Womb as Paradise Lost

Recommendations

Info

Womb as Paradise Lost – Foetal ProgrammingThetic Part – Medical power in a narcissistic culture264Some examples of Fibonacci Super Lissajous figures.These forms are the result of operations of the Fibonacci series(Ad Commeren)My research is involved with the actual reality of the creative energy, which ismade current by the present substance, which receives numerical values, meaningswhich are important for the entire humanity and science.Here we are back at the downward causation, in which are emergent processeswhich produce not apparently planned phenomena.Commeren: the "emergent process" from its precise vision of reality show unleashesawesome form.For the process in which these forms in an emergent manner have arisen, as aresult of the fact that everything is in motion, within the creative space of evercontinuingcreation. See the website on which the process is placed:http://fiboart.jouwweb.nl.The phenomenon of "emergent process" is not at odds with the downward causation,unless the driving source of permanent emanation of creative energy is notreplaced by Darwinian upward causation, as "dogmatic evolutionist, materialisticphenomenon".
Womb as Paradise Lost – Foetal ProgrammingThetic Part – Medical power in a narcissistic culture265We already have seen that the number 26 inside the nature and culture is explicitlymore than striking and necessitates further research.Since mathematics is the language of exact science, I looked for a possible continuationof the special nature of the number 26 in mathematics as a abstract science.I met the work of the French mathematician Pierre Fermat (1601-1665). Thenumber 53 mentioned above plays a central role which is described in the secondPhilosophical Introduction as the numerical value of "Garden in the east, inEden," popularized as paradise, but which in Hebrew means Ng - gan (garden). Wealready saw that permutation could create a space between the two letters.Again we apply permutation, and we consider the numerical value of Ng as twoseparate numbers 5 and 3.14.9 Last Theorem of Fermat and 26I returned to the DNA test, reread the book of Kevin Davies and discovered thatthe stop and start codons of a human chromosome end with 5 and 3, or vice versa3 and 5. 247 Back at the permuted Garden (5-3), we not only obtain a view of thefigure 26, but also to the DNA, which has a relation with the number 26 and itsderivations.First a brief interlude, as a repetition of the earlier description in the introductionof Simon Singh's book "Last Theorem of Fermat”. 248247 Davies, Kevin, The code of life, Prometeus Amsterdam 2001: “The special 'end of the human chromosome is asfollows”:GCGATTGGGATTGGGATTGGGATTGGGATT – (5’)CCCTAACCCTAACCCTAACCCTAA – (3’).The double stranded RNA does not end in a neat manner, but stuttering tips ... for the fact hunters, from the above sequenceshows that the first letter in the book of life is a G ", p. 64.248 The subtitle of the book indicates the importance, "the story of a proposition that the greatest minds of the earth 358years until desperation drove" ... with the statement: "If n> 2 there are no solutions x n + y n = z n .” A variant of the Pythagoreantheorem: x 2 + y 2 = z 2 in whole numbers: (3 x 3) + (4 x 4) = (5 x 5) or 9 + 16 = 25.
Page 1 and 2:
Womb as Paradise Lost
Page 3 and 4:
Womb as Paradise LostRegained by th
Page 5 and 6:
Womb as Paradise Lost - Foetal Prog
Page 7 and 8:
Page 9 and 10:
Page 11 and 12:
Page 13 and 14:
Page 15 and 16:
Page 17 and 18:
Page 19 and 20:
Page 21 and 22:
Page 23 and 24:
Page 25 and 26:
Page 27 and 28:
Page 29 and 30:
Page 31 and 32:
Page 33 and 34:
33Womb as Paradise Lost - Foetal Pr
Page 35 and 36:
Page 37 and 38:
Page 39 and 40:
Page 41 and 42:
Page 43 and 44:
Page 45 and 46:
Page 47 and 48:
Page 49 and 50:
Page 51 and 52:
Page 53 and 54:
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62:
Page 63 and 64:
Page 65 and 66:
Page 67 and 68:
Page 69 and 70:
Page 71 and 72:
Page 73 and 74:
Page 75 and 76:
Page 77 and 78:
Page 79 and 80:
Page 81 and 82:
Page 83 and 84:
Page 85 and 86:
Page 87 and 88:
Page 89 and 90:
Page 91 and 92:
Page 93 and 94:
Page 95 and 96:
Page 97 and 98:
Page 99 and 100:
Page 101 and 102:
Page 103 and 104:
Page 105 and 106:
Page 107 and 108:
Page 109 and 110:
Page 111 and 112:
Page 113 and 114:
Page 115 and 116:
Page 117 and 118:
Page 119 and 120:
Page 121 and 122:
Page 123 and 124:
Page 125 and 126:
Page 127 and 128:
Page 129 and 130:
Page 131 and 132:
Page 133 and 134:
Page 135 and 136:
Page 137 and 138:
Page 139 and 140:
Page 141 and 142:
Page 143 and 144:
Page 145 and 146:
Page 147 and 148:
Page 149 and 150:
Page 151 and 152:
Page 153 and 154:
Page 155 and 156:
Page 157 and 158:
Page 159 and 160:
Page 161 and 162:
Page 163 and 164:
Page 165 and 166:
Page 167 and 168:
Page 169 and 170:
Page 171 and 172:
Page 173 and 174:
Page 175 and 176:
Page 177 and 178:
Page 179 and 180:
Page 181 and 182:
Page 183 and 184:
Page 185 and 186:
Page 187 and 188:
Page 189 and 190:
Page 191 and 192:
Page 193 and 194:
Page 195 and 196:
Page 197 and 198:
Page 199 and 200:
Page 201 and 202:
Page 203 and 204:
Page 205 and 206:
Page 207 and 208:
Page 209 and 210:
Page 211 and 212:
Page 213 and 214: Womb as Paradise Lost - Foetal Prog
Page 263: Womb as Paradise Lost - Foetal Prog
Page 315 and 316:
Page 317 and 318:
Page 319 and 320:
Page 321 and 322:
Page 323 and 324:
Page 325 and 326:
Page 327 and 328:
Page 329 and 330:
Page 331 and 332:
Page 333 and 334:
Page 335 and 336:
Page 337 and 338:
Page 339 and 340:
Page 341 and 342:
Page 343 and 344:
Page 345 and 346:
Page 347 and 348:
Page 349 and 350:
Page 351 and 352:
Page 353 and 354:
Page 355 and 356:
Page 357 and 358:
Page 359 and 360:
Page 361 and 362:
Page 363 and 364:
Page 365 and 366:
Page 367 and 368:
Page 369 and 370:
Page 371 and 372:
Page 373 and 374:
Page 375 and 376:
Page 377 and 378:
Page 379 and 380:
Page 381 and 382:
Page 383 and 384:
Page 385 and 386:
Page 387 and 388:
Page 389 and 390:
Page 391 and 392:
Page 393 and 394:
Page 395 and 396:
Page 397 and 398:
Page 399 and 400:
Page 401 and 402:
Page 403 and 404:
Page 405 and 406:
Page 407 and 408:
Page 409 and 410:
Page 411 and 412:
Page 413 and 414:
Page 415 and 416:
Page 417 and 418:
Page 419 and 420:
Page 421 and 422:
Page 423 and 424:
Page 425 and 426:
Page 427 and 428:
Page 429 and 430:
Page 431 and 432:
Page 433 and 434:
Page 435 and 436:
Page 437 and 438:
Page 439 and 440:
Page 441 and 442:
Page 443 and 444:
Page 445 and 446:
Page 447 and 448:
Page 449 and 450:
Page 451 and 452:
Page 453 and 454:
Page 455 and 456:
Page 457 and 458:
Page 459 and 460:
Page 461 and 462:
Page 463 and 464:
Page 465 and 466:
Page 467 and 468:
Page 469 and 470:
Page 471 and 472:
Page 473 and 474:
Page 475 and 476:
Page 477 and 478:
Page 479 and 480:
Page 481 and 482:
Page 483 and 484:
Page 485 and 486:
Page 487 and 488:
Page 489 and 490:
Page 491 and 492:
Page 493 and 494:
Page 495 and 496:
Page 497 and 498:
Page 499 and 500:
Page 501 and 502:
Page 503 and 504:
Page 505 and 506:
Page 507 and 508:
Page 509 and 510:
Page 511 and 512:
Page 513 and 514:
Page 515 and 516:
Page 517 and 518:
Page 519 and 520:
Page 521 and 522:
Page 523 and 524:
Page 525 and 526:
Page 527 and 528:
Page 529 and 530:
Page 531 and 532:
Page 533 and 534:
Page 535 and 536:
Page 537 and 538:
Page 539 and 540:
Page 541 and 542:
Page 543 and 544:
Page 545 and 546:
Page 547 and 548:
Page 549 and 550:
Page 551 and 552:
Page 553 and 554:
Page 555 and 556:
Page 557 and 558:
Page 559 and 560:
Page 561 and 562:
Page 563 and 564:
Page 565 and 566:
Page 567 and 568:
Page 569 and 570:
Page 571 and 572:
Page 573 and 574:
Page 575 and 576:
Page 577 and 578:
Page 579 and 580:
Page 581 and 582:
Page 583 and 584:
Page 585 and 586:
Page 587 and 588:
Page 589 and 590:
Page 591 and 592:
Page 593 and 594:
Page 595 and 596:
Page 597 and 598:
Page 599 and 600:
Page 601 and 602:
Page 603 and 604:
Page 605 and 606:
Page 607 and 608:
Page 609 and 610:
Page 611 and 612:
Page 613 and 614:
Page 615 and 616:
Page 617 and 618:
Page 619 and 620:
Page 621 and 622:
Page 623 and 624:
Page 625 and 626:
Page 627 and 628:
Page 629 and 630:
Page 631 and 632:
Page 633 and 634:
Page 635 and 636:
Page 637 and 638:
Page 639 and 640:
Page 641 and 642:
Page 643 and 644:
Page 645 and 646:
show all

Womb as Paradise Lost

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?