Automation and Real-time PCR Products and ... - Eppendorf AG

Automation and Real-time PCR 

Products and Applications 2008/09

2 

What ARTS can do for you. 

Eppendorf ARTS stands for “Automation and Real-time Systems,” 

and it is a special division of Eppendorf North America with its own 

sales and support team. They focus solely on the intricacies of real- 

time PCR and liquid handling automation, so you can trust them to 

understand your applications and recommend the right Eppendorf 

system to meet your exact needs. 

Combining quality products with expert, reliable support. 

Go to virtually any lab anywhere in the world, and you will see 

Eppendorf products hard at work—it’s a sure sign of those 

labs’ strong commitment to the quality of their research and 

the accuracy of their results. Why? Because Eppendorf has a 

reputation for producing the best and most reliable laboratory 

equipment and consumables—dating back to the 1950s and ‘60s, 

when we introduced our flagship products: pipettes, centrifuges, 

tips and microcentrifuge tubes. Fast-forward to a new century—and 

a new era in liquid handling and scientific research—and see our 

innovative solutions for automated pipetting and PCR applications. 

Eppendorf ARTS 

Specializing in automation and real-time systems. 

Just one look at our epMotion ® automated pipetting systems, 

and you will love pipetting—it’s true! Say goodbye to tedium and 

repetitive stress injuries, as well as compromised results due 

to manual pipetting error. Say hello to hands-free pipetting with 

complete accuracy and reproducibility. epMotion lets you get 

to more important and interesting work—and have more time to 

concentrate on it. And we’ve priced it so that every lab can afford 

to upgrade. Complete application and product details begin 

on page 6. 

Automation is only one half of the ARTS story. Take a look at our 

space-saving Mastercycler ® ep realplex qPCR instruments: they’re 

designed with the most advanced optics and thermal blocks to 

satisfy even the most stringent qPCR requirements and give you 

highly sensitive and accurate results. Our ultra-fast and flexible 

models have also been documented to cut experiment time in half 

when compared with older, slower systems in use today. Read all 

about them beginning on page 29. 

Eppendorf ARTS is not just about products; we’re equally 

passionate about the type of personal service that comes 

along with them. Enjoy the service and support of dedicated 

professionals to assist you every step of the way with your system 

purchase and with after-sale applications support and service.

Meet your ARTS team. 

They are your colleagues in science and experts in application 

support and customer relations, whose singular purpose is to 

provide you with the best research tools and support available 

anywhere in the United States and Canada. 

Count on your local ARTS Specialist, a highly trained scientist with 

extensive bench experience, to assess your needs and recommend 

the Eppendorf system that’s best for you and your research. 

Then meet your local Field Service Engineer, who will install your 

system and train you to a high level of user confidence. Call our 

Customer Support Representatives with your general inquiries, and 

for method-related questions you can always call our dedicated 

applications hotline for a direct response from a staff scientist. 

Take advantage of everything ARTS has to offer. 

Enjoy innovative products that answer to your needs and take 

your research to the next level. 

Enjoy the service and support of dedicated professionals to 

assist you every step of the way with your system purchase and 

application support. 

Enjoy the peace of mind that our Performance Plans bring, 

keeping your instruments operating at peak efficiency for years to 

come. Services are performed on site by a dedicated Eppendorf 

service professional to keep downtime at a minimum. 

We also have several service centers located across the United 

States and Canada to provide expert validation, calibration, and 

a host of other repair services, should the need arise. 

Eppendorf: In touch with life, in touch with you. 

“In touch with life” is not just a catch-phrase under our logo—it’s 

our mission and has been for over 60 years. By introducing cutting- 

edge products and technologies, we support the advancement 

of life science research; and through our ARTS organization we 

support YOU in making these advancements possible. 

Your ARTS team is here for you: 

Contact us by phone 

1-800-645-3050, M–F 8:30 am – 6:00 pm EST (U.S) 

1-800-263-8715, M–F 8:30 am – 5:00 pm EST (Canada) 

Contact us by email 

artsinfo@eppendorf.com (general inquiries) 

arts@eppendorf.com (applications support) 

Visit us online 

In the U.S., www.eppendorfna.com 

In Canada, www.eppendorf.ca

Table of contents 

Info 

Table of contents 

Introduction to epMotion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .6 

epMotion selection guide . . . . . . . . . . . . . . . . . . . . . . . . . . . . .7 

epMotion system overview . . . . . . . . . . . . . . . . . . . . . . . . . . . .8 

Automated real-time PCR set-up . . . . . . . . . . . . . . . . . . . . . .10 

Automated nucleic acid preparation . . . . . . . . . . . . . . . . . . . .11 

epMotion 5070 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .12 

epMotion 5075 LH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .14 

epMotion 5075 VAC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .16 

epMotion 5075 MC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .18 

Real-time PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .29 

Mastercycler ep realplex. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .30 

Gradient function: a highly useful tool for 

optimizing real-time PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . .34 

Impulse PCR: a novel, accelerated and 

improved qPCR Hot Start method . . . . . . . . . . . . . . . . . . . . . .36 

High-speed, real-time PCR assay design 

for realplex silver block models . . . . . . . . . . . . . . . . . . . . . . . .38 

Automated genomic DNA purification 

from tissue culture cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .49 

Isolation of high quality BAC DNA . . . . . . . . . . . . . . . . . . . . . .52 

Accurate and precise pipetting of soluents . . . . . . . . . . . . . . .56 

PureLink 96 Total RNA Purification Kit . . . . . . . . . . . . . . . . .58 

Automated genomic DNA purification in 

96-well plate and 8-well strip format . . . . . . . . . . . . . . . . . . . .60 

Mastercycler ep realplex—a flexible device 

for fast and accurate real-time PCR. . . . . . . . . . . . . . . . . . . . .65 

Automated Pipetting Systems 

Real-time PCR 

Applications 

Appendix 

Product appearance, specifications, and/or prices are subject to change without notice. 

epMotion 5070 CB . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .19 

epMotion control options . . . . . . . . . . . . . . . . . . . . . . . . . . . . .20 

epBlue PC software for epMotion . . . . . . . . . . . . . . . . . . . .21 

epMotion accessories . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .22 

epMotion tools and tips . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .23 

Technical specifications . . . . . . . . . . . . . . . . . . . . . . . . . . . . .24 

Order information, general . . . . . . . . . . . . . . . . . . . . . . . . . . .25 

Order information, accessories . . . . . . . . . . . . . . . . . . . . . . . .26 

Benefits of realplex’s homogeneity and 

accuracy on reproducibility in real-time qPCR. . . . . . . . . . . . .42 

Optical concept highlight – 96 well excitation . . . . . . . . . . . . .43 

twin.tec PCR plates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .44 

twin.tec real-time PCR plates. . . . . . . . . . . . . . . . . . . . . . . . . .45 

Heat sealing instruments and consumables . . . . . . . . . . . . . .46 

Low volume real-time PCR 

on the Mastercycler ep realplex. . . . . . . . . . . . . . . . . . . . . . . . . 71 

Real-time RT-PCR diagnosis of the avian influenza 

virus using Mastercycler ® ep realplex S and 

AIV RT-PCR kits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .74 

Improved reproducibility and sensitivity in real-time 

PCR with Eppendorf ® twin.tec real-time PCR plates . . . . . . . .77 

Successful qPCR with small reaction volumes on 

Eppendorf Mastercycler ® ep realplex. . . . . . . . . . . . . . . . . . . .80 

qPCR: Definitions, concepts and overview . . . . . . . . . . . . . . .87 Calculating primer quantity . . . . . . . . . . . . . . . . . . . . . . . . . . .93 

Detection chemistries. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .88 PCR calculator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .94 

Methods of real-time PCR quantification. . . . . . . . . . . . . . . . .90 Abbreviations, symbols and conversion factors. . . . . . . . . . . .96 

Methods of primer and probe validation . . . . . . . . . . . . . . . . .91 Genetic code and amino acid properties. . . . . . . . . . . . . . . . .98 

References, resources and useful websites. . . . . . . . . . . . . . .92 

How to buy 

Products listed in this catalog can be purchased directly from 

Eppendorf North America. Your local Eppendorf ARTS Specialist 

can help you choose the Eppendorf system that best meets your 

needs and provide you with a price quotation. When you’re ready 

to order, call Eppendorf Customer Support at 1-800-645-3050, 

ext. 2101. Select products can also be purchased through the 

Eppendorf eShop at www.eppendorfna.com/eshop. 

Orders can be placed using a purchase order or major credit card. 

We accept VISA ® , MasterCard ® and American Express ® . We also 

accept EDI order transfers. Please contact our Customer Support 

department for more information. 

Prices and specifications 

Product appearance, specifications and/or prices are subject 

to change without notice. 

Product warranty 

Eppendorf products are warranted against defects in workmanship 

and materials. Contact our Customer Support department at 

1-800-645-3050, ext. 2101, for warranty information on specific 

products and warranty extensions that may be available. Product 

warranty information is also available on our website. 

Freight terms 

Parcel and motor freight shipments ordered collect are F.O.B. 

Westbury, NY. In most cases, prepaid shipments are F.O.B. 

destination.

Automated Pipetting 

Systems 

ARTS

Instruments | Automated Pipetting 

Automated pipetting 

epMotion Automated Pipetting Systems: the next step in liquid handling 

Ever since Eppendorf invented the microliter pipette 45 years ago, 

we have been passionate about precision in liquid handling. This 

passion for excellence is clearly demonstrated in our epMotion ® 

systems. These products are flexible enough to use in virtually any 

assay that can be manually pipetted, from sample prep to assay 

set-up. 

With epMotion automated systems, you will see pipetting in a new 

light. All your routine pipetting tasks, whether small or large, will be 

automated with more precision and reproducibility than you ever 

experienced with manual pipetting. 

Learn how simple it is to automate. The revolutionary and easy 

to use epMotion lends itself to all laboratory environments. The 

software is so intuitive you can learn it in just one morning and be 

up and running protocols that same afternoon. Options for the 

integrated compact control panel or the flexible PC version make 

it easy for anyone to use, anywhere. Features such as pipetting 

pattern recognition or the ready to go Plug’n’Prep ® methods ensure 

that entering the world of automation is fast and easy. 

Order direct from Eppendorf North America. 


Learn about our unique pipetting range from 1 µl to 1,000 µl. With 

epMotion, you can experience utmost precision even at the lowest 

volumes without complex pipetting commands. Our open platform 

lets you automate your applications with all your favorite labware. 

We have more than 700 single-tube formats, well plates, and even 

unusual plastics such as real-time rotor tubes included in our 

database and available for immediate use. 

Discover new possibilities: Save reagent costs in real-time 

PCR, enjoy the choices in nucleic acid preparation, get more 

performance out of your cell culture work, finish first in your 

genomics projects, and experience more reliability in clinical 

research. With five models, two instrument sizes, and multiple 

pipetting deck combinations to choose from, epMotion is the 

perfect companion for your workload. epMotion —discover 

the possibilities.

epMotion selection guide 

epMotion Capacity Applications 

0 0 4-position deck and 

3 virtual positions 

System description page 12 

0 0 CB 4-position deck and 

3 virtual positions, 

specially designed to 

fit into a laminar flow 

hood or fume hood 


0 LH 12-position deck 


‡ Transporting 

‡ Stacking ability 

‡ 3 thermo modules 

(optional) 

0 VAC 11-position deck and 

1 vacuum station 


0 MC 9-position deck 

and 1 position 

for Mastercycler ® ep 


Read our detailed epMotion application examples: 

Automated real-time PCR set-up, page 10 

Automated nucleic acid preparation, page 11 

General pipetting tasks 

‡ Serial dilutions 

‡ Tube to plate transfer 

‡ Reformatting of plates 

‡ Concentration normalization 

‡ Hit-picking 

‡ Reagent transfer 

‡ Pooling 

Examples: All routine pipetting, e.g. sample/ 

reagent transfer, qPCR or immunoassays 

Cell culture 

‡ Cell separation 

‡ Change of media 

‡ Cytotoxicity assays 

‡ Growth curves 

‡ Soft agar assays 

‡ Cell-based assays 

‡ Apoptosis assays 

Examples: Cell culture maintenance 

and assays 

Genomics applications 

‡ Real-time PCR set-up 

‡ PCR set-up with automated amplification 

‡ Sequencing set-up 

‡ SNP detection 

‡ Forensics 

Examples: All routine pipetting, e.g. sample/ 

reagent transfer, qPCR or immunoassays 

Nucleic acid purification 

‡ gDNA from various matrixes 

‡ Total and viral RNA 

‡ Plasmid preparation 

‡ BAC purification 

‡ PCR and sequencing clean-up 

‡ Bacterial DNA 


Examples: Nucleic acid extraction, Plug’n’Prep ® 

protocols, filtration, and solid phase extraction 

Complex assays 

‡ Luminex ® assay set-up 

‡ HLA genotyping 

‡ Advalytix PCR slide pipetting 

Examples: Fully automated PCR: set-up 

and amplification 

In the U.S.: Eppendorf North America 800-645-3050 • In Canada: Eppendorf Canada Ltd. 800-263-8715 

email: info@eppendorf.com • www.eppendorf.com 

Automated Pipetting | Instruments


8 


epMotion Automated Pipetting Systems 

Easy to use 

‡ No other automation compares to epMotion 

– Software can be fully mastered in only a few hours 

– Optical sensor for safe operation examines 

the worktable for correct loading 

– No teaching required – labware data is available 

as free download at www.epMotion.com 

Accurate 

‡ Superior automated liquid handling 

– Pipetting tools with single- and eight-channel 

Eppendorf air cushion technology 

– Pipetting range from 1 to 1,000 µl, always 

from air to minimize cross-contamination 

– Typical pipetting precision below 2% CV at 1 µl* 

* Eppendorf application note 168: “Measuring the Accuracy and Precision of the 

epMotion ® 5070 Workstation Using the Artel Multichannel Verification System (MVS ® ).” 


Flexible 


‡ Every application, every day 

– Tubes range from 0.2 ml PCR to 50 ml blue-cap tubes 

– Plates range from 6 to 96 and 384 wells 

– Filter and non-filter tips, specially selected for straightness, 

non-carbonized to reduce costs 

– Sterile tips available 

epMotion application overview, see page . 

To learn more visit www.epmotion.com.


Five different epMotion systems give you the freedom to 

handle any application: 

‡ epMotion 5070 

‡ epMotion 5070 CB (cell biology) 

‡ epMotion 5075 LH (liquid handling) 

‡ epMotion 5075 VAC (vacuum technology) 

‡ epMotion 5075 MC (PCR set-up and amplification) 

epMotion selection guide, see page . 

Control options for all models 

‡ Compact epMotion control panel (see page 20) 

‡ Easily operated epMotion PC version (see page 20) 

Features for all models 


‡ Verified single-channel and multi-channel pipetting tools 

‡ Completely contained housing including door safety mechanism 

‡ Optical sensor for identification of labware, tips, and 

reagent volumes 

‡ Easy to use software with pre-loaded labware files 

Options for 0 models 

‡ Plate gripper 

‡ Up to three temperature control positions 

‡ Built-in vacuum 

‡ Built-in thermal cycler 

Check out our latest video at www.epmotion.com/video. 



9 



10 


�� 

Automated real-time PCR set-up 

Less reagents needed, more reproducibility delivered 

With epMotion, you can increase reproducibility in real-time PCR 

experiments significantly. In an experimental attempt to pipette 

a real-time PCR sample 96 times, the epMotion shows superior 

results compared to manual pipetting by reducing the standard 

deviations from 0.34 to 0.18 (Fig. 1).* This decreases the number 

of sample replicates needed to statistically confirm an increase in 

gene expression. With epMotion, your real-time PCR experiments 

become more significant. 

* Data kindly provided by Mikael Kubista, TATAA Biocenter, Göteborg, Sweden. 

�� 

�� 

�� 

�� 

�� 

�� 

� 

� 

� 

� 

Visit www.save-reagents.com 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

� � � �� 

‡ Fig. 1a/1b: Reproducibility in real-time PCR set-up 

left: Manual dispensing (SD=0.34), right: Automated dispensing (SD=0.18)* 

‡ With epMotion, your 

real-time PCR cycler 

becomes ultra-efficient. 



Versatility: Enjoy it with any real-time system! 

The epMotion is compatible with any real-time cycler. 

With epMotion, you have the flexibility of using single tubes, 

96- or 384-well plates, or unusual plastics such as real-time rotor 

tube-strips. You can even save on tips with the multi-dispensing 

capability of epMotion. 

epMotion: Spend less on reagents! 

Reagents are a critical cost factor when performing real-time 

PCR experiments, and sometimes the cost of reagents can even 

limit your research projects. epMotion delivers utmost pipetting 

precision from 1 µl to 1,000 µl. Reaction volumes as low as 5 µl 

can easily be achieved, cutting your reagent costs by as much 

as 80%. 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

� 

� 

� 

� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

� � � ��

Plug'n'Prep automated nucleic acid preparation 

More choices with pre-tested Plug’n’Prep ® protocols 

Purification of nucleic acids is a time-consuming process. epMotion 

provides walk-away automation. 

With the unique Plug’n’Prep ® technology, you are only four 

steps away from truly simple and fast purification of up to 

9 samples per run: 

1 

2 

3 

4 

Finally forget about tedious and stressful repetitive 

pipetting. Choose your preferred extraction brand 

and benefit from manufacturer pre-tested 

Plug’n’Prep ® methods. 

Download the pre-tested methods 

from www.epMotion.com. 

Transfer the method data 

file to the epMotion. 

Place samples in the epMotion 

and press “start”. 

1 

2 

3 

4 


epMotion is a true open system. It allows you to choose the type 

of extraction you need from the brands that you prefer. 

And since epMotion can fully automate your protocol, you are 

available to do other tasks while your sample is being purified. All 

epMotion methods have been optimized and tested in cooperation 

with the kit manufacturer. Our Plug’n’Prep ® protocols provide 

superior nucleic acid yield and purity. 

epMotion automated pipetting systems 

give you freedom of choice: 

gDNA extraction from blood, 

tissue, and cultured cells 

Total RNA and 

virus RNA isolation 

Plasmid and 

BAC purification 

PCR and 

sequencing clean-up 



11 



12 


epMotion 5070 Automated Pipetting System 

The epMotion 5070 is the most compact solution for accurate and 

reproducible automated pipetting. With four deck positions, it can 

hold tips, reagent reservoirs, single tubes, tube racks, microplates, 

or PCR plates with up to 384 wells. Two options are available to 

control automated pipetting: epMotion PC version or epMotion 

control panel (see page 20). 

Safety door 

epMotion can be fully closed. 

Operation is paused when the door 

is opened during a run. 

4-position worktable 

Perfect for up to 192 samples per run. 

Specially designed for applications such as 

real-time PCR or immunoassay set-up, 

tube to plate transfer, serial dilutions, or sample 

normalization. 

Control panel 

Compact and easy to use, 

graphical color display. 



More reliability—change to the best in pipetting. 

Get the optimum in reproducible 

pipetting for really reproducible results. 

“We have used the epMotion 5070 for more than two years 

to set up low-volume reactions for our 48-channel 

capillary sequencers. The epMotion enables us to run 

ten plates a day at 2 µl reaction volume with maximum 

reliance and reproducibility.” 

Dr. Yogesh S. Shouche, 

Scientist ‘E’ (In-Charge DNA Sequencing), 

National Centre for Cell Science, Pune, India

epMotion 5070 Automated Pipetting System 

Automated pipetting – ultra-compact 

This makes the epMotion 5070 a perfect match for any routine 

application such as serial dilutions, reagent distribution, sample 

transfer from tubes to plates, and sample normalization. 

Due to its exceptional accuracy, the epMotion 5070 sets the 

standard for automated pipetting and real-time PCR set-up. The 

epMotion 5070 enables assay set-up with less reagent volume and 

excellent reproducibility – within and even across experiments! 


More savings—reduce reaction volumes 

and change to more dense plates 

to cut reagent costs. 

“The epMotion saved us a significant amount of money in 

our real-time PCR work, as we were able to decrease 

to a 5 µl total reaction volume. Additionally, we benefited 

from absolute reproducibility in pipetting volumes that 

is far better than with manual pipetting. We realized that 

our investment in the epMotion was easily recovered in 

about one year, based on the reagent savings.” 

Elaine R. Mardis, Ph.D. 

Associate Professor in Genetics and 

Molecular Microbiology, Director, Technology Development 

and Co-Director, Genome Sequencing Center, 

Washington University School of Medicine, 

St. Louis, Missouri, USA 

Optical sensor 

Checks loading of the worktable for tips 

(type and number), labware type, and even 

liquid volumes in vessels. 

Pipetting tools 

High-precision pipetting tools based on the 

Eppendorf air cushion liquid handling 

technology. Unique free-jet dispensing 

minimizes the risk of cross-contamination. 

Manually interchangeable between singleand 

eight-channel tools. 

Small footprint 

Only 65 cm × 48 cm. Fits on even 

the smallest available lab bench. 

For more details, see also: technical specifications, pages 24 and 2 . 



13 



14 


epMotion 5075 LH Automated Pipetting System 

The epMotion 5075 LH is the ideal solution for advanced liquid 

handling demands. It offers the same outstanding accuracy and 

precision as the epMotion 5070, making it an excellent tool for 

demanding, small-volume applications such as real-time PCR 

set-up or magnetic bead purification, as well as any routine 

pipetting task. 

Gripper 

Move plates to different positions 

on the deck. 


Increased batch sizes. 

Stacking options for micro and deepwell plates. 



More simplicity—automate your projects faster 

than you’ve ever imagined. 

“We came to the conclusion that we could automate 

complex pipetting steps more quickly and simply with 

Eppendorf’s epMotion liquid handling platform than 

with any other system.” 

Neil Campbell, Sr. Experimental Officer, 

CMD, Liverpool, UK

epMotion 5075 LH Automated Pipetting System 

Automated pipetting with maximum flexibility 

The 12 positions, automatic tool exchange, and transporting 

capabilities expand the application range to handle complex 

patterns and higher sample numbers. With heating and cooling, as 

well as the gripper option, the epMotion 5075 LH is one of the most 

flexible and advanced automated pipetting systems available. Two 

options are available to control automated pipetting: epMotion PC 

version or epMotion control panel (see page 20). 


Learn more about the accuracy and precision of the epMotion 

automated pipetting system. See the applications note on pages 

and . 

Automated tool exchange 

Enables the execution of more 

complex pipetting patterns. 

Plate stacking 

Up to five microplates or two deepwell plates 

can be stacked on each other by the gripper. 

3 thermal element options 

Peltier-based thermal element for 

heating or cooling of samples or reagents. 




1 



1 


epMotion 5075 VAC Automated Pipetting System 

The epMotion 5075 VAC is all about productivity. With epMotion 

5075 VAC’s unique Plug’n’Prep ® applications, you can choose 

virtually any kit for your purification needs and you are free from the 

bench with true walk-away automation. Plug’n’Prep ® also means 

it’s easy to set-up—you can start running your protocols 

on the day of installation! Two options are available to control 

automated pipetting: epMotion PC version or epMotion control 

panel (see page 20). 

Gripper 

Moves plates and assembles/disassembles 

the vacuum station without manual interference. 


Designed to automate vacuum-based extraction and 

downstream applications for up to 96 samples. 



More productivity—use your time 

for more important things than tedious 

and repetitive pipetting tasks. 

“The in-house team of automation experts at Promega 

has extensively tested Eppendorf’s epMotion system 

and found it to be very simple to operate. End users 

were trained in less than a day and they were 

developing their own protocols almost immediately.” 

Dan Kephart, Ph.D. , 

Scientific Application Manager, 

Promega Corporation, Madison, Wisconsin, USA

epMotion 5075 VAC Automated Pipetting System 

Plug’n’Prep ® vacuum-based separation technology 

epMotion 5075 VAC has an 11-position deck plus one vacuum 

station for filter plates. The vacuum station is self-adjusting; you 

no longer have to “stack collars” of varying sizes around the lower 

plate. In addition to the range of pre-tested Plug’n’Prep ® protocols, 

alternative purification methods or downstream applications can 

be composed individually. 


Learn more about epMotion 0 VAC nucleic acid purification 

applications. See pages 49, 2, 8, and 0. 

Integrated vacuum pump 

No tubing, wiring, and reservoirs to maintain. 

Silent operation. 

Vacuum station 

Fully integrated. 

Adapts automatically to any filter plate type. 

3 thermal element options 

Peltier-based thermal element for 

heating or cooling of samples or reagents. 




1 



18 


epMotion 5075 MC Automated Pipetting System 

Hands-free PCR 

This epMotion version can be equipped with our Mastercycler ® ep 

PCR system. The integrated cycler enables hands-free set-up 

and amplification from start to finish without manual intervention. 

Automated pipetting with epMotion provides you with more 

accuracy and performance throughout your day. epMotion frees 

you from routine, repetitive pipetting such as setting up PCR 

reactions which gives you more time for other tasks in the lab. 

Gripper 

Moves the plate 

to the Mastercycler ® ep. 

Automated sealing 

Sealing of plates with 

reuseable silicon-based 

cycle lock system. 


System features 


‡ Integrated Mastercycler ® ep software 

‡ Fits Mastercycler ® ep gradient with motorized lid 

‡ Robust, high-quality aluminum block in 96/384-well format 

‡ 96-well silver block for maximum speed 

‡ Gripper for plate transport 

‡ Multitasking: simultaneous PCR reaction and liquid handling 

‡ Automatic plate sealing before PCR 

‡ Two options are available to control automated pipetting: 

epMotion PC version or epMotion control panel (see page 20). 

Interested in real-time PCR? Read our application example: 

Automated real-time PCR set-up, page 10. 

Integrated Mastercycler ® ep 

Automated loading 

of the cycler.

epMotion 5070 CB Automated Pipetting System 

Automated cell culture liquid handling 

epMotion 5070 CB is the first automated pipetting system for 

cell culture applications. Now all the benefits of automated 

pipetting are available for liquid handling tasks inside a tissue 

culture hood or fume hood. 

Handling cells is one of the most tedious tasks in life science 

research. epMotion 5070 CB allows you to automate key processes 

such as seeding cells, media change, or cytotoxicity tests. It 

enables you to handle 6-, 24- or 48-well plates or even denser 

formats from 96 to 384 wells, allowing you the best statistical 

optimization by using a higher number of samples. 

More power—perform applications that you 

are not able to handle manually. 

“The epMotion is a perfect tool to automate cell culture 

liquid handling. With more reproducible pipetting we were 

able to increase the number of data points and we 

obtained a far better statistical background.” 

Dr. René Thierbach, 

Institut für Ernährungswissenschaft, 

Universität Potsdam, Germany 

System features 


‡ Most commonly used cell culture labware is predefined 

for immediate use 

‡ Compatible with almost all culture hood brands 

‡ Sterile pipetting tips available 

‡ Autoclavable pipetting tools 

‡ Innovative light barrier detects hood closing 

‡ Two options are available to control automated pipetting: 

epMotion PC version or epMotion control panel (see page 20). 

Compact design 

Only 65 cm × 48 cm × 63 cm, 

(W × D × H) fits most 

bench types. 

Light barrier beam 

Monitors the closure 

of the bench hood. 




19 



20 


epMotion Control: two smart options 

epMotion offers you two options to control automated pipetting: 

the epMotion PC version or the epMotion control panel. 

Whatever you choose, the innovative epMotion functions make 

programming easy; pipetting pattern recognition, labware database, 

and liquid classes are always included. 

epMotion PC version 

‡ The network interface of the integrated 

PC allows the remote control of the 

epMotion via direct ethernet connection. 

Method files can be shared using 

the computer network or USB port. 

epMotion control panel 



‡ The epMotion PC version with epBlue software offers the most 

convenient way ever to use an automated liquid handling system. 

‡ The epMotion control panel provides all functions and Windows ® 

style programming in an ultra-compact design. 

Control panel features 

‡ Graphical user interface 

‡ Drag and drop programming 

‡ Windows ® explorer style organization 

‡ User management 

‡ Run reports 

‡ Software preinstalled on the 

control panel 

Windows is a registered trademark of the Microsoft Corporation 

in the United States and other countries.

epMotion PC software: epBlue—intuitive operation and programming 

Simple and clear, epBlue guides you through your everyday 

pipetting tasks: Choose your objective in the home section 

and follow the epBlue commands from left to right with unique 

guiding menus and the consistent, tab-based structure. With the 

unmatched ease-of-use of epBlue, even complex methods can 

be generated in minutes. 

‡ The home screen provides fast access to the main 

functions and personal list of the recently used methods, 

while the intuitive graphical user interface provides 

epMotion editor features 


Pipetting pattern recognition, labware database, and liquid classes 

are built-in and organized for intuitive use. Simply set up your 

worktable, select the pipetting commands, simulate, and launch. 

Operating and programming epBlue is fast and easy. 

a consistent, tab-based workflow from left to right. ‡ Menus guide you step by step through the software functions. 

epMotion editor—easy off-line program management 

epMotion editor 

A separate, off-line software package for generating and editing 

methods as well as printing and archiving program processes on 

your PC is also available. 

‡ Programming functions analogous to the control panel 

‡ Graphical user interface identical to epBlue 

‡ Print function 

‡ Archiving function 

‡ Safe operation through 3D run-simulation. 

‡ Transfer of methods using the MMC card 



21 

Automated Pipetting | Software

Accesssories | Automated Pipetting 

22 


epMotion accessories 

Automate all your favorite labware 

Whether 0.2 ml PCR tubes, standard test tubes, 15 or 50 ml blue-cap tubes, six-well plates, 96/384-well microplates, PCR plates, 

or deepwell plates—with epMotion accessories, you can handle it. 

epMotion Accessories 

Reservoir rack 

Enables provisioning of up to 7 

reagent rack modules or reservoirs 

with 30 ml or 100 ml filling volume. 

Reservoir rack modules TC 

Modules for the reservoir rack. 

Seven module sizes are available to 

use tubes from 0.2 ml PCR to 

50 ml tubes. Temperature-controlled 

when used with a thermal module. 

30 ml and 100 ml reagent reservoir 

The reagent reservoirs are both 

“PCR clean,” autoclavable, and 

can be placed in the reservoir rack; 

their special geometry minimizes 

residual volume. 

Racks for single test tubes 

For micro test tubes, 

glass, or plastic tubes. 

Thermoadapter DWP 9 

For heating or cooling of 

deepwell plates. Plates can be 

exchanged by the gripper. 

Thermoracks for 24 × 

Safelock 0. /1. /2 ml tubes 

For 24 micro test tubes. 



epMotion Accessories 

Thermoracks and adapter 

For the use of 96- or 384-well 

PCR plates. 

Height adapter 

Various height adapters enable 

exact height level adjustment 

and accelerated processing of 

microplates. 

Thermoblock for PCR plates 

Thermal block holds 96- or 

384-well PCR plates. 

Allows for temperature control 

when used with a thermal module. 

Gripper for epMotion 0 

For the transport of plates 

on the worktable and for automatic 

operation of the vacuum manifold. 

Thermal module 

(only epMotion 0 ) 

For racks and 96- and 384-well 

PCR plates. Cool or heat up to 

three positions on the deck. 

More information on epMotion accessories: 

order information, page 2 .

epMotion tools and tips 

Accuracy and reproducibility delivered 

Based on Eppendorf classic air cushion pipetting technology 

‡ No tubes, no wires, no air bubbles 

‡ As simple to operate and maintain as a manual pipette 

‡ Excellent pipetting precision, typically below 2% CV at 1 µl* 

‡ Automatic alert when pipetting tools need calibration 

‡ Ultra-low dead volume pipetting 

‡ Every tool tested and certified to ISO 85540 

* Eppendorf application note 168: “Measuring the Accuracy 

and Precision of the epMotion ® 5070 Workstation 

using the Artel Multichannel Verification System (MVS ® ).” 

‡ 50 µl filter tip 

‡ 50 µl tip without filter 

‡ 300 µl filter tip 

‡ 300 µl tip without filter 

‡ 1,000 µl filter tip 

‡ 1,000 µl tip without filter 

epT.I.P.S. Motion 

Specially selected tips for use in automated systems. Each tip 

is inspected for straightness prior to packaging. This ensures a 

perfect handling of 96- and 384-well micro and PCR plates. 

‡ Box packaging ensures contamination-free tip loading 

‡ Non-carbonized, pure virgin polypropylene, both tip and box 

are recyclable 

‡ Standard, filter, and sterile tips available 

‡ PCR-clean quality grade for filter tips 

More information on epMotion tools and tips: 

order information, pages 24 and 2 . 




23 

Automated Pipetting | Consumables


24 



Technical specifications 

epMotion 0 LH 0 VAC 0 MC 0 0/ 0 0 CB 

Labspace 

System Width 140 cm / 56 98 cm / 39 

Depth 75 cm / 30 62 cm / 25 

Dimensions 

Device Width 107 cm / 43 65 cm / 26 

Depth 61 cm / 25 48 cm / 20 

Height 67 cm / 27 63 cm / 26 

Control panel Width 25 cm / 10 

Depth 15 cm / 6 

Height 11 cm / 4.4 

Weight 

Device 85 kg / 188 lb 90 kg / 199 lb 102 kg / 225 lb 45 kg / 99 lb 

Control panel 1.2 kg / 3 lb 

Power supply 

Voltage 100 to 130 V ±10% / 200 to 240 V ±10% 

Frequency 50 to 60 Hz ±5% 

Max. output 1,000 W 70 W 

Ambient conditions 

Air temperature storage –20 to +70 °C / –4 to +158 °F 

operation +15 to +35 °C / +59 to +95 °F 

Atmospheric humidity storage 10 to 80% rF / rH 

operation 55 to 75% rF / rH 

Atmospheric pressure storage 300 to 1,060 hPa / 4.4 to 15.4 psi 

operation 970 to 1,060 hPa / 14.1 to 15.4 psi 

Pipetting performance specification according to ISO 8 

1-channel tool Volume systematic measurement error random measurement error 

TS 0 1 µl ±15 % ≤5 % 

50 µl ±1.2 % ≤0.4 % 

TS 300 20 µl ±4 % ≤2.5 % 

300 µl ±0.6 % ≤0.3 % 

TS 1000 40 µl ±5 % ≤1.5 % 

1,000 µl ±0.7 % ≤0.15 % 

Typical pipetting performance* 

MVS data for epMotion 0 0 

single-channel dispensing tools 

Dispensing 

tool 

Target vol. 

(μl) 


Coefficient 

of variation (%) 

TS 0 1 1.9 

50 0.2 

TS 300 30 0.4 

200 0.3 

TS 1000 40 0.6 

200 0.3 

* Eppendorf application note 168: “Measuring the Accuracy and Precision of the epMotion ® 5070 

Workstation Using the Artel Multichannel Verification System (MVS ® ).” 


in pipetting mode, free jet, without pre-wetting, with distilled water, at 20 °C 

MVS data for the epMotion 0 0 

multichannel dispensing tools 

Dispensing 

tool 

Target vol. 

(μl) 

Coefficient 

of variation (%) 

TM 0-8 1 1.6 

50 0.4 

TM 300-8 20 1.9 

200 0.4 

TM 1000-8 45 0.8 

200 0.3




epMotion 0 LH 0 VAC 0 MC 0 0/ 0 0 CB 

Conductor 

X, Y, Z axes systematic measurement error random measurement error 

Positioning ±0.3 mm ±0.1 mm 

Positions in MTP format 12 12 10 4 

Detector 

Optical confocal infrared detector contact-free detection of liquid levels, tools used, 

labware worktables, tip types, and quantities 

Optical Sensor liquid surface must be 90 ±3° to the vertical plane of the optical sensor 

Gripper 

Carrying capacity ≤1,200 g 

Vacuum unit 

Max. output - (feed) 35 l/min - - 

Suction range - 0.1 to 0.85 

±0.05 hPa 

- - 

Suction time - 1 to 99 minutes - - 

Tempering unit: optional 

Setting range 0 °C to 110 °C - 

Heating time of the heating-cooling plate from 25 °C to 95 °C in 8 minutes - 

Cooling time of the heating-cooling plate from 25 °C to 4 °C in 5 minutes - 

Software 

Operating Software MotionManager v. 4.0 or higher; Firmware: MotionInstrument v. 4.0 or higher; 

Labware 1.0 or higher 

Ordering information 

Description Catalog No. 

epMotion 0 0 

epMotion 0 0 with control panel 

Basic device incl. control panel, mouse, software, waste box, 

MMC, and reader, 50/60 Hz, 100–240 V. 

epMotion 0 0 PC version 

Same as 5070 catalog no. 960000005 but with integrated industrial PC, keyboard, and mouse 

instead of control panel. Software and monitor not included. 

epMotion 0 0 CB with control panel 

epMotion to be operated inside closed containers, basic device 

incl. control panel, mouse, software, waste box, MMC, and reader 100–240 V. 

epMotion 0 0 CB with integrated PC 



epMotion 0 

epMotion 0 LH 

Basic device incl. control panel, software, waste box, 

MMC, and reader, 50/60 Hz, 100–240 V. 

epMotion 0 VAC 

Basic device incl. control panel, software, vacuum system, 

gripper, waste box, MMC, and reader, 50/60 Hz, 100–240 V. 

epMotion 0 MC 

Basic device incl. control panel, software, cycler bay, gripper, 

waste box, MMC, and reader, 50/60 Hz, 100–240 V. Mastercycler ® not included. 

epMotion 0 LH PC version 



epMotion 0 VAC PC version 



epMotion 0 MC PC version 



960000005 

960000100 

960000021 

960000200 

960020006 

960020014 

960020022 

960020101 

960020202 

960020303 



2 


Accessories | Automated Pipetting 

2 





Accessories epMotion PC versions 

Monitor 

19 TFT monitor to be used with epMotion versions with integrated PC. 

epBlue – epMotion PC software 

Preinstalled operating software for epMotion versions with integrated PC, 

epBlue must be ordered with each epMotion PC version. 

Upgrade and conversion kits 

Upgrade Set 1 

Upgrade kit for epMotion 5075 

with serial numbers 1,000 (integrated PC) 

Conversion kit MC 

For conversion of LH version in MC version 

(Mastercycler ® not included) 

Conversion kit VAC 

For conversion of LH version in VAC version 

(vacuum system included) 

Dispensing tools and gripper 



960021044 

960000309 

960021022 

960021033 

960021002 

960021011 

Holder for up to six pipetting tools 960001109 

Dispensing tool TS 0 

960001010 

1-channel dispensing tool for the volume range from 1–50 µl 


960001028 



960001036 

1-channel dispensing tool for the volume range from 40–1,000 µl 

Dispensing tool TM 0-8 

960001044 



960001052 



960001061 

8-channel dispensing tool for the volume range from 40–1,000 µl 

epT.I.P.S. Motion 

epT.I.P.S. Motion 0 μl, volume range 1–50 µl, 

15 × 96 tips in racks, Eppendorf quality 

epT.I.P.S. Motion 0 μl, filter, volume range 1–50 µl, 

15 × 96 tips in racks, PCR-clean 

epT.I.P.S. Motion 0 μl, sterile, volume range 1–50 µl, 

15 × 96 tips in racks 

epT.I.P.S. Motion 0 μl, sterile, filter, volume range 1–50 µl, 


epT.I.P.S. Motion 300 μl, volume range 20–300 µl, 


epT.I.P.S. Motion 300 μl, filter, volume range 20–300 µl, 


epT.I.P.S. Motion 300 μl, sterile, volume range 20–300 µl, 


epT.I.P.S. Motion 300 μl, sterile, filter, volume range 20–300 µl, 


epT.I.P.S. Motion 1,000 μl, volume range 40–1,000 µl, 


epT.I.P.S. Motion 1,000 μl, filter, volume range 40–1,000 µl, 


epT.I.P.S. Motion 1,000 μl, sterile, volume range 40–1,000 µl, 


epT.I.P.S. Motion 1,000 μl, sterile, filter, volume range 40–1,000 µl, 


960050002 

960050029 

960050200 

960050201 

960050045 

960050061 

960050202 

960050203 

960050088 

960050100 

960050204 

960050205





Reagent rack, reservoirs, modules 

Reservoir Rack for use with 30 ml and 100 ml reagent reservoirs 

and reagent rack modules. 

Reservoir Rack Module TC PCR 0.2 ml 

Temperature-controlled for heating or cooling of 8 × 0.2 ml PCR tubes, 

to be used with a reservoir rack. 

Reservoir Rack Module TC PCR 0. ml 

Temperature-controlled for heating or cooling of 8 × 0.5 ml PCR tubes, 


Reservoir Rack Module TC Safe Lock Tubes 

Temperature-controlled for heating or cooling of 4 × 0.5/1.5/2.0 ml tubes, 


Reservoir Rack Module TC Ø 12 mm 

Temperature-controlled for heating or cooling of 4 × 12 mm tubes, 


Reservoir Rack Module TC Ø 1 mm 


must be used with a reservoir rack. 

Reservoir Rack Module TC Ø 1 ml “BlueCap” 


to be used with a reservoir rack, needs two module positions. 

Reservoir Rack Module TC Ø 0 ml “BlueCap” 


to be used with a reservoir rack, needs two module positions. 

epMotion Reservoir 30 ml 

Must be used with a Reservoir Rack. 30 ml maximum volume, 

dead volume optimized. 5 reservoirs packed in separate bags, 10 bags per set. 

All reservoirs are PCR-clean (free of human DNA, DNase, RNase, and PCR inhibitors) 

and made of polypropylene. Production batch tested and certified. 

epMotion Reservoir 100ml 

Same as catalog no. 960051009, but with 100 ml max volume. 

Reservoir Rack Module Adapter TC 30 ml 

Together with a thermal module, enables the temperature control 

of 1 × epMotion reservoir 30 ml, must be used with a reservoir rack 

and a tube reservoir rack module. 

Reservoir Rack Module Adapter TC 100 ml 

Same as catalog no. 960002670, but for 100 ml reservoirs. 

Racks for single tubes, no temperature control, for a supply of Eppendorf tubes ® , glass or plastic test tubes. 

960002148 

960002601 

960002611 

960002620 

960002630 

960002640 

960002650 

960002660 

960051009 

960051017 

960002670 

960002680 

Rack for 24× test tubes, Ø 17 mm × 100 mm max. length 960002024 







Rack for 24× test tubes, Ø 15 × 100 mm max. length 960002377 





Rack for 9 × 1. /2.0 ml screw-cap tubes, 

Two slots of the worktable are blocked, only pipetting mode compatible. 

960002318 



2 

Automated Pipetting | Accessories

Accessories | Automated Pipetting 

28 





Height adapters for uniform levels of labware, this enables faster processing of the plate. 

Height adapter, 85 mm 960002105 

Height adapter, 55 mm 960002113 

Height adapter, 40 mm for tips 960002121 

Thermoblocks, Thermoracks, and Thermoadapter 

Thermoadapter Frosty For cooling of skirted PCR plates by integration 

of PCR Cooler into epMotion adapter system. 

960002300 

Thermorack for 24× Safe-Lock 0.5 ml tubes, temperature control. 960002067 

Thermorack for 24× Safe-Lock 1.5 / 2 ml tubes, 1.5 / 2 ml tubes, 

temperature control. For a supply of 24× 1.5 ml or 2.0 ml test tubes. 

960002075 

Adapter 25× Safe Lock 0.5 ml tubes. 960002172 

Thermoadapter for 9 -PCR Skirted, for heating or cooling of PCR plates, 

plates are exchangeable via the gripper. 

960002199 

Thermoadapter for 384-PCR Skirted, for heating or cooling of PCR plates, 

plates are exchangeable via the gripper. 

960002202 

Thermoblock for PCR 96 wells / tubes 0.2 ml. For use of 48 × 0.2 ml tubes. 960002083 

Thermoblock for PCR 384 wells, for use of a PCR 384-well plate. 960002091 

Thermoadapter DWP 9 

For use with 1.1 ml Eppendorf deepwell plates. 

960002391 

Additional accessories 

epMotion Editor, complete version Incl. editor key, software package for creating and editing methods, 

960000269 

and for printing out archiving program sequences on a PC. 

epMotion Editor, additional license 

960000300 

License for a second PC, USB key. 

Must be used with an epMotion editor package 5075.014.009. 

MultiMediaCard, empty for archiving parameters 

960002008 

and transport of data between control panel and PC. 

Wastebox Receptacle for used pipette tips. 960002016 

Assembly plate To be used with epMotion 5070 CB, 

960002570 

supports laminar flow worktable. 

Additional accessories only for epMotion 0 

Thermal module 

960002181 

Heats or cools microplates or other labware on the epMotion 5075. 

Gripper 

960002270 

Moves plates and vacuum station components on the epMotion 5075. 

Gripper holder 

960002211 

Stand for the gripper on the worktable 

Vac Holder Base for the Vac Frame 960002237 

Vac Lid + Mats Lid for the vacuum manifold 960002245 

Mats for Vac Lid 960002407 

Vac Frame 1 to adapt different filter plates to the vacuum manifold. 960002253 

Vac Frame 2 to adapt different filter plates to the vacuum manifold. 960002261 

CycleLock starter set 

960002288 

1 frame and 8 mats for automated sealing of Eppendorf PCR plates. 

Can only be used with Mastercyler ep and motorized lid. 

All mats are PCR-clean (free of human DNA, DNase, RNase, and PCR inhibitors). 

Production batch tested and certified. 

CycleLock Mats 

960002296 

5 sealing mats, frame not included. All mats are PCR-clean. 

Production batch tested and certified. 


Product appearance, specifications, and/or prices are subject to change without notice.

Real-time PCR 

ARTS 

29

Instruments | Real-time PCR 

30 

Thermal Cycler 

Mastercycler® ep realplex 

Application 

‡ Quantitative real-time PCR 

Product features 

‡ Quick detection 

‡ Choose from fast or 

ultra-high-speed models 

‡ Unrestricted system gives 

you total freedom to use the 

tubes, plates and reagents of 

your choice 

‡ Modular design provides 

several system options 


‡ Compact footprint saves 

valuable bench space 

‡ Solid design for quiet 

operation and dependability 

‡ Intuitive software includes a 

variety of analysis modules for 

easy translation of results 

Quality in all forms 

The new optical system of the Mastercycler ep realplex offers a 

new proprietary particle protection technology* and very sensitive 

photomultipliers of the latest generation. 

Small, fast and flexible 

Mastercycler ep realplex meets all the latest requirements of 

quantitative PCR applications: high-speed temperature ramping, 

short detection times and intuitive assay programming translate to 

huge time savings, so that more experiments can be completed per 

day—with accurate and reliable results. And its flexibility is beyond 

compare—this completely open system allows you to use tubes, 

plates and reagents of your choice. 

Modular and compact in size, realplex can fit in virtually any lab, 

no matter how limited the bench space. Since it is part of the 

premier Mastercycler ep family of thermal cyclers, if you already 

have a Mastercycler ep gradient S in your lab, for example, you can 

upgrade it to a realplex real-time PCR cycler at any time; and the 

realplex 2 module can be replaced by the realplex 4 module if/when 

greater multiplexing becomes essential. 

Eppendorf Thermal Sample Protection technology prevents the 

negative effects of condensation on amplification, and a solid 

construction with minimal moving parts makes this a quiet, 

dependable cycler that promotes consistently high sensitivity. 

*Patent pending. 


Practice of the patented polymerase chain reaction (PCR) process 

requires a license. The Eppendorf Thermal Cycler is an Authorized 

Thermal Cycler and may be used with PCR licenses available 

from Applied Biosystems. Its use with Authorized Reagents also 

provides a limited PCR license in accordance with the label rights 

accompanying such reagents. This is a Licensed Real-Time Thermal 

Cycler under Applera’s United States Patent No. 6,814,934 and 

corresponding claims in non-U.S. counterparts thereof, for use 

in research and for all other applied fields except human in vitro 

diagnostics. No right is conveyed expressly, by implication or by 

estoppel under any other patent claim.


realplex thermoblocks 

Choose either the 96-well aluminum or the 96-well silver 

thermoblock: both feature Eppendorf SteadySlope ® gradient 

technology for assay optimization—even optimization of two-step 

qPCR. If you require the fastest heating and cooling rates, choose 

the silver block, whose performance is enhanced by our unique 

Impulse PCR technology (more information on page 36). 

Both blocks are compatible with either the realplex 2 or realplex 4 

optical modules, which permit the use of nearly all fluorescent dyes 

used in real-time PCR: the realplex 2 module has two fluorescence 

filters and one channel photo-multiplier tube (CPM), while the 

realplex 4 module incorporates four filters and two CPMs for up 

to four-fold multiplexing assays. Our new and innovative CPMs, 

in contrast to conventional photo-multiplier tubes, are far less 

sensitive to magnetic field interference and offer greatly 

increased sensitivity. 

Licensed for real-time PCR, see previous page. 

realplex system product highlights begin on page 34. 

96-well excitation 


The fluorescent dyes chosen for each experiment are excited by 

96 individual LEDs, which have a substantially longer lifespan than 

halogen lamps: a blue light emission of ~470 nm excites nearly all 

applicable fluorophores, including SYBR ® Green, FAM, VIC, TET, 

HEX, ROX, JOE, TAMRA and more; the emitted fluorescence is 

focused through an array of lenses and passed to the optical 

detection unit through 96 individual optical fibers, where our new 

CPMs serve as the detectors. 

Results in real-time 

realplex software offers six different evaluation modules for 

maximum flexibility when processing results. An intuitive user 

interface ensures quick and easy PCR and assay setup, as well 

as simple transfer of previously established PCR protocols. 

Smart programming automatically interprets possible dye 

interferences when performing multiplex assays, and results 

are easily exported to Microsoft ® Excel for GLP compliance 

(as an alternative to the built-in analysis modes). 



31 

Real-time PCR | Instruments


32 



‡ Plate layout 

The clear and comprehensive organization of multiple viewing 

windows, as well as intuitive options for selection within each 

view, enable easy and fast plate setup when creating assays. 

‡ Quantification/relative quantification 

This analysis module performs calculations from raw data 

for a variety of assays, including absolute quantification 

of DNA or relative quantification of gene expression based 

on the DDC t method. 

‡ Endpoint 

The analysis module option for endpoint measurements instructs 

Mastercycler ep realplex to serve as a “plate fluorometer” and aids 

in the determination of absolute fluorescence intensities, even with 

samples previously amplified on standard thermocyclers. 

Licensed for real-time PCR, see page 30. 


‡ Raw data 

This software module displays the generated raw data in real time, 

which means that you can immediately evaluate your real-time PCR 

and interrupt the reaction as soon as the desired result is obtained. 

‡ Gene identification 

Selecting this analysis module option generates allele-discrimination 

results. Data previously generated in melting curve analyses, end- 

point measurements or C t-value determinations serves as the basis. 

‡ +/– Assay 


Define critical threshold values through this analysis module 

option to differentiate between positive and negative samples 

(e.g., for the detection of pathogens). Data from previous endpoint 

measurements serves as the source for such determinations.



Optical module 

Excitation source: 96 LEDs (470 nm) 

Emission filters: 520 nm/550 nm/580 nm/605 nm (realplex 4 ) 

520 nm/550 nm (realplex 2 ) 

Detector: 2-channel photo-multiplier tubes (realplex 4 ) 

1-channel photo-multiplier tube (realplex 2 ) 

Dynamic range: 9 orders of magnitude from starting copy number 

Sensitivity: ≤ 50 fM fluorescein 

Thermomodule 

Sample capacity: 96 x 0.2 ml PCR tubes or one 96 PCR plate 

(unskirted, semiskirted or skirted—as per SBS standard) 

Temperature control range of block: 4 °C–99 °C 

Degree range of gradient, maximum: 1 °C–24 °C (thermomodule Mastercycler ep S) 

1 °C–20 °C (thermomodule Mastercycler ep) 

Temperature control range of gradient: 30 °C–99 °C 

Temperature of lid: 105 °C 

Block homogeneity: 35 °C ± 0.3 °C 

90 °C ± 0.4 °C 

Control accuracy: ± 0.2 °C 

Heating speed*: approx. 6 °C/s (thermomodule Mastercycler ep S) 

approx. 4 °C/s (thermomodule Mastercycler ep) 

Cooling speed*: approx. 4.5 °C/s (thermomodule Mastercycler ep S) 

approx. 3 °C/s (thermomodule Mastercycler ep) 

Complete system 

Dimensions (W x D x H): 10.2 x 16.1 x 15.6 in/26 x 41 x 39.6 cm 

Total weight: 53 lb/24 kg 

Weight of thermomodule: 37.5 lb/17 kg 

Weight of detection module: 15.4 lb/7 kg 

Voltage requirements: 100–130 V/50–60 Hz 

Power consumption: 800 W 

*Measured at block 




Mastercycler ® ep realplex: 

Mastercycler ® ep realplex 2 , with aluminum block and two emission filters Please inquire 

Mastercycler ® ep realplex 2 S, with silver block and two emission filters 

Mastercycler ® ep realplex 4 , with aluminum block and four emission filters 

Mastercycler ® ep realplex 4 S, with silver block and four emission filters 

Optical detection module to upgrade Mastercyler ep gradient / S 

realplex 2 Please inquire 

realplex 4 

Service 

Performance Plans Please inquire 

Validation/calibration service 



33 



34 


Product highlights—Mastercycler® ep realplex 

Gradient function: a highly useful tool for optimizing real-time PCR 

The right choice of annealing temperature for primers (and probe) 

has a significant influence on the performance and efficiency of 

real-time PCR reactions. While software programs offer various 

algorithms to estimate this temperature, the best way to accurately 

determine optimal annealing temperature is empirically. 

Mastercycler ep realplex’s gradient function 1 offers a wide 

temperature range across all 12 column well positions of the 

thermoblock, and it provides 12 different temperatures to test in 

a single experiment: choose a temperature span from 1 °C up to 

20 °C when using the aluminum block, or from 1 °C to 24 °C when 

using the silver block. 

The gradient function is easy to use, and its importance for real- 

time PCR optimization is demonstrated in the following assay. 

‡ Fig. 1: Simple programming of realplex’s annealing 

temperature gradient step 

The gradient preview for the 12 column well positions on the block 

demonstrate the highly linear characteristic of its Triple Circuit 

Peltier design. 



Real-time PCR with gradient function—assay setup 

A mastermix containing RealMasterMix 2 , SYBR ® Green I and prim- 

ers was prepared to amplify and detect a sequence segment of 

the Beta globin gene. A temperature gradient over a range of 24 °C 

(from 44 °C to 68 °C) on the Mastercycler ep realplex S (silver block) 

was programmed for the annealing step (Fig. 1). The program in 

detail: 95 °C for 2 min; 40 cycles of 95 °C for 15 s, 44 °C–68 °C for 

30 s, 68 °C for 60 s; and finally a melting curve analysis. 

For each of the 12 different annealing temperatures, 3 sample 

replicates, each with 5 ng of human genomic DNA as template, 

and one negative template control (NTC) were prepared. 

1 U.S. Pat. 6,767,512. 

2 U.S. Pat. 6,667,165.


Gradient function: a highly useful tool for optimizing real-time PCR, continued. 


Well position 1 2 3 4 5 6 7 8 9 10 11 12 

Annealing 

temperature (°C): 

44.1 44.7 46.2 48.6 51.4 54.6 57.8 61.0 63.8 66.0 67.4 67.8 

Mean C t: 28.5 28.7 28.1 26.9 25.6 25.0 24.3 24.1 24.0 23.9 24.1 24.4 

Specific PCR product: - - (+) + + + + + + + + + 

Nonspecific 

PCR product: 

+ + + (+) - - - - - - - - 

‡ Table 1: Analysis parameters of the three replicates for each well position 

Results and conclusions 

At temperatures below an annealing temperature of 48.6 °C 

(column well positions 1–3) there are primarily nonspecific PCR 

products (Table 1, Fig. 3). Nonspecific products were produced in 

some NTCs (no template controls) at these temperatures as well. 

Therefore, when a double-stranded DNA-binding dye such as 

SYBR ® Green I is used for detection, it is important to check the 

products with a melting curve analysis following the last cycle of 

the PCR reaction (Fig. 3). 

The Ct values of the specific Beta globin PCR products vary from 

approx. 24 to 28 (Table 1, Fig. 2). This means that there is a Ct shift of approx. 4 PCR cycles from the most favorable annealing 

temperatures (column well positions 7–12) to the least favorable 

(column well position 3) annealing temperatures—a very significant 

determination that impacts the practice of real-time PCR. Note 

that Table 1 indicates the optimal annealing temperature in column 

10—and a 0.5 Ct shift over an ~2 °C change in temperature from 

column 10 to column 12. Thus, we see that the Ct values drop 

(improve) from columns 1 to 10 and then start to increase again 

from 10 to 12. 

This assay demonstrates the importance of gradient optimization 

of annealing temperatures to achieve reliable results across 

individual assays and experiments. The flexible gradient function 

of Mastercycler ep realplex is a time- and cost-saving feature, 

especially for introducing and establishing new real-time PCR 

reactions in the laboratory. 

‡ Fig. 2: Logarithmic-scaled amplification plots of the 

Beta globin assay 

The range of C t values correspond to a range in annealing 

temperature in a gradient optimization experiment. 

‡ Fig. 3: Peak curves (negative first derivative of the melting 

curves) of each of the three replicates from column positions 

3 and 8 



35 



36 

realplex highlights 


Impulse PCR: a novel, accelerated and improved qPCR Hot Start method 

An essential and critical goal during any PCR is to avoid nonspecific 

primer annealing during PCR setup and each successive cycle 

of PCR. Two key and unique features of realplex—SteadySlope ® 

gradient technology and Impulse PCR—make this goal easy 

to achieve. 

As discussed in the “Gradient function: a highly useful tool for 

optimizing real-time PCR” highlight on the previous pages, specific 

primer annealing is often highly sensitive for optimal temperature. In 

addition, a nonoptimal annealing temperature can have a negative 

impact on the C t values and the overall sensitivity of the assay. With 

the gradient function, optimization of a specific probe and/or primer 

pair’s ideal annealing temperature is easy and fast, and an optimized 

real-time PCR cycling program can be created in a short time. 

With a well-designed assay, once the optimal annealing 

temperature has been determined and adopted, the risk of 

nonspecific amplification after the first cycle is minimal. This is 

due to the fact that the temperature for specific annealing will not 

Temp. 

1 

‡ Fig. 1: A typical PCR cycling program 


2 

2 

Time 

The critical temperature range of initial ramping (circled), lower than 

the critical annealing temperature (Step 2), is where nonspecific 

amplification will most likely occur. 


fall below the critical temperature at which nonspecific annealing 

occurs. However, the first initial ramping step of a PCR carries a 

serious risk of nonspecific amplification—and, therefore, lowered 

specificity—for two reasons: (a) in the course of ramping from 

ambient to initial denaturation temperature, the sample heats across 

a range of temperatures—at first well below that of the optimal an- 

nealing temperature, and (b) any nonspecific product extended 

in that first ramping step will have the potential for amplification 

in each and every additional cycle. This subjects the assay to 

additional potential for nonspecific amplification to occur. 

To demonstrate the effects of nonspecific amplification: if 

one of several suboptimal events occurs—such as choice of 

wrong annealing temperature for the cycle programming, use of 

poorly designed primer pairs, or heating/cooling steps that are too 

lengthy—nonspecific annealing and subsequent amplification may 

be observed. Figure 2B demonstrates this nonspecific annealing 

and amplification effect. 

A B 

‡ Fig. 2: Polyacrylamide gel analysis 

A highly specific amplified PCR product (A) is compared to (B)— 

a similar gel image showing more than one specific band, which 

indicates nonspecific products.


Impulse PCR: a novel, accelerated and improved qPCR Hot Start method, continued. 

In real-time PCR assays for which SYBR ® Green I is the chosen 

fluorescent reporter molecule, nonspecific amplification may be 

indicated—not by additional bands, but by a higher-than-accurate 

level of total fluorescence in the sample. And higher fluorescence 

resulting from the presence of nonspecific product means that 

accurate quantification is no longer possible. A view of the melt- 

ing curve plot of SYBR Green real-time PCR assays confirms the 

presence of nonspecific product through the appearance of more 

than one peak (Fig. 3), comparable to the single vs. multiple bands 

shown in Fig. 2 on the previous page. 

‡ Fig. 3: Melting curve analysis profile of the final melting 

curve step across a number of samples of a real-time PCR 

assay, each with SYBR Green I as the reporter dye 

Double-stranded DNA-binding dyes such as SYBR Green I bind 

to any double-stranded DNA molecule; therefore, it is important 

to design a highly specific assay that will eliminate the presence/ 

amplification of nonspecific product. 

Blue = Impulse PCR Red = Standard PCR 

100 

90 

80 

70 

60 

50 

40 

30 

20 

Time 


The Impulse PCR option of realplex S silver block models is 

an Eppendorf invention. Impulse PCR acts as a “device-driven 

Hot Start” to greatly increase the specificity of real-time PCR 

reactions and, thus, increase the dependability of SYBR Green 

dye experiments. 

The Impulse function targets the first initial ramping step of 

the real-time PCR program—identified earlier as a point of high 

risk for nonspecific amplification—by jump-starting the reaction 

with additional speed (up to 8 °C/s), thereby reaching the initial 

denaturation step much faster. The time for, and the possibility of, 

nonspecific annealing is minimized because samples spend very 

little time below their ideal programmed annealing temperature. 

‡ Fig. 4: Temperature ramping profiles of two experiments 

One uses Impulse PCR (in blue) and the other (in red) does not. 

The plot demonstrates time (x axis) versus temperature (y axis). 

This example shows that by selecting the Impulse PCR function, 

the sample reaches the initial denaturation temperature faster, 

which leads to a decrease in total run time and increased 

specificity—a device-driven Hot Start. 



37 



38 



High-speed, real-time PCR assay design for realplex silver block models 

Real-time PCR is an ideal application for the design and operation 

of high-speed PCR programs—providing results in minutes, rather 

than hours. Furthermore, in comparison to conventional PCR, 

complex post-PCR handling is no longer required, which reduces 

analysis time and further reduces overall time spent on each 

experiment. With Mastercycler ep realplex silver block models 

realplex 2 S and realplex 4 S, the already fast ramp rates of the 

aluminum block models increase from 4 ºC/3 ºC to 6 ºC/4.5 ºC 

(heating/cooling). Table 1 below lists a comparison of heating ramp 

rates among Mastercycler ep realplex and other real-time systems 

currently available. 

The key benefits of realplex’s silver block for ultra-high-speed 

real-time PCR are: 

‡ Visualize results in real time during a PCR run: at every cycle, the 

fluorescence of each sample chronologically appears and can be 

observed and analyzed—no more waiting for > 30 cycles, followed 

by post-PCR analysis! 

‡ Shorten total run times: because longer amplicons require 

longer extension/elongation dwell times, the total run time of 

PCR programs with shorter amplicons reap the greatest benefit 

from our ultra-high-speed ramping; and since amplicons under 

100 bp are optimal for real-time PCR applications, realplex S 

models, therefore, have a great impact on the reduction of total 

run time. 

Instrument Ramp rate—heating 

Mastercycler ep realplex S 6 °C/sec 

Mastercycler ep realplex 4 °C/sec 

Instrument M 3 °C/sec 

Instrument S 2.5 °C/sec 

Instrument A 1.6 °C/sec 

‡ Table 1: Ramp rates of several real-time PCR systems 



‡ Fast optical detection also reduces total run time: realplex optical 

detection requires only 8 seconds for 1 to 2 channels or up to 16 

seconds for 4 channels—across an entire plate in a single cycle. 

‡ Optimized plate design: to supplement realplex’s very fast 

ramping, Eppendorf ® twin.tec PCR plates facilitate high-speed 

temperature change by providing optimal heat transfer through 

their thin well walls. 

The amplification plots in Fig. 1 on the next page show a 

dramatic reduction of total run time and total reaction volume on 

the Mastercycler ep realplex real-time PCR systems, while offering 

outstanding reproducibility and peak performance. 

Would you base your life’s work on anything else? 

Keep in mind, the right chemistry also makes a difference: 

Hot Start polymerases that do not require lengthy activation 

steps of 10 minutes or more will not require any more time for 

initial denaturation than is needed by the template. Furthermore, 

the enzyme you choose must perform efficiently during 

short protocols.


High-speed, real-time PCR assay design for realplex silver block models, continued. 

A B 

Fig. 1 

Av.Ct 22.62 

St.dev. 0.05 

1 h 12 min 

C D 

Av.Ct 22.45 

St.dev. 0.10 

35 min 37 sec 

‡ Fig. 1: High-speed, real-time PCR using Mastercycler ep realplex 4 S 

Initial denaturation/ 

activation 

40 cycles 

Denaturation Annealing/extension 

95 °C 95 °C 60 °C 


High reproducibility is demonstrated with a minimum of 15 replicates of a SRY TaqMan ® assay across a variety of PCR protocols and a variety 

of total reaction volumes (as low as 10 µl) with low standard deviation. (A) through (D) show the effect of a stepwise time optimization (see 

Table 2 below) of PCR profiles and concomitant reduction of reaction volumes on total PCR run times and standard deviation—the reaction 

was reduced from 72 min down to 23 min 34 s. 

Total run time on a 

Mastercycler ep S realplex system 

A 2 min 15 s 60 s 72 min (50 µl reaction vol., tube control) 

B 2 min 10 s 20 s 42 min 02 s (20 µl reaction vol., tube control) 

C 20 s 3 s 20 s 35 min 37 s (20 µl reaction vol., tube control) 

D 20 s 3 s 17 s 23 min 34 s (10 µl reaction vol., block control) 

‡ Table 2: Optimization of the PCR profiles shown in Fig. 1 

Av.Ct 22.82 

St.dev. 0.08 

42 min 

Av.Ct 23.545 

St.dev. 0.08 

23 min 34 sec 



39 



40 




General recommendations for the optimization of high-speed, 

real-time PCR protocols 

Since the “early days” of real-time PCR, 90 minutes to 2 hours 

has generally been the standard total run time required for a single 

standard assay. Lately there has been a real push to optimize 

reactions towards high-speed, real-time PCR protocols for 

increased sample throughput—providing the opportunity for more 

researchers to perform many more types and quantities of assays 

on a single real-time PCR device. 

Until now, total reaction time for high-speed qPCR has typically 

been 40 minutes—a substantial time-savings when compared 

to standard assays. With the introduction of Mastercycler ep 

realplex S systems, we have further pushed the limits of speed 

and shortened real-time PCR reactions to just over 20 minutes! 

With real-time PCR this fast, many more labs will want to take 

high-speed assay optimization into serious consideration. 

Some general recommendations for the stepwise optimization 

of high-speed, real-time PCR are explained here and on the next 

page. By following Eppendorf’s general optimization tips and 

adopting the reliability and speed of Mastercycler ep realplex 2 S 

or realplex 4 S, you can routinely approach total run times of 24 

minutes or less. 

Forward/reverse 

primer concentration 

50 nM 


100 nM 

300 nM 


Step 1: Examine your target length 

Consistent with the design of most TaqMan ® assays, an amplifica- 

tion target should not exceed a length of 100 bp by much—due to 

the fact that a PCR program’s extension time can be significantly 

reduced for PCR targets of such short lengths. The target length of 

the PCR reaction from the amplification plots shown in Fig. 1 (page 

39) was 80 bp. 

Step 2: Optimize primer design 

Good primer design is an important variable for highly efficient 

and robust PCR. 

(a) The presence of self-complementary structures within the 

primer (and probe) flanking regions should be prevented to avoid 

nonspecific PCR products, resulting in loss of PCR efficiency and 

possible false-positive results (SYBR ® Green I). 

(b) It is helpful to design primers with a melting temperature (T m) 

of 60 °C or higher so that two-step PCR programs may be used 

(see step 5). 

Note: A useful and widely available tool for primer design that 

considers the above-mentioned general guidelines is Primer3- 

Software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) 

[Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW 

for general users and for biologist programers. Krawetz S, Misener 

S (eds) Bioinformatics Methods and Protocols: Methods in 

Molecular Biology. Humana Press, Totowa, NJ, pp 365-386]. 

600 nM 

900 nM 

50 nM 50/50 100/50 300/50 600/50 900/50 

100 nM 50/100 100/100 300/100 600/100 900/100 

300 nM 50/300 100/300 300/300 600/300 900/300 

600 nM 50/600 100/600 300/600 600/600 900/600 

900 nM 50/900 100/900 300/900 600/900 900/900 

‡ Table 3: A common primer-matrix for suggested optimization of forward and reverse primer combinations



Step 3: Gradient real-time PCR optimization 

A gradient PCR should be performed to find the optimal 

annealing/extension temperature for the primers. This step is easy, 

yet critically important for achieving the best primer performance in 

any PCR reaction. 

Note: Detailed instruction on the gradient function of realplex and 

its importance for real-time PCR optimization—including two-step 

protocols—appears on page 34. 

Step 4: Primer matrix optimization 

A primer-matrix that spans a range of common concentrations 

of the forward and reverse primer should be performed to find 

the optimal combination of concentrations for both primers. 

A commonly used primer-matrix is featured in Table 3 on the 

previous page. 

Note: To achieve the most reliable results, each combination should 

be performed with 3 replicates. 

Step 5: Design a two-step program for added speed 

A two-step PCR program with a combined annealing/extension 

step of 60 °C or higher can be easily optimized by activating 

realplex’s gradient option in the second cycle step. A two-step 

program enables you to achieve the fastest run times because 

it features fewer ramping steps than a conventional three-step 

protocol. 

(a) To begin optimization of a two-step protocol, it is good to start 

with a default program such as that listed in Fig. 1 and Table 2 on 

page 39. 


(b) Change the annealing/extension temperature to the optimal 

temperature as explained in Step 3. 

(c) Based on the length of the target amplicon for your assay (see 

Step 1 on the previous page), shorten the annealing/extension dwell 

time and test to confirm high performance. 

(d) Next, consider decreasing the cycle denaturation dwell time. 

As a general rule, if your template’s GC-content is < 50%, shorter 

times for denaturation should be sufficient. 

(e) Consider the gradient option to test a range of denaturation 

temperatures in the event that templates are GC-rich—because 

GC-rich templates may not amplify sufficiently at shorter 

denaturation dwell times. Again, choose your denaturation dwell 

time and perform an assay test to confirm good performance. 

(f) Decrease your total reaction volume. Lower volumes require less 

time to heat and, therefore, less overall time to amplify. Perform a 

melting curve analysis to confirm high specificity. 

Note: If working with volumes of 10 µl or higher, “Simulate tube” 

mode in your program Header may be required. Block mode is 

faster and works well with low-volume samples (10 µl). 

(g) Shorten your initial denaturation. If GC-content is < 50% and 

your mastermix polymerase enables short activation times, follow 

this guide’s recommendations for a short initial denaturation. 



41 



42 



Benefits of realplex’s homogeneity and accuracy on reproducibility in real-time qPCR 

A key contributor to reproducible real-time PCR is the accuracy 

and uniformity of temperatures across a range of samples. Ideally, 

thermal block-based qPCR systems must demonstrate an even 

temperature profile across the entire block, with identical heating 

and cooling speeds and dwell temperatures in every position. 

Without this high degree of temperature control, edge effects 

may occur, reflecting a loss of temperature to the environment 

at the outer edges of the block. 

Addressing this challenge—and increasing the reproducibility of 

real-time PCR assays across a 96-well plate—is Eppendorf’s Triple 

Circuit Technology. This unique arrangement of multiple Peltier 

elements into three defined temperature control regions provides 

the following key benefits: (a) more linear gradient testing of optimal 

annealing temperature or two-step PCR optimization, translating to 

more distinct temperatures tested in a single experiment, and (b) a 

higher degree of temperature control around the outer regions of 

the block, thus decreasing edge effects and allowing the effective 

use of all wells in a 96-well plate with high reproducibility. 

Mastercycler Triple Circuit Technology benefits 

‡ Ensures precise control of 

the temperature gradient 

‡ Enhances linearity of 

the gradient 

‡ The thermal block is controlled by three separate 

temperature control circuits 


‡ Reduces temperature 

loss in the peripheral areas 

during uniform (nongradient) 

temperature mode 

Critical impact 

realplex’s combined optical and temperature control features 

provide uniform temperature and light signals for all positions in a 

plate-based qPCR assay. The following amplification plot (Fig. 1) 

shows convincing results: 96 samples with perfect replicate results, 

an excellent foundation for the success of any real-time PCR 

application or assay. 

9000 

8000 

7000 

6000 

5000 

4000 

3000 

Fluorescence (norm) 10000 

2000 

1000 

0 

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 

Cycle 

Threshold: 186 (Noiseband) 


‡ Fig. 1: Mastercycler ep realplex’s block and optical 

Baseline settings: automatic, Drift correction OFF 

homogeneity provide high reproducibility across 96 replicates


Optical concept highlight – 96 well excitation 

Mastercycler ep realplex light path 

� Light emission from 96 LEDs (470 nm) 

�a/b/c Focusing with 96-lens-arrays 

� Semipermeable beam splitter 

� Light emission from excited fluores- 

Optical design 

An additional requisite of reproducible real-time PCR is the design 

of a uniform light source for even well-to-well excitation—in other 

words, the excitation source should show the same intensity in 

every position. To this end, realplex features a 96-LED array for 

excitation, and the intensity of each LED is normalized to a mean 

value. Thus, each sample receives the same light intensity, and 

every well has a direct light source—with stray light minimized. 

This is in stark contrast to halogen-based lamps that decrease in 

intensity over their lifespan and, thus, may negatively impact results 

over time. 

cent dyes in the reaction mixture 

(see representation in the graphic) 

� Merging of the rays through a 

“96-in-1” optical fiber 

� Focusing; passage through additional 

beam splitters 

� Filter wheel with interference filters 

� Advancing the light beam to the 

photomultiplier 

‡ Inside view of the 

realplex’s heated lid and 

96-LED array 




43 


Consumables | PCR 

44 

PCR Consumables 

twin.tec PCR plates 


‡ One-piece design 

combines polycarbonate 

and polypropylene for 

optimum performance 

‡ Increased plane parallelism 

‡ Extremely thin-walled 

for optimum heat transfer 

to the sample 

‡ Low-profile design enhances 

efficiency of PCR and enables 

the highest efficiency for small 

sample volumes 

‡ Raised well rims for 

effective sealing, also reduces 

risk of cross-contamination 

‡ Improved well-to-well 

tolerance 


‡ Autoclavable 

(121 °C, 20 min) 

‡ Certified to be free of 

any detectable human DNA, 

DNase, RNase and 

PCR inhibitors* 

‡ Meets SBS footprint 

recommendations 

‡ Max. well volumes: 

– 45 µl, twin.tec 384 

– 150 µl, twin.tec 96 skirted— 

when used with cap strips 

– 250 µl, twin.tec 96 semi- 

skirted—ideal for qPCR on 

a variety of systems 

* Certificate, test procedures and detailed 

information available upon request. 


twin.tec PCR Plate 96, skirted (clear wells), 25 pcs. 

Clear 951020401 

Yellow 951020427 

Green 951020443 

Blue 951020460 

Red 951020486 

twin.tec PCR Plate 96, skirted (black wells), 25 pcs. 

Yellow (not shown) 951020508 

twin.tec PCR Plate 96, semiskirted (frosted wells), 25 pcs. 

Clear 951020303 

Yellow 951020320 

Green 951020346 

Blue 951020362 

Red 951020389 

twin.tec PCR Plate 384, skirted (colorless wells), 25 pcs. 

Clear 951020702 

Yellow 951020711 

Green 951020729 

Blue 951020737 

Red 951020745 

Order from your laboratory supply dealer or Eppendorf North America. 


twin.tec plates are made of the best quality materials for use 

manually AND with automated systems: virgin polypropylene 

ensures minimal binding of DNA, RNA and enzymes—with 

maximum recovery; polycarbonate, which provides sturdiness 

and high mechanical stability, makes up the plate surface and 

frame. The well walls are 20% thinner than conventional thin- 

walled tubes, providing optimal heat transfer between the block 

and your samples. Choose from 3 styles (unskirted, skirted and 

semiskirted) and 5 colors to suit your experimental needs and 

ease identification/handling.

twin.tec real-time PCR plates* 

Eppendorf twin.tec real-time PCR plates* offer all the advantages of 

regular twin.tec plates and give you the advantage of white wells for 

your real-time PCR. 

The limiting factor in low volume real-time PCR is often the 

remaining intensity of fluorescence. The white wells of the 

Eppendorf twin.tec real-time PCR plates* reflect fluorescence 

much better than clear or frosted wells. Thus, lower levels of 

fluorescence are still detectable with the same instrument – 

just by using the right consumables. 


‡ White wells for better reflection 

‡ High mechanical stability 

‡ Raised rims for effective sealing 

‡ “Skirted” (stackable) and “semi-skirted” plates 

‡ Optimal heat transfer due to reduced wall thickness 

‡ Autoclavable (121 °C, 20 min.) 


Real-time PCR Consumables 

Additionally, white wells significantly reduce interfering background 

fluorescence and lead to increased homogeneity of replicates and 

reproducible results. 

The rigidity of the polycarbonate frame ensure easy and reliable 

handling – manually or automated. The polypropylene wells 

guarantee excellent and fast temperature transfer to the sample. 

‡ The intensity of fluorescence measured by the instrument 

is up to 10-fold higher than with frosted wells. 


twin.tec 96 real-time PCR plates*, skirted white, set of 25 pcs. 951022015 

twin.tec 96 real-time PCR plates*, skirted blue, set of 25 pcs. 951022003 

twin.tec 96 real-time PCR plates*, skirted black, set of 25 pcs. 951022027 

twin.tec 96 real-time PCR plates*, semi-skirted white, set of 25 pcs. 951022055 

twin.tec 96 real-time PCR plates*, semi-skirted blue, set of 25 pcs. 951022043 

twin.tec 96 real-time PCR plates*, semi-skirted black, set of 25 pcs. 951022067 

*Eppendorf owns protective rights under European Patent EP 1 161 994, US patents pending. 



45 

Real-time PCR | Consumables

Consumables | Instruments | PCR 

46 

PCR Accessories and Consumables 

Heat sealing materials 

Heat Sealer product features 

‡ Safe and easy hermetic heat 

sealing of 96- and 384-well 

plates (384-well base available 

separately) 

‡ Eliminates evaporation 

in PCR, reducing cross- 

contamination 

‡ Suitable for plates of 

different heights 

‡ Optimum sealing with 

Eppendorf ® Heat Sealing 

Foils and Films at a preset 

temperature 

Film/Foil product features 

‡ Hermetic sealing of 

multiwell plates, especially 

recommended for low 

reaction volumes 

‡ Best protection against 

evaporation during PCR 

‡ Certified free of human 

DNA, DNase, RNase and 

PCR Inhibitors* 


‡ Compact and portable, ideal 

for transporting and storing 

samples 

‡ Integrated thermostat 

prevents overheating 

‡ Heating plate recessed 

for safety 

‡ Use with optically clear 

heat-sealing film for real-time 

qPCR applications 

‡ Heat sealing film is optically 

clear for real-time PCR 

applications. 

* Certificate, test procedures and detailed 

information available upon request. 

Order from your laboratory supply dealer or Eppendorf North America. 




Heat Sealer, 115 V/50 Hz 951023078 

Base plate, for 384-well plate 951023086 

Heat Sealing Film, 10 x 10 pcs. 951023060 

Peel-it-lite Foil, 100 pcs. 951023205 

Pierce-it-lite Foil, 100 pcs. 951023213 

Foil Stripper 951023043 

Heat Sealing Film Peel-it-lite Foil Pierce-it-lite Foil 

Packaging: 10 x 10 pcs. 1 x 100 pcs. 1 x 100 pcs. 

Features: Optically clear polyester/ 

polypropylene laminate 

Extremely stable sealing option 

—cannot be removed or pierced 

Laminated aluminum foil 

Easily removable 

Laminated aluminum foil 

Easily pierced—even with 

multichannel pipettes 

No glue residue on the 

pipette tips 

Seal integrity: –80 °C to 140 °C –200 °C to 120 °C –80 °C to 120 °C 

Sealing time with 

Eppendorf Heat Sealer: 

1–2 s 2–4 s 2–3 s 

Weldable materials: Polypropylene Polypropylene 

Polyethylene 

Special applications: Colorimetric applications 

Fluorescence applications, 

including real-time PCR 

Storage of hazardous samples 

Storage at extremely low 

temperatures (–200 °C) 

Can even be removed at –80 °C 

Plate can be resealed 

(after removal of old foil) 

Polypropylene 

PCR with water bath cyclers 

Storage and transport 

of samples

Applications 

ARTS 

47

Applications | ARTS 

48 

Application notes 

Eppendorf offers more: application support 

Both automation and real-time PCR applications 

vary in their scope and complexity. This section 

includes application notes related to PCR/qPCR 

and nucleic acid purification that highlight the 

Mastercycler ® ep realplex and epMotion ® systems— 

demonstrating their superior performance as standalone 

devices as well as the great benefits of using 

them together. More application notes are available 

to view and download at www.eppendorfna.com/arts. 




Automated genomic DNA purification from tissue culture cells using the Promega 

Wizard ® SV 96 Genomic DNA Purification System and the Eppendorf epMotion ® 5075 VAC 

Sarah Shultz, Promega Corporation, Madison, WI 

Abstract 

Purification of genomic DNA from tissue culture cells in a high- 

throughput method is essential for many downstream applications 

in molecular biology. In this report, we have developed an auto- 

mated method to meet the need for high-throughput genomic DNA 

purification on the Eppendorf ® epMotion ® 5075 VAC. Genomic 

DNA is purified from tissue culture cells with no detectable 

cross-contamination during the automated isolation procedure. 

Genomic DNA is then analyzed for yield and purity by measuring 

sample absorbance at 260 nm and 280 nm, amplified to confirm 

compatibility for downstream PCR amplification (1.2 kb IL-1ß), and 

compared to genomic DNA extracted from the same tissue culture 

cells using a manual method. 

Introduction 

High-throughput isolation and purification of genomic DNA is 

an essential step for many researchers in molecular biology. 

Genomic DNA is traditionally purified from cultured cell samples 

by mechanically disrupting the cells by proteolysis, followed by 

phenol extraction. This process can be tedious, labor-intensive and 

hazardous because of the use of toxic organic compounds. Thus, 

the development of a simple, hands-free, high-throughput genomic 

DNA purification procedure capable of isolating high-quality DNA 

in a relatively short amount of time without contamination between 

samples is desirable. 

The Promega Wizard SV 96 Genomic DNA Purification System 

provides a high-throughput, membrane-based technique for 

consistent preparation of genomic DNA from tissue culture cells. 

Amplifiable genomic DNA can be isolated from up to 5×10 6 cells, 

without a centrifugation clearing step. The SV 96 genomic DNA 

isolation procedure involves sample lysate preparation, capture 

of genomic DNA, washing to remove impurities, and eluting the 

purified DNA. 

The Eppendorf epMotion 5075 VAC is a flexible automated 

pipetting system, that can be adapted to various liquid handling 

tasks. The concept of exchangeable tips and the “Free Jet 

Dispensing” technology enables this workstation to dispense 

liquids contact-free and makes it ideal for implementing complex 

work steps where precision and reliability are required. 

Materials and methods 

‡ Eppendorf epMotion 5075 VAC equipped as follows: 

‡ Gripper 

‡ Dispensing tools TM1000-8 and TM300-8 

‡ Vacuum with manifold 

‡ Reservoir Rack 

‡ Height spacers 85 mm and 35 mm 

‡ Vac Frame 2 

‡ Waste Tub 

‡ Eppendorf consumables 

‡ 5 x 100 ml Reagent Reservoirs 

‡ 1 x 1000 μl epT.I.P.S. Motion Filtered Tips 

‡ 1 x 300 μl epT.I.P.S. Motion Filtered Tips 

‡ Promega Wizard SV 96 Genomic DNA Purification System 

‡ Promega 1.2 ml 96-Well Round-Bottom Deep Well Plate 

(Elution Plate) 

‡ 96-Well Tissue Culture Plate (Sample Plate) 

‡ Fresh tissue culture cells 

‡ Sterile 1x Phosphate Buffered Saline (PBS) 

Cell and reagent preparation 

Two common tissue culture cell lines, HEK-293 and NIH-3T3, 

were prepared at 1x10 5 cells per well and placed in 96-Well Tissue 

Culture Plates (Corning, USA) in a checkerboard pattern, as shown 

in Figure 1. 

‡ Figure 1: Sample Plate checkerboard layout. 

Every other well was left empty to serve as a control for method 

cross-contamination. Reagents were prepared and dispensed into 

five 100 ml Reagent Reservoirs, as described in Table 1. 



49 

ARTS | Applications


50 



Automated genomic DNA purification, continued. 

Reservoir Contents Comments 

20ml Wizard ® SV Lysis Buffer 

90ml Wizard ® SV Wash Solution with EtOH Add 95% EtOH 

to the Wizard ® SV 

90ml Wizard 

96 Wash Solution 

bottle as directed 

on the bottle label 

before dispensing. 

® SV Wash Solution with EtOH 

90ml Wizard ® SV Wash Solution with EtOH 

30ml Nuclease-Free Water 

‡ Table 1: Contents of the Reagent Reservoirs in the 

Reservoir Rack. 

Labware was placed onto the epMotion 5075 VAC worktable, as 

shown in Figure 2 and Table 2. The automated method was then 

started. 

‡ Figure 2: Screenshot from the epMotion Editor showing the 

epMotion 5075 VAC setup for the Automated Wizard SV 96 

Genomic DNA Tissue Culture Method. 

Position Labware 

A2 1000μl epTIPS Motion Filtered Tips 

A3 Reservoir rack with 5 Reagent Reservoirs 

A4 Empty 

B0 Empty 

B1 Empty 

B2 300μl epTIPS Motion Filtered Tips 

B3 Filter Plate sitting atop 85mm Height Spacer 

Vacuum Empty 

C1 Waste Tub with quarter wall separators 

C2 

Elution Plate: 96-Well 2.2ml Square-Bottom Deep 

Well Plate 

C3 Sample Plate: 96-Well Tissue Culture Plate 

C4 Vac Frame 2 atop 35mm Height Spacer 

‡ Table 2: epMotion 5075 Worktable setup details by position. 


Automated method overview 

The automated method begins by dispensing 150 μl Lysis Buffer 

to each well of the Sample Plate. The dispensing tool mixes and 

transfers the cell lysates to a Filter Plate atop the vacuum manifold 

apparatus. A vacuum is then applied and lysates are pulled through 

the Filter Plate. During this step, genomic DNA binds to the 

filter plate. 

The dispensing tool next dispenses 810 μl Wash Solution to each 

well of the Filter Plate. A vacuum is applied and the Wash Solution 

is pulled through the Filter Plate. This step is repeated for a total 

volume of 2.4 ml of Wash Solution per well. After washing, the 

vacuum remains on for an additional 10 minutes to remove any 

residual Wash Solution from the Filter Plate. Once the Filter Plate 

is dry, the Gripper tool disassembles the vacuum manifold stack 

by moving the Vac Frame 2 and Filter Plate from the manifold to a 

holding position. The Gripper tool next moves the Elution Plate into 

the vacuum manifold, to replace the Waste Tub. Then, the Gripper 

tool reassembles the vacuum manifold stack by moving the Vac 

Frame 2 and Filter Plate back top the vacuum. 

After reassembly, the dispensing tool transfers 200 μl Elution 

Buffer to each well of the Filter Plate. A final vacuum is applied and 

the Elution Buffer is pulled through the Filter Plate while eluting 

genomic DNA. At the end of the automated method, purified 

genomic DNA from the original tissue culture cells is eluted into the 

Elution Plate. The total processing time for 96 samples using the 

automated method is just under 1 hour. 

Analysis of purified genomic DNA 

Downstream analyses of the purified genomic DNA samples were 

performed. One microliter samples from the Elution Plate were 

placed directly onto a ND-1000 Spectrophotometer (Nanodrop, 

USA). Average yield (A260) and purity (A260/A280) measurements 

were taken. For eluates purified from NIH-3T3 cells, 1 μl purified 

genomic DNA samples were also PCR amplified using Promega’s 

PCR Master Mix, Cat.# M712B (Promega, USA) and IL-1ß primers 

(Integrated DNA Technologies, USA). A negative control reaction 

comprised of Elution Buffer only was included in the analysis. 

The PCR thermal cycling conditions were as follows: 2 minutes 

at 94 °C; followed by 40 cycles of 94 °C for 30 seconds, 58 °C for 

30 seconds, and 72 °C for one minute; final extension at 72 °C for 

5 minutes. After PCR amplification, 10 μl of each reaction product 

was separated on a 1.2% agarose gel and visualized by ethidium 

bromide staining. 

For additional comparative analysis, the Promega Wizard SV 96 

Genomic DNA Purification System was also performed manually 

using HEK-293 tissue culture cells at 1x10 5 cells per well. Cells 

were prepared in the same checkerboard pattern as described 

above. Refer to Promega TB#303 for details on the manual 

processing procedure.



Results and Discussion 

Use of the automated method described in this article incorporating 

the Promega Wizard SV 96 Genomic DNA Purification System to 

isolate genomic DNA from tissue culture cells using the epMotion 

5075 VAC results in high-quality genomic DNA compatible with 

downstream PCR amplification. Successful amplification of IL-1ß 

from 1 μl purified genomic DNA samples isolated from NIH-3T3 

tissue culture cells is shown in Figure 3, lanes D4, D6, D8, and D10. 

‡ Figure 3: Genomic DNA isolated from NIH-3T3 tissue culture 

cells using the Wizard SV 96 gDNA Tissue Culture Method on 

the epMotion 5075 VAC. PCR products were amplified from 

1 μl of purified sample from each well for IL-1ß. Ten microliters of 

PCR product was run on a 1.2% agarose gel and visualized by 

staining with ethidium bromide. Expected PCR product for IL-1ß 

is approximately 1.2 kb, as shown in lanes D4, D6, D8, and D10. 

No PCR product is expected from blank samples, as shown in 

lanes D5, D7, D9, and D11, as well as in the negative control lane 

–C which contained only Elution Buffer. A marker standard was 

included for size estimation, lane M (Promega BenchTop 1 kb 

DNA Ladder). 

Ten microliters of each PCR product was run on a 1.2% agarose 

gel and visualized by staining with ethidium bromide. No cross- 

contamination between wells of the same Elution Plate was 

observed, as shown on lanes D5, D7, D9, and D11. A negative 

control consisting of amplified Elution Buffer shows no amplified 

product in lane –C, as expected. A marker standard lane M, 

BenchTop 1 kb DNA Ladder (Promega, USA), was included for 

size estimation. Expected PCR products size for IL-1ß is 

approximately 1.2 kb. 

1x10 5 293 cells (n=12) 

Blank Wells (n=12) 


Genomic DNA purified using this automated method is also of 

quality yield and purity, as determined by spectrophotometer 

absorbance measurements at 260 nm and 280 nm. In addition, 

DNA yields are comparable to those prepared manually. This can 

be seen in the data presented in Table 3. Spectrophotometer 

measurements collected from 24 genomic DNA samples processed 

using the automated and manual methods isolated from HEK- 

293 tissue culture cells show comparatively equal yields between 

methods from wells containing 1x105 cells (1.0 ± 0.2 μg and 0.9 ± 

0.2 μg, respectively). Expected average DNA yield is approximately 

0.8 μg for the 293 cell line at this density. Spectrophotometer 

measurements also display excellent genomic DNA purity (A260/ 

A280) for both methods (1.8 ± 0.1 and 1.9 ± 0.2, respectively). 

Expected average purity (A260/A280) is ≥ 1.7. Finally, further 

support that no cross-contamination exists between wells of the 

same Elution Plate was evidenced in Table 3, as the average DNA 

yield for both Blank wells groups analyzed were approximately zero 

(0.1 ± 0.1 μg and 0.0 ± 0.1 μg, respectively). 

This simple, high-throughput, automated genomic DNA purification 

procedure on the epMotion 5075 VAC successfully isolates high- 

quality DNA in less than one hour without contamination between 

samples. This method nicely fits the needs of researchers requiring 

considerable sample sets of genomic DNA for downstream 

applications in molecular biology. 

Automated Manual 

DNA (µg) 260/280 ng/µl DNA (µg) 260/280 ng/µl 

AVG 1.0 1.8 4.5 0.9 1.9 4.1 

STDEV 0.2 0.1 1.1 0.2 0.2 0.9 

AVG 0.1 1.0 0.3 0.0 0.1 -0.2 

STDEV 0.1 2.2 0.3 0.1 0.6 0.5 

‡ Table 3: Spectrophotometer measurements collected from 24 samples processed using the Automated Wizard SV 96 Genomic DNA 

Tissue Culture Method on the epMotion 5075 VAC and manual Wizard SV 96 Genomic DNA Purification System. Expected average DNA 

yield from wells containing 1x105 293 cells is approximately 0.8 μg. Expected average purity (A260/A280) is ≥ 1.7. 



51 

ARTS | Applications


52 


Isolation of high quality BAC DNA 

Isolation of high quality BAC DNA using the Perfectprep ® BAC 96 Kit from 5 PRIME on the 

epMotion ® 5075 VAC from Eppendorf 

Sabine Mueller, Ph.D., 5 PRIMe GmbH, Renate Froendt, eppendorf AG, Hamburg, Germany 

Abstract 

Eppendorf’s continuing efforts to provide complete systems for 

biological research have created a system for the automated 

isolation of BAC DNA. This system uses the 5 PRIME Perfectprep 

BAC 96 Kit on the Eppendorf epMotion 5075 VAC allowing for the 

simultaneous, fully automated isolation of BAC DNA from 96 clones. 

The typical yield of a single BAC-clone from a 96-clone library plate 

was 0.5 – 1.0 µg, and the average Phred Q>20 score of one library 

plate was 676 bases with a passing rate of 100% (scores >100 

bases). Consistent results were obtained when isolating a single 

BAC clone from all 384 wells of four 96-well culture plates. The 

average Phred Q>20 score of 192 of these samples was 718 bases 

with a passing rate of 97.4%. The "walk away" protocol requires 

approximately 75 minutes and results in highly pure BAC DNA 

with sufficient yields for five downstream applications such as four 

sequencing reactions and one fingerprinting analysis. 

Introduction 

Bacterial Artificial Chromosomes (BACs) are a very common and 

useful tool for genomic research due to their high cloning efficiency, 

clone stability, and easy handling. BACs can maintain DNA 

fragments as large as 300 kb while maintaining excellent stability. 

Fingerprinting and BAC-end sequencing are the major applications 

used by scientists to collect genomic sequence data and obtaining 

quality sequences with long read lengths expedites this research. 

It is also advantageous, especially in whole genome sequencing 

efforts, to generate sequence data in a high-throughput manner 

on fully automated workstations. 

The 5 PRIME Perfectprep BAC 96 Kit and the Eppendorf epMotion 

5075 VAC are integrated to provide a complete system for obtaining 

highly pure BAC DNA using a fully automated approach. The kit 

uses a modified alkaline lysis technology with a vacuum driven 

protocol to isolate BAC DNA from bacterial cultures. The protocol 

on the epMotion 5075 VAC is optimized to obtain yields of 0.5 – 

1.0 μg of highly pure BAC DNA and requires approximately 

75 minutes. The DNA is ready for immediate use in multiple 

downstream applications (at least 5 sequencing reactions, or 4 

sequencing reactions and 1 fingerprinting analysis, or several PCR 

reactions), and the purity of the DNA results in accurate and long 

sequencing read lengths. 


‡ 5 PRIME Perfectprep BAC 96 Kit 

‡ Eppendorf epMotion 5075 VAC 

‡ Human BAC Library plate 

Growth of bacterial culture 


Library plate 

1.5 ml of 2x YT medium containing 12.5 μg/ml of chloramphenicol 

was aliquoted into each well of a 96 deepwell culture plate. Using a 

96-pin replicator, the medium was inoculated from frozen glycerol 

stocks of one quadrant of a 384-clone BAC library. The cultures 

were grown at 37°C overnight for 24 hours in a shaker at 325 rpm. 

The plate was centrifuged for 10 minutes at 1900 x g to pellet the 

cells, and the supernatant was poured off. The plate was blotted to 

remove residual medium. 

Single clone 

15 μl of a single clone BAC gylcerol stock was inoculated into 

5 ml 2x YT medium containing 5 μl 12.5 mg/ml chloramphenicol. 

This small culture was grown at 37°C at 325 rpm for 6 hours. 

600 ml 2x YT medium containing 600 μl 12.5 mg/ml chloramphenicol 

was inoculated with 600 μl of the 5 ml starter culture. The 

culture was grown overnight (approximately 18 hours) in 37°C 

incubator shaking at 325 rpm. 1.5 ml of the culture was aliquoted 

into four 96-deep well culture plates so that each well contained 

equivalent culture medium. The plates were centrifuged at 

1900 x g for 10 minutes. The supernatant was decanted and 

the excess medium was removed by blotting. The pellets were 

stored at -20°C until the plates were processed. 

Processing 

The pelleted cells were processed using the 5 PRIME BAC 96 

protocol on the epMotion 5075 VAC. 96 clones from a library plate 

were processed. Also, all wells of four plates containing the same 

clone (384 samples) were processed.


Isolation of high quality BAC DNA, continued. 


‡ Figure 1: Screenshot from the epMotion Editor showing the setup of the epMotion 5075 VAC worktable for the 5 PRIME BAC 96 protocol. 

Position Labware Comment 

A2 epT.I.P.S Motion 1000 μl 96 tips for 96 samples 

A3 epT.I.P.S Motion 1000 μl 96 tips for 96 samples 

A4 Collection Plate Collects eluates 

85 mm Adapter Height adapter for Collection Plate 

B1 Position 1: Solution 1 

Position 2: Solution 2 

Position 3: Solution 3 

Position 4: Trapping Buffer 

Position 5: Diluted Wash Solution 

Position 6: Elution Buffer 

30 ml reservoir 






B2 epT.I.P.S Motion 1000 μl 24 tips for 96 samples 

B3 epT.I.P.S. Motion 300 μl 8 tips for 96 samples 

VACUUM Filter Plate A Filters lysate 

Vacuum Frame 1 Collar for vacuum chamber 

Filter Plate BAC Traps BAC DNA 

C1 Culture Plate Contains bacterial pellets 

C2 55 mm Adapter Height adapter for Filter Plate BAC 

C3 55 mm Adapter Height adapter for Filter Plate A 

C4 Vacuum Frame Holder Height adapter for Vacuum Frame 1 

T0 Gripper Tool to move labware 

T1 TM 1000-8 1000 μl 8-channel pipetting tool 


‡ Table 1: Details of the worktable used in the ep BAC 96 protocol. 



53 

ARTS | Applications


54 




Automated fluorescent sequencing 

One half of the BAC DNA samples from each plate were sequenced 

using ABI BigDye V 3.1 chemistry on an ABI PRISM ® 3700 DNA 

Analyzer. The reaction conditions and the cycling parameters are 

listed in Table 2 and Table 3. 

Template DNA 10 μl 

5x Sequencing Buffer (ABI) 3 μl 

BigDye version 3.1 Ready Reaction Premix 2 μl 

Primer T7 (10 μM) 1 μl 

MgCl 2 (25 mM) 0.6 μl 

Molecular Biology Grade H 2 O 3.4 μl 

Total Reaction Volume 20 μl 

‡ Table 2: Sequencing Reaction Conditions (BigDye version 3.1; 

reactions). 

Step 1 95°C for 4 minutes 

Step 2 95°C for 15 seconds 

Step 3 51°C for 15 seconds 

Step 4 60°C for 4 minutes 

Step 5 Go to step 2 and repeat 99 times 

Step 6 10°C hold 

‡ Table 3: Cycle Sequencing Parameters. 

To purify the cycle sequencing products, 5 μl of 125 mM EDTA was 

added directly to the samples followed by 60 μl of 95% highly pure 

ethanol. The plates were sealed and vortexed for 10 seconds. The 

samples were incubated for 25 minutes at room temperature in 

the dark and centrifuged for 30 minutes at 3000 x g. The ethanol 

was poured off and the plates were spun for 1 minute at 50 x g. 

150 μl of ice-cold 70% ethanol was added to wash the samples. 

The plates were centrifuged at 1900 x g for 15 minutes. The ethanol 

was poured off and the plates were spun for 1 minute at 50 x g. The 

samples were air dried for at least 15 minutes and resuspended in 

8 μl of 0.1x TE prior to loading onto the 3700 DNA Analyzer. 

Results 

Agarose Gel Analysis 


‡ Figure 2: BAC DNA from one quadrant of a 384-clone library 

(96 samples) was isolated using the Perfectprep BAC 96 Kit on 

epMotion 5075 VAC. 10 μl of each sample were run on a 1% 

agarose gel and stained with ethidium bromide. The size marker 

is Lambda DNA digested with Hind III. 

‡ Figure 3: AC DNA samples from a plate containing the same 

single clone in all 96 wells were isolated using the Perfectprep 

BAC 96 Kit on the epMotion 5075 VAC. 10 μl of each sample were 

analyzed on a 1% agarose gel. Four plates containing this single 

clone were processed, and this gel photo represents one of those 

plates. The size marker is Lambda DNA digested with Hind III. 

Library plate 

The BAC DNA was sequenced using ABI BigDye V 3.1 chemistry 

on an ABI PRISM ® 3700 DNA Analyzer. The average Phred Q>20 

score is 676 bases, and the passing rate (scores > 100 bases) is 

100%. 72% of the scores are over 700 bases. 

Single clone 

One-half of each of the four plates processed (48 samples for each 

plate) was sequenced using ABI BigDye V 3.1 chemistry on an 

ABI PRISM ® 3700 DNA Analyzer. The average Phred Q>20 score 

for these samples is 718 bases and the passing rate (scores > 100 

bases) is 97.4%.



Automated Fluorescent Sequencing 

‡ Figure 4: An example of a sequencing trace from this BAC library. The Phred Q>20 score of this 

electropherogram is 823 bases, and there are zero "N" no calls through 859 bases. 

Discussion 

BACs continue to be an important molecular biology tool in 

genomic research and isolation of this DNA is critical to a research 

project. Moreover, the yield of BAC DNA must be sufficient and 

the purity must be high for optimal performance in downstream 

applications. The Perfectprep BAC 96 Kit provides excellent yield 

of high quality BAC DNA in a 96-well format. 

This kit is integrated onto the epMotion 5075 VAC system, and the 

protocol is optimized to give high yields and high quality BAC DNA. 

Using the Perfectprep BAC 96 Kit, the typical yield of a BAC clone 

is 0.5 – 1.0 μg. The average Phred Q>20 sequencing score for the 

96 different clones from library plate processed in this paper was 

676 bases. 


This system for purification of BAC DNA also provides consistent 

results across a 96-well plate. To demonstrate this, all wells of four 

96-well culture plates containing an aliquot of the same flask-grown 

single clone were processed with the 5 PRIME kit on the Eppendorf 

system. The agarose gel in Figure 3 illustrates that the yield across 

all wells of a plate are consistent. The average Phred Q>20 score 

for one half of each of these four plates was 718 with a passing rate 

of 100%. 

Conclusion 

The Perfectprep BAC 96 Kit from 5 PRIME used on the epMotion 

5075 VAC from Eppendorf is a complete system for the isolation 

of BAC DNA in a 96-well, fully automated format. The process 

requires approximately 75 minutes and gives consistent results 

across the plate. The DNA yield is sufficient for several downstream 

applications, and the DNA purity ensures optimal results from these 

applications. High throughput genomic sequencing projects as well 

as studies concentrating on specific genes can benefit from this 

complete system for the isolation of BAC DNA. 



55 

ARTS | Applications


56 


Accurate and precise pipetting of soluents 

Accurate and precise pipetting of DMSO with the epMotion ® 5070/5075 

Daniel Wehrhahn, eppendorf AG, Hamburg, Germany 

Abstract 

Dimethyl sulfoxide (DMSO) is a powerful organic solvent that can 

dissolve most organic substances to high loading levels, including 

carbohydrates, polymers and peptides. Therefore, DMSO is widely 

used for compound dissolution in pharmaceutical and research 

laboratories. Even when performed in the low to mid throughput 

range, compound testing assays require a high degree of 

standardization and reproducibility. An automated pipetting system 

can help to meet these requirements. In this report we show that 

DMSO* can be pipetted with the Eppendorf epMotion automated 

pipetting system at an excellent accuracy and precision over a 

broad volume range. 

Introduction 

The excellent pipetting accuracy of the epMotion automated 

pipetting system has made it a popular tool for many demanding 

small volume molecular biology reaction set-ups [1]. Routine 

pipetting tasks, like serial dilutions, reagent distributions and 

sample transfers can equally benefit from automation through 

increased reproducibility and complete assay standardization. 

The epMotion pipetting tools work with an air cushion piston 

stroke system and disposable tips. The unique optical sensor can 

measure liquid levels contact free, also with non-conducting liquids 

like DMSO. Liquid type parameters for the tools can be adapted to 

many different liquids from aqueous solutions to organic solvents. 

Safe operation is ensured by the completely contained housing that 

prevents manual interference in the process and possible contact 

with hazardous substances. 


‡ Figure 1: epMotion 5075 LH, Version with PC software. 


When working with pure DMSO, the liquid type class “98% alcohol” 

should be set in the epMotion software [2]. With this setting a 

prewetting step is performed to saturate the air inside the tip with 

the solvent and the aspiration and dispensing is done at low speed. 

Water based solutions with low DMSO content should be pipetted 

with the liquid type class “water”. 

For the accuracy and precision measurement of DMSO the 

epMotion was equipped with a Mettler SAG high precision balance. 

The measurements were taken and recorded electronically 

using the PICASO ® Pipette calibration software [3]. Used tools 

were taken randomly from the training laboratory. The density of 

DMSO was set to 1.101 mg/μl. For the single channel TS tools 

the measurements were taken according to EN ISO 8655: 10 

measurements each at 10%, 50% and 100% of the maximum 

volume of the tool. For each volume, the average out of these 10 

measurements, the corresponding systematic error (Accuracy) and 

the random error (Precision) was calculated. 

* Please note that DMSO can be explosive. DMSO should be used 

in well ventilated areas when working with concentrated solutions.

Accurate and precise pipetting of soluents 

Accurate and precise pipetting of DMSO, continued. 

For the eight channel TM-8 tools 12 measurements in total with 

4 separate channels were taken at 10%, 50% and 100% of the 

maximum filling volume. Per individual channel 3 measurements 

were taken. For each volume the average systematic error 

(Accuracy) and random error (Precision) were calculated for the 

4 channels. 

‡ Table 1: Automated pipetting of DMSO with the epMotion system: Accuracy and precision results. 

Conclusion 

The data clearly demonstrate that DMSO can be pipetted by 

the epMotion with a very high accuracy and precision over 

the complete volume range. The results were obtained with 

pipetting tools from standard laboratory equipment and were not 

precalibrated before the test. This shows the excellent mechanical 

quality and reproducibility of the tools. 

With the single channel pipetting tools a CV below 1% at 5 μl and 

below 0.05% at 1000 μl could be achieved. These values clearly lie 

within the Eppendorf technical specification limits for the epMotion 

tools set for the pipetting of double distilled water. 


The results are shown in Table 1. The technical specifications 

for the epMotion pipetting tools and the accuracy and precison 

limits for the pipetting of double distilled water can be found 

in the epMotion manual or on the internet at 

www.eppendorf.com/epmotion. 

Dispensing tool Volume range Volume Average Systematic error 

(Accuracy, es) 

Random error 

(Precision, CV) 

TS 50 1 -50 μl 5 μl 5.21 μl 4.18% 0.84% 

25 μl 25.27 μl 1.09% 0.48% 

50 μl 50.47 μl 0.95% 0.25% 

TS 300 20 - 300 μl 30 μl 30.41 μl 1.36% 0.47% 

150 μl 150.1 μl 0.06% 0.13% 

300 μl 300.1 μl 0.05% 0.06% 

TS 1000 40 - 1000 μl 100 μl 100.97 μl 0.97% 0.36% 

500 μl 500.3 μl 0.06% 0.05% 

1000 μl 997.0 μl -0.03% 0.02% 

TM 50-8 1 -50 μl 5 μl 5.35 μl 6.97% 3.04% 

25 μl 25.28 μl 1.13% 0.83% 

50 μl 50.37 μl 0.73% 0.40% 

TM 300-8 20 - 300 μl 30 μl 30.81 μl 2.70% 0.83% 

150 μl 150.98 μl 0.65% 0.19% 

300 μl 299.73 μl -0.10% 0.09% 

TM 1000-8 40 - 1000 μl 100 μl 101.02 μl 1.02% 0.44% 

500 μl 501.4 μl 0.27% 0.03% 

1000 μl 1000.13 μl 0.01% 0.01% 

References 

[1] Accuracy and precision of the epMotion system, Eppendorf Application Note 104, 

December 2004. 

[2] epMotion 5070/5075 Operating Manual, Eppendorf AG, Hamburg. 

[3] PICASO Pipette calibration software, Eppendorf AG, Hamburg. 



57 

ARTS | Applications


58 


Automated high-throughput RNA purification 

PureLink 96 Total RNA Purification Kit—automated high-throughput purification of total 

RNA from cultured cells 

eric Olivares, Invitrogen Corp., Carlsbad, CA; Daniel Wehrhahn, eppendorf AG, Hamburg, Germany 

Starting material: w 5 × 10 5 cells/well 

Typical yields: Up to 25 μg 

epMotion ® 5075 VAC processing time: 48–53 min 

The PureLink 96 Total RNA Purification Kit provides high- 

throughput isolation of high-quality total RNA from the widest 

range of sample types and sizes. The kit allows isolation of high 

yields of total RNA with minimal genomic DNA contamination from 

bacterial, yeast, plant, or mammalian samples. High-purity total 

RNA is eluted into RNase-free water and ideal for use in a variety 

of applications, including RT-PCR, qPCR, northern blotting, and 

nuclease protection assays. 

Yield (µg) 

20 

18 

16 

14 

12 

10 

8 

6 

4 

2 

‡ Figure 1: 5 × 10 5 293F cells per well were processed using the 

PureLink 96 Total RNA Purification Kit and the epMotion ® 5075 

VAC platform. Yields were quantitated using the Quant-iT RNA 

Assay Kit. 

4.7 kb 

1.9 kb 

4.7 kb 

1.9 kb 

0 

0 10 20 30 40 50 60 70 80 

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 

‡ Figure 2: Agarose gel electrophoresis of total RNA isolated with 

the PureLink Total RNA Kit from 5 × 10 5 293F cells. Total RNA 

(15 μl of eluate, ~9% of total yield) was separated on an E-Gel ® 48 

1% agarose gel. 

n = 80 

Mean yield = 10.1 ± 1.2 µg 

CV = 12.5% 

Well position 


Cultured 293F cells (5 x 10 5 cells/well) were lysed manually off the 

instrument, and then the lysates were transferred to a deepwell 

plate for automated processing. It is possible to perform the lysis 

step directly on the instrument; however, due to the labile nature 

of RNA it is preferable to lyse cells immediately after harvesting to 

stabilize the cellular transcriptome. The deck setup and required 

labware and accessories are shown in the appendix. Automated 

processing using the epMotion ® 5075 VAC system was completed 

in just under 45 minutes. 

Yields were measured using the Quant-iT RNA Assay Kit 

(Figure 1). The total RNA samples were subjected to a variety of 

quality measurements. Agarose gel electrophoresis (Figure 2) 

and Agilent Bioanalyzer analysis (Figure 3) demonstrate that the 

isolated RNA is of high integrity and contains minimal genomic 

DNA contamination. Quantitative RT-PCR for a housekeeping gene 

was used to assess the performance of the isolated total RNA in 

downstream applications. As shown in Figure 4, the RNA produces 

linear amplification plots in qRT-PCR down to a 105-fold 

cDNA dilution. 

Bases 

4,000 

2,000 

1,000 

500 

200 

25 

1 2 3 4 5 6 7 

9.8 9.9 10 10 10 10 

RNA integrity number (RIN) 

‡ Figure 3: Agilent ® Bioanalyzer analysis of total RNA integrity. 

RNA prepared from 5 × 10 5 293F cells using the PureLink 

96 Total RNA Kit (1 μl, ~50 ng) was subjected to microcapillary 

electrophoresis using an Agilent Bioanalyzer. Control RNA 

samples (~250 ng) were also included. The Bioanalyzer calculated 

RNA Integrity Numbers (“RIN”) from measurements of the 

electrophoretic trace. The PureLink samples all had RINs of 10, 

indicating the highest possible integrity. Lane 1: Agilent RNA 6000 

Nano LabChip ® Kit size standard; lanes 2–3: control RNA, 250 μg; 

lanes 4–7: four selected RNA samples.

Automated high-throughput RNA purification 

Automated high-throughput RNA purification, continued. 

A 

C t 

C t 

B 

�Rn 

45 

40 

35 

30 

25 

20 

45 

40 

35 

30 

25 

20 

1 

0.1 

10 –5 10 –4 10 –3 10 –2 10 –1 1 

cDNA relative dilution 

10 –5 10 –4 10 –3 10 –2 10 –1 1 


Ampli�cation plot 

C t 

C t 

0.01 

0 5 10 15 20 25 

45 

40 

35 

30 

25 

20 

45 

40 

35 

30 

25 

20 

Cycle 

10 –5 10 –4 10 –3 10 –2 10 –1 1 


10 –5 10 –4 10 –3 10 –2 10 –1 1 


30 35 40 45 50 


‡ Figure 4: Isolated total RNA produces linear amplification plots. First-strand cDNA was synthesized from ~300 ng of total RNA using 

reagents included in the SuperScript ® III First-Strand Synthesis SuperMix for qRT-PCR kit (Cat. no. 11752-050). A. A ten-fold dilution series 

was prepared, and 5 μl of each dilution was used in triplicate qPCR reactions for β-actin. The certified LUX primer set for ββ-actin (Cat. no. 

101H-01) was used in combination with Platinum ® Quantitative PCR SuperMix-UDG with ROX (Cat. no. 11743-100). Real-time detection of 

amplification was performed using an ABI 7900HT thermocycler. B. Standard curves were plotted for four random samples over the 6-log 

dilution series, and all four samples show a squared correlation coefficient (R 2 ) of 0.997–0.999, demonstrating robust performance of the 

isolated RNA in qRT-PCR. 



59 

ARTS | Applications


60 



Automated genomic DNA purification in 96-well plate and 8-well strip format using the 

MACHEREY-NAGEL NucleoSpin ® 8/96 Tissue kits on the epMotion ® 5075 

Henning Risch, Thomas Zinn, MACHeReY-NAGeL GmbH & Co. KG, Düren, Germany; Daniel Wehrhahn, eppendorf AG, 

Hamburg, Germany 

Abstract 

In the current application note we demonstrate the integration 

of the MACHEREY-NAGEL NucleoSpin 8/96 Tissue kits into the 

epMotion 5075 VAC automated pipetting system. The NucleoSpin 

8/96 Tissue kits are based on a vacuum filtration based bind-washelute 

procedure. Protocols for the epMotion 5075 VAC are available 

for medium throughput using the flexible 8-well strip based 

purification kit or for high throughput using the 96-well plate based 

kit. The use of NucleoSpin 8/96 Tissue kits on the epMotion 5075 

instrument allows the isolation of DNA from a wide range of sample 

materials. Application data for genomic DNA isolation from different 

mouse tissues, human cells or bacteria cells are presented. 

Introduction 

Typically, PCR based analytical methods in the field of transgenics, 

genotyping and SNP analysis require template DNA of high 

quality and reproducible yields. Purification of genomic DNA from 

different types of sample material is still challenging. First, the 

method should be sensitive, robust and easy to automate with 

little hands-on time. Second, besides a high degree of flexibility 

for the user, the procedure should avoid use of toxic solvents or 

precipitations which are very difficult to automate. Most of the 

drawbacks of conventional DNA isolation can be overcome by 

state-of-the-art silica membrane purification. Here, we describe 

the use of the MACHEREY-NAGEL NucleoSpin 8/96 Tissue kits for 

use on the epMotion 5075 VAC automated pipetting system. Using 

the well proven bind-wash-elute procedure liquid-liquid extraction 

or DNA precipitation can be avoided. The NucleoSpin 8/96 Tissue 

kits provide excellent consistency, a high robustness even when 

using very diverse sample types such as tissues from various 

organs, mouse tail clippings, eukaryotic and bacterial cells, and 

uncompromised DNA yield and quality. 

In addition, the kits can readily be automated on liquid handling 

systems. The procedure starts with an enzymatic sample digest at 

56 °C. This heat incubation step can be either performed externally 

or on the instrument which is equipped with a heat incubator. All 

further steps are performed at room temperature. Following the 

lysis incubation the DNA is bound reversibly to the silica membrane 

of the NucleoSpin Tissue Binding Plate or strips. Following washing 

steps and an ethanol evaporation step the purified DNA is eluted in 

water or low salt elution buffer. The purified DNA is suitable for use 

in down-stream applications like PCR, real-time PCR or restriction 

analysis. The kits are available in either 8-well strip format or 

96-well plate format in order to meet the user requirements for 

sample throughput. The use of NucleoSpin 8/96 Tissue kits on 

the epMotion 5075 automated pipetting system provides excellent 

results without the need for extensive programming, optimization 

and set-up time. 


‡ Eppendorf epMotion 5075 VAC 

‡ Vac Thermo Lid (for NucleoSpin 96 Tissue kit only) 

‡ Vac Frame 2 

‡ Vac Holder 

‡ Reservoir 400 ml 

‡ Collection Plate Adapter for MN Tube Strips 

‡ Channeling Plate 

‡ Reservoir Rack with Reagent Reservoirs 

‡ MACHEREY-NAGEL NucleoSpin 96 Tissue kit 

‡ MACHEREY-NAGEL NucleoSpin 8 Tissue kit 

‡ Tissue samples (e.g. mouse tail clippings, mouse ear punches, 

mouse organs), eukaryotic cells (HeLa S3 cells), bacterial cells 

Product use limitations and safety information 

Please read the MACHEREY-NAGEL NucleoSpin 8 Tissue or 

NucleoSpin 96 Tissue manual before performing the method for 

the first time. 

Determination of yield and purity 

Yield and purity were determined using a microplate reader (Biotek, 

Powerwave 200). DNA yield was calculated from A260 values. 

Purity was determined by calculating the A260/280 ratio. 

Agarose gel electrophoresis 

Integrity of DNA and results of restriction analysis were analyzed 

by TAE agarose gel electrophoresis (1% (w/v) agarose, ethidium 

bromide stain). 


Restriction analysis 

Approx 1 μg DNA was incubated with EcoRI for 2 h at 37 °C 

according to manufacturers instructions (Invitrogen). 

‡ Figure 1: Screenshot from the epMotion Editor showing the setup 

of the epMotion 5075 VAC worktable for use with the NucleoSpin 96 

Tissue kit.




A2 epT.I.P.S Motion 1000 μl 


A4 MN Tube Strips Elution tubes 

B1 epT.I.P.S Motion 1000 μl 

B2 Reagent Reservoirs 

Position 1: Empty 

Position 2: Buffer BQ1/Ethanol mix 

Position 3: Buffer BW 

Position 4: Buffer B5 


Position 6: Buffer BE 


Optional: Lysis buffer 






Empty 

B3 1.1 ml deepwell plate Sample plate 

Vacuum NucleoSpin Tissue Binding Plate 

Vacuum Frame 2 

Reservoir 400 ml with channeling plate 

DNA binding plate (top) 

Collar for vacuum manifold 

Collects waste 

C3 2.1 ml deepwell plate For mixing sample with binding buffer 

C4 Vacuum Frame Holder Height adapter for vacuum Frame 2 

T0 Gripper 


‡ Table 1: epMotion 5075 VAC worktable details for NucleoSpin 96 Tissue protocol. 




A4 MN Tube Strips Elution tubes 

B2 Reagent Reservoirs 


Position 2: Buffer BQ1/Ethanol mix 

Position 3: Buffer BW 



Position 6: Buffer BE 


‡ Table 2: epMotion 5075 VAC worktable details for NucleoSpin 8 Tissue protocol. 

Optional: Lysis buffer 




Empty 


Empty 

B3 1.1 ml deepwell plate Sample plate 

Vacuum NucleoSpin Tissue Binding Strips 

Vacuum Frame 2 

Reservoir 400 ml with channeling plate 


DNA binding strips inserted into Column Holder A (top) 

Collar for vacuum manifold 

Collects waste 

C3 2.1 ml deepwell plate For mixing sample with binding buffer 

C4 Vacuum Frame Holder Height adapter for vacuum Frame 2 

T0 Gripper 




61 

ARTS | Applications


62 




‡ Figure 2: Screenshot from the epMotion Editor showing the 

setup of the epMotion 5075 VAC worktable for use with the 

NucleoSpin 8 Tissue kit. 

DNA yield, µg 

DNA purity, A260/280 

12 

10 

8 

6 

4 

2 

0 

0 8 16 24 32 40 48 56 64 72 80 88 96 

2 

1 

‡ Figure 3: Reproducibility of DNA purification using 

NucleoSpin 96 Tissue kit. 

Genomic DNA was isolated from mouse tail samples (master 

lysate) using NucleoSpin 96 Tissue kit on the epMotion 5075 VAC 

automated pipetting system. DNA yield and purity were determined 

spectrophotometrically. 

sample number 

0 

0 8 16 24 32 40 48 56 64 72 80 88 96 

sample number 

Results 


Reproducibility of yield and purity of genomic DNA isolated 

from mouse tail clippings using NucleoSpin 96 Tissue kit 

In order to demonstrate the reproducibility of the purification 

method genomic DNA was isolated from a master lysate of mouse 

tail clippings representing identical sample material. Each lysate 

aliquot corresponds to a 4 mm mouse tail sample. The mouse 

tail samples were lysed with proteinase K overnight at 56 °C. 

Heat incubation for lysis was performed in an external incubator. 

Following lysis the lysate was centrifuged in order to precipitate 

remaining debris and hairs. The cleared lysate was transferred 

into the wells of a deepwell plate and placed on the instrument for 

further processing. DNA yield and purity are shown in figure 3. The 

results are summarized in table 3. Highly reproducible results for 

yield and purity were obtained. With a CV of 6.2% an average yield 

of 9.3 μg genomic DNA was obtained from the mouse tail clippings. 

DNA yield (µg) DNA purity ( A260/280 ) 

average yield / purity 9.30 1.84 

standard deviation 0.58 0.05 

min. yield / purity 8.03 1.68 

max. yield / purity 10.69 1.91 

‡ Table 3: Yield and purity of DNA isolated from mouse tail clippings. 

Quality of DNA and structural integrity 

In order to demonstrate quality and structural integrity of the 

isolated DNA the purified samples were analyzed by agarose 

gel electrophoresis. From the recovered 150 μl of purified DNA 

20 μl were loaded on the agarose gel. The DNA migrates as high 

molecular weight band of approx. 20-30 kbp. The appearance 

of the tight DNA band and the absence of low molecular weight 

smear demonstrate the excellent quality of DNA and well to well 

consistency. The results are shown in figure 4. 

‡ Figure 4: Agarose gel analysis of purified DNA isolated from 

mouse tail clippings. 

Aliquots of 20 μl from randomly selected purified genomic DNA 

samples were analyzed on an 1% agarose gel. High molecular 

weight DNA with a good consistency of yield was obtained.



Isolation of genomic DNA from different mouse organ tissues 

using NucleoSpin 8 Tissue kit 

In addition to the 96-well plate based NucleoSpin 96 Tissue kits 

for high sample throughput, the NucleoSpin 8 Tissue kit offers 

high flexibility using the NucleoSpin 8 Tissue binding strips. This 

kit is specially designed for medium throughput and allows for the 

processing of flexible sample numbers in multiples of 8 samples. 

The use of individual 8-well strips avoids the sealing of unused 

wells of a 96-well plate when processing less than 96 samples. 

Reusing partially used 96-well filterplates introduces a risk of 

contamination or sample carry-over and thus should be avoided. 

As an example for the use of the NucleoSpin 8 Tissue kit DNA 

purification from different mouse organs is shown in figure 5. The 

results for yield and purity are summarized in figure 6. The mouse 

organs were incubated for 6 h at 56 °C in the supplied lysis buffer 

including proteinase K using an external incubator. 

kidney brain liver 

heart ear tail 

‡ Figure 5: DNA isolation from mouse organs. 

DNA was isolated from 20 mg tissue samples as described 

before. Aliquots of 20 μl from the purified samples were analyzed 

by agarose electrophoresis. High molecular weight DNA with 

consistent yield was obtained. 

‡ Figure 6: DNA isolation with NucleoSpin 8 Tissue from 

different mouse tissue samples. 

DNA was isolated from approx. 20 mg of the indicated tissues. Each 

bar represents the average of eight extractions. Error bars indicate 

the standard deviation for each set of extractions. 


DNA yield as shown in figure 6 represents the amount of genomic 

DNA in different organs. Different yields are also represented by the 

DNA intensities in figure 5. Within one sample (e.g., mouse kidney 

tissue) DNA yields are consistent with a small variation as indicated 

by the error bars in figure 6. 

DNA quality and suitability for downstream applications 

In order to demonstrate quality (e.g., absence of DNase activity) 

and suitability for downstream applications, isolated DNA was 

analyzed by agarose gel electrophoresis. Samples were analyzed 

with and without treatment with restriction enzyme. Furthermore, 

samples were mixed with restriction enzyme incubation buffer 

and incubated without restriction enzyme for 2 h at 37 °C to 

demonstrate the absence of DNase activity. The results are 

shown in figure 7. 

‡ Figure 7: Restriction digest of isolated genomic DNA. 

An aliquot of 10 μl from randomly selected purified DNA samples 

isolated from mouse tail clippings were incubated for 2 h at 37 °C 

with EcoRI restriction enzyme (+). In all samples treated with EcoRI 

enzyme DNA was restricted. Another aliquot was incubated with 

the restriction enzyme buffer only at 37 °C for 2 h (-). The samples 

incubated with enzyme reaction buffer only show a distinct high 

molecular weight band. Distinct bands in these samples indicate 

the absence of DNase activity demonstrating the high quality of 

DNA. 

In order to demonstrate the suitability of the purified DNA for 

real-time PCR analysis, DNA isolated from mouse tail samples 

was used as template for PCR in a Roche ® Lightcycler instrument. 

The purified DNA was diluted 1:10 and used in 40 cycle reactions. 

A primer set amplifying a 212 bp fragment of Mus musculus 

cytoplasmatic aconitase exon (aco I) gene was used. 



63 

ARTS | Applications


64 




Figure 8: Real time PCR of DNA isolated from mouse tails. 

DNA isolated from mouse tails was used in a SYBR Green PCR 

assay. PCR amplification plots show reproducible amplification and 

no evidence for PCR inhibitors. The average crossing point for all 

sixteen samples was 23.79 with a CV of 2.43% demonstrating the 

high reproducibility of DNA yield and amplification. The specificity 

of the amplified PCR product was verified by melting curve 

analysis and analysis of the amplified PCR products by agarose 

electrophoresis (data not shown). 

DNA isolation from cells 

With a slightly modified procedure the NucleoSpin 8/96 Tissue 

kits can also be used for DNA isolation from cultured eukaryotic or 

bacterial cells. DNA isolation from eukaryotic cells was exemplified 

with HeLa cells. In contrast to the applications described before 

the lysis with proteinase K supplemented buffer and all purification 

steps were performed at room temperature on the instrument. 

After lysis RNase A was added to digest RNA. The results of the 

extraction of gDNA from HeLa cells are shown in the figure 9. 

‡ Figure 9: DNA isolation from HeLa cells 

HeLa cells were grown in culture bottles, harvested after trypsin 

treatment and pelleted into the wells of the lysis block. Each well 

represents approx. 5 x 10 5 cells. gDNA was isolated according to 

the NucleoSpin 96 Tissue protocol using lysis with proteinase K 

followed by RNase A treatment. Average yield of DNA was 2.9 μg. 

The high molecular weight band and absence of smear indicate the 

excellent quality of the DNA. 


DNA isolation from bacteria cells 

DNA isolation from gram-negative bacteria may be performed 

according to the standard protocol of the NucleoSpin 8/96 Tissue 

kit protocol. For Gram-positive bacteria the lysis procedure has to 

be modified. For these difficult to lyse bacteria the use of a modified 

lysis buffer, including lysozyme or lysostaphin, is recommended. 

M ------B. subtilis----- ----B. polymyxia---- 

‡ Figure 10: DNA isolation from bacterial cells 

DNA was isolated from 1 ml of an overnight culture of Bacillus 

subtilis and Bacillus polymyxa. Bacteria cells were harvested and 

resuspended in 180 μl resuspension buffer (20 mM Tris buffer pH 

8,0, 2 mM EDTA, 1% Triton X-100). 25 μl of a lysozyme solution 

(20 mg/ml) was added to each sample. Bacteria were lysed for 

1 h at 37°C with moderate shaking. Following lysis 20 μl of a RNase 

A solution (20 mg/ml) was added and samples were incubated 

for 10 min at room temperature. All further steps were performed 

according to the standard protocol of NucleoSpin ® 96 Tissue kit. 

Reproducible yields of high molecular weight DNA were obtained. 

Conclusion 

The combination of the MACHEREY-NAGEL NucleoSpin 8 Tissue 

and 96 Tissue kits and the epMotion 5075 VAC resulted in a flexible 

system for automated purification of high quality genomic DNA 

from a broad range of various sample materials. The compact 

epMotion 5075 VAC automated pipetting system can be used 

either for low to medium throughput using the 8-well strip based 

NucleoSpin 8 Tissue kit or for higher throughput using the 96well 

based NucleoSpin 96 Tissue kit. Both kits can be used with 

the same hardware allowing the user to switch between the two 

methods according to the requirements in sample throughput. 

DNA purification is achieved using the NucleoSpin Technology 

based on a vacuum driven bindwash-elute procedure. The use 

of an optimized silica membrane in the NucleoSpin 8/96 Tissue 

kits allows the purification of DNA from various sample materials 

without a risk of clogged columns. The purified DNA is of excellent 

quality and suitable for downstream applications such as restriction 

analysis or PCR based analysis. In summary, the NucleoSpin 

technology and the epMotion 5075 VAC automated pipetting 

system form an attractive and versatile system for the automated 

isolation of genomic DNA from different sample materials.

Real-time PCR with Mastercycler® ep realplex 

Mastercycler ep realplex—a flexible device for fast and accurate real-time PCR 

Beate Riekens and Andrés Jarrin, eppendorf AG, Hamburg; Richard Black, eppendorf North America 

Introduction 

Real-time PCR has become one of the most popular tools in 

molecular biology research. It allows precise quantitative and 

qualitative detection of nucleic acids, and it is used in a variety 

of applications such as gene expression analysis and genotyping. 

In addition to fluorochrome-coupled hybridization probes, 

intercalating dyes are used for the monitoring of DNA amplification. 

Newer developments in real-time PCR devices and reagent 

technology concentrate primarily on shortening run times and 

improving sensitivity and reproducibility. With Mastercycler ep 

realplex, Eppendorf introduces a flexible, reliable and exceptionally 

high-speed real-time PCR instrument. The device is of modular 

design—consisting of a compact thermoblock and an optical 

detection unit that features an LED optics array and the latest 

in photo-multiplier technology. The realplex 2 module detects 

fluorochromes within a range of 520 to 550 nm, while the realplex 4 

device has additional filters, paired with a second channel photo- 

multiplier, to detect additional emission wavelengths of 580 to 

605 nm. The signal recording times for all 96 samples range from 

8 seconds for two channels to a maximum of 16 seconds for all 

four detection channels. The optical units can be combined with 

either a standard 96-well aluminum thermoblock or the highspeed 

(6 °C/s) 96-well silver block. Both thermoblocks1 have a 

temperature gradient option for easier and faster optimization of 

assays. Depending upon application requirements, Mastercycler ep 

realplex can thus be configured to function as a standard device for 

two-fold multiplexing, or, in its most advanced configuration, as a 

“high-speed” system for fast real-time PCR analyses with up to four 

detection channels. 

In addition to the technical features of the instrument, reagent 

chemistry significantly impacts the results and protocols of a 

real-time PCR assay. 5 PRIME RealMasterMix series reagents 

are based on the innovative HotMaster ® technology2 —they 

utilize a temperature-dependent inhibitory ligand of Taq DNA 

polymerase to ensure the Hot Start function. While Taq activity 

is blocked at lower temperatures, enzyme activity is immediately 

restored when a temperature of 60 °C is exceeded. Therefore, in 

contrast to conventional real-time PCR reagents, RealMasterMix 

Probe (for use with probe-based assays) and RealMasterMix (for 

SYBR ® Green assays and single-plex probe formats) do not require 

traditional, lengthy activation steps. Regardless of the reagent 

chemistries used, Mastercycler ep realplex’s combined benefit of 

high-temperature control speed and brief signal recording time 

enables total run times that were never before possible with Peltier 

element-based real-time PCR devices. The performance of 

Mastercycler ep realplex, using RealMasterMix reagents, is 

documented in this article. Experimental data is presented to 

highlight reproducibility, linear detection range, sensitivity, 

specificity, multiplexing capability and speed. 



All experiments were conducted on a Mastercycler ep 

realplex4 S with a silver block. For SYBR Green I assays, 5 PRIME 

RealMasterMix was used; for TaqMan ® assays, RealMasterMix 

Probe was used. All reactions were set up on an Eppendorf 

epMotion ® 5070 automated pipetting system and dispensed into 

Eppendorf ® twin.tec 96 skirted PCR plates. The plates were then 

sealed with Eppendorf Heat Sealing Film, using an Eppendorf 

Heat Sealer. 

Reproducibility 

An 80 bp target sequence of the human sex-related Y chromosome 

gene (SRY) was quantitated in a uniformity experiment to determine 

the reproducibility of a SYBR Green I assay across all positions of 

the thermoblock. 100,000 copies of a plasmid target that contains 

the SRY amplicon were used in 50 μl total reaction volumes. 

A mastermix of all reaction components was prepared and 

distributed with the 8-channel dispensing tool of the epMotion 

5070 into a twin.tec 96 PCR plate. The PCR run profile A was 

used (see Table 2 on page 68). 

Following the PCR, a melting curve analysis was performed to test 

the specificity of the amplification. 

1 U.S. Pat. 6,767,512 

2 U.S. Pat. 6,667,165 

‡ Fig. 1: Mastercycler ep realplex 



65 

ARTS | Applications


66 



Mastercycler ep realplex—a flexible device for fast and accurate real-time PCR, continued. 

Target sequence Primer/probe sequence TM (°C) Final concentration Amplicon size 

Lambda genome Forward primer: caggaactgaagaatgccagaga 63.0 TaqMan ® : 300 nM 104 bp 

Reverse primer: ccgtcgagaatactggcaattt 62.5 

Probes: 

FAM-tgtactttcgtgctgtcgcggatcg-TAMRA 

YY-tgtactttcgtgctgtcgcggatcg-BHQ1 

72.8 TaqMan single-plex: 200 nM 

Sex-related 

Forward primer: gcgacccatgaacgcatt 63.0 SYBR 

Y chromosome 

(SRY) gene 

® Green: 300 nM 80 bp 

Reverse primer: agtttcgcattctgggattctct 62.6 

TaqMan single-plex: 900 nM 

TaqMan duplex: 300 nM 

Probes: 

72.4 TaqMan single-plex: 300 nM 

FAM-tggtctcgcgatcagaggcgc-TAMRA 

YY-tggtctcgcgatcagaggcgc-BHQ1 

TaqMan duplex: 200 nM 

GAPDH gene Forward primer: tgccttcttgcctcttgtct 60.1 TaqMan duplex: 300 nM 146 bp 

Reverse primer: ggctcaccatgtagcactca 59.9 

Probe: FAM-tttggtcgtattgggcgcctgg-BHQ1 71.8 TaqMan duplex: 200 nM 

‡ Table 1: Primer and probes 

Dynamic detection range 

With the help of the epMotion ® 5070, a Lambda DNA dilution series 

of 10 8 to 10 0 copies/μl was produced. 10 μl of each dilution was 

used as template DNA in a Lambda-specific TaqMan assay (see 

Table 1). To test comparability of the results of two detection 

channels, a FAM- and a Yakima Yellow (YY)-labeled probe of the 

same sequence were used in parallel experiments. The run profile 

B was used (see Table 2 on page 68). 

A B 

‡ Fig. 2: Reproducibility across 96 replicates 

(A): Logarithmically scaled amplification plots of 96 replicates of the SRY target amplified using 5 PRIME RealMasterMix in the SYBR 

format; with a mean C t value of 18.99, the standard deviation was 0.07. (B): Melting curve analysis of the 96 replicates shows no primer- 

dimers or nonspecific products. Comparable results were obtained with 20 μl of reaction volumes (not shown). 


Differentiation of two-fold concentration differences 

A TaqMan assay for the human SRY gene was selected to detect 

two-fold concentration differences of template DNA copy numbers. 

Starting from a stock solution of human genomic DNA (200 ng/μl, 

corresponding to 33,333 copies/μl), samples of 2,000, 1,000, 500 

and 250 copies, respectively, were produced. For each dilution a 

mastermix with 6 replicates was prepared. The run profile B was 

used (see Table 2 on page 68).



A B 

‡ Fig. 3: Dynamic range in the 520 nm and 550 nm detection channel 


Within a range from 10 9 to 10 1 template molecules, Lambda DNA can be reliably detected in a TaqMan ® assay. Using RealMasterMix Probe, 

both a FAM-labeled probe [detection channel 520 nm (A)] and a Yakima Yellow-labeled probe [detection channel 550 nm (B)] demonstrate 

PCR efficiencies of 97% and 96% at a correlation coefficient of 0.999. 

‡ Fig. 4: Two-fold concentration changes 

A SRY-specific TaqMan assay shows that Mastercycler ep 

realplex can differentiate two-fold copy number differences with 

high precision. The C t differences between two-fold differential 

dilutions in a range between 2,000 and 250 copies correspond 

almost exactly to one cycle that mirrors the two-fold differences 

on copy numbers. 

‡ Fig. 5: Single-molecule DNA detection 

Out of 50 replicates of the SRY-specific TaqMan assay, 

each statistically calculated to contain a single template DNA 

molecule, 28 exceeded threshold while 22 behaved in accordance 

with the negative controls. The positive samples, with a mean value 

of 37.03, had minimum and maximum values of 35.89 and 38.07, 

respectively. Mastercycler ep realplex in combination with 

RealMasterMix Probe thus reliably detected single-target 

DNA molecules. 



67 

ARTS | Applications


68 




Standard PCR profile 

Two-step PCR 

Conventional qPCR instrument 

+ conventional reagents 

50 μl reaction volume 

PCR profile A 

Two-step PCR 

Mastercycler ep realplex S + 

RealMasterMix Probe 

Tube control 


PCR profile B 

Fast two-step PCR 



Tube control 


PCR profile C 




Tube control 


PCR profile D 




Block control 


‡ Table 2: PCR profiles 

Single-molecule DNA detection 

Initial 

denaturation/ 

activation 

The SRY gene is present as a single copy on the male Y chromo- 

some. A dilution of male human genomic DNA containing 600 fg 

DNA/μl was prepared, which corresponds to one copy per 10 μl. 

A SRY-specific TaqMan ® assay was developed with the goal of 

single-copy detection. As a result of the statistical dispersal of 

molecules per volume unit, some reactions contained several 

copies each while others contained no target molecules. A 

mastermix of 50 replicates, each with 10 μl of template DNA per 

reaction, was prepared, and run profile B was used (see Table 2). 

Denaturation Annealing/ 

extension 


Cycles Total run time 

10 min 15 s 60 s 40 1 h 38 min 

2 min 15 s 60 s 40 1 h 12 min 

2 min 10 s 20 s 40 42 min 02 s 

20 s 3 s 20 s 40 35 min 37 s 

20 s 3 s 17 s 40 23 min 34 s 

High-speed PCR protocols 

The SRY TaqMan assay was selected to test the influence of PCR 

run profiles and reaction volumes on the results. A mastermix with 

1,000 copies of human gDNA/μl was used (for run profiles see 

Table 2). At least 15 replicates were prepared. An identical assay 

that uses a traditional two-step PCR profile was run in parallel on a 

competitor instrument (data not shown).



A B 

Av.Ct 22.62 

St.dev. 0.05 

1 h 12 min 

50 μl 

C D 

Av.Ct 22.45 

St.dev. 0.10 

32 min 

20 μl 

‡ Fig 6: High-speed PCR profiles 


(A) to (D) show the effect of a stepwise time optimization of PCR profiles and concomitant reduction of reaction volumes on total PCR 

run times as well as standard deviation of a SRY TaqMan ® assay. Please note that due to the different reaction volumes and fluorescent 

intensities generated, C t values cannot be directly compared. 

Multiplexing 

The human SRY (single copy) and GAPDH (two copies per genome) 

genes were chosen to demonstrate the multiplexing capability of 

Mastercycler ep realplex. In a duplex TaqMan assay a YY/BHQ1- 

labeled TaqMan probe for the SRY gene and a FAM/BHQ1-labeled 

probe for GAPDH gene were used. 10,000 copies of male genomic 

DNA per 20 μl reaction were used as template DNA. For primer 

and probe concentrations see Table 1 on page 68; the run profile 

B was used (see Table 2 on the previous page). 

A comparison of the Eppendorf real-time PCR system 

(Mastercycler ep realplex and 5 PRIME RealMasterMix reagents) 

with a competitor-based system that uses a conventional device 

and reagent technology shows that considerably shorter run 

times can be obtained with the Eppendorf system—even when 

traditional PCR profiles are maintained (Table 2 and Fig. 6A). 

Av.Ct 22.82 

St.dev. 0.08 

42 min 

20 μl 

Av.Ct 23.54 

St.dev. 0.08 

23 min 

10 μl 

When the PCR profiles are more closely adapted to the properties 

of the Eppendorf system (fast heating/cooling rates, brief signal 

recording times, no enzyme activation times), a run time of less 

than 45 minutes for 40 cycles can be achieved (Fig. 6B). When 

further optimization of the temperature holding times is carried 

out, run times of slightly more than 35 minutes with comparable 

C values and deviations are possible (Fig. 6C). 

t 

Combined with a reduced reaction volume (5 μl is achievable 

with an automated pipetting system), real-time PCR assays in 

the 96-well format with total run times under 24 minutes can be 

achieved (Fig. 6D). If established PCR systems require slow heating 

and cooling rates, the speed of Mastercycler ep realplex can be 

finely regulated as well as emulate the temperature control behavior 

of other devices. 



69 

ARTS | Applications


70 




‡ Fig. 7: Multiplexing of SRY and GAPDH targets 

A duplex TaqMan ® assay for the SRY (single copy, YY Probe) and GAPDH (two copies, FAM probe) targets from human genomic DNA in 

12 replicates is shown. As seen in Fig. 3, the YY signal was detected in the 550 nm channel using VIC dye calibration data. The “all dyes” 

view of the realplex software reveals the shifted pattern of the GAPDH and SRY amplification plots and corresponding C t values. Reflecting 

the gene dosage ratios of both genomic targets, these data document that Mastercycler ep realplex can reliably differentiate fluorescence 

signals in multiplex applications, even with targets that show only minimal differences in abundance. 

Conclusion 

Mastercycler ep realplex is a real-time PCR instrument that, due 

to its flexible modular design, can be adjusted to the specific 

requirements of the user. Its high-quality construction and stable, 

user-friendly software form a reliable real-time PCR platform 

that ensures a high degree of accuracy across all sample 

positions—and within a wide detection range. Adoption of the silver 

block significantly speeds up run times while still maintaining the 

instrument’s high degree of accuracy. 



Low volume real-time PCR on the Mastercycler ® ep realplex 

Nils Gerke, eppendorf AG, Hamburg, Germany 

Abstract 

This Application Note provides a comparative overview of real-time 

PCR reactions at 20 µl, 10 µl and 5 µl reaction volumes, each 

generated on the Mastercycler ep realplex real-time PCR system. 

SYBR ® Green I- as well as TaqMan® probe-based assays were 

performed, and the reaction setup was done with the aid of the 

epMotion ® 5070 automated pipetting system. 

It is shown that real-time PCR reactions with small reaction volumes 

can successfully be performed on the Mastercycler ep realplex: The 

reaction efficiencies obtained for the presented assays, including 

the lowest volume reactions, were comparably good and the C t 

values obtained from the 10 µl- and 5 µl- reactions were only 

slightly higher than those detected for the 20 µl setups. 

Introduction 

While PCR setups of 50 μl or 25 μl used to be customary, there 

is nowadays a trend towards carrying out PCR in lower reaction 

volumes [1]. 

One of the advantages when working with reduced volumes is that 

a correspondingly lower amount of template is needed to achieve 

a particular DNA template concentration in the reaction sample 

(Table 1). This is of particular importance when only small amounts 

of template are available, for example in gene expression studies 

using degraded biological starting materials or when working with 

forensic sample material [1]. 

As an additional benefit, faster run times can be achieved by 

reducing the temperature holding times in the PCR protocol, since 

the programmed temperatures are transferred to the sample more 

quickly in a smaller reaction volume. 

However, in many cases the main reason for reducing the reaction 

volume is to minimize reagent costs. These reagents, in particular 

the kits and the fluorescence-labeled DNA probes, comprise a 

significant share of total cost during routine use of real-time PCR. 

Therefore, depending on the sample throughput of the laboratory, 

significant savings can be achieved by reducing the reaction 

volume. 



With real-time PCR, two different targets were amplified: 

1 PCR target: 108 bp, fragment of Lambda DNA 

Forward primer (600 nM): cgcacaggaactgaagaatg, 

Reverse primer (300 nM): ccgtcgagaatactggcaat, 

Lambda TaqMan probe (labeled with FAM, 200 nM): 

tgtactttcgtgctgtcgcggatcg 

Template: Lambda DNA (Roche) 

2 PCR target: 80 bp, fragment of human SRY gene 

Forward primer (300 nM): gcgacccatgaacgcatt, 

Reverse primer (300 nM): agtttcgcattctgggattctct, 

TaqMan probe (labeled with FAM, 200 nM): tggtctcgcgatcagaggcgc 

Template: Human Genomic DNA (Roche) 

For each PCR reaction SYBR Green I- and TaqMan probe-based 

assays were carried out and each setup was done with 

20 μl, 10 μl, and 5 μl reaction volumes. For pipetting the reaction 

setup, a Mastermix (consisting of 5 PRIME RealMasterMix, SYBR 

Green and primer or 5 PRIME RealMasterMix Probe, TaqMan probe 

and primer) and the highest template DNA concentration were each 

initially prepared manually for each reaction (Table 1). In subsequent 

steps, the reaction samples were pipetted with the epMotion 5070 

automated pipetting system. 

The epMotion was programmed to dispense Mastermix into the 

corresponding wells of an Eppendorf twin.tec PCR Plate 96 skirted, 

to pipette a dilution series starting with the highest template 

concentration and then to add template DNA to the appropriate 

wells: 

20 μl total reaction volume: 12 μl Mastermix + 8 μl template DNA 



A 5-step serial dilution with five replicates each was pipetted to 

generate a standard curve that permitted comparison of the PCR 

results. While the Lambda DNA standard samples were diluted 

ten-fold, the standard samples for human genomic DNA were 

diluted three-fold. A negative control was included in each assay 

by substituting water for template DNA. 

The Eppendorf twin.tec PCR Plates 96 skirted were sealed with 

Eppendorf Heat Sealing Film and then subjected to a short spin 

(approx. 500 x g) prior to the run. The PCR setup for all assays 

was carried out with the same epMotion 5070 automated pipetting 

system and all real-time PCR runs were performed on the same 

Mastercycler ep realplex4 S device (Table 2). 



71 

ARTS | Applications


72 



Low volume real-time PCR on the Mastercycler ® ep realplex, continued. 

‡ Figure 1: Selected amplification plots and parameters of the 20 μl, 10 μl und 5 μl Lambda (A, B) and SRY (C, D) assays. 



Low volume real-time PCR on the Mastercycler ® ep realplex, continued. 

Results 

The amplification plots of the presented assays are comparably 

steep for all reaction volumes (Figure 1). Absolute fluorescence 

intensity is lower at the smaller reaction volumes. However, even in 

the case of the lowest fluorescence intensity (5 μl SRY SYBR assay) 

the analysis can be performed easily with adjusted scaling. 

PCR efficiencies of the shown assays, calculated from the C values 

t 

of the standard samples, differ only minimally among the various 

reaction volumes of the particular PCR system. The r2-coefficients of the Lambda assays do not show a decline at smaller reaction 

volumes (≥ 0.99 for all). The r2- values of the 5 μl setups for the SRY 

assays are, with values of 0.989 and 0.987, slightly below the 10 μl 

and 20 μl setups (Figure 1). 

When considering all assays shown in Figure 1, the mean replicate 

C values of the 10 μl reaction samples are, at the highest template 

t 

concentration level, between 0.55 and 0.86 higher compared to the 

20 μl reactions. For the 5 μl setups an increase of between 0.27 and 

0.61 relative to the 10 μl assays was observed. 

Reaction 

Setup 

highest 

template 

conc. 

[cop./μl] 

Lambda SRY 

template 

amount 

[cop./rxn] 

highest 

template 

conc. 

[ng/μl] 

template 

amount 

[ng/rxn] 

20 μl 

2.5x105 5x106 24.3 

10 μl 2.5x10 1.215 

6 12.15 

5 μl 1.25x106 6.075 

‡ Table 1: Highest template concentration and its appropriate 

template amount for the 20 μl, 10 μl and 5 μl reaction volumes 

Reaction PCR program 

95 °C 95 °C 60 °C melting curve (default 

settings) 

Lambda 2 min 10 s 40 s only with SYBR 

SRY 2 min 10 s 30 s only with SYBR 

40 cycles 

‡ Table 2: PCR programs on the Mastercycler ep realplex 4 S 


Discussion 

The selected assays may indicate that there is a small loss in 

sensitivity for the low volume qPCR assays. The C values of the 

t 

10 μl reactions were only slightly higher than those detected for 

the 20 μl setups (Figure 1). One reason for the small shift of the Ct value at lower volumes could be explained by the fact that due to 

the smaller amount of template used (Table 1), the increase of PCR 

product amount during the course of the reaction was delayed 

accordingly. Since the intensity of the detected fluorescence signal 

is proportional to the amount of PCR product, a delayed increase in 

the fluorescence signal at constant instrument detection sensitivity 

is observed. For many applications, this small Ct value shift does 

not pose a problem. However, this should be taken into account 

particularly when working with small amounts of template (low 

copy PCR). 

The reaction efficiencies obtained for all assays shown in Figure 1, in 

particular those with low reaction volumes, were comparably good 

with values above 0.92. 

The reactions presented here were all performed successfully 

using the same reagents, concentrations and reaction vessels. 

The Eppendorf twin.tec PCR Plate 96 skirted used in this study 

has a relatively low total reaction volume of 150 μl/well. Also, by 

sealing the plate with an Eppendorf Heat Sealing Film, the risk of 

evaporation is almost eliminated, which is of particular importance 

when working with small reaction volumes. It must be assumed that 

not all reaction conditions are equally suited for the establishment 

of small reaction volumes. In order to assess this, reduced-volume 

PCR reactions should be evaluated in direct comparison to larger 

volumes, prior to the routine use of small reaction volumes [2]. 

The integrity of the data fit to the theoretical line of the standard 

curve is described by the r2-coefficient [3]. 

Lower r2-coefficients of the presented SRY 5 μl setups may indicate 

that the lower reaction volumes put higher demands on liquid 

handling accuracy during PCR setup (Figure 1). In order to ensure 

reproducible results when routinely working with small volumes, it 

is recommended to employ an automated PCR setup, such as the 

epMotion automated pipetting system. These results demonstrate 

that real-time PCR with small reaction volumes can successfully 

be performed on the Mastercycler ep realplex. With the aid of the 

epMotion automated pipetting system, up to 75% savings in reagent 

costs can be achieved compared with 20 μl real-time PCR reactions. 

References 

[1] Leclair B, Sgueglia JB, Wojtowicz PC, Juston AC, Fregeau CJ, Fourney RM. STR DNA typing: increased 

sensitivity and efficient sample consumption using reduced PCR reaction volumes. J Forensic Sci 

2003; 48(5):1001-1013. 

[2] Thomson E, Vincent B. Reagent volume and plate bias in real-time polymerase chain reaction. 

Analytical Biochemistry 2005; 337: 347-350. 

[3] Dorak T (ed.). Real-time PCR. Taylor & Francis Group; 2006. 



73 

ARTS | Applications


74 


Real-time RT-PCR diagnosis of the avian influenza virus 

Real-time RT-PCR diagnosis of the avian influenza virus using Mastercycler ® ep 

realplex S and AIV RT-PCR kits from PG Biotech 

Ong Wai Kean and Christian Rohrer, eppendorf Asia Pacific Headquarters, Malaysia 

Abstract 

The recent outbreak of avian influenza in different parts of the world 

not only has caused major economic losses, but also has presented 

a significant threat to public health due to a potential transmission 

of the avian influenza virus to humans. The ability to rapidly 

recognize avian influenza virus (AIV) in biological specimens is of 

utmost importance to enable fast decision making on appropriate 

countermeasures to prevent the further spread of the virus. In 

this study we evaluated the performance of a commercial Kit, AIV 

RT-PCR Kit (PG Biotech), for the detection of influenza-specific 

RNA using real-time reverse transcription PCR. The tests were 

performed on the Mastercycler ep realplex S (Eppendorf AG), a 

96-well real-time PCR instrument. It could be demonstrated that the 

fast ramping speed of the Mastercycler ep realplex S was able to 

significantly shorten the run time of the kit as compared to standard 

real-time PCR instruments. The real-time PCR Kits could be 

implemented on the instrument using a standard protocol according 

to manufacturers specifications with no optimization of parameters 

required. With an average Ct value of 24 obtained for the Influenza 

A and H5 subtype, the combination of the Mastercycler ep 

realplex S and the AIV RT-PCR Kits outperformed the expected 

Ct value of 28 stated in the operation manuals of the kits. 

Introduction 

The highly pathogenic avian influenza virus threatens to become 

a worldwide pandemic [1] and as such, very fast screening and 

detection methods are becoming increasingly important to ensure 

that appropriate measures can be taken quickly to contain the 

spread of the virus. 

Molecular techniques offer a more rapid approach to detecting and 

characterizing the viral genome compared to classical methods. 

Many samples can be analyzed in a shorter time by performing a 

reverse transcription of the virus RNA followed by an AIV specific 

PCR or real-time PCR assay. 

PCR is a specific and sensitive technique but samples must be 

analyzed via Gel Electrophoresis following the amplification step. 

Firstly, this increases the risk of carryover contamination since the 

tubes need to be opened and secondly, the post PCR handling 

steps are time consuming and cumbersome. Using real-time PCR 

offers several advantages over standard PCR when applied for 

viral screening purposes. Since result monitoring is integrated in 

the process and can be done in real time, post PCR handling is 

not required and data can be analyzed while the result is being 

generated. This shortens the time in obtaining a result considerably. 

Also, since real-time PCR displays broader dynamic range, it is 

possible to detect lower copy numbers in a shorter time compared 


to standard PCR. Real-time PCR assays also offer the added 

benefit of including several external and internal controls which 

improves the overall integrity of the assay, thereby reducing the 

number of false positive, and more importantly, false-negative 

results. This coupled with the increased sensitivity that real-time 

PCR offers ads to the overall importance that real-time PCR has 

in the modern laboratory. 

To satisfy the demand of a diagnostic laboratory, real-time PCR 

offers the possibility to screen large numbers of samples very 

quickly and obtain accurate results at the same time. If assays are 

run on a fast and sensitive real-time PCR platform the time to result 

can be shortened even more. Eppendorf’s Mastercycler ® ep 

realplex S 96 well system with heating rates of 6 deg/sec and 

cooling rates of 4.5 deg/sec allow quick completion of a real-time 

PCR assay of 96 samples at one go. The use of 96 individual 

LEDs as an excitation source in combination with minimal moving 

parts in the optical detection module allow single color fluorescent 

detection in 8 seconds which is faster than comparable filter based 

real-time PCR systems. 

In this paper, we evaluate the performance of two commercially 

available real-time RT-PCR avian influenza detection kits, AIV A 

RT-PCR Kit and AIV H5 RT-PCR Kit (PG Biotech, manufactured for 

Qiagen) on the Mastercycler ® ep realplex S. 

Overview of avian influenza virus 

Influenza viruses have a single-stranded RNA genome and are 

classified into types A, B or C based on antigenic differences 

of their nucleo- and matrix proteins. Avian influenza viruses 

(AIV) belong to type A, which is able to infect a range of species 

including humans, birds, horses and pigs. The main antigenic 

determinants of influenza A viruses are the haemagglutinin (H) and 

the neuraminidase (N) transmembrane glycoproteins. On the basis 

of the antigenicity of these glycoproteins, influenza A viruses are 

classified into sixteen H (H1 - H16) and nine N (N1 - N9) subtypes. 

The subtype H5 of the virus can be transmitted from birds to 

human causing major health concerns. 

Wild aquatic birds are potential carriers and the assumed natural 

reservoir of all influenza virus A subtypes [2]. These natural hosts 

normally are not seriously affected by an AIV infection but some 

domesticated poultry such as chicken or turkey are known to be 

particularly susceptible to the infection [3].


Real-time RT-PCR diagnosis of the avian influenza virus, continued. 

Materials and Methods 

The AIV A RT-PCR Kit and AIV H5 RT-PCR Kit (PG Biotech, 

manufactured for Qiagen) are kits that are developed for veterinary 

research. The AIV A RT-PCR kit detects a gene that is common to 

all subtypes of the avian influenza virus and the AIV H5 RT-PCR kit 

detects the hemagglutinin gene of the H5 subtype. Both kits use 

hydrolysis probes that have FAM as the reporter dye at the 5‘ end 

and TAMRA as a quencher at the 3‘ end. 

These kits were tested on the Mastercycler ep realplex S 

(Eppendorf, Germany) which has a 96 well block format, a 

gradient function and a heating rate of 6 deg/sec and cooling 

rate of 4.5 deg/sec. Assays were performed with positive and 

negative controls which are included in the kits. The reagents were 

dispensed according to the PG Biotech instruction manual. Assays 

were run using twin.tec PCR plate 96, skirted (Eppendorf, Germany) 

in combination with Heat Sealing Film (Eppendorf, Germany). 

The investigation process follows a cascade: the presence of 

influenza A specific RNA is detected through a one-step reverse 

transcription – real-time polymerase chain reaction (RT – real-time 

PCR) using primers and probes provided in the AIV A RT-PCR kit 

that are specific for a gene that is common to all subtypes of avian 

influenza virus. 

When a positive result is obtained, a second one-step RT – 

real-time PCR assay is set up using primers and probes from 

the AIV H5 RT-PCR Kit which are specific for a sequence of the 

hemagglutinin gene that is conserved among avian influenza 

viruses of subtype H5. 

The Mastercycler ep realplex S was programmed according to 

manufacturer’s recommendation for block based systems. See 

Table 1 for thermal protocols for both kits. 

RT-RCR-Thermal Protocol No. of 

cycles 

‡ Table 1: RT-PCR thermal protocol as per manufacturer’s 

recommendation 

Data acquisition was carried out during the combined annealing/ 

extension step (*). 

Temp 

(°C) 

Time 

Reverse transcription 42 30:00 

Initial denaturation 92 3:00 

3-step cycling: 

Denaturation 

Annealing 

Extension 

2-step cycling: 

Denaturation 

Annealing/extension* 

5 

40 

92 

45 

72 

92 

60 

0:10 

0:30 

1:00 

0:10 

1:00 

Results 


The positive control with the subtype A primers gave rise to a 

signal with an average Ct of 24 cycles (Fig. 1). As for the positive 

control with the type H5 primers, the signal has an average Ct of 

24.4 cycles. According to PG Biotech, Ct values of approx. 28 are 

representative of a good result. The amplification plots for both 

AIV A RT-PCR Kit and AIV H5 RT-PCR Kit therefore outperform the 

expectations stated in the operation manual of the manufacturer. 

Using the Mastercycler ep realplex S Ct values of approx. 24 were 

obtained. The tightness of the replicates show good reproducibility 

of the results. As expected the negative controls did not show any 

amplification. 

Performing the AIV A RT-PCR Kit and AIV H5 RT-PCR Kit on the 

Mastercycler ep realplex S resulted in a runtime of only 90 minutes 

(Fig. 2). In comparison to standard real-time PCR platforms with 

slower ramp rates and a runtime of 120 min for the same protocol, 

the run-time was significantly reduced. Looking at time needed 

starting from sample preparation to the analysis of the results, real- 

time PCR considerably shortens the time needed in comparison to 

standard PCR. 

Fluorescence (norm) 

1 0 0 0 

1 0 0 

1 0 

1 

Subtype A 

Type H5 

0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4 1 5 1 6 1 7 1 8 1 9 2 0 2 1 2 2 2 3 2 4 2 5 2 6 2 7 2 8 2 9 3 0 3 1 3 2 3 3 3 4 3 5 3 6 3 7 3 8 3 9 4 0 

Cycle 

‡ Figure 1: Amplification plots showing positive identification of 

both subtype A and H5 genes. 



75 

ARTS | Applications


76 



Real-time RT-PCR diagnosis of the avian influenza virus, continued. 

A 

B 

C 

Sample preparation prior to 

RT-PCR 

ca. 2 hrs 

RT step 

30 min 

PCR 

ca 1 hr 30 min 

Gel preparation, Electrophoresis 

& EtBr Staining 

ca. 2 hrs 15 min 

PCR technique: Total time of 6 hours 15 minutes 

Sample preparation prior to RT step 

qPCR 


ca. 2 hrs 

30 min ca. 1 hr 30 min 

Real-time PCR with standard cycler: Total time of 4 hours 

Sample preparation prior to 


ca. 2 hrs 

RT step 

30 min 

qPCR 

ca. 1 hr 

Real-time PCR with fast rampling cycler: Total time of 3 hours 30 minutes 

‡ Figure 2: Expected time needed to obtain a result for avian influenza virus detection using PCR or real-time PCR 

Discussion 

The AIV A RT-PCR Kit and AIV H5 RT-PCR Kit show optimal 

performance when used on the Mastercycler ep realplex S from 

Eppendorf. The real-time PCR Kits to detect avian influenza virus 

were successfully implemented on the platform using a standard 

protocol according to manufacturers specifications without any 

optimization of parameters. 

With average Ct values of 24 obtained for the Influenza A and H5 

subtype, the combination of the Mastercycler ep realplex and the 

AIV RT-PCR Kits outperforms the expectations of 28 Ct stated 

in the operation manuals of the Kits.The fast ramping speed of 

the Mastercycler ep realplex real-time PCR platform was able to 

shorten the run time as compared to a standard real-time PCR 

instrument, which may need at least two hours to complete the 

same assay. 

Reduction of time was achieved without any need for special 

consumables or reagents. At the same time, having a 96 well block 

format enables a high number of samples to be processed at one 

time. Real-time PCR is a very fast and precise tool that can be 

used for rapid avian flu virus detection. Results are obtained in 

real time without having to do any post PCR analysis. Results are 

obtained without opening the reaction tubes, which eliminates the 

risk of carryover contamination. 


References 

[1] Widjaja L, SL Krauss, RJ Webby, X Tao and RG Webster. Matrix gene of influenza A viruses isolated 

from wild aquatic birds: ecology and emergence of influenza A viruses. J.Virol. 78: 8771-8779. 

[2] Kaye D and CR Pringle. Avian influenza viruses and their implication for human health. CID 40: 

108-112. 

[3] Kamps BS, C Hoffmann and W Preiser. Influenza Report 2006.

Improved reproducibility with twin.tec real-time PCR plates 

Improved reproducibility and sensitivity in real-time PCR with Eppendorf ® twin.tec 

real-time PCR plates* 

Beate Riekens, eppendorf AG, Hamburg, Germany 

Abstract 

In this Application Note, the influence of various consumables 

on the results of real-time PCR is described. In comparison to 

transparent micro test tubes, the white wells of the Eppendorf 

twin.tec real-time PCR plates* result in an improved amplification of 

the fluorescence signal and a reduced influence of the thermoblock 

on the reflection of the signal. These effects in turn lead to 

increased reproducibility and improved sensitivity in real-time 

PCR experiments. 

Introduction 

In PCR, consumables made from polypropylene are mainly used 

today, as this material is capable of forming especially thin-walled 

and well-proportioned micro test tubes that ensure a rapid and 

consistent temperature transfer from the thermoblock to the 

sample. In addition, the material is distinguished by low binding 

properties with respect to proteins and nucleic acids, so that the 

reaction components are completely available for efficient PCR. 

Since the introduction of real-time PCR, the requirements with 

respect to the components have become stricter. This is the case 

both for reagents and disposables. Transparent micro test tubes, 

which are used frequently, can only increase the fluorescence 

signal to a limited extent. In addition, due to the permeability 

of the material, the fluorescence signal can be reflected from 

the thermoblock of the real-time PCR device, and thus have 

an interfering influence on the fluorescence signal. 

Through the addition of titanium dioxide to the polypropylene, 

the fluorescence signal is considerably increased by the reflection 

against the walls of white wells. In addition, the fluorescence 

signal is enhanced more evenly, because the interfering reflection 

of the thermoblock is significantly reduced. This is proven by a 

considerable improvement of the reproducibility with respect to 

replicate samples, while the background noise of the baseline is 

also reduced. This makes it possible to measure an increase in the 

fluorescence much earlier, and can, depending upon the threshold 

value setting, result in lower C t values, amounting to improved 

sensitivity of the real-time PCR experiment. 



The following plates were evaluated within a comparative 

experiment: 

‡ Eppendorf twin.tec PCR plate* with clear wells 

‡ Eppendorf twin.tec PCR plate* with frosted wells 

‡ Eppendorf twin.tec real-time PCR plate* with white wells 

‡ Competitor plate A with white wells 

‡ Competitor plate B with white wells 

For the comparison of the various plates, all preparations were 

pipetted with the same automated pipetting station epMotion ® 

5070, and were processed with the same real-time PCR system 

Mastercycler ® ep realplex 4 S. The following PCR system was used 

in a SYBR Green application: 

PCR target: 108 bp, fragment from lambda DNA 

Forward primer (600 nM): cgcacaggaactgaagaatg, 

Reverse primer (300 nM): ccgtcgagaatactggcaat, 

Template: lambda DNA (Roche) 

A tenfold dilution series of the lambda DNA was manually created 

for a range of 100 – 1x10 7 copies for each reaction preparation. In 

order to exclude the influence of potential pipetting inaccuracies, 

all additional components were added to the various DNA 

concentrations. 

These mini-master mixes were pipetted into the respective wells of 

a plate in 6 replicates of 20 μl each with the help of the Eppendorf 

epMotion 5070. The plates were then heat-sealed with Eppendorf 

Heat Sealing Film in order to prevent evaporation. Following this, 

the plates were centrifuged for 1 min at 500 x g and real-time PCR 

was carried out with the following program: 

95°C 2 min 

95°C 10s 

60°C 30s 


40x 

*Eppendorf owns protective rights under European Patent EP 1 161 994, US Patent 7,347,977. 


77 

ARTS | Applications


78 



Improved reproducibility with twin.tec real-time PCR plates, continued. 

a) 

‡ Figure 1: Comparison of fluorescence signals and reproducibility of replicates 

a) A lambda serial dilution of 100 to 1x10 7 copies per reaction was amplified with SYBR Green in twin.tec PCR plate* with frosted wells (blue) 

and twin.tec real-time PCR plate* with white wells (red). b) The exponential phase of 6 replicates each (1000 – 1x10 6 copies) are displayed in 

enlarged amplification plots. 

Results and discussion 

In comparison to a plate with frosted wells (semi-transparent), 

the absolute fluorescence signals in the twin.tec real-time PCR 

plates* are strengthened more than tenfold due to the reflective 

properties of titanium dioxide (Fig. 1a). Equally good signal 

improvements could also be observed in comparison to clear 

wells (data not shown). In addition to the considerably stronger 

signals, the enlarged amplification plots (Fig. 1b) show that the 

replicates of the respective DNA concentrations are amplified 

much more homogeneously than in transparent wells. In these, 

the fluorescence is reflected not only onto the walls of the wells, 

but also onto the thermoblock. In addition, in the event that the 

reaction vessel is not evenly and completely in contact with the 

thermoblock, the fluorescence signal will be additionally dispersed 

due to the refraction index of air. 


b) 

This influence is prevented by the white wells of the twin.tec 

real-time PCR plates*. 

For purposes of most effective comparability with various 

consumables, the standard deviations for each 6 replicates were 

averaged over several log steps and compared (Fig. 2). 

standard deviation (mean over 4 logs) 

0,1 

0,08 

0,06 

0,04 

0,02 

0 

‡ Figure 2: Mean standard deviation over a range of 4 logs 

The standard deviation of 6 replicates each was calculated at 1000 

to 1x10 6 copies per reaction at a time. The values were averaged 

afterwards. 

Plate 1 Plate 2 Plate 3 

twin.tec PCR Plate, clear wells* 

twin.tec PCR Plate, frosted wells* 

twin.tec real-time PCR Plate, white wells* 

Supplier A, white wells 

Supplier B, white wells 

Compared plates 

Plate 4 Plate 5


Improved reproducibility with twin.tec real-time PCR plates, continued. 

ct shift compared to clear wells 

–1,0 

–0,8 

–0,6 

–0,4 

–0,2 

0 

twin.tec PCR plate, frosted wells* 

twin.tec real-time PCR plate, white wells* 

1,00E+07 

1,00E+06 1,00E+05 1,00E+04 

‡ Figure 3: C t shift improvement 

C t values which were obtained in twin.tec PCR plates* with clear 

wells were set as equal to 1 for all examined DNA concentrations. 

The Ct shift improvement of all other plates was compared to the 

twin.tec PCR plates* with clear wells. 

copies / reaction 

Supplier A, white wells 

Supplier B, white wells 

1,00E+03 1,00E+02 

While the transparent wells have a mean standard deviation of 0.09 

and 0.1, the reproducibility of the replicates can be improved with 

the twin.tec real-time PCR plates* to a standard deviation of less 

than 0.04. White plates of other manufacturers also reduced the 

standard deviation, down to 0.05. The consistent enhancement of 

the fluorescence signal by the white polypropylene also improves 

the signal-to-noise ratio of the measurement, thus supporting 

the earlier differentiation of baseline and point of increasing 

fluorescence. The determination of Ct values generally takes place 

in the exponential increase of the amplification curve. The threshold 

value for the determination of Ct values is thus very often set to 


the default of ten-fold standard deviation of the baseline. This 

evaluation therefore requires a qualitatively good baseline with a low 

noise level. The comparison shown in figure 3 was carried out with 

the help of this threshold value setting. It was thereby shown that the 

plate with clear wells generated the highest C t values. These were 

set as equal to 1 for all examined DNA concentrations and viewed 

in relation to the C t shift of all other tested plates. 

It thereby became clear that frosted wells also offer a minor 

improvement of the C t values in comparison to completely clear 

wells. In contrast, white wells improve the C t values for all DNA 

concentrations by up to 0.92. This increases the sensitivity of the 

assay by a factor of nearly 2, assuming an amplification efficiency 

of 100%. The white plates of other manufacturers also show an 

improvement of the Ct values in comparison to clear wells. However, 

the Ct shift of alternative white well plates lies at a maximum of 0.77 

and 0.54, respectively. 

Conclusion 

The use of Eppendorf twin.tec real-time PCR plates* can increase 

the sensitivity and the reproducibility of real-time PCR experiments. 

This offers the greatest advantage for real-time PCR systems with 

low fluorescence or with small reaction volumes, which can lead to 

a reduction of the signal. As a result of the improvements shown 

here, the use of white wells can be of advantage in the analysis of 

samples, especially those with low nucleic acid concentrations. 

*Eppendorf owns protective rights under European Patent EP 1 161 994, US Patent 7,347,977. 



79 

ARTS | Applications


80 


Optimizing qPCR with small reaction volumes 

Successful qPCR with small reaction volumes on Eppendorf Mastercycler ® ep realplex 

Cynthia Potter, Eppendorf UK Limited; Arun Kumar, Ph.D., Eppendorf North America 

Abstract 

Recent technological developments in the field of qPCR enable 

short run times and improved reproducibility. The objective of this 

study was to assess the reproducibility of qPCR data with 5 µl 

reaction volumes on Eppendorf Mastercycler ep realplex. 

Introduction 

Methodologies in genomics are expensive, and there is a critical 

need to lower costs by minimizing reagent use. One of the major 

cost components of the qPCR technique is reagent cost, including 

a mastermix that contains dNTPs, PCR enzymes (Taq), Mg 2+ and 

stabilizers. A second costly component is the template: the DNA 

or RNA is often in short supply and/or expensive as well as timeconsuming 

to extract and purify; a 25 μl reaction volume would be 

prohibitive in this case. Another challenge of qPCR is to minimize 

the assay variability. Bustin [1] has demonstrated significant 

user pipetting variability, providing reasons for the use of automated 

liquid handling stations in achieving greater assay reproducibility. 

The solution to keeping reagent costs down is to lower reaction 

volume while maintaining the same ratios of reaction components. 

However, many problems can arise in low-volume reactions, 

which can then lead to PCR efficiency plummeting to unacceptable 

levels for quantification. Perhaps the most significant problem with 

small reaction volumes is evaporation off the walls of the wells— 

the reagents are pulled out of the reaction, leaving variable 

concentrations of all reactants. To control volume variation 

due to pipetting error, ROX normalization is sometimes used. 

However, concentration of key reactants—rather than volume— 

remains a challenge in terms of reproducibility, because variability 

of evaporation in low-volume reactions cannot be controlled and 

evaporation levels are not reproducible. Controls such as ROX 

cannot normalize for this. Additionally, on instruments that perform 

qPCR in 1.5 to 2 hours, this evaporation cannot be completely 

eliminated. The amount of heat being applied is too great for 

excessive periods of time; therefore, it is imperative that run 

times are short when using low-volume reactions. 


Eppendorf offers the Mastercycler ep realplex line of quantitative 

real-time PCR instruments to the research community. In this 

article, data is presented that demonstrate robust quantitative PCR 

of three mouse genes and Lambda DNA, using SYBR ® Green I and 

TaqMan ® , in a total reaction volume of 5 μl. 

Eppendorf epMotion ® 5070, an automated pipetting system, has 

been used in academic and pharmaceutical research communities 

for small-volume assay setup to increase throughput and achieve 

significant cost reduction. The use of a liquid handling workstation 

also addresses the human error in reaction assembly, ensuring 

assay accuracy and reproducibility. 

This article will show that by combining assay setup with an 

automated pipetting system and a sensitive and fast real-time PCR 

instrument, qPCR reactions in the 5 μl range are easily achieved. In 

addition, the PCR efficiencies and correlation coefficients are nearly 

identical to reactions performed at higher volumes.


Successful qPCR with small reaction volumes on Eppendorf Mastercycler ® ep realplex, continued. 

Methods 

Quantitative real-time PCR experiments 

All experiments were run on an Eppendorf Mastercycler ep 

realplex 4 S with a silver block. A mastermix containing 5 PRIME 

RealMasterMix*, SYBR ® Green I assays and primers was prepared 

(to amplify and detect Beta actin) as well as two proprietary target 

genes for mouse and a 104 bp sequence of Lambda DNA. A 

mastermix containing 5 PRIME RealMasterMix Probe ROX , primers 

and CAL Fluor ® Gold 540/Black Hole Quencher-1 probe 

(Biosearch Technologies) was prepared for Lambda. All reactions 

were set up on the Eppendorf epMotion ® 5070 and dispensed into 

Eppendorf ® twin.tec 96-well skirted PCR plates. The plates were 

then sealed with Eppendorf Heat Sealing Film, using an Eppendorf 

Heat Sealer. For comparison, parallel reactions were assembled 

with 20 μl reaction volumes. 

Assay setup — SYBR Green I assays 

Each qPCR reaction was run in triplicate. A three-fold dilution series 

was prepared down to ~142.5 copies of the human genes studied. 

A two-step protocol (denature/cycling) was followed that consisted of 

initial denaturation of 2 min, followed by 2 s secondary denaturing 

at 95 ºC and annealing/extension at ~60 ºC (depending on gradient 

optimization for each amplicon), cycled 40 times. 

*U.S. Pat. 6,667,165 

1000 


100 

10 


1 

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 

Cycle 

Threshold: 393 (Adjusted manually) 


40 

Ct[Cycle] 

35 

30 

25 

20 

15 

Slope: -3.552 

Y-Intercept: 37.89 

Efficiency: 0.91 

R^2: 0.998 

10 1000 1.0E+05 1.0E+07 

Amount[Copies] 

‡ Fig. 1: TaqMan ® assay with CAL FLUOR Gold 540 

Top: Reproducibility with 5 μl total reaction volume per well. 

Amplification plot (log view) of 104 bp amplicon for Lambda DNA 

target. A 10-fold dilution series of Lambda DNA (Promega ® ) was 

prepared as above and amplified with 5 PRIME RealMasterMix 

Probe. Forward and reverse primers were used at 400 nM each, 

while CFG540/BHQ-1 was used at 400 nM, 50 cycles, 43 min. 



Bottom: Standard curve generated with data from 

above TaqMan assay 

Results: Slope=–3.552, Y-Intercept=37.89, Efficiency=0.91, 

R2 =0.998 



81 

ARTS | Applications


82 


10000 


1000 

100 

10 

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 

Cycle 



35 

Ct[Cycle] 

30 

25 

20 

15 

10 

5.0 

Slope: -3.591 



R^2: 1.000 



10 1000 1.0E+05 


1.0E+07 

‡ Fig. 2: SYBR ® Green I assay 


Amplification plot (log view) of 104 bp amplicon for Lambda DNA 

target. A 10-fold dilution series of Lambda DNA (Promega ® ) was 

prepared as above and amplified with 5 PRIME RealMasterMix with 

SYBR Green I. Forward and reverse primers were used at 400 nM 

each, 50 cycles, 43 min. 

Threshold: 2,334 (Noiseband) 



above SYBR Green assay 


R 2 =1.000 

TaqMan ® assay with CAL Fluor ® Gold 540 

The following amplifications were performed from a 10-fold 

dilution series prepared from Lambda DNA (Promega) at a range 

from 1.42 x 10 7 copies down to 142.5 copies. A two-step protocol 

(denature/extension) was followed that consisted of initial denaturation 

of 2 min, followed by 2 s secondary denaturing at 95 °C and 

annealing/extension at 60 °C. 

1000 


100 

10 

1 

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 

Cycle 


Baseline settings: automatic, Drift correction ON 

Ct[Cycle] 

34 

32 

30 

28 

26 

24 

22 

20 

Slope: -3.309 



R^2: 0.994 

10 1000 


‡ Fig. 3: SYBR Green I assay 


Amplification plot of 69 bp G4 (proprietary) target in triplicate. A 

three-fold dilution series of mouse genomic DNA (Promega) was 

prepared and amplified with 5 PRIME RealMasterMix with SYBR 

Green I. Forward and reverse primers were used at 300 nM each, 

45 cycles, 41 min. 






R 2 =0.994 


Results 

The TaqMan assay was linear over 6 orders of magnitude in a 5 μl 

reaction setup. In the SYBR Green I assay, there was amplification in 

the “no template” controls representing primer-dimer (melting curve 

not shown). SYBR Green I cannot reliably quantify at the singlecopy 

level due to the inherent background of this assay; however, 

7 logs of quantification were achieved—down to ~14 copies.

10000 


1000 

100 

10 

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 

Cycle 



34 

Ct[Cycle] 

32 

30 

28 

26 

24 

22 

20 

Slope: -3.207 



R^2: 0.996 



10 1000 


‡ Fig. 4: SYBR ® Green I assay 


Amplification plot of 71 bp G1 (proprietary) target in triplicate. A 

three-fold dilution series of mouse genomic DNA (Promega ® ) was 

prepared and amplified with 5 PRIME RealMasterMix with SYBR 

Green I. Forward and reverse primers were used at 300 nM each, 

45 cycles, 41 min. 

Threshold: 1,568 (adjusted manually) 





R2 =0.996 


Conclusions 

Highly reproducible results were obtained with a small (5 μl) 

reaction volume (Figs. 1–4); and nearly identical PCR efficiencies 

and correlation coefficients were obtained with 5 μl reaction 

volumes as compared with 20 μl reaction volumes (not shown). 

Working with low volumes presents challenges due to evaporation, 

but these challenges are overcome by using a fast (silver) block, 

which can easily run 40 cycles in 25 minutes. These initial runs 

were ~40 min for 45–50 cycles. 

Mastercycler ep realplex achieves uniform heating across the block 

through its Triple Circuit Technology, which features six Peltier 

elements to ensure this precise temperature control. In addition, 

the 96-LED array excitation source is positioned above the block 

so that each well is maximally and uniformly excited. Other cyclers 

that utilize bulbs as a light source above the plate and in the middle 

exhibit edge effects with 25 μl reactions; these edge effects may be 

exacerbated when dropping to small volumes, which, consequently, 

may not achieve the same level of uniformity required for success 

when using low-volume reactions. To ensure that all photons are 

captured, realplex’s 96 fiber-optic cables effectively capture the 

emission from each well and pass it into channel photo-multiplier 

tubes. To date, these are the most sensitive detectors available. 

We believe the combination of optical sensitivity, excitation and 

emission—plus the uniformity of heating—are responsible for the 

reproducible qPCR reactions at low volumes on the Mastercycler 

ep realplex. In addition, short run times also resolve the issue of 

sample evaporation from the wells. 

The ease of use for reaction setup with the epMotion ® 5070 

workstation and the advanced features of Mastercycler ep 

realplex enable reaction volumes to be scaled down to 5 μl. This 

is an 80% reduction in volume—when compared with the typical 

25 μl reaction volume—and represents substantial reagent 

cost-savings. 

There is a clear advantage to saving reagent cost when working 

in high-throughput gene expression analysis. Saving time is also 

advantageous, and the speed of the realplex silver block allows the 

completion of a 40-cycle qPCR reaction in as little as 23 minutes. 

The combination of the epMotion 5070 and Mastercycler ep 

realplex provides these time- and cost-savings. 

Reference 

[1] Bustin SA. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and 

problems. J. Endocrinology. 2002;29:23-39. 

*U.S. Pat. 6,667,165. 



83 

ARTS | Applications


84 


Additional application notes on the Web 

Visit www.eppendorfna.com/arts regularly to view and download additional 

Automation and Real-time PCR application notes. Below is a sampling of what 

you can find on our automated pipetting systems. The site is continually updated 

as new applications are added, so be sure to check back frequently! 

epMotion ® 5070 

High-throughput, fully automated real-time PCR diagnostics of HBV 

and salmonella 

PCR product purification using the Eppendorf epMotion 5070 liquid 

handling workstation together with the 5 PRIME Perfectprep ® PCR 

Cleanup 96 kit 

Minimization of remaining volumes in plates and tubes 

Facilitating PCR setup via an automated liquid handling system 

Loading the Invitrogen ® E-Gels with the epMotion 5070 

epMotion 5075 


Automated isolation of plant genomic DNA using ChargeSwitch 

technology 

Reproducible and easy automated purification of plant 

genomic DNA 

Isolation of high-quality plasmid DNA using the Perfectprep Plasmid 

96 VAC Direct Bind kit on the epMotion 5075 VAC workstation 

Isolation of high-quality BAC DNA using the Perfectprep BAC 96 kit 

on the epMotion 5075 VAC workstation 

Purification of PCR products using the Perfectprep PCR Cleanup 

96 kit on the epMotion 5075 VAC workstation 

Guideline for processing the RNeasy ® 96 BioRobot ® 8000 kit on the 

epMotion 5075 VAC workstation 

Guidelines for processing the QIAamp ® DNA Blood BioRobot MDx 

kit on the epMotion 5075 VAC workstation 

High-throughput RNA preparation using the QIAGEN ® RNeasy 96 

BioRobot 8000 kit on the workstation epMotion 5075

Picture: Model of a Taq DNA polymerase with a DNA strand. Image made with Molsoft ® -ICM. www.molsoft.com 

Appendix 

ARTS 

85

TOC | Appendix 

86 

Info 

Appendix Table of Contents 

Eppendorf ARTS is dedicated to helping you perform successful 

real-time PCR experiments. This section covers qPCR basics and 

the various detection chemistries used, and we include a list of 

relevant websites where you can get more information about 

qPCR and/or designing optimized qPCR primers. 

Description Page 

Definitions, concepts and overview of real-time quantitative PCR principles 87 

Background information 87 

Advantages of qPCR over traditional endpoint PCR 88 

Detection chemistries 88 

Double-stranded DNA-binding dyes 88 

Probe-base chemistries 89 

Methods of real-time PCR quantification 90 

Absolute quantification (standard curve method) 90 

Relative quantification (comparative C t method) 90 

Methods of primer and probe validation 91 

Optimization of forward and reverse primer concentrations 91 

Primer and probe validation: general strategy for new qPCR assay development 91 

References, resources and useful websites 92 

Calculating primer quantity 93 

PCR calculator 94 

Abbreviations, symbols and conversion factors 96 

Genetic code and amino acid properties 98 


Definitions, concepts and overview of real-time quantitative PCR principles 

What is real-time quantitative PCR? 

Real-time quantitative PCR, or “qPCR,” is a technique that reaches 

far beyond the limitations of standard PCR. It provides a unique, 

multidimensional perspective of a gene’s presence, its function— 

even its regulation—in a concrete, quantifiable manner. 

What are its applications/uses? 

The applications of real-time PCR technology are a testament to 

its wide range of influence, and they include the analysis of gene 

expression and gene regulation, determinations of the effects of 

variations in genetic composition, and the identification and 

quantification of microorganisms and viruses, among others. 

PCR can be used to estimate the amount of a particular target 

DNA or RNA in a sample relative to either a standard or another 

sample that has been subjected to some treatment or time 

progression—but it has very limited value as a quantitative 

tool. Real-time PCR expands the utility of PCR for quantitation 

through the incorporation of a fluorescent reporter molecule—or 

molecules—to each assay. Fluorescent intensity, which increases 

proportionally with each DNA molecule amplified, is measured 

during each cycle of PCR and plotted over time. As there is a direct 

correlation between the amount of PCR product in each cycle and 

the progression of a fluorescence amplification curve, an analysis 

of this curve enables calculation of the original starting quantity of 

target DNA or RNA. 

Background information 

Quantitative PCR is the most rapid and sensitive quantitative 

method for target RNA or DNA, combining the extraordinary 

sensitivity of the PCR process with highly sensitive optical 

detection technology. The fluorescence generated by a sample 

of DNA or RNA during real-time PCR is plotted over time or, 

rather, PCR cycle number. The middle of its curve represents 

the exponential phase of PCR—when the levels of generated 

fluorescence exceed background fluorescence, but reagents 

have not nearly begun to reach limiting factors. 

Each sample or reaction is assigned a specific value in real-time 

PCR, referred to as cycle threshold (C t)—the point or cycle number 

at which the fluorescence curve for that sample exceeds back- 

ground fluorescence and measurements become meaningful. 

Samples with the highest starting target amount will also have the 

highest values of amplified target in a given PCR cycle number. 

This means their fluorescence curves will exceed background 

earlier and cross the threshold at an earlier cycle number; thus, the 

more abundant the starting quantity of template or target, the lower 

the C t value of that sample. 

There are certain assumptions that are made about the sample 

C t value and initial target amount: early on in a PCR reaction and 

into the exponential phase, there is a doubling of fluorescence 

from one cycle to the next that is directly proportional to the 

doubling of amplicons; therefore, when a sample provides 

known values—a C t value (cycle number to reach threshold) and 

a fluorescence value—starting sample quantity can be calculated 

from the knowledge that at each earlier cycle number, exactly half 

the quantity of target was present. 

Due to the exponential nature of PCR amplification, we can 

extrapolate that in the event there are 80 copies of a gene present 

during cycle number 4: cycle number 3 had 40 copies, cycle 

number 2 had 20 copies and cycle number 1 had 10; and at 

time-point zero, we began with just 5 copies in the sample— 

an exceptionally sensitive measurement of a gene’s quantity. 

The plateau stage of any real-time PCR curve represents the 

endpoint of that reaction—the point at which there is significant 

depletion of one or more reaction components. At the plateau 

stage the amplification curves of real-time PCR are no longer 

exponential, which means that the association of a two-fold 

increase in quantity from one cycle number to the next has come 

to an end. For this reason, real-time PCR is not concerned with 

plateau endpoints (Fig. 1). 

‡ Fig. 1: PCR—kinetic vs. endpoint detection 


Info 

A plot of the quantity of amplicon DNA over time; in real-time PCR 

we are only concerned with amplification during the exponential 

phase of amplification, as accurate quantification of DNA is not 

possible at the plateau. 


87 

Appendix | Real-time qPCR

Real-time qPCR | Appendix 

88 

Info 

Definitions, concepts and overview of real-time quantitative PCR principles 

Advantages of qPCR over traditional endpoint PCR 

In addition to the capacity for highly sensitive detection, real- 

time PCR can provide quantitative data across a wide dynamic 

range—on Mastercycler ® ep realplex, detection from single 

molecules to up to 10 9 molecules of the same target sequence is 

possible in a single experiment. Furthermore, there is no additional 

handling required for these samples—and no time or money is 

wasted on gel analysis with an end result that is semiquantitative, 

at best. Adding to its convenience and speed, amplification and 

detection occur simultaneously, making qPCR technology a highly 

efficient alternative. 

Detection chemistries 

Real-time PCR detection can be performed with one of many 

available fluorescent reporters, including sequence-specific, 

dual-labeled probes such as TaqMan ® , molecular beacons, 

hybridization or locked nucleic acid (LNA) probes. Alternatively, 

free dyes that bind to double-stranded DNA (dsDNA), such as 

SYBR ® Green I, can also be used. 

Double-stranded DNA-binding dyes 

DNA-binding dyes like SYBR Green I are a relatively convenient 

and inexpensive option for real-time PCR chemistries, as they 

are simply added to a PCR reaction mix—no sequence-specific, 

synthetic oligonucleotides other than primers need to be prepared. 

Free in solution, DNA-binding dyes exhibit low levels of background 

fluorescence until they find their primary match; when they bind 

to the minor groove of their double-stranded DNA target, these 

dyes increase 10- to 20-fold in fluorescence. Real-time PCR 

takes advantage of this dye property, detecting double the dye 

fluorescence with each successive cycle in the exponential 

phase of amplification. 

These double-stranded DNA-binding dyes are not discriminatory 

fluorophores, which means they will bind to any nonspecific 

product that is present in the reaction. For this reason, a useful tool 

called a “melting curve” is added following the last PCR program 

step of a SYBR assay. The melting curve command directs the 

thermal block of the real-time device to slowly and gradually ramp 

temperature upward to 95 ºC, taking fluorescent measurements 

across time and temperature. Because DNA hybrids melt, or 

“denature,” at varying temperatures based on both varying 

sequence and length of product—and because a release in SYBR 

Green fluorescence corresponds to the exact point/temperature 

at which a distinct hybrid population’s strands separate, or “melt”— 

a real-time melting curve shows distinct drops in fluorescence at 

each amplicon population’s melting temperatures (Fig. 2). In the 

event that a single, nonspecific hybrid population such as a primerdimer 

forms during a reaction, two distinct drops in fluorescence 


Unlike the “endpoint measurement” of PCR products, real-time 

PCR also provides immediate information about the kinetics of the 

PCR while the fluorescence is plotted out, one cycle to the next, 

in “real-time.” 

Good experimental design can further enable researchers to 

acquire a wealth of additional information—down to a detailed 

assessment of amplification efficiencies—from one sample to the 

next. Clearly, adding fluorescence and a highly sensitive optical 

detection device to PCR opens a world of new possibilities. 

at different temperature points of a melting curve analysis can 

easily confirm this event. A single, distinct drop in fluorescence at 

a single temperature, on the other hand, indicates a homogenous 

population of highly specific amplified products. 

The DNA-binding dye’s ability to bind with any double-stranded 

DNA may be interpreted as a disadvantage of lower specificity; 

but alternatively, this presents an advantage—you can distinguish 

between two hybrid populations with small mutational differences 

through the companion tool of melting curves. 

This lack of discrimination by DNA-binding dyes is actually a true 

advantage in laboratories that wish to look at many different gene 

sequences on a routine basis—no oligo design beyond that of the 

primer is required, and the cost is much less; only primer annealing 

needs to be optimized, making it not only a cost-effective chemistry 

for real-time PCR, but also a flexible and highly convenient one. 

‡ Fig. 2: Melting curve analysis 

Raw data shows a dramatic drop in fluorescence when DNA is 

melted (denatured); the fact that the drop is seen in several samples 

at the same time indicates the presence of a single product, i.e., a 

highly specific reaction.

Detection chemistries 

Probe-based chemistries 

Hydrolysis probes, commonly called TaqMan ® probes, are 

so-named because they enlist the 5'-endonuclease activity of 

Taq polymerase to cleave a reporter dye from their 5'-probe- 

terminus. This is significant due to the design of a TaqMan probe, 

which not only contains a fluorescent dye terminus but also a 

quencher dye at its 3' end. When free in solution or bound to a 

complementary sequence of template, each probe molecule’s 

quencher disables the nearby reporter dye’s ability to emit 

detectable fluorescence. This interaction is termed fluorescence 

resonance energy transfer, or “FRET,” because reporter 

fluorescence is absorbed by a quencher. 

TaqMan probes hybridize in the region between the primers so 

that Taq polymerase can activate the reporter during the elongation 

step of a PCR. As it extends one complement strand, Taq 5'-3'- 

exonuclease activity releases exactly one reporter dye molecule 

that freely emits fluorescence without FRET absorption. Thus, the 

correlation between one detected reporter molecule and one new 

PCR product is made. 

Pros 

‡ High specificity 

‡ Duplexing and multiplexing 

are possible—different reporter 

dyes can be selected for 

different target sequences, 

thus enabling multiple probes 

to seek and amplify multiple 

targets in a single tube 

Cons 

‡ Require optimization of 

probe sequence 

‡ Short amplicons, 

less sensitive to sample 

degradation—e.g., formalin 


Info 

fixed and embedded material 

‡ Added cost of probe in 

addition to primers 

Double-stranded DNA-binding dyes, such as SYBR Green, are 

an often-used format for optimizing TaqMan assays, as they allow 

primers to be optimized before the addition of a probe. 

Dye Excitation maximum (nm) Emission maximum (nm) 

FAM 494 518 

TET 521 538 

JOE 520 548 

VIC 538 552 

Yakima Yellow 526 552 

HEX 535 553 

NED 546 575 

Cy ® 3 552 570 

TAMRA 560 582 

ROX 587 607 

‡ Table 1: Table of dyes frequently used with Mastercycler ® ep realplex systems, and their approximate excitation and emission 

curve peaks 

This added specificity comes at a cost—to both the price of probe 

synthesis and the time required for the design and optimization 

of a specific probe sequence. These chemistries are, therefore, 

preferred when a large number of assays are required for a 

single, specific target. The advantages and disadvantages are 

summarized below. 


89 



90 

Info 

Methods of real-time PCR quantification 

Two primary methods of quantification are routinely used with qPCR technology: absolute and relative quantification. 

Absolute quantification 

Absolute quantification is an analysis method to accurately quantify 

the exact amount of initial target template in a sample. It does this 

through the inclusion of a standard curve. By offering correlations 

between known starting quantities and C t values, an unknown 

sample’s C t value may be correlated to an associated initial 

template quantity (Fig. 3). 

This method is measured in units of gene copy number (or pico- 

grams or nanograms of DNA) as compared to relative quantification 

and its ratio value of one target amount compared to another. 

Absolute quantification assumes that all standards and samples 

have equal amplification efficiencies. As a result, this approach can 

pose two key challenges: (1) You must ensure that the amplification 

efficiencies of the knowns and unknowns are nearly equivalent, and 

(2) the concentration of the serial dilutions should be within 

the range of the unknown(s). 

The optimization of appropriate controls for reliable absolute 

quantification is no small task, and in the event RNA is the 

initial template it must take into account efficiencies of reverse 

transcription as well. 

‡ Fig. 3: Absolute quantification 

A set of known standards is run in a qPCR reaction, and the C ts are 

plotted against the known quantities of starting materials; once the 

unknown’s C t value is obtained and compared, this graph can then 

be used to determine its starting quantity. 

Relative quantification 


Relative quantification compares the C t value of one target gene 

to another—for example, an internal control or reference gene 

(sometimes called a “housekeeping gene”)—in a single sample. 

When RNA is the template, this provides some normalization 

effects against variables such as RNA integrity and reverse 

transcription efficiencies. 

In addition to establishing the comparison of a gene of interest 

(GOI) to an internal control or reference for that single sample, the 

relative quantification method also compares a GOI to the control/ 

reference gene for some other control sample, called a “calibrator” 

(∆∆C t method). The resulting unit of measure is an X-fold change 

in gene expression levels; and due to the inherent normalization 

of the ∆∆C t method, variations in PCR efficiency are somewhat 

accounted for between samples, which makes it a reliable tool 

for gene expression analysis (Fig. 4). 

‡ Fig. 4: Relative quantification 

This method compares the differences in expression between a 

GOI and a housekeeping gene of a calibrator control; the ∆∆C t 

value shown represents an X-fold change in gene expression.

Methods of primer and probe validation 

It is essential to validate both the primers and probe. For TaqMan ® 

probe-based systems, the general rule states that amplicons of 

< 150 base pairs (ideally < 100) with a primer melting temperature 

(Tm) of ~60 °C and a probe Tm between 68 °C and 70 °C should be 

universally acceptable. The idea is to have the probe anneal first and 

saturate all targets before the primers bind and start to extend—this 

ensures that all nascent DNA will be quantified. 

Probes should not contain multiple repeats, and they should avoid 

high “G” nucleotide content. Guanine should likewise be excluded 

from the 5'-probe terminus, as it has been shown that guanosine 

quenches an adjacent fluorophore. Finally, the 3' end of forward 

primer should be, optimally, 5 bases from the 5' end of the probe 

(within 10 bases is acceptable). Several quencher dyes exist to pair 

with reporter dyes. 

Primer optimization may be done with conventional PCR for those 

new to real-time PCR, and results may be analyzed on an agarose 

gel or non-denaturing polyacrylamide gel (polyacrylamide is more 

sensitive in picking up primer-dimers). The criteria for good primer 

performance are as follows: 

1. No primer-dimers in the negative controls. 

2. Little or no mispriming that would result in mismatched 

amplicons—the Impulse PCR function of Mastercycler ® ep 

realplex’s silver block is a useful feature that avoids these effects 

(more on Impulse PCR in the PCR product highlights section of 

this catalog, page 36). 

Optimization of forward and reverse primer concentrations 

It is difficult to design a primer pair with identical melting 

temperatures, even though theoretical values may match. 

Adjustments to either the annealing temperature or Mg2+ concentration will have a limited affect on improving the 

performance of Tm-disassociated primers. If primer pairs fail to 

meet the criteria for good performance, a primer matrix across 

a span of concentrations may be tested (see “High-speed, realtime 

PCR assay design for realplex silver block models” in the 

PCR product highlights section of this catalog, page 38). 


Info 

Primer and probe validation: general strategy for new 

qPCR assay development 

Every assay needs to be reoptimized when subject to any new 

condition or variable. Recommended optimization includes the 

quantification of standard curve series with high-qualified primers 

so that PCR efficiency and sensitivity may be easily measured. 

SYBR Green ® I is a flexible and inexpensive option for the 

determination of primer quality across a range of tested annealing 

temperatures. Mastercycler ep realplex’s gradient option* eases this 

optimization effort (see “Gradient function: a highly useful tool for 

optimizing real-time PCR” in the PCR product highlights section of 

this catalog, page 34). 

The issue of specificity is answered by the implementation of a 

SYBR melting curve analysis, which provides an additional, valuable 

perspective in the primer and basic assay optimization effort (Fig. 5). 

*U.S. Pat. 6,767,512 

90 

80 

70 

60 

50 

40 

30 

- dI / dT (%) 100 

20 

10 

0 

-10 

6263 

64 6566 

6768 

6970 

7172 

7374 

7576 

7778 

7980 

8182 

8384 

8586 

8788 

8990 

9192 

9394 

95 

Temperature [°C] 

Threshold: ‡ Fig. 33% 5: Melting curve analysis 

Note that in this negative (inverted) first derivative the inflection 

point consists of a single peak, indicating a highly specific 

PCR reaction. 


91 



92 

Info 

References 

1. Hartling I, Weisner RJ. Quantitation of transcript-to-transcript 

ratios as a measure of gene expression using RT-PCR. 

BioTechniques. 1997;23:450-455. 

2. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. 

Continuous fluorescence monitoring of rapid cycle DNA 

amplification. BioTechniques. 1997;22:130-138. 

3. Rire KM, Rasmussen RP, Wittwer CT. Product differentiation 

by analysis of DNA melting curves during the polymerase chain 

reaction. Anal. Biochem. 1997;245:154-160. 

Resources and useful websites 

Oligonucleotide and assay design resources 

Gene Quantification Web page, edited by Michael W. Pfaffl, 

contains a host of information relating to qPCR: 

http://www.gene-quantification.info/ 

TATAA Biocenter: http://www.tataa.com 

GeNorm: http://medgen.ugent.be/~jvdesomp/genorm 

Primer 3 Homepage: 

http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi 

Primer quest Homepage: 

http://www.idtdna.com/Scitools/Applications/Primerquest/ 

Zucker Mfold: www.bioinfo.rpi.edu/~zukerm/ 

IDT Oligoanalyzer: 

http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ 

OLIGO Primer Analysis Software: http://www.oligo.net/ 

Premier Biosoft Beacon Designer: 

http://www.premierbiosoft.com/molecular_beacons/ 


4. Gibson UE, Heid CA, Williams PM. A novel method for real time 

quantitative RT-PCR. Genome Res. 1996;6:995-1001. 

5. Tichopad A, Dilger M, Schwartz G, Pfaffl MW. Standardized 

determination of real-time PCR efficiency from a single reaction 

set-up. Nucleic Acids Res. 2003;31:122. 

6. Marion JH, Cook P, Miller KS. Accurate and statistically verified 

quantification of relative mRNA abundances using SYBR Green I 

and real time RT-PCR. J. Immunol. Methods 2003;283:291-306. 

Real-time PCR primer and probe databases 

http://medgen.ugent.be/rtprimerdb/ 

The Primer Bank database, hosted by Harvard University, 

contains user-submitted primer sequences for several mouse 

and human genes: 

http://pga.mgh.harvard.edu/primerbank/index.html 

The Quantitative PCR Primer Database (QPD), maintained by the 

National Cancer Institute, contains primer and probe sequences for 

mouse and human genes collected from articles cited in PubMed: 

http://web.ncifcrf.gov/rtp/gel/primerdb 

Discussion groups 

qPCR list server: http://groups.yahoo.com/group/qpcrlistserver/

Calculating primer quantity 

Conversion to absolute quantity (in pmol) 

Primer in pmol = 

Example: 0.1 µg of 20 oligomer: 

0.1 x 1,000,000 

20 x 327 

Weight in µg x 1,000,000 

Length x 327 

= 15.3 pmol primer 

Calculating the molar concentration of the primer 

Micromolar concentration of primer = pmol/µl 

Example 1 Example 2 

20 pmol of primer in 100 µl PCR mixture = 0.20 micromolar (µM) Primer is 24 nucleotides in length and dissolved in 0.1 ml of water 

A 10 µl aliquot is diluted to 1.0 ml for A 260 measurement: A 260 = 0.76. 

The stock solution has an absorbance at 260 nm (A 260) of 76. 

The stock solution (0.1 ml) contains 2.6 A 260 units. 

The base composition of the primer is: 

A = 6 

C = 6 

G = 6 

T = 6 

The molar extinction coefficient at 260 nm for the primer = k (15,200) + l (12,010) + m (7,050) + n (8,400) where: 

k = number of A’s 

m = number of G’s 

l = number of C’s 

n = number of T’s 

The molar extinction of the PCR primer = 6 (15,200) + 6 (12,010) + 6 (7,050) + 6 (8,400) = 255,960 e 

The molar concentration of the PCR primer stock solution is: 

Conversion to weight (in µg) 

Weight in µg = 

Example: 10 pmol of 25 oligomer: 

10 x 25 x 327 

76 

255,960 

1,000,000 

= 297 micromolar 

pmol x Length x 327 

1,000,000 

= 0.081 µg primer 


Info 


93 

Appendix | Practical Information

Practical Information | Appendix 

94 

Info 

PCR calculator 

Optimizing your PCR reaction is critical in order to obtain good data. To better assist in this process we offer an online 

PCR calculator to help you set up various reactions including singleplex and multiplex reactions. To access this feature please 

visit www.eppendorfna.com/pcrcalculator. 

What is the PCR calculator? 

The composition of every PCR preparation has to be calculated 

according to the desired concentration of the individual 

components (with regard to the volume to be used and the 

prepared original solutions) as well as the number of samples. Even 

Application Calculation template 

if the individual components and the volume remain the same, the 

number of samples may change. The PCR calculator calculates the 

composition of the MasterMix for your PCR preparation. 

Conventional PCR with a ready-to-use PCR-Mix SYBR Assay or Conventional PCR 

Conventional PCR with a PCR-Mix, 

to which further components (up to 4) are added 

Conventional multiplex PCR (max. 3 targets) 

with a ready-to-use PCR-Mix 

SYBR Green real-time PCR with a ready-to-use PCR-Mix, 

which already includes SYBR Green 

SYBR Green real-time PCR with a ready-to-use PCR-Mix, 

SYBR Green is added separately 

SYBR Green real-time PCR with a PCR-Mix, to which further 

components (up to 4) are added 

Additional Components 


The primer couple 2 and 3 is recorded as 

“Additional Component” 

SYBR Assay or Conventional PCR 

SYBR Assay (SYBR not included) 


Singleplex, probe-based real-time PCR with a ready-to-use PCR Mix Probe Assay 

Singleplex, probe-based real-time PCR with a PCR-Mix, 

to which further components (up to 3) are added 

Multiplex, probe-based real-time PCR (max. 3 targets) 

with a ready-to-use PCR-Mix 

How does the PCR calculator work? 

Our PCR calculator facilitates the calculation of a PCR preparation. 

You can choose different calculation templates for your MasterMix ® 

depending on your application. You just need to enter the present 

values and the calculation of your preparation will be made 

automatically. In order to document the calculation you can print 

out the calculation sheet and add it to your documents. 

The calculation basis for the calculator is represented by the 

following formula: 

C 

C 

final 

initial 

X V = 

final Vinitial 

C final = Final concentration in the PCR reaction 

C initial = Concentration of the stock solution 

V final = Total volume of all PCR reactions 

V initial = Required volume for the MasterMix 


The probe is recorded as “Additional Component” 

Multiplex Assay 


The calculator calculates the MasterMix preparation including 

10% excess in order to have enough MasterMix available. The 

MasterMix is calculated for the total volume of the PCR preparation, 

the Template being added separately to each PCR reaction and 

not being considered within the MasterMix calculation. If you want 

to use a constant volume of Template for your PCR preparation 

and add it to the MasterMix, this can be calculated by using the 

calculation template “Additional Components”. The same applies to 

the separate addition of dNTPs, magnesium etc. 

In the pure MasterMix, the concentration of the individual 

components is higher than the subsequent PCR preparation, as 

the addition of the Template is a dilution. The PCR preparation 

should be construed so as to preferably mix the same parts by 

volume of Template and MasterMix. The effect of pipetting errors 

can therefore be maintained as small as possible. The smaller the 

volume of the Templates to be pipetted, the greater the effect of 

pipetting accuracies on the result. 

MasterMix PCR 

Reaction 

volume 

Template

PCR calculator 

Example: 

9 different samples as well as a negative control sample (9+1=10) 

shall be examined with a ready-to-use PCR-Mix in a singleplex, 

probe-based real-time PCR preparation. Each sample (the negative 

control sample, too) is prepared in triplicate (10*3=30). For the 

preparation of the MasterMix a 10% reserve is included (30+3=33). 

This results in a total number of 33 preparations. 

30 Reactions (rxn) of 20 µl + 10% Reserve = 33 rxn =660 µl V final 

10 µl MasterMix + 10 µl Template = 20 µl Reaction volume per reaction (rxn) 

33 Reactions (rxn) of 10 µl MasterMix = 330 µl MasterMix 

C initial C final V initial 

Each preparation consists of 50% MasterMix and 50% Template 

Info 

solution, which will be added to each reaction later. Consequently, 

the total volume per preparation is 20µl (10µl Template solution 

plus 10µl MasterMix). This results in a total volume of 660 µl for the 

entire reaction preparation and 330 µl for the MasterMix. 

Value must be entered Value must be entered Value is calculated 

F-primer 100 µM 0.9 µM 5.94 µl (0.9/100*660) 

R-primer 100 µM 0.9 µM 5.94 µl (0.9/100*660) 

Probe 50 µM 0.2 µM 2.64 µl (0.2/50*660) 

PCR-Mix 2.5x 1.0x 264.0 µl (1/2.5*660) 

Water – – 51.48 µl (330-264-5.94-5.94-2.64) 

Volume MasterMix 330.0 µl 

Example calculation: 

PCR reaction set-up calculator Probe qPCR Assay 

Component Conc. Initial (µM or x) Conc. Final (µM or x) Volume Initial (µl) 

F-Primer (µM) 100 0.9 5.94 

R-Primer (µM) 100 0.9 5.94 

Probe (µM) 50 0.2 2.64 

PCR-Mic (x fold conc.) 2.5 1 264 

Water 51.48 

Total Volume MasterMix (µl) 330 

Total Volume MasterMix per reaction (µl) 10 

Total Volume Template per reaction (µl) 10 

Total Volume per reaction (µl) 20 

Number of samples 10 

Number of replicates 3 

Number of total samples 30 

Recommended pipetting reserve (10%), e.g. 3 3 

Number of total samples + pipetting reserve 33 

Total reaction volume (µl) 660 



95 



96 

Info 

Abbreviations, symbols and conversion factors 

Metric prefixes 

E = exa = 10 18 

P = peta = 10 15 

T = tera = 10 12 

G = giga = 10 9 

M = mega = 10 6 

k = kilo = 10 3 

h = hecto = 10 2 

da = deca = 10 1 

d = deci = 10 -1 

c = centi = 10 -2 

m = milli = 10 -3 

µ = micro = 10 -6 

n = nano = 10 -9 

p = pico = 10 -12 

f = femto = 10 -15 

a = atto = 10 -18 

z = zepto = 10 -21 

Tris-HCl buffer, pH values 

Nucleic acid conversions 

Conversion of weight to absolute quantity (mol) 

1 µg of 1,000 bp DNA = 1.52 pmol = 9.1 x 10 11 molecules 

1 µg of pUC18/19 DNA (2,686 bp) = 0.57 pmol = 3.4 x 10 11 molecules 

1 µg of pBR322 DNA (4,361 bp) = 0.35 pmol = 2.1 x 10 11 molecules 

1 µg of M13mp18/19 DNA (7,250 bp) = 0.21 pmol = 1.3 x 10 11 molecules 

1 µg of l-DNA (48,502 bp) = 0.03 pmol = 1.8 x 10 10 molecules 

Conversion of absolute quantity (mol) to weight 

1 pmol of 1,000 bp DNA = 0.66 µg 

1 pmol of pUC18/19 DNA (2,686 bp) = 1.77 µg 

1 pmol of pBR322 DNA (4,361 bp) = 2.88 µg 

1 pmol of M13mp18/19 DNA (7,250 bp) = 4.78 µg 

1 pmol of l-DNA (48,502 bp) = 32.01 µg 

Common abbreviations 

ds double-stranded (as in dsDNA) 

ss single-stranded (as in ssDNA) 

bp base pair 

kb kilobase: 1,000 bases or base pairs, as appropriate 

nt nucleotides (base) 

Mb megabase: 1,000,000 bp 

Da Dalton, the unit of molecular mass; 

kDa = 1,000 Da, MDa = 1,000,000 Da 

MW molecular weight (g/mol) 

M Molar or molarity, moles of solute 

per liter of solution (mol/L) 

mol Mole, absolute amount of a substance 

(1 mol = 6.023 x 10 23 , Avogadro number) 

l wavelength 

l max 

wavelength at the absorption maximum 

5 ºC 7.76 7.89 7.97 8.07 8.18 8.26 8.37 8.48 8.58 8.68 8.78 8.88 8.98 9.09 9.18 9.28 

25 ºC 7.20 7.30 7.40 7.50 7.60 7.70 7.80 7.90 8.00 8.10 8.20 8.30 8.40 8.50 8.60 8.70 

37 ºC 6.91 7.02 7.12 7.22 7.30 7.40 7.52 7.62 7.71 7.80 7.91 8.01 8.10 8.22 8.31 8.42 


Abbreviations, symbols and conversion factors 

Molecular weight of DNA fragments 

500 bp dsDNA = 325,000 Da 

500 nt (nucleotide) ssDNA = 162,500 Da 

1 kb dsDNA = 660,000 Da 

1 kb ssDNA = 330,000 Da 

1 kb ssRNA = 340,000 Da 

1 MDa dsDNA = 1.52 kb 

Average molecular weight of dNMP = 325 Da 

Average molecular weight of 

DNA base pair 

Protein conversions 

Conversion of proteins to DNA length 

= 650 Da 

Molecular weights for nucleotides 

Compound Molecular weight (in Dalton) 

ATP 507.2 

CTP 483.2 

GTP 523.2 

UTP 484.2 

dATP 491.2 

dCTP 467.2 

dGTP 507.2 

dTTP 482.2 

AMP 347.2 

CMP 323.2 

GMP 363.2 

UMP 324.2 

dAMP 312.2 

dCMP 288.2 

dGMP 328.2 

dTMP 303.2 

Protein with a molecular weight of 10,000 = 270 bp DNA 

Protein with a molecular weight of 30,000 = 810 bp DNA 

Protein with a molecular weight of 37,000 (corresponds to 333 amino acids) = 1,000 bp DNA 

Protein with a molecular weight of 50,000 = 1.35 kb DNA 

Protein with a molecular weight of 100,000 = 2.7 kb DNA 

Conversion of absolute quantity (mol) to weight 

100 pmoles of 100,000 Da protein = 10 µg 



DNA content of various organisms 

Organism DNA content (in bp, haploid genome) 

Escherichia coli 4.2 x 10 6 

Arabidopsis thaliana 4.7 x 10 6 

Saccharomyces cerevisiae 1.4 x 10 7 

Drosophila melanogaster 1.4 x 10 8 

Homo sapiens 3.3 x 10 9 

Triticum aestivum (hexaploid wheat) 1.7 x 10 10 


Info 


97 



98 

Info 

Genetic code and amino acid properties 

Genetic code 

1 st Codon position 

2 nd Codon position 

U C A G 

U UUU Phe UCU Ser UAU Tyr UGU Cys U 

UUC UCC UAC UGC 

UUA Leu UCA UAA Stop UGA Stop 

UUG UCG UAG Stop UGG Trp 

C CUU Leu CCU Pro CAU His CGU Arg U 

CUC CCC CAC CGC 

CUA CCA CAA Gln CGA 

CUG CCG CAG CGG 

A AUU Ile ACU Thr AAU Asn AGU Ser U 

AUC ACC AAC AGC 

AUA ACA AAA Lys AGA Arg 

AUG Met, Start ACG AAG AGG 

G GUU Val GCU Ala GAU Asp GGU Gly U 

GUC GCC GAC GGC 

GUA GCA GAA Glu GGA 

GUG GCG GAG GGG 

Nomenclature and properties of amino acids 

C 

A 

G 

C 

A 

G 

C 

A 

G 

C 

A 

G 

3 rd Codon position 

Termination codons: 

UAA: ochre 

UAG: amber 

UGA: opal 

Amino acid 3-letter symbol 1-letter symbol Major properties of side chains 

Alanine Ala A Aliphatic 

Arginine Arg R Basic group 

Asparagine Asn N Amide group 

Aspartic acid Asp D Acidic group 

Cysteine Cys C Sulfur-containing 

Glutamic acid Glu E Acidic group 

Glutamine Gln Q Amide group 

Glycine Gly G No side chain 

Histidine His H Imidazole group 

Isoleucine Ile I Aliphatic 

Leucine Leu L Aliphatic 

Lysine Lys K Basic group 

Methionine Met M Sulfur-containing 

Phenylalanine Phe F Aromatic group 

Proline Pro P Aliphatic 

Serine Ser S Hydroxyl group 

Threonine Thr T Hydroxyl group 

Tryptophan Trp W Aromatic group 

Tyrosine Tyr Y Aromatic group 

Valine Val V Aliphatic 


In yeast mitochondria, the AUA 

and UGA codons are used 

for Met and Trp, not for Ile and 

Stop as normally. 

Start codon: 

AUG: Methionine

Your gateway to everything Eppendorf: 

Access many useful website features 

when you register with myEppendorf 

‡ Customer Care Center 

‡ Online product registration 

‡ ep-points customer 

rewards program 

‡ Eppendorf eShop 

For Application Support 

Email: 

arts@eppendorf.com 

Hotline: 

800-645-3050 ext. 2258 

Local Sales Support 

Use our Sales Rep Locator to get in touch 

with your local ARTS Specialist. 

Eppendorf Awards 

We promote science! Learn about the 

$25,000 Eppendorf & Science Prize at 

www.eppendorf.com/awards. 

Eppendorf ® and design, epMotion ® , Eppendorf Tubes ® , Mastercycler ® , and SteadySlope ® are registered trademarks of 

Eppendorf AG. epBlueis a trademark of Eppendorf AG. Eppendorf ARTS and design is a trademark of Eppendorf 

North America. Agilent ® is a registered trademark of Agilent Technologies, Inc. American Express ® is a registered trademark 

of The American Express Company. CAL Fluor ® is a registered trademark of Biosearch Technologies, Inc. Cy ® 3 is a registered 

trademark of Amersham Biosciences UK Limited. FAM and TAMRA are trademarks of Applied Biosystems. Invitrogen ® , 

LUX Primer, PureLink ® and Superscript ® are registered trademarks of Invitrogen Corporation. LabChip ® is a registered 

trademark of Caliper Life Sciences, Inc. LightCycler ® is a registered trademark of Roche Diagnostics GmbH. MasterCard ® 

is a registered trademark of MasterCard International Incorporated. Microsoft ® and Windows ® are registered trademarks of 

Microsoft Corporation. NucleoSpin ® is a registered trademark of Macherey, Nagel GmbH & Co. Promega ® and Promega 

Wizard ® are registered trademarks of Promega Corporation. QIAGEN ® , Biorobot ® , QiaAmp ® and Rneasy ® are registered trademarks 

of QIAGEN GmbH or its subsidies in the US and certain other countries. HotMaster ® , MasterMix ® and Perfectprep ® are 

registered trademarks of 5 PRIME GmbH. Roche ® is a registered trademark of Hoffmann-La Roche Inc. ROX is a trademark 

of Applera Corporation or its subsidies in the US and certain other countries. ABI PRISM ® is a registered trademark of Applera 

Corporation or its subsidies in the US and certain other countries. ABI BigDye is a trademark of Applera Corporation or its 

subsidies in the US and certain other countries. SmartCycler ® is a registered trademark of Cepheid Corporation. SuperMix ® 

is a registered trademark of Gentest Corporation. SYBR ® is a registered trademark of Molecular Probes, Inc. TaqMan ® is a 

registered trademark of Roche Molecular Systems, Inc. VISA ® is a registered trademark of IBANCO Ltd. 

www.eppendorf.com 

Online Support 

Visit our online Resource Center to view 

and download a wealth of information: 

‡ Applications 

‡ FAQs 

‡ Product manuals 

‡ Material safety data sheets 

‡ Product quality certificates 

‡ Product literature 

Service 

Learn about our calibration, preventive 

maintenance and repair services—all provided 

by manufacturer-direct technicians. 

Eppendorf Advantage 

View our latest product promotions. 

Mastercycler ep: Practice of the patented polymerase chain reaction (PCR) process requires a license. The Eppendorf ® 

Thermal Cycler is an Authorized Thermal Cycler and may be used with PCR licenses available from Applied Biosystems. Its use 

with Authorized Reagents also provides a limited PCR license in accordance with the label rights accompanying such reagents. 

Mastercycler ep realplex: Practice of the patented polymerase chain reaction (PCR) process requires a license. The 

Eppendorf ® Thermal Cycler is an Authorized Thermal Cycler and may be used with PCR licenses available from Applied 

Biosystems. Its use with Authorized Reagents also provides a limited PCR license in accordance with the label rights 

accompanying such reagents. This is a Licensed Real-Time Thermal Cycler under Applera’s United States Patent No. 

6,814,934 and corresponding claims in non-U.S. counterparts thereof, for use in research and for all other applied fields 

except human in vitro diagnostics. No right is conveyed expressly, by implication or by estoppel under any other patent claim. 



99

Support and Services Directory 

Contact Information 

United States Canada 

Business Hours: 8:30 a.m. to 6:00 p.m. EST 8:30 a.m. to 5:00 p.m. EST 

Phone: 800-645-3050 

516-334-7500 

800-263-8715 

905-826-5525 

Fax: 516-334-7506 905-826-5424 

Address: Eppendorf North America, Inc. 

One Cantiague Road 

Westbury, NY 11590-0207 

Eppendorf Canada Ltd. 

2810 Argentia Road, #2 

Mississauga, ON L5N 8L2 

Website: www.eppendorfna.com www.eppendorf.ca 

Email: info@eppendorf.com canada@eppendorf.com 

Customer Support: 800-645-3050, ext. 2101 

custserv@eppendorf.com 

Repair/Service 

Support: 

Applications 

Support: 

800-645-3050, ext. 2405 

service@eppendorf.com 

800-645-3050, ext. 2258 

apps@eppendorf.com 

800-263-8715, menu option 1 

canadacustserv@eppendorf.com 

800-263-8715, ext. 3231 

canadaservice@eppendorf.com 

800-645-3050, ext. 2258 (U.S.) 

apps@eppendorf.com 

www.eppendorf.com • Email: info@eppendorf.com • Application hotline: 516-515-2258 

In the U.S.: Eppendorf North America, Inc. 800-645-3050 • In Canada: Eppendorf Canada Ltd. 800-263-8715 

ENA.C1.0120.B.US-7.0 © 2008 Eppendorf AG.

Automation and Real-time PCR Products and ... - Eppendorf AG

Create successful ePaper yourself

Delete template?

Save as template?