Essential Cell Biology 5th edition
A:26 Answerslonger products that eventually make an insignificantcontribution to the total DNA amplified), this amount ofproduct approximately doubles for every amplificationstep. Therefore, 100 × 10 –9 g = 2 N × 5.5 × 10 –19 g,where N is the number of amplification steps of thereaction. Solving this equation for N = log(1.81 × 10 11 )/log(2) gives N = 37.4. Thus, only about 40 cycles ofPCR amplification are sufficient to amplify DNA from asingle molecule to a quantity that can be readily handledand analyzed biochemically. This whole procedure isautomated and takes only a few hours in the laboratory.ANSWER 10–5 If the ratio of dideoxyribonucleosidetriphosphates to deoxyribonucleoside triphosphatesis increased, DNA polymerization will be terminatedmore frequently and thus shorter DNA strands will beproduced. Such conditions are favorable for determiningnucleotide sequences that are close to the DNAprimer used in the reaction. In contrast, decreasingthe ratio of dideoxyribonucleoside triphosphates todeoxyribonucleoside triphosphates will produce longerDNA fragments, thus allowing one to determine nucleotidesequences more distant from the primer.ANSWER 10–6 Although several explanations arepossible, the simplest is that the DNA probe has hybridizedpredominantly with its corresponding mRNA, which istypically present in many more copies per cell than is thegene. The different extents of hybridization probably reflectdifferent levels of gene expression. Perhaps each of thedifferent cell types that make up the tissue expresses thegene at a different level.ANSWER 10–7 Like the vast majority of mammalian genes,the attractase gene likely contains introns. Bacteria do nothave the splicing machinery required to remove introns,and therefore the correct protein would not be expressedfrom the gene. For expression of most mammalian genes inbacterial cells, a cDNA version of the gene must be used.ANSWER 10–8A. False. Restriction sites are found at random throughoutthe genome, within as well as between genes.B. True. DNA bears a negative charge at each phosphate,giving DNA an overall negative charge.C. False. Clones isolated from cDNA libraries do notcontain promoter sequences. These sequences are nottranscribed and are therefore not part of the mRNAsthat are used as the templates to make cDNAs.D. True. Each polymerization reaction produces doublestrandedDNA that must, at each cycle, be denatured toallow new primers to hybridize so that the DNA strandcan be copied again.E. False. Digestion of genomic DNA with restrictionenzymes that recognize four-nucleotide sequencesproduces fragments that are on average 256 nucleotideslong. However, the actual lengths of the fragmentsproduced will vary considerably on both sides of theaverage.F. True. Reverse transcriptase is first needed to copy themRNA into single-stranded DNA, and DNA polymeraseis then required to make the second DNA strand.G. True. Using a sufficient number of STRs, individuals canbe uniquely “fingerprinted” (see Figure 10–15).H. True. If cells of the tissue do not transcribe the geneof interest, it will not be represented in a cDNAlibrary prepared from this tissue. However, it will berepresented in a genomic library prepared from thesame tissue.ANSWER 10–9A. The DNA sequence, from its 5′ end to its 3′ end, is readstarting from the bottom of the gel, where the smallestDNA fragments migrate. Each band results from theincorporation of the appropriate dideoxyribonucleosidetriphosphate, and as expected there are no twobands that have the same mobility. This allows one todetermine the DNA sequence by reading off the bandsin strict order, proceeding upward from the bottom ofthe gel, and assigning the correct nucleotide accordingto which lane the band is in.The nucleotide sequence of the top strand (FigureA10–9A) was obtained directly from the data of FigureQ10–9, and the bottom strand was deduced from thecomplementary base-pairing rules.B. The DNA sequence can then be translated into an aminoacid sequence using the genetic code. However, thereare two strands of DNA that could be transcribed intoRNA and three possible reading frames for each strand.Thus there are six amino acid sequences that can inprinciple be encoded by this stretch of DNA. Of thethree reading frames possible from the top strand, onlyone is not interrupted by a stop codon (underlined in theDNA sequence and represented by yellow blocks in thethree amino acid sequences in Figure A10–9B).From the bottom strand, two of the three readingframes also have stop codons (not shown). The thirdframe gives the following sequence:SerAlaLeuGlySerSerGluAsnArgProArgThrProAlaArgThrGlyCysProValTyrIt is not possible from the information given to tellwhich of the two open reading frames corresponds tothe actual protein encoded by this stretch of DNA. Whatadditional experiment could distinguish between thesetwo possibilities?ANSWER 10–10A. Cleavage of human genomic DNA with HaeIII wouldgenerate about 11 × 10 6 different fragments[= 3 × 10 9 /4 4 ] and with EcoRI about 730,000 differentfragments [= 3 × 10 9 /4 6 ]. There will also be some(A)5′ TATAAACTGGACAACCAGTTCGAGCTGGTGTTCGTGGTCGGTTTTCAGAAGATCCTAACGCTGACG 3′3′ ATATTTGACCTGTTGGTCAAGCTCGACCACAAGCACCAGCCAAAAGTCTTCTAGGATTGCGACTGC 5′Figure A10–9(B)top strand of DNA5′ TATAAACTGGACAACCAGTTCGAGCTGGTGTTCGTGGTCGGTTTTCAGAAGATCCTAACGCTGACG 3′1 TyrLysLeuAspAsnGlnPheGluLeuValPheValValGlyPheGlnLysIleLeuThrLeuThr2 IleAsnTrpThrThrSerSerSerTrpCysSerTrpSerValPheArgArgSer Arg Ar3 ThrGlyGlnProValArgAlaGlyValArgGlyArgPheSerGluAspProAsnAlaAsp
Answers A:27additional fragments generated because the maternaland paternal chromosomes are very similar but notidentical in DNA sequence.B. A set of overlapping DNA fragments will be generated.Libraries constructed from sets of overlapping fragmentsare valuable because they can be used to order clonedsequences in relation to their original order in thegenome and thus obtain the DNA sequence of a longstretch of DNA (see Figure 10−20).ANSWER 10–11 By comparison with the positions of thesize markers, we find that EcoRI treatment gives twofragments of 4 kb and 6 kb; HindIII treatment gives onefragment of 10 kb; and treatment with EcoRI + HindIII givesthree fragments of 6 kb, 3 kb, and 1 kb. This gives a totallength of 10 kb calculated as the sum of the fragments ineach lane. Thus the original DNA molecule must be10 kb (10,000 nucleotide pairs) long. Because treatmentwith HindIII gives a fragment 10 kb long it could be thatthe original DNA is a linear molecule with no cutting site forHindIII. But we can rule that out by the results of the EcoRI+ HindIII digestion. We know that EcoRI cleavage aloneproduces two fragments of 6 kb and 4 kb, and in the doubledigest this 4-kb fragment is further cleaved by HindIII intoa 3-kb and a 1-kb fragment. The DNA therefore contains asingle HindIII cleavage site, and thus it must be circular, asa single fragment of 10 kb is produced when it is cut withHindIII alone. Arranging the cutting sites on a circular DNAto give the appropriate sizes of fragments produces themap illustrated in Figure A10–11.HindIIIEcoR I1 kb3 kbEcoR IFigure A10–116 kbANSWER 10–12A. Infants 2 and 8 have identical STR patterns and thereforemust be identical twins. ECB5 Infants EA10.11/A10.113 and 6 also haveidentical STR patterns and must also be identical twins.The other two sets of twins must be fraternal twinsbecause their STR patterns are not identical. Fraternaltwins, like any pair of siblings born to the same parents,will have roughly half their genome in common. Thus,roughly half the STR polymorphisms in fraternal twinswill be identical. Using this criterion, you can identifyinfants 1 and 7 as fraternal twins and infants 4 and 5 asfraternal twins.B. You can match infants to their parents by using thesame sort of analysis of STR polymorphisms. Everyband present in the analysis of an infant should havea matching band in one or the other of the parents,and, on average, each infant will share half of itspolymorphisms with each parent. Thus, the degreeof match between each child and each parent will beapproximately the same as that between fraternal twins.ANSWER 10–13 Mutant bacteria that do not produceice-protein have probably arisen many times in nature.However, bacteria that produce ice-protein have a slightgrowth advantage over bacteria that do not, so it would bedifficult to find such mutants in the wild. Recombinant DNAtechnology makes these mutants much easier to obtain.In this case, the consequences, both advantageous anddisadvantageous, of using a genetically modified organismare therefore nearly indistinguishable from those of a naturalmutant. Indeed, bacterial and yeast strains have beenselected for centuries for desirable genetic traits that makethem suitable for industrial-scale applications such as cheeseand wine production. The possibilities of recombinantDNA technology are endless, however, and as with anytechnology, there is a risk of unforeseen consequences.Recombinant DNA experimentation, therefore, is regulated,and the risks of individual projects are carefully assessedby review panels before permissions are granted. Thestate of our knowledge is sufficiently advanced that theconsequences of some changes, such as the disruption of abacterial gene in the example above, can be predicted withreasonable certainty. Other applications, such as germlinegene therapy to correct human disease, may have farmore complex outcomes, and it will take many more yearsof research and ethical debate to determine whether suchtreatments will eventually be used.Chapter 11ANSWER 11–1 Water is a liquid, and the hydrogenbonds that form between water molecules are not static;they are continually broken and remade again by thermalmotion. When a water molecule happens to be next to ahydrophobic molecule, it is more restricted in motion andhas fewer neighbors with which it can interact, because itcannot form any hydrogen bonds in the direction of thehydrophobic molecule. It will therefore form hydrogenbonds to the more limited number of water molecules inits proximity. Bonding to fewer partners results in a moreordered water structure, which represents the cagelikestructure in Figure 11–9. This structure has been likenedto ice, although it is a more transient, less organized, andless extensive network than even a tiny ice crystal. Theformation of any ordered structure decreases the entropy ofthe system and is thus energetically unfavorable (discussedin Chapter 3).ANSWER 11–2 (B) is the correct analogy for lipid bilayerassembly because exclusion from water rather thanattractive forces between the lipid molecules is involved.If the lipid molecules formed bonds with one another, thebilayer would be less fluid, and might even become rigid,depending on the strength of the interaction.ANSWER 11–3 The fluidity of the bilayer is strictly confinedto one plane: lipid molecules can diffuse laterally in theirown monolayer but do not readily flip from one monolayerto the other. Lipid molecules inserted into one monolayertherefore remain in it unless they are actively transferred tothe other monolayer by a transporter such as a scramblaseor a flippase.ANSWER 11–4 In both an α helix and a β barrel, thepolar peptide bonds of the polypeptide backbone can becompletely shielded from the hydrophobic environment ofthe lipid bilayer by the hydrophobic amino acid side chains.
- Page 743 and 744: Stem Cells and Tissue Renewal709cyt
- Page 745 and 746: Stem Cells and Tissue Renewal711epi
- Page 747 and 748: Stem Cells and Tissue Renewal713LUM
- Page 749 and 750: Stem Cells and Tissue Renewal715SEL
- Page 751 and 752: Stem Cells and Tissue Renewal717reg
- Page 753 and 754: Cancer719normal epithelial cellprim
- Page 755 and 756: Cancer721Figure 20−43 Cancer inci
- Page 757 and 758: Cancer7232. Cancer cells can surviv
- Page 759 and 760: Cancer725(B)(A)loss-of-function mut
- Page 761 and 762: Cancer727(A)Figure 20-50 Colorectal
- Page 763 and 764: Essential Concepts729Figure 20-53 A
- Page 765 and 766: 731It turns out that APC regulates
- Page 767 and 768: Questions733KEY TERMSadherens junct
- Page 769 and 770: AnswersChapter 1ANSWER 1-1 Trying t
- Page 771 and 772: Answers A:3proteins, nucleic acids,
- Page 773 and 774: Answers A:5B. The volume of the pag
- Page 775 and 776: Answers A:7X YYYY Zenzyme lowers th
- Page 777 and 778: Answers A:9ANSWER 3-16A. From Table
- Page 779 and 780: Answers A:11on its surface; however
- Page 781 and 782: Answers A:13rate (µmole/min)210 5
- Page 783 and 784: Answers A:15transcriptionally inact
- Page 785 and 786: Answers A:17HNNadenineNNHNH 2NH 2NO
- Page 787 and 788: Answers A:19(A) NORMALsplicing173 b
- Page 789 and 790: Answers A:21Figure A8-2minor groove
- Page 791 and 792: 5′ 3′3′Answers A:23proliferat
- Page 793: Answers A:25that its function is ve
- Page 797 and 798: Answers A:29slightly water-soluble,
- Page 799 and 800: Answers A:311 2 3 4OUTSIDEFigure A1
- Page 801 and 802: Answers A:33ANSWER 12-21 The membra
- Page 803 and 804: Answers A:35STEP1STEP2STEP3STEP4COO
- Page 805 and 806: Answers A:37in their reduced form.
- Page 807 and 808: Answers A:39D. Prokaryotic cells do
- Page 809 and 810: Answers A:41cells that evolved. New
- Page 811 and 812: Answers A:43ANSWER 16-14 Activation
- Page 813 and 814: Answers A:45becomes localized by bi
- Page 815 and 816: Answers A:47ANSWER 18-3 For multice
- Page 817 and 818: Answers A:49overlapping interpolar
- Page 819 and 820: Answers A:51large amounts of alcoho
- Page 821 and 822: Answers A:53chromosome during a mei
- Page 823 and 824: Answers A:55ANSWER 20-9A. False. Ga
- Page 825 and 826: Glossaryacetyl CoAActivated carrier
- Page 827 and 828: Glossary G:3Ca 2+ /calmodulin-depen
- Page 829 and 830: Glossary G:5cyclic AMPSmall intrace
- Page 831 and 832: Glossary G:7a chain of enzymatic re
- Page 833 and 834: Glossary G:9homologousDescribes gen
- Page 835 and 836: Glossary G:11membrane of a cell or
- Page 837 and 838: Glossary G:13oxidative phosphorylat
- Page 839 and 840: Glossary G:15as a molecular marker
- Page 841 and 842: Glossary G:17stromaIn a chloroplast
- Page 843 and 844: IndexNote: The index covers the tex
Answers A:27
additional fragments generated because the maternal
and paternal chromosomes are very similar but not
identical in DNA sequence.
B. A set of overlapping DNA fragments will be generated.
Libraries constructed from sets of overlapping fragments
are valuable because they can be used to order cloned
sequences in relation to their original order in the
genome and thus obtain the DNA sequence of a long
stretch of DNA (see Figure 10−20).
ANSWER 10–11 By comparison with the positions of the
size markers, we find that EcoRI treatment gives two
fragments of 4 kb and 6 kb; HindIII treatment gives one
fragment of 10 kb; and treatment with EcoRI + HindIII gives
three fragments of 6 kb, 3 kb, and 1 kb. This gives a total
length of 10 kb calculated as the sum of the fragments in
each lane. Thus the original DNA molecule must be
10 kb (10,000 nucleotide pairs) long. Because treatment
with HindIII gives a fragment 10 kb long it could be that
the original DNA is a linear molecule with no cutting site for
HindIII. But we can rule that out by the results of the EcoRI
+ HindIII digestion. We know that EcoRI cleavage alone
produces two fragments of 6 kb and 4 kb, and in the double
digest this 4-kb fragment is further cleaved by HindIII into
a 3-kb and a 1-kb fragment. The DNA therefore contains a
single HindIII cleavage site, and thus it must be circular, as
a single fragment of 10 kb is produced when it is cut with
HindIII alone. Arranging the cutting sites on a circular DNA
to give the appropriate sizes of fragments produces the
map illustrated in Figure A10–11.
HindIII
EcoR I
1 kb
3 kb
EcoR I
Figure A10–11
6 kb
ANSWER 10–12
A. Infants 2 and 8 have identical STR patterns and therefore
must be identical twins. ECB5 Infants EA10.11/A10.11
3 and 6 also have
identical STR patterns and must also be identical twins.
The other two sets of twins must be fraternal twins
because their STR patterns are not identical. Fraternal
twins, like any pair of siblings born to the same parents,
will have roughly half their genome in common. Thus,
roughly half the STR polymorphisms in fraternal twins
will be identical. Using this criterion, you can identify
infants 1 and 7 as fraternal twins and infants 4 and 5 as
fraternal twins.
B. You can match infants to their parents by using the
same sort of analysis of STR polymorphisms. Every
band present in the analysis of an infant should have
a matching band in one or the other of the parents,
and, on average, each infant will share half of its
polymorphisms with each parent. Thus, the degree
of match between each child and each parent will be
approximately the same as that between fraternal twins.
ANSWER 10–13 Mutant bacteria that do not produce
ice-protein have probably arisen many times in nature.
However, bacteria that produce ice-protein have a slight
growth advantage over bacteria that do not, so it would be
difficult to find such mutants in the wild. Recombinant DNA
technology makes these mutants much easier to obtain.
In this case, the consequences, both advantageous and
disadvantageous, of using a genetically modified organism
are therefore nearly indistinguishable from those of a natural
mutant. Indeed, bacterial and yeast strains have been
selected for centuries for desirable genetic traits that make
them suitable for industrial-scale applications such as cheese
and wine production. The possibilities of recombinant
DNA technology are endless, however, and as with any
technology, there is a risk of unforeseen consequences.
Recombinant DNA experimentation, therefore, is regulated,
and the risks of individual projects are carefully assessed
by review panels before permissions are granted. The
state of our knowledge is sufficiently advanced that the
consequences of some changes, such as the disruption of a
bacterial gene in the example above, can be predicted with
reasonable certainty. Other applications, such as germline
gene therapy to correct human disease, may have far
more complex outcomes, and it will take many more years
of research and ethical debate to determine whether such
treatments will eventually be used.
Chapter 11
ANSWER 11–1 Water is a liquid, and the hydrogen
bonds that form between water molecules are not static;
they are continually broken and remade again by thermal
motion. When a water molecule happens to be next to a
hydrophobic molecule, it is more restricted in motion and
has fewer neighbors with which it can interact, because it
cannot form any hydrogen bonds in the direction of the
hydrophobic molecule. It will therefore form hydrogen
bonds to the more limited number of water molecules in
its proximity. Bonding to fewer partners results in a more
ordered water structure, which represents the cagelike
structure in Figure 11–9. This structure has been likened
to ice, although it is a more transient, less organized, and
less extensive network than even a tiny ice crystal. The
formation of any ordered structure decreases the entropy of
the system and is thus energetically unfavorable (discussed
in Chapter 3).
ANSWER 11–2 (B) is the correct analogy for lipid bilayer
assembly because exclusion from water rather than
attractive forces between the lipid molecules is involved.
If the lipid molecules formed bonds with one another, the
bilayer would be less fluid, and might even become rigid,
depending on the strength of the interaction.
ANSWER 11–3 The fluidity of the bilayer is strictly confined
to one plane: lipid molecules can diffuse laterally in their
own monolayer but do not readily flip from one monolayer
to the other. Lipid molecules inserted into one monolayer
therefore remain in it unless they are actively transferred to
the other monolayer by a transporter such as a scramblase
or a flippase.
ANSWER 11–4 In both an α helix and a β barrel, the
polar peptide bonds of the polypeptide backbone can be
completely shielded from the hydrophobic environment of
the lipid bilayer by the hydrophobic amino acid side chains.