Products and Applications 2006/2007 - Eppendorf

Products and Applications 

2006/2007

2 

We’ve “combined” ARTS and SCIENCES 

And you’ll agree it’s a perfect mix 

Eppendorf ARTS stands for “Automation and Real-time 

Systems,” and it is a special division of Eppendorf North America 

with its own Sales and Support team. They focus solely on the 

intricacies of real-time PCR and liquid handling automation, so you 

can trust them to understand your applications and recommend 

the right Eppendorf systems to meet your exact needs. As with 

anything Eppendorf, you will work quickly and easily, with complete 

confidence in your results. 

What ARTS can do for you 

Go to virtually any lab anywhere in the world, and you will 

see Eppendorf products hard at work—it’s a sure sign of those 

labs’ strong commitment to the quality of their research and 

the accuracy of their results. Why? Because Eppendorf has a 

reputation for producing the best and most reliable laboratory 

equipment and consumables—dating back to the 1950s, when 

we introduced our flagship products: pipettes, centrifuges, tips 

and tubes. 

Fast-forward to a new century—and a new era in liquid handling 

and scientific research—and see our innovative solutions for 

automated pipetting and PCR applications. Just a quick look at 

our epMotion ® liquid handling workstations and Mastercycler ® ep 

realplex systems reveals Eppendorf’s precision, care and quality 

manufacturing. But the really good stuff is on the inside—what 

you can’t see that drives these instruments—and you—to better 

accuracy, better results, faster throughput and easier work 

processes. 

epMotion workstations feature unique technology to recognize 

your labware and ensure that each vessel you have placed on 

the deck contains the correct volume of reagent. They are compact, 

modular and so flexible, you can even integrate a vacuum station 

or thermal cycler without taking up any additional bench space! 

Applications range from simple reagent transfer to complex qPCR, 

cell culture and ELISA assays—with step-by-step programming that 

makes learning and using epMotion a breeze. Get the full benefits 

picture beginning on page 6. 

Mastercycler ep realplex is our fully-licensed qPCR dynamo. 

Small to fit virtually anywhere, flexible to suit your multiplexing 

needs and consumable preferences, and split-second speed 

to get you fast results, realplex is truly ahead of its time. Its 

open-format design features block options, the most sensitive 

optical detection modules/technology available and ramp rates 

up to 6 °C/second, so you’ll complete twice as many experiments 

relative to other slower and older systems! More about realplex 

begins on page 18.

Your gateway to everything Eppendorf: 

For Application Support 

Email: 

arts@eppendorf.com 

Hotline: 

800-645-3050 ext. 2258 

Eppendorf Awards 

We promote science! Learn about the 

$25,000 Eppendorf & Science Prize at 

www.eppendorf.com/awards 

Local Sales Support 

Use our Sales Rep Locator to 

get in touch with your local representative. 

Eppendorf ® and design, epMotion ® , Eppendorf Tubes ® , HotMaster ® , Mastercycler ® , and SteadySlope ® are registered 

trademarks of Eppendorf AG. Eppendorf ARTS and design is a trademark of Eppendorf North America./American Express ® 

is a registered trademark of The American Express Company. Cal Fluor is a trademark of Biosearch Technologies, Inc. 

Cy ® 3 is a registered trademark of Amersham Biosciences UK Limited. Invitrogen ® is a registered trademark of Invitrogen 

Corporation. LightCycler ® is a registered trademark of Roche Diagnostics GmbH. MasterCard ® is a registered trademark of 

MasterCard International Incorporated. Microsoft ® and Windows ® are registered trademarks of Microsoft Corporation. Promega ® 

is a registered trademark of Promega Corporation. Qiagen ® , Biorobot ® , QiaAmp ® and Rneasy ® are registered trademarks of 

Qiagen GmbH. ROX is a trademark of Applera Corporation or its subsidies in the US and certain other countries. SmartCycler ® 

is a registered trademark of Cepheid Corporation. SYBR ® is a registered trademark of Molecular Probes, Inc. TaqMan ® is a 

registered trademark of Roche Molecular Systems, Inc. VISA ® is a registered trademark of IBANCO Ltd. 

Mastercycler ep: Practice of the patented polymerase chain reaction (PCR) process requires a license. The Eppendorf ® 

Thermal Cycler is an Authorized Thermal Cycler and may be used with PCR licenses available from Applied Biosystems. Its use 

with Authorized Reagents also provides a limited PCR license in accordance with the label rights accompanying such reagents. 

www.eppendorf.com 

Online Support: 

Visit our new online Resource Center 

to view and download a wealth of information: 

‡ Applications 

‡ FAQs 

‡ Product manuals 

‡ Material safety data sheets 

‡ Product quality certificates 

‡ Product literature 

Service Support 

Learn about our calibration, 

preventive maintenance and 

repair services—all provided by 

manufacturer-direct technicians. 

Mastercycler ep realplex: Practice of the patented polymerase chain reaction (PCR) process requires a license. The 

Eppendorf ® Thermal Cycler is an Authorized Thermal Cycler and may be used with PCR licenses available from Applied 

Biosystems. Its use with Authorized Reagents also provides a limited PCR license in accordance with the label rights 

accompanying such reagents. This is a Licensed Real-Time Thermal Cycler under Applera’s United States Patent No. 

6,814,934 and corresponding claims in non-U.S. counterparts thereof, for use in research and for all other applied fields 

except human in vitro diagnostics. No right is conveyed expressly, by implication or by estoppel under any other patent claim. 

Eppendorf PCR reagents (e.g., HotMaster, RealMasterMix, etc.): This product is sold under licensing arrangements with 

F. Hoffman-La Roche Ltd., Roche Molecular Systems, Inc. and Applied Biosystems./Purchase of this product is accompanied 

by a limited license to use it in the Polymerase Chain Reaction (PCR) process [and real-time PCR or other as appropriate] 

for internal use in scientific research and development in conjunction with a thermal cycler whose use in the automated 

performance of the PCR process is covered by the up-front license fee, either by payment to Applied Biosystems or as 

purchased, i.e., an authorized thermal cycler. 

In the U.S.: Eppendorf North America 800-645-3050 • In Canada: Eppendorf Canada Ltd. 800-263-8715 

email: info@eppendorf.com • www.eppendorf.com 

67

Meet your ARTS team 

We place as much emphasis on quality customer service as 

we do our products and technologies. Your ARTS team consists 

of dedicated support from local technical specialists to order 

processors, application experts and service/calibration technicians. 

Your local ARTS Specialist, a highly trained scientist with extensive 

bench experience, will personally assess your needs, recommend 

an Eppendorf system that fits your exact criteria and budget, install 

your system and train you to a high level of user confidence. 

Customer Support Representatives are available M–F, 8:30 am– 

6:00 pm EST, to answer general inquiries and place/track your 

order. And because you are dealing directly with Eppendorf, you are 

assured of receiving that extra, personalized support you so deserve. 

Rely on our state-of-the-art Applications Laboratory and Specialists 

to help troubleshoot and assist you with method development. And 

to keep your lab operating at peak efficiency, establish a Preventive 

Maintenance schedule with our Service group. Manufacturer-trained 

field service professionals and various service centers located 

across the United States and in Canada cover the range from 

simple calibration services to expert, expedited repair, should the 

need ever arise. 

Eppendorf: In touch with life, in touch with you 

“In touch with life” is not just a catch-phrase under our logo— 

it’s our mission and has been for over 60 years. By introducing 

cutting-edge products and technologies, we support the 

advancement of life science research; and through our ARTS 

organization we support YOU in making these advancements 

possible. 

So go ahead, contact us any time—your ARTS team 

is looking forward to hearing from you! 

Contact us by phone 

1-800-645-3050, M–F 8:30 am – 6:00 pm EST (U.S) 

1-905-826-5525, M–F 8:30 am – 5:00 pm EST (Canada) 

Contact us by email 

artsinfo@eppendorf.com (general inquiries) 

arts@eppendorf.com (applications support) 

Visit us online 24/7 

www.eppendorfna.com 

At any time you can access product information, application 

notes, view our latest specials and promotions—even find out 

where we’re exhibiting next!

Table of contents 

4 

Info 

Table of contents 

epMotion ® family overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . .7 

5070. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8, 13-14 

5075 LH. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9, 13-14 

5075 VAC. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10, 13-14 

5075 MC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11, 13-14 

Mastercycler ® ep realplex. . . . . . . . . . . . . . . . . . . . . . . . . . . . .19 

Mastercycler ep . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .23 

twin.tec PCR plates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .24 

Heat sealing instruments and consumables . . . . . . . . . . . . . .25 

Mastercycler ep realplex—a flexible device 

for fast and accurate real-time PCR. . . . . . . . . . . . . . . . . . . . .37 

Successful qPCR with small reaction volumes 

on Eppendorf Mastercycler ep realplex . . . . . . . . . . . . . . . . . .43 

Accuracy and precision of the epMotion system . . . . . . . . . . .47 

Automated Pipetting Systems 

Real-time PCR 

Applications 

Appendix 

Product appearance, specifications, and/or prices are subject to change without notice. 

Accessories . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12, 14-16 

realplex Product Highlights 

Gradient function: a highly useful tool for 

optimizing real-time PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . .26 

Impulse PCR: a novel, accelerated and 

improved qPCR Hot Start method . . . . . . . . . . . . . . . . . . . . . .28 

High-speed, real-time PCR assay design 

for realplex silver block models . . . . . . . . . . . . . . . . . . . . . . . .30 

Benefits of realplex’s homogeneity and 

accuracy on reproducibility in real-time qPCR. . . . . . . . . . . . .34 

Contamination test for epMotion 5070 and 5075 

automated pipetting systems . . . . . . . . . . . . . . . . . . . . . . . . . .49 

epMotion automates PCR setup in the 384-well 

format without cross-contamination . . . . . . . . . . . . . . . . . . . .51 

Additional application notes on the Web . . . . . . . . . . . . . . . . .54 

qPCR: Definitions, concepts and overview . . . . . . . . . . . . . . .57 References, resources and useful Websites . . . . . . . . . . . . . .62 

Detection chemistries. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .58 Calculating primer quantity . . . . . . . . . . . . . . . . . . . . . . . . . . .63 

Methods of real-time PCR quantification. . . . . . . . . . . . . . . . .60 Abbreviations, symbols and conversion factors. . . . . . . . . . . .64 

Methods of primer and probe validation . . . . . . . . . . . . . . . . .61 Genetic code and amino acid properties. . . . . . . . . . . . . . . . .66 

How to buy 

Products listed in this catalog can be purchased directly from 

Eppendorf Canada. When placing an order, be certain to use the 

referenced catalog number and identify special requirements, such 

as voltage. 

We accept EDI order transfers to eliminate paperwork 

and to transfer orders quickly and automatically. Please 

contact our Customer Support department for more 

information. Orders can also be placed using your VISA ® , 

MasterCard ® or American Express ® card. 

Prices and specifications 

Product appearance, specifications and/or prices are subject 

to change without notice. 

Product warranty 

Eppendorf products are under warranty against defects in 

workmanship and materials. Contact our Customer Support 

department for warranty information on specific products 

and for additional information on warranty extensions that 

may be available. 

Freight terms 

Parcel and motor freight shipments ordered collect are F.O.B. 

Westbury, NY. In most cases, prepaid shipments are F.O.B. 

destination.

Automated Pipetting 

Systems 

ARTS

Instruments | Automated Pipetting 

Lab automation 

Automation: the next step in liquid handling 

Ever since Eppendorf invented the microliter 

pipette 45 years ago, we have been passionate 

about precision in liquid handling. This passion 

for excellence is clearly demonstrated in our 

epMotion ® systems. These products are flexible 

enough to use in virtually any assay that can 

be manually pipetted, but they are particularly 

suited to real-time PCR and applications where 

precision and reproducibility are essential… 

Order direct from Eppendorf Canada. 

Product appearance, specifications, and/or prices are subject to change without notice.

epMotion® automated pipetting systems 

Description 

Our epMotion automated pipetting systems are flexible, easy to use 

and extremely accurate. Their design is so compact, they can fit 

into any laboratory environment and make the ideal platform for all 

your liquid handling needs. 

The ability to pipette from single tubes or reservoirs to 96-well 

and 384-well plates is built-in. With advanced programming 

options, such as serial dilutions, pooling functions and contact- 

free liquid level sensing, the epMotion family can be used for 

virtually all of your routine applications. The comprehensive 

range of accessories covers a multitude of applications for 

low-to-medium sample throughput. 

The innovative control panel with keyboard, mouse and color 

display is particularly user-friendly, and it eliminates the need for 

a PC; however, for those who prefer, PC software is also available. 

The following pages describe the different models in the 

epMotion family and their relevant applications: 


epMotion 0 0: for basic liquid handling applications 

epMotion 0 LH: for basic liquid handling applications 

with higher sample throughput 

requirements; can be upgraded to 

either model below 

epMotion 0 VAC: an integrated vacuum station allows fully 

automated nucleic acid purifications 

epMotion 0 MC: an integrated Mastercycler ® ep* 96 or 

384 thermal cycler provides total PCR 

automation 

* Practice of the patented polymerase chain reaction (PCR) 

process requires a license. The Mastercycler is an Authorized 

Thermal Cycler and may be used with PCR licenses available 

from Applied Biosystems. Its use with Authorized Reagents 

also provides a limited PCR license in accordance with the 

label rights accompanying such reagents. 



Automated Pipetting | Instruments



epMotion® 5070 


‡ Sample preparation of 

PCR/real-time PCR/RT-PCR: 

setup in the 96- and 

384-well formats 

‡ Reagent transfer: 

distribution of reagents 

from reservoirs into plates 

or single tubes 

‡ Sample transfer: creation 

of copies from 24-, 96- and 


Product features 

‡ Simple operation 

‡ Easily exchangeable 

dispensing tools 

‡ Large volume range from 

1 μl to 1,000 μl 

‡ Precise and reproducible 

pipetting 


‡ Generation of dilution series 

‡ Merging of many samples, 

media change 

‡ Reformatting: 

from 4 x 24 Eppendorf Tubes ® 

into a 96-well format 

‡ Normalization and “cherry- 

picking” in 96-well plates 

‡ Optical Sensor* for the 

recognition of tips, labware 

and liquid levels 

‡ Dispensing tools for 

single- and 8-channel pipetting 

‡ PC editor software 

available 

*U.S. Pat. 6,819,437 

Description 


epMotion 5070 enables fast and reproducible liquid handling 

through automated pipetting, dispensing and other dispensing 

variants. Programming is so easy that previous automation know- 

ledge or extensive training is not required. In fact, installation and 

training can be completed in less than one day. 

Protocols that have been carried out manually are quickly and 

easily transferred to the epMotion 5070 workstation, maintaining 

tried-and-true pipetting procedures. Its great similarity to manual 

pipettes and its familiar manual work methods make moving to 

automation very easy. 

Operate the epMotion via the connected control panel—the 

connected mouse enables free movement of the cursor over the 

integrated screen. Operation is intuitive and flexible: the software 

prompts you step-by-step through the necessary actions; and 

because epMotion 5070 can operate without a PC, it also saves 

you precious bench space.

epMotion® 5075 LH 


‡ Sample preparation of 

PCR/real-time PCR/RT-PCR: 

setup in 96-/384-well format 

‡ Reagent transfer: 

distribution of reagents 

from wells in plates or 

individual tubes 

‡ Sample transfer: creation 

of copies from 24-, 96- and 



‡ Basic version with 12 rack 

positions in 96-/384-well 

standard format (SBS 

microplate specifications) 

‡ Automatic exchange 

of all tools 

‡ Installation of up to three 

thermomodules is possible 

‡ Optional labware handling 

with gripper 

‡ Precise and reproducible 

pipetting 

‡ Thermoblock for 

PCR plates 

Thermal block holds 

96- or 384-well PCR plates. 

‡ Thermoelements for 

racks and -/3 4-well 

PCR plates 

Cool or heat up to three 

positions on the deck. 

‡ Generation of dilution series 

‡ Merging of many samples, 

media change 

‡ Reformatting: from tubes 

to plates, and from 96-well 

to 384-well formats 



‡ Optical Sensor 1 for the 



‡ Expandable modular system 

– Upgrade from 

epMotion 5075 LH to 

epMotion 5075 VAC possible 

– Conversion of epMotion 5075 

LH to epMotion 5075 MC 

(with Mastercycler ® ep 2 ) 

1 U.S. Pat. 6,819,437 

2 Practice of the patented polymerase chain reaction (PCR) process 

requires a license. The Mastercycler is an Authorized Thermal 

Cycler and may be used with PCR licenses available from Applied 

Biosystems. Its use with Authorized Reagents also provides a limited 

PCR license in accordance with the label rights accompanying such 

reagents. 


‡ Modular construction to suit a variety of liquid handling tasks 

Description 

epMotion 5075 features 12 positions on its deck, and it is ideal for 

virtually any liquid handling application. Functional enhancements 

over the epMotion 5070 include: the ability to automatically change 

pipetting tools, the availability of temperature control modules, and 

the addition of a gripper functionality to move labware on the deck. 

‡ Calibration and 

certification program 

Brinkmann-Eppendorf 

Certification, designed to 

safeguard your results and 

satisfy both government 

and internal laboratory 

requirements (e.g., FDA, 

ISO, GLP, SOP), establishes 

precision and confidence in 

your data, with traceability 

to the National Institute 

of Technology (NIST); 

manufacturer-direct 

trained service 

professionals perform 

all services. 





10 


epMotion® 5075 VAC 


‡ Cleanup of PCR and 

sequencing products 

in 96-well format 




‡ Perfectly tuned system of 

instruments, consumables 

and reagents 

‡ Modular system—can 

be expanded/upgraded for 

additional applications 

‡ Ready-to-go methods 

included 

‡ Walk-away solution for 

isolation of nucleic acids 

‡ Integrated vacuum station 

with innovative “self-adjusting” 

vacuum chamber 

‡ Integrated vacuum station 

Compact system with a 

completely integrated vacuum 

chamber and pump. 


‡ Isolation in 96-well format of: 

– Plasmid DNA 

– BAC DNA 

– Genomic DNA 

– Total RNA 

‡ Optical Sensor* for the 



‡ Labware handling: the 

gripper can be used to move 

plates and sections of the 

aspiration chamber 

‡ Easily upgrade from 

epMotion 5075 LH to 

epMotion 5075 VAC 

*U.S. Pat. 6,819,437 

Description 


epMotion 5075 VAC comes equipped with a complete vacuum 

station. This system is ideal for processing vacuum-based, high- 

throughput nucleic acid isolation in a 96-well format, and it can 

be used for a variety of other liquid handling applications. 

‡ Labware handling 

Use of a gripper for precise 

reconfiguration of the vacuum 

chamber and transport 

of plates.

epMotion® 5075 MC 


‡ Fully automated reaction 

preparation and subsequent 

amplification in the 

Mastercycler ® ep1 ‡ PCR and RT-PCR setup 

in 96-/384-well plate format 

‡ Sequencing reactions in 

96-/384-well plate format 


‡ Integrated Mastercycler ep 

software 

‡ Mastercycler ep gradient 

with motorized lid (sold 

separately) 

– Robust, high-quality 

aluminum block in 

96-/384-well format or 

optional 96 silver block 

for maximum speed 

‡ Ready to go 

Our Mastercycler ep and 

epMotion 5075 are perfectly 

compatible, e.g., for direct 

filling of 384-well plates in the 

thermal block. 

‡ Expandable system for 

a number of applications 

in the fields of genomics 

and proteomics 

‡ Normalization and “cherrypicking” 

in 96-well plates 

‡ Gripper for plate transport 

‡ Multitasking: 

simultaneous PCR reaction 

and liquid handling 

‡ Easily upgrade from 

epMotion 5075 LH 

1 Practice of the patented polymerase chain reaction (PCR) 

process requires a license. The Mastercycler is an Authorized 


from Applied Biosystems. Its use with Authorized Reagents 

also provides a limited PCR license in accordance with the 

label rights accompanying such reagents. 

‡ Dispensing without 

cross-contamination 

Amplification of the 

535 bp fragment of the 

human Beta globin gene 

in a 384-well format. 

Description 


epMotion 5075 MC is equipped with our Mastercycler ep line of 

thermal cyclers (sold separately); a wide variety of configuration 

options ensures optimum adaptation to your individual laboratory 

needs. Enjoy the highest level of reliability and precise performance 

of even the most complex work steps. The combination of sample 

preparation and PCR in one sealed housing enables contamination- 

free performance of amplification reactions. 

‡ 30 ml and 100 ml reagent 

reservoirs 

The reagent reservoirs are 

“PCR clean” as well as 

autoclavable, and they can be 

easily placed in the reagent 

rack; their special geometry 

minimizes residual volume and 

makes them ideal vessels for 

reagents in the PCR setup. 



11 



12 


epMotion® accessories 

‡ Reservoir rack 

For holding the 30 ml and 100 ml 

reagent reservoirs and enabling the 

positioning of up to seven reservoirs 

with 30 ml or 100 ml filling volume. 

‡ Thermoracks and adapter 

For use with 96-well or 384-well plates 

and single 0.2 ml tubes. 

‡ Gripper for epMotion 0 

For the transport of plates on the 

deck and for automatic operation 

of the vacuum manifold. 


‡ Height adapters 

Various height adapters allow exact 

height level adjustment and accelerated 

processing of PCR and deepwell plates. 

‡ Thermoracks for 24 x Safe-Lock 

0. ml/1. ml/2.0 ml tubes 

For 24 micro test tubes. 

epMotion Editor 


‡ Dispensing tools 

Six dispensing tools from 1 μl to 

1,000 μl are available: 3 single-channel 

and 3 multichannel (ordering info on 

page 14). 

‡ Racks for single test tubes 

For glass or plastic micro 

test tubes. 

‡ Software package for generating 

and editing methods, as well as printing 

and archiving program processes on 

a PC; the drag-and-drop interface is 

extremely easy to use and intuitive—data 

is transferred between the PC and the 

control panel using a MultiMediaCard 

and card reader.


Technical specifications 0 0 0 LH 0 VAC 0 MC 

Surface 


System Width: 39 in/98 cm 56 in/140 cm 56 in/140 cm 56 in/140 cm 

Depth: 30 in/75 cm 30 in/75 cm 30 in/75 cm 30 in/75 cm 

Dimensions 

Device Width: 26 in/65 cm 43 in/107 cm 43 in/107 cm 43 in/107 cm 


Height: 25 in/63 cm 27 in/67 cm 27 in/67 cm 27 in/67 cm 

Control panel Width: 10 in/25 cm 10 in/25 cm 10 in/25 cm 10 in/25 cm 


Height: 4 in/11 cm 4 in/11 cm 4 in/11 cm 4 in/11 cm 

Weight 

Device: 99 lb/45 kg 187 lb/85 kg 198 lb/90 kg 224 lb/102 kg 

Control panel: 3 lb/1.2 kg 3 lb/1.2 kg 3 lb/1.2 kg 3 lb/1.2 kg 

Power supply 

Voltage: 100–130 V ± 10% 100–130 V ± 10% 100–130 V ± 10% 100–130 V ± 10% 

Frequency: 50–60 Hz ± 5% 50–60 Hz ± 5% 50–60 Hz ± 5% 50–60 Hz ± 5% 

Max. output: 80 W 1,000 W 1,000 W 1,000 W 

Dispensing tools 

Volume 1 μl 

Systematic measurement error: ± 10% ± 10% ± 10% ± 10% 

Random measurement error: ≤ 5% ≤ 5% ≤ 5% ≤ 5% 

Volume 50 μl 

Systematic measurement error: ± 0.8% ± 0.8% ± 0.8% ± 0.8% 

Random measurement error: ≤ 0.4% ≤ 0.4% ≤ 0.4% ≤ 0.4% 

Volume 1,000 μl 

Systematic measurement error: ± 0.6% ± 0.6% ± 0.6% ± 0.6% 

Random measurement error: ≤ 0.2% ≤ 0.2% ≤ 0.2% ≤ 0.2% 

Conductor 

Measurement error in pipetting mode, free-jet, without prewetting, 

with distilled water, at 20 °C 

X, Y, Z Positioning 

Systematic measurement error: ± 0.3 mm ± 0.3 mm ± 0.3 mm ± 0.3 mm 

Random measurement error: ± 0.1 mm ± 0.1 mm ± 0.1 mm ± 0.1 mm 

Positions in MTP format: 4 12 12 10 

Detector 

Optical confocal infrared detector: Contact-free detection of liquid level, tools used, labware deck, 

tip types and quantities 

Optical Sensor:* Liquid surface must be 90° ± 3° to the vertical plane of the Optical Sensor 

Gripper 

Carrying capacity: – ≤ 1,200 g ≤ 1,200 g ≤ 1,200 g 

Vacuum unit 

Max. output: – – 35 L/min – 

Suction range: – – 0.1–0.5 ± 0.05 hPa – 

Suction time: – – 1 min–99 min – 

*U.S. Pat. 6,819,437 



13 


Consumables | Instruments | Automated Pipetting 

14 



Technical specifications 0 0 0 LH 0 VAC 0 MC 

Cycler unit 

Heat-cooling unit: – – – 96 Al, 96 Ag, 384 Al 

Thermal module (optional) 

Setting range: – 0 °C–110 °C 0 °C–110 °C 0 °C–110 °C 

Heating time of the heating/cooling plate: – from 25 °C–95 °C 

in 8 min 

Cooling time of the heating/cooling plate: – from 25 °C–4 °C 

in 5 min 

Software 

Operating software: MotionManager v2.0 or higher; 

Firmware: MotionInstrument v2.0 or higher 

Ordering information 



from 25 °C–95 °C 

in 8 min 

from 25 °C–4 °C 

in 5 min 

from 25 °C–95 °C 

in 8 min 

from 25 °C–4 °C 

in 5 min 

Description Catalog No. 

Liquid handling workstations 

epMotion 0 0, basic device includes control panel, software, Optical Sensor*, waste container, 

MMC and reader, operating instructions, 100–130 V/50–60 Hz 

960000005 

epMotion 0 LH, 100–130 V/50–60 Hz (liquid handling) 960020006 

epMotion 0 VAC, 100–130 V/50–60 Hz (includes vacuum station) 960020014 

epMotion 0 MC, 100–130 V/50–60 Hz (Mastercycler ® ep sold separately) 960020022 

Retrofit set 

MC, for retrofitting an LH version into an MC version 960021002 

VAC, for retrofitting an LH version into a VAC version 960021011 

Dispensing tools 

Highly precise pipetting heads, for use in the tool holder of the epMotion workstation. 

Each dispensing tool is completely autoclavable at 121 °C, 1 bar for 20 min. 

A quality certificate for the measurement results accompanies each tool. 

TS 0, single-channel dispensing tool for the volume range 1–50 μl 960001010 

TS 300, single-channel dispensing tool for the volume range 20–300 μl 960001028 

TS 1000, single-channel dispensing tool for the volume range 40–1,000 μl 960001036 

TM 0- , 8-channel dispensing tool for the volume range 1–50 μl 960001044 

TM 300- , 8-channel dispensing tool for the volume range 20–300 μl 960001052 

TM 1000- , 8-channel dispensing tool for the volume range 40–1,000 μl 960001061 

Holder, for 6 dispensing tools 960001109 

epTIPS Motion pipette tips 

Pipette tips for automated systems in individual racks, for use with epMotion. 

Tip type and size are automatically recognized on the device. 96 epTIPS/rack, 15 racks per set. 

Two purity levels: without filter = Eppendorf Quality; Filtertips = PCR clean (free of human DNA, 

DNase, RNase and PCR inhibitors). Production batch-tested, certified. 

Without filter, Eppendorf Quality 

50 μl, volume range 1–50 μl, 15 x 96 tips in racks = 1,440 tips 960050002 

300 μl, volume range 30–300 μl, 15 x 96 tips in racks = 1,440 tips 960050045 

1,000 μl, volume range 40–1,000 μl, 15 x 96 tips in racks = 1,440 tips 960050088 

Filtertips, PCR clean 

50 μl, volume range 1–50 μl, 15 x 96 Filtertips in racks = 1,440 tips 960050029 

300 μl, volume range 30–300 μl, 15 x 96 Filtertips in racks = 1,440 tips 960050061 

1,000 μl, volume range 40–1,000 μl, 15 x 96 Filtertips in racks = 1,440 tips 960050100 

*U.S. Pat. 6,819,437 

Please contact Eppendorf Canada to receive a quotation for 

epMotion liquid handling workstations and accessories.





Accessories 

Reservoir rack, for use with 30 ml and 100 ml reagent reservoirs, 

holds max. seven reservoirs of 30 ml or 100 ml filling volumes 

epMotion reservoirs 

Large volume reservoir, must be used with a reservoir rack. 

Two sizes: 30 ml or 100 ml maximum volume. Five reservoirs packed in separate bags, 10 bags per set. 

All reservoirs are PCR clean (free of human DNA, DNase, RNase and PCR inhibitors) and made of 

polypropylene. Production batch-tested, certified. 

960002148 

30 ml, set of 50 960051009 

100 ml, set of 50 960051017 

Racks 


epMotion liquid handling workstations and accessories. 

For 24 glass or plastic tubes, no temperature control 

Ø 17 mm x 100 mm max. length 960002024 












Rack for 24 x HPCL tubes, Ø 12 mm x 40 mm max. length 960002380 

Rack for x 1. ml/2.0 ml screw-cap tubes 

Requires two positions on the deck 

Height adapters 

For uniform levels of labware; enables faster processing of the plate 

960002318 

85 mm 960002105 

55 mm 960002113 

40 mm (for pipette tips) 960002121 

Accessories for epMotion 0 0/ 0 

epMotion Editor, software package for creating and editing methods 

and for printing out and archiving program sequences on a PC, includes editor key 

960000269 

MultiMediaCard, for archiving parameters and transporting data between control panel and PC 960002008 

USB card reader 960000501 

Mouse PS/2 960000510 

Waste container, receptacle for used pipette tips, with lid 960002016 

Thermorack for 24 x 0. ml Safe-Lock tubes, for a supply of 24 test tubes, temperature control 960002067 

Thermorack for 24 x 1. ml/2 ml Safe-Lock tubes, for a supply of 24 test tubes, temperature control 960002075 

Adapter sleeves, 1 set = 25 pieces 

for reconfiguring the 1.5 ml/2.0 ml Thermorack for 0.5 ml tubes 

960002172 

Panel plate, for control panel 960000301 

Accessories for epMotion 0 only 

Thermal module, for heating and cooling microplates and thermal racks 960002181 

Gripper, for transporting plates on the deck and for automatic operation of the vacuum chamber 960002270 

Gripper holder 960002211 



1 

Automated Pipetting | Instruments | Consumables


1 




epMotion liquid handling workstations and accessories. 



Accessories for PCR/real-time PCR 

Rack Smart, for holding one tube rack of SmartCycler ® reaction tubes 960002520 

Rack LC 20 µl/100 µl, for holding up to 96 x 20 μl or 100 μl LightCycler ® capillaries, 

for use with, e.g., Centrifuge 5804/5804 R or 5810/5810 R, set of 2 

Thermorack CB 100 µl, 

for holding up to 384 x 0.1 ml strip tubes in the Corbett Research Rotor-Gene 3000 

Thermoadapter for PCR plates, -well, skirted, 

for heating or cooling of PCR plates; plates are exchangeable using the gripper 

Thermoadapter for PCR plates, 3 4-well, skirted, 

for heating or cooling of PCR plates; plates are exchangeable using the gripper 

Thermoadapter Frosty, combination of height adapter and 

PCR-Cooler for cooling of skirted PCR plates 

Thermoblock for PCR plates, -well, 

for use with 96 x 0.2 ml tubes or a PCR plate 96 

Thermoblock for PCR plates, 3 4-well, 

for use with a PCR plate 384 

CycleLock starter set, 1 frame and 8 mats for automated sealing of Eppendorf ® PCR plates, 

PCR clean; can only be used with Mastercycler ® ep 



960002511 

960002500 

960002199 

960002202 

960002300 

960002083 

960002091 

960002288 

CycleLock mats, 5 sealing mats, PCR clean, frame not included 960002296 

Accessories for nucleic acid purification 

Vac frame holder 960002237 

Vac lid 960002245 

Mat, for vacuum lid 960002407 

Vac frame 1 960002253 

Vac frame 2 960002261 

Collection Plate Adapter, for handling collection microtubes in microtube racks 960002531 

Channeling Plate Adapter, for vacuum-processing foaming solutions through 

multiwell plates, set of 10 

960002540 

-well Calibration Plate 960002560 

Vac Thermo Lid, for effective drying of filter plates in epMotion 5075 VAC vacuum chamber 

Note: additional thermal module required 

Service plans 

960002551 

Robot support 

For epMotion 5070 955989015 

For epMotion 5075 955989007 

For epMotion 5075 VAC 955989070 

For epMotion 5075 MC 955989081 

1-year extended warranty 

For epMotion 5070 955989061 

For epMotion 5075 955989050 

For epMotion 5075 VAC 955989090 

For epMotion 5075 MC 955989101 

Shipping and installation 

epMotion shipping 955989020 

epMotion installation and training 955989030 

epMotion advanced training 955989040

Real-time PCR 

ARTS 

17

Instruments | Real-time PCR 

18 

Thermocycler 

Real-time PCR—the Eppendorf way 

Eppendorf has earned its standing as a leading innovator of PCR instruments 

with SteadySlope ® single-block gradient technology and device-driven, highspeed 

PCR—with the freedom to use consumables and kits of your choice. 

Our cyclers also have the best reported specifications of paired uniformity 

and accuracy of any Peltier block thermal cycler available. 

Did you know that we also have a long history in the design of optical systems? 

For 60 years we’ve been engineering and manufacturing photometers and other 

instruments that require fine optics—and with our Mastercycler ® ep realplex we’ve 

designed a real-time PCR system with the most advanced, highly sensitive optics 

available. It is the fastest, best-designed, real-time thermoblock cycler today… 



Mastercycler® ep realplex 

Application 

‡ Quantitative real-time PCR 


‡ Quick detection 

‡ Choose from fast or 

ultra-high-speed models 

‡ Unrestricted system gives 

you total freedom to use the 

tubes, plates and reagents of 

your choice 

‡ Modular design provides 

several system options 

‡ Compact footprint saves 

valuable bench space 

‡ Solid design for quiet 

operation and dependability 

‡ Intuitive software includes a 

variety of analysis modules for 

easy translation of results 

NEW! 

Small, fast and flexible 

Thermocycler 

Mastercycler ep realplex meets all the latest requirements of 

quantitative PCR applications: high-speed temperature ramping, 

short detection times and intuitive assay programming translate to 

huge time savings, so that more experiments can be completed per 

day—with accurate and reliable results. And its flexibility is beyond 

compare—this completely open system allows you to use tubes, 

plates and reagents of your choice. 

Modular and compact in size, realplex can fit in virtually any lab, 

no matter how limited the bench space. Since it is part of the 

premier Mastercycler ep family of thermal cyclers, if you already 

have a Mastercycler ep gradient S in your lab, for example, you can 

upgrade it to a realplex real-time PCR cycler at any time; and the 

realplex 2 module can be replaced by the realplex 4 module if/when 

greater multiplexing becomes essential. 

Eppendorf Thermal Sample Protection technology prevents the 

negative effects of condensation on amplification, and a solid 

construction with minimal moving parts makes this a quiet, 

dependable cycler that promotes consistently high sensitivity. 

Practice of the patented polymerase chain reaction (PCR) process 

requires a license. The Eppendorf Thermal Cycler is an Authorized 


from Applied Biosystems. Its use with Authorized Reagents also 

provides a limited PCR license in accordance with the label rights 

accompanying such reagents. This is a Licensed Real-Time Thermal 

Cycler under Applera’s United States Patent No. 6,814,934 and 

corresponding claims in non-U.S. counterparts thereof, for use 

in research and for all other applied fields except human in vitro 

diagnostics. No right is conveyed expressly, by implication or by 

estoppel under any other patent claim. 



19 

Real-time PCR | Instruments


20 

Thermocycler 


realplex thermoblocks 

Choose either the 96-well aluminum or the 96-well silver 

thermoblock: both feature Eppendorf SteadySlope ® gradient 

technology for assay optimization—even optimization of two-step 

qPCR. If you require the fastest heating and cooling rates, choose 

the silver block, whose performance is enhanced by our unique 

Impulse PCR technology (more information on page 28). 

Both blocks are compatible with either the realplex 2 or realplex 4 

optical modules, which permit the use of nearly all fluorescent dyes 

used in real-time PCR: the realplex 2 module has two fluorescence 

filters and one channel photo-multiplier tube (CPM), while the 

realplex 4 module incorporates four filters and two CPMs for up 

to four-fold multiplexing assays. Our new and innovative CPMs, 

in contrast to conventional photo-multiplier tubes, are far less 

sensitive to magnetic field interference and offer greatly 

increased sensitivity. 

Licensed for real-time PCR, see previous page. 

realplex system product highlights begin on page 26. 


96-well excitation 


The fluorescent dyes chosen for each experiment are excited by 

96 individual LEDs, which have a substantially longer lifespan than 

halogen lamps: a blue light emission of ~470 nm excites nearly all 

applicable fluorophores, including SYBR ® Green, FAM, VIC, TET, 

HEX, ROX, JOE, TAMRA and more; the emitted fluorescence is 

focused through an array of lenses and passed to the optical 

detection unit through 96 individual optical fibers, where our new 

CPMs serve as the detectors. 

Results in real-time 

realplex software offers six different evaluation modules for 

maximum flexibility when processing results. An intuitive user 

interface ensures quick and easy PCR and assay setup, as well 

as simple transfer of previously established PCR protocols. 

Smart programming automatically interprets possible dye 

interferences when performing multiplex assays, and results 

are easily exported to Microsoft ® Excel for GLP compliance 

(as an alternative to the built-in analysis modes).


‡ Plate layout 

The clear and comprehensive organization of multiple viewing 

windows, as well as intuitive options for selection within each 

view, enable easy and fast plate setup when creating assays. 

‡ Quantification/relative quantification 

This analysis module performs calculations from raw data 

for a variety of assays, including absolute quantification 

of DNA or relative quantification of gene expression based 

on the DDC t method. 

‡ Endpoint 

The analysis module option for endpoint measurements instructs 

Mastercycler ep realplex to serve as a “plate fluorometer” and aids 

in the determination of absolute fluorescence intensities, even with 

samples previously amplified on standard thermocyclers. 

Licensed for real-time PCR, see page 19. 

‡ Raw data 

Thermocycler 

This software module displays the generated raw data in real time, 

which means that you can immediately evaluate your real-time PCR 

and interrupt the reaction as soon as the desired result is obtained. 

‡ Gene identification 

Selecting this analysis module option generates allele-discrimination 

results. Data previously generated in melting curve analyses, end- 

point measurements or C t-value determinations serves as the basis. 

‡ +/– Assay 

Define critical threshold values through this analysis module 

option to differentiate between positive and negative samples 

(e.g., for the detection of pathogens). Data from previous endpoint 

measurements serves as the source for such determinations. 



21 

Real-time PCR | Instruments


22 

Thermocycler 


Technical specifications 

Optical module 

Excitation source: 96 LEDs (470 nm) 

Emission filters: 520 nm/550 nm/580 nm/605 nm (realplex 4 ) 

520 nm/550 nm (realplex 2 ) 

Detector: 2-channel photo-multiplier tubes (realplex 4 ) 

1-channel photo-multiplier tube (realplex 2 ) 

Dynamic range: 9 orders of magnitude from starting copy number 

Sensitivity: ≤ 50 fM fluorescein 

Thermomodule 

Sample capacity: 96 x 0.2 ml PCR tubes or one 96 PCR plate 

(unskirted, semiskirted or skirted—as per SBS standard) 

Temperature control range of block: 4 °C–99 °C 

Degree range of gradient, maximum: 1 °C–24 °C (thermomodule Mastercycler ep S) 

1 °C–20 °C (thermomodule Mastercycler ep) 

Temperature control range of gradient: 30 °C–99 °C 

Temperature of lid: 105 °C 

Block homogeneity: 35 °C ± 0.3 °C 

90 °C ± 0.4 °C 

Control accuracy: ± 0.2 °C 

Heating speed*: approx. 6 °C/s (thermomodule Mastercycler ep S) 

approx. 4 °C/s (thermomodule Mastercycler ep) 

Cooling speed*: approx. 4.5 °C/s (thermomodule Mastercycler ep S) 

approx. 3 °C/s (thermomodule Mastercycler ep) 

Complete system 

Dimensions (W x D x H): 10.2 x 16.1 x 15.6 in/26 x 41 x 39.6 cm 

Total weight: 53 lb/24 kg 

Weight of thermomodule: 37.5 lb/17 kg 

Weight of detection module: 15.4 lb/7 kg 

Voltage requirements: 100–130 V/50–60 Hz 

Power consumption: 800 W 

*Measured at block 


the Mastercycler ep realplex system that meets your specific 

requirements. 

Licensed for real-time PCR, see page 19. 



Mastercycler® ep 

Mastercycler ep, family to the realplex qPCR system, is also fast, 

precise and easy to use. Absolute reliability united in a flexible 

concept allows these models to take on a variety of roles in your lab: 

1. Use one as a universal, stand-alone device with Control 

Panel operation 

2. Create a “mini-satellite” system, consisting of a Control 

Panel and up to 5 Mastercycler ep models 

Regulatory documentation 

Compliance with GMP/GLP or FDA guidelines is becoming 

increasingly important, particularly in pharmaceutical and 

biotechnology laboratories. The Mastercycler ep system’s 

programming and user management systems provide a 

GLP-conforming environment for your PCR assays. 

Program and user administration features 

‡ Administrator protection to 

manage user and service 

functions 

‡ Easy addition of new 

users with limited rights 

‡ Password protection 

against unauthorized login 

‡ A report file for each run, 

including total temperature 

profiling 

‡ Development, testing and 

validation of the software 

using certified standards 

3. Use one or more as a PC-supported, GLP-conforming 

PCR system 

4. Daisy-chain a PC-controlled Mastercycler ep network of 

thermal cyclers 

5. Choose high-throughput units with motorized lids for 

automation integration 

Thermocycler 

Mastercycler ep ordering information at www.eppendorfna.com 

Mastercycler epCycleManager software 

‡ As an alternative to the 

Control Panel, network and 

control up to 30 Mastercycler 

ep thermal cyclers with a 

PC; mix and match models 

of your choice 

‡ Send programs to a 

network of Mastercycler eps 

or to several thermal cyclers 

simultaneously 

‡ GLP-conformity documen- 

tation of all PCR experiments 

‡ User password protection 

‡ Real-time acquisition of 

temperature data 

‡ Compatible with Windows ® 

operating system, with intuitive 

Windows-like interface 

Practice of the patented polymerase chain reaction (PCR) process 

requires a license. The Mastercycler is an Authorized Thermal 

Cycler and may be used with PCR licenses available from Applied 

Biosystems. Its use with Authorized Reagents also provides a limited 

PCR license in accordance with the label rights accompanying such 

reagents. 



23 

PCR | Instruments

Consumables | PCR 

24 

PCR consumables 

twin.tec PCR plates 


‡ One-piece design 

combines polycarbonate 

and polypropylene for 

optimum performance 

‡ Increased plane parallelism 

‡ Extremely thin-walled 

for optimum heat transfer 

to the sample 

‡ Low-profile design enhances 

efficiency of PCR and enables 

the highest efficiency for small 

sample volumes 

‡ Raised well rims for 

effective sealing, also reduces 

risk of cross-contamination 

‡ Improved well-to-well 

tolerance 


‡ Autoclavable 

(121 °C, 20 min) 

‡ Certified to be free of 

any detectable human DNA, 

DNase, RNase and 

PCR inhibitors* 

‡ Meets SBS footprint 

recommendations 

‡ Max. well volumes: 

– 45 µl, twin.tec 384 

– 150 µl, twin.tec 96 skirted— 

when used with cap strips 

– 250 µl, twin.tec 96 semi- 

skirted—ideal for qPCR on 

a variety of systems 

* Certificate, test procedures and detailed 

information available upon request. 

Description Catalog No. List CAD 

twin.tec PCR Plate 96, skirted (clear wells), 25 pcs. 

Clear 951020401 $ 127.00 

Yellow 951020427 127.00 

Green 951020443 127.00 

Blue 951020460 127.00 

Red 951020486 127.00 

twin.tec PCR Plate 96, skirted (black wells), 25 pcs. 

Yellow (not shown) 951020508 133.00 

twin.tec PCR Plate 96, semiskirted (colorless wells), 25 pcs. 

Clear 951020303 127.00 

Yellow 951020320 127.00 

Green 951020346 127.00 

Blue 951020362 127.00 

Red 951020389 127.00 

twin.tec PCR Plate 384, skirted (colorless wells), 25 pcs. 

Clear 951020702 252.00 

Yellow 951020711 252.00 

Green 951020729 252.00 

Blue 951020737 252.00 

Red 951020745 252.00 

Order from your laboratory supply dealer or Eppendorf Canada. 


twin.tec plates are made of the best quality materials for use 

manually AND with automated systems: virgin polypropylene 

ensures minimal binding of DNA, RNA and enzymes—with 

maximum recovery; polycarbonate, which provides sturdiness 

and high mechanical stability, makes up the plate surface and 

frame. The well walls are 20% thinner than conventional thin- 

walled tubes, providing optimal heat transfer between the block 

and your samples. Choose from 3 styles (unskirted, skirted and 

semiskirted) and 5 colors to suit your experimental needs and 

ease identification/handling.

Heat sealing materials 

Heat Sealer product features 

‡ Safe and easy hermetic heat 

sealing of 96- and 384-well 

plates (384-well base available 

separately) 

‡ Eliminates evaporation 

in PCR, reducing cross- 

contamination 

‡ Suitable for plates of 

different heights 

‡ Optimum sealing with 

Eppendorf ® Heat Sealing 

Foils and Films at a preset 

temperature 

Film/Foil product features 

‡ Hermetic sealing of 

multiwell plates, especially 

recommended for low 

reaction volumes 

‡ Best protection against 

evaporation during PCR 

‡ Certified free of human 

DNA, DNase, RNase and 

PCR Inhibitors* 

Technical specifications 

‡ Compact and portable, ideal 

for transporting and storing 

samples 

‡ Integrated thermostat 

prevents overheating 

‡ Heating plate recessed 

for safety 

‡ Use with optically clear 

heat-sealing film for real-time 

qPCR applications 

‡ Heat sealing film is optically 

clear for real-time PCR 

applications. 

* Certificate, test procedures and detailed 

information available upon request. 


PCR consumables 

Description Catalog No. List CAD 

Heat Sealer, 115 V/50 Hz 951023078 $1,690.00 

Base plate, for 384-well plate 951023086 520.00 

Heat Sealing Film, 10 x 10 pcs. 951023060 244.00 

Peel-it-lite Foil, 100 pcs. 951023205 131.00 

Pierce-it-lite Foil, 100 pcs. 951023213 124.00 

Foil Stripper 951023043 244.00 

Heat Sealing Film Peel-it-lite Foil Pierce-it-lite Foil 

Packaging: 10 x 10 pcs. 1 x 100 pcs. 1 x 100 pcs. 

Features: Optically clear polyester/ 

polypropylene laminate 

Extremely stable sealing option 

—cannot be removed or pierced 

Laminated aluminum foil 

Easily removable 

Laminated aluminum foil 

Easily pierced—even with 

multichannel pipettes 

No glue residue on the 

pipette tips 

Seal integrity: –80 °C to 140 °C –200 °C to 120 °C –80 °C to 120 °C 

Sealing time with 

Eppendorf Heat Sealer: 

1–2 s 2–4 s 2–3 s 

Weldable materials: Polypropylene Polypropylene 

Polyethylene 

Special applications: Colorimetric applications 

Fluorescence applications, 

including real-time PCR 

Storage of hazardous samples 

Storage at extremely low 

temperatures (–200 °C) 

Can even be removed at –80 °C 

Plate can be resealed 

(after removal of old foil) 

Polypropylene 

PCR with water bath cyclers 

Storage and transport 

of samples 



25 

PCR | Instruments | Consumables

The realplex advantage | Real-time PCR 

26 

realplex highlights 

Product highlights—Mastercycler® ep realplex 

Gradient function: a highly useful tool for optimizing real-time PCR 

The right choice of annealing temperature for primers (and probe) 

has a significant influence on the performance and efficiency of 

real-time PCR reactions. While software programs offer various 

algorithms to estimate this temperature, the best way to accurately 

determine optimal annealing temperature is empirically. 

Mastercycler ep realplex’s gradient function 1 offers a wide 

temperature range across all 12 column well positions of the 

thermoblock, and it provides 12 different temperatures to test in 

a single experiment: choose a temperature span from 1 °C up to 

20 °C when using the aluminum block, or from 1 °C to 24 °C when 

using the silver block. 

The gradient function is easy to use, and its importance for real- 

time PCR optimization is demonstrated in the following assay. 

‡ Fig. 1: Simple programming of realplex’s annealing 

temperature gradient step 

The gradient preview for the 12 column well positions on the block 

demonstrate the highly linear characteristic of its Triple Circuit 

Peltier design. 



Real-time PCR with gradient function—assay setup 

A mastermix containing RealMasterMix 2 , SYBR ® Green I and 

primers was prepared to amplify and detect a sequence segment of 

the Beta globin gene. A temperature gradient over a range of 24 °C 

(from 44 °C to 68 °C) on the Mastercycler ep realplex S (silver block) 

was programmed for the annealing step (Fig. 1). The program in 

detail: 95 °C for 2 min; 40 cycles of 95 °C for 15 s, 44 °C–68 °C for 

30 s, 68 °C for 60 s; and finally a melting curve analysis. 

For each of the 12 different annealing temperatures, 3 sample 

replicates, each with 5 ng of human genomic DNA as template, 

and one negative template control (NTC) were prepared. 

1 U.S. Pat. 6,767,512. 

2 U.S. Pat. 6,667,165.


Gradient function: a highly useful tool for optimizing real-time PCR, cont’d. 


Well position 1 2 3 4 5 6 7 8 9 10 11 12 

Annealing 

temperature (°C): 

44.1 44.7 46.2 48.6 51.4 54.6 57.8 61.0 63.8 66.0 67.4 67.8 

Mean C t: 28.5 28.7 28.1 26.9 25.6 25.0 24.3 24.1 24.0 23.9 24.1 24.4 

Specific PCR product: - - (+) + + + + + + + + + 

Nonspecific 

PCR product: 

+ + + (+) - - - - - - - - 

‡ Table 1: Analysis parameters of the three replicates for each well position 

Results and conclusions 

At temperatures below an annealing temperature of 48.6 °C 

(column well positions 1–3) there are primarily nonspecific PCR 

products (Table 1, Fig. 3). Nonspecific products were produced in 

some NTCs (no template controls) at these temperatures as well. 

Therefore, when a double-stranded DNA-binding dye such as 

SYBR ® Green I is used for detection, it is important to check the 

products with a melting curve analysis following the last cycle of 

the PCR reaction (Fig. 3). 

The Ct values of the specific Beta globin PCR products vary from 

approx. 24 to 28 (Table 1, Fig. 2). This means that there is a Ct shift of approx. 4 PCR cycles from the most favorable annealing 

temperatures (column well positions 7–12) to the least favorable 

(column well position 3) annealing temperatures—a very significant 

determination that impacts the practice of real-time PCR. Note 

that Table 1 indicates the optimal annealing temperature in column 

10—and a 0.5 Ct shift over an ~2 °C change in temperature from 

column 10 to column 12. Thus, we see that the Ct values drop 

(improve) from columns 1 to 10 and then start to increase again 

from 10 to 12. 

This assay demonstrates the importance of gradient optimization 

of annealing temperatures to achieve reliable results across 

individual assays and experiments. The flexible gradient function 

of Mastercycler ep realplex is a time- and cost-saving feature, 

especially for introducing and establishing new real-time PCR 

reactions in the laboratory. 

‡ Fig. 2: Logarithmic-scaled amplification plots of the 

Beta globin assay 

The range of C t values correspond to a range in annealing 

temperature in a gradient optimization experiment. 

‡ Fig. 3: Peak curves (negative first derivative of the melting 

curves) of each of the three replicates from column positions 

3 and 8 



27 

Real-time PCR | The realplex advantage


28 



Impulse PCR: a novel, accelerated and improved qPCR Hot Start method 

An essential and critical goal during any PCR is to avoid nonspecific 

primer annealing during PCR setup and each successive cycle 

of PCR. Two key and unique features of realplex—SteadySlope ® 

gradient technology and Impulse PCR—make this goal easy 

to achieve. 

As discussed in the “Gradient function: a highly useful tool for 

optimizing real-time PCR” highlight on the previous pages, specific 

primer annealing is often highly sensitive for optimal temperature. In 

addition, a nonoptimal annealing temperature can have a negative 

impact on the C t values and the overall sensitivity of the assay. With 

the gradient function, optimization of a specific probe and/or primer 

pair’s ideal annealing temperature is easy and fast, and an optimized 

real-time PCR cycling program can be created in a short time. 

With a well-designed assay, once the optimal annealing 

temperature has been determined and adopted, the risk of 

nonspecific amplification after the first cycle is minimal. This is 

due to the fact that the temperature for specific annealing will not 

Temp. 

1 

‡ Fig. 1: A typical PCR cycling program 


2 

2 

Time 

The critical temperature range of initial ramping (circled), lower than 

the critical annealing temperature (Step 2), is where nonspecific 

amplification will most likely occur. 


fall below the critical temperature at which nonspecific annealing 

occurs. However, the first initial ramping step of a PCR carries a 

serious risk of nonspecific amplification—and, therefore, lowered 

specificity—for two reasons: (a) in the course of ramping from 

ambient to initial denaturation temperature, the sample heats across 

a range of temperatures—at first well below that of the optimal 

annealing temperature, and (b) any nonspecific product extended 

in that first ramping step will have the potential for amplification 

in each and every additional cycle. This subjects the assay to 

additional potential for nonspecific amplification to occur. 

To demonstrate the effects of nonspecific amplification: if 

one of several suboptimal events occurs—such as choice of 

wrong annealing temperature for the cycle programming, use of 

poorly designed primer pairs, or heating/cooling steps that are too 

lengthy—nonspecific annealing and subsequent amplification may 

be observed. Figure 2B demonstrates this nonspecific annealing 

and amplification effect. 

A B 

‡ Fig. 2: Polyacrylamide gel analysis 

A highly specific amplified PCR product (A) is compared to (B)— 

a similar gel image showing more than one specific band, which 

indicates nonspecific products.


Impulse PCR: a novel, accelerated and improved qPCR Hot Start method, cont’d. 

In real-time PCR assays for which SYBR ® Green I is the chosen 

fluorescent reporter molecule, nonspecific amplification may be 

indicated—not by additional bands, but by a higher-than-accurate 

level of total fluorescence in the sample. And higher fluorescence 

resulting from the presence of nonspecific product means that 

accurate quantification is no longer possible. A view of the melting 

curve plot of SYBR Green real-time PCR assays confirms the 

presence of nonspecific product through the appearance of more 

than one peak (Fig. 3), comparable to the single vs. multiple bands 

shown in Fig. 2 on the previous page. 

‡ Fig. 3: Melting curve analysis profile of the final melting 

curve step across a number of samples of a real-time PCR 

assay, each with SYBR Green I as the reporter dye 

Double-stranded DNA-binding dyes such as SYBR Green I bind 

to any double-stranded DNA molecule; therefore, it is important 

to design a highly specific assay that will eliminate the presence/ 

amplification of nonspecific product. 

Blue = Impulse PCR Red = Standard PCR 

100 

90 

80 

70 

60 

50 

40 

30 

20 

Time 


The Impulse PCR option of realplex S silver block models is 

an Eppendorf invention. Impulse PCR acts as a “device-driven 

Hot Start” to greatly increase the specificity of real-time PCR 

reactions and, thus, increase the dependability of SYBR Green 

dye experiments. 

The Impulse function targets the first initial ramping step of 

the real-time PCR program—identified earlier as a point of high 

risk for nonspecific amplification—by jump-starting the reaction 

with additional speed (up to 8 °C/s), thereby reaching the initial 

denaturation step much faster. The time for, and the possibility of, 

nonspecific annealing is minimized because samples spend very 

little time below their ideal programmed annealing temperature. 

‡ Fig. 4: Temperature ramping profiles of two experiments 

One uses Impulse PCR (in blue) and the other (in red) does not. 

The plot demonstrates time (x axis) versus temperature (y axis). 

This example shows that by selecting the Impulse PCR function, 

the sample reaches the initial denaturation temperature faster, 

which leads to a decrease in total run time and increased 

specificity—a device-driven Hot Start. 



29 



30 



High-speed, real-time PCR assay design for realplex silver block models 

Real-time PCR is an ideal application for the design and operation 

of high-speed PCR programs—providing results in minutes, rather 

than hours. Furthermore, in comparison to conventional PCR, 

complex post-PCR handling is no longer required, which reduces 

analysis time and further reduces overall time spent on each 

experiment. With Mastercycler ep realplex silver block models 

realplex 2 S and realplex 4 S, the already fast ramp rates of the 

aluminum block models increase from 4 ºC/3 ºC to 6 ºC/4.5 ºC 

(heating/cooling). Table 1 below lists a comparison of heating ramp 

rates among Mastercycler ep realplex and other real-time systems 

currently available. 

The key benefits of realplex’s silver block for ultra-high-speed 

real-time PCR are: 

‡ Visualize results in real time during a PCR run: at every cycle, the 

fluorescence of each sample chronologically appears and can be 

observed and analyzed—no more waiting for > 30 cycles, followed 

by post-PCR analysis! 

‡ Shorten total run times: because longer amplicons require 

longer extension/elongation dwell times, the total run time of 

PCR programs with shorter amplicons reap the greatest benefit 

from our ultra-high-speed ramping; and since amplicons under 

100 bp are optimal for real-time PCR applications, realplex S 

models, therefore, have a great impact on the reduction of total 

run time. 

Instrument Ramp rate—heating 

Mastercycler ep realplex S 6 °C/sec 

Mastercycler ep realplex 4 °C/sec 

Instrument M 3 °C/sec 

Instrument S 2.5 °C/sec 

Instrument A 1.6 °C/sec 

‡ Table 1: Ramp rates of several real-time PCR systems 



‡ Fast optical detection also reduces total run time: realplex optical 

detection requires only 8 seconds for 1 to 2 channels or up to 16 

seconds for 4 channels—across an entire plate in a single cycle. 

‡ Optimized plate design: to supplement realplex’s very fast 

ramping, Eppendorf ® twin.tec PCR plates facilitate high-speed 

temperature change by providing optimal heat transfer through 

their thin well walls. 

The amplification plots in Fig. 1 on the next page show a 

dramatic reduction of total run time and total reaction volume on 

the Mastercycler ep realplex real-time PCR systems, while offering 

outstanding reproducibility and peak performance. 

Would you base your life’s work on anything else? 

Keep in mind, the right chemistry also makes a difference: 

Hot Start polymerases that do not require lengthy activation 

steps of 10 minutes or more will not require any more time for 

initial denaturation than is needed by the template. Furthermore, 

the enzyme you choose must perform efficiently during 

short protocols.


High-speed, real-time PCR assay design for realplex silver block models, cont’d. 

A B 

Fig. 1 

Av.Ct 22.62 

St.dev. 0.05 

1 h 12 min 

C D 

Av.Ct 22.45 

St.dev. 0.10 

35 min 37 sec 

‡ Fig. 1: High-speed, real-time PCR using Mastercycler ep realplex 4 S 

Initial denaturation/ 

activation 

40 cycles 

Denaturation Annealing/extension 

95 °C 95 °C 60 °C 


High reproducibility is demonstrated with a minimum of 15 replicates of a SRY TaqMan ® assay across a variety of PCR protocols and a variety 

of total reaction volumes (as low as 10 µl) with low standard deviation. (A) through (D) show the effect of a stepwise time optimization (see 

Table 2 below) of PCR profiles and concomitant reduction of reaction volumes on total PCR run times and standard deviation—the reaction 

was reduced from 72 min down to 23 min 34 s. 

Total run time on a 

Mastercycler ep S realplex system 

A 2 min 15 s 60 s 72 min (50 µl reaction vol., tube control) 

B 2 min 10 s 20 s 42 min 02 s (20 µl reaction vol., tube control) 

C 20 s 3 s 20 s 35 min 37 s (20 µl reaction vol., tube control) 

D 20 s 3 s 17 s 23 min 34 s (10 µl reaction vol., block control) 

‡ Table 2: Optimization of the PCR profiles shown in Fig. 1 

Av.Ct 22.82 

St.dev. 0.08 

42 min 

Av.Ct 23.545 

St.dev. 0.08 

23 min 34 sec 



31 



32 




General recommendations for the optimization of high-speed, 

real-time PCR protocols 

Since the “early days” of real-time PCR, 90 minutes to 2 hours 

has generally been the standard total run time required for a single 

standard assay. Lately there has been a real push to optimize 

reactions towards high-speed, real-time PCR protocols for 

increased sample throughput—providing the opportunity for more 

researchers to perform many more types and quantities of assays 

on a single real-time PCR device. 

Until now, total reaction time for high-speed qPCR has typically 

been 40 minutes—a substantial time-savings when compared 

to standard assays. With the introduction of Mastercycler ep 

realplex S systems, we have further pushed the limits of speed 

and shortened real-time PCR reactions to just over 20 minutes! 

With real-time PCR this fast, many more labs will want to take 

high-speed assay optimization into serious consideration. 

Some general recommendations for the stepwise optimization 

of high-speed, real-time PCR are explained here and on the next 

page. By following Eppendorf’s general optimization tips and 

adopting the reliability and speed of Mastercycler ep realplex 2 S 

or realplex 4 S, you can routinely approach total run times of 24 

minutes or less. 

Forward/reverse 

primer concentration 

50 nM 


100 nM 

300 nM 


Step 1: Examine your target length 

Consistent with the design of most TaqMan ® assays, an amplifica- 

tion target should not exceed a length of 100 bp by much—due to 

the fact that a PCR program’s extension time can be significantly 

reduced for PCR targets of such short lengths. The target length of 

the PCR reaction from the amplification plots shown in Fig. 1 (page 

31) was 80 bp. 

Step 2: Optimize primer design 

Good primer design is an important variable for highly efficient 

and robust PCR. 

(a) The presence of self-complementary structures within the 

primer (and probe) flanking regions should be prevented to avoid 

nonspecific PCR products, resulting in loss of PCR efficiency and 

possible false-positive results (SYBR ® Green I). 

(b) It is helpful to design primers with a melting temperature (T m) 

of 60 °C or higher so that two-step PCR programs may be used 

(see step 5). 

Note: A useful and widely available tool for primer design that 

considers the above-mentioned general guidelines is Primer3- 

Software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) 

[Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW 

for general users and for biologist programers. Krawetz S, Misener 

S (eds) Bioinformatics Methods and Protocols: Methods in 

Molecular Biology. Humana Press, Totowa, NJ, pp 365-386]. 

600 nM 

900 nM 

50 nM 50/50 100/50 300/50 600/50 900/50 

100 nM 50/100 100/100 300/100 600/100 900/100 

300 nM 50/300 100/300 300/300 600/300 900/300 

600 nM 50/600 100/600 300/600 600/600 900/600 

900 nM 50/900 100/900 300/900 600/900 900/900 

‡ Table 3: A common primer-matrix for suggested optimization of forward and reverse primer combinations



Step 3: Gradient real-time PCR optimization 

A gradient PCR should be performed to find the optimal 

annealing/extension temperature for the primers. This step is easy, 

yet critically important for achieving the best primer performance in 

any PCR reaction. 

Note: Detailed instruction on the gradient function of realplex and 

its importance for real-time PCR optimization—including two-step 

protocols—appears on page 26. 

Step 4: Primer matrix optimization 

A primer-matrix that spans a range of common concentrations 

of the forward and reverse primer should be performed to find 

the optimal combination of concentrations for both primers. 

A commonly used primer-matrix is featured in Table 3 on the 

previous page. 

Note: To achieve the most reliable results, each combination should 

be performed with 3 replicates. 

Step 5: Design a two-step program for added speed 

A two-step PCR program with a combined annealing/extension 

step of 60 °C or higher can be easily optimized by activating 

realplex’s gradient option in the second cycle step. A two-step 

program enables you to achieve the fastest run times because 

it features fewer ramping steps than a conventional three-step 

protocol. 

(a) To begin optimization of a two-step protocol, it is good to start 

with a default program such as that listed in Fig. 1 and Table 2 on 

page 31. 


(b) Change the annealing/extension temperature to the optimal 

temperature as explained in Step 3. 

(c) Based on the length of the target amplicon for your assay (see 

Step 1 on the previous page), shorten the annealing/extension dwell 

time and test to confirm high performance. 

(d) Next, consider decreasing the cycle denaturation dwell time. 

As a general rule, if your template’s GC-content is < 50%, shorter 

times for denaturation should be sufficient. 

(e) Consider the gradient option to test a range of denaturation 

temperatures in the event that templates are GC-rich—because 

GC-rich templates may not amplify sufficiently at shorter 

denaturation dwell times. Again, choose your denaturation dwell 

time and perform an assay test to confirm good performance. 

(f) Decrease your total reaction volume. Lower volumes require less 

time to heat and, therefore, less overall time to amplify. Perform a 

melting curve analysis to confirm high specificity. 

Note: If working with volumes of 10 µl or higher, “Simulate tube” 

mode in your program Header may be required. Block mode is 

faster and works well with low-volume samples (10 µl). 

(g) Shorten your initial denaturation. If GC-content is < 50% and 

your mastermix polymerase enables short activation times, follow 

this guide’s recommendations for a short initial denaturation. 



33 



34 



Benefits of realplex’s homogeneity and accuracy on reproducibility in real-time qPCR 

A key contributor to reproducible real-time PCR is the accuracy 

and uniformity of temperatures across a range of samples. Ideally, 

thermal block-based qPCR systems must demonstrate an even 

temperature profile across the entire block, with identical heating 

and cooling speeds and dwell temperatures in every position. 

Without this high degree of temperature control, edge effects 

may occur, reflecting a loss of temperature to the environment 

at the outer edges of the block. 

Addressing this challenge—and increasing the reproducibility of 

real-time PCR assays across a 96-well plate—is Eppendorf’s Triple 

Circuit Technology. This unique arrangement of multiple Peltier 

elements into three defined temperature control regions provides 

the following key benefits: (a) more linear gradient testing of optimal 

annealing temperature or two-step PCR optimization, translating to 

more distinct temperatures tested in a single experiment, and (b) a 

higher degree of temperature control around the outer regions of 

the block, thus decreasing edge effects and allowing the effective 

use of all wells in a 96-well plate with high reproducibility. 

Mastercycler Triple Circuit Technology benefits 

‡ Ensures precise control of 

the temperature gradient 

‡ Enhances linearity of 

the gradient 

‡ The thermal block is controlled by three separate 

temperature control circuits 


‡ Reduces temperature 

loss in the peripheral areas 

during uniform (nongradient) 

temperature mode 

Optical design 

9000 

8000 

7000 

6000 

5000 

4000 

3000 

Fluorescence (norm) 10000 

2000 

1000 

0 

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 

Cycle 

Threshold: 186 (Noiseband) 


An additional requisite of reproducible real-time PCR is the design 

of a uniform light source for even well-to-well excitation—in other 

words, the excitation source should show the same intensity in 

every position. To this end, realplex features a 96-LED array for 

excitation, and the intensity of each LED is normalized to a mean 

value. Thus, each sample receives the same light intensity, and 

every well has a direct light source—with stray light minimized. 

This is in stark contrast to halogen-based lamps that decrease in 

intensity over their lifespan and, thus, may negatively impact results 

over time. 

‡ Fig. 1: Inside view of the realplex’s 

heated lid and 96-LED array 

Critical impact 

realplex’s combined optical and temperature control features 

provide uniform temperature and light signals for all positions in a 

plate-based qPCR assay. The following amplification plot (Fig. 2) 

shows convincing results: 96 samples with perfect replicate results, 

an excellent foundation for the success of any real-time PCR 

application or assay. 

‡ Fig. 2: Mastercycler ep realplex’s block and optical 

Baseline settings: automatic, Drift correction OFF 

homogeneity provide high reproducibility across 96 replicates


ARTS 

35

Applications | ARTS 

36 

Application notes 

Eppendorf offers more: application support 

Both automation and real-time PCR applications 

vary in their scope and complexity. This section 

includes application notes related to PCR/qPCR 

that highlight the Mastercycler ® ep realplex and 

epMotion ® systems—demonstrating their superior 

performance as stand-alone devices as well as the 

great benefits of using them together. More application 

notes are available to view and download at our special 

ARTS Website, www.eppendorfna.com/arts. 


Real-time PCR with Mastercycler® ep realplex 

Mastercycler ep realplex—a flexible device for fast and accurate real-time PCR 

Beate Riekens and Andrés Jarrin, Eppendorf AG, Hamburg; Richard Black, Eppendorf North America 

Introduction 

Real-time PCR has become one of the most popular tools in 

molecular biology research. It allows precise quantitative and 

qualitative detection of nucleic acids, and it is used in a variety 

of applications such as gene expression analysis and genotyping. 

In addition to fluorochrome-coupled hybridization probes, 

intercalating dyes are used for the monitoring of DNA amplification. 

Newer developments in real-time PCR devices and reagent 

technology concentrate primarily on shortening run times and 

improving sensitivity and reproducibility. With Mastercycler ep 

realplex, Eppendorf introduces a flexible, reliable and exceptionally 

high-speed real-time PCR instrument. The device is of modular 

design—consisting of a compact thermoblock and an optical 

detection unit that features an LED optics array and the latest 

in photo-multiplier technology. The realplex 2 module detects 

fluorochromes within a range of 520 to 550 nm, while the realplex 4 

device has additional filters, paired with a second channel photo- 

multiplier, to detect additional emission wavelengths of 580 to 

605 nm. The signal recording times for all 96 samples range from 

8 seconds for two channels to a maximum of 16 seconds for all 

four detection channels. The optical units can be combined with 

either a standard 96-well aluminum thermoblock or the highspeed 

(6 °C/s) 96-well silver block. Both thermoblocks1 have a 

temperature gradient option for easier and faster optimization of 

assays. Depending upon application requirements, Mastercycler ep 

realplex can thus be configured to function as a standard device for 

two-fold multiplexing, or, in its most advanced configuration, as a 

“high-speed” system for fast real-time PCR analyses with up to four 

detection channels. 

In addition to the technical features of the instrument, reagent 

chemistry significantly impacts the results and protocols of a 

real-time PCR assay. Eppendorf RealMasterMix series reagents 

are based on the innovative HotMaster ® technology2 —they 

utilize a temperature-dependent inhibitory ligand of Taq DNA 

polymerase to ensure the Hot Start function. While Taq activity 

is blocked at lower temperatures, enzyme activity is immediately 

restored when a temperature of 60 °C is exceeded. Therefore, in 

contrast to conventional real-time PCR reagents, RealMasterMix 

Probe (for use with probe-based assays) and RealMasterMix (for 

SYBR ® Green assays and single-plex probe formats) do not require 

traditional, lengthy activation steps. Regardless of the reagent 

chemistries used, Mastercycler ep realplex’s combined benefit of 

high-temperature control speed and brief signal recording time 

enables total run times that were never before possible with Peltier 

element-based real-time PCR devices. The performance of 

Mastercycler ep realplex, using RealMasterMix reagents, is 

documented in this article. Experimental data is presented to 

highlight reproducibility, linear detection range, sensitivity, 

specificity, multiplexing capability and speed. 


Materials and methods 

All experiments were conducted on a Mastercycler ep 

realplex4 S with a silver block. For SYBR Green I assays, 

Eppendorf RealMasterMix was used; for TaqMan ® assays, 

RealMasterMix Probe was used. All reactions were set up on 

an Eppendorf epMotion ® 5070 automated pipetting system and 

dispensed into Eppendorf ® twin.tec 96 skirted PCR plates. The 

plates were then sealed with Eppendorf Heat Sealing Film, using 

an Eppendorf Heat Sealer. 

Reproducibility 

An 80 bp target sequence of the human sex-related Y chromosome 

gene (SRY) was quantitated in a uniformity experiment to determine 

the reproducibility of a SYBR Green I assay across all positions of 

the thermoblock. 100,000 copies of a plasmid target that contains 

the SRY amplicon were used in 50 µl total reaction volumes. 

A mastermix of all reaction components was prepared and 

distributed with the 8-channel dispensing tool of the epMotion 

5070 into a twin.tec 96 PCR plate. The PCR run profile A was 

used (see Table 2 on page 40). 

Following the PCR, a melting curve analysis was performed to test 

the specificity of the amplification. 

1 U.S. Pat. 6,767,512 

2 U.S. Pat. 6,667,165 

‡ Fig. 1: Mastercycler ep realplex 



37 

ARTS | Applications


38 



Mastercycler ep realplex—a flexible device for fast and accurate real-time PCR, cont’d. 

Target sequence Primer/probe sequence TM (°C) Final concentration Amplicon size 

Lambda genome Forward primer: caggaactgaagaatgccagaga 63.0 TaqMan ® : 300 nM 104 bp 

Sex-related 

Y chromosome 

(SRY) gene 

‡ Table 1: Primer and probes 

Dynamic detection range 

With the help of the epMotion ® 5070, a Lambda DNA dilution series 

of 10 8 to 10 0 copies/µl was produced. 10 µl of each dilution was 

used as template DNA in a Lambda-specific TaqMan assay (see 

Table 1). To test comparability of the results of two detection 

channels, a FAM- and a Yakima Yellow (YY)-labeled probe of the 

same sequence were used in parallel experiments. The run profile 

B was used (see Table 2 on page 40). 

‡ Fig. 2: Reproducibility across 96 replicates 

Reverse primer: ccgtcgagaatactggcaattt 62.5 

Probes: 

FAM-tgtactttcgtgctgtcgcggatcg-TAMRA 

YY-tgtactttcgtgctgtcgcggatcg-BHQ1 

(A): Logarithmically scaled amplification plots of 96 replicates of the SRY target amplified using Eppendorf RealMasterMix in the SYBR 

format; with a mean C t value of 18.99, the standard deviation was 0.07. (B): Melting curve analysis of the 96 replicates shows no primer- 

dimers or nonspecific products. Comparable results were obtained with 20 µl of reaction volumes (not shown). 


72.8 TaqMan single-plex: 200 nM 

Forward primer: gcgacccatgaacgcatt 63.0 SYBR ® Green: 300 nM 

Reverse primer: agtttcgcattctgggattctct 62.6 

TaqMan single-plex: 900 nM 

TaqMan duplex: 300 nM 

Probes: 

FAM-tggtctcgcgatcagaggcgc-TAMRA 

YY-tggtctcgcgatcagaggcgc-BHQ1 

72.4 TaqMan single-plex: 300 nM 

TaqMan duplex: 200 nM 

GAPDH gene Forward primer: tgccttcttgcctcttgtct 60.1 TaqMan duplex: 300 nM 

Reverse primer: ggctcaccatgtagcactca 59.9 

Probe: FAM-tttggtcgtattgggcgcctgg-BHQ1 71.8 TaqMan duplex: 200 nM 

A B 

Differentiation of two-fold concentration differences 

A TaqMan assay for the human SRY gene was selected to detect 

two-fold concentration differences of template DNA copy numbers. 

Starting from a stock solution of human genomic DNA (200 ng/µl, 

corresponding to 33,333 copies/µl), samples of 2,000, 1,000, 500 

and 250 copies, respectively, were produced. For each dilution a 

mastermix with 6 replicates was prepared. The run profile B was 

used (see Table 2 on page 40). 

80 bp 

146 bp



A B 

‡ Fig. 3: Dynamic range in the 520 nm and 550 nm detection channel 


Within a range from 10 9 to 10 1 template molecules, Lambda DNA can be reliably detected in a TaqMan ® assay. Using RealMasterMix Probe, 

both a FAM-labeled probe [detection channel 520 nm (A)] and a Yakima Yellow-labeled probe [detection channel 550 nm (B)] demonstrate 

PCR efficiencies of 97% and 96% at a correlation coefficient of 0.999. 

‡ Fig. 4: Two-fold concentration changes 

A SRY-specific TaqMan assay shows that Mastercycler ep 

realplex can differentiate two-fold copy number differences with 

high precision. The C t differences between two-fold differential 

dilutions in a range between 2,000 and 250 copies correspond 

almost exactly to one cycle that mirrors the two-fold differences 

on copy numbers. 

‡ Fig. 5: Single-molecule DNA detection 

Out of 50 replicates of the SRY-specific TaqMan assay, 

each statistically calculated to contain a single template DNA 

molecule, 28 exceeded threshold while 22 behaved in accordance 

with the negative controls. The positive samples, with a mean value 

of 37.03, had minimum and maximum values of 35.89 and 38.07, 

respectively. Mastercycler ep realplex in combination with 

RealMasterMix Probe thus reliably detected single-target 

DNA molecules. 



39 



40 




Standard PCR profile 

Two-step PCR 

Conventional qPCR instrument 

+ conventional reagents 

50 µl reaction volume 

PCR profile A 

Two-step PCR 

Mastercycler ep realplex S + 

RealMasterMix Probe 

Tube control 


PCR profile B 

Fast two-step PCR 



Tube control 


PCR profile C 




Tube control 


PCR profile D 




Block control 


‡ Table 2: PCR profiles 

Single-molecule DNA detection 

Initial 

denaturation/ 

activation 

The SRY gene is present as a single copy on the male Y chromo- 

some. A dilution of male human genomic DNA containing 600 fg 

DNA/µl was prepared, which corresponds to one copy per 10 µl. 

A SRY-specific TaqMan ® assay was developed with the goal of 

single-copy detection. As a result of the statistical dispersal of 

molecules per volume unit, some reactions contained several 

copies each while others contained no target molecules. A 

mastermix of 50 replicates, each with 10 µl of template DNA per 

reaction, was prepared, and run profile B was used (see Table 2). 

Denaturation Annealing/ 

extension 


Cycles Total run time 

10 min 15 s 60 s 40 1 h 38 min 

2 min 15 s 60 s 40 1 h 12 min 

2 min 10 s 20 s 40 42 min 02 s 

20 s 3 s 20 s 40 35 min 37 s 

20 s 3 s 17 s 40 23 min 34 s 

High-speed PCR protocols 

The SRY TaqMan assay was selected to test the influence of PCR 

run profiles and reaction volumes on the results. A mastermix with 

1,000 copies of human gDNA/µl was used (for run profiles see 

Table 2). At least 15 replicates were prepared. An identical assay 

that uses a traditional two-step PCR profile was run in parallel on a 

competitor instrument (data not shown).



A B 

Av.Ct 22.62 

St.dev. 0.05 

1 h 12 min 

50 µl 

C D 

Av.Ct 22.45 

St.dev. 0.10 

32 min 

20 µl 

‡ Fig 6: High-speed PCR profiles 


(A) to (D) show the effect of a stepwise time optimization of PCR profiles and concomitant reduction of reaction volumes on total PCR 

run times as well as standard deviation of a SRY TaqMan ® assay. Please note that due to the different reaction volumes and fluorescent 

intensities generated, C t values cannot be directly compared. 

Multiplexing 

The human SRY (single copy) and GAPDH (two copies per genome) 

genes were chosen to demonstrate the multiplexing capability of 

Mastercycler ep realplex. In a duplex TaqMan assay a YY/BHQ1- 

labeled TaqMan probe for the SRY gene and a FAM/BHQ1-labeled 

probe for GAPDH gene were used. 10,000 copies of male genomic 

DNA per 20 µl reaction were used as template DNA. For primer 

and probe concentrations see Table 1 on page 38; the run profile 

B was used (see Table 2 on the previous page). 

A comparison of the Eppendorf real-time PCR system (Mastercycler 

ep realplex and RealMasterMix reagents) with a competitor-based 

system that uses a conventional device and reagent technology 

shows that considerably shorter run times can be obtained with 

the Eppendorf system—even when traditional PCR profiles are 

maintained (Table 2 and Fig. 6A). When the PCR profiles are more 

Av.Ct 22.82 

St.dev. 0.08 

42 min 

20 µl 

Av.Ct 23.54 

St.dev. 0.08 

23 min 

10 µl 

closely adapted to the properties of the Eppendorf system (fast 

heating/cooling rates, brief signal recording times, no enzyme 

activation times), a run time of less than 45 minutes for 40 cycles 

can be achieved (Fig. 6B). When further optimization of the 

temperature holding times is carried out, run times of slightly more 

than 35 minutes with comparable C t values and deviations are 

possible (Fig. 6C). 

Combined with a reduced reaction volume (5 µl is achievable 

with an automated pipetting system), real-time PCR assays in 

the 96-well format with total run times under 24 minutes can be 

achieved (Fig. 6D). If established PCR systems require slow heating 

and cooling rates, the speed of Mastercycler ep realplex can be 

finely regulated as well as emulate the temperature control behavior 

of other devices. 



41 



42 




‡ Fig. 7: Multiplexing of SRY and GAPDH targets 

A duplex TaqMan ® assay for the SRY (single copy, YY Probe) and GAPDH (two copies, FAM probe) targets from human genomic DNA in 

12 replicates is shown. As seen in Fig. 3, the YY signal was detected in the 550 nm channel using VIC dye calibration data. The “all dyes” 

view of the realplex software reveals the shifted pattern of the GAPDH and SRY amplification plots and corresponding C t values. Reflecting 

the gene dosage ratios of both genomic targets, these data document that Mastercycler ep realplex can reliably differentiate fluorescence 

signals in multiplex applications, even with targets that show only minimal differences in abundance. 

Conclusion 

Mastercycler ep realplex is a real-time PCR instrument that, due 

to its flexible modular design, can be adjusted to the specific 

requirements of the user. Its high-quality construction and stable, 

user-friendly software form a reliable real-time PCR platform 

that ensures a high degree of accuracy across all sample 

positions—and within a wide detection range. Adoption of the silver 

block significantly speeds up run times while still maintaining the 

instrument’s high degree of accuracy. 


Optimizing qPCR with small reaction volumes 


Successful qPCR with small reaction volumes on Eppendorf Mastercycler ® ep realplex 

Cynthia Potter, Eppendorf UK Limited; Arun Kumar, Ph.D., Eppendorf North America 

Abstract 

Recent technological developments in the field of qPCR enable 

short run times and improved reproducibility. The objective of this 

study was to assess the reproducibility of qPCR data with 5 µl 

reaction volumes on Eppendorf Mastercycler ep realplex. 

Introduction 

Methodologies in genomics are expensive, and there is a critical 

need to lower costs by minimizing reagent use. One of the major 

cost components of the qPCR technique is reagent cost, including 

a mastermix that contains dNTPs, PCR enzymes (Taq), Mg 2+ and 

stabilizers. A second costly component is the template: the DNA 

or RNA is often in short supply and/or expensive as well as time- 

consuming to extract and purify; a 25 µl reaction volume would be 

prohibitive in this case. Another challenge of qPCR is to minimize 

the assay variability. Bustin [1] has demonstrated significant 

user pipetting variability, providing reasons for the use of automated 

liquid handling stations in achieving greater assay reproducibility. 

The solution to keeping reagent costs down is to lower reaction 

volume while maintaining the same ratios of reaction components. 

However, many problems can arise in low-volume reactions, 

which can then lead to PCR efficiency plummeting to unacceptable 

levels for quantification. Perhaps the most significant problem with 

small reaction volumes is evaporation off the walls of the wells— 

the reagents are pulled out of the reaction, leaving variable 

concentrations of all reactants. To control volume variation 

due to pipetting error, ROX normalization is sometimes used. 

However, concentration of key reactants—rather than volume— 

remains a challenge in terms of reproducibility, because variability 

of evaporation in low-volume reactions cannot be controlled and 

evaporation levels are not reproducible. Controls such as ROX 

cannot normalize for this. Additionally, on instruments that perform 

qPCR in 1.5 to 2 hours, this evaporation cannot be completely 

eliminated. The amount of heat being applied is too great for 

excessive periods of time; therefore, it is imperative that run 

times are short when using low-volume reactions. 

Eppendorf recently introduced the Mastercycler ep realplex line of 

quantitative real-time PCR instruments to the research community. 

In this article, data is presented that demonstrate robust quantitative 

PCR of three mouse genes and Lambda DNA, using SYBR ® Green I 

and TaqMan ® , in a total reaction volume of 5 µl. 

Eppendorf epMotion ® 5070, an automated pipetting system, has 

been used in academic and pharmaceutical research communities 

for small-volume assay setup to increase throughput and achieve 

significant cost reduction. The use of a liquid handling workstation 

also addresses the human error in reaction assembly, ensuring 

assay accuracy and reproducibility. 

This article will show that by combining assay setup with an 

automated pipetting system and a sensitive and fast real-time PCR 

instrument, qPCR reactions in the 5 µl range are easily achieved. In 

addition, the PCR efficiencies and correlation coefficients are nearly 

identical to reactions performed at higher volumes. 



43 



44 



Successful qPCR with small reaction volumes on Eppendorf Mastercycler ® ep realplex, cont’d. 

Methods 

Quantitative real-time PCR experiments 

All experiments were run on an Eppendorf Mastercycler ep 

realplex 4 S with a silver block. A mastermix containing Eppendorf 

RealMasterMix*, SYBR ® Green I assays and primers was prepared 

(to amplify and detect Beta actin) as well as two proprietary target 

genes for mouse and a 104 bp sequence of Lambda DNA. A 

mastermix containing Eppendorf RealMasterMix Probe ROX, primers 

and Cal FLUOR Gold 540/Black Hole Quencher-1 probe 

(Biosearch Technologies) was prepared for Lambda. All reactions 

were set up on the Eppendorf epMotion ® 5070 and dispensed into 

Eppendorf ® twin.tec 96-well skirted PCR plates. The plates were 

then sealed with Eppendorf Heat Sealing Film, using an Eppendorf 

Heat Sealer. For comparison, parallel reactions were assembled 

with 20 µl reaction volumes. 

Assay setup — SYBR Green I assays 

Each qPCR reaction was run in triplicate. A three-fold dilution series 

was prepared down to ~142.5 copies of the human genes studied. 

A two-step protocol (denature/cycling) was followed that consisted of 

initial denaturation of 2 min, followed by 2 s secondary denaturing 

at 95 ºC and annealing/extension at ~60 ºC (depending on gradient 

optimization for each amplicon), cycled 40 times. 

*U.S. Pat. 6,667,165 

1000 

Fluorescence (norm) 

100 

10 

1 

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 

Cycle 

Threshold: 393 (Adjusted manually) 


40 

Ct[Cycle] 

35 

30 

25 

20 

15 

Slope: -3.552 

Y-Intercept: 37.89 

Efficiency: 0.91 

R^2: 0.998 


10 1000 1.0E+05 1.0E+07 

Amount[Copies] 

‡ Fig. 1: TaqMan ® assay with CAL FLUOR Gold 540 

Top: Reproducibility with 5 µl total reaction volume per well. 

Amplification plot (log view) of 104 bp amplicon for Lambda DNA 

target. A 10-fold dilution series of Lambda DNA (Promega ® ) was 

prepared as above and amplified with Eppendorf RealMasterMix 

Probe. Forward and reverse primers were used at 400 nM each, 

while CFG540/BHQ-1 was used at 400 nM, 50 cycles, 43 min. 



Bottom: Standard curve generated with data from 

above TaqMan assay 

Results: Slope=–3.552, Y-Intercept=37.89, Efficiency=0.91, 

R2 =0.998

10000 


1000 

100 

10 

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 

Cycle 



35 

Ct[Cycle] 

30 

25 

20 

15 

10 

5.0 

Slope: -3.591 



R^2: 1.000 



10 1000 1.0E+05 


1.0E+07 

‡ Fig. 2: SYBR ® Green I assay 


Amplification plot (log view) of 104 bp amplicon for Lambda DNA 

target. A 10-fold dilution series of Lambda DNA (Promega ® ) was 

prepared as above and amplified with Eppendorf RealMasterMix 

with SYBR Green I. Forward and reverse primers were used at 

400 nM each, 50 cycles, 43 min. 

Threshold: 2,334 (Noiseband) 



above SYBR Green assay 


R 2 =1.000 

TaqMan ® assay with CAL FLUOR Gold 540 

The following amplifications were performed from a 10-fold 

dilution series prepared from Lambda DNA (Promega) at a range 

from 1.42 x 10 7 copies down to 142.5 copies. A two-step protocol 

(denature/extension) was followed that consisted of initial denaturation 

of 2 min, followed by 2 s secondary denaturing at 95 °C and 

annealing/extension at 60 °C. 

1000 


100 

10 


1 

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 

Cycle 


Baseline settings: automatic, Drift correction ON 

Ct[Cycle] 

34 

32 

30 

28 

26 

24 

22 

20 

Slope: -3.309 



R^2: 0.994 

10 1000 


‡ Fig. 3: SYBR Green I assay 


Amplification plot of 69 bp G4 (proprietary) target in triplicate. A 

three-fold dilution series of mouse genomic DNA (Promega) was 

prepared and amplified with Eppendorf RealMasterMix with SYBR 

Green I. Forward and reverse primers were used at 300 nM each, 

45 cycles, 41 min. 






R 2 =0.994 

Results 

The TaqMan assay was linear over 6 orders of magnitude in a 5 µl 

reaction setup. In the SYBR Green I assay, there was amplification in 

the “no template” controls representing primer-dimer (melting curve 

not shown). SYBR Green I cannot reliably quantify at the singlecopy 

level due to the inherent background of this assay; however, 

7 logs of quantification were achieved—down to ~14 copies. 



45 



46 


10000 


1000 

100 

10 

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 

Cycle 



34 

Ct[Cycle] 

32 

30 

28 

26 

24 

22 

20 

Slope: -3.207 



R^2: 0.996 



10 1000 


‡ Fig. 4: SYBR ® Green I assay 


Amplification plot of 71 bp G1 (proprietary) target in triplicate. A 

three-fold dilution series of mouse genomic DNA (Promega ® ) was 

prepared and amplified with Eppendorf RealMasterMix with SYBR 

Green I. Forward and reverse primers were used at 300 nM each, 

45 cycles, 41 min. 

Threshold: 1,568 (adjusted manually) 





R 2 =0.996 

Conclusions 

Highly reproducible results were obtained with a small (5 µl) 

reaction volume (Figs. 1–4); and nearly identical PCR efficiencies 

and correlation coefficients were obtained with 5 µl reaction 

volumes as compared with 20 µl reaction volumes (not shown). 

Working with low volumes presents challenges due to evaporation, 

but these challenges are overcome by using a fast (silver) block, 

which can easily run 40 cycles in 25 minutes. These initial runs 

were ~40 min for 45–50 cycles. 

Mastercycler ep realplex achieves uniform heating across the block 

through its Triple Circuit Technology, which features six Peltier 

elements to ensure this precise temperature control. In addition, 

the 96-LED array excitation source is positioned above the block 

so that each well is maximally and uniformly excited. Other cyclers 

that utilize bulbs as a light source above the plate and in the middle 

exhibit edge effects with 25 µl reactions; these edge effects may be 

exacerbated when dropping to small volumes, which, consequently, 

may not achieve the same level of uniformity required for success 

when using low-volume reactions. To ensure that all photons are 

captured, realplex’s 96 fiber-optic cables effectively capture the 

emission from each well and pass it into channel photo-multiplier 

tubes. To date, these are the most sensitive detectors available. 

We believe the combination of optical sensitivity, excitation and 

emission—plus the uniformity of heating—are responsible for the 

reproducible qPCR reactions at low volumes on the Mastercycler 

ep realplex. In addition, short run times also resolve the issue of 

sample evaporation from the wells. 

The ease of use for reaction setup with the epMotion ® 5070 

workstation and the advanced features of Mastercycler ep 

realplex enable reaction volumes to be scaled down to 5 µl. This 

is an 80% reduction in volume—when compared with the typical 

25 µl reaction volume—and represents substantial reagent 

cost-savings. 


There is a clear advantage to saving reagent cost when working 

in high-throughput gene expression analysis. Saving time is also 

advantageous, and the speed of the realplex silver block allows the 

completion of a 40-cycle qPCR reaction in as little as 23 minutes. 

The combination of the epMotion 5070 and Mastercycler ep 

realplex provides these time- and cost-savings. 

Reference 

[1] Bustin SA. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and 

problems. J. Endocrinology. 2002;29:23-39. 

*U.S. Pat. 6,667,165.

epMotion® for accurate and precise automatic pipetting 

Accuracy and precision of the epMotion system 

Rafal Grzeskowiak, Eppendorf AG, Hamburg; Rainer Oltmanns, Eppendorf Instrumente GmbH, Hamburg 

Introduction 

With the advent of the human genome era, the molecular biology 

laboratory has transformed from a small enterprise into a semi- 

industrial, highly parallel environment; one where large numbers 

of samples are analyzed and terabytes of data are processed. 

The ever-growing number of identified transcripts, genes, proteins 

and single-nucleotide polymorphisms (SNPs) have created great 

demand for high-density formats that require a dexterity of handling 

far beyond the limitations of manually operated tools. With the goal 

of minimizing errors, high-density multiwell plates require more 

accurate tools for manipulation and liquid handling. In addition, 

there is a strong need for reproducible results with sensitive assays 

such as genotyping, gene expression quantification or large scale 

sequencing. 

Robotic stations have enabled highly repetitive pipetting in dense 

grids, and they are preferred when the emphasis is on speed, 

accuracy and minimized risk of contamination. Keeping these 

requirements in mind, Eppendorf has come up with an innovative 

solution for liquid handling and sample preparation. 

Dispensing 

tool 

‡ Table 1: Accuracy and precision data for the epMotion 5070 

and 5075 dispensing tools 

The data for the border volumes of the respective single-channel 

tools (TS) is presented. 

Range Volume Accuracy Precision 

TS 30 1–50 µl 1 µl ± 10% < 5% 

50 µl ± 0.8% < 0.4% 

TS 300 20–300 µl 20 µl ± 4% < 3% 

300 µl ± 0.6% < 0.3% 

TS 1000 40–1,000 µl 40 µl ± 3% < 2% 

1,000 µl ± 0.6% < 0.2% 


The pipetting heads of epMotion—“dispensing tools” as we 

call them—employ the same technology Eppendorf has been 

successfully using for decades in their pipettes: the air-cushion, 

piston-stroke system with disposable, high-precision tips. This 

particular approach makes both the exchange of dispensing tools 

easy, and, more importantly, it assures that the liquid handling is 

completely free of contamination (using noncontact “free-jet” 

dispensing). It also enables pipetting to be performed in a wide 

range of volumes (1 ml down to 1 µl) with high precision and 

accuracy (Table 1). 

This study takes a look at this approach and demonstrates that 

the epMotion’s free-jet dispensing with its precision tips provides 

accurate and precise liquid handling down to 1 µl. 

A B C 

‡ Fig.1: Explanation of the accuracy and precision terms 

Nominal volume of 2 µl is dispensed (blue points) by exemplary tool 

with: (A) high precision and high accuracy, (B) high precision and 

low accuracy (far from the nominal 2 µl), (C) low precision and low 

accuracy (dispersed and far from the nominal 2 µl). 



47 



48 


epMotion® for accurate and precise automatic pipetting 

Accuracy and precision of the epMotion system, cont’d. 

‡ Fig. 2: Accuracy and precision of the epMotion singlechannel 

50 µl tools 

Forty tools from different production lots were tested 

gravimetrically. Each point represents the mean value of 10 

single-measured values for the given tool (in µl), and the error 

bars represent their precision. Border values for accuracy (± 10%) 

are indicated. Mean value is 1.025 µl. 82% of the tools have an 

accuracy of ± 5%. 


Forty single-channel 50 µl dispensing tools (TS 50) were chosen 

at random from different production lots and tested gravimetrically 

(which provides the most exact and direct measure of precision and 

accuracy) as follows: 

The tools were set to deliver the 1 µl nominal volume, and the weight 

of the free-jet dispensed droplets was measured on a high-end 

precision scale in a strict, environmentally-controlled and ISO- 

certified laboratory. The results are summarized in Fig. 2. 

The official limit of accuracy for the TS 50 is ± 10%, meaning that 

no tool can dispense more than 1.1 µl and no less than 0.9 µl when 

set to the 1 µl nominal volume. All forty tools had much closer 

nominal volume with the mean value of 1.025 µl (± 3%)! A closer 

look at the data reveals that more than 80% of the tools have actual 

accuracy limits of 5%. This means that when set to 1 µl, a tool 

would actually vary ± 0.05 µl (a droplet of 0.2 mm in diameter!). 

And this accuracy is very precise—considerably higher than 

certified imprecision of < 5%. The forty tools tested here could 

pipette 1 µl with a mean precision of 3%; this translates to the 

average absolute variance for the 40 TS 50 tools to be between 

1.055 µl and 0.995 µl (mean accuracy: 1.025 µl ± 3%). 


‡ Fig. 3: A FAM channel for direct detection of the HBVspecific 

PCR product in human serum samples 

Note the high reproducibility of the sample replicates and their 

consistency with the quantification standards (QS). No contamination 

was present. NTC=no template control. 

The best proof comes from actual experiments. Eppendorf 

epMotion 5070 was used to set up very sensitive real-time qPCR 

reactions. In the given example (Fig. 3), the viral load of the HBV in 

human serum samples was quantified. The highly consistent and 

reproducible amplification plot of fluorescent intensity has been 

routinely obtained with much higher reproducibility than with hand 

pipetting. 

Conclusion 

Apart from highly reliable data, the performance of epMotion allows 

researchers to reduce the number of sample repetitions, reaction 

volume and, ultimately, reagent usage—a factor with significant 

importance for expensive, probe-based RT-qPCR systems. And if 

high throughput means many samples—speed is required, but not 

at the cost of reproducibility and precision: 

“Fast is fine, but accuracy is everything!” 

—Wyatt Earp, legendary gunslinger

Contamination-free automated pipetting with epMotion® 

Contamination test for epMotion 5070 and 5075 automated pipetting systems 

Renate Fröndt, Eppendorf AG, Hamburg 

Introduction 

Strictly speaking, the term contamination includes both true 

contamination and carryover. Carryover is defined as an earlier 

sample A interfering with a later sample B. Carryover can therefore 

occur only from A to B, seen only in the transport of liquids, and 

it may consequently affect all parts that come in contact with this 

exchange of liquids. Carryover may be limited to just a single part 

of an analytical device, or it might affect all parts of a flow system. 

In contrast to carryover, true contamination is due to external 

materials entering the sample (splashes of liquid, solid particles and 

gases). In the process of contamination, sample A may be affected 

by sample B and sample B may be affected by sample A. 

A variety of qualitative and quantitative methods can be used to 

determine the degree of contamination. A well-known qualitative 

procedure in molecular biology involves pipetting PCR reagents into 

a 96-well or 384-well plate in a chessboard pattern, where adjacent 

wells receive only water with no sample material (DNA). Once a 

PCR reaction and subsequent gel electrophoresis are completed, 

an assessment is made as to whether or not contamination from 

one well to another has occurred. 

A quantitative procedure involves pipetting demineralized water 

and lithium chloride solution (using a saturated lithium chloride 

solution) in a chessboard pattern into a 96-well or 384-well plate, 

followed by flame photometry to assay for lithium. This procedure is 

an accepted method, and it is used, for example, for quality control 

testing of pipette tips. It allows a quantitative statement regarding 

possible contamination levels to be made, since its detection limit 

is as low as 0.1 nl (= 6.1 ng of Li). According to Specker and Kaiser 

[1], the detection limit of the measurement of the Li emission by 

flame photometry is 1 ng Li/ml (= 1 ppb Li). A very stable signal is 

attained from approx. 5 ng Li/ml and higher. Unlike sodium and 

potassium, which are detectable at similar concentrations, this 

level can hardly be expected as a coincidental contamination. 

Consequently, one can be fairly certain that Li signals in the wells 

that are designated to contain only water are due to a satellite 

drop—arising when the Li solution is dispensed or transported 

to the other wells. 

To be able to methodically estimate any contamination during 

pipetting steps, the lithium chloride procedure described above 

has been used. This method is less susceptible to interference 

than the biological procedure underlying a PCR reaction. A 

multitude of interfering factors, ranging from contaminated 

samples or reagents to erroneous cyclers, etc., can substantially 

interfere with a PCR reaction. The same interference is not 

encountered in lithium chloride pipetting, so it therefore does 

not falsify the results obtained. 



The described method refers to the contamination tests using PCR 

plates and epMotion 5070/5075. 

In order to test for the possibility of contamination in the case 

of glycerol-containing solutions, it is recommended to select the 

nearly saturated LiCl solution (375 g LiCl/l) as the stock solution. 

This corresponds to a Li content of 61 mg/ml (equivalent to 

61,000,000 ng Li/ml = 61 ng Li/nl). At a density of approx. 

1.2 g/ml, the nearly saturated LiCl solution shows similar pipetting 

behavior as a 40–60% glycerol solution. In contrast, if the test 

involves the dosing of a rather aqueous medium, the stock solution 

mentioned above is to be diluted 1 + 9-fold and used in the form 

of the 1:10 dilution. This corresponds to 6,100,000 ng Li/ml 

(= 6.1 ng Li/nl). Demineralized water is used as the diluent. 

To test for contamination using the epMotion 5070 or 5075, a 384well 

PCR plate and dispensing tool TS 50-1 or TM 50-8 and their 

corresponding 50 µl epTIPS are used. Either of the two methods, 

Li384_1 and Li384_8, is employed in the procedure. Both methods 

are stored in the folder of the ep-node, “Routine,” in the form of 

preprogrammed methods. 

‡ Fig. 1: Deck setup (epMotion Editor screenshot) 

Pos. A1: 50 µl tips 

Pos. B1: 7 x 30 ml reservoirs in tub holder 

Pos. B2: 384-well Eppendorf ® twin.tec PCR plate 

W=Waste container 



49 



50 


Contamination-free automated pipetting with epMotion® 

Contamination test for epMotion 5070 and 5075 automated pipetting systems, cont’d. 

‡ Fig. 2: 384-well Eppendorf ® twin.tec PCR plate filled in a 

chessboard pattern 

Each well then receives 30 µl of demineralized water, and 

subsequently, in a chessboard pattern every other well 

receives 4 µl of water or 4 µl of lithium solution. 

Since the test well received 30 µl of demineralized water and the 

measurement at the ELEX requires a liquid volume of at least 1 ml, 

the contamination test drop has a measured volume of 1,030 µl. 

If a drop with a volume of 0.1 nl (= 6.1 ng Li) of the stock solution 

described above enters the well containing 30 µl of water (and, 

subsequently, is present in the 1,030 µl measured volume), the 

flame photometry measurement would generate a stable signal that 

corresponds to approx. 6 ng Li/ml. Using the diluted stock solution 

(1 + 9), contamination of the well with approx. 0.2 nl (= 1.2 ng Li) 

would generate a signal just above the detection limit. 

Eppendorf ® ELEX 6361 Flame Photometer measuring parameters: 

For the Li assay, the zero point of the flame photometer was 

determined using demineralized water. Solutions containing 100, 

250, and 500 ng Li/ml were used as the standards. The solution 

containing 500 ng Li/ml was used for signal amplification (standard 

high). Acetylene was used as the combustible gas. The standard 

671 nm Li filter was used. Solutions containing 0, 2, 5 and 10 ng 

Li/ml were used as controls. The Eppendorf Flame Photometer 

ELEX 6361 was employed in this test; alternatively, the Li assay 

can be performed using a similarly sensitive AAS or ICP apparatus. 


‡ Fig. 3: Amplification of the human Beta globin gene across 

one fourth of a 384-well PCR plate [2] 

Flame photometers for Li assays in clinical chemistry for the 

so-called “Lithium drug monitoring” are not suitable for this 

contamination test. 

Results 

In total 2 out of 384 wells produced signals of up to 2 ng Li/ml 

(2 ppb). This corresponds to a contamination level of approx. 30 pl 

for the corresponding well and represents 0.52% of all wells. 

The satellite drops of this size do not produce interference at a level 

that can be detected in a PCR reaction. This is evident since a PCR 

reaction was tested in parallel using the same dosing parameters. 

The gel electrophoretic analysis showed no contamination signals, 

(Fig. 3). 

We conclude, therefore, the described method is more sensitive 

than PCR, and we provide evidence for virtually contamination-free 

pipetting using the epMotion 5070/5075 systems. 

Literature 

[1] Specker H, Kaiser H. “Zeitschrift für Analytische Chemie” Vol. 149; 1956 

[2] Frank Apostel, Eppendorf BioNews 20

Automated PCR setup with epMotion® 

epMotion automates PCR setup in the 384-well format without cross-contamination 

Frank Apostel, Eppendorf AG, Hamburg 

Introduction 

The development of the polymerase chain reaction (PCR) by Kary 

Mullis 20 years ago has revolutionized many fields of science and 

medicine [1]. Since that time, new applications for DNA amplification 

are being continuously developed. A recent example is its use in 

the detection of severe acute respiratory syndrome (SARS), where 

PCR has made it possible to detect the corona virus pathogen 

agent with absolute certainty [2]. 

The highly sensitive nature of PCR is also a cause for concern, 

since it exacts certain demands on the methodology and 

technique. Because it is possible to detect 10–100 DNA molecules, 

PCR is subject to contamination by exogenous DNA—and for this 

reason, often-overlooked precautions should be considered when 

performing PCR. For example: designating pre- and post-PCR 

areas would minimize the risk of contamination; in addition, the 

use of filter tips for all liquid handling steps would address the issue 

of aerosol contamination; finally, the use of positive and negative 

controls aids in troubleshooting a PCR. The pre-PCR area requires 

particular care when preparing samples: cautious handling of the 

DNA and consumables is a must—to prevent the risk of false- 

positive results. 

Proper liquid handling also plays a key role in sample preparation: 

the parallel processing of PCR reactions in the 96- and 384-well 

format, as well as the miniaturization of the reaction volumes, make 

it extremely difficult to manually dispense liquids into the wells of the 

PCR plates precisely and accurately; the distance between the wells 

of a 384-well plate is only 4.5 mm, which places great demands 

upon the dexterity of the person carrying out the experiment. 

Automating these steps makes it possible to reliably carry out a 

large number of reactions with small sample volumes—with total 

accuracy and precision. 

This article outlines the workflow for easily assembling 

contamination-free PCR reactions in the 384-well format using 

the epMotion 5070 automated pipetting workstation. In addition, 

it demonstrates that the use of automated sample preparation 

is of particular help in avoiding errors that commonly plague 

miniaturized, parallel analysis systems. 

Experimental setup 


The following items were placed on the workstation deck: 

50 µl filtertips (50 µl epTIPS Motion, Filter), the Thermorack for 

1.5 ml Eppendorf ® Safe-Lock tubes and the 384-well PCR plate 

(Eppendorf ® twin.tec PCR Plate 384 was used) on top of the 

epMotion Thermoblock (Fig. 1). Eppendorf HotMasterMix, 

which contains a Hot Start enzyme, 1 was used in these reactions; 

therefore, it was not necessary to refrigerate the reagents and 

the PCR plate. The Thermoblock for the plate facilitated the sealing 

of the plate with the Eppendorf Heat Sealer. 

The Thermorack for 1.5 ml Eppendorf Safe-Lock tubes was loaded 

with the following reagents: 

‡ Human genomic DNA (5 ng/µl) 

‡ Molecular biology pure water 

(Eppendorf ® Molecular Biology Grade Water) 

‡ Primer mix (1 µM each) 

‡ 2.5x Eppendorf HotMasterMix 

All dispensing steps were carried out with the epMotion single- 

channel dispensing tool TS 50, as single tubes were used for 

the reagents. 

All liquid levels of the reagents were determined—without 

contacting the liquids—via epMotion’s Optical Sensor. 2 The sensor 

also checked the labware, the number of tips and the type of 

tip rack. 

1 U.S. Pat. 6,667,164 

2 U.S. Pat. 6,819,437 

‡ Fig. 1: Deck setup (screenshot from epMotion 5070 

PC Editor) 

Pos. A1: 50 µl filtertips 

Pos. B1: Thermorack for 24 x 1.5 ml Eppendorf Safe-Lock tubes 

Pos. B2: Eppendorf twin.tec 384-well PCR Plate on Thermoblock 

W=Waste container 



51 



52 



epMotion automates PCR setup in the 384-well format without cross-contamination, cont’d. 

‡ Fig. 2: Automated PCR setup protocol (screenshot from 

epMotion 5070 PC Editor) 

Only eight complex commands are required for the procedure. 

epMotion 5070 prepared a total of 96 PCR reactions in a 384-well 

twin.tec PCR plate. A 535 bp fragment of the human Beta globin 

gene was detected. 

For this purpose, 5 µl primer mix (at a final concentration of 

0.2 µM for each primer) that consisted of sense (5´-GGT TGG CCA 

ATC TAC TCC CAG G-3´) and antisense (5´-GCT CAC TCA GTG 

TGG CAA AG-3´) primer (TIB MOLBIOL, Berlin, Germany) from 

the human Beta globin gene, was dispensed into each well in the 

first step. 

10 µl 2.5x HotMasterMix (Eppendorf) was subsequently added 

to each reaction preparation. The 25 µl reaction preparation was 

completed with either human genomic DNA (final concentration: 

2 ng/µl; Roche ® , Pleasanton, CA, USA) or with molecular biology- 

pure water (Eppendorf ® ) as a negative control. The method is 

shown in Fig. 2. 

‡ Fig. 3: Pipetting scheme 


A total of 96 PCR preparations were pipetted into the 384-well 

twin.tec PCR Plate, whereby 48 preparations (positions in blue) 

contained human genomic DNA. The other half served as a 

negative control containing the complete reaction preparation, 

but without DNA. 

The reagents were added in alternating wells of the PCR plate, 

forming a chessboard pattern (Fig. 3). 

Following the liquid handling, the PCR plate was sealed with Peel- 

it-lite Heat Sealing Foil (Eppendorf), and the reaction was amplified 

in an Eppendorf Mastercycler ® ep as follows: 

94°C 2 min Initial denaturing 

30 cycles: 94°C 30 s Denaturing 

60°C 30 s Annealing 

65°C 30 s Extension 

The samples were subsequently analyzed by agarose gel 

electrophoresis.


epMotion automates PCR setup in the 384-well format without cross-contamination, cont’d. 


M 1 2 3 4 5 6 7 8 9 10 11 12 M 1 2 3 4 5 6 7 8 9 10 11 12 

+ – + – + – + – + – + – 

‡ Fig. 4: Amplification of the 535 bp fragment of the human 

Beta globin gene 

M: DNA marker (100 bp ladder) 

12 reaction products from row E of the PCR plate were analyzed in 

a 1% agarose gel 

(+)=with human DNA; (-)=without human DNA 

Results and discussion 

Figure 4 shows amplification of the 535 bp fragment of the human 

Beta globin gene from human DNA. No nonspecific PCR products 

were detected. The fragment of the Beta globin gene was detected 

in all positive reaction preparations (those with added human 

gDNA). The experiment demonstrates that no PCR product was 

detected in any of the 48 accompanying negative controls (Fig. 5). 

These results can be attributed directly to the use of epMotion’s 

exchangeable tips and its completely novel dispensing technique 

called “free-jet” dispensing. The continued development of the air- 

cushion principle for pipettes—developed by Eppendorf 45 years 

ago—enables contact-free, and thus contamination-free, precise 

dispensing of liquids at volumes down to one microliter. Free-jet 

dispensing also makes an additional mixing step unnecessary, 

saving time and pipette tips. 

A 

B 

C 

D 

E 

F 

G 

H 

‡ Fig. 5: Agarose gel of 96 PCR reactions 

A 535 bp fragment of the human Beta globin gene was amplified on 

a quarter of a 384-well PCR plate. For purposes of better illustration, 

the gel photos of the individual rows (A-H) of the PCR plate were 

cut out and compiled according to the pattern in Fig. 3. 

Given the results, the conclusion can be made that the sample 

preparation of highly parallel and miniaturized analysis systems, 

such as PCR in the 384-well format, can be carried out without 

detectable cross-contamination using the compact and flexible 

epMotion 5070 automated pipetting system. It ensures reliability 

and error-free execution of routine laboratory procedures. For 

anyone working with a multiwell plate format, automated pipetting 

is an important advancement for ensuring sample quality and 

improved data/results. 

References 

[1] Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA. Science. 

1988;239:87-491. 

[2] Drosten C, Preiser W, Gunther S, Schmitz H, Doerr HW. Trends Mol Med. 2003;9:325-327. 

1 U.S. Pat. 6,667,165. 

2 U.S. Pat. 6,819,437. 



53 



54 


Additional application notes on the Web 

Visit www.eppendorfna.com/arts regularly to find and download additional 

Automation and Real-time PCR application notes. Below is a sampling of what 

you can find on our automated pipetting systems. The site is continually updated 

as new applications are added, so be sure to check back frequently! 

epMotion ® 5070 

High-throughput, fully automated real-time PCR diagnostics of HBV 

and salmonella 

PCR product purification using the Eppendorf epMotion 5070 liquid 

handling workstation together with the Eppendorf Perfectprep ® 

PCR Cleanup 96 kit 

Minimization of remaining volumes in plates and tubes 

Facilitating PCR setup via an automated liquid handling system 

Loading the Invitrogen ® E-Gels with the epMotion 5070 

epMotion 5075 


Automated isolation of plant genomic DNA using ChargeSwitch 

technology 

Reproducible and easy automated purification of plant 

genomic DNA 

Isolation of high-quality plasmid DNA using the Perfectprep Plasmid 

96 VAC Direct Bind kit on the epMotion 5075 VAC workstation 

Isolation of high-quality BAC DNA using the Perfectprep BAC 96 kit 

on the epMotion 5075 VAC workstation 

Purification of PCR products using the Perfectprep PCR Cleanup 

96 kit on the epMotion 5075 VAC workstation 

Guideline for processing the RNeasy ® 96 BioRobot ® 8000 kit on the 

epMotion 5075 VAC workstation 

Guidelines for processing the QIAamp ® DNA Blood BioRobot MDx 

kit on the epMotion 5075 VAC workstation 

High-throughput RNA preparation using the QIAGEN ® RNeasy 96 

BioRobot 8000 kit on the workstation epMotion 5075

Picture: Model of a Taq DNA polymerase with a DNA strand. Image made with Molsoft ® -ICM. www.molsoft.com 

Appendix 

ARTS 

55

TOC | Appendix 

56 

Info 

Appendix Table of Contents 

Eppendorf ARTS is dedicated to helping you perform successful 

real-time PCR experiments. This section covers qPCR basics and 

the various detection chemistries used, and we include a list of 

relevant Websites where you can get more information about 

qPCR and/or designing optimized qPCR primers. 

Description Page 

Definitions, concepts and overview of real-time quantitative PCR principles 57 

Background information 57 

Advantages of qPCR over traditional endpoint PCR 58 

Detection chemistries 58 

Double-stranded DNA-binding dyes 58 

Probe-base chemistries 59 

Methods of real-time PCR quantification 60 

Absolute quantification (standard curve method) 60 

Relative quantification (comparative C t method) 60 

Methods of primer and probe validation 61 

Optimization of forward and reverse primer concentrations 61 

Primer and probe validation: general strategy for new qPCR assay development 61 

References, resources and useful Websites 62 

Calculating primer quantity 63 

Abbreviations, symbols and conversion factors 64 

Genetic code and properties 66 


Definitions, concepts and overview of real-time quantitative PCR principles 

What is real-time quantitative PCR? 

Real-time quantitative PCR, or “qPCR,” is a technique that reaches 

far beyond the limitations of standard PCR. It provides a unique, 

multidimensional perspective of a gene’s presence, its function— 

even its regulation—in a concrete, quantifiable manner. 

What are its applications/uses? 

The applications of real-time PCR technology are a testament to 

its wide range of influence, and they include the analysis of gene 

expression and gene regulation, determinations of the effects of 

variations in genetic composition, and the identification and 

quantification of microorganisms and viruses, among others. 

PCR can be used to estimate the amount of a particular target 

DNA or RNA in a sample relative to either a standard or another 

sample that has been subjected to some treatment or time 

progression—but it has very limited value as a quantitative 

tool. Real-time PCR expands the utility of PCR for quantitation 

through the incorporation of a fluorescent reporter molecule—or 

molecules—to each assay. Fluorescent intensity, which increases 

proportionally with each DNA molecule amplified, is measured 

during each cycle of PCR and plotted over time. As there is a direct 

correlation between the amount of PCR product in each cycle and 

the progression of a fluorescence amplification curve, an analysis 

of this curve enables calculation of the original starting quantity of 

target DNA or RNA. 

Background information 

Quantitative PCR is the most rapid and sensitive quantitative 

method for target RNA or DNA, combining the extraordinary 

sensitivity of the PCR process with highly sensitive optical 

detection technology. The fluorescence generated by a sample 

of DNA or RNA during real-time PCR is plotted over time or, 

rather, PCR cycle number. The middle of its curve represents 

the exponential phase of PCR—when the levels of generated 

fluorescence exceed background fluorescence, but reagents 

have not nearly begun to reach limiting factors. 

Each sample or reaction is assigned a specific value in real-time 

PCR, referred to as cycle threshold (C t)—the point or cycle number 

at which the fluorescence curve for that sample exceeds back- 

ground fluorescence and measurements become meaningful. 

Samples with the highest starting target amount will also have the 

highest values of amplified target in a given PCR cycle number. 

This means their fluorescence curves will exceed background 

earlier and cross the threshold at an earlier cycle number; thus, the 

more abundant the starting quantity of template or target, the lower 

the C t value of that sample. 

There are certain assumptions that are made about the sample 

C t value and initial target amount: early on in a PCR reaction and 

into the exponential phase, there is a doubling of fluorescence 

from one cycle to the next that is directly proportional to the 

doubling of amplicons; therefore, when a sample provides 

known values—a C t value (cycle number to reach threshold) and 

a fluorescence value—starting sample quantity can be calculated 

from the knowledge that at each earlier cycle number, exactly half 

the quantity of target was present. 

Due to the exponential nature of PCR amplification, we can 

extrapolate that in the event there are 80 copies of a gene present 

during cycle number 4: cycle number 3 had 40 copies, cycle 

number 2 had 20 copies and cycle number 1 had 10; and at 

time-point zero, we began with just 5 copies in the sample— 

an exceptionally sensitive measurement of a gene’s quantity. 

The plateau stage of any real-time PCR curve represents the 

endpoint of that reaction—the point at which there is significant 

depletion of one or more reaction components. At the plateau 

stage the amplification curves of real-time PCR are no longer 

exponential, which means that the association of a two-fold 

increase in quantity from one cycle number to the next has come 

to an end. For this reason, real-time PCR is not concerned with 

plateau endpoints (Fig. 1). 

‡ Fig. 1: PCR—kinetic vs. endpoint detection 


Info 

A plot of the quantity of amplicon DNA over time; in real-time PCR 

we are only concerned with amplification during the exponential 

phase of amplification, as accurate quantification of DNA is not 

possible at the plateau. 


57 

Appendix | Real-time qPCR

Real-time qPCR | Appendix 

58 

Info 

Definitions, concepts and overview of real-time quantitative PCR principles 

Advantages of qPCR over traditional endpoint PCR 

In addition to the capacity for highly sensitive detection, real- 

time PCR can provide quantitative data across a wide dynamic 

range—on Mastercycler ® ep realplex, detection from single 

molecules to up to 10 9 molecules of the same target sequence is 

possible in a single experiment. Furthermore, there is no additional 

handling required for these samples—and no time or money is 

wasted on gel analysis with an end result that is semiquantitative, 

at best. Adding to its convenience and speed, amplification and 

detection occur simultaneously, making qPCR technology a highly 

efficient alternative. 

Detection chemistries 

Real-time PCR detection can be performed with one of many 

available fluorescent reporters, including sequence-specific, 

dual-labeled probes such as TaqMan ® , molecular beacons, 

hybridization or locked nucleic acid (LNA) probes. Alternatively, 

free dyes that bind to double-stranded DNA (dsDNA), such as 

SYBR ® Green I, can also be used. 

Double-stranded DNA-binding dyes 

DNA-binding dyes like SYBR Green I are a relatively convenient 

and inexpensive option for real-time PCR chemistries, as they 

are simply added to a PCR reaction mix—no sequence-specific, 

synthetic oligonucleotides other than primers need to be prepared. 

Free in solution, DNA-binding dyes exhibit low levels of background 

fluorescence until they find their primary match; when they bind 

to the minor groove of their double-stranded DNA target, these 

dyes increase 10- to 20-fold in fluorescence. Real-time PCR 

takes advantage of this dye property, detecting double the dye 

fluorescence with each successive cycle in the exponential 

phase of amplification. 

These double-stranded DNA-binding dyes are not discriminatory 

fluorophores, which means they will bind to any nonspecific 

product that is present in the reaction. For this reason, a useful tool 

called a “melting curve” is added following the last PCR program 

step of a SYBR assay. The melting curve command directs the 

thermal block of the real-time device to slowly and gradually ramp 

temperature upward to 95 ºC, taking fluorescent measurements 

across time and temperature. Because DNA hybrids melt, or 

“denature,” at varying temperatures based on both varying 

sequence and length of product—and because a release in SYBR 

Green fluorescence corresponds to the exact point/temperature 

at which a distinct hybrid population’s strands separate, or “melt”— 

a real-time melting curve shows distinct drops in fluorescence at 

each amplicon population’s melting temperatures (Fig. 2). In the 

event that a single, nonspecific hybrid population such as a primerdimer 

forms during a reaction, two distinct drops in fluorescence 


Unlike the “endpoint measurement” of PCR products, real-time 

PCR also provides immediate information about the kinetics of the 

PCR while the fluorescence is plotted out, one cycle to the next, 

in “real-time.” 

Good experimental design can further enable researchers to 

acquire a wealth of additional information—down to a detailed 

assessment of amplification efficiencies—from one sample to the 

next. Clearly, adding fluorescence and a highly sensitive optical 

detection device to PCR opens a world of new possibilities. 

at different temperature points of a melting curve analysis can 

easily confirm this event. A single, distinct drop in fluorescence at 

a single temperature, on the other hand, indicates a homogenous 

population of highly specific amplified products. 

The DNA-binding dye’s ability to bind with any double-stranded 

DNA may be interpreted as a disadvantage of lower specificity; 

but alternatively, this presents an advantage—you can distinguish 

between two hybrid populations with small mutational differences 

through the companion tool of melting curves. 

This lack of discrimination by DNA-binding dyes is actually a true 

advantage in laboratories that wish to look at many different gene 

sequences on a routine basis—no oligo design beyond that of the 

primer is required, and the cost is much less; only primer annealing 

needs to be optimized, making it not only a cost-effective chemistry 

for real-time PCR, but also a flexible and highly convenient one. 

‡ Fig. 2: Melting curve analysis 

Raw data shows a dramatic drop in fluorescence when DNA is 

melted (denatured); the fact that the drop is seen in several samples 

at the same time indicates the presence of a single product, i.e., a 

highly specific reaction.

Detection chemistries 

Probe-based chemistries 

Hydrolysis probes, commonly called TaqMan ® probes, are 

so-named because they enlist the 5'-endonuclease activity of 

Taq polymerase to cleave a reporter dye from their 5'-probe- 

terminus. This is significant due to the design of a TaqMan probe, 

which not only contains a fluorescent dye terminus but also a 

quencher dye at its 3' end. When free in solution or bound to a 

complementary sequence of template, each probe molecule’s 

quencher disables the nearby reporter dye’s ability to emit 

detectable fluorescence. This interaction is termed fluorescence 

resonance energy transfer, or “FRET,” because reporter 

fluorescence is absorbed by a quencher. 

TaqMan probes hybridize in the region between the primers so 

that Taq polymerase can activate the reporter during the elongation 

step of a PCR. As it extends one complement strand, Taq 5'-3'- 

exonuclease activity releases exactly one reporter dye molecule 

that freely emits fluorescence without FRET absorption. Thus, the 

correlation between one detected reporter molecule and one new 

PCR product is made. 

Pros 

‡ High specificity 

‡ Duplexing and multiplexing 

are possible—different reporter 

dyes can be selected for 

different target sequences, 

thus enabling multiple probes 

to seek and amplify multiple 

targets in a single tube 

Cons 

‡ Require optimization of 

probe sequence 

‡ Short amplicons, 

less sensitive to sample 

degradation—e.g., formalin 


Info 

fixed and embedded material 

‡ Added cost of probe in 

addition to primers 

Double-stranded DNA-binding dyes, such as SYBR Green, are 

an often-used format for optimizing TaqMan assays, as they allow 

primers to be optimized before the addition of a probe. 

Dye Excitation maximum (nm) Emission maximum (nm) 

FAM 494 518 

TET 521 538 

JOE 520 548 

VIC 538 552 

Yakima Yellow 526 552 

HEX 535 553 

NED 546 575 

Cy ® 3 552 570 

TAMRA 560 582 

ROX 587 607 

‡ Table 1: Table of dyes frequently used with Mastercycler ® ep realplex systems, and their approximate excitation and emission 

curve peaks 

This added specificity comes at a cost—to both the price of probe 

synthesis and the time required for the design and optimization 

of a specific probe sequence. These chemistries are, therefore, 

preferred when a large number of assays are required for a 

single, specific target. The advantages and disadvantages are 

summarized below. 


59 



60 

Info 

Methods of real-time PCR quantification 

Two primary methods of quantification are routinely used with qPCR technology: absolute and relative quantification. 

Absolute quantification 

Absolute quantification is an analysis method to accurately quantify 

the exact amount of initial target template in a sample. It does this 

through the inclusion of a standard curve. By offering correlations 

between known starting quantities and C t values, an unknown 

sample’s C t value may be correlated to an associated initial 

template quantity (Fig. 3). 

This method is measured in units of gene copy number (or pico- 

grams or nanograms of DNA) as compared to relative quantification 

and its ratio value of one target amount compared to another. 

Absolute quantification assumes that all standards and samples 

have equal amplification efficiencies. As a result, this approach can 

pose two key challenges: (1) You must ensure that the amplification 

efficiencies of the knowns and unknowns are nearly equivalent, and 

(2) the concentration of the serial dilutions should be within 

the range of the unknown(s). 

The optimization of appropriate controls for reliable absolute 

quantification is no small task, and in the event RNA is the 

initial template it must take into account efficiencies of reverse 

transcription as well. 

‡ Fig. 3: Absolute quantification 

A set of known standards is run in a qPCR reaction, and the C ts are 

plotted against the known quantities of starting materials; once the 

unknown’s C t value is obtained and compared, this graph can then 

be used to determine its starting quantity. 

Relative quantification 


Relative quantification compares the C t value of one target gene 

to another—for example, an internal control or reference gene 

(sometimes called a “housekeeping gene”)—in a single sample. 

When RNA is the template, this provides some normalization 

effects against variables such as RNA integrity and reverse 

transcription efficiencies. 

In addition to establishing the comparison of a gene of interest 

(GOI) to an internal control or reference for that single sample, the 

relative quantification method also compares a GOI to the control/ 

reference gene for some other control sample, called a “calibrator” 

(∆∆C t method). The resulting unit of measure is an X-fold change 

in gene expression levels; and due to the inherent normalization 

of the ∆∆C t method, variations in PCR efficiency are somewhat 

accounted for between samples, which makes it a reliable tool 

for gene expression analysis (Fig. 4). 

‡ Fig. 4: Relative quantification 

This method compares the differences in expression between a 

GOI and a housekeeping gene of a calibrator control; the ∆∆C t 

value shown represents an X-fold change in gene expression.

Methods of primer and probe validation 

It is essential to validate both the primers and probe. For TaqMan ® 

probe-based systems, the general rule states that amplicons of 

< 150 base pairs (ideally < 100) with a primer melting temperature 

(Tm) of ~60 °C and a probe Tm between 68 °C and 70 °C should be 

universally acceptable. The idea is to have the probe anneal first and 

saturate all targets before the primers bind and start to extend—this 

ensures that all nascent DNA will be quantified. 

Probes should not contain multiple repeats, and they should avoid 

high “G” nucleotide content. Guanine should likewise be excluded 

from the 5'-probe terminus, as it has been shown that guanosine 

quenches an adjacent fluorophore. Finally, the 3' end of forward 

primer should be, optimally, 5 bases from the 5' end of the probe 

(within 10 bases is acceptable). Several quencher dyes exist to pair 

with reporter dyes. 

Primer optimization may be done with conventional PCR for those 

new to real-time PCR, and results may be analyzed on an agarose 

gel or non-denaturing polyacrylamide gel (polyacrylamide is more 

sensitive in picking up primer-dimers). The criteria for good primer 

performance are as follows: 

1. No primer-dimers in the negative controls. 

2. Little or no mispriming that would result in mismatched 

amplicons—the Impulse PCR function of Mastercycler ® ep 

realplex’s silver block is a useful feature that avoids these effects 

(more on Impulse PCR in the PCR product highlights section of 

this catalog, page 28). 

Optimization of forward and reverse primer concentrations 

It is difficult to design a primer pair with identical melting 

temperatures, even though theoretical values may match. 

Adjustments to either the annealing temperature or Mg2+ concentration will have a limited affect on improving the 

performance of Tm-disassociated primers. If primer pairs fail to 

meet the criteria for good performance, a primer matrix across 

a span of concentrations may be tested (see “High-speed, realtime 

PCR assay design for realplex silver block models” in the 

PCR product highlights section of this catalog, page 30). 


Info 

Primer and probe validation: general strategy for new 

qPCR assay development 

Every assay needs to be reoptimized when subject to any new 

condition or variable. Recommended optimization includes the 

quantification of standard curve series with high-qualified primers 

so that PCR efficiency and sensitivity may be easily measured. 

SYBR Green ® I is a flexible and inexpensive option for the 

determination of primer quality across a range of tested annealing 

temperatures. Mastercycler ep realplex’s gradient option* eases this 

optimization effort (see “Gradient function: a highly useful tool for 

optimizing real-time PCR” in the PCR product highlights section of 

this catalog, page 26). 

The issue of specificity is answered by the implementation of a 

SYBR melting curve analysis, which provides an additional, valuable 

perspective in the primer and basic assay optimization effort (Fig. 5). 

*U.S. Pat. 6,767,512 

90 

80 

70 

60 

50 

40 

30 

- dI / dT (%) 100 

20 

10 

0 

-10 

6263 

64 6566 

6768 

6970 

7172 

7374 

7576 

7778 

7980 

8182 

8384 

8586 

8788 

8990 

9192 

9394 

95 

Temperature [°C] 

Threshold: ‡ Fig. 33% 5: Melting curve analysis 

Note that in this negative (inverted) first derivative the inflection 

point consists of a single peak, indicating a highly specific 

PCR reaction. 


61 



62 

Info 

References 

1. Hartling I, Weisner RJ. Quantitation of transcript-to-transcript 

ratios as a measure of gene expression using RT-PCR. 

BioTechniques. 1997;23:450-455. 

2. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. 

Continuous fluorescence monitoring of rapid cycle DNA 

amplification. BioTechniques. 1997;22:130-138. 

3. Rire KM, Rasmussen RP, Wittwer CT. Product differentiation 

by analysis of DNA melting curves during the polymerase chain 

reaction. Anal. Biochem. 1997;245:154-160. 

Resources and useful Websites 

Oligonucleotide and assay design resources 

Gene Quantification Web page, edited by Michael W. Pfaffl, 

contains a host of information relating to qPCR: 

http://www.gene-quantification.info/ 

TATAA Biocenter: http://www.tataa.com 

GeNorm: http://medgen.ugent.be/~jvdesomp/genorm 

Primer 3 Homepage: 

http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi 

Primer quest Homepage: http://biotools.idtdna.com/Primerquest/ 

Zucker Mfold: www.bioinfo.rpi.edu/~zukerm/ 

IDT Oligoanalyzer: 

http://biotools.idtdna.com/Analyzer/oligocalc.asp 

OLIGO Primer Analysis Software: http://www.oligo.net/ 

Premier Biosoft Beacon Designer: 

http://www.premierbiosoft.com/molecular_beacons/ 


4. Gibson UE, Heid CA, Williams PM. A novel method for real time 

quantitative RT-PCR. Genome Res. 1996;6:995-1001. 

5. Tichopad A, Dilger M, Schwartz G, Pfaffl MW. Standardized 

determination of real-time PCR efficiency from a single reaction 

set-up. Nucleic Acids Res. 2003;31:122. 

6. Marion JH, Cook P, Miller KS. Accurate and statistically verified 

quantification of relative mRNA abundances using SYBR Green I 

and real time RT-PCR. J. Immunol. Methods 2003;283:291-306. 

Real-time PCR primer and probe databases 

http://medgen.ugent.be/rtprimerdb/ 

The Primer Bank database, hosted by Harvard University, 

contains user-submitted primer sequences for several mouse 

and human genes: 

http://pga.mgh.harvard.edu/primerbank/index.html 

The Quantitative PCR Primer Database (QPD), maintained by the 

National Cancer Institute, contains primer and probe sequences for 

mouse and human genes collected from articles cited in PubMed: 

http://web.ncifcrf.gov/rtp/gel/primerdb 

Discussion groups 

qPCR list server: http://groups.yahoo.com/group/qpcrlistserver/

Calculating primer quantity 

Conversion to absolute quantity (in pmol) 

Primer in pmol = 

Example: 0.1 µg of 20 oligomer: 

0.1 x 1,000,000 

20 x 327 

Weight in µg x 1,000,000 

Length x 327 

= 15.3 pmol primer 

Calculating the molar concentration of the primer 

Micromolar concentration of primer = pmol/µl 

Example 1 Example 2 

20 pmol of primer in 100 µl PCR mixture = 0.20 micromolar (µM) Primer is 24 nucleotides in length and dissolved in 0.1 ml of water 

A 10 µl aliquot is diluted to 1.0 ml for A 260 measurement: A 260 = 0.76. 

The stock solution has an absorbance at 260 nm (A 260) of 76. 

The stock solution (0.1 ml) contains 2.6 A 260 units. 

The base composition of the primer is: 

A = 6 

C = 6 

G = 6 

T = 6 

The Molar extinction coefficient at 260 nm for the primer = k (15,200) + l (12,010) + m (7,050) + n (8,400) where: 

k = number of A’s 

m = number of G’s 

l = number of C’s 

n = number of T’s 

The Molar extinction of the PCR primer = 6 (15,200) + 6 (12,010) + 6 (7,050) + 6 (8,400) = 255,960 e 

The Molar concentration of the PCR primer stock solution is 

Conversion to weight (in µg) 

Weight in µg = 

Example: 10 pmol of 25 oligomer: 

10 x 25 x 327 

76 

255,960 

1,000,000 

= 297 micromolar 

pmol x Length x 327 

1,000,000 

= 0.081 µg primer 


Info 


63 

Appendix | Practical information

Practical information | Appendix 

64 

Info 

Abbreviations, symbols and conversion factors 

Metric prefixes 

E = exa = 10 18 

P = peta = 10 15 

T = tera = 10 12 

G = giga = 10 9 

M = mega = 10 6 

k = kilo = 10 3 

h = hecto = 10 2 

da = deca = 10 1 

d = deci = 10 -1 

c = centi = 10 -2 

m = milli = 10 -3 

µ = micro = 10 -6 

n = nano = 10 -9 

p = pico = 10 -12 

f = femto = 10 -15 

a = atto = 10 -18 

z = zepto = 10 -21 

Tris-HCl buffer, pH values 

Nucleic acid conversions 

Conversion of weight to absolute quantity (mol) 

1 µg of 1,000 bp DNA = 1.52 pmol = 9.1 x 10 11 molecules 

1 µg of pUC18/19 DNA (2,686 bp) = 0.57 pmol = 3.4 x 10 11 molecules 

1 µg of pBR322 DNA (4,361 bp) = 0.35 pmol = 2.1 x 10 11 molecules 

1 µg of M13mp18/19 DNA (7,250 bp) = 0.21 pmol = 1.3 x 10 11 molecules 

1 µg of l-DNA (48,502 bp) = 0.03 pmol = 1.8 x 10 10 molecules 

Conversion of absolute quantity (mol) to weight 

1 pmol of 1,000 bp DNA = 0.66 µg 

1 pmol of pUC18/19 DNA (2,686 bp) = 1.77 µg 

1 pmol of pBR322 DNA (4,361 bp) = 2.88 µg 

1 pmol of M13mp18/19 DNA (7,250 bp) = 4.78 µg 

1 pmol of l-DNA (48,502 bp) = 32.01 µg 

Common abbreviations 

ds double-stranded (as in dsDNA) 

ss single-stranded (as in ssDNA) 

bp base pair 

kb kilobase: 1,000 bases or base pairs, as appropriate 

nt nucleotides (base) 

Mb megabase: 1,000,000 bp 

Da Dalton, the unit of molecular mass; 

kDa = 1,000 Da, MDa = 1,000,000 Da 

MW molecular weight (g/mol) 

M Molar or molarity, moles of solute 

per liter of solution (mol/L) 

mol Mole, absolute amount of a substance 

(1 mol = 6.023 x 10 23 , Avogadro number) 

l wavelength 

l max 

wavelength at the absorption maximum 

5 ºC 7.76 7.89 7.97 8.07 8.18 8.26 8.37 8.48 8.58 8.68 8.78 8.88 8.98 9.09 9.18 9.28 

25 ºC 7.20 7.30 7.40 7.50 7.60 7.70 7.80 7.90 8.00 8.10 8.20 8.30 8.40 8.50 8.60 8.70 

37 ºC 6.91 7.02 7.12 7.22 7.30 7.40 7.52 7.62 7.71 7.80 7.91 8.01 8.10 8.22 8.31 8.42 


Abbreviations, symbols and conversion factors 

Molecular weight of DNA fragments 

500 bp dsDNA = 325,000 Da 

500 nt (nucleotide) ssDNA = 162,500 Da 

1 kb dsDNA = 660,000 Da 

1 kb ssDNA = 330,000 Da 

1 kb ssRNA = 340,000 Da 

1 MDa dsDNA = 1.52 kb 

Average molecular weight of dNMP = 325 Da 

Average molecular weight of 

DNA base pair 

Protein conversions 

Conversion of proteins to DNA length 

= 650 Da 

Molecular weights for nucleotides 

Compound Molecular weight (in Dalton) 

ATP 507.2 

CTP 483.2 

GTP 523.2 

UTP 484.2 

dATP 491.2 

dCTP 467.2 

dGTP 507.2 

dTTP 482.2 

AMP 347.2 

CMP 323.2 

GMP 363.2 

UMP 324.2 

dAMP 312.2 

dCMP 288.2 

dGMP 328.2 

dTMP 303.2 

Protein with a molecular weight of 10,000 = 270 bp DNA 

Protein with a molecular weight of 30,000 = 810 bp DNA 

Protein with a molecular weight of 37,000 (corresponds to 333 amino acids) = 1,000 bp DNA 

Protein with a molecular weight of 50,000 = 1.35 kb DNA 

Protein with a molecular weight of 100,000 = 2.7 kb DNA 

Conversion of absolute quantity (mol) to weight 

100 pmoles of 100,000 Da protein = 10 µg 



DNA content of various organisms 

Organism DNA content (in bp, haploid genome) 

Escherichia coli 4.2 x 10 6 

Arabidopsis thaliana 4.7 x 10 6 

Saccharomyces cerevisiae 1.4 x 10 7 

Drosophila melanogaster 1.4 x 10 8 

Homo sapiens 3.3 x 10 9 

Triticum aestivum (hexaploid wheat) 1.7 x 10 10 


Info 


65 

Appendix | Practical information

Practical information | Appendix 

66 

Info 

Genetic code and amino acid properties 

Genetic code 

1 st Codon position 

2 nd Codon position 

U C A G 

U UUU Phe UCU Ser UAU Tyr UGU Cys U 

UUC UCC UAC UGC 

UUA Leu UCA UAA Stop UGA Stop 

UUG UCG UAG Stop UGG Trp 

C CUU Leu CCU Pro CAU His CGU Arg U 

CUC CCC CAC CGC 

CUA CCA CAA Gln CGA 

CUG CCG CAG CGG 

A AUU Ile ACU Thr AAU Asn AGU Ser U 

AUC ACC AAC AGC 

AUA ACA AAA Lys AGA Arg 

AUG Met, Start ACG AAG AGG 

G GUU Val GCU Ala GAU Asp GGU Gly U 

GUC GCC GAC GGC 

GUA GCA GAA Glu GGA 

GUG GCG GAG GGG 

Nomenclature and properties of amino acids 

C 

A 

G 

C 

A 

G 

C 

A 

G 

C 

A 

G 

3 rd Codon position 

Termination codons: 

UAA: ochre 

UAG: amber 

UGA: opal 

Amino acid 3-letter symbol 1-letter symbol Major properties of side chains 

Alanine Ala A Aliphatic 

Arginine Arg R Basic group 

Asparagine Asn N Amide group 

Aspartic acid Asp D Acidic group 

Cysteine Cys C Sulfur-containing 

Glutamic acid Glu E Acidic group 

Glutamine Gln Q Amide group 

Glycine Gly G No side chain 

Histidine His H Imidazole group 

Isoleucine Ile I Aliphatic 

Leucine Leu L Aliphatic 

Lysine Lys K Basic group 

Methionine Met M Sulfur-containing 

Phenylalanine Phe F Aromatic group 

Proline Pro P Aliphatic 

Serine Ser S Hydroxyl group 

Threonine Thr T Hydroxyl group 

Tryptophan Trp W Aromatic group 

Tyrosine Tyr Y Aromatic group 

Valine Val V Aliphatic 


In yeast mitochondria, the AUA 

and UGA codons are used 

for Met and Trp, not for Ile and 

Stop as normally. 

Start codon: 

AUG: Methionine

Support and Services Directory 

Contact Information 

United States Canada 

Business Hours: 8:30 a.m. to 6:00 p.m. EST 8:30 a.m. to 5:00 p.m. EST 

Phone: 800-645-3050 

516-334-7500 

800-263-8715 

905-826-5525 

Fax: 516-334-7506 905-826-5424 

Address: Eppendorf North America, Inc. 

One Cantiague Road 

Westbury, NY 11590-0207 

Eppendorf Canada Ltd. 

6670 Campobello Road 

Mississauga, ONT L5N 2L8 

Website: www.eppendorf.com www.eppendorf.com 

Email: artsinfo@eppendorf.com canada@eppendorf.com 

Customer Support: 800-645-3050, ext. 2101 

custserv@eppendorf.com 

Repair: 800-645-3050, ext. 2404 

service@eppendorf.com 

Applications Lab: 800-645-3050, ext. 2258 


800-263-8715, menu option 1 

custserv@eppendorf.com 

800-263-8715, ext. 231 

service@eppendorf.com 

800-645-3050, ext. 2258 (U.S.) 


www.eppendorf.com • Email: info@eppendorf.com • Application hotline: 516-515-2258 

In the U.S.: Eppendorf North America, Inc. 800-645-3050 • In Canada: Eppendorf Canada Ltd. 800-263-8715 

9700-C124-06 © 2006 Eppendorf AG.

Products and Applications 2006/2007 - Eppendorf

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?