Supplemental Figure 1 online. RT-PCR to Confirm ... - The Plant Cell
Supplemental Figure 1 online. RT-PCR to Confirm ... - The Plant Cell Supplemental Figure 1 online. RT-PCR to Confirm ... - The Plant Cell
Supplemental Table 3 online. Mean Ct Values and LSDs of Gene Expression Studies Shown in Figure 4C. Sample GA2ox1 GA2ox2 GA2ox3 GA2ox4 GA2ox6 GA2ox7 GA2ox8 Col 0 h 31.9 ± 0.4 30.6 ± 0.1 35.0 ± 0.6 31.8 ± 0.1 28.8 ± 0.1 32.0 ± 0.2 29.4 ± 0.1 Col 3 h mock 31.6 ± 0.1 30.5 ± 0.0 35.9 ± 0.3 31.9 ± 0.1 28.2 ± 0.0 31.0 ± 0.2 29.4 ± 0.0 Col 3 h GA 29.8 ± 0.0 ** 27.9 ± 0.0 ** 37.5 ± 1.5 29.6 ± 0.1 ** 27.6 ± 0.1 ** 30.6 ± 0.3 28.8 ± 0.1 ** LSD(5%/1%) (df) 0.67/0.93 (12) 0.30/0.43 (12) 2.60/3.64 (12) 0.42/0.59 (12) 0.37/0.52 (12) 0.84/1.18 (12) 0.29/0.41 (12) N 3 3 3 3 3 3 3 See Methods for details on statistical analysis. The measurements are the mean reference-genes-corrected threshold cycle (Ct) values ± SE. **, significantly different from the 0 h and 3 h mock controls (P
Supplemental Table 4 online. Germination Characteristics of Wild- type and ga2ox quintuple Seeds as Shown in Figure 5A. Wild type ga2ox quintuple Dark +cold 0.2 ± 0.2 (-6.32) a 8.8 ± 1.0 (-2.34) ** 0.7 ± 0.2 (-4.91) 22.1 ± 1.0 (-1.26) ** +light pulse 77.2 ± 3.5 (1.24) 70.6 ± 1.8 (0.88) +cold +light pulse 99.6 ± 0.2 (5.61) 99.9 ± 0.1 (6.34) LSD(5%/1%) (df) 1.167/1.608 a (16) (for all comparisons) n 3 3 3 3 See Methods for details on statistical analysis. The measurements are the mean germination% ± SE. **, significantly different from the wild type with the same treatment (P
- Page 1 and 2: A B 100bp ladder Col-0 ga2ox1-1 100
- Page 3 and 4: Relative mRNA level 140 120 100 80
- Page 5: Supplemental Table 2 online. Mean C
- Page 9 and 10: Supplemental Table 6 online. Flower
- Page 11 and 12: Supplemental Table 7 online. Siliqu
- Page 13 and 14: Supplemental Table 9 online. Phenot
- Page 15 and 16: Supplemental Table 10 online. Suppr
- Page 17 and 18: JL-202 CATTTTATAATAACGCTGCGGACA TAC
- Page 19: GA2ox7 qR GAAAGCTATTGACATCCTCTCG GA
<strong>Supplemental</strong> Table 4 <strong>online</strong>. Germination Characteristics of Wild-<br />
type and ga2ox quintuple Seeds as Shown in <strong>Figure</strong> 5A.<br />
Wild type<br />
ga2ox quintuple<br />
Dark +cold<br />
0.2 ± 0.2<br />
(-6.32) a<br />
8.8 ± 1.0<br />
(-2.34) **<br />
0.7 ± 0.2<br />
(-4.91)<br />
22.1 ± 1.0<br />
(-1.26) **<br />
+light<br />
pulse<br />
77.2 ± 3.5<br />
(1.24)<br />
70.6 ± 1.8<br />
(0.88)<br />
+cold<br />
+light<br />
pulse<br />
99.6 ± 0.2<br />
(5.61)<br />
99.9 ± 0.1<br />
(6.34)<br />
LSD(5%/1%) (df) 1.167/1.608 a (16) (for all comparisons)<br />
n 3 3 3 3<br />
See Methods for details on statistical analysis. <strong>The</strong> measurements are<br />
the mean germination% ± SE. **, significantly different from the wild<br />
type with the same treatment (P
Change language