tjh
tjh
tjh
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
Volume 37 Issue 2
June 2020
E-ISSN: 1308-5263
TURKISH JOURNAL OF HEMATOLOGY • VOL.: 37 ISSUE: 2 JUNE 2020
Research Articles
In Silico Study of Correlation between Missense Variations of F8 Gene and Inhibitor Formation in Severe Hemophilia A
Mostefa Fodil and Faouzia Zemani; Oran, Algeria
Splenic Marginal Zone Lymphoma in Turkey: Association with Hepatitis B Instead of Hepatitis C Virus as an Etiologic and
Possible Prognostic Factor - A Multicenter Cohort Study
Müfide Okay et al.; Ankara, Edirne, Trabzon, Samsun, Kayseri, İzmir, Denizli, Van, Erzurum, İstanbul, Malatya, Turkey
Bortezomib-based Regimens Improve the Outcome of Patients with Primary or Secondary Plasma Cell Leukemia: A
Retrospective Cohort Study
Huijuan Wang et al.; Beijing, China
PTEN and AKT1 Variations in Childhood T-Cell Acute Lymphoblastic Leukemia
Fulya Küçükcankurt et al.; İstanbul, Turkey
Expression Profile Screening and Bioinformatics Analysis of circRNA, LncRNA, and mRNA in Acute Myeloid Leukemia
Drug-Resistant Cells
Meiling Li et al.; Xiamen, Duyun, China
Cover Picture:
Chandan Kumar, Garima Jain, Anita
Chopra, New Delhi, India
Garland of Erythroblasts around a
Macrophage: Erythroblastic Island
2
Editor-in-Chief
Reyhan Küçükkaya
İstanbul, Turkey
rkucukkaya@hotmail.com
Associate Editors
A. Emre Eşkazan
İstanbul University-Cerrahpaşa,
İstanbul, Turkey
Ayşegül Ünüvar
İstanbul University, İstanbul, Turkey
aysegulu@hotmail.com
Cengiz Beyan
cengizbeyan@hotmail.com
Hale Ören
Dokuz Eylül University, İzmir, Turkey
hale.oren@deu.edu.tr
İbrahim C. Haznedaroğlu
Hacettepe University, Ankara, Turkey
haznedar@yahoo.com
Selami Koçak Toprak
Ankara University, Ankara, Turkey
sktoprak@yahoo.com
Semra Paydaş
Çukurova University, Adana, Turkey
sepay@cu.edu.tr
Şule Ünal
Hacettepe University, Ankara, Turkey
Assistant Editors
Ali İrfan Emre Tekgündüz
Dr. A. Yurtaslan Ankara Oncology Training
and Research Hospital, Ankara, Turkey
Claudio Cerchione
University of Naples Federico II Napoli,
Campania, Italy
Elif Ünal İnce
Ankara University, Ankara, Turkey
İnci Alacacıoğlu
Dokuz Eylül University, İzmir, Turkey
Müge Sayitoğlu
İstanbul University, İstanbul, Turkey
Nil Güler
Ondokuz Mayıs University, Samsun, Turkey
Olga Meltem Akay
Koç University, İstanbul, Turkey
Veysel Sabri Hançer
İstinye University, İstanbul, Turkey
Zühre Kaya
Gazi University, Ankara, Turkey
International Review Board
Nejat Akar
Görgün Akpek
Serhan Alkan
Çiğdem Altay
Koen van Besien
Ayhan Çavdar
M. Sıraç Dilber
Ahmet Doğan
Peter Dreger
Thierry Facon
Jawed Fareed
Gösta Gahrton
Dieter Hoelzer
Marilyn Manco-Johnson
Andreas Josting
Emin Kansu
Winfried Kern
Nigel Key
Korgün Koral
Abdullah Kutlar
Luca Malcovati
Robert Marcus
Jean Pierre Marie
Ghulam Mufti
Gerassimos A. Pangalis
Antonio Piga
Ananda Prasad
Jacob M. Rowe
Jens-Ulrich Rüffer
Norbert Schmitz
Orhan Sezer
Anna Sureda
Ayalew Tefferi
Nükhet Tüzüner
Catherine Verfaillie
Srdan Verstovsek
Claudio Viscoli
Past Editors
Erich Frank
Orhan Ulutin
Hamdi Akan
Aytemiz Gürgey
Senior Advisory Board
Yücel Tangün
Osman İlhan
Muhit Özcan
Teoman Soysal
Ahmet Muzaffer Demir
TOBB University of Economics and Technology Hospital, Ankara, Turkey
Maryland School of Medicine, Baltimore, USA
Cedars-Sinai Medical Center, USA
Ankara, Turkey
University of Chicago Medical Center, Chicago, USA
Ankara, Turkey
Karolinska University, Stockholm, Sweden
Mayo Clinic Saint Marys Hospital, USA
Heidelberg University, Heidelberg, Germany
Lille University, Lille, France
Loyola University, Maywood, USA
Karolinska University Hospital, Stockholm, Sweden
Frankfurt University, Frankfurt, Germany
University of Colorado Anschutz Medical Campus, USA
University Hospital Cologne, Cologne, Germany
Hacettepe University, Ankara, Turkey
Albert Ludwigs University, Germany
University of North Carolina School of Medicine, NC, USA
Southwestern Medical Center, Texas, USA
Medical College of Georgia at Augusta University, Augusta, USA
Pavia Medical School University, Pavia, Italy
Kings College Hospital, London, UK
Pierre et Marie Curie University, Paris, France
King’s Hospital, London, UK
Athens University, Athens, Greece
Torino University, Torino, Italy
Wayne State University School of Medicine, Detroit, USA
Rambam Medical Center, Haifa, Israel
University of Köln, Germany
AK St Georg, Hamburg, Germany
University Medical Center Hamburg, Germany
Santa Creu i Sant Pau Hospital, Barcelona, Spain
Mayo Clinic, Rochester, Minnesota, USA
İstanbul Cerrahpaşa University, İstanbul, Turkey
University of Minnesota, Minnesota, USA
The University of Texas MD Anderson Cancer Center, Houston, USA
San Martino University, Genoa, Italy
Language Editor
Leslie Demir
Statistic Editor
Hülya Ellidokuz
Editorial Office
İpek Durusu
Bengü Timoçin Efe
A-I
Publishing
Services
GALENOS PUBLISHER
Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey
Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr
Contact Information
Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya
E-mail : rkucukkaya@hotmail.com
All Inquiries Should be Addressed to
TURKISH JOURNAL OF HEMATOLOGY
Address : Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey
Phone : +90 312 490 98 97
Fax : +90 312 490 98 68
E-mail : info@tjh.com.tr
E-ISSN: 1308-5263
Publishing Manager
Muhlis Cem Ar
Management Address
Türk Hematoloji Derneği
Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.)
No: 8 06550 Çankaya, Ankara / Turkey
Online Manuscript Submission
http://mc.manuscriptcentral.com/tjh
Web Page
www.tjh.com.tr
Owner on Behalf of the Turkish Society
of Hematology
Güner Hayri Özsan
Publishing House
Molla Gürani Mah. Kaçamak Sk. No: 21,
34093 Fındıkzade, İstanbul, Turkey
Tel: +90 212 621 99 25
Fax: +90 212 621 99 27
E-mail: info@galenos.com.tr
Publisher Certificate Number: 14521
Publication Date
06.05.2020
Cover Picture
Chandan Kumar, Garima Jain, Anita Chopra, New Delhi, India
Garland of Erythroblasts around a Macrophage: Erythroblastic
Island
Bone marrow aspiration smear showed immature cells with
disseminated intranuclear/intracytoplasmic vacuolization.
International scientific journal published quarterly.
The Turkish Journal of Hematology is published by the commercial enterprise
of the Turkish Society of Hematology with Decision Number 6 issued by the
Society on 7 October 2008.
A-II
AIMS AND SCOPE
The Turkish Journal of Hematology is published quarterly (March, June,
September, and December) by the Turkish Society of Hematology. It is an
independent, non-profit peer-reviewed international English-language
periodical encompassing subjects relevant to hematology.
The Editorial Board of The Turkish Journal of Hematology adheres to the
principles of the World Association of Medical Editors (WAME), International
Council of Medical Journal Editors (ICMJE), Committee on Publication
Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and
Strengthening the Reporting of Observational Studies in Epidemiology
(STROBE).
The aim of The Turkish Journal of Hematology is to publish original
hematological research of the highest scientific quality and clinical relevance.
Additionally, educational material, reviews on basic developments, editorial
short notes, images in hematology, and letters from hematology specialists
and clinicians covering their experience and comments on hematology and
related medical fields as well as social subjects are published. As of December
2015, The Turkish Journal of Hematology does not accept case reports.
Important new findings or data about interesting hematological cases may
be submitted as a brief report.
General practitioners interested in hematology and internal medicine
specialists are among our target audience, and The Turkish Journal of
Hematology aims to publish according to their needs. The Turkish Journal of
Hematology is indexed, as follows:
- PubMed Medline
- PubMed Central
- Science Citation Index Expanded
- EMBASE
- Scopus
- CINAHL
- Gale/Cengage Learning
- EBSCO
- DOAJ
- ProQuest
- Index Copernicus
- Tübitak/Ulakbim Turkish Medical Database
- Turk Medline
- Hinari
- GOALI
- ARDI
- OARE
Impact Factor: 0.779
Open Access Policy
Turkish Journal of Hematology is an Open Access journal. This journal
provides immediate open access to its content on the principle that making
research freely available to the public supports a greater global exchange of
knowledge.
Open Access Policy is based on the rules of the Budapest Open Access
Initiative (BOAI) http://www.budapestopenaccessinitiative.org/.
Subscription Information
The Turkish Journal of Hematology is published electronically only as of
2019. Therefore, subscriptions are not necessary. All published volumes are
available in full text free-of-charge online at www.tjh.com.tr.
Address: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613.
Sok.) No: 8 06550 Çankaya, Ankara / Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: info@tjh.com.tr
Permissions
Requests for permission to reproduce published material should be sent to
the editorial office.
Editor: Professor Dr. Reyhan Küçükkaya
Adress: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613.
Sok.) No: 8 06550 Çankaya, Ankara / Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: info@tjh.com.tr
Publisher
Galenos Yayınevi
Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey
Telephone : +90 212 621 99 25
Fax : +90 212 621 99 27
info@galenos.com.tr
Instructions for Authors
Instructions for authors are published in the journal and at www.tjh.com.tr
Material Disclaimer
Authors are responsible for the manuscripts they publish in The Turkish
Journal of Hematology. The editor, editorial board, and publisher do not
accept any responsibility for published manuscripts.
If you use a table or figure (or some data in a table or figure) from another
source, cite the source directly in the figure or table legend.
Editorial Policy
Following receipt of each manuscript, a checklist is completed by the Editorial
Assistant. The Editorial Assistant checks that each manuscript contains all
required components and adheres to the author guidelines, after which time
it will be forwarded to the Editor in Chief. Following the Editor in Chief’s
evaluation, each manuscript is forwarded to the Associate Editor, who in
turn assigns reviewers. Generally, all manuscripts will be reviewed by at least
three reviewers selected by the Associate Editor, based on their relevant
expertise. Associate editor could be assigned as a reviewer along with the
reviewers. After the reviewing process, all manuscripts are evaluated in the
Editorial Board Meeting.
Turkish Journal of Hematology’s editor and Editorial Board members are active
researchers. It is possible that they would desire to submit their manuscript
to the Turkish Journal of Hematology. This may be creating a conflict of
interest. These manuscripts will not be evaluated by the submitting editor(s).
The review process will be managed and decisions made by editor-in-chief
who will act independently. In some situation, this process will be overseen
by an outside independent expert in reviewing submissions from editors.
A-III
TURKISH JOURNAL OF HEMATOLOGY
INSTRUCTIONS FOR AUTHORS
The Turkish Journal of Hematology accepts invited review articles,
research articles, brief reports, letters to the editor, and hematological
images that are relevant to the scope of hematology, on the condition
that they have not been previously published elsewhere. Basic science
manuscripts, such as randomized, cohort, cross-sectional, and casecontrol
studies, are given preference. All manuscripts are subject
to editorial revision to ensure they conform to the style adopted by
the journal. There is a double-blind reviewing system. Review articles
are solicited by the Editor-in-Chief. Authors wishing to submit an
unsolicited review article should contact the Editor-in-Chief prior to
submission in order to screen the proposed topic for relevance and
priority.
The Turkish Journal of Hematology does not charge any article
submission or processing charges.
Manuscripts should be prepared according to ICMJE guidelines (http://
www.icmje.org/). Original manuscripts require a structured abstract.
Label each section of the structured abstract with the appropriate
subheading (Objective, Materials and Methods, Results, and Conclusion).
Letters to the editor do not require an abstract. Research or project
support should be acknowledged as a footnote on the title page.
Technical and other assistance should be provided on the title page.
Original Manuscripts
Title Page
Title: The title should provide important information regarding the
manuscript’s content. The title must specify that the study is a cohort
study, cross-sectional study, case-control study, or randomized study (i.e.
Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability
of ferrous succinate tablet formulations without correction for baseline
circadian changes in iron concentration in healthy Chinese male
subjects: A single-dose, randomized, 2-period crossover study. Clin Ther
2011;33:2054-2059).
The title page should include the authors’ names, degrees, and
institutional/professional affiliations and a short title, abbreviations,
keywords, financial disclosure statement, and conflict of interest
statement. If a manuscript includes authors from more than one
institution, each author’s name should be followed by a superscript
number that corresponds to their institution, which is listed separately.
Please provide contact information for the corresponding author,
including name, e-mail address, and telephone and fax numbers.
Important Notice: The title page should be submitted separately.
Running Head: The running head should not be more than 40
characters, including spaces, and should be located at the bottom of
the title page.
Word Count: A word count for the manuscript, excluding abstract,
acknowledgments, figure and table legends, and references, should be
provided and should not exceed 2500 words. The word count for the
abstract should not exceed 300 words.
Conflict of Interest Statement: To prevent potential conflicts of
interest from being overlooked, this statement must be included in each
manuscript. In case there are conflicts of interest, every author should
complete the ICMJE general declaration form, which can be obtained at
http://www.icmje.org/downloads/coi_disclosure.zip
Abstract and Keywords: The second page should include an abstract
that does not exceed 300 words. For manuscripts sent by authors in
Turkey, a title and abstract in Turkish are also required. As most readers
read the abstract first, it is critically important. Moreover, as various
electronic databases integrate only abstracts into their index, important
findings should be presented in the abstract.
Objective: The abstract should state the objective (the purpose of the
study and hypothesis) and summarize the rationale for the study.
Materials and Methods: Important methods should be written
respectively.
Results: Important findings and results should be provided here.
Conclusion: The study’s new and important findings should be
highlighted and interpreted.
Other types of manuscripts, such as reviews, brief reports, and
editorials, will be published according to uniform requirements.
Provide 3-10 keywords below the abstract to assist indexers. Use
terms from the Index Medicus Medical Subject Headings List
(for randomized studies a CONSORT abstract should be provided: http://
www.consort-statement.org).
Introduction: The introduction should include an overview of the
relevant literature presented in summary form (one page), and whatever
remains interesting, unique, problematic, relevant, or unknown about
the topic must be specified. The introduction should conclude with the
rationale for the study, its design, and its objective(s).
Materials and Methods: Clearly describe the selection of observational
or experimental participants, such as patients, laboratory animals, and
controls, including inclusion and exclusion criteria and a description of
the source population. Identify the methods and procedures in sufficient
detail to allow other researchers to reproduce your results. Provide
references to established methods (including statistical methods),
provide references to brief modified methods, and provide the rationale
for using them and an evaluation of their limitations. Identify all drugs
and chemicals used, including generic names, doses, and routes of
administration. The section should include only information that was
available at the time the plan or protocol for the study was devised
A-IV
(https://www.strobe-statement.org/fileadmin/Strobe/uploads/checklists/
STROBE_checklist_v4_combined.pdf).
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
the reported results. Statistically important data should be given in the
text, tables, and figures. Provide details about randomization, describe
treatment complications, provide the number of observations, and specify
all computer programs used.
Results: Present your results in logical sequence in the text, tables, and
figures. Do not present all the data provided in the tables and/or figures
in the text; emphasize and/or summarize only important findings, results,
and observations in the text. For clinical studies provide the number of
samples, cases, and controls included in the study. Discrepancies between
the planned number and obtained number of participants should be
explained. Comparisons and statistically important values (i.e. p-value
and confidence interval) should be provided.
Discussion: This section should include a discussion of the data. New and
important findings/results and the conclusions they lead to should be
emphasized. Link the conclusions with the goals of the study, but avoid
unqualified statements and conclusions not completely supported by the
data. Do not repeat the findings/results in detail; important findings/results
should be compared with those of similar studies in the literature, along with
a summarization. In other words, similarities or differences in the obtained
findings/results with those previously reported should be discussed.
Study Limitations: Limitations of the study should be detailed. In
addition, an evaluation of the implications of the obtained findings/
results for future research should be outlined.
Conclusion: The conclusion of the study should be highlighted.
References
Cite references in the text, tables, and figures with numbers in square
brackets. Number references consecutively according to the order in
which they first appear in the text. Journal titles should be abbreviated
according to the style used in Index Medicus (consult List of Journals
Indexed in Index Medicus). Include among the references any paper
accepted, but not yet published, designating the journal followed by “in
press”.
Examples of References:
1. List all authors
Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow
transplantation from unrelated donors for patients with aplastic anemia
after failure of immunosuppressive therapy. Blood 2006;108:1485-1491.
2. Organization as author
Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of
syngeneic bone marrow graft without preconditioning in post-hepatitis
marrow aplasia. Lancet 1977;2:742-744.
3. Book
Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.
4. Book Chapter
Perutz MF. Molecular anatomy and physiology of hemoglobin. In:
Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin:
Genetics, Pathophysiology, Clinical Management. New York, Cambridge
University Press, 2000.
5. Abstract
Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin)
stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).
6. Letter to the Editor
Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further
definition of 20q deletion in myeloid leukemia using fluorescence in situ
hybridization. Blood 1994;84:2821-2823.
7. Supplement
Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant
2005;9(Suppl 7):81-86.
Brief Reports
Abstract length: Not to exceed 150 words.
Article length: Not to exceed 1200 words.
Introduction: State the purpose and summarize the rationale for the study.
Materials and Methods: Clearly describe the selection of the observational
or experimental participants. Identify the methods and procedures in
sufficient detail. Provide references to established methods (including
statistical methods), provide references to brief modified methods, and
provide the rationale for their use and an evaluation of their limitations.
Identify all drugs and chemicals used, including generic names, doses, and
routes of administration.
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
the reported findings/results. Provide details about randomization,
describe treatment complications, provide the number of observations,
and specify all computer programs used.
Results: Present the findings/results in a logical sequence in the text, tables,
and figures. Do not repeat all the findings/results in the tables and figures in
the text; emphasize and/or summarize only those that are most important.
Discussion: Highlight the new and important findings/results of the
study and the conclusions they lead to. Link the conclusions with the
goals of the study, but avoid unqualified statements and conclusions not
completely supported by your data.
Invited Review Articles
Abstract length: Not to exceed 300 words.
Article length: Not to exceed 4000 words.
Review articles should not include more than 100 references. Reviews
should include a conclusion, in which a new hypothesis or study about the
subject may be posited. Do not publish methods for literature search or level
of evidence. Authors who will prepare review articles should already have
published research articles on the relevant subject. The study’s new and
A-V
important findings should be highlighted and interpreted in the Conclusion
section. There should be a maximum of two authors for review articles.
Perspectives in Hematology
“Perspectives” are articles discussing significant topics relevant to
hematology. They are more personal than a Review Article. Authors
wishing to submit a Perspective in Hematology article should contact
the Editor in Chief prior to submission in order to screen the proposed
topic for relevance and priority. Articles submitted for “Perspectives
in Hematology” must advance the hot subjects of experimental and/
or clinical hematology beyond the articles previously published or in
press in TJH. Perspective papers should meet the restrictive criteria of
TJH regarding unique scientific and/or educational value, which will
impact and enhance clinical hematology practice or the diagnostic
understanding of blood diseases. Priority will be assigned to such
manuscripts based upon the prominence, significance, and timeliness of
the content. The submitting author must already be an expert with a
recognized significant published scientific experience in the specific field
related to the “Perspectives” article.
Abstract length: Not to exceed 150 words.
Article length: Not to exceed 1000 words.
References: Should not include more than 50 references
Images in Hematology
Article length: Not to exceed 200 words.
Authors can submit for consideration illustrations or photos that are
interesting, instructive, and visually attractive, along with a few lines
of explanatory text and references. Images in Hematology can include
no more than 200 words of text, 5 references, and 3 figures or tables.
No abstract, discussion, or conclusion is required, but please include a
brief title.
Letters to the Editor
Article length: Not to exceed 500 words.
Letters can include no more than 500 words of text, 5-10 references,
and 1 figure or table. No abstract is required, but please include a brief
title. The total number is usually limited to a maximum of five authors
for a letter to the editor.
Tables
Supply each table in a separate file. Number tables according to the order
in which they appear in the text, and supply a brief caption for each.
Give each column a short or abbreviated heading. Write explanatory
statistical measures of variation, such as standard deviation or standard
error of mean. Be sure that each table is cited in the text.
Figures
Figures should be professionally drawn and/or photographed. Authors
should number figures according to the order in which they appear in
the text. Figures include graphs, charts, photographs, and illustrations.
Each figure should be accompanied by a legend that does not exceed
50 words. Use abbreviations only if they have been introduced in the
text. Authors are also required to provide the level of magnification for
histological slides. Explain the internal scale and identify the staining
method used. Figures should be submitted as separate files, not in
the text file. High-resolution image files are not preferred for initial
submission as the file sizes may be too large. The total file size of the
PDF for peer review should not exceed 5 MB.
Authorship
Each author should have participated sufficiently in the work to assume
public responsibility for the content. Any portion of a manuscript that is
critical to its main conclusions must be the responsibility of at least one
author.
Contributor’s Statement
All submissions should contain a contributor’s statement page. Each
statement should contain substantial contributions to idea and design,
acquisition of data, and analysis and interpretation of findings. All persons
designated as an author should qualify for authorship, and all those that
qualify should be listed. Each author should have participated sufficiently
in the work to take responsibility for appropriate portions of the text.
Acknowledgments
Acknowledge support received from individuals, organizations, grants,
corporations, and any other source. For work involving a biomedical
product or potential product partially or wholly supported by corporate
funding, a note stating, “This study was financially supported (in part)
with funds provided by (company name) to (authors’ initials)”, must
be included. Grant support, if received, needs to be stated and the
specific granting institutions’ names and grant numbers provided when
applicable.
Authors are expected to disclose on the title page any commercial or
other associations that might pose a conflict of interest in connection
with the submitted manuscript. All funding sources that supported the
work and the institutional and/or corporate affiliations of the authors
should be acknowledged on the title page.
Ethics
When reporting experiments conducted with humans indicate that
the procedures were in accordance with ethical standards set forth
by the committee that oversees human subject research. Approval of
research protocols by the relevant ethics committee, in accordance with
international agreements (Helsinki Declaration of 1975, revised 2013
available at https://www.wma.net/policies-post/wma-declaration-ofhelsinki-ethical-principles-for-medical-research-involving-humansubjects/),
is required for all experimental, clinical, and drug studies.
Patient names, initials, and hospital identification numbers should not be
used. Manuscripts reporting the results of experimental investigations
conducted with humans must state that the study protocol received
A-VI
institutional review board approval and that the participants provided
informed consent.
Non-compliance with scientific accuracy is not in accord with scientific
ethics. Plagiarism: To re-publish, in whole or in part, the contents of
another author’s publication as one’s own without providing a reference.
Fabrication: To publish data and findings/results that do not exist.
Duplication: Use of data from another publication, which includes republishing
a manuscript in different languages. Salami slicing: To create
more than one publication by dividing the results of a study unnecessarily.
We disapprove of such unethical practices as plagiarism, fabrication,
duplication, and salami slicing, as well as efforts to influence the
review process with such practices as gifting authorship, inappropriate
acknowledgments, and references. Additionally, authors must respect
participants‘ right to privacy.
On the other hand, short abstracts published in congress books that do
not exceed 400 words and present data of preliminary research, and those
that are presented in an electronic environment, are not considered as
previously published work. Authors in such a situation must declare this
status on the first page of the manuscript and in the cover letter.
(The COPE flowchart is available at http://publicationethics.org.)
We use iThenticate to screen all submissions for plagiarism before
publication.
Conditions of Publication
All authors are required to affirm the following statements before their
manuscript is considered: 1. The manuscript is being submitted only
to The Turkish Journal of Hematology; 2. The manuscript will not be
submitted elsewhere while under consideration by The Turkish Journal
of Hematology; 3. The manuscript has not been published elsewhere,
and should it be published in The Turkish Journal of Hematology it will
not be published elsewhere without the permission of the editors (these
restrictions do not apply to abstracts or to press reports for presentations
at scientific meetings); 4. All authors are responsible for the manuscript’s
content; 5. All authors participated in the study concept and design,
analysis and interpretation of the data, and drafting or revising of the
manuscript and have approved the manuscript as submitted. In addition,
all authors are required to disclose any professional affiliation, financial
agreement, or other involvement with any company whose product
figures prominently in the submitted manuscript.
Authors of accepted manuscripts will receive electronic page proofs and
are responsible for proofreading and checking the entire article within
two days. Failure to return the proof in two days will delay publication.
If the authors cannot be reached by email or telephone within two
weeks, the manuscript will be rejected and will not be published in the
journal.
Copyright
At the time of submission all authors will receive instructions for submitting
an online copyright form. No manuscript will be considered for review until
all authors have completed their copyright form. Please note, it is our practice
not to accept copyright forms via fax, e-mail, or postal service unless there
is a problem with the online author accounts that cannot be resolved. Every
effort should be made to use the online copyright system. Corresponding
authors can log in to the submission system at any time to check the status
of any co-author’s copyright form. All accepted manuscripts become the
permanent property of The Turkish Journal of Hematology and may not be
published elsewhere, in whole or in part, without written permission.
Note: We cannot accept any copyright form that has been altered,
revised, amended, or otherwise changed. Our original copyright form
must be used as is.
Units of Measurement
Measurements should be reported using the metric system, according
to the International System of Units (SI). Consult the SI Unit Conversion
Guide, New England Journal of Medicine Books, 1992.
An extensive list of conversion factors can be found at https://www.
nist.gov/sites/default/files/documents/pml/wmd/metric/SP1038.pdf. For
more details, see http://www.amamanualofstyle.com/oso/public/jama/
si_conversion_table.html.
Abbreviations and Symbols
Use only standard abbreviations. Avoid abbreviations in the title and
abstract. The full term for an abbreviation should precede its first use
in the text, unless it is a standard abbreviation. All acronyms used in the
text should be expanded at first mention, followed by the abbreviation
in parentheses; thereafter the acronym only should appear in the text.
Acronyms may be used in the abstract if they occur 3 or more times
therein, but must be reintroduced in the body of the text. Generally,
abbreviations should be limited to those defined in the AMA Manual of
Style, current edition. A list of each abbreviation (and the corresponding
full term) used in the manuscript must be provided on the title page.
Online Manuscript Submission Process
The Turkish Journal of Hematology uses submission software powered
by ScholarOne Manuscripts. The website for submissions to The Turkish
Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This
system is quick and convenient, both for authors and reviewers.
Setting Up an Account
New users to the submission site will need to register and enter their
account details before they can submit a manuscript. Log in, or click
the “Create Account” button if you are a first-time user. To create a new
account: After clicking the “Create Account” button, enter your name and
e-mail address, and then click the “Next” button. Your e-mail address is very
important. Enter your institution and address information, as appropriate,
and then click the “Next” Button. Enter a user ID and password of your
choice, select your area of expertise, and then click the “Finish” button.
If you have an account, but have forgotten your log-in details, go to
“Password Help” on the journal’s online submission system and enter your
e-mail address. The system will send you an automatic user ID and a new
temporary password.
A-VII
Full instructions and support are available on the site, and a user ID
and password can be obtained during your first visit. Full support for
authors is provided. Each page has a “Get Help Now” icon that connects
directly to the online support system. Contact the journal administrator
with any questions about submitting your manuscript to the journal
(info@tjh.com.tr). For ScholarOne Manuscripts customer support, click
on the “Get Help Now” link on the top right-hand corner of every page
on the site.
The Electronic Submission Process
Log in to your author center. Once you have logged in, click the “Submit
a Manuscript” link in the menu bar. Enter the appropriate data and
answer the questions. You may copy and paste directly from your
manuscript. Click the “Next” button on each screen to save your work
and advance to the next screen.
Upload Files
Click on the “Browse” button and locate the file on your computer. Select
the appropriate designation for each file in the drop-down menu next to
the “Browse” button. When you have selected all the files you want to
upload, click the “Upload Files” button. Review your submission before
sending to the journal. Click the “Submit” button when you are finished
reviewing. You can use ScholarOne Manuscripts at any time to check
the status of your submission. The journal’s editorial office will inform
you by e-mail once a decision has been made. After your manuscript
has been submitted, a checklist will then be completed by the Editorial
Assistant. The Editorial Assistant will check that the manuscript contains
all required components and adheres to the author guidelines. Once the
Editorial Assistant is satisfied with the manuscript it will be forwarded to
the Senior Editor, who will assign an editor and reviewers.
The Review Processs
Each manuscript submitted to The Turkish Journal of Hematology is
subject to an initial review by the editorial office in order to determine
if it is aligned with the journal’s aims and scope and complies with
essential requirements. Manuscripts sent for peer review will be assigned
to one of the journal’s associate editors that has expertise relevant to the
manuscript’s content. All accepted manuscripts are sent to a statistical
and English language editor before publishing. Once papers have been
reviewed, the reviewers’ comments are sent to the Editor, who will then
make a preliminary decision on the paper. At this stage, based on the
feedback from reviewers, manuscripts can be accepted or rejected, or
revisions can be recommended. Following initial peer-review, articles
judged worthy of further consideration often require revision. Revised
manuscripts generally must be received within 3 months of the date of
the initial decision. Extensions must be requested from the Associate
Editor at least 2 weeks before the 3-month revision deadline expires;
The Turkish Journal of Hematology will reject manuscripts that are
not received within the 3-month revision deadline. Manuscripts with
extensive revision recommendations will be sent for further review
(usually by the same reviewers) upon their re-submission. When a
manuscript is finally accepted for publication, the Technical Editor
undertakes a final edit and a marked-up copy will be e-mailed to the
corresponding author for review and any final adjustments.
Submission of Revised Papers
When revising a manuscript based on the reviewers’ and Editor’s
feedback, please insert all changed text in red. Please do not use
track changes, as this feature can make reading difficult. To submit
revised manuscripts, please log in to your author center at ScholarOne
Manuscripts. Your manuscript will be stored under “Manuscripts with
Decisions”. Please click on the “Create a Revision” link located to the right
of the manuscript title. A revised manuscript number will be created for
you; you will then need to click on the “Continue Submission” button.
You will then be guided through a submission process very similar to
that for new manuscripts. You will be able to amend any details you
wish. At stage 6 (“File Upload”), please delete the file for your original
manuscript and upload the revised version. Additionally, please upload
an anonymous cover letter, preferably in table format, including a
point-by-point response to the reviews’ revision recommendations. You
will then need to review your paper as a PDF and click the “Submit”
button. Your revised manuscript will have the same ID number as the
original version, but with the addition of an R and a number at the
end, for example, TJH-2011-0001 for an original and TJH-2011-0001.
R1, indicating a first revision; subsequent revisions will end with R2,
R3, and so on. Please do not submit a revised manuscript as a new
paper, as revised manuscripts are processed differently. If you click on
the “Create a Revision” button and receive a message stating that the
revision option has expired, please contact the Editorial Assistant at
info@tjh.com.tr to reactivate the option.
English Language and Statistical Editing
All manuscripts are professionally edited by an English language editor
prior to publication. After papers have been accepted for publication,
manuscript files are forwarded to the statistical and English language
editors before publishing. Editors will make changes to the manuscript
to ensure it adheres to TJH requirements. Significant changes or
concerns are referred to corresponding authors for editing.
Online Early
The Turkish Journal of Hematology publishes abstracts of accepted
manuscripts online in advance of their publication. Once an accepted
manuscript has been edited, the authors have submitted any final
corrections, and all changes have been incorporated, the manuscript will
be published online. At that time the manuscript will receive a Digital
Object Identifier (DOI) number. Both forms can be found at www.tjh.
com.tr. Authors of accepted manuscripts will receive electronic page
proofs directly from the printer and are responsible for proofreading
and checking the entire manuscript, including tables, figures, and
references. Page proofs must be returned within 48 hours to avoid delays
in publication.
A-VIII
CONTENTS
Research Articles
77 In Silico Study of Correlation between Missense Variations of F8 Gene and Inhibitor Formation in Severe Hemophilia A
Mostefa Fodil, Faouzia Zemani; Oran, Algeria
84 Splenic Marginal Zone Lymphoma in Turkey: Association with Hepatitis B Instead of Hepatitis C Virus as an Etiologic and Possible Prognostic
Factor - A Multicenter Cohort Study
Müfide Okay, Tuncay Aslan, Evren Özdemir, Ayşegül Üner, Arzu Sağlam, Elif Güngör, Ayşe Uysal, Nevin Alayvaz Aslan, Esra Yıldızhan, Abdullah
Ağıt, Mehmet Sinan Dal, Serdal Korkmaz, Sinem Namdaroğlu, Serdar Sivgin, Gülsüm Akgün Çağlıyan, Sinan Demircioğlu, İbrahim Barışta,
Esra Özhamam, Filiz Vural, Bülent Eser, Gülsüm Özet, Rahşan Yıldırım, Mehmet Hilmi Doğu, İlhami Berber, Mehmet Ali Erkurt, Ümit Yavuz
Malkan, Fevzi Altuntaş, Yahya Büyükaşık; Ankara, Edirne, Trabzon, Samsun, Kayseri, İzmir, Denizli, Van, Erzurum, İstanbul, Malatya, Turkey
91 Bortezomib-based Regimens Improve the Outcome of Patients with Primary or Secondary Plasma Cell Leukemia: A Retrospective Cohort
Study
Huijuan Wang, Huixing Zhou, Zhiyao Zhang, Chuanying Geng, Wenming Chen; Beijing, China
98 PTEN and AKT1 Variations in Childhood T-Cell Acute Lymphoblastic Leukemia
Fulya Küçükcankurt, Yücel Erbilgin, Sinem Fırtına, Özden Hatırnaz Ng, Zeynep Karakaş, Tiraje Celkan, Ayşegül Ünüvar, Uğur Özbek, Müge
Sayitoğlu; İstanbul, Turkey
104 Expression Profile Screening and Bioinformatics Analysis of circRNA, LncRNA, and mRNA in Acute Myeloid Leukemia Drug-Resistant Cells
Meiling Li, Fuxue Meng, Quanyi Lu; Xiamen, Duyun, China
Perspectives in Hematology
111 Endocrine and Metabolic Disorders after Hematopoietic Cell Transplantation
Annalisa Paviglianiti; Paris, France
Brief Report
116 The Impact of Early Versus Late Platelet and Neutrophil Recovery after Induction Chemotherapy on Survival Outcomes of Patients with Acute
Myeloid Leukemia
Rafiye Çiftçiler, İbrahim C. Haznedaroğlu, Nilgün Sayınalp, Osman Özcebe, Salih Aksu, Haluk Demiroğlu, Hakan Göker, Ümit Yavuz Malkan,
Yahya Büyükaşık; Ankara, Turkey
Images in Hematology
121 A Rare Chromosomal Abnormality in Chronic Lymphocytic Leukemia: t(13;13)
Akbar Safaei, Ahmad Monabati, Moeinadin Safavi; Shiraz, Tehran, Iran
123 Garland of Erythroblasts around a Macrophage: Erythroblastic Island
Chandan Kumar, Garima Jain, Anita Chopra; New Delhi, India
A-IX
Letters to the Editor
125 Percentages and Absolute Numbers of CD4+CD8+ Double-positive T Lymphocytes in the Peripheral Blood of Normal Italian Subjects:
Relationship with Age and Sex
Alessandra Marini, Daniela Avino, Monica De Donno, Francesca Romano, Riccardo Morganti; Camaiore, Pagani, Pisa, Italy
127 Double-positive T Lymphocytes Do Not Vary in Different Age Groups in Colombian Blood Donors
Miguel S. Gonzalez-Mancera, John Mario Gonzalez; Bogota, Colombia
128 A Novel Mutation in a Patient with Wiskott-Aldrich Syndrome
Yurday Öncül, Arzu Akyay, İbrahim Tekedereli; Malatya, Turkey
130 Budd-Chiari Syndrome: An Unusual Complication of AL Amyloidosis
Onur Tarık Tiryaki, İpek Yonal Hindilerden, GülçinYegen, Meliha Nalçacı; İstanbul, Turkey
132 Rare Cytogenetic Anomalies in Two Pediatric Patients with Acute Leukemia
Süreyya Bozkurt, Şule Ünal, Turan Bayhan, Fatma Gümrük, Mualla Çetin; İstanbul, Ankara, Turkey
134 Importance of DNA Sequencing for Abnormal Hemoglobins Detected by HPLC Screening
Duran Canatan, Abdullah Çim, Serpil Delibaş, Emel Altunsoy, Serdar Ceylaner; Antalya, Ankara, Turkey
135 Two Rare Pathogenic HBB Variants in a Patient with β-Thalassemia Intermedia
Veysel Sabri Hançer, Tunç Fışgın, Murat Büyükdoğan; İstanbul, Turkey
137 A Case of Myelodysplastic Syndrome in an Adult with Down Syndrome: A Rare Observation of a Well-known Pediatric Disease
Harpreet Virk, Shano Naseem; Chandigarh, India
A-X
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2019.2019.0094
Turk J Hematol 2020;37:77-83
In Silico Study of Correlation between Missense Variations of F8
Gene and Inhibitor Formation in Severe Hemophilia A
Ağır Hemofili A’da Yanlış Anlamlı F8 Gen Varyasyonları ile İnhibitör Oluşumu İlişkisini
İnceleyen Bilgisayar Simülasyon Çalışması
Mostefa Fodil 1 , Faouzia Zemani 2
1Higher School of Biological Sciences of Oran (ESSBO), Oran, Algeria
2Molecular and Cellular Genetics Laboratory, Oran University of Science and Technology - Mohamed Boudiaf (USTOMB), Oran, Algeria
Abstract
Objective: Deleterious substitutions of the F8 gene are responsible
for causing hemophilia A, which is an inherited bleeding disorder
resulting from reduced or absent activity of the coagulant protein
factor VIII (FVIII). The most important complication in treatment is
inhibitor development toward therapeutic factor VIII. In this study,
we aimed to analyze the effects of deleterious substitutions in the F8
gene upon protein structure and function.
Materials and Methods: All tests were conducted by computational
methods from the CHAMP (CDC Hemophilia A Mutation Project)
database. We performed an in silico analysis of deleterious variations
using five software programs, Sift, PolyPhen-2, Align-GVGD, KD4v,
and MutationTaster, in order to analyze the correlation between
variation and the disease. We also studied the correlation between
these variations and inhibitor formation.
Results: Our analysis showed that these in silico tools are coherent
and that there are more variations in the A than the C domains.
Moreover, we noticed that there are more deleterious variations than
neutral variations in each of the A and C domains. We also found that
13.51% of the patients suffered from a severe form of hemophilia A
and that carriers of missense variations developed inhibitors. Also, for
the first time, we determined that variation nature is not associated
with inhibitor formation. Furthermore, this analysis showed that the
risk of developing inhibitors increases when the variation causes a
change of amino acid class.
Conclusion: This study will help to correctly associate variations
with inhibitor development and aid in early characterization of novel
variants.
Keywords: Hemophilia A, Missense variation, In silico analysis,
Inhibitor formation, FVIII, Coagulation
Öz
Amaç: F8 genindeki patolojik varyasyonlar, pıhtılaşma faktörü VIII’in
(FVIII) azalmış ya da kaybolmuş aktivitesinden kaynaklanan ve kalıtsal
bir kanama bozukluğu olan Hemofili A’ya neden olmaktadır. Tedavide
en önemli zorluk, tedavi edici faktör VIII’e karşı inhibitör gelişimidir.
Bu çalışmada F8 gen varyasyonlarının protein yapısı ve fonksiyonu
üzerine olan etkilerini incelemeyi amaçladık.
Gereç ve Yöntemler: Tüm testler CHAMP (CDC Hemofili A Mutasyon
Projesi) veri tabanından bilgisayar hesaplama yöntemleriyle yapıldı.
Varyasyon ve hastalık arasındaki ilişkiyi araştırmak için beş farklı yazılım
programı; Sift, PolyPhen-2, Align-GVGD, KD4v ve MutationTaster
kullanarak, patojenik varyasyonların analizi yapıldı. İlave olarak bu
varyasyonlar ve inhibitör oluşumu arasındaki ilişki de incelendi.
Bulgular: Analizlerimiz bilgisayar tahmin araçlarının tutarlı olarak
A bölgesinde, C bölgesine kıyasla daha fazla varyasyon olduğunu
gösterdi. Ayrıca A ve C bölgelerinde nötral varyasyonlardan ziyade
patojenik varyasyonlar bulunduğunu fark ettik. Ayrıca hastaların
%13,51’inin ağır hemofili A olduğunu ve yanlış anlamlı varyasyon
taşıyıcılarının inhibitör geliştirdiğini bulduk. Ayrıca ilk kez varyasyon
türünün inhibitör oluşumu ile ilişkili olmadığını gösterdik. İlave olarak
bu analiz, aminoasit değişimine yol açan varyasyonların inhibitör
geliştirme riskini arttırdığını bize gösterdi.
Sonuç: Bu çalışma inhibitör gelişimi ile varyasyonları doğru bir şekilde
ilişkilendirmeye ve yeni varyasyonların erken karakterizasyonuna
yardımcı olacaktır.
Anahtar Sözcükler: Hemofili A, Yanlış anlamlı varyasyon, Bilgisayar
analizi, İnhibitör oluşumu, FVIII, Pıhtılaşma
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Mostefa Fodil, M.D., Higher School of Biological Sciences of Oran
(ESSBO), Oran, Algeria
Phone : +213699436929
E-mail : mostefa.fodil@gmail.com ORCID: orcid.org/0000-0003-2856-1988
Received/Geliş tarihi: March 5, 2019
Accepted/Kabul tarihi: December 24, 2019
77
Fodil M and Zemani F: Inhibitor Development and F8 Variations
Turk J Hematol 2020;37:77-83
Introduction
The X-linked bleeding disorder hemophilia A (HA) (OMIM
#306700) is caused by a decrease or dysfunction in circulating
blood coagulation factor VIII. This coagulation defect is present
in 1/5000 of the male population [1,2]. According to the residual
plasma FVIII coagulant activity (FVIII: C), HA can be classified
into 3 forms: severe (FVIII: C<1%), moderate (1% <FVIII: C<5%),
and mild (5% <FVIII: C<40%) [2]. Treatment of hemorrhages in
hemophiliac patients consists of protein replacement therapy
using plasma-derived or recombinant FVIII [3,4]. A serious
complication of this therapy is the development of inhibitors
(i.e. neutralizing alloantibodies against FVIII), which negate
treatment benefits [2,5,6]. This process is observed in more than
30% of patients with severe HA. However, only 3% to 13% of
patients with moderate and mild HA develop these inhibitors
[7,8]. Several studies showed that determinants of inhibitor
formation include environmental factors [9,10,11,12] as well as
the patient’s genetic background. The type of variation in the
F8 gene is the strongest risk factor for inhibitor development
[7,13]. A recent meta-analysis confirmed that the risk of
patients with large deletions and nonsense variations was
higher when compared with the risk of inhibitor development
in patients with intron 22 inversion [13]. The same study showed
that the risk of patients with intron 1 inversions and splicesite
variations was equal, and the risk of patients with small
deletions and insertions and missense variations was lower [13].
In our study, the role of F8 missense variations in inhibitor
risk was evaluated in a cohort of 407 patients with severe
HA extracted from the CDC Hemophilia A Mutation Project
(CHAMP) database [14]. We have also assessed the impact of
these missense variations on the structure and/or function of
the FVIII protein using in silico programs.
Materials and Methods
Extraction of Variation Information
The variation information of F8 was retrieved from the CHAMP
database for our analysis [14]. Among the 2537 variations listed
in the CHAMP database until 2014, we selected 407 missense
exon variations from severe hemophilia A patients for this
study. Among these variants, 296 have known inhibitor status.
Evaluation of the Variations
Clustal W2
This software uses sequence homology to study the conservation
between species during evolution [15]. The protein sequences
of Mus musculus, Rattus norvegicus, and Macaca fascicularis
were collected from the UniProt database (http://www.uniprot.
org/) regarding their phylogenetic proximity. We then aligned
these sequences to locate the variations relative to the important
regions of the genome that are most conserved.
SIFT
Sorting Intolerant From Tolerant (SIFT) is a program based
on sequence homology to predict whether an amino acid
substitution will affect protein function [16]. The scores are
classified as intolerant (0.00-0.05), potentially intolerant
(0.051-0.10), borderline (0.101-0.20), or tolerant (0.201-1.00).
A tolerant substitution does not have deleterious effects on
protein function. On the other hand, intolerant substitution
appears to have a partial or complete impact on the loss of
protein function.
PolyPhen-2
Polymorphism Phenotyping v2 (PolyPhen-2), available as
software and via a Web server, predicts the possible impact
of amino acid substitutions on the stability and function of
human proteins using structural and comparative evolutionary
considerations [17]. It is based on three types of information:
the multiple alignment, structural information from the
database structure (PDB), and the physicochemical properties
of the amino acids. Predictions of a variation’s effect on protein
structure are assigned as “probably damaging”, with a score of
≥2.000, and “possibly damaging”, with a score of 1.500-1.999,
which means that these variations may affect protein function
and/or structure. Finally, “benign”, with a score of 0.000-0.999,
signifies no likely phenotypic effect.
Align-GVGD
Align-GVGD is a freely available web-based program that
combines multiple sequence alignment and biophysical
characteristics of amino acids that are based on Grantham
distance [18]. The Grantham distance calculates the
physicochemical difference between two amino acids. If this
distance is important, it means that the two amino acids are
different. The results are established as classes C0 to C65. Classes
C45 to C65 are more likely to affect the function, while classes
C0 to C25 are less likely to affect the function.
KD4v
KD4v is based on two complementary services: the first is similar
to other prediction software such as SIFT and PolyPhen-2,
while the second is based on the information and the threedimensional
(3D) structure to predict changes in size, charge,
polarity, hydrophobicity, accessibility, and physicochemical
properties of amino acids due to a missense variation [19]. KD4v
predicts whether the variation is “neutral” or “deleterious” for
the protein.
MutationTaster
MutationTaster is a free web-based application to evaluate
DNA sequence variants for their disease-causing potential.
78
Turk J Hematol 2020;37:77-83
Fodil M and Zemani F: Inhibitor Development and F8 Variations
The software performs a battery of in silico tests to estimate
the impact of the variant on the gene product/protein. This
program was designed for the rapid assessment of the potential
pathogenic alterations in DNA sequences [20]. It integrates
information from different databases and biomedical analyses
that include conservation during evolution, changes in splice
sites, and the loss of protein function. MutationTaster predicts
if the variation is “disease-causing” or just a “polymorphism”.
Statistical Analysis
In order to evaluate statistical differences between different
groups (presence or absence of inhibitors) we used the chisquare
test (χ 2 ). Classical chi-square evaluation is possible when
numbers are greater than 5. An estimated p-value of less than
or equal to 0.05 was considered to be statistically significant.
Results
Among the 407 exon variations studied by ClustalW2, 378
(92.87%) are located in highly conserved regions. We applied
five in silico tools, SIFT, PolyPhen-2, Align-GVGD, KD4v, and
MutationTaster, to predict the effects of each variation on the
protein function and/or structure (Table 1).
For the rest of the analysis, we chose to take into consideration
the results of KD4V, since it is a software program based on
structure homology and also considers the information on the
three-dimensional structure. The results obtained allowed us to
classify variations as deleterious or neutral. First, we studied the
distribution of variations according to domains A (A1+A2+A3)
and C (C1+C2) of the FVIII protein. The variations located on the
B domain were not included in this study. In fact, the B domain
does not play a major role in blood clotting. Our results showed
that the A domain contains four times more variations than the
C domain (Figure 1).
We then examined the distribution of deleterious and neutral
variations according to the A and C domains. Therefore, we
calculated the frequencies of deleterious and neutral variations
in each domain: A1, A2, A3, C1, and C2. We noticed that
deleterious variations were significantly more prevalent than
neutral variations in each domain (p<0.001) (Figure 2).
Among the 407 variations, 296 (72.73%) variants have known
inhibitor status. Accordingly, 13.51% of patients developed
inhibitors, while 86.49% did not (Table 2). In order to test the
correlation between the nature of the variation (deleterious/
Table 1. Prediction results of studied variations’ effects on the protein function and/or structure.
SIFT PolyPhen-2 Align-GVGD KD4v MutationTaster
Tolerant
[0.201-1.0]
20
(4.91%)
Benign
[0-0.99]
11
(2.70%)
Less likely
[C0-C25]
76 (18.67%) Neutral
96
(23.59%)
Polymorphism 52 (12.78%)
Deleterious
[0.00-0.05]
387
(95.09%)
Possibly
damaging
[1.5-1.99]
12
(2.95%)
Intermediate
[C35]
17 (4.18%) Deleterious
311
(76.41%)
Disease
causing
355 (87.22%)
Probably
damaging
[>2.0]
384
(94.35%)
More likely
[C45-C65]
314 (77.15%)
Figure 1. Variation distribution according to the A and C domains.
Figure 2. Deleterious and neutral variation distribution according
to the A and C domains. ***: p<0.001.
79
Fodil M and Zemani F: Inhibitor Development and F8 Variations
Turk J Hematol 2020;37:77-83
neutral) and inhibitor formation, frequencies of deleterious and
neutral variations in the two groups of patients were calculated
(developing or not developing inhibitors). The results showed
the absence of a correlation between inhibitor development
and variation nature (Figure 3). In fact, in the group of patients
developing inhibitors, there were no statistically differences
between deleterious and neutral variations frequencies (13.54%
vs. 13.43%; p=0.9). The same results were observed in the second
group of patients that did not develop inhibitors (86.46% vs.
86.57%; p=0.9).
We then studied the impact of the localization of a variation
on the A1, A2, A3, C1, and C2 domains on inhibitor formation.
Therefore, for each domain we calculated the variant frequencies
among the group of patients developing inhibitors. Frequencies
of patients with missense variations located in the A3 and C2
domains were higher than those with variations located in the
A1, A2, and C1 domains (Figure 3). However, this difference was
not statistically significant (p=0.19).
Table 2. Distribution of single-nucleotide polymorphisms in
patients with or without inhibitors.
Inhibitors Number of variations Percentage (%)
Presence 40 13.51
Absence 256 86.49
Finally, we assigned four different classes of amino acids
according to the properties of their side chains [class 1:
hydrophobic (A, V, F, P, M, I, L, W); class 2: polar uncharged (S, Y,
N, Q, C, T, H, G); class 3: acidic (D, E); class 4: basic (K, R)] Then
we examined whether substitution caused changes in the amino
acid class. The substitution of the wild-type amino acid by an
amino acid from the same class gives an intra-class substitution.
However, its replacement by an amino acid of another class
results in inter-class substitution.
Comparison of all intra- and inter-amino acid substitutions
showed that a significantly greater incidence of inhibitor
formation was observed in the case of inter-amino acid
substitutions than intra-amino acid substitutions: 28 (70%)
vs. 12 (30%) (p=0.003, according to a normal distribution)
(Table 3).
Discussion
Alterations of the F8 gene are extremely diverse. Many
bioinformatics tools were used to assess the impact of these
variations on protein function. These are based on the study of
sequence conservation, amino acid physicochemical properties,
and the information concerning the 3D structure of the
FVIII protein [21,22,23]. In this perspective, we analyzed 407
Figure 3. Correlation between variation character (deleterious/
neutral) and inhibitor formation.
Figure 4. Correlation of variation localization on each domain
with inhibitor formation.
Table 3. Variation distribution in the patients that developed inhibitors according to the change of amino acidic class. 1:
Hydrophobic (A, V, L, I, M, P, F). 2: Polar uncharged (S, Y, N, Q, C, T, H, G). 3: Acidic (D, E). 4: Basic (K, R).
Change in 1 Change in 2 Change in 3 Change in 4 Intra-class Inter-class
1 10 3 5 5 10 13
2 2 2 3 3 2 8
3 2 0 0 1 0 3
4 2 0 2 0 0 4
Total 12 (30%) 28 (70%)
80
Turk J Hematol 2020;37:77-83
Fodil M and Zemani F: Inhibitor Development and F8 Variations
variations extracted from the CHAMP database. We selected
exon missense variations that are responsible for the severe
form of HA.
The conservation analysis study focused on the most important
regions that can influence the stability, the function, and the
structure of the FVIII protein. The results obtained by ClustalW2
showed that 92.87% of the analyzed variations were located in
highly conserved regions. Therefore, these variations are likely
to have a very important deleterious effect on the function of
the FVIII protein [24].
We then studied the distribution of the variations according to
the A and C domains. The variations located in the B domain
were not included in this study. In fact, the B domain does not
play a major role in blood clotting, but it is involved in intracellular
interactions such as the regulation of quality control
and secretion. Therefore, it could be considered that missense
variations located in the B domain can only affect the efficiency
of secretion of FVIII [25,26]. Indeed, if a missense variation is
identified in the B domain in a patient with HA, it would be
necessary to look for other variations in the other domains of
the F8 gene.
Our results showed that there are four times more variations in
the A domains than the C domains (80.34% vs. 19.66%, p<0.001).
This is probably due to the fact that the peptide sequences of
the A domains (1112 amino acids) are approximately three times
longer than the peptide sequences of the C domains (312 amino
acids) [27,28].
On the other hand, we studied the impact of the 407 variations
using five in silico tools, SIFT, PolyPhen-2, Align-GVGD, KD4v,
and MutationTaster, in order to predict deleterious and/or
damaging effect of variations. The combination of the results
obtained by these software programs showed that there were
more deleterious than neutral variations. This observation was
in keeping with the patients’ phenotypes as they developed
the severe form of HA. According to KD4v results, we noticed
that there were three times more deleterious variations than
neutral variations. This difference was still valid for each of
the A domains (A1, A2, and A3) and C domains (C1 and C2)
(p<0.001). This observation was in correlation with the results
obtained by MutationTaster, which predicted that 87.22%
of the variations were disease-causing and 12.78% were
polymorphisms. Regarding the neutral variations, they probably
represent polymorphisms that are not responsible for the
disease. In fact, it has been reported that in 2% to 18% of
patients with HA, no genetic alterations were detected except
polymorphisms [29,30,31]. Moreover, the A and C domains have
important interaction sites. Indeed, the activation sites of the
FVIII protein by thrombin are located in the A domain (Arg372,
Arg740, and Arg1689) [32]. Consequently, if a variation affects
one of these sites, the FVIII will not be activated and the tenase
complex will not activate the FX. This induces the arrest of the
coagulation cascade [33]. Furthermore, the C domain interacts
with von Willebrand factor and the phospholipid membrane.
These interactions are responsible for maintaining the stability
and structure of the FVIII protein [7]. Besides, the A domain has
six disulfide bonds (Cys-Cys) and the C domain contains only
two. Those bridges are responsible for the protein stability and
risk being broken because of missense variations [34].
Furthermore, in order to study the correlation between the
impact of the variations and inhibitor formation, we examined
the 296 variations that have known inhibitor status. We
have shown that 13.51% of the patients with a severe form
of HA carrying missense variations developed inhibitors. This
frequency is higher than that found in Oldenburg and Pavlova’s
study, where HA patients with missense variations had a risk of
5% of developing inhibitors [7]. This difference can be explained
by the fact that our study concerns only the severe form of HA.
In a recent study, Spena et al. [36] evaluated the association
between F8 gene variants and inhibitor development by
analyzing 231 causative variants, grouped as low-risk and
high-risk variations according to Gouw et al. [35]. Only a small
difference was observed in the cumulative inhibitor incidence
[32.0% (95% CI=18.9 to 45.1) vs. 37.9% (95% CI=29.9 to 45.9)]
for low- and high-risk variations classified corresponding to a
hazard ratio of 1.35 (95% CI=0.78-2.35) [36].
Otherwise, according to the hypothesis of Schwaab et al. [37],
the low risk of developing inhibitors in patients with missense
variations is due to the fact that patients with missense
variations synthesize some endogenous protein that, although
functionally altered, are sufficient to induce immune tolerance.
We supposed that a deleterious variation that alters the protein
function and structure might increase the risk of developing
inhibitors. We noticed that there were no correlations between
deleterious missense variations and inhibitor formation (p=0.9).
We then studied the association between the location of a
variation in the A and C domains with inhibitor formation. We
observed that these variations are located in different domains.
There were more variations located in the A3 and C2 domains
(respectively 20.55% and 18.75%) than the other domains.
However, this difference was not significant (p=0.19). Indeed,
the FVIII inhibitors recognize epitopes on all the domains [38].
Finally, we analyzed the impact of a change of physicochemical
properties of amino acids due to missense variations according
to inhibitor formation. Our data showed that the risk of
developing inhibitors increases when the variation causes
a change of amino acid class (70% vs. 30%; p=0.003). These
results support those of Schwaab et al. [37] study (91.5%).
81
Fodil M and Zemani F: Inhibitor Development and F8 Variations
Turk J Hematol 2020;37:77-83
This percentage decreases (8.5%) in the case of patients with
missense variations that do not cause changes in amino acid
class [37].
Conclusion
Our study showed that there are more variations in the A than the
C domain. Moreover, we noticed that there are more deleterious
than neutral variations in each of the A and C domains. For
the first time, we have determined that variation nature is not
associated with inhibitor formation. This study showed that
variations in patients developing inhibitors are localized on
both A and C domains of FVIII. Finally, we showed that the risk
of developing inhibitors increases when the variation causes a
change of amino acid class.
This analysis showed that combining information from different
tools may facilitate a better understanding for predictive
accuracy in determining the functional impact of a given
variation.
Ethics
Ethics Committee Approval: Not applicable.
Informed Consent: Not applicable.
Authorship Contributions
Concept: M.F., F.Z.; Design: M.F., F.Z.; Analysis or
Interpretation: M.F., F.Z.; Writing: M.F., F.Z.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
Acknowledgments: The authors state that they have no interests
that might be perceived as posing a conflict or bias.
References
1. Lenting PJ, van Mourik JA, Mertens K. The life cycle of coagulation factor
VIII in view of its structure and function. Blood 1998;92:3983-3996.
2. White GC 2nd, Rosendaal F, Aledort LM, Lusher JM, Rothschild C, Ingerslev
J; Factor VIII and Factor IX Subcommittee. Definitions in hemophilia.
Recommendation of the scientific subcommittee on factor VIII and factor
IX of the scientific and standardization committee of the International
Society on Thrombosis and Haemostasis. Thromb Haemost 2001;85:560.
3. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole
SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard
TE. Inhibitors of factor VIII in black patients with hemophilia. N Engl J Med
16 2009;360:1618-1627.
4. Mannucci PM, Tuddenham EG. The hemophilias--from royal genes to gene
therapy. N Engl J Med 2001;344:1773-1779.
5. Fulcher CA, de Graaf Mahoney S, Zimmerman TS. FVIII inhibitor IgG subclass
and FVIII polypeptide specificity determined by immunoblotting. Blood
1987;69:1475-1480.
6. Hoyer LW. The factor VIII complex: structure and function. Blood 1981;58:1-
13.
7. Oldenburg J, Pavlova A. Genetic risk factors for inhibitors to factors VIII and
IX. Haemoph Off J World Fed Hemoph 2006;12(Suppl 6):15-22.
8. Witmer C, Young G. Factor VIII inhibitors in hemophilia A: rationale and
latest evidence. Ther Adv Hematol 2013;4:59-72.
9. Bardi E, Astermark J. Genetic risk factors for inhibitors in haemophilia A. Eur
J Haematol 2015;94(Suppl 77):710.
10. Carcao M, Re W, Ewenstein B. The role of previously untreated patient
studies in understanding the development of FVIII inhibitors. Haemoph Off
J World Fed Hemoph 2016;22:22-31.
11. Gorski MM, Blighe K, Lotta LA, Pappalardo E, Garagiola I, Mancini I, Mancuso
ME, Fasulo MR, Santagostino E, Peyvandi F. Whole-exome sequencing to
identify genetic risk variants underlying inhibitor development in severe
hemophilia A patients. Blood 2016;127:2924-2933.
12. Rosendaal FR, Palla R, Garagiola I, Mannucci PM, Peyvandi F; SIPPET Study
Group. Genetic risk stratification to reduce inhibitor development in the
early treatment of hemophilia A: a SIPPET analysis. Blood 2017;130:1757-
1759.
13. Gouw SC, van den Berg HM, Oldenburg J, Astermark J, de Groot PG,
Margaglione M, Thompson AR, van Heerde W, Boekhorst J, Miller CH, le
Cessie S, van der Bom JG. F8 gene mutation type and inhibitor development
in patients with severe hemophilia A: systematic review and meta-analysis.
Blood 2012;119:2922-2934.
14. Payne AB, Miller CH, Kelly FM, Michael Soucie J, Craig Hooper W. The
CDC Hemophilia A Mutation Project (CHAMP) mutation list: a new online
resource. Hum Mutat 2013;34:E2382-2391.
15. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson
JD. Multiple sequence alignment with the Clustal series of programs.
Nucleic Acids Res 2003;31:3497-3500.
16. Ng PC, Henikoff S. SIFT: Predicting amino acid changes that affect protein
function. Nucleic Acids Res 2003;31:3812-3814.
17. Sunyaev S, Ramensky V, Bork P. Towards a structural basis of human nonsynonymous
single nucleotide polymorphisms. Trends Genet 2000;16:198-
200.
18. Tavtigian SV, Byrnes GB, Goldgar DE, Thomas A. Classification of rare
missense substitutions, using risk surfaces, with genetic- and molecularepidemiology
applications. Hum Mutat 2008;29:1342-1354.
19. Luu TD, Rusu A, Walter V, Linard B, Poidevin L, Ripp R, Moulinier L, Muller J,
Raffelsberger W, Wicker N, Lecompte O, Thompson JD, Poch O, Nguyen H.
KD4v: Comprehensible Knowledge Discovery System for Missense Variant.
Nucleic Acids Res 2012;40:W71-75.
20. Schwarz JM, Rödelsperger C, Schuelke M, Seelow D. MutationTaster
evaluates disease-causing potential of sequence alterations. Nat Methods
2010;7:575-576.
21. Hamasaki-Katagiri N, Salari R, Wu A, Qi Y, Schiller T, Filiberto AC, Schisterman
EF, Komar AA, Przytycka TM, Kimchi-Sarfaty C. A gene-specific method for
predicting hemophilia-causing point mutations. J Mol Biol 2013;425:4023-
4033.
22. Doss CGP. In silico profiling of deleterious amino acid substitutions of
potential pathological importance in haemophlia A and haemophlia B. J
Biomed Sci 2012;19:30.
23. Liu ML, Shen BW, Nakaya S, Pratt KP, Fujikawa K, Davie EW, Stoddard
BL, Thompson AR. Hemophilic factor VIII C1- and C2-domain missense
mutations and their modeling to the 1.5-angstrom human C2-domain
crystal structure. Blood 2000;96:979-987.
24. Sengupta M, Sarkar D, Ganguly K, Sengupta D, Bhaskar S, Ray K. In silico
analyses of missense mutations in coagulation factor VIII: identification of
severity determinants of haemophilia A. Haemoph Off J World Fed Hemoph
2015;21:662-669.
82
Turk J Hematol 2020;37:77-83
Fodil M and Zemani F: Inhibitor Development and F8 Variations
25. Bogdanova N, Markoff A, Eisert R, Wermes C, Pollmann H, Todorova A,
Chlystun M, Nowak-Göttl U, Horst J. Spectrum of molecular defects and
mutation detection rate in patients with mild and moderate hemophilia A.
Hum Mutat 2007;28:54-60.
26. Jayandharan G, Shaji RV, Baidya S, Nair SC, Chandy M, Srivastava A.
Identification of factor VIII gene mutations in 101 patients with haemophilia
A: mutation analysis by inversion screening and multiplex PCR and CSGE
and molecular modelling of 10 novel missense substitutions. Haemoph Off
J World Fed Hemoph 2005;11:481-491.
27. Oldenburg J. Mutation profiling in haemophilia A. Thromb Haemost
2001;85:577-579.
28. Pipe SW. Functional roles of the factor VIII B domain. Haemoph Off J World
Fed Hemoph 2009;15:1187-1196.
29. Ogata K, Selvaraj SR, Miao HZ, Pipe SW. Most factor VIII B domain missense
mutations are unlikely to be causative mutations for severe hemophilia A:
implications for genotyping. J Thromb Haemost 2011;9:1183-1190.
30. Saenko EL, Ananyeva NM, Tuddenham EGD, Kemball-Cook G. Factor VIII -
novel insights into form and function. Br J Haematol 2002;119:323-331.
31. Thompson AR. Structure and function of the factor VIII gene and protein.
Semin Thromb Hemost 2003;29:11-22.
32. Pittman DD, Kaufman RJ. Proteolytic requirements for thrombin
activation of anti-hemophilic factor (factor VIII). Proc Natl Acad Sci U S A
1988;85:2429-2433.
33. Butenas S, van’t Veer C, Mann KG. “Normal” thrombin generation. Blood
1999;94:21692178.
34. McMullen BA, Fujikawa K, Davie EW, Hedner U, Ezban M. Locations
of disulfide bonds and free cysteines in the heavy and light chains of
recombinant human factor VIII (antihemophilic factor A). Protein Sci Publ
Protein Soc 1995;4:740-746.
35. Gouw SC, van der Bom JG, Ljung R, Escuriola C, Cid AR, Claeyssens-Donadel
S, van Geet C, Kenet G, Mäkipernaa A, Molinari AC, Muntean W, Kobelt R,
Rivard G, Santagostino E, Thomas A, van den Berg HM; PedNet and RODIN
Study Group. Factor VIII products and inhibitor development in severe
hemophilia A. N Engl J Med 2013;368:231-239.
36. Spena S, Garagiola I, Cannavò A, Mortarino M, Mannucci PM, Rosendaal
FR, Peyvandi F; SIPPET Study Group. Prediction of factor VIII inhibitor
development in the SIPPET cohort by mutational analysis and factor VIII
antigen measurement. J Thromb Haemost 2018;16:778-790.
37. Schwaab R, Pavlova A, Albert T, Caspers M, Oldenburg J. Significance of F8
missense mutations with respect to inhibitor formation. Thromb Haemost
2013;109:464-470.
38. Chaves DG, Velloso-Rodrigues C, Moreau V, Nguyen C, Villard S, Belisário
AR, Granier C, Santoro MM. Reactivity profile of anti-factor VIII antibodies
with designed synthetic peptides mimicking epitopes of the C2 and a1
domains. Br J Haematol 2008;141:708-715.
83
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2019.2019.0177
Turk J Hematol 2020;37:84-90
Splenic Marginal Zone Lymphoma in Turkey: Association with
Hepatitis B Instead of Hepatitis C Virus as an Etiologic and
Possible Prognostic Factor - A Multicenter Cohort Study
Türkiye’de Splenik Marjinal Zon Lenfoma: Hepatit C Virüs Yerine Hepatit B Virüsünün
Etiyolojik ve Olası Prognostik Faktör Oluşu-Çok Merkezli Kohort Çalışması
Müfide Okay 1 , Tuncay Aslan 1 , Evren Özdemir 2 , Ayşegül Üner 3 , Arzu Sağlam 3 , Elif Güngör 4 , Ayşe Uysal 5 ,
Nevin Alayvaz Aslan 6 , Esra Yıldızhan 7 , Abdullah Ağıt 8 , Mehmet Sinan Dal 9 , Serdal Korkmaz 10 , Sinem Namdaroğlu 11 ,
Serdar Sivgin 12 , Gülsüm Akgün Çağlıyan 13 , Sinan Demircioğlu 14 , İbrahim Barışta 15 , Esra Özhamam 16 , Filiz Vural 17 ,
Bülent Eser 7 , Gülsüm Özet 8 , Rahşan Yıldırım 18 , Mehmet Hilmi Doğu 19 , İlhami Berber 20 , Mehmet Ali Erkurt 21 ,
Ümit Yavuz Malkan22, Fevzi Altuntaş9,23, Yahya Büyükaşık1
1Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey
2Medicana International Ankara Hospital, Clinic of Medical Oncology, Ankara, Turkey
3Hacettepe University Faculty of Medicine, Department of Pathology, Ankara, Turkey
4Trakya University Faculty of Medicine, Department of Internal Medicine, Edirne, Turkey
5University of Health Sciences, Trabzon Kanuni Training and Research Hospital, Division of Hematology, Trabzon, Turkey
6Ondokuz Mayıs University Faculty of Medicine, Department of Hematology, Samsun, Turkey
7Erciyes University Faculty of Medicine, Department of Hematology, Kayseri, Turkey
8Ankara Numune Training and Research Hospital, Division of Hematology, Ankara, Turkey
9University of Health Sciences, Ankara Oncology Training and Research Hospital, Clinic of Hematology and BMT Unit, Ankara, Turkey
10Kayseri Training and Research Hospital, Division of Hematology, Kayseri, Turkey
11University of Health Sciences, İzmir, Turkey
12Acıbadem Kayseri Hospital, Kayseri, Turkey
13Denizli State Hospital, Division of Hematology, Denizli, Turkey
14Yüzüncü Yıl University Faculty of Medicine, Department of Hematology, Van, Turkey
15Hacettepe University Faculty of Medicine, Department of Medical Oncology, Ankara, Turkey
16Ankara Numune Training and Research Hospital, Division of Pathology, Ankara, Turkey
17Ege University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İzmir, Turkey
18Atatürk University Faculty of Medicine, Department of Hematology, Erzurum, Turkey
19İstanbul Training and Research Hospital, Clinic Hematology, İstanbul, Turkey
20Malatya Training and Research Hospital, Division of Hematology, Malatya, Turkey
21İnönü University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Malatya, Turkey
22University of Health Sciences, Dışkapı Yıldırım Beyazıt Training and Research Hospital, Clinic of Hematology, Ankara, Turkey
23Yıldırım Beyazıt University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Müfide Okay, M.D., Hacettepe University Faculty of Medicine,
Department of Internal Medicine, Division of Hematology, Ankara, Turkey
Phone : +903123051536
E-mail : mufide_okay@yahoo.com ORCID: orcid.org/0000-0001-5317-0597
Received/Geliş tarihi: May 5, 2019
Accepted/Kabul tarihi: October 18, 2019
84
Turk J Hematol 2020;37:84-90
Okay M, et al: Splenic Marginal Zone Lymphoma in Turkey
Abstract
Objective: Chronic antigenic stimulation is frequently blamed in
the pathogenesis of extranodal marginal zone lymphomas including
splenic marginal zone lymphoma (SMZL). Chronic hepatitis C is
frequently observed in SMZL patients in some geographical regions.
However, these reports are largely from North America and Europe,
and data from other countries are insufficient. In this multicenter
study we aimed to identify the clinical characteristics of SMZL patients
in Turkey, including viral hepatitis status and treatment details.
Materials and Methods: Data were gathered from participating
centers from different regions of Turkey using IBM SPSS Statistics
23 for Windows. Hepatitis B virus surface antigen (HBsAg), anti-HBs
antibody, anti-HB core antigen antibody (anti-HBcAg), HB viral load,
anti-hepatitis C virus (HCV) antibody, HCV viral load results were
analyzed.
Results: One hundred and four patients were reported. Hepatitis C
virus positivity was observed in only one patient. However, hepatitis
B virus surface antigen (HBsAg) positivity was observed in 11.2%
and HBsAg and/or anti-HB core antigen antibody (anti-HBcAg)
positivities were seen in 34.2% of the patients. The median age was
60 years (range=35-87). Median follow-up duration was 21.2 months
(range=00.2-212; 23.2 months for surviving patients). Median overall
survival was not reached. Estimated 3-year and 10-year survival
rates were 84.8% and 68.9%, respectively. Older age, no splenectomy
during follow-up, platelet count of <90x10 3 /µL, lower albumin, higher
lactate dehydrogenase, higher β 2
-microglobulin, and HBsAg positivity
were associated with increased risk of death. Only albumin remained
significant in multivariable analysis.
Conclusion: These results indicate that hepatitis B virus may be a
possible risk factor for SMZL in our population. It may also be an
indirect prognostic factor.
Keywords: Low-grade lymphoma, Hepatitis B virus, Hepatitis C virus,
Risk factors
Öz
Amaç: Splenik marjinal zon lenfoma’yı da (SMZL) içeren ekstranodal
marjinal zon lenfomaların patogenezinde, kronik antijenik stimülasyon
sorumlu olan mekanizmadır. Bazı coğrafik bölgelerde SMZL
hastalarında kronik hepatit C sıklıkla gözlenir. Fakat bu çalışmalar
sıklıkla kuzey Amerika ve Avrupa’dandır. Diğer ülkelerden veriler
sınırlıdır. Bu çalışma ile Türkiye’deki SMZL hastalarının hepatit serolojisi
durumları ve tedavi yöntemlerinin ortaya konulması amaçlanmıştır.
Gereç ve Yöntemler: Türkiye’de farklı merkezlerden IBM SPSS
Statistics for Windows v23 elektronik tablo kullanılarak veriler
toplanmıştır. Hepatit B virüs yüzey antijeni (HBsAg), Anti-HBs antikor,
Anti-HB kor antijen antikoru (anti-HBcAg), HB virüs yükü, anti-hepatit
C virüs (HCV) antikoru, HCV virüs yükü sonuçları analiz edilmiştir.
Bulgular: Yüz dört hastanın verilerine ulaşılmıştır. Hepatit C virüs
pozitifliği sadece 1 hastada tespit edilmiştir. Hepatit B virüs yüzey
antijeni (HBsAg) pozitifliği %11,2, HBsAg ve/veya hepatit B kor antijen
antikoru (anti-HBcAg) pozitifliği %34,2 oranında tespit edilmiştir.
Ortanca yaş 60 yıl (35-87) olarak saptanmıştır. Ortanca izlem süresi
21,2 (0,2-212) ay (yaşayan hastalar için 23,2 ay) olarak bulunmuştur.
Ortanca genel sağkalım (GS) süresine ulaşılamamıştır. Tahmini 3-yıl
ve 10-yıl GS oranları %84,8 ve %68,9 olarak bulunmuştur. İleri yaş,
splenektomi yapılmaması, <90x10 3 /µL platelet sayısı, hipoalbuminemi,
laktat dehidrogenaz yüksekliği, β 2
-mikroglobulin yüksekliği ve
HBsAg pozitifliği sağkalımla ilişkili faktörler olarak bulunmuştur. Çok
değişkenli analizde, sadece albumin düşüklüğü istatistiksel olarak
anlamlı saptanmıştır.
Sonuç: Bu çalışmanın sonuçlarına göre, toplumumuzda SMZL için
hepatit B virüsü olası bir risk faktörü olabilir. Aynı zamanda indirek bir
prognostik gösterge olabilir.
Anahtar Sözcükler: Düşük dereceli lenfoma, Hepatit B virüs, Hepatit
C virüs, Risk faktörleri
Introduction
Splenic marginal zone lymphoma (SMZL) is a rare B-cell
lymphoma. It constitutes less than 2% of lymphoid neoplasms
[1]. The majority of patients have an indolent course with
median overall survival of about 10 years [2,3].
Chronic hepatitis C is frequently observed in SMZL patients.
However, these reports are largely from North America and
Europe [4,5]. Data from various countries with different
hepatitis prevalence rates are lacking.
Many prognostic factors have been described for SMZL, such
as leukocytosis, thrombocytopenia, elevated β 2
-microglobulin,
anemia, elevated lactate dehydrogenase (LDH), decreased
albumin, impaired performance status, advanced age, bone
marrow involvement, and histologic transformation [6,7,8,9,10].
Various clinical prognostic scores have been described, but
no universally accepted risk stratification formula has been
identified.
No curative treatment has been described for this indolent
neoplastic disorder. Treatment is indicated in the case of
symptomatic disease and/or significant cytopenia. Splenectomy,
rituximab, rituximab plus single-agent or multiagent
chemotherapy regimens, and recently ibrutinib and idelalisib
have been reported to give high treatment success rates [11].
In this multicenter cohort study we aimed to identify the
clinical characteristics of SMZL patients in Turkey including viral
hepatitis status, treatment details, and survival.
Materials and Methods
Data were gathered from voluntarily participating centers
from different regions of Turkey using IBM SPSS Statistics
23 for Windows (IBM Corp., Armonk, NY, USA). The diagnosis
of SMZL, established by the local hematopathologist, was
accepted. Diagnoses were based on widening of the white
pulp without predominant red pulp involvement and a wide
immunohistochemical panel that helped rule out other lowgrade
B-cell lymphomas and clinicopathologic correlation.
85
Okay M, et al: Splenic Marginal Zone Lymphoma in Turkey
Turk J Hematol 2020;37:84-90
The neoplastic B-cell population was immunophenotypically
required to lack cyclin D1, CD10, Bcl-6, CD123, annexin-1, and coexpression
of CD5 and CD23. A central review in our department
of pathology was not obligatory, but statistical evaluations were
repeated in the group of cases (n=40) diagnosed at the primary
research center, Hacettepe University’s Faculty of Medicine
(HUFM). In the case of atypical clinical presentation (e.g., presence
of prominent lymphadenopathies in addition to splenomegaly),
unexpected morphological, and/or immunophenotypic
findings, the submitting center was contacted to confirm the
diagnosis. As presented in Table 1, the following data were
recorded: age; sex; main reasons for admission to the hospital;
leukocyte, lymphocyte, and neutrophil counts and hemoglobin
level, platelet count, serum albumin, and β 2
-microglobulin at
diagnosis; CD5, CD10, CD20, CD23, CD7, CD103, surface Ig,
cyclin D1, and FMC7 results (immunohistochemical or flow
cytometry); spleen size; bone marrow involvement; extranodal
involvement site; ECOG performance status; and hepatitis
B virus surface antigen (HBsAg), anti-HBs antibody, anti-HB
core antigen antibody (anti-HBc), HB viral load, anti-hepatitis
C virus (HCV) antibody, and HCV viral load results. In addition,
the first treatment choice (watch-and-wait, splenectomy,
chemoimmunotherapy, etc.), treatment response, and survival
status were recorded. Treatment responses were defined as
previously reported [12]: 1) hematological improvement (after
splenectomy): at least 50% improvement in blood counts; 2)
partial response: ≥50% improvement in spleen size, cytopenias,
and lymphadenopathies if present, and decrease in the level of
marrow lymphoid infiltration; 3) complete response: resolution
of organomegaly, normalization of blood counts (hemoglobin
>12 g/dL, platelet count >100x10 3 /µL, neutrophils >1.5x10 3 /µL),
no evidence of circulating clonal B cells, and no or minor BM
infiltration detected by immunohistochemistry; 4) no response
or progressive disease: less than partial response or disease
progression.
Statistical Analysis
Categorical and continuous data were expressed as ratio (%)
and median (range) and they were compared by chi-square
and independent samples t-tests, respectively. Survival analyses
were computed by the Kaplan-Meier method. Overall survival
(OS) was calculated from presentation to the date of mortality
due to any reason. Patients who had not died at the last followup
were censored at that time. Parameters related to survival
were investigated by Cox regression univariate and multivariate
analyses. All 7 parameters in Table 2 were included in the
multivariable model. All patients gave informed consent for
their treatment and information analyses. This study complied
with the Declaration of Helsinki. IBM SPSS Statistics 23 for
Windows was used for statistical analyses. Values of p<0.05
were considered statistically significant.
Results
A total of 104 patients, diagnosed between June 1999 and
November 2017, were reported from 23 hematology/oncology
centers. Forty-seven (45%) of these were diagnosed/confirmed
at our center. Data on baseline clinical characteristics are
presented in Table 1. The median age was 60 years (range=35-87),
Table 1. Baseline characteristics and main treatment details
of patients.
Clinical Parameters n=104
Median age, years (range) 60 (35-87)
Female/male 65 (62.5%)/39 (37.5%)
Median (range) interval between
admission and diagnosis (months)
Main reason for admission
Cytopenia symptoms
Abdominal complaints
B symptoms
Liver dysfunction
Frequency of symptoms at diagnosis
Cytopenia symptoms
Abdominal complaints
B symptoms
Coincidental
ECOG performance score at diagnosis
Asymptomatic
1
2
3
1.6 (0-85)
26 (26.8%)
44 (45.4%)
25 (25.8%)
2 (2.1%)
46 (44.2%)
63 (58.6%)
48 (46.1%)
9 (8.6%)
21/95 (20.2%)
45/95 (43.3%)
22/95 (21.2%)
7/95 (6.7%)
Bone marrow involvement 81/98 (82.6%)
Peripheral blood involvement 51/91 (56%)
Lymphadenopathy 51/100 (51%)
Extranodal involvement 26/102 (25.5%)
Spleen length on ultrasound/computed
tomography, median (range)
22 (13-32)
HbsAg 11/98 (11.2%)
Anti-HCV 1/93 (1.1%)
HbsAg or anti-HBc 26/76 (34.2%)
Upfront management
Watch-and-wait 19/103 (18.4%)
Splenectomy 51/103 (49.5%)
CH (O)P±R* 18/103 (17.5%)
Purine analog ± R 6/103 (5.8%)
Other 9/103 (8.7%)
Best responses (in treated patients)
during follow-up
No response 4/79 (5.1%)
Hematological improvement 40/79 (50.6%)
Partial response 11/79 (13.9%)
Complete response 24/79 (30.4%)
*CH(O)P±R: Cyclophosphamide, doxorubicin, vincristine, prednisone ± rituximab.
86
Turk J Hematol 2020;37:84-90
Okay M, et al: Splenic Marginal Zone Lymphoma in Turkey
and 62.5% of the patients were female. Cytopenia(s) and/or
related symptoms (26.8%) and abdominal discomfort (45.4%)
were the most frequent reasons for hospital admission. At
presentation, 46.1% of patients had B symptoms (fever, night
sweats, weight loss), while 8.6% of the patients lacked diseaserelated
symptoms and were diagnosed incidentally. According to
ECOG performance scoring, 22.1%, 47.4%, 23.2%, and 7.4% of
patients were scored as 0, 1, 2, and 3, respectively. At diagnosis,
77.9% and 49% of patients had bone marrow and peripheral
blood involvement, respectively, while 17.3% of patients had
prominent lymphadenopathies in addition to splenomegaly.
Eleven of 98 (11.2%) evaluable patients had HBsAg positivity
and only 1 of 93 (1.1%) evaluable patients had HCV positivity.
Twenty-two of 74 (29.7%) evaluable patients had anti-HBc
positivity. The rate of HBsAg and/or anti-HBc positivity was
34.2%. The rate of HBsAg and/or anti-HBc positivity was 30.2%
in these cases. The rates of HBsAg and anti-HBc positivities were
13% and 27.9%, respectively, in the cases diagnosed at HUFM.
All positive HBV patients received antiviral prophylaxis.
[1.00 (1.00-1.00)], higher β 2
-microglobulin [1.00 (1.00-1.00)],
and HBsAg positivity [0.27 (0.08-0.88)] were associated with
increased risk of death in the univariate analyses. Only serum
albumin level remained marginally significant in multivariate
analysis [0.09 (0.00-1.04)]. Univariate and multivariate analyses
for survival are shown in Table 2.
Discussion
In this analysis we report increased prevalence of chronic HBV
infection in SMZL patients. HBV exposure is prevalent among
adults in Turkey. The reported rate of HBsAg positivity in blood
donors was approximately 2%-3% during the last decade
[13,14]. In recent epidemiological data, the prevalence was
reported as close to 4% [15]. Anti-HCV positivity was reported
to be close to 1% in our country [16]. HBsAg was 3.7% and anti-
HCV Ab positivity was 2.8% in lymphoma patients in another
study from Turkey [17]. We previously reported interim results
of this study in 2016 [18]. To the best of our knowledge, we
were the first group to suggest a possible association between
Wait-and-watch strategies, splenectomy, and chemo(immune)-
therapy were the frontline management methods for 18.4%,
49.5%, and 32.1% of patients, respectively. Only 79 patients
were evaluated for response. Hematological improvement
and complete response were obtained in the majority of
patients (Table 1). Median follow-up duration was 21.2 months
(range=0.2-212; 23.2 months for surviving patients). Fourteen
(13.4%) patients died during follow-up. Median OS was not
reached. Estimated 3-year and 10-year survival rates were
84.8% and 68.9%, respectively (Figure 1).
Older age [hazard ratio (HR), confidence interval (CI): 1.10
(1.03-1.17)], no splenectomy during follow-up [3.88 (1.26-
11.88)], platelet counts of <90x10 3 /µL at presentation [3.84
(1.31-11.20)], lower albumin [0.13 (0.03-0.47)], elevated LDH
Table 2. Univariate and multivariate analyses for survival.
Univariate analysis
Figure 1. Overall survival of all patients.
Multivariate analysis
Parameter P Odds ratio (OR) 95% confidence interval p OR 95% confidence interval
Age 0.00 1.10 1.03-1.17 0.23 1.07 0.95-1.22
Albumin 0.00 0.13 0.03-0.47 0.05 0.09 0.00-1.04
HBsAg positivity 0.03 0.27 0.08-0.88 0.18 0.16 0.01-2.44
Lactate dehydrogenase 0.02 1.00 1.00-1.00 0.96 1.00 0.99-1.00
Splenectomy 0.01 3.88 1.26-11.88 0.46 2.33 0.24-22.13
Platelets
<90x10 3 /µL
0.01 3.84 1.31-11.20 0.24 2.40 0.54-10.66
b 2
-microglobulin 0.00 1.00 1.00-1.00 0.94 1.00 1.00-1.00
87
Okay M, et al: Splenic Marginal Zone Lymphoma in Turkey
Turk J Hematol 2020;37:84-90
HBV and SMZL in a considerably large SMZL cohort. Some other
studies reported on only a few patients with SMZL associated
with HBV [19,20,21,22,23]. Recently, Fetica et al. [24] from
Romania found HBV infection in 3 patients out of 34 SMZL
patients in the same time period as our early report. A more
recent study from China reported HBsAg positivity in 25/160
(16%) and resolved HBV infection (HBsAg negative, anti-HBc
positive) in 54/160 (34%) patients [25]. A summary of the data
in the literature on HBV and HCV seropositivity is shown in Table
3 [19,20,21,22,23,24,25,26,27,28,29].
Chronic antigenic stimulation is frequently blamed in the
pathogenesis of extranodal marginal zone lymphomas. The
association between gastric mucosa-associated lymphoid tissue
lymphoma and chronic Helicobacter pylori infection is the
classical example for this relationship. An association between
HCV and SMZL has been previously reported in some geographic
regions, mostly in South Europe [2,5,29]. Now we can suggest
that the association between SMZL and chronic viral hepatitis
is not specific for HCV. HBV may also be involved in SMZL
lymphomagenesis.
Splenectomy and rituximab-based chemoimmunotherapies
were the most frequently used treatments in our cohort. This
is in concordance with current treatment strategies for SMZL.
Responses (most commonly hematological improvement after
splenectomy as expected) were very frequent (94.9%) in our
cohort. The median follow-up duration (21.2 months) in our
patients was relatively short for this indolent lymphoma.
Estimated 10-year survival was 68.6%. We found many
parameters (lower albumin, splenectomy, thrombocytopenia,
elevated LDH, higher b 2
-microglobulin, and HBsAg positivity)
to be associated with overall survival, but albumin was the
only parameter to retain marginal significance in multivariate
analysis (Figure 2). HBsAg positivity was an adverse prognostic
factor in univariate analysis, but not in the multivariate test. It
is possible that HBV may indirectly affect survival by lowering
serum albumin levels due to liver impairment. This suggestion
should be investigated in further studies.
Arcaini et al. [2] reported 10-year OS as 65% in SMZL. In that
study, the authors proposed a prognostic model including
hemoglobin of <12 g/dL, elevated LDH, and albumin level of <3.5
Table 3. Summary of the data in the literature about hepatitis B and C.
Reference
Type
[19] Case report 1
[20] Letter to the editor 1
[22] Case report 1
[26] Case report 1
[23] Research article 129
[24] Research article 34
Number of
patients
Important clinical features
56-year-old Lebanese male patient with B symptoms and elevated liver
enzymes was diagnosed with HBV infection; after 6 months, SMZL was
diagnosed due to persistent splenomegaly
38-year-old male Greek patient with a history of chronic HBV infection was
diagnosed with SMZL with developing B symptoms and splenomegaly
64-year-old Chinese man with cirrhosis (HBV-positive) was diagnosed with
hepatocellular cancer and SMZL (mass in liver and spleen)
42-year-old Caucasian male patient with a history of chronic HCV infection
was diagnosed with SMZL with increased lymphocyte count and mild
splenomegaly
129 adult patients were consecutively diagnosed with SMZL in Italian
hematological centers; HCV seropositivity was 16/129 (16%)
731 lymphoma cases from Romania with Hodgkin lymphoma (160 cases),
NHLs (571 cases), and SMZL (34 cases); results of tests for viral hepatitis
infection were available for 17 cases (17/34); 2/17 (11.7%) patients were
positive for HCV and 3/17 (17.7%) patients were positive for HBV
[27] Research article 140
1052 MZL cases with EMZL (633 cases), NMZL (157 cases), and SMZL (140
cases) and 13766 controls from 12 case-control studies; HCV seropositivity
was 3.2%, OR was 3.04 (95% CI: 1.65-5.60)
[28] Research article 100
[25] Research article 160
[29] Research article 15
Study was based on real-life data from Italy; HCV positivity was 3.1% in 100
SMZL patients
Study was conducted with 160 SMZL patients from China; 25 patients (16%)
were HBsAg-positive and 54 (34%) patients had resolved HBV infection; IGH
gene was analyzed in 39 patients; patients with HBV infection presented
biased IGHV-D-J rearrangements and mutational status
9 SMZL patients with HCV infection from France who received IFN alpha had
remission; in contrast, none of the six HCV-negative patients had a response
to IFN therapy
HBV: Hepatitis B infection, HCV: hepatitis C infection, MZL: marginal zone lymphoma, EMZL: extranodal marginal zone lymphoma, NMZL: nodal marginal zone lymphoma,
OR: odds ratio, CI: confidence interval, IFN alpha: interferon alpha.
88
Turk J Hematol 2020;37:84-90
Okay M, et al: Splenic Marginal Zone Lymphoma in Turkey
S.K., S.N., S.S., G.A.C., S.D., I.B., E.O., F.V., M.T., B.E., G.O., R.Y.,
M.H.D., I.B., M.A.E., F.A., Y.B.; Analysis or Interpretation: M.O.,
U.Y.M., Y.B.; Literature Search: M.O., U.Y.M., Y.B.; Writing: M.O.,
U.Y.M., Y.B.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: This research did not receive any specific
grants from funding agencies in the public, commercial, or notfor-profit
sectors.
Figure 2. Overall survival according to serum albumin level at
diagnosis.
g/dL as adverse prognostic factors. In another study, Montalbán
et al. [5] developed a continuous model for estimating
lymphoma-specific survival including decreased hemoglobin
level, lower platelet count, elevated LDH, and extrahilar
lymphadenopathy as unfavorable prognostic indicators. In a
recent Chinese study [25], the authors also suggested a new
prognostic system. Decreased hemoglobin, HBsAg positivity, and
complex karyotype were related to decreased survival in that
study. We did not intend to develop a prognostic scoring system
or to test previously suggested scoring systems in our study,
but it is convincing to observe that many of the risk factors we
identified in univariate analyses have been previously reported
to have prognostic significance in SMZL.
The major limitations of this study are its retrospective design
and somewhat limited number of patients.
Conclusion
Our results in association with some recent literature data
indicate that HBV may be a possible risk factor for development
of SMZL in some geographical regions, similar to HCV in some
Western countries. It may also be an indirect prognostic factor.
Larger studies about this rare lymphoma would obviously
provide better data and firmer conclusions on this relationship
and the prognostic impact of HBV.
Ethics
Ethics Committee Approval: Retrospective study.
Informed Consent: Approval was obtained from the patients
during their first hospitalization as most of them were being
treated in the hospital.
Authorship Contributions
Concept: M.O., H.G., Y.B.; Design: M.O., H.G., Y.B.; Data Collection
or Processing: M.O., T.O., E.O., E.G., A.U., N.A.A., E.Y., A.A., M.S.D.,
Acknowledgments: The interim results of this study were
presented at the American Society of Hematology 2016 Annual
Meeting.
Gülsüm Emel Pamuk, M.D., previously affiliated with Trakya
University’s Faculty of Medicine, could not be contacted during
the preparation and submission of this paper. We would like to
thank her for her contributions.
References
1. Swerdlow SH, Campo E, Pileri SA, Harris NL, Stein H, Siebert R, Advani R,
Ghielmini M, Salles GA, Zelenetz AD, Jaffe ES. The 2016 revision of the
World Health Organization classification of lymphoid neoplasms. Blood
2016;127:2375-2390.
2. Arcaini L, Lazzarino M, Colombo N, Burcheri S, Boveri E, Paulli M, Morra E,
Gambacorta M, Cortelazzo S, Tucci A, Ungari M, Ambrosetti A, Menestrina
F, Orsucci L, Novero D, Pulsoni A, Frezzato M, Gaidano G, Vallisa D, Minardi
V, Tripodo C, Callea V, Baldini L, Merli F, Federico M, Franco V, Iannitto E;
Integruppo Italiano Linfomi. Splenic marginal zone lymphoma: a prognostic
model for clinical use. Blood 2006;107:4643-4649.
3. Olszewski AJ, Castillo JJ. Survival of patients with marginal zone lymphoma:
analysis of the Surveillance, Epidemiology, and End Results database. Cancer
2013;119:629-638.
4. Peveling-Oberhag J, Crisman G, Schmidt A, Döring C, Lucioni M, Arcaini
L, Rattotti S, Hartmann S, Piiper A, Hofmann WP, Paulli M, Küppers R,
Zeuzem S, Hansmann ML. Dysregulation of global microRNA expression in
splenic marginal zone lymphoma and influence of chronic hepatitis C virus
infection. Leukemia 2012;26:1654-1662.
5. Montalbán C, Abraira V, Arcaini L, Domingo-Domenech E, Guisado-Vasco P,
Iannitto E, Mollejo M, Matutes E, Ferreri A, Salar A, Rattotti S, Carpaneto A,
Pérez Fernández R, Bello JL, Hernández M, Caballero D, Carbonell F, Piris MA;
Splenic Marginal Zone Lymphoma Study Group. Risk stratification for splenic
marginal zone lymphoma based on haemoglobin concentration, platelet
count, high lactate dehydrogenase level and extrahilar lymphadenopathy:
development and validation on 593 cases. Br J Haematol 2012;159:164-
171.
6. Thieblemont C, Felman P, Berger F, Dumontet C, Arnaud P, Hequet O, Arcache
J, Callet-Bauchu E, Salles G, Coiffier B. Treatment of splenic marginal zone
B-cell lymphoma: an analysis of 81 patients. Clin Lymphoma 2002;3:41-47.
7. Troussard X, Valensi F, Duchayne E, Garand R, Felman P, Tulliez M, Henry-
Amar M, Bryon PA, Flandrin G. Splenic lymphoma with villous lymphocytes:
clinical presentation, biology and prognostic factors in a series of 100
patients. Groupe Francais d’Hématologie Cellulaire (GFHC). Br J Haematol
1996;93:731-736.
8. Parry-Jones N, Matutes E, Gruszka-Westwood AM, Swansbury GJ,
Wotherspoon AC, Catovsky D. Prognostic features of splenic lymphoma with
villous lymphocytes: a report on 129 patients. Br J Haematol 2003;120:759-
764.
89
Okay M, et al: Splenic Marginal Zone Lymphoma in Turkey
Turk J Hematol 2020;37:84-90
9. Chacón JI, Mollejo M, Muñoz E, Algara P, Mateo M, Lopez L, Andrade J,
Carbonero IG, Martínez B, Piris MA, Cruz MA. Splenic marginal zone
lymphoma: clinical characteristics and prognostic factors in a series of 60
patients. Blood 2002;100:1648-1654.
10. Lenglet J, Traullé C, Mounier N, Benet C, Munoz-Bongrand N, Amorin S,
Noguera ME, Traverse-Glehen A, Ffrench M, Baseggio L, Felman P, Callet-
Bauchu E, Brice P, Berger F, Salles G, Brière J, Coiffier B, Thieblemont C.
Long-term follow-up analysis of 100 patients with splenic marginal
zone lymphoma treated with splenectomy as first-line treatment. Leuk
Lymphoma 2014;55:1854-1860.
11. Dreyling M, Thieblemont C, Gallamini A, Arcaini L, Campo E, Hermine O,
Kluin-Nelemans JC, Ladetto M, Le Gouill S, Iannitto E, Pileri S, Rodriguez
J, Schmitz N, Wotherspoon A, Zinzani P, Zucca E. ESMO Consensus
conferences: guidelines on malignant lymphoma. part 2: marginal zone
lymphoma, mantle cell lymphoma, peripheral T-cell lymphoma. Ann Oncol
2013;24:857-877.
12. Matutes E, Oscier D, Montalban C, Berger F, Callet-Bauchu E, Dogan A,
Felman P, Franco V, Iannitto E, Mollejo M, Papadaki T, Remstein ED, Salar A,
Solé F, Stamatopoulos K, Thieblemont C, Traverse-Glehen A, Wotherspoon A,
Coiffier B, Piris MA. Splenic marginal zone lymphoma proposals for a revision
of diagnostic, staging and therapeutic criteria. Leukemia 2008;22:487-495.
13. Yakut U, Güney M, Doğanay ÜD, Koçak A, Avcı İ. Bir kan merkezinde
bağışçılara uygulanan mikrobiyolojik tarama testleri sonuçlarının on yıllık
değerlendirilmesi. Türk Mikrobiyol Cem Derg 2010;40:201-206.
14. Çelebi D, Çelebi Ö, Altoparlak Ü, Kök A. Kan donörlerinde HBsAg, anti-HCV,
anti-HIV, sifiliz seroprevalansı ve macro-ELISA sonuçlarının optik dansite
değerleri ile doğrulama testlerinin karşılaştırılması. Türk Mikrobiyol Cem
Derg 2012;42:137-141.
15. Özkan H. Epidemiology of chronic hepatitis B in Turkey. Euroasian J
Hepatogastroenterol 2018;8:73-74.
16. Tozun N, Ozdogan O, Cakaloglu Y, Idilman R, Karasu Z, Akarca U, Kaymakoglu
S, Ergonul O. Seroprevalence of hepatitis B and C virus infections and
risk factors in Turkey: a fieldwork TURHEP study. Clin Microbiol Infect
2015;21:1020-1026.
17. Sonmez M, Bektas O, Yilmaz M, Durmus A, Akdogan E, Topbas M, Erturk
M, Ovali E, Omay SB. The relation of lymphoma and hepatitis B virus/
hepatitis C virus infections in the region of East Black Sea, Turkey. Tumori
2007;93:536-539.
18. Aslan T, Ozdemir E, Uner A, Gungor E, Alayvaz Aslan N, Yildizhan E, Agit A,
Korkmaz S, Akgun Cagliyan G, Barista I, Ozhamam E, Pamuk GE, Turgut M,
Eser B, Ozet G, Yıldırım R, Buyukasik Y. Splenic marginal zone lymphoma
in an East Mediterranean/Middle Eastern population cohort: possible
association with hepatitis B instead of hepatitis C virus as an etiologic and
prognostic factor (ThREG-NHL01 Study). Blood 2016;128:5332.
19. Koot AW, Visscher AP, Huits RM. Remission of splenic marginal zone
lymphoma in a patient treated for hepatitis B: a case of HBV-associated
lymphoma. Acta Clin Belg 2015;70:301-303.
20. Christou L, Kalambokis G, Bai M, Kamina S, Tsianos E. Splenic marginal zone
lymphoma in a patient with chronic hepatitis B. J Gastrointestin Liver Dis
2009;18:511-512.
21. Mathew J, Aldean I. Splenic marginal zone lymphoma associated with
hepatitis B virus infection: a case report. Internet J Surg 2002;5:3.
22. Zhang SH, Xu AM, Zheng JM, He MX. Coexistence of splenic marginal zone
lymphoma with hepatocellular carcinoma: a case report. Diagn Pathol
2007;2:5.
23. Iannitto E, Minardi V, Callea V, Stelitano C, Calvaruso G, Tripodo C, Quintini
G, De Cantis S, Ambrosetti A, Pizzolo G, Franco V, Florena AM, Abbadessa V.
Assessment of the frequency of additional cancers in patients with splenic
marginal zone lymphoma. Eur J Haematol 2006;76:134-140.
24. Fetica B, Pop B, Blaga ML, Fulop A, Dima D, Zdrenghea MT, Vlad CI, Bojan AS,
Achimas-Cadariu P, Lisencu CI, Irimie A, Weisenburger DD. High prevalence
of viral hepatitis in a series of splenic marginal zone lymphomas from
Romania. Blood Cancer J 2016;6:498.
25. Yi S, Yan Y, Xiong W, Lv R, Yu Z, Liu W, Liu E, Li H, Liu H, Li Z, An G, Xu Y,
Ru K, Zou D, Qiu L. Distinct clinical characteristics draw a new prognostic
model for splenic marginal zone lymphoma in HBV high prevalent region.
Oncotarget 2017;8:98757-98770.
26. Rossotti R, Travi G, Pazzi A, Baiguera C, Morra E, Puoti M. Rapid clearance
of HCV-related splenic marginal zone lymphoma under an interferon-free,
NS3/NS4A inhibitor-based treatment. A case report. J Hepatol 2015;62:234-
237.
27. Bracci PM, Benavente Y, Turner JJ, Paltiel O, Slager SL, Vajdic CM, Norman
AD, Cerhan JR, Chiu BC, Becker N, Cocco P, Dogan A, Nieters A, Holly EA,
Kane EV, Smedby KE, Maynadié M, Spinelli JJ, Roman E, Glimelius B, Wang
SS, Sampson JN, Morton LM, de Sanjosé S. Medical history, lifestyle, family
history, and occupational risk factors for marginal zone lymphoma: the
InterLymph Non-Hodgkin Lymphoma Subtypes Project. J Natl Cancer Inst
Monogr 2014;2014:52-65.
28. Perrone S, D’Elia GM, Annechini G, Ferretti A, Tosti ME, Foà R, Pulsoni A.
Splenic marginal zone lymphoma: prognostic factors, role of watch and
wait policy, and other therapeutic approaches in the rituximab era. Leuk
Res 2016;44:53-60.
29. Hermine O, Lefrère F, Bronowicki JP, Mariette X, Jondeau K, Eclache-
Saudreau V, Delmas B, Valensi F, Cacoub P, Brechot C, Varet B, Troussard X.
Regression of splenic lymphoma with villous lymphocytes after treatment
of hepatitis C virus infection. N Engl J Med 2002;347:89-94.
90
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2019.2019.0254
Turk J Hematol 2020;37:91-97
Bortezomib-based Regimens Improve the Outcome of
Patients with Primary or Secondary Plasma Cell Leukemia: A
Retrospective Cohort Study
Bortezomib Temelli Tedavi Rejimleri Birincil veya İkincil Plazma Hücreli Lösemi Hastalarının
Sonuçlarını İyileştirir: Retrospektif Kohort Çalışması
Huijuan Wang 1 , Huixing Zhou 1 , Zhiyao Zhang 1 , Chuanying Geng 2 , Wenming Chen 3
1Beijing, China
2Workers Stadium South Road, Chaoyang District, Beijing, China
3Chaoyang District, Hematology, Beijing, China Beijing
Abstract
Objective: The management experience for plasma cell leukemia
(PCL) is still limited by PCL’s rare incidence and aggressive course. The
goal of this study was to further identify the efficacy of bortezomibcontaining
regimens for PCL in Chinese patients.
Materials and Methods: In this study, 56 consecutive PCL patients
[14 primary PCL (pPCL) and 42 secondary PCL (sPCL) cases] were
retrospectively enrolled and 42/56 patients received bortezomibbased
regimens (BBRs), including 10/14 pPCL and 32/42 sPCL patients.
The patients’ survival data, clinical information, and safety data were
collected and analyzed.
Results: In pPCL and sPCL patients, the overall response rate in the
bortezomib group was 90.0% and 25.0%, respectively. The median
progression-free survival from PCL diagnosis for pPCL and sPCL was
8.3 months vs. 2.9 months (p=0.043) and median overall survival
(OS) from PCL diagnosis was 23.3 months vs. 4.0 months. The OS for
patients receiving BBRs was significantly longer for both pPCL (8.3
vs. 1.2 months, p=0.002) and sPCL (4.3 vs. 1.1 months, p<0.001). In
multivariate COX analysis, BBR treatment [p=0.008, hazard ratio
(HR)=0.38, 95% confidence interval (CI)=0.19-0.77] and very good
partial response or better (≥VGPR) (p=0.035, HR=0.19, 95% CI=0.04-
0.74) were independent predictors of OS for sPCL patients. For pPCL
patients, BBR predicted OS (p=0.029, HR=0.056, 95% CI=0.004-0.745)
instead of ≥VGPR (p=0.272, HR=3.365, 95% CI=0.38-29.303).
Conclusion: It was found that BBRs could significantly improve OS for
both pPCL and sPCL patients.
Keywords: Primary plasma cell leukemia, Secondary plasma cell
leukemia, Bortezomib-based treatment, Overall survival
Öz
Amaç: Plazma hücreli lösemide (PHL) tedavi deneyimi PHL’nin nadir
görülmesi ve agresif seyri nedeni ile halen sınırlıdır. Bu çalışmanın
amacı Çin’deki PHL hastalarında bortezomib temelli tedavi rejimlerinin
etkinliğini belirlemektir.
Gereç ve Yöntemler: Bu çalışmaya geriye dönük olarak 56 PHL olgusu
[14 birincil PHL (pPHL) ve 42 ikincil PHL (sPHL)] dahil edilmiştir ve
pPHL 10/14 ve sPHL 32/42 olmak üzere 42/56 olgu bortezomib temelli
tedavi (BTT) almıştır. Hastaların sağ-kalım verileri, klinik bilgileri ve
güvenlik verileri toplandı ve analiz edildi.
Bulgular: PPHL ve sPHL hastalarında bortezomib grubunda genel
yanıt oranı sırasıyla %90 ve %25 idi. PHL tanısından itibaren ortanca
hastalıksız sağ kalım pPHL ve sPHL için sırasıyla 8,3 ay ve 2,9 ay
(p=0,043) ve genel ortanca sağkalım (GS) 23,3 ay ve 4 ay idi. BTT alan
hastalar için GS hem pPHL (8,3 aya 1,2 ay, p=0,002) hem de sPHL
(4,3 aya 1,1 ay, p<0,001) için anlamlı olarak daha uzun bulundu. Çok
değişkenli COX analizinde BTT [p=0,008, kalp atım oranı (KAO)=0,38,
%95 güven aralığı (CI)=0.19-0.77] ve daha iyi ya da çok iyi kısmi yanıt
(≥ÇİKY) (p=0,035, KAO=0,19, %95 CI=0,04-0,74), sPHL hastaları için
GS’ın bağımsız göstergesidir. PPHL hastalarında BTT için öngörülen GS
(p=0.029, KAO=0,056, %95 CI=0,004-0,745) iken, ≥ÇİKY için (p=0,272,
HR=3,365, %95 CI=0,38-29,303) idi.
Sonuç: BTT’nin hem pPHL hem de sPHL hastalarında genel sağkalımı
belirgin olarak iyileştirebileceği bulunmuştur.
Anahtar Sözcükler: Birincil plazma hücreli lösemi, İkincil plazma
hücreli lösemi, Bortezomib temelli tedavi, Sağkalım
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Wenming Chen, M.D., Hematology, 8 th Gongti South
Street, Chaoyang District, Beijing, China
Phone : +8613910107759
E-mail : xybxx@ccmu.eucn ORCID: orcid.org/0000-0001-7682-6907
Received/Geliş tarihi: July 7, 2019
Accepted/Kabul tarihi: November 26, 2019
91
Wang H, et al: Bortezomib-based Regimen Improve Survival of PCL
Turk J Hematol 2020;37:91-97
Introduction
Plasma cell leukemia (PCL) is the most aggressive disease among
plasma cell malignancies with malignant plasma cells present
in the peripheral blood, which accounts for 2%-4% of patients
with multiple myeloma [1]. The diagnostic criteria of PCL are
based on the presence of more than 20% plasma cells in the
peripheral blood or an absolute plasma cell count of greater
than 2x10 9 /L [2,3]. Primary PCL (pPCL) patients represent
cases of de novo leukemia, accounting for 60% of PCL cases.
Secondary PCL (sPCL) represents aggressive transformation of
relapsed or refractory multiple myeloma (MM), occurring in
40% of PCL cases.
The survival of PCL patients remains considerably poor, especially
for sPCL patients [1,4], and because of its low incidence and
extreme aggressiveness, the therapeutic management of PCL is
limited. Results from both retrospective [5,6] and prospective
research [7,8] are insufficient and no explicit conclusion has been
reached. The purpose of this study was to explore the survival
of pPCL and sPCL patients being treated with bortezomib-based
regimens (BBRs) in China.
Materials and Methods
Patients
We retrospectively and consecutively collected data of 56 PCL
patients (including 14 with pPCL and 42 with sPCL) diagnosed
and treated in Beijing Chao-Yang Hospital, Capital Medical
University, between 2000 and 2017. Diagnosis of PCL was based
on the criteria proposed by the International Myeloma Working
Group (IMWG) [9].
Methodology
We retrospectively collected clinical data of pPCL and sPCL
patients during the aforementioned period of time. These clinical
data included the date of pPCL or sPCL diagnosis, the date of last
follow-up, progression-free survival (PFS), overall survival (OS),
and information about the treatment. This study was conducted
in accordance with the World Medical Association Declaration
of Helsinki and approved by the Ethics Committee of Beijing
Chao-Yang Hospital, Capital Medical University. The patients or
relatives gave their written informed consent. Baseline data are
shown in Table 1.
Response to treatment was evaluated according to the IMWG
criteria [10]. BBRs were defined as triplet or quartet therapy
containing bortezomib according to the IMWG consensus,
administered subcutaneously at a dose of 1.0 to 1.3 mg/m 2 once
or twice a week.
Statistical Analysis
One-way ANOVA, Pearson’s chi-square test, and the Mann-
Whitney U test were used for the calculation of significant
differences and correlations of clinical and laboratory features
and response rates between groups. The Kaplan-Meier method
was used to estimate survival curves. Cox regression univariate
and multivariate analyses were used to measure possible
independent predictive factors for survival. Values of p<0.05
were considered statistically significant. Statistical description
and analysis were carried out with the software package IBM
SPSS 24 (IBM Corp., Armonk, NY, USA).
Results
Patients
There were 56 PCL patients diagnosed and treated from 2000 to
2017 in Beijing Chao-Yang Hospital, Capital Medical University.
Fourteen patients had pPCL (0.87% of all MM patients) and
42 patients had sPCL (2.61% of all MM patients). Five patients
(35.7%) with pPCL and eight patients (19.0%) with sPCL were
≥65 years old. For sPCL patients, the median time from diagnosis
of MM to progression to sPCL was 26.5 months (range=14.9 to
48.8 months). The baseline characteristics of the sPCL and pPCL
groups are listed in Table 1. Platelet counts were significantly
higher in pPCL (p=0.002). Lactate dehydrogenase (LDH) was
significantly higher in sPCL (437.5 U/L vs. 166.3 U/L, p<0.05). Age
and serum Ca and β 2
-microglobulin did not differ between pPCL
and sPCL (p>0.05). Immunophenotyping data of the peripheral
blood plasma cells were available for 37 of 59 patients and
CD56 was negative in 15 of 37 (40.5%) patients. The frequency
of CD20 and CD27 expression was significantly higher in pPCL
patients than sPCL patients (21.4% vs. 7.1%, p=0.004; 35.7% vs.
7.1%, p<0.001).
Fluorescence in situ hybridization data were available for 24
patients; 16/24 patients (66.7%) presented with high-risk
features including del17p present in 8 patients, t(4;14) present
in 6 patients, and t(14;16) present in 5 patients (Table 1). In
particular, 9 sPCL and 2 pPCL patients presented with 2 or 3
cytogenetic aberrations concurrently. The occurrence of del17p
and t(14;16) was markedly higher in sPCL patients pPCL patients
(19% vs. 7.1%, p=0.019; 0% vs. 11.9%, p<0.001), while the
occurrence of t(4;14) was significantly higher in pPCL patients
than sPCL patients (21.4% vs. 7.1%, p=0.007).
Response to Treatment
Treatment regimens in patients with pPCL and sPCL are listed
in Table 2. Conventional regimens are regimens without
proteasome inhibitors and immunomodulatory drugs, including
DECP (cisplatin, etoposide, cyclophosphamide, dexamethasone)
and VMP (vincristine, melphalan, prednisone). The median
treatment cycle number was 11 cycles in pPCL and 3 cycles in
sPCL patients. Of the sPCL patients, 88.7% patients had novel
drug-based induction therapy before progression to sPCL, and
in total 42/56 (75.0%) patients (including 10 pPCL and 32 sPCL)
received bortezomib-based induction for the treatment of
92
Turk J Hematol 2020;37:91-97
Wang H, et al: Bortezomib-based Regimen Improve Survival of PCL
Table 1. Patients’ characteristics of pPCL and sPCL.
Parameters pPCL (n=14) sPCL (n=42)
Age 61 (39-76) 58 (35-73)
≥65 years old 5 (35.7%) 8 (19.0%)
Sex
Male 5 (35.7%) 25 (59.5%)
Heavy light chain
IgG 8 (57.1%) 16 (38.1%)
IgA 1 (7.1%) 11 (26.2%)
IgD 0 2 (4.8%)
Nonsecretory 0 3 (7.2%)
Light chain
Kappa 4 (28.6%) 19 (45.2%)
Lambda 10 (71.4%) 20 (47.6%)
DS phase
I 0 1 (2.4%)
II 2 (14.3%) 8 (19.0%)
III 12 (85.7%) 33 (78.6%)
Renal dysfunction
A 9 (64.3%) 34 (81.0%)
B 5 (35.7) 8 (19.0%)
ISS stage
I 0 5 (11.9%%)
II 4 (28.6%) 15 (35.7%)
III 10 (71.4%) 22 (52.4%)
EMD 5 (35.7%) 8 (19%)
FISH
Del17p 1 (7.1%) 8 (19%)
1q21 amplification 2 (14.3%) 10 (23.8%)
t(4;14) 3 (21.4%) 3 (7.1%)
t(11;14) 1 (7.1%) 6 (14.3%)
t(14;16) 0 5 (11.9%)
CD20 positive 3 (21.4%) 3 (7.1%)
CD56 positive 6 (42.9%) 17 (40.5%)
CD28 positive 0 6 (14.3%)
CD27 positive 5 (35.7%) 3 (7.1%)
Hb, g/L 81.0 (65.5-104) 70 (60.5-89.5)
PLT, x10 9 /L 85.5 (68.5-134.6) 31 (19-72)
WBC, x10 9 /L 12.2 (6.04-22.2) 6.06 (3.7-13.23)
Cr, µmol/L 82.7 (66.8-280.4) 88.8 (57.9-174.1)
Ca, mmol/L 2.20 (2.17-2.54) 2.21 (1.99-2.21)
ALB, g/L 31.0 (28.8-35.6) 31.4 (24.4-36.3)
LDH, U/L 166.3 (159.5-463)
437.5 (182.8-
662.5)
BMPCs, % 73.2 (62.8-73.25) 74.0 (54.5-89.1)
Involved FLC, mg/L 464.8 (62.1-464.8)
545.0 (107.5-
1073.8)
FLC κ/λ ratio 4.02 (0.06-4.03)
14.78 (2.12-
139.23)
pPCL: Primary plasma cell leukemia, sPCL: secondary plasma cell leukemia, ISS:
international Scoring System, EMD: extramedullary disease, FISH: fluorescence in situ
hybridization, LDH: lactate dehydrogenase, BMPCs: bone marrow plasma cells, FLC:
free light chain, Ig: immunoglobulin, WBC: white blood cell, PLT: platelets, platelets,
ALB: albumin.
PCL. Nine patients (2 pPCL and 7 sPCL) underwent autologous
stem cell transplantation (ASCT). Overall response rate (ORR)
was 71.4% in pPCL [complete response (CR)=21.4%, very good
partial response (VGPR)=28.6%, partial response (PR)=21.4%,
stable disease (SD)=21.4%, partial disease (PD)=7.1%) and
19% in sPCL (CR=4.8%, VGPR=2.4%, PR=11.9%, SD=45.2%,
PD=35.7%).
ORR differed significantly between patients who received BBRs
versus those who received conventional regimens (40.5% vs.
7.1%, p=0.044) (Table 3). Response rates significantly differed
between patients who received BBRs and conventional regimens
in both pPCL (90.0% vs. 25.0%) and sPCL (25.0% vs. 0%); pPCL
patients who received a BBR had the highest response rate and
the median time to progression for pPCL was 8.4 months (95%
CI=2.4-10.9). The results demonstrated that bortezomib could
improve the quality of response in both pPCL and sPCL patients.
Survival Data
The median follow-up of the total 56 patients was 32.1 months
(range=1.3-104.7 months). At the end of the follow-up time, 3
of 14 pPCL and 4 of 42 sPCL patients were alive. The median PFS
Table 2. Therapeutic regimens.
Regimen pPCL sPCL Overall
PAD 5 8 13
PCD 1 1 2
MPV 1 6 7
PDT 4 7 11
V-DTPACE 5 5
V-DECP 5 5
Conventional
regimens
4 10 14
pPCL: Primary PCL; sPCL: secondary PCL; PAD; bortezomib, adriamycin, dexamethasone;
PCD: bortezomib, cyclophosphamide, dexamethasone; PDT: bortezomib,
dexamethasone, thalidomide; MPV: melphalan, prednisone, bortezomib; V-DCEP:
bortezomib, dexamethasone, cyclophosphamide, etoposide, cisplatin; V-DTPACE:
bortezomib, dexamethasone, thalidomide, cisplatin, doxorubicin, cyclophosphamide,
etoposide.
Table 3. Response rate in patients treated with bortezomibbased
regimens or conventional chemistry.
pPCL
n=14
sPCL
n=42
BBR CR BBR CR
ORR 9 (90.0%) 1 (25.0%) 8 (25.0%) 0
≥VGPR 7 (70.0%) 0 3 (9.4%) 0
PR 2 (20.0%) 1 (25.0%) 5 (15.6%) 0
SD 1 (10.0%) 2 (50.0%) 16 (50.0%) 3 (30.0%)
PD 0 1 (25.0%) 8 (25.0%) 7 (70.0%)
ORR: Overall response rate, VGPR: very good partial response, PR: partial response,
SD: stable disease, PD: progressive disease, BBR: bortezomib-based regimen, CR:
conventional regimen.
93
Wang H, et al: Bortezomib-based Regimen Improve Survival of PCL
Turk J Hematol 2020;37:91-97
from PCL diagnosis for pPCL and sPCL was 8.3 months vs. 2.9
months (p=0.043) (Figure 1A). The median OS from PCL diagnosis
for pPCL and sPCL was 23.3 months (95% CI=4.1-21.6) vs. 4.0
months (95% CI=1.7-6.2) (p=0.012) (Figure 1B). sPCL patients
were much more likely to experience disease progression during
treatment.
The median PFS in pPCL patients undergoing a BBR was
significantly longer than that of those receiving conventional
therapy (8.3 vs. 1.2 months, p=0.002), as was also the case for
sPCL patients (4.3 vs. 1.1 months, p<0.001) (Figures 2A and 2B).
Furthermore, BBR treatment also significantly improved OS in
both pPCL patients (19.1 vs. 2.1 months, p=0.002) and sPCL
patients (6.2 vs. 1.4 months, p=0.001) (Figures 2C and 2D). The
median OS after relapse for pPCL and sPCL patients treated with
BBR was 4.5 months and 1.6 months, respectively. There were
2 pPCL patients and 7 sPCL patients who received autologous
hematopoietic stem cell transplantation (HSCT) therapy. The
median OS of HSCT recipients was 29.1 months in pPCL patients
and 17.5 months in sPCL patients. Furthermore, the OS for
patients who achieved CR and VGPR was remarkably better than
that of those who achieved PR or less in both pPCL (19.5 vs. 1.9
months, p=0.002) and sPCL (16.2 vs. 2.4 months, p=0.006).
Univariate Cox regression analysis showed that type of PCL,
LDH, type of treatment (BBR vs. conventional treatment), and
quality of response indicated significantly better OS from the
PCL diagnosis (p<0.05). For pPCL, OS significantly benefitted
from BBR and high-quality response (p=0.033, HR=6.877,
95% CI=1.173-40.322; p=0.040, HR=2.930, 95% CI=1.049-
8.183, respectively). For sPCL patients, BBR treatment (p=0.001,
HR=3.252, 95% CI=1.603-6.598) and high-quality response
(≥VGPR, p=0.021, HR=1.937, 95% CI=1.1-3.4) also effectively
contributed to OS. In multivariate COX analysis, BBR treatment
(p=0.008, HR=0.38, 95% CI=0.19-0.77) and response ≥VGPR
(p=0.035, HR=0.19, 95% CI=0.04-0.74) were independent
predictors of OS for sPCL patients, while for pPCL patients, BBR
predicted OS (p=0.029, HR=0.056, 95% CI=0.004-0.745) instead
of ≥VGPR (p=0.272).
Safety
Figure 1. PFS and OS from PCL diagnosis in patients with primary
PCL (pPCL) and secondary PCL (sPCL).
PFS: Progression-free survival, OS: overall survival, PCL: plasma cell
leukemia.
Figure 2. PFS and OS of patients treated with bortezomib-based
regimens (BBRs) and conventional therapy (CT). A, B) pPCL PFS
and sPCL PFS; C, D) pPCL OS and sPCL OS.
PFS: Progression-free survival, OS: overall survival, PCL: plasma cell
leukemia.
sPCL patients constituted the majority of our population and
most of them were exposed to bortezomib treatment. Therefore,
there was a higher incidence of grade 3 and 4 adverse events
for this mixed population. In bortezomib-treated patients,
grade 3 or 4 myelosuppression was present in 48.2% of patients.
Grade 3 or 4 neurotoxicity happened in 19.6% of patients.
Gastrointestinal toxicity of grade 3 or 4 was present in 16.1% of
patients. The incidence of grade 3-4 renal toxicity and hepatic
toxicity was 8.9% and 12.5%, respectively. Neutropenic infection
was present in 32.1% of patients, and seven patients died from
acute respiratory failure caused by neutropenic infection in the
bortezomib group.
Discussion
PCL is an extremely rare and aggressive form of plasma cell
malignancy [4], and the OS from diagnosis ranges from 7
to 14 months [11,12]. The survival of patients with pPCL is
short. In seven series, the historical median survival without
novel therapies ranged from 6.8 to 12.6 months in the era of
conventional therapy [3,11,13,14]. Novel agents followed by
stem cell transplant yielded prolonged survival of more than 3
years [15]. The best survival data, incorporating hematopoietic
stem cell transplantation, demonstrated median survival of
longer than 3 years [15]. However, in the era of novel agents,
the proteasome inhibitor bortezomib has shown clinical efficacy
in both pPCL and sPCL [16,17]. BBRs could improve both
therapeutic response and survival of PCL patients, especially
those with pPCL [5]. Furthermore, in the study by Katodritou
et al. [18], bortezomib-based treatment showed clinical activity
94
Turk J Hematol 2020;37:91-97
Wang H, et al: Bortezomib-based Regimen Improve Survival of PCL
in pPCL patients with t(4;14) and CD27 expression. In another
study by Katodritou et al. [6], with BBRs and a median follow-up
of 51 months, the median OS of the patients with pPCL and sPCL
treated with BBRs was 18 and 7 months, respectively. Autologous
or allogenic HSCT has yielded encouraging outcomes and could
prolong survival to more than 30 months [1,15,19]. However,
only younger and highly eligible patients may benefit from
stem cell transplantation and there are limited data from novel
drug-based regimens in the treatment of PCL. The incidence of
PCL is rare and the aggressively poor physical status of patients
cannot tolerate the adverse effects of novel drugs. In recent
years, however, several case series of PCL indicated that both
pPCL and sPCL patients could benefit from bortezomib regimens
[5,6,20,21,22,23].
Our current data collected from a single center are from 14
pPCL patients and 42 sPCL patients, representing the largest
retrospective study with the longest follow-up time in China. To
date, the largest series of pPCL treated with BBR was reported by
Katodritou et al. [23], which included 50 pPCL patients, and that
of Mina et al. [24], which enrolled 38 pPCL patients. The study
of Jurczyszyn et al. [25] summarized the results of 101 sPCL
patients. We have reported an ORR of 71.5% in pPCL patients
receiving BBRs, which is similar to the result of 70% reported
by Katodritou et al. [23]. However, our ORR is much higher than
that of the previous study without novel agents. Meanwhile,
Katodritou et al. [23] reported 100% ORR for pPCL patients with
bortezomib-therapy and ASCT. As only 1 of our pPCL patients
received allogenic HSCT treatment, our study cannot evaluate
the role of bortezomib-therapy + allo-HSCT for pPCL patients,
which is one of the deficiencies of this study.
For sPCL patients, bortezomib treatment could also contribute
to higher ORR and prolong survival significantly. Our data are
in accordance with the aforementioned studies, with a slightly
lower overall response of 70.0% for ≥VGPR in pPCL patients.
In sPCL patients treated with BBRs the ORR was 25%, which
corresponds with the 36.4% ORR of Katodritou et al. [6] but is
lower than the ORR of 60% reported by Jurczyszyn et al. [25].
With respect to survival, at the time of data collection, 3/14
(21.4%) pPCL patients and 4/42 (9.5%) sPCL patients receiving
BBRs were still alive. Most sPCL patients die after the disease
progresses. The median OS of PCL patients diagnosed with pPCL
and sPCL was 23.3 months vs. 4.0 months, whereas the median
OS of PCL patients diagnosed with pPCL and sPCL who received
BBRs was 19.1 months vs. 6.8 months, respectively. Multivariate
Cox regression analysis also proved BBRs to be positive predictors
for both pPCL and sPCL patients, which highlights the impact
of bortezomib treatment of PCL patents. Our conclusion is in
accordance with previous studies. More remarkably, our data
demonstrate that BBRs contributed to much longer OS for both
pPCL and sPCL patients. However, because of the small number
of pPCL patients, the survival data of our pPCL patients should
be further validated by data from larger samples. In the study
by D’Arena et al. [5], 2-year median follow-up reached 55%
while median follow-up was not reached. In the multicenter
retrospective study of Pagano et al. [14], the median OS for 73
pPCL patients was 12.6 months and HSCT patients had a longer
OS (median=38.1 months). In our study, the median OS of HSCTtreated
PCL patients was 29.1 months in pPCL patients (2/14
patients) and 27.53 months in sPCL patients (7/42 patients).
Though the small number of patients limits the reliability, the
results still highlight the benefits of HSCT.
The study of Lebovic et al. [21] reported the data of 25 PCL
patients (13 with pPCL) treated with bortezomib-based agents
and 19 patients received HSCT. The median OS of pPCL patients
treated with a bortezomib-based agent was 28.4 months and
the 18 patients treated with bortezomib regimens had the
opportunity for optimum treatments, which could explain the
better survival of those patients. In the study by Katodritou et
al. [6], only six of the pPCL patients had undergone autologous
HSCT and HSCT was not a significant predictor for OS in the
univariate analysis. On the other hand, 45% of patients
were still alive at 2 years, and after 4 years and 3 months of
median follow-up 28% of all pPCL patients were still alive.
The administration of “triplet” bortezomib-based treatment in
15/18 pPCL patients could probably explain the high ORR and
the longer survival in their study.
In our study, according to multivariate COX analysis, treatment
with BBRs and high-quality response (≥VGPR) positively
predicted OS after PCL diagnosis. Likewise, in the studies of
Katodritou et al. [6], Jurczyszyn et al. [25], and Mina et al. [24],
it was reported that high-quality response was an important
positive indicator of OS in pPCL patients. To some extent, BBRs
and other novel agents may overcome the negative impact
of highly aggressive PCL. Nevertheless, further verification is
needed.
Bias on account of financial situation and comorbidities of
patients also exists in this study, which is an inevitable factor
in real-world clinical work. Our clinical features between the
2 groups were mostly matched. Because of the small sample
of pPCL patients, the results will be further verified in a future
study.
Safety is one of the important factors affecting the efficacy of
bortezomib, especially in elderly myeloma patients. Our results
showed that the adverse effects were acceptable even in sPCL
patients who received BBRs for induction therapy, similar to the
study of Katodritou et al. [6], in which grades 3/4 neurological,
hematological, and infectious adverse events happened in 7%,
41.4%, and 31% of cases, respectively. In the study of D’Arena
et al. [5], grades 3 and 4 hematological, neurological, and
95
Wang H, et al: Bortezomib-based Regimen Improve Survival of PCL
Turk J Hematol 2020;37:91-97
infectious events occurred in 20%, 21%, and 16%. As our study
included more sPCL patients and older patients, our incidences
of infection and neurological adverse events were relatively
higher.
Conclusion
Our data from a relatively high number of PCL patients have
shown that treatment with BBRs is highly effective and safe in
cases of PCL. BBRs and patients’ high-quality responses could be
independent predictors for OS in PCL patients. BBRs are among
the best therapeutic options for PCL patients, which could
contribute to both therapeutic response and further overall
survival. However, the defects of this study lie in the lack of
data from ASCT PCL patients, which leads to weaker survival
data than in other works. The conclusion is still required to be
validated in studies with further large numbers of PCL patients.
With novel drugs arising, new management approaches for both
primary and secondary PCL will appear for deeper response and
longer survival.
Ethics
Ethics Committee Approval: This study was conducted in
accordance with the World Medical Association Declaration of
Helsinki and approved by the Ethics Committee of Beijing Chao-
Yang Hospital, Capital Medical University.
Informed Consent: Informed consent was obtained from all
participants included in the study.
Authorship Contributions
Concept: H.W., H.Z., Z.Z., C.G., W.C.; Design: H.W., H.Z., Z.Z., C.G.,
W.C.; Data Collection or Processing: H.W., H.Z., Z.Z., C.G., W.C.;
Analysis or Interpretation: H.W., H.Z., Z.Z., C.G., W.C.; Literature
Search: H.W., H.Z., Z.Z., C.G., W.C.; Writing: H.W., H.Z., Z.Z., C.G.,
W.C.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
Acknowledgments: This study was funded by the National
Natural Science Foundation of China (No. 81500164).
References
1. Tiedemann RE, Gonzalez-Paz N, Kyle RA, Santana-Davila R, Price-Troska T,
Van Wier SA, Chng WJ, Ketterling RP, Gertz MA, Henderson K, Greipp PR,
Dispenzieri A, Lacy MQ, Rajkumar SV, Bergsagel PL, Stewart AK, Fonseca
R. Genetic aberrations and survival in plasma cell leukemia. Leukemia
2008;22:1044-1052.
2. Kyle RA, Maldonado JE, Bayrd ED. Plasma cell leukemia. Report on 17 cases.
Arch Intern Med 1974;133:813-818.
3. Noel P, Kyle RA. Plasma cell leukemia: an evaluation of response to therapy.
Am J Med 1987;83:1062-1068.
4. Mina R, D’Agostino M, Cerrato C, Gay F, Palumbo A. Plasma cell leukemia:
update on biology and therapy. Leuk Lymphoma 2017;58:1538-1547.
5. D’Arena G, Valentini CG, Pietrantuono G, Guariglia R, Martorelli MC,
Mansueto G, Villani O, Onofrillo D, Falcone A, Specchia G, Semenzato G,
Di Renzo N, Mastrullo L, Venditti A, Ferrara F, Palumbo A, Pagano L, Musto
P. Frontline chemotherapy with bortezomib-containing combinations
improves response rate and survival in primary plasma cell leukemia: a
retrospective study from GIMEMA Multiple Myeloma Working Party. Ann
Oncol 2012;23:1499-1502.
6. Katodritou E, Terpos E, Kelaidi C, Kotsopoulou M, Delimpasi S, Kyrtsonis
MC, Symeonidis A, Giannakoulas N, Stefanoudaki A, Christoulas D,
Chatziaggelidou C, Gastari V, Spyridis N, Verrou E, Konstantinidou P, Zervas
K, Dimopoulos MA. Treatment with bortezomib-based regimens improves
overall response and predicts for survival in patients with primary or
secondary plasma cell leukemia: analysis of the Greek Myeloma Study
Group. Am J Hematol 2014;89:145-150.
7. Royer B, Minvielle S, Diouf M, Roussel M, Karlin L, Hulin C, Arnulf B, Macro
M, Cailleres S, Brion A, Brechignac S, Belhadj K, Chretien ML, Wetterwald
M, Chaleteix C, Tiab M, Leleu X, Frenzel L, Garderet L, Choquet S, Fuzibet JG,
Dauriac C, Forneker LM, Benboubker L, Facon T, Moreau P, Avet-Loiseau H,
Marolleau JP. Bortezomib, doxorubicin, cyclophosphamide, dexamethasone
induction followed by stem cell transplantation for primary plasma cell
leukemia: a prospective phase II study of the Intergroupe Francophone du
Myelome. J Clin Oncol 2016;34:2125-2132.
8. Musto P, Simeon V, Martorelli MC, Petrucci MT, Cascavilla N, Di Raimondo F,
Caravita T, Morabito F, Offidani M, Olivieri A, Benevolo G, Mina R, Guariglia
R, D’Arena G, Mansueto G, Filardi N, Nobile F, Levi A, Falcone A, Cavalli
M, Pietrantuono G, Villani O, Bringhen S, Omede P, Lerose R, Agnelli L,
Todoerti K, Neri A, Boccadoro M, Palumbo A. Lenalidomide and lowdose
dexamethasone for newly diagnosed primary plasma cell leukemia.
Leukemia 2014;28:222-225.
9. Kyle RA, Durie BG, Rajkumar SV, Landgren O, Blade J, Merlini G, Kröger N,
Einsele H, Vesole DH, Dimopoulos M, San Miguel J, Avet-Loiseau H, Hajek
R, Chen WM, Anderson KC, Ludwig H, Sonneveld P, Pavlovsky S, Palumbo A,
Richardson PG, Barlogie B, Greipp P, Vescio R, Turesson I, Westin J, Boccadoro
M; International Myeloma Working Group. Monoclonal gammopathy of
undetermined significance (MGUS) and smoldering (asymptomatic) multiple
myeloma: IMWG consensus perspectives risk factors for progression and
guidelines for monitoring and management. Leukemia 2010;24:1121-1127.
10. Fernández de Larrea C, Kyle RA, Durie BG, Ludwig H, Usmani S, Vesole
DH, Hajek R, San Miguel JF, Sezer O, Sonneveld P, Kumar SK, Mahindra A,
Comenzo R, Palumbo A, Mazumber A, Anderson KC, Richardson PG, Badros
AZ, Caers J, Cavo M, LeLeu X, Dimopoulos MA, Chim CS, Schots R, Noeul A,
Fantl D, Mellqvist UH, Landgren O, Chanan-Khan A, Moreau P, Fonseca R,
Merlini G, Lahuerta JJ, Bladé J, Orlowski RZ, Shah JJ; International Myeloma
Working Group. Plasma cell leukemia: consensus statement on diagnostic
requirements, response criteria and treatment recommendations by the
International Myeloma Working Group. Leukemia 2013;27:780-791.
11. Ramsingh G, Mehan P, Luo J, Vij R, Morgensztern D. Primary plasma cell
leukemia: a Surveillance, Epidemiology, and End Results database analysis
between 1973 and 2004. Cancer 2009;115:5734-5739.
12. Sher T, Miller KC, Deeb G, Lee K, Chanan-Khan A. Plasma cell leukaemia and
other aggressive plasma cell malignancies. Br J Haematol 2010;150:418-
427.
13. Colovic M, Jankovic G, Suvajdžic N, Milic N, Dorcevic V, Jankovic S. Thirty
patients with primary plasma cell leukemia: a single center experience.
Medical Oncology 2008;25:154-160.
14. Pagano L, Valentini CG, De Stefano V, Venditti A, Visani G, Petrucci MT,
Candoni A, Specchia G, Visco C, Pogliani EM, Ferrara F, Galieni P, Gozzetti A,
Fianchi L, De Muro M, Leone G, Musto P, Pulsoni A; GIMEMA-ALWP (Gruppo
96
Turk J Hematol 2020;37:91-97
Wang H, et al: Bortezomib-based Regimen Improve Survival of PCL
Italiano Malattie EMatologiche dell’Adulto, Acute Leukemia Working Party:
coordinator Sergio Amadori). Primary plasma cell leukemia: a retrospective
multicenter study of 73 patients. Ann Oncol 2011;22:1628-1635.
15. Mahindra A, Kalaycio ME, Vela-Ojeda J, Vesole DH, Zhang MJ, Li P, Berenson
JR, Bird JM, Dispenzieri A, Gajewski JL, Gale RP, Holmberg L, Kumar S, Kyle
RA, Lazarus HM, Lonial S, Mikhael J, Milone GA, Munker R, Nath R, Saccaro
S, To LB, Vogl DT, Wirk B, Hari P. Hematopoietic cell transplantation for
primary plasma cell leukemia: results from the Center for International
Blood and Marrow Transplant Research. Leukemia 2012;26:1091-1097.
16. Esparís‐Ogando A, Alegre A, Aguado B, Mateo G, Gutiérrez N, Bladé J,
Schenkein D, Pandiella A, San Miguel JF. Bortezomib is an efficient agent in
plasma cell leukemias. Int J Cancer 2005;114:665-667.
17. van de Donk NW, Lokhorst HM, Anderson KC, Richardson PG. How I treat
plasma cell leukemia. Blood 2012;120:2376-2389.
18. Katodritou E, Verrou E, Gastari V, Hadjiaggelidou C, Terpos E, Zervas K.
Response of primary plasma cell leukemia to the combination of bortezomib
and dexamethasone: do specific cytogenetic and immunophenotypic
characteristics influence treatment outcome? Leuk Res 2008;32:1153-1156.
19. Saccaro S, Fonseca R, Veillon DM, Cotelingam J, Nordberg ML, Bredeson C,
Glass J, Munker R. Primary plasma cell leukemia: report of 17 new cases
treated with autologous or allogeneic stem-cell transplantation and review
of the literature. Am J Hematol 2005;78:288-294.
20. Libby E, Candelaria-Quintana D, Moualla H, Abdul-Jaleel M, Rabinowitz
I. Durable complete remission of primary plasma cell leukemia with the
bortezomib plus melphalan and prednisone (VMP) regimen. Am J Hematol
2010;85:733-734.
21. Lebovic D, Zhang L, Alsina M, Nishihori T, Shain KH, Sullivan D, Ochoa-
Bayona JL, Kharfan-Dabaja MA, Baz R. Clinical outcomes of patients with
plasma cell leukemia in the era of novel therapies and hematopoietic
stem cell transplantation strategies: a single-institution experience. Clin
Lymphoma Myeloma Leuk 2011;11:507-511.
22. Ali R, Beksac M, Ozkalemkas F, Ozkocaman V, Ozkan A, Ozcelik T, Tunali A.
Efficacy of bortezomib in combination chemotherapy on secondary plasma
cell leukemia. Leuk Lymphoma 2007;48:1426-1428.
23. Katodritou E, Terpos E, Delimpasi S, Kotsopoulou M, Michalis E, Vadikolia
C, Kyrtsonis MC, Symeonidis A, Giannakoulas N, Vadikolia C, Michael
M, Kalpadakis C, Gougopoulou T, Prokopiou C, Kaiafa G, Christoulas D,
Gavriatopoulou M, Giannopoulou E, Labropoulou V, Verrou E, Kastritis E,
Konstantinidou P, Anagnostopoulos A, Dimopoulos MA. Real-world data on
prognosis and outcome of primary plasma cell leukemia in the era of novel
agents: a multicenter national study by the Greek Myeloma Study Group.
Blood Cancer J 2018;8:31.
24. Mina R, Joseph NS, Kaufman JL, Gupta VA, Heffner LT, Hofmeister CC,
Boise LH, Dhodapkar MV, Gleason C, Nooka AK, Lonial S. Survival outcomes
of patients with primary plasma cell leukemia (pPCL) treated with novel
agents. Cancer 2019;125:416-423.
25. Jurczyszyn A, Castillo JJ, Avivi I, Czepiel J, Davila J, Vij R, Fiala MA, Gozzetti
A, Grzasko N, Milunovic V, Hus I, Madry K, Waszczuk-Gajda A, Usnarska-
Zubkiewicz L, Debski J, Atilla E, Beksac M, Mele G, Sawicki W, Jayabalan D,
Charlinski G, Gyula Szabo A, Hajek R, Delforge M, Kopacz A, Fantl D, Waage
A, Crusoe E, Hungria V, Richardson P, Laubach J, Guerrero-Garcia T, Liu J,
Vesole DH. Secondary plasma cell leukemia: a multicenter retrospective
study of 101 patients. Leuk Lymphoma 2019;60:118-123.
97
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2019.2019.0282
Turk J Hematol 2020;37:98-103
PTEN and AKT1 Variations in Childhood T-Cell Acute
Lymphoblastic Leukemia
Çocukluk Çağı T-hücreli Akut Lenfoblastik Lösemi Hastalarında PTEN ve AKT1 Varyasyonlar
Fulya Küçükcankurt 1,2,a , Yücel Erbilgin 1,a , Sinem Fırtına 1,3 , Özden Hatırnaz Ng 1,4 , Zeynep Karakaş 5 , Tiraje Celkan 6 ,
Ayşegül Ünüvar 5 , Uğur Özbek 1,7 , Müge Sayitoğlu 1
1İstanbul University, Aziz Sancar Institute of Experimental Medicine, Department of Genetics, İstanbul, Turkey
2Altınbaş University Faculty of Medicine, İstanbul, Turkey
3İstinye University Faculty of Art and Science, Department of Molecular Biology and Genetics, İstanbul, Turkey
4Acıbadem Mehmet Ali Aydınlar University Faculty of Medicine, Department of Medical Biology, İstanbul, Turkey
5İstanbul University Faculty of Medicine, Department of Pediatrics Hematology, İstanbul, Turkey
6İstanbul University-Cerrahpaşa Cerrahpaşa Faculty of Medicine, Department of Pediatric Hematology, İstanbul, Turkey
7Acıbadem Mehmet Ali Aydınlar University Faculty of Medicine, Department of Medical Genetics, İstanbul, Turkey
aF.K. and Y.E. contributed equally to this work.
Abstract
Objective: PTEN/AKT pathway deregulations have been reported to
be associated with treatment response in acute leukemia. This study
examined pediatric T-cell acute lymphoblastic leukemia (T-ALL)
samples for PTEN and AKT1 gene variations and evaluated the clinical
findings.
Materials and Methods: Fifty diagnostic bone marrow samples of
childhood T-ALL cases were investigated for the hotspot regions of
the PTEN and AKT1 genes by targeted next-generation sequencing.
Results: A total of five PTEN variations were found in three of the 50
T-ALL cases (6%). Three of the PTEN variations were first reported in
this study. Furthermore, one patient clearly had two different mutant
clones for PTEN. Two intronic single-nucleotide variations were found
in AKT1 and none of the patients carried pathogenic AKT1 variations.
Conclusion: Targeted deep sequencing allowed us to detect both lowlevel
variations and clonal diversity. Low-level PTEN/AKT1 variation
frequency makes it harder to investigate the clinical associations
of the variants. On the other hand, characterization of the PTEN/
AKT signaling members is important for improving case-specific
therapeutic strategies.
Keywords: T-ALL, PTEN, AKT1, Next-generation sequencing
Öz
Amaç: PTEN/AKT yolak düzensizliklerinin akut lösemide tedavi yanıtı
ile ilişkili olduğu bildirilmiştir. Çalışmanın kapsamı, pediatrik T-ALL
hastalarının PTEN ve AKT1 genlerinin sıcak bölge varyasyonları için
incelenmesi ve klinik bulgularla değerlendirilmesidir.
Gereç ve Yöntemler: Elli pediatrik T-ALL olgusunun tanı zamanı
kemik iliği örnekleri, PTEN ve AKT1 genlerinin sıcak bölgeleri için
hedefe yönelik yeni nesil dizileme ile dizilenmiştir.
Bulgular: Elli T-ALL olgusunun %6’sında PTEN varyasyonu
saptanmıştır. Tespit edilen varyasyonlardan üçü ilk defa bu çalışmada
gösterilmiştir. Ayrıca bir hastanın PTEN açısından iki farklı mutant
klon taşıdığı belirlenmiştir. AKT1 geninde iki intronik tek nükleotid
polimorfizmi tespit edilirken hiçbir olguda patojenik AKT1 varyasyonu
saptanmamıştır.
Sonuç: Derin dizileme, hem düşük düzeydeki varyasyonların hem
de klonal çeşitliliğin belirlenmesine olanak sağlamıştır. T-ALL
hastalarındaki düşük düzey PTEN/AKT1 varyasyon sıklığı, varyantların
klinikle ilişkisinin ortaya çıkarılmasını zorlaştırmaktadır. Diğer yandan,
PTEN/AKT sinyal yolağının karakterizasyonu hasta spesifik terapötik
stratejilerin uygulanabilirliği için önemlidir.
Anahtar Sözcükler: T-ALL, PTEN, AKT1, Yeni nesil dizileme
Introduction
One of the key signal transduction pathways involved in
malignant transformation is the PTEN/PI3K/AKT pathway,
which regulates cellular metabolism, cell growth, translation,
chromosome stability, and cell survival [1]. Phosphatase and
tensin homolog deleted on chromosome ten (PTEN) is a lipid
and dual function phosphatase that antagonizes the PI3K/
AKT pathway; by dephosphorylating phosphoinositide 3-kinase
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Müge Sayitoğlu, Ph.D., İstanbul University, Aziz Sancar Institute of
Experimental Medicine, Department of Genetics, İstanbul, Turkey
Phone : +90 212 414 20 00 -33314
E-mail : mugeay@istanbul.edu.tr ORCID: orcid.org/0000-0002-8648-213X
Received/Geliş tarihi: July 24, 2019
Accepted/Kabul tarihi: November 19, 2019
98
Turk J Hematol 2020;37:98-103
Küçükcankurt F, et al: PTEN and AKT1 Variations in T-ALL
(PI3K) it produces PIP2 (phosphatidylinositol 4,5-bisphosphate)
and PIP3 (phosphatidylinositol (3,4,5)-triphosphate) and so
terminates the transmission of the signal to AKT and other
PIP3-effector targets [2]. AKT1 is a serine threonine kinase
that modulates the cell cycle checkpoint [3]. AKT1 is activated
by platelet-derived growth factor and its activation is
deregulated by mutations in the pleckstrin homology domain of
AKT1. Survival factors can suppress apoptosis in a transcriptionindependent
manner by activating the serine/threonine kinase
AKT1, which then phosphorylates and inactivates components
of the apoptotic machinery [4].
PTEN as a tumor suppressor is frequently mutated in cancers
and its inactivation results in constitutive activation of the
PI3K/AKT pathway. PTEN is a regulatory key to prevent the
malignant transformation of T-cells [5]. The PTEN/AKT pathway
has an important role in the β-selection checkpoint in T-cell
development and lymphocyte homeostasis [6]. PTEN-deficient
T-cells are found to be highly proliferative as a cause of increased
phosphorylation of AKT [7]. AKT1 is highly expressed in thymus
tissue and knockout studies showed that terminal differentiation
in CD8+ T-cells failed, with increased proliferation, cytokine
secretion, and prolonged survival [8,9]. PTEN/AKT abnormalities
resulting in deletion, insertion, or missense mutations lead to
differential regulation in different hematologic malignancies
[10,11,12,13,14]. Genomic resequencing results showed that
PI3K/AKT pathway genes are commonly mutated in pediatric
and young adult T-cell acute lymphoblastic leukemia (T-ALL)
cases [11,15]. In this study, PTEN and AKT1 variations and their
clinical associations were analyzed in a group of childhood
T-ALL cases.
Materials and Methods
Childhood T-ALL cases (n=50) diagnosed at the İstanbul
University Faculty of Medicine and Cerrahpaşa University
Faculty of Medicine were included in this study. Patients were
treated according to the BFM-ALL protocol. Diagnostic bone
marrow samples with a blast count of >80% were included in
the study. The T-cell origin of ALL was defined by the expression
of immunophenotype markers that included CD1a, CD2,
cytoplasmic CD3, surface CD3, CD4, CD5, CD7, and CD8. T-ALL
cases were evaluated according to the European Group for the
Immunological Characterization of Leukemia classification scale
as immature (n=20), cortical (n=17), or mature (n=4); however,
nine cases were not able to be further classified due to limited
immunological marker information [11]. Median age was 8
(range=0.9-17) years and other clinical features of the T-ALL
cases are summarized in Table 1. Written and oral informed
consent was obtained from the legal representatives of the
pediatric patients.
Identification of PTEN and AKT1 variations
The mononuclear cells of the bone marrow samples were isolated
by the Ficoll density gradient procedure [16]. Genomic DNA was
isolated with the QIAamp DNA Mini Kit (QIAGEN GmbH, Hilden,
Germany) according to the manufacturer’s protocol. DNA
quality and quantity were checked with a spectrophotometer
(NanoDrop 100, Thermo Scientific, USA). The hotspot regions of
PTEN (exons 7 and 8) and AKT1 (exon 2) were covered by primer
pairs, which were designed and validated by the ALL package
of the IRON-II (Interlaboratory Robustness of Next-Generation
Sequencing) study (Table 2). Exons were amplified using the
FastStart High Fidelity PCR System and GC-RICH PCR System
kits (Roche Applied Science, Penzberg, Germany). Amplicons
were purified with Ampure XP beads (Beckman Coulter, Krefeld,
Germany) and libraries were quantified by Quant-iT PicoGreen
dsDNA Reagent (Invitrogen, Carlsbad, CA, USA). Deep sequencing
was performed on a Roche FLX GS Junior (454-Life Sciences,
Branford, CT, USA) according to the manufacturer’s instructions.
The minimum read depth threshold per amplicon per sample
was set to 500x. Sanger sequencing was used to confirm the
variations, and low-level variants (variant calling was <20%)
were re-sequenced by using a different MID. After the data
quality assessment, variant detection analyses were done by
AVA software (GS Amplicon Variant Analyzer software version
2.5.3, Roche Applied Science). The in silico prediction tools
MutationTaster [17] and SIFT [18] were used to evaluate the
functional effects of identified variants in PTEN (NM_000314.4)
and AKT1 (NM_005163.2).
Results
A total of 50 childhood T-ALL patients were screened for
hotspot regions of PTEN and AKT1 by targeted deep sequencing.
All detected variations are listed in Table 3. A total of five PTEN
variations were found in three of the 50 T-ALL cases (6%) and
all the variations occurred in exon 7, truncating PTEN in the
C2-domain.
A nonsense c.781C>T, p.Q261* (rs730882131) pathogenic variant
was found in one patient (P#7) with a low frequency (2.1%),
and this somatic variation was evaluated as a small background
clone without any clinical significance. P#7 is a 3.5-year-old boy
who was classified in the medium-risk group (MRG), a responder
to induction therapy who was followed for 27 months.
Three novel variants including insertions and deletions were
detected in two T-ALL cases. One patient (P#48) had two
different mutant clones for PTEN; the first clone carried
c.700_701insCTGGAGCCGAC p.R234Pfs*26 with 40% frequency
and the second clone harbored c.707_720delACAAGTTCATGTAC
and c.724_740delGAGTTCCCTCAGCCGTT deletions that cause
p.D236Vfs*6 with 16% frequency, which are classified as
“deleterious” by SIFT. The deletion area was able to be detected
by conventional sequencing; however, it was not possible to
99
Küçükcankurt F, et al: PTEN and AKT1 Variations in T-ALL
Turk J Hematol 2020;37:98-103
distinguish the clones (Figure 1B). P#48 is a 12-year-old girl
who had high white blood cell count at diagnosis (170x10 9 /L)
with lymphadenopathy, splenomegaly, and hepatomegaly; she
was a responder to induction therapy and has been followed in
remission for 90 months.
One patient (P#27) also had two variations in the PTEN gene:
a likely pathogenic deletion c.703delG, p.G235Kfs*21 with 10%
frequency and a novel insertion c.737_738insAAG, p.P246_
L247insR with 4.6% frequency (Figure 1A). She is 7 years old
and classified in the MRG, a responder to induction therapy. She
Table 1. Clinical features of childhood T-ALL patients.
Clinical features
100
All cases
(n=50)
PTEN variation (+)
(n=3)
Sex
Male:Female 39:11 1:2 37:10
PTEN variation (-)
(n=47)
Platelets, 10 9 /L
Median (min-max) 43000 (5400-450000) 60000 (51000-72000) 44000 (5400-450000)
WBC, 10 9 /L
Median (min-max) 86000 (1300-603000) 90000 (10300-170000) 76400 (1300-603000)
Hemoglobin, g/dL
Median (min-max) 10 (1.2-13.5) 10 (9.3-12) 8.6 (1.2-13.5)
CNS involvement, n (%)
Yes
No
NA
Risk group, n (%)
MRG
HRG
SRG
Steroid response, n (%)
Yes
No
NA
Day 33 BM, n (%)
Remission
No remission
NA
Relapse, n (%)
Yes
No
NA
Last status, n (%)
Live
Dead
NA
NOTCH1/FBXW7 mutation, n (%)
Yes
No
NA
t(9;22), n (%)
Yes
No
t(4;11), n (%)
Yes
No
12 (24)
26 (52)
12 (24)
13 (26)
20 (40)
17 (34)
17 (34)
2 (4)
31 (62)
31 (62)
8 (16)
11 (22)
11 (22)
29 (58)
10 (20)
20 (40)
20 (40)
10 (20)
7 (14)
17 (34)
26 (52)
0 (0)
50 (100)
8 (16)
42 (84)
0 (0)
2 (67)
1 (33)
1 (33)
2 (67)
0 (0)
1 (33)
0 (0)
2 (67)
3 (100)
0 (0)
0 (0)
1 (33)
2 (67)
0 (0)
3 (100)
0 (0)
0 (0)
0 (0)
1 (33)
2 (67)
0 (0)
0 (0)
0 (0)
0 (0)
12 (25.5)
24 (51.1)
11 (23.4)
12 (25.6)
18 (38.2)
17 (36.2)
16 (34)
2 (4)
29 (62)
28 (59.6)
8 (17)
11 (23.4)
10 (21.3)
27 (57.4)
10 (21.3)
17 (36.2)
20 (42.5)
10 (21.3)
7 (14.9)
16 (34)
24 (51.1)
0 (0)
50 (100)
8 (17)
42 (83)
BM: Bone marrow, WBC: white blood cells, Hb: hemoglobin, CNS: eentral nervous system, SRG: standard risk group, MRG: medium risk group, HRG: high risk group, NA: not available,
t: translocation, min: minumum, max: maximum.
Turk J Hematol 2020;37:98-103
Küçükcankurt F, et al: PTEN and AKT1 Variations in T-ALL
Table 2. Gene-specific primer sets for deep sequencing.
Gene Exon Forward primer 5’-3’ Reverse primer 5’ -3’
PTEN 7 GCATTTCCTGTGAAATAATACTGG CACCAATGCCAGAGTAAGCA
PTEN 8 TGTTTAACATAGGTGACAGATTTTCTT AAGTCAACAACCCCCACAAA
AKT1 2 GGTCAGAGAGCTTAGAGGGATG CACAGACCCTGGGGCTACTA
Table 3. Pathogenic PTEN variations in childhood T-ALL patients.
Patient ID HGVSc Protein Variation dbSNP MutationTaster SIFT
P#48 c.700_701insCTGGAGCCGAC p.R234Pfs*26 Insertion Novel DC DM
P#48
c.707_720delACAAGTTCATGTAC
c.724_740delGAGTTCCCTCAGCCGTT
p.D236Vfs*6 Deletion Novel DC DM
P#7 c.781C>T p.Q261* Nonsense rs730882131 DC DM
P#27 c.703delG p.G235Kfs*21 Deletion
ExAc-likely
pathogenic DC DM
P#27 c.737_738insAAG p.P246_L247insR Insertion Novel DC DM
HGVS: Human Genome Variation Society, SIFT: sorting Intolerant from Tolerant, where SIFT scores predict the effect of variants on protein function and ≤0.05 is predicted to have
damaging effects on protein function; dbSNP: database for Single Nucleotide Polymorphisms; MutationTaster indicates that the amino acid sequence changed and protein features
(might have) affected splice site changes, ExAc: Exome Aggregation Consortium, DC: Disease-causing, DM: damaging, DL: Deleterious (NM_000314.4 reference for PTEN).
presented with lymphadenopathy, splenomegaly, hepatomegaly,
and mediastinum involvements. She had early relapse and
has now been in remission for 80 months. Furthermore, two
common intronic single-nucleotide variations, rs2494749 (8%)
and rs2494748 (6%), were found in the AKT1 gene. However,
none of the patients carried the diseased-linked variation in
exon 2 of the AKT1 gene.
NOTCH1/FBXW7 mutation data were available for 24 of the
patients [19]. None of the patients who had NOTCH1/FBXW7
variations carried PTEN or AKT1 mutations for the respective
exons. Furthermore, patients who had PTEN or AKT1 variations
did not carry t(9;22), t(12;21), or t(4;11).
Discussion
Figure 1. Novel variants including insertions and deletions were
detected in two T-ALL cases.
PTEN has an important role in the proliferation and survival
of T-cell progenitors, and its loss may sustain leukemic T-cell
viability in T-ALL [20]. PTEN function is often inactivated by
different mechanisms such as mutations, epigenetic alterations,
gene silencing, and post-translational modifications in cancers
where it can be associated with reduced chemotherapy response
and poor prognosis [21,22].
101
Küçükcankurt F, et al: PTEN and AKT1 Variations in T-ALL
Turk J Hematol 2020;37:98-103
The frequency of PTEN variation was previously reported
as 5%-27% in different studies of T-ALL patients. Different
methodologies, numbers of analyzed cases, and whole exome
or hot spot region examinations may explain this diversity. In
our study, exon 7 and exon 8, which are the hot spot regions
for PTEN gene variations, were screened with targeted amplicon
sequencing. Three patients had PTEN mutations in our cohort;
on the other hand, two of the patients harbored multiple
PTEN mutant clones that we were able to distinguish by deep
sequencing. Furthermore, two patients showed low-level PTEN
variations; we may consider that PTEN mutations were not the
first to be hit for the oncogenic behavior in these T-ALL patients.
In common with other studies, all the mutations were located
in exon 7 and two novel frameshift mutations were detected
in one patient, predicted to cause truncated protein. Truncating
mutations located within the first eight exons of the PTEN gene
lead to mono-allelic expression by nonsense mediated decay
[23]. Furthermore, a nonsense PTEN variation was found in a
T-ALL patient that resulted in the loss of PTEN protein levels [10].
All the patients with mutations for PTEN achieved remission
after induction therapy and one patient developed early relapse.
Furthermore, all patients were alive during the follow-up. PTEN
is implicated in regulating downstream effects of NOTCH1
signaling such as proliferation and survival of T-cell progenitors.
PTEN mutations were also suggested to be secondary mutations
following NOTCH1-activating mutations, rendering cells
insensitive to γ-secretase inhibitors. On the other hand, other
studies suggested that NOTCH1-activating mutations and PTEN
mutations were two different hits in different T-ALL subgroups
[21,24]. Patients with PTEN mutations were particularly
associated with the TAL-1-expressing group in T-ALL cases. In
our cohort, 30% of T-ALL patients harbored NOTCH1/FBXW7
mutations and none of the PTEN mutant samples carried
NOTCH1/FBXW7 aberrations [19].
Previous studies have reported controversial prognostic effects
of PTEN variations in childhood T-ALL [11,13,25]. In the BFM
(n=301) and GBTL1 ALL-99 (Brazilian) (n=62) pediatric ALL
cohort studies, it was shown that in the absence of NOTCH1
mutations PTEN gene variations were associated with poor
prognosis, while the DCOG/COALL (German) (n=146) cohort
study reported PTEN variations as independent high-risk factors
for relapse [10]. However, the UKALL2003 (n=145) pediatric
cohort could not find any association between PTEN variations
and clinical findings [11]. An Italian study group examined 257
children with T-ALL treated with AIEOP-BFM protocols. They
found an association between increased risk of relapse and PTEN
mutations in pediatric T-ALL [26]. In another study, Szarzynska-
Zawadzka et al. [27] screened 162 patients with T-ALL for
PTEN aberrations (mutations, copy number variations, and
deletions) and found that PTEN deletions were more common
than mutations (16% vs. 9%) in the patients. Additionally, biallelic
inactivation of PTEN (co-occurrence of deletions and
mutations) was detected in 8% of patients. PTEN deletions were
associated with worse survival and increased risk of relapse.
However, PTEN mutations were associated with poor survival
but not with relapse. These findings suggest the existence of
multiple leukemic sub-clones displaying various PTEN anomalies,
with each of these subsets possibly having different biological
and clinical features. Detailed analysis of the type of genetic
anomaly would be useful to refine risk stratification based on
PTEN status.
Study Limitations
This study has some limitations. The number of patients in the
study is limited and the patients had only been screened for the
hot spot regions of the genes, although variation frequencies
are similar to those of other studies.
Conclusion
PTEN tumor suppressor gene inactivation is a frequent
event in T-ALL, but its effect on patient therapy response is
debatable. Herein, only a small proportion of T-ALL patients
had PTEN and AKT1 variations. Therefore, it is not possible to
reach a meaningful conclusion about the prognostic value of
PTEN mutations in T-ALL. In our cohort, screening for PTEN
abnormalities at diagnosis did not add further information
about patients’ risk groups. However, the PTEN genotype may
serve as a potential biomarker for targeted therapy in later
perspective studies. Furthermore, PTEN mutations are not the
only aberrations that contribute to the loss of PTEN protein in
T-ALL patient samples. Other PTEN aberrations (copy number
variations, deletions), different molecular mechanisms like
effective PTEN-splicing, long noncoding RNAs, and epigenetic
modulations that also lead to PTEN inactivation should also be
evaluated in the future. The PTEN/AKT pathway has a critical role
in cell growth and survival and has become a target pathway
for pharmacological studies due to its frequent activation in
various types of tumors [28,29,30,31,32]. In order to identify
patients who may benefit from novel developed therapeutics,
it is important to characterize the molecular background of the
patients.
Ethics
Ethics Committee Approval: The ethical committee of
the İstanbul Medical Faculty (reference number and date:
1298/22.08.2014) approved this study.
Informed Consent: It was obtained from the parents or legal
guardians before patients’ enrollment in the study.
Authorship Contributions
Concept: M.S, U.Ö., O.H.; Design: S.F., M.S., O.H., Y.E.; Data
Collection or Processing: F.K., Y.E., M.S., Z.K, T.C., A.Ü; Analysis
102
Turk J Hematol 2020;37:98-103
Küçükcankurt F, et al: PTEN and AKT1 Variations in T-ALL
or Interpretation: F.K., Y.E., M.S, S.F; Literature Search: F.K., Y.E.,
M.S.; Writing: F.K., Y.E., M.S.
Acknowledgments: We highly appreciate the efforts of Monica
Ann Malt, MSN, RN, and CPAN (Bezmialem Vakıf University,
Turkey), for language editing of this paper.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The present work was supported by the
Research Fund of İstanbul University (Project No. 48185) and
the İstanbul Development Agency, Investment in the Future:
Project of BIOBANK (Project No: TR10/15/YNK/0093).
References
1. Yin Y, Shen WH. PTEN: A new guardian of the genome. Oncogene
2008;27:5443-5453.
2. Hopkins BD, Hodakoski C, Barrows D, Mense SM, Parsons RE. PTEN function:
The long and the short of it. Trends Biochem Sci 2014;39:183-190.
3. Cai J, Xu L, Tang H, Yang Q, Yi X, Fang Y, Zhu Y, Wang Z. The role of the
PTEN/PI3K/Akt pathway on prognosis in epithelial ovarian cancer: a metaanalysis.
Oncologist 2014;19:528-535.
4. Mahajan K, Mahajan NP. PI3K-independent AKT activation in cancers: a
treasure trove for novel therapeutics. J Cell Physiol 2012;227:3178-3184.
5. Maehama T. PTEN: Its deregulation and tumorigenesis. Biol Pharm Bull
2007;30:1624-1627.
6. Suzuki A, Yamaguchi MT, Ohteki T, Sasaki T, Kaisho T, Kimura Y, Yoshida
R, Wakeham A, Higuchi T, Fukumoto M, Tsubata T, Ohashi PS, Koyasu S,
Penninger JM, Nakano T, Mak TW. T cell-specific loss of Pten leads to defects
in central and peripheral tolerance. Immunity 2001;14:523-534.
7. Carnero A, Paramio JM. The PTEN/PI3K/AKT pathway in vivo, cancer mouse
models. Front Oncol 2014;4:252.
8. Le Page C, Koumakpayi IH, Alam-Fahmy M, Mes-Masson AM, Saad F.
Expression and localisation of Akt-1, Akt-2 and Akt-3 correlate with clinical
outcome of prostate cancer patients. Br J Cancer 2006;94:1906-1912.
9. Sauer S, Bruno L, Hertweck A, Finlay D, Leleu M, Spivakov M, Knight ZA,
Cobb BS, Cantrell D, O’Connor E, Shokat KM, Fisher AG, Merkenschlager M.
T cell receptor signaling controls Foxp3 expression via PI3K, Akt, and mTOR.
Proc Natl Acad Sci U S A 2008;105:7797-7802.
10. Zuurbier L, Petricoin EF 3rd, Vuerhard MJ, Calvert V, Kooi C, Buijs-Gladdines
JG, Smits WK, Sonneveld E, Veerman AJ, Kamps WA, Horstmann M, Pieters
R, Meijerink JP. The significance of PTEN and AKT aberrations in pediatric
T-cell acute lymphoblastic leukemia. Haematologica 2012;97:1405-1413.
11. Jenkinson S, Kirkwood AA, Goulden N, Vora A, Linch DC, Gale RE. Impact
of PTEN abnormalities on outcome in pediatric patients with T-cell acute
lymphoblastic leukemia treated on the MRC UKALL2003 trial. Leukemia
2016;30:39-47.
12. Larson Gedman A, Chen Q, Kugel Desmoulin S, Ge Y, LaFiura K, Haska
CL, Cherian C, Devidas M, Linda SB, Taub JW, Matherly LH. The impact
of NOTCH1, FBW7 and PTEN mutations on prognosis and downstream
signaling in pediatric T-cell acute lymphoblastic leukemia: a report from
the Children’s Oncology Group. Leukemia 2009;23:1417-1425.
13. Gutierrez A, Sanda T, Grebliunaite R, Carracedo A, Salmena L, Ahn Y, Dahlberg
S, Neuberg D, Moreau LA, Winter SS, Larson R, Zhang J, Protopopov A, Chin
L, Pandolfi PP, Silverman LB, Hunger SP, Sallan SE, Look AT. High frequency
of PTEN, PI3K and AKT abnormalities in T cell acute lymphoblastic leukemia.
Blood 2009;114:647-650.
14. Morotti A. The role of the tumor suppressor PTEN in chronic myeloid
leukemia pathogenesis. Science Proceedings 2015;2:e638.
15. Liu Y, Easton J, Shao Y, Maciaszek J, Wang Z, Wilkinson MR, McCastlain K,
Edmonson M, Pounds SB, Shi L, Zhou X, Ma X, Sioson E, Li Y, Rusch M, Gupta
P, Pei D, Cheng C, Smith MA, Auvil JG, Gerhard DS, Relling MV, Winick
NJ, Carroll AJ, Heerema NA, Raetz E, Devidas M, Willman CL, Harvey RC,
Carroll WL, Dunsmore KP, Winter SS, Wood BL, Sorrentino BP, Downing
JR, Loh ML, Hunger SP, Zhang J, Mullighan CG. The genomic landscape of
pediatric and young adult T-lineage acute lymphoblastic leukemia. Nat
Genet 2017;49:1211-1218.
16. Panda SK, Ravindran B. Isolation of human PBMCs. Bio-Protocol 2013;3:4-6.
17. Schwarz JM, Cooper DN, Schuelke M, Seelow D. MutationTaster2: Mutation
prediction for the deep-sequencing age. Nat Methods 2014;11:361-362.
18. Choi Y, Sims GE, Murphy S, Miller JR, Chan AP. Predicting the functional
effect of amino acid substitutions and indels. PLoS One 2012;7:e46688.
19. Erbilgin Y, Sayitoglu M, Hatirnaz O, Dogru O, Akcay A, Tuysuz G, Celkan T,
Aydogan G, Salcioglu Z, Timur C, Yuksel-Soycan L, Ure U, Anak S, Agaoglu
L, Devecioglu O, Yildiz I, Ozbek U. Prognostic significance of NOTCH1 and
FBXW7 mutations in pediatric T-ALL. Dis Markers 2010;28:353-360.
20. Tesio M, Trinquand A, Macintyre E, Asnafi V. Oncogenic PTEN functions and
models in T-cell malignancies. Oncogene 2016;35:3887-3896.
21. Mendes RD, Canté-Barrett K, Pieters R, Meijerink JP. The relevance of PTEN-
AKT in relation to NOTCH1-directed treatment strategies in T-cell acute
lymphoblastic leukemia. Haematologica 2016;101:1010-1017.
22. Milella M, Falcone I, Conciatori F, Cesta Incani U, Del Curatolo A, Inzerilli
N, Nuzzo CM, Vaccaro V, Vari S, Cognetti F, Ciuffreda L. PTEN: Multiple
functions in human malignant tumors. Front Oncol 2015;16;5:24.
23. Tétreault MP. Esophageal cancer: insights from mouse models. Cancer
Growth Metastasis 2015;8(Suppl 1):37-46.
24. Palomero T, Sulis ML, Cortina M, Real PJ, Barnes K, Ciofani M, Caparros E,
Buteau J, Brown K, Perkins SL, Bhagat G, Agarwal AM, Basso G, Castillo
M, Nagase S, Cordon-Cardo C, Parsons R, Zúñiga-Pflücker JC, Dominguez
M, Ferrando AA. Mutational loss of PTEN induces resistance to NOTCH1
inhibition in T-cell leukemia. Nat Med 2007;13:1203-1210.
25. Jotta PY, Ganazza MA, Silva A, Viana MB, da Silva MJ, Zambaldi LJ, Barata
JT, Brandalise SR, Yunes JA. Negative prognostic impact of PTEN mutation in
pediatric T-cell acute lymphoblastic leukemia. Leukemia 2010;24:239-242.
26. Paganin M, Grillo MF, Silvestri D, Scapinello G, Buldini B, Cazzaniga G,
Biondi A, Valsecchi MG, Conter V, Te Kronnie G, Basso G. The presence of
mutated and deleted PTEN is associated with an increased risk of relapse in
childhood T cell acute lymphoblastic leukaemia treated with AIEOP-BFM
ALL protocols. Br J Haematol 2018;182:705-711.
27. Szarzynska-Zawadzka B, Kunz JB, Sedek Ł, Kosmalska M, Zdon K, Biecek
P, Bandapalli OR, Kraszewska-Hamilton M, Jaksik R, Drobna M, Kowalczyk
JR, Szczepanski T, Van Vlierberghe P, Kulozik AE, Witt M, Dawidowska M.
PTEN abnormalities predict poor outcome in children with T-cell acute
lymphoblastic leukemia treated according to ALL IC-BFM protocols. Am J
Hematol 2019;94:93-96.
28. Dillon L, Miller T. Therapeutic targeting of cancers with loss of PTEN
function. Curr Drug Targets 2014;15:65-79.
29. Hall CP, Reynolds CP, Kang MH. Modulation of glucocorticoid resistance in
pediatric T-cell acute lymphoblastic leukemia by increasing BIM expression
with the PI3K/mTOR inhibitor BEZ235. Clin Cancer Res 2016;22:621-632.
30. Azimi A, Azimi A. Hypothesis: ROBOPHERA, a phosphatase and tensin
homolog-targeted antineoplastic therapy. Anticancer Drugs 2017;28:369-375.
31. Zhang X, Park JS, Park KH, Kim KH, Jung M, Chung HC, Rha SY, Kim HS. PTEN
deficiency as a predictive biomarker of resistance to HER2-targeted therapy
in advanced gastric cancer. Oncology 2015;88:76-85.
32. Moses C, Nugent F, Waryah CB, Garcia-Bloj B, Harvey AR, Blancafort P.
Activating PTEN tumor suppressor expression with the CRISPR/dCas9
system. Mol Ther Nucleic Acids 2019;14:287-300.
103
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2019.2019.0312
Turk J Hematol 2020;37:104-110
Expression Profile Screening and Bioinformatics Analysis of
circRNA, LncRNA, and mRNA in Acute Myeloid Leukemia Drug-
Resistant Cells
Akut Myeloid Lösemi İlaç-Dirençli Hücrelerde circRNA, LncRNA, ve mRNA Ekspresyon
Profili Tarama ve Biyoinformatik Analizi
Meiling Li 1,2 , Fuxue Meng 2 , Quanyi Lu 1
1Zhongshan Hospital Affiliated to Xiamen University, Department of Hematology, Xiamen, China
2The Third Affiliated Hospital of Guizhou Medical University, Department of Hematology and Rheumatology, Duyun, China
Abstract
Objective: Acute myeloid leukemia (AML) is a highly heterogeneous
hematological malignancy, and drug resistance and relapse are
key factors in the failure of leukemia treatment. Studies have
increasingly shown that circRNA and LncRNA play important roles
in the development of tumors, but their roles remain unclear in the
mechanism of AML resistance.
Materials and Methods: Resistant AML cell line HL-60/ADM
(adriamycin, ADM) was constructed and circRNA, LncRNA, and mRNA
expression profiles were screened followed by high-throughput
sequencing. Bioinformatics analysis was then carried out, and the
circRNA-miRNA ceRNA network was constructed and confirmed using
qRT-PCR analysis.
Results: A total of 1824 circRNAs, 2414 LncRNAs, and 5346 mRNAs
were screened for differentially expressed genes. Enrichment analysis
was performed utilizing Gene Ontology and the Kyoto Encyclopedia of
Genes and Genomes, which mainly involved protein domain specific
binding, transforming growth factor-β (TGF-β) receptor, and cellular
metabolism. The mTOR signaling pathway, MAPK signaling pathway,
RAP1 signaling pathway, and Akt signaling pathway were closely
related to drug resistance.
Conclusion: Our study provides a systematic outlook on the potential
function of ncRNA in the molecular mechanisms of resistant AML cells.
Hsa-circ-0000978 and hsa-circ-0000483 might serve as potential
prognostic biomarkers and therapeutic targets of AML resistance.
Keywords: Acute myeloid leukemia, Drug resistance, CircRNA, LncRNA,
Bioinformatics analysis
Öz
Amaç: Akut myeloid lösemi (AML) oldukça heterojen bir hematolojik
malignitedir, ve tedavi başarısızlığında ilaç direnci ve nüks anahtar rol
oynamaktadır. Çalışmalar, circRNA ve lncRNA’nın tümör gelişiminde
önemli rol oynadığını artarak göstermektedir, ancak AML direnç
mekanizmasında rolleri belirsizliğini korumaktadır.
Gereç ve Yöntemler: Dirençli AML hücre hattı HL-60/ADM (adriamisin,
ADM) oluşturuldu ve circRNA, LncRNA, ve mRNA ekspresyon profilleri
yüksek-kapasitede dizileme sonrası tarandı. Sonra biyoinformatik
analiz gerçekleştirildi ve circRNA-miRNA ceRNA ağı oluşturuldu ve
qRT-PCR analizi kullanılarak doğrulandı.
Bulgular: Farklı ifade edilen genler için toplam 1824 circRNA, 2414
LncRNA, ve 5346 mRNA tarandı. Başlıca protein domain spesifik
bağlama, transforme edici büyüme faktörü-β (TGF-β) reseptörü, ve
hücresel metabolizma ile ilgili ‘Gene Ontology’ ve ‘Kyoto Encyclopedia
of Genes and Genome’ kullanılarak zenginleştirme analizi
gerçekleştirildi. mTOR sinyal yolağı, MAPK sinyal yolağı, RAP1 sinyal
yolağı ve Akt sinyal yolağı ilaç direnci ile yakından ilişkili idi.
Sonuç: Çalışmamız, dirençli AML hücrelerinin moleküler
mekanizmasında ncRNA’ın potansiyel fonksiyonuna sistematik bir
bakış açısı sağlamıştır. Hsa-circ-0000978 ve hsa-circ-0000483
potansiyel prognostik biyogöstergeler ve AML direncinin terapötik
hedefleri olarak işlev görebilirler.
Anahtar Sözcükler: Akut myeloid lösemi, İlaç direnci, CircRNA,
LncRNA, Biyoinformatik analiz
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Quanyi Lu, M.D., Zhongshan Hospital Affiliated to Xiamen
University, Department of Hematology, Xiamen, China
Phone : 86-18375129409
E-mail : wzst666@126.com ORCID: orcid.org/0000-0001-7173-6080
Received/Geliş tarihi: August 22, 2019
Accepted/Kabul tarihi: December 3, 2019
104
Turk J Hematol 2020;37:104-110
Li M, et al: Expression Profile of Resistant Leukemia Cells
Introduction
Acute myeloid leukemia (AML) is a highly heterogeneous
hematological malignancy. Although its treatment has made
significant progress, the prognosis is still unsatisfactory.
Recurrence and drug resistance are the main factors [1]. At
present, there are many studies on the molecular mechanisms
of AML resistance [2,3]. However, with the development of
bioinformatics, the epigenetic mechanism in the pathogenesis
of AML still remains unclear.
Among human transcripts, about 10%-20% are proteinencoding
RNA, and the remaining 80%-90% are noncoding
RNAs (ncRNAs) [4,5]. Long noncoding RNAs (LncRNAs) are a
class of noncoding RNAs that regulate gene expression at the
transcriptional or posttranscriptional level [6]. LncRNA plays
an important regulatory role in the drug resistance process. Li
et al. [7] reported that the LncRNA HOTTIP can promote the
development of pancreatic cancer and regulate gemcitabine
resistance by regulating HOXA13, while HOTTIP regulates
cisplatin resistance in osteosarcoma cells by activating the
Wnt/β-catenin pathway [8]. In addition, Qu et al. [9] found that
in sunitinib-resistant renal cell carcinoma, when FOX0 and AKT
expression decreased, LncRNA increased, knocking out LncRNA
and then reversing drug resistance. Endogenous competition
between mir-34 and mir-449 promotes the expression of AXL
and c-MET in sunitinib-resistant renal cell carcinoma to regulate
the drug resistance process, confirming that LncRNA can be used
as a target to repair drug resistance. Circular RNAs (circRNAs)
are novel noncoding RNAs characterized by a covalently closed
structure with nonrandom spiking and RNase degradation
resistance [10,11]. CircRNA is present in the cytoplasm and is
extremely abundant and highly conserved and stable in the
blood [12]. CircRNAs are increasingly found in various diseases
and show cell or tissue specificity [13,14,15].
At present, the molecular mechanism of LncRNA and circRNA
in resistant AML cells remains unclear. In this study, highthroughput
sequencing of HL-60 and HL-60/ADM (adriamycin,
ADM) was performed utilizing Gene Ontology (GO) and the
Kyoto Encyclopedia of Genes and Genomes (KEGG). A circRNAmiRNA
ceRNA network was constructed to provide new
therapeutic targets and the theoretical basis for treatment of
drug resistance in AML.
Materials and Methods
Materials
HL-60 cells were donated by Professor Lu Quanyi of the Key
Laboratory of Hematology, Xiamen University, Xiamen, China.
Basic RPMI 1640 Medium (GIBCO, Carlsbad, CA, USA), fetal
bovine serum (FBS; ScienCell, Carlsbad, CA, USA), adriamycin
(Haizhenghuirui Pharmaceutical Co. Ltd., Fuyang, Zhejiang,
China), the Cell Counting Kit-8 (Dojindo, Tokyo, Japan), RIPA
buffer (Beijing Solarbio Science & Technology Co. Ltd., Beijing,
China), the BCA Protein Assay Kit and One-Step Western Kit HRP
(Beijing Kangwei Century Biotechnology Co. Ltd., Beijing, China),
GAPDH monoclonal antibody (ImmunoWay Biotechnology Co,
Plano, TX, USA); P-gp monoclonal antibody (Abcam, Cambridge,
MA, USA), and Immobilon Western Chemiluminescent HRP
Substrate (Millipore Corp., Billerica, MA, USA) were also obtained.
Methods
Cell Culture and Drug Resistance Induction
HL-60 cells were incubated in basic RPMI 1640 Medium containing
10% FBS, 100 µg/mL streptomycin, and 100 U/mL penicillin at
37 °C and 5% CO 2
under saturated humidity conditions after
recovery. The liquid was changed once every 2 days, and 10 6
cells/mL were amplified at a 1:3 ratio. ADM induction was
performed in HL-60 cells by combining the concentration
gradient increasing method and the impact method (high-dose
intermittent induction) as referenced in the literature [16]. The
initial induction concentration was 0.1 µg/mL, shock induction
was performed for 1 h, and culturing was continued until HL-60
cells grew and proliferated normally at 1 µg/mL ADM. It took 8
months to successfully induce ADM resistance in HL-60 cells.
CCK-8 Assay and Cell IC 50
Values
HL-60 cells were collected and centrifuged at 1000 rpm/min for
5 min, and then they were resuspended in RPMI 1640 Medium
and counted. Furthermore, 10 4 cells of cell suspensions of 100
µL were placed in 96-well plates at 37 °C in a 5% CO 2
incubator
for culturing for 24 h. ADM was added with differences in
concentrations of 10 µL and cells were incubated for 24 h, and
then 10 µL of CCK-8 solution was added to each well. Culture
plates were further incubated in the incubator for 4 h. OD values
were measured and data were collected to calculate IC 50
values,
or ADM concentrations required for 50% inhibition in vitro.
Western Blot Detection of the Expression of Drug-Resistant
Protein
RIPA buffer was added with phenylmethanesulfonyl fluoride
to collect the cells showing logarithmic growth, and proteins
were extracted from the cells. Protein concentration was
determined using the BCA Protein Assay Kit. Protein samples
containing sample buffer were denatured for 5 min in boiling
water. SDS-PAGE electrophoresis was performed with 25 µg of
sample in each hole with the addition of 5 µL of prestained
protein marker. When the bromophenol blue dye ran off the
gel layer, the electrophoresis was terminated, and further
experiments were performed on a 35 mA transmembrane
overnight. The One-Step Western Kit HRP was used according to
the manufacturer’s instructions. Rabbit P-gp antibody, antibody
pretreatment solution, and dilution buffer solution were added,
105
Li M, et al: Expression Profile of Resistant Leukemia Cells
Turk J Hematol 2020;37:104-110
mixed, and poured onto the membrane. Immobilon Western
Chemiluminescent HRP Substrate was used for color reaction.
RNA Library Construction and Sequencing
High-throughput sequencing service was provided by CloudSeq
Biotech (Shanghai, China). Transcriptome high-throughput
sequencing and subsequent bioinformatics analyses were also
performed by CloudSeq Biotech (Shanghai, China). Briefly, total
RNA was used to remove the rRNAs using the Ribo-Zero rRNA
Removal Kit (Illumina, USA) according to the manufacturer’s
instructions. RNA libraries were constructed using rRNAdepleted
RNAs with the TruSeq Stranded Total RNA Library Prep
Kit (Illumina, USA) according to the manufacturer’s instructions.
Libraries were checked for quality, and they were quantified
using the Bioanalyzer 2100 system (Agilent Technologies, USA).
Furthermore, 10 pM libraries were denatured as single-stranded
DNA molecules, captured on Illumina flow cells, amplified in situ
as clusters, and finally sequenced for 150 cycles on an Illumina
HiSeq Sequencer according to the manufacturer’s instructions.
Bioinformatics Analysis
For circRNA, high-quality reads were aligned to the reference
genome/transcriptome with STAR software (v2.5.1b) and
circRNAs were detected and identified with DCC software
(v0.4.4). edgeR software (v3.16.5) was used to normalize the
data and perform analysis of differentially expressed circRNAs.
GO and KEGG analyses were performed for the differentially
expressed circRNA-associated genes.
For LncRNA and mRNA, high-quality reads were aligned to the
human reference genome (UCSC hg19) with HISAT2 software
(v2.0.4). Then, guided by the Ensembl gtf gene annotation file,
the Cuffdiff program (v2.2.1, part of Cufflinks software) was
used to get the FPKM (fragments per kilobase of exon model per
million reads mapped) for the expression profiles of LncRNA and
mRNA. Accordingly, fold change and p-values were calculated
based on FPKM, and differentially expressed LncRNAs and
mRNAs were identified. LncRNA target genes were predicted
by locations in relation to nearby genes, and GO and pathway
analyses were performed on these target genes.
Time PCR System (Applied Biosystems) using the qPCR SYBR Green
Master Mix (CloudSeq). Primer design was as follows: chr13:
50054355-50057699+ (F 5’-CCTGAATCCAAGACAGCCA-3’, R
5’-AAGGGGGAAGTTTTGGCA-3’), chr18: 21644104-21649235+ (F
5’-GAAAATCCGCCCCCTCTA-3’, R 5’-TGACAAAGCTGGCTCCAA-3’),
chr7: 22330794-22357656- (F 5’-CATTCCTGCCAGAGGTGG-3’, R
5’-TGGGAAGGCGTATGTTCAA-3’), chr2: 15629018-15651474- (F
5’-CATCTGGGCGATTCCATC-3’, R 5’- AACCCCGTCTCCACCATT-3’),
and ACTB (F5’-GTGGCCGAGGACTTTGATTG-3’, R
5’-CCTGTAACAACGCATCTCATATT-3’). The target RNA and
internal parameters of each sample were subjected to real-time
PCR, which was repeated three times. The data were analyzed
by the 2 -ΔΔC T method.
Statistical Analysis
All of the experimental data are presented as mean ± standard
deviation (SD), and the t-test was used for comparisons
between the two groups. Values of p<0.05 were considered to
be significantly different. GraphPad Prism 5 software was used
for statistical analysis.
Results
Construction of HL-60/ADM Drug-Resistant Cell Lines
Adriamycin resistance was induced in HL-60 cells via a
combination of the concentration gradient method and the
impact method (high-dose intermittent induction method)
according to the literature [16], and it took 8 months to obtain
HL-60/ADM resistant cell lines. IC 50
detection is shown in
Figure 1A. The expression of the drug resistance protein P-gp
in HL-60/ADM resistant cells was significantly higher than that
in HL-60 cells, with significance at p<0.01 (Figures 1B and 1C).
Expression of circRNA, LncRNA, and mRNA in Resistant Cells
To analyze the gene expression of resistant AML cells, we
performed high-throughput sequencing of circRNA, LncRNA,
and mRNA, and we screened differentially expressed genes.
Hierarchical cluster analysis showed that the expression patterns
Construction of circRNA-miRNA ceRNA Network
CircRNA-miRNA interactions were predicted using miRcode
(http://www.mircode.org/) and TargetScan (http://www.
targetscan.org/vert_72/) based on seed-match sequences. The
circRNA-miRNA network was then constructed using Cytoscape
software (http://www.cytoscape.org/).
Validation of Differentially Expressed circRNAs
Total RNA was extracted by TRIzol (Invitrogen Life Technologies,
Shanghai, China) to synthesize cDNA via reverse transcription.
Quantitative real-time PCR was performed on the ViiA 7 Real-
Figure 1. Detection of HL-60/ADM resistance: A) HL-60/ADM IC 50
test, where the ADM concentration gradient was set at 0, 0.1, 0.2,
0.4, 0.8, and 1.6 µg/mL. The horizontal axis is ADM concentration
and vertical axis is inhibition rate. B) Expression of drug-resistance
related protein P-gp. C) P-gp/GAPDH ratio (**p<0.01).
106
Turk J Hematol 2020;37:104-110
Li M, et al: Expression Profile of Resistant Leukemia Cells
of drug-resistant and drug-sensitive cells were significantly
different (circRNA, Figure 2A; LncRNA, Figure 2D; mRNA, Figure
2G). Scatter plots were used to evaluate circRNA between
drug-resistant and drug-sensitive cells. LncRNA and mRNA
signal values were normalized to log2 values for visualization
of expression differences (Figures 2B, 2E, and 2H, respectively).
Volcanic maps were constructed based on fold change (FC≥1.2)
and p-value (<0.05), and volcano maps of the differentially
expressed genes between these two different conditions are
provided in Figures 2C, 2F, and 2I. The general characteristics of
RNA include RNA type, length, and localization distribution, as
shown in Figures 2J-2L. The results showed that resistant AML
cells differentially expressed 1824 circRNAs, 2414 LncRNAs, and
5346 mRNAs.
Functional Analysis of Differentially Expressed circRNA, LncRNA,
and mRNA
To explore the underlying genomics mechanisms involved in the
developmental disorders of AML tumorigenesis, GO and KEGG
pathway enrichment analyses of differentially expressed genes
were used to evaluate candidate RNA functions. The GO terms
with the highest enrichment scores for upregulated circRNA
targeting were ribonucleoside triphosphate catabolic process
and purine ribonucleoside triphosphate catabolic process (BP),
intracellular (CC), and adenyl ribonucleotide binding (MF); for
LncRNA, the GO terms involved macromolecule modification
(BP), cornified envelope (CC), and protein homodimerization
activity (MF); and anatomical structure morphogenesis (BP),
cytoplasm (CC), and protein binding (MF) belonged to the GO
analysis of mRNA. Furthermore, KEGG pathway analysis was
performed to predict potential module functions. The KEGG
analysis results were as follows: for circRNA, the B cell receptor
signaling pathway (hsa04662), T cell receptor signaling pathway
(hsa04660), MAPK signaling pathway (hsa04010), and mTOR
signaling pathway (hsa04150); for LncRNA, signaling pathways
regulating pluripotency of stem cells (hsa04550); and for mRNA,
the Wnt signaling pathway (hsa04310), Rap1 signaling pathway
(hsa04015), p53 signaling pathway (hsa04115), and VEGF
signaling pathway (hsa04370). These are closely related to cancer
progression and are significantly enriched in AML (Figure 3).
Construction of circRNA-miRNA ceRNA Network
To fully understand the underlying mechanisms of circRNA
and AML development, based on differentially expressed
circRNA data, we used a database to predict target miRNAs
interacting with circRNA, and Cytoscape was used to construct
a circRNA-targeted miRNA gene network map (Figure 4). For a
particular miRNA, circRNA has many targets, and the network
map illustrates the first five predicted miRNA targets that
differentially express circRNA.
Validation of circRNA Expression by RT-qPCR
Two upregulated genes (chr7: 2330794-22357656- and chr2:
15629018-15651474-) and two downregulated genes (chr13:
50054355-50057699+ and chr18: 21644104-21649235+)
Figure 2. Differential expression of circRNA, LncRNA, and mRNA
in HL-60/ADM. A-C) Hierarchical clustering, scatter plots, and
volcano plots of the differentially expressed circRNAs in HL-
60 and HL-60/ADM, respectively. D-F) Hierarchical clustering,
scatter plots, and volcano plots of the differentially expressed
LncRNAs in HL-60 and HL-60/ADM, respectively. G-I) Hierarchical
clustering, scatter plots, and volcano plots of the differentially
expressed mRNAs in HL-60 and HL-60/ADM, respectively. J) The
catalog of differentially expressed circRNAs. K) Distribution of
differentially expressed LncRNAs based on the length of nuclear
acids. L) Distribution of differentially expressed mRNAs based on
the location on human chromosomes.
Figure 3. GO and KEGG pathway analysis of circRNA, LncRNA,
and mRNA. A-B) Analysis of GO in terms of upregulation and
downregulation of circRNA. C) Pathway analysis of upregulation of
LncRNA. D) GO molecular function classification for upregulation
of mRNA.
107
Li M, et al: Expression Profile of Resistant Leukemia Cells
Turk J Hematol 2020;37:104-110
were selected from the circRNAs with differential expression.
Differentially expressed circRNA levels were verified by RTqPCR.
As shown in Figure 5, the results of four circRNAs were
consistent with the trend observed in circRNA sequencing.
Discussion
At present, chemotherapy is still one of the main treatments
for leukemia. However, multidrug resistance and treatment
Figure 4. Network of twelve differentially expressed circRNA
and miRNA genes predicted in drug-resistant cells. CircRNA:
Red circles; MiRNA: green polygons. Twelve different genes were
selected from the upregulated circRNAs to construct the circRNAtargeted
miRNA gene network. Each circRNA is shown with five
miRNA predicted targets.
Figure 5. Expression levels of differentially expressed circRNA were
detected by RT-qPCR. The horizontal axis is genes and the vertical
axis is circRNA expression levels. A) Two genes, chr7:2330794-
22357656- and chr2:15629018-15651474, were selected from
circRNA with upregulated expression. B) chr13:50054355-
50057699+ and chr18:21644104-21649235+ were selected from
downregulated circRNAs. The target RNA and internal parameters
of each sample were subjected to real-time PCR, which was
repeated three times. The data were analyzed by 2- ΔΔC T method.
**p<0.01,*p<0.05.
are key factors in the failure of leukemia treatment. Several
factors are involved in the mechanism of leukemia resistance,
including ABC transporter-mediated multidrug resistance [17],
DNA repair abnormalities [18], variations in the bone marrow
microenvironment [19], and abnormal expression of noncoding
RNAs including circRNA, miRNA, and LncRNA [20]. Undeniably,
ncRNAs have opened up new prospects for AML diagnosis,
prognosis, and treatment. Indeed, the expression of specific
ncRNAs such as circRNAs and LncRNAs could assist clinicians
in classifying subtypes, evaluating prognosis, and predicting
the response to drug treatment in AML. Garzon et al. [21]
evaluated the associations of LncRNA expression with clinical
characteristics, gene mutations, and outcomes and constructed
an LncRNA score including 48 LncRNAs for independently
predicting outcome prognosis, confirming that LncRNAs can
assist in predicting clinical outcomes in older patients with
CN-AML. Moreover, Li and Sun [22] reported that SNHG5
overexpression was frequently observed in AML patients with
advanced FAB classification and unfavorable cytogenetics.
Furthermore, a higher SNHG5 expression level was also associated
with shorter overall survival. However, comprehensive analyses
of the profiles of differentially expressed circRNAs, LncRNAs,
and mRNAs in resistant AML cells have not been studied. Thus,
we explored the expression profiles and predicted the potential
functions of circRNAs, LncRNAs, and mRNAs in resistant
AML cells by utilizing RNA high-throughput sequencing and
bioinformatics analysis.
The numbers of differentially expressed genes of circRNAs,
LncRNAs, and mRNA in resistant AML cells are 1824, 2414,
and 5346, respectively. GO and KEGG pathway analyses of
differentially expressed LncRNAs mainly revealed protein
domain specific binding and protein dimerization activity. This
provides a basis for important contributions to the development
and resistance of leukemia. Although the understanding of the
nature and function of circRNAs is still limited, it is undeniable
that circRNA has always been a research hotspot in the field
of ncRNAs, which particularly regulate miRNA-targeted gene
expression as ceRNA molecules [23,24]. GO and KEGG pathway
analyses predicted that these differentially expressed circRNA
functions were related to tumor development, drug-resistant
regulation, and metabolism-related pathways.
GO analysis mainly revealed involvement with PI3K activity,
transforming growth factor-β (TGF-β) receptor, and cellular
metabolism. Sui et al. [25] reported that activation of the
PI3K/Akt/NF-κB pathway promotes P-gp expression, and the
inhibition of this pathway reverses P-gp-mediated multidrug
resistance. Zhou et al. explored the effect of the PI3K-specific
inhibitor ZSTK474 on K562/A02 cells and their results showed
that ZSTK474 reversed the resistance of K562/A02 cells to ADM
and imatinib by downregulating P-gp expression; accordingly,
the target of ZSTK474 for CML treatment is PI3K [26]. It can be
108
Turk J Hematol 2020;37:104-110
Li M, et al: Expression Profile of Resistant Leukemia Cells
seen that PI3K activity plays an important role in the regulation
of drug resistance in leukemia. Results of KEGG analysis indicated
that the upregulated circRNA in drug-resistant cells was mainly
related to the mTOR signaling pathway, MAPK signaling pathway,
and Akt signaling pathway. The PI3K/Akt signaling pathway
maintains a close relationship between tumor cell multidrug
resistance and P-gp. Studies have shown that activation of the
PI3K/Akt signaling pathway increases drug efflux via the ATPbinding
cassette (ABC) transporter [27], while the blocking of
PI3K/Akt signaling pathways leads to downregulation of P-gp
and MRP1 expression, restoring sensitivity to chemotherapeutic
drugs [28].
According to the ceRNA theory, a circRNA-miRNA regulation
network is present in cases of resistant AML. Moreover,
differentially expressed circRNAs-miRNA interactions were
predicted and the potential molecular mechanisms were
further explored. Among these predicted potential target
miRNAs, hsa-miR-24-2-59 is reported to be upregulated during
hematopoietic cell terminal differentiation, suppressing MYC
expression [29]. Hsa-miR-181b-5p may play a prominent role
in pituitary adenoma as an effective biomarker and therapeutic
target [30]. However, there are some limitations to this study,
such as a small sample size and the in vitro research being
conducted only on HL-60 cells. The next step of this work will
be to verify the expression of LncRNAs and circRNAs in AML
patients and to study the mechanisms of LncRNAs and circRNAs
in the development of resistant AML.
Conclusion
Even though only resistance to adriamycin was assessed in
this study, the results suggest that the expression changes of
circRNA/LncRNA regulate the cell resistance of AML, providing a
new theoretical basis for the further understanding of multidrug
resistance mechanisms and targeted therapies in AML.
Ethics
Ethics Committee Approval: No human studies were involved
in this work.
Informed Consent: This study did not involve animal and
human ethics.
Authorship Contributions
Concept: Q.L.; Data Collection or Processing: M.L., F.M.; Analysis
or Interpretation: F.M.
Conflict of Interest: The authors have no conflicts of interest
to declare.
Financial Disclosure: This work was supported by the Science and
Technology Project of the Science and Technology Department
of Guizhou Province (Qian Ke He Basics [2016]1129), the Science
and Technology Fund Project of the Health and Family Planning
Commission of Guizhou Province (gzwjkj2016-1-025), and the
Chinese Medicine Science and Technology Research Project of
the Guizhou Provincial Administration of Traditional Chinese
Medicine (QZZYY-2017-035).
References
1. Li XX, Zhou JD, Wen XM, Zhang TJ, Wu DH, Deng ZQ, Zhang ZH, Lian XY,
He PF, Yao XY, Lin J, Qian J. Increased MCL-1 expression predicts poor
prognosis and disease recurrence in acute myeloid leukemia. Onco Targets
Ther 2019;12:3295-3304.
2. Shang J, Chen WM, Liu S, Wang ZH, Wei TN, Chen ZZ, Wu WB. CircPAN3
contributes to drug resistance in acute myeloid leukemia through regulation
of autophagy. Leuk Res 2019;85:106198.
3. Lai QY, He YZ, Peng XW, Zhou X, Liang D, Wang L. Histone deacetylase 1
induced by neddylation inhibition contributes to drug resistance in acute
myelogenous leukemia. Cell Commun Signal 2019;17:86.
4. Bertone P, Stolc V, Royce TE, Rozowsky JS, Urban AE, Zhu X, Rinn JL,
Tongprasit W, Samanta M, Weissman S, Gerstein M, Snyder M. Global
identification of human transcribed sequences with genome tiling arrays.
Science 2004;306:2242-2246.
5. Kapranov P, Cheng J, Dike S, Nix DA, Duttagupta R, Willingham AT, Stadler
PF, Hertel J, Hackermüller J, Hofacker IL, Bell I, Cheung E, Drenkow J, Dumais
E, Patel S, Helt G, Ganesh M, Ghosh S, Piccolboni A, Sementchenko V,
Tammana H, Gingeras TR. RNA maps reveal new RNA classes and a possible
function for pervasive transcription. Science 2007;316:1484-1488.
6. Guttman M, Rinn JL. Modular regulatory principles of large noncoding.
Nature 2012;482:339-346.
7. Li Z, Zhao X, Zhou Y, Liu Y, Zhou Q, Ye H, Wang Y, Zeng J, Song Y, Gao W,
Zheng S, Zhuang B, Chen H, Li W, Li H, Li H, Fu Z, Chen R. The long noncoding
RNA HOTTIP promotes progression and gemcitabine resistance by
regulating HOXA13 in pancreatic cancer. J Transl Med 2015;13:84.
8. Li Z, Zhao L, Wang Q. Overexpression of long non-coding RNA HOTTIP
increases chemoresistance of osteosarcoma cell by activating the Wnt/βcatenin
pathway. Am J Transl Res 2016;8:2385-2393.
9. Qu L, Ding J, Chen C, Wu ZJ, Liu B, Gao Y, Chen W, Liu F, Sun W, Li XF, Wang
X, Wang Y, Xu ZY, Gao L, Yang Q, Xu B, Li YM, Fang ZY, Xu ZP, Bao Y, Wu DS,
Miao X, Sun HY, Sun YH, Wang HY, Wang LH. Exosome-transmitted lncARSR
promotes sunitinib resistance in renal cancer by acting as a competing
endogenous RNA. Cancer Cell 2016;29:653-668.
10. Wilusz JE, Sharp PA. Molecular biology. A circuitous route to noncoding
RNA. Science 2013;340:440-441.
11. Jeck WR, Sorrentino JA, Wang K, Slevin MK, Burd CE, Liu J, Marzluff WF,
Sharpless NE. Circular RNAs are abundant, conserved, and associated with
ALU repeats. RNA 2013;19:141-157.
12. Grisendi S, Mecucci C, Falini B, Pandolfi PP. Nucleophosmin and cancer. Nat
Rev Cancer 2006;6:493-505.
13. Salzman J, Chen RE, Olsen MN, Wang PL, Brown PO. Cell-type specific
features of circular RNA expression. PLoS Genet 2013;9:e1003777.
14. Memczak S, Jens M, Elefsinioti A, Torti F, Krueger J, Rybak A, Maier L,
Mackowiak SD, Gregersen LH, Munschauer M, Loewer A, Ziebold U,
Landthaler M, Kocks C, le Noble F, Rajewsky N. Circular RNAs are a large
class of animal RNAs with regulatory potency. Nature 2013;495:333-338.
15. Rybak-Wolf A, Stottmeister C, Glažar P, Jens M, Pino N, Giusti S, Hanan M,
Behm M, Bartok O, Ashwal-Fluss R, Herzog M, Schreyer L, Papavasileiou
P, Ivanov A, Öhman M, Refojo D, Kadener S, Rajewsky N. Circular RNAs
in the mammalian brain are highly abundant, conserved, and dynamically
expressed. Mol Cell 2015;58:870-885.
109
Li M, et al: Expression Profile of Resistant Leukemia Cells
Turk J Hematol 2020;37:104-110
16. Chen J, Wei H, Cheng J, Xie B, Wang B, Yi J, Tian B, Liu Z, Wang F, Zhang
Z. Characteristics of doxorubicin-selected multidrug-resistant human
leukemia HL-60 cells with tolerance to arsenic trioxide and contribution of
leukemia stem cells. Oncol Lett 2018;15:1255-1262.
17. Liu B, Li LJ, Gong X, Zhang W, Zhang H, Zhao L. Co-expression of ATP
binding cassette transporters is associated with poor prognosis in acute
myeloid leukemia. Oncol Lett 2018;15:6671-6677.
18. Rushing AW, Hoang K, Polakowski N, Lemasson I. The human
T-cell leukemia virus type 1 basic leucine zipper factor attenuates repair of
double-stranded DNA breaks via nonhomologous end joining. J
Virol 2018;92:e00672-18.
19. Su M, Chang YT, Hernandez D, Jones RJ, Ghiaur G. Regulation of drug
metabolizing enzymes in the leukaemic bone marrow microenvironment. J
Cell Mol Med 2019;23:4111-4117.
20. Calin GA. The noncoding RNA revolution-three decades and still going
strong. Mol Oncol 2019;13:3.
21. Garzon R, Volinia S, Papaioannou D, Nicolet D, Kohlschmidt J, Yan PS,
Mrózek K, Bucci D, Carroll AJ, Baer MR, Wetzler M, Carter TH, Powell BL,
Kolitz JE, Moore JO, Eisfeld AK, Blachly JS, Blum W, Caligiuri MA, Stone RM,
Marcucci G, Croce CM, Byrd JC, Bloomfield CD. Expression and prognostic
impact of lncRNAs in acute myeloid leukemia. Proc Natl Acad Sci U S A
2014;111:18679-18684.
22. Li J, Sun CK. Long noncoding RNA SNHG5 is up-regulated and serves as a
potential prognostic biomarker in acute myeloid leukemia. Eur Rev Med
Pharmacol Sci 2018;22:3342-3347.
23. Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK,
Kjems J. Natural RNA circles function as efficient microRNA sponges.
Nature 2013;495:384-388.
24. Liu J, Liu T, Wang X, He A. Circles reshaping the RNA world: from waste to
treasure. Mol Cancer 2017;16:58.
25. Sui H, Pan SF, Feng Y, Jin BH, Liu X, Zhou LH, Hou FG, Wang WH, Fu XL, Han
ZF, Ren JL, Shi XL, Zhu HR, Li Q. Zuo Jin Wan reverses P-gp-mediated drugresistance
by inhibiting activation of the PI3K/Akt/NF-kB pathway. BMC
Complement Altern Med 2014;14:279.
26. Zhou Q, Chen Y, Chen X, Zhao W, Zhong Y, Wang R, Jin M, Qiu Y, Kong D.
In vitro antileukemia activity of ZSTK474 on K562 and multidrug resistant
K562/A02 cells. Int J Biol Sci 2016;12:631-638.
27. Zhang X, Dong W, Zhou H, Li H, Wang N, Miao X, Jia L. α-2,8-Sialyltransferase
is involved in the development of multidrug resistance via PI3K/Akt
pathway in human chronic myeloid leukemia. IUBMB Life 2015;67:77-87.
28. Ma H, Cheng L, Hao K, Li Y, Song X, Zhou H, Jia L. Reversal effect of ST6GAL
1 on multidrug resistance in human leukemia by regulating the PI3K/Akt
pathway and the expression of P-gp and MRP1. PLoS One 2014;9:e85113.
29. Lal A, Navarro F, Maher CA, Maliszewski LE, Yan N, O’Day E, Chowdhury
D, Dykxhoorn DM, Tsai P, Hofmann O, Becker KG, Gorospe M, Hide W,
Lieberman J. miR-24 inhibits cell proliferation by targeting E2F2, MYC, and
other cell-cycle genes via binding to “seedless” 3‘UTR microRNA recognition
elements. Mol Cell 2009;35:610-625.
30. Wu S, Gu Y, Huang Y, Wong TC, Ding H, Liu T, Zhang Y, Zhang X. Novel
biomarkers for non-functioning invasive pituitary adenomas were
identified by using analysis of microRNAs expression profile. Biochem
Genet 2017;55:253-267.
110
PERSPECTIVES IN HEMATOLOGY
DOI: 10.4274/tjh.galenos.2019.2019.0248
Turk J Hematol 2020;37:111-115
Endocrine and Metabolic Disorders after Hematopoietic Cell
Transplantation
Hematopoietik Hücre Transplantasyonu sonrası Endokrin ve Metabolik Bozukluklar
Annalisa Paviglianiti
Saint Antoine Hospital, Department of Hematology and Cell Therapy, AP-HP, Paris, France
Abstract
Chemotherapy treatment and autologous and allogeneic cell
transplantations are often complicated by the onset of metabolic
and endocrine disorders. Autoimmune disorders, metabolic diseases,
and hormonal dysfunctions are some of the endocrine complications
observed during or after treatment with immunotherapy (mostly
novel agents) and/or chemotherapy conditioning for transplantation.
Although successful treatment of the underlying hematological
condition often improves the dysfunction, endocrinopathies can
have an impact on prognosis and are associated with poor survival;
therefore, it is important to detect and treat them as early as possible.
An increased incidence of cardiovascular diseases and metabolic
syndrome has been observed after transplantation mostly in longterm
survivors. In addition, chemotherapy and radiation along with
the prolonged use of corticosteroids can contribute to the onset
of thyroid and gonadal dysfunctions. The aim of this article is to
describe metabolic dysfunctions occurring in patients who underwent
allogeneic cell transplantation.
Keywords: Diabetes, Metabolic complications, Hematological disease,
Hematopoietic cell transplantation, Endocrine disorders
Öz
Kemoterapi tedavisi ve otolog ve allojeneik hücre transplantasyonları,
metabolik ve endokrin bozuklukların başlaması ile sıklıkla komplike
olmaktadır. Otoimmün bozukluklar, metabolik hastalıklar, ve
hormonal disfonksiyonlar immünoterapi (çoğunlukla yeni ajanlar)
ve/veya transplantasyon için uygulanan hazırlama rejimi sırasında
veya sonrasında gözlenen bazı endokrin komplikasyonlardır. Altta
yatan hematolojik durumun başarılı tedavisi endokrin disfonksiyonu
sıklıkla iyileştirmekle birlikte, endokrinopatilerin prognoz üzerine
etkisi olabilir ve kısa yaşam süresi ile ilişkilidir; bu nedenle mümkün
olduğu kadar erken saptanmaları ve tedavi edilmeleri önemlidir.
Çoğunlukla uzun dönem sağkalan hastalarda transplantasyon sonrası
kardiyovasküler hastalıklar ve metabolik sendromun insidansında
artma gözlenmektedir. Ek olarak, kortikosteroidlerin uzun süreli
kullanımı ile birlikte kemoterapi ve radyoterapi tiroid ve gonadal
bozuklukların başlamasına katkıda bulunabilir. Bu yazının amacı
allojeneik kök hücre transplantasyonu uygulanan hastalarda metabolik
bozuklukların anlatılmasıdır.
Anahtar Sözcükler: Diyabet, Metabolik bozukluklar, Hematolojik
hastalık, Hematopoietik hücre transplantasyonu, Endokrin bozukluklar
Introduction
Patients with hematological diseases undergoing chemotherapy
and/or hematopoietic cell transplantation (HCT) could
experience endocrine and metabolic complications affecting
their quality of life in a chronic way [1,2,3]. The occurrence
of metabolic complications can be related to different factors
including hematological disease, preexisting risk conditions,
cancer treatments, and HCT conditioning regimen modalities
(total body conditioning and type of chemotherapy).
Cancer treatment often consists of a combination of
corticosteroids with chemo-immunotherapy that can favor the
development of metabolic alterations. Furthermore, the use of
immunosuppressive agents in HCT settings is another iatrogenic
cause (Table 1). Nevertheless, the majority of available data
on the occurrence of endocrine complications refers to
pediatric populations. Reports on the endocrine consequences
of allogeneic transplantation at an adult age are poorer and
disparate.
Progress made in the cure of cancer has allowed for an increase
in the numbers of survivors of hematological diseases. Therefore,
prevention and prompt diagnosis of early and late endocrine
and metabolic complications, which impact a patient’s quality
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Annalisa Paviglianiti, M.D., Saint Antoine Hospital,
Department of Hematology and Cell Therapy, AP-HP, Paris, France
Phone : 0033(0) 1 42494823
E-mail : annalisa.paviglianiti@gmail.com ORCID: orcid.org/0000-0002-4243-9252
Received/Geliş tarihi: July 2, 2019
Accepted/Kabul tarihi: December 24, 2019
111
Paviglianiti A: Metabolic Diseases in Hematology
Turk J Hematol 2020;37:111-115
Table 1. Main risk factors for endocrine disorders after HCT.
Risk factors
Chemotherapy conditioning
Radiation therapy
Chronic GVHD
Female sex
Pituitary irradiation
High-dose and prolonged corticosteroid
treatment for GVHD
Young age at HCT
Pituitary irradiation
Low BMI
Chronic GVHD
Age >25 years at HCT
Alkylating agent use
Age <50 years
Prolonged corticosteroid use
Methotrexate use
Diagnosis of ALL
Prolonged immunosuppression
High-dose and prolonged corticosteroids
use for GVHD
Immunosuppressive therapy
Lipodystrophy due to GVHD
Elevated BMI
of life, are important. Herein, we discuss the main metabolic
and endocrine alterations in patients with hematological
malignancies undergoing HCT.
Diabetes
Endocrine alteration
Hypothyroidism
Adrenal insufficiency
Growth hormone
insufficiency
Spermatogenesis
alterations
Osteoporosis
Insulin resistance
HCT: Hematopoietic cell transplantation, GVHD: graft-versus-host disease, ALL: acute
lymphoblastic leukemia, BMI: body mass index.
Hyperglycemia is a frequent metabolic alteration in patients
with hematological diseases [4]. Glucocorticoids induce
hyperglycemia by increasing insulin resistance through
post-receptor insulin signaling defects [5]. Different factors
can trigger a preexisting condition of insulin resistance or
increase insulin requirements in a previously normoglycemic
patient. The main cause of hyperglycemia in patients with
hematological malignancies is glucocorticoid treatment, which
is frequently part of chemotherapy regimens and is also used
for the treatment of acute graft-versus-host disease (GVHD) in
patients who underwent HCT. Corticosteroids are able to induce
apoptosis of lymphocytes [6] and are an essential part of the
treatment for lymphoma [7], acute lymphoblastic leukemia [8],
and multiple myeloma [9]. Glucocorticoids are also used for the
prevention of acute and delayed chemotherapy-induced nausea
and vomiting in association with other antiemetic agents with
different doses according to grading [10,11,12].
In allogeneic settings, high-dose steroids are used for 1 to 2
weeks and eventually tapered over 8 weeks or more to treat
GVHD [13]. The use of calcineurin inhibitors, such as tacrolimus
and cyclosporine, is also associated with hyperglycemia due to
a direct effect on insulin biosynthesis and release [14], and with
islet cell apoptosis after toxic levels [5]. Another possible cause
of hyperglycemia in these patients is the administration of total
parenteral nutrition (TPN). Several studies have demonstrated
higher hyperglycemia rates in HCT recipients treated with TPN
compared to those who were not [15].
Hyperglycemia is associated with adverse outcomes in patients
undergoing intensive chemotherapy and HCT, such as increased
infections [16], incidence of GVHD [17], and mortality [18,19,20].
A survey of 1089 patients who underwent HCT reported higher
incidence of type 2 diabetes in allogeneic but not in autologous
HCT cases [21]. Moreover, a higher prevalence of metabolic
syndrome was reported in 86 patients who underwent allogeneic
HCT, highlighting the importance of glycemia monitoring in this
setting [22].
Treatment should be differentiated according to preexisting
diabetic status. For patients with type 2 diabetes before
chemotherapy, insulin substitution therapy is recommended.
In a study of patients with hematological malignancies and
type 2 diabetes, an increase of insulin therapy to 1.2 UI/kg a
day was necessary [23]. In patients with no previous history of
diabetes, treatment can be stratified according to mild (<200
mg/dL), moderate (200-300 mg/dL), or severe (>300 mg/dL)
hyperglycemia. Intravenous insulin should be reserved for critical
cases. For patients undergoing allogeneic HCT, glycosylated
hemoglobin (A1c) and lipid assay should be done once a year.
This timing should be shortened to 3 or 6 months for patients
who received corticosteroids or calcineurin inhibitors [24].
Metabolic Syndrome
The International Diabetes Foundation has defined metabolic
syndrome as the presence of at least three of the following
risk factors: abdominal obesity, triglycerides of more than 1.7
mmol/L, HDL cholesterol of less than 1 mmol/L for men and
less than 1.3 mmol/L for women, blood pressure of more than
130/85 mmHg, and blood glucose of more than 5.6 mmol/L
or treatments for the last three findings. A high incidence of
metabolic syndrome has been reported in HCT recipients [24].
One of the causes is the use of corticosteroids. Allogeneic
HCT recipients also have a higher incidence of dyslipidemia
compared to autologous recipients [25]. The lifestyle and family
history in association with treatments (total body irradiation,
112
Turk J Hematol 2020;37:111-115
Paviglianiti A: Metabolic Diseases in Hematology
acute and chronic GVHD, immunosuppressive treatment) have
all been associated with an augmented risk of dyslipidemia and,
consequently, metabolic syndrome [26]. Although there are no
studies showing the incidence of cardiovascular disease after
HCT, a few case reports described the onset of coronary artery
disease and early heart failure at a median of 7.5 years after
HCT in recipients aged 35 years old [27]. In adult long-term
survivors it is recommended to perform screening for glycemia
and dyslipidemia annually and a blood pressure assessment
at every outpatient consultation. Dietary restrictions and
treatment with statins for hypercholesterolemia and fibrate for
hypertryglicemia should also be considered.
Hypoglycemia
Hypoglycemia is a rare event but can occur as a consequence
of paraneoplastic production of insulin-like factors. The
main pathogenic mechanism for hypoglycemia is IGF-2
secretion. Hypoglycemia may also be due to increased glucose
consumption by the tumor [28]. Iatrogenic hypoglycemia has
also been reported in patients treated with rituximab [29],
tyrosine kinase inhibitors [30], and oral purine analogues [31], as
well as in those receiving trimethoprim/sulfamethoxazole [32];
all these drugs are commonly used in the allogeneic HCT setting.
A suggested mechanism for antibiotic-associated hypoglycemia
is the sulfonylurea-like effect [32].
The optimal therapeutic approach to hypoglycemia is to treat the
underlying malignancy. Parenteral dextrose has an immediate
effect, while oral glucose administration leads to glycemia in
15 to 30 minutes. For recurrent or chronic hypoglycemia, longterm
management includes intravenous corticosteroids and
glucagon (0.5 to 1 mg, intramuscularly).
Pituitary Dysfunctions
The prolonged use (more than 3 months) of steroids at a dose
of more than 7.5 mg/day can be associated with inhibition of
the production of the hypothalamic corticotrophin-releasing
hormone, leading to pituitary deficiency in HCT recipients
(secondary adrenal insufficiency). Corticotrophin deficiency
can also be caused by total body irradiation (TBI) [33]. Blood
cortisol levels and ACTH should be tested in all patients with
clinical symptoms and/or those who had long courses of steroids
treatment.
Replacement therapy with hydrocortisone is recommended
until the adrenal axis recovers [34]. Thyrotropin, gonadotropin,
and somatotropin deficiencies may also be associated.
Thyroid Disorders
Hypothyroidism is one of the most common endocrine
dysfunctions occurring after HCT [35]. The incidence varies
according to conditioning regimen, and it is increased in
the case of TBI. In a retrospective study, 248 patients who
underwent HCT (related donors, n=150; unrelated donors, n=70;
autologous, n=28) were compared to 317 siblings. Multivariate
analysis found that chronic GVHD was associated with a higher
risk of hypothyroidism together with other endocrine and
vascular diseases for related and unrelated survivors compared
to siblings [21]. A more recent retrospective study on acute
myeloid leukemia patients reported the presence of positive
thyroperoxidase antibodies and more than one allogeneic
HCT as being the main risk factors for developing clinical
hypothyroidism [36]. In addition, several retrospective studies
reported prolonged immunosuppressive therapy, HLA B35 of
the donor, and female donor to male recipient mismatch as risk
factors for hypothyroidism [37]. Patients should be screened
every 6 months in the first year after HCT and then once a
year for thyroid function (FT4 and TSH). A retrospective study
also reported that HCT recipients have a 3.26-fold higher risk
of thyroid cancer compared to the general population [38]. For
this reason, a thyroid ultrasound exam is recommended every 5
years after HCT after a normal clinical examination or every year
after an abnormal thyroid palpation [38].
Gonadal Dysfunction
Chemotherapy and radiation can cause infertility according to
type and dose [39].
For women, the degree of damage is dependent on the
chemotherapy agent and the patient’s age. Salooja et
al. retrospectively reported pregnancy outcomes after
HCT, indicating that patients who received busulfan and
cyclophosphamide are at higher risk of ovarian failure, while
cases of pregnancy were described for recipients of only
cyclophosphamide [40]. On the other hand, radiation leads to
sterility. Data derived from human oocyte models treated with
radiation have demonstrated that the lethal threshold is 2 Gy
[41].
For males, radiation is the main cause of azoospermia.
Chemotherapy with busulfan induces azoospermia at a
lower rate (approximately 50% of male patients). Rovo et
al. retrospectively reported that the presence of GVHD was
associated with adverse sperm recovery in 224 male patients
who underwent HCT [42].
Osteoporosis
The use of corticosteroids for hematological diseases and
for acute GVHD treatment is one of the main risk factors for
osteoporosis in HCT recipients. Age, lack of physical activity and
sun exposure, and gonadal failure are other causes. Moreover,
high-dose chemotherapy has been associated with a loss in
trabecular and cortical bone [43]. Vitamin D supplementation
113
Paviglianiti A: Metabolic Diseases in Hematology
Turk J Hematol 2020;37:111-115
(100,000 unit dose of oral cholecalciferol every month) is
essential to prevent osteoporosis in HCT recipients.
Conclusion
Survival after chemotherapy and HCT has improved with time;
therefore, it is important to include evaluation of metabolic and
endocrine disorders during follow-up. Moreover, the impact of
haploidentical HCT and novel immunotherapies on long-term
outcomes is still under assessment. Prospective research is
needed to better define individual risk factors for prevention
and strategies for treatment.
Ethics
Informed Consent: Institutional review board approval was
given and the participants provided informed consent.
Financial Disclosure: The author declared that this study
received no financial support.
References
1. Flombaum CD. Metabolic emergencies in the cancer patient. Semin Oncol
2000;27:322-334.
2. Lee JH, Choi SJ, Lee JH, Kim SE, Seol M, Lee YS, Lee JS, Kim WK, Lee KH.
Severe metabolic abnormalities after allogeneic hematopoietic cell
transplantation. Bone Marrow Transplant 2005;35:63-69.
3. Ho AY, Mijovic A, Pagliuca A, Mufti GJ. Idiopathic hyperammonaemia
syndrome following allogeneic peripheral blood progenitor cell
transplantation (allo-PBPCT). Bone Marrow Transplant 1997;20:1007-1008.
4. Healy SJ, Dungan KM. Hyperglycemia in patients with hematologic
malignancies. Curr Diab Rep 2015;15:8.
5. Clore JN, Thurby-Hay L. Glucocorticoid-induced hyperglycemia. Endocr
Pract 2009;15:469-474.
6. Smith LK, Cidlowski JA. Glucocorticoid-induced apoptosis of healthy and
malignant lymphocytes. Prog Brain Res 2010;182:1-30.
7. Armitage JO. Treatment of non-Hodgkin’s lymphoma. N Engl J Med
1993;328:1023-1030.
8. Pui CH, Evans WE. Treatment of acute lymphoblastic leukemia. N Engl J Med
2006;354:166-178.
9. Burwick N, Sharma S. Glucocorticoids in multiple myeloma: past, present,
and future. Ann Hematol 2019;98:19-28.
10. Hesketh PJ. Chemotherapy-induced nausea and vomiting. N Engl J Med
2008;358:2482-2494.
11. American Society of Clinical Oncology; Kris MG, Hesketh PJ, Somerfield MR,
Feyer P, Clark-Snow R, Koeller JM, Morrow GR, Chinnery LW, Chesney MJ,
Gralla RJ, Grunberg SM. American Society of Clinical Oncology guideline
for antiemetics in oncology: update 2006. J Clin Oncol 2006;24:2932-2947.
12. Jordan K, Gralla R, Jahn F, Molassiotis A. International antiemetic guidelines
on chemotherapy induced nausea and vomiting (CINV): content and
implementation in daily routine practice. Eur J Pharmacol 2014;722:197-
202.
13. Griffith ML, Jagasia M, Jagasia SM. Diabetes mellitus after hematopoietic
stem cell transplantation. Endocr Pract 2010;16:699-706.
14. Vincenti F, Friman S, Scheuermann E, Rostaing L, Jenssen T, Campistol JM,
Uchida K, Pescovitz MD, Marchetti P, Tuncer M, Citterio F, Wiecek A, Chadban
S, El-Shahawy M, Budde K, Goto N; DIRECT (Diabetes Incidence after Renal
Transplantation: Neoral C Monitoring Versus Tacrolimus) Investigators.
Results of an international, randomized trial comparing glucose metabolism
disorders and outcome with cyclosporine versus tacrolimus. Am J Transplant
2007;7:1506-1514.
15. Sheean PM, Freels SA, Helton WS, Braunschweig CA. Adverse clinical
consequences of hyperglycemia from total parenteral nutrition exposure
during hematopoietic stem cell transplantation. Biol Blood Marrow
Transplant 2006;12:656-664.
16. Derr RL, Hsiao VC, Saudek CD. Antecedent hyperglycemia is associated
with an increased risk of neutropenic infections during bone marrow
transplantation. Diabetes Care 2008;31:1972-1977.
17. Gebremedhin E, Behrendt CE, Nakamura R, Parker P, Salehian B. Severe
hyperglycemia immediately after allogeneic hematopoietic stemcell
transplantation is predictive of acute graft-versus-host disease.
Inflammation 2013;36:177-185.
18. Hammer MJ, Casper C, Gooley TA, O’Donnell PV, Boeckh M, Hirsch IB. The
contribution of malglycemia to mortality among allogeneic hematopoietic
cell transplant recipients. Biol Blood Marrow Transplant 2009;15:344-351.
19. Garg R, Bhutani H, Alyea E, Pendergrass M. Hyperglycemia and length of
stay in patients hospitalized for bone marrow transplantation. Diabetes
Care 2007;30:993-994.
20. Brunello A, Kapoor R, Extermann M. Hyperglycemia during chemotherapy
for hematologic and solid tumors is correlated with increased toxicity. Am J
Clin Oncol 2011;34:292-296.
21. Baker KS, Ness KK, Steinberger J, Carter A, Francisco L, Burns LJ, Sklar C,
Forman S, Weisdorf D, Gurney JG, Bhatia S. Diabetes, hypertension, and
cardiovascular events in survivors of hematopoietic cell transplantation:
a report from the bone marrow transplantation survivor study. Blood
2007;109:1765-1772.
22. Majhail NS, Flowers ME, Ness KK, Jagasia M, Carpenter PA, Arora M, Arai
S, Johnston L, Martin PJ, Baker KS, Lee SJ, Burns LJ. High prevalence of
metabolic syndrome after allogeneic hematopoietic cell transplantation.
Bone Marrow Transplant 2009;43:49-54.
23. Gosmanov AR, Goorha S, Stelts S, Peng L, Umpierrez GE. Management of
hyperglycemia in diabetic patients with hematologic malignancies during
dexamethasone therapy. Endocr Pract 2013;19:231-235.
24. DeFilipp Z, Duarte RF, Snowden JA, Majhail NS, Greenfield DM, Miranda JL,
Arat M, Baker KS, Burns LJ, Duncan CN, Gilleece M, Hale GA, Hamadani M,
Hamilton BK, Hogan WJ, Hsu JW, Inamoto Y, Kamble RT, Lupo-Stanghellini
MT, Malone AK, McCarthy P, Mohty M, Norkin M, Paplham P, Ramanathan
M, Richart JM, Salooja N, Schouten HC, Schoemans H, Seber A, Steinberg
A, Wirk BM, Wood WA, Battiwalla M, Flowers ME, Savani BN, Shaw BE.
Metabolic syndrome and cardiovascular disease following hematopoietic
cell transplantation: screening and preventive practice recommendations
from CIBMTR and EBMT. Bone Marrow Transplant 2017;52:173-182.
25. Tichelli A, Bucher C, Rovó A, Stussi G, Stern M, Paulussen M, Halter J, Meyer-
Monard S, Heim D, Tsakiris DA, Biedermann B, Passweg JR, Gratwohl A.
Premature cardiovascular disease after allogeneic hematopoietic stem-cell
transplantation. Blood 2007;110:3463-3471.
26. Oudin C, Auquier P, Bertrand Y, Contet A, Kanold J, Sirvent N, Thouvenin S,
Tabone MD, Lutz P, Ducassou S, Plantaz D, Dalle JH, Gandemer V, Beliard S,
Berbis J, Vercasson C, Barlogis V, Baruchel A, Leverger G, Michel G. Metabolic
syndrome in adults who received hematopoietic stem cell transplantation
for acute childhood leukemia: an LEA study. Bone Marrow Transplant
2015;50:1438-1444.
27. Annaloro C, Airaghi L, Saporiti G, Onida F, Cortelezzi A, Deliliers GL.
Metabolic syndrome in patients with hematological diseases. Expert Rev
Hematol 2012;5:439-458.
28. Halsall DJ, Mangi M, Soos M, Fahie-Wilson MN, Wark G, Mainwaring-Burton
R, O’Rahilly S. Hypoglycemia due to an insulin binding antibody in a patient
with an IgA-kappa myeloma. J Clin Endocrinol Metab 2007;92:2013-2016.
29. Hussain BM, Geetha N, Lali V, Pandey M. Rituximab induced hypoglycemia
in non-Hodgkin’s lymphoma. World J Surg Oncol 2006;4:89.
114
Turk J Hematol 2020;37:111-115
Paviglianiti A: Metabolic Diseases in Hematology
30. Agostino NM, Chinchilli VM, Lynch CJ, Koszyk-Szewczyk A, Gingrich R, Sivik
J, Drabick JJ. Effect of the tyrosine kinase inhibitors (sunitinib, sorafenib,
dasatinib, and imatinib) on blood glucose levels in diabetic and nondiabetic
patients in general clinical practice. J Oncol Pharm Pract 2011;17:197-202.
31. Bay A, Oner AF, Cesur Y, Dogan M, Etlik O, Sanli F. Symptomatic hypoglycemia:
an unusual side effect of oral purine analogues for treatment of ALL. Pediatr
Blood Cancer 2006;47:330-331.
32. Nunnari G, Celesia BM, Bellissimo F, Tosto S, La Rocca M, Giarratana F, Benanti
F, Caltabiano E, Russo R, Cacopardo B. Trimethoprim-sulfamethoxazoleassociated
severe hypoglycaemia: a sulfonylurea-like effect. Eur Rev Med
Pharmacol Sci 2010;14:1015-1018.
33. Sathyapalan T, Dixit S. Radiotherapy-induced hypopituitarism: a review.
Expert Rev Anticancer Ther 2012;12:669-683.
34. Savani BN, Griffith ML, Jagasia S, Lee SJ. How I treat late effects in adults
after allogeneic stem cell transplantation. Blood 2011;117:3002-3009.
35. Isshiki Y, Ono K, Shono K, Onoda M, Yokota A. Autoimmune thyroid
dysfunction after allogeneic hematopoietic stem cell transplant. Leuk
Lymphoma 2016;57:1227-1229.
36. Medinger M, Zeiter D, Heim D, Halter J, Gerull S, Tichelli A, Passweg J,
Nigro N. Hypothyroidism following allogeneic hematopoietic stem cell
transplantation for acute myeloid leukemia. Leuk Res 2017;58:43-47.
37. Savani BN, Koklanaris EK, Le Q, Shenoy A, Goodman S, Barrett AJ. Prolonged
chronic graft-versus-host disease is a risk factor for thyroid failure in longterm
survivors after matched sibling donor stem cell transplantation for
hematologic malignancies. Biol Blood Marrow Transplant 2009;15:377-381.
38. Cohen A, Rovelli A, Merlo DF, van Lint MT, Lanino E, Bresters D, Ceppi M,
Bocchini V, Tichelli A, Socié G. Risk for secondary thyroid carcinoma after
hematopoietic stem-cell transplantation: an EBMT Late Effects Working
Party Study. J Clin Oncol 2007;25:2449-2454.
39. Tichelli A, Rovó A. Fertility issues following hematopoietic stem cell
transplantation. Expert Rev Hematol 2013;6:375-388.
40. Salooja N, Szydlo RM, Socie G, Rio B, Chatterjee R, Ljungman P, Van Lint
MT, Powles R, Jackson G, Hinterberger-Fischer M, Kolb HJ, Apperley JF;
Late Effects Working Party of the European Group for Blood and Marrow
Transplantation. Pregnancy outcomes after peripheral blood or bone
marrow transplantation: a retrospective survey. Lancet 2001;358:271-276.
41. Wallace WH, Thomson AB, Kelsey TW. The radiosensitivity of the human
oocyte. Hum Reprod 2003;18:117-121.
42. Rovó A, Aljurf M, Chiodi S, Spinelli S, Salooja N, Sucak G, Hunter A, Kim
TS, Socié G, van Lint MT, Passweg JR, Arat M, Badoglio M, Tichelli A; Late
Effects Working Party of the EBMT. Ongoing graft-versus-host disease
is a risk factor for azoospermia after allogeneic hematopoietic stem cell
transplantation: a survey of the Late Effects Working Party of the European
Group for Blood and Marrow Transplantation. Haematologica 2013;98:339-
345.
43. Banfi A, Podestà M, Fazzuoli L, Sertoli MR, Venturini M, Santini G, Cancedda
R, Quarto R. High-dose chemotherapy shows a dose-dependent toxicity
to bone marrow osteoprogenitors: a mechanism for post-bone marrow
transplantation osteopenia. Cancer 2001;92:2419-2428.
115
BRIEF REPORT
DOI: 10.4274/tjh.galenos.2019.2019.0154
Turk J Hematol 2020;37:116-120
The Impact of Early Versus Late Platelet and Neutrophil Recovery
after Induction Chemotherapy on Survival Outcomes of Patients
with Acute Myeloid Leukemia
Akut Myeloid Lösemili Hastalarda İndüksiyon Kemoterapisi Sonrası Erken ve Geç Trombosit
ve Nötrofil İyileşmesinin Etkileri
Rafiye Çiftçiler¹, İbrahim C. Haznedaroğlu¹, Nilgün Sayınalp 1 , Osman Özcebe 1 , Salih Aksu 1 , Haluk Demiroğlu 1 ,
Hakan Göker 1 , Ümit Yavuz Malkan 2 , Yahya Büyükaşık 1
1Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey
2Dışkapı Training and Research Hospital, Department of Hematology, Ankara, Turkey
Abstract
Objective: The prognosis of patients with acute myeloid leukemia
(AML) is affected by factors that are both patient- and diseasespecific.
The aim of this study is to evaluate the impact of early versus
late platelet and neutrophil recovery after induction chemotherapy
on survival outcomes of AML patients.
Materials and Methods: A total of 181 patients with AML who were
treated in our tertiary center between 2001 and 2018 were evaluated.
Neutrophil and platelet recovery times were accepted as the periods
from the beginning of induction chemotherapy to a neutrophil
count of ≥0.5x10 9 /L and a platelet count of ≥20x10 9 /L 3 days in a
row, respectively. The median time to platelet recovery was 25 days
(range=12-52) for all patients. Therefore, platelet recovery in the
first 25 days was defined as early platelet recovery (EPR) and at ≥26
days it was defined as late platelet recovery (LPR). The median time
to neutrophil recovery was 28 days (range=13-51) for all patients.
Therefore, neutrophil recovery in the first 28 days was defined as early
neutrophil recovery, and at ≥29 days it was defined as late neutrophil
recovery.
Results: The 5-year overall survival (OS) rates for patients who had
EPR and LPR after induction chemotherapy were 62% and 23%,
respectively (p<0.001). The 5-year disease-free survival (DFS) rates for
patients who had EPR and LPR after induction chemotherapy were
57% and 15%, respectively (p<0.001).
Conclusion: Short bone marrow recovery time may indicate better
healthy hematopoiesis and marrow capacity associated with longer
OS and DFS.
Keywords: Acute myeloid leukemia, Platelet recovery, Neutrophil
recovery
Öz
Amaç: Akut myeloid lösemili (AML) hastaların prognozu, hem hastaya
hem de hastalığa özgü faktörlerden etkilenmektedir. Bu çalışmanın
amacı, indüksiyon kemoterapisi sonrası erken ve geç trombosit ve
nötrofil iyileşmesinin akut myeloid lösemi hastalarının sağkalım
sonuçları üzerindeki etkisini değerlendirmektir.
Gereç ve Yöntemler: 2001-2018 yılları arasında üçüncü basamak
sağlık merkezimizde tedavi edilen 181 AML hastası çalışmaya alındı.
Nötrofil ve trombosit iyileşme süreleri, indüksiyon kemoterapisinin
başlangıcından itibaren sırasıyla 3 gün süreyle nötrofil sayısının
0,5×10 9 /L’ye ve trombosit sayısının 20×10 9 /L’ye ulaşması olarak kabul
edildi. Trombosit iyileşmesinin ortalama süresi tüm hastalar için 25
gündü (12-52). Bu nedenle, ilk 25 günde trombosit iyileşmesi erken
trombosit iyileşmesi ve ≥26 gün geç trombosit iyileşmesi olarak
tanımlandı. Nötrofil iyileşmesine kadar geçen ortalama süre tüm
hastalar için 28 gündür (13-51). Bu nedenle, ilk 28 günde nötrofil
iyileşmesi erken nötrofil iyileşmesi ve ≥29 gün geç nötrofil iyileşmesi
olarak tanımlandı.
Bulgular: İndüksiyon kemoterapisi sonrası erken ve geç trombosit
iyileşmesi olan hastalar için 5 yıllık genel sağkalım sırasıyla %62 ve
%23 olarak saptandı (p<0,001). İndüksiyon kemoterapisi sonrası
erken ve geç trombosit iyileşmesi olan hastalar için 5 yıllık hastalıksız
sağkalım sırasıyla %57 ve %15 saptandı (p<0,001).
Sonuç: Sonuç olarak, kısa kemik iliği iyileşme süresi, daha uzun genel
ve hastalıksız sağkalım ile ilişkili daha sağlıklı bir hematopoez/kemik
iliği kapasitesini gösterebilir.
Anahtar Sözcükler: Akut myeloid lösemi, Nötrofil iyileşmesi,
Trombosit iyileşmesi
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Rafiye Çiftçiler, M.D., Hacettepe University Faculty of Medicine,
Department of Hematology, Ankara, Turkey
Phone : +90 505 583 17 98
E-mail : rafiyesarigul@gmail.com ORCID: orcid.org/0000-0001-5687-8531
Received/Geliş tarihi: April 9, 2019
Accepted/Kabul tarihi: September 2, 2019
116
Turk J Hematol 2020;37:116-120
Çiftçiler R, et al: The Impact of Early Versus Late Platelet and Neutrophil Recovery
Introduction
The clinical outcome of patients with acute myeloid leukemia
(AML) varies across a wide spectrum, ranging from survival of
a few days to remission. Therefore, the prediction of outcome
is vital for those patients [1]. Prognosis of patients with AML
is affected by factors that are both patient- and diseasespecific.
The most significant disease-specific prognostic
factors at the time of diagnosis of AML are cytogenetics and
molecular abnormalities [2]. On the other hand, the most
important patient-specific prognostic factor is age at diagnosis
[3]. Estimating resistance to treatment in patients with AML
is extremely important for critical therapeutic decisions and
follow-up of the patient [4]. Very limited data are available
regarding the association between AML prognosis and bone
marrow recovery kinetics following induction chemotherapy
[5,6,7]. The aim of this study was to evaluate the impact of early
versus late platelet and neutrophil recovery after induction
chemotherapy on the survival outcomes of AML patients.
Materials and Methods
Study Design and Data Collection
This study was performed in a retrospective manner. All clinical
data were collected from hospital medical records. As a result of
the application standards of the hospitals of Hacettepe Medical
School, it has been recognized from the patient records that all
of the studied patients had given informed consent at the time of
hospitalization and before the administration of chemotherapy
and other relevant diagnostic/therapeutic standards of care.
Patient and Disease Characteristics
Neutrophil recovery time (NRT) and platelet recovery time (PRT)
were accepted as the periods from the beginning of induction
chemotherapy to a neutrophil count of ≥0.5x10 9 /L 3 days
in a row and a platelet count of ≥20×10 9 /L 3 days in a row
(without transfusion support), respectively. The median time to
platelet recovery was 25 days (range=12-52) for all patients.
Therefore, platelet recovery in the first 25 days was defined as
early platelet recovery (EPR) and at ≥26 days it was defined
as late platelet recovery (LPR). The median time to neutrophil
recovery was 28 days (range=13-51) for all patients. Therefore,
neutrophil recovery in the first 28 days was defined as early
neutrophil recovery (ENR) and at ≥29 days it was defined as late
neutrophil recovery (LNR).
In this study, patient inclusion criteria were as follows: age
>18 years at the time of diagnosis, patients who received
first induction chemotherapy, and achievement of complete
remission after induction chemotherapy. Patients with refractory
AML and patients who were diagnosed with acute promyelocytic
leukemia were not included in this study. All patients included
in the study received idarubicin (12 mg/m 2 IV push on each of
the first 3 days of treatment) and Ara-C (100 mg/m 2 daily as a
continuous infusion for 7 days) as induction chemotherapy [8].
Statistical Analyses
Statistical analyses were performed using SPSS 25 (IBM Corp.,
Armonk, NY, USA). The variables were investigated using
visual (histograms, probability plots) and analytical methods
(Kolmogorov-Smirnov/Shapiro-Wilk tests) to determine
whether they were normally distributed or not. Statistical
comparisons were made using chi-square tests for categorical
data. The Student t-test for two independent samples was used
for comparison of continuous numerical data. Survival analyses
were made using Kaplan-Meier tests. Multivariate analysis of
predictors of survival was performed using the Cox regression
test. Parameters with p≤0.10 in univariate tests were included
in the multivariate analysis, while p<0.05 was considered to
indicate statistical significance.
Results
Patients’ Characteristics
A total of 450 AML patients admitted to our hospital between
2001 and 2018 were screened for this study. Patients with
refractory AML, patients who did not achieve complete
remission after the first induction chemotherapy, and patients
who died during induction chemotherapy were not included
in the study. Patient characteristics are summarized in Table 1.
There were 106 (57.9%) males and 77 (42.1%) females with a
median age of 44 (range=18-69) years at diagnosis. Karyotype
analyses were available for 159 patients: 6 patients (3.7%) were
in the favorable-risk group, 101 (63.5%) patients were in the
intermediate-risk group, and 54 (33.9%) patients were in the
adverse-risk group according to the European LeukemiaNet
classification [9]. The number of patients classified as having
Eastern Cooperative Oncology Group performance status (ECOG
PS) 0, 1, 2, and 3 were 4 (2.2%), 87 (48.1%), 78 (43.1%), and
12 (6.6%), respectively [10]. According to periods, LPR was seen
in fewer patients between 2011 and 2018 than in 2001-2010
(p=0.01). Preexisting myelodysplastic syndrome or secondary
AML was seen more in patients with LPR than in patients with
EPR (p=0.02).
There were no statistically significant differences between
the two groups in terms of median age (p=0.10), sex (p=0.18),
cytogenetic risk group (p=0.77), and ECOG PS (p=0.06). Mortality
(66.3% vs. 30.4%, p<0.001) and relapse rate (47.2% vs. 29.3%
p=0.01) were higher in patients who had LPR than EPR after
induction chemotherapy. Nonrelapse mortality rate (NMR) was
higher in patients who had LPR than EPR (28.1% vs. 9.8%,
p=0.001). Major causes of NRM were infections (20 vs. 8), heart
attack (3 vs. 0), acute renal failure (1 vs. 0), and graft-versushost
disease (1 vs. 0) in LPR and EPR patients, respectively.
117
Çiftçiler R, et al: The Impact of Early Versus Late Platelet and Neutrophil Recovery
Turk J Hematol 2020;37:116-120
Table 1. Baseline characteristics of AML patients.
Parameters Patients who had EPR Patients who had LPR p-value
N (%) 92 (50.8%) 89 (49.2%)
Median age (range), years 41 (19-69) 45 (18-68) 0.10
Male/female (%) 49/43 (53.3%/46.7%) 56/33 (62.9%/37.1%) 0.18
Platelet recovery time, ± SD 19.8±3.4 35.5±7.9 <0.001
ECOG performance status 0.06
0 3 (3.3%) 1 (1.1%)
1 52 (56.5%) 35 (39.3%)
2 32 (34.8%) 46 (51.7%)
3 5 (5.4%) 7 (7.9%)
Cytogenetic risk group 0.77
Favorable 2 (2.2%) 4 (4.5%)
Intermediate 50 (54.3%) 51 (57.3%)
Adverse 28 (30.4%) 24 (27.0%)
Unavailable 12 (13.0%) 10 (11.2%)
According to time period 0.01
2001-2010 27 (39.1%) 42 (60.9%)
2011-2018 65 (58 %) 47 (42%)
Preexisting MDS or secondary AML 0.02
Preexisting MDS 1 (1.1%) 9 (10.1%)
Secondary AML 3 (3.3%) 2 (2.2%)
Patients who had early/late neutrophil recovery 77/15 (83.7%/16.3%) 23/66 (25.8%/74.2%) <0.001
Neutrophil recovery time, ±SD 24.8±7.1 34.0±8.2 <0.001
Allo-HSCT 66 (71.7%) 46 (51.7%) 0.005
Relapse rate (%) 27 (29.3%) 42 (47.2%) 0.01
Mortality rate (%) 28 (30.4%) 59 (66.3%) <0.001
Nonrelapse mortality (%) 9 (9.8%) 25 (28.1%) 0.002
AML: Acute myeloid leukemia, EPR: early platelet recovery; LPR: late platelet recovery, ECOG: eastern Cooperative Oncology Group, MDS: myelodysplastic syndrome, allo-HSCT:
allogeneic hematopoietic stem cell transplantation.
Overall Outcomes
Median follow-up time was 21 months (range=1.5-220) for all
patients. The 3-year overall survival (OS) rates for patients who
had EPR and LPR were 68% and 40%, respectively. The 5-year
OS rates for patients who had EPR and LPR were 62% and 23%,
respectively (p<0.001). The 3-year disease-free survival (DFS)
rates for patients who had EPR and LPR were 64% and 28%,
respectively. The 5-year DFS rates for patients who had EPR and
LPR were 57% and 15%, respectively (p<0.001).
The 3-year OS rates for patients who had ENR and LNR were 63%
and 42%, respectively. The 5-year OS rates for patients who had
ENR and LNR were 53% and 28%, respectively (p<0.001). The
3-year DFS rates for patients who had ENR and LNR were 57%
and 32%, respectively. The 5-year DFS rates for patients who
had ENR and LNR were 46% and 22%, respectively (p<0.001)
(Figure 1).
Figure 1. Overall survival (OS) and disease-free survival (DFS)
of patients (A-B for EPR and LPR groups, C-D for ENR and LNR
groups).
118
Turk J Hematol 2020;37:116-120
Çiftçiler R, et al: The Impact of Early Versus Late Platelet and Neutrophil Recovery
Table 2. Univariate and multivariate analyses of overall survival (OS) and disease-free survival (DFS).
Parameters for OS
Univariate analyses
Hazard ratio
95% confidence
interval
p-value
Multivariate analyses
Hazard ratio
95% confidence
interval
Age 1.025 1.008-1.042 0.004 1.003 0.987-1.020 0.69
Sex (female) 0.730 0.470-1.132 0.159
p-value
Cytogenetic 2.350 1.770-3.120 <0.001 1.691 1.260-2.269 <0.001
ECOG PS 3.271 2.346-4.561 <0.001 2.393 1.633-3.506 <0.001
ENR 2.157 1.408-3.307 <0.001 1.337 0.781-2.289 0.28
EPR 2.744 1.744-4.315 <0.001 1.911 1.090-3.348 0.02
Parameters for DFS
Age 1.022 1.006-1.037 0.006 1.006 0.991-1.021 0.41
Sex (female) 0.678 0.452-1.018 0.06 0.500 0.324-0.772 0.002
Cytogenetic 2.094 1.625-2.698 <0.001 1.680 1.284-2.199 <0.001
ECOG PS 2.816 2.085-3.805 <0.001 2.392 1.656-3.454 <0.001
ENR 2.090 1.413-3.091 <0.001 1.281 0.766-2.141 0.34
EPR 2.650 1.758-3.996 <0.001 1.944 1.144-3.305 0.01
ECOG PS: Eastern Cooperative Oncology Group performance status, ENR: early neutrophil recovery, EPR: early platelet recovery, OS: overall survival, DFS: disease-free survival.
Cox Regression Analyses
In univariate analyses, factors affecting OS were age (p=0.004),
cytogenetics (p<0.001), ECOG PS (p<0.001), ENR (p<0.001),
and EPR (p<0.001) of the patients, as shown in Table 2. Cox
regression analysis revealed the parameters predicting OS as
cytogenetics (p<0.001), ECOG PS (p<0.001), and EPR (p=0.02)
of the patients.
In univariate analyses, factors affecting DFS were age (p=0.006),
sex (p=0.06), cytogenetics (p<0.001), ECOG PS (p<0.001), ENR
(p=0.009), and EPR (p=0.001) of the patients. Cox regression
analysis revealed the parameters predicting DFS as sex (p=0.002),
cytogenetics (p<0.001), ECOG PS (p<0.001), and EPR (p=0.01) of
the patients.
Discussion
After induction chemotherapy, the duration of neutropenia
and thrombocytopenia carries a risk of complications in
AML patients. Some patients die from infections during the
neutropenic period. Intracranial hemorrhage may be seen
because of thrombocytopenia as a serious life-threatening
complication. In this study, EPR was one of the significant
independent parameters in multivariate analysis that included
classical prognostic risk factors for OS and DFS. Since
hematopoietic growth factors were used for neutrophil recovery
in some patients, ENR may not have significantly resulted in
long OS and DFS in multivariate analysis. Bone marrow reserve
may be considered to be better in patients who had EPR and
ENR. Patients with LPR and LNR may be considered more atrisk
and donor screening may be initiated at an early stage for
allogeneic hematopoietic stem cell transplantation (allo-HSCT).
AML prognosis is related to bone marrow recovery, cellular
kinetics [5], and blast clearance after induction chemotherapy
[11,12]. Some studies reported that an early response to induction
chemotherapy was a strong and independent prognostic
factor for survival in patients with de novo and relapsed AML
[13,14,15]. Yamazaki et al. [16] showed that the regeneration
of hematopoiesis after induction chemotherapy, and especially
the recovery of platelets, is an important positive predictor for
DFS in patients with AML. On the other hand, a previous study
evaluated the survival outcomes of patients who underwent
allo-HSCT with incomplete remission (CRi, bone marrow CR
with absolute neutrophil count of <1,000/mm 3 and/or platelet
count of <100,000/mm 3 ) and complete remission (CR, bone
marrow CR with absolute neutrophil count of ≥1,000/mm 3 and
platelet count of ≥100,000/mm 3 ). The study showed equivalent
posttransplant outcomes between patients who were in CR and
in CRi before allo-HSCT. Therefore, allo-HSCT can eliminate the
negative effect of pretransplant blood count levels [17]. The
major cause of NRM was infection; therefore, allo-HSCT might
be considered in the nadir period for AML patients. However,
it will be difficult to find a donor in such a short period and
prepare the patient for allo-HSCT.
Conclusion
Early bone marrow recovery may indicate a better healthy
hematopoiesis and marrow capacity associated with longer OS
and DFS. As PRT and NRT are very easy to detect, they can be
119
Çiftçiler R, et al: The Impact of Early Versus Late Platelet and Neutrophil Recovery
Turk J Hematol 2020;37:116-120
used as prognostic indicators in countries with limited laboratory
facilities. Our results support the impression that an accelerated
platelet and neutrophil recovery following chemotherapy could
be accepted as a promising sign of good prognosis and thus
good future response to therapy in AML. The results of this
study are important for prediction of the prognosis of newly
diagnosed AML patients.
Ethics
Ethics Committee Approval: All ethical considerations
were strictly followed in accordance with the 1964 Helsinki
Declaration. As standard care/action of the hospitals of the
Hacettepe Medical School, it has been recognized from the
patient records that all of the studied patients had given
informed consent at the time of hospitalization and before the
administration of chemotherapy and other relevant diagnostic/
therapeutic standards of care.
Informed Consent: All of the studied patients gave informed
consent at the time of admission to the hospital.
Authorship Contributions
Surgical and Medical Practices: R.Ç.; Concept: Y.B.; Design:
H.D.; Data Collection or Processing: R.Ç., Ü.Y.M.; Analysis or
Interpretation: Y.B., O.Ö., N.S.; Literature Search: İ.C.H., S.A.;
Writing: R.Ç.
Conflict of Interest: The authors of this paper have no conflict
of interests, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Ferrara F, Palmieri S, Leoni F. Clinically useful prognostic factors in acute
myeloid leukemia. Crit Rev Oncol Hematol 2008;66:181-193.
2. Döhner H, Estey E, Grimwade D, Amadori S, Appelbaum FR, Büchner T,
Dombret H, Ebert BL, Fenaux P, Larson RA, Levine RL, Lo-Coco F, Naoe T,
Niederwieser D, Ossenkoppele GJ, Sanz M, Sierra J, Tallman MS, Tien HF,
Wei AH, Löwenberg B, Bloomfield CD. Diagnosis and management of AML
in adults: 2017 ELN recommendations from an international expert panel.
Blood 2017;129:424-447.
3. Liersch R, Müller-Tidow C, Berdel WE, Krug U. Prognostic factors for acute
myeloid leukaemia in adults-biological significance and clinical use. Br J
Haematol 2014;165:17-38.
4. Walter RB, Othus M, Burnett AK, Löwenberg B, Kantarjian HM, Ossenkoppele
GJ, Hills RK, Ravandi F, Pabst T, Evans A, Pierce SR, Vekemans MC, Appelbaum
FR, Estey EH. Resistance prediction in AML: analysis of 4601 patients
from MRC/NCRI, HOVON/SAKK, SWOG and MD Anderson Cancer Center.
Leukemia 2015;29:312-320.
5. Yanada M, Borthakur G, Garcia-Manero G, Ravandi F, Faderl S, Pierce S,
Kantarjian H, Estey E. Blood counts at time of complete remission provide
additional independent prognostic information in acute myeloid leukemia.
Leuk Res 2008;32:1505-1509.
6. Malkan UY, Gunes G, Isik A, Eliacik E, Etgul S, Aslan T, Balaban MS,
Haznedaroglu IC, Demiroglu H, Goker H, Ozcebe OI, Sayınalp N, Aksu S,
Buyukasik Y. Rebound thrombocytosis following induction chemotherapy
is an independent predictor of a good prognosis in acute myeloid leukemia
patients attaining first complete remission. Acta Haematol 2015;134:32-37.
7. Gonen C, Haznedaroglu IC, Aksu S, Koca E, Göker H, Büyükaşik Y, Sayinalp N,
Ozcebe O, Dündar S. Endogenous thrombopoietin levels during the clinical
management of acute myeloid leukaemia. Platelets 2005;16:31-37.
8. Ravandi F, Cortes JE, Jones D, Faderl S, Garcia-Manero G, Konopleva MY,
O’Brien S, Estrov Z, Borthakur G, Thomas D, Pierce SR, Brandt M, Byrd A,
Bekele BN, Pratz K, Luthra R, Levis M, Andreeff M, Kantarjian HM. Phase I/II
study of combination therapy with sorafenib, idarubicin, and cytarabine in
younger patients with acute myeloid leukemia. J Clin Oncol 2010;28:1856-
1862.
9. Döhner H, Estey EH, Amadori S, Appelbaum FR, Büchner T, Burnett
AK, Dombret H, Fenaux P, Grimwade D, Larson RA, Lo-Coco F, Naoe T,
Niederwieser D, Ossenkoppele GJ, Sanz MA, Sierra J, Tallman MS, Löwenberg
B, Bloomfield CD; European LeukemiaNet. Diagnosis and management of
acute myeloid leukemia in adults: recommendations from an international
expert panel, on behalf of the European LeukemiaNet. Blood 2010;115:453-
474.
10. Oken MM, Creech RH, Tormey DC, Horton J, Davis TE, McFadden ET, Carbone
PP. Toxicity and response criteria of the Eastern Cooperative Oncology
Group. Am J Clin Oncol 1982;5:649-656.
11. Elliott MA, Litzow MR, Letendre LL, Wolf RC, Hanson CA, Tefferi A, Tallman
MS. Early peripheral blood blast clearance during induction chemotherapy
for acute myeloid leukemia predicts superior relapse-free survival. Blood
2007;110:4172-4174.
12. Vainstein V, Buckley SA, Shukron O, Estey EH, Abkowitz JL, Wood BL, Walter
RB. Rapid rate of peripheral blood blast clearance accurately predicts
complete remission in acute myeloid leukemia. Leukemia 2014;28:713.
13. Kern W, Haferlach T, Schoch C, Loffler H, Gassmann W, Heinecke A,
Sauerland MC, Berdel W, Buchner T, Hiddemann W. Early blast clearance by
remission induction therapy is a major independent prognostic factor for
both achievement of complete remission and long-term outcome in acute
myeloid leukemia: data from the German AML Cooperative Group (AMLCG)
1992 Trial. Blood 2003;101:64-70.
14. Creutzig U, Zimmermann M, Ritter J, Henze G, Graf N, Löffler H, Schellong
G. Definition of a standard-risk group in children with AML. Br J Haematol
1999;104:630-639.
15. Creutzig U, Zimmermann M, Dworzak MN, Gibson B, Tamminga R,
Abrahamsson J, Ha SY, Hasle H, Maschan A, Bertrand Y, Leverger G, von
Neuhoff C, Razzouk B, Rizzari C, Smisek P, Smith OP, Stark B, Reinhardt
D, Kaspers GL. The prognostic significance of early treatment response in
pediatric relapsed acute myeloid leukemia: results of the international
study Relapsed AML 2001/01. Haematologica 2014;99:1472-1478.
16. Yamazaki E, Kanamori H, Itabashi M, Ogusa E, Numata A, Yamamoto W, Ito
S, Tachibana T, Hagihara M, Matsumoto K, Koharazawa H, Taguchi J, Tomita
N, Fujimaki K, Fujita H, Fujisawa S, Ogawa K, Ishigatsubo Y. Hyper-recovery
of platelets after induction therapy is a predictor of relapse-free survival in
acute myeloid leukemia. Leuk Lymphoma 2017;58:104-109.
17. Ciftciler R, Demiroglu H, Buyukasık Y, Aksu S, Goker H. Impact of blood
count recovery-based complete remission before allogeneic hematopoietic
stem cell transplantation on survival in patients with acute myeloid
leukemia. Clin Lymphoma Myeloma Leuk 2019;19:e205-e212.
120
IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.galenos.2019.2019.0134
Turk J Hematol 2020;37:121-122
A Rare Chromosomal Abnormality in Chronic Lymphocytic
Leukemia: t(13;13)
Kronik Lenfositik Lösemide Nadir Bir Kromozomal Anomali: t(13;13)
Akbar Safaei 1 , Ahmad Monabati 1,3 , Moeinadin Safavi 1,2
1Shiraz University of Medical Sciences Molecular Pathology and Cytogenetic Section, Medical Faculty, Department of Pathology, Shiraz, Iran
2Tehran University of Medical Sciences Medical Faculty, Department of Pathology, Tehran, Iran
3Shiraz University of Medical Sciences, Hematopathology Research Center, Shiraz, Iran
Figure 1. Peripheral blood culture with TPA revealed t(13;13) (q14;q32).
The patient was a 67-year-old man with peripheral blood
lymphocytosis. The patient’s complete blood count revealed
hemoglobin of 12.2 g/dL, white blood cell count of 22,000/µL,
and platelet count of 124,000/µL. The differential count for
white blood cells was as follows: neutrophils, 10%; lymphocytes,
86%; and monocytes, 4%. Absolute lymphocyte count was
18,920/µL. Flow cytometry of peripheral blood revealed 86%
lymphocytes, which were positive for CD19, CD79b, CD20 (dim),
CD5, CD23, and CD45, but they were negative for FMC7 and
CD38. Blood culture with phorbol 12-myristate 13-acetate (TPA)
and subsequent Giemsa banding revealed t(13;13)(q14;q32)
[8]/46,XY[12] (Figure 1).
Structural aberrations of the long arm of chromosome
13,t/del(13q) account for 20% of all chromosomal abnormalities
in chronic lymphocytic leukemia [1]. This rate is even higher when
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Moeinadin Safavi, M.D., Shiraz University of Medical Sciences
Molecular Pathology and Cytogenetic Section, Medical Faculty, Department of Pathology, Shiraz, Iran
E-mail : safavi_moeinadin@yahoo.com ORCID: orcid.org/0000-0002-4042-7506
Received/Geliş tarihi: March 29, 2019
Accepted/Kabul tarihi: June 11, 2019
121
Safaei A, et al: Rare Chromosomal Abnormality
Turk J Hematol 2020;37:121-122
more precise methods like fluorescence in situ hybridization are
used for deletion of band 13q14, reaching 50% of all cases.
Although translocations of chromosome 13 could have different
counterparts, t(13;13) has been reported very rarely. According
to the Mitelman database, only six cases have been registered
so far [2].
Keywords: Chronic lymphocytic leukemia, Cytogenetics,
Chromosome 13
Anahtar Sözcükler: Kronik lenfositik lösemi, Sitogenetik,
Kromozom 13
Informed Consent: Informed consent was obtained from the
individual participant included in the study.
Authorship Contributions
Concept: A.S., A.M.; Design: M.S.; Data Collection or Processing:
M.S.; Interpretation: A.S., A.M., M.S.; Literature Search: M.S.;
Writing: M.S.
Conflict of Interest: The authors declare no conflict of interest.
References
1. Herholz H, Kern W, Schnittger S, Haferlach T, Dicker F, Haferlach C.
Translocations as a mechanism for homozygous deletion of 13q14 and loss
of the ATM gene in a patient with B-cell chronic lymphocytic leukemia.
Cancer Genet Cytogenet 2007;174:57-60.
2. Mitelman Database of Chromosome Aberrations and Gene Fusions in
Cancer. Bethesda, National Cancer Institute. Accessed 29 March 2019.
Available online at https://cgap.nci.nih.gov/Chromosomes/Mitelman.
122
IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.galenos.2019.2019.0398
Turk J Hematol 2020;37:123-124
Garland of Erythroblasts around a Macrophage: Erythroblastic
Island
Makrofajların Etrafndaki Eritroblast Halkası: Eritroblastik Ada
Chandan Kumar, Garima Jain, Anita Chopra
Laboratory Oncology Unit, Dr. B.R.A.I.R.C.H., All India Institute of Medical Sciences, New Delhi, India
Figure 1. Bone marrow aspirate showing erythroid precursors
surrounding a central macrophage: erythroblastic island (Jenner and
Giemsa, 1000 x ).
Erythroblastic islands (EBIs) were first described by Marcel Bessis
in 1958 [1] as functional units of erythropoiesis where a central
macrophage functions as a “nurse” cell [2].
We found a picturesque erythroblastic island with a central
macrophage encircled by a garland of erythroid cells (Figure
1) in the bone marrow aspirate (BMA) of a 43-year-old man
diagnosed with diffuse large B-cell lymphoma (DLBCL) on
lymph node biopsy. BMA was done as a part of the staging
workup, which was cellular and showed normoblastic erythroid
hyperplasia and no evidence of lymphoma infiltration. Many
macrophages surrounded by erythroid precursors (EBIs) were
also seen.
Early descriptions of EBIs did not receive much attention because
of their infrequent occurrence in BMA due to their distortion
during smear preparation [2]. Some recent studies [3,4] have
suggested that EBIs can boost the number of red blood cells
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Anita Chopra, M.D., Laboratory Oncology Unit, Dr. B.R.A.I.R.C.H., All
India Institute of Medical Sciences, New Delhi, India
Phone : 91-11-29575415
E-mail : chopraanita2005@gmail.com ORCID: orcid.org/0000-0002-0238-8702
Received/Geliş tarihi: November 9, 2019
Accepted/Kabul tarihi: December 24, 2019
123
Kumar C, et al: Erythroblastic Island
Turk J Hematol 2020;37:123-124
produced in vivo during stress and can also act as potential targets
in the treatment of inappropriately accelerated erythropoiesis
in disease conditions like β-thalassemia and polycythemia vera.
While progress is being made in understanding the role of the
central macrophage of an EBI in regulating erythropoiesis, many
questions remain unanswered, such as its precise physiology,
clinical relevance, and contribution to the pathology of
erythropoiesis in benign and malignant hematopoietic disorders.
Keywords: Erythroblastic island, Macrophage
Anahtar Sözcükler: Eritroblast adası, Makrofaj
Informed Consent: Bone marrow examination was done as part
of routine work-up of the patient after obtaining his consent.
We did not collect extra samples from the patient.
Authorship Contributions
CK and AC saw the morphology slides. CK and GJ wrote the
manuscript.
Conflict of Interest: None declared.
References
1. Bessis M. Erythroblastic island, functional unity of bone marrow. Rev
Hematol 1958;13:8-11.
2. Chasis JA, Mohandas N. Erythroblastic islands: niches for erythropoiesis.
Blood 2008;112:470-478.
3. Chow A, Huggins M, Ahmed J, Hashimoto D, Lucas D, Kunisaki Y, Pinho
S, Leboeuf M, Noizat C, van Rooijen N, Tanaka M, Zhao ZJ, Bergman A,
Merad M, Frenette PS. CD169+ macrophages provide a niche promoting
erythropoiesis under homeostasis and stress. Nat Med 2013;19:429-436.
4. Ramos P, Casu C, Gardenghi S, Breda L, Crielaard BJ, Guy E, Marongiu MF,
Gupta R, Levine RL, Abdel-Wahab O, Ebert BL, Van Rooijen N, Ghaffari S, Grady
RW, Giardina PJ, Rivella S. Macrophages support pathological erythropoiesis
in polycythemia vera and β-thalassemia. Nat Med 2013;19:437-445.
124
LETTERS TO THE EDITOR
Turk J Hematol 2020;37:125-138
Percentages and Absolute Numbers of CD4+CD8+ Doublepositive
T Lymphocytes in the Peripheral Blood of Normal Italian
Subjects: Relationship with Age and Sex
Normal İtalyan Bireylerin Periferik Kanında CD4+CD8+ Çift-pozitif T Lenfositlerin Oran ve
Sayıları: Yaş ve Cinsiyet İlişkisi
Alessandra Marini 1 , Daniela Avino 2 , Monica De Donno 1 , Francesca Romano 1 , Riccardo Morganti 3
1Laboratory of Clinical Pathology, Versilia Hospital, Lido di Camaiore, Italy
2Unit of Hematological Diagnostics, A. Tortora Hospital, Pagani, Italy
3Section of Statistics, AOUP, Pisa, Italy
To the Editor,
We read with great interest the paper by Gonzalez-Mancera
et al. [1] concerning the percentages of CD4+CD8+ doublepositive
T-lymphocytes (DPTs) in normal subjects. DPTs are a
small subset of T cells normally found in the peripheral blood.
Their functions appear to be controversial, since both cytotoxic
and suppressive roles have been reported [2].
The paper by Gonzalez-Mancera et al. [1] assessed the frequency
of DPTs in a large cohort of normal subjects. This topic is very
interesting, since only a few papers with the aim of establishing
reference values of DPTs have been published. Previous studies
were carried out with Spanish and German subjects [3,4], while
that of Gonzalez-Mancera et al. [1] took Colombian individuals
into consideration.
With regards to Italy, to the best of our knowledge, no data
about the frequency of DPTs have been produced so far. It is
noteworthy that the largest multicenter Italian study, carried
out in 1999, did not evaluate DPTs [5].
Therefore, we revised our electronic files on normal Italian
subjects referring to our laboratories for routine controls. We
evaluated 238 subjects (males=84; females=154) with normal
complete blood counts and hematochemical values. Flow
cytometry was carried out with a FACSCanto II cytometer,
assisted by FACSCanto software. A single platform assay was
performed using the BD Multitest 6-color TBNK reagent and
Trucount tubes. All subjects showed normal percentages and
absolute counts of CD3+, CD4+, CD8+, CD19+, and CD16/CD56+
lymphocytes. The CD4:CD8 ratio was always >1. Percentages
and absolute counts of CD4+CD8+ DPTs were calculated by
automated lymphocyte gating.
Continuous data were described by mean, standard deviation
(SD), median, and interquartile range. Comparisons between
CD4+CD8+ DPTs and age categories or sex were performed
by two-way ANOVA followed by multiple comparisons (LSD
method). Significance was fixed at 0.05. All analyses were
carried out with SPSS 25.
Results are shown in Tables 1 and 2 and are expressed both as
percentages and absolute counts. We found that the comparisons
of DPTs with the factors of “sex” and “sex-age” were not
significant (p=0.533 and p=0.398, respectively). Interestingly,
we found a statistically significant increase of DPTs with age.
This phenomenon was more evident when younger subjects
(especially 20-30 years old) and older subjects (older than 50
years) were compared.
Previous studies showed discordant results, since DPT frequency
was found to increase with age in Spanish individuals [3] but
to decrease with age in German males [4]. These two studies
did not find a relationship between DPT frequency and sex,
in agreement with our results. On the contrary, Gonzalez-
Mancera et al. [1] reported that women showed a significantly
higher DPT percentage than males.
Our method did not allow us to make a distinction between
CD4 high CD8 low and CD4 low CD8 high , as done by Gonzalez-Mancera et
al. [1]. Nevertheless, we think that our study might provide some
novel information about reference values of DPTs and might
encourage further studies, since this subset of lymphocytes
might play a significant role in some human diseases.
Acknowledgment
The authors thank Giovanni Carulli, M.D., Division of Hematology,
University of Pisa, for helpful discussion.
Keywords: CD4+CD8+ double-positive T lymphocytes, Flow
cytometry
Anahtar Sözcükler: CD4+CD8+ çift-pozitif T lenfositler, Akım
sitometri
125
LETTERS TO THE EDITOR
Turk J Hematol 2020;37:125-138
Table 1. Descriptive analysis of double-positive T lymphocytes (DPTs), stratified for sex and age. The comparisons of DPTs with the
factors “sex” and “sex-age” are not significant (p=0.533 and p=0.398, respectively).
20-30 30-40 40-50 50-60 60-70
T lymphocytes Statistics Population M F
years years years years years
CD4+CD8+ DPTs (%)
CD4+CD8+ DPTs/µL
SD: Standard deviation, M: males, F: females, per: percentile.
Mean 0.88 0.84 0.91 0.40 0.62 1.07 0.92 1.17
SD 0.98 0.89 1.03 0.26 0.39 1.01 0.77 1.51
Median 0.60 0.52 0.69 0.36 0.55 0.76 0.60 0.79
25 th per 0.40 0.37 0.40 0.20 0.38 0.50 0.50 0.40
75 th per 1.00 1.00 1.02 0.56 0.80 1.23 1.02 1.30
Mean 18.89 16.60 20.14 9.25 13.35 21.31 22.92 22.77
SD 21.96 19.70 23.07 6.57 10.39 21.72 26.75 27.09
Median 12.00 11.00 14.00 8.00 11.00 14.00 13.00 14.00
25 th per 7.11 6.35 9.00 5.54 6.00 9.00 9.00 8.50
75 th per 20.25 16.18 22.00 12.00 17.00 20.00 23.00 23.50
Table 2. Inferential analysis of DPTs: multiple comparisons related to age categories after two-way ANOVA (age and sex).
CD4+CD8+ DPTs (%) Category p-value CD4+CD8+ DP/µL Category p-value
20-30 years
30-40 years
40-50 years
30-40 years 0.328
30-40 years 0.412
40-50 years 0.001* 40-50 years 0.012*
20-30 years
50-60 years 0.012* 50-60 years 0.004*
60-70 years <0.0001* 60-70 years 0.005*
40-50 years 0.021*
40-50 years 0.076
50-60 years 0.114 30-40 years
50-60 years 0.030*
60-70 years 0.006* 60-70 years 0.037*
50-60 years 0.405
50-60 years 0.696
40-50 years
60-70 years 0.615 60-70 years 0.731
50-60 years 60-70 years 0.181 50-60 years 60-70 years 0.970
*: The p-value is statistically significant.
Informed Consent: Informed consent was not needed, as this
was a retrospective chart review.
Authorship Contributions
Concept and writing: A.M.; Flow cytometry: A.M., D.A., M.D.D.,
F.R.; Statistics: R.M.
Conflict of Interest: The authors declare no conflict of interest.
References
1. Gonzalez-Mancera MS, Bolaños NI, Salamanca M, Orjuela GA, Rodriguez
AN, Gonzalez JM. Percentages of CD4+CD8+ double-positive T lymphocytes
in the peripheral blood of adults from a blood bank in Bogotá, Colombia.
Turk J Hematol 2020;37:36-41.
2. Overgaard NH, Jung JW, Steptoe RJ, Wells JW. CD4+/CD8+ double-positive
T cells: more than just a developmental stage? J Leukoc Biol 2015;97:31-38.
3. García-Dabrio MC, Pujol-Moix N, Martinez-Perez A, Fontcuberta J, Souto
JC, Soria JM, Nomdedéu JF. Influence of age, gender and lifestyle in
lymphocyte subsets: report from the Spanish Gait-2 Study. Acta Haematol
2012;127:244-249.
4. Melzer S, Zachariae S, Bocsi J, Engel C, Löffler M, Tárnok A. Reference
intervals for leukocyte subsets in adults: results from a population-based
study using 10-color flow cytometry. Cytometry B Clin Cytom 2015;88:270-
281.
5. Santagostino A, Garbaccio G, Pistorio A, Bolis V, Camisasca G, Pagliaro
P, Girotto M. An Italian national multicenter study for the definition of
reference ranges for normal values of peripheral blood lymphocyte subsets
in healthy adults. Haematologica 1999;84:499-504.
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Alessandra Marini, M.D., Laboratory of Clinical Pathology,
Versilia Hospital, Lido di Camaiore, Italy
Phone : +39 0584 6055320
E-mail : alessandra.marini@hotmail.it ORCID: orcid.org/0000-0002-2605-7051
Received/Geliş tarihi: December 13, 2019
Accepted/Kabul tarihi: January 17, 2019
DOI: 10.4274/tjh.galenos.2019.2019.0452
126
Turk J Hematol 2020;37:125-138
LETTERS TO THE EDITOR
Double-positive T Lymphocytes Do Not Vary in Different Age
Groups in Colombian Blood Donors
Kolombiyalı Kan Vericilerinde Çift-pozitif T Lenfositler Değişik Yaş Gruplarında Farklılık
Göstermemektedir
Miguel S. Gonzalez-Mancera,
John Mario Gonzalez
Universidad de los Andes, School of Medicine, Grupo de Ciencias Básicas Médicas, Bogotá, Colombia
To the Editor,
We read with interest the letter of Gonzalez-Mancera et al. [1]
regarding the percentages and absolute numbers of doublepositive
T cells (DPTs) in the peripheral blood of a normal
Italian population. In a previous article by our group, the DPT
population was evaluated in one hundred suitable donors from a
Colombian blood bank using flow cytometry. Our main findings
showed a median DPT value of 2.6% and a higher percentage
in women.
In the Italian cohort, they found an increase of DPTs with age
and no difference by sex. In our original study, we did not test
donors over 61 years old to corroborate if age is associated with
the marked increased level of DPTs above this age, as shown in
the Italian population. We reanalyzed our data and did not find
a difference in the percentages of DPTs when comparing age
groups (Figure 1).
In the Spanish and German cohorts, although there was no
significant difference in DPTs according to sex, women showed
a tendency to have more DPTs when compared to men [2,3].
The flow cytometry panel (monoclonal antibodies and
fluorochromes) used in our work detected and discriminated
the DPTs through manual gating as shown in the original
publication [1]. Previous studies showed that the antibody
cocktail and the gating strategy (manual versus automated) are
sources of variability in the results [4]. Also, according to our
original flow cytometry analysis [1], it was possible to determine
the subpopulations of CD4 high CD8 low and CD4 low CD8 high in healthy
donors as described by other authors [5,6].
In order to understand the differences found in these
publications, future studies must include a more diverse
population, larger samples, and increased age range.
Keywords: T lymphocytes, Flow cytometry
Anahtar Sözcükler: T lenfosit, Akım sitometrisi
Informed Consent: Not relevant.
Authorship Contributions
Analysis or Interpretation: M.S.G., J.M.G.; Literature Search:
M.S.G., J.M.G.; Writing: M.S.G., J.M.G.
Conflict of Interest: The authors declare no conflict of interest.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Gonzalez-Mancera MS, Bolaños NI, Salamanca M, Orjuela GA, Rodriguez
AN, Gonzalez JM. Percentages of CD4+CD8+ double-positive T lymphocytes
in the peripheral blood of adults from a blood bank in Bogotá, Colombia.
Turk J Hematol 2019;37:36-41.
2. García-Dabrio MC, Pujol-Moix N, Martinez-Perez A, Fontcuberta J, Souto
JC, Soria JM, Nomdedéu JF. Influence of age, gender and lifestyle in
lymphocyte subsets: report from the Spanish Gait-2 Study. Acta Haematol
2012;127:244-249.
3. Melzer S, Zachariae S, Bocsi J, Engel C, Löffler M, Tárnok A. Reference intervals
for leukocyte subsets in adults: results from a population-based study using
10-color flow cytometry. Cytometry B Clin Cytom 2015;88:270-281.
Figure 1. Median and interquartile rankings of donors according
to age group. Kruskal-Wallis, p=0.83.
4. Maecker HT, Rinfret A, D’Souza P, Darden J, Roig E, Landry C, Hayes P,
Birungi J, Anzala O, Garcia M, Harari A, Frank I, Baydo R, Baker M, Holbrook
127
LETTERS TO THE EDITOR
Turk J Hematol 2020;37:125-138
J, Ottinger J, Lamoreaux L, Epling CL, Sinclair E, Suni MA, Punt K, Calarota
S, El-Bahi S, Alter G, Maila H, Kuta E, Cox J, Gray C, Altfeld M, Nougarede
N, Boyer J, Tussey L, Tobery T, Bredt B, Roederer M, Koup R, Maino VC,
Weinhold K, Pantaleo G, Gilmour J, Horton H, Sekaly RP . Standardization of
cytokine flow cytometry assays. BMC Immunol 2005;6:13.
5. Nascimbeni M, Shin EC, Chiriboga L, Kleiner DE, Rehermann B. Peripheral
CD4+ CD8+ T cells are differentiated effector memory cells with antiviral
functions. Blood 2004;104:478-486.
6. Sullivan YB, Landay AL, Zack JA, Kitchen SG, Al-Harthi L. Upregulation of
CD4 on CD8 + T cells: CD4 dim CD8 bright T cells constitute an activated phenotype
of CD8+ T cells. Immunology 2001;103:270-280.
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Miguel S. Gonzalez-Mancera, M.D., Universidad de los Andes,
School of Medicine, Grupo de Ciencias Básicas Médicas, Bogotá, Colombia
E-mail : ms.gonzalez137@uniandes.edu.com ORCID: orcid.org/0000-0001-7251-5984
Received/Geliş tarihi: January 13, 2020
Accepted/Kabul tarihi: January 17, 2020
DOI: 10.4274/tjh.galenos.2020.2020.0017
A Novel Mutation in a Patient with Wiskott-Aldrich Syndrome
Wiskott-Aldrich Sendrom’lu Bir Hastada Yeni Bir Mutasyon
Yurday Öncül 1 , Arzu Akyay 1 , İbrahim Tekedereli 2
1İnönü University Faculty of Medicine, Division of Pediatric Hematology, Malatya, Turkey
2İnonu University Faculty of Medicine, Division of Medical Genetics, Malatya, Turkey
To the Editor,
We read with great interest the recently published article in
your journal by Kaya et al. [1] regarding a novel mutation in the
Wiskott-Aldrich syndrome (WAS) gene. After that publication,
we also had a patient with another novel mutation in the WAS
gene from Turkey.
A 3-month-old boy was admitted to our hospital with the
complaints of cough, wheezing, and eczema. He also had a
history of pneumonia. On physical examination, diffuse eczema
was observed (Figure 1), along with widespread petechiae and
pulmonary crepitant rales and rhonchi. His family history was
unremarkable. Laboratory analysis revealed anemia (hemoglobin
of 8.9 g/dL), leukocytosis (white blood count of 13,330/mm 3 ),
and thrombocytopenia (platelet count of 63,000/mm 3 ). Mean
platelet volume was 4.8 fL. A peripheral blood smear revealed
thrombocytopenia and micro-thrombocytes. Immunoglobulin
levels were normal. Peripheral lymphocyte subset analysis
revealed reduced CD3 percentage and CD16/CD56 ratio. With
these results, patient was diagnosed with WAS, and molecular
genetic analysis revealed a novel mutation in the WAS gene, a
hemizygous c.11_12insGG p.G4Afs mutation on exon 1 (Figure
2). The patient is 18 months old now. Human intravenous
immunoglobulin therapy was administered monthly, and
thrombocyte replacement was done in case of need [2]. He did
not have a family donor, so he was scheduled for allogeneic
hematopoietic stem cell transplantation from an unrelated
donor.
Figure 1. Physical examination revealed diffuse eczema,
widespread petechiae, and pulmonary crepitant rales and rhonchi.
128
Turk J Hematol 2020;37:125-138
LETTERS TO THE EDITOR
a mutational hotspot. To the best of our knowledge, this is the
first case of this mutation to be presented. We suspect that this
mutation might be important in contributing to the genotypephenotype
relation.
Keywords: Wiskott-Aldrich Syndrome, WAS gene, Novel
mutation
Anahtar Sözcükler: Wiskott-Aldrich sendromu, WAS geni, Yeni
mutation
Figure 2. Hemizygous c.11_12insGG p.G4Afs mutation on exon
1 (A, B).
The clinical presentation of WAS is very heterogeneous. Based
on the severity of symptoms, a 5-point severity score was
developed [2,3]. This score differentiates patients with milder
presentation (scores of up to 2) from the severe classic WAS
phenotype (scores of 3-5). While most patients suffer from
thrombocytopenia and susceptibility to infections, the other
clinical complications of the disease can be variably present
[4]. WAS cases with milder clinical manifestations are usually
referred to as X-linked thrombocytopenia (XLT) [4,5]. XLT
patients must also be carefully monitored, however, because
patients with initially mild phenotypes can transition to severe
phenotypes. Our patient presented a classical severe case of
WAS with severe eczema, immune deficiency with recurrent
infections, and thrombocytopenia.
There are many possible mutations in the WAS gene. However,
missense mutations are seen most often, especially on the first
four exons. The subsequently most frequent mutations are
splice mutations, deletions, insertions, nonsense mutations,
and complex mutations in descending order [3,4]. The missense
mutations on exons 2 and 3 are linked to mild phenotypes [5].
The nonsense mutations, insertions, and deletions are often
associated with severe phenotypes. In our case, a hemizygous
c.11_12insGG p.G4Afs mutation on exon 1 was detected. This
was a frameshift mutation. Frameshift mutations encode
incorrect amino acids and usually cause nonsense codons [6].
Another frameshift mutation at the c:11 position on the WAS
gene with deletion of a guanine nucleotide has been reported as
a disease-causing variant [7]. In our case, an insertion affected
the WAS protein and led to the emergence of the disease.
Therefore, the 11 th position on WAS cDNA could be referred to as
Informed Consent: Written informed consent was received
from the patient’s parents.
Authorship Contributions
Concept: A.A., Y.Ö.; Data Collection or Processing: Y.Ö., A.A.;
Analysis or Interpretation: A.A., Y.Ö., İ.T.; Literature Search: Y.Ö.,
A.A., İ.T.; Writing: Y.Ö., A.A., İ.T.
Conflict of Interest: No author of this paper has a conflict of
interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included in this manuscript.
Disclosure of funding: The authors have no conflicts of interest
or funding to disclose.
References
1. Kaya Z, Muluk C, Haskoloğlu Ş, Lale Ş, Tufan LŞ. A novel mutation in a child
with atypical Wiskott-Aldrich syndrome complicated by cytomegalovirus
infection. Turk J Hematol 2019;36:70-71.
2. Ochs HD, Filipovich AH, Veys P, Cowan MJ, Kapoor N. Wiskott-Aldrich
syndrome: diagnosis, clinical and laboratory manifestations, and treatment.
Biol Blood Marrow Transplant 2009;15(1 Suppl):84-90.
3. Candotti F. Clinical manifestations and pathophysiological mechanisms of
the Wiskott-Aldrich syndrome. J Clin Immunol 2018:38:13-27.
4. Notarangelo LD, Miao CH, Ochs HD. Wiskott-Aldrich syndrome. Curr Opin
Hematol 2008;15:30-36.
5. Zhu Q, Zhang M, Blaese RM, Derry JM, Junker A, Francke U, Chen SH, Ochs HD.
The Wiskott-Aldrich syndrome and X-linked congenital thrombocytopenia
are caused by mutations of the same gene. Blood 1995;86:3797-3804.
6. Pelley JW. Elsevier’s Integrated Biochemistry, 2nd ed. Amsterdam, Elsevier,
2007.
7. Du W, Kumaki S, Uchiyama T, Yachie A, Yeng Looi C, Kawai S, Minegishi
M, Ramesh N, Geha RS, Sasahara Y, Tsuchiya S. A second-site mutation
in the initiation codon of WAS (WASP) results in expansion of
subsets of lymphocytes in a Wiskott-Aldrich syndrome patient. Hum
Mutat 2006;27:370-375.
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Arzu Akyay, M.D., İnönü University Faculty of Medicine,
Division of Pediatric Hematology, Malatya, Turkey
Phone : +90 422 341 06 60/5319
E-mail : arzuakyay@yahoo.com ORCID: orcid.org/0000-0002-4480-7784
Received/Geliş tarihi: August 26, 2019
Accepted/Kabul tarihi: January 28, 2020
DOI: 10.4274/tjh.galenos.2020.2019.0321
129
LETTERS TO THE EDITOR
Turk J Hematol 2020;37:125-138
Budd-Chiari Syndrome: An Unusual Complication of AL Amyloidosis
Primer Amiloidozun Nadir Bir Karaciğer Tutulumu: Budd-Chiari Sendromu
Onur Tarık Tiryaki 1 , İpek Yonal Hindilerden 1 , Gülçin Yegen 2 , Meliha Nalçacı 1
¹İstanbul University İstanbul Medical Faculty, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey
2İstanbul University İstanbul Medical Faculty, Department of Pathology, İstanbul, Turkey
To the Editor,
Budd-Chiari syndrome (BCS) is an uncommon congestive
hepatopathy caused by blockage of hepatic veins in the absence
of cardiac/pericardial disorders as well as hepatic veno-occlusive
disease [1]. In 75% of patients with BCS there is an underlying
condition that predisposes to blood clotting [2]. More than
one etiological factor may play a role in 25% of cases [2].
Coagulation problems mainly involving bleeding abnormalities
are well recognized in AL amyloidosis while thrombosis is
a less common feature [3]. Here, we report a rare case of AL
amyloidosis complicated by BCS.
A 66-year-old man presented with right upper abdominal pain.
On physical examination, there was hepatomegaly measuring
6 cm below the costal margin. His complete blood count
(CBC) was as follows: hemoglobin (Hb), 11 g/dL; white blood
cell count, 15,100/mm 3 ; neutrophils, 8400/mm 3 ; lymphocytes,
4700/mm 3 ; platelets, 677,000/mm 3 . The following biochemical
tests were abnormal: corrected calcium, 10.74 mg/dL (normal
range: 8.5-10.5); albumin, 3.12 g/dL (normal=3.2-5.5); alkaline
phosphatase, 266 IU/L (normal=35-105); gamma-glutamyl
transferase, 388 IU/L (normal=5-85); C-reactive protein, 26
(normal=0-5); erythrocyte sedimentation rate, 85 mm/h
(normal=0-20). JAK2V617F mutation was not detected and
bcr-abl was negative. Upon serum protein electrophoresis, a
monoclonal protein of 0.01 g/dL was present and serum and
urine immunofixation electrophoresis showed monoclonal λ
light chain. Serological tests for hepatitis B, hepatitis C, HIV,
and autoimmune liver disorders were negative. The result of the
24-h urine protein was 150 mg. Abdominal ultrasonography
showed hepatomegaly measuring 189 mm on the longitudinal
axis. Liver biopsy showed diffuse amyloid deposits in the
parenchyma stained by Congo red (Figure 1). Bone marrow
biopsy demonstrated increased plasma cells constituting 20% of
the marrow cellularity and eosinophilic, homogeneous deposits
of amyloid confirmed by Congo red staining. Echocardiography
showed thickened interventricular septum measuring 15 mm.
Histological examination of the duodenum revealed amorphous
pink deposits in the lamina propria staining positive for Congo
red. The patient did not meet the diagnostic criteria for
myeloma and was diagnosed with AL amyloidosis with kidney,
heart, liver, and gastrointestinal tract involvement. CyBorD was
initiated as induction treatment. After 1 course of CyBorD,
his CBC results were completely normal. After the 4 th course,
the patient presented with severe acute right upper quadrant
abdominal pain and severe orthostatic hypotension. Abdominal
CT angiography showed thrombosis of the left and middle
hepatic veins. Intrahepatic venous collaterals and a relative
increase in the caudate and left lobes of the liver were noted
(Figure 2). These findings were compatible with BCS. Screening
Figure 1. Diffuse infiltration of eosinophilic amorphous material
in the liver parenchyma (a, H&E, 400 x ), and deposition positive
for Congo red staining (b, 400 x ).
Figure 2. Abdominal CT angiography demonstrated occlusion of
the left hepatic vein and enlargement in the left lobe of the liver.
130
Turk J Hematol 2020;37:125-138
LETTERS TO THE EDITOR
for hereditary and/or acquired thrombophilic conditions were
negative. Anticoagulation with low-molecular-weight heparin
was initiated.
To our knowledge, this is the first reported case of AL amyloidosis
complicated by BCS in the absence of nephrotic syndrome.
The underlying causes of bleeding in AL amyloidosis are well
established, including acquired factor X deficiency, increased
intravascular coagulation and fibrinolysis, and capillary
infiltration by amyloid and liver involvement, which results in
the reduced synthesis of procoagulant proteins [4,5]. Thrombosis
is a less-recognized association of AL amyloidosis. It was
demonstrated that impairment of the thrombin-antithrombin
pathway, in association with low antithrombin biological activity,
contributed to hypercoagulability in amyloidosis [5]. Cançado
et al. [6] described a BCS patient diagnosed with AL amyloidosis
in the concomitant presence of nephrotic-range proteinuria. The
loss of hemostatic proteins due to nephrotic syndrome certainly
contributed to the imbalance between clotting factors and
inhibitors [6]. Although arterial thrombosis after bortezomib
treatment has been reported rarely, a review of data from phase
3 trials demonstrated lower venous thromboembolism risk
with bortezomib [7,8]. Therefore, we believe that there is no
association between BCS and bortezomib. Our case shows that
AL amyloidosis patients can develop BCS even in the absence of
nephrotic syndrome.
Keywords: Primary amyloidosis, Budd-Chiari syndrome, Plasma
cell diseases
Anahtar Sözcükler: Primer amiloidoz, Budd-Chiari sendromu,
Plazma hücre hastalıkları
Compliance with Ethical Standards: The authors have no
potential conflicts of interests to declare. This research includes
human participants. Informed consent was obtained. All
procedures performed in this study were in accordance with the
ethical standards of the institutional and/or national research
committee and with the 1964 Helsinki Declaration and its later
amendments or comparable ethical standards. This study did not
receive any funding.
Informed Consent: It was received.
Authorship Contributions
Data Collection or Processing: G.Y., M.N.; Writing: O.T.T., İ.Y.H.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Aydinli M, Bayraktar Y. Budd-Chiari syndrome: etiology, pathogenesis and
diagnosis. World J Gastroenterol 2007;13:2693-2696.
2. Denninger MH, Chaït Y, Casadevall N, Hillaire S, Guillin MC, Bezeaud A,
Erlinger S, Briere J, Valla D. Cause of portal or hepatic venous thrombosis
in adults: the role of multiple concurrent factors. Hepatology 2000;31:587-
591.
3. Kyle RA, Gertz MA. Primary systemic amyloidosis: clinical and laboratory
features in 474 cases. Semin Hematol 1995;32:45-59.
4. Kyle RA, Greipp PR. Amyloidosis (AL): clinical and laboratory features in 229
cases. Mayo Clin Proc 1983;58:665-683.
5. Gamba G, Montani N, Anesi E, Palladini G, Lorenzutti F, Perfetti V, Merlini
G. Abnormalities in thrombin-antithrombin pathway in AL amyloidosis.
Amyloid 1999;6:273-277.
6. Cançado GGL, Faria LC, Osório FMF, Vidigal PVT, Couto CA, Ferrari TCA. Budd
Chiari syndrome associated with AL amyloidosis: a coagulation paradox.
Amyloid 2018;25:70-71.
7. Guo HF, Su HL, Mao JJ, Sun C, Wang J, Zhou X. Stroke after treatment with
bortezomib and dexamethasone in a Chinese patient with extramedullary
relapse of multiple myeloma. Int J Clin Pharmacol Ther 2010;48:776-778.
8. Zangari M, Fink L, Zhan F, Tricot G. Low venous thromboembolic risk with
bortezomib in multiple myeloma and potential protective effect with
thalidomide/lenalidomide-based therapy: review of data from phase 3 trials
and studies of novel combination regimens. Clin Lymphoma Myeloma Leuk
2011;11:228-236.
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Onur Tarık Tiryaki, M.D., İstanbul University İstanbul Medical
Faculty, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey
Phone : +90 506 216 86 95
E-mail : tonurtiryaki@gmail.com ORCID: orcid.org/0000-0002-0096-5684
Received/Geliş tarihi: May 12, 2019
Accepted/Kabul tarihi: February 28, 2020
DOI: 10.4274/tjh.galenos.2020.2019.0186
131
LETTERS TO THE EDITOR
Turk J Hematol 2020;37:125-138
Rare Cytogenetic Anomalies in Two Pediatric Patients with Acute
Leukemia
Akut Lösemili İki Pediatrik Hastada Nadir Görülen Sitogenetik Anomaliler
Süreyya Bozkurt 1 , Şule Ünal 2 , Turan Bayhan 3 , Fatma Gümrük 2 , Mualla Çetin 2
1Istinye University Faculty of Medicine, Department of Medical Biology, İstanbul, Turkey
2Hacettepe University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey
3Dr. Abdurrahman Yurtaslan Oncology Hospital, Clinic of Pediatric Oncology and Hematology, Ankara, Turkey
To the Editor,
Structural chromosomal abnormalities are frequently seen
in both pediatric acute lymphoblastic leukemia (ALL) and
acute myeloid leukemia (AML) cases [1,2,3]. Although some
chromosomal abnormalities are common, other abnormalities
are rarely seen [4,5]. In this study two relatively rare cytogenetic
abnormalities are reported.
All procedures were performed in accordance with the Helsinki
Declaration and approved by the local ethics committee
(Approval No: GO 16/267-45).
Case One
CALLA+ pre-B-cell ALL was diagnosed in an 8-year-old-boy. The
complete blood count (CBC) at diagnosis revealed hemoglobin
of 5.5 g/dL, white blood cell (WBC) count of 2.8x10 9 /L, and
platelet count of 301x10 9 /L. He had t(1;4)(q42;q22) in all
twenty metaphases as a sole abnormality (Figure 1). The ALLIC-
BFM-2009 treatment protocol was started. Bone marrow
examination on day 15 revealed remission. The patient was
diagnosed in 2006. The last follow-up visit was in December
2019 and he is still alive.
case [7]. While we found t(1;4)(q42;q22) as a sole abnormality in
all metaphases, the anomaly was found in a complex karyotype
in the previously reported case. The hybrid gene formed as a
consequence of this t(1;4)(q42;q22) and its function are not
known. Our case is the second reported case with this anomaly
and thus contributes to the literature.
In our second case, t(1;11)(p32;q23) was found, which has been
seen in a total of seven pediatric AML cases to date [6]. The ages
of patients in whom this abnormality was previously detected
were between 0 and 12 years, two of them being infants; our
patient was 2.5 months old. When the FAB classification of the
patients was examined for the previously reported cases, M0,
M1, M4, and M5 were found. Hayashi et al. [8] reported this
anomaly for the first time in a 7-year-old patient with AML
M1 and they did not find this anomaly at diagnosis; instead, it
was detected during the remission of the patient. In our case,
t(1;11)(p32;q23) was present at the time of diagnosis of acute
Case Two
A girl of two and half months was diagnosed with the AML
FAB-M5 phenotype. She had no comorbid disease and the
diepoxybutane (DEB) test for Fanconi’s anemia was negative.
CBC results at diagnosis revealed hemoglobin of 10 g/dL,
WBC count of 9.2x10 9 /L, and platelet count of 365x10 9 /L. The
AML-BFM-2004 protocol was initiated. The karyotype of the
patient was 46,XX,t(1;11)(p32;q23)[19]/46,XX [1]. Bone marrow
aspiration of the patient showed that she had entered the
remission.
Herein, we report two rare translocations. t(1;4)(q42;q22) was
found in Case 1 with ALL and this anomaly has been reported in
one case to date according to the database in which we searched
[6]. The previous case was also a pediatric ALL patient, as in our
Figure 1. Case 1 revealed t(1;4)(q42;q22) in all twenty metaphases
as a sole abnormality.
132
Turk J Hematol 2020;37:125-138
LETTERS TO THE EDITOR
leukemia. The result of t(1;11)(p32;q23) is the MLL-EPS15 fusion
gene. The role of this fusion gene in the pathogenesis of AML
is not known, but it has been suggested that the coiled-coil
domains of EPS15 mediate oligomerization and activate MLL
[9,10,11].
The prognostic values of rare cytogenetic anomalies are
unknown. The accumulation of knowledge about rare
cytogenetic anomalies detected in childhood leukemia is
expected to contribute to a better understanding of the
pathogenesis of these diseases.
Key words: Acute myeloid leukemia, Rare cytogenetic anomalies,
Karyotype
Anahtar Sözcükler: Akut myeloid lösemi, Nadir sitogenetik
anomaliler, Karyotip
Informed Consent: Informed consent was received from the
families of all patients.
Authorship Contributions
Concept: Ş.Ü., F.G., M.Ç.; Design: Ş.Ü., F.G., M.Ç.; Data Collection
or Processing: S.B., T.B.; Analysis or Interpretation: Ş.Ü., S.B., T.B.;
Literature Search: S.B.; Writing: S.B.
Conflict of Interest: The authors declare no conflict of interest.
References
1. Seth R, Singh A. Leukemias in children. Indian J Pediatr 2015;82:817-824.
2. Manola KN. Cytogenetics of pediatric acute myeloid leukemia. Eur J
Haematol 2009;83:391-405.
3. Hunger SP, Mullighan CG. Redefining ALL classification: toward detecting
high-risk ALL and implementing precision medicine. Blood 2015;125:3977-
3987.
4. Iacobucci I, Mullighan CG. Genetic basis of acute lymphoblastic leukemia. J
Clin Oncol 2017;35:975-983.
5. Harrison C. New genetics and diagnosis of childhood B-cell precursor acute
lymphoblastic leukemia. Pediatric Rep 2011;3(Suppl 2):2-4.
6. Mitelman F, Johansson B, Mertens F. Mitelman Database of Chromosome
Aberrations and Gene Fusions in Cancer. http://cgap.nci.nih.gov/
Chromosomes/Mitelman, 2017.
7. Behm FG, Raimondi SC, Schell MJ, Look AT, Rivera GK, Pui CH. Lack of
CD45 antigen on blast cells in childhood acute lymphoblastic leukemia is
associated with chromosomal hyperdiploidy and other favorable prognostic
features. Blood 1992;79:1011-1016.
8. Hayashi Y, Raimondi SC, Behm FG, Santana VM, Kalwinsky DK, Pui CH, Mirro
J Jr, William DL. Two karyotypically independent leukemic clones with the
t(8;21) and 11q23 translocation in acute myeloblastic leukemia at relapse.
Blood 1989;73:1650-1655.
9. Rogaia D, Grignani F, Carbone R, Riganelli D, LoCoco F, Nakamura T, Croce
CM, Di Fiore PP, Pelicci PG . The localization of the HRX/ALL1 protein to
specific nuclear subdomains is altered by fusion with its eps15 translocation
partner. Cancer Res 1997;57:799-802.
10. Huret JL. t(1;11)(p32;q23). Atlas Genet Cytogenet Oncol Haematol
2011;15:529-532.
11. Meyer C, Hofmann J, Burmeister T, Gröger D, Park TS, Emerenciano M,
Pombo de Oliveira M, Renneville A, Villarese P, Macintyre E, Cavé H, Clappier
E, Mass-Malo K, Zuna J, Trka J, De Braekeleer E, De Braekeleer M, Oh SH,
Tsaur G, Fechina L, van der Velden VH, van Dongen JJ, Delabesse E, Binato
R, Silva ML, Kustanovich A, Aleinikova O, Harris MH, Lund-Aho T, Juvonen
V, Heidenreich O, Vormoor J, Choi WW, Jarosova M, Kolenova A, Bueno C,
Menendez P, Wehner S, Eckert C, Talmant P, Tondeur S, Lippert E, Launay
E, Henry C, Ballerini P, Lapillone H, Callanan MB, Cayuela JM, Herbaux C,
Cazzaniga G, Kakadiya PM, Bohlander S, Ahlmann M, Choi JR, Gameiro P,
Lee DS, Krauter J, Cornillet-Lefebvre P, Te Kronnie G, Schäfer BW, Kubetzko
S, Alonso CN, zur Stadt U, Sutton R, Venn NC, Izraeli S, Trakhtenbrot L,
Madsen HO, Archer P, Hancock J, Cerveira N, Teixeira MR, Lo Nigro L, Möricke
A, Stanulla M, Schrappe M, Sedék L, Szczepanski T, Zwaan CM, Coenen EA,
van den Heuvel-Eibrink MM, Strehl S, Dworzak M, Panzer-Grümayer R,
Dingermann T, Klingebiel T, Marschalek R. The MLL recombinome of acute
leukemias in 2013. Leukemia 2013;27:2165-2176.
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Süreyya Bozkurt, M.D., İstinye University Faculty of Medicine,
Department of Medical Biology, İstanbul,Turkey
Phone : +90 850 283 60 00
E-mail : sureyyabozkurt8@gmail.com ORCID: orcid.org/0000-0002-1765-9894
Received/Geliş tarihi: November 25, 2019
Accepted/Kabul tarihi: February 10, 2020
DOI: 10.4274/tjh.galenos.2020.2019.0425
133
LETTERS TO THE EDITOR
Turk J Hematol 2020;37:125-138
Importance of DNA Sequencing for Abnormal Hemoglobins
Detected by HPLC Screening
HPLC ile Tanımlanan Anormal Hemoglobinler için DNA Dizilemenin Önemi
Duran Canatan 1,2 , Abdullah Çim 1 , Serpil Delibaş 2 , Emel Altunsoy 1 , Serdar Ceylaner 3
1Antalya Genetic Diseases Diagnosis Center, Antalya, Turkey
2Mediterranean Blood Diseases Foundation - Hemoglobinopathy Diagnosis Center, Antalya, Turkey
3Intergen Genetic Diseases Diagnosis Center, Ankara, Turkey
To the Editor,
Hemoglobinopathies are the most common health problem
in Turkey. A hemoglobinopathy prevention program has been
implemented by the Ministry of Health in Turkey in 33 provinces
since 2003 and it spread to all 81 provinces in 2018 [1]. Our
hemoglobinopathy diagnostic center has been licensed for 16
years [2]. The aim of this study was to compare the molecular
genetic analysis and high-performance liquid chromatography
(HPLC) results for abnormal hemoglobins. Blood samples were
directed from local primary health care centers, hospitals, and
laboratories in the context of premarital screening processes.
Complete blood count (CBC) and HPLC methods were applied
for all blood samples. Abnormal hemoglobins or abnormal bands
were detected in 219 (0.67%) of 32,513 blood samples between
2013 and 2019. DNA sequencing was performed for 190 of 219
samples. Of those 190 samples, 38 were abnormal bands, 76
were HbS, 49 were HbD, 6 were HbC, and 21 were HbE. While
ten different mutations were detected in 24 cases (63.2%), they
were not found for 14 (36.8%) of 38 abnormal bands (Table
1). In addition, molecular analysis confirmed 69 cases of HbS
(90.8%) from among 76 HbS, 42 HbD Punjab (85.7%) in 49 HbD,
4 HbC (66.7%) in 6 HbC, and 4 HbE (19%) in 21 HbE samples
detected by HPLC.
Al-Madhani et al. [3] screened 3740 newborns and compared
the results of CBC and HPLC with the molecular genetic analysis
results for 290 newborns. They confirmed 26 cases of homozygous
sickle cell anemia and 5 of homozygous β-thalassemia major
by DNA sequencing among 31 newborns [3]. Warghade et al.
[4] screened 65,779 cases for hemoglobinopathy using cationexchange
(CE)-HPLC and abnormal hemoglobin fractions were
observed in 12,131 (18.44%) cases. They confirmed eight rare
hemoglobin variants by beta-globin gene analysis for those
samples that could not be distinguished by CE-HPLC [4].
Chen et al. screened couples of reproductive age using HPLC
and reported 1.14% hemoglobinopathy in the Chinese city of
Table 1. Molecular analysis of the cases with abnormal bands
(n=38).
Mutation N %
Unknown 14 36.84
Hb O-Arab (β121 Glu->Lys) 5 13.15
Hb S (β 6 Glu->Ala) 4 10.52
Hb G-Coushatta (β 22 Glu->Ala) 4 10.52
Beta IVS2.1(G->A) 3 7.89
Hb Hamadan (β56 Gly->Arg) 2 5.26
Hb G Norfolk (A2 85 Asp->Asn] 2 5.26
-30(T>A) 1 2.63
-56(G>C 1 2.63
Hb Fontainebleau (A21(B2) Ala>Pro) 1 2.63
Hb Ernz (β 123(H1) Thr-->Asn) 1 2.63
Guangzhou. They reported 8 different abnormal hemoglobins
by molecular techniques [5].
In the present study, the concordance of sequencing analysis
with the HPLC results was 90.8% for HbS, 85.7% for HbD, 66.7%
for HbC, and 19% for HbE. Interestingly, 10 different abnormal
hemoglobin variants have been detected using DNA sequencing
in 24 of 38 (63.2%) samples with abnormal bands. Therefore,
the type of abnormal hemoglobin can be determined more
precisely using molecular analysis.
In conclusion, whatever screening method is used in
hemoglobinopathy diagnosis centers, all reports should include
the following expression: “This is a screening test; molecular
analysis should be carried out for a definite result”. Taking into
account the different results obtained in screening and molecular
analysis, physicians working in these centers should be offered
access to molecular analysis for all abnormal hemoglobins and
abnormal bands.
134
Turk J Hematol 2020;37:125-138
LETTERS TO THE EDITOR
Keywords: Hemoglobinopathy, HPLC, DNA, Sequencing
Anahtar Sözcükler: Hemoglobinopati, HPLC, DNA, Dizileme
Informed Consent: As a result of the explanations, the patients
voluntarily asked for the tests to be conducted.
Authorship Contributions
Concept: D.C.; Design: D.C.; Data Collection or Processing: S.D.,
A.Ç., E.A.; Analysis or Interpretation: D.C., A.Ç., S.C.; Literature
Search: D.C., A.Ç.; Writing: D.C., A.Ç.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Canatan D, Kose MR, Ustundağ M, Haznedaroglu D, Ozbaş S.
Hemoglobinopathy control program in Turkey. Community Genet
2006;9:124-126.
2. Canatan D, Delibas S. Report on ten years’ experience of premarital
hemoglobinopathy screening at a center in Antalya, Southern Turkey.
Hemoglobin 2016;40:273-276.
3. Al-Madhani A, Pathare A, Al Zadjali S, Al Rawahi M, Al-Nabhani I,
Alkindi S. The use of HPLC as a tool for neonatal cord blood screening
of haemoglobinopathy: a validation study. Mediterr J Hematol Infect Dis
2019;11:e2019005.
4. Warghade S, Britto J, Haryan R, Dalvi T, Bendre R, Chheda P, Matkar S,
Salunkhe Y, Chanekar M, Shah N. Prevalence of hemoglobin variants and
hemoglobinopathies using cation-exchange high-performance liquid
chromatography in central reference laboratory of India: a report of 65779
cases. J Lab Physicians 2018;10:73-79.
5. Chen GL, Qu YX, Jiang F, Tang Y, Tang F, Zuo LD. Screening abnormal
hemoglobin diseases for couples of childbearing age in Guangzhou City by
HPLC. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2017;25:1768-1771.
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Duran Canatan, M.D., Antalya Genetic Diseases Diagnosis
Center, Antalya, Turkey
Phone : +90 242 248 88 40
E-mail : durancanatan@gmail.com ORCID: orcid.org/0000-0001-8128-8269
Received/Geliş tarihi: December 28, 2019
Accepted/Kabul tarihi: February 28, 2020
DOI: 10.4274/tjh.galenos.2020.2019.0470
Two Rare Pathogenic HBB Variants in a Patient with
β-Thalassemia Intermedia
Bir Beta Talasemi İntermedya Hastasında İki Nadir Patojenik HBB Varyantı
Veysel Sabri Hançer 1 , Tunç Fışgın 2 , Murat Büyükdoğan 3
1İstinye University Faculty of Medicine, Department of Medical Biology, İstanbul, Turkey
2Altınbaş University Faculty of Medicine, Department of Pediatrics, İstanbul, Turkey
3İstinye University Faculty of Medicine, Department of Medical Genetics, İstanbul, Turkey
To the Editor,
The β-thalassemias are a group of hereditary disorders
with autosomal recessive inheritance characterized by the
presence of defective synthesis of the β-globin chain, an
integral component of the hemoglobin molecule, resulting
in either partial synthesis (β + ) or complete absence (β 0 ) [1].
The disease reaches a high frequency in the Mediterranean
Basin, Africa, the Middle East, the Indian subcontinent,
and Southeast Asia [2]. According to the World Health
Organization, the frequency of abnormal hemoglobin is 7%
globally [3]. β-Thalassemia major is characterized by completely
inhibited synthesis of beta chains [4], and so it must be treated,
generally by transfusion therapy [4]. The β-thalassemia major
phenotype has homozygotes or compound heterozygotes
for β 0 or β + genes. Generally, mutations targeting the coding
regions of the gene and conservative regions on the exon-intron
boundary lead to β 0 -thalassemia, and mutations in regions that
do not encode β + -thalassemia. In contrast to the major type, the
presence of one normal gene in heterozygotes usually leads to
enough normal β-globin chain synthesis so that the affected
individuals are usually asymptomatic with only hypochromic
and microcytic red blood cells. This condition is referred to as
β-thalassemia minor [5]. β-Thalassemia intermedia clinically
differs from the major and minor ones with respect to the
necessity of transfusion. The degree of anemia for β-thalassemia
major is more aggravated than that for β-thalassemia
intermedia. The genotype of β-thalassemia intermedia is mostly
135
LETTERS TO THE EDITOR
Turk J Hematol 2020;37:125-138
These findings may be useful for genetic counseling, premarital/
prenatal diagnosis, and prevention programs.
Keywords: Beta thalassemia, HBB, Variation
Anahtar Sözcükler: Beta talasemi, HBB, Varyasyon
Informed Consent: Written informed consent was obtained
from the patient’s parents.
Authorship Contributions
Design: V.S.H.; Data Collection: V.SH., T.F., M.B.; Writing: V.S.H.
Figure 1. Electropherograms of the patient.
homozygous or compound heterozygous [5]. A 14-year-old
male Iraqi patient with Turkish origins presented with infection,
mild hepatomegaly, and loss of appetite. Laboratory findings
were as follows: white blood cell count, 13.53x10 9 /L; red blood
cell count, 3.84x10 12 /L; platelet count, 367x10 9 /L; hemoglobin,
7.7 g/dL; hematocrit, 26.3%; mean corpuscular hemoglobin,
22.7 pg; and mean corpuscular volume, 68.5 fL. The patient
had no transfusion history. Written informed consent was
obtained. A peripheral blood sample was collected in an EDTAcontaining
tube. Genomic DNA was extracted from the white
blood cells. The HBB gene was amplified as 2 polymerase chain
reaction (PCR) fragments (from the -101 position to the Poly-A
signal) using 40 ng of genomic DNA in reaction volumes of 25
µL. After PCR amplification, sequencing was performed using
the BigDye Terminator v3.1 Cycle Sequencing Kit. The patient
had heterozygous c.251delG (p.Gly84fs, rs193922555, β 0 )
and heterozygous c.316-3 C>A (IVSII-848 C>A, rs33913413,
β + ) pathologic variants, as shown in Figure 1. Sequencing
analysis showed that the father had heterozygous c.251delG
and the mother had heterozygous c.316-3 C>A variants. The
global frequency of c.251delG and c.316-3 C>A is unknown
and 0.00002%, respectively [6]. c.316-3 C>A is observed at a
frequency of 0.4% in Turkey [7] and 2.9% in Iraq [8]. c.251delG is
observed at 0.2% in Turkey [9] and 10.1% in northern Iraq [10].
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Rachmilewitz EA, Giardina PJ. How I treat thalassemia. Blood 2011;118:3479-
3488.
2. Weatherall DJ, Clegg JB. The Thalassaemia Syndromes, 3rd ed.
Oxford, Blackwell Scientific Publications, 1981.
3. World Health Organization. Management of Haemoglobin Disorders: Report
of Joint WHO-TIF Meeting. Geneva, WHO, 2012.
4. Atanasovska B, Bozhinovski G, Chakalova L, Kocheva S, Karanfilski O,
Plaseska-Karanfiska D. Molecular diagnostics of β-thalassemia. Balkan J
Med Genet 2012;15:61-65.
5. Galanello R, Origa R. Beta-thalassemia. Orphanet J Rare Dis 2010; 5:11.
6. NCBI. dbSNP. Available at www.ncbi.nlm.nih.gov/snp.
7. Altay C, Basak AN. Molecular basis and prenatal diagnosis of
hemoglobinopathies in Turkey. Int J Peadiatr Hematol Oncol 1995;2:283-
290.
8. Al-Allawi NA, Al-Mousawi BM, Badi AI, Jalal SD. The spectrum
of β-thalassemia mutations in Baghdad, Central Iraq. Hemoglobin
2013;37:444-453.
9. Çürük MA, Arpacı A, Atilla G, Tuli A, Kılınç Y, Aksoy K, Yüreğir GT. Genetic
heterogeneity of β thalassemia at Çukurova in Southern Turkey. Hemoglobin
2001;25:241-245.
10. Al-Allawi NA, Jalal SD, Mohammad AD, Omer SQ, Markous RS. β-Thalassemia
intermedia in northern Iraq: a single center experience. Biomed Res
Int 2014;2014:262853.
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Veysel Sabri Hançer, M.D., İstinye University Faculty of
Medicine, Department of Medical Biology, İstanbul, Turkey
E-mail : vhancer@istinye.edu.tr ORCID: orcid.org/0000-0003-2994-1077
Received/Geliş tarihi: January 13, 2020
Accepted/Kabul tarihi: February 13, 2020
DOI: 10.4274/tjh.galenos.2020.2020.0020
136
Turk J Hematol 2020;37:125-138
LETTERS TO THE EDITOR
A Case of Myelodysplastic Syndrome in an Adult with Down
Syndrome: A Rare Observation of a Well-known Pediatric Disease
Down Sendromlu Erişkinde Myelodisplastik Sendrom: İyi Bilenen Bir Pediatrik Hastalığın
Nadiren Görülmesi
Harpreet Virk 1 , Shano Naseem 2
1Postgraduate Institute of Medical Education and Research, Senior Resident, Department of Pathology, Chandigarh, India
2Postgraduate Institute of Medical Education and Research, Department of Hematology, Chandigarh, India
To the Editor,
A 56-year-old man with Down syndrome (DS) presented with a
fever for the previous 7 weeks. On evaluation he was found to
have bicytopenia with hemoglobin (Hb) of 87 g/L and platelet
count of 100x10 9 /L. Total leukocyte count was 5.9x10 9 /L. Even
after an adequate trial of hematinics, the anemia persisted. Bone
marrow examination revealed significant dysgranulopoiesis in
43% of neutrophils in the form of hypolobation, hypogranulation,
ring forms, and pseudo-Pelger-Huet anomaly (Figures 1a-1c).
No significant dyserythropoiesis or dysmegakaryopoiesis was
noted. Bone marrow biopsy showed hypercellular marrow
spaces with granulocytic hyperplasia; however, megakaryocytes
and erythroid series were adequately represented. Fluorescence
in situ hybridization (FISH) testing was performed, which
revealed deletion of the 20q12 locus in 140/200 (70%) of nuclei
examined (Figure 1d). It was negative for -7/7q deletion, -5/5q
deletion, and trisomy 8. The patient currently remains under
observation with hematinic supplementation and close followup
of blood counts.
The age of onset for myeloid neoplasms in children with DS
is bimodal, peaking first in the newborn period and again at
3-6 years. However, this increased risk continues even into
adulthood [1]. Pertaining to this increased risk, even minor
but persistent cytopenias give rise to concerns regarding the
possibility of underlying myelodysplastic syndrome (MDS) or
marrow failure, or the potential for the development of myeloid
leukemia. This has become important given the increasing
life expectancy of adults with this disorder [2]. Although
conditions like hypothyroidism, obesity, epilepsy, dementia, and
Alzheimer’s disease are known to become increasingly prevalent
in individuals with DS in later life [3], myeloid leukemias in
general and MDS in particular are relatively less common.
Deletion of the long arm of chromosome 20 (del20q) has been
reported in 3%-7% of patients with MDS. Isolated del20q is
associated with a low risk of progression to AML, with good
prognosis and overall prolonged survival [4]. Although
this abnormality has been well documented in the MDS
subpopulation, its prevalence in MDS associated with DS has
not been described in the literature. McLean et al. studied 9
patients with DS with a median age of 41 years having clinical
suspicion of MDS. In their cohort, multilineage dysplasia was
observed in one case only. No acquired cytogenetic abnormality
was seen in any of the cases [5].
Our patient had bicytopenia to begin with, with improvement
in leukocyte and platelet counts after supportive care. However,
his Hb was persistently low even after an adequate trial of
hematinics. Morphological dysplasia was noted in a single
lineage in the form of dysgranulopoiesis and FISH studies
revealed deletion in 20q, which to our knowledge has never
been reported before in this clinical scenario.
DS can no longer be considered a “pediatric” disease; rather,
it is a condition that can affect an individual’s whole lifespan.
Figure 1. Bone marrow examination revealed significant
dysgranulopoiesis in 43% of neutrophils in the form of
hypolobation, hypogranulation, ring forms, and pseudo-Pelger-
Huet anomaly (a-c), while fluorescence in situ hybridization
testing revealed deletion of the 20q12 locus in 140/200 (70%) of
nuclei examined (d).
137
LETTERS TO THE EDITOR
Turk J Hematol 2020;37:125-138
Comprehensive research has been done on myeloid neoplasms
related to pediatric DS; we now emphasize the importance of
reporting similar findings in adult patients, so as to be able to
better delineate the course and subsequent management of this
under-recognized condition in later life.
Keywords: Adult, Down syndrome, Myelodysplastic syndrome
Anahtar Sözcükler: Yetişkin, Down sendrom, Myelodisplastik
sendrom
Informed Consent: Informed consent was obtained from the
patient included in the study.
Authorship Contributions
Data Collection or Processing: H.V.; Literature Search: H.V., S.N.;
Writing: H.V., S.N.
Conflict of Interest: We confirm that there are no conflicts of
interest to declare.
References
1. Fong CT, Bordeur GM. Down’s syndrome and leukemia: epidemiology,
genetics, cytogenetics and mechanisms of leukemogenesis. Cancer Genet
Cytogenet 1987;28:55-76.
2. Glasson EJ, Sullivan SG, Hussain R, Petterson BA, Montgomery PD, Bittles AH.
The changing survival profile of people with Down’s syndrome: implications
for genetic counselling. Clin Genet 2002;62:390-393.
3. Carfì A, Antocicco M, Brandi V, Cipriani C, Fiore F, Mascia D, Settanni S,
Vetrano DL, Bernabei R, Onder G. Characteristics of adults with Down
syndrome: prevalence of age-related conditions. Front Med (Lausanne)
2014;1:51.
4. De Benedittis D, Fianchi L, Niscola P, Piccioni A, Di Veroli A, Campagna A,
Mancini S, Villiva N, Mohamed S, Carmosino I, Criscuolo M, Fenu S, Aloe
Spiriti MA, Buccisano F, Breccia M, Mancini M, Latagliata R. Myelodysplastic
syndromes with isolated 20q deletion: a new clinical-biological entity?
Blood 2018;132(Suppl 1):5516.
5. McLean S, McHale C, Enright H. Hematological abnormalities in adult
patients with Down’s syndrome. Ir J Med Sci 2009;178:35-38.
©Copyright 2020 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Shano Naseem, M.D., Postgraduate Institute of Medical
Education and Research, Department of Hematology, Chandigarh, India
Phone : 91-172-2755131
E-mail : shanonaseem@yahoo.co.in ORCID: orcid.org/0000-0003-0580-019X
Received/Geliş tarihi: November 8, 2019
Accepted/Kabul tarihi: February 13, 2020
DOI: 10.4274/tjh.galenos.2020.2019.0397
138
Advisory Board of This Issue (June 2020)
Atoosa Gharib, Iran
Aydan Akdeniz, Turkey
Ayşe Çırakoğlu, Turkey
Barbara J. Bain, United Kingdom
Bela Balint, Serbia
Brenda W. Cooper, USA
Can Boğa, Turkey
Davut Albayrak, Turkey
Deniz Karapınar, Turkey
Ebru Koca, Turkey
Elias Kouroumalis, Greece
Evren Özdemir, Turkey
Fatma Burcu Belen Apak, Turkey
Giuseppe Visani, Italy
Hakan Göker, Turkey
Ines Lohse, USA
İrfan Yavaşoğlu, Turkey
Juan Manuel Mejia-Arangure, Mexico
Maryam Abolhasani, Iran
Müge Sayitoğlu, Turkey
Mutlu Arat, Turkey
Muzaffer Keklik, Turkey
Nazan Sarper, Turkey
Nejat Akar, Turkey
Neşe Yaralı, Turkey
Nilgün Sayınalp, Turkey
Peter H. Wiernik, USA
Rajive Kumar, India
Seok-Goo Cho, Korea
Tahir Atik, Turkey
Tülin Tiraje Celkan, Turkey
Vanessa Innao, Italy
Vasilios Berdoukas, China
Veysel Sabri Hançer, Turkey
Vijay Kumar, India
Wellington F. da Silva, Brazil
Zahit Bolaman, Turkey
Zübeyde Nur Özkurt, Turkey
Zühre Kaya, Turkey