note - FIZ Karlsruhe
note - FIZ Karlsruhe
note - FIZ Karlsruhe
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
Introduction to similarity searching<br />
Nucleic acid sequences<br />
<strong>note</strong><br />
For nucleotide similarity searching the GETSIM (FASTA) default is single<br />
strand (SIN). In contrast the BLAST default is BOTH strands. In order to<br />
run a corresponding GETSIM search BOTH must be specified, e.g.<br />
=> RUN GETSIM L1 /SQN BOTH<br />
Search Question: Find nucleic acid sequences of more than 100 nucleotides which have<br />
similarity to the following sequence:<br />
Page 36 | GENESEQ on STN (DGENE) Workshop Manual<br />
GGGUUUAGGAGUGGUAGGUCUUACGAUGCCAGCUGUAAUG<br />
CCUACCGGATAA<br />
Search Strategy<br />
To conduct a GETSIM search for nucleic acid sequences…<br />
Step 1 RUN GETSIM using the SQN BOTH option<br />
Step 2 Refine the answer set further by sequence length<br />
Step 3 Sort the answer set by similarity score<br />
Step 4 Display results with ALIGN and SCORE