”,
“Performance of financial institutions” and
“Financial deepening of Swarna Jayanthi Swarojgar
Yojana (SGSY)”. This clearly indicates that the states
should focus on creation of more and more of SHGs
and also give emphasis on the identification of proper
micro-enterprises for adoption by the SHGs. It should
also promote and nurture good SHPIs strengthen the
financial institution for promotion of microfinance in
the state. The discriminant function analysis revealed
that twelve factors discriminate the good and poor
performing states. to the maximum extent. Loan
outstanding to women SHGs (Amt/SHG), SHGs in
RRB’s (No.), SGSY loan outstanding from RRB’s
(Amount/SHG), and SGSY SHGs (No.) are the major
factors affecting performance. In general, it could be
inferred that for a state to be classified as a good
performer with respect to microfinance, more focus
should be laid on amount of loan lent per women SHGs,
followed by the performance of SGSY promoted SHGs.
Thus, the states should focus on improving the
performance of SGSY scheme.

Factors affecting performance microfinance across states
Variables Coefficients Strength
of discriminant of the
function variable
(%)
SHG’s in RRB’s (No.) 5.31 17.90
SHG’s in Co-operative banks (No.) 2.73 9.20
Loan disp. Coops (Amt/SHG) 1.73 5.83
Loan O/s in RRB’s (Amt/SHG) 0.95 3.20
SGSY SHG’s (No.) 3.46 11.67
SGSY savings (Amt) 1.05 3.54
Savings SGSY (Amt/ member) 3.87 13.05
Loan disp. Women PSBs (Amt/SHG) -2.30 7.75
Loan disp. SGSY RRB’s (Amt/SHG) 0.99 3.34
Loans outstanding Women (Amt/SHG) 5.78 19.49
SGSY loan O/s RRB’s (Amt/SHG) 3.98 13.42
SGSY loan O/s PSB’s (Amt/SHG) 2.11 7.11
6.2 AGRICULTURAL EXTENSION
6.2.1 Strengthening Cyber and Frontline
Extension System for Agricultural
Development: An Action Research
6.2.1.1 Cyber extension model
The cyber extension model provides an effective
mechanism for communication of farm information
and dissemination of technology to the farmers. The
Cyber Extension Centres set up in Sitapur district of
Uttar Pradesh facilitated faster information access. The
rural youths trained by the scientists of IARI in internet
usage felt socially empowered. One hundred farmers
were trained in the Awareness meetings organised for
capacity building. Information related to land records,
status of pending cases, scholarships for students,
Government notifications and proformas/forms, etc.
can be accessed and retrieved by the farmers. The utility
of the intervention can be gauged from the fact that
users expressed a willingness to pay for such
information. This can also ensure the sustainability of
the cyber extension model. Extent of information access
increased to 74% in 2011-12 compared to 61.25% in
2010-11. Weekly usage frequency increased to 71.6%
111
in 2011-12 compared to 26.5% in 2010-11. Utilization
of cyber extension centres has been ascertained as 100%
in the village where it was established and 74% in the
adjoining villages under the same village panchayat.
SWOT analysis of information access through internet
based on users’ perception identified the availability
of information at the doorstep and cost savings as major
strengths, non-availability of computers, poor
connectivity, and infrastructure as major weaknesses.
Networking among farmers emerged as a major
opportunity. Significant change was observed among
the farmers in information output behaviour. All the
respondents (100%) sought general information related
to agriculture, 81% new technological information, 75%
market related information whereas, about 65%
farmers sought information on land records at the cyber
extension centres. Based on the assessed information
needs of stakeholders, an Agri-portal was developed
which provided information on Government schemes
on agriculture, horticulture and agri-business
enterprises, etc. and links for market information
(AGMARKNET) and agro-met advisory (IARI). A pilot
study undertaken to record and analyse the perceptions
of the farmers receiving voice SMS from ZPD, Zone
IV, Kanpur in the project area revealed that about 60%
farmers who received the voice SMS were using the
information. About 35% of the farmers were accessing
the voice SMS more than once and 10-15% farmers
made calls to seek clarifications on the information
received through voice SMS.
6.2.1.2 Frontline extension system
In order to strengthen the Frontline Extension
System of the country, IARI is experimenting with an
innovative approach of establishing linkages with Post
Offices for dissemination of IARI technologies and
information. Quality seeds were distributed through
IARI – Post Office – Farmer linkage to 546 farmers from
39 villages under seven post offices in Sidhauli and
Kasmanda blocks of Sitapur district (U.P.). Seed
dissemination according to the demand creation by the
village Post Master (Mean Score 4.5) and cost sharing
by the farmers (Mean Score 4.7 out of 5.0) were rated
more effective by the farmers. The farmers shared half
of the seed cost and paid the amount in cash. During
last year ` 38,616/- was collected from the farmers. The

Scientists interacting with Post Office staff in Sitapur, U.P.
amount shared by the farmers was collected by the
postal staff posted at the villages. From the coming
Kharif 2012 season, farmers have agreed to share full
seed cost of Kharif and Rabi crops. This indicates the
effectiveness of the model in technology delivery and
also its sustainability. Farmers preferred PRH 10 to
other varieties in terms of yield and taste. Preference
for Basmati type of rice was less because of nonavailability
of specified milling facility. Performance of
Pusa 44 was better (13-15%) compared to the prevailing
variety (Saryu 52). Bottle gourd variety Pusa Naveen
became popular among the farmers as it is easy to
market because of small size (500 – 750 gm), good in
taste, average market price is high (` 3500/t), B:C ratio
2.84 and seeds are kept for next year unlike hybrids.
6.2.2 Analyzing and Devising Extension
Models and Strategies for Sustainable
Livelihoods
6.2.2.1 ATMA
Establishment of Agricultural Technology
Management Agency (ATMA) in Nagaland, Bihar and
Uttar Pradesh has helped to strengthen institutional
linkages. The mean scores (MS) obtained for extent of
linkage were above 3 on a five-point scale, reflecting
enhanced linkages in respect of inter-departmental
activities (MS 3.7), KVKs (MS 3.5), and other institutions
(MS 3.4).
6.2.2.2 Krishi Mahotasava
Krishi Mahotasava, a month long campaign
effectively executed by Gujarat and Bihar States for
112
promoting scientific farming, was perceived by farmers
as highly effective (Effectiveness index of 4.74 on a scale
of 1 to 5). Movement of mobile exhibition called Krishi
Rath, covering almost all villages, facilitated direct
contact of farmers with state department officials,
scientists as well as service and input agencies. In
addition, training and interactions during the
mahotsava led to improvement of extension contact
(mean score 5); awareness of technologies (mean score
4.8); availability of quality seeds (4.7); awareness of
government schemes (mean score 4.8) and awareness
and availing of subsidy (4.2) among the farmers. As a
result there is speedy technology diffusion and
application. Nearly 73 per cent of a sample of 60 farmers
of block Motipur of Muzaffarpur district in Bihar
shared that there was about 50 per cent enhancement
in area under hybrid paddy and about 68 per cent seed
replacement with modern varieties of various crops.
Factors of sustainability of community institutions
were studied with case analysis of Madhurapur
Women Milk Producers’ Cooperatives of district
Vaishali in Bihar. Robust financial management,
incentives to members, trust among members,
democratic style, transparency in functioning, and
group identity were identified as the major factors
determining its sustainability.
6.2.2.3 Community radio
Community radio has been deployed in many
states to strengthen the information flow among the
farmers. Comparative case analyses of community
radio of CCSHAU, Hissar, Haryana; community radio
station of KVK Saharanpur, UP and NGO run
community radio station in Mewat, Haryana revealed
satisfaction with quality and utility of content by above
75 per cent of users in all the three cases. However, the
level of awareness was found to be more in case of NGO
run community radio station in Mewat, Haryana due
to predominance of entertainment programmes. About
22 per cent of the users listened to CRS, Mewat
programmes, while 65 per cent preferred to
entertainment programmes. Out of nearly 11 hours
programme, barely half-an hour was devoted to
agricultural programmes. Problems of sustainability,
low frequency range, fluctuation in frequency, poor
sound quality, and less broadcast time of SAU and KVK

community radios were the major limitations ranked
by the farmers in descending oreder. Increase in
transmitter frequency and involvement of community
in programme development were suggested for
effectiveness.
Analysis of private extension services revealed
their importance in complementing the public
extension services. BAIF’s paid artificial insemination
service was found highly satisfactory by the farmers
of Bidupur block of Vaishali district in Bihar.
Promptness of service, door to door service, and
advisory services along with artificial insemination
service were reported by 95, 100 and 78 per cent of
farmers out of a sample of forty dairy farmers as factors
for preference to BAIF’s programmes. The major
determinants of willingness to pay by farmers for the
private extension services were identified as size of land
holding, proportion of irrigated holding, scientific
orientation, extension contact and achievement
motivation of farmers.
6.2.2.4 Effectiveness of voice message service of
extension initiatives
Effectiveness of voice message service of IFFCO -
Kisan Sanchar Ltd was analyzed with a sample of 75
farmers of Rewari and Kurushetra ditrsict of Haryana.
More than 96 per cent of users perceived the service as
trustworthy, while 68 per cent of them rated the service
better compared to other sources. About 60 per cent of
the message listeners implemented or planned to
implement the information received. On a scale of 1 to
5, relevance was rated 4.3, while content and clarity of
voice and its quality were rated 4.5. The overall
effectiveness mean score of 4.1 showed its acceptance
among the farmers. The farmer’s suggestions for
enhancing effectiveness included use of video (multimedia)
message in addition to voice messages.
Effectiveness studies on extension initiatives of
Punjab National Bank (PNB) Farmers Welfare Trust
in Sachakhera village of Jind District, Haryana showed
that the presence of Kisan Bandhus (mean score 4.5),
Biometrics smart cards scheme (MS 4.2) and PNB
Kisan Credit Card (MS 4.2) were the major
components that accounted for the success of PNB’s
extension initiatives.
113
6.2.3 Constraints in Adoption of Improved
Technologies and Yield Gap in Selected
Pulses and Cereals: A Comparative Study
During Kharif 2011, a total of 32 demonstrations of
paddy varieties P 1401 (12) and P 1121 (20) and 36
demonstrations of pigeonpea (18 each of variety P 2001
and P 2002) were conducted. The yield recorded in the
demonstration field of rice was 4.52 t/ha and the yield
gap I was calculated 0.28 t/ha whereas yield gap II was
0.32 t/ha. The pigeon pea varieties under demonstration
(P 2001 and P 2002) yielded an average of 1.2 t/ha,
leading to a yield gap-I of 0.6 t/ha and yield gap II of
0.438 t/ha. The comparison of pigeon pea and paddy
on B:C ratio basis revealed that it was higher for pigeon
pea (3.02) than paddy (2.82) but in absolute terms
paddy gave more profit than pigeon pea. The adoption
of recommended technology in case of pigeon pea was
only 31.6% in comparison of 59.2% in paddy.
During Rabi 2010-11, 20 profitability
demonstrations (1 demonstration = 0.40 ha) of wheat
were conducted during Rabi 2010-11 at farmers’ fields
at four locations. The demonstration yield of IARI
varieties was 5.157 t/ha. However, yield gap-I and yield
gap-II were calculated to be 43 kg/ha and 257 kg/ha,
respectively. The B: C ratio was also higher in case of
IARI varieties (3.40:1). The profitability analysis of
wheat and chickpea showed that there was comparable
profit in case of chickpea and wheat. The B: C ratio
was in case of chickpea was higher at 3.40:1 relative to
wheat at 3.06:1. The adoption of recommended
technology in case of chickpea was only 37.3% in
comparison of 62.3% in wheat.
The major constraints perceived by the farmers
were mostly related to inputs, know-how, and
infrastructure. The recommended package of practices
was generally not being adopted by the farmers in
pigeonpea. A majority of the farmers in NCR region
are not growing pigeonpea due to menace of Blue Bulls.
The farmers considered pigeonpea as risky crop as
compared to rice due to more attack of pests and
diseases. The sowing, harvesting, spraying of fully
grown crop and threshing equipments are also lacking
for pigeonpea cultivation. Generally, large farmers
grow pigeonpea in neglected fields that too not for

grains but for fuel wood. Similarly, one hundred
farmers of village Jassaur Kheri, District Jhajhar,
Haryana and 60 farmers of village Padmada Khurd,
Alwar, Rajasthan were trained by subject matter experts
of IARI with a team of extension scientists to orient
and update the knowhow of latest technologies of pulse
production among the pulse growers. The effect of
training on gain in knowledge was recorded to be 28.5%
in overall. Maximum gain was observed in seed
treatment methods and chemicals, IPM, knowledge
regarding rhizobium inoculation and recommended
varieties.
6.2.4 Enhancing Entrepreneurship among
Rural Youth
The Institute has been promoting entrepreneurship
among farmers and rural youth. Several entrepreneurs
became successful achievers. To strengthen
entrepreneurship among rural people and replicate the
success stories of several people, thirty eight cases of
achiever farmers were studied in depth to identify and
document the best practices (initiatives having a
demonstrable and tangible impact on improving
people’s quality of life) and determine success and
inhibitory factors in setting up of their agri-enterprises.
Best practices in the case of a strawberry grower in
Delhi were identified as relay cropping of strawberry
and water melon, direct marketing after proper sorting
and packaging, and adoption of scientific cultivation
practices. In case of a dairy entrepreneur in Gurgaon,
Haryana, scientifically constructed sheds, good animal
husbandry practices focusing on hygiene, adoption of
scientific breeding, close linkages with scientific
personnel and marketing arrangements with a milk
processing plant were identified as the best practices.
In case of two women entrepreneurs producing and
selling value-added products, success factors were
identified as effective marketing linkages with retailers,
maintenance of product quality and production of new
and innovative products. All the entrepreneurs were
found to be strong in personal entrepreneurial
competence.
Based on the case studies of thirty eight achiever
farm entrepreneurs, a model of agri-enterprise
development process has been designed.
114
Process of an agri-enterprize development
Self Sphere
Personal
entreprenurial
competencies
Technical
knowledge
& skills
Good management
skills
Environmental
Sphere
Facilitators /
Inhibitors
Situational factors
Environmental
factors
Governrnent
policies
Credit and input
availability
High
Agripreneurial
Success
Higher profits
Growth
Higher yields
Quality/ brand
recognition
Innovations
generated
Interaction of scientists with participants of training on Value
Addition of Baby Corn in Sungarpur – Pachara village of
Ghaziabad
6.2.5 On-Farm Testing of IARI Technologies
in NCR
The on-farm trials of wheat were laid out during
Rabi 2010-11. The grain yield of all the three varieties
subjected for adaptation research under timely sown
conditions was significantly higher than the local
practice as a whole. The variety HD 2967 yielded
highest (22% higher than local check, PBW 343)
followed by HD 2894 and HD 2733. In case of late sown
varieties, WR 544 yielded highest (29% higher than local
check) followed by HD 3016 and HD 2985, respectively.
Regarding effect of nutrient management practices on
grain and straw yield, it is clear from the data that the
application of fertilizers on the basis of soil test yielded
significantly higher quantities of grain and straw than
the farmers’ practice and general recommendations of
fertilizers.

Yield performance of different varieties at farmers’ fields
Timely sown Average Late Average
varieties grain sown grain
yield varieties yield (t/ha)
(t/ha)
HD 2967 60.49 WR 544 57.55
HD 2894 50.47 HD 2985 45.75
HD 2733 51.83 HD 3016 52.15
Farmers’ Practice 49.15 Farmers’ Practice 44.56
Effect of weed control interventions on yield and
yield attributes clearly indicated that the weed control
with Clodinofop (60 g/ha) + Metsulfuron (4 g/ha) gave
better results in terms of plant height, effective tillers/
m 2 , spike length, grains /spike, grain and straw yield .
It superseded the control with sulpfosulfuron (30 g/
ha) and the practices followed by the farmers in the
form of recommended herbicides like 2,4-D. The results
show that not only the crop yield increased significantly
but also the quantity of the herbicides used reduced
Scientists visiting the OFT laid out on farmers’ field in Badarpur
Said village, Faridabad, Haryana
Effect of weed control interventions on yield attributes of wheat crop
115
significantly. The result of the interventions laid out
for adaptation are clear indications for the extension
agencies working in the area for their concerted efforts
to repeat the interventions with farmers to make the
final choice on technology adoption.
Similarly the site specific nutrient management
yielded highest in case of paddy var. P 1121 both in
terms of grain (19.7 % higher than farmers’ practice) as
well as straw yield(22.2% higher than farmers’ practice).
In case of weed management, Pretilachlor + Bispyribac-
Na proved promising in direct seeded (8% higher than
farmers’ practice) as well as transplanted paddy (10.3%
higher than farmers’ practice) in terms of grain yield.
As far as varietal performance is concerned P 1509
yielded 4.52 t/ha, had not shattered in the field, yield
was comparable with P 1121 (4.58 t/ha) and P 2511 (4.89
t/ha), farmers’ were in dilemma regarding the market
rates. Lack of capacity to take risk on the part of farmers,
unfavourable attitude, lack of interest of farmers to
participate, no monetary advantage to farmers and no
remuneration to farmers for participating in On Farm
Research were the major constraints perceived by the
farmers.
Effect of nutrient management on grain, straw and dry
matter yield of wheat
Treatments Grain Straw Dry matter
yield yield yield
(t/ha) (t/ha) (t/ha)
Farmers practice 4.972 11.125 16.097
Recommended dose of fertilizer 5.458 12.096 17.554
Site specific nutrient management 6.230 13.467 19.697
CD (P=0.05) 0.304 0.686 0.969
Treatments Plant height Effective Spike Grains Grain Straw Harvest
(cm) tillers/m 2 length (cm) per spike yield (t/ha) yield (t/ha) Index (%)
Farmers’ Practice 85.0 302.1 8.80 49.8 3.49 5.43 39.2
Control 83.6 283.3 8.20 43.2 2.92 4.39 39.9
Clodinofop + Metsulfuron 90.6 354.9 9.95 61.3 4.49 6.75 40.0
Sulfosulfuron 88.9 344.7 9.55 56.9 4.09 6.09 41.7
CD (P=0.05) 2.64 23.08 0.64 5.49 0.40 0.60 NS

6.2.6 Integrated Farming System and
Technology Model for Livelihood and
Nutritional Security of Tribals
6.2.6.1 Demonstrations of high yielding varieties
In four districts of Rajasthan, namely, Udaipur,
Banswara, Dungarpur and Sirohi, demonstrations of
high yielding varieties of wheat (HD 2932, DBW 17) in
3.8 ha, paddy (P 2511) - 8.0 ha, mustard (Pusa Vijay,
Pusa Tarak) - 4.3 ha, green gram (Pusa Vishal) - 3 ha,
pigeonpea (Pusa 2002) – 3 ha, were conducted. During
Rabi 2010-11, the average yield of demonstrated wheat
varieties WR 544, HD 2932, DBW 17, HD 2684 and HD
2864 was 3.61 t/ha, 3.86 t/ha, 3.75 t/ha, 3.88 t/ha, 3.94 t/
ha and 3.28 t/ha, respectively. All the wheat varieties
performed better than the local check variety Raj 3077
(2.43 t/ha). The gram variety P 1008 gave an average
yield of 1.72 t/ha which was 56.21% higher than the
local check. During Kharif 2011, rice variety Pusa 2511
gave better yield (3.24 t/ha) in comparison to existing
cultivars in Banswara district. Farmers accepted this
variety due to good yield and better fragrance. The rain
in the district during vegetative growth was less, but
the farmers harvested good yield. The variety Pusa
Vishal of green gram was liked by the farmers due to
bold grains and better yield (1.26 t/ha) which was 50%
higher than the local variety. Farmers kept seed for the
next year. The rice variety P 2511 gave better yield (3.24
t/ha) in comparison to existing local variety, Kali Kamod
(2.45 t/ha). Farmers accepted this variety due to good
yield and better fragrance. Although, there was low
rainfall during vegetative growth, still farmers
harvested good yield.
6.2.6.2 Seed production and multiplication
Seed production and multiplication of suitable
varieties of paddy (PRH 10, P 2511, P-1401)- 13.3
hectare, pigeon pea (P 2002)- 3.30 ha, moong (Pusa
Vishal)- 2.25 ha in the project area was taken up. Total
seed produced of paddy was 31.2 t of P 2511, 26 t of P
1401 and 4.063 t of PRH 10 variety. For pigeonpea (P
2002), 3.3 t seed was produced and for mungbean (Pusa
Vishal 2.7 t seed was produced. Seed production and
multiplication of suitable vegetable varieties of
vegetables, viz., bhindi (Pusa A4)- 3.0 ha, bottle guard
(Pusa Naveen)- 2.00 ha, brinjal (Pusa Uttam)- 0.2 ha
116
Scientists visiting the seed production plot of vegetable crops
was also done in the project area and total 110.4 tonnes
quality seed was produced. A book on “Rajasthan ke
Janajatiya Kshetron mein phaslon ke kit rog va kharpatvar
evam unka niyantran” was published. One 5 days oncampus
training at IARI, New Delhi on “Value addition
of Agri-Horti Produce” was organized for 25 tribal
women of Udaipur district under this project.
6.3 TECHNOLOGY ASSESSMENT
AND TRANSFER
6.3.1 Assessment and Promotion of
Agricultural Technologies and Developing
Market-led Extension Models
This Project has been implemented in four villages
of Haryana and Uttar Pradesh in the NCR namely
Badarpur Said (Faridabad district), Pabsara (Sonipat
district), Kumbawas (Gurgaon district) and Partapur
(Ghaziabad district) with the objective of developing
these villages as model villages through integrated
development. Farmers’ problems were prioritized and
potential crop based interventions and trainings were
planned and implemented accordingly.
6.3.1.1 Crop based interventions
Demonstrations were carried out for different
varieties of wheat ( HD 2932, HD 2987, HD 2733, HD
2894, HD 2851, HD 2967, WR 544), lentil (K-75),
mustard (Pusa Jagannath, Pusa Vijay) and gram (BGD
72). In village, Pabsara, wheat variety HD 2733
outperformed all other varieties followed by HD 2987

in comparison to local check variety (PBW 343, 4.75 t/
ha). Significant increase in net profit from improved
wheat varieties was realised in comparison to local
check. Lentil K-75 and gram BGD 72 gave higher yield
to the tune of 38.32 and 12.70 per cent over the local
checks (1.43 t/ha) and (1.93 t/ha), respectively.
Local: PBW 343,
HYV: HD 2733
Local: PBW 343,
HYV: HD 2894
Local: PBW 343,
HYV: HD 2932
Local: PBW 502,
HYV: HD 2932
During Kharif 2011, different varieties of paddy
(P 1121, PRH 10, P 1401, PB 1, P 2511, P 1509), arhar
(P 2001), okra (Pusa A4), bottle gourd (Pusa Naveen
and Pusa Santushti), moong (Pusa Vishal), amaranthus
(PLC and P-Kiran) were demonstrated. The paddy
variety PRH-10 gave highest yield of 6.25 t/ha which
was 67.96% higher than the local check variety, sharbati
(3.72 t/ha) resulting in BC ratio of 2.22. Paddy varieties
Pusa 1121 and Pusa 1401 were well accepted for their
cooking quality. P 1509 gave an average yield of 3.5 t/
ha in comparison to 2.85 t/ha of local check variety
sarbati and this variety was found tolerant to blast and
BLB in village Pabsara. The best traits of the variety
reported by farmers were its short duration, fine grain
and good aroma. More tillers and less incidence of
disease were observed in variety P 401 as compared to
P 1121 in village Badarpur Said.
Arhar variety P 2001 gave an average yield of 1.72
t/ha in comparison to 1.37 t/ha yield of local variety.
Moong, Pusa Vishal gave an average yield of 1.0 t/ha
in comparison to 0.62 t/ha in village Partapur. However,
this was a new introduction in village Dhani
117
Kumbhawas and Pabsara and its benefit cost ratio was
1.75 and 1.66, respectively.
6.3.1.2 Water management technologies for
sustainable agriculture
Overall coordination was done for layout of 253
demonstrations on five water management technologies,
namely system of rice intensification (SRI), raised bed,
biogas, laser leveling and micro-irrigation, in three
operational areas Bulandshahar, Jhajjar and Alwar.
Proper management of irrigation led to substantial saving
of irrigation water under the different technologies.
Savings in irrigation water were accompanied by savings
in energy utilization and farmers’ time. An increase in
productivity was also realized in case of the interventions.
Bio-gas slurry demonstrations in paddy and wheat crop
helped the farmers to save three and one complete
irrigation, respectively.
Water saved and the gains in productivity
Water management Crop Irrigation Gain
technology water in
saving yield
(%) (%)
System of rice intensification
(SRI)
Paddy 33.33 2.27
Laser levelling Paddy 25.00 4.61
Wheat 20.00
Raised bed planting Maize 37.50 12.67
Wheat 30.00
Onion
(kharif )
10.00 18.00
Drip irrigation Cotton 38.70 75.00

Drip system installed in villages Gujuki and Tilwar, Alwar, Rajasthan
Farmers were trained on various water saving
technologies and interactions arranged with
progressive farmers to motivate them to adopt the
technologies. Twenty six farmers installed drip system
on nearly 34 hectares in Tilwar, Gujuki, Salpuri,
Sunehra, Chauma, Alawara, Sirmaur and Kalsana
villages of Alwar district
6.3.1.3 Establishment of orchard for economic
prosperity
Kinnow, lemon, guava, aonla and mango orchards
were established in the model villages for enhancing
income and ensuring nutritional security in the villages.
More than 95% of the planted saplings of above fruit
crops were established at all the locations. The growth
related performance of these saplings encouraged other
farmers to adopt fruit plantation.
6.3.1.4 Awareness and capacity building
Six farmers from each of the four model villages
were given hands-on training on protected cultivation
of vegetables. This training helped them to gain
knowledge and develop skills for protected cultivation.
During summer 2011, cucumber was grown in lowcost
polyhouse in Rajpur village. Similarly, 500 farmers
and 150 farm women from these villages were also
118
given exposure during the events of agricultural
exhibition and Pusa Krishi Vigyan Mela.
6.3.2 Strengthening Extension Education
Programme for Developing Innovative
Models and Techniques for Higher
Productivity and Profitability in Agriculture
The National Extension Programme was further
strengthened in collaboration with 17 ICAR institutes/
SAUs for faster diffusion of IARI varieties and
production technologies to greater numbers of farmers
in different parts of the country. This programme was
effective in dissemination of IARI technologies in far
off locations.
6.3.2.1 Rabi 2010-11
A total of 398 demonstrations covering an area of
140 hectares were conducted at 17 locations. The major
observations are as under:
Wheat
Crop Variety Number of Saplings
● HD 2985 emerged as the high yielding variety with
less water requirement having medium bold grain
and good fodder quality.
● HD 2932 was found good in tillering with medium
height giving more straw of good quality. Seeds
Kumbhawas Badarpur Said Rajpur Soodna
Kinnow Kinnow 220 - - -
Lemon Baramasi 200 100 100 100
Guava Lalit and L49 - - 125 200
Aonla NA 7 and Krishna - - 100 100
Mango Amrapali, Dasheri - - - 160

were found bold with good ear heads. This variety
performed well in timely sown and slightly late
sown conditions.
● HD 2733, number of tillers were found (15-20) more
than any other variety. Ear heads are compact,
medium height, more straw, no lodging, no disease
attack, more yield (5.00-5.50 t/ha)
● HS 420, HS 490 and HS 507- found to be free of
rust while other popular varieties suffered
heavily due to rust. Farmers were satisfied with
performance of these varieties regarding
tillering, earhead length etc. The potential for
adoption of these varieties was reported to be
good at Kangra.
● In Bilaspur region (HP), HS 277 gave good tillering
as well as yield (6.25 t/ha).
● Wheat varieties HD 2987 (5.43 t/ha), HD 2894 (5.21
t/ha) and HD 2733 (5.0 t/ha) yielded fairly well
across the zones throughout the country.
Lentil
● Plants of L 4076 were erect with dark green colour,
bold seed and high yields (1.2 t/ha). Water
requirement of this variety was low and it fetched
better market price.
● K 75 performed well with good branching, less
insect-pests attack, very good fruiting, bold grain,
high yield at all the locations.
● L 4076 was preferred by farmers for its bold and
attractive grain and yield (1.50 t/ha) in Varanasi,
UP.
Gram
● BGD 72 had good branching, bold pods and grains,
good in taste, but less liked in the market.
Onion
● Pusa Red produced medium sized compact blubs,
which fetched better market price. It is high
yielding with good in taste
Carrot
● Pusa Rudhira was found to have very good roots,
uniform size, long, no pith and red attractive
colour. It fetched 10-20% higher market price
because of its good in taste.
119
Mustard
● At Kangra, the average crop yield of Pusa Bold, Pusa
Agrani and Pusa Mahak was recorded to be 43.7,
32.8 and 39.1% higher than the local check (Gobhi
sarson, Neelam), respectively. The variety, thus,
provided a net return ratio of 1.65-1.92. On the other
hand, at Una, the varieties yielded 7, 29.3 and 23.3%
lower than the local check. At Hamirpur, the farmers
recorded 220-240 pods/plant with 9-10 seeds/pod
in case of Pusa Bold and Pusa Mahak while Pusa
Agrani had only 48-51 pods/plant with about 6
grains/pod. The potential for adoption of these
varieties was reported to be good at Kangra.
Pea
● The green pod yield of the variety Pusa Pragati was
reported to be 14.1-22.4% higher than the local
check with a net return ratio of 1.22-1.26. The
growers were satisfied with the variety as they
observed completely filled pods with more number
of grains as compared to popular variety Punjab
89. The potential for adoption of the variety was
reported to be good at Palampur district.
Palak var. All Green
● The green leaf yield of the variety was reported to
be 20% higher than the local check. The potential
for adoption of this variety was reported to be good
at Kangra.
● Palak variety P. Bharati was well accepted in
Karnataka because of its good market price,
broader leaves, rapid growth and four times more
harvest as compared to local varieties.
Okra var. Pusa A 4
It was accepted across eastern districts, Rajasthan,
and western UP and Haryana owing to its good yield
(12.5-14.0 t/ha), taste and marketability.
6.3.2.2 Kharif 2011
A total of 500 demonstrations on paddy (P 1460, P
2511, PRH 10, P 44, P 1121, PB 1, P 1401), Moong
(P Vishal), Palak (P. Harit), Carrot (Nantis), Cowpea
(V 578), Bottlegourd (P Naveen), Arhar (P 2001) were
conducted at different locations of ICAR institutes/
SAUs covering an area of 206.4 ha. Some of the results
of these demonstrations are detailed below.
● PRH 10 variety of paddy was liked by farmers due
to short duration character of the variety.

● P 2511 was liked by farmers due to its aroma and
taste, however, they were not satisfied with respect
of its marketability at Varanasi area.
● Farmers were satisfied with yield (3.1 t/ha) and
high demand of variety Pusa 1121 in the market.
They reported the lodging problem in this variety
during slightly off weather situation. Some fields
were attacked by brown plant hopper (BPH) and
damaged the crop in spots.
● Overall performance of the variety Pusa 1401 in
respect of yield (3.7 t/ha) is good but bacterial leaf
blight was observed in this variety.
● Higher yield of P 2511 (4.64 t/ha) was at par with
the coarse grain variety of paddy. Farmers
observed false smut disease in this variety.
● Farmers reported that the yield of Pusa 44 variety
(3.36 t/ha) was higher than the local basmati
sharbati. But in the market, the rate of Pusa 44
variety was less in comparison to the local basmati
sharbati. Farmers also observed that the Pusa 44
variety was susceptible to bacterial leaf blight
disease.
● Okra variety (Pusa A 4) was accepted across eastern
districts of Rajasthan, western UP and Haryana on
account of good yield (12.5-14.0 t/ha), taste and
marketability.
● Farmers at Varanasi area reported that fruiting in
Pusa Naveen is better than that of other varieties.
However, fruits were smaller than Mahyco Hybrid.
Producers sell in local mandi from where it is
transported to Kolkata and Delhi alternatively.
Farmers get low price, if they sell to traders of
Kolkata because their preference is for long bottle
Front line demonstrations on wheat with application of zero tillage and use of bio-fertilizer
120
gourd. However, Delhi traders buy it at a little
higher price than the long one. People in Eastern
India like long and bigger size bottle gourd, while
in the North, particularly Delhi, they prefer small
size bottle gourd.
6.3.3 Participatory On-farm Seed
Production of Improved Varieties of IARI
● At Jhajjar location, 200 kg seed of bottle gourd
(Pusa Naveen) was produced by farmers.
● At Bharatpur, 1.0 t seed of carrot (P, Rudhira) was
produced at farmers’ fields.
● Production of 78 t of paddy seed of varieties Pusa
44, Pusa 1401, Pusa 1121 and Pusa 1460 during
Kharif 2011, and 45 t of wheat seed of variety HD
2967 during Rabi 2010-11 was done in
collaboration with Young Farmers Association of
Punjab, Rakhra.
● Total of 35.1 t of quality seed of wheat varieties
namely HD 2733, HD 2851, HD 2894 and DBW 17
was produced in Punjab in collaboration with YFA,
Patiala (Punjab).
● Total of 84 t of paddy seed (P 1401, P 44, P 1460)
was produced.
6.3.4 Front Line Demonstrations on Wheat
(in collaboration with DWR)
During Rabi 2010-11, 35 FLDs on wheat in selected
villages of districts Aligarh and Bulandshahr in UP
were conducted on newly released varieties of wheat,
DBW 17 and PBW 550 with the application of zero
tillage and use of bio-fertilizer (Azotobacter + PSB).
S. Technology Variety No. of Area Yield Increase in
No. Demos (ha) (t/ha) yield (%)
Test Check
1. New Released Variety DBW 17 15 6.60 4.78 4.26 12.38
PBW 550 4 2.40 4.56 5.05 -9.64
2. Use of biofert. (Azotobacter+PSB+Micorrhyza DBW 17 6 3.00 4.91 4.45 10.42
3. Zero tillage DBW 17 6 2.40 4.79 4.55 5.43
PBW 550 4 1.60 4.95 4.67 6.10
Total 35 16.00

6.3.5 Innovative Transfer of Technology
Model: Partnership between IARI and Non-
Government Organisations for Effective
Transfer of Agricultural Technologies to the
Farmers
Under this programme 31 NGOs of repute from
17 states of the country are involved in assessment and
dissemination of IARI technologies in their operational
areas. During Rabi 2010-11, 545 demonstrations
covering 196.11 ha of area for 10 crops were conducted
across various regions. Similarly, during Kharif 2011,
678 demonstrations covering 263.80 ha and 6 crops
were conducted at different locations of operations of
the partners.
Rabi 2010-11
● At Gorakhpur, wheat variety HD 2733 gave yield
(4.09 t/ha) advantage of 47.13% over the local check
followed by HD 2985 (3.35 t/ha.)
● At Dola, UP, wheat variety HD 2894 (5.42 t/ha)
outperformed HD 2851 (5.13 t/ha) and the local
check PBW 343 (4.0 t/ha). The B:C ratio for above
IARI varieties were 3.25, 3.01 respectively.
● At Aligarh, HD 2932 (4.95 t/ha) gave 33.22% of yield
advantage over local (3.54 t/ha).
● Mustard (Pusa Vijay) : Badly affected with white
rust and aphids at Jammu.
● At Gorakhpur, Pusa Jagannath (2.87 t/ha) gave 37%
more yield over local variety (2.1 t/ha).
● Gram (BGD 72) gave an average yield of 2.94 t/ha
at Gorakhpur, which was 30% higher to farmers
own seed (1.34 t/ha).
● Lentil (L 4076) gave an average yield of 1.79 t/ha,
which was 31% more than the local check with B:
C ratio of 3.85.
Kharif 2011
● Paddy variety P 1121 was demonstrated at
Dehradun (UK), Hisar (Har), Baghpat (UP) and
Bilaspur (HP). The average yield ranged from 4.52
t/ha to 3.0 t/ha. The highest was at Bilaspur (HP)
and lowest at Dehradun. However, its BC ratio was
7.5 at Dehradun while it was 1.77 at Hisar. The
farmers like this variety due to good tillering and
its high market price.
121
● Demonstrations on paddy variety P 2511 were
conducted in Gorakhpur, and Lucknow in UP,
Bilaspur (HP) and Chhapra (Bihar). Its average
yield was 4.82 t/ha in Bilaspur. Farmer preferred
this variety for its high yielding and short duration
character. Its average yield in Bihar was 5.15 t/ha
in comparison to local Sona Mansun variety
resulting in 47.12 % increase in the yield.
● A total of 81 demonstrations of P 44 were
demonstrated in Eastern Region of UP, Kerala, West
Bengal and Dehradun. It yielded 5.4 t/ha in Bihar,
which was 52.29% higher than the local check. This
variety gave 86% higher yield at Dehradun in
comparison to local variety Kasturi (2.9 t/ha). At
Kerala there was average increase in yield was up
to 40%. There was no specific pest infestation. The
best trait of variety was abundant growth and good
straw yield.
● Twenty six on-farm assessments of PRH 10 were
conducted in eastern UP and Bihar. In eastern UP,
the average yield obtained was 4.6 t/ha (local Saryu
52: 2.08 t/ha). PRH 10 is definitely a higher yielding
hybrid with better grain quality. Since it matures
only in about 110 days, the farmers felt that they
can take potato and any other short duration crop
after harvesting of PRH 10 followed by a short
duration variety of wheat, say Halna which
matures in 100 days and does well even if planted
in first week of January. In Bihar, there was 73.57%
higher yield of this variety in comparison to local
(3.5 t/ha) with B:C ratio of 1.89.
● In West Bengal, paddy varieties Pusa 44 and PNR
381 were assessed. All the varieties gave higher
yield than local check. The average increase in yield
was up to 15.86 %. The BC ratio of variety PNR 381
was 1.86. The extent of infestation of disease was
than 5%. All the varieties have potential for
adoption in the area. Best traits of the variety PNR
381 are higher yield and better market price.
● Bhindi variety Pusa A4 gave an average yield of
12.5 t/ha in Gorakhpur region. In Jhalawar Region,
however, average yield of 6.75 t/ha in comparison
to 6.0 t/ha yield of local check variety with CB ratio
of 1: 3.44 was found.
● Pigeon pea variety P 992 gave an average yield of
1.85 t/ha as compared to yield of local variety (1.43
t/ha) at Chhapra, Bihar.

6.3.6 Pusa Krishi Vigyan Mela-2012
The annual Krishi Vigyan Mela of the Indian
Agricultural Research Institute, New Delhi on the
theme “Prosperity through Innovative Farm
Technologies” was organised from 1 st to 3 rd March 2012.
Farm technologies developed by IARI for enhanced
productivity and income were displayed in the
thematic pandal. Besides 35 stalls of ICAR Institutes, 6
KVKs, 46 private companies, 2 news papers, 29 NGOs
and 12 Public Sector Undertakings, participated in the
mela to demonstrate their technologies / products for
display or sale. There were ten stalls exclusively
devoted to show the innovations developed by the
farmers. About twenty five progressive farmers from
Extension Operational Areas of the Institute also putup
their stalls for display and sale of their farm produce.
Farmers were provided free of cost consultancy service
like soil testing, mushroom cultivation etc., at the mela
site by various agricultural experts.
More than 1,00,000 visitors from different parts of
the country including farmers, farm women, extension
workers, entrepreneurs, students and others visited the
mela. Three technical sessions were organised as a part
of the farmers-scientist-industry interface on different
themes. In addition to these, a ‘Women Empowerment
Workshop’ was also organized in which more than 5000
farm-women and farm-men from different parts of the
country participated. Over 21.5 t of seeds of high
yielding varieties of different crops were sold through
Pusa Seed Sale Counter during the mela period. In
recognition of the outstanding contributions in
technology development and dissemination in
partnership with IARI, seven farmers from different
122
parts of the country were bestowed with “IARI Fellow”
award. Thirty two progressive farm-men and farmwomen
from different States of the country were
honoured for their innovations in the field of
agriculture.
6.3.7 Off-campus Exhibitions
The Centre for Agricultural Technology
Assessment and Transfer (CATAT), Indian Agricultural
Research Institute, New Delhi participated in 12
National and International Exhibitions during 2011-
2012. These exhibitions were organised in the states of
Uttar Pradesh, Delhi, Rajasthan, Chhattisgarh, Jammu
& Kashmir, Haryana, Punjab and Uttrakhand. IARI
received the First Prize at the Kisan Mela Avam Pashu
Vigyan Pradarshni at the Indian Veterinary Research
Institute, Izatnagar and the Second Prize at Mustard
Vigyan Mela organized by DRMR, Bharatpur for the
excellent display of the exhibits, live materials and
literature. Sale of IARI seed was also conducted in the
exhibitions.
6.3.8 Training Programmes Conducted
6.3.8.1 Trainings for farmers and extension
workers
CATAT and ATIC organized 17 on-campus training
programmes for agricultural officials and progressive
farmers. These programmes were attended by 429
participants from Uttar Pradesh, Uttrakhand, Bihar,
Assam, Rajasthan and NCR of Delhi. The major areas
covered were good agriculture practices (GAP) in
agriculture, organic farming, post-harvest
management, soil and water management, integrated

nutrient management, nursery management and value
addition in agricultural and horticultural produce.
These programmes were sponsored by SIRD (Assam),
Delhi Development Department, NAIP, ATMA (Patna)
and ATMA Jhalawar, Rajasthan.
6.3.8.2 Model training course on “Micro
Enterprise Promotion in Agriculture and Allied
Areas”
CATAT organised an eight days model training
course on “Capacity Building of Development
Department Personnel on Micro Enterprise Promotion
in Agriculture and Allied Areas” sponsored by the
Directorate of Extension, Government of India in
September 2011. Thirty two trainees from eleven states
of the country and from various State agricultural and
allied departments participated in the training. The
major objective of the course was to sensitize and
enable the extension personnel and officials for
conceptual comprehension and skills inculcation for
promoting micro-enterprise in agriculture and allied
fields.
6.3.9 Agricultural Technology Information
Centre (ATIC)
6.3.9.1 Services rendered by ATIC
The Agricultural Technology Information Centre
(ATIC) is based on a single window concept and
provides farm information advisory services, sale of
seeds and other critical inputs to different stakeholders
at one location and contact point for guidance of
farmers and other agri-entrepreneurs visiting the
institute for varied purposes. A total number of 21,509
farmers / entrepreneurs, development department
officials, students, and NGO representatives from 22
states of India visited ATIC during the year for farm
advisory, diagnostic services, purchase of technological
inputs/ products and trainings. Maximum number of
farmers visited ATIC to purchase seeds or inquire about
seeds and varieties (11,055).This was followed by those
seeking horticultural and medicinal plants related
information (6021), plant protection (1552), agro-based
enterprises (1135), farm literature (4546), dairy (240),
agricultural implements (745). State-wise, out of total
farmers visiting ATIC, Uttar Pradesh. ranked first (28
%), followed by Haryana (21%), Delhi (18 %), Rajasthan
123
(16%) and others (17%). Besides farm advisory services
to visiting farmers, ATIC also provides farm advice
through Pusa Agri Com 1800-11- 8989 (toll free), Pusa
Helpline (011-25841670), exhibitions, farm literature
and letters. A Level II Kisan Call Centre (1800-180-1551)
has also been established at ATIC for addressing the
problems and queries of farmers of Delhi state, which
are escalated from level I. These lines were used by
5028 farmers / entrepreneurs from 18 states to get
information about seed availability (2875), production
technology (2205), plant protection (1205), agro-based
enterprises (645), literature (651), biofertilisers (357) and
others (780). ATIC’s telephone based information
delivery services hold immense potential for reaching
the distant farmers in time.
Sale of seeds at ATIC
6.3.9.2 State of the art technologies
ATIC has been using state-of-the-art technologies
such as touch panel computer display systems, screen
rollers, illuminated display panels and models, to
demonstrate important IARI technologies in crop
production including nutrient and water management
to visiting farmers. A unit of bee keeping (apiary) with
4 bee hives has been established in ATIC which can be
a source of information for starting an agro-based
enterprise for visiting rural youths and farmers. A biogas
plant (Gobar gas plant) of 4 cubic meter size has
been constructed as a demonstration on sustainable
farming system and adoption of eco friendly
technologies. Drip irrigation system has been installed
in ATIC crop cafeteria for demonstrating water saving
technology to the visiting farmers.

Touch Screen Computer Display Panel at ATIC
6.3.9.3 Technology products and publications
Technology products and publications worth about
`15.37 lakhs and ` 0.95 lakhs, respectively, were sold by
ATIC during 2011-12. Two bulletins on Kharif Fasalon ki
Kheti, Sabji Fasalon ki Utpadan Taknikiya, Fal Evam Foolon
ki Kheti and Four issues of farm magazine Prasar Doot
were published by the centre during the reporting
period. Fifteen Pamphlets (reprints) on cereals, pulses,
vegetables and fruit crops were distributed free to
visiting farmers. More than 36 farmers got farm advisory
services through letters/e-mails during the period.
6.3.9.4 Upgradation of crop cafeteria
ATIC’s Crop Cafeteria has been upgraded to high
intensity field crop based cropping system
demonstrations involving following sequence.
1. Wheat (November to April)- summer mung (April
to June) - rice (July to November)
The crop cafeteria at ATIC
124
2. Wheat (November to April)-green manuring (April
end to June) - rice (July to October)
3. Wheat (November to April)- green manuring
(April to June) - arhar (July to November End)
4. Wheat (November to April)- green manuring
(April to June) followed by bajra for forage (July to
September) followed by mustard (October to
March)
These live demonstrations included a mix of cereal,
pulse, oilseed, fodder and vegetable varieties. For
generating awareness about medicinal plants, small
plots of aloe vera, ashwagandha, satavar, coleus, giloe,
mushkdana, kalmegh, sadabahar, konch, mint, tulsi
(basil), lemon grass, Java citronella, etc. have been
developed. High density fruit trees orchard of lemon
(Kagzi Kalan), mango (Amrapali), guava (Lucknow
49, Allahabadi Safeda and Lalit), ber (Banarasi Karaka
and Gola) and aonla (NA -7, NA -10, Lakshmi 52,
Chakaiya)
Demonstration of Pusa Basmati
1 (Pusa 1460)
Demonstration of HD 2967
6.3.10 Krish Vigyan Kendra, Shikopur,
Gurgaon
6.3.10.1 Front line demonstrations
Under KVK scheme. During Rabi 2010-11 and Kharif
2011, 107 FLDs in 41.40 ha were conducted for
disseminating location-specific technologies in
oilseeds, pulses and cereal crops.
Sponsored front line demonstrations. During Rabi
2010-11, the KVK organized 22 demonstrations on

FLDs organized at the farmers’ field during 2010-11
Season Crop Varieties No. of Area Yield Increase
Demos (ha) (kg/ha) (%)
Rabi 2010-11 Demo Local
Mustard Pusa Vijay 47 20.00 2152 1935 11.21
(Krishna)
Gram Pusa 1103 07 2.00 1728 1625 6.34
(HC 1)
Barley BH 393 10 4.00 5256 4860 8.15
(PL 426)
Wheat HD 2894 05 2.00 5118 4660 7.52
(PBW 343)
HD 2851 05 2.00 5089 -do- 6.71
Total Rabi 74 30.00
Kharif 2011 Arhar Pusa 2001 10 4.00 1888 1795 5.18
(Manak)
Summer Moong SML 668 13 4.00 582 First time -
introduction
Paddy Pusa 1121 06 2.00 3734 3525 5.93
(PB 1)
Bhindi (Okra) Pusa A-4 03 1.20 7596 7213 5.31
(Local)
Bottle gourd P. Naveen 01 0.20 15700 14925 5.19
(Local)
Total Kharif 33 11.40
Grand Total 107 41.40
wheat and barley over an area of 13 ha sponsored by
the Directorate of Wheat Research (DWR), Karnal and
53 demonstrations on wheat, mustard, gram, paddy,
FLDs sponsored by Directorate of Wheat Research (DWR)
Season Crop Varieties No. of Area Yield Increase
Demos (ha) (kg/ha) (%)
125
Demo Local
Rabi 2010-11 Wheat DBW 17 09 5.00 4932 4660 3.60
(PBW 343)
Barley RD 2668 13 8.00 5184 4860 6.66
(PL 426)
Total 22 13.00
pearl millet and moong on 29.20 ha on farmers’ fields
under National Extension Programme.

FLDs sponsored under National Extension Programme
Season Crop Varieties No. of Area Yield Increase
Demos (ha) (kg/ha) (%)
126
Demo Local
Rabi 2010-11 Wheat HD 2851 02 0.80 5240 4760 10.08
(PBW 343)
HD 2932 02 0.80 5635 -do- 18.38
HD 2894 02 0.80 5401 -do- 13.46
Total 06 2.40
Mustard Pusa Vijay 13 5.20 2246 1935 16.07
(Krishna)
Pusa Jagannath 05 2.00 2178 -do- 12.35
Total 18 7.20
Gram BGD 72 01 0.40 1816 1625 11.70
(local)
Total Rabi 25 10.00
Kharif 2011 Paddy PB 1121 04 1.60 3565 3525 11.20
(PB 1)
PB 1401 02 0.80 3606 -do- 2.30
Total 06 2.40
Pearl millet HHB 197 09 6.80 3600 3170 13.50
( Pioneer)
PA 9444 05 4.80 3550 -do- 11.90
JK 26 05 4.00 3520 -do- 11.00
H 4201 01 0.40 3490 -do- 10.00
Total 20 16.00
Moong Pusa Vishal 02 0.80 823 — —
Total Kharif 28 19.20
Grand Total 53 29.20
Mustard (P Vijay) demonstration by KVK Demonstration of barley (BH 393) by KVK

6.3.10.2 Training programmes conducted for
different target groups
Several training programmes on diverse topics
were organized for various target groups to equip them
with skills and knowledge to enhance their incomes
and apprise farmers about developments in production
technologies. Vocational trainings for income
generation and employment enhancement were
organized in the areas of dress making, dairy
management, kitchen gardening, nursery
management, plant protection and pest control
services, vermicomposting, bee-keeping and value
addition and agro-processing. Discipline-wise,
programmes were organized in the disciplines of crop
production, dairy management, horticulture, plant
protection, post-harvest management and agricultural
engineering. Around 1028 participants attended the
Disseminating the technology for vermicomposting through
demonstration
Type of training with No. of No. of
target groups programmes beneficiaries
Male Female Total
Vocational trainings for
rural youth and girls 20 227 164 391
Day long on/off campus
trainings for farmers and
farm women 59 891 137 1028
In-service (refresher course) 07 137 — 137
trainings for field extension
functionaries
Total 86 1255 301 1556
127
various programmes organised. Refresher courses for
in-service candidates were organized in integrated
plant nutrient management, IPM, livestock production
and management, participatory rural management,
and first aid in animals. The beneficiaries of these
courses numbered 137. In addition to these, one
programme on “Skill Development in Horticulture”
was organized. This programme was sponsored by
Gramin Bank.
6.3.10.3 On-farm testing
Forty on-farm trials were conducted on different
field/farm based problems and two trials were
conducted on animal based problems. The OFTs were
conducted with the active participation of farmers and
recommendations were developed based on the
results.
Name of the On-Farm Testing Trial No. of
Trials
Rabi 2010-11
Management of pod borer in gram 03
Management of stem rot in mustard 04
Varietal evaluation in rabi crops 12
(mustard, barley and wheat)
Total 19
Kharif 2011
Varietal evaluation of arhar 04
Varietal evaluation of pearl millet 03
Leaf blight management in marigold 03
Effect of plant hormones on size & uniformity 03
of flowering and yield in African marigold
Effect of plant hormones to control fruit dropping 03
in young orchards of lemon
Varietal evaluation in kharif onion 03
Effect of different deworming drugs 01
on calf mortality (10 calves)
To test efficiency of mineral mixture on 01
reproductive performance in buffalo (10 buffalo)
Total 21
Grand Total 40

6.3.10.4 Agricultural extension activities and
farm advisory services
For dissemination of technologies among the
farming community, the KVK organized various
extension activities in the villages as well as at KVK
campus. Over 500 activities were organized. These
activities included field days, radio and television talks,
lectures by subject matter specialists, field visits by SMS
to farmers’ fields, exhibitions, soil and water testing,
special days to commemorate world food day, women
in agriculture, technology weeks, and farm advisory
services over telephone. KVK continued to publish a
quarterly newsletter in Hindi “Krishi Vigyan Patrika”,
which provides information on technological
developments and production related information to
farmers at their doorstep.
KVK observing Technology Week
6.3.11 Regional Station, Pusa, Bihar
Four frontline demonstrations were laid out in
Samastipur and Muzaffarpur districts of Bihar. The
Frontline demonstrations were conducted on the use
of bio-fertilizers, Azatobactor and PSB (1), zero tillage
(1) and new variety (2). With a view to popularize IARI
wheat varieties, among farmers, forty-nine
demonstrations of four timely sown wheat varieties
(HD 2733, HD 2824, K 307 and HP 1761) and four late
sown wheat varieties (HD 2985, WR 544, HI 1563 and
PBW 373) were laid out in five districts of Bihar. The
response of farmers was very encouraging. Among
timely sown varieties, HD 2824 and K 307 preformed
128
very well with average wheat yields ranging from 4.955
t/ha. Similarly among late sown varieties, HD 2985, WR
544 and PBW 373 performed well with average yields
around 4.4 t/ha. Twenty demonstrations of papaya cv.
Pusa Dwarf (20 plants each) were given to the farmers
of Samastipur, Muzaffarpur and Vaishali districts of
Bihar with a purpose of popularizing cultivation of
papaya and upscaling to commercial level.
6.3.12 Regional Station, Indore, Madhya
Pradesh
Forty-four FLDs of 11 recently released IARI wheat
varieties were conducted in 23 hectares in 11 villages
of tribal and backward regions of Dhar and Indore
districts of Madhya Pradesh. Average increase in grain
yield was 36% in these demonstrations. In addition to
this, under the NAIP Project on “Strategies to enhance
adaptive capacity to climate change in vulnerable
regions”, 268 demonstrations of 5 wheat varieties (HI
1500, HI 1531 and HI 1544 of bread wheat and HI 8627
and HI 8638 of durum wheat) were conducted in 60
hectares area, and 233 demonstartions of three gram
varieties (JG 11, JG 16, and JG 130) were conducted in
45 hectares area in tribal and backward regions of Dhar
district of Madhya Pradesh. Average yield increase for
wheat was 10%, while that in gram was 22 % in these
demonstrations.
Hon’ble Member of Parliament (Rajya Sabha) Dr. M.S.
Swaminathan delivering speech during Diamond Jubilee of IARI
Regional Station, Indore
The Station also celebrated it Diamond Jubilee on
March 24, 2012. On this occasion Dr. M.S. Swaminathan
delivered a speech laying emphasis on the need of

esearch in durum wheat as well as its extension to
minimize chances of rust epidemics and to reduce
prevalent malnutrition. An extension bulletin “Madhya
Bharat Main Malvi Gehoon Ki Kheti–Avasyakta Aur
Upyogita” and a technical bulletin”60 Years of Wheat
Research: IARI Regional Station, Indore” were released
on this occasion.
6.3.13 Regional Station, Katrain
Forty- two field demonstrations of different
vegetables were conducted on farmers’ fields and the
varieties showed 15 to 28 % higher yield over the check.
Exhibitions were conducted and technical information
on production of improved vegetables was
disseminated to farmers during the Kullu Dussehra
festival.
6.3.14 Regional Station, Karnal
Under the seed village programme, seed
production was undertaken on 16 ha area in Kharif 2011
(paddy cv 1121) and 16 ha area in Rabi 2011-12 (wheat
cv HD 2967) in three villages of Karnal district for
horizontal spread of seeds from farmer to farmer. In
addition to this, 15 training programmes were
organized on various aspects of quality seed
production. The aeas covered in the different training
programmes included seed agronomy, weed control,
disease and insect management, genetic purity,
129
harvesting and post harvest management. The target
group included resource poor farmers, especially farm
women, who actively participated in the programme.
6.3.15 Regional Station, Wellington
The Station conducted front line demonstrations
on 20 ha of land for successfully promoting wheat as
an alternate viable crop in Southern Hills Zone. The
varieties promoted are CoW(W) 1, HW 5207, CoW 2
and HD 2833. The adoption of this crop by the farmers
can be an important means of enhancing incomes of
resource poor farmers in non-traditional wheat
growing areas.
6.3.16 Regional Station, Shimla
A total of 8 front line demonstrations were
conducted by the Shimla Station in different villages
of Himachal Pradesh for popularizing newly released
rust resistant wheat and barley varieties among the
farmers. A farmers’ day was organized in February 2012
which was attended by 29 farmers from Mandi district.
A farmers-scientists interaction was held to discuss the
problems and prospects of wheat and barley cultivation
in the hills. Farmers took keen interest in wheat and
barley varieties developed at the Centre. They were
acquainted with wheat varieties developed at this
Centre, also suitable for cultivation in North-Eastern
region.

7. EMPOWERMENT OF WOMEN AND
MAINSTREAMING OF GENDER ISSUES
The contribution of rural women in the agricultural and allied sectors is significant. Even more significant is the
role that they play as managers of their homes. Various capacity building activities were taken up by the Institute
to equip women with the skills necessary to enhance their incomes and employment through increased
participation and efficient management of their work in agriculture. Trainings were also organised to create
greater awareness among women about home management and nutrition.
7.1 CAPACITY BUILDING OF SELF
HELP GROUPS FOR GENDER
EMPOWERMENT
Exposure visit of women SHG members from Nooh
(Mewat), Haryana was organized to sensitise them
about the latest agricultural technologies developed
at IARI for higher income and productivity. Literature
was provided to them on package of practices of
various crops. Linkage through toll free Pusa Agricom
was also introduced to them. Efforts were made to
link up SHG women given training for non-farm
enterprise establishment with the market which
included “skill test” and “selection” by an export
organization and linking up with the local markets
for purchase of raw materials and sale of finished
products.
130
Capacity building programmes for women
empowerment were also organized in village Badarpur
Said and Dhani Kumbhavas. Two trainings on post
harvest processing of seasonal vegetables, tomato,
cauliflower, carrot, and peas were organized in Badarpur
Said, in which 50 farm women participated. The trained
women farmers made an average of 10 kg of ketchup at
their household level. In village Dhani Kumbhavas,
training on disease management in milch animals,
nursery management of horticultural crops and one
month training on tailoring was conducted. About 100
farm women from all four villages participated in a
NABARD sponsored on campus training on value
addition in dry flowers in collaboration with Floriculture
and Landscaping Division, IARI.
The KVK, Shikopur took several initiatives targeted
towards the capacity building of rural farm women.
Name of activity No. of Activities No. of Beneficiaries
A Vocational trainings
• Dress designing & tailoring 01 50
• Dairy management 02 58
• Preservation of fruits & vegetables 01 18
• Post harvest technology of marigold flower 01 20
B Agriculture extension and farm advisory service
Total 05 146
• Celebration of women’s day as agriculture day 01 35
• Method demonstration 08 82
• Day long trainings in villages 08 153
• Women’s visit in agricultural fairs 03 180
Total 20 450
Grand Total 25 596

The important programmes and activities organized
for rural women during the period included
• Vocational training courses for self employment
and income generation.
• Trainings in villages for updating the farm
knowledge/skills.
• Method demonstration for skill development
• Visit of rural women in agriculture fairs and
exhibitions.
• Celebration of women’s day as agriculture day
Training programme in value addition for rural women
As shown in the table above, a total number of 25
activities were organized for rural women during the
period and through these activities 596 rural women
were benefited. Out of 596 participants, 12.5% belonged
to SC, 64% to OBC and 23.50 % to other categories.
Capacity building modules on Management
Development, Communication, Enterprise
Establishment and ICT applications, selected on the
basis of Training Needs Assessment of women SHGs
were designed. Appropriate training methods and
technologies were chosen for different types of learning
such as cognitive knowledge, development of
behavioural skills and development of awareness.
Modules included participatory methods, simulation
exercises, projective techniques, role play and case
analysis etc. which will result in improvement in the
knowledge (Cognitive Dimension), skill (psychomotor
Dimension) and awareness (affective dimension) of
SHG women. This in turn will result in enhancing the
effectiveness and sustainability of SHGs.
131
Vocational training for rural women on
dress designing and tailoring
7.2 IMPACT OF SHGs ON WOMEN
EMPOWERMENT
A SWOT analysis of data collected from 200 women
SHG members from Ganderbal (Jammu and Kashmir),
Chitrakoot (Madhya Pradesh), Patna (Bihar) Jhunjhunu
and Chittorgarh (Rajasthan), Kurukshetra, Ambala,
Jhajjar (Haryana) and Hapur (Uttar Pradesh) revealed
that besides increase in income as the major factor,
enrollment of critical mass of women SHG in the
village, formation of federation, involvement in
community action, access to regular schemes of the
government, networking and group affiliation were the
factors that most influenced the sustainability of SHGs.
The impact of SHG formation on empowerment
dimensions was perceived to be maximum for self
development followed by economic, social and political
empowerment.
Interaction with members of self-help groups

8. POST-GRADUATE EDUCATION AND
INFORMATION SYSTEM
The Indian Agricultural Research Institute is India’s largest and foremost Institute in the field of agricultural
research and higher education and training. A formal course leading to a two year diploma, ‘Associateship of
IARI’ in various fields of agriculture was started in 1923, which was awarded to 903 graduates up to 1957. The
P.G. School of IARI was accorded the status of a “Deemed University” in 1958 and has since been engaged in
providing high quality agricultural education at the post-graduate level in the country. Keeping the tradition of
the glorious past, the PG School endeavours to scale newer heights in agricultural research, education, and training
through upgradation of course curriculum and by adopting new methods of teaching.
8. POST-GRADUATE EDUCATION
8.1.1 Admission during the Academic
Session 2011-12
The Post Graduate School of IARI continues to
attract a large number of students seeking admission
to various PG courses in all five categories of
admission, viz., open competition, faculty upgradation,
ICAR in-service nominees, departmental
candidates and foreign students. The admissions to
the Ph.D. programme are made on the basis of
candidates’ performance in a national level entrance
examination conducted in different parts of the
country followed by an interview. While the
admissions to the M.Sc. programme are made on the
basis of an ‘All-India Entrance Test’ conducted by the
Education Division of the Indian Council of
Agricultural Research. The foreign students are
admitted through DARE, Ministry of Agriculture.
During the academic year 2011-12, two hundred sixty
one students were selected for admission to various
M.Sc. and Ph.D. courses as per details given below.
Category M.Sc. Ph.D. Total
Open Competition 108 138 246
Foreign Students 4 11 15
Total 112 149 261
132
8.1.2 Golden Jubilee Convocation of the
Institute
The Golden Jubilee Convocation of the P.G. School
of the Indian Agricultural Research Institute was held
on February 20, 2012. Hon’ble Prime Minister of India,
Dr. Manmohan Singh, was the Chief Guest. Hon’ble
Union Minister of Agriculture and Food Processing
Industries, Shri Sharad Pawar, presided over the
function. Hon’ble Union Minister of State for
Agriculture, Food Processing Industries and
Parliamentary Affairs, Shri Harish Rawat; Hon’ble
Ministers of State for Agriculture and Food Processing
Industries, Dr. Charan Das Mahant; Hon’ble Member
of Parliament (Rajya Sabha), Dr. M.S. Swaminathan;
Dr. S. Ayyappan, Secretary, Department of Agricultural
Research and Education (DARE) and Director-General,
Indian Council of Agricultural Research (ICAR) and
several other dignitaries graced the ceremony. Dr. H.S.
Gupta, Director, IARI in his welcome address
highlighted the salient achievements of the Institute.
In his Convocation Address, Dr. Manmohan Singh
appreciated the significant research and academic
contributions made by the Institute in the upliftment
of agriculture and rural India. While addressing a large
gathering of scientists/students/guests Dr. Singh said,
“We have adopted a multi-pronged strategy to improve
returns to farming and step up investment in rural
infrastructure. Our flagship programme Bharat Nirman

has focussed on increasing investment in rural roads,
rural electrification, irrigation, rural housing and rural
communications. We launched the Mahatma Gandhi
National Rural Employment Guarantee Programme
which is both a safety net for the poor and also a
powerful instrument for undertaking works that will
enhance land productivity. We launched the Rashtriya
Krishi Vikas Yojana and the Rainfed Areas
Development Programme. These policies have begun
to pay off and the country has reached new plateaus in
foodgrain production. Food production at the end of
the XI Plan will exceed 250 million tonnes, an all time
record.” He further stated, “It is estimated that we
would need an addition of nearly 50 million tonnes of
food grains in the next 10 years to meet domestic
demand. Increased production of foodgrains is
certainly an important plank of food security and our
efforts to rid the country of the scourge of malnutrition.
We would need to produce more fruits & vegetables
and protein rich products such as milk, eggs, fish and
meat.” The Prime Minister exhorted the agricultural
scientists and students to pursue a multi-pronged
strategy which seeks to boost productivity and
production through product-specific interventions.
A Ph.D. student receiving his degree certificate from
Dr. Manmohan Singh, Hon’ble Prime Minister of India at the
convocation. Also seen in the picture is Dr. H.S. Gupta, Director,
IARI (centre)
At the Golden Jubilee Convocation 202 candidates
(120 M.Sc. and 82 Ph.D.) including 18 international
students were awarded degrees. Mr. R. Thava Prakash
Pandian (M.Sc., Plant Pathology) and Dr. Shailendra
133
Kumar Jha (Ph.D., Genetics) received the “Best Student
of the Year Award”. Five students each in M.Sc. and
Ph.D. also received IARI Merit Medals.
The Degree of Doctor of Science (Honoris Causa)
was conferred on Dr. Manmohan Singh, for his
outstanding contributions acclaimed internationally in
the field of Economics. The degree was presented by
Shri Sharad Pawar.
Dr. Manmohan Singh, Hon’ble Prime Minister of India,
Government of India receiving the Degree of Doctor of Science
(Honoris Causa) from Shri Sharad Pawar, Hon’ble Union Minister
of Agriculture at the convocation
The first “Dr. A.B. Joshi Memorial Award” for the
biennium 2011-2012 consisting of a cash prize of
` 1,00,000/-, a medal and a citation was awarded to
Dr. R.S. Paroda, Chairman, Farmers’ Commission of
Haryana for his invaluable contributions in the field of
agricultural research and education. Dr. Pious Thomas,
Principal Scientist, IIHR, Bengaluru received the 12 th
“Shri Hari Krishna Shastri Memorial Award” for the
year 2011 for conducting very useful research on
molecular profiling, and marker assisted selection,
besides innovative research in endophytic
microbiology. Dr. Subhash Chandra, Principal Scientist,
Division of Entomology, IARI received the 17 th
“Sukumar Basu Memorial Award” for his excellent
research contributions in developing a decision support
system to facilitate simulation of growth and yield of
annual crops, and Dr. R.N. Padaria, Principal Scientist,
Division of Agricultural Extension was given the “Best
Teacher Award” for his achievements in academics
during 2011.

On this special ceremony, the Chairman of
the Session, Hon’ble Union Minister of Agriculture
Shri Sharad Pawar also released 10 varieties of different
crops developed by the Institute.
Dr. R.S. Paroda, Chairman, Farmers’ Commission of Haryana
receiving the first Dr. A.B. Joshi Memorial Award from
Dr. Manmohan Singh
The 42 nd Lal Bahadur Shastri Memorial Lecture was
delivered by Dr. M.C. Saxena, Senior Advisor to the
Director-General, ICARDA on February 18, 2012 on the
topic “Harnessing the Potential of Dry Areas for
Ensuring Food Security”. Dr. J.S. Samra, CEO, National
Rainfed Area Authority, Govt. of India presided over
the function. In his very informative lecture, Dr. Saxena
Dr. M.C. Saxena, Senior Advisor to the Director General, ICARDA
(seated 2nd from right) delivered the 42 nd Lal Bahadur Shastri
Memorial Lecture, Dr.J.S. Samra,CEO, National Rainfed Area
Authority, Dr. H.S. Gupta, Director & Dr.H. S. Gaur, Dean are also
seen in the picture
134
emphasized that agriculture was expected to feed some
8.3 billion people by 2030 and over 83% of those would
be from developing countries. He further mentioned
that by 2030, 60% more food would be needed and food
security continues to be the major challenge of the
international community. Dr. Saxena proposed that
with available infrastructure for ARD and support for
S&T innovations, urgent policy actions were needed
to usher-in and sustain Green Revolution in the dry
areas.The Chairman, Dr. J.S. Samra concluded with the
remarks that major changes in our organizational
structure, functioning and infrastructure would be
required to face the emerging challenges.
A national conference on “Shaping Human
Resource for Global Competitiveness” and Global
Alumni Meet were organized on February 18, 2012 at
Dr.B.P. Pal Auditorium, to intro-spect the performance
of agriculture graduates in different fields, assess the
present needs and draw the future road map to meet
the global challenges in agriculture. The conference was
inaugurated by Hon’ble Minister of State for Agriculture,
Food Processing Industries and Parliamentary Affairs,
Shri Harish Rawat. Prof. V. L. Chopra, former Member,
Planning Commission, Dr. S. Ayyappan, Secretary,
DARE & DG, ICAR, Dr. S. L. Mehta, former VC,
MPUA&T, Udaipur, Dr. H.S. Gupta, Director, IARI,
Dr. H. S. Gaur, Dean and Joint Director (Education), IARI
and Dr. N.K. Dadlani, Director, National Seed
Association of India graced the function.The
deliberations were held on two themes,viz., (i) IARI
education in the global context: Striving for excelleence,
and (ii) Agricultural research to meet global food security
needs. The conference was attended by nearly 600 IARI
alumni from India and abroad.
8.1.3 National Education Day Lecture
The Institute observed the National Education Day
on November 21, 2011. On this occasion, Dr. R.S.
Paroda, Chairman, Trust for Advancement of
Agricultural Research (TAAS), New Delhi, who was
the chief guest, delivered a lecture on “Higher
Agricultural Education System in India”. Dr. H.S. Gaur,
Dean & Joint Director (Education), IARI delivered the
welcome address and highlighted the significance of
the National Education Day. Dr. H.S. Gupta, Director,
IARI, presided over the function.

In his lecture, Dr. Paroda emphasized the need for
a different breed of teachers besides training at all levels
for maintaining quality in education and ensuring
sustainable agricultural development. He exhorted the
young scientists to engage in research that solves the
problems of farmers. Dr. Malavika Dadlani, Joint
Director (Research), IARI proposed a vote of thanks.
Dr. R.S. Paroda, Chairman, TAAS (extreme right) and Dr. H.S.
Gupta, Director, IARI lighting a lamp at the inaugural function of
the National Education Day
8.1.4 Dr. B.P. Pal Memorial Lecture
The 18 th Dr. B.P. Pal Memorial Lecture was
delivered by Dr. Yoginder K. Alagh, Chairman, Institute
of Rural Management, Anand on May 28, 2011 on the
topic ‘The Future of Indian Agriculture’. In his lecture,
Dr. Alagh suggested that the research systems will have
to concentrate on a much larger cafeteria of crops and
support to non-crop agriculture, including animal
husbandry, fish and forests. The function was chaired
by Hon’ble Member of Parliament (Rajya Sabha) and
Chairman, M.S. Swaminathan Research Foundation,
Chennai, Dr.M.S. Swaminathan.
8.1.5 Institution Building in Other Countries
A delegation led by Hon’ble Member of Parliament
(Rajya Sabha) and Chairman, M.S. Swaminathan Research
Foundation, Chennai, Professor M.S. Swaminathan
including Dr. H.S. Gupta, Director, IARI visited Myanmar
in July, 2011. The delegation observed the acute need to
strengthen the agricultural research, education and
extension in Myanmar and suggested to establish an
Advanced Centre for Agricultural Research and
135
Education (ACARE) at Yezin. Later, a team led by Dr.
H.S.Gaur, Dean & Joint Directors (Education) including
Drs. R.K. Pal, Head, Division of Post Harvest Technology,
Jitendra Kumar, pulse breeder, A.K. Singh, rice breeder,
and R. Roy Burman, Senior Scientist, Agricultural
Extension visited the Yezin Agricultural University (YAU)
and the Department of Agricultural Research (DAR),
Yezin. The team had discussions with Hon’ble Rector,
YAU and DG, DAR, and senior faculty members, visited
the various departments, laboratories, research farms and
prepared a detailed project report for the establishment
of ACARE for strengthening research on improvement
of rice and pulses, post harvest technology, participatory
knowledge management and human resource
development aimed at improving the income, living,
nutritional and working conditions of the farmers and
the people of Myanmar. The team also discussed the draft
with His Excellency Dr. V.S. Seshadri, Ambassador of
India to Myanmar, who appreciated the efforts made.
The IARI has also been invited to establish
Universities of Agricultural Sciences in Afghanistan
and Africa.
8.1.6 Modernization of PG Laboratories and
Lecture halls
Modernisation of PG laboratories and lecture halls
was undertaken under the scheme for strengthening of
PG education programme at deemed university. Teaching
facilities were modernized in a number of Divisions by
adding audio-visuals, LCD projectors, multi-media
systems, interactive boards, etc. Some of the PG
laboratories and lecture halls were renovated and
refurnished. Equipments were repaired/procured,
computer facilities improved and text books procured in
the main Library as well as divisional libraries. Laboratory
manuals were prepared in teaching disciplines.
8.1.7 Training Programmes
The Institute organized several national and
international short-term training courses (regular, ad
hoc and individual) and refresher courses in specialized
areas for the scientists of National Agricultural
Research System (NARS) under the programmes like
“Centres of Excellence” and “Centres of Advanced
Studies”. Some special training courses were also
organized for the benefit of professionals, farmers and
extension workers.

Important training programmes organized
Topic/Name of the training course Date No. of trainees
Division of Agricultural Chemicals
Naturally Occurring Nutraceuticals, Crop Protectants and other Biomolecules for January 23 to 22
Application in Human and Crop Health February 2, 2012
Health Benefitting Phytoceuticals from Vegetables, Fruits and Non-food Crops March 21-23, 2012 11
Division of Agricultural Economics
Quantitative Methods for Agricultural Policy Research October 17-22, 2011 18
Agricultural Growth, Diversification and Food Security November 15 to 13
December 5, 2011
Division of Agricultural Engineering
Protected Cultivation of Horticultural Crops for Farmers June 14-17, 2011 25
Project Formulation, Risk Assessment, Scientific Report Writing and Presentation September 26-30, 2011 18
Training for Rural Youth/Farmers and Technical Staff on Dal Milling and November 23-29, 2011 10
Oil Expelling Operations
Division of Agricultural Extension
Enhancing Motivation for High Job Performance November 30 to 26
December 2, 2011
Innovative Communication Interventions for Sustainable Agricultural Development January 18 to 25
February 7, 2012
Vegetable Seed Production January 20, 2012 30
Technology and Value Addition of Baby Corn March 20-21, 2012 100
Enhancing the Adoption of Pulse Production Technologies March 21, 2012 100
(Village -Jasaur Kheri, Jhajhar, Haryana)
Enhancing the Adoption of Pulse Production Technologies March 23, 2012 60
(Village-Padmada Khurd, Alwar, Rajasthan)
Protection of Plant Variety and Farmers’ Rights at Badarpur Said, Faridabad, Haryana March 30, 2012 120
Division of Agricultural Physics
EDUSAT Based Off-campus Training Programme on Remote sensing, GIS and GPS August 1 to October 28, 2011 46
Hyperspectral Remote Sensing for Agriculture August 2-11, 2011 20
EDUSAT Based Off - campus Advance Training Programme on February 13 to 40
Hyperspectral Remote Sensing, GIS and GPS March 30, 2012
Division of Biochemistry
Current Techniques & Protocols under the aegis of the December 8-28, 2011 20
ICAR Centre of Advanced Faculty Training (CAFT)
Division of Microbiology
Entrepreneurship Development Program on Biofertilizers and Compost Inoculant January 23-28, 2012 2
136

Topic/Name of the training course Date No. of trainees
Division of Floriculture and Landscaping
Value Addition and Dry Flower Product Making for Sustainable Livelihood for March 12-14, 2012 20
Farm Women at Dhani Kumbhavaas village, Gurgaon district
Value Addition and Dry Flower Product Making for Sustainable Livelihood for March 16-18, 2012 20
Farm Women at Badarpur Saed village, Faridabad district
Value Addition and Dry Flower Product Making for Sustainable Livelihood for March 21-23, 2012 20
farm women of Rajpur village, Sonepat district
Division of Nematology
Nematode Problems in Field and Horticultural Crops and their Management November 3-10, 2011 22
Division of Plant Pathology
Mushroom Cultivation September 20-26, 2011 47
Monitoring and Forecasting of Plant Disease Epidemics under Climate Change Scenario October 10 to 22
November 1, 2011
Division of Post Harvest Technology
Pre- and Post-harvest Management of Horticultural Produce for Export March 13-17, 2012 15
Division of Seed Science and Technology
Seed Quality Assurance November 22-26, 2011 15
International training on “Seed Production and Quality Evaluation” October 17-29, 2011 7
organized for officials of AARDO member countries
Quality Seed Production March 15-17, 2012 25
Seed Production of Field Crops March 28, 2012 30
Division of Soil Science and Agricultural Chemistry
Soil Testing, Plant Analysis and Water Quality Assessment September 6-26, 2011 19
Water Technology Centre
Enhancing Water Productivity in Agriculture for Livelihood through 24 trainings of 1200
Training and Demonstration: Training of Trainers and Farmers 7- day each
Sensor Based Application for Enhancing Water Use Efficiency for February 14-27, 2012 13
Wireless Irrigation and Fertigation Control
Micro Irrigation and Plasticulture Applications under PFDC 28 trainings 1856
of one-day each
Centre for Protected Cultivation Technology (CPCT)
Greenhouse Technology for Horticulture Crops May 3-6, 2011 30
Greenhouse Technology for Horticulture Crops May 7-10, 2011 30
Protected Cultivation of High Value Vegetables and Cut Flowers June 19, 2011 150
Training of Horticulture officers IFFCO Foundation June 14-17, 2011 13
Regional Station, Karnal
Beej Phaslon Ka Sasya Prabandh March 15-16, 2012 25
137

Topic/Name of the training course Date No. of trainees
Beej Utpadan Parshikshan March 23, 2012 20
Regional Station, Pusa (Bihar)
Quality Seed Production March 1-3, 2012 35
Hybrid Seed Production March 28, 2012 100
Management of Soil Carbon and Water Management in Agriculture August 25, 2011 25
Modern Agriculture and Nursery Management December 24-30, 2011 24
Vocational Training Courses
ATIC
Krishi Vigyan Kendra, Shikohpur, Gurgaon (Haryana)
Vermi-compost Technology September 5-15, 2011 50
November 19-30, 2011
January 16-24, 2012
Commercial Dairy Farming May 20-31, 2011 110
June 3-13, 2011
September 12-22, 2011
Dress Designing and Tailoring May 23 to July 6, 2011 50
Nursery Management of Fruits, Vegetables and Flowers August 30 to 30
September 7, 2011
September 19-26, 2011
October 10-18, 2011
Bee Keeping September 20-30, 2011 37
November 8-16, 2011
Preservation of Seasonal Fruits and Vegetables January 17-23, 2012 18
Kitchen Gardening May 26 to June 2, 2011 22
September 27 to
October 4, 2011
Plant Protection and Pest Control Services August 1-11, 2011 25
January 27 to
February 4, 2012
Motor Winding September 21-30, 2011 9
Agro-Processing January 11-12, 2012 20
Post-Harvest Technology for Marigold Flowers March 12-14, 2012 20
In-service trainings for field extension functionaries
Integrated Plant Nutrient Management May 27, 2011 47
November 25, 2011
Integrated Pest Management June 10, 2011 44
September 16, 2011
Livestock Production & Management December 6, 2011 15
Participatory Rural Appraisal (PRA) January 20, 2012 21
138

Topic/Name of the training course Date No. of trainees
First aid in Animals (For VLDAs) March 16, 2012 10
Directorate
Effective Office Management of RTI (conducted by National Productivity Council, Munnar) May 9-13, 2011 1
Capacity Building of Administrative Personnel of S&T Department , Govt. of India June 6-24, 2011 3
September 12-30, 2011
Orientation Programme for ARS Trainees January 11-25, 2012 9
Bioinformatics Applications in Agricultural Sciences December 21-23, 2011 20
8.2 INFORMATION AND DATABASE
8.2.1 Bioinformatics
8.2.1.1 Wheat informatics
Contents in the wheat portal was updated.
Developed SNP Prédictions Tool, called ‘SNPredictor’,
which predicts, all potential SNP’s (Single Nucleotide
Polymorphs) for a given EST data. These are helpful in
predicting the causes of mutation in the organisms and
can also be used to predict the potential contigs.
8.2.2 Agri-informatics
8.2.2.1 Consortium for e-Resources in
Agriculture (CeRA)
Nearly 1776 on line journals are available for full
text from nine publishers in addition to nearly 1120
journals abstracts. Photocopies provided (18,512 pages)
against 5314 articles from the holding of the library.
Two hundred and fifty two articles were received from
different institutes and delivered to concerned students
and faculty. A new website for CeRA was developed
(URL: http://cera.iari.res.in). Under CeRA, ten
awareness cum monitoring workshops covering 12
institutions under NARS were organized. During 2011-
12, more than 5000 reprints of articles from journals
were distributed to CeRA members in NARS.
8.2.2.2 Rice Knowledge Management Portal
(RKMP)
The RKMP portal of IARI was updated. ‘SMS
KRISHI’ facility introduced by IARI to facilitate SMS
service to the farmers to address their farm-related
queries. This service was provided to all registered users.
USI
139
8.2.3 e-Granth: Strengthening of Digital
Library and Information Management under
NARS
As a subcomponent of ICDS of component – I of
NAIP, e-Granth was started from May 2009 with 12
Libraries of ICAR Institutes and SAU’s as consortia
partners and IARI as the lead center. Under the project
7,531 new books and old unresolved records were
added in worldCat through Connextion Software of
Online Computer Library Center (OCLC). Nearly
62,184 publications are accessible in worldcat
(catalogue of 71,000 libraries of the world) which are
available in IARI Library. About 50 lakh pages of rare
books, journals and IARI publications were selected
for digitization and 17,35,394 pages were scanned
during reported period.
8.2.4 Software Development: Leveraging
Technology System 1.0 and Asset
Management System 1.0
The Leveraging Technology online system was
developed for submission of monthly reports to the
council on “Leveraging Technology”, which covered
all Sections, Units, Divisions, Project Directorates and
Regional Stations of IARI. The online Asset
Management system was also developed with a view
to keep a track of assets in every division/unit of IARI.
These systems were developed using open source
platform and hosted on a Linux server. The front end
was coded in PHP and the backend was managed with
MySQL. The web application was designed to work
on all browsers.

8.3 LIBRARY SERVICES
IARI Library is one of the largest and the finest
agro- biological libraries in South East Asia housing a
large collection of publications including books/
monographs, journals, reports, bulletins, post graduate
theses and other reference materials. The Library
functions as the depository of Food and Agricultural
Organization (FAO), and Consultative Group of
International Agricultural Research (CGIAR) institutes’
publications. Several training programme/demos and
tests were conducted during the reported period on
the aspects of RFID based automation, asset register of
institute, DSpace software, CD ROM databases,
Networking, etc.
8.3.1 Acquisition Programme
8.3.1.1 Books
During the period of report, the Library procured
747 publications which include 295 in Hindi and 452
in English costing ` 31,69,044. The Library also acquired
64 gift publications and 202 PG Students’ theses from
IARI and 3 RFT theses.
8.3.1.2 Serials
The Library procured 806 journals/serials through
subscription, gifts and exchanges. It subscribed to 158
foreign journals (out of which 17 online access) and
342 Indian journals, advances, and annual reviews.
Exchange relationship was maintained with 67
institutions globally and nationally. One hundred
eighty five annual scientific/ technical reports of
different institutions and 92 bulletins were received in
the Library during the reported period. The
expenditure on serial acquisition from plan and PG
strengthening scheme was `1,65,64,082.
8.3.2 Documentation Activities
8.3.2.1 AGRIS project
The IARI Library is declared as an input center for
National Agricultural Research Database (NARD)
under AGRIS Project. The Library is assigned the job
of scanning articles from 10 Indian journals. The input
was done in ISO format using AGRIN methodology.
During the reported period, 209 articles were scanned,
processed and sent to Directorate of Knowledge
140
Management in Agriculture, ICAR for inclusion in
AGRIS Index.
8.3.2.2 Development news in agriculture
Four thousand four hundred ninety-eight issues
of 14 newspapers were scanned and 92 news items
pertaining to IARI as well as ICAR were sent to the
Directorate, Principal Scientist (PME) and CATAT.
8.3.2.3 Document processing
In all, 724 documents consisting of 683 books and
41 bulletins were processed (classifying and
cataloguing).
8.3.3 Resource Management
8.3.3.1 Binding of publications
In all, 900 volumes consisting of 3,600 loose issues
of journals, reports and bulletins were bound and 9,600
volumes accessioned.
8.3.3.2 Reference, circulation and stack
maintenance
Apart from approximately 2000 registered
members, the Library served everyday approximately
125 to 130 users, who consulted approximately 1500 to
2000 documents. During the period under report,
38,270 publications were issued to its members. In all,
55 documents were issued under Inter Library Loan
System to various institutions.
8.3.4 Services
8.3.4.1 Reprography services
During the period, over 9400 photocopies were
provided to scientific and technical staff from the
holdings of the Library.
8.3.4.2 CD-Rom workstation
Three prominent international databases on
agricultural aspects were subscribed to provide CD-
ROM services. Ten user terminals were provided to
users in CD-ROM workstation of the library. These
databases are accessible to scientists/students/users
through LAN. In all, 34,705 references were
downloaded by the scientists and students of IARI and
research scholars from all over India. Twenty thousand
one hundred eighty five references were downloaded
on payment basis, generating a revenue of ` 37,335.

9. PUBLICATIONS
An important mandate of the Institute is to generate scientific information, add value to information and
share the information nationally and internationally. Publications are an integral component of the information
system. During the reported period, the Institute brought out quality publications in the form of research papers
in peer reviewed journals, books/ book chapters, popular articles, etc. both in English and Hindi. Apart from
these publications, the Institute brought out several regular and ad hoc publications both in English and Hindi.
The details of these publications are given below:
9.1 RESEARCH/SYMPOSIA PAPERS
a) Research papers published in international
journals
268
b) Research papers published in national
journals
368
c) Symposia/conference papers 609
9.2 BOOKS/CHAPTERS IN BOOKS
a) Books 32
b) Chapters in Books 269
9.3 POPULAR ARTICLES 250
9.4 IN HOUSE PUBLICATIONS
9.4.1 Regular Publications (English)
● IARI Annual Report 2010-2011 (ISSN: 0972-6136)
● IARI NEWS (Quarterly (ISSN: 0972-6144)-4 issues
● IARI Current Events (Monthly)-12 issues
(Available on IARI website)
9.4.2 Ad hoc Publications (English)
● Wheat Pathology in the Indian Context (ISBN 978-
81-88708-69-7)
● Catalogue of Fungal Specimens in Herbarium
Cryptogamae Indiae Orientalis (HCIO) (ISBN 978-
81-88708-71-0)
● PG School Publications (ISBN 978-81-88708-72-7)
● Agriculture for Inclusive Growth (ISBN 978-81-
88708-73-4)
141
● Rice Breeding and Genetics Research Centre-A
Story of Success (ISBN 978-81-88708-74-1)
● Advances in Rootstocks for overcoming Biotic and
Abiotic Stresses in Fruit Crops (ISBN 978-81-88708-
75-8)
● A Practical Manual on Plant Bacteriology (ISBN
978-81-88708-77-2)
● Plant Variety Protection in Ornamental Crops
(ISBN 978-81-88708-78-9)
● Practical Manual on Soil Physical Measurements
(ISBN 978-81-88708-79-6)
● A Practical Manual on Biocontrol of Plant Diseases
(ISBN 978-81-88708-80-2)
● Climate Change Impact, Adaptation and Mitigation
in Agriculture: Methodology for Assessment and
Application (ISBN 978-81-88708-82-6)
● Low Carbon Options in Rice and Wheat
Production Systems: Potentials and Problems
(ISBN 978-81-88708-83-3)
● Practical Manual on Remote Sensing, Data
Processing, GIS and GPS (ISBN 978-81-88708-84-0)
● Practical Manual on Value Addition in Ornamental
Crops (ISBN 978-81-88708-85-7)
● Technological Options for Enhanced Productivity
and Profit (ISBN 978-81-88708-86-4)
● Hyperspectral Remote Sensing for Agriculture
(ISBN 978-81-88708-87-1)
● Systematics of the genus Siddiqia (Nematoda:
Longidoroidea) (TB-ICN: 83/2011)

● Greenhouse Cucumber Production and Protection
(TB-ICN: 84/2011)
● Remote Sensing for Enhancing Imput Use
Efficiency (TB-ICN:85/2011)
● Value-addition of Wheat through Genetic
Approaches and its Scope in India (TB-ICN: 86/
2011)
● Groundwater Pollution Status of Intensively
Cropped IARI Farm, New Delhi (TB-ICN: 87/2011)
● Decision Support System in Water Resources
Management - A Review (TB-ICN: 88/2011)
● Seed Production Technology of Brinjal (TB-ICN:
89/2011)
● Root-knot Nematode Meloidogyne graminicola:
A Key Nematode Pest of Rice (TB-ICN: 90/2012)
● Diversified Agriculture (TB-ICN: 91/2012)
● 60 Years of Wheat Research: IARI-Regional Station,
Indore (TB-ICN: 92/2012)
9.4.3 fu;fer çdk’ku ¼fgUnh½
◆ iwlk lqjfHk ¼okf"kZd½ (ICN : H-98/2010)
◆ iwlk lekpkj ¼=Sekfld½ (ISSN 0972-7280)
◆ izlkj nwr ¼=Sekfld½
◆ lkef;dh ¼ekfld½ ¼dsoy laLFkku dh osCklkbV ij miyC/k½
9.4.4 rnFkZ çdk’ku ¼fgUnh½
◆ ltkoVh Qlyksa esa ikS/kk fdLeksa dk laj{k.k % orZeku Lrj
(ISBN 978-81-88708-70-3)
142
◆ xq.koŸkk ;qDr cht mRiknu] iSdsftax ,oa HkaMkj.k (ISBN 978-
81-88708-76-5)
◆ mPp mRiknu ,oa vk; gsrq mUur Ñf"k izkS|ksfxfd;ka (ISBN
978-81-88708-81-9)
◆ jch Qlyksa dh mUur [ksrh (ICN : H-104 /2011)
◆ Qy ,oa Qwyksa dh [ksrh (ICN : H-105 /2011)
◆ Hkkjrh; Ñf"k vuqla/kku laLFkku {ks=h; dsUnz dVjkb± }kjk fodflr
fofHkUu lfCt;ksa dh fdLesa (ICN : H-107 /2011)
◆ eDdk dk iqVhdkjh lw=Ñfe gsVsjksMsjk th & eDdk dk izeq[k
lw=Ñfe ihM+d ,oa mldk izca/ku (ICN : H-108 /2012)
◆ [kjhQ Qlyksa dh [ksrh (ICN : H-109 /2012)
◆ lCth Qly mRiknu dh rduhfd;ka (ICN : H-110 /2012)
◆ ladj /kku cht mRiknu rduhd (ICN : H-111 /2012)
◆ Qyksa ,oa lfCt;ksa ds ewY;o/kZu dh ljy rduhdsa (ICN : H-
112 /2012)
◆ xsgwa esa eq[; [kjirokjksa dk izca/ku (ICN : H-113 /2012)
◆ cht Qlyksa ds lL; izca/k (ICN : H-114 /2012)
◆ e/; Hkkjr esa ekyoh xsgwa dh [ksrh % vko’;drk ,oa mi;ksfxrk
(ICN : H-115 /2012)
◆ tSfod [ksrh dh vksj c

10. COMMERCIALIZATION AND IPR ACTIVITIES
The mandate of the Institute Technology Management Unit (ITMU) relates to registration of patents, facilitation
of contract research projects and consultancies by the Institute scientists, intellectual property rights, and interaction
with the agri-business industry. During the period, the ITMU has organised following activities:
10.1 INTELLECTUAL PROPERTY
RIGHTS
A. Patents Filed
1. Samfungin: A novel fungicide and the process for
making the same (Dr. Madhuban Gopal & Others,
Division of Agricultural Chemicals).
2. Development of substituted alkene as a potential
nematicide (Dr. Madhuban Gopal & Others,
Division of Agricultural Chemicals).
3. Nanoencapsulated Hexaconazole: A novel
fungicide and the process for making the same (Dr.
Madhuban Gopal, Division of Agricultural
Chemicals).
4. Pigeonpea Pod Stripper (Dr. Jagnnath Prasad
Sinha, Division of Agricultural Engineering).
5. Digital Soil Test Fertilizer Recommendation (STFR)
Meter (Dr. Samar Chandra Datta, Division of Soil
Science & Agricultural Chemistry).
6. Development of slow release nano formulations
of bioactive molecules and method of preparation
thereof (Dr. N. A. Shakil, Senior Scientist, Division
of Agricultural Chemicals).
7. A product and process for the decontamination of
pesticide residues from vegetables by using safe
reagent (Dr. Madhuban Gopal, Division of
Agricultural Chemicals).
8. Production of cocktail polyclonal antibodies for
broad spectrum ELISA based diagnosis of
potyviruses and cucumoviruses using fusion
construct derived from coat protein gene sequences
from Papaya ringspot and Cucumber mosaic virus
(Dr. Bikash Mandal, Division of Plant Pathology).
143
9. Nanocopper-a copper based formulation to
combat bacterial blight of pomegranate, rice and
bean (Dr. Kalyan K. Mondal, Division of Plant
Pathology).
B. Patents Renewed
1. A process for the preparation of Mosquito
Larvicidal Formulations based on Rabdosia
Melissoides Ingredients (Dr. B.S.Parmar & Dr. Lalit
Kumar, Division of Agricultural Chemicals).
2. Additives for improved photostability of
Azadirachtin-A (Dr. Prem Dureja & Others,
Division of Agricultural Chemicals).
3. Process for the preparation of Pesticidal Oxime
Esters (Dr. Suresh Walia and Dr. B.S. Parmar,
Division of Agricultural Chemicals).
4. Process for the preparation of Mono/Di/Polyol
Ester Pesticides (Dr. Suresh Walia & Others,
Division of Agricultural Chemicals).
5. A hyper-spectral data analyzing method for
characterization and discrimination of natural/
man-made resources from air borne platforms
(Dr. Ravinder Kaur, Division of Environmental
Sciences).
6. Efficient process for the preparation of Neem based
Reduced Azadirachtin(s) Pesticides (Dr. Suresh
Walia & Others, Division of Agricultural
Chemicals).
7. Synthetic gene encoding Cry 1 Fa 1�-endotoxin of
Bacillus thuringiensis (Dr. P. Ananda Kumar,
NRCPB).
8. Synthetic gene encoding a chimeric ä-endotoxin of
Bacillus thuringiensis (Dr. P. Ananda Kumar,
NRCPB).

9. Biopesticidal formulation with improved shelf life
and the process of preparation (Dr. Prem Dureja
and others, Division of Agricultural Chemicals).
10. Novel superabsorbent hydrogel/s and the method
of obtaining the same (Dr. Anupama, Division of
Agricultural Chemicals).
D. Varieties Protected Under PPV&FRA
144
C. Patent Granted
Novel superabsorbent hydrogel/s and the method
of obtaining the same (Patent No. 250349) granted on
28.12.2011.
Sl. Variety Name Type of Date of Principal
No. Variety Filing Inventor
1. Wheat HD 2985 (Pusa Basant) New 1.6.2011 Dr. G. P. Singh
Division of Genetics
2. Wheat HD 2987(Pusa Bahar) New 1.6.2011 Dr. G. P. Singh
Division of Genetics
3. Wheat HD 2967 New 1.6.2011 Dr. R. K. Sharma
Division of Genetics
4. Cabbage Pusa Ageti Extant 1.6.2011 Dr. Pritam Kalia
Division of Vegetable Science
5. Cauliflower Pusa Meghna Extant 1.6.2011 Dr. Pritam Kalia
Division of Vegetable Science
6. Brinjal Pusa Ankur Extant 1.6.2011 Dr. Ravinder Kumar,
Division of Vegetable Science
7. Cauliflower Pusa Sharad Extant 13.6.2011 Dr. Pritam Kalia
Division of Vegetable Science
8. Brinjal Pusa Bindu Extant 13.6.2011 Dr. Pritam Kalia
Division of Vegetable Science
9. Bread Wheat HI 1563 Pusa Prachi New 25.7.2011 Dr. A. N. Mishra
IARI Regional Station, Indore
10. Tomato Pusa Sadabahar Extant 27.7.2011 Dr. Pritam Kalia
Division of Vegetable Science
11. Tomato Pusa Rohini Extant 27.7.2011 Dr. Pritam Kalia
Division of Vegetable Science
12. Chrysanthemum Pusa Anmol Extant 27.7.2011 Dr. K. V. Prasad
Division of Floriculture & Landscaping
13. Chrysanthemum Pusa Centenary Extant 27.7.2011 Dr. K. V. Prasad
Division of Floriculture & Landscaping

E. Copyrights Filed
1. ResourCeS - A Regional Resource Characterizing
System (Dr. Ravinder Kaur, Division of
Environmental Sciences).
2. USAR- An EIA Tool for managing salt affected
agricultural lands and irrigation waters (Division
of Environmental Sciences).
Memorandum of understanding signed
145
10.2 TECHNOLOGY
COMMERCIALIZED
A. Memorandum of Understanding Signed
Seventeen memorandum of understanding (MoUs)
signed during the year under report with fifty-one
private partners generating a revenue of ` 49.70 Lakh.
Sl. No Technologies Licensee Companies Date of MoU
1. Liquid Biofertilizer M/s Sai Bio Organics, Punjab 30.3.2012
2. Neutraceuticals and Functional Foods M/s Ozone Biotech, Faridabad 3.3.2012
3. PCR based detection Kit for bacterial blight of Ostwal & Harit, Malegaon 2.2.2012
pomegranate
4. Candy from Fruits (Aonla, Mango, Carrot) M/s Gold Win Agro Foods Pvt Ltd, New Delhi 29.2.2012
5. Chrysanthemum Variety Pusa Anmol M/s Leadbeter Seeds, Bangalore 1.2.2012
6. Pusa Bajra Puff M/s Agro Tech Foods Limited, Gurgaon 12.1.2012
7. Maize-PEEHM 5 M/s Goutami Seeds Pvt. Ltd., Kurnool 17.11.2011
M/s Sampoorna Seeds 15.11.2011
M/s Sri Laxmi Venkateshwara Seeds, Kurnool 8.11.2011
M/s Muralidhar Seeds Corporation 8.11.2011
M/s Victory Seeds Ltd, Kurnool, AP 20.7.2011
8. Wheat Variety HD 2967 M/s ID Agri Seeds Pvt. Ltd., Delhi 9.9.2011
M/s Akash Seeds & Co. 30.9.2011
M/s Amar Seeds, Punjab 5.10.2011
M/s Amar Seeds, Punjab 21.10.2011
M/s Asian Seeds, Karnal 24.10.2011
M/s Aujla Seeds, Machhiwara
M/s Bhagati Seed Farm, Punjab
M/s Bhatinda Seed Farm, Bhatinda, Punjab
M/s Bhatti Agri Seeds, Sirsa, Haryana
M/s Bhawani Seeds & Biotech
M/s Dhaliwal Seed Farm
M/s Dhaliwal Seed Pvt. Ltd., Kurukshetra
M/s Hans Moderan Agri. Seeds, Karnal
M/s Harbir Agrotech
M/s Haryana Seeds Co., Haryana
M/s Hygiene Kamboj Seed Farm, Punjab
M/s Japreet Singh Gill
M/s Kamboj Export
M/s Kurukshetra Seeds Pvt Ltd, Haryana
M/s Mehla Seed Farm, Karnal, Haryana
M/s Model Agritech India Ltd.
M/s Navodaya Seed Farm
M/s Nirankari Agri Seeds
M/S Parbhat Seed Traders, Kurukshetra

Sl. No Technologies Licensee Companies Date of MoU
M/s Punjab Beej
M/s Sahil Seeds, Ludhiana, Punjab
M/s Sahu Seed Farm
M/s San Seed Farm, Moga, Punjab
M/s Sandeep Seeds, Ludhiana
M/s Sandeep Seeds, Ludhiana, Punjab
M/s Sandhu Seed Farm, Sirsa, Haryana
M/s Sekhon seed farm, Punjab
M/s Sekhon seed farm, Sangrur, Punjab
M/s Vignette Hi-tech Seeds Co. Karnal
9 Wheat Variety HI 1563 M/s Pan Seeds Pvt. Ltd., Kolkata-700 001 18.6.2011
10 Tomato- PH 8 M/s Bhartiya Beej Nigam Ltd., 24.5.2011
Distt. Udham Singh Nagar, Rudrapur, Uttarakhand
11 Brinjal- PH 9 M/s Bhartiya Beej Nigam Ltd., 24.5.2011
Distt. Udham Singh Nagar, Rudrapur, Uttarakhand
12 Bottle Gourd- PH 3 M/s Bhartiya Beej Nigam Ltd., 24.5.2011
Distt. Udham Singh Nagar, Rudrapur, Uttarakhand
13 Bitter gourd PH 2 M/s Bhartiya Beej Nigam Ltd., 24.5.2011
Distt. Udham Singh Nagar, Rudrapur, Uttarakhand
14 Cucumber- Pusa Sanjog M/s Bhartiya Beej Nigam Ltd., 24.5.2011
Distt. Udham Singh Nagar, Rudrapur, Uttarakhand
15 Pusa Fruit Drink M/s Gold Win Agro Foods Pvt. Ltd., New Delhi 8.11.2011
M/s Shree Krishna Pickles, New Delhi 23.7.2011
16 Pusa Soya Nuts M/s Pravin Reinforced Plastics Pvt. Ltd., New Delhi 23.7.2011
17 RNAi gene construct against ToLCV virus M/s Bejo Sheetal Seeds Pvt. Ltd, Jalna, Maharashtra 28.7.2011
B. Consultancies /Contract Research
Proposals/ Agreements
1. Consultancy for effective and affordable biological
agents (entomopathogenic nematodes and other
bio-agents) for the management of white grub
menace on sugarcane crop in western UP for an
NGO- FARMER (Dr. Sharad Mohan, Division of
Nematology).
2. Contract research for worldwide study of
pluralistic agricultural extension system for
International Food Policy Research Institute
(IFPRI), Washington (Dr. Ram Bahal, Division of
Agricultural Extension).
3. Contract research on high density CFU microbial
formulation for International Panaacea Limited,
146
New Delhi (Dr. Pratibha Sharma, Division of Plant
Pathology).
4. Contract research for bio-efficacy trial and residual
analysis in potato under controlled application of
chlorpropham 50% HN for M/s. Rajhans Fertilizers
Ltd. Indore (Dr. R.K. Pal, Division of PHT).
5. Contract research for bioefficacy of capsicin and
bicolor against sucking insects of Okra, Brinjal and
Chillies for M/s. Sree Ramcides Chemicals Pvt. Ltd.,
Chennai (Dr. R.K. Sharma, Division of
Entomology).
6. Consultancy for research for weather and remote
sensing based crop yield modelling for use in crop
insurance for ICICI Lombard General Insurance
Co. Ltd., Mumbai (Dr. Vinay Sehgal, Dr. R. Sahoo,

Dr. Ravender Singh, Division of Agricultural
Physics).
7. Consultancy for evaluating bio-fuel plant effluents
and recommending a suitable effluent
management system for Agni Bio-Power Energy
Pvt. Ltd. Mohali, Punjab (Dr. Ravinder Kaur,
Division of Environmental Sciences).
8. Contract research for evaluation of bio-efficacy of
new herbicide molecule PIH 485 (25% WG) on
weeds in wheat and rabi maize and residual toxicity
on succeeding crop for M/s P.I. Industries Limited,
Gurgaon (Dr. Rajvir Sharma, Division of
Agronomy).
9. Contract research for bio-efficacy and phytotoxicity
studies of Insure Perform 12% FS against seed
borne diseases in wheat for BASF India Ltd,
Mumbai, (Dr. Anuja Gupta, IARI Regional Station,
Karnal).
10.3 OTHER ACTIVITIES
A. Formation of a Producer Company
With a motto of converting farmers to
entrepreneurs, ZTM-BPD Unit facilitated the formation
of a Producer company named “beej India Producers
Co. Ltd” and was registered under Companies Act
1956. This incubating company has 50 farmers with 20
subscribed founding members. It has 8 member
Executive Board with IARI as Advisory Director.
Activities were initiated as Seed Venture from Rabi 2012
covering about 100 ha, targeting Wheat, Pulses,
Oilseed, Potato and Vegetable crops.
B. Technology Promotional Events
1. Meets Organized/Participated
i. IARI Industry Day for Pearl Millet
An Institute industry day was organized on
September 27, 2011 for Pearl Millet. Over 30
participants including people from industry attended
the meet.
ii. ICAR-Industry Meet
Participated in ICAR-CII Meet 2011 held at NASC
Complex, New Delhi on May 23, 2011. IARI-ZTM &
147
BPD Unit coordinated the display of technologies
pertaining to seeds, planting material, plant
biotechnology and post harvest processes/ products
from all the ICAR institutes. More than 150
technologies were displayed in the exhibition.
iii. ZTM & BPD Unit wins Best Incubator Award
During the 2nd Global Agri - Business Incubation
Conference held at IARI, New Delhi during February
6-8, 2012, Hon’ble former President of India, Dr. A.P.J.
Abdul Kalam, presented the Best Incubator Award to
IARI, New Delhi and IVRI, Izatnagar.
Dr. H S Gupta, Director, IARI receiving the Best Incubator Award
from Hon’ble former President of India Dr. A.P.J. Abdul Kalam.
Also seen in the picture is Dr Bangali Baboo, National Director,
NAIP(left)
2. Entrepreneurship Development Programme
(EDP)
Four entrepreneurship development programmes
(EDP) were conducted to impart skills to upcoming
entrepreneurs. The programmes were on: (i) Plant

Entrepreneurship Development Programme (EDP) with IARI
technologies
Tissue Culture (December 19-23, 2011), (ii) Biofertilizer
and Composting Methods (January 23-28, 2012), (iii)
Protected Crop Cultivation Technologies (March 13,
2012), and (iv) Hydroponics (February 8-15, 2012).
3. News Bulletin
A news bulletin named TAKSAY (Taknique se
Vyavsay) was published from IARI-ZTM BPD Unit
148
covering activities like technology commercialization,
agri-business incubation, IP protection, EDP and
technologies from North Zone Institutes.
4. Business Incubation
The following business incubates associated with
the IARI: (i) M/s. Abu Biotech in the area of in vitro
propagation of medicinal and high value plants like
Stevia rubidiana, (ii) M/s KAD Biotech in the area of
tissue culture for multiplication of Stevia rubidiana
and (iii) M/s Sai Bio Organics in the area of
biofertilizer.
5. Corporate Membership
Continuous interaction with the industry and the
entrepreneurial community has resulted in the
development of a network of corporate members.
About 158 corporate members were registered with
BPD Unit during the period under report making a total
of 205.

11. LINKAGES AND COLLABORATION
The Indian Agricultural Research Institute has
linkages with various national and international
institutes/organizations.At national level the Institute
has close linkages with almost all agricultural sciences
research institutes, centres, project directorates,
coordinated projects as well as a few selected institutes
of the ICAR. Similar linkages exist for natural resource
and socio-economic research institutes. Collaboration
exists with almost all state agricultural universities
(SAUs), selected conventional universities, several of
the institutes of the CSIR and departments of Ministry
of Science and Technology such as the Departments of
Biotechnology, Space Research, Meteorology, and
several other ministries/departments/organizations of
the Government of India.
At the international level, the Institute has close
linkages with some of the CGIAR’s international
agricultural research centres (IARCs), viz., ICRISAT,
CIMMYT, IRRI, and ICARDA. It also has linkages with
other international organizations, viz., FAO, IAEA,
USAID, UNDP, WMO, UNIDO and UNEP. Several
bilateral research linkages involving developed and
developing countries also exist. These include linkages
with USDA, selected universities in USA, Canada,
Australia, World Bank, Rockfeller Foundation,
149
European Commission, JAICA, JIRC, JSPS, ACIAR,
AVRDC (Taiwan), etc.
The number of externally funded projects in
operation during the period from 1.4.2011 to 31.3.2012
are given below:
Details of externally funded projects in operation
Name of funding agency
No. of projects
Within India
DBT, DST, ICAR, CICR, CPRI (Mini Mission-HP), 146
CSIR, NCPA, CPCB, Ministry of Water
Resources, Ministry of New and Renewable
Energy, Ministry of Environments & Forest,
Basmati Export Development Foundation,
Ministry of Earth Sciences, Directorate of
Vanaspati, Vegetable Oils and Fats, National
Medicinal Plant Board, DAC, SAC, NABARD,
National Horticultural Mission, NRDC, BARC,
PPV&FRA, ISRO, IIRS, NFBSRA (ICAR),
NFBSFARA (ICAR), NAIP (ICAR), etc.
Revolving Fund, ICAR Young Scientist Award, 08
National Fellow Scheme of ICAR and ICAR
Niche Area Project
Outside India
IPNI India Programme, USAID, UKIERI, 04
CIMMYT, University of Sydney, Indo-Australian
Programme

12. AWARDS AND RECOGNITIONS
● The Indian Agricultural Research Institute won the
Sardar Patel Outstanding ICAR Institution Award
for the year 2010 jointly with the Tamil Nadu
Agricultural University, Coimbatore for its
outstanding contribution in the field of agricultural
research, education and extension. The Award
carries ` 10,00,000 in cash, a citation and a plaque.
Dr. H.S. Gupta, Director, IARI receiving the Sardar Patel
Outstanding ICAR Institution Award 2010 from the Hon'ble
Minister of State for Agriculture and Food Processing Industries,
Shri Charan Das Mahant
● Indian Agricultural Research Institute was
conferred the Environment Leadership Award of
Agriculture Today, 2011 for its pioneering work on
development of sustainable agriculture, protection
of environment, mitigation and adaptation to
climate change and environmental policy planning
for the benefit of farming community. The award
carries a memento and a citation.
● The Indian Agricultural Research Institute received
Quality Management System Standard Certificate,
NS-EN ISO 9001: 2008/ISO 9001:2008 of KVQA for
providing education, research and training in the
field of agriculture.
● Dr. A.K. Saxena, Head, Division of Microbiology
was nominated Member of the Soil Quality and
Fertilizers Sectional Committee of BIS.
150
● Dr. B.S. Dwivedi, Head, Division of Soil Science
and Agricultural Chemistry received (i) First
Dr. J.S.P. Yadav Memorial Award and of the Indian
Society of Soil Science (ISSS) for excellence in Soil
Science and (ii)Nominated Editor, Journal of the
Indian Society of Soil Science and Indian Journal
of the Agronomy.
● Dr. J. P Sharma, Head, Division of Agricultural
Extension received (i) Shanti Prasad Goel Award
by MOBILIZATION, New Delhi and (ii) Best
Scientist Award by Young Farmers’ Association,
Punjab.
● Dr. K.V. Prabhu, Head, Division of Genetics
received N.S. Cheema Award of 2012 for his
contribution in the field of wheat and basmati rice
varietal popularization and redefining basmati rice.
● Dr. P. Kalia, Head, Division of Vegetable Science
was elected Executive Councillor of the
Horticultural Society of India.
● Dr. R.K. Jain, Head, Division of Plant Pathology
received (i) B.B. Mundkur Memorial Award by
Indian Phytopathological Society, (ii) Nominated
to the International Committee on Tospovirus
(Bunyaviridae), and (iii) Vice- President, Indian
Virological Society.
● Dr. R.K. Pal, Head, Post Harvest Technology was
nominated Member of the RAC, CIPHET,
Ludhaina and technical expert, SAARC Countries.
● Dr. T. Janakiram, Head, Division of Floriculture and
Landscaping was nominated (i) Executive
Councillor of the Horticultural Society of India, (ii)
Editor-in-Chief of the Indian Society of Ornamental
Horticulture, (iii) Member of Institute Management
Committee of IIHR, Bengaluru and Directorate of
Floricultural Research, New Delhi, and (iv) Vice
President, Rose Society of India.
● Dr. V.V. Datar, Head, IARI, Regional Station, Pune
received M.S. Pavgi Memorial Lecture Award by the
Indian Phytopathological Society for 2011-12.

● Dr. Pratibha Sharma, Professor, Division of Plant
Pathology received (i) SAB Women Scientist Award
by the Society for Applied Biotechnology, Tamil
Nadu, (ii) Best Citizen of India by International
Publishing House, and (iii) Fellow of the Indian
Society of Ornamental Horticulture, IARI.
● Dr. Rashmi Aggarwal, National Fellow, Division
of Plant Pathology was elected Editor of Indian
Phytopathology.
● Dr. A.D. Munshi, Principal Scientist, Division of
Vegetable Science was elected (i) Member of
Editorial Board, Prasar Doot and received
appreciation letter from Director, IARI for the
Hindi Book Swa-Paragit Phaslon ki Beej Utpadan
Takniki.
● Dr. A.K. Patra, Principal Scientist, Division of Soil
Science and Agricultural Chemistry received (i)
Bharat Jyoti Award by India International
Friendship Society and (ii) FAI-Dhiru Morarji
Memorial Award.
● Dr. (Mrs.) Anuja Gupta, Principal Scientist,
Regional Station, Karnal received Pusa Vishist Hindi
Pravakta Puruskar for 2010-11 of IARI.
● Dr. Anupama, Principal scientist, Division of
Agricultural Chemicals received Award for
Excellence for her research work in the field
Agricultural Chemicals.
● Dr. Balraj Singh, Principal Scientist & In-charge,
CPCT received (i) Distinguished Scientist Award
2012 of GBPUA&T, Pantnagar, (ii) Distinguished
Scientist Award by Hi-Tech Horticultural Society,
Meerut, (iii) Member of the Consultative Group
on Protected Cultivation for Haryana by Chairman,
Haryana Kisan Ayog, and (iv) Member of the
Technical Advisory Committee by CIH, Dimapur,
Nagaland.
● Dr. B.K. Singh, Principal Scientist, CATAT received
(i) Dr. G.S. Vidyarthi Memorial Award by the
Indian Society of Extension Education, New Delhi
and (ii) Dr. S.L. Bhela Award by the Society of
Extension Education, Agra.
● Dr. K. Annapurna, Principal Scientist, Division of
Microbiology was nominated as Editor-in-Chief of
the Indian Society of Agricultural Science.
151
● Dr. Lata, Principal Scientist, Division of
Microbiology was elected (i) Editor of Journal of
the Indian Society of Soil Science, (ii) Executive
Member of Association of Microbiologists of India
and (iii) Member, Scientific Panel on
●
“Contaminants in the Food Chain” of Food Safety
Standards Authority of India.
Dr. P.K. Sharma, Principal Scientist, Regional
Station, Karnal received National Award for
guiding the best M. Tech. thesis in Agricultural
Engineering-2011 by Indian Society for Technical
Education (ISTE), New Delhi.
● Dr. Robin Gogoi, Principal Scientist, Division of
Plant Pathology was elected Fellow of the Indian
Phytopathological Society.
● Dr. R. S. Chillar, Principal Scientist (WTC), Dr.
Dabas, Senior Scientist, (CATAT), Dr. I.M. Mishra,
Principal Scientist (Agricultural Engineering) and
Dr. S.S. Parihar, Principal Scientist (WTC) received
Groundwater Augmentation Award of Ministry of
Water Resources.
● Dr. Sunil Pabbi, Principal Scientist, Division of
Microbiology was nominated Member of the
Editorial Board, VEGETOS: An International
Journal of Plant Research.
● Dr. Adrash Kumar, Senior Scientist and Er J.K.
Singh, Principal Scientist, Division of Agricultural
Engineering received 2012 ISAE Team Award.
● Dr. A.K. Singh, Senior Scientist, Division of
Genetics received (i) The Best Scientist Award by
Young Farmers’ Association, Punjab for
development of high yielding basmati rice varieties
and marker assisted breeding, (ii) Agriculture
Leadership Award 2011 for improvement of basmati
rice varieties through conventional and marker
assisted breeding.
● Dr. Bikash Mondal, Senior Scientist, Division of
Plant Pathology was elected (i) Fellow of Indian
Virological Society, (ii) Editor-in-Chief, Indian
Journal of Virology, and (iii) nominated to the
International working Committee on Nanoviridae.
● Dr. B. Ramakrishnan, Senior Scientist, Division of
Microbiology was nominated Member of the
Editorial Board, Journal of Bioremediation &
Biodegradation.

● Dr. D.K. Sharma, Senior Scientist, CESCRA
received First Pusa Visisthya Vakta Puraskar 2010-
2011.
● Dr. D.R. Biswas, Senior Scientist, Division of Soil
Science and Agricultural Chemistry was elected
Fellow of the ISSS.
● Dr H. Pathak, Senior Scientist, CESCRA was
nominated as (i) DARE/ICAR’s Coordinator for the
climate negotiations in the UNFCCC, and (ii)
Editor, Indian Journal of Agronomy.
● Dr. K. V. Prasad, Senior Scientist, Division of
Floriculture and Landscaping was nominated
Executive Councillor of the Horticultural Society
of India.
● Dr. Manjeet Singh Nain, Senior Scientist, Division
of Agricultural Extension received (i) Agricultural
Extension Young Scientist Award by the Society of
Extension Education, Agra and (ii) Elected Fellow
of the Indian Society of Extension Education, New
Delhi.
● Dr. Monika Wason, Senior Scientist, CATAT was
nominated Editor of the “Prasar Doot”.
● Dr. S. Naresh Kumar, Senior Scientist, Centre for
Environment Science and Climate Resilient
Agriculture (CESCRA) was elected Fellow of the
Indian Society for Plant Physiology.
● Dr. Neelam Patel, Senior Scientist and Dr. T.B.S.
Rajput, Principal Scientist, WTC received
Certificate of appreciation from IARI for writing
research article in Hindi “Zaid fasalon mein uchit jal
prabandhan”.
● Dr. Nishi Sharma, Senior Scientist, CATAT was
elected (i) Fellow, MOBILIZATION, New Delhi ,
(ii) National Co-coordinator of National Seminar
on Multi Sectoral Innovations for Rural Prosperity,
and (iii) Editor, Journal of Community
Mobilization and Sustainable Development.
● Dr. Pankaj, Senior Scientist, Division of
Nematology received the Prof. H.M. Shah
Memorial Award of the Nematological Society of
India for his contribution in the field of Nematode
Management for the period 2007-2011.
152
● Dr. Rashmi Singh, Senior Scientist, Division of
Agricultural Extension received recognition as an
International Expert on Women Entrepreneurship
by Asian Productivity Organization, Japan.
● Dr. R. Roy Burman, Senior Scientist, Division of
Agricultural Extension received (i) Young
Professional Award by MOBILIZATION, New
Delhi and (ii) S.N. Bhela Extension Professional
Award by Society of Extension Education, Agra.
● Dr. R.R. Sharma, Senior Scientist, Post Harvest
Technology received (i) Dr. Rajendra Prasad Award
(ICAR), (ii) Dr. Ram Nath Singh Award (IARI), and
(iii) Elected Member, Editorial Board of American
Journal of Plant Sciences, USA.
● Dr. Shantanu Kumar Dubey, Senior Scientist,
CATAT was elected Fellow, MOBILIZATION, New
Delhi and (ii) Editor, Journal of Community
Mobilization and Sustainable Development.
● Dr. Sharad Mohan, Senior Scientist, Division of
Nematology nominated as a country
●
representative to the European Society of
Nematology (ESN).
Dr. S.P. Datta, Senior Scientist, Division of Soil
Science and Agricultural Chemistry received (i)
The XII International Congress Commemoration
Award by the ISSS and (ii) Nominated Editor,
Journal of the Indian Society of Soil Science.
● Dr. T.K. Behera, Senior Scientist, Division of
Vegetable Science was elected (i) Fellow of the
Horticulture Society of India and (ii) Editor,
Horticulture Society of India.
● Dr. T.K. Das, Senior Scientist, Division of
Agronomy was elected Fellow of the Indian Society
of Weed Science, Jabalpur.
● Dr. Vinod, Senior Scientist, Division of Genetics
received V.S. Mathur Memorial Award by ISGPB
for wheat genetics and improvement.
● Dr. A.K Mishra, Scientist (SS), USI received Young
Scientist award from Computer Society of India
(Delhi Chapter).
● Dr. Renu Singh, Scientist (SS), CESCRA received
Young Fellow Award by the Society for Recent
Development in Agriculture.

13. BUDGET ESTIMATES
Statement showing Budget Estimates & Revised Estimates for the year 2011-12 and Budget Estimates for 2012-13 under
Plan
S. No. Sub Head Budget Revised Budget
Estimates Estimates Estimates
2011-12 2011-12 2012-13
1. TA 95.00 72.50 118.44
2. Other Contingencies 515.88 410.00 1200.00
3. HRD 59.30 14.20 50.00
4. Library 200.63 155.20 250.00
5. Furniture 77.43 77.00 100.00
6. Equipment 2309.57 1416.08 1200.00
7. Works 2208.04 1419.00 3410.00*
8. Provision for OBC quota 1934.15 210.00 400.00
Total 7400.00 3773.98 6728.44
9. NEH 0.00 65.00 80.00
10. TSP 0.00 35.00 29.05
Grand Total 7400.00 3873.98 6837.49
*This includes ` 1000.00 lakh for repair which is 15% of the total allocation
153
` in lakh
Statement showing Budget Estimates & Revised Estimates for the year 2011-12 and Budget Estimates for 2012-13 under
Non-Plan
S. No. Name of the Head Budget Revised Budget
Estimates Estimates Estimates
2011-12 2011-12 2012-13
Grants for Creation of Capital Assets (CAPITAL)
1 Works
(A) Land
(B) Building
i. Office building
ii. Residential building
iii. Minors Works
2 Equipments 54.00 135.00 60.00
3 Information & Technology
` in lakh

4 Library Books & Journal 5.00 20.00 2.00
5 Vehicles & Vessels
6 Livestock 1.00 8.00
7 Furniture & Fixtures 10.00 10.00
8 Others
Total - CAPITAL 70.00 165.00 70.00
Grants in Aid - Salaries (REVENUE)
1 Establishment Expenses
(A) Salary
i. Establishment charges 12456.00 11851.00 12375.00
ii. Wages
iii. Overtime allowance 4.00 4.00 4.00
(B) Loan & Advances 11.00 16.00 11.00
Total - Establishment Expenses 12471.00 11871.00 12390.00
(Grants in Aid -Salaries)
Grants in Aid - General (REVENUE)
1 Pension and Other Retirement Benefits 9450.00 9000.00 9900.00
2 Travelling Allowance
(A) Domestic/Transfer T.A. 20.00 29.00 25.00
(B) Foreign TA
Total - Travelling Allowance 20.00 29.00 25.00
3 Research & Oper. Expenses
(A) Research Expenses 180.00 211.99 200.00
(B) Operational Expenses 243.00 288.01 275.00
Total - Research & Oper. Expenses 423.00 500.00 475.00
4 Administrative Expenses
(A) Infrastructure 1000.00 1550.00 1500.00
(B) Communication 20.00 37.01 37.00
(C) Repair & Maintenance
i. Equipments, vehicles & others 100.00 177.23 341.00
ii. Office building 350.00 739.00 600.00
iii. Residential building 200.00 567.55 350.00
iv. Minor works 66.00 257.81 180.00
(D) Others (exc.TA) 200.00 1066.40 515.00
Total - Administrative Expenses 1936.00 4395.00 3523.00
5 Miscellaneous Expenses
(A) HRD
(B) Other Items(fellowships) 350.00 160.00 300.00
(C) Publicity & Exhibitions 0.00 0.20 25.00
(D) Guest House-Maintenance 0.00 41.70 50.00
(E) Other Misc. 240.00 288.10 250.00
Total - Miscellaneous Expenses 590.00 490.00 625.00
Total Grants in Aid - GENERAL 12419.00 14414.00 14548.00
Total Revenue (Grants in Aid- 24890.00 26285.00 26938.00
Salaries+Grants in Aid-General)
GRAND TOTAL (Capital+Revenue) 24960.00 26450.00 27008.00
154

14. STAFF POSITION
(As on 31.03.2012)
Category Number of posts
Sanctioned Filled
155
Direct By
Recruitment Assessment Total
A. SCIENTIFIC STAFF
1) Research Management Personnel 6 5 – 5
2) Principal Scientist 65 46 91 137
3) Senior Scientist/Scientist (S.G.) 170 84 98 182
4) Scientist 337 269* – 80
Total 578 404 404
B. TECHNICAL STAFF
1) Category III 25 15
2) Category II 308 246
3) Category I 395 284
4) Auxiliary 02
Total 728 547
C. ADMINISTRATIVE STAFF
1) Group A 20 15
2) Group B 276 191
3) Group C 164 151
Total 460 357
D. SKILLED SUPPORTING STAFF 1307 1058
Note: *Out of 269 positions of Scientist filled through direct recruitment only 80 are working in the grade of Scientist. The remaining 189 scientists
(i.e. 91 Principal Scientists & 98 Senior Scientists) have been promoted as Principal Scientist and Senior Scientist through assessment.

I. On-going Projects at IARI as on 31.03.2012
a) School of Crop Improvement 34
b) School of Resource Management 29
c) School of Crop Protection 19
d) School of Basic Sciences 14
e) School of Social Sciences 12
f) Other projects 12
g) Challenge projects 05
Total 125
II. Scientific Meetings Organized
a) Workshops 16
b) Seminars 11
c) Summer institutes/Winter school 03
d) Farmers’ day (s) 69
e) Others 88
Total 187
III. Participation of Personnel in Scientific
Meetings
India
a) Seminars 181
b) Scientific meetings 202
c) Workshops 103
d) Symposia 110
e) Others 131
Total 727
Abroad
a) Seminars 28
b) Scientific meetings 16
c) Workshops 10
d) Symposia 08
e) Others 15
Total 77
15. MISCELLANY
156
IV. Significant Suggestions Given /
Decisions Taken at the Meetings of Senior
Management Personnel
Board of Management
● Establishment of Centre for Environment Science
and Climate Resilient Agriculture (CESCRA).
Academic Council
● Institution of an award in the name of Dr. A.B. Joshi,
the first Indian Dean, IARI; Director, IARI; and
Deputy-Director General (Crop Sciences), ICAR.
● Re-nomenclature of the M.Sc. degree in Post
Harvest Technology as M.Tech. (Post Harvest
Technology) for those students who are admitted
with B.Tech. degree.
● The students pursuing their M.Sc. / Ph.D.
programme at IARI are given the option to write
their theses in Hindi if they so desire. It is
mandatory for thesis title, first page of the thesis,
and the abstract of the thesis to be written in
Hindi.
Research Advisory Committee
School of Crop Improvement
● Work on basmati rice be published in the form of
success story, highlighting the contribution and
economic impact of PB 1121.
● Collaborative research progamme aimed at solving
the problem of mango malformation through
biotechnological approaches needs to be pursued
with full vigor. Possibly a Challenge Programme
in inter-institutional mode will be desirable.
● Alternatives to the existing wheat variety PBW 343
for higher productivity and rust resistance in the
north-western zone of the country is a must and
should be given high priority.
● Prime importance needs to be given for breeding
varieties for high temperature tolerance in

Institute’s mandate crops, with special emphasis
on terminal heat in wheat.
● Research needs to be focussed on a few selected
and mandated vegetable crops only. Hence,
prioritization must be made for future research
programmes.
● Large scale multiplication of quality planting
material for the best available mango hybrids be
given top priority.
● Major emphasis needs to be given to the
development of technologies for food processing,
packaging and also commercialization of value
added products through PPP.
School of Natural Resource Management
● Research programmes of Water Technology Center
should focus at maximizing production under
rainfed agriculture in north-western region of the
country.
● Alternatives to the existing rice-wheat system
should be worked out, with a greater emphasis to
resource conservation technologies under direct
seeded rice. Efforts should also be made to work
out strategies for controlling weed and nematodes
in direct seeded rice. Economic analysis of
alternative systems be worked out.
● Studies on rain water harvesting, microirrigation
and fertigation technologies be given prime
importance. Cost-benefit analysis of the drip
irrigation technology should also be worked out
for the benefit of end users.
● Decision support systems and sensors for precision
farming be developed in collaboration with other
advanced Institutes.
● Strategies on minimizing water consumption in
transplanted rice may be looked into, and studies
on improving efficiency of rice transplanters
undertaken.
● Training of scientists needed in the area of
simulation modeling and WUE.
● Research programmes pertaining to the use of
nano-technology for fertilizer use & management
be given greater emphasis.
School of Crop Protection
● Concerted research efforts needed in the area of
IPM of important vegetable and horticultural crops
157
in collaboration with NCIPM. Efforts should also
be made to test and popularize the crop-specific
IPM packages on a large scale.
● Due emphasis needs to be given to research on the
use of bioagents for reducing the post harvest
losses of important fruit and vegetable crops.
● Technologies with respect to Trichoderma and
Chaetomium based formulations along with
Hydrogel Technology should be demonstrated on
a large scale for the benefit of end users. Such
experiments be taken up on farmers’ fields.
● Studies on the efficient use of neem coated urea
for enhancing NUE and WUE in rice may be taken
up in view of good work carried out on neem
pesticides at the Institute.
● Integrated research programme is needed on
improving virus resistance in papaya. Hence, a
project at inter-divisional level be initiated as a
matter of priority.
School of Basic Sciences
● Work on developing GM rice with relevant traits
may be intensified.
● Research programmes aimed at improving
drought tolerance in wheat be strengthened.
● Focussed research on selected crops and high
priority areas needed to be the future aim involving
all the Basic Sciences disciplines rather than taking
small and diverse studies, keeping in view the
interest of individual scientists.
School of Social Sciences
● Impact assessment and evaluation models for out
scaling of institute innovations be the future thrust
and given major priority.
● Strong inter-disciplinary linkages with the
Biological scientists of other schools is required for
developing effective impact assessment models.
● Research and teaching linkages with IASRI and
NCAP to be established involving post-graduate
faculty and students on priority. An MOU with
NCAP be signed soon on the lines similar to IASRI
and NBPGR for post-graduate teaching
programme.
● Institute should take lead in transfer of potential
technologies to the end users. Efforts should also

e made to display / demonstrate the technologies
to the end users prior to their large scale transfer.
● Special attention needs to be given to linking
farmers with market to enhance their income.
● The technologies / products developed by IARI
should be placed on the Institute website and made
available to end users through ATIC and given
wide publicity.
Challenge Programmes
● Studies carried out by other institutes with respect
to these challenge programmes should also be
looked into in order to avoid duplicity in research
work and arrive at more meaningful research
conclusions.
● Collaboration with CIMMYT and IRRI will be
desirable for the challenge programme on
conservation agriculture.
● Concerted efforts are required for breeding
varieties for high temperature tolerance and
terminal heat tolerance in wheat.
● Only diseases and pests of national importance be
addressed in priority vegetable crops.
● Possibility of using marine aquatic algae for the
production of biofuel may be examined and
explored.
● Adaptation and mitigation strategies to climate
change be given high priority.
Post Graduate School Activities
● Need for regular upgradation of IARI faculty by
imparting training / study tours in specialized
fields of research in reputed national / international
Institutions.
● Faculty evaluation system be relooked for making
it more effective and purposeful. Professors should
be identified on the basis of their merit and
scientific contributions. Entire post-graduate
faculty in each Division be involved in the process
of faculty evaluation system.
● Intake of M. Sc. Students be gradually reduced and
that of Ph. D. as well as female students be
increased. Even gender balance be given due
attention at the Institute level.
● Renovation and upkeep of P.G. hostels be the top
priority under 12th five year plan.
158
● Number of Post-doctoral Fellows to be increased
from present 15 to at least 25 during the next plan.
Finance and Administration
● Filling of the scientific posts in various disciplines
and technical positions to be taken up on priority,
especially for senior scientists at IARI in view of a
large number of vacancies already notified to the
Council.
● Assessment of technical staff should be done
preferably on every six monthly basis.
● HRD funds may be utilized for the international
training programmes of the scientists in
specialized areas of research and participation in
seminars, conferences abroad, especially when
they have been invited to make oral / lead or
plenary papers.
● Revolving fund schemes need to be reviewed. Due
incentives / rewards should be given to the staff
working in the Revolving fund schemes on a
regular basis, as per provisions under the scheme
and also backlog be got cleared on priority basis.
Recommendations of the Technical Advisory
Committee (TAC) for the Challenge
Programmes of IARI
The following recommendations were made by the
members of TAC for bringing further improvement in
the under mentioned five challenge programmes of
IARI.
1. Hybrid development in crops (wheat,
pigeonpea and mustard)
● Basic and strategic studies for improving the
functionality of A, B and R lines in mustard need
to be carried out.
● Effective pollination control mechanisms are
required for production of hybrids in wheat,
mustard and pigeonpea.
● Use of stable CMS lines in hybrid research
programme may be given due emphasis.
● Strategies for popularization and promotion of the
available hybrids need to be carried out.
● Efforts should be made to study the hybrid seed
production of these major crops in relation to
climate change.

● Quantifiable deliverables in the hybrid programme
may be highlighted keeping in view the available
manpower and resources in hand.
2. Hybrid development in vegetable crops
● Focused research in CMS based hybrid
development in cauliflower and cabbage is
required.
● Major thrust needs to be given to studies on
multiple disease resistance, uniformity,
●
reproductive biology, quality control in addition
to yield. Research on leaf curl virus resistance in
hybrid tomato needs to be pursued with full vigor.
Work on early cauliflower may be given prime
importance. Efforts should also be made to increase
the curd size of early cauliflower for the benefit of
end user.
● Due emphasis needs to be given to marketing of
developed varieties / hybrids of important
vegetable crops by taking help from private
companies.
● Studies on functional male sterility and production
of hybrid seeds in vegetable crops are needed.
● The Division of vegetable Science should take lead
in the development of vegetable hybrids for the
year round cultivation and promotion of some
underutilized vegetables.
3. Enhancing resilience of Indian Agriculture to
climate change
● A Policy paper on residue utilization may be
published on priority.
● The work carried out under the challenge
programme should be translated and up scaled to
national policies. In this respect involvement of
Economist in the challenge programme is must.
● Effective technologies for increasing the
productivity of rainfed areas needs to be worked
out while addressing the problem of climate change.
● Benefits accruing from the effect of elevated CO2 treatment under filtered ozone levels may be seen
and recorded.
● Efforts should be made to study long term effects
of elevated temperature on the nitrogen cycle
arising due to changes taking place in nitrogen /
potassium / phosphorus fixing bacteria.
159
● Programme on climate change needs to be closely
linked with conservation agriculture programme.
Emphasis should be laid down on understanding
the effect of conservation agriculture practices in
mitigating the impact of elevated CO . 2
● Breeding work should form an integral component
of studies pertaining to screening of varieties for
high temperature tolerance.
● Studies on the effect of elevated CO on BPH
2
population and yield in rice under OTC need to be
re-examined and further investigated.
● Lethal temperature dose for BPH survival should
be taken into consideration while studying the
effect of elevated temperature on BPH population.
4. Bioprospecting of microorganisms for
sustainable production of second generation
liquid biofuels
● Strategic approaches aimed at identification of
novel algal strains which can produce high levels
of lipids as well as reduce incubation time for lipid
accumulation needs to be looked into. Possibility
of using oleo genus microbes (fungi) for lipid
accumulation may also be explored.
● Cost effective approaches for biofuel production
to be worked out. In this respect, selection,
sustainability, availability and cost of raw materials
to be used for biofuel production may be given due
importance.
● Studies on screening of microbes for delignification
and saccharification may be undertaken. Emphasis
should also be given to the use of non-edible
lignocellulosics for biofuel purpose.
● Efforts should be made to isolate efficient algal
strains which can convert pentoses and hexoses to
ethanol for improved biofuel production
5. Conservation agriculture for enhancing
productivity and resource-use efficiency
● Cutting edge research in the area of conservation
agriculture, especially under rainfed conditions is
required.
● Studies on weed and insect dynamics, carbon
sequestration and moisture regime under
conservation agriculture may be given major
emphasis.

● Development of suitable sensors and Decision
Support Systems for integrated nutrient, pest and
stress (abiotic / biotic) management to be taken up
on priority.
● Concerted efforts needed in the area of soil health
and microbial studies.
● Effective approaches for increasing the input use
efficiency in direct seeded rice under conservation
agriculture needs to be looked into.
V. Resource Generation
1. Consultancy & other services
Consultancy services ` 4,18,470
Contract research –
Contract service –
Training –
Total (A) ` 4,18,470
2. Revolving fund Sale Proceeds
Revenue
Generated
(a) Seed ` 1,00,01,222
(b) Commercialization ` 12,33,582
(c) Prototype manufacturing ` 49,27,862
Total (B) ` 1,61,62,666
3. Post Graduate School receipt
Training Programme
(a) Foreigners & Indians
M.Sc./Ph.D Programme
` 1,09,000
(b) Institutional economic fee from
foreign scholars under Work Plan
`16,71,185
(c) Receipt from Registrar
Account No.
5432(9029.201.4314) :
` 1622004
all fees except institutional economic fee,
including sale of information |
bulletin through D.D.
(d) Cash transferred from Syndicate ` 9,11,187
Bank to Director’s Account No.
C-49(9029.305.17) from sale of
information bulletin
+ ` 280250
160
(e) Receipt deposited in Director’s ` 1,99,076
Account No. C-49(9029.305.17)
for theses evaluation, PDC & Misc.
(does not include refund
of IARI scholarship by students)
Total (C) ` 47,92,702
Grand Total (A+B+C) ` 2,13,73,838
VI. Infrastructural Development
● Construction of farmers training hall, guest room
and boundary wall at the Regional Station, Indore.
● Development of office-cum-laboratory building
and establishment of vermi-composting system of
12t per annum capacity at the IARI Centre,
Dharwad.
● Construction of threshing, seed drying and curing
facility at main Vegetable Research Farm, covering
of parking and exhibition enclosure at divisional
UVRD, development of conference room and
creation of tissue culture laboratory facilities in the
Division of Vegetable Science.
● Development of cold storage facility and car
parking area at the Division of Floriculture and
Landscaping.
● Tiling of rooms and renovation of technical cell and
committee room in the Division of Agronomy.
● A recharge field for rain water harvesting of 10000
m 3 capacity, a semi climate control greenhouse of
1000 m 2 area, construction of 1000 m 2 zero energy
naturally ventilated green house and 200 m 2
greenhouse aqua-ponics facility were developed
at the farm of CPCT.
● Procured a new Holland Tractor (75 hp), three
FARMTRAC Tractors (55hp), a FARMTRAC
Tractor (65 hp), a Zurn Plot Combine Harvester, a
Tipping Tractor Trailer and a non-Tipping Tractor
Trailer at FOSU.
● Development of a new laboratory and renovation
of laboratories in the Division of Microbiology.
● Construction of office cum Laboratory building at
IARI, Regional Station, Pune.

● Development of glasshouse integrating to the
transgenic research and a new class room in the
Division of Nematology.
● Renovation of Post Graduate and Training
laboratories, divisional Library, Committee room,
Students’ Room, Conference Room and flooring of
corridors in the Division of Biochemistry.
● (i) Renovation of a FACE, TGT and four OTCs with
fully automatic monitoring of CO 2 , temperature,
humidity and light, (ii) Two laboratories, (iii) False
ceiling with lights and electrical works in four labs
and corridors (ground and first floor), (iv) Flooring
in growth chamber room, (v) repairing/
redevelopment of two borewell, (vi) Repairing/
replacement of polysheet (2 high temperature
chamber-pot culture and 8 small OTCs, and (vii)
Development of Committee Room in the Division
of Plant Physiology.
● Development of website of Centre of Advanced
Faculty Training (CAFT), Board Room and creation
of improved projection facility in Information Hall
at the Division of Agricultural Extension.
● Establishment of (i) a unit of Bee keeping (apiary)
with 4 bee hives and honey extraction machine,
(ii) a bio-gas plant (Gobar gas plant) of 4 cubic
meter size, (iii) Drip irrigation system, (iv) ATIC
conference hall, (v) installation of two Touch Panel
Kiosks, two revolving scroller posters and 19
illuminated display panels at ATIC.
VII. All India Coordinated Research Projects
in Operation during the year April 1, 2011 to
March 31, 2012
Project Headquarters
1. All India Coordinated Project on Plant Parasitic
Nematodes with Integrated Approach for their
Control.
161
2. All India Network Project on Pesticide Residues
National Centres Functioning at IARI under All
India Coordinated Research Projects
1. All India Network Project on Biofertilizers
(Erstwhile All India Coordinated Research Project
on Biological Nitrogen Fixation)
2. All India Coordinated Project on Long-Term
Fertilizer Experiments
3. All India Coordinated Research Project on Soil Test
Crop Response Correlations
4. All India Coordinated Research Project on
Floriculture Improvement
5. All India Network Project on Pesticide Residues
6. All India Coordinated Research Project on
Renewable Energy Sources for Agriculture and
Agro-based Industries
7. All India Coordinated Research Project on
Biological Control of Crop Pests and Weeds
8. All India Coordinated Research Project on Soybean
9. All India Coordinated Research Project on Honey
Bees
10. All India Coordinated Research Project on Sub-
Tropical Fruits
11. All India Coordinated Research Project on
N.S.P.(Crops)
12. All India Coordinated Research Project on Mustard
13. All India Coordinated Research Project on Wheat
14. All India Coordinated Research Project on Rice
15. All India Coordinated Research Project on Pulses
16. All India Coordinated Research Project on
Pearlmillet

VIII. Foreign Visitors during April 1, 2011 to March 31, 2012
S. Visitor (s) Month
No.
1. A 5-member delegation from Ethiopia April, 2011
2. A 9-member delegation from Bhutan April, 2011
3. Her Excellency Mrs. Orit Noked, Minister of Agriculture, Israel April, 2011
4. A high level delegation from Ministry of Education, Taiwan May, 2011
5. Dr. Emmanuel Fabiano, Vice Chancellor, University of Malawi May, 2011
6. Mr. Hugues Ngouelondele, Mayor of Brazzaville, Republic of Congo June, 2011
7. His Excellency Prof. Babury, Hon’ble Deputy Minister, Ministry of Higher Education, Afghanistan June, 2011
8. A 5-member delegation from the Ministry of Agriculture of the Republic of Mozambique July, 2011
9. An 18-member high level delegation led by Hon. Dr. Ahmed Yakubu Alhassan, Member of Parliament, Ghana July, 2011
10. A 9-member delegation led by Dr. Romono Klome, Permanent Secretary, Ministry of Agriculture, Kenya August, 2011
11. Visit of Ms. Diden Bilmez from Uludag University, Agricultural Economics, Turkey August-September, 2011
12. A 3-member delegation from Ethiopia August, 2011
13. A 20-member delegation of Editors/ Sr. Journalist of 10 Francophone Countries of Africa August, 2011
14. Mr. Adeline Rolnick, Researcher, Harvard College, USA August, 2011
15. A 2-member delegation, Dr. Johan Dasaeger, Global Technical Product Manager (Nematology)
& Dr. James Rauh, (B-Fate/Environmental Fare) from the DuPont, USA
September, 2011
16. His Excellency U. Thein Sein, President of the Republic of Union of Myanmar October, 2011
17. Dr. Keith Jones, Executive Director, Intellectual Property Office, Washington State University, USA November, 2011
18. A delegation from Austria led by Mr. Josef Kaifler, Head of Advisory Unit in the
Agricultural Administration Pharmacist, Austria
November, 2011
19. A group of 35 Professors, Students and Dean of Environmental Studies,
Department of Escuela Politecnica Javeriana of the Republic of Ecuador
November, 2011
20. A 5-member delegation from Rothamsted Research Station, UK November, 2011
21. A 12-member Chinese delegation headed by Mr. Liu Kun, Vice- Governor of Guangdong, China December, 2011
22. His Excellency, the Agriculture Minister of Indonesia December, 2011
23. A 5-member delegation from Malaysia December, 2011
24. The United State Agency for International Development (USAID) December, 2011
25. Visit of Ms. Yoshiko Honda from Japan December, 2011
26 Sh. Vasant Bharath, Hon’ble Minister of Food Production Land & Marine Affairs of Trinidad and Tobago January, 2012
27. A 9-member delegation led by Mr. Martin Taylor, Chairman, Syngenta Foundation for Sustainable Agriculture January, 2012
28. A 6-member Chinese delegation led by His Excellency Mr. Yu Youjun,
Vice-Minister of the Office of the South-to-North Water Diversion Commission of the
State Council of People’s Republic of China
February, 2012
29. A 13-member delegation from Switzerland February, 2012
30. A 29-member delegation from America/ Canada February, 2012
31. Dr. Alex Deghan, the Science and Technology Advisor, USAID March, 2012
32. An 11-member delegation from Kandhar, Afghanistan March, 2012
33. A group of 78- students attending Orientation Programme for African Students admitted in different
Indian Agricultural University under India-Africa Forum Summit (IAFS)
March, 2012
34. A 4-member delegation from Iran led by Mr. Reza Ranjbor Karimi (PhD), Faculty Member,
Assistant Professor in Organic Chemistry, IRAN
March, 2012
35. His Excellency, Mr. Bui Ba Bong, Deputy Minister of Agriculture and Rural Development, Vietnam March, 2012
162

Chairman
1. Dr. H.S. Gupta
Director, IARI
Members
2. Dr. H.S. Gaur
Dean & Joint Director
(Education), IARI
3. Dr. Malavika Dadlani
Joint Director (Research)
IARI
4. Dr. K. Vijayaraghvan
Joint Director (Extension)
IARI
5. Dr. A.K. Srivastava
Director
NDRI, Karnal
6. Agril. Commissioner
Deptt. of Agril. & Cooperation
Ministry of Agriculture
Krishi Bhawan
New Delhi - 110 114
7. Development Commissioner
Delhi Administration
Govt. of NCT of Delhi
5/9 Under Hill Road
Delhi - 110 054
8. Dr. Swapan Kumar Datta
Deputy Director- General (CS)
ICAR, Krishi Bhawan
New Delhi - 110 114
Appendix 1
Members of Board of Management of IARI
(As on 31.03.2012)
9. Director (Finance), ICAR
Krishi Bhawan
10. Dr. K. V. Prabhu
Head, Division of Genetics
11. Dr. A. K. Vyas
Head, Division of Agronomy
12. Dr. R. K. Jain
Head, Division of Plant
Pathology
13. Dr. Raj Deo Rai
Head, Division of Biochemistry
14. Dr. Suresh Pal
Head, Division of Agril.
Economics
15. Ms. Sudha Pillai
Secretary (Planning
Commission)
Yojna Bhawan, New Delhi
16. Dr. Chanda Nimbkar
Director,
Animal Husbandry Division
Nimbkar Agricultural
Research Institute,
Maharashtra - 415 523
17. Dr. R. R. Hanchinal
Vice Chancellor
University of Agricultural
Sciences
Dharwad - 580 005
(Karnataka)
163
18. Sh. Rajendrakumar
Shantilal Patel
Ved Wali Khadki
Khambholaj - 388 330
Taluka & District Anand
(Gujrat)
19. Sh. M.J. Ummen,
Mangaiathuparambil
House : Arivilanjapoyil
P.O. : Alakode
Via. Kannur
Distt. Kerala - 670 571
Member-Secretary
20. Sh. B.N. Rao
Registrar & Joint Director
(Admn.)

Chairman
Dr. R.S. Paroda
Former Secretary
DARE & DG, ICAR and
Chairman, Trust for Advancement
of Agricultural Sciences
Library Avenue, IARI Campus
Pusa, New Delhi - 110 012
Members
Prof. S.L. Mehta
Former Vice Chancellor (MPUAT)
71, Gokul Nagar,
Udaipur - 313 001 (Rajasthan)
Prof. A.N. Mukhopadhyay
Sangini, 151 Akanksha
Udhyan II, Raibareilly Road
Lucknow - 226 025, U.P.
Appendix 2
Members of Research Advisory Committee of IARI
(As on 31.03.2012)
Dr. M. Velayutham
Former DDG (NRM), ICAR
6A, Gardenia Apartment
275, Kilpauk Garden Road
Kilpauk, Chennai - 600 010
Dr. G. L. Kaul
Former VC, AAU
KA- 59 A, Kaushambi
Ghaziabad - 201 012 U.P.
Dr. Mruthyunjaya
Former National Director, NAIP
A-701, Vasundhara Apartments
Sector 6, Plot No. 16, Dwarka,
New Delhi - 110 075
Dr. Swapan Kumar Datta
Deputy Director-General, (CS)
ICAR, Krishi Bhavan
New Delhi - 110 114
Dr. H. S. Gupta
Director
IARI, New Delhi - 110 012
Member-Secretary
Dr. Malavika Dadlani
Joint Director (Research)
IARI, New Delhi

Chairman
Dr. H.S. Gupta
Director, IARI
Co-Chairman
Dr. Malavika Dadlani
Joint Director (Research), IARI
Members
Dr. I.P. Abrol
Former DDG (NRM), ICAR and
Director, Centre for Advancement
of Sustainable Agriculture
NASC Complex, DPS Marg
New Delhi - 110 012
Appendix 3
Members of TAC (Technical Advisory Committee)
for Challenge Programmes
(As on 31.01.2012)
Prof. S.L. Mehta
Former Vice Chancellor
(MPUA&T)
71 Gokul Nagar
Udaipur - 313 001, Rajasthan
Dr. Gautam Kalloo
Former DDG (Crop Sciences) and
Vice Chancellor, JNKV, Jabalpur
Dr. P.K. Aggarwal
Former National Professor, ICAR
Regional Facilitator, Challenge
Program on Climate Change,
Agriculture & Food Security, IWMI
India Office, NASC Complex, DPS
Marg, New Delhi - 110 012
Prof. R. Banerjee
Head
P.R. Sinha Centre for Bioenergy
I.I.T., Kharagpur - 721 301

Chairman
1. Dr. H.S. Gupta
Director, IARI
Vice-Chairman
2. Dr. H.S. Gaur
Dean & Joint Director
(Education), IARI
Members
3. Dr. Arvind Kumar
DDG (Edn.), ICAR
4. Dr. K.C. Bansal
Director, NBPGR, New Delhi
5. Dr. V.K. Bhatia
Director, IASRI, New Delhi
6. Dr. P.A. Kumar
Director, NRCPB, New Delhi
7. Dr. Malavika Dadlani
Joint Director (Research), IARI
8. Dr. K. Vijayaragavan
Joint Director (Extension)
IARI
9. Prof. A.K. Tyagi
Director
National Institute of Plant
Genome Research,
Aruna Asaf Ali Marg,
P.O. Box No. 10531
New Delhi - 110 067
10. Dr. U.S. Singh
STRASA Coordinator
IRRI, Indian Liaison Office,
NASC Complex, DPS Marg
New Delhi - 110 012
Appendix 4
Members of Academic Council of IARI
(As on 31.03.2012)
11. Dr. I.P. Abrol
Director,
Centre for Advancement of
Sustainable Agriculture
NASC Complex
New Delhi - 110 012
12. Dr. P.G. Chengappa
Former Vice-Chancellor
43, II – Cross, Sneha Nagar
Amrutha Halli Main Road
Bengaluru – 560 092
13. Dr. R. Sai Kumar
Project Director,
DMR, New Delhi - 110 012
14. Dr. Ramesh Kumar
Directorate of Floriculture,
New Delhi - 110 012
15. Dr. Ravinder Kaur
Project Director,
WTC
16. Dr. Suresh Walia
Professor, Agril. Chemicals
17. Dr. V.C. Mathur
Professor, Agril. Economics
18. Dr. D.V.K. Samuel
Head & Professor, Agril.
Engineering
19. Dr. Prem Lata Singh
Professor, Agril. Extension
20. Dr. (Ms.) I.M. Santha
Professor, Biochemistry
21. Dr. Rajendra Parsad
Professor, Agril. Statistics
22. Dr. A.K.Vyas
Head & Professor, Agronomy
23. Dr. (Ms.) Usha K. Chopra
Professor, Agril. Physics
24. Dr. P.K. Malhotra
Professor
Computer Application
25. Dr. Prajneshu
Professor, Bioinformatics
26. Dr. R.D. Gautam
Professor, Entomology
27. Dr. S.D. Singh
Professor
Environmental Sciences
28. Dr. K.V. Prabhu
Head & Professor, Genetics
29. Dr. Subodh Joshi
Professor, Horticulture
30. Dr. V.R. Sagar
Professor
Post Harvest Technology
31. Dr. A.K. Singh
Head, Division of Fruits &
Horticultural Technology
32. Dr. T. Jankiram
Head, Division of Floriculture
& Landscaping
33. Dr. Pritam Kalia
Head, Division of Vegetable
Science
34. Dr. Dolly Wattal Dhar
Professor, Microbiology

35. Dr. Srinivasan
Professor, Molecular Biology
& Biotechnology
36. Dr. Sudarshan Ganguly
Professor, Nematology
37. Dr. I.S. Bisht
Professor, Plant Genetic
Resources
38. Dr. Pratibha Sharma
Professor, Plant Pathology
39. Dr. V.P. Singh
Professor, Plant Physiology
40. Dr. S.S. Parihar
Professor, Seed Science
& Technology
41. Dr. R.D. Singh
Professor, Soil Science &
Agricultural Chemistry
42. Dr. R.K. Sharma
Professor
Water Science & Technology
43. Dr. R.S. Chhillar
Master of Halls of Residences
44. Ms. Usha Khemchandani
In-charge
IARI Library
45. Dr. Sunil Pabbi
Faculty Representative
46. Dr. Anil Sirohi
Faculty Representative
47. Dr. K.M. Manjaiah
Officer Incharge, AIM Cell
PG School
48. Shri H.H. Kumarasamy
President, PGSSU
49. Shri Bontha Vidyadhar
Students’ Representative
Member-Secretary
50. Sh. B.N. Rao
Registrar & Joint Director
(Admn.)

Chairman
1. Dr. H.S. Gupta
Director, IARI,
New Delhi
Members
2. Dr. K.D. Kokate
DDG, (Extension)
ICAR, KAB, Pusa
New Delhi - 110 012
3. Dr. K. Vijayaragavan
Joint Director (Extension),
IARI, New Delhi
4. Dr. Malavika Dadlani
Joint Director (Research)
IARI, New Delhi
5. Sh. B.N. Rao
Registrar & Joint Director
(Admn.), IARI
6. Dr. K.V. Prabhu
Head, Genetics
IARI, New Delhi
7. Dr. A.K. Vyas
Head, Agronomy
IARI, New Delhi
8. Dr. R.K. Jain
Head, Plant Pathology
IARI, New Delhi - 110 012
Appendix 5
Members of Extension Council of IARI
(As on 31.03.2012)
9. Dr. Suresh Pal
Head, Agril. Economics
IARI, New Delhi
10. Dr. V.A. Tonapi
Head, Seed Science and
Technology, IARI,
New Delhi
11. Dr. D.V.K. Samuel
Head, Agril. Engg.
IARI, New Delhi
12. Dr. B.S. Dwivedi
Head, Soil Science &
Agricultural Chemistry
IARI, New Delhi
13. Dr. G.T. Gujar
Head, Entomology
IARI, New Delhi
14. Dr. Subodh Joshi
Professor, Vegetable Science
IARI, New Delhi
15. Dr. Ravinder Kaur
Project Director, WTC
IARI, New Delhi
16. Dr. A.N. Mishra, Head, IARI
Regional Research Station,
Indore (MP)
17. Agril. Commissioner, Deptt.of
Agriculture & Cooperation,
Ministry of Agriculture, Krishi
Bhavan, New Delhi
18. Sh. D.K. Thakur
Joint Director (Agriculture),
Govt. of NCT of Delhi, MSO
Building, 11th Floor, IP Estate,
New Delhi
19. Sh. Kailash Chandra, Director
(Ag. Mktg.) Govt. of NCT of
Delhi, 49, Shamnath Marg, Old
Sectt., Delhi-54
20. Dr. Khajan Singh, Principal
Scientist. Dairy Extension,
NDRI, Karnal
21. Dr. M. Kazmi, Director (FI),
Directorate of Extension,
Krishi Vistar Sadan, Behind
Agronomy Division, IARI
Campus, New Delhi - 110 012
Member-Secretary
22. Dr. J.P. Sharma
Head, Agricultural Extension,
IARI, New Delhi

Chairman
Director, IARI
Members
Deputy Director-General (Crop
Sciences), ICAR
Appendix 6
Members of Institute Research Council
(As on 31.03.2012)
Joint Director (Research), IARI
All Project Directors/Project
Coordinators of IARI
All Heads of Divisions / Regional
Stations of IARI
All Principal Investigators of IARI
Member-Secretary
Principal Scientist (PME), IARI

Chairman
1. Dr. H.S. Gupta
Director, IARI
Members
2. Dr. H.S. Gaur
Dean & Joint Director
(Education), IARI
3. Dr. Malavika Dadlani
Joint Director (Research)
IARI
4. Dr. K. Vijayaragavan
Joint Director (Extension),
IARI
5. Dr. Madhuban Gopal
National Fellow, Division of
Agricultural Chemicals
Appendix 7
Members of Executive Council of IARI
(As on 31.03.2012)
6. Dr. Pritam Kalia
Head, Division of Vegetable
Science
7. Dr. Y.P. Sharma
Head, IARI Regional Station,
Amartara Cottage, Shimla
8. Dr. A. K. Saxena
Head, Division of
Microbiology
9. R. K. Pal, Head,
Division of Post Harvest
Technology
10. Dr. R. K. Jain, Head,
Division of Plant Pathology
11. Dr. Raj Deo Rai
Head, Division of
Biochemistry
12. Dr. Suresh Pal
Head, Division of Agricultural
Economics
13. Dr. Ramesh Kumar
Director, Directorate of
Floriculture, Pusa Campus,
New Delhi-110012
14. Dr. S.S. Atwal
Head, Regional Station, Karnal
15. Dr. Swapan Kumar Datta,
DDG (CS)
ICAR, Krishi Bhawan
Member-Secretary
16. Sh. B.N. Rao
Registrar & Joint Director
(Admn.)

Chairman
1. Dr. H.S. Gupta
Director
Members (Official Side)
2. Dr. H.S. Gaur
Dean & Joint Director
(Education)
3. Dr. Jagdish Kumar
Head, R.S. Wellington
4. Sh. Radhey Sham
Comptroller
5. Dr. P. Natu
Sr. Scientist (PME)
Directorate
6. Sh. Puspender Kumar
Chief Admn. Officer
Secretary (Official Side)
7. Sh. B.N. Rao
Registrar & Joint Director
(Admn.)
Appendix 8
Members of Institute Joint Staff Council (IJSC)
(As on 31.03.2012)
Members of the Staff Side
(Elected)
1. Sh. Veer Pal Singh
Technical Officer (T-5)
Centre for Protected
Cultivation Technology
2. Sh. S.C. Dixit
T-4, Division of Genetics
3. Sh. Mithlesh Narayan
(T-4), Division of Genetics
4. Sh. Chetan Swaroop Issar
AAO, Directorate
5. Sh. Radhey Krishan Thakur
UDC, Directorate
6. Sh. Yogesh Kumar
UDC, Directorate
7. Sh. Ajit Singh Rainu
UDC, Division of Entomology
8. Sh. Umesh Thakur
SSS, Directorate
9. Sh. Bijender Singh
SSS, CATAT
10. Sh. Dharm Singh
SSS, Division of Soil Science &
Agricultural Chemistry
11. Sh. Shashi Kant Kamath
SSS, Seed Production Unit
Secretary (Staff Side)
12. Sh. Ganesh Rai
T-2, Division of Entomology

Directorate
Director
Dr. H.S. Gupta
Dean & Joint Director (Education)
Dr. H.S. Gaur
Joint Director (Research)
Dr. Malavika Dadlani
Joint Director (Extension)
Dr. K. Vijayaragavan
Joint Director(Admn.) &
Registrar
Mr. B.N. Rao
Principal Scientist (PME)
Dr. B.R. Atteri
Incharge, Publication Unit
(English)
Dr. R.L. Sapra
Principal Scientist (ITMU)
Dr. Archna Suman
Comptroller
Mr. Radhey Sham
Chief Administrative Officers
Mr. P.K. Jain
Mr. Pushpendra Kumar
Chief Finance & Accounts Officer
Ms.Bharti Jhade
Agricultural Chemicals
Head
Dr. V.T. Gajbhiye
Professor
Dr. Suresh Walia
Appendix 9
Personnel
(As on 31.03.2012)
Network Project Coordinator
Dr.K.K.Sharma
National Fellow
Dr. Madhuban Gopal
Agricultural Economics
Head
Dr. Suresh Pal
Professor
Dr. V.C. Mathur
Agricultural Engineering
Head & Professor
Dr. D.V.K. Samuel
Agricultural Extension
Head
Dr. J.P. Sharma
Professor
Dr. Prem Lata Singh
Agricultural Physics
Head
Dr. Ravender Singh
Professor
Dr. Usha Kiran Chopra
Agronomy
Head & Professor
Dr. A.K. Vyas
Biochemistry
Head
Dr. R.D. Rai
Professor
Dr. I.M. Santha
Entomology
Head
Dr. G.T. Gujar
Professor
Dr. R.D. Gautam
National Fellow
Dr. G.K. Mahapatro
Floriculture and Land-scaping
Head
Dr. T. Janakiram
Fruits and Horticultural
Technology
Head
Dr. A.K. Singh
Genetics
Head & Professor
Dr. K.V. Prabhu
Microbiology & CCUBGA
Head
Dr. A.K. Saxena
Professor
Dr. Dolly Wattal Dhar
Nematology
Head
Dr. A.K. Ganguly
Professor
Dr. Sudershan Ganguly
Project Coordinator
Dr. R.K. Jain

Plant Pathology
Head
Dr. R.K. Jain
Professor
Dr. Pratibha Sharma
National Fellow
Dr. Rashmi P. Aggarwal
Plant Physiology
Head
Dr. R.K. Sairam
Professor
Dr. V.P. Singh
Post Harvest Technology
Head
Dr. R.K. Pal
Professor
Dr. Vidya Ram Sagar
Seed Science and Technology
Head
Dr. Vilas A. Tonapi
Professor
Dr. S.S. Parihar
Soil Science and Agricultural
Chemistry
Head
Dr. B.S. Dwivedi
Professor
Dr. R.D. Singh
Vegetable Science
Head
Dr. Pritam Kalia
Professor (Hort.)
Dr. Subodh Joshi
Centre for Environment Science
and Climate Resilient
Agriculture (CESCRA)*
Incharge
Dr. R.K. Rattan
Professor
Dr. Shiv Dhar Singh
Water Technology Centre
Project Director
Dr. Ravinder Kaur
Professor
Dr. R.K. Sharma
Centre for Agricultural
Technology Assessment and
Transfer
Incharge
Dr. Ambrish Kumar Sharma
Centre for Protected Cultivation
Technology
Incharge
Dr. Balraj Singh
Agricultural Technology
Information Centre (ATIC)
Incharge
Dr. Monika Wasan
Farm Operation Service Unit
Incharge
Dr. Man Singh
National Phytotron Facility
Incharge
Dr. K.V.Prabhu
Seed Production Unit
Incharge
Dr. B.S. Tomar
Unit for Simulation and
Informatics (USI)
Incharge
Dr. H. Chandrasekharan
IARI Library
Incharge (Library Services)
Ms. Usha Khemchandani
Regional Station, Amartara
Cottage, Shimla
Head
Dr. Y.P. Sharma
Regional Station, Indore
Head
Dr. A.N. Mishra
Regional Station, Kalimpong
Incharge
Dr. Ravindra Kumar
Regional Station, Karnal
Head
Dr. S.S. Atwal
Regional Station, Katrain
Head
Dr. R.N. Barwal
Regional Station, Pune
Head
Dr. V.V. Datar
Regional Station, Pusa
Head
Dr. I.S. Solanki
Regional Station, Wellington
(The Nilgiris)
Head
Dr. Jagdish Kumar
Rice Breeding & Genetics
Research Centre, Aduthurai
Incharge
Dr. M. Nagarajan
Centre for Improvement of
Pulses in South, Dharwad
Incharge
Dr. V. Hegde
IARI KVK, Shikohpur, Gurgaon
Incharge
Dr. Anjani Kumar
*Formerly Division of Environmental
Sciences and including NRL.