Supplemental Figure 1 online. RT-PCR to Confirm ... - The Plant Cell

More documents

Recommendations

Info

Supplemental Table 8 online. Parthenocarpic Growth of GA2ox Mutants as Shown in Figure 6E. Wild-type Col-0 5.1 ± 0.1 Carpel length (mm) Wild-type Col-0 + GA 11.5 ± 0.1 ** ga2ox quintuple 10.2 ± 0.1 ** ga2ox2 8.0 ± 0.2 ** ga2ox1 ga2ox3 5.1 ± 0.1 ga2ox4 ga2ox6 5.0 ± 0.1 LSD(5%/1%) (df) 0. 48/0.64 (31) Wild-type Ws-0 5.6 ± 0.1 ga2ox2-3 7.3 ± 0.1 ** LSD(5%/1%) (df) 0.43/0.59 (21) See Methods for details on design and statistical analysis. The two sections of the table represent separate experiments. The measurements are the means ± SE. **, significantly different from the wild type (P
Supplemental Table 9 online. Phenotype of the ga2ox Mutants under Low-GA Conditions, Including as Shown in Figure 7B, C and D. Wild type ga2ox quintuple Flowering time (days) PAC (uM): 0 1 5 25 18.7 ± 0.2 (2.93) a 17.4 ± 0.1 (2.86) * 19.0 ± 0.2 (2.94) 17.2 ± 0.1 (2.85) ** 20.1 ± 0.4 (2.99) 17.9 ± 0.2 (2.89) ** 21.0 ± 0.5 (3.04) 17.8 ± 0.2 (2.88) ** LSD(5%/1%) (df) 0.056/0.079 a (10) (for comparisons within a PAC treatment) n 18 18 18 18 Total plant height (cm) PAC (uM): 0 1 5 25 Wild type 52.2 ± 0.7 26.3 ± 0.9 10.2 ± 0.5 6.8 ± 0.5 ga2ox quintuple 57.8 ± 0.7 ** 44.0 ± 0.6 ** 27.5 ± 0.9 ** 14.0 ± 1.1 ** LSD(5%/1%) (df) 2.42/3.52 (8) (for comparisons within a PAC treatment) n 18 18 18 18 No. of flowers / inflorescence internodes PAC (uM): 0 1 5 25 Wild type 55.4 ± 1.5 52.5 ± 1.0 40.9 ± 1.0 36.0 ± 1.0 ga2ox quintuple 63.2 ± 1.5 ** 61.6 ± 1.4 ** 57.3 ± 1.6 ** 45.8 ± 0.8 ** LSD(5%/1%) (df) 4.93/7.18 (8) (for comparisons within a PAC treatment) n 18 18 18 18 Rosette radius (mm) PAC (uM): 0 1 5 25 Wild type 58.5 ± 0.9 51.9 ± 1.0 48.8 ± 0.9 38.3 ± 1.0 ga2ox quintuple 59.0 ± 0.8 56.2 ± 0.6 * 54.9 ± 0.6 ** 46.9 ± 0.9 ** LSD(5%/1%) (df) 3.44/4.89 (10) (for comparisons within a PAC treatment) n 18 18 18 18
Page 1 and 2: A B 100bp ladder Col-0 ga2ox1-1 100
Page 3 and 4: Relative mRNA level 140 120 100 80
Page 5 and 6: Supplemental Table 2 online. Mean C
Page 7 and 8: Supplemental Table 4 online. Germin
Page 9 and 10: Supplemental Table 6 online. Flower
Page 11: Supplemental Table 7 online. Siliqu
Page 15 and 16: Supplemental Table 10 online. Suppr
Page 17 and 18: JL-202 CATTTTATAATAACGCTGCGGACA TAC
Page 19: GA2ox7 qR GAAAGCTATTGACATCCTCTCG GA

Supplemental Figure 1 online. RT-PCR to Confirm ... - The Plant Cell

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?