transmembrane domain ECD: extracellular domain ICD

Cloning of two members of the calcitonin-family receptors from stingray, Dasyatis
akajei: Possible physiological roles of the calcitonin family in osmoregulation
Nobuo Suzuki a* , Toshio Sekiguchi b , Honoo Satake b , Kanoko Kato c , Yudai Nishiyama c ,
Hideya Takahashi c,d , Janine A. Danks e , T. John Martin f , Atsuhiko Hattori g , Masaki
Nakano g , Makiko Kakikawa h , Sotoshi Yamada h , Maho Ogoshi c , Susumu Hyodo i , Yoko
Yamaguchi i , Vishwajit S. Chowdhury j , Kazuichi Hayakawa k , Hisayuki Funahashi m ,
Tatsuya Sakamoto c and Yuichi Sasayama a
a
Noto Marine Laboratory, Institute of Nature and Environmental Technology, Kanazawa University,
Housu-gun, Ishikawa 927-0553, Japan; b Suntory Institute for Bioorganic Research, Mishima-gun,
Osaka 618-8503, Japan; c Ushimado Marine Institute, Okayama University, Ushimado, Okayama
701-4303, Japan; d Institute of Science and Technology, Niigata University, Niigata 950-2181, Japan;
e f
School of Medical Sciences, RMIT University, Bundoora 3083, Australia; St. Vincent's Institute of
Medical Research, 41 Victoria Parade, Fitzroy 3065, Australia; g Department of Biology, College of
Liberal Arts and Sciences, Tokyo Medical and Dental University, Ichikawa-city, Chiba 272-0827;
h
Institute of Nature and Environmental Technology, Kanazawa University, Kanazawa-city, Ishikawa
920-1192, Japan; i Atmosphere and Ocean Research Institute, University of Tokyo, Kashiwa-city, Chiba
277-8564 Japan; j International Education Center, Faculty of Agriculture, Kyushu University, Fukuoka
812-8581, Japan; k Faculty of Pharmaceutical Science, Institute of Medical, Pharmaceutical and
Health Sciences, Kanazawa University, Kanazawa-city, Ishikawa 920-1192; m Showa University,
School of Medicine, Department of Anatomy, Shinagawa-ku, Tokyo 142-8555, Japan
Correspondence to: Dr. N. Suzuki, a Noto Marine Laboratory, Institute of Nature and Environmental
Technology, Kanazawa University, Ogi, Noto-cho, Ishikawa 927-0553, Japan. Tel.: 81-768-74-1151; Fax
81-768-74-1644; e-mail: nobuos@staff.kanazawa-u.ac.jp
Keywords: calcitonin; calcitonin gene-related peptide; tissue expression; elasmobranch
Abbreviations: bp, base pair(s); cDNA, DNA complementary to RNA; CGRP, calcitonin gene-related
peptide; calcitonin, CT; calcitonin receptor, CTR; calcitonin-receptor-like receptor, CRLR; mRNA,
messenger RNA; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; RT-PCR,
reverse transcription-polymerase chain reaction.
1

Abstract In cartilaginous fish, two cDNAs encoding calcitonin-family receptors were
isolated for the first time from the stingray brain. The open reading frame of one receptor
cDNA coded a 525-amino acid protein. The amino acid identity of this receptor to human
calcitonin-receptor-like receptor (CRLR) is 64.5%, frog CRLR is 64.7%, and flounder
CRLR is 61.2% and this was higher than to human calcitonin receptor (CTR) (46.1%),
frog CTR (54.7%), and flounder CTR (48.9%). We strongly suggested that this receptor is
a ray CRLR based on phylogenetic analysis. In case of the second receptor, amino acid
identity among CRLRs (human 50.5%; frog 50.7%; flounder 48.0%) and CTRs (human
43.2%; frog 49.1%; flounder 41.8%) was similar. From phylogenetic analysis of both
CRLRs and CTRs, we believe that this receptor is ray CTR. The expression of ray CRLR
mRNA was predominantly detected in the nervous system (brain) and vascular system
(atrium, ventricle, and gill), which reflects the similar localization of CGRP in the nervous
and vascular systems as mammals. It was observed that the second receptor was expressed
in several tissues, namely cartilage, brain, pituitary gland, gill, atrium, ventricle, pancreas,
spleen, liver, gall bladder, intestine, rectal gland, kidney, testis and ovary. This
localization pattern was very similar to flounder CTR. Both receptor mRNAs were
strongly expressed in the gill. This suggests that the calcitonin-family members are
involved in the osmoregulation of stingray as this fish is known to be euryhaline. When a
stingray was transferred to diluted seawater (20% seawater), the expression of both
receptors significantly decreased in the gill. Similar results were obtained in the kidney of
the stingray. Thus, our cloning and isolation of both receptors in the stingray will be
helpful for elucidation of their physiological role (s) such as osmoregulation including
calcium metabolism of cartilaginous fish.
2

1. Introduction
Calcitonin gene-related peptide (CGRP) is a 37 amino acid hormone whose mRNA is
co-encoded with calcitonin (CT) mRNA on a single gene (Amara et al., 1982). In mammals,
the mRNA synthesis of two hormones is controlled by tissue-specific alternative splicing;
CGRP precursor mRNA is synthesized in the neural tissues; CT precursor mRNA is
synthesized in the thyroidal C-cells (Rosenfeld et al., 1983). Since CGRP exists widely in
the central nervous system (Rosenfeld et al., 1983; Gibson et al., 1984), it is suggested that
CGRP plays role as a neuromediator or neuromodulator (Lafont et al., 2007). In addition,
CGRP is synthesized in the heart and blood vessels to control blood flow by its potent
vasodilatory actions (Mulderry et al., 1985; Wimalawansa, 1997; Brain and Grant, 2004).
In teleosts, the presence of CGRP immunoreactive substances has been demonstrated in
trout (Fouchereau-Peron et al., 1990). Jansz and Zandberg (1992) characterized the CGRP
gene of salmon, suggesting that salmon CGRP is the product of the alternative splicing of
the CT/CGRP gene, common to mammals. We also cloned a part of genomic DNA
including the CGRP gene from flounder (Paralichthys olivaceus) and detected mRNA
expression in the brain and heart (Suzuki et al., 2001), suggesting that CGRP acts as a
neuropeptide and a vasodilator in fish as well as mammals. As CGRP immunoreactivity has
been detected in the brain of small-spotted dogfish (Molist et al., 1995), and may be quite
important in homeostasis in all fish including cartilaginous fish (Lafont et al., 2007). On the
other hand, calcitonin receptor-like receptor (CRLR) functions to a receptor for CGRP
when it is co-expressed with RAMP1 (McLatchie et al., 1998; Husmann et al., 2000;
Sexton et al., 2001). The distribution and expression analysis of CRLR under various
physiological and environmental conditions could contribute to the understanding of
physiological functions of CGRP in cartilaginous fish.
3

To study the physiological role of CGRP in cartilaginous fish, the full coding region of
CRLR was sequenced from the brain of stingray and the mRNA expression in the various
tissues was analyzed. In the process of CRLR cloning, a second member of the
calcitonin-family receptors was isolated and cloned. Based on the data of multiple
alignment, phylogenetic analysis and tissue distribution pattern, it is apparent that this
receptor is equivalent to the stingray calcitonin receptor (CTR). In addition, it was found
that the expression of two receptors was decreased in the gill and kidney when the rays
were transferred to diluted seawater. Thus, this is the first study that identifies two members
of calcitonin-family receptors in cartilaginous fish and indicates the possible physiological
roles of CT and CGRP in the osmoregulation of stingray.
2. Materials and methods
2.1. Animals
The brain of male stingray (Dasyatis akajei) was used for PCR amplification. Male and
female stingrays were used for the analysis of tissue-specific expression and adaptation in
seawater. The original concentration of seawater (100%) and diluted seawater (20%) were
used for this study. The animals were anesthetized with ethyl 3-amino-benzoate,
methanesulfonic acid salt (Sigma-Aldrich Inc., MO, USA) and then dissected for tissue
preparation.
All experimental procedures were conducted in accordance with the Guide for the
Care and Use of Laboratory Animals prepared by Kanazawa University.
2.2. PCR amplification
Total RNAs were prepared using a total RNA isolation kit (Nippon Gene, Tokyo,
4

Japan) from the brains of stingray. RT-PCR was performed using Oligotex-dT 30 Super
(Takara, Kusatsu, Japan) as an oligo dT primer to prevent genomic DNA contamination
(Suzuki et al., 1997). The PCR primers were designed at the well-conserved region of the
mammalian CRLR and CTR cDNA sequences (Figure 1). The primer sequences were:
5’A-GYAAYMGXACXTGGGAYGG; 5’B-GAYTAYTTYCCXGAYTTYGA;
3’A-CCYTCRCAXARCATCCARAA; 3’B:CATCCARAARTARTTRCA (Suzuki et al.,
2000). The 1st and the nested-PCR (1st PCR: 5’A/3’A primer set; 2nd PCR: 5’B/3’B
primer set) were performed using a Taq polymerase and an additional buffer (Takara Bio
Inc., Otsu, Japan). The PCR parameters were 35 cycles of 96°C for 30s, 45°C for 1 min,
and 72°C for 2 min. The sequencing of the PCR products of the expected length (422 bp)
was performed by Dragon Genomics Center, Takara Bio Inc. (Mie, Japan).
2.3. RACE amplification of receptors cDNAs in stingray
Total RNA (1 �g) was obtained from the stingray brain. The complete sequences of the
two receptors were obtained by 5’- and 3’-RACE method using a kit 5' RACE System,
Version 2.0 and 3' RACE System for Rapid Amplification of cDNA Ends, respectively
(Invitrogen, CA, USA). The primer locations for two receptors were described in
supplementary figures. RACE was performed using the respective gene-specific primer and
the primer of adaptor sequences in the kit. The products were sequenced on an ABI PRISM
3130 sequencer (Applied Biosystems, CA, USA) using BigDye terminators.
2.4. Expression analysis
Total RNAs were prepared from the cartilage, brain, pituitary gland, gill atrium,
ventricle, pancreas, spleen, liver, gall bladder, intestine, rectal gland, kidney, and testis of
5

male stingray, as well as the ovary of female stingray using a total RNA isolation kit
(Nippon Gene). RT-PCR was performed using the primer set (CRLR
5’:AGACTTCGATCCATCAGA; CRLR 3’: AGTCAATGCTGTCTTTA; CTR-like 5’:
CACGGAAAAGGTCACC; CTR-like 3’: AGTGAACAAAGAGTAATAT). The
conditions for PCR amplification were 40 cycles of denaturation for 0.5 min at 96°C,
annealing for 1 min at 60°C, and extension for 2 min at 72°C, followed by a single cycle
at 72°C for 30 min. In case of the �-actin cDNA (AB675482), the amplification using a
primer set (5’: TTGGCAATGAGCGATTCAGA; 3’:
CACAGGATTCCATACCCAAGAAA) were consisted of 25 cycles of denaturation for
0.5 min at 96°C, annealing for 1 min at 60°C, and extension for 2 min at 72°C, followed
by a single cycle at 72°C for 15 min. The PCR products were analyzed on 2.5% NuSive
GTG agarose gel (FMC Bioproducts, ME, USA) and stained with ethidium bromide.
2.5. Phylogenetic analysis
The amino acid sequences were aligned using the CLUSTAL program (Higgins and
Sharp 1988). After removing gaps, the verified alignments were used to construct
phylogenetic trees. The trees were calculated using MEGA program based on the
neighbor-joining method (Saitou and Nei 1987; Kumar et al. 2001). The sequences used as
follow: Human-CRLR, NP_005786; Pig-CRLR, Q867C1; Dog-CRLR, XP_545560;
Mouse-CRLR, NP_061252; Xenopus-CRLR, NP_001016893; Fugu-CRLR2, BAE45313;
Salmon-CRLR, CAD48406; Flounder-CRLR, AB035314; Fugu-CRLR1, BAE45312;
Flounder-CTR, AB035315; Chicken-CTR, XP_425985; Bullfrog-CTR, Q28DX2;
Fugu-CTR, BAE76018; Medaka-CTR, AAI19273; Pig-CTR, AAA31023; Mouse-CTR,
AAI19273; Human-CTR, NP_001733; Dog-CTR, XP_539423; Ascidian-CTR,
6

BAI63096; Human-CRHR1, NP_004373.
2.6. Analysis of the mRNA expression of both ray CRLR and CTR-like receptors in the gill
and kidney after transfer to diluted seawater.
Seawater adapted-stingrays (n = 8, both sexes) were gradually transferred into diluted
seawater. In the first day, the stingrays were transferred to 80% seawater and then kept for
6 hours followed by putting them into 60% seawater for remaining of the day. In the next
day, the stingray were kept in 40% seawater for 6 hours, and then transferred into 20%
seawater. After keeping the stingrays in 20% seawater for 12 hours, the stingrays were
anesthetized with ethyl 3-aminobenzoate, methanesulfonic acid salt (Sigma-Aldrich). The
gill and kidney were collected from stingray under proper anesthetic condition. Also, the
seawater-adapted stingrays (n = 8, both sexes) were anesthetized with ethyl
3-aminobenzoate, methanesulfonic acid salt (Sigma-Aldrich). The gill and kidney were
removed from the seawater stingrays.
Total RNA was prepared using a total RNA isolation kit for fibrous tissue and
complementary DNA synthesis was performed (RNase Easy Fibrous Mini-Kit, Qiagen
GmbH, Hilden, Germany). The real-time PCR amplification was analyzed with a
BIO-RAD iCycler (BIO-RAD, Hercules, CA) using the primers for CRLR (5':
GGAGAAGCTAAAGACAGCATTGACT; 3': CAGCAGCGAAGCCACTGATA') and
for CTR-like (5': GGAAAAGGTCACCAAGATTTGC; 3':
AGTCCATGTTCGGTTGCTCTCT). The annealing temperature in the amplification of
both CRLR and CTR-like cDNAs was 63°C. The amplified PCR products have been
verified by sequencing to confirm its sequences. The detailed conditions of PCR were
described in our previous study (Takahashi et al., 2007). The CRLR and CTR-like mRNA
7

levels were normalized to the �-actin mRNA level measured by above described primer
set (5’: TTGGCAATGAGCGATTCAGA; 3’: CACAGGATTCCATACCCAAGAAA).
2.7. Statistical analysis
Real-time PCR was performed and the data were analyzed using the Student’s t-test.
The significance level was P

The amino acid identity of the second stingray receptor (see, supplementary data) was
similar to CRLRs (human 50.5%; frog 50.7%; flounder 48.0%) and CTRs of other species
(human 43.2%; frog 49.1%; flounder 41.8%). After alignment of flounder CRLR, flounder
CTR, human CRLR, human CTR, and two stingray receptors, three potential sites
(Asn-X-Ser/Thr) for N-linked glycosylation, which are conserved in mammalian CRLR and
CTR, were identified in stingray receptors before the first putative transmembrane domain.
Furthermore, 12 cysteines were conserved among CRLRs, CTRs, and stingray receptors.
These glycosylation sites and cysteines are suggested to be important for ligand binding (Qi
et al., 1997; Ho et al., 1999). Using BLAST against the DDBJ/NCBI protein database,
furthermore, we confirmed that the sequences are most similar to CRLR and CTR. Thus,
we concluded that two receptors belong to the calcitonin-family receptors.
3.3. Phylogenetic analysis of calcitonin-family receptors
The phylogenetic tree was determined for the known calcitonin-family receptors
together with stingray receptors (see, supplementary data). As a result, the stingray
receptors were located with CRLR and CTR in other animals. The first stingray receptor
branched from teleost CRLR and composed of a clade of mammalian and xenopus CRLR.
This result strongly supports that the amino acid sequence was that of stingray CRLR (ray
CRLR). The second stingray receptor, co-located with flounder CTR, and was placed
between the CRLRs clade and the non-mammalian CTRs clade (see, supplementary data).
We previously reported amino acid sequences of both CT and CGRP in flounder
(Suzuki et al., 2001). The amino acid sequence of flounder CT was more similar to
teleosts (78–100%), salamander (81%), reptiles (84%), and chicken (84%) than those of
stingray (72%) and frogs (56–78%), and it is largely different from that of mammals
9

(31–50%). However, the predicted amino acid sequence of flounder CGRP was more
conserved than CT among vertebrates and showed 78%, 78%, 78%, 81%, and 73–78%
identity to salmon, cod, frog, chicken, and mammalian CGRPs, respectively. Among
vertebrates, CGRP is a well-conserved molecule during evolution while CT is quite varied.
Corresponding to sequence changes in ligand (CT), the receptor (CTR) seems to be varied
largely. Thus, it is highly likely that the second receptor is the stingray equivalent of CTR
(ray CTR-like).
3.4. Expression of ray CRLR and ray CTR-like mRNAs in different tissues
Specific PCR products of ray CRLR mRNA were amplified from brain, gill, atrium
and ventricle and detected in cartilage, pituitary gland, spleen, liver, gall-bladder, intestine,
rectual gland, kidney, testis and ovary (Fig. 2). Pancreas did not show any expression with
the present conditions (Fig. 2). The ray CRLR mRNA expression was found in brain, heart
and intestine and this same as seen in mammals (Eysselein et al., 1991; Poyner, 1992),
suggesting similar functions in those tissues. In spleen, relatively high expression of ray
CRLR was detected. Arlot-Bonnemains et al. (1991) reported that CGRP-specific binding
in trout tissues is high in the spleen although the function has not yet been elucidated. In the
early development of gut in zebrafish, the number of nerve cell bodies and fibers gradually
increased and CGRP was detected in these nerve cells (Olsson et al., 2008). In another
study, cod CGRP (10 -9 –10 -7 M) inhibited the motility of spontaneously active ring
preparations from the cod intestine (Shahbazi et al., 1998) suggesting that CGRP plays a
role in fish gut development and physiology. The localization of CGRP in the stingray gut
suggests that CGRP may have significant roles in its gut.
Recently, involvement of CGRP in the outgrowth of the gubernaculums has been noted,
10

and it has been suggested to play a role in testicular descent in mammalians (Chan et al.,
2009). CGRP released from the genitofemoral nerve causes maximal mitosis in the
gubernacular bulb of mammals (Chan et al., 2009). In stingray, this hormone may involve
in testicular development that regulating the balance between cell proliferation and
apoptosis.
Specific PCR products of ray CTR-like mRNA were amplified from cartilage, brain,
pituitary gland, gill, atrium, ventricle, pancreas, spleen, liver, gall bladder, intestine, rectal
gland, kidney, testis, and ovary (Fig. 2). In the cartilage of stingray, we detected ray
CTR-like mRNA expression. It has been reported that CT acts on mammalian cartilage and
promotes synthesis (Karsdal et al., 2006; Sondergaard et al., 2006). In the stingray, thus, CT
may function to the growth of cartilage. CT-immunoreactive cells were found in the
intestine of goldfish and appeared to control absorption of nutrients (Okuda et al., 1999).
Therefore, the presence of ray CTR-like mRNA in intestine corresponds well with this
physiological role of CT in fish. Previously mRNA expression of salmon CTR was detected
in brain and pituitary gland and this was consistent with another study in mammalian
tissues (Azria, 1989) where it was suggested that CT might act as a neurotransmitter.
In female sharks, it had been shown that plasma CT levels were elevated during
reproductive periods (Nichols et al., 2003). We previously reported that
estrogen-specific-binding and estrogen receptor mRNA were present in the stingray
ultimobranchial gland (CT secreting organ in sub-mammalian vertebrates) (Yamamoto et
al., 1996). The possible involvement of CT in stingray reproductive physiology is implied
because of the presence of this receptor in the ovary and testis of stingray in the present
study.
Ray CRLR and ray CTR-like mRNAs were found to be expressed in the excretory
11

organs such as gill, kidney and rectal gland. As this fish is euryhaline (de Vlaming and
Sage, 1973; Janech et al., 2003; Evans et al., 2010) and CGRP functions to osmoregulation
in teleosts (Lamharzi et al., 1996; Suzuki et al., 2002; Lafont et al., 2007), we examined ray
CRLR and ray CTR-like mRNA expression in the gill and kidney when stingrays were
transferred to the diluted seawater.
3.5. Changes in mRNA expression of both ray CRLR and CTR-like receptors in the gill and
kidney when transferred to diluted seawater
The results are shown in Fig. 3. The ray CTR-like mRNA expression in the gill and
kidney was higher than the ray CRLR mRNA. These results coincided with the tissue
specific expressions (Fig. 2). When stingrays were transferred to the diluted seawater (20%
seawater), both receptors mRNA expression significantly decreased in the gill. Similar
results were obtained in the stingray kidney. When rainbow trout were adapted to seawater,
their plasma CGRP levels and CGRP binding sites in the gill increased (Lamharzi et al.,
1996). Similarly when flounder were moved from seawater to freshwater, CRLR mRNA
expression decreased (Suzuki et al., 2002). Thus, CGRP may play a role in osmoregulation
in teleosts (Lafont et al., 2007).
Interestingly, the plasma level of CT did not change when freshwater adapted eels
were moved to 100% seawater (Suzuki et al., 1999). This was reflected in the study where
the flounder were transferred from seawater to freshwater and CTR mRNA expression in
the gill did not alter (Suzuki et al., 2002). Therefore, CT may play a role in osmoregulation
in cartilaginous fish and not in teleosts, as CT has some functions in osmoregulation as the
CTR-like mRNA expression in both stingray gill and kidney was decreased when the fish
were transferred from seawater to freshwater. Further study is required to elucidate the
12

possible roles of CT and CGPR in cartilaginous fish.
3.6. Conclusions
(1) cDNA encoding CRLR was cloned from the stingray brain. Tissue-expression analysis,
using RT-PCR, indicated that ray CRLR mRNA was detected mainly in the nervous system
(brain) and vascular system (atrium, ventricle, and gill), indicating that CGRP may play
roles in the nervous and vascular systems as it does in mammals.
(2) Another receptor cDNA was cloned from the brain of stingray. Based on the data of
multiple alignments, phylogenetic analysis and tissue distribution pattern, this receptor is
CTR equivalent in stingray.
(3) When stingray transferred to the diluted seawater (20% seawater), mRNA expression of
both receptors were significantly decreased in the stingray gill. Similar results were
obtained in the kidney. Thus, identification of two members of the calcitonin-family
receptors in the stingray will assist in the elucidation of the physiological roles of these
receptors and their ligands in cartilaginous fish.
Acknowledgments
This study was supported in part by grants to N.S. (Grant-in-Aid for Scientific
Research (C) No. 21500404 by JSPS; Grant-in-Aid for Space Utilization by Japan
Aerospace Exploration Agency), to A.H. (Grant-in-Aid for Scientific Research (C) No.
21570062 by JSPS), to T.S. (Grant-in-Aid for Scientific Research (C) No. 22570065
by JSPS), to M.O. (Grant-in-Aid for Encouragement of Scientists No. 22870020 by JSPS),
and to K.H. [the Environment Research and Technology Development Fund (B-0905) by
the Ministry of the Environment in Japan; Health and Labor Sciences Research Grants of
13

Ministry of Health, Labor and Welfare, Japan; Grant-in-Aid for Scientific Research (B)
No. 21390034 by JSPS]. This work was carried out in part as a joint-research in Japanese
Association for Marine Biology (JAMBIO).
References
Amara, S.G., Jonas, V., Rosenfeld, M.G., Ong, E.S., Evans, R.M., 1982. Alternative RNA
processing in calcitonin gene expression generates mRNAs encoding different
polypeptide products. Nature 298, 240-244.
Arlot-Bonnemains, Y., Fouchereau-Peron, M., Jullienne, A., Milhaud, G., Moukhtar, M.S.,
1991. Binding sites of calcitonin gene related peptide (CGRP) to trout tissues.
Neuropeptides 20, 181-186.
Azria, M., 1989. In: The calcitonins: Physiology and Pharmacology, Karger, Basel.
Brain, S.D., Grant, A.D., 2004. Vascular actions of calcitonin gene-related peptide and
adrenomedullin. Physiol. Rev. 84, 903–934.
Chan, J.J., Farmer, P.J., Southwell, B.R., Sourial, M., Hutson, J.M., 2009. Calcitonin
gene-related peptide is a survival factor, inhibiting apoptosis in neonatal rat
gubernaculum in vitro. J. Pediatr. Surg. 44, 1497-1501.
Eysselein, V.E., Reeve, J.R., Jr., Sternini, C., Cominelli, F., Davis, W.M., Davis, M.T., Lee,
T.D., Ho, F.-J., Ridout, D., Shively, J.E., 1991. Structural characterization of calcitonin
gene-related peptide purified from rabbit intestine. Peptides 12, 289-295.
Evans, A.N., Henning, T., Gelsleichter, J., Nunez, B.S., 2010. Molecular classification of
an elasmobranch angiotensin receptor: Quantification of angiotensin receptor and
natriuretic peptide receptor mRNAs in saltwater and freshwater populations of the
Atlantic stingray. Comp. Biochem. Physiol. 157B, 423–431.
14

Fouchereau-Peron, M., Arlot-Bonnemains, Y., Taboulet, J., Milhaud, G., Moukhtar, M.S.,
1990. Distribution of calcitonin gene-related peptide and calcitonin-like
immunoreactivity in trout. Regl. Pept. 27, 171-179.
Gibson, S.J., Polak, J.M., Bloom, S.R., Sabate, I.M., Mulderry, P.M., Ghatei, M.A.,
McGregor, G.P., Morrison, J.F.B., Kelly, J.S., Evans, R.M., Rosenfeld, M.G., 1984.
Calcitonin gene-related peptide immunoreactivity in the spinal cord of man and of eight
other species. J. Neurosci. 4, 3101-3111.
Higgins, D.G., Sharp, P.M., 1988. CLUSTAL: A package for performing multiple sequence
alignment on a microcomputer. Gene 73, 237-244.
Husmann, K., Sexton, P.M., Fischer, J.A., Born, W., 2000. Mouse
receptor-activity-modifying proteins 1, -2, and -3: Amino acid sequence, expression and
function. Mol. Cell. Endocrinol. 162, 35-43.
Ho, H.H., Gilbert, M.T., Nussenzveig, D.R., Gershengorn, M.C., 1999. Glycosylation is
important for binding to human calcitonin receptors. Biochemistry 38, 1866-1872.
Jansz, H.S., Zandberg, J., 1992. Identification and partial characterization of the salmon
calcitonin/CGRP gene by polymerase chain reaction. Ann. N. Y. Acad. Sci. 657, 63-69.
Janech, M.G., Fitzgibbon, W.R., Chen, R., Nowak, M.W., Miller, D.H., Paul, R.V., Ploth,
D.W., 2003. Molecular and functional characterization of a urea transporter from the
kidney of the Atlantic stingray. Am. J. Physiol. Renal. Physiol. 284, F996–F1005.
Karsdal, M.A., Tanko, L.B., Riis, B.J., Sondergard B.C., Henriksen, K., Altman, R.D.,
Qvist, P., Christiansen, C., 2006. Calcitonin is involved in cartilage homeostasis: Is
calcitonin a treatment for OA? Osteoarthritis Cartilage 14, 617-624.
Kumar, S., Tamura, K., Jakobsen, I.B., Nei, M., 2001. MEGA2: Molecular evolutionary
genetics analysis software. Bioinformatics 17, 1244-1245.
15

Lafont, A.-G., Dufour, S., Fouchereau-Peron, M., 2007. Evolution of the CT/CGRP family:
Comparative study with new data from models of teleosts, the eel, and cephalopod
molluscs, the cuttlefish and the nautilus. Gen. Comp. Endocrinol. 153, 155–169.
Lamharzi, N., Fouchereau-Peron, M., 1996. Adaptation of rainbow trout to seawater:
Changes in calcitonin gene-related peptide levels are associated with an increase in
hormone-receptor interaction in gill membranes. Gen. Comp. Endocrinol. 102, 274-280
McLatchie, L.M., Fraser, N.J., Main, M.J., Wise, A., Brown, J., Thompson, N., Solari, R.,
Lee, M.G., Foord, S.M., 1998. RAMPs regulate the transport and ligand specificity of
the calcitonin-receptor-like receptor. Nature 393, 333-339.
Molist, P., Rodriguez-Moldes, I., Batten, T.F.C., Anadon, R., 1995. Distribution of
calcitonin gene-related peptide-like immunoreactivity in the brain of the small-spotted
dogfish, Scyliorhinus canicula L. J. Comp. Neurol. 352, 335-350.
Mulderry, P.K., Ghatei, M.A., Rodrigo, J., Allen, J.M., Rosenfeld, M.G., Polak, J.M.,
Bloom, S.R., 1985. Calcitonin gene-related peptide in cardiovascular tissues of the rat.
Neuroscience 14, 947-954.
Nichols, S., Gelsleichter, J., Manire, C.A., Cailliet, G.M., 2003. Calcitonin-like
immunoreactivity in serum and tissues of the bonnethead shark, Sphyrna tiburo. J. Exp.
Zool. A. Comp. Exp. Biol. 298, 150-161.
Okuda, R., Sasyama, Y., Suzuki, N., Kambegawa, A., Srivastav, A. K., 1999. Calcitonin
cells in the intestine of goldfish and a comparison of the number of cells among
saline-fed, soup-fed, or high Ca soup-fed fishes. Gen. Comp. Endocrinol. 113, 267-273.
Olsson, C., Holmberg, A., Holmgren, S., 2008. Development of enteric and vagal
innervation of the zebrafish (Danio rerio) gut. J. Comp. Neurol. 508, 756-770.
Poyner, D.R., 1992. Calcitonin gene-related peptide: Multiple actions, multiple receptors.
16

Pharmac. Ther. 56, 23-51.
Qi, L.J., Leung, A.T., Xiong, Y., Marx, K.A., Abou-Samra, A.-B., 1997. Extracellular
cysteines of the corticotropin-releasing factor receptor are critical for ligand interaction.
Biochemistry 36, 12442-12448.
Rosenfeld, M.G., Mermod, J.-J., Amara, S.G., Swanson, L.W., Sawchenko, P.E., Rivier, J.,
Vale, W.W., Evans, R.M., 1983. Production of a novel neuropeptide encoded by the
calcitonin gene via tissue-specific RNA processing. Nature 304, 129-135.
Saitou, N., Nei, M., 1987. The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Mol. Biol. Evol. 4, 406-425.
Sexton, P.M., Albiston, A., Morfis, M., Tilakaratne, N., 2001. Receptor activity modifying
proteins. Cell. Signal. 13, 73-83.
Shahbazi, F., Karila, P., Olsson, C., Holmgren, S., Conlon, J.M., Jensen, J., 1998. Primary
structure, distribution, and effects on motility of CGRP in the intestine of the cod Gadus
morhua. Am. J. Physiol. Regul. Integr. Comp. Physiol. 275, R19-28.
Sondergaard, B.C., Wulf, H., Henriksen, K., Schaller, S., Oestergaard, S., Qvist, P., Tankó,
L.B., Bagger, Y.Z., Christiansen, C., Karsdal, M.A. 2006. Calcitonin directly attenuates
collagen type II degradation by inhibition of matrix metalloproteinase expression and
activity in articular chondrocytes. Osteoarthritis Cartilage 14,759-768.
Suzuki, N., Eguchi, C., Hirai, T., Sasayama, Y., 1997. Nucleotide sequences of reptile
calcitonins: Their high homology to chicken calcitonin. Zool. Sci. 14, 833-836.
Suzuki, N., Suzuki, D., Sasayama, Y., Srivastav, A. K., Kambegawa, A., Asahina, K., 1999.
Plasma calcium and calcitonin levels in eels fed a high calcium solution or transferred
to seawater. Gen. Comp. Endocrinol. 114, 324-329.
Suzuki, N., Suzuki, T., Kurokawa, T., 2000. Cloning of a calcitonin gene-related peptide
17

eceptor and a novel calcitonin receptor-like receptor from the gill of flounder,
Paralichthys olivaceus. Gene 244, 81-88.
Suzuki, N., Suzuki, T. and Kurokawa, T., 2001. Cloning of a calcitonin gene-related
peptide from genomic DNA and its mRNA expression in flounder, Paralichthys
olivaceus. Peptides 22, 1435-1438.
Suzuki, N., Suzuki, T. and Kurokawa, T., 2002. Possible involvement of calcitonin
gene-related peptide in seawater adaptation of flounder: Expression analysis of its
receptor mRNA in the gill. Fisheries Sci. 68, 425-429.
Takahashi, H., Prunet, P., Kitahashi, T., Kajimura, S., Hirano, T., Grau, E.G., Sakamoto, T.,
2007. Prolactin receptor and proliferating/apoptotic cells in esophagus of the
Mozambique tilapia (Oreochromis mossambicus) in fresh water and in seawater. Gen.
Comp. Endocrinol. 152, 326–331.
De Vlaming, V.L., Sage, M., 1973. Osmoregulation in the euryhaline elasmobranch,
Dasyatis Sabina. Comp. Biochem. Physiol. 45A, 31-44.
Wimalawansa, S.J., 1997. Amylin, calcitonin gene-related peptide, calcitonin, and
adrenomedullin: A peptide superfamily. Crit. Rev. Neurobiol. 11, 167-239.
Yamamoto, K., Suzuki, N., Takahashi, N., Sasayama, Y., Kikuyama, S., 1996. Estrogen
receptors in the stingray (Dasyatis akajei) ultimobranchial gland. Gen. Comp.
Endocrinol. 101, 107-114.
18

Figure Legends
Fig. 1. Location and sequence of primers. The CRLR and CTR molecules have four
extracellular domains (Ecd) 1-4, seven transmembrane domains (Tmd 1-7), and for
intracellular domains (Icd 1-4). The PCR primers were designed to the highly conserved
region of the mammalian CRLR and CTR cDNA sequences.
Fig. 2. Tissue specific expression of ray CRLR and ray CTR-like mRNAs by RT-PCR.
After PCR amplification, the PCR products were analyzed on 2.5% NuSive GTG agarose
gel (FMC Bioproducts, ME, USA) and stained with ethidium bromide.
Fig. 3. Changes in mRNA expression of both ray CRLR and CTR-like receptors in the gill
(A) and kidney (B) when transferred to diluted (20%) seawater. * indicates statistically
significant difference at P < 0.05 from the values in the control. The data expressed as
mean ± SEM (n = 8).
19

Supplementary data of Legends
Fig. 1. Nucleotide and deduced amino-acid sequences of ray CRLR cDNA. The
nucleotide sequence obtained by PCR using a 5’B/3’B primer set is shown in bold. The
boxes and underlining indicate the location of 5’ RACE primers and 3’ RACE primers,
respectively. The stop codon TGA is indicated by the asterisk. This data has been
available under Genbank accession no. AB665754.
Fig. 2. Nucleotide and deduced amino-acid sequences of ray CTR-like cDNA. The
nucleotide sequence obtained by PCR using a 5’B/3’B primer set is shown in bold. The
boxes and underlining indicate the location of 5’ RACE primers and 3’ RACE primers,
respectively. The stop codon TGA is indicated by the asterisk. This data has been
available under Genbank accession no. AB665755.
Fig. 3. Multiple alignment of the amino-acid sequences of flounder CRLR (fCRLR),
flounder CTR (fCTR), human CRLR (hCRLR), human CTR (hCTR), stingray CRLR (ray
CRLR), and stingray CTR-like (ray CTR-like). Deletion of amino-acid residues is
indicated by dashes. Conserved amino-acid residues at least three sequences are indicated
by shaded areas. Underlining indicate putative transmembrane domains I to VII. # and *
indicate potential N-linked glycosylation sites and cysteine residues commonly to these
receptors, respectively. DDBJ/EMBL/GenBank accession numbers are as follow: fCRLR
(AB035314), fCTR (AB035315), hCRLR (NP_005786), hCTR (NP_001733), ray CRLR
(AB665754), and ray CTR-like (AB665755).
20

Fig. 4. Phylogenetic tree of CRLRs and CTRs constructed by the neighbor-joining
method. The number beside each branch indicates the percentage of times that a node was
supported in 1000 bootstrap pseudoreplications. The scale bar indicates an evolutionary
distance of 0.1 amino acid substitutions per protein.
21

ECD1
Location of primer sets
TMD1 TMD2 TMD3 TMD4 TMD5 TMD6 TMD7
ICD1 ECD2 ICD2 ECD3 ICD3 ECD4 ICD4
Forward primer Reverse primer
1
2
Forward primer
1:GYAAYMGXACXTGGGAYGG
2:GAYTAYTTYCCXGAYTTYGA
2
1
TMD: transmembrane domain
ECD: extracellular domain
ICD: intracellular domain
Reverse primer
1:CCYTCRCAXARCATCCARAA
2:CATCCARAARTARTTRCA
Figure 1 Suzuki et al.

CRLR
CTR-like
�-actin
Figure 2Suzuki et al.

A) Gill
CRLR or CTR mRNA expression
(CTR or CRLR/ �-actin)
1000
900
800
700
600
500
400
300
200
100
0
CRLR
100% Seawater-adapted stingray
20% Seawater-adapted stingray
*
*
CTR-like
B) Kidney
CRLR or CTR mRNA expression
(CTR or CRLR/ �-actin)
40
35
30
25
20
15
10
5
0
100% Seawater-adapted stingray
20% Seawater-adapted stingray
CRLR
*
CTR-like
Figure 3 Suzuki et al.