note - FIZ Karlsruhe

Advanced similarity searching
Sorting by BLAST percent identity (IDENT)
In addition to the BLAST score (SCORE), DGENE provides the option to sort search results by
BLAST local percent identity (IDENT). This feature is especially useful to when looking for
short, highly similar sequences with a low BLAST score (low overall similarity). IDENT is
available both for sorting and display purposes, and can be used in combination with the similarity
SCORE. Either SCORE or IDENT may be specified as the primary sorting parameter in any dual
sort command. This is seen in the example below. Results may be further grouped into patent
families, using the FSORT command. When FSORT is used on an answer set previously sorted by
IDENT and/or SCORE, the sorting order is retained for each family (see page 40).
Search Question: Find relevant U.S. patents or published applications which disclose a
specific stretch of Equus caballus interleukin 1 receptor antagonist
(IL1RN), mRNA (NCBI: NM_001082525), or similar sequences –
including shorter answers which have high local percent identity.
Page 68 | GENESEQ on STN (DGENE) Workshop Manual
GGAAGAGACCCTGCAAGATGCAAGCCTTCAGAATCTGGGATGTTAACCAGAA
GACCTTCTACATGAGGAATAACCAACTAGTTGCTGGATACTTGCAAGAATCA
AATACTAAATTACAAGAGAAGATAGATGTGGTGCCCATTGAGCCTGATGCTC
TATTCCTGGGACTCCATGGGAGGAAGCTGTGCCTGGCCTGTGTCAAGTCTGG
TGATGAGATTAGGTTCCAATTGGAGGCAGTTAACATCACTGA
Search Strategy
To conduct a similarity search for sequences using BLAST…
Step 1 Save, upload and verify the query
Step 2 RUN the BLAST /SQN (BLASTN) search
Step 3 Decide how many answers to keep
Step 4 Dual sort into descending local percent identity
(IDENT) and descending SCORE order
Step 5 Review the answers retrieved in a free-of-charge
format, including the BLAST alignment (ALIGN)
Step 6 Display selected answers in a bibliographic format