Essential Cell Biology 5th edition

312 CHAPTER 9 How Genes and Genomes Evolve
exon intron
mouse
GTGCCTATCCAGAAAGTCCAGGATGACACCAAAACCCTCATCAAGACCATTGTCACCAGGATCAATGACATTTCACACACGGTA-GGAGTCTCATGGGGGGACAAAGATGTAGGACTAGA
GTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACGGTAAGGAGAGT-ATGCGGGGACAAA---GTAGAACTGCA
human
mouse
ACCAGAGTCTGAGAAACATGTCATGCACCTCCTAGAAGCTGAGAGTTTAT-AAGCCTCGAGTGTACAT-TATTTCTGGTCATGGCTCTTGTCACTGCTGCCTGCTGAAATACAGGGCTGA
GCCAG--CCC-AGCACTGGCTCCTAGTGGCACTGGACCCAGATAGTCCAAGAAACATTTATTGAACGCCTCCTGAATGCCAGGCACCTACTGGAAGCTGA--GAAGGATTTGAAAGCACA
human
Figure 9−19 Accumulated mutations have
resulted in considerable divergence in the
nucleotide sequences of the human and
the mouse genomes. Shown here in two
contiguous segments of DNA are portions
of the human and mouse leptin gene
sequences. Positions where the sequences
differ by a single nucleotide substitution
are boxed in green, and positions where
they differ by the addition or deletion of
nucleotides are boxed in yellow. Note that
the coding sequence of the exon is much
more conserved than the adjacent intron
sequence.
75 million years since humans and mice diverged from their common
ancestor, about 50% of the nucleotides have changed. However, these
differences are not dispersed evenly across the genome. By observing
where ECB5 the human e9.18/9.19 and mouse sequences have remained nearly the same,
one can thus see very clearly the regions where genetic changes are
not tolerated (Figure 9−19). These sequences have been conserved by
purifying selection—that is, by the elimination of individuals carrying
mutations that interfere with important functions.
The power of comparative genomics can be further increased by stacking
our genome up against the genomes of additional animals, including
the rat, chicken, and dog. Such comparisons take advantage of the
results of the “natural experiment” that has lasted for hundreds of millions
of years, and they highlight some of the most important regions
of these genomes. These comparisons reveal that roughly 4.5% of the
human genome consists of DNA sequences that are highly conserved in
many other mammals (Figure 9−20). Surprisingly, only about one-third
human gene: 190,000 nucleotide pairs
5′ 3′
intron exon intron mammalian conserved intron sequences
chimpanzee
orangutan
100% identical
50% identical
baboon
marmoset
lemur
rabbit
horse
percent
identity
cat
dog
mouse
opossum
chicken
fish (Fugu)
100% identical
50% identical
10,000 nucleotide pairs
Figure 9−20 Comparison of nucleotide sequences from many different vertebrates reveals regions of high conservation. The
nucleotide sequence examined in this diagram is a small segment of the human gene for a plasma membrane transporter protein.
The upper part of the diagram shows the location of the exons (red) in both the complete gene (top) and in the expanded region of
the gene. Three blocks of intron sequence that are conserved in mammals are shown in blue. In the lower part of the figure, the DNA
sequence of the expanded segment of 10,000 nucleotide pairs is aligned with the corresponding sequences of different vertebrates;
the percent identity with the human sequences for successive stretches of 100 nucleotide pairs is plotted in green, with only identities
above 50% shown. Note that the sequence of the exon is highly conserved in all the species, including chicken and fish, but the
three intron sequences that are conserved in mammals ECB5 are e9.19/9.20 not conserved in chickens or fish. The functions of most conserved intron
sequences in the human genome (including these three) are not known. (Courtesy of Eric D. Green.)