Womb as Paradise Lost

Womb as Paradise Lost – Foetal Programming
Thetic Part – Medical power in a narcissistic culture
265
We already have seen that the number 26 inside the nature and culture is explicitly
more than striking and necessitates further research.
Since mathematics is the language of exact science, I looked for a possible continuation
of the special nature of the number 26 in mathematics as a abstract science.
I met the work of the French mathematician Pierre Fermat (1601-1665). The
number 53 mentioned above plays a central role which is described in the second
Philosophical Introduction as the numerical value of "Garden in the east, in
Eden," popularized as paradise, but which in Hebrew means Ng - gan (garden). We
already saw that permutation could create a space between the two letters.
Again we apply permutation, and we consider the numerical value of Ng as two
separate numbers 5 and 3.
14.9 Last Theorem of Fermat and 26
I returned to the DNA test, reread the book of Kevin Davies and discovered that
the stop and start codons of a human chromosome end with 5 and 3, or vice versa
3 and 5. 247 Back at the permuted Garden (5-3), we not only obtain a view of the
figure 26, but also to the DNA, which has a relation with the number 26 and its
derivations.
First a brief interlude, as a repetition of the earlier description in the introduction
of Simon Singh's book "Last Theorem of Fermat”. 248
247 Davies, Kevin, The code of life, Prometeus Amsterdam 2001: “The special 'end of the human chromosome is as
follows”:GCGATTGGGATTGGGATTGGGATTGGGATT – (5’)
CCCTAACCCTAACCCTAACCCTAA – (3’).
The double stranded RNA does not end in a neat manner, but stuttering tips ... for the fact hunters, from the above sequence
shows that the first letter in the book of life is a G ", p. 64.
248 The subtitle of the book indicates the importance, "the story of a proposition that the greatest minds of the earth 358
years until desperation drove" ... with the statement: "If n> 2 there are no solutions x n + y n = z n .” A variant of the Pythagorean
theorem: x 2 + y 2 = z 2 in whole numbers: (3 x 3) + (4 x 4) = (5 x 5) or 9 + 16 = 25.