ЗБОРНИКРАДОВА PROCEEDINGS

Међународни симпозијум 

о актуелним трендовима у заштити биља 

25 - 28. септембар 2012 

Београд, Србија 

ЗБОРНИКРАДОВА 

"International Symposium 

on Current Trends in Plant Protection'' 

th 

25 – 28 September, 2012 

Belgrade, Serbia 

PROCEEDINGS 

Институт за заштиту биља и животну средину из Београда 

Institute for Plant Protection and Environment, Belgrade

Међународни симпозијум о актуелним трендовима у заштити биља 

i 

Институт за заштиту биља и животну средину, 


Међународни симпозијум 

о актуелним трендовима у заштити биља 

Зборник радова 

Београд, 25-28. септембар 2012

ii 




Органзатор Симпозијума: 

Институт за заштиту биља и животну средину, Београд, Србија 

Издавач: 


За издавача: 

Др Ненад Доловац, Директор Института 

Главни уредник: 

др Драгана Марисављевић, 


Уредници поглавља: 

др Жарко Ивановић, 


др Милана Митровић, 


др Виолета Оро, 


Рецензенти: 

Проф др Јанош Варга, Универзитет Сегедин, Мађарска 

Проф др Јелена Латиновић, Биотехнички факултет, Подгорица, Црна Гора 

Проф др Татјана Перовић, Биотехнички факултет, Подгорица, Црна Гора 

Проф др Дарко Вончина, Загребачки Универзитет, Пољопривредни факултет, 

Хрватаска 

Проф др Недељко Латиновић, Биотехнички факултет, Подгорица, Црна Гора 

Проф др Сеад Шабанаџовић, Департман за биохемију, молекуларну биологију, 

ентомологију и биљну патологију, Државни универзитет Мисисипи, Сједињене 

Америчке Државе 

Проф др Биљана Кукавица, Универзитет у Бања Луци, Природно – математички 

факултет, Босна и Херцеговина 

Проф др Светослав Бобев, Пољопривредни универзитет, Пловдив, Бугарска 

Проф др Војислав Тркуља, Универзитет у Бања Луци, Пољопривредни факултет, 

Босна и Херцеговина 

Проф др Стефаниа Полластро, Универзитет у Барију, Италија 

Проф др Оливер Т. Нехер, Универзитет Ајдахо, Сједињене Америчке Државе 

Др Луис Теиxеира да Коста, Медитерански пољопривредни институт, Универзитет Евора, 

Португал 

Др Рикардо Холгадо, Норвешки институт за пољопривреду и заштиту животне 

средине, Биофорск, Норвешка 

Др Солвеиг Хаукеланд, Норвешки институт за пољопривреду и заштиту животне 

средине, Биофорск, Норвешка 

Звонко Пацаноски, Пољопривредни факултет, Скопље, Македонија 

Проф др Ахмет Улудаг, Игдир Универзитет, Департман за заштиту биља, Игдир, Турска 

Проф др Елена Котула Сика, Универзитет Тракије, Грчка


iii 

Проф др Петрос Лолас, Универзитет Тесалије, Грчка 

Проф др Ђузепе Брунду, Департман за природно математичке науке и животну 

средину, (ДИПНЕТ), Универзитет Сасари, Италија 

Проф др Алберт Фишер, Универзитет Калифорнија, Дејвис, Сједињене Америчке 

Државе 

Проф др Озхан Боз, Пољопривредни факултет, Аднан Мендерес Универзитет Турска 

Проф др Едита Штефанић, Ј.Ј. Штросмајер Универзитет, Осјек, Хрватска 

Проф др Штефан Тир, Универзитет Нитра, Словачка 

Проф Васкрсија Јањић, Универзизет у Бања Луци, Босна и Херцеговина 

Проф др Јосеф Холец, Чешки универзитет природних наука Праг, Чешка 

Проф др Мирза Даутбашић, Шумарски факултет, Сарајевски универзитет, Босна и 

Херцеговина 

Др Стив А. Кворие, гостујући професор, Београдски Универзитет, Србија 

Проф др Пал Божа, Универзитет Нови Сад, Природно – математички факултет, Нови 

Сад, Србија 

Проф др Ружица Игић, Универзитет Нови Сад, Природно – математички факултет, 

Нови Сад, Србија 

Проф др Горан Аначков, Универзитет Нови Сад, Природно – математички факултет, 


Др Милана Митровић, Институт за заштиту биља и животну средину, Београд, Србија 

Др Татјана Цврковић, Институт за заштиту биља и животну средину, Београд, Србија 

Др Слободан Крњајић, Институт за заштиту биља и животну средину, Београд, Србија 

Проф др Жељко Томановић, Универзитет у Београду Биолошки факултет, Београд, 

Србија 

Др Вељко Гавриловић, Институт за заштиту биља и животну средину, Београд, Србија 

Др Мира Старовић, Институт за заштиту биља и животну средину, Београд, Србија 

Др Слободан Кузмановић, Институт за заштиту биља и животну средину, Београд 

Србија 

Др Саша Стојановић, Институт за заштиту биља и животну средину, Београд, Србија 

Др Светлана Живковић, Институт за заштиту биља и животну средину, Београд, Србија 

Др Татјана Поповић, Институт за заштиту биља и животну средину, Београд, Србија 

Др Ненад Доловац, Институт за заштиту биља и животну средину, Београд, Србија 

Др Зарко Ивановић, Институт за заштиту биља и животну средину, Београд, Србија 

Др Горан Алексић, Институт за заштиту биља и животну средину, Београд, Србија 

Др Виолета Оро, Институт за заштиту биља и животну средину, Београд, Србија 

Др Љиљана Радивојевић, Институт за пестициде и заштиту животне средине, Београд, 

Србија 

Др Дејан Марчић, Институт за пестициде и заштиту животне средине, Београд, Србија 

Др Бојан Дудук, Институт за пестициде и заштиту животне средине, Београд, Србија 

Др Горан Андрић, Институт за пестициде и заштиту животне средине, Београд, Србија 

Проф др Бранко Константиновић, Универзитет Нови Сад, Пољопривредни факултет, 


Проф др Маја Меселџија, Универзитет Нови Сад, Пољопривредни факултет, Нови Сад, 

Србија 

Проф др Сава Врбничанин, Универзитет у Београду, Пољопривредни факултет, 

Београд , Србија 

Др Милена Симић, Институт за кукуруз Земун Поље, Београд, Србија 

Проф др Александра Булајић, Универзитет у Београду, Пољопривредни факултет, 


Др Драгана Марисављевић, Институт за заштиту биља и животну средину, Београд 

Србија 

Др Данијела Павловић, Институт за заштиту биља и животну средину, Београд, Србија

iv 


Др Весна Крњаја, Институт за сточарство, Београд, Србија 

Ласло Барши, Универзитет Нови Сад, Природно – математички факултет, Нови Сад, 

Србија 

Техничко уређење и графичка припрема: 

Гордан Радомировић, дипл инж, sigra.star@gmail.com 

Штампа: 

Штампарско предузеће ''Макарије'' доо Београд, www.makarije.rs 

Тираж: 300 

ИСБН: 978-86-910951-1-6 

Решењем бр . 451-03-3906 /2011-14, од 21 Јун 2011, Министарство Просвете и Науке 

помогло је штампање овог Зборника радова 

ОРГАНИЗАЦИОНИ ОДБОР 

1. Председник Др Ненад Доловац, Институт за заштиту биља и животну средину, 


2. Секретар (Секретар Симпозијума) Др Драгана Марисављевић,Одсек за 

хербологију Института за заштиту биља и животну средину, Београд, Србија 

3. дипл биолог Милица Рат, Департман за биологију и екологију, Природно - 

математички факултет Нови Сад, Србија 

4. Проф Др Ференц Баги, доцент, Департман за заштиту биља и животну 

средину, Пољопривредни факултет Нови Сад, Србија 

5. Др Љиљана Радивојевић, Лабораторија за хербологију, Институт за 

пестициде и заштиту животне средине, Београд, Србија 

6. Др Емил Рекановић,Лабораторија за примењену ентомологију, Институт за 

пестициде и заштиту животне средине, Београд, Србија 

7. Др Милана Митровић, Одсек за штеточине биља, Институт за заштиту биља и 

животну средину, Београд, Србија 

8. Др Данијела Павловић, Одсек за хербологију, Институт за заштиту биља и 


9. Др Жарко Ивановић, Одсек за болести биља, Институт за заштиту биља и 


10. Др Слободан Кузмановић, Одсек за болести биља, Институт за заштиту биља и 


11. Др Виолета Оро, Одсек за болести биља, Институт за заштиту биља и животну 

средину, Београд, Србија 

12. Мр Петар Митровић, Завод за уљане културе, Институт за ратарство и 

повртарство Нови Сад, Србија 

13. Мр Александра Коњевић, асистент, Департман за заштиту биља и животну 


14. Ненад Тркуља, дипл инг - мастер, Одсек за болести биља, Институт за 

заштиту биља и животну средину, Београд, Србија 

15. Мр Бојан Константиновић, Департман за заштиту биља и животну средину, 

Пољопривредни факултет Нови Сад, Србија 

16. Наташа Самарџић, дипл инг – мастер, Департман за заштиту биља и животну 

средину, Пољопривредни факултет Нови Сад, Србија


v 

НАУЧНИ ОДБОР 

1. Председник: Проф. Др Бранко Константиновић, Пољопривреднi факултет 


2. Ahmet Uludag, Igdir University, Plant Protection Department, Igdir, Turkey 

3. Giusepe Brundu, Department of Science for Nature and Environmental Resources 

(DIPNET), University of Sassari, Sassari, Italy 

4. Ricardo Holgado, Ph.D, Norwegian Institute for Agricultural & Environmental 

Research-Bioforsk, Norwеy 

5. Jеlena Latinović Ph .D, Proffesor, Biotechnical faculty, Podgorica, Montenegro 

6. Darko Vončina Ph .D, Proffesor, University of Zagreb, Faculty of Agriculture, Croatia 

7. Carl Reinhardt, Department of Plant Production and Soil Science, University of 

Pretoria, South Africa 

8. Janos Varga, PhD Proffesor, University of Szeged, Hungary 

9. Luís Teixeira da Costa, Ph. D, Instituto de Ciências Agrárias e Ambientais 

Mediterrânicas, Universidade de Évora, Portugal 

10. проф др Васкрсија Јањић, Пољопривредни факултет Бања Лука, Босна и 

Херцеговина 

11. Др Сања Лазић, редовни професор, Департман за заштиту биља и животну 


12. Проф. др Пал Божа, Универзитет у Новом Саду, Природно-математички 

факултет, Департман за биологију и екологију, Нови Сад, Србија 

13. Др Стеван Маширевић, редовни професор, Департман за заштиту биља и 

животну средину, Пољопривредни факултет Нови Сад, Србија 

14. Проф. др Ружица Игић, Универзитет у Новом Саду, Природно-математички 


15. Проф. др Иво Караман, Универзитет у Новом Саду, Природно-математички 


16. Др Горан Аначков, Универзитет у Новом Саду, Природно-математички 


17. Др Маја Меселџија, Пољопрпивредни факултет Нови Сад, Департман за 

фитомедицину и заштиту животне средине, Нови Сад, Србија 

18. Др Aна Маријановић Јеромела, Институт за ратарство и повртарство, Нови 

Сад, Србија 

19. Др Радован Маринковић, Институт за ратарство и повртарство, Нови Сад, 

Србија 

20. проф Др Бранка Крстић, редовни професор Пољопривредни факултет у 

Београду, Србија 

21. проф Др Александра Булајић, ванредни професор Пољопривредни факултет у 

Београду, Србија 

22. др Горан Алексић, Одсек за болести биља Института за заштиту биља и 


23. Др Татјана Цврковић, Одсек за штеточине биља Института за заштитту биља 

и животну средину, Београд, Србија 

24. Др Слободан Крњајић, Одсек за штеточине биља Института за заштиту биља 

и животну средину, Београд, Србија 

25. Др Татјана Поповић, Одсек за болести биља Института за заштиту биља и 


26. Др Мира Старовић, Одсек за болести биља Института за заштиту биља и 

животну средину, Београд, Србија

vi 


27. Др Светлана Живковић, Одсек за болести биља Института за заштиту биља и 


28. Др Богдан Николић, Одсек за фитофармацију, Институт за заштиту биља и 

животну средину, Београд, Србија


vii 

Реч организатора 

Институт за заштиту биља и животну средину је први симпозијум 

организовао 2010. године у години када је прослављао свој јубилеј 65 година 

рада. То је био национални симпозијум „ Актуелни проблем у сузбијању 

корова и оптимизација примене пестицида у заштити биља “. Симпозијум је 

био веома успешан и ми смо одлучили да ови симпозијуми буду 

традиционални скупови у септембру сваке друге године. 

Узимајући у обзир потребу за успостављањем боље сарадње са 

истраживачима у региону а такође и у Европи одлучили смо да 2012 

организујемо први Међународни симпозијум о актуелним трендовима у 

заштити биља. 

Тема Међународног симпозијума о актуелним трендовима у заштити 

биља је презентовање актуелних сазнања и измена искустава из области 

заштите биља, узимајући у обзир развојне тенденције и трендове у Србији 

као и у свету. Такође, циљ је и окупљање истраживача из ове области и 

унапређење регионалне и међународне сарадње што води подизању нивоа 

стручног и научног рада у Институту и охрабрује младе истраживаче из ове 

области. Узевши у обзир да је овај симпозијум међународни очигледна 

његова важност за целу Србију. 

Институт као једна од главних институција у заштити биља организовао 

је овај симпозијум заједно са две образовне институције Пољопривредним 

Факултетом из Новог Сада , Департманом за фитомедицину и заштиту 

животне средине и Природно- математичким факултетом из Новог сада – 

Департманом за биологију и екологију, којима се искрено захваљујемо. 

У Зборнику радова налазе се сви прихваћени радови рецензирани од 

стране два рецензента. Радови су подељену у пет секција: Ентомологија, 

Фитофармација, Интегрална заштита, Хербологија, Фитопатологија. 

Нематологија. 

Искрено се захваљујемо Министарству просвете и науке и нашим 

спонзорима за подршку организацији Међународног симпозијума о актуелним 

трендовима у заштити биља. Такође изражавамо захвалност ауторима који су 

послали своје радове и рецензентима који су нам помогли. 

Отворени смо и бићемо вам веома захвални за све корисне сугестије 

које би нам помогле да следећи II Међународни симпозијум – Aктуелни 

трендови у заштити биља (2014) буде још бољи ! 

Председник Организационог Одбора Симпозијума 

Др Ненад Доловац 

Секретар Симпозијума 

Др Драгана Марисављевић

viii 


Спонзори 

Генерални спонзор 

Галеника Фитофармација а.д. / Земун 

Главни спонзор: 

МаганАгроХемикалс д.о.о. / Суботица 

Агромаркет д.о.о. / Крагујевац 

Спонзор учесник: 

БАСФ Србија д.о.о / Београд 

Хемикал Агросава / Београд 

ПКБ Београд 

ВИНС 2000 Београд

Internation Symposium: Currrent Trends in Plant Protection 

ix 

Institute for Plant Protection and Enviroment 

Beograd, Serbia 

International Symposium: 

Current Trends in Plant Protection 

Proceedings 

Belgrade, 25-28. September 2012

x 

Proceedings 

Belgrade September 2012 

International Symposium 

Current Trends in Plant Protection 

Proceedings 

Organizer of the Symposium: 

Institute for Plant Protection and Enviroment, Belgrade, Serbia 

Publisher: 

Institute for Plant Protection and Enviroment, Belgrade, Serbia 

For publisher: 

Nenad Dolovac Ph .D, Director of Institute 

Editor in Chief: 

Dragana Marisavljević Ph .D, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

Subeditors: 

Žarko Ivanović Ph .D, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

Milana Mitrović Ph .D, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

Violeta Oro Ph .D, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

Reviewers: 

Janos Varga Ph .D , Proffesor, University of Szeged, Hungary 

Jelena Latinović Ph .D, Proffesor, Biotechnical faculty, Podgorica, Montenegro 

Tatjana Perović, Ph .D, Proffesor, Biotechnical faculty, Podgorica, Montenegro 

Darko Vončina Ph .D, Proffesor, University of Zagreb, Faculty of Agriculture, Croatia 

Nedeljko Latinović Ph .D, Proffesor, Biotechnical faculty, Podgorica, Montenegro 

Sead Šabanadžović Ph .D, Proffesor, Department of Biochemistry, Molecular Biology, 

Entomology and Plant Pathology, Mississippi State University, USA 

Biljana Kukavica Ph .D, Proffesor, University of Banja Luka, Faculty of Natural Scienses and 

Mathematics, Bosnia and Hercegovina 

Svetoslav Bobev Ph .D, Proffesor, Agicultural University, Plovdiv, Bulgaria 

Vojislav Trkulja Ph .D, Proffesor, University of Banja Luka, Faculty of Agriculture, Bosnia and 

Hercegovina 

Stefania Pollastro Ph .D, Proffesor, University of Bari, Italy 

Oliver T. Neher, Ph. D, Proffesor, University of Idaho, Twin Falls Research and Extension 

Center, USA 

Luís Teixeira da Costa, Ph. D, Instituto de Ciências Agrárias e Ambientais Mediterrânicas, 

Universidade de Évora, Portugal 

Ricardo Holgado, Ph.D, Norwegian Institute for Agricultural & Environmental Research- 

Bioforsk, Norwey 

Solveig Haukeland Ph.D, Norwegian Institute for Agricultural & Environmental Research- 

Bioforsk, Norvey 

Zvonko Pacanoski, Assistant Professor principles of field crop production herbology and 

phytopharmacy, Faculty of Agriculture Sciences and Food, Skopje 

Ahmet Uludag, Igdir University, Plant Protection Department, Igdir, Turkey 

Elena Kotula Syka, Ph. D, proffesor, Democritus University of Thrace, Greece


xi 

Petros Lolas , Ph. D, proffesor, School of Agriculture, Crop Production and Rural 

Environment, University of Thessaly, Greece 

Giusepe Brundu, Department of Science for Nature and Environmental Resources (DIPNET), 

University ofSassari, Sassari, Italy 

Albert Fisher Ph.D, Professor, Dept. of Plant Sciences, University of California Davis, USA 

Özhan Boz, [Plant Protection Department, Faculty of Agriculture, Adnan Menderes 

University, Turkey 

Edita Štefanić, J.J. Strosmayer University, Osjek, Croatia 

Štefan Týr, PhD., Katedra udržateľného poľnohospodárstva a herbológie, Nitra, Slovak 

Republic 

Josef Holec, Czech University of Lite Sciences Prague,Dept.Agroecology and Biometeorology 

Prague, Czech Republic 

Mirza Dautbasic, Faculty of Forestry University of Sarajevo, Bosnia and Herzegovina 

Vaskrsija Janjić, Ph.D., Proffesor, Faculty of Agriculture, Banja Luka, Bosnia and 

Hercegovina 

Steve A. Quarrie, Ph.D, Guest Professor, Belgrade University 

Pal Boza, Ph.D, Proffesor, University of Novi Sad, Faculty of Sciences, Novi Sad, Serbia 

Ružica igić, , Ph.D, Proffesor, University of Novi Sad, Faculty of Sciences, Novi Sad, Serbia 

Goran Anačkov, , Ph.D, Proffesor, University of Novi Sad, Faculty of Sciences, Novi Sad, 

Serbia 

Milana Mitrović, Ph .D, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

Tatjana Cvrković, Ph .D, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

Slobodan Krnjajić, Ph .D, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

Željko Tomanović, Ph.D, Professor, Faculty of Biology Belgrade, Serbia 

Veljko Gavrilović,Ph . D, Institute for Plant Protection and Environment, Belgrade, Serbia 

Mira Starović, Ph . D, Institute for Plant Protection and Environment, Belgrade, Serbia 

Slobodan Kuzmanović, Ph . D, Institute for Plant Protection and Environment, Belgrade, 

Serbia 

Saša Stojanović, Ph . D, Institute for Plant Protection and Environment, Belgrade, Serbia 

Svetlana Živković, Ph . D, Institute for Plant Protection and Environment, Belgrade, Serbia 

Tatjana Popović, Ph . D, Institute for Plant Protection and Environment, Belgrade, Serbia 

Nenad Dolovac, Ph.D, Institute for Plant Protection and Environment, Belgrade, Serbia 

Žarko Ivanović, Ph.D, Institute for Plant Protection and Environment, Belgrade, Serbia 

Goran Aleksić , Ph.D, Institute for Plant Protection and Environment, Belgrade, Serbia 

Violeta Oro, Ph. D, Institute for Plant Protection and Environment, Belgrade, Serbia 

Ljiljana Radivojević, Ph.D, Institute for Pesticides and Enviroment, Belgrade, Serbia 

Goran Andrić, Ph.D, Institute for Pesticides and Enviroment, Belgrade, Serbia 

Dejan Marčić, Ph.D, Institute for Pesticides and Enviroment, Belgrade, Serbia 

Bojan Duduk, Ph.D, Institute for Pesticides and Enviroment, Belgrade, Serbia 

Branko Konstantinovič, Ph.D, Proffesor, University of Novi Sad, Faculty of Agriculture, Novi 

Sad, Serbia 

Maja Meseldžija, Ph.D, Proffesor, University of Novi Sad, Faculty of Agriculture, Novi Sad, 

Serbia 

Sava Vrbničanin, Ph.D, Proffesor,Univerity of Belgrade, Faculty of Agriculture, Belgrade, 

Serbia 

Milena Simić, Ph.D, Maize research Institute Zemun Polje, Belgrade, Serbia 

Aleksandra Bulajić, Ph.D Proffesor, University of Belgrade, Faculti of Agriculture, Belgrade, 

Serbia 

Dragana Marisavljević, Ph.D, Institute for Plant Protection and Environment, Belgrade, 

Serbia 

Danijela Pavlović, Ph.D, Institute for Plant Protection and Environment, Belgrade, Serbia 

Vesna Krnjaja, Ph.D, Institute for Animal Husbrandy, Belgrade, Serbia

xii 

Proceedings 

Laszlo Barsi,Ph. D,University of Novi Sad Proffesor, Faculty of Sciences, Novi Sad, Serbia 

Branka Krstić, Ph D, Proffesor, University of Belgrade, Faculty of Agriculture, Belgrade, 

Serbia 

Darko Jevremović, PhD, Fruits Research Institue, Čačak, Serbia 

Nenead Trkulja, Institute for Plant Protection and Environments, Belgrade, Serbia 

Design: 

Gordan Radomirović, dipl ing, sigra.star@gmail.com 

Printed by: 

’’Makarije’’ doo Beograd, www.makarije.rs 

Circulation: 300 

ИСБН: 978-86-910951-1-6 

By the resolution no. 451-03-3906 /2011-14, од 21 Јun 2011 Ministry of Education and 

Science Republic of Serbia donated financial means for printing this Symposium Proceeding 

Organizing Committee: 

1. President Dr Nenad Dolovac, Institute for Plant Protection and Enviroment, 


2. Secretary (Symposium secretary) Dr Dragana Marisavljević, Institute for Plant 

Protection and Enviroment, Belgrade, Serbia 

3. Dr Milica Rat, University of Novi Sad, Faculty of Sciences, Novi Sad, Serbia 

4. Prof Dr Ferenc Bagi, Proffesor, University of Novi Sad, Faculty of Agriculture, Novi 

Sad, Serbia 

5. Dr Ljiljana Radivojević, Institute for Plant Pesticides and Enviroment, Belgrade, 

Serbia 

6. Dr Emil Rekanović, Institute for Plant Pesticides and Enviroment, Belgrade, Serbia 

7. Dr Milana Mitrović, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

8. Dr Danijela Pavlović, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

9. Dr Žarko Ivanović, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

10. Dr Slobodan Kuzmanović, Institute for Plant Protection and Enviroment, Belgrade, 

Serbia 

11. Dr Violeta Oro, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

12. Mr Petar Mitrović, Institute for Field and Vegetable Crops, Novi Sad, Serbia 

13. Mr Aleksandra Konjević, University of Novi Sad, Faculty of Agriculture, Novi Sad, 

Serbia 

14. Nenad Trkulja Dipl ing, Institute for Plant protection and Enviroment, Belgrade, 

Serbia 

15. Mr Bojan Konstantinović, University of Novi Sad, Faculty of Agriculture, Novi Sad, 

Serbia 

16. Nataša Samardžić, University of Novi Sad, Faculty of Agriculture, Novi Sad, Serbia


xiii 

Program Commitee 

1. President: Prof. Dr Branko Konstantinović, University of Novi Sad, Faculty of 

Agriculture, Novi Sad, Serbia 

2. Ahmet Uludag, Igdir University, Plant Protection Department, Igdir, Turkey 

3. Giusepe Brundu, Department of Science for Nature and Environmental Resources 

(DIPNET), University of Sassari, Sassari, Italy 

4. Ricardo Holgado, Ph.D, Norwegian Institute for Agricultural & Environmental 

Research-Bioforsk, Norwey 

5. Jelena Latinović Ph .D, Proffesor, Biotechnical faculty, Podgorica, Montenegro 

6. Darko Vončina Ph .D, Proffesor, University of Zagreb, Faculty of Agriculture, Croatia 

7. Carl Reinhart , Department of Plant Production and Soil Science, University of 

Pretoria, South Africa, 

8. Janos Varga Ph .D , Proffesor, University of Szeged, Hungary 

9. Luís Teixeira da Costa, Ph. D, Instituto de Ciências Agrárias e Ambientais 

Mediterrânicas, Universidade de Évora, Portugal 

10. prof dr Vaskrsija Janjić, University of Banja Luka, Faculty of Agriculture, Bosnia and 

Hercegovina 

11. Dr Sanja Lazić, University of Novi Sad, Faculty of Agriculture, Novi Sad, Serbia 

12. Prof. dr Pal Boža, University of Novi Sad, Faculty of Sciences, Novi Sad, Serbia 

13. Dr Stevan Maširević, University of Novi Sad, Faculty of Agriculture, Novi Sad, Serbia 

14. Prof. dr Ružica Igić, University of Novi Sad, Faculty of Sciences, Novi Sad, Serbia 

15. Prof. dr Ivo Karaman, University of Novi Sad, Faculty of Sciences, Novi Sad, Serbia 

16. Dr Goran Anačkov, University of Novi Sad, Faculty of Sciences, Novi Sad, Serbia 

17. Dr Maja Meseldžija, University of Novi Sad, Faculty of Agriculture, Novi Sad, Serbia 

18. Dr Ana Marijanović Jeromela, Institute for Field and Vegetable Crops, Novi Sad, 

Serbia 

19. Dr Radovan Marinković, Institute for Field and Vegetable Crops , Novi Sad, Serbia 

20. Prof dr Branka Krstić, Ph.D Proffesor, Belgrade University, Faculty of Agriculture, 


21. Prof dr Aleksandra Bulajić, Ph.D Proffesor, Belgrade University, Faculty of 

Agriculture, Belgrade, Serbia 

22. Dr Goran Aleksić, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

23. Dr Tatjana Cvrković, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

24. Dr Slobodan Krnjajić, Institute for Plant Protection and Enviroment, Belgrade, 

Serbia 

25. Dr Tatjana Popović, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

26. Dr Mira Starović, Institute for Plant Protection and Enviroment, Belgrade, Serbia 

27. Dr Svetlana Živković, Institute for Plant Protection and Enviroment, Belgrade, 

Serbia 

28. Dr Bogdan Nikolić, Institute for Plant Protection and Enviroment, Belgrade, Serbia

xiv 

Proceedings 

Sponsors 

General sponsor: 

Galenika Phitopharmacy a.d. / Zemun 

Sponsors: 

MaganAgroChemicals d.o.o. / Subotica 

Agromarket d.o.o. / Kragujevac 

BASF Serbia d.o.o / Belgrade 

Chemical Agrosava / Belgrade 

PKB Belgrade 

VINS 2000 Belgrade


xv 

Word of the organizer 

Institute for plant protection and Enviroment have started the organization 

plant protection symposiums in 2010 year when we celebrates 65th anniversary. 

The first Symposiom was national symposium „ Actual problems in control of 

weeds and optimization of pesticides use in plant protection“ 

The symposium was succesful and we decided our Symposiums to become 

a traditional meeting of researchers in September , every second year. Consider 

needs to make beter conections with reaserchers in region and also in Europe we 

decided in 2012 organize or first international symposium „ International 

Symposium : Curent trends in plant Protection „ 

The objectives of the International Symposium Curent trends in plant 

Protection are presentation of current knowledge and the exchange of 

experiences from the field of Plant Protection consideration of development 

tendencies and trends in Serbia and the world as well, gathering researchers from 

this field with the aim of expanding regional and international cooperation, raising 

the level of professional and scientific work at Institute For Plant protection and 

Enviroment , expanding cooperation with educational institutions and encouraging 

young researchers within this field. Taking into account that this Symposium is 

international, the importance of this event is obvious for the town of Belgrade and 

Serbia. 

Institute as one of the major representatives of plant protections 

development in Serbia did the organization of Symposium in collaboration with two 

educational institutions Agricultural Faculty University of Novi Sad, Department of 

Phytomedicine and Environmental Protection and Faculty of Science, University of 

Novi Sad Department of Biology and Ecology whom we wish to thank. 

Within this Proceedings are presented all accepted papers (reviewed with 

two reviewers). The papers are divided into six sessions: Entomology, 

Phytopharmacy, Integrated Pest management, Herbology and Nematology. 

We wish to thank Ministry of Education and Science, Republic of Serbia 

and our Sponsors for supporting the organization International Symposium : 

Current Trends in Plant Protection. We are also expressing our gratitude to all 

authors who have contributed with their papers to the organization of our first 

International symposium and our gratitude to all reviwers for helping us . 

We are open for cooperation and thankful for all useful suggestions which 

could contribute that the next - II International Symposium: Current Trends in Plant 

Protection (2014) become better ! 

President of the Organizing Committee 

Dr Nenad Dolovac 

Secretary of the Symposium 

Dr Dragana Marisavljević 

Belgrade, September 2012

xvi 

Proceedings

International Symposium: Current Trends in Plant Protection - Proceedings 1 

H E R B O L O G Y

2 HERBOLOGY

Giuseppe Brundu, Johan van Valkenburg 3 

International Symposium: Current Trends in Plant Protection UDK: 574 

Proceedings 502.17 

PRIORITISATION OF INVASIVE ALIEN PLANTS 

GIUSEPPE BRUNDU 1 , JOHAN VAN VALKENBURG 2 

1 Department of Science for Nature and Environmental Resources (DIPNET), University of 

Sassari, Via Piandanna 4, 07100 Sassari, Italy, * corresponding author, 

2 National Plant Protection Organisation, P.O. Box 9102, 6700 HC Wageningen, 

The Netherlands. 

e-mail: gbrundu@tin.it 

The commitment to prioritise species and pathways is quite a big challenge as the effects of 

most of the non-native plant species have not been evaluated in the non-native range and as there are 

not yet agreed systems for risk analysis and common indicators for impacts. In the framework of the 

ad hoc Panel on Invasive Alien Species, EPPO (European and Mediterranean Plant Protection 

Organisation, http://www.eppo.org) proposes a prioritization process for invasive alien plants 

designed (i) to produce a list of invasive alien plants that are established or could potentially establish 

in the EPPO region and (ii) to determine which of these have the highest priority for an EPPO pest 

risk analysis. 

Key words: Prioritization invasive alien plants, risk analysis 

INTRODUCTION 

In October 2010, the Conference of the Parties to the Convention on Biological 

Diversity adopted the Strategic Plan for Biodiversity 2011-2020 which includes the Aichi 

Biodiversity Targets. Target 9 of the plan aims to achieve that by 2020 invasive alien 

species and pathways are identified and prioritized, priority species are controlled or 

eradicated, and measures are in place to manage pathways to prevent their introduction and 

establishment. 

Plant invasions are often resulting in a significant loss in the economic value, 

biological diversity and function of invaded ecosystems, nevertheless, within a particular 

nation, state, region, island or habitat, only a relatively small proportion of the established 

nonnative plant species are recognized as causing, or having the potential to cause, 

significant damage to native biodiversity (e.g., Randall et al., 1998) to ecosystems services 

and/or to economic activities. 

The commitment to prioritise species and pathways is quite a big challenge as the 

effects of most of the non-native plant species have not been evaluated in the non-native 

range, and as there are not yet agreed systems for risk analysis and common indicators for 

impacts (e.g., McGeoch et al., 2010) caused by different taxonomic groups (e.g. plants vs. 

invertebrates). Also in the same broad taxonomic groups (e.g. within vascular plants) it is 

challenging to find suitable methods for comparative assessments between species and 

impacted ecosystems.

4 Prioritisation of Invasive Alien Plants 

In the lack of a common agreed method for pathways’ risk assessment, several 

approaches are actually in use, with different levels of integration or overlapping: 

1. Biogeographic approach. As it is possible to distinguish between IAS alien to 

Europe and IAS alien in Europe, pathways responsible for the introduction or 

species alien to Europe could be considered a priority in comparison to those that 

promote the spread of a species alien within Europe, i.e. a taxa not considered alien 

in some countries, or already established in part of the EU; 

2. “Ecological” approach (propagule pressure, number, frequency, spatial extent, 

probability of establishment, e.g., see Reaser et al., 2007). From this point of view, 

pathways responsible for higher propagule pressures should be considered a priority; 

3. Taxonomic approach (species-specific approach, invasive alien species or main 

taxonomical groups involved/transported). According to this approach, all the 

pathways related to the introduction of a given species (or to a group of species), 

should be considered a priority (sometimes also when a risk assessment is not yet 

available for all the species in that group); 

4. Impacts’ approach (ecosystems, habitats or species affected/invaded/degraded – 

economical costs, etc.). According to this approach are priority pathways those 

responsible for the introduction of species that can or could have some specific 

negative impacts. For example, UNEP/CBD/SBSTTA/6/INF/11 highlights the most 

critical pathways in a set of habitats and land uses, i.e. coastal and marine areas; 

inland waters; terrestrial areas including forests, Mediterranean regions, grasslands 

and savannas, arid and semi-arid areas, and mountains; agricultural lands; islands 

and other geographically and evolutionary isolated areas; polar regions; 

5. Management approach (pathways not already covered by other EU legislation, 

pathways that could be regulated/detected/inspected). From this point of view, 

priorities pathways are those that could be regulated or mitigated in some way. 

Concerning legislation tools, some pathways are already dealt with by a series of 

other EU legislations (plant, animal health, aquaculture etc.), while others are not 

addressed, and therefore could be considered a priority for legislation action. 

Additionally, after an eradication intervention, the pathways that could be 

responsible for a reintroduction of the eradicated taxa could be considered a priority 

for management. 

THE EPPO PRIORITISATION SYSTEM 

As already stated, although invasive alien plants are gaining increased attention within 

countries, there is no existing widely agreed method to identify those alien plants that are 

considered invasive and represent the highest priority for pest risk analysis or PRA (Brunel 

et al., 2010). In the framework of the ad hoc Panel on Invasive Alien Species, EPPO 

(European and Mediterranean Plant Protection Organisation, http://www.eppo.org) 

proposes a prioritization process for invasive alien plants designed (i) to produce a list of 

invasive alien plants that are established or could potentially establish in the EPPO region 

and (ii) to determine which of these have the highest priority for an EPPO pest risk

Giuseppe Brundu, Johan van Valkenburg 5 

analysis. The process consists of compiling available information on alien plants according 

to pre-determined criteria, and can be run at the EPPO region level, or at a country or local 

area level. These criteria examine whether the species is alien in the area under study, and 

whether it is established or not. The criteria used primarily rely on observations in the 

EPPO region but, if the species is not established, the invasive behaviour of the species in 

other countries should be investigated, as well as the suitability of the ecoclimatic 

conditions in the area under consideration. The spread potential, the potential negative 

impacts on native species, habitats and ecosystems, as well as on agriculture, horticulture or 

forestry are considered. If the species qualifies as an invasive alien plant of major concern 

through this first set of questions, the process then investigates the efficiency of 

international measures (to be justified through a pest risk analysis) to prevent the entry and 

spread of the species. The second set of questions are designed to determine whether the 

species is internationally traded or enters new countries through international pathways for 

which the risk of introduction is superior to natural spread, and whether the species still has 

a significant suitable area for further spread. If used by several EPPO countries, this 

prioritization process represents an opportunity to provide consistent country lists of 

invasive alien plant species, as well as a tool for dialogue and exchange of information. The 

computer software CAPRA (Computer Assisted Pest Risk Analysis, 

http://capra.eppo.org/)has been developed by the EPPO Secretariat in the framework of the 

European Union 7th framework program protect PRATIQUE (Grant agreement No 212 

459) and with the support of the EPPO Panels. This software aims to assist pest risk 

analysts in running the EPPO decision-support scheme for Pest Risk Analysis (EPPO 

Standard PM 5/3(5) Decision-support scheme for quarantine pests), and the EPPO 

prioritisation process for invasive alien plants. CAPRA incorporates a development 

environment for building graphical decision-theoretic models, developed at the Decision 

Systems Laboratory, University of Pittsburgh Bayesian, i.e. the software GenNie 

(http://genie.sis.pitt.edu/). In this framework a Bayesian approach is used for dealing with 

the uncertainty in the evaluation of the alien taxa under assessment with the EPPO 

prioritisation process. Understanding the errors and uncertainties that occur during the 

process of listing invasive species, as well as the potential size and nature of their effects on 

IAS lists, is key to improving the value of these lists for governments, management 

agencies, and conservationists. Such understanding is increasingly important given positive 

trends in biological invasion and the associated risks to biodiversity and biosecurity 

(McGeoch et al., 2012). 

EMERGING MEDITERRANEAN INVADERS 

A major step in tackling invasive alien plants consists of identifying those species 

that represent a future threat to managed and unmanaged habitats. EPPO reviews and 

organizes data on alien plants in order to build an early warning system (Brunel et al., 

2010). During a series of dedicated workshops, the EPPO prioritization system has been 

applied to the Mediterranean Basin which is particularly vulnerable because its climatic 

conditions potentially allow the establishment of sub-tropical and tropical species. Surveys 

and rapid assessments of spread and impact have allowed identification of emerging 

invasive alien plants for Mediterranean countries: Alternanthera philoxeroides 

(Amaranthaceae), Ambrosia artemisiifolia (Asteraceae), Baccharis halimifolia 

(Asteraceae), Cortaderia selloana (Poaceae), Eichhornia crassipes (Pontederiaceae), 

Fallopia baldschuanica (Polygonaceae), Hakea sericea (Proteaceae), Humulus japonicus

6 Prioritisation of Invasive Alien Plants 

(Cannabaceae), Ludwigia grandiflora and L. peploides (Onagraceae), Hydrilla verticillata 

(Hydrocharitaceae), Microstegium vimineum (Poaceae), Myriophyllum heterophyllum 

(Haloragaceae), Pennisetum setaceum (Poaceae), Pistia stratiotes (Araceae), Salvinia 

molesta (Salviniaceae), Solanum elaeagnifolium (Solanaceae). These species represent 

priorities for action. Some other species are placed on the observation list, as available 

information does not allow them to be counted among the worst threats: Akebia quinata 

(Lardizabalaceae), Araujia sericifera (Apocynaceae), Delairea odorata (Asteraceae), 

Cabomba caroliniana (Cabombaceae), Nassella neesiana, N. tenuissima and N. trichotoma 

(Poaceae), Sesbania punicea (Fabaceae) and Verbesina encelioides (Asteraceae). 

This application on the Mediterranean region exemplify the possibility to apply the 

method at biogeographic level and we hope will promote the use of the EPPO prioritisation 

process in other regions and countries. 

REFERENCES 

Brunel, S., Branquart, E., Fried, G., Van Valkenburg, J., Brundu, G., Starfinger, U., Buholzer, 

S., Uludag, A., Joseffson, M., Baker, R. (2010): The EPPO prioritization process for 

invasive alien plants. EPPO Bulletin, 40: 407 – 422. doi: 10.1111/j.1365- 

2338.2010.02423.x. 

Brunel, S., Schrader, G., Brundu, G., Fried, G. (2010): Emerging invasive alien plants for the 

Mediterranean Basin. EPPO Bulletin, 40: 219 – 238. doi: 10.1111/j.1365- 

2338.2010.02378.x 

McGeoch, M.A., Butchart, S.H.M., Spear, D., Marais, E., Kleynhans, E.J., Symes, A., Chanson, 

J., Hoffmann, M. (2010): Global indicators of biological invasion: species numbers, 

biodiversity impact and policy responses. Diversity and Distributions, 16: 95 – 108. 

McGeoch, M.A., Spear, D., Kleynhans, E.J., Marais, E. (2012): Uncertainty in invasive alien 

species listing. Ecological Applications, 22: 959 – 971. http://dx.doi.org/10.1890/11- 

1252.1. 

Randall, J.M., Morse, L.E., Benton, N., Hiebert, R., Lu, S., Killeffer, T. (2008): The Invasive 

Species Assessment Protocol: A Tool for Creating Regional and National Lists of 

Invasive Nonnative Plants that Negatively Impact Biodiversity. Invasive Plant Science 

and Management, 1: 36 – 49. 

Reaser, J.K., Meyerson, L.A., Von Holle, B. (2007): Saving camels from straws: how propagule 

pressure-based prevention policies can reduce the risk of biological invasion. Biological 

Invasions, DOI 10.1007/s10530-007-9186-x. 

UNEP/CBD/COP/DEC/VIII/27, 15 June 2006 “Conference of the Parties to the Convention on 

Biological diversity, Eighth meeting, Curitiba, Brazil, 20-31 March 2006, Decision 

adopted by the Conference of the Parties to the Convention on Biological Diversity at its 

eight meeting. VIII/27. Alien species that threaten ecosystems, habitats or species 

(Article 8 (h)): further consideration of gaps and inconsistencies in the international 

regulatory framework [http://www.cbd.int/doc/decisions/cop-08/cop-08-dec-27-en.pdf]

Branko Šikoparija, Carsten A. Skjoth, Predrag Radišić,... 7 

International Symposium: Current Trends in Plant Protection UDK: 574(497.113) 

Proceedings 632.51:582.998.1(497.113) 

AEROBIOLOGY DATA USED FOR PRODUCING INVENTORIES 

OF INVASIVE PLANTS 

BRANKO ŠIKOPARIJA 1 , CARSTEN A. SKJØTH 2, 3 , PREDRAG RADIŠIĆ 1 , BARBARA 

STJEPANOVIĆ 4 , IVANA HRGA 4 , DÓRA APATINI 5 , DONÁT MAGYAR 5 , ANNA PÁLDY 5 , 

NICOLETA IANOVICI 6 , MATT SMITH 7 

1 Laboratory for Palynology, Faculty of Sciences University of Novi Sad, Serbia; 

2 Department of Environmental Science, Aarhus University, Denmark; 

3 Department of Earth and Ecosystem Sciences, Lund University, Sweden 

4 Institute of Public Health “Dr Andrija Stampar”, Croatia; 

5 National Institute of Environmental Health, Hungary 

6 Faculty of Chemistry-Biology-Geography, West University of Timisoara, Romania; 

7 University Department of ORL, Medical University of Vienna, Austria; 

Email: sikoparijabranko@yahoo.co.uk 

Mapping the distribution and abundance of alien plants is important in the process of 

understanding their invasive potential. It provides basic information that can be used in estimating 

their ecological preferences but also the success of eradication strategies. Mapping of vegetation is a 

time consuming task and especially problematic for annuals whose population distribution and 

abundance show year–to-year variability. Alternatives to this bottom-up approach are therefore highly 

needed when producing vegetation maps and inventories. The paper examines the potential of using 

the top-down approach for producing pollen source inventories, which employs spatial variations in 

annual airborne pollen counts to indicate the abundance of invasive species. The ragweed pollen 

source inventory over Vojvodina is presented here as an example. The degree in which the 

performance of the method is affected by spatial resolution is investigated. 

Key words: Inventory, invasive species, aerobiology, Ambrosia 

INTRODUCTION 

The exchange of gasses and particles from the surface and with the atmosphere are 

important processes that contribute to the overall climate (e.g Xu and Penner, 2012) and 

participate in feedback effects (Arneth et al., 2010). They are also important both for 

natural ecosystems and human health in relation to air quality. Air quality is often assessed 

and described using atmospheric transport models that can distribute, modify and deposit 

known sources. The character of the source (distribution and emission) is typically based on 

an inventory, and this is considered among the biggest uncertainties in the application of 

atmospheric transport models (Russell & Dennis, 2000). In comparison to chemical air 

pollutants where inventories have been available for decades (e.g Olivier et al, 1998), very 

limited work has been done with respect to locating and mapping the sources of allergenic 

pollen (Skjoth et al., in press).

8 Aerobiology data used for producing inventories of... 

Gridded pollen source inventories are essentially based on vegetation mapping 

(bottom-up approach) but the mapping of the vegetation is time consuming and it is 

especially problematic for annuals whose population distribution and abundance show yearto-year 

variability. Therefore an alternative top-down approach, that uses a measured 

quantity of airborne pollen as a starting point and then a backwards calculation method for 

estimating the geographical distribution of the species of interest, is required (Skjoth et al., 

in press). 

Invasive species cause economic or environmental harm, including negative impacts 

to human health. In Europe, more than 6,600 terrestrial plant species are identified as aliens 

(DAISIE, 2008) but only part of them are considered invasive. 

Among the Ambrosia genus, only A. maritima L. is native to Europe (Hansen, 1976) 

while four others species have been introduced from North America. Common ragweed 

(Ambrosia artemisiifolia L.) is the most widespread Ambrosia species in Europe, and as 

such is the most important in terms of allergy and plant protection. Common ragweed is a 

rather aggressive and plastic species that predominates in the first stage of the progressive 

succession (Maryushkina, 1991). The plant is known as an important invasive species 

(DAISIE, 2008) and it will colonise a wide range of habitats, such as cultivated fields as 

well as riparian and ruderal habitats, if two conditions are fulfilled: (1) available seeds; (2) 

soil disturbance (Skjøth et al., 2010). Each ragweed plant produces millions of pollen grains 

that are well designed for wind pollination (Payne, 1963). The most important sources of 

ragweed pollen in Europe are considered to be the Pannonian Plain, predominantly the 

northern part of Serbia (Vojvodina) and the Southern part of Hungary (Kiss and Béres, 

2006), the Rhône Valley (France) and parts of Northern Italy (Rybníček and Jäger, 2001). 

The aims of this study are to: (1) compile a list of invasive species that can be 

mapped using an integrated methodology that considers airborne pollen data as an indicator 

of the plant abundance; (2) analyze performance of the recently developed methodology for 

producing a ragweed pollen source inventory over Vojvodina. 

MATERIAL AND METHODS 

A list of plant species that could to be mapped using the top-down approach has 

been compiled by considering: (a) the invasive plant species recognized in Vojvodina 

(IASV, 2011); (b) the pollen types recorded in the European Aeroallergen Network (EAN - 

https://ean.polleninfo.eu/Ean/); (c) 12-year records of airborne pollen monitoring in Novi 

Sad. 

As an illustration of the methodology for producing plant inventory, we compared 

the 50×50 km and 5×5 km ragweed pollen source inventories over Vojvodina based on the 

top-down approach proposed by Skjoth et al. (2010). The applied methodology for 

producing species inventories (Fig.1) combines spatial variations in annual airborne pollen 

counts (indicator of abundance), knowledge of plant ecology (indicator of habitat 

preference) and detailed land cover information from the area of interest. Anemophilous 

pollination strategy and resulting high pollen production makes Ambrosia a good subject 

for such a study.


Fig. 1. Algorithm for producing pollen source 

inventories (parallelogram = input/output; 

rectangle = processing step) (Sikoparija et al., 2012). 

Annual airborne pollen counts are obtained from aerobiological pollen data that 

were collected using volumetric spore traps of the Hirst design (Hirst, 1952) by a number of 

stations situated on the southern Pannonian plain during the period 2000-2010. These traps 

continuously suck in air at a rate of 10 l min -1 through a 2×14 mm orifice. Behind the 

orifice the air flows over a rotating drum that moves past the inlet at 2mm h -1 and is 

covered with an adhesive coated, transparent plastic tape. Particles in the air (including 

pollen grains) impact on the tape to give a time related sample (Emberlin, 2000). Following 

its removal from the trap, the tape is divided into segments corresponding to 24-h periods 

(48mm in length) (Piotrowska and Weryszko-Chmielewska, 2006). Each segment is 

mounted between a glass slide and cover slip using a mixture that contains gelatine, 

glycerine, phenol, distilled water and basic fuchsine (Laaidi et al., 2003). The slides are 

examined by light microscopy, the pollen grains were identified at ×400 magnification and 

the results are expressed as daily pollen concentrations (grains m -3 ). The annual sum of 

daily pollen concentrations for each aerobiological station is used in the inventory 

development process. 

All habitats present in the Pannonian Plain are identified in the CLC2000 dataset 

according to CORINE nomenclature (EC, 2005). Areas with frequent and extensive soil 

disturbance have been extracted from selected CORINE categories. The growth habitats of 

common ragweed are identified using local expertise. The sorted CLC2000 dataset is then


combined with the airborne pollen stations information data and the average annual 

airborne pollen counts at the stations using the GIS software ArcGIS (ESRI). The amount 

of pollen recorded using volumetric traps is generally considered to reflect the overall 

pollen load within a distance of about 30 km (Skjøth et al., 2010). Therefore, the total area 

of possible Ambrosia habitats was calculated within a distance of 30 km from each pollenmonitoring 

station. Overall species distribution within growth habitats around a pollenmonitoring 

site is then calculated, normalised and synchronised and then interpolated from 

the station locations to all possible growth habitats in the studied region. Both the habitat 

coverage and Ambrosia infection are then gridded to the European Monitoring and 

Evaluation Programme 50 grid (http://www.emep.int/grid/gridescr.html). The coarse 50×50 

km and fine 5×5 km resolution data are compared. The EMEP grid is commonly used for 

inventories in European air quality studies and therefore forms the basis for many 

regulation and mitigation strategies – nationally as well as internationally. Furthermore, this 

particular procedure makes the comparison of Ambrosia infection levels throughout the 

region straightforward. 

RESULTS 

Among recognized invasive species in Vojvodina, pollen of Acer negundo, 

Ailanthus altissima, Amorpha fruticosa, Broussonetia papyrifera, Elaeagnus angustifolia, 

Gleditsia triacanthos, Iva xanthifolia, Maclura aurantiaca and Xanthium sp. can be 

identified in airborne pollen samples from Novi Sad. These pollen types are recorded in the 

EAN network as well, but they are frequently classified under higher taxonomical category 

(i.e. Acer negundo under Acer pollen type). It is also likely that these pollen types are 

sometimes recorded under “Varia” or “unidentified” as they occur rarely or are not of 

allergoligical importance (many sites only identify known aeroallergens and list the 

remaining pollen fraction as unknown). As such, they are not always suitable target for 

producing source inventories over large geographical areas. On the other hand, pollen 

grains of Ambrosia sp. are both important aeroallergens and relatively straightforward to 

identify and so they are regularly recorded at Novi Sad and other sites throughout the 

region. 

Among the pollen types listed above, Ambrosia pollen is the most abundant in 

Vojvodina, which has a high density of possible growth habitats for Ambrosia species, 

ranging from 35% to 93% per 50×50 km grid cell. The highest habitat abundance was 

identified to the north and east from Sombor and Zrenjanin (Fig. 2a). Areas of lower habitat 

densities can be identified when a 5x5 km resolution is applied, mainly around the Rivers 

Danube and Tisa and in the region of the Fruska Gora Mountain (Fig. 2b). 

The 50×50 km gridded species inventory shows that with 60% to 78% per grid cell 

the most infected areas are found in Backa (West part of Vojvodina), where these areas 

correspond to the location of the most abundant habitats. However, Banat (East part of 

Vojvodina) is characterized by lower ragweed infection even in the area with the densest 

preferred habitats (Fig. 3a), with 24% to 39% per grid cell. The 50×50 km grid cells can 

look rather homogeneous with respect to infection. Whereas, much more detail is obtained 

with the 5×5 km resolution, with areas of high and low levels of infection being found 

within each 50×50 km grid.


(a) 

(b) 

Figure. 2. Average annual pollen count and density and distribution of possible growth habitats 

of Ambrosia on the southern Pannonian Plain resulting from the filtering mechanism described 

in Fig. 1: (a) 50×50 km, (b) 5×5 km resolution grid. 

(a) 

(b) 

Fig. 3. Average annual pollen count and the areas most infected by Ambrosia pollen over the 

southern Pannonian Plain: (a) 50×50 km, (b) 5×5 km resolution grid 

DISCUSSION 

We have shown the possibilities for using the top-down approach in producing 

inventories for plant species adapted to wind pollination strategy. The List of invasive 

species in Vojvodina (IASV, 2011) indicates the possibility for expanding the inventorying 

methodology to other plants as well. Future work should be focused in analysing the 

performance of the methodology when applied to other anemophilous invaders (i.e. Acer 

negundo, Broussonetia papyrifera, Iva xanthifolia). The methodology could also be tested 

on invasive plants that are primarily entomophilous (i.e. Ailanthus altissima, Amorpha 

fruticosa) but whose pollen is regularly recorded in the atmosphere. Although the approach 

can be limited to certain geographical areas because not all pollen-monitoring stations 

regularly record certain pollen types and so any attempt to produce inventories 

encompassing larger areas would require distribution of information and a programme of 

education.


In addition, airborne pollen is usually identified to genus level so the results can be 

misleading if the same area is inhabited both by autochtonous and introduced species or 

several introduced species. For example, during routine pollen monitoring it is impossible 

to differentiate pollen grains of different ragweed species so the presented inventory 

indicates distribution and abundance of all Ambrosia species in Vojvodina together. But 

wide and frequent distribution of Ambrosia artemisiifolia compared to A. tenuifolia and A. 

trifida (IASV, 2011) makes produced inventory the most reflective to common ragweed 

distribution and abundance. 

The application of coarse 50×50 km resolution used by the EMEP (Fagerli and Aas, 

2008; Simpson et al., 2012) and DEHM (Frohn et al., 2002; Christensen et al., 2004; Brandt 

et al., 2012) chemical transport models, makes the inventory comparable to common 

emission reporting routines (http://www.emep.int) and easy to implement into atmospheric 

transport models. However, the application of finer resolution is particularly important 

when producing inventories for invasive species, especially for identifying threatened 

habitats. Here the 5×5 km resolution is more appropriate. But increasing the resolution does 

not necessarily improve the inventory, if the input data is too coarse. Two main data sets 

are used as input: pollen data and land cover data and neither if these data sets have been 

changed. The CLC2000 land cover data are quite coarse, so improvement to the inventory 

requires increasing the resolution so that it includes other specific habitats such as 

transportation infrastructure (i.e. vegetation bands linked to roads and railroads). The 

increase of inventory resolution should enable taking into account soil types from atlases 

(Jones et al., 2005) and crop types that are known to be associated with ragweed 

populations (Pinke et al., 2011) or including individual fields and the degree of 

fragmentation of field systems because ragweed is often present around the edges of fields 

that are the least affected by agro-technical processes (Pinke et al., 2011). The uncertainty 

of the inventory is therefore likely to be reduced by either taking into account additional 

data sets or by replacing the land cover data set with a more detailed data that covers the 

countries in question. Another needed improvement is the availability of pollen-monitoring 

stations. A relatively large fraction of the 5×5 km grid cells in Fig. 3b are not within 30 km 

zone of a pollen-monitoring site. The infection levels for these areas are therefore based on 

interpolation. It is therefore likely that the uncertainty can be reduced by using a denser 

pollen-monitoring network, especially in the most data sparse regions. 

The top-down approach based methodology presented here relies on the assumption 

that the pollen load reflects the amount of plants within a distance of 30 km from each 

pollen-monitoring station (Skjøth et al., 2010). This introduces some degree of uncertainty. 

The local pollen load is also affected by known annual variations in pollen production 

(Brostrom et al., 2008) and by the meteorological conditions that either increase the amount 

of recorded pollen due to long-distance transport or decrease the amount due to 

exceptionally rainy season. Although the applied methodology reduces the effect of local 

variations in environmental variables by using annual pollen count averaged for a number 

of years as an indicator of source abundance, application of numerical dispersion models, 

e.g. COSMO-ART (Zink et al., 2011) and SILAM (Sofiev et al., 2006) is required here to 

distinguish pollen originating from local sources from pollen arrived by long distance 

transport.


ACKNOWLEDGEMENTS 

This work was supported by the Copenhagen Global Change Initiative, the Ministry 

of Science R. Serbia projects no. OI173002 and III43002, and the Villum-Kann Rasmussen 

Foundation through a Post Doc grant to Carsten Ambelas Skjøth. The results presented here 

address one of the main scientific challenges described in COST Action FA1203 

(SMARTER). 

REFERENCES 

Anačkov, G., Bjelić-Čabrilo, O., Karaman, I., Karaman, M., Radenković, S., Radulović, S., 

Vukov, D., Boža P, editors. (2011): List of invasive species in AP Vojvodina [Internet]. 

Version 0.1beta Novi Sad (Serbia): Department of Biology and Ecology; [cited 2012 

June 10]. Available from: URL Serbian, English. In text citation (IASV, 2011). 

Arneth, A., Harrison, S. P., Zaehle, S., Tsigaridis, K., Menon, S., Bartlein, P. J., Feichter, J., 

Korhola, A., Kulmala, M., O'Donnell, D., Schurgers, G., Sorvari, S., Vesala, T. (2010): 

Terrestrial biogeochemical feedbacks in the climate system. Nature Geoscience, 3: 525- 

532. 

Brandt, J. Silver, J. D., Frohn, L. M., Geels, C., Gross, A., Hansen, A. B., Hansen, K. M., 

Hedegaard, G. B., Skjøth, C. A., Villadsen, H., Zare, A., Christensen J. H. (2012): An 

integrated model study for Europe and North America using the Danish Eulerian 

Hemispheric Model with focus on intercontinental transport of air pollution. 

Atmospheric Environment, 53: 156-176. 

Brostrom, A., Nielsen, A. B., Gaillard, M. J., Hjelle, K., Mazier, F., Binney, H., Bunting, J., 

Fyfe, R., Meltsov, V., Poska, A., Rasanen, S., Soepboer, W., von Stedingk, H., Suutari, 

H., & Sugita, S. (2008): Pollen productivity estimates of key European plant taxa for 

quantitative reconstruction of past vegetation: a review. Vegetation History and 

Archaeobotany, 17: 461-478. 

Christensen, J. H., Brandt, J., Frohn, L. M., Skov, H. (2004): Modelling of mercury in the Arctic 

with the Danish Eulerian Hemispheric Model. Atmos Chem Phys, 4: 2251–2257. 

DAISIE European Invasive Alien Species Gateway, 2008. from: http://www.europe-aliens.org/ 

[Accessed 12th June 2012]. 

EC (2005) European Commission. Image2000 and CLC2000 Products and Methods. Maria 

Vanda Nunes de Lima, European Commision, Joint Research Centre (DG JRC), Institute 

for Environment and Sustainability, Land Management Unit, I-21020 Ispra (VA), Italy: 

pp. 1-152. 

Emberlin, J., 2000. Aerobiology. In: Busse, W. W., Holgate, S. T. (Eds.), Asthma and Rhinitis, 

vol. 2. Blackwell Science. 

Fagerli, H., Aas, W. (2008): Trends of nitrogen in air and precipitation: model results and 

observations at EMEP sites in Europe, 1980–2003. Environ Pollut, 154: 448–461. 

Frohn, L. M., Christensen, J. H., Brandt, J. (2002): Development of a high-resolution nested air 

pollution model—the numerical approach. J. Comput Phys, 179: 68–94. 

Hansen, A., (1976): Ambrosia L. in: Flora Europaea, Vol 4: Tutin, T. G. and Heywood, V. H., 

Eds., Cambridge University Press, pp. 142-143. 

Hirst, J. M. (1952): An automatic volumetric spore trap. Ann. Appl. Biol. 39: 257–265. 

Jones, A., Montanarella, L., Jones, R. (2005): Soil Atlas of Europe. (ed. by European 

Commision), pp. 1 - 128. 

Kiss, L., Béres, I. (2006): Anthropogenic factors behind the recent population expansion of 

common ragweed (Ambrosia artemisiifolia L.) in Eastern Europe: is there a correlation 

with political transitions? Journal of Biogeography, 33: 2154–2157.


Laaidi, M., Thibaudon, M., Besancenot, J.-P., (2003): Two statistical approaches to forecasting 

the start and duration of the pollen season of Ambrosia in the area of Lyon (France). Int. 

J. Biometeorol. 48: 65–73. 

Maryushkina, V. Y., (1991): Peculiarities of common ragweed (Ambrosia artemisiifolia L.) 

strategy. Agric. Ecosyst. Environ, 36, 207–216. 

Olivier, J. G. J., Bouwman, A. F., Van der Hoek, K. W., Berdowski, J. J. M. (1998): Global air 

emission inventories for anthropogenic sources of NOx, NH3 and N2O in 1990. Environ. 

Pollut., 102: 135-148. 

Payne, W. W. (1963): The morphology of the inflorescence of ragweeds (Ambrosia-Franseria: 

Compositae). Am J Bot, 50: 872-880. 

Pinke, G., Karacsony, P., Czucz, B., Botta-Dukat, Z. (2011): Environmental and land-use 

variables determining the abundance of Ambrosia artemisiifolia in arable fields in 

Hungary. Preslia, 83: 219-235. 

Piotrowska, K., Weryszko-Chmielewska, E. (2006): Ambrosia pollen in the air of Lublin, 

Poland. Aerobiologia, 22: 151–158. 

Russell, A., Dennis, R. (2000): NARSTO critical review of photochemical models and 

modelling. Atmos Environ, 34: 2283-2324. 

Rybníček, O., Jäger, S. (2001): Ambrosia (Ragweed) in Europe. Allergy and Clinical 

Immunology, 13(2), 60-66. 

Simpson, D., Benedictow, A., Berge, H., Bergström, R., Emberson, L. D., Fagerli, H., Hayman, 

G. D., Gauss, M., Jonson, J. E., Jenkin, M. E., Nyíri, A., Richter, C., Semeena, V. S., 

Tsyro, S., Tuovinen, J. P., Valdebenito, Á., Wind, P. (2012): The EMEP MSC-W 

chemical transport model - Part 1: Model description. Atmos. Chem. Phys. Discuss., 12: 

3781-3874. 

Sofiev, M., Siljamo, P., Valkama, I., Ilvonen, M., & Kukkonen, J. (2006): A dispersion 

modelling system SILAM and its evaluation against ETEX data. Atmospheric 

Environment, 40: 674-685. 

Šikoparija, B., Smith, M., Thibaudon, M., Oliver, G., Myszkowska, D., Kasprzyk, I., Radišić, P., 

Stjepanović, B., Hrga, I., Apatini, D., Magyar, D., Paldy, A., Ianovici, N., Skjøth, C. A. 

(2012): Constructing ragweed pollen source inventories. 2nd International Ragweed 

Conference, Lyon, France. 

Skjøth, C. A., Smith, M., Sikoparija, B., Stach, A., Myszkowska, D., Kasprzyk, I., Radisic, P., 

Stjepanovic, B., Hrga, I., Apatini, D., Magyar, D., Paldy, A., Ianovici, N. (2010): A 

method for producing airborne pollen source inventories: An example of Ambrosia 

(ragweed) on the Pannonian Plain. Agricultural and Forest Meteorology, 150: 1203- 

1210. 

Skjøth, C. A., Šikoparija, B., Jaeger, S., EAN-network. (2012): Pollen Sources. In Sofiev, M., 

Bergman, C-K (eds.) Allergenic Pollen: A Review of the Production, Release, 

Distribution and Health Impacts. Springer Verlag, in press. ISBN978-94-007-4880-4. 

Xu, L., Penner, J. E. (2012): Global simulations of nitrate and ammonium aerosols and their 

radiative effects. Atmos. Chem. Phys. Discuss., 12: 10115-10179. 

Zink, K., Vogel, H., Vogel, B., Magyar, D., Kottmeier, C. (2011) Modelling the dispersion of 

Ambrosia artemisiifolia L. pollen with the model system COSMO-ART. International 

Journal of Biometeorology, 1-12.

B. Konstantinović, M. Meseldžija, N. Samardžić 15 

International Symposium: Current Trends in Plant Protection UDK: 632.954.025.8 

Proceedings 

HERBICIDES RESISTANCE OF AMARANTHUS RETROFLEXUS 

L. THE IMPORTANT WEED OF ROW CROP, TO ALS 

INHIBITORS 

B. KONSTANTINOVIĆ, M. MESELDŽIJA, N. SAMARDŽIĆ 

University of Novi Sad, Faculty of Agriculture, Serbia, 

e-mail: brankok@polj.uns.ac.rs 

Seeds of biotypes of weed species Amaranthus retroflexus L. for which there exists possiblity 

of resistance occurrence were collected from different localities in Vojvodina, i.e. Krivaja, Kikinda, 

Bečej, Kačarevo, Vrbas (Sava Kovačević and Carnex). The studies were perfomed in the period 

2004-2011. Biological testings comprehended whole plant bioassays (Moss, 1995) on plants grown in 

controlled conditions in Petri dishes treated with a range of herbicide rates. During studies herbicides 

based upon active ingredients nicosulfuron, sulfometuron-methyl and imazethapyr were used, with 

the aim of studing occurrence of cross resistance. Values of resistance index were calculated in regard 

to refferent population, collected from ruderal sites. In order to calculate ALS enzime’s activity, 

immunological studies were perfomed on biotypes with the highest resistance index obtained by 

application of biological methods. Based upon results of biological assays, presence of cross 

resistance was confirmed for weed species Amaranthus retroflexus L. from locality Krivaja on 

herbicides nicosulfuron and imazethapyr. 

Key words: ALS inhibitors; herbicide resistance, Amaranthus retroflexus. 

INTRODUCTION 

Since confirmation of the first resistant weed species Senecio vulgaris L. to triazine 

herbicides until nowadays, resistance has been found in 388 biotypes of weed species to 18 

herbicide groups of different action mechanism, in 209 weed species, of which 123 were 

dicotyledonous and 86 grass species (Ryan, 1970; Heap, 2012). Number of representatives 

of these populations keeps increasing on a daily basis, due to the frequent use of the same 

herbicides or herbicides of the identical mechanism of action. Since 1982 herbicide 

technology has been significantly improved by introduction of the first ALS inhibiting 

herbicide, hlorsulfuron for control of broad-leaved weeds in wheat (Saari et al., 1994). 

Hlorsulfuron, as well as the other sulfonylurea herbicides (SU) proved to be efficient in 

lower rates, which is related to their highly specific inhibition of ALS enzyme. In 

susceptible plants these herbicides cause damages such as necrosis of the apical meristems 

that cease plant growth in cases of soil application, while during foliar use they lead to the 

occurrence of purple color along the central leaf (Lovell et al., 1996b). In 1987, only 5 

years after introduction of the first SU, with discovery of hlorsulfuron resistant biotypes of

16 Herbicides resistance of Amaranthus retroflexus L. the important weed of... 

weed species Lactuca serriola L. (Mallory-Smith et al., 1990) and Kochia scoparia (L.) 

Shrad (Primiani et al., 1990), occurred selection due to which weed populations rapidly 

evolved resistance to ALS inhibiting herbicides. Currently, 126 weed species are resistant 

to the herbicides belonging to this group of action mechanism (Heap, 2012). Resistance to 

ALS inhibitors in some weed species is not limited to only several isolated population, but 

it is more frequently widely distributed and common, so that it represents threat to further 

use of ALS inhibiting herbicides. 

MATERIALS AND METHODS 

Weed seeds was collected in the period August-October 2004-2011 from plots with 

the long history of use of ALS inhibiting herbicides in control of weedy vegetation and on 

which low efficiency to the monitored weed species was observed (Table 1). Seed were 

collected from different localities in the region of Vojvodina (North Serbia); Kikinda, 

Becej, Kačarevo, Vrbas (Sava Kovačević and Carnex). For susceptible, referent population 

were taken seeds from ruderal sites that had never been treated by herbicides. In whole 

plant studies, plants were grown in controlled conditions of climatic chamber. 

Imazethapyr was applied before sowing of seeds with a range of rates, 0.04; 0.08; 

0.1; 0.15 and 0.2 kg a.i./ha, while nicosulfuron was applied with a range of rates, 40; 50; 

80; 120; 160 and 240 kg a.i./ha. Thirty days after onset of the experiment (and preemergence 

treatment), percentage of survived plants and foliage fresh weight were 

calculated in relation to the control for all of the studied weed species. Based upon 

coefficients of ED50 concerning those susceptible populations, resistance index (RI) that 

enables relatively simple description of resistance level was calculated (Moss, 1995). 

Herbicide rates for biochemical studies were chosen in a manner convenient for getting 

plant reactions from ‘’ without damage’’, to ‘’ the complete destruction’’. Sulfometuronmethyl 

was applied with a range of rates, 0, 1, 5, 10, 25, 50, 100 and 500 g/ha, and 

imazethapyr with a range of rates of 0, 8, 40, 100, 200, 400, 800 and 2000 g/ha. Extraction 

and biochemical studies of ALS enzyme activity in vivo were performed according to the 

method of Lovell et al. (1996a). 

RESULTS AND DISCUSSION 

Based upon field observations, populations of Amaranthus retroflexus L. were 

separated from localities Krivaja, Kikinda, Kačarevo, Bečej and Vrbas, in order to perform 

biological assays and biochemical ALS enzyme resistance studies. Whole plant bioassays 

were performed with a range of nicosulfuron and imazethapyr rates. The measured 

parameters were fresh foliage weight and number of survived plants treated with a range of 

herbicide rates (Tables 1 and 2). Values of ED50 and RI presented in tables 1 and 2 were 

calculated upon dose-response curve that represents plant reaction to the applied range of 

herbicide rates. 

Determination of resistance level is expressed by resistance index (IR), based upon 

all morphological parameters of the population Amaranthus retroflexus L. From the studied 

localities. Values of the studied parameters after use of nicosulfuron are presented in Table 

1, and after application of imazethapyr in Table 2. 

Based upon resistance indecies of all measured parameters, high susceptibility of 

populations from all of the studied localities to the herbicide nicosulfuron, with IR lower 

than 1, became obvious.


Table 1. Indecies of resistance parameters of weed species Amaranthus retroflexus L. after 

nicosulfuron treatment 

Resistance indecies (IR) 

Locality 

Measured parameters 

Epicotyl Hypocotyl Stem height Foliage fresh weight 

Krivaja 2.92 1.90 1.53 1.29 

Kikinda 1.21 1.24 2.95 0.59 

Bečej 0.89 0.77 18.05 1.43 

Kačarevo 0.75 0.99 0.10 1.53 

Carnex 0.49 0.69 0.18 0.45 

Sava Kovačević 0.33 0.55 0.13 0.52 

Table 2. Indecis of resistance parameters of weed species Amaranthus retroflexus L. after 

imazethapyr treatment 

Resistance indecies (IR) 

Locality 

Measured parameters 

Epicotyl Hypocotyl Stem height Foliage fresh weight 

Krivaja 1.8 1.61 2.0 2.27 

Kikinda 1.0 0.8 0.9 0.53 

Bečej 1.0 1.0 1.0 0.99 

Kačarevo 1.6 1.0 1.63 1.0 

Carnex 1.5 1.0 1.25 1.0 

Sava Kovačević 0.7 1.0 1.50 1.0 

The highest values of resistance index of the mesured parameters were established 

for population from locality Krivaja (1.0-2.27), while for Amaranthus retroflexus L. from 

localities Kikinda and Bečej values of resistance index were singificantly lower (~1). 

Based upon resistance index, it was established that the highest resistance to herbicide 

imazethapyr evolved pupulations from localities Kikinda and Kačarevo (IR epicotyl 1.6, IR stem 

height 1.63), while populations from localitie Vrbas-Sava Kovačević remained susceptible to 

the applied herbicide. Comparison between localities showed that a stastistically significant 

differences found in relation to the susceptible standard refer only to localities Krivaja and 

Kačarevo. Statistically significant differences were established also between these two 

localities. Similar results were obtained for all of the studied parameters. 

With the purpose of conducting biochemical studies of ALS activity resistance, 

whole plant studies were performed in a net-house by application with a range imazethapyr 

rates. Imazethapyr was chosen as the representative of imidazolinone and sulfometuronmethyl, 

belonging to the sulfonylurea group of herbicides. Sulfometuron-methyl is 

considered as highly aggressive herbicide that does not metabolite itself in plants, which 

was the reason of its use during analysis of ALS activity instead of nicosulfuron. 

Table 3. RI values for whole plant studies in a range of sulfometuron-methyl and imazethapyr rates 

RI values 

Sulfometuronmethymethyl 

(survived 

Sulfometuron- 

imazethapyr 

Biotype 

imazethapyr 

(relative mass) 

(relative mass) (survived plants) 

plants) 

1 Kikinda 8.95 2.78 7.46 21.38 

2 Carnex 6.36 2.78 87.68 1.69 

3 Krivaja 25.28 2.61 38.66 7.35 

4 Kačarevo 17.80 0.81 20.35 1.958 

Susceptible standard - - - -

18 Herbicides resistance of Amaranthus retroflexus L. the important weed of... 

Activity of ALS enzymes in various biotypes of weed species Amaranthus 

retroflexus L. from localities Krivaja, Kikinda, Kačarevo and Vrbas, was established upon 

acetoin rate (µg) per 1g of weight of fresh plant material within 1 h period. 

Table 4. Acetoin accumulation (µg g -1 of fresh plant weight h -1 ) of different populations of 

Amaranthus retroflexus L. after nicosulfuron application 

Biotype 

Nicosulfuron rates (g a.i./ha) 

0 40 50 80 120 160 240 

1 Kikinda 13.54 9.35 6.51 5.20 3.32 2.10 0.58 

2 Carnex 16.02 8.05 7.03 4.87 3.51 1.97 0.43 

3 Krivaja 15.41 12.70 10.24 9.63 8.02 7.22 4.50 

4 Kačarevo 13.94 10.33 9.65 8.54 7.86 6.04 3.78 

Susceptible standard 14.32 4.20 3.96 2.91 2.73 2.01 0.68 

The method is based upon acetoin rate in fresh plant weight of the plant material, 

which enables obtaining results of the evaluation of herbicide action 24h after herbicide 

use. 

In all studied biotypes in control, in which none of the herbicides were used, acetoin 

rates in fresh plant weight were high, up to 16.02, which confirmed validity of the assay 

performed according to the described method (Table 4). Increased rates of nicosulfuron 

caused reduction of acetoin rates, which is noticeable also on logarithmic dose-response 

curve, where relative activity of ALS enzyme was presented in regard to control (Graph 1). 

re la tive a c tivity o f A L e nzym e (% in re g a rd to c o n tro l) 

120 

100 

80 

60 

40 

20 

0 

0.01 0.1 1 

Kikinda 

Carnex 

Krivaja 

Kacarevo 

Susceptible standard 

nicosulfuron rates (g a.i./ha) 

Graph 1. Activity of ALS enzyme after application with a range of nicosulfuron rates


Activity of ALS enzymes proved statistically highly different in biotypes from 

localities Krivaja and Kačarevo, after treatment with a range of nicosulfuron rates (Table 5). 

Table 5. Significant differences between various populations and susceptible standard treated by 

nicosulfuron 

Biotype 

ALS enzyme 

activiry 

Kikinda-S 

I.D. 

Carnex-S 

I.D. 

Krivaja-S * 

Kačarevo-S * 

p

20 Alien invader plants in South Africa: Management and challenges 

International Symposium: Current Trends in Plant Protection UDK: 574(680) 

Procedings 502.17(680) 

ALIEN INVADER PLANTS IN SOUTH AFRICA: MANAGEMENT 

AND CHALLENGES 

CARL REINHARDT 

Department of Plant Production and Soil Science, University of Pretoria, South Africa, 

dr.charlie.reinhardt@gmail.com 

Invasive alien plants impact negatively on agriculture, forestry, natural ecosystems, human 

health, and biodiversity. These global threats also apply to South Africa, which basically is a waterstressed 

country that cannot afford wastage of water by any means, least of all through alien invasive 

plants. The level of understanding of the origins, biology, ecology, and impacts of alien invasive 

plants is high for certain species but for many others the knowledge that matters is either at a low 

level or non-existent. Human activities have contributed much to the general problem, especially 

through injudicious practices such as deliberate introduction of foreign species, crop production in 

marginal areas that are prone to soil erosion, overgrazing of grassland, mining activities that disrupt 

or destroy ecosystems, etc. Negative impacts of alien invasive plants that drive control efforts include 

the aggressive nature of many species, disruption and displacement of native biodiversity, water 

conservation, fire intensity, and soil stability. Research on the control of invasive plants is mainly 

focused on biological control by means of natural enemies (mainly insects, and some pathogens) that 

are procured in countries from where the plants originated. Chemical control involving herbicides is 

in many cases arguably the best option for adequate control but there are real or perceived risks of 

environmental pollution and non-selectivity of herbicides that need to be considered. Political support 

in the country for the management of alien invasive plants is considerable in the form of policies, 

legislation and control programmes. Conflicts of interest sometimes arise because of the usefulness of 

certain species (e.g. sources of fruit, animal feed, firewood, building material, etc), and due to the 

perception of people that plants in general do more good than harm. Opposition of this kind can 

complicate strategies for the effective and sustainable management of invasive alien species. 

Key words: alien, invader, plants, South Africa, 

INTRODUCTION 

In South Africa there are three distinct vegetation types: (1) the southern fynbos 

(shrubland or heathland within areas with a Mediterranean climate) and forest of the winter 

rainfall region; (2) the northern tropical forest, savannah and grassland of the summer 

rainfall region; (3) the Karoo that developed between the afore-mentioned floras, and is 

characterized by semi-desert to near-desert conditions (rainfall of less than 250 mm per 

annum). Irrespective of the eastern side of the country being wetter than the drier central 

and western parts (Acocks, 1988), all vegetation types and regions of the country are prone 

to invasion by a wide variety of alien plant species, which thanks to peculiar adaptive 

abilities and growth habits, can thrive in diverse environments. Indigenous plant

Carl Reinhardt 21 

communities that are particularly susceptible to invasion by alien plants are those where 

deterioration of the environment has occurred, either due to human activities, e.g. farming, 

mining, road-building, or as a result of natural events such as floods or soil erosion caused 

by water or wind. 

Climatic changes that occurred over periods of tens of thousands, or hundreds of 

thousands of years probably caused changes in the composition and distribution of the basic 

vegetation types of South Africa. But the changes that have been observed in the last 100 to 

150 years are considered far too great to be attributed to only fluctuations of climate that 

apparently occur with a periodicity of about 200 years (Brooks, 1926; Acocks, 1988). It is 

generally accepted that crop and animal production have been the main causes of the rapid 

deterioration in vegetation type, species abundance and biodiversity that have been 

experienced on the sub-continent in recent times (c. 1920-2010). This happened despite the 

fact that, in comparison to Europe, human pressure on the environment of the sub-continent 

of Africa started late because farming with crops and livestock only intensified to a marked 

extent after colonization by Europeans, which started in 1652 with a small Dutch settlement 

around Cape Town at the southernmost tip of the country. Degradation of natural 

vegetation escalated with the introduction in the 1920s of the tractor which revolutionized 

row-crop production. Extensive, indiscriminate tillage of soil and the keeping of large herds 

of livestock put great pressure on the tropical grasses, which through ploughing and/or 

over-grazing caused the soil across vast tracts of land to become denuded of vegetation that 

gave protection against wind and water erosion. Reduction and elimination of the grass 

component lead to the development of bare areas (devoid of vegetation) which creates an 

ideal environment for the establishment of pioneer plant species such as weeds, in 

particular alien invasive species. Another consequence of the degradation of grassland is 

reduction of natural fuel (grass biomass) needed for hot fires which is important for 

preventing the woody component of the savannah from becoming unnaturally dense. This 

phenomenon whereby indigenous woody types become overly dense is known as 

“densification” or “bush encroachment”. Such species are the target of plant control 

programmes that, in terms of effort and cost, can easily match those on alien invasive 

species. Management of bush encroachment is mostly done by private landowners who 

seek to provide as wide a variety of plant species as possible for wild animals and livestock 

to feed on. Farming with wild animals has developed into an important industry in South 

Africa, to such an extent that in certain regions it can rival livestock production as regards 

profitability. 

The mechanisms through which alien invasive plants are able to displace native 

species and thrive in foreign environments at the latter’s expense are well documented (van 

Andel, 2005; Knapp and Kühn, 2012), and therefore, it is not discussed in any depth here. 

Instead, the overview given here will deal with those alien plants that are considered the 

most noxious under South African conditions, their impacts and how they are controlled – 

in certain instances successfully and in others not adequately, or not all. Although the 

impacts of alien plants differ from species to species and according to the habitat in which 

they occur, their impacts can be generalized as follows: reduction in biodiversity; 

displacement and even extinction of indigenous species; reduction in productivity of natural 

grazing; reduction in land value; promotes soil erosion; loss of water; economic loss; 

promotes diseases such as malaria and bilharzia. Despite it having regions that receive 1000 

to 2000 mm rain per annum, South Africa is for the greater part a water-stressed country. 

Most regions receive


is closely linked to soil moisture content, is a major factor governing inter-species 

interference. The other factor involved in inter-species interference is allelopathy, thus 

interference = competition + allelopathy. Few competition studies involving alien invader 

plants have been done in South Africa, and to date even less research has been done on the 

allelopathic potential of these species (Van der Laan et al., 2008; Belz et al., 2009). In 

contrast, considerable research has been done on biological control (Moran et al., 2011) and 

water-use (water-wastage!) by alien invasive plants (Versveld et al., 1998). 

POLICY BACKGROUND 

The first national policy and legislative instrument that directly addressed the 

management of invasive plants in South Africa came about under the Conservation of 

Agricultural Resources Act [(CARA)] Act 43 of 1983, amended in 2001). Regulations under this 

act classify 368 species as declared weeds and alien invasive plants, and stipulate that they must 

be controlled to certain degrees based on their problem status (Bromilow, 2010). Based on the 

1983 regulations, 57 alien plants were declared “noxious weeds” that must be controlled where 

they occur, and their spread had to be prevented. In 2001, the list of noxious weeds was 

expanded to include 198 species. From then on weeds were classified into three categories: (1) 

weeds of no value – control is required and trade is banned; (2) recognized weeds that have 

commercial value – permits are required for their cultivation, and trade in plants and products is 

permitted (e.g. fruit and forestry species); and (3) recognized weeds that have ornamental but no 

commercial value – permits are needed to keep them, but further cultivation and sales are 

prohibited. A more recent development is the National Environment Management: Biodiversity 

Act (NEMBA] Act 10 of 2004) that is in the process of being finalized, and will probably 

introduce similar categories which will complement those of CARA. 

ORIGINS AND IMPACTS OF INVASIVE ALIEN PLANTS 

About 50% of the 316 alien invasive species in South Africa originated in South, 

Central and Tropical America, about 25% came from Europe, Asia and the Mediterranean, 

and about 13% from Australia (Moran et al., 2011). Because South Africa’s indigenous 

plant species (approx. 27000) far outnumber the exotic or alien types, it may appear as if 

the latter species could not have a large influence on the natural (indigenous) vegetation. In 

fact, the impacts on natural vegetation are often environment (soil and rainfall) and speciesspecific, 

in that certain alien plants cause significant direct and/or indirect damage to 

particular natural plant communities in certain locations. Certainly, the level of infestation 

that an alien invasive species has attained at a given point in time will also play an 

important role with regard to impact – high infestation levels and high impact usually takes 

considerable time to develop, depending on the adaptability of the invader and the 

resistance against invasion put up by the threatened native vegetation. Low infestation 

levels of an alien invader plant could be indicative of it experiencing resistance (interspecies 

interference) from the native species, but on the other hand, low numbers of the 

alien species may signify recent infestation which may or may not escalate over time. 

The alien weed problem in South Africa is characterized by a high proportion of 

woody species, most of which were introduced for good reasons such as stabilization of 

sand dunes (Acacia spp from Australia), commercial forestry (Acacia spp and Eucalyptyus 

spp from Australia, and Pinus spp from North America and Europe), agroforestry (e.g. 

Prosopis spp from Texas, USA), horticulture (e.g. Jacaranda mimosifolia from South


America, Melia azedarach from India, and Lantana camara from many parts of the 

tropics), and fruit production (e.g. Psidium guajava and Opuntia ficus-indica). Same as for 

many other alien invader species, all the afore-mentioned species have already become 

naturalized in South Africa, and therefore, control measures can only hope to maintain their 

levels below the “economic threshold” that can be set with regard to economic and 

environmental impact. Predicting the further spread of already naturalized alien species is 

an important science in South Africa (Hui et al., 2011). The Southern African Plant 

Invaders Atlas (SAPIA) project has as its focus the recording of alien plant distribution and 

the identification of “emerging” or “dormant” species that have the potential to attain 

problem status (Henderson, 2011). South Africa became Party to the Convention on 

Biodiversity in November 1995. South Africa is increasingly involved in solving alien plant 

problems in the rest of Africa, and there have been and still are many collaborative projects 

with countries in various parts of the world, notably on the exchange of organisms or agents 

for biocontrol. Most of the research focused on the control of alien invasive plants in South 

Africa has been on biological control which exploits a plant’s natural enemies as means for 

control (Moran et al., 2011). Failure of biocontrol agents to adapt to environments in which 

they are introduced has proved to be a major stumbling block, and recent research has 

shown that morphological traits and the biochemical profile of target plants can play 

important roles (Ghebremariam et al., 2012). Research on chemical control methods are 

virtually exclusively done by chemical companies in the process of registering herbicides. 

Use of herbicides gets a lot of opposition, rightly or wrongly, from those concerned about 

risks of environmental pollution. Considerably less effort has thus far gone into researching 

the biology and ecology of alien invader species, and rarely is the combined use of different 

methods of control (IWM) employed. In fact, there is the perception that proponents of 

biological control are averse to the use of herbicides, or at least regards chemical control as 

a threat to the success of biological control efforts. The reason for this perception is that 

biocontrol agents (insects, pathogens), which invariably are 100% host-specific, require live 

plants as hosts and herbicides are meant to kill those very plants. Since 1996 there exists a 

national Working for Water programme that seeks to provide all South Africans with 

readily available and sufficient potable water, and hence, the programme has at its core the 

control of alien plants that constitute a risk to water resources (van Wilgen, 2012). About 

7% (3300 million m 3 ) of South Africa’s mean annual water runoff is lost through 

transpiration of woody alien species that have invaded water catchments, riparian zones and 

wetlands (Versveld et al., 1998). Ten alien aquatic weeds also contribute to water loss from 

surface waters (rivers, lakes, reservoirs). Other important driving forces behind the 

Working for Water programme is job creation through involving local people in the control 

of alien plants, as well as the realization that controlling alien plants is more cost-effective 

than building new water reservoirs. 

KRUGER NATIONAL PARK: EXAMPLE OF A CONSERVATION AREA 

THREATENED BY INVASIVE ALIEN PLANTS 

The development and management of strategies for the control of those alien species 

that cause negative impacts is one of the major tasks of managers in many protected areas. 

The management of invasive alien plants in South Africa’s Kruger National Park (area: 

20000 km 2 ) has been supported by research that includes: studies on the determinants and 

dynamics of spread of key species (Foxcroft et al., 2008), examination of the importance of


issues pertaining to spatial scale in designing management plans (Foxcroft et al., 2009), and 

the effectiveness of the park boundary as a filter for invasive species (Foxcroft et al., 2011). 

Alien invasive species in KNP (top 28 arranged in descending order of abundance) 

Opuntia stricta 

Ageratum spp. 

Lantana camara 

Ricinus communis 

Opuntia spp. 

Argemone mexicana 

Chromolaena odorata 

Catharanthus roseus 

Pistia stratiotes 

Arundo donax 

Parthenium hysterophorus 

Datura inoxia 

Eichhornia crassipes 

Datura stramonium 

Xanthium strumarium 

Ageratum conyzoides 

Azolla filiculoides 

Melia azedarach 

Argemone spp. 

Senna occidentalis 

Senna spp. 

Datura ferox 

Xanthium spp. 

Zinnia peruviana 

Nicotiana glauca 

Cardiospermum halicacabum 

Psidium guajava 

Argemone ochroleuca 

Fig. 1. – Mean annual river run off in Kruger National Park (KNP), 

pattern of non-native plant records relative to KNP boundary and segments (lower left inset), 

and location of KNP within South Africa – upper left inset (from Foxcroft et al., 2010).


CONCERNS REGARDING THE CONTROL OF INVASIVE ALIEN SPECIES 

In South Africa, an important obstacle to efforts for controlling alien invasive 

species is the issue of conflicts of interest which arise when an alien invader plant has some 

or other useful purpose (e.g. wood for fuel and building material, fruits as food, plants as 

fodder, etc). Many encourage the use of alien plants for small business enterprises (e.g. 

charcoal, fruit, wood fuel, furniture, ornaments, etc), whereas others believe that promotion 

of such uses will only perpetuate the problem. According to van Wilgen (2012), other 

concerns that often are raised as arguments against the wholesale destruction of alien 

invasive populations include the following: (1) the perception that forest cover in general is 

the best way of protecting soil against erosion, and ensures sustained water flow from 

catchments; (2) habitat destruction through removal of alien plants is regarded as further 

damage to ecosystems already under stress; (3) some alien plants are aesthetically pleasing 

and are enjoyed by people for recreational purposes, especially where trees are rare; (4) the 

removal of vegetation, trees in particular, is seen by many as counter-intuitive in light of 

growing awareness of global war333ming and its mitigating factors, such as carbon 

sequestration in plants and soil. 

REFERENCES 

Acocks, J. P. H. (1988): Veld types of South Africa. In: O.A. Leistner (ed). Memoirs of the 

Botanical Society of South Africa No. 57 (3 rd edn,). Botanical Research Institute, South 

Africa. 

Belz, R. G., Van der Laan, M., Reinhardt, C. F., Hurle, K. (2009): Soil degradation of parthenin 

– does it contradict the role of allelopathy in the invasive weed Parthenium 

hysterophorus? Journal Chemical Ecology, 35, 1137-1150. 

Bromilow, C. (2010): Problem plants and alien invader weeds of South Africa. Briza 

Publications, Pretoria, South Africa. 

Brooks, C. E. P. (1926): Climate through the ages. Benn, London. 

Foxcroft, L. C., Jarosˇic, V., Pysˇek, P., Richardson, D. M., Rouget, M. (2011): Protected-area 

boundaries as filters of plant invasions. Conservation Biology, 25, 400-405. 

Foxcroft, L.C., Richardson, D. M., Wilson, J. R. U. (2008): Ornamental plants as invasive 

aliens: problems and solutions in the Kruger National Park, South Africa. Environmental 

Management, 41, 32–51. 

Foxcroft, L. C., Richardson, D. M., Rouget, M., MacFadyen, S. (2009): Patterns of alien plant 

distribution at multiple spatial scales in a large national park: implications for ecology, 

management and monitoring. Diversity and Distributions, 15, 367–378. 

Ghebremariam, T., Reinhardt, C. F., Krüger, K. (2012): Unpublished research from a PhD study 

conducted in the Department of Entomology and Zoology, University of Pretoria, South 

Africa. 

Henderson, L. (2011): Mapping of invasive alien plants: the contribution of the Southern 

African Plant Invaders Atlas (SAPIA) to biological weed control. African Entomology, 

19, 498-503. 

Hui, C., Foxcroft, L. C., Richardson, D. M., MacFadyen, S. (2011): Defining optimal sampling 

effort for large-scale monitoring of invasive alien plants: a Bayesian method for 

estimating 1abundance and distribution. Journal of Applied Ecology, 48, 768-776. 

Knapp, S., Kühn, I. (2012): Origin matters: widely distributed native and non-native species 

benefit from different functional traits. Ecology Letters, 15, 696-703.


Moran, V. C., Hoffmann, J. H., Hill, M. P. (2011): A context for the 2011 compilation of 

reviews on the biological control of invasive alien plants in South Africa. African 

Entomology, 19, 177-185. 

Van Andel, J. (2005): Species interactions structuring plant communities. In: E. van der Maarel 

(ed.). Vegetation ecology. Blackwell Science Ltd, UK. 

Van der Laan, M., Reinhardt, C. F., Belz, R. G., Truter, W. F., Foxcroft, L. C., Hurle, K. (2008): 

Interference potential of the perennial grasses Eragrostis curvula, Panicum maximum 

and Digitaria eriantha with Parthenium hysterophorus. Tropical Grasslands, 42, 88-95. 

Van Wilgen, B. (2012): Evidence, perceptions, and trade-offs associated with invasive alien 

plant control in the Table Mountain National Park, South Africa. Ecology and Society, 

17, 23-37. 

Versveld, D. B., Le Maitre, D. C., Chapman, R. A. (1998): Alien invading plants and water 

resources in South Africa: A preliminary assessment. WRC Report no. TT 99/98, CSIR 

Division of Water, Environmentvand Forestry Technology, Stellenbosch, South Africa.

Goran Anačkov, Slobodan Bojčić, Vladimir Ječmenica,... 27 

International Symposium: Current Trends in Plant Protection UDK: 632.51:582.988.1(497.113) 

Proceedings 

MORPHOLOGICAL VARIABILITY OF INVASIVE SPECIES 

AMBROSIA ARTEMISIIFOLIA L. (ASTERALES, ASTERACEAE) 

ON THE IMPORTANT TRANSIT AREAS 

GORAN ANAČKOV, SLOBODAN BOJČIĆ, VLADIMIR JEČMENICA, MILICA RAT, RUŽICA IGIĆ, 

PAL BOŽA 

University of Novi Sad, Faculty of Sciences, Department of biology and ecology 

mail: goran.anackov@dbe.uns.ac.rs 

Investigations and distribution monitoring of invasive species in Vojvodina are mainly based 

on the degree of natural and agricultural ecosystems decreasing by invasive alien plants. The studies 

that are omitted are biology of alien species, their adaptive mechanisms and physiology in order to 

find answers related to their accomplishments on the new habitat. For those reasons, samples in this 

study were taken from different habitat types to get final data about mechanical treatment as a tool for 

eradication of Ambrosia artemisiifolia L., depending on different habitats type, and to provide data 

for developing of effective measurements. The results are analyzed by descriptive and multivariate 

statistics. Conducted investigations have shown that in some, especially the poorer soil types, species 

A. artemisiifolia shows extraordinary capabilities of adaptation in terms of survival and biomass 

production. 

Key words: invasive species, common ragweed, adaptation, phenotypic plasticity, 

INTRODUCTION 

As one of the most interesting evolutionary mechanisms, it is considered a form of 

adaptive differentiation and in accordance with that natural selection (Schulter, 2000). The 

fact is that selection pressure in the natural environment affects many levers of adaptive 

radiation and allows normal historical changes in the ecosystem units, occurrence of 

adaptation, specialization and phenotypic neo-speciation (Takhtajan, 1991). Invasive 

species have ability to accelerate certain processes, characterized by adaptive mechanism, 

and soon they become members of the phytocoenological structure in new habitats. At that 

moment they begin to modify it, causing destructive changes and finally its extinction 

(Myers and Bazely, 2003). Such changes are part of the essential biological transformations 

and they present the basis for the observation of genetic diversity, which explains their 

adaptive divergence. One of the mechanisms is multiple introductions of species in new 

habitats as well as mixing of primary and secondary introduced populations that enriches 

the genetic composition. In this way remarkable adaptability and evolutionary advantages 

that have invasive species is created. One of them is certainly Ambrosia artemisiifolia, 

which in its history shows all the elements of the genetic basis for the successful 

propagation range (Jin Chunet al., 2011).

28 Morpfological variability of invasive species ambrosia artemisiifolia L.,... 

In Vojvodina, 147 invasive plant species have been identified (IASV, 2011). 

Invasive alien species (IAS) develop specific adaptation mechanisms to the ecological 

conditions in new conquered habitats. In this way, stable populations are established, and 

they are the centers of species spreading to the natural habitats and surrounding nonnative 

ecosystems (agro-ecosystems). The degradation of habitats enables invasive alien plants 

spreading and naturalizations, and in the same time they disturb the ecological balance of 

ecosystems. Invasive nature of these plants is result of their high adaptability, absence of 

natural enemies and easy adaptability to sudden changes in the general environmental 

conditions (Jaric, 2009). 

In the Serbia during last centuries three Ambrosia species were recorded: Ambrosia 

artemisiifolia L. 1753 (common ragweed), A. trifida L. 1753 (giant ragweed) and A. 

tenuifolia Spreng. 1826 (field ragweed). Common ragweed is only species which is 

naturalized in nature, and giant ragweed is in the adaptation phase. Field ragweed was 

recorded only once, in 1995 th in the wider area of Novi Sad, near rail station (Boža, 2002). 

For this record herbarium sheets exists in Herbarium BUNS, but after this data, no more 

data were provided, so it can be concluded that it was just one accidentally introducing of 

the seeds. 

A. artemisiifolia L. is one of the most invasive alien plants distributed in Europe. 

Ragweed is introduced in a botanical garden as a cultivated species in the mid XVIII 

century. In the 1880 it was detected in natural habitats in two districts, and in 2004 in 63 

districts in France (Dessaint et al., 2005). Today, regions with the most abundant 

populations of ragweed in Europe are Valley Roneu in France, northern Italy and the 

Pannonian plain (Juhász, 1998). In Vojvodina, ragweed inhabits mostly ruderal places. 

Common ragweed is introduced in the northern part of Serbia at the beginning of the 

twentieth century, although the first records dates from 1953 (Slavnić, 1953). Ten years 

earlier was noted for the first time in neighboring Croatia (Galzina et al., 2010). From 

entering in the Pannonian part of Serbia to the first data recording, common ragweed has 

succeeded in overcoming the initial adaptation and began spreading extensively. As a 

pioneer plant, common ragweed occurs along the roads, railroads, abandoned places, 

wastes, but also as a weed of small grains, row crops, orchards and vineyards (Boža, 2011). 

Recently, it is expanded into the closed phytocenoses and grasslands, especially in arid 

areas (Sărăteanu et al., 2010), such are majority in Vojvodina. In this way, ragweed has 

become almost obligatory member of vegetation in the natural habitats and present a threat 

to the habitats such are steppes on loess and sand and saline grasslands. In forest 

ecosystems is not present, except in the planted forests of alien species black locust and 

poplar forests, where it may survive and develop stabile populations (Boža et al. 2002). The 

problem of ragweed massive presence is also its influence on human health. Ragweed 

pollen is one of the most dangerous allergens in the air for the man, which can cause 

diseases such as asthma, rhinitis and conjunctivitis. Additionally, ragweed is contact 

allergenic plant, which causes local changes on the skin (Igić and Boža, 2012). 

Intensive agricultural production in the Pannonian basin is primarily consequence by 

quality of pedological substrate. However, the area is opened for the spreading of alien 

species. Given that the land is constantly treated and refined for the cultivation, this 

situation and organic component of the substrate correspond to the initial expansion of 

invasive weed species. For these reasons, the treated areas (agricultural sites) are one of the 

main centers for spreading of invasive species. 

Problems with invasive species and their control are not new. Investigations and 

distribution monitoring of invasive species in Vojvodina are mainly based on the degree of 

natural and agricultural ecosystems deficiency by invasive alien plants. Should not be


ignored the fact that new species in the newly conquered habitats have no natural enemies 

of an IAP. Most of these species belongs to the group of an allergen plants, and prevent 

actions for the timely removal of them for reducing higher concentrations of pollen in the 

air are founded every year. Biological and mechanical control methods are the primary 

models for struggle with invasive species in natural and urban ecosystems (Wittenberg and 

Cock, 2001). Significant resources are spent on their removal, however, insufficient for the 

study of their invasive nature. One reason for the unsuccessful struggle should be sought in 

uneven prevention methodologies in Europe, as well in the absence of any treatment in 

certain regions (Gerber et al., 2011). Combine methods of mechanical and chemical 

treatments do not show significant changes compared to the purely mechanical treatment. 

Successively mowing has the effect in natural habitats, but much higher in controlled 

conditions (Holst, 2009). The problem is the individual capacity of local populations and 

the size of the adaptive response to current environmental impacts. This is a consequence of 

the previously mentioned genetic basis of adaptive potential. The local ragweed populations 

have the ability to adapt quickly, even if a several ragweed species grow in the same area 

(Fernández-Lamazareset al., 2012). Additionally, it is necessary to conduct studies that are 

aimed to establish long-term strategy and efficient destruction mechanism of such species. 

In accordance with these objectives were set the goals for this work: to determine the pace 

of growth and production of invasive species A. artemisiifolia L. on different substrates 

correlated with the method of mechanical removal of plants. 


Plant material was collected at three localities in Vojvodina, in Novi Sad (Fig. 1, 

Table 1). Selection of sites was made on the basis of experience in dealing with the species 

habitats. For A. artemisiifolia, typical ruderal habitat types and locations were selected in 

urban settlements. A total of 90 plants samples were taken, with 30 samples from each site. 

Stable populations were chosen, with a significant number of individuals that are 

successfully developed at that locality. The second character for the site selection was 

pedological substrate and each population is characterized by pedological individuality 

(Table 1). 

All the measurements for analyzed characteristics were carried out at the stage of 

full flowering. Measurements were performed in the sites, after which the plants were cut at 

the height of 30 cm, and the measurements were repeated after 30 days. Leaf area is 

measured in the laboratory. Plants were labeled with standard signs of operational 

taxonomic units (OTU). Material was deposited in the taxonomic collection in the 

Herbarium BUNS at the Department of Biology and Ecology, Faculty of Sciences, 

University of Novi Sad. Leaves taken from plants are also marked with OTU compatible 

units. 

Table 1: Localities of sampled material 

Locality Substrate characters GPS coordinates 

Novi Sad sand 45 o 15'59.58"SGŠ 19 o 51'47.34"IGD 

Novi Sad clay-sand 45 o 16'28.97"SGŠ 19 o 50'34.62"IGD 

Novi Sad construction material 45 o 14'52.44"SGŠ 19 o 47'06.23"IGD


Figure 1: Localities of sampled material, cadastral map of Novi Sad city 

(Public Enterprise for City Construction and Development, modified) 

Field measurements were performed by standard measuring instruments and 

floating-gauged measurement tool with the precision level 0.01. Leaf area was measured 

using LI-COR Bioscientific portable leaf area meter, model LI-3000. 

Analyzed characters were selected based on diagnosis taken from floras from 

species native range (Flora of North America, 2008) and species allochthonous range 

(Gajic, 1975; Vasic, 1986). Characters are grouped according to plant regions (Tables 2, 3: 

Fig. 2). After mechanical treatment, characters related to the pollen production were 

observed. 

All data from the field/laboratory protocols are synthesized into an electronic 

database created in MS software, Microsoft Excel 2007 for Windows. Data were analyzed 

by descriptive, parametric and multivariate analysis in software package Statistica for 

Windows ver. 10 (StatSoft, Inc., 2011).


Table 2: Morphological characters measured before mechanical treatment 

Plant organe 

Stem 

Leaf 

Inflorescence 

Characters 

Height 

Noduse position 

First internode length 

Middle internode length 

Terminal internode length 

Node with first branch 

Node with first fertile branch 

Total number 

Area 

Total number 

Terminal inflorescence length 

Length of lateral inflorescences 1 

Length of lateral inflorescences 2 

Figure 2: Elements of morphometric analysis before mechanical treatment: 1. terminal inflorescence 

length; 2. lateral inflorescence length D1, 3. lateral inflorescence length L2; 4a. terminal internode 

length; 4b. middle internode length; 4c. first internode length; 5. node with the first fertile branch; 6. 

central leaf; 7. node with the first branch; 8. height (modified from Flora of North America, 2008) 

Table 3: Analyzed morphological characters after mechanical treatment 

Plant organe 

Stem 

Character 

Node with first branch 

Node with first fertile branch


RESULTS 

Results of descriptive statistical analysis for 13 quantitative characters of A. 

artemisiifolia showed high variability for most of the characters. The characteristics of 

importance for the interpretation of biological production and biomass formation were stem 

height (SH) and middle leaf area (MLA) (Table 4). 

Stem height processed by descriptive statistics showed that data from population on 

clay-sand varies within the temperate zone with coefficient of 11.17%. Pronounced 

variability for same character inside temperate zone is obtained for the data from population 

on construction sites, with a coefficient of variation 18.48%. For the MLA variability is 

obtained inside temperate zone for populations on sand and clay-sand, while the population 

from construction sites is characterized by expressed variability of 39.69%, higher than the 

value of standard deviation and has a significantly higher mean value 22.18 cm 2 (Fig. 3). 

Values obtained by descriptive statistics for all three populations, clearly indicate moderate 

variability of character stem height (16.43%), while expressed variability of MLA (39.71%) 

indicate the minimum and maximum values (Fig. 4). These characters are one of the main 

levers of species invasiveness poll and of particular importance is their inter-population 

stability. 

Figure 3: Basic statistical parameters for the characters stem height and middle leaf area from 

different pedological substrates A: Population on sand; B: Population on construction sites; 

C: Population on clay-sand. 

Figure 4: Summary of descriptive statistics for characters stem height and middle leaf area


The character ‘total number of inflorescences before cutting’ (TNIBC) analyzed by 

descriptive statistics indicate pronounced variation for two populations, and the coefficient 

of variation (40.41%) is significantly high in the population sampled at construction sites 

(Fig. 5). The coefficient of variation for the character ‘total number of inflorescences after 

cutting' (TNIAC) in all three populations are more than 30%, although smaller variation of 

the analyzed character is noticed in populations from clay-sand (Fig. 6, Tab. 4). 

Figure 5: Basic statistical parameters for the characters ‘total number of inflorescences’ before 

and after cutting. A: Population on clay-sand; B: Population on construction site; 

C: Population on sand. 

Figure 6: A summary of descriptive statistics for the character ‘total number of 

inflorescences’ before and after cutting. 

Table 4: Coefficient of variation for selected morphological characters of A.artemisiifolia 

Stem height 

Middle leaf 

area 

Inflorescence no. 

before treatment 

Inflorescence no. 

after treatment 

Population on 

sand 

11,82% 19,18% 33,06% 82,14% 

Population on 

constructed site 

18,48% 39,69% 40,41% 65,71% 

Population on 

clay-sand 

11,17% 18,04% 26,81% 87,56% 

All populatins 16,42% 39,71% 34,32% 78,98%


Using multivariate statistical method of discriminant analysis, a priori defined 

populations of common ragweed are tested. Compared to the first discriminant axis (75% 

sample variability) populations on clay-sand and construction site were separated, but the 

population on the natural soil (sand) has considerably more uniform characteristics. 

According to characters that define the variability on the second axis, population on sand is 

partially separated (Fig. 7). Characters that contribute most to discrimination are SH and 

leaves number, which follows the previous character, as well as total number of 

inflorescences. In relation to these characteristics the first two populations are significantly 

different. Besides characters by which the separation is performed on first axis, to partial 

separation of individuals on the second axis contributes characters number of nodes and 

length of terminal and lateral inflorescences (Table 5). 

Figure 7: Positions of analyzed individuals in the area of the first two discriminant axes, (blue: 

sand; red: construction site; green: clay-sand) 

Table 5: Load levels for quantitative characters of analyzed A. artemisiifolia populations 

character DA 1 DA 2 

Stem height (cm) -1.03294 1.29487 

The number of stem nodes 0.45887 -1.04201 

First internode length (cm) -0.30352 0.21460 

Middle internode length (cm) 0.31373 0.48901 

Terminal internode length (cm) -0.07362 -0.03511 

Node with first branch 0.15064 -0.13993 

Node with first fertile branch 0.45483 -0.46194 

The number of leaves -1.22594 -1.10257 

Middle leaf area (cm 2 ) -0.33375 0.05487 

Total number of inflorescences 1.28461 0.11636 

Terminal inflorescence length (cm) 0.29838 1.10207 

Length of lateral inflorescences 1 (cm) 0.54342 -0.13671 

Length of lateral inflorescences 2 (cm) -0.02151 -0.92707 

characteristic value 3.35724 1.10494 

cumulative effect 0.75238 1.00000


Figure 8: Correlation between characters ‘node with first fertile branches’ before (green) and 

after (red) mechanical treatment 

Character ‘node with first fertile branch’ showed a significant depending on the 

substrate type. Plants from populations with arid ground (sand), fertile branches formed on 

the second or third nodes before mechanical treatment, while after the treatment node with 

first fertile branches is significantly higher. Population from clay-sand, which is 

characterized by increased level of humidity, fertile branches have appeared at an extremely 

high nodes, while after the mechanical treatment they were significantly lower (third node), 

or even in some cases on ground node (Fig. 8). 

DISCUSSION 

Conducted investigations have shown that at some, especially the poorer soil types, 

species A. artemisiifolia shows an extraordinary capability of adaptation in terms of 

survival and biomass production. The results indicate that stem height is a more or less 

stable character while leaf area has an intense variability (Table 4). Favoring the character 

leaf area is a way of adjusting to environmental conditions, with strategy of faster 

completion of the life cycle and propagulume production in conditions of temperatecontinental 

climate with arid character, then a character that indicates the quality of the 

habitat. Substrate characteristics enabled the preference of the character leaf area and 

stability of character stem height, since compared to the poorer substrate characters are 

significantly different (Fig. 5, 6). These features have undergone changes comparing to 

provide data (Fig. 6, 10) in the indigenous floras (Flora of North America, 2008 el. Ver.) 

and floras for allochthonous region (Gajic, 1975; Vasic, 1986). Populations’ individuality 

are confirmed by data obtained by discriminant analysis for the combination of 

morphometric and meristic characters. These characteristics are variable because they are 

not polygenic determined and they are conditioned by various environmental factors. The 

common response of the population has been confirmed by a priori classification, which is 

reflected in discriminant analysis in the compactness of population scores for each 

population individually (Fig. 7, 13). Characters that significantly contribute to such 

populations’ distribution in both cases are almost the same. Stem height is responsible for 

the associativity of population scores, because it has a low intra-population and pronounced


inter-population variability. Character leaf area is associated with the nutrients amount and 

substrate moisture. 

The characteristics of inflorescence region were used for the interpretation of pollen 

and propagulumes production. Analyzed results have more expressed variability in 

comparison to characteristics of the vegetative organs (Table 5, 7). Their effect on the total 

variability and segregation of populations are significantly reduced due to increased interpopulation 

variation (Table 4, 6). Regardless to the substrate nature, nutrient amount, 

locality, even the species, the character inflorescence number is highly variable (Table 4, 6) 

and have a significant loading degree in populations differentiation (Fig. 7). The high 

variability of the generative organs was obtained only for characters such as inflorescence 

number, inflorescence length, etc. Variability is not related to the generative region sensu 

stricto (flower and fruit characters), but to inflorescence. The inflorescence organization 

contributes to the development of a large number of stamens and fruits. 

Model of mechanical treatments as a method for removing of potentially allergenic 

species is generally accepted, but the justification is often discussed (Host, 2009). The 

results of corresponding analysis prove justification of this method. Mechanical removal of 

ragweed - cutting at the correct height before initial development of generative buds 

significantly reduces the development of flowers and pollen (Boža et al., 2006). Values for 

characters inflorescence number, length and position obtained after mechanical treatment, 

are also different. The inflorescence variability was confirmed and after mechanical 

treatment. After removing of fertile branch retains the high variability of the inflorescence 

characters, which point to the conclusion that this is a characteristic of this plant group. 

Increased variability after treatment is the result of the plants individuality in order to solve 

the problem of propagulume production. The position of nodes, where the first fertile 

branch is developed after mechanical treatment is also characteristic that allows a high 

degree of individual plants variability. This feature is part of their strategy that allows 

creations of individuality with aim to overcome emerging environmental conditions in 

nature. 

Increased/decreased variability of certain characters analyzed in this paper provides 

a better understanding of the nature of common ragweed in the area of the Pannonian plain. 

Of particular interest is information related to the mechanical removal and achieved effects. 

The individuality which is shown in this study, in response to the soil content and 

especially at the post-mechanical development of fertile branches, indicates significant 

changes in strategy against this model of adaptation of invasive plant species, favoring 

methods that are characterized with more intensive and better-formed prior to the 

monitoring mechanical treatment. 

REFERENCE 

Boža, P. (2011): Taxon: Ambrosia artemisiifolia L. 1753. [20 July 2012]. In: Lista invazivnih 

vrsta na području AP Vojvodine = List of invasive species in AP Vojvodina [Internet]. 

Version 0.1beta. Anačkov G, Bjelić-Čabrilo O, Karaman I, Karaman M, Radenković S, 

Radulović S, Vukov D & Boža P, editors. Novi Sad (Serbia): Department of Biology and 

Ecology; 2011. [Available: 

http://iasv.dbe.pmf.uns.ac.rs/index.php?strana=baza&idtakson=40&jezik=english]. 

Boža, P., Igić, R., Anačkov, G., Vukov, D., (2006): Complex Research of Invasive species 

Ambrosia artemisiifolia L. 1753. First Scientific-Professional Conference with 

International Participation “Air Protection and Health”. Bosnia and Herzegovina, Banja 

Luka, 20.-21.04.2006. Collection of Papers, pp: 39-46.


Boža, P., Radić, J., Igić, R., Vukov, D., Anačkov, G. (2002): Rod Ambrosia L.1754 u Vojvodini. 

XXIII Seminar iz zaštite bilja Vojvodine, Novi Sad, 12-13.02.2002. Biljni Lekar, pp. 92- 

100. 

Dessaint, F, Chauvel, B., Bretagnolle, F. (2005): L’ambrosie, Chronique de l’extension d’un 

“pollutant biologique” en France. Medecine Sciences, 21: 207-209. 

Fernández-Llamazares, Á., Belmonte, J., Alarcón, M., López-Pacheco, M. (2012): Ambrosia L. 

in Catalonia (NE Spain): expansion and aerobiology of a new bioinvader. Aerobiologia, 

DOI: 10.1007/s10453-012-9247-1. 

Flora of North America,2008. [internet]. [11.07.2012.] availabel: 

http://www.efloras.org/object_page.aspx?object_id=57495&flora_id=1 

Gajić, M. (1975): Asteraceae Dumortier, Compositae Adans., in Josifović, M. ed., Flora of SR 

Serbia, VII: 1-465. SASA, Belgrade. 

Galzina, N., Barić, K., Šćepanović, M., Goršić, M., Ostojić, Z. (2010): Distribution of Invasive 

Weed Ambrosia artemisiifolia L. in Croatia.Agriculturae Conspectus Scientificus, 75 (2): 

75-81. 

Gerber, E., Schaffner, U., Gassman, A., Hinz, H.L., Seier, M., Müller-Schärer, H. (2011): Weed 

Research, 51: 559-573. 

Holst, N. ed., (2009): Strategies for Ambrosia Control. Scientific Report, Euphresco Project 

AMBROSIA 2008-09. [Internet]. [2012 July 12]. Available from: URL, English. 

IASV (2011): List of invasive species in AP Vojvodina [Internet]. Version 0.1beta. Anačkov G, 

Bjelić-Čabrilo O, Karaman I, Karaman M, Radenković S, Radulović S, Vukov D & Boža 

P, editors. Novi Sad (Serbia): Department of Biology and Ecology; 2011 [2012 July 12]. 

Available from: http://iasv.dbe.pmf.uns.ac.rs/index.php?strana=pocetak&jezik=english. 

Igić, R., Boža, P. (2012): Polenalergijske biljke, in Igić, R. ed., Alergijske biljke. Univerzitt u 

Novom Sadu, Prirodno-matematički fakultet, Departman za biologiju i ekologiju i 

“Vrelo” Društvo za zdrau ishranu i zaštitu životne sredine, Novi Sad, pp. 69-178. 

Jarić, S. (2009): Alohtone biljne vrste u prirodnim i antropogeno izmenjenim fitocenozama 

Srema, PhD thesis. Poljoprivredni fakultet, Beograd. 

Jin Chun, Y., Corre Le, V., Bretagnolle, F. (2011): Adaptive divergence for a fitness-related trait 

among invasive Ambrosia artemisiifolia populations in France. Molecular Ecology, 20: 

1378-1388. 

Juhász, M. (1998): History of ragweed in Europe. – In: Ragweed in Europe. 6th International 

Congress of Aerobiololgy, Perugia 1998. Satellite Symposium Proceeding, ed. 

Spieksma, F.Th.M. pp. 11 – 14. 

Mayers, J.H., Bazely, D. (2003): Ecology and Control of Introduced Plants. Cambridge 

University Press, Cambridge. 

Ribolovački savez Vojvodine,2008. [internet]. [11.07.2012.] available from 

http://www.akvakamp.org.rs/images/MAPA-Backe1.jpg 

Sărăteanu, V., Moisuc, A., Cotuna, O. (2010): Ambrosia artemisiifoliaL. an invasiveweed from 

ruderal areas to disturbed grasslands. Lucrări Ştiinţifice, 53: 28-31. 

Schulter, D. (2000): The Ecology of Adaptive Radiation. Oxford University Press, Oxford. 

Slavnić, Ž. (1953): Prilog flori našeg Podunavlja. Glasnik biološke sekcije Hrvatskog 

Prirodoslovnog Društva, ser. II/B, T.4-6: 145 - 177. 

StatSoft, Inc. (2011). STATISTICA (data analysis software system), version 10. 

[www.statsoft.com.] 

Takhtajan, A. (1991): Evolutionary Trends in Flowering Plants.Columbia Univerity Press, New 

York. 

Wittenberg, R., Cock, M.J.W. (2001): Invasive Alien Species: A tool of Best Prevention and 

Menagement Practices. CABI publishing, Oxford.

38 Distribution of the sorghum halepense (L.) pers... 

International Symposium: Current Trends in Plant Protection UDK: 633.17(560) 

Proceedings 

DISTRIBUTION OF THE SORGHUM HALEPENSE (L.) PERS. IN 

THE MARMARA REGION OF TURKEY 

A. YAZLIK ISIK 1 , I. UREMIS 2 

1 Batı Akdeniz Agricultural Research Institute, Plant Protection Department, Antalya/Turkey 

2 Mustafa Kemal University, Faculty of Agriculture, Plant Protection Department, Hatay/Turkey 

ayseyazlik77@hotmail.com 

Invasive alien plants and expanding native species, which have unpredictable but significant 

effects in ecosystems in many cases, cause huge and rising ecological, socio-economical and human 

health problems. Key points for precise and timely detection of invasive plants are: (i) history of 

spreading (vectors, pathways, introduction time etc), (ii) basic taxonomic and biological information, 

and (iii) distribution and status of the plants. Sorghum halepense is a Mediterranean element, i.e. a 

native plant of Turkey with impacts on managed and unmanaged areas in native and non-native 

ranges. However, there is still lack of information on S. halepense in different ecosystems and 

regions of Turkey. A project has been carried out to (i) map S. halepense at regional level, (ii) 

determine plant species established community with S. halepense, and (iii) examine factors causing 

high competitive ability. Thus, data obtained can be used to create a strategy from prevention to 

containment of S. halepense and, compare and assess behavior of the species in current and 

prospected invaded regions worldwide. In this paper, data from the Marmara Region of Turkey, 

where surveys were carried out in 28 different managed and unmanaged ecosystems in 11 provinces 

is presented. 

Key Words: Sorghum halepense (SORHA), Marmara region, mapping, weeds 

INTRODUCTION 

Johnsongrass is a perennial grass species, considered native to the Mediterranean 

area (Holm et al., 1977) and Turkey. Johnsongrass is ranked as the sixth worst weed, which 

was reported by 53 countries as a weed in 30 different crops (Holm et al., 1977). It has been 

reported in industrial crops such as cotton and maize, wheat fields, vegetables, fruit 

plantations and waste areas in Turkey (Ulug et al., 1993; Zel, 1994; Uludag and Uremis, 

2000). It was reported that 61% of cotton production areas were infested with SORHA in 

Turkey and impact of SORHA control is 165 million Euro (Gunes et al., 2008). Crop lost in 

cotton due to Johnsongrass interference was calculated 7% through 69% depending on 

Johnsongrass density 1 through 32 on 8 m of a row (Uludag et al., 2007). In a study fiftyone 

olive groves surveyed twice during 2003-2004 growing season. Ninety-two different 

weed species were determined which belong to 29 families. SORHA (81,60%) was the 

most common weed. Also, study identified widespread and intense, such as SORHA weed 

species, reaches a level of damage indicated that as a result of agricultural practices 

(Uremis, 2005). In another study weed species and densities detected of olive nurseries,

A.Yazlik Isik, I. Uremis 39 

Edremit (Balıkesir) and Kemalpaşa (Bursa) districts in 1993, four different survey period 

was chosen. SORHA in Edremit was found with a frequency of 8,25% and a density of 22,2 

plant/m 2 ; and in Kemalpaşa 29,27% and 68,36 plant/m 2 respectively (Erten and Nemli, 

1997). 

According to a study weeds have a role within agro-ecosystems in supporting 

biodiversity. In this study a geo database was developed in order to store all the available 

information on Greek grasses. The grass species which are considered weeds in terms of 

their occurrence in Greek agricultural crops are the following in decreasing rank: Lolium 

rigidum, Hordeum murinum, Poa bulbosa, Cynodon dactylon, Avena sterilis, Poa trivialis, 

Bromus sterilis, Phalaris paradoxa, Bromus tectorum, Phalaris minor, Lolium temulentum, 

Sorghum halepense, Alopecurus myosuroides and Lolium perenne. This ranking is derived 

from 52 to 178 records each. One of the objectives of this survey is to bring together a 

selection of standardized vegetation data in a computerized databank. Such a databank will 

provide information on the floristic composition and geographical distribution of plant 

communities which will serve as a source for various applications. The information derived 

from the database will provide a scientific basis for a European vegetation classification by 

documentation of vegetation types (syntaxa) from an ecological point of view. It may also 

contribute to a European survey and management of grasses which could become problems 

as invasive species (Economou et al., 2011). 

The lack of information on Johnsongrass in different ecosystems and regions of 

Turkey necessitates such studies. In this paper, data from the Marmara Region of Turkey, 

where surveys were carried out in 28 different managed and unmanaged ecosystems in 11 

provinces, is presented. Thus, data were obtained can be used to create a strategy from 

prevention to containment of SORHA and, compare and assess behavior of the species in 

current and prospected invaded regions worldwide. 


The survey was carried out at SORHA flowering period starting early July to late 

September in the year 2011 in order to determine the prevalence and density. During 

survey; 11 provinces were covered in the Marmara Region. Area was considered in the 

Marmara region according to Flora of Turkey (Davis, 1965-1988) which is designated on a 

map of Turkey; A1 (Edirne, Kırklareli, Tekirdağ and Çanakkale), A2 (Istanbul, Yalova, 

Bursa and Kocaeli), A3 (Sakarya, Bilecik, Kocaeli), B1 (Balıkesir, Çanakkale) and B2 

(Balıkesir, Bursa) squares system is located. 

Survey focused in a 20 kilometer intervals, at the each occurrence of the stop areas 

(agricultural and / or non-farm) samples have been counted and recorded on a form. It was 

considered to take into account the samples of 0.1 ha in the areas of agriculture and in the 

100 m 2 (20 m x 5 m) in non-agricultural areas. A four - times random counts of frames (0.5 

m x 0.5 m) in each point SORHA plants were counted and recorded. The latitude, 

longitude, and elevation of each site were recorded using a handheld global positioning 

system (GPS) device, in the presence of SORHA at the site. 

Survey data, SORHA encounter frequency (%) was calculated with the following formula; 

Encounter Frequency (%) = 100 x N / m 

N: positive SORHA sampling 

m: Total number of sampling


In addition, the value obtained as a result of the counts divided by the total area 

density (plants/m 2 ), thus density of SORHA was calculated. Each point with the Global 

Positioning System (GPS) a map was drawn to show the spread of SORHA in the region. 


In this study, both the general situation in the Marmara region was identified for the 

SORHA, as well as the control measurements to control it by farmers. 

In 2011, observations were made in 11 localities from Marmara region including 27 

different crops, nurseries and unsowed areas (grassland area, road verge and irrigation canal 

etc) were examined (Table 1). A total of 2623 samples taken from 167 points were marked 

with the GPS (Figure 1). SORHA plants were found growing in and around all localities. 

Sorghum plants encounter frequency (%) and intensity (plant/m 2 ) of the region is presented 

in Table 1. SORHA was very common in all of the sampled regions at surveyed sites. 

Density in an m 2 and encounter frequency of SORHA ranged from 13 to 30 and 34 to 

100%, respectively (Table 1). Even these data would give an idea of invasive characteristics 

of SORHA. Warwick and Black (1983) list S. halepense characteristics lending to its 

success as: (i) production of extensively creeping rhizomes, (ii) high seed production, (iii) 

rhizomes which regenerate easily when segmented, (iv) self-compatibility, (v) seed 

dormancy and seed longevity, (vi) vigorous growth rate in a wide range of environmental 

conditions, and under low light levels, (vii) plasticity when growing in a wide range of 

environmental conditions and (viii) great variability (contributing to S. halepense rapid 

adaptability to northern climates). Furthermore FAO notes that SORHA has good drought 

tolerance, with rhizomes surviving dry periods (Anonymous 1). 

Figure 1: SORHA spread in Marmara Region (167 point marked)


Table 1: Spreading of SORHA in all locality, in experimental years, 2011 

No Locality Surveyed Total 

Crop + non-crop 

area 

Density 

(weed/m 2 ) 

Frequency 

(%) 

Name of the 27 different 

Crops + Non-Crop area 

1 Balıkesir 10 25,00 94,33 Peach, Apple, Pears, Quince, 

2 Bilecik 7 26,70 100,00 Cherry, Olive, Plum, Figs, 

3 Bursa 19 30,12 98,30 Persimmon Walnut, 

4 Çanakkale 17 13,40 88,13 Mandarin, Bond, Kiwi, Corn, 

5 Edirne 5 19,00 90,30 Onion, Leek, Beet, 

6 İstanbul 3 22,00 100,00 Watermelon, Melon, Tomato, 

7 Kırklareli 6 15,40 34,20 Pepper, Beans, Pumpkin, 

8 Kocaeli 20 20,10 100,00 

Cabbage, Okra, Sunflower, 

9 Tekirdağ 10 15,30 89,91 

Nursery, Non-crop area 

(grassland area, road verge 

10 Sakarya 16 20,00 96,10 

and irrigation canal etc.) 

11 Yalova 15 23,00 100,00 

Mowing, plowing, and herbicide applications were done to control SORHA, but it 

was observed that these applications were not successful. 

Mowing; both to control and long-term management of grain reserves are useful for 

curbing the SORHA population. As reported by different researchers; Mowing 

Johnsongrass for several seasons weakens the plants and reduces rhizome growth 

(McWhorter, 1981). Removing aerial grass shoots close to the ground is a technique used to 

exhaust the stored carbohydrates of perennial weeds (Horowitz, 1972). Horowitz (1972) 

reports that clipping three week old seedlings will kill them, whereas McWhorter (1961) 

claims that seedlings must be clipped within 14 days after emergence for death of the plants 

to occur. As compared to the single clipping of seedlings, plants arising from rhizomes 

require two clippings within the first two weeks of growth to insure death of the plant 

(McWhorter, 1961). Because the lowest rhizome carbohydrate concentration occurs in the 

spring, during initial above-ground growth, and in the fall, during over-wintering rhizome 

formation, clipping at this time will have the maximum controlling effect by preventing the 

formation of photosynthesis and thus precluding a stored energy supply (Horowitz, 1972). 

However, this method is useful only for reduction of seed production in the Marmara 

region, because; (i) timing of the mowing and (ii) only one time mowing in a season, there 

was no mortality of SORHA was observed. 

Plowing; usually were applied in the orchards, but SORHA density and the 

distribution within the ploughed area were noticed by the farmers. This situation is a result 

of incorrect timing of plowing, the loss of apical dominance, transportation by equipment 

used and insufficient numbers of plowing to be done within a period. The studies confirm 

these observations. Halvorson and Guertin (2003) notes that rhizome fragments as small as 

1 in. (2.5 cm) can produce new plants from a soil depth of 4 in. (10 cm). In fact when a 

heavily infested site was thoroughly tilled 6 times at 2 week intervals over the growing 

season, rhizome production was reduced by over 99% (McWhorter, 1973). Also reported 

by Newman (1993); the optimum time to begin control efforts is during the first two weeks 

of growth; new rhizome development has not begun and carbohydrate reserves are at their 

lowest. 

Herbicide applications: were observed to yield insufficient control in the Marmara 

region. These unsatisfactory results are due to: (i) mistiming of the application (ii) and 

repeated use of the same active ingredients. Treating Sorghum halepense with herbicides to 

insure effective control requires several applications with proper timing (Anonymus 2, 

1999). The prolonged use of the same herbicide can cause problems of herbicide resistance,


a phenomenon consisting in the selection of resistant weed population of a previously fairly 

well controlled by the same herbicide (Palou et al., 2008). In addition, Sorghum halepense 

resistance to herbicides: as acetolactate synthase (ALS) inhibitors (imazethapyr, 

nicosulfuron), acetyl-CoA synthase carboxylase (ACCase) inhibitors (clethodim, 

fenoxaprop-P-ethyl, fluazifop-p-butyl, quizalofop-p-ethyl, sethoxydim), dinitroanilines and 

others (pendimethalin) (Anonymous 3). 

One type of control method is not effective for SORHA. First of all surveys should 

be carried out to determine the level of invasion, and then the control methods can be 

planned. In addition, measures should be taken within the scope of integrated weed 

management. 

The most efficient and effective method of managing invasive species such as the 

Johnsongrass is to prevent their invasion and spread. Also, on the Integrated Management, 

a combination of complementary control methods may be helpful for rapid and effective 

control of Johnsongrass. Integrated management includes not only killing the target plant, 

but establishing desirable species and discouraging nonnative, invasive species over the 

long term (Anonymous 4). 

In this study, SORHA's general situation throughout the region was determined. The 

data collected can be utilized as a beginning of a data bank. It may also provide a source for 

the future studies. It will be useful: (i) a training facility for the region, (ii) to determine 

SORHA herbicide resistance and (iii) SORHA regional invasion situation should followup. 

Therefore, there is a need to plan adequate control programs for SORHA in 

Marmara region. 

REFERENCES 

Anonymus 1: FAO: Sorghum halepense (L.) Pers. Grassland Index. Website: 

http://www.fao.org/WAICENT/FAOINFO/AGRICULT/AGP/AGPC/doc/GBASE/D 

ata/Pf000320.HTM 

Anonymus 2 : Invasive Alien Plants Species of Virginia (1999): Johnsongrass (Sorghum 

halepense (L.) Pers.). Department of Conservation and Recreation and the Virginia 

Native Plant Society. http://www.dcr.state.va.us/dnh/invlist.htm. 

Anonymus 3: Weed Science: 09-04-2012 

http://www.weedscience.org/Summary/USpeciesCountry.asp?lstWeedID=166&FmCom 

monName=Go 

Anonymus 4:http://www.fs.fed.us/database/feis/plants/graminoid/sorhal/introductory.html 10- 

05-2012 

Davis, P.H., (1965-1988): Flora of Turkey and East Aegean Islands. Edinburgh University 

Press, Vol.: 10 p: xvi 

Economou, G., Uludag, A., Uremis, I., Kalivas, D., Tabbache, S., Al-Jboory, I., Taab, A., Rubin, 

B., (2011): Weed surveys in cotton fields in the Eastern Mediterranean countries 

European Weed Research Society 2nd Workshop Of The EWRS Working Group: 

Weed Mapping Jokioinen, Finland 21-23 September 2011. 

Erten, L., Nemli, Y. (1997): Zeytin fidanlıklarında görülen yabancı otlar ve yoğunluklarının 

belirlenmesi üzerinde çalışmalar Sf. 133-140 Türkiye II. Herboloji Kongresi, Bildiri 

Kitabı 1-4 Eylül 1997 İZMİR/Ayvalık. 

Halvorson, W. L., Guertin, P. (2003): USGS Weeds in the West project: Status of Introduced 

Plants in Southern Arizona Parks Factsheet for: Sorghum halepense (L.) Pers. U.S.


Geological Survey / Southwest Biological Science Center Sonoran Desert Field Station 

University of Arizona. 

Holm, L. G., Plucknett, D. L., Pancho, J. V., Herberger, J. P. (1977): The World’s Worst Weeds, 

Distribution and Biology, (Sorghum halepense (L.) Pers., 54-61). The University Press 

of Hawaii, Honolulu. 

Horowitz, M. (1972): Effects of frequent clipping on three perennial weeds, Cynodon dactylon 

(L.) Pers., Sorghum halepense (L.) Pers. and Cyperus rotundus L. Experimental 

Agriculture 8: 225-234. 

Gunes, E., Uludag, A., Uremis, I. (2008): Economic impact of johnsongrass (Sorghum 

halepense (L.) Pers.) in cotton production in Turkey. Zeitschrift für Pflanzenkrankheiten 

und Pflanzenschutz, Sonderheft XXI: 515-520. 

McWhorter, C.G. (1961): Morphology and development of Johnsongrass plants from seeds and 

rhizomes. Weeds 9: 558-562. 

McWhorter, C.G. (1973): Johnson grass, its history and control. Weeds Today 3: 12-13. 

McWhorter, C.G. (1981): Johnson grass as a weed. USDA Farmers Bulletin 1537: 3-19. 

Newman, D. (1993): The Nature Conservancy Element Stewardship Abstract for Sorghum 

halepense. The Nature Conservancy. 1815 North Lynn St., Arlington, Virginia. 

http://tncweeds.ucdavis.edu/esadocs/documnts/sorghal.html 

Palou, A. T., Ranzenberger, A. C., Larios, C. Z., (2008): Management of Herbicide-Resistant 

Weed Populations 100 questions on resistance. Food and Agriculture Organization Of 

The United Nations Rome. 

Uludağ, A., Uremis I (2000): A perspective on weed problems in cotton in Turkey. In: Proceedings 

of The Inter-Regional Cooperative Research Network on Cotton, A joint Workshop and 

Meeting of the All Working Groups, Adana, Turkey), 194-199. 

Uludag, A., Gozcu, D., Rusen, M, Guvercin, R. S., Demir, A. (2007): The effect of johnsongrass 

densities (Sorghum halepense L. Pers.) on cotton yield. Pakistan J. Biol. Sci. 10: 523- 

525. 

Ulug, E., Kadioglu, I., Uremis, I. (1993): Türkiye’nin Yabancı Otları ve Bazı Özellikleri (Weeds 

of Turkey and Their Some Characteristics). T.K.B. Adana Zirai Mücadele Araştırma 

Enstitüsü, Turkey. (in Turkish and English). 

Uremis, I. (2005): Determination of weed species and their frequency and density in olive 

groves in Hatay province of Turkey, Pakistan Journal of Biological Science, 8 (1): 164- 

167 

Zel, M. (1994): Güneydoğu ve Doğu Anadolu bölgeleri hububat tarlalarında yabancı otların 

dağılımı ve ortalama yoğunlukları. Türkiye Fitopatoloji Derneği, Turkey. 

Warwick, S. I., Black, L. D. (1983): The biology of Canadian weeds. 61. Sorghum halepense 

(L.) Pers. Canadian Journal of Plant Science 63(4):997-1014.

44 Distribution of invasive weeds on the territory of AP Vojvodina 

International Symposium: Current Trends in Plant Protection UDK: 632.51(497.11) 

Proceedings 

DISTRIBUTION OF INVASIVE WEEDS ON THE TERRITORY OF 

AP VOJVODINA 

KONSTANTINOVIĆ BRANKO 1 , MESELDŽIJA MAJA 1 , SAMARDŽIĆ NATAŠA 1 , KONSTANTINOVIĆ 

BOJAN 2 

1 Faculty of Agriculture, Trg Dositeja Obradovića 8, 21 000 Novi Sad, Srbija 

2 Dipkom d.o.o., Agrimatco Group, Novi Sad 

e-mail: brankok@polj.uns.ac.rs 

Invasive weed species occur as companions of various human activities. They occupy 

different ruderal, urban and rural habitats, which is followed by their free spreading in nature. In 

recent years, spread of invasive weed species on the territory of AP Vojvodina became more 

pronounced, and the number of invasive weeds is constantly increasing. On the territory of AP 

Vojvodina, several ruderal weed species are found among invasive weeds, threatening agricultural 

production, human and animal health and the environment in general. The greatest economic 

significance have ruderal weed species, such as: Sorghum halepense (L.) Pers, Rumex crispus L., 

Carduus acanthoides L., Conyza canadensis L., Urtica dioica L., Chenopodium album L., Rubus 

caesius L., Arctium lappa L., and established invasive weed species Ambrosia artemisiifolia L., 

Asclepias syriaca L., Iva xanthofolia L. and Artemisia vulgaris L. Established coverage of invasive 

weed species is within a range of 30-95%, while the presence level marked V is found for Ambrosia 

artemisiifolia and Artemisia vulgaris, and presence level marked I for Amaranthus retroflexus, 

Asclepias syriaca and Cuscuta campestris. 

Key words: invasive weed, ruderal habitats, distribution, AP Vojvodina 

INTRODUCTION 

During the last decade, the study of the spread of invasive weed species on the 

territory of AP Vojvodina intensified. Invasive weed species spread in ruderal habitats, as 

well as under different crops. They are introduced species from natural habitats in new 

ecosystems to which they adjust and suppress already present weed species (Konstantinović 

et al., 2011). The invasion of certain weed species does not depend only on its invasive 

abilities and individual biological traits that enable it to invade new areas, but also from 

external environmental factors that contribute to this process (Tilman, 1997). Unstable 

ecosystems, arable land, and ruderal habitats are the primary sites of infection by invasive 

weed species that keep spreading to surrounding ecosystems causing homogenization of the 

regional flora (Stevanović et al., 2009). Data on potential dangers caused by weediness of 

agricultural land, as well as ruderal sites are obtained by studies of distribution of 

introduced invasive weed species on the territory of AP Vojvodina.

Konstantinović Branko, Meseldžija Maja, Samardžić Nataša, Konstantinović Bojan 45 

MATHERIALS AND METHODS 

In the period from 2008-2010 on the territory of AP Vojvodina, field studies on the 

presence of species Ambrosia artemisiifolia L. and determination of its abundance and 

coverage on the ruderal and unregulated areas were carried out. Determination of 

abundance and coverage was performed according to modified Brauen-Blanquet scale 

(1951). In 2011, mapping of invasive weed species was carried out on the territory of AP 

Vojvodina. The studies included the following invasive weed species: Ambrosia 

artemisiifolia L., Artemisia vulgaris L., Iva xanthifolia Nutt., Asclepias syriaca L., 

Sorghum halepense (L.) Pers., Amaranthus retroflexus L., Chenopodium album L., Cuscuta 

campestris Yunkers., Arctium lappa L., Carduus acanthoides L., Conyza canadensis L., 

Rubus caesius L., Rumex crispus L. and Urtica dioica L. For determination of abundance 

and coverage of invasive weeds was used modified scale according to the method of 

Brauen-Blanquet (1951). Mapping was conducted in 11 municipalities in 18 localities. 

Based on field visits, phytocenological records of invasive weed species were made for the 

studied localities. Studied area was 100 m 2 in size, and in each locality, there were 10 plots 

for inspection. Mapping of invasive weed species was carried out by GPS, the data were 

then introduced into software program Ambrosia Spot Marker for area of Novi Sad, while 

the data for the area of AP Vojvodina were inserted into the Google Earth program. 

RESULTS 

During 2011 performed monitoring in the region of AP Vojvodina, showed that 

spread of invasive weed species is gaining increasing importance, due to their expansion to 

new areas. Processing of data from the field revealed spread of invasive weed species such 

as: Ambrosia artemisiifolia L., Artemisia vulgaris L., Iva xanthifolia Nutt., Asclepias 

syriaca L., Sorghum halepense (L.) Pers., Amaranthus retroflexus L., Chenopodium album 

L., Cuscuta campestris Yunkers., Arctium lappa L., Carduus acanthoides L., Conyza 

canadensis L., Rubus caesius L., Rumex crispus L. and Urtica dioica L. It was established 

that the overall coverage of invasive weed species at studied localities was within the range 

of 30-95%. The highest percentage of overall coverage was measured in the municipality of 

Sremska Mitrovica (75-95%), followed by Novi Sad, Odžaci, and Kula (70-95%), while 

the lowest overall coverage was measured in the municipalities of Zrenjanin (40-95%) and 

Šid (30-95%). The degree of presence of the analyzed invasive weed species was 

determined by data processing. The degree of presence marked V was established for A. 

artemisiifolia L. in municipalities Sombor, Odžaci and Novi Sad and A. vulgaris L. in 

municipalities Sombor, Odžaci and Šid. Mark IV indicated the degree of presence for weed 

species Artemisia vulgaris L. (municipalities Kikinda, Zrenjanin, Vrbas, Kula, Sremska 

Mitrovica, Bačka Palanka and Novi Sad) and Rumex crispus L. (municipalities Kikinda, 

Vrbas, Sombor, Odžaci, Ruma, Šid and Novi Sad). Data processing revealed also the 

degree of presence marked I for species A. artemisiifolia L. in municipality Zrenjanin, 

Amaranthus retroflexus L. in municipalities Kula, Sombor, Ruma and Šid, Aclepias syriaca 

L. in municipalities Kikinda, Vrbas, Kula, Sremska Mitrovica and Novi Sad, and Cuscuta 

campestris Yunkers. that was determined in even 7 municipalities (Kikinda, Sombor, 

Odžaci, Sremska Mitrovica, Šid, Bačka Palanka and Novi Sad) (Table 1).


Table 1. Overall coverage and degree of presence of invasive weed species on the territory of 

AP Vojvodina 

Kikinda Zrenjanin Vrbas Kula Sombor Odžaci Ruma Sr. Mitrovica Šid B.Palanka Novi Sad 

Invasive weed species 

Overall coverage % 

60-95 40-95 65-95 70-95 50-95 70-95 30-95 75-95 30-95 50-95 70-95 

Level of presence 

Ambrosia artemisiifolia L. III I IV IV V V II II IV IV V 

Artemisia vulgaris L. IV IV IV IV V V III IV V IV IV 

Amaranthus retroflexus L. I I I II I III 

Arctium lappa L. I I III II I 

Asclepias syriaca L. I I I I I 

Carduus acanthoides L. III V II I III III IV IV III III II 

Chenopodium album L. I II II I III II IV III II III IV 

Cuscuta campestris Yunkers. I I I I I I I 

Conyza canadensis L. II II II IV III III II II II III 

Iva xanthifolia Nutt. I I III 

Rubus caesius L. I I I III II II II 

Rumex crispus L. IV V IV III IV IV IV V IV II IV 

Sorghum halepense (L.) Pers. II IV III IV III III IV III III II IV 

Urtica dioica L. II I II III IV III IV V IV I IV 

DISCUSSION 

Invasive weed species that spread along the Balkan Peninsula are of great 

importance for Serbia, and especially for the territory of AP Vojvodina. Some sporadic or 

completely new weed species have assumed an increasingly important role in the region 

(Konstantinović et al., 2006). The species Ambrosia artemisiifolia, which first appeared in 

the former Yugoslavia for more than half a century ago (Maly, 1949), today is very 

common and mostly distributed invasive weed species (Mataruga et al., 2004; 

Konstantinović et al., 2011).. According to Jovanović et al., (2009) A. artemisiifolia is 

distributed on even 70% of the total territory of Serbia, and the largest damages causes 

primarily in AP Vojvodina, around Beograd and in the region of Mačva (Milošević, 2008). 

In the period 2006-2007, A. artemisiifolia L. was found on the banks of the river Danube, 

near Petrovaradin, Sremski Karlovici and Novi Sad, as well as near Bač, Bačka Palanka, 

Begeč, Bogojevo and Futog, in the entire region of Bačka in the central and southern Banat 

region (Konstantinović et al., 2008). Studies conducted in the period 2008-2011, revealed 

presence of A. artemisiifolia L. on over 400 ha on the territory of the municipality Novi 

Sad, at more than 200 localities and more than 50 plants per m 2 (Konstantinović et al., 

2011). In 2008 mapping and control or A. artemisiifolia L. was performed in AP 

Vojvodina. Control of A. artemisiifolia L. was conducted on 2500 ha in 42 municipalities, 

by mechanical or chemical control measures. Monitoring also showed that retro vegetation 

occurred. The highest overall coverage was established in the South Bačka region 

amounting 80-95%, while the degree of presence is evaluated by V. The lowest overall 

coverage was found in the region of South Banat amounting 30-80%, with the presence 

degree I (Konstantinović et al., 2011) (Table 2). In agricultural habitats, A. artemisiifolia 

was found mostly in crops of maize, soybean, sunflower and sugar beet, as well as in 

stubbles. 

Asclepias syriaca L. is allochthonous invasive weed species originating from North 

America, and it was introduced into Europe at the beginning of the nineteenth century. It is 

present in many European countries (Stanković-Kalezić et al., 2008). This species invades 

soils due to insufficient cultivation and herbicide use, fertilizers and irrigation measures 

(Cramer and Burnside, 1981). On the territory of AP Vojvodina, Asclepias syriaca L. is

Konstantinović Branko, Meseldžija Maja, Samardžić Nataša, Konstantinović Bojan 47 

present in the wider area of Bačka, north part of Banat, especially in wider area of 

Subotica- Horgoš sands (Dolmagić, 2010). 

Table 2. Overall coverage and degree of presence ofi Ambrosia artemisiifolia L. on the territory 

of AP Vojvodina in the period 2008-2010 

Ambrosia artemisiifolia L. on the territory AP Vojvodina 

Districts Overall coverage in % Level of presence 

North Bačka (3 municipalities) 60-95 II 

West Bačka (4 municipalities) 70-95 IV 

South Bačka (10 municipalities) 80-95 V 

Nort Banat (6 municipalities) 50-90 II 

Central Banat (5 municipalities) 60-95 III 

South Banat (8 municipalities) 30-80 I 

Srem (7 municipalities) 70-95 IV 

Iva xanthifolia Nutt. is new invasive weed species on the territory of AP Vojvodina, 

it spread during sixties of the last century on the territory of AP Vojvodina and it is now a 

very strong allergen that expands 5-10 times faster than A. artemisiifolia L. During 2002- 

2006, the study of this weed species was conducted on the territory of AP Vojvodina, and 

its presence was registered on ruderal sites, but also in maize, sugar beet, sunflower and 

soybean crops. The studies showed that it is the most widespread in the regions of Srem 

and Bačka, and somewhat less in Banat (Marisavljević et al., 2007). 

Data obtained by the study of invasive weed species on the territory of Novi Sad and 

AP Vojvodina suggest that the named weed species keep spreading very fast, especially A. 

artemisiifolia L., A. syriaca L., A. vulgaris L., I.xanthifolia L. and R.crispus L. 

REFERENCES 

Brauen-Blanquet, J. (1951): Pflanzensoziologie. Wien, Osstereich. 

Cramer, G. L., Burnside. O. C. (1981): Control of common milkweed (Asclepias syriaca) with 

postemergence herbicides. Weed. Sci. 29: 636-640. 

Dolmagić, A. (2010): Preliminarna ispitivanja o mogućnosti suzbijanja ciganskog perja 

(Asclepias syriaca L.) u usevu soje. Biljni lekar, 38(1) 42-49. 

Jovanović, G., Paunović, M., Todorović, D., Vojinović, M., Đorđević Lj., Stajić, M. (2009): 

Pojava i širenje invazivnih korovskih vrsta sa posebnim osvrtom na Ambrosia 

artemisiifolia L. na jugu Srbije. VI Congress of Plant Protection (Book I), Zlatibor, 113- 

114. 

Konstantinović, B., Meseldžija, M., Konstantinović, Bo. (2006): Ambrosia artemisiifolia and Iva 

xanthifolia spread and distribution in Vojvodina region. Proceeding IV International 

Plant Protection Symposium, Debrecen, Hungary, 281-288. 

Konstantinović, B., Meseldžija, M., Konstantinović, Bo. (2008): Mapiranje važnijih invazivnih 

korova i njihovo suzbijanje. Acta Herbologica, 17 (2), 53-56. 

Konstantinović, B., Korać, M., Mandić, N., Blagojević, M. (2011): Invasive weed species in 

ruderal and agriculture areas in Vojvodina. 22nd International symposium ``Save food 

production``‚Trebinje, 401-403.


Maly, K. (1949): Notizen zur Flora von Bosnien-Herzegovina. Glasnik zemaljskog muzeja za 

Bosnu i Hercegovinu, Sarajevo, II, 1-2. 

Marisavljević, D., Stojanović, S., Pavlović, D., Dolovac-Pfaf, E. (2007): Prisustvo i 

kvantitativna zastupljenost alohtone invazivne korovske vrste Iva xanthifolia Nutt. na 

teritoriji Vojvodine. Acta biologica iugoslavica - serija G: Acta herbologica, 16(2)105- 

125. 

Mataruga, D., Janjić, V., Mitrić, S. (2004): Efikasnost glifosata u suzbijanju ambrozije, 

Ambrosia artemisiifolia L. Acta biologica Iugoslavica, serija G: Acta herbologica 13(2) 

88-95. 

Milošević, V. (2008): Asocijacija Panico-Ambrosietum artemisiifoliae ass. nova. Acta biologica 

iugoslavica - serija G: Acta herbologica, 17(1)59-67. 

Stanković-Kalezić, R., Radivojević, Lj., Jovanović, V., Janjić, V., Šantrić, L. (2008): 

Adventivna vrsta Asclepias syriaca L. na području Pančevačkog rita. Acta biologica 

iugoslavica - serija G: Acta herbologica, 17(1)95-103. 

Stevanović, J., Stavretović, N., Obratov-Petković, D., Mijović, A. (2009): Ivazivne biljne vrste 

na nekim sportsko-rekreativnim površinama Beograda. Acta biologica iugoslavica - 

serija G: Acta herbologica, 18 (2), 115-125. 

Tilman, D. (1997): Community invasibility, recruitment limitation, and grassland biodiversity. 

Ecology, 78,81-92.

Mirjana Krstivojević, Ružica Igić, Dragana Vukov, Marko Rućando, Saša Orlović 49 

International Symposium: Current Trends in Plant Protection UDK: 574(497.113) 

Proceedings 630*182(497.113) 

INVASIVE SPECIES OF PLANTS IN THE ANTHROPOGENIC 

WOODLANDS 

MIRJANA KRSTIVOJEVIĆ 1, RUŽICA IGIĆ 1, DRAGANA VUKOV 1, MARKO RUĆANDO 1, SAŠA 

ORLOVIĆ 2 

1 Department of Biology and Ecology, Faculty of Science, University Novi Sad, 

Trg Dositeja Obradovica 2, 21 000 Novi Sad 

2 Faculty of Agriculture, University of Novi Sad, Trg Dositeja Obradovica 8, 21 000 Novi Sad 

e-mail: mirjana.krstivojevic@dbe.uns.ac.rs 

This paper presents an insight into the representatives of invasive species that occur in 

antropogenic woodlands in Vojvodina. The purpose of the paper is creating an inventory of invasive 

species that frequently occur in forest plantations. In the preparation of this paper, literature data, 

information from the Herbarium of the Department of Biology and Environmental Science - Faculty 

of Science, University of Novi Sad (BUNS), and the data obtained by field research were used. Based 

on the obtained informations, a list of invasive plants that occur in antropogenic woodlands was 

created. The paper gives a brief overview of plants species- their description, distribution data, 

analysis of life forms and origin of taхa. Giwen that many of these species occur very often in forest 

plantations and their impact on flora and forest ecosystems is extremely large, research in this area 

should continue. 

Key words: anthropogenic woodlands, invasive species. 

INTRODUCTION 

Anthropogenic woodland ecosystems 

Woodland ecosystems representvery complex communities of living beings,the most 

magnificent communities of plants and animals on Earth (Horvat, 1950).Flora of the 

woodland ecosystemhas a very complex structure that is primarily reflected in its spatial 

arrangement. Three or more vegetation strata are usually distinguished in woodlands 

(herbaceous plants stratum, shrub vegetation and trees). Storey vegetation is caused by a 

specific soil structure in the woodlands, and the amount of nutrients and light.These 

conditions provide a significant periodicity in the annual development fromearly spring to 

late autumn, thus the space of the woodland is perfectly exploited (Horvat, 1950). 

Woodlands integrate in themselves something magnificent and always provide us with 

something new and interestingany season of the year (Silic, 1990). In addition to spatial and 

temporal complexity, woodlands are also characterized by very complex relations between 

the members of this biocoenosis, reflected in mutual adjustment and the struggle for 

survival (Horvat, 1950). Each woodland community in fact, is the result ofinteraction 

between its members through the history of its development.Woodland ecosystems are

50 Ivasive species of plants in the anthropogenic woodlands 

dynamic and subjected to changes, and those elements that have high fitness and 

competitive ability are the one that survive and dominate them. 

Woodlands in AP Vojvodina cover 137 000 ha, representing 6.37% of its total area 

(Vlatković, 1986). In agricultural zones, the percentage of woodland area drops below 1%, 

which clearly indicates that the northern Serbian province is a region with very degraded 

and endangered ecosystems (Ivanisevic, 2008). It is considered that the optimal percentage 

of woodlands in Vojvodina should be 14.3% (Vlatković, 1986), because than the balance of 

ecosystems would be restored and further degradation would be prevented. Afforestation of 

new areas (zones along roads, railways and rivers, hunting reserves, sandy areas, erosion 

areas) could be the means to reach the optimum percentage of woodlands in Vojvodina, 

which would directly contribute to stability and sustainable development of ecosystems of 

the area. Also afforestation in Vojvodina contributes to the increase in its financialand 

general economic stability. 

Woodland plantations and woodlands of anthropogenic origin in Vojvodina make up 

more than 49% of the totalwoodland vegetation of the northern Serbian province (Tomovic, 

2006).In anthropogenic woodlands, mainly present are the species of poplar, willow, ash, 

and oak. 

Invasive species 

The concept of invasiveness and invasion 

Introduced species, neophyte or exotics include species, subspecies or lower taxa 

that occur outside their natural habitat, with expansion into other habitats naturally or under 

direct or indirect anthropogenic influence.Under the influence of humans, as vectors of 

introduction, introduced species in a particular habitat can be entered deliberately, with a 

specific purpose (such as horticulture, medicinal, industrial or species of agricultural 

importance).This introduction of alien species is often uncontrollable, and even 

illegal.Exotic species may be introduced accidentally – via seeds of some plants, in 

transport etc. 

Exotic species can have positive, negative and neutral impact on the 

ecosystem.Positive and neutral influence implies strict control of alien species, which are 

commonly used in the diet of indigenous organisms, or are used in horticulture.On the other 

hand, exotic species can disrupt the balance of the ecosystem they arrive in and take over 

the food and living space of indigenous organisms, can extremely increase its population 

and continue expanding its range.This process, that the species aregoing through in order to 

become successful harmful invasive species, without the available data on the 

consequences for the economy and the environment, is called invasion. 

Stable ecosystems resist invasions more easily.However, ecosystems where the 

ecological balance is already disturbed are more susceptible to invasions.The susceptibility 

to invasions varies depending on the region and habitat type (Tunic, 2008). 

Characteristics of invasive species and their impact on biodiversity 

Invasive species include species, subspecies or lower taxa that are introduced from 

areas of their previous or present distribution into spaces in which they have not naturally 

occurred. (Anon, 2003). All invasive species characteristically have no natural enemies on 

the newly occupied spaces and are very easily adapted to all conditions of the new 

environment, and therefore are superior in competition compared to native species and 

haveno limitations for their reproduction and expansion. With that, they very easily and 

quickly establish dense and often monotypic population on large areas (Daehler, 1998).


Invasive species are capable of vegetative and sexual reproduction, they are 

characterized by rapid growth, early sexual maturity, high reproduction rate (multiproduction 

of seed and long retention of germination), great ability of sapling expansion 

(aggressive expansion with rhizomes, shoots and expansion with the help of various 

factors- water, wind, wildlife, human); they are capable of nourishing ona wide range of 

materials, have a wide ecological valence, high phenotypic plasticity. 

Invasive types necessarily have negative effects on the environment, and often also 

on economy, agriculture, water management, woodlandry, as well as urban and rural 

ruderal communities (Stevanovic and al., 2004). 

Negative influence of invasive species on native ones can be direct and indirect. 

Directly, invasive types represent exceptionally strong competitors for nutrients, lightand 

moisture, can cause or convey different diseases to domestic populations or parasite on 

them, prevent their reproduction or cross-fertilize with native species. Indirectly, invasive 

types cause disorders in the original processes in ecosystems (Pimentel and al., 2000). Due 

to the forming of populations of non-native species in these habitats, density of the native 

vegetation reduces and significant changes are made in the composition and structure of 

native biocenosis. In some parts of the world some indigenous communities contain an 

equal number of indigenous and introduced species, or even, introduced invasive types can 

be dominant and give basic contribution to the physiognomy of the conquered 

communities. 

Negative influence of invasive species on native can also cause a series of negative 

interaction within natural biocenosis. Invasive species often change the hydrologica lregime 

of aquatic ecosystems. They are capable of changing the erosion level. Also, it isknown that 

a large percent of invasive species has allelopathic properties, i.e. secretion of substances 

that other native types do not tolerate. Invasive types have the ability to change chemical 

composition and pH of the soil or to change the amount of nutrients and moisture in the 

base and in that way threaten the domestic flora. It is considered that invasive species affect 

frequency, intensity and outcome of natural fires, and they affect mutual relationships 

between plants (pollination, dispersal, parasitism and commensalism) (Panjković and al. 

2006). In addition to pressuring domestic vegetation and degrading the existing ecosystems, 

and therefore being a problem for local ecosystems, invasive species are exceptionaly 

dangerous for global biodiversity, with often being causes of disappearance of a vulnerable 

taxa from the flora of the world. Invasive species can hybridize with native species and thus 

give a negative genetic impact on the authenticity of the species and their adaptation 

acquired through evolution. 

Invasive woody species are a danger that threatens the natural balance of European 

woodlands. These species are more and more frequent in the ecosystems of Europe. They 

inhabit all segments of woodland habitats, all vegetation strata, inhibiting the productivity 

of woodland ecosystems and disrupting forestry activities, degradingthe habitat and 

affecting biodiversity (www.nps.gov). 

Measures of invasive species suppression 

Losses caused by invasive species are not only registered at biodiversity level. 

Economic losses caused by invasive species are high. These losses can be classified under 

the direct costs of production loss in agriculture and forestry and the costs of removing and 

controlling invasive species. The costs of prevention, monitoring and control of invasive 

species in the U.S. annually exceed 137 billion of U.S. dollars (Tunic, 2008). Economic 

losses occur due to attenuationof tourism, as invasive species affect recreational activities; 

many of them are allergens and threaten people‘s life and activity. Invasive species are


more and more difficult to control because of the rapid global commercialization, world 

trade and facilitated travel possibilities. 

Introduction of non-native species is occurring still today, very intensively. Plant 

and animal species are introduced where they naturally do not belong in different parts of 

the world, so that the risk of new environmental disorders and degradations of natural 

ecosystems increases daily (Vitousek and al., 1997). 

One of the main measures of invasive species suppression is to regulate the 

introduction of new plant species, as well as suppressing of further invasion of already 

introduced species. 

In order to prevent further expansion of invasive species and to reduce harmful 

influence of the already present ones, it is necessary to know their biology, ecology, and 

especially invasive ability. Invasive species are becoming an increasingly important subject 

of research in many scientific disciplines, which is certainly one of the important measures 

taken to solve the aforementioned problems. On the Figure 1 is showed number of papers in 

environmental journals referring to invasive species during ten years (1990-2001). 

Figure 1: Number of papers in environmental journals referring to invasive species, 1990-2001 

(Z. Botta-Dukat et. Al. 2004) 

Besides getting to know the characteristics of invasive species, it is necessary to take 

various applicative measures for suppression, in the form of monitoring and control of the 

populations of invasive species, but also mechanical, chemical and biological removal. 

Also, a legislative background is very important in the actions against invasive 

species in the form of global initiatives, conventions and law regulations. For this reason, 

there are numerous European and international strategies with sole purpose to solve the 

problem of invasive species. 

Under the national legislation of our country, the problem of invasive species, their 

control and measures of suppression as undesirable weeds, are mentioned in the laws on 

forestry and agriculture. However, the necessary legal support to solve the problem in 

Serbia is still lacking. 

Among the invasive plant species are those that are extremely harmful to human 

health, so they receive the most attention. In our country there are programs (in several 

municipalities) for suppression of ragweed (Ambrosia artemisifolia L.), a weed species that


causes a lot of damage to agricultural crops,and is also one of the strongest allergens. The 

fight against ragweed in these municipalities is an example of a successful action against 

invasive species. 


Literature data and data obtained by processing the plant material from Herbarium 

of the Department of Biology and Environmental Sciences - Faculty of Science, University 

of Novi Sad (BUNS) were used for the preparation of this paper, as well as data obtained 

from field research. On Photo 1. below is showed one of anthropogenic woodlands in 

Vojvodina, primarily of poplar. Literature and herbarium data present the source of 

information which includes most of the anthropogenic woodlands in Vojvodina, primarily 

of willow and poplar. 

Based on the obtained information a list of invasive plants that occur in 

anthropogenic woodlands was created. Presented in this paper is a brief description of the 

species. Gained results about invasive species in anthropogenic woodlands are systematized 

and coordinated with the synonymy of species in the Flora of Europe (Ball, 

1968).Information about the general distribution in Serbia have been retrieved from the 

flora of Serbia (Nikolic, 1973, Nikolic et al. 1986). 

Ecological index was determined for each species, as well as affiliation by 

ecological groups in relation to the indicator values of ecological index (Landolt, 1977; 

Kojic et al., 1997). 

For each species, a life form by Ranunkieu was determined, but revised and 

supplemented for the Flora of Serbia (Stevanovic, 1992). 

The origin, i.e. native range for each taxon was represented. 

Photo 1: Anthropogenic woodland community in Kovilj-Petrovaradin marsh 

(Krstivojević, 2011)


RESULTS 

Invasive species in anthropogenic woodland 

In the anthropogenic woodlands of Euro-American poplar and willow, 32 invasive 

plant species, classified into 18 families, were recorded. Species and their families are 

presented in Table 1: 

Table 1. Invasive species and subspecies of plants that occur in anthropogenic woodland 

ecosystems 

Species 

Family 

Acer negundoL. 1753 

Aceraceae 

Ailanthus altissima(Mill.) Swingle 1916 

Simarubaceae 

Ambrosia artemisiifoliaL. 1753 

Asteraceae 

Ambrosia trifida L. 1753 

Asteraceae 

AmorphafruticosaL.1753 

Fabaceae 

Artemisia annuaL. 1753 

Asteraceae 

AsclepiassyriacaL. 1753 

Apocynaceae 

BidensfrondosaL. 1753 

Asteraceae 

Broussonetiapapyrifera(L.) Vent. 1799 

Moraceae 

CeltisoccidentialisL. 1753 subsp. occidentalis Ulmaceae 

Conyzacanadensis(L.) Cronquist. 1943 

Asteraceae 

Echinochloa crus-galli(L.) Beauv. 1812 

Poaceae 

Echinocystislobata(Michx.) Torr. et Gray 1840 Cucurbitaceae 

ElaeagnusangustifoliaL.1753 

Elaeagnaceae 

Eleusineindica(L.) Gaertn. 1788 

Poaceae 

Erechtiteshieraciifolius(L.) DC. 1838 

Asteraceae 

Erigeron annuus(L.) Pers. 1807 

Asteraceae 

FraxinusamericanaL. 1753 

Oleaceae 

FraxinuspennsylvanicaMarsh. 1785 

Oleaceae 

GleditsiatriacanthosL. 1753 

Fabaceae 

Impatiens glanduliferaRoyle 1834 

Balsaminaceae 

Juglansnigra L. 1753 

Juglandaceae 

Oxalis strictaL. 1753 

Oxalidaceae 

PhytolaccaamericanaL. 1753 

Phytolaccaceae 

Reynoutria japonica Houtt. 1777 

Polygonaceae 

Rhustyphina L. 1756 

Anacardiaceae 

RobiniapseudacaciaL. 1753 

Fabaceae 

SicyosangulatusL. 1753 

Cucurbitaceae 

SolidagocanadensisL. 1753 

Asteraceae 

SolidagogiganteaAiton. 1789 

Asteraceae 

Symphyotrichumsalignum(Willd.) G.L.Nesom 1995 Asteraceae 

Vitisriparia Michx. 

Vitaceae 

Total number of species 32 Total number of families 18 

Percentual representation of different families in the total list of invasive taxa that 

occur in anthropogenic woodlands is presented in Table 2.


Table 2. Percentual representation of different families in invasive species flora in 

anthropogenic woodlands 

Number of taxa 

Family 

within the family 

Representation (%) 

Aceraceae 1 3.125 

Anacardiaceae 1 3.125 

Apocynaceae 1 3.125 

Asteraceae 10 31.250 

Balsaminaceae 1 3.125 

Cucurbitaceae 2 6.250 

Elaeagnaceae 1 3.125 

Fabaceae 3 9.375 

Juglandaceae 1 3.125 

Moraceae 1 3.125 

Oleaceae 2 6.250 

Oxalidaceae 1 3.125 

Phytolaccaceae 1 3.125 

Poaceae 2 6.250 

Polygonaceae 1 3.125 

Simarubaceae 1 3.125 

Ulmaceae 1 3.125 

Vitaceae 1 3.125 

Figure 2 shows the representation of different families among the invasive taxa that 

occur in anthropogenic woodlands. 

Figure 2. The representation of different families among invasive taxa that occur in 

anthropogenic woodlands


Table 3. Life forms of invasive taxa that occur in anthropogenic woodlands 

Species 

Life form 

Acer negundoL. 1753 

dec Mes P scap 

Ailanthus altissima(Mill.) Swingle 1916 

dec P scap 

Ambrosia artemisiifoliaL. 1753 

a-autMes-Alt T scap 

Ambrosia trifidaL. 1753 

a-aut Meg-Alt T scap 

AmorphafruticosaL.1753 

dec P caesp 

Artemisia annuaL. 1753 

a-aut Meg-Alt T scap 

AsclepiassyriacaL. 1753 

a Meg-Alt G scap/rhiz 

BidensfrondosaL. 1753 

aut Meg T scap 

Broussonetiapapyrifera(L.) Vent. 1799 

v fodecMesP scap 

CeltisoccidentialisL. 1753 subsp. occidentalis 

vfodecMes P scap 

Conyzacanadensis(L.) Cronquist. 1943 

T scap 

Echinochloa crus-galli(L.) Beauv. 1812 

a MegT caesp 

Echinocystislobata(Michx.) Torr. et Gray 1840 ST herb 

ElaeagnusangustifoliaL.1753 

fodecMesP scap 

Eleusineindica(L.) Gaertn. 1788 

a Mes-Mac T scap 

Erechtiteshieraciifolius(L.) DC. 1838 

a-autMee-Meg (Alt) T scap 

Erigeron annuus(L.) Pers. 1807 

a Mes-Meg (Alt) T scap/bienn 

FraxinusamericanaL. 1753 

v fodecMes P scap 

FraxinuspennsylvanicaMarsh. 1785 

dec P scap 

GleditsiatriacanthosL. 1753 

a-autMes-Meg (Alt) G scap/rhiz 


a Meg-Alt T scap 

JuglansnigraL. 1753 

fodecMes P scap 

Oxalis strictaL. 1753 

v-a Mi-Mac H rept 

PhytolaccaamericanaL. 1753 

a-autMes-Meg (Alt) G scap/rhiz 

Reynoutria japonica Houtt. 1777 

a Meg-Alt H scap 

RhustyphinaL. 1756 

v fodecMi-Mes P scap 

RobiniapseudacaciaL. 1753 

dec P scap 

SicyosangulatusL. 1753 

a ST herb 

SolidagocanadensisL. 1753 

H scap 


H scap 

Symphyotrichumsalignum (Willd.) G.L.Nesom 1995 a-aut Meg-Alt H scap 

VitisripariaMichx. 

P rept / a S P 

Representation of different life forms is presented in Table 4. 

Table 4. Representation of different life forms among invasive taxa in anthropogenic woodlands 

Designation Life form 

Number of Representation 

taxa 

(%) 

G scap/rhiz Geophyte with erect stem 3 9.375 

H rept Hemicryptophyte with creeping stem 1 3.125 

H scap Hemicryptophytewith erect stem 4 12.500 

P caesp Phanerophyte, turf 1 3.125 

P rept / a S P Phanerophytewith creeping stem 1 3.125 

P scap Phanerophytewith erect stem 8 25.000 

ST herb Vines 2 6.250 

T caesp Therophyte, turf 1 3.125 

T scap Therophytewith erect stem 8 25.000 

T scap/bienn Therophyte with erect stem, biennial 1 3.125


Figure 3 shows the representation of various life forms among invasive taxa that 

occur in anthropogenic woodlands. 

Figure 3. Representation of different life forms among invasive taxa 

that occur in anthropogenic woodlands 

Table 5. presents the origins of invasive species that occur in anthropogenic 

woodlands in Vojvodina. 

Table 5. Indigenous ranges of invasive taxa that occur in anthropogenic woodlands of Vojvodina 

The title of the 

Indigenous areal 

North America 

Acer negundo L. 1753 

USA. - South, East 

Asia 

Ailanthus altissima (Mill.) Swingle 1916 

Eastern Asia 

North America 

Ambrosia artemisiifolia L. 1753 

USA - South 

North America 

Ambrosia trifida L. 1753 

Canada - Central and southern 

USA - the entire country 

North America 

Canada - the southeastern part 

Amorphafruticosa L.1753 


Mexico – northern part 

Asia 

middle Asia 

Artemisia annua L. 1753 

Europe 

Eastern and southern Europe 

North America 

Asclepiassyriaca L. 1753 

Canada - the entire country 

USA - the entire country


Bidensfrondosa L. 1753 

Broussonetiapapyrifera (L.) Vent. 1799 

Celtis L. occidentialis 1753 subsp.occidentalis 

Conyzacanadensis (L.) Cronquist. 1943 

Echinochloa crus-galli (L.) Beauv. 1812 

Echinocystislobata (Michx.) Torr. et Gray in 

1840 

Elaeagnusangustifolia L.1753 

Eleusineindica (L.) Gaertn. 1788 

Erechtiteshieraciifolius (L.) DC. 1838 

Erigeron annuus (L.) Pers. 1807 

Fraxinusamericana L. 1753 

Fraxinuspennsylvanica Marsh. 1785 

Gleditsiatriacanthos L. 1753 


Juglansnigra L. 1753 

North America 



Central America 

South America 

Northern tropical countries 

Pacific countries 

Atlantic countries 

Europe 

eastern, southern and western 

North America 



North America 

USA - South, East 

North and Central America 

North America 



Central America (Caribbean) 

Australia and Oceania 

North America, USA east 

Asia 

eastern, southeastern, middle 

Europe 

Eastern (Mediterranean), southern 

Africa 

middle 

Asia 

South and South East 

North America 

Canada - Eastern part 

USA -western, eastern and southern parts 

South America 

Pacific countries 

North America 

Canada - eastern, central and midwestern 

parts 


Asia 

East (China, Japan) 

North America 

USA - the eastern part of the country 

North America 


North America 


Asia -southern, the Himalayas 

North America 

Canadian East 

USA - the eastern part of the country


Oxalis stricta L. 1753 

Phytolaccaamericana L. 1753 

Reynoutria japonicaHoutt. 1777 

Rhustyphina L. 1756 

Robiniapseudacacia L. 1753 

Sicyosangulatus L. 1753 

Solidagocanadensis L. 1753 


Symphyotrichumsalignum (Willd.) GLNesom 

1995 

VitisripariaMichx. 

North America 

A Canadian - eastern and central part of 

the country 


North America 

USA - eastern and southern parts of the 

country 

Asia 

East (China, Japan) 

North America 

Canadian East 


North America 

USA - the southeastern part of the country 

North America 

Canadian East 


North America 



North America 



North America 

USA - the eastern part of the state 

North America 



Table 6 presents percentual representation of the origin of invasive taxa that occur in 

anthropogenic woodlands of euroamerican poplar and willow. 

Table 6. The representation of different indigenous areal of the invasive taxa 

Indigenous areal Number of taxa Representation (%) 

Asia 3 9.375 

Asia and Europe 2 6.250 

Africa and Asia E 3.125 

North America 21 65.625 

North America and Asia 1 3.125 

North America and Europe 1 3.125 

North and Central America, 

Australia and Oceania 

1 3.125 

North, Central and South 

America 

2 6.250


Figure 4 presents the participation of the origin of invasive taxa that occur in 

anthropogenic woodlands of euroamerican poplar and willow. 

Figure 4. participation of the origin of invasive taxa that occur in anthropogenic woodlands of 

euroamerican poplar and willow 

DISCUSSION 

According to data obtained by reviewing the literature and the material from the 

Herbarium of the Department of Biology and Ecology, - Faculty of Science in Novi Sad 

(BUNS), as well as the data obtained by field research, 32 invasive taxa that occur in 

anthropogenic woodlands of euroamerican poplar and willow were confirmed for the area 

of Vojvodina. Based on the reviewed literature and processed data from the field, we can 

say that invasive species that typically occur in anthropogenic poplar woodlands are: Acer 

negundo, Ailanthus altissima, Ambrosia artemisiifolia, Amorpha fruticosa, Artemisia 

annua, Asclepias syriaca, Conyza canadensis, Gleditsia triacanthos, Robinia pseudacacia 

and Solidago canadensis. These species have been recorded at all research sites, where they 

form dense populations that inhibit the growth and development of other plant species. The 

most common species in the floor of herbaceous plants are: Ambrosia artemisiifolia, 

Conyza canadensis, Acer negundo saplings and Gleditsia triacanthos. Species Amorpha 

fruticosa, Asclepias syriaca, Robinia pseudacacia and Ailanthus altissima occur in the 

peripheral parts of anthropogenic woodlands.


All invasive taxa are classified into 18 families: Aceraceae, Anacardiaceae, 

Apocynaceae, Asteraceae, Balsaminaceae, Cucurbitaceae, Elaeagnaceae, Fabaceae, 

Juglandaceae, Moraceae, Oleaceae, Oxalidaceae, Phytolaccaceae, Poaceae, 

Polygonaceae, Simarubaceae, Ulmaceae, Vitaceae. The most represented family is 

Asteraceae which includes as many as 10 taxa (31.25%). Less represented families are 

Fabaceae (9.375), then Cucurbitaceae and Poaceae with 6.25%, while other families are 

represented by only one species (3.125%). 

Invasive species that grow in artificial woodlands occur in eight different life forms, 

geophytes with an upright stem, hemicryptophyte with creeping stem, hemicryptophyte 

with erect stem, phanerophyte in turfs, phanerophyte with creeping stem, phanerophyte 

with erect stem, vines, therophyte in turfs , therophyte with erect stem, therophyte with 

erect stem and leaf rosette. Analyzing life forms, it was found that the majority of invasive 

flora of artificial woodlands belongs to the group of phanerophyte with erect stem (25%) 

and the group of therophyte with erect stem (also 25%) . Among these taxa, significantly 

represented are also hemicryptophyte with erect stem (12.5%). Geophytes with erect stem 

are represented by three species (9.375%),vines by two species (6.25%), while other 

ecobiomorphs occur only in individual species. Most taxa have medium or tall stems and 

their phenophase of flowering is in the summer. 

Analysis of the origin of these invasive species revealed that 65.625% come from 

North America, the United States and Canada. Asian species are less frequent –9.375% 

species has this indigenous areal. Eurasian species that have invasively expanded their areal 

are represented by 6.25% of the analyzed flora. In the same percentage are represented the 

indigenous species of North, Central and South America. In Vojvodina’s anthropogenic 

woodlands grows one Afro-Asian, North American-Asian and American-Australian 

species. 

CONCLUSION 

Recordings in the anthropogenic woodland count 32 invasive plant taxa, classified in 18 

different families. The most dominant species are of the family Asteraceae which includes 

as many as 10 taxa (31.25%). 

Invasive species that grow in artificial woodlands occur in eight different life forms. 

The most common are phanerophyte with erect stem (25%) and the group of therophyte 

with erect stem (also 25%). Most taxa have medium or tall stems and their flowering 

phenophaseis in the summer. 

Analysis of the origin of invasive species that grow in the artificial woodlands in 

Vojvodina, showed that the most frequent species are from North America (65 625%), i.e. 

from different parts of the United States and Canada. 

Invasive plant species significantly alter biodiversity of all ecosystems in which they 

occur. Also, these species degrade the biodiversity of anthropogenic woodlands. Invasive 

plant species that occur in anthropogenic woodlands negatively affect the biodiversity of 

these woodland communities and are establishing a foothold from which they can expand 

onto surrounding ecosystems. In order to maintain balance in woodland ecosystems, but 

also to prevent further expansion of exotic species, it is important to control the number and 

density of their populations with adequate measures of suppression.


LITERATURE 

Anon. (2003): Guidance on monitoring for Water Framework Directive (CIS Working group 

2.7). Final version. 

Daehler, C., C. (1998): The taxonomic distribution of invasive angiosperm plants: ecological 

insights and comparation to agricultural weeds. Biological Conservation, 84(12): 167- 

180.. 

Diklić, N. (1972b); Robinia pseudo-acacia L. U: Mladen Josifović (ur.). Flora SR Srbije. br. 4. 

Srpska Akademija Nauka i Umetnosti, Odeljenje Prirodno-matematičkih nauka. 

Beograd. 

Diklić, N. (1973): Rod Ailanthus Desf. U: Josifović, M. (ur.): Flora Srbije br. V. Srpska 

Akademija Nauka i Umetnosti. Beograd. 

Gajić, M. (1975): Conyza canadensis (L.) Cronquist. U: Josifović, M. (ur.): Flora Srbije br. 7. 

Srpska Akademija Nauka i Umetnosti. Beograd. 

Gajić, M. (1975): Rod Ambrosia L. U: Josifović, M. (ur.): Flora Srbije br. V. Srpska Akademija 

Nauka i Umetnosti. Beograd. 

Gajić, M. (1975): Rod Artemisia L. U: Josifović, M. (ur.): Flora Srbije br. V. Srpska Akademija 


Gajić, M. (1975a); Solidago canadensis L. U: Mladen Josifović (ur.). Flora SR Srbije. br 7. 

Srpska Akademija Nauka i Umetnosti, Odeljenje Prirodno-matematičkih nauka. 

Beograd. 

Horvat, I. (1950): Šumske zajednice Jugoslavije. Institut za šumarska istraživanja ministarstva 

šumarstva N. R. Hrvatske. Nakladni Zagreb Hrvatske. Zagreb. 

Ivanišević, P., Galić, Z., Rončević, S., Kovačević, B., Marković, M. (2008): Značaj podizanja 

zasada šumskog drveća i žbunja za stabilnost i održivi razvoj ekosistema u Vojvodini. U: 

Orlović, S. (ur.): Topola Br. 181-182. Istraživačko razvojni institut za nizijsko šumarstvo 

i životnu sredinu. Novi Sad. 

Janković, M. (1973): Asclepias syriaca L. 1753. U Mladen Josifović (ur.). Flora SR Srbije. Vol 

5. Srpska Akademija Nauka i Umetnosti, Odeljenje Prirodno-matematičkih nauka. 

Beograd. 

Jovanović, B. (1973): Fraxinus pennsylvanica Marshall 1785. U: Mladen Josifović (ur.). Flora 

SR Srbije. Vol 5. Srpska Akademija Nauka i Umetnosti, Odeljenje Prirodnomatematičkih 

nauka. Beograd. 

Jovanović, B. (1973): Rod Acer L. U: Josifović, M. (ur.): Flora Srbije br. V. Srpska Akademija 


Landolt, E. (1977): Oekologische Zeigerwerte zur Schweizer Flora. Veroeffentlichungen des 

geobotanischen institutes der eidg. Techn. Hochule, Stiftung Ruebel. Zurich. 

McNeill, J. (1976): Solidagogigantea L. In: Tutin, T, G, Heywood, V., H., Burges, N., A., 

Moore, D., M., Valentine, D., H., Walters, M., S., Webb, D., A. Assisted by Charter, A., 

O., DeFilipps, R., A., Richardson, I., B., K. (Eds). Flora Europaea. Vol 4.Cambridge at 

Univercity Press, Cambridge. 110. 

Panjković, B., Sabadoš, K., Stojšić, V. (2006): Invazivne biljne vrste na zaštićenim prirodnim 

dobrima u Vojvodini. VIII Simpozijum o flori jugoistočne Srbije i susednih područja. 

20-24 jun. Niš. Srbija i Crna Gora. 

Pimental, D., Lach, L., Zuniga, R., Morrison, D. (2000): Enviromental and economic costs of 

nonindigenous species in the United States. BioScience, 50: 53-65. 

Puhalo, S. (2009): Autohtone i alohtone drvenaste vrste Specijalnog rezervata prirode 

„Koviljsko-Petrovaradinski rit“. Diplomski rad. Prirodno-matematički fakultet. Novi 

Sad. 

Soó, R. (1966): A magyar flóra ès vegetáció rendszertani-növènyföldrajzi kèzikönyve I-VII. 

Akadèmiai Kiadó, Budapest.


Stevanović, V., Šinžar-Sekulić, J., Stevanović, B. (2004): Expansion of the adventive species 

Paspalum paspaloides (Michx) Schribner, Echinochloa oryzoides (Ard) Fritsch and 

Cyperus strigosus L. in Yugoslav part of the Denaub reservoir(km 1090-1075). In: 

Teodorović, I., Rdulović, S., Bloesc, J. (Eds.), Limnological Reports, Vol 35, 

Procwwdings of the 35 th IAD Conference, Novi Sda, Serbia and Montenegro, pp.399- 

405. 

Šilić, Č. (1990): Šumske zeljaste biljke. IP „Svetlost“. Zavod za udžbenike i nastavna sredstva. 

Sarajevo. Zavod za udžbenike i nastavna sredstva. Beograd. 

Takhtajan, A. (1997): Diversity and Classification of Flowering Plants. Columbia University 

Press, New York 

Tomović, Z. (2006): Sadašnje stanje prema korisnicima i mogućnosti za unapređenje stanja i 

osnivanje novih zasada i šuma u Javnim preduzećima "Vojvodinašume" Petrovaradin, 

"Vode Vojvodine" Novi Sad i Nacionalni park "Fruška gora" Sremska Kamenica. Studija 

"Stanje šuma i potencijali razvoja u Autonomnoj pokrajini Vojvodini". Poljoprivredni 

fakultet Novi Sad, Institut za nizijsko šumarstvo i životnu sredinu, pp: 25-41. 

Tunić, T. (2008): Upravljanje Specijalnim rezervatom prirode „Koviljsko-Petrovaradinski rit“, 

problem invazivnih drvenastih vrsta. Završni rad. Prirodno-matematički fakultet. Novi 

Sad. 

Tutin, T, G. (1968): Ailanthus altissima (Miller) Swingle 1916 In: Tutin, T, G, Heywood, V., H., 

Burges, N., A., Moore, D., M., Valentine, D., H., Walters, M., S., Webb, D., A. Assisted 

by Ball, P., W., Charter, A., O., Ferguson, I., K. (Eds). Flora Europaea. Vol 2.Cambridge 

at Univercity Press, Cambridge. 231. 

Tutin,T, G. (1968): Echinocystis lobata (Michx.) Torr.et Gray. In: Tutin, T, G, Heywood, V., H., 

Burges, N., A., Moore, D., M., Valentine, D., H., Walters, M., S., Webb, D., A. Assisted 

by Ball, P., W., Charter, A., O., Ferguson, I., K. (Eds). Flora Europaea. Vol 2.Cambridge 

at Univercity Press, Cambridge. 231. 

Vitousek, P., D'Antonio, C. M., Loope , L.,L., Rejmanek, M., Westbrooks, R.(1997): Introduced 

species: a significant component of human-caused global change.New Zeland Journal of 

Ecology. 21: 1-16. 

Vlatković, S. (1986): Funkcije šuma i optimalna šumovitost Vojvodine. Doktorska disertacija, p. 

321, Institut za topolarstvo. Novi Sad. 

Vukićević, (1973): Eleagnus angustifolia L. 1753. U: Josifović, M. (ur.): Flora Srbije br. V. 

Srpska Akademija Nauka i Umetnosti. Beograd. 

Websites 

http://www.nps.gov 

http://www.ekoplan.gov.rs 

http://iasv.dbe.pmf.uns.ac.rs

64 Soil persistence of tritosulfuron+dicamba in the... 

International Symposium: Current Trends in Plant Protection UDK: 632.954.028:631.4(560) 

Proceedings 

SOIL PERSISTENCE OF TRITOSULFURON+DICAMBA IN THE 

CENTRAL ANATOLIA REGION IN TURKEY 

AHMET TANSEL SERIM 1 , SALIH MADEN 2 

1 South Marmara Development Agency 17100, Çanakkale, Turkey 

2 Ankara University Faculty of Agriculture Department of Plant Protection 06120, Ankara, 

Turkey 

*e - mail: tserim@gmka.org.tr 

Tritosulfuron+dicamba is widely used in wheat and maize production areas for the control 

wild bishop, milk thistle, common cocklebur, black nightshade. In order to determine the persistence 

of the herbicide residue in the soil, laboratory studies were conducted in growth chamber. The 

herbicide was applied at three rates (100, 200, 400 g ha -1 ) in different times (early and late) in two 

sites in the field to obtain soil samples for sunflower seedling bioassay. Soil was sampled from top 15 

cm at 3, 6, 12, and 15 month after treatment (MAT). Herbicide soil residues in the soil decreased 

rapidly at 3 month after application and continued to decrease slightly at 6 MAT. After one year, 

herbicide residues were not detected. The effect of application time on the herbicide soil residue was 

not important at the four sampling times, but the effect of application time was important in 

interactions with site at 3 MAT and with dose and dose x site at the 6 MAT. The herbicide residues 

were higher at site 1 at both application times, especially at 3 rd month. The results showed that sixmonth 

interval for dissipation of tritosulfuron+dicamba in the top 15 cm soil was not enough in the 

Central Anatolia Region in Turkey. 

Key words: Tritosulfuron+dicamba, soil persistence, bioassay, sunflower 

INTRODUCTION 

Tritosulfuron has been used for broadleaf weed control in wheat and maize fields for 

the last decade. Dicamba is a growth regulating herbicide, which has been widely used 

against broadleaf weed species in wheat, corn, sugarcane and rangelands for more than half 

century. Their mixture, tritosulfuron (25%) and dicamba (50%), which is a newer 

formulation, is extensively used in wheat and maize fields against broadleaf weed species, 

such as wild bishop (Bifora radians Bieb.), milk thistle (Silybum marianum L. Gaertn.), 

common cocklebur (Xanthium strumarium L.) and black nightshade (Solanum nigrum L.), 

in Turkey. 

The fate of SU herbicides in soil ranges from few weeks to three or more years. 

Their persistence in the soil environment is mainly dependent on several site specific 

factors, such as rainfall, soil properties, climate and combination of factors (Rapparini et 

al., 2003; Bhowmik et al., 2012; Moyer et al., 1990). Generally, dicamba is regarded as a 

non-residual herbicide, except extreme conditions. Since, it is rapidly broken down due to 

activity of soil microbes under warm and moist soil conditions (Smith and Cullimore,

Ahmet Tansel Serim, Salih Maden 65 

1975). The results of the prior studies show that dicamba may persist for several weeks 

after spray in soil depending on the weather and soil condition (Moyer et al., 1992; 

Burnside and Lavy, 1966; Friesen, 1965). In addition, degradation of the herbicide mixture 

of Tritosulfuron and Dicamba (HMTD) mainly depends on soil-related factors and weather 

conditions (Serim, 2010). 

The concern about herbicide soil residue among grain and legume farmers has risen 

in recent years due to residual herbicides. Afterwards a dry season, some grain producers 

experienced a carryover problem from one crop growing season to another; even they used 

herbicide in recommended rate. Some unfavorable conditions may lead to herbicide 

carryover in some country or some region for soil residual herbicides, such as 

chlorsulfuron. Thus, usages of this type of herbicides are restricted in many countries 

(Başaran and Serim, 2011; Vicari et all., 1994). Under favorable condition, HMTD may 

decompose before it causes injury to succeeding crops. 

Because HMTD is a relatively new herbicide, little published information is 

available on the persistence of HMTD in soil in refereed journals. Therefore, the objective 

of this study was to study the persistence of HMTD under varying spraying times and rates 

under Central Anatolian conditions using the sunflower seedling bioassay. 


Growth chamber trials were conducted to determine degradation of HMTD as 

affected by time under Central Anatolian region’s dry-land conditions using sunflower 

seedling bioassay. 

In order to obtain soil samples for laboratory assays two field trials were conducted 

in a randomized complete block design, with four replications. HMTD was applied using a 

motorized knapsack sprayer. Lechler 1 , AI 110–015, flat fun nozzles were used during spray 

and hold at nearly 50 cm above soil surface. The herbicide used was commercial 

formulation (CF) of Tritosulfuron+Dicamba (Arrat, 250 g active ingredient (a.i.) 

Tritosulfuron kg -1 + 500 g a.i. Dicamba kg -1 . Wettable granule, (WG)). HMTD doses were 

100, 200 (recommended rate of herbicide), 400 g CF ha -1 , and application volume was 400 l 

ha -1 . Early and late HMTD applications were made on April 5, 2008 and April 19, 2008, 

respectively. Field studies were conducted at two sites near Ankara, Turkey. Some physical 

and chemical properties of the soils used in this experiment are shown in Table 1. Three 

soil samples from the top 15 cm were collected from plots at 3, 6, 12 and 15 MAT (Lyon et 

al., 2003; Alonso-Prados et al., 2002). Soil samples taken from plots were air-dried at room 

temperature for 3 days and passed through a 2 mm sieve and then stored in plastic bags at 

+4 o C until used in bioassays. 

Table 1: Selected chemical and physical properties of the clay-loam soils used in the 

investigation 

Sand 

(%) 

Loam 

(%) 

Clay 

(%) 

pH * 

CaCO 3 

(%) 

OM** 

(%) 

P 2 O 5 

K 2 O 

EC 

(dS/m) 

Site 1 27.6 30.9 41.6 7.92 31.07 2.49 25.61 126.84 0.935 

Site 2 32.5 26.3 41.2 7.93 15.85 1.46 5.36 89.27 0.994 

*1:2.5 soil to water, ** Organic matter 

1 Lechler GmbH Manzinger, Almanya

66 Soil persistence of tritosulfuron+dicamba in the... 

The growth chamber experiments were laid out in complete randomized design with 

five replications and repeated twice. Sunflower seedling bioassay was used for determine 

the persistence of HMTD in the soil, as previous studies indicated that sunflower was very 

sensitive to sulfonylureas (Alonso-Prados et al., 2002; Hernandez–Sevillano et al., 2001). 

The growth chamber procedures were adopted from Hernandez–Sevillano et al. (2001). 

Sunflower seeds (Helianthus annuus L. var PR64A71) were placed into two moistened 

germination papers (Schleicher & Schuell No: 5703) 2 in sterile petri dishes and then the 

seeds were incubated for pre-germination over a 3-day period at room temperature. One 

pre-germinated seed was sown in each pot filled with soil samples taken from sprayed and 

untreated plots. The pots were sub-irrigated with deionized water and put in the growth 

chamber (16 h light at 24±1 o C, illumination 100 µE m -2 s -1 and 8 h darkness at 15±1 o C) 

randomly (Hernandez–Sevillano et al., 2001; Alonso-Prados et al., 2002). Afterwards, the pots 

were continued to be sub-irrigate with deionized water as required. The trials were finished 

15 days after sowing (DAS). All seedling roots were gently washed under running tap water 

to remove the soil from roots. Later, the root length of the seedling was measured to the 

nearest millimeter. 

Data were subjected to analysis of variance to determine significant differences at 

the 5% level of significance and means were separated by Duncan’s multiple range test. 

The statistical analysis was performed using SPSS (version 13, SPSS Inc., Chicago, IL, 

USA) and MSTAT-C (version 2.1, Michigan State University, 1991). 


The cumulative rainfall, which were slightly below average of long-term in both 

experimental sites, at the 3 rd , 6 th , 12 th and 15 th month were 88.4, 150.7, 428.3 and 552.1 

mm, respectively. 

Degradation of HMTD was monitored by sunflower seedling bioassay, with respect 

to root lengths. In general, depending on application time and rate, a significant amount of 

HMTD residue was persisted in the top 15 cm soil at 3 rd and 6 th month, while no HMTD 

residue was detected at 12 th and 15 th month. 

The statistical analysis revealed that there is a highly significant difference between 

herbicide doses at the 3rd month and also sites, but no significant interaction between main 

factors (site x application time x herbicide dose). The interaction of doses x sites and of 

sites x application times were significant. All HMTD doses at both times caused by 

statistically significant injury, indicated by root length reduction, when compared with the 

control which was sampled 3 MAT from no herbicide applied plots (Table 2). Root length 

decreased as HMTD dose increased. The root reductions ranged from 37% to 64% 

depending on application time, HMTD dose and site as compared to untreated control. 

The interaction of site x application time x dose was important at the 6rd month 

(Table 2). The effects of site and application time on the HMTD persistence are not 

important statistically. In addition, there is no interaction between site and application time. 

The statistical analysis showed that, there is significant effect of dose on the HMTD 

persistence; and there were highly significant interactions dose x site and dose x application 

time. The residues of half rate HMTD disappeared 6 MAT at site 1, while little amount of 

HMTD residue was persisted at site 2. The residues of full rate HMTD reduced root length 

of sunflower seedling 12-21%, except late application at site 1, which caused 9.4% 

2 Schleicher & Schuell MicroScience GmbH Dassel, Almanya


reduction. This slight difference was probably due to the relatively high variation in 

measured seedling root lengths. At the twice amount of the recommended application dose 

of HMTD, root length of sunflower seedling was considerably reduced (19-55%) due to 

residue of HMTD 6 MAT. 

The HMTD residues at both sites decreased to levels not to cause injury for test 

seedling at the 12th and 15th month (Table 2). Therefore, all test plants apparently 

unharmed by all rates at the 12th and 15th month in both sites. The statistical analysis 

presented that there is a highly significant difference between site 1 and site 2, but the effect 

of dose, application time and the interaction of these were not important. At site 2, the root 

lengths at 12 MAT were generally high, as compared to control. These unexpected long 

root lengths at site 2 might have been attributed to hormesis, which is explained as growth 

stimulation by small doses of herbicides (Wiedman et al., 1972; Calabrese and Baldwin, 

2003). 

More HMTD persisted at site 1 as compared to site 2, especially 3 MAT. This 

phenomenon was more evident at the recommended and double doses of HMTD. These 

results are in agreement with those of Aksoy (2009) that the higher CaCO3 content of the 

soil may cause some SU herbicide carryover. 

The effect of HMTD application time on the seedling root length was not important 

at the four sampling times, but the effect of application time was important in interactions 

with site at the 3rd month and with dose and dose x site at the 6th month. 

In conclusion, the results of this research showed that HMTD degraded at the top 15 

cm of the soil before the succeeding crops were planted, 12 MAT. The risk of HMTD 

carryover injury, however, is likely when used at recommended and double doses 6 MAT. 

As second crop sunflower planted 6 MAT may injure severely from HMTD soil residue 

under unfavorable conditions.

68 Soil persistence of tritosulfuron+dicamba in the...


REFERENCES 

Aksoy, A. (2009) The investigation on adverse effect of the herbicides used in the wheat fields 

on following crops sown after the wheat harvest. Unpublished PhD Thesis. University Of 

Çukurova. 

Alonso–Prados, J.L., Hernandez–Sevillano, E., Lianos, S., Villarroya, M. and Gardia– Baudin, 

J.M. (2002) Effects of sulfosulfuron soil residues on barley (Hordeum vulgare), 

sunflower (Helianthus annuus) and common wetch (Vicia sativa). Crop Protection, 21: 

1061–1066. 

Başaran, M.S., Serim, A.T. (2010) Degradation of herbıcide in the soil. Selçuk Journal of 

Agriculture and Food Sciences, 24: 54–61. 

Burnside, O.C., Lavy, T.L. (1966) Dissipation of dicamba. Weeds, 14: 211–214. 

Friesen, H. A. 1965. The movement and persistence of dicamba in soil. Weeds, 13: 30–33. 

Bhowmik, P., Grey, T.L., McCullough, P.E. (2012) Sulfonylurea Herbicides fate in soil: 

Dissipation, mobility and other processes. Weed Technology In-Press, Doi: 

http://dx.doi.org/10.1614/WT-D-11-00168.1. 

Calabrese, E.J., Baldwin, L.A. (2003) Hormesis: The Dose-Response Revolution. Annu. Rev. 

Pharmacol. Toxicol., 43:175–97. 

Hernandez–Sevillano, E, Villarroya, M., Alonso–Prados, J.L., Garcia–Baudin, J.M. (2001) 

Bioassay to detect MON–37500 and Triasulfuron residues in soils. Weed Technology, 

15: 447–452. 

Lyon, D.J., Miller, S.D., Siefert–Higgins, S (2003) MON 37500 soil residues affect rotational 

crops in the high plains. Weed Technology, 17: 792–798. 

Moyer, J.R., Bergen, P., Schaalje, G.B. (1992) Effect of 2,4-D and dicamba residues on 

following crops in conservation tillage systems. Weed Technology, 6: 149–155. 

Moyer, J.R., Esau, R., Kozub, G.C. (1990) Chlorsulfuron persistence and response of nine 

rotational crops in alkaline soils of southern Alberta. Weed Technology, 4: 543548. 

Rapparini, G., Paci, F., Campagna, G. (2003) Persistence and percolation of metsulfuron-methyl 

and iodosulfuron-methyl applied in post-emergence of wheat. 7. EWRS Mediterranean 

Symposium, Proceedings pp 105-106. 

Serim, A.T. (2010) Investigations on residual effects of some sulphonylurea herbicides on 

sunflower, used in wheat growing areas. Unpublished PhD Thesis. Ankara University. 

Smith, A.E., Cullimore, D.R. (1975) Microbiological degradation of the herbicide dicamba in 

moist soils at different temperatures. Weed Research, 15: 59–62. 

Vicari, A., P. Catizone, Zimdahl, R.L. (1994) Persistence and mobility of chlorsulfuron and 

metsulfuron under different soil and climatic conditions. Weed Research, 34: 147–155. 

Wiedman, S.J., Appleby, A.P. (1972) Plant growth stimulation by sublethal concentrations of 

herbicides. Weed Research, 12: 65–74.

70 Importance of seeds in the process of common ragweed invasion 

International Symposium: Current Trends in Plant Protection UDK: 632.51:582.998.1 

Proceedings 

IMPORTANCE OF SEEDS IN THE PROCESS 

OF COMMON RAGWEED INVASION 

BRUNO CHAUVEL 1,2 , QUENTIN MARTINEZ 2 , JEAN-PHILIPPE GUILLEMIN 3 

1 - INRA, UMR1347 Agroécologie, AgroSup Dijon, INRA, Université de Bourgogne, 17 rue 

Sully, BP 86510, F-21065 Dijon Cedex, France. 

bruno.chauvel@dijon.inra.fr 

2 - INRA – Observatoire de l’ambroisie. 26 bd Docteur Petitjean, BP 87999, 

F-21079 Dijon, France. 

3 - AgroSup, UMR1347 Agroécologie, AgroSup Dijon, INRA, Université de Bourgogne, 26 bd 

Docteur Petitjean, BP 87999, F-21079 Dijon, France. 

Ambrosia artemisiifolia L. (common ragweed) was introduced into Europe at the end of the 

1900s and is now present in several European countries. This annual invasive plant produces seeds 

that are highly polymorphic. Common ragweed can produce only a few thousand highly viable seeds. 

Many studies have focused on the seed stage. Greater seedling emergence for the seeds placed near 

the soil surface could explain the success of this species in open habitats, where the probability of 

deeper burial is low. Emergence percentage was found to decrease as burial depth increased from 2 to 

8 cm, and no germination nor seedling emergence was observed for the seeds buried from 10-cm 

depth. The huge plasticity in seed weight may help common ragweed to cope with a wide range of 

conditions and to establish in very different disturbed habitats. Control of seed production of ragweed 

appears to be a necessary step in its sustainable management. Despite a late seed production in the 

season, which should facilitate the management practices, nothing seems to be able to stop the spread 

of this species. Moreover, because of global warming, the reduction in the number and in the duration 

of days with frost may favour the expansion of common ragweed by increasing the period of seed 

production. 

Key words: Ambrosia artemisiifolia L., germination, seedling emergence, seed weight, burial 

depth, invasion success. 

INTRODUCTION 

Ambrosia artemisiifolia L. is an invasive weed native to North America (Basset and 

Crompton 1975). This species was introduced into Europe at the end of the1900s (Chauvel 

et al. 2006) and is now present in several European countries – such as France (Chauvel et 

al. 2006), Hungary (Török et al. 2003) and Switzerland (Bohren et al. 2006). Common 

ragweed is considered as an invasive species characteristic of disturbed habitats and is 

described as a successful pioneer in early successional ecosystems (Fumanal et al. 2008). 

Since seed stage is a key stage in the life cycle of common ragweed, better 

biological knowledge of its seed is essential in improving the control and stopping the 

spread of this annual species (Figure 1).

Bruno Chauvel, Quentin Martinez, Jean Philippe Guillemin 71 

Figure 1: importance of the seed stage in the life cycle of common ragweed (Ambrosia 

artemisiifolia L.; from Bazzaz, 1979). 

Seed stage is a crucial part of weed biology, especially for invasive annual species: it 

is the unit of reproduction and spread as well as the main means of weed persistence. How 

common ragweed seeds germinate is well known (Bazzaz, 1979): primary dormancy 

requires stratification for seeds to germinate (Willemsen, 1975) and secondary dormancy 

protects them in the seedbank until the conditions become favourable again for germination 

(Bazzaz, 1979). 

Seed weight is widely recognized as a key trait in plant population dynamics and, in 

the case of A. artemisiifolia, the biological characteristics of the seeds are highly 

polymorphic (Washitani and Nishiyama 1992; Fumanal et al. 2007b). The seed production 

of A. artemisiifolia varies from several dozen seeds to several thousand seeds. Seed size 

and weight also vary considerably both within a single population and within a single plant 

individual. This variability is cited as a favourable trait for invasive plants which have to 

cope with a range of different environmental conditions: large seeds are considered better 

adapted for competitive conditions (Fenner and Thompson 2005) and small seeds are often 

associated with greater dispersal and higher persistence in the seedbank (Harper et al. 

1970). Moreover, it is often suggested that species with higher spread rate often have 

relatively larger and heavier seeds. 

To better understand the present success of A. artemisiifolia, we present in this 

article a short review of data describing the role of the seeds in the spread of A. 

artemisifolia. The hypothesis formulated is that seed characteristics are the main cause of 

common ragweed success, even though the seed is not wind disseminated. The aim of this 

contribution is to evaluate the impact of seed variability in the process of common ragweed 

invasion.


GENERAL OBSERVATIONS 

Common ragweed starts to germinate in spring from March to April depending on 

the latitude; it is a short-day plant. In Europe this species usually flower from July to 

October. Male flowering occurs before female flowering. According to climatic conditions, 

seeds are produced from mid-September to late in the season. The seed of A. artemisiifolia 

is an achene (i.e. a hard coat involucre protecting a soft seed containing a unique embryo) 

with a central terminal beak surrounded by a ring of tiny spines (Basset and Crompton, 

1975). The seeds of common ragweed go dormant (primary dormancy), requiring a cold 

and moist period to germinate. The germination may be favoured by light (Baskin and 

Baskin, 1980). The base temperature for their germination phase is estimated at about 3.5°C 

(Shrestha et al., 1999; Sartorato and Pignata, 2008; Gardarin et al., 2010) and the base 

water potential is estimated at about -1 MPa (-0.8 MPa by Shrestha et al., 1999 and -1.28 

MPa by Guillemin et al., 201X), indicating a degree of moisture required during the early 

stages of the species development. If the environmental conditions (temperature, water) are 

not favourable, seeds can remain in a secondary dormancy for several years (Bazzaz, 1979). 

* Seed weight variability 

In a study carried out by Fumamal et al. (2007b), a high variability was observed in 

the seed weight: the mean seed weight varied between 1.72+0.04 to 4.28+ 0.09 mg among 

the ten populations under consideration (Table 1). The seed weights were significantly 

different among populations (Table 1). The authors showed that 13.9% of the total observed 

variation was caused by variation among populations, 22.2% was caused by variation 

among plants within populations. For all ten populations studied, 53.2% of the variation 

was observed among plants (Table 1). 

Table 1: Mean seed weight per Ambrosia artemisiifolia population studied, with variations within 

populations. The individual weight of 30 seeds from 15 plants within each population was 

used (from Fumanal et al., 2007b; Guillemin, personal communication). 

Mean of seed 

Range of seed Coefficient of 

Standard error 

weight 

weight variation (%) 

Population 1 1.72 0.04 0.4 – 6.6 88.8 

Population 2 3.07 0.08 0.2 – 9.8 73.4 

Population 3 3.08 0.08 0.2 – 7.6 75.8 

Population 4 3.28 0.08 0.4 – 7.7 45.2 

Population 5 3.48 0.07 0.3 – 8.0 43.8 

Population 6 3.60 0.06 0.4 – 7.2 40.2 

Population 7 4.08 0.05 1.2 – 7.7 34.6 

Population 8 4.10 0.05 1.1 – 8.0 33.4 

Population 9 4.21 0.04 0.9 – 9,0 30.2 

Population 10 4.28 0.09 1.3 – 9.1 60.7 

Very high variability within an individual plant has also been confirmed for another 

set of French populations (Figure 2). Only a precise characterization of the development 

and growth conditions (competition intensity, climatic conditions, etc.) could explain the 

variability observed. The germination date, as well as the effects of control practices, can 

strongly modify seed weight.


The high seed-weight variability observed within populations of A. artemisiifolia 

could be related to the high genetic diversity found within populations. Various studies 

(Genton et al. (2005) demonstrated that the genetic diversity of populations was very high 

in the area of introduction suggesting a link between diversity and invasibility. 

Figure 2: Box plot of weight (mg) of individual seeds for seven different French populations 

(15 plants per population; 30 seeds per plant; from Chauvel et al., 2005).


The plasticity in seed weight may certainly help common ragweed to cope with a wide 

range of conditions and to establish in very different disturbed habitats. The role of the seedbank 

then certainly varies according to the habitat. 

* Seed production 

In comparison with other weed species such as Chenopodium album L. and 

Amaranthus retroflexus L. (two species with a development cycle similar to that of 

A.artemisiidfolia but with a potential seed production of tens of thousands of seeds per 

plant), common ragweed has a seed production relatively low approximately 2500 seeds per 

plant on average (from 300 to 6000; Fumanal et al., 2007a). On nutrient-poor areas, an 

average of only 160 seeds per plant were observed (from 6 to 810; Chauvel and Fumanal, 

2009), and the number of seeds produced in mowed plants on roadsides is certainly even 

lower. That could be considered as a weakness for an invasive species whose natural seed 

dispersal level is very low. The relatively low seed production is nonetheless offset by a 

very high rate of viability (on average at least 75% of viability – from 56 to 90%) for a 

strictly allogamous species. 

* Seed quality 

All the categories of seeds are able to germinate and no differences were observed 

between large and small seeds (Guillemin and Chauvel, 2011). Seed weight did not 

influence germination rate of A. artemisiifolia. 

Common ragweed is characterized by long-term survival in the seedbank. In 

historical experiments initiated in 1879, 4% of seeds of common ragweed were able to 

germinate after 40 years (Darlington, 1922). In another experiment initiated in 1902, 21% 

and 57% of the seeds respectively buried 8 cm and 22 cm in the soil germinated 30 years 

later, while those buried 22 cm deep germinated after 39 years (Toole and Brown, 1946). 

This survival in the seedbank contributes to the success of ragweed but may over time have 

a very negative effect on managers as they get discouraged by successive germinations of 

ragweed over the years. 

* Seed emergence 

The size and weight of common ragweed seed raise the question of the ability of the 

seed to germinate and to emerge at different depths (Guillemin et al., 2011). In this study, 

the rates of germination and seedling emergence were greater for the seeds on the soil 

surface or near of the soil surface, and decreased as burial depth increased from 2 to 8 cm. 

Martinez et al. (2002) indicated that seeds rarely germinate if buried deeper than 4 cm.


Figure 3: Seedling emergence of Ambrosia artemisiifolia seeds for three weight classes (White 

bar - light (L) 5 mg) at 

several burial depths. For each depth, the bars with different letters are significantly different, 

with P


for such an invasive annual species. It would also be very interesting to study the role of 

mycorrhizal fungi in the germination and emergence of common ragweed. If the 

ecophysiology of the seed stage has been much studied in the United States, few data are 

available on the possible regulation of seeds in the seedbank (Trichard, 2012). 

Its ability to germinate in a wide range of temperature, light and depth conditions 

seems well adapted to environmental variations of disturbed environments and to avoid 

strong competition in cultivated areas. Seeds from roadside population are able to 

germinate with high concentrations of salt; this observation indicate that common ragweed 

populations may be locally adaptive and also allows it to colonize roadsides by giving it a 

competitive advantage over other species (DiTommaso, 2004). At least the floating ability 

of the seed has been demonstrated for A. artemisiifolia (Fumanal et al. 2007b): the recent 

invasion of southern France by A. artemisiifolia could mainly be explained by water 

dispersal of seeds through rivers and confirms its colonization potential along French rivers 

with large banks. This water dispersion allows seeds to travel long distances and to colonize 

natural environments that are only weakly occupied by native species. The process of seed 

dispersal by irrigation in cultivated areas is still unknown. 

The role of seeds is fundamental in the invasion by common ragweed. Seed 

plasticity certainly plays a major role in this invasion. In the same way, the role of the 

seedbank is certainly very important in maintaining populations in cultivated areas, while in 

disturbed habitats – but without soil disturbance (roadsides), the ability of small seeds to 

germinate at the soil surface is crucial. The control of seed production by new techniques 

issued for example from biological management (Gerber et al., 2011) is essential for a 

sustainable and integrated control of A. artemisiifolia. 


We thank Jean-Luc Demizieux for his help in reviewing the manuscript. 

REFERENCES 

Baskin J.M., Baskin C.C. (1980): Ecophysiology of secondary dormancy in seeds of Ambrosia 

artemisiifolia. Ecology, 61: 475-480. 

Basset, I.J., Crompton C.W. (1975): The Biology of Canadian Weeds. 11. Ambrosia 

artemisiifolia L. A. psilotachya DC. Canadian Journal of Botany 55: 463 - 476. 

Bazzaz, F.A. (1979): The physiological ecology of plant succession. Annual Review of Ecology 

and Systematics, 10: 351 - 371. 

Bohren, C., Mermillod, G., Delabays, N. (2006): Common ragweed (Ambrosia artemisiifolia L.) 

in Switzerland: development of a nationwide concerted action. Journal of Plant Disease 

Protection. XX: 497-503. 

Chauvel, B., Fumanal, B., Sabatier, A., Dessaint, F. (2005): Variabilité morphologique des 

semences d’Ambrosia artemisiifolia L. Colloque Invasions Biologiques et Traits 

d'Histoire de Vie : de l'approche descriptive à l'approche prédictive» 30 juin & 1er juillet 

2005, Campus de Beaulieu, Rennes (France). 

Chauvel, B., Fumanal, B. (2009): Production de semences d’Ambrosia artemisiifolia L. en 

conditions limitantes. XIIIème Colloque International sur la Biologie des Mauvaises 

Herbes. Dijon (France) – 8 - 10 Septembre 2009. 465 - 472. CD Rom N° ISBN 978-2- 

950550-17-0.


Chauvel, B., Dessaint, F., Cardinal-Legrand, C., Bretagnolle, F. (2006): The historical spread of 

Ambrosia artemisiifolia L. in France from herbarium records. Journal of Biogeography, 

33: 665 - 673. 

Darlington, H.T. (1922): Dr. W.J. Beal's seed viability experiment. American Journal of Botany, 

9: 266 – 269. 

DiTommaso, A. (2004): Germination behaviour of common ragweed (Ambrosia artemisiifolia) 

populations across a range of salinities. Weed Science, 52: 1002 – 1009. 

Fenner, M., Thompson, K. (2005): The Ecology of Seeds. 1st Edn., Cambridge University Press, 

Cambridge, UK., ISBN: 0521653681. 

Fumanal B., Chauvel B., Bretagnolle F. (2007a): Estimation of pollen and seed production of 

common ragweed in France. Annals of Agricultural and Environmental Medicine, 14: 

233 - 236. 

Fumanal, B., Chauvel, B., Sabatier, A., Bretagnolle F. (2007b): Variability and cryptic 

heteromorphism of Ambrosia artemisiifolia seeds: what consequences for its invasion in 

France? Annals of Botany, 100: 305 -313. 

Fumanal, B., C. Girod, G. Fried, Bretagnolle F., Chauvel B. (2008): Can the large ecological 

amplitude of Ambrosia artemisiifolia explain its invasive success in France? Weed 

Research, 48: 349 - 359. 

Fumanal B., Plenchette C., Chauvel B., Bretagnolle F. (2006): Which role can arbuscular 

mycorrhizal fungi play in the facilitation of Ambrosia artemisiifolia L. invasion in 

France? Mycorrhiza, 17: 25 – 35. 

Gardarin A, Guillemin JP, Munier-Jolain NM, Colbach N. (2010): Estimation of key parameters 

for weed population dynamics models: Base temperature and base water potential for 

germination. European Journal of Agronomy, 32: 162-168. 

Genton, B.J., Shykoff, J.A., Giraud, T. (2005): High genetic diversity in French invasive 

populations of common ragweed, Ambrosia artemisiifolia, as a result of multiple sources 

of introduction. Molecular. Ecology, 14: 4275 - 4285. 

Gerber, E., Schaffner, U., Gassmann, A.,Hinz, H. L.,Seier, M.,Mueller-Schaerer, H. (2011): 

Prospects for biological control of Ambrosia artemisiifolia in Europe: learning from the 

past. Weed Research, 51 (6): 559 - 573. 

Guillemin J-P., Chauvel B. (2011): Effects of seed weight and burial depth on seed behavior of 

common ragweed (Ambrosia artemisiifolia). Weed Biology Management, 11: 217 – 223. 

Guillemin J.P., Gardarin A., Granger S., Reibel C., Munier-Jolain N., Colbach N. (201X): 

Assessing of base temperatures and base water potentials for germination of weeds. 

Weed Research, accepted with minor revisions. 

Harper J.L., Lovell P.H., Moore K.G. (1970): The shapes and sizes of seeds. Importance of the 

seed stage. 1: 327 - 356. 

Hirschwehr R., Heppner, C., Spitzauer, S., Sperr, W.R., Valent, P., Berger, U., Horak, F., Jäger, 

S.,Kraft, D., Valenta, R. (1998): Identification of common allergenic structures in 

mugwort and ragweed pollen. Journal of Allergy and Clinical Immunology, 101 (2): 196 

– 206. 

Martinez M.L., Vasquez G, White A, Thivet G., Brengues M. (2002): Effect of burial by sand 

and inundation by fresh- and seawater on seed germination of five tropical beach species. 

Canadian Journal of Botany, 80: 416 - 424. 

Sartorato, I, Pignata, G. (2008): Base temperature estimation of 21 weed and crop species. In: 

Proceedings 2008 of the 5 th International Weed Science Congress, Vancouver (Canada). 

Shrestha A., Roman E.S., Thomas A.G., Swanton C.J. (1999): Modeling germination and shootradicle 

elongation of Ambrosia artemisiifolia. Weed Science, 47: 557 - 562. 

Stoller E.W., Wax L.M. (1973): Periodicity of germination and emergence of some annual 

weeds. Weed Science, 21: 574-580


Toole, A.H., Brown, E. (1946): Final results of the Duvel buried seed experiment. Journal of 

Agricultural Research, 72: 201 - 210. 

Török, K., Botta-Dukat Z., Dancza I., Németh, I., Kiss, J., Mihaly B., Magyar D. (2003): 

Invasion gateways and corridors in the Carpathian Basin: biological invasions in 

Hungary. Biological Invasions, 5: 349 - 356. 

Trichard A., Auguste C., Petit S., Chauvel B. (2012): Ragweed seed predation by invertebrates 

in cultivated area. IInd International Ragweed Conference, Lyon (France), March 28-29, 

2012. 

Washitani, I.,S. Nishiyama (1992): Effects of seed size and seedling emergence time on the 

fitness components of Ambrosia trifida and A. artemisiaefolia var. elatior in competition 

with grass perennials. Plant Species Biology, 7: 11 - 19. 

Willemsen R.W. (1975): Dormancy and germination of common ragweed seeds in the field. 

American Journal of Botany, 62: 639 - 643.

Yakup Erdal Erturk, Ilhan Uremis, Ahmet Uludag 79 

International Symposium: Current Trends in Plant Protection UDK: 633.15-29:33(560) 

Proceedings 

THE ECONOMIC IMPACT OF WEEDS AND THEIR CONTROL IN 

TURKEY 

YAKUP ERDAL ERTURK 1 ILHAN UREMIS 2 AHMET ULUDAG 3 

1 Assist. Prof. Dr., Department of Agricultural Economics, Igdir University 

2 Prof. Dr., Department of Plant Protection, Mustafa Kemal University 

3 Assoc. Prof. Dr., Department of Plant Protection, Igdir University 

Weeds are among limiting factors in maize production, which is an important crop 

in Turkey. There are common problematic weeds in all maize producing regions of Turkey 

although there are some different problems in some regions due to varying climate and soil 

factors, and cropping practices. When weeds are left for interfering with maize during 

entire cropping season, 31-65% of crop lost depending on locations and years. The cost of 

weed control in maize in Turkey in 2011 was assessed as roughly 66.3 million € (1 €= 

2.322 TL as average in 2011) which might caused saving 50% of current maize production 

of Turkey which was 4.2 million tons in 2011. The return was calculated as over 500 

million € due to weed control in maize. 

Key words: Maize, impact of weeds, crop losses, cost of weed control, Turkey 

INTRODUCTION 

Maize is an important crop with various uses from animal husbandry to industry. It is 

mainly a fodder crop with its 64% use worldwide. However, it is produced 45% for human 

consumption in Turkey, which is 19% only worldwide (Turgut, 2002). The Black Sea, 

Marmara, Aegean, Southeast Anatolia and Mediterranean Regions of Turkey are main maize 

producing regions although it is sown all over Turkey for farmers’ own consumption (Table 1). 

Table 1. Maize producing regions of Turkey their share in area and production in 2007 (Ozcan, 2009) 

Regions Area Sown (ha) Production (ton) Yield (ton/ha) 

Mediterranean 197,867 1,681,714 8.50 

Aegean 65,582 511,900 7.81 

East Marmara 64,547 456,423 7.07 

Southeast Anatolia 53,079 439,702 8.28 

West Black Sea 64,726 179,028 2.77 

East Black Sea 43,529 84,773 1.95 

West Anatolia 11,671 76,665 6.57 

West Marmara 10,150 68,190 6.72 

Central East Anatolia 3,188 19,545 6.13 

Central Anatolia 2,119 15,592 7.36 

Northeast Anatolia 498 1,478 2.97

80 The economic impact of weeds and their control in Turkey 

The world maize areas reached to 163 million hectares with 8.7% increase and 

production 824 million metric tons with 15.4% increase in the last 5 years. Bioethanol 

production, increase in fodder demand, climatic factors such as drought and raise in crop 

prices are among main drivers of increases in maize areas and productions (Tasdan et al., 

2011). 

Maize producing area in Turkey has been about 600 000 hectares since 1960s in 

spite of year by year fluctuations (FAOSTAT, 2012). The area decreased in late 1980s but 

mainly it as ascended for last decade (Table 1). Maize yield have had a steady increase 

since 1960s. The yield was 1400 kg/ha in 1961 and over 7 tons in 2010 (FAO, 2012). It was 

almost doubled after mid 2000s (Table 2) due to some financial and technical support 

systems. 

Table 2. Maize production in Turkey (1990-2011) (Source: Ministry of Agriculture) 

Year 

Area Harvested Increase in Production Increase in Yield 

(1000 ha) Area (%) (Ton) Production (%) (kg / ha) 

1990 515 0,01 2.100.000 0,05 4080 

1995 515 0,06 1.900.000 0,03 3690 

2000 555 0,07 2.300.000 0,00 4140 

2005 600 0,10 4.200.000 0,40 7000 

2006 536 -0,11 3.811.000 -0,09 7110 

2007 517 -0,03 3.535.000 -0,07 6830 

2008 595 0,15 4.274.000 0,21 7180 

2009 592 -0,01 4.250.000 -0,01 7180 

2010 594 0,00 4.310.000 0,01 7260 

2011 589 -0,01 4.200.000 -0,03 7130 

Pests are among factors causing crop losses in quantity and quality and requiring 

extra costs to control them. It has been known that there are over 400 pests, 60 diseases and 

some weed species interfere with maize production worldwide. Pests in Turkey in maize 

show similarity with common pests worldwide. Ostrinia nubilalis, Sesamia nonagrioides, 

Agrotis spp., Helicoverpa armigera, Rhopalosiphum spp., Spodoptera spp., Tetranychus 

spp., Mythimna spp. and Nezara viridula are the most important pests in maize in Turkey. 

Helminthosporium spp. and Fusarium spp. are the main disease agents in Turkey’s maize 

production. 

Weeds also cause crop losses in maize if they are not controlled. Weeds could cause 

potentially 37% crop loss in the world production. Ten per cent (5 to 17% depending on 

regions) actual crop loss worldwide assessed in spite of application of the weed control 

measures (Oerke and Dehne, 2004) 

The aim of current paper is to review weed problem in maize production and assess 

economic impact of weeds and weed control in Turkey. 

WEED PROBLEM IN MAIZE IN TURKEY 

Due to climatic, geographic, and edaphic differences in maize producing areas of 

Turkey and varying cropping techniques, field sizes, and economical levels, for most weed 

species change region to region. However, there are many common species.


In the Samsun province in the Black Sea Region, weed species reduced from 43 

species in 1973 to 30 species in early 2000s (Mennan and Isik, 2003; Ozduman, 2005). 

Sorghum halepense (L.) Pers. and Cynodon dactylon (L.) Pers. were among important 

species in 1973. No narrow leaf species except Alopecurus myosuroides Hudson was 

among important species in 2000s where Artemisia vulgaris L. and Convolvulus arvensis L. 

were the only important perennials. In the inner part of the Black Sea Region (Kazova 

area), C. arvensis was the only perennial species among the top 10 common species (Kacan 

et al., 1997) while Echinochloa crus- galli (L.) P. Beauv., Setaria spp. and Digitaria 

sanguinalis (L.) Scop. were the narrow leaf species. 

In the Cukurova plain in the Mediterranean Region of Turkey, 18 species were 

mentioned as the most common and dense species (in the alphabetical order): Amaranthus 

albus L., A. retroflexus, A. viridis L., Chrozophora tinctoria (L.) Rafin., Convolvulus 

arvensis L., Cyperus rotundus L., Echinochloa colonum (L.) Link, E. crus-galli, Euphorbia 

chamaesyce L., Hibiscus trionum L., Paspalum paspalodes (Michx.) Schrib., Physalis 

alkekengi L., Portulaca oleracea L., Prosopis farcta (Banks and Sol.) Macbride, Setaria 

viridis L., Solanum nigrum L., Sorghum halepense, Xanthium strumarium L. (Orel, 1996). 

Other studies in this region gave the same species with different importance orders (Gonen, 

1999; Oksar, 2000). Also, similar results in maize growing areas were found in Aydin 

province in the Aegean Region (Dogan and Boz, 2005). 

Actually maize in the Cukurova plain as well as the Aegean and the South Anatolian 

Regions was produced as main crop or the second crop following small grain harvest in 

general. The second crop maize consists 26% of the total maize production of Turkey 

(Dagdelen and Gurbuz, 2008). Farmers’ view for the most problematic species, for the both 

cropping type, was similar for two types of productions in the Cukurova Region. 

Echinochloa spp., Amaranthus spp., Sorghum halepense, Setaria spp. and Portulaca 

oleracea were the top five problematic species in the main crop maize while Setaria spp., 

Xanthium strumarium, Echinochloa spp., Amaranthus spp., and Sorghum halepense in the 

second crop maize in the order of magnitude by farmers (Gungor, 2005). In the field 

surveys in the second crop maize, those species were detected over 50% of fields except 

Setaria viridis. However, S. viridis was the densest species in the region. Cyperus rotundus 

was among the most common and dense species, which was in the sixth rank as farmers’ 

preference. 

There has been no study about weed problem in maize in the other maize producing 

regions. However, similarities problematic weeds in other summer crops such as cotton in 

those regions, problematic weeds in the Southeast Anatolia and the Marmara Regions are 

similar to Mediterranean Region where also later two are located in the same phytogeographic 

region with Mediterranean and the former is next to Mediterranean Region. 

If weeds were left during entire season, studies with natural weed stands, which 

were mainly common weeds of the regions of Turkey, showed that maize yield can be 

reduced 34-65% depending on year in the main crop corn in the Aegean Region and 49% in 

the second crop maize (Dogan et al., 2004). In the Cukurova plain crop loss changed from 

38 to 61% in the second crop maize due to season-long weed competition (Uremis et al., 

2009). 

WEED CONTROL IN MAIZE IN TURKEY 

Critical period for weed control (CPWC)in maize was found 3 to 10 leaf stage in the 

Aegean Region (Dogan et al., 2004). CPWC in the second crop maize was calculated in the


Mediterranean Region as 131 to 927 growing degree days (GDD) after sowing in 1996, 337 

to 731 GDD in 1997 and 266 to 551 GDD in 1998 for 10% yield loss; for 2.5 - 5% yield 

loss, the critical period starts with germination and lasts longer (Uremis et al., 2009). They 

suggested that preemergence (PRE) or presowing herbicides would be preferred to avoid 

higher yield losses. However, a postemergence (POST) herbicide can be applied in the 

second week after crop sowing, and the field should be kept weed free for 4 or 5 weeks if a 

farmer can tolerate 10% yield loss. 

Hand hoeing, interrow tillage and herbicide applications are the common weed 

control methods in maize production. The effect of methods on maize yield differs. In fact, 

weedy treatments yielded less than sole hand hoeing, interrow tillage with hand hoeing, and 

herbicide application at 17.6, 19.9, and 37.9%, respectively, in the Southeast Anatolian 

Region (Oktem et al., 2004). Some farmers apply interrow tillage twice, hand hoeing is 

common practice of small farmers. In addition earthen can be considered a weed control 

method although weeding is not the main aim (Uremis, 1993) 

Farmers choose different methods and their combinations. Sole hand hoeing was chosen by 

only 2% of farmers while interrow tillage by 27%, interrow tillage with hand hoeing by 

47%, PRE herbicides by 8% and POST herbicides by 16% in the Hatay Province of the 

Mediterranean Region (Gozubenli et al., 2000). 

The number of herbicides applied was changed depending on crop type and year in 

the Cukurova Region (Gungor, 2005). One herbicide applied by 28, 44, 34% of main crop 

maize producers and 20, 32, 40% by the farmers producing second crop in 2002, 2003, and 

2004, respectively. The percentage of farmers who applied herbicides more than once was 

less: 8, 14, and 2% in main crop and 2, 5, 9% in the second crop depending on growing 

years above mentioned. Herbicide application time choice of farmers showed fluctuations 

year by year (Gungor, 2005). PRE was chosen 47, 45, and 68% by main crop maize 

producing farmers and 28, 16, and 30% by the second crop producers in 2002, 2003, and 

2004, respectively. Remaining of farmers who applied herbicides chose POST application. 

Herbicide choice of farmers not only affected by cost and weed species; but also 

regulations, companies’ marketing techniques and farmers’ habits. The main crop maize 

producers’ main choice was acetochlor followed by nicosulfuron and foramsulfuron. In the 

second crop maize 2,4-D and rimsulfuron also applied beside above three herbicides 

(Gungor, 2005). It is surprising that farmers mainly used few herbicides among many 

registered choices in those years. Due to prohibition by Turkish Ministry of Agriculture, 

few choices, especially PRE, remained. Currently isoxaflutole, linuron, acetochlor, and 

pendimethalin for PRE, 2.4-D, florosulam, bromoxynil, pyridate, rimsulfuron, 

nicosulfuron, foramsulfuron, iodosulfuron, isoxadifen, mesotrione, tritosulfuron, dicamba 

for POST are available registered herbicides as solo and/or in mixtures. 

COST OF WEED CONTROL 

Main production and cost components of maize production are presented in Table 3. 

Among activities showed in the table, weed control under plant protection and interrow 

tillage/rotatilling directly aim weed control. However, plowing, tillage in spring, disking, 

harrowing for seedbed preparation, earthing up and preparation of irrigation ditches 

requires special attention if weed pressure is high in the given field. Under such a condition, 

all those activities can be considered as weed control technique. But we added only half of 

the cost as weed control cost for those processes. The compiled list of weed control 

techniques in maize and their costs are given in Table 4. Consumption of diesel was taken


from a report of Cukurova Irrigation Association (CSB, 2009) and price of rural diesel, 

which was average 1.6 € per liter for 2011, obtained from Energy Market Regulatory 

Authority (EPDK, 2012). We assumed a flat rate 2.2 TL per ha for labor. Indeed, labor cost 

was 3.6% of overall maize production costs (Aktas and Yurdakul, 2005). Total cost of weed 

production for maize was calculated as 160.7 € for 2011 (Table 4). In the reports and 

market, national currency Turkish Lira are used, in this report we used exchange rate 1 €= 

2.322 TL as average in 2011. 

Table 3. Main components of maize production (Anonymous, 2011) 

Components for Maize Production 

Field Lease 

Plowing in Autumn 

Tillage in Spring 

Disking-harrowing (up to 3 times) 

Seed purchasing 

Seeding with pneumatic machine 

Smooth roller (up to 2 times) 

Fertilizer and Fertilizing 

Interrow tillage - Rotatilling - Earthing up - Preparing irrigation ditches 

Water and irrigation 

Plant protection (Weeds, Pests) 

Harvest 

Transportation of produce 

Guard 

Table 4. Calculation of weed control costs in maize 

Cost Components 

Diesel 

Consumption 

(l/ha) 

Cost 

(€/ha)* 

Part of Cost 

for Weed 

control (€/ha) 

Labor and 

Herbicide 

(€/ha) 

Total Cost 

(€/ha) 

Plowing 30 82.8 23.5 23.5 

Tillage 30 82.8 23.5 23.5 

Interrow tillage (3 times) 10 82.8 47.0 47.0 

Preparing irrigation ditches 10 15.7 7.8 7.8 

Earthing up 10 15.7 7.8 7.8 

Herbicide 10 15.7 15.7 25.3 41.0 

Smooth roller 10 15.7 7.8 7.8 

Total: 0.0 2.2 2.2 

TOTAL: 160.7 

No all farmers apply the same processes. Some of them use less than 3 times 

interrow tillage. Farmers using herbicide in the Cukurova Region, the most pesticide 

consuming region for a given area part of Turkey were about 36% mostly (Gungor, 2005). 

Regarding to those data and observations, we might say one third of maize farmers spent 

160.7 € for weed control. It can be assumed the remaining might spend 205.2 TL per


hectare for weed control excluding herbicide costs and reducing interrow tillage costs. The 

area sown in 2011 was 589,000 ha. Using these assumptions, the cost of weed control in 

maize in Turkey in 2011 was roughly 66 million €. 

Regarding to crop loss data from Dogan et al. (2004) and Uremis et al. (2009), 

weeds without any control measure can reduce maize yield from 34 to 65% depending on 

year. We might assume 50% maize crop loss as average. It means 2.1 million ton maize 

was gained applying weed control techniques, which the maize production of Turkey was 

4.2 millions tons in Turkey in 2011. The monetary value of saved crop for 2011 was 

assessed 570 million € (average price of maize was 0.27€=0.63 TL per kg), which means 

over 500 million € return was obtained by farmers. However, average 10% loss is still 

occurs under weed control measures worldwide (Oerke and Dehne, 2004). It means, 

probably under ideal weed control measurements, it would have saved another 500 000 tons 

maize, roughly. 

REFERENCES 

Aktas, E.,Yurdakul, O. (2005): Destekleme ve teknoloji politikalarının Cukurova bolgesinde 

misir tarimi uzerine etkisi. Journal of Agricultural Faculty, University of Cukurova , 20 

(2) 19-28. 

Anonymous (2011): 2011 Yili misir urunu maliyet cizelgesi. Aydin Ziraat Odasi, Aydin-Turkey. 

CSB (2009): Mısır ekim istatistiği at internet: http://cukurovasulama.gov.tr/files/MISIR%20 

EKiM%20 iSTATiSTiGi.pdf. (accessed on 10 July 2012). 

Dagdelen N., Gurbuz T. (2008): Aydin kosullarinda ikinci urün misirin su tuketimi. Journal of 

Agricultural Faculty, University of Adnan Menderes 5 (2): 67-74. 

Dogan M.N., Boz O., Unay A., Albay F. (2004): Determination of optimum weed control 

timing in maize (Zea mays L.) ,Turkish Journal of Agriculture and Forestry, 28: 349-354. 

Dogan M.N., Boz O. (2005): Comparison of weed problems in main and second crop of maize 

(Zea mays l.) growing areas of Turkey. Asian Journal of Plant Sciences, 4 (3): 220-224. 

EPDK 

(2012): Akaryakit bayi fiyatı raporu at internet: https://ppbp.epdk.org.tr/Rapor/ 

Akaryakit/Paylasim/Fiyat Listesi.aspx?RaporTip=5 (accessed on 10 July 2012). 

FAOSTAT (2012): Statistical database at internet http://faostat.fao.org/site/567/default.aspx 

(accessed on 10 July 2012). 

Gonen, O. (1999): Cukurova Bolgesi Yazlik Yabanci Ot Turlerinin Cimlenme Biyolojileri ve 

Bilgisayar ile Teshise Yonelik Morfolojik Karakterlerinin Saptanmasi, University of 

Cukurova, PhD Thesis, Adana-Turkey. 

Gozubenli, H., Sener, O., Konuskan, O., Sahinler, S., Kılınc, M. (2000): Hatay’da misir 

tariminin genel durumu, sorunlari ve cozum onerileri. Journal of Agricultural Faculty, 

University of Mustafa Kemal 5 (1-2): 41-48. 

Gungor, M. (2005): Adana Ili Misir Ekim Alanlarinda Yabanci Otlara Karsi Uygulanan 

Kimyasal Mucadelenin Onemi ve Ortaya Cikan Sorunlarin Arastirilmasi, University of 

Cukurova, Master Thesis, Adana-Turkey. 

Kacan, K., Tursun, N., Onen, H., Ozer, Z. (1997): Kazova (Tokat)’da misir (Zea mays L.) ekim 

alanlarinda sorun olan yabanci otlar. Türkiye ΙΙ. Herboloji Kongresi. (1- 4 Eylül 1997, 

Ayvalık ve İzmir) 189-194. 

Mennan, H., Isik, D. (2003): Samsun ili ekim alanlarinda son 30 yilda gorulen floral 

degisiklikler ve bunlarin nedenlerinin arastirilmasi. Türkiye Herboloji Dergisi, 6 (1): 1-7. 

Oerke, E.C., Dehne, H.W. (2004): Safeguarding production-losses in major crops and the role of 

crop protection. Crop Protection, 23: 275–285. 

Oksar, M. (2000): Cukurova’daki Yabanci Otlar ve Bunlarin Biyolojik Mucadele Olanaklari, 

University of Cukurova, Master Thesis, Adana-Turkey.


Oktem, A., Ulger, A.C., Coskun, Y. (2004): Harran ovasi kosullarinda bazi yabanci ot kontrol 

yontemlerinin misir bitkisinde (Zea mays L.) tane verimi ve verim unsurlarina etkisi. 

Journal of Agricultural Faculty, University of Harran, 5 (1-2): 51-57. 

Orel, E. (1996): Cukurova Bolgesi Bugday ve Misir Ekim Alanlarinda Bazi Ekolojik Faktorlerin 

Gostergesi Olabilecek Yabanci Ot Turlerinin Saptanmasi. University of Cukurova, 

Master Thesis, Adana-Turkey. 

Ozcan, S. (2009): Modern dunyanin vazgecilmez bitkisi misir: genetigi degistirilmis 

(transgenik) misirin tarimsal uretime katkisi. Turk Bilimsel Derlemeler Dergisi 2 (2) 1- 

34. 

Ozduman, A. (2005): Samsun'da Misir Ekim Alanlarindaki Yabancı Ot Florasinin Belirlenmesi 

ve Mısır ve Soyanın Karisik Ekim Sisteminde Domuz Pıtrağı (Xanthium strumarium 

L.)'nın Verime Etkisi, University of Ondokuz Mayis, Master Thesis, Samsun-Turkey. 

Tasdan, K., Cetin, F., Gurer, B. (2011): Misir Durum ve Tahmin 2011-2012. Tarimsal Ekonomi 

ve Politika Gelistirme Enstitusu (TEPGE), TEPGE Yayin No: 193, Ankara-Turkey. 

Turgut, I. (2002): Silajlık Misir Yetistiriciligi. Silaj Bitkileri Yetistirme ve Silaj Yapimi (2. 

Bolum). Hasad Yayincilik Ltd. Sti., Istanbul-Turkey. 

Uremis, I. (1993): Adana’da Misir Ekilislerinde Ucakla Herbisit Uygulamalari Uzerinde Bir 

Arastirma, University of Cukurova, Master Thesis, Adana-Turkey. 

Uremis, I., Uludag, A., Ulger A.C., Cakir, B. (2009): Determination of critical period for weed 

control in the second crop corn under Mediterranean conditions. African Journal of 

Biotechnology, 8 (18): 4475-4480.

86 Comparative study of the allelopathic effects of... 

International Symposium: Current Trends in Plant Protection UDK: 632.51:582.751.1(439) 

Proceedings 

COMPARATIVE STUDY OF THE ALLELOPATHIC EFFECTS OF 

INVASIVE WOOD SORRELS (OXALIS CORNICULATA L., 

OXALIS DILLENII JACQ.) IN HUNGARY 

ANNA MARIA HÓDI 1 , LÁSZLÓ HÓDI 2 , LÁSZLÓ PALKOVICS 1 

1 Corvinus University of Budapest, 1118. Budapest, Villányi út 29-43. 

2 

Government Office for Csongrad County, Plant Protection and Soil Conservation Directorate, 

6800. Hódmezővásárhely Rárósi út 110. 

anna.hodi@gmail.com 

Oxalis corniculata and Oxalis dillenii are specially harmful weeds in greenhouses. 

Invasive spread of Oxalis corniculata and Oxalis dillenii could be observed in the latest 

decades mainly in urban surroundings in Hungary. 

The high oxalic acid content of these weed species has been known since long time, while, at 

the same time the effect of the extracts of the plants on other species has been rarely investigated. In 

this study the allelopathic effect of creeping wood sorrel and common yellow wood sorrel were 

assessed through laboratory analysis. 

The results reveale that extracts of shoots and roots of Oxalis corniculata influence the 

germination of test plants, while this effect is leess evident for Oxalis dillenii. 

Both ethyl alcohol, and water extracts decreased the lengths of shoots of some of the test 

plants. The allelopathic effect of O. corniculata was more intense, which could explain its enhanced 

invasive spreading in Hungary.. 

Key words: Allelopathy, Oxalis corniculata, Oxalis dillenii, invasive alien plants 

INTRODUCTION 

Fighting against undesirable agricultural weeds is a task originated back to the times 

mankind started cultivating crops. 

Changes within the natural flora occur in line with globalization and thus the 

proportion of weeds increase worldwide. (Solymosi, 2002). 

According to the findings of Czimber and his colleagues (Czimber et al., 2004) the 

number of species known to be earlier or lately immigrated has increased in Central- 

Europe. These mainly derive from warmer regions, especially from the Mediterranean. 

Oxalis corniculata and Oxalis dillenii, both native to North America, are specially 

harmful in greenhouses as weeds (Whitcomb and Santelmann, 1977). 

Invasive spreading of Oxalis corniculata and Oxalis dillenii could be observed in the 

latest decades mainly in urban surroundings in Hungary. 

The term ”allelopathy” was proposed for expressing the harmful, stimulatory, 

enhanced and beneficial effects that one plant species has on another through the formation

Anna Maria Hodi, Laszlo Hodi, Laszlo Palkovics 87 

of chemical retardants escaping into the environment (Molisch, 1937). Allelopathy plays an 

important role in biological invasion (Peng et al. 2007). 

The high oxalic acid content of these weeds is well known since long time, while the 

effects of the extracts of the plants on other species has been poorly investigated. In this 

study the allelopathic effect of creeping wood sorrel and common yellow wood sorrel are 

assessed through laboratory analysis. 


Fresh roots and shoots of Oxalis corniculata and Oxalis dillenii were collected at the 

beginning of flowering in Csongrád county (Hungary). For the laboratory germination trials 

water extract and alcoholic extract have been prepared from the roots and shoots of plants 

by the help of 10 g of cut up plant parts and 100 ml of distillated water or dehydrated ethyl 

alcohol. Then the mixtures were homogenized by ultraturax and left for a day. The mixtures 

were filtered by vacuumfilter. Double filter paper was placed in each Petri dish. On the top 

of filter paper in each Petri dish 25 winter wheat (Triticum aestivum L.), white mustard 

(Sinapis alba L.), garden cress (Lepidium sativum L.) or meadow fescue (Festuca pratensis 

L.) seeds were placed to germinate in four replicates, after having been wetted by 5 ml-s of 

the appropriate extract. In case of the alcoholic extract, the alcohol had been evaporated and 

replaced by the same quantity of distillated water. 

The germination test was carried out at 20 0 C temperature in alternating light 

conditions (12 hours of darkness and 12 hours of illumination). 

Seeds germinated in distilled water served as control. 


Results of percent of germination and lenght of plants are shown in Table 1. and 2 

Table 1: Germination % 

Germination % 

winter wheat white mustard garden cress meadow fescue 

O. corn. O. dill. O. corn. O. dill. O. corn. O. dill. O. corn. O. dill. 

Untreated 100 100 93 94 96 98 49 51 

alc. root 91** 96 54*** 94 58*** 94 23,5*** 46 

alc. shoot 97 96 39*** 92 83* 92 14*** 42 

water root 94* 98 94 86 97 94 26*** 48 

water shoot 94* 100 5*** 84 29*** 96 7*** 46,5 

Table 2: Lenght of plants mm 

Lenght of winter wheat white mustard garden cress meadow fescue 

plants mm O.corn. O. dill. O. corn. O.dill. O. corn. O. dill. O. corn. O. dill. 

Untreated 70,8 73,9 35,3 37,6 42,4 41,9 31,5 30,6 

alc. root 15,4*** 65,8 10,9*** 34,9 31,0*** 37,8 20,4*** 31,0 

alc. shoot 62,4 72,4 10, 6*** 11,5*** 10,1*** 8,5*** 8,7*** 24,1** 

water root 70,1 63,1 33,1 30,4 41,1 47,7 24,0** 27,8 

water shoot 34,4*** 36,6*** 8,4*** 7,5*** 7,8*** 8,3*** 10,7*** 23,1** 

SD10%=* 

SD5%=** 

SD1%=***

88 Comparative study of the allelopathic effects of... 

• The ethyl alcohol and the water shoot extracts of O. corniculata had a strong inhibiting 

effect on the growth of wheat. 

• The alcoholic extract of O. dillenii did not influence the germination of wheat, but the 

water shoot extracts influenced significantly the lenght of plants. 

• The effect of treatments made with alcohol extracts and water shoot extracts of roots 

and shoots of O. corniculata on the germination and lenght of white mustard plants 

indicated significant negative effects. 

• The extracts of O. dillenii shoots influenced the lenght of plants and had no effect on the 

germination. 

• The tests with alcoholic extracts and water shoot extracts of O. corniculata showed 

inhibiting effect on the growth of garden cress and the water shoot extracts influenced 

the germination. 

• The shoot extracts of O. dillenii influenced the lenght of plants and had no effect on the 

germination. 

• The alcoholic and water extracts of O. corniculata had a strong inhibiting effect on 

meadow fescue. 

• The shoot extracts of O. dillenii influenced the lenght of plants and had no effect on the 

germination. 

• The results revealed that the extracts of shoots and roots of Oxalis corniculata 

influenced the germination of test plants, while in the case of Oxalis dillenii this effect 

was less significant. 

• Both the ethyl alcohol, and the water extracts decreased the lengths of shoots of some of 

the test plants. 

• The allelopathic effect of O. corniculata was more intense, which could explain its 

enhanced invasive spread in Hungary. 


The work was supported by TÁMOP- 4.2.1./B-09/1-KMR-2010-0005 and TÁMOP- 

4.2.2./B-10/1-2010-0023 grants. 

REFERENCES 

Czimber Gy., Glemmitz M., Hoffmann J., Radics L., Pinke Gy. (2004): A klímaváltozás és a 

Szigetköz gyomflórája. A Szigetközi környezeti monitoring eredményei. MTA 

Szigetközi munkacsoportja. Budapest 35-37. 

Molisch, H. (1937): Der Einfluβ einer Pflanze ouf die andere – Allelopathie. G. Fischer Verlag, 

Jena. 106 pp. 

Peng Yu; Hu JinYao; Su ZhiXian (2007): Research on allelopathic effects of Oxalis corymbosa 

– an invasive species. Acta Prataculturae Sinica Vol. 16 No. 5pp. 90-95 

Solymosi P. (2002): A globális felmelegedés hatása a gyomflóra összetételére, valamint a C3-as 

és C4-es gyomfajok produktivitására. Gyomnövények, gyomirtás 3(1):12-19. 

Whitcomb, C.E. and Santelmann, P.W. (1977): Effects of herbicides used on a greenhouse floor 

on growth of plants on raised benches. Res. Rep. Okla. Agric. Exp. Sta. 760. 3pp.

Srđan Živanović, Goran Anačkov, Bojana Bokić,... 89 

International Symposium: Current Trends in Plant Protection UDK: 632.51:582.988.1 

Proceedings 

MORPHOLOGICAL VARIABILITY OF SPECIES IVA 

XANTHIFOLIA NUTT. 1818 (ASTERACEAE, HELIANTHAE) IN 

RUDERAL HABITATS 

SRĐAN ŽIVANOVIĆ, GORAN ANAČKOV, BOJANA BOKIĆ, MILICA RADANOVIĆ, MILICA RAT, 

SLOBODAN BOJČIĆ, RUŽICA IGIĆ, PAL BOŽA 


mail: goran.anackov@dbe.uns.ac.rs 

The object of our investigation was Iva xanthifolia. This species was recorded 1966 th in the 

vicinity of Novi Sad, for the first time in our country. It is a threat to our native flora and cause 

allergic reaction in human population. Expansion of this species is a unique concept of adaptation that 

is reflected by variability of organs responsible for biomass production and creation of potential 

allergens. Drastic increase of territories in urban areas inhabited by Iva has led to investigation about 

variability which depends of the type of urban habitats in area where Iva is recorded for the first time. 

Quantitative characters were analyzed, among them twelve were morphometric and eight were 

meristic. Statistical analysis of characters included measures of central tendency: separately and for 

all analyzed populations, correlation analysis, as well as multivariate methods of principal 

components and discriminant analysis a priori with populations defined as factors. Processed 

populations show a high degree of variability what may be another contribution to the assumption that 

process of adaptation and naturalization of Iva in our region has not been completed yet. A large 

percentage of variability is related to the morphometric and meristic characters, which are dependent 

on ecological conditions. 

Key words: adaptation, spreading, range, biological invasion 

INTRODUCTION 

Species I. xanthifolia is invasive plant species from North America that is 

naturalized in the area of Europe. This species is not only a threat to the native flora of our 

country but also causes a variety of allergic reactions in human population. The first record 

of this species for Serbia was in 1966 year in the vicinity of Novi Sad (Šajinović and 

Koljadžinski, 1966). At present, Iva shows a great aggressiveness and tendency to spreads 

throughout Vojvodina by taking up a bigger range. She was appeared in crops, row crops 

and plots with low plant density (Kojić and Ajder, 1996) from initial ruderal habitats. 

Center of its native range is continental part of North American prairies and extends 

up to southern Canada. It is present in almost all countries in Western Europe. In Northern 

Serbia (Vojvodina) were recorded stable populations of I. xanthifolia. Iva most often 

inhabits a ruderal habitats, abandoned meadows and crops but sometimes grows along 

roadsides. This is a weed plant that produces seeds extensively, in average between 35000 

and 50000, most up 105000 seeds (Milanova, 2001), what as a consequence leads to high

90 Morphological variability of species iva xanthifolia Nutt. 1818.,... 

potential for expansion, especially in the temperate climate with long arid period as it here 

in our country. Considering all known characteristics, Iva is included in the A2 list of 

quarantine harmful organisms. In Serbia, Iva enjoys the status of invasive species 

(Vrbničanin et al., 2004). 

The city of Novi Sad is in continental temperate climate area. Its geographical 

coordinates are 45 o 20'0" north and 19 o 51'0" east. This climate is characterized by four 

seasons, very cold winters and extremely hot summers. The transitional seasons are 

characterized by high precipitation and moderate temperatures. Closeness of the Danube 

river and the Fruška gora mountain to Novi Sad, alleviate elements of continental climate. 

The most frequent and strongest wind in Novi Sad is košava (south-eastern wind) (Kaptić et 

al., 1979). Basic climate characteristics of Novi Sad are conditioned by its geographical 

position, both vertical and horizontal separateness of macro, meso and micro relief (Dukić, 

1973). 

Pedological substrate of this area is assembled of sand, loam – clay and in some 

places of mildly saline soils (Živković et al., 1972). In the area of Novi Sad there are 

several types of soils: alluvial soil type with several subtypes, carbonated humogley, 

carbonated and saline humogley, chernozem on alluvial deposits, highly saline chernozem, 

solonetz and uncarbonated chernozem on meadows (Nejgebauer et al., 1971). 

The aim of this study is better understanding of species I. xanthifolia morphology, 

especially variability of organs that are responsible for production of biomass and potential 

allergens, which depend on habitats in urban areas, such as the city of Novi Sad. 


Data about units of elemental range was obtained based on the monitoring of Iva 

populations in Novi Sad area. Obtained data was used for selection of units from which has 

been collected plant material. Three sites with different type of soil substrates were 

selected: arable land, construction waste and sandy soils. At these sites, stable populations 

with more than 100 individuals of Iva were detected, upon which is ascertained that they 

have been present during the previous years. 

Almost all morphological characters were measured directly on the site of sampling. 

The lower leaves were collected from each plant. Sampled leaves have been dried by 

standard technique in thermostatic press (StiroLab) whereupon were labelled with standard 

signs of original taxonomical units (OTU – Original Taxonomic Unit). The numbers of 

sampled leaves and plants from the field are compatible with numbers that were used in 

Laboratory for ragweed and other allergenic plants on Department of Biology and Ecology, 

Faculty of Sciences in Novi Sad. The whole sampled material is stored in Herbarium of 

Department on Biology and Ecology, Faculty of Sciences in Novi Sad (BUNS). After the 

selection of characters for analysis, all data from laboratory protocols and field data are 

synthesized in electronic database which is created in MSsoftware, Microsoft Excel 2007 

for Windows. 

In total were analyzed twenty quantitative characters, including twelve 

morphometric and eight meristic (Table 1). Measured characters of leaves are illustrated in 

Picture 1. For measurements of meristic characters of leaves was used calibrated sliding 

gauge (precision 0,01mm). For measuring of leaf area was used electronic device LI-COR 

Bioscientific, portable leaf area meter (model LI-3000). Along with quantitative characters 

was observed the occurrence of side shoots on five plants in each population that were 

exposed to mechanical treatment.


The morphological data were analyzed by methods of descriptive and multivariate 

analysis in software package Statistica for. Windows ver. 10 (StatSoft, Inc., 2011). 

Statistical analysis of characters was included measures of central tendency: separately and 

for all analyzed populations, correlation analysis, as well as multivariate methods of 

principal components and discriminant analysis a priori with defined populations as 

factors. 

Table 1. Review of processed characters of species I. Xanthifolia 

Organ Meristic characters Morphometric characters 

Number of nodes 

Stem height 

Number of nodes with the first branch Height of opposite leaves 

Stem 

Number of nodes with the first fertile 

Petiole length 

branch 

Number of leaves 

Leaf surface 

Leaf width L1 

Leaf 

Leaf width L2 

Leaf width L3 

Leaf length H1 

Leaf length H2 

Number of complex spikelike Length of terminal complex spikelike 

inflorescence 

Number of capitulum on terminal Length of the first complex lateral 

Inflorescence 

complex spikelike 

spikelike inflorescence BCv-1 

Number of capitulum in the first Length of the second complex lateral 

lateral complex spikelike BCv-1 spikelike inflorescence BCv-2 

Number of capitulum in the second 

lateral complex spikelike BCv-2 

Picture 1. Analyzed morphometric characters of leaves of species I. xanthifolia 

H1, H2, H3 – length 

L1, L2 - width


RESULTS 

Variability of the morphometric characters within the first population is very high, 

considering that are almost all characters are in the zone of moderate variability but leaf 

area, length of lobes below the widest part of leaf (leaf length H2) and length of 

inflorescences show increased variability (Table 2). According to the results of variability 

analysis of morphological characters within the second population, the great number of 

characters is in zone of moderate variability. Exceptions are leaf area that has a high 

coefficient of variability (46.37), length of base of leaf (length H2) and width of the right 

half of lamina (leaf width L3) and they are in zone of prominent variability (Table 2). The 

third population is characterized by morphological characters with lower variability and 

most of characters are in zone of medium variability, but with lower values. Within this 

zone, leaf area and petiole length stand out as characters that are in zone of prominent 

variability (coefficient of variation is 30-50%), and there are no characters in zone of high 

variability (Table 2). Based on all analyzed specimens, the largest number of characters is 

in zone of moderate variability (10-30%). These characters are: tree height, height of 

opposite leaves, leaf width (L1), leaf width (L3), leaf length (H1), petiole length, peak 

length of complex spikelike inflorescence, length of the first lateral complex spikelike 

inflorescence (BCv-1) and length of the second lateral complex spikelike inflorescence 

(BCv-2) (Table 2). In zone of prominent variability are three characters: area, length and 

width of leaf. Leaf area has the highest value of variability, whereas coefficient of variation 

of leaf width is marked as marginal value (Table 2). 

Table 2. Coefficient of variation for morphometric characters of each single populations and of 

whole group sample of the I. xanthifolia in Novi Sad 

Population 

1 

Population 

2 

Population 

3 

Population 

4 

Characters 

Coeficient of variation 

Stem height 21,09 19,92 10,14 21,31 

Leaf surface 42,26 46,38 36,60 49,14 

Height of opposite leaves 22,90 20,02 15,80 19,71 

Leaf width L1 21,92 25,44 17,54 25,04 

Leaf width L2 21,48 35,21 20,10 30,27 

Leaf width L3 21,23 24,78 18,95 25,58 

Leaf lenght H1 16,91 23,18 12,66 23,18 

Leaf lenght H2 30,52 30,39 37,57 33,07 

Petiole length 27,77 25,52 15,53 27,20 

Length of terminal complex 

spikelike inflorescence 

28,18 28,33 24,58 27,32 

Length of the first complex lateral 


32,49 18,55 26,10 26,74 

Length of the second complex lateral 


32,18 22,14 26,94 29,74 

Discriminant analysis, applied to quantitative morphometric characters, is a 

multivariate method that defines the variables that contribute most to the pattern 

discrimination in the sample group, in which are group members the most distinguished. 

Application of this method in analyzing populations of I. xanthifolia in Novi Sad enables 

recognition of characters that contribute most to sample separation in groups. The first 

discriminant axis describes 43.50% of the sample variability, while the other axes make it


in percentage of 17.94%. The cumulative value of these two axes makes 61.43% of sample 

discrimination (Table 3). Discrimination of the populations by the first discriminant axis 

contributes most characters as leaf length H1 and petiole length. Compared to the other 

axes, the most important features are tree height, leaf length H2 and length of the first 

lateral spikelike complex inflorescence BV-c1 (Table 3). Despite of low power of 

discrimination, width of leaf character is worth mentioning. However, all important 

discriminant characters are highly depend on environmental factors. 

Table 3. Loads of morphometric characters of species I. xanthifolia and load levels of the first 

two discriminant axes 

Character 

The first 

discriminante 

axis 

The second 

discriminant 

e axis 

Stem hight -0.083 -0.621 

Leaf area 0.472 0.122 

Hight of oposite leaves 0.082 -0.114 

Leaf width L1 0.460 0.071 

Leaf width L2 0.403 -0.060 

Leaf width L3 0.483 0.131 

Leaf lenght H1 0.637 0.276 

Leaf lenght H2 -0.089 0.125 

Patiole lenght 0.534 -0.033 

Lenght of terminal complex spikelike inflorescence -0.129 -0.007 

Lenght of the first complex lateral spikelike inflorescence 

BCv-1 -0.050 0.135 

Lenght of the second complex lateral spikelike inflorescence 

BCv-2 -0.167 0.293 

Total character values 5.225 2.125 

Percentage of variance (%) 43.496 17.935 

Percentage of total variance (%) 61.4312 

Discriminant analysis, based on the first two axes is confirmed the results of analysis 

of principal components. The third population shows the clearest separation, but by using 

mechanisms of discriminant analysis we realized that two other populations have 

significant potential for separation from the third population as well from each other. 

Results of discriminant analysis were based on the variability of the sample. According to 

the first axis there is a separation of the first and the third population. The second 

population is separated exclusively by the second axis, which has a lower power of 

discrimination, mainly due to the strength of the load caused by the plant height character. 

In all analyzed populations there is a significant, but not large number of "extreme cases" 

which causing increase in total variability (Figure 1). Though the discriminant analysis 

(Figure 1) demonstrated significant difference among individuals, a priori classification of 

belonging individuals to the populations, based on discriminant scores, is showed a good 

classification.


Figure 1. Positions of analyzed individuals within populations of I. xanthifolia in Novi Sad in the 

space of the first two discriminant axes according to morphometric characters 

Also, significant variability was found of eight meristic characters that were 

statistically analyzed (Table 4). In zone of prominent variability (30-50%) are four 

characters. The highest value has the number of heads in the first lateral spikelike complex 

inflorescence (BCv-1) with 41.15%, then number of leaves with 38.59%, number of heads 

in the second lateral spikelike complex inflorescence (BCv-2) with 37.98% and number of 

heads in terminal complex spikelike inflorescence with 35.78% of the variability. It was 

noted that three of four characters of this group are in the generative region of individuals 

of the sample. In zone of high variability with more than 50% of coefficient of variation is 

only complex spikelike inflorescence parameter with 62.74% of the variability. Mentioned 

character is also in the generative region of the plant (Table 4). 

Table 4. Coefficient of variation for meristic characters of each single population and group 

sample of species I. xanthifolia in Novi Sad 

Population 

1 

Population 

2 

Population 

3 

Group 

sample 

Character 

Coefficient of variation 

Number of nodes 14,83 13,21 18,73 16,48 

Number of nodes with the first branch 25,47 18,80 20,50 27,66 

Number of nodes with the first fertile 

branch 

26,97 15,00 24,88 23,58 

Number of leaves 41,30 26,02 25,41 38,59 

Number of complex spikelike 

inflorescence 

69,15 29,02 33,31 62,74 

Number of capitulum in terminal 

complex spikelike inflorescence 

36,31 32,60 30,25 35,78 

Number of capitulum in the first lateral 

complex spikelike inflorescence BCv-1 

35,48 42,01 27,47 41,15 

Number of capitulum in the second 

lateral complex spikelike inflorescence 

BCv-2 

29,89 38,22 32,16 37,98


Discriminant analysis of meristic characters was applied in order to determine which 

of characters contribute the most to the group discrimination. The first discriminant axis 

describes 30.029% of the sample, while the second axis describes 27.95% of the sample. 

Cumulative value of these two axes makes 57.983% of sample discrimination. However, 

some characters have small power to influence the discrimination of populations. 

According to the first axis of discrimination, characters that largely reflect general 

ecological conditions on the habitat, in terms of the occurrence or absence of water and 

concentration of nutrients in the substrate stand out. These characters are appearance of 

node with the first branch and number of leaves. It is interesting that the second 

discriminant axis is also definened with appearance of node with the first branch. More 

precisely, this character is favored in the studied populations (Table 5). 

Table 5. Loads of meristic characters of species I. xanthifolia and load levels of the first two 

discriminant axes 

Character 

The first 

The second 

discriminate axis discriminante axis 

Number of nodes 0.438 0.134 

Number of nodes with the first branch 0.651 -0.791 

Number of nodes with the first fertile branch -0.228 0.171 

Number of leaves -0.617 0.037 

Number of complex spikelike inflorescences -0.367 -0.414 

Number of capitulum in terminal complex spikelike 

inflorescence 

0.175 0.177 

Number of capitulum in the first complex lateral 


0.392 0.255 

Number of capitulum in the second complex lateral 


-0.084 0.463 

Total character value 2.402 2.236 

Percentage of variance (%) 30.029 27.954 

Percentage of total variance (%) 57.983 

Although the most compact, the third discriminant axis occupies an intermediate 

character compared to the first one. Certainly, its synergies and interpopulation stability in 

terms of morphological properties is not irrelevant, but in choosing characters she pointed 

out another fact, that the selected ones are not good for discrimination of Iva population. 

The first discriminant axis are successfully separated the first and second studied 

population, while is the third divided in the middle by the first discriminant axis. The third 

population is clearly separated by the second discriminant axis that carries a smaller 

percentage of the total variability of the sample. Discriminant analysis a priori largely 

confirmed the arrangement of individuals in the Iva population. (Figure 2).


Figure 2. Positions of analyzed individuals within populations of I. xanthifolia in Novi Sad in 

space of the first two discriminant axes according to meristic characters 

DISCUSION 

Species I. xanthifolia is an invasive plant species which has a high potential to 

spread throughout Vojvodina region (Boža, 2011). Years of research and monitoring of Iva 

populations in the area of Novi Sad, have shown that there are numerous stable populations 

and some of them may be monodominant. In these populations, iva prevents development 

of other species because of its large leaf area whereby make shadow. These populations are 

mostly in periphery parts of the city and on ruderal habitats. Iva is often found in 

association with other weed and ruderal species, mainly with Ambrosia artemisifolia. The 

results of the three-year monitoring of species I. xanthifolia in the city of Novi Sad show a 

high correlation between range dynamic and spatial spread with accentuated anthropogenic 

influence. There is no doubt that the timely suppression of invasive species, primarily 

ragweed, was led to changing in the initial number of sites where iva was recorded. 

Phytocoenological status of iva, in urban areas clearly indicates at this fact, because is often 

occurred in bipolar, sinanthropic plant communities, with ragweed. Our results of 

monitoring of appearance of secondary lateral shoots after mechanical treatment of iva, 

confirmed former fact as well. However, analysis of distribution and quality of the 

pedological substrate and correlation with the two major climatic parameters has shown 

that it is an important factor that dictates almost all phases in the life cycle of iva in the area 

of Novi Sad. 

Looking at the results of statistical analysis of morphometric and meristic characters, 

it seems that species I. xanthifolia didn’t complete yet its cycle of adaptive entry into a new 

habitats and that this process is still ongoing. Namely, there is big difference between data 

obtained on field and data listed in the Flora of SR Serbia (Gajic, 1975), what can be 

explained with the diagnosis of this species which comes from the native habitats of North 

America (Cyclachaena, 2006). In the literature, within the diagnosis of species I. 

xanthifolia, is noted that characters, like plant height, are in range values up to two meters


(Gajic, 1975). Obtained results in the measurements were significantly different, so for 

example, the tallest plant from our analyses belongs to the second population and its tree 

height is 350cm, without length of the peak inflorescence. The average height of trees in 

this population was 254cm. There are similar results in related papers for I. xanthifolia from 

other sites in Vojvodina. For example, the average height of plants in Nova Pazova is 

340cm, but in Zemun is 255cm (Marisavljević, 2007). 

Processed populations show a high degree of variability what can be another support 

for assumption that process of adaptation and naturalization of this species in our region has 

not been completed. Great percentage of variability is referred to characters, both 

morphometric and meristic, who are dependent on ecological conditions. The most stable is 

the third population, and discriminant analysis proved that it is the most compact in 

comparison to quantitative morphometric characters. The site where this population grows 

has a high isolation index. Substrate of its locality is anthropogenic. It was created with 

depositing of gravel and sand on the Danube alluvial plain. This substrate is not in contact 

with underground water and soil humidity entirely depends on precipitation. These 

ecological conditions are not ideal for development of iva. However, closeness to the 

Danube river ensures this site with a lot of dew and because of makes it more suitable for 

iva. Microclimate is balanced, physical factors are shifting at regular intervals and without 

major fluctuations. The third population is also characterized by the lower plants with large 

leaves surfaces, hence the ground is covered and with shadow substrate moisture is 

retained. 

Features of the first population are interesting. Its quantitative morphometric 

character, stem height, is negatively corelated with almost all other morphometric 

characters, which may be concequence of rapid growth. Such situation of the first 

population can be additional evidence for real invasive power of iva. Therefore, on 

modified substrate that retain water poorly, iva is succeeded to maximally utilize the most 

favourable climatic condition (high daily temperature and precipitation) and to fruiting 

quite a while before other populations. The average tree height of lower plants is about 195 

cm thereby they are closest to the literature data. 

In the second population, almost all of morphometric and meristic characters are in 

zone of moderate variability. This population has been present on that locality years ago. 

Also, second population fruiting in dificult climatic conditiones, for what might be 

responsible convenient substrate on which it is located. Favorable characteristics of 

carbonated humogley soil type can be seen in the results of measurment of the second 

population. This population has the most highest plants and leaves with largest areas. It is a 

very large population that spreads every season, occupies an increasingly larger space and 

suppresses a great number of species of ruderal flora. 

Based on statistical analysis the first population is clearly separated from the two 

other. It is especially prominent in discriminant analysis of meristic and morphological 

characters. This kind of separation can be explained with the fact that the first population 

which flowering and fruiting before other populations, inhabits area on carbonated saline 

humogley soil type. This type of soil is not ideal. If the plant species, particularly invasive, 

find themselves in unfavourable conditions, they provide maximum production and end 

earlier vegetative cycle, primarily because of prolong of next generation. Individuals of the 

first population of I. xanthifolia fit into this pattern, since they maximally exploit 

favourable climate conditions and develop inflorescence even a month before other 

populations in the Novi Sad area. 

This kind of field data and results of morphological analyses suggest that 

environmental conditions of our climate are greatly appropriate for weed species I.


xanthifolia and also indicate that pedological substrate and general climatic conditions 

significantly affect on morphological specialization of iva, i.e. affect the specialization of 

selected features that would enabled successful survival of iva in our region. 

ACKNOWLEDGEMENT 

This work was performed under the project 173030 funded by the Ministry of 

Education and Science of the Republic of Serbia. 

REFERENCES 

Boža, P. Taxon: Iva xanthifolia (Linnaeus, 1758). [citirano 2012 August 07]. U Lista invazivnih 


Verzija 0.1beta. Anačkov, G., Bjelić-Čabrilo, O., Karaman, I., Radenković, S., 

Radulović, S., Vukov, D., Boža, P., editori. Novi Sad (Serbia): Departman za biologiju i 

ekologiju; 2011. 

Cyclachaena xanthiifolia (30.06.2006.) [Internet]. [cited August 8, 2012]. Online available at: 

http://www.efloras.org/florataxon.aspx?flora_id=1&taxon_id=250066460 

Dukić, D. (1973): Kratka klimatska karakteristika godišnjih doba Novosadskog regiona. Srpsko 

geografsko društvo. Beograd 

Gajic, M. (1975): Rod Iva L. u: Josifović, M. (ed.): Flora SR Srbije VII. Beograd, SANU, str. 

64. 

Kaptić, P., Đukanović, D., Đaković, P. (1979): Klima SAP Vojvodine. Poljoprivredni fakultet 

Novi Sad. Novi Sad. 

Kojić, M. i Ajder, S. (1996): Problemi biodiverziteta u agrarnim ekosistemima. Zbornik radova 

Petog kongresa o korovima, Banja Koviljača, str. 35-63. 

Marisavljević, D. (2007): Rasprostranjenost, bioekološke karakteristike i suzbijanje Ive (Iva 

xanthifolia Nutt.), doktorska disertacija. Poljoprivredni fakultet, Univerzitet u Novom 

Sadu. str. 99. 

Milanova, S. (2001): Some morphological and bioecological characteristics of Iva xanthifolia 

(Nutt.). Bulgarian Journal of Agricultural Science, 7: 141-146 

Nejgebauer, V., Živković, B., Tanasijević, and Đ., Miljković, N. (1971). Pedološka karta. In: 

Zemljišta Vojvodine, Razmera 1: 400 000. (Eds. K. Živković, V. Nejgebauer, Đ. 

Tanasijević, N. Miljković, L. Stojković, P. Drezgić). Institut za poljoprivredna 

istraživanja, Novi Sad. 

Šajinović, B. i Koljadžinski, B. (1966): Nova adventivna vrsta Iva xanthifolia Nutt. 

(Cychachaena xanthifolia Fresen) u našoj zemlji. Glasnik Prirodnjačkog muzeja 

Beograd, Ser. B. 21: 217-220. 

StatSoft, Inc. (2011). STATISTICA (data analysis software system), version 10. 

Vrbničanin, S., Karadžić, B. i Dajić-Stevanović, Z. (2004): Adventivne i invazivne korovske 

vrste na području Srbije. Acta herbologica, 13: 1-3. 

Živković, B., Nejgebauer, V., Tanasijević, Đ., Miljksović, N., Stojković, L., Drezgić, P. (1972): 

Zemljišta vojvodine. Institut za poljoprivredna istraživanja, Novi Sad. Novi Sad.

Štefan Tyr, Tomaš Vereš 99 

International Symposium: Current Trends in Plant Protection UDK: 633/635-251(437.6) 

Proceedings 

DISTRIBUTION OF INVASIVE WEED SPECIES IN 

AGROECOSYSTEMS 

ŠTEFAN TÝR, TOMÁŠ VEREŠ 

Slovak University of Agriculture in Nitra, Faculty of Agrobiology and Food Resources, 

Department of Sustainable Agriculture and Herbology; e-mails: Stefan.Tyr@uniag.sk; 

Tomas.Veres@uniag.sk 

The aim of this study was to determine the distribution of invasive weed species in 

agroecosystems in the maize production region of Slovakia. The most dangerous invasive weeds in 

maize, sunflower, sugar beet stands and in the stubbles after cereals and oilseed crops were Ambrosia 

artemisiifolia L., Abutilon Theophrasti Med. and Iva xanthiifolia Nutt.. They infested stands with low 

to medium intensity of their actual weed infestation. Field margins were infested with A. 

artemisiifolia L., A. Theophrasti Med., I. xanthiifolia Nutt., Helianthus tuberosus L. and Solidago 

canadensis L. with weak to medium rate of their actual weed infestation. Sorghum halepense L. 

infested only in maize stands with few plants per m 2 . 

Key words: invasive weeds, Ambrosia artemisiifolia L., Abutilon Theophrasti Med., Iva 

xanthiifolia Nutt. 

INTRODUCTION 

On agricultural lands, weeds are defined by their effects on a human modifies 

environment; that is they generally interfere with crop production or other uses of the land. 

They are plants that grow out of place; plants that are competitive, persistent and pernicious 

(James, et al., 1991). Once introduced to a cropping situation, weeds are spread further as 

hitchhikers on equipment and vehicles and as contaminants of agricultural products. In 

natural areas, the definition expands to include introduced aggressive plants that produce a 

significant change in terms of composition, structure, or ecosystem recognized as major 

problems in world agriculture. Invasive plants do not constitute a separate biological 

category. However, invasive plants do have characteristics that permit them to rapidly 

invade new areas and outcompete native plants for light, water, and nutrients (Westbrooks, 

1998). 


The assessment of the invasive weed species in agroecosystems of south-west 

Slovakia was conducted at the fields in maize production region in the years 2010 – 2012. 

Share of arable land in maize production region is 24% in up to 200 m above sea. Average 

year temperature is 9.5-10.5°C and average year precipitation is between 550-600 mm. At

100 Distribution of the invasive weed species in agroecosystems 

the selected fields common chemical weed practices were used. Present study assessed the 

actual weed infestation of agroecosystems in maize production region with invasive plants 

in canopies of maize, cereals, oilseed crops and row crops during the years 2010 – 2012. 

An actual weed infestation of agroecosystems with invasive plant species was 

evaluated before application of herbicides with concordance to modified international scale. 

Screening of each field was made on the quadrant of 1m 2 area with four replications. One 

quadrant of each replication was 1.0m x 1.0m. The four randomly established sample 

quadrants were situated minimally 20 m from field margin and apart each other, 

respectively. The fields with same history were selected. Standard mechanical and chemical 

weed control have been used. The level of infestation was evaluated according to average 

density of weeds per square meter (Table 1). 

Table 1. Evaluation scale of actual weed infestation 

Actual weed infestation 

none weak low medium heavy 

Group of weeds* 

Infestation level 

0 1 2 3 4 

Number of weeds per m 2 

Excessively dangerous - 2 3-5 6-15 ≥ 16 

Less dangerous - 4 5-8 9-20 ≥ 21 

Less important - 8 9-15 16-30 ≥ 31 

*- weed species checklist Hron-Vodák, 1959, modified by authors Smatana-Týr, 2011. 

Received dates were computed to whole area of growing crop and statistically 

analysed in Statistica 7.0. 


In the last years Abutilon Theophrasti Med. became dominant invasive weed species 

in the Slovak Republic. It occurred mainly in maize, sugar beet and sunflower stands. But 

also stands of winter and spring cereals, winter rape and peas were infected with this 

invasive weed. A. Theophrasti became also one of the most problematic weeds in the field 

margins (Table 2). Iva xanthiifolia Nutt occurred mainly in maize, sugar beet and sunflower 

stands but also in the stands of winter and spring cereals and winter rape. I. xanthiifolia 

infested the sugar beet, sunflower and maize stands and also field margins in lower rate 

(Table 2). 

Ambrosia artemisiifolia L. infested mainly maize and sunflower stands but also 

stubbles after cereals and oilseed crops cropping. A. artemisiifolia was important weed of 

field margins and disturbed sites of agroecosystems with up to medium level of actual weed 

infestation (Table 2).

Štefan Tyr, Tomaš Vereš 101 

Table 2. Weed infestation of parts of the agroecosystem with invasive weeds. 

Weed Part of the agroecosystem Actual weed infestation 

Ambrosia artemisiifolia L. Field margins low - medium 

Disturbed sites of fields low - medium 

Crop stands 

low - medium 

Abutilon Theophrasti Med. Field margins weak - low 

Crop stands 

low - medium 

Iva xanthiifolia Nutt. Field margins weak - low 

Crop stands 

low - medium 

Sorghum halepense L. Crop stands weak - low 

Helianthus tuberosus L. Field margins weak - low 

Solidago canadensis L. Field margins weak - low 

Abutilon Theophrasti Med. is establishing itself in warmer regions as a weed of 

wide-row crops. The optimum environment for this species is in sugar beet stands, where in 

comparison with grass weeds, this broad-leaved weed overgrow and overshadow sugar beet 

and cause more damage (Konstantinović et al., 2001). Plants of A. Theophrasti are very 

noticeable in sugar beet because of their height and leaf diameter. Biological characteristics 

predetermine this species to become a major late summer annual weed in our conditions. In 

the area of its origin, which is in middle Asia, it can be found as an arable weed mostly in 

cotton and soya. In central Europe it occurs more frequently since the 1980’s. In the Czech 

Republic is A. Theophrasti a ruderal plant on places of its introduction (train stations, 

storage places) and only occasionally on arable land (South Moravia, lowlands of the Elbe 

river) (Jehlík, 1998; Soukup et al., 2004) 

Iva xanthiifolia is also as A. Theophrasti a weed of wide row crops. It caused serious 

damages in sugar beet stands (Konstantinović et al., 2006) According to Tóth (2008) I. 

xanthiifolia and A. Theophrasti reached the higher overpopulation rate and their control is 

at the higher economic importance in the Slovakia. 

Main localities, where A. artemisiifolia can be finding in the Slovak Republic, are 

lowlands. It grows mainly on railway stations, docks and industrial objects, agricultural, 

ruderal and urban sites (Jehlík, 1998; Tóth, 2008). But results of weed survey show that 

Ambrosia has potential to spread into the agroecosystems not only in maize production 

region of Slovakia. 

REFERENCES 

James, L.F., Evans, J.O., Ralphs M.H., Child, R.D. (1991): Noxious range weeds. Westview 

Press, Boulder. 466 pp. 

Jehlík, V. (1998): Alien expansive weeds of the Czech Republic and the Slovak Republic. 

Academia, Prague, Czech Republic, p. 506, ISBN 80-200-0656-7. 

Konstantinović, B., Meseldžija, M. (2001): Zakorovljenost šećerne repe i primena herbicida u 

sušnim uslovima sa osvrtom na problem perzistentnosti, XXII Seminar iz zaštite bilja, 

Novi Sad. 

Konstantinović, B., Meseldžija, M. (2006): Occurrence, spread and possibilities of invasive 

weeds control in sugar beet. Proc. Nat. Sci., 110: 173-178. 

Smatana, J., Týr, Š (2011): Základy herbológie. 1. vyd. Nitra : Slovenská poľnohospodárska 

univerzita, 125 p. ISBN 978-80-552-0579-3.

102 Distribution of the invasive weed species in agroecosystems 

Soukup, J., Holec, J., Hamouz, P., Tyšer, L. (2004): Aliens on arable land. Scientific 

Colloquium, Weed Science in the Go, pp. 11-22. 

Tóth, Š. (2008): Weed occurrence under the field conditions of Slovakia. Acta fytotechnica et 

zootechnica, 11, 4:89-95. 

Westbrooks, R. (1998): Invasive plants, changing the landscape of America: Fact book. Federal 

Interagency Committee for the Management of Noxious and Exotic Weeds 

(FICMNEW), Washington, D.C. 109 pp.

Milica Radanović, Bojana Bokić, Boris Radak, Milica Rat, Goran Anačkov 103 

International Symposium: Current Trends in Plant Protection UDK: 582.998.1-19(497.113) 

Proceedings 

MODEL FOR THE SECONDARY SPREADING AREA OF 

INVASIVE SPECIES IVA XANTHIFOLIA NUTT. 1818 

(ASTERACEAE, HELIANTHAE) FROM ANTROPOGENIC 

DEPENDENT ON NATIVE HABITATS 

MILICA RADANOVIĆ, BOJANA BOKIĆ, BORIS RADAK, MILICA RAT, GORAN ANAČKOV 


e mail: milica.radanovic@dbe.uns.ac.rs 

The subject of our study was Iva xanthifolia Nutt. 1818, an invasive plant species native to 

North America. In this paper, we tried to determine the current state of populations of this species in 

Vojvodina, their geographical distribution in anthropogenic habitats and the model for secondary 

transition to natural and semi-natural habitats. The study of species I. xanthifolia was carried out in 

Serbia in the area north of the Danube and Sava rivers (Vojvodina), except the southeastern part. It 

was found that the roads and railways are primary routes for expansion in Vojvodina. After transition 

from primary dispersion sites to secondary, which are dikes of rivers and their flood areas, this 

species increases its populations, which now represent the zones for further expansion to natural 

ecosystems. 

Key words: invasive species, Iva xanthifolia, Vojvodina, a model of secondary spread 

INTRODUCTION 

Invasive species, regardless of the origin and genesis, are considered to be alien 

organisms in a particular geographic region. They may be native for other part of the 

country in which are invasive, for nearby or distant regions of the same state or another 

continent (Weber, 1997). Negative impact of invasive plants is reflected in their high 

competitive capabilities in the fight for resources with native species, as well as their ability 

to modify habitat conditions which lead in increasing of their dominance and withdraw of 

native plant species. These plants in relatively short period of time can dramatically 

increase their range (Davies et al., 2009). Most often they are related to semi-autonomous 

and no autonomous ecosystems and mainly occur in large amount in such places. However, 

invasive species are weak competitors for the native species in natural habitats and in these 

occur only in the case of habitat degradation (Jarić, 2009). 

In Vojvodina region were registered 144 invasive plants species (Boža, 2011). 

Among them in the largest percentage are represented species native to the New World, 

primarily from North America, from where is Iva xanthifolia Nutt. 1818. 

Species I. xanthifolia is an annual herbaceous plant (Gajić, 1975), which flowers 

from July to October (Cyclachaena, 2006). This species is native to North American 

prairies, where inhabits abandoned fields, alluvial rivers plains, floodplains and stream

104 Model for the secondary spreading area of invasive species,... 

banks (Cyclachaena, 2006). First data for Europe is from 1858th (Potsdam) and in the 

Carpathian Basin appeared after World War II (Hegi, 1966). 

The first record of this species for Serbia was in 1966 year, close to Novi Sad, from 

where it quickly spread to 20 new sites. This species was introduced by accident (Boža, 

2011) and it’s consider to entered Serbia from southern Hungary region, most likely by 

roads and railway traffic (Koljadžinski and Šajinović, 1973). 

This species is related to the recently formed ruderal habitats such as layers of soil 

and construction waste, dumps, warehouse surrounding and alongside transport hubs. On 

places like this I. xanthifolia reaches the optimum conditions for survival, development and 

further expansion, achieving maximum growth and dense ground cover, suppressing the 

emergence of competing species. It also occurs in the wider area around the abandoned 

channels, mounds of loose earth and residues after harvest of maize and sunflower 

(Koljadžinski and Šajinović, 1973) and spreads by transport. The massive presence of 

dense populations living on existing sites in our country, which abundantly fruiting, 

confirm that they had found a fertile soil, so we can predict that this species will relatively 

quickly expand its range. Reduced competition in phytocoenosis of ruderal habitats, 

favorable microclimate conditions for seed germination and vicinity to transportation 

networks affect the expanding speed of this species (Šajinović and Koljadzinski, 1978). 

Considering that the knowledge and informations about current status of the 

invasive range of each of the invasive species is of particular concern for Vojvodina, the 

aim of this paper is to present the current status of populations I. xanthifolia in Vojvodina, 

their geographical distribution in anthropogenic habitats and the model for secondary 

transition to natural and semi-natural habitats. 


The study of a species I. xanthifolia was carried out in Serbia in the area north of the 

Danube and Sava rivers (Vojvodina), which geographically covers the southern part of the 

Pannonian Basin. Due to the lack of literature data, which would serve as a basis for further 

analysis, this paper has not covered the southeastern part of the study area. 

Based on available literature, we collected data on the distribution of this species 

from the moment of entrance in this region. On field trips we verify old literature and 

recorded some new field data. 

Importing data on a map and creation of distribution map was performed using 

OziExplorer and Diva Gis programs. To determine penetration of this species in natural 

habitat, we used the map of protected natural areas in Vojvodina and guide "Habitats in 

Serbia" (Blaženčić et al., 2005). 

RESULTS 

Synthetic distribution database of species I. xanthifolia in Vojvodina include data 

from the literature, herbarium collections and field studies (Table 1). Table 1 represents 

locations and types of habitats where each of population had been recorded. Primary 

distribution map of species I. xanthifolia in Vojvodina is based on of the mentioned base 

(Figure 1).


Table 1. Distribution of species I. xanthifolia in Vojvodina 

Region Locality Coordinates 

Banat 

Banat 

Banat 

Banat 

Banat 

Banat 

Banat 

Banat 

Banat 

Banat 

Banat 

Banat 

Banat 

Banat 

Banat 

Bačka 

Bačka 

Bačka 

Bačka 

Bačka 

Bačka 

Bačka 

Bačka 

Bačka 

Bačka 

Banatsko 

Karađorđevo 

Bečej 

Čestereg 

Jaša Tomić 

Kikinda 

Nova Crnja 

Orlovat 

Road Bašaid- 

Melenci 

Road Bašaid- 

Kikinda 

Road 

Melenci- 

Zrenjanin 

Road 

Kikinda- 

Bašaid 

Sečanj 

Tomaševac 

Zrenjanin 

Žitište 

Apatin 

Bačko 

Gradište 

Bezdan 

Bezdan 

Crvenka 

Despotovo 

Despotovo 

Gornji Breg 

Horgoš 

Between 

Apatinski rit 

and Apatin 

45 .590042 

20 .556063 

45 .620664 

20 .035304 

45 .563633 

20 .532304 

45 .448352 

20 .855316 

45 .808263 

20 .433174 

45 .668409 

20 .605035 

45 .243140 

20 .582791 

45 .604443 

20 .394295 

45 .666583 

20 .421450 

45 .455665 

20 .352816 

45 .730240 

20 .419453 

45 .365764 

20 .772461 

45 .269796 

20 .621682 

45 .380876 

20 .349202 

45 .485150 

20 .550457 

45 .671692 

18 .981019 

45 .530626 

20 .023352 

45 .842765 

18 .940911 

45 .849000 

18 .925732 

45 .658595 

19 .456334 

45 .449970 

19 .516730 

45 .454770 

19 .503730 

45 .919608 

20 .017897 

46 .152810 

19 .965602 

45 .645195 

18 .975108 

Type of 

habitat 

Region Locality Coordinates 

e16 Bačka Kać- road 

e16 Bačka Kać- field 

e16 Bačka Kanjiža 

e16 Bačka Kljajićevo 

e16 Bačka Kucura 

e16 

j41 

j42 

j42 

j42 

j42 

Bačka 

Bačka 

Bačka 

Bačka 

Bačka 

Bačka 

j41 Bačka Senta 

j41 Bačka Sivac 

Maglić - road 

Bački Petrovac- 

Silbaš 

Novi Sad- Novo 

Naselje 

Novi Sad- Slana 

bara 

Novi Sad- 

Internacionalni put 

Road Bačko 

Petrovo Selo- Ada 

Road Rumenka- 

Kisač 

e16 Bačka Stanišić 

e16 Bačka Subotica 

e16 Bačka Šajkaš 

e16 Bačka Titel 

e16 Bačka Velebit 

j41 Bačka Vrbas 

e16 

Bačka 

Žabalj 

j42 Srem Batajnica 

j43 

Srem 

Fruška gora- 

Crveni čot 

e16 Srem Nova Pazova 

e16 

Srem 

Road Šid- 

Adaševci 

j41 Srem Ruma 

45 .312719 

Bačka Kać 

e16 Srem Stara Pazova 

19 .926299 

Legend: 

e1.6 Subnitrophilous annual grassland 

e6.2 Continental inland salt steppes 

g1.7 Thermophilous deciduous woodland 

i1.5 Bare tilled, fallow or recently abandoned arable land 

j4.1 Disused road, rail and other constructed hardsurfaced areas 

j4.2 Road networks 

j4.3 Rail networks 

45 .318937 

19 .930126 

45 .319895 

19 .921353 

46 .062573 

20 .052116 

45 .769430 

19 .278266 

45 .538730 

19 .611740 

45 .374470 

19 .536080 

45 .257325 

19 .798982 

45 .286996 

19 .811349 

45 .305255 

19 .850034 

45 .728946 

20 .103245 

45 .310240 

19 .741770 

45 .928108 

20 .075413 

45 .701859 

19 .381490 

45 .935193 

19 .165731 

46 .029425 

19 .661083 

45 .272385 

20 .088905 

45 .205063 

20 .298944 

45 .008225 

19 .948263 

45 .564370 

19 .642460 

45 .347529 

20 .036925 

44 .905828 

20 .275203 

45 .157081 

19 .718174 

44 .944086 

20 .218711 

45 .102294 

19 .220938 

45 .008104 

19 .816423 

44 .985002 

20 .162332 

Type of 

habitat 

e16 

i15 

e16 

e16 

j42 

j42 

e16 

e16 

e16 

j42 

e16 

e16 

e16 

e16 

e16 

e16 

e16 

e62 

e16 

e16 

e16 

g17 

e16 

j42 

e16 

e16


Figure 1. Distribution of species I. xanthifolia in Vojvodina 

Legend: 

1. flood areas of Danube river in the region of Special Nature Reserve ’’Gornje Podunavlje’’ 

2. saline near Velebit village 

3. embankment along the Tamiš river 

4. edge of the forest on Fruška Gora mountain highways 

The most number of sites that represent the most vital I. xanthifolia populations are 

often monodominant and correspond to anthropogenic habitats such as ruderal places 

alongside roads and settlements periphery. A few populations deviate from that rule - west 

end points are located in flood areas in the Danube region, in the Special Nature Reserve 

’’Gornje Podunavlje’’ (1), then saline around Velebit village (2), bank along the river 

Tamiš (3) and forest edges on the Fruška Gora mountain (4). In all cases except saline, 

these are a seminatural-ecosystems, i.e. anthropogenic formations, which are in the phase of 

returning to its original condition due to lack of human maintenance (Table 2).


Table 2. Percent of certain types of habitats in relation to level of degradation 

Type of habitat Habitat mark Percentage of prevalence % 

Anthropogenic habitat 

Seminatural habitat 

e1.6 

i1.5 

j4.2 

j4.3 

g1.7* 

65.38 

1.92 

17.31 

1.92 

1.92 

9.62 

j4.1 

Natural habitat e6.2 1.92 

Legend: 

e1.6 Subnitrophilous annual grassland 

e6.2 Continental inland salt steppes 

g1.7 Thermophilous deciduous woodland 

i1.5 Bare tilled, fallow or recently abandoned arable land 

j4.1 Disused road, rail and other constructed hardsurfaced areas 

j4.2 Road networks 

j4.3 Rail networks 

* habitat conditionally taken as the seminatural, because population of I. xanthifolia was found at the 

edge of thermophilous deciduous forest 

Species I. xanthifolia spread into Vojvodina from south Hungary by transport 

network (Koljadžinski and Šajinović, 1973). This type of entrance is typical for most 

invasive species with similar habit, which are, like iva, usually spread by transport and 

agricultural products, seeds and agricultural techniques, considering that they are terophits 

who have propagules which does not require a large space or special conditions for 

survival. Presence of mainly degraded habitats alongside roads and railways makes this 

model of spreading of invasive species dominant. This type of entrance and the significant 

presence of degraded habitats in the study area, reflect the current distribution of the 

investigated species in Vojvodina. Species I. xanthifolia primarily, after entering a new 

area, inhabits ruderal habitats near human settlements and factory facilities. The largest 

amount of registered individuals are located along the main roads in Vojvodina. These 

populations are visible on the main roads from Novi Sad to Belgrade, Subotica, Sombor 

and Zrenjanin. Strong anthropogenic influence on these habitats and lack of predators in the 

allochthonous area help this species to suppress native species and expanded its distribution 

area. These types of habitats are the primary source for further spread of investigated 

species in semi-natural and natural habitats. 

On several sites iva had been recorded in flood zones along the bank of the Danube 

and Tamiš river (Figure 1, points 1 and 3). Such habitats are in many cases under the lower 

human impact in relation to the transport network and some of them are capable in restoring 

primary natural characteristics. As a species that prefer increased humidity in its native area 

(Cyclachaena, 2006), iva found here a place to expand and increase its populations. Primary 

routes for expansion in Vojvodina are roads and railways, but on such places iva does not 

appear in very large populations, but vary depending on seasonal climatic conditions and 

anthropogenic impacts (road maintenance, mowing, agricultural activities). After transition 

from primary dispersion sites to secondary, like rivers banks and their flood areas, this 

species increases its population, which now represents zones for further expansion to 

natural ecosystems. The occurrence of this species on saline near village Velebit (Figure 1, 

point 2) seems to deviate from this model, because of presence on a habitat that is not 

characteristic for this species. However, detailed analysis of this area shows a large number


of water bodies - ponds, backwaters and regulated system of canal waterways makes this 

area very wet and therefore close to its native habitat. 

According to the results of the analysis of distribution area of invasive species Iva 

xanthifolia in Pannonian region of Serbia, can be concluded that this species is successfully 

adapted to the increased rate of climate aridity. Progressive area that these species shows in 

contact zone between anthropogenically-dependent and natural habitats indicates its large 

invasive capacity. This is reflected in fact that the species showed a high degree of 

tolerance to physical drought, and successfully populate saline habitats. On the other hand, 

its primary need for high degree of substrate moisture and preference to mesophilic habitats 

points to another potential expansion direction, like azonal wet meadows near wetlands and 

marshes that are specific for Vojvodina and are immeasurable for its total biodiversity. 


This article was done under the project 173030 funded by the Ministry of Education 

and Science of the Republic of Serbia. 

LITERATURE 

Blaženčić, J., Ranđelović, V., Butorac, B., Vukojičić, S., Zlatković, B., Žukovec, D., Ćalić, I., 

Pavićević, D., Lakušić, D. (2005): Staništa Srbije – Priručnik sa opisima i osnovnim 

podacima. Institut za Botaniku i Botanička Bašta »Jevremovac«, Biološki fakultet, 

Univerzitet u Beogradu. Beograd. 

Boža, P. Taxon: Iva xanthifolia (Linnaeus, 1758). [citirano 2012 June 30]. U Lista invazivnih 


Verzija 0.1beta. Anačkov G, Bjelić-Čabrilo O, Karaman I, Radenković S, Radulović S, 

Vukov D, Boža P, editori. Novi Sad (Serbia): Departman za biologiju i ekologiju; 2011. 

Cyclachaena xanthiifolia (30.06.2006.) [Internet]. [citirano 12.juna 2012.]. Dostupno na: 

http://www.efloras.org/florataxon.aspx?flora_id=1&taxon_id=250066460 

Davies, K., Johnson, D. (2009): Prevention: A proactive approach to the control of invasive 

plants in wildlands. In: Wilcox, C., Turpin, R. (Eds.), Invasive species: Detection, impact 

and control. Nova Science Publishers, Inc. pp: 81-96. 

Gajić, M. (1975): Rod Iva L. 1753 u Josifović, M. (Ed.), Flora SR Srbije VII. Srpska Akademija 

nauka i umetnosti, Odeljenje prirodno – matematičkih nauka, Beograd. pp: 64-65. 

Hegi, G. (1966): Illustrierte flora von Mitteleuropa. Band VI, teil 3, liefg. 3. Verlag Paul Parey, 

Berlin-Hamburg 


Srema. Doktorska disertacija. Poljoprivredni fakultet, Beograd. 

Koljadzinski, B., Šajinović, B. (1973): Nova nalazišta adventivne biljne vrste – Iva xanthifolia 

Nutt. (Cyclachaena xanthifolia Fresen.) u Vojvodini. Zbornik za prirodne nauke. Matica 

Srpska, Novi Sad. pp: 113-121 

Šajinović, B., Koljadžinski, B. (1978): Prilog proučavanju procesa naturalizacije adventivnih 

biljnih vrsta - Ambrosia artemisiifolia L.1753 i Iva xanthifolia Nutt.1818 (Asteraceae) u 

Vojvodini. Acta biologica Iugoslavica Biosistematika 4 (1): 81-92. 

Weber, E. (1997): The alien flora of Europe: a taxonomic and biogeographic review. Journal of 

Vegetation Science 8: 565-572. IAVS; Opulus Press Uppsala, Sweden.

Simin Đurica, Vestek Ana, Vukov Dragana, Anačkov Goran 109 

International Symposium: Current Trends in Plant Protection UDK: 582.542.11(497.113) 

Proceedings 

DIVERSITY AND DISTRIBUTION OF THE SPECIES OF GENUS 

BROMUS L. 1753 IN VOJVODINA 

SIMIN ĐURICA. 1* , VESTEK ANA. 1 , VUKOV DRAGANA. 1 , ANAČKOV GORAN. 1 

University of Novi Sad, Faculty of Science, Department of Biology and Ecology, Trg D. 

Obradovic 2, 21000 Novi Sad, Serbia 

*djurdjicasimin@gmail.com 

The genus Bromus L. is mostly distributed in northern hemisphere, where a significant 

percentage of species are involved in the construction of different types of herbaceous vegetation. 

Species of this genus are known as a forage and allergenic plant. In the area of Vojvodina are noted 

12 out of 14 species that are known for the flora of Serbia. Of the total number of analyzed species, 

six are wide and three are sporadically distributed. Three species are stand out as a rare species in the 

region, of which B. racemosus L. and B. secalinus L. according to data from literature are not found 

in the Banat region. Among analyzed taxa dominate the medium-high and high annual herb 

(therophytes) scaposus form. According to the type of adaptive strategy most of the taxa belongs to 

the group DT - plants tolerant to changes in natural habitats. They are one of the main components of 

the plant communities of meadows and pastures, as well as the habitats under strong human impact. 

Key words: Bromus L., distribution, diversity, life forms, ecological indexs, correspondent 

analysis 

INTRODUCTION 

Vegetation of Vojvodina includes steppes, steppes-forests, sandy ecosystems on the 

loess plateau and sandstones, as well as continental halobiome (Stevanovic et al., 1995). 

This area can be divided into two vegetation belts: lowland region and montan area, which 

includes two island mountains in the Vojvodina. The dominant vegetation of the study area 

consists of arable land and various forms of meadows and pastures (Janković et al., 1984). 

The most frequent communities that are core mass of the herbaceous habitats belongs to 

classes: Festuco-Brometea Br.-Bl. et Tx. 1943., Festucetea vaginatae Soó 1968. em. Vich. 

1972., Chenopodietea albae Br.-bl. 1951. em. Lohm., R. et J. Tx. 1961., Artemisietea 

vulgaris Lohm., Prsg. et Tx. 1950., Plantaginetea majoris Tx. et Prsg. 1950., Stellarietea 

mediaea Tx., Lohm. et Prsg. 1950. (Kojić et al. 1998). 

Genus Bromus includes about 37 species, widespread predominantly in the northern 

temperate zone, while in Serbia are recorded 14 species (Smith, 1980; Tatić, 1976). 

Annuals species (15) occurs in ruderal habitats, as well as weeds on the surface of the 

culture and arid habitats, especially in the southern parts of their range (Smith, 1980). Most 

species are characterized by tolerance to drought and severe competition. As a important 

agricultural species stands out two species: Bromus inermis Leyssr. and B. erectus Huds. 

Species B. erectus is the main builders of mountain meadows, whose hay is the primary

110 Diversity and distribution of the species of genus bromus L.1753 in Vojvodina 

food source in livestock (Smith, 1980). Highly allergenic properties exhibits pollen of B. 

sterilis L. (Igić, 2012). According to morphological characters, within the genus Bromus, 

there are outstanding and unresolved problems of species differentiation. As a consequence 

taxa are inaccurately defined and misinterpreted, especially in phytocenological studies. In 

this sense, particularly interesting are the representatives of the sections Pnigma Dumort, 

within which occurs a number of European endemics species, as well as some 

representatives of the typical sections, especially species B. intermedius Guss., B. japonicus 

Thunb. and B. squarrosus L. (Smith, 1980). 

For all these reasons, and particularly the need for actual knowledge of the diversity 

and taxonomy of species, data for the area in the southeast part of the Pannonian lowland 

were compiled from the literature and herbarium collections. The fact that genus Bromus is 

an important indicator and builder of grass vegetation, points out the significance knowing 

the ecology of Bromus species, towards the detection of habitats and their correct 

classification. 


The nomenclature data collected from the literature and herbarium were 

systematized and harmonized with data provided by Flora Europaea (Smith, 1980). 

Analyzed data covered the period of 95 years, and obtained localities are grouped by 

regions: Backa, Banat and Srem. Ranges of taxa are shown in UTM maps (Universal 

Transverse Mercator) of Vojvodina, extent of 10x10 km (Walter and Straka, 1970). Floral 

elements are given by Soó (Soó, 1973). Ecological characteristics of species are represented 

by the life forms by Raunkier, revised and supplemented for the flora of Serbia 

(Stevanović, 1992). The analysis of ecological conditions includes data on habitat types 

(Blaženčić et al., 2005), ecological indexs for basic abiotic factors as well as an overview of 

adaptive strategies for selected species of the genus Bromus (Borhidi, 1993). 

Phytogeographic and ecological data are presented with aim to examine the general 

trend of the impact of biogeographical and ecological parameters on the analyzed species. 

These data are coded and analyzed using correspondence analysis (CA) and presented in 

the space of the first two axes. For statistical analysis is used software package Statistica for 

Windows ver .10.0 (StatSoft, 2012). 

RESULTS 

Based on the analyzed data and created UTM maps, in Vojvodinat are recorded 12 

species from the genus Bromus. Of the total number of analyzed species of the genus, as 

very frequent can be distinguished taxa: Bromus arvensis subsp. arvensis, B.commutatus 

subsp. commutatus, B. inermis subsp. inermis, B. hordeaceus subsp. hordeaceus, B. sterilis, 

B. tectorum. The species which are sporadically distributed in Vojvodina are: B. erectus 

subsp. erectus - data for the presence in the localities in northern Backa and eastern Banat 

have not been recorded since 1975 (Fig. 1), B. japonicus subsp. japonicus - data for the 

presence on localities from Backa and Srem dating back to 1915 (Fig. 2), B. squarrosus 

subsp squarrosus - most common on the Fruska gora Mountain (Fig. 3). The rare species in 

the region are: B. racemosus - in the Banat region is not observed (Fig. 4), B. ramosus - 

spreads along the Danube (Fig. 5) and B. secalinus subsp secalinus - the Banat region is 

without data (Fig. 6).


Figure. 1. Distribution of the B. erectus Huds. in Vojvodina 

Figure. 2. Distribution of the B. japonicus Thunb. in Vojvodina 

Figure. 3. Distribution of the B. squarrosus L. in Vojvodina


Figure. 4. Distribution of the B. racemosus L. in Vojvodina 

Figure. 5. Distribution of the B. ramosus Huds. in Vojvodina 

Figure. 6. Distribution of the B. secalinus L. in Vojvodina


Analysis of the biogeographical characteristics of the genus Bromus, on the southern 

edges the Pannonian lowland, indicates that the species mostly belong to of the Eurasian 

areal type. Observed ecological features indicates that the therophytes are predominantly 

presented in the investigated area. The analyzed species are thermophilic, continental and 

salt non-tolerant plants and inhabit dry, mesotrophic, lighted and open habitats with 

alkaline reaction. In Vojvodina, most species of the genus Bromus according to the type of 

adaptive strategy, belongs to a group of plants tolerant to changes in natural habitats (Tab. 

1). 

Table 1. Floral elements, areal types, life forms, ecological features, adaptive strategies and 

types of habitat for species of the genus Bromus in Vojvodina 

Name of 

taxon 

B. arvensis 

subsp. 

arvensis L. 

1753 

Floral element 

(Soó, 1973) / 

Areal type* 

Life form 

(Stevanović, 

1992)** 

Ecological indexes 

(Borhidi, 1993)*** 

TB WB RB NB LB CB SB 

Adaptive 

strategies 

(Borhidi, 

1993)**** 

Evr./Euras T 6 4 8 5 7 4 0 W E 1.2 

Habitat 

types 

(Blaženčić 

et al., 

2005)***** 

B.commuta 

tus subsp. 

commutatu 

s Schrad. 

1806 

AsM/Med_Sub 

med 

T 7 4 7 3 6 4 0 DT C 3.2 

B. erectus 

subsp. 

erectus 

Huds. 1762 

PaB/PontS_Sib H 6 3 8 3 8 2 0 C 

E 1.2, F 3.2, 

G 1.A 

B. inermis 

subsp. 

inermis 

Leyssr. 

1761 

Cir/Holarct H 6 4 8 5 8 7 0 C E 3.4 

B. 

japonicus 

subsp. 

japonicus 

Thunb. 

1784 

Koz/Cosm T 8 3 8 5 8 7 0 DT E 1.2


B. 

D 6.1, E 

hordeaceus 

1.2, E 1.2C, 

subsp.hord Koz/Cosm T 6 5 6 5 7 3 0 DT 

E 1.7, E 2.5, 

eaceus L. 

E 3.4, E 6.2 

1753 

B. 

AsM/Med_Sub 

racemosus 

T 6 8 5 5 6 2 0 DT E 1.2 

med 

L.1762 

B. ramosus 

Huds. 1762 Evr./Euras H 6 5 7 6 6 2 0 G G 1.6 

B. 

secalinus 

subsp. 

secalinus 

L.1753 

Evr./Euras T 7 4 6 5 6 3 0 DT G 1.1, F 3.2 

B. 

E 1.2, E 

squarrosus 

1.2C, E 

subsp. Evr./Euras T 8 2 7 3 9 7 0 NP 

1.2F, F 3.2, 

squrrosus 

G 1.7 

L. 1753 

B. sterilis L. 

F 3.2, G 

Evr./Euras T 7 4 6 5 7 4 0 RC 

1753 

1.1, C 3.5 

B. tectorum 

Evr./Euras T 6 3 8 4 8 7 0 DT E 3.4 

L. 1753 

* Evr./Euras - Eurasian / Eurasian; AsM/Med_Submed - Atlantic - submediterranean / Mediterranean - submediterranean; 

PaB/PontS_S - Pannonian - Balkans / Pontic – South Siberian; Cir/Holarct - Circumpolar / Holarctic; Koz/Cosm - Cosmopolitan 

/Cosmopolitan 

**T - Therophyta; H - Hemicryptophyta 

*** TB - The relative "temperature figures" reflecting the heat supply of the habitats where the species occur.; WB - The relative 

"moisture figures" (occurence in relation to soil moisture or water table).; RB - Reaction figures reflect to the occurence of the 

plants in relation of the soil reaction of the habitats.; NB - Nitrogen figures based on the occurence in relation to the ammonia and 

nitrate supply of the habitats.; LB - "Light figures" based on the occurence of plants in relation to relative light intensity during 

summer time.; CB - "Continentality figures" based on the main distribution of plants according to degree of continentality of the 

general climate with emphasis on maximum and minimum temperature.; SB - "Salto figures" for indicating plant occurence in 

relation to the salt concentration of the soils. 

***** C-competitors; G-generalists; NP-plants of habitats disturbed by natural factors: Natural pioneers; DT-Disturbance tolerant 

plants of natural 

*****E 1.2 - Perennial calcareous grassland and basic steppes; C 3.2 -Water-fringing reedbeds and tall helophytes other than canes 

; F 3.2 - Submediterranean deciduous thickets and brushes; G 1.A - Meso- and eutrophic [Quercus], [Carpinus], [Fraxinus], 

[Acer], [Tilia], [Ulmus] and related woodland; D 6.1 - Inland saltmarshes; E 1.2C - Pannonic loess steppic grassland; E 1.7 - 

Closed non-Mediterranean dry acid and neutral grassland; E 2.5 - Meadows of the steppe zone; E 3.4 - Moist or wet eutrophic and 

mesotrophic grassland; E 6.2 - Continental inland salt steppes; G 1.6 - [Fagus] woodland E 1.2F - Pannonic sand steppes; G 1.7 - 

Thermophilous deciduous woodland; G 1.1 - Riparian and gallery woodland, with dominant [Alnus], [Betula], [Populus] or [Salix]; 

C 3.5 - Periodically inundated shores with pioneer and ephemeral vegetation


The results of correspondence analysis, based on the association of selected 

ecological indices in the space of the first two axes showing the separation of species into 

three groups. In the first group are: Bromus racemosus, B. arvensis, B. hordeaceus, B. 

sterilis, B. secalinus, B. ramosus and B. commutatus. B. racemosus and B. arvensis 

inhabiting the mesotrophic habitats, growing in moist and slightly acidic soils, with 

tolerance to occasional flooding. The second group includes species that are xero-tolerant, 

with a greater requirement for the degree of light and inhabit the land with the base 

reaction: B. tectorum, B. japonicus, B. erectus and B. inermis. The most striking separation 

shows B. squarrosus, growing in open habitats with full brightness and tolerates long dry 

periods. Regarded to climate belts three groups of taxa are recognized. The first group of 

taxa is in the zone of thermophilic forests (B. commutatus, B. sterilis and B. secalinus). 

Sub-Mediterranean forest and meadows area includes: B. japonicus and B. squarrosus. The 

remaining species from the genus, recorded in Vojvodina, in terms of vegetation, 

corresponding to an equivalent area sub-mountainous broadleaf forests (Fig. 7). 

Figure 7. Mutual association of ecological indexes in the analyzed species of the genus Bromus 

in Vojvodina 

Analysis of the frequency and relationship between elements of life forms and 

adaptive strategies, separates the species into two groups with respect to the first axis. In the 

first group are: B. tectorum, B. japonicus, B. commutatus, B. hordeaceus, B. racemosus, B. 

arvensis, B. sterilis, B. secalinus, while the second group consists of: B. erectus, B. inermis 

and B. ramosus. Compared to the second axis, it is observed separation of species B. 

squarrosus. B. tectorum, B. japonicus, B. commutatus, B. hordeaceus, B. racemosus and B. 

arvensis that are medium height therophytes, belonging to the natural weeds tolerant to 

changes in natural habitats. B. secalinus and B. sterilis medium to high therophytes, ruderal 

competitors and species that are weeds among the indigenous species that may become 

dominant over their strategies and thus to influence a change in habitat. Species B. 

squarrosus is a medium height therophyte, natural pioneer that is among the first to occur 

in habitats exposed to certain influences that are unfavorable to plant life. B. erectus is 

medium to high hemicryptophyte, competiror, and B. inermis and B. ramosus are 

generalists. Competitors are the dominant species of the relevant community, and 

generalists are species in natural communities with a high tolerance (Fig. 8).


Fig. 8. The frequency and mutual association elements of life form the adaptive strategies of the 

analyzed species of the genus Bromus in Vojvodina 

Results of statistical analysis covering the frequency and correlation of areal types with the 

characters of continentality, indicate the separation of the genus Bromus in the two groups. 

The first group includes: B. commutatus, B. racemosus, B. sterilis, B. arvensis, B. secalinus, 

B. squarrosus, B. tectorum, B. hordeaceus and B. japonicus. Within this group there are 

indications of differences between taxa. On the one side are mediterraneansubmediterranean 

species, which are mainly distributed in central Europe and can reach up 

to the east, and on the other are taxa widespread throughout central Europe. For the group, 

consisting of B. ramosus, B. erectus and B. inermis, is characteristic that they are oceanic 

species, which are mainly distributed in western Europe and western part of central Europe. 

Slight separation of B. racemosus in relation to the above group may be explained by the 

mediterranean areal type, which is closer to the group characterized by a mediterraneansubmediterranean 

areal type. Clearly separation of B. inermis is a characteristic of a general 

nature of holarctic areal type (Fig. 9). 

Fig. 9. The frequency and mutual association areal types and continentality analyzed species of 

the genus Bromus in Vojvodina


DISCUSSION 

Comparing of statistically analyzed ecological indexes by Borhidi (1995) and habitat 

types based on the EUNIS classification system (Blaženčić et al., 2005) concludes that a 

separate group of taxa (B. tectorum, B. japonicus, B. erectus, B. inermis) requires habitats 

with high brightness, moderate humidity and base reactions. Species B. tectorum and B. 

inermis are most frequent in Vojvodina, because they inhabit wet eutrophic and 

mesotrophic grass formations typical for this territory (Blaženčić et al., 2005). It is assumed 

that sporadic occurrence of the B. japonicus (Fig. 2) can be explained as a result of 

misidentification of plant material. Most of the literature for this species dating back to 

1915 th (Prodán, 1916), and identification of plant material from these areas is done on the 

basis of dichotomy keys that didn’t contain taxonomicaly important characters for 

separation species within the genus Bromus. Namely, B. japonicus in the northern parts of 

Europe show high morphological similarity with species B. squarrosus and B. arvensis and 

as the result there is obvious suspicious of correct plant material identification. It is 

necessary to carry out detailed field studies and review of herbarium material in order to 

visualize the real image of distribution of this taxa. Information about sporadic presence of 

B. erectus (Fig. 1) at locations in northern Backa and eastern Banat, have not been 

confirmed since 1975. year (Vajgand, 1965, Sučević, 1962), which indicates extinction of 

natural habitats. 

The results of correspondence analysis which includes connectivity of the ecological 

indicators for species B. arvensis and B. racemosus, in relation with humidity shows the 

deviation from the EUNIS habitat classification (Fig. 8). According to the type of adaptive 

strategies, that involve a wide tolerance to changes in natural habitats, these species are still 

found on them. This results in widespread of species B. arvenis, while rarity of species B. 

racemosus is a consequence of the conquest of new habitats, indicating the absence from 

the Banat region (Fig. 4) and first recording of taxa after 1955 th (Babić, 1955). 

Statistical analysis of the ecology of species B. hordeaceus, B. sterlis, B. 

commutatus, B. secalinus and B. ramosus (Fig. 8) confirms their affiliation as defined by 

EUNIS Habitat classification (Blaženčić et al., 2005). Also, in this case the adaptive 

strategies are the cause of their wide distribution (B. hordeaceus , B. sterlis, B. 

commutatus), while the degradation and extinction the typical habitat for the species B. 

ramosus and B. secalinus caused rare occurrence in Vojvodina (Fig. 5 and 6). 

Species that from the foregoing is the most distinguished is B. squarrosus. It prefers 

habitats with intense brightness and long dry period (Fig. 8) which coincides with the 

EUNIS habitat classification (Blaženčić et al., 2005). High presence on Fruska gora 

mountain (Fig. 3) is a consequence of thermophilous deciduous forest, the edges of which 

the species occurs. Considering that the Vojvodina is under strong abiotic and biotic 

influences can be expected that this species is expanding its areal, thanks to the 

characteristics of natural pioneer (Table 1), which allows the undisturbed expansion into 

new habitats with extreme conditions. 

Life forms are specific to the climate and can thus serve as indicators of climate 

because they clearly reflect the living conditions of environment (Diklić, 1984). Results 

obtained through statistical analysis that includes the asociations between the life forms and 

the types of adaptive strategies confirm that climate of Vojvodina belongs to the temperate 

continental region (presence hemikryptophytes and therophytes) and that the most common 

habitat are arable lands and abandoned fields around the village (presence of weeds, 

competitors and species with large tolerance on changes in habitat).


Areal of each species is a reflection of its distribution and the result of a complex 

historical process of distribution (Janković, 1985). Based on the results of statistical 

analysis of areal types, can be seen that the Eurasian type is present in highest degree, 

which indicate a high correlation of flora in Europe and Asia. Pontic–south siberian areal 

type justifies the fact that Vojvodina climate belongs to the Pontian type. Xerophyle 

conditions in this region are the cause of the presence of the mediterraneansubmediterranean 

areal type (Gajić, 1984) (Fig. 9). 

During studies of the genus Bromus in Vojvodina has been observed exceptional 

importance of knowing the type of adaptive strategy, which influences their 

presence/absence from the different habitats. Knowing distribution, diversity and ecology 

of these species can serve as an indicator of living conditions and habitat types in 

Vojvodina. Further research should be directed towards to the study of the important 

taxonomical characters for species identification and revision of the herbarium materials. 


This work was performed under the project 173 030 funded by the Ministry of 


REFERENCE 

Babić, N. (1955): Nizijske livade u Podunavlju. Rad vojvođanskih muzeja, 4: 155-163 

Blaženčić, J., Ranđelović, V., Butorac, B., Vukojičič, S., Zlatković, B., Žukovec, D., Đalić, I., 

Pavićević, D., Lakušić, D. (2005): „ Harmonizacija nacionalne nomenklature u 

klasifikaciji staništa sa standardima međunarodne zajednice“ staništa Srbije priručnika sa 

opisima i osnovnim podacima, Institut za Botaniku i Botanička Bašta „Jevremovac“, 

Biološki fakultet, Univerzitet u Beogradu, Beograd. 

Borhidi, A. (1995): Social behaviour types, the naturalness and relative ecological indicator 

values of the higher plants in the hungarian flora, Botanical Department, Janus 

Pannonius University, Pécs. 

Diklić, M. (1984): Životne forme biljnih vrsta i biološki spektar flore SR Srbije. In: Janković, 

M., Pantić, N., Mišić, V., Diklić, N., Gajić, M. (eds) Vegetacija SR srbije I, SANU, 

Odeljenje prirodno matematičkih nauka, Beograd, pp. 291-313. 

Gajić, M. (1984): Florni elementi SR Srbije. In: Janković, M., Pantić, N., Mišić, V., Diklić, N., 

Gajić, M. (eds) Vegetacija SR Srbije I, SANU, Odeljenje prirodno matematičkih nauka, 

Beograd, pp. 307-388. 

Igić, R. (2012): Alergijske biljke. Univerzitet u Novom Sadu, Prirodno – matematički fakultet, 

Departman za biologiju i ekologiju, Novi Sad, pp. 124. 

Janković, M. (1984): Fitogeografski položaj i rasčlanjenost vegetacije SR Srbije. In: Janković, 

M., Pantić, N., Mišić, V., Diklić, N., Gajić, M. (ed) Vegetacija SR Srbije I. SANU, 

odeljenje prirodno-mаtemаtičkih nаukа, Beogrаd, pp. 160-162. 

Janković, M. (1985): Fitogeografija. PMF u Beogradu i Jugoslovenski zavod za produktivnost 

rada i informacione sisteme, Beograd, pp. 5-12. 

Kojić, M., Popović, R., Karadžić, B. (1998). Sintaksonomski pregled vegetacije Srbije. Institut 

za biološka istraživanja “Siniša Stanković”, Beograd, pp. 130-178. 

Prodán Gy. (1916): Bács-Bodrog vármege flórája, Flora des Komitates Bács-Bodrog, Budapest. 

Smith P. M (1980): Bromus L..-In: Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., 

Valentine, D.H., Walters, S.M. i Webb, D.A. (eds.). Flora Europaea V. Cambrige 

University Press, London, pp. 182-188.


Soó, R. (1973): A Magyar Flóra és Vegetáció Rendszertani-növényföldrajzi kézikönyve V. 

Akadémiai Kiadó, Budapest, pp. 262-276. 

StatSoft, Inc. (2012): STATISTICA (data analysis software system), ver. 10. 

Stevаnović, V. (1992): Klаsifikаcijа životnih formi biljаkа. In: Sаrić M. (ed) Florа Srbije 1, 

second edition. SANU, odeljenje prirodno-mаtemаtičkih nаukа, Beogrаd, pp. 39-45. 

Stevanović, V. (1995): Biogeografska podela teritorije Jugoslavije. In: Stevanović, V., Vasić, V. 

(ed.): Biodiverzitet Jugoslavije sa pregledom vrsta od međunarodnog značaja. Beograd, 

Biološki fakultet i Ecolibri, pp. 117-127. 

Stevanović, V., Jovanović, S., Lakušić, D. (1995). Diverzitet vegetacije Jugoslavije. In: 

Stevanović, V., Vasić, V. (ed.): Biodiverzitet Jugoslavije sa pregledom vrsta od 

međunarodnog značaja. Beograd, Biološki fakultet i Ecolibri, pp. 225-228. 

Sučević, P. (1962): Šumske fitocenoze Vršačkih planina. Vojvođanski muzej, 11: 79-87. 

Tatić, B. 1976. Bromus L..-In: Josifović, M. (ed.): Flora SR Srbije VIII. Beograd, SANU, pp. 

362-373. 

Vajgand, K. (1965): Prilog flori Bačke (osvrt na floru okoline Sombora), Diplomski rad, Novi 

Sad. 

Walter, H., Straka, H. (1970): Arealkunde, Florisch-Historische Geobotanik, VEU, Stutgart. 

Appendix I 

Acević, N. (1976): Biljnogeografske karakteristike okoline Pećinca i Obedske bare, Diplomski 

rad, Novi Sad. 

Andrejević, N. (1976): Florogeneza severnovojvođanskih slatina, Magistarski rad, Novi Sad. 

Babić, N. (1952): Odnosi učešća i pokrovnosti životnih oblika na higrofilnim livadama u okolini 

Novog Sada. Rad vojvođanskih muzeja: 1-100 

Babić, N. (1965): Močvarna i livadska vegetacija Koviljskog rita (fitocenološka studija), 

Doktorska disertacija, Beograd. 

Banđur, M. (1998): Flora okoline Futoga, Diplomski rad, Novi Sad. 

Blažević, D. (2003): Fitocenološke i mikrobiološke karakteristike deponija odpadne isplake u 

Banatu, Magistarska teza, Beograd. 

Boža, P. (1976): Flora Bajše, Diplomski rad, Novi Sad. 

Broz, V. (1951): Floristički rad T. Soške na Deliblatskoj peščari. Zbornik zaštita prirode, 2-3: 

318-342. 

Budak, V. (1998): Flora i biljnogeografske odlike flore slatina Bačke, Novi Sad. 

Bugarski, V. (1979): Samonikle i gajene biljke okoline Suseka, Diplomski rad, Novi Sad. 

Butorac, B. (1989): Vegetacija Sremskog lesnog platoa, Doktorska disertacija, Novi Sad. 

Cekuš, G. (1976): Flora okoline Subotice (severni deo), Diplomski rad, Novi Sad. 

Cvetkov, S. (1999): Vaskularne makrofite ribnjaka “ Ečka”, Diplomski rad, Novi Sad. 

Čapaković, J. (1978): Poplavne livade Petrovaradinskog rita, Magistarski rad, Novi Sad. 

Čičovački, B. (2001): Egzote u flori Sombora i okoline, Diplomski rad, Novi Sad. 

Čontos Kiš, A. (2009): Flora okoline Hajdukova, Diplomski rad, Novi Sad. 

Drašković, R. (1996): Flora okoline Orlovata, Diplomski rad, Novi Sad. 

Dudaš, I. ( 1996): Flora okoline Zobnatice kod Bačke Topole (Zobnatičko jezero), Diplomski 


Đakić, Ž. (2000): Flora severozapadnog dela grada Novog Sada, Diplomski rad, Novi Sad. 

Đurčjanski, R. (1980): Florističke karakteristike jugoistočne Bačke, Magistarski rad, Novi Sad. 

Erdeši, J. (1971): Fitocenoza šuma jugozapadnog Srema, Doktorska disertacija, Sremska 

Mitrovica. 

Gajić, M. (1986): Flora i vegetacija Subotičko Horgoške poščere, Subotica, 1986. 

Gajić, M.; Kradžić, D. (1991): Flora ravnog Srema sa posebnim osvrtom na Obedsku baru, 

Sremska Mitrovica.


Galamboš, L. (2007): Flora nasipa Dunava u okolini Novog Sada, Diplomski rad, Novi Sad. 

Gostović, A. (1971): Biljnogeografske karakteristike Vršačkih planina, Diplomski rad, Novi 

Sad. 

Grdinić, B. (1996): Značaj florističkih istraživanja u funkciji unapređivanja nastave biologije, 

Doktorska disertacija, Novi Sad. 

Igić, R. (1995): Novozabeleženi taksoni u flori Bačke lesne zaravni. Zbornik radova Prirodno - 

matematičkog fakuleta, serija za biologiju, 24: 27-32. 

Ivković, O., Budak, V. (1979): Prilog flori prostora na kome se nalazi Petrovaradinska tvrđava i 

njena bilža okolina. Zbornik za prirodne nauke, 56: 53-64. 


Srema, Doktorska disertacija, Beograd. 

Kabić, D. (1985): Slatinska vegetacija u okolini Riđice, Diplomski rad, Novi Sad. 

Karlečik, G. (1979): Florističke osobine područja između Palićkog i Ludoškog jezera, 

Diplomski rad, Novi Sad. 

Katić, B. (2005): Flora surduka Titelskog brega, Diplomski rad, Novi Sad. 

Kilibarda, M. (1973): Flora okoline Vrbasa, Diplomski rad, Novi Sad. 

Knežević, A. (1979): Ekološke karakteristike nekih halofitskih vrsta u Bačkoj. Savez ekologa 

Jugoslavije: 1275-1283. 

Knežević, A. (1980): Slatinska vegetacija u okolini Kruščića, Magistarski rad, Novi Sad. 

Knežević, A. (1990): Ekološka i biljnogeografska analiza flore slatina Banata, Doktorska 

disertacija, Novi Sad. 

Knežević, A., Boža, P. (1987): Cenološka pripadnost vrsta Sueda maritima (L.) Dum. i Sueda 

pannonica Beck. na lokalitetu kod Melenaca (Vojvodina- Banat). Zbornik matice srpske 

za prirodne nauke, 72: 153-168. 

Knežević, A., Boža, P., Butorac, B., Vučković, M. (2000): Lepido Classifolio- Festucetum 

pseudovinae ass. nova of the halobiome in Yugoslavia. Zbornik matice srpske za 

prirodne nauke, 98: 45-51. 

Knežević, J. (2008): Flora okoline Bašaida, Diplomski rad, Novi Sad. 

Kubica, I. (2005): Flora okoline Čoke, Diplomski rad, Novi Sad. 

Kujundžić, M. (1979): Slatinska vegetacija u okolini Ruskog Krstura, Magistarski rad, Novi 

Sad. 

Kupcsok S.T. (1915): Adatok Bács-Bodrogmegye déli részének es Szerémmegyének flórájához. 

Magyar Botanikai Lapok, XIII, 1/5, Budapest. 

Lacković, S. (1998): Flora okoline Sremskih Karlovaca, Diplomski rad, Novi Sad. 

Lazić, D. (1995): Florističko-ekološka analiza sastojina acc. Trifolio-Agrostietum stoloniferae 

Marković 1973 na području Vojvodine, Diplomski rad, Novi Sad. 

Lučić, K. (1973): Flora okoline Stepanovićeva, Diplomski rad, Novi Sad. 

Marčetić, M., Babić, N. (1954): Prva i treća centurija Andrije Volnija, floristički prikaz. Rad 

vojvođanskih muzeja, 3: 1-14. 

Marić, A. (1979): Florističke odlike Severnog dela okoline Sente, Diplomski rad, Novi Sad. 

Nikić, N. (2008): Flora parka Dvorca u Čelarevu kao zaštićenog prirodnog dobra- spomenik 

prirode, Diplomski rad, Novi Sad. 

Obradović, M. (1966): Biljnogeografska analiza flore Fruške gore, Novi Sad. 

Obradović, M., Boža, P. (1986): Prodromus flore papratnica i semenica Subotičke peščare i 

bliže okoline. Zbornik radova Prirodno - matematičkog fakuleta, serija za biologiju, 16: 

121-142. 

Obradović, M., Budak, V., Acević, N. (1977): Biljnogeografske karakteristike šire okoline 

Obedske bare u Južnom Sremu. Zbornik radova Prirodno - matematičkog fakuleta, serija 

za biologiju, 7: 191-215. 

Obradović, M., Panjković, V. (1980): Prodromus flore papratnica i semenica Deliblaske peščare. 

Zbornik radova Prirodno - matematičkog fakuleta, serija za biologiju, 10: 323-326.


Panjković, V. (1977): Biljnogeografska analiza flore Deliblatske peščare, Magistarski rad, Novi 

Sad. 

Panjković, V. (1983): Biljnogeografska analiza flore Vršačkog brega, Doktorska disertacija, 

Novi Sad. 

Parabućski, S. (1979): Zajednice Peucedano-Asteretum punctati Soó i Trifolietum subterranei 

Slavnić na nekim lokalitetima Bačke i njihov sintaksonomski položaj. Zbornik za 


Parabućski, S., Stojanović, S., Vučković, M. (1986): Zajednica Festucetum vaginatae danubiale 

Soó 29 na Subotičko Horgoškoj peščari. Zbornik matice srpske za prirodne nauke, 70: 

129-134. 

Pekanović, V. (1991): Šumska vegetacija Vršačkih planina, Novi Sad. 

Pekla, G. (2006): Flora okoline Kanjiže, Diplomski rad, Novi Sad. 

Perić, R. (2006): Kvalitativne promene u diverzitetu vaskularne flore opštine Apatin, Diplomski 


Petrović, M. (1979): Flora okoline Bečeja, Diplomski rad, Novi Sad. 

Prabućski, S. (1965): Šumska vegetacija Koviljskog rita, Doktorska disertacija, Beograd. 

Puhalo, S. (2009): Autohtone i alohtone drvenaste vrste Specijalnog rezervata prirode 

Koviljsko- Petrovaradinski rit, Diplomski rad, Novi Sad. 

Purger, D. (1993): Vegetacija u okolini Doroslova (zapadno Bačka), Magistarski rad, Novi Sad. 

Radonić, D. (1979): Florističke osobine okoline Bačke Palanke (severni deo prema Obrovcu), 


Rajačić, O. (1971): Flora Novog Sada i okoline (Retke, reliktne i adventivne biljke), Diplomski 


Ristivojević, B. (2002): Flora okoline Bele crkve (Rađevina), Diplomski rad, Novi Sad. 

Savić, D. (1993): Flora okoline Tomaševca, Diplomski rad, Novi Sad. 

Slavnić, Ž. (1951): Pregled nitrofilne vegetacije Vojvodine. Naučni zbornik matice srpske, serija 

prirodnih nauka, 1: 84-169. 

Stankov, S. (2006): Flora Čuruga i okoline, Diplomski rad, Novi Sad. 

Stanković, S. (1993): Florističke odlike okoline Novog Sada (jugozapadni deo – Podunavlje), 


Stanojev, R., Boža, P. (1984): Novozabeležene biljke u flori Titelskog brega. Zbornik radova 

Prirodno - matematičkog fakuleta, serija za biologiju, 14: 61-68. 

Stanojević, S. (1996): Ekološko-fitogeografske karakterstike flore okoline Karlovčića, 

Diplomski rad, Beograd. 

Stevanović, V. (1984): Ekologija, fitocenologija i floristička struktura stepske vegetacije Fruške 

gore, Doktorska disertacija, Beograd. 

Stjepanović – Veseličić, L. (1979): Vegetacija Deliblatske peščare, Novi Sad. 

Stojanović, S. (1979): Jedna stepska zajednica na Titelskom bregu. Savez ekologa Jugoslavije: 

1103-1113. 

Stojanović, S. (1981): Vegetacija Titelskog brega, Doktorska disertacija, Novi Sad. 

Stojanović, S., Butorac, B. (1988): Specifičnosti u florističkom sastavu stepske vegetacije nekih 

lesnih zaravni Bačke i Srema. Zemaljski muzej Bosne i Hercegovine: 399-402. 

Stojanović, S., Pekanović, V., Vučković, M., Butorac, B., Crnčević, S. (1992): Sinekološke 

odlike vegetacije na deponijama šećerane "Bačke" u Vrbasu. Zbornik matice srpske za 


Šabić, T. (1976): Flora okoline Subotice (severoistočni deo – Radanovac), Diplomski rad, Novi 

Sad. 

Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M. i 

Webb, D.A. 1976. Flora Europaea V. Cambrige University Press, London, pp. 182-188. 

Toth, M. (1976): Flora okoline Subotice (severozapadni deo), Diplomski rad, Novi Sad. 

Ujhelji, S. (2005): Flora okoline Rumenke, Diplomski rad, Novi Sad.


Vučković, M. (1991): Livadska i livadskostepska vegetacija Vršačkih planina, Novi Sad. 

Vučković, R. (1980): Zeljasta (močvarna i livadsko - pašnjačka) vegetacija okoline Sečnja, 

Beograd. 

Vučković, R. (1985): Fitocenoze slatinske vegetacije istočnog Potamišja, njihova produkcija i 

hranljiva vrednost, Doktorski rad, Beograd. 

Vukov, I. (1999): Florističko – ekološke karakteristike vodenih ekositema u okolini Zrenjanina, 


Vuković, B. (1972): Biljno – geografske karakteristike flore okoline Petrovaradina, Diplomski 


Zarić, S. (1973): Flora okoline Bačkog Brestovca, Diplomski rad, Novi Sad. 

Zorkóczy, L. (1896): Újvidék és környékének flόrája. Újvidék. 

Žunić, B. (2002): Flora hrastovih šuma duž reke Zasevice, Diplomski rad, Novi Sad.

Dragana Marisavljević, Danijela Pavlović, Radovan Marinković,... 123 

International Symposium: Current Trends in Plant Protection UDK: 582.916.26-115(497.11) 

Proceedings 

MOLECULAR STUDIES ON OROBANCHE CUMANA IN SERBIA 

DRAGANA MARISAVLJEVIĆ, DANIJELA PAVLOVIĆ, RADOVAN MARINKOVIĆ, PETAR 

MITROVIĆ, NENAD TRKULJA, ŽARKO IVANOVIĆ, IVAN NIKOLIĆ 

Institut za zaštitu bilja i životnu sredinu 

e-mail: marisavljevicd@yahoo.com 

Sunflower broomrape (Orobanche cumana Wallr.) is a parasitic plant that infects sunflower 

(Helianthus annuus L.) plants. The productivity of the sunflower is reduced due to competition with 

O. cumana for organic and inorganic resources. Genetic variability among O. cumana populations in 

Serbia was investigated using RAPD and DAMD molecular techniques. Analyzes revealed presence 

of specific patterns in samples with different geographic origin, indicating existence of diverse 

populations of O. cumana in Serbia. 

Key words: Orobanche cumana, Genetic diversity, RAPD, DAMD 

INTRODUCTION 

Orobanche spp. are obligate, holoparasitic angiosperms that live attached to the 

roots of a host plant. Due to a lack of a root system and chlorophyll they obtain water, 

minerals, and organic compounds through the host roots. The direct diversion of water and 

nutrients from the host can lead to significant yield losses in parasitized crops (Parker and 

Riches, 1993; Sauerborn, 1991). Parasitization by Orobanche is mediated by host derived 

chemical signals that control parasite seed germination and haustorium initiation. Each 

Orobanche spp. has specific host to parasitize. Sunflower broomrape (Orobanche cumana 

Wallr.) is a parasitic plant that infects sunflower (Helianthus annuus L.) plants. The first 

steps of the sunflower - broomrape interaction are broomrape germination and attachment 

of its radicle to the sunflower root. After several weeks, the broomrape shoot emerges, 

produces flowers and thousands of tiny seeds. The productivity of the host is reduced 

because of competition for organic and inorganic resources. O. cumana successfully 

competes for sunflower nutritional resources, thereby damaging crop development and 

reducing yields drastically, by up to 50% (Parker and Riches, 1993; Dominguez, 1996). 

Resistant hybrids and cultivars were developed against different races of O. cumana and 

these resistant sunflower cultivars were used widely in sunflower production. Resistance of 

sunflower to O. cumana involved several mechanisms which are interrupting broomrape 

development at different stages. Those include excretion of phytoalexins (Serghini et al., 

2001), cell wall deposition, vessel occlusion, development of an encapsulation layer in the 

cortical parenchyma, and lignification of host xylem vessels (Dorr et al., 1994; Labrousse et 

al., 2001).

124 Molecular studies on orobanche cumana in Serbia 

The development of new and more virulent races of O. cumana imposed need for 

analyze their genetic variability. With this in prospect, the genetic variability of O. cumana 

populations was studied using Random Amplified Polymorphic DNA (RAPD) markers and 

Direct Amplification of Minisatellite-region DNA (DAMD). 


Seeds of broomrape (Orobanche cumana Wallr.) were collected from infested 

sunflower fields in the region of Vršac, Subotica and Kula in North Serbia and Negotin in 

East Serbia. Ten populations with a total of 300 plants, 30 plants per population, were 

analyzed. Orobanche seeds are extremely small, between 200 and 300 mm, each weighing 

ca. 10–25 mg and composed of only 200–300 cells (Portnoy et al., 1997). Due to that, DNA 

extraction was performed from approximately 100 seeds per each individual plant sample. 

DNA EXTRACTION AND AMPLIFICATION 

DNA extraction was performed from seeds using standard Plant Dneasy Mini Kit 

(Qiagene, USA). The Polymerase Chain Reaction (PCR) was performed using Random 

Amplified Polymorphic DNA (RAPD) and Direct Amplification of Minisatellite - region 

DNA (DAMD) markers under the protocol described by Moretti et al., 2004. 

Amplifications were performed in a total reaction volume of 50 µl using the following 

reaction mixtures. 

RAPD primers 

Master mix consisted of 2.5 U Taq polymerase (Fermentas, Lithuania), 1 x Taq 

buffer (Fermentas, Lithuania), 1 mM MgCl 2 , 0.2 mM each of dATP, dCTP, dGTP, and 

dTTP (Fermentas, Lithuania), 2 µg DNA and 0.5 µM primers (Fermentas, Lithuania). The 

primers used in reactions were: OPA 01 (5’-CAGGCCCTTC-3’) and OPA 02 (5’- 

TGCCGAGCTG-3’). Amplification was performed with a Mastercycler personal model 

(Eppendorf, Hamburg, Germany) using the following thermal conditions: an initial 

denaturation at 94 °C for 5 min, followed by 45 cycles at 94 °C for 1 min, 37 °C for 1 min, 

and 72 °C for 2 min, with a final extension at 72 °C for 5 min. 

DAMD primers 

Master mix consisted of 2 U Taq polymerase, 1 x Taq buffer, 1.5 mM MgCl 2 , 0.2 

mM each of dATP, dCTP, dGTP, and dTTP, 2 µl DNA, and 0.42 µM primer. The primer 

for minisatellites was (GACAC) 3. The cycling parameters for (GACAC) 3 the thermal cycler 

was programmed for an initial denaturation at 94 °C for 1 min, followed by 40 cycles at 94 

°C for 30 s, 55 °C for 1 min, and 72 °C for 1 min, with a final extension at 72 °C for 6 min. 

Amplification products were resolved by electrophoresis on 2% agarose gel in TAE 

buffer (Tris-acetate EDTA, Tris-HCl 40 mM and NaEDTA 1 mM) stained with 0.5 µg ml -1 

ethidium bromide and visualized on a UV transilluminator. A hundred base-pair ladder 

marker was used as molecular weight marker. The negative control was sterile water.

Dragana Marisavljević, Danijela Pavlović, Radovan Marinković,... 125 


The present study was undertaken to analyze and compare the genetic variability of 

O. cumana populations in Serbia. O. cumana was collected from natural populations in the 

north and east of Serbia. In total, 10 populations with 300 individuals were sampled. The 

interspecific variation study was conducted on 10 different populations, and the 

repeatability of obtained results was checked three times. The RAPD amplification 

generated clear and reproducible bands ranging from 500 to 2000 bp in length, which were 

used in the population analysis. RAPD analysis has detected low genetic differentiation 

among populations and no variation among individual broomrape plants within a 

population. RAPD technique was performed with two primers OPA1 and OPA2 profile. 

RAPD patterns generated with OPA2 primer were the same for all the samples analyzed, 

regardless of the collection region and showed no differences between the populations of O. 

cumana. The second primer used in this study (OPA1) gave RAPD patterns with 

differences between the samples originated form different regions. Samples from Vršac had 

specific band (950 bp), which is missing in other samples. Samples originating from 

Negotin had RAPD pattern with characteristic band at 700 bp and absence of a band at 

1200 bp (Fig. 1). 

Genetic variability among O. cumana populations investigated using DAMD 

technique confirmed variation between the populations from different regions. The DAMD 

primer generated clear and reproducible bands from 200-3000 bp. An unique, well define, 

band 660 bp in length, specific for the samples originating from region of Vršac, was 

observed in the DAMD profile generated with primer (GACAC) 3 (Fig. 2). The absence of 

this band was observed in all other samples. Another specific band 700 bp length was 

observed for the sample originating from region of Negotin. This fragment was not 

observed in DAMD patterns of the other samples originating from Vršac, Kula and 

Subotica, all with identical DAMD pattern. 

Using RAPD and DAMD analyzes enable us to detect specific genetic patterns for 

the samples with different geographic origin in Serbia and showed existence of diverse 

populations of O. cumana in Serbia. This difference seems to be a result of the geographical 

origin of the populations, since the regions of the cultivation are borderland. With regard to 

intraspecific variation among the populations studied, no individual polymorphism was 

detected within each population. RAPD and DAMD techniques have been previously 

shown to be a useful for estimating genetic relationships within and between populations. 

The obtained marker information is helpful not only for taxonomic but also for diagnostic 

purposes and determination of the origin of each population. 

Figure 1: Banding patterns of the Orobanche cumana with the OPA1 (RAPD): lane M. Molecular marker; 

lane 1 negative control; lane 2 O. cumana Vršac; lane 3 Negotin; lane 4-6 Subotica; lane 7-10 Kula.

126 Molecular studies on orobanche cumana in Serbia 

Figure 2: Banding patterns of the Orobanche cumana with the (DAMD): lane 1 O. cumana Vršac; 

lane 2 Negotin; lane 3-6 Subotica; lane 7-10 Kula; lane 11 negative control;. Lane 12 molecular 

marker. 

ACKNOWLEDGMENTS 

This work was supported by the Ministry of Education and Science, Republic of 

Serbia (Grants No. TR31018 and TR31043) 

REFERENCES 

Dorr, I., Staack, A., Kollmann, R. (1994): Resistance of Helianthus to Orobanche - histological 

and cytological studies. In: Pieterse AH, Verkleij JAC, ter Borg SJ, eds. Biology and 

management of Orobanche, Proceedings of the Third International Workshop on 

Orobanche and related Striga research. Amsterdam: Royal Tropical Institute, 276–289. 

Domínguez, J. (1996): R-41, a sunflower restorer inbred line, carrying two genes for resistance 

against a highyl virulent Spanish population of Orobanche cernua. Plant Breed 115: 

203–204. 

Labrousse, P., Arnaud, M. C., Serieys, H., Berville, A., Thalouarn, P. (2001): Several 

mechanisms are involved in resistance of Helianthus to Orobanche cumana Wallr. 

Annals of Botany 88: 859–868. 

Moretti, M., Saracchi, M., Farina, G. (2004): Morphological, physiological and genetic diversity 

within a small population of Cercospora beticola Sacc. Annals of Microbiology, 54 (2): 

129-150. 

Parker, C., Riches, C. R. (1993): Parasitic Weeds of the World: Biology and Control. 

Wallingford, United Kingdom: CAB International. Sauerborn. 

Portnoy, V. H., Katzir, N., Joell, D. M. (1997): Species Identification of Soil-Borne Orobanche 

Seeds by DNA Fingerprinting. Pesticide Biochemistry and Physiology 58: 49–54. 

Serghini, K., Perez-De-Luque, A., Castejon-Munoz, M., Garcıa-Torres, L., Jorrın, J. V. (2001): 

Sunflower (Helianthus annuus L.) response to broomrape (Orobanche cernua Loefl.) 

parasitism: induced synthesis and excretion of 7-hydroxylated simple coumarins. Journal 

of Experimental Botany 52: 2227–2234.

Bokić Bojana, Knežević Jelena, Ječmenica Vladimir,... 127 


Proceedings 

BIOLOGY, LIFE STRATEGY AND INVASIVENESS OF SPECIES 

OF THE GENUS AMARANTHUS L. IN PANNONIAN PART OF 

SERBIA 

BOKIĆ BOJANA 1* , KNEŽEVIĆ JELENA 1 , JEČMENICA VLADIMIR 1 , BRATIĆ NATAŠA 2 , 

ANAČKOV GORAN 1 

University of Novi Sad, Faculty of Sciences, Department of biology and ecology¹ 

University of East Sarajevo, Faculty of Agriculture 2 

* bojana.bokic@dbe.uns.ac.rs 

The subject of research was genus Amaranthus in the Pannonian part of Serbia, where there 

are ten recorded species, two subspecies and one hybrid. All species are annuals, except A. deflexus 

which is perennial. According to the type of adaptive strategy, in the highest percentage of present 

plants are weed and adventive. Most species originated from America, A.graecizans is native to 

Southeast Asia and A. blitum is Mediterranean species, native for that part of Europe. The primary 

ecological factor in habitat selection is continentality. Most taxa prefer sunny, warm and less humid 

habitats, high in nitrogen content and neutral soil reaction, such as ruderal habitats and crops where 

they are predominantly present. Six taxa are recorded on saline soils, which are a type of natural 

habitats. This can be considered as a successive invasion phase in the study area. 

Key words: Amaranthus, life forms, ecological factor, habitats 

INTRODUCTION 

Genus Amaranthus is represented in Europe by 12 introduced and naturalized 

species, whereas A. caudatus is planted as ornamental and it sometimes occurs 

spontaneously. Other species are weeds or ruderal and common on territory of the northern 

and central Europe (Aellen and Akeroyd, 1993). In the Serbian flora this genus includes 

nine species of which all originated from America (Slavnić, 1972). 

Some of recorded taxa appear in constant and stable populations, and are considered 

naturalized, while others are in the stage of naturalization process and occuring 

sporadically. Certain species of this genus are very important as forage crops because of 

high nutritional value (Boža, 2011), and also they negative effects as crop weeds (Simić 

and Stefanović, 2008; Stoimenova et al., 2004; Týr, and Macák, 2007). Because of its 

foreign origin, the absence of predators and adaptive strategies, species of genus 

Amaranthus can easily expand their range in the Pannonian part of Serbia (Vojvodina) 

which is covered with 76% of arable land: 

(http://ec.europa.eu/agriculture/analysis/external/applicant/serbia_en.pdf). 

Species of genus Amaranthus today represent significant portion of the Pannonian 

part of Serbian flora. A significant number of species that were moved to Vojvodina,

128 Biology, life strategy and invasiveness of species of the genus,... 

became naturalized and integrated as a part of the flora, points out enough about the 

potential of this genus. 

In this paper species of genus Amaranthus are ecologically and taxonomically 

processed in order to define direction of adaptive strategy and their distribution pattern 

along with degree of invassiveness in the Pannonian part of Serbia. 


Data about distribution of genus Amaranthus in Vojvodina were collected from 

literature and herbarium collections. The nomenclature follows Flora Europaea (Allen and 

Akeroyd, 1993). 

Belonging to the appropriate type of life forms is listed as it was classified by 

Raunkier (1934) and refined according to Ellenberg and Mueller – Dambois (1967), 

amended and elaborated for the Serbian flora towards in accordance to Stevanović (1992). 

To observe the general trend of infuence on some ecological factors, ecological data 

were coded and analysed using canonical correspondence analysis (CCA) and shown in the 

space of two correspondent axis. Software package Statistica for Windows ver. 11.0 (Stat. 

Soft, 2012) was used for analysis. Literature and herbarium data were combined into a 

database with software package Microsoft Office Excell ver. 2007. 

RESULTS 

Based on data from literature and herbarium collections ten species (A. albus L., A. 

blitoides S. Watson, A. blitum L., A. caudatus L., A. crispus (Lesp. & Thév) N. Terracc., A. 

deflexus L., A. graecizans L., A. hybridus L., A. retroflexus L., A. viridis L.), two subspecies 

(A. hybridus L. subsp. cruentus (L.) Thell., A. hybridus L. subsp. hypochondriacus (L.) 

Thell.) and one hybrid (A. x budensis Prisztez) (Table 1) were recorded in Vojvodina. 

All recorded taxa are annuals (T – therophytes), except A. deflexus which is a 

perennial (H – hemicryptophytes). Within therophytes A. blitoides and A. crispus stand out 

as prostrate forms, while the rest are erect plants (Table 1). 

According to the type of adaptive strategy, analyzed taxa are divided into two 

groups. First group takes 60% which is equally divided among weeds and adventive plants, 

30% each. A smaller percentage group of 40% is divided among plants designated as 

ruderal competitors and introduced alien species, 20% each (Table 2). 

Based on data summarized in Table 1., comparative analysis of the correspondence 

was done because it can show interrelationships of taxa analyzed in correlation with defined 

models of adaptive strategies and ecological characteristics of plant biological cycle (life 

form). As a result, we can come to a conclusion about the usage of adaptive solutions that 

plants made in our area.


Table 1. Review of detailed life forms, adaptive strategie types, ecological indexes and origin of 

recorded taxa of genus Amaranthus 

No 

Adaptive Ecological indicator values (Borhidi, 1995) 

Origin 

Taxon/detail life form strategies 

(Soó, 

(Stevanović, 1992) (Borhidi, TB WB RB NB LB KB SB 

1970) 

1995) 

1 

A. albus L. 

North 

RC 8 4 6 8 9 6 1 

a Mes-Meg T scap 

America 

2 

A. blitoides S. Watson 

North 

W 7 3 7 8 9 7 1 

a Mes-Mac T rept 

America 

3 

A. blitum L. 

a T Mes scap 

W 8 4 7 8 8 3 1 Mediteran 

4 

A. caudatus L. 

South 

I 8 4 7 8 8 3 1 

a Mes-Meg T scap 

America 

5 

A. crispus (Lesp.& Thév) 

South 

A 7 5 7 8 9 7 1 

N. Terracc. a Mac T rept 

America 

6 

A. deflexus L. 

South 

A 9 4 7 7 8 7 1 

a Mes-Meg H scap 

America 

7 

A. graecizans L. 

South 

W 8 4 7 8 9 5 0 

a Meg T scap 

Eurasia 

8 

A. hybridus L. 

ver-a Mes-Meg T scap 

9 

A. retroflexus L. 

North 

RC 9 5 7 9 9 7 1 

a Mes-Alt T scap 

America 

10 

A. viridis L. 

Meg 

11 

12 

A. hybridus L. subsp. 

cruentus (L.) Thell. 

a-aut Mes-Meg T scap 

A. hybridus L. subsp. 

hypochondriacus (L.) 

Thell. 

A 8 5 7 8 9 7 0 

I 9 4 7 7 9 7 1 

Tropical or 

subtropical 

America 

Subtropical 

America 

A x budensis Prisztez (A. 

13 

blitoides x A. albus) 

Legend: 

RC – Ruderal competitors, W – Weed, I – Introduced allian species, A – Adventives, TB – temperature, 

WB – moisture, RB – soil reaction, NB – nitrogen sipply, LB – light, KB – continentality, SB - salinity 

Table 2. Percentage of adaptive strategies of taxa within genus Amaranthus 

Type of adaptive strategies SBT % 

I – introduced allian species 20 

W - weeds 30 

A - adventives 30 

RC – ruderal competitors 20 

The results of correspondence analysis of predefined adaptive strategies which are in 

correlation with basic life forms of analyzed species, are shown in space of the first two 

correspondence axes, where they form four groups (Figure 1). The first group consists of 

three species classified as weeds, A. graezicans, A. blitum and A. blitoides, which are 

clearly separated in relation to both axis and characterized by positive value relative to the 

first, but negative to the second axis. The group in which adventive weed species are, A. 

deflexus, A. cruentus and A. crispus, is also distinctly separated and characterized by


negative value to both axes respectively. Among introduced plants and ruderal competitors 

there is no clear separation in comparison to the firs correspondence axis. 

Figure 1. Association of adaptive strategies and life form elements in space of the first two 

correspondence axes of analyzed taxa of genus Amaranthus 

The results of correspondence analysis of associated predefined ecological factors 

are shown in space of the first two axes (Figure 2) where in relation to the humidity (V), pH 

reaction of substrate (R), nitrogen need (N), temperature (T) and salinity (S) does not exist 

clear clustering of taxa. According to continentality (K) as an ecological factor clear 

separation of taxa can be seen and it is probably the primary ecological factor in the 

selection and colonization of new habitats, while influence of other ecological factors 

commands further expansion of given plants outside of areal borders. 

Figure 2. Interplay of ecological indexes in space of the first two correspondence axes of 

analyzed taxa of genus Amaranthus


From all analyzed taxa, the majority is originaly from America, one taxon originates 

from Southeast Eurasia, and one is Mediterranean species (Table 1). In relation to the origin 

and continentality level there is a clear separation found of three taxa groups during the 

correspondence analysis. 

In relation to the first correspondent axis, whole group of taxa with American origin 

stands out from A. graecizans, which is native to the southern Eurasia, characterized as 

continental and sub-continental plant, and it is located in positive value zone in respect to 

the first correspodence axis (Figure 3). 

Taxa originally from North America, A. albus, A. blitoides, A. retroflexus with subcontinental 

and continental character are in the negative zone, separated from A. hybridus 

subsp. hypochondriacus and A. hybridus subsp. cruentus which originated from Central 

America and are referred to as continental and sub-continental subspecies. 

Taxa A. deflexus and A. crispus are of South American origin with sub-continental 

character along with A. caudatus marked oceanic-suboceanic character, which has most 

luckily, thanks to some other primary factor, successfully adapted in Vojvodina. Manly on 

plant saline soils (40%, Table 3) main factors of expansion are high light and temperature 

index. 

Compared with other taxa, A. blitum is allocated because its native area is southern 

and southeastern Europe. It is originating from Mediterranean, but in Central and Western 

Europe is archeophyta (Soó, 1970). 

Figure 3. Origin, degree of continentality and basic life forms interplay in space of the first two 

correspnodence axes of analyzed taxa of the genus Amaranthus 

Considering the invasive degree of specific species is very much dependent on 

interaction with other plants, but also elements of the biology of species as well as from 

variety of plasticity in new environment. Due to successful spread of Amaranthus genus in 

natural habitats, we observed flowering intervals along with ways of pollination and seeds 

dispersal, in order to observe degree of propagation from anthropogenic to natural habitats. 

As an example of natural habitats typical for Pannonian plain, continental halobiomes that 

represent intrazonal vegetation element were observed. This form of vegetation in 

Vojvodina is in direct contact with antropogenic habitats. In this paper, we selected the


most invasive taxa in relation to percentage of appearing in natural habitats, for how long 

and when are they flowering, and how are performing pollination and seed dispersal. 

On literature data basis about sites and habitats where given taxa of Amaranthus 

genus are present for over a century, six of those taxa show a significant degree of 

aggressiveness and have affinity and adaptive potential because they form population on 

the natural habitats (Table 3). This is the reason they are considered potentially invasive. 

Rest of the taxa, are not yet ascertained on any natural habitats and therefore they are 

considered to be less aggressive than taxa from Table 3. 

Table 3. Percentage of genus Amaranthus species on natural saline soils 

Taxon % 

A. caudatus 40.0 

A. albus 20.2 

A. crispus 6.2 

A. retroflexus 4.3 

A. hybridus 4.0 

A. blitoides 0.9 

Flowering time is not the same for all taxa, hence A. hybridus subsp. hybridus (vera) 

and A. hybridus subsp. cruentus (a-aut) are set aside from the time that other taxa flower 

which is just during summer (Table 1). Flowering period of most analyzed taxa coincide 

with the final phase of flowering time in anthropogenic ecosystems in Vojvodina, as well as 

with the first stage in salty ecosystems. 

According to the type of seed dispersal and pollination cited by Soó (1979) analyzed 

species are pollinated by wind and insects, with exception of A. albus which is exclusively 

anemophilous plant. Seeds of all analyzed taxa are dispersed by wind, except A. retroflexus 

whoose seeds are disseminated by animals. Species A. albus and A. retroflexus have 

completely different way of seed dispersion, although they are classified together in a group 

of ruderal competitors. Dominant way of seed dispersal in group of adventive plants is by 

wind and animals. Following taxa have different adaptive strategies (Table 1). Seeds of 

species A. albus, A. blitoides and A. caudatus (Table 4) are spread by humans. Weed 

species A. blitoides has the largest variety of seed distribution, which is done by wind, 

humans and animals (Table 4). 

Table 4. Type of seed dispersal and pollination of analyzed taxa within genus Amaranthus by 

Soó (1979) 

Taxon Seed dispersal type Pollination type 

A. albus anemochory, antropochory anemophily 

A. blitoides anemochory, antropochory, epizoochory anemophily, entomophily 

A. caudatus anemochory, antropochory anemophily, entomophily 

A. crispus anemochory, epizoochory anemophily, entomophily 

A. deflexus anemochory, epizoochory anemophily, entomophily 

A. hybridus anemochory, epizoochory anemophily, entomophily 

A. retroflexus epizoochory, endozoochory anemophily, entomophily


DISCUSION 

There are many definitions for the term „invasive species”, the one accepted here is given 

by Alpert et al. (2000). Under that term they consider those species that are spreading and 

the same time have a negative effect on native plants in area which they settled. However, 

we will not only limit on the introduced, alien species since some of those that are analyzed 

are considered domestic, although they can, due to changes caused by human population, 

increase population density and its range and hence become invasive. It is very difficult to 

define a feature which produces a base for invasiveness since depends more on the 

interaction of alien species and potential new habitats, than just the species characteristics 

(Alpert et al., 2000). 

In Vojvodina region, there were recorded ten species, two subspecies and one hybrid of 

genus Amaranthus. Hybrid A. x budensis is a problem because it is only ones recorded in 

the wider area of Subotica sand and new findings are needed for confirmation of this 

information. Also, in this study we recorded more taxa then it is stated in Flora of Serbia, 

which is the main reason why more detailed taxonomical and chorological analysis of 

genus Amaranthus is needed. 

According to analysis of detailed life forms it was found that annuals (therophytes) 

are numerous. Therophytes have short life cycle and they can adapt to emerging 

anthropogenic habitats, for a relatively short time (Viega, 2001). This is a huge advantage 

when alien species are progressing to new space. Also, within this genus there have a 

number of erect, branched forms recorded, which are superior to native species concerning 

competition (Iamonico, 2010). Papers which point out to negative effects of some species 

of genus Amaranthus can confirm competitive superiority. There is noted negative impact 

to soybean productivity (Stoimenova et al., 2004), also domination of genus Amaranthus as 

weeds in wheat (Konstantinović, 2009), alfaalfa (Pacanoski, 2009) and maize fields (Týr, 

and Macák, 2007) where they reduced light supply (Simić and Stefanović, 2008). 

Plants that are entered by accident and do not appear massively on natural habitats are 

adventive plants (Borhidi, 1995) which is in line with accidental introduction of A. crispus, 

A. deflexus and A. hybridus subsp. cruentus with seed material (Hegi, 1979) along with lack 

information about massive appearance on natural habitats. In Vojvodina, they are present in 

settlements, along the train tracks and in trodden meadows, but also A. crispus occurs in a 

small percentage, in natural habitats (Table 3). Because of strong dynamic processes and 

instability ruderal habitats are convenient areas with free ecological nishes which allow 

entrance to adventive species, which after longer or shorter phase of adjustment often begin 

to spread extensively while also suppressing native species (Pyšek, 1998). This kind of 

benefits used A. crispus, currently in the initial invasion phase. Plants marked as weed are 

growing in distrubed, degraded habitats with long-term human influence (Borhidi, 1995). 

Species like, A. blitum, A. blitoides and A. graecizans were found in Vojvodina in crops, 

along roadsides and in dumps. 

Introduced taxa, by Borhidi (1995), have been brought on purpose, as potentially 

economically useful, generaly do not leave areas where they have been cultivated, but their 

presence in natural habitats means that those areas used to be exploited. This group includes 

A. hybridus subsp. hypochondriacus and A. caudatus which has been introduced long time 

ago as a garden plant (Hegi, 1979). However, A. caudatus differs from this theory about 

introduced taxa since it was found with the highest percentage on the saline soil, i. e. 

natural habitats that have not been exploited. Ruderal competitors are characterized by 

effective development strategy, and thanks to this and / or area with few competitors they 

are able to transform and modify the trend of habitat succession. (Borhidi, 1995). Plants A.


retroflexus and A. albus belong to the group of ruderal competitors (Table 3) and are 

located on salty habitats in Vojvodina with a significant percentage. 

From all analyzed taxa, A. retroflexus is set aside because it has the greatest need for 

nitrogen (N 9 ). In those circumstances young plants emerge more frequently and do 

photosynthesis, along with that the assimilation of organic matter and water circulation 

processes is also more efficient (Iamonico, 2010). Species with high index of continentality, 

A. retroflexus, A. cruentus and A. crispus should inhabit more arid habitats, but they show 

greater preference for humid habitats. The pH reaction of the substrate, separates A. albus 

from the other taxa since it prefers habitats of neutral reaction, but it is noted on saline soils 

(Budak, 1978; Đurčjanski 1980, Knežević, 2008), which characterized by very alkali 

reaction. 

The analyzed taxa of genus Amaranthus in Vojvodina are presented with high 

percentage of North American origin and have high continentality index (K 6 and K 7 ), 

thanks to this they easily succeeded in adapting and spreading after introduction in the 

region of Central and Southeastern Europe, and after that all the way to Central Asia. 

Six taxa are potentially marked as the most invasive (Table 3) because in addition to 

habitation of the typical artificial, ruderal, arable and disturbed habitats, they also populate 

natural and salty habitats because of their vastness, high light intensity and small species 

number. These natural habitats are extreme concerning high salt content and negative water 

regime, which indicates high adaptability of taxa from Table 3. 

Related to the flowering time A. hybridus subsp. cruentus is distinguished from the 

rest taxa (Table 1). According to Iamonico (2010) later flowering may be a key character in 

the process which starts with neutralization and ends with invasion. Based on this, in the 

near future it is possible that late-flowering species will expand its range and move from 

artificial to natural habitats. Totally dependent from animals is A. retroflexus, while other 

taxa seeds are dispersed by wind, human or animals. All species from Table 4 are 

highlighted as very invasive in Vojvodina. Since, according to Rejmanek (1999) dispersion 

by wind is an advantage in expansion and invasion process of the open areas. Therefore, we 

can expect large spreading of genus Amaranthus taxa to the other open habitats in 

Vojvodina. According to Panetta and Scanlan (1995) the spreading of many alien species is 

closely related to human activities. Regarding this, these taxa are highlighted, A. albus, A. 

blitoides and A. caudatus, which appear on arable lands, orchards and ruderal places, where 

human and his activities predominantly affect the expansion. 

All recorded and analyzed taxa of genus Amaranthus prefer sunny, hot, less humid 

habitats with high nitrogen content such as ruderal and arable lands on which they are 

primarily occurring. Most taxa are erect, annual, anemophilous plants characterized by high 

competitiveness and adaptability degree. In addition, thanks to the great plasticity they 

became present on natural saline soils what may be considered as the next stage of invasion 

process in this area. 


This work was performed under the project 173 030 funded by the Ministry of 

Education and Science of the Republic of Serbia.


REFERENCES: 

Aellen, P. and Akeroyd, J. (1993): Genus Amaranthus L. In Tutin, G. (ed): Flora Europaea II. 

Cambridge University Press, London, pp. 130-132. 

Alpert, P., Bone, E., Holzapfel, C. (2000): Invasiveness, invasibility and the role of 

environmental stress in the spread of non-native plants. Urban & Fischer Verlag, vol. 

3/1, pp. 52-66. 

Borhidi, A. (1995): Social behaviour types, the naturalness and relative ecological indicator 

values of the higher plants in the hungarian flora, Botanical Department, Janus 

Pannonius University, Pécs. 

Boža, P: Amaranthus retroflexus L. (citirano 2012 June 30) u Lista invazivnih vrsta na području 

AP Vojvodine. Verzija 0.1 beta. Anačkov, G., Bjelić-Čabrilo, O., Karaman, I., 

Radenković, S., Radulović, S., Vukov, D. & Boža, P., editori. Novi Sad (Serbia): 

Departman za biologiju i ekologiju, 2011. 

Budak, V. (1978): Florogeneza slatina Jugoistočne Bačke, magistarski rad. Prirodnomatematicki 

fakultet. Novi Sad. 

Đurčjanski, R. (1980): Florističke karakteristike jugoistočne Bačke, magistarski rad. Prirodnomatematicki 


Hegi, G. (1979): Illustrierte flora von Mitteleuropa. Band III, teil 2, liefg. 10. Berlin-Hamburg. 

Serbia Country Report (december 2006) [Internet]. [cited 27.07.2012). Available at 

http://ec.europa.eu/agriculture/analysis/external/applicant/serbia_en.pdf 

Iamonico, D. (2010): Biology, life-strategy and invasiveness of Amaranthus retroflexus L. 

(Amaranthaceae) in central Italy: preliminary remarks. Botanica Serbica, vol 34 (2), pp. 

137-145. 

Knežević, A. (2008): Slatinska vegetacija u okolini Kruščića, diplomski rad. Prirodnomatematički 


Konstantinović, B., Meseldžija, M., Korać, M., Mandić, N. (2009): Ispitivanje banke semena 

korova u usevu pšenice. VI Congress of Plant Protection (Book I), Zlatibor, 23-27 

november 2009, poster. 

Müller-Dombois, D. and H. Ellenberg (1974): Aims and methoods in vegetation ecology. 

Wiley, New York. 

Pacanoski, Z. (2009): Floristic composition of the weed population in seedling alfaalfa 

(Medicago sativa L.) in the Pelagonia region. Herbologia, vol 10, no. 2. 

Panetta, D. and Scanlan, C. (1995): Human involvement in the spread of noxious weeds: what 

plants should be declared and when should control be enforced? Pl. Prot. Quart. vol. 10, 

pp. 69–74. 

Pyšek, P. (1998): Is there a taxonomic pattern to plant invasions? Oikos, vol 82, pp 282-294. 

Raunkiaer, C. (1934): The life forms of plants and statistical plant geography. Clarendon, 

Oxford. 

Rejmanek, M. (1999): Invasive plant species and invasible ecosystem. In: Sandlund OT. (ed.), 

Invasive species and biodiversity management. Kluwer, Dordrecht pp 79-102. 

Simić, M. and Stefanović, L. (2008): Kompeticija – najčešći oblik interakcija između useva i 

korova. Acta biologica iugoslavica – serija G: vol. 17, br. 2, str. 7-21. 

Slavnić, Ž. (1972): Rod Amaranthus L. u: Josifović, M. (ed.): Flora SR Srbije III. Beograd, 

SANU, pp. 2-10. 

Soó, R. (1970): A Magyar Flóra és Vegetáció Rendszertani-növényföldrajzi kézikönyve IV. 

Akadémiai Kiadó, Budapest. 

StatSoft, Inc. (2012): STATISTICA (data analysis software system), ver. 11. 

Stevаnović, V. (1992): Klаsifikаcijа životnih formi biljаkа. U: Sаrić M. (ed) Florа Srbije 1, 

second edition. SANU, odeljenje prirodno-mаtemаtičkih nаukа, Beogrаd.


Stoimenova, I., Alexieva, S., Taleva, A., Djonova, E. (2004): Biomasa soje u zavisnosti od 

zakorovljenosti vrstom Amaranthus retroflexus L. na dva tipa zemljišta. Acta biologica 

iugoslavica - serija G: Acta herbologica 2004, vol. 13, br. 1, pp. 135-140 

Týr, S. and Macák, M. (2007): The diversity and harmfulness of weeds and weed cover in 

maize. Herbologia vol. 8, no. 1. 

Viega, L. (2001): Investigation on some reproductive features of invasive alien plants in Italy. 

In: Brundu G, Brock J,Camarda I, Child L & Wade M. (eds.), Plant invasions: Species 

Ecology and Ecosystem Management, Blackhuys, Leiden, pp. 255-262.

Sima Sohrabi and Javid Gherekhloo 137 

International Symposium: Current Trends in Plant Protection UDK: 582.736.3-114.2 

Proceedings 

EFFECT OF DROUGHT STRESS ON SEED GERMINATION OF 

PROSOPIS FARCTA 

SIMA SOHRABI 1 AND JAVID GHEREKHLOO 2 

1 Faculty of Agriculture, Ferdowsi University of Mashhad, Iran 

2 Gorgan University of Agricultural Sciences and Natural Resources, Iran 

A laboratory experiment was conducted to determine the effects of drought stress on Prosopis 

farcta seed germination indices. The experiment was carried out in a completely randomized design. 

The trial was arranged with seven treatments of osmotic potential and 3 replications at 35°C. The 

water potential of the germination substrates were conducted using PEG-6000 solutions (0,-2, -4, -6, - 

8, -10 and -12 bar). The results indicated that P. farcta had resistance to drought stress. The 

germination percentage of this invasive weed was about 30% in -10 bar. Decreasing water absorption 

potential from 0 to -10 bars, significantly reduced germination percentage and rates of Syrian 

mesquite. Shoot and root length and SLV were high in 0 to -6 bars. Between water potential (0 to -10 

bars) were not significant effect for seedling vigor index. 

Key words: Polyethylene glycol (PEG) 6000, Seedling vigor index (SLV), Syrian mesquite 

(Prosopis farcta), water potential 

INTRODUCTION 

Invasive species are displaced native species and have the ability to dominate an 

ecosystem, or a species that enters an ecosystem beyond its natural range and causes 

economic or environmental harm (Heutte and Bella 2003). Invasive weeds possess a variety 

of characteristics that enable them to disperse rapidly into new areas and compete with 

crops and native or desirable nonnative vegetation for light, water, nutrients, and space 

(Westbrooks, 2001). In order to succeed, newly formed species need to colonize new 

habitats and establish reproducing populations away from their location of origin. Factors 

that affect the capacity of plants to be rapid or efficient colonizers include wide 

environmental tolerance, high levels of phenotypic plasticity, ability to self-reproduce, 

effective dispersal, high relative growth rate, high competitive ability and/or avoidance of 

genetic bottlenecks following founder effects (Baker, 1965; Levin, 2000). 

Prosopis farcta (syn: Prosopis stephaniana) from Fabaceae family and subfamily 

Mimosoideae is a small, prickly shrub, 30–80 cm tall. It is native to Northern Africa and 

Asia, also found in the United States. In native range, it is widespread, and a weed of wheat 

and cotton fields, invading by root suckers. Although not eaten by livestock (because of its 

spines), other herbivores eat the fruits, thus most likely aiding seed dispersal. It growth in 

clayey, dry soils, and deep alluvial soils with shallow ground water; thrives in saline soils 

under semiarid conditions (Anonymous, 2012).

138 Effect of drought stress on seed germination of prosopis farcta 

Most invasive plants primarily rely on seed dispersal and seedling recruitment for 

population establishment and persistence. Rapid spread of many invasive plants is 

frequently correlated with germination and dormancy patterns. Environmental factors, such 

as temperature, soil solution osmotic potential, affect weed seed germination and 

emergence (Norsworthy and Oliveira, 2006). P. farcta is an expanding weed in most parts 

of Iran. To understand why this weed is so troublesome and which areas in the country is 

favorite for distribution of this invasive weed, it is important to gain a better understanding 

how seeds of P. farcta germinates in response to different environmental factors specially 

drought stress. 


Seeds of P. fracta were collected from the aired lands located in Golestan province, 

north of Iran during August 2011. To evaluate the effect of drought stress on seed 

germination of P. fracta, an experiment was conducted in a complete randomized design 

with 3 replications. After soaking in concentrated sulfuric acid for 30 min to break 

dormancy (Andersen, 1968), seeds (25 seeds in each replication) of Syrian mesquite P. 

farcta were incubated at PEG solutions (0,-2, -4, -6, -8, -10 and -12 bar) prepared as 

described by Michel and Kaufman (1973) at 35 °C for two weeks. Then germination rate 

was calculated based on equation (1). 

RS = 

n 

∑ 

i= 

1 

Si 

Di 

Equation (1) 

In which, RS: germination rate, S: number of seed germinated per day, D: number of 

day and i: number of days to final observation. Root & shoot length and seedling vigor 

index (SVI) were calculated at the end of 12 th day. In the equation 2, RL and SL, are root 

and shoot length, respectively, and n is the total germination in 12 days (Equation 2). 

Equation (2) 

Data were statistically analyzed using SAS software program and Excel was used 

for charting. 

RESULTS 

Seeds of P. farcta germinated even at -10 bar but germination percentage and rates 

of P. farcta reduced with decreasing water absorption potential from 0 to -10 bars. 

Germination percentage of this invasive weed was about 30% in -10 bar. Rates of 

germination were 4 and 2 seed/day in -8 and -10 bars, respectively (figure 1 and 2).

Sima Sohrabi and Javid Gherekhloo 139 

germination percentage (%) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

0 -2 -4 -6 -8 -10 -12 

Water potential (bar) 

Figure 1: Effect of water potential on germination percentage of P. farcta 

14 

Germination rate(no/day) 

12 

10 

8 

6 

4 

y = 0.9928x + 11.757 

R 2 = 0.9406 

2 

0 

0 

-2 

-4 

-6 

-8 

-10 

-12 

-14 

Water potential(bar) 

Figure2: Effect of water potential on germination rate of P. farcta 

The root and shoot length were also significantly decreased at high concentrations of 

PEG. In all drought treatments, maximum germination rate, root and shoot length traits in P. 

farcta related to low levels of PEG. The highest values for Root/Shoot ratio, root length traits 

and SLV were observed in -2 and -4 bars. Increasing water potential caused significant 

difference in germination percentage and rate, shoot and root length. There was not difference 

between treatments in SLV (Table 1). 

Table 1: Effects of water potentials on germination traits of P. Farcta 

Water Germination Germination 

potential rate percentage 

Shoot length Root length SLV 

0 bar 11.38 a 94.66 a 1.90 a 3.08 a 0.21 a 

-2 bar 10.33 a 85.33 ab 2.11 a 3.14 a 0.24 a 

-4 bar 7.85 b 78.66 bc 1.2 b 3.28 a 0.22 a 

-6 bar 5.5 c 66.66 cd 0.94 bc 2.8 ab 0.22 a 

-8 bar 3.93 c 60 d 0.42 cd 1.94 ab 0.157 a 

-10 bar 1.56 d 29 e 0.19 d 1.41 bc 0.204 a 

-12 bar 0 d 0 f 0 d 0 c 0 b 

Significant differences among water potentials are presented by Duncan's Multiple Range 

(alpha=0.05) for 7 treatments. Means with the same letter are not significantly different. 

SLV=seedling vigor index

140 Effect of drought stress on seed germination of prosopis farcta 

DISCUSSION 

Decreasing osmotic potential progressively inhibited seed germination of the two 

thyme species (Khoshsokhan, et al., 2011). PEG causes the seed reserves materials 

hydrolysis and finally decreases the germination percentage (Munns and Weir, 1981). 

Decreasing solution osmotic potentials reduced germination percentage, as well as 

germination rate of Ceratocarpus arenarius seeds (Ebrahimi and Eslami, 2011). The 

tolerance of a particular weed species to water stress appears to be related to its ecology, for 

example, Eslami (2011) found that a xeric population of Chenopodium album L. from Iran 

maintained >65% seed germination up to an osmotic potential of 0.4 MPa, while decreasing 

osmotic potential from 0 to 0.4 MPa caused an 80% reduction in germination (9% 

germination) of a mesic population of the same weed species from Denmark. 

According to result water potential stress only in high levels reduced germination 

indices of P. farcta. Therefore, it can be concluded that P. farcta is relatively resistant to 

drought stress at germination stage. The drought tolerance of P. farcta seeds appears to be 

an adaptation to the limited and unpredictable rainfall of the habitats that this species 

occupies (especially south of Iran and Qom province). 

REFERENCES 

Anonymous; (2011). Prosopis farcta (Banks & Solander) J.F. Macbr. 

http://keys.lucidcentral.org/keys/v3/FNWE2/key/FNW_Mimosoideae/Media/Html/fact_s 

heets/Prosopis_farcta.htm. Access date April 13, 2012. 

Baker, H. G. (1965): Characteristics and modes of origin of weeds. In: Baker HG, Stebbins GL. 

eds. The genetics of colonizing species. New York: Academic Press, pp. 147–168. 

Ebrahimi, E. and Eslami, S. V. (2012): Effect of environmental factors on seed germination and 

seedling emergence of invasive Ceratocarpus arenarius. Weed Research, 52: 50–59. 

Eslami, S. V. (2011): Comparative germination and emergence ecology of two populations of 

common lambsquarters (Chenopodium album L.) from Iran and Denmark. Weed 

Science, 59: 90–97. 

Heutte, T., and E. Bella. (2003). Invasive plants and exotic weeds of Southeast Alaska. 

Anchorage, AK: USDA Forest Service. Website : http://aknhp.uaa.alaska.edu/ 

Levin, D. A. (2000): The origin, expansion and demise of plant species. Oxford: Oxford 

University Press. 

Michel B. E. and Kaufmann M. R. 1973. The osmotic potential of polyethylene glycol 6000. 

Plant Physiology, 51: 914–916. 

Munns, R., Weir, R. (1981): Contribution of sugars to osmotic adjustment in elongating and 

expanding zones of wheat leaves during moderate water deficits at two light levels. 

Australian Journal of Plant Physiology, 8: 93- 105. 

Norsworthy, J. K. and Oliveira, M. J. (2006): Sicklepod (Senna obtusifolia) germination and 

emergence as affected by environmental factors and burial depth. Weed Science, 54: 

903–909. 

Westbrooks, R. G. (1998): Invasive Plants, Changing the Landscape of America: Fact Book. 

Washington, DC: Federal Interagency Committee for the Management of Noxious and 

Exotic Weeds. Pp. 109. 

Westbrooks, R. G. (2001): Invasive species, coming to America: new strategies for biological 

protection through prescreening, early warning, and rapid response. Wildland Weeds, 4: 

5–11.

Gavrilović Marijana, Rat Milica, Božin Biljana, Anačkov Goran, Boža Pal 141 


Proceedings 

WEED SPECIES IN SYNANTROPIC FLORA OF NOVI SAD 

GAVRILOVIĆ MARIJANA 1 , RAT MILICA 2 , BOŽIN BILJANA 3 , ANAČKOV GORAN 2 , BOŽA PAL 2 

1 University Educons, Faculty of Environmental protection 

2 University of Novi Sad, Faculty of Sciences, Department of biology and ecology 

3 University of Novi Sad, Faculty of Medicine 

mail: akeldama@neobee.net 

Ruderal or syntrophic flora and vegetation are the most dynamic floristic-vegetation complex 

and an integral part of antropogenic environment. On one side the influence of antropogenic factors 

and on the other a variety of climate, topografic, geological and soil characteristics contribute to 

highly pronounced diversity of a weed flora. The presence of antropogenic influences have crucial 

importance of the emergence, development and distribution of ruderal flora and ruderal vegetation 

making the biotops very dynamic and unstable habitats. Horticulture has a long tradition in the city of 

Novi Sada which is located in the region of intensive agricultural production as a port center with 

international transport links and consequently is the most exposed to the introduction of new species. 

According to the existing data Novi Sad has the largest number of invasive species (59,7%) in 

Vojvodina, which indicates a need to produce a syntrophic inventory of its flora in order to list both 

native and introduced species. Phytogeographical analysis has been performed on syntrophic flora 

whith special emphasis on the analysis of the origin of introduced plant species. Furthermore, the 

range of life forms that indicates the caracter of antropogenically altered phytocenosis has been 

determined. 

Key words: weed species, syntrophic flora, floristic diversity, introduced species, native 

species, invasive species. 

INTRODUCTION 

Ruderal or synanthropic flora and vegetation embody the most dynamic floristic and 

vegetation complex and are an integral part of an anthropogenic environment. The 

diversity of anthropogenic ruderal habitats with specific combinations of micro-complexes 

of ecological conditions is of a key significance for accentuated anthropophilic ruderal 

vegetation (Šajinović, 1968). Ruderal vegetation is mainly connected with anthropomorphic 

soil whose physical-chemical features are to that extent altered by the actions of man that 

they have most often lost any resemblance to the primary soil type. The physical and 

chemical features of soil vary, frequently reaching extreme values: from the exceptionally 

compact due to the trampling of compressed soil, to a skeletogenic ground filled with 

gravel, sand or construction surplus, and to a loose nitrophylic soil saturated with 

decomposing organic material. The species Plantago major L., Taraxacum officinale 

Weber., Polygonum aviculare L., Cynodon dactylon (L.) Pers. are prominent due to their 

exceptionally pioneering character and the ability to adapt to diverse, often extreme and

142 Weed species in synantropic flora of Novi Sad 

difficult conditions of ruderal habitats. However, their presence in different ruderal habitats 

shows a morphological and anatomical variability which points to their great phenotypic 

plasticity which represents an ecological flexibility of the weed flora (Stevanović et al., 

1988). According to the syntaxonic appraisal of vegetation in Serbia, the most represented 

groups which can be found in habitats under a strong anthropogenic influence belong to the 

following classes: Bidentetea tripartita Tx., Lohm. et Prsg. 1950; Chenopodietea albae Br.- 

Bl. 1951. em. Lohm., R. et J. Ty. 1961; Artemisietea vulgaris Loxm., Prsg. Et J. Tx. 1950; 

Agropyretea repentis Oberd., Müll. Et Görs 1967; Asplenietea rupestris Meir.et Br.-Bl. 

1934; Plantaginetea majoris Tx. Et Prsg. 1950; Stellarietea mediae Tx., Lohm. et Prsg. 

1950 (Kojić, 1998). In urban habitats (industrial grounds, agricultural fields, parks, 

gardens) the dominant vegetation in the researched area is made up of weeds and 

synanthropic vegetation. An analysis of the number of weed flora species in individual 

biotope types of Novi Sad has pointed out that the largest representation of weeds is in the 

group of artificial habitats (transportation networks and other construction zones, solid arch 

parts, tenement buildings in city centers), in grassy habitats (dry and grass formations, 

moderately humid grass formations, abandoned pastures, weeds in vacated gardens) as well 

as coastal (pioneer and ephemeral vegetation of periodically flooded coasts). Along with 

the features of the habitats, the effect of the anthropogenic factors on the one hand and 

various influences of the climate, as well as orographic, geological and pedological features 

on the other, contribute to a highly stressed diversity of weed flora causing the ruderal 

habitats to be very dynamic but also very unstable biotopes. Weed flora adapts to these 

specific, frequently very negative conditions of habitats in respect to the higric and thermic 

regime, the character of the base, as well as in regards to mechanical impacts such as 

trampling, mowing, grazing, fires, etc. However, due to their great biological potential, a 

very emphasized dynamism which is conditioned by the instability of the ruderal habitats, a 

great morpho-anatomical variability as well as a lack of competition of species 

characteristic for the anthropogenic environment, the weed species represent natural 

focuses from which the species spread to natural habitats but also to arable areas 

(Jovanović, 1998). Hitherto research of the diversity of the weed flora in the Republic of 

Serbia has shown that the number of weed species in the widest sense makes up about 28% 

of the total flora (over 1,000 species), which is an indicator of a high degree of an 

emphasized floristic diversity of weeds (Kojić and Vrbaničanin, 1998, Strategy of 

biological diversity, 2011). Vojvodina represents a specific floral and geographical and 

natural-historical area in our country, and thus the flora and vegetation in it differs from the 

other parts of the country. The floral cover of Vojvodina is distinguished by various types 

of vegetation, with numerous communities of a great floral cornucopia and a complex 

structure (Parabućski and Šajinović, 1982). Novi Sad is a town with a long tradition of 

horticulture, and it is located in an area with a concentrated agricultural production, a town 

which is also an international river port and thus it is very receptive to the importing of 

plants of foreign origin. In the flora of Novi Sad, there have lately been significant changes 

which have been conditioned by anthropogenic factors and which are manifested by the 

spreading and assimilation of a sizeable number of adventive species. The largest number 

of invasive species (59.72%) in Vojvodina was recorded in Novi Sad, which indicates the 

need to catalogue the synanthropic flora in the area of the town of Novi Sad (Sekulić, 

2011). Until the 30s of the last century the largest number of references of ruderal flora can 

be found in the floristic monographs of Kupsok (1915), Prodán (1915,1916), Jávorko 

(1925) and Kovács (1929) (Obradović, 1986). From then until the 70s of the last century, 

the flora and vegetation of Vojvodina has been extensively tested by Slavnić (1951) and 

gives very significant data on the nitrophylic vegetation of Vojvodina, researching typical


ruderal communities, the nitrophylic vegetation of swamps and the weed vegetation of 

grains and row crops. Numerous authors, in researching the flora of Vojvodina and the salt 

marshes of Bačka, have given a contribution to the researching of adventive flora - Slavnić, 

Ž. (1953, 1956, 1961,1965, 1972), Atanacković, N. (1958), Obradović, M., Budak, V. 

(1974), Obradović Melanija (1974), Obradović, M., Boža, P (1983), Obradović and 

associates (1986), Janjatović et al. (1980), Parabućski, S. (1979), Parabućski, S, et al. 

(1971, 1979), Djurčjanski, P. (1980), Boža, P., et al. (1980,1987), Boža Pal, (1979, 1980) 

Budak, V. (1978, 1986, 1998), Ivković Olga (1975, 1978), Vrbaničanin et al. (2000, 2004). 

The diversity of the weed flora of the grassland and pasture ecosystem was tested by Kojić 

and Janjić (1997), Knežević (2008), Stavretović (2003) while Nestorović (2002, 2003, 

2005, 2011), Kojić et al. (2004), Jakovljević et al. (2005, 2008), Jovanović (2004) and 

Stanković-Kalezić (2007) tested the weed flora of urban environments. 

The floristic research of weeds is significant for cataloguing and a better insight into 

the flora of an area, based on which can be done a detailed plant and geographic analysis 

and a conclusion on the origin and history of the tested weed flora (Slavnić, 1956). This 

paper has carried out a taxonomic, ecological and phyto-geographical analysis of the 

synanthropic flora of Novi Sad, with a special stress on the analysis of the origin of 

allochthonic plant species as well as the range of life forms which indicate the character of 

anthropogenically altered phytocenosis. 


The plant material was collected during the entire vegetation seasons of 2009 and 

2010 at chosen localities in Novi Sad (Klisa, Novo Naselje, the Industrial zones North and 

South, along the canal, along the embankment, the Kej, Štrand). The plants were herbalized 

and processed via a method of classical herbalistics and deposited in the main collection of 

the herbalists in the Departments of Biology and Ecology of the Faculty of Sciences in 

Novi Sad (BUNS). 

The determining of the plant material was enacted by dichotomous keys based on 

the morphological character (Javorka, 1925). The taxonomic status and nomenclature were 

determined according to the Flora of Europe (Tutin et al., 1968). The belonging of the 

species to a certain family was determined according to Tahtajan (Tahtajan, 1997). 

The categorizing of species according to the appropriate life form (Raunkiaer, 1934; 

Pignastti, 1980) was carried out in the aim of showing a general trend and the impact of 

climate factors on the life forms and the strategies of plant dissemination. During the 

defining of life forms, a model adapted to the flora of Serbia was used (Stevanović, 1992). 

The flora elements were specified according to Gajić (Gajić, 1980) and Soó (1968) and 

were analyzed according to the range of aerial types (Janković, 1985). 

RESULTS 

I. Taxonomic analysis of flora 

With the aid of a floristic research of synanthropic flora on the territory of the city of 

Novi Sad, some 344 taxa at the level of species and subspecies were recorded. 

Based on our research and review of available references which relate to the tested 

area (Zorkóczy, 1896; Šajinović, 1968; Kupsok, 1915; Prodán, 1915,1916; Slavnić, 1953; 

Šajinović, 1968; Obradović, 1981, 1974; Budak, 1978, 1986; Parabućski, 1979;


Djurčjanski, 1980) and many other authors, recorded were a total of 900 taxa at the level of 

species and subspecies, that is, 895 species, classified into 396 genus and 106 families. 

Of the total number of recorded taxa (at the level of species and subspecies) based 

on the separated weed flora according to the weed flora of Yugoslavia (Čanak and 

associates, 1978) 568 species were recorded, that is, 63.11% of the total number of species. 

The Liliopsida class (Monocotyledones) is represented with 10 families and with 94 species 

(16.55%), while the Poaceae family dominates with 61 species, that is, 10.74% of the total 

number of species. The Magnoliopsida class (Dicotyledones) is represented by 58 families, 

some 469 species were recorded, that is, 82.57% of the total number of species, the 

Asteraceae family with 78 species that is, 13.73% of the total number of species which 

dominate. The Equisetopsida class is represented by one Equisetaceae family with 5 

representatives. 

The taxonomic analysis of the weed flora was carried out based on the most 

represented families and species according to the number of species (Diagram 1). 

16 

14 

12 

10 

8 

6 

4 

2 

0 

Asteraceae 

Poaceae 

Lamiaceae 

Fabaceae 

Brassicaceae 

Scrophulariaceae 

Apiaceae 

Chenopodiaceae 

Cyperaceae 

Polygonaceae 

Rosaceae 

Boraginaceae 

Ranunculaceae 

Caryophyllaceae 

Euphorbiaceae 

Diagram 1: Percentage (%) of the representation of weed flora families with more than ten taxa 

within the framework of synanthropic flora of Novi Sad 

The most represented families with more than 10 representatives were the 

Asteraceae with 78 representatives (13.73%), Poaceae with 59 representatives (10.38 %), 

Lamiaceae with 39 representatives (6.87%), Fabaceae with 37 representatives (6,51%), 

Brassicaceae with 36 representatives (6.34%), Scrophulariaceae with 31 representatives 

(5.46%), Cyperaceae with 19 representatives (3.34 %), Chenopodiaceae with 20 

representatives (3.52%) , Polygonaceae with 18 representatives (3.17%), Rosaceae with 17 

representatives (2.99 %), Boraginaceae and Ranunculaceae with 15 representatives 

(2.64%), Caryophyllaceae with 14 (2.46 %), and Euphorbiaceae with 10 representatives 

(1.76%). 

Along with the most represented families of the synanthropic flora of Asteraceae, 

Poaceae, Fabaceae and Brassicaceae which are represented in the flora of Serbia 

(Nestorović and Konstantinović, 2011) and the urban environment - Beograd 

(Jovanović,1994), Vranje (Jovanović, 2004), Smederevska Palanka (Jakovljević, 2005) - a 

high participation of the species of the Chenopodiaceae, Scrophulariaceae, Apiaceae and 

other families were expected considering the synanthropic character of a large number of 

representatives from these families. According to the research of Pyšek et al. (2009), the


most represented families in Europe are the ruderal species of an urban environment, 

agricultural weeds as well as invasive species, among which are the following: Asteraceae 

(692), Poaceae (597), Rosaceae (363), Fabaceae (323) and Brassicaceae (247) which 

indicates a wide transparency of weed species and their easy transferring and spreading. 

The aerial range of the total ruderal flora is characterized by the dominating of the species 

of wide aerials whose spreading is mostly carried out by man (directly or indirectly). 

Spreading predominantly in an hyman influent, the ruderal species inhabit habitats which 

are insufficiently stable, mostly intensely salted, thermophylic, hygrically unstable and 

usually nitrified. The most represented kinds are those which stress the anthropogenic 

character of diverse ruderal habitats. 

Based on the available literature and field data, among the most represented kinds 

which include 568 species (63.1%), the ones which are prominent according to the number 

of species are the following: Veronica and Carex with 15 representatives (2.64%), 

Chenopodium with 13 representatives (2.29%), Vicia and Euphorbia with 12 

representatives (2.11%), Rumex with 11 representatives (1.94%) and Bromus with 10 

representatives (1.76%) (Tab.1). Ranunculus, Polygonum, Verbascum, Poa, Centaurea, 

Amaranthus and many others are represented with less than 10 representatives. 

Table 1: Percentage (%) of represented genus of weed flora of Novi Sad 

Genera No of taxa % 

Veronica 15 2,64 

Carex 15 2,64 

Chenopodium 13 2,29 

Vicia 12 2,11 

Euphorbia 12 2,11 

Rumex 11 1,94 

Bromus 10 1,76 

Ranunculus 8 1,41 

Polygonum 8 1,41 

Vebascum 7 1,23 

Poa 7 1,23 

Centaurea 7 1,23 

Amaranthus 7 1,23 

According to research of other authors (Nestorović and Konstantinović, 2011) the 

weed flora of Serbia is characterized by a highly stressed diversity, and the following are 

prominent according to the number of species: Veronica (19), Chenopodium (16), Rumex 

(13), Ranunculus (12), Vicia (12), Bromus (11), Euphorbia (11), etc. 

II. Ecological analysis of flora 

With an analysis of the representation of certain life forms within the structure of 

synanthropic flora on the territory of the town of Novi Sad and within its framework as well 

as the structure of weed flora its hemicryptophytic-pterophytic character with the 

domination of hemicryptophytes was determined (Tab. 2.). The domination of 

hemicryptophytes and pterophytes is in accordance with the dominant participation of the 

mentioned life forms in the flora of Serbia which indicates an intensive anthropogenic 

character of an urban environment.


Table 2: The biological range of weed flora in Novi Sad for basic life forms 

Life form No of species % 

Hemicryptophyta (H) 225 39,61 

Therophyta (T) 183 32,22 

Phanerophyta (Ph) 65 11,44 

Geophyta (G) 46 8,10 

Therophyta/Chamephyta (TH) 17 2,99 

Hydrophyta (H) 12 2,11 

Scadentophyta (S) 11 1,94 

Chamaephyta (Ch) 9 1,58 

Ukupno 568 63,10 

Hemicryptophyta (H) 

In the weed flora of Novi Sad, the life form of hemicryptophyta is the most 

numerous, with 225 taxa, that is, 39.61% of the total number of recorded species. 

Within the framework of hemicryptophyta dominates the group of perennial 

hemicryptophyta with a stem (H scap), which is represented with 20.25%, that is 115 

species. The number is in accordance with the dominant participation of this life form in the 

synanthropic flora of Serbia, which makes the climate of the tested area, as well as the 

entire moderate area towards Teril and Runkier a hemicryptophytic one. 

The most represented are hemicryptophyta with a stem (H scap) with 115 species, 

tufted life forms (H caesp) were represented with 5.98%, that is 34 species, creeping (H 

rept) with 10 species, that is 1.76%, rosette plants (H ros) with 7 species, that is 1.23%, 

perennial hemicryptophytes with a stem (H scap perenn) were represented with 0.88%, that 

is 5 species, while to a lesser extent less than 5 species were represented by perennial 

rosette plants with a stem (H scap semiros), half-rosette plants (H semiros), half-bushy etc. 

(Diagram 2) 

8% 

17% 

6% 5% 4% 3% 

57% 

H scap 

H caesp 

H bienn 

H scap bienn 

H rept 

H ros 

H scap perenn 

Diagram 2: Percentage (%) of represented life forms of hemicryptophytes of the weed flora of 

Novi Sad with more than 5 representatives


The domination of hemicryptophytes is in accordance with the dominant 

representation of this life form in the flora of Serbia, while the participation of the highly 

dominant life form of pterophytes is in a direct correlation with the instability 

(ephemerality) of the majority of ruderal habitats in which man with his frequent 

interventions impedes development, primarily of perennial plants. An annual character, that 

is, a relatively limited vegetation period within which these plants “complete” their 

onthogenetic development is a specific response (adaptation) of ruderal plants to the 

unstable and short-lasting habitats in urban environments. 

The analysis of life forms of hemicryptophytes from the aspect of the representation 

of specific growth categories indicates the domination of the transitional groups: Mac-Alt, 

Mes-Mac, Mac-Meg, Meg-Alt, Mes-Meg. 

The most represented are the species which bloom in the summer and in the springsummer 

period (a, v-a). 

Therophyta (T) 

The group of therophyta is the second in line according to representation in the 

biological range of weeds of the flora of Novi Sad. It is represented with 180 species which 

makes up 31.69% of the total number of taxa in the tested area. 

The basic life form of the therophyta with a stem (T scap) is the most represented 

among the pterophyta with 157 species, that is, 21.64%. 

The creeping life forms (T rept) are represented with 6 types, that is, 1.06%. Annual 

tufted kinds (T caesp) have 4 representatives, that is, 0.70% while rosette plants (T ros) and 

parasites (T par) are presented with two genus (Diagram 3). 

4% 2%2% 2% 

90% 

T scap 

T rept 

T caesp 

T scap H scap 

T scap H bienn 

Diagram 3. Percentage (%) of representation of life forms of therophyta of the weed flora of 

Novi Sad with more than 5 representatives 

An analysis of life forms of therophyta from the aspect of the representation of 

certain categories of growth points to the domination of the following transitory groups: 

Mes-Mac, Mi-Mes, Mes-Meg, Mac-Meg. 

The most represented are species which bloom in the summer and in the springsummer 


A high participation of therophyta in the biological range is a result of the instability 

of the majority of habitats, where the anthropogenic factor with its activities (occasional or 

permanent) hinders the development of perennial plants and enables an uninterrupted


development of annual genus. As a rule, the lesser the impact of anthropogenic factors on 

some ruderal habitat, the more the composition of the biological range will be altered in the 

direction of reducing the proportional participation of therophyta and increasing the total 

share of biennial and perennial plant types (Jovanović, 1994; Jarić, 2009). 

Geophyta (G) 

Geophyta are represented with 46 species, that is, 8.10%. Within the framework of 

geophytes, the most represented are rhizomatous geophytes (G rhiz) with 25 species, that is, 

4.40%. Geophyta with bulbs (G bulb) include 11 species, that is, 1.97% while the other life 

forms are represented with less than 5 species (Diagram 4). The life form of rhizomatous 

geophytes (G rhiz) is present with 2 species, that is, 0.35% while other life forms are 

present with less than 1 species. 

31% 

G rhiz 

G bulb 

69% 

Diagram 4. Percentage (%) of representation of life forms of geophyte of weed flora of Novi 

Sad with more than 5 representatives 

An analysis of life forms of geophytes from the aspect of the representation of 

certain growth categories indicates the domination of the transitory groups: Mac-Meg,Mes- 

Mac, Mac-Alt and tall plants (Alt). 

The most represented are species which bloom during the summer and in the springsummer 


Therophyta/hamephyta (TH) 

The life form therophyta/hamephyta in the weed flora of Novi Sad is represented 

with 17 species, that is, 2.99%. Within these categories, the most represented are plants 

with aboveground trees without a ground rosetta (T/H scap), with 7 species, that is 1.23%, 

biennial kinds (T scap/H bienn) are represented with 5 species, that is 0.5%, while the other 

life forms are represented with less than 5 species (Diagram 5). With 4 species, that is 0.7% 

represented are life forms T scap/H bienn and T scap/H scap bienn while T ros/H ros bienn 

is represented with one species, 0.18%.


36% 

64% 

T scap/ H scap 

T scap/H bienn 

Diagram 5. Percentage (%) of representation of life forms of therophyta/hamephyta in the weed 

flora of Novi Sad with more than 5 representatives 

An analysis of the life form of therophyta/hamephyta from the aspect of 

representation of certain growth categories indicates the domination of the species of 

average height (Mes) as well as transitory groups: Mac-Alt, Mes-Meg. 

The most represented are the kinds which bloom during the summer and in the 

spring-summer period (a, v-a). 

Scandetophyta (S) 

The life form of lianas or climbing vines are represented primarily with a group of 4 

species of lignified (S lig) types of lianas, that is, 0.71% while the other types of lianas with 

a rosette (SG herb rhiz), hemicryptophytic (SH herb) and geophytic (ST herb) vines are 

represented with one species, that is, 0.18% (Diagram 6). 

50% 

50% 

S lig 

ST herb/T scap 

Diagram 6. Percentage (%) of representation of life forms of scadentophyta of the weed flora of 

Novi Sad with more than 5 representatives 

An analysis of life forms of climbing vines from the aspect of the representation of 

certain growth categories indicates the domination of very tall species (Alt) with 5 species, 

that is 0.88% and a species of medium height (Mes) as well as transitory categories (Mes- 

Meg) with 2 species, that is, 0.35%, while the tall species (Meg) and the transitory category 

Meg-Alt represented with 1 species, that is, 0.18%. The most represented are the species 

which bloom in the summer (a).


Chamephyta (Ch) 

The life form of chamephyta is represented with 10 species (1.76%). In the group of 

chamephyta, dominant is the form of half-shrubs (Ch suffr) with 2 species (0.35%), life 

forms with climbing vine shoots (Ch rept) are present with 3 species (0.53%), while the 

other life forms are present with 1 species (0.18%). 

An analysis of the life forms of chamephyta from the aspect of the representation of 

certain growth categories indicate the domination of tall species (Mac) with 3 species, that 

is, 0.53% while the other species of medium height (Mes), miniature (Mi) as well as 

transitory categories (Mes-Mec) are present with 2 species, that is, 0.35%. The most represented 

are species which bloom in the summer and in the spring-summer period (a, v-a). 

Hydrophyta (Hyd) 

The life form of hydrophytes in the weed flora of Novi Sad are represented with 12 

species, that is, 2.11%. Within this category, the most represented are rooted hydrophytes 

(Hyd rad) with 8 species, that is 1.41%, while flotant hydrophytes are represented with 3 

species, that is, 0.53%. 

The most represented are species which bloom in the summer (a). 

III. Phyto-geographic analysis 

A plant-geographical analysis of the total synanthropic flora in the area of the town 

of Novi Sad included some 900 taxa. A research has recorded 109 adventive taxa of which 

46 taxa were of an American origin, 22 came from Africa, 20 from Asia, 10 from the 

Mediterranean, and one taxon was Pontic and cryptogenic. Some 73 invasive species were 

recorded. 

Based on the separated weed flora which encompasses 568 species, aerial types with 

a number of species were recorded: the Eurasian aerial type with 276 representatives 

(48.95%), the Mediterranean-Sub Mediterranean with 36 representatives (6.34%), Pontic- 

South Siberian with 29 representatives (5.10%), Middle European with 77 (13.56%), 

Atlantic-Mediterranean with 5 (0.88%), circumpolar with 50 (8.8%), Cosmopolitan with 55 

(9.68%) and 40 (7.42%) representatives of the adventive species of which 17 species and 4 

which are not precisely defined originated from America, 6 species originated from Asia, 2 

species were Mediterranean and one taxon was cryptogenic. Some 44 invasive species were 

recorded. 

According to research (Obradović, Matanović, 1986) the Mediterranean-Sub 

Mediterranean aerial type and adventive of Northern American origin were emphasized 

with the largest number of species which is in accordance with the Vojvodina flora period 

before World War 2 and especially the enriching of adventive species after World War 2. 

The composition was fairly heterogeneous and thus the imported plants were most often 

neophytic or ephemerophytic cultured plants or cultivated (ergasiophytes), or species 

frequently escaping from cultivation (ergasiophygophytes) or members of the Vojvodina 

flora (epicophytes) such as the species of the Amarantus genus (Obradović and Matanić, 

1986). In the framework of our research of weed flora of Novi Sad, 8 aerial types were 

separated, which were then classified into aerial groups (Table 3).


Table 3. The review of aerial types in the weed flora of Novi Sad 

Aerial types No of species Percentage (%) 

Eurasian 276 48,59 

Centar European 77 13,56 

Cosmopolitan 55 9,68 

Circumpolar 50 8,8 

Adventive 40 7,42 

Mediterranean and sub-Mediterranean 36 6,34 

Pontic- southern Siberian 29 5,1 

Atlantic-Mediterranean 5 0,88 

As a consequence of an intense anthropogenic influence during the last few decades, 

there have been significant changes which were headed in the direction of a ruderalization 

of flora, that is, an increasing of the number of adventive and cosmopolitan species which 

are the most important factors in the changing and enriching of the flora of Vojvodina. A 

significant participation of “adventive” and cosmopolitan aerial type is what characterizes 

ruderal flora as a whole as well as the ruderal flora on the territory of the town of Novi Sad. 

DISCUSSION 

The contemporary way of life and urbanization in large towns have resulted in 

frequent changes within habitats. The anthropogenic pressure on these kinds of habitats 

which has been present for centuries and is increasingly more intense in the modern age, 

has led to changes in the floral composition of plant communities of the ruderal flora. The 

arheophytes which arrived with the first farmers to new environments adapted to the new 

conditions on arable land from which they spread to cities without difficulty. Neotophytes 

with different life forms are urban habitats and a very diverse group of allochthonous flora 

which adapted well in towns. In Central Europe, 45% native species have been defined, as 

well as 16% arheophytes and 33% neotophytes (Lososova et al., 2011). One part of the 

imported flora which exists in towns was imported and cultivated as decorative in botanical 

gardens and parks and spread from an urban environment into a natural environment 

(uncultivated) while the other part was imported inadvertently. 

The first finding of the allochthonous weed species Iva xanthifolia imported into 

Vojvodina was revealed in 1966 (Šajinović and Koljadžinski, 1966), on 4 locations in Novi 

Sad. Later data from 1973 (Koljadžinski and Šajinović, 1973) indicates the spreading of 

these species in the area of Novi Sad as well as the new localities of Bačka and Srem 

(Šajinović and Koljadžinski, 1978). Slavnić ascertains that Eleusine indica (L.) Gaertn. had 

appeared in Bačka in 1958 when it was noted in the streets of Novi Sad. Panicum capillare 

L. was for the first time determined on the territory of Vojvodina in 1954, spreading until 

1961 to the entire southwestern Bačka (Slavnić, 1962). In the flora of Novi Sad and the 

surroundings, similarly as in other regions of Vojvodina, constant changes of the floristic 

composition took place, which are reflected, on the one hand, on the withdrawing and 

disappearing of certain species, and on the other, in the enriching of the flora of the newly


imported adventive species. For an insight into the flora of Vojvodina, it is significant to 

record new species of a foreign origin. Based on research in the period 1972-1974, Ivković 

points to the spreading of aerial adventive species among which were the following: 

Ambrosia elatior L., Solidago giganthea var. serotina (Ait) Cronquist, Oxalis corniculata 

L., Galinsoga parviflora Cav, Eleusine indica (L.) Gaertn, Panicum capillare L. and 

Oenothera depressa Gaertn. (Ivković, 1975). Based on the mentioned references, we can 

conclude that, the region of Vojvodina, not just due to its geographical position but also its 

agricultural character, is the most favorable for importing and spreading of weeds. The fact 

that in the flora of Vojvodina a great number of allochthonic species have been recorded 

goes in favor of this, along with the spreading of their aerials. After World War 2, the issue 

of the spreading of allochthonic species was researched by Slavnić (1953, 1961), 

Atanacković,1968 and others who in their papers presented floristic and ecological data on 

the newly imported species. Asclepias syriaca L. is cited by Atanacković in 1958, which 

spread in the surroundings of Novi Sad from the cultures of honey plants, considering that 

they were imported as a culture. 

As a consequence of an intense and diverse impact of man, along with an 

increasingly developed trade of a wide international and intercontinental scope, today there 

is an increasingly more rapid spreading of weed species. The speed of the spreading of 

species shown in Vojvodina can surely be explained by a reduced competition in the 

phytocenosis of ruderal habitats, by optimal edaphic and microclimatic conditions of 

anthropogenic habitats for the germinating of seeds of plant species as well as the proximity 

of habitats to roads with mass transport. Also, their mass appearance can be explained by a 

similarity of climate conditions of the southeastern part of Europe, to which Vojvodina also 

partly belongs, with the climate of the habitation of the adventive kind. It is a fact that in 

Serbia there is an increase of frequency, intensity and duration of meteorological droughts, 

as a result of increased temperatures, decreased summer precipitation and a larger number 

of longer dry periods. These changes were followed by physical and biological indications 

of environmental changes, such as a prolonged vegetation season which conditioned an 

increased productivity of vegetation, especially thermophylic weed species which dominate 

in in Serbia, encompassing ¾ of the total number of weed species (Popović, 2009). Weed 

plants indisputably serve as indicators of a certain type of habitat or point to a certain type 

of climate, especially in regards to a heat regimen (Kovačević, 1959). The composition of 

the weed flora of a habitat changes depending on climate changes, the type of soil, the 

altitude, and it is also subject to seasonal changes so that biomonitoring, charting weeds 

with the aim to determine the diffusion and intensity of the representation of the dominant 

species is of a great significance - with the aim of determining new, invasive, resistant 

species (Stefanović and associates, 2002). Weed plants have according to the heat factor a 

wider ecological valence and the temperature limits for seed germination are significantly 

more wide-ranging than with cultivated plants. In most cases they have the ability to be 

maintained in very wide margins of vacillation of ecological factors, and during changes of 

the external environment factors weed plants are, due to their wide ecological valence, able 

to adapt to newly occurring conditions, which are often not optimal. Connected with the 

spreading of ecological valence is also cosmopolitism, one of the features of weed plants 

and also a significant one which enables them a great expansion, due to the production of a 

huge amount of seeds and a great seed longevity which enables survival (Kojić and 

associates, 1985). The allochthonous weed species which are represented in the flora of 

Novi Sad and widely spread in Europe are the following: Amaranthus retroflexus L. 1753, 

Amaranthus albus L. 1759, Amaranthus blitoides S. Watson 1877, Chenopodium 

ambrosioides L. 1753, Datura stramonium L. 1753, Erigeron annus (L.) Pers 1807, Juncus


tenuis Willd, 1799, Medicago sativa L. 1753, Oenothera biennis L. 1753, Panicum 

capillare L. 1753, Solidago canadensis L.1753, Veronica persica Poiret in Lam. 1808, 

Vicia sativa L. 1753, Lepidium virginicum L. 1753, Medicago sativa L. 1753 etc. (Pyšek et 

al., 2009). The most represented genus of weed flora of Novi Sad is that which stresses the 

anthropogenic character of different ruderal habitats, these being Veronica, Chenopodium, 

Rumex, Ranunculus, Vicia, Bromus, Euphorbia. The most represented families of Novi Sad 

among which are the ruderal species of an urban environment, agricultural weeds as well as 

invasive species are the following: Asteraceae, Poaceae, Fabaceae and Brassicaceae. The 

mentioned families are also represented in the other towns of Serbia and Europe which 

points to a wide transparency of weed species and their easy transporting and spreading. 

Life forms are determined by the climate and reflect the life conditions of the 

environment. Weed plant species can undoubtedly serve as indicators of a certain type of 

habitat or point to a certain kind of climate, especially in regards to the heat regimen. Based 

on an insight into weed flora, it is possible to carry out an assessment of the thermophylic 

character of habitats (Kovačević, 1959:2). For all the tested towns in Serbia, references cite 

the hemicryptophytic-pterophytic character of the ruderal flora, which is also determined by 

our research. The dominant hemicryptophytic-pterophytic life form of weed flora was to be 

expected due to the biological traits of plants and the habitat conditions of the urban 

environment. The pterophytes forms are representative annual plants with a short 

vegetation period and a need for a great amount of light and heat and as such, they are 

suitable to be imported in urban environments and deserted areas and therefore they can be 

encountered in the very same environments. Along with pterophytes, the most numerous 

group of weed plants are represented by hemicryptophytes which, due to the heterogeneous 

habitat of Novi Sad, are spread widely starting from partly humid terrains to steppes, and 

also numerous are xerothermic communities on stony areas which belong to thermophylic 

fields and pastures (Diklić, 1984). The third in order according to the number of 

represented species are geophytes which make up an integral part of steppe vegetation and 

the vegetation of stony areas and among them are species which belong in dry habitats. The 

microclimate conditions of urban habitats increasingly suit the weed species of North 

American, Asian and Mediterranean origin which appear as the most represented in the 

weed flora of Novi Sad. Stress tolerance, pollution, water deficit resistance are the features 

of many foreign species which exist in the urban flora (Williams et al., 2009) and thus, due 

to a certain number of weeds, ruderal and adventive plants which have adapted and in some 

cases also evolved into special infraspecies taxa are considered to be a potential 

precondition of the decreasing biodiversity (Knežević and associates, 1993). Some of the 

weed species which we consider as having disappeared from the territory of the town of 

Novi Sad and are now included in various referential data are Abutilon theophrasti, Adonis 

aestivalis, Antennaria dioica, Berula erecta, Caltha palustris, Crepis cappillaris, 

Euphorbia palustris, Euphobia stricta, Glyceria fluitans, Glyceria maxima, Juncus tenuis, 

Ononis arvensis, Rapistrum perenne and others. 

Monitoring weed species is a key factor in controlling and preventing of the 

spreading of species with a high degree of invasiveness. 

REFERENCES 

Atanacković, N. (1958): Prilog flori Bačke, Zbornik Matice srpske, serija za prirodne nauke, br.14, 

Novi Sad. 

Boza Pal (1980): Prilog flori Srbije III, Biosistemtaika, Vol 6, No 1, 57-67 

Boža Pal (1979): Prilog Flori Srbije II, Biosistematika, Vol. 5, No. 2, str. 167-179.


Boža, P., Obradović, M., Knežević,A. (1987): Prilog poznavanju varijabilnosti nekih stepskih i 

slatinskih biljaka u Vojvodini, Zbornik Radova PMF, serija za biologiju 17, str. 59-62. 

Boža,P. Obradović,M. (1980): Novi podaci za floru SR Srbije, Zbornik radova PMF, serija za 

biologiju 10, str. 361-369. 

Budak Vera (1978): Florogeneza slatina jugoistočne Bačke, magistraski rad, PMF Novi Sad. 

Budak Vera (1986): Biljnogeografske karakteristike flore slatina Bačke,doktorska 

disertacija,Univerzitet u Novom Sadu,Prirodno-matematički fakultet,Novi Sad. 

Budak Vera (1998): Flora i biljnogeografske odlike flore Bačke, Matica srpska, odeljenje za prirodne 

nauke. 

Čanak, M., Stanija, P., Kojić,M. (1978): Ilustrovana korovska flora Jugoslavije,Matica srpska, 

odeljenje za prirodne nauke, Novi Sad. 

Djurčjanski Ruženka (1980): Florističke karakteristike jugoistočne Bačke, magistarski rad, Prirodnomatematički 

fakultet u Novom Sadu, Institut za Biologiju. 

Gajić Milovan (1980): Pregled vrsta flore SR Srbije sa biljnogeografskim oznakama. Glasnik 

šumarskog fakulteta, Serija A „Šumarstvo“,br. 54. 

Ivković Olga (1975): Prilog adventivnoj flori okoline Novog Sada, Zbornik za prirodne nauke Matice 

srpske, 49, 197-202. 

Ivković, O. (1978): Lepidium virginicum L. 1753-nova vrsta u flori SR Srbije, Biosistematika, 4 

(1):75-79. 

Jakovljević,K., Jovanović S. (2005): Ruderalnafloraof Smederevska Palanka town-ecological and 

phytogeographical characteristics. Acta herbologica, 14(1): 1-14. 

Jakovljević,K., Lakušić, D., Vukojičić, S., Teofilović, A., Jovanović, S. (2008): Floristics 

characteristics of Višnjička Kosa bear Belgrade, Serbia. Arch.Biol.Sci., Belgrade, 60(4):703- 

712. 

Janjatović, V., Obradović, M., Merkulov, Lj., Boža, P. (1980): Prilog letnjoj flori šire okoline Novog 

Sada, Zbornik radova PMF, br. 10, Novi Sad. 

Janković M. (1985): Fitogeografija. Univerzitet u Beogradu. Beograd 

Jarić Snežana (2009): Alohtone biljne vrste u prirodnim antropogeno izmenjenim fitocenozama 

srema, doktorska disertacija, Poljoprivredni fakultet, Univerzitet u Beogradu. 

Jávorka Sándor-Csapody Vera (1975): Közép-Európa Délkeleti Részének Flórája Képekben. 

Aadémiai Kiadó, Budapest. 

Jovanović Marica (2004): Ruderalna flora Vranja. Acta herbologica,13(1): 83-88. 

Jovanović Slobodan (1994): Ekološka studija ruderalne flore i vegetacije Beograda, Biološki fakultet 

Univerziteta u Beogradu. 

Knežević A., Boža,P., Merkulov, Lj., Ivezić, J. (1993): Primeri infraspecijskih eko-morfoloških 

adaptacija biljaka na slatinama u Vojvodini, Zbornika radova PMF, serija za Biologiju, 23: 

79-83. 

Knežević, A., Ljevnaić,B., ikolić, Lj., Ćupina,B. (2008): Biljnogeografska analiza flore zaslanjenih 

pašnjaka severnogdela vojvođanskog Banata. 

Kojić, M., Janjić V. (1997): Savremeni problemi herbologije. Herbološko društvo Srbije, Beograd. 

Kojić, M., Popović, R., Karadžić,B. (1998): Sintaksonomski pregled vegetacije Srbije. Institut za 

biološka istraživanja „Siniša Stanković“, Beograd. 

Kojić, M., Vrbaničanin S. (1998): Agrestial, ruderal, grass and aquatic weeds on Serbia. Acta 

herbologica, 7(1): 7-35. 

Kojić, M., Vrbaničanin, S., dajić,Z., Mrfat-Vukelić, S. (2006): Korovska flora prirodnih travnjaka 

Srbije. Acta herbologica, 15 (1): 15-20. 

Kojić, M., Stanković-Kalezić, R., Radivojević, Lj. (2004): Contribution to studies of the ruderal 

vegetation of eastern Srem (II). Acta herbologica, 13(1): 75-82. 

Kovačević Josip (1959): Procjena termofilnosti staništa na oraničnim površinama pomoću korovske 

vegetacije, Zavod za agroekologiju,1-2, Zagreb. 

Kupcsok, Tivadar (1915): Adatok Bács-Bodrogmegye déli részének és Szerémmegyének flórájához, 

Magyar Botanikai Lapok, Budapest.


Lososova, Z., Chytrý, M., Tichrý, L., Danihelka, J., Fajmon, K., Hájek, O., Kintrová, K., Lániková, 

D., Otýpková, Z., Řenořek, V. (2011); Biotic homogenization of Central European Urban 

floras depends on residence time of alien species and habitat types, in press. 

Nestorović Marko (2002): Ekološke-fitogeografske karakteristike korovske flore urbane sredine u 

cilju iznalaženja mera borbe, magistarska teza, Univerzitet u Novom Sadu, Poljoprivredni 

fakultet, Novi Sad. 

Nestorović Marko (2003): The Weed flora of Mirijevo-The analysis of living forms. Acta agriculturae 

Serbica, Vol. VIII, 15: 47-55. 

Nestorović Marko (2005): Eological and Phytogeographic characteristic of weed flora of Mirijevo. 

Acta Phytopathologica and Enthomologica Hungarica 40 (1-2), pp. 79-110. 

Nestorović, M., Konstantinović, M., (2011): Overview of weed flora in the Serbia. Contemporary 

Agriculture 60 (1-2): 215-230. 

Obradović Melanija i Panković-Matanović Vera (1986): Adventivna flora Vojvodine Zbornik Matice 

srpske za prirodne nauke, br. 70, Novi Sad. 

Obradović, M., Budak, B., Boža, P. (1983): Novi infraspecijski taksoni kaćuna (Orchidaceae Lindl.) u 

flori Vojvodine, Zbornik Matice srpske za prirodne nauke, br. 64, Novi Sad. 

Obradović, M., Budak, V. (1974): Neke bljnogeografske karakteristike flore slatina okoline Novog 

Sada, Zbornik Matice srpske za prirodne nauke, br. 46, Novi Sad. 

Obradović, M., Pal, B., Budak, V. (1986): Dopuna poznavanju varijabilnosti i rasprostranjenosti 

nekih monokotila u Vojvodini, Zbornik radova PMF-a, ser.16, str. 111-1120. 

Pal Boza (1979): Neki infraspecijski oblici kao novi podaci za floru SR Srbije, Zbornik radova PMF, 

Univerzitet u Novom Sadu, knjiga 9, strp. 545-551 

Parabućski S., Šajinović, B. (1982): Flora i vegetacija Vojvodine i problemi njihove zaštite, 

Makedonska akademija na naykite i ymetnostite macedonian academy of science and arts, 

prilozi, III 1-oddelenie za biološki i medicinski nayki, 93-108. 

Parabućski, S, Ćanak, M., Kujundžić, M. (1979): Senecio doria Nath. U flori Vojvodine, Zbornik za 

prirodne nauke Matice Srpske, br.56, Novi Sad. 

Parabućski, S., Janjatović,V., Anđelić, M. (1971): Plantago tenuifolia W. Et K. na slatinama u okolini 

Novog Sada.Letopis naučnih radova Poljoprivrednog fakulteta, sv. 15, Novi Sad. 

Pignatii Sanndro (1982): Flora D’Italia, No 1-3. Edagricole. 

Popović, T., Đurđević, V., Živković,M., Jović,B., Jovanović,M. (2009): Promene klime u Srbiji i 

očekivani uticaji. Peta regionalna konferencija „EnEOg-životna sredina ka Evropi“, Beograd 

4-5 jun. 

Prodan, Gy. (1915): Bacs-Bodrog-varmegye sziki novenye, Magyar Bot. Lap, 13, Budapest, 1915 

Prodan, Gyula. (1916): Bacs-Bodrog-vármegye flórája, Flora des komitates Bacs-Bodrog, Magyar 

Botanika Lapok., 14, Budapest, 1916 

Pyšek, P., Jarošík, V., Pergl, J., Randall, R., Chytry, M., Kühn, I., Tichý, L., Danihelka, J., Chrtek, J., 

Sádlo, J. (2009): The global invasion success of Central European plants is related to 

distribution characteristics in their native range and species traits, Diversity and 

Distirbutions,15, 891-903. 

Pyšek,P., Lambdon,W., Arianoutsou, M., Kühn, I., Pino, J., Winter,M. Alien vascular plants in 

Europe.In: James AD. editor. Handbook of alien species in Europae, Springer, 2009,p. 43-79. 

Radović I., Kozomara,M. (2011): Strategija biološke raznovrsnosti, Republike Srbije za period od 

2011. do 2018. godine. Ministarstvo životne sredine i prostornog planiranja, Beograd. 

Raunkiaer, C. (1934):The life forms odplants and statistical plants geography; being the collected 

papers of C. Raunkiaer, translated into English. Clarendon, London. 

Sarić, M. (1992): Flora Srbije 1. 

Radanović M. (2011): Predikcija areala vrsta roda Ambrosia L. 1754 (Asteraceae, Heliantheae) na 

području Vojvodine. Prirodno-matematički fakultet, Univerzitet u Novom Sadu. (manuscr.) 

Slavnić Ž. (1953): Prilog flori našeg podunavlja.Glasnik biološke sekcije,Hrvatsko prirodoslovno 

društvo, Zagreb 

Slavnić Živko (1956): Značaj florističkih i ekoloških proučavanja korova za teoriju i poljoprivrednu 

praksu, First symposium about weed control, Beograd, 1-11.


Slavnić Živko (1962): Eleusine indica (L.) Gaertn i Panicum capillare L. u flori Bačke, Zbornik 

matice srpske za prirodne nauke, sv. 21. 

Slavnić, Ž. (1972): Fam. Amarantaceae Juss.in Josifović, M. (ed.): Flora SR Srbije 3, 1-10.- 

SANU,Beograd. 

Slavnić, Ž. I Lozušić, B. (1965): geografsko rasprostranjenje, tipovi staništa i stepena odomaćivanja 

vrste Amaranthus blitoides S. Watson u Jugoslaviji, prirodne nauke, sveska III/IV, Sarajevo. 

Slavnić. Ž. (1961): O nekim adventivnim vrstama u Vojvodini , Zbornik Matice srpske za prirodne 

nauke, br. 20, Novi Sad. 

Soó, R. (1964-1980): A magyar flóra ès vegetáció rendszertani-növènyföldrajzi kèzikönyve I-VI. 

Akadèmiai Kiadó, Budapest. 

Stanković-Kalezić Radmila (2007): Taksonomska i ekonomska analiza ruderalne flore na području 

Panačevačkog rita.Acta herbologica 20(1): 1-13. 

Stavretović Nenad (2003): Weeds, conditional weeds and quality plants in lawns of the urban part of 

Belgrade. Acta herbologica, 12 (1-2): 37-48. 

Stefanović, L., Vrbničanin, S., Simić, M. (2002): The importance of weed flora mapping in the 

regions of Serbia, Acta herbologica, 11(1-2): 14, Beograd 

Stevanović, B., Jovanović, S., Šošić, Lj. (1988): Ekološke karakteristike ruderalne vegetacije i morfoanatomska 

analiza biljaka sa gaženih i ne gaženih ruderalnih površina, Glasnik Instituta za 

botaniku i botaničke bašte Univerziteta u Beogradu, Tom XXII, 117-130. 

Šajinović Branislava (1968): Ekološka-fitocenološka studija, segetalne vegetacije okoline Novog 

Sada, magistarski rad. 

Šajinović, B., Koljadžinski, B. (1966): Nova adventivna vrsta Iva xanthifolia Nutt. (Cyclachaena 

xanthifolia Fresen) u našoj zemlji. Glas. Prir. Muzeja u Beogradu, 21: 217-220. 

Šajinović, B., Koljadžinski, B. (1978): Prilog proučavanju procesa naturalizacije adventivnih biljnih 

vrsta-Ambrosia artemisifolia L. 1753 i Iva xanthifoila Nutt. 1818. (Asteraceae) u Vojvodini, 

Biosistematika, 4(1): 81-92. 

Taktajan,A. (2007): Flowering Plants 2nd edition. Columbia University Press, New York. 

Tutin, T.G., Burges, N.A.,Chater, A.O., Edmondson, J.R., Heywood, V.H., Moore, D.M., Valentine, 

D.H., Walters, S.M. i Webb, D.A. 1999. Flora Europaea I. London, Cambrige University 

Press. 

Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M. i Webb, 

D.A. 1976. Flora Europaea II-V. London, Cambrige University Press. 

Vrbaničanin,S., karadžić,B., Dajić-Stevanović, Z. (2004): Adventivne i invazivne korovske vrste na 

području Srbije. Acta hebologica, Vol.13, No. 1, 1-12, Beograd. 

Vrbaničanin,S., Kojić, M. (2000): Biološka i ekološka proučavanjakorova na području Srbije 

razvoj,današnje stanje, perspektive. Acta herbologica, 9(1): 41-59. 

Williams, N., Schwartz, M., Vesk, P., McCarthy, M., Hahs, A., Clemants, S., Corlett, R., Duncan, R., 

Norton, B.,Thompson, K., McDonnell, M. (2009): Future directions, A conceptual framework 

for predicting the effects of urban environments on floras Journal of Ecology, 97: 4–9. 

Zorkóczy Lajos (1896.): Ujvidék-és környékének, Flórája, Ujvidék, Kapható valamennyi ujvidék 

könyvkereskedésben.

Eleni Kotoula-Syka, C.Afentouli, I.Georgoulas 157 

International Symposium: Current Trends in Plant Protection UDK: 633.1-251(495) 

Proceedings 632.954.025.8(495) 

HERBICIDE - RESISTANT WEEDS IN CEREAL CROPS IN 

GREECE 

ELENI KOTOULA-SYKA 1 , C. AFENTOULI 2 , I. GEORGOULAS 3 

1 Democritus University of Thrace, Greece, 

2 West Thessaloniki Secondary Education Directorate, Greece, 

3 National Agricultural Research Foundation, Plant Protection Institute , Thessaloniki, Greece 

e-mail : kotoulaeleni@yahoo.gr 

In Greece, diclofop-methyl was heavily used for grass weed control whereas chlorsulfuron 

was used for many years to control broad-leaf weeds in winter cereals. 

Recently, failures in control of several populations of major weeds were reported in Greece. 

The objectives of this research were to investigate the possibility of resistance evolution in various 

populations of Lolium rigidum, Phalaris brachistachys and Avena sterilis to grass herbicides and 

Papaver rhoeas to chlorsulfuron, and to elucidate the mechanisms of resistance. Plant response to 

these herbicides was evaluated in pot experiments and laboratory studies. We found that L. rigidum is 

multiple-resistant to ACCase inhibitors due to an altered target site, and to chlorsulfuron due to 

enhanced detoxification. Eight biotypes of P. brachystachys, were examined for resistance to ACCase 

inhibitors and seven of them indicated resistance to fenoxaprop-ethyl. In contrast all eight biotypes 

were susceptible to tralkoxydim and clodinafop-propargyl. Continuous use of isoproturon resulted in 

heavy infestation with A. sterilis that tolerates high rates of isoproturon while being susceptible to 

ACCase inhibitors used. A population of P. rhoeas was found to be resistant to chlosulfuron (altered 

target site), whereas all P. rhoeas populations were susceptible to imazamox and tolerant to imazapic 

but resistant plants were cross-resistant to imazethapyr. 

Key words: ACCase inhibitors; ALS inhibitors; herbicide resistance. 

INTRODUCTION 

The aryloxyphenoxypropionate (AOPP) and cyclohexanedione (CHD) herbicides 

are two important groups of post-emergence herbicides used to control grass weeds in grass 

and dicot crops that share a common mode of action (ACCase inhibitors).The increase in 

the use of these graminicides led to a parallel increase in the evolution and spread of 

resistant weed populations to these herbicides. Diclofop-methyl was the first 

aryloxyphenoxypropionate (AOPP) herbicide used for selective control of grass weeds in 

cereals (mid 70’s), followed by other graminicides like tralkoxydim (cyclohexanedione, 

CHD) and fenoxaprop-ethyl that were used to control Phalaris spp. Isoproturοn, a 

substituted urea herbicide, was the main herbicide used to control grass weeds and some 

broad-leaf weeds in winter wheat in a region near Florina in the Northwest of Greece. Since 

2,4 D was introduced, auxinic herbicides as well as benzoics and nitriles, were the main

158 Herbicide – resistant weeds in cereal crops in Greece 

herbicides used in Greece to control broad-leaf weeds in winter wheat. Chlorsulfuron, a 

cereal-selective herbicide, was the first sulfonylurea used in Greece since the middle of 

80’s followed by other ALS inhibitors such as triasulfuron, tribenuron and metosulam. It 

has become widely used, mainly for broad-leaf weeds and L. rigidum control. The 

extensive use of chlorsulfuron has led to a widespread resistance. The objectives of this 

study were to investigate the evolution of resistance to ACCase inhibitors in L. rigidum, P. 

brachystachys, and A. sterilis as well as to confirm the resistance to isoproturon in A.sterilis 

and to chlorsulfuron in various populations of P. rhoeas. 


Resistant L. rigidum, P. brachystachys, A. sterilis and P. rhoeas seeds were 

collected from winter wheat fields treated repeatedly for more than five consecutive years 

with diclofop-methyl, fenoxaprop-ethyl, isoproturon or chlorsulfuron, whereas the seeds of 

susceptible biotypes were collected from fields that had never been treated with herbicides. 

Pot experiments were conducted outdoors and commercial formulations of the herbicides 

were applied post-emergence at the 3-4 leaf stage. Plant growth was evaluated by 

determining shoot fresh weight per pot. The ACCase and ALS extraction and their activity 

were assayed using the procedures described by Tal et al., (1996) and Ray, (1984). 


Repeated use of chlorsulfuron, diclofop-methyl, fenoxaprop-ethyl and isoproturon 

for more than five consecutive years in wheat monoculture, combined with reduced or no 

tillage and limited herbicide rotation resulted in a shift in the structure of the weed 

population. Heavy infestation with L. rigidum, P. brachystachys, A. sterilis or P. rhoeas, 

which were poorly controlled by the above mentioned herbicides, was evident. At present, 

considerable research efforts are devoted to confirm the evolution of herbicide resistance in 

these weed populations and to elucidate the mechanisms of resistance as well as to develop 

suitable weed management systems to overcome their detrimental effect. Dose response 

curves have shown that diclofop-resistant (R) L. rigidum biotype from Athos, North Greece 

tolerates not only high rates of AOPP and CHD herbicides (Table1), but also higher rates of 

chlorsulfuron than the S biotype from Korinos. According to our previous study, we have 

shown that the resistance of this biotype (R) to AOPP and CHD herbicides, is based on a 

less sensitive ACCase (Kotoula-Syka et al., 2002). 

Table 1. Response of resistant (R) and susceptible (S) Lolium rigidum biotypes to various AOPP and 

CHD herbicides. 

Herbicide Group Biotype ED 50 (g. a.i. ha -1 ) R/S ED 50 

R 

11700.0 

Diclofop 

AOPP 

97.5 

S 

120.0 

R 

360.1 

Clodinafop 

AOPP 

33.9 

S 

10.6 

R 

256.3 

Fluazifop 

AOPP 

6.9 

S 

37.0 

R 

112.3 

Tralkoxydim 

CHD 

6.0 

S 

18.9 

R 

9.2 

Sethoxydim 

CHD 

10.2 

S 

0.9


Pretreatment of Athos R plants with malathion, a known inhibitor of cytochrome P- 

450 mono-oxygenases, increased their sensitivity to chlorsulfuron whereas the response of 

the S plants did not change, indicating that this resistance is based on enhanced 

detoxification of the herbicide (Table 2). (Kotoula - Syka et al., 2002). 

Table 2. Response of resistant (R) and sensitive (S) Lolium rigidum biotypes to chlorsulfuron 

applied following pretreatment with different rates of malathion. 

Malathion (g.a.i.ha -1 ) Chlorsulfuron ED 50 (g.a.i. ha -1 ) 

0.0 

62.5 

250.0 

1000.0 

R 

155.2 

175.7 

90.3 

14.8 

S 

3.0 

2.4 

1.3 

1.0 

Eight biotypes of P. brachystachys from North and Central Greece, were examined 

for resistance to ACCase inhibitors namely fenoxaprop-ethyl, tralkoxydim and clodinafoppropargyl. 

Seven of them indicated differential resistance to fenoxaprop-ethyl and only one 

was susceptible. In contrast all eight biotypes were susceptible to tralkoxydim and 

clodinafop-propargyl (research in progress). Continuous application of isoproturon in wheat 

monoculture resulted in a heavy infestation with A. sterilis that was no longer controlled by 

the recommended rates of this herbicide. Pot experiments indicated that this population 

tolerates higher rates of isoproturon as compared to the population collected from Thermi 

(never treated with herbicides). Both biotypes were susceptible to ACCase inhibitors used 

(Table 3). 

Table 3. Response of resistant (R) and susceptible (S) Avena sterilis biotypes to isoproturon and 

to various AOPP and CHD herbicides. 

Herbicide Group Biotype ED 50 (g.a.i.ha -1 ) R/S 

R 

6420 

Isoproturon 

2.6 

S 

3504 

R 

564 

Diclofop 

AOPP 

1.3 

S 

441 

R 

55 

Fenoxaprop 

AOPP 

1.2 

S 

46 

R 

63 

Clodinafop 

AOPP 

2.0 

S 

31 

R 

161 

Fluazifop 

AOPP 

1.8 

S 

89 

R 

85 

Haloxyfop 

AOPP 

1.5 

S 

56 

R 

202 

Tralkoxydim 

CHD 

1.1 

S 

180 

R 

175 

Sethoxydim 

CHD 

1.3 

S 

137

160 Herbicide – resistant weeds in cereal crops in Greece 

P. rhoeas population from Bafra (North Greece) was found to be highly resistant to 

chlorsulfuron. This R biotype tolerates also higher rates of tribenuron, triasulfuron and 

thifensulfuron than the wild type population (S) from Thermi. The response of R plants to 

imidazolinone herbicides was different. Both R and S biotypes were almost similarly 

susceptible to imazamox and both quite tolerant to imazapic, but R plants were clearly 

cross-resistant to imazethapyr (Kotoula-Syka et al., 2000).There are several non-ALS 

herbicides recommended for the control of P. rhoeas in winter cereals. Two such herbicides 

used in this study were bromoxynil that was applied alone and 2,4-D applied in mixture 

with metosulam, a triazolopyriminide herbicide. No resistance to these products was 

observed in both populations and complete control of both biotypes was achieved at rates 

below the recommended field rates (Table 4). In vitro studies have shown the ALS isolated 

from the R P. rhoeas biotype, was much less sensitive to inhibition by chlorsulfuron and 

sulfometuron than the S biotype, indicating an altered target site (Kotoula-Syka et al., 

2000). 

Table 4. ED 50 (herbicide rate causing 50% reduction of shoot fresh weight) of resistant (R) and 

susceptible (S) Papaver rhoeas biotypes. 

ED 50 (g ai ha -1 ) 

Herbicide R S R/S 

Chlorsulfuron 50.6 0.3 148.9 

Thifensulfuron >>160.0 0.4 >>400.0 

Thiasulfuron 35.6 0.4 98.8 

Tribenuron 67.0 0.5 148.8 

Imazamox 13.4 11.1 1.2 

Imazapic 184.5 94.5 2.0 

Imazethapyr 9.2 1.0 9.2 

Metosulam (+ 2,4 D) 0.4 0.3 1.2 

Bromoxynil 500.0 400.0 1.2 

CONCLUSIONS 

Practically, the selective control of multiple-resistant L. rigidum population in cereal 

crops with ACCase and ALS inhibitors is a difficult task due to the unpredicted and 

inconsistent cross-and multiple-resistance pattern found among populations. Clearly, 

integrated strategies based on crop rotation, judicious choice of herbicides and cultural 

weed control practices, are required. However, control of the herbicide-resistant 

populations of P. rhoeas and P. brachystachys is still possible as control can be achieved by 

alternative selective herbicides. Similarly, isoproturon-resistant A. sterilis could be 

effectively controlled by all ACCase inhibitors. In spite of the above, in order to reduce the 

risk of a widely-spread herbicide-resistance, the complete dependence on chemical control 

should be ceased and alternative weed management should be developed.


REFERENCES 

Kotoula-Syka E., Tal A., Rubin B. (2000): Diclofop-resistant Lolium rigidum from northern 

Greece with cross-resistance to ACCase inhibitors and multiple resistance to 

chlorsulfuron. Pest Management Science, 56: 1054-1058. 

Kotoula-Syka E., Sibony M., Georgoulas I., Rubin B. (2000). Proc. XI th International 

Conference on Weed Biology, Dijon, France, pp. 499-506. 

Kotoula-Syka E., (2002). Proc. 12 th EWRS Symposium, Wageningen, The Netherlands, pp.132- 

133. 

Kotoula-Syka E. (2003). Evolution, distribution and mechanisms of herbicide-resistant weeds in 

cereal crops in Greece. Proc. 7 th EWRS Mediterranean Symposium, Adana, Turkey, pp 

149-150. 

Ray T.B. (1984). Site of action of chlorsulfuron: inhibition of valine and isoleucine biosynthesis 

in plants. Plant Physiology, 75:827-831. 

Tal A., Zarka S., Rubin B. (1996). Fenoxaprop-P resistance in Phalaris minor conferred by an 

insensitive acetyl-coenzyme A carboxylase. Pesticide Biochemistry and Physiology, 56: 

134-140.

162 Effectiveness and selectivity of herbicides in lentils 

International Symposium: Current Trends in Plant Protection UDK: 635.658-295.4.024(495) 

Proceedings 

EFFECTIVENESS AND SELECTIVITY OF HERBICIDES IN 

LENTILS 

SPYROS SOUIPAS AND PETROS LOLAS 

Weed Science Lab, School of Agriculture, Crop Production, and Rural Environment, University 

of Thessaly, Volos, GR-384 46, Greece, 

lolaspet@agr.uth.gr 

Lentils (Lens culinaris Medik.) are an economic crop in four main agricultural regions in 

Central and Northern Greece. Weeds are a major problem in lentil production in Greece, 

significantly reducing crop yield if not controlled. Mechanical or cultural weeding is not possible in 

lentils because of the close sowing space. Economic and effective control of weeds in lentils is 

possible only chemically. However, only one herbicide is registered so far for broadleaf weed 

control in Greece Nine herbicides, ethalfluralin as a pre plant soil incorporated (PPI) and 

pendimethalin, oxadiazon, promyzamide, terbuthylazine, metribuzin, prometryn, linuron, 

dimethenamid as pre emergence (PRE) were used in a randomized complete block design (RCB) 

with three replications per treatment Plot size was 6 m2, and had 5 rows. Plant spacing was 40 X 3 

cm between the rows and on the row, respectively.. Data were obtained for germination percentage, 

weed control, lentil plant height, and dry weight per plant. Germination percentage in plots treated 

with herbicides was similar to that of the untreated control. Weed control was very good in all 

herbicide treatments and ranged from 85% (propyzamide) to 98% (ethalfluralin, linuron, 

terbuthylazine), to 100% (metribuzin). Plant height was significantly lower at 35 but not at 65 days 

after germination (DAS) and dry weight at 45 but not at 65 DAS only in plots treated with 

ethalfluralin. 

Key words: Lentils, weed control, herbicides 

INTRODUCTION 

Lentil is an important grain legume all over the world. Lentils were one of the first 

crops domesticated and used by man since the ancient times (www.wikipedia.org). In 

Greece lentils are known and used as a high nutritional value crop for more than 2.500 

years, until late 1960 (Iliadis, 2005). Production declined in the period 1970 to 2005, when 

a number of farmers started again production of lentil looking for economic crops in the 

frame of the new CAP. Today lentils are an important crop in four main agricultural regions 

in Central and Northern Greece and its cultivated area increases the last three years 

(www.minagric.gr). One of the major problems lentil farmers face in Greece is the 

difficulty in controlling weeds mechanically or culturally, mainly due the close sowing 

space and the cost of hand labor (Papakosta-Tasopoulou, 2007). Weed control in lentils is 

crucial because lentils are a relatively non competitive crop due to its slow establishment 

and limited vegetative growth. Halila (1995) reported a mean loss of 60% in lentil yield by

Spyros Soupas and Petros Lolas 163 

weeds and at the highest weed density yield loss reached 100%. Economic and effective 

control of weeds in lentils is only possible chemically by herbicides as almost in all crops 

(Basler, 1981; Lolas, 2007). However, there are no registered herbicides to control 

broadleaf weeds in lentils in Greece, except propyzamide (Lolas, 2007; www.minagric.gr). 

It is obvious that the only one registered herbicide does not control all different weeds 

present in the lentil fields. Therefore, there is a need for new effective and selective 

herbicides that can be used by lentil growers .The objective of this research was to evaluate 

the effectiveness against weeds and the selectivity to lentils of nine herbicides. 


The experiment was carried out at the University Experimental Farm in Velestino, 

Thessaly, Greece in 2012. The experimental design used was a RCB with three replications 

per treatment. The 10 treatments were nine herbicides and an uncultivated control. Of the 

nine herbicides tested, one, ethalfluralin at 1 kg a.i./ha was applied as PPI, and eight 

(pendimethalin-at 1 kg a.i./ha , oxadiazon-0,88 kg a.i./ha, promyzamide- 1,25 kg a.i./ha, 

terbuthylazine-0,75 kg a.i./ha, metribuzin-0,21 kg a.i./ha, prometryn-1,25 kg a.i./ha, 

linuron-1,25 kg a.i./ha, dimethanamid-0,90 kg a.i./ha) as PRE. The PPI herbicide was 

applied on 15 March 2012, whereas the PRE herbicides were applied on 19 March 2012 

after the sowing of lentil on 16 March 2012. Herbicide application was followed by a light 

irrigation of 5 mm. The experimental plot was 3X2 m, with 5 rows, spaced 40 cm apart and 

plants on the row3 cm apart. The small seed variety Samos was used. Data were obtained 

for germination percentage 18 days after sowing (DAS), for weed control at 35 DAS, for 

herbicide selectivity on lentils as plant height at 35, 65 DAS and dry weight at 45, 65 DAS 

(10 plants per plot in the middle row). Weed density was 54 weeds/m 2 . Main weeds were 

Chenopodium album (50%), Papaver roeas (32%), Scandix pecten veneris (9%), Avena 

spp. (4%), Anthemis arvensis (4%). Data were analyzed by PC ANOVA software and the 

LSD 0,05 was used for mean separation. 


Weed control was very good, above 85% by all herbicide treatments. The highest 

weed control (100%) was observed in plots that were treated with metribuzin and the 

lowest (85%) in propyzamide plots, statistically different from the other herbicides. Where 

ethalfluralin, linuron, or terbuthylazine were applied weed control was 98%. In plots treated 

with pendimethalin, prometryn, oxadiazon, or dimethenamid, weed control was 95, 92, 90 

and 90%, respectively (Table 1). 

The results in Table 1 show that lentil germination in plots treated with herbicides 

was very good, similar to that found in control plots. Dimethenamid and oxadiazon gave 

97, and 92% germination respectively but no significant difference was found in any 

herbicide treatment .

164 Effectiveness and selectivity of herbicides in lentils 

Table 1. Weed control and germination percentage in lentil as affected by nine herbicides. 

Herbicide 

Rate, Application Weed control 

kg a.i./ha time 

% 

Germination% 

Pendimethalin 1,00 PRE 95 109 

Oxadiazon 0,88 PRE 90 92 

Propyzamide 1,25 PRE 85 103 

Terbuthylazine 0,75 PRE 98 109 

Metribuzin 0,21 PRE 100 101 

Prometryn 1,25 PRE 92 101 

Ethalfluralin 1,00 PPI 98 100 

Linuron 1,25 PRE 98 108 

Dimethenamid 0,90 PRE 90 97 

Control - - 20 100 

LSD 0,05 10 NS 

All nine herbicides studied were selective to lentil as indicated by the lentil 

agronomic data in Table 2. 

Table 2. Some lentil agronomic data as affected by nine herbicides 

Herbicide 

Lentil height, Lentil dry weight, 

Rate, Application 

cm 

mg 

kg a.i./ha time 

35 DAS 65 DAS 45 DAS 65 DAS 

Pendimethalin 1,00 PRE 16,6 40,2 1513 4236 

Oxadiazon 0,88 PRE 15,7 41,1 1313 4820 

Propyzamide 1,25 PRE 16,8 40,1 1340 3607 

Terbuthylazine 0,75 PRE 16,4 39,4 1367 4080 

Metribuzin 0,21 PRE 17,8 40,6 1400 4253 

Prometryn 1,25 PRE 16,9 39,0 1473 4693 

Ethalfluralin 1,00 PPI 12,5 41,6 1080 5053 

Linuron 1,25 PRE 17,1 39,3 1467 4360 

Dimethenamid 0,90 PRE 16,4 40,2 1467 4010 

Control - - 16,7 39,4 1266 3426 

LSD 0,05 3,4 NS 189 381 

Lentil plant height at 35 DAS was significantly lower compared to control (16,7 cm) 

only in ethalfluralin (12,5 cm) plots. In all other herbicide treated plots lentil plant height at 

35 DAS was not significantly affected compared to control. At 65 DAS lentil plant height 

in herbicide treated plots although higher was not significantly different compared to 

control plots (Table 2). Lentil plant dry weight was significantly lower compared to control 

(1266 mg) only in ethalfluralin plots (1080 mg) at 45 but not at 65 DAS (Table 2). At 45 

DAS lentil plant weight was significantly lower (1266 mg) in control plots compared to 

pendimethalin (1513 mg), to prometryn (1473 mg), and to linuron and dimethenamid (1467 

mg). At 65 DAS lentil plant dry weight in herbicides treated plots, except propyzamide 

(3607) was significantly higher compared to that of the control (3426 mg) as shown in 

Table 2. Phytotoxicity symptoms as leaf discoloration for about 20 DAS were observed 

only where oxadiazon was used.

Spyros Soupas and Petros Lolas 165 

All nine herbicides controlled weeds effectively, above 85% and up to 100% 

depending on the herbicide. It is important to note that the eight herbicides not yet 

registered for use in lentils in Greece, gave better weed control (90 to 100%) than 

promyzamide (85%) the currently registered herbicide for use in lentils in Greece. Of the 

herbicides used, only oxadiazon and ethalfluralin showed temporary phytotoxicity. In 

oxadiazon plots germination percentage was 92% as compared to that of the control and 

some leaves in some plants were chlorotic for about the first 20 days after germination but 

plant height or dry weight were not affected when measured at 35 and 45 DAS respectively, 

or at 65 DAS. Where ethalfluralin was used plant height was significantly lower compared 

to the control at 35 DAS but not at 65 DAS and plant dry weight at 45 but not at 65DAS. 

The results of this study showed that the herbicides ethalfluralin as PPI and pendimethalin, 

oxadiazon, terbuthylazine, metribuzin, prometryn, linuron, or dimethenamid as PRE are 

effective for weed control and selective in lentils and can be used by the lentil growers in 

the future. 

REFERENCES 

Basler F. (1981). Weeds and their control. In Webb C., and Hartin G (eds). Lentils, pp. 143- 

153, CAB International, U.K. 

Halila, M.H. (1995). Status and potential of winter-sowing of lentil in Tunisia. In: Proceedings 

of the Workshop on “Towards Improved Winter-Sown Lentil Production for the West 

Asian and North African Highlands “ 1994; Antalya, Turkey, 172-183. 

Iliadis C. (2005). Influence of genotype and soil type on cooking time of lentil (Lens culinaris 

Medik.). Intern. J. Food Sci. Technol. 38:89-93 

Lolas P. (2007). Weed Science: Weeds, Herbicides (in Greek). ed. Syghroni Paideia, 

Tessaloniki, 2 nd ed., pp. 608 

Papakosta-Tasopoulou D. (2007). Leguminous crops (in Greek). Ed. Syghroni Paideia, 

Tessaloniki, pp 358 

www.wikipedia.org 

www.minagric.gr

166 Germination of two-year-old seeds... 

International Symposium: Current Trends in Plant Protection UDK: 632.51:631.547.1(497.11) 

Proceedings 

GERMINATION OF TWO-YEAR-OLD SEEDS OF SINAPIS 

ARVENSIS AND PAPAVER RHOEAS ORIGINATING FROM A 

ZEMUN POLJE SITE 

VLADAN JOVANOVIĆ 1 , VASKRSIJA JANJIĆ 1 , BOGDAN NIKOLIĆ 2 

1 Institute of Pesticides and Environmental Protection, Banatska 31b, 11000 Belgrade, Serbia 

2 Institute for Plant Protection and Environment, Teodora Drajzera 9, 11000 Belgrade, Serbia 

Vladan.Jovanovic@pesting.org.rs 

Wild mustard (Sinapis arvensis L.) and corn poppy (Papaver rhoeas L.) are relatively 

common weed species in Serbian fields. The present study focused on examining the interaction of 

light effect and duration of stratification (4 ± 1 °C) on the germination of two-year-old seeds collected 

from a site at Zemun Polje, Belgrade. The seeds were germinated at an alternating temperature of 30 

°C for 14 h and 20 °C for 10 h and were illuminated during the longer period. Stratification duration 

had no statistically significant effect on the percentage of germinated wild Sinapis arvensis, but it had 

a stimulating effect on germination speed. A reverse situation was observed with Papaver rhoeas, the 

duration of stratification had a negative effect on total germination but no effect on gemination speed. 

Light had no effect on the germination of either species. 

Keywords: stratification duration, light effect, cumulative germination, germination dynamic 

INTRODUCTION 

Germination is a crucial process in the life cycle of a plant because the time of 

germination determines the environment in which that plant will develop, and eventually 

the plant’s fitness. The time of germination can determine when reproduction and fruit 

ripening will occur (Stratton, 1992). 

Sinapis arvensis has a competitive potential against main crops, such as wheat, 

barley, and canola (Oveisi et al., 2008). Sporadic germination even under optimal 

conditions is an important feature of Sinapis arvensis seeds, which ensures that many years 

will elapse before all seeds present in a soil have germinated. Buried, undisturbed Sinapis 

arvensis seeds have been described in a study as persistent in soil, having a half-life of 3 

years in England (Edwards, 1980). In another study, 86% of undisturbed buried seeds 

survived after 3 years and 17% survived after 14 years of burial (Kolk, 1962), but shallow 

buried seeds were less persistent than more deeply buried ones. Sinapis arvensis seeds that 

had been kept with seeds of other plant species in hermetically sealed steel containers for 

100 years were still able to germinate (Steiner and Ruckenbauer, 1995). Matured seeds are 

dormant and ready to germinate only at a very low percentage, no more than 1-2%. After 

winter stratification, their germination capacity increases up to 75%. In the laboratory,

Vladan Jovanović, Vaskrsija Janjić, Bogdan Nikolić 167 

seeds kept at room temperature have demonstrated a germinability that was slowly rising 

over a period of several years (Fogg, 1950). 

In a study by Fogg (1950), the optimum temperature for germination of Sinapis 

arvensis was 21 °C, both in the laboratory and in the field, while germination was found to 

be low at temperatures below 11 and above 30 °C. Temperature variation, primarily 

towards lower ones of up to 5 °C stimulated germination. In another study, the final 

cumulative germination percentage of Sinapis arvensis ranged from 93-96% at day/night 

temperatures of 22/14°C and a 14 h photoperiod (Oveisi et al., 2008). 

Seeds of Papaver rhoeas L. are dormant at maturity, and dormancy is not easily 

broken (McNaughton and Harper, 1964). They are small-sized and consequently tend to get 

buried deeper into the soil, which delays their germination. As a consequence, they often 

make large contribution to a seed bank without being observed in the extant vegetation 

(Luzuriaga et al., 2005). They are able to survive at least five years in soil (Barralis et al., 

1988). The minimum temperature for Papaver rhoeas germination is 2 °C, maximum 35 

°C, while optimum is in the range of 7-13 °C (Lauer, 1953, cited by Buhler and Hoffman, 

1999). Germination was found to be satisfactory at constant temperatures from 2 to 25 °C, 

and at alternating temperatures of 5/15, 10/18 and 10/25 °C. Germination of seeds stored 

dry in the laboratory was 56% after one, 79% after five and 3% after 10 years (Kjaer, 1940, 

1948, cited by Buhler and Hoffman, 1999). Seeds that failed to germinate before treatment 

germinated at 75% over a period of three months at 5 °C (Grime et al., 1981). 

Many seed characteristics are determined both by seed genotype and parental 

environment. Parental environment can influence the proportion of seeds entering 

dormancy and becoming a part of the seedbank (Munir et al., 2001), as well as the 

frequency distribution of seed weights produced by a plant (Sultan, 1996) and seed 

germinability (Paolini et al., 1999). The present study examined the interaction of light 

effect and duration of stratification on the germination of two-year-old seeds of wild 

mustard (Sinapis arvensis L.) and corn poppy (Papaver rhoeas L.), both collected from a 

site at Zemun Polje. 


Seeds were collected at Zemun Polje, Belgrade, in May and June 2010. Seeds were 

kept at room temperature until the experiment began. 

Batches of 50 seeds were placed into 6 cm petri dishes containing 2 ml of distilled 

water. Three petri dishes were used to test each experimental treatment. 

The seeds were stratified for one or four weeks at 4±1 °C. 

The seeds were germinated at an alternating temperature of 30 °C for 14 h and 20 °C 

for 10 h, and were illuminated with white neon light during the longer interval. The 

illuminated seeds were kept in the same growth chamber with those germinating in the 

dark. The latter were in petri dishes covered with tin foil over the initial 7-8 days after 

stratification, and the foil was then removed. The illuminated seeds that germinated were 

counted and removed daily or every other day. Seed counting was terminated three weeks 

after stratification.


RESULTS 

Germination of Sinapis arvensis seeds at the alternating temperature of 30/20 °C 

with daily illumination periods of 14 h at the higher temperature was not significantly 

affected by the duration of stratification (Figure 1). Unstratified seeds germinating in the 

dark showed the lowest percentage of germination. It was the only group of seeds for which 

a statistically significant difference was detected in germination, compared to seeds 

stratified for four weeks and illuminated, and seeds stratified for a week and germinating in 

the dark. Light was not found to influence the percentage of germinating seeds. Seeds 

stratified for one week reached a germination plateau after the first day of germination, 

while unstratified seeds reached it after two days of germination. 

Seed germination, % 

50 

40 

30 

20 

10 

Sa0S 

Sa0M 

Sa1S 

Sa1M 

Sa4S 

Sa4M 

0 

0 4 8 12 16 20 

Time, days 

Figure 1. Germination of wild mustard (Sinapis arvensis) seeds in light and in the dark, at 

alternating temperature of 30 °C for 14 h and 20 °C for 10 h and were illuminated during the 

longer period following one and four weeks of stratification (4±1 °C) or without stratification. 

Sa0S – unstratified seeds germinating in light from the beginning; Sa0M – unstratified 

seeds germinating in the dark during the initial 8 days, then in light; Sa1S – seeds stratified 

for one week, germinating in light from the beginning; Sa1M – seeds stratified for one 

week, germinating in the dark during the initial 8 days, then in light; Sa4S – seeds stratified 

for four weeks, germinating in light from the beginning; Sa4M – seeds stratified for four 

weeks, germinating in the darks during the initial 7 days, then in light. 

The duration of stratification had a negative effect on the germination of Papaver 

rhoeas seeds under the experimental conditions. Even though no significant difference was 

detected between the germination of unstratified seeds and those stratified for one week, the 

fact that stratified seeds germinated at a lower percentage is interesting. The low percentage 

of germinated seeds stratified for four weeks was statistically different, compared to both 

former groups. Light was not found to have any effect on germination. Germination of 

unstratified seeds and of those stratified for a week increased abruptly the third and fourth


day of germination, and almost stopped after that. A similar dynamic could not be detected 

in seeds stratified for four weeks because of their very low germination percentage. 

Seed germination, % 

50 

40 

30 

20 

10 

Pr0S 

Pr0M 

Pr1S 

Pr1M 

Pr4S 

Pr4M 

0 

0 4 8 12 16 20 

Time, days 

Figure 2. Germination of corn poppy (Papaver rhoeas) seeds in light and in the dark, at 

alternating temperature of 30 °C for 14 h and 20 °C for 10 h and were illuminated during the 

longer period following one and four weeks of stratification (4±1 °C) or without stratification. 

Pr0S – unstratified seeds germinating in light from the beginning; Pr0M – unstratified seeds 

germinating in the dark during the initial 8 days, then in light; Pr1S – seeds stratified for 

one week, germinating in light from the beginning; Pr1M – seeds stratified for one week, 

germinating in the dark during the initial 8 days, then in light; Pr4S – seeds stratified for 

four weeks, germinating in light from the beginning; Pr4M – seeds stratified for four 

weeks, germinating in the dark during the initial 7 days, then in light. 

DISCUSSION 

The germination of Sinapis arvensis seeds in our study, i.e. at the alternating 

temperature of 30/20 °C and 14 h photoperiod with the higher temperature coinciding with 

light treatment, was not found to depend on the duration of stratification (one or four 

weeks), having reached between 6% and 20% over the 21-day period of germination. 

Germination of Sinapis arvensis seeds under relatively similar conditions in another study, 

i.e. at a constant temperature of 25 °C and a daily illumination period of 16 h, ranged from 

0% to 10% (Luzuriaga et al., 2006). Similar data have been reported from other studies as 

well (Andersson and Milberg, 1998). 

Kolk (1947), cited by Fogg (1950) reported that Sinapis arvensis seeds germinated 

best under weak light or in the dark. It was probably the rather low germination percentage 

in our experiment that prevented us from observing a significant statistical difference 

between germination in the dark and under illumination. 

Germination timing has a crucial contribution to life-history traits and reproduction 

of a plant and eventually on the establishment of competitive hierarchies in the plant


community (Donohue, 2002). In our experiment, the illuminated seeds of Sinapis arvensis 

that were stratified for one week reached a germination plateau already after the first day of 

germination, while unstratified seeds reached it after two days. Evidently, low temperature 

enhances the germination process of Sinapis arvensis seeds, a fact which may be important 

for germination of the surviving seeds after the winter period. 

Two-year-old seeds of Papaver rhoeas germinated in our experiment at a rate of 

over 20%, both under light and in the dark (Figure 2). Baskin et al. (2002) reported a lower 

germination percentage of younger seeds used in their study. After 12 weeks of dry storage 

at room temperature, Papaver rhoeas seeds germinated 3%, 6% and 6% at 15/5 °C, 20/10 

°C and 25/15 °C, respectively, in light, and 1%, 3% and 0%, respectively, in the dark. The 

percentage of germinating seeds of Papaver rhoeas has been known to rise for some time 

during dry storage (Kjaer, 1940, 1948, cited by Buhler and Hoffman, 1999). In our 

experiment, stratification for four weeks at 4±1 °C resulted in a statistically significant 

decrease in seed germination below 6%. In a study by McNaughton and Harper (1964), 

germination of Papaver rhoeas seeds at 20 °C after stratification for merely two days at 5 

°C increased from 58% to 78%. One-week stratification at -10, -5, 0, 5 and 10 °C had no 

effect at all. Baskin et al. (2002) found that Papaver rhoeas seeds have non-deep simple 

morphophysiological dormancy. After a 12-week period of burial in soil at 25/15 °C, seeds 

germinated up to 100% in light, demonstrating that cold stratification temperatures (0.5-10 

°C) are not required for embryo growth. During exposure to low winter temperatures 

(November and March, 5/1 °C; December, January and February, 1 °C), 52% of the seeds 

with physiologically non-dormant embryos entered conditional dormancy and thus lost the 

ability to germinate at 25/15 °C but not at 15/5 °C or 20/10 °C. If seeds of Papaver rhoeas 

come out of physiological dormancy during summer/autumn, but fail to germinate in the 

autumn, low temperatures during winter cause them to enter conditional dormancy (Baskin 

and Baskin, 1985). 

Baskin et al. (2002) reported that after physiological dormancy was broken, Papaver 

rhoeas seeds required light for embryo growth (i.e. for loss of morphological dormancy) 

and consequently for germination. However, unless seeds have come out of physiological 

dormancy, light has no promotive effect on embryo growth and germination. As light had 

no effect on the germination of P.rhoeas seeds in our experiment, morphological dormancy 

was presumably partially lost after two years of storage, even in dry conditions, so that 

germination exceeded 20%. Stratification caused the seeds to enter a conditional dormancy. 


The present study was part of Projects ТR 31043 and ТR 31037 financed by the 

Ministry of Education and Science of the Republic of Serbia. 

REFERENCES 

Andersson, L., Milberg, P. (1998): Variation in seed dormancy among mother plants, 

populations and years of seed collection. Seed Science Research, 8: 29 – 38. 

Barralis, G., Chadoeuf, R., Lonchamp, J. P. (1988): Longevity of annual weed seeds in 

cultivated soil. Weed Research, 28: 407 – 418. 

Baskin; J. M., Baskin, C. C. (1985): The annual dormancy cycle in buried weed seeds: a 

continuum. BioScience, 35: 492 – 498.


Baskin, C. C., Milberg, P., Andersson, L., Baskin, J. M. (2002): Non-deep simple 

morphophysiological dormancy in seeds of the weedy facultative winter annual Papaver 

rhoeas. Weed Research, 42: 194 – 202. 

Buhler, D. D., Hoffman, M. L. (1999): Andersen’s Guide to Practical Methods of Propagating 

Weeds and Other Plants. Weed Science Society of America, Lawrence, Kansas, pp. 90. 

Donohue, K. (2002): Germination timing influences natural selection on life-history characters 

in Arabidopsis thaliana. Ecology, 83: 1006–1016. 

Edwards, M. M. (1980): Aspects of the population ecology of charlock. J. Appl. Ecol., 17: 151 - 

171. 

Fogg, G. E. (1950): Biological flora of the British Isles, Sinapis arvensis L. (Brassica sinapis 

Vis. nec Noul., B. arvensis (L.) Kuntze, non L.). Journal of Ecology, 38: 415 – 429. 

Grime, J. P., Mason, G., Curtis, A. V., Rodman, J., Band, S. R., Mowforth, M. A. G., Neal, A. 

M., Shaw, S. (1981): A comparative study of germination characteristics in a local flora. 

Journal of Ecology, 69: 1017 – 1059. 

Kolk, H. (1962): Viability and dormancy of dry stored weed seed. Vaxtodling, 18: 1 - 192. 

Luzuriaga, A. L., Escudero, A., Olano, J. M., Loidi, J. (2005): Regenerative role of seed banks 

following an intense soil disturbance. Acta Oecologica, 27: 57 – 66. 

Luzuriaga, A. L., Escudero, A., Pérez-García, F. (2006): Environmental maternal effects on seed 

morphology and germination in Sinapis arvensis (Cruciferae). Weed Research, 46: 163 – 

174. 

McNaughton, I. H., Harper, J. L. (1964): Papaver L. Journal of Ecology, 52, 3: 767 – 793. 

Munir, J., Dorn, L. A., Donohue, K., Schmitt, J. (2001): The effect of maternal photoperiod on 

seasonal dormancy in Arabidopsis thaliana (Brassicaceae). American Journal of Botany, 

88: 1240 – 1249. 

Oveisi, M., Mashhadi, H. R., Baghestani, M. A., Alizadeh, H. M., Badri, S. (2008): Assessment 

of the allelopathic potential of 17 Iranian barley cultivars in different development stages 

and their variations over 60 years of selection. Weed Biology and Management, 8: 225 – 

232. 

Paolini, R., Principi, M., Froud-Williams, R. J., Del Plugia, S., Biancardi, E. (1999): 

Competition between sugarbeet and Sinapis arvensis and Chenopodium album, as 

affected by timing of nitrogen fertilization. Weed Research, 39: 425 – 440. 

Steiner, A. M., Ruckenbauer, P. (1995): Germination of 110-year-old cereal and weed seeds, the 

Vienne sample of 1877. Verification of effective ultra-dry storage at ambient 

temperature. Seed Science Research, 5: 195 - 199. 

Stratton, D. A. (1992): Life-cycle components of selection in Erigeron annuus: I. Phenotypic 

selection. Evolution, 46: 92 – 106. 

Sultan, S. E. (1996): Phenotypic plasticity for offspring traits in Polygonum persicaria. Ecology, 

77: 1791 – 1807.

172 Effect of some herbicides (antrazine and nicosulfuron),... 

International Symposium: Current Trends in Plant Protection UDK: 632.95.02:631.46 

Proceedings 

EFFECT OF SOME HERBICIDES (ATRAZINE AND 

NICOSULFURON) ON MICROBIAL NITROGEN AND PHOSPHOR 

BIOMASS IN SOIL 

RADIVOJEVIĆ LJILJANA*, GAŠIĆ SLAVICA, ŠANTRIĆ LJILJANA, GAJIĆ UMILJENDIĆ JELANA, 

BRKIĆ DRAGICA 

Institute of Pesticides and Environmental Protection, 11080 Belgrade-Zemun, Banatska 31b 

*ljiljana.radivojevic @gmail.com 

The impact of the herbicides atrazine and nicosulfuron on microbial biomass was 

investigated. Trails were conducted in laboratory conditions. The rates of application were: 8.0, 40.0 

and 80.0 mg/kg soil for atrazine and 0.3, 1.5 and 3.0 mg/kg soil for nicosulfuron. Microbial biomass 

nitrogen (N) and phosphor (P) were examined. Microbial biomass N were estimated by chloroformfumigation 

extraction method. For determination microbial biomass P method Brooks et al. (1982) 

were used. Samples were collected for analysis 1, 7, 14, 21, 30 and 60 days after herbicides 

application. The data acquired indicated that the effect of atrazine and nicosulfuron on soil microbial 

biomass N and P depended on their application rate and duration of activity, and the effect was either 

stimulating or inhibiting. However, the changes detected were found to be transient, and there is no 

real risk of the compound disrupting the balance of biochemical processes in soil. 

Keywords: atrazine, nicosulfuron, soil, microbial biomass 

INTRODUCTION 

The actual interest in the effects of herbicides on soil microbial biomass is driven by 

the awareness of the importance of soil microorganisms in controlling carbon, nitrogen, 

phosphor and sulfur flows in soil decomposition, mineralization and immobilization 

processes. Exposure to some xenobiotic compounds may force the soil microbial biomass 

to direct a large part of its energy budget maintenance into reducing mineralization activity. 

Such a situation could have long-lasting negative effects on soil fertility (Schloter et al., 

2003; Lupwayi et al., 2007). 

Atrazine, which was first put on the market in 1952, belongs to a group of herbicides 

that are moderately persistent and moderately mobile in soil. Atrazine half-life varies 

between several days and several months (Radosevic et al., 2003). In recent years many 

European countries have been restricted or banned the use of atrazine as a herbicide due to 

its persistence on the environment and its toxicological properties. The influence of s- 

triazines on soil microorganisms has been intensively investigated. Several studies have 

demonstrated that atrzine may influence the population dynamic of certain microbial groups 

(Entry et al., 1995; de Souza et al., 1996; Johensen et al., 2001; Radivojevic et al., 2008).

Radivojević Ljiljana, Gašić Slavica, Šantrić Ljiljana,... 173 

Sulfonylureas are class of herbicides characterized by high biochemical activity at 

low application rate. Sulfonylurea herbicides were introduced in the 1980s and have 

become valuable tools for weed management in agricultural production. Nicosulfuron, a 

member of this class, is a common agricultural herbicide used to control most annual and 

perennial grasses and several broad-leaved weeds in maize. The results some researchers 

suggest that sulfonylurea herbicides can affect ecosystems, although their acute and chronic 

toxicity to animals are considered to be very low. Ismail et al. (1998) reported that 

metsulfuron methyl suppressed soil respiration and microbial biomass at ten-fold field rate, 

although the effects were transient and there were no significant effects at the field rate. 

Perucci and Scarponi (1996) reported the side-effects of rimsulfuron on soil microbial 

biomass in a clay loam soil, where rimsulfuron was applied at potato weed control dose 

(15g/ha) and at a 10-fold rate, under field conditions. Dumontet et al. (1993) reported the 

effects of five sulfonylureas, applied at 10- and 100-times the field dose on the growth and 

respiration of some selected microbial strains. 

The purpose of the present study was to examine how the herbicides atrazine and 

nicosulfuron at normal field concentration, five times and ten times higher concentrations 

affect the soil microbial biomass nitrogen and phosphor. 


Atrazine (6-chloro-N 2 -ethyl-N 4 -isopropyl-1,3,5-triazine-2,4-diamine), tested in the 

experiment, was a technical grade product of Agan Chemical Manufacturers, Ashdod, 

Izrael. The rates of application the herbicide were: 8.0, 40.0 and 80.0 mg/kg soil. 

Nicosulfuron 

(1-(4,6-dimethoxypyrimidin-2-yl)-3-(3-dimethylcarbamoyl-2- 

pyridylsulfonyl)urea) was a technical grade product of BASF Company, Germany. The 

rates of application for the herbicide were: 0.3, 1.5 and 3.0 mg/kg soil. The lowest 

concentrations tested were label rate (8.0 mg/kg for atrazine and 0.3 mg/kg for 

nicosulfuron), and the other two doses were five and ten times higher than recommended 

dose. 

Trails were conducted in laboratory conditions in chernozem soil (pH 7.10, organic matter 

3.32 %, sand 21 %, silt 49 %, clay 30 %) at Zemun Polje, Belgrade. The trial soil had 

never been treated with pesticides before. 

Soil samples were collected from the upper layer (0-10cm), carefully dried, sieved to 

pass 5 mm mesh, and stored at 4°C. The soil was air-dried at room temperature for 24h 

before using. Each herbicide concentration was pipetted to the surface of 1 kg of soil before 

homogenization on a rotary stirrer for 30 minutes. Untreated soil served as a control. The 

experiments were conducted in four replications. Soil humidity was kept at 50% field 

capacity. Samples were collected for analysis 1, 7, 14, 21, 30 and 60 days after herbicides 

application. 

Soil microbial biomass nitrogen were estimated by chloroform-fumigation 

extraction according to Vance et al. (1987). Soil microbial biomass phosphor were 

estimated by method reported by Brooks et al. (1982). 

Statistical data processing was done using the PC Anova software. F-test was 

applied to all variables and their interactions and, in the case of a significant result in 

individual comparisons, the LSD test was applied. Probability levels of 0.05 and 0.01 were 

used as significance criteria.



The effects of atrazine and nicosulfuron on microbial biomass nitrogen and 

phosphor are shown in Graphs 1-4. Acquired datas indicated that the effect of atrazine and 

nicosulfuron on soil microbial biomass N and P depended on their application rate and 

duration of activity, and the effect was either stimulating or inhibiting. 

The results of this experiment with atrazine show a decreased microbial biomass N 

from day the 7 st to the 21 st day. The decrease ranged: 33.6% for 8.0 mg concentration, 19.3- 

33.6% for 40.0 mg and 39.3-48.5% for 80.0 mg and the differences were found significant 

statistically (P


The experimental data are consistent with results reported by other authors on the 

effect of different pesticides on microbial biomass N. Fleibach and Mader (2002) reported 

that herbicides-defoliants glufosinate and dinoterb inhibited microbial biomass N 21 days 

after application. Similar findings were reported by Radivojević et al. (2008, 2012) with 

atrazine, nicosulfuron and microbial biomass carbon, as well as Macalady et al. (1998), 

Ibekwe et al. (2001), Klose and Ajwa (2004) with methyl-bromide. 

In this investigation the highest biomass P (52.4 µg P g -1 soil) was found under 40.0 

mg (21 days after application), and the lowest (14.7 µg P g -1 soil) was under 80.0 mg 

atrazine (7 days after application). Reduced biomass P under all concentrations atrazine was 

recorded only seven days after application (32.3-58.3%). Increase in biomass P was 

recorded under concentration 8.0 (15 th day), 40.0 (21 th day) and 80.0 mg (30 th day). 

However, these effects were transitory, because all the variables tested showed a tendency 

to the controls values (Graph 3). 

Under ours experimental conditions changes in the biomass P content varies 

throughout the experiment and the changes were depended on nicosulfuron rates of 

application and exposure time (Graph 4). Reduced biomass P was recorded under 

concentrations 1.5 (7 th day, 26.9%) and 3.0 mg (7 th day, 37.2%). Increase in biomass P was 

recorded for concentrations 0.3 and 1.5 mg at 15 th and 21 th day. 

60 

µgP g -1 soil 

40 

20 

0 

1 7 15 21 30 60 

Days after application 

0.0 mg 8.0 mg 40.0 mg 80.0 mg 

Graph 3. Microbiological biomass phosphor in the presence of atrazine 

80 

60 

µgP g -1 soil 

40 

20 

0 

1 7 15 21 30 60 

Days after application 

0.0 mg 0.3 mg 1.5 mg 3.0 mg 

Graph 4. Microbiological biomass phosphor in the presence of nicosulfuron


There have been other reports on the activity of different pesticides in relation to 

biomass P. The effects of long-term cumulative field application of pesticides benomyl, 

chlorfenvinphos, aldicarb, triadimefon and glyphosate, on soil microbial biomass were 

investigated. The addition of aldicarb consistently increased the microbial biomass, due to 

its beneficial effect on crop growth, but this effect was not influenced by the rate of 

organic matter mineralization (Garcia-Orenes et al., 2010). Duah-Yentumi and Jonson 

(1986) reported dramatic reduction in soil biomass following vinclosolin application, but 

for the other pesticides as carbofuran, carbosulfan, simazine and paraquat etc. they 

concluded that there were substantially different effects on soil biomass production by 

single or repeated application. It can be concluded that almost every pesticide has different 

impact on microbial biomass as there is no general rule for their behavior. Still, it is very 

important to know the influence as microbial biomass reflects the effects of pesticide 

contaminants on overall microbial population. 

We should note in conclusion that the investigated rates of atrazine and nicosulfuron 

were either recommended or multiplied doses, while the changes observed were temporary 

in character and intensity, which suggests that there is no real risk of causing a disruption of 

the existing balance of soil biochemical processes. 


This study was financially supported by the Serbian Ministry of Education and 

Science under the projects Number. TR31043 and III46008. 

REFERENCES 

Brookes, P.C., Powlson, D.S., Jenkinson, D.S. (1982): Measurement of microbial biomass 

phosphorus in soil. Soil Biology and Bichemistry, 14: 319-329. 

de Souza, M., Sadowsky, M.J., Wackett, L.P. (1996): Atrazine chlorohydrolase from 

Pseudomonas sp. strain ADP: gene sequence, enzyme purification and protein 

characterisation. Journal of Bacteriology, 178: 4894-4900. 

Duah-Yentumi, S., Jonson, D.B. (1986): Changes in soil microflora in response to repeated 

applications of some pesticides. Soil Biology and Biochemistry, 18: 629-635. 

Dumontet, S., Peruuci, P., Scopa, A., Riccardi, A. (1993): Sulfonylureas: preliminary study on 

the effect on selected microbial strains and soil respiration. Soil Science, 1: 193-198. 

Garcia-Orenes, F., Guerrero, C., Roldan, A., Mataix-Solera, J., Cerda, A., Campoy, M., 

Zornoza, R., Barcenas, G., Caravaca, F. (2010): Soil microbial biomass and activity 

under different agricultural management system. Soil and Tillage Research, 109: 110- 

115. 

Entry, J.A., Donnelly, P.K., Emmingham, W.H. (1995): Atrazine and 2,4-D mineralization in 

relation to microbial biomass in soils of yang-, second- and old-growth riparian forests. 

Applied Soil Ecology, 2: 74-84. 

Fleibach, A.S., Mader, P.D. (2002): Microbial biomass in soil as influenced by herbicidesdefoliants 

glufosinate and dinoterb. Soil Biology and Biochemistry, 33: 258-265. 

Johensen, K., Jacobsen C.S. , Torsvik, V. (2001): Pesticide effects on bacterial diversity in 

agricultural soils – a review. Biology and Fertility Soils, 33: 443-453. 

Ibekwe, M.A., Papiernik, K.S., Gan, J., Yates, R.S., Yang, C., Crowley, D.E. (2001): Impact of 

fumigants on soil microbial communities. Applied Environmental Microbiology, 67: 

3245-3257.


Ismail, B. S., Yapp, K. F., Omar, O. (1998): Effects of metsulfuron-metil on amylase, urease and 

protese activities in two soils. Australin Journal of Soil Research, 36: 449-456. 

Klose, S., Ajwa, H. (2004): Enzyme activities in agricultural soils fumigated with methyl 

bromide alternatives. Soil Biology and Biochemistry, 36: 1625-1635. 

Lupwayi, N.Z., Hanson, K.G., Harker, K.N., Clayton, G.W., Blackshaw, R.E., O´Donovan, J.T., 

Jonson, E.N., Gan, Y., Irvine, R.B., Monreal, M.A. (2007): Soil microbial biomass, 

funkcional diversity and enzyme activity in glyphosate-resistant wheat-canola rotations 

under low-disturbance direct seeding and conventional tillage. Soil Biology and 

Biochemistry, 39: 1418-1427. 

Macalady, J.L., Fuller, M.E., Scow, K.M. (1998): Effects of methyl-bromide on soil microbial 

activity and community structure. Journal of Environmental Quality, 27: 54-63. 

Perucci, P., Scarponi, L. (1996): Side effects of rimsulfuron on the microbial biomass of a clayloam 

soil. Journal of Environmental Quality, 25: 610-613. 

Radivojevic, LJ., Gasic, S., Santric, LJ., Stankovic-Kalezic, R. (2008): The impact of atrazine on 

several biochemical properties of chernozem soil. Journal of the Serbian Chemical 

Society, 73:, 951-959. 

Radivojevic, LJ., Gasic, S., Santric, LJ., Gajic Umiljendic, J., Marisavljevic, D (2012): Shorttime 

effects of herbicide nicosulfuron on biochemical activity of chernozem soil. Journal 

of the Serbian Chemical Society, 77: 1-15. 

Radosevich, M., Traina S.J., Hao, Y.L. and Touvinen, O.H. (2003): Degradation and 

mineralisation of atrazine by soil bacterial isolate. Applied Environmental Microbiology, 

61: 1451-1457. 

Schloter, M., Dilly, O., Munch J.C. (2003): Indicators for evaluating soil quality. Agriculture 

Ecosystems and Environment, 98: 255-262. 

Vance, E.D., Brooks, P.C., Jenkinson, D.S. (1987): An extraction method for measuring soil 

microbial biomass. Soil Biology and Biochemistry, 19: 703-707.

178 The sensitivity of maize lines to different herbicides 

International Symposium: Current Trends in Plant Protection UDK: 633.15-295.4.024 

Proceedings 

THE SENSITIVITY OF MAIZE LINES TO DIFFERENT 

HERBICIDES 

BRANKOV MILAN 1 , DRAGIČEVIĆ VESNA 2 , SIMIĆ MILENA 2 , VRBNIČANIN SAVA 3 , 

SPASOJEVIĆ IGOR 2 

1 Scholar of the Ministry of Education and Science of the Republic of Serbia, Slobodana Bajića 

1,11185 Zemun Polje 

2 

Maize Research Institute, Slobodana Bajića 1,11185 Zemun Polje, Belgrade-Zemun, Serbia 

3 Faculty of Agriculture, University of Belgrade, Nemanjina 6,11000, Belgrade, Serbia 

mbrankov@mrizp.rs 

Selectivity of herbicides to crop plants is the basis for their safe use. Maize lines are 

characterized by slow growth and small habitus, what provides larger area for growth of weeds in 

relation to hybrid maize. The technology of seed maize growing involves the use of herbicides, such 

as pre-em and post-em. Generally, the majority of maize lines are more sensitive to herbicides than 

the hybrids, and therefore it is necessary to examine the selectivity of the herbicides. The aim of this 

study was to examine the sensitivity of maize inbred lines to herbicides applied at 5-6 leaf stage of 

maize by measuring of EWRC values, soluble protein content and yield. According to the obtained 

results maize inbred lines showed different sensitivity to the applied herbicides. The content of 

soluble proteins showed what happened in maize plants after 48 h after herbicide treatment. The 

highest EWRC values were recorded after first measuring. Herbicides mezotrione, rimsulfuron and 

foramsulfuron significantly decreased the average yield of maize lines in both years. 

Key words: maize inbred lines, herbicides 

INTRODUCTION 

The technology of maize production involves the use of herbicides, especially in the 

seed crop. Seed maize crop is characterized by slow growth and smaller habit, unlike the 

hybrid crop. Such a spatial arrangement creates a microclimate conditions particularly 

favourable to weed growth. As a consequence, weeds present a problem in maize hybrid 

until the closing of the rows, while in the seed maize weeds are the problem throughout the 

all growing season (Stefanovic et al., 2007). 

On the other hand, many experiments confirmed the different sensitivity of different 

maize genotypes to herbicides. However, the greatest interest is aroused with application of 

herbicides during the growing season. The introduction of sulfonylurea herbicides has led 

to the solution of the problem with narrow-leaved weeds in maize crop, but also created 

many problems after the application (Harms i sar., 1990; Green i Ulrich, 1993). Seed maize 

crop is generally more sensitive to herbicides than hybrids, and using of sulfonylurea could 

lead to high phytotoxicity (Stefanovic et al. 2010). Moreover, herbicides registered for use

Brankov Milan, Dragičević Vesna, Simić Milena,... 179 

in hybrid maize were not registered for use in seed maize, so it is necessary to examine 

susceptibility of maize inbred lines. 

Because of great importance for seed maize, various tests were performed in order to 

obtain results on the selectivity of the herbicides. A simple method for assessing the effects 

of herbicides is a visual observation of plants in relation to the untreated control. Although 

visual evaluation can be subjective, it can integrate all the parameters that the researcher 

deemed relevant (Horowitz, 1976). 

The herbicide effect starts immediately after the absorption, occurring at the cellular 

level. Later, it can be seen the visible changes on plant organs. Each herbicide acts at a 

certain place in the plant cell, called the mode of action. Inhibition of certain reactions in 

the metabolism can lead to cell death and the death of whole plant. By monitoring the 

content of certain compounds affected by the herbicides, directly or indirectly, it is possible 

to explain its fate in the plant. Dragičević et al. (2010) stated that the herbicides, according 

to their mode of action, have different effects on content of soluble proteins, free thiol 

groups, and phenols. 

The aim of trial was to observe the effects of herbicides on five maize lines, parental 

components of commercial ZP hybrids. 


Experiment was set up on slightly calcareous chernozem in the experimental field of 

the Maize Research Institute, “Zemun Polje”, during 2010 and 2011. Wheat was a 

preceding crop in both years. Impacts of four herbicides (mesotrione, topramezone, 

rimsulfuron and foramsulfuron) on five ZP maize lines (L1→L5) were observed in the trail. 

The four-replicate trail was set up according to the split-plot arrangement. The elementary 

plot size was 16.8 m 2 , with the plant density 60,000 plants ha -1 . Maize lines were sown 

manually on April 26 and 27 in both years. All herbicides were applied at recommended 

doses at the 5-6 leaf stage of maize. 

EWRC values were measured: at 21 and 35 days after the herbicide application. 

EWRC is estimated according to EWRC scale (Feldfersuche Manual, 1975). 

Samples for measuring of the soluble protein content were collected 48h after 

herbicide application. Their content was determined after drying at 105 °C (Lowry et al., 

1951). Maize grain yield was measured after harvesting and was calculated at 14% 

moisture. Obtained data were statistically processed by ANOVA and differences between 

means were tested by the least significant difference test (LSD test). Meteorological data 

for two experimental years are presented in Table 1. 

Table 1. Precipitation sum and average air temperatures for the period April-September 2010/11 

Months 

Precipitation (mm) 

Temperatures (°C) 

2010 2011 2010 2011 

April 44.0 14.9 13.2 13.4 

May 64.1 89.6 17.5 16.8 

June 167.3 26.2 21.0 21.5 

July 35.6 44.0 23.2 23.3 

August 68.2 66.0 23.1 23.9 

September 68.0 32.6 17.6 21.6 

Average 447.2 273.3 19.3 20.1



Maize lines showed different sensitivity to the applied herbicides, according to 

obtained EWRC values (Tables 2 and 3). Generally, herbicides mezotrione and 

topramezone caused small damages on all maize lines in the form of bleach sheets. On the 

other hand, sulfonylurea herbicides (rimsulfuron and foramsulfuron) were more aggressive 

in both years, especially on L1 which expressed the severe phytotoxic symptoms, with 

keeping of EWRC values over 4 in 2011 at both evaluations (Table 3). Stefanović et al. 

(2010) also noticed the high maize susceptibility to sulfonilurea herbicides. More intensive 

damages in all maize lines were recorded in 2010 than in 2011. In second year the more 

obvious symptoms of phytotoxicity were recorded in L1, while in other maize lines they 

were not recorded. 

Table 2. EWRC values in 2010. 

Evaluation I 

Evaluation II 

L1 L2 L3 L4 L5 Average L1 L2 L3 L4 L5 Average 

H1 1.5 1.5 1.75 1.25 1.5 1.5 1.5 1.25 1.5 1 1.5 1.35 

H2 1.5 1.5 2 1.25 1.5 1.55 1.5 1.5 1 1 1.5 1.31 

H3 2.5 2 2.25 2.75 2.5 2.4 3 2 2 2 2 2.2 

H4 2.5 2.5 3 3 3 2.8 2 2 2.5 2 2 2.1 

Average 2 1.87 2.25 2.06 2.12 2 1.69 1.75 1.5 1.7 

Table 3. EWRC values in 2011. 

Evaluation I 

Evaluation II 

L1 L2 L3 L4 L5 Average L1 L2 L3 L4 L5 Average 

H1 1 1 1 1 1 1 1 1 1 1 1 1 

H2 1.25 1.25 1 1.25 1 1.15 1 1 1 1 1 1 

H3 3 2 2 2 2.25 2.25 3.25 1 1 1 1 1.45 

H4 4.25 2.25 2.25 2 2 2.55 4.25 1 1 1 1 1.65 

Average 2.37 1.62 1.56 1.56 1.56 2.37 1 1 1 1 

(L1-L5 – maize inbred lines; H1 – control, H2 – mesotrione, H3 – topramezone, 

H4 – rimsulfuron, H5 – foramsulfuron) 

The content of soluble proteins varied among the treatments (Figure 1). In line L5 

was observed the highest values of soluble proteins in control and treatments. The increase 

of soluble proteins, induced by foramsulfuron was observed in all maize lines, compared to 

control. Similar results were obtained by Dragičević et al. (2010), also on maize lines. 

Rimsulfuron (H4), as sulfonylurea herbicide, too, caused the increase of soluble proteins, 

but only in L5. The sulfonilurea herbicides has very specific mode of action, by blocking 

cell division. According to observed results, susceptibility of maize lines to herbicides can 

be explained by increasing trend of soluble protein content (which represents amino acids 

and small-length protein chains), already 48 h after herbicide application. Moreover, the 

increased content of soluble proteins in relation to control is also noticed in L3 in 

topramezone treatments (Figure 1).

Brankov Milan, Dragičević Vesna, Simić Milena,... 181 

Figure 1. The influence of applied herbicides on ZP maize inbred lines (L1-L5), average 

2010/11. 

(L1-L5 – maize inbred lines; H1 – control, H2 – mesotrione, H3 – topramezone, 

H4 – rimsulfuron, H5 – foramsulfuron), ** - p< 0.01; * p -


REFERENCES 

Dragičević, V., Simić, M., Stefanović, L., Sredojević, S. (2010): Possible toxicity and tolerance 

patterns towards post-emergence herbiicdes in maize inbred lines. Fresenius 

Environmental Bulletin Vol. 19, No. 8, 1499-1504. 

Feldfersuche Manual: Ciba-Geigy AD, Basel. Switzerland, 1975. 

Green, J.M., Ulrich, J.F. (1993): Response of Maize (Zea mays) inbreds and hybrids to 

Sulfolylurea Herbicides. Weed Sci., 41, 508-516. 

Harms, C.T., Monitoya, A.L, Privale, L.S., Briggs, R.W. (1990): Genetic and biochemical 

characterization of maize inbred lines tolerant to sulfonylurea herbicides primsulfuron. 

Theor. Appl. Genet., 80: 353-358. 

Horowitz, M. (1976): Application of bioassay techniques to herbicides investigations. Weed 

Research, 16: 209-215 

Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J. (1951): Protein measurement with the 

Folin-Phenol reagent. JBC 193, 265-275. 

Stefanović, L., Simić, M., Dragičević, V. (2010): Studies on maize inbred lines susceptibility to 

herbicides. Genetika, Vol 42, No. 1,146-155. 

Stefanović L., Simić M., Rošulj M., Vidaković M., Vančetović J., Milivojević M., Mišović M., 

Selaković D. (2007): Weed control in maize seed production. Maydica, Vol. 52, No 3, 

277-280.

Konstantinović Branko, Meseldžija Maja, Samardžić Nataša, Blagojević Milan 183 

International Symposium: Current Trends in Plant Protection UDK: 634.8-251(497.113) 

Proceedings 633.15-251(497.113) 

HORIZONTAL SEED DISTRIBUTION IN THE SOIL UNDER VINE 

GRAPE PLANTATION AND MAIZE CROP 

KONSTANTINOVIĆ BRANKO, MESELDŽIJA MAJA, SAMARDŽIĆ NATAŠA, BLAGOJEVIĆ MILAN 

Faculty of Agriculture, Department for Environmental and Plant Protection 

Trg Dositeja Obradovica 8, 21000 Novi Sad 

e-mail: brankok@polj.uns.ac.rs. 

Soil surface contains huge quantity of seeds of various weed species. Study of weed seed 

distribution in the soil allows prediction of seed occurrence, as well in which volume under various 

crops. In such a manner, it is possible to make more efficient and economic plan of measures for their 

control. 

In the period 2011-2012 on the territory of AP Vojvodina, seed bank of perennial vineyard 

plantations in vineyard region of Subotičko-Horgoška Peščara was studied. In the period 2009-2010, 

the identical studies were carried out at locality Despotovo in the annual maize field culture. The 

sampling was performed diagonally in ten replications and with several depths of the arable soil layer, 

i.e. 0-10, 10-20 and 20-30 cm. 

The highest number of weed seeds was found in perennial vine grape plantation at depth of 

10-20 cm at locality Subotica (118503 seeds per m 2 ), followed by depth of 0-10 cm, (14914 seeds per 

m 2 ), lowest number of weed seeds was recorded in the soil layer of 20-30 cm, (13239 seeds per m 2 ). 

In maize crop, the highest number of weed seeds was found at locality Despotovo, in the soil 

depth of 20-30 cm, (4498 seeds per m 2 ), followed by soil depths of 10-20 cm - 3604, and of 20-30 

cm -1431 seeds per m 2 . 

Key words: Horizontal distribution, seed bank, vineyard, maize, number of weeds 

INTRODUCTION 

Type of soil and its cultivation, as well as crop type in great extent has impact on 

quantity of weed seeds in the soil. Soil seed bank represent past, as well as potential future 

of the size of weed plant community about the soil surface (Swanton & Booth, 2004). 

Density of weed seeds and their number depend highly upon soil type, previous crops, soil 

cultivation, and certainly on herbicide application (Konstantinovic et al, 2008). 

Weeds present one of the most significant limiting factors in agricultural production. 

In competition for life space and nutrients (Bhatt and Singh, 2007), they cause reduction in 

crops yield (Sen, 2000; Vasileidiadis, 2007), and presence of weed seeds reduces market 

value of agricultural products (Renton et al., 2006). 

During studies of weed seed bank in the soil it must be taken into consideration that 

it is only part of complex and dynamic system that comprises of soil, plants, animals and 

microorganisms. It is exposed to different influences and changes, therefore, results of its

184 Horizontal seed distribution in the soil under vine grape plantation and maize crop 

studies provide immediate, but not final insight into situation on the terrain (Menalled, 

2008). 

The objective of this study was to determine quantitative and qualitative values of 

weed seed bank in vine grape plantations and maize crops. 


In the period 2009-2010, the studied soils under maize crop were sampled at locality 

Despotovo in AP Vojvodina. The soil of perennial vineyard plantation on the locality 

Subotica was also studied in the period 2010-2011. Samples were taken from different 

layers of the arable soil – (0-10 cm, 10-20 cm and 20-30 cm) (Conn, 1987; Sharatt, 1998). 

In laboratory conditions, the soil samples were sieved through sieves of different diameters 

(the smallest one was 0.25 mm² in diameter), after which separation and determination of 

seeds was done by microscopes, and manuals for identification of weed seeds. (Skender et 

al., 1998; Kronaveter and Boža, 1994). 

RESULTS 

In perennial vineyard plantations the mostly distributed weed seed species were 

Amaranthus retroflexus L., Chenopodium album L., Portulaca oleracea L., Stellaria media 

(L.) Vill. (Graph 1.) 

The mostly distributed weed species in seed bank under studied maize crop were 

Amaranthus retroflexus L., Chenopodium album L., Solanum nigrum L., Euphorbia 

helioscopia L. and Stachys annua L. (Graph 2.) 

In maize crop at locality Despotovo, in the soil layer of 0-10 cm, greater number of 

seeds Chenopodium album L. was determined with 716 seeds per m 2 and Amaranthus 

retroflexus L. with 281 seeds per m² (Graph 2). In the identical layer in the locality 

Subotica in vineyard plantation higher number of seeds of Chenopodium album L. was 

found with 4785 seeds per m 2 and Portulaca oleracea L. with 2951 seeds per m 2 (Graph 1). 

In the soil layer of 20-30 cm, at locality Despotovo, it was found that seeds of 

Chenopodium album L. dominated with 1866 seeds per m 2 and Amaranthus retroflexus L. 

with 613 seeds per m 2 . In the Subotca locality in the same soil in vineyard plantation higher 

number of seeds of Chenopodium album L. was established with 5423 seeds per m 2 and 

Portulaca oleracea L. with 5742 seeds per m 2 . In the soil layer of 20-30 cm, also at locality 

Despotovo, the highest number of seeds of Amaranthus retroflexus L. was 1329 seeds per 

m 2 and Chenopodium album L. 1304 seeds per m 2 . Data obtained from the identical layer in 

the locality Subotica in vineyard plantation revealed that the highest number of seeds had 

weed species Portulaca oleracea L. with 4067 seeds per m 2 , and Chenopodium album L. 

with 3429 seeds per numbering of weed species m 2 .In the identical layer in the locality 

Subotica in vineyard plantation the highest number of seeds of weed species Portulaca 

oleracea L. was determined numbering 4067 seeds per m 2 and Chenopodium album L. with 

3429 seeds per m 2 . 

On the studied locality of Despotovo, 11 seeds of weed species were determined: 

Amaranthus retroflexus L., Chenopodium album L., Datura stramonium L., Euphorbia 

helioscopia L. ,Galium verum L., Litosprmum arvanse L., Setaria glauca (L.) P.B.,Sinapis 

arvensis L., Solanum nigrum L., Stachys annua L., and Veronica hederifolia L. (Graph 1). 

On the studied locality Subotica 19 seeds of weed species were identified: Amaranthus 

retroflexus L., Chenopodium album L., Datura stramonium L., Stellaria media L., Galium


verum L., Solanum nigrum L., Viola arvensis L., Stachys annua L., Euphorbia ciparissias 

L., Portulaca oleracea L., Bilderdykia convolvulus (L.) Dumort., Convolvulus arvensis L., 

Cannabis canadensis L., Geranium dissectum L., Setaria glauca (L.) P.B., Polygonum 

persicaria L., Sinapis arvensis L., Veronica arvensis L., and Euphorbia helioscopia L. 

(Graph. 2). 

No. of seeds per m² 

7000 

6000 

5000 

4000 

3000 

2000 

1000 

0 

0-10 

10 20 

20-30 

Weed species 

Graph 1 Seeds of weed species at locality Subotica in vine grape plantation 

in different soil depths. 

No. of seeds per m² 

2000 

1800 

1600 

1400 

1200 

1000 

800 

600 

400 

200 

0 

0-10 

10 -20 

20-30 

Weeds species 

Graph 2 Seeds of weed species at locality Despotovo in maize crop 

in different soil depths. 

Statistical data processing by statistical program Statgraphics (2012), showed that 

the greatest deviation from number of weed seeds per different soil layers at locality

186 Horizontal seed distribution in the soil under vine grape plantation and maize crop 

Despotovo was 1288, and at locality Subotica in vine grape plantation it was 2241. By data 

processing of variation coefficient, it was found that the percentage of variation at locality 

Despotovo was 40.53%, and at locality Subotica in the vine grape plantation the percentage 

of variation between numbers of weed species was the highest (72%) (Table 1). 

Table 1 Statistical data processing on number of seeds from the studied localities 

Locality Standard 

deviation (δ) 

Coefficient of 

variation (V%) 

Despotovo 1288 40.53 

Subotica 2241 72 

Weeds secure their survival in changeable and inconvenient environmental 

conditions by production of greater amount of seeds, ensuring efficient spreading in the 

area. Study of weed seeds and determination of their number is very important for timely 

determination of weed control measures, as well as use of herbicides. Results obtained by 

data processing during the period of the study showed that there exist defined potential of 

weed seed bank in the soil. Application of cultural practices and chemical measures of 

weed control has great influence to reduction of weed seed bank. After picking of maize, a 

significant reduction of weed seed bank in the soil was established. 

At locality Despotovo, determination of weed seeds in various soil layers, revealed 

presence of significant number of seeds of Chenopodium album L., -1866 seeds per m 2 in 

the soil layer of 10-20 cm. Seeds of Amarantus retroflexus L. was found in higher quantity 

in the layer of 20-30 cm. Domination of seeds of Amaranthus retroflexus L. was established 

in all three soil layers. In vine grape plantation at locality Subotica, seeds of Amaranthus 

retroflexus L. was dominant in the layers of 10-20 cm, as well as in the layer of 0-10 cm. 

Portulaca oleracea L. proved to be dominant in all studied soil layers, but the highest 

number of seeds of Portulaca oleracea L. was found in soil layers of 10-20 and 20-30 cm. 

DISCUSSION 

Maize is wide - row crop with large inter-row distance and space between plants in a 

row. Its growth is slower in the initial growth stages, which enables shooting, development 

of weeds and early formation of weed community in maize (Konstantinovic, 2011). Weed 

community of maize is typically row cropping and floristically very rich. It comprises about 

150 weed species that do not have the same significance in weed infestation. Only small 

number of these species takes part in establishment of characteristic composition of maize 

weed community, and these are Abuthilon theophrast Medic., Ambrosia artemisiifolia L., 

Amaranthus retroflexus L., Chenopodium album L., Cirsium arvense (L.) Scop., 

Convolvulus arvensis L., Cynodon dactylon (L.) Pers., Digitaria sanguinalis (L.) Scop., 

Hibiscus trionum L., Rubus caesius L., Echinochloa crus-galli (L.) P.B., Polygonum 

aviculare L., Polygonum lapathifolium L., Polygonum persicaria L., Setaria glauca (L.) 

P.B., Setaria viridis (L.) P.B., Solanum nigrum L. and Sorghum halepense (L.) Pers. 

(Konstantinović, 1999). 

Vineyards are perrenial agrophytocenosis in which vine grape has a role of agro 

edificator. Concerning floristic composition, in Vojvodina, weed community of vineyards is 

relatively rich by species. The mostly distributed weeds in Vojvodina vineyards are the 

following: Agropyron repens (L.) Beauv., Amaranthus retroflexus L., Capsella bursa-


pastoris (L.) Medic., Chenopodium album L., Convolvulus arvensis L., Cynodon dactylon 

(L.) Pers., Digitaria sanguinalis (L.) Scop., Erigeron canadensis L., Lamium amplexicaule 

L., Echinochloa crus-galli (L.) P.B., Setaria glauca (L.) P.B., Setaria viridis (L.) P.B., 

Solanum nigrum L., Sorghum halepense (L.) Pers., Stellaria media (L.) Vill., and 

Taraxacum officinale Web. (Konstantinović, 2011). 

REFERENCES 

Bhatt, M.D., Singh, S.P. (2007): Soil seed bank dynamics of weed flora in upland and lowland 

paddy cultivation areas of far western Nepal. Scientific World 5: 54-59. 

Conn, J. S. 1987): Effects of tillage and straw management on Alaskan weed vegetation: 

Distribution of weed species seed under different crops and in various soil lazers. interior 

Alaska, Soil Tillage Res. 46, pp. 225–229. 

Konstantinović, B. (1999). Poznavanje i suzbijanje korova. Poljoprivredni fakultet, Novi Sad. 

Konstantinović, B. (2011). Osnovi herbologije i herbicidi. Poljoprivredni fakultet, Novi Sad. 

Konstantinović, B., Meseldžija, M., Konstantinović, Bo. (2008): Distribution of weed species 

seed under different crops and in various soil layers. Polish Journal of Natural Science, 

5, 298-299. 

Kronaveter, Đ., Boža, P. (1994): Poznavanje semena najčešćih korova u semenarstvu. 

Univerzitet u Novom Sadu, Institut za ratarstvo i povrtarstvo, Novi Sad. 

Menalled F (2008): Weed Seedbank Dynamics & Integrated Management of Agricultural 

Weeds. Montana State University and Montana State University Extension. 

Renton, M., Peltzer, S., Diggle, A. (2006): Using the Weed Seed Wizard to Understand and 

Manage the Weed Seedbank. Australian Society of Agronomy. www. 

regional.org.au/au/asa/1998/6/093walker.htm. 

Sen, D.N. (2000): Weeds in rainfed cropping in Indian desert. Environment and Agriculture: 

At the cross road of New Millennium vol. I (eds.) P.K. Jha, S.B. Karmacharya, S.R. 

Baral and P. Lacuol. Ecological Society (ECOS), Kathmandu, Nepal, pp. 223-228. 

Sharratt (1998): Barley yield and evapotranspiration governed by tillage practices in interior 

Alaska, Soil Tillage Res. 46, pp. 225–229. 

Statgraphics (2012). Versione Centurion XVI. Reference Manual. StatPoint Inc. 

Skender A., 1998: Sjemenje i plodovi poljoprivrednih kultura i korova na području Hrvatske. 

Poljoprivredni fakultet, Osijek. 

Swanton, C.J., Booth, B.D. (2004): Management of weed seedbanks in the context a study on 

newly cleared land, Soil Tillage Res. 9 (1987), pp. 275–285. 

Vasileiadis, V.P., Froud-Williams, R.J., Eleftherohorinos, I.G. (2007): Vertical distribution, size 

and composition of the weed seedbank under various tillage and herbicide treatments in a 

sequence of industrial crops. Weed Research 47:222–230.

188 Morpho-anatomical response of glyphosate-resistant and... 

International Symposium: Current Trends in Plant Protection UDK: 633.15-295.024 

Proceedings 

MORPHO-ANATOMICAL RESPONSE OF GLYPHOSATE- 

RESISTANT AND -SUSCEPTIBLE MAIZE TO GLYPHOSATE 

TRIMESIUM 

1 DANIJELA PAVLOVIĆ*, 2 SAVA VRBNIČANIN, 3 CARL REINHARDT, 1 DRAGANA 

MARISAVLJEVIĆ 

1 Institute for plant protection and environment, Belgrade; Email: pavlovicdm @ gmail.com 

2 University of Belgrade, Faculty of Agriculture, Belgrade 

3 Department of Plant Production and Soil Science, University of Pretoria, South Africa 

dulekaca@yahoo.com 

Changes in leaf anatomy of two maize hybrids (GM and non-GM) were examined after 

application of 1, 2 and 4 L ha -1 of the herbicide product TOUCHDOWN ® [active ingredient: 

glyphosate trimesium salt (syn. sulfosate), 500 g L -1 ]. Samples for light and transmission electron 

microscopy analysis were collected 3, 7 and 24 hours after glyphosate application (HAA). Changes in 

leaf anatomy were not detected in both hybrids at 3 HAA. At 24 HAA, depending on herbicide rate 

and maize hybrid, changes in leaf anatomy were observed. Injuries at anatomical level were detected 

in non-GM maize after application of all tested doses, but in glyphosate-resistant (GR) maize injury 

were observed only after application of the highest dose (4 L ha -1 , double the recommended rate for 

use in GR maize). The onset of this relatively mild damage in the GR hybrid occurred later than in the 

non-GM hybrid. In non-GM maize distinct changes were detected in palisade and pith tissue of 

leaves, whereas the cuticle and epidermis remained unaffected. 

Key words: Maize hybrids, leaf anatomy, glyphosate trimesium, sulfosate 

INTRODUCTION 

Glyphosate-resistant (GR) transgenic crops (GM) gave a new approach to weed 

control, but also a risk of evolution in weeds of alternative resistance mechanism to the 

herbicide. By planting GM crops there is a possibility of gene transfer by reversed crossing 

and hybridization, but only in the case of co-existence of the GM crop with its wild 

relative(s) or non-GM crop. Some plants that withstand glyphosate treatment must be 

regarded as resistant. Glyphosate is mostly taken up by leaves and the degree of its 

absorption depends on formulation type, concentration, droplet size and characteristics of 

the leaf surface (Feng et al., 1998, 2003). Glyphosate is highly water soluble (Caseley and 

Coupland, 1985). Damage symptoms can be very similar to symptoms caused by herbicides 

from the acetyl CoA carboxylase (ACCase) and acetolactate synthase (ALS) inhibitors 

(Singh and Shaner, 1998).

Danijela Pavlović, Sava Vrbnicanin, Carl Reinhardt, Dragana Mirisavljević 189 

The goal of our research was to determine differences between glyphosate resistant 

(GM) and glyphosate susceptible (non-GM) maize by investigating morpho-anatomical 

responses after application of glyphosate. 


The experiment was conducted under controlled environmental conditions (temp. 

22.8/10.5 o C day/night, 54.6% RH, 12:12h period) at the University of Pretoria, South 

Africa, in 2007. For monitoring morpho-anatomical changes we used the commercial 

glyphosate formulation TOUCHDOWN ® [active ingredient: glyphosate trimesium salt 

(syn. sulfosate), 500 g L -1 ] at doses of 1, 2 and 4 L ha -1 . Application was made by dipping 

into the herbicide solution one half of one leaf per plant for each dose. Samples were 

collected 3, 7 and 24 hours after application (HAA). Pieces of treated and non-treated 

leaves were kept in fixative (2.5% glutaraldehyde in 0.075 M phosphate buffer, pH 7.4 until 

preparation for transmission electron microscopy (TEM) and light microscopy (LM) 

according to Glauert (1975) and to Coetzee and Van der Merwe (2007). Samples were 

rinsed 3x10 min. in 0.075 M phosphate buffer and fixed in 0.5% water solution of osmium 

tetroxide for 1-2 h. Following this step, samples were rinsed 3x10 min with distilled water. 

Samples were then dehydrated in increasing concentrations of ethanol: 30%, 50%, 70%, 

90%, 3x100% for 30 min. After this, samples were infiltrated first in 50% Quetol for 1h and 

then in 100% Quetol, and polymerized at 60 0 C for 39h in a special mould. Moulds 

provided LM cuttings of 0.5-1 µm thickness which were stained with Toluidine blue in 1% 

tap water. Samples were examined under the LM (Nikon Optiphod-Nikon Instech Co., 

Kanagawa, Japan). Samples for TEM were ultra-thin cuttings. Cuttings were then placed on 

a mesh (ø 3 mm) and fixed with 4% uranyl acetate (10 min) and Reynolds acid (2 min) 

followed by rinsing 20x in each of the 3 glass vessels containing distilled water. Samples 

were examined under TEM (Philips EM 301 transmission electron microscope, Eindhoven, 

Netherlands). 

RESULTS AND DISCUSION 

Effects of glyphosate on leaf anatomy of maize were dependent on dose rate and 

time after application. Anatomical changes were not observed by 3 HAA in the susceptible 

hybrid. At 7 HAA, changes were observed in leaf tissue of the non-GM hybrid after 

application of the highest dose (4 L ha -1 ). However, at 24 HAA with the highest dose, 

injury symptoms were observed in both of the maize hybrids (Figure 1 a,b), but did not 

cause injury to epidermal and mesophyll cells (Figure 1a). Contrary to these, we obserwed 

extensive and clear deformations in susceptible tissues of non-GM maize (Figure 1b). 

Twenty four hours after herbicide application the following observations were made: 

wrinkling of the cell wall of mesophyll cells, deformations of chlorophyll grains, and a 

reduction in chlorophyll content in assimilation parenchyma (Figure 1b). The cellular 

damage observed in both maize hybrids was not confirmed with a visual estimation 

conducted 24 HAA on plants exposed to the 2 and 4 L ha -1 rate (plants looks helthy, data 

did not showen).

190 Morpho-anatomical response of glyphosate-resistant and... 

a 

b 

Figure 1. Light micrographs of leaf cross sections: a) GM maize 24 HAA of 4 L ha -1 

(40x, enlargement; b) non-GM maize 24 HAA of 4 L ha -1 , (20x, enlargement). 

Images show damage to assimilation parenchyma and no damage to epidermal cells. 

Significant changes after glyphosate application were observed by TEM (Figure 2) 

were showed: wrinkling and damage of cell walls, cell cytolysis of intercellular spaces, and 

complete damage to cells of assimilation parenchyma. Also noted were decreased numbers 

of chlorophyll grana compared to the cells in healthy tissue, and tearing of chloroplast 

lamellas (data did not showen). 

a 

b 

Figure 2. Transmission electron micrographs of leaf cross sections: a) GM 

maize and b) non-GM maize 24 HAA of 4 L ha -1 TOUCHDOWN ® . Images 

show cytolysis and total tissue damage (4300x enlargement). 

In plants of the non-GM hybrid, morpho-anatomical changes at cellular level were 

observed starting between 3 to 7 HAA with the highest glyphosate dose, which confirms 

previous findings that glyphosate is absorbed between 4 and 8 HAA (Feng et al., 1998). 

The lowest applied dose of glyphosate (1 L ha -1 ) did not cause significant damage to 

epidermal and mesophyll cells of both hybrids. This can be explained by the low amount of 

active ingredient, a well-developed cuticle on resistant epidermal cells, and other natural 

barriers for penetration of a hydrophilic molecule such as glyphosate (Chamel, 1986; 

Chamel et al., 1991). However, the dose of herbicide (4 L ha -1 ) caused damage, especially 

in tissue of non-GM maize. Injury symptoms were manifested as warping of cell walls, 

chloroplast deformations, and reductions in the number of chlorophyll grana. Chloroplasts 

are important functional semi-autonomous organelles playing a critical role in cell, tissue,

Danijela Pavlović, Sava Vrbnicanin, Carl Reinhardt, Dragana Mirisavljević 191 

and whole plant functions. Changes in chloroplasts will result in serious damage to the 

whole plant, at vegetative and reproductive growth stages (Kastori, 1995; Nešković et al., 

2003). Deformations in chlorophyll grana were not observed which indicates that inhibition 

of the light reaction of photosynthesis is probably not a primary effect of glyphosate 

(Pihakaski and Pihakaski, 1980). Contrary to distinct reactions of the non-GM maize 

hybrid, changes in the GM hybrid appeared as mild warping of cell walls. 


We thank the Ministry of Education and Science of the Republic of Serbia (Project TR 

31018 and III 46008) and the University of Pretoria for supporting this study. 

REFERENCES 

Caseley, J. C., Coupland, D. (1985): Environmental and plant factors affecting glyphosate 

uptake, movement and activity. In: Herbicide glyphosate (ed. Atkinson, E. G. D.), 92- 

123, Butterworths, UK. 

Coetzee, J., Van der Merwe, C. F. (2007): Preparation of biological material for electron 

microscopy, Laboratory for Microscopy and Microanalysis, University of Pretoria. 

Feng, P. C. C., Chiu, T., Sammons, R. D., Ryerse, J. S. (2003): Droplet size affects glyphosate 

retention, absorption and translocation in corn. Weed Science, 51, 443-448. 

Feng, P. C. C., Ruff, T. G., Rangwala, S. H., Rao, S. R. (1998): Engineering plant resistance in 

thiazopyr herbicide via expression of a novel esterase deactivation enzyme. Pesticide 

Biochemistry and Physiology, 59, 89-103. 

Chamel, A., Pineri, M., Escoubes, M. (1991): Quantitative determination of water sorption by 

plant cuticules. Plant, cell and environment, 14, 87-95. Chamel, A. (1986): Foliar 

absorption of herbicides: Study of the cuticular penetration using isolated cuticuls. 

Physiologie Végétole, 24, 491-508. 

Glauret, A. M. (1975): Fixation, dehydration and embedding of biological specimens. In: 

Practical methods in electron microscopy (ed. Glauret, A. M.), North-Holland 

Publishing, Amsterdam. 

Gronwald, J. W. (1995): Resistance to photosystem II inhibitor herbicides. International 

Symposium on Weed and Crop Resistance to Herbicides, Cordoba, Spain. 

Jasieniuk, M., Badel, B. A. L., Morrison, I. N. (1996): The evolution and genetics of herbicide 

resistance in weeds. Weed Science, 44, 176-193. 

Kastori, R. (1995): Physiology of plants. Feuilleton, Novi Sad. 

Nešković, M., Konjević, R., Ćulafić, Lj. (2003): Physiology of plants. NNK-Internacional, 

Belgrade. 

Pihakaski, S., Pihakaski, K. (1980): Effects of glyphosate on ultrastructure and photosynthesis 

of Pellia epiphylla. Ann. Bot., 46, 133-141. 

Singh, B. K., Shaner, D. L. (1998): Rapid determination of glyphosate injury to plants and 

identification of glyphosate-resistant plants. Weed Technology, 12, 527-530. 

Smeda, R. J., Hasegawa, P. M., Goldsbrough, P. B., Singh, N. K., Weller, S. C. (1993): A 

serine-to-treonine substitution in the triazine herbicide-binding protein in potato cells 

results in atrazine resistance without impairing productivity. Plant Physiology, Vol. 103, 

No 3, 911-917.

192 Influence of root manipulation on herbicide sulphosate... 


Proceedings 

INFLUENCE OF ROOT MANIPULATION ON HERBICIDE 

SULPHOSATE INDUCED INHIBITION OF GROWTH AND 

PHOTOSYNTHESIS IN MAIZE (ZEA MAYS L.) 

BOGDAN NIKOLIĆ 1 , GORAN DRINIĆ 2 , VLADAN JOVANOVIĆ 3 , HADI WAISI 1 , 

ZORAN MILIĆEVIĆ 1 , SANJA ĐUROVIĆ 1 

1 Institute of Plant Protection and the Environment, Teodora Drajzera 9 11000 Belgrade 

2 Maize Research Institute, Slobodana Bajića 1, 11080 Zemun polje, Belgrade 

3 Pesticide and Environment Research Institute, Banatska 31b 11080 Zemun, Belgrade 

Effects of the herbicide sulfosate on growth, accumulation and distribution of dry weight and 

photosynthesis in maize plants subjected to source-sink manipulation at the root were studied. The 

findings indicate that growth and dry weight accumulation correlate significantly only with the dry 

mass ratio and/or volume of the root (RMR, Vr, respectively), while a significant negative correlation 

was found with stem mass ratio (SMR) and mostly with leaf mass ratio (LMR), which reflects an 

irregular distribution of carbohydrate metabolism in maize plants. As the root is where cytokinins, 

plant hormones essential for maintaining photosynthetic structures, are synthesized, we assumed that 

the root status under stress caused by the herbicide sulphosate could be one of the factors of 

stability/susceptibility of photosynthesis/ photosynthetic structures in plants exposed to this herbicide. 

Key words: LMR, SMR, RMR, dry matter partitioning, Chla fluorescence, photosynthesis, 

sulfosate 

INTRODUCTION 

Phosphonate herbicides (e.g. glyphosate, sulfosate) primarily induces inhibition of 

the shikimate biosynthetic pathway as the first assumed mode of action of these herbicides 

(Amrhein et al, 1980). Geiger and his coworkers (Servaites et al., 1987; Shieh et al., 1991) 

investigated herbicide glyphosate-induced early (1-2 h post-treatment) inhibition of 

photosynthesis and starch synthesis. We re-examined their findings during inhibition of 

photosynthesis and growth of maize plants treated with sulfosate and subjected to sourcesink 

manipulation of the root. 


Maize (Zea mays L.; hyb. ZPSC 704) plants were grown under field conditions 

(PARmax>1500 µmol m -2 s -1 , variable photoperiod (15/9±1 h) and relatively stable 

temperature and humidity (28/22±4 0 C, 50/60± 5%) over the July-August periods of 2002, 

2003 and 2004. The plants were growing on organic compost for up to 4 weeks (nearly 5 

fully grown leaves): one third of them in large pots (V=5 l; L plants) and two thirds in small

Bogdan Nikolić, Goran Drinić, Vladan Jovanović,... 193 

pots (V=1 l). Three days before treatment, half of the plants growing in small pots (V=1 l) 

were transferred into large pots (RP plants), while the other half remained in small pots 

(V=1 l, S plants). L plants were not grown in 2003, which was a method of source-sink 

manipulation at the root. At the beginning of trial, half the plants were treated with 10 -2 mol 

of sulphosate herbicide (syn. glyphosate-trimesium; product Touchdown®, Syngenta, UK, 

480 g/l a.i.) until fully soaked leaves, and the other half (control plants) remained untreated. 

Samples were taken for an analysis of growth and dry weight distribution (after dividing 

plants on leaves, pseudostems (designed in this article as a “stem”; this plant part consisted 

from a sheats prolonged from the top soil to the last emerged leaf without all developed and 

developing blades of leaves) and roots, cleansing those plant parts from dust and compost 

and measuring the plant parts on technical balance), photosynthetic pigment content, RWC 

parameter and root volume on the day of treatment, and the 4 th and 8 th post-treatment days. 

The parameters of growth and dry weight distribution were defined (SMR ratio defined 

according to definition of “stem”: see above definition), measured and calculated according 

to Poorter and Garnier (1996) and de Groot et al. (2002).Photosynthetic pigments were 

exposed to passive DMF extraction from samples at -20°C with sample absorbance (A 664 , 

A 647 and A 480 ) reading directly on the spectrophotometer, while Chl a , Chl b and total 

carotenoids (x+c) in the sampled leaf extract were calculated using Wellburn’s formula 

(Wellburn, 1994). Root volume was determined using the Archimedes’ Law. Chl a 

fluorescence measurements (as well as sampling for RWC and photosynthetic pigment 

measurements) were done 20-25 cm below the tip of the youngest fully grown leaf on the 

day of treatment and the 2 nd , 4 th , 6 th and 8 th post-treatment days using a PAM 101/103 

fluorometer in the first part of the photoperiod and following at least 3 hours of plant 

incubation in darkness. Parameters of Chl a fluorescence were calculated according to 

Maxwell and Johnson (2000). For technical resons, Chl a flurescence measurements were 

performed within limits in 2003 and were not carried out at all in 2004. 

In occasion of determination of the parameters of plant growth and dry weight 

distribution, and root volume, we used replicate from eight plants. In cases of determination 

of RWC parameter of water regime, and parameters of Chla fluorescence and content and 

ratious of photosynthetic pigments we used replicate from four plants. 

Because maize plants were raised in the field conditions during three years (2002- 

2004) we show results according trials performed in separated years, and also for separated 

parameters because of different numbers of replicates in different parameters. 

Before statistical processing we transformed dry matter data (for growth analysis) by 

multiplied original data with natural logarithm according Poorter and Garnier (1996) and de 

Groot et al. (2002), Statistical processing of the results acquired began by computing the 

means, using the M Stat C software (MSU, East Lansing USA). Statistical significance was 

tested by the analysis of variance (LSD test, the same software). Statistical significance of 

the differences found in the trial is marked with different letters and other symbols and it 

stands for 5% statistical threshold. The significance of relationships between parameters 

was tested using correlation computation in the same software. The results of correlation 

computation are presented in tables with the results and degrees of freedom. The asterisk 

sign (*) marks significant (5%) and double askerisk (**) highly significant (1%) 

correlation.



Dry weight accumulation (Fig. 1) of control plants in all plant groups (S, L and RP; 

2002 trial) was significantly higher from the 4 th day onwards than that of treated plants, 

which is concurrent with the differences in their plant growth. In this complex trial, we 

observed a low but highly significant correlation between ln DW and RMR, a negative 

highly significant correlation between RMR and SMR, and a negative significant 

correlation between LMR and any other parameter (Table 1). 

K/S 

T/S 

2.0 

A 

K/L 

T/L 

ln DW (g) 

1.5 

1.0 

EFG 

FG 

G 

BC 

BCD 

EF 

G 

G 

K/RP 

T/RP 

0.5 

0.0 

0 2 4 6 8 10 12 

TIME (days) 

Figure 1. Accumulation of dry weight in control and treated (10 -2 molsulphosate) S, L and RP maize 

plants in the 8-day trial. The plants were grown under field conditions for 4 weeks. К/S, К/L, К/RP, 

Т/S, Т/L, Т/RP: control or treated S plants (RGR K =122.25 mg g -1 d -1 ; RGR T =31.12 mg g -1 d -1 ),L 

plants (RGR K =58.75 mg g -1 d -1 ; RGR T = -18.88 mg g -1 d -1 ) and RP plants (RGR K =52.88 mg g -1 d -1 ; 

RGR T = -15.50 mg g -1 d -1 ) (2002 trial). Results accompanied by different letters differ significantly at 

P


treated plants as early as on the 2 nd day of trial. In repotted plants (RP plants), a significant 

inhibition of this photosynthetic parameter took place already on the 4 th day (Fig. 2). 

ETR (umol electrons/m 2 s) 

120 

100 

80 

60 

40 

20 

B...E 

B...F 

C...H 

B...E 

ABC 

AB 

H...K 

KLM 

0 

-2 0 2 4 6 8 10 12 

TIME (days) 

M 

K/S 

T/S 

K/L 

T/L 

K/RP 

T/RP 

Figure 2.Changes in the photosynthesis parameter ETR in the 5 th leaf of control and treated (10 -2 mol 

sulphosate) S, L and RP maize plants in the 8-day trial. The plants were grown under field conditions 

for 4 weeks. К/S, К/L, К/RP, Т/S, Т/L, Т/RP: control ortreated S, L and RP plants (2002 trial). 

Results accompanied by different letters differ significantly at P


A significant inhibition of dry weight accumulation (Figure 3) and growth was 

observed in treated S plants, although their growth in this trial (2003) was considerably 

slower than in the previous one (Figure 1; 2002). In RP plants (Figure 3), the accumulation 

of dry weight was moderate, growth inhibition less pronounced than in S plants (but 

neverthless statistically significant). Although not prominent, the correlation between dry 

weight accumulation in this trial, and leaf mass ratio and root volume is highly significant 

(Table 3). The LMR parameter is also negatively highly significantly correlated with RMR 

and especially with SMR, while the correlation between Vr and SMR is highly significantly 

negative, and RMR and SMR significantly negative (Table 3). 

Table 3. Correlation between parameters of accumulation and distribution of dry weight and 

root volume (2003 trial). Degrees of freedom has 59. 

Parameters Vr LМR SМR RМR 

ln DW 0.400** 0.350** -0.208 -0.207 

RМR 0.682** -0.459** -0.313* 

SМR -0.316** -0.700** 

LМR -0.217 

K/S 

T/S 

1.6 

A 

K/RP 

1.4 

T/RP 

1.2 

CD 

D 

ln DW (g) 

1.0 

0.8 

0.6 

CDE 

DE 

0.4 

0.2 

0.0 

-2 0 2 4 6 8 10 12 

TIME (days) 

Figure 3.Dry weight accumulation in control and treated (10 -2 mol sulphosate) S and RP maize plants 

in the 8-day trial. The plants were grown under field conditions for 4 weeks. К/S, К/RP, Т/S, Т/RP: 

control or treated S (RGR K =52.88 mg g -1 d -1 ; RGR T = -27.00 mg g -1 d -1 ) and RP (RGR K =71.38 mg 

g -1 d -1 ; RGR T =31.12 mg g -1 d -1 ) plants (2003 trial). Results accompanied by different letters differ 

significantly at P


However, the Fv/Fm values of control S plants (as an indicator of RC PS II activity) 

were rising, but without significant difference between control and treated plants in the trial 

(Table 4). On the 2nd day of trial alone a significant decrease in treated S plants was 

observed regarding this parameter, compared to control. In the final stage of the trial (6th 

day), sulphosate inhibited the photochemical activity of RC PS II of treated S plants (Table 

4). According to available literature (Babani and Lichtenthaler, 1996), the Fv/F 0 parameter 

(Table 4) is statistically more sensitive, so that significantly higher values were observed in 

control than in treated S plants, which indicates an increase in the photochemical activity of 

RC PS II. 

Table 4. Chl a fluorescence parameter of the 5th leaf of S maize plants grown under field 

conditions for 4 weeks. NM – not measured. (2003 trial) 

Day/treatment 

(К/Т) 

0/K 

2/K 

2/T 

4/K 

4/T 

6/K 

6/T 

8/K 

8/T 

Fv/Fm LSD 0.05 LSD 0.01 Fv/F 0 LSD 0.05 LSD 0.01 

0.762 

BCD 

0.774 

BCD 

0.712 

E 

0.791 

ABCD 

0.758 

CD 

0.804 

AB 

NM 

0.795 

ABC 

0.746 

E 

0.045 0.060 

3.212 

FGH 

3.452 

DEFG 

2.558 

H 

3.765 

CDEF 

3.672 

CDEF 

4.106 

ABCD 

NM 

3.831 

CDEF 

2.868 

GH 

0.656 0.876 

K / S 

2 0 0 

1 8 0 

A 

A 

A 

T / S 

K / R P 

T / R P 

1 6 0 

Chla (mg/m 2 ) 

1 4 0 

1 2 0 

1 0 0 

8 0 

6 0 

4 0 

2 0 

B 

C 

B C 

C 

C 

0 

4 8 

T I M E ( d a y s ) 

Figure 4. Changes in chlorophyll a (Chl a ) content in the 5th leaf of control and treated (10 -2 mol 

sulphosate) S and RP maize plants in the 8-day trial. The plants were grown under field conditions for 

4 weeks. К/S,К/RP, Т/S, Т/RP: control or treated S and RP plants (2003 trial). Results accompanied 

by different letters differ significantly at P


The parameter Fv/Fm (Tab. 5) changed in a similar way as it did in S plants. Fv/F 0 

was significantly inhibited in treated RP plants on the 8th day of this trial (Table 5). The 

two indicators of PS II quantum efficiency are highly significantly (0.901) correlated. 

K/S 

T/S 

ln DW (g) 

3.2 

2.8 

2.4 

2.0 

1.6 

1.2 

AB 

EF 

G 

AB 

AB 

BC 

CD 

EF 

K/L 

T/L 

K/RP 

T/RP 

0.8 

0.4 

0.0 

-2 0 2 4 6 8 10 12 

TIME (days) 

Figure 5. Accumulation of dry weight in control and treated (10 -2 mol sulphosate) S, L and RP maize 

plants in the 8-day trial. The plants were grown under field conditions for 4 weeks. К/S, К/L, К/RP, 

Т/S, Т/L, Т/RP: control or treated S (RGR K =101.88 mg g -1 d -1 ; RGR T =23.88 mg g -1 d -1 ), L (RGR K 

=44.12 mg g -1 d -1 ; RGR T =18.62 mg g -1 d -1 ) and RP (RGR K =151.38 mg g -1 d -1 ; RGR T =114.50 mg g - 

1 d -1 ) plants (2004 trial). Results accompanied by different letters differ significantly at P


In treated S plants, a significant decrease in Chl a content (Fig. 4) is evident as early 

as on the 4th day of trial, while the content of Chl a pigment (Fig. 4) was significantly lower 

in treated (than in control) RP plants no sooner than on the 8th day of trial. 

All parameters indicating the contents and relationships of photosynthetic pigments 

in this trial were highly significantly correlated (Tab. 6). 

Table 6. Correlation of contents and ratios of photosynthetic pigmens (2003 trial). Degrees of 

freedom has23. 

Parameters Chl a /x+c x+c Chl a /Chl b Chl а+b Chl b 

Chl a 0.894** 0.881** 0.918** 1.000** 0.992** 

Chl b 0.877** 0.900** 0.885** 0.995** 

Chl а+b 0.891** 0.886** 0.912** 

Chl a /Chl b 0.952** 0.715** 

x+c 0.615** 

Dry weight accumulation (Fig. 5) in control S plants was prominent and statistically 

significantly higher than in treated plants, which indicates a significant inhibition of 

growth. The growth of S plants in this trial (2004) was comparable to that of corresponding 

plants in 2002. 

In L plants, dry weight accumulation was prominent but did not change significantly 

(Fig. 5), regardless of whether the plants had been treated with sulphosate or not. 

Consequently, plant growth was moderate, and sulfosate-caused inhibition of growth was 

not high. Comparing this trial (2004) with the earlier one (2002), it becomes evident that, 

despite a considerable difference in dry weight accumulation, the dynamics of growth and 

values of the RGR parameter of growth were similar. 

In RP plants, dry weight accumulation was prominent (Fig. 5) and there were no 

significant differences between control and treated plants, so that growth was pronounced 

in both groups. 

Dry weight accumulation is evidently highly correlated only with root volume (Vr). 

Vr correlates highly significantly with RMR, while a high negative correlation exists 

between Vr and LMR and a negative correlation between Vr and SMR (Tab. 7). RMR has a 

highly significant negative correlation both with SMR and LMR (Tab. 7). 

Table 7. Correlation of the parameters of accumulation and distribution of dry weight and root 

volume (2004 trial). Degrees of freedom has 89. 

Parameters Vr LМR SМR RМR 

ln DW 0.715** -0.073 0.205 0.097 

RМR 0.334** -0.672** -0.578** 

SМR -0.219* 0.023 

LМR -0.327** 

Our overall conclusion is that dry weight accumulation and plant growth 

significantly correlate with root volume and/or root mass ratio (Vr, RMR), while 

correlation with SMR and (greatly) LMR is significantly negative, which agrees with the 

irregular distribution of carbo-hydrate metabolism in maize plants (Setter and Meller, 

1984). The root is known to be the site of synthesis of cytokinins, i.e. plant hormons 

required for maintaining photosynthetic structures (Pons et al., 2001). As our results


(Figures 1-5, Tables 1-7) indicate an important role of the root under stress conditions 

provoked by the herbicide sulfosate, we believe that it could be a place for biosynthesis of 

some photosynthetic structures-stabilizing factors in plants exposed to stress induced by 

those herbicide. 


This study was supported by project TR 31018, 31037 and 31043 of the Ministry of 

Education and Science of the Republic of Serbia. The herbicide Touchdown was provided 

courtesy of Saša Marinković (Syngenta Serbia, Belgrade). 

REFERENCES 

Amrhein, N., Deus, B., Gehrke, P. AND Steinrücken, H.C. (1980) The Site of the Inhibition of 

the Shikimate Pathway by Glyphosate. II. Interference of glyphosate with chorismate 

formation in vivo and in vitro. Plant Physiology, 66: 830-834. 

Babani, F. and Lichtenthaler, H.K. (1996) Light-induced and Age-dependent Development of 

Chloroplasts in Etiolated Barley Leaves as Visualisated by Determination of 

Photosynthetic Pigments, CO 2 Assimilation Rates and Different Kinds of Chlorophyll 

Fluorescence Ratios. Journal of Plant Physiology, 148: 555-566. 

De Groot, C.C., Marcelis, L.F.M., Van den Boogaard, R. and Lambers, H. (2002) Interactive 

effects of nitrogen and irradiance on growth and partitioning of dry-mass and nitrogen in 

young tomato plants. Functional Plant Biology, 11: 1319-1328. 

Maxwell, K. and Johnson, G. (2000) Chlorophyll fluorescence-a practical guide. Journal of 

Experimental Botany, 51 (345): 659-668. 

Pons, T.L., Jordi, W. and Kuiper, D. (2001) Acclimation of plants to light gradients in leaf 

canopies: evidence for a possible role for cytokinins transported in the transpiration 

stream. Journal of Experimental Botany, 52 (360): 1563-1574. 

Poorter, H. and Garnier, Е. (1996) Plant growth analysis: evaluation of experimental design and 

computational methods. Journal of Experimental Botany, 47: 1343-1351. 

Servaites, J.C., Tucci, M.A. and Geiger, D.R. (1987) Glyphosate Effects on Carbon 

Assimilation, Ribulose Bisphosphate Carboxylase Activity, and Metabolite Levels in 

Sugar Beet Leaves. Plant Physiology, 85: 370-374. 

Setter, T.L. and Meler, V.H. (1984) Reserve Carbohydrate in Maize Stem. [ 14 C] glucose and 

[ 14 C] sucrose uptake characteristics. Plant Physiology, 75: 617-622. 

Shieh, W.-J., Geiger, D.R. and Servaites, J.C. (1991) Effect of N-(Phosphonomethyl) glycine on 

Carbon Assimilation and Metabolism during a Simulated Natural Day. Plant Physiology, 

97: 1109-1114. 

Wellburn, A.R. (1994) The Spectral Determination of Chlorophylls a and b, as well as Total 

Carotenoids, Using Various Solvents with Spectrophotometers of Different Resolution. 

Journal of Plant Physiology, 144: 307-313.

Maširević Stevan, Medić Pap Slađana, Živanov Dalibor 201 

International Symposium: Current Trends in Plant Protection UDK: 633.15-251; 

Proceedings 582.916.26 

RESISTANCE OF SOME SUNFLOWER GENOTYPES TO 

BROOMRAPE (OROBANCHE CUMANA WALLR.) AND ITS 

INFLUENCE ON SEED YIELD AND QUALITY 

MAŠIREVIĆ STEVAN 1 , MEDIĆ PAP SLAĐANA 2 , ŽIVANOV DALIBOR 2 

1 Faculty of Agriculture, Novi Sad, Trg Dositeja Obradovića 8, 21000 Novi Sad 

2 Institute for field and vegetable crops, Maksima Gorkog 30, 21000 Novi Sad 

Broomrape (Orobanche cumana Wallr.) is a flowering parasitic plant which is one of the 

major sunflower parasites. Different sunflower hybrids have different reaction to the broomrape. The 

aim of this paper is to evaluate influence of broomrape attack to seed yield and quality in different 

experimental sunflower genotypes. In this trial we evaluated 13 experimental hybrids to broomrape 

which belong to 3 different groups: resistant to broomrape, high-oleic and resistant to imidazolinone 

herbicides and 4 standard hybrids. Out of 13 inoculated sunflower hybrids broomrape was noticed on 

8. Obtained seed yield and oil content were higher in non-infected plants in comparison to the plants 

infected with broomrape in five hybrids. The negative correlations between number of broomrape 

plants per sunflower plant and seed yield (-0.419717) and oil yield (-0.409165) were obtained. 

Key words: broomrape, sunflower, seed yield, oil yield 

INTRODUCTION 

Broomrape as a parasite of sunflower in Serbia for the first time was described in 

1951. Since that period it has been appearing with varying intensity almost every year but 

since the 1990s broomrape has been causing significant damage in susceptible sunflower 

hybrids (Gulya et al., 1997, Maširević 2002). The broomrape genus (Orobanche L.) is 

characterized by pronounced biodiversity. There are about 200 species identified so far 

throughout the world (Pusch and Günther 2009), 26 have been found in Serbia (Maširević 

and Kojić, 2002). Despite such high biodiversity, 8 species alone are important parasite 

species in cultivated crops. The species Orobanche cumana (Wallr.) is one of the most 

dangerous parasites on sunflower. 

In addition to the pest’s huge infectious potential and long viability of seed in the 

soil, another great problem is caused by the heterogeneity of its population i.e. by the 

existence of multiple physiological races, each specific to a particular sunflower region. 

The appearance of new broomrape races has been reported in recent years in: Spain, 

Turkey, Romania, Bulgaria, Russia (Melero-Vara et al., 2000; Kaya et al., 2004; Molinero- 

Ruiz and Melero-Vara, 2005; Fernandez Escobar et al., 2008; Schindrova, 2006, 

Pãcureanu-Joita et al., 2008, Antonova et al., 2009, Škorić et al., 2010). According to the 

recent investigations, there are some changes in broomrape race composition in Serbia, 

(Maširević et al., 2012).

202 Resistance of some sunflower genotypes to broomrape ... 

Constant monitoring of broomrape population is very important due to reveal 

changes in race composition as well as testing of sunflower hybrids (Maširević and 

Malidža, 2006). 

Yield losses depend on intensity of attack and susceptibility of cultivated hybrid and 

they can range from 5 to 100 %. High susceptible hybrids infected with broomrape have 

smaller heads which are sometimes sterile (Škorić et al., 1994). In such heads, decrease of 

seed yield and oil content has been noticed (Shindrova et al., 1998, Kaya et al., 2004, 

Alcántara et al., 2006). 

The aim of this paper is to evaluate influence of broomrape attack in different 

experimental sunflower genotypes. 


The experiment was conducted in field conditions in Svetozar Miletić locality 

(North Serbia), at naturally highly infested plot. This area is known as main foci of hazard. 

In this trial we evaluated resistance of 13 experimental hybrids to broomrape 

(Orobanche cumana Wallr.) The tested hybrids belong to 3 different groups: resistant to 

broomrape (NORH-28, NORH-29, NORH-30, NORH-33, NORH-34), high-oleic (H.O-B- 

2, H.O-B-3 H.O-B-4, H.O-B-5, H.O-08) and resistant to imidazolinone herbicides (IMI-3- 

911, IMI-3-369, PARAISO). Hybrids NK NEOMA, NK DELFI, NK KONDI and NS-H- 

111 were used as standard. Hybrids were sown in 4 rows in 3 replicates (22 plants in each 

row) (figure 1). 

Figure 1. Sowing of the field trial 

Samples of broomrape seed which were used in the trial were collected during 2010 

in the Vojvodina province. Seed samples were kept in the fridge on +4 0 C. The trial was 

sown on April, 19, 2011. and harvested September 12, 2011. 

Broomrape seed were put in seedbed together with sunflower seeds during the 

sowing. The first five plants in the third row were inoculated, while the fourth row was 

used as uninfested control. Evaluation of the hybrids resistance was done according to the 

number of broomrape plants per one sunflower plant. From these infected plants during the 

harvest heads were taken separately due to calculate seed and oil yield per each plant.


Obtained yields (kg/ha -1 ) were calculated according to standard 8% moisture and 3% 

impurities. Oil content in seed was measured by NMR method (nuclear-magnetic 

resonance) according to Granlund & Zimmerman (1975). Oil yield (kg/ha -1 ) was calculated 

as product of seed yield and oil content. 

Data were analyzed by ANOVA and Duncan test using software Statistica 10. 

RESULTS AND DISSCUSION 

Out of 13 inoculated sunflower hybrids broomrape was noticed on 8 (graph.1). The 

highest number of broomrape per sunflower plant has hybrids HO-B-3 (29.5) and NS-H- 

111 (28.5), while the smallest number has hybrids HO-B-5 (6.5), IMI-3-369 (8.0) and HO- 

B-2 (8.5). 

It is interested to report that hybrid NORH-34 was attacked by Orobanche cumana. 

Broomrape was also noticed in this hybrid during 2009 (Maširević et al, 2011). These 

results could indicate the weakening of resistant genes but also the ability of the pathogen 

to accommodate and to overcome the hybrid resistance. 

Graph.1. Broomrape attack on different sunflower hybrids in condition of artificial inoculation 

Influence of Orobanche cumana on seed and oil yield could be seen in table 1 and 

graph 2. Obtained seed yield and oil content were higher in non-infected plants in 

comparison to the plants infected with broomrape in five hybrids. The exception are hybrids 

HO-B-2*, HO-B-4* and HO-B-5*, in those hybrids infected plants had higher yields. This 

could be explained by relatively low percent of broomrape infection and other factors 

which can influence the seed yield and oil content.


Table 1. Obtained seed and oil yield per head of infected and healthy plants in different 

sunflower hybrids 

Hybrid 

Seed yield per 

head (g) 

Oil yield per head (g) 

Average number of 

broomrape per 

sunflower plant 

IMI-3-369 126.5 a 59.5 a without broomrape 

IMI-3-369* 37.9 b 16.6 b 8.0 

IMI-3-911 93.4 a 47.3 a without broomrape 

IMI-3-911* 91.0 a 42.0 a 18.3 

HO-B-2 79.5 a 41.8 a without broomrape 

HO-B-2* 86.5 a 44.2 a 8.5 


HO-B-3* 34.4 b 17.9 b 29.5 


HO-B-4* 77.9 a 39.1 a 11 


HO-B-5* 74.3 a 39.8 a 6.5 

NORH-34 80.9 a 41.5 a without broomrape 

NORH-34* 46.0 a 24.1 a 18.5 

NS-H-111 74.2 a 38.1 a without broomrape 

NS-H-111* 68.6 a 34.7 a 28.5 

p 0.000*** 0.025952* 

* Sunflower plants infected with broomrape 

Graph.2. Influence of broomrape to seed and oil yield in different sunflower hybrids 

There are significant differences in achieved seed and oil yield in attacked compared 

to non-attacked plants IMI-3-369 (seed -70%; oil -72.1%) and HO-B-3 (seed -46.7%; oil - 

40.3%) (tab 2 and 3). In other tested hybrids influence of broomrape to achieved yield was


not statistically significant. Hybrid NORH-34 achieved 43.1% lower seed yield and 41.9% 

lower oil content in average, but there is no statistic difference between healthy and 

attacked plant. Eizenberg et al, 2004 reported that susceptible sunflower genotype in 

Orobanche infected field (28-45 broomrape plants per sunflower plant) achieved only 8% 

of seed production compared to control. 

High attack in hybrid NS-H-111 (28.5) has not important effect to the decrease of 

seed and oil yield. It is known that this hybrid could achieve good results in conditions of 

high infestation (Maširević, 2002). According to Wegmann et al. (1991) crop can be 

recognized as tolerant to broomrape if it is parasited but without yield loss, аnd as resistant 

if it is broomrape free. 

Graph.3. Differences in seed yield in sunflower plants infected with broomrape and control 

plants 

Graph.4 Differences in oil yield in sunflower plants infected with broomrape and control plants


Tab.2. Differences in seed yield in plants attacked by broomrape and healthy plants 

Hybrid 

Seed yield in 

healthy plants 

(g) 

Seed yield in 

attacked plants 

(g) 

Differences in 

seed yield in 

attacked and 


(%) 

Average 

number of 

broomrape 

per plant 

Differences in 

seed yield in 

attacked and 


per one 

broomrape 

plant (%) 

IMI-3-369 126.5 37.9 -70.0* 8.0 -8.8 

IMI-3-911 93.4 91.0 -2.6 18.3 -0.1 

HO-B-2 79.5 86.5 8.8 8.5 1.0 

HO-B-3 64.5 34.4 -46.7* 29.5 -1.6 

HO-B-4 62.0 77.9 25.7 11.0 2.3 

HO-B-5 66.9 74.3 11.1 6.5 1.7 

NORH-34 80.9 46.0 -43.1 18.5 -2.3 

NS-H-111 74.2 68.6 -7.6 28.5 -0.3 

Tab.3. Differences in oil yield in plants attacked by broomrape and healthy plants 

Oil yield in 


(g) 

Oil yield in 

attacked plants 

(g) 

Differences in oil 

yield in attacked 

and healthy 

plants (%) 

Average 

number of 

broomrape per 

plant 

Differences in seed 

yield in attacked and 

healthy plants per one 

broomrape plant (%) 

59.5 16.6 -72.1* 8.0 -9.0 

47.3 42.0 -11.2 18.3 -0.6 

41.8 44.2 5.7 8.5 0.7 

41.5 24.1 -41.9 18.5 -2.3 

35.2 39.8 13.1 6.5 2.0 

32.7 39.1 19.6 11.0 1.8 

38.1 34.7 -8.9 28.5 -0.3 

30.0 17.9 -40.3* 29.5 -1.4 

Generally, the negative correlations between number of broomrape plants per 

sunflower plant and seed yield (-0.419717) and oil yield (-0.409165) were obtained. 

If the effect of broomrape to seed and oil yield analyzed separately per hybrid, the 

negative correlation was noticed in all hybrids, but the significant negative correlation was 

obtained in HO-B-3 (-0.966975; -0.962241) and HO-B-4 (-0.990622; -0.997403). 

Intensity of damage depends on severity of attack and decrease of the seed yield is 

explained by number of broomrape plants per sunflower plant (Aćimović, 1998). The early 

and severe attack of broomrape can cause decrease of sunflower plants height about 40% 

(Maširević, unpublished data). 

According to Vranceanu et al. (1980), sunflower plants infected with broomrape in 

range from 0 to 10% are considered as resistant, while the plants with attack 10-20% could 

be classified as tolerant. 

Gospodinov (1960) reported if the number of broomrape plants per one sunflower 

plant are from 1 to 10 the seed yield is decreased for 13.8%, and if the number of 

broomrape plants per sunflower plant are 111 to 130 the loss is 70%. 

According to Grenz et al., 2008 presence of 50, 200 and 1600 kg- 1 seed of 

Orobanche cumana leads into reduction of sunflower seed size and number in average for 

13%, 25%, 37% respectively and this loss directly influenced to the total seed and oil yield.


Our results indicate that tested hybrids expressed different susceptibility and variable 

response to broomrape attack. Five out of eight hybrids had smaller yields due to 

broomrape attack. The seed yield loss in attacked sunflower plants varied from 2.6-70% 

and the oil yield loss varied from 8.9- 72%. 

REFERENCES 

Aćimović, М. (1998): Bolesti suncokreta. Naučni institut za ratarstvo i povrtarstvo, Novi Sad, 

(Novi Sad: Feljton), str.736. 

Alcántara, E., Morales-Garcia, M., Diaz-Sanchez, J. (2006): Effects of Broomrape Parasitism on 

Sunflower Plants: Growth, Development and Mineral Nutrition, Journal of plant 

Nutrition, 29: 1199-1206. 

Antonova, T.S, (1978): Development of Orobanche cumana Wallr. suckers in roots of immune 

and susceptible forms of sunflower. Akademija NAUK SSSR. Botanicseszkij zsurnal, 

Leningrad, 63 (7):1025-1030. 

Antonova, T.S., Araslanova, N.M., Guchetl, S.Z., Tchelustnikova, T.A., Ramazanova, S.A. and 

Trembak, E.N. 2009. Virulence of sunflower broomrape in some regions of Northen 

Caucasus Helia, 32, 51, p.p. 101-110, (2009) 

Eizenberg H., Plakhine J., Hershenhorn J., Kleifeld Y. (2004): Variations in Reponses of 

Sunflower Cultivars to the Parasitic Weed Broomrape. Plant Disease 88/5, 479-484. 

Fernandez-Escobar, J., Rodriguez-Ojeda, M.I. and Alonso, L.C. 2008. Distribution and 

dissemlination of sunflower broomrape (Orobanche cumana Wallr.) rase F in Southern 

Spain p. 231-236. Proc. 17th International Sunflower Conference. Cordoba, Spain. 

Fernandez-Martinez, J.M., Dominguez, J., Perez-Vick, Valasco, L. (2008): Update on breeding 

for resistance to sunflower broomrape. Helia, 31 (48):73-84. 

Gospodinov, G. (1960): Opiti za ustanovjavane na metod za opredeljane zagubite, pričineni ot 

sinjata kitka po slnčogleda (Orobanche cumana Wall.). Plant Protection Institute of 

Sofia, 43-52. 

Granlund, M., Zimmerman, D. C. (1975): Effect of drying conditions on oil contents of 

sunflower (Helianthus annuus L.) seed determined by wide-line Nuclear Magnetic 

Resonance (NMR). North Dakota Acad Sci Proc. 27: 128-13. 

Grenz, J.H., Istoc, V.A., Manschadi, A.M, Sauerborn, J. (2008): Interactions of sunflower 

(Helianthus annuus) and sunflower broomrape (Orobanche cumana) as affected by 

sowing date, resource supply and infestation level. Field Crop Research, 102 (2):170- 

179. 

Gulya, T.J, Rashid, K., Maširević, S. (1997): Sunflower diseases. In: Sunflower Technology and 

Production (Schneider, A., Ed.). Madison, p. 263-379. American Society of Agronomy, 

Madison, Wisconsin, USA. 

Kaya, Y., Evci, G., Pekcan, V. and Gucer, T. 2004. Determining new broomrape infested areas, 

resistant lines and hybrids in Trakya region of Turkey. Helia 27: 211-218. 

Kaya, Y., Evci, G., Pekcan, V., Gucer, T. (2004): Determining new broomrape-infested areas, 

resistance lines and hybrids in Trakya Region of Turkey. Helia 27(40): 211-218. 

Maširević, S. (2001): Širenje volovoda na suncokretu i analiza populacije parazita. Zbornik 

radova Naučnog instituta za ratarstvo i povrtarstvo, Novi Sad. Sveska 35: 235-241. 

Maširević, S. (2002): Stanje i perspektive rešenja problema volovoda (Orobanche cernua) na 

suncokretu. Zbornik radova Naučnog instituta za ratarstvo i povrtarstvo, Novi Sad. 

Sveska 8: 117-128. 

Maširević, S., Kojić, M. (2002): Rasprostranjenje i biodiverzitet volovoda (Orobanche L.) u 

Evropi i kod nas. Zbornik radova Naučnog instituta za ratarstvo i povrtarstvo, Novi Sad. 

Sveska 36: 161-168.


Maširević, S., Malidža, G. (2006): Problem i suzbijanje volovoda (Orobanche spp.). Biljni lekar, 

4-5, str. 353-360. 

Maširević, S., Medić-Pap, S., Škorić D. (2012): Is there appearance of new broomrape race in 

Serbia? 18th International Sunflower Conference Mar del Plata & Balcarce, Argentina 

27.2.-1.3. 2012, p. 1048-1051. 

Maširević, S., Medić-Pap, S., Škorić D., Živanov, D. (2011): Susceptibility of some 

experimental sunflower hybrids to white rot (Sclerotinia sclerotiorum) and broomrape 

(Orobanche cumana). 22 nd International symposium “Food safety production”. 

Trebinje, Bosnia and Herzegovina, 19-28.6.2011, p. 318-321. 

Melero-Vara, J.M., Dominguez, J., Fernandez-Martinez, J.M., 2000. Update on sunflower 

broomrape situation in Spain: racial status and sunflower breeding for resistance. Helia 

23(33): 45-55. 

Molinero-Ruiz, M.L. and Melero-Vara, J.M. 2005. Virulence and aggressiveness of 

sunflowerbroomrape (Orobanche cumana) populations overcoming the Or5 gene p. 165- 

169. In: Seiler, G.J.,[ed], Proc. 16th Int. Sunflower Conf., Fargo, ND, USA. 

Pacureanu-Joita, M., Raranciuc, S., Stancu, D., Sava, E. and Nastase, D. 2008. Virulence and 

aggressiveness of sunflower broomrape (Orobanche cumana Wallr.) populations in 

Romania. Romanian Agricultural Research, 25, 47-50 

Pusch J., Günther, K.F. (2009): Orobanchaceae (Sommerwurzgewächse). In: G. Hegi (ed.), 

Illustrierte Flora von Mitteleuropa Bd. 6/1A, Lieferung 1.Weissdorn-Verlag, Jena. 

Ruso, J., Sukno, S., Domingues-Gimenez, J., Melero-Vara, J.M., Fernandez-Martinez, J., 

(1996): Screening of wild Helianthus species and derived lines of resistance to several 

populations of Orobanche cernua. Plant disease 80: 1165-1169. 

Shindrova, P. 2006. Broomrape (Orobanche cumana Wallr.) in Bulgaria - distribution and race 

composition. Helia 29(44): 111-120. 

Shindrova, P., Ivanov, P., Nikolova, V. (1998): Effect of broomrape (Orobanche cumana 

Wallr.) intensity of attack on some morphological and biochemical indices of sunflower 

(Helianthus annuus L.). Helia 21(29): 55-62. 

Statistical Releases (2010): Statistical Office of the Republic of Serbia. 

http://webrzs.stat.gov.rs/axd/index.php. 

Škorić D., Pacureanu-Joita M., Elizabeta S. 2010. Sunflower breeding for resistance to 

broomrape (Orobanche cumana Wallr.). An. N.C.D.A. Fundulea, VOL. LXXVIII (1), 

63-79 Bucharest Romania. 

Škorić, D., Maširević, S., Tadić, L., Glušac, D., Turkulov, J. (1994): Suncokret. Poljoknjiga, 

Beograd, str. 205. 

Vranceanu, A.V., Tudor, V.A., Stoenescu, F.M., Pirvu, N. (1980): Virulence groups of 

Orobanche cumana Wallr., differential hosts and resistance source genes in sunflower. u: 

Int. Sunflower conference (9th), June 8-13, Terrenolins, Spain, Paris: int. Sunflower 

Association, p. 74-82. 

Vranceanu, A.V., V.A. Tudor, F.M. Stonescu and N. Pirvu, 1980. Virulence groups of 

broomrape (Orobanche cumana Wallr.) differential hosts and resistance sources and 

genes in sunflower. In Proceedings of the 9th International Sunflower Conference. 

Torremolinos, Spain. June, 8-13: pp. 74-81. 

Wegmann, K. (2004): The nature of known and less known factors of Orobanche resistance. 

COST action 849 Workshop “Breeding for resistance to Orobanche sp.”Summary, 4-6. 

November 2004. Bucharest. 

Wegmann, K., Elert, E., Harloff, H.J., Stadler, M. (1991): Tolerance and resistance to 

Orobanche. Proceedings of International Workshop on Orobanche, Obermarchial, 1989. 

Tubeningen, pp. 318-321.


P H Y T O P A T H O L O G Y

210 PHYTOPATHOLOGY

Gyöngyi Szigeti, Nikolett Baranyi, Sándor Kocsubé,... 211 

International Symposium: Current Trends in Plant Protection UDK: 582.282.123(4-191.2) 

Proceedings 

ROLE OF ASPERGILLUS SPECIES IN MYCOTOXIN 

CONTAMINATION OF AGRICULTURAL PRODUCTS IN 

CENTRAL EUROPE 

GYÖNGYI SZIGETI 1 , NIKOLETT BARANYI 1 , SÁNDOR KOCSUBÉ 1 , TAMÁS GYŐRI 1 , ANDRÁS 

SZEKERES 1 , BEÁTA TÓTH 2 , ORSOLYA TÖRÖK 2 , EDIT HÁFRA 1,2 , XÉNIA PÁLFY 2 , JÁNOS 

VARGA 1 

1 

University of Szeged, Faculty of Science and Informatics, Department of Microbiology, 6726 

Szeged, Közép fasor 52. 

2 Cereal Research Nonprofit Ltd., 6726 Szeged, Alsó kikötő sor 9. 

Aspergillus species are filamentous fungi which are widespread on agricultural products in 

subtropical and tropical areas of the world. Aspergilli are able to produce a range of mycotoxins 

which can be harmful to animals or humans, including aflatoxins, ochratoxins, fumonisins and 

patulin. According to recent studies, climate change accompanied by global warming affects the 

occurrence of fungi and their mycotoxins in our foods and feeds. A shift has recently been observed 

in the occurrence of Aspergillus species, especially aflatoxin producers in Europe. Our aim was to 

examine the occurrence of mycotoxin producing Aspergilli in Hungarian agricultural products to 

evaluate their importance in food safety. The examined agricultural products included various cereals, 

onions, nuts and spices. The surface-sterilized products were placed on selective media, and the 

isolated fungal strains were identified using morphological and sequence-based methods. Regarding 

cereals, several Aspergillus flavus isolates were identified, which are potential aflatoxin producers. 

This species was identified on various cereal seeds including maize, wheat and barley in different 

regions of Hungary. Several of the A. flavus isolates were found to be able to produce aflatoxins. 

Onions were found to be infected by Aspergillus awamori, a recently described ochratoxin and 

fumonisin producing species. This species together with other black Aspergilli was also identified on 

cereal seeds. Besides A. flavus, several potential mycotoxin producing species including A. 

westerdijkiae, A. melleus, A. terreus, A. awamori and A. niger have also been identified on nuts and 

spices (chilli, red pepper, spice mixes). Several species including Aspergillus eucalypticola and 

Aspergillus amoenus were identified for the first time in Europe. Further studies are in progress to 

examine the mycotoxin producing abilities and genetic variability of the isolates identified, and to 

examine the mycotoxin content of the samples. 

Key words: Aspergillus, cereals, onions, aflatoxins, fumonisins, climate change 

INTRODUCTION 

Mycotoxins are secondary metabolites of filamentous fungi which are harmful to 

animals and humans, and able to provoke various disease symptoms (Varga et al., 2009). 

Aflatoxins are among the most important mycotoxins, which are produced by species 

assigned to the Aspergillus genus. Among the numerous aflatoxins described, aflatoxin B 1

212 Role of 

is the most toxic, being a potent genotoxic carcinogen in laboratory animals and with strong 

evidence for its liver carcinogenity in humans. Aflatoxin B 1 exhibits hepatocarcinogenic 

and hepatotoxic properties, and is referred to as the most potent naturally occurring 

carcinogen. The International Agency for Research on Cancer has classified aflatoxin B 1 as 

a group I carcinogen. The most important producer, Aspergillus flavus, is also an important 

pathogen of various cultivated plants including maize, cotton and peanut causing serious 

yield losses throughout the world. Since aflatoxin production is favoured by moisture and 

high temperature, A. flavus is able to produce aflatoxins in warmer, tropical and subtropical 

climates (Varga et al., 2009). Consequently, aflatoxin contamination of agricultural 

products in countries with temperate climate, including Central European countries, is not 

treated as a serious health hazard. However, climate change associated with global warming 

seems to change the scenario. Based on recent studies, aflatoxin producing fungi and 

consequently aflatoxins are expected to become more prevalent with climate change in 

countries with temperate climate (Paterson and Lima, 2010). Indeed, several recent reports 

have indicated the occurrence of aflatoxin producing fungi and consequently aflatoxin 

contamination in agricultural commodities in several European countries that did not face 

with this problem before (Dobolyi et al., 2011). These observations led us to examine the 

occurrence of potential mycotoxigenic Aspergillus species in Central European agricultural 

products. 


Sample collection 

The cereal samples were collected from various cereal growing regions of Hungary 

in 2010 and 2011. The cereals examined included wheat, maize and barley. Onion samples, 

nuts and spices were also collected in this period from various outlets and stores in Central 

Europe including Hungary, Serbia and Romania. The samples were surface sterilized using 

ethanol, and plated onto dichloran rose bengal (DRBC) media (King et al., 1979). Plates 

were incubated at 25 °C in darkness and monitored periodically for characteristic mycelium 

growing from the kernels. Outgrowing mycelia were purified and transferred to malt extract 

agar (MEA) and/or Czapek-Yeast Extract agar (CYA) media without antibiotics. Isolates 

were subcultured as single conidia on MEA, PDA and CYA plates (Samson et al., 2004). 

Genotypic studies 

The cultures used for the molecular studies were grown on malt peptone (MP) broth 

for 2 days, and DNA was extracted from the mycelia using the Masterpure yeast DNA 

purification kit (Epicentre Biotechnol., USA) according to the instructions of the 

manufacturer. Part of the calmodulin gene was amplified and sequenced as described by 

Pildain et al. (2008). Calmodulin sequences were compared using nucleotide-nucleotide 

BLAST (blastn) with default settings (http://blast.ncbi.nlm.nih.gov) to the Genbank 

database, and to our own sequence database. Species identification was determined from 

the lowest expect value of the BLAST output. 


Occurrence of Aspergilli on cereals 

We examined the occurrence of potential aflatoxin producing fungi in cereals in 

Hungary. The surface-sterilized cereal seeds were placed on selective media, and the


isolated fungal strains were identified using morphological and sequence-based methods. 

Among the examined samples, several isolates were found to be members of section Flavi 

of the genus Aspergillus based on colony morphology and microscopic features (Figure 1). 

Species assignment of the isolates was carried out using partial sequence analysis of the 

calmodulin gene. In spite of their high morphological variability, all isolates proved to 

belong to the Aspergillus flavus species based on calmodulin sequence data. The proportion 

of the positive samples varied: 0.83%, 2.00% and 3.17% rates were observed for maize, 

barley and wheat, respectively. None of the cereal samples were found to be contaminated 

by aflatoxins (data not shown). Examination of aflatoxin producing abilities of the isolates 

is in progress. According to preliminary results, several of the isolates were able to produce 

aflatoxins B 1 and B 2 (Figure 2). 

Figure 1. Aspergillus flavus and A. niger contamination of stored wheat. 

Figure 2. HPLC-FLD chromatogram of aflatoxins produced by one of the Aspergillus flavus 

isolates collected from wheat.

214 Role of 

Besides A. flavus, several other potential mycotoxin producers were identified in the 

samples. The patulin producer A. clavatus and black Aspergilli able to produce both 

ochratoxins and fumonisins were recovered from several samples. 

Occurrence of black Aspergilli on onions 

Black mold rot caused by black Aspergilli is often responsible for severe damage of 

onion bulbs during storage. Infected onion bulbs have a black discoloration at the neck, 

shallow lesions on the outer scales, streaks of black mycelium and conidia beneath the outer 

scales and a black discoloration in bruised areas. The disease commonly occurs on onions 

stored at high ambient temperatures. Contaminated seeds and soil appear to constitute the 

main inoculum source. The species responsible for black mold rot is usually referred to as 

Aspergillus niger. We examined the mycobiota and fumonisin contamination of mouldy 

onion bulbs purchased in Hungary. All except one of the examined mouldy samples were 

found to be contaminated with black Aspergilli, which could be isolated both from the outer 

dry and the inner fleshy scales of onion bulbs. Species assignment of the isolates was 

carried out using sequence analysis of part of the calmodulin gene. Sequence data revealed 

that all 35 black Aspergilli isolated from onions belong to the Aspergillus awamori species. 

Two of the examined onion samples were found to be contaminated with fumonisins at a 

low rate (ca. 0.3 mg kg -1 ; data not shown). This is the first report on fumonisin 

contamination of onion bulbs. 

Occurrence of Aspergilli on spices and nuts 

Several spice and nut samples were collected in outlets and stores in Hungary and 

Serbia. Besides A. flavus, several potential mycotoxin producing species including A. 

westerdijkiae, A. melleus, A. terreus, A. awamori and A. niger have also been identified on 

nuts and spices (chilli, red pepper, spice mixes). Several species including Aspergillus 

eucalypticola and Aspergillus amoenus were identified for the first time in Europe (data not 

shown). Further studies are in progress to examine the mycotoxin producing abilities and 

genetic variability of these species. 


This work was supported by OTKA grant Nos. K84122 and K84077. The project is 

co-financed by the European Union through the Hungary-Serbia IPA Cross-border Cooperation 

Programme (ToxFreeFeed, HU-SRB/1002/122/062), and by the European Union 

and co-funded by the European Social Fund (“Broadening the knowledge base and 

supporting the long term professional sustainability of the Research University Centre of 

Excellence at the University of Szeged by ensuring the rising generation of excellent 

scientists”; TÁMOP-4.2.2/B-10/1-2010-0012). Beáta Tóth was supported by the János 

Bolyai Research Scholarship of the Hungarian Academy of Sciences. 

REFERENCES 

Dobolyi, C., Sebők, F., Varga, J., Kocsubé, S., Szigeti, G., Baranyi, N., Szécsi, Á., Lustyik, G., 

Micsinai, A., Tóth, B., Varga, M., Kriszt, B., Kukolya, J. (2011): Aflatoxin-termelő 

Aspergillus flavus törzsek előfordulása hazai kukorica szemtermésben. Növényvédelem, 

47: 125-133 (in Hungarian).


King, A.D.JR., Hocking, A.D. , Pitt, J.I. (1979): Dichloran-rose bengal medium for enumeration 

and isolation of molds from foods. Applied and Environmental Microbiology, 37: 959– 

964. 

Paterson, R.R.M., Lima, N. (2010): How will climate change affect mycotoxins in food? Food 

Research International, 43: 1902-1914. 

Pildain, M.B., Frisvad, J.C., Vaamonde, G., Cabral,D., Varga, J., Samson, R.A. (2008): Two 

novel aflatoxin-producing Aspergillus species from Argentinean peanuts. International 

Journal of Systematic and Evolutionary Microbiology, 58: 725-735. 

Samson, R. A., Hoekstra, E. S., Frisvad, J. C. (2004): Introduction to Food- and Airborne Fungi. 

7 th edition. CBS Fungal Biodiversity, Center, Utrecht, Netherlands. 

Varga, J., Frisvad, J.C., Samson, R.A. (2009): A reappraisal of fungi producing aflatoxins. 

World Mycotoxin Journal, 2: 263-277.

216 The most important olive disease in Montenegro 


Proceedings 

THE MOST IMPORTANT OLIVE DISEASES IN MONTENEGRO 

JELENA LATINOVIĆ, JELKA TIODOROVIĆ, NEDELJKO LATINOVIĆ 

University of Montenegro, Biotechnical faculty, Podgorica, Montenegro 

An overview of the most important olive diseases and their causal agents in Montenegro has 

been presented in the paper. 

Keywords: Olive diseases, Montenegro 

Olive is a typical Mediterranean plant species, and is grown primarily between 30° 

and 45° N latitude. It is an evergreen and long-lived plant. 

In Montenegro olive is grown mainly in coastal areas, although it also grows in the 

modified Mediterranean climate of the Zetsko-Bjelopavlićka plain. Olive cultivation is an 

ancient tradition in Montenegro. Extremely old groves include two outstanding specimens, 

the ‘Old olive tree’ in Bar and the ‘Big olive tree’ near Budva, estimated to be more than 

2,000 years old. 

Montenegrin olive orchards cover 3,200 ha, comprising one-third of the total area 

in the country that is under fruit cultivation. Approximately 70% of groves are traditional 

ones with trees more than 100 years old. The terrains of olive growing areas are either 

sloped with very high inclination or foothills of the mountain massifs. 

The most widespread olive cultivar in Montenegro is ”Žutica“ which predominates 

especially in the southern sub-area of olive production, comprising 95-98% of the trees. 

”Žutica“ and ”Sitnica“ are for oil production, ”Lumbardeška“ for table olive, and ”Crnica“ 

for both purposes. There are also some introduced olive cultivars, mostly for table use, but 

their cultivation is limited to small areas. 

Olive diseases are among the factors that could jeopardise olive production. In 

Montenegro the most important disease is caused by the fungus Spilocea oleaginea (Cast.) 

Hugh., since the prevailing domestic olive cultivars are very susceptible to the mentioned 

parasite. The fungus Botryosphaeria dothidea (former name Sphaeropsis dalmatica (Thüm) 

Gigante) is second according to economic impact. Pseudomonas syringae pv. savastanoi 

(Smith) Young occurs in significant extent only on some susceptible introduced cultivars 

which are not widespread. Pseudocercospora cladosporioides (Sacc.) U. Braun seems to be 

dangerous to some introduced cultivars for table use, whereas Colletotrichum 

gloeosporioides (Penz.) Penz. & Sacc. causes significant damage affecting both immature 

and ripe fruit of several introduced and local varieties. Recently, Verticillium dahliae 

(Kleb). was found on cv. ”Leccino“ and its importance could increase in the future, since 

the pathogen is found in many surrounding countries from which olives are imported. Other 

parasites, such as Marthamyces panizzei (De Not.) Minter and Hysterographium fraxini 

(Pers.) De Not., occur sporadically.

Jelena Latinović, Jelka Tiodorović, Nedeljko Latinović 217 

Olive leaf spot or peacock spot is the disease caused by fungus Spilocea oleaginea 

(Cast.) Hugh. (=Cycloconium oleaginum Cast.). Symptoms are the most evident on leaves 

as sooty blotches that develop into greenish-black circular spots measuring up to 6 mm in 

diameter. Around the spot may be a faint yellow halo. The spots sometimes merge into each 

other. The symptoms look like the eye spot on the tail feathers of a peacock which was the 

reason for the disease name (Fig. 1). Infected leaves fall prematurely by summer. A drastic 

reduction in foliage each year means several months of reduced photosynthesis which 

results in poor twig growth and poor fruit set. Infections can occur throughout the year and 

are normally associated with rainfall and moderate temperatures (optimum 14-19 °C). This 

is the reason why, in Montenegrin conditions, infections are usually correlated with autumn 

and spring rains. High temperatures restrict spore germination and growth of the fungus, 

making the disease inactive during summer. The pathogen has very reduced conidiophores 

bearing brown, two-celled conidia with average size 20,7 × 9,7 µm. Conidia germinate at 

temperatures between 7 ° and 28 °C (Mijušković, 1999). To control the disease, infected 

trees should be thoroughly sprayed with a copper containing fungicide in late autumn. If the 

problem is severe, then another application may be needed in early winter. This treatment 

often eradicates the problem completely. 

Figure 1. Spilocea oleaginea - Olive leaf spot symptoms 

(Original photo taken by N. Latinović)


Olive fruit rot has caused severe damage in olive orchards in Montenegro in recent 

years. Identity of fungal isolates obtained consistently from infected fruit was confirmed by 

morphological and molecular evidence as Botryosphaeria dothidea (anamorph: Fusicoccum 

aesculi) (Latinović, 2006). This disease was initially recorded during surveys in 

Montenegro in 1954 and 1986, when the pathogen was identified as Sphaeropsis dalmatica 

(Thüm) Gigante (Mijuškovic, 2002). Although fruit rot did not cause significant damage 

prior to 2000, during the last decade it has become widespread and now is one of the 

economically most important olive diseases in Montenegro. On naturally infected fruit, the 

disease causes necrotic, depressed, mostly rounded spots with clearly limited edges, but in 

some cases decay spread over the entire fruit surface (Fig. 2). Under disease-favourable 

conditions, black pycnidia appear on the epidermis, exuding conidia in orange-colored 

drops. Physical injuries from stings by the olive fly (Bactrocera oleae Gmelin) are readily 

invaded by the pathogen, promoting disease development. Therefore, one of the most 

important measures in disease management is control of the olive fly by insecticide sprays, 

sometimes in combination with copper containing fungicides. Olive fruit rot fungus forms 

well developed, velvety, gray to dark olive green colonies on potato dextrose agar (PDA). 

Figure 2. Botryosphaeria dothidea - Symptoms on naturally infected olive fruits 

(Original photo taken by J. Latinović) 

Mainly stromatic growth was formed on this nutrient medium, but sometimes 

pycnidia were formed as well. From these mature pycnidia, conidia gathered in masses of 

mucilaginous dirty-white to light-gray color could be secreted. In pycnidia, hyaline 

conidiophores with elongated-cylindrical shape are formed. Unicellular conidia are formed 

on conidiophores. Conidia are straight, colorless, aseptate and thin-walled, with shape that 

varies from narrow ellipsoid, cylindrical-oval with rounded and slightly narrower ends to 

spindle-like. Their cytoplasm is finely granulated and their average dimensions are (16.50-) 

22.19 (-26.40) × (4.95-) 7.51 (-9.90) µm. Mycelium from seven fungal isolates obtained 

from main olive production areas in Montenegro was used to extract DNA. PCR products

Jelena Latinović, Jelka Tiodorović, Nedeljko Latinović 219 

after their purification were sent to sequencing, using both primers in order to obtain the 

complete sequence for each strain. Nucleotide sequences of the ITS region (complete 

sequences of ITS and 5.8S rDNA and partial sequences of 18S and 28S rDNA) were 

compared with others from EMBL data base and all Montenegrin isolates appeared to be 

indistinct to the other B. dothidea isolates suggesting unequivocally their belonging to that 

species. They formed a group with isolates both from the same host (olive) and from other 

different hosts confirming the wide pathogenicity of this fungus. Therefore, based on 

morphological features and phylogeny, the identity of the fruit rot pathogen in Montenegro 

is confirmed as B. dothidea (Latinović, 2006). 

Olive verticilliosis was not a significant disease in Montenegro years ago, but lately, 

with introduction of susceptible foreign cultivars, it appeared to be more significant. A 

survey of olive orchards throughout the Montenegrin seacoast in spring of 2006 revealed 

the occurrence of wilted olive young trees of cv. ”Leccino“ in the Bar region. Affected 

stems and leaves lost their greenish hue and become light brown in colour, and the leaves 

curled downward. Cross sections of diseased branches revealed darkening of xylem tissue. 

Wilting was progressive over the course of the growing season. A fungus was consistently 

isolated in May on potato dextrose agar (PDA) from xylem tissue of symptomatic branches 

at the margin between discoloured and healthy-looking tissue. Identification was made after 

incubation at 25 ºC in darkness for 10-15 days. Morphological features of the obtained 

isolates (verticillate shaped conidiophores and abundant production of microsclerotia) 

corresponded to the descriptions of Verticillium dahliae (Kleb). A pathogenicity test was 

done according to Koch’s rules. Artificial inoculations of two-year-old healthy olive plants 

were performed to verify the hypothesis that the fungus was the causal agent of the disease. 

Inoculations were made by watering olive plants with suspensions of fresh conidia (from 

fungal colonies cultured on PDA) in sterile distilled water. Olives treated in the same way 

just with sterile distilled water were used as a control. All plants were kept under the same 

controlled conditions (temperature 25 ± 1°C and adequate humidity). During subsequent 

weeks, first chlorosis of the leaves and then wilt of the entire inoculated plants began to 

appear, while on the control plants symptoms were absent. At the end of June, V. dahliae 

was reisolated on PDA from all inoculated plants, whereas attempts to isolate the pathogen 

from control plants were negative (Latinović and Vučinić, 2010). 

Olive anthracnose (Colletotrichum gloeosporioides Penz. & Sacc.) can cause 

significant yield loss in table olives and also decrease olive oil quantity and quality. It is 

observed only on infected ripe olive fruit with symptoms as brown depressed lesions of 

fruit tissue. In these rotted spots, slimy orange-colored masses of spores are produced under 

high humidity. The isolates on PDA show a velvety, grey mycelium with numerous black 

acervuli. Conidia are one-celled, hyaline and elliptical with average size 14,20 × 4,21 µm. 

Optimal temperature for growth of the fungal isolates was 25 °C, while there was no fungal 

growth at 3 ° and 34 °C. Eight hours per day of direct sunlight could lead to almost total 

inhibition of conidia germination. Conidia germinate in water drops as well as at relative 

humidity ≥ 98% (Latinović, 2001). Infected mummified olive fruit that hang on branches 

and fruit dropped on the soil surface represent the permanent source of inoculums. Infected 

fruits dug into soil at depths of 10-15 cm cannot serve as inoculum for the following year. 

Since olive fruit mature in October and November, these two months could be considered 

as a critical period for appearance and spreading of the disease in Montenegro, if the 

climatic factors, primarily rainfall and temperature, are favourable for infection. In order to 

control the disease, pruning the trees to improve airflow into the canopy and reducing 

moisture together with gathering and destruction of diseased fruits will help minimise the 

infection. Removal of plant debris by deep plowing prevents fungal survival. However, the


main method used to control anthracnose in olives is to apply a preventative spray of 

copper fungicides. If the disease pressure is high and environmental conditions are 

favourable, several copper sprays throughout the growing season may be required. 

Cercosporiose of olive (Pseudocercospora cladosporioides) causes sooty-mold-like 

symptoms on the underside of the leaves. Leaves subsequently turn yellow, reddish-brown 

and then dropped. The fungus can cause serious defoliation. Besides leaves, fruits can also 

be affected. In Montenegro the most significant fruit damage was recorded in the 

introduced cv. ”Itrana”, while the most significant leaf damage was in cv. ”Picholine“ 

(Vučinić, 1994). Conidiophores of the fungus are mostly unbranched, bearing conidia on 

their tips. Conidia are olivaceous-brown, apex obtuse, straight or often curved, 3-8 septate, 

58 x 3.7 µm in average. If olives are treated against peacock spot disease (copper 

fungicides), cercosporiose is reduced as well. 

Olive knot is caused by a bacterium, Pseudomonas syringae pv. savastanoi. The 

disease is not widespread in Montenegro since the most important local cv. ”Žutica“ is 

quite resistant (Mijušković, 1999). The bacterium infects olive trees through wounds and 

causes forming of galls. These galls are most common on twigs and young branches, but 

will also form around wounds on the main trunk and on damaged leaves. The bacteria could 

enter through wounds during leaf fall and wounds made from pruning, harvesting, hail or 

frost. Most infection occurs with wet weather in spring. Once it is established the disease is 

difficult to eradicate. Therefore infection should be prevented by avoiding wounding the 

trees, providing good growing conditions, avoiding over-fertilization, removing alternative 

host plants such as oleander, pruning the trees during dry weather in summer, pruning 

healthy plants first, disinfection of tools after pruning suspect trees, harvesting during dry 

weather and avoidance of harvesting by beating as it may cause wounds. Copper sprays 

should be applied throughout the year if it is required. 

Other parasites such as Marthamyces panizzei and Hysterographium fraxini occur 

sporadically (Mijušković at al., 1989). 

Study on major olive diseases in Montenegro will be continued. 

REFERENCES 

Latinović, J. (2001): Studies on basic characteristics of Colletotrichum gloeosporioides (Penz.) 

Penz. & Sacc., a new olive pathogen for Montenegro. MSc thesis, Faculty of Agriculture, 

University of Belgrade. 

Latinović, J. (2006): Study on Sphaeropsis dalmatica (Thüm.) Gigante, causal agent of olive 

fruit rot on the Montenegrin coast. PhD thesis, Faculty of Agriculture, University of 

Belgrade. 

Latinović, J., Vučinić, Z. (2010): First report of Verticillium dahliae on olives in Montenegro. 

Petria 20 (2): 253-254. 

Mijušković, M., Vučinić, Z., Tiodorović, J. (1989): Some important olive diseases in 

Montenegro. Agriculture and Forestry, 35, 3-4: 115-126. 

Mijušković, M. (1999): Diseases and pests of subtropical plants. University of Montenegro, 

Biotechnical Institute, Podgorica. 

Mijušković, M. (2002): Contributions to the study of plant diseases in Montenegro. Montenegrin 

Academy of Sciences and Arts. Podgorica. 

Vučinić, Z. (1994): Susceptibility of some olive tree cultivars in Montenegro to Cercospora 

cladosporioides Sacc. Acta Horticulturae, No 356: 386-389.

Darko Vončina, Darko Preiner, Darko Radović,... 221 


Proceedings 

PREVALENCE OF VIRUSES IN AUTOCHTHONOUS GRAPEVINE 

CULTIVARS FROM CROATIAN CONTINENTAL AND COASTAL 

VINE-GROWING REGIONS 

DARKO VONČINA 1 , DARKO PREINER 2 , DARKO RADOVIĆ 3 , EDI MALETIĆ 2 , 

JASMINKA KAROGLAN KONTIĆ 2 

1 

Department of Plant Pathology, University of Zagreb, Faculty of Agriculture, Svetošimunska 25, 

10 000 Zagreb, Croatia 

2 

Department of Viticulture and Enology, University of Zagreb, Faculty of Agriculture, 

Svetošimunska 25, 10 000 Zagreb, Croatia 

3 

Student of Plant Protection, University of Zagreb, Faculty of Agriculture, Svetošimunska 25, 10 000 

Zagreb, Croatia 

The investigation of occurrence of nine grapevine viruses (ArMV, GFLV, GFkV, GLRaV-1, 

2, 3 and 7, GVA and GVB) using ELISA was conducted on Croatian autochthonous grapevine 

cultivars included in clonal selection from Coastal vine-growing region (Babić and Plavac mali) and 

from Continental region on cv. Moslavac and some cvs. typical for subregion Hrvatsko zagorje. Out 

of 383 tested plants 312 (81.5%) were infected with at least one virus, while mixed infections with 

two (28.9%) or even tree (17.8%) viruses were not rare, especially in Coastal region. In Continental 

region dominant viruses were GLRaV-1 (38.9%) and GFkV (31.1%), while in Coastal region 

dominant were GVA (72.2%) and GLRaV-3 (71.8%). Occurrence of GLRaV-1 (45.8%), GFLV 

(31.5%) and GLRaV-2 (10.7%) in Coastal region and GVA (22.2%) in Continental region was also 

notable.ArMV and GVB in both regions were found scarcely. In general, better sanitary status was 

determined in Continental region, especially in cv. Moslavac where almost 45% of analyzed plants 

were free of all viruses included in investigation. In cv. Babić virus-free plants were not found, while 

in case of cv. Plavac mali and cvs. from subregion Hrvatsko zagorje infection rates were very high 

(95.9% and 92% respectively). 

Key words: Croatian autochthonous Vitis vinifera L. cultivars, viruses, ELISA 

INTRODUCTION 

Viticulture in Croatia presents important branch of national economy. Due to 

different climatic conditions, Croatia is divided in two main vine-growing regions: 

Continental with features of middle European climate and Coastal with Mediterranean 

climate. Beside cultivation of well known introduced grapevine cultivars, very important 

role is given to autochthonous cultivars, especially in Coastal region where they are 

represented with almost 80% of total wine production (Pejić et al., 2000). Today, on 

officially variety list there are 197 cultivars among which around 70 are autochthonous 

(Maletić et al., 2007), but according to our research there are more than 130 autochthonous

222 Prevalence of viruses in autochthonous grapevine cultivars from... 

cultivars in Croatia. Most of them are currently not economically important, but can be 

valuable for future, and for this reason are placed in national collection of native grapevine 

cultivars located in experimental station Jazbina (Faculty of Agriculture Zagreb). In last 

decade, there is an increased interest for production of wines from autochthonous grapevine 

cultivars, and this can be clearly seen trough more than 300% increase in production of 

their planting material: 0,75 mil. in the year 2004. to more than 2,5 mil. in the year 2011. 

(Andabaka et al., 2011). 

Beside fungal and bacterial diseases very important role in production of grapes, 

wines and planting material have viral diseases. They can cause significant yield quality 

and quantity reduction, can have negative impact on vigor of infected plant and reduction of 

vineyard exploitation period. In production of planting material they can decrease rooting 

ability and cause scion-rootstock incompatibility. Their negative impact is enhanced by the 

fact that once infected plant remains infected for whole life (Walter and Martelli, 1996). 

In the same time, sanitary and clonal selection of most important Croatian 

autochthonous grapevine (Vitis vinifera L.) cultivars is still not completed, and this 

represents a great danger in further spreading of grapevine viral diseases, mainly trough 

infected planting material. According to mentioned the main object of present survey was 

to determine prevalence of viral diseases in autochthonous grapevine cultivars typical for 

Coastal region (Plavac mali and Babić), and for some cultivars from Continental region: 

Moslavac and cultivars typical for viticultural subregion Hrvatsko zagorje. 


The investigation was conducted on Croatian autochthonous grapevine (Vitis 

vinifera L.) cultivars included in clonal selection. Two cultivars were from Coastal vinegrowing 

region: Plavac mali and Babić, while in Continental region the object of 

investigation was cv. Moslavac and mixed group of autochthonous grapevine cvs. typical 

for subregion Hrvatsko zagorje. The collecting of samples, which consisted of three well 

wooded cuttings per plant, for cvs. Plavac mali and Babić was done during September 

2007, while in case of cvs. from Continental region collecting was done during February 

2011. Collected samples were labeled, sealed in plastic bags and kept in refrigerator on 4ºC 

until testing. The total of 148 samples of cv. Plavac mali were collected from 9 different 

locations on peninsula Pelješac, Babić was represented by 68 samples collected from 3 

locations in surroundings of Primošten, Moslavac by 142 samples from 7 locations in 

subregion Međimurje while cvs. from subregion Hrvatsko zagorje were presented by 25 

samples collected from 9 locations (Figure 1.). All plants were tested using ELISA on 

presence of 9 viruses: Arabis mosaic virus (ArMV), Grapevine fanleaf virus (GFLV), 

Grapevine fleck virus (GFkV), Grapevine leafroll-associated viruses 1, 2, 3 and 7 (GLRaV- 

1, GLRaV-2, GLRaV-3 and GLRaV-7), Grapevine virus A (GVA) and Grapevine virus B 

(GVB). The ELISA-tests were done using commercial kits provided by Agritest 

(Valenzano, Italy) according to manufacturer's instructions. As a potential source of antigen 

cortical shavings taken from 3 cuttings per sample/plant were mixed together and used. The 

results were determined with an EL800 spectrophotometer (BioTek, USA) at a wavelength 

of 405 nm one or two hours (depending on virus) after adding substrate - p- 

nitrophenylphosphate (Sigma, USA). Positive were considered samples with absorbance 

value greater than three times the average value of negative controls.


Figure 1. Sampling regions of Croatian autochthonous grapevine cultivars included in investigation 

RESULTS 

From nine viruses included in investigation only presence of GLRaV-7 was not 

confirmed in any sample, while presence of other viruses was determined in different 

ranges depending on cv. and sampling location. Detailed review of ELISA-results for 

different Croatian autochthonous grapevine cvs. grown in different regions is given in 

Table 1, while determined mixed virus infections are shown in Table 2. 

Table 1. The results of ELISA conducted on 383 plants of Croatian autochthonous Vitis vinifera 

L. cultivars: Babić, Plavac mali, Moslavac and those from vine-growing subregion 

Hrvatsko zagorje. All plants were tested on presence of nine viruses (ArMV, GFLV, 

GFkV, GLRaV-1, GLRaV-2, GLRaV-3, GLRaV-7, GVA and GVB). Presence of 

GLRaV-7 was not confirmed 

Cultivar 

No. of different 

locations/ 

vineyards 

Babić 

3 

Plavac mali 

9 

TOTAL for 

Coastal region 

Moslavac 

7 

Cultivars from 

Hrvatsko zagorje 

9 

TOTAL for 

Contitnental 

region 

TOTAL 

OVERALL 

No. of 

tested 

plants 

68 

148 

216 

142 

25 

167 

383 

Infected 

samples 

No. 

% 

68 

100.0 

142 

95.9 

210 

97.2 

79 

55.6 

23 

92,0 

102 

61.1 

312 

81.5 

No. of plants infected with certain virus 

(%) 

ArMV GFLV GFkV GLRaV-1 GLRaV-2 GLRaV-3 GVA GVB 

0 

14 

9.5 

14 

6.5 

2 

2.9 

66 

44.6 

68 

31.5 

0 0 

3 

12.0 0 

3 

1.8 

17 

4.4 

0 

68 

17.8 

13 

19.1 

18 

12.2 

31 

14.4 

35 

24.7 

17 

68.0 

52 

31.1 

83 

21.7 

4 

5.9 

95 

64.2 

99 

45.8 

46 

32.4 

19 

76.0 

65 

38.9 

164 

42.8 

22 

32.4 

1 

0.7 

23 

10.7 

0 

0 

0 

23 

6.0 

68 

100.0 

87 

58.8 

155 

71.8 

10 

7.0 

4 

16.0 

14 

8.4 

169 

44.1 

57 

83.8 

100 

67.6 

157 

72.7 

25 

17.6 

12 

48.0 

37 

22.2 

194 

50.7 

4 

5.9 

1 

0.7 

5 

2.3 

0 

2 

8.0 

2 

1.2 

7 

1.8

224 Prevalence of viruses in autochthonous grapevine cultivars from... 

Table 2. The review of mixed virus infections determined in different Croatian autochthonous 

Vitis vinifera L. cultivars 

Cultivar 

No. of 

tested 

plants 

No. of 

plants free 

from all 9 

tested 

viruses 

% 

No. of samples/plants infected with different No. (1-6) of viruses 

% 

1 2 3 4 5 6 

Babić 68 

0 3 37 20 7 1 

4.4 54.4 19.4 10.3 1.5 

0 

Plavac mali 148 

6 19 52 36 24 11 

4.1 12.8 35.1 24.3 16.2 7.4 

0 

Moslavac 

62 54 18 6 2 

142 

43.7 38.0 12.7 4.2 1.4 

0 0 

Cultivars from 

2 

8 4 6 2 2 1 

25 

Hrvatsko zagorje 

8.0 32.0 16.0 24.0 8.0 8.0 4.0 

TOTAL 383 70 84 111 68 35 14 1 

% - 18.3 21.9 28.9 17.8 9.1 3.7 0.3 

DISCUSSION 

Even due to the fact that investigated plants of Croatian autochthonous grapevine 

cvs. were included in clonal selection and most of them were without noticeable symptoms 

of viral infections obtained results revealed high viral infection rates, especially with certain 

viruses. In case of cv. Babić all tested plant were infected with at least GLRaV-3. Similar 

situation was with cv. Plavac mali and cvs. from Hrvatsko zagorje (infection rate over 

90%), while conditionally acceptable sanitary status was determined in Moslavac - almost 

45% plants were free of all tested viruses. In exclusion of 3 locations under cv. Plavac mali 

with GLRaV-1 infection over 90% in overall Coastal region dominant were GLRaV-3 and 

GVA, while in Continental region dominant were GLRaV-1 and GFkV. Mentioned results 

are in correspondence with previous investigations done in Coastal and Continental region 

(Karoglan Kontic et al., 2009) and investigation conducted on autochthonous grapevine 

cultivars typical for Istria (Poljuha et al., 2010). Also, similar results were determined in 

Italy where occurrence of GLRaV-3 was highest in southern part of country; while in 

northern part dominant was GLRaV-1 (Savino et al., 2001). The cause of mentioned 

phenomena is unknown, but besides using infected planting material maybe it has some 

anchorage in different appearance of their insect vectors, mealybugs and soft scale insects, 

in different regions. Beside single infections in cv. Babić and Plavac mali, complex 

infections with two viruses (Babić 54.4%, Plavac mali 35.1%), consisted mostly from 

combination of GLRaV-3 and GVA, and tree viruses (Babić 19.4%, Plavac mali 24.3%) 

were also notable. Only 70 (18.3%) plants were free of all nine tested viruses, most of 

which were found in Continental region (91.4%). The results of conducted investigation 

indicated high viral infection rate and deteriorated sanitary status of Croatian autochthonous 

grapevine cultivars, especially those grown in Coastal region, and supported the fact that 

latent viral infections are not rare so sanitary and clonal selection must be performed 

simultaneously. 


This work was supported by the Croatian Ministry of Science, Education and Sport 

by the grants no. 178-1781844-2692 and 178-1781844-2758.


REFERENCES 

Andabaka, Ž., Stupić D., Marković, Zvjezdana, Preiner, D. (2011): Novi trendovi u proizvodnji 

sadnog materijala autohtonih sorata vinove loze u Hrvatskoj. Glasnik zaštite bilja 34 (1): 

46-56. 

Karoglan Kontić, Jasminka, Pejić, I., Maletić, E., Sladonja, Barbara, Poljuha, Danijela, Vokurka, 

A., Zdunić, G., Preiner, D., Šimon, S., Ruehl, E. (2009): Virus Diseases Screening in 

Clonal Selection of Croatian Grapevine Cultivars. 9th International Conference on Grape 

Genetics and Breeding, Udine, Italy, Acta Horticulturae 827: 623-626. 

Maletić, E., Karoglan Kontić, Jasminka, Pejić, I., Preiner, D., Šimon, S. (2007): Grapevine 

genetic resources in Croatia - Preservation, evaluation and revitalization of 

autochthonous varieties. Conference on Native Breeds and Varieties as part of Natural 

and Cultural Heritage, Šibenik, November 13-16, Book of Abstracts: 166-167. 

Pejić, I., Maletić, E., Karoglan Kontić Jasminka, Kozina B., Mirošević N. (2000): Diversity of 

autochthonous grapevine genotypes in Croatia. Acta Horticulturae, 528: 67-73. 

Poljuha, Danijela, Sladonja, Barbara., Bubola, M. (2010): Incidence of viruses infecting 

grapevine varieties in Istria (Croatia). Journal of Food, Agriculture & Environment, vol. 

8: 166-169. 

Savino, V., La Notte, P., Bottalico, G., Cardone, A., Martelli, G. P. (2001): Situazione sanitaria 

della vite in Italia Centro-Meridionale. Quaderni della Scuola di Specializzazione in 

Scienze Viticole ed Enologiche n. 25: 67-76. 

Walter, B., Martelli, G. P. (1996): Selection clonale de la vigne: selection sanitaire et selection 

pomologique. Influence des viruses et qualite. 1ere partie: Effects des viruses sur la 

culture des vignes et ses produits. Bulletin del’OIV, 69: 945-971.

226 Incidence of virus infections on different peach culivars in Montenegro 


Proceedings 

INCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH 

CULTIVARS IN MONTENEGRO 

ZINDOVIĆ JELENA, 1 BOŽOVIĆ VLADAN, 1 MILADINOVIĆ ZORAN, 2 

RUBIES AUTONELL CONCEPCION 3 , RATTI CLAUDIO 3 

1 

University of Montenegro, Biotechnical Faculty, Mihajla Lalića 1, 20000 Podgorica, 

Montenegro, jelenazindovic@yahoo.com 

2 

AD Plantaže, Put Radomira Ivanovića 2, 20000 Podgorica, Montenegro 

3 

DiSTA – Patologia Vegetale, Università di Bologna, Viale G. Fanin, 40 - 40127 Bologna, Italy. 

Nine peach cultivars were examined for the presence of nine viruses in the most important 

peach-growing area in Montenegro. Molecular analysis of 58 samples confirmed the presence of 

Plum pox virus (PPV), Prunus necrotic ringspot virus (PNRSV) and Prune dwarf virus (PDV). PPV 

was found to be prevailing virus, with an incidence ranging from 50 to 83.3% in assessed peach 

cultivars. Results showed the absence of Apple chlorotic leaf spot virus (ACLSV), Peach mosaic 

virus (PMV), Cherry mottle leaf virus (CMLV), Strawberry latent ringspot virus (SLRSV), Tobacco 

ringspot virus (TRSV) and Tomato ringspot virus (ToRSV) from all assayed samples. Eight PPV, two 

PNRSV and one PDV isolate were cloned, sequenced and analysed by BLAST analysis. In particular, 

phylogenetic analysis of CP nucleotide sequences of eight PPV isolates from infected peach cultivars 

was reported. The phylogenetic studies revealed that all investigated PPV isolates clustered within 

PPV-M group. 

Key words: peach, RT-PCR, peach viruses, PPV, phylogenetic analysis 

INTRODUCTION 

Among the stone fruits grown in Montenegro, plum is the most important and 

widespread crop. Peach fruit production ranking second with a surface of about 185 ha 

(Anonymous, 2011). The most important peach-growing area is situated in Ćemovsko field 

in the vicinity of Podgorica and represents 45% of Montenegrin production. 

Peach can be infected by many virus and virus-like diseases (Nemeth, 1986), but 

mainly with PPV, PNRSV, PDV and ACLSV. Except than for PPV (Viršček-Marn et al., 

2012), no survey was done regarding peach viruses in Montenegro. 

The aim of this study was to investigate sanitary status of different peach cultivars in 

the most important peach-growing area in Montenegro. 


In September and October 2011, chlorotic rings and spots, vein clearing, mosaic, 

necrosis, leaf distortion, stunting and rosette formation were observed in biggest

Zindović Jelena, Božović Vladan, Miladinović Zoran,... 227 

commercial peach orchard (around 85 ha) in Montenegro. Symptomatic leaves were 

collected from 16 - 17 years old plants of nine different peach cultivars: Adriana, Caldesi, 

Gloria, Maria Marta, May Crest, Morsiani, Rita Star, Spring Belle, Spring Crest. Extraction 

of total RNAs was performed using RNeasy Plant Mini kit (Qiagen Hilden, Germany). 

Samples were assayed by RT-PCR using different sets of primers for detection of ACLSV, 

PNRSV, PPV, PDV, PMV, CMLV, SLRSV, TRSV and ToRSV (Table 1). Selected PCR 

products corresponding to complete CP gene of eight PPV (1,276 bp) this amplified 

product include not just CP, but also 3’NCR isolates and partial CP gene of two PNRSV 

(206 bp) and one PDV isolate (173 bp) were cloned in pGEM-T Easy Vector (Promega, 

Madison, WI) and sequenced by MWG-Biotech AG (Germany). The nucleotide sequences 

of selected virus isolates were compared with previously reported PPV, PNRSV and PDV 

isolates deposited in GenBank by BLAST analysis. 

In particular, phylogenetic analysis of CP nucleotide sequences of eight PPV isolates 

from this study and 36 isolates from GenBank was done. Phylogenetic tree was constructed 

using Neighbor-Joining method with bootstrap analyses of 1000 replicates within MEGA 

4.1 software (Tamura et al., 2007). 

Table 1. List of primers sequences 

Virus Primers Primers sequences (5’ - 3’) 

ACLSV 

CMLV 

PMV 

PNRSV 

PDV 

PPV 

TRSV 

ToRSV 

ACLSRV F 

ACLSV R 

PM16AFF 

PM16AFR 

PM16AFF 

CML-26R 

Ilar 2 F 

Ilar 1 R 

PDV 2 F 

PDV 1 R 

PPV 8511-8532 F 

PPV 9763-9784 R 

TRSVf1 

TRSVr1 

ToRSVf1 

ToRSVr1 

GGCAACCCTGGAACAGA 

CAGACCCTTATTGAAGTCGAA 

CAAACATGGCTTTCACCTTCTGCA 

TCTTGCCCCACCCTTCAACAAATG 

CAAACATGGCTTTCACCTTCTGCA 

AGATCCTCTTTCCCTTCTAAAATG 

CCACCGAGAGGTTGGCA 

TTCTAGCAGGTCTTCATCGA 

ATGGATGGGATGGATAAAATAGT 

TAGTGCAGGTTAACCAAAAGGAT 

CGATATCTTGAAGCTTTTTACG 

CTCTTGCACAAGAACTATAACC 

GGAAGCTGTATAAACTCAGC 

GTGTTGGACAAACACGACAC 

GGAAGCTGTATAAACTCAGC 

GTCCTCATGGAACCTTTCTC 

Size of 

amplicon 

Reference 

358 bp Nemichov et al., 1995 

419 bp 

705 bp 

206 bp 

Delano and Upton, 

1999 

Candresse et al., 

1997 

173 bp Parakh et al., 1995 

1274 bp This work 

338 bp 

512 bp 

Martin et al., 2009 

RESULTS 

Molecular analyses determined presence of three economically important peach 

viruses and, in particular, of one quarantine virus (PPV) and two “quality” viruses (PDV 

and PNRSV). The majority of tested samples (70.7%) were infected by at least one of 

ascertained viruses. Single and double infections were confirmed, respectively, in 56.9% 

and 13.8% of the assayed plants. The most prevalent virus was PPV (60.3%) then PNRSV 

(18.9%) and PDV (1.7%).


The results of our survey suggested high incidence (50.0 - 83.3%) of PPV in the 

assessed peach cultivars. PNRSV was identified in cvs. Ritastar or May Crest and in cv. 

Spring Crest respectively in 66.7% and 25% of the examined samples, while PDV was 

confirmed only in Gloria cultivar (12.5%). Interestingly, Caldesi cultivar resulted free from 

all inspected viruses. 

Sequence analyses of partial CP gene of two PNRSV isolates (368/11 and 369/11) 

from cv. Rita Star, proved to be 92.4 – 98.9% identical with corresponding sequences of 

isolates previous described. The Montenegrin PNRSV 368/11 isolate was most closely 

related to Chinese isolate from ornamental peach (HQ833200), while 369/11 was most 

similar to Canadian isolate from peach (JN416776). The sequence of PDV isolate 399/11 

from Gloria cultivar, shared 94.2 – 95.9% identity with those of isolates reported from other 

parts of the world showing highest similarity with Ch137 isolate (L28145). 

Phylogenetic analysis using complete sequences of CP gene showed that all 

Montenegrin sequences from peach belong to PPV-M strain (Figure 1). In particular 

sequence analyses revealed that all eight isolates from Montenegro shared from 92.2 to 

99.1% nucleotide identity with corresponding PPV-M strain sequences deposited in 

GenBank. Montenegrin isolates from cvs. Gloria, May Crest, Adriana and Rita Star were 

the most closely related (97.1 – 99.1%) with isolate SK68 (M92280.1), while isolates from 

cvs. Morsiani, Maria Marta and Spring Crest shared most identity (97.6 – 98.4%) with 

previously reported Montenegrin isolate Godinje 1 (HQ452396) from region of Bar. Only 

sequence derived from cv. Spring Belle was most similar with corresponding sequence of 

Greek isolate N1 (FJ361234) from peach. 

DISCUSSION 

This study reported presence of PPV, PNRSV and PDV and very high incidence of 

PPV in the area where almost half of Montenegrin peach production is situated. Similar 

data were also reported in recent studies in plum production in Montenegro (Viršček-Marn 

et al., 2012), as well as in the surrounding countries (Dulić-Marković and Jevremović, 

2006; Musa et al., 2009). Since only presence of PPV-M strain in peach was confirmed our 

results indicate the most probable introduction of PPV in Montenegro through peach 

propagation material which is mainly imported from Greece where this strain is the most 

prevailing one. 

Our data suggested that urgent sanitation measures should be taken. A severe control 

related to importation of the plant material, as well as an eradication of infected trees are of 

the great importance in Montenegro.

Zindović Jelena, Božović Vladan, Miladinović Zoran,... 229 

Figure 1. Neighbour-joining (complete deletion, bootstrap analysis with 1,000 replicates) tree of 

44 Plum pox virus isolates (8 from this study and 36 from NCBI database), generated from 

complete nucleotide sequence of CP gene. The isolates analyzed in this work are marked with 

(*). The scale represents 0.05 substitutions per site.


REFERENCES 

Anoniymous (2011): Statistical yearbook, Statistical office of Montenegro – Monstat, 

Podgorica, pp 110. 

Candresse T., Kofalvi S.A., Lanneau M., Dunez J., (1998): A PCR-ELISA procedure for the 

simultaneous detection and identification of Prunus necrotic ringspot (PNRSV) and 

Apple mosaic (ApMV) ilarviruses. Acta Horticulturae, 472 (1), 219-225. 

Delano, J., Upton C. (1999): Single primer pair designs that facilitate simultaneous detection 

and differentiation of peach mosaic virus and cherry mottle leaf virus. Journal of 

Virological Methods, 83: 103-111. 

Dulić-Marković, I., Jevremović, D. (2006): Plum pox virus in Serbia, EPPO Bulletin 36 (2): 

213-214. 

Martin, R. M., Pinkerton, J. N., Kraus, J. (20098): The use of collagenase to improve the 

detection of plant viruses in vector nematodes by RT-PCR, Journal of Virological 

Methods 155: 91-95. 

Musa, A., Merkuri, J., Milano, R., Djelouah, K. (2009): Investigation on the phytosanitary status 

of the main stone nurseries and mother plots in Albania, Book of Abstract, 21st 

International Conference on Virus and other Graft Transmissible Diseases of Fruit 

Crops, July 5 - 10, 2009, Neustadt, Germany: 304-308. 

Nemchinov L., Hadidi A., Foster J.A., Candresse T., Verderevskaya T., (1995): Sensitive 

detection of Apple chlorotic leaf spot virus from infected apple or peach tissue using RT- 

PCR, IC-RT-PCR, or multiplex IC-RT-PCR. Acta Horticulturae, 386 : 51-57. 

Németh, M. (1986): Virus, Mycoplasma and Rickettsia Diseases of Fruit Trees. Ed. Akademiai 

Kiado, Budapest and Martinus Nijhoff Publishers, Dordrecht, Boston, Lancaster. 

Parakh, D.R., Shamloul A.M., Hadidi A., Scott SW., Waterworth H.E., Howell W.E. and Mink 

G.I. (1995): Detection of prune dwarf ilarvirus from infected stone fruits using reverse 

transcription-polymerase chain reaction. Acta Horticulturae, 386: 421-430. 

Tamura K., Dudley J., Nei M., Kumar S. (2007): MEGA4 Molecular Evolutionary Genetics 

Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596- 

1599. 

Viršček-Marn, M., Mavrić-Pleško, I., Zindović, J., Miladinović, Z. (2012): Presence and 

variability of Plum Pox Virus isolates in Montenegro, Journal of Plant Pathology, 94(1): 

201-204.

Aleksandra Bulajić, Ivana Stanković, Ana Vučurović,... 231 

International Symposium: Current Trends in Plant Protection UDK: 635.25/.26-238 

Proceedings 

IRIS YELLOW SPOT VIRUS - EMERGING PATHOGEN AND 

SERIOUS TREAT FOR THE PRODUCTION OF ALLIUM SPECIES 

ALEKSANDRA BULAJIĆ 1 , IVANA STANKOVIĆ 1 , ANA VUČUROVIĆ 1 , DANIJELA RISTIĆ 1 , 

KATARINA MILOJEVIĆ 1 , VOJISLAV TRKULJA 2 AND BRANKA KRSTIĆ 1 

1 Institute of Phytomedicine, Department of Phytopathology, University of Belgrade-Faculty of 

Agriculture, Belgrade, Serbia 

2 Faculty of Agriculture, Banja Luka, Republic of Srpska, Bosnia and Herzegovina 

(branka.krstic@agrif.bg.ac.rs) 

During 2008 to 2011, a survey was conducted to detect the possible presence of IYSV in 

Serbia. In total, plants from 47 crops in different localities were visually inspected and 204 samples of 

onion (Allium cepa), 13 samples of garlic (A. sativum) and eight samples of leek (A. porrum) were 

collected. Samples were tested utilizing double-antibody sandwich (DAS)-ELISA, and 132 randomly 

selected samples originating from all 47 crops, at least two samples from each locality were tested 

utilizing conventional reverse transcription (RT)-PCR with several previously developed primers. 

Despite the presence of specific or other symptoms of the sampled onion, garlic and leek plants, 

IYSV was not detected by ELISA or by RT-PCR. The intensive sampling included the municipalities 

of Temerin (especially surrounding locality of Sirig) and Obrenovac with history of IYSV presence, 

but the virus was not detected, proving that eradication in 2007 was successful. Following first 

detection, IYSV was regarded as minor pathogen, but later started to cause considerable losses in seed 

and bulb onion crops and today is among the most important onion viral pathogens worldwide. For 

that reason and previous multiple introductions, the surveillance for the presence of IYSV in Serbia 

will be continued in the future. 

Key words: Iris yellow spot virus, survey, DAS-ELISA test, conventional RT-PCR detection 

INTRODUCTION 

Iris yellow spot virus (IYSV) is one of 23 distinct species of the genus Tospovirus 

(family Bunyaviridae) that have been discovered so far (Pappu et al., 2009; Plyusnin et al., 

2011). It has typical tospovirus genome organization with three single-stranded RNA 

segments of negative or ambisense polarity (Pappu, 2008; Tsompana and Moyer, 2008). 

IYSV is transmitted by Thrips tabaci (Nagata et al., 1999; Kritzman et al., 2001) and is 

considered an emerging virus whose world presence and distribution have recently 

dramatically increased (Gent et al., 2006; Pappu et al., 2009). 

The virus causes important problems in a number of monocot hosts, and among 

these, the diseases caused to onions is the most severe. IYSV is an economically important 

viral pathogen of onion (Allium cepa), but the infection of other cultivated and wild Allium 

species, several ornamental species, and a certain number of weeds has also been reported 

(Gent et al., 2006; Sampangi et al., 2007). IYSV in onion presents an interesting and

232 Iris yellow spot virus – emerging pathogen and serious treat for... 

intriguing scenario in the USA. Though the virus was known to infect onion in southern 

Idaho and south-east Oregon since the early 1990s (Hall et al., 1993), it caused limited 

economic impact on this crop. However, since 2000, several other states in the USA have 

reported or confirmed the presence of IYSV. In 2000, IYSV started causing considerable 

losses in yield of both seed and bulb onion crops in Idaho and Oregon (Gent et al., 2006). 

Also, it was first confirmed in Washington State in 2003, and then spread rapidly to all the 

onion-growing counties in the state. By 2005, several seed production fields had to be 

abandoned resulting in total crop loss. Much remains to be learned about the epidemiology 

of this important virus of onion (Gent et al., 2006). 

While IYSV has become a major constraint for the production of onion bulb and 

seed crops, especially in the United States (Poole et al., 2007), Israel (Gera et al., 1998), 

and Brazil (Pozzer et al., 1999), the situation in Europe regarding its presence, distribution, 

and economic impact is still not completely understood. IYSV was first isolated from iris in 

the Netherlands in 1992 (Cortês et al., 1998). In last decade, IYSV has been more prevalent 

in onion crops according to the reports of its occurrence in Slovenia (Mavrič and Ravnikar, 

2000), Italy (Cosmi et al., 2003), Poland (Balukiewics and Kryczynski, 2005), Spain 

(Córdoba-Sellés et al., 2005), France (Huchette et al., 2006), Germany (Leinhos et al., 

2007), and Serbia (Bulajić et al., 2008). In European countries in which the virus is 

detected, its status can be described as: present, transient, incidental or isolated findings, or 

present without causing damage. However, most recent records of IYSV outbreak in 

several European countries such as Italy (Tomassoli et al., 2009), Germany (Anonymous, 

2008a), the UK (Mumford et al., 2008), and Serbia (Bulajić et al., 2009), and the virus 

occurrence in different areas of France on onion and shallot (Huchette et al., 2008), as well 

as a new report on leek in Spain (Córdoba-Sellés et al., 2007) could represent increasing 

incidence of IYSV in Europe. But, there is no information on damage and economic 

impact, except that estimated incidence on onion was high in Slovenia (Mavrič and 

Ravnikar, 2000) and that severely infected plants eventually died in Spain (Córdoba-Sellés 

et al., 2005). 

Given the importance of onion bulb and seed crops in Serbia and previous records of 

IYSV in two localities in Serbia, it was of utmost importance to further carry out a survey 

of onion-producing areas. The possibility of the virus spreading to other Allium species was 

also taken into account. So, the objective of this study was to gain an insight into the further 

spread of IYSV in onion crops and possible occurrence in leek and garlic crops or even new 

introduction in Serbia. 


During 2008 to 2011, a survey was conducted in order to ensure that IYSV spread 

had not occurred after eradication in localities where the virus was first recorded and to 

detect the possible presence of IYSV in other onion-growing localities in Serbia. In 

addition, during a four-year period of visual inspection of 19 garlic and leek crops to record 

symptoms resembling those of IYSV, a total of 21 samples were collected. In total, over the 

course of the surveys, plants from 47 crops in different localities were visually inspected 

and 225 samples were collected, including 204 samples of onion (Allium cepa), 13 samples 

of garlic (A. sativum) and eight samples of leek (A. porrum) (Table 1). Collected samples 

included symptomatic as well as portion of symptomless plants and all were tested utilizing 

double-antibody sandwich (DAS)-ELISA kit (Loewe Biochemica, Sauerlach, Germany), 

and the ELISA procedure was performed according to manufacturer’s instructions.


Commercial positive and negative controls and extracts from healthy onion, garlic and leek 

tissue were included in each ELISA. 132 randomly selected samples originating from all 47 

inspected crops, at least two samples from each locality were tested utilizing conventional 

reverse transcription (RT)-PCR analysis. Total RNA was extracted from sampled freezedried 

onion leaves and scapes, and garlic and leek leaves using the RNeasy Plant Mini Kit 

(Qiagen, Hilden, Germany) following the manufacturer’s instructions. Total RNAs 

obtained from the Serbian 605-SRB isolate of IYSV (GenBank Acc. No. EU586203) and 

from healthy onion, garlic and leek leaves were used as positive and negative controls, 

respectively. Specific nucleotide sequence of IYSV nucleocapsid (NC) gene was detected 

using RT-PCR with several previously developed primers (du Toit et al., 2004; Uga and 

Tsuda, 2005; Pappu et al., 2006; Robène-Soustrade et al., 2006) (Table 2). 

RESULTS 

During the visual inspection of onion, garlic and leek plants from 2008 to 2011, 

various symptoms were observed on leaves and scapes. Symptoms were ranged from strawcoloured, 

dry, necrotic spindle- or diamond-shaped lesions on scapes that are of diagnostic 

value and less characteristic symptoms such as circular or oval yellow spots to chlorotic 

spots and streaks on leaves and scapes which are not described to be of diagnostic value. 

In onion crops, symptoms characteristic for IYSV were observed in only one 

location, in the vicinity of Novi Sad. Some of the observed lesions had distinct green 

centers with chlorotic and necrotic borders. Other lesions appeared as concentric rings of 

alternating green and chlorotic/necrotic tissue. A vast majority of sampled onion plants 

exhibited symptoms with limited diagnostic value as chlorotic spots, streaks and stripes on 

the leaves and scapes, and yellowing, dwarfing and stunting of whole plants. On garlic and 

leek only chlorotic spots, streaks and stripes and chlorosis of leaves were observed with no 

specific elongated lesions or other particular symptoms described for IYSV. 

Table 1. Overview of the survey on the presence of Iris yellow spot virus during 2005-2011 in 

Serbia 

Year Host plant 

No. of No. of tested 

localities samples 

2005 

35 genera of ornamentals 24 453 

Onion 31 52 

2006 

14 genera of ornamentals 16 215 

Onion 15 149 

2007 Onion 16 189 

2008 Onion, leek 11 51 

2009 Onion 10 63 

2010 Onion, garlic, leek 16 58 

2011 Onion, garlic, leek 10 53 

Reference 

Bulajić et al. 

(2009) 

This study 

Despite the presence of specific or other symptoms of the sampled onion, garlic and 

leek plants, IYSV was not detected by ELISA in any of 225 onion, garlic and leek samples 

collected from 47 crops on the territory of Serbia (Table 1). The intensive sampling 

included the municipalities of Temerin (especially surrounding locality of Sirig) and 

Obrenovac with history of IYSV presence, but the virus was not detected.


Table 2. The primers used for IYSV detection in Allium leaves and scapes 

Primer 

IYSV917L 

IYSV56U 

IYSV-Pappu1* 

IYSV-Pappu2 

Sequence 

5’-TAAAACTTAACTAACACAAA-3’ 

5’-TCCTAAGTATTCACCAT-3’ 

5’-TAAAACAAACATTCAAACAA-3’ 

5’-CTCTTAAACACATTTAACAAGCAC-3’ 

Amplicon 

size (bp) 

896 

1200 

Reference 

Robène– 

Soustrade et 

al. (2006) 

Pappu et al. 

(2006) 

IYSV-459 

TOS-R15 

5’-ACCAGAGGAAGCCCGCAG-3’ 

5’-GGGAGAGCAATYGWGKYR-3’ 

459 

Uga and Tsuda 

(2005) 

IYSV-F* 

IYSV-R 

5’-TCAGAAATCGAGAAACTT -3’ 

5’-TAATTATATCTATCTTTCTTGG-3’ 

700 

du Toit et al. 

(2004) 

* Reference sources included no primer name and a suitable designation was allocated. 

Further confirmation of the obtained results and virus absence included molecular 

detection utilizing RT-PCR with four different specific primer pairs. The presence of IYSV 

was not detected in any of 132 randomly tested samples originating from all 47 sampled 

crops. Also, uninfected, negative controls did not produce any amplicons, while the 

expected sizes of the RT-PCR products were only amplified from positive control using 

primer pairs IYSV-Pappu1/2, IYSV917L/56U and IYSV-459/TOS-R15. 

DISCUSSION 

In the EPPO region, IYSV as relatively newly characterized tospovirus gained 

significance in 1999, when it was included in the EPPO Alert List (Anonymous, 2000), 

because it could pose a risk for the cultivation of onion and other host plants. The present 

geographical distribution of IYSV is still under investigation, and in most cases the virus 

records were incidental findings. After comprehensive studies in several countries in the 

EPPO region, and several pest risk analysis conducted by joint international efforts (Jones, 

2002; Collins et al., 2007; Sunsford and Woodhall, 2007), IYSV is excluded from EPPO 

Alert list (Anonymous, 2011). It is predicted that the possible economic impact of IYSV in 

Europe is less valuable compared to the cost of imposing quarantine measures (Jones, 

2002). 

Onion and garlic are traditionally grown crops in Serbia produced on close to 20,000 

ha and 8,000 ha, respectively (http://webrzs.stat.gov.rs/WebSite/Public/ReportView.aspx). 

In July 2007, onion plants with distinctive symptoms on leaves and on scapes were 

observed in an onion seed production field in the Sirig locality (South Bačka District). 

Affected plants were spread across the field with very high disease incidence, estimated at 

80%. Disease occurrence was associated with a high population of Thrips tabaci. IYSV was 

detected by ELISA in 26 out of 34 symptomatic onion samples (Bulajić et al., 2008). 

Another outbreak was recorded in June 2007 in the Obrenovac locality (City of Belgrade 

District). Only two infected onion plants with chlorotic spots and streaks were found in an 

onion bulb crop with relatively low population of Thrips tabaci. IYSV was detected 

serologically in both samples (Bulajić et al., 2009). Because of these outbreaks, IYSV was 

deleted from the IA part I of the Lists of harmful organisms of the Republic of Serbia and 

included in the IA part II (The Law on Plant Health, 

http://www.mpt.gov.rs/postavljen/123/bilje1.pdf). The results discussed in this paper are


part of continuous surveillance of IYSV in a seven year period (2005-2011) which in the 

first three years revealed no virus presence in the wide range of visually inspected and 

tested ornamentals (Bulajić et al., 2009). For that reason, the particular attention was given 

to the different Allium crops, such as onion, garlic and leek. 

IYSV infection is often associated with characteristic symptoms on diseased onion 

plants such as straw-colored ringspots, diamond-shaped lesions, or necrotic eyelike spots 

(Gera et al., 1998; Pozzer et al., 1999; Pappu et al., 2008). Some of these typical symptoms 

of diagnostic value were observed on onion plants in the Sirig locality. In the Obrenovac 

locality, onion plants did not express symptoms indicative of IYSV infection. A similar 

situation was reported in the Netherlands in 2006 (Anonymous, 2008b), where, in contrast 

to many reports from other European countries, IYSV was mainly found in symptomless 

onion plants or in a few plants showing mild symptoms. For these reasons, during this 

survey, sampling included onion, garlic and leek plants with all sorts of symptoms, as well 

as symptomless plants. In the June 2008, in one onion seed crop in the vicinity of Novi Sad, 

plants with symptoms strongly resembling those characteristic of IYSV infection were 

observed. Despite applying all relevant diagnostic methods, serological as well as 

previously proven successful RT-PCR, no virus presence was established. 

Survey for the presence of quarantine IYSV in Serbia included variety of diagnostic 

methods including primer pairs with different capabilities that has been proved to be 

necessary for the virus detection in 2007 virus outbreaks in Serbia (Bulajić et al., 2009). 

The phylogenetic analysis performed in Serbia showed high variation between IYSV 

isolates originating from two distant localities in Serbia. Two isolates originating from the 

Sirig locality (605-SRB and 622-SRB) clustered with European isolates from Italy and 

Spain, but isolate 283-SRB, originating from the Obrenovac locality, fell into a different 

and distant clade. Similarly, it was reported that an Oregon onion isolate had significant 

divergence from the others originating from the western United States, and it was grouped 

with IYSV isolates from the Netherlands and Israel (Pappu et al., 2006). The analysis also 

indicated that Serbian IYSV isolates do not share a recent common ancestor and that there 

are two distinct lineages of IYSV in Serbia. The clustering of isolates from Serbia in 

distinct clades suggests two introductions of IYSV at different times, as was similarly 

reported for isolates from California (Pappu et al., 2006). The high sequence divergence 

among European IYSV isolates, their clustering into four different clades, and the 

occurrence of the most divergent isolate so far from Slovenia indicate a longer association 

with the virus, such as was stated for Japan (Smith et al., 2006). Interestingly, clustering of 

one of the Serbian isolates into the clade with isolates from different parts of the world 

which potentially indicated extensive and rapid spread of the virus throughout the world, 

probably due to increasing international trade. 

After IYSV outbreaks in Serbia (Bulajić et al., 2008, 2009) the measures of 

thorough eradication were applied according to Sunsford and Woodhall (2007). The 

intensive sampling in the municipalities of Temerin, especially surrounding locality of 

Sirig, and Obrenovac was performed and greater number of samples tested. No virus 

presence was detected in any of the tested samples which proved that IYSV eradication 

conducted in 2007 was successful. Sunsford and Woodhall (2007) discuss possibilities for 

successful eradication IYSV and concluded that an outbreak in field crops may be more 

difficult to eradicate compared to glasshouse outbreak. Nevertheless the examples of 

successful eradication are known as is one performed in Serbia. 

There are strong indications that IYSV is spreading through the region of West 

Balkans as there are some preliminary results to support its presence in the Republic of 

Srpska, Bosnia and Herzegovina (Trkulja, unpublished). Another important fact that could


be taken into account is that IYSV was considered a minor importance in the USA until 

2000. After its establishment in several states of the USA, IYSV started to cause 

considerable losses in yield of both seed and bulb onion crops and is one of the most 

important viral pathogens of onion today. For that reason and due to previous 

documentation of multiple introductions in Serbia (Bulajić et al., 2009), the surveillance for 

the presence of IYSV will be continued in the period to come. 

ACKOWLEDGEMENT 

This research was supported by grant III 43001 of the Ministry of Education and 

Science, Republic of Serbia and 19/6-020/961-92/11 of the Ministry of Science and 

Technology, Republic of Srpska. 

REFERENCES 

Anonymous. (2000): EPPO Alert List. Iris yellow spot tospovirus. 

http://www.eppo.org/QUARANTINE/Alert_List/viruses/IYSV00.htm. 

Anonymous. (2008a): First report of Iris yellow spot virus on onion in Germany. EPPO 

Reporting Service 2: 033. 

Anonymous. (2008b): New findings of Iris yellow spot virus in the Netherlands in 2007. EPPO 

Reporting Service 3:060 

Anonymous. (2011): EPPO Alert List. Deletions. 

http://www.eppo.int/QUARANTINE/Alert_List/deletions.htm 

Balukiewics, A., Kryczynski, S. (2005): Tospoviruses in chrysanthemum mother stock plants in 

Poland. Phytopathologia Polonica, 37: 59 – 67. 

Bulajić, A., Đekić, I., Jović, J., Krnjajić, S., Vučurović, A., Krstić, B. (2009): Incidence and 

distribution of Iris yellow spot virus on onion in Serbia. Plant Disease, 93: 976 – 982. 

Bulajić, A., Jović, J., Krnjajić, S., Petrov, M., Djekić, I., Krstić, B. (2008): First report of Iris 

yellow spot virus on onion (Allium cepa) in Serbia. Plant Disease, 92: 1247. 

Collins, D., Jackeviciene, L. T., Mnari-Hattab, M., Pfeilstetter de, E., Reynaud, P., Tassus, X., 

Verhoeven, J., Vetten, H. J., Woodhall, J. (2007): Report of a Pest Risk Analysis Iris 

yellow spot virus. WPPR point 8.4., EPPO, 09-15198 (07-13315). 

Córdoba-Sellés, C., Cebrián-Mico, C., Alfaro-Fernández, A., Muñoz-Yerbes, M. J., Jordá- 

Gutiérrez, C. (2007): First report of Iris yellow spot virus in commercial leek (Allium 

porrum) in Spain. Plant Disease, 91: 1365. 

Córdoba-Sellés, C., Martínez-Priego, L., Muñoz- Gómez, R., Jordá-Gutiérrez, C. (2005): Iris 

yellow spot virus: A new onion disease in Spain. Plant Disease, 89: 1243. 

Cortês, I., Livieratos, I. C., Derks, A., Peters, D., Kormelink, R. (1998): Molecular and 

serological characterization of iris yellow spot virus, a new and distinct Tospovirus 

species. Phytopathology, 88: 1276 – 1282. 

Cosmi, T., Marchesini, E., Martini, G. (2003): Presence and spread of tospovirus and thrip 

vectors in Veneto. Informatore Agrario, 59: 69 – 72. 

du Toit, L. J., Pappu, H. R., Druffel, K. L., Pelter, G. Q. (2004): Iris yellow spot virus in onion 

bulb and seed crops in Washington. Plant Disease, 88: 222. 

Gent, D. H., du Toit, L. J., Fichtner, S. F., Mohan, S. K., Pappu, H. R., Schwartz, H. F. (2006): 

Iris yellow spot virus: An emerging threat to onion bulb and seed production. Plant 

Disease, 90: 1468 – 1480.


Gera, A., Kritzman, A., Cohen, J., Raccah, B. (1998): Tospoviruses infecting bulb crops in 

Israel. In: Recent Progress in Tospovirus and Thrips Research. D. Peters and R. 

Goldbach, eds. International Symposium on Tospoviruses and Thrips in Floral and 

Vegetable Crops, 4th. Wagengingen, The Netherlands, pp. 86 – 87. 

Hall, J. M., Mohan, K., Knott, E. A., Moyer, J. W. (1993): Tospoviruses associated with scape 

blight of onion (Allium cepa) seed crops in Idaho. Plant Disease, 77: 952. 

Huchette, O., Bellamy, C., Filomenko, R., Pouleau, B., Seddas, S., Pappu, H. R. (2008): Iris 

yellow spot virus on shallot and onion in France. Online. Plant Health Progress doi: 

10.1094/PHP-2008-0610-01-BR. 

Huchette, O., Filomenko, R., Pouleau, B., Godbert, N., Larièpe, A., Out, H., Seddas, S. (2006): 

Development of an easy and reliable method to diagnose the Iris yellow spot virus in 

Burgundy, France. In: Proceedings of 2006 National Allium Research Conference, 

College Station, TX, pp. 40. 

Jones, D. (2002): Summary Pest Risk Analysis for Iris yellow spot virus. PP9369, 02-9835, 

PPM Point 8.7., Central Science Laboratory, Sand Hutton, Jork, UK. 

Kritzman, A., Lampel, M., Raccah, B., Gera, A. (2001): Distribution and transmission of Iris 

yellow spot virus. Plant Disease, 85: 838 – 842. 

Leinhos, G., Müller, J., Heupel, M., Krauthausen, H. J. (2007): Iris yellow spot virus an Bundund 

Speisezwiebeln-erster Nachweis in Deutschland. Nachrichtenblatt des Deutschen 

Pflanzenschutzdienstes, 59: 310 – 312. 

Mavrič, I., Ravnikar, M. (2000): Iris yellow spot tospovirus in Slovenia. In: Proceedings of 5 th 

Congress of the Europea Foundation for Plant Pathoogy: Biodiversity in Plant Pathology, 

Taormina-Giardini Naxos, Italy, pp. 223 – 225. 

Mumford, R. A., Glover, R., Daly, M., Nixon, T., Harju, V., Skelton, A. (2008): Iris yellow spot 

virus (IYSV) infecting Lisianthus (Eustoma grandiflorum) in the UK: First finding and 

detection by real-time PCR. Plant Pathology, 57: 768. 

Nagata, T., Almedia, Ana Carla L., de Resende, R., de Avila C. (1999): The identification of the 

vector species of Iris yellow spot tospovirus occurring in onion in Brazil. Plant Disease, 

83: 399. 

Pappu, H. R. (2008): Tomato spotted wilt virus (Bunyaviridae). In: Mahy, B. W. J., Van 

Regenmortel, M. H. V. (eds). Encyclopedia of Virology, Vol 5, 3rd ed. Elsevier Ltd., 

Oxford, UK, pp. 133-138. 

Pappu, H. R., du Toit, L. J., Schwartz, H. F., Mohan, K. (2006): Sequence diversity of the 

nucleoprotein gene of Iris yellow spot virus (genus Tospovirus, family Bunyaviridae) 

isolates from the western region of the United States. Archives of Virology, 151: 1015 – 

1023. 

Pappu, H. R., Jones, R. A. C., Jain, R. K. (2009): Global status of tospovirus epidemics in 

diverse cropping systems: Successes achieved and challenges ahead. Virus Research, 

141: 219 – 236. 

Pappu, H. R., Rosales, I. M., and Druffel, K. L. (2008): Serological and molecular assays for 

rapid and sensitive detection of Iris yellow spot virus infection of bulb and seed onion 

crops. 

Plant Disease, 92: 588 – 594. 

Plyusnin, A., Beaty, B. J., Elliott, R. M., Goldbach, R. Kormelink, R., Lundkvis,t Å., 

Schmaljohn, C. S, Tesh, R. B. (2011): Bunyaviridae. In: King AMQ, Adams MJ, 

Carstens EB, Lefkowitz EJ, eds. Virus Taxonomy: Classification and Nomenclature of 

Viruses. Ninth Report of the International Committee on Taxonomy of Viruses. San 

Diego, Elsevier, 725 – 741. 

Pozzer, L., Bezerra, I. C., Kormelink, R., Prins, M., Peters, D., Resende, R. de O., de Ávila, A. 

C. (1999): Characterization of a tospovirus isolate of Iris yellow spot virus associated 

with a disease in onion fields in Brazil. Plant Disease, 83: 345 – 350.


Poole, G. J., Pappu, H. R., Davis, R. M., Turini, T. A. (2007): Increasing outbreaks and impact 

of Iris yellow spot virus in bulb and seed onion crops in the Imperial and Antelope 

Valleys of California. Online. Plant Health Progress doi:10.1094/PHP-2007-0508-01- 

BR. 

Robène-Soustrade, I., Hostachy, B., Roux-Cuvelier, M., Minatchy, J., Hédont, M., Pallas, R., 

Couteau, A., Cassam, N., Wuster, G. (2006): First report of Iris yellow spot virus in 

onion bulb and seed production fields in Reunion Island. Plant Pathology, 55: 288. 

Sampangi, R. K., Mohan, S. K., Pappu, H. R. (2007): Identification of new alternative weed 

hosts for Iris yellow spot virus in the Pacific Northwest. Plant Disease, 91: 1683. 

Smith, T. N., Jones, R. A. C., and Wylie, S. J. (2006): Genetic diversity of the nucleocapsid 

gene of Iris yellow spot virus. Australasian Plant Pathology, 35: 359 – 362. 

Sunsford, C., Woodhall, J. (2007): Pest risk analysis for Iris yellow spot virus. Central Science 

Laboratory, Sand Hutton, UK, on line publication 

http://www.fera.defra.gov.uk/plants/plantHealth/pestsDiseases/documents/irisyellow.pdf 

Tomassoli, L., Tiberini, A., V. Masenga, V., Vicchi, V., Turina, M. (2009): Characterization of 

Iris yellow spot virus isolates from onion crops in northern Italy. Journal of Plant 

Pathology, 91: 733 – 739. 

Tsompana, M., Moyer, J. W. (2008): Tospoviruses. In: Mahy, B. W. J., Van Regenmortel, M. H. 

V. (Eds). Encyclopedia of Virology, Vol 5, 3rd ed., Elsevier, Oxford, UK., pp. 157 – 

162. 

Uga, H., Tsuda, S. (2005): A one-step reverse transcription-polymerase chain reaction system 

for the simultaneous detection and identification of multiple tospovirus infections. 

Phytopathology, 95:166 – 171.

Bese Gabor, Krizbai L., Horvath J., Takacs A. 239 

International Symposium: Current Trends in Plant Protection UDK: 635.64-238(439) 

Proceedings 

RESISTANCE BREAKING STRAIN OF TOMATO SPOTTED WILT 

VIRUS (TSWV) ON RESISTANT PEPPER CULTIVARS IN 

HUNGARY 

BESE GABOR 1 , KRIZBAI L. 2 , HORVATH J. 3 , TAKACS A. 3 

1 Csongrad County Govermental Office, Plant and Soil Conservation Directorate Plant Health 

Division, Rárósi út 110, H-6800 Hódmezővásárhely, Hungary; 

2 National Food Chain Safety Office, Laboratory for Pest Diagnosis, Budaőrsi út 141-145, 1118 

Budapest, Hungary; 

3 University of Pannonia, Georgikon Faculty, Deák F. u. 16. H 8360 Keszthely, Hungary 

TSWV is one of the most serious viruses in vegetable crops in Hungary causing great 

financial losses to many pepper growers. So far the only efficient method to control this virus in 

pepper crops has relied on the Tsw resistance gene. In 2011, pepper (Capsicum annum) varieties 

having the Tsw resistance gene against Tomato spotted wilt virus (TSWV) were observed showing 

symptoms resembling those caused by TSWV, such as mosaic, leaf deformations and concentric ring 

patterns in plastic tunnels in south-eastern Hungary. The presence of TSWV was determined by 

double- and triple-antibody sandwich, (DAS)-ELISA and (TAS)-ELISA, respectively, reverse 

transcription (RT)-PCR and sequencing. Finally, back inoculation was carried out to accession of 

Capsicum chinense „PI152225”. According to laboratory techniques the studied pepper plants were 

infected with TSWV. Based on biotest, this isolate was the resistance breaking strain of TSWV. 

Key words: Pepper, TSWV-RB, serological detection, biotest, molecular detection 

INTRODUCTION 

Serious damage of Tomato spotted wilt virus (TSWV) to Capsicum spp. occurs 

worldwide. In Hungary the virus can be transmitted by two thrips species (Thrips tabaci 

and Frankliniella occidentalis) and also transmitted mechanically (Jones, 2005). 

The most effective control strategy had been using resistance varieties (Margaria et 

al., 2007). The Tsw gene has been introduced into several pepper cultivars (Fraser, 1990). 

This fact, however, has not reassured virologists and growers because new TSWV strains - 

(RB) resistance-breaking strain (Boiteaux and Nagata, 1993) in Capsicum chinense - can 

appear and be selected (Qiu et al., 1998). This strain of TSWV was reported in pepper 

cultivar in Italy in 1999 (Roggero, 1999). Hungarian outbreaks of this TSWV-RB strain 

were detected in pepper showing local lesion under experimental circumstances (Salamon, 

2010). 

In 2011, TSWV resistance pepper varieties from a greenhouse located in southeastern 

Hungary, where 75% of greenhouse production takes place, were observed showing 

symptoms commonly associated with TSWV infection. It causes 30-70% losses for the

240 Resistance breaking strain of tomato spotted wilt virus (TSWV) on... 

pepper growers. The aim of the research described in this paper was to determine the cause 

of the disease in the TSWV resistant capsicum cultivars. 


Leaf sample showing TSWV-like symptoms was collected and analysed for the 

presence of different viruses by DAS- and TAS-ELISA according to EPPO protocols. 

Back inoculation was also carried out to Capsicum chinense PI152225 and four C. 

annum×C. chinense commercial pepper varieties as indicator plants. Local and systemic 

symptoms were checked on indicator plants at 7 and 14 days later. 

Total RNA was extracted by Qiagen Total RNeasy Plant mini Kit and tested by RT- 

PCR with cDNA prepared using Superscript III with the primers specific for TSWV 

amplifying the regions of the S segment of the TSWV genome (primer 1: TSWV-S1983 5′- 

CCCTCGAGGCTTTCAAGCAAGTTCTGCG-3’ and TSWV-S2767 5′- 

GCTCTAGAGCC-ATCATGTCTAAGGTTAAGCTCAC-3′; primer 2: TSWV-S70 5’- 

CACAGTACCAACC-3’ and TSWV-S890 CATCTCCTGGAACCTTGAAC-3’ (Qui et al., 

1998). Excess primers were removed using the QIAquick PCR purification kit and the PCR 

product was directly sequenced with DYEnamic ET Dy Terminator Cycle Sequencing Kit 

and evaluation were carried out with MegaBACE 1000. 


We got ELISA-positive result for the presence of TSWV. TSWV infection was 

confirmed by RT-PCR. The nucleotide sequence of sample was 95-97% identical to isolates 

from other parts of the world. 

By means of biotest, no local lesions were observed on the cotyledon leaves, 

whereas systemic symptoms were observed 6 days post-inoculation on the newly emerged 

non-inoculated leaves in all tested plants. 

According to the symptoms, biotest, ELISA and molecular detection, the pepper 

samples from TSWV resistance varieties were verified to be infected with TSWV. The 

result of the biotest showed that TSWV-resistance breaking strain infected the pepper 

varieties. To our knowledge this is the first report of TSWV strains breaking the resistance 

provided by the Tsw gene under field conditions in Hungary. 


Present article was published in the frame of the project TÁMOP-4.2.2/B-10/1- 

2010-0025. The project is realized with the support of the Hungarian Government and the 

European Union, with the co-funding of the European Social Fund. 

REFERENCES 

Boiteux L.S., Nagata T. (1993): Susceptibility of Capsicum chinense PI 159236 to tomato 

spotted wilt virus isolates in Brazil. Plant Disease, 77: 210. 

Fraser R.S.S. (1990): The genetics of resistance to plant viruses. Annual Review of 

Phytopathology, 28: 179-200.

Bese Gabor, Krizbai L., Horvath J., Takacs A. 241 

Margaria, P., Ciuffo, M., Pacifico, D., Turina, M. (2007): Evidence that the nonstructural protein 

of Tomato spotted wilt virus is the avirulence determinant in the interaction with resistant 

pepper carrying the TSW gene. Molecular Plant-Microbe Interaction, 20: 547-558. 

Qui W.P., Geske S.M., Hickey C.M., Moyer J.W. (1998): Tomato spotted wilt tospovirus 

genome reassortment and genome segment specific adaptation. Virology, 244: 186-194. 

Roggero P, Melani V, Ciuffo M, Tavella L, Tedeschi R., Stravato V.M. (1999): Two field 

isolates of tomato spotted wilt tospovirus overcome the hypersensitive response of a 

pepper (Capsicum annuum) hybrid with resistance introgressed from C. chinense 

PI:152225. Plant Disease, 83: 965. 

Salamon P., Nemes K., Salánki K. (2010): A paradicsom foltos hervadás vírus (Tomato spotted 

wilt virus, TSWV) rezisztenciatörő törzsének izolálása paprikáról (Capsicum annum L.) 

Magyarországon. 56. Növényvédelmi Tudományos Napok. Budapest, p. 23.

242 Molecular studies on Cryphhonectria parasitica isolates from... 

International Symposium: Current Trends in Plant Protection UDK: 630*443.3:582.632.2(4) 

Proceedings 

MOLECULAR STUDIES ON CRYPHONECTRIA PARASITICA 

ISOLATES FROM DIFFERENT CENTRAL-EUROPEAN PLOTS 

GÖRCSÖS GÁBOR, IRINYI LÁSZLÓ, TARCALI GÁBOR, RADÓCZ LÁSZLÓ 

University of Debrecen, Centre for Agricultural and Applied Economic Sciences, Institute of 

Plant Protection, P.O. Box 36 H-4015 Debrecen, Hungary 

The ascomycete fungus, Cryphonectria parasitica (Murr.) Barr, is an important fungal 

pathogen of chestnut in Europe and North America. The pathogen kills the infected tree branches and 

the rapid death of the entire tree take place which is causing high environmental and economic 

concerns. In this study we employed a part of the translation elongation factor 1 subunit alpha (EF- 

1α=tef1) and ITS region, as a potential genetic markers to infer phylogenetic relationships among C. 

parasitica isolates. The molecular differences among the C. parasitica isolates originated from the 

Carpathian-Basin was not significant. The ITS sequences proved variable but this kind of variability 

does not represent the geographical regions where they were collected. Significant, well based 

differences were not found between Hungarian isolates. Little differences were found between 

Hungarian, Greek and isolates from database which constitute separate groups. In our study, the tef1 

sequences have not showed any differences, they were identical in all isolates supporting that these 

sequences remained conservative within this species. The result shows that the tef1 sequences are not 

well suited for delineating phylogenetic relationships within C. parasitica isolates collected from 

different regions of Europe. 

Key words: Cryphonectria parasitica, ITS, tef1, Central-Europe, Chestnut 

INTRODUCTION 

The heterothallic ascomycete fungus, Cryphonectria parasitica (Murr.) Barr and the 

casual agent of chestnut blight disease, is one of the most important fungal pathogens of 

chestnut in Europe and North America (Anagnostakis, 1987). The pathogen kills the 

infected tree branches and the rapid death of the entire tree take place which is causing high 

environmental and economic concerns (Braghi, 1946). In our study, we have tried to infer 

phylogenetic relationships among Cryphonectria parasitica isolates collecting from 

different Central-European plots. 


Isolates 

In this study we analyzed 100 Cryphonectria parasitica strains isolated from 

different part of Central-Europe but mainly from the Carpathian-basin (Table. 1 and Fig. 

1.). Bark samples were collected from chestnut trees located in geographically determined

Görcsös Gábor, Irinyi László, Tarcali Gábor, Radócz László 243 

(GPS) areas. Individual samples were surface disinfected in 70% ethanol, rinsed in sterile 

water and then placed on PDA (40g potato dextrose agar, Scharlau, 1 l tap water). Plates 

were incubated at 24 °C in the dark for 7 days and all cultures were checked for typical C. 

parasitica characteristics. In the analyses, other C. parasitica isolates were included from 

GenBank maintained by NCBI (GenBank; http://www.ncbi.nlm.nih.gov/). 

Table 1 Origine of Cryphonectria parasitica isolates 

Name of the samples Country Location Date of the collection 

B1 Hungary Nagymaros 13 may 2011 

C1 Hungary Nagymaros 13 may 2011 

E3 Hungary Nagymaros 13 may 2011 

F4 Hungary Nagymaros 13 may 2011 

N2 Hungary Nagymaros 13 may 2011 

ERSEK2 Hungary Érsekvadkert 13 may 2011 

ERSEK3 Hungary Érsekvadkert 13 may 2011 

BOB1-1 Ukraine Bobovyshche 23 april 2011 


BOB2-2T Ukraine Bobovyshche 23 april 2011 


BOB2-4T Ukraine Bobovyshche 23 april 2011 



RO4 Ukraine Rostovjatica 23 april 2011 

RO6 Ukraine Rostovjatica 23 april 2011 

S1 Ukraine Serednje 23 april 2011 

S3 Ukraine Serednje 23 april 2011 

VEVI1 Romania Baia Mare 7 september 2011 

VEVI2 Romania Baia Mare 7 september 2011 

FEL1T Romania Baia Mare 7 september 2011 

FEL4 Romania Baia Mare 7 september 2011 

TG2 Romania Baia Mare 7 september 2011 

TG4 Romania Baia Mare 7 september 2011 

KOBA2 Romania Baia Mare 7 september 2011 

KOBA4T Romania Baia Mare 7 september 2011 

KEK2 Slovakia Modrý Kameň 8 december 2011 




PAR4 Slovakia Párovské Háje 18 january 2012 



MOD1 Slovakia Modra 18 january 2012 

MOD4 Slovakia Modra 18 january 2012 

BRAT1 Slovakia Bratislava 18 january 2012 

BRAT3 Slovakia Bratislava 18 january 2012 

SVE1 Slovakia Svätý Jur 18 january 2012 

SVE3 Slovakia Svätý Jur 18 january 2012


TET3 Macedonia Tetovo 4 october 2011 



VROT1 Macedonia Vrutok 4 october 2011 

VROT3 Macedonia Vrutok 4 october 2011 

OSOJ2 Macedonia Osoj 4 october 2011 

OSOJ7 Macedonia Osoj 4 october 2011 

VOL3 Macedonia Volino 4 october 2011 

VOL4 Macedonia Volino 4 october 2011 

RAD2 Macedonia Radolishta 5 october 2011 



PET1 Bulgaria Petrich 5 october 2011 

PET3 Bulgaria Petrich 5 october 2011 

KAV2 Greece n.a n.a 

KAV5 Greece n.a n.a 

PIR1 Greece n.a n.a 

P74 Greece n.a n.a 

ARK14 Greece n.a n.a 

HOR10hpv Greece n.a n.a 

KAS1 Greece n.a n.a 

KAS2 Greece n.a n.a 

P5-1 Greece n.a n.a 

P5-2 Greece n.a n.a 

ME48-1 Greece n.a n.a 

ME48-2 Greece n.a n.a 

MV1/4 Greece n.a n.a 

MV1/6 Greece n.a n.a 

Figure 1. Map showing the collection sites of Cryphonectria parasitica isolates involved in this study


Culture morphology and growth 

Isolates were grown on PDA (Difco 39 g L_1) in 90mm diam. Petri dishes are 

incubated at 25 °C in the dark for 1 week. 

DNA extraction 

For molecular works the studied cultures were grown in 100 ml of malt broth (MB, 

containing 2% malt extract) for 48 hours at room temperature in the dark on a rotary shaker 

(125 rpm). Mycelium from each culture was transferred to 100 ml Erlenmeyer flasks 

containing 50 ml MB. The cultures were grown at room temperature for 48 hours in the 

dark on a rotary shaker (125 rpm). Mycelium was harvested by vacuum filtration. Total 

genomic DNA was extracted from freeze-dried mycelium and isolated using NucleoSpin 

Plant II (Macherey-Nagel, 740770) according to the protocol, followed the manufacturer’s 

instructions. DNA concentrations were measured by NanoDrop (Thermo Scientific) 

Amplification of the large intron tef1 gene 

Amplifications of 50 µl PCR reaction mixture contained 25 µl 2xPCR Master Mix 

(Fermentas, #K0171, Burlington, Canada), 40 pmol of each primer, 20–40 ng DNA and 

nuclease free water were run out. Primers used to amplify the large intron of the tef1 gene 

was amplified by the EF1-728F (5'- CAT CGA GAA GTT CGA GAA GG -3') and EF1- 

986R (5'- TAC TTG AAG GAA CCC TTA CC -3') primer pair (Druzhinina and Kubicek, 

2005) according to the following program: 3 min initial denaturing at 95°C, followed by 5 

cycles of 1 min at 95°C, 1 min annealing at 59°C, 1 min at 72°C and 25 cycles of 1 min at 

90°C, 1 min annealing at 59°C, 1min at 72°C and 15 min final extension at 72°C. PCR was 

performed in a Primus (MWG Biotech, Martinsried, Germany) thermocycler. Amplification 

products were subjected to electrophoresis in a 0.7 % agarose gel containing EtBr for 1 

hour and visualized by UV illumination. The PCR products were purified by using YM-100 

Microcon Centrifugal Filter Devices (Millipore, Billerica, USA). Purified amplification 

products were sequenced by MWG Biotech in Germany. 

Amplification of nuclear ribosomal internal transcribed spacer (ITS) and translation 

elongation factor 1-alpha (tef1) and sequencing 

Amplifications of 50 µl PCR reaction contained 25 µl 2xPCR Master Mix 

(ImmoMix, Bioline, 25020), 40 pmol of each primer, 20-40 ng of genomic DNA and 

nuclease free water were run out. Primers (Integrated DNA Technologies, Inc) used to 

amplify approx. 520bp of the ITS region containing the internal transcribed spacer regions 

1 and 2, moreover the 5.8S rDNA are based on published composite sequences, SR6R and 

LR1 (White et al., 1990) with the following amplification protocol: 3 min initial denaturing 

at 95 °C, followed by 5 cycles of 1 min at 95 °C, 1 min annealing at 50 °C, 1 min at 72 °C 

and 25 cycles of 1 min at 90 °C, 1 min annealing at 50 °C, 1 min at 72 °C and 15 min final 

extension at 72 °C. The large intron (approx. 300bp) of the tef1 gene was amplified by the 

EF1-728F and EF1-986R primer pair (Druzhinina and Kubicek, 2005) according to the previously 

described protocol with a temperature of 56 °C rather than 50 °C. 

PCR was performed in a Primus (MWG Biotech) thermocycler. Amplification products 

were subjected to electrophoresis in a 0.7 % agarose gel containing EtBr and visualized by 

UV illumination. The PCR products were purified by using Nucleospin Gel and PCR 

Clean-up (Macherey-Nagel, 740609). Purified amplification products were sequenced by 

MWG Biotech Company in Germany.


Data analysis 

The obtained DNA sequences were aligned first with ClustalX (Thompson et al., 

1997) automatically and manually checked for ambiguities and adjusted, when necessary, 

using Genedoc (Nicholas et al., 1997). Single gaps were treated either as missing data or as 

the fifth base and multistate characters as uncertain. In phylogenetic analyses tef1 and ITS 

fragments of other Cryphonectria parasitica from GenBank maintained by NCBI were also 

included. Parsimony analyses (Kluge and Farris, 1969; Farris, 1970; Fitch, 1971) were 

performed using PAUP 4.0 (Swofford, 2002) and consisted of heuristic searches with 1 K 

random addition sequences and tree bisection–reconnection (TBR) branch swapping. All 

characters were equally weighted and alignment gaps were treated as missing data. The 

stability of clades was assessed with 1 K BS replications. Phylogenetic trees were drawn by 

TREEVIEW (Page, 1996). 

RESULTS 

The genomic DNA concentrations after the extraction were about 100 ng/µl. PCR 

amplifications resulted in single fragments of circa 350bp of tef1 fragment and in single 

fragments approx. 560bp of the rDNA gene containing the internal transcribed spacer 

regions 1 and 2 and the 5.8S regions was amplified. There was no size variation observed 

among amplified tef1 and ITS fragments. The phylogentic tree based on ITS sequence (Fig. 

2) is drawn by parsimony analysis. Topological robustness in parsimony analysis was 

estimated using 1000 bootstrap replicates. The numbers above the lines on the Fig. 4 

represent the bootstrap values which support the robustness of the clades. The C. parasitica 

isolates are grouped in several clades which indicates the high variability in ITS sequences. 

However the clades do not represent the studied geographical regions. Tef1 sequences were 

edited to 320bp for the alignment. At the time of the analyses, only two tef1 sequences were 

available in the database. In the case of tef1 fragment, no differences were found during the 

alignment. The tef1 sequences of all isolates were perfectly identical. The phylogenetic tree 

based on partial sequences of EF-1α genes sequences (Fig. 3) is drawn by parsimony 

analysis. Parsimony analysis of the tef1 fragment did not revealed any estimable values. 

Only little differences were found between the tef1 sequences of our isolates and the ones 

downloaded from GenBank but this could be attributed to the mis-sequencing of the tef1 

sequences found in the GenBank. Our results show that there is no variability in tef1 

sequences among C. parasitica isolates collected from Europe.


Figure 2. Phylogenetic relationships of Cryphonectria parasitica strains inferred by Parsimony 

analysis of ITS sequences. The numbers above the lines represent the bootstrap 

(bootstrap=1000) values. Our isolates are indicated by colors, the isolates downloaded from 

GenBank indicated by black color


Figure 3. Phylogenetic relationships of Cryphonectria parasitica strains inferred by Parsimony 

analysis of tef1 sequences. The numbers above the lines represent the bootstrap 

(bootstrap=1000) values. Our isolates are indicated by colors, the isolates downloaded from 

GenBank indicated by black color.


DISCUSSION 

In this study we tried to use ITS sequences to resolve phylogenetic relationships at 

intra specific level among C. parasitica isolates collected from different geographical 

regions of Central-Europe. Our results shows that the ITS sequences are suitable for 

phylogenetic studies among C. parasitica isolates but they do not represent geographical 

distributions. Further work need to be done to see whether there are other characteristics 

which is correlates with the variability of ITS sequences. 

Translation elongation factor 1 subunit alpha (EF1α) encoding gene (tef1) has been 

proved to be a useful gene to resolve phylogenetic relationships at species level, as well as 

in deeper divergences of fungi (Roger et al., 1999; Druzhinina and Kubicek, 2005). In our 

study, the tef1 sequences have not showed any differences, they were identical in all 

isolates supporting that these sequences remained conservative within this species. The 

result shows that the tef1 sequences are not well suited for delineating phylogenetic 

relationships within C. parasitica isolates collected from different regions of Europe. The 

difference among the C. parasitica isolates originated from the Carpathian-Basin was not 

insignificant because only six sites were considered as informative for the parsimony 

analysis. The bootstrap values were not enough high either to support real differences 

among isolates. Significant, well based differences were not found between Hungarian 

isolates. Little differences were found between Hungarian, Greek and isolates from 

database which constitute separate groups. It show also that the tef1 sequences could be 

suitable for studying C. parasitica isolates originated from geographical places far away 

from each other. 

REFERENCES 

Anagnostakis, S.L. (1987). Chestnut blight: the classical problem of an introduced pathogen. 

Mycologia 79: 23–37. 

Braghi, A. (1946). Il cranco del castagno causato da Endothia parasitica Ital. Agric. 7: 406-412. 

Druzhinina, I., Kubicek, C.P. (2005). Species concepts and biodiversity in Trichoderma and 

Hypocrea: from aggregate species to species cluster? Journal of Zhejiang University 

Science 6B: 100-112. 

Farris, J.S. (1970). Estimating phylogenetic trees from distances matrixes. American Nature 

106: 645-668. 

Fitch, W.M. (1971). Toward defining the course of evolution: minimum change for a specific 

tree topology. Systematic Zoology 20: 406-416. 

Kluge, A.G., Farris, J.S., (1969). Quantitative phyletics and the evolution of anurans. Systematic 

Zoology 18: 1-32. 

Nicholas, K.B., Nicholas, Jr. H.B., Deerfield, II D.W.I. (1997). GeneDoc: analysis and 

visualization of genetic variation. Embnew news 4: 14. 

Page, R.D.M. (1996). TREEVIEW: an application to display phylogenetic trees on personal 

computers. Computer Applications in the Biosciences 12: 357-358. 

Roger, A.J., Sandblom, O., Doolittle, W.F., Philippe, H. (1999). An evaluation of elongation 

factor 1α as a phylogenetic marker for eukaryots. Molecular biology and evolution 16: 

218-233. 

Swofford, D.L. (2002). PAUP*: phylogenetic analysis using parsimony (*and other methods), 

version 4b10. Sinauer Associates, Sunderland, MA.


Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G. (1997). The 

ClustalX windows interface: flexible strategies for multiple sequence alignment aided by 

quality analysis tools. Nucleic acids research 24: 4876-4882. 

White, T.J., Bruns, T., Lee, S., Taylor, J. (1990). Amplification and direct sequencing of fungal 

ribosomal RNA genes for phylogenetics. pp. 315-322. In: PCR protocols. A guide to 

methods and applications. Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (Eds.) 

Academic Press, Inc., New York.

Stojšin Vera, Budakov Dragana, Bagi Ferenc, Đuragin Nadežda, Marinkov Ranko 251 


Proceedings 

MORPHOLOGICAL, CULTURAL AND PATHOGENIC 

CHARACTERISTICS OF MACROPHOMINA PHASEOLINA 

ISOLATES FROM SUGAR BEET 

STOJŠIN VERA, BUDAKOV DRAGANA, BAGI FERENC, ĐURAGIN NADEŽDA, 

MARINKOV RANKO 

Department for Environmental and Plant Protection, Faculty of Agriculture, University of Novi 

Sad, Trg Dositeja Obradovića 8, 21000 Novi Sad, Serbia 

Charcoal root rot, caused by Macrophomina phaseolina is potentially the most destructive 

sugar beet pathogen in Serbia, especially during extremely warm and dry season. Sixteen isolates 

from sugar beet and three from sunflower, soybean and maize were chosen for testing morphological 

and cultural characteristics, as well as their pathogenicity on young sugar beet plants. All isolates 

were chlorate sensitive, even though significant differences existed between isolates in colony 

diameter on Minimal Media (MIN). All isolates were pathogenic to sugar beet plants causing 

symptoms of necrosis on hypocotyls and roots. In regard to their pathogenicity isolates were grouped 

into low pathogenic (26.3%), moderately and highly pathogenic (36.8% each). 

KEY WORDS:Macrophomina phaseolina, sugar beet, microsclerotia, chlorate resistance, 

pathogenicity 

INTRODUCTION 

Macrophomina phaseolina was first discovered in warm and arid regions of 

California (Tompkins, 1938). Almost at the same time it was described in the former USSR 

(Solunskaja, 1959). In our country, this fungus was described in 1967 on sugar beet in north 

and central Banat. Significant occurrence was observed in 1971 in many localities in the 

Vojvodina Province, while M. phaseolina was predominantly found in isolations from 

sugar beet with symptoms of wilt and root rot in 1992, 2003 and especially in 2009, when it 

caused damages in over 50% of sugar beet growing areas (damages were estimated on 

approximately 2.5 million euro). This polyphagous plant pathogenic fungus attacks 

sunflower, soybean, maize, rapeseed, tobacco, alfalfa, red clover, potato, peas, beans, 

pepper, onion, cabbage, watermelon, strawberry and many weed species. 

Symptoms of charcoal root rot on sugar beet start with wilting and usually end in 

complete decay. Typical symptoms may appear on the crown, the central part and tip of the 

root when the outer tissues become grayish brown to black with a silverish reflection, 

whereas the inner tissues turn into sponge like consistency, with colors ranging from lemon 

yellow and finally brownish to black. Severely damaged roots in dry soils can become 

mummified, while in moist soils rot can have a wet appearance (Figure 1) (Stojšin, 2003).

252 Morphological, curtural and pathogenic characteristics of... 

Figure 1. Symptoms of charcoal root rot 

The pathogen survives in plant remains in the field as mycelia and microsclerotiaoverwintering 

structure. Microsclerotia may survive in the soil for many years and they are 

always present in sufficient amount. Infection may occur on young roots, after which the 

pathogen spreads through the vascular system, while characteristic symptoms appear after 

plants are being stressed due to drought (Stojšin et al., 1999). 

Lack of water and high soil temperatures (25-30 o C) are favorable conditions for 

disease development. Also, many other factors that cause drop of plant vitality increase 

susceptibility to M. phaseolina. Cultural practices in combination with environmental 

factors may significantly affect disease incidence. With more frequent growing seasons 

associated with high temperatures and lack of precipitation this pathogen could become 

predominant in the sugar beet root mycopopulation in Serbia, where beets are primarily 

grown without irrigation (Stojšin et al., 2011). 

Therefore, the aim of this research was to separate and classify isolates of M. 

phaseolina and to test their morphological and cultural characteristics, as well as their 

pathogenicity on young sugar beet plants. 

MATERIAL AND METHOD 

Collection of isolates 

Isolates that were used in this research were chosen from the collection comprising 

103 monohyphal isolates of M. phaseolina. Sixteen isolates from sugar beet grown in


leading production areas in Serbia were tested, including one isolate from sunflower, 

soybean and maize each. Isolates including localities are listed in Table 1. 

Table 1. Codes, localities and hosts of isolates used in this research. 

Morphological and cultural characteristics 

Cultural characteristics were evaluated on Potato Dextrose Agar (PDA) and Minimal 

Media (MIN) using methods described by Pearson et al. (1986). MIN was amended with 

chlorine by adding 0.015% of potassium chlorate. Petri dishes were incubated at 30°C and 

each isolate was repeated four times. Mycelial growth was evaluated after three days by 

measuring the diameter of the culture. The size of 100 microsclerotia was measured on all 

media after six days. 

Pathogenicity tests 

Inoculum was prepared by colonizing sorghum seed with tested M. phaseolina 

isolates (Omar et al., 2007). Sugar beet plants at the two leaf stage were replanted in 

500cm³ pots containing mixture of sterile sand and inoculum in a 3:1 ratio (v/v). For the 

negative control, plants were grown in non inoculated sterile sand. Plants were incubated in 

a growth chamber at 30°C with a photoperiod of 16h/8h light/dark and watered daily. 

Symptom development on leaves was assessed daily, while final evaluation of root and 

hypocotyl necrosis was performed after eight days when over 50% of plants showed 

symptoms of irreversible wilting. 

Root and hypocotyl necrosis was rated using a scale from 0 to 4 which is explained 

in Table 2. Based on average pathogenicity isolates were grouped into three groups: i) low 

pathogenic 0-1, ii) moderately pathogenic 1-2, iii) highly pathogenic 2-4.


Table 2. Scale for rating hypocotyl and root necrosis on young sugar beet plants 

Data analysis 

Data were analyzed by analysis of variance (ANOVA) using Statistica 10 (StatSoft, 

Tulsa, OK). Comparisons between means were made with Duncan’s Multiple Range Test at 

significance level of 5%. 

RESULTS AND DISCUSION 

The mycelial growth of the majority of the isolates grown on PDA reached 

maximum and filled Petri dish in 3 days. Only two isolates (ŠR 7/09 and Mph Su) had 

significantly slower growth. 

In general, isolates showed different growth patterns on MIN amended with chlorine 

and statistical differences were detected (Table 3). However, none of tested isolates was 

resistant to chlorine, i.e. none of isolates formed dense mycelium as on PDA. The size of 

microsclerotia on PDA was on average larger than on MIN given that some isolates did not 

form microsclerotia on media with chlorine. 

Seven isolates (36.8%): ŠR5/09, MphKu, ŠR62/4, ŠR17/11, ŠR24M/10, ŠR15/11 

and ŠR1/11showed high pathogenicity with average ratings from 2 to 4 -(Table 3). Seven 

isolates were categorized into a moderately pathogenic group (ŠR55(3)/09, ŠR7/09, 

ŠR3/09, ŠR2/09, ŠR45(4)/09, Mph Su and ŠR23/11), among which appeared significant 

differences. Five isolates (26.3%)-ŠR 9M/10, ŠR10/09, MphSo, ŠR14/09 and ŠR42/09 

showed low pathogenicity.


Table 3. Influence of media on mycelia growth and the size of microsclerotia, chlorate 

sensitivity and pathogenicity of M. phaseolina 

DISCUSSION 

M. phasolina, causal agent of charcoal root rot is a plant pathogenic fungus that 

causes great damages in arid regions. Additionally, drought stress increases plant 

susceptibility to this fungus (Mayek-Perez et al., 2002). Since M. phaseolina is highly 

polyphagous attacking over 500 species (Dhingra and Sinclair, 1978), variations in chlorate 

sensitivity, microclerotial size and formation as well as pathogenicity are not surprising 

(Pearson et al., 1987). 

However, there are limited data on occurrence and significance of M.phaseolina on 

sugar beet, so the aim of this research was to describe cultural, morphological and 

pathogenic characteristics of isolates from sugar beet and compare them to isolates from 

other hosts (sunflower, soybean and maize). Results showed that there are differences in 

pathogenicity of isolates from sugar beet, and even more in isolates that are from other 

hosts (sunflower, soybean, maize). 

No pattern was detected in comparison of growth patterns on PDA and MIN, 

microsclerotia formation on both media and pathogenicity on sugar beet plants between 

isolates from sugar beet and other hosts. Since various authors reported that M. phaseolina 

isolates from different hosts can be differentiated using chlorate resistance (Pearson et al., 

1986; Rayatpanah et al., 2009), this implies the need to increase the number of isolates 

from other hosts.


Identifying differences in pathogenicity among isolates is the most useful tool for 

grouping isolates. Based on our results, isolates can be divided into 3 groups: low 

pathogenic – 5 isolates (26.3%), moderately and highly pathogenic – 7 isolates (36.8%) for 

each group. 

Given that M. phaseolina is a polyphagous and always present in the soil, and 

environmental factors are hard to control in the sugar beet production without irrigation, 

one potential solutions is breeding for resistance (Stojšin et al., 2012).The described method 

for artificial inoculation can be used as the optimized method for pathogenicity testing of 

large number of isolates from Serbian sugar beet growing areas, which enables further 

research of M. phaseolina population as well as fast testing of sugar beet genotypes that are 

grown in our region. 

REFERENCES 

Dhingra, O. D., Sinclair, J. B. (1978): Biology and Pathology of Macrophomina phaseolina. O. 

D. Dhingra and J. B. Sinclair, eds. Universidade Federal De Vicosa, Minas Gerais. 

Mayek-Perez, N., Garcia-Espinoza, R., Lopez-Castaneda, C., Acosta-Gallegeos, J., Simpson, J. 

(2002): Water relations, histopathology and growth of common bean (Phaseolus vilgaris 

L.) during pathogenesis of Macrophomina phaseolina under drought stress. 

Physiological and Molecular Plant Pathology 60, 185-195. 

Omar, M.R., Abd-Elsalam, K.A., Aly1, A.A., El-Samawaty, A.M.A., Verreet, J.A. (2007): 

Diversity of Macrophomina phaseolina from cotton in Egypt: Analysis of pathogenicity, 

chlorate phenotypes, and molecular characterization Journal of Plant Diseases and 

Protection, 114 (5): 196–204. 

Pearson, C.A.S., Leslie, J.F., Schwenk, F.W. (1986): Variable chlorate resistance in 

Macrophomina phaseolma from corn, soybean and soil. Phytopathology 76, 646—649. 

Pearson, C.A.S., Leslie J.F., Schwenk, F.W. (1987): Host preference correlated with chlorate 

resistance in Macrophomina phaseolina. Plant Disease, 71: 828-831. 

Rayatpanah, S., Nanagulyan, S.G., Alavi, S.V., Yasari, E. (2009): Phenotypic Variations of 

Isolates of Macrophomina phaseolina from Different Hosts in Northern Iran. Australian 

Journal of Basic and Applied Sciences 3(3): 2908-2913. 

Solunskaja I. N. (1959): Bolezni vsego rastenija, vizivaemie nebalogoprijatnimi uslovijami 

pitanija. Sveklovodstvo. 

Tompkins, C. M. (1938): Charcoal root rot of sugar beets. Hilgardia 12 (1). University of 

California, Berkeley. 

Stojšin, V., Marić, A., Marinković, B. (1999): Effect of drought, high temperatures and mineral 

nutrition on the occurrence of char-coal root rot of sugar beet (Macrophomina phaseolina 

Tassi Goidanich). Proceedings of the International Symposium for Biological Control of 

Noxious Animals and Pests- East Paleartic Section, Vrnjačka Banja, Yugoslavia, September 

25 th , 195-203. 

Stojšin, V. (2003): Ethilogy of sugar beet root diseases in different regimes of mineral nutrition. 

PhD Thesis, University of Novi Sad, Faculty of Agriculture, 1-159 (in Serbian). 

Stojšin, V., Budakov, D., Bagi, F., Marinković, B., Marinkov, R., Janićijević, M. (2011): 

Influence of locality on type of rot and mycopopulation of sugar beet root in 2010. Plant 

doctor, 39 (1), 54-60 (in Serbian). 

Stojšin, V., Bagi, F., Budakov, D., Marinković, B., Nagl, N. (2012): Sugar beet root rot in 

Serbia. 73. IIRB Congress, Proceedings of Papers, 14-15.02.2012, Brussels, Belgium, 

195-202.

Rossitza Rodeva 1 , Ilija Karov 2 , Zornitsa Stoyanova 1 ,... 257 


Proceedings 

PHOMOPSIS CAPSICI AND COLLETOTRICHUM COCCODES 

INFECTING PEPPER IN MACEDONIA 

ROSSITZA RODEVA 1 , ILIJA KAROV 2 , ZORNITSA STOYANOVA 1 , BILJANA KOVACEVIK 2 , 

VASILISSA MANOVA 1 , RALITSA GEORGIEVA 1 

1 Institute of Plant Physiology and Genetics, 1113 Sofia, Bulgaria 

2 Goce Delcev University-Stip, Macedonia 

Phomopsis capsici and Colletotrichum coccodes were found on pepper fruits during a joint 

expedition carried out in Macedonia. The lesions caused by P. capsici often occurred together and 

resembled slightly those incited by C. coccodes. Phomopsis lesions could be differentiated on the 

basis of pliable leathery condition of the affected tissue and of pycnidium presence while C. coccodes 

produced lesions with regular round shape and abundant acervuli, setae and microsclerotia in 

colonized fruit tissue. On some fruits P. capsici caused single infection but mixed infections of 

Phomopsis and Colletotrichum were observed, as well. C. coccodes is a soil-borne pathogen that 

produces long-lasting structures (microsclerotia) in the plant debris. The development of this 

pathogen on pepper might contribute to the building up of inoculum in the soil which could serve as 

reservoir for other Solanaceae. To our knowledge, this is the first report of P. capsici and C. coccodes 

on pepper in Macedonia. 

Key words: Capsicum annuum, Colletotrichum coccodes, pepper anthracnose, Phomopsis 

capsici, fruit decay 

INTRODUCTION 

Last years, Phomopsis capsici (Magnaghi) Sacc and several Colletotrichum spp. 

(Colletotrichum gloeosporioides (Penz.) Penz. & Saccardo in Penz., C. acutatum 

Simmonds ex Simmonds and C. coccodes (Wallr.) S.J. Hughes) occurred on pepper in 

Bulgaria with increasing frequency (Rodeva et al., 2009a; 2009b; 2009c). In August 2011 a 

joint expedition was carried out in Macedonia related to the implementation of ERA 226 

project. Two new pepper fungal pathogens were found, isolated, described and 

characterized. The results are presented in this paper. 


Initial isolations from diseased pepper fruits on potato dextrose agar (PDA) revealed 

the presence of P. capsici and C. coccodes. Four Macedonian (MK26.1, MK26.2, MK7.1, 

MK7.2) and one Bulgarian (B8.1) isolates of C. coccodes were selected for the investigations. 

Identification of Colletotrichum spp. was performed on the basis of morphological 

and cultural characteristics (conidial size and morphology, colony morphology and growth

258 Phomopsis capsici and Colletotrichum coccodes infecting papper in Macedonia 

rate, presence or absence of: teleomorph, setae, microsclerotia) (Sutton, 1992; Freeman et 

al., 1998; Tozze Jr. et al., 2006) and pathogenicity tests. Growth rate and colony appearance 

were studied on three nutrient media: PDA, 0.2% malt extract agar (MEA) and oatmeal 

agar (OA), which were inoculated with mycelial discs taken from the edge of growing 

colonies. For the pathogenicity tests the isolates were grown on PDA. Pin pricked detached 

pepper fruits were inoculated with agar plugs containing fungal mycelium. Control fruits 

were inoculated with sterile PDA discs. Tomato and eggplant fruits were additionally 

inoculated with C. coccodes for comparison. Fruits were incubated for 7 days at 25°C under 

100% relative humidity. Reisolations were made at the end of the experiments. At least 100 

conidia of each isolate were measured on the images with Carnoy program. 

Total DNA of investigated Colletotrichum isolates was extracted directly from 

mycelium by DNeasy Plant mini kit (Qiagen, Hilden, Germany). PCR amplifications were 

performed with both Colletotrichum-specific primer set Cc1F1/Cc2R1 and C. coccodesspecific 

nested primers Cc1NF1/Cc2NR1. The gels were visualized by UV 

transillumination, their electronic images were taken by ImageQuant150 imager (GE 

Healthcare) and densitometrically analyzed with ImageQuantTL7 software (GE Healthcare) 

to determine the approximate length of the resulting PCR products. 

RESULTS 

C. coccodes was isolated mainly from fruits, seeds of heavily infected fruits and 

occasionally from roots although it could infect stems and leaves. The disease symptoms 

were observed in the area of Kochani (village Dolni Podlog) on variety Kurtovska kapija 

and in Strumica (village Bosilovo) also in the postharvest period. Fruit anthracnose 

appeared first as small, circular, slightly sunken lesions on the surface of ripening fruits 

(Fig. 1a). Majority of infections were observed on ripe or over-ripe fruits. The spots quickly 

enlarged in concentric circles, coalesced, become deeply sunken with dark brown border 

and developed a water-soaked appearance directly beneath the skin (epidermis) of the fruit 

(Fig. 1b). At first small rounded acervuli containing rose conidial mass were developed on 

the surface and beneath the lesion (Fig. 1c,e). Later then the fungus formed small, dark 

survival structures called sclerotia (Fig. 1d). 

Fig. 1. Colletotrichum coccodes: Symptoms of anthracnose on pepper fruits, early infection (a); 

coalescent lesions (b); young lesions with sporulating acervuli (c); fully developed lesions with 

microsclerotia (d); sporulating acervuli (e)


The C. coccodes colonies were slowly growing. On the ninth day the highest growth 

rate was recorded on OA (49.5±5.1 mm) and PDA (47.8±4.8 mm) (Fig. 2c,a) and the 

lowest – on MEA (39.0±7.6 mm) (Fig. 2b). Bulgarian isolate had higher growth rate than 

Macedonian ones on all nutrient media used in the study. The colony colour was gray with 

rose nuance mainly in the periphery, where acervuli with conidia developed. With aging a 

great number of microsclerotia appeared under mycelium. 

Fig. 2. Colletotrichum coccodes: Appearance of 10 days old colonies potato dextrose agar (a), 

malt extract agar (b) and oatmeal agar (c) (left and middle column Macedonian isolates, right 

column – Bulgarian isolate)


Conidia were hyaline, straight, cylindrical, aseptate with two to seven oil globules 

measuring (19.2) 21.3±1.7 (24.6) x (3.1) 4.1±0.4 (4.7) µm (Fig. 3a). Acervuli with setae 

longer than 100 µm developed (Fig. 3b). 

Fig. 3. Colletotrichum coccodes: Conidia (a) and acervulus with conidiophores, conidia and 

setae (b) (Scale bars = 10 µm) 

All investigated C. coccodes isolates were pathogenic for pepper, tomato and 

eggplant (Fig. 4a,b,c). Water-soaked circular lesions appeared three days after inoculation 

(dai) that became soft and slightly sunken. Wet, gelatinous conidial mass from fungal 

fruiting bodies (acervuli) gradually covered the lesions. About 10 - 14 dai the central lesion 

part darkened where abundant microsclerotia developed. 

Fig. 4. Colletotrichum coccodes: Symptoms on artificially inoculated pepper (a), tomato (b) and 

eggplant (c) fruits – 14 days after inoculation


PCR amplification with genus-specific primers (Cc1F1/Cc2R1) gave a single band 

of ~450 bp in all isolates analyzed (C. coccodes and C. sp.) as expected from the literature 

(Cullen at al., 2002) (Fig. 5A). However, with the nested primer set Cc1NF1/Cc2NR1, a 

single specific PCR band of expected size (~350bp) was obtained only in those reactions 

containing as a template DNA from investigated C. coccodes isolates (Fig. 5B). 

Fig. 5. Molecular identification of different Colletotrichum species: Gel (A): PCR amplification 

with primers Cc1F1/Cc2R1; gel (B): PCR amplification with C. coccodes-specific primers 

Cc1NF1/Cc2NR1; Lanes 2-13 (C. coccodes isolates B8.1, B2.1, B40.1a, MK26.1, MK26.2, 

MK7.1, MK7.2 and C. sp. isolates B27, B1.1, B29, S2, S3); lanes 14: Negative controls (mQ 

water); lanes 1: DNA marker GeneRuler 1kb+ (Fermentas).


P. capsici was found in the village Zubovo, Strumica region, on pepper fruits cv. 

Zubovska kapija (domestic pepper variety of Kurtovska kapija, which is grown only in this 

village). Until now P. capsici was not recorded on pepper anywhere else in the country. 

The symptoms of P. capsici on the fruits appeared as brown rot extending in wavy rings 

more rapidly longitudinally than laterally in the tissue (Fig. 6a). Infection progress led to 

fruit decay. The dead tissue became dry and bleached in the centre where black globose to 

subglobose subepidermal or erumpent pycnidia were noticed. White felt-like mycelium 

developed inside the damaged fruits. The fungus was isolated not only from pericarp but 

also from seeds of diseased pepper fruits. 

Fig. 6. Phomopsis capsici: symptoms (a), colony morphology (b) and alpha and beta conidia (c) 

P. capsici developed fast growing colonies on PDA (Fig. 6b). They were initially 

white, later developing light to dark brown patches and reached the Petri dish borders 7 

days after inoculation. Small black pycnidia (150-250 µm) developed after 10-12 days. The 

extruded conidia were visible as yellowish globose slime. The reverse sides of the colonies 

were grayish with darker regions coinciding with conidiomata. The isolates produced 

abundant alpha conidia – unicellular, straight, ovoid to oblong-fusoid, hyaline, biguttulate, 

with averrage dimensions 6.8 x 2.9 µm, scarce beta conidia which are unicellular, curved or 

hamate, eguttulate, with averrage dimensions 29.8 x 1.8 µm and very rarely gamma conidia 

– unicellular, straight, paddle shape, multiguttulate, with averrage dimensions 11.0 x 2.9 

µm (Fig. 6c). The first ones only are viable and infective. No perithecia were found on the 

over wintered diseased pepper fruits or in culture. Artificial inoculations of detached pepper 

fruits led to successful infection ten day after inoculation. 

DISCUSSION 

Anthracnose of pepper caused by C. coccodes appeared to be a devastating disease 

of ripe fruits causing severe damages to both field and post harvest levels in warm and 

rainy seasons. The infections occurred on green fruits but symptoms were visible after the 

ripening. During the season the pathogen was spread from infected to healthy fruits with 

conidia splashed by rain, overhead irrigation, or by picking fruit from wet plants. The 

lasting structures called sclerotia could survive in soil for up to three years and cause 

infections either directly or by producing secondary spores. The lesions caused by P. 

capsici often occurred together and resembled slightly those resulting from infection by C. 

coccodes. Phomopsis lesions could be differentiated on the basis of pliable leathery 

condition of the affected tissue and of pycnidium presence while C. coccodes produced 

lesions with regular round shape and abundant microsclerotia in colonized fruit tissue. On


some fruits P. capsici caused single infection but mixed infections of Phomopsis and 

Colletotrichum were observed, as well. 

To our knowledge, this is the first report of C. coccodes and P. capsici on pepper in 

Macedonia. Recently, C. coccodes has been reported in Bosnia and Herzegovina (Trkulja et 

al., 2008). C. coccodes is an important soil-borne pathogen that produces long-lasting 

structures (microsclerotia) in the dying plant parts, with host range in Solanaceae that 

includes pepper, tomato and eggplant, causing anthracnose and potato, causing black-dot. 

The outbreak of this pathogen on pepper can lead to an enrichment of inoculum density in 

the soil serving as an important source of inoculum for other solanaceous crops. 


Financial support of SEE-ERA.NET PLUS project ERA 226 is gratefully 

acknowledged. 

REFERENCES 

Cullen, D. W., Lees, A. K., Toth, I. K., Duncan, J. M. (2002). Detection of Colletotrichum 

coccodes from soil and potato tubers by conventional and quantitative real-time PCR. 

Plant Pathology, 51: 281–292. 

Freeman, S., Katan, T. Shabi, E. (1998). Characterization of Colletotrichum species responsible 

for anthracnose diseases of various fruits. Plant Disease, 82: 596-605. 

Rodeva, R., Pandeva, R., Stoyanova, Z. (2009a). A new fruit disease of pepper in Bulgaria 

caused by Phomopsis capsici. Acta Horticulturae (ISHS), 830: 551-556. 

Rodeva, R., Stoyanova, Z., Pandeva, R., Petrov, N. (2009b). Field reaction to anthracnose 

caused by Colletotrichum spp. on pepper fruits. Acta Horticulturae (ISHS), 830: 557- 

562. 

Rodeva, R., Stoyanova, Z., Pandeva, R. (2009c). Occurrence of Colletotrichum coccodes on 

pepper fruits in Bulgaria. Plant Protection (Skopje), 20: 65-69. 

Sutton, B. C. (1992): The genus Glomerella and its anamorph Colletotrichum. In: 

Colletotrichum. Biology, Pathology and Control. J. A. Bailey and M. J. Jeger (eds.), 

CAB Intl., Wallingford, Oxon, UK, pp.1-26. 

Tozze Jr., H. J., Mello, M. B. A., Massola Jr., N. S. (2006). Morphological and physiological 

characterization of Colletotrichum sp. isolates from solanaceous crops. Summa 

Phytopathologica, 32: 71-79. 

Trkulja, V., Stojčić, J., Brkljač, G., Zavišić, N. (2008). Pojava Colletotrichum coccodes u BiH i 

mogućnosti njegova suzbijanja. Glasnik zaštite bilja, 31: 43-53.

264 The impact of biological control of wilt and rot disease of... 

International Symposium: Current Trends in Plant Protection UDK: 635.922-24 

Proceedings 

THE IMPACT OF BIOLOGICAL CONTROL OF WILT AND ROT 

DISEASE OF GLADIOLUS CORMS CAUSED BY FUSARIUM 

OXYSPORUM F. SP. GLADIOLI (MASSEY) 

A.O.AL-ATRAKCHII 1 , B.Y.IRAHEEM 2 

1 Hort. and landscape design Dept., College of Agriculture and Forestry University of Mosul / 

Mosul /Iraq 

2 Plant protection Dept., College of Agriculture and Forestry University of Mosul / Mosul /Iraq 

In this study, four isolates of the biological control agent Trichoderma spp. (in the form of 

suspension) was applied to the corms of gladiolus to control Fusarium oxysporum f.sp.gladioli under 

greenhouse conditions. The results indicated a varied antagonistic ability of biological control agent 

isolates against F.oxysporum f.sp.gladioli. Under the laboratory conditions, the isolates also reduced 

the disease severity and disease incidence of Fusarium oxysporum f. sp. gladioli in Gladiolus plants. 

Trichoderma spp. caused notable improving in vegetative characteristics of plants, biological control 

agent also caused significant increase in the total chlorophyll, carbohydrates and phenols. 

Key words: Gladiolus, Fusarium oxysporum, antagonistic, biological control, Trichoderma, 

phenols, 

INTRODUCTION 

Gladiolus hortulanus is an important commercial plants and occupies a privileged 

position for its flowers. It's production represents an important sectors in the agricultural 

economy in many countries (Singh, 2006). Gladiolus is seriously affected by Fusarium wilt 

disease caused the soil borne pathogen Fusarium oxysporum f. sp. gladioli. It causes wilt 

and corms rot resulting in significant losses in the production of flowers and corms. This 

disease has been reported as a problem which limits gladiolus production worldwide 

(Nelson,1981; Sunita and Deepika, 2010). Fusarium wilt disease usually spread in warm 

areas and under dry conditions. In the past few years, management the diseases using 

biological antagonists has been increased significantly (Barakat et al, 2007). This is 

influenced by the possibility of using alternatives measures to the use of fungicides. 

Trichoderma is a fast growing, soil fungus that parasitizes the mycelia of other fungi. The 

parasitic activity of Trichoderma is mediated by the excretion of a variety of enzymes 

including cellulases and chitinases and antibiotics such as gliotoxin (Harman, 2000). 

Trichoderma spp. are economically important, because of their mycoparasitic properties, 

which makes them suitable for application as biocontrol agents against soil-borne 

phytopathogenic fungi (Benitez et al., 1998). Trichoderma species are reported to give 

protection against Fusarium wilt disease under greenhouse and field conditions, reducing

A.O.Al-Atrakchii, B.Y.Iraheem 265 

disease severity and minimizing time required for germination, as well as improving the 

overall plant quality (Mishra et al., 2005; Sharma and Chandel, 2006; Nosir et al., 2010) 

MATERIAL AND METHOD 

Plant material: Gladiolus Gladiolus hortulanus Prisсilla corms was used. 

Biological control agent: T. harzianum strains Th(k20) and Th(k80) and T. viride 

strain TV1 and TV2 were Used Trichoderma isolates were obtained from Dr.K.H. Taha 

,plant protection department, college of agriculture and forestry ,university of Mosul, 

Mosul, Iraq. 

Pathogen isolation: Samples of infected Gladiolus corms and root were collected 

showing typical symptoms of the diseases. Approximately 2mm were used for the isolation 

of pathogen. The infected parts were surface sterilized with 6% sodium hypochlorite 

solution for 3 minutes and washed serially in sterilized distilled water to remove the traces 

of sodium hypochlorite solution and then transferred to the sterilized Petri plates containing 

potato dextrose agar PDA containing 10 µg/ml of tetracycline hydrochloride and 100 µg/ml 

of streptomycin sulfate.The Petri plates were incubated at 25 ± 2 °C and observed 

periodically for the growth of pure colonies. The pure colonies which developed from the 

infected tissues were transferred to PDA slants and incubated at 27 ± 1 °C for 15 days.On 

the basis of morphological characteristics such slants were identified according to the 

taxonomic keys reported by Barnett and Hunter (2006) and Booth (1977). 

In vitro antifungal activity of Trichoderma strain against Fusarium oxysporum f. sp. 

Gladioli were tested on dual culturing method. Discs (5 mm in diameter) of Fusarium 

oxysporum f. sp. Gladioli and Trichoderma strains (one at a time) were cut from advancing 

edge of 7-day PDA culture are placed 5 cm from each other and incubated at 30 °C. 

Inhibition of radial growth of fungi and encroachment over pathogens by Trichoderma 

were measured and compared with the control. 

Experimental design and conditions: Six treatments in the greenhouse experiment 

were designed:1: Non-inoculated control (non infested soil only); 2: Non-treated control 

(Fusarium-infested soil 3: Fusarium-infested soil supplemented with Th(k20) ); 4: 

Fusarium-infested soil supplemented with Th(k80); 5: Fusarium-infested soil 

supplemented with TV1; 6: (Fusarium-infested soil supplemented with TV2) ); Each 

treatment had five replicates (five pots). Each pot (diameter 30 cm, height 40 cm) was filled 

with 5 kg of sterilized soil (wet weight) and planted with one gladiolus corms. All pots 

were arranged randomly. Plants were grown under the daylight conditions in a greenhouse 

of the College of Agricultural and forestry University of Mosul, Iraq. 

Bioassay and assessment of disease incidence and severity: Bioassay and 

assessment of the disease incidence and severity was performed 60 days after the 

experiment was carried out in a greenhouse. The disease incidence was expressed as the 

percentage of diseased plants over the total number of plants. Physiological and 

biochemical parameters, including fresh weight, chlorophylls (a and b); carbohydrates 

percentage and total phenols content, were analyzed at this stage. The number of wilting 

plants in each pot was recorded. Severity symptoms on the individual plants were rated on a 

scale from 0 to 4, according to the percentage of foliage with chlorosis or necrosis in


acropetal progression: 0 = 0%, 1 = 1–33%, 2 = 34–66%, 3 = 67–100% and 4 = dead plant 

(Hervas et al.,1997). 

Statistical analysis. All calculations were carried out using the Statistic Analysis 

System, version 9 (SAS Institute, Cary, NC). For all experiments the levels of significance 

for the experimental repetitions, main treatments, and their interactions were calculated 

using the General Linear Models Procedure (PROC GLM). Data were subjected to analyses 

of variance and treatment means results were compared by an approximate Duncan’s 

multiple test (P


DISCUSSION 

The results of this study suggest that diverse Fusarium oxysporum f. sp. gladioli. are 

responsible for corms rot and root rot disease on Gladiolus plants. Fusarium oxysporum f. 

sp. gladioli are very common in field soil and all have been reported as causal agents of 

corms rot and root rot (Walid et al, 2011). Trichoderma spp. have attracted much academic 

and commercial interest as bio protective agents against fungal pathogens. The mode of 

action appears to be very complex indicating a possible mechanism which suppresses the 

disease incidence and severity of symptoms in gladiolus plants infected with F. oxysporum 

f. sp. gladioli (Jones,1975). Antibiotic production, mycoparasitism, the production of cell 

wall-degrading enzymes and competition for nutrients or space are considered as the 

actions involved in bio control of this pathogen and as well as the prevention of fusaric acid 

(an important virulence factor) production. Pathogenicity factors are required by plant 

pathogens to cause disease (Zeilinger and Omann, 2007; Vinale et al., 2008). During direct 

contact, lectins in the host’s cell wall can induce coiling of the Trichoderma around the host 

hyphae and mycoparasite can produce appressorium-like structures to destroy the pathogen 

(Zeilinger and Omann, 2007). 

Chlorosis of plant tissue is a common visible symptoms following infection with the 

phytopathogenic fungi. It may result as a consequence of either a) photo oxidative 

destruction of existing pigments, or b) inhibition of pigment synthesis. It is possible that the 

effect of the phytopathogenic fungi on chlorophyll and carotenoids is a result of decrease of 

the biosynthetic rate rather than a breakdown of pigments already formed. Adverse effect of 

fungal pathogen on chlorophyll pigments may be due to the fact that the fungal toxins form 

iron-chelate, transforming iron to become unavailable to participate in chlorophyll 

synthesis. Treatment with the bio control agents Trichoderma appeared to stimulate 

chlorophyll synthesis or at least eliminate the adverse effect of the phytopathogens on 

pigment formation (Ibraheem, 2009). 

Toxic metabolites of the pathogen may activate phenol-oxidizing enzymes causing 

high accumulation of phenol. The phenol-oxidizing enzyme plays a vital role in browning 

of the tissue by the way of its capacity to oxidize phenols to quinines, which increase host 

resistance against the invading pathogen (Brunner, et al., 2005). 

Growth inhibited 

Trichoderma strain 

Figure 1. In vitro growth inhibition of Trichoderma strain to Fusarium oxysporum f. sp. gladioli 

in PDA plate


Table 1. Effect of Trichoderma strain on the disease incidence and severity of Gladiolus plants 

inoculated with Fusarium oxysporum f. sp. gladioli in greenhouse condition 

Trichoderma strain Disease incidence % Disease severity 

Th(K20) 20 b 0.12 b 

Th(K80) 25 b c 0.14 b c 

TV1 25 b c 0.18 bc 

TV2 45 d 0.22 bc 

Non-treated control 70 a 0.6 a 

Non-inoculated control 0.0 e 0.0 e 

*Values are the means of five replicates. Means in a column followed by the same letter are not 

significantly different according to Duncan significant difference test at p £ 0.05. 

Table 2. Effect of Trichoderma strain on fresh weight, Plant height and number of leaves of 

gladiolus plants inoculated with Fusarium oxysporum f. sp. gladioli under greenhouse 

condition. 

Trichoderma strain fresh weight/ gm Plant high /cm Leaves number 

Th(K20) 40.2 ab 76abc 8.0 a 

Th(K80) 35.2 c 74.4 abc 6.4 b 

TV1 44.8 a 70.2 cd 7.4 ab 

TV2 41.8 bc 70.cd 7.0 ab 

Non-treated control 32.7 de 61.6 d 5.0 c 

Non-inoculated control 40.7 bc 83.6 a 7.4 ab 


significantly different according to Duncan significant difference test at p £ 0.05 

Table 3. Effect of Trichoderma strain on Chlorophyll, carbohydrate and total phenol contents of 

Gladiolus plants inoculated with Fusarium oxysporum f. sp. gladioli under greenhouse 

condition 

Trichoderma strain 

Chlorophyll a & b 

Total phenol 

%Carbohydrate 

(mg/g fresh eight) 

(mg/g fresh eight) 

Th(K20) 30.4 ab 2.51 ab 1.569 ab 

Th(K80) 35.6 a 2.17 b 1.489 ab 

TV1 32.4 ab 2.73 a 1.697 a 

TV2 35.4 a 2.37 ab 1.442 bc 

Non-treated control 19.2 c 1.81 c 1.357 d 

Non-inoculated control 33.8 ab 2,59 ab 1.456 bc 


significantly different according to Duncan significant difference test at p £ 0.05.


REFERENCES 

Barakat, M. Radwan, F., Al-Mahareeq, M., Ali-Shtayeh S., AL-Masri1 M.I. (2007): Biological 

Control of Rhizoctonia solani by Indigenous Trichoderma spp. Isolates from Palestine. 

Hebron Univ. Res. J.3: 1–15. 

Barnett, H.L, Hunter (2006): Illustrated Genera of Imperfect Fungi. ?urgess. Pulishing 

Company. 241 pp. 

Benitez, T., Rincon, A.M., Limon, M.C., Codon, A.C. (2004): Biocontrol mechanisms of 

Trichoderma strains. Int. Microbiol., 7: 249-260. 

Booth, C. (1977): Fusarium. Commonwealth Mycological Institute. Kew, Surrey, England, 357 pp. 

Brunner K., Zeilinger, S., Ciliento, R., Woo, L.S., Lorito, M., Kuicek, C.R., Mack, R.L. (2005): 

Improvement of fungal iocontrol agent Trichoderma atroviride to enhance oth 

antagonism and induction of plant systemic disease resistance. Appl. Environ. Microiol. 

7: 3959-3969. 

Harman, G.E. ( 2000): Myths and dogmas of biocontrol change in perceptions derived from 

research on Trichoderma harzianum T22 . Plant Dis. 84: 377-393 . 

Hervas, A. Linda, B., Jimenez-Diaz, R.M. (1997): Influence of chickpea genotype and Bacillus 

sp on protection from Fusarium wilt by seed treatment with nonpathogenic Fusarium 

oxysporum. Eur J Plant Pathol 103:631–642. 

Ibraheem, B.Y. (2009): Induced biotypes from the Fungus Trichoderma Types to Improve 

biocontrol and Enhancement Plant Growth Parameters. Ph.D. Thesis. College of 

Agriculture and Forestry, Mosul Univ., Iraq (In Arabic with English abstract). 

Jones, R.K., Jenkins, J.M. (1975): Evaluation of resistance in Gladiolus sp.to Fusarium 

oxysporum f.sp . gladioli. Phytopathology, 65(4): 481-484. 

Mishra, P.K., Mukhopadhyay, A.N., Fox, R.T.V. ( 2005): Integrated and iological control of 

gladiolus corm rot and wilt caused by Fusarium oxysporum f. sp.gladioli. Appl. Biol. 

137: 361-364. 

Mishra, P.K., Mukhopadhyay, A.N., Fox, R.T.V. (2000):Integrated and biological control of 

gladiolus corm rot and wilt caused by Fusarium oxysporum f.sp gladioli.Annu. Appl. 

Biol. 137: 361–364. 

Nelson, P.E., Hort, R.K., Woltz, S.S. (1981): Fusarium Diseases of Ornamental Plants. In: 

Nelson P.E., Tonson J.A., Cook R.J.(eds), Fusarium: diseases, Biology, Taxonomy, 

Pemsylvania State University Press, pp. 121-128. 

Nosir, W., Jim, M., Steve, W. (2010): The Efficiency of Trichoderma harzianum and 

Aneurinoacillus migulanus in the Control of Gladiolus CormRot in Soil-Less Culture 

System. American Journal of Agricultural and Biological Sciences, 5 : 436-445. 

Vinale, F., Sivasithamparam, K., Ghisalberti, E.L., Marra, R., Barbetti, M.J., Woo, H.,, Lorito, 

S.L. (2008): A novel role for Trichoderma secondary metabolites in the interactions with 

plants. Physiol. Mol. Plant Pathol. 72,80-86. 

Walid, N., McDonald, J, Woodward, S. (2011): Impact of biological control agents on fusaric 

acid secreted from Fusarium oxysporum f. sp. gladioli (Massey) Snyder and Hansen in 

Gladiolus grandi Xorus corms Ind Microbiol Biotechnol 38:21–27. 

Zeilinger, S., Omann, M. (2007): Trichoderma biocontrol: signal transduction pathways 

involved in host sensing and mycoparasitism. Gene Regul. Syst. Biol. 1: 227-234.

270 Potential of quinhydrone as a growth inhibator of phytopathogenic bacteria 

International Symposium: Current Trends in Plant Protection UDK: 632.934 

Proceedings 

POTENTIAL OF QUINHYDRONE AS A GROWTH INHIBITOR OF 

PHYTOPATHOGENIC BACTERIA 

TATJANA POPOVIĆ 1 , FILIS MORINA 2 , SVETLANA ŽIVKOVIĆ 1 , ŽARKO IVANOVIĆ 1 , SONJA 

VELJOVIĆ JOVANOVIĆ 2 

1 

Institute for Plant Protection and Environment, Belgrade, Republic of Serbia 

2 University of Belgrade, Institute for Multidisciplinary Research, Belgrade, Republic of Serbia 

The possibilities of using naturally occurring substances as bioactive agents are being 

constantly explored. Common protective chemicals against pathogens have several disadvantages, 

such as resistance and environmental pollution. We investigated the effect of quinhydrone (QH), a 

charge transfer complex discovered in plant cell wall, on the growth of three economically important 

plant pathogenic bacteria Erwinia amylovora (Ea), Pseudomonas syringae pv. syringae (Pss) and 

Xanthomonas campestris pv. campestris (Xcc). Range of concentrations from 0.01 mM to 5 mM QH 

was used. Concentration of 1 mM QH inhibited Xcc growth by 50% and Pss and Ea by 40% 

compared to controls. A possibility to use QH as an efficient antimicrobial agent is discussed in 

relation to adverse effects on plant development. 

Key words: quinhydrone, phytopathogenic bacteria, growth inhibition 

INTRODUCTION 

Phytopathogenic bacteria are responsible for great losses in economically important 

crops such as vegetables and fruits (Agrios, 1998). Although extensive research has been 

undertaken to overcome the damage caused by phytopathogenic bacteria, a major difficulty 

that was encountered was the lack of effective control against some severe diseases (Van 

der Zwet and Keil, 1979; Bradbury, 1986; Garret and Schwartz, 1998; Alvarez, 2000). 

Plant protection against pathogens is mainly based on copper derivatives and antibiotics 

(Schaad, 1988), but an accumulation of antiobiotics and Cu in the environment has adverse 

effects on human health (Loper et al., 1991; Sundin and Bender, 1993). Therefore, research 

on possible use of naturally occurring substances for pathogen control and for plant growth 

promotion is preferable with great importance in environmental protection. 

Quinhidrone (QH) is a charge transfer complex commonly used as a redox standard 

(FIGURE 1). It can be accumulated in the cell wall, as a complex of benzoquinone and 

hydroquinone; however, its physiological function and mechanism of generation have not 

been fully elucidated (Takahama, 2004; Kukavica et al., 2009). Recently, we showed that 

QH accumulates in response to excess Zn in phenolic rich plants such as Verbascum 

thapsus due to stabilization of phenoxyl radicals (Morina et al., 2010).

Tatjana Popović, Filis Morina, Svetlana Živković,... 271 

Figure 1. QH charge transfer complex between benzoquinone and hydroquinone 

In the present study we report the activity of QH as a growth inhibitor of three 

economically important phytopathogenic bacteria, Erwinia amylovora (Burrill) Winslow et 

al. (Ea), Pseudomonas syringae pv. syringae van Hall (Pss) and Xanthomonas campestris 

pv. campestris (Pammel) Dowson (Xcc). 


Test strains used in experiment were: Ea from Institute for Plant Protection and 

Environment, Serbia (TEad1), Pss from La Collection Française de Bactéries 

Phytopathogènes, France (CFBP 1582) and Xcc was from National Collection of Plant 

Pathogenic Bacteria, United Kingdom (NCPPB 1144). Strains was cultured on Nutrient 

Agar (NA) for 48 h at 28°C. 

Agar diffusion technique was used for determination of growth inhibition. A 100 µL 

of bacteria suspensions (3 x 10 6 cells/mL) were mixed in 100 mL Nutrient Agar (NA) and 

poured in sterilized Petri plates (90 mm in diameter). After solidification, 25 µL of different 

QH concentrations (0.01, 0.02, 0.03, 0.04, 0.1, 0.5, 1, 5 and 100 mM) were placed on filer 

paper disks on the agar surface and incubated three days at 28ºC. After incubation, the 

number of bacteria within the inhibition halos was measured according to McFarland 

standard units using a densitometer (Biosan, Latvia). 

RESULTS 

QH inhibited the growth of all three bacterial strains in a concentration dependant 

way (FIGURE 2). Concentration of 100 mM QH completely inhibited bacterial growth 

(data not shown), while 0.01 mM QH had no effect on growth in any of the bacterial 

strains. The most sensitive was Xcc strain, with 50% inhibition at 1 mM QH (Figure 1). At 

5 mM QH only about 20% of Xcc bacteria survived compared to controls. The number of 

Pss and Ea strains decreased to 60% of controls at 1 mM QH and to 36% at 5 mM QH 

treatment.

272 Potential of quinhydrone as a growth inhibator of phytopathogenic bacteria 

A 120 

100 

80 

B 120 

100 

80 

C 120 

100 

80 

Xcc (%) 

60 

40 

Ea (%) 

60 

40 

Pss (%) 

60 

40 

20 

20 

20 

0.0 0.5 1.0 2 3 4 5 

QH (mM) 

0.0 0.5 1.0 2 3 4 5 

QH (mM) 

0.0 0.5 1.0 2 3 4 5 

QH (mM) 

Figure 2. The number of A) Xanthomonas campestris pv. campestris, B) Erwinia amylovora 

and C) Pseudomonas syringae pv. syringae presented as % of controls after incubation with 

different QH concentrations for three days 

DISCUSSION 

Quinhydrone, an endogenous radical, found to be bound to the cell wall in several 

plant species (Morina and Mojovic, unpublished), has the ability to act both as prooxidant 

and antioxidant (Takahama, 2004), thus affecting redox processes in the plant cell wall. Its 

generation and accumulation in plants has been demonstrated in a few reports, investigating 

free radicals generation in the cell wall of Pisum sativum and effect of zinc on phenolics 

stabilization in the cell wall of V. thapsus (Kukavica et al., 2009; Morina et al., 2010). Here 

we showed that QH had antimicrobial properties and could significantly decrease the 

growth of phytopathogenic bacteria, such as Ea, Pss and Xcc (Figure 2). 

Rangaswami and Bagyaraj (2005) reported that the peach X-disease phytoplasma 

may be controlled by treating the infected trees with aqueous solution of QH, without 

affecting the host tissue. In our experiment, there is no negative effect on five weeks old 

cabbage plants (unchanged chlorophyll and flavonols concentrations) after the application 

of 5 mM QH by spraying the leaves (data not shown). Data are preliminary and extensive 

studies of the effects of QH on plants are planned for future work. 

In conclusion, we showed that QH in concentration range 0.5 mM and 5 mM can be 

effective against Ea, Pss and Xcc. Therefore, this complex might be considered as a 

potential compound for the development of antimicrobial agents for use in plant protection 

either as pesticide ingredient or as agent expressed in transgenic plants. 


The research is a part of the Project No. III43010 funded by Ministry of Education 

and Science, Republic of Serbia. 

REFERENCES 

Agrios, G.N. (1998): Plant pathology. 4th ed. Academic Press, San Diego, Calif. 

Alvarez, A.M. (2000): Black rot of crucifers. In: A.J. Slusarenko et al. (eds.), Mechanisms of 

Resistance to Plant Diseases. Kluwer Academic Publishers, Dordrecht, The Netherlands, 

pp. 21-52.

Tatjana Popović, Filis Morina, Svetlana Živković,... 273 

Bradbury, J.F. (1986): Guide to plant pathogenic bacteria. CAB International, Wallingford, UK. 

332 p. 

Garrett, K.A., Schwartz, H.F. (1998): Epiphytic Pseudomonas syringae on dry beans treated 

with copper-based bactericides. Plant Disease, 82(1): 30-35. 

Kukavica, B., Mojović, M., Vučinić, Z., Maksimović, V., Takahama, U., Veljović-Jovanović, S. 

(2009): Generation of hydroxyl radical in isolated pea root cell wall, and the role of cell 

wall-bound peroxidase, Mn-SOD and phenolics in their production. Plant Cell. Physiol., 

50: 304-317. 

Loper, J.E., Henkels, M.D., Roberts, R.G., Grove, G.G., Willet, M.J., Smith, T.J. (1991): 

Evaluation of streptomycin, oxytetracycline and copper resistance of Erwinia amylovora 

isolated from pear orchards in Washington state. Plant Dis., 75: 287-290. 

Morina, F., Jovanović, Lj., Mojović, M., Vidović, M., Panković, D., Veljović-Jovanović, S. 

(2010): Zinc-induced oxidative stress in Verbascum thapsus is caused by an 

accumulation of reactive oxygen species and quinhydrone in the cell wall. Physiol 

Plantarum, 140: 209-224. 

Rangaswami, G., D. J., Bagyaraj, D.G. (2005): Agricultural Microbiology. 2nd ed. Prentice, 

Hall of India, New Delhi. 

Schaad, N.W. (1988): Laboratory Guide for Identification of Plant Pathogenic Bacteria. 2nd ed. 

American Phytopathological Society, St. Paul, Minnesota. 198 p. 

Sundin, G.W., Bender, C.L. (1993): Ecological and genetic analysis of copper and streptomycin 

resistance in Pseudomonas syringae pv. syringae. Appl. Environ. Microbiol., 59: 1018- 

1024. 

Takahama, U. (2004): Oxidation of vacuolar and apoplastic phenolic substrates by peroxidase: 

physiological significance of the oxidation reactions. Phytochem. Rev., 3: 207-219. 

Van der Zwet, T., Keil, H.L. (1979): Fireblight: a bacterial disease of rosaceous plants. USDA 

Agriculture Handbook No. 510.

274 Prevalence of pathogenic groups of Leptosphaeria maculans in Serbia 


Proceedings 

PREVALENCE OF PATHOGENIC GROUPS OF LEPTOSPHAERIA 

MACULANS IN SERBIA 

1 PETAR MITROVIĆ, 1 ŽELJKO MILOVAC, 1 MILAN JOCKOVIĆ , 1 VELIMIR RADIĆ, 

1 ANA MARJANOVIĆ–JEROMELA, 1 NADA LEČIĆ, 1 RADOVAN MARINKOVIĆ 

1 Institute of Field and Vegetable Crops, Novi Sad, 

Among numerous pathogenic fungi on oil rapeseed (Brassica napus L.), Leptosphaeria 

maculans belongs to the most important disease agent in many countries (Canada, Australia, 

Germany, France, Great Britain), where this plant species is intensively grown. In Serbia, wery little 

is known about this pathogenic species and even less about the current distribution of pathogenic 

groups (PG S ) of L. maculans. Based on literature and experimental data isolates are classified in 4 

PG s (PG1 known as Leptosphaeria biglobosa and PG2, PG3, PG4 known as L. maculans). A total of 

119 isolates were tested originating from Serbia on differential varieties of oil rapeseed (Westar, 

Quinta and Glacier). All 4 PGS have been observed in the population collected during 2009 and 2010. 

Key words: oil rapeseed, Leptosphaeria maculans, Leptosphaeria biglobosa, pathogenicity 

group, prevalence. 

INTRODUCTION 

Leptosphaeria maculans (Desm.) Ces and De Not (anamorph: Phoma lingam (Tode 

ex Fr.) Desm.) cause dry (black leg) on oil rapeseed worldwide. Desease is economically 

very important in Europe, Australia and Canada (West et al., 2001). The appearance of the 

disease to a greater or lesser intensity depends on climatic factors, cultural practices and 

varieties resistance (Howlett, 2004; Aubertot et al., 2006; Sosnowski et al., 2004). 

However, it is already observed that in the species of L. maculans differences exist in 

morphological, physiological and virulence characteristics (Mcgee and Petrie, 1978¸ Petrie, 

1988). Based on DNA restriction pattern, Johnson and Lewis (1990) classified the isolates 

into two distinct groups, labeled A and B. Brun et al. (1997) and Williams and Fitt (1999) 

indicated that group A is highly virulent, while group B is slightly virulent. Koch et al. 

(1991), Mengistu et al. (1991) & Kutcher et al. (1993) have studied the virulence of 

different isolates of L. maculans on three varieties of oil rapeseed (Westar, Quinta and 

Glacier) and classified them into four pathogenic groups (PG S ): PG2, PG3, PG4, while 

slightly virulent isolates were classified into PG1. Kuusk et al. (2002) stated that PG2, PG3 

and PG4 can be classified into group A, while PG1 into group B. Group B was then 

isolated and identified as a new species called L. biglobosa (Shoemaker and Brun, 2001). 

Recently, the new pathogenic group has been found in North America and Canada, marked 

with PGT (Chen and Fernando, 2006). This group differs from PG3 and PG4 based on the

Petar Mitrović, Željko Milovac, Milan Jocković,... 275 

average number of virulence on varieties Glacier on a scale from 0 to 9 (Wiliams, 1975, cit. 

Chen and Fernando, 2006). 

The aim of this study was to determine the presence of pathogenic groups in Serbia using 

the differential varieties (Westar, Quinta and Glacier). 


Isolation of fungi and obtaining mono-spore culture 

Infected plants of oil rapeseed were collected during 2009 and 2010. in the region 

Vojvodina, Serbia. The diseased plant parts (roots, ground tree, upper stem, leaf, flower, 

shell, seeds) with well-developed clinical disease, were used for isolation of fungi. 

Fragments of diseased tissues were immersed in 3% solution of sodium-hypochlorite for 5- 

10 minutes and then were washed with sterile water and dried naturally under controlled 

conditions. After drying, the fragments of diseased tissue were applied to the culture 

medium of potato dextrose agar (PDA) (Difco, Detroit, USA) which had previously been 

poured in Petri dishes. To prevent bacterial growth medium was supplemented with 50 mg/l 

of streptomycin sulfate (Galenika, Belgrade, Serbia). Petri dishes sown with this substrate 

were placed in a thermostat at a temperature of 25°C ± 1°C. After 5-10 days the 

development of spore bearing organs was observed under binocular microscope. Pure 

cultures were obtained as follows: pycnospores that were released from pycnidia, 

originating from the culture media, were transferred using spear needle tip into plastic tubes 

in which had previously been added 2 ml of sterile water. Prepared conidial suspension was 

poured on the surface of the water-agar, which had previously been poured in Petri dishes. 

After 48 h conidia germination was observed under the binocular microscope. Germinated 

conidia, together with the fragment of the substrate were transferred to PDA medium and 

placed in a thermostat at 25°C in order to obtain mono-spore isolates. Using this method 

119 isolates were obtained. 

Determination of pathogenic groups 

The distribution of pathogenic groups (PG1, PG2, PG3, PG4) in Serbia has been 

examined by the method of Koch et al. (1991), Mengistu et al. (1991) and Chen and 

Fernando (2006). Seeds were disinfected by dipping in 3% solution of sodium-hipohlorite 

(NaOCl) for 3 to 5 min. and then washed with tap water and dried at room temperature 

under controlled conditions. The success of disinfection was tested on PDA nutrient 

medium. Disinfected seeds of varieties Westar, Quinta and Glacier were applied in two 

Petri dishes, and not disinfected seeds of listed varieties were used as controls. . In each box 

was placed 5 seeds. Thus prepared Petri dishes were placed in a thermostat at 25 0 C ± 1 0 C in 

the dark. After 15 days was carried out visual and microscopic examination of the seeds 

and substrate, after which the seeds were placed in a germination chamber. Germinated 

seeds were sown in plastic containers with a diameter of cells 4 x 5 cm, which were 

previously filled with sterile substrate. Each cell was seeded by one germinated seed. After 

germination (6-7 days), when the cotyledons separated, inoculation was performed as 

follows: sterile needle was used to injure one cotyledon, while the other cotyledon was not 

injured. Injured part was inflicted by micropipette with 5 µl (10 6 ) suspension of 

pycnospores. After inoculation, plants were transferred to controlled conditions at a 

temperature of 20ºC, 95% RH and 12h photoperiod. After 48 h the plants were placed in


greenhouse conditions. During follow-up of symptoms true leaves were removed several 

times. After 12 to 13 days the trial was assessed by a scale Koch et al. (1991): 0 – without 

the appearance of leaf spot and necrosis around the injured part; 1 – limited browning of 

tissue around the injury, lesion diameter 0.5 to 1.5 mm; 3 – dark necrotic spots with a 

diameter of 1.5 to 3.0 mm; 5 – dark brownish spots on back side of leaf, 3-6 mm in 

diameter; 6 – as in estimating the value of the scale of 5, but less necrotic areas on the leaf 

face; 7 – gray-green spots of limited size or large necrotic spots; 8 – the great gray-green 

spots with or without pycnidia; 9 – the great gray-green spots with abundant sporulation. In 

these studies was used all isolated isolates, and each isolate was tested on all varieties of oil 

rapeseed in 6 replicates. 

Pycnospores suspension was obtained as follows: each isolate was applied to the 

PDA nutrient medium in three replicates. After 10-15 days, based on binocular viewing in 

Petri dishes was added 10 ml of sterile distilled water (Bonman et al., 1981). Sterile glass 

rod was gently withdrawn over the surface of pycnidia and mycelium, to lead to the release 

of pycnospores. Released pycnospores were drained through a 10 micron sieve into a sterile 

plastic tube. Using hemocytometer pycnospores concentration was set to 10 6 , and after that 

in each tube was added 10 µl macerated sap of oil rapeseed. The prepared suspension was 

kept under controlled conditions at a temperature of 20 ° C ± 1 ° C and 12 h photoperiod. 

After period of 56 h germinated conidia on the basis of microscopic examination were used 

for inoculation. 


From a total of 119 isolates isolated in 2009 and 2010 in Vojvodina, Serbia, on the 

basis of pathogenic test on the differential varieties (Westar, Quinta and Glacier), eight 

isolates belong to PG1, five isolates belong to PG2, 22 isolates belong to PG3 and 84 

isolates belong to PG4. Different pathogenicity of isolates of L. maculans and L. biglobosa 

on the differential varieties of oil rapeseed makes distinction between less virulent (nonaggressive) 

and virulent (aggressive) isolates, and further division of virulent isolates into 

three groups of pathogens (table. 1). The appearance of symptoms of different pathogenic 

groups are shown on Figure 1. PG1 isolates (pathogenic group L. biglobosa) cause small 

necrotic spots around the injured part of cotyledon in all differential varieties. PG2 isolates 

cause large necrotic spots on the variety Westar in which fungal mycelium has expressed 

sporulation, while on Quinta variety produce different spots in which mycelium does not 

sporulate. Spots on Glacier variety are similar in size caused by weak virulent isolates, but 

showing less necrosis around the inoculated part. PG3 isolates have increased sporulation 

on varieties Westar and Glacier, and on Quinta variety cause brown spots without 

sporulation. PG4 isolates cause large necrotic spots on all varieties and sporulate 

abundantly. 

Table. Pathogenicity of isolates PG2, PG3, PG4 (L. maculans) and PG1 (L. biglobosa) on the 

differential varieties 

Isolate Origin Westar Quinta Glacier PG 

l. b. Great Britain 1,0 1,3 1,0 PG1 

K – 111 Vojvodina 1,8 1,5 1,0 PG1 

K – 112 Vojvodina 1,2 1,0 1,0 PG1 

K – 113 Vojvodina 2,5 1,6 1,9 PG1


K – 114 Vojvodina 2,1 1,3 1,6 PG1 

K – 115 Vojvodina 1,8 1,5 1,3 PG1 

K – 116 Vojvodina 1,9 1,5 1,4 PG1 

K – 117 Vojvodina 2,2 2,0 0,9 PG1 

K – 118 Vojvodina 1,7 1,0 0,8 PG1 

K – 21 Vojvodina 7,0 4,9 2,3 PG2 

S – 5 Vojvodina 8,6 6,3 2,5 PG2 

S – 9 Vojvodina 7,6 5,0 2,3 PG2 

L – 4 Vojvodina 8,3 5,6 2,8 PG2 

L – 8 Vojvodina 8,0 7,5 2,6 PG2 

l. m. Great Britain 9,0 5,9 8,5 PG3 

K – 5 Vojvodina 8,8 5,8 8,3 PG3 

K – 6 Vojvodina 8,1 5,3 8,5 PG3 

L – 1 Vojvodina 8,3 5,5 7,8 PG3 

L – 2 Vojvodina 8,5 5,1 7,6 PG3 

L – 3 Vojvodina 8,5 4,6 7,0 PG3 

L – 5 Vojvodina 8,8 4,3 7,8 PG3 

Lj – 2 Vojvodina 7.6 6,0 7,0 PG3 

Lj – 3 Vojvodina 8,0 5,8 7,5 PG3 

St – 23 Vojvodina 8,3 5,5 8,0 PG3 





Gs – 4 Vojvodina 8,3 6,1 8,0 PG3 




K – 9 Vojvodina 9,0 3,6 9,0 PG3 

K – 11 Vojvodina 9,0 5,6 8,6 PG3 

K – 13 Vojvodina 9,0 3,8 7,5 PG3 

K – 15 Vojvodina 9,0 4,6 8,0 PG3 


St – 2 Vojvodina 9.0 8.6 8.3 PG4 

St – 3 Vojvodina 9.0 8.5 7,6 PG4 

St – 4 Vojvodina 8.0 8,6 8,6 PG4 










St – 14 Vojvodina 9,0 7,5 9,0 PG4











K – 1 Vojvodina 8,6 8,6 7,8 PG4 

K – 2 Vojvodina 8,5 7,8 8,6 PG4 

K – 3 Vojvodina 8,6 8,0 8,0 PG4 

K – 4 Vojvodina 8,6 7,6 8,3 PG4 

K – 7 Vojvodina 8,6 8,8 8,5 PG4 

K – 8 Vojvodina 9,0 8,1 9,0 PG4 

K – 10 Vojvodina 9,0 8,6 8,1 PG4 

K – 12 Vojvodina 9,0 8,5 7,5 PG4 

K – 14 Vojvodina 9,0 9,0 7,8 PG4 

K – 16 Vojvodina 9,0 8,3 8,5 PG4 

K – 17 Vojvodina 8,6 7,8 7,5 PG4 

K – 18 Vojvodina 9,0 7,8 8,5 PG4 

K – 19 Vojvodina 9,0 8,8 8,1 PG4 

K – 20 Vojvodina 9,0 8,6 8,1 PG4 

K – 22 Vojvodina 9,0 8,6 9,0 PG4 

K – 23 Vojvodina 9,0 8,8 8,5 PG4 

K – 24 Vojvodina 9,0 8,0 8,3 PG4 

K – 25 Vojvodina 9,0 8,5 8,8 PG4 

C – 1 Vojvodina 8,6 7,5 8,3 PG4 

C – 2 Vojvodina 8,6 8,8 8,1 PG4 

C – 3 Vojvodina 8,3 7,9 7,5 PG4 

C – 4 Vojvodina 8,6 8,6 8,1 PG4 

C – 5 Vojvodina 8,6 8,6 8,0 PG4 

C – 6 Vojvodina 8,8 8,5 7,5 PG4 

L – 6 Vojvodina 8,8 7,8 8,0 PG4 

L – 7 Vojvodina 8,8 7,6 7,0 PG4 

L – 9 Vojvodina 8,6 8,5 8,3 PG4 

L – 10 Vojvodina 9,0 8,0 8,8 PG4 





S – 1 Vojvodina 8,6 8,5 7,3 PG4 

S – 2 Vojvodina 8,1 7,6 7,0 PG4 

S – 3 Vojvodina 8,5 8,1 7,5 PG4 

S – 4 Vojvodina 8,8 8,6 8,5 PG4 

S – 6 Vojvodina 8,5 8,8 8,3 PG4


S – 7 Vojvodina 8,8 8,1 8,1 PG4 

S – 8 Vojvodina 8,8 8,6 8,5 PG4 

S – 10 Vojvodina 8,6 8,2 8,5 PG4 

S – 11 Vojvodina 9,0 8,5 7,6 PG4 






















Figure. 1: Symptoms caused by different pathogenic groups of L. maculans on cotyledons of 

three Brassica napus cultivars


This study clarified that all pathogenic groups of L. maculans are present in the 

rapeseed producing regions of Serbia (Vojvodina). Similar results of presence of PGs 

(pathogenic groups) in other countries were stated by Mengista et al. (1991), Kuusk et al. 

(2002), and Chen and Fernando (2006). Pathogenic groups within the population of group 

A are not equally represented in all growing regions of oil seed rape. In Ontario (Canada) 

Mahuku et al. (1997) found that PG4 was represented by 80%, PG3 with 11% and 

assuming that the remaining 9% belongs to a new group marked with PG5. Unlike Mahuku 

et al. (1997), isolates from Western Canada mostly belong to PG2 (Mengistu et al. 1991). In 

France, over 90% of tested isolates belong to PG3, the remaining were mainly PG4 and a 

small number of PG2 isolates (Ansan - Melayu et al., 1997, Penaud et al., 1999a). The 

research carried out by Chen and Fernando (2006) in North Dakota (USA) and Manitoba 

(Western Canada) found that 76.6% of isolates belonged to PG2 and 21.3% to PG1, while 

the remaining isolates belonged to PG3, PG4 and PGT. On the basis of the symptoms on 

the cotyledons of differential varieties and scale by Koch et al. (1991) PGT was not found 

in our research which is consistent with statements of Chen and Fernando (2006) that new 

PG is discovered, for now in the U.S. and Canada. In Sweden PG3 and PG4 were dominant, 

while PG2 was not observed and PG 1 was present in very low percentage (Kuusk et al., 

2002). The same authors stated that there is no correlation between pathogenic groups and 

sites of infection and that PG1 is mainly observed at the top of the tree, while in Serbia PG1 

is isolated from the crown root (Kuusk et al., 2002). In Australia, PG3 and PG4 ratio is 

equal, but PG2 is present in very low percentage, while PG1 is not detected Mengistu et al. 

(1991). Based on the analysis of the percentage of PG3 and PG4 in our country is very 

similar with the results of Mahuku et al. (1997), in Canada. Considering that all four groups 

were detected in Serbia (also confirmed by PCR analysis, – data not shown], our data about 

the presence of PG are very similar with statements Chen and Fernando (2006). Research 

on the presence of pathogenic groups can provide reliable information about the dynamics 

and pathogenicity of L. maculans in the producing region. 

CONCLUSION 

Based on the obtained results we can conclude that in Serbia four groups of L. 

maculans are present (PG1, PG2, PG3 and PG4), except for PGT. The PG4 group has the 

highest percentage of prevalence (70.5%), followed by PG3 (18.4%), PG1 (6.7%) and PG2 

(4.2%). The high percentage of PG3 and PG4 groups points to the conclusion that in Serbia 

highly pathogenic groups are present. 

REFERENCES 

Ansan-Melayah, D., T. Rouxel, J. Bertrandy, B. Letarnec, E. Mendes-Pereira, M.-H. Balesdent 

(1997): Field efficiency of Brassica napus specific resistance correlates with 

Leptosphaeria maculans population structure. Eur. J. Plant Pathol. 103, 835–841. 

Aubertot, J. N., West, J. S., Bousset-Vaslin, L., Salam, M. U., Barbetti, M. J and A. J., Diggle, 

2006. Improved resistance management for durable disease control: a cas study of 

Phoma stem canker of oilseed rape (Brassica napus). Eur. J. Plant Pathol. 114: 91-106. 

Bonman, J. M., Gabrielson, R. L., Williams, P. H., Delwiche, P. A., 1981. Virulence of Phoma 

lingam to cabbage. Plant Disease, 65: 865 – 867.


Brun, H., S. Levivier, F. Eber, M. Renard, A. M. Chevre, 1997. Electrophoretic analysis of 

natural populations of Leptospheria maculans directly from leaf lesions. Plant Pathology 

46, 147-154. 

Chen, Yu and W. G. D., Fernando, 2006. Prevalence of pathogenicity groups of Leptosphaeria 

maculans in western Canada and North Dakota, USA. Can. J. Plant Pathol. 28: 533-539. 

Howlett, B. J., 2004. Current knowledge of the interactio between Brassica napus and 

Leptosphaeria maculans. Can. J. Plant Pathol. 26: 245 – 252. 

Johnson, R. D, Lewis, B. G. 1990. DNA polymorphism in Leptosphaeria maculans. 

Physiological and Molecular Plant Pathology 37:417-424. 

Koch, E., R. Song, C. T. Osborn, P. H. Williams, 1991. Relationship between pathogenicity and 

phylogeny based on restriction fragment lenght polimorphism in Leptospheria maculans. 

Molecular Plant-Microbe Interactions 4, 341-349. 

Kutcher, H. R., Vandenberg, C. G. J., S. R. Rimmer, 1993. Variation in pathogenicity of 

Leptospheria maculans and Brassica spp. Based on cotyledon and stem reactions. Can. J. 

Plant Pathol. 15: 253-258. 

Kuusk, A. K., Happstadius, I., Zhou, L., Steventon, L. A., Giese, H. and C. Dixelius, 2002. 

Presence of Leptosphaeria maculans Group A and Group B Isolates in Sweden. J. 

Phytopathology 150, 349–356. 

Mahuku GS, Goodwin PH, Hall R, Hsiang T, 1997. Variability in the highly virulent type of 

Leptosphaeria maculans within and between oilseed rape fields. Canadian Journal of 

Botany 75, 1485 -1492. 

McGee, D. C. and G. A., Petrie, 1978. Variability of Leptospheria maculans in relation to 

blackleg of oilseed rape. Phytopathology, 68: 625 – 630. 

Mengistu, A., S. R. Rimmer, P. H. Williams, 1991. Pathogenicity grouping of isolates of 

Leptospheria maculans on Brassica napus cultivars and their disease relation profiles on 

rapid-cycling brassicas. Plant Disease 75: 1279-1282. 

Penaud A, Jain L, Poisson B, Balesdent M-H, PeÂreÁs A, 1999a. Structure of populations of 

Leptosphaeria maculans in France. Proceedings of the 10th International Rapeseed 

Congress, 1999. Canberra, Australia. http://www.regional.org.au/papers/index.htm 

Petrie, G. A., 1988, The rapid differentiation of virulent and weakly virulent strains of 

Leptosphaeria maculans (blackleg or stem canker) and related pycnidial fungi from 

Brassica seeds and stems. Can. J. Plant Pathol. 10: 188-190. 

Shoemaker, R. A., H. Brun, 2001. The teleomorph of the weakly aggressive segregate of 

Leptospheria maculans. Canadian Journal of Botany 79, 412-419. 

Sosnowski, M. R., Scott, E. S. and M. D., Ramsey, 2004. Infection of Australian canola 

cultivars (Brassica napus) by Leptospheria maculans is influenced by cultivar and 

environmental conditions. Australas. Plant Pathol. 33: 401-411. 

West, S. J., D. P. Kharbanda, J. M. Barbeti, Fitt, L. D. B. 2001. Epidemiology and management 

of Leptosphaeria maculans (phoma stem canker) on oilseed rape in Autralia, Canada and 

Europe. Plant Pathology 50, 10-27. 

Williams, H. R, Fitt, L. D. B. 1999. Differentiating A and B groups of Leptospheria maculans 

casual agent of stem canker (blackleg) of oilseed rape. Plant Pathology 48, 161-175.

282 Pathogenicity of Fusarium spp and Aspergillus flavus on maize ear 


Proceedings 

PATHOGENICITY OF FUSARIUM SPP. AND ASPERGILLUS 

FLAVUS ON MAIZE EAR 

FERENC BAGI 1 , VERA STOJŠIN 1 , DRAGANA BUDAKOV 1 , ÁKOS MESTERHAZY 2 , JÁNOS 

VARGA 3 , JOVANA VUČKOVIĆ 4 , BEÁTA TÓTH 2 

1 Department for Environmental and Plant Protection, Faculty of Agriculture, University of Novi 

Sad, Trg Dositeja Obradovića 8, 21000 Novi Sad, Serbia 

2 Cereal Research Nonprofit Ltd., 6726 Szeged, Alsó kikötő sor 9. Hungary 

3 

University of Szeged, Faculty of Science and Informatics, Department of Microbiology, 6726 

Szeged, Közép fasor 52, Hungary 

4 Institute of Food Technology, Bulevar cara Lazara 1, 21 000 Novi Sad, Serbia 

Sensitivity of seven maize hybrids to ear rot, caused by Fusarium graminearum, F. 

culmorum, F. verticillioides and Aspergillus flavus, was evaluated during 2010 and 2011 in field trials 

with artificial inoculations using colonized toothpick method. Significant differences in expression of 

symptoms were observed. The lowest susceptibility to F. graminearum and F. culmorum had hybrids: 

Sz349, Sarolta and Kenez and to F. verticillioides and A. flavus Kenez, Sz451 and Sarolta. 

Key words: maize, ear rot, Fusarium spp., Aspergillus flavus, pathogenicity 

INTRODUCTION 

Maize is one of the most important ingredients of feed formulations worldwide. 

Several fungal pathogens that infect maize in the field may also produce mycotoxins, 

secondary metabolites which are harmful to animal and human health (Lević et al., 2004). 

Therefore, mycotoxin contamination of maize grain is a worldwide threat to both safety of 

human food and animal feed. The most harmful mycotoxins in maize are aflatoxins 

produced by Aspergillus spp. and trichothecenes produced by several Fusarium species and 

they may cause various diseases in animals. Fusarium toxins are considered the most 

important in maize in areas with temperate climate (Logrieco and Mul, 2002). On the other 

hand, in countries with moderate climate, aflatoxin contamination of maize is estimated as a 

minor problem, although recent surveys show that aflatoxins in maize samples from 

Northern Italy and Romania occurred in concentrations exceeding the EU limit (Giorni et 

al. 2007, Tabuc et al., 2009). Further, ochratoxin A has also been frequently identified in 

maize samples in several European countries including Hungary and Croatia (Borbely et 

al., 2010, Halt et al., 2004). Given the importance of maize kernel mycotoxin 

contamination, it is necessary to regularly evaluate maize ear infection level. Since 

differences in resistance level among maize hybrids (Mesterhazy et al., 2000; Silva et al., 

2007) greatly influence the infection level and mycotoxin content, the aim of this research 

was to evaluate sensitivity of seven maize hybrids to ear rot caused by Fusarium

Ferenc Bagi, Vera Stojšin, Dragana Budakov,... 283 

graminearum, F. culmorum, F. verticillioides and Aspergillus flavus in field trials with 

artificial inoculation. 


Plant material 

Seven hybrids that were used in this research were provided by Cereal Research 

Nonprofit Ltd., Szeged, Hungary: Kenez, Sarolta, SZ386, SZ349, Csanad, SZ475 and 

SZ451. Trial was set up in Kupusina (Apatin County, Serbia) during 2010 and 2011. 

Planting was performed in optimally prepared chernozem on April 29 th 2010 and April 23 rd 

2011. Standard cultivation for maize production was applied during vegetative season. Each 

hybrid-fungi combination counted 10 plants that were repeated 4 times. 

Fungal material 

Fungal isolates for artificial inoculations were obtained from Cereal Research 

Nonprofit Ltd. and used as standard isolates for evaluation of maize hybrid sensitivity level 

(Mesterhazy, pers. comm.). Isolates were the following: 12377 = F. graminearum; 12375 = 

F. culmorum; 18 = F. verticillioides; 172 = A. flavus. 

Artificial inoculation 

For artificial inoculations toothpick method was used (Reid et al., 1996). Toothpicks 

were boiled in tap water three times, dried and soaked in Czapek Dox Broth prior to 

autoclaving. After cooling down they were inoculated with fungal isolates and incubated at 

25°C until fungi completely colonized the substrate. Inoculation was performed 10-12 days 

after 50% of plants reached silking phase using awl to make a hole in the middle part of the 

central ear and subsequently place a toothpick with inoculum. Depending on moment of 

silking period of each hybrid, inoculations were performed from July 26 th to August 4 th 

2010 and from July 27 th to August 1 st 2011. 

Visual evaluation of disease intensity 

Visual rating was performed on October 4 th 2010 and October 11 th 2011 based on a 

scale for ear rot intensity after artificial inoculation according to Reid et al. (1996), which 

ranges from 1 (complete absence of symptoms) to 7 (76-100% infected kernels). After 

disease evaluation, an average values were calculated for each variant and replication. 

Statistical analysis 

Statistical analysis was performed by factorial analysis of variance (ANOVA) using 

Statistica 8 software (StatSoft, Tulsa, OK, USA). Comparisons between means were made 

with Duncan’s Multiple Range Test at significance level of 5%. 

RESULTS 

Visual evaluation of disease intensity 

Two factorial ANOVA showed that both factors (year and hybrid) affected ear rot 

intensity caused by Fusarium species and A. flavus (Figure 1-4). Average disease intensity 

during both years and all tested hybrids showed that F. culmorum (2.55) and F. 

graminearum (2.52) had the highest pathogenicity while F. verticillioides (1.90) and A. 

flavus (1.81) expressed lower pathogenicity. Fusarium species were more pathogenic to


tested hybrids during 2010, while in 2011 the most pathogenic was Aspergillus flavus. 

Given the reaction of tested hybrids, higher resistance to F. graminearum and F. culmorum 

exhibited hybrids Sz349, Sarolta and Kenez, to F. verticillioides Sz451, Sarolta and Kenez, 

and to A. flavus Kenez, Sz451 and Sarolta (hybrids in ascending order according to disease 

intensity). 

Figure 1. Intensity of maize ear rot caused by F. graminearum during 2010 and 2011. 

Figure 2. Intensity of maize ear rot caused by F. culmorum during 2010 and 2011. 

Figure 3. Intensity of maize ear rot caused by F. verticilioides during 2010 and 2011.

Ferenc Bagi, Vera Stojšin, Dragana Budakov,... 285 

Figure 4. Intensity of maize ear rot caused by A. flavus during 2010 and 2011. 

DISCUSSION 

Natural infestations of maize ear occur through silk and wounds made by insects, 

birds and hail. Artificial inoculation methods were developed according to natural model 

and the most frequently used are methods with placing a colonized toothpick into the maize 

ear, injection of conidial suspension into the ear tips, as well as inoculation with inserting 

oat kernel or toothpicks into the silk channel (Sutton and Baliko, 1981). Inoculation into the 

silk channel is less aggressive then other methods, however it is limited by environmental 

factors which greatly affect its success. Colonized toothpick method ensures successful 

inoculation, however, this method is limited only to maize susceptibility to infections 

through wounds disregarding susceptibility to pathogen penetration through silk. 

Among Fusarium species, the most significant causers of maize ear rot are F. 

graminearum and F. verticillioides, although additional other 10 species were also isolated 

from maize. F. graminearum and F. culmorum are the most aggressive causers, whereas F. 

verticillioides is less pathogenic but very significant mycotoxin producer (Mesterhazy et al., 

2012). Due to intensive mycotoxin production, Aspergillus species are also of increasing 

importance on European continent (Giorni et al. 2007). 

Most of maize hybrids which are grown today are more or less susceptible to ear rot 

(Mesterhazy et al., 2012). Additional challenge to breeders is absence of correlation in 

maize susceptibility between penetration through silk channel and infection through 

wounds, as well as the fact that visual disease intensity ratings may not correspond to the 

amount of accumulated mycotoxins in maize ear (Mesterhazy et al., 2012). Results of other 

authors identify different inheritance patterns: additive, non-additive effects, digenic 

(dominant) and polygenic which is difficult to identify. Additionally, complexity of the 

problem increases since intraspecific isolates may vary in their pathogenicity. Therefore, it 

is recommended to continually use the same Fusarium isolate for artificial inoculations. 

Results of this research indicate existence of significant differences in maize hybrids 

susceptibility to ear rot causing fungi. Among tested hybrids, the least susceptible were 

Sarolta and Kenez. In order to confirm obtained results and to determine resistance 

mechanism, it is necessary to compare these with data collected from several years of 

inoculations thorough silk channel. Similarly, it would be essential to compare mycotoxin 

content in samples from both trials.



Presented results were obtained within framework of projects: New products of 

organic cereals and pseudocereals (III46005, Ministry of education and science, Republic 

of Serbia) and Improvement of safety of corn-based feedstuffs through using more resistant 

hybrids and management of corn processing (ToxFreeFeed, HUSRB/1002/1.2.2/062, 

Hungary-Serbia IPA Cross-border Co-operation Programme). 

REFERENCES 

Borbély, M., Sipos, P., Pelles, F., Győri, Z. (2010): Mycotoxin contamination in cereals. J. 

Agronom. Proc. Techn., 16: 96-98. 

Giorni, P., Magan, N., Pietri, A., Bertuzzi, T., Battilani, P. (2007): Studies on Aspergillus 

section Flavi isolated from maize in northern Italy. Int. J. Food Microbiol., 113: 330-338. 

Halt, M., Klapec, T., Slibaric, D., Macura, M., Bacani, S. (2004): Fungal contamination of 

cookies and the raw materials for their production in Croatia. Czech J. Food Sci., 22: 95- 

98. 

Lević, J., Stanković, S., Bočarov - Stančić, A., Škrinjar, M., Mašić, Z. (2004): The overview on 

toxigenic fungi and mycotoxins in Serbia and Montenegro. A. Logrieco, A. Visconti 

(eds), An Overview on toxigenic fungi and mycotoxins in Europe, Kluwer Academic 

Publishers, Dordrecht, Boston, London, pp. 201—218. 

Logrieco, A. Mul, G. (2002): Toxigenic Fusarium species and mycotoxins associated with maize 

ear rot in Europe. European Journal of Plant Pathology, 108 (7): 597-609. 

Mesterhazy, A., Kovacs, G. Jr, Kovacs, K. (2000): Breeding for resistance to Fusarium ear rot 

(FER) in maize. Genetika, 32 (3): 495-505. 

Mesterhazy, A., Lemmens, M., Reid, L.M. (2012): Breeding for resistance to ear rots caused by 

Fusarium spp. in maize- a review. Plant breeding, 131: 1-9. 

Reid, L. M., Hamilton, R. I. Mather, D. E. (1996): Screening Maize for Resistance to Gibberella 

Ear Rot. Agriculture and Agri-Food Canada, Research Branch, pp. 1-25. 

Silva, E., Mora, E. A., Medina, A., Vasquez, J., Valdez, D., Danial, D. L., Parlevliet, J. E. 

(2007): Fusarium ear rot and how to screen for resistance in open pollinated maize in the 

Andean regions. Euphytica, 153: 329–337. 

Sutton, J.C., Baliko, W. (1981): Methods for quantifying partial resistance to Gibberella zeae in 

maize ears. Canadian Journal of Plant Pathology, 3: 26-32. 

Tabuc, C., Marin, D., Guerre, P., Sesan, T., Bailly, J.D. (2009): Molds and mycotoxin content of 

cereals in southeastern Romania. J. Food Protect. 72, 662-665.

Trkulja Nenad, Milosavljević Anja, Ivanović Žarko,... 287 

International Symposium: Current Trends in Plant Protection UDK: 634.1/.2-248.214(497.11) 

Proceedings 

MORPHOLOGICAL AND GENETIC CHARACTERIZATION OF 

MONILINIA LAXA ISOLATES ORIGINATED FROM STONE 

FRUITS IN SERBIA 

TRKULJA NENAD, MILOSAVLJEVIĆ ANJA, IVANOVIĆ ŽARKO, POPOVIĆ TATJANA, ŽIVKOVIĆ 

SVETLANA, ORO VIOLETA, DOLOVAC NENAD 

Institute for plant protection and environment, Belgrade 

Monilinia laxa is one of the most important fruit pathogens worldwide which causes a brown 

rot disease of stone and pome fruits. Morphological and genetic diversity were studied, as well as a 

relationship between four isolates of M. laxa obtained from plum, cherry, peach and apricot from 

diferent orchards in Serbia. Isolates grown on the PDA and MEA medium have shown differences in 

the colony growth and morphological characteristics. Comparison of the internal transcribed spacer 

regions ITS1 and ITS2 obtained from the observed isolates revealed that an isolate BRIC from peach 

differs in a single nucleotide mutation from the other Serbian isolates associated with apricot, cherry 

and plum as well as from sequences of M. laxa available from the GeneBank. 

Key words: Monilinia laxa, brown rot disease, ITS1, ITS2 

INTRODUCTION 

Monilinia laxa (Aderhold & Ruhland) Honey is one of the three most important 

pathogens from the genus Monilinia which causes a drying of flowers and twigs and brown 

rot of pome and stone fruits. Other two Monilinia species are M. fructigena Honey and M. 

fructicola (Wint.) Honey causal agents of significant losses on stone and pome fruits, 

before and after the harvest (Ioos and Frey, 2000). M. fructigena is distributed mainly in 

Europe, while M. fructicola in North America. M. laxa is widespread in Europe and USA 

and has been considered an Old World species (van Leeuwen et al., 2002). In Serbia M. 

laxa regularly appears on stone fruits, i.e. plum (Prunus domestica L.), cherry (Prunus 

cerasus L.), peach (Prunus persica (L.) Batsch), apricot (Prunus armeniaca L.) but also 

appears on apple (Malus domestica Borkh.) and pear (Pyrus communis L.) causing severe 

yield losses (Trkulja et al. 2010). 

In order to determine morphological characteristics which may be linked with some 

pathogen traits such as pathogenicity, researchers cultured isolates of M. laxa on different 

nutrition media and kept them under specific conditions (De Cal and Melgarejo, 1999). 

Recently, molecular characterization towards the differentiation between Monilinia species 

(Ioos and Fray, 2000) and revealing a genetic diversity of the isolates originating from 

different geographic regions and host plants (Cote et al. 2004). The objective of this study 

was morphological and molecular characterization of the M. laxa isolates obtained from 

plum, cherry, peach and apricot from diferent locations in Serbia.

288 Morphological and genetic characterization of Monilinia laxa isolates... 


Collection of isolates and identification 

Symptomatic shoots affected with brown rot disease were collected in 2010 at 

localities Šabac, Smederevo, Topola, Grocka from orchards of plum, cherry, peach and 

apricot in order to obtain isolates of M. laxa (Table 1). Isolation of the pathogen was made 

by transferring piece of infected tissue to potato dextrose agar (PDA). To obtain 

monosporial isolates two weeks after conidia were transferred to water agar and incubated 

for 24h at 22°C. One germinated conidium’s transferred to fresh PDA and all isolates were 

grown in 9-cm-diameter plastic Petri dishes at 25°C in the dark for mycelia production. 

Identification was performed according to the culture and morphological characteristics (De 

Cal and Melgarejo, 1999). 

Morphological characterizations 

After 12 days of incubation on PDA and malt extract agar 2% (MEA), the following 

morphological characteristics were recorded for each isolate: colony growth (mm/day), 

colony color, colony rosette, rosettes with black arcs. To obtain uniform colonies for each 

isolate, plugs with actively growing mycelium were removed from the periphery of a 4- 

day-old colony grown on PDA. Plugs (5mm diameter) were placed in the center of plastic 

Petri dishes (90mm diameter) containing PDA and MEA media. They were incubated at 

25°C in the dark. Mycelial growth rates were determined on both PDA and MEA media. 

Growth rates of isolates were determined by measuring colony diameters (excluding the 

transfer plug of 5mm) every 2 days. Growth rates were expressed as a millimeter of growth 

per day and the mean of 3 replicate colonies were used to represent each isolate. 

PCR amplification and sequencing of internal transcribed spacer (ITS) regions 

The internal transcribed spacer 1 (ITS 1), 5.8S ribosomal RNA, internal transcribed 

spacer 2 (ITS 2) and 28S ribosomal RNA regions of the fungal rDNA were amplified using 

the primers ITS1 and ITS4 (White et al., 1990). Amplifications were performed in 20 µl 

reactions containing 1 µl of template DNA, 14.45 µl of H 2 O, 2 µl of High Yield Reaction 

Buffer A (with 1x1.5mM MgCl 2 ) , 0.8 µl of dNTPs (0.4mM), 0.8 µl of each primer (0.2 µM) 

and 0.15 µl of KAPATaq DNA polymerase (5U/µl) (Kapabiosystems). PCR protocol 

included initial denaturation at 94 o C for 3 min, 30 cycles consisted of 0.5 min at 94 o C, 0.5 

min at 55 o C, 1.30 min at 72 o C and a final extension at 72 o C for 10 min. Amplified products 

were analyzed by 1% agarose gel electrophoresis, stained with ethidium bromide and 

visualized under a UV transilluminator. All amplified products were purified using the 

QIAquick PCR purification kit (QIAGEN) according to the manufacturer’s instructions and 

sequenced using the automated equipment (Macrogen, Korea). Sequences were manually 

aligned in MEGA5 software by ClustalW program (Tamura et al., 2011). The DNA 

sequences of the ITS region of four analyzed isolates were aligned and compared to each 

other and with available sequences of the ITS region of M. laxa (Acc. No. EF153013.1, 

EF153014.1, EF153015.1, EF153016.1, EF153017.1) retrieved online from the National 

Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov).


Table 1. Monilinia laxa isolates host plants, locality and the year of collection and isolation 

Isolates Host Locality Year of isolations 

KJ3 apricot Šabac 2010 

SDV2 chery Smederevo 2010 

BRIC peach Topola 2010 

SD1 plum Grocka 2010 

RESULTS 

Isolates were identified as Monilinia laxa based on the developed cultures on PDA 

medium. Tested isolates had characteristic rosetted colonies with markedly lobed margins. 

At the bottom of the dishes some isolates showed a black arcs or rings. 

The growth measurement on the PDA medium showed substantial differences 

between M. laxa isolates. Growth diameter of the colonies ranged from 4.5 to 6.1 mm. The 

color of the colony was white for isolates KJ3, BRIC and SDI and green for isolate SDV2. 

Isolates also exhibited differences in expression of the colony rosette and black arcs (Table 

2). 

Table 2. Morphological characteristics of the isolates of M. laxa grown on PDA medium 

originating from different stone fruits 

PDA KJ3 SDV2 BRIC SD1 

Colony growth (mm/day) 6.1 4.5 5.2 6.1 

Colony colour White Green White White 

Colony rosetted M 1 H S H 

Rosettes with black arcs No Yes No Yes 

1 – Colony rosetted: S (slightly); M (moderately); H (highly) 

The growth of the isolates colonies on MEA medium ranged from 1.4mm for SDV2 

to 5.1mm for KJ3 isolate. Colony colour was white for all isolates. Growth diameter of the 

colonies of M. laxa isolates varied from 4.5 to 6.1 mm. Colony was rosetted highly in 

isolates KJ3, SDV2 and SD1 while slightly in the case of BRIC. Black arcs appear at the 

MEA for SDV2 and SD1, but is absent in KJ3 and BRIC isolates (Table 3). 

Table 3. Morphological characteristics of the isolates of M. laxa grown on MEA medium 

originating from different stone fruits 

MEA KJ3 SDV2 BRIC SD1 

Colony growth (mm/day) 5.1 1.4 2.5 3.7 

Colony colour White White White White 

Colony rosetted H H S H 

Rosettes with black arcs No Yes No Yes 

1 – Colony rosetted: S (slightly); M (moderately); H (highly) 

The ITS region was successfully amplified for all tested isolates in this study. 

Nucleotide sequences were obtained for ITS 1 partial sequence, 5.8S and ITS 2 complete 

sequence and 28S partial sequence of M. laxa tested isolates. Obtained DNA sequences of 

the ITS region for isolates KJ3, SDV2 and SD1 were identical among each other showing 

100% homology with a reference ITS sequences of M. laxa in NCBI base (Acc. No. 

EF153013.1, EF153014.1, EF153015.1, EF153016.1, EF153017.1). The ITS sequence for

290 Morphological and genetic characterization of Monilinia laxa isolates... 

isolate BRIC which was obtained from peach, has a single nucleotide mutation compared 

with other isolates observed in this study collected from apricot, cherry and plum, as well as 

the reference sequences from NCBI base listed above. 

DISCUSSION 

Monilinia laxa causes a brown rot is distributed worldwide in all areas where the 

stone and pome fruits are grown. Considering its wide distribution and ability to infect a 

wide range of plant species, morphological and genetic diversity could be excepted for 

isolates of M. laxa originating from different geographical regions and host plants. In our 

study we revealed differences in culture characteristics such as a colony growth and color. 

Isolate SDV2 has lower growth on both PDA and MEA nutrition media then other three 

isolates. De Cal and Melgarejo (1999) detected very significant differences in growth 

intensity among isolates of M. laxa originating from stone fruit as well as some differences 

in growth pattern within isolates indicating two groups with and without lobed margins, one 

of the characteristics defining this species. Given that the morphological and cultural 

characteristics vary among isolates that may affect on their ability to adapt to different host 

plants as well as the expression of pathogenicity (Munoz et al. 2008). 

Many researchers had been analyzing ribosomal sequences of Monilinia spp. and 

revealed a slight difference among them suggesting that these species share the common 

ancestor (Holst-Jensen et al. 1997; Fulton et al. 1999; Gell et al. 2007). Sequences of the 

Monilinia spp. showed a 100% similarity at the 5.8S rDNA, however some diversity was 

shown at the ITS1 and ITS2 region (Gell et al. 2007). Based on these differences between 

ITS1 and ITS2 sequences a species-specific PCR tool has been developed to distinguish 

three Monilinia species (Ioos and Frey, 2000). Analysis of the ITS sequences of M. laxa 

revealed almost no intraspecific polymorphism (Fulton et al., 1999; Ioos and Frey, 2000). 

Isolate BRIC has a single nucleotide change at ITS1 region indicating that this isolate may 

contain genetic difference at other genes which created some trait characteristics associated 

with geographic origin or host plant. Fulton et al. (1999) found a variation in M. laxa based 

on RAPD-PCR data, but this difference was not correlated to a geographic origin. They 

suggest that M. laxa is randomly distributed worldwide and appears to have readily adapted 

to its different hosts. Gril et al. (2008) for the first time used AFLP techniques in diversity 

analysis of M. laxa isolates from different hosts and deduced significant differences 

between isolates from apple trees and from other host plants. This finding clearly suggests 

the genetic specialization of M. laxa to different host plants. 


This study is funded by the project TR31018 of Ministry of Education and Science 

of the Republic of Serbia. 

REFERENCES 

Cote, M. J., Tardiff, M.C., Meldrum, A.J. (2004): Identification of Monilinia fructigena, M. 

fructicola, M. laxa, and Monilia polystroma on inoculated and naturally infected fruit 

using multiplex PCR. Plant Disease 88, 1219–1225.


De Cal, A., Melgarejo, P. (1999): Effects of long-wave UV light on Monilinia growth and 

identification of species. Plant Disease 83, 62–65. 

Fulton, C. E., van Leeuwen, G. C. M., Brown, A. E. (1999): Genetic variation among and within 

Monilinia species causing brown rot of stone and pome fruits. European Journal of Plant 

Pathology 105:495-500. 

Gell, I., Cubero, J., Melgajero, P. (2007): Two different approaches for universal diagnosis of 

brown rot and identification of Monilinia spp. in stone fruit trees. Journal of Applied 

Microbiology 103, 2629–2637. 

Gril, T., Celar, F., Munda, A., Javornik, B., Jakse, J. (2008): AFLP analysis of intraspecific 

variation between Monilinia laxa isolates from different hosts. Plant Disease 92:1616- 

1624. 

Holst-Jensen, A., Kohn, L. M., Jakobsen, K. S., Schumacher, T. (1997): Molecular phylogeny 

and evolution of Monilinia (Sclerotiniaceae) based on coding and noncoding rDNA 

sequences. American Journal of Botany 84:686-701. 

Ioos, R., Frey, P. (2000): Genomic variation within Monilinia laxa, M. fructigena and M. 

fructicola, and application to species identification by PCR. European Journal of Plant 

Pathology 106:373-378. 

Munoz, Z., Moret, A., Bech, J. (2008): Morphological and molecular characterization of 

Monilinia sp. Isolates and pathogenicity on apple. Agrociencia 42: 119-128. 

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. (2011): MEGA5: 

Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary 

Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, 28, 

2731-2739. 

Trkulja, N., Aleksić, G., Starović, M., Dolovac, N., Ivanović, Ž., Savić, D., Gavrilović, V. 

(2010): Efikasnost preparata za suzbijanje Monilinia laxa u zasadu višnje tokom 

dvogodišnjih ispitivanja - 2008-2009. Zaštita bilja, 61(1), 37-48. 

van Leeuwen, G. C. M., Baayen, R. P., Holb, I. J., Jeger, M. J. (2002): Distinction of the asiatic 

brown rot fungus Monilia polystroma sp. nov. from M. fructigena. Mycological Research 

106:444-451. 

White, T.J., Bruns, T., Lee, S., Taylor, J. (1990): Amplification and direct sequencing of fungal 

ribosomal RNA genes for phylogenetics. In: PCR protocols: a guide to methods and 

applications, chapt 38, 315–322. (Eds. Innis M, Gelfand DH, Shinsky JJ and White TJ). 

Academic Press, San Diego, CA (US).

292 Morphological and molecular identification of... 



MORPHOLOGICAL AND MOLECULAR IDENTIFICATION OF 

COLLETOTRICHUM GLOEOSPORIOIDES FROM CITRUS 

RETICULATA 

SVETLANA ŽIVKOVIĆ, NENAD TRKULJA, TATJANA POPOVIĆ, VIOLETA ORO, ŽARKO 

IVANOVIĆ 

Institute for Plant Protection and Environment, Belgrade, Serbia 

e-mail: zivkovicsvetla@gmail.com 

The Colletotrichum spp. were isolated from anthracnose fruits of mandarin (Citrus reticulata). 

Infected fruits have small, water soaked, sunken, dark circular spots that may increase in size. 

Pathogen isolates on PDA medium forming gray to dark gray colonies. Conidia were hyaline, 

aseptate, and cylindrical. Appressoria were smooth, simple, clavate or irregular and varied from light 

to dark brown. Pathogenicity tests with representative isolates were conducted on symptomless, 

detached mandarin fruits. All tested isolates caused anthracnose lesions on fruit after 10 days of 

incubation. Koch’s postulates were fulfilled by reisolation from inoculated mandarin fruits. Speciesspecific 

PCR (using primer pair CgInt/ITS4) of genomic DNA from mandarin isolates resulted in an 

amplification product of 450 bp, specific for C. gloeosporioides. The fungal strains were identified as 

Colletotrichum gloeosporioides based on morphology and ITS sequence data analyses. 

Key words: Colletotrichum gloeosporioides, anthracnose, Citrus reticulata, identification. 

INTRODUCTION 

Citrus (Citrus spp.) is the most common fruit crop, grown in over 100 countries 

worldwide. Citrus fruits are enjoyed for their taste, nutritional value, and relatively low 

price. Control of postharvest diseases of citrus is vital for maintaining quality and shelf life 

in a market where transport from producer to consumer may take several weeks (Smilanick 

et al., 2005). 

Colletotrichum spp. causes anthracnose disease and postharvest decay on many 

tropical, subtropical, and temperate fruits (Freeman and Shabi, 1996). On citrus, postbloom 

fruit drop is caused by Colletotrichum acutatum J.H. Simmonds. Infection results in 

necrotic brown lesions on petals (blossom blight) and premature fruit drop. This fungus 

infects almost all citrus species: sweet oranges (C. sinensis), grapefruit (C. paradisi) and 

mandarin (C. reticulata), (Timmer and Brown, 2000). Postharvest anthracnose is caused by 

C. gloeosporioides (Penz.) Penz. & Sacc., and is a problem especially for citrus fruits 

harvested early that must be degreened with ethylene. C. gloeosporioides also is a common 

saprophyte in citrus groves (Timmer et al., 1998). This species invades dead and senescent 

leaves, twigs, and fruit and produces acervuli with abundant conidia on dead tissues of 

citrus. Conidia are splash-dispersed to living leaves, twigs and fruit, where they germinate

Svetlana Živković, Nenad Trkulja, Tatjana Popović,... 293 

to produce appressoria and quiescent infections. When immature fruit with high numbers of 

appressoria of C. gloeosporioides are exposed to stress, the rind collapses and is colonized 

by the fungus, producing postharvest anthracnose (Brown, 1975). 

In Serbia, C. acutatum and C. gloeosporioides have been reported as pathogens of 

apple, strawberry, sour cherry, pear, and tomato fruit (Ivanović and Ivanović, 1992; 

Trkulja, 2003; Ivanović et al., 2007; Živković, 2011). The occurrence of anthracnose on 

mandarin fruit (import from Greece), has been found during 2010. Typical symptoms 

include dark, sunken, and circular lesion that produce mucilaginous, orange conidial 

masses. Economic losses caused by the disease are mainly attributed to lower fruit quality 

and marketability. Therefore, the objective of the present study was to identify the causing 

agent of mandarin anthracnose using morphological and molecular analysis. 


Isolation and maintenance 

Mandarin fruits with typical anthracnose symptoms were collected from the markets 

(Figure 1a). Pieces of the diseased tissues were sterilized in 3% NaOCl for 3 min, followed 

by several rinses with sterile distilled water, and placed on water agar (WA) in Petri plates 

at 25 o C for 7 days. Five representative monoconidial isolates were selected for further 

studies and mainteined on potato dexrose agar (PDA) slants at 4°C. The reference strains of 

C. acutatum (CBS 294.67) and C. gloeosporioides (CBS 516.97) were obtained from 

Fungal Biodiversity Centre, Netherlands. 

Pathogenicity 

Pathogenicity test with representative isolates was conducted on symptomless, 

detached mandarin fruits. The fruits of mandarin were surface sterilized with ethanol (70%) 

wounded with sterile needle, and inoculated with 20 µl of the conidial suspensions (10 7 

conidia/ml). Control fruit was inoculated with sterile distilled water. Inoculated fruits were 

kept in a humid chamber at 25°C for 10 days. 

Morphology 

Size and shape of conidia were recorded from the colonies grown on PDA plates at 

25°C. Length and width were measured for 100 conidia, and conidial shape was recorded 

using light microscopy. Appressoria were produced using a slide culture technique, in 

which 10 mm 2 squares of PDA were placed in an empty Petri plate. The edge of the agar 

was inoculated with spores taken from a sporulating culture and a sterile cover slip was 

placed over the inoculated agar (Johnston and Jones, 1997). After 5 days, the shape and size 

of the 100 appressoria formed across the underside of the cover slip were examined 

microscopically. 

DNA extraction 

Total genomic DNA was extracted from mycelium obtained from cultures grown on 

PDA for 7 days at 25°C. The 0.5 g of mycelium for each isolate was frozen in liquid 

nitrogen and ground in a sterile mortar. DNA was extracted using the DNeasy Plant Mini 

Kit (QIAGEN, Hilden, Germany), according to the manufacturer's instructions. Extracted 

DNAs were preserved at -20 o C.


PCR amplification 

Species-specific primers for C. gloeosporioides (CgInt; 5’- 

GGCCTCCCGCCTCCGGGCGG- 3’), and C. acutatum (CaInt2; 5’- 

GGCGCCGGCCCCGTCACGGGGG-3’) from the ITS1 region of the ribosomal DNA 

gene were used in combination with the conserved primer ITS4 (5'- 

TCCTCCGCTATTGATATGC-3'), (White et al., 1990). PCR amplification was performed 

in a 25 µl reaction mixture containing 1.5 µl of DNA extract in low-TE buffer; 4 µl of 200 

µM each of dATP, dCTP, dGTP, and dTTP; 2.5 µl of 10× Taq reaction buffer; 0.5 µl of 100 

µM MgCl 2 ; 1.0 µl of 1 µM target primer; 1 µl of 1 µM ITS4 primer; 0.65 U Taq DNA 

polymerase, and 14.85 µl of sterile water. Amplifications were performed in Eppendorf 

Master Cycler programmed for the following cycling conditions: initial denaturation at 

94°C for 5 min; 35 amplification cycles consisting of 1 min at 94°C, 2 min at 59°C, 1 min 

of extension at 72°C, and final extension at 72°C for 5 min. PCR products were separated 

using electrophoresis in 1% agarose gels in TBE buffer. Gels were stained in dilute 

ethidium bromide (0.2µg/ml) and visualized by UV transilluminator. 

ITS1-2 sequence analysis 

One representative isolate (MC-1), was chosen for DNA sequence analysis. The 

ITS1-2 gene region was amplified by PCR using the primer combinations ITS1 and ITS4 

(White et al., 1990). Sequencing was performed by Macrogen Service (Seoul, Korea). 

Sequences of representative Colletotrichum strains were retrieved from the NCBI website, 

and used to construct phylogenetic tree. Phylogenetic analysis using neighbor-joining was 

conducted with MEGA4 software (Tamura et al., 2007). The reliability of the analyses was 

subjected to a bootstrap test with 1000 replicates. 

RESULTS 

Pathogenicity 

All tested isolates caused anthracnose lesions on mandarin fruit after 10 days of 

incubation. No lesion developed on control fruit inoculated with sterile distilled water. 

Koch’s postulates were fulfilled by reisolation from inoculated mandarin fruits. 

Morphology 

Colonies of all mandarin isolates were dense aerial, initially white gray, becoming 

dark gray, as the cultures aged on PDA (Figure 1b). Colonies reverse were dark gray. The 

cultures developed black acervuli around the center of the colony. No setae were observed. 

Mycelia were branched, septate, and hyaline. Conidia were hyaline, aseptate, and 

cylindrical with obtuse apices, 11.2-17.6 × 3.2-4.8 µm, with a mean range of 15.7 x 3.7 µm 

(Figure 1c). Appressoria produced directly from conidia were light to dark brown, smooth, 

simple, clavate or irregular, 6.9-12.8 × 5.5-8 µm, with a mean range of 7.7 x 6.3 µm (Figure 

1d).


Figure 1. (a). Anthracnose symptom on mandarin fruit; (b). Cultural appearance of C. 

gloeosporioides, (isolate MC-1); (c). Conidia of C. gloeosporioides, (isolate MC-1) (light 

microscope, 600x); (d). Appressoria of C.gloeosporioides (isolate MC-1) (light microscope, 

1000x). 

Molecular identification 

The species-specific primer CgInt in conjunction with ITS4 primer amplified a 450 

bp fragment from genomic DNA of all mandarin isolates, and the reference strain of C. 

gloeosporioides (CBS 516.97). In contrast, species-specific primer CaInt2/ITS4 amplified a 

490 bp fragment only from DNA of reference C. acutatum (CBS 294.67). No PCR products 

were produced with water controls in any of the reaction. 

ITS1-2 sequence analysis 

Phylogenetic analysis based on ITS1-2 sequences resulted in a tree with three 

clusters (Figure 2). The strains of C. gloeosporioides from: mandarin (MC-1); C. reticulata 

(JN887350, China); C. sinensis (EU371022, Italy); Citrus sp. (AJ313178, Portugal) and 

Olea europea (AM991138, Portugal), formed the first cluster with bootstrap values of 63%. 

The strain from Citrus sp. (AJ536229, Italy) formed a separate lineage with a bootstrap 

value of 76%. The second cluster consists of three C. gloeosporioides from different hosts: 

Prunus malus (DQ003097, USA); P. armeniaca (AF207792, Israel), and Magnifera indica 

(AF521198, Columbia). Phylogenetic relationships among strains in this cluster were not 

well resolved, as indicated by the low bootstrap value (44%). The strain of C. fragariae 

from Fragaria chiloensis (DQ003093, USA) formed a separate lineage with this cluster. 

The third cluster consists of C. acutatum from O. europea (AJ749695, Portugal).


Figure 2. Phylogenetic tree of C. gloeosporioides, isolate MC-1 from mandarin, based on ITS 

rDNA sequences. The tree was generated using neighbor-joining analysis. Bootstrap values for 

1000 replicates are shown on branches. Marks AJ, AF, AM, DQ, EU and JN are DNA sequence 

accession numbers from NCBI GenBank. 

DISCUSSION 

Anthracnose caused by the fungi C. acutatum and C. gloeosporioides is an important 

disease in Serbia. Several host species can be affected, and this study focused on examining 

the etiology of anthracnose on mandarin fruits sold on the domestic markets. 

Infected fruits have small, sunken, circular spots that may increase in size. 

Pathogenicity test with representative isolates was conducted on symptomless mandarin 

fruits. C. gloeosporioides was successfully reisolated from the artificially inoculated 

mandarin fruits, thus establishing proof of pathogenicity. 

Morphological identification of mandarin isolates based on phenotypic traits such as 

colony appearance, and characters of vegetative and reproductive structures. The color of 

cultures may vary considerably within and between species of C. acutatum and C. 

gloeosporioides. Colonies of C. gloeosporioides were usually gray in appearance, while C. 

acutatum colonies had a chromogenic (pink) or nonchromogenic (white to gray) phenotype 

(Baxter et al., 1983). The results of cultures studies showed no distinct differences in 

characteristics among the mandarin isolates. Colonies on PDA were effuse, white to dark 

gray. The conidial shape of all mandarin isolates was cylindrical with obtuse apices. In 

general, conidia of C. acutatum are elliptic-fusiform in shape; whereas conidia of C. 

gloeosporioides are cylindrical with obtuse ends (Baxter, et al., 1983). Conidial size of this 

fungus was described as 9-24 × 3-6 µm (Mordue, 1971). Conidia length and width of 

mandarin isolates were consistent with descriptions of Hong et al. (2008), and Jiang et al. 

(2012). Shape and size of appressoria have also been used for taxonomy of the genus 

Colletotrichum. The shape of appressoria of C. gloeosporioides from mandarin was 

variable, irregular or ovate, and the size was similar to those described by Sutton (1992), 

and Cannon et al. (2008).


Morphological characteristics of isolates from mandarin fruit indicated that the 

causal agent could be C. gloeosporioides, but the shape and size of conidia and appressoria, 

as well as cultural characters should be evaluated and used with caution, as these characters 

are highly dependent on the growth conditions (Cai et al., 2009). However, PCR with 

primers specific for both species, followed by nucleotide sequencing of the amplicons, and 

phylogenetic analysis of ITS rDNA sequences, demonstrated that the causal agent of 

mandarin anthracnose was C. gloeosporioides. 


This study was supported by the Ministry of Education and Science of the Republic 

of Serbia, Projects TR 31018 and OI 173026. 

REFERENCES 

Baxter, A.P., van der Westhuizen, G.C.A., Eicker, A. (1983): Morphology and taxonomy of 

South African isolates of Colletotrichum. S. African. J. Bot., 2: 259–289. 

Brown, G. E. (1975): Factors affecting postharvest development of Colletotrichum 

gloeosporioides in citrus fruits. Phytopathology, 65: 404-409. 

Cai, L., Hyde, K.D., Taylor, P.W.J., Weir, B.S., Waller, J., Abang, M.M., Zhang, J.Z., Yang, 

Y.L., Phoulivong, S., Liu, Z.Y., Prihastuti, H., Shivas, R.G., McKenzie, E.H.C. and 

Johnston, P.R. (2009): A polyphasic approach for studying Colletotrichum. Fungal 

Diversity, 39: 183-204. 

Cannon, P.F., Buddie, A.G., Bridg,e P.D. (2008): The typification of Colletotrichum 

gloeosporioides. Mycotaxon, 104: 189–204. 

Freeman, S. and Shabi, E. (1996): Cross-infection of subtropical and temperate fruits by 

Colletotrichum species from various hosts. Physiol. Mol. Plant Pathol., 49: 395-404. 

Hong, S.K., Kim, W.G., Yun, H.K., Choi, K.J. (2008): Morphological variations, genetic 

diversity and pathogenicity of Colletotrichum species causing grape ripe rot in Korea. 

Plant Pathol. J., 24(3): 269-278. 

Ivanović, M. and Ivanović, D. (1992): Proučavanje Colletotrichum gloeosporioides, 

prouzrokovača antraknoze višnje i delovanje nekih fungicida na gljivu in vitro. Zaštita 

bilja, 201: 211-218. 

Ivanović, M., Duduk, B., Ivanović, M., and Ivanović, M. (2007): Anthracnose – a new 

strawberry disease in Serbia and its control by fungicides. Proc. Nat. Sci. Matica Srpska, 

113: 71-81. 

Jiang, Y.L., Tan. P., Zhou, X.Y., Hou, X.L., Wang, Y. (2012): Colletotrichum gloeosporioides, 

the causal agent of citrus anthracnose in Guizhou Province. Plant Pathology & 

Quarantine, 2(1): 25–29. 

Johnston, P.R. and Jones D.(1997): Relationship among Colletotrichum isolates from fruit rots 

assessed using rDNA sequences. Mycologia, 89: 420-430. 

Mordue, J. E. M. (1971): Colletotrichum gloeosporioides. CMI Descriptions of Pathogenic 

Fungi and Bacteria. No. 315. C.M.I. Kew, U.K. 

Smilanick, J.L., Mansour, M.F., Margosan, D.A., Mlikota Gabler, F., Goodwine, W.R. (2005): 

Influence of pH and NaHCO3 on effectiveness of imazalil to inhibit germination of 

Penicillium digitatum and to control postharvest green mold on citrus fruit. Plant Dis., 

89: 640–648.


Sutton, B.C. (1992): The genus Glomerella and its anamorph Colletotrichum, in: 

Colletotrichum: Biology, Pathology and Control, eds.,J. A. Bailey and M. J. Jeger, CAB 

Int., Wallingford, UK, pp. 1-26. 

Tamura, K., Dudley, J., Nei, M., Kumar, S. (2007): MEGA4: Molecular Evolutionary Genetics 

Analysis (MEGA) software version 4.0. Mol. Biol. Evol., 24: 1596-1599. 

Timmer, L. W., Brown, G. E., Zitko, S. E. (1998): The role of Colletotrichum spp. in 

postharvest anthracnose of citrus and survival of C. acutatum on fruit. Plant Dis., 82:415- 

418. 

Timmer, L. W. and Brown, G.E. (2000): Biology and control of anthracnose disease of citrus. 

In: Colletotrichum: Host specificity, pathology and host-pathogen interaction. D. Prusky, 

Freeman, S., and Dickman, M.B., eds APS Press, St. Paul, Minn., pp. 300-316. 

Trkulja, V. (2003): Patogene, morfološke i odgajivačke odlike Colletotrichum spp. 

prouzrokovača gorke truleži ploda jabuke. Doktorska disertacija, Poljoprivredni fakultet, 

Beograd. 

White, T. J., Bruns, T. D., Lee, S., Taylor, J. W. (1990): Amplification and direct sequencing of 

fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to methods 

and applications. ed. by M. A. Innis, D. H. Gelfand, J. J. Sinsky and T. J. White, 

Academic Press, New York, USA, pp. 315-322 

Živković, S. (2011): Uporedna proučavanja izolata Colletotrichum spp. prouzrokovača 

antraknoze. Doktorska disertacija, Poljoprivredni fakultet, Novi Sad.

Zornitsa Stoyanova, Rossitza Rodeva, Vasilissa Manova,... 299 

International Symposium: Current Trends in Plant Protection 

Proceedings UDK: 635.649-248.231(497.11+497.2) 

UNUSUAL COLLETOTRICHUM SP. ASSOCIATED WITH PEPPER 

FRUIT ANTHRACNOSE IN BULGARIA AND SERBIA – 

PRELIMINARY RESULTS 

ZORNITSA STOYANOVA 1 , ROSSITZA RODEVA 1 , VASILISSA MANOVA 1 , LUBOMIR STOILOV 1 , 

MIRJANA MIJATOVIC 2 

1 Institute of Plant Physiology and Genetics, 1113 Sofia, Bulgaria 

2 Institute for Vegetable Crops, Smederevska Palanka, Serbia 

Unusual Colletotrichum sp. was isolated from naturally infected pepper fruits in Bulgaria and 

Serbia. Both anamorphic and teleomorphic stage simultaneously developed very easily on artificial, 

solid medium but teleomorph was not observed on naturally or artificially infected fruits. Some of 

conidia were rounded at both ends like C. gloeosporioides and others were pointed at one end like C. 

acutatum. However, the curved or even sickle-shaped ascospores differed from those of Glomerella 

cingullata and G. acutata. The pathogenicity test on green apple fruits resulted in large round 

necroses with light gray mycelium in the centre and conidial mass emerging from densely situated 

small acervuli. The isolates were pathogenic for pepper and tomato but not for eggplant. PCR 

amplification with universal and species-specific primers, based on the ITS (internal-transcribed 

spacer) of ribosomal genes, confirmed the undoubted affiliation of fungus to the genus Colletotrichum 

but not to C. acutatum or C. coccodes. Some of symptoms and characteristics of investigated isolates 

of Colletotrichum sp. partially resembled other known causal agents of pepper anthracnose, however, 

they showed some individual characteristics like ascospore morphology and simultaneous appearance 

of anamorph and teleomorph in vitro. Molecular investigations will be continued to determine the 

taxonomic position of this interesting pathogen. 

Key words: Capsicum annuum, Colletotrichum sp., C. acutatum, C. coccodes, C. 

gloeosporioides, pepper anthracnose 

INTRODUCTION 

Symptoms of fruit anthracnose were observed during pepper disease surveys in 

Bulgaria and Serbia. The most frequently reported causal agents worldwide are C. 

gloeosporioides (Penz.) Penz. & Saccardo in Penz., C. capsici (Syd.) E.J. Butler & Bisby, 

C. acutatum Simmonds ex Simmonds and C. coccodes (Wallr.) S.J. Hughes (Manandhar et 

al., 1995; Roy et al., 1997; Lewis Ivey et al., 2004; Tozze Jr. et al., 2006). An investigation 

was undertaken to identify the Colletotrichim spp. from diseased fruits collected in Bulgaria 

and Serbia. 

The present paper reports some preliminary results about unusual Colletotrichum 

species associated with fruit anthracnose of pepper in Bulgaria and Serbia.

300 Unusual colletotrichum SP. associated with pepper fruit anthroacnose in... 


Joint and individual expeditions were carried out in Bulgaria (regions of Stara 

Zagora, Plovdiv and Sofia) and Serbia (Smederevska Palanka, Staro Selo, Rutevac, 

Vukashinovac, Nevalin and Leskovac) in August – September 2011. Open and protected 

fields were visited and fruits with anthracnose symptoms were collected. Potato dextrose 

agar (PDA) was used for initial isolations and subsequent culturing and storage of the 

strains. Identification of Colletotrichum spp. was performed on the basis of morphological 

features (Sutton, 1992; Freeman et al., 1998; Tozze Jr. et al., 2006) and pathogenicity tests. 

Five isolates (3 from Bulgaria – B1, B27, B29 and 2 from Serbia – S2, S3) were selected 

for examination. Digital images were recorded with a Canon PowerShot A95 digital 

camera. Measurements were made with Carnoy program. At least 100 conidia/ascospores 

of each isolate were measured on images on three nutrient media. The pathogenicity tests 

were performed by inoculations of green apple (Talhinhas et al., 2008) and pepper, tomato 

and eggplant fruits with colony fragments of investigated Colletotrichum sp. and C. 

coccodes as a standard. Control fruits were inoculated with sterile PDA discs. Fruits were 

incubated for 7 days at 25°C under 100% relative humidity. Reisolations were made at the 

end of the experiments. 

For molecular characterization the Colletotrichum isolates were grown in potato 

dextrose broth. DNA was isolated from fungal mycelium by DNeasy Plant mini kit 

(Qiagen, Hilden, Germany) and PCR amplification was performed with different sets of 

primers based on the ITS (internal-transcribed spacer) of ribosomal genes (Table 1). PCR 

reactions were performed in 25 µl vol, containing 50-100 ng total genomic DNA, 1x 

reaction buffer [20 mM (NH4) 2 SO 4 , 75 mM Tris-HCl (pH 8.8), 0.01% (v/v) Tween 20), 

200 µM dNTPs, 0.4 µM primers, 1.5-2.5 mM MgCl 2 and 0.75U Taq polymerase 

(Fermentas). 5-10 µl of each PCR reaction were loaded on 1.6% agarose gels (300 ng/ml 

EtBr) and subjected to electrophoresis in 1xTAE buffer at 60V for at least 2.5h. Electronic 

images of the gels were captured by ImageQuant150 and densitometrically analyzed with 

ImageQuantTL7 software (GE Healthcare) to determine the approximate length of the 

resulting PCR products. 

Table 1. Primers and conditions used in the investigation 

Primer pairs 

Its1/Its 4 

Initial 

denaturation 

94°C 

(5min.) 

20-30 cycles Final 

Denaturation Annealing Elongation 

elongation 

94°C 

(1 min.) 

55°C 

(2 min.) 

72°C 

(1.5 min.) 

72°C 

(5-10 min.) 

RESULTS 

C. coccodes was isolated from diseased fruits collected in all visited locations in 

Bulgaria and Serbia. The unusual Colletotrichum sp. was isolated from naturally infected 

pepper fruits in Bulgaria (Sofia region) in 2010 and 2011 and Serbia (Staro selo) in 2011. In 

2011 the similar isolates were obtained from tomato in Bulgaria (data not presented). The 

disease was observed only on the fruits. Lesions were oval to elongated, on which dark 

acervuli were concentrically arranged extruding rose-orange conidial mass under wet 

conditions (Fig. 1). No setae were found on the acervuli.


Fig. 1. Colletotrichum sp.: Pepper fruit anthracnose - natural infection 

The highest growth rate of all isolates was recorded on PDA (Fig. 2a) producing 

gray colonies with dark center and salmon colored drops of conidia. Reverse side of agar 

plate had rose-ochre color set with black fruit bodies. On malt extract agar (Fig. 2b) the 

colonies were light gray with numerous fruit bodies situated in concentric zones and visible 

salmon colored conidial masses. The colonies on oatmeal agar (Fig. 2c) developed 

transparent periphery and dark grey-green central part with numerous submerged fruit 

bodies ordered in concentric zones. 

Fig. 2. Colletotrichum sp.: Colonies of isolates from Serbia (above) and from Bulgaria (below) 

on potato dextrose agar (a), malt extract agar (b) and oatmeal agar (c).


All isolates formed hyaline, straight, cylindrical, aseptate conidia with two to seven 

oil globules measuring 15.5±1.1 x 4.7±0.4 µm (Fig. 3a). Conidia were pointed at one end 

and rounded at the other or rounded at both ends. Black perithecia with narrow clavate asci 

measuring 61.7±8.7 µm readily emerged in and between the conidial masses. Asci 

contained 8 hyaline, straight, slightly curved or sickle-shaped, ellipsoidal, aseptate 

ascospores with average dimensions 19.5±1.4 x 4.2±0.6 µm (Fig. 3b). 

Fig. 3. Colletotrichum sp.: conidia (a) and asci and ascospores (b) (Scale 

= 10 µm) bars 

On green apple fruits large round area of necrotic tissues developed with light gray 

mycelium in the centre and conidial mass emerging from small acervuli (Fig. 4). 

Fig. 4. Colletotrichum sp.: Pathogenicity test on green apple fruits inoculated with two 

Bulgarian Colletotrichum sp. isolates (a) and one Serbian isolate (b) 

On pepper and tomato fruits Colletotrichum sp. and C. coccodes exhibited to a 

certain extent similar symptoms. Three days after inoculation (dai) water-soaked circular 

lesions appeared that became soft and slightly sunken. About 10 dai central lesion part 

darkened where abundant acervuli with salmon conidial mass (Colletotrichum sp.) or


microsclerotia (C. coccodes ) developed (Fig. 5A,B). With aging the diseased by 

Colletotrichum sp. fruits mummified. The eggplant fruits became diseased only by C. 

coccodes while after the inoculations with Colletotrichum sp. remained healthy (Fig. 5C,D). 

Fig. 5. Colletotrichum coccodes and Colletotrichum sp.: Pathogenicity test on pepper (A), 

tomato (B) and eggplant (C, D) fruits – 10 days after inoculation 

PCR amplification with ITS1/ITS4 resulted in a single band of ~600 bp in all 

isolates (C. coccodes, Colletotrichum sp. and C. acutatum). C. acutatum-specific primers 

CaInt2/ITS4 amplified a single PCR band of the expected size (~500 bp) only in the two 

previously confirmed C. acutatum isolates (Rodeva et al., 2009) (Fig. 6, lanes 15-16). As 

expected, no band was visible in C. coccodes isolates (Fig. 6, lanes 2-8). When 

amplification reactions containing as a template DNA purified from investigated 

Colletotrichum sp. isolates were performed with C. gloeosporioides-specific primer set 

CgInt/ITS4 a single band of about 470 bp in length was detected (Fig. 6, lanes 17-20). 

Colletotrichum sp. isolates will be further characterized by sequencing of the single 600 bp 

band amplified with the universal primers ITS1/ITS4.


Fig. 6. PCR amplification of different Colletotrichum isolates with primers CaInt2/ITS4 and 

CgInt/ITS4: Lanes 2-8 - C. coccodes isolates B8.1, B2.1/10, B40.1a, MK 26.1, MK 26.2, MK 

7.1, MK 7.2; lanes 10-14 - Colletotrichum sp. isolates B27, B1, B29, S2, S3; lanes 15-16 – C. 

acutatum isolates; lanes 17-20 - C. species isolates B1, B29, S2, S3; lane 1: Negative control 

(mQ water); lane 9: GeneRuler 1kb Plus DNA Ladder (Fermentas) 

DISCUSSION 

Fruit rot is the most important disease caused by Colletotrichum spp. although it 

could affect other plant parts. In a previous investigation it was established that the 

Colletotrichum population associated with pepper in Bulgaria is heterogeneous and at least 

3 species (C. acutatum, C. coccodes and C. gloeosporioides) cause fruit anthracnose 

(Rodeva et al., 2009). C. capsici with falcate conidia and large amount of setae has not been 

recorded yet (Rodeva et al., 2009). In 2002 C. acutatum was first found in Bulgaria on 

strawberry (Bobev et al., 2002) and later then on pepper and tomato (Jelev et al., 2008). 

Recently, C. acutatum has been reported on strawberry (Ivanović et al., 2007) and tomato 

(Živković et al., 2010) in Serbia, but not on pepper. C. coccodes could be easily separated 

from C. acutatum and C. gloeosporioides on the basis of abundant microsclerotia and 

scarce mycelium production. C. acutatum and C. gloeosporioides developed 

morphologically similar gray colonies and it was difficult to differentiate them on the basis 

of the phenotype only. 

The isolates of investigated Colletotrichum sp. were obtained from dry, leathery 

lesions extending more rapidly longitudinally than laterally, partially resembling to the 

lesions caused by Phomopsis capsici, but no pycnidia were observed. The symptoms 

caused by Colletotrichum sp. were similar to ones caused by C. coccodes but instead of 

microsclerotia, densely situated acervuli were found under the cuticle, which was ruptured 

by the emergence of conidiophores and a great mass of conidia. 

Both anamorphic and teleomorphic stages simultaneously developed very easily on 

several nutrient media, but the perithecia has not been found on naturally or artificially 

infected fruits. Some of conidia were rounded at both ends resemble to those of C. 

gloeosporioides and others were pointed at one end and rounded at the other end similar to 

C. acutatum. However, the curved or sickle-shaped ascospores differed from both 

Glomerella cingullata and G. acutata (Sutton, 1992; Guerber and Correll, 2001).


Some of symptoms and characteristics of investigated isolates of Colletotrichum sp., 

partially resembled other known causal agents of pepper anthracnose, however, they 

showed some individual characteristics like ascospore morphology and simultaneous 

anamorph and teleomorph sporulation. 

PCR amplifications with genus- and species-specific primers, based on the ITS of 

ribosomal genes, confirmed the undoubted affiliation of fungus to the genus Colletotrichum 

but not to C. coccodes (Rodeva et al., 2012). C. acutatum-specific primers CaInt2/ITS4 

amplified a single PCR band of the expected size (~500 bp) only in the two previously 

confirmed C. acutatum isolates (Rodeva et al., 2009). Only when C. gloeosporioidesspecific 

primer set CgInt/ITS4 was used a single band of about 470 bp was detected 

suggesting that the species under study might belong to the C. gloeosporioides group. 

Molecular investigations will be continued to determine the taxonomic position of this 

interesting pathogen. 


Financial support of SEE-ERA.NET PLUS project ERA 226 is gratefully 

acknowledged. 

REFERENCES 

Bobev, S. G., Zveibil, A., Freeman, S. (2002). First report of Colletotrichum acutatum on 

strawberry in Bulgaria. Plant Disease, 86: 1178. 

Freeman, S., Katan, T., Shabi, E. (1998). Characterization of Colletotrichum species responsible 

for anthracnose diseases of various fruits. Plant Disease, 82: 596-605. 

Guerber, J. C., Correll, J. C. (2001). Characterization of Glomerella acutata, the teleomorph of 

Colletotrichum acutatum. Mycologia, 93: 216-229. 

Ivanović, M. S., Duduk, B. B., Ivanović, M. M., Ivanović, M. S. (2007). Anthracnose – a new 

strawberry disease in Serbia and its control by fungicides. Proc. Nat. Sci., Matica Srpska 

Novi Sad, 113: 71-81. 

Jelev, Z. J., Bobev, S. G., Minz, D., Maymon, M., Freeman, S. (2008). First report of 

anthracnose fruit rot caused by Colletotrichum acutatum on pepper and tomato in 

Bulgaria. Plant Disease, 92: 172. 

Lewis Ivey, M. L., Nava-Diaz, C., Miller, S. A. (2004). Identification and management of 

Colletotrichum acutatum on immature bell peppers. Plant Disease, 88: 1198-1204. 

Manandhar, J. B., Hartman, G. L., Wang, T. C. (1995). Semiselective medium for 

Colletotrichum gloeosporioides and occurrence of three Colletotrichum species on 

pepper plants. Plant Disease, 79: 376-379. 

Rodeva, R., Karov, I., Stoyanova, Z., Kovacevik, B., Manova, V., Georgieva, R. (2012). New 

fungal pathogens causing diseases on pepper in Macedonia. Ibid. 

Rodeva, R., Stoyanova, Z., Pandeva, R., Petrov, N. (2009): Field reaction to anthracnose caused 

by Colletotrichum spp. on pepper fruits. Acta Horticulturae (ISHS), 830: 557-562. 

Roy, K. W., Killebrew, J. F., Ratnayake, S. 1997. First report of Colletotrichum capsici on bell 

pepper in Mississippi. Plant Disease, 81: 693. 

Sutton, B. C. (1992): The genus Glomerella and its anamorph Colletotrichum. In: 

Colletotrichum. Biology, Pathology and Control. J. A. Bailey and M. J. Jeger (eds.), 

CAB Intl., Wallingford, Oxon, UK, pp.1-26.


Talhinhas, P., Muthumeenakshi, S., Neves-Martin, J., Oliveira, H., Sreenivasaprasad, S. (2008). 

Agrobacterium-mediated transformation and insertional mutagenesis in Colletotrichum 

acutatum for investigating varied pathogenicity lifestyles. Mol. Biotechnol., 39: 57-67. 

Tozze Jr., H. J., Mello, M. B. A., Massola Jr., N. S. (2006). Morphological and physiological 

characterization of Colletotrichum sp. isolates from solanaceous crops. Summa 

Phytopathologica, 32: 71-79. 

Živković, S., Stojanović, S., Ivanović, Ž., Trkulja, N., Dolovac, N., Aleksić, G., Balaž, J. (2010). 

Morphological and molecular identification of Colletotrichum acutatum from tomato 

fruit. Pestic. Phytomed. (Belgrade), 25: 231-239.

Svetlana Živković, Dragana Jošić, Tatjana Popović... 307 


Proceedings 582.282.31:57.085.2 

CHARACTERIZATION OF DIAPORTHE/PHOMOPSIS SPP. FROM 

PLUM TREES BY SDS-PAGE 

SVETLANA ŽIVKOVIĆ 1 , DRAGANA JOŠIĆ 2 , TATJANA POPOVIĆ 1 , VIOLETA ORO 1 , 

NENAD DOLOVAC 1 , ŽARKO IVANOVIĆ 1 

1 Institute for Plant Protection and Environment, Belgrade, Serbia 

2 Institute of Soil Science, Belgrade, Serbia 


In the present study twelve Diaporthe/Phomopsis spp. originating from plum trees were 

characterized by total cell protein profiles using sodium dodecyl sulfate-polyacrylamide gel 

electrophoresis (SDS-PAGE). There were considerable differences in protein profiles of tested 

isolates at 170 - 17 kDa region. Numerical analysis revealed three distinct clusters at a difference 

level of 29%. The first main cluster consisted of D. eres (isolate Sl-U-4) with genetic difference of 

33.5%. The second cluster included six isolates: Sl-K-7, JP-3, Sl-T-1, Sl-Br-2, Sl-K-1 and Sl-K-3. 

The third clustur comprised also six isolates: Sl-B-2, Sl-K-5, Sl-K-8, Sl-1, Sl-K-4 and Sl-M. The 

genetic difference between members of the cluster 2 and 3 ranged from 4.8 to 24%. A low correlation 

between protein dendrogram and geographic origin of tested isolates was found. The similarities and 

distinctions indicated that population of different Diaporthe/Phomopsis spp. were characterized by 

expressive genetic variability. 

Key words: Diaporthe/Phomopsis spp., SDS-PAGE, characterization. 

INTRODUCTION 

The ascomycete genus Diaporthe Nitschke, and their anamorphs Phomopsis (Sacc.) 

Bubák contains a large number of cosmopolitan plant pathogens, many of which incite 

blights, cankers, die-backs, rots, spots, and wilts on a wide range of host including 

economically important crops (Uecker, 1988). 

Several Diaporthe/Phomopsis species are important pathogens of Malus domestica, 

Pyrus communis, Prunus persica and P. salicina in fruit orchards worldwide (Uddin et al., 

1998; Molleleki et al., 2002; Thomidis and Michailides, 2009). These fungi caused tissue 

necrosis, canker and die-back of affected fruit trees. During last ten years the die-back of 

young plum trees (Prunus domestica L.) was noticed in many localities in Western Serbia. 

Phomopsis isolates recovered from necrotic cambium tissues were examined 

morphologically, by pathogenicity tests and DNA sequencing, but could not be identified at 

the species level (except of Diaporthae eres, isolate SL-U-4). Distinct differences in colony 

appearance, and morphology of conidiomata, conidiogenous cells and conidia were 

observed among all Diaporthe/Phomopsis spp. (Živković, 2008). 

Electrophoretic analysis of total cell proteins by one-dimensional protein patterns 

provides a rough measure of the number and physicochemical properties of gene products.

308 Characterization of diaporthe/phomopsis spp. from plum trees by sds-page 

SDS-PAGE has been used for studying the biology of fungal populations with respect to 

differentiation of species, species forms, and isolates (Mandeel et al., 1994; Hames, 1995). 

This method is highly dependable and species-specific, because proteins are markers for the 

genes that express them, so that differences in their electrophoretic profiles are presumably 

proportional to the genetic divergence among the isolates being compared (Arabi et al., 

2001). A proteomic approach could be a solution for better understanding the variation in 

virulence in a fungal pathogen population (Mohan and Ride, 1984; Huang and Mahoney, 

1999). Furthermore, comparative proteome analysis is a good strategy for discovering 

proteins which undergo changes in expression level and may underlie the differences of 

phenotype. 

Since polypeptide pattern diversity of Diaporthe/Phomopsis populations has not 

been investigated so far, a study with this aim was conducted on 12 isolates collected from 

Western Serbia. Protein gel electrophoresis may provide important information about 

genetic variation of Diaporthe/Phomopsis spp. originating from plum trees. 


Fungal cultures 

Diaporthe/Phomopsis spp. were isolated from branches and trunk of plum trees with 

canker and die-back symptoms. Twelve representative monoconidial isolates were selected 

for further studies and mainteined on potato dextrose agar (PDA) slants at 4°C (Table 1.). 

The strain JP-3, (Phomopsis perniciosa) from apple fruit was used as a control. 

Table 1. Isolates of Diaporthe/Phomopsis spp. from plum trees used for SDS-PAGE analysis. 

Isolate 

Year of 

Species Cultivar Location 

code 

isolation 

Sl-1* Phomopsis sp. stenlej Valjevo 2004 

Sl-M Phomopsis sp. čačanska rodna Osečina 2004 

Sl-T-1 Phomopsis sp. čačanska rodna Lipolist 2005 

Sl-B-2 Phomopsis sp. stenlej Belanovica 2004 

Sl-Br-2 Phomopsis sp. čačanska rodna Belanovica 2004 

Sl-K-1 Phomopsis sp. čačanska lepotica Koceljeva 2006 





Sl-K-8* Phomopsis sp. čačanska lepotica Koceljeva 2006 

Sl-U-4* Diaporthe eres čačanska rodna Ub 2006 

* The isolates were identified by CBS Fungal Biodiversity Centre, Identification Service (Utrecht, The Netherlands). 

Preparation of protein extracts 

Mycelium production of Diaporthe/Phomopsis spp. was carried out by culturing the 

fungi in 100 ml of potato dextrose broth (PDB) in 250 ml Erlenmeyer flasks and incubating 

them at 25°C for 7 days. Mycelial mats were then filtered under vacuum on a Büchner 

funnel, rinsed three times with distilled water and blotted dry. Mycelium to be used for 

protein analyses was freeze-dried and stored at -20°C.


SDS-PAGE analysis 

SDS-PAGE was performed by the method described by Laemmli (1970), and 

modified according to Sambrook et al. (1989). 500 µl of fungal protein extracts were mixed 

with 250 µl of sample buffer (2% SDS; 0.0625 M Tris-HCl, pH 6.8; 5% ME and 8.8% 

glicerol) in Eppendorf tubes, and then boiled in a water bath for 10 min. Denatured proteins 

were cooled at room temperature before electrophoresis. A 50 µl of each protein sample 

was loaded on a polyacrylamide gel. The separation gel (10%) and staking gel (4%) were 

prepared from an acrylamide monomer solution. Electrophoresis was carried out at constant 

current of 0.12 kV through the stacking gel, and 0.15 kV through the separation gel at room 

temperature. After electrophoresis the gel was stained in 0.1% (w/v) Coomassie Brilliant 

Blue R250, and then distained in a distaining solution (25% methanol, 7% acetic acid, and 

68% H 2 O). 

Data analysis 

Gel was examined by naked eyes directly and the protein profiles were recorded as 

binary data, (1 or 0). The similarity and relationship between the protein traces of isolates 

were expressed in a dendrogram derived by means of the simple matching coefficient, and 

unweighted pair group method with arithmetic averages algorithm using STATISTICA 5 

software. 


Since the difficulties of distinguishing Phomopsis species are well known, due to the 

wide host range of some species and their morphological plasticity (van Niekerk et al., 

2005), isolates from plum trees were characterized by total cell protein profiles using SDS- 

PAGE. There were considerable differences in protein profiles of tested isolates at 170 - 17 

kDa region (Figure 1). The total number of protein bands on the gel was 21. Twelve 

isolates Diaporthe/Phomopsis spp., including JC-3, characterized by the presence of a 

common protein bands with molecular weight between 55 kDa and 40 kDa. The all tested 

cultures, also had a common protein fraction with molecular weight of 17 kDa. 

A dendrogram of the total cell protein profiles of Diaporthe/Phomopsis spp. is 

shown in Figure 2. Numerical analysis revealed clearly three distinct clusters at a difference 

level of 29%. Isolate Sl-U-4 (D. eres), formed the first separate cluster with the largest 

percentage difference (33.5%). The second cluster included six isolates: Sl-K-7, JP-3, Sl-T- 

1, Sl-Br-2, Sl-K-1 and Sl-K-3. Clustur 3 comprised also six isolates: Sl-B-2, Sl-K-5, Sl-K- 

8, Sl-1, Sl-K-4 and Sl-M. The level difference of members of the cluster 2 and 3 changed 

between 4.8% and 24%. 

The smallest genetic distance was found between isolates Sl-K-1 and Sl-Br-2, and 

also between Sl-K-4 and Sl-1. In both cases obtained value was 0.048. Isolates Sl-K-8 and 

Sl-K-3 exhibited the greatest genetic distance, of 0.667. D. eres showed a genetic distance 

ranging from 0.334 to 0.524. This fungus exhibited a significant difference in protein 

expression. 

Within the clusters of Diaporthe/Phomopsis spp., low correlation between the 

geographic origin of the isolates and their protein patterns was observed.


Figure 1. SDS-PAGE of total cell proteins of Diaporthe/Phomopsis spp. (Line M: Marker, 

Fermentas Life Sciences; Page Ruler Prestained Protein Ladder SM 0697). 

Figure 2. Dendrogram based on unweighted pair group method with arithmetic averages 

algorithm of the protein patterns of Diaporthe/Phomopsis spp. from plum trees.


The electrophoretic separation of protein is a useful tool for differentiating fungal 

taxa (Mandeel et al., 1994; Arabi et al., 2001; Mahmoud et al., 2007). SDS-PAGE method 

is relatively easy and many samples can be screened at the same time. It is also cheaper 

than all DNA PCR- based fingerprinting techniques. Moreover, results of SDS-PAGE of 

total cell proteins can discriminate in some cases fungal isolates at the same level as DNA 

fingerprinting (Priest and Austin, 1993). 

Our results have showed that electrophoretic methods can provide valuable 

information which may be used in characterization of fungal strains. There is no data in the 

literature on the content of Diaporthe/Phomopsis protein fractions, so it was not possible to 

compare our results. However, the electrophoretic analysis of total cell proteins showed that 

each isolate had characteristically distinctive protein band patterns. The similarities and 

distinctions indicated that population of different Diaporthe/Phomopsis spp. were 

characterized by expressive genetic variability. 




REFERENCES 

Arabi, M.I.E., MirAli N., Jawhar M., Alsafadi B. (2001): The effects of barley seed infected 

with Pyrenophora graminea on storage protein (Hordeins) patterns. Plant Varieties and 

Seeds, 14: 113-117. 

Hames, B.D. (1995): One-dimensional polyacrylamide gel electrophoresis. In: Gel 

electrophoresis of proteins. A practical approach. Hames B.D., and Rickwood D. (eds.). 

Oxford University Press, New York, USA, pp. 1- 147. 

Huang, L.K., and Mahoney, R.R. (1999): Purification and characterization of an 

endopolygalacturonase from Verticillium albo-atrum. J. Appl. Microbiol., 86: 145- 156. 

Laemmli, U.K. (1970): Cleavage of structural proteins during the assembly of head of 

bacteriophage T4. Nature, 227: 680-685. 

Mandeel Q.A., El-Din A.Y.G., Mohammed S.A. (1994): Analysis of SDS-dissociated proteins 

of pathogenic and nonpathogenic Fusarium species. Mycopathologia, 127: 159-166. 

Mahmoud,Y.A.G., Gaafar, R.M., Mubarak, H.M. (2007): Genetic diversity among Nile Delta 

isolates of Rhizoctonia solani Kühn based on pathogenicity, compatibility, isozyme 

analysis and total protein pattern. Turk J. Bot., 31: 19-29 

Mohan, S.B., and Ride, J.P. (1984): Some biochemical and morphological characteristics of 

serotypes of Verticillium albo-atrum from hop. J. Gen. Microbiol., 130: 3203-3218. 

Moleleki, N., Preisig, O., Wingfield, M.J., Crous, P.W., Wingfield, B.D. (2002): PCR–RFLP 

and sequence data delineate three Diaporthe species associated with stone and pome fruit 

trees in South Africa. European Journal of Plant Pathology, 108: 909–912. 

Priest F.G., and Austin B. (1993): Modern Bacterial Taxonomy. 2nd Ed. Chapman and Hall, 

London, UK. 

Sambrook, J., Fritsch, E.F., Maniatis, T. (1989): Molecular cloning: A laboratory manual, 

Second edition. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. 

Thomidis, T., and Michailides, T. J. (2009): Studies on Diaporthe eres as a new pathogen of 

peach trees in Greece. Plant Dis., 93: 1293-1297.


Uddin, W., Stevenson, K. L., Pardo-Schultheiss, R. A., Rehner, S. A. (1998): Pathogenic and 

molecular characterization of three Phomopsis isolates from peach, plum, and Asian 

pear. Plant Dis., 82: 732-737. 

Uecker, F.A. (1988): A Word List of Phomopsis Names with Notes on Nomenclature, 

Morphology and Biology. Mycologia Memoir No.13. J. Cramer, Berlin. 

van Niekerk J.M., Groenewald J.Z., Farr D.F., Fourie P.H., Halleen F., Crous P.W. (2005): 

Reassessment of Phomopsis species on grapes. Australasian Plant Pathology, 34: 27-39. 

Živković S. (2008): Etiological studies of plum trees die-back. M. Sc. Thesis. Faculty of 

Agriculture, Novi Sad.

Zdravka Sever, Tihomir Miličević, Joško Kaliterna... 313 


Proceedings UDK: 634.11-24]:631.563.9(497.5) 

LOSSES OF APPLE FRUIT (CV. CRIPPS PINK) CAUSED BY 

FUNGAL DISEASES DURING STORAGE 

ZDRAVKA SEVER, TIHOMIR MILIČEVIĆ, JOŠKO KALITERNA 

University of Zagreb, Faculty of Agriculture, Department of Plant Pathology, 

Svetošimunska 25, 10000 Zagreb, Croatia 

zsever@agr.hr 

Apple (Malus domestica Borkh.) is the most significant fruit species in Croatia. Therefore, a 

study was initiated to determine causal agents of apple fruit cv. Cripps Pink postharvest diseases and 

losses during storage in ULO (Ultra Low Oxygen) conditions. Fungi were determined based on 

symptoms on rotten apple fruit and morphological features in pure culture. Prevalent fungi 

determined in this study were: Penicillium spp., Neofabraea spp. and Botrytis spp. Incidence of other 

genera Fusarium, Colletotrichum, Alternaria and Botryosphaeria was determined at lower 

frequencies. Economic losses were estimated based on weight loss per one tone with average 

wholesale market price of one kilo of apple cv. Cripps Pink. Both disease incidence and economic 

loss were significantly increased with prolongation of storage period. Such results pointed out 

significance of postharvest diseases and their potential to cause substantial yield and economic losses. 

Key words: apple, ULO storage, postharvest diseases, disease incidence, economic loss. 

INTRODUCTION 

Apple is one of the most important fruit species worldwide as well as in Croatia. 

Prevalent cultivars grown in Croatia are Idared, Jonagold, Granny Smith and Golden 

Delicious but new ones are being introduced in production, such as Cripps Pink. 

Apple fruits are stored after harvest in order to provide market with quality fruits 

yearlong. Fungal diseases occur regularly during storage and can cause severe yield and 

economic losses. During 1950s postharvest losses on apple fruits were up to 80%, even 

90% (Anderson, 1956). Rosenberger (1997) estimated loss of 4,4 million $ per year caused 

by postharvest decay of apple in USA. In 2004 report was published suggesting that 

deterioration during storage caused 5 to 25% losses of total yield (Jijakli and Lepoivre, 

2004). In Croatia study was conducted during three seasons (2004/2005, 2007/2008 and 

2008/2009) and economic losses were estimated (Ivić et al., 2009). 

The major postharvest pathogens of pome fruit according to literature are 

Penicillium expansum Link, Botrytis cinerea Pers.: Fr and Monilinia fructigena (Snowdon 

1990, Ivić et al., 2009, Ivić et al., 2006, Trkulja 2008; Konstantinou et al., 2011). Other 

common fungal species isolated from rotten pome fruits are: Colletotrichum, Mucor, 

Rhizopus, Alternaria, Botryosphaeria, Fusarium, Neofabraea etc. (Konstantinou, 2011; 

Ivić et al., 2009; Snowdon, 1990).

314 Losses of apple fruit (cv. Cripps pink) caused by.... 

Losses of apple fruit caused by fungal pathogens during storage are poorly 

investigated in Croatia. Therefore, a study was initiated to estimate losses due to 

postharvest diseases of apple cv. Cripps Pink and to determine causal agents of fungal 

diseases during storage. 


Study was conducted in season 2009/2010. After harvest fruits cv. Cripps Pink from 

orchard situated near Vrgorac (Dalmatia) were stored in ULO (Ultra Low Oxygen) 

conditions at temperature 0,5 ° C, relative humidity 92%, oxygen concentration 1,5% and 

carbon dioxide 2%. 

After two, five, seven and eight months of storage assesments of disease incidence 

and losses were done. One thousand of randomly selected fruits were examined from the 

selection line during the packing operation. Disease incidence was calculated based on 

number of symptomatic fruits out of the total number of examined fruits, and was expressed 

as a percentage. Economic loss was calculated by multiplying weight loss per one tone with 

average wholesale market price of one kg of apple for periods when assesments were done. 

Fruit weight loss per one tone was calculated on the basis of disease incidence, average 

fruit weight and number of fruits in one tone. Frequencies of pathogens among decayed 

Cripps Pink fruit were also calculated. 

Symptomatic fruits were transported to the laboratory and fungal pathogens were 

determined based on symptoms and morphological characters of fruiting bodies and spores, 

according to descriptions of Snowdon (1990) and Crous et al. (2009). Parts of fruit tissue 

without visible sporulation were incubated at 22 °C in moist chamber for several days. 

After incubation fungal colonies were transferred to PDA (Potato Dextrose Agar) medium 

to obtain pure cultures, and subsequently fungal identification was done based on colony 

appearance and morphological features. 

RESULTS 

During the season 2009/2010 disease incidence on apple fruit cv. Cripps Pink varied 

from 2,1% to 38,5% after eight months of storage (Table 1). Estimated economic loss 

during storage ranged from 14,91 EUR to 450,45 EUR per one tone of apple fruits (Table 

1). 

Table 1. Disease incidence and estimated economic loss of apple fruit cv. Cripps Pink during 

storage. 

Months 

of storage 

Disease incidence 

(%) 

Yield loss 

(EUR/t) 

2 2,1 14,91 

5 11,1 87,69 

7 17,7 205,32 

8 38,5 450,45

Zdravka Sever, Tihomir Miličević, Joško Kaliterna... 315 

Seven different fungal genera were determined in this study (Table 2). Dominant fruit rot 

pathogens in all assesed periods were Botrytis spp., Neofabrea spp. and Penicillium spp. 

accounting for 44,6; 24,1 and 20,3% average of the decayed fruit. Frequency of recovery of 

Fusarium spp. varied from 2,4 to 14,8% in all assessed periods. Incidence of other diseases, 

including bitter rot caused by Colletotrichum spp., Alternaria rot and black rot caused by 

Botryosphaeria spp. occurred sporadically in decayed apple fruit in frequencies of 0 to 6,6%. 

Table 2. Frequency of fungal pathogens on apple fruit cv. Cripps Pink during storage (%). 

Months 

Neofa 

braea 

spp. 

Botrytis 

spp. 

Frequency of fungal pathogens (%) 

Penicilli 

um spp. 

Fusariu 

m spp. 

Botryosp 

haeria 

spp. 

Alternaria 

spp. 

Colletotric 

hum spp. 

2 15,4 49,8 27,3 3,5 4,0 0,0 0,0 

5 28,2 31,9 31,4 3,2 5,3 0,0 0,0 

7 27,2 54,2 9,6 2,4 0,0 6,6 0,0 

8 25,6 42,6 12,8 14,8 0,0 0,0 4,2 

Average 24,1 44,6 20,3 5,9 2,3 1,7 1,1 

DISCUSSION 

Results in this study have shown relatively high losses of apple fruit cv. Cripps Pink 

after five and seven months of storage, but consistent with previously published report 

suggesting that postharvest diseases cause 5 to 25% losses of total yield (Jijakli and 

Lepoivre, 2004). Losses after eight months of storage were very high, with disease 

incidence of 38,5%. After two months of storage disease incidence was substantially lower 

and economic loss valued 14,91 EUR/t. 

Dominant postharvest diseases determined in this experiment were blue mold 

(Penicillium spp.) and gray mold (Botrytis cinerea), considered to be major postharvest 

pathogens of pome fruit (Snowdon 1990, Ivić et al 2009, Ivić et al 2006, Trkulja 2008, 

Konstantinou et al 2011). Monilinia spp., one of the prevalent fruit rot pathogens according 

to literature was not determined in this study. Nevertheless, Neofabraea spp. considered as 

a minor pathogen in previously mentioned studies, was determined as one of the major 

pathogens in our study, accounting for 24,1% average of the diseased fruit. Other fungal 

genera Colletotrichum, Botryosphaeria, Alternaria and Fusarium were determined at lower 

frequencies. 

Increase of yield and economic loss during storage was evident in the study. One of 

factors that contributed to such increase might be storage conditions in ULO chambers. 

Since cv. Cripps Pink is a newer apple variety grown in Croatia, ULO conditions that suit 

best for long time storage should be established. The other reason might be appearance of 

Neofabraea spp. in higher frequencies after five months of storage, since storage conditions 

prolong beginning of rotting caused by this fungus (Snowdon, 1990). Therefore, 

susceptibility of Cripps Pink variety to Neofabraea spp. should be evaluated. 

Results of this study emphasised importance of postharvest diseases and need for 

further development of management strategies considering pathogens, cultivar 

susceptibility, storage conditions etc., aiming to reduce losses of apple fruit during storage.

316 Losses of apple fruit (cv. Cripps pink) caused by.... 

REFERENCES 

Anderson, W.H. (1956): Diseases of Fruit Crops. New York-Toronto-London. 

Crous, P.W., Verkley, G.J.M., Groenewald, J.Z., Samson, R.A. (2009): CBS Laboratory Manual 

Series. Fungal Biodiversity. CBS-KNAW Fungal Biodiversity Centre. Utrecht. The 

Netherlands. 

Ivić, D., Cvjetković, B., Sever, Z. (2009): Procjena šteta od bolesti jabuke nakon berbe. Glasilo 

biljne zaštite, 1/2: 44-45. 

Ivić, D., Cvjetković, B., Miličević, T. (2006): Dinamika i intenzitet razvoja bolesti na jabuci 

tijekom skladištenja. Poljoprivreda, 12 (2): 36-41. 

Jijakli, M.H., and Lepoivre, P. (2004): State of the art and challenges of post-harvest disease 

management in apples. Fruit and vegetable diseases, Volume 1. K.G. Mukerji, ed. 

Kluwer Academic Publishers. Dordrecht. The Netherlands, pp. 59-94. 

Konstantinou, S., Karaoglanidis, G.S., Bardas, G.A., Minas, I.S., Doukas, E., Markoglou, A.N. 

(2011): Postharvest Fruit Rots of Apple in Greece: Pathogen Incidence and Relationships 

between Fruit Quality Parameters, Cultivar Susceptibility, and Patulin Production. Plant 

Disease 95: 666-672. 

Rosenberger, D.A. (1997): Recent research and changing options for controlling postharvest 

decays of apples. Proc. Harvesting, Handling and Storage Workshop. Northeast Reg. 

Agric. Eng. Serv. Publ. NRAES-112. Cornell University, Ithaca, NY. 

Snowdon, A.L.(1990): Pome fruits. In A Colour Atlas of Post-harvest Diseases and Disorders of 

Fruits & Vegetables. Volume 1: General Introduction & Fruits. Wolfe Scientific Ltd, 

London, England, pp. 170-218. 

Trkulja, V.(2008): Zaštita uskladištenog voća od bolesti. In Kljajić P (ed), Zaštita uskladištenih 

biljnih proizvoda od štetnih organizama. Institut za pesticide i zaštitu životne sredine, 

Beograd, Republika Srbija, pp. 193-213.

Mira Milinkovic, Danka Radic, Blazo Lalevic,... 317 

International Symposium: Current Trends in Plant Protection UDK: 631.879.4 

Proceedings 

INFLUENCE OF COMPOST TEA ON INHIBITION OF GROWTH 

OF PHYTOPATOGENIC FUNGI FUSARIUM OXYSPORUM AND 

RHIZOCTONIA SP. 

MIRA MILINKOVIĆ 1 , DANKA RADIĆ 2 , BLAZO LALEVIĆ 3 , VESNA GOLUBOVIĆ ĆURGUZ 4 , 

LJUBINKO JOVANOVIĆ 5 , IVANA SPASOJEVIĆ 3 , VERA RAIČEVIĆ 3 

1 Fruit research institute, Kralja Petra I no. 9, 32000 Cacak, Serbia 

2 Institute for development of water resources «Jaroslav Cerni», Jaroslava Cernog 80, 11226 


3 University of Belgrade, Faculty of Agriculture, Nemanjina 6, 11080 Belgrade-Zemun, Serbia 

4 University of Belgrade, Faculty of Forestry, Kneza Viseslava 1, 11000 Belgrade, Serbia 

5 Educons University, Vojvode Putnika 87, 21208 Sremska Kamenica, Serbia 

This research aims to examine the potential of different compost teas as biocontroling agents. 

The teas are deriving primerily from composting process, and then from aerated and non-aerated 

treatments. Inhibition percentage of phytopathogenic fungi growth, Fusarium oxysporum and 

Rhizoctonia sp. has been tested in laboratory conditions as the effect of these agents. The effect of 

examined teas has given different growth inhibition levels of the phytopathogenic fungi. There is a 

difference in the sensitivity of Fusarium oxysporum and Rhizoctonia sp. to tested types of compost 

teas, with the emphasis of higher inhibition level of Rhizoctonia sp. 

The tobacco waste-derived compost tea has shown to have highest inhibiton effect among all the 

tested compost products. The aerated teas comparing to non-aerated have harboured higher inhibition 

rate of Fusarium oxysporum, while supression in Rhizoctonia sp. growth was the same by both 

compost tea types. 

Key words: Fusarium oxysporum, Rhizoctonia sp., compost tea, inhibition 

INTRODUCTION 

In Europe, legislation on plant protection products has been re-evaluated since 1991 

(Directives 1991/414 and 2009/128), leading to a drastic reduction in the use of chemical 

compounds. Usage of compost and its products can greatly contribute in reducing the 

application of fungicides. In this context the production of these green materials could 

develop into significant field of agricultural biotechnology. The application of compost is 

considered to be biological control measure, representing a complex interaction between 

microorganisms in compost, plant pathogens and plants themselves (Aviles et al., 2011). 

Growing researches on this subject are not refering to compost only as the final product in 

recycling organic waste, but they manifest about its usefulness in getting other reusable 

products. Compost extracts or so called compost teas are liquid compost extracts, deriving

318 Influence of compost tea on inhibition of growth of .... 

from continuous mixing of compost and water during certain period of time (Ingham, 

2002). 

There are two different groups of methods used in production of compost teas 

deppending on the applied aeration system: with and without aeration. Application of 

compost teas provides nutrients and organic matter to soils, but numerous up to date 

experiments manifest about the inhibition effect of compost teas to Botrytis-a, Fusarium 

oxysporum, Rhizoctonia sp and other phytopathogenic fungi (Litterick et al., 2004; 

Kavroulakis et al., 2010, Aviles et al., 2011). 

This research is aiming to examine the inhibition rate of phytopathogenic fungi 

Fusarium oxysporum and Rhizoctonia sp by using aerated and non-aerated teas. Compost 

teas are deriving from biodegradible municipial waste derived compost, green wastederived 

compost (grass, leaves, tree branches), and tobacco waste-derived compost. 


The green waste-derived compost (GW) was made from source-separated municipal 

shredded green waste (mainly grass and hedge) obtained from the town of Cacak, Serbia. 

The municipal solid waste-derived compost (MSW) was made from biodegradable 

municipal waste, also obtained from Cacak town. Tobacco tea was obtained from tobacco 

waste-derived compost. 

Preparation of compost teas (not aerated) :The compost was put through a sieve 

(7mm diameter holes) in cotton bag and than fully saturated with water. After five hours the 

mass was squeezed (hand grape press) and leachate was collected in separate vials. 

Preparation of compost teas (aerated): Compost and tap water were mixed in the ratio of 1:3 

(w/v), in polyethylene non-degradable containers with covers. The mixtures were supplied 

with aeration by using an aquarium pump and left at ambient temperature for 10 days prior 

to filtering through cheesecloth. 

Phytopathogenic fungi are part of the collection of Institute of plant protection at 

Faculty of Agriculture from Belgrade. 

The inhibiton percentage was calculated by following formula: 

where: 

R1 - Radial mycelial growth in control, 

R2 - Radial mycelial growth in treatment. 

R1 - R2 * 100 

R1 

RESULTS 

The inhibition percentage of phytopathogenic fungi Fusarium oxysporum ranges 

from 26.4 to 36.4% in the tretment with aerated teas, while non-aerated teas proven range 

from 16.4 to 31.4% (fig.1.). Tobacco tea has shown to provide the highest inhibition rate. 

The inhibition percentage of phytopathogenic fungi Rhizoctonia sp.ranged from 78 

to 100% in the tretment with aerated teas, while non-aerated teas shown percentage range 

from 77 to 100%. This treatment showed that the aeration did not influence the inhibition

Mira Milinkovic, Danka Radic, Blazo Lalevic,... 319 

rate of this fungi. In contrast to the mentioned treatment, tobacco tea (both aerated and nonaerated) 

has completely inhibited the growth of Rhizoctonie sp. (fig.1). 

Fusarium oxysporum 

% 

40 

35 

30 

25 

20 

15 

10 

5 

0 

aerated 

not aerated 

MCW-tea GW-tea Nicotin-tea 

Rhizoctonia 

120 

100 

aerated 

not aerated 

80 

60 

% 

40 

20 

0 

MCW-tea GW-tea Nicotin-tea 

Fig.1. The inhibition percentage of Fusarium oxysporum i Rhizoctonia sp. 

under the influence of aerated and non-aerated compost teas 

DISCUSSION 

The results of this research have proven the inhibition influence of compost teas to 

the growth of Fusarium oxysporum and Rhizoctonia sp. The inhibition rate depends on the 

type of fungi, as well as the compost tea type. Non sterilized compost teas contain various 

microbial populations and microbial content is dependant upon chemical characteristics of 

meterial used for compost preparation (Castano et al., 2011). 

There are two kinds of suppressive potential (general and specific) according to the 

spectrum of microorganisms involved in this phenomenom (Aviles et al., 2011). Results 

from Sand and Kim (2011) have pointed out that root application of liquid compost extract 

induces systematic resistance to plant pathogens. 

The presented results of this research show that waste materials can reach their 

significance in application as biocontroling agents. The inhibition mechanisms have 

proven to be very different, indicating the need for further investigations.

320 Influence of compost tea on inhibition of growth of .... 

REFERENCES 

Sang M. K., Kim, K.D. (2011): Biocontrol activity and primed systemic resistance by compost 

water extract against anthracnoses of peper and cucumber. Phytopatology, 101: 732-740. 

Ingham, E. R. (2002): The compost tea brewing manual, 3rd edn. Soil Foodweb Incorporated, 

Corvallis, Oregon, USA. 

Aviles, M., Borrero, C., Trillas M. I. (2011): Review on compost as an inducer of desease 

suppression in plants grown in soilless culture. Dynamic Soil, dynamic plant, 5: 1-11. 

Kavroulakis, N., Ehaliotis, C., Ntougias, S., Zervakis, G. I., Papadopoulou, K. K. (2010): 

Antagonistic bacteria of composted agro-industrial residues exhibit antibiosis against 

soil-borne fungal plant pathogens and protection of tomato plants from Fusarium 

oxysporum f.sp. radicis-lycopersici. Plant and soil, 333: 233-247. 

Castano, R., Borrero, C., Aviles, M. (2011): Organic matter fractions by SP-MAS 13 C NMR and 

microbial communities involved in the suppression of Fusarium wilt in organic growth 

media. Biological control, 58: 286-293. 

Litterick, A. M., Harrier, L., Wallace, P. Watson, C. A., Wood, M. (2004): The role of 

uncomposted materials, composts, manures, and compost extracts in reducing pest and 

disease incidence and severity in sustainable temperate agricultural and horticultural crop 

production - a review. Critical Reviews in Plant Sciences, 23(6): 453-479.

Jelena Jovicic Petrovic, Vera Raicevic, Branislava Sivcev,... 321 


Proceedings 

FUNGAL ISOLATES FROM AGROINDUSTRIAL WASTE AS 

POTENTIAL BIOCONTROL AGENTS 

JELENA JOVIČIĆ PETROVIĆ 1 , VERA RAIČEVIĆ 1 , BRANISLAVA SIVČEV 1 , 

DRAGAN KIKOVIĆ 2 , IGOR KLJUJEV 1 

1 University of Belgrade, Faculty of agriculture, Nemanjina 6, 11080 Belgrade-Zemun, Serbia 

2 

Faculty of natural sciences, Lole Ribara 29, 38220 Kosovska Mitrovica, Serbia 

The management of agricultural waste is very important to achieve sustainable food 

production. Using compost obtained from agricultural waste is important not only for reducing 

environmental production, but has also shown same effect on number and diversity of 

microorganisms in soil, and suppression of soil born plant diseases. The aim of this work was 

isolation of fungi form agroindustrial waste, and screening for the isolates with antagonistic effect on 

Rhizoctonia spp., Botrytis cinerea, Fusarium oxysporum and Pythium spp., in vitro. In vitro 

antagonism was observed by method of paired cultures. The results indicate that six isolates from rape 

(residue from grape wine production) and compost made of sop from plum brandy production show 

some antagonistic properties against at least one of the investigated phytopathogenic fungi. The 

results indicate that there is biological potential of agroindustrial waste for suppression of some 

pathogen fungi. 

Key words: agroindustrial waste, biocontrol agents, antagonism, fungi 

INTRODUCTION 

The agricultural industry is responsible for the production of large volumes of 

residual by-products. It is apparent that new methods of utilizing agro-residues are needed 

in order to achieve sustainable management of agricultural waste. 

Agro-waste management is aimed at minimizing waste production, reducing 

environmental pollution and enhancing the recycling capacity of substrates (Cebar, 2006). 

Benefits of compost as organic substrate additives in plant cultivation and suppression of 

soil borne diseases have been extensively reviewed by several authors (Hoitink et al., 2001; 

Noble and Coventry, 2005). Adding compost to soil improves the physical and chemical 

properties of soil and increases the number and diversity of bacteria and fungi in soil 

(Stoffella and Kahn, 2001). Some of those fungal and bacterial species have been 

recognized as natural antagonists of fungi that cause plant diseases. Also, the development 

of fungi for the biocontrol of plant diseases has received a significant amount of interest in 

recent years. Penicillium spp., Aspergillus spp., Trichoderma spp., Gliocladium virens, and 

other fungi have been identified as biocontrol agents in compost-amended substrates 

(Carisse et al., 2003; Suárez-Estrella et al., 2007; Haggag and Abo-Sedera, 2005).

322 Fungal isolates from agroindustrial waste as potential biocontrol agents 

The aim of this work was isolation of fungi form agroindustrial waste, and screening 

for isolates with some antagonistic effect on Rhizoctonia spp., Bortitys cinerea, Fusarium 

oxysporum and Pythium spp., in in vitro conditions. 


Morphologically different fungi were isolated form: rape – residue from grape wine 

production, compost made of sop from plum brandy production, and waste from tobacco 

industry – tobacco dust and waste leaves. Isolation was performed using serial dilution 

method on Rose-Bengal selective medium with streptomycin (Peper et al., 1995). Colonies 

with different morphological properties were isolated and stored on Potato dextrose agar 

(PDA) at 4ºC. 

Phytopathogenic fungi that were included in the assay are: Rhizoctonia spp., Botrytis 

cinerea, Fusarium oxysporum (part of collection of Institute for Phytomedicine, Faculty of 

Agriculture, Belgrade) and Pythium spp. (from collection of Institute for Pesticides and 

Environmental Protection, Belgrade). 

In vitro essays were accomplished through the method of paired cultures. The 

cultures of each isolate and each test pathogen were cultivated at 25±1ºC for 5-7 days. For 

each isolate – phytopathogen combination, 5-mm-diameter agar disk were cut from the 

edge of actively growing colonies of investigated isolate and plated on one side of a PDA 

plate and 5-mm-diameter agar disk of the test pathogen on the other side of the same plate. 

Each combination had three replications. Plates were incubated at 25±1ºC. Zones of 

inhibition, appearance of pigments, density and diameter of test pathogen colony were 

observed after 5-7 days, depending on growth rate of investigated pathogen. Appearance of 

the test pathogen colony was compared with the colony of the same pathogen that was 

grown in pure culture on PDA plate. 

Fungi were identified conventionally according to their macroscopic and microscopic 

features observed on tree different media: Malt agar, Czapek agar and Sabouraud agar 

(Samson, 2000). 

RESULTS 

Morphologically different colonies of fungi were isolated and 33 different isolates 

were obtained. Only three dominant isolates were obtained from rape – residue from grape 

wine production, 14 from compost made of sop from plum brandy production and 16 from 

tobacco waste. 

Dual test results indicated that 27 of the isolates do not show any antagonistic 

properties against soil phytopathogenic fungi. Six of the isolates induced some changes in 

growth of the tested fungi, including isolates: G1, G2, G3, 19/5, 10/5 and A/5. Isolates G1, 

G2 and G3 originate form grape, while isolates 19/5, 10/5 and A/5 from sop from plum 

brandy production. 

Some of the antagonistic properties that were noticed are: zone of growth inhibition 

(in combinations: G1 with Pythium spp., Fusarium oxysporum and Rhizoctonia spp.; G2 

with Pythium spp.; G3 and 10/5 with Bortytis cinerea), appearance of pigment that the 

phytopathogen or the isolate didn’t produce in pure culture (in combinations: A/5 with 

Botrytis cinerea and G2 and G3 with Fusarium oxysporum) and reduction in density and 

diameter of the mycelia of phytopathogenic fungi in comparison to pure culture on the 

same media (19/5 and 10/5 with all of the pathogens). (Tab1.)

Jelena Jovicic Petrovic, Vera Raicevic, Branislava Sivcev,... 323 

None of the isolates obtained from tobacco waste showed antagonistic effect. 

Table 1: Morphological changes of colonies of phytopathogenic fungi in dual test 

Rhizoctonia spp. 

Botrytis cinerea 

Fusarium 

oxysporum 

Pythium spp. 

G1 

Zones of growth 

inhibition (3-4mm) 

Reduced diameter of 

mycelia 

- 


inhibition (5-8mm) 

G2 

Reduced density of 

mycelia 

G3 - 


mycelia 


inhibition (5mm) 

Reduced diameter 

and brighter color 

of mycelia 


and brighter color 

of mycelia 

19/5 - - - 

10/5 

A/5 


and density of 

mycelia 


and density of 

mycelia 


mycelia and zones of 

growth inhibition 

(1mm) 

A/5 produces yellow 

pigment in contact 

with B. cinerea 


of mycelia 

- 



Zone of reduced 

density of mycelia 

(15mm) 


mycelia 


mycelia 



The analysis of macromorphological and micromorphological properties of six 

isolates led to the identification at the species level that should be confirmed by molecular 

methods in further investigations: 

Isolate G1 – Penicillium paneum 

Isolate G2 – Penicillium chrysogenum 

Isolate G3 – Aspergillus fumigatus 

Isolate 19/5 – Rhizopus oryzae 

Isolate 10/5 – Trichoderma longibrachiatum 

Isolate A/5 – Aspergillus niger 

DISCUSSION 

The composition of microorganisms in compost is affected by the chemistry of 

materials from which the compost is prepared (Castaño et al., 2011). It was concluded by 

several authors that composts with high lignocellulosic substances are mostly colonized by 

Trichoderma spp. In contrast, grape pomace, with low cellulosic substances and high 

sugars, becomes colonized by Penicillium spp. and Aspergillus spp. (Kutter et al., 1983, 

Gorodecki and Hadar, 1990). The differences in the composition of fungal communities in 

different agricultural waste are noticed in this work. Three dominant fungal isolates from 

the rape were identified to belong to Penicillium spp. and Aspergilus spp. 

Considering the result that 6 isolates of fungi from investigated agroindustrial waste 

have some antagonistic effect on at least one of the phytopatogenic fungi: F. oxysporum, B. 

cinerea, Rhizoctonia spp. and Pythium spp., it can be concluded that rape from grape wine 

industry and compost form sop from plum brandy production have some biological

324 Fungal isolates from agroindustrial waste as potential biocontrol agents 

potential that could be used in suppression of some plant phytopathogens. Trichoderma 

longibrachiatum 

In the further investigations it is needed to confirm the identification results by 

molecular methods. Further in vitro investigations that are planned are directed towards 

understanding the mechanism of antagonistic effect of the isolates. 

REFERENCES 

Carisse, O., Bernier, J., Benhamou., N (2003): Selection of biological agents from composts for 

control of damping-off of cucumber caused by Pythium ultimum, Canadian Journal of 

Plant Pathology, 25 (3) 

Castaño R., Borrero C., Avilés M. (2011): Organic mater fractions by SP-MAS 13 C NMR and 

microbial comunities ivnolved in the suppression of Fusarium wilt in organic growth 

media, Biological Control, 58: 286-293. 

Cebar Info Sheet (2006): Management of Agricultural Waste, Series 1 No. 2 April 2006. 

Gorodecki B, Hadar Y. (1990): Suppression of Rhizoctonia solani and Sclerotium rolfsii in 

container media containing composted separated cattle manure and composted grape 

marc, Crop Protection, 9: 271-274. 

Haggag, WM., Abo-Sedera, SA. (2005): Characteristics of Three Trichoderma Species in 

Peanut Haulms Compost Involved in Biocontrol of Cumin Wilt Disease, International 

Journal of Agriculture and Biology, Vol.7 

Hoitink H. A. J., Krause M.S., Han D.Y. (2001): Spectrum and mechanisms of plant disease 

control with composts. 

Kuter G. A. , Nelson E. B. , Hoitink H.A. J, Madden L.V. (1983): Fungal populations in 

container media amended with composted hardwood bark suppressive and conductive to 

Rhizoctonia damping-off, Phytopatology 73: 1450-1456. 

Noble R., Coventry E. (2005): Suppression of soil-borne plant diseases with composts: a review. 

Biocontrol Sci Techn 15: 3-20. 

Peper I. L., Gerba C. P., Brendencke J. W. (1995): Environmental Microbiology. Acad. Press, 

San Diego, p 11-33. 

Samson R. A., Hoekstrs, E. S., Frisvad, J. C. (2000): Introduction to food- and airborne fungi, 

Centraalbureau voor Schimmelcultures, Utrecht, Netherlands 

Stoffella P.J., B.A. Kahn (eds.) (2001): Compost utilization in horticultural cropping systems. 

Lewis Publ., Boca Raton, Fla. 

Suárez-Estrella F., Vargas-García C., López M. J., Capel C. (2007): Antagonistic activity of 

bacteria and fungi from horticultural compost against Fusarium oxysporum f. sp. 

melonis, Crop protection, 26: 46-53.

Svetlana Živković, Saša Stojanović, Tatjana Popović,... 325 


Proceedings 

ANTAGONISTIC POTENTIAL OF TRICHODERMA HARZIANUM 

AGAINST POSTHARVEST FUNGAL PATHOGENS 

SVETLANA ŽIVKOVIĆ, SAŠA STOJANOVIĆ, TATJANA POPOVIĆ, VIOLETA ORO, 

ŽARKO IVANOVIĆ, NENAD TRKULJA 



The antagonistic potential of Trichoderma harzianum was tested in vitro, againts some 

common postharvest fungal pathogens: Alternaria alternata, Aspergillus flavus, Botrytis cinerea, 

Colletotrichum acutatum, C. gloeosporioides, Mucor sp., and Penicillium expansum. Results from 

dual culture assay showed that T. harzianum inhibited the mycelial growth of all tested pathogens 

with a high PGI value (51% - 72%). Microscopic examination revealed that antagonist caused a wide 

spectrum of mycelial malformation: abnormal stunted, highly branched hyphal tips, swollen hyphae 

and the vacuolar appearance of the mycelium of pathogenic fungi. The results of this study identify T. 

harzianum as promising biological control agent for further testing against postharvest diseases on 

fruits. 

Key words: Trichoderma harzianum, antagonistic activity, postharvest fungal pathogens. 

INTRODUCTION 

Postharvest decay is a serious problem in the storage of many fresh fruits and 

vegetables (Moss, 2008). Introduction of non-chemical control methods to reduce 

postharvest decay is becoming increasingly important. Consumers are demanding less 

chemical residue on produce, and many fungi are developing resistance to commonly used 

fungicides (Conway et al., 2004). Moreover, the use of chemical fungicides is becoming 

more restricted due to environmental and health concerns (Janisiewicz and Korsten, 2002). 

It is therefore necessary to develop alternatives to synthetic fungicide to reduce 

environmental risks and raise consumer confidence. 

Biological control of plant pathogens by microorganisms has been considered a 

more natural and environmentally acceptable alternative to the existing chemical treatment 

methods. Trichoderma harizanum, T. viridae, T. virens, T. hamatum, T. roseum and T. 

koningii are the most common fungal biological control agents (BCAs) that have been 

comprehensively researched and deployed throughout the world. Major mechanisms 

involved in the biocontrol activity of Trichoderma spp. were competition for space and 

nutrients, production of diffusible and/or volatile antibiotics, and hydrolytic enzymes like 

chitinase and β-1,3-glucanase (Ramesh Sundar et al., 1995; Howell, 2003). The first BCA 

to be commercialized and registered was T. harzianum. This antagonist has a wide 

spectrum of antimicrobial activity against some economically important plant pathogens

326 Antagonistic potential of Trichoderma harzianum against,... 

from different genera, such as Alternaria, Aspergillus, Botrytis, Colletotrichum, 

Diaporthae, Fusarium, Monilinia, Phytophthora, Phythium, Rhizoctonia, Sclerotinia, and 

Verticillium (Balaž et al., 2000; Begum et al., 2008; Hajieghrari et al., 2008; Imitiaj and 

Lee, 2008; Živković et al, 2010). 

The objective of the present study was to evaluate the inhibitory role of T. 

harzianum in the biological control of some postharvest fungal pathogens. 


Pathogens and antagonist 

The monoconidial isolates of postharvest fungal pathogens were isolated from 

various decayed fruits (Table 1.). Stock cultures of each isolate were maintained on potato 

dextrose agar (PDA) at 4°C. Working cultures were established by transferring a stock agar 

plug containing mycelium of each isolate onto PDA in Petri plates and incubating for 7 

days in darkness at 25°C. 

Antagonistic microorganism T. harzianum (DSM 63059), employed for in vitro 

antimicrobial assay was obtained from German Collection of Microorganisms and Cell 

Cultures (DSMZ). 

Table 1. Postharvest fungal pathogens used to test the antagonistic activity of T. harzianum. 

Isolate code Species Host 

AAJ- 2 Alternaria alternata apple 

ASL-2 Aspergillus flavus lemon 

BCJ-1 Botrytis cinerea strawberry 

CAJ- 20 Colletotrichum acutatum apple 

CGP- 9 C. gloeosporioides sour cherry 

MUP- 1 Mucor sp. pear 

PEL- 4 Penicillium expansum lemon 

Antagonistic activity in vitro 

The assay for antagonism was performed on PDA in Petri plates by dual culture 

method. Mycelial plugs (5 mm diameter) of pathogens and antagonist were placed in the 

same plate 6 cm from each other. Paired cultures were incubated at 25ºC. Plates inoculated 

only with test pathogens served as controls. The experiment was repeated twice with three 

replications of each treatment. Percent growth inhibition (PGI) was calculated using the 

formula: PGI (%) = R-R1/R x 100, where R represents the distance (measured in mm) from 

the point of inoculation to the colony margin in control plates, and R1 the distance of fungal 

growth from the point of inoculation to the colony margin in treated plates in the direction 

of the antagonist (Korsten and De Jager, 1995). 

T. harzianum was tested for both antibiosis and mycoparasitic activities against 

isolates of postharvest pathogens. Edges of parasitized pathogen hyphae by microbial 

antagonists were transferred from dual culture plate onto clean slides after 14 days of 

incubation. Cover slips were mounted on the mycelia with a drop of lactophenol cotton blue 

(LCB). Hyphal interaction and morphology were examined under a light microscope. 


The mycelial growth inhibition of postharvest fungi was subjected to analysis of 

variance (ANOVA). Statistical significance was assessed at the level p


RESULTS 

Antagonistic activity in vitro 

Results from dual culture assay showed that T. harzianum inhibited mycelial growth 

of all tested postharvest fungal pathogens, however with varying efficiencies (Figure 1. and 

Figure 2.). T. harzianum significantly exhibited the strong antagonism against isolates of B. 

cinerea, Mucor sp., and P. expansum with a high PGI value (72%, 64%, and 63% 

respectively). Also, this antagonist had moderate antifungal effect in vitro on A. alternata 

(59%), C. gloeosporioides (52%), and C. acutatum (51%). 

Figure 1. Antagonistic activity of T. harzianum against: (a) A. alternata; (b) A. flavus; (c) C. 

acutatum; (d) P. expansum; (e) B. cinerea; and (f) mycelial degradation of B. cinerea in dual 

culture assay with T. harzianum (back side); K – control plate without antagonist. 

Figure 2. Percent growth inhibition of postharvest fungal pathogens by T. harzianum. 

* The values with the same letter are not statistically different by Duncan’s multiple range test (p< 0.05).


Microscopic examination of dual culture assay showed alternation of the mycelium 

of pathogen where it was in contact with antagonist. Mycoparasitism of T. harzianum was 

observed as coiling, penetration, degradation of the fungal cell wall, and direct contact and 

parallel growth alongside host hyphae of A. alternata, A. flavus, B. cinerea, C. acutatum, C. 

gloeosporioides and Mucor sp. (Figure 3b). Also, T. harzianum induced abnormal stunted, 

highly branched hyphal tips, swollen hyphae and the vacuolar appearance of the mycelium 

of all tested fungal pathogens (Figure 3a). A very weak inhibition zone (1mm) was showed 

only between T. harzianum and isolate of P. expansum. The mycelial malformation 

observed was probably due to the toxic effect of antibiotic substances interfering with 

normal growth processes. 

Figure 3. (a) Swollen hyphae and vacuolar appearance of the mycelium of A. alternata; (b) 

degradation of the fungal cell wall of A. flavus in dual culture assay with T. harzianum 

(light microscope, 600x). 

DISCUSSION 

In this work, the results of dual culture revealed the rapid colonization of the 

medium by T. harzianum. This antagonist was effective in controlling colony growth of all 

tested postharvest fungi. Its rapid growth gives Trichoderma an importnat advantage in the 

competition for space and nutriens with plant pathogenic fungi, even before it deploys its 

arsenal of mycotoxin (Barbosa et al., 2001). Toxic action was evident in varius alternation 

of the hyphal structure of postharvest pathogens growth together with T. harzianum, similar 

to the effects described in other systems of mixed cultures (Aryantha and Guest, 2006). The 

species of Trichoderma are known to produce a number of antibiotics, such as 

trichodermin, trichodermol, trichotoxin, harzianum A and harzianolide (Dennis and 

Webster, 1971). These compounds were responsible for most inhibitions of postharvest 

fungi in this study, and observed in other experiments involving biocontrol of fungal 

phytopathogens (Zazzerini and Tosi, 1985). Direct mycoparasitic activity of fungi from 

genus Trichoderma has been proposed as one of the mechanisms involved in their 

antagonistic activity. Trichoderma spp. attach to the host hyphae by coiling, hooks or 

appresorium like structures (Elad et al., 1983). Most of the interactions among isolates of 

pathogens and the antagonist T. harzianum observed in this study involved coiling and 

parallel growth. Rahman et al. (2007) also found that the Trichoderma isolates coiled 

around hyphae of Sclerotinia rolfsii. They produced appressorium like structures which


aided in the penetration of the host cell wall (Begum et al., 2008). A similar observation 

was reported on parasitized hyphae of S. rolfsii and Botryodiplodia theobromae by T. 

harzianum (Gupta et al., 1995: Widyastuti et al., 2003), and Rhizoctonia solani by T. virens 

(Howell, 2003). In this study subsequent degradation of the fungal cell wall might be due to 

the actions of different lytic enzymes. Secreted enzymes mainly chitinase, β-1,3 glucanase 

and β-1,3 glucosidase were reported to be responsible for the degradation of the host cell 

wall by T. harzianum and T. virens. These hydrolytic enzymes partially degrade the 

pathogen cell wall and lead to its parasitization (Kubicek et al., 2001). 

The expression of antagonistic activity by a microorganism towards a pathogen in 

culture medium cannot generally be taken as evidence of control in situ. However, our 

results show that T. harzianum (DSM 63059) have a wide spectrum of antimicrobial 

activity, and might be used as BCA against various postharvest fungal pathogens. 




REFERENCES 

Aryantha, P.G., and Guest, I.D. (2006): Mycoparasitic and antagonistic inhibition on 

Phytophthora cinnamomi Rands by microbial agents isolated from manure composts. 

Plant Pathology Journal, 5: 291-298. 

Balaž, J., Stojšin, V., Bagi, F. (2000): Mogućnost suzbijanja truleži plodova jabuke (Monilinia 

spp.) antagonistima iz roda Trichoderma. Eko-konferencija, Ekološki pokret grada 

Novog Sada: 43-48. 

Barbosa, M.A., Rehn, G.K., Menezes, M., Mariano, L.R. (2001): Antagonism of Trichoderma 

species on Cladosporium herbarum and their enzimatic characterization. Braz. J. of 

Microbiol. 32: 98-104. 

Begum, M.M., Sariah, M., Abidin, Z.M.A., Puteh, B.A., Rahman, A.M. (2008): Antagonistic 

potential of selected fungal and bacterial biocontrol agents againts Colletotrichum 

truncatum of soybean seeds. Pertanica J. Trop. Agric. Sci., 31: 45-53. 

Conway, W.S., B. Leverentz, W.J. Janisiewicz, A.B. Blodgett, R.A. Saftner, Camp, M.J. (2004): 

Integrating heat treatment, biocontrol and sodium bicarbonate to reduce postharvest 

decay of apple caused by Colletotrichum acutatum and Penicillium expansum. 

Postharvest Biol. Technol., 34: 11–20 

Dennis, C., and Webster, J. (1971): Antagonistic properties of species-groups of Trichoderma. 

Hyphal interaction. Trans. Br. Mycol. Soc. 57: 363-369. 

Elad, Y., Cher, I., Boyle, P., Henis, Y. (1983): Parasitism of Trichoderma spp. on Rhizoctonia 

solani and Sclerotinium rolfsii – scaning electron microscopy and fluorescence 

microscopy. Phytopathology, 73: 85-88. 

Gupta, V.P., Govindaiah, A.K.B., Datta, R.K. (1995): Antagonistic potential of Trichoderma 

and Gliocladium species to Bothryodiplodia theobromae infecting mulberry. Indian J. 

Mycol. and Pl. Pathol. 25: 125. 

Hajieghrari, B., Giglou-Torabi, M., Mohammadi, R.M., Davari, M. (2008): Biological potential 

of some Iranian Trichoderma isolates in the control of soil borne plant pathogenic fungi. 

Afr. J. Biotechnol., 8: 967-972. 

Howell, C.R. (2003): Mechanisms employed by Trichoderma species for the biological control 

of plant diseases: the history and evolution of current concepts. Plant Dis., 87: 1-10.


Imtiaj, A., and Lee, S.T. (2008): Antagonistic effect of three Trichoderma species on the 

Alternaria porri pathogen of onion blotch. World J. Agric. Sci., 4: 13-17. 

Janisiewicz W.J., and Korsten, L. (2002): Biocontrol of post harvest diseases of fruits. Annu. 

Rev. Phytopathol., 40: 411-441. 

Korsten, L., and De Jager, E.S. (1995): Mode of action of Bacillus subtilis for control of 

avocado postharvest pathogens. S. Afr. Avocado Growers Assoc. Yearb, 18: 124-130. 

Kubicek, C. P., Mach, R. L., Peterbauer, C. K., Lorito, M. (2001): Trichoderma: From genes to 

biocontrol. J. Plant Pathol., 83:11-23. 

Moss, M.O. (2008): Fungi, quality and safety issues in fresh fruits and vegetables. Journal of 

Applied Microbiology, 104: 1239-1243. 

Rahman, M.A., Kadir, J., Mahmud, T.M.M., Rahman, R.A., Begum, M.M. (2007): Screening of 

antagonistic bacteria for biocontrol activities on Colletotrichum gloeosporioides in 

papaya. Asian J. Plant Sci. 6: 12-20. 

Ramesh Sundar, A., Das, N.D., Krishnaveni (1995): In vitro antagonism of Trichoderma spp. 

against two fungal pathogens of caster. Indian J. Plant Prot., 23: 152-155. 

Widyastuti, S.M., Harjono, Sumardi and Yuniarti, D. (2003): Biological control of Scleorotium 

rolfsii damping-off of tropical pine (Pinus merkusii) with three isolates of Trichoderma 

spp. Online Journal of Biological Sciences, 3: 95-102. 

Zazzerini, A., and Tosi, L. (1985): Antagonistic activity of fungi isolated from sclerotia of 

Sclerotinia sclerotiorum. Plant Pathology, 34: 415-421. 

Živković, S., Stojanović, S., Ivanović, Ž., Gavrilović, V., Popović, T., Balaž, J. (2010): 

Screening of antagonistic activity of microorganisms against Colletotrichum acutatum 

and Colletotrichum gloeosporioides. Archives of Biological Sciences, 62 (3): 611-623.

Žarko Ivanović, Tanja Popović, Svetlana Živković,... 331 


Proceedings 634-23 

CHARACTERIZATION OF PSEUDOMONAS SYRINGAE STRAINS 

BY ERIC PCR GENOMIC FINGERPRINTING 

ŽARKO IVANOVIĆ, TANJA POPOVIĆ, SVETLANA ŽIVKOVIĆ, VIOLETA ORO, NENAD TRKULJA, 

MILOŠ STEVANOVIĆ, VELJKO GAVRILOVIĆ 

Institute for Plant Protection and Environment, Belgrade 

Pseudomonas syringae was associated with a number of strains that parasites the stone fruit 

trees in Serbia. P. syringae causes the blossom blast, shoot blight, bud necrosis, branch decay and 

dying of whole trees. Detection of differences among Pseudomonas syringae strains was successfully 

performed using ERIC-PCR method. This kind of characterization was for the first time used to 

discriminate P. syringae isolates originating from fruit trees in Serbia. 

Key words: Pseudomonas syringae, ERIC-PCR, fruits 

INTRODUCTION 

The most widespread and economically important plant pathogen Pseudomonas 

syringae is found on numerous hosts including fruit trees, field crops, vegetables and 

decorative plants. P. syringae causes the blossom blast, shoot blight, bud necrosis, 

branchies decay and dying of whole trees. Identification of the bacterium is accurate using 

the pathogenicity test and biochemical characteristics. The pathogen has the ability to kill 

both young and older trees. Endophytic P. syringae populations can be established through 

leaf scar infection in autumn, which can lead directly to canker formation or to internal 

migration and colonization of dormant buds (Renick et al., 2008). Colonized buds can 

remain symptomless overwinter or can be killed by the pathogen, leading to the systemic 

invasion of shoots followed by leaf or blossom infection. Leaf surface populations, which 

typically are reduced during summer months, increase in autumn and enable pathogen 

colonization of leaf scars (Renick et al., 2008). Populations that overwinter in dormant buds 

then provide the primary inoculum for epiphytic blossom colonization the following spring. 

The occurrence of frost injury or exposure to freezing temperatures is important 

predisposition factor in canker development by P. syringae (Renick et al., 2008). To 

estimate possible diversity of P. syringae fruit trees strains, we collected a set of isolates in 

several areas of Serbia. The samples were isolated from infected orchards of raspberry, 

plum, cherry, sour cherry, peach, pear and apple trees. This study was undertaken to 

characterize the genetic diversity of P. syringae strains from a fruit trees, using ERIC-PCR. 

The genomic DNA fingerprinting technique known as repetitive sequence – based 

polymerase chain reaction (rep-PCR) was utilized as a tool to differentiate P. syringae 

strains isolated from the different plant hosts. ERIC DNA primers, were used to generate

332 Characterization of Pseudomonas syringae strains by,... 

genomic fingerprints. The ERIC-PCR – generated patterns of DNA fragments were 

observed after the agarose gel electrophoresis. 

Figure. 1: Agarose gel electrophoresis of as repetitive-sequence – based polymerase chain 

reaction (ERIC-PCR) fingerprint patterns obtained from Pseudomonas syringae. CFBP-1582 

(lane 1), CFBP-2119 (lane 2), P. syringae isolate from plum (lane 3), P. syringae isolate from 

sour cherry (lane 4), P. syringae isolate from cherry (lane 5), P. syringae isolate from pear (lane 

6), P. syringae isolate from apple (lane 7); P. syringae isolate from raspberry (lane 8), P. 

syringae isolate from peach (lane 9) and negative control (lane 10); DNA molecular size marker 

(GeneRuler TM DNA Ladder Mix) (lane 11). 


Bacterial strains 

Pseudomonas syringae were isolated between 2008 and 2010 from pear, peach, 

apple, plum, cherry, sour cherry and raspberry trees, originating from different localities in 

Serbia. As the check strains CFBP 11 (P. syringae pv. syringae), CFBP 1582 (P. syringae 

pv. syringae) and CFBP 2119 (P. syringae pv. morprunorum) from the French collection of 

phytopathogenic bacteria were used in this work. 

Diseased tissues were surface sterilized in 0.5% sodium hypochlorite for 1 min, 

rinsed in sterile water, and ground in a small amount of 0.01 M potassium phosphate buffer 

(PB), and the liquid suspension was spread onto KB. The plates were incubated for 3 days, 

and then fluorescent colonies were counted, purified, and tested for the oxidase reaction, 

the ability to rot potato slices, the presence of arginine dihydrolase, levan production, and 

tobacco hypersensitivity (Lelliott et al., 1966). 


Pathogenic characteristics of the isolates were tested by artificial inoculation of pear, 

and cherry fruit, using the procedure described by Klement (1990). Fruits were surface 

sterilized by dipping for 2 min in 2% of sodium hypochlorite and then rinsed with sterile 

distilled water. Four punctures, 1 mm wide and 3 mm deep, were made on each fruit with a 

sterile needle. Bacterial suspensions were prepared from cells grown on SNA medium for 2


days at 25°C. The bacterial cultures were suspended in sterile distilled water and the 

concentrations were photometrically adjusted with sterile water to a cell density 

corresponding to 1–2 x 10 9 CFU/ml. A 20 µl drop of the bacterial suspension was placed on 

each wound and was allowed to dry. Control fruits were treated with sterile distilled water 

only. After the inoculation, fruits were placed on plastic packaging trays. The cavity trays 

isolate each fruit and prevent contact infections of adjacent fruits. To provide ample 

humidity for disease development, a wet paper towel was placed on empty cavity trays and 

the entire box was placed in a plastic bag. The bags were sealed and the fruits were 

incubated at 20°C. During incubation, the fruits were observed repeatedly and the width of 

necrosis was measured 7 days after inoculation. Each experiment was repeated twice. In 

order to check the hypersensitive reaction (HR), Geranium leaves were inoculated with the 

bacterial suspension of 10 7 cfu/ml (Klement, 1963). 

DNA isolation 

Total genomic DNA was prepared by using a modification of the procedure of 

Ausubel et al. (1992). Cultures were grown in NAS (sucrose nutrient agar) medium for 48 h 

at 25°C. Bacterial cell were rinsed with sterile distillated water and centrifuged at 4000 × g 

for 10 min at 4°C. Pellet was resuspended twice in 0.85% NaCl and once in 0.1 M NaPO 4 

buffer (pH 6.8). Cells were treated with 10% sodium dodecyl sulfate (SDS), and mixed 

with 20 mg of proteinase K per ml at 37°C for 1 h. NaCl was added to a final concentration 

of 5 M, and the DNA was purified using a solution of 10% hexadecyltrimethyl ammonium 

bromide (CTAB) in 1 M NaCl at 65°C for 10 min, followed by phenol-chloroform and 

chloroform extractions. DNA was recovered by isopropanol precipitation, redissolved in 

Tris-EDTA (TE, 10 mM Tris, 1 mM EDTA, pH 8.0), and quantified spectrophotometrically 

at 260 nm. 

Amplification and separation of DNA bands 

Amplification was performed in a total volume of 25 µl containing 67 mM Tris-HCl 

(pH 8.8); 25 mM MgCl 2 ; 125 µM of dATP, dCTP, dGTP, and dTTP each; 2 units of Taq 

DNA polymerase (Fermentas, Lithuania); and 100 pmol of ERIC1R-I and ERIC2 primer. A 

40 ng quantity of genomic DNA or distilled water as a negative control was added to the 

reaction tubes. The primers (Lupski et al., 1992): (ERIC1R [59- 

ATGTAAGCTCCTGGGGATTCAC-39] and ERIC2 [59-AAGTA 

AGTGACTGGGGTGAGCG-39]). The PCR conditions were as previously described (de 

Bruijn, 1992). The PCR protocols with ERIC primers are referred to as ERIC-PCR. 

Amplification of PCR was performed with a Mastercycler personal model (Eppendorf, 

Hamburg, Germany) using the following cycles: one initial cycle at 95°C for 7 min; 35 

cycles of denaturation at 94°C for 1 min; annealing at 40°C for 1 min; and extension at 

65°C for 8 min, with a single final extension cycle at 65°C for 16 min and a final soak at 

4°C. Amplified PCR products were separated by gel electrophoresis on 1% agarose gels in 

0.5 X TAE buffer for 1 h at 5 V/cm, stained with ethidium bromide, and visualized under 

UV illumination. Fingerprints generated from different strains were compared visually. 

RESULTS 

Patogenicity 

The investigated isolates showed significant heterogeneity in pathogenic 

characteristics. All of them cause hypersentivity (HR) on tobacco, but in other respects the

334 Characterization of Pseudomonas syringae strains by,... 

isolates behave differently. The isolates from peach, pear, apple, sour cherry and raspberry 

cause necrosis on inoculated unripe pear and cherry, demonstrating typical characteristics 

of P. syringae pv. syringae. The isolates from necrotic plum and cherry buds, have caused 

necrosis of cherry fruit but without effects on pear, showing characteristic of the P. 

syringae pv. morsprunorum. 

Based on pathogenicity, the investigated isolates could clearly be divided in two 

groups: the first one isolated from peach, pear, apple, sour cherry and raspberry and the 

second one from cherry and plum. 

DNA analysis 

In this study, the P. syringae pv. syringae strains isolated from pear, peach, apple, 

sour cherry and raspberry trees, generated different genetic profiles in ERIC-PCR whereas 

strains of P. syringae pv. morsprunorum isolated from plum and cherry hosts, generated 

similar patterns. This suggests a host specialization of the stone fruit strains within the 

heterogeneous pathovar syringae. Specialization of P. syringae pv. syringae strains toward 

a particular host has been observed in previous studies (Ivanovic et al., 2009). 

The rep-PCR genomic fingerprints generated with the ERIC primer from the 10 

virulent isolates enabled us to distinguish among the different strains of Pseudomonas 

syringae. The fingerprint patterns of Pseudomonas syringae strains are shown in Fig. 1. 

Fingerprint profiles generated with ERIC primer were complex and very different among 

the isolates. The ERIC - PCR yielded 5 to 15 distinct PCR products, ranging in size from 

approximately 100 bp to over 6 kb. Differences among strains were assessed visually on the 

basis of the migration patterns of the PCR products. 

DISCUSSION 

Our research strategy was based on the finding that Pseudomonas syringae was 

associated with a number of strains that parasites the stone fruit trees in Serbia. In the recent 

years, P. syringae causes blossom blast as well as necrosis of branches and trunk of pear 

resulting in dying of whole pear trees; sour cherry trees were affected by spottedness, which 

leaded to necrosis off the the fruits, while in raspberry symptoms manifested as shoot 

blights. Symptoms of sudden dieback buds in peach trees, wilting of young leaves and 

flowers with necrosis of wooden tissue around the bud base, followed by canker formation 

were observed in Serbia (Gavrilović et al., 2009). 

All of bacterial isolates cause hypersentivity (HR) on tobacco and Geranium leaves. 

They showed heterogeneity in pathogenic characteristics, causing necrosis on inoculated 

unripe pear and cherry. 

Concerning their pathogenic characteristics, the investigated strains belong to two 

distinct groups. The first one contains varieties originating from peach, pear, apple, sour 

cherry and raspberry demonstrating typical characteristics of P. syringae pv. syringae. The 

other group comprises isolates from cherry and plum buds, showing characteristics tyical 

for P. syringae pv. morsprunorum. 

Detection of differences among Pseudomonas syringae strains was successfully 

performed using ERIC-PCR method. This kind of characterization was first time used to 

discriminate P. syringae isolates originating from fruit trees in Serbia. Genetic fingerprints 

were determined for strains of P. syringae isolated from peach, pear, apple, plum, sour 

cherry and raspberry. Adoption for a particular host appears to affect the distribution of 

repetitive sequences, resulting in fingerprints unique to specific strains.


Our experiment demonstrates the potential of ERIC-PCR fingerprinting as a diagnostic tool 

in determining the difference among the Pseudomonas syringae strains from various origin. 

ACKNOWLEDGMENTS 


Serbia (Grants No. OI 173026 and TR 31018) 

REFERENCES 

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and K. 

Struhl 1992. Current Protocols in Molecular Biology, Vol. I. Greene Publishing 

Associates and Wiley-Interscience, New York. 

de Bruijn, F. J. 1992. Use of repetitive (repetitive extragenic palindromic and enterobacterial 

repetitive intergeneric consensus) sequences and the polymerase chain reaction to 

fingerprint the genomes of Rhizobium meliloti isolates and other soil bacteria. Appl. 

Environ. Microbiol. 58: 2180-2187. 

Gavrilović, V., Ivanović., Ž., Živković, S., and Milijašević, S. 2009. Characteristics of 

Pseudomonas syringae strains isolated from necrotic peach buds in Serbia, 7th 

Interantional Peach Symposium, June 8–11, 2009 Leida, Spain. Book of Abstracts 

Ivanovic, Z., Zivkovic, S., Starovic, M., Josic, D., Stankovic, S., and Gavrilovic, V. 2009. 

Diversity among Pseudomonas syringae strains originating from fruit trees in Serbia. 

Arch. Biol. Sci. 61 (4): 863-870 

Klement, Z. 1990. Inoculation plant tissues. Cancer and dieback disease, In: Methods in 

Phytobacteriology (Eds. Z. Klement, K. Rudolph, and D. Sands), 105-106. Akademiai 

Kiado, Budapest. 

Klement, Z. 1963. Rapid detection of the pathogenicity of phytopathogenic pseudomonades. 

Nature 199: 299-300. 

Lelliott, R. A., Billing, E., and Hayward, A. C. 1966. A determinative scheme for the fluorescent 

plant pathogenic pseudomonads. J. Appl. Bacteriol. 29: 470–489. 

Lupski, J. R., and Weinstock, G. M. 1992. Short, interspersed repetitive DNA sequences in 

prokaryotic genomes. J. Bacteriol. 174: 4525-4529. 

Renick, L. J., Cogal, A. G., and Sundin, G. W. 2008. Phenotypic and genetic analysis of 

epiphytic Pseudomonas syringae populations from sweet cherry in Michigan. Plant Dis. 

92: 372-378.

336 ERIC PCR as a method for determining diversity of... 


Proceedings 

ERIC PCR AS A METHOD FOR DETERMINING DIVERSITY OF 

XANTHOMONAS ARBORICOLA PV. JUGLANDIS 


ANJA MILOSAVLJEVIĆ, VELJKO GAVRILOVIĆ 


Xanthomonas arboricola pv. juglandis is the causal agent of walnut blight. The bacterial 

blight of walnut is a severe disease affecting leaves, fruits, twigs and branches and may cause severe 

losses of fruits. Genomic fingerprinting of the Xanthomonas arboricola pv. juglandis populations by 

ERIC PCR determining the genetic difference between X. arboricola pv. juglandis populations in 

Serbia. The results obtained with genetic techniques clearly differentiate three populations of this 

bacterium. 

Key words: Xanthomonas arboricola pv. juglandis, walnut, ERIC PCR 

INTRODUCTION 

The Persian walnut (J. regia L.) is widely cultivated and important commercial nut. 

Among biotic diseases that affect walnut, bacterial blight is considered as the most important 

one in all walnut-growing areas (Leslie et al., 2006). Xanthomonas arboricola pv. juglandis is 

the causal agent of walnut blight. Disease affects leaves, fruits, twigs and branches and may 

cause severe losses of fruits. This bacterium has also been reported to be responsible for the 

vertical oozing canker that has been observed in France (Hajri et al., 2010). The main field 

symptom is sudden wilting of the twigs, branches, and tree, especially at the end of spring and in 

the summer. 

Xanthomonas arboricola is a complex of bacterial species which cause diseases on 

different fruit trees and include seven different pathovars, including X. arboricola pv. pruni, X. 

arboricola pv. corylina, X. arboricola pv. juglandis, X. arboricola pv. populi, X. arboricola pv. 

poinsettiicola, X. arboricola pv. celebensis, and X. arboricola pv. fragariae (Hajri et al., 2012). 

Host specialization is very high for bacteria belonging to X. arboricola and relationships within 

X. arboricola species were assessed using different methods, showing that the different 

pathovars formed well-defined groups in relation to their phytopathogenic specialization (Hajri 

et al., 2010). Within this species, the host range of different pathovars is restricted to one or a 

few host plants, reflecting a close adaptation to the host (Rademaker, 2005, Vauterin et al., 

1995). Genomic fingerprinting of the Xanthomonas arboricola pv. juglandis populations by 

repetitive PCR performed with ERIC primer set could reveal a level of diversity among the 

populations of this bacterium in Serbia. 

More recently, enterobacterial repetitive intergenic consensus (ERIC) sequences which 

are short repetitive DNA sequences with highly conserved central inverted repeats that are 

dispersed throughout the genomes of diverse bacterial species (Little et al., 1998), have been


used to generate highly reproducible, strain-specific fingerprints that can differentiate bacterial 

strains below the level of species or subspecies. 


The X. arboricola pv. juglandis isolates that were used in this study were collected 

from different areas of walnut cultivation in Serbia. Research has been conducted during 

three years: 2010, 2011 and 2012. Fields were inspected throughout the season, from end of 

May to harvest. Symptomatic samples were taken from buds, leaf and fruit surface and 

isolation of the pathogen has been cultured on YDC medium (1 % Yeast extract, 2 % 

dectrose, 2 % CaCO 3, 1.5 % agar) for 2 to 4 days at 28°C. 

Pathogenic characteristics of the isolates were tested by artificial inoculation on bean 

pods, using the procedure described by Klement (1990). The pathogenicity of isolates was 

also tested on immature fruits according to the technique described by Aleta et al. (2001). 

The strains CFBP 2528 and CFBP 2567 from the French collection of phytopathogenic 

bacteria, were used in this work as referent strains. 


Ausubel et al. (1992). Cultures were grown on YDC medium for 48 h at 25°C. Bacterial 

cells were washed with sterile distilled water and centrifuged at 4000 × g for 10 min at 4°C. 

The pellet was washed twice in 0.85% NaCl and once in 0.1M NaPO 4 buffer, pH 6.8. Cells 

were treated with 10% sodium dodecyl sulfate (SDS) and mixed with proteinase K at 37°C 

for 1h. DNA was purified using a 5M NaCl and solution of 10% hexadecyltrimethyl 

ammonium bromide (CTAB) in 1M NaCl at 65°C for 10 min, followed by phenolchloroform 

and chloroform extractions. The DNA was recovered by isopropanol 

precipitation, redissolved in Tris-EDTA (TE, 10mM Tris, 1 mM EDTA, pH 8.0), and 

quantified spectrophotometrically at 260 nm. 

Amplification was performed in a total volume of 25 µl containing 67 mM Tris-HCl 

(pH 8.8); 25 mM MgCl 2 ; 125 µM of dATP, dCTP, dGTP, and dTTP each; 2 units of Taq 

DNA polymerase (Fermentas, Lithuania); and 100 pmol of ERIC1R-I and ERIC2 primer. A 

40-ng quantity of genomic DNA or distilled water as a negative control was added to the 

reaction tubes. The primers were a sequences: (ERIC1R [59- 

ATGTAAGCTCCTGGGGATTCAC-39] and ERIC2 [59-AAGTA 

AGTGACTGGGGTGAGCG-39]) (Lupski and Weinstock, 1992). The PCR conditions 

were as previously described (de Bruijn, 1992). The PCR protocols with ERIC primers are 

referred to as ERIC-PCR. Amplification of PCR was performed with a Mastercycler 

personal model (Eppendorf, Hamburg, Germany) using the following cycles: one initial 

cycle at 95°C for 7 min; 35 cycles of denaturation at 94°C for 1 min; annealing at 40°C for 

1 min; and extension at 65°C for 8 min, with a single final extension cycle at 65°C for 16 

min and a final soak at 4°C. Amplified PCR products were separated by gel electrophoresis 

on 1% agarose gels in 0.5 X TAE buffer for 1 h at 5 V/cm, stained with ethidium bromide, 

and visualized under UV illumination. Fingerprints generated from different strains were 

compared visually. 

RESULTS 

Positive isolation occurs in most cases from leaf and fruit surface. From samples 

collected in the surveyed orchards and nurseries displaying, the YDC medium consistently 

allowed the recovery of 20 bacterial isolates. These isolates formed yellow-colored mucoid


and convex colonies after 3 days of incubation at 28°C. The investegated isolates caused 

necrosis on bean pods and immature fruits. In addition, two referent strains (CFBP 2528 

and CFBP 2567) induced the same necrotic symptoms on inoculated immature fruit and 

bean pod according to the technique described by Aleta et al. (2001). 

ERIC primer sets gave reproducible genomic PCR profiles consisting of bands 

ranging in size from approximately 100 bp to over 6 kb. With the ERIC primers distinct 

DNA polymorphism was observed in the region between 100 and 3 kb. ERIC-PCR 

analyses indicated genetic diversity among the isolates which could be divided in four 

groups with the different types of profile. Group 1 included the isolates from Ruma, 

originated from fruit surface (Fig. 1., lane 3) and isolates from Ratkovo, originated from 

fruit (Fig. 1., lane 7). The members of group 1 had characteristic band at 600 bp. Group 2 

included the isolates from Ratkovo, originated from leaf surface (Fig. 1., lane 6), and this 

group produced two differentiating bands at around 600 and 800 bp. Group 3 included the 

isolates from Ratkovo, originated from leaf surface (Fig. 1., lane 5), and the isolates from 

Ratkovo, originated from fruit (Fig. 1., lane 8), and they produced characteristic bands at 

around 600 and 1500 bp. Group 4 included the isolates from Ratkovo, originated from leaf 

surface (Fig. 1., lane 4), and this group produced two differentiating bands at around 600 

and 1300 bp. The referent strain CFBP 2528 had similar ERIC fingerprint pattern like 

isolates from group 1 while referent strain CFBP 2567 had the same ERIC fingerprint 

pattern like isolates from group 2. 

Figure 1. Agarose gel electrophoresis of repetitive-sequence – based polymerase chain reaction 

(ERIC-PCR) fingerprint patterns obtained from X. arboricola pv. juglandis. CFBP-2528 (lanes 

1), CFBP-2567 (lanes 2), X. arboricola pv. juglandis isolate from fruit, Ruma (lane 3), X. 

arboricola pv. juglandis isolate from leaf, Ratkovo (lane 4-6), X. arboricola pv. juglandis 

isolate from fruit Ratkovo (lane 7-8), negative control (lane 9); DNA molecular size marker 

(GeneRuler TM DNA Ladder Mix) (lane M). 

DISCUSSION 

The purpose of the present study was to investigate the genetic diversity of X. 

arboricola pv. juglandis. This bacterium has been identified as the causal agent of a known 

disease on walnut - bacterial blight. Pathogenicity tests demonstrated that X. arboricola pv. 

juglandis isolates caused infections on fruits and leaves. In the study we ascertained that X.


arboricola pv. juglandis could be divided in three groups currently causing disease on 

walnut in Serbia. The results obtained with genetic techniques clearly differentiate three 

populations of this bacterium. Repetitive PCR profiling differentiated two population of X. 

arboricola pv. juglandis with a different pattern in the Ratkovo region. One population was 

found on fruits, while another was found on leaves. Genetic variability of X. arboricola pv. 

juglandis strains that cause walnut blight was indicated previously by other authors (Du 

Plessis and Van der Westhuizen, 1995; Loreti et al., 2001; Scortichini et al., 2001; 

Barionovi and Scortichini, 2008). Such heterogeneity Hajri et al. (2010) explained by its 

broad geographical distribution, and long association with walnut, which is endemic in 

Europe. This indicates that each area of Persian walnut cultivation has a different X. 

arboricola pv. juglandis population. In this study it has been shown the potential of ERIC 

PCR as a diagnostic tool in determining the genetic difference between X. arboricola pv. 

juglandis populations. 



Serbia (Grants No. OI173026 and TR31018) 

REFERENCES 

Aleta, N., Ninot, A., Moragrega, C., Llorente, I., Montesinos, E. 2001. Blight sensitivity of 

Spanish selections of Juglans regia. Acta Horticulturae 544: 353–362. 

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and 

Struhl, K. 1992. Current Protocols in Molecular Biology, Vol. I. Greene Publishing 


Barionovi D, Scortichini M, 2008. Integron variability in Xanthomonas arboricola pv. juglandis 

and Xanthomonas arboricola pv. pruni strains. FEMS Microbiology Letters 288, 19–24. 

Du Plessis, H. J., Van der Westhuizen, T. J. 1995. Identification of Xanthomonas campestris pv. 

juglandis from (Persian) English walnut nursery trees in South Africa. Journal of 

Phytopathology 143: 449–454. 

de Bruijn, F. J. (1992). Use of repetitive (repetitive extragenic palindromic and enterobacterial 

repetitive intergeneric consensus) sequences and the polymerase chain reaction to 

fingerprint the genomes of Rhizobium meliloti isolates and other soil bacteria. Appl. 

Environ. Microbiol. 58, 2180-2187. 

Hajri, A., Pothier, J. F., Fischer-Le Saux, M., Bonneau, S., Poussier, S., Boureau, T., Duffy, B., 

and Manceaua, C. 2012. Type Three Effector Gene Distribution and Sequence Analysis 

Provide New Insights into the Pathogenicity of Plant-Pathogenic Xanthomonas 

arboricola. Applied and Environmental Microbiology. 78: 371–384 

Hajri, A., Meyer, D., Delort, F., Guillaumes, J., Brin, C., and Manceau, C. 2010. Identification 

of a genetic lineage within Xanthomonas arboricola pv. juglandis as the causal agent of 

vertical oozing canker of Persian (English) walnut in France. Plant Pathol. 59:1014 – 

1022. 

Klement, Z. 1990. Inoculation plant tissues. Cancer and dieback disease, In: Methods in 

Phytobacteriology (Eds. Z. Klement, K. Rudolph, and D. Sands), 105-106. Akademiai 

Kiado, Budapest. 

Leslie, C. A., Uratsu, S. L., McGranahan, G., Dandekar, A. M., 2006. Walnut (Juglans). 

Methods in Molecular Biology 344: 297–307.


Little, E. L., Bostock, R. M., and Kirkpatrick, B. C. 1998. Genetic Characterization of 

Pseudomonas syringae pv. syringae Strains from Stone Fruits in California. Applied and 

Environmental Microbiology. 64: 3818–3823 

Loreti, S., Gallelli, A., Belisario, A., Wajnberg, E., Corazza, L. 2001. Investigation of genomic 

variability of Xanthomonas arboricola pv. juglandis by AFLP analysis. European 

Journal of Plant Pathology 107: 583–591. 

Lupski, J. R., and Weinstock, G. M. 1992. Short, interspersed repetitive DNA sequences in 

prokaryotic genomes. J. Bacteriol. 174: 4525-4529. 

Rademaker, J. L. W. 2005. A comprehensive species to strain taxonomic framework for 

Xanthomonas. Phytopathology 95: 1098 –1111. 

Scortichini, M, Marchesi U, Di Prospero P, 2001. Genetic diversity of Xanthomonas arboricola 

pv. juglandis (synonyms: X. campestris pv. juglandis; X. juglandis pv. juglandis) strains 

from different geographical areas shown by repetitive polymerase chain reaction 

genomic fingerprinting. Journal of Phytopathology 149: 325–332. 

Vauterin, L, Hoste, B, Kersters, K, Swings, J. 1995. Reclassification of Xanthomonas. Int. J. 

Syst. Bacteriol. 45: 472– 489.



Proceedings 

IDENTIFICATION OF PHYTOPATHOGENIC AGROBACTERIUM 

SPP. IN SERBIA 


NENAD DOLOVAC, VELJKO GAVRILOVIĆ 


Agrobacterium spp. cause common diseases of dicotyledonous plants including stone and 

pome fruit trees, grapevines, roses and some ornamental plants. Agrobacterium spp.were diagnosed 

using conventional methods based on the isolation on selective media, followed by pathogenicity tests 

on carrot disks. PCR amplifications were conducted with specific sets of primers and confirmed the 

presence of Agrobacterium spp. on sour cherry, plum, blackberry, and grapevine in Serbia. 

Key words: Agrobacterium, fruits, PCR 

INTRODUCTION 

The genus Agrobacterium consists of Gram-negative, soil-borne bacteria, both 

pathogenic and non-pathogenic for plants. Members of the genus Agrobacterium are 

ubiquitous components of the soil microflora, with vast majority of saprophytic bacteria, 

surviving primarily on decaying organic matter. However, several species of agrobacteria 

cause neoplastic diseases in plants, including Agrobacterium rhizogenes (hairy root 

disease), Agrobacterium rubi (cane gall disease), Agrobacterium tumefaciens (crown gall 

disease) and Agrobacterium vitis (crown gall of grape). Pathogenic strains include bacteria 

causing crown gall and hairy-roots diseases. The crown gall bacteria can infect over 90 

different plant families (De Cleene and De Ley, 1976) and are responsible for economic 

losses in nurseries of fruit trees and ornamental plants (Pulawska, 2010). Agrobacterium 

pathogenesis is a unique and highly specialized process involving bacterium–plant 

interkingdom gene transfer (Chilton et al., 1977). Genes responsible for pathogenicity of 

agrobacteria are mostly located on conjugal plasmids (Ti—in tumorigenic and Ri—in 

rhizogenic strains). These plasmids can be transferred to non-pathogenic agrobacteria (Kerr 

et al., 1977) resulting in an increase of pathogenic agrobacteria populations. Crown gall and 

hairy root have been described as a transfer and expression of an appropriate 

Agrobacterium genes in a plant cell that cause uncontrolled cell proliferation and synthesis 

of nutritive compounds which can be metabolized specifically by the infecting bacteria 

(Schell et al., 1979). Thus, infection effectively creates a new niche specifically suited to 

Agrobacterium survival. The natural host range of Agrobacterium among plant kingdom 

species is rather extensive and includes members of most of the plant families. Crown gall 

disease could cause fatal infection of young plants, and it is related to reduction in crop 

yield. The decreased productivity of galled plants is probably caused by several factors,

342 Identification of phytopathogenic Agrobacterium spp. in Serbia 

including decreased water and nutrient flow due to damaged or constricted vasculature at 

the site of gall development, and significant water and nutrient allocation to the rapidly 

dividing but unproductive gall sink (Aloni et al., 1998). In addition, crown galls are sites for 

secondary infection by other phytopathogens or pests, and can increase plant susceptibility 

to abiotic stresses (Schroth et al., 1988). 

In this study polymerase chain reaction (PCR) has been used for identification and 

detection of Agrobacterium spp. isolated from sour cherry, plum, blackberry, and 

grapevine. 


Pathogen isolation 

The bacteria were isolated from collected samples of diseased sour cherry, plum, 

blackberry, and grapevine plants using young galls. Gall surface was washed under running 

water, surface sterilized for 10 minutes in 1% sodium hypochlorite solution and rinsed with 

sterile water prior to isolation. The small pieces of tumor tissue were macerated, soaked in 

sterile distilled water to allow diffusion of bacteria into the liquid and then bacterial 

suspension was streaked on nutrient agar plates (NA) (Milijašević et al., 2007). Plates were 

incubated at 25°C and examined after 2-3 days. Presumptive colonies were purified by 

streaking onto PDA medium with 0.5% CaCO 3 and PYGA medium (0.3% peptone, 0.5% 

yeast extract, 1% glycerol and 2% agar). Single cell colonies were transferred onto NA 

slants and stored at 4°C. The strains CFBP 2621 (A. vitis) and CFBP 4442 (A. tumefaciens) 

from the French collection of phytopathogenic bacteria, were used in this work as referent 

strains. 


Pathogenicity of the strains isolated from tumors was tested on sterilized and 

aseptically cut carrot disks by inoculation with bacterial suspension (containing 10 7 cfu/ml). 

Carrot disks treated in the same way with distilled water served as negative control and 

disks inoculated with the reference strains were used as positive control. Inoculated carrot 

slices were placed on moistened sterile filter paper in Petri dishes and kept at room 

temperature for three weeks. Carrot disks inoculated with water served as negative control, 

while carrot disks inoculated with the reference strains served as positive control. The 

presence of galls was checked after four weeks. 

Polymerase chain reaction (PCR) 


Ausubel et al. (1992). Cultures were grown on YDC medium for 48 h at 25°C. Bacterial 

cells were washed with sterile distilled water and centrifuged at 4,000 × g for 10 min at 

4°C. The pellet was washed twice in 0.85% NaCl and once in 0.1M NaPO 4 buffer, pH 6.8. 

Cells were treated with 10% sodium dodecyl sulfate (SDS) and mixed with proteinase K at 

37°C for 1h. DNA was purified using a 5M NaCl and solution of 10% hexadecyltrimethyl 

ammonium bromide (CTAB) in 1M NaCl at 65°C for 10 min, followed by phenolchloroform 

and chloroform extractions. The DNA was recovered by isopropanol 

precipitation, redissolved in Tris-EDTA (TE, 10mM Tris, 1 mM EDTA, pH 8.0), and 

quantified spectrophotometrically at 260 nm. PCR was conducted using primers specific for 

detection of tumorigenic agrobacteria (complementary to the tms2 gene) with the following 

sequence: tms2F1 (5` TTT CAG CTG CTA GGG CCA CAT CAG 3`) and tms2R2 (5`


TCG CCA TGG AAA CGC CGG AGT AGG 3`) (Pulawska and Sobiczewski, 2005) where 

the expected PCR products are 617 base pairs. DNA amplification was performed in a total 

volume of 25 µl. All reactions contained: 1 x PCR Master mix (Fermentas, Lithuania) 

(0.625 U Taq polymerase, 2 mM MgCl 2 , 0.2 mM each dNTPs), 1 µl of each primer (20 

µM) and 1 µl of template DNA. Sterile deionized water was used as negative control, and 

the reference strains were used as positive control. Amplification conditions were: initial 

denaturation at 94°C for 1 min, followed by 35 cycles of denaturation at 94°C for 1 min, 

annealing at 63°C for 1 min, extension at 72°C for 1.5 min, and a final extension step at 

72°C for 10 min. (Milijašević et al., 2007). Amplified PCR products were separated by gel 

electrophoresis on 1% agarose gels in 0.5 X TAE buffer for 1 h at 5 V/cm, stained with 

ethidium bromide, and visualized under UV illumination. 

RESULTS 

Pathogenicity test 

Infected plants had crown on the roots and crowns of diseased plants near the soil 

surface. In early stages of symptom development, galls were spherical with rough and 

spongy consistency. With age they become brown, woody knots. The plant may show water 

stress and nutrient deficiency symptoms since the movement of water and nutrients through 

the plant is disrupted. All tested strains caused small, green tumors on carrot disks three 

weeks after inoculation. No changes were observed on carrot slices inoculated with water. 

Polymerase chain reaction (PCR) 

The appropriate amplification bands were obtained after amplification with primers 

for the tms2 gene. Using tms2F1 and tms2R2 primers, 617 bp PCR products specific for 

tumorigenic Agrobacterium strains were detected (Figure 1.). Therefore, we confirmed that 

the strains isolated from tumors in sour cherry, plum, blackberry, and grapevine plants were 

tumorigenic Agrobacterium strains.

344 Identification of phytopathogenic Agrobacterium spp. in Serbia 

Figure 1. Amplification of 617 bp PCR products with DNA of following Agrobacterium strains: 

Lane 1 Positive control strain CFBP 2621 (A. vitis); Lane 2 Positive control strain CFBP 4442 

(A. tumefaciens); Lane 3 Agrobacterium sp. from sour cherry; Lane 4 Agrobacterium sp. from 

plum; Lane 5 Agrobacterium sp. from blackberry; Lane 6 Agrobacterium sp. from grapevine; 

Lane 7 Negative control; Lane M Molecular weight marker 100 bp ladder 

DISCUSSION 

The purpose of this study was to identify different virulent Agrobacterium spp. 

strains from different hosts using pathogenicity test and PCR identification. Agrobacterium 

spp. cause common diseases of dicotyledonous plants including stone and pome fruit trees, 

grapevines, roses and some ornamental plants (Rhouma et al., 2006). The bacteria that 

induce crown gall are responsible for great losses, first of all in nursery production of fruit 

trees, roses and grapevines worldwide (Kennedy and Alcorn, 1980). Agrobacterium spp. 

were diagnosed using conventional methods based on the isolation on selective media, 

followed by pathogenicity tests on carrot disks. PCR amplifications were conducted with 

specific sets of primers and the presence of Agrobacterium spp. on sour cherry, plum, 

blackberry, and grapevine was confirmed in Serbia. 



Serbia (Grants No. OI173026 and TR31018). 

REFERENCES 

Aloni, R., Wolf, A., Feigenbaum, P., Avni, A., and Klee, H. J. 1998. The Never ripe mutant 

provides evidence that tumor-induced ethylene controls the morphogenesis of


Agrobacterium tumefaciens-induced crown galls on tomato stems. Plant Physiol. 117, 

841–849. 

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and K. 

Struhl 1992. Current Protocols in Molecular Biology, Vol. I. Greene Publishing 


Chilton, M. D., Drummond, M. H., Merio, D. J., Sciaky, D., Montoya, A. L., Gordon, M. P., and 

Nester, E. W. 1977. Stable incorporation of plasmid DNA into higher plant cells: the 

molecular basis of crown gall tumorigenesis. Cell 11, 263–271. 

De Cleene, M., and Ley, J. 1976. The host range of crown gall. Botanical Review 42: 389–466 

Kerr, A., Manigault, P., and Tempé, J. 1977. Transfer of virulence in vivo and in vitro in 

Agrobacterium. Nature, 265, 560–561. 

Kennedy, B.W., and Alcorn, S.M. 1980: Estimates of U. S. crop losses to prokaryote plant 

pathogens. Plant Dis., 64: 674-676. 

Milijašević, S., Gavrilović, V., Živković, S., Trkulja, N. and Pulawska, J. 2007. First report of 

tumorigenic Agrobacterium radiobacter on raspberry in Serbia. Pesticidi i fitomedicina, 

22: 113-119. 

Ogawa, J. M., Zehr, E. I., Bird, G. W., Ritchie, D. F., Uriu, K. and Uyemoto, J. K. 1995. 

Compendium of Stone Fruit Diseases. APS Press, Minnesota, pp:98. 

Puławska, J. 2010. Crown gall of stone fruits and nuts—economic significance and diversity of 

its causal agent—tumorigenic Agrobacterium spp. Journal of Plant Pathology, 

92(Suppl.1), S1.87–98. 

Pulawska, J. and Sobiczewski, P. 2005. Development of a seminested PCR based method for 

sensitive detection of tumorogenic Agrobacterium in soil. J. Appl. Microbiol., 98: 710- 

721. 

Rhouma A, Boubaker A, Nesme X, Dessaux, Y. 2006. Plasmid and chromosomal diversity of a 

Tunisian collection of Agrobacterium tumefaciens strains. Tunis J Plant Protect 1:73–84. 

Schell, J., Van Montagu, M., De Beuckeleer, M., De Block, M., Depicker, A., De Wilde, A,, 

Engler, G., Genetello, C., Hernalsteens, 1.-P., Holsters, M., Seurinck, J., Silva, A., Van 

Vliet, F. and Villarroel, R. 1979. Interactions and DNA transfer between Agrobacterium 

tumefaciens, the Ti plasmid and the plant host. Proc. R. Soc. Lond. 8204: 251-266. 

Schroth, M. N., McCain, A. H., Foott, J. H., and l-luisman, O. C. 1988. Reduction in yield and 

vigor of grapevine caused by crown gall disease. Plant Dis. 72, 241–246.

346 Antagonistic activity of Bacillus and Pseudomonas,... 


Proceedings 

ANTAGONISTIC ACTIVITY OF BACILLUS AND PSEUDOMONAS 

SOIL ISOLATES AGAINST XANTHOMONAS CAMPESTRIS PV. 

CAMPESTRIS 

TATJANA POPOVIĆ 1 , DRAGANA JOŠIĆ 2 , MIRA STAROVIĆ 1 , SVETLANA ŽIVKOVIĆ 1 , ŽARKO 

IVANOVIĆ 1 , NENAD TRKULJA 1 , VIOLETA ORO 1 

1 Institute for Plant Protection and Environment, Belgrade, Republic of Serbia 

2 Institute for Soil Science, Belgrade, Republic of Serbia 

Antagonism activity of Bacillus and Pseudomonas soil isolates collected from the rhizosphere 

of different cultivated plants was investigated against Xanthomonas campestris pv. campestris (Xcc), 

a causal agent of crucifers’ black rot. Antimicrobial activity tests were performed in vitro using agar 

diffusion methods. Tested rhizospheric isolates caused Xcc growth inhibition zone in a range of 1 to 

31.25 mm. The most effective isolates will be tested further in in vivo experiments and optimized for 

neutralization of Xcc in plants. 

Key words: Bacillus, Pseudomonas, antagonism, Xanthomonas campestris pv. campestris, 

black rot, crucifers 

INTRODUCTION 

Agricultural production was intensified over the past few decades and became 

dependent on agrochemicals. Using pesticides is a relatively reliable method of crop 

protection. However, the pathogenic microorganisms affecting plant health still pose a 

significant threat to food production and ecosystem stability worldwide (Compant et al., 

2005). The frequent use of chemicals causes some negative effects, such as development of 

pathogen resistance to the applied agents and their non-target environmental impacts 

(Gerhardson, 2002). The demands for pesticide-free food have led to search for its 

substitutes. Biological control was reported as alternative or/and supplemental way of 

reducing the use of chemicals in agriculture (Gerhardson, 2002; Postma et al., 2003; 

Welbaum et al., 2004). Plant growth-promoting bacteria (PGPB) are known as very 

effective in biological control. Many diseases of fungal, bacterial, and viral origin, and 

some damages caused by insects and nematodes, can be reduced after application of PGPB 

(Kerry, 2000; Ramamoorthy et al., 2001; Sturz and Christie, 2003; Ping and Boland, 2004; 

Ryu et al., 2004; Compant et al., 2005). 

Xanthomonas campestris pv. campestris (Pammel 1895) Dowson 1939 (Xcc), 

causal agent of crucifers black rot, is considered the most serious disease of crucifers 

worldwide (Williams, 1980; Alvarez, 2000). The most important host is Brassica oleracea 

(including cabbage, cauliflower, broccoli and kale) susceptible to this disease in all 

developmental stages. Xcc occurs more frequently in warm and humid environments,

Tatjana Popović, Dragana Jošić, Mira Starović,... 347 

which are common in tropical and subtropical regions (Williams, 1980). The symptoms are 

characterized by yellow V-shaped lesions starting from leaf margins and progressing to the 

centre through the vascular tissue, resulting, in general, in the leaf necrosis (Seebold et al., 

2008). 

The aim of the presented work was to detect antagonistic activities of 

Bacillus and Pseudomonas bacteria from the rhizospheric soil against Xcc. 


Microorganisms 

Among a large numbers of isolates from the rhizosfere of different plants, several 

Bacillus and Pseudomonas isolates were selected in previous investigation. In this work, we 

chose two Bacillus (Q3 and Q5) and two Pseudomonas (Q4 and Q20) isolates from maize 

rhizosphere in Sumadija and one Pseudomonas from Vojvodina (PS2), two Bacillus (Q7 

and Q13) and Pseudomonas Q33 from pepper rhizosphere, Bacillus Q10 and Pseudomonas 

Q1a from alfalfa rhizosphere and from red clover rhizosphere Bacillus Q18 and 

Pseudomonas Q34. P1 from oil polluted soil was used as non-rhizospheric Pseudomonas 

isolate. 

Reference Xcc strain was from National Collection of Plant Pathogenic Bacteria 

(NCPPB No. 1144). The strain was grown on Yeast Dextrose Chalk medium (YDC) for 48 

h at 28°C. 

Antimicrobial activity 

Antimicrobial activity was determined by agar diffusion technique. One hundred 

microliters of Xcc suspensions (3 x 10 8 cells/mL) were mixed in 100 mL Nutrient Agar 

(NA) and poured in sterilized Petri plates (90 mm in diameter). Tested Bacillus and 

Pseudomonas isolates were grown on Nutrient Broth (NB) and 10µl containing 10 6 

CFUmL -1 (obtained by OD 600 measurement and calculation) were placed in Petri plates 

surface and incubated at 28ºC. There were four replicates for each antagonistic bacterium. 

After three days of incubation, inhibition halos were measured and antimicrobial 

activity (mm) was expressed as the difference between the diameter of inhibition zone and 

the diameter of Bacillus and Pseudomonas colony (Monteiro, 2002). 

Data analysis 

All experiments were performed in a completely randomized design. The results 

were subjected to analysis of variance (ANOVA) and means were compared by Duncan´s 

Multiple Range Test (P = 0,05) using the software COSTAT. 

RESULTS 

Antagonistic activity of rhizospheric isolates Bacillus and Pseudomonas to Xcc 

strain were detected using agar diffusion methods and results are presented in FIGURE 1. 

Growth inhibition of Xcc strain by Q18 and Q3 of Bacillus isolates showed significant 

value of 31,25 and 30 mm, respectively. The maximum inhibition value caused by 

Pseudomonas tested was 28.5 mm for Ps2. A very effective Pseudomonas isolate Q1a 

generated similar halo value, since P1 and Q20 isolates showed a minimal inhibition halo of 

about 1 mm


Figure 1. Antimicrobial activity of Bacillus spp. and Pseudomonas spp. against Xanthomonas 

campestris pv. campestris 

DISCUSSION 

Considering the extent infections by Xcc detected on cabbage, kale and broccoli 

(Popović et al., 2011), it is necessary to obtain ecologically friendly way to control these 

pathogens. All antagonists tested in this study inhibited the phytopathogenic Xcc strains 

with a different degree of efficiency. Bacillus isolates Q18 and Q3, as a most effective, can 

be considered for tests in field conditions. It is well known that the genus Bacillus is one of 

the most commonly used for the biocontrol of plant diseases. One of the main mechanisms 

of action of these microorganisms in biocontrol of phytopathogens is the production of 

antimicrobial substances, such as lipopeptides, which exibit hemolytic activity (Monteiro, 

2002). Our previous investigations confirmed the production of extracellular metabolites 

such as siderophores, hydrolytic enzymes, organic acids and Indole Acetic Acid (IAA) for 

Bacillus Q3 isolate (Jošić et al., 2011). Also, this isolate is capable of stopping the growth 

of some phytopathogenic fungi - Alternaria alternata, Myrothecium verrucaria and 

Sclerotinia sclerotiorum and to stimulate germination of marshmellow seeds. The Xcc 

antagonistic property, as an additional PGP trait, made this isolates significant for futher 

field investigation in biological control of different plant pathogens. 

Many Bacillus spp. have been formulated and registered for commercial use in the 

United States, and recommended for foliar diseases of several crops (Gardener and Fravel, 

2002). Xcc is found among the phytopathogens inhibited by the genus Bacillus (Assis et al., 

1996, 1997; Monteiro, 2002; Monteiro et al., 2005). Assis et al. (1996) investigated the 

antagonism of 32 epiphytic Bacillus spp., isolated from cabbage, kale and radish. Among 

these isolates, 13 reduced the incidence of black rot in kale by 100% under greenhouse 

conditions. In another study (Assis et al., 1997), 13 isolates reduced incidence in cabbage, 

ranging from 48% to 78%, in field experiments. Among them, B. cereus, B. megaterium, B. 

subtilis and B. cereus reduced 78%, 74%, 73% and 71%, respectively. The study conducted 

by Monteiro (2002) demonstrated the positive results in antimicrobial activity tests of eight 

Bacillus isolates against strain of Xcc. 

As a variety of microorganisms, PGP Pseudomonas also exhibit antagonistic 

activity, attacking pathogens by excreting cell wall lytic enzymes. One of the mechanisms


of biological control is the detoxification and degradation of pathogen virulence factors, as 

reported for albicidin toxin produced by Xanthomonas albilineans (Zhang and Birch, 1997). 

Also, some pseudomonads use the quorum-sensing capacity to block pathogen by 

degrading autoinducer signals and blocking expression of numerous virulence genes (von 

Bodman et al., 2003). Many rhizospheric and certain endophytic bacteria isolated from 

field-grown potato plants can reduce in vitro growth of Streptomyces scabies and 

Xanthomonas campestris through the production of siderophore and antibiotic compounds 

(Sessitsch et al., 2004). Aino et al. (1997) have also reported that the endophytic P. 

fluorescens strain FPT 9601 can synthesize antibiotic DAPG and deposit DAPG crystals 

around and in the roots of tomato, thus demonstrating that endophyte can produce 

antibiotics in plants. 

Among Pseudomonas isolates tested, the most effective inhibitor of Xcc growth was 

PS2 isolate. The production of significant amounts of phenazine-1-carboxylic acid (PCA) 

and 2-hydroxy-phenazine-1-carboxylic acid (2-OH-PCA), as a members of a group of 

heterocyclic nitrogen–containing compounds with broad spectrum of antibiotic properties - 

phenazines, and detection of PCA genes were reported for this isolate already (Protolipac 

et al., 2011). Antifungal activity of PS2 isolate was reported against Alternaria tenuissima 

isolated from Echinacea purpurea (Protolipac et al., 2012) and Ocimum basilicum L., plant 

where PS2 caused disease reduction in gnotobiotic condition (Jošić et al., 2012). 

The results of this study showed a selection of rhizospheric isolates Bacillus Q18 

and Q3 and Pseudomonas PS2 and Q1a as effective in growth suppression of Xcc 

pathogenic strain. A large numbers of autochthonous Xcc isolates from different plants will 

be included in further analysis. 


The work is a part of the Projects No. III43010 and III46007 funded by Ministry of 

Education and Science-Republic of Serbia. 

REFERENCES 

Aino, M., Maekawa, Y., Mayama, S., Kato, H. (1997): Biocontrol of bacterial wilt of tomato 

by producing seedlings colonized with endophytic antagonistic pseudomonads. In: A. 

Ogoshi, K. Kobayashi, Y. Homma, F. Kodama, N. Kondo, and S. Akino (eds.), Plant 

growth promoting rhizobacteria: present status and future prospects. Nakanishi 

Printing, Sapporo, Japan, pp. 120-123. 

Alvarez, A.M. (2000): Black rot of crucifers. In: A.J. Slusarenko et al. (eds.), Mechanisms of 

Resistance to Plant Diseases. Kluwer Academic Publishers, Dordrecht, The Netherlands, 

pp. 21-52. 

Assis, S.M.P., Mariano, R.L.R., Michereff, S.J., Coelho, R.S.B. (1997): Antagonism of Bacillus 

spp. to Xanthomonas campestris pv. campestris on cabbage phyloplane in the field. 

Proceedings of the Fourth International Workshop on Plant Growth-Promoting 

Rhizobacteria – Present Status and Future Prospects. Japan: OECD. pp. 345-348. 

Assis, S.M.P., Mariano, R.L.R., Michereff, S.J., Coelho, R.S.B. (1996): Biocontrol of 

Xanthomonas campestris pv. campestris on kale with Bacillus spp. and endophytic 

bacteria. In: T. Wenhua et al. (eds.), Advances in Biological Control of Plant Diseases. 

Beijing. pp. 347-353.


Compant, S., Duffy, B., Nowak, J., Clement, C., Barka, E.A. (2005): Use of Plant Growth- 

Promoting Bacteria for Biocontrol of Plant Diseases: Principles, Mechanisms of Action, 

and Future Prospects. Applied and environmental microbiology, 71 (9): 4951-4959. 

Gardener, B.B.M., Fravel, D.R. (2002): Biological control of plant pathogens: research, 

commercialization and application in the USA. Plant Health Progress. 

http://www.plantmanagementnetwork.org/pub/php/review/biocontrol/ 

Gerhardson, B. (2002): Biological substitutes for pesticides. Trends Biotechnol., 20: 338-343. 

Jošić, D., Pavlović, S., Starović, M., Stojanović, S., Stanojković-Sebić, A., Pivić, R. (2012): 

Biocontrol of Alternaria tenuissima originated from Ocimum basilicum L using 

indigenous Pseudomonas spp. strains. Proceedings of the 7 th Conference on Medicinal 

and Aromatic plants of Southeast European Countries, May 27 th -31 st , Subotica, Serbia, 

pp. 195-200. 

Jošić, D., Pivić, R., Pavlović, S., Stojanović, S., Aleksić, G., Starović, M. (2011): Antifungal 

activity of indigenous Bacillus sp. isolate Q3 against marshmallow mycobiota. Zbornik 

Matice srpske za prirodne nauke/Proceedings for Natural Sciences, Matica Srpska Novi 

Sad, 120: 109-118. 

Kerry, B.R. (2000): Rhizosphere interactions and the exploitation of microbial agents for the 

biological control of plant-parasitic nematodes. Annu. Rev. Phytopathol., 38: 423-441. 

Monteiro, L. (2002): Produção de substâncias bioativas de Bacillus spp. contra Xanthomonas 

campestris pv. campestris. MSc Thesis, Universidade Federal de Pernambuco, Brazil. 

Monteiro, L., de Lima Ramos Mariano, R., Souto-Maior, A.M. (2005): Antagonism of Bacillus 

spp. Against Xanthomonas campestris pv. campestris. Brazilian archives of biology and 

technology, 48(1): 23-29. 

Ping, L., Boland, W. (2004): Signals from the underground: bacterial volatiles promote growth 

in Arabidopsis. Trends Plant Sci., 9: 263-269. 

Popović, T., Jošić, D., Starović, M., Aleksić, G., Poštić, D., Stajković, O., Mijatović, M. (2011): 

Genetic diversity of Xanthomonas campestris pv. campestris isolated from cabbage, kale 

and broccoli. 7 th Balkan Congress of Microbiology - Microbiologia Balkanica, 

Belgrade, Serbia, October 25-29. 

Postma, J., Montanari, M., van den Boogert, P.H.J.F. (2003): Microbial enrichment to enhance 

the disease suppressive activity of compost. Eur. J. Soil Biol., 39: 157-163. 

Protolipac, K., Jošić, D., Starović, M., Pavlović, S., Poštić, D., Popović, T., Stojanović, S. 

(2011): The Effect of Pseudomonas Isolates on Growth and Pathogenicity of Alternaria 

tenuissima. 7 th Balkan Congress of Microbiology - Microbiologia Balkanica, 

Belgrade, Serbia, October 25-29. 

Protolipac, K., Pavlović, S., Starović, M., Stojanović, S., Lepšanović, Z., Jošić, D. (2012): 

Antifungal activity of idigenous Pseudomonas isolates aganist Alternaria tenuissima 

isolated from Echinacea purpurea. Proceedings of the 7 th Conference on Medicinal and 

Aromatic plants of Southeast European Countries, May 27 th -31 st , Subotica, Serbia, pp. 

187-191. 

Ramamoorthy, V., Viswanathan, R., Raguchander, T., Prakasam, V., Smaiyappan, R. (2001): 

Induction of systemic resistance by plant growth-promoting rhizobacteria in crop plants 

against pests and diseases. Crop Prot., 20: 1-11. 

Ryu, C.M., Murphy, J.F., Mysore, K.S., Kloepper, J.W. (2004): Plant growth-promoting 

rhizobacterial systemically protect Arabidopsis thaliana against Cucumber mosaic virus 

by a salicylic acid and NPR1-independent and jasmonic acid-dependent signaling 

pathway. The Plant J., 39: 381-392. 

Seebold, K., Bachi, P., Beale, J. (2008): Black rot of crucifers. In: Vegetable production guide 

for commercial growers, ID-36. UK Cooperative Extension Service, College of 

Agriculture, University of Kentucky.


Sessitsch, A., Reiter, B., Berg, G. (2004): Endophytic bacterial communities of field-grown 

potato plants and their plant growth-promoting and antagonistic abilities. Can. J. 

Microbiol., 50: 239-249. 

Sturz, A.V., Christie, B.R. (2003): Beneficial microbial allelopathies in the root zone: the 

management of soil quality and plant disease with rhizobacteria. Soil Tillage Res., 72: 

107-123. 

Von Bodman, S.B., Bauer, W.D., Coplin, D.L. (2003): Quorum sensing in plant-pathogenic 

bacteria. Annu. Rev. Phytopathol., 41: 455-482. 

Welbaum, G., Sturz, A.V., Dong, Z., Nowak, J. (2004): Fertilizing soil microorganisms to 

improve productivity of agroecosystems. Crit. Rev. Plant Sci., 23: 175-193. 

Williams, P.H. (1980): Black rot: A continuing threat to world crucifers. Plant Disease, 64: 736- 

742. 

Zhang, L., Birch, R.G. (1997): The gene for albicidin detoxification from Pantoea dispersa 

encodes an esterase and attenuates pathogenicity of Xanthomonas albilineans to 

sugarcane. Proc. Natl. Acad. Sci. USA 94: 9984-9989.

352 Antagonistic activity of Bacillus and Pseudomonas Soil isolates,... 


Proceedings 

ANTAGONISTIC ACTIVITY OF BACILLUS AND PSEUDOMONAS 

SOIL ISOLATES AGAINST PSEUDOMONAS SYRINGAE PV. 

SYRINGAE 

TATJANA POPOVIĆ 1 , DRAGANA JOŠIĆ 2 , MIRA STAROVIĆ 1 , SVETLANA ŽIVKOVIĆ 1 , 

ŽARKO IVANOVIĆ 1 , NENAD TRKULJA 1 , VIOLETA ORO 1 

1 Institute for Plant Protection and Environment, Belgrade, Republic of Serbia 

2 Institute for Soil Science, Belgrade, Republic of Serbia 

Six Bacillus and seven Pseudomonas soil isolates were tested in vitro for their antagonistic 

activities against Pseudomonas syringae pv. syringae (Pss), using an agar-diffusion assay. Among 

them, two Bacillus (Q7 and Q13) and four Pseudomonas isolates formed inhibition zones larger than 

10 mm. The maximum inhibition of Pss growth was demonstrated by the Pseudomonas isolate Q34 

from the red clover rhizosphere. Selected isolates will be considered in our future investigation for 

biocontrol of Pss. 

Key words: Bacillus, Pseudomonas, antagonism, Pseudomonas syringae pv. syringae 

INTRODUCTION 

Plant growth-promoting bacteria (PGPB) are commonly present in many 

environments and are associated with many plant species. The most widely studied group 

of PGPB are plant growth-promoting rhizobacteria (PGPR) colonizing the root surfaces and 

closely adhering rhizosphere (Kloepper et al., 1999). Some of the mechanisms of biocontrol 

mediated by PGPB are: a competition for an ecological niche or a substrate, a production of 

inhibitory allelochemicals, an induction of systemic resistance (ISR) in host plants to a 

broad spectrum of pathogens (Haas et al., 2000, 2002; Bloemberg and Lugtenberg 2001; 

Ryu et al., 2004) and/or abiotic stresses (Mayak et al., 2004; Nowak and Shulaev, 2003). 

Bacteria genus Pseudomonas and Bacillus are widely recognized as PGPR effective 

in biological control of different phytopathogens (fungi, bacteria and viruses) (Gerhardson, 

2002). A variety of antibiotics and inhibitory compounds such as amphisin, 2,4- 

diacetylphloroglucinol (DAPG), hydrogen cyanide, oomycin A, phenazine, pyoluteorin, 

pyrrolnitrin, tensin, tropolone, and cyclic lipopeptides produced by Pseudomonas (Nielsen 

et al., 2002; Raaijmakers et al., 2002; de Souza, 2003; Nielsen and Sørensen, 2003) and 

oligomycin A, kanosamine, zwittermicin A, and xanthobaccin are produced by Bacillus, 

Streptomyces, and Stenotrophomonas spp. (Milner et al., 1996; Hashidoko et al., 1999; Kim 

et al., 1999) and form a basis for a biocontrol mechanism of PGPB. Some of the PGP 

Pseudomonas and Bacillus are able to attack pathogens by excreting cell wall hydrolases 

(Chernin and Chet, 2002) or are able to detoxify of pathogen virulence factors.


Pseudomonas syringae pv. syringae van Hall 1902 (Pss) caused bacterial canker of 

stone-fruit trees (CPC, 2004) and it is one of the most devastating diseases with a loss of 

10-75% in young orchards (Agrios, 1988). Disease symptoms include canker development 

on the shoots and at the spurs base and its progression upwards accompanied with gum 

exudation early in the growing season (Hattingh and Roos, 1995). The pathogen attacks 

twigs, buds, flowers, leaves and fruits. In the early spring, dark brown sunken lesions 

appear on twigs beneath the infected spurs. A severe infection of the twigs results in shoot 

blight and death of the infected branches with gums often appearing from cankered regions 

on the limbs (Goto, 1992). Pss is also an important pathogen of beans worldwide, causing 

bacterial brown spot with associated yield losses of up to 55% in South Africa (Serfontein, 

1994). Bacterial brown spot was reportedly the most widespread bacterial disease of dry 

bean in South Africa, occurring in 93% of seed production fields and in 100% of 

commercial fields (Fourie, 2002). 

Pss survives on a number of crops and non-crop species, which serve as sources of 

primary inoculum for an infection. Pss is widespread from the tropical areas to the northern 

Europe and Canada (CPC, 2004). Pss strains on bean plants are developing resistance to 

copper fungicides (Garret and Schwartz, 1998). No method can provide a complete control 

against bacterial canker and gummosis of fruit trees. This work was focused on the 

possibility of indigenous rhizospheric Pseudomonas and Bacillus strains, already selected 

as PGP bacteria, to act as inhibitory agents on phytopathogenic Pss, as a first step in 

investigating of their potential use for the biological control of plant diseases. 


Antagonistic activities of six Bacillus and seven Pseudomonas soil isolates (TABLE 

1) against reference Pss strain CFBP 1582 were tested in vitro by an agar-diffusion assay. 

Pss strain was cultured on Nutrient Agar (NA) for 48 h at 28°C. One hundred 

microliters of Pss suspensions (3 x 10 8 cells/mL) were mixed in 100 mL Nutrient Agar 

(NA) and poured in sterilized Petri plates (90 mm in diameter). After solidification, 10 µL 

(containing 10 6 CFUmL -1 ) of Bacillus and Pseudomonas suspensions, grown during 24 h at 

28°C in Nutrient Broth (NB), were placed on the agar surface and incubated for 48 h at 

28°C. There were four replicates for each antagonistic bacterium. 

After incubation, the inhibition halos were measured and antimicrobial activity 

(mm) was expressed as the difference between the diameter the inhibition zone and the 

diameter of Bacillus and Pseudomonas colony. 

Table 1: Bacterial strains used as antagonistic bacteria and their source of isolation 

Bacillus 

Isolates Isolation source 

Isolates Isolation source 

Q3 Maize rhizosphere Q1a Alfalfa rhizosphere 

Q5 Maize rhizosphere Q4 Maize rhizosphere 

Q7 Pepper rhizosphere Q20 Maize rhizosphere 

Q10 Alfalfa rhizosphere Q33 Pepper rhizosphere 

Q13 Pepper rhizosphere Q34 Red clover 

rhizosphere 

Q18 Red clover 

P1 Oil polluted soil 

rhizosphere 

Ps2 Maize rhizosphere 

Pseudomonas


The experiment was performed in a completely randomized design. The results were 

subjected to the analysis of variance (ANOVA) and means were compared by Duncan´s 

Multiple Range Test (P = 0,05) using the software COSTAT. 

According to May et al. (1997) isolates that produced an inhibition zone of 2 mm or 

more around the agar disks in the lawn of Pss were regarded as antagonistic. 

RESULTS 

Antagonistic bacterial isolates used in this study were selected in the previous 

investigation on the basis of their PGP traits. All isolates showed at least two traits that 

cause plant stimulation and/or plant protection or acquisition with nutritive elements. 

Results of the antagonistic activities of six Bacillus and seven Pseudomonas soil isolates 

against Pss in in vitro conditions by an agar-diffusion assay, showed that 12 out of 13 

isolates produced inhibition zones on the test plates (FIGURE 1). Isolate Q5 inhibited Pss 

strain less than 2 mm and it was considered as non-antagonistic isolate. 

Figure 1: Antimicrobial activity of Bacillus spp. and Pseudomonas spp. Against 

Pseudomonas syringae pv. syringae 

DISCUSSION 

Rhizospheric Pseudomonas isolates tested in the study inhibited the growth of Pss 

more strongly than tested Bacillus isolates. The maximum inhibition of Pss growth was 

demonstrated by the Pseudomonas isolate Q34, than Q1a and Q4. Pseudomonas PS2 and 

Bacillus Q13 generated a similar value of inhibition. However, Bacillus Q7 isolate was less 

effective. Some of Pseudomonas isolates were already tested for their PGP traits. Isolates 

Q4 and Q20 from the maize rhizosphere in Sumadija produce HCN, have protease and 

phospholipase activity, phosphosolubilization ability and isolate Q4 produce a siderophore 

(Jošić et al., 2012). Isolate PS2 from maize rhizosphere in Vojvodina is a good producer of 

lytic enzymes and phenazines and could inhibit growth of many phytopatogenic fungi 

(Đurić et al., 2011).


Bacillus isolates Q7, Q10 and Q13 showed better antagonism to Psp than isolate Q3. 

We already reported growth inhibition of Alternaria alternata, Myrothecium verrucaria and 

Sclerotinia sclerotiorum for Bacillus Q3 isolate (Jošić et al., 2011) and the production of 

the different antifungal metabolites: siderophores, hydrolytic enzymes, organic acids and 

Indole Acetic Acid (IAA). In further investigation we will compare PGP traits of isolates 

Q7, Q10 and Q13 with results for Q3 isolate. 

Bacillus and Pseudomonas have been reported among other antagonistic bacteria 

isolated from lesions on plants. Antagonists belonged to various taxonomic groups, 

including Erwinia and Escherichia (Sobiczewski, 1987). Two of 28 Erwinia carotovora 

subsp. carotovora isolates screened were antagonistic to Pss (Nishioka et al., 1997). 

Cytospora cincta and various yeasts isolated from cankered and freeze-injured peach trees 

reduced the population of Pss (Endert-Kirpatrick i Ritchie, 1988). Pantoea agglomerans 

applied at the early mild stage of barley in the field and before pathogen’s attack in the 

greenhouse tests provided a 60 to 100% reduction in the infected seeds. Multiple 

mechanisms appeared to be involved that include competition for iron and other nutrients, 

competition for space and induced systemic resistance (Braun-Kiewnick et al., 2000). The 

mechanisms involved in the inhibition of Pss by the most effective Bacillus and 

Pseudomonas rhizospheric isolates will be considered in the next step of our investigation. 


The work is a part of the Projects No. III43010 and III46007 funded by Ministry of 


REFERENCES 

Agrios, G.N. (1988): Plant Pathology. 3rd ed. Academic Press. 803 pp. 

Bloemberg, G.V., Lugtenberg, B.J.J. (2001): Molecular basis of plant growth promotion and 

biocontrol by rhizobacteria. Curr. Opin. Plant Biol., 4: 343-350. 

Braun-Kiewnick, A., Jacobsen, B.J., Sands, D.C. (2000): Biological control of Pseudomonas syringae 

pv. syringae, the causal agent of basal kernel blight of barley, by antagonistic Pantoea 

agglomerans. Phytopathology 90: 368-375. 

Chernin, L., Chet, I. (2002): Microbial enzymes in biocontrol of plant pathogens and pests. In: R. G. 

Burns and R. P. Dick (ed.), Enzymes in the environment: activity, ecology, and applications. 

Marcel Dekker, New York, N.Y., pp. 171-225. 

CPC - Crop Protection Compendium (2004): Crop Protection Compendium 2004 Edition. 

Wallingford, UK, CAB International. 

De Souza, J.T., de Boer, M., de Waard, P., van Beek, T.A., Raaijmakers, J.M. (2003): Biochemical, 

genetic, and zoosporicidal properties of cyclic lipopeptide surfactants produced by 

Pseudomonas fluorescens. Appl. Environ. Microbiol., 69: 7161-7172. 

Đurić, S., Pavić, A., Jarak, M., Pavlović, S., Starović, M., Pivić, R., Jošić, D. (2011): Selection of 

indigenous fluorescent pseudomonad isolates from maize rhizospheric soil in Vojvodina as 

possible PGPR. Rom. Biotechnol. Lett., 16: 6580-6590. 

Endert-Kirkpatrick, E., Ritchie, D.F. (1988): Involvement of pH in the competition between 

Cytospora cincta and Pseudomonas syringae pv. syringae. Phytopathology, 78: 619-624. 

Fourie, D. (2002): Distribution and severity of bacterial diseases on dry beans (Phaseolus vulgaris) in 

South Africa. Journal of Phytopathology, 150: 220-226. 

Garrett, K.A., Schwartz, H.F. (1998): Epiphytic Pseudomonas syringae on dry beans treated with 

copper-based bactericides. Plant Disease, 82(1): 30-35. 

Gerhardson, B. (2002): Biological substitutes for pesticides. Trends Biotechnol., 20: 338-343.


Goto, M. (1992): Fundamentals of Bacterial Plant Pathology, Academic Press, Inc. New York. 342 

pp. 

Haas, D., Blumer, C., Keel, C. (2000): Biocontrol ability of fluorescent pseudomonads genetically 

dissected: importance of positive feedback regulation. Curr. Opin. Biotechnol., 11: 290-297. 

Haas, D., Keel, C., Reimmann, C. (2002): Signal transduction in plantbeneficial rhizobacteria with 

biocontrol properties. Antonie Leeuwenhoek, 81: 385-395. 

Hattingh, M.J., Roos, I.M.M. (1995): Bacterial Canker. In: Ogawa, J.M., Zehr, E.I., Bird, G.W., 

Ritchie, D.F., and Uymoto, J.K. (eds), Compendium of Stone Fruit Diseases. The Am. 

Phytopathol. Soc. Press, St. Paul, MN, USA, pp. 48-50. 

Hashidoko, Y., Nakayama, T., Homma, Y., Tahara, S. (1999): Structure elucidation of xanthobaccin 

A, a new antibiotic produced from Stenotrophomonas sp. strain SB-K88. Tetrahedron Lett., 

40: 2957-2960. 

Jošić, D., Delić, D., Rasulić, N., Stajković, O., Kuzmanović, D., Stanojković, A., Pivić, R. (2012): 

Indigenous Pseudomonads from Rhizosphere of Maize grown on Pseudogley Soil in Serbia. 

Bulgarian Journal of Agricultural Science, 18(2): 197-206. 

Jošić, D., Pivić, R., Pavlović, S., Stojanović, S., Aleksić, G., Starović, M. (2011): Antifungal activity 

of indigenous Bacillus sp. isolate Q3 against marshmallow mycobiota. Zbornik Matice srpske 

za prirodne nauke/Proceedings for Natural Sciences, Matica Srpska Novi Sad, 120: 109-118. 

Kim, B.S., Moon, S.S., Hwang, B.K. (1999): Isolation, identification and antifungal activity of a 

macrolide antibiotic, oligomycin A, produced by Streptomyces libani. Can. J. Bot., 77: 850- 

858. 

Kloepper, J.W., Rodriguez-Ubana, R., Zehnder, G.W., Murphy, J.F., Sikora, E., Fernandez, C. 

(1999): Plant root-bacterial interactions in biological control of soilborne diseases and 

potential extension to systemic and foliar diseases. Austral. Plant Pathol., 28: 21-26. 

May,R., Völksch, B., Kampmann, G. (1997): Antagonistic Activities of Epiphytic Bacteria from 

Soybean Leaves against Pseudomonas syringae pv. glycinea in vitro and in planta. Microbial 

Ecology, 34 (2): 118-124. 

Mayak, S., Tirosh, T., Glick, B.R. (2004): Plant growth-promoting bacteria confer resistance in 

tomato plants to salt stress. Plant Physiol. Biochem., 42: 565-572. 

Milner, J.L., Silo-Suh, L., Lee, J. C., He, H., Clardy, J., Handelsman, J. (1996): Production of 

kanosamine by Bacillus cereus UW85. Appl. Environ. Microbiol., 62: 3061-3065. 

Nielsen, T.H., Sørensen, J. (2003): Production of cyclic lipopeptides by Pseudomonas fluorescens 

strains in bulk soil and in the sugar beet rhizosphere. Appl. Environ. Microbiol., 69: 861-868. 

Nielsen, T.H., Sørensen, D., Tobiasen, C., Andersen, J.B., Christeophersen, C., Givskov, M., J. 

Sørensen, J. (2002): Antibiotic and biosurfactant properties of cyclic lipopeptides produced by 

fluorescent Pseudomonas spp. from the sugar beet rhizosphere. Appl. Environ. Microbiol., 68: 

3416-3423. 

Nishioka, M., Furuya, N., Nakashima, N., Matsuyama, N. (1997): Antibacterial activities of 

metabolites produced by Erwinia spp. against various phytopathogenic bacteria. Ann. 

Phytopathol. Soc. Japan, 63: 99-102. 

Nowak, J., Shulaev, V. (2003): Priming for transplant stress resistance in in vitro propagation. In 

Vitro Cell. Dev. Biol. Plant., 39: 107-124. 

Raaijmakers, J.M., Vlami, M., de Souza, J. T. (2002): Antibiotic production by bacterial biocontrol 

agents. Antonie Leeuwenhoek, 81: 537-547. 

Ryu, C.M., Murphy, J.F., Mysore, K.S., Kloepper, J.W. (2004): Plant growth-promoting 

rhizobacterial systemically protect Arabidopsis thaliana against Cucumber mosaic virus by a 

salicylic acid and NPR1-independent and jasmonic acid-dependent signaling pathway. The 

Plant J., 39: 381-392. 

Serfontein, J.J. (1994): Occurrence of bacterial brown spot of dry beans in the Transvaal province of 

South Africa. Plant Pathology, 43(3): 597-599. 

Sobiczewski, P. (1987): Antagonistic bacteria in relation to Pseudomonas syringae pv. syringae 

occurring in necroses and cankers of sour cherry trees. Fruit Science Reports, 14(4): 179-185.

Simonida Djurć, Vesna Protulipac, Jelica Simeunovic,.. 357 


Proceedings 

INHIBITING ACTIVITY OF PSEUDOMONAS SOIL ISOLATES 

AGAINST TOXIGENIC FRESHWATER CYANOBACTERIA 

NOSTOC SP. 

SIMONIDA ĐURIĆ 1 , VESNA PROTULIPAC 1 , JELICA SIMEUNOVIĆ 2 , ZORICA SVIRČEV 2 , 

MIROSLAV MILADINOVIĆ 3 , DRAGANA JOŠIĆ 3 

1 

University of Novi Sad, Faculty of Agriculture, Novi Sad, Republic of Serbia 

2 University of Novi Sad, Faculty of Science, Department of Biology and Ecology, Novi Sad, 

Republic of Serbia 

3 Institute of Soil Science, Belgrade, Republic of Serbia 

The inhibiting activity of Pseudomonas soil isolates collected from rhizosphere of different 

cultivated plants was investigated against freshwater Cyanobacteria Nostoc sp., producing toxin 

microcystin. Inhibition tests were performed in vitro using liqiud dilution methods by counting cells 

in a hemocytometer under the light microscope, in corresponding stages. Tested rhizospheric isolates 

caused Nostoc sp. growth inhibition from 0.12 to 15.84% for T1 strain and -8.22 to 14.17% for P3 

strain, by decreasing the number of cells and by degrading the chlorophyll in cells. The most effective 

isolates will be tested further in experiments in vivo and optimized for inhibiting activity against 

toxigenic Nostoc sp. strains. 

Key words: Pseudomonas, inhibition, cyanobacteria, Nostoc sp., microcystin. 

INTRODUCTION 

In few past decades, the Plant Growth-Promoting Rhizobacteria (PGPR) was 

included in biological control of many plant pathogens: fungi, bacteria, viruses, insects, 

nematodes, etc. Many diseases were reduced or suppressed by application of PGP bacteria 

(PGPB) (Gerhardson, 2002; Compant et al., 2005). Supression of diseases include 

inhibition of pathogens by competition and/or by antagonism (Couillerot et al., 2009). 

Bacteria from genus Pseudomonas are among the most effective PGPB which act 

via direct and indirect mechanisms. Direct promotion of plant growth involves production 

of the phytohormones (auxins, cytokinins, gibberellins), 1-aminocyclopropane-1-carboxylic 

acid deaminase, and improvement of nutrient availability (N 2 fixation, phosphate 

solubilization). Indirect promotion of plant-growth involve the biological control of plant 

pathogens through the colonization of root surface, the production of extracellular lytic 

enzymes, siderophores, antibiotics, hydrogen cyanide, or by activation of plant defenseresponses 

(Weller et al., 2002; Tsavkelova et al., 2005; Compant et al., 2005). 

The Cyanobacteria, especially ones from eutrophic freshwater habitat, are the group 

of simple and coherent prokaryotes (Turner, 1998). Living in water, producing a high 

biomass, proteins, phycobliins and antibacterial substances they are very important as

358 Inhibiting activity of Pseudomonas soil isolates against toxigenic,... 

sources in food industry, pharmacology, medicine or as a biocontrol agents. In other ways, 

they could be very dangerous, as toxin producers in a case where the water supply of towns 

are based on surface fresh water pools (Namikoshi et al., 1996; Moore, 1996; Erhard etal. 

1997; Simeunovic, 2010). 

Specifically, the neurotoxins (anatoxin, saxitoxin) and hepatotoxins (microcystin, 

nodularin, cylindrospermopsin) associated with cyanobacterial blooms are responsible for 

deaths in wild and domesticated animal populations and have various acute and chronic 

pathogenic effects on humans (Carmichael, 1992; Falconer etal., 1989). Microcystin, a nonribosomal 

synthesized cyclic peptide (Neilan et al., 1999) act by inhibiting protein 

phosphatases which leads to hyperphosphorylation of cellular proteins such as cytokeratin 8 

and 18 (Eriksson et al., 1990; MacKintosh et al., 1990). 

Fig.1: General structure of microcystin (Neilan et al.,1999) 

The aim of the present work was to detect inhibiting activities of PGP 

Pseudomonas bacteria from rhizospheric soil against toxigenic Cyanobacteria Nostoc 

strains T1 and P3. 


Microorganisms 

In this work, we chose five Pseudomonas (Q1, Q4, Q16, P3 and Q20) isolates from 

maize rhizosphere in Šumadija and six Pseudomonas from Vojvodina (PS2, PS4, PS6, PSv, 

PSk and PSd), previously examined. Strains were grown on the King B liquid nutrient 

medium for 48h using shaker incubator adjusted on 150 rpm and 28 o C. After OD 

determination on 600 nm all inocula were adjusted at 10 8 cell ml -1 .


Cyanobacterial strains were grown photoautotrophically in 100 ml Erlenmeyer 

flasks containing 80 ml BG-11 medium buffered with Tris - HCl, pH 7.4 (Rippka et al., 

1979). For this study BG-11 medium without nitrogen (for Nostoc strains) was used. 

Experimental cultures were maintained at 22-24ºC under illumination by cool white 

fluorescent light (50 µmol m -2 s -1 ). In terms of duration of light and dark period mode 12 

hours of light and 12 hours of darkness was used. Cultures in the stationary phase of growth 

(21st day of cultivation) were used for experiment. 

Table 1. Cyanobacterial strains used in experiment and their origin 

Cyanobacterial strain Origin Type 

Nostoc T1 River Tamis (NSCCC) Filamentous, N 2 -fixing 

Nostoc P3 Palic Lake (NSCCC) Filamentous, N 2 -fixing 

*NSCCC-Cyanobacterial Culture Collection of Novi Sad 

Inhibiting activity 

Inhibiting activity was determined by liquid dilution method. The amount of 4,5 ml 

of Nostoc T1 and P3 strains were transferd from the initial inocula (80 ml of cyanobacteria 

in stationary phase with 10 7 cell ml -1 ) into the test tubes. Tested Pseudomonas isolates were 

added in amount of 0,5 ml containing 10 8 CFUml -1 (obtained by OD 600 measurement and 

calculation). 

After seven days of incubation, inhibition were measured by counting cells in a 

hemocytometer under the light microscope (KHC Bi, Olympus, Japan) and the % of 

inhibition was calculated (Kim at al., 2007) 

Data analysis 

The experiment was performed in liquid selective nutrient mediums, in four 

replications. The results were subjected to analysis of variance (ANOVA) and means were 

compared by Fisher LSD Test of homogenous groups (P = 0,05) using the software 

STATISICA 10 and the % of inhibition was calculated. 

RESULTS 

The results of inhibiting activity of rhizospheric isolates of Pseudomonas to Nostoc 

T1 and P3 strains are presented in Table 2. On the basis of cell number decrease, growth 

inhibition of Nostoc T1 strain by the Pseudomonas isolates Q4, Q16, PS2, PS4 and PSd 

showed significant value after seven days period, ranging from 7,43 to 15,84%,. Maximal 

inhibition were caused by Pseudomonas Q4 and Q16, but the chlorophyll degradation was 

registered only with strain PS2 (Fig. 2 and 3). In general, Pseudomonas isolates showed 

lower inhibition effect on Nostoc P3 strain. Only strain PS2 significantly inhibited number 

of Nostoc P3 cells (14,17%), while strains P3 and PS6 stimulated the growth of this 

cyanobacteria.


Table 2. The inhibition effect of different Pseudomonas isolates on toxigenic Nostoc T1 and P3 

strains 

Location 

Šumadija 

Vojvodina 

Pseudomonas 

% of 

% of 

Nostoc T1 

Nostoc P3 

strains (variants) 

inhibition 

inhibition 

Q1 8,9118 c,d* 2,53 8,0113 c,d 5,29 

P3 8,6104 c,d,e 5,83 9,1543 a -8,22 

Q4 

7,6954 a 15,84 7,6896 b,c 9,10 

Q16 7,9870 a,b 12,65 8,3494 c,d 1,30 

Q20 8,7368 c,d,e 4,45 8,3249 c,d 1,59 

PS2 8,3893 b,d,e 8,26 7,2603 b 14,17 

PSd 8,3145 b,e 9,06 7,9683 b,c,d 5,80 

PS4 8,4641 b,d,e 7,43 8,3579 c,d 1,20 

PS6 8,7939 c,d,e 3,81 8,5122 a,d -0,63 

PSv 

9,1319 c 0,12 8,1426 c,d 3,74 

PSk 8,7804 c,d,e 3,97 8,2635 c,d 2,31 

Control 9,1433 c 8,4592 a,c 

* Fisher LSD Test of homogenous groups, the same letter suggest no statistically significant 

differences (P=0,05). 

Fig. 2: Nostoc T1 (mag.10x63) 

Fig. 3: Nostoc P3 (mag.10x63) 

DISCUSSION 

Phytoplankton (Cyanobacteria and algae) blooms in marine and fresh waters 

generally indicate eutrophication that occurs worldwide and causes mass mortalities of fish 

and shellfish, seriously damage agriculture industries, and impact on environmental and 

human health (Nagayama et al., 2003; Jeong et al., 2000). The same authors (Joeng et al., 

2007) in latest study confermed that the growth of marine alga Heterostigma akashiwo 

(Raphidophycese) was strongly suppressed by P. fluorescens Hak-13 in all growth phases, 

with strong alga-lytic activity noted against harmful bloom-forming species in the 

exponential stage (6-22 days). All inhibitions tested in this study were obtained in 

stationary phase of Nostoc strains (21-28 days) with the different efficiency. 

One of the important features of fluorescent Pseudomonas species is production of 

antibiotics as inhibitory compounds which play role in suppression of diseases caused by 

different phytopathogens (Haas and Défago, 2005). The heterocyclic nitrogen–containing


compounds with antibiotic properties – phenazines, were detected as some of the active 

compound of Pseudomonas Q16 and PS2 against phytopathogenic fungi (Protolipac et al., 

2011; Josic et al., 2012). PS2 isolate reduce growth of Alternaria tenuissima originated 

from Echinacea purpurea (Protolipac et al., 2012). Pseudomonas Q16 and PS2 caused 

significant disease reduction (86 and 90,2%) of A. tenuissima on Ocimum basilicum L., 

growing in gnotobiotic condition (Jošić et al., 2012). As a most effective, Pseudomonas 

isolates Q4, Q16 and PS2 can be considered for further tests in variation of cells fractions 

content effects. 

The results of this study allowed selection of rhizospheric isolates Pseudomonas Q4, 

Q16 and PS2 as effective in growth suppression and chlorophyll degradation of toxigenic 

Nostoc strains from river Tamiš and lake Palić. 


The work is a part of the Project III46007 funded by Ministry of Education and 

Science-Republic of Serbia. 

REFERENCES 

Carmichael, W. W. 1992. Cyanobacterial secondary metabolites—the cyanotoxins. J. Appl. 

Bacteriol. 72:445–459. 

Compant, S., Duffy, B., Nowak, J., Clement, C., Barka, E.A. (2005): Use of Plant Growth- 

Promoting Bacteria for Biocontrol of Plant Diseases: Principles, Mechanisms of Action, 

and Future Prospects. Applied and environmental microbiology, 71 (9): 4951-4959. 

Couillerot, O., Prigent-Combaret, C., Caballero-Mellado, J., and Y. Moënne-Loccoz (2009). 

Pseudomonas fluorescens and closely-related fluorescent pseudomonads as biocontrol 

agents of soil-borne phytopathogens. Lett. Appl. Microbiol. 48, 505-512. 

Erhard, M., H. von Do¨hren, and P. Junblut. (1997). Rapid typing and elucidation of new 

secondary metabolites of intact cyanobacteria using MALDITOF mass spectrometry. 

Nat. Biotechnol. 15:906–909. 

Eriksson, J.E., Toivola, D., Meriluoto, J.A.O., Karaki, H., Han, Y.-G., Hartshorne, D., (1990). 

Hepatocyte deformation induced by cyanobacterial toxins re¯ ects inhibition of protein 

phosphatases. Biochem. Biophys. Res. Commun. 173, 1347-1353. 

Falconer, I. R., and T. H. Buckley. 1989. Tumour promotion by Microcystis sp., a blue-green 

alga occurring in water supplies. Med. J. Aust. 150:351. 

Gerhardson, B. (2002): Biological substitutes for pesticides. Trends Biotechnol., 20: 338-343. 

Haas, D., and G. Défago (2005). Biological control of soil-borne pathogens by fluorescent 

pseudomonads. Nat. Rev. Microbiol. 3, 307-319. 

Jeong, J.H., Jin, H.J:, Sohn, C.H, Suh,K.H., Hong,Y.K. (2000). Algicidal activity of the seaweed 

Corallina pilulifera against of red tide microalgea, J. Appl. Phycol., 12, 37-43. 

Jošić, D., Pavlović, S., Starović, M., Stojanović, S., Stanojković-Sebić, A., Pivić, R. (2012): 

Biocontrol of Alternaria tenuissima originated from Ocimum basilicum L using 

indigenous Pseudomonas spp. strains. Proceedings of the 7 th Conference on Medicinal 

and Aromatic plants of Southeast European Countries, May 27 th -31 st , Subotica, Serbia, 

pp. 195-200. 

Moore, R. E. 1996. Cyclic peptides and depsipeptides from cyanobacteria: a review. J. Ind. 

Microbiol. 16:134–143.


Nagayama, K., Shibata, T., Fujimoto, K., Honjo, T., Nakamura, T. (2003). Algicidal effect of 

phlorotannins from the brown alga Ecklonia kurome on red tide microalgae, Agriculture, 

218, 601-611. 

Namikoshi, M., and K. L. Rinehart. 1996. Bioactive compounds produced by cyanobacteria. J. 

Ind. Microbiol. 17:373–384. 

Neilan B.A., Dittman E., Rouhiainen L., Bass A., Schaub V., Sivonen K. and Borner T (1999). 

Nonribosomal Peptode Synthesis and Toxigenisity of Cyanobacteria, Journal of 

Bacteriology, Vol. 181, No. 13, 4089-4097. 

Protolipac, K., Jošić, D., Starović, M., Pavlović, S., Poštić, D., Popović, T., Stojanović, S. 

(2011): The Effect of Pseudomonas Isolates on Growth and Pathogenicity of Alternaria 

tenuissima. 7 th Balkan Congress of Microbiology - Microbiologia Balkanica, Belgrade, 

Serbia, October 25-29. 

Protolipac, K., Pavlović, S., Starović, M., Stojanović, S., Lepšanović, Z., Jošić, D. (2012): 

Antifungal activity of idigenous Pseudomonas isolates aganist Alternaria tenuissima 

isolated from Echinacea purpurea. Proceedings of the 7 th Conference on Medicinal and 

Aromatic plants of Southeast European Countries, May 27 th -31 st , Subotica, Serbia, pp. 

187-191. 

Rippka R, Deruelles J, Waterbury JB, Herdman M, Stanier R.Y. (1979) Generic assignments, 

strainhistories and properties of pure cultures of cyanobacteria. J Gen Microbiol 111:1- 

61 

Tsavkelova E.A., Klimova S. Yu, Cherdyntseva T.A, Netrusov A. I. (2006). Microbial 

producers of plant growth stimulators and their practical use: A review. App. Biochem. 

Microbiol. 42 (2): 117-126. 

Turner, S. (1998). Molecular systematics of oxygenic photosynthetic bacteria. Plant Syst. Evol. 

11:13–52. 

Weller D.M, Raaijmakers J.M, Gardener B.B.M, Thomashow L.S. (2002). Microbial 

populations responsible for specific soil suppressiveness to plant pathogens. Ann. Rev. 

Phytopath. 40: 309–348.

Tatjana Popović, Zoran Milićević, Nenad Trkulja,... 363 

International Symposium: Current Trends in Plant Protection UDK: 632.952 

Proceedings 

CU-CITRATE, A NEW SOURCE OF CU ION AS A FUNGICIDE 

TATJANA POPOVIĆ 1 , ZORAN MILIĆEVIĆ 1 , NENAD TRKULJA 1 , ANJA MILOSAVLJEVIĆ 1 , 

PREDRAG MILOVANOVIĆ 2 , GORAN ALEKSIĆ 1 , ŽARKO IVANOVIĆ 1 

1 

Institute for Plant Protection and Environment, Belgrade, Republic of Serbia 

2 Galenika-Fitofarmacija, Belgrade, Republic of Serbia 

Four copper fungicides were evaluated for their in vitro effect on the colony growth of 

Monilinia laxa in pre-amended Potato dextrose agar (PDA) medium. The fungicides showed variable 

response in inhibiting the colony growth of the pathogen according to different EC 50 values. Cucitrate 

proved to be the best fungicides giving very high toxicity on the fungus growth. Toxicity of 

Cu-sulfate, Cu-hydroxide and Cu-oxychloride as compared to the Cu-citrate was 8, 40 to 60 times 

lower respectevely. 

Key words: Copper citrate, fungicide, efficacy 

INTRODUCTION 

Pesticides containing copper have a historical significance in that the fungicidal 

properties of Bordeaux mixture, named after the Bordeaux region in France, were 

accidentally discovered (Fishel, 2011). Today, there are approximately 15 various active 

ingredients registered for use over the world that contain some form of copper, depending 

on how their composition is defined (Fishel, 2011). Cu-Citrate is a complex compound of 

copper, which is characterized by a higher degree of dissociation in relation to other copper 

compounds which are now applied as fungicides. Therefore, Cu-citrate can be used in the 

application of lower concentrations compared to other copper products, and how, according 

to Fishel (2011) expressed no toxic effects to fish, birds, mammals and bees, it can be 

recommended to be used as an antifungal agent. 

Brown rot blossom blight, caused by Monilinia laxa (Aderhold & Ruhland) Honey, 

is a devastating disease of sour cherry (Prunus vulgaris Mill.). The disease is endemic in 

Europe and United States (Ogawa et al. 1985; Osorio et al., 1994; Holb, 2003). Depending 

on weather conditions, blossom blight can be controlled with one to three applications of 

protective or systemic fungicides during the bloom period in conventionally grown stone 

fruit orchards (Ogawa et al. 1985; Holb, 2003). Copper based fungicides are traditionally 

used to control brown rot blossom blight caused by M. laxa (Holb and Schnabel, 2005; 

Obenaus et al., 2010). 

The aim of this study was to test in vitro efficacy of Cu-citrate comparing to other 

Cu-fungicides against M. laxa isolates.

364 Cu-citrate, a new source of Cu ion as a fungicide 


In vitro evaluation of copper fungicides to check preferment of Cu-citrate in 

inhibitory of colony growth of the fungus M. laxa was done through in vitro method 

described by Popović (2004) on potato dextrose agar (PDA) medium. The experiment was 

conducted in completely randomized design. Four fungicides, Cu-citrate, Cu-(II) hydroxide, 

Cu-oxychloride and Cu-sulfate were tested, each with different doses of i.e. (Table 1). 

Table 1: Tested copper fungicides on fungal cultures according to active ingredient, content of 

Cu ions and tested doses 

Fungicides 

Content of a.i. 

in formulations 

Tested doses Cu ++ (mg/L) 

Cu-citrate 229 g/l 10; 25; 30; 40; 50; 70; 90; 100; 200; 400 

Cu-(II) hydroxide 500 g/kg 32; 320; 640; 1000; 2000; 3000; 4000; 6000 

Cu-oxychloride 350 g/kg 350; 700; 1500; 3600; 5000 

Cu-(II) sulfate 100 g/l 250; 500; 1000; 2000; 5000 

Four isolates of M. laxa were collected from symptomatic shoots affected with 

brown rot disease on several stone fruit from different locality in Serbia (TABLE 2). 

Isolates were collected from plum (Prunus domestica L.), sour cherry (Prunus cerasus L.), 

peach [Prunus persica (L.) Batsch] and apricot (Prunus armeniaca L.) orchards. All 

isolates were grown in 9-cm-diameter plastic Petri dishes on potato dextrose agar (PDA) 

medium at 22°C in the dark for mycelial production. Identification was conducted by 

combining culture characteristics, such as growth rate and colour, with morphological data 

such as the conidial dimensions (Byrde and Willetts, 1977). 

Table 2: Isolates of Monilinia laxa with information of host, locality and year of isolations 

Isolates Host Locality Year of isolations 

KJ2 Apricot Šabac 2010 

SDV2 Cherry Smederevo 2010 

BRIC Peach Topola 2010 

SD1 Plum Grocka 2010 

After autoclaving of PDA medium, fungicides in different doses were added in 

separate 200 ml flasks and 10 ml of each concentration was poured in sterilized 50 mm 

Petri plates. The fungus, grown two weeks on PDA at 22°C were picked from purified 

culture in the form of a 3 mm agar disc and inoculated in the center of each Petri plate. Four 

replicate plates were inoculated for each fungicidal dose. The PDA medium without 

fungicide was kept as control. The dishes were incubated at 25°C. Mean colony diameter 

was measured after 7, 14 and 21 days. 

Data analysis: 

First readings of colony growth (after 7 days) were taken for calculating EC 50 

(fungicide concentration which inhibits fungal development by 50%). Mean colony 

diameter (mm) of each isolate M. laxa was measured (minus the diameter of inoculation 

plug) by calculating the mean of two perpendicular colony diameters. The mean diameter 

of colonies was expressed as a percentage of colony diameters in control treatments and the

Tatjana Popović, Zoran Milićević, Nenad Trkulja,... 365 

relative growth (RG) was estimated. Based on relative growth EC 50 value was calculated 

using MCSTAT ver.2.10 (Russel D. F., University of Michigan). 

RESULTS 

In this study, fungicides were evaluated for their effect on mycelial growth of M. 

laxa to identify best effective accessible Cu ions. The fungicides showed variable response 

in inhibiting the colony growth of the pathogen according to their nature and specificity at 

different EC 50 values. Obtained EC 50 values indicate a very high toxicity of Cu-citrate 

compared to other copper fungicide. The mean EC 50 for Cu-citrate was eight times lower 

than for Cu-sulfate, and 40 to 60 times lower compared to Cu-hydroxide and Cuoxychloride, 

respectively (Table 3). 

Table 3: Calculated EC 50 values for isolates M. laxa and mean values EC 50 for all isolates to 

different copper fungicides 

Fungicides Isolates EC 50 (mg/l) Mean EC 50 (mg/l) 

BRIČ 54.42 

Cu-citrate 

KJ3 46.25 

SDV2 52.57 

ŠD1 54.06 

BRIČ 2253.70 

Cu-(II) hydroxide 

KJ3 2639.13 

SDV2 1648.26 

ŠD1 1789.40 

BRIČ 3535.09 

Cu-oxychloride 

KJ3 3816.31 

SDV2 2315.45 

ŠD1 2940.67 

BRIČ 417.04 

Cu-(II) sulfate 

KJ3 417.02 

SDV2 416.93 

ŠD1 355.48 

EC 50 : The effective concentration to inhibit mycelial growth by 50% 

51.82 

2082.62 

3151.88 

401.62 

DISCUSSION 

Although copper is non systemic however it kills fungal spores by combining with 

sulphhydral group of certain enzymes. Inactivation of fungal enzymes by copper ions gives 

good inhibition than other non-systemic fungicides. Due to possible negative effects on 

environment, investigations of alternative copper source are needed. Cu-citrate as a new 

form of Cu ions does not have a toxicities to fish, birds, mammals and bees (Fishel, 2011). 

Overall suppressive effect was displayed by all the tested Cu-fungicides and the 

colony growth decreased with increase of fungicidal doses. Considering the efficacy and 

cumulative performance, tested fungicides could be placed into three groups. First group, 

Cu-citrate constitutes highly effective fungicides. Second group includes Cu-sulfate with 

lower toxicity and appeared to be medium effective. Third group comprised of Cu-

366 Cu-citrate, a new source of Cu ion as a fungicide 

hydroxide and Cu-oxychloride was comparatively less effective. There are no many 

literature sources about use of Cu-citrate as a fungicide, except in Florida where it is 

registrated as an algaecide, bactericide and fungicide (Fishel, 2011). Use of cupric citrate as 

a growth promoter (de Almeida Brainer et al., 2003), indicates the need to examine the 

possibility of introducing such compounds as a fungicides with the aim of protecting the 

environment. 

Holb and Schnabel (2005) performed in vivo tests with copper hydroxide used alone 

or in combination with micronized wettable sulfur against M. laxa and their results showed 

that both treatments were not as effective as the conventional standard - vinclozoline and 

penconazol and caused more damage on spur-leaf clusters during wet weather conditions, 

but significantly increased crop yield compared with the untreated control. 

Evaluation of EC 50 values of copper fungicides also helped to standardize the best 

fungicides against fungi in the present study. This study could contribute in a future to 

devise fungicidal application schedule for commercial orchards. 


The work is a part of the Projects No. III43010 and TR31018 funded by Ministry of 


REFERENCES 

Byrde, R.J.W., Willetts, H.J. (1977). The brown rot fungi of fruit: Their biology and control. 

Oxford, UK: Pergamon Press. 

De Almeida Brainer, M.M., Menten, J.F.M., do Vale, M.M., de Morais, S.C.D. (2003): Cupric 

citrate as growth promoter for broiler chickens in different rearing stages. Scientia 

Agricola, 60(3), 441-445. 

Fishel, F.M. (2011): Pesticide Toxicity Profile: Copper-based Pesticides. Pesticide Information 

Office, Florida Cooperative Extension Service, Institute of Food and Agricultural 

Sciences, University of Florida. 

Holb, I. J. (2003): The brown rot fungi of fruit crops (Monilinia spp.). I. Important features of 

their biology. Int. J. Hortic. Sci., 9(3-4): 23-36. 

Holb, I. J. (2004): The brown rot fungi of fruit crops (Monilinia spp.). III. Important features of 

their disease control. Int. J. Hortic. Sci., 10(4): 31-48. 

Holb, I.J., Schnabel, G. (2005): Effect of fungicide treatments and sanitation practices on brown 

rot blossom blight incidence, phytotoxicity and yield for organic sour cherry production. 

Plant Disease 89: 1164-1170. 

Obenaus, S., Rank, H., Scheewe, P. (2010): Investigations of control strategies against Monilia 

disease in organic sour cherry production. 

http://www.ecofruit.net/2010/63_SC_S_Obenaus_H_Rank_P_Scheewe_S380bis383.pdf 

Ogawa, J. M., Manji, B. T., Sonoda, R. M. (1985): Management of the brown rot disease on 

stone fruits and almonds in California. N. Y. State Agric. Exp. Stn. Geneva Specific 

Rep., 55: 8-15. 

Osorio, J. M., Adaskaveg, J. E., Ogawa, J.M. (1994): Inhibition of mycelial growth of Monilinia 

species and suppression and control of brown rot blossom blight of almond with 

iprodione and E-0858. Plant Dis., 78: 712-716. 

Popović, T. (2004): Etiološka proučavanja sušenja grana breskve na području Fruške Gore. 

Poljoprivredni fakultet, Novi Sad, p.110.

Trkulja Nenad, Ivanović Žarko, Popović Tatjana,... 367 


Proceedings 632.934 

EXISTENCE OF CERCOSPORA BETICOLA ISOLATES 

RESISTANT TO BENZIMIDAZOLE AND TRIAZOLE 

FUNGICIDES IN NATURAL POPULATIONS 

TRKULJA NENAD 1 , IVANOVIĆ ŽARKO 1 , POPOVIĆ TATJANA 1 , ŽIVKOVIĆ SVETLANA 1 , 

ORO VIOLETA 1 , DOLOVAC NENAD 1 , BOŠKOVIĆ JELENA 2 

Institute for Plant Protection and Environment, Belgrade 1 

Faculty of Biofarming, Bačka Topola 2 

Cercospora beticola is the most destructive disease of sugar beet worldwide. If fungicides are 

not appropriately applied, C. beticola can cause high yield losses even up to 50%. Appearance of the 

populations resistant to fungicides reduced their efficacy in the sugar beet fields . In this study we 

compared existence of the resistant populations of C. beticola to benzimidazole and triazole 

fungicides in natural and in the fungicides selected populations. Obtained results indicate very 

significant presence of resistant isolates to benzimidazole fungicides in natural populations which 

exceeded 90%. On the contrary, no data on the existence of resistant populations of C. beticola to 

triazole fungicides in the natural populations were recorded. 

Key words: Cercospora beticola, fungicides resistance, benzimidazoles, triazoles. 

INTRODUCTION 

Sugar beet leaf spot caused by Cercospora beticola Sacc. is the most important 

foliar disease of sugar beet worldwide (Weiland and Koch, 2004). In the absence of control 

measures C. beticola could cause significant yield losses up to 50% (Shane and Teng, 

1992). Crop protection of sugar beet is based on intensive application of fungicides because 

C. beticola produces a great amount of inoculum which in favorable weather conditions 

spread rapidly in the field. Protective fungicides such as chlorothalonil or maneb were 

available in the past but were not favored because they had to be applied every 10 to 14 

days. On the other hand, the benzimidazole and triazole fungicides have systemic activity 

and could stop the infections that had occurred during the previous 24 to 36 h and 

application intervals could be extended from 14 to 21 days (Windels et al. 1998). 

For the management of C. beticola in Serbia benzimidazole fungicides were used a 

four decades ago, while triazoles were used somewhat less. Benzimidazoles act by 

inhibiting a microtubule assembly during mitosis by binding to ß-tubuline subunits 

(Davidse 1986). Under the selection force of benzimidazole fungicides C. beticola 

populations favored the rapid development of resistant strains (Dovas et al. 1976). 

Resistance to benzimidazole fungicides in Serbia was recorded for the first time in 1976 

after short period of their use (Marić et al. 1976). Thereafter the use of benzimidazoles for 

the control of Cercospora leaf spot in sugar beet crops was reduced up to one treatment per

368 Existence of cercospora beticola isolates resistant to... 

year. In recent studies, a high frequency of resistant populations was detected in the 

populations C. beticola at the sugar beet field (Trkulja et al. 2009; 2010). 

Resistance to triazole fungicides was detected worldwide in Greece, Italy and USA 

(Karaoglanidis et al., 2000; Moretti et al., 2003; Bolton et al., 2012). In Serbia resistance to 

triazole fungicides was detected by Trkulja et al., (2009). Despite their site specific mode of 

action, triazole fungicides are considered as moderate resistance-risk fungicides 

(Georgopoulos, 1985). Resistance to DMI fungicides is under multigenic control, 

increasing gradually by additive action of the different resistance genes (DeWaard, M. A., 

1993). As the consequence of polygenic control of resistance, populations may, therefore, 

shift gradually from baseline sensitivity to a distinct level of resistance (Koller, et al. 1997). 

To investigate the existence of C. beticola populations resistant to benzimidazole and 

triazole fungicides in natural populations, we compared a frequency of resistant populations 

in the natural populations with populations treated with these fungicides. 


Collection of sugar beet leaves with sporulated lesion of cercospora leaf spot disease 

was conducted during 2009 at localities Ruma and Stari Tamiš, in order to collect isolates 

which were intensively treated with fungicides in the past few decades. On the other hand, 

from the field of beet root which have newer been treated with fungicides, leaves with 

symptoms of cercospora leaf spot were collected to isolate natural populations of C. 

beticola. 

Symptomatic leaves were transfered to laboratory and used for isolation of the 

pathogen. Single monosporial isolates were obtained by transferring a one conidium from 

one lesion per leaf into a potato dextrose agar (PDA). After that, plates were incubated two 

days at 25ºC in the dark. Colonies were than transferred to a fresh PDA plates for ten days 

at the same conditions. These colonies were used for the following examinations. From 

locality Ruma, a total of 34 C. beticola isolates were obtained, from locality Stari Tamiš 37 

and from Loznica 31 isolates. 

To determine a frequency of resistant isolates to benzimidazole and triazole 

fungicides they vere tested on discriminatory concentrations. For benzimidazoles we used 

commercial formulations of carbendazim 500 g/l (Galofungin, 500 SC; GALENIKA- 

FITOFARMACIJA, Serbia) and thiophanate-methyl 450 g /l (Galofungin T, 450 SC; 

GALENIKAFITOFARMACIJA, Serbia). Isolates were tested at the discriminatory 

concentrations (DC) which for carbendazim was 1 mg/l according to Karaoglanidis et al., 

(2003) while for thiophanate-methyl was 5 mg/l as determined by Weiland and Halloin 

(2001). 

For triazole fungicides we used commercial formulations of flutiafol 250 g/l (Impact 

25-SC, Cheminova, Denmark) and tetraconazole 125 g/l (Eminent 125-ME, Isagro, Italy). 

According to previously conducted research, appropriate discriminatory concentration was 

1 mg/l for both fungicides flutriafol and tetraconazole (Georgopoulos, 1987; Karaoglanidis 

et al., 2003). 

Commercial formulations of the fungicides were dissolved in sterile distilled water 

before the test. Autoclaved PDA in Petri dishes was cooled to 40-50 o C and amended with 

fungicide solutions to obtain discriminatory concentrations for all tested fungicides. 

Mycelial plugs (5 mm in diameter) were taken from the edge of 14-day-old colonies of each 

isolate and placed on the centre of PDA plates amended with fungicides in order to 

discriminate resistant from sensitive isolates. Control Petri dishes were not amended with


fungicides. After incubating the plates at 25°C for seven days in the dark, the radial growth 

(colony diameter) of each isolate was measured and the diameter of the original mycelial 

plug (5mm) was subtracted from these measurements. For each plate, the average colony 

diameter (measured in two, perpendicular directions) was used to calculate relative growth 

(RG). The RG was calculated by formula: 

RG= (average colony diameter at DC / average colony diameter in contoll) x 100 

(Karaoglanidis et al., 2003). 

Isolates of C. beticola were classified as resistant if the RG measured using the 

discriminatory concentration was ≥50% compared with the control (Russell 2004). 

RESULTS 

From 34 isolates originated from locality Ruma, only one was sensitive to 

benzimidazole fungicides i.e. carbendazim and thiophanate-methyl, while the remained 33 

were resistant. Relative growth of resistant isolates was very intense compared to a control 

treatment and exceeded 90%. Frequency of resistance to benzimidazole fungicides at 

locality Ruma was very high 97%. Five out of 37 C. beticola isolates from locality Ruma 

were resistant to triazole fungicides flutriafol and tetraconazole. Frequency of resistant 

isolates was 14.7% (Graph. 1). 

Graph. 1. Frequency of C. beticola isolates resistant to benzimidazole and triazole fungicides 

at locality Ruma. 

At locality Stari Tamiš where benzimidazole and triazole fungicides were applied, a 

frequency of resistant isolates to benzimidazole fungicides was very high (91.8%). From 

total of 37 isolates, 34 had exhibited a low sensitivity to benzimidazole fungicides. At 

discriminatory concentration of triazole fungicides, six out of 37 isolates were resistant and 

had a relative growth up to 80% compared to control. Frequency of resistance to triazole 

fungicides at locality Stari Tamiš was 17.1% (Graph. 2).


Graph. 2. Frequency of C. beticola isolates resistant to benzimidazole and triazole fungicides 

at locality Stari Tamiš. 

Isolates of C. beticola obtained from locality Loznica exhibited a very high level of 

resistance frequency to benzimidazole fungicides. From the total of 31 isolates, 30 had a 

low sensitivity to carbendazim and thiophanate-methyl. On the contrary there was no 

isolates of C. beticola resistant to triazole fungicides (Graph. 3). 

Graph. 3. Frequency of C. beticola isolates resistant to to benzimidazole and triazole fungicides 

at locality Loznica. 

DISCUSSION 

Resistance to benzimidazole fungicides in populations of C. beticola for the first 

time was recorded in 1973 in Greece after two years of their application (Georgopoulos and 

Dovas, 1973) and later in the USA as well (Ruppel et al., 1974). In Serbia, benzimidazole 

resistance was detected for the first time by Marić et al. (1976), whereafter the 

benzimidazole fungicides were used for once a year. Despite their lower application in the 

field of sugar beet, a high frequency of resistant C. beticola populations was detected 

(Trkulja et al., 2010). In this study we detected a high frequency of resistance C. beticola 

isolates at localities Ruma and Stari Tamiš, where benzimidazole fungicides were used 

intensively in the past. Conversely frequency of resistant populations was surprisingly high


at locality Loznica in the field of root beet where benzimidazole fungicides have newer 

been used. Dovas et al. (1976) in their study detected a low but constant level of resistant C. 

beticola isolates in the field where benzimidazole fungicides have newer been used. 

Nevertheless this research has provided no evidence that the frequency of benzimidazoleresistant 

strains declines after fungicides were discontinued. However, Karaoglanidis et al. 

(2003) detected very low frequency of resistant C. beticola at locality where benzimidazole 

use was discontinued after 1973. 

Due to polygenic control of resistance to triazole fungicides, development of 

resistance is slow and quantitative. Under the selection force of a triazole fungicides, the 

fraction of the population with lower sensitivity will gradually be increased and this can 

lead to a weaker disease control (Skylakakis, 1987). This research revealed presence of 

resistant isolates in populations Ruma and Stari Tamiš, while in locality Loznica resistant 

isolates have not been found. This research is in correlation with the fact that isolates 

resistant to triazole fungicides have a high fitness penalty. Karaoglanidis et al. (2002) 

suggested that the frequency of resistant isolates to triazole fungicides was significantly 

lower during the first sampling and after the end of the spraying period of the previous year, 

indicating that resistant strains either cannot compete well with the sensitive strains in the 

absence of DMI treatments or that they cannot survive well during overwinter. Moretti et 

al. (2003) detected low fitness and virulence isolates of C. beticola resistant to triazole 

fungicides compared to sensitive populations. 




REFERENCES 

Bolton, M.D., Birla, K., Rivera-Varas, V., Rudolph, K.D., Secor, G.A. (2012): Characterization of 

CbCyp51 from field isolates of Cercospora beticola. Phytopathology. 102(3):298-305. 

Davidse, L. C. (1986): Benzimidazole fungicides: mechanism of action and biological impact. Annual 

Review of Phytopathology, 24, 43–65. 

DeWaard, M. A. (1993): Recent developments in fungicides. Pages 11-19 in: Modern Crop 

Protection: Developments and Perspectives. J. C. 

Dovas C, Skylakakis, G., Georgopoulos, S.G. (1976): The adaptability of benomyl-resistant 

population of Cercospora beticola in Northern Greece. Phytopathology 66: 1452–1456 

Georgopoulos, S.G., Dovas, C. (1973): Occurence of Cercospora beticola strains resistant to 

benzimidazole fungicides in northern Greece. Plant Disease Reporter 57, 321–324. 

Georgopoulos, S. G. (1985): Thr genetic basis of classification of fungicides according to resistance 

risk. EPPO Bulletin, 15, 513-517. 

Georgopoulos, S.G. (1987): The development of fungicide resistance. In: Wolfe, M.S., Caten, C.E. 

(Eds.), Populations of Plant Pathogens: Their Dynamics and Genetics. Blackwell Scientific 

Publications, Oxford, UK, pp. 239–251. 

Koller, W., Wilcox, W. F., Barnard, J., Jones, A. L., Braun, P. G. (1997): Detection and quantification 

of resistance of Venturia inaequalis populations to sterol demethylation inhibitors. 

Phytopathology 87:184-190. 

Karaoglanidis, G.S., Ioannidis, P.M., Thanassoulopoulos, C.C. (2000): Reduced sensitivity of 

Cercospora beticola to sterol-demethylationinhibiting fungicides. Plant Pathology 49, 567– 

572.


Karaoglanidis, G. S., Ioannidis, P.M., Thanassoulopoulos, C.C. (2002): Changes in sensitivity of 

Cercospora beticola populations to sterol-demethylation-inhibiting fungicides during a 4- 

year period in northern Greece. Plant Pathology 51, 55–62. 

Karaoglanidis, G. S., Karadimos, D. A., loannidis, P. M., loannidis, P. I. (2003): Sensitivity of 

Cercospora beticola populations to fentin-acetate, benomyl and flutriafol in Greece. Crop 

Protection, 22, 735–740. 

Marić, A., Petrov, M., Maširević, S. (1976): Pojava tolerantnosti kod Cercospora beticola Sacc. 

prema benomilu u Jugoslaviji i mogućnosti suzbijanja ovog parazita. Zaštita bilja, 27, 227- 

236. 

Moretti, M., Arnoldi, A., D`Agostina A., Farina, G., Gozzo, F. (2003): Characterization of fieldisolates 

and derived DMI-resistant strains of Cercospora beticola. Mycological Research 

107: 1178-1188. 

Ruppel, E.G., Scott, P.R., (1974): Strains of Cercospora beticola resistant to benomyl in the USA. 

Plant Disease Reporter 58, 434–436. 

Russell, P. E. (2004): Sensitivity baselines in fungicide resistance research and management. FRAC 

Monograph No. 3. Crop Life International, Brussels, Belgium. 

Shane, W.W., Teng, P.S. (1992): Impact of Cercospora leaf spot on root weight, sugar yield and 

purity of Beta vulgaris. Plant Disease 76: 812–820 

Skylakakis, G. (1987): Changes in the composition of pathogen populations caused by resistance to 

fungicides. In: Wolfe MS and Caten CE (eds) Populations of Plant Pathogens: Their 

Dynamics and Genetics (pp 222–237) Blackwell Scientific Publications, Oxford 

Trkulja, N., Aleksić, G., Starović, M., Dolovac, N., Ivanović, Ž., Živković, S. (2009): Osetljivost 

izolata Cercospora beticola prema karbendazimu i flutriafolu u Srbiji. Zaštita bilja, 270, 

237- 45. 

Trkulja, N., Starović, M., Aleksić, G., Dolovac, N., Ivanović, Ž., Poštić, D., Gavrilović, V. (2010): 

Determining the frequency of resistance of isolates Cercospora beticola (Sacc.) originating 

from the location Sid to carbendazim and flutriafol. 3rd international scientific/ profesional 

conference: Agriculture in nature and environment protection. Vukovar, 31st May- 2nd 

June. Proceedings and abstracts, 210-214. 

Weiland, J., Koch, G. (2004): Sugar beet leaf spot disease (Cercospora beticola Sacc.). Molecular 

Plant Pathology 5(3): 157–166. 

Weiland, J. J., Halloin, J. M. (2001): Benzimidazole resistance in Cercospora beticola sampled from 

sugarbeet fields in Michigan, USA. Canadian Journal of Plant Pathology, 23, 78–82. 

Windels, C.E., Lamey, H.A., Hilde, D., Widner, J., Knudsen, T., (1998): A Cercospora leaf spot 

model for sugar beet: in practice by an industry. Plant Disease 82, 716–726.

Jelica Balaž, Dragana Radunović, Marija Krstić 373 


Proceedings 

STATUS OF ERWINIA AMYLOVORA IN MONTENEGRO 

JELICA BALAŽ 1 , DRAGANA RADUNOVIĆ 2 , MARIJA KRSTIĆ 3 

1 Faculty of Agriculture, Novi Sad, Serbia 

2 

Extension Service in Plant Production, Biotechnical Faculty, Podgorica, Montenegro 

3 

Ministry of Agriculture and Rural Development, Podgorica, Montenegro 

Literature data on Erwinia amylovora in Montenegro is very poor. The pathogen was first 

reported in 1996, on a couple of pear trees near Bijelo Polje. Presence of E. amylovora was 

experimentally proven in 2003, on apple samples from the vicinity of Nikšić. Monitoring performed 

during the period of June-July 2012 confirmed wide distribution of this pathogen in Montenegro, with 

expanding host range. The most endangered fruit species is quince, while flower and shoot fire blight 

are predominant types of symptoms. Infection intensity in quince tree tops is most often about 30%, 

but sometimes even much higher. The disease occurs sporadically (1-3%) on apple and pear trees. 

Medlar (Mespilus germanica) and hawthorn (Crategus sp.) are established as completely new hosts of 

E. amylovora in Montenegro. This indicates the spread of E. amylovora in Montenegro and need for 

its control, using integrated control measures. 

Keywords: Erwinia amylovora, Montenegro, distribution, fruits and hawthorn 

INTRODUCTION 

Although bacterial fire blight (Erwinia amylovora) is well-known and probably the 

most studied pome fruit disease, it is still a major threat when first occurs in a country. In 

new areas, this quarantine pathogen finds new hosts and spreads freely until organized and 

regular control measures are introduced at state level. In former Yugoslavia, the occurrence 

of E. amylovora was first established on pear in Macedonia (1989) and the presence of this 

pathogen was officially confirmed in 1990 (EPPO Reporting Service, 1991; Panić and 

Arsenijević, 1996). At that time, bacterial fire blight was already recorded in Serbia and 

Bosnia and Herzegovina. Since then, E. amylovora has gradually spread over all newly 

established countries, also increasing the number of its host plants. Because of its large 

pome fruit growing areas, Serbia suffered the greatest commercial damages caused by 

bacterial fire blight (Panić and Arsenijević, 1993 and 1996; Balaž et. al., 1997, 2009; Balaž, 

1999, 2000; Gavrilović and Arsenijević, 1998; Jovanović, 1999; Obradović et. al., 2003; 

Arsenijević and Gavrilović, 2007;). In Croatia, E. amylovora was first reported in 1995 

(Cvjetković et al., 1999). In Slovenia, bacterial fire blight occurred in 2001-2002 at the 

latest, and since 1998, a regular monitoring has been carried out by its Phytosanitary 

Service, in order to promptly detect the occurrence of this disease, which is now under 

control in this country (Dreo et al., 2006). There have been only a few literature data on E. 

amylovora in Montenegro for the past 20 years. Arsenijević and Gavrilović (2007) reported 

that symptoms of bacterial fire blight were first observed in Montenegro in 1996, on a

374 Status of Erwinia amylovora in Montenegro 

couple of pear trees near Bijelo Polje, and that the presence of this bacterium was 

experimentally proven in 2003, on apple trees from the vicinity of Nikšić (Župa Nikšićka). 

Epiphytotic occurrence of E. amylovora on quince (Bijelo Polje, Berane, Mojkovac and 

Župa Nikšićka) was reported in 2003 (Obradović et al., 2003). 

Distribution and host range of E. amylovora in Montenegro were investigated in 

2012. 


Monitoring of E. amylovora 

Monitoring of E. amylovora included health examination of pome fruits in fruit 

growing regions situated in northern, western and central parts of Montenegro. The 

examination was carried out in the period of June-July 2012 and it covered private orchards 

and numerous yards with single pome fruit trees, in municipalities of Berane, Bijelo Polje, 

Andrijevica, Kolašin, Nikšić, Pljevlja and Podgorica. Visual examination was performed 

and the infection level in tree tops was estimated using the scale 1-10 (Zwet and Keil, 

1979). Isolation from representative samples was carried out on suitable nutrient media and 

isolates were determined on the basis of their examined pathogenicity and bacteriological 

characteristics. 

Determination of isolates 

Isolation of bacteria from samples with various types of symptoms (shoot fire blight, 

necrosis of flower and leaf petioles and fruits) was carried out on sucrose media – Nutrient 

Sucrose Agar (NSA) (Lelliott and Stead, 1966). Pathogenicity was examined on immature 

pear fruits, inoculated by pricking with a needle (Schaad, 1980). Hypersensitive reaction 

(HR) was examined on tobacco leaves by infiltration of bacterial suspension into interneural 

tissue with a medical needle (Klement et. al., 1990). Cultural characteristics of 

colonies were examined on NSA and King B media. The production of levan and 

fluorescent pigment were examined on NSA and King B media, respectively (Lelliott and 

Stead, 1987; King et al., 1954). Morphological characteristics were determined by 

examining the shape of bacterial cells using optical microscope (BTC, BIM-312 T, 1000 x 

magnification) with immersion objective. Gram reaction was examined using 3% KOH 

(Suslow et al., 1982). Some biochemical and physiological characteristics, such as the 

presence of oxidase (Kowacs, 1956), were also examined, and oxidative - fermentative 

(O/F) test was carried out (Hugh and Leifson, 1953). 

RESULTS 

Monitoring of E. amylovora 

The obtained results show that E. amylovora is widely distributed over the northern 

and western regions of Montenegro, characterized by fruit production. The presence of 

bacterial fire blight was determined on quince, pear, apple, medlar and hawthorn (Figures 1, 

2, 3, 4, and 5). Medlar and hawthorn are reported for the first time as the hosts of E. 

amylovora in Montenegro. The highest infection level was recorded on quince, which is the 

most endangered fruit species. In mentioned regions, it is mainly grown in private yards 

(single trees). Symptoms of bacterial fire blight were clearly manifested on almost all 

examined quince trees, especially in municipalities of Berane and Bijelo Polje. The 

infection level in quince tree tops was usually about 30%, and sometimes even higher.


According to estimation carried out in June and July 2012, prevailing symptom was fruit 

and shoot fire blight, manifested by dark necrosis of herbaceous plant parts. Shoot necrosis 

was usually 20-25 cm in length. Most often, there were a few old and dry branches in tree 

tops. Apple and pear trees were infected much more rarely, mainly with much lower 

infection level of 1-3% (sporadic infection) and only a few shoots were affected with 

bacterial fire blight. On pear trees from several orchards in Nikšić municipality, the 

infection level was a little higher (6-9%). 

Fig. 1 Erwinia amylovora. Bacterial fire blight: A. Infected quince tree; B. Infected pear shoots; 

C. Infected apple shoots; D. Infected medlar flowers and leaves, E. Infected hawthorn; 

F. Artificial inoculation of green pear fruits. Photo: D. Radunović


Except these dominant pome fruit species with observed symptoms of bacterial fire 

blight, for the first time in Montenegro, this monitoring confirmed the presence of E. 

amylovora on medlar (Rasovo, municipality of Bijelo Polje) and spontaneously grown 

hawthorn (Kisjele Vode, municipality of Bijelo Polje). On medlar, fire blight affected 

flowers and spread over a few leaves, while an intensive drying of flowers, leaves and 

herbaceous schoots was recorded on hawthorn. 

In the central part of Montenegro, on the territory of Podgorica municipality, the 

presence of bacterial fire blight on susceptible fruit species was not established. 

Determination of isolates 

Isolation on NSA medium resulted in large number of isolates, obtained from large 

number of collected samples. The main criterion for choosing the isolates was the presence 

of whitish, mucous, shiny and convex, i. e. levan-positive colonies. Chosen isolates did not 

produce fluorescent pigment on King B medium. Pathogenicity of isolates was proven on 

young, immature pear fruits and tobacco leaves (HR). Three to four days after inoculation 

of immature pear fruits, symptoms were clearly manifested as deep green necrotic spots 

which later turned dark, often in the presence of a drop of bacterial exudate (Figure 6). 

Examined isolates caused hypersensitive reaction (HR) on tobacco leaves 24 h after 

inoculation. Isolates had the following morphological characteristics: bacterial cells were 

rod-shaped with rounded ends; Gram reaction was negative. As regards biochemical and 

physiological characteristics, examined isolates did not produce oxidase and glucose 

metabolism was both oxidative and fermentative, i. e. they behaved as facultative 

anaerobes. 

On the basis of their proved pathogenicity, characteristics of the colonies on NSA 

medium, the fact that they did not produce fluorescent pigment on King B medium, as well 

as certain morphological and biochemical and physiological characteristics, it could be 

concluded that bacterial isolates obtained from diseased quince, pear, apple, medlar and 

hawthorn belong to E. amylovora species. In this investigation, medlar and hawthorn were 

reported for the first time as E. amylovora hosts in Montenegro. 

DISCUSSION 

On the basis of health condition monitoring of pome fruits in northern, western and 

central parts of Montenegro, it was determined that, during the past fifteen years, E. 

amylovora has spread in this country, both territorially and through new hosts (medlar and 

hawthorn). 

All the information, available from literature, on the presence of E. amylovora in 

Montenegro has been very poor. According to Arsenijević and Gavrilović (2007), 

symptoms of bacterial fire blight were first observed in Montenegro in 1996, on a couple of 

pear trees near Bijelo Polje. The same authors reported that the presence of E. amylovora 

was experimentally proven in 2003, on apple from the vicinity of Nikšić. Obradović et al. 

(2003) reported on epiphytotic occurrence of bacterial fire blight on quince at several 

localities (Bijelo Polje, Berane, Mojkovac and Župa Nikšićka) and the isolation of E. 

amylovora from collected samples. 

The obtained results clearly show wide distribution of E. amylovora in northern and 

western regions of Montenegro, known for fruit production, as well as that quince is the 

most endangered fruit species.


The occurrence of E. amylovora on pome fruit species in Montenegro, with 

emphasized high infection intensity on quince, indicates a similar trend of this pathogen in 

Serbia (Panić and Arsenijević, 1996; Obradović et al., 2003; Balaž and Smiljanić, 2004; 

Arsenijević and Gavrilović, 2007; Balaž, 2008; Balaž et al., 2009). High level of infection 

with E. amylovora on quince in Serbia could probably be explained by its late blooming. In 

this region, the period of quince blooming is the latest of all pome fruits, coinciding with 

higher temperatures which are favourable for intensive infections of flowers. Furthermore, 

this pathogen spreads rapidly through quince shoots, twigs and branches. For this reason, 

eradication of single, dry quince trees is usual in the region of southern Bačka (AP 

Vojvodina). Within the project “Monitoring of Erwinia amylovora in the District of South 

Bačka, as the basis for implementing the program of eradication of pome fruit trees”, 

financed by Serbian Ministry of Agriculture, Forestry and Water Management, except mass 

eradication of old desseased apple plantations, a young quince orchard on an area of 0.6 ha 

was also eradicated, as well as numerous single trees. 

Other authors from this region also pointed out that quince is one of the most 

endangered fruit species by bacterial fire blight (Cvjetković et. al., 1998; Nemeth, 1998; 

Bobev et. al., 1998; Saygili, 1998). 

Relatively low infection intensity on apple and pear trees, registered in Montenegro 

during the spring and summer of 2012, is probably related to low temperatures during their 

phenophase of blooming and intensive growth of shoots. While analyzing the intensity of 

certain types of symptoms, it should be taken into account that susceptibility of various 

parts of the same plant host to E. amylovora could be different (Persen et. al., 2011). 

Main bacteriological characteristics (rod-shaped with rounded ends, gram-negative, 

produce levan, but not fluorescent pigment, facultative anaerobes, oxidase-negative) 

together with pathogenicity proved by inoculation of immature pear fruits and HR on 

tobacco leaves, indicate that the examined isolates belong to the species E. amylovora 

(Schaad, 1980; Lelliott and Stead, 1987; Klement et al., 1990; Schaad et al., 2001). 

REFERENCES 

Arsenijević, M., Gavrilović, V. (2007): Praktični priručnik o bakterioznoj plamenjači voćaka i 

ukrasnih biljaka. Institut za zaštitu biljaka i životnu sredinu, Beograd-Topčider, pp. 79. 

Balaž, J. (1999): Status of Erwinia amylovora in Yugoslavia: Distribution, Identification and 

Control. Proceedings of the Eight International Workshop on Fire Blight. Acta Hort., 

489: 99-103. 

Balaž, J. (2000): Erwinia amylovora (Burr.)Winsl. et al. kao parazit jabuke. Biljni lekar, 6: 457- 

463. 

Balaž, J., Keserović, Z., Aćimović, Z., Nikolić, Z., Mažić, J. (2009): Erwinia amylovora u 

Vojvodini i postupci za stavljanje pod kontrolu. XXIV Seminar zaštite bilja Vojvodine, 

12. Februar, Biljni lekar, Vanredni broj: 46-56. 

Balaž, J., Ognjanov, V., Stamenov, V. (1997): Erwinia amylovora na jabučastom voću u 

Vojvodini i mere zaštite. Biljni lekar, 1: 55-60. 

Balaž, J., Smiljanić, A. (2004): Chaenomeles japonica and Cotoneaster horizontalis new hosts 

of Erwinia amylovora in Serbia. Zaštita bilja, 55 (1-4), 247-250: 87-96. 

Bobev, S., Garbeva, P., Hauben, L. (1999): Fire Blight in Bulgaria – Characteristics of 

E.amylovora isolates. Acta Hort.,489: 121-126. 

Cvjetković, B., Halupecki, E., Špoljarić, J. (1999): The occurence and control of fire bljght in 

Croatia. Acta Hort., 489: 71-76.


Dreo, T., Župančič, M., Demšar., T., Ravnikar, M. (2006): First Outbreaks of Fire Blight in 

Slovenia. Acta Hort., 704: 37-41. 

Gavrilović, V., Arsenijević, M. (1998): Vatreni trn – novi domaćin bakterije Erwinia amylovora 

za našu zemlju. Biljni lekar, 1: 52-55. 

Hugh, R., Leifson, E. (1953): The taxonomic significance of fermentative versus oxidative 

metabolism of carbohydrate by various gram negative bacteria. J. Bact., 66: 24. 

Jovanović, G. (1999): Rasprostranjenost, značaj i domaćini bakterije Erwinia amylovora na 

teritoriji južne Srbije. Magistarska teza, Poljoprivredni fakultet, Novi Sad. 

King, E.O., Ward, M.K., Raney, D.E. (1954): Two simple media for the demonstration of 

pyocyanin and fluorescin. Journal of Laboratory and Clinical Medicine, 44: 301-307. 

Klement, Z., Rudolph, K., Sands, D.C. (1990): Methods in Phytobacteriology. Academiai 

Kiado, Budapest, pp. 568. 

Kovacs, N. (1956): Identification of Pseudomonas pyocyanea by the oxidase reaction. Nature, 

178: 703. 

Lelliott, R.A., Stead., D.E. (1987): Methods for the Diagnosis of Bacterial Diseases of Plants. 

Plant Pathology. Blackwell Scientific Publications, 2, pp. 215. 

Nemeth, J. (1999): Occurence and spread of Fire Blight (Erwinia amylovora) in Hungary (1996- 

1998). Management of the Disease. Acta Hort., 489: 177-183. 

Obradović, A., Vučinić, Z., Gavrilović, V. (2003): Epifitotična pojava bakteriozne plamenjače 

dunje u Srbiji i Crnoj Gori. Šesto Savetovanje o zaštiti bilja, Zlatibor, 24-28. Novembar. 

Zbornik rezimea: 84. 

Panić, M., Arsenijević, M. (1996): Bakteriozna plamenjača voćaka i ukrasnih biljaka-Erwinia 

amylovora . Zajednica za voće i povrće, Beograd, pp. 403. 

Panić, M., Arsenijević, M. (1993):Outbreak, spread and economic importance of fire blight 

pathogen (Erwinia amylovora) in Yugoslavia. Acta Hort., 338: 89-96. 

Persen, U., Gottsberg, R., Reisenzein, H. (2011): Spread of Erwinia amylovora in apple and pear 

trees of different cultivars after artificial inoculation. ISHS Acta. Hort., 896: 319-331. 

Saygili, H., Aysan, Y., Mirik, M. (2006): Severe Outbreak of Fire Blight on Quince in Turkey. 

Acta Hort., 704: 51-53. 

Schaad, N.W. (1980): Laboratory Guide for Identification of PlantPathogenic Bacteria. APS, 

pp. 72. 

Suslow, T.V., Schroth, M.N., Isaka, M. (1982): Application of a rapid method for Gram 

differentiation of Plant Pathogenic and Saprofitic bacteria without staining. 

Phytopathology, 72: 917-918. 

Zwet, T. Van der, Keil, H.L. (1979): Fire Blight – A bacterial disease of Rosaceous plants. U.S. 

Department of Agriculture, Agriculture Handbook, 510: 200.

Stevanović Miloš, Trkulja Nenad, Nikolić Bogdan,,, 379 


Proceedings 

EFFECT OF SIMULTANEOUS APPLICATION OF 

BRASSINOSTEROIDS AND REDUCED DOSES OF FUNGICIDES 

ON VENTURIA INAEQUALIS 

STEVANOVIĆ MILOŠ, TRKULJA NENAD, NIKOLIĆ BOGDAN, DOLOVAC NENAD, IVANOVIĆ 

ŽARKO 

Institute for Plant Protection and Environment, Belgrade, Serbia. 

Contact e-mail: stevanovicmilos14@yahoo.com 

Venturia inaequalis (Cooke) G. Wint., the causal agent of apple scab, is one of the most 

important diseases of apple worldwide. Our research included an examination of the effect of reduced 

doses of fungicides tebuconazole and mancozeb combined with brassinosteroids, amino acids 

fertilizers ("Drin", "Green Has", Italy; "Amalgerol Premium", "Hechenbichler", Austria) and 

preparations based on the plants extract ("Zircon", “Nest-M”, Russia) in control of V. inaequalis. 

Brassinosteroids applied in half of the producer’s recommended dosage expressed a high efficacy on 

scab reduction, whereas the control plots treated with fully prescribed dose of fungicides had the 

highest efficacy. 

KEY WORDS: brassinosteroids, tebuconazole, mancozeb, efficacy, Venturia inaequalis. 

INTRODUCTION 

Apple scab caused by the fungus V. inaequalis (Cooke) G. Wint. is one of the most 

serious diseases of apple that occurs in almost all apple-producing areas and causes huge 

economic losses (MacHardy, 1996). However, the disease is more severe in temperate 

countries with cool, moist climates during early spring (MacHardy, 1996; Manktelow et al., 

1996). 

If scab control measures are not taken well, losses from the disease may be 70% or 

more of the total fruit value (Agrios, 2005). Current disease control is achieved mainly 

through scheduled applications of fungicides. V. inaequalis has successively developed 

resistance to dodine, benzimidazole, demethylation inhibitor (Köller, 1994) and quinone 

outside inhibitor (Köller et al., 2004) classes of fungicides. Strategies to delay the 

development of resistance to these fungicides in field populations of the pathogen rely on 

restricting the number of applications per season of fungicides in each class and mixing or 

alternating at-risk fungicides with ones that are not at risk from resistance development 

(Brent and Holloman, 2007). Recent years, the frequent occurrence of apple scab resistance 

to fungicides indicates the need for fungicides to reduce the expanse of their use and 

develop alternative environmentally friendly approach to control V. inaequalis (Balaž et al., 

2010). Russian and Chinese scientists have applied brassinosteroids and reduced doses of 

pesticides in sunflower (Dorozhkina et al., 2007) and cucumber (Xia et al., 2009). Yield of

380 Effects of simultaneous application of brassinosteroids and reduced doses of ... 

crops is preserved and also the level of plant protection. Brassinosteroids have stimulatory 

effect on pesticide metabolism which was observed for chlorothalonil and carbendazim 

(Xia et al., 2009). These results suggest that brassinosteroids may be promising, 

environmentally friendly, natural substances suitable for a wide application in reducing the 

risk of exposing the humans and environment to pesticides. So the aim of this study was to 

determine the effect of different scheduled hormon and amino acids with reduced use of 

fungicides to control V. inaequalis. 


The trials were conducted in 2011 in commercial apple orchards at two localites 

Morović and Obrenovac (cv. Idared). Treatments were carried out using a motorized 

knapsack sprayer (Solo Port 423, Germany) by thoroughly wetting the trees (water volume: 

1000 liter/ha). First application was carried out at BBCH (Biologische Bundesanstalt, Bundessortenamt 

and Chemical Industry) 54-55 (first leaves), and final at BBCH 69-71 (fruit 

setting). Application details are listed in Table 1. The trials were arranged in a randomized 

complete block design with four replications and plot size was 4 trees according to EPPO 

methods (EPPO PP 1/152 (2), 1997). Intervals between treatments were 7-9 days. The 

assessment was made on 200 leaves of long shoots and rosettes per plot. The percentage of 

disease development on the leaves was rated on a scale developed by Croxall et al. (1953): 

0 (no disease), 1% (one to four small spots on about a quarter of the leaves), 5% (almost 

every leaf infected with scab areas covering approximately 25% of the leaf surface on about 

one-quarter of the leaves), 10% (every leaf infected with scab areas covering approximately 

25% of the leaf surface on half the leaves), 25% (every leaf infected with scab areas 

covering 50% of the leaf surface on half the leaves), and 50% (all leaves infected, with scab 

areas covering 50% of the leaf surface on half the leaves). The percentage of disease 

development of the fruits was rated on a EPPO scale (EPPO PP 1/5 (3), 2004) : 1 = no 

attack, 2 = 1-3 spots per fruit, 3 = > 3 spots per fruit. Assessment per plot was based on 100 

fruits collected. The disease severity (DS) was evaluated using the Townsend-Heuberger’s 

formula (Townsend and Heuberger, 1943), DS (%) = 

, where n- degree of 

infection according to the scale, v-number of leaves/fruits per category, V- total number of 

leaves/fruits screened, N- highest degree of infection. The fungicide efficacy (FE) was 

calculated using Abbott’s formula (Abbott, 1925), FE. (%) = ; where X- 

disease severity of the control, Y- disease severity of the treatment. The data were analyzed 

separately for each trial using ANOVA and the means were separated by Duncan’s multiple 

range test. 

RESULTS 

During the 2011 environmental conditions were not favorable for infection caused 

by V. inaequalis, however intensive disease development was recorded in untreated control 

plots with infection rate of 43.44-43.63% on leaves and 37.25-46.50% on fruits. 

Assessment of the disease intensity in treated orchards was carried out on 16.06.2011 on 

locality Morović and 17.06.2011. on locality Obrenovac (Tables 2, 3, 4, 5). Lowest 

infection rate of the leaves on both localities was recorded in plots with full dose of 

fungicides applied, that is 6.5% in Morović and 6.88% in Obrenovac. In plots treated with


reduced dose of fungicides, infection rate was much higher ranging from 18.5 to 20%. In 

comparison with full dose of fungicides, a reduced dose of brassinosteroids "Epin-extra" 

showed a disease intensity from 9.25% to 11.75%. At the locality Morović, in plots treated 

with combination of reduced dose of fungicides and amino acid fertilizers "Drin" and 

"Amalgerol Premium", as well as preparations based on extracts of plants "Zircon", 

infection rate was 15,94%, 15,0% and 14,69%, respectively. The same treatments at the 

second locality Obrenovac resulted in approximate disease intensity of 14.25%, 14.50%, 

and 15.56%. 

Similar to the infection of the leaves, disease intensity on the fruits was the lowest in 

plots treated with a full dose of fungicides, from 5.63% to 5.88%, and in the plots with half 

of the usual dose of fungicides intensity was 15.25%-17.88%. Plots treated with reduced 

dose of fungicides and brassinosteroids "Epin-extra" combination had shown disease 

intensity from 8.38% to 10.38%. Fungicides applied with amino acid fertilizers "Drin" and 

"Amalgerol Premium", and preparations based on extracts of plants "Zircon" shown the 

following infection rates, 18,25%, 13,13% and 14,38% at the locality Morović, whit similar 

results recorded in Obrenovac i.e. 16.25%, 12.75% and 14.13%. 

Table 1. Application details with designated number and time of treatments in orchards 

No. 

application 

Locality 

Obrenovac 

Morović 

Time application BBCH Time application BBCH 

1 06.04.2011. 15 04.04.2011. 15 

2 12.04.2011. 19 11.04.2011. 19 

3 19.04.2011. 51-55 18.04.2011. 51-55 

4 26.04.2011. 71 27.04.2011. 71 

5 05.05.2011. 72 04.05.2011. 72 

6. 11.05.2011. 72-74 10.05.2011. 72-74 

7. 18.05.2011. 75 17.05.2011. 75 

8. 24.05.2011. 75-77 25.05.2011. 75-77 

9. 02.06.2011. 77 03.06.2011. 77 

Time 

assessment 

16.06.2011 78-79 17.06.2011 78-79


Table 2. Venturia inaequalis – disease intensity on apple leaves and fungicide efficacy on 

locality Morović in 2011 

Fungicides Conc. Ms Sd E% 

Akord + Mankogal-80 0.015%+0.1% 18.50c 4,08 57.59 

Akord + Mankogal-80+ 

Epin Extra 

0.015%+0.1%+0,034% 11.75b 1,54 73.35 


Cirkon 

0.015%+0.1%+0,03% 15.94c 1,98 63.47 


Amalgerol Premium 

0.015%+0.1%+0,75% 15.00bc 2,11 65.62 


Drin 

0.015%+0.1%+0,75% 14.69bc 2,74 66.33 

Akord + Mankogal-80 0.03%+0.2% 6.50a 1,08 85.10 

Control - 43.63d 2,97 - 

*Mean values in columns followed by different letters are significantly (p


Table 5. Venturia inaequalis – disease intensity on apple fruits and fungicide efficacy on 

locality Obrenovac, 2011 

Fungicides Conc. Ms Sd E% 

Akord + Mankogal-80 0.015%+0.1% 17.88e 1,60 61.56 


Epin Extra 

0.015%+0.1%+0,034% 10.38b 1,11 77.69 


Cirkon 

0.015%+0.1%+0,03% 16.25de 1,55 65.05 


Amalgerol Premium 

0.015%+0.1%+0,75% 12.75bc 1,94 72.58 


Drin 

0.015%+0.1%+0,75% 14.13cd 1,45 69.62 

Akord + Mankogal-80 0.03%+0.2% 5.63a 1,11 87.90 

Control - 46.50f 2,34 - 

* Mean values in columns followed by different letters are significantly (p





REFERENCES 

Abbott, W. S. (1925): A method of computing effectiveness of an insecticide. Journal of 

Economic Entomology, 18: 265-267. 

Agrios, G. (2005): Plant pathology/Apple scab. UK, 2005, p. 504-507. 

Brent, K. J., and Holloman, D.W. (2007): Fungicide resistance in crop pathogens: how can it be 

managed? FRAC Monograph No. 1 (second, revised edition). Brussels: Fungicide 

Resistance Action Committee. 

Balaz, J., Acimovic, S., Aleksic, G., Bodroza, M., and Cvetkovic, B. (2010): Evaluation of 

Possibilities of Venturia inaequlis Control by Ecologically Acceptable Products. Pestic. 

Phytomed, 25: 335-342. 

Carisse, O. and Bernier, J. (2002): Effect of environmental factors on growth, pycnidial 

production and spore germination of Microsphaeropsis isolates with biocontrol potential 

against apple scab. Mycol. Res., 106: 1455–1462. 

Croxall, H. E., Gwynne, D. C., and Jenkins, E. E. (1952): The rapid assessment of apple scab on 

leaves. Plant Pathology, 1: 39-41. 

Dorozhkina L. A., Narezhnaia E. D., Yachromenko P. G. (2007): Influence of application of 

epine-extra on lower doses of pesticides treatment and higher yield of sunflower. in: 

Polyfunctionality of action of brassinosteroids. (ed. Malevanaya N.), “NEST M”, 

Moscow, Russia (on Russian), pp. 231-241. 

EPPO, (2004): Guidelines for the efficacy evaluation of plant protection products: Venturia 

inaequalis and V. pyrina – PP 1/5 (3), in EPPO Standards: Guidelines for the efficacy 

evaluation of plant protection products, 2, EPPO, Paris, 15-18. 

EPPO, (1997): Guidelines for the efficacy evaluation of plant protection products: Design and 

analysis of efficacy evaluation trials – PP 1/152 (2), in EPPO Standards: Guidelines for 

the efficacy evaluation of plant protection products, 1, EPPO, Paris, 37-51. 

Ilhan, K., Arslan, U., Karabulut, O. A. (2006): The effect of sodium bicarbonate alone or in 

combination with a reduced dose of tebuconazole on the control of apple scab. Crop 

Protection, 25: 963–967. 

Köller, W. (1994): Chemical control of apple scab—status quo and future. Norweg. J. Agric. 

Sci. Suppl., 17: 149–170. 

Köller, W., Parker, D.M., Turechek, W.W., Avila-Adame, C., Cron-shaw, K. (2004): A twophase 

resistance response of Venturia inaequalis populations to the QoI fungicides 

kresoxim-methyl and trifloxystrobin. Plant Dis., 88: 537–544. 

Townsend, G. R., Heuberger, J. V. (1943): Methods for estimating losses caused by diseases in 

fungicides experiments. Plant disease report, 24: 340-343. 

MacHardy, W. E. (1996): Apple Scab: Biology, Epidemiology, and Management.St. Paul, MN: 

The American Phytopathological Society Press. 

Manktelow, D. W. L., Beresford, R. M., Batchelor, T. A., Walker, J. T. S. (1996): Use patterns 

and economics of fungicides for disease control in New Zealand apples. Acta Hortic., 

422: 187–192. 

Xia X. J., Zhang Y., Wu J. X., Wang J. T., Zhou Y. H., Shi K., Yu Y. L., Yu J. Q. (2009): 

Brassinosteroids promote Metabolism of Pesticides in Cucumber. Journal of 

Agricultural and Food Chemistry, 57: 8406-8413.

Kahld Hassan Taha and Bassam Yahya Ibraheem 385 


Proceedings 

TRICHODERMA SPP. BIOTYPES EFFECTIVE IN BIOLOGICAL 

CONTROL AND INDUCING RESISTANCE AGAINST 

RHIZOCTONIA SOLANI CASUAL AGENT OF BEAN ROOT ROT 

AND DAMPING OFF 

KAHLD HASSAN TAHA AND BASSAM YAHYA IBRAHEEM 

Department of Plant Protection, College of Agriculture and Forestry. University of Mosul. 

Mosul, Iraq 

Six isolates of the indigenous fungus Trichoderma harzianum, Thk20, Th1, Th2, Th3. Th4, 

Th5 and one isolate T. viride Tv1 were selected as a agents for biological control of Rhizoctonia 

solani, causes bean root rot and damping off. The results showed that application of the bioagents 

isolates as a conidial suspension greatly reduced the percentage of disease and the disease index 

caused by R. solani in bean plants at different rates. The most effective Trichoderma spp. isolate was 

Thk20 which reduced the disease percentage to 23% and disease index to 0.27, The results indicate 

that isolates Thk20, Th1 and T. viride have a strong tendency to induce resistance against R. solani. 

The isolate Thk20 differed significantly and caused significant raising in peroxidase activity 

18.3unit/min/g f.w followed by isolates Th1 and T.viride 11.48 and 8.45unit /min/g f.w. Thk20 and 

Th1 isolates differed significantly and caused significant raising polyphenol oxidase activity with 

0.265 and 0.189uint /min/g f.w . 

Key words: bean , Rhizoctonia, peroxidase, biological control, Trichoderma, polyphenol 

oxidase 

INTRODUCTION 

Root rot and damping off diseases regarded as one of the most common diseases to 

the field corpus so many soil fungi caused these diseases among of them Rhzoctonia solani 

(Alenciano et al., 2006). Nowadays, there is a global attempt to minimize the use of 

harmful substances, particularly chemical pesticides in agriculture. Biological control of 

soil borne phytopathogens has proven to be a good alternative to the use of chemical 

pesticides (Mujeebur and Shahana, 2001). Biological control has advantages over chemical 

control, because it is less likely to damage non-target organisms and because resistance is 

lower to evolve. Bioagents are also preferred over chemical control methods because they 

do not leave any residue of toxic substances, are environment friendly and may be cheaper. 

To achieve this purpose different species of Trichoderma, well known antagonist, were 

successfully used in a number of crop diseases (Mansour et al., 2008). Thichoderma sp. was 

used to control bean root rot and damping off throughout its direct effect as antagonist and 

parasite or indirect mechanism as promoting plant growth and stimulating plant defense.

386 Trichoderma SPP. biotypes effective in biological control and ... 

Induced systemic resistance (ISR) in plants is a common response to nonpathogenic 

bacteria, viruses or fungi (Theodore and Panda, 1994). Once resistance is induced, the plant 

expresses number of inducible defense responses including reinforcement of cell walls by 

increases in peroxidase activities (Cook, 1993) and the deposition of lignin, callose, and 

hydroxyproline-rich glycoprotein (Heller and Theiler-Hedtrich, 1994; Dodd et al., 2001). 

Isolate referred to colonization of epidermal cells by the Thichoderma sp. associated with a 

deposition of an electron-dense cell wall material rich in lignin, suberin, and phenolic 

compounds. Deposition of these compounds may provide a physical or chemical barrier to 

the invading R. solani. From these observations an attempt was made to study the role of 

Trichoderma spp. as an inducing agent of systemic resistance by analyzing, changes in 

peroxidases and polyphenol oxidase which catalyze the final polymerization step of lignin 

synthesis and, therefore, may be directly associated with the increased ability of 

systemically protected tissue to lignify (Theodore and Panda, 1994). The objective of this 

study was to determine if peroxidases and polyphenol oxidase are produced in substantial 

amounts in bean seedlings pre inoculated with Trichoderma spp. isolate and the activity of 

these enzymes in bean plants during Trichoderma spp. and R. solani interaction in order to 

find any correlation that may exist in host defense mechanism. 


Isolation and determination of pathogens 

Bean seedlings were inspected for possible presence of Rhizoctonia sp. The samples 

from diseased root tissue were disinfected in 0.1% sublimate solution, rinsed in sterile 

water and planted onto potato dextrose agar (PDA) amended with streptomycin sulphate 

(50 mg/l). The isolates were purified and on the basis of morphological characteristics of 

mycelia described by Ogoshi (1987) isolates were identified as Rhizoctonia solani. 

Biological material 

Bean seeds (Phaseolus vulgaris L.), cultivar Contender Bush UT15, were obtained 

from Stokes Seeds. Seeds were soaked for 1h in water, surface-sterilized with a 1% 

(vol/vol) sodium hypochlorite solution for 10 min, and rinsed with sterile distilled water. 

Biological control agent 

In experiment T. harzianum strains Thk20 Th1, Th2, Th3, Th4, Th5 and T.viride 

strain Tv1 were used. 

Mycoparasitism 

Mycoparasitism of Trichoderma spp was studied in dual cultures. Petri dishes (9 

cm-diam) containing 20 ml of PDA were inoculated with mycelial plugs (5 mm-diam) 

taken from an actively growing edge of 3 day-old colonies of both fungi. These mycelia 

disks were simultaneously placed 5 cm apart from each other on the surface of the medium. 

The plates were incubated at 25°C for 4 days. The time for the first contact between the 

antagonist and inhibition of radial growth of fungi and encroachment over pathogens by 

Trichoderma were measured and compared with the control. Control plates were prepared 

by inoculating only Rhzoctonia solani. Each treatment was replicated five times.


Production of inoculum of Trichoderma spp. 

Six Trichoderma harzianum isolates strains Thk20, ,Th1, Th2,Th3 ,Th4 and T5and 

one T. virid isolate (strain Tv1) were used for the inoculum production. The strains were 

cultured on PDA medium and incubated for 7–15 days at 25 ± 5°C in a growth chamber. 

The conidia of each isolate were harvested by flooding the cultures with sterile distilled 

water and then rubbing the culture surfaces with a sterile glass rod. After filtering the 

suspensions through two layers of cheesecloth, the concentrations of propagules in 

suspensions were standardized with the aid of a haemocytometer (Hausswr Scientific 

,USA) to 200000 conidia per ml for each tested Trichoderma isolate. The suspensions were 

amended with one drop of 0.05% Tween surfactant in distilled water immediately before 

plant inoculation. Isolates were applied as spore suspension. 

Pot trials and conditions 

Nine treatments in the greenhouse conditions were designed: 

1. Uninoculated control (non infested soil only); 

2. Untreated control (R. solani - infested soil) 

3. R.solani - infested soil supplemented with Thk20; 

4. R.solani - infested soil supplemented with Th1; 

5. R.solani -infested soil supplemented with Th2; 

6. R.solani -infested soilsupplemented with Th3; 

7:R.solani -infested soil supplemented with Th4; 

8. R.solani -infested soilsupplemented with Th5; 

9. R.solani -infested soilsupplemented with Tv1. 

Each treatment had five replicates (five pots). Each pot (diameter 30 cm, height 40 

cm) was filled with 5 kg of sterilized soil (wet weight) and bean seeds with sterilized 

surface were sown at the rate of 5 seeds. Disease incidence percentages were counted 45 

days after sowing for pre- and post-emergence damping off as well as for healthy survived 

seedlings. Disease severity on individual plants were rated on a scale from 0 to 4 according 

to Krause et al. (2001). All pots were randomly arranged. Plants were grown under daylight 

conditions in a greenhouse of College of Agricultural and forestry, University of Mosul, 

Iraq. 

Extraction of the enzymes 

Two gm of bean root tissues were homogenized with a pinch of neutral sand in 6.0 

ml of phosphate buffer (0.1M, pH 7.0) at 0°C. The extracts were obtained by filtering off 

the debris with a clean cloth and centrifuged at 3000 rpm for 15 minutes in cold centrifuge. 

The supernatants were recovered, collected and served as the source of enzymes. 

Polyphenol oxidase enzymes activity assay 

Polyphenol oxidase: 2.0 ml of the enzyme extract and 3.0 ml of 0.1 M phosphate 

buffer were mixed together in a cuvette and the sample was adjusted to zero absorbance in 

a Spectrophotometer (UV-7502-UV7504,Shanghai ,China) at wavelength of 495 nm. 1.0 

ml of 0.01 M catechol in 0.1 M phosphate buffer (0.4 mg/ml) was added to the above 

mixture and the reactants were quickly mixed. The enzyme activity was measured as the 

change in absorbance per minute at 495 nm immediately after the addition of catechol 

solution. Control in similar manner was maintained at different times by heating the extract 

at 100°C for 10 minutes. The activity was always measured zero indicating complete 

inactivation of the enzyme by this heat treatment.


Peroxidases enzymes activity assay 

Five ml of freshly prepared pyrogallol reagent (prepared by mixing 10 ml of 0.5 M 

pyrogallol solution and 12.5 ml of 0.66 M phosphate buffer and filled up to 100 ml with 

distilled water) and 1.5 ml of the enzyme extract were mixed in a cuvette of a 

spectrophotometer and the mixture was immediately adjusted to zero absorbance. half mlof 

1% H 2 O 2 solution was added to it and content of was mixed by inverting the tube. The 

reaction was initiated by the addition of H 2 O 2 . Enzyme activity was recorded as the change 

in absorbance per minute unit /min at 430 nm immediately after the addition of substrate. 

Similarly, control on non-enzymatic oxidation was maintained at different times by heating 

the extract at 100°C for 10 minutes. The activity was always measured zero indicating its 

complete inactivation by the heat treatment. 


All calculations were carried out using the Statistic Analysis System, version 9 (SAS 

Institute, Cary, NC, USA). For all experiments the levels of significance for the 

experimental repetitions, main treatments and their interactions were calculated using the 

General Linear Models Procedure (PROC GLM). Data were subjected to analyses of 

variance and treatment means were compared by an approximate Duncan’s multiple test 

(P


Effect of Trichoderma strain on bean root rot incidence and severity 

The results of experiment demonstrating the effect of Trichoderma strain on control 

of bean rot root disease caused by R. solani are given in Table 2. There was significant 

difference in reduction of disease incidence between Trichoderma strains where Thk20 

exhibited lower disease incidence by 23%, all Trichoderma strains were significantly 

different compared to control treatments and soil infested with R. solani. Disease severity in 

bean plant treated with Trichoderma strain Thk20 were lower (0.28) compared to the 

infected control (0.68). 

Table 2. Effect of Trichoderma strain on disease incidence and severity of bean plants 

inoculated with Rhizoctonia solani under greenhouse conditions 

Trichoderma strain Disease incidence (%) Disease severity 

Thk20 23 f 0.28 f 

Th1 48c 0.39 e 

Th2 52 b 0.49 b 

Th3 44 d 0.49c 

Th4 48 c 0.43 c d 

Th5 48 c 0.40 de 

Tv1 36 e 0.41 cde 

Untreated control 64a 0.68 a 

Non-inoculated control 0.0 g 0.0 g 

*Values are the means of five replicates. Means in a column followed by the same letter are not significantly 

different according to Duncan significant difference test at p ˂0.05 

Enzymes activity 

The results given in Table 3. demonstrate remarkable increases in the relative 

activities of oxidative enzymes, notably, peroxidase and polyphenol oxidase in bean plants 

as a response to treatment with Trichoderma strains. The increasing amount in peroxidase 

activity was in ranges from 18.3 to 3.81 (unit/g fresh weight) depending on Trichoderma 

isolate, while polyphenoloxidase activity was in ranges from 0.256 to 0.178 (unit/g fresh 

weight). 

Table 3. Enzymatic activity in bean plants infested with Rhizoctonia solani under greenhouse 

conditions for different Trichoderma strains 

Enzyme activity (unit/g fresh weight) 

Trichoderma strain Peroxidase polyphenol oxidase 

Thk20 18.3 a 0.189a b 

Th1 11.48 b 0.256 a 

Th2 4.02 d 0.184 b 

Th3 3.81 d e 0.144 c d 

Th4 3.47 d e 0.123 d e 

Th5 1.78 f 0.093 f 

Tv1 8.45 b c 0.178 b c 

Untreated control 3.57 d e 0.153 c d 

Non-inoculated control 3.18 e 0.116 e 

*Values are the means of five replicates. Means in a column followed by the same letter are not significantly 

different according to Duncan significant difference test at p ˂0.05


DISCUSSION 

Species of Trichoderma are known to produce nonvolatile metabolites, such as 

antibiotics (Sivasithamparam and Ghisalberti, 1998) and enzymes (Elad, 1999) that are 

involved in the inhibition of growth of phytopathogenic fungi. Mycoparasitism of 

pathogenic fungi by Trichoderma species is proposed as a mechanism of biocontrol and 

involves enzymes that degrade cell wall constituents (Chet et al., 1997). In order to test this 

hypothesis, Trichoderma strains were dual cultured with R. solani. In these cultures, contact 

between the hyphae of Trichoderma strains and R. solani was achieved at different culture 

times (between 40 and 55 h) according to the tested antagonistic strain (Table 1). After the 

establishment of physical contact, all the studied Trichoderma strains were able to grow 

over, to sporulate on, and completely to inhibit the mycelial growth of R. solani. Similar 

results have been found for Trichoderma/pathogen combinations, T. harzianum against R. 

solani (Benhamou and Chet, 1993) and T. harzianum, T. atroviride against Sclerotium 

rolfsii (El-Katatny et al., 2001). In their study of T. harzianum against R. solani, 

(Benhamou and Chet, 1993) observed the first contact between the two fungi within 2 days 

of dual culture and a complete inhibition of R. solani immediately after this contact. These 

authors suggested that the antagonistic activity of T. harzianum was not due to the diffusion 

of toxic metabolites. Increase oxidative enzymes activity in host tissues in response to 

infection by the pathogen has been reported by Ojha et al. (2005). 

In plant tissues Polyphenol oxidase enzyme might function as an alternate electron 

transport chain and serve as terminal oxidases. And It is quite probable that the toxic 

metabolites of the pathogen may activate phenol-oxidizing enzymes. The phenol-oxidizing 

enzyme plays a vital role in tissue browning by way of its capacity to oxidize phenols to 

quinines. The toxic substances, quinones, which are more reactive and have more 

antimicrobial activity than the phenols already existing in plants tissues causing increased 

host resistance against the invading pathogen (Hassan et al, 2007).Polyphenol oxidase 

enzyme has been recorded to be increased as a result of infection by the fungal pathogen 

(Al –Tuwaijri, 2009). Increased peroxidase enzyme activity upon infection might be 

required for an additional deposition of lignin. Changes in the rate of synthesis of 

peroxidase enzyme has been recorded as a result of pathogenic infection might be 

responsible for determining the resistance or susceptibility of the host (Gahukar and 

Jambhale, 2004). In the present experiment, when bean plant was infected with both the 

pathogen R. solani and Trichoderma spp. polyphenol oxidase and peroxidase activities 

remained much higher compared to both healthy plant and R. solani infected plant. This 

might be due to the fact that the host plant when challenged with both the pathogen and the 

antagonist ought to secrete more phenol enzymes for defense but at the steady state of 

infection the antagonist itself deters the activity of the pathogen resulting in the decline of 

enzyme activity. Since the increase in the activity of the enzyme was noticeable from early 

stages of infection, this may well be due to the increased synthesis of the enzyme and not 

due to the degenerative process, which should have taken longer time. The enzyme activity 

enhances as a general metabolic response against pathogen invasion 

REFERENCE 

Al –Tuwaijri, M., (2009): Role of the biocontrol agent Trichoderma viride and Bacillus subtilius in 

elimination of the deteriorative effects of the root rot pathogens Fusarium oxysporum


and F. solani on some metabolic and enzyme activates of cucumber plants. Egypt. J. 

Exp. Biol. 5: 29 –32. 

Alenciano, J. Casquero, V., Boto, J., V., Marcelo (2006): Evaluation of the occurrence of root 

rots on bean plants Phaseolus vulgaris using different sowing methods and with different 

techniques of pesticide application. New Zealand J.Crop Horti.Sci. 34:215-221. 

Benhamou, N., I.,Chet (1993): Hyphal interactions between Trichoderma harzianum and 

Rhizoctonia solani: ultrastructure and gold cytochemistry of the mycoparasitic process. 

Phytopathology, 83: 1062–1071. 

Chet, I.,J., Invar, Y.,J, Hadar (1997): Fungal antagonists and mycoparasites. In: Wicklow DT, 

Soderstrom B, eds. The Mycota IV: Environmental and Microbial Relationships, 

Springer-Verlag, Berlin: 165–184. 

Cook, R. J. (1993): Making greater use of introduced microorganisms for biological control of 

plant pathogens. Annu. Rev. Phytopathol, 31: 53–80. 

Dodd, S. L.,E., Lieckfeldt, P.,Chaverri, B.,Overton, G.J.,.E., Samuels (2002): Taxonomy and 

phylogenetic relationships of two species of Hypocrea with Trichoderma anamorphs. 

Mycol Prog, 1: 409–428. 

Dyakov, Yu. T., V.G.,Dzhavakhiya, T., Korpele (2007): Comprehensive and Molecular 

Phytopathology. Elsevier Publications: 483 pp. 

Elad, Y.,A., Kapat, (1999): The role of Trichoderma harzianum protease in the biocontrol of 

Botrytis cinerea. Eur J Plant Pathol, 105: 177–189. 

El-Katatny, M. H.,M., Gudelj, K-H.,Robra,M.A., Elnaghy,G.,Gubitz, G. M.(2001): 

Characterization of a chitinase and an endob-1,3-glucanase from Trichoderma 

harzianum Rifai T24 involved in control of the phytopathogen Sclerotium rolfsii. Appl 

Microbiol Biotechnol; 56: 137–143. 

Gahukar, S. J., N.D., Jambhale(2004): Early screening of tissue culture derived plantlets for 

smut tolerance in Saccharum officinarum. Advan. Plant. Sci. 17(11): 385-388. 

Ganesan, S. R.,Sekar (2004): Biocontrol mechanism of Trichoderma harzianum on groundnut 

web blight disease caused by Rhizoctonia solani. J. Theor. Expl. Biol. 1: 43-47 

Hassan, E. Maggie, M., Saieda, S., El-Rahman,I.H., Abd, El-Abbasi, M.S., Mikhail(2007): 

Changes in peroxidase activity due to resistance induced against fababean chocolate spot 

disease. Egypt J. Phytopathol., 35: 35-48. 

Heller, W. E., R.,Theiler-Hedtrich (1994): Antagonism of Chaetomium globosum, Liocladium 

virens and Trichoderma viride to four soil-borne Phytophthora species. J Phytopathol, 

141: 390–394. 

Krause, M. S.,V., Laurence, V. A.J.,Harry (2001): Effect of potting mix microbial carrying 

capacity on biological control of Rhizoctonia damping-off of radish and Rizoctonia 

crown and root rot of poinsettia. Phytopathology 91: 1116-1123. 

Mansour, F. A.,A.H., Mohammedin,H., Badre, H. (2008): Biological control of soft-rot disease 

of potato using some Streptomycetes. Egypt. J. Microbiol., 39: 1-3. 

Mujeebur, R. K., M.K.,Shahana (2001): Biomanagement of Fusarium wilt of tomato by solid 

application of certain phosphate solubilizing microorganisms.Int. J. Pest Manage., 47(3): 

227-231. 

Ogoshi, A., (1987): Ecology and pathogenicity of anastomosis and interspecific group of 

Rhizoctonia solani (Kuhn). Ann. Rev. Phytopathol., 25: 125-143. 

Ojha, S., M.R.,Chakraborty,N.C., Chatterjee (2005): Activities of phenolics in Anthracnose of 

Saraca asoca and the associated resistance. Indian Biologist, 37(2): 9-11 

Pradeep, T.,N.D., Jambhale(2002): Relationship between phenolics, polyphenol oxidase and 

peroxidase , and resistance to powdery mildew in Zizhyphus. Indian Phytopath. 55(2): 

195-196.


Sivasithamparam, K.,E.L., Ghisalberti (1998): Secondary metabolism in Trichoderma and 

Gliocladium. In: Kubicek CP, Harman GE, eds. Trichoderma and Gliocladium. Vol. 1, 

Taylor and Francis, London: 139–191. 

Theodore, K., T.,Panda. T. (1994): Production of β-1,3-glucanase from Trichoderma harzianum 

in surface and submerged culture processes and its role on protoplast generation from 

Trichoderma reesei mycelium. Bioprocess Eng. 10: 161–166.


P H Y T O P H A R M A C Y

394 PHYTOPHARMACY

Šunjka Dragana, Lazić Sanja, Grahovac Nada,... 395 

International Symposium: Current Trends in Plant Protection UDK; 628.034.3:632.954.032 

Proceedings 

APPLICATION OF RESPONSE SURFACE METHODOLOGY 

(RSM) FOR DETERMINATION OF PESTICIDE RESIDUES IN 

WATER 

ŠUNJKA DRAGANA* 1 , LAZIĆ SANJA 1 , GRAHOVAC NADA 2 , JAKŠIĆ SNEŽANA 2 , 

VUKOVIĆ SLAVICA 1 

1 Faculty of Agriculture, Trg Dositeja Obradovića 8, Novi Sad, Serbia 

2 Institute for Field and Vegetable Crops, Maksima Gorkog 30, Novi Sad, Serbia 

*Corresponding author 

e-mail address: draganas@polj.uns.ac.rs 

For determination of pesticide residues in water, the extraction has a very important place, 

considering that many factors may significantly influence on the extraction. The aim of this study was 

to examine the influence of sample volume and solvent ratio (dichloromethane/n-hexane) on 

extraction yield of herbicide acetochlor from water. The extraction of pesticide from water was 

carried out with C 18 disc. Analyses were performed using gas chromatography/electron-capture 

detection (GC/ECD). A response surface methodology (RSM) was used to determine the optimum 

extraction conditions. The results show a good fit to the proposed model (R 2 =0.981). This optimized 

method was confirmed with recovery test under recommended conditions and average value of the 

recovery was >95 %. The experimental values agreed with those predicted, thus indicating suitability 

of the used model and the success of RSM in optimizing the investigated extraction conditions. 

Key words: acetochlor, water, response surface methodology 

INTRODUCTION 

In determination of pesticide residues in different matrices the problem presence the 

extraction of pesticide residues from these matrices. Many factors, such as type and ratio of 

solvent, sample volume, extraction time, temperature, pH may significantly influence on 

the extraction. The statistical method using response surface methodology (RSM) has been 

proposed to determine the influences of individual factors and the influence of their 

interactions. RSM is a technique for designing experiments, building models, evaluating the 

effects of several factors, and achieving the optimum conditions for desirable responses 

with a limited number of planned experiments (Khuri and Cornell, 1996). RSM helps to 

demonstrate how a particular response is affected by a given set of input variables over 

some specified region of interest, and what input values will yield a maximum (or 

minimum) for a specific response. RSM was initially developed for the purpose of 

determining optimum operation conditions in the chemical industry, but it is now used in a 

variety of fields and applications, not only in the physical and engineering sciences, but 

also in biological, clinical, and social sciences (Khuri, 2001). In this study response surface

396 Application of response surface methodology (RMS) for determination of... 

methodology was used to determine the optimum extraction conditions of acetochlor from 

water. The extraction of pesticide from water was carried out with C 18 disc and analyses 

were performed using GC/ECD. 

Acetochlor [2-chloro-N-ethoxymethyl-N-[2-ethyl-6-methylphenyl]acetamide) 

belong to the chloroacetanilide class of herbicides and they are widely used for the control 

of broadleaf weeds and annual grasses in row crops. It was registered for use to replace the 

more widely used herbicides such as alachlor, atrazine, butylate, EPTC, 2,4-D and 

metolachlor (US EPA, 1994). Recent trends in the use of this herbicide show that 

acetochlor use continuously is increasing. 

Acetochlor is moderately persistent in the environment and moderately to very 

mobile in soil. As a result, acetochlor residues are very likely to reach groundwater and 

surface water (US EPA, 1994). There is some evidence that this compound might migrate 

into ground and surface waters due to their solubility and mobility (Konda and Pásztor, 

2001; Hu et al., 2011; Widmer and Spalding, 1995) and their detection in water samples 

(VanRyswyk and Tollefson, 2009; Kalkhoff et al., 1998; Field and Thurman, 1996; Kolpin 

et al., 1996; Kolpin et al., 1996a) is addressed in several reports. During the first season it 

was used, acetochlor was detected in surface water in Minnesota at concentrations 

comparable with those of other chloracetanilide herbicides (10-250 ng/l) (Capel et al., 

1995). Contamination of surface and groundwater with pesticides may be due to their direct 

application, discharges of industrial waste water, or leaching from soil treated with 

pesticides. As well the erosion of pesticides from agricultural and urban areas, a source of 

contamination can be their waste and dumps. 

Besides the occurrence of pesticides in drinking water, control of pesticide presence 

in surface and groundwater is also very important. This primarily refers to the drainage 

water, river and groundwater, considering the importance of environmental protection and 

food safety production. 


Chemicals 

The analytical standard of acetochlor produced by Dr. Ehrenstorfer GmbH 

(Augsburg, Germany) were used. Solvents used in this study, methanol, dichloromethane 

and n-hexane, were all obtained from J.T. Baker (Holland). 

Stock solution of pesticide standard were prepared by dissolving the standard 

material in methanol, whereas the working solutions of pesticide (0.01 µg/ml - 2 µg/ml) 

were prepared by the appropriate dilution. All the solutions were protected from light and 

kept in a refrigerator until being used. 

Recovery test was done with model solution – appropriate volume of tap water (250- 

1000 ml) enriched with 1 ml of pesticide solution in concentration of 1 µg/ml. 

SP disc extraction 

The extraction of pesticide from water was carried out with ENVI-18 DSK (47mm) 

(Supelco No. 57171). The disc was previously conditioned with methanol and deionized 

water (5 ml/5 ml). Under vacuum (10 ml/min) the model solution was filtered through the 

disc. After the disc was dried (1 h) the analyte was eluted from the disc with 5 ml of 

mixture dichloromethane/n-hexane (40-60 %). Eluate was evaporated to dryness and the 

extract was diluted in 1ml of methanol and analyzed on GC/ECD. The analysis was done in 

three replications.


GC/ECD analysis 

A Hewlett-Packard model 5890 Series II gas chromatograph equipped with Supelco 

column 24048 (SPBTM-5, 30mx0,32 mm id, film tickness 0,25 µm) and an electron 

capture detector Ni 63 (ECD) was used for pesticdie analysis. Carrier gas flow rate was 1 

ml/min, splitless injection. Temperatures of injector and detector were 250˚C and 300˚C, 

respectively. The initial oven temperature was 100˚C and increased 9˚C/min to 250˚C. 

LOQ 

Limit of quantification was calculated using Guidelines for Data Acquisition and 

Data Quality Evaluation in Environmental Chemistry (MacDougall and Crummett, 

1980). 


The experiment has been done to full factorial plan (FFP). The design consisted of 

two factors (sample volume and solvent ratio) at three levels (+1, 0, -1). The levels of 

factors were selected according to results from previous research (Lindley et al., 1996; 

Yokley et al., 2002). Statistical and graphical analysis of the data were performed using 

Statistica 10 software. The results were statistically tested by the analysis of variance 

(ANOVA) at the significance level of p=0.05. The adequacy of the model was evaluated by 

the coefficient of determination (R 2 ) and model p-value. For the description of the 

responses Y (recovery), a second-degree polynomial model was fitted to data (Eq. 1): 

Y=b 0 + b 1 X 1 + b 2 X 2 + b 11 X 1 2 + b 22 X 2 2 + b 12 X 1 X 2 

Eq. 1. 

Where 

b 0 is intercept, 

b 1 , b 2 is represents the linear, 

b 11 , b 22 is the quadratic and 

b 12 is the interaction effect of the factors. 

The factor variables are: X 1 : sample volume and X 2 : solvent ratio. 


Using the selected conditions the linearity of the calibration curve was evaluated at a 

concentration range between 0.01-2 µg/ml using five calibration solutions prepared in 

methanol. The calibration plots were linear and the correlation coefficients (R 2 ) for 

acetochlor was 0.997 % and LOQ was 0.01 µg/ml, lower than the maximum residue limits 

of the pesticides in water samples established by the European Union. 

Effects of sample volume and solvent ratio on the extraction yield of acetochlor were 

studied by RSM. The results of the ANOVA are reported in Table 1. 

Table 1. Analysis of variance (ANOVA) for the modeled response of acetochlor 

Response 

Source 

Acetochlor 

Residual 

Model 

DF SS MS DF SS MS 

F-value p-value R 2 

3 23.444 7.8148 5 600.111 120.022 15.358 0.0239 0.981 

DF – Degree of Freedom; SS – Sum of Squares; MS – Mean Squares


High value of the coefficient of determination (R 2 =0.981), obtained for response 

indicate good fit of experimental data to Eq. 1. This means that the response surface model 

could explain more than 98 % of the variation of the studied response variables. The model 

F-value of 15.358 for acetochlor content, demonstrates that models for selected responses 

are significant at 95 % confidence level, p


Figure 1. The effect of sample volume and solvent ratio on acetochlor extraction 

(response surface) 

CONCLUSIONS 

A simple and sensitive method for determination of acetochlor from water using C 18 

disc and GC/ECD was developed. The response surface methodology was used to optimize 

the parameters of extraction and to investigate the interaction effects of different factors. 

Optimal conditions for acetochlor extraction from water were – sample 800 ml, solvents 

40/60 (v/v) dichloromethane/n-hexane. Given the above we can conclude that RMS 

provides sufficient information to allow us to select individual and/or simultaneous 

extraction conditions that will yeald a specific target recovery. 


The authors thank the Ministry of Education and Science of the Republic of Serbia 

(Grant III43005) for financial support to carry out this work. 

REFERENCE 

Capel, P.D., Ma, L., Schroyer, B.R., Larson, S.J., Gilchrist, T.A. (1995): Analysis and detection 

of the new corn herbicide acetochlor in river water and rain. Environmental Science and 

Technology, 29:1702-1705. 

Field, J. A.; Thurman, E. M. (1996): Glutathione Conjugation and Contaminant Transformation. 

Environ. Sci. Technol., 30:1413-1418. 

Hu, J.Y., Zhen, Z.H., Deng, Z.B. (2011): Simultaneous determination of acetochlor and 

propisochlor residues in corn and soil by solid phase extraction and gas chromatography 

with electron capture detection. Bull Environ Contam Toxicol, 86(1):95-100.


Kalkhoff, S.J., Kolpin, D.W., Thurman, E.M., Ferrer, I., Barcelo, D. (1998): Degradation of 

chloroacetanilide herbicides, the prevalence of sulfonic and oxanilic acid metabolites in 

Iowa groundwaters and surface waters. Environ Sci Technol., 32(11):1738-1740. 

Khuri, A.I. (2001): An overview of the use of generalized linear models in response surface 

methodology. Nonlinear Analytica, 47:2023-2034. 

Khuri, A.I., Cornell, J.A. (1996): Responses surfaces: design and analyses. 2 nd Ed. New York: 

Marcel Dekker. 

Kolpin, D.W., Nations, B.K., Goolsby, D.A., and Thurman, E.M. (1996): Acetochlor in the 

Hydrologic System in the Midwestern United States, 1994: Environmental Science & 

Technology, 30(5):1459-1464 

Kolpin, D.W., Thurman, E.M., Goolsby, D.A. (1996a): Occurrence of selected pesticides and 

their metabolites in near-surface aquifers of the Midwestern U.S. Environ Sci Technol; 

30(1):335-340. 

Konda, L.N., Pásztor, Z. (2001): Environmental distribution of acetochlor, atrazine, 

chlorpyrifos, and propisochlor under field conditions. , J Agric Food Chem, 49(8):3859- 

63. 

Lindely, C.E., Stewart, J.T., Sandstorm, M.W. (1996): Determination of Acetochlor in water by 

automated solid-phase extraction and gas chromatography with mass-selective detection. 

Analytical Chemistry, 79 (4): 962-966. 

MacDougall, D., Crummett, W.B. (1980): Guidelines for Data Acquisition and Data Quality 

Evaluation in Environmental Chemistry. Analytical Chemistry, 52: 2242–2249. Statistica 

10.0 (Stat Soft., Inc., Tulsa, Oklahoma). 

U.S. Environmental Protection Agency (1994): Questions and Answers, Conditional 

Registration of Acetochlor, U.S. Environmental Protection Agency, Washington, DC. 

VanRyswyk, B., Tollefson, D. (2009): Evaluation of an ELISA method for acetochlor analysis 

in the Le Sueur river Watershed. Minnesota Department of Agriculture Pesticide and 

Fertilizer Management Division Monitoring and Assessment Unit, Saint Paul, MN. 

Widmer, S.K., Spalding, R.F. (1995): A natural gradient transport study of selected herbicides. 

J. Environ. Qual., 24:445-453. 

Yokely, R.A., Mayer, L.C., Huang, S-B., Vargo, J. (2002): Analytical method for the 

determination of metolachlor, acetochlor, alachlor, dimethenamid and their 

corresponding ethansulfonic and oxanillic acid degradates in water using SPE and 

LC/ESI-MS/MS. Analytical Chemistry (74): 3754-3759.

Lazić Sanja, Komlen Vedrana, Šunjka Dragana,... 401 



DETERMINATION OF FUNGICIDE RESIDUES IN GRAPE BY 

GC/MS 

LAZIĆ SANJA 1 , KOMLEN VEDRANA 2 , ŠUNJKA DRAGANA* 1 , GRAHOVAC NADA 3 , PEJČIĆ 

JADRANKA 2 , RAHIMIĆ ALMA 2 , BLESIĆ MILENKO 4 

1 

University of Novi Sad, Faculty of Agriculture, Trg D. Obradovića 8, Novi Sad, SERBIA 

2 

University Džemal Bijedić, Agromediterannian faculty, Sjeverni logor bb, Mostar, BiH 

3 

Institute for Field and Vegetables Crops, Maksima Gorkog 30, Novi Sad, SERBIA 

4 

University of Sarajevo, Faculty of Agriculture and Food Science, Zmaja od Bosne 8, Sarajevo, 

BiH 

*Corresponding author 

e-mail address: draganas@polj.uns.ac.rs 

The extensive use of pesticides in modern farming on fruit and vegetables has posed risks to 

public health and environment. Pesticide residues can be found even when they are applied in 

accordance with good agricultural practices. This paper deals with the analysis residues of three 

fungicides (benalaxyl, dimethomorph, tetraconazole) by chromatographic method in grape samples. 

The applicability of the proposed method to detect and quantify pesticide residues has been 

demonstrated by the analysis sample grapes varieties "Žilavka" and "Blatina" cultivated on a small 

farm in the vineyards in a broader the region of Mostar. Analytes were extracted using SPE technique 

and analysis is performed by gas chromatography, employing mass selective detection in the selected 

ion monitoring mode. The content fungicides (benalaxyl, dimethomorph, tetraconazole) in grape 

samples is regulated by relevant EU regulation (The Annexes of Commission Regulation (EC), No. 

396/2005). In grape samples analyzed in this study residues of benalaxyl and tetraconazole were 

found. The fungicide concentrations were bellow the MRL value permitted by EU regulations for 

grape. 

Key words: grape, fungicides, gas chromatography, residue analysis 

INTRODUCTION 

Fungicides represent one of the most relevant groups of pesticides applied to 

vineyards. These compounds are sprayed directly on fruit and leaves to prevent the attack 

of fungi, which reduce the yield of fruit (Otero et al., 2003). Residues of these compounds 

were believed to be one of the most important pollution sources in food production and 

might pose potential threat to public health. However, if these harmful chemicals are not 

degraded naturally, they will penetrate plant tissues and appear in the pulp and juice. Once 

present in the pulp, pesticides are difficult to completely be removed. Moreover, the 

concentration of pesticide residues may increase during post processing, where in general 

pesticide concentrations in processed juices are higher than that in the natural fruit (Cabras

402 Determination of fungicide residues in grape by GC/MS 

and Angioni, 2000). Pesticide residues in fruit wine, like those found in juice, are also 

introduced from planting and preservation process. Several different fungicides are widely 

used in the treatment of diseases of grapes (Alawi, 1995; Cabras and Angioni, 2000; Cabras 

et al., 1997; Cabras et al., 1998). Because of the health risk of pesticide residues in fruit and 

wine, it is of particular importance to provide precise, accurate and reliable test result of 

residues as the scientific basis for ensuring food safety and fair practice in international 

trade. Pesticide residue analysis is becoming one of the most active directions in the field of 

analytical chemistry. Most of the traditional analysis methods of pesticide residues are 

applied to detection of a single component or a category of pesticides. On the contrary, 

multi-residue analysis method can be used to analyze not only different components of 

same type of pesticides, but also different components of different types of pesticides. The 

development of multi-residue methods represents a relatively new trend in pesticide residue 

analysis. 

Sample preparation plays an important role in the field of pesticide residue analysis. 

Solid phase extraction (SPE) is the most common method of extracting fungicides and 

renders high extraction yields. It has been proven that SPE offered several significant 

advantages over LLE, such as less consumption of organic solvent, shorter analysis time, 

no phase emulsion, higher method recovery, and more efficient removal of interfering 

compounds. SPE can be used to isolate analytes of interest from a wide variety of matrices, 

including juice and wine. It was often used combined with LLE as means for enrichment 

and purification. Several multiresidue methods are available for the determination of 

residues of different triazoles in various food products such as processed fruits, vegetables, 

grapes, wines and strawberries (Garland et al., 1999; Sannino, 2004; Zambonin et al., 2002) 

involving intensive sample preparation such as solid phase extraction which is time 

consuming and labor intensive. The residues of these fungicides are analyzed by gas–liquid 

chromatography by both nitrogen phosphorous detector (NPD) and electron capture 

detector (ECD), or by techniques such as gas chromatography-tandem mass spectrometry 

for confirmation and quantization (Bernal et al., 1997; Otero et al., 2003; Schermerhorn and 

Golden, 2005; Trosken et al., 2005). 

Benalaxyl, dimethomorph and tetraconazole is included among the active substances 

in Annex I to Directive 91/414/EEC (http://ec.europa.eu/sanco_pesticides) and their 

structures are shown in Figure 1. 

a) b) c) 

Figure 1. Structures of fungicides a) benalaxyl b) dimethomorph c) tetraconazole 

The aim of this work was to determine fungicides residues (benalaxyl, 

dimethomorph, tetraconazole) in grape samples. Residues were determined using a gas 

chromatograph equipped with a mass selective detector (MSD).



The vineyards choice was done to research on four different locations in the 

vineyards of Mostar. At three locations - Humčine, Mukoša and Žitomislić - it was a 

plantation vineyards, while the location Hodbina was a small vineyard. The field sampling 

was conducted during the technological maturity of the grape varieties of "Žilavka" and 

"Blatina" and concentration of fungicide residues determinated in samples of grape of this 

varieties. The average sample was taken from five grapevines with different heights and 

foreign vines. The average weight of each laboratory sample of grapes was approximately 2 

kg with at least five clusters. The samples were packed in plastic bags and hand delivered to 

the laboratory refrigerator (Table 1). 

Table 1. Place and method of sampling grapes 

Location Varieties Number of samples 

Humčine 

Žilavka 

4 

Blatina 

4 

Mukoša 

Žitomislić 

Žilavka 

Blatina 

4 

4 

Hodbina 

Žilavka 

4 

Blatina 

4 

Treatments were carried out air assistance sprayers (atomizer) with 300 l with 

average interval between treatments was 10 days (the largest gap was 17 days, a minimum 

distance of applications 3 days) as presented on table 2. During vegetation has been free of 

disease. The protection program grape in the vineyard plantation Žitomislić was the same 

as the program was conducted in the vineyard plantation Mukoša (Table 2-4). 

Table 2. The protection program grape in the vineyard plantation Humčine 

No. 

Date 

treatment 

Product 

Active substance 

Quantity 

kg or l/ha 

1. April 21 st Folpan Folpet 2.05 

Kossan WG Sulfur 4.1 

2. May 6 th Folpan Folpet 2.5 

Kossan WG Sulfur 4.9 

3. May 14 th Manfil 75 WG Mancozeb 3.3 

Karathane Gold 350 Meptyldinocap 0.9 

4. May 23 rd Manfil 75 WG Mancozeb 3.3 

Karathane Gold 350 Meptyldinocap 0.9 

5. May 27 th Fantic M Benalaxyl + mancozeb 4.9 

Domark 40 ME Tetraconazole 1.4 

6. June 16 th Fantik F Benalaxyl + folpet 4.9 

Crystal Quinoxyfen 0.4 

7. June 29 th Fantikc F Benalaxyl + folpet 4.9 

Crystal Quinoxyfen 0.4 

8. July 15 th Mythos Pirimetanile 2.5


Table 3. The protection program grape in the vineyard plantations Mukoša and Žitomislić 

No. 

Date 

treatment 

Product 


Quantity 

kg or l/ha 

1. May 5 th Delan Dithianon 0.3 

Sulfur Sulfur 1.5 

2. May 15 th Delan Dithianon 0.4 

Thiovit jet Sulfur 2.0 

3. May 25 th Pergado F Mandipropamid+ folpet 2.0 

Talendo Proquinazid 0.25 

4. June 5 th Fantic F Benalaxyl + folpet 2.5 

Domark, Tetraconazole 0.75 

5. June 18 th Forum star Dimethomorph + folpet 2.0 

Collis Kresoxim-methyl + boskalid 0.4 

6. June 30 th Mikal premium Fosetyl + folpet+ iprovalicarb 3.0 

Postalon Quinoxyfen + myclobutanil 0.125 

7. July 12 th Cabrio top Pyraclostrobin + methiram 2.0 

8. August 9 th Mythos Pirimethanil 2.5 

Table 4. The protection program grape in the vineyard plantation Hodbina 

No. 

Date 

treatment 

Product 


Quantity 

kg or l/ha 

1. April 20 th Cuprablau Copper 3.0 

Chromosul Sulfur 2.5 

2. April 28 th Chromosul Sulfur 2.5 

3. May 7 th Chromosul Sulfur 2.5 

4. May 20 th Chromosul Sulfur 2.5 

Ridomil gold Metalaxyl + mankozeb 2.5 

Topas Penconazole 0.25 

5. June 1 st Ridomil gold Metalakxyl + mankozeb 2.5 

Chromosul Sulfur 2.5 

6. June 11 th Domark, Tetraconazole 0.75 

Fantic F Benalaxyl + folpet 2.5 

Pirus Pirimetanil 2.5 

7. June 24 th Acrobat Dimethomorph + mankozeb 2.5 

Systane 24 E Myclobutanil 1.0 

8. July 4 th Cuprablau Copper 3.0 


9. July 20 th Nordoks 75W Copper 1.25 


10. August 5 th Mythos Pirimetanil 2.5


In this study we are investigated the presence of benalaxyl, dimethomorph and 

tetraconazole residues in grape. Fungicides were extracted from homogenized samples of 

grape by mechanical shaking with acetonitrile (Fillion et al., 2000). Clean-up is necessary 

in order to reduce the detection limits of the method and/or to avoid interferences from the 

barley malt matrix. The concentrated sample extracts may contain a high content of coextractives 

which can damage the GC column, resulting in a matrix enhancement effect 

(Hajšlová et al., 1998). 

GC–MS ANALYSIS 

Determinations were performed on Thermo type Focus DSQ II gas chromatograph 

fitted with an mass selective detector. The gas chromatograph was equipped with sampler 

and split less injector with electronic pressure control. The mass spectrometer was used 

with electron impact ionization (70 eV) in Scan mode and selected ion monitoring (SIM) 

mode (Table 5). 

Table 5. Operational conditions 

Operating mode splitless 

Injection volume 2 µl 

Injector temperature 250 °C 

Temperature detector 285 °C 

Helium flow rate 0.9 ml/min 

Initial column temperature 70 °C 

Initial time 2 min 

Speed of temperature rise 25 °C/min 

Final temperature 280 °C 

Identification of the studied analytes was done by comparing mass spectra and 

retention times of the samples grape with working standard solutions of fungicides. The 

identification was confirmed by comparing the relative abundances of ions (quantifier and 

qualifiers) of the experimental standards against well-known relative abundances of the US 

National Institute of Standards and Technology (NIST) library reference spectra. The mass 

spectrometer was calibrated with perfuorotributylamine (PFTBA). 

Limit of detection was calculated using Guidelines for Data Acquisition and Data 

Quality Evaluation in Environmental Chemistry (MacDougall and Crummett, 1980). 

RESULTS 

Under the selected conditions, the linearity of the calibration curve was evaluated in 

a concentration range. LOD was 0.001 mg/kg. Average value for the recovery of benalaxyl, 

dimethomorpf and tetraconazole were > 90%. The final extracts of grape samples made by 

the proposed SPE method were satisfactorily clean for direct GC-MS analysis (Figure 2). 

The results of fungicide residues in the grapes are shown in the Table 6.


Figure 2. GC-MS chromatogram of grape samples 

Table 6. Determined value of fungicides in grape by GC-MS 

Locality Variety Investigated compound 

Determinted 

value (mg/kg) 

LOD* (mg/kg) 

Žilavka 

Benalaxyl < LOD 0.001 

Dimethomorph < LOD 0.001 

Tetraconazole 0.003 0.001 

Humčine 

Benalaxyl 0.014 0.001 

Blatina 



Benalaxyl 0.002 0.001 

Mukoša Žilavka Dimethomorph < LOD 0.001 



Žitomislić Blatina Dimethomorph < LOD 0.001 


Žilavka 




Hodbina 


Blatina 


Tetraconazole < LOD 0.001 

*LOD- Limit of detection


In samples of grape, variety Žilavka, residues of tetraconazole were found in 

samples from all localities (Humčine, Mukoša and Hodbina) in amount of 0.002-0.003 

mg/kg, while benalaxyl was found only in samples from locality Mukoša (0.002 mg/kg). 

The residues of benalaxyl in grape, variety Blatina were found in samples collected 

from locality Humčine (0.014 mg/kg). Fungicide tetraconazole in the same samples were 

found in amount of 0.001-0.017 mg/kg (localities Humčine and Žitomislić). 

The residues of tetraconazole found in grape samples from field experiments were 

clearly below the EU established MRL values (0.5 mg/kg), thus causing no problems in 

food safety. The residues of benalaxyl were also below EU MRL (0.3 mg/kg). Residues of 

dimethomorph were not found in analyzed grape samples. 

DISCUSSION 

A number of analytical methods designed to determine multiple pesticide residues 

have been developed since the 1950s and 1960s and have greatly contributed to agricultural 

productivity (Jeong et al., 2012). Chromatographic methods represent the most suitable 

approach for determining pesticide residues in food samples (Schenck et al., 2002). In this 

work fungicide residues from grape samples were isolated by SP extraction with 

acetonitrile and determination was performed using GC/MS. Considering high value of the 

recovery (>90 %), applied method was completely suitable for this kind of analysis. 

The highest value of the fungicide residues were found in grape variety Blatina from 

the locality Humcine. It is can be explain with intensive application of fungicide benalaxyl 

on this locality (Table 2). The content of fungicide residues were under MRL permitted 

from European Union for those selected pesticides. 

The obtained results it can be concluded that the applied fungicide in grape samples 

naturally degraded and ensure their safety for safe use. The obtained positive results for 

tetraconazole and benalaxyl could be attributed to the high sensitivity of the developed GC– 

MS method. 

The main reasons that the amounts of the residues were bellow the maximal residue 

limits are considering of appropriate fungicide concentrations at the application and also 

considering of safety intervals, which have to run out from the last application and harvest 

(Čuš et al., 2011). 

CONCLUSIONS 

In this research, SPE combined with GC-MS has been applied to the simultaneous 

determination of selected fungicide residues in grape samples. Performance of the proposed 

method fits the requirements for the determination of selected fungicides in real grape 

samples. Using MSD, quantification (through selective ion monitoring) and confirmation 

are achieved simultaneously. Residues of dimethomorph in analyzed samples of grape, 

variety Žilavka and Blatina were not detected. The concentrations of benalaxyl and 

tetraconazole in the analyzed samples of grape were 0.002-0.014 mg/kg and 0.001-0.017 

mg/kg, respectively. These results were below the permissible levels (MRL) set by EU 

regulations (The Annexes of Commission Regulation (EC) No 396/2005) for tetraconazole 

and benalaxyl in grape.


REFERENCES 

Alawi, M. A. (1995): Development of a New Approach for the Determination of Folpet in 

Grapes. Analytical Letters, 28(2): 349–356. 

Bernal, J.L., Del nozal, M.Z.M.J., Jimenez, J.J., Rivera, M.J. (1997): Matrix effects in the 

determination of acaricides and fungicides in must by gas chromatography with electron 

capture and nitrogen phosphorus detection. Journal of Chromatography A, 778(1– 

2):111–117. 

Cabras, P., Angioni, A. (2000): Pesticide residues in grapes, wine, and their processing products. 

Journal of Agricultural and Food Chemistry, 48(4): 967–973. 

Cabras, P., Angioni, A., Garau, V. L., Minelli, E.V. (1997): Gas chromatographic determination 

of cyprodinil, fludioxonil, pyrimethanil, and tebuconazole in grapes, must, and wine. 

Journal of AOAC International, 80(4): 867–870. 

Cabras, P., Angioni, A., Garau, V.L., Pirisi, F.M., Brandolini, V. (1998): Gas chromatographic 

determination of azoxystrobin, fluazinam, kresoxim-methyl, mepanipyrim, and 

tetraconazole in grapes, must, and wine. Journal of AOAC International, 81(6): 1185– 

1189. 

Čuš, F., Čadež, J.N., Raspor, P.I. (2011): Fungicide Residues in Grapes Determined the 

Dynamics of Saccharomyces cerevisiae Strains during Spontaneous Wine Fermentation. 

Proc. Nat. Sci, Matica Srpska Novi Sad, № 121: 85—101. 

EU Document No. 3010, Status of active substances under EU review 

(http://ec.europa.eu/sanco_pesticides). 

Fillion, J., Sauve, F., Selwyn, J. (2000): Multiresidue Method for Determination 251 Pesticides 

in Fruits and Vegetables by GC/MS and HPLC/Fluorescence. Journal of AOAC 

International 83: No3, 698-713. 

Garland, S., Menary, R., Davies, N. (1999): Dissipation of propiconazole and tebuconazole in 

peppermint crops (Mentha piperita) (Labiatae) and their residues in distilled oils. Journal 

of Agricultural and Food Chemistry, 47(1):294–298. 

Hajšlová J., Holadová K., Kocourek V., Poustka J., Godula M., Cuhra P., Kempný M. (1998): 

Matrix-induced effects: a critical point in the gas chromatographic analysis of pesticide 

residues. Journal of Chromatography A, 827: 283-295. 

Jeong, I.S., Kwak, B.M., Ahn, J.H., Jeong, S.H. (2012): Determination of pesticide residues in 

milk using a QuEChERS-based method developed by response surface methodology. 

Food Chemistry, 133 :473–481. 

MacDougall, D., Crummett, W.B. (1980): Guidelines for Data Acquisition and Data Quality 

Evaluation in Environmental Chemistry. Analytical Chemistry, 52: 2242–2249. 

Otero, R.R., Granade, B.C., Gandara, J.S. (2003): Multiresidue method for fourteen fungicides 

in white grapes by liquid-liquid and solidphase extraction followed by liquid 

chromatography-diode array detection. Journal of Chromatography A, 992(1–2):121– 

131. 

Regulation (EC) No 396/2005 of the European Parliament and of the Council of 23 February 

2005 on maximum residue levels of pesticides in or on food and feed of plant and animal 

origin and amending Council Directive 91/414/EEC. 

(http://ec.europa.eu/sanco_pesticides/public/index.cfm) 

Sannino, A. (2004): Evaluation of a method based on liquid chromatography/electrospray 

tandem mass spectrometry for analyzing eight triazolic and pyrimidine fungicides in 

extract of processed fruits and vegetables. Journal of AOAC International, 87(4):991– 

996. 

Schenck, F. J., Lehotay, S. J., & Vega, V. (2002). Comparison of solid-phase extraction sorbents 

for cleanup in pesticide residue analysis of fresh fruits and vegetables. Journal of 

Separation Science, 25:883–890.


Schermerhorn, P.G., Golden, P.E. (2005): Determination of 22 triazole compounds including 

parent fungicides and metabolites in apple, peaches, flour and water by liquid 

chromatography, tandem mass spectreometry. Journal of AOAC International, 

88(5):1491–1502. 

Trosken, E.R., Bittner, N., Volkel, W. (2005): Quantitation of 13 azole fungicides in wine 

sample by liquid chromatography-tandem mass spectrometry. Journal of 

Chromatography A, 1083(1–2):113–119. 

Zambonin, G., Cilenti, A., Palmisano, F. (2002): Solid-phase micro extraction and gas 

chromatography-mass spectrometry for the rapid screening of triazole residues in wine 

and strawberries. Journal of Chromatography A, 967(2):255–260.

410 Determination of deoxynivalenol in pasta samples by HPLC/DAD 


Proceedings 664.694:632.952 

DETERMINATION OF DEOXYNIVALENOL IN PASTA SAMPLES 

BY HPLC/DAD 

VUKOVIĆ GORICA 1 , PAVLOVIĆ SNEŽANA 2 , STAROVIĆ MIRA 3 , STOJANOVIĆ SAŠA 3 . 

1 Institute of Public Health, Bulevar despota Stefana 54a, Belgrade 

2 Institute for Medicinal Plant Research „Dr Josif Pančić“, T.Košćuška 1, Belgrade, Serbia 

3 Institute for Plant Protection and Environment, T. Drajzera 9, Beograde, Serbia 

A reversed phase HPLC method with UV detection has been used for the determination and 

quantification of deoxinivalenol (DON) in pasta samples. DON was extracted by deionized water then 

isolated by immuno-affinity column. Chromatographic separation was achieved using a reverse phase 

chromatography on Zorbax SbAq column (Agilent, USA). The mean recovery for DON, at 50, 200 

and 1250 µg kg -1 spiking levels, was 88,8 % (%RSD 4.4). The limit of detection (calculated from the 

concentrations that provide a signal to noise ratio of 1:3) was 7µg kg -1 . The limits of quantification 

estimated as the concentrations of analytes which yield a signal to noise of at least 1:10, was 25µg kg - 

1 . A total of 12 commercially available samples of pasta and wheat products were analyzed and DON 

was detected in 4 samples. The concentration ranged from 37 to 155 µg kg -1 , but none of the samples 

were above MRL. 

Key words: deoxynivalenol, mycotoxins, pasta, HPLC/DAD 

INTRODUCTION 

Deoxynivalenol (DON) is one of the most frequently detected mycotoxin 

contaminant in wheat and wheat products worldwide (Klinglmayr et al., 2010). This is a 

secondary metabolite produced by fungi from the Fusarium genus. Fusarium graminearum 

and Fusarium culmorum are the most important ear blight pathogens of wheat, producing 

higher levels of DON than other Fusarium species. 

DON belongs to the trichothecenes, which are esters of sesquiterpenoid alcohols 

containing a tricyclic ring system. DON is known to bind to eukaryotic ribosomes, 

inhibiting protein synthesis and thus leading to a variety of toxic effects (Scientific 

Committee of Food, Opinion on Fusarium Toxins, 1999). In animals, acute exposure to 

high DON doses causes vomiting, diarrhea and gastrointestinal hemorrhage, with chronic 

exposure leading to reduced weight gain and anorexia (Pestka, 2007). The toxic effects of 

DON on humans are not well-known, but studies list the following symptoms in humans: 

abdominal pain, dizziness, headache, throat irritation, nausea, vomiting, diarrhea, and blood 

in the stool. (Rotter, et al., 1996). 

Numerous analytical methods have already been developed for the determination of 

DON in food products such as gas chromatography with electron-capture (Valle-Algarra, et 

al., 2005; Kotal, et al., 1999) or mass-spectrometry (MS) detection (Malmauret, 2001;

Vuković Gorica, Pavlović Snežana, Starović Mira, Stojanović Saša 411 

Schollenberger, et al., 2005; Schollenberger, 2005), high performance liquid 

chromatography with ultraviolet (UV) (Anselme, et al., 2006; Cahill, et al., 1999) or MS 

detection [Razzazi-Fazeli et al., 2003; Biancardi, et al., 2005). Recent review articles 

focused on the determination of mycotoxins by LC–MS (Zöllner, et al., 2006, Sforza, et al., 

2006). 

The purpose of this study was to examine the presence and concentration levels of 

DON in wheat-based foods, especially pasta samples and to identify the easiest method 

which can be used routinely in commercial purposes. 


Materials and Reagents 

The presence of microorganisms on pasta was tested according to the ‘Regulations 

of microbiological safety of food products’(Sl.RS, 2002). The number of microorganisms 

in each samples was estimated by multiplying the mean number of colonies per plate by the 

dilution used. Colonies were counted and counts were expressed as colony forming units 

per gram (cfu g − 1). 

Generally accepted principles were followed for the identification of the most 

frequent Fusarium species (Nelson et al., 1983; Burgess et al., 1994). 

The mycotoxin standard of deoxynivalenol (DON), was supplied by R-Biopharm 

Rhone Ltd, (Glasgow, Scotland). Stock solutions of deoxynivalenol were prepared in 

methanol from commercial standard (c = 100 µg/ml) and stored at –20°C. The calibration 

standards solutions ranging from 25 ng/ml to 1000 ng/ml were prepared in deionised water. 

The DONPREP immune-affinity column for the detection of DON was supplied by R- 

Biopharm Rhone LTD (Glasgow, Scotland). A filter paper no. 42 from Whatman (UK) was 

used. Analytical HPLC grade acetonitrile, methanol, polyethylene glycol PEG 8000 were 

obtained from Merck (Germany). Certified reference material CRM T2226 (dried pasta 

containing deoxynivalenol residues 421-859µg/kg was supplied by the FAPAS (FERA, 

UK). Samples of pasta were obtained from the local supermarket. 

Equipment: The liquid chromatograph LC 1200 model (Agilent, Germany) 

equipped with binary pump, auto-sampler and DAD detector, was used with a stainless 

steel reverse phase 250 × 4.6mm, 5µm particle size Zorbax SB-Aq HPLC column (Agilent, 

USA). 

Analytical Procedures 

Extraction: 25g of a grounded sample was placed into the blender jar, and then 200 

ml deionized water (HPLC grade water) and 2g of polyethylene glycol were added. The 

mixture was blended at a high speed for 2 min. Immediately after the blending a minimum 

of 20ml of the supernatant was filtered through Whatman No 42 filter paper. 

Clean-up by immune-affinity chromatography. 2 ml of the final extract, 

corresponding to 0.25g of the original material, was placed into the DONPREP® column. 

10ml of deionised water was used for the column washing. The elution of DON was done 

by 1.5ml of methanol. The elution solvent was removed by a gentle stream of nitrogen and 

reconstituted in 0.5ml deionised water. 

HPLC chromatography. 100µl of the sample was injected into the HPLC column 

heated to 30°C. The mobile phase consisted of acetonitrile/water solution (10:90, v/v). The 

flow rate was 1.2ml/min. Deoxynivalenol was determined at a wavelength of 218nm by use 

of a DAD detector.



Method of DON Determination 

The nvestigated pasta samples were contaminated by three species fungi from the 

genus Fusarium: Fusarium graminearum,i F. culmorum and F. verticillioides (Fig. 1). 

Figure1. Fusarium sp.: a) F.graminearum, b) F. cumlmorum c) F. verticillioides 

The aim of the study was to develop an easy method for a routine determination of 

DON in pasta, and other wheat products such as crumpets. A commonly used HPLC 

method for DON determination was applied. Deoxynivalenol absorbance is in the UV 

spectrum range, with maximum around 218nm. DON (a relatively polar trichothecene) is 

quickly excluded from the C18 analytical column if the less polar mobile phase is used. The 

optimum mobile phase consisting of the acetonitrile–water (10:90, v/v) was finally used for 

determination. The increasing temperature of the column moderately increased the rate of 

elution of the analyte from the column. The 30°C column temperature was chosen as an 

optimum. At the flow rate 1.2 ml/min, the analyte DON, was sufficiently separated (Fig. 2). 

The calibration curve was linear in the range of 25–1000 ng/ml (R 2 is 0.99965). 

mAU 

VWD1 A, Wavelength=218 nm (DON_2012\DON3 2012-06-12 10-08-33\DON0000003.D) 

4 

3 

2 

2 . 2 2 4 

Blank pasta sample 

1 

6 . 1 0 7 

8 . 6 5 9 

0 

-1 

2 4 6 8 10 

min

Vuković Gorica, Pavlović Snežana, Starović Mira, Stojanović Saša 413 

mAU 

VWD1 A, Wavelength=218 nm (DON_2012\DON3 2012-06-12 10-08-33\DON0000008.D) 

6 

5 

2 . 1 6 7 

Spiked pasta sample 100ng/ml (200ug/kg) 

4 

3 

2 

1 

5 . 4 0 8 

5 . 7 0 9 - D O N 

5 . 9 7 6 

6 . 3 8 9 

7 . 4 6 9 

8 . 0 0 7 

8 . 7 3 5 

8 . 9 2 3 

0 

-1 

-2 

2 4 6 8 10 12 

min 

Figure 2. A comparison of elution profiles of (a) blank pasta sample and 

(b) spiked pasta sample (level of contamination 0,2 mg DON per kg) 

Linearity and range 

A series of DON standards with the concentrations ranging from 25 to 1000 ng/ml 

were analyzed to determine linearity. Correlation coefficient was greater than 0,999. 

Recovery studies 

For the recovery studies, mycotoxin-free samples were artificially fortified at three 

levels in triplicate (50, 200, and 1250 µg/kg) of DON. 25g grams of a grounded sample 

were spiked with a suitable amount of mycotoxin and left at room temperature about 1 

hour. Finally, the spiked sample was extracted and analyzed by LC as described above. 

The recoveries of DON at the lower spiking level varied between 84.8% and 86.5%. 

At the higher spiking level, the recoveries varied between 92.2% and 100.2% (Fig.1) The 

RSDr (%) of the mean recoveries for DON ranged from 2.90% at the higher spiking level, 

to 6.81% at the lower spiking level; The recovery and RSDr obtained for DON are in line 

with the legislation levels for the DON determination methods (European Commission, 

2005), thus the method is acceptable according to the EU criteria. 

Precision study 

Precision was calculated in terms of intra–day repeatability (n=5) and assessment of 

trueness. Repeatability is based on the analysis of five individual portions of CRM 

(FAPAS, UK). The method repeatability is estimated as a relative standard deviation of 

4.5%. Trueness was expressed as relative difference between obtained and certified value 

(+11,1 %) 

CONCLUSION 

A procedure for determination of DON in pasta and whet-based food using immuneaffinity 

columns clean-up and HPLC/DAD has been described. Out of 12 samples 4 were 

found to be contaminated with DON, but the concentration in all the samples was below the 

MRL.


Since mycotoxin producing fungi are quite widespread, they can be detected in 

various products intended for human consumption. Therefore, it is very important to 

discover the sources of contamination of raw materials, intermediate and final products 

with mycotoxins and mycotoxin producing moulds. This can be achieved by establishing a 

monitoring programme of the distribution and contamination levels of mycotoxins (in this 

case deoxynivalenol) in human food. 

ACKNOWLEDGMENT 

This research was supported by the Ministry of Education and Science of the 

Repbulic of Serbia, through the project TR-31018 

REFERENCES 

Anselme, M., Tangni, E.K., Pussemier, L., Motte, J.C., van Hove, F., Schneider, Y.J. van 

Peteghem, C., Larondelle, Y. (2006). Food Addit. Contam. 23 910 

Biancardi, A., Gasparini, M., Dall’Asta, C., Marchelli, R. (2005). Food Addit. Contam. 22:251. 

Burgess L.W., Summerell B.A., Bullock S., Gott Kathryn, Backhouse D. (1994). Laboratory 

Manual for Fusarium Research.Fusarium Research Laboratory, Department of Crop 

Sciences, University of Sydney and Royal Botanic Gardens, Sydney, PP.1/-133. 

Cahill, L.M., Kruger, S.C., McAlice, B.T., Ramsey, C.S., Prioli, R., Kohn, B. (1999). J. 

Chromatogr. A 859: 23. 

European Commission (2005). Commission Directive No. 2005/38/EC of 6 June 2005 laying 

down the sampling methods of analysis for the official control of the levels of Fusarium 

toxins in foodstuffs. Official Journal of European Union L143, pp. 18–26. 

Klinglmayr, C., Nöbauer, K., Razzazi-Fazeli, I., Cichna-Markl, M. (2010). Journal of 

Chromatography B, 878: 187–193. 

Kotal, F., Holadova, K., Hajslova, J., Poustka, J., Radova, Z., J. (1999), Chromatogr. A 830: 

219. 

Malmauret, L., Parent-Massin, D., Hardy, J.-L., Verger, P. (2002). Food Addit. Contam. 19: 

524. 

Nelson P.E., Toussoun T.A., Marasas W.F.O. (1983). Fusariumspecies. An illustrated manual 

for identification. The Pennsylvania State University Press, University Park and London, 

1-193 

Pestka, J.J. (2007). Anim. Feed Sci. Technol. 137: 283. 

Razzazi-Fazeli, E., Böhm, J., Jarukamjorn, K., Zentek, J. J. (2003). Chromatogr. B 796: 21. 

Rotter, B. A., Prelusky, D. B., Pestka, J. J. (1996). Toxicology of deoxynivalenol (vomitoxin). 

Journal of Toxicology and Environmental Health - Part A, 48(1): 1-34. 

Schollenberger, M., Dochner, W., Rüfle, M., Suchy, S., Terry-Jara, H., Müller, H.-M. (2005) J. 

Food Com. Anal. 18: 69. 

Scientific Committee on Food, Opinion on Fusarium Toxins. (1999). Deoxynivalenol (DON), 

Part 1:

Slavica Gašić, Ljiljana Radivojević, Jelena Gajić,... 415 

International Symposium: Current Trends in Plant Protection UDK: 661.162.2.022.3 

Proceedings 

DEVELOPMENT OF THE ADJUVANTS BASED ON PLANT OILS 

AND THEIR APPLICATION 

SLAVICA GAŠIĆ, LJILJANA RADIVOJEVIĆ, JELENA GAJIĆ-UMILJENDIĆ, MARIJA STEVANOVIĆ, 

LJILJANA ŠANTRIĆ 

Institue of Pesticides and Environmental Protection, Banatska 31b, Belgrade, Serbia 

Adjuvants have been used worldwide in order to improve the efficacy of pesticide products. 

There is still considerable development of new adjuvants for the enhancement biological performance 

of different kind of pesticide products then for control drift and volatilization and for reducing dose 

rate. Among the different types of adjuvants we investigated development of the adjuvants based on 

plant oils (sun flower oil, soya been oil and esterified rape seed oil) in combination with different 

surfactants. After developing we compare the effects of the herbicide (bentazon) applied alone and in 

mixture with the adjuvants. In addition we also compared the effects of the adjuvants with the 

commercial adjuvant during the application with the same herbicide (bentazon) on two different 

locations. The results after one year trials were promising and we will continue this investigation in 

the same way this year. 

Key words: Adjuvant, Bentazon, Efficacy, Maize, Weeds, Oils 

INTRODUCTION 

Over the last few years the number of adjuvants on the market has been increased 

because of the interest in the potential benefits of their application. Also in the past the use 

of adjuvants was concentrated only on herbicides, whereas there is now considerable 

interest in using adjuvants for fungicides and insecticides to enhance activity and possible 

reduce dose rates for applications. Generally it is accepted that there are two main ways in 

which adjuvants may enhance biological performance of the pesticide products. The first 

way is increasing amount of retained pesticide active substance and the other way is 

promoting its uptake (Holloway et al., 2000, Green and Beestman, 2007). Although 

pesticide manufactures generally attempt to build in adjuvant in pesticide formulations it is 

not always possible. Actually there is no universal adjuvant which will give enhanced 

effects with all pesticides. Sometimes happens that biological efficacy with adjuvant may 

be even reduced or in some cases phytotoxicity problems to the crop may be increased 

(Ramsdale, Messersmith, 2002). Thus it is necessary to carry out field trials with adjuvants 

and the pesticide formulations to avoid this problem. 

The objective of this study was to develop three different adjuvants based on plant 

oils (sun flower oil, soya been oil and esterified rape seed oil) in combination with different 

surfactants. In adjuvants study, the most common experimental approach is to compare the 

effects of an herbicide applied alone at one or a few doses, alone and in mixture with

416 Development of the adjuvants based on plant oils and their application 

adjuvants applying analysis of variance for the statistical assessment. So we compare the 

effects of the herbicide (bentazon) applied alone and in mixture with the adjuvants. In 

addition we also compared the effects of the adjuvants with commercial adjuvant Trend 90 

during the application with the same herbicide (bentazon) on two different locations. The 

results we got after one year trials were encouraging and we will repeat the field 

investigation in the same way this year. 


The plant oils which were used for formulating adjuvants were purchased from 

commercial sources (Dijamant, Zrenjanin, Uvita, Debeljaca, Oleon, Belgium) and used 

without further purification. Emulsifiers which were used were of commercial quality 

(Ajinomoto OmniChem, Belgium and Rhodia, Italy). 

Adjuvants ware obtained by mixing oil phases (sun flower oil, soya been oil and 

esterified rape seed oil) with emulsifiers. For homogenization magnetic stirrer (IKA, RH 

basic 2, duration time 30 minutes, temperature 40 o C) was used. In this way the all adjuvants 

were prepared: soya been oil with 15% of emulsifiers (adjuvant 1-A1), esterified rape seed 

oil with 10% of emulsifiers (adjuvant 2-A2) and sun flower oil with 15% of emulsifiers 

(Adjuvant 3-A3). After formulating, the accelerated storage tests (storage stability) were 

done (CIPAC method MT 39 and 46). After stability tests the same characteristics were 

checked according standard CIPAC methods: pH MT 75, density MT 3, and emulsion 

stability and re-emulsification MT 36.1 and compare (CIPAC, 1995). 

Field trials were carried out on maize crops in 2011, on two locations: Putinci (JPC 

coordinates: w: 7421521, e: 4983507, elevation: 105m a.s.l.). and Glogonjski Rit (JPC 

coordinates: 7461181, 4981089, elevation: 60m a.s.l.). 

Developed adjuvants used with commercial product Deltazon (Producer: Delta-M, 

active substance Bentazon, content 480 g/L). The same herbicide used with commercial 

adjuvant Trend 90 (DuPont International, Switzerland). Adjuvants (0.1%) were added to 

tank mixes (herbicide solutions) just prior application. Herbicides were applied at full 

recommended rate of 3 L/ha (active substance Bentazon 1440 g/ha). 

Adjuvants with herbicide were applied when stage of maize was 3-5 leaves and stage of 

weeds was 2-6 leaves. All treatments were done with a handheld backpack boom sprayer 

"Solo", equipped with Tee Jet XR 110/03. The quantity of water was 400 L/ha. The first 

evaluation of herbicide efficacy was made 3 weeks after the treatment and the second one 6 

weeks after the treatment. 

The herbicide efficacy was evaluated by OEPP/EPPO method (2004). Efficacyy 

percentage for each weed species was calculated. 


Before the field experiment started the stability and physical properties of the 

developed adjuvants had been checked and the results confirmed that the adjuvants were 

stable enough to be used (Tables 1-3).

Slavica Gašić, Ljiljana Radivojević, Jelena Gajić,... 417 

Table 1. Physical properties of Adjuvant with soya oil, before and after stability tests (Adjuvant 1) 

Temperature 0 o C (7 days) 20 o C 54 o C (14 days) 

Density (g/cm 3 ) 0.933 0.929 0.928 

pH value 5.03 5.61 5.39 

Stability of Emulsion 

and Reemulsification 

(cm 3 ) 

0.5h 0/0 

1h 0/0 

2h 0/0 

24h 1/0 

REE 0/0 

0.5h 0/0 

1h 0/0 

2h 0/0 

24h 0/0 

REE 0/0 

0.5h 0/0 

1h 0/0 

2h 0/0 

24h 0/0 

REE 0/0 

Table 2. Physical properties of Adjuvant with esterified rape seed oil, before and after stability 

tests (Adjuvant 2) 


Density (g/cm 3 ) 0.932 0.891 0.890 

pH value 5.23 5.10 4.94 



(cm 3 ) 

0.5h 0/0 

1h 0/0 

2h 0/0 

24h 2/0 

REE 0/0 

0.5h 0/0 

1h 0/0 

2h 0/0 

24h 1/0 

REE 0/0 

0.5h 0/0 

1h 0/0 

2h 0/0 

24h 4/0 

REE 0/0 

Table 3. Physical properties of Adjuvant with sun flower oil, before and after stability tests 

(Adjuvant 3) 


Density (g/cm 3 ) 0.934 0.929 0.929 

pH value 4.94 5.26 5.22 



(cm 3 ) 

0.5h 0/0 

1h 0/0 

2h 0/0 

24h 1/0 

REE 0/0 

0.5h 0/0 

1h 0/0 

2h 0/0 

24h 0/0 

REE 0/0 

0.5h 0/0 

1h 0/0 

2h 0/0 

24h 3/0 

REE 0/0


Many of herbicides, requires use of adjuvants to improve biological efficacy for 

foliage-applied treatments. Bentazon, a post-emergence herbicide with high selectivity is 

commonly used for controlling weeds in many crops altogether with adjuvants (Abouziena 

et al. 2009). The addition of an adjuvant increase herbicidal activity (Zabkiewicz, 2000, 

Kudsk and Mathiassen, 2007, Knowles, 2006) and modify environmental fate (Weinterberg 

and Greenhalgh, 1984). It has been reported that weed control with bentazon applied at rate 

of 0.56 kg/ha with any adjuvant was equal to weed control with bentazon applied alone at 

112 kg/ha (Al-Khatib et al, 1995). The addition of adjuvant doesn’t always correlate with 

increased efficacy (Singh et al, 2002). It is necessary to check the influence of adjuvant in 

field trials. 

In our investigation on the locations Putinci and Glogonjski rit dominate weed 

species were: Abutilon theoprasti, Chenopodium album, Chenopodium hybridum, 

Convolvulus arvensis, Datura stramonium, Helinathus annuus, Hibiscus trionum 

Polygonum aviculare,, Poligonium lapathifolium, Sinapis arvensis, Solanum nigrum, 

Stachys annua and Xanthium strumarium. 

The results of the investigation are shown in Table 4. The results are average of 

values for efficacy for two locations. 

From the results given in the Table 4 can be seen that mixing each adjuvant with 

bentazon generally enhanced efficiency of active substance to weeds. The adjuvants 

developed by us enhanced the efficiency more or less equal as commercial adjuvant Trend 

90. The results we got at both locations were in accordance. It should be point out that at 

the location of Glogonjski rit Adjuvants 2 and 3 in combination with bentazon enhanced 

efficacy to weed species Heliathus annuus which is dominate at that area even more than 

commercial adjuvant Trend 90 and adjuvant 1.If we in repeated field trails, this year would 

have the same results it would be very important facility for those adjuvants. It is worth to 

mention that the adjuvants formulated in this way leading to the use of safer and more 

environmentally friendly products with good biodegradability and low toxicity. With the 

many pressures on product performance, adjuvants are becoming a way by which the 

pesticide products could add significant value.

Slavica Gašić, Ljiljana Radivojević, Jelena Gajić,... 419



This work was financially supported by the Ministry of Education and Science 

Republic of Serbia under the projects No. III46008 and TR31043. 

REFERENCES 

Abouziena, H.F.H., Sharma, S.D., Singh, M.(2009): Impact of adjuvants on bentazon efficacy 

on selected broadleaf weeds. Crop Prot., 28: 1081-1085. 

Al-Khatib, K., Kadir, S., Libbey, C. (1995):Effect of adjuvants on bentazon efficacy in green 

pea (Pisum sativum.), Weed Technol., 9: 426-431. 

CIPAC (1995): CIPAC Handbook – Volume F. Physico-Chemical Methods for Technical and 

Formulated Pesticides (Dobrat W., Martin A., eds.). Collaborative International 

Pesticides Analytical Council Ltd., Harpenden, Herts, UK. 

Green, J.M., Beestman, G.B. (2007): Recently patented and commercialized formulation and 

adjuvant technology. Crop Prot., 26: 320-327. 

Holoway, P.J., Ellis Butler, M.C., Webb, D.A., Western, N.M., Tuck, C.R., Hayes, A.L,. Miller, 

P.C.H. (2000): Effects of some agricultural tank-mix adjuvants on the deposition 

efficiency of aqueous sprays on foliage. Crop Prot., 19: 27-37. 

Knowles, A. (2006): Adjuvants and additives. Agrow Reports, London, UK. 

Kudsk, P., Mathiassen, S.K. (2007): Analysis of adjuvant effects and their interactions with 

variable application parameters. Crop Prot., 26: 328-334. 

OEPP/EPPO (2004): EPPO Standards PP1: Efficacy evaluation of herbicides and plant growth 

regulators. Weeds in maize. European and Mediterranean Plant Protection Organization, 

Paris, France, 4:, 6-10. 

Ramsdale, B.K., Messersmith (2002): Adjuvant and Herbicide Concentration in Spray Droplets 

Influence Phytotoxicity. Weed Sci 16: 631-637. 

Sinigh, M., Tan, S. Sharma, S.D. (2002): Adjuvants enhance weed control efficacy of foliar – 

applied diuron. Weed Technol. 16: 74-78. 

Weinberger, P., Greenhalgh, R. (1984): Some adjuvants effects on the fate of fenitrothion and 

aminocarb. Environ.Toxicol. Chem..3: 325-334. 

Zabkiewicz, J.A(2000).: Adjuvants and herbicidal efficacy - present status and future prospects. 

Weed Res., 40: 139-149.

Goran Aleksić, Tatjana Popović, Mira Starović,... 421 


Proceedings 

SENSITIVITY OF VENTURIA INAEQUALIS ISOLATES TO 

FUNGICIDES WITH DIFFERENT MODES OF ACTION 

GORAN ALEKSIĆ 1 , TATJANA POPOVIĆ 1 , MIRA STAROVIĆ 1 , SLOBODAN KUZMANOVIĆ 1 , 

DRAGANA JOŠIĆ 2 , NENAD DOLOVAC 1 , DOBRIVOJ POŠTIĆ 1 

1 Institute for Plant Protection and Environment, Belgrade, Serbia 

2 Institute for Soil Science, Belgrade, Serbia 

Venturia inaequalis (apple scab) is the most important disease in apple orchards where 

fungicide management is the main tool to control of the disease. Sensitivity tests to difenoconazole, 

flusilazole, cyprodinil, pyrimethanil, kresoxim-methyl, captan and mancozeb fungicides were 

conducted on V. inaequalis isolates from treated and untreated orchards. In vitro assays were 

conducted and sensitivity was measured as the inhibition of mycelial growth. Lower sensitivity was 

only found for kresoxim-methyl. Difference between populations from treated and untreated orchards 

was not observed. 

Key words: Apple, apple scab, fungicides, resistance 

INTRODUCTION 

Apple scab caused by Venturia inaequalis (Cooke) Winter (anamorph Spilocaea 

pomi Fr.) is the most important apple disease in the world. Chemical control with 

fungicides has been the main measure of disease control (Ivanović, 2001). During the 

growing season, in order to keep the trees scab free, more than 20 treatments may be 

needed (Ivanović, 2001). In order to protect apple trees from the apple scab, a wide 

spectrum of different chemical preparations is used from different chemical groups, with 

different mode of action (preventative, preventative-curative, curative and eradicative) 

which are often combined in order to enhance their effectiveness or avoid development of 

resistance. Unfortunately, fungicide resistance has been observed in some orchards. 

Investigating occurrence of reduced sensitivity of pathogens to fungicides is of great 

importance in conditions of intensive crop protection. Fungicide resistance in V. inaequalis 

is well documented worldwide for old fungicides such as dodine (Köller and Wilcox, 1999; 

Broniarek-Niemiec and Bielenin, 2008), benzimidazole (Koenraadt et al., 1992), 

demethylation inhibitors (DMIs) (Sholberg and Haag, 1993; Köller et al., 1997), and newer 

fungicides such as strobilurins (Olaya and Koller, 1999; Fontaine et al., 2009) and 

anilinopyrimidines (Küng et al., 1999). There are no reports in the literature about the 

sensitivity to mancozeb, an old fungicide still used for apple scab control, either used alone 

or mixed mainly with DMIs as an anti-resistance strategy.

422 Sensitivity of venturia inaequalis isolates to fungicides with... 

The objective of this research was to determine the sensitivity of V.inaequalis 

populations isolated from treated and untreated apple orchards to the difenoconazole, 

flusilazole, cyprodinil, pyrimethanil, kresoxim-methyl, captan and mancozeb fungicides. 


Fungal strains. 

The purpose of this trial is to test, in vitro, the effectiveness of some fungicides on 

the mycelia growth of Venturia inaequalis isolated from infected apple leaves collected 

from treated (isolate Morovic – M and M1) and untreated (isolate Nestin – N and N1) 

orchards during 2011. Isolations were carried out according to the method of Borić (1987) 

and Aleksić (1996). Isolates were grown for six weeks on PDA at 20°C. 

Mycelial growth assay. 

Commercial formulations of seven fungicides, representing different chemical 

families, were used in this study (TABLE 1). The experiment was done using a method 

described by Popović (2004). Appropriate volumes of each fungicide were added to the 

PDA at approximately 50°C in the quantities needed to achieve the final concentrations at 

the rate of the registered dose (TABLE 1) and poured in sterilized 50 mm Petri plates. 

Table 1: Fungicides on tested fungal cultures of Venturia inaequalis 

Active ingredient Fungicide Tested concentrations Tested doses 

/ litar 

Difenoconazole Score 250 EC 0.02 1 (0.005) 2 0.2 mL 

Flusilazole Punch 40 EC 0.01 1 (0.004) 2 0.1 mL 

Cyprodinil Chorus 75 WG 0.025 1 (0.01875) 2 0.25 g 

Pyrimethanil Pyrus 400 SC 0.15 1 (0.06) 2 1.5 mL 

Kresoxim-methyl Stroby DF 0.02 1 (0.01) 2 0.2 g 

Captan Merpan 80 0.2 1 (0.16) 2 2.0 g 

Mancozeb Mankogal 0.25 1 (0.2) 2 2.5 g 

1 

% of fungicide 

2 

% of active ingredient 

Mycelia plug (1 mm in diameter), obtained from the actively growing cultures, were 

transferred to fungicide amended plates. The Control was PDA plates without the addition 

of the fungicide. There were four replicates for each fungicide. The dishes were incubated 

at 20°C in the dark and the diameter of each colony was measured twice perpendicularly. 

Statistical Analyses 

The trial assay is a completely random factorial experiment with two factors 

(treatments and isolates). Data were subjected to an analysis of variance (ANOVA). The 

Mean values were compared according to Duncan’s test at 5% using a statistic program 

Costat.


RESULTS 

Four isolates (M, M1, N1 and N) of V. inaequalis, originating from two localities on 

the teritory of Serbia (Morović and Neštin) were used for investigations in this work. 

Isolates from Morović locality were sampled from commercial apple orchards area of 100 

ha, in which intensive measures for apple scab control are implementing for many years. 

This orchard had applications of the entire range of fungicides registered for apple scab 

control. Isolates from locality Neštin were taken from individual apple trees distant from 

any commercial orchards. No funficides have been applied for apple scab control, and 

these isolates could be considered wild or organic isolates. 

The results of the isolates growing on the PDA with the appropriate amounts of the 

fungicides added, are presented in Table 2. 

Table 2: Growth of four Venturia inaequalis isolates on PDA medium with tested fungicides 

Isolate (average growth in mm) 

Active 

Fungicide Dose/ lit. 

ingredient 

Duncan 

Duncan 

Duncan 

Duncan 

M 

M1 

N 

N1 

test 

test 

test 

test 

Difenoconazole Score 250 EC 0.2 mL 1.0 a 1.0 a 1.0 a 1.0 a 

Flusilazole Punch 40 EC 0.1 mL 1.0 a 1.0 a 1.0 a 1.0 a 

Cyprodinil Chorus 75 WG 0.25 g 1.0 a 1.0 a 1.0 a 1.0 a 

Pyrimethanil Pyrus 400 SC 1.5 mL 1.0 a 1.0 a 1.0 a 1.0 a 

Kresoxim-methyl Stroby DF 0.2 g 1.0 a 12.75 b 1.0 a 1.0 a 

Captan Merpan 80 2.0 g 1.0 a 1.0 a 1.0 a 1.0 a 

Mancozeb Mankogal 2.5 g 1.0 a 1.0 a 1.0 a 1.0 a 

Control - untreated 19.8 b 20.13 c 21.88 b 29.38 b 

LSD0.05 0.44 0.61 2.82 0.33 

From Table 2 it can be seen that there was no colony growth of M, N and N1 

isolates on the media with all tested fungicides. Also there was no colony growth of M1 

isolate, except in the treatment with fungicide kresoxim-methyl, where the mean colony 

growth was 12.75 mm (Table 1). All isolates in the control had a normal colony growth 

(from 19.8-29.4 mm). 

Figure 1 represents a colony growth of isolates M, and Figure 2 the growth of 

colonies of isolates M1. As can be seen from Figure 1, the colony growth was registered 

only in the control isolates. Figure 2 shows that the colony growth was only registered in 

the control and the treatment with fungicide kresoxim-methyl (S).


Figure 1: Isolate M; K-control, D-difenoconazole, F-flusilazole, 

P-pyrimethanil, C-cyprodinil, S-kresoxim-methyl 

Figure 2: Isolate M; K-control, D-difenoconazole, F-flusilazole, 

C-cyprodinil, P-pyrimethanil, S-kresoxim-methyl


DISCUSSION 

V. inaequalis is the most important disease in apple production. About 75% of the 

total application of pesticides applied in the production of apples are for the fungal diseases 

control (of which 70% is used for apple scab control alone. A major problem in protecting 

apples from this pathogen is the fact that a small number of fungicides are being used in 

ever increased quantity. This fact contributes to the occurence of pathogen resistance or 

reduced susceptibility of the pathogen towards used fungicides, due to capacity tof the 

pathogen for genetic variation (Aleksić et al., 2005). According to Köller (1988) most 

fungicides used to control pathogens have a specific mechanism of action (eg. DMI 

fungicides), and it was clear that there is a risk of resistance development. 

Kunz et al. (1997) assessed the sensitivity of in vivo DMIs where difenoconazole 

was ranked as the most active fungicide against V. inaequalis when compared to flusilazol, 

fenarimol, tebuconazole, and pyrifenox. Difenoconazole has been used for more than ten 

years to control apple scab and it is the latest DMI fungicide introduced to control it. It is 

regarded as one of the most effective fungicides which is widely used alone or mixed with a 

preventive fungicide as a resistance management strategy (Köller and Wilcox, 1999). 

The similar situation is with the QoI fungicides, which are compounds with a narrow 

and specific mechanism of action on disease-causing agents (inhibition of electron transport 

- ETI) (Beresford et al., 1999). 

According to the results of testing the biological efficacy of some fungicides (QoI 

and DMI), conducted during two growing periods, Aleksić (2006) found that the examined 

products showed high efficiency in both preventive and curative control of apple scab. 

Similar results have been announced Balaz and Knezevic (2003) examining the efficacy of 

newer fungicides in controlling apple scab and apple powdery mildew. In studies conducted 

during 1998, 1999 and 2002, the authors found that the best efficacy in controlling apple 

scab was demonstrated by a group of strobilurins (trifloxystrobin and kresoxim-methyl) 

They found no statistically significant differences in the efficiency of the the preparations 

tested in this group of compounds. They then tested a group of DMI fungicides - 

Difenoconazole (product-Score 250 EC), which exhibited a lower efficacy in controlling 

apple scab. 

In our in vitro experiments, colony growth of V. inaequalis was registered only in 

the treatment with kresoxim-methyl, which leads to the conclusion that there was an 

appearance of pathogens resistance to this fungicide. 

Recent studies by other authors identified reduced sensitivity of pathogen to the 

compounds of the strobilurin group (Köller et al., 2004) which is consistent with the results 

obtained in this paper. According to Kuck and Mehl (2003), the resistance to strobilurins in 

the field is noticed on several pathogens since 1998. Mutations of the G143A are mostly 

responsible for the occurence of this resistance. According to Brunelli et al. (2003), in the 

case of fungicides in the strobilurin group, the second generation fungicides 

(trifloxystrobin) exhibited greater efficacy than the previous generation (kresoksimmethyl). 

The occurence of resistance in another very important group of fungicides – DMI, 

was observed even twenty years ago. The problems with decreasing effectiveness of these 

fungicides can occur after several years of their intensive use. Among them there is no 

cross-resistance. The genetic basis of resistance to the DMI is complex and has not been 

sufficiently studied. It is polygenic and developed through a process of gradual decline in 

pathogen sensitivity to fungicides (Gaunt et al., 1996). According to Pscheidt (2004) 

resistance to DMI fungicides in the United States is noticed in several states and in several


cultures. The powdery mildew and apple scab causal agents are the first pathogens in which 

the emergence of resistance observed. 


The work is a part of the Projects No. BT31018, III46007 and II43010 funded by 

Ministry of Education and Science-Republic of Serbia. 

REFERENCES 

Aleksić, G. (1996): Karakteristike razvoja Venturia inaequalis (Cooke) Winter (anamorf 

Spilocea pomi Fr.) in vitro. Magistarski rad, 1-68, Poljoprivredni fakultet Univerziteta u 

Novom Sadu. 

Aleksić, G., Stojanović, S., Starović, M., Kuzmanović, S., Trkulja, N. (2005): Porast i 

sporulisanje kolonija Venturia inaequalis na različitim temperaturama i podlogama. 

Zaštita bilja, 56(1-4), 251-254, 77-86. 

Balaž, J., Knežević, T. (2003): Efikasnost novijih fungicida u suzbijanju čađave krastavosti i 

pepelnice jabuke. Pesticidi, 18: 175-185. 

Broniarek-Niemiec, A., Bielenin, A. (2008): Resistance of Venturia inaequalis to strobilurin and 

dodine fungicides in Polish apple orchards. Zemdirbyste Agriculture, 95: 366-372. 

Beresford, R., Pak, H., Brown, G., Follas, G., Hagerty, G. (1999): Strategies avoid resistance 

development to strobilurin and related fungicides in New Zealand. Proc.52 nd N.Z. Plant 

Protection Conf. 179-181. 

Borić, B. (1987): Identifikacija rasa Venturia inaequalis u Jugoslaviji. Savetovanje o biološkoj 

borbi u zaštiti bilja, Beograd. 

Borić, B., Draganić, M., Stanišić, T., Aleksić, G. (1993): Nova iskustva u postinfektivnoj zaštiti 

jabuke od čadjave krastavosti. Prvo jugoslovensko savetovanje o zaštiti bilja. 

Zbornik rezimea, 61: 65, Vrnjačka Banja, 30.oktobar-03.novembar. 

Brunelli, A., Gianati, P., Flori, P., Berardi, R. (2003): Experimental trials on the activity of new 

fungicides against apple scab. Pflanzenschutz-Nachrichten Bayer, 56, 2, 259-280. 

Fontaine, S., Remuson, F., Fraissinet-Tachet, L., Micoud, A., Marmeisse, R., Melayah, D. 

(2009): Monitoring of Venturia inaequalis harbouring the QoI resistance G143A 

mutation in French orchards as revealed by PCR assays. Pest Management Science, 65: 

74-81. 

Gaunt, R.E., Elmer, P.A.G., Manktelow, D., Moore, M. (1996): Demethyl inhibitor resistance 

management strategy. In: Pesticide Resistance Prevention and Management, Bourdot, 

G.M. and Suckling, D.M., N. Prot.Soc., pp.152-158. 

Ivanović, M., Ivanović, D. (2001): Mikoze i Pseudomikoze biljaka. P.P. De-eM-Ve, Beograd. 

Pscheidt, J.W. (2004): Fungicide Resistance and Fungicide Families. Oregon State University, 

Corvallis, OR 97331-2903 World Wide Web site. Access the Plant Disease Control 

Guide on-line at http://plant-disease.orst.edu/ 

Koenraadt, H., Somerville, S., Jones, A.L. (1992): Characterization of mutations in the Betatubulin 

gene of benomyl-resistant field strains of Venturia inaequalis and other plant 

pathogenic fungi. Phytopathology, 82: 1348-1354. 

Köller, W. (1988): Sterol demethylacion inhibitors: Mechanism of action and resistance. In: 

Fungicide Resistance in North America, Delp, C.,J. (Ed.) APS Press, St Paul, Minnesota. 

Köller, W., Wilcox, W.F. (1999): Evaluation of tactics for managing resistance of Venturia 

inaequalis to sterol demethylation inhibitors. Plant Disease, 83: 857-863.


Köller, W., Wilcox, W.F., Barnard, J., Jones, A.L. (1997): Detection and quantification of 

resistance of Venturia inaequalis populations to sterol demethylation inhibitors. 

Phytopathology, 87: 184-190. 

Köller, W., Parker, D.M., Turechek, W.W., Avila-Adame, C., Cronshaw, K. (2004): A Two- 

Phase Resistance Response of Venturia inaequalis Populations to the QoI Fungicides 

Kresoxim-Methyl and Trifloxystrobin, Plant Dis., 88: 537-544. 

Kuck, K.H., Mehl, A. (2003): Trifloxystrobin: resistance risk and resistance management. 

Pflancenschutz-Nachrichten Bayer, 56, 2. 

Küng, R., Chin, K.M., Gisi, U. (1999): Sensitivity of Venturia Inaequalis to cyprodinil. p. 313- 

322. In: Lyr, H., P.E. Russel, H.W. Dehne, and H.D. Sisler (eds.) Modern fungicides and 

antifungal compounds II. Intercept, Andover, UK. 

Olaya, G., Köller, W. (1999): Baseline sensitivities of Venturia inaequalis to the strobilurin 

kresoxymmethyl. Plant Disease, 83: 274-278. 

Popović T. (2004): Etiološka proučavanja sušenja grana breskve na području Fruške Gore. 

Poljoprivredni fakultet, Novi Sad, 1-110. 

Sholberg, P.L., Haag, P.D. (1993): Sensitivity of Venturia inaequalis isolates from British 

Columbia to flusilazole and myclobutanil. Canadian Journal of Plant Pathology, 15: 102- 

106.

428 The generation of resistance to metalaxyl in phytophthora infestas (mont.) de bary 


Proceedings 

THE GENERATION OF RESISTANCE TO METALAXYL IN 

PHYTOPHTHORA INFESTANS (MONT.) DE BARY 

EMIL REKANOVIĆ, MILOŠ STEPANOVIĆ, SVETLANA MILIJAŠEVIĆ-MARČIĆ, IVANA POTOČNIK 

AND BILJANA TODOROVIĆ 

Institute of Pesticides and Environmental Protection, 

Laboratory of Applied Phytopathology, 

Banatska 31 b, 

11080 Zemun-Belgrade, Serbia 

Sensitivity of Phytophthora infestans isolates collected from diseased potato leaves at eight 

localities in Serbia to metalaxyl was investigated. Inhibition of mycelial growth was monitored on a 

growth medium and sensitivity parameters were determined using probit analysis. The obtained EC 50 

values were in range 0.3-3.9 mg/kg. The generation of resistance in Phytophthora infestans was 

attempted using repeated culturing on metalaxyl-amended medium. The EC 50 values and resistance 

factor for all isolates on medium amended with metalaxyl at 10.0 mg/l increased with subculture 

number for all isolates. With most isolates, the largest increase occurred between the initial and fifth 

subcultures, whereas changes at subsequent subcultures were generally remains the same. Isolates 

P11, P12, PR1 and DO7 had highest EC 50 values for SS (subcultured sensistivity) than for BS (basic 

sensitivity). For all isolates the calculated resistance factor (RF) was numerically larger for the SS 

than for the BS. 

Key words: P. infestans, sensitivity, resistance, generation, fungicides 

INTRODUCTION 

Potato late blight, caused by Phytophthora infestans (Mont.) de Bary, is the 

economically most important potato disease in Serbia. The asexual life cycle of P. infestans 

is short; and sporulating foliar lesions develop three to seven days after successful infection 

under conductive conditions resulting in a polycyclic epidemic (Stein and Kirk, 2002). 

In recent years, the severity of late blight has increased in many parts of the world. 

This has been frequently associated with migrations that have introduced new, more 

aggressive, populations of the pathogen (Fry and Goodwin, 1997). The late blight epidemic 

in 1999 was devastating in Serbia. The new genotypes of P. infestans are being detected in 

the countries from which a large quantity of potato seed has been imported to Serbia for its 

own potato production, in particular from Holland, Germany and Hungary. Ivanović (2005) 

has reported that the A2 mating type occurs in Serbia. The appearance of more aggressive 

strains of P. infestans, containing both A1 and A2 mating types makes this problem even 

more complicated. 

Control of P. infestans in Serbia has relied on intensive use of fungicides often 

without any appropriate programs. Discovery and development of the first systemic

Emil Rekanović, Miloš Stepanović, Svetlana Milijašević-Marčić,... 429 

fungicides from phenylamides class was a significant improvement and one of the most 

important contributions to agrochemical industry. However, the intensive use of metalaxyl 

led to the rapid selection of metalaxyl-resistant strains of P. infestans in Europe within one 

year of its introduction (Parra and Ristaino, 2001). 

Laboratory resistance to metalaxyl was generated with UV light mutagenesis and 

chemical mutagenesis in one isolate of Phytophthora citricola (Joseph and Coffey, 1984). 

Both methods produced similar numbers of resistant mutant isolates. In vitro resistance was 

exhibited by 22 isolates that had growth rates indistinguishable from the parent isolate, and 

five of these isolates were also resistnt in vivo. 

The objective of this study was to test the sensitivity of P. infestans isolates 

collected in Serbia over the period 2005-2007, to the metalaxyl and generate resistance in 

P. infestans to metalaxyl using mycelial adaptation. 


Samples collection and isolation 

Isolates were collected from the major potato growing regions in Serbia during 2005 

and 2007 growing season. The host variety on which late blight was detected, plot size, 

fungicides used, and late blight incidence and severity were also recorded. P. infestans was 

isolated from the infected potato leaves collected from eight different locations according to 

the methods described by Mukalazi et al. (2001) and Zhu et al. (2008). Fragments of 

infected leaf tissue were placed under a thin, surface disinfected slice of potato tuber of 

variety Desiree and incubated at 18 o C for seven days to allow mycelial growth through the 

potato slice. Mycelia was picked from the surface of the slice using a sterile needle, and 

then put on rye B medium (200 g rye, 20 g glucose, 17 g agar, 1 l deionized water) 

amended with rifampicin 20 µg/ml, ampicillin 200 µg/ml, and nystatin 100 µg/ml, and 

incubated at 18°C in darkness for 7 days. After two transfers of hyphal tips on media 

containing antibiotics, twelve pure isolates were obtained (Table 1). The identity of isolates 

of P. infestans was confirmed by polymerase chain reaction (PCR) using species-specific 

primers (Tooley, 1998) and their morphological traits according to Erwin and Ribeiro 

(2005). The isolates were kept on potato dextrose agar (PDA) at 5 o C in the Culture 

Collection of the Institute of Pesticides and Environmental Protection, Belgrade. 

Table 1. Phytophthora infestans isolates and their origin 

Code of isolate Location Year of isolation 

DO7 Dobanovci 2005 

GU6 Guča 2005 

KS3 Kosjerić 2005 

KS2 Kosjerić 2005 

KT1 Kotraža 2006 

KT2 Kotraža 2006 

KV1 Kraljevo 2006 

KV5 Kraljevo 2006 

P11 Prijepolje 2007 

P12 Prijepolje 2007 

PR1 Prilike 2007 

VK1 V. Kamenica 2007


Preparation of amended medium and fungicide stock solutions 

Experiments involving in vitro hyphal growth were performed on modified rye B 

agar (2,5) consisting of the filtrate of pre-rinsed rye (Secale cereale L.) seed (100.0 g/liter) 

boiled for 1 h, deionized (d)H2O added to a final volume of 1.0 liter, glucose (8.0 g/liter), 

β-sitosterol (0.05 g/liter), and Bacto agar (15.0 g/liter). All plates for each subculture on 

metalaxyl amended medium, or run of the sensitivity assay were prepared from the same 

batch in order to limit variability. Metalaxyl as 95.4% technical grade, provided by 

Syngenta Agro Service, Serbia (BASF Corp., Research was first dissolved in 

dimethylsulfoxide (DMSO), and then made into a set of stock solutions with sterile 

distilled water. Each stock solution, including the control (no fungicide), contained the 

same concentration of DMSO. The stock solutions were added to molten medium at 10 

ml/liter when the temperature was cooled to approximately 55°C in a water bath (Stein and 

Kirk, 2002). 

Resistance generation: mycelial selection 

Colonized agar plugs, 4 mm in diameter, were transferred from the margin of an 

actively growing culture of each isolate, mycelium-side down, onto modified rye B agar 

amended with 10.0 mg/l metalaxyl and incubated at 21°C in the dark with three replicate 

plates per concentration. The metalaxyl concentration used for selection was previously 

found to be highly inhibitory, yet sublethal for all isolates of P. infestans examined. Final 

colony diameter (FCD) was measured after 11 days. Mycelial fragments of the tested 

isolates were transferred five times onto rye B agar amended with 10.0 mg/l of metalaxyl. 

After that, the selected isolates were tansferred 10 times onto rye B agar without fungicide 

and EC 50 values were calculated (Stein, 2002). 

Calculation of EC 50 and resistance factor (RF) 

The colony diameter of each isolate was measured in two directions (minus the 

diameter of the inoculation plug) and the percent inhibition (PI) values of each of the 

fungicide rates were calculated using the formula below: 

percent inhibition = (a – b) / a x 100 

where a = the colony diameter of the control plate and b = the colony diameter of the 

fungicide-amended plate. PI values were subjected to regression analysis against the 

logarithmic values of the fungicide rates. The EC 50 (fungicide concentration which inhibits 

mycelial growth by 50%) was determined for each isolate and data on fungicide 

concentration and relative inhibition were analysed using probit analysis, according to 

Finney (1971). 

The resistance factor (RF) was expressed as the ratio of the EC 50 and the lowest 

EC 50 of the isolates tested (Gouot, 1994). The level of resistance factor (RF) was expressed 

according to following scale (Gouot, 1994): 

RF < 3 – sensitive isolates; 

RF = 3 – 20 > – moderate resistant isolates; 

RF = 100 > – high resistant isolates. 

RESULTS 

Sensitivities of P. infestans isolates to the metalaxyl are shown in Table 2. Among 

the 12 P. infestans isolates, the KS3 isolate showed the highest basic sensitivity (EC 50 = 0.3 

mg/l), whereas the P11 isolate had the lowest values (EC 50 = 3.9 mg/l). The EC 50 values of


the remaining 10 isolates were between 0.4 and 2.7 mg/l (Table 2). All isolates tested 

exhibited RF < 20. Resistance factors of metalaxyl for 50% isolates were below 3, and for 

41.7% ranging from 3 to 13. 

Table 2. Calculated EC 50 values and resistance factors for isolates of Phytophthora infestans and 

the same isolates repeatedly cultured on metalaxyl-amended medium 

Subcultured sensitivity (SS) 

Basic sensitivity (BS) 

Five subcultures Ten subcultures 

Isolate code 

EC 50 

EC 

RF 

50 

EC 

RF 

50 

RF 

(mg/l) 

(mg/l) 

(mg/l) 

DO7 1.7 5.7 31.07 12.9 23.5 11.2 

GU6 1.6 5.3 20.06 8.5 15.6 7.4 

KS3 0.3 1.0 2.4 1.0 2.1 1.0 

KS2 0.8 2.7 9.2 3.8 7.3 3.5 

KT1 0.9 3.0 14.4 6.0 12.6 4.1 

KT2 0.8 2.7 12.3 5.1 9.5 4.5 

KV1 0.7 2.3 13.6 5.6 11.5 5.5 

KV5 0.4 1.3 10.9 4.5 8.9 4.2 

P11 3.9 13.0 95.6 39.8 82.5 39.3 

P12 2.7 9.0 81.9 34.1 71.4 34.0 

PR1 2.2 7.3 80.3 33.4 69.3 33.0 

VK1 1.1 1.0 29.5 12.9 26.6 12.7 

EC 50 - Fungicide concentration which inhibits mycelial growth by 50%; RF – The resistance 

factor was expressed as the ratio of the EC 50 and the lowest EC 50 for the isolates tested; 

The EC 50 values and resistance factor for all isolates on medium amended with 

metalaxyl at 10.0 mg/l increased with subculture number for all isolates (Table 2). With 

most isolates, the largest increase occurred between the initial and fifth subcultures, 

whereas changes at subsequent subcultures were generally remains the same. Isolates P11, 

P12, PR1 and DO7 had highest EC 50 values for SS than for BS. For all isolates the 

calculated resistance factor (RF) was numerically larger for the SS than for the BS. 

DISCUSSION 

The results of the present study showed that most of the P. infestans isolates 

collected from eight different locations in Serbia were sensitive to the metalaxyl. However, 

the EC 50 values (BS) differed depending on the isolates. The range of EC 50 values of the 

tested isolates varied from 0.3 mg/ml (KS3) to 3.9 mg/ml (P11). The EC 50 values of isolates 

PR1 (2.2 mg/ml), and P12 (2.7 mg/ml) were also higher than those expected in a 

susceptible population of P. infestans. According to Schwinn and Staub (1995) , the EC 50 

values for wild populations of P. infestans ranged from 0.3 to 1.0 mg/ml. Based on Gout's 

scale and RF values, 50% of Serbian isolates from four localites (Kotraža, Kraljevo, 

Kosjerić and V. Kamenica) were sensitive to metalaxyl having RFs below 3. Moderately 

resistant isolates (50%) were found in the same area as sensitive (Kotraža) and other four 

localities (Prijepolje, Dobanovci, Guča and Prilike) as RF values were ranging 3-13. In the 

early 1980's, metalaxyl was introduced to the Serbian market, and it was applied in a 

mixture with contact fungicides, mancozeb or cineb. The selection pressure was relatively 

low and that could be one of the possible explanations that P. infestans resistance to


metalaxyl was not detected in Serbia. However, this was not the common practice in 

Western European countries where metalaxyl was used alone for several years. Zhu et al., 

reported that very high variations in sensitivity to metalaxyl were observed amongst 

isolates from different areas. The resuslts of our study also showed variations in sensitivity 

to metalxyl between isolates, except in Kotraža where both sensitive and moderately 

resistant isolates were found. This is the first report of P. infestans isolates in Serbia 

showing intermediate resistance to metalaxyl. None of the isolates tested in the present 

study was highly resistant to metalaxyl though it was widely applied in all surveyed 

localities. 

A decrease in sensitivity to metalaxyl (SS) (increase in the EC 50 for in vitro growth) 

was demonstrated in P. Infestans following repeated subculturing on medium amended 

with a sublethal concentration of metalaxyl in all P. infestans isolates examined. The 

resistance factor for most isolates was between 3 and 20, which represents a moderate 

resistance. The rapid increase in final colony diameter by the fifth subculture cycle on 

amended medium indicates a physiological adaptation to metalaxyl or selection for a 

mutation providing resistance. 

The generation of resistance to metalaxyl in P. infestans was possible through 

sublethal amended medium. The high amount of resistance that developed to metalaxyl, 

indicates that the mechanism may be controlled by a single dominant gene modified by 

other genes of minor effect. This major gene is not linked to fitness attributes. Identification 

of the number of minor genes and magnitude of effect may require QTL (quantitative trait 

loci) analysis (Lee et al., 1999). 

Resistance management techniques such as block treatments and co-application of 

metalaxyl with protectant fungicides would likely be effective. Currently, the development 

of field resistance to metalaxyl in P. infestans is unlikely for most potato-growing regions 

of the Serbia because growers rely primarily on protectant fungicide applications. 


This study was carried out as a part of project 31043 financially supported by the 

Ministry of Education, Science and Technological Development of the Republic of Serbia. 

REFERENCES 

Erwin, D.C, and Ribeiro O.K. (2005): Phytophthora diseases worldwide. St. Paul, Minnesota: 

Aps Press. 

Finney, D.J. (1971): Probit analysis. Cambridge, UK: University Press. 

Fry, W.E. and Goodwin, S.B. (1997): Re-emergence of potato and tomato late blight in the 

United States. Plant Disease, 81: 1349-1357. 

Gouot, J.M. (1994): Characteristics and population dynamics of Botrytis cinerea and other 

pathogens resistant to dicarboximides. In: Fungicide Resistance in North America. (Ed. 

Delp, C. J.), The American Phytopatological Society, St. Paul, Minnesota, USA, pp. 53- 

55. 

Ivanović, M. (2005): Structure of population and biological characteristics of Phytophthora 

infestans (Mont.) de Bary. PhD thesis, University of Belgrade, Faculty of Agriculture. 

Joseph, M.C. and Coffey, M.D. (1984): Development of laboratory resistance to metalaxyl in 

Phytophthora citricola. Phytopathology, 74: 1411-1414.


Lee, T.Y., Mizubuti, E. and Fry, W.E. (1999): Genetics of Metalaxyl Resistance in 

Phytophthora infestans. Fungal Genetics and Biology, 26: 118-130. 

Mukalazi, J. Adipala, E., Sengooba, T., Hakiza, J.J., Olanya, M. and Kidanemariam H.M. 

(2001): Metalaxyl resistance, mating type and pathogenicity of Phytophthora infestans in 

Uganda. Crop Protection, 20: 379-388. 

Parra, G. and Ristaino, J.B. (2001): Resistance to mefenoxam and metalaxyl among filed 

isolates of Phytophthora capsici causing phytophthora blight of bell pepper. Plant 

Disease, 85: 1069-1075. 

Schwinn, F. and Staub, T. (1995): Oomycetes fungicides. In Modern selective fungicides: 

properties, applications, mechanisms of action; Lyr, H. Ed., Gustav Fischer Verlag: New 

York, USA, pp. 323-346. 

Stein, J.M. (2002): The use of dimethomorph in the control of potato late blight (Phytophthora 

infestans): sensitivity survey, insensitivity generation, and field optimization. Ph.D. 

Thesis. Michigan State University, Department of Botany and Plant Pathology, USA, 

2002. 

Stein, J.M., and Kirk W.W. (2002): Containment of existing potato late blight (Phytophthora 

infestans) foliar epidemics with fungicides. Crop Protection, 21:575-582. 

Tooley, P.W., Carras, M.M. and Lambert, D.H. (1998): Application of a PCR-based test for 

detection of potato late blight and pink rot in tubers. American Journal of Potato 

Research, 75: 187-194. 

Zhu, G., Huang, F., Feng, L., Qin, B., Yang, Y., Chen, Y. and Lu, X. (2008): Sensitivities of 

Phytophthora infestans to metalaxyl, cymoxanil, and dimethomorph. Agricultural 

Sciences in China, 7(7): 831-840. 

Zhu, G., Huang, F., Feng, L., Qin, B., Yang, Y., Chen, Y., Lu, X. (2008): Sensitivities of 

Phytophthora infestans to metalaxyl, cymoxanil, and dimethomorph. Agr. Sci. China, 7: 

831-840.

434 PHYTOPHARMACY


INTEGRATED 

PEST MANAGEMENT

436 INTEGRATED PEST MANAGEMENT

Injac Marko, Petrović Jovanka, Krnjajić Slobodan 437 


Proceedings UDK: 634.11-29(497.11)”2009/2012” 

INTEGRATED APPLE PROTECTION IN ATOS FRUCTUM, MALA 

REMETA, 2009-2012 

INJAC MARKO 1 , PETROVIĆ JOVANKA 1 , KRNJAJIĆ SLOBODAN 2 

1 

Chemical Agrosava, Novi Beograd 

2 Institute for Plant Protection and Environment Beograd 

During the period from 2008 to 2012, for the first time the principles of IPM have been 

introduced in Serbia into two apple orchards: Atos Fructum and Vlabons of a total area of 100 ha.. 

The model for introducing IPF have been taken from Agrios, South Tirol. The basic principal is that 

harmful organisms like V. inaequais, E. amylovora, D. perniciosus and D. plantaginea which have 

zero damage threshold, are controlled in the first part of vegetation. Secondary harmful organisms 

such as A. pomi, phythophagous mites have damage thresholds and are controlled when this is 

estimated between beneficiary and harmful organisms 

Some harmful organisms as C. pomonella appear less frequently but it has been determined that they 

are pathogen like the Alternaria alternata , Dasineura mali which appear more frequently than in 

standard protection. 

Key words: IPF ( integrated fruit production), IPM ( integrated pests management ), damage 

threshold, pest, disease, predators, Granulosis virus, Exosect CM confusion method. 

INTRODUCTION 

Integrated fruit production (IFP) is an economical production of high quality fruit, 

giving priority to ecologically safer methods, minimizing the undesirable side effects and 

use of agrichemicals, to enhance the safeguards to the environment and human health 

(Cross, Dickler, 1994). 

IFP is a high-tech manufacturing based on: 

• Personnel training, maintenance of a balanced orchard ecology, choosing the 

site and the rootstock for planting, the cultivar based on market demand, 

grafting height which determines the height of trees, maintenance of tree 

lawns, irrigation, nutrition and pruning of trees in order to maintain fertility 

and yield, quality management (fruit thinning), integrated apple protection, 

fruit picking in order to store healthy and physiologically stable fruits in cold 

storage and analysis of pesticide residues on fruits and issuing certificates.

438 Integrated apple protection in atos fructum, Mala Remeta, 2009-2012 

• Integrated apple protection or Integrated Pest Management, (IPM) involves 

managing the populations of harmful and beneficial organisms in the 

integrated apple production, and the suppression is performed when harmful 

organisms cross the damage threshold. When selecting the chemicals, 

attention is paid to the ratio of beneficial and harmful organisms giving 

advantage to the more ecologically and toxicologically favourable ones. 

• For introducing the principle of integrated apple protection, the model of 

Agrios from South Tyrol was used. At pesticide application, the waiting 

period is usually but not necessarily longer than the registered period in 

Serbia, which decreases the values of MRL (maximum residue level). The 

application quantity, if possible, is in accordance with the registration in the 

EU i.e. per metre of tree height/400 litres/ ha. Depending on the development 

phase of apple trees, the quantity of water does not exceed 1200 litres/ha. 

• The basic approach within IPM is to suppress the primary pests in the first 

phase of vegetation, such as: Venturia inaequalis, Erwinia amylovora, 

Diaspidiotus perniciosus, Dysaphis plantaginea and Cydia pomonella, 

because the possibility of their appearance in the apple orchard in the second 

phase of vegetation is negligible. The second principle is to suppress 

secondary pests only when the population exceeds the damage threshold. 

Damage thresholds are the populations of pests that would cause more damage than 

the suppression measures. There are different thresholds and they depend on the yield, the 

price of fruit in a given year and the cost of service. In Atos Fructum, the previously 

determined and published thresholds within IFP in France, South Tyrol and Germany were 

used. In the period from 2009 to 2012 we implemented some new damage threshold 

adapted to new mechanisms of action of insecticides/acaricides and the principles of IFP 

(Orts and, 2006). 

Predator thresholds are the prey population which is in a biological relation to the 

development of predators. They are determined only with specific predators. 

With specific predators of phytophagous mites Stethorus punctillum, we used three 

thresholds: 

a) thresholds of flying S. punctillum imagos into the apple orchard are: 4-6 mobile 

forms of Tetranychidae per leaf 

b) the egg-laying thresholds of predators are: 8-10 mobile forms of mites per leaf 

c) thresholds of flying S .punctillum imagos out of the apple orchard averagely 5 

mobile forms of mites per leaf.( Pasqualini, Malavolta 1984., Pasqualini 1993). 

ORCHARDS ATOS FRUCTUM 

The apple orchard Atos Fructum, with an area of 75 ha, is situated on Fruska Gora at 

a height of 212 to 283 m above sea level, in order to avoid freezing caused by extremely 

low temperatures. The orchard has 13 cultivars: Golden Delicious Reinders, Braeburn, 

Granny Smith, Fuji Kiku, Red Chief, Top Red, Red Jonaprince, Decosta, Cripps Pink, 

Golden Delicious Crillard, Gala Schtzer, Early Top Red and Wellant . Cultivars are planted 

according to the monocultivar block system, each 29th tree is a pollinator.


For example, for the Braeburn cultivar the pollinator is Granny Smith ; Golden 

Delicious Rainders is the pollinator to Top Red etc, in order to achieve good pollination, 

nutrition, thinning and protection per cultivar. The trees are grafted at the height of 10-20 

cm from the ground in order to regulate the tree height up to 4 m. The tree spacing is 80 

cm, 65 cm for the cultivar Red Chief, which provides up to 4500 trees/ha. In the years of a 

full production, as in 2011, some cultivars' productivity was 70 t/ha of fruit. The apple 

orchard is fenced, with an implemented irrigation system, tree lawn maintained and hail 

nets (Fig. 1) set, and thus meets all the requirements prescribed by law for IFP. 

Figure1: Atos Fructum apple orchard 

METHODS AND EQUIPMENT OF INTEGRATED APPLE PROTECTION IN 

ATOS FRUCTUM 

1. Mitos - a device designed to register humidity and temperature favourable for 

primary infections of V. inaequalis 

2.“Kloft“ of the tree, 50 times into an entomological catcher, with dimensions 60 x 40 

cm (per each cultivar). 

3. Visual examination of 50 shoots, flower rosettes i.e. fruit branches 

4. Winter examination of 60 biannual twigs with two adjacent buds of each cultivar. If 

necessary, even the shoots that grow from the roots are examined for the presence of 

Psylla mali or eggs of leaf miners. 

5. Biocular examination of 25 leaves taken from the shoots 

6. Pheromone traps for C. pomonella, leaf miners (L. scitella, L. corylifoliella, L. 

blancardella), T. hirta, Z. pyrina, S. myopiaeformis, A. orana and P. heparana). 

7. Tree belts made of corrugated paper set one every tenth tree in a row (a total of 30), 

in order to register chrysalidation or hibernaculum formation of C. pomonella in the 

fall.


Apple orchard is reviewed every other week. The results and recommendations are 

summarized in the reports which are kept in the archives of Atos Fructum. 

Each cultivar is separately examined, using the methods mentioned, 11 times during 

vegetation. The choice of pesticide is based on the population or presence of the disease 

and pests and their relations to the beneficials. Protection of orchard is carried out per 

cultivar or per group of cultivars. 

The pesticides used to protect the apple orchard Atos Fructum are registered in 

Serbia or in the EU. 

RESULTS OF APPLICATION IPM IN ORCHARDS FROM 2009-2012 YEARS 

A. Major diseases in apple orchards 

1. Apple scab on the fruit (Venturia inaequalis (Cke) Wint) 

The damage threshold is zero, then just the ascospore infections of V. inaequalis are 

suppressed in a classical way by fungicide application. After the last throw out of 

ascospores or at the beginning of June, the apple orchard is reviewed and if there are no 

symptoms of apple scab as the cause of secondary infections by conidia, the apple 

protection terminates. 

Typically, the time interval between two treatments is up to 8 days, and if there were 

no conditions for the infection, the time distance between two treatments will be prolonged. 

At the beginning of leafing of apple, we organized the suppression by applying a 

penetrant fungicide, which can be used when the temperatures are above 5 o C, such as: 

cyprodinil supplemented with the preventive fungicide dithianon. Application of 

preparations based on these active ingredients is regularly before a rainfall or before the 

conditions for infection are acquired. Before flowering, pyraklostrobilurin + dithianon are 

used, and the quantity of the preparation depended on the tree height. 

In the flowering phase, the preparation based on a.i. trifloxistrobin is applied in the 

quantity 50 g/m/ of the tree height/ha , because it does not have any effects on pollen. 

After flowering, we used sterol biosynthesis inhibitor fungicides (triazoles) in addition to 

captan. 

Triazoles are retardants, therefore captan was added in order to prevent a retarded 

growth, as captan redistributes well on the fruits, extends the action up to 7-8 days and 

favours the growth of shoots and fruits. A mixture of triazole and captan obtains a normal 

growth (Bosch, 1975). 

With this approach, the apple orchard in the period from 2009 to 2012 was regularly 

without any disease symptoms. 

Exceptionally, the cultivars Golden Delicious and Gala, as the most sensitive ones, had a 

few leaves with spots. On these two cultivars a subsequent "burning" of spots of apple leaf 

spot was carried out. 

2. Powdery mildew (Podosphaera leucotricha Ellis & Everh) 

Powdery mildew is considered a secondary disease, whose presence is tolerated 

when there is up to 20% of white shoots. 

The presence of P. leucotricha in the apple orchard was significant every year, 

especially on some red cultivars, such as Red Jonaprince and Braeburn. Annually we


controlled the apple from powdery mildew 4 times with fungicides of different mechanisms 

of action (proquinazid, bupirimat and triazoles).Control were manly in May, as 

temperatures in this month are most favourable. 

3. Alternaria blotch (Alternaria alternata Keissler) 

This is a new pathogen in Atos Fructum and in some other apple orchards with a 

high quality growing technology. Infections of A. alternata are performed through flowers 

or through the sub- calyx tube . A .alternata develops in seed and cause failing of fruits. In 

2012 years, Red Delicious Camspur was particularly sensible . A. alternata can develop 

also on fruits on some cultivars (e.g. Braeburn) during season and during the storage.. The 

symptoms are visible on the fruits and are often localized near the sepal (Fig. 2). 

Inside of the group of A. alternata, a particular pathotype Alternaria pomi, which is 

visible on the leaves, distinguished itself. The spots are round with a highlighted white 

circle in the centre. It appears mostly during the summer or after the protection of the apple 

orchard from apple scab. 

Figure 2: Symptom of A. alternata on Braeburn fruits 

The most attractive cultivars are: Golden delicious and Braeburn where they 

regularly occur during July or August. Favourable conditions for the occurrences of 

pathogens are: warm weather with short rainfalls. In 2012 the preparation based on a.i. 

fluazinam was successfully used for the suppression of Alternaria pomi. 

B. Major pests in Atos Fructum apple orchards 

1.) Green apple leaf aphid (Aphis pomi Geer) 

A green apple leaf aphid (A. pomi) is one of the "r" selected species. It is characterized 

by a large number of generations, high reproductivity, the population depends on the quality of


plant juices of the host (feeds with top shoots), the female during the summer months produces 

about 50 larvae by each generation, they have a small number of host plants, there are no 

intermediate host plants, they fly from orchard to orchard, followed by polyphagous predators, 

parasitoids and diseases that have no significant role in reducing the population and occur more 

massively when the threshold of harm for A. pomi is close or already crossed. 

A. pomi (Fig. 3) is fed with juices from parenchyma tissues, so it does not secrete 

honeydew in greater quantities. 

Figure 3: Larvae A. pomi 

Damage threshold of A. pomi during winter: 5-50 winter eggs on 50 cm of length of 

the upper shoots, and the damage threshold in the vegetation period is 15-20% of inhabited 

shoots. 

In the period 2009-2012 the number of colonies of A. pomi regularly crossed the 

damage threshold of 15% by at least 3 times 

Table 1: Time of occurrence of leaf aphids and major predators in 2009 

Aphids and aphids scale 

Polyphagous predators 

The 

examinati 

on time 

A. 

pomik 

D. 

pernici 

Pauci 

predator 

Larve 

Syrphid 

Dysaph 

is vrste 

Coccin 

elidae 

Anthoc 

oridae 

A.aphid 

omiza 

olonija osus 

i ae 

07.04.09 10 0 12 20 3 39 0 0 

05.04.09 3 0 0 4 0 20 0 0 

27.04.09 10 0 0 2 1 8 0 0 

05.05.09 3 0 0 2 1 8 0 0 

18.05.09 0 19 0 0 0 37 0 0 

27.05.09 0 3 2 1 11 35 0 0 

10.06.09 0 0 0 0 5 16 0 0 

30.06.09 0 7 0 3 0 26 0 0 

14.07.09 0 7 0 2 0 6 0 0 

28.07.09 0 63 0 0 0 9 6 120 

12.08.09 0 1 0 15 9 26 10 15 

25.08.09 0 19 0 4 0 4 0 12 

09.09.09 0 1 0 37 14 25 0 0 

Total 26 120 14 90 44 255 16 147


The suppression was carried out based on: 

• population of A. pomi on each cultivar separately, 

• the presence of ants 

• ratio of A. pomi/predators (tab. 1) 

Based on the population of ants during tree shaking, colonies of A. pomi and 

predators, on 27 May 2009 only cultivars Golden Delicious 1st, 2nd and 3rd year were 

treated. For suppression we usually used neonicotinoids, but in higher quantities. During 

summer, the most inhabited cultivars with the colonies of A. pomi are Golden Delicious 

Rainders, but also red cultivars (Red Chief, Top Red etc.). 

The number and species of predators of A. pomi are adapted to the prey. In the 

colonies of A. pomi we regularly found fewer predators than in the colonies of Dysaphis 

species. The most numerous are larvae of Aphidoletes aphidimyza Rond (Cecidomyides) 

Fig. 4 and Syrphus balteatus (Dipteres, Brachyceres) Fig. 5. 

Figure 4: Larvae of A. aphydomiza in the colony of green apple leaf aphid (A. pomi ) 

Figure 5: Larvae of S. balteatus in the colony of A. pomi


2.) Apple grain aphid: Dysaphis plantaginea Pass and Dysaphis devecta Walker 

Dysaphis plantaginea and Dysaphis devecta are among "rK" selected species. 

Annually 3-5 generations are developed on the apple. They suck the juices from the phloem 

of leaves, so they secrete a large quantity of honeydew, they have intermediate hosts when 

they fly away from the apple orchard. Parasitoids and predators of Dysaphis species are 

generally polyphagous but have narrowly specific parasitoids. 

D. plantaginea and D. devecta secrete the plant hormone auxin, which causes 

proliferation or gall formation. D. plantaginea causes curling and yellowing of the leaves 

and fruit deformation, as D. plantaginea, therefore it is included in primary pests. It occurs 

more massively at red cultivars, and most often at Fuji Kiku and Cripps Pink. 

Suppression of Dysaphis species 

Since the tolerance threshold is zero and fruit deformation must not happen, the 

suppression is performed by some of neonicotinoids before flowering or before apple fruit 

formation. 

3.) Woolly apple aphid (Eriosoma lanigerum De Geer) 

Woolly apple aphid is one of "rK" selected species and has about 20 generations 

annually. In Europe it is fed with apple only. It lives in the root collar zone and in the aerial 

parts of the apple tree. At the beginning of vegetation, a part of aphids comes out of the root 

collar zone and inhabits the shoots or goes up the tree. During summer months (July- 

August) formed imagos fly to other apple orchards. Females produce larvae that are 

initially mobile and are looking for a place to feed. The larvae feed on the phloem. During 

feeding, larvae secrete hormones that cause proliferation of water tumours, which 

decompose and that place is inhabited by wound pathogens or insects like clearwing moths 

or many others. As far as beneficial organisms are concerned, there are mostly polyphagous 

or some narrow specific parasitoids, such as (Aphelinus mali Hald. Aphelinides). There was 

a small number of his parasitoid on the colonies of E. lanigerum because it was a young 

apple orchard, where the presence of woolly apple aphid in the root collar zone was 

negligible. 

Damage threshold in spring is 10% of the tree with colonies at the base of the tree 

trunk. 

During the flying phase of E. lanigerum imagoes, the damage threshold is 10 

colonies on 100 branches (Agrios, 2011). Although the flying of E. lanigerum imagoes is 

usually in July, in 2011 the first formed imagoes were not found until 10th of August. 

Within a region or a larger apple orchard, such as Atos Fructum, we followed the 

occurrence of imagoes. During the springtime we used phloem aphicides, such as the 

neonicotinoides with the addition of organosilicone surfactants. In autumns , we used 

hlorpirifos with additional of trisilicons surfactant. 

4.) San Jose scale (Diaspidiotus perniciosus Komst) 

San Jose scale is one of the introduced pests. The damage threshold is 0 i.e. its presence 

is not allowed, because it is fed with fruits as well (Fig. 6), this way they become noncommercial 

and cannot be exported to some of European countries.


Figure 6: Granny Smith fruit with the scale of D. perniciosus 

In the system of intensive apple production, where the trees are thin, D. perniciosus 

is the most harmful insect for apple trees, as the trees respond to the sucking and insertion 

of toxins and the following year the susceptible cultivars dry out. 

Control of D. perniciosus 

OILB (1977) suggest the suppression of the mobile forms of L1 San Hose scale 

(crawlers) in the spring while searching for a feeding place. 

AGRIOS (2011) recommend the suppression of the mobile larvae of L1 during larva 

hatching in the late autumn before the rest (overwintering). Mineral oils, phosmet, 

chlorpyrifos-methyl and pyriproxifen are recommended. 

Having considered that the threshold is zero, we used Howitt's approach (1993) and 

Crop Protection Guide for Tree Fruits in Washington from 2011, that suggest: 

1. Winter spraying with chlorpyrifos-based preparations in EC formulation with 

added oil in the concentration of 1% as the wetting agent. 

2. Before the occurrence and during flying of the male imago, spraying is carried 

out with contact insecticides in order to prevent copulation and, thus, formation 

of F1 generation. 

Figure 7: Male adult of D. perniciosus


5.) Apple leaf-curling midge (Dasineura mali Kieff.), Cecidomyiidae 

In apple orchards with tree lawns, between the rows and shaded with anti-hail nets 

where there is higher humidity, D. mali regularly occurs, especially on some cultivars such 

as Braeburn and Fuji Kiku . 

Suppression: Within IPM special measures for the suppression are not usually 

considered because it is believed to be the secondary pest. If you want to suppress them, the 

optimum time for insecticide application is the beginning of larva hatching. 

6.) Phytophagous mites 

a) Apple rust mite (Aculus schlechtendali Nalepa), Eriophyidae 

b) European red mite (Panonychus ulmi Koch) , Tetranychidae 

c) Two-spotted spider mite (Tetranychus urticae Koch), Tetranychidae 

Phytophagous mites are included in "rK" selected species and have a large number 

of generations, a great reproduction potential, they are not very mobile, the population 

depends on the host's food quality, the mites are followed by both polyphagous and specific 

predators, such as S. punctillum and Staphylinidae. The predators are regularly ''late" and 

cannot decrease the number of mites below the damage threshold. 

The treatment threshold for P. ulmi and T .urticae during vegetation is 50% of 

inhabited foliage.(Orts and all, 2006) 

The threshold for Aculus schlechtendali, in the F2 development apple stage (flower 

buds just visible but not yet opened), is 10% inhabited floral rosettes. 

The occurrence of mites depends on the age of trees. When trees are younger, apple 

rust mite regularly occurs right in the spring. T. urticae usually occurs if the apple orchard 

has weeds. P. ulmi is the most important mite because, in case of bronzing, it lays eggs 

around some fruit sepals as well. The abundance and overgrowth time is different every 

year and also depend on the choice of acaricide. In 2009, the largest mite was A. 

schlechtendali, then T. urticae (Table 2). However, even in 2011 the most abundant of all 

mites was P. ulmi. Apple cultivars Braeburn and Red Top are very attractive for P. ulmi. 

When the number of. P. ulmi crossed the threshold of 50% of inhabited foliage, we used a 

propargit, and then spirodiclofen 10 days later. Spirodiclofen inhibits the biosynthesis of fat 

so it acts slowly. Forms, like females of P. ulmi, that have a lot of fat, feed for a long time 

and lay "unfertilized" eggs on fruits (Washendorf and all, 2002). The eggs were attractive 

food for predators O. minutum (Figure 9), S. punctillum (Figure 8) and A. andersoni. 

Because of predators and "unfertilized" eggs, in 2012 until the second half of June there 

were no outbreaks of phytophagous mites in the apple orchard. 

Figure 8: Imago of S. punctillum


Table 2: The number of phytophagous mites in the apple orchard in 2009 after a biocular 

examination of 250 leaves (25 leaves on 10 cultivars) 

The examination 

time 

Population of phytophagous 

mites on 250 leaves examined 

P. ulmi T. urticae 

A. 

schlechten 

dali 

Tyde 

us 

spp 

S. 

punctilu 

m 

Number of predators 

A. 

andersoni 

Aeolotripsi 

pred. 

7.04.2009 0 0 0 0 0 0 0 

15.04.09 0 0 3 0 0 0 0 

27.04.09 0 0 7 0 0 0 0 

05.05.09 0 0 15* 0 0 0 0 

18.05.09 1 0 25 0 2 0 0 

27.05.09 0 0 37 0 13 0 1 

10.06.09 0 1 2 0 5 0 0 

30.06.09 0 0 0 0 0 0 0 

14.07.09 0 1 17 0 0 0 0 

28.07.09 0 0 175 0 0 0 0 

12.08.09 41 39 250 0 2 0 6 

28.08.09 21 106 110 23 49 0 9 

09.09.09 1 23 31 15 197 3 47 

A specific predator called Stethorus punctillum (Fig. 8). feeds with all mites, but 

does not lay eggs if fed only with A. schlechtendali. Minute pirate bug Orius minutus flies 

in even if there is a larger population of T. urtiae and P. ulmi. It lays its eggs inside the leaf 

of upper shoots. (Fig. 9). In 2011, we found A. andersoni in a smaller number on most 

cultivars where phytophagous mites fed, as well as on cultivars where there were no 

Tetranychidae developed. We even used to find single eggs laid, which means that A. 

andersoni can develop and feed with apple juices. 

Figure 9. Orius minutus, eggs in a leaf


7.) Codling moth (Cydia pomonella L) 

Codling moth is one of "K" selected species that does not endanger the apple 

orchard as a habitat, there are two to three generations, a smaller breeding potential, it is 

accompanied by specific beneficial organisms and diseases.(Cross, Dickler, 1994). 

The basic approach to the suppression of codling moth is to suppress its F1 generation. The 

orchard is isolated to prevent flying in, so there are no conditions for a significant 

occurrence in F2 generation. Codling moth in Atos Fructum was suppressed in F1 with 

insecticides that are registered in our country or in the EU, such as thiacloprid, phosmet, 

chlorpyrifos or a combination of chlorpyrifos + cypermethrin, and for the suppression of 

F2, chlorantraniliprole was used once a month. The damage thresholds were not crossed. 

Damage thresholds for C. pomonella according to Agrios (2011): 

• June - 3 wormy fruits of 1000 examined 

• July - 5 wormy apple fruits 

• August - 8 wormy fruits 

Cydia pomonella granulosis virus 

Granulosis viruses are included in "K" selected species( Injac, Dulić, 1992). These 

are DNA viruses that develop in the nucleus and subsequently in the cytoplasm of fat tissue 

cells, muscle tissue cells and blood cells. 

In 2012 we used the preparation Madex in the quantity of 150 ml / ha or 1.5 x 10 -13 

granules / ha, three times in the suppression of the first generation. In terms of IPM, after 3 

treatments with Madex, we found 7 bites on fruits that healed and only one drilling into the 

fruit; however the caterpillar died as L2. 

Auto-confusion System Exosex CM in the suppression of C. pomonella 

In 2012 Faculty of Agriculture, Novi Sad, examined Auto-confusion System Exosex 

CM on 2 hectares of the apple orchard Atos Fructum. In the conditions of IPM, in the first 

generation of C.pomonella, this system showed satisfactory performance. In 2 generations , 

on 1000 fruits we found in Jul 11th 5 damaged fruits of C. pomonella. Diference beetween 

efficacy on F1 and F2 g pheromone. 

Other secondly pests 

Having considered the proximity of forests of Fruska Gora, caterpillars of autumn 

crocus and other Geometridae moths regularly occur from the beginning of vegetation, but 

the threshold of 8 caterpillars per 100 branches have not been crossed. From 2010 to 2012 

individual cricket larvae occurred (Tetigonia viridissima L) that feed on apple fruits before 

ripening. 

Rodents 

Forest mice regularly occur because of tree lawns between rows, which are 

favourable for the development of rodents. Forest mice damage tree roots, so in the spring 

there are more trees in a row having small leaves. Mice control is regularly performed in 

the fall, then immediately after the snow withdrawal, with preparations such as


bromadiolone or brodifacoum, always in moisture-resistant paraffin blocks, in places where 

colonies of mice or voles were formed. The suppression threshold of field mice is 3-5 

colonies per ha. 

PESTICIDE RESIDUES ON FRUITS 

Analysis of fruits for the presence of pesticides, conducted by the Laboratory in 

Becej, showed that pesticides are below the thresholds of tolerance, or in other words that 

the fruits are safe. The analysis revealed the presence of metals and some radioactive 

elements below the thresholds of tolerance. 

DISCUSSION 

During our work, we came across a number of problems that require additional 

research. Iperti, (1974) stated that food significantly affects the reproducibility of predators, 

therefore we should distinguish primary food, which determines the development and 

reproduction, from alternative food that they feed on, but can not complete their 

development. Iperti, (1974), McMuetry, (1984) indicate that S. punuctillum requires 

Tetranychidae to feed on for its development and reproduction. Iperti (1974) states that A. 

bipunctata lays 10 eggs when fed on D. plantaginea and only 4 fed on A. pomi, and we 

came to the same conclusion. By introducing acaricides with new mechanisms of action, 

such as spirodiclofen, which inhibits the biosynthesis of fat and acts slowly, previous 

threshold of tolerance of 50% of inhabited foliage need to be corrected. Predators that are 

most commonly used prefer eggs, so the thresholds need to be corrected to 10-15% of 

foliage where eggs and mobile forms of Tetranychidae are present. This way the 

appearance of leaf bronzing and laying eggs on fruits would be avoided. If acaricides, fat 

synthesis inhibitors, were applied in the fall, than the females would lay "unfertilized eggs" 

and in spring of next year there would be no occurrences of phytophagous mites 

(Washendorf and all, 2002). 

By changing the cultivation technology, the use of insecticides reduces. An apple 

orchard from an unstable habitat becomes a relatively stable one, where the ratio between 

predators and prey is established. The importance of beneficial organisms is observed in 

determining the measure of stability of the apple orchard as a habitat intended for the 

production of fruit, and less in reduction of pest population. 

Conditions of high technology integrated production have beneficial effects on the 

occurrence of diseases, such as Alternaria alternata, and pests, such as Zeuzera pyrina, 

Dasyneura pomi, phytophagous mites, but have adverse effects on the occurrence of 

codling moth (C. pomonella). 

BIBLIOGRAPHY: 

Bosch, J., (1975): Indirekte Wirkungen von Pestiziden.C.R.em Symp. Integree en vergers. 

OILB/SROP 333-338. 

Cross, J., V., Dicklet, E.,(1994): Guidelines for Integrated Production of Pome Fruits in Europe. 

Injac, M., Dulić, K., (1992): Efikasnost Carpovirusin FLO (Baculovirusi granuloze) na C. 

pomonella F1 i F2 generaciju. Pesticidi.


Iperti, G., (1974): Les organismes auxiliaires en verger de pommiers, OILB/SROP, Broshure No 

3:111-124. VIIth Symposium integrated plant protection in vergers. Bulletin SROP 

1986/IX/4:62-67. 

Howitt, A., J., (1993): Common Tree Fruit Pests, Apple Rust Mite (Aculus schlechtendali 

(Nalepa) Michigen state University: 61-63. 

Orts, R., Ciraud, M., Darthout, L., (2006): Protection integree pommier-poirier, 2 edition, Centre 

technique interprofessionnel des fruits et legumes: 1-326, Paris. 

Pasqualini, E., (2000): IPM - Theory and practice in the pest control of pomme fruit trees. 

Pflanzenschutz Nachrichten Bayer: 53, 2-3: 154-176. 

Pasqualini, E., Malavolta, C., (1984): Natural control of Panonychus ulmi Koch in apple 

orchards of Emilia-Romagna Italy. VII the Symposium integrated plant protection in 

vergers. Bulletin SROP 1986/IX/4:3-17 . 

Washendorf, V., Naven, R., Schnorbach, H.J., Rauch, N., Elbert,A., (2002): The biological 

profile of spirodiclofen /Envidor) - A new selective tetronic acid acaricide, 

Pfanenschutz-Nachrichetn Bayer 55:2-3: 140-176.

Milka Glavendekić 451 


Proceedings 

INTEGRATED PEST MANAGEMENT OF INSECTS IN URBAN 

GREEN SPACES 

MILKA GLAVENDEKIĆ 

University of Belgrade, Faculty of Forestry, Department of Landscape Architecture and 

Horticulture, Belgrade, Serbia, email: milka.glavendekic@sfb.bg.ac.rs 

In parks and gardens, urban forests and other human-made habitats are recorded more than 

65% of alien arthropods. The surveys carried out on urban green spaces in Serbia confirmed that there 

are sometimes 4 trophic levels, from the producers to the hyperparasitoids. This has appeared in urban 

parks, as well as along tree-lined avenues. There is evidence that insect pests follow their host plants 

and invade new habitats. The most important insect pests on urban green spaces are: Cameraria 

ohridella, Cinara spp., C. ciliata, Metcalfa pruinosa and Tomostethus nigritus. IPM could be applied 

for their control. 

Key words: urban forests, public green, insect pests, natural enemies, IPM 

INTRODUCTION 

In parks and gardens and other human-made habitats are recorded more than 65% 

alien arthropods (Lopez-Vaamonde et. al, 2010). The most aliens remain strictly associated 

with their ornamental exotic hosts. Beneficial insects on public green and in urban forest 

ecosystems have been studied in Serbia for more than 40 years. The surveys carried out on 

urban green spaces in Serbia confirmed our hypothesis how it is complex ecosystem. There 

are sometimes 4 trophic levels, from the producers to the hyperparasitoids. This has 

appeared in urban forests and parks, as well as along tree-lined avenues. A plenty of 

ornamental plants are exotic, originating from North America of Asia. There is evidence 

that insect pests follow their host plants and invade new habitats. (Glavendekic & Roques, 

2010). Especially invasive species free from their natural enemies can outbreak and cause 

economic and ecological damage. 


Studies on the biology and ecology of alien insects were conducted in parks and 

urban forests in Belgrade. Vršac, Novi Sad and Kruševac (Serbia) and in Budva and Herceg 

Novi (Montenegro). The investigation of insect pests on urban green was mainly done 

because of their economic and ecological effect on cultivated ornamental plants. Standard 

entomological methods were applied. Scientific names of insects follow Alford (1991) and 

Mihajlovic (2008).

452 Integrated pest management of insect in urban green space 

RESULTS 

Integrated pest management (IPM) involves the use of different techniques to 

control insect pests: cultural control (use ornamental plants the most suitable for 

environmental condition, choose appropriate cultivar of host plant, apply technique of 

planting following good practice and standards, plant healthy plants for planting); physical 

control (cutting and destroying of highly affected plant parts, collecting of leaves in 

autumn, pheromone traps, sticky stripes, color sticky traps); use of biological control 

agents, keep safe populations of natural enemies and selective applications of chemical 

insecticides. 

Cameraria ohridella Deschka & Dimić is one of the most important insect pests in 

urban green.. The most frequent parasitoids recorded in Serbia are: Minotetrastichus 

frontalis, Closterocerus trifasciatus, Pnigalio pectinicornis, P. agraules, Pediobius saulius, 

Cirrospilus talitzkii, C. elegantissimus, C. vitatus, Elachertus inunctus. Up to now there is 

no evidence that natural enemies can control populations of the pest (Dautbašić, 2002; 

Stojanović and Marković, 2004). Following IPM options could be considered for control of 

C. ohridella: cultural, physical, biological control and application of biorational 

insecticides. 

Among alien terrestrial insects in Europe, one of the most abundant families is 

Aphididae (Coeur d’Acier et al., 2010) and a lot of their hosts are ornamental trees and 

shrubs. Outbreaks of Cinara cedri Mimeur 1936 (Homoptera; Aphididae) have been 

observed in 2002 in Belgrade, Vrsac and Novi Sad. During the research on natural enemies 

of C. cedri, the most common were predators: Chrysopa spp, Coccinella septempunctata, 

Adalia bipunctata and recently immature stages and adults of Harmonia axyridis have been 

observed. Ecological impact of H. axyridis is very important, since it was recorded that it 

shares parasitoid Homalotylus flaminius Dalman (Hymenoptera, Encyrtidae) with native 

coccinellids (Glavendekić et al., 2010a). Bow-legged fir aphid Cinara curvipes, (Patch) 

(Homoptera: Aphididae) a pest of Abies spp. was in 2001 recorded in Serbia (Poljakovic- 

Pajnik et al., 2002). Predators belonging to Chrysopidae, Coccinelidae and Syrphidae were 

observed. Following IPM options could be considered for control of aphids: cultural, 

physical, biological control and application of biorational insecticides. 

American netlike bug Corythucha ciliata (Say) (Heteroptera: Tingidae) was at the 

beginning of 70th’s for the first time recorded on the Balkan Peninsula (Tomić and 

Mihajlović, 1974). During ninetieths lower population of C. ciliata has been observed, as 

well as very good established population of predators: Anthocoridae, Miridae, and 

Chrysopidae. Following IPM options could be considered for control of C. ciliata: cultural, 

physical, biological control and application of biorational insecticides. 

Metcalfa pruinosa (Say, 1830) expanded its range within last decade significantly. It 

was observed in Serbia for the first time in 2006 in the vicinity of Belgrade and now it is 

spread about 130 km westwards and north from the first recorded locality. A wasp 

parasitoid, Neodryinus typhlocybae Ashmead (Hymenoptera: Dryinidae) was observed in 

Montenegro in the town Budva (Glavendekic et al., 2010). The level of parasitism was low. 

Following IPM options could be considered for control of M. pruinosa: cultural, physical, 

biological control and application of biorational insecticides. 

Tomostethus nigritus F. (Hymenoptera: Tenthredinidae) reached very high 

population level as defoliator of Fraxinus excelsior cultivars along tree-lined avenues in 

Belgrade. The research on natural enemies of T. nigritus revealed parasitic wasps 

Synoecetes tenuicornis Grav. (Hymenoptera: Ichneumonidae) and flies as parasitoids of

Milka Glavendekić 453 

immature stages. Following IPM options could be considered for control of T. nigritus: 

cultural, physical, biological control and application of biorational insecticides. 

The surveys carried out on urban green spaces in Serbia confirmed that there are sometimes 

4 trophic levels, from the producers to the hyperparasitoids in urban forest ecosystems. 

Application of biorational insecticides could reduce some natural enemies in various stages. 

It is recommended to do occasionally assessment of natural enemies on urban green areas. 

DISCUSSION 

Insect pests C. ohridella, C. cedri, C. curvipes, C. ciliata, M. pruinosa and T. 

nigritus in urban parks and forests outbreak and thus cause damage on ornamental trees and 

shrubs. The research on their natural enemies revealed that they have potential to be 

included in IPM. 

CONCLUSIONS 

Natural enemies of following pests were studied: C. ohridella, C. cedri, C. curvipes, 

C. ciliata, M. pruinosa and T. nigritus occur in parks and urban forest ecosystems. In their 

control IPM could be applied. Biorational products in managing pests could be more fully 

integrated into IPM programs. Thorough periodic survey that includes an assessment of 

natural enemies can provide this information. 


This work was supported by Ministry of Education and Science, Grant III 42007. 

REFERENCES 

Coeur d’Acier A., Perez Hidalgo N.& Petrovic-Obradovic O. (2010): Chapter 9.2. Aphids 

(Hemiptera, Aphididae). In: Terrestrial invertebrate invasions in Europe. A. Roques,J.Y. 

Rasplus, C. Lopez-Vaamonde, W. Rabitsch, M. Kenis & W. Nentwig Eds. BioRisk 4(1): 

435–474. 

Dautbašić M. (2002): Bioekološke karakteristike Cameraria ohridella Deschka & Dimić 

(Lepidoptera, Lithocolletidae) u Bosni i Hercegovini. Doktorska disertacija, Sarajevo. 

Glavendekic M., Ćirković-Ognjanović, Mirić M. (2010): Beneficial insects in integrated pest 

management on public green“. Proceedings of 57. Deutsche Pflanzenschutztagung from 

6 - 9. September, 2010. 

Glavendekić M., Mihajlović Lj., Hrašovec B. (2010a): Native species Homalotylus flaminius 

Dalman (Hymenoptera, Encyrtidae) parasitoid of Harmonia axyridis on Balkan 

Peninsula”. Proceedings Population dynamics, biological control and integrated 

management of Forest insects, 12-16 th September, 2010, Eberswalde, Germany, p. 47. 

Glavendekic M, Roques A (2009): Invasive species following new crops. In: Feldmann F., 

Alford D V, Furk C: Crop Plant Resistance to Biotic and Abiotic Factors, 328-337; 

Deutsche Phytomedizinische Gesellschaft, Braunschweig, Germany. 

Poljaković-Pajnik, L., Petrović, O. (2002): Bow-legged fir aphid Cinara curvipes (Patch) 

(Aphididae, Homoptera) new pest of Abies concolor in Serbia. Acta Ent. Serb. 7 

(1/2):147-150.

454 Integrated pest management of insect in urban green space 

Roques A., Kenis M., Lees D., Lopez-Vaamonde C, Rabitsch W., Rasplus J.Y. & Roy D.B. 

(Eds.) (2010): Alien Terrestrial Arthropods of Europe. Lopez-Vaamonde, Glavendekić, 

Paiva M. R. S. de Invaded habitats. Chapter 4. BioRisk 4(1): 435–474. 

Stojanović A. and Č. Marković (2004): Parasitoid Complex of Cameraria ohridella 

(Lepidoptera: Gracillariidae) in Serbia. Phytoparasitica 32(2):132-140. 

Tomić D., Mihajlović L. 1974. Američka mrežasta stenica (Corythucha ciliata Say 

(Heteroptera, Tingidae) nova štetočina platana u Beogradu. Šumarstvo 7-9: 51-54 

Beograd.

Branislava Sivčev, Blaga Radovanović, Ivan Sivčev,... 455 


Proceedings UDK: 631.147:634.8(497.11)”2008/2010” 

EFFICACY OF CONVERSION OF CONVENTIONAL TO 

ORGANIC GRAPE AND WINE PRODUCTION 

BRANISLAVA SIVČEV, BLAGA RADOVANOVIĆ, IVAN SIVČEV, ZORICA RANKOVIĆ-VASIĆ, 

NEVENA PETROVIĆ, LJUBOMIR ŽIVOTIĆ 

This paper focuses on the procedure of converting conventional to organic grape and wine 

production in accordance with the Law on Organic Production and corresponding regulations. The 

experiment was conducted in the regions of South Banat and Central Serbia from April 2008 to 

October 2010. In 2008, conventional production was applied at both localities and in 2009 and 2010 

the conventional production was converted to organic production. In 1970, Riesling Italico variety 

/Kober 5 BB rootstock was planted on the area of 3ha in South Banat in the wine growing region of 

Vršac in Gudurica wine production facility. In Central Serbia, in Grocka wine growing region - 

experimental field ’’Radmilovac” of the Faculty of Agriculture - Riesling variety/Kober 5BB 

rootstock was planted on the area of 1ha in 1995. Plantation density at both localities was 3330 

grapevines per hectare with 1m tall trunk and the training systems were double Guyot and asymmetric 

cordon training system. The first year of disease control included conventional preparations for the 

control of main pests and diseases. The second and third year of investigation included disease 

control with copper, sulfur and pyrethrin. The number and period of treatments during one year 

depended on the weather conditions and set insect pheromone traps. GPS technology was used for the 

positioning of experimental plots and data base was created in GIS. Yield and grape quality were 

monitored. 

According to the results conventional and organic grape vine growing showed no differences in grape 

quantity and quality and wine sensory properties. Vine disease and pest control was proved to be 

acceptably efficient with preparations based on copper, sulfur and pyrethrin in both regions. 

Key words: grape vine protection, organic production, grape yield 

INTRODUCTION 

Organic agriculture, as well as viticulture and wine production, represent a “holistic 

production management system that emphasizes and propagates healthy eco – system, 

biodiversity, biological cycle and soil biological activity. It is based on practical knowledge 

applied on farms considering that regional conditions require locally adapted systems ’’ 

(IFOAM, 2005). As Trioli and Hofmann (2009) simplified it, organic viticulture is the 

implementation of procedures applied in organic agriculture to produce the best possible 

quality of grape and wine. System of growing, soil, disease and pest control are all aspects 

that are considered with the aim of improving the quality and safety of wine and table 

grapevine cultivars in organic production.

456 Efficacy of conversion to organic grape and wine production 

Protection of grape vine in organic production focuses on the causal agents of grape 

vine diseases and pests that are the same as those occurring in conventional production. 

Both types of protection have the same goal but the difference is the way of control. In 

organic production, control is based first on preventive measures intended to diminish the 

attack and then the allowed preparations from the list are applied (Sivčev et al., 2010a). In 

organic grape production insecticides of plant origin, plant oils, powders, insecticidal soaps 

that are selective, narrow-spectrum and of lower toxicity and biological preparations are 

used. More frequent application is required with these types of preparations. Copper and 

sulfur based fungicides are leading products in grape vine disease control. Contemporary 

research focuses on the reduction in application quantity, discovery of adequate substitute 

that would be equally efficient, selection of varieties more tolerable to pests and diseases 

(Sivčev et al., 2010b). 

This paper focuses on the comparison of conventional production (2008) with the 

years of conversion (2009, 2010) in respect of the yield and quality of Riesling Italico and 

Riesling varieties of grape and wine. 


In 2008, conventional production was applied at both localities and in 2009 and 

2010 the conventional production was converted to the organic production. In 1970, 

Riesling Italico variety /Kober 5 BB rootstock was planted on the area of 3ha in the wine 

growing region of Vršac. Riesling variety/Kober 5BB rootstock was planted on the area of 

1ha in 1995 in Grocka wine growing region. Plantation density at both localities was the 

same, 3330 grapevines per hectare, and the training systems were double Guyot and 

asymmetric cordon training system. 

In 2008 the protection program included application of conventional preparations for 

the control of pest and disesase causal agents (Tab.1). 

Table 1. Treatments applied for grape vine protection in 2008 

Date 

Phenological phase 

Applied fungicides and insecticides 

Gudurica and EF «Radmilovac» 

May, 21 Growth of shoot apex up to 10 grown leaves 

Cabrio Top BASF 

Tiovit® Jet 80WG Syngenta 

June, 7 Flowering with 50% of open flowers 

Mical flash Bayer 

Collis BASF 

Lanate® 25 WP Agromarket 

June, 14 Flowering with 80-100% of open flowers 

Acrobat MZ BASF 

Collis BASF 

June, 28 Formation of berries – 2-4 mm 

Eqution® Pro WG Dupont 

Collis BASF 

July, 10 Formation of berries – 4-7 mm 


Collis BASF 

July, 27 «pea» size berries prior to cluster ripening 

Captan 50 WP Agromarket 


August, 7 The beginning of ripening 

Funguran OH Agromarket 

Thiovit® Jet 80WG Syngenta 

In 2009 and 2010 preparations based on copper, sulfur and pyrethrin were applied 

(Tab. 2). Wet conditions in the flowering phase required more treatments in 2009; there 

were 8 treatments in total. The preparations applied were Funguran OH (1.7kg/ha), 

Thiovit® Jet 80WG (2.9 kg/ha) and Pyros (150 ml/ha) in the second and fifth treatment.



Date 






Thiovit® Jet 80WG Syngrnta 

May, 29 Flowering with 50% of open flowers 



Pyros Serbios 


Funguran OHAgromarket 





July, 6 

Formation of berries – 4-7 mm 



Pyros Serbios 



Cosan WP 




August, 21 Middle of ripening phase 

Funguran OH Agromarket* 

Thiovit® Jet 80WG* Syngenta 

*Treatment applied in Gudurica only – wine growing region of Vršac 

A total of 7 treatments were applied in 2010 and the preparations used were 

Kocide® 2000 (1.7 kg/ha), Cosan WP (2.6 kg/ha) and Pyros (100 ml/ha) which was applied 

only once, at the beginning of the grape ripening phase (Tab.3). Ampelotechnical measures 

were standard, grass in rows was cut manually, soil between the rows was tilled and planted 

with grass seed mixture (fodder peas +barley) and incorporated in the withering phase. 

Table 3. Protection program in 2010 

Date 



June, 9 

Flowering with 50% of open flowers 



July, 13 Formation of berries – 4-7 mm 





Kocide® 2000 Dupont 

Cosan WP 


Cosan WP 


Cosan WP 


Cosan WP 


Cosan WP 


Cosan WP 

Funguran OH Dupont 

Cosan WP 

Pyros Serbios 

In 2009 soil properties at the depths of 30 and 60 cm were tested (pH of H20, pH of 

KCl, accessible phosfor and potassium , humus content), and grape yield indicators (yield 

and number of clusters per grapevine) were analyzed geostatistically; soil sampling scheme 

and grapevine monitoring was regular, with distance of 10 m in the row and interrow 

distance of 14 m. Every sampling site was identified by GPS device. Such a sampling 

scheme provided appropriate coverage of 0.71 ha with respect to the total area of 1 ha of 

experimental field «Radmilovac» and 1.26 ha with respect to the total area of 3 ha in 

Gudurica. The recorded data were analyzed statistically in a software program SPSS 17.0.

458 Efficacy of conversion to organic grape and wine production 

The aim was to determine the existence of correlation between soil and yield parameters. 

All analyses were conducted separately for each locality. 

Chemical and sensory analyses of produced wines were conducted in the Laboratory 

of fermentation Technology at the Institute of Food Technology and Biochemistry of the 

Faculty of Agriculture, University of Belgrade. The same procedure was applied in wine 

production in 2009 and 2010. Degustation of young wines was performed. 


Grape vine protection in 2009 and 2010 was performed with copper and sulfur based 

products listed as acceptable for plant protection in organic production in Serbia, and with 

natural pyrethrin based insecticide which is on the list of EU – Regulation (EEC) No 

2092/91-ANNEX II. Preventive treatments were applied in 2009 and 2010 on the 

experimental field «Radmilovac» and wine production facility Gudurica which is within the 

company «Vršački vinogradi». The results were positive. The only exception was part of 

the plot on the experimental field «Radmilovac» where downy mildew and rottening 

occurred in 2009 because agrotechnical measures were not taken on time: grass cutting in 

row and shallow soil tillage. The attacks of grape berry moth and other pests were below 

damage threshold. Eight treatments with 6.8 kg/ha of cupric hydroxides were applied in 

Gudurica in 2009. Pyrethrum was used more in 2009 (2 treatments) than in 2010. Six 

treatments with 6 kg/ha of cupric hydroxides were applied in 2010. 

Due to vineyard variability, the entire plot should be analyzed rather than its small 

part, which was the case with the experiments conducted in the past (Bishop and Lark, 

2006; Panten et al. 2010). Spearman rank correlation test was used for testing the 

correlation between soil properties and yield indicators because the regular data distribution 

was not determined by detailed analysis. The following correlations were determined: 

correlation between the number of clusters and pH of H20 (r=0.370, p=0.017 at first depth 

and r=0.331, p=0.035 at second depth), correlation between the number of clusters and pH 

of KCl (r=0.446, p=0.003 at first depth and r=0.478, p=0.002 at second depth), as well as 

the correlation between the yield and pH of KCl (r=0.325, p=0.038 at first depth and 

r=0.339, p=0.030 at second depth). 

Spearman rank correlation test was conducted based on the data from Gudurica 

locality and it showed that there was no correlation between the measured quantities at any 

depth. However, the fact that vineyard had a lot of empty space at the end of its 

exploitation should be taken into consideration. 

The yield varied widely at both localities. In the first year of investigation the yield 

was higher than in the second and third year, but the recorded differences did not show any 

statistical significance. Results in the world have shown that grape purchase price has 

increased by 20% to 40% with respect to the grape produced conventionally (Granastein et 

al. 2009). This compensates the yield which is lower in the process of conversion. 

Grapes were harvested in the phase of technological maturity and had 100% healthy 

phytosanitary conditions. According to the degustation of Riesling Italico variety in 2009 

and 2010 the wine was clear, with mild and undeveloped flavor, moderately full, with hard 

taste and slight variety aroma. Riesling variety gave better wine with distinguished variety 

aroma, clear, of full flavor with slight sugar remains.


Figure 1. Grape yield and number of clusters per grapevine on EF «Radmilovac», 

Riesling variety 

We selected the vineyard in full growth (Riesling variety -EF «Radmilovac») and at 

the end of the exploitation period (Riesling Italico -«Vršački vinogradi» company). Copper, 

sulfur and pyrethrin based preparations were efficient which was confirmed by yield and 

healthy condition of grapes at both localities. 


This study is partially funded by the Ministry of Education and Science of Republic 

of Serbia through the projects 20093 and 31063. 

REFERENCES 

Bishop T:E:A: and Lark R.M. (2006): The geostatistic analysis of experiments at the landscapescale. 

Geoderma 133, 87-106. 

Granatstein, D., Kirby E., Willer H. (2009) The World of Organic Agriculture. Statistics and 

Emerging Trends 2009. IFOAM and FiBL Report, www.organic-world.net 

IFOAM (2005): Principles of Organic Agriculture. 

http://www.ifoam.org/organic_facts/principles 

Panten, K. and Bramly R. G. V. (2011): Viticultural expermatation using whole blocks: 

Evaluation of there floor management option. Australian Journal of Grape and Wine 

Research 17, 136-146. 

Sivčev B., Sivčev I., Ranković-Vasić Z (2010a): Plant protection products in organic grapevine 

growing. Journal of Agriculture Sciences Vol. 55 No 1, 103-122 

Sivčev B., Sivčev I., Ranković-Vasić Z (2010a): Natural process and use of natural material in 

organic viticulture. Journal of Agriculture Sciences Vol. 55 No 2, 195-215. 

Trioli, G., Hofmann, U. (2009): ORWINE code of good organic viticultureand wine making. In 

Hofmann, U. (Ed.) ECOVIN-federal Association of Organic Winw-Producer. 

Oppenheim, Germany.

460 Advantages and limitations in bioherbicides use 

International Symposium: Current Trends in Plant Protection - Proceedings 

ADVANTAGES AND LIMITATIONS IN BIOHERBICIDES USE 

ZVONKO PACANOSKI 

Faculty for Agricultural Sciences and Food, Skopje, R. Macedonia 

E-mail: zvonko_lav@yahoo.com 

Development of alternative weed control methods is needed to help decrease 

reliance on herbicide use. Bioherbicides are phytopathogenic microorganisms or microbial 

phytotoxins useful for biological weed control applied in similar ways to conventional 

herbicides (GOEDEN, 1999; BOYETCHKO et al., 2002; BOYETCHKO & PENG, 2004). 

Therefore, bioherbicides has been recognized as a significant biological control 

strategy.The active ingredient in a bioherbicide is, however, a living micro-organism. Most 

commonly the organism is a fungus, hence the term mycoherbicide is often used in these 

cases (AULD & MCRAE, 1997). Although the use of fungi and bacteria as inundative 

biological control agents (bioherbicides) has been recognized as a significant technological 

weed control alternative (ROSSKOPF, et al., 1999; BOYETTE, 2000; CHARUDATTAN, 

2001; 2005; HOAGLAND, 2001), it can be argued that it serves a more important role as a 

complimentary component in successful integrated management strategies (HOAGLAND 

et al., 2007), and not as a replacement for chemical herbicides and other weed management 

tactics (SINGH et al., 2006). Actually, in many situations, bioherbicides can be used as the 

sole option for the management of one or two target weeds, i.e. as a minor supplement to 

conventional chemical herbicides (CHARUDATTAN, 2005). However, according some 

authors, bioherbicides offer many advantages. They include a high degree of specificity of 

target weed; no effect on non-target and beneficial plants or man; absence of residue buildup 

in the environment; effectiveness for managing herbicide-resistant (HR) weed 

populations (TEBEEST, 1991; BOYETTE, 1991; BOYETTE et al., 1993; ABBAS & 

BOYETTE, 2000; HOAGLAND, 2001; CHARUDATTAN, 2001; 2005). The concept of 

combining microbial herbicides with chemical herbicides or adjuvants has been the subject 

of considerable research. Furthermore, it has been demonstrated that combinations of some 

bioherbicides and synthetic herbicides can be synergistic (CAULDER & STOWELL, 1988; 

CHRISTY et al. 1993), resulting from lowered weed defense responses caused by the 

herbicides, thus making the weeds more susceptible to pathogen attack (HOAGLAND, 

1996; 2000). Besides many advantages of bioherbicides, certain factors have been reported 

to limit the development of bioherbicides into commercial products. Limitations in 

bioherbicide development can be classified as either environmental (temperature and, 

particularly, humidity as major factors influencing the efficacy of bioherbicides); biological 

(mainly host variability and resistance) and technological-commercial limitations (mass 

production and formulation which often blocked bioherbicide development) (AULD & 

MORIN, 1995; MORTENSEN, 1996; AULD et al., 2003).

Zvonko Pacanoski 461 

Environmental limitations are a constraint to the effective use of many biological 

agents, including bioherbicides. Environmental factors influence formulation performance 

of bioherbicides as inoculum production is dependent on sporelation of the formulation. 

This process, although rapid, might continue over several weeks subsequent to applications 

and might encounter variable environmental conditions (ALTMAN et al. 1990; AULD & 

MORIN 1995; BAILEY et al. 1998). 

It is desirable for a bioherbicide to act relatively quickly and have sufficient efficacy 

to control weeds. Unfortunately, many of the weed pathogens discovered may provide only 

partial control of only one weed species, even under ideal conditions (CHARUDATTAN, 

2005). This host specificity is related to the basic biology of the pathogen and to host 

variability (GABRIEL, 1991; LEONARD, 1982). Biological constraints including host 

variability and resistance mechanisms and interaction with other microorganisms that affect 

efficacy (AULD, 2002). 

Several technological- commercial limitations have been identified that could 

prevent the widespread use of bioherbicides (ALTMAN et al., 1990). Pathogenical strains, 

formulation method and the interaction of these two parameters significantly affect the 

shelf life of the formulations at room temperature (ALTMAN et al., 1990; HEBBAR et al., 

1998). 

The most challenging aspect of formulating bioherbicides is to overcome the dew 

requirement that exists for several of them. Attempts to overcome this limitation have 

included developing various water-retaining materials; invert and vegetable oil emulsion 

formulations (BOYETTE et al., 1993; BOYETTE, 1994; BOYETTE, et al., 1999) and 

granular preemergence formulations (WATSON & WYMORE, 1990), considered as a 

promising approach to make pathogens less dependent on available water for initial 

infections to occur (DAIGLE & CONNICK, 1990: WOMACK & BURGE, 1993). 

Taking into considerations previous mentioned limitations, the development of 

bioherbicides by commercial firms would involve additional costs without secured returns. 

The cost of mass production of microorganisms for bioherbicides in submerged culture or 

in solid-state systems, which would vary from one bioherbicide to another, is relatively 

high (GHOSHEH, 2005). In addition, the low market potential of several efficient 

bioherbicide candidates indicates that market size could be a constraint for developing such 

herbicides. On this basis, companies are unsure that development and registration costs will 

be recovered (ALTMAN et al., 1990; AULD & MORIN, 1995). 

The bioherbicides approach is gaining momentum. New bioherbicides will find 

place in irrigated lands, wastelands as well as in parasite weeds or resistant weed control. 

Research on synergy test of pathogens and herbicides for inclusion in IWM, developmental 

technology, fungal toxins, and application of biotechnology, especially genetic engineering 

is required. Bioherbicides will not solve all of the environmental and weed management 

problems associated with synthetic herbicides, nor will replace the current or future arsenal 

of synthetic herbicides. Rather, their role will probably be complimentary components in 

successful IWM systems, and in the discovery of novel phytotoxins with new chemistries 

and new molecular sites of action. Continued research on these areas is important in order 

to fully understand interactions of microorganisms and plants (crops and weeds), and to 

discover new phytopathogenic microorganisms or microbial phytotoxins useful as 

bioherbicides.

462 Advantages and limitations in bioherbicides use 

REFERENCES 

Abbas, H.K. and Boyette, C.D. (2000). Solid substrate formulation of the mycoherbicide 

Colletotrichum truncatum for hemp sesbania (Sesbania exaltata) control. Biocon. Sci. 

Technol., 10: 297–304. 

Altman, J., Neate, S., Rovira, A.D. (1990). Herbicide pathogens interaction and mycoherbicides 

as alternative strategies for weed control. In: Microbes and Microbial Products as 

Herbicides (ed. by Hoagland R.E.). ACS Symposium Series 439. American Chemical 

Society, Washington DC, 240–259. 

Auld, B.A. and Morin, L. (1995). Constraints in the development of bioherbicides. Weed 

Technol., 9: 638–652. 

Auld, B.A. and McRae, C. (1997). Emerging technologies in plant protection - bioherbicides. 

Proc. 50th N.Z. Plant Protection Conf., 191-194. 

Auld, B.A (2002). Bioherbicidal formulations. Australian Provisional Patent Application 

2002952094. Patent Office, IP Australia, Canberra. 

Auld, B.A., Hetherington, S.D., Smith, H.E. (2003). Advances in bioherbicide formulation. 

Weed Biol. and Manag., 3: 61–67. 

Bailey, B.A., Hebbar, P.K., Strem, M., Lumsden, R.D., Darlington, L.C., Connick, W.J. Jr. 

Daigle, D.J., Lumsden, R.D. (1998). Formulation of Fusarium oxysporum f. Sp. 

erythroxyli for biocontrol of Erythroxylum coca var. coca. Weed Sci., 46: 682–689. 

Boyetchko, S.M., Rosskopf, E.N., Caesar, A.J., Charudattan, R. (2002). Biological weed 

control with pathogens: search for candidates to applications. In: Applied Mycology and 

Biotechnology, Vol. 2 (ed. by Khachatourians G.G. and Arora D.K.). Elsevier, 

Amsterdam, 239–274. 

Boyetchko, S.M. and Peng, G. (2004). Challenges and strategies for development of 

mycoherbicides. In: Fungal Biotechnology in Agricultural, Food, and Environmental 

Applications (ed. by Arora D.K.). Marcel Dekker, NewYork, 11–121. 

Boyette, C.D., Quimby, P.C. Jr., Connick, W.J. Jr., Daigle, D.J., Fulgham, F.E. (1991). Progress 

in the production, formulation and application of mycoherbicides. p. 209-224 in D.O. 

TeBeest, ed. Microbial Control of Weeds. Chapman and Hall Inc., New York. 

Boyette, C.D. (1991). Host range and virulence of Colletotrichum truncatum, a potential 

mycoherbicide for hemp sesbania (Sesbania exaltata). Plant Dis., 75: 62–64. 

Boyette, C.D., Quimby, P.C. Jr., Bryson, C.T., Egley, G.H., Fulgham, F.E. (1993). Biological 

control of hemp sesbania (Sesbania exaltata) under field conditions with Colletotrichum 

truncatum formulated in an invert emulsion.Weed Sci., 41: 497–500. 

BoyettE, C.D. (1994). Unrefined corn oil improves the mycoherbicidal activity of 

Colletotrichum truncatum for hemp sesbania (Sesbania exaltata) control. Weed Technol., 

8: 526-529. 

Boyette, C.D., Jackson, M.A., Quimby, P.C. Jr., Connick, W.J. Jr., Zidak, N.K., Abbas, H.K. 

(1999). Biological control of the weed hemp sesbania with Colletotrichum truncatum. 

In: Spencer N., Noweierski R., eds. Abstracts of the 10th International Symposium on 

Biological Control of Weeds (Bozeman, MT, USA, 4–9 July 1999). Montana State 

University, Bozeman, MT, USA, 64. 

Boyette, C.D. (2000). The bioherbicide approach: using phytopathogens to control weeds. In: 

Herbicides and their Mechanisms of Action (ed. by Cobb A.H. and Kirkwood R.C.). 

Sheffield Academic Press, Sheffield, UK, 134–152. 

Caulder, J.D. and Stowell, L. (1988a). Synergistic herbicidal compositions comprising 

Colletotrichum truncatum and chemical herbicides. US patent 4,775,405. 6 Jan. 1987. 

Charudattan, R. (2001). Biological control of weeds by means of plant pathogens: significance 

for integrated weed management in modern agro-ecology. Bio Control, 46: 229-260.

Zvonko Pacanoski 463 

Charudattan, R. (2005). Use of plant pathogens as bioherbicides to manage weeds in 

horticultural crops. Proc. fla. state hort. soc., 118: 208-214. 

Christy, A.L., Herbst, K.A., Kostka, S.J., Mullen, J.P., Carlson, S.J. (1993). Synergizing weed 

biocontrol agents with chemical herbicides. In: Pest Control with Enhanced 

Environmental Safety (ed. by Duke S.O., Menn J.J. and Plimmer J.R.). American 

Chemical Society, Washington, DC, 87–100. 

Daigle, D.J. and Connick, W.J. (1990). Formulation and application technology for microbial 

weed control. p. 288-304 in R.E. Hoagland, ed. Microbes and Microbial Products as 

Herbicides, ACS Symp. Ser. 439. American Chem. Soc., Washington, DC. 

Gabriel, D.W. (1991). Parasitism, host species specificity, and gene-specific host cell death. In 

D.O. TeBeest, Microbial Control of Weeds. New York: Chapman and Hall. 115-131. 

Ghosheh, H.Z. (2005). Constraints in implementing biological weed control: A review. Weed 

Biol. and Manag., 5: 83-92. 

Goeden, R.D. (1999). Projects on biological control of Russian thistle and milk thistle in 

California: Failures that contributed to the science of biological weed control. In: 

Spencer N., Noweierski R., eds. Abstracts of the 10th International Symposium on 

Biological Control of Weeds. Montana State University, Bozeman, MT, USA, 27. 

Hebbar, K.P., Lumsden, R.D., Lewis, J.A., Poch, S.M., Bailey, B.A. (1998). Formulation of 

mycoherbicidal strain of Fusarium oxysporum. Weed Sci., 46: 501-507. 

Hoagland, R.E. (1996). Chemical interactions with bioherbicides to improve efficacy.Weed 

Technol., 10: 651–674. 

Hoagland, R.E. (2000). Plant pathogens and microbial products as agents for biological weed 

control. In: Advances in Microbial Biotechnology (ed. by Tewari J.P., Lakhanpal T.N., 

Singh J., Gupta R. and Chamola V.P.). APH Publishing, New Delhi, 213–255. 

Hoagland, R.E. (2001). Microbial allelochemicals and pathogens as bioherbicidal agents.Weed 

Technol., 15: 835–857. 

Hoagland, R.E., Weaver, M.A., Boyette, C.D. (2007). Myrothecium verrucaria fungus; A 

bioherbicide and strategies to reduce its non-target risks. Allelopathy Journal, 19: 179- 

192. 

Leonard, K.J. (1982). The benefits and potential hazards of genetic heterogeneity in plant 

pathogens. In R. Charudattan and H. L. Walker, eds. Biological Control of Weeds with 

Plant Pathogens. New York: J. Wiley. pp. 99–112. 

Mortensen, K. (1996). Constraints in development and commercialization of a plant pathogen, 

Colletotrichum gloeosporioides f. sp. malvae, for biological weed control. In H. Brown, 

G. Cussans, M.Devine, S. Duke, C. Fernandez-Quintanilla, A. Helweg, R. Labrada, M. 

Landes, P. Kudsk, and J. Streibig, eds. Proc. 2nd Int. Weed Control Congress. 

Flakkebjerg, Denmark: Weed Control, Pesticides, Ecology. pp. 1297–1300. 

Singh, H.P., Batish, D.R., Kohli, R.K. (2006). Handbook of Sustainable Weed Management. 

Food Products press. Binghamton, NY. 

TeBeest, D.O. (1991). Microbial Control of weerds, (Ed., D.O. TeBeest). Chapman and Hall, 

Newyork. 284 pp. 

Womack, J.G. and Burge, M.N. (1993). Mycoherbicide formulation and the potential for 

bracken control.

464 Questions on effect of climate change on plant protection 

International Symposium: Current trends in plant protection – Proceedings 

QUESTIONS ON EFFECT OF CLIMATE CHANGE ON PLANT 

PROTECTION 

AHMET ULUDAG 

Igdir University, Plant Protection Department, Igdir, Turkey 

INTRODUCTION 

No need to explain the effect and impact of extreme weather events and climatic 

anomalies on agriculture and nature in broad. Reduction in crop yield or quality or 

complete lost of produce due to deviating temperatures or precipitation from climate of 

given area and loss of crop due to hail or frost are well known examples of effects of 

anomalies and extreme events. An example of effect on unmanaged areas is increasing 

forest and bush fires of which incidence increases with frequent heat waves. Anthropogenic 

global climate change which is resulted from industrialization has been evident with its 

observed and projected effects. Global temperatures have risen by almost 1°C over the last 

century and changes in precipitation have also been observed. Although average 

precipitation shows only small changes, there has been a significant increase in heavy 

precipitation events (Degaetano 2005). Due to increase temperature, greenhouse gasses and 

incidence of extreme events, changes in crop plants, farming practices and pests are 

expected more than current conditions. As Degaetano (2005) explained not only direct 

cause of temperature increase is a problem; but also problems will bear from that many 

agricultural and water resource practices are based on climate data from 1950s and 1960s, 

which climate conditions over the last 20 years are not reflective of those years. 

Some researches have been done on effect of climate change, global change in 

broad, on crop protection as well as crop production. However, results are far away making 

generalizations, establishing theories and responding appearing questions. As global 

climate changes, what will crop protection scientists do? They can wait until seeing the 

effects of climate change then they take measures or they can start the research to be ready 

for changes. The latter is more acceptable strategy. Then, what kind of research should be 

conducted? What should be the assumptions? The aim of this paper is to give a general 

view on effect of climate change on plant protection via finding out questions which will 

lead to solve the problems timely. Although climate change ill be the focus, effect of global 

change will be discussed when requires broader view on the problem.

Ahmet Uludag 465 

QUESTIONS 

I think there is no limit for questions which might be arisen. However some could be 

more important or has priority than others. We can start with three main questions: What, 

how and why. The question with “what” will be what will change. Biological processes 

have hierarchy in time and space: They start with gene level and reach ecosystem level 

processes (Ziska and Dukes, 2011). We can ask “what” questions to understand flora and 

fauna changes and farming practice changes. “How” questions could help us understanding 

magnitude and shape of problem. The real answer will come with responding “why” 

questions. 

In the context of this paper, not regarding to three basic question words, following 

questions have been raised. 

Do we know what climate change is and how the climate will be in our region? 

• What will be the crop pattern? 

• Will cropping practices change? 

• How crop physiology will change? 

• Will introduction of alien species increase? 

• Will main pests change? 

• Will pests be more aggressive? 

• Will life cycles of pests change? 

• Will control methods change? 

• Will effectiveness of applications change? 

• What will happen with biological control agents? 

ANSWERS 

There are already answers for some of these questions. However, answers are far 

away to set a general theatrical ground on the issue. IPPC report (Easterling et al. 2007), 

FAO Report FAO, 2008), a book “weed biology and change” (Ziska and Dukes, 2011), and 

a paper “Emerging infectious diseases of plants: pathogen pollution, climate change and 

agrotechnology drivers” are some examples of activities which reviews answers. Most of 

us, plant protection scientists, have worked on problems arisen and found solutions. 

Dealing with problems of future is different. When we consider global change and/or 

climate change, we need to focus on scenarios, projections and models. Furthermore, 

setting indicators, which shows changes in pest flora and fauna in a given area, could help 

to find our questions and answers. 

These questions should be considered as general initiation, an agitating point to start. 

Without finding out correct questions we cannot reach correct answers. One of the main 

aims of this presentation was to initiate a discussion in the meeting and find out 

collaborative works for future via asking soe general questions. 

REFERENCES 

Degaetano A.T. (2005): Greenhouse Gases and Climate Change: What We Know Now. 

Proceedings Climate Change and Northeast Agriculture: Developing an Education 

Outreach Agenda November 17, 2004, NY

466 Questions on effect of climate change on plant protection 

FAO (2008): Climate-related transboundary pests and dıseases, Technıcal background document 

from the expert consultatıon held on 25 TO 27 FEBRUARY 2008. 

Ziska, L.H. and J.S. Dukes (2011): Weed Biology and Climate Change. Wiley-Blackwell 

Anderson, P.K. , A. A. Cunningham, N. G. Patel, F. J. Morales, P. R. Epstein and P. Daszak 

(2004): Emerging infectious diseases of plants: pathogen pollution, climate change and 

agrotechnology drivers. TRENDS in Ecology and Evolution Vol.19. 

Easterling, W.E., P.K. Aggarwal, P. Batima, K.M. Brander, L. Erda, S.M. Howden, A. 

Kirilenko, J. Morton, J.-F. Soussana, J. Schmidhuber and F.N. Tubiello, (2007): Food, 

fibre and forest products. Climate Change 2007: Impacts, Adaptation and Vulnerability. 

Contribution of Working Group II to the Fourth Assessment Report of the 

Intergovernmental Panel on Climate Change, M.L. Parry, O.F. Canziani, J.P. Palutikof, 

P.J. van der Linden and C.E. Hanson, Eds., Cambridge University Press, Cambridge, 

UK, 273-313.

Natalia Nikolaevna Malevannaya 467 

International Symposium: Current Trends in Plant Protection UDK: 504.3:632.9 

Proceedings 

Reklamno predavanje 

THE USE OF PROTECTIVE-STIMULATING COMPLEXES IN THE 

MODERN AGRICULTURAL TECHNOLOGY 

NATALIA NIKOLAEVNA MALEVANNAYA 

Central Research Institute of Agrochemistry, Moscow, Russia 

info@nest-m.ru 

The biological measure of life of each nation is the quality of the food it consumes. 

And we eat ecologically contaminated food, drink ecologically contaminated water, breathe 

ecologically polluted air. That is, we live in conditions of the total chemization of our 

planet. The most dangerous to human being are pesticides, mycotoxins, heavy metals, 

radionuclides, and nitrates contained in food above permissible concentrations. As it turns 

out, in polluted anthropogenic ecosystem the most harmful and toxicogenic organisms 

predominate. In response to the chemicals used to control them, they increase synthesis of 

toxins. As a result, in addition to residues of the chemicals used the food also contains 

mycotoxins. This situation makes up the medical aspect of the food security problem of any 

country. All countries, regardless of economic development level, are affected by this 

problem. 

At present scientists worldwideare conducting researches aimed at reducing the 

toxic effects of pesticides. However, this is not an easy task, as the resistance of many 

phytopathogens to used chemicals has increased many times. There is a need for 

development and use of new pesticides every 3-5 years, and the last ones have become the 

ecological oppressors of plant immune systems today. At the same time plant immunity is 

no less important to plant viability than to humans and determines their resistance to biotic 

and abiotic environmental factors. The genetic margin of safety given to plants by nature is 

now reduced to nothing. 

For example, we know that in Russia each new cultivar loses resistance to diseases 

and pests every 3-5 years after its introduction into production. Over the last 15-20 years 

the protein level of wheat in Russia has decreased by one third. The yield of many crops 

continues to reduce, and the efficiency of pesticide use in Russia and CIS countries is 

about 0.1, while in the U.S. and other countries it is 0.5 - 0.6. Compared to the general 

achievements of civilization, an agricultural technology in which efficiency doesn’t exceed 

0.5-0.6 leaves much to be desired. 

Today the recognized new trend in plant protection is the application of 

immunomodulators, the inducers of plant disease resistance. These are biologically active 

substances with regulatory activity, extracted from natural, mostly plant, sources, or 

synthetic analogs of these substances. Many of these act not only through the plant itself, 

activating innate plant resistance, its internal protection mechanisms (Pic.1), but also 

directly on phytopathogens (Pic.2, 3).

468 The use of protective stimulating complexes in the modern agricurtural technology


Unlike chemical pesticides, immunomodulators aren’t addictive, and don’t suppress 

but rather stimulate immune system of plants. Moreover besides of plant protection against 

diseases and pests, they also provide protection against abiotic stresses. Being used in 

combination with pesticides, they form so-called protective-stimulating complexes, which 

improve pesticide efficiency and simultaneously eliminate or alleviate their inhibitory 

effect on agricultural crops. This allows to lower application rates of pesticides by 30% - 

50% or to reduce number of treatments. 

Whether we talk about the weight of an individual grain, dry matter, proteins, or oil 

content level in crop production, all have their best performance when protectivestimulating 

complexes are applied. 

Our Russian company ”NEST M" is engaged in development of exactly such 

preparations of natural origin, helping to get the most out of seeds, fertilizers, and chemical 

pesticides. These are the phytohormoneEpin-Extra (active ingredient (a.i.) 24- 

epibrassinolide), the inducer of plant disease resistance Circon (a.i. mixture of 

hydroxycinnamic acids related to plant phenolics) and the siliceous preparation with 

fungicidal properties Siliplant. 

All three of these preparations stimulate plant growth and accelerate passage through 

vegetative stages, affecting the levels of phytohormones such as auxins, cytokinins and 

gibberellins. Due to increasing of the hormone levels that are responsible for cell division 

(gibberellins), root system growth (auxin), lateral shoots and aerial parts formation 

(cytokinin and auxin), yhe active development of root system and foliage takes place. 

Plants with well-developed root systems are better supplied with mineral elements owing to 

active uptake of minerals from the soil. A well-developed leaf apparatus is a guarantee of 

an intensive photosynthesis, therefore it’s important to stimulate early growth of the root 

and aboveground part of the plant. Treatment of seeds (or seedlings) with Epin-Extra or 

Circon (Pic. 4, 5) helpsto ensure such development.

470 The use of protective stimulating complexes in the modern agricurtural technology


The serious enemies of agricultural crops are weeds, outgrowing cultural plants, 

actively intercepting nutrients, water and light. The application of herbicide reduces weeds, 

but herbicides, in killing weeds, also inhibit the development of crop itself. 

Application of Epin-Extra, Circon, or Siliplant in tank mixes with herbicides 

relieves stress response of agricultural plants. For example, the use of Circon (20 ml /ha) or 

Siliplant (0.6 -1.5 l/ha) in combination with herbicides, sulfonylurea derivatives (Laren, 

Logran and others) decreases photosynthetic activity in 3-5 times as compared with plants 

treated with herbicide alone. Combined application of pesticides with preparations inducing 

plant immunity not only eliminates the negative effects of herbicide, but enhances the 

destruction of weeds. 

Thus, when barley was sprayed with a mixture of Logran and Siliplantat the 

tillering stage, the first day after treatment a significantly enhanced accumulation of active 

ingredient (triasulfuron) in upperground plant parts was observed, as compared to plants 

sprayed with the herbicide only. Later, in the barley plants under the impact of Siliplant, 

the period to complete breakdown of herbicide was shortened by 10-11 days, while in 

weeds (orach), on the contrary, breakdown was slowed down 2 times. This makes it 

possible to reduce the rate of application of herbicides, sulfonylurea derivatives, by 30- 

40%, if they are applied in combination with Siliplant. A similar intensifying of the weedkilling 

effect was observed when herbicides were applied in rates reduced by 30% in a tank 

mix with Circon, on cereals (20 ml/ha, sugar beet (40 ml/ha), and sunflower (40 ml/ ha). 

Meanwhile, due to the absence of stress, productivity of agricultural crops was significantly 

higher than when herbicide was used alone. When fighting against the Colorado potato 

beetle in the absence of its stable population, the application rate of insecticide Akhtar, 

when used in combination with Siliplant, can be reduced from 60 to 20-30 g/ha, and usage 

of fungicides (Ridomil gold, Orlan, etc.) - by 2-2.5 times, from 2-2.5 to 1 kg/ha. 

Reduction of pesticide application rates is achieved due to the porous film that 

Siliplant forms on plant surface, which fixes the pesticide, diminishing its losses to the 

environment. The silicon contained in the product increases the inflow of insecticides and 

fungicides to the leaf plate and the rapidity of their transport to the point of action. In 

addition, the silicon has a direct effect on the cells of the fungus, causing their plasmolysis. 

It thickens the leaf blade and increases the mechanical strength of tissues. Such multilateral 

action of Siliplant allows for a significantly lower level of pesticides used, not only by 

reducing their amount, but also by reducing frequency of treatments. This concerns all 

agricultural crops, which require multiple pesticide treatments for growing, such as grapes, 

fruit, vegetables and others. 

These are just a few examples of the inefficiency of traditional technology, using 

only chemical pesticides, as compared with application of protective-stimulating 

complexes. 

The maximum yield gain of corn in the steppe zone of Russia, when the herbicide 

MaisTer (a.i. foramsulfuron + yodosulfuron-methyl-sodium + antidote isoxadifen-ethyl) 

(0.15 l/ha) was applied alone, achieved 33% relative to the yield in control. A mixture of 

MaisTer (herbicide use reduced by 30%) in combination with Circon (40 ml/ha) gave a 

67.5% gain. In addition, application of ofMaisTer in a tank mix with Circon enhanced 

protein content in crop production. 

Winter wheat, when only the herbicide Khlebodar (a.i. - 2,4-D ester + metsulfuronmethyl) 

was used (0.6 l /ha), enhanced yield by 12%, while the tank mixture of Khlebodar 

(with pesticide application rate reduced by 30%) with Circon (20 ml /ha) provided 

increase of yield by 39.6%. Treatment of wheat seeds with the fungicide Scarlet (a.i.

472 The use of protective stimulating complexes in the modern agricurtural technology 

tebuconazole +imazalil) 0.3 l/t gave a yield of 4.96 t/ha. The same pesticide mixture, but in 

tank mix with Siliplant (30 ml/t) gave the yield of 6.47 t /ha. 

The occurrence of root rot in the version without Siliplant reached 30-35%, when 

the fungicide was used in combination with Siliplant root rot was almost absent. 

The maximum yield gain on rapeseed,69%, was obtained when combined 

application of insecticide Citkor (a.i. cypermethrin) and Circon (40 ml/ha) was used. The 

increase in seed yield was due to increase of the number of pods (2.2 times) and mass of 

every seed in the pods (2.4 times). A significant enhancement of seed oil content (6.8%) 

has been observed in rapeseed, when plants were treated with Circon (from 35.1% to 

41.9%). 

Extremely important is the fact that 24-epibrassinolide, the active ingredient of the 

preparation Epin-Extra, being applied exogenously 3 days prior to application of 

pesticides, significantly reduces pesticide contamination of crops. This decrease is due to 

the activation of detoxification enzymes by Epin-Extra (Xia X.J.,, et al., 2009). 

According to the authors, 24-epibrassinolide in concentration of 0.1mmol reduces 

the level of pesticide residues (Chlorpyrifos, β-cypermethrin, Chlortalonil, Carbendazim) 

by as much as 70%. 

Application of the pesticide 2.4-D in combination with the preparation Epin (a.i. 24- 

epibrassinolide) in concentrations 0.075 and 0.1 mg/ l completely eliminates the toxic effect 

of the pesticide (5) (Voronina L., Malevannaya N. 2001). 

It is well known that plant damage caused by herbicides, inhibiting photosynthesis, 

results in the accumulation of reactive oxygen species such as superoxide radicals and 

singlet oxygen. These molecules, being accumulated in local areas, draw serious 

consequences. Thereupon it’s very important, that 24-epibrassinolide be applied 

exogenously at a dose 2 • 10 -6 mmol - 2 • 10 -5 mmol, reduces harmful effects of herbicides of 

s - triazine origin (4) (Pinol R., Simon E.. 2010). 

The usage of phenolic compounds, including hydroxycinnamic acids (a.i. of 

preparation Circon) as antimicrobial or antiseptic substances is known since 1867. These 

compounds are powerful antioxidants, and act as inhibitors of many fungal enzymes. It has 

been shown that they can be used not only for reducing of fungal growth but also for 

detoxification of mycotoxins that fungi produce (Wood M. 2006; Mahoney N. et al., 2010). 

Thus, caffeic and ferulic acidin concentration of 1mcg/mlreduced the mycotoxinfumonisin 

B1 level, produced by Fusariumverticilloides by 90 - 91% (Beekrum S. et al., 2003). 

Stimulation of innate plant immunity promotes induction of plant resistance not only 

to diseases but also to adverse environmental factors such as drought, overwetting, low and 

high temperature stress, salinity, pollution with heavy metals, radionuclides, toxic 

chemicals etc. 

Thus in dry 2010 summer application to sugar beet of Circon in tank mix with the 

herbicides (Sinbetan Expert OF (1.5 l/ ha) + Clethodim Plus Mix (0.7 l/ha) + Cleo (0.12 kg/ 

ha)) provided yield 25.0 -35.0 t /ha of sugar beet root-crops with sugar content exceeded 

22%.The same summer in the farms, where only herbicides were applied, the yield did not 

exceed 15.0 t/ha with an average yield 31.2 - 43.8 t/ha under normal weather conditions. 

Examples of plant cold resistance increasing due to Epin-Extra application are 

described in agronomic literature, and this is especially important for winter wheat 

growing. 

Previously the natural disease resistance inducers, stimulating plant immunity, 

accounted for a small part of the chemical pesticides usage. At present only in Europe their 

sales have been increased by 20-25%. The Stollercompany a huge international concern 

with main offices in the United States (Texas and Florida) and 15 offices around the world


from Canada and Latin America to Thailand and the Philippines, manufactures more than 

thirty products of such kind. 

The US Environmental Protection Agency (EPA) encourages the development and 

introduction of such preparations by, among other ways, simplifying and shortening 

research time required for the registration of this kind of preparations. Thus, if a traditional 

classical pesticide demands over 3 years for a full range of research studies, in case of these 

preparations, known as "biochemical pesticides", less than one year is enough. As they are 

of natural origin and being used in small amounts, it is not likely that their residues may be 

present in agricultural production in dangerous amounts. 

According to the US Environmental Protection Agency (EPA) requirements for 

manufacturers and users of chemical pesticides have been tightened. Many pesticides are 

excluded from the list of those permitted to be used. 

As for Russia, preparations, aimed at maintaining plant health and regulating plant 

growth by inducing complex of protective reactions in response to pathogens invasion and 

environmental stresses, have long been developed and manufactured. 

Our preparations are highly effective both in the traditional technology of 

agricultural production and in ecologically friendly technology of organic farming. They 

can be used for growing wholesome, healthy, and ecologically pure production even in 

adverse environmental conditions. 

REFERENCES 

Beekrum S., Govinden R., Padayachee T., Odhav B. (2003): Naturally occurring phenols: a 

detoxification strategy for fumonisin B1. Food Additives and Contaminants, 20:.490- 

493 

Mahoney N., Molyneux R.J., Kim J.H., Campbell B.C., Waiss A.C., and Hagerman A.E. (2010): 

Aflatoxigenesis induced inAspergillusflavus by oxidative stress and reduction by 

phenolic antioxidants from tree nuts. World Mycotoxin Journal, 3:49-57 

Pinol R., Simon E. (2010): Protective Effects of Brassinosteroids against Herbicides, in 

Brassinosteroids: A Class of Plant Hormone. Springer, pp. 309-344 

Voronina, L.P., Malevannaya N.N. (2001): Ecological Functions of Growth Regulators in 

Agrocenosis. In Soil as a Link Function of Natural and Anthropogenically-transformed 

Ecosystems. Abstracts Publication. Irkutsk, pp.173-174 

Wood M. (2006): Nuts' New Aflatoxin Fighter: caffeic acid? Agricultural Research, 54:9 

Xia X.J., Zhang Y., Wu J.X., Wang J.T, et al. ( 2009): Brassinosteroids Promote Metabolism 

of Pesticides in Cucumber. Journal of Agriculturaland FoodChemistry, 57: 8406-8413

474 INTEGRATED PEST MANAGEMENT


E N T O M O L O G Y

476 ENTOMOLOGY

Tatjana Cvrković, Jelena Jović, Milana Mitrović, Oliver Krstić, Ivo Toševski 477 

International Symposium: Current Trends in Plant Protection UDK: 632.731:575.22(497.11) 

Proceedings 

GENETIC VARIABILITY IN THRIPS TABACI (INSECTA: 

THYSANOPTERA) LIVING ON VEGETABLES IN SERBIA 

TATJANA CVRKOVIĆ * , JELENA JOVIĆ, MILANA MITROVIĆ, OLIVER KRSTIĆ, IVO TOŠEVSKI 


*e-mail: tosevski_ivo@yahoo.com 

Thrips tabaci Lindeman is an extensively distributed pest insect in many areas that affects 

plants through direct feeding and at the same time, it makes damage as a vector of a tospoviruses, 

Tomato spotted wilt virus (TSWV) and Iris yellow spot virus (IYSV). We analysed genetic variability 

of T. tabaci populations collected on five vegetable crops (leek, cucumber, bean, pepper and onion) in 

open field and greenhouse production in Serbia. Phylogenetic analyses based on sequence variation at 

a fragment of the mitochondrial cytochrome oxidase I gene, conducted by the neighbor-joining 

method indicate that all serbian samples belong to “leek-associated” lineage. Three different 

haplotypes were identified among two major subdivisions inside leek-associated lineage. Our 

analyses clearly indicate that genetic differentiation is not correlated with host plant preference inside 

leek-associated group. 

Key words: Thrips tabaci, onion thrips, molecular identification, vegetable crops, 

phylogenetic analysis, mitochondrial DNA, cytochrome oxidase subunit I 

INTRODUCTION 

The onion thrips, Thrips tabaci Lindeman belongs to the family Thripidae 

(Thysanoptera) and is widely distributed throughout the world. It is a highly polyphagous 

species that causes damages on tobacco, alliaceous crops, cabbage, and ornamental plants. 

The damage is caused either by feeding and by transmitting tomato spotted wilt 

virus (TSWV) and Iris yellow spot virus (IYSV), a tospoviruses with a wide host range that 

are capable of causing serious epidemics and crop losses. (Zawirska, 1976, Doi et al., 

2003). 

Some authors suggest that T. tabaci consists of several strains with different host 

preferences (Zawirska, 1976). On the other hand, it has been noted that ‘tabaci type’ is 

associated with tobacco plants and is vector of TSWV, while ‘communis type’ infest 

different host plants (but not tobacco) and couldn’t transmit this virus (Zawirska, 1976, 

Chatzivassiliou, 2002, Brunner et al., 2004). 

Morphological identification of thrips, both in adult and nymphal stages, is limited 

by polymorphism, and the high degree of similarity of various developmental stages 

(Brunner et al., 2002). Molecular identification, on the other hand, is not hampered by the

478 Genetic variability in thrips tabaci (Insecta : Thysanoptera) living on... 

above factors and can easily be followed. The use of genetic markers, like mtDNA, 

represents a valuable addition or alternative to classical methods of species identification. 

The development of molecular genetics techniques during the last two decades, 

particularly analysis of mitochondrial DNA (mtDNA), has substantially contributed to an 

understanding of natural genetic diversity and speciation issues (Moritz et al, 1987; Avise, 

1994). 

This study investigates the genetic variability of T. tabaci populations on different 

vegetable crops in Serbia, based on sequence variation of the mitochondrial cytochrome 

oxidase I (COI) gene. 


Insect collection. Specimens of Trips tabaci were collected on vegetables from 4 

sites in Serbia (Table 1): a) open field and greenhouse production area around village Donji 

Vrtogoš (near town Vranje, South Serbia) close to border with FYRO Macedonia, b) open 

field and greenhouse production area located around village Slance (about 10 km east from 

Belgrade); c) main greenhouse and open field production area located near town Ub 

(Central Serbia); d) open field bean production area in Zemun. 

Table 1. List of T. tabaci specimens collected for phylogenetic analyses 

Sample code Locality 

S8 Vranje 

S13 Zemun 

Lat/Long 

N42 29.192 

E21 49.190 

N44 51.32 

E20 22.625 

Host 

plant 

Collection date 

Accession 

No. 

cucumber 01-Sept-2010 JX275861 

bean 06-Aug-2010 JX275862 

S29 

Slanci 

N44 48.899 

E20 34.436 

leek 26-July-2011 JX275863 

S58 

Ub 

N 44 48 298 

E 20 34 228 

pepper 27-July-2011. JX275864 

S60 

Ub 

N 44 28 322 

E 20 01 278 

onion 27 -July-2011. JX275865 

DNA extraction, PCR amplification and sequencing. Total genomic DNA was 

extracted from a single specimen using the QIAGEN DNeasy extraction Kit (QIAGEN) 

following the manufacturer’s instructions. The mitochondrial cytochrome oxidase subunit I 

gene (COI) was chosen as the appropriate gene with good genetic resolution for 

differentiation at species level. Amplification for the barcode region of the COI gene 5′-end 

comprising 658 nucleotides (nt) (709 including primers) was performed using LCO1490 

and HCO2198 primers (Folmer et al., 1994). 

Polymerase chain reactions (PCR) contained High Yield Reaction Buffer A with Mg 

(1x), 2.25mM MgCl2, 0.6mM of each dNTP, 0.5 µM of each primer and 1U of KAPATaq 

DNA polymerase (Kapabiosystems) in a 20µL final volume. PCR cycles were carried out 

in a Mastercycler ep gradient S (Eppendorf) applying the following thermal steps with 

LCO1490/HCO2198 primer pair: 95°C for 5 min (initial denaturation), 35 cycles at 95 °C


for 1 min, 1 min at 54°C (annealing), 72°C for 2 min, and a final extension at 72°C for 10 

min. 

PCR products were purified using the QIAquick PCR-purification Kit (QIAGEN) 

according to the manufacturer’s instructions, and sequenced on automated equipment by 

Macrogen (Seoul, South Korea). Sequences for COI were obtained with the forward primer 

only. Comparison with sequences from GenBank were carried out using BLAST (Basic 

Local Alignment Search Tool) analyses (http://blast.ncbi.nlm.nih.gov/Blast.cgi). 

Phylogenetic analysis. Nine COI sequence data on T. tabaci submitted by Brunner et 

al. (2004) were obtained from the National Center for Biotechnology Information (NCBI) 

database and used for phylogenetic analysis employing the sequence data obtained in this 

study. The complete mitochondrion sequence data of T. palmi (AF378690) and T. 

angusticeps (AF378679) (Brunner et al, 2002) provided from GenBank served as an 

outgroups. Selected sequences were trimmed to 471 bp, the length of the shortest fragment. 

Multiple sequence alignment was done using ClustalW integrated in MEGA5 softwer 

(Tamura et al., 2011). Phylogenetic analysis was performed using the maximum-likelihood 

(ML) and neighbor-joining method. Five hundred bootstrap replicates were performed to 

assess branch support in the resulting tree topology. 

RESULTS 

Mitochondrial COI gene of T. tabaci individuals collected from five host plants in 

five localities were successfully amplified and sequenced (Table 1). The sequences are 

available from GenBank under accession numbers JX275861 to JX275865. 

COI sequencing yielded a 617 bp long fragment for four specimens and 571bp long 

fragment for one individual of T. tabaci. 

There were a total of 417 bp in final alignment, which corresponds to all sequences 

of T. tabaci, T. palmi and T. angusticeps. The COI sequences showed polymorphism at 18 

nucleotide positions (0.4%) among the five Serbian samples. All variations were in the 

form of silent, single base-pair substitutions, resulting in no amino-acid replacement. (Table 

2) 

Table 2. Variable nucleotide positions in the 471bp long COI fragment of T.tabaci 

Sequence 

code 

78 

87 

99 

114 

117 

189 

246 

Nucleotide position 

288 

S8 A G A A G A G C T T G G C C A A G T 

S58 . . . . . . . . . . . . . . . . . . 

S13 G . . . . . A . . . A . . . . . . . 

S29 . A G G A G A T C C . A T T G G A C 

S60 . A G G A G A T C C . A T T G G A C 

Phylogenetic trees were estimated using the neighbor-joining (NJ) and maximum 

likelihood method. Althoug their main stems showed the same pattern supported by high 

bootstrap values, we showed only the NJ tree in Figure 1. 

294 

307 

309 

321 

354 

363 

381 

384 

390 

399


100 

100 

99 

S8_T. tabaci 

73 

S58_T. tabaci 

94 

AY196831_T. tabaci H1 

64 

70 




S13_T. tabaci 



99 

S29_trips_T. tabaci 

72 

S60_trips_T. tabaci 

100 

60 

AY196847_T. tabaci T3 



AF378690_Thrips palmi 

L2 

L1 

T 

AF378679_Thrips angusticeps 

0.02 

Figure 1. Neighbor-joining tree based on 471 bp of the COI gene of T. tabaci. Branch lengths 

are proportional to the number of inferred character state transformation. Bootstrap values (500 

replicates) are indicated on the branches. T. palmi (AF378690) and T. angusticeps (AF378679) 

served as outgroups. The accession numbers show the sequence data of T. tabaci obtained from 

DNA databases. 

Three different haplotypes were identified among COI sequences from Serbia. All 

serbian samples belong to “leek-associated” lineage (L1 and L2), proposed by Brunner et 

al. (2004), while none of them belongs to tobacco-associated lineage (T). The NJ tree 

revealed two major subdivisions inside leek-associated lineage. Two haplotypes belong to 

Group 2 which corresponds to L2 group, while the third haplotype belongs to Group 1 

which corresponds to L1 group according to Brunner et al., 2004. Uncorrected pairwise 

distance between these two groups is about 0.4%, and between haplotypes inside Group 2 is 

0.7%. 

Two samples S8 and S58, collected on cucumber and pepper, respectively, showed 

100% similarity between each other and with H 1 of leek-associated group (AY 196831). 

Specimen S13 collected on bean indicate 100% similarity with H 5 (AY 196835), while 

samples S29 and S60, collected on leek and onion, respectively, showed 100% homology 

between each other and with H10 of leek-associated group (AY196840).


DISCUSSION 

Brunner et al. (2004), proposed three distinct major lineages (T, L1 and L2) in T. 

tabaci. They suggested that T is the tobacco-associated lineage, while L1 and L2 are the 

leek-associated lineages. 

In this study, we found three mitochondrial COI haplotypes inside leek associated 

lineage, while no samples belonging to tobacco-associated lineage. This is attributable to 

the fact that no sample was collected from host plants of the tobacco type as described in 

Zawirska (1976). Our analyses clearly indicate that genetic differentiation is not correlated 

with host plant preference inside leek-associated group. 

Chatzivassiliou et al. (2002) revealed that populations collected from tobacco 

transmitted TSWV efficiently (up to 48.5% transmission) and those from leek were poor 

transmitters (up to 3.1%). These facts show that the ability to transmit TSWV is closely 

linked to host preference. On the other hand, leek associated populations transmitted 

efficiently IYSV on onion (Chatzivassiliou et al., 2002). 

The biological relationship of T. tabaci with TSWV and IYSV seems to be more 

complicated than previously believed. The worldwide distribution of the T. tabaci 

populations in an extensive range of hosts may have generated specific associations with 

the tospoviruses that had an impact in their transmission. 

Both tospoviruses (IYSW and TSWV) are widely distributed in different host plants 

in Serbia (Bulajić et al, 2008, Bulajić et al, 2009, Stanković et al, 2012). The complicated 

relationship between tospoviruses and T. tabaci as well as the infection mechanisms 

involved in this pathosystem remains to be unsolved. Understanding the factors which 

determine the vector competence of T. tabaci populations may provide useful knowledge to 

manage tospovirus epidemics. However, further testing is required to correlate virus 

transmission with presence of different populations in T. tabaci. 


We thank the Ministry of Agriculture, Forestry and Water Management of the 

Republic of Serbia for supporting this programme in 2010 and 2011 (contract number 321- 

01-575/2011-11). This research was partly funded by grant III43001 from the Ministry of 


REFFERENCES 

1. Avise J.C. (1994): Molecular Markers, Natural History and Evolution. Chapman & Hall: New 

York. 

2. Brunner, P. C., Chatzivassiliou, E. K., Katis N. I., Frey J. E. (2004): Host-associated genetic 

differentiation in Thrips tabaci (Insecta; Thysanoptera), as determined from mtDNA 

sequence data. Heredity, 93: 364–370. 

3. Brunner P.C., Fleming C., Frey J.E. (2002): A molecular identification key for economically 

important thrips species (Thysanoptera: Thripidae) using direct sequencing and a PCR- 

RFLP-based approach. Agricultural and Forest Entomology, 4: 127–136. 

4. Bulajić, A., Jović, J., Krnjajić, S., Petrov, M.,Djekić, I., and Krstić, B. (2008): First report of 

Iris yellow spot virus on onion (Allium cepa) in Serbia. Plant Disease, 92(8):1247. 

5. Bulajić A. Djekić I, Jović J, Krnjajić S, Vučurović A, Krstić B (2009): Incidence and 

distribution of Iris yellow spot virus on onion in Serbia. Plant Disease, 93(10): 976-982.


6. Chatzivassiliou, E. K., Peters, D., Katis N. I. (2002) The efficiency by which Thrips tabaci 

populations transmit Tomato spotted wilt virus depends on their host preference and 

reproductive strategy. Phytopathology, 92: 603–609. 

7. Doi, M., Zen, S., Okuda, M., Nakamura, H., Kato K., Hanada K (2003): Leaf necrosis disease 

of lisianthus (Eustoma grandiflorum) caused by Iris yellow spot virus. Japanese Journal 

of Phytopathology, 69: 181–188 (in Japanese with English summary). 

8. Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. (1994): DNA primers for 

amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan 

invertebrates. Molecular Marine Biology and Biotechnology, 3: 294–299. 

9. Moritz C, Dowling TE, Brown WM (1987). Evolution of animal mitochondrial DNA: 

relevance for population biology and systematics. Annual Review of Ecology and 

Systematics, 18: 269–292. 

10. Stanković, I, Bulajić, A, Vučurović, A, Ristić, D, Milojević, K, Nikolić, D, Krstić, B (2012): 

First Report of Tomato spotted wilt virus Infecting Onion and Garlic in Serbia. Plant 

Disease, 96(6): 918. 

11. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. (2011): MEGA5: 

Molecular evolutionary genetics analysis using maximum likelihood, evolutionary 

distance and maximum parsimony methods. Molecular Biology and Evolution, 28: 2731- 

2739. 

12. Zawirska, I. (1976) Untersuchungen über zwei biologische Typen von Thrips tabaci Lind. 

(Thysanoptera, Thripidae) in der VR Polen. Archiv fur Phytopathologie und 

Pflanzenschutz, 12: 411–422.

Tatjana Cvrković, Phillipp Chetverikov, Biljana Vidović, Radmila Petanović 483 

International Symposium: Current Trends in Plant Protection UDK: 632.654.2:577.2(497.11) 

Proceedings 632.654.2:582.685.4(497.11) 

MOLECULAR ANALYSIS OF COI MTDNA IN PHYTOPTUS 

(PHYTOPTIDAE) AND ERIOPHYES (ERIOPHYIDAE) SPECIES 

ASSOCIATED WITH GALLS OF TILIA SPP. (TILIACEAE): 

PRELIMINARY RESULTS 

TATJANA CVRKOVIĆ *1 , PHILLIPP CHETVERIKOV 2,3 , BILJANA VIDOVIĆ 4 , 

RADMILA PETANOVIĆ 4 

1 

Institute for Plant Protection and Environment, Banatska 33, Zemun, Serbia; * e-mail: 

tanjacvrkovic@yahoo.com 

2 

Department of Invertebrate Zoology, Saint-Petersburg State University, Universitetskaya nab., 

7/9, 199034, St. Petersburg, Russia; 

3 Zoological Institute, Russian Academy of Sciences, Universitetskaya Embankment 1, 199034 

St. Petersburg, Russia; 

4 Department of Entomology and Agricultural Zoology, University of Belgrade, Faculty of 

Agriculture; 11080 Zemun, Nemanjina 6, Serbia; 

The occurrence of eriophyoid mite species inducing galls was observed on two most common 

Tiliaceae plants in the urban area of Belgrade: silver linden (Tilia tomentosa Moench) and largeleaved 

linden (Tilia platyphyllos Scop.). Morphological identification shows that Phytoptus 

tetratrichus Nalepa induces green warty galls on the upper side and erinea on the underside of T. 

tomentosa leaves, while Eriophyes tiliae (Pagenstecher) is associated with greenish nail galls on T. 

tomentosa and with reddish nail galls on T. platyphyllos. Molecular analyses of mitochondrial COI 

gene indicate that 2 different genotypes are present in P. tetratrichus. On the other hand, 

morphologically identified specimens of E. tiliae associated with greenish-yellow nail galls on T. 

tomentosa significantly differ from E. tiliae mites associated with red nail galls from T. platyphylos. 

Key words: Eriophyoidea, Phytoptus tetratrichus, Eriophyes tiliae, gall inducing mites, Tilia 

tomentosa, Tilia platyphylos, cytochrome oxidase subunit I 

INTRODUCTION 

The Tiliaceae plants are important components of the urban areas, city greenery and 

natural habitats of Serbia. The most abundant are silver linden (Tilia tomentosa Moench), 

large-leaved linden (Tilia platyphyllos Scop.) and small-leaved linden (Tilia cordata 

Miller). The caucasian linden (Tilia caucasica Rupr.) and american linden (Tilia americana 

L.) are rear in the Serbian flora (Josifović, 1972). 

Up to now, 21 species of eriophyoid mites are known to live on linden trees (Amrine 

and Stasny, 1994, Boczek and Szymkowiak, 1997). Amongst them, gall-inducing species 

such as a complex of morphologically close Eryophyes and Phytoptus species are the most 

frequently recorded.

484 Molecular analysis of COI mtDNA in Phytoptus (Phytoptidae) and... 

Some authors hypothesized that Eryophyes and Phytoptus mites can cause various 

types of injury on Tilia species, which differ depending of the mite species-host plant 

interaction. Eriophyes spp. can cause greenish or reddish nail galls with a pointed or a 

rounded tip, vein angle galls with outer hear, vein erinea, or hairy patches (shallow erinea) 

on both upper and undersurface of leaves. Phytoptus spp. can cause pouch shaped leaf galls, 

margin rolls (leaf bulges, leaf edge curl) and small round erinea on the lower leaf surface 

and small wart-like galls on the upper leaf surface. Mite taxa causing different symptoms or 

similar symptoms on different plant species have been treated as separate species or 

subspecies. 

Moreover, morphological differences between protogyne and deutogyne forms of 

Phytoptus tetratrichus Nalepa inhabiting T. cordata, T. tomentosa and T. americana, as 

well as between samples of these mites in different seasons have been found (Soika and 

Kozak, 2011). Similar observations related with Eriophyes spp. have been done (Soika and 

Kozak, in press). 

Bearing in mind that the taxonomical status of different entities inhabiting different 

Tilia spp. is still not clear, the aim of this study was to start preliminary research of 

eriophyoid species associated with most frequent galls on silver linden and large-leaved 

linden in urban area of Belgrade using molecular marker COI mtDNA in order to obtain 

results which will help to clarify this taxonomic problems. 


Field research on the occurrence of eriophyoid mites inducing galls was conducted 

in 2011. Silver linden (T. tomentosa) and large-leaved linden (T. platyphyllos) trees 

growing in the urban area of Belgrade were observed for galls presence. Leaves with galls 

or other visible symptoms of infestation by mites were collected for detailed analysis. The 

collected leaves were placed in plastic bags and transported in an ice box to the laboratory 

where they were stored at 4°C until the examination. Ten galls of each sample were 

examined in the laboratory under a stereomicroscope. Individuals collected from galls were 

separated into two groups: for the morphological and molecular species identification. 

Morphological study. The morphology of species was examined using a phasecontrast 

microscope LEICA DMLS (Hi-plan phase objectives x10, x40 and x100). Prior to 

light microscopy mites were examined directly under a dissection stereo-microscope MBS- 

9, then picked up by a fine pin, mounted on microscope slides in Hoyer’s medium 

(Dobrivojević and Petanović,1982), and cleared on a heating block at 70ºC for 3hours. 

DNA extraction, PCR amplification and sequencing. Specimens provided for molecular 

identification were preserved in 96% ethanol and stored at 4°C until DNA extraction. Total 

DNA was extracted from 15-20 whole specimens, using the QIAGEN Dneasy® Blood & 

Tissue Kit, following the manufacturer’s instructions, with modification according to 

Dabert et al. 2008. 

A fragment of 658 bp of the mitochondrial cytochrome oxidase subunit I gene (COI) 

was amplified using the primers LCO1490 (5`-GGTCAACAAATCATAAAGATATTGG- 

3`) and HCO2198 (5`-TAAACTTCAGGCTGACCAAAAAATCA-3`) (Folmer et al., 

1994). 

Polymerase chain reactions (PCR) contained High Yield Reaction Buffer A with Mg 

(1x), 2.5mM MgCl2, 0.6mM of each dNTP, 0.5 µM of each primer and 1U of KAPATaq 

DNA polymerase (Kapabiosystems) in a 25µL final volume. PCR cycles were carried out 

in a Mastercycler ep gradient S (Eppendorf) applying the following thermal steps: 95°C for


5 min (initial denaturation), 35 cycles at 94 °C for 1 min, 1 min at 54°C (annealing), 1 min 

30 s at 72°C, and a final extension at 72°C for 7 min. 

PCR amplicons were purified using the QIAquick PCR-purification Kit (QIAGEN) 

according to the manufacturer’s instructions, and sequenced on automated equipment by 

Macrogen (Seoul, South Korea) with the same primer pairs as in the initial PCR procedure. 

Sequencing was performed with both primers to obtain sequences of full-length PCR 

products (658 bp). 

Sequence alignment. Sequences were edited with FINCHTV v.1.4.0 (www. 

geospiza.com) and aligned with CLUSTALW integrated in MEGA5 (Tamura et al., 2011). 

A neighbor joining phylogeny was reconstructed with MEGA5. Five hundred bootstrap 

replicates were performed to assess branch support in the resulting tree topology. Inter- and 

intraspecific uncorrected pairwise genetic distance calculations between nucleotide 

sequences were computed using p-distance model for all codon positions with MEGA 5 

software. 

RESULTS 

On silver linden in the urban area of Belgrade, two types of galls caused by 

eriophyoid mites were found: i.) green warty galls on the upper side and erinea on the 

underside of leaves (Picture 1) and ii.) greenish-yellow nail galls on the upper surface of the 

leaf. (Picture 2) 

On large-leaved linden red pointed nail galls on the upper surface of the leaf were 

monitored. (Picture 3) 

Picture 1. Green warty galls on the the upper surface and erinea on the lower 

surface of T. tomentosa leaf induced by P. tetratrichus.


Picture 2. Greenish-yellow nail galls on the 

upper leaf surface induced by E. tiliae on T. 

tomentosa. 

Picture 3. Red pointed nail galls on the upper 

leaf surface induced by E. tiliae on T. 

platyphyllos. 

Morphological study. Two species of eriophyoid mites belonging to Phytopus and 

Eriophyes genera, inducing deformations (malformations) on linden leaves were present. 

According to morphological characteristics they fitted to the diagnoses of Phytoptus 

tetratrichus associated with warty galls on T. tomentosa, and Eriophyes tiliae 

(Pagenstecher) associated with nail galls on both T. tomentosa and T. platyphyllos. 

Molecular study. Molecular analyses were performed on four groups of P. 

tetratrichus and one group of E. tiliae on T. tomentosa as well as on one group of E. tiliae 

on T. platyphyllos (Picture 4). A fragment of 658bp of mitochondrial COI gene were 

successfully amplified and sequenced. Mitochondrial COI sequence of Tetranychus urticae 

(AJ316606) (Navajas and Boursot, 2003) was used as distant outgroup. 

Four COI sequences of P. tetratrichus represent 2 different genotypes that vary 

significantly (about 12%). Molecular analyses of E. tiliae indicate that mites associated 

with greenish-yellow nail galls on T. tomentosa differ (about 9%) from mites associated 

with red nail galls from T. platyphylos.


100 

PT_Tilia tomentosa 

100 

100 



Phytoptus tetratrichus 


100 

ET_Tilia tomentosa 

ET_Tilia platyphyllos 

Eriophyes tiliae 

Tetranychus urticae_AJ316606.1 

0.05 

Picture 4. Phylogenetic tree constructed using the Neigbor-Joining method of MEGA v5.05 for 

mitochondrial COI sequences of P. tetratrichus and E. tiliae. Abbreviations, names and 

GenBank accession number of the outgroup are indicated. Bootstrap values are indicated on the 

branches. 

DISCUSSION 

Previous research revealed that P. tetratrichus occurring on linden trees can induce 

two gall types on different linden species. For example, the catalogue of de Lillo (2004) 

suggests that P. tetratrichus causes margin rolls along the edges of T. cordata leaves, 

whereas warty galls on the upperside and erinea on underside of T. tomentosa leaves were 

registered (Boczek, 1961, Petanović and Stanković, 1999, Soika and Kielkiewicz, 2004, 

Soika, 2006). In our observation a numerous green warty galls on the upper side and erinea 

on the underside of leaves were present. 

E. tiliae create distinctive galls on different linden species (Buchta et al, 2006). Galls 

induced by E. tiliae on T. cordata leaves are cone-shaped, while on T. platyphyllos the galls 

are elongated, with a rounded or pointed tip, which may be erect, oblique or curved. 

Variations in color can be from greenish yellow to pink or red (Soika, 2006). Our study 

indicates that E. tiliae is associated with elongated and pointed greenish-yellow nail galls 

on the upperside of T. tomentosa leaves. On T. platyphylos E. tiliae induces elongated and 

oblique red distortions, rising up from the upper surface of the leaves. 

Preliminary results showed that at least two different genotypes are present in P. 

tetratrichus and E. tiliae populations associated with lindens. To clarify the relationships 

within Phytoptus and Eriophyes complexes of species associated with different linden 

species, and their evolutionary diversification, more molecular data from other Tilia species 

and diverse geographical regions would be needed. 


This research was funded by grant III43001 from the Ministry of Education and 

Science of the Republic of Serbia.


REFFERENCES 

1. Amrine, J.W. Jr. & Stasny, T.A. (1994): Catalog of the Eriophyoidea (Acari: Prostigmata) of 

the world. Indira Publishing House, West Bloomfield, Michigan, U.S.A.,798 pp. 

2. Boczek, J. (1961): Badania nad roztoczami z rodziny Eriophyidae (Szpecielowate) w Polsce. 

I. [Studies on mites of family Eriophyidae in Poland I]. Prace Instytutu Ochrony Roślin, 

Poznań, Poland, 3 (2), 5–85. 

3. Boczek, J., Szymkowiak P. (1997): Studies on Eriophyoid Mites (Acari: Eriophyoidea). 

XXIV. Bull. Pol. Acad. Sci. Biol. 45: 35.40. 

4. Buchta, I., Kula, E., Krestanpolova, M. (2006): Occurrence variations and spatial distribution 

patterns of Eriophyes tiliae (Pgst.) (Acari, Eriophyidae) subspecies in the urban 

environment. Journal of Forest Science. 52(12): 547-555. 

5. Dabert, J., Ehrnsberger, R. & Dabert, M. (2008): Glaucalges tytonis sp. n. (Analgoidea, 

Xolalgidae) from the barn owl Tyto alba (Strigiformes, Tytonidae): compiling 

morphology with DNA barcode data for taxon descriptions in mites (Acari). Zootaxa, 

1719: 41–52. 

6. de Lillo, E. (2004): Fauna Europaea: Eriophyoidea. Fauna Europaea version 1.1, 

http://www.faunaeur.org (accessed 3 September 2010). 

7. Dobrivojević, K., Petanović, R. (1982): Fundamentals of Acarology. Slovo Ljubve 

Publishing, Belgrade, Serbia, 284 pp. [in Serbian]. 

8. Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. (1994): DNA primers for 


invertebrates. Molecular Marine Biology and Biotechnology, 3: 294–299. 

9. Josifović, M. (1972): Flora SR Srbije III. Srpska akademija nauka i umetnosti, Beograd. 

10. Navajas M, Boursot P (2003) Nuclear ribosomal monophyly versus mitochondrial DNA 

polyphyly in two closely related mite species: the influence of life history and molecular 

drive. Proceedings of the Royal Society of London. Series B, Biological Sciences, 270: 

124–127. 

11. Petanović, R., Stanković, S. (1999): Catalog of the Eriophyoidea (Acari: Prostigmata) of 

Serbia and Montenegro. Acta Entomologica Serbica (special edition), 1–143. 

12. Soika, G. (2006): Eriophyoid mites (Acari: Eriophyoidea) occurring on lime trees in 

ornamental nurseries. Biological Lett., 43(2): 367-373. 

13. Soika, G., Kielkiewicz, M. (2004): Occurrence of Phytoptus tetratrichus (Nalepa) (Acari: 

Eriophyoidea) and differences in the morphology of leaf galls on two linden species. 

Phytophaga 14: 615.622. 

14. Soika, G. Kozak, M. (2011): Problems with the taxonomy of Phytoptus tetratrichus Nalepa 

1890 (Acari: Eriophyoidea) inhabiting Tilia spp.: Analysis based on morphological 

variation among individuals. Zootaxa 2988: 37–52. 

15. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. (2011): MEGA5: 

Molecular evolutionary genetics analysis using maximum likelihood, evolutionary 

distance and maximum parsimony methods. Mol. Biol. Evol., 28: 2731-2739.

Snježana Hrnčić, Sanja Radonjić, Tatjana Perović, Katja Žanić, Marisa Škaljac 489 


Proceedings 

THE CURRENT STATUS OF THE TOBACCO WHITEFLY - 

BEMISIA TABACI (GENNADIUS) 

(HEMIPTERA:ALEYRODIDAE) IN MONTENEGRO 

SNJEŽANA HRNČIĆ 1 , SANJA RADONJIĆ 1 , TATJANA PEROVIĆ 1 , KATJA ŽANIĆ 2 , 

MARISA ŠKALJAC 2 

1 University of Montenegro, Biotechnical faculty, Podgorica, Montenegro, 

2 Institute for Adriatic Crops and Karst Reclamation, Split Croatia 

All developmental stages of the tobacco whitefly Bemisia tabaci (Gennadius) were found for 

the first time in Montenegro (Podgorica) in the middle of May in 2008 on the Hibiscus sp. in 

Podgorica. In order to determine the presence of B. tabaci on other locations and host plants, visual 

examinations in greenhouses and open fields were conducted in the area of inland (Podgorica) and 

coastal (Bar, Tivat and Ulcinj) Montenegro, during 2008 – 2011 on ornamentals and vegetables. 

Lower side of the leaves was examined to find out whether pre-adult stages of B. tabaci were present. 

The presence of B. tabaci was confirmed in the greenhouses in Podgorica (during the whole 

monitoring period), Bar, Ulcinj and Radanovići (Tivat). B. tabaci was found on nine ornamentals, 

belonging to five botanical families: Hibiscus sp. and Abutilon sp. (Malvaceae); Lippia citriodora, 

Lantana camara, Tumbergia sp. and Verbena sp. (Verbenaceae), Euphorbia pulcherrima 

(Euphorbiaceae); Gerbera jamesonii (Asteraceae) and Dipladenia sanderi (Apocynaceae); on a weed 

species – Sonchus oleraceus (Asteraceae). In vegetables, it was found exclusively on melon – 

Cucumis melo (Cucurbitaceae), in the fall of 2011 in an open field near Ulcinj, while in greenhouses, 

B. tabaci was never found on vegetables. 

Key words: Bemisia tabaci, distribution, host plant, Montenegro, tobacco whitefly. 

INTRODUCTION 

Bemisia tabaci (Gennadius) was described in Greece over 100 years ago and has 

since become one of the most important pests worldwide in subtropical and tropical 

agriculture. It is a pest in the greenhouses and open fields, which adapts easily to new host 

plants and geographical regions (Oliveira et al., 2001). In recent years, international 

transport of plant material have contributed to it’s geographical spread. It is considered one 

of the world’s top 100 invasive species (International Union and Conservation of Nature 

and Natural Resources (IUCN)) list (http://www.issg.org). 

Bemisia tabaci is extremely polyphagous, feeding on more than 700 host plant 

species within 86 botanical families (Fekrat and Shishehbor, 2007). It causes damage to 

numerous vegetable crops such as tomato, tobacco, eggplant, pepper, beans, cucumber, 

melon, and ornamental plants, especially Euphorbia pulcherrima. Adults and larvae feed by 

sucking the phloem sap and can cause damage directly and indirectly by excretion of

490 The current status of the tobacco whitefly – Bemisia tabaci (Gennadius),.. 

honeydew onto the leaf surface. Sooty mold fungi, using honey dew as a substrate, colonize 

contaminated surfaces, further interfering with photosynthesis, which ultimately results in 

reduced crops and fruit quality. In addition, B. tabaci indirectly transmits several 

economically devastating viruses (Brown, 2007). In general, it vectors 111 virus species in 

several genera: Begomovirus (Geminiviridae), Crinivirus (Closteroviridae) and Ipomovirus 

(Potyviridae) (Jones, 2003; Helmi, 2011; Huipeng et al., 2012). Important aspect of B. 

tabaci is high genetic variability that exists among its populations (Iida et al., 2009). This 

species complex includes 30 morphologically indistinguishable species (previously known 

as biotypes) (Teng et al., 2010; Dinsdale et al., 2010; Hu et al., 2011; Alemandri et al., 

2012). In general, species in B. tabaci are primarily distinguished based on genetic markers 

and not on the base of biological characteristics; therefore the term biotype is inadequate 

and misleading. Finally, the biotype terminology was needed to be changed (De Barro et 

al., 2011). The world’s two most widespread members of the B. tabaci species complex are 

the Middle East-Asia Minor 1 (MEAM1, known as B biotype) and Mediterranean (MED, 

known as Q biotype). MEAM1 and MED became global invaders and the most damaging, 

due to the ornamental plants trade (De Barro and Ahmed, 2011). They are known for their 

wide host range, high fecundity, insecticide resistance and ability to transmit plant viruses 

and induce plant disorders (Brown et al., 1995; Secker et al., 1998; Perring, 2001). 

Bemisia tabaci is spread in most of Mediterranean countries. Among countries of the 

region, B. tabaci was found in Croatia (Žanić et al., 2001) and Bosnia and Herzegovina 

(Ostojić and Zovko 2008) in greenhouses, as well as in the open field. In 2008 it was found 

for the first time in Montenegro on ornamental plants in a greenhouse near Podgorica. In 

the fall of 2011, it was found on melon in an open field near Ulcinj which is the first 

finding of this species on a vegetable crop in Montenegro. Škaljac et al. (2010) and Škaljac 

et al. (2012) conducted research on the presence of B. tabaci species in Montenegro, where 

both MEAM1 and MED groups were confirmed. 


In the period from 2008 to 2011 several times during summer months (June – 

September) lower side of leaves of ornamental and vegetable plants, in the area of 

Podgorica and at Montenegrin seaside were visually examined for the presence of pre-adult 

stages of B. tabaci. 

In 2008 one greenhouse with ornamental plants, and also one with vegetable plants 

(cucumber, tomato and pepper) in the area of Podgorica were examined. 

In 2009 ornamental plants in two greenhouses in the area of Podgorica, two 

greenhouses in the Bar area, one greenhouse in the area of Ulcinj and two in the area of 

Tivat, were examined. At the same time, examinations of vegetable plants in two 

greenhouses (tomato) in Zeta area (Podgorica), two greenhouses in the area of Ulcinj 

(tomato and cucumber) and one greenhouse in Tivat area (tomato) were conducted. 

In 2010 and 2011 besides the greenhouses examined in 2009, one more greenhouse 

with ornamental plants in Ulcinj area and one greenhouse with vegetable plants (tomato, 

cucumber) in Bar area were included in examination, as well as one tomato and melon crop, 

but only in 2011. 

The leaves on which presence of larvae, pupae and exuvium were observed were 

examined under stereomicroscope (ZEISS DISCOVERY V12) in the laboratory. EPPO 

Diagnostic protocols for regulated pests (OEPP/EPPO, 2004 by Malumphy) were used in 

morphological determination of B. tabaci.


RESULTS 

Based on morphological properties of certain development stadiums, particularly 

pupa and exuvium, the presence of B. tabaci was confirmed. 

Adults are small, with yellow colored body, not more than 1 mm long. The males 

are slightly smaller than the females. The whole body, particularly wings, is covered with 

white powdery wax. At rest, the wings are roof positioned and closely pressed to the body 

(Figure 1). Eggs are laid in piles or in circular groups, vertically on lower side of leaves. 

They are anchored to the leaves by a short pedicel. When first laid, eggs are light yellow 

and become brown at the end of embryonic development (Figure 2). Larval body is flat, 

oval. It is 0.3 mm long in first stage larvae and 0.6 mm in fourth stage larvae. On third and 

fourth stage larvae red eyes are visible (Figure 3). Pupae are yellow, convex, about 0.7 mm 

long. Body margin is irregularly shaped depending on leaf structure of the feeding plant 

(Figure 4). 

Figure 1: Adult of B. tabaci 

Figure 2: Eggs of B. Tabaci 

Figure 3: B. tabaci larvae and pupa 

Figure 4: B. tabaci Pupae and exuvium 

The presence of B. tabaci in Montenegro was firstly observed in the middle of May 

in 2008 on hibiscus in a residential building in Podgorica. Adults, larvae, pupae and 

exuvium were observed on the leaves which indicated that the species completed the 

development cycle on the hibiscus.


Table 1. Recorded host plants and finding locations of Bemisia tabaci in Montenegro 

Year 

2008 

2009 

2010 

2011 

Locations and host plant 

Podgorica greenhouse: Hibiscus sp. (Malvaceae), Abutilon sp. (Malvaceae), Lippia 

citriodora (Verbenaceae), Lantana camara (Verbenaceae), Tumbergia sp. (Acanthaceae), 

Sonchus oleraceus (Asteraceae) 

Podgorica open field: Lantana camara and Verbena sp. 

Podgorica greenhouse: Abutilon sp., Lantana camara, Lippia citriodora, Sonchus 

oleraceus 

Tivat- Radanovići greenhouse: Abutilon sp. 

Bar greenhouse: Euphorbia pulcherrima (Euphorbiaceae) 

Podgorica greenhouse: Abutilon sp., Lippia citriodora 

Bar greenhouse: Euphorbia pulcherrima 

Podgorica greenhouse: Abutilon sp., Lippia citriodora, Sonchus oleraceus 

Bar 1 greenhouse: Dipladenia sanderi (Apocynaceae) 

Bar 2 grennhouse: Dipladenia sanderi, Lantana camara, Euphorbia pulcherrima, Gerbera 

jamesonii (Asteraceae) 

Ulcinj greenhouse: Dipladenia sanderi 

Ulcinj open field: Cucumis melo (Cucurbitaceae) 

Figure 5: Distribution of B. tabaci in Montenegro


Origin of B. tabaci is not familiar, however concerning that most of ornamental 

plants are imported from Italy, it was probably introduced by this way. In the following 

years of monitoring, the presence of tobacco whitefly was confirmed in the area of 

Podgorica and Montenegrin seaside. Localities and host plants on which the whitefly was 

found are presented in Figure 5 and Table 1. B. tabaci was not found on vegetable plants in 

greenhouses. 

DISCUSION 

Monitoring results show that in the area of Podgorica B. tabaci was found in one 

greenhouse with ornamental plants in all observation years. However, range of hosts on 

which it was found did not change, although literature data suggest that it is pronouncedly 

polyphagous and adaptable species (Oliveira et al., 2001; Fekrat and Shishehbor, 2007). 

The reason for this might be continual application of control measures on one side, and 

absence of annual herbaceous plants which would be favourable hosts, and difficulties in 

adaptation to climatic conditions in Podgorica on the other side. The fact that in September 

2008 B. tabaci was found on Lantana camara and Verbena sp. on a balcony in Podgorica 

and that on the same hosts and locality in the following year it was not present suggests that 

this species does not easily adapt to climatic conditions of Podgorica. This indicates that B. 

tabaci cannot survive in outdoor conditions in Podgorica. 

In the period, from 2009 to 2011, B. tabaci was found at new locations at 

Montenegrin seaside (Tivat- Radanovići, Bar, Ulcinj) and on new hosts. Euphorbia 

pulcherrima was recorded as the most common host at seaside which is in agreement with 

literature data that suggest that this ornamental species is one of the most preferable hosts 

(Žanić, 2001), and therefore it is used as a trap plant (Šimala and Masten, 2003). During 

2011 out of five localities at which B. tabaci was found, at three localities Dipladenia 

sanderi was recorded as favourable host plant. This ornamental is exclusively comes to 

Montenegro by international trade which indicates that import of plant material is the cause 

of B. tabaci introduction in new areas (Oliveira, 2001). 

Although the subject of this paper was not genetic variability of B. tabaci, in the 

research conducted by Škaljac et al. (2010) it was found that B. tabaci collected from 

Hibiscus sp. in 2008 in Podgorica belonged to MEAM1 genetic group, while in Croatia and 

Bosnia and Herzegovina MED group of B. tabaci was only found. In 2011, both MEAM1 

and MED B. tabaci species were found in Montenegro. MEAM1 was found again in 

Podgorica and infested Sonchus oleraceus, while MED group infested Dipladenia sanderi 

in Bar and Ulcinj (Škaljac et al., 2012). MED group of B. tabaci infested melon in the open 

field in 2011 near Ulcinj (Škaljac, pers. comm.). These results suggest that B. tabaci was 

introduced to Montenegro on several occasions. 

Concerning that in September 2011 B. tabaci was found for the first time on melon 

in an open field, in a period to come special attention will be paid to spreading of this 

species on other vegetable crops, and eventual presence of a virus it transmits. 


This study was partially funded by Ministry of Science, Montenegro „Newly 

introduced invasive pests in the plant production of Montenegro“ and the the grant 

„Whiteflies (Aleyrodidae), viruses that they transmit and Mediterranean fruit fly

Teng, X., Fang-Hao, W., Dong, C. (2010): Florida Entomologist, 93(3), 363-368. 


(Tephritidae) in horticulture of Croatia and Montenegro“ (Bilateral research collaboration, 

Montenegro: Croatia). 

REFERENCES 

Alemandri, V., De Barro, P., Bejerman, N., Argüello Caro, E.B., Dumon, A.D., Mattio, M.F., 

Rodriguez, S.M., Truol, G. (2012) Species Within the Bemisia tabaci (Hemiptera: 

Aleyrodidae) Complex in Soybean and Bean Crops in Argentina. Journal of Economic 

Entomology 105, 48–53. 

Brown, J.K., Frohlich, D.R., Rosell, R.C. (1995) The tobaco or silverleaf whiteflies: biotypes of 

Bemisia tabaci or a species complex? Annual Review of Entomology 40, 511–534. 

Brown, J. (2007): The Bemisia tabaci Complex: Genetic and Phenotypic Variability Drives 

Begomovirus Spread and Virus Diversification, Online. APSnet Features. doi: 

10.1094/APSnetFeature-2007-0107. 

De Barro J, Liu S, Boykin L, Dinsdale A (2011) Bemisia tabaci: a statement of species status. 

Annual Review of Entomology 56: 1-19. 

De Barro P, Ahmed MZ (2011): Genetic Networking of the Bemisia tabaci Cryptic Species 

omplex Reveals Pattern of Biological Invasions. PLoS ONE 6(10): e25579. 

doi:10.1371/journal.pone. 0025579. 

Dinsdale, A.; Cook, L.; Riginos, C.; Buckley, Y. M.; De Barro, P. (2010): Annals of the 

Entomological Society of America, 103 (2) , pp. 196-208(13). 

Fekrat, L., Shishehbor, P. (2007): Some biological features of cotton whitefly, Bemisia tabaci 

(Homoptera: Aleyrodidae) on varius host plant, pakistan Journal of Biological Sciences 

10(18), pp 3180-3184 

Helmi, A. (2011): Host-Associated Population Variatioons of Bemisia tabaci (Genn.) 

(Hemiptera; Sternorryncha: Aleyrodidae) Characterized with Random DNA 

Markers,International Journal of zoological Researcch 7(1): 77-84 

Hu, J., De Barro, P., Zhao, H., Wang, J., Nardi, F. & Liu, S.S. (2011): An Extensive Field 

Survey Combined with a Phylogenetic Analysis Reveals Rapid and Widespread Invasion 

of Two Alien Whiteflies in China. PLoS ONE 6(1): e16061. 

doi:10.1371/journal.pone.0016061. 

Huipeng, P., Xianchun, L., Daqing ,G., Shaoli, W., Qingjun, W., Wen, X., Xiaoguo, J., Dong, 

C., Baiming L., Baoyun X., Youjun Z., (2012): PLoS One.; 7(2): e30760. Published 

online 2012 February 23. doi: 10.1371/journal.pone.0030760. 

Iida, H.,, Kitamura, T., Honda, K. (2009): Appl. Entomol. Zool. 44 (2): 267–273. 

Jones , D. (2003): Plant viruses transmitted by whiteflies. Eur J Plant Pathol 109: 195–219. 

OEPP/EPPO (2004): Diagnostic protocols for regulated pests, OEPP/EPPO Bulletin 34, 155– 

157. 

Oliveira, M.R.V., Henneberry, T.J., Anderson, P. (2001): History, current status, and 

collaborative research projects for Bemisia tabaci, Crop Protection 20, 709–723. 

Ostojić, I., Zovko, M. (2008): Duhanov štitasti moljac - Bemisia tabaci (Gennadius), novi član 

entomofaune u BiH, V Simpozijum o zaštiti bilja u Bosni i Hercegovini - Sarajevo, 16- 

18. decembar 2008. godine. 

Perring, T.M. (2001) The Bemisia tabaci species complex. Crop Protection 20, 725–737. 

Secker, A.E., Bedford, I.A., Markham, P.G. & William, M.E.C. (1998) Squash, a reliable field 

indicator for the presence of B biotype of tobacco whitefly, Bemisia tabaci. pp. 837–842 

in Brighton Crop Protection Conference-Pests and Diseases Farnham, UK, British Crop 

Protection Council.


Šimala, M., Masten, T. (2003): The results of the monitoring of tobacco whitefly Bemisia tabaci 

(Gennadius, 1889), (Homoptera: Aleyrodidae) during 2001. and 2002. in Croatia, 

Zbornik predavanj in referatov 6. slovenskega posvetovanja o varstvu rastli, pp 493-497 

Škaljac, M., Žanić, K., Goreta Ban, S., Kontsedalov, S., Ghanim, M. (2010): Co-infection and 

localization of secondary symbionts in two whitefly species. BMC Microbiology 10, 

142. 

Škaljac, M., Žanić, K., Hrnčić, S., Radonjić, S., Perović, T., Ghanim, M. (2012): Diversity and 

localization of bacterial symbionts in three whitefly species (Hemiptera: Aleyrodidae) 

from the east coast of the Adriatic Sea, Bulletin of Entomological Research, 

doi:10.1017/S0007485312000399. 

Žanić, K., Kačić, S., Katalinić, M. 2001. Duhanov štitasti moljac - Bemisia tabaci 

(Gennadius,1889). Glasilo biljne zaštite, 6: 313-318.

496 Invasive mosquito species in Europe and Serbia, 1979 - 2011 


Proceedings UDK: 595.771(497.11)”1979/2011” 

INVASIVE MOSQUITO SPECIES IN EUROPE AND SERBIA, 

1979 - 2011 

PETRIĆ DUŠAN 1 , ZGOMBA MARIJA 1 , IGNJATOVIĆ ĆUPINA ALEKSANDRA 1 , 

MARINKOVIĆ DUŠAN 1 , BELLINI ROMEO 2 , SCHAFFNER FRANCIS 3 AND IGOR PAJOVIĆ 4 

1 Laboratory for medical and veterinary entomology, Faculty of Agriculture, 

University of Novi Sad, 21000 Novi Sad, Serbia 

2 Centro Agricoltura Ambiente “G. Nicoli”, 40014 Crevalcore (BO), Italy 

3 

Avia-GIS Agriculture &Veterinary Information & Analysis; Institute of Parasitology, 

University of Zurich, Zurich, Switzerland 

4 

University of Montenegro, Biotechnical Institute, Mihaila Lalića 1., Podgorica, Montenegro 

People’s increased mobility and international trade play important roles in the dissemination 

of vectors and the pathogens that they could transmit. Climate change is likely to become another 

important consideration in the near future. The responses of insects to these changes (in addition to 

potential for increased vector capacity) could allow for a broadening of their colonized areas and the 

invasion of new sites. In the last couple of years a number of pathogen introductions into Europe have 

been recorded. The latest (Ravenna, Italy, 2007) was caused by the tropical Chikungunya virus, which 

is transmitted by the “Asian tiger mosquito”, a species introduced into Europe in 1979 (Albania), and 

then Italy in 1990. Invasion continued to France in 1999 and until present, Belgium, Montenegro, 

Greece, Switzerland, Croatia, Spain, Bosnia and Herzegovina, the Netherlands, Slovenia, Germany, 

Serbia, Bulgaria and Turkey have been invaded. Deciphering the true cause of changes in the 

distribution of mosquitoes is difficult and complex and depends, to a great extent, on the availability 

of data obtained by monitoring. In order to assist in vector-borne disease preparedness, distribution of 

the most important invasive species St. albopicta in Europe and particulars of findings in Serbia are 

conferred. 

Key words: invasive mosquito species, St. albopicta, Ae. albopictus, Asian tiger mosquito 

INTRODUCTION 

The Asian tiger mosquito is on a rampage. Entomologists are impressed, public 

health officials are nervous, and many of the rest of us are swatting furiously (Enserink, 

2008). Present-day human activities enable the transportation of mosquitoes from one 

continent to another within a matter of hours to a few days. International trade and the 

increased transcontinental mobility of humans facilitate the dispersal and, in some cases, 

the establishment of exotic mosquito species in other countries with favourable climatic 

conditions. Exotic species are thus shuttled from their native geographic ranges to recipient 

biotopes where they have never been present before. If some of these exotic species possess 

mechanisms that allow them to adapt to the new conditions and reproduce in the recipient 

ecosystem, they are termed “invasive”.

Petrić Dušan, Zgomba Marija, Ignjatović Ćupina Aleksandra,... 497 

Human activities have initiated the spread of invasive mosquito species and vectorborne 

diseases (a disease that is transmitted to humans or other animals by an insect or 

other arthropod), and ongoing globalization and increases in air temperature are greatly 

accelerating the process. As a result, many vector introductions into Europe have been 

reported since the end of the old millennium. Among the introduced mosquito species, 

some, such as Stegomyia albopicta [Aedes albopictus] and Hulecoeteomyia japonica [Aedes 

japonicus] are already well established in large areas, whereas others, such as St. aegypti 

[Aedes aegypti], Georgecraigius atropalpus [Aedes atropalpus] and Hulecoeteomyia 

koreica [Aedes koreicus] are still confined to their introduction sites or surroundings; 

others, such as Ochlerotatus triseriatus [Aedes triseriatus], have thus far only been 

intercepted during surveillance programs (Schaffner and Van Bortel, 2010) 

Three of six mentioned species are notable for their dispersal potential and their 

significance as vectors of human diseases: St. aegypti, St. albopicta and Hl. japonica. Their 

desiccation-resistant eggs, wide host preference range, ability to exploit a wide range of 

natural and artificial breeding places (container-breeding species) and adaptation to 

temperate climates including winter diapause (except St. aegypti) enable the permanent 

establishment of viable populations in temperate regions (Hawley, 1988; Moore, and 

Mitchell, 1997). Invasive species pose a threat to biodiversity by homogenizing biota with 

cosmopolitan species that usually endanger and replace native counterparts. Once 

misbalanced, the restoration of native diversity becomes impossible. Invasive mosquito 

species also pose a threat to human and/or animal health as a biting nuisance and as vectors 

of transmittable mosquito-borne diseases. 

All invasive mosquitoes that threaten Europe are container breeding species. For 

such species, artificial containers with stagnant water such as private and public catch 

basins, water barrels, cemetery vases, buckets and used tires, are known to be a suitable 

habitat. For tree hole breeding mosquitoes (that was originally St. albopicta) abandoned or 

outdoor stored tires are nearly ideal place for development. Exposed to the rain, tires can 

accumulate water, organic material and microbes. In addition they offer high humidity, high 

temperatures, and lack of natural enemies (Beuwekes et al., 2011). Female mosquitoes can 

lay their eggs inside these tires, using them as a ‘vehicle’ to get transported and invade new 

areas (Reiter, 1988). Eggs of Stegomyia and Hulecoeteomyia spp. are drought resistant and 

are oviposited just above the water level. When the water level inside tires rises due to rain 

(e.g., in a new area where that species did not previously occur) the eggs can hatch and 

invasion begins. 

The results of surveillance of invasive mosquito species that started in Federal 

Republic of Yugoslavia (FRY), sustained in State Union of Serbia and Montenegro (SCG) 

and has been continued in both Republic of Montenegro (ME) and Republic of Serbia (RS) 

will be presented, focusing on St. albopicta, the only invasive species at hand (Fig. 1). 

Biology of other five invasive mosquito species and their distribution in Europe will be 

discussed.


Figure 1. Stalbopicta (left) in comparison to invasive Hl. japonica (middle) and indigenous 

Culex pipiens (right) – (Schaffner and Hendrickx, 2011) 


At a beginning of the surveillance in Federal Republic of Yugoslavia (now 

Montenegro) and Serbia (2001 – 2008) inspections were conducted to determine if exotic 

mosquitoes were present at a companies that are engaged in the international used tire trade. 

Later on, surveillance has been continued in factories (e.g. cement factory La Farge, 

Beočin) that utilize used tires collected within Serbia as a fuel, having in mind that these 

tires could have been stored close to the borders of Montenegro, FYRO Macedonia 

(intensive road travel from Greece) and Croatia where St. albopicta is widespread. 

Inspections were done from June through October with varying frequency based on the 

foreseen risk, ranging from every week for high risk premises to once per season for low 

risk premises, usually in August and September, when mosquitoes are most abundant. 

Tires without water were all, or randomly checked for presence of eggs above the 

water marks and these with water were visually inspected for mosquito larvae. Mosquito 

larvae were collected from tires with a pipette and transferred in vials filled with water for 

consequent breeding or tubes with 70% ethanol. Up to several hundreds of tires were 

inspected per premise. 

Adult mosquitoes were collected with a sweep net, and/or mouth aspirator. All 

samples were labeled and brought to the Laboratory for Medical Entomology (LME), 

Faculty of Agriculture Novi Sad for identification. Mosquitoes were identified 

morphologically by using the diagnostic keys (Becker et al., 2003; Schaffner, 2003; Becker 

et al.2010). 

Latter on (2009 – 2011) ovitraps were distributed at used tire storage places, border 

crossings to Croatia, Montenegro and FYRO Macedonia, as well as on main resting places


on roads connecting Serbia with neighboring countries infested by Asian tiger mosquito 

and main flower importation companies in Novi Sad (usually 10 ovitraps per sampling 

site). The trap stations were kept fixed for the whole season and inspected every 7 th to 14 th 

day. Within each sampling site, the ovitrap was placed in a position of most probable 

occurrence of invasive species often not in accordance with standard requirements for trap 

placement (green, shaded, and easily accessible area). It was positioned on the ground, with 

a free space of at least 1 m above it. Each ovitrap consisted of a black plastic pot (capacity 

400 ml; upper diameter: 8 cm), filled to about 2/3 of its height with about 285 ml of 

dechlorinated water. One 12.5 x 2.5 cm strip of masonite as egg deposition substrate. The 

weekly/biweekly check of the ovitraps provided for the replacement of the deposition 

substrate and of the dechlorinated water, after a careful cleaning in order to remove any 

eggs. Masonite strips were then delivered to the LME for classification, counting, hatching 

and breeding the mosquitoes to the 4 th instar larvae or adult stage and identification (Becker 

et al., 2003; Schaffner, 2003; Becker et al.2010). 

RESULTS 

First specimen of invasive St. albopicta in former Federal Republic of Yugoslavia 

(FRY), now Montenegro, was registered in Podgorica on August 21 st 2001. One last instar 

larva was found in water collected from used tires produced in France and imported from 

Germany. It was developed to a male adult in laboratory. During 2002, 168 larvae and 55 

adults of St. albopicta were detected in 3 of 5 monitored spots in Podgorica including used 

tire shops and residential area downtown. While in the USA and EU the used tires are used 

as a fuel for power production, road surfacing, and recycling for carpet industry, in 

Montenegro they have been sold to be used in traffic again or some of them are used as a 

kind of a barrier for coastal protection. 

In the year 2003 and 2004, St. albopicta spread to east and mid coastal part of 

Montenegro and around capital city of Podgorica. Next year, Asian tiger mosquito was 

detected close to Andrijevica at altitude of 850m that was first record on such high 

elevation in Europe, indicating possible adaptation to climatic conditions outside the limits 

of average temperature values foreseen for Europe at that time. The coldest month average 

temperature in Andrijevica is -2.6°C (January). Between 2006 and 2011, inspections were 

done usually in August and September, when mosquitoes are most abundant, mostly once 

per season and limited to high risk premises because of no budget available. Patchy 

distribution indicating spreading to Boka Kotorska bay and Luštica peninsula as well as 

places around Skadar Lake was recorded. From 2012 new project “Surveillance of invasive 

invertebrate St. albopicta in Montenegro“ was launched, allowing systematic approach 

aimed to depict both distribution and numerosity of St. albopicta across Montenegro in next 

three years. First year surveillance is focused to Montenegro coast. Until now Asian tiger 

mosquito is detected on 17 out of 40 sampling sites. Number of eggs per positive ovitrap in 

May 2012 ranged from 1 to 127, average 4.39. 

In Serbia first egg detection was made on 1 st September 2009 in ovitrap positioned 

at passport/custom control terminal of Batrovci border pass between Croatia and Serbia. 

The masonite strip from positive trap was brought to laboratory for eggs to hatch and after 

rearing of larvae and pupae, 22 adults of St. albopicta ecloded. That was the first detection 

of Asian tiger mosquito at country level. Surveillance was continued on weekly basis until 

14 th October 2009 but no new detections were made. Water containers in vicinity of border 

pass were also checked for presence of immature stages as well as human bait samplings


but no St. albopicta specimens had been detected. It seems that we were lucky enough to 

stop establishment by having the eggs deposited in one of our traps. Apart from border, sets 

of three to 10 ovitraps were positioned at used tire storage dump in La Farge cement 

factory, Beočin; three petrol/rest stop station at the highway Zagreb – Belgrade proximal to 

border pass; one restaurant visited by travellers from Montenegro coast and two flower 

importation companies in Novi Sad. 

Same sampling setup was repeated next year, in weekly intervals from 13 th of 

August until 20 th of September but no new detections were made. Until 13 th of September 

traps were positive for egg rafts, larvae and pupae of Cx.pipiens pipiens and larvae of hover 

flies (Diptera: Syrphidae). 

In 2011, biweekly/weekly samplings were performed on border passes to Croatia 

(Batrovci), Montenegro (Jabuka and Gostun) and FYRO Macedonia (Preševo), using 10 

ovitraps per sampling site. For inspection of all border passes two days of work and more 

than 1400km of travel were needed. Surveillance was done in five round trips, on 27-28 

July, 4-5 August, 15-16 August, 24-25 August, 31 August- 1 September and 12-13 

September 2011. All sampling sites except Batrovci were negative for the eggs of St. 

albopicta, so last four samplings (18 th and 29 th September and 4 th and 11 th October) were 

concentrated to this border pass only. 

First eggs of St. albopicta at Batrovci were detected on 31 st of August (32 eggs) and 

then on 18 th (46 eggs) and 29 th (5 eggs) September. On 4 th October one St. albopicta female 

was sampled close to the ovitrap situated on concrete floor near the entrance to custom 

offices. No invasive species were detected on other border passes but egg rafts, larvae and 

pupae of Cx.pipiens pipiens were frequently found. 

DISCUSSION 

After our findings of St. albopicta in a small used tire trade company in Podgorica in 

2001 (Petrić et al., 2001), and also because no capacity to process all imported used tires in 

the safe way were available in Serbia, national government imposed amendment on Nature 

protection law that ban the importation of used tires in Serbia in 2007. It is likely that this 

legal decision has been protecting Serbia from introduction of Asian tiger mosquito for 

couple of years and will lower the risk of new introductions in the years to come. 

The “Asian tiger mosquito”, St. albopicta, originating from Southeast Asia, has 

undergone a noteworthy expansion of its range in the last few decades (Hawley, 1988). Due 

to its immense invasive capacity, it is listed in the inventory of “100 of the World's Worst 

Invasive Alien Species” (http://www.issg.org). With the increase in the international trade 

of used tires, this species has spread across very large distances and between continents 

(Reiter, 1998). In Europe, it was first reported in Albania in 1979 (Adhami, and Murati, 

1987) probably due to the country intense trade with China but did not spread around, most 

likely because of the trade isolation of the country at neighbouring countries level. 

Subsequent introduction was reported in Italy in 1990, where it was probably introduced 

through the import of used tires from the USA (Sabatini et al., 1990; Dalla Pozza and 

Majori, 1992). Over the next few years, the species rapidly dispersed to other regions of 

Italy (Romi, 1994), and it has now been reported in France - 1999 (Schaffner and Karch, 

2000), Belgium - 2000 (Schaffner et al., 2004), Federal Republic of Yugoslavia, now 

Montenegro - 2001 (Petrić et al., 2001; Becker et al., 2003), Greece - 2003 (Samanidou- 

Voyadjoglou et al., 2005), Switzerland - 2003 (Flacio et al., 2004), Croatia - 2004 

(Klobučar et al.m 2006), Spain - 2004 (Aranda et al., 2006), Slovenia, Bosnia and


Herzegovina - 2005 (Scholte and Schaffner, 2007), the Netherlands - 2005 (Scholte et al., 

2007), Germany - 2007 (Pluskota et al., 2008) Serbia - 2009 (Petrić, 2009), Bulgaria and 

Turkey – 2011 (Mikov, personal communication) (Fig.2). 

Figure 2. Distribution of St. albopicta in Europe 

(VBORNET vector maps: http://ecdc.europa.eu). 

The “Asian rock pool” or “Asian bush” mosquito, Hl. japonica, is an Asian species 

native to Japan, Korea, South China, Taiwan and the Russian Federation. In Europe, this 

species was established in Belgium and has successively been detected in Switzerland and 

Germany, where it is rapidly spreading (Schaffner et al., 2009; Becker et al., 2011). 

The “African tiger mosquito” or “Yellow fever mosquito”, St. aegypti, has spread 

across almost all tropical and subtropical countries over the past four centuries. St. aegypti 

disappeared from Southern Europe at the beginning of the last century but recently, in 

2004, was introduced in Madeira and has since started to spread around the Black Sea. It 

has also been introduced to the Netherlands through the used tire trade (Scholte et al., 

2010). 

The primary dispersal mode of these three invasive mosquito species by human 

activity has been through the transport of desiccation-resistant eggs in cargo. The most 

important types of goods responsible for this passive transport are used tires, which are 

generally stored outdoors and thus collect and store rain water that is indispensable for 

mosquito development (Knudsen, 1995). Businesses that process and/or trade used tires 

should be given a high priority for the monitoring of exotic fauna and flora. Another 

documented source of introduction is through ornamental plants, e.g., “Lucky Bamboo” 

(Dracaena spp.) from Southeast Asia, which is transported in containers with standing


water, making it an ideal insectaria in transit. “Lucky Bamboo” was the primary reason for 

the introduction of St. albopicta from Southeast Asia to California (Madon et al. 2004). 

Similarly, multiple introductions of the Asian tiger mosquito to the Netherlands in 

commercial horticultural greenhouses have been linked to the intensive trade of this plant 

(Scholte et al., 2007; Scholte et al., 2010). 

Therefore, harbors, ports and inland air or road terminals that receive transoceanic 

containers from infested countries should be routinely monitored. Rest areas and parking 

lots along highways originating in areas infested with exotic species can also serve as sites 

of introduction (Flacio et al., 2004; Pluskota et al., 2008). 

St. aegypti and St. albopicta are the primary and secondary vectors, respectively, for 

Dengue fever (DF) and Dengue hemorrhagic fever (DHF), which affect more than 40 % of 

the human population worldwide, especially in mega-cities of the tropics (Halstead, 1980, 

1982, 1992; Becker et al., 1991; Gratz, 1999). St. albopicta is the most important vector for 

the Chikungunya virus (Reiter et al., 2006). Recently, this species was involved in the 

transmission of Chikungunya virus to humans in Italy in 2007 and was also most likely 

involved in the first confirmed autochthonous dengue cases in France and Croatia in 2010 

(Beltrame et al., 2007; Becker et al., 2010; Schmidt-Chanasit, 2010; Gjenero-Margan et al., 

2011). In addition to Dengue and Chikungunya, other viruses such as Batai, Inkoo, 

Lednice, Sindbis, Tahyna, Usutu and West Nile have shown some activity, and the Rift 

Valley and Japanese encephalitis viruses are likewise threatening human health in Europe 

(Becker et al., 2010). 

The capacity of Serbia to detect the early presence of invasive species and define 

their abundance and colonized area needs to be rapidly improved in order to increase the 

chances of early detection and elimination of invaders at the beginning of the colonization 

process and/or to develop efficient control programs. Moreover, in areas where the 

invading species is established, monitoring of further spread and abundance is needed for 

timely risk assessment of arbovirus transmission. 

It has been demonstrated on several occasions within different countries and 

environmental conditions that it is possible, and perhaps highly convenient in term of costbenefit 

balance, to eliminate an invading mosquito species by promptly applying intensive 

suppression methods if the colonized area is still well delimited. 

At least some kinds of surveillance and monitoring networks (research and/or 

control based) are already organized in many European countries, including Albania, 

Belgium, Bulgaria, Croatia, the Czech Republic, France, Germany, Greece, Italy, 

Montenegro (through a research project, started in 2012), the Netherlands, Portugal, Serbia 

(through the research projects, started in 2009), Slovenia, Spain, Switzerland and the 

United Kingdom (Fig. 3). 

European Centre for Disease Prevention and Control (ECDC), Stockholm, Sweden 

has been supporting several projects that aim to increase the capacities of European 

countries for surveillance and control of invasive mosquito species and vector-borne 

diseases: (i) the TigerMaps project, which included a multi-model approach to model and 

predict the spread of St. albopicta in Europe taking into consideration the current 

presence/absence data, expert knowledge and a variety of IPCC-derived climate scenarios; 

(ii) VBORNET, the European Network for Arthropod Vector Surveillance for Human 

Public Health; (iii) Vi-Map, which aims to map European health vulnerabilities to climate 

change related to communicable disease and (iv) MosqInvade project which outcomes are 

Guidelines for the surveillance of invasive mosquitoes in Europe (Schaffner et al., 2012).


Figure 3. Current known surveillance activities in Europe 

(VBORNET: http://ecdc.europa.eu) 


This research has been supported through the projects: a) “Monitoring of invasive 

mosquito vectors and vector borne diseases” financed by The City of Novi Sad, City 

Administration for Environmental Protection (2009-10); b) “Studying climate change and 

its influence on the environment: impacts, adaptation and mitigation” (III43007) and 

“Surveillance of game health and introduction of novel biotechnology detection methods of 

infectious and zoonotic agents - risk analysis to humans, domestic and wild animals and 

environmental contamination” (TR 31084) financed by the Ministry of Education and 

Science of the Republic of Serbia (2011-14), c) “Survey of West Nile virus in vector and 

seroprevalence in human population” (114-451-2142/2011-01), financed by Provincial 

Secretariat for Science and Technological Development, AP Vojvodina and d) 

“Surveillance of invasive invertebrate St. albopicta in Montenegro“ financed by Ministry of 

Science of the Republic of Montenegro (2012-15). 

REFERENCES 

Adhami, J., Murati, N. (1987): Presence du moustique St. albopicta en Albanie. Revist. 

Mjekesore., 1, 13-16. 

Aranda, C., Eritja, R., Roiz, D. (2006): First record and establishment of the mosquito, Aedes 

albopictus, in Spain. Med. Vet. Entomol., 2, 150-152. 

Becker, N., Djakaria, S., Kaiser, A., Zulhasril, O., Ludwig, H.W. (1991): Efficacy of a new 

tablet formulation of an asporogenous strain of Bacillus thuringiensis israelensis against 

larvae of Aedes aegypti. Bull. Soc. Vector. Ecol., 16, 176- 182.


Becker, N., Huber, K., Pluskota, B., Kaiser, A. (2011): Ochlerotatus japonicus japonicus – a 

newly established neozoan in Germany and a revised list of the German mosquito fauna. 

European Mosquito Bulletin, 29, 88-102. 

Becker, N., Petrić, D., Zgomba, M., Boase, C., Dahl, C., Lane, J., Kaiser, A. (2003): Mosquitoes 

and Their Control. Kluwer Academic/Plenum Publishers, New York. ISBN 0-306- 

47360-7. pp.498. 

Becker, N., Petrić, D., Zgomba, M., Boase, C., Madon, M., Dahl, C., Kaiser, A. (2010): 

Mosquitoes and Their Control. Springer: Heidelberg, Dordrecht, New York, p. 577. 

Beeuwkes, J., den Hartog W., Dik M., Scholte E.J. (2011): Surveillance and findings of exotic 

mosquitoes in used tires in The Netherlands: a methodological approach. Proc. Neth. 

Entomol. Soc. meet. – Vol. 22: 31-37. 

Beltrame, A., Angheben, A., Bisoffi, Z., Monteiro, G., Marocco, S., Caller G. (2007): Imported 

Chikungunya infection, Italy. Emerg. Infect. Dis. 

[http://www.cdc.gov/EID/content/13/8/1264.htm] 

Dalla Pozza, G., Majori, G. (1992): First record of Aedes albopictus establishment in Italy. J. 

Am. Mosq. Contr. Assoc., 8, 318-320. 

Enserink, M. (2008): A Mosquito Goes Global. Science, 320(5878), 864-866. 

Flacio, E., Lüthy, P., Patocchi, N., Guidotti, F., Tonolla, M., Peduzzi, R. (2004): Primo 

ritrovamento di Aedes albopictus in Svizzera. Boll. Soc. Ticinese Sc. Natl., 92, 141-142. 

Gjenero-Margan, I., Aleraj, B., Krajcar, D., Lesnikar, V., Klobučar, A., Pem-Novosel, I., 

Kurečić-Filipović, S., Komparak, S., Martić, R., Đuričić, S., Betica-Radić, L., Okmadžić, 

J., Vilibić-Čavlek, T., Babić-Erceg, A., Turković, B., Avšić-Županc, T., Radić, I., Ljubić, 

M., Šarac, K., Benić, N., Mlinarić-Galinović, G. (2011): Autochthonous dengue fever in 

Croatia, August– September 2010. Euro Surveill., 16(9), pii=19805. 

Gratz, N.G. (1999): Emerging and resurging vector-borne diseases. Annu. Rev. Entomol., 44, 51- 

75. 

Halstead, S.B. (1980): Dengue haemorrhagic fever-a public health problem and a field for 

research. Bull. WHO, 58, 1-21. 

Halstead, S.B. (1982): WHO fights dengue haemorrhagic fever. WHO Chronicle, 38, 65-67. 

Halstead, S.B. (1992): The XXth century dengue pandemic: need for surveillance and research. 

World Health Stat. Q., 45, 292-298 (1992). 

Hawley, W.A. (1988): The biology of Aedes albopictus. J. Am. Mosq. Contr. Assoc., (Suppl.) 4, 

1-39. 

Klobučar, A., Merdić, E., Benić, N., Baklaić, Ž., Krćmar, S. (2006): First record of Aedes 

albopictus in Croatia. J. Am. Mosq. Contr. Assoc., 22, 147-148. 

Knudsen, A.B. (1995): Global distribution and continuing spread of Aedes albopictus. 

Parassitologia, 37, 91-97. 

Madon, M.B., Hazelrigg, J.E., Shaw, M.W., Kluh, S., Mulla, M.S. (2004): Has Aedes albopictus 

established in California? J. Am. Mosq. Contr. Assoc., 19, 298. 

Moore, C.G., Mitchell, C.J. (1997): Aedes albopictus in the United States: Ten-year presence 

and public health implications. Emerg. Infect. Dis., 3, 329-334. 

Petrić, D. (2009): Monitoring of invasive vector mosquitoes and vectorborne diseases (in 

Serbian). Report to Administration for Environmental Protection, Novi Sad City: 1–9. 

Petrić, D., Pajović, I., Ignjatović Ćupina, A., Zgomba, M. (2001): Aedes albopictus (Skuse, 

1894) new mosquito species (Diptera, Culicidae) in entomofauna of Yugoslavia. 

Abstract of Symposia of the entomologists of Serbia, Goč, RS, 26-27. 

Pluskota, B., Storch, V., Braunbec, T., Beck, M., Becker, N. (2008): First record of Stegomyia 

albopicta (Skuse) (Diptera: Culicidae) in Germany. European Mosquito Bulletin, 26, 1- 

5. 

Reiter, P. (1998): Aedes albopictus and the world trade in used tires, 1988-1995: The shape of 

things to come. J. Am. Mosq. Contr. Assoc., 14, 83-94.


Reiter, P., Fontenille, D., Paupy, C. (2006): Aedes albopictus as an epidemic vector of 

Chikungunya virus: another emerging problem? Lancet Infect. Dis., 6, 463-464. 

Romi, R. (1994): Aedes albopictus in Italia: problemi sanitari, strategie di controllo e 

aggiornamento della distribuzione al 30 settembre 1994. Notiziario I.S.S., 7, 7-11. 

Sabatini, A., Raineri, V., Trovato, G., Coluzzi, M. (1990): Aedes albopictus in Italia e possibile 

diffusione della specie nell’area del mediterraneo. Parassitologia, 32, 301-304. 

Samanidou-Voyadjoglou, A., Patsoula, E., Spanakos, G., Vakalis, N.C. (2005): Confirmation of 

Aedes albopictus (Skuse) (Diptera: Culicidae) in Greece. Eur. Mosq. Bull., 19, 10-12. 

Schaffner, F. (2003): Mosquitoes in used tyres in Europe: species list and larval key. European 

Mosquito Bulletin, 16: 7-12. 

Schaffner, F., Bellini, R., Petrić, D., Scholte, E.-J. (2012) Guidelines for the surveillance of 

invasive mosquitoes in Europe. ECDC http://ecdc.europa.eu/en/healthtopics/vectorborne_diseases/public_health_measures/pages/mosquito-guidelines.aspx 

(In prep.) 

Schaffner, F., Hendrickx, G. (2011) Proceedings of the WHO - EMCA Meeting on vectorrelated 

risk of introduction of Chikungunya and Dengue fever and spread of Ae. 

albopictus and Ae. japonicus within Europe”, Speyer, Germany. (In prep.). 

Schaffner, F., Karch. S. (2000): First report of Aedes albopictus (Skuse, 1894) in metropolitan 

France. C. R. Acad. Sci., III 323, 373-375. 

Schaffner, F., Kaufmann, C., Mathis, A. (2009): The invasive mosquito Aedes japonicus in 

Central Europe. Med. Vet. Entomol., 23, 448-451. 

Schaffner, F., Van Bortel, W. (2010): Current status of invasive mosquitoes in Europe. ECDC, 

VBORNET Newsletter, 2, 6-8. 

Schaffner, F., Van Bortel, W., Coosemans, M. (2004): First record of Aedes (Stegomyia) 

albopictus in Belgium. J. Am. Mosq. Contr. Assoc., 20, 201-203. 

Schmidt-Chanasit, J., Haditsch, M., Schöneberg, I., Günther, S., Stark, K., Frank, C. (2010): 

Dengue virus infection in a traveller returning from Croatia to Germany. Euro Surveill., 

15(40), pii=19677. 

Scholte, E.J., Dik, M., Schoelitsz, B., Brooks, M., Schaffner, F., Foussadier, F.R., Brak, M., 

Beeukes, J. (2010): Introduction and control of three invasive mosquito species in the 

Netherlands. Euro Surveill., 15(45), pii=19710. 

Scholte, E.J., Jacobs, F., Linton, Y.M., Dijkstra, E., Fransen, J., Takken, W. (2007): First record 

of Aedes (Stegomyia) albopictus in the Netherlands. European Mosquito Bulletin, 22, 5- 

9. 

Scholte, E.J., Schaffner F. (2007): Waiting for the tiger: establishment and spread of the Aedes 

albopictus mosquito in Europe. In: Emerging Pests and Vector-Borne Diseases in 

Europe; W. Takken, B.G.J. Knols, Eds.; Book series: Ecology and control of vector 

borne diseases; Wageningen Academic Publishers: Wageningen, NL,; Vol. 1, pp. 241- 

260.

506 Presence and distribution of scaphoideus titanus ball,... 


Proceedings 

UDK:634.8-275(497.16) 

PRESENCE AND DISTRIBUTION OF SCAPHOIDEUS TITANUS 

BALL (HEMIPTERA: CICADELLIDAE) IN THE VINEYARDS OF 

MONTENEGRO 

SANJA RADONJIĆ 1 , SNJEŽANA HRNČIĆ 1 , OLIVER KRSTIĆ 2 , IVO TOŠEVSKI 2 , JELENA JOVIĆ 2 

1 

University of Montenegro, Biotechnical Faculty, Department of Plant Protection, Mihaila 

Lalića 1, 81000 Podgorica, Montenegro 

2 Institute for Plant Protection and Environment, Department of Plant Pests, Banatska 33, 

11080 Zemun, Serbia 

The nearctic leafhopper Scaphoideus titanus Ball (Hemiptera: Cicadellidae), main vector of 

the flavescence dorée (FD) phytoplasma, was detected for the first time in Montenegro in August 

2008. Adults were identified using yellow sticky traps in a single vineyard on the locality Šušunja in 

the Podgorički subregion - a largest viticulture subregion of Montenegro. In the following years 

(2009-2011), surveys were conducted in order to confirm the presence and determine the distribution 

of S. titanus in the grape-growing regions of Montenegro. Altogether 12 vineyards were examined in 

different viticultural subregions. Regarding presence of S. titanus nymphs, down side of the oldest 

grapevine leaves were visually inspected from mid-May to mid-June. Adults were collected from the 

beginning of July to the end of August by means of sweep nets and yellow sticky traps. Results of the 

monitoring showed spreading of S. titanus in Montenegro in years after its first detection and 

confirmed its presence in 8 out of 12 inspected vineyards. Out of the first detection site the farthest 

occurrence of S. titanus was detected near border with Bosnia and Herzegovina, in a locality Nudo, 

around 330 m above sea level in the Grahovsko-Nudolski subregion. 

Key words: Scaphoideus titanus, Montenegro viticultural regions, presence, distribution 

INTRODUCTION 

The nearctic leafhopper Scaphoideus titanus Ball (Hemiptera: Cicadellidae) is native 

of North America and invasive in Europe. Its first occurrence in Europe was reported from 

France (Bonfils and Schvester, 1960) and after that reported in vineyards of Italy (Vidano, 

1964), Switzerland (Baggiolini et al.,1968), Slovenia (Seljak, 1987), Spain (Batlle et 

al.,1997), Portugal (Quartau et al., 2001), Austria (Zeisner, 2005), Hungary (Dér et al., 

2007). In countries neighboring to Montenegro it was detected in Serbia (Magud and 

Toševski, 2004), Croatia (Budinščak et al., 2005) and Bosnia and Herzegovina (Delić et al., 

2007). S. titanus is monophagous on grapevine and has one generation per year (Caudwell 

et al., 1987; Boudon-Padieu, 2003). It is the main vector of Flavescence dorée (FD) 

phytoplasma belonging to the elm yellow group 16Sr-V subgroups C and D. This is the 

most severe phytoplasma disease of the grapevine in Europe and an epidemic disease with

Sanja Radonjić, Snježana Hrnčić, Oliver Krstić,... 507 

quarantine status in the EPPO region (Boudon-Padieu, 2002). The disease is characterized 

by rapid spreading within vineyards due to the vine-to-vine transmission by S. titanus. 

Where allowed to spread uncontrolled, epidemic FD has catastrophic consequences to 

grapevine production (Boudon-Padieu, 2003, Bressan et al., 2005) 

Montenegro has a long tradition in grape-growing and vine production. Today, there 

are about 4400 ha of vineyards with the largest vineyard in one complex in Europe (2310 

ha) and two autochthonous grape varieties Vranac and Krstač. Grapes are grown in two 

main regions: Crnogorsko-primorski and Basin of the lake Skadar. They are divided in to 

the subregions regarding specific agroecological conditions which influence on 

characteristics of grape and wine. More than 75% of Montenegrin vineyards are located 

near the vicinity of the city Podgorica in the Podgoričko subregion. 

In August 2008 adults of Scaphoideus titanus were detected for the first time in 

Montenegro, on locality Šušunja in the surrounding of Podgorica. They were collected on a 

yellow sticky traps placed in July in one of the five randomly selected vineyards during a 

regular phytosanitary pest surveillance. The number of captured adults, indicating 

population density of the leafhopper, was low in the first year of identification, with only 

seven specimens collected in July and five in mid-September. 

Regarding economic importance which grape-growing and wine production has for 

Montenegro and correlation between presence of S. titanus and risk for FD phytoplasmas 

appearance, the aim of this study was to confirm the presence and determine the 

distribution of S. titanus in the grape-growing area of Montenegro in order to undertake 

appropriate control measures to prevent its further spreading and possible FD appearance. 


Survey was conducted between 2009 and 2011 in 12 vineyards (sites) in different 

vine growing localities of Montenegro: Zeta (sites Šušunja1, 2 and 3), Crmnica (sites 

Godinje 1 and 2), Rijeka Crnojevića (sites Drušići 1 and 2), Bjelopavlići (sites Martinići 1 

and 2), Podgorica (sites Lješkopolje and Beri), Grahovo (site Nudo) (Table 1). In most of 

surveyed vineyards dominant grape was black variety - Vranac (more than 85 %) and the 

rest was white variety Kratošija. Vineyards were visually inspected form mid-May to mid- 

June, at the beginning of nymph emergence and during the second instar period. Down side 

of the oldest leaves was examined in term to detect presence of young nymphs or its 

exuvias. Adults were collected from beginning of July to the end of August directly 

from plants by means of sweep net. Collected adults were preserved in 75 % ethanol for 

subsequent identification. Additionally, yellow sticky traps were randomly set up within the 

vineyards (two per vineyard) at the beginning of July and replaced every 15 days until end 

of September. 

RESULTS 

After the first detection of S. titanus in Montenegro when seven adults were 

captured on yellow sticky trap in locality Šušunja (Podgorički subregion) and in mid- 

September five adults, in the following years new localities with S. titanus presence were 

identified (Table 1).


Table 1. Occurence of Scaphoideus titanus in the surveyed vineyards per year 

Locality a 

Year Š1 Š2 Š3 G1 G2 D1 D2 M1 M2 B Lj N 

2008 - + + n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. 

2009 - + + + - - n.s. ns ns ns ns + 

2010 - + + + + - - - - - - + 

2011 - + + + + - - + - - + + 

a Locations of the surveyed vineyards: Š1-Šušunja 1; Š2-Šušunja 2; Š3-Šušunja 3; G1-Godinje 1; G2- 

Godinje 2; D1- Drušići 1; D2- Drušići 2; M1- Martinići 1; M2- Martinići 2; B- Beri; Lj-Lješkopolje; 

N- Nudo; + present; - absent; n.s. = not surveyed during a particular year 

In 2009 S. titanus was confirmed from 4 out of 10 inspected vineyards, out of which 

two were new localities: Godinje (Crmnički subregion) and Nudo (Grahovsko Nudolski 

subregion). Godinje is distanced around 20 km in south-east direction from the first 

detection site (Šušunja), while Nudo around 100 km in northwestern direction. In localities 

Šušunja and Godinje visual inspections of grapevine leaves indicated presence of first and 

second instar nymphs from mid-May to beginning of June. These findings were confirmed 

in July and August when adults were captured by sweep net, as well as on a yellow sticky 

trap. In locality Nudo grapevine leaves were not observed in May and June on nymph 

presence, but adults were found in July and August. Number of captured adults per locality, 

collected using sweep, net ranged from 1 to 5 at the end of July and 1 to 10 at the end of the 

first decade in August. 

Spreading of S. titanus in new localities was not detected in 2010, but it was found 

in one new vineyard in subregion Godinje. As in the previous year, presence of first and 

second instar nymphs were found from mid-May to beginning of June and confirmed in 

adult stage during July and August capturing in sweep net and on yellow sticky traps. 

In 2011 its occurrence was recorded in two new localities: Martinići (Bjelopavlićki 

subregion) and Lješkopolje (Podgorički subregion). Locality Martinići is distanced from the 

first detection site (Šušunja) around 25 km in northwestern direction, while Lješkopolje 

around 15 km northern. In this year presence of S. titanus nymphs were found until end of 

May in 8 of 12 inspected vineyards (Šušunja 1, Šušinja 2, Godinje1, Godinje2, Martinići 1, 

Lješkopolje and Nudo). In locality in Rijeka Crnojevića (sites Drušići 1 and Drušići 2) 

which belongs to the Riječki subregion, presence of S. titanus was not detected during this 

survey, neither in locality Beri (Podgorički subregion). In the Figure 1 the current 

distribution of S. titanus in Montenegro is given.

Sanja Radonjić, Snježana Hrnčić, Oliver Krstić,... 509 

Figure 1. Distribution of Scaphoideus titanus in Montenegro in 2011 

DISCUSSION 

Results of the conducted survey indicates that after the first identification of S. 

titanus presence in Montenegro in next three years it spreaded in new localities which are 

adjacent to the first detection site (approximately 15-25 km distanced). It could be assumed 

that S. titanus spreaded through these localities in natural way, although the way of its 

introduction in Montenegro has not been clarified yet. Regarding countries surrounding the 

Montenegro (Serbia, Croatia, Bosnia and Herzegovina) with confirmed presence of S. 

titanus makes open possibility of the pest introduction from their teritories. However, quite 

distanced location of the first finding site (Šušunja) from borders with those countries, does 

not indicate it could be by natural movement. Additionaly, there is an introduction of 

propagation material in Montenegro mostly from Serbia and Italy which also allows 

assumption of introduction by propagating material (in egg stage). The only exception is 

locality Nudo which is placed on the border with Bosnia and Herzegovina, in surrounding 

of the city Trebinje, where S. titanus was detected in 2007 (Delić et al., 2007). Therefore 

there is real possibility of its natural spreading from the area of Trebinje (Herzegovina) to 

the vineyards in Nudo (Montenegro) where its presence was detected in 2009. 

After three years of S. titanus monitoring in Montenegro it can be concluded that it 

is already established pest in Montenegro which has spreaded in a different viticultural 

subregions. Its populations showed stabilization during 2011 and adaptation on 

agroecological conditions in diferrent viticultural subregions. 

Presence and spreading of S. titanus in Montenegrin vineyards represents a serious 

threat for possible occurrence and spreading of FD phytoplasmas. Considering that FD 

phytoplasma is widely present in the grape-growing regions of Serbia (Krnjajić et al., 2007) 

from where most of the grapevine planting material is being imported into the Montenegro,


there is a need for the constant monitoring of the distribution and population density of S. 

titanus as well as the appearance of phytoplasma-induced symptoms on grapevine. 


This research was funded through project “Proučavanje cikada (Auchenorrhyncha) – 

prenosioca fitoplazmatičnih bolesti” from the Ministry of Science of Montenegro and by 

grant III43001 from the Ministry of Science and Technological Development of the 

Republic of Serbia. 

REFFERENCES 

Baggiolini, M., Canevascini, V., Caccia, R., Tencalla, Y., Sobrio, G. (1968): Présence dans le 

vignoble du Tessin d’une cicadelle nouvelle pur la Suisse, Scaphoideus littoralis Ball. (Hom., 

Jassidae), vecteur possible de la flavescence dorée. Mitteilungen der Schweizerischen 

Entomologischen Gesellschaft, 40 (3-4): 270-275. 

Batlle, A., Laviña, A., Kuszala, C., Clair, D., Larrue, J., Boudon-Padieu, E. (1997): Detection of 

Flavescence dorée phytoplasma in grapevine in Northern Spain. Vitis, 36: 211–213. 

Bonfils, J., Schvester, D. (1960): Les Cicadelles (Homoptera, Auchenorrhyncha) dans leurs rapports 

avec la vigne dans le Sud-Ouest de la France. Ann. Epiphyt. 11, 325-336. 

Boudon-Padieu, E. (2002): Flavescence dore´e of the grapevine: knowledge and new developments in 

epidemiology, etiology and diagnosis. ATTI Giornate Fitopatologiche 1, 15–34. 

Boudon-Padieu, E. (2003): The situation of grapevine yellows and current research directions: 

distribution, diversity, vectors, diffusion and control.- Proceedings of XV nternational 

Conference of Virus and Virus-like diseases of Grapevine: 47-53. 

Bressan, A., Girolami, V., Boudon-Padieu, E. (2005): Reduced fitness of the leafhopper vector 

Scaphoideus titanus exposed to Flavescence dorée phytoplasma. Entomologia Experimentalis 

et Applicata, 115: 283 –290. 

Budinščak, Ž., Križanac, I., Mikec, I., Seljak, G., Škorić, D. (2005): Vektori fitoplazmi vinove loze u 

Hrvatskoj. Glasilo biljne zaštite, 5: 240-244. 

Caudwell, A., Boudon-Padieu, E., Kuzsala, C., Larrue, J. (1987): Biologie et étiologie de la 

flavescence dorée. Recherches sur son diagnostic et sur les méthodes de lutte. Atti del 

Convegno sulla flavescenza dorata delle vite, Vicenza-Verona 1987, 175-203. 

Delić, D., Seljak, G., Martini, M., Ermacora, P., Carraro, L., Myrta, A., Đurić, G. (2007): Surveys for 

grapevine yellows phytoplasmas in Bosnia and Herzegovina. Bulletin of Insectology, 60 (2): 

369-370. 

Dér, Z., Koczor, S., Zsolnai, B., Ember, I., Kölber, M., Bertaccini, A., Alma, A. (2007): Scaphoideus 

titanus identified in Hungary. Bulletin of Insectology, 60 (2): 199-200. 

Krnjanjić, S., Mitrović, M., Cvrković, T., Jović, J., Petrović, A., Forte, V., Angelini, E., Toševski, I. 

(2007): Occurrence and distribution of Scaphoideus titanus Ball - multiple outbreaks of 

Flavescence dorée in Serbia. Bulletin of Insectology 60 (2), 197-198. 

Magud, B., Toševski, I. (2004): Scaphoideus titanus Ball (Homoptera, Cicadellidae) nova štetočina u 

Srbiji. Biljni lekar, 32 (5): 348-352. 

Quartau, J.A., Guimarães, J.M., André, G. (2001): On the occurrence in Portugal of the nearctic 

Scaphoideus titanus Ball (Homoptera, Cicadellidae), the natural vector of the grapevine 

“flavescence dorée” (FD).- Bulletin OILB/srop, 24 (7): 273-276. 

Seljak, G. (1987): Scaphoideus titanus Ball (=S. littoralis Ball), novi štetnik vinove loze u Jugoslaviji. 

Zaštita bilja, 38 (4): 349-357. 

Vidano, C. (1964): Scoperta in Italia dello Scaphoideus littoralis Ball Cicalina americana collegata 

alla “Flavescence dorée” della Vite. Italia Agric. 101, 1031-1049. 

Zeisner, N. (2005): Augen auf im Süden: Amerikanische Zikaden im Anflug. Der Winzer, 5: 20-21.

Lazar Sivčev, Draga Graora, Ivan Sivčev,... 511 

International Symposium: Current Trends in Plant Protection UDK: 633.853.49-23/28(497.11) 

Proceedings 

PESTS OF OILSEED RAPE IN NORTHERN SERBIA 

LAZAR SIVČEV 1 , DRAGA GRAORA 2 , IVAN SIVČEV 3 , WOLFGANG BUCHS 4 , TATJANA GOTLIN 

ČULJAK 5 , IVAN JURAN 5 , VLADO TOMIĆ 6 , BORIS DUDIĆ 6 

1 Scholar of the Ministry of Education and Science of the Republic of Serbia, 

lazarsivcev@gmail.com 

2 Faculty of Agriculture, University of Belgrade, Zemun, Serbia. 

3 Institute for Plant protection and Environment, Beograd, Serbia 

4 

Julius Kühn-Institut, Institute for Crop and Soil Science, Braunschweig, Germany 

5 

Faculty of Agriculture, Agricultural Zoology, University of Zagreb, Croatia 

6 

Faculty of Biology, University of Belgrade, Serbia 

Oilseed rape (Brassica napus, Brassicaceae), is very important arable crop being a third 

leading source of vegetable oil. Oilseed rape is less abundant crop in Serbia probably because 

sunflower is dominating as edible oil crop with tradition in farming. Pests and diseases play 

significant role in oilseed rape yield. In Serbia pollen beetle - Meligethes aeneus (HFabriciusH, 1775) is 

considered as most important pest of oilseed rape which can significantly reduce yield. Turnip sawfly 

– Athalia rosae (Linnaeus 1758) is considered as a second most important oilseed rape pest. The goal 

of this paper is to determine status of oilseed rape pests from observations which are done during 

2010 and 2011 vegetation in fields located in northern Serbia. It was found that the most important 

pests are Ceutorhynchus pallidactylus (Marsham 1802), Ceutorhynchus napi (Gyllenhal 1837) and 

Dasineura brassicae (Winnertz 1853). According to these results insecticide treatment was justified 

only against these pests. 

Key words: oilseed rape pests, Athalia rosae, Ceutorhynchus pallidactylus, Ceutorhynchus 

napi, Meligethes aeneus, Dasineura brassicae. 

INTRODUCTION 

Oilseed rape (Brassica napus, Brassicaceae), is very important arable crop being a 

third leading source of vegetable oil in the world (Orlovius, 2003). On a world scale, the 

oilseed rape is sown on about 30 million ha, of which about 5 million ha is in Europe 

(FAO, 2001). In Serbia most important crop for vegetable oil production is sunflower 

followed by oilseed rape. Oilseed rape is less abundant crop in Serbia probably because 

sunflower is dominating as edible oil crop with tradition in farming. Oilseed rape is grown 

on considerable larger acreage in plains in northern Serbia although soil and climate is also 

favorable in hilly landscape in central Serbia. In the period from 1985 to 2010 acreage 

under oilseed rape was changed from 25000 ha to 15000 ha. Yield is significantly improved 

in recent years and is reaching as much as 3 tones/ha (Stat. year b. Serb., 2010). 

In 2006 Republic of Serbia ratified the Treaty establishing the European Energy 

Community, and undertook implementation of Directive 2003/30/EC of the European

512 Pests of oilseed rape in northern Serbia 

Parliament and the Council on the promotion of biofuels or other fuels produced from 

renewable energy sources in transport sector. This biofuels directive defines and imposes an 

obligation on states to put on the market a 5.75% of biofuel of the total amount of fuel used 

in the transport sector by end of 2010. It is estimated that potential for acreage increase is 

directly in connection with need for increased use of renewable fuel resources. Commercial 

producers (Hhttp://www.biodizel.co.yuH) estimate that oilseed rape production in Serbia 

can be realised on up to 20% of the land cultivated by arable crops with a significant 

increase in hilly areas up to 700 metres above see level in central Serbia. 

Pests and diseases play significant role in oilseed rape yield. In Serbia pollen beetle 

is considered as most important pest of oilseed rape which can reduce yield by 80% 

(Sekulić and Kereši, 1996). Same authors stated that each year almost all oilseed rape fields 

are sprayed with insecticides, without being justified. Besides that, Čamprag et al. (2007); 

Štrbac et al. (2007) considers turnip sawfly (A. rosae) as a second most important oilseed 

rape pest in Europen countries. Losses caused by pollen beetle, of 70% yield in spring crops 

not treated with insecticide have been reported (Williams, 2010). Recent surveys of 

insecticide usage across Europe have revealed that crops of winter and spring rape 

commonly receive between one and four applications and that some receive more than five 

(Menzler-Hokkanen et al., 2006; Richardson, 2008). In many European countries farmers 

prefer to use insecticide against cabbage stem flea beetle in the autumn, ceutorhynchid stem 

weevils in the early spring, and pollen beetle and cabbage seed weevil in the spring (Alford, 

2003). So far, Milovanović, (2007) and Milovac et al, (2010) presented results of their 

research on oilseed rape pest in central Serbia and southern Bačka region. 

This paper is aimed to present data on identity and status of oilseed rape pests from 

observations which are done during 2010 and 2011 vegetation in fields located in northern 

Serbia. 


The trial was set up in an area of intensive oilseed rape growing, in the northern 

Serbia, near village Stari Žednik. Our experimental field was sown on mid September 2010 

which is optimal time for winter oilseed rape. No herbicides were used during autumn or 

spring. Variety we used for planting our field was Excalibur. Preceding crop was wheat. 

Sampling of insects started in October 2010 as soon as the young plants sprouted. 

Following methods and tools were used: 

Yellow water traps (YWT): 

Yellow water traps were placed into the soil in order to follow settlement and flight 

activity of harmful insects. Four traps were placed into the soil of experiment field in 50 m 

distance from each other. Installed traps were checked every week, caught insects were 

examined and pest species were counted. As soon as first pest species such as turnip sowfly 

(A. rosae) and cabbage stem flea beetle (Psylliodes chrysocephalus (Linnaeus 1758)) were 

registered, visual observations started. In the spring (air temperature above 5°C) YWT were 

used to control immigration of rape stem weevil (C. napi), cabbage stem weevil (C. 

pallidactylus), cabbage seed weevil (C. assimilis) and pollen beetle (M. aeneus). YWT 

were placed on holders at which they can be raised up to be always few centimeters above 

oilseed rape crops. YWT were checked weekly until flowering (BBCH 63).


Beating into trays: 

Beating into tray sampling is used in the spring to assess the abundance of stem 

beetles (C. pallidactylus and C. napi) and pollen beetle (M. aeneus), but later also cabbage 

seed weevil (C. assimilis) on the flower stands of the oilseed rape. As tray a dry YWT is 

used, which is placed below the plant as soon as it was possible to do and depending on the 

plant height. Later on it was below flower stand of the main raceme which is beaten by a 

stick so that stem beetles and pollen beetles fall into the tray. The method is applied every 3 

days on 10 plants in the surrounding of each of 8 sampling points. 

Visual checking 

During autumn 100 plants on 5 randomly chosen places within field were visually 

checked for presence of turnip sawfly (A. rosae) larvae and adults of stem flea beetle (P. 

chrysocephalus). 

Action thresholds used in this study for turnip sawfly (A. rosae) is 1 larva per 

oilseed rape plant and 1 adult of stem flea beetle (P. chrysocephalus) per meter of plant 

row. For pests which were assessed during spring following action thresholds were used: 

for pollen beetle (M. aeneus) 3-4 adults per plant in BBCH 50 (flower buds present, still 

enclosed by leaves), 7-8 adults per plant in BBCH 52-53 (flower buds free, level with the 

youngest leaves; flower buds visible from above (“green bud”)) and >8 adults per plant in 

BBCH 55-59 (individual flower buds (main inflorescence) visible but still closed; first 

petals visible, flower buds still closed (“yellow bud”)). For cabbage stem weevil (C. 

pallidactylus) we used threshold of 30 weevils/ YWT trap in 3 days or 6 weevils/25 plants. 

For rape stem weevil (C. napi) 10 weevils/trap in 3 days or 2 weevils/ 25 plants. For 

cabbage seed weevil (C. assimilis) threshold is 1 weevil/plant. For brassica pod midge 

(Dasineura brassicae ) threshold of 5 infested pods per plant was used. 

RESULTS 

Activity of turnip sawfly adults was recorded by YWT. In October was main flight 

period when we found on average 3 adults of turnip sawfly per YWT. At the beginning of 

November there was 05, turnip sawfly per YWT and up to the November 10 th and later 

there were no further flight. Visual checking was done 2 times at the end of October and at 

the beginning of November. We estimated on average 0,1 turnip sawfly larvae per oilseed 

rape plant which was below threshold number. However, on plants located in 2 out of 5 

checked places within field estimated number was close to 1 adult of sawfly per plant. On 

these spots damages were noticeable but average numbers lead us not to spray. 

During autumn oilseed rape crop was checked regularly for shot-holing of leaves 

and presence of cabbage stem flea beetle (P. chrysocephalus) and turnip sawfly (A. roseae). 

Cabbage stem flea beetle is feeding on leaves of emerging oilseed rape seedlings and later 

on older leaves as well as larvae of turnip sawfly. On YWT recorded activity of cabbage 

stem beetle was during whole autumn period up to the December when cold winter time 

started. During period up to 20 th October on average there was 4 adults of turnip sawfly, on 

1 st November – 19,5 adults, on 10 th November 19,5 adults and on 30 th November 23,5 

adults. Visual checking of number of adults of stem flea beetle (P. chrysocephalus) per 

meter of plant row was done 3 times with highest estimated number of 0,3 beetle per m of 

plant row. Leaf area (feeding scars) damaged by stem flea beetle feeding was estimated to 

be about 10%.

514 Pests of oilseed rape in northern Serbia 

One can conclude that autumn infestation by harmful insects (A. roseae and P. 

chrysocephalus ) was low and there were no need for insecticide spraying. 

YWT provided us evidence on C. pallidactilus and C. napi activity during February, 

March and April. Maximum number of their adults immigrating into oilseed rape fields was 

registered at the end of March at a time when the snow melted. Both species were 

numerous and caught number exceeds thresholds for spraying. Beating into trays confirmed 

presence of C. pallidactillus and C. napi in high numbers. So as soon as it was possible 

sprayer entered the field to apply insecticide (Hlorpirifos + cipermetrin). Spraying was 

done 25 th March. 

First pollen beetles were recorded by YWT, visually and by beating into trays. Their 

number was below threshold as it was estimated twice a week. Moreover, counting of eggs 

and larvae in the most sensitive period before opening oilseed rape flowers showed that on 

average there was < 1 imago per plant. First insecticide treatment covered feeding activity 

of pollen beetle. Due to low number of beetle, residual activity of applied insecticide and 

very fast oilseed rape development and beginning of flowering there were no further 

insecticide treatments. 

Assessment of pod damages from D. brassicae was done during pod stage of oilseed 

rape. Obtained results showed that on average 13 % of pods were infested. 

DISCUSSION 

In Serbia most harmful insect pest for oilseed rape is considered to be pollen beetle. 

(Sekulić and Kereši, 1996) becouse in some year’s massive outbreaks can reduce yeild 

significantly. Similar is with turnip sawfly (A. rosae) as a second most important oilseed 

rape pest (Čamprag et al., 2007; Štrbac et al., 2007). Our study showed that during 

2010/2011 growing season in northern regions of Srbia where oilseed rape production is 

concentrrated the most important pests are cabbage stem weevil (C. pallidactyllus) and rape 

stem weevil (C. napi) followed by brasssica pod midge (D. brassicae). Therefore, our 

experimental oilseed rape field was sprayed with insecticide at the end of March. 

Infestation by turnip sawfly (A. rosae) in autumn 2010 was increased but still below the 

need to insecticide application. Our results pointed out that integrated pest management and 

rational application of pesticides should be done only pest with regular pest status 

assessments using valid methods. 

Novel research on oilseed rape pest fauna, done by Milovac et al., (2010), showed C. 

pallidactilus as the most abundant in the region of Novi Sad. 


The paper is realized with financial support within project III 46008 “Development 

of integrated systems for pest management in plant production with an aim to overcome 

resistance and improve food quality and safety” funded by Ministry of Education and 

Science of the Republic of Serbia and SEEERA NET Project 051. 

REFERENCES 

EPPO (2003): Ceuthorhynchus napi and Ceuthorhynchus pallidactilus on rape- PP 1/219(1). 

Bulletin EPPO/OEPP, 33: 65-69.


Williams I. H. (2010): The Major Insect Pests of Oilseed Rape in Europe and Their 

Management: An Overview. In: “Biocontrol-Based Integrated Management of Oilseed 

Rape Pests”. Ed: Ingrid H. Williams, Springer, pp. 1-45. 

Directive 2003/30/EC of the European Parliament and of the Council of 8 May 2003. on the 

promotion of the use of biofuels or other renewable fuels for transport. Official Journal L 

123 of 17.5.2003. 

Statistical Yearbook (2010): Statistical Office of the Republic of Serbia. Belgrade 

Orlovius, K. (2003) Fertilizing for High Yield and Quality Oilseed Rape. IPI Bulletin No. 16. 

International Potash Institute. Basel, Switzerland 

FAO (2001): Production Yearbook. Volume 53. FAO Statistics Series No. 156. Food and 

Agriculture Organization of the United Nations: Rome. 

Alford, D.V. (2003): The Oilseed Rape Crop. In “Biocontrol of Oilseed Rape Pests” Edited by 

David V. Alford. Blackwell Science, pp 1-9. 

Sekulić, R ., Kereši, T. (1996): Ne suzbijati repičinog sjajnika (Meligethes aeneus F.) po svaku 

cenu. Biljni lekar. No 1, 23-29. 

Sekulić, R ., Kereši, T. (2007): Repičin sjajnik (Meligethes aeneus) najvažnija štetočina ozime 

uljane repice. Biljni lekar. No 4, 410-419. 

Čamprag, D., Sekulić, R., Kereši, T. (2007): Štetna fauna na poljima pod uljanom repicom i 

integralne mere zaštite. Biljni lekar. No. 4, 401.410. 

Štrbac, P., Kereši, T., Sekulić, R. (2007): Zaštita uljane repice od repičine lisne ose (Athalia 

rosae). Biljni lekar, No 4, 420-425. 

Menzler-Hokkanen I., Hokkanen HMT, Büchs W., Klukowski Z., Luik A., Nilsson C., Ulber 

B.,Williams I. (2006): Insect problems in European oilseed rape cultivation, and how to 

deal with them: The OSR farmers’ perspective. IOBC/wprs Bull 29(7): 91–94 

Richardson, DM. (2008): Summary of findings from a participant country pollen beetle 

questionnaire. EPPO Bull 38: 68–72. 

Milovac, Ž., Pešić, S., Kereši, T., Marinković, R. (2010): Weevils (Coleoptera: Curculionoidea) 

– Important members of rapeseed entomofauna in vicinity of Novi Sad. Kragujevac J. 

Sci. 32: 141-148. 

Milovanović, P. (2007): Štetni insekti na uljanoj repici u Srbiji. Zaštita bilja, 58: 25-53.

516 Potential of traps baited with aggregation attractant of the... 

International Symposium: Current Trends in Plant Protection UDK: 632.768.2:632.936 

Proceedings 633.63-276.82 

POTENTIAL OF TRAPS BAITED WITH AGGREGATION 

ATTRACTANT OF THE SUGAR-BEET WEEVIL 

IVAN SIVČEV 1 , IVAN TOMAŠEV 1 , TATJANA MARKOVIĆ 2 , MIROSLAV KOSTIĆ 2 , 

LAZAR SIVČEV 3 , DRAGA GRAORA 4 

1 Institute for Plant protection and Environment, T. Drajzera 9, Beograd, Serbia 

ivansivcev2011@gmail.com 

2 Institute for Medicinal Plants Research “Dr Josif Pancic”,Tadeuša Košćuška 9, 11000 Beograd, 

Serbia 

3 Scholar of the Ministry of Education and Science of the Republic of Serbia 

4 Faculty of Agriculture, University of Belgrade, Nemanjina 2, Zemun, Serbia. 

The sugar-beet weevil (Bothynoderes punctiventris Germar) (Coleoptera: Curculionidae) is an 

important pest of sugar-beet causing damages by feeding on young seedlings early in the spring. 

Sugar beet producers integrated several methods in order to control the pest. However, control of the 

weevil is still heavily depended on the use of significant amounts of insecticides. Discovery of 

aggregation attractant of sugar beet beetle offers possibility for mass trapping. In the traps baited with 

this attractant both sexes are captured. Results of our study show that sex ration of captured beetles 

are similar to sex ratio in naturally occurring populations. 

Key words: Bothynoderes (Cleonus) punctiventris, sex ratio, aggregation attractant, mass 

trapping, 

INTRODUCTION 

The sugar-beet weevil (Bothynoderes punctiventris Germar) is an important pest of 

sugar-beet in the areas with dryer climate throughout the central, eastern and southeastern 

parts of Europe (Hoffmann, 1966). During the outbreak periods the sugar-beet weevil is 

causing significant damages and therefore is considered as the most destructive pest. It was 

estimated (Sekulic et al., 1997a;Camprag, 1992) that during the twentieth century B. 

punctiventris destroyed over 2 millions ha of sugar-beet fields in Eastern Europe. 

Sugar beet producers integrated several methods in order to control the pest. This 

includes spatial rotation, suppression of beetles in the overwintering sites and finally 

control on the newly planted sugar beet fields where beetles are feeding on newly emerged 

seedlings. Despite this, control of the weevil is still depended on the use of significant 

amounts of insecticides. In Yugoslavia during 26 years of chlorinated carbohydrate 

insecticide usage (until their final ban in 1972) cca. 12,000 tons were applied to control 

sugar-beet pests (Camprag, 1992). Out of a total of 27 kg/ha pesticide use, 17 kg were 

insecticides to control the sugar-beet weevil, while in other field crops (i.e. wheat, maize, 

sunflower, etc.) up to 90% less insecticides had to be used (Markovic, 1988). In recent

Ivan Sivčev, Ivan Tomašev, Tatjana Marković,... 517 

years for foliar applications, monocrotophos and fenitrotion were the most used insecticides 

as well as chlorpirifos and fention (Sekulic et al, 1997b), which in 2003 were banned in the 

European Community . 

Recently a powerful synthetic attractant has been described for the sugar-beet weevil 

(Tóth et al., 2002a, b, 2006). It was discovered that the (E/Z)-3,3-dimethylcyclohexylidene) 

acetaldehyde isomeric mixture (grandlure III+IV) was active in attracting individuals of B. 

punctiventris adults. Both males and females were attracted to the traps (Tomašev et al, 

2007; Toth et al, 2007) 

This study is a part of a broader study on potential of mass trapping. The aim of this 

paper is to present results on gender issues of the sugar beet weevil population caught in 

traps baited with aggregation attractant. 


The trial was set up in sugar beet field at locality Bajmok. Pitfall traps baited with 

sugar beet weevil aggregation attractant were used in this study. Sets of 10 and 30 traps per 

ha were placed in 4 replicates in a zig zag manner. Each replicate covers surface of 1 ha. 

Within a period of duration of the trial (31 March – 15 April 2004) traps were checked 

weekly. Each baited trap was followed with unbaited trap. Five soil samples (50 x 50 x 50 

cm) from each replicate were checked for number and sex of overwintering beetles. 

RESULTS 

Results of the present study refer to sugar beet weevil population immigrating from 

overwintering sites to sugar beet fields. This population is responsible for damages to 

seedlings. Those female individuals who survived and successfully mated are laying eggs in 

this field. Therefore sex ratios of beetles present in the field and those which are captured in 

the baited traps were counted. We presume that beetles captured in unbaited traps are 

representing actual number of males and females. 

Results of the study showed that both males and females were captured in traps 

baited with aggregation attractant. In two different test with 10 and 30 traps /ha we obtained 

data showing similar sex ratio of the beetles captured in baited and unbaited traps. 

Percentage of females in population making damages to young sugar beet plants was 23% 

and 30%. Percentage of females captured in baited traps was from 26% to 31%. Percentage 

of females captured in unbaited traps was from 32% to 40%. On graph 1 one can see mean 

values of percentage of females captured in our trial. 

Sex ratio in baited and unbaited traps was similar, suggesting that attraction was 

equally strong for the two sexes, and thus sex ratio of captures in an attractant baited trap 

would represent the natural sex ratio of the population in the field. Since baited traps are 

capturing realistic proportion of females their potential use for mass trapping is making a 

sense. By mass trapping of such proportion of females we can expect that population can be 

significantly reduced. Further tests have to prove magnitude of this reduction.

518 Potential of traps baited with aggregation attractant of the... 

Figure 1. Sex ratio of sugar-beet weevil (B. punctiventris) in traps with or without the synthetic 

attractant and in soil samples in field tests in Serbia, 31 March – 15 April, 2004 

DISCUSSION 

Sugar beet weevil is an important pest of sugar beet. Its control is highly dependent 

on chemical insecticides which have adverse effects on environmental pollution. Intensive 

use of insecticides resulted in significant resistance development in some populations. 

Legislative regulations and environmental safety demands recently limited in majority of 

endangered countries a market of traditionally used insecticides. Therefore, demand for 

development of sustainable strategy of sugar beet weevil control is prominent. Other 

methods for pest population suppression are highly needed by sugar beet producers. 

It was found that the (E/Z)-3,3-dimethylcyclohexylidene) acetaldehyde isomeric 

mixture was active in attracting individuals of B. punctiventris adults. Both males and 

females were attracted to the traps and therefore attractant is described as aggregation 

attractant (Toth et al., 2002a, 2002b). 

Discovery of aggregation attractant (E/Z)-3,3-dimethylcyclohexylidene) 

acetaldehyde isomeric mixture is offering a possibility for developing and application of 

the new methods for sugar beet weevil population density monitoring and control by mass 

trapping technique. Preliminary results showed that mass trapping is powerful in reducing 

significant number of beetles in overwintering sites (Tomašev et al., 2007). 

It was demonstrated that the aggregation attractant at 10 and 30 trap/ha densities, 

sugar-beet weevil population was mass-trapped at the overwintering sites. Application of 

the traps shows good potential as a control method especially at population densities of 30 

000 insect/ha or below and may be capable of decreasing the population pressure of 

immigrating beetles to sites where sugar-beet is planted in the spring (Sivčev et al., 2005, 

Tomašev et al., 2005, Tomašev, et al., 2007) 

In contrast to the widely used pheromone traps for catching only males of 

lepidoptera, aggregation pheromones offers high perspectives in mass trapping in beetle 

pests where they are frequently found. In sugar beet weevil aggregation attractant is 

capturing both sexes; the impact of traps reducing the population should be larger. Also, in 

many coleopteran pests the damage-causing life stage is the adult, so the traps, by removing 

a hopefully large part of the population, may directly decrease damages (Tomasev et al., 

2007)

Ivan Sivčev, Ivan Tomašev, Tatjana Marković,... 519 


The paper is partially realized with financial support within project III 46008 

“Development of integrated systems for pest management in plant production with an aim 

to overcome resistance and improve food quality and safety” funded by Ministry of 


REFERENCES 

Čamprag, D. (1992): Pests of sugar-beet and integrated plant protection (in Serb.). Akademske 

besede, knjiga 29. Vojvodjanska Akademija nauka i umetnosti. Novi Sad. 

Hoffmann, A. (1966): Sous-famille des Cleoninae. In: A.S. Balachowsky (ed.), Entomologie 

appliquée ą l'agriculture, vol. 1. Masson et Cie Éditeurs, Paris pp. 953–981. 

Markovic, M. (1988): Biological and ecological aspects of pest control of main field crops in 

Vojvodina in 1986 (in Serb.). Zbornik radova Jugoslovenskog savetovanja o primeni 

pesticida. Opatija, 9:17–41. 

Sekulic, R., Keresi, T., Strbac, P.(1997b): Chemical control of sugar beet pests (in Serb.). Biljni 

lekar 2:209–218. 

Sekulic, R., Keresi, T., Strbac, P., Radin, Z. (1997a): The beet weevil (Bothynoderes 

punctiventris Germ.) – the most dangerous spring pest of sugar beet (in Serb.). Biljni 

lekar 2:164–173. 

Sivcev, I., Tóth, M., Tomasev, I., Ujváry, I. (2005): Effectiveness of different trap design in 

mass trapping of Bothynoderes punctiventris Germar. Abstracts of 4th Inernational 

Symposium on Sugar Beet Protection, 26-28 September, 2005, Novi Sad. pp. 62 

Tomasev, I. Tóth, M., Sivcev, I. (2005): Mass trapping of Bothynoderes punctiventris Germar 

overwintering populations. Abstracts of 4th Inernational Symposium on Sugar Beet 

Protection, 26-28 September, 2005, Novi Sad. pp. 71 

Tomasev, I., Sivcev, I., Ujvary, I., Toth, M. (2007): Attractant-baited traps for the sugar-beet 

weevil Bothynoderes (Cleonus) punctiventris: Preliminary study of application potential 

for mass trapping. Crop Protection, 26(9) 1459 -1464 

Tóth, M., Sivcev, I. & Ujváry, I. (2005): Aggregation attractant of Bothynoderes punctiventris 

Germar. Abstracts of 4th Inernational Symposium on Sugar Beet Protection, 26-28 

September, 2005, Novi Sad. pp. 57 

Tóth, M., Sivcev, I., Tomasev, I., Szarukán, I., Imrei, Z. Ujváry, I. (2002b): Development of a 

new pheromone trap for capturing the sugar-beet weevil (Bothynoderes punctiventris 

Germar.) (Coleoptera, Curculionidae). Növényvédelem 38:145–152. (in Hung.) 

Toth, M., Ujva ry, I., Sivcev, I., Imrei, Z., Szarukan, I., Farkas, O., Gomo ry, A ., Ga cs-Baitz, 

E., Francke, W. (2007): An aggregation attractant for the sugar-beet weevil 

Bothynoderes punctiventris. Entomol. Exp. Appl., 122: 124-132 

Tóth, M., Ujváry, I., Sivčev, I. (2002a): Selective insect bait and trap for Bothynoderes 

punctiventris beetles (in Hung.). Patent No. OTH P0202374, Hungarian Patent 

Authority, Budapest 22 p. 

Ujváry, I., Tóth, M., Sivcev, I., Tomasek, I., Szarukán, I., Imrei, Z., Francke, W., Gömöry, Á. 

(2002): Discovery of an attractant for the beet root weevil, Bothynoderes punctiventris 

(Coleoptera, Curculionidae). Book of Abstracts Vol. 1., 10th IUPAC Intl. congr. Chem. 

Crop Prot., Basel, August 4-9 2002, pp. 278.

520 Occurrence and molecular identification of western flower thrips,... 


Proceedings 

OCCURRENCE AND MOLECULAR IDENTIFICATION OF 

WESTERN FLOWER THRIPS, FRANKLINIELLA OCCIDENTALIS 

(PERGANDE), IN SERBIA 

JELENA JOVIĆ*, MILANA MITROVIĆ, TATJANA CVRKOVIĆ, OLIVER KRSTIĆ, IVO TOŠEVSKI 

Institute for Plant Protection and Environment, Department of Plant Pests, Banatska 33, 11080 

Zemun, Serbia 

*e-mail: jovic_biolab@yahoo.com 

The western flower thrips, Frankliniella occidentalis (Pergande), is one of the most 

destructive insect pests of greenhouse-grown crops. It causes direct damage to the plant by feeding on 

foliage and flowers and indirect damage by vectoring the tospoviruses. During 2010 and 2011 a 

survey was conducted in order to determine presence of F. occidentalis in greenhouse-grown crops in 

Serbia. Survey included inspection of pepper, tomato, onion, leek and cucmber crops. Thrips 

identification was performed by amplification of the mitochondrial cytochrome oxidase subunit I 

gene (COI) barcode region. The obtained COI gene sequences were subjected to comparison with the 

publicly available sequence data in the NCBI database. Presence of four thrips species was 

molecularly identified: Thrips tabaci, Haplothrips aculeatus, Frankliniella occidentalis and F. 

intonsa. F. occidentalis was identified on pepper at two locations in Serbia: Lukićevo in Central 

Banat district and Vojka in the Srem district. Confirmation of the presence and pest status of F. 

occidentalis in Serbia is of economic importance representing a significant finding for the 

management and control of tospoviruses in greenhouses-grown vegetables and ornamental crops. 

KEY WORDS: DNA barcoding, Frankliniella occidentalis, greenhouse vegetables, Impatient 

necrotic spot virus – INSV, occurrence, Tomato spotted wilt virus - TSWV 

INTRODUCTION 

The western flower thrips (WFT), Frankliniella occidentalis (Pergande), is an 

invasive species and one of the most destructive insect pests on greenhouse vegetable and 

ornamental crops (Kirk, 2002). It is the economically most important pest within the order 

Thysanoptera (reviewed in Yang et al., 2012). F. occidentalis causes direct damage to the 

plant by feeding on foliage and flowers and indirect damage by transmitting plantpathogenic 

tospoviruses Impatient necrotic spot virus - INSV and Tomato spotted wilt virus 

- TSWV (Prins and Goldbach, 1998). 

WFT is native to North America, but due to its invasive biology today it is present 

on every continent except Antarctica (Kirk and Terry, 2003). First record of F. occidentalis 

presence on the territory of the former Yugoslavia was made in 1988 in Macedonia, locality 

Kočani (Andjus and Vuković, 1991). Few years later, presence of the WFT was confirmed 

for Serbia as well (Andjus, 1992). Although damage caused by the thrips was recorded and

Jelena Jović, Milana Mitrović, Tatjana Cvrković, Oliver Krstić, Ivo Toševski 521 

possible role as a vector of tospoviruses supposed, no study dealing with the population 

genetics of WTF in Serbia was preformed. Due to the economic importance of thrips as 

pests in a greenhouse crop production worldwide, methods for precise identification of the 

thrips species applying molecular tools in species identification has became a standard as 

addition or alternative to classical methods of species identification (Mainali et al., 2008; 

Karimi et al., 2010). 

The aim of this study was to confirm presence and determine occurrence of F. 

occidentalis in Serbia using molecular biology tools as a method of species identification. 


Insect collection. 

Survey for the presence of F. occidentalis in greenhouse-grown crops in Serbia was 

conducted during 2010 and 2011 (Table 1). Survey included inspection of diverse vegetable 

crops grown in greenhouses on ten different localities in six districts of Serbia. Crops of 

pepper, tomato, leek, onion and cucumber were inspected. Presence of thrips on individual 

plant was identified by visual inspection of flowers and leaves for damage caused by direct 

feeding of the thrips. Individuals were caught either by beating the flowers and leaves over 

plastic tray and then conserved in 96% ethanol, or by placing the leaf directly into plastic 

tube with 96% ethanol. All samples were transported on 11°C to the laboratory and 

maintained in 96% ethanol on 4°C prior to the DNA analyzes. 

DNA extraction and PCR amplification. 

Each individual specimen was punctured using sterile needle on the ventrolateral 

side of the thorax and incubated overnight at 56°C in extraction buffer with proteinase K. 

Total genomic DNA was isolated using the DNeasy Blood & Tissue Kit (QIAGEN) 

following the manufacturer’s instructions. 

Amplification of the mitochondrial cytochrome oxidase subunit I gene (COI) 

barcode region, 709 bp in length including primers, was performed in a reaction primed 

with LCO1490 (5'-GGTCAACAAATCATAAAGATATTGG-3') and HCO2198 (5'- 

TAAACTTCAGGCTGACCAAAAAATCA-3') primer pair (Folmer et al., 1994). 

Polymerase chain reactions (PCR) contained High Yield Reaction Buffer A with Mg (1x), 

2.25mM MgCl2, 0.6mM of each dNTP, 0.5 µM of each primer and 1U of KAPATaq DNA 

polymerase (Kapabiosystems) in a 20µL final reaction volume. PCR cycles were carried 

out in a Mastercycler ep gradient S (Eppendorf) applying the following thermal protocol: 

initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation step at 95 °C 

for 1 min, annealing at 54°C for 1 min and elongation step at 72°C for 90 sec; final 

extension was performed at 72°C for 10 min. Prior to DNA sequencing, the PCR amplicons 

were examined by agarose gel electrophoresis and purified using the QIAquick PCR- 

Purification Kit (Qiagen) according to the manufacturer’s instructions. 

DNA sequencing and sequence comparison. 

Sequencing was performed on automated equipment by Macrogen Inc. (Seoul, 

South Korea) using the same primers as those that were used for the amplification. The 

obtained sequences were edited using FinchTV v.1.4.0 (www.geospiza.com), assembled 

using the Clustal W program integrated into MEGA5 software (Tamura et al. 2011) and 

deposited in the GenBank database under the accession numbers JX235929-31.


The obtained COI gene sequences of all thrips specimens analyzed in this study 

were subjected to comparison with the publicly available sequence data in the NCBI 

database (National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/) 

using a blastn algorithm (http://blast.ncbi.nlm.nih.gov/Blast.cgi). 

RESULTS 

Over two-year survey for quarantine thrips species in the greenhouse-grown crops in 

Serbia, ten localities in six administrative districts were inspected. Altogether, eleven 

samples of thrips were analyzed and identified using molecular tools. Presence of four 

thrips species was molecularly identified: Thrips tabaci, Haplothrips aculeatus, 

Frankliniella occidentalis and F. intonsa (Table 1). 

Majority of the analyzed specimens were belonging to the Thrips tabaci species 

complex. T. tabaci was found in Serbia to be associated with leek, onion, pepper and 

cucumber on six localities in Belgrade, Kolubara and Pčinja distict (Table 1). BLAST 

analysis revealed maximum sequence identity (100%) either with specimen under accession 

number AY196840 or with specimen AY196831, both originating from leek. Sequence 

comparison between them revealed 3.7% of genetic divergence, confirming previous 

finding of divergent lineages within T. tabaci (Bruner et al., 2004). 

On two localities in Banat region of Serbia, Vršac and Zrenjanin, presence of 

Haplothrips aculeatus was identified. In Vršac, thrips samples collected on tomato crops 

revealed to have mtCOI gene sequence of 100% homology with the specimen of H. 

aculeatus from China (GanBank acc. no. HQ605966). On the other hand, specimen 

sampled on pepper at locality Zrenjanin was the most similar with H. aculeatus originating 

from United Kingdom (FN545921) with 99% COI sequence homology, although with low 

"query coverage" (67%). Comparison of the COI gene sequences of the two specimens 

collected in Serbia revealed a high genetic divergence, with p-distance of 3.6%, indicating 

existence of two phylogenetic lineages within H. aculeatus.

Jelena Jović, Milana Mitrović, Tatjana Cvrković, Oliver Krstić, Ivo Toševski 523


Presence of the target thrips species, Frankliniella occidentalis was identified on 

pepper at two locations in Serbia: Lukićevo in Central Banat district and Vojka in the Srem 

district (Table 1). BLAST analysis of the COI gene revealed 100% identity of the 

sequenced specimens collected in Serbia with the specimens of F. occidentalis from 

Netherlands, China, South Africa, California, etc. (GenBank Acc. No. HQ697596, 

HQ697597, HQ605956, EU004556, GU148084). In addition, presence of another species 

within the genus Frankliniella, F. intonsa was identified also on pepper, in Kolubara 

district of Central Serbia. BLAST analysis of the COI sequence data of this specimen 

revealed 99% homology with the F. intonsa from China (HM246175). Using Clustal W 

analysis for COI gene sequence comparison we identified 6 nucleotide substitutions, all 

synonymous by type. 

DISCUSION 

In this study, the presence of F. occidentalis on the territory of Serbia was confirmed 

by molecular identification of the specimens collected on pepper originating from Central 

Banat and Srem distict of Serbia. Analysis of the mtDNA COI barcoding gene revealed 

presence of a single haplotype in both detected specimens, confirming low genetic diversity 

of F. occidentalis in its introduced range (Yang et al., 2012). In addition we molecularly 

identified presence of another Frankliniela species with ability to vector tospoviruses- F. 

intonsa. 

WFT is one of the most important vector of TSWV and INSV tospoviruses (Prins 

and Goldbach, 1998). Presence of the INSV was first recorded in Serbia in 2005 on 

different ornamental plants: Pelargonium, Begonia, Impatiens and Petunia (Krstić et al., 

2005). In addition, it was identified in mix infection with TSWV in samples of Dicentra, 

Petunia and Impatiens. On the other hand, TSWV is known to be present on the territory of 

Serbia for more than 50 years (reviewed in Krstić and Bulajić, 2007). Mostly it is 

associated with tobacco and pepper crops, bur recent findings prove its presence on much 

wider territory of Serbia and diverse ornamental plants and vegetables. In 2011 TSWV was 

identified for the first time to infect gerbera hybrid in Serbia (Stanković et al., 2011), while 

in 2012 as a cause of symptoms of extensive bleaching and chlorotic spots and streaks on 

onion and garlic (Stanković et al., 2012). 

Confirmation of the presence and pest status of F. occidentalis in Serbia is of 

economic importance representing a significant finding for the management and control of 

tospoviruses in greenhouses-grown vegetables and ornamental crops. Further research to 

confirm its presence in other parts of Serbia and other vegetable crops, as well as 

ornamental plants is needed to enable better management practice in control of the widely 

distributed tospoviruses in Serbia (Krstić and Bulajić, 2007). 


We thank the Ministry of Agriculture, Forestry and Water Management of the 

Republic of Serbia for supporting this programme in 2010 and 2011 (contract number 321- 

01-575/2011-11). This research was partly funded by grant III43001 from the Ministry of 

Education and Science of the Republic of Serbia.

Jelena Jović, Milana Mitrović, Tatjana Cvrković, Oliver Krstić, Ivo Toševski 525 

REFFERENCES 

Andjus, Lj., Vuković, M. (1991): Frankliniella occidentalis (Pergande, 1895) – new pest in 

glasshouses in Yugoslavia. Plant Protection 42, 69-72. 

Andjus, Lj. (1992): Nalaz Kalifornijskog tripsa u Srbiji. Jugoslovenski Simpozijum o zaštiti 

bilja, Vrnjačka Banja 1992, 80. 

Brunner, P. C., Chatzivassiliou, E. K., Katis N. I., Frey J. E. (2004): Host-associated genetic 

differentiation in Thrips tabaci (Insecta; Thysanoptera), as determined from mtDNA 

sequence data. Heredity, 93: 364–370. 

Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R. (1994): DNA primers for 


invertebrates. Molecular Marine Biology and Biotechnology 3, 294–299. 

Karimi J., Hassani-Kakhki M., Awal M. M. (2010):Identifying thrips (Insecta: Thysanoptera) 

using DNA Barcodes. Journal of Cell and Molecular Research 2 (1), 35-41. 

Kirk, W.D.J. 2002. The pest and vector from the West: Frankliniella occidentalis, pp. 33-42. In 

R. Marullo and L. Mound [eds.], Thrips and Tospoviruses: Proceedings of the 7th 

International Symposium on Thysanoptera. Australian National Insect Collection, 

Canberra, Australia. 

Kirk, W.D.J., Terry, L.I. (2003): The spread of the western flower thrips Frankliniella 

occidentalis (Pergande). Agricultural and Forest Entomology 5: 301–310. 

Krstić, B., Bulajić, A., Dukić, N. (2005): Occurrence of Tomato spotted wilt virus and Impatient 

necrotic spot virus in Serbia. XXX-th Meeting for Plant Protection in Republic of 

Macedonia and Ist Congress of Plant Protection "Environmental Concern and Food 

Safety". Proceeding of Articles: 85-88. 

Krstić, B., Bulajić, A. (2007): Karantinski virusi povrća i ukrasnih biljaka u zaštićenom 

prostoru. Univerzitet u Beogradu – Poljoprivredni fakultet, ISBN 978-86-7834-038-3, 

204 pp. 

Mainali, B. P. Shrestha, S. Lim, U. T. Kim, Y. (2008): Molecular markers of two sympatric 

species of the genus Frankliniella (Thysanoptera: Thripidae). Journal of Asia-Pacific 

Entomology 11(1), 45-48. 

Prins, M., Goldbach, R. (1998): The emerging problem of tospovirus infection and 

nonconventional methods of control. Trends in Microbiology 6: 31-35. 

Stanković, I., Bulajić, A., Vučurović, A., Ristić, D., Jović, J., Krstić, B. (2011): First report of 

Tomato spotted wilt virus on gerbera hybrida in Serbia. Plant disease, 95(2), 226-226. 

Stanković, I, Bulajić, A.,Vučurović, A., Ristić, D., Milojević, K., Nikolić, D., Krstić, B. (2012): 

First report of Tomato spotted wilt virus infecting onion and garlic in Serbia. Plant 

disease, 96(6), 918-918. 

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. (2011): MEGA5: 

Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary 

Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, 28, 

2731-2739. 

Yang X-M, Sun J-T, Xue X-F, Li J-B, Hong X-Y (2012) Invasion Genetics of the Western 

Flower Thrips in China: Evidence for Genetic Bottleneck, Hybridization and Bridgehead 

Effect. PLoS ONE 7(4): e34567. doi:10.1371/journal.pone.0034567

526 Biology and harmfulness of soft scale insects,... 


Proceedings 

BIOLOGY AND HARMFULNESS OF SOFT SCALE INSECTS 

(HEMIPTERA: COCCIDAE) ON THE GRAPEVINE 

DRAGA GRAORA 1 , LAZAR SIVČEV 2 , RADOSLAVA SPASIĆ 1 , IVAN SIVČEV 2 

1 University of Belgrade, Faculty of Agriculture 

2 Institute for Plant Protection and Environment, Belgrade 

Two species of soft scale insects from the family Coccidae, Pulvinaria vitis (L.) and 

Parthenolecanium persicae (Fabricius) have been determined in vineyard in Radmilovac locality 

(Belgrade). Their presence has been registered on individual trunks, where they have occured in a 

larger number, with visible lesions since 2007. Life cycle of these species was studied in the period 

2007. - 2009. Both species have one generation per year and overwinter at different developmental 

stages on woody parts of grapevine. P. vitis overwinters as a third instar larva and as female, while P. 

persice overwinters as second instar larva. Females of both species are formed at the end of April and 

the oviposition is in May. During vegetation, first and second instar larvae feed on leaves and shoots, 

whilst the overwintering stages concentrate on canes and trunks. Scale insects are physiological pests. 

Sucking juices from all above ground plant organs, they cause physiological weakening of the plant. 

Visible lesion symptoms are leaf yellowing and annual yield reduction, as well as the 

underdevelopment of canes or its drying. 

Key words: Pulvinaria vitis, Parthenolecanium persicae, Coccidae, grapevine, Serbia 

INTRODUCTION 

Scale insects from Coccidae family are mostly polyphagous pests inhabiting fruits, 

grapevine, forest trees and other perennial plants. Their size is in milimeters and the scale is 

a part of the insect’s body which cannot be separated from it. An outstanding sexual 

dimorphism is manifested in distinct body constitution of the insect. A female has mildly 

segmented body, without legs, antennae or wings, and with well developed mouthparts for 

piercing and sucking. A male has clear body segmentation with well developed antennae, 

legs and one pair of wings and stunted mouthparts. They develop through an incomplete 

metamorphosis. Larvae from which females develop, go through two or three larval stages, 

while larvae from which males develop, go through two larval stages and through prepupal 

and pupal stages. First and second instars larvae are mobile and used for the dispersion of 

the species. 

Scale insects are physiological pests. Sucking juices from the above ground parts of 

the plant, they cause distraction of many physiological processes in the plant, manifesting 

in the reduction in annual yield, leaves yellowing and falling, reduction in the yield and 

quality of grapes, and in case of an intensive attack, drying of plants. Besides, on honeydew 

as a product of scale insects’ excretion covering plant organs, saprophytic fungi also

Draga Graora, Lazar Sivčev, Radoslava Spasić, Ivan Sivčev 527 

develop, disturbing the photosynthesis of plants. Recent researches indicate that many 

species from Pulvinaria and Parthenolecanium genera, including species P. vitis and P. 

persicae, are vectors of plant viruses (Belli et al., 1994; OEPP/EPPO, 2008; Hommay et al., 

2009). 

In Palearctic region, 17 species of Coccidae (Kozar, 1998) have been determined, 

eight of which are present in the region of former Yugoslavia, and only three in Serbia: 

Parthenolecanium corni (Bouche), Parthenolecanium persicae (Fabricius) and Pulvinaria 

vitis (Linnaeus) (Ciglar, 1983; Tošić et al., 2003; Graora et al., 2006). 

On grapevine in Radmilovac locality, two species have been determined, Pulvinaria 

vitis and Parthenolecanium persicae. In the period from 2007 to 2009, the number of 

populations slightly increased, especially on some trunks, initiating the research of their life 

cycle and harmfulness. 


Biology and harmfulness of scale insects on grapevine was observed in the period 

from 2007 to 2009, on experimental field “Radmilovac“ (Belgrade). 

Plant material was sampled every 10 - 15 days. Parts of bark and two vine-shoots 30 

cm long were taken from each infested trunk. Examination of the presence and number of 

scale insects was carried out in laboratory. During the examination of infested parts of 

trunks, life cycle of scale insects was also followed, i.e. ovipositional period, number of 

laid eggs, development duration, number of generations and overwintering mode. 

In order to analyse morphological traits of scale insects and determine their species, 

permanent microscopic slides of females were made according to Kosztarab and Kozar 

(1988) method. 


In Radmilovac locality, on individual grapevine trunks, two new species of scale 

insects were determined, Pulvinaria vitis (Cottony grape scale) and Parthenolecanium 

persicae (European peach scale). These species clearly differ between themselves 

according to their morphological traits, especially female appearance. 

Female of P. vitis is 2,5 - 6,5 mm long, 1,5 - 6,5 mm wide, red-brown to dark brown 

(Fig. 1). Body ends with a white waxy ovisac, longer than female’s body. 

Female of P. persicae has elongated oval body, up to 8 mm long and 5 mm wide, 

brown, with longitudinal median dorsal keel, reddish-brown (Fig. 2).


Figure 1. P. vitis - female (orig.) 

Figure 2. P. persicae - female (orig.) 

Figure 3. P. vitis – colony on trunk (orig.) 

Figure 4. P. persicae - colony on trunk (orig.) 

Figure 5. P. persicae – colony on spurs (orig.) 

Figure 6. P. persicae – stunted trunk (orig.) 

Life cycle of P. vitis 

P. vitis has one generation per year. It overwinters as third instar larva and as a 

mated female on canes or under bark. In spring, overwintering larvae resume their


development and at the end of April form parthenogenetic females, whose oviposition was 

registered at the beginning of May. The hatching of larvae starts at the end of May and lasts 

two weeks. First instars develop until the beginning of August and then molt into second 

instars. Second instars from which males will develop, at the beginning of October, form a 

thin transparent scale under which prepupae develop, and at the end of October into pupae 

and males. Second instars of future females give third instars in October. Most of third 

instars overwinter and a few of them continue development and at the end of October form 

females which are fertilized by males and then overwinter. In spring, overwintering females 

resume their feeding and at the beginning of May lay eggs. Within this species it was 

determined that a part of the population has parthenogenetic reproducion and overwinter at 

larval stage, and a part has gamogenetic reproduction when a mated female overwinters. It 

was also concluded that regardless the overwintering mode, females lay eggs at the same 

time, at the beginning of May. One female lays approximately 4000 eggs in the white waxy 

ovisac placed at the end of the body. Eggs are pink. First instars move actively on the plant 

looking for a place suitable for feeding. Most often they inhabit shoots, leaf stems and 

leaves where they feed on plant juices, first from the reverse side and then from the front of 

the leaf. 

Life cycle of P. persicae 

P. persicae has one generation per year and overwinters at second instar larva on 

canes and trunk under bark flakes. In spring larvae resume development and at the end of 

April and beginning of May form females. During investigation, males were not registered, 

which shows that females reproduce exclusively by parthenogenesis. 

The beginning of oviposition is at the end of May and takes about 15 days. Each 

female lays approximately between 1000 and 2600 eggs under the scale. Eggs are white. 

Hatching of larvae begins in the middle of June and takes approximately 15 days. First 

instars move actively inhabiting shoots and leaves on which they feed sucking juices. In 

August they molt and give second instars present on leaves until October when they go 

down to thicker canes and cordon or to hidden places on trunk in order to overwinter. 

According to literature data up to date, in our country there was no detailed research 

of biology of the determined species. Acquired data on reproduction mode and life cycle 

are similar to those of foreign authors, citing that P. vitis in Palearctic region has 

gamogenetic and in North America and Canada parthenogenetic reproduction, while it was 

registered that P. persice has only parthenogenetic reproduction (Kosztarb and Kozar, 

1988; Pellizzari, 1997; Pfeiffer, 1997) 

Harmfulness and symptoms on grapevine 

During investigations, P. vitis and P. persicae were registered on some trunks and 

numerous specimens were found on less developed and already physiologically exhausted 

plants. 

Females of P. vitis inhabit lower parts of the trunk where they don’t form dense 

colonies (Fig. 3). Opposite to them, females of P. persicae are stuck together forming dense 

colonies on the trunk and cordons (Fig. 4 and 5). At the length of 10 cm of the plant, 10 

female P. vitis were registered, and over 50 female P. persicae. On one trunk there was 

mostly one species of scale insects and in rare mixed populations, P. persicae was always 

much more numerous. 

First and second instar larvae of both species feed by sucking juices from leaves, 

leaf stems and shoots. When on leaves, larvae first feed on the back along the nerves, and 

later on the front side. Due to the feeding, shoots have stunted development, leaves yellow


and it can even lead to premature drying and falling. Number of larvae per leaf varies and 

during investigation it was from about ten larvae of P. vitis, to 100 and more larvae of P. 

persicae. Near the end of vegetation, larvae of both species go down to branches and trunk 

where they resume feeding. Due to continuous attack, especially if already exhausted plants 

are infested, trunks have stunted development, like in Radmilovac in the investigated period 

(Fig. 6). 

Data on presence and harmfulness of scale insects on grapevine in Serbia are very 

scarce and relate primarily to their registration. In the lists of grapevine pests they are 

usually mentioned within the group of other species with no economic significance 

(Kovačević et al., 1960; Ciglar, 1983). There is more data for the species P. persicae, 

investigated as a significant pest of forest trees (Kozarževskaja and Vlainić, 1982), and is 

mentioned on grapevine, especially on Fruška Gora (Čamprag, 1999), and on stone fruits 

(Graora and Spasić, 2010). 

Although both species are polyphagous, according to many authors, more 

significance from the aspect of lesions and damages they have for grapevine (Borchsenius, 

1963; Kosztrab and Kozar, 1988; Foldi and Soria, 1989; Pellizzari, 1997; Stathas et al., 

2003). Their harmfulness on grapevine is enlarged by the fact that they are vectors of „leafroll 

virus“ (GLRaV) (OEPP/EPPO, 2008; Masten – Milek et al., 2008; Hommay et al., 

2009). 

REFERENCES 

Belli G, Fortusini A, Casati P, Bianco, P., Prati, S. (1994). Transmission of a grapevine leafroll 

associated closterovirus by the scale insect Pulvinaria vitis L. Rivista di Patologia 

Vegetale, 4:105–8. 

Borchsenius, N. S. (1963): Praktičeskij opredeljitelj kokcid (Coccoidea) kulturnih rastenij i 

lesnih porod SSSR. "Nauka", Leningrad, st. 311. 

Foldi, I., Soria, S. J. (1989): Los cochenilles nuisibles a la vigne en Amrrique du Sud 

(Homoptera:Coccoidea). Annales de la Societ~ Entomologique de France (N.S.), 25: 

411-430. 

Graora, Draga, Spasić, Radoslava (2010): Scale insects (hemiptera, Coccoidea) on stone fruit - 

trees in Serbia. Plant doctor, 4-5: 354-362. 

Graora, Draga, Spasić, Radoslava, Nikolić, Tatjana (2006): Prisustvo štitastih vaši iz familije 

Coccidae na vinovoj lozi. VIII savetovanje o zaštiti bilja. Zlatibor, 27. 11.– 01. 12. 

Zbornik rezimea, str. 113 – 114. 

Hommay, G., Le Maguet, J., Komar, V., Lemaire, O., Herrbach, E. (2009). Transmission of 

Grapevine leaf roll-associated virus-1 and -3 (Ampelovirus) and Grapevine virus A 

(Vitivirus) by natural populations of soft scales and mealybugs in the north-eastern 

French vineyard. Progrès Agricole et Viticole, 2009, hors-série, 286-287 – Extended 

Abstracts 16th Meeting of ICVG, Dijon, France, 31 août – 4 septembre 2009. 

Čamprag, D. (1999): Štetna fauna na vinovoj lozi u Jugoslaviji i susednim zemljama. Biljni 

lekar, 5-6: 499-505. 

Ciglar, I. (1983): Pulvinaria vitis. U: Priručnik izveštajne i prognozne službe zaštite 

poljoprivrednih kultura, (D.Čamprag, ed.). Savez društava za zaštitu bilja Jugoslavije 

Beograd, str. 597-598. 

Kosztarab. M., Kozar, F. (1988): Scale insects of Central Europe. Akademia Kiado, Budapest, 

pp. 456. 

Kovačević, Z., Kišpatić, J., Panjan, M. (1960): Bolesti i štetnci voćaka i vinove loze. 

Poljoprivredni nakladni zavod. Zagreb, pp. 416.


Kozar, F. (1998): Cotalogne of Paleartic Coccoidea. Plant Protection Institue, Budampest, pp. 

526. 

Kozarževskaja, Elga, Vlainić, A. 1982. Bioecological survey of scale insects (Homoptera: 

Coccoidae) on cultural flora of Belgrade. Plant Protection. 160: 183 – 202. 

Masten Milek, Tatjana, Bjeliš, M., Šimala, M. (2008). Intensity of scale insects infestation in 

relation to grapevine variety and soil type in Croatia. Cereal Research Communications 

36, Suppl. 5 Part 3, 1735-1738. 

OEPP/EPPO (2008): Pathogen-tested material of grapevine varieties and rootstocks Bulletin 

OEPP/EPPO Bulletin 38, 422–429. 

Pellizzari Giuseppina (1997): Grapevine. In: Soft Scale Insects. Their Biology, Natural Enemies 

and Control (Y. Ben-Dov and C. J. Hodgson, ed.). World Crop Pests, Vol. 7B. Elsevier, 

pp. 323 - 331. 

Pfeiffer, D. (1997): Deciduous fruit trees. In: Soft Scale Insects. Their Biology, Natural Enemies 

and Control (Y. Ben-Dov and C. J. Hodgson, ed.). World Crop Pests, Vol. 7B. Elsevier, 

pp. 293 - 322. 

Stathas, G. J., Eliopoulos, P. A., Bouras, S. L., Economou, L. P., Kontodimas, D. C. (2003): 

The scale Parthenolecanium persicae (Fabricius) on grapes in Greece. Conference 

Proceeding. In proceeding of: IOBC-WPRS working group, Integrated Control in 

Viticulture, 18th – 22nd March 2003, At Volos, Greece. 

Tošić, M., Dobrivojević, K., Žinžar, B. (2003): Zaštita vinove loze od bolesti, štetočina i korova. 

Institut za istraživanja u poljoprivredi Srbija, Beograd, st. 81.

532 Invasive insect and fish species in Moravica district 


Proceedings 597(497.11) 

INVASIVE INSECT AND FISH SPECIES IN MORAVICA DISTRICT 

MARKOVIĆ GORAN 1 , TANASKOVIĆ SNEŽANA 1 , SRETENOVIĆ DUŠICA 1 , RANĐIĆ DANKA 2 

1 University of Kragujevac, Faculty of Agronomy Čačak, Cara Dušana 34, Čačak, Serbia 

(stanasko@tfc.kg.ac.rs); 

2 Municipality Čačak, Župana Stracimira 2, 32 000 Čačak, Serbia 

The Moravica district is located in central and west part of Serbia. The variety of 

geomorphological, climate, hydrological and other environmental conditions resulted in the 

relatively large biodiversity of this region. The first record of Harmonia axyridis in Serbia 

was reported in 2008 from the Vorovo locality within the Fruška Gora National Park by 

Thalji and Stojanović (2008). During the late autumn of 2009, the first and mass occurrence 

of the species was noted at 19 sites in residential areas in the vicinity of the towns of Čačak 

and Gornji Milanovac (Moravica district). Additionally, the imagoes of H. axyridis were 

recorded in late October in the mentioned areas on the balconies of residential buildings. 

No allergic reactions in humans to H. axyridis were reported. The water courses of the 

district belong to the Zapadna Morava river basin. The ichthyofauna of the Zapadna 

Morava and tributaries of this river including 33 species from 9 families, with 7 non-native 

species, belongs to 4 families (Salmonidae, Cyprinidae, Centrarchidae and Ictaluridae). 

Some of the non-native species (Carassius gibelio, Pseudorasbora parva, Lepomis 

gibbosus and Ameiurus nebulosus) are invasive, endangering the native ichthyofauna of this 

region. 

Key words: Harmonia axyridis, invasive fish species, ichthyofauna 

INTRODUCTION 

The Moravički district (total area of 3016 km 2 ) is located in central and west part of 

Serbia. The District is composed of municipalities Čačak (636 km 2 ), Gornji Milanovac 

(836km 2 ), Lučani (454km 2 ) and Ivanjica (1090 km 2 ). The climate of the region is 

moderately continental with elements of mountain climate on higher altitude. The relief is 

very diverse. The most surface area are under agricultural crops (58.9%) and forests 

(36.1%). The hydrological network of this territory forms the Zapadna Morava River (309 

km total length) and lower courses of its tributaries (Fig.1). 

There are four multipurpose reservoirs in the district (the eutrophic reservoir 

Međuvršje is the greatest -Table 1). The variety of geomorphological, climate, hydrological 

and other environmental conditions resulted in relatively large biodiversity of this region. In 

the territory of district there are natural protected areas of the Republic of Serbia – the part

Marković Goran, Tanasković Snežana, Sretenović Dušica, Ranđić Danka 533 

of biosphere reserve Golija-Studenica, landscape of outstanding features in the Ovčar- 

Kablar gorge and some natural monuments. 

Figure 1. Meander of river West Morava in the Ovčar–Kablar Gorge 

The invasive species H. axyridis (Coleoptera, Coccinelidae) was first reported in 

Serbia in August 2008 from the Fruška Gora National Park (Thalji and Stojanović 2008), 

located in the northern part of the country (the Vojvodina province). Due to its predatory 

and competitive abilities, the ladybird concerned can have adverse effects on the indigenous 

entomofauna of some regions, including the populations of ladybirds and other 

aphidophagous insects. 

Table 1. The reservoirs of the Moravički district 

Reservoir 

Year of 

construction 

Area 

(km 2 ) 

Watercourse, 

river 

Purpose 

Energy production, protection from 

flood 

Međuvršje 1953 1.5 

Z. Morava 

Ovčar-Kablar 1953 0.72 Energy production 

Gornji Banjani 1969 0.07 Dičina 

Water supply, retention of river 

deposit 

Goli Kamen 1982 0.075 Crnovrški brook Technical use, protection from flood 

The adverse impacts of H. axyridis also include fruit damage in late autumn and 

tainting the flavour of wine when accidentally harvested and processed along with grapes 

(Pickering et al. 2004; Galvan et al. 2007; Staverløk et al. 2007). Moreover, H. axyridis has 

been reported to increasingly search for overwintering sites in residential buildings within 

new geographic regions. Exposure to the species may also affect humans by triggering 

allergic reactions (Hauelsman et al. 2002). 

The presence of non-native (allochthonous) fish in open waters is the result of areal 

expansion, unskilled stocking, escape from aquaculture facilities, stocking for sport 

fisheries, struggle against eutrophication and other reasons. Although it is often difficult to 

determine the impact of non-native species on the autochthonous ichthyofauna, generally 

the impact is negative (expressed in violation of existing food chains, competition for 

places of spawning, emergence of new parasites, etc.).



The entomological and ichthyological investigations were conducted in the period of 

2000-2012. Several collection methods were used, depending on the type of habitat. 

Collections of lady bird - Several collection methods were used, depending on the 

type of habitat on different locations (surrounding of cities Čačak and Gornji Milanovac - 

20 villages and 6 sites in the cities). The specimens were collected by shaking them off the 

host plants and structures, using an aspirator or by hand-picking individual specimens. The 

collected specimens were transferred from flacons into 'self-lock' cuvettes to allow easy 

manipulation and then were refrigerated. The identification of collected insects is carried 

out by standard procedure (Kuznetsov, 1993). 

The ichtyophauna collections – The specimens were colleted by standard fishing 

equipment (nets and hooks) from different locations (the Međuvršje reservoir and 

tributaries of Z. Morava - Moravica, Dičina, Kamenica and some streams). The 

identification of fish specimens was carried out by a standard procedure (Simonović, 2001). 

RESULTS 

This invasive lady bird species H. axyridis was detected in 2009 in the 16 villages 

and in the four urban locations of the cities Čačak and Gornji Milanovac. In 2010 and 2011 

the species expanded about 100 km from the first location in 2009. At the end of May 2010 

and June 2011 we registered this invasive species on bean aphid colony (Aphis fabae) in 

alfalfa on fiddle dock (Rumex pulcher L.) and in apple orchard (colony Dysaphis 

plantaginea). The identification of the specimens collected suggested that all three forms 

(Fig. 2) of the invasive ladybird H. axyridis - succinea, spectabilis and conspicua - were 

found within the studied area. During the period, no disturbances in the human population 

were reported (Public Health Agency Čačak). 

Figure 2: Variations in colour forms of the collected Harmonia axyridis (Pallas 1773)


The cases of insect aggregations on the sun-facing exposure of the buildings - 

usually a southern or south western exposure, and on the light-coloured surfaces of 

residential buildings were notified at the end of October (20-25 October 2009 - 2011) and 

in mid or late November (14-17 November 2009 and 21-27 November 2010 and 2011). 

During this three-year period, no disturbances in the human population were reported, as 

expected in view of the results of earlier investigation (Goetz, 2007). 

The general hydroecological conditions are favorable for ichthyoproduction. The 

ichthyofauna of the Moravički district watercourses including 33 species from 9 families, 

with 7 non-native species, belongs to 5 families (Salmonidae, Cyprinidae, Centrarchidae 

and Ictaluridae - Table 2). 

Table 2. The non-native fish species in the Moravički District watercourses 

Families Common name Scientific name 

Salmonidae Rainbow trout Oncorhynchus mykiss 

Grass carp 

Ctenopharyngodon idella 

Cyprinidae 

Silver carp 

Hypophthalmichthys molitrix 

Prussian carp 

Carassius gibelio 

Topmouth gudgeon 

Pseudorasbora parva 

Centrarchidae Pumpkinseed Lepomis gibbosus 

Ictaluridae Brown bullhead Ameiurus nebulosus 

The rainbow trout (O. mykiss) is a non-native fish of the highest commercial 

significance in Serbian aquaculture (Marković et al., 2011). The presence was registered in 

some mountain streams in the Ivanjica municipality. Its population is probably being 

associated with the escapes from trout farms. The members of “Chinese carps” – 

herbivorous grass carp (C. idella) and planktivorous filter-feeding silver carp (H. molitrix) 

are registered only in the Međuvršje reservoir (the most important biotope for ichthyo 

production in this area). Prussian carp (C. gibelio) is the most widesperead non-native fish 

species in Serbian watercourses. Despite expressed fluctuacions in the number (the first 

record in the Međuvršje reservoir in 1984), Prussian carp is very invasive species. 

Topmouth gudgeon (P. parva), pumpkinseed (L. gibbosus - Fig. 3) and brown bullhead (A. 

nebulosus) are also very invasive fish and show good adaptability to environmental 

conditions in district reservoirs.


Figure 3. Pumpkinseed (Lepomis gibbosus) – an invasive fish species 

DISCUSSION 

Given the fact that ladybirds as members of the Serbian entomofauna have not been 

sufficiently investigated (Tanasković, 1996; Tanasković and Thalji, 1998; Thalji and 

Tanasković, 2006; Thalji et al., 2009; Tanasković et al., 2009), monitoring of this insect 

group should be conducted, particularly in view of the current records of the invasive 

multicoloured Asian ladybird H. axyridis from a number of locations in Serbia. Adequate 

control measures should be explored for Asian ladybird and developed considering harmful 

effects on exposed ecosystems and potential health risks for the human population. The 

measures should particularly focus on indoor insect control, considering the potentially 

deleterious effects of biocides on humans. 

The ichthyofauna of Serbia includes 23 non-native species (from 11 families) 

(Lenhardt et al., 2011; Marković et al., 2012). The living activities of O. mykiss, coupled 

with stream course regulation and water deficiency, have led to decrease in the population 

number of autochthonous salmonid brown trout (Salmo trutta fario). Due to a low 

population number of C. idella, they have not bigger impact on autochthonous 

ichthyofauna. The negative effect of C. gibelio is reflected in possible competition for food 

and places for reproduction with common carp (Cyprinus carpio). P. parva, L. gibbosus 

and A. nebulosus have negative effects on native (autochthonous) fish species by feeding on 

the bottom fauna, fish roe, fish larvae and fingerling, coupled with the competition for 

habitat and spawning sites. Propagation of these non-native species endangered 

autochthonous fish assemblages. 

CONCLUSION 

Insects are very diverse group of organisms. In the conditions of developed various 

agriculture, biodiversity is exposed to permanent risk of devastation. But alien or invasive 

species are not bad per se. Some of them may become harmful, as H.axyridis, and it is the 

reason for reaction. We should explore establishment of this coccinellid in this region of 

Serbia, its potential interactions with native species and presence and undesirable effects on


fruits in this leading productions area. Also, a potential allergenic agent in human and 

control measure in open field and residential areas should be investigated. 

Hydroecological conditions in the Moravički District are generally favorable for 

ichthyoproduction. The ichthyofauna of the Moravički District watercourses including 33 

species from 9 families, with 7 non-native species belongs to 5 families. Some of nonnative 

species (especially C. gibelio, P. parva, L. gibbosus and A. nebulosus) are invasive 

and endangered native ichthyofauna of this region. 


The research was conducted within the STAR project AAP 024, funded by the 

Ministry of Agriculture, Trade, Forestry and Water Management of the Republic of Serbia. 

We thank Milevica Bojović, Magister of Philology for encouragement and help. 

REFERENCES 

Goetz, D.W. (2007): Harmonia axyridis ladybug hypersensitivity in clinical allergy practice. 

Allergy Asthma Proceedings. 28:50–57. 

Kuznecov, V.N. (1993): Zhuki-kokcinellidy (Coleoptera, Coccinellidae) Dalnego Vostoka 

Rossii [Ladybirds of the Far East of Russia]. 1 pp 183; Dal'nauka. Vladivostok, 1993. 

Lenhardt M., Marković, G., Hegediš, A., Maletin, S., Ćirković, M. Marković Z. (2011): Nonnative 

and translocated fish species in Serbia and their impact on the native 

ichthyofauna. Reviews in Fish Biology and Fisheries, 21,407-421. 

Marković, G., Ćirković, M., Maletin, S. (2012): The role of allochthonous (non-native) fish 

species in Serbian aquaculture. Journal of Central European Agriculture (in press). 

Marković, Z., Stanković, M., Dulić, Z., Živić, I., Rašković, B., Spasić, M., Poleksić V. (2011): 

Aquaculture and fishery in Serbia – status and potentials. Proceedings of 5 th International 

Conference Aquaculture & Fishery. Belgrade, Serbia, June 1-3, 36-40. 

Simonović, P. (2001): Fishes of Serbia. NNK International, Institute of Nature Protection, 

Biological Faculty of the Belgrade University, Belgrade. 

Tanasković S. (1996): Dynamics populations of Coccinelidae in pear orchard. Book of Abstract, 

71. V kongres ekologa Jugoslavije. Belgrade, Yugoslavia. 

Tanasković S. and Thalji, R. (1998): Dynamics populations of Coccinelidae in pear orchard. 

Contemporary Agriculture, 46(31):391-395. 

Tanasković S., Thalji, R., Marković, G. (2009): Asian multicoloured lady beetle Harmonia 

axyridis Pallas 1773 (Coleoptera, Coccinellidae). Book of Proceedings, XIV 

International Symposium On Biotechnology, 14(15):271-276. 

Thalji, R, Stojanović, D., Galić, Z. (2009): Two ladybirds (Coleoptera, Coccinellidae) new to 

the fauna of Serbia. Plant doctor. 37(6):613-619. 

Thalji, R. and Tanasković S. (2006): Little known paleoarctic Coccinella magnifica Redt., a new 

member of ladybirds fauna in Serbia. Plant doctor, 34(3):204-207. 

Thalji, R. and Stojanović, D. (2008): First sighting of the invasive ladybird Harmonia xyridis 

Pallas (Coleoptera, Coccinellidae)in Serbia. Plant doctor. 36(6):389-393. 

Pickering GJ, Lin J, Reynolds A, Soleas G, Riesen R (2006): The evaluation of remedial 

treatments for the wine affected by Harmonia axyridis. International Journal of Food 

Science & Technology 41:77–86. 

Staverløkk A, Sæthre MG, Hågvar EB (2007): A review of the biology of the invasive harlequin 

lady bird Harmonia axyridis (Pallas, 1773) (Coleoptera, Coccinellidae). Norwegian 

Journal of Entomology. 54, 97-104.


Galvan TL, Burkness EC, Hutchison WD (2007): Enumerative and binomial sequential 

sampling plans for the multicolored Asian lady beetle (Coleoptera: Coccinellidae) in 

wine grapes. Journal of Economic Entomology, 100:1000–1010. 

Hauelsman MF, Kovach J, Jasinski J, Young C, Eisley B (2002): Multicolored Asian lady beetle 

(Harmonia axyridis) as a nuisance pest in households in Ohio. in Jones SC, Zhai J, 

Robinson W H (eds). Proceedings of 4 th International Conference of Urban Pests, 7–10 

July, 2002. pp. 243-250. Charleston, SC, USA.


International Symposium: Current trends in plant protection – Proceedings 

EFFICACY OF CONVERSION OF CONVENTIONAL TO 

ORGANIC GRAPE AND WINE PRODUCTION 

BRANISLAVA SIVČEV, BLAGA RADOVANOVIĆ, IVAN SIVČEV, ZORICA RANKOVIĆ-VASIĆ, 

NEVENA PETROVIĆ, LJUBOMIR ŽIVOTIĆ 

This paper focuses on the procedure of converting conventional to organic grape and wine 

production in accordance with the Law on Organic Production and corresponding regulations. The 

experiment was conducted in the regions of South Banat and Central Serbia from April 2008 to 

October 2010. In 2008, conventional production was applied at both localities and in 2009 and 2010 

the conventional production was converted to organic production. In 1970, Riesling Italico variety 

/Kober 5 BB rootstock was planted on the area of 3ha in South Banat in the wine growing region of 

Vršac in Gudurica wine production facility. In Central Serbia, in Grocka wine growing region - 

experimental field ’’Radmilovac” of the Faculty of Agriculture - Riesling variety/Kober 5BB 

rootstock was planted on the area of 1ha in 1995. Plantation density at both localities was 3330 

grapevines per hectare with 1m tall trunk and the training systems were double Guyot and asymmetric 

cordon training system. The first year of disease control included conventional preparations for the 

control of main pests and diseases. The second and third year of investigation included disease 

control with copper, sulfur and pyrethrin. The number and period of treatments during one year 

depended on the weather conditions and set insect pheromone traps. GPS technology was used for the 

positioning of experimental plots and data base was created in GIS. Yield and grape quality were 

monitored. According to the results conventional and organic grape vine growing showed no 

differences in grape quantity and quality and wine sensory properties. Vine disease and pest control 

was proved to be acceptably efficient with preparations based on copper, sulfur and pyrethrin in both 

regions. 

Key words: grape vine protection, organic production, grape yield 

INTRODUCTION 

Organic agriculture, as well as viticulture and wine production, represent a “holistic 

production management system that emphasizes and propagates healthy eco – system, 

biodiversity, biological cycle and soil biological activity. It is based on practical knowledge 

applied on farms considering that regional conditions require locally adapted systems ’’ 

(IFOAM, 2005). As Trioli and Hofmann (2009) simplified it, organic viticulture is the 

implementation of procedures applied in organic agriculture to produce the best possible 

quality of grape and wine. System of growing, soil, disease and pest control is all aspects 

that are considered with the aim of improving the quality and safety of wine and table 

grapevine cultivars in organic production. 

Protection of grape vine in organic production focuses on the causal agents of grape 

vine diseases and pests that are the same as those occurring in conventional production.

540 Efficacy of conversion of conventional to organic grape and wine production 

Both types of protection have the same goal but the difference is the way of control. In 

organic production, control is based first on preventive measures intended to diminish the 

attack and then the allowed preparations from the list are applied (Sivčev et al., 2010a). In 

organic grape production insecticides of plant origin, plant oils, powders, insecticidal soaps 

that are selective, narrow-spectrum and of lower toxicity and biological preparations are 

used. More frequent application is required with these types of preparations. Copper and 

sulfur based fungicides are leading products in grape vine disease control. Contemporary 

research focuses on the reduction in application quantity, discovery of adequate substitute 

that would be equally efficient, selection of varieties more tolerable to pests and diseases 

(Sivčev et al., 2010b). 

This paper focuses on the comparison of conventional production (2008) with the 

years of conversion (2009, 2010) in respect of the yield and quality of Riesling Italico and 

Riesling varieties of grape and wine. 


In 2008, conventional production was applied at both localities and in 2009 and 

2010 the conventional production was converted to the organic production. In 1970, 

Riesling Italico variety /Kober 5 BB rootstock was planted on the area of 3ha in the wine 

growing region of Vršac. Riesling variety/Kober 5BB rootstock was planted on the area of 

1ha in 1995 in Grocka wine growing region. Plantation density at both localities was the 

same, 3330 grapevines per hectare, and the training systems were double Guyot and 

asymmetric cordon training system. 

In 2008 the protection program included application of conventional preparations for 

the control of pest and disesase causal agents (Tab.1). 

Table 1. Treatments applied for grapevine protection in 2008 

Date 

May, 21 

June, 7 

June, 14 

June, 28 

July, 10 

July, 27 

August, 7 


Growth of shoot apex up to 10 grown 

leaves 


Flowering with 80-100% of open flowers 



«pea» size berries prior to cluster 

ripening 

The beginning of ripening 



Cabrio Top BASF 


Mical flash Bayer 

Collis BASF 

Lanate® 25 WP Agromarket 

Acrobat MZ BASF 

Collis BASF 


Collis BASF 


Collis BASF 

Captan 50 WP Agromarket 




In 2009 and 2010 preparations based on copper, sulfur and pyrethrin were applied 

(Tab. 2). Wet conditions in the flowering phase required more treatments in 2009; there 

were 8 treatments in total. The preparations applied were Funguran OH (1.7kg/ha), 

Thiovit® Jet 80WG (2.9 kg/ha) and Pyros (150 ml/ha) in the second and fifth treatment.



Date 

May, 19 

May, 29 

June, 8 

June, 26 

July, 6 

July, 18 

August, 5 

August, 21 


Growth of shoot apex up to 10 grown 

leaves 





«pea» size berries prior to cluster ripening 


Middle of ripening phase 







Pyros Serbios 

Funguran OHAgromarket 






Pyros Serbios 


Cosan WP 



Funguran OH Agromarket* 

Thiovit® Jet 80WG* Syngenta 

*Treatment applied in Gudurica only – wine growing region of Vršac 

A total of 7 treatments were applied in 2010 and the preparations used were 

Kocide® 2000 (1.7 kg/ha), Cosan WP (2.6 kg/ha) and Pyros (100 ml/ha) which was applied 

only once, at the beginning of the grape ripening phase (Tab.3). Ampelotechnical measures 

were standard, grass in rows was cut manually, soil between the rows was tilled and planted 

with grass seed mixture (fodder peas +barley) and incorporated in the withering phase. 

Table 3. Protection program in 2010 

Date 

May, 26 

June, 9 

June, 21 

June, 30 

July, 13 

July, 28 

August, 13 


Growth of shoot apex up to 10 grown leaves 





«pea» size berries prior to cluster ripening 


Applied fungicides and 

insecticides 



Cosan WP 


Cosan WP 


Cosan WP 


Cosan WP 


Cosan WP 


Cosan WP 

Funguran OH Dupont 

Cosan WP Pyros Serbios 

In 2009 soil properties at the depths of 30 and 60 cm were tested (pH of H20, pH of 

KCl, accessible phosphor and potassium, humus content), and grape yield indicators (yield 

and number of clusters per grapevine) were analyzed geostatistically; soil sampling scheme

542 Efficacy of conversion of conventional to organic grape and wine production 

and grapevine monitoring was regular, with distance of 10 m in the row and interrow 

distance of 14 m. Every sampling site was identified by GPS device. Such a sampling 

scheme provided appropriate coverage of 0.71 ha with respect to the total area of 1 ha of 

experimental field «Radmilovac» and 1.26 ha with respect to the total area of 3 ha in 

Gudurica. The recorded data were analyzed statistically in a software program SPSS 17.0. 

The aim was to determine the existence of correlation between soil and yield parameters. 

All analyses were conducted separately for each locality. 

Chemical and sensory analyses of produced wines were conducted in the Laboratory 

of fermentation Technology at the Institute of Food Technology and Biochemistry of the 

Faculty of Agriculture, University of Belgrade. The same procedure was applied in wine 

production in 2009 and 2010. Degustation of young wines was performed. 


Grape vine protection in 2009 and 2010 was performed with copper and sulfur based 

products listed as acceptable for plant protection in organic production in Serbia, and with 

natural pyrethrin based insecticide which is on the list of EU – Regulation (EEC) No 

2092/91-ANNEX II. Preventive treatments were applied in 2009 and 2010 on the 

experimental field «Radmilovac» and wine production facility Gudurica which is within the 

company «Vršački vinogradi». The results were positive. The only exception was part of 

the plot on the experimental field «Radmilovac» where downy mildew and rottening 

occurred in 2009 because agrotechnical measures were not taken on time: grass cutting in 

row and shallow soil tillage. The attacks of grape berry moth and other pests were below 

damage threshold. Eight treatments with 6.8 kg/ha of cupric hydroxides were applied in 

Gudurica in 2009. Pyrethrum was used more in 2009 (2 treatments) than in 2010. Six 

treatments with 6 kg/ha of cupric hydroxides were applied in 2010. 

Due to vineyard variability, the entire plot should be analyzed rather than its small 

part, which was the case with the experiments conducted in the past (Bishop and Lark, 

2006; Panten et al. 2010). Spearman rank correlation test was used for testing the 

correlation between soil properties and yield indicators because the regular data distribution 

was not determined by detailed analysis. The following correlations were determined: 

correlation between the number of clusters and pH of H20 (r=0.370, p=0.017 at first depth 

and r=0.331, p=0.035 at second depth), correlation between the number of clusters and pH 

of KCl (r=0.446, p=0.003 at first depth and r=0.478, p=0.002 at second depth), as well as 

the correlation between the yield and pH of KCl (r=0.325, p=0.038 at first depth and 

r=0.339, p=0.030 at second depth). 

Spearman rank correlation test was conducted based on the data from Gudurica 

locality and it showed that there was no correlation between the measured quantities at any 

depth. However, the fact that vineyard had a lot of empty space at the end of its 

exploitation should be taken into consideration. 

The yield varied widely at both localities. In the first year of investigation the yield 

was higher than in the second and third year, but the recorded differences did not show any 

statistical significance. Results in the world have shown that grape purchase price has 

increased by 20% to 40% with respect to the grape produced conventionally (Granastein et 

al. 2009). This compensates the yield which is lower in the process of conversion. 

Grapes were harvested in the phase of technological maturity and had 100% healthy 

phytosanitary conditions. According to the degustation of Riesling Italico variety in 2009 

and 2010 the wine was clear, with mild and undeveloped flavor, moderately full, with hard


taste and slight variety aroma. Riesling variety gave better wine with distinguished variety 

aroma, clear, of full flavor with slight sugar remains. 

Figure 1. Grape yield and number of clusters per grapevine on EF «Radmilovac», 

Riesling variety 

We selected the vineyard in full growth (Riesling variety -EF «Radmilovac») and at 

the end of the exploitation period (Riesling Italico -«Vršački vinogradi» company). Copper, 

sulfur and pyrethrin based preparations were efficient which was confirmed by yield and 

healthy condition of grapes at both localities. 


This study is partially funded by the Ministry of Education and Science of Republic 

of Serbia through the projects 20093 and 31063. 

REFERENCES 

Bishop T:E:A: and Lark R.M. (2006): The geostatistic analysis of experiments at the landscapescale. 

Geoderma 133, 87-106. 

Granatstein, D., Kirby E., Willer H. (2009) The World of Organic Agriculture. Statistics and 

Emerging Trends 2009. IFOAM and FiBL Report, www.organic-world.net 

IFOAM (2005): Principles of Organic Agriculture. 

http://www.ifoam.org/organic_facts/principles 

Panten, K. and Bramly R. G. V. (2011): Viticultural expermatation using whole blocks: 

Evaluation of there floor management option. Australian Journal of Grape and Wine 

Research 17, 136-146. 

Sivčev B., Sivčev I., Ranković-Vasić Z (2010a): Plant protection products in organic grapevine 

growing. Journal of Agriculture Sciences Vol. 55 No 1, 103-122 

Sivčev B., Sivčev I., Ranković-Vasić Z (2010a): Natural process and use of natural material in 

organic viticulture. Journal of Agriculture Sciences Vol. 55 No 2, 195-215. 

Trioli, G., Hofmann, U. (2009): ORWINE code of good organic viticultureand wine making. In 

Hofmann, U. (Ed.) ECOVIN-federal Association of Organic Winw-Producer. 

Oppenheim, Germany.

544 Cannibalism in Hippodamia variegata Goeze (Coleoptera: Coccinellidae)... 


Proceedings 597(497.11) 

CANNIBALISM IN HIPPODAMIA VARIEGATA GOEZE 

(COLEOPTERA: COCCINELLIDAE) UNDER LABORATORY 

CONDITIONS 

REZA JAFARI 

Faculty of Agriculture Science, Islamic Azad University, Boroujerd Branch, Boroujerd, Iran. 

e-mail: jafari_po@yahoo.com 

Cannibalism is a common phenomena amongst coccinellids and serves as a vital alternative 

feeding strategy which can prolong survival during periods of prey scarcity. Cannibalism of larvae 

and adult of Hippodamia variegata Goeze (Coleoptera, Coccinellidae) was studied in the laboratory 

conditions (25±1°C, 60±5 % RH and 16h L: 8h D). In the first experiment, different larval instars and 

adults were transferred into Petri dishes near the eggs separately. Results showed that average egg 

cannibalism by 1 st , 2 nd , 3 rd , 4 th instars larvae and adult were 3, 6, 9, 21 and 23.5 respectively. In the 

second experiment, older larval instars (2 nd , 3 rd and 4 th ) and adults transferred into Petri dishes near 

the younger instars larvae separately. Results showed that younger larvae were eaten by the older 

instars. A linear correlation curve showed the dependency of cannibalism on the developmental stages 

of H. variegata. The results obtained here provide information about the cannibalism of H. variegata 

that might be useful for IPM programs because may disrupt a biological control of pest aphids. 

Key words: ladybirds, Integrated Pest Management, Hippodamia variegata, cannibalism 

INTRODUCTION 

Cannibalism is defined as a frequent behavior in carnivorous animals when 

individuals eat other individuals of the same species (Miesner et al., 2011). Ladybirds 

(Coleoptera: Coccinellidae) are holometabolous insects and as such begin their life cycle as 

an egg, which hatches to give rise to a larva that generally passes through four instars 

before pupation and metamorphosis into an adult. With only a few exceptions, the 

aphidophagous species lay their eggs in clusters and the coccidophagous species lay their 

eggs singly or in very small groups (Majerus, 1994; Dixon, 2000). 

The majority of ladybirds are carnivorous, both the larvae and the adults feeding on 

aphids (Hemiptera: Aphididae), which cause damages in agricultural crops. Cannibalism is 

an important mortality factor in natural populations of several species of ladybird beetles 

(Osawa, 1989; 1993; Hironori and Katsuhiro, 1997). 

Ladybird beetles are known to be voracious predators of plant pests such as aphids (Hodek, 

1973; Gordon, 1985). They have been used for biological control against scales, aphids, and 

other pest insects (Obrycki and Kring, 1998). 

Hippodamia variegata Goeze is aphidopgagous species. In the absence of food the 

risk of cannibalism greatly increases (Agarwala and Dixon, 1992). Cannibalism is common

Reza Jafari 545 

in aphidophagous ladybirds and in nature often reduces juvenile survival dramatically 

(Dixon, 2000). Egg cannibalism by larvae is common in Coccinellidae and is known to be 

advantageous for the cannibals. Furthermore, larvae of aphidophagous ladybirds usually 

produce an oviposition-deterring pheromone, which inhibits oviposition by females 

(Martini et al., 2009). 

Colonies may increase the incidence of cannibalism in many species (Fox, 1975). In 

ladybirds, eggs cannibalism by larvae and adults in the field has been recorded for several 

species (Mills, 1982; Takahashi, 1989; Osawa, 1989). In Japan, H. axyridis, with high 

ability of prey searching and reproduction and with the density-dependent and selfregulatory 

population regulation through various types of cannibalism, maintains a stable 

population in heterogeneous and temporal habitats (Osawa, 2009). Study conducted by 

Osawa and Ohashin (2008) showed that the percentage of cannibalism per hatched larval 

cluster in H. yedoensis was 3.36 times larger than that in H. axyridis. Lack of research on 

the biology and its beneficial utilization led to the present work. Purpose of this research is 

to the study a phenomenon of cannibalism in H. variegata under laboratory conditions. This 

is important in biological control because cannibalism reduces the efficiency of ladybirds. 


To maintain the culture of black bean aphid (Aphis fabae), sugar beet (Beta vulgaris) 

plants were grown in the micro-plots sized 2x3 meter and maintained at the experimental 

field of Faculty of Agricultural Sciences, Boroujerd Isalamic Azad University, Iran. Aphis 

fabae and H. variegata were collected from the unsprayed sugar beet fields and reared on 

planted beets in micro-plots. Population of aphids and ladybirds rapidly increased where 

after some pairs of ladybirds were selected for oviposition. The selected pairs were kept in 

separate plexiglas cage (6x11x23 cm 3 ) to get the batches of eggs for single cohort offspring 

to minimize the variation in the experiments. A blotting paper was spread over its inner 

surface for egg laying. Two experiments were conducted: in the first experiment, 50 eggs 

were laid, with help of soft hair brush, and transferred in other Petri dishes (6x11x23 cm 3 ) 

separately. Then different larval instars (1 st , 2 nd , 3 rd and 4 th instars) and adults from stock 

culture were obtained and kept starved for 24 hours before each trial to homogenize their 

hunger level, then transferred into Petri dishes near the eggs separately. Experiments were 

carried out in ten replicates. The eggs were observed regularly (for 24 hours in 6 hours 

interval) and number of eggs consumed (cannibalized) by each individual larva or adult in 

each run, was calculated and recorded. 

In the second experiment, some of the first instars larvae from stock culture were 

obtained and transferred into Petri dishes separately. Then older larval instars ( 2 nd , 3 rd and 

4 th instars) and adults from stock culture were obtained and kept starved for 24 hours before 

each trial to homogenize their hunger level, then transferred into Petri dishes near the first 

instars larvae separately. The same experiments were conducted on 2 nd , 3 rd and 4 th larval 

instars taking care for each larval instar, so that the older larval instars were placed together 

in Petri dishes. Experiments were carried out in ten replicates for each run. The larvae were 

observed regularly (24 hours with 6 hours interval) and numbers of larvae consumed 

(cannibalized) by each individual larva or adult in each run, were calculated and recorded. 

Differences in consuming and cannibalism were tested by analysis of variance 

(ANOVA). If significant differences were detected, multiple comparison were made using 

Duncan ’s Multiple Range test (p


16L: 8D) at Faculty of Agricultural Sciences, Boroujerd Islamic Azad University, 

Boroujerd, Iran, during the year 2010. 

RESULTS 

The average cannibalism of different developmental stages of H. variegata is presented in Fig. 

1. The average cannibalism of eggs by larval instars 1, 2, 3, 4 and adults were 3, 6, 9, 21 and 

23.5 respectively. Number of eggs consumed increased the older the larval instars. The results of 

the ANOVA showed a significant difference between the cannibalism of eggs and growth stages 

(P< 0.05). Duncan test results also showed that the average egg cannibalism and developmental 

stages of H. variegata are at different levels. Our investigation had shown how all 

developmental stages except pupa can consume eggs. The mean cannibalism of different 

developmental stages of H. variegata, is presented in Fig. 2. The average adult cannibalism rate 

for larval instars 1, 2, 3, 4 and pupa were 5.4, 3.5, 1.5, 0 and 1.5 respectively. The results 

showed that adults are feeding on all developmental stages except 4 th grubs and themselves. 

Average fourth grubs cannibalism rate from larvae instars 1, 2, 3, 4, and pupa were 6.4, 5.4, 3.5, 

0 and 3.5 respectively. 

Figure 1. Comparasion of avrage cannibalism 

between egg and other developmental stages of H. variegata 

The results showed that 4 th instars fed on all developmental stages except themselves 

and adults. Both adults and fourth instars larvae do not consume themselves and each other. 

Average third grub cannibalism rate from larvae instars 1, 2, 3, 4, and pupa were 4.5 ,1.5 , 0 , 0 

and 0 respectively. Also 2 nd grub expressed a mean cannibalism of 3.1 by feeding only on 1 st 

grub. The results showed that the larval instars of the same age who does not feed itself. 

The results of the ANOVA showed that significant difference exists between the cannibalism 

rate and growth different stages (P< 0.05). Duncan test results also showed that the average 

cannibalism from growth different stages and developmental stages of H .variegata are at 

different levels. Between average adult feeding of larvae and pupa were not significant 

difference (Fig. 2).


Figre 2. Comparison of average cannibalism 

between Adult and 4 th instar larva of H. variegata 

DISCUSSION 

Results showed that highest and lowest egg cannibalism rates were associated with 

adult and first grub respectively. Rahimkhan et al. (2003) also shared the same opinion. 

Eggs were more sensitive to cannibalism than other growth stages, which corresponds to 

findings of other researches (Mills, 1982; Takahashi, 1989; Osawa, 1989). Mills (1989) 

showed that larvae of the ladybird eat the eggs of their own species and this cannibalism 

increases as egg density rises. 

Experiments by Rahimkhan et al., (2003) with C. septempunctata revealed that 

fourth instar larvae were voracious and consumed. So far, few studies have been done on 

cannibalism of H. variegata. Laboratory studies in Europe also demonstrated the strong 

tendency of H. axyridis to prey on larvae of indigenous ladybirds (Burgio et al., 2002; Sato 

and Dixon, 2004; Felix and Soares, 2004; Noia et al., 2008; Ware and Majerus, 2008). 

Cannibalism and intraguild predation are both common phenomena amongst 

aphidophagous coccinellids and serve as vital alternative feeding strategies which can 

prolong survival during periods of aphid scarcity (Ware et al., 2008). When larvae of H. 

axyridis were paired together on aphid-infested plants, no cannibalism between them was 

detected (Alhmedi , 2010) . 

There are several ways to combat the cannibalism. The extent of egg predation 

depends on the defensive alkaloids present in eggs of individual species (Agarwala and 

Dixon, 1992; Sloggett and Davis, 2010). Lady beetles avoid egg predation by reducing 

oviposition where other adults are present, ovipositing on plants associated with less 

exposure or incidence of intraguild predation (Seagraves, 2009). In aphidophagous 

ladybirds, larvae reflexively exude hemolymph, i.e. reflex bleeding, when disturbed. The 

80% of eggs of C. septempunctata brucki were cannibalized when no H. axyridis 

hemolymph was present; however, only 20% of eggs were cannibalized when H. axyridis 

hemolymph was present (Sato et al., 2009). There is a worry therefore that such intraguild 

predation could disrupt biological control of pest aphids.


REFERENCES 

1. Agarwala, B. K., Dixon, A. F. G. (1992): Laboratory study of cannibalism and interspecific 

predation in ladybirds. Ecological Entomology, 17: 303–309. 

2. Alhmedi, A., Haubruge, E., Francis, F. (2010): Intraguild interactions and aphid predators: 

biological efficiency of Harmonia axyridis and Episyrphus balteatus. Journal of Applied 

Entomology, 134(1): 34-44. 

3. Burgio, G., Santi, F., Maini, S. (2002): On intra-guild predation and cannibalism in Harmonia 

axyridis (Pallas) and Adalia bipunctata L. (Coleoptera: Coccinellidae). Biological 

Control, 24:110–116. 

4. Felix, S., Soares, A.O. (2004): Intraguild predation between the aphidophagous ladybird 

beetles Harmonia axyridis and Coccinella undecimpunctata (Coleoptera: Coccinellidae): 

the role of body weight. European Journal of Entomology, 101:237–242. 

5. Fox, L. R. (1975): Cannibalism in animal populations. Annual Review of Ecology and 

Systematic, 6: 87-106. 

6. Gordon, R. D. (1985): The Coccinellidae (Coleoptera) of America north of Mexico. Journal of 

New York Entomological Society, 93: 1-912. 

7. Hodek, I. (1973): Biology of Coccinellidae. Czechoslovak. Academy of Science Prague, 

260pp. 

8. Martini, X., Haccou, P., Olivieri, I., Hemptinne, J. L. (2009): Evolution of cannibalism and 

female's response to oviposition-deterring pheromone in aphidophagous predators. 

Journal of Animal Ecology, 78 ( 5): 964-972. 

9. Meisner, M. H., Harmon, J. P., Ives, A. R. (2011): Response of coccinellid larvae to 

conspecific and heterospecific larval tracks: a mechanism that reduces cannibalism and 

intraguild predation. Environmental Entomology, 40 (1): 103-110. 

10. Mills, N. J. (1989): Voracity, cannibalism and coccinellid predation. Annual Applied 

Biology, 101: 144-148. 

11. Noia, M., Borges, I., Soares, A. O. (2008): Intraguild predation between the aphidophagous 

ladybird beetles Harmonia axyridis and Coccinella undecimpunctata (Coleoptera: 

Coccinellidae): the role of intra and extraguild prey densities. Biological Control, 

46:140–146. 

12. Obrycki, J. J., Kring, T. J. (1998): Predaceous Coccinellidae in biological control. Annual 

Review of Entomology, 43:295–321. 

13. Osawa, N. (1989): Sibling and non-sibling cannibalism by larvae of ladybeetle Harmonia 

axyridis in the field. Research Population Ecology, 31:153- 160. 

14. Osawa, N., Ohashi, K. (2008): Sympatric coexistence of sibling species Harmonia yedoensis 

and H. axyridis (Coleoptera: Coccinellidae) and the roles of maternal investment through 

egg and sibling cannibalism. European Journal of Entomology, 105(3):445-454. 

15. Osawa, N. ( 2009): The ecology of Harmonia axyridis in its native range. Working Group 

"Benefits and Risks of Exotic Biological Control Agents". Proceedings of the first 

meeting at Engelberg, Switzerland, 6-10 September 2009. 

16. Polis, G. (1981): The evolutions and dynamics of intraspecific predation. Annual Review of 

Ecology and Systematic, 12: 225-251. 

17. Rahim Khan, M., Rafique Khan M., Hussein, M. Y. (2003): Cannibalism and interspecific 

predation in ladybird beetle Coccinella sptempunctata (L.) in laboratory. Pakistan 

Journal of Biological Science, 6(24):2013-2016. 

18. Sato, S., Dixon, A. F. G. (2004): Effect of intraguild predation on the survival and 

development of three species of aphidophagous ladybirds: consequences for invasive 

species. Agricultural For Entomology, 6:21–24. 

19. Sato, S., Kushibuchi, K., Yasuda, H. (2009): Effect of reflex bleeding of a predatory 

ladybird beetle, Harmonia axyridis (Pallas) (Coleoptera: Coccinellidae), as a means of


avoiding intraguild predation and its cost. Applied Entomology and Zoology, 44(2):203- 

206. 

20. Seagraves, M. P. (2009): Lady beetle oviposition behavior in response to the trophic 

environment. Biological Control, 51(2):313-322. 

21. Sloggett, J. J., Davis, A. J. (2010): Eating chemically defended prey: alkaloid metabolism in 

an invasive ladybird predator of other ladybirds (Coleoptera: Coccinellidae). Journal of 

Experimental Biology, 213:237–241. 

22. Takahashi, K. (1989): Intra and inter-specific predation in ladybeetle in spring alfalfa field. 

Japan Journal of Entomology, 77: 199-203. 

23. Ware, R. L., Yguel, B., Majerus, M. E. N. (2007): Effects of larval diet on female 

reproductive output of the European coccinellid Adalia bipunctata and the invasive 

species Harmonia axyridis (Coleoptera: Coccinellidae). European Journal of 

Entomology, 105(3): 437-443. 

24. Ware, R., Majerus, M. E. N. (2008): Intraguild predation of immature stages of British and 

Japanese coccinellids by the invasive ladybird Harmonia axyridis. Biological Control, 

53:169–188.

550 Effect of some medical plants extract on predation efficiency and fertility of... 

International Symposium: Current Trends in Plant Protection UDK: 595.763:[615.32:582 

Proceedings 

EFFECT OF SOME MEDICAL PLANTS EXTRACT ON 

PREDATION EFFICIENCY AND FERTILITY OF LADY BEETLE 

COCCINELLA UNDECUMPUNCTATA L. 

(COLEOPTERA: COCCINELLIDAE) 

SAHIL K. AL-JAMIL AND MOHAMMAD F. EDAN 

Plant protection Department- College of Agriculture and Forestry 

Mosul – Iraq 

sahilaljameel@yahoo.com 

This study was conducted to determine the predation efficiency and fertility of the Lady bird 

beetle Coccinella undecumpunctata L.(Coleoptera: Coccinellidae) reared on the green peach aphid 

Myzus persicae (Homoptera: Aphididae) treated directly and indirectly with aqueous leaves extract of 

the three medical plants Mentha viridis, Myrtus commnuis, Eucalyptus camaldulensis in 

concentrations of 3% and 6%. The results show significant effects on the mean percentage of the 

predation efficiency for the larval instars reared on the green peach aphid treated directly with 

Eucalyptus camaldulensis 6% extract. Predation efficiency for the four larval instars was 5.60, 22.11, 

24.80 and 26.11% in comparison with 4.2, 14.11, 21.81 and 24.0% in control. The indirect treatment 

of aphids with the same extract of 6% significantly affected the mean percentage efficiency of the 

four instars larvae. The results showed that predation efficiency of adults reached its maximum when 

the paired lady bird beetle fed on the green peach aphid treated directly with Eucalyptus 

camaldulensis of 6%. The results showed the significant effect of the extracts on the fertility of C. 

undecumpunctata particularly by direct treatment of the aphids. 

Key words: Coccinella undecumpunctata, medical plants, predation efficiency, fertility 

INTRODUCTION 

Integrated pest management includes a biological control as one of the measures in 

suppressing pest populations under economic threshold by the action of parasitoids 

predators and pathogens (Ameter, 1967). Aphids are one of the famous groups of plant 

pests, a reason for which their natural enemies have received high attention for the mass 

rearing and releasing as potential biological control agents (Mandor and Warren, 2000). 

Coccinella undecumpunctata one of the most active predator from the Coccinellidae family 

that feeds on different sap sucking pests including aphids, whiteflies, jassids and scale 

insects. This predator has a short life cycle with high reproduction rate and a number of 

generations per year (Omkar and Pervez, 2002). 

This study was carried out in Mosul – Iraq with the aim to increase the predation 

efficiency by using the extract of medical plants available in fields.

Sahil K., Al-jamil and Mahammad F. Edan 551 


Three medical plants Mentha viridis, Myrtus commnuis and Eucalyptus 

camaldulensis, were collected in the Mosul fields for the extraction from leaves which were 

washed and macerated to the dust and placed in clean glass tubes. 

Extraction method: To get the water extract of medical plants, 10 g of dust was 

mixed with 100 ml of distilled water and put in the shaker for about 24 h. After that the 

solution was filtrated with filter paper and concentrated by heating at 23 0 C and put in a cool 

room at 4 0 C. 

Concentrations: The preliminary tests showed that 3% and 6% concentrations are 

suitable to treat the aphids the C. undecumpunctata will feed upon. 

Treatment method: Two methods were used to treat the aphids, first directly by 

putting the aphids in the tube containing 3% or 6% extract of the medical plants for about 3 

sec and after that aphids were placed on the filter paper for about 10 min. After the 

treatment aphids were than offered to larvae and adults of C. undecumpunctata. The second 

method is indirect treatment by putting the 1 ml of extract (3% or 6%) in Petri dish and than 

put the larvae and adults of the predator and aphids together to study the predation. Control 

included distilled water also heated at 23 0 C and kept at relative humidity of 50 %. 

The aphid colonies were taken from peach trees infested by Myzus persicae. The 

colony of C. undecumpunctata was reared by placing the 10 couples in a plastic jar of 5 lit 

in volume containing aphids and covered with gauze lid. 

The experiments were conducted in the laboratory conditions at 18-23 0 C and 50– 

55% of relative humidity. The predation efficiency was calculated by putting the first instar 

larvae in Petri dish treated with 1ml of each concentration from each medical plants extract 

by direct and indirect treatment with 5 replicates for each treatment using the formula: % 

predation efficiency = predation efficiency for each larvae instar\ total of prey x 100. 

Statistical analysis: Data were statistically analyzed using CRBD design and tested by 

Duncan test. 


Larval predation efficiency percentage: results of the Duncan test at 0.05 level 

(Table 1) show the significant effect of the medical plants extract type, its concentration 

and the treatment method. The highest predation efficiency of 26.11% was recorded for C. 

undecumpunctata forth larval instars feeding on the aphids treated directly with 6% of the 

E. camaldulensis. The lowest percentage of 4.11% was registered in the first larval instar 

which fed on the aphids treated directly with the 6% of M. viridis. The effect of the 

treatment method on the percentage of predation efficiency of larvae of C. 

undecumpunctata is noticeable where the mean 15.48% was registered when the aphids 

were directly treated with an extract whereas 9.89% in the indirect treatment. 

The same table shows the correlation between predation and larval instar of C. 

undecumpunctata with the lowest percentage of 2.24% registered for the first instar feeding 

on the aphids treated with 3% extract of Mentha viridis while the highest 26.4% was 

recorded for the forth larval instar consuming the aphids treated with 3% extract of 

Eucalyptus camaldulensis. A significant effect of the treatment methods was recorded on 

the percentage of predation efficiency of the larval instars of C. undecumpunctata which 

was 9.89% and 15.48% for direct and indirect treatment method respectively.

552 Effect of some medical plants extract on predation efficiency and fertility of... 

Table 1: Effect of medical plants extract, its concentration and treatment methods on predation 

efficiency of C. undecum punctata 

Treatment 

effect 

15.48 

b 

9.89 

a 

Predation efficiency % 

Stage 

Treatment 

Stage 

effect 

E. camaldulensis M. communis M. viridis 

method 

Control 

6% 3% 6% 3% 6% 3% 

4.99 a 4.22 b 5.6 c 4.56 b 4.96 b 4.23 b 4.11 b 2.24 a 1 

14.87 b 14.11 b 22.11 d 15.4 c 16.90 c 14.18 b 13.01 b 11.08 a 2 

19.60 b 21.81 c 24.8 d 21.1 c 23.11 d 18.01 b 18.60 b 14.16 a 3 Directly 

23.58 c 24.0 b 26.11 c 26.4 c 25.70 c 23.15 b 24.24 b 20.18 a 4 

45.6 d 50.0 d 51.1 c 40.0 ab 50.6 c 44.11 b 40.1 ab 81 .41a Adult 

4.64 b 5.6 c 4.46 b 4.81 b 5.41 c 4.11 b 2.18 a 1 

16.11 bc 16.11 cd 15.06 b 15.11 b 16.11 bc 12.11 a 11.18 a 2 

20.18 c 22.8 c 20.11 c 21.60 c 18.80 bc 16.75 b 13.61 a 3 Indirectly 

22.16 b 25.6 c 23.6 b 23.08 b 26.11 c 19.88 a 19.66 a 4 

50.0 c 56.3 c 48.6 b 49.0 c 46.6 b 40.6 b 23.11 a Adult 

43.67b 43.05 b 18.12 a Extract Effect 

Adult predation efficiency percentage: the results of the Duncan test are presented in 

the Table 1 showing a significant effect of the type of the extract, concentration and the 

treatment method on the adults predation efficiency. The percentage reached 81.41% when 

adults fed on the aphids treated directly with M. viridis 3% extract.The significant 

difference was recorded in the dose of extract which the adults of C. undecumpunctata 

consumed that is it was much higher in the test with direct application of the extracts 

compared to the indirect method. 

The effect of medical plants extract, their concentration and the treatment method of 

the aphids on the fertility of C. undecumpunctata was recorded for couples feeding on the 

specimens of Myzus persicae treated directly with 6% extract of Mentha viridis. From these 

results we can conclude that 3% and 6% are suitable to increase the predation efficiency 

and fertility of C. undecumpunctata because the extracts contain different amino acids 

needed for the predator foraging (Giles et-al 2002). 

REFERENCES 

Ameter, R.H. (1967). Present and future systematics of Coccinellidae in North America. Ann. 

Rev. Entomol. 60, 162-170. 

Giles, K. L., R. D. Madden, R. Stockland, M. E. Payton and J. W. Dill With (2000). Host plants 

affect predator fitness via the nutritional value of herbivore prey investigation of a plantaphid-lady 

bird beetle system. Biocontrol (1):1-21. 

Mandor, B. E. and Warren L. J. (2000). Unconditioned responses to colour in the predatory 

Coccinellids (Coleoptera: Coccinellidae). Eur. J. Entomol. 97 (4):463-467. 

Omkar, G. M. and Pervez (2002). Ecology of aphidophagous lady bird beetle C. 

septumpunctata L. (Coccinellidae: Coleoptera). A review. J. Aphidol. 16: 175 -201.

Dušanka Jerinić-Prodanović 553 


Proceedings 

ALIEN SPECIES OF JUMPING PLANT LICE (HEMIPTERA: 

PSYLLOIDEA) IN SERBIA 

DUŠANKA JERINIĆ-PRODANOVIĆ 

University of Belgrade, Faculty of Agriculture, Nemanjina 6, 11080 Zemun, Serbia 

E-mail: dusanka@agrif.bg.ac.rs 

Five species of invasive jumping plant-lice have been determined from Serbia. Two species 

were introduced into Europe from other continents (Acizzia jamatonica (Kuwayama) and Trioza 

neglecta Loginova, 1978), while the following three species Calophya rhois (Löw, 1877), Homotoma 

ficus (Linnaeus, 1758) and Cacopsylla pulchella (Löw, 1877) are originally European, having 

extended their habitat from the Medatiterranean Basin to the North of Europe. Distribution, 

morphology and biology of the determined species of jumping plant-lice are studied in this 

manuscript. 

Key words: Psylloidea, jumping plant-lice, Serbia, alien species 

INTRODUCTION 

Psyllids or jumping plant-lice are small sup-sucking insects, 1-10 mm long. 

Together with white flies, aphids and scale insects they constitute suborder Sternorrhyncha 

within the order Hemiptera. They usually develop on woody dicotyledons (Burckhardt, 

1994), except for several species from genus Livia, developing on monocotyledons. Most 

species have very restricted host plant ranges. More than three-quarters of psylloid species 

are free-living in larval stages, while other develop in open or closed galls. Australian 

species from subfamilies Spondyliaspidinae, Pachypsyllinae and Macrocorsinae build waxy 

coverings, called lerps. 

Damage on plants can be induced either directly by sap-sucking, or by the excretion 

of honey-dew while feeding, which is suitable for sooty mold development. Several species 

of jumping plant-lice are vectors of bacterial or viral pathogens, such as phytoplasma in the 

first place, so they pose a potential danger for cultivated plants. Small body size and 

unobtrusive colour enables them to be transferred over longer dinstances by wind or with 

host plant. 

They are distributed in all biogeographical regions, with the highest diversity in 

tropical and southern temperate regions (BURCKHARDT and BASSET, 2000). There have 

been 3850 species of jumping plant-lice described in the world so far (Malenovsky, et. al., 

2012). In Europe 282 species have been registered, among which 14 have been determined 

as invasive. From family Psyllidae, 11 species have been determined and from family 

Triozidae three species (Mifsud et. al., 2010).

554 Alien species of jumping plant lice (Hemiptera:Psylloidea) in Serbia 


The fauna of jumping plant-lice (Psylloidea) was investigated in the period from 

2000 to 2011 in Serbia. Jumping plant-lice were collected from different localities. Most of 

the investigated localities were agro-biocoenoses, settlements and ruderal habitats. Adults 

were collected by an exhaustor and larvae of different developmental stages were collected 

together with damaged plants. 

Collected larvae were reared in laboratory conditions in Petri dishes until eclosion of 

adults. Both adults and a part of five-instar larvae were fixed in 70% ethyl alcohol for 

further analysis. 

Nymphs and adults, as well as some body parts of adults, were enlightened in 10% 

KOH. Permanent slides were made in Canada balsam and used for determination. All 

examined material is kept in the Entomology collection, Department of Entomology and 

Agricultural Zoology, Faculty of Agriculture, University of Belgrade, Serbia. 

The nomenclature and classification follow the Burckhardt (2009). 

Family: Calophyidae Vondraček, 1957 


1) Calophya rhois (Löw, 1877) 

Researched material: Beograd - hotel Jugoslavija, 08.10.2007. E, leg. G. Prodanović; 

15.11.2007. E, leg. D. Jerinić-Prodanović; 25.06.2009. (I, 2♀). D. Milanovac - Veliki 

greben, 13.05.2006. (L 1 , L 2 , L 3 , L 4 , L 5 ), leg. D. Smiljanić; Deliblato, 03.07.2006. (I), leg. D. 

Smiljanić; 19.09.2006. I, 1♀, 1♂, GP; Goč-Kamenica, 09.07.2006. (I, 13♀, 10♂), leg. D. 

Smiljanić; 09.06.2008. (L 1 , L 2 , L 3 , L 4 , L 5 ,), leg. D. Smiljanić; Iriški Venac- monument, 

16.04.2008. (ZI. J, 6♀, 6♂), leg. A. Vučetić; Kanjon Dervente, 13.07.2007. (L 5 , I), leg. D. 

Jerinić-Prodanović; 08.08.2007. (I, 1♀), leg. G. Prodanović; Kozja Stena, 13.07.2007. (L 5 , 

I, 2♀, 3♂), leg. D. Jerinić-Prodanović; Mokra Gora-Obilaznica, 13.08.2006. (I), leg. D. 

Jerinić-Prodanović; Stari Ledinci, 14.04.2008. (J, I), leg. D. Smiljanić; Sremska Kamenica, 

13.06.2009. (I, 4♀, 2♂), leg. G. Prodanović; Široka Torina, 03.07.2006. (L 1 , L 2 , L 3 , L 4 , L 5 , 

I, J, ), leg. D. Smiljanić; 29.06.2008. (L 1 , L 2 , L 3 , L 4 , L 5 , I, J, 1♀, 1♂), leg. D. Jerinić- 

Prodanović; Zemunski Kej, 15.11.2007. (E), leg. D. Jerinić-Prodanović; 25.06.2009. (I, 2♀, 

1♂), leg. D. Jerinić-Prodanović. 

Calophya rhois is a Mediterranean species introduced into Central Europe, the Great 

Britain and China. It develops on Cotinus coggygria Scop.. Young adults are whitish. Later, 

head and thorax become red-brown, while abdomen is whitish to light brown with grey 

tergites (Fig. 1). Overwintering adults are red-brown. Younger larvae are yellow, changing 

colour until dark brown (Fig. 2). Freshly laid egg is milky white, later becoming dark 

brown. While feeding, larvae cause curling and bending of leaves inwards, developing a 

kind of a gall. Besides, larvae also feed on branches, excreting a large amount of honeydew, 

suitable for the development of sooty mold. It overwinters in adult stage on other plants, 

most probably conifers. It has two generations per year.


Family: Homotomidae 

2) Homotoma ficus (Linnaeus, 1758) 

Researched material: Dobanovci (11.05. 2008., (L 3 ), leg. D. Jerinić-Prodanović; 

Novi Sad - Liman (9.06.2008., (L 5 , 4♀, 1♂), 2.11.2008, (eggs, 1♀), 15.05.2009. (L 3 )), leg. 

D. Jerinić-Prodanović; Belgrade region: Voždovac (25.04.2007 (L 3 ), 3.05.2007 (L 4 , L 5 ), 

26.05.2007 (L 5 , 12♀, 9♂), 27.02.2008 (eggs), 14.03.2008 (eggs), 21.10.2008 (eggs, 5♀, 

1♂)), leg. D. Jerinić-Prodanović; Šumice (24.05.2007 (L 3 )), leg. D. Jerinić-Prodanović; 

Zemunski Kej (10.05.2007 (L 3 ), 16.05.2007 (L 4 , L 5 ), 21.06.2007 (L 5 ), 18.07.2007 (3♀, 

3♂), 20.09.2007 (5♀, 3♂, eggs), 08.10.2007 (eggs), 26.03.2008 (eggs, L 1 ), 07.04.2008 

(eggs, L 1 ), 15.05.2008 (L 3 ), 30.05.2008, 19.10.2008 (eggs, 3♀, 3♂), 18.05.2009 (L 3 , L 4 ), 

25.06.2009 (L 5 , 4♀, 3♂)), leg. D. Jerinić-Prodanović; Nova Galenika (09.05.2007 (L 3 )), 

leg. D. Jerinić-Prodanović; Lazareviceva street (25.05.2007 (L 5 )), leg. A. Vučetić; 

Studentski Grad (31.05.2007 (L 5 )), leg. S. Mutavdžić; Zeleni Venac (15.08.2007 (1♀, 1♂)), 

leg. D. Jerinić-Prodanović; Zemun – Faculty of Agriculture (17.09.2007 (2♀, 1♂, eggs), 

26.06.2008 (L 5 ), 01.09.2008 (eggs, 3♀), 06.05.2009 (L 3 )), leg. D. Jerinić-Prodanović; 

Zvezdara (13.04.2008 (L 1 , L 2 )) leg. D. Jerinić-Prodanović and Banjica (10.09.2008 (15♀, 

12♂, eggs)), 23.09.2008 (10♀, 8♂, eggs), 08.04.2009 (eggs, L 1 ), 21.05.2009 (L 4 , L 5 ), leg. 

G.Prodanović. 

H. ficus is native to Central and southern Europe and the Middle East, feeding on 

Ficus carica L. However, it has been introduced together with the host plant into other 

countries outside the original distributional range, too. Hodkinson and White (1979) 

registered it from the Great Britain. Burckhardt and Mühlethaler (2003) reported its 

presence from Switzerland. According to Mijušković (1999) and Seljak (2006) H. ficus is 

also present in coastal regions of Slovenia, Croatia and Montenegro. Halperin et. al. (1982) 

and Gencer et. al. (2007), registered fig psylla in the USA (California), too. It is an alien 

species to North America (Hollis and Broomfield, 1989). In Serbia, Homotoma ficus was 

determined for the first time on fig (Ficus carica) in Belgrade area in 2008 (Jerinić- 

Prodanović, 2011a). 

Adult. Body light green in freshly moulted specimens, later becoming darker, light 

green-brown to yellow-brown with dark brown abdominal tergites. Antennae densely 

covered with long setae, light brown, segments 9-10 dark brown. Forewing light brown 

with dark brown spots. (Fig. 3). 

Larva. First instar with yellow body. Fifth-instar bright green with whitish wing 

pads (Fig. 4); dorsum and body margin densely covered with simple setae. 

Egg is oval in shape, with pedicel situated ventrally and long terminal filament. 

Recently laid eggs light yellow, later becoming bright yellow. 

The fig psylla has one generation per year. It overwinters in the egg stage on the host 

plant. Larvae of H. ficus start hatching in March. While feeding, larvae excrete honeydew 

which is usually wrapped in wax, so their presence can be recognized by wax secretion in 

the form of drops or threads on leaves. Eclosion of adults was registered at the end of May. 

During summer (June to August), adults were found on fig mostly on lower sides of the 

leaves. Copulation was observed at the end of August and during September, first laid eggs 

were registered in September. Eggs were laid near leaf buds and in the folds of the bark in 

small groups.


Figure 1. Adult of Calophia rhois (Orig.) 

Figure 2. Larvae of Calophya rhois (Orig.) 

Figure 3. 

Adult of Homotoma ficus (Orig.) 

Figure 4. Fifth instar larva 

of Homotoma ficus (Orig.) 

Family: Psyllidae Löw, 1878 

3) Acizzia jamatonica (Kuwayama, 1908) 

Researched material: Beograd – Bežanijsko groblje, 22.05.2010. (J, I, 10♀ 10♂), 

leg. D.Smiljanić; Lugavčina, 27.07.2010. (J, L, a large number of adults), leg. O. Petrović- 

Obradović; Šid, 15.08.2010. (J, L 1 - L 5 , a large number of adults), leg. G. Prodanović; 

Vašica, 15.08.2010. (J, L), leg. G. Prodanović; Zemun – Banatska, 3.05.2010. (I, 2♀, 3♂) 

01.07.2010. (J, L, a large number of adults), leg. D. Jerinić-Prodanović; 23.07.2010. (J, L 1 – 

L 5 , a large number of adults), leg. D. Jerinić-Prodanović; Zemun – Naselja Nova Galenika, 

10.08.2010. (J, L 1 – L 5 , a large number of adults), leg. D. Jerinić-Prodanović. 

A. jamatonica is an East-Asian species, until 1980 known only in Japan. It was then 

registered in South Korea in 1983, in Taiwan in 1984 and in China in 1992 (Lauterer et al. 

2011). In 2001 it was registered for the first time in Europe, in the North of Italy. After this 

record, it was registered in other European countries as well (France, Slovenia, Switzerland, 

Hungary, Bulgaria, Serbia, Greece, Slovakia) (Seljak, 2006; Šimala et al., 2006; Vétek 

Redei, 2009; Vétek et al., 2009; Mifsud et al., 2010). Since 2006, its presence has also been 

registered in Southeast part of the USA (Mifsud et al., 2010).


Young adults are light green (Fig. 5). Thorax with visible light brown stripes. 

Antennae, legs and wing nervature light brown. Older adults become darker. Summer 

generations of adults have this colour, while overwintering adults are light to dark brown 

with visible red eyes. 

Eggs elongated, dark yellow to orange, with a tail-like appendage at one end, and at 

the other a stinger inserted into leaf tissue. 

Larvae (L 1 ) are light yellow, almost transparent. The colour changes, so the larvae of 

the final stage (L 5 ) are light green with light brown antennae, rudiments of wings and legs. 

The apices of antennae and legs dark brown, eyes pink (Fig. 6). 

Acizzia jamatonica is a monophagous species feeding exclusively on Albizzia 

julibrissin (Durazz), having become a popular decorative plant species in gardens and parks 

in Serbia. 

The damage on plants is caused by larvae and adult specimens sap-sucking on 

leaves, flowers and young legumes. Stronger infestation leads to yellowing and premature 

leaf falling. They also cause secondary damages on infested plants, manifested as 

honeydew excretion and appearance of sooty mold on the excreted honeydew. Besides, 

larvae excrete large amounts of wax secretions, which altogether reduces decorative value 

of infested trees. 

A. jamatonica has more than two generations per year. Šimala et al. (2006) indicate 

that there are at least four overlapping generations at Croatian sea coast and Lauterer et al. 

(2011) indicated up to four generations in Slovakia and Greece. In our conditions, A. 

jamatonica overwinters in adult stage outside the host plant, on other plants (literature data 

indicate that it overwinters on conifers e.g. Lauterer et al., 2011). Adults fly on the host 

plant in March, where they copulate and lay eggs around buds (Lauterer et al., 2011.). Later 

they lay eggs along the leaf edges. During vegetation all stages of development are present. 

At the end of September and throughout October, overwintering adults are visible, staying 

on the plant, depending on the temperature, until the middle of November, and then leaving 

to other plants to overwinter. 

Figure 5. Adult of Acizzia 

jamatonica (Orig.) 

Figure 6. Fifth instar larva of 

Acizzia jamatonica (Orig.) 

4) Cacopsylla (H.) pulchella (Löw, 1877) 

Researched material: Belgrade (ulica Đorđa Vajferta, 08.05.2010. (eggs, L 2 - L 5 , a 

large number of adults), leg. D. Jerinić-Prodanović, 21.05.2010. (L 2 , L 3 , adults), leg. G. 

Prodanović, 18.06.2010. (last instar skin), leg. G. Prodanović; Botanicka basta garden, 

11.05.2010. (eggs, L 2 , L 3 , L 4 , L 5 , a large number of adults), leg. D. Smiljanić; Kalemegdan, 

11.05.2010. (eggs, L 2 , L 3 , L 4 , L 5 , a large number of adults), leg. D. Smiljanić, 07.06.2010.


(L 2 - L 5 , a large number of adults), leg. D. Smiljanić; Novi Beograd (Univerzitetsko 

naselje), 27.05.2010. (L 3 - L 5 , 1♀), leg. D. Jerinić-Prodanović, 04.06.2010. (L 3 - L 5 ), leg. D. 

Jerinić-Prodanović, 17.06.2010. (L 5 , 1♂), leg. D. Jerinić-Prodanović), Zemun (Gradski 

park), 08.05.2010. (1♀, 1 ♂ ), leg. D. Jerinić-Prodanović). 

C. pulchella is probably a Mediterranean species. It has been registered in Western 

Mediterranean (Italy, France, Greece) and Asia Minor, from where it has been introduced 

into other countries, such as: the Great Britain, Switzerland, Austria, Ukraine, Slovenia, 

Hungary (Klimaszewski, 1973; Halperin et al. 1982; Burckhardt and Mühlethaler, 2003; 

Seljak, 2006; Ripka, 2008). It is a monophagous species, feeding on Judas tree Cercis 

siliquastrum (Burckhardt, 1999). Judas tree (Cercis siliquastrum), originating from Western 

Mediterranean, is often grown as a decorative species in city parks (Šilić, 1990). In Serbia, 

Cacopsylla pulchella was deterimined for the first time on Judas tree (C. siliquastrum) in 

Belgrade area in 2010 (Jerinić-Prodanović, 2011b). 

Adults of C. pulchella are green-brown. There are orange stripes on the thorax. 

Abdomen is dark brown and intersegmental membranes are red-orange. There are dark 

brown spots on forewings (Fig. 7). Larva of the final stage is light green with 

semitransparent wing rudiments (Fig. 8). 

C. pulchella’s feeding and honeydew secretion are harmful. The attacked leaves 

become yellow and then necrotize (Rapisarda and Belcari, 1997). Besides honeydew, larvae 

also excrete wax secret in the form of fibres. 

We have determined that it has one generation per year in Serbia and that it 

overwinters on other plants. Adults were determined in the first decade of April 2010 on C. 

siliquastrum and the first adults of new generation in the first decade of May. Cercis 

siliquastrum stays on host plant until the second half of June. Eggs are laid on the same 

place near leaf nerves. In the beginning, eggs have milky white colour and as they grow 

older, they become intensively yellow. After hatching, larvae are placed on the back of 

leaves. In Italy (Toscana), Rapisarda and Belcari (1997) found that C. pulchella can 

develop three generations per year, but Burckhardt (1999) found in Switzerland (Basel) that 

it has one generation per year. It overwinters as an adult on conifers (Burckhardt, 1999). 

Figure 7. Adult of C. pulchella Orig.) 


C. pulchella (Orig.)


Family: Triozidae Löw, 1878 

5) Trioza neglecta Loginova, 1978 

Researched material: Zemun-Nova Galenika, 07.10.2006. (L 5 , I, 2♀, 1♂), leg. D. 

Jerinić-Prodanović; 05.10.08. (I, 1♀, 1♂), leg. D. Jerinić-Prodanović; Stari Slankamen, 

27.07.2012. (L 2 ) leg. R. Petanović. 

Trioza neglecta is originally from Southeast and Central Asia, but it was introduced 

into Europe (Loginova, 1978). Today it is distributed in Georgia, Armenia, Azerbaijan and 

Iran, expanding accross Russia, Ukraine, Moldova, Bulgaria, Romania and parts of former 

Yugoslavia, together with host plant Elaeagnus angustifolia L., into the countries of 

Central Europe (Slovakia, the Czech Republic, Austria) (Lauterer and Malenovsky, 2002). 

The adults of T. neglecta are light green. Antennae yellow-green, the last two 

segments black. Thoracic tergites with wide yellow to light brown stripes, abdomen with 

three black spots (Fig. 9). First-instar yellow, with colour changing to green-blue with 

silver reflection in the last stage of development (L 5 ). Wing rudiments whitish (Fig. 10). 

Figure 9. Adult Trioza neglecta 

(Orig.) 


Trioza neglecta (Orig.) 

In our conditions, T. neglecta has two generations per year. Lauterer and 

Malenovsky (2002) indicated that in the Czech Republic there are also two generations per 

year. The first generation is the least numerous and its adults appear in June and July, while 

the second generation is a little more numerous. Larvae can be found throughout September 

until the middle of November. During our investigations, we found a small number of 

adults in October, while in summer we also found larvae of lower stages of development 

(L 2 ). Lauterer and Malenovsky (2002) found overwintering adults on host plant in April, 

and therefore concluded it overwinters in adult stage. 

REFERENCES 

Burckhardt, D. (1999): Cacopsylla pulchella (Löw) a plant-louse species of Cercis siliqastrum from Basel 

(Hemiptera: Psylloidea). Mitt Entomol Ges Basel 49: 71 – 76. 

Burckhardt, D. (2012): Fauna Europaea: Psylloidea. Fauna Europaea version 2.5, http://www.faunaeur.org 

Burckhardt D. and Mühlethaler R. (2003): Exotische Elemente der Schweizer Blattflohfauna (Hemiptera, 

Psylloidea) mit einer Liste weiterer potentieller Arten. Mitt. Ent. Gesellschaft Basel 53: 98-110. 

Gencer, N. S., Coskuncu, K., S. and Kumral N., A. (2007): The colonization preference and population 

trends of larval fig psylla, Homotoma ficus L. (Hemiptera: Homotomidae). Jour. Pest. Sci. Vol. 80, 

N 0 1, pp.1-8.


Halperin, J., Hodkinson, I. D., Russell, L. M. and BERLINGER, M. J. (1982): A contribution to the knowledge 

of the psyllids of Israel (Homoptera: Psylloidea). Israel Journal of Entomology. Vol. XVI, pp. 27- 

44. 

Hodkinson, I. D. and White, I. M. (1979): Homoptera Psylloidea. Handbooks for the Identification of 

British Insects 2(5a): 1–98. 

Hollis D. and Broomfield P. S. (1989): Ficus-feeding psyllids (Homoptera), with special reference to the 

Homotomidae. Bull. Br. Mus. Nat. Hist. (Ent.) 58: 131-183 

Jerinić-Prodanović, D. (2011a): The first finding of the fig psylla Homotoma ficus L. (Hemiptera, 

Psylloidea, Homotomidae) in Serbia. Pesticidi i fitomedicina. Vol. 26, br. 3, pp. 205 – 212. 

Jerinić-Prodanović, D. (2011b): First record of Cacopsylla pulchella (Löw, 1877) (Hemiptera: Psylloidea) 

in Serbia. Acta Entomologica Serbica, vol. 16, (1/2). Pp. 139-142. 

Klimaszewski, S. M. (1973): The Jumping Plant Lice or Psyllids (Homoptera, Psyllodea) of the Palaearctic. 

An annotated Check-List. Annals. Zool. Warsz. Tom XXX, Nr. 7, Polska Akademia Nauk. Inst. 

Zool. p.155-286. 

Lauterer, P. and Malenovsky, I (2002): New distributional and biological data on European Psylloidea 

(Hemiptera, Sternorrhyncha), with special reference to the fauna of the Czech Republic and 

Slovakia. Entomologica Basiliensia. 24, 161 – 177. 

Lauterer, P., Bartoš, R. and Milanas, P. (2011): First Records of the Jumping Plant-Louse Acizzia 

jamatonica (Kuwayama) (Hemiptera: Sternorrhyncha: Psyllidae) in Slovakia and Greece. Plant 

Protect. Sci., Vol.47, No. 1: 37-40. 

Loginova, М. М. (1964а): Раздел "Подотряд Psyllinea-Псиллиды или листоблошки". Определьитель 

насекомых европейской части СССР-а, I, в пяти томах. Издательство "Наука" Москва- 

Ленинрад, стр. 437-482. 

Malenovskỳ, I., Lauterer, P., Labina, E. and Burckhardt, D. (2012): Jumping plant-lice (Hemiptera: 

Psylloidea) of Afghanistan. Acta Entomologica Musei Nationalis Pragae, 52(1), pp. 1-22. 

Mifsud, D., Cocquempot, C., Mühlethaler, R., Wilson, M. and Streito, J.-C. (2010) Other Hemiptera 

Sternorrhyncha (Aleyrodidae, Phylloxeroidea, and Psylloidea) and Hemiptera Auchenorrhyncha. 

Chapter 9.4. In: Roques, A. et al. (eds). Alien terrestrial arthropods of Europe. BioRisk 4: 511–552. 

doi: 10.3897/biorisk.4.63 

Mijušković, M. (1999): Bolesti i štetočine suptropskih voćaka. Univerzitet Crne Gore, Biotehnički Institut 

Podgorica. 

Ossiannilsson, F. (1992): The Psylloidea (Homoptera) of Fennoscandia and Denmark, Fauna Entomologica 

Scandinavica, 26, 346. 

Rapisarda, C. and Belcari, A. (1997). Notes on some psyllids (Homoptera, Psylloidea) infesting urban trees 

in Italy. In: Lematre M. et al. (eds): International symposium on urban tree health. Acta 

Horticulturae 496: 155–164. 

Queiroz, D., L., Burckhardt, D., and Majer, J. (2012). Integrated Pest Management of Eucalypt Psyllids 

(Insecta, Hemiptera, Psylloidea), Integrated Pest Management and Pest Control - Current and 

Future Tactics, Marcelo L. Larramendy and Sonia Soloneski (Ed.), ISBN: 978-953-51-0050-8, 

InTech, Available from: http://www.intechopen.com/books/integrated-pest-management-and-pestcontrol-current-and-future-tactics/integrated-pest-management-of-eucalypt-psyllids-insectahemiptera-psylloidea 

Šilić, Č. (1990): Atlas drveća i grmlja. IP ”Svjetlost Sarajevo”, Zavod za udžbenike i nastavna sredstva, 

Sarajevo – Zavod za udžbenike i nastavna sredstva Beograd, p. 124. 

Seljak, G.: An overview of the current knowledge of jumping plant-lice of Slovenia (Hemiptera: 

Psylloidea). Acta entomologica Slovenica. Vol. 14. št.1:11-34, 2006. 

Šimala, M., Seljak, G., Poje, I. and Masten, T. (2006): Novo zabilježene vrste lisnih buha (Hemiptera: 

Psylloidea) na drvenstom ukrasnom bilju u Hrvatskoj. Glasilo biljne zaštite, 6: 294-299. 

Vétek, G, Babić, A, Bognar-Pastor, H., (2009): Acizzia jamatonica (Kuwayama) Hemiptera: Psyllidae) - 

nova štetočina albicije u Srbiji. Biljni lekar, vol. 37, br. 6, str. 608-613. 

Vétek, G. and Redei D, 2009. First record of Acizzia jamatonica (Kuwayama) (Hemiptera: Psyllidae) in 

Bulgaria. Acta zoologica Bulgarica, 61, 3, 323-325.


N E M A T O L O G Y

562 NEMATOLOGY

Ricardo Holgado and Christer Magnusson 563 


Proceedings 

QUARANTINE NEMATODES – EUROPEAN LEGISLATION, 

CURRENT STATUS AND PERSPECTIVES 

RICARDO HOLGADO AND CHRISTER MAGNUSSON 

Norwegian Institute for Agricultural and Environmental Research, Plant Health and Plant 

Protection Division, Dept. of Entomology and Nematology Høgskoleveien 7, 1432 Aas, Norway 

During the last 30 years, European international trade patterns have changed markedly. Trade 

increases in volume, frequency and speed. Changes in pathways of trade in ornamental plants and 

root crops such as potato tubers add to this complexity and inevitably increase the risk of plant 

parasitic nematodes being introduced into new areas. There is a concern that such introductions may 

affect negatively the agricultural production systems of receiver countries. Quarantine regulations are 

formulated by governments to reduce the chances of pests being introduced on articles imported from 

foreign countries. 

The efforts to expand international cooperation in the management of plant pest threats 

resulted in the creation of the International Plant Protection Convention (IPPC) in 1951. 

Regional and inter-regional cooperation and harmonization in all areas of plant health is 

encouraged under the International Plant Protection Convention IPPC. 

The European Plant Protection Organisation (EPPO) with 50 member countries has a central 

role in European plant health activities and is in many ways complementary to the European 

Community (EC). The early stage EC plant health regulation resulted in the directives of 1966–1969 

on the marketing of field crop seeds, seed potatoes (66/403/EEC, now replaced), vine reproductive 

material (68/193/EEC), forestry reproductive material (66/401/EEC), and the control of potato wart 

disease (69/464/EEC) and of potato cyst nematode (69/465/EEC now amended 2007/33/EC). Council 

Directive 2000/29/EC (consolidating the old and much amended Directive 77/93/EEC) is the 

principal piece of legislation governing plant health regulations within the EU. 

The European plant health legislation is an instrument supporting the development of 

sustainable crop production by aiming at control the pests at their source. The challenges involved in 

putting such legislation into practice will be described here. 

Key words: quarantine, nematodes, European legislation, perspectives, status 

INTRODUCTION 

In many countries many, dangerous pests have frequently been found to be of 

foreign origin. Such pests may inflict greater crop damage than the indigenous ones. The 

importance of imposing restriction on the movement of pest infested plants or plant 

material from one country to another was realized in about 1860 when the grapevine 

phylloxera (vine louse) was introduced into France from America. The exchange of crops 

and their nematode pests between continents increased dramatically after the European 

discovery of the Americas. Typically, nematode species were first described from a country

564 Quarantine nematodes – European legislation, current status and perspectives 

that was not their centre of origin. PCN was first described as Heterodera rostochiensis by 

Wollenweber (1923) in Germany, although it originated from the Andean regions of South 

America, wherefrom it was reported 29 years later (Wille and Bazan de Segura, 1952). A 

second species of PCN, H. pallida, which also originated in South America, was not 

described until 1973, in England, by Stone (1973) using a type British population. 

Regional and inter regional cooperation and harmonization in all areas of plant 

health is encouraged under the International Plant Protection Convention IPPC. 

This role is performed by the Regional Plant Protection Organizations (RPPOs). 

There are currently nine RPPOs recognized by the IPPC, including the European and 

Mediterranean Plant Protection Organization (EPPO), established in 1951 as the first RPPO 

(www.eppo.org.). RPPOs perform their role in various ways. They produce non-binding 

(i.e. without legal status) recommendations to member countries for harmonizing 

regulations among their members. 

The main tasks of the National Protection Organizations (NPPOs) are: 

• to provide laboratory services for identification of harmful organisms in 

support of phytosanitary inspections and surveys; 

• to provide advice on and interpretation of the scientific aspects of national 

and international legislation or other regulations; 

• to carry out pest risk analyses; 

• to provide scientific support, training and advice to other parts of the 

NPPO during negotiations, or when planning policy or executing 

initiatives such as surveys or eradication campaigns, 

• and to advise on the scientific aspects of certification schemes and issue 

of licences and permits. 

Complementary to these tasks is the need to carry out related research to improve 

testing or identification procedures, to investigate pest biology where necessary to help in 

assessing threats and developing effective eradication measures, and to keep up to date with 

scientific advances in relevant disciplines. 

Thus plant health legislation has a place in the development of sustainable crop 

health systems, by controlling the pests at their source. 

The challenges involved in putting such legislation into practice will be described 

here. 

INTERNATIONAL PLANT HEALTH 

Since pest and disease organisms move freely over national boundaries, the 

development and application solutions require international cooperation. Within the past 

few years countries throughout the world have become more aware of the fact that 

prevention of the spread of plant pests can best be accomplished if nations work together. 

This has been the driving force behind the adoption in 1929 of International Convention for 

the Protection of plants (Ikin, 1990). The efforts to expand international cooperation in the 

management of plant pest threats resulted in the creation of the International Plant 

Protection Convention (IPPC) in 1951. The IPPC was revised in 1979 and again in 1997. 

According to the 1997 revision, the purpose of the IPPC is to secure “common and 

effective action to prevent the spread and introduction of pests of plants and plant products 

and to promote measures for their control”. The work programme of the IPPC is 

administered through the IPPC Secretariat and the Commission on Phytosanitary Measures


(CPM), in cooperation with National Plant Protection Organizations (NPPOs) and Regional 

Plant Protection Organizations (RPPOs). 

In line with the principles of the IPPC, national governments around the world 

develop their own plant health and quarantine regulations, which are usually enforced by an 

NPPO. 

International phytosanitary activities today are governed by relatively few 

agreements and organizations, principal among which are the Agreement on the 

Application of Sanitary and Phytosanitary Measures under the World Trade Organization 

General Agreement on Tariffs and Trade (the WTO-SPS), the IPPC, administered by a 

Commission on Phytosanitary Measures under the United Nations Food and Agriculture 

Organization (FAO) and, more recently, the Convention on Biological Diversity (CBD) 

administered under the United Nations Environment Programme (UNEP). 

REGIONAL PLANT PROTECTION ORGANIZATIONS (RPPO) 

In accordance with IPPC philosophy nine Regional Plant Protection Organizations 

(RPPO) have been formed. 

• NAPPO : North American Plant Protection Organization 

• OIRSA : Organismo Internacional Regional de Sanidad Agropecuaria 

• CPPC : The FAO Carribbean Plant Protection commission 

• CIPA : Comite Inter- Americano de Protection Agricola 

• CA: Comunidad Andina 

• IAPSC : Inter-African Phytosanitary Council 

• EPPO : European and Mediterranean Plant Protection Organisation 

• SEAPPC : Plant Protection Committee for the South East Asia and Pacific region 

• NEPPC : Near East Plant Protection Commission 

The oldest of these, founded in 1951, is the European and Mediterranean Plant 

Protection Organization (EPPO). At present EPPO has 50 member countries in Europe, 

North Africa and the near East. The aim of EPPO is to help its member countries to prevent 

entry or spread of dangerous pests (plant quarantine). Information on pests presenting a risk 

to the EPPO region is collected and publishes in the "Alert list". Pests recommended for 

regulation as quarantine pests are placed either on the A1-list (quarantine pests absent from 

the EPPO region) or on the A2-list (quarantine pests present locally in the EPPO region and 

under official control, i.e. eradication or containment (www.eppo.org). A list with European 

Quarantine Nematodes EPPO A1 and EPPO A2 are presented in table 1.The Organization 

has made a considerable effort in formulating standards for phytosanitary measures, like 

certification, inspection, identification, pest risk analysis (PRA) and recommendations on 

the control of quarantine pests. Nearly 92 such standards have now been approved, and are 

in active use in EPPO countries. (Zlof et al., 2000, Petter et al., 2010, 2011). 

In 2003, EPPO initiated a new program on quality management and accreditation for 

plant pest laboratories and standards are now also being developed in this area (EPPO, 

2007, EPPO, 2010). In 2006, a survey of existing diagnostic capacities in EPPO member 

countries was undertaken and a database on diagnostic expertise was created (Roy et al., 

2010).


Table1. European Quarantine Nematodes EPPO A1 and EPPO A2; EPPO Alert list and 

nematodes regulated in some parts of the EPPO region 

Family 

Meloidogynidae: 

Heteroderidae: 

Pratylenchidae: 

Anguinidae: 

Aphelenchoididae: 

Longidoridae: 

Genera and species 

EPPO List of pests 

recommended for 

regulation as quarantine 

Meloidogyne chitwoodi EPPO A2 

Meloidogyne enterolobii EPPO A2 

Meloidogyne fallax EPPO A2 

M. ethiopica EPPO Alert list 

Globodera rostochiensis 

Globodera pallida 

Heterodera glycines 

Heterodera zeae 

Punctodera chalcoensis 

Hirschmanniella spp. 

(except H. gracilis and H. 

loofi) 

Nacobbus aberrans 

Radopholus similis 

attacking citrus (formerly 

R. citrophilus) 

Radopholus similis (not 

attacking citrus) 

Ditylenchus dipsaci 

Ditylenchus destructor 

Aphelenchoides besseyi 

Bursaphelenchus 

xylophilus 

Longidorus diadecturus 

Xiphinema americanum 

sensu lato 

Xiphinema americanum 

sensu stricto 

Xiphinema bricolense 

Xiphinema californicum 

Xiphinema rivesi 

EPPO A2 

EPPO A2 

EPPO A2 

EPPO Alert list 

EPPO Alert list 

regulated in some parts of 

the EPPO region 

EPPO A1 

EPPO A1 

EPPO A2 

EPPO A2 



EPPO A2 

EPPO A2 





EPPO A1 

EPPO A1 

EPPO A1 

EPPO A2


EU A SINGLE MARKET AND PLANT HEALTH REGULATIONS 

The Treaty of Rome, signed in 1957, created the European Economic Community 

(EEC) of the six participating countries: Belgium, France, the Federal Republic of 

Germany, Italy, Luxembourg and The Netherlands. The emphasis at first was on economic 

cooperation and free trade between the participants. In the succeeding years the tendency in 

common parlance to refer to this grouping as the “European Community” (EC) gradually 

increased, EC regulations began to cover much wider areas than strictly economic 

activities, and this development gradually accelerated. The early stage EC plant health 

regulation resulted in the directives of 1966–1969 on the marketing of field crop seeds, seed 

potatoes (66/403/EEC, now replaced), vine reproductive material (68/193/EEC), forestry 

reproductive material (66/401/EEC), and the control of potato wart disease (69/464/EEC) 

and of potato cyst nematode (69/465/EEC now amended 2007/33/EC). 

Development of plant health regulations was then resumed between members of the 

enlarged Community, and reached a conclusion in 1976 with agreement on the plant health 

directive (Council Directive 77/93/EEC). This directive established key principles, such as 

the transparency of regulations, a common list of quarantine organisms and the right to take 

emergency action in certain circumstances. The International Phytosanitary Certificate and 

the rules governing its use still provided the basis for trade in plants and plant products 

between Member states. In 1993 amendments to Directive 77/93/EEC were introduced, and 

the use of plant passports was implemented (Ebbels, 2003). Over the years, the number and 

complexity of amendments and directives associated with Directive 77/93/EEC increased to 

such an extent that in the year 2000 a consolidated version, Council Directive 2000/29/EC, 

was agreed on. This new Plant Health Directive, together with its amendments, is now the 

main piece of legislation governing the EU plant health regime. More information is found 

in the EU website: http://www.europa.eu.int. 

A general index and information on plant health legislation, including legislative 

texts, can be found on http://www.europa.eu.int/comm/food. This also gives access links to 

reports on the deliberations of the various standing committees, forthcoming agendas, 

information on the work and structure of the scientific committees, and EU reports on 

country plant health inspections. 

THIRD COUNTRIES 

These are all countries other than EU Member States. Certain of these countries may 

be recognized by the EU as having equivalence with the EU and can therefore be treated 

similarly to a Member State for the specific item and purpose concerned (for example, 

Switzerland is recognized as having equivalence for the marketing of seed potatoes). 

THE PLANT HEALTH DIRECTIVE, 2000/29/EC 

Council Directive 2000/29/EC replacing the old and much amended Directive 

77/93/EEC) is the principal piece of legislation governing plant health regulations within 

the EU.


PLANT PASSPORTS 

Certain plants and plant products are identified as associated with risks to plant 

health in the Community. For the movement and marketing of these plants and plant 

products within the Community, including within the Member State of origin, they must be 

accompanied by a plant passport giving relevant details and assurances as to the health of 

these items. 

The proper issue of plant passports is the responsibility of the Member State in 

which the traded material has been produced or to which it is imported from a third country. 

Plant passports are issued by the responsible official body (normally the NPPO or an 

independent organization delegated for the purpose), or by producers or traders authorized 

to do so by the responsible official body. Inspections for issue of plant passports are 

normally required to be done at the place of production at an appropriate time in relation to 

the growth of the plants or production of products. 

PHYTOSANITARY CERTIFICATES 

These are issued only for consignments of plants and other relevant items that 

require a phytosanitary certificate (specified in Directive 2000/29/EC) and which are 

destined for export from the Community to third countries. The certificate confirms that 

the requisite inspections and conditions specified by the country of destination have been 

fulfilled. Phytosanitary certificates are issued only by the responsible official body 

designated under the IPPC (normally the NPPO) or under its direct supervision, and their 

issue cannot be delegated to private producers or traders as with the issue of plant 

passports. 

LEGISLATION AGAINST PLANT PARASITIC NEMATODES 

There is a core of nematode species that are targeted by legislation around the world. 

A list of plant parasitic nematodes most frequently regulated in international trade was 

prepared by Lehman in 2004, (Table 2). 

Nematode pests of potatoes are amongst the most highly regulated because they are 

readily disseminated in infested tubers or associated soil residues, and because potatoes 

destined for consumption may instead be propagated in fields. Potato cyst nematodes 

species are among the top six nematodes listed in Table 2. Other cyst forming nematodes H. 

glycines and H. schachtii are most commonly regulated by countries. The false root-knot 

nematode, Nacobbus aberrans, another major potato pest, is included in the list of regulated 

pests for many countries (Manzanilla-Lopez et al., 2002). 

In general, root-knot nematodes are not regulated as a group because the major 

economically important species are already widely distributed. However, one increasingly 

important regulated species is M. chitwoodi, primarily because it is a serious pest of potato 

and other economically important crops such as carrot. The burrowing nematode 

Radopholus similis is common on lists of quarantine pests. The occurrence of a R. similis 

race capable of infesting and damaging citrus, and the lack of reliable and rapid 

morphological methods and molecular analyses to identify this race has prompted a 

worldwide ban against this nematode especially in citrus-growing countries. The listed 

root-lesion nematode pests include mainly tropical and subtropical species such as


Pratylenchus coffeae, P. loosi, P. scribneri and P. zeae, and the temperate species P. 

penetrans. 

Endoparasitic migratory species of above-ground parts of plants are regulated by 

many countries; species belonging to the genera Aphelenchoides and Ditylenchus are most 

common in the quarantine lists (Table 2). The insect vectored species such as 

Bursaphelenchus. xylophilus and B. cocophilus are also of major concern for many 

countries. Dagger (Xiphinema spp.) and needle (Longidorus spp.) nematodes that vector 

nepoviruses are of major concern for European countries. Further details of nematodes 

listed by countries around the world can be found on the EPPO website (www.eppo.org). 

Table 2 Nematodes regulated by 20 or more countries in international quarantine legislation. 

After (Lehman, 2004) 

Nematode species 

Crop 

Number of countries 

regulating (in 2000) 

Globodera rostochiensis Potato 106 

Apelenchoides besseyi Rice 70 

Ditylenchus dipsaci Several 58 

Radopholus similis/R. citrophilus Citrus 55 

Globodera pallida Potato 55 

Ditylenchus destructor Potato 53 

Heterodera glycines Soybean 52 

Aphelenchoides fragariae Strawberry and ornamentals 47 

Bursaphelenchus xylophilus Forestry (Pinus) 46 

Xiphinema index Grapes 42 

Nacobbus aberrans Potato and Vegetables 38 

Xiphinema americanum Grapes 30 

Anguina tritici Cereals (wheat) 24 

Heterodera schachtii Sugarbeet 22 

Bursaphelenchus cocophilus Ornamentals 21 

PLANT PARASITIC NEMATODES - PEST RISK ANALYSIS (PRA) 

Phytosanitary measures must be justified by a PRA as described in the International 

Standards for Phytosanitary Measures (ISPM) “Guidelines for Pest Risk Analysis” and 

“Pest Risk Analysis for Quarantine Pests”, including Analysis of Environmental Risks. All 

current ISPMs are published on the IPPC home website, the International Phytosanitary 

Portal (IPP) at www.ippc.int. 

The IPPC ISPM on Pest Risk Analysis (PRA) includes a scientific evaluation of 

biological and economic evidence to determine whether a pest should be regulated (pest 

risk assessment) and the strength of any phytosanitary measures to be taken against it (pest 

risk management). 

One of the crucial steps in a PRA is the determination of whether or not the pest or 

pests of concern meet the definition of a “quarantine pest”. An organism can only be 

considered a quarantine pest for a particular country if it is not present in that country or of 

limited distribution and under official control. Official control of regulated pests must aim 

at eradication or containment and not merely a reduction or suppression of population 

levels. The official control program must be implemented on a national scale. PRA can be 

initiated for a variety of reasons, such as if a particular pest is intercepted at points of entry,


a new pest risk is identified by scientific research or a pathway other than a commodity 

import (e.g. natural spread, international mail, garbage) is identified. 

A PRA can also be initiated because a country makes a request to the NPPO of a 

second country for authorization to allow the importation of an agricultural commodity 

(e.g. fruits and vegetables for consumption or plant products for propagation) into that 

second country. The importation of an agricultural commodity represents a pathway that 

pests can potentially follow to enter and establish in a new country. 

In the preparation of a PRA initiated by a commodity import request, only 

quarantine pests likely to be carried on the particular commodity require complete risk 

analysis (risk assessment followed by risk management). In addition to the type of plant 

commodity being imported, other factors used in assessing pest risk include: the pest’s 

biology including host range, feeding habits, life cycle, habitat, symptoms produced, 

overwintering/dormancy ability, dispersal ability, interaction with plant pathogens. The 

pest’s economic and environmental impacts in other parts of the world, and the host range 

and environmental conditions within the geographical distribution should be compared to 

conditions in the importing country. 

The more knowledge of these factors, the more accurate the risk can be estimated. 

Unfortunately, biological information is lacking for many new pests intercepted in 

international trade, including most new nematodes. Additionally, data as soil temperature, 

rainfall, necessary for nematode assessments, are often nonexistent and have to be 

extrapolated from air temperatures. With guidance of the PRA the NAPPO can decide on 

the pest risk management by choosing the most appropriate phytosanitary measures needed 

to reduce risks associated with the pest. 

There are several important WTO-SPS/IPPC principles that should be followed 

when deciding whether or not to allow importation of a commodity and, if so, what 

phytosanitary measures should be implemented to manage the risks associated with that 

commodity (principles in the WTO-SPS Agreement). 

The first of these principles is that of “minimal impact”, also known as “least 

restrictive measures”, which states that measures must not restrict trade more than that 

required to achieve the appropriate level of protection for the importing country. The 

principle of “equivalence” means that an importing country must recognize that different 

phytosanitary measures can potentially be used to achieve their appropriate level of 

protection. For example, if an irradiation or hot water treatment is equally effective in 

managing a particular plant parasitic nematode pest on a particular commodity, compared 

to a chemical treatment, then exporting countries should be allowed to use one of the 

alternatives The WTO-SPS principle of “non-discrimination” states that importing 

countries should not discriminate between countries that have the same phytosanitary 

status. 

Finally, the principle of “transparency” requires countries to provide information 

regarding their risk analysis procedures, including the technical information justifying why 

certain phytosanitary measures were selected. These key principles, and decisions based on 

scientific evidence through risk analysis, provide a more predictable, transparent and fair 

trading system. 

FUTURE CHALLENGES FOR THE CONTROL OF REGULATED NEMATODES 

The increasing volume, frequency and speed of transport of plants and plant 

products around the world, makes it difficult to inspect adequately every consignment that


might contain nematodes. Today the main challenges facing NPPOs is to target inspections 

to consignments with high risk to the agricultural industry in their countries. It is necessary 

to have actualized statistic data as this will provide information on the volume and 

fluctuation of various types of trade, the problems encountered and the association of 

problems with particular sources, areas or suppliers, to determine priorities for targeting 

inspections and monitoring. The same information is important in performing a PRA. 

In current years organic farming and the use of integrated pest management 

programmes, combined with the loss of many chemical products used to control nematodes, 

means that another future challenge is to develop a better understanding of the biology of 

plant parasitic nematodes, so that as many cultural measures as possible can be used to 

suppress them at their source. Such measures might include, increasing the interval between 

susceptible crops to reduce the rate of multiplication of pest species. In addition, the 

growing desire to use plant waste for composting, presents an additional risk unless 

appropriate measures are taken to secure complete sanitation. 

FUTURE CHALLENGES FOR ADVISERS AND RESEARCHERS 

Expert scientific support is essential for a country or region to provide an adequate 

plant health service. A good cooperation between the regulatory agencies, crop consultants, 

farmers and growers is essential for success in all kinds of phytosanitary programmes. 

The increasingly declining skills in classical identification and diagnosis in 

nematology is evident. At the same time there are increasing demands to formalize quality 

procedures in laboratories, leading to the production of identification protocols that provide 

guidance for international agreement. For more than a century the identification of plant 

parasitic nematodes has been dependent on recording and quantifying morphological keyfeatures. 

Important tools for morphological identification are original descriptions and 

reference material in slide collections. The international decline of taxonomic skills, and the 

lack of resources for competence-building, maintenance and expansion of collections will 

threaten the basis of identification of regulated nematodes. 

In order to fill this gap molecular tools have been developed to assist the 

morphological identification. Such tools include electrophoresis and polymerase chain 

reaction (PCR). They are especially important where morphological identification is 

particularly difficult or where only immature specimens have been intercepted. However, it 

is often not realized that the development of such techniques as reliable, routine methods 

for use as quarantine identification tools requires additional intensive research. 

Today diagnostic protocols are only developed for a restricted range of species, thus 

still necessitating a preliminary, provisional identification by a morphological specialist. 

Analytical methods examining the genetic make-up of organisms are being 

continually refined and adapted to develop new phylogenetic models that are becoming an 

integral part of nematode systematics (De Ley and Blaxter, 2002), and the associated 

technological equipment, though expensive, is becoming a familiar equipment of most 

diagnostic laboratories. Despite great advances in the use of molecular methods for the 

identification of diseases, especially viruses, their development as identification tools for 

nematodes has been relatively slow. 

Of the species listed in EU legislation, reliable protocols have currently only been 

developed for B. xylophilus, G. pallida, G. rostochiensis, M. chitwoodi and M. fallax. Even 

as molecular tools can be used by personnel with no nematological skills, possible 

requirements in phytosanitary legislation to produce rapid morphological evidence will be


difficult in the light of the declining competence in classical morphology among 

nematologists. Not recognizing the possible limitations in existing molecular techniques 

could in some cases result in over- or under regulation of pest organisms. At present the 

protocols for regulated species do not distinguish unregulated or native species of the 

genera that occur in the countries where interceptions or outbreaks may occur. For example 

protocols for PCN do not include G. achilleae, cyst nematode occurring in several 

European countries. In addition, PCN cysts will register as negative with such methods if 

eggs are absent, thus perhaps giving a false impression of the situation with regard to the 

status of the pest in a particular consignment. Therefore, the role of experienced 

diagnosticians and taxonomists in nematode identification remains a vital one. 

SCIENCE OF NEMATOLOGY VERSUS LEGISLATION 

Phytosanitary legislation requires clarity and consistency to avoid misinterpretation. 

The names of regulated plant parasitic nematodes need to be as firmly established as 

possible. 

This, however, requires awareness of the fact that some species might be subject to 

many taxonomic changes, and that there may exist many synonyms in the legislation of 

some countries; this needs to be recognized to avoid confusion and allow for the correct 

phytosanitary action to be taken. An example of this is the controversy is Radopholus 

citrophilus and R. similis, which are both listed in European legislation. R. similis was 

thought to consist of different pathotypes but Huettel et al., (1984) concluded that the 

banana race and the citrus race were distinct species; the name R. similis was restricted to 

the banana race, and the citrus race was described as R. citrophilus. Subsequently, Kaplan 

et al, (1997) synonymized R. citrophilus with R. similis; Valette et al., (1998) proposed R. 

citrophilus as a junior synonym of R. similis, although Siddiqi (2000) proposed it as a 

subspecies of R. similis, and Elbadri et al., (2002), using molecular techniques, 

demonstrated marked intraspecific variation in various isolates of R. similis. This 

continuing taxonomic uncertainty has caused confusion for quarantine officers and 

specialists involved in PRA work, due to the uncertainty on the actual host lists of R. 

similis. 

CHALLENGES FOR LABORATORIES INVOLVED IN PLANT PARASITIC 

NEMATODE DIAGNOSTICS 

International standards for phytosanitary measures for plant parasitic nematode 

diagnostics are becoming increasingly important but their adaptation in some areas, such as 

the identification of species, which entails the use of judgement by experts rather than the 

output from machines, has proved a difficult philosophy for accreditation schemes to 

embrace. 

In addition, the variability of resources available in individual laboratories means a 

range of protocols has to be included. Nevertheless, selected protocols are slowly achieving 

international status. 

The combination of scarce scientific resources and the cost of providing prescribed 

levels and speed of delivery have led some countries to negotiate contracts for science 

services with those countries that possess the ability to deliver. Inevitably, this will lead to 

centres of expertise serving a community in a particular geographical location or region.


At the same time this may have economic advantages, it should not discourage the 

broad development of essential identification and diagnostic expertise that is vital for the 

whole basis of phytosanitary work. The decline in taxonomic expertise requires networks to 

take advantage of scarce skills at short notice and to develop standardized protocols that are 

increasingly being demanded internationally. 


The authors wish to acknowledge the support from the Research Council of Norway, 

the Foundation for Research Levy on Agricultural Products, the Agricultural Agreement 

Research Fund, and Norwegian food industries. Thanks are also due to Bioforsk Plant 

Health and Plant Protection Division, for providing resources. 

REFERENCES 

Ebbels, D.L. (2003): Principles of Plant health and quarantine CAB International, Wallingford, 

UK, pp:203. 

Elbadri, G. A.A., De Ley, P., Waeyenberge, L., Vierstraete, A., Moens, M., Vanfleteren, J. 

(2002): Intraspecific variation in Radopholus similis isolates assessed with restriction 

fragment length polymorphism and DNA sequencing of the internal transcribed spacer 

region of the ribosomal RNA cistron. International Journal of parasitology 32: 199-205. 

EPPO (2007): PM 7/84 (1) Basic requirements for quality management in plant pest diagnosis 

laboratories. EPPO Bulletin 37: 580-588. 

EPPO (2010): PM 7/98 (1) Specific requirements for laboratories preparing accreditation for a 

plant pest diagnostic activity. EPPO Bulletin, 40: 5-22. 

De Ley, P., Blaxter, M. L. (2002): Systematic position and phylogeny. In: Lee, D.L.(ed ) The 

Biology of Nematodes. Taylor & Francis London,. 1-30. 

Huettel, R. N., Dikson, D. W., Kaplan, D.T. (1984): Radopholus citrophilus n.sp. a sibling 

specie of Radopholus similis. Proceedings of the Helminthological society of 

Washington 51: 32-35. 

Ikin, R. (1990): The International Plant Protection convention: its future role. FAO Plant 

Protection Bulletin 38(3): 123-125. 

Kaplan, D.T., Vanderspool, M. C., Opperman, C.H. (1997): Sequence tag site and host range 

demonstrate the Radopholus similis and R. citropholus are not reproductively isolated. 

Journal of Nematology 29: 421-429. 

Lehman, P.S. (2004): Cost benefit of nematode management through regulatory programs. In: 

Chen, Z. X. Chen, S. Y. & Dickson, D.W.(eds.) Nematology Advances and Perspectives, 

vol 2 CAB International Wallingford UK. pp: 155-179. 

Manzanilla-Lopez, R. H. Costilla, M. A., Doucet, M., Franco, J., Insierra, R. N., Lehman, P. S., 

Cid del Prado, I., Souza, R.M., Evans, K.(2002): The genus Nacobbus Thorne & Allen, 

1944 (Nematoda: Pratylenchidae): Systematic, distribution, biology and management. 

Nematropica 32: 149-227. 

Petter, F., Suffert, M. (2010): Survey on the use of tests mentioned in EPPO diagnostic 

protocols. EPPO Bulletin, 40: 121-126. 

Siddiqi, M.R. (2000): Tylenchida parasites of Plants and Insects, 2 nd edition. CAB International 

Wallingford, UK. 

Stone, A. R. (1972): Heterodera pallida n.sp (Nematoda: Heteroderidae), a second species of 

potato cyst nematode. Nematologica 18: 591-606.


Roy, A. S., Pette, F., Griessinger, D. (2010): EPPO database on diagnostic expertise: 

http://dc.eppo.org.- Bulletin OEPP/EPPO Bulletin, 40: 127-130. 

Zlof, V., Smith, I. M., McNamara, D. G. (2000): Protocols for the diagnosis of quarantine pests. 

EPPO Bulletin, 30: 361-363. 

Petter, F., Suffert, M., Roy, A.S., Griessinger, D., McMullen, M. (2011): Highlights on some 

EPPO activities in plant quarantine. Bulletin of Insectology (Supplement), 64: 285-286. 

Valette, C., Mounport, D., Nicole, M., Sarah, J.L. Baujard, P. (1998): Scanning electron 

microscope studies of two African populations of Radopholus similis (Nematoda: 

Pratylenchidae) and proposal of R. citropholus as junior synonym of R. similis. 

Fundamental and Applied Nematology, 21: 139-146. 

Wille, J.E., Bazan de Segura, C. (1952): La anguilula dorada, Heterodera rostochiensis, una 

plaga del cultivo de las papas, recien descubierta en el Peru. Centro Nacional de 

Investigaciones y Experimentacion Agricola de La Molina, Lima, Peru. Bolletin 48: 17. 

Wollenweber, H. W. (1923): Krankheiten Und Beschadigungen der Kartoffel. Arbeit der 

Forschungs Institut Kartoffel Berlin, 7: 1-56.

Korma Aleksandr and Sigareva Dina 575 

International Symposium: Current Trends in Plant Protection UDK: 630*459(477) 

Proceedings 

RESULTS OF A SURVEY ON INFESTATION BY 

BURSAPHELENCHUS SPP. IN PINE FORESTS IN UKRAINE 

KORMA ALEKSANDR 1 AND SIGAREVA DINA 2 

1 Chernigov State Institute for Economics and Management, Streletskaya St. 1, Chernigov, 

14033, Ukraine, e-mail:korma@km.ru, 

2 Institute of Plants Protection of the Ukrainian Academy of Agrarian Sciences, 

Vasilkovskaya St. 33, Kiev, 03022, Ukraine 

The survey on Bursaphelenchus spp. and other xylobiotic nematodes in pine forests in 

Ukraine was carried out. The dominant species was B. mucronatus, while two other identified species, 

B. eggersi and B. sexdentati, were classified as common and rare, respectively. The large number of 

B. mucronatus was hypothesized to have a possible role in pine trees wilting in Polesye region. 

Bursaphelenchus xylophilus was not found in Ukraina. 

Key words: Bursaphelenchus spp., infestation risk, pine wilt disease, xylobiotic nematodes 

INTRODUCTION 

Pine wood nematode (PWN) Bursaphelenchus xylophilus (Steiner et Buhrer) Nickle 

(Aphelenchida, Parasitaphelenchidae), causal agent of pine wilt disease (PWD), is a 

quarantine organism in Europe that was first identified in Portugal in 1999 (Mota et al., 

1999, Sousa et al., 2001). Pine wood nematode is a parasitic nematode that develops in the 

wood of many coniferous species, but mainly in Pinus spp. (Kiyohara and Tokushige 1971; 

Mamiya 1972). The rapid proliferation of the pathogen in a tree results in a disruption of 

water flow and eventually causes plant death within several days from the time of 

infestation. PWN is transmitted from infested trees to new hosts by long-horn beetles 

Monochamus spp. (Coleoptera, Cerambycidae) either during oviposition or maturation 

feeding (Mamiya and Enda 1972; Wingfield 1983; Linit 1988, 1990; Sousa et al., 2001; 

Naves et al. 2007). The pine wood nematode Bursaphelenchus xylophilus is one of the most 

dangerous phytoparasitic nematodes at present, which causes dying of the whole forest 

stands in the South-Eastern Asia. It belongs to the ecological group of xylobiotic 

nematodes. 

The distinctive feature of xylobiotic nematodes is their adaptation to living in 

weakened, dying tree trunks. The habitat conditions in this environment are more stable, the 

processes of wood saprobiotic decomposition are considerably slower, as well as the 

ontogenesis. It may be due to these habitat peculiarities that the xylobiotic habitats became 

a refuge for many primitively organized forms of nematodes (Paramonov, 1970). 

The second peculiarity of typical xylobiotic nematodes is their narrow adaptation 

and close relations to particular species of carrier insects. It is possible that exactly these

576 Results of a survey on infestation by Bursaphelenchus spp. in ... 

features of environment formed fauna of xylobiotic nematodes as a separate group 

(Vaysher and Braun, 2001). 

Xylobiotic nematodes were studied first by German scientists. Nematodes of 

decaying wood were studied by Körner, nematodes of bark beetles, capricorn beetles and 

weevils – by Fuchs and Ruhm (Blinova, 1982). 

Fuchs, who described about 100 new nematode species, is considered to be one of 

the founders of entomohelminthology. He studied the representatives of the genera 

Parasitorhabditis, Rhabdontolaimus, Panagrolaimus, Poikilolaimus, Cryptaphelenchus, 

Bursaphelenchus, Ectaphelenchus, Parasitaphelenchus and distinguished Aphelenchoidea 

superfamily. He was the first who described the nematodes of the genus Bursaphelenchus, 

pointing out that their larval stages develop in the bark beetles’ abdominal cavity, and their 

adult stages – in mines of the host insect (Blinova et al., 1972). 

The studies of nematodes as hidden forest pests expanded in the 1970s in the Soviet 

literature. These nematodes were studied by Blinova, Kakuliya, Devdariani and others 

(Blinova et al, 1972). 

According to Blinova (1982), the nematofauna associated with xylobiotic beetles is 

represented by 3 orders: Rhabditida, Tylenchida, Trichosyringida. The most numerous 

group of nematodes found in xylobiotic insects (35.90% of the general species number) 

includes mainly ectoparasitic species of entomonematodes from the Aphelenchoidea 

superfamily. The second-ranked is Rhabditoidea (21.30%), represented almost exclusively 

by nematodes of the genus Parasitorhabditis, parasitizing in the intestine, Malpighian 

tubules and body cavity of bark beetles. The representatives of Neotylenchoidea make up 

16.90% of the species found, most part of which are cavity parasites. The fourth most 

numerous group of species (14.70%) comprises mainly predator species from the 

Diplogasteroidea superfamily that use insects only for distribution purposes and localize on 

their body covers. Cephaloboidea form 11.20% of the general species number. These are 

mainly representatives of the genus Panagrolaimus – saprobiotic group, distinguished by 

close biological relations with xylobiotic beetles and transition to parasitic way of life 

(Panagrolaimus spondyli). 

The purpose of our research was to survey the pine forests in order to find the 

Bursaphelenchus xylophilus (Steiner et Buhrer) Nickle and the nematode species associated 

to it, and also to define the role of tree dwelling nematodes in the process of coniferous 

forests wilting in the Polesye region in Ukraine. 


The survey was carried out from 2002-2010, within the framework of the thesis, in 

forestry enterprises in Kyiv and Chernihiv areas of the Polesye region. The wood samples 

were obtained in the areas of drying forest plantations and in timber-yards (Fig.1). The total 

of 161 samples of wood and 240 specimens of beetles – sawyers of the genus Monochamus 

were taken and studied. In order to understand the significance of the separate nematode 

species in the pine wood nematode complex structure we used the occurrence rate and 

domination indices. The species inhabiting more than 50% of wood samples were 

considered dominant, 5–50% – common, and less than 5% – rare. The systematics of 

Andrassy, 1984 was used for identification of nematodes of the order Rhabditida as well as 

Siddiqui`s system (Siddiqui, 1980) for the orders Tylenchida and Aphelenchida.

Korma Aleksandr and Sigareva Dina 577 

Fig. 1 Wilted pine trees in state forest enterprise the "Kyivskoe" forest district is "Dachnoe" 

(photo Korma A., Kyiv area, 2003) 


The detected nematodes belong to 23 genera (Plectus Bastian, Bunonema 

Jagerskiold, Caenorhabditis (Osche) Dougherty, Protorhabditis (Osche) Dougherty, 

Parasitorhabditis (Fuchs) Ruhm, Diplogasteroides de Man, Rhabdontolaimus (Fuchs) 

Paramonov et Turlygina, Neodiplogaster Cobb, Tridontus Khera, Cephalobus Bastian, 

Panagrolaimus Fuchs, Panagrobelus Thorne, Pseudhalenchus Tarjan, Nothotylenchus 

Thorne, Parasitylenchus Micoletzky, Allantonema Leuckart, Deladenus Thorne, 

Laimaphelenchus Fuchs, Seinura Fuchs, Ektaphelenchus (Fuchs) Skrjabin et al., 

Cryptaphelenchus (Fuchs) Ruhm, Parasitaphelenchus Fuchs, Bursaphelenchus Fuchs), 15 

families and 4 orders: Araeolaimida, Rhabditida, Tylenchida and Aphelenchida. 

The dominant nematode species in wood samples of pine trees was Bursphelenchus 

mucronatus Mamiya et Enda. It occurred in 54% of the examined common pine wood 

samples. The same nematode species was found in 50 specimens of the surveyed beetles. 

The other two representatives of this genus, Bursaphelenchus eggersi Rühm (Rühm, 1956) 

and Bursaphelenchus sexdentati (Rühm) Hunt., were found to be common and rare, 

respectively. 

The average number of B. mucronatus in 100 g of wood was 138.60 specimens, the 

maximum number reached 2124 specimens. All wood samples were taken from trees 

affected by xylobiotic beetles. High occurrence rate of B.mucronatus shows that this 

species occupies the favorable ecological niche: tree xylem, practically devoid of the 

limiting factor – competitor phytonematode species. Intensive reproduction of these 

nematodes takes place in the vegetating plant, where they can feed on the resin ducts living 

cells.

578 Results of a survey on infestation by Bursaphelenchus spp. in ... 

We hypothesise that the large number of B. mucronatus could be the reason of pine 

tree plantations wilting, which is the statement that needs further investigations. 

REFERENCES 

Andrassy, I. (1984): Klass Nematode (Ordnungen Monhysterida, Desmoscolecida, 

Araeolaimida, Chromadorida, Rhabditida). Akademie-Verlag, Berlin, pp: 509. 

Blinova, S.L. (1982): Entomopathogenic nematodes - are vermin of wreckers of the forest. 

Family of Rabditidae. Science, Moscow, pp:135. (in Russian) 

Blinova, S.L., Kakulia, A., Slankis, A.J. (1972): Infection by the nematodes of barrel wreckers 

of coniferous breeds in the USSR . Helmintology laboratory AS SSR, Publ. АS USSR, 

Moscow, 20-36. (in Russian) 

Kiyohara, T., Tokushige, Y. (1971): Inoculation experiments of a nematode, Bursaphelenchus 

sp., onto pine trees (in Japanese with English summary). Journal of Japanese Forestry 

Society, 51: 193– 195. 

Linit, M.J. (1988): Nematode-vector relationships in the pine wilt disease system. Journal of 

Nematology, 20: 227– 235. 

Linit, M.J. (1990): Transmission of pinewood nematode through feeding wounds of 

Monochamus carolinensis (Coleoptera: Cerambycidae). Journal of Nematology, 22: 

231– 236. 

Mamiya, Y. (1972): Pine wood nematode, Bursaphelenchus lignicolus Mamiya and Kiyohara, 

as a causal agent of pine wilting disease. Review of Plant Protection Research, 5: 46–60. 

Mamiya, Y., Enda, N. (1972): Transmission of Bursaphelenchus lignicolus (Nematoda: 

Aphelenchoididae) by Monochamus alternatus (Coleoptera: Cerambycidae). 

Nematologica, 18:159– 162. 

Mota, M.M., Braasch, H., Bravo, M.A., Penas, A.C., Burgermeister, W., Metge, K., Sousa, E. 

(1999): First report of Bursaphelenchus xylophilus in Portugal and in Europe. 

Nematology, 1, (7/8):727– 734. 

Naves, P.M., Camacho, S., Sousa, E., Quartau, J.A. (2007): Transmission of the pine wood 

nematode Bursaphelenchus xylophilus through oviposition activity of Monochamus 

galloprovincialis (Coleoptera: Cerambycidae). Entomologia Fennica, 18:193-198. 

Paramonov, A.A. (1970): Bases of phytohelminthology. V. IIІ. Taxonomy of nematodes of 

superfamily Tylenchoidea. Science, Moscow, pp: 256. (in Russian) 

Rühm, W. (1956): Die nematoden der Ipiden. Parasitol. Schiftenr. Fisher Verlag, Jena,H.6. pp: 

437. (in German) 

Siddiqi, M.R. (1980): The origin and phylogeny of the nematode orders Tylenchida Thorn, 1949 

and Aphelenchida n. ord. Helminthoogical Abstacts, (Ser. B), 49, 4:143-170. 

Sousa, E., Bravo, M., Pires, J., Naves, P., Penas, A., Bonifácio, L., Mota, M. (2001): 

Bursaphelenchus xylophilus (Nematoda: Aphelenchoididae) associated with 

Monochamus galloprovincialis (Coleoptera: Cerambycidae) in Portugal. Nematology, 3: 

89– 91. 

Vaysher, B., Braun, D.D.F. (2001): Acquaintance with nematodes: General nematologi. 

PENSOFT, Sofia-Moscow, pp: 206 (in Russian) 

Wingfield, M. (1983): Transmission of pine wood nematode to cut timber and girdled trees. 

Plant Disease, 67: 35– 37.

Sigareva Dina, Zhylina Tatjana, Galagan Tatjana 579 


Proceedings 

DETECTION OF DITYLENCHUS DESTRUCTOR IN POTATO 

DURING THE GROWING SEASON AND IN STORAGE 

SIGAREVA DINA 1 , ZHYLINA TATJANA 2 , GALAGAN TATJANA 1 

1 Institute of Plant Protection NAAS of Ukraine, 33, Vasilkovskaya str., Kiev-022, 03022, 

Ukraine, 

2 

Chernihiv State Pedagogical University named after Taras Shevchenko, 

Hetmana Polubotka str. 53, Chernihiv, 14038, Ukraine 

galaganta@mail.ru 

The research on detection of Ditylenchus destructor in growing plants of potato and in stored 

tubers was carried out. It showed that during vegetative growth visual symptoms of disease are almost 

imperceptible and can be observed only at a high-level infestation (100%) of seed material. Even the 

cutting of seed potatoes cannot always reveal the symptoms of a disease which is latent. Cutting of 

tubers 30 days before planting appeared to be an improving method. The best preventive measure 

included sprouting of tubers for 30 days, with sorting them out before and after sprouting. 

Key words: potato, Ditylenchus destructor, detection 

INTRODUCTION 

Potato tuber nematode Ditylenchus destructor Thorne, 1945, which is categorized in 

Ukraine as a regulated non-quarantine organism, is a major pathogen of potato crop. It 

degrades product characteristics and causes large losses during storage. It especially causes 

great damage to seed potato farms. This is due to the fact that, when infected by stem 

nematode, a lot of potatoes become unfit for calibration. Harmfulness of D. destructor is 

amplified by secondary infections of other phytopathogenic microorganisms (fungi, 

actinomycetes, bacteria, viruses) which accelerate and complete the process of potato tuber 

rotting (Paramonov, Bryushkova, 1956). 

Ditylenchosis in potato in Ukraine was detected as early as in 1920s (Belova, 1939; 

Zynovev and Volodchenko, 1967). Ditylenchus destructor is a very common pathogen 

today in all regions of Ukraine and causes significant losses of food and seed potatoes 

during storage. 


A research to establish the degree of stem nematode infestation was conducted for 4 

years, with different varieties and maturity of seed potato sowed in spring (March-April).

580 Detection of Ditylenchus destructor in potato during the ... 

According to GOST 11859-89, the study was conducted with three batches, each weighing 

0.8 tons. From each batch, a sample of 200 tubers was selected for detailed analysis. 

In the selection process, we used a visual method to pick the tubers with symptoms of III 

and IV stages of infestation by Ditylenchus, and the method of skin removal - for detection 

of tubers apparently healthy, with I and II early stages of the disease. 

In order to test the effectiveness of preventive measures we carried out the field 

research, which had 10 variants, including 3 controls. In the first variant of the control, all 

planted tubers were healthy, in the second - all tubers were infested with Ditylenchus, in the 

third - the tubers, without sorting. The other 7 variants included use of preventive measures. 

Thus, in the fourth variant – the tubers were halved and the diseased tubers were discarded; 

in the fifth - potatoes were washed in water and then the diseased tubers were eliminated; in 

the sixth – the tubers were sprouted (for 15 days) and planted without additional sorting 

out; in the seventh - tubers were sprouted (for 30 days) and planted after being sorted out 

again; in the eighth – the planted potato tubers were peeled; in the ninth - the planted tubers 

were infested, with the stolon removed on the day of planting, in the tenth-the planted 

tubers were infested, with the stolon removed 20 days before planting, followed by 

sprouting of tubers. Phenological observations carried out in the experiment included: 

period of sprouting and quality of shoots, the number of stems and height during flowering, 

and foliage characteristics of healthy and diseased plants. 


Results of phenological observations indicated that, during the growing season, 

infested potato plants in most variants did not differ in appearance from healthy ones, with 

the exception of variant with 100% Ditylenchosis (about 30% of tubers were severely 

affected). Some plants (about 30%) in this variant had shortened stems, deformed leaves 

with curved top outer edge. 

Concerning the period of sprouting, the best results were observed when tuber 

sprouting was included in preventive measures (especially for 30 days). Obviously, the 

recommended measure is heating and sprouting of tubers before planting. During the first 

two counts (20 and 25 days after planting), there were evident differences between variants 

with and without sprouting. However, the last two counts showed almost 100% germination 

in all variants of the experiment, except in control variant with all infested tubers which had 

germination up to 20% less than other variants of the experiment. 

Thus, our study shows that external signs of ditylenchosis are almost imperceptible 

at low level of infestation and may occur only at high infestation levels (100% infestation 

by D. destructor with the presence of very sick tubers). 

Ditylenchosis is a disease, which develops during the storage of potato tubers. The 

pathogenesis of this disease is a gradual process, which can be divided into five stages. 

The first stage (shown in Fig.1) is characterized by a hidden invasion (subtle off-white 

spots under the skin of apparently healthy tubers). In the second stage (Fig.2), light, subtle, 

brilliant lead-gray spots appear. 

The darkening of the skin and the formation of pressed pits at the edges of healthy 

part is typical for the third stage (Fig.3). These pressed pits i.e. sunken lesions are formed 

by appearance of small cavities ("pockets") in skin that appear as a result of nematodes 

feeding on tuber tissue (Duggan and Moore 1963). "Pockets" are small cavities, which 

gradually increase in size, darken and merge together, forming a mesh system of caverns 

and passages in the fourth stage (Fig.4). And the fifth (Fig.5) - last stage of tuber rot is

Sigareva Dina, Zhylina Tatjana, Galagan Tatjana 581 

when tuber is already rotten, with small remaining areas of healthy tissue. These stages are 

visually different. Only the first stage is hidden and therefore often ignored. 

Fig. 1 First stage of ditylenchosis 

Fig. 2 Second stage of ditylenchosis 

Fig. 3 Third st. of ditylenchosis 

Fig. 4 Fourth st. of ditylenchosis 

Fig. 5 Fifth st. of ditylenchosis 

In case of seed potatoes, the signs of ditylenchosis were latent. After a single-step 

selection, the loss of yield was 12.60%, but the marketability of tubers increased to 63.40% 

(compared with control 53.60%). Infestation of new harvest tubers by the stem nematode, 

although reduced by 6.80%, still remained high (15.60%). Washing of tubers before

582 Detection of Ditylenchus destructor in potato during the ... 

selection allowed more careful culling of infested tubers, which reduced the percentage of 

final infestation by 11.10%, when compared with controls. 

Loss of harvest was also reduced (9.50%) and marketability increased (69.10%). 

The latent form of disease is more noticeable if tubers are sprouted at 15-16 0 C for 30 days 

prior to planting. 

As a result of this measure, symptoms of ditylenchosis become more visible and 

tubers with these features are discarded during the additional sorting out, which 

significantly reduces the infestation of new potato crop (6.50%), reduces crop losses 

(2.40%) and increases the crop quality (80.20%). 

Thus, the best results were obtained when tubers were sorted out before and after 

sprouting that lasted for 30 days. Our results show that the above measures cannot fully 

eliminate pest from seed material, yet make it possible to significantly reduce stem 

nematode infestation of new harvest tubers. They can be applied for homestead lands if no 

other measures can be applied to obtain healthy seed potatoes. However, in cultivation of 

commodity and seed potatoes on commercial farms it is necessary to adhere strictly to all 

phytosanitary requirements and norms. 

REFERENCES 

Belova, A.D. (1939): Results of survey and field experiments in studying of a stem nematode in 

potatoes. Collection of papers on nematodes of agricultural plants, “Sel’khozgiz” 

Moscow-Leningrad, 142-149. (In Russian) 

Duggan, J.J., Moore, J.F. (1963): Observations on tuber-rot eelworm (Ditylenchus destructor 

Thorne, 1945). Irish Journal of Agricultural Research, 2, (1): 75-86. 

Paramonov, A.A., Bryushkova, F.I. (1956): The Potato Rot Nematode and its control. Moscow: 

Academy of sciences of the USSR, 111 pp. (In Russian) 

Zinoviev, V.G., Volodchenko, Z.G. (1967): Materials to the study of distribution of 

phytohelminthes in Ukraine. Collection of materials to the scientific conference of Allunion 

society of helminthologists, Moscow, 170-175. (In Russian)

Galagan Tatjana and Sigareva Dina 583 

International Symposium: Current Trends in Plant Protection UDK: 632.651.32(477) 

Proceedings 

DISTRIBUTION OF GLOBODERA ROSTOCHIENSIS AND ITS 

CONTROL IN UKRAINE 

GALAGAN TATJANA AND SIGAREVA DINA 

Institute of Plant Protection NAAS of Ukraine, Vasilkovskaya str. 33, Kiev-022, 03022, 

Ukraine, galaganta@mail.ru 

Globodera rostochiensis has been detected on 5059,64 hectares of agricultural land in 17 

regions in Ukraine. The system of protective measures, including various schemes of growing 

nematode-resistant varieties of potato and non-host plants, is presented in the paper. 

plants 

Key words: Globodera rostochiensis, potato, distribution, control, resistant varieties, non-host 

INTRODUCTION 

Golden potato cyst nematode, Globodera rostochiensis (Wollenweber, 1923, 

Behrens, 1975) – a quarantine organism, has been reported in 17 regions in Ukraine 

totalling to the area of 5059,64 hectares (Fig.1). Its danger consists not only in significant 

loss of potato yield and reducing its quality, but also in the fact that infected areas are 

symptomless. Therefore, a strategy and protective measures must be, first of all, focused on 

prevention of further spread of G. rostochiensis to the uninfected soils. 

Concerning the protection of potato in the areas already infected by the pathogen, 

there is a lot of information in the world literature about the impact of population size of 

potato cyst nematode on potato growing technology (Shevchenko et al., 2007). 

The experience of countries faced with a problem of globoderosis has shown that 

chemical nematicides and resistant varieties are the most effective methods to manage this 

pathogen. But, chemical treatments entail too many negative effects. Moreover, the use of 

chemical nematicides is not permitted in Ukraine. Because of these reasons, the preferred 

method to deal with the golden nematode in Ukraine is to grow resistant varieties. From the 

aspect of ecology, it is the most acceptable way of potato cyst nematode control today. 

Application of methods depends on the soil population density of G.rostochiensis and 

specific conditions in the potato sector (availability resistant potato varieties, the ability to 

use science-based crop rotation, etc.). Although the planting of resistant varieties is 

currently the most effective way to deal with globoderosis, the use of non-host plants 

should not be neglected as a protective measure either (Sulchak, Galagan, 2012).

584 Distribution of Globodera rostochiensis and its control in Ukraine 

Fig.1 – Distribution of Globodera rostochiensis in Ukraine 

On the basis of our long-term researches we developed a system of protective 

measures, including various schemes of growing nematode-resistant varieties of potatoes, 

districted for a concrete soil-climatic zones and crop rotation with non-host plants (Galagan 

et al., 2011) (Table 1). 

Table 1 – Control of Globodera rostochiensis in Ukraine 

Level of G. rostochiensis 

population density (j.+eg. Measures 

/100 cm 3 of soil) 

Very low (1-500) 

Annual checking of level of PCN population’s density 

Annual cultivation of PCN resistant potato variety and checking 

Low (501-1000) 

the following years the level of PCN population’s density 

3-field crop rotation with non-host plants and resistant potato 

Moderate (1001-5000) variety is recommended. Then cultivation of a susceptible variety 

with periodic control of level of soil infestation 

Crop rotation with non-host plants and resistant potato variety (not 

High (5001-15000) 

more than 1 time in 3-5 years) 

Crop rotation with non-host plants and resistant potato variety (not 

Very high (>15000) more than 1 time in 5 years) is necessary, but better – growing 

potatoes is not recommended for 10 years 

Species and varieties of non-host plants develop different characteristics, depending 

on the country and soil-climatic zone. Thus, it is necessary to choose the most adequate 

non-host plants among those traditionally grown in every zone. 

For this reason, the aim of this paper was to estimate the effectiveness of potato cyst 

nematode elimination from soil using nematode-resistant varieties and non-host plants on 

homestead farms, where about 98,00% of potato is grown in Ukraine.

Galagan Tatjana and Sigareva Dina 585 


The material used in research included the results of team’s own long-term studies 

and the papers of graduate students based on laboratory analysis of globoderosis on 

homestead farms in the Volyn, Chernihiv, Lviv and Kyiv regions. The choice of zones 

covered by the research was based on differences in the areas of distribution and levels of 

pathogen contamination in these regions. In order to evaluate the efficiency of G. 

rostochiensis eradication from soil, the zoned nematode-resistant varieties of potato and 

non-host plants were sown in the fields where potato was grown as a monoculture, showing 

the high initial level of invasion (> 8000 juv. + eg./100 см 3 of soil). The selection of soil 

samples and eelworms found in them, determination of the population density and 

assessment of the effectiveness of control methods, determination of closeness of 

populations and efficiency assessment of control methods, were performed using the 

conventional methods (Sigareva, 1986). 


The results for the Volyn region, where golden nematode extended to the area of 

1034,97 ha, and the level of soil infestation did not exceed 25 000 juv.+eg./100 см 3 of soil, 

the well-proven varieties Dniprianka, Lileya, and Sante eliminated pathogen by 70,10 - 

99,80% per annual cultivation. 

In the Chernihiv region, where G. rostochiensis was somewhat less common (807.77 

ha), but the population density occasionally reached 100 000 juv.+eg./100 см 3 of soil, 

varieties Obriji, Sednivska rannya, Chernigivska rannya, Pekyrivska, and Vodogray 

purified the soil from golden nematode by 54,70-91,80% per annual cultivation (Zhilina, 

2005). 

In the Kiev region, where the infested area was only 60,21 ha, and the level of 

nematode invasion did not exceed 17 000 juv.+eg./100 см 3 of soil, the best effectiveness 

(72,00-95,00%) showed the varieties Vodogray, Povin, Dnipryanka, Partner, Mandrivnitsa, 

Zvizdal, Slovyanka, and Levada. 

In the Lviv region, where 270,25 ha of land were infested with the golden nematode, 

and the level of invasion did not exceed 12 000 juv.+eg./100 см 3 of soil, in the conditions 

of difficult mountain terrain, the high efficiency of nematode-resistant varieties grown for a 

year was not observed. However, the three-year growing in the same area of resistant 

varieties Slovyanka, Obrij, Zakhidna resulted in decline of G.rostochiensis populations by 

64,20-73.80%. 

Regarding the crop rotation with non-host plants, short-term crop rotations in the 

Volyn region, such as three-field system with small grains (wheat, barley), or five-field 

system - with three years of a lucerne (alfalfa) cultivation and annual of oats, reduced the 

soil infestation by golden nematode by 89,00-90,00%, even when susceptible potato 

varieties were cultivated. 

In the Chernihiv region the annual growing of wheat, cucumber, lupine, maize, 

beans, reduced the level of soil infestation by G.rostochiensis by 48,70-66,06%, of beet - by 

37,50-45,50%, and of white cabbage - by 33,30% (Zhilina, 2005). 

In the Lviv region, neither using of resistant varieties, nor the growing of non-host 

plants proved to be highly efficient. The average efficiency of annual growing of non-host 

plants, such as clover, beans and cucumbers, ranged from 22,00 to 31,00%. Somewhat

586 Distribution of Globodera rostochiensis and its control in Ukraine 

lower effectiveness (10,00-19,00%) was observed when growing rye, wheat, lupine, or beet 

(Sulchak, Galagan, 2012). 

REFERENCES 

Galagan, T.A., Sigareva D.D., Nikishicheva, E.S., Nikolaytchuk, L.P. (2011): System of 

protective actions against golden potato nematode in Ukraine. Abstr. of IXth RSN 

International Symposium, Russian Journal of Nematology, 19 (2): 192. 

Sigareva, D.D. (1986): Methodical instructions on identification and registration of parasitic 

nematodes of field crops, “Urozay”, Kiev, pp: 21. (in Russian) 

Shevchenko, N.G., Galagan, T.O., Sigareva, D.D. (2007): The measures for potato protection 

against globoderosis. Protection and Quarantine of Plants (Interdepartmental thematic 

scientific collection), Kyiv, 53: 214-218. (in Ukrainian) 

Sulchak, N.Y., Galagan, T.A. (2012): Using of non-host plants for decrease of golden potato 

nematode infestation in soil. Collection of Papers of Institute of Bioenergy Crops and 

Sugar Beet, Kyiv, 14: 205-208. (in Ukrainian) 

Zhilina, T.M. Parasitic nematodes of potato in the East Polesje in Ukraine: spreading, 

harmfulness and quantity control methods. PhD Thesis, National Agrarian University 

Kyiv, 21pp. (in Ukrainian)


International Symposium: Current Trends in Plant Protection UDK: 632.651.32(481) 

Proceedings 

HALF A CENTURY OF POTATO CYST NEMATODE 

(GLOBODERA SPP.) MANAGEMENT IN NORWAY 

RICARDO HOLGADO AND CHRISTER MAGNUSSON 

Norwegian Institute for Agricultural and Environmental Research, Plant Health and Plant 

Protection Division, Dept. of Entomology and Nematology Høgskoleveien 7, 1432 Aas, Norway 

Potato cyst nematodes (PCN) have been present in Norway for more than a half century. 

Since their detection, management strategies have been implemented in order to limit and/or prevent 

the spread of the nematode. Since 1955 surveys have been made to map the distribution of Globodera 

rostochiensis and G. pallida. Both species are quarantine pests. The legislative regulation of PCN was 

introduced in 1956 and prohibits introduction and spread of the nematode with soil or plant materials. 

In Norway all pathotypes of G. pallida and most pathotypes of G. rostochiensis except Ro1 are 

considered virulent. Non-virulent G. rostochiensis is managed by crop rotation using non-host crops; 

alternating susceptible and resistant cultivars, while infestations byG. pallida or virulent G. 

rostochiensis results in 40-years ban on growing potato. In the past 50 years great emphasis has been 

placed on documenting freedom from PCN in the certified seed potato production. Infested fields are 

subjected to a strict quarantine. To prevent introduction of PCN import of seed potato is forbidden. 

Nematicides have been banned for more than 40 years, so the use of resistant potato cultivars 

becomes important, and requires correct information on species and pathotypes. During the last 50 

years Norwegian statutory regulations have contributed in preventing PCN infestations in seed potato 

areas, and also prevented further spreading of G. pallida, and virulent G. rostochiensis as the detected 

nematodes were placed under quarantine. 

Key words: Potato cyst nematodes, G. rostochiensis, G. pallida, pathotypes, quarantine 

regulations, Norway 

INTRODUCTION 

Potato cyst nematodes (PCN) Globodera spp. are thought to have originated in the 

Andean region of South America, and have been introduced into Europe after 1850. 

Subsequently, in Nordic region PCN were detected in Sweden 1922, Denmark 1928, 

Finland 1946, Faroe Island 1951, Island 1953, and Norway 1955 (Videgård, 1969; Øydvin, 

1975). 

Since the first record of PCN in Norway in 1955 there has been more than a half 

century of the potato cyst nematode management. After the first detection of PCN extensive 

surveys were carried out and regulations were implemented. The first statutory regulation 

for PCN dates from 1956, and has later been amended several times (Holgado and 

Magnusson, 2010). The latest amendment was made in 2010 (Anonymous, 2010). All 

regulations prohibit the introduction and spread of PCN with soil and plant materials. Early

588 Half a century of potato cyst nematode (Globodera spp.) management in Norway 

control strategies included the use of chemical fumigants and resistant potato cultivars in 

infested fields. 

The taxonomic separation of the yellow Globodera rostochiensis and the white 

species G. pallida, together with emerging information on the existence of pathotypes 

caused a change in the strategy involving a controlled use of resistant cultivars to avoid the 

increase of resistant breaking pathotypes. Today Globodera rostochiensis and the white 

species G. pallida are regarded as quarantine pests. 

In the preceding decades great emphasis has been placed on documenting freedom 

from PCN in the production of certified seed potatoes, and on the detection of infested 

fields and their placement under effective quarantine regulations. In the early 1960s import 

and movement of all kinds of potato seed was prohibited, as a measure to prevent the 

introduction of new PCN populations, and to prevent contamination of uninfested land. In 

addition proper crop rotation and the use of cultivars with resistance have been enhanced 

(Holgado and Magnusson, 2010). 

Commercial chemical fumigants, organophosphates or carbamate nematicides have 

not been used in Norway for more than 40 years. Today, non-virulent G. rostochiensis is 

managed by crop rotation, while infestations by G. pallida or virulent G. rostochiensis 

results in 40-years ban on growing potato (Holgado and Magnusson, 2010, 2012b). Most 

Norwegian potato cultivars have the resistance genes, Gro-1 (H1) from Solanum tuberosum 

ssp. andigena. Crop rotations using non-host crops, alternating susceptible and resistant 

cultivars are important control measures, but not easy to implement in Norway due to 

restricted acreage suiTable for long rotations. Hence, the use of resistant potato cultivars 

becomes important, but requires a better knowledge on the species and present pathotypes 

(Holgado and Magnusson, 2010, 2012b). An overview of the PCN management strategies 

and studies done since PCN were detected in Norway are presented in this paper. 


The history of regulations has been compiled by reviewing official documents. 

Information on distribution and biology of PCN has been collected from survey reports, 

current compilations and published experimental data. With regard to survey data the 

current sampling system is shown in Table 1. 

Table 1 Type of soil sampling to estimate PCN occurrence and density for statutory and 

advisory purpose 

Number of 

Total bulked Area to provide Patterns of cores grid 

Type of Sample cores pr. 

Sample one bulk sample (Core size 25.0x2.5 cm.) 

Sample. 

Routine 50 250ml 0.5 ha Line distance 10m 

Certified potato 50 250ml 0.25 ha Line distance 7m 

Quarantine proposes 9 250ml 100m 2 Line distance 3m 

Statutory tests 25 1000ml 100m 2 Line distance 2m 

Suspicion of PCN 

infection 

In stored Packing 

houses of ware 

potatoes 

- 500ml - Soil and plant samples 

250ml 

min 30 ton 

potato 

Min. 1 sample pr. 

Consignment


PCN MANAGEMENT 

Occurrence of PCN in surveys of areas for potato production 

The detection of PCN in Agder-County in 1955 immediately triggered an extensive 

survey activity of both production fields and home gardens. This activity continued until 

the end of the 1990s, and provided a significant increase in our knowledge of the 

distribution of PCN. In 1974 PCN had been detected in all counties south of the Dovre 

Mountains with the exception of Hedmark. In 1985 PCN was recorded in the counties of 

Møre and Romsdal, Hedmark and Sør Trøndelag. In 1993 the nematode was registered in 

the county of Nord Trøndelag in the municipalities of Frosta, and Stjørdal in 2004. In the 

northernmost counties of Finmark, Nordland and Troms old and empty cysts without 

juveniles or eggs were detected, but subsequent monitoring has failed in revealing new 

infestations (Holgado and Magnusson, 2010). 

The intensive surveys carried out from 1955 until 2000 demonstrated PCN to occur 

in 6406 properties, and 47% of these observations were made in home gardens (Table 2). 

PCN was recorded in 5% of the total 89162 samples analysed. However, in these surveys 

many samples were collected in the county of Hedmark, an area with low infection and 

high sampling activity due to the large production of certified seed potato. 

In order to update the information on the distribution of PCN a new national survey 

of ware potato fields was started in 2009. The first year 2375 samples were analysed from 

the county of Rogaland and PCN was discovered in a frequency of 14%. In the second year 

a total of 2590 samples from 5 counties were analysed (Table 3). High incidences of PCN 

were in the counties of Rogaland (22 %) and Vest Agder (17%). In Hedmark county 12 % 

of samples were recorded with PCN, as samples were collected from packing houses, these 

packing houses received potato for packing from other counties around Norway, therefore 

findings of Hedmark do not represent the PCN distribution on potato field for this county 

(Table 3).This survey will continue until all major potato areas have been covered. 

Table 2 Occurrence of PCN in Norway on properties (farms and home gardens), number of 

analysed samples with and without PCN, during the extensive survey period 1955– 

2000. 

Total 

Home 

gardens 

(% )* 

2979 

Number of properties with PCN 

Farms 

Without 

information 

Total 

1785 1642 6406 

With 

PCN 

(%)** 

4554 

Analysed samples 

Without PCN 

Total 

84 608 89 162 

(47) 

(5) 

* % in relation to the total proprieties with PCN (farms + home gardens) 

** % in relation to the total number of samples analysed


Table 3 Occurrence of PCN in Norway by counties, number of analysed samples with and 

without PCN, during the 2010-2011 

County Total samples With PCN (%) Without PCN (%) 

Aust-Agder 475 35(7.3) 430 (92.7) 

Vest-Agder 99 17 (17.1) 82 (82.8 ) 

Rogaland 385 85 (22.0) 300 (78.0) 

Nord-Trøndelag 906 3 (0.3) 903 (99.6) 

Hedmark 

(packing houses) 

725 12 (1.6) 713 (98.4) 

Total 2590 (100 %) 152 (6.0) 2438 (94) 

PCN and certified seed potato 

Official controls of certified seed potatoes started in 1939. At that time the 

regulations were aimed at controlling Synchytrium endobioticum, Potato Mosaic Virus, and 

preventing the entry of Leptinontarsa decemlineata. So at this time there was no prevention 

against the importation of PCN in seed potato (Jørstad, 1951). In 1957, however, 

Heterodera rostochiensis f. solani was incorporated in the regulations on certified seed 

potatoes (Larsen, 1951). Surveying areas with production of certified seed potatoes for 

PCN started already in 1956, soon after the first detection of PCN in Norway. By now, 

areas with seed potato production have been under constant monitoring for more than 50 

years. Each year about 3000 soil samples are taken (normally after lifting) and analysed for 

PCN to clear areas for certified seed potato production. These areas are so far free of PCN. 

Nematode virulence 

The diversity of pathotypes was first recognised when the reproductive ability of 

PCN populations was tested on Solanum clones containing PCN resistance genes, e.g. gene 

H1 from Solanumtuberosum ssp. andigena. These resistance genes were identified in 

collections of wild or cultivated Andean potatoes, and were recognised as a potential tool 

for PCN control. However, it became evident that many PCN populations could reproduce 

on Solanum clones despite the presence of these resistance genes. This led to the 

recognition of a series of virulent “resistance-breaking” pathotypes within both species 

(Videgård, 1969; Bumulucz and Øydvin, 1976). 

PCN species and pathotypes found in Norway 

The correct identification of species and pathotypes is of crucial importance for the 

kind management and regulations to be imposed. Studies on the identity of species and 

pathotypes have been carried out since the middle of the 1970s until present time. This is 

done in accordance with the EPPO diagnostic protocol PM 7/40(2) (EPPO, 2009) and 

includes morphology, iso-electric focusing and molecular methods. The initial studies on 

pathotypes were made according to Kort et al. (1977).


Under Norwegian conditions all pathotypes of G. pallida and most pathotypes of G. 

rostochiensis except Ro1 are considered virulent on andigena-resistant potatoes. Hence, in 

the 1980s a simpler method was introduced using resistant potato cv. Saturna (resistant to 

Ro1and Ro4) with the susceptible variety Kerrs Pink as control. Populations developing on 

cv. Saturna are classified as resistance breakers. In Norway occurs G. rostochiensis 

pathotypes Ro1, Ro2, Ro3 and Ro4, and G.pallida, Pa1 and Pa2/Pa3. Pathotype Ro1 is the 

predominant and represents 98% of the infections. The earlier surveys indicated that G. 

rostochiensis had a moderate distribution and occurred mainly in the southern part of the 

country, while the distribution of G. pallida, was much restricted and limited mainly to 

home gardens. However in the last 5 years we have detected infestations by G. pallida, and 

resistant breaking G. rostochiensis (Ro3) in a small number of commercial fields. 

In recent times we observed large morphological variability in PCN regarding shape 

and length of stylet, tail, and characters of the perineal pattern. Studies including DNAbased 

diagnostics of these populations are at the present underway (Holgado and 

Magnusson, 2010). 

Crop rotation 

Since 1956 crop rotation on a 4 year basis was included in the statutory regulation. 

In this early stage resistance was not recognised. In 1970 the use of resistant potato 

cultivars was officially recommended in Norway. For Norwegian farmers today the best 

long-term policy to manage G. rostochiensis Ro1 is still crop rotation using non-host crops, 

and alternating between susceptible and resistant cultivars every 4 years. This 

recommendation includes the use of certified seed potatoes. The 4 years rotations, however, 

are complicated by restricted acreage. 

Potential for using trap crops and biofumigation 

The use of early potatoes as a trap crop is recommended for reducing PCN 

populations. A recommendation for Norwegian farmers with early potato production is to 

plant and grow for sufficient time to permit nematode infection, and lift before the start of 

nematode reproduction. 

Our studies have shown that PCN need 40 days to start to form new cysts in 

southern Norway (Bioforsk unpubl). 

The establishment of Solanum sisymbriifolium in field trials using the commercial 

varieties are in progress. Studies performed from 2009 -2011 in 5 localities showed 

Solanum sisymbriifolium incapable of competing with weeds. Sowing in July after early 

potatoes using rimsulfuron to control weeds was more promising. These studies indicated 

that S. sisymbriifolium could establish successfully if attention was paid to proper weed 

management and sowing time (Holgado et al., 2010, Holgado and Magnusson, 2010). 

Brassicas are used as biofumigants most commonly through the use of green 

manures. Brassica species release chemical compounds that may be toxic to soilborne 

pathogens and pests, such as nematodes, fungi and some weeds. Oilseed mustard and white 

radish have been reported as good alternatives for nematode management (Holgado and 

Magnusson, 2012a). 

Studies to evaluate the agronomic performance of Caliente Brand Mustard Products 

(Caliente 199, Caliente 61 and Nemat) have started (Holgado and Magnusson, 2012a), field 

trials in three localities in Sør Trøndelag county begun in may 2012.


Occurrence and pathogenicity of microbial antagonists parasitic to PCN 

Soil from fields with PCN was collected and bait used for antagonistic fungi, as 

previously described by Holgado and Crump (2003). 

The soil samples were collected in the counties of Nord Trøndelag (six localities) 

and Rogaland (five localities). Four growing chambers were filled with test soils. For each 

species two chambers were inoculated with 20 cysts. Each chamber was planted with two 

potato chits of susceptible potato cultivars Beate or Desirée. Females developing on the 

root surface were examined monthly. The females were counted and infected specimens 

were removed from the roots and placed onto moist filter paper in a Petri dish and assessed 

for infection. Fungi that sporulated, and could be identified were transferred on nutrient 

agar. The following nematophagous fungi were found: Pochonia chlamydiosporia, 

Paecilomyces lilacinus and Catenaria spp. 

Historical review of regulation and management of PCN in Norway 

The management of PCN has been based mainly on regulatory restrictions. The first 

regulation on PCN specifically is dated 31 May 1956 and prescribed potato or tomato 

cultivation every 4 years, and prohibited soil or infected plants to be moved (Anonymous, 

1956). In 1962 the regulation was amended by incorporating a ban on the movement of 

equipment and machinery used in the infected area, unless it was cleaned, inspected and 

found free of PCN (Anonymous, 1962). In 1964 the Ministry of Agriculture reviewed the 

general statutory rules from 1916 (Anonymous, 1916), and launched a new law dealing 

with prevention and control of plant pests (Anonymous, 1964). This resulted in a revision 

of the PCN regulation, which now included the use of PCN resistant potato cultivars 

(Anonymous, 1970). For using resistant cultivars a surveillance and official control of the 

infected areas was recommended, and the control strategies now included the use of 

chemical fumigants in highly infested fields. The survey activity detected new infestations, 

and infested fields were placed under quarantine regulations (Anonymous, 1976). In 1977 a 

new regulation appeared were the taxonomic separation of G. rostochiensis and G. pallida, 

together with emerging information on the existence of pathotypes was taken into 

consideration. The regulation of 1977 recommended a controlled use of resistant cultivars, 

to avoid the increase of resistant breaking pathotypes (Anonymous, 1977). In 1990 a new 

regulation incorporated a prohibition of growing potatoes in areas with G. pallida, or 

virulent G. rostochiensis, and included further the possibility of imposing a ban on growing 

potato in areas close to the farms, or on farms sharing equipment or machinery with 

infested farms (Anonymous, 1990). 

In 1998 the Ministry of Agriculture delegated the responsibility for maintaining 

good plant health to the Norwegian Plant Inspection Service. A new regulation for PCN 

was produced, and included measures for potato manufacturing facilities; if PCN was 

found, sanitary measures are compulsory to the houses committed to packing potatoes. For 

farmers the movement of their own seed potatoes from packing houses was prohibited. 

Also the possibility of economic compensation for farms affected with a ban for growing 

potatoes is mentioned (Anonymous, 1998). In 2000 a new PCN regulation stipulated that 

all potato producers and manufacturing facilities must be officially listed and have an 

internal control system for PCN management, including preventive measures against its 

dissemination. The regulation mentioned the possibility of a long quarantine period for 

resistance breaking PCN populations, in practice more than 40 years due to the long 

persistence of PCN in the absence of host plants (Anonymous, 2000). 

Today the Norwegian Food Safety Authority is in charge of import and export 

inspections for plants and plant products, and surveillance and official control programs for


regulated pests. In April 2010 a new regulation was introduced (Anonymous, 2010) 

prescribing surveillance and official control of PCN-infected and non-infected areas where 

potatoes are produced. 

This new strategy implies the demarking and regulation of the area actually infested. 

The statutory regulations indicate two important principles; the owner/tenant of property 

where PCN has been detected must have the knowledge on species and its distribution on 

the farm land; and owners/tenants have the responsibility to limit and/or prevent further 

spread. PCN populations on infested areas shall be reduced. To meet this requirement in 

2011 The Norwegian potato industry has created a standard for potato cultivation practices 

to control and prevent the spreading of PCN (Anonymous, 2011). The standard gives a 

description of measures for potato growers. The recommendations are easier to implement 

on farms without PCN, and more complex on farms with known PCN infestation. 

DISCUSSION 

During the last 55 years our knowledge on the occurrence of PCN in Norway has 

grown considerably, and PCN is today considered as one of the most noxious pests in 

Norwegian potato production. The recognition of PCN as an important potato pest has 

increased, and it has become apparent that continuous cropping of susceptible cultivars on 

land heavily infested with G. rostochiensis (Ro1) may easily result in an average yield loss 

exceeding 50%. Both G. rostochiensis and G. pallida are quarantine pests subjected to 

national regulations. An infection by G. pallida and virulent G. rostochiensis adds a serious 

aspect to the situation because of the strict regulation involving a minimum of 40-years ban 

on growing potatoes (Holgado and Magnusson, 2010). The duration of this ban is based on 

studies from Northern Ireland indicating a persistence of eggs and juveniles for 42 years in 

soil without host plants (Turner, 1996). 

With this in mind, the first priority of management is to keep farms free of PCN, and 

access to clean seed potatoes is fundamental. Great emphasis has been placed on 

documenting freedom from PCN in the certified production. The domestic production of 

seed potato has been kept free of PCN by frequent inspections and analyses for more than 

50 years (Holgado and Magnusson 2010). The fact that farmers are not allowed to import 

seed potatoes adds to the level of security. 

Although the survey activities steadily increase our knowledge of the PCN situation, 

our experience indicates that it is necessary to have better information on the distribution of 

virulent populations. As continuous cropping of cultivars with H1 resistance gene on land 

infested with the G. rostochiensis Ro1 decimates the nematode population fairly rapidly, 

there is a temptation to use resistant cultivars too often. The selection for resistancebreaking 

pathotypes has been demonstrated in a long-term field trial where an infestation of 

G. rostochiensis Rol was shown to contain initially low frequencies of andigena resistancebreaking 

genes. The continuous cropping of Ro1 resistant potato cultivars for 10 years 

resulted in Ro3 overcoming Ro1 (Bomulucz and Øydvin, 1976). Complementary laboratory 

studies indicated that continuous growing of H1 resistant cv. Saturna in soil with Ro1/Ro3 

mixtures, showed that an initial Ro3 frequency as low as 0.1% in 5 years’ time resulted in 

high populations of Ro3 (Magnusson et al., 1999). This is in line with experience of other 

European countries where intensive cropping of potato cultivars with the H1 resistance 

gene has allowed G. pallida, to increase (Minnis et al., 2000). These observations suggest 

that routine-testing PCN populations for virulence would be important.


Correct identification to species and pathotype is of crucial importance for 

management and regulations to be imposed. It is likely that each introduction of PCN into 

Norway represents only a sub-set of the original population gene pool. 

Consequently, each introduction is likely to have been genetically distinct with a 

limited variability. Our morphological studies indicate a degree of variation that needs to be 

analysed further by a combination of morphological studies, and molecular techniques 

focussing on our domestic populations (Holgado and Magnusson, 2010). 

The use of traps crops as early potato cultivars is aimed at reducing PCN 

populations. The effectiveness of this method is highly dependent on the time frame for 

hatching and reproduction of the PCN population. However, cropping potatoes as trap crop 

requires careful timing to avoid increasing rather than reducing PCN populations. Hence, 

trap-cropping systems with early potatoes need to be closely adapted to local conditions. 

Our studies in potato fields in southern part of Norway indicate new cysts are formed after 

40 days. We assume the formation of cysts in northern parts of Norway requires less than 

40 days. Our assumptions are based on growing a PCN population from Finland in a 

chamber with a day temperature of 18 o C, which started to form new cysts after 20 days. 

The inclusion of S. sisymbriifolium as trap crop in Norwegian management systems 

is not without agronomic complications and need to be investigated further. Studies of 

using crops for biofumigation (Caliente Brand Mustard) just have started and need to be 

investigated further. It will be also necessary to include cost and benefit for farmers in it. 

The presence of natural enemies to cyst nematodes indicates that there is a reason to 

suspect that plant parasitic nematodes in Norwegian fields live under various degrees of 

natural control (Holgado and Magnusson, 2010). However, it will be necessary to screen 

these fungal isolates to select the best isolates for testing in long term field trials, which will 

be an important task in further studies. 

Norwegian statutory regulations have been sensitive to new information on PCN. 

The regulations have without doubt contributed in preventing PCN infestations in the seed 

potato areas, and probably also prevented further spreading of G. pallida, and virulent G. 

rostochiensis as the detected nematodes were placed under quarantine. Permanent grass as a 

statutory regulation in home garden plots may have contributed to reducing the spread of G. 

pallida, to commercial fields. 

The regulations have most probably made possible the early reduction in use of 

chemical fumigants, organophosphates or carbamate nematicides. These chemicals have not 

been used since the early 1970s.The statutory regulation for PCN from 2010 has created a 

new challenge for potato production. The Norwegian potato industry and potato growers 

have generated a standard for potato cultivation to prevent the increasing problems with 

PCN. The potato cultivation standard has just started to be tested in practice and will be 

compulsory from 2013 (Anonymous, 2011). 

However, to further alleviate the present situation for Norwegian farmers, it is 

necessary to provide new information for a better prognosis of rates of decline in PCN 

numbers and infectivity in field soil. Any possible shortening the quarantine period would 

have immediate positive economic effects for farmers and local enterprises and also will 

contribute to the sustainable development of potato production. 


The authors wish to acknowledge the support from the Research Council of Norway, 

the Foundation for Research Levy on Agricultural Products, the Agricultural Agreement


Research Fund, and Norwegian food industries. To Marlijn Hellendoorn-Vos from 

VandijkeSemo BV, The Netherlands, for providing seeds of Solanum sisymbriifolium. 

To Alec Roberts from Plant Solutions, division of Tozer Seeds Ltd. UK for 

providing seeds of Caliente brand. To Bonsak Hammeraas, Kari-Anne Strandenæs, Irene 

Rasmussen, from Bioforsk for technical assistance. The authors also wish to thank Håkon 

Brække and Randi Knudsen from the Norwegian Food Safety Authority for the information 

provided. 

REFERENCES 

Anonymous (1916): Lov om bekjempelse av skadeinsekter og plantesygdommer av 21. juli 

1916 nr.15 landbruksdepartementet 1916. 

Anonymous (1956): Rådgjerder mot potetål gitt ved Kronprinsregentens resolusjon av 31. 

mai.1956. 

Anonymous (1962): Forskrifter om rådegjerder mot potetål (potetnematode) Heterodera 

rostochiensis. Fastsatt av landbruksdepartementet den 26. november 1962. 

Anonymous (1964): Lov om tiltak mot plantesjukdommar og skadedyr på planter 

(Plantesjukdomslova) av 14. mars 1964. 

Anonymous (1970): Forskrifter om rådegjerder mot potetnematode (potetcystenematode) 

Heteroderarostochiensis Woll. fastsatt av landbruksdepartementet den 28. april 1970. 

Anonymous (1976): Kjend utbreiing av potetcystenematoder (Heterodera rostochiensis Woll. 

og H.pallida Stone) i Norge etter 20 års gransking. Statens Plantevern, Zoologisk 

avdeling. Ås Norge:1–24. 

Anonymous (1977): Forskrifter om rådegjerder mot potetnematoder, Globoderarostochiensis 

(Woll.) og Globodera pallida (Stone) – gull og kvit potetcystenematode (potetål), fastsatt 

av landbruksdepartementet den 5. desember 1977. 

Anonymous (1990): Utfyllende bestemmelser om tiltak mot Potetcystenematoder, 

Globoderarostochiensis (Woll.) og Globodera pallida (Stone) - gull og kvit 

potetcystenematode (PCN), fastsatt av Statens plantevern den 1. november 1990. 

Anonymous (1998): Utfyllende bestemmelser om tiltak mot gull og hvit potetcystenematode 

(PCN) Globoderarostochiensis (Woll.) Behrens og Globodera pallida (Stone) Behrens. 

Fastsatt av Statens landbrukstilsyn den 21. oktober 1998. 

Anonymous (2000): Forvaltningspraksis ved påvisning av hvit og gul potetcystenematode 

(PCN), i medhold av Forskrift om planter og tiltak mot skadegjørere av 1.1.2000. 

Fastsatt av Statens landbrukstilsyn den 24. oktober 2000. 

Anonymous (2010): Forvaltningspraksis ved påvisning av hvit og gul potetcystenematode 

(PCN), i medhold av Matloven § 23 og plantehelseforskriften § 6. Fastsatt av Mattilsynet 

april 2010. 

Anonymous (2011):Nasjonal bransjestandard for PCN. Standard er utarbeidet på vegne av den 

norske potetbransjen, med utgangspunkt i Mattilsynets ”Forvaltningspraksis ved 

påvisning av gul og/eller hvit potetcystenematode (PCN)”. Arbeidet med Nasjonal 

bransjestandard for PCN ble avsluttet 27. oktober 2011. 

Bumulucz, L., Øydvin, J. (1976): Populasjonstettleik hos gul potetcystemantode Heterodera 

rostochiensis Woll. og potetavlingar ved ensidig dyrkning av motakeleg og ex andigene 

nematode resistente cultivar med genet H1 1963–1970. Forskning og Forsøk i 

Landbruket. 27:731–743. 

EPPO (2009): PM 7/40 (2). Diagnostics Globodera rostochiensis and Globodera pallida. EPPO 

Bulletin 39:354–358. 

Holgado, R., Crump, D. H. (2003): First record on the occurrence of nematophagous fungi 

parasitizing cyst nematodes in Norway. International Journal of Nematology 13:65–71.


Holgado, R., Magnusson, C. (2010):Management of Potato cyst nematodes (Globodera spp.) 

populations under Norwegian conditions. Aspects of Applied Biology, 3rd Symposium 

onPotato Cyst Nematodes 103:87-92. 

Holgado, R., Magnusson, C. (2012a): Biogassing mot nematoder- aktuelt under norsk forhold? 

Bioforsk Fokus (7) 2: 127-129. 

Holgado, R., Magnusson, C. (2012b):Nematodes as a Limiting Factor in Potato Production in 

Scandinavia. Potato Research publ. online. DOI 10.1007/s11540-012-9209-6. 

Holgado, R., Niere, B., Forbord, J. O., Vagle, A., Magnusson, C. (2010): Resultater fra 

pilotprosjekt om potetcystenematoder, Bioforsk Fokus, 5, (2):148–149. 

Kort, J., Ross, H., Rumpenhorst, H. J., Stone, A. R. (1977): An international scheme for 

identifying and classifying pathotypes of potato cyst nematodes Globodera rostochiensis 

and G. pallida. Nematologica 23:333–339. 

Jørstad, I. (1951): Sunnhets-og kvalitetskontroll ved inn- og utførsel av poteter In Potetsorter i 

Norge. (L. Fornebo and O. Gjelsvik, eds.) Utgitt av Produsentenes 

omsettingsorganisajoner for Poteter, Eget forlag Oslo, 104–106. 

Larsen Dilling, O. (1951): Kontrollavl av settepoteter In Potetsorter i Norge (L. Fornebo and O. 

Gjelsvik, eds.) Utgitt av Produsentenes omsettingsorganisajoner for Poteter, Eget forlag 

Oslo. 95–103 

Magnusson, C., Hammeraas, B. (1994): Potetcystenematodenes (PCN) biologi, smitteveier og 

bekjempelse. FAGINFO /NLH-Fagtjeneste c \4:112–127. 

Magnusson, C., Brandsæther, L. O., Hammeraas, B. (1999): Dyrkingsstrategi mot 

potetcystenematoder (PCN) Globodera spp. Grønn Forskning, 02, 99:87–97. 

Minnis, S. J, Haydock, P. P. J., Ibrahim, S.K., Grove, I. G. (2000): The occurrence and 

distribution of potato cyst nematodes in England and Wales. Aspects of Applied Biology 

59, Potato cyst nematode management, 1–9. 

Øydvin, J. (1975):Nematoderesistentepotetsortar. Nordisk Jordbr.forsk., 57:487–492. 

Øydvin, J. (1978):Studies on Potatocyst-nematodes Globodera spp. (Skarbilovich) and the use 

of plant resistance against G. rostochiensis (Woll.) in Norway. Växtskyddsrapporter, 

Avhandlingar 2:1–37. 

Turner, S. J. (1996): Population decline of potato cyst nematodes (Globodera rostochiensis, G. 

pallida) in field soils in Northern Ireland. Annals of Applied Biology 129:315–322. 

Videgård, G. (1969): Nematoderesistenta sorter-sanerings effekt och faran för resistensbrytare. 

Potatis 1969:26–28.

Violeta Oro, Svetlana Živković, Tatjana Popović, Nenad Trkulja, Žarko Ivanović 597 

International Symposium: Current Trends in Plant Protection UDK: 632.651.32:577.1/.2 

Proceedings 

INFERRING PLACES OF ORIGIN OF TWO POTATO CYST 

NEMATODES FROM SERBIA USING MOLECULAR TOOLS 

VIOLETA ORO, SVETLANA ŽIVKOVIĆ, TATJANA POPOVIĆ, NENAD TRKULJA, 

ŽARKO IVANOVIĆ 

Institute for Plant Protection and Environment, T. Drajzera 9, Belgrade 

e-mail: viooro@yahoo.com 

Phylogenetic relationships are nowadays mostly studied at the molecular level, ie. on the basis 

of protein or nucleotide sequences. The obtained dendrograms reflect the evolutionary relationships 

among organisms and indicate the potential ancestor. To infer the potential places of origin of potato 

cyst nematodes (PCN) Globodera pallida and G. rostochiensis from Serbia, the statistical approach to 

Dispersal-Vicariance Analysis (S-DIVA) is used as molecular tool. The biogeographic history of 

Serbian PCN indicate that the possible ancestors of both PCN originate from Peru. The presence of 

Globodera pallida and G. rostochiensis in our country is not the result of direct import of infected 

potatoes from Latin America, but it is more likely that a country in Europe was a "transition host". 

Key words: potato cyst nematodes, Serbia, origin, phylogeny, molecular tools 

INTRODUCTION 

As a difference from the past time when biogeographic, morphologic or 

paleontologic data were used as the base of phylogeny, phylogenetic relationships are 

nowadays mostly studied at the molecular level, ie. on the basis of protein or nucleotide 

sequences. 

The dendrograms obtained by phylogenetic methods reflect the evolutionary 

relationships among organisms and indicate the potential ancestor or the paths of 

geochronologic speciation (Subbotin et al., 2003; Picard et al., 2008; Madani et al., 2010). 

To infer the potential places of origin of the two potato cyst nematodes (PCN) from Serbia, 

the statistical approach to Dispersal-Vicariance Analysis (S-DIVA) was used as molecular 

tool. 

Potato originated in the highlands of Peru particularly the region around Lake 

Titicaca. Potatoes were first domesticated at least 7 000 years ago. The food security 

provided by potato and maize allowed the development of civilizations such as the Huari 

and Inca (Choiseul et al., 2008). 

It seems there were two main “potato roads” to Europe in the past. The one was 

leading directly from Latin America to Spain and the other was the introduction of the 

potato from North America to England (Sanders, 1904). Introducing the potato to Europe 

they brought along its parasites – potato cyst nematodes: Globodera pallida (Stone)

598 Inferring places of origin of two potato cyst nematodes from Serbia ... 

Behrens and G. rostochiensis (Wollenweber) Behrens. According to Evans et al., (1975) G. 

pallida is dominant north of Lake Titicaca in Peru, Ecuador and Colombia. 

Globodera rostochiensis is dominant south of the lake (parts of Peru and Bolivia). In 

the southern parts of Peru, both species are present around the lake. 

Two potato cyst nematodes: G. rostochiensis and G. pallida are identified in Serbia 

since 2000 (Krnjaić et al., 2000) and 2005 (Krnjaić et al., 2005) respectively. The presence 

of introduced species of quarantine concern raise the logic question that has to be answered: 

Where did they come from? 


Dispersal-Vicariance Analysis (DIVA) is one of the most widely used methods of 

inferring biogeographic histories. S-DIVA complements DIVA and uses a Statistical 

Dispersal-Vicariance Analysis to statistically evaluate the alternative ancestral ranges at 

each node in a tree accounting for phylogenetic uncertainty and uncertainty in DIVA 

optimization. In S-DIVA, the frequencies of an ancestral range at a node in ancestral 

reconstructions are averaged over all trees and each alternative ancestral range at a node is 

weighted (Yu et al., 2010). 

Phylogenetic analyses of PCN were performed under Bayesian method implemented 

in S-DIVA, based on 15 002 trees and burn in function of 1500. The population 

Antofagasta from Chile was chosen as an outgroup. 

The comparisons of our PCN populations were made with similar sequences via 

NCBI GenBank database: 1. GU084810_Tiraque-Bolivia, 2. AF016872_Allpachaka-Peru, 

3. AF016877_Cuapiaxtla-Mexico, 4. DQ847117_Moscow-Russia, 5. 

FJ212164_Newfoundland-Canada, 6. GQ294521_BritishColumbia-Canada, 7. 

AB207271_Japan, 8. AY700060_Libelice-Slovenia, 9. EF622532_Victoria-Australia, 10. 

DQ847118_Scarcliffe-UK, 11. AF016876-Falkland Islands, 12. EF153840_York-UK, 13. 

EF153839_New York-USA, 14. EU855120-Poland, 15. DQ887562-South Africa, 16. 

AF016873-Peru, 17. AF016874_Anta-Peru, 18. HM159430_Milatovici-Serbia, 19. 

GU084809_LagunaPampa-Bolivia, 20. EU006705_Amantani-Peru, 21. 

GU084817_Porvenir-Peru, 22. GU084802_Apurimac-Peru, 23. EU006704_Huancabamba- 

Peru, 24. AF016867_Tiabaya-Peru, 25. AF016868_Santa Ana-Junin-Peru, 26. 

GU084818_La Libertad-Peru, 27. GU084804_Cusco-Peru, 28. GU084805_Puno-Peru, 29. 

GU084798_Taquile-Peru, 30. AF016865_Pilayo-Peru, 31. HQ260427_Otuzco-Peru, 32. 

HQ260426_Capachica-Peru, 33. HQ260428_Huamachuco-Peru, 34. 

AF016866_Peru_Bolivia border, 35. GU084815_Filipic-Chile, 36. GU084814_Cassola- 

Chile, 37. GU084801_Terre de Feu-Chile, 38. EF153838_YorkUK, 39. 

GQ294522_Newfoundland-Canada, 40.GU084808_Antofagasta-Chile, 41. 

EF153837_Idaho-USA, 42. DQ097514_Argentina, 43. AF016871-Spain, 44. 

DQ847109_Risby-UK, 45. AJ606687_Uzhorod-Ukraine, 46. EF622533_LI_Pali-NZ, 47. 

AF016869-Northern Ireland, 48. AF016870-Romania, 49. The Netherlands, 50. EU855119- 

Poland, 51. HM159428_Kladnica-Serbia. The first 18 populations represent sequences of 

G. rostochiensis. The rests are G. pallida.



The resulting consensus dendrogram (Fig. 1) suggests the potential places of origin of the 

two potato cyst nematodes. Regarding G. rostochiensis populations, the dendrogram 

derived from S-DIVA shows clades originating from different places. The Serbian 

population Milatovici belongs to the clade in which most world populations (from South 

Africa, Canada, USA, Australia,) are clustered. The Peruvian population Allpachaka is 

placed in this clade. 

The second clade comprises Euro-Asian (York-UK, Moscow-Russia) and Peruvian 

populations (Anta and unnamed population). The third clade clustered two European 

populations (Scarcliffe (UK) and Poland) with populations from Bolivia (Tiraque) and 

Mexico (Cuapiaxtla). 

Regarding G. pallida populations, the dendrogram shows three clades: 

predominantly European-Peruvian clade where the following countries are represented: 

Poland, Ukraine, England (UK), Spain, The Netherlands, Romania, North Ireland, Serbia, 

Canada, New Zealand and Peruvian populations: Cusco, Pilayo, Amantani and Capachica. 

There are two more clades. The one is Peruvian-Chilean with Taquile, Apurimac, Porvenir, 

Puno, Fillipic, Terre de Feu and Cassola and a strictly Peruvian clade. The third Peruvian 

clade represent localities (Santa Ana, La Libertad, Huancabamba, Huamachuco) which are 

geographicaly connected. The most distant populations was the population from Argentina 

and population Antofagasta from Chile. The latter was designated as Globodera sp. 

indicating that neither morphologic nor molecular identification was not able to designate 

species level. 

The exact places of origin of PCN populations from different countries can be 

resolved by broader sampling in South American countries as well as sequencing of the 

same DNA region. 

From the previous phylogenetic analysis, it could be assumed that possible ancestors 

of our PCN populations originate from Peru, since populations from the same clade are 

genetically the most similar. The presence of G. pallida and G. rostochiensis in our country 

is not the result of direct import of infected potatoes from Latin America, but it is more 

likely that a country in Europe was a "transition host".

600 Inferring places of origin of two potato cyst nematodes from Serbia ... 

Fig. 1 Consensus dendrogram of PCN populations derived from S-Diva


REFERENCES 

Choiseul, J., Doherty, G., Roe, G. (2008): Potato varieties in Ireland. Department of Agriculture, 

Fisheries and Food, pp: 78. 

http://www.agriculture.gov.ie/media/migration/farmingsectors/crops/seedcertification/to 

pspotatocentre/PotatoBook010610.pdf 

Evans, K., Franco, J., de Scurrah, M. M. (1975): Distribution of species of potato cystnematodes 

in South America. Nematologica 21: 365-369. 

Krnjaić, Đ., Bačić J., Krnjaić, S., Ćalić, R. (2000): Prvi nalaz zlatnožute krompirove nematode u 

Jugoslaviji. XI Jugoslovenski simpozijum o zaštiti bilja, Zlatibor, Zbornik rezimea, 71. 

Krnjaić, Đ., Oro, V., Gladović, S., Trkulja, N., Šćekić D., Kecović V. (2005): Novi nalazi 

krompirovih nematoda u Srbiji, Zaštita bilja, 53 (4): 147 -156. 

Madani, M., Subbotin, S.A., Ward, L.J., Li, X., De Boer, S.H. (2010): Molecular 

characterization of Canadian populations of potato cyst nematodes, Globodera 

rostochiensis and G. pallida using ribosomal nuclear RNA and cytochrome b genes. 

Canadian Journal of Plant Pathology 32: 252-263. 

Picard, D., Sempere, T., Plantard, O. (2008): Direction and timing of uplift propagation in the 

Peruvian Andes deduced from molecular phylogenetics of highland biotaxa. Earth and 

Planetary Science Letters, 271: 326-336. 

Sanders, T.W. (1905): The book of the potato. Collingridge, London, pp. 222. 

http://archive.org/stream/cu31924073899423#page/n9/mode/2up 

Subbotin, S.A., Sturhan, D., Rumpenhorst, H.J., Moens, M. (2003): Molecular and 

morphological characterisation of the Heterodera avenae complex species (Tylenchida: 

Heteroderidae). Nematology, 5: 515-538. 

Yu, Y., Harris. A.J., He, X. (2010): S-DIVA (Statistical Dispersal-Vicariance Analysis): A tool 

for inferring biogeographic histories. Molecular Phylogenetetics and Evolution, 56 

(2):848-850.

602 Morphology of Heterodera filipjevi from Serbia 


Proceedings 

MORPHOLOGY OF HETERODERA FILIPJEVI FROM SERBIA 

VIOLETA ORO, SVETLANA ŽIVKOVIĆ, TATJANA POPOVIĆ, NENAD TRKULJA, 

ŽARKO IVANOVIĆ 

Institute for Plant Protection and Environment, T. Drajzera 9, Belgrade 

e-mail: viooro@yahoo.com 

Cereals were grown in Serbia since the first humans came to this area. Wheat was dominant 

agriculture crop until the XVII century. Cyst nematodes associated with cereals were found 

occasionally and only Heterodera avenae was recorded. Morphological characters of cysts and 

second stage juveniles of Heterodera filipjevi are described. The morphology of the Serbian 

population is generally in accordance with foreign populations of the same species. 

Key words: Heterodera filipjevi, morphology, cysts, second stage juveniles 

INTRODUCTION 

Cereals were grown for centuries in Serbia, presumably since the first humans came 

to this area. The data from the XIV century and Serbian epic hero the prince Marko 

Kraljević (Mrnjavčević) mentioned wheat growing. From the XVII century maize was 

dominant agriculture crop. Nowadays, wheat, barley, triticale and oats are grown on 

approximate 600 000 ha and maize is grown in a double large territory, near 1 300 000 ha. 

Cyst nematodes associated with cereals were found occasionally and only Heterodera 

avenae was recorded (Meagher, 1977). The morphology of cysts and second stage juveniles 

of Heterodera filipjevi (Madžidov, 1981) Mulvey and Golden, 1983 from Serbia are 

described in this paper. 


During regular quarantine control in the soil samples originated from Gunaroš (Vojvodina 

province), Heterodera cysts were found. The cysts were extracted by elutriation with the 

Spears apparatus (Spears, 1968) and collected on a 150 µm sieve while second stage 

juveniles (J 2 ) were obtained by cyst dissection. For morphological studies and species 

identification, mature cysts containig eggs and fully developed juveniles were used. The 

nematode was identified by the following characters: cyst body length (L) and width (W), 

L/W ratio, fenestral length (l) and width (w), l/w ratio, vulval bridge length and width, 

underbridge length, the presence of bullae as well as second-stage juvenile length and 

width, stylet length and shape, tail length and width and hyaline tail length. Comparison of 

morphometrics was done with the following reported populations: Kuljabska region-type


population-Tadžikistan (Madžidov, 1981), Imbler, Oregon-USA (Smiley et al, 2008), 

Sandefjord 185-Norway (Holgado et al., 2004), Akenham-UK and Selcuklu-Turkey 

(Subbotin et al., 2003), Kohgiluyeh and Boyer-Ahmad province-Iran (Abdollahi, 2008). 


Found cysts are lemon shaped with posterior protuberance, golden brown (Fig. 1). 

The vulval cone is bifenestrate with horseshoe-shaped semifenestra, light to dark brown 

bullae and underbridge (Fig. 2). 

Fig. 1 Heterodera filipjevi cysts from Serbia 

(bar = 100µm) 

Fig. 2 Vulval cone of H. filipjevi from Serbia 

(bar = 10µm) 

The second stage juvenile has an offset head, stylet with characteristic anchorshaped 

basal knobs (Fig. 3) and the tapering tale with a rounded tip (Fig. 4). 

Mean values of morphometrics of second-stage juveniles and cysts of H. filipjevi 

based on 30 specimens are given in Table 1. 

Fig. 3 Head region of H. filipjevi J2 from 

Serbia (bar = 10µm) 

Fig. 4 Tail region of H. filipjevi J2 from Serbia 

(bar = 10µm)

̄̄ ̄ 


Tab. 1 Morphometrics of juveniles (J 2 ) and cysts of H. filipjevi population from Gunaroš 

(Vojvodina province) in a form: mean and standard deviation 

Juveniles (J 2 ) 

Cysts 

characters 

x̄ ̄̄ ̄ sd x̄ 

sd 

J 2 length (µm) 546.43 54.09 - - 

J 2 width (µm) 23.73 1.04 - - 

J 2 stylet (µm) 22.45 1.15 - - 

J 2 tail length (µm) 64.17 3.50 - - 

J 2 tail width (µm) 16.8 1.56 - - 

J 2 tail length/ width 3.87 0.27 - - 

J 2 hyaline length (µm) 39.68 2.60 - - 

cyst length (µm) - - 647.00 113.20 

cyst width (µm) - - 472.22 111.09 

cyst length/width - - 1.35 0.22 

fenestral length (µm) - - 55.57 5.81 

fenestral width (µm) - - 30.45 4.91 

fenestral length/width - - 1.85 0.28 

vulval bridge length (µm) - - 19.84 2.81 

vulval bridge width (µm) - - 10.19 2.08 

vulval slit (µm) - - 9.32 2.12 

underbridge length (µm) - - 87.39 14.79 

The morphology of the Serbian population is generally in accordance with foreign 

populations reported in literature of the same species. Comparison of mean morphological 

values of Serbian population and reported populations are shown in the Figures 5 and 6.


22,45 

64,17 

39,68 

Serbia 

546,43 

26,50 

51,00 

34,80 

Tadžikistan 

510,00 

23,20 

57,40 

33,50 

USA 

549,00 

body length 

23,30 

57,50 

35,00 

Norway 

490,00 

stylet length 

tail length 

hyaline length 

24,00 

59,00 

35,00 

UK 

522,00 

25,00 

62,00 

37,00 

Turkey 

543,00 

23,16 

61,96 

33,64 

Iran 

543,16 

Fig. 5 Comparison of mean J 2 characters (in micrometers) from different populations of 

Heterodera filipjevi 

The characters that vary most are larval length and cyst size. On average, the 

shortest second-stage juveniles are from Norway population (490.00 µm) and the longest 

are from Oregon (549.00 µm). The J 2 from Turkey have the highest mean stylet value 

(25.00 µm) and the specimens from Serbia have the lowest mean stylet value (22.45 µm). 

On average, the juveniles from Serbia have the longest tail (64.17 µm) and the juveniles 

from Tadžikistan have the shortest tail (51.00 µm). 

In relation to type population, second stage juveniles of Serbian population from 

Gunaroš are longer, have the longer tail and hyaline portion of the tail. 

The mean stylet length of J 2 from Gunaroš is shorter than the mean stylet length of 

the type population. Regarding J 2 morphological characters, the closest to Serbian 

population is the population from Oregon (USA).


1,35 

9,32 

30,45 

55,57 

Serbia 

87,39 

1,40 

7,30 

27,50 

51,50 

Tadžikistan 

82,40 

1,40 

1,40 

1,30 

7,80 

7,90 

9,30 

29,00 

23,30 

29,00 

56,50 

47,80 

54,00 

USA 

69,00 

Norway 

82,00 

UK 

74,00 

cyst length/width 

fenestral length 

fenestral width 

vulval slit 

underbridge length 

1,40 

9,50 

28,00 

59,00 

Turkey 

76,00 

1,39 

8,18 

25,36 

51,00 

Iran 

75,52 

Fig. 6 Comparison of mean cyst characters (in micrometers, except for the ratio) from different 

populations of Heterodera filipjevi 

As for the morphometrics of cysts, the specimens from all foreign populations 

previously reported, with the exception of the population from UK, have L/W ratio higher 

than specimens from Serbia. 

The highest mean fenestral length has the population from Turkey (59.00 µm) while 

the lowest value has the population from Norway (47.80 µm). The highest mean fenestral 

width has the population from Serbia (30.45 µm) while the lowest value has the population 

from Norway (23.30 µm). 

The longest mean vulval slit has the Serbian population (9.32 µm) and the shortest 

mean vulval slit belongs to the type population. 

The maximum value of underbridge length (87.39 µm) has our population from 

Gunaroš, while the minimum value has the population from Oregon (69.00 µm). 

In relation to type population, cyst morphometrics of Serbian population regarding 

fenestral length and width, vulval slit and underbridge length are greater. Only the cyst 

length/width ratio from Gunaroš is smaller comparing with the type population. Generally, 

there are no substantial morphological differences among the observed populations. 

Heterodera filipjevi is designated one of the most economically important species of 

the Cereal Cyst Nematode complex (Nicol et al., 2011), the fact that should be considered 

in Serbian phytosanitary regulations.


REFERENCES 

Abdollahi, M. (2008): Morphology and morphometrics of Heterodera filipjevi (Madzhidov, 

1981) Steller, 1984 from Kongiluyeh and Boyer-Ahmad province, Iran. Pakistan Journal 

of Biological Sciences, 11, (4): 1864-1867. 

Holgado, R., Rowe, J.A., Magnusson C. (2004): Morphology of cysts and second stage juveniles 

of Heterodera filipjevi (Madzhidov, 1981) Stelter, 1984 from Norway. Journal of 

Nematode Morphology and Systematics, 7: 77-84. 

Madžidov, A.R. (1981): Novij vid Bidera filipjevi sp. nov. (Heteroderina: Tylenchida) iz 

Tadžikistana. Izvestija Akademii Nauk Tadžikskoj SSR, Otdelenie biologičeskih nauk, 2, 

(83): 40-44. (in Russian) 

Meagher, J.W. (1977): World dissemination of cereal-cyst nematode (Heterodera avenae) and 

its potential as a pathogen of wheat. Journal of Nematology, 9, (1): 9-15. 

Nicol, J. M., Turner, S. J., Coyne, D. L., den Nijs, L., Hockland, S. and Tahna Maafi, Z. (2011): 

Current Nematode Threats to World Agriculture. In: Genomics and Molecular Genetics 

of Plant-Nematode Interactions (J. Jones, G. Gheysen and C. Fenoll, eds.) Springer, New 

York, 21-45. 

Smiley, R.W., Yan, G.P., Handoo Z.A. (2008): First record of the cyst nematode Heterodera 

filipjevi on wheat in Oregon. Plant Disease, 92, (7): 1136. 

Spears J.F. (1968): The Golden Nematode Handbook-Survey, Laboratory, Control and 

Quarantine Procedures. Agriculture Handbook 353, USDA, Agricultural Research 

Service. Washington, D.C., 82 pp. 

Subbotin, S.A., Sturhan, D., Rumpenhorst, H.J., and Moens. M. (2003): Molecular and 

morphological characterisation of the Heterodera avenae species complex (Tylenchida: 

Heteroderidae). Nematology, 5, (4): 515-538.

608 NEMATOLOGY

Contents 609 

Contents: 

H E R B O L O G Y ............................................................................................................................ 1 

PRIORITISATION OF INVASIVE ALIEN PLANTS ................................................................................................ 3 

Giuseppe Brundu, Johan van Valkenburg 

AEROBIOLOGY DATA USED FOR PRODUCING INVENTORIES OF INVASIVE PLANTS.................... 7 

Branko Šikoparija, Carsten A. Skjøth, Predrag Radišić, Barbara 

Stjepanović, Ivana Hrga, Dóra Apatini, Donát Magyar, Anna Páldy, 

Nicoleta Ianovici, Matt Smith 

HERBICIDES RESISTANCE OF AMARANTHUS RETROFLEXUS L. THE IMPORTANT 

WEED OF ROW CROP, TO ALS INHIBITORS ..................................................................................................... 15 

B. Konstantinović, M. Meseldžija, N. Samardžić 

ALIEN INVADER PLANTS IN SOUTH AFRICA: MANAGEMENT AND CHALLENGES ...................... 20 

Carl Reinhardt 

MORPHOLOGICAL VARIABILITY OF INVASIVE SPECIES AMBROSIA ARTEMISIIFOLIA L. 

(ASTERALES, ASTERACEAE) ON THE IMPORTANT TRANSIT AREAS ................................................. 27 

Goran Anačkov, Slobodan Bojčić, Vladimir Ječmenica, Milica Rat, 

Ružica Igić, Pal Boža 

DISTRIBUTION OF THE SORGHUM HALEPENSE (L.) PERS. IN THE MARMARA 

REGION OF TURKEY ..................................................................................................................................................... 38 

A. Yazlik, I. Uremis 

DISTRIBUTION OF INVASIVE WEEDS ON THE TERRITORY OF AP VOJVODINA ............................ 44 

Konstantinović Branko, Meseldžija Maja, Samardžić Nataša, 

Konstantinović Bojan 

INVASIVE SPECIES OF PLANTS IN THE ANTHROPOGENIC WOODLANDS ........................................ 49 

Mirjana Krstivojević, Ružica Igić, Dragana Vukov, Marko Rućando, 

Saša Orlović 

SOIL PERSISTENCE OF TRITOSULFURON+DICAMBA IN THE CENTRAL ANATOLIA 

REGION IN TURKEY ...................................................................................................................................................... 64 

Ahmet Tansel Serim, Salih Maden 

IMPORTANCE OF SEEDS IN THE PROCESS OF COMMON RAGWEED INVASION .......................... 70 

Bruno Chauvel, Quentin Martinez, Jean-Philippe Guillemin 

THE ECONOMIC IMPACT OF WEEDS AND THEIR CONTROL IN TURKEY ......................................... 79 

Yakup Erdal Erturk, Ilhan Uremis, Ahmet Uldag

610 Contents 

COMPARATIVE STUDY OF THE ALLELOPATHIC EFFECTS OF INVASIVE WOOD 

SORRELS (OXALIS CORNICULATA L., OXALIS DILLENII JACQ.) IN HUNGARY ................................... 86 

Anna Maria Hódi, László Hódi, László Palkovics 

MORPHOLOGICAL VARIABILITY OF SPECIES IVA XANTHIFOLIA NUTT. 1818 

(ASTERACEAE, HELIANTHAE) IN RUDERAL HABITATS ........................................................................... 89 

Srđan Živanović, Goran Anačkov, Bojana Bokić, Milica Radanović, 

Milica Rat, Slobodan Bojčić, Ružica Igić, Pal Boža 

DISTRIBUTION OF INVASIVE WEED SPECIES IN AGROECOSYSTEMS ................................................ 99 

Štefan Týr, Tomáš Vereš 

MODEL FOR THE SECONDARY SPREADING AREA OF INVASIVE SPECIES IVA 

XANTHIFOLIA NUTT. 1818 (ASTERACEAE, HELIANTHAE) FROM ANTROPOGENIC 

DEPENDENT ON NATIVE HABITATS ................................................................................................................ 103 

Milica Radanović, Bojana Bokić, Boris Radak, Milica Rat, Goran 

Anačkov 

DIVERSITY AND DISTRIBUTION OF THE SPECIES OF GENUS BROMUS L. 1753 IN 

VOJVODINA .................................................................................................................................................................... 109 

Simin Đurica, Vestek Ana, Vukov Dragana, Anačkov Goran 

MOLECULAR STUDIES ON OROBANCHE CUMANA IN SERBIA .............................................................. 123 

Dragana Marisavljević, Danijela Pavlović, Radovan Marinković, 

Petar Mitrović, Nenad Trkulja, Žarko Ivanović, Ivan Nikolić 

BIOLOGY, LIFE STRATEGY AND INVASIVENESS OF SPECIES OF THE GENUS 

AMARANTHUS L. IN PANNONIAN PART OF SERBIA .................................................................................. 127 

Bokić Bojana, Knežević Jelena, Ječmenica Vladimir, Bratić Nataša, 

Anačkov Goran 

EFFECT OF DROUGHT STRESS ON SEED GERMINATION OF PROSOPIS FARCTA ....................... 137 

Sima Sohrabi, Javid Gherekhloo 

WEED SPECIES IN SYNANTROPIC FLORA OF NOVI SAD......................................................................... 141 

Gavrilović Marijana, Rat Milica, Božin Biljana, Anačkov Goran, 

Boža Pal 

HERBICIDE - RESISTANT WEEDS IN CEREAL CROPS IN GREECE ...................................................... 157 

Eleni Kotoula-Syka, C. Afentouli, I. Georgoulas 

EFFECTIVENESS AND SELECTIVITY OF HERBICIDES IN LENTILS .................................................... 162 

Spyros Souipas, Petros Lolas 

GERMINATION OF TWO-YEAR-OLD SEEDS OF SINAPIS ARVENSIS AND PAPAVER 

RHOEAS ORIGINATING FROM A ZEMUN POLJE SITE ................................................................................ 166 

Vladan Jovanović, Vaskrsija Janjić, Bogdan Nikolić 

EFFECT OF SOME HERBICIDES (ATRAZINE AND NICOSULFURON) ON MICROBIAL 

NITROGEN AND PHOSPHOR BIOMASS IN SOIL ........................................................................................... 172 

Radivojević Ljiljana, Gašić Slavica, Šantrić Ljiljana, Gajić 

Umiljendić Jelana, Brkić Dragica

Contents 611 

THE SENSITIVITY OF MAIZE LINES TO DIFFERENT HERBICIDES ..................................................... 178 

Brankov Milan, Dragičević Vesna, Simić Milena, Vrbničanin Sava, 

Spasojević Igor 

HORIZONTAL SEED DISTRIBUTION IN THE SOIL UNDER VINE GRAPE PLANTATION 

AND MAIZE CROP ....................................................................................................................................................... 183 

Konstantinović Branko, Meseldžija Maja, Samardžić Nataša, 

Blagojević Milan 

MORPHO-ANATOMICAL RESPONSE OF GLYPHOSATE-RESISTANT AND - 

SUSCEPTIBLE MAIZE TO GLYPHOSATE TRIMESIUM ............................................................................... 188 

Danijela Pavlović, Sava Vrbničanin, Carl Reinhardt, Dragana 

Marisavljević 

INFLUENCE OF ROOT MANIPULATION ON HERBICIDE SULPHOSATE INDUCED 

INHIBITION OF GROWTH AND PHOTOSYNTHESIS IN MAIZE (ZEA MAYS L.) .............................. 192 

Bogdan Nikolić, Goran Drinić, Vladan Jovanović, Hadi Waisi, Zoran 

Milićević, Sanja Đurović 

RESISTANCE OF SOME SUNFLOWER GENOTYPES TO BROOMRAPE (OROBANCHE 

CUMANA WALLR.) AND ITS INFLUENCE ON SEED YIELD AND QUALITY ...................................... 201 

Maširević Stevan, Medić Pap Slađana, Živanov Dalibor 

P H Y T O P A T H O L O G Y .................................................................................................... 209 

ROLE OF ASPERGILLUS SPECIES IN MYCOTOXIN CONTAMINATION OF 

AGRICULTURAL PRODUCTS IN CENTRAL EUROPE .................................................................................. 211 

Gyöngyi Szigeti, Nikolett Baranyi, Sándor Kocsubé, Tamás Győri, 

András Szekeres, Beáta Tóth, Orsolya Török, Edit Háfra, Xénia 

Pálfy, János Varga 

THE MOST IMPORTANT OLIVE DISEASES IN MONTENEGRO .............................................................. 216 

Jelena Latinović, Jelka Tiodorović, Nedeljko Latinović 

PREVALENCE OF VIRUSES IN AUTOCHTHONOUS GRAPEVINE CULTIVARS FROM 

CROATIAN CONTINENTAL AND COASTAL VINE-GROWING REGIONS ............................................ 221 

Darko Vončina, Darko Preiner, Darko Radović, Edi Maletić, 

Jasminka Karoglan Kontić 

INCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN 

MONTENEGRO.............................................................................................................................................................. 226 

Zindović Jelena, Božović Vladan, Miladinović Zoran, Rubies 

Autonell Concepcion, Ratti Claudio 

IRIS YELLOW SPOT VIRUS - EMERGING PATHOGEN AND SERIOUS TREAT FOR THE 

PRODUCTION OF ALLIUM SPECIES .................................................................................................................... 231 

Aleksandra Bulajić, Ivana Stanković, Ana Vučurović, Danijela 

Ristić, Katarina Milojević, Vojislav Trkulja, Branka Krstić

612 Contents 

RESISTANCE BREAKING STRAIN OF TOMATO SPOTTED WILT VIRUS (TSWV) ON 

RESISTANT PEPPER CULTIVARS IN HUNGARY ........................................................................................... 239 

Bese Gabor, Krizbai L., Horvath J., Takacs A. 

MOLECULAR STUDIES ON CRYPHONECTRIA PARASITICA ISOLATES FROM 

DIFFERENT CENTRAL-EUROPEAN PLOTS .................................................................................................... 242 

Görcsös Gábor, Irinyi László, Tarcali Gábor, Radócz László 

MORPHOLOGICAL, CULTURAL AND PATHOGENIC CHARACTERISTICS OF 

MACROPHOMINA PHASEOLINA ISOLATES FROM SUGAR BEET .......................................................... 251 

Stojšin Vera, Budakov Dragana, Bagi Ferenc, Đuragin Nadežda, 

Marinkov Ranko 

PHOMOPSIS CAPSICI AND COLLETOTRICHUM COCCODES INFECTING PEPPER IN 

MACEDONIA .................................................................................................................................................................. 257 

Rossitza Rodeva, Ilija Karov, Zornitsa Stoyanova, Biljana 

Kovacevik, Vasilissa Manova, Ralitsa Georgieva 

THE IMPACT OF BIOLOGICAL CONTROL OF WILT AND ROT DISEASE OF GLADIOLUS 

CORMS CAUSED BY FUSARIUM OXYSPORUM F. SP. GLADIOLI (MASSEY) ....................................... 264 

A.O.Al-Atrakchii, B.Y.Iraheem 

POTENTIAL OF QUINHYDRONE AS A GROWTH INHIBITOR OF PHYTOPATHOGENIC 

BACTERIA ....................................................................................................................................................................... 270 

Tatjana Popović, Filis Morina, Svetlana Živković, Žarko Ivanović, 

Sonja Veljović Jovanović 

PREVALENCE OF PATHOGENIC GROUPS OF LEPTOSPHAERIA MACULANS IN SERBIA .......... 274 

Petar Mitrović, Željko Milovac, Milan Jocković, Velimir Radić, Ana 

Marjanović–Jeromela, Nada Lečić, Radovan Marinković 

PATHOGENICITY OF FUSARIUM SPP. AND ASPERGILLUS FLAVUS ON MAIZE EAR ................... 282 

Ferenc Bagi, Vera Stojšin, Dragana Budakov, Ákos Mesterhazy, 

János Varga, Jovana Vučković, Beáta Tóth 

MORPHOLOGICAL AND GENETIC CHARACTERIZATION OF MONILINIA LAXA 

ISOLATES ORIGINATED FROM STONE FRUITS IN SERBIA .................................................................... 287 

Trkulja Nenad, Milosavljević Anja, Ivanović Žarko, Popović 

Tatjana, Živković Svetlana, Oro Violeta, Dolovac Nenad 

MORPHOLOGICAL AND MOLECULAR IDENTIFICATION OF COLLETOTRICHUM 

GLOEOSPORIOIDES FROM CITRUS RETICULATA .......................................................................................... 292 

Svetlana Živković, Nenad Trkulja, Tatjana Popović, Violeta Oro, 

Žarko Ivanović 

UNUSUAL COLLETOTRICHUM SP. ASSOCIATED WITH PEPPER FRUIT ANTHRACNOSE 

IN BULGARIA AND SERBIA – PRELIMINARY RESULTS ........................................................................... 299 

Zornitsa Stoyanova, Rossitza Rodeva, Vasilissa Manova, Lubomir 

Stoilov, Mirjana Mijatovic

Contents 613 

CHARACTERIZATION OF DIAPORTHE/PHOMOPSIS SPP. FROM PLUM TREES BY SDS- 

PAGE .................................................................................................................................................................................. 307 

Svetlana Živković, Dragana Jošić, Tatjana Popović, Violeta Oro, 

Nenad Dolovac, Žarko Ivanović 

LOSSES OF APPLE FRUIT (CV. CRIPPS PINK) CAUSED BY FUNGAL DISEASES DURING 

STORAGE ......................................................................................................................................................................... 313 

Zdravka Sever, Tihomir Miličević, Joško Kaliterna 

INFLUENCE OF COMPOST TEA ON INHIBITION OF GROWTH OF PHYTOPATOGENIC 

FUNGI FUSARIUM OXYSPORUM AND RHIZOCTONIA SP. .......................................................................... 317 

Mira Milinković, Danka Radić, Blazo Lalević, Vesna Golubović 

Ćurguz, Ljubinko Jovanović, Ivana Spasojević, Vera Raičević 

FUNGAL ISOLATES FROM AGROINDUSTRIAL WASTE AS POTENTIAL BIOCONTROL 

AGENTS ............................................................................................................................................................................ 321 

Jelena Jovičić Petrović, Vera Raičević, Branislava Sivčev, Dragan 

Kiković, Igor Kljujev 

ANTAGONISTIC POTENTIAL OF TRICHODERMA HARZIANUM AGAINST 

POSTHARVEST FUNGAL PATHOGENS ............................................................................................................. 325 

Svetlana Živković, Saša Stojanović, Tatjana Popović, Violeta Oro, 

Žarko Ivanović, Nenad Trkulja 

CHARACTERIZATION OF PSEUDOMONAS SYRINGAE STRAINS BY ERIC PCR GENOMIC 

FINGERPRINTING ....................................................................................................................................................... 331 

Žarko Ivanović, Tanja Popović, Svetlana Živković, Violeta Oro, 

Nenad Trkulja, Miloš Stevanović, Veljko Gavrilović 

ERIC PCR AS A METHOD FOR DETERMINING DIVERSITY OF XANTHOMONAS 

ARBORICOLA PV. JUGLANDIS ................................................................................................................................. 336 


Nenad Trkulja, Anja Milosavljević, Veljko Gavrilović 

IDENTIFICATION OF PHYTOPATHOGENIC AGROBACTERIUM SPP. IN SERBIA ........................... 341 


Nenad Trkulja, Nenad Dolovac, Veljko Gavrilović 

ANTAGONISTIC ACTIVITY OF BACILLUS AND PSEUDOMONAS SOIL ISOLATES 

AGAINST XANTHOMONAS CAMPESTRIS PV. CAMPESTRIS ...................................................................... 346 

Tatjana Popović, Dragana Jošić, Mira Starović, Svetlana Živković, 

Žarko Ivanović, Nenad Trkulja, Violeta Oro 

ANTAGONISTIC ACTIVITY OF BACILLUS AND PSEUDOMONAS SOIL ISOLATES 

AGAINST PSEUDOMONAS SYRINGAE PV. SYRINGAE .................................................................................. 352 

Tatjana Popović, Dragana Jošić, Mira Starović, Svetlana Živković, 

Žarko Ivanović, Nenad Trkulja, Violeta Oro 

INHIBITING ACTIVITY OF PSEUDOMONAS SOIL ISOLATES AGAINST TOXIGENIC 

FRESHWATER CYANOBACTERIA NOSTOC SP. ............................................................................................. 357 

Simonida Đurić, Vesna Protulipac, Jelica Simeunović, Zorica 

Svirčev, Miroslav Miladinović, Dragana Jošić

614 Contents 

CU-CITRATE, A NEW SOURCE OF CU ION AS A FUNGICIDE .................................................................. 363 

Tatjana Popović, Zoran Milićević, Nenad Trkulja, Anja 

Milosavljević, Predrag Milovanović, Goran Aleksić, Žarko Ivanović 

EXISTENCE OF CERCOSPORA BETICOLA ISOLATES RESISTANT TO BENZIMIDAZOLE 

AND TRIAZOLE FUNGICIDES IN NATURAL POPULATIONS ................................................................... 367 

Trkulja Nenad, Ivanović Žarko, Popović Tatjana, Živković Svetlana, 

Oro Violeta, Dolovac Nenad, Bošković Jelena 

STATUS OF ERWINIA AMYLOVORA IN MONTENEGRO ............................................................................. 373 

Jelica Balaž, Dragana Radunović, Marija Krstić 

EFFECT OF SIMULTANEOUS APPLICATION OF BRASSINOSTEROIDS AND REDUCED 

DOSES OF FUNGICIDES ON VENTURIA INAEQUALIS ................................................................................. 379 

Stevanović Miloš, Trkulja Nenad, Nikolić Bogdan, Dolovac Nenad, 

Ivanović Žarko 

TRICHODERMA SPP. BIOTYPES EFFECTIVE IN BIOLOGICAL CONTROL AND INDUCING 

RESISTANCE AGAINST RHIZOCTONIA SOLANI CASUAL AGENT OF BEAN ROOT ROT 

AND DAMPING OFF .................................................................................................................................................... 385 

Kahld Hassan Taha, Bassam Yahya Ibraheem 

P H Y T O P H A R M A C Y ....................................................................................................... 393 

APPLICATION OF RESPONSE SURFACE METHODOLOGY (RSM) FOR 

DETERMINATION OF PESTICIDE RESIDUES IN WATER ......................................................................... 395 

Šunjka Dragana, Lazić Sanja, Grahovac Nada, Jakšić Snežana, 

Vuković Slavica 

DETERMINATION OF FUNGICIDE RESIDUES IN GRAPE BY GC/MS .................................................. 401 

Lazić Sanja, Komlen Vedrana, Šunjka Dragana, Grahovac Nada, 

Pejčić Jadranka, Rahimić Alma, Blesić Milenko 

DETERMINATION OF DEOXYNIVALENOL IN PASTA SAMPLES BY HPLC/DAD .......................... 410 

Vuković Gorica, Pavlović Snežana, Starović Mira, Stojanović Saša 

DEVELOPMENT OF THE ADJUVANTS BASED ON PLANT OILS AND THEIR 

APPLICATION................................................................................................................................................................ 415 

Slavica Gašić, Ljiljana Radivojević, Jelena Gajić-Umiljendić, Marija 

Stevanović, Ljiljana Šantrić 

SENSITIVITY OF VENTURIA INAEQUALIS ISOLATES TO FUNGICIDES WITH 

DIFFERENT MODES OF ACTION .......................................................................................................................... 421 

Goran Aleksić, Tatjana Popović, Mira Starović, Slobodan 

Kuzmanović, Dragana Jošić, Nenad Dolovac, Dobrivoj Poštić 

THE GENERATION OF RESISTANCE TO METALAXYL IN PHYTOPHTHORA INFESTANS 

(MONT.) DE BARY ....................................................................................................................................................... 428 

Emil Rekanović, Miloš Stepanović, Svetlana Milijašević-Marčić, 

Ivana Potočnik and Biljana Todorović

Contents 615 

INTEGRATED PEST MANAGEMENT .................................................................................... 435 

INTEGRATED APPLE PROTECTION IN ATOS FRUCTUM, MALA REMETA, 2009-2012 ........... 437 

Injac Marko, Petrović Jovanka, Krnjajić Slobodan 

INTEGRATED PEST MANAGEMENT OF INSECTS IN URBAN GREEN SPACES .............................. 451 

Milka Glavendekić 

EFFICACY OF CONVERSION OF CONVENTIONAL TO ORGANIC GRAPE AND WINE 

PRODUCTION ................................................................................................................................................................ 455 

Branislava Sivčev, Blaga Radovanović, Ivan Sivčev, Zorica 

Ranković-Vasić, Nevena Petrović, Ljubomir Životić 

ADVANTAGES AND LIMITATIONS IN BIOHERBICIDES USE ................................................................. 460 

Zvonko Pacanoski 

QUESTIONS ON EFFECT OF CLIMATE CHANGE ON PLANT PROTECTION .................................... 464 

Ahmet Uludag 

THE USE OF PROTECTIVE-STIMULATING COMPLEXES IN THE MODERN 

AGRICULTURAL TECHNOLOGY ........................................................................................................................... 467 

Natalia Nikolaevna Malevannaya 

E N T O M O L O G Y ................................................................................................................... 475 

GENETIC VARIABILITY IN THRIPS TABACI (INSECTA: THYSANOPTERA) LIVING ON 

VEGETABLES IN SERBIA ......................................................................................................................................... 477 

Tatjana Cvrković, Jelena Jović, Milana Mitrović, Oliver Krstić, Ivo 

Toševski 

MOLECULAR ANALYSIS OF COI MTDNA IN PHYTOPTUS (PHYTOPTIDAE) AND 

ERIOPHYES (ERIOPHYIDAE) SPECIES ASSOCIATED WITH GALLS OF TILIA SPP. 

(TILIACEAE): PRELIMINARY RESULTS ............................................................................................................ 483 

Tatjana Cvrković, Phillipp Chetverikov, Biljana Vidović, Radmila 

Petanović 

THE CURRENT STATUS OF THE TOBACCO WHITEFLY - BEMISIA TABACI 

(GENNADIUS) (HEMIPTERA:ALEYRODIDAE) IN MONTENEGRO .................................................. 489 

Snježana Hrnčić, Sanja Radonjić, Tatjana Perović, Katja Žanić, 

Marisa Škaljac 

INVASIVE MOSQUITO SPECIES IN EUROPE AND SERBIA, 1979 - 2011 .......................................... 496 

Petrić Dušan, Zgomba Marija, Ignjatović Ćupina Aleksandra, 

Marinković Dušan, Bellini Romeo, Schaffner Francis, Igor Pajović 

PRESENCE AND DISTRIBUTION OF SCAPHOIDEUS TITANUS BALL (HEMIPTERA: 

CICADELLIDAE) IN THE VINEYARDS OF MONTENEGRO ....................................................................... 506 

Sanja Radonjić, Snježana Hrnčić, Oliver Krstić, Ivo Toševski, Jelena 

Jović

616 Contents 

PESTS OF OILSEED RAPE IN NORTHERN SERBIA ...................................................................................... 511 

Lazar Sivčev, Draga Graora, Ivan Sivčev, Wolfgang Buchs, Tatjana 

Gotlin Čuljak, Ivan Juran, Vlado Tomić, Boris Dudić 

POTENTIAL OF TRAPS BAITED WITH AGGREGATION ATTRACTANT OF THE SUGAR- 

BEET WEEVIL ............................................................................................................................................................... 516 

Ivan Sivčev, Ivan Tomašev, Tatjana Marković, Miroslav Kostić, 

Lazar Sivčev, Draga Graora 

OCCURRENCE AND MOLECULAR IDENTIFICATION OF WESTERN FLOWER THRIPS, 

FRANKLINIELLA OCCIDENTALIS (PERGANDE), IN SERBIA .................................................................... 520 

Jelena Jović, Milana Mitrović, Tatjana Cvrković, Oliver Krstić, Ivo 

Toševski 

BIOLOGY AND HARMFULNESS OF SOFT SCALE INSECTS (HEMIPTERA: COCCIDAE) 

ON THE GRAPEVINE .................................................................................................................................................. 526 

Draga Graora, Lazar Sivčev, Radoslava Spasić, Ivan Sivčev 

INVASIVE INSECT AND FISH SPECIES IN MORAVICA DISTRICT ......................................................... 532 

Marković Goran, Tanasković Snežana, Sretenović Dušica, Ranđić 

Danka 

EFFICACY OF CONVERSION OF CONVENTIONAL TO ORGANIC GRAPE AND WINE 

PRODUCTION ................................................................................................................................................................ 539 

Branislava Sivčev, Blaga Radovanović, Ivan Sivčev, Zorica 

Ranković-Vasić, Nevena Petrović, Ljubomir Životić 

CANNIBALISM IN HIPPODAMIA VARIEGATA GOEZE (COLEOPTERA: COCCINELLIDAE) 

UNDER LABORATORY CONDITIONS ................................................................................................................. 544 

Reza Jafari 

EFFECT OF SOME MEDICAL PLANTS EXTRACT ON PREDATION EFFICIENCY AND 

FERTILITY OF LADY BEETLE COCCINELLA UNDECUMPUNCTATA L. (COLEOPTERA: 

COCCINELLIDAE) ........................................................................................................................................................ 550 

Sahil K. Al-jamil and Mohammad F. Edan 

ALIEN SPECIES OF JUMPING PLANT LICE (HEMIPTERA: PSYLLOIDEA) IN SERBIA ................ 553 

Dušanka Jerinić-Prodanović 

N E M A T O L O G Y ................................................................................................................... 561 

QUARANTINE NEMATODES – EUROPEAN LEGISLATION, CURRENT STATUS AND 

PERSPECTIVES ............................................................................................................................................................. 563 

Ricardo Holgado, Christer Magnusson 

RESULTS OF A SURVEY ON INFESTATION BY BURSAPHELENCHUS SPP. IN PINE 

FORESTS IN UKRAINE .............................................................................................................................................. 575 

Korma Aleksandr, Sigareva Dina

Contents 617 

DETECTION OF DITYLENCHUS DESTRUCTOR IN POTATO DURING THE GROWING 

SEASON AND IN STORAGE ..................................................................................................................................... 579 

Sigareva Dina, Zhylina Tatjana, Galagan Tatjana 

DISTRIBUTION OF GLOBODERA ROSTOCHIENSIS AND ITS CONTROL IN UKRAINE ................. 583 

GAalagan Tatjana, Sigareva Dina 

HALF A CENTURY OF POTATO CYST NEMATODE (GLOBODERA SPP.) MANAGEMENT 

IN NORWAY ................................................................................................................................................................... 587 

Ricardo Holgado, Christer Magnusson 

INFERRING PLACES OF ORIGIN OF TWO POTATO CYST NEMATODES FROM SERBIA 

USING MOLECULAR TOOLS ................................................................................................................................... 597 

Violeta Oro, Svetlana Živković, Tatjana Popović, Nenad Trkulja, 


MORPHOLOGY OF HETERODERA FILIPJEVI FROM SERBIA ................................................................... 602 

Violeta Oro, Svetlana Živković, Tatjana Popović, Nenad Trkulja, 


CONTENTS: .................................................................................................................................................................... 609 

AUTHOR INDEX:.......................................................................................................................................................619

618 Contents

Author index 619 

AUTHOR INDEX 

A 

Afentouli C. 157 

Al.-Atrakchii A.O., 264 

Al-Jamiil S. 550 

Aleksić G. 363, 421 

Anačkov G. 27, 89, 103, 109, 127,142 

Apatini D. 7 

B 

Bagi F. 251, 282 

Balaž J. 373 

Baranyi N. 211 

Bellini R. 496 

Bese G. 239 

Blagojević M. 183 

Blesić m. 401 

Bojčić S. 27, 89 

Bokić B. 89, 103, 127 

Bošković J. 367 

Boža P. 89,141 

Božin B. 141 

Božović V. 226 

Brankov M. 178 

Bratić N. 127 

Brkić D. 172 

Brundu 3 

Budakov D. 251, 282 

Bulajić A. 231 

Buchs W. 511 

C 

Chauvel B. 70 

Chetverikov P. 483 

Concepcion R.A.226 

Cvrković T. 477, 483, 520 

D 

Dolovac N. 287, 307, 341, 367, 379, 421 

Dragičević V. 178 

Drinić G. 192 

Dudić B. 511 

Đ 

Đuragin N. 251 

Đurić S. 357 

Đurović S. 192 

E 

Edan M. 550 

Erturk Y.E. 79 

G 

Gajić Umiljendić J. 172, 415 

Galagan T. 579, 583 

Gavrilović M. 141 

Gavrilović V. 331 , 336, 341 

Gašić S. 172, 415 

Georgoulas I. 157 

Georgieva R. 257 

Gherekhloo J. 137 

Glavendekić M. 451 

Gorcsos G.241 

Golubović – Ćurguz V. 317 

Gotlin Čuljak T. 511 

Graora D. 511, 516, 526 

Grahovac N. 395, 401 

Guillemin J.P. 70 

Gyori T.211 

H 

Hafra E.211 

Hodi A.M. 86 

Hodi L. 86 

Hrnčić S. 489, 506 

Holgado R. 563, 587 

Horvath J. 239 

Hrga I. 7 

I 

Ianović N. 7 

Igić R. 49, 89 

Ignjatović – Ćupina A. 496

620 Author index 

Injac m. 437 

Iraheem B.Y. 264, 385 

Irinyi L 242 

Isik A. 38 

Ivanović Ž. 123, 270 , 287, 292, 307, 325, 

331, 336, 341, 346, 352, 363, 367, 379, 597, 

602 

J 

Jafari R. 544 

Jakšić S. 395 

Janjić V. 166 

Ječmenica V. 27, 127 

Jerinić-Prodanović D. 553 

Jocković M. 274 

Jovanović Lj. 317 

Jovanović V. 166, 192 

Jović J. 477, 506, 520 

Jovičić – Petrović J. 321 

Jošić D. 307, 346, 352, 357, 421 

Juran I. 511 

K 

Kaliterna J. 313 

Karov I.257 

Karoglan Kontić J.221 

Kiković D. 321 

Kljujev I. 321 

Knežević J. 127 

Kocsube S.211 

Konstantinović B. 15, 44,183 

Konstantinović Bo. 44 

Kostić M. 516 

Komlen V. 401 

Korma A. 575 

Kotula-Syka E. 157 

Kovacevik B. 257 

Kriybai I. 239 

Krstić B. 231 

Krstić M. 373 

Krstivojević M. 49 

Krnjajić S. 437 

Krstić O. 477, 506, 520 

Kuzmanović s. 421 

L 

Lalević B. 317 

Latinović J. 216, 

Latinović N. 216 

Lazić S. 395, 401 

Lećić N. 274 

Lolas P.162 

M 

Magnuson C. 563, 587 

Maden S. 64 

Magyar D. 7 

Maletić E.221 

Malevannaya N. 467 

Manova V. 257, 299 

Marijanović – Jeromela A. 274 

Marinkov R. 251 

Marinković R. 123, 274 

Marinković D. 496 

Marisavljević D. 123,188 

Marković G. 532 

Marković T. 516 

Martinez Q.70 

Maširević S. 201 

Medić Pap S. 201 

Meseldžija M. 15, 44,183 

Mesterhazy A. 282 

Milićević Z. 192, 363 

Miladinović Z.226 

Miladinović M. 357 

Mijatović M. 299 

Milijašević – Marčić S. 428 

Milinković M. 317 

Milovac Ž. 274 

Milojević K.231 

Milovanović P. 363 

Milosavljević A. 287, 336, 363 

Mitrović M. 477, 520 

Mitrović P. 123, 274 

Morina F.270 

N 

Nikolić B. 166, 192, 379 

Nikolić I. 123 

O 

Orlović S. 49 

Oro V. 287, 292, 307, 325, 331, 336, 341, 

346, 352, 367, 597, 602 

P 

Pacanoski Z. 460 

Pajović I. 496 

Paldy A.7

Author index 621 

Palkovics L. 86 

Pavlović D. 123, 188 

Pavlović S. 410 

Pejčić J. 401 

Perović S. 489 

Petanović R. 483 

Petrić D. 496 

Petrović J. 437 

Petrović N. 455, 539 

Popović T. 270, 287, 292, 307, 325, 331, 

336, 341, 346, 352, 363, 367, 421, 597, 602 

Potočnik I. 428 

Poštić D. 421 

Preiner D. 221 

Protulipac V. 357 

R 

Radanović M. 89, 103 

Radak B. 103, 

Radišić P. 7 

Radivojević Lj. 172, 415 

Radić D. 317 

Radić V. 274 

Radonjić S. 489, 506 

Radović D. 221 

Radocz L. 241 

Radovanović B. 455, 539 

Radunović D. 373 

Rahimić A. 401 

Raičević V. 317, 321 

Ranković-Vasić Z. 455, 539 

Ranđić R. 532 

Ratti C. 226 

Rat M. 27, 89, 103, 141 

Reinhardt C. 20,188 

Rekanović E. 428 

Ristić D. 231 

Rodeva R. 257, 299 

Rućando M. 49 

S 

Samardžić N. 15,44,183 

Serim A.T. 64 

Sever Z. 313 

Schaffner F. 496 

Sigareva D. 575, 579, 583 

Simeunović J. 357 

Simin Đ. 109, 

Simić M. 178 

Sivčev B. 321, 455, 539 

Sivčev I. 455, 516, 526, 539 

Sivčev L. 511, 516, 526 

Smith M. 7 

Skjothc C.. 7, 

Sohrabi S. 137 

Souipas S. 162 

Spasić R. 526 

Spasojević I. 178, 

Spasojevic Iv 317 

Sretenović D. 532 

Stanković I.231 

Starović M. 346, 352, 410, 421 

Stevanović M. 331, 379 

Stevanović Ma. 415 

Stepanović M. 428 

Stjepanović B.. 7 

Stoilov L- 299 

Stojšin V. 251, 282 

Stojanović S. 325, 410 

Stoyanova Z. 257, 299 

Svirčev Z. 357 

Syigeti G.211 

Syekeres A.211 

Š 

Šantrić Lj. 172, 415 

Škalac M.489 

Šikoparija B. 7, 

Šunjka D. 395, 401 

T 

Taha K. H. 385 

Takacs A. 239 

Tanasković S. 532 

Tarcali G. 242 

Tiodorović J.216 

Todorović B. 428 

Tomašev I. 516 

Tomić V. 511 

Toth B.211, 282 

Torok O.211 

Toševski I. 477, 506, 520 

Trkulja N. 123, 287, 292, 325, 331, 336, 341, 

346, 352, 363, 367, 379, 597, 602 

Trkulja V. 231 

Tyr Š. 99 

U 

Uludag A. 79, 464 

Uremis I. 38, 79

622 Author index 

V 

Van Valkenburg 3 

Varga J.211, 282 

Veljović – Jovanović S. 270 

Vereš T. 99 

Vestek A. 109 

Vidović B. 483 

Vončina D. 221 

Vrbničanin S. 178, 188 

Vukov D. 49, 109 

Vuković G. 410 

Vuković S. 395 

Vučković J. 282 

Vučurović A. 231 

Z 

Zgomba M. 496 

Zindović J. 226 

Zhylina T. 579 

Ž 

Žanić K. 489 

Živanov 201 

Živanović S. 89 

Živković S. 270, 539, 287, 292, 307, 325, 

331, 336, 341, 346, 352, 367, 597 

Životić Lj. 455 

W 

Wasi H.192

623

624 CIP 

CIP - Каталогизација у публикацији 

Народна библиотека Србије, Београд 

632(082) 

MEĐUNARODNI simpozijum o aktuelnim 

trendovima u zaštiti bilja (2012 ; Beograd) 

Међународни симпозијум о актуелним 

трендовима у заштити биља, Београд, 25-28 

септембар 2012. : зборник радова / 

[организатор] Институт за заштиту биља и 

животну средину ; [главни уредник Драгана 

Марисављевић]. - Београд : Институт за 

заштиту биља и животну средину, 2012 

(Београд : Макарије). - 603 str. : ilustr. ; 

24 cm 

Tiraž 300. - Bibliografija uz svaki rad. 

ISBN 978-86-910951-1-6 

1. Institut za zaštitu bilja i životnu 

sredinu (Beograd) 

a) Биљке - Заштита - Зборници 

COBISS.SR-ID 192875020

ЗБОРНИКРАДОВА PROCEEDINGS

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?