note - FIZ Karlsruhe
note - FIZ Karlsruhe
note - FIZ Karlsruhe
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
Altering BLAST parameters<br />
Advanced similarity searching<br />
Oligonucleotide sequences: changing word size, e-Value and filter<br />
Search Question: Find sequences similar to the following nucleic acid sequence:<br />
AAAATGTTTTTAAAGAAGCCAGCTCAAGCAA<br />
Search Strategy<br />
To conduct a similarity search for nucleotide sequences with<br />
DGENE BLAST altering parameters<br />
Step 1 Run a BLAST similarity search with default settings<br />
Step 2 Keep all answers and sort them by similarity score<br />
Step 3 Display some answers with alignment<br />
Step 4 Run a BLAST similarity search with altered settings<br />
Step 5 Identify additional answers, sort them by similarity<br />
score, and display answers<br />
Run a BLAST similarity search with default settings<br />
=> RUN BLAST AAAATGTTTTTAAAGAAGCCAGCTCAAGCAA/SQN<br />
BLAST Version 2.2<br />
The BLAST software is used herein with permission of the National Center for<br />
Biotechnology Information (NCBI) of the National Library of Medicine (NLM).<br />
BLAST SEARCHING<br />
. . . .<br />
Lambda K H<br />
1.37 0.711 1.31<br />
Gapped<br />
Lambda K H<br />
1.37 0.711 1.31<br />
(continued on next page)<br />
GENESEQ on STN (DGENE) Workshop Manual | Page 51