Diversity of weeds in sorghum.pdf - ResearchGate

J.Res. ANGRAU 37(3&4)1-12, 2009
ISOLATION AND CHARACTERIZATION OF MICROSATELLITES IN
OIL PALM (Elaeis guineensis)
P CHERUKU, K MANORAMA and S. SIVARAMAKRISHNAN
Department of Agricultural Biotechnology
College of Agriculture, Acharya N.G. Ranga Agricultural University
Rajendranagar, Hyderabad-500030
ABSTRACT
Microsatellites were isolated from Oil Palm (Elaeis guineensis) by selective hybridization which
involved capturing DNA fragments containing repeat motifs. Two biotinylated oligonucleotides containing Di
and Trinucleotide repeats were used as probes in individual hybridization reactions, for capturing microsatellites.
Genomic DNA isolated from flushing tender leaves of oil palm and digested with RsaI was ligated to Super SNX
ds linkers, hybridized with biotinylated repeat oligonucleotides, and the eluted microsatellite enriched DNA
fragments were amplified by PCR using Super SNX primer. Enriched DNA fragments were cloned in a TA
cloning vector and transformed into E. coli DH-5á competent cells. White colonies were screened and the
clones having insert size above 300 bp were selected and sequenced. Of the 30 clones sequenced, 9 were
positive for microsatellites, of which, 5 were dinucleotide repeats, 4 were trinucleotide and imperfect repeats.
SSR primers were designed from the flanking regions of microsatellites and PCR conditions were standardized.
Oil palm, is reported to be the highest yielder with the potential of 4-6 tonnes of
vegetable oil per ha (Mielke, 1996). It produces two distinct oils, palm oil and palm kernel oil,
used for culinary and industrial purposes respectively.
Oil palm is a monocotyledonous plant belonging to the palm family (Arecaceae). It is
a single stemmed plant i.e., it possesses a single shoot apical meristem and grows to 20
metres height. Established trees over 10 years produce about 20 leaves a year. The flowers
are produced in dense clusters; each individual flower is small, with 3 sepals and 3 petals.
Fruit takes 5 to 6 months to mature from pollination to maturity; it comprises an oily, fleshy
outer layer (the pericarp), with a single seed (kernel), also rich in oil. Unlike its relative, the
coconut palm, the oil palm does not produce off shoots. It has 16 pairs of chromosomes
(2n=32). The genome size is reported to be 3.42 X 10 9 bp, a medium sized genome when
compared with that of rice (Rival et al., 1997).
As Oil Palm is a tree crop, breeding selection is slow, with a typical round of selection
taking around 10 years. By developing genetic markers for this species, the management of
germplasm can be improved and it helps to investigate new sources of variation for introduction
into breeding programmes, eventually allowing selection of traits using markers before the
E-Mail: makanuri@yahoo.com
1

CHERUKU et al.
trait itself is expressed. This could significantly decrease the breeding cycle time. RFLP
markers were used to assess genetic diversity within palms of a specific oil palm breeding
programme by Jack and Mayes (1993). Rival et al.(1998) employed RAPD analysis for the
detection of somaclonal variants in oil palm . Isoenzymes and AFLP markers were used for
genetic diversity of oil palm by Purba et al., (2000). Barcelos et al., (2002) used RFLP and
AFLP to evaluate the genetic diversity, its organisation and the genetic relationships within
oil palm (Elaeis oleifera kunth) from America and E. guineensis (Jacq.), from Africa. Morentzon
et al., (2000) identified two RAPD markers linked to shell thickness. Work on genetic diversity
and palm identification has been initiated using RAPD markers, STMS markers at NRCOP
(National research center for Oil Palm) by Mandal and Pillai, (2005).
One of the most recent advances in molecular genetics is the introduction of
microsatellite markers to investigate the genetic diversity of natural and hybrid, as well as
transformed populations of crops (Balloux and Moulin, 2002). Microsatellites are a tandem
array of short stretches of 2-6 base pairs length, normally repeated about 15 to 30 times and
scattered randomly throughout the genome, found in both prokaryotes and eukaryotes
(Bennett, 2000). Their presence in genomes of all living organisms, high level of allelic
variation, co-dominant inheritance pattern and potential for automated analysis make them
excellent molecular markers for a number of applications. They have been used for a variety
of applications like genetic mapping, level of inbreeding, positional cloning of genes, etc
(Schulter et al., 1996). Their flanking regions are usually genetically conserved (Bennet,
2000). Microsatellite primers developed for one species frequently amplify loci in related
species.
The major challenge with microsatellites is that they need to be isolated de novo
from most species being examined for the first time. Selective hybridization method is the
most successful method used until now (Karagyozov et al., 1993).
The present study has therefore been undertaken to isolate microsatellites from oil
palm and characterize the isolated microsatellites.
MATERIAL AND METHODS
Flushing tender leaves of oil palm ( Elaeis guineensis Jacq ) were collected from
green house farm of College of Agriculture, Rajendranagar, ANGRAU, Hyderabad.
2

ISOLATION AND CHARACTERIZATION OF MICROSATELLITES
Oligonucleotides and primers
Two primer sets were used for isolation of microsatellites, one for the preparation of
double strand linker (ds) named as ‘superSNX24’ and ‘superSNX24 + 4P’, and the other for
confirming the presence of inserts, M13 universal forward and reverse primers (sigma). Two
Biotinylated repeat primers (CT, TCG) were also synthesized based on their frequency in
plant genome. Primer sequences adopted in the study are listed in Table 1.
Genomic DNA was extracted by modified CTAB method (Sambrook and Russel,
2001). Flushing tender oil palm leaves were extracted with DNA extraction buffer (2% CTAB,
100 mM Tris, 20 mM EDTA, 1.4 M NaCl) preheated at 60ÚC and 200 mg of PVP
(Polyvinylpyrolidone). The quality and quantity of extracted DNA was judged by comparing it
with uncut ë DNA in agarose gel electrophoresis. DNA quantification and purity was checked
by measuring the O.D at 260 nm and 280 nm using a UV visible spectrophotometer.
Microsatellite capture was performed according to the method described by Glenn
and Schable (2005), involving different steps, namely, restriction digestion using Rsa I,
preparation and ligation of double stranded Super SNX linkers to size selected Rsa1 digest.
After PCR confirmation of ligated ds linkers repeat-enrichment was done using Biotinylated
Oligonucleotides described in Table 1, individually with the two oligonucleotides at their
respective hybridization temperatures . Repeat enrichment was carried out in 5 steps, namely,
preparation of streptavidin magnetic beads, hybridization of linker-ligated genomic DNA with
biotinylated repeat oligo, conjugation of biotin - streptavidin beads, washing and elution, as
described in detail by Glenn and Schable, 2005. Then, amplification of repeat enriched DNA
was done using PCR for each of the eluted samples. Each 25 µl reaction volume contained
about 2.0 µl of eluted DNA, 1 x PCR buffer (Invitrogen), 1.5 mM MgCl 2
(Invitrogen), 0.1 mM
dNTPs (Amersham), 0.5 p moles of super SNX24 primer, 0.3 units Taq polymerase (Invitrogen)
and programmed for an initial denaturation step of 2 min at 95ÚC followed by 30 cycles of 20
sec denaturation at 95ÚC, 20 sec annealing at 60ÚC, 1.5 min extension at 72ÚC and final
extension at 72ÚC for 30 min and a hold temperature of 15ÚC at the end. All the 5 PCR
reaction products were pooled and stored at 4 0 C until further use.
The repeat enriched DNA fragments obtained by using two biotinylated repeat
oligonucleotides were cloned into TA cloning vector (Promega) and transformed into E. coli
DH 5a competent cells as per standard methods (Sambrook and Russel, 2001).
White colonies were screened for the presence of the insert by colony PCR and
plasmid DNA from positive clones was isolated for sequencing using standard dideoxy
3

CHERUKU et al.
sequencing protocol (Sanger et al., 1977). The colonies that had inserts with more than 300
bp were selected. Plasmid PCR was conducted to further confirm the presence of the 300 bp
band and the positive samples were sent for sequencing using an automated sequencer.
The sequences were screened for the presence of microsatellites manually.
The sequences containing microsatellites with sufficient flanking regions on either
side were submitted in primer 3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/
primer3_www.cgi), for designing primers of length 18-22 base length and product sizes of
150-250 bp.
Standardization of primers
Primers were diluted to a concentration of 10 picomoles/ml. Fifteen PCR reactions
were set up for each primer in a total reaction volume of 10 ml containing a final concentration
of 1 X PCR buffer (Invitrogen), 1.5 mM MgCl 2
(Invitrogen), 0.1mM dNTPs (Invitrogen), 20 ng
template DNA, 10 picomoles of each forward and reverse primers. As per the primer melting
temperature [Tm] different annealing temperatures were programmed in eppendorf mastercycler
gradient thermal cycler. Amplified products were detected on 2.5 % agarose gel. The intensity
of bands was increased by using different concentrations of MgCl 2.
RESULTS AND DISCUSSION
Rsa1 being a 4 base cutter, on an average cuts DNA every 256 bases. Digestion of
genomic DNA was found to be successful, as indicated by a uniform smear visualized on a
1.5% agarose gel (Figure 1). Ligation of ds linkers to size selected Rsa1 digest (between 500
to 1000 bp) was confirmed by PCR amplification with linker specific primer SuperSNX24
(Fig. 2). The linkers will provide the primer binding site for subsequent PCR steps. They also
provide sites to ease cloning of fragments into the vectors that will subsequently be used.
The linkers are compatible with the restriction sites in the vector’s multiple cloning site. The
Super SNX primer also incorporates a GTTT “pigtail” to facilitate non template ‘A’ addition by
Taq DNA polymerase during PCR, which can be used for cloning (Glenn and Schable, 2005).
Efficient attachment of ds linkers to Rsa I digest was attained at a molar ratio of 1:10.
Ligation of ds linker gave a thick smear between 300-1000 bp after confirmation using PCR
with 2 ìl of linker ligated DNA, which indicated the successful ligation of ds linkers to all size
selected Rsa1 digested DNA fragments (Fig. 2).
Hybridization of DNA fragments with biotinylated repeat oligonucleotides
was achieved by incubating the mixture at respective hybridization temperatures, followed
by confirmation by PCR using linker specific Super SNX24 primer. A smear was formed
4

ISOLATION AND CHARACTERIZATION OF MICROSATELLITES
between 300-500 bp region indicated the successful hybridization of repeat containing DNA
fragments. (Figure 3). To capture the repeat motifs in oil palm genome (CT)
10 and (TCG) 10
biotinylated oligo repeats were used as probes, because of their high frequency in plant
genome, to isolate microsatellite repeats. Hybridization of biotinylated oligo against Super
SNX linker ligated genomic digest was carried out separately as it increases the efficiency
of isolation at a specific hybridization temperature (Table 2) for each probe. This was done to
ensure a higher efficiency of isolation at a specific hybridization temperature for each probe,
which also allows control over hybridization and gives more products for repeats with different
melting temperatures or repeats that are rare.
The enriched fragments were cloned into pGEM-T easy cloning vector (Promega).
The ligated products were used to transform DH5á competent cells. The presence of both
blue and white colonies after transformation indicated the presence of inserts in the vector.
Totally, 100 white colonies were screened for the presence of inserts by conducting colony
PCR. Among these 60 colonies were found to be positive for inserts, as visualized on a
1.5% agarose gel. The amplification profiles of colony PCR results are shown in Figure 4.
Sequencing
30 positive colonies were randomly selected from the 60 which were found positive
for the inserts, as sequencing is an expensive process. They were grown in LB culture
medium and plasmid DNA was isolated for sequencing of the microsatellite repeat containing
regions. Of the 10 microsatellites captured five were GA/CT type, and imperfect repeats like
(CTT) 2
GTT(CTT) 2
(CCT) 3
(CTT) (AAT) (GAA) CAA(GAA) are obtained with (CT) biotinylated
3, 5, 2 4 10
repeat oligo. With (TCG) biotinylated repeat oligo, (GTC) ATC(ATT) microsatellite was
10 6 9
captured. The types of microsatellite repeats captured are listed in Table 2. Overall efficiency
of the protocol was found to be 30%, as 9 microsatellites were isolated from 30 positive
clones sequenced which is similar when compared to previous reports on selective
hybridization. In Coconut (Cocos nucifera) 1341 microsatellites were captured from 1880
clones (Rivera et al.,1999), and in another study 8 microsatellites were captured in Oenocarpus
bacaba (Billotte et al., 2005). In Bactris gasipaes 27 clones were showing microsatellite
sequences from 62 positive colones sequenced (Martinez et al.,2002). Honsho et al., (2005)
reported 6 mango microsatellite loci and Viruel et al., (2005) reported 16 mango microsatellite
loci. Two different repeat containing probes were used in hybridization reactions separately.
This indicates that the protocol used is best suited for capturing the di-nucleotide repeat
motifs rather than tri nucleotide repeat motifs. Imperfect repeats were also obtained in coconut
(Rivera et al.,1999), Geum urbanum (Rosaceae) (Arens et al., 2004).
5

CHERUKU et al.
The microsatellite repeats captured were submitted to the Vector Screen software in
NCBI web site (http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen.html) to remove the vector
sequences. Seven microsatellite sequences having sufficient flanking regions were used
for primer designing, using Primer 3 software. Primer designation and product sizes are
given in the Table 3.
Primers were standardized with different annealing temperatures and MgCl 2
concentrations (Figure 5), PCR conditions for the respective primers are given in the
Table 3.
Nine captured microsatellite containing sequences with flanking regions were
submitted in the NCBI (National Center for Biotechnology Information) web site for BLAST-
N (http://www.ncbi.nlm.nih.gov/BLAST/)
Most of the microsatellites showed high homology with Prochilodus argenteus
microsatellite sequence, Acacia mellifera subspp. mellifera microsatellite sequence, Oryza
sativa (japonica cultivar- group) genomic DNA, chromosome 12, complete sequence. The
microsatellite (GA) 12
was showing high homology with Elaeis guineensis microsatellite DNA,
clone mEgCIRO219 and Cocos nucifera microsatellite DNA, clone CncirB6. (AAT) 5
microsatellite was showing high homology with Ostertagia ostertagi mRNA for heat shock
protein 20 (hsp 20).
This work represents the first Indian effort in the isolation of microsatellites from Oil
palm (Elaeis guineensis Jacq.). Marker based characterization of genomes is generally done
for phylogenetic studies and gene discovery. Elaeis guineensis microsatellites can serve as
a powerful tool for genetic studies of the genus Elaeis, including variety identification and
intra or inter-specific genetic mapping. Phylogenetic information based on SSR flanking
region sequences makes Elaeis guineensis SSR markers a potentially useful molecular
resource for any researcher studying the phylogeny of palm taxa.
Table 1. List of primer sequences
S.No Primer Name Primer Sequence (5’ 3’)
1. Super Snx24 5’GTTTAAGGCCTAGCTAGCAGAATC
2. Super Snx24 +4p 5’pGATTCTGCTAGCTAGGCCTTAAACAAAA
3. M13 F CCCAGTCACGACGTTGTAAAACG
4. M13 R AGCGGATAACAATTTCACACAGG
5. (CT)
10
CTCTCTCTCTCTCTCTCTCT
6. (TCG)
10
TCGTCGTCGTCGTCGTCGTCGTCGTCGTCG
6

ISOLATION AND CHARACTERIZATION OF MICROSATELLITES
Table 2. List of microsatellite repeat motifs captured
S.No Clone Insert size( bp ) Repeat motif Biotinylated oligo
1. E 4
376 (GA) 16
(CT)
10
2. B 4
489 (CT) 9
(CG) 3
(CA) 6
(CT)
10
3. C 2
489 (CT) 9
(CG) 3
(CA) 6
(CT)
10
4. E 9
209 (CT) 6
(CT)
10
5. H 4
511 (AAT) 5
(CT)
10
6. C 4
374 (CTT)
2 GTT(CTT) 2
(CT)
10
(CCT)
3 (CTT) 3
7. E 5
362 (GA) 12
(CT)
10
8. B 10
546 (GAA) 2
CAA(GAA) 4
(CT)
10
9 A 6
- (GTC)
6 ATC(ATT) 9
(TCG)
10
Table 3. List of standardized conditions for captured microsatellites.
S. Annealing MgCl2
Repeat motif
Primer sequences
No Temperature (mM)
(oC)
1 (GA)16 5’CTTGATTGGATGGCGGATAG3’5 58.5 1.5
’GGAATGAACATAGAGCTTTTTCC3’
2 (CT)9(CG)3(CA)6 5’GGACTGCTAGGGTGCCACT3’ 58.5 1.5
CCCCTATAGATGGGGCTGAT
3 (CT)9(CG)3(CA)6 5’GGACTGCTAGGGTGCCACT3’5’ 58.5 1.5
CCCCTATAGATGGGGCTGAT3’
4 (CT)6 5’AATCACATGGGCTTGGGTTA3’ 58.5 2
5’GCAAGAGGGAGAAGAGAGAGAG3’
5 (AAT)5 5’TGGATCCTGGAGATTGCTTT3’ 46.1 2
5’CTCAAGCTATGCATCCAACG3’
6 (CTT) 2 GTT(CTT) 2 5’ATGGCAAAGCTGGAGAAGTG3’ 46.1 2
(CCT) 3 (CTT) 3 5’AGCAGAATCACAGTCACAGCA3’
7 (GA)12 5’CGCGAATTCACTAGTGATT3’ 47.5 2
5’GGTGCTAACAGGTTGAGTTGG3’
7

CHERUKU et al.
1000 bp
500 bp
RD M
M: 100 bp marker RD: Restriction digest of genomic
FIGURE 1. Rsa I digested genomic DNA of Elaeis guineensis Jacq.
1000 bp
500 bp
M A N
FIGURE 2. Amplification of linker ligated Rsa I digest
M: 100 bp marker
A: 2ml of linker ligated DNA template
N: Negative control without linker ligated DNA
8

ISOLATION AND CHARACTERIZATION OF MICROSATELLITES
M A B
M:100bp marker
A: DNA fragments enriched with (CT) 10 repeat oligo
B: DNA fragments enriched with (TCG) 10 repeat oligo
FIGURE 3. Amplification of DNA fragments enriched with repeat oligos
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
M:100 bp marker
1: Blue colony
2:16: White colonies
FIGURE 4. Colony PCR of transformed colonies
9

CHERUKU et al.
M
______________A______________ ______________B____________
M: 100 bp ladder
A: 3 mM MgCl 2
B: 2 mM MgCl 2
FIGURE 5. Standardization of SSR primers for optimization of MgCl 2
concentration
REFERENCES
Arens, P., Durka, W., Wernke, J. H and Smulders, J. M. 2004. Isolation and characterization
of microsatellite loci in Geum urbanun (Rosaceae) and their transferability within the
genus Geum. Moleculor Ecology Notes, 4: 209-212
Balloux, F and Lugon-Moulin, N. 2002. The estimation of population differentiation with
microsatellite markers. Molecular Ecology, 11(2): 155-165.
Barcelos, E., Amblard, P., Berthaud, J and Seguin, M. 2002. Genetic diversity and relationship
in American and African oil palm as revealed by RFLP and AFLP molecular markers.
Pesq. agropec. bras.37: 1105-1114.
Bennett, P. 2000. Microsatellites. Journal of Clinical Pathology, 53: 177-183.
Billotte, N., Marseillac, N., Risterucci, A. M., Adon, B., Brottier, P., Baurens, F. C and
Charrier, A. 2005. Microsatellite based high density linkage map in oil palm (Elaeis
guineensis Jacq.). Theory & Applied Genetics110: 754-765.
Glenn, T.C and Schable, N.A. 2005. Isolating microsatellite DNA loci. Methods in Enzymology,
395: 202-222.
Honsho, C., Nishiyama, K., Eiadthong, W and Yonemori, K. 2005. Isolation and
characterization of new microsatellite markers in mango (Mangifera indica L.). Molecular
Ecology Notes, 5: 152-154.
10

ISOLATION AND CHARACTERIZATION OF MICROSATELLITES
Jack, P. L and Mayes, S. 1993. Use of molecular markers for oil palm breeding. II. Use of
DNA markers (RFLPs). Oleagineux, 48: 1-8.
Karagyozov, L., Kalcheva, I. D and Chapman, V. M. 1993. Construction of random smallinsert
genomic libraries highly enriched for simple sequence repeats. Nucleic Acids
Research, 21: 3911-3912.
Mandal, P. K and Pillai, R. S. N. 2005. Screening of PCR primers for oil palm (Elaeis
guineensis Jacq.) shell thickness marker. In: Proceedings of the ICAR National
Symposium on Biotechnological Interventions for Improvement of Horticultural Crops:
Issues and Strategies. College of Horticulture, Kerala Agricultural University, Thrissur,
India. pp. 280-281.
Martinez, A. K., Gaitan-Solis, E., Duque, M. C., Bernal, R. S and Tohme J, 2002. Microsatellite
loci in Bactris gasipaes ( Arecaceae) their isolation and characterization. Molecular
Ecology Notes, 2: 408-410.
Mielke, T. 1996. Outlook for oils and fats from 1996 onwards with special emphasis on oil
palm and kernel oil. PAC seminars of the Palm Oil Research Institute of Malaysia
(PORIM), Kuala Lumpur. 28 March 1996.
Moretzsohn, M. C., Nunes, C. D. M., Ferreira, M. E and Grattapagliad 2000. RAPD linkage
mapping of the shell thickness of the shell thickness locus in oil palm (Elaeis guineensis
Jacq.). Theory & Applied Genetics, 100: 63-70.
Purba, A. R., Noyer, J. L., Baudouin, L., Perrier, X. Hamon, S and Lagoda, P. J. L. 2000.
A new aspect of genetic diversity of Indonesian oil palm (Elaeis guineensis Jacq.)
revealed by isoenzyme and AFLP markers and its consequences for breeding. Theory
& Applied Genetics, 101: 956-961.
Rival, A. Beule, T. Barre, P. Hamon, S. Duval, Y and Noirot, M. 1997. Comparative flow
cytometric estimation of nuclear DNA content in oil palm (Elaeis guineensis Jacq.)
tissue cultures and seed derived plants. Plant Cell Report, 16: 884-887.
Rival, A., Bertrand, C., Beule, T., Combes M. C., Trouslot, P and Lashermes, P. 1998.
Suitability of RAPD analysis for the detection of somaclonal variants in oil palm (Elaeis
guineensis Jacq.). Plant Breeding,117 (1): 73-76
Rivera, R., Edwards, K. J., Barker, J. H.A., Arnold, G. M., Ayad, G., Hodgkin, T and Karp,
A. 1999. Isoaltion and characterization of polymorphic microsatellites in Cocos nucifera
L. Genome, 42: 668-675.
11

CHERUKU et al.
Sambrook, J and Russel, D.W. 2001. “Molecular Cloning: A Laboratory Manula.” Cold Spring
harbor Laboratory Press, Cold Spring Harbor, Newyark.
Sanger, F., Nicklen, S and Coulson, A.R. 1977. DNA sequencing with chain-terminating
inhibitors, Proceedings of National Academy of Sciences, 74: 5463-5467.
Schulter, G. D., Boguski, M. S and Stewart, E. 1996. A gene map of the human genome.
Science, 274: 540-546.
Viruel, M. A., Escribano, P., Barbieri, M., Ferri, M and Hormaza, J. I. 2005. Fingerprinting,
embryo type and geographic differentiation in Mango (Mangifera indica L.,
Anacardiaceae) with microsatellites. Molecular breeding, 15: 383-393.
12

J.Res. ANGRAU 37(3&4)13-21, 2009
COMBINING ABILITY ANALYSIS FOR PRODUCTIVITY AND FIBRE
QUALITY TRAITS IN INTRA-HERBACEUM AND INTERSPECIFIC
(G. herbaceum L. x G. arboreum L.) CROSSES OF
DIPLOID COTTON
VEMANNA IRADDI and S. T. KAJJIDONI
Department of Genetics and Plant Breeding
University of Agricultural Sciences, Dharwad -580 005
ABSTRACT
The study was conducted at Main Agricultural Research Station, Dharwad during kharif 2006-07 to
estimate combining ability involving four female parents of Gossypium herbaceum L. and four male parents
of each of G. herbaceum L. and G. arboreum L. These were evaluated to select donor parents and hybrids for
seed cotton yield and fibre quality traits along with agronomically superior varieties which were used in line x
tester analysis for yield and yield components, economic traits and fibre quality traits. Analysis of variance for
combining ability revealed that magnitude of SCA variance was greater than GCA variance for all the traits.
This indicated predominance of non-additive gene action, which is important in exploitation of heterosis
through hybrid breeding. The line ´ tester analysis for combining ability of four lines and eight testers are
crossed to produce 32 F 1
s. The parents KS-16, 9747 and DLSA-17 for seed cotton yield and boll weight,
RAHS-14, RAHS-131, MB-3200 and RDC-53 for 2.5 per cent span length and fibre strength were observed to
be good general combiners. The crosses KS-16 ´ BLACH-1, RDC-53 ´ MB-3200, RDC-88 ´ DLSA-17, RAHS-
14 ´ MDL-2601, KS-16 ´ MDL-2582, RDC-53 ´ MDL-2582 and RDC-88 ´ DLSA-17 exhibited significant sca
effects for seed cotton yield per plant. In general, RAHS-14, KS-16 and RDC-88 exhibited good general
combining ability for most of the yield and fibre quality traits.
Cotton, “The king of apparel fibre” is the most important commercial crop of India,
cultivated mainly for its fibre and other byproducts such as nutritionally desirable oil quality.
Yield being a complex character and components which contribute towards high yielding
potential in cotton needs careful study. Several studies revealed the utility of combining
ability analysis in cotton in predicting the pre-potency on the basis of genetic information. In
any breeding programme, the proper choice of parents depending upon their combining ability
is a pre-requisite. The present investigation line x tester design was used to obtain information
on combining ability for yield and yield components, economic traits, and fibre quality traits
of genotypes obtained from leading centres working on diploid cotton.
MATERIALS AND METHODS
All the 45 entries consisting of four females RAHS-14, KS-16, RDC-53 and RDC-88;
eight males RAHS-131, 9747, MB-3200, BLACH-1, AK-235, DLSA-17, MDL-2601, MDL-
2582 and 32 F 1
s along with agronomically superior variety Jayadhar as check were grown in
email.id: vemanraddi@gmail.com
13

IRADDI and KAJJIDONI
randomized block design with two replications during kharif 2006-07 at Main Agricultural
Research Station, Dharwad. The crop was planted at 90 and 30 cm distance apart between
row and plant to plant, respectively. Data were recorded for number of bolls per plant, boll
weight, seed cotton yield per plant, ginning out turn, lint index, seed index, 2.5 per cent span
length, uniformity ratio, fibre strength and micronaire value. The data were averaged and
analysed according to the method outlined by Kempthorne (1957).
RESULTS AND DISCUSSION
Among intra-herbaceum crosses, mean square due to tester were higher in magnitude
for boll weight, 2.5 per cent span length and fibre strength. The lines exhibited significant
differences for boll weight and seed cotton yield per plant, whereas line x tester interactions
were significant for most of the traits. In interspecific crosses, the mean squares due to
testers were significant for number of bolls per plant and uniformity ratio. The lines exhibited
significant differences for 2.5 per cent span length, uniformity and fibre strength and line x
tester interactions were significant for most of the traits. The estimates of gca and sca
variance component revealed that non-additive components were predominant for all the
characters (Table 1 to 4). The predominance of sca variance in diploid cotton for yield and its
component characters were also reported by Neelima (2002) and Laxman and Ganesh (2003).
Yield and yield components
Seed cotton yield is a complex trait, dependent on many other component traits.
Boll number and boll weight in intraspecific hybrids and boll number in interspecific hybrids
were reported as major components of yield heterosis in diploid cotton (Bhatade, 1983 and
Singh et al., 1995). Hence, in the present study, the results of these traits are discussed as
component characters of seed cotton yield. Among intraspecific crosses, parents, KS-16
and 9747 exhibited significant gca effects for seed cotton yield per plant and boll weight.
Hence they are the best general combiners. Three crosses viz., KS-16xBLACH-1, RDC-53 x
MB-3200 and RDC-88 x RAHS-131 exhibited significant sca effects in desirable direction for
seed cotton yield per plant. Out of these crosses, KS-16 x BLACH-1 exhibited significant
sca effects for seed cotton yield per plant and number of bolls per plant. All the crosses
exhibited negative sca effects for boll weight.
Among interspecific crosses, parent KS-16 had significant gca effects for seed
cotton yield and boll weight indicating it is best general combiner for these two traits. AK-235
was the good general combiner for seed cotton yield per plant, boll weight and number of
bolls per plant. The parent DLSA-17 was the good general combiner for seed cotton yield per
plant and boll weight. Five crosses exhibited significant sca effects in desirable direction for
seed cotton yield per plant. Out of these four crosses viz., RAHS-14xMDL-2601,
14

COMBINING ABILITY ANALYSIS FOR PRODUCTIVITY
KS-16xMDL-2582, RDC-53xMDL-2582 and RDC-88xDLSA-17 exhibited significant positive
sca effects for seed cotton yield per plant and boll weight. These findings are in accordance
with Neelima (2002). Only one cross viz., RAHS-14 xDLSA-17 exhibited significant positive
sca effects for seed cotton yield per plant and number of bolls per plant. The results of sca
effects are in agreement with the reports of Kajjidoni (1982) and Neelima (2002). In contrast
to this, the cross combination RDC-53xAK-235 exhibited significant positive sca effects for
only boll weight. This indicates predominance of additive gene effect for number of bolls per
plant. Similar findings were also reported by Wilson (1991) and Neelima (2002).
Economic traits
Among three economic traits, ginning out turn primarily depends on seed and lint
weight. Lint index is directly governed by ginning per cent and higher estimate of lint index is
desirable. The present findings indicated that among intra-herbaceum crosses, RAHS-14
had significant gca effects for ginning out turn, lint index and seed index. Hence it is the best
general combiner for these three traits. Similarly, MB-3200 was the good general combiner
for ginning out turn and lint index. The parents KS-16, RDC-88 and BLACH-1 were good
general combiner for seed index. The study of sca effects of economic traits revealed that
two intra-herbaceum crosses viz., RAHS-14xMB-3200 and KS-16x9747 exhibited significant
sca effect for ginning out turn, lint index and seed index in desirable direction. While two
cross combinations viz., RDC-53xRAHS-131 and RDC-88xBLACH-1 were good specific
combiners for ginning out turn and lint index in desirable direction. In contrast to this, four
crosses viz., RAHS-14xBLACH-1, KS-16xRAHS-131, RDC-53x9747 and RDC-88xMB-3200
exhibited significant sca effects for seed index. These findings are in conformity with Maisuria
et al. (2006).
In interspecific crosses, RAHS-14 female was good general combiner for ginning
out turn, lint index and seed index, while RDC-88, AK-235 and DLSA-17 were good general
combiners for ginning out turn and lint index. In contrast to this, RDC-53 and MDL-2582
exhibited significant gca effect for seed index. Similar findings of sca effects were reported
by Pavasia et al. (1999) and Karande et al. (2004).The study of sca effects of economic
traits revealed that two interspecific crosses viz., RAHS-14xDLSA-17 and RDC-88xAK-235
exhibited significant sca effect for ginning out turn, lint index and seed index in desirable
direction. Three crosses viz., KS-16xMDL-2582, KS-16xMDL-2601 and RDC-53xAK-235
exhibited significant sca effect for ginning out turn and lint index. Two crosses viz.,
KS-16x DLSA-17 and RDC-53xMDL-2582 exhibited significant sca effects for seed index.
The findings of sca effects are in agreement with the results of Laxman and Ganesh (2003)
and Maisuria et al. (2006).
15

IRADDI and KAJJIDONI
Fibre quality traits
Among the intra-herbaceum crosses, RAHS-14 was good general combiner for 2.5
per cent span length, uniformity ratio, and fibre strength. But, KS-16 was a good general
combiner for 2.5 per cent span length and micronaire value. The parent RDC-88 was good
combiner for uniformity ratio and fibre strength. The results of gca effects are in agreement
with the findings of Neelima (2002) and McCarthy et al. (2004). The parent RDC-53 was a
good general combiner for 2.5 per cent span length and micronaire value. Among male
parents, RAHS-131 and MB-3200 were good general combiners for 2.5 per cent span length,
fibre strength and micronaire value. Parent BLACH-1 was a good general combiner for fibre
strength. Seven crosses exhibited significant sca effects in desirable direction for 2.5 per
cent span length. Out of which, five crosses viz., RAHS-14xRAHS-131, RAHS-14x9747,
KS-16xMB-3200, RDC-53x9747 and RDC-88xRAHS-131 exhibited significant sca effects for
2.5 per cent span length and fibre strength. These findings are in agreement with Muthuswamy
et al. (2003) and Manickam and Gururajan (2004). Five crosses exhibited significant sca
effects for micronaire value. Out of which, three crosses viz., RAHS-14xRAHS-131,
KS-16xMB-3200 and RDC-53x9747 exhibited sca effects in desirable direction for 2.5 per
cent span length and fibre strength .
In interspecific crosses, RDC-53 female was good general combiner for all the fibre
quality traits viz., 2.5 per cent span length, uniformity ratio, fibre strength, and micronaire
value. The results of gca effects are in agreement with the findings of Neelima (2002) and
McCarthy et al. (2004). The parent RDC-88 was good general combiner for some traits except
micronaire value. Among male parents, DLSA-17 was a good general combiner for 2.5 per
cent span length, MDL-2601 was good general combiner for 2.5 per cent span length and
fibre strength while, MDL-2582 was good general combiner for fibre strength. Seven
interspecific crosses exhibited significant sca effects in desirable direction for fibre strength.
Out of which five crosses viz., RAHS-14xAK-235, KS-16xDLSA-17, KS-16xMDL-2601,
RDC-53xAK-235 and RDC-88xDLSA-17 exhibited significant sca effects for 2.5 per cent
span length and fibre strength. A total of nine crosses exhibited significant sca effect for
micronaire value. Out of which RAHS-14xAK-235 and KS-16xMDL-2601 exhibited sca effect
in desirable direction for 2.5 per cent span length, fibre strength and micronaire value.
In general, the parents RAHS-14, KS-16 and RDC-88 exhibited good general
combining ability for most of the yield and fibre quality traits. They can be exploited for
further recombination breeding programme to isolate superior segregants for both seed cotton
and fibre quality traits.
16

COMBINING ABILITY ANALYSIS FOR PRODUCTIVITY
Table 1. gca effects of female and male parents for yield and yield components and fibre quality traits of
G. herbaceum L. cotton.
Source
Female parent
Number
of bolls
per
plant
Boll
weight
(g)
Seed
cotton
yield
per
plant
(g)
Ginning
out turn
(%)
Lint
index
(g)
Seed
index
(g)
2.5%
span
length
(mm)
Uniformity
ratio (%)
Fibre
strength
(g/tex)
Micronaire
value
(g/in)
RAHS-14 0.33 0.10 3.08 1.12** 0.22** 0.11** 0.24**
1.50** 0.59** -0.27**
KS-16 1.27 0.16** 10.27** -1.56** -0.19** 0.09* 0.39** -1.47** -1.06** 0.18**
RDC-53 -0.87 -0.02 -2.73 0.11 -0.09 -0.25** -0.47* -1.19** 0.00 0.15**
RDC-88 -0.73 -0.24** -10.61** 0.33 0.06 0.04* -0.16** 1.18**
0.46** -0.06
GCA lines
CD at 5 % 3.08 0.15 4.64 1.00 0.13 0.04 0.04 0.10 0.10 0.11
Male parent
RAHS-131 2.71* -0.09 0.70 0.61 -0.01 -0.21** 0.36**
1.58** 1.34** 0.10*
9747 0.08 0.28** 8.45** -1.65** -0.23** 0.02 -1.33** -1.82** -2.07** 0.27**
MB-3200 0.02 -0.09 -2.23 1.75** 0.23** -0.03* 2.04**
-0.01 0.64** 0.30**
BLACH-1 -2.81* -0.09 -6.92** -0.71* 0.01 0.22** -1.07**
0.25** 0.10* -0.07
GCA testers
CD at 5 % 3.08 0.15 4.64 1.00 0.13 0.04 0.04 0.10 0.10 0.11
17

IRADDI and KAJJIDONI
Crosses
RAHS-14 RAHS-
131
Table 2. sca effects of hybrids for yield and yield components and fibre quality
traits of Intra-herbaceum cotton
Number
of bolls
per plant
Boll
weight (g)
Seed
cotton
yield per
plant (g)
Ginning
out turn
(%)
Lint index
(g)
Seed
index (g)
2.5% span
length
(mm)
Uniformity
ratio (%)
Fibre
strength
(g/tex)
Micronaire
value
(g/in)
-1.21 -0.04 -1.45 -1.81* -0.32** -0.15** 0.54** -1.28** 0.88** 0.26**
RAHS-14 9747 1.42 -0.01 3.30 -0.96 -0.18 -0.14** 0.40** 1.08** 1.12** 0.15
RAHS-14 MB-3200 0.86 0.10 2.98 1.96** 0.35** 0.13** -1.77** 1.07** -1.43** -0.50**
RAHS-14 BLACH-1 -1.07 -0.05 -4.83 0.86 0.15 0.16** 0.83** -0.87** -0.57** 0.09
KS-16 RAHS-131 -0.64 -0.14 -7.14* 0.52 0.15 0.14** -1.80** 0.68**
-1.24 0.01
KS-16 9747 -0.52 0.02 -2.89 2.56** 0.23* 0.12** -0.30** 0.68** 0.82** -0.36**
KS-16 MB-3200 -4.68 0.00 -5.45 0.14 0.03 0.00 3.24** -4.91** 0.25** 0.17*
KS-16 BLACH-1 5.24* 0.12 15.48** -3.23** -0.41** -0.02 -1.14** 3.56**
0.17* 0.17*
RDC-53 RAHS-131 0.24 -0.03 -1.39 1.69* 0.21* -0.02 -0.08** -0.53* -0.81** -0.22
RDC-53 9747 -2.63
0.09 -1.89 -2.27** -0.11 0.37** 0.24* 0.20** 1.45** 0.49**
RDC-53 MB-3200 3.06 0.09 8.30* 0.55 -0.07 -0.28** -0.81** 0.72** -0.49** 0.03
RDC-53 BLACH-1 -0.67 -0.15 -5.02 0.03 -0.04 -0.07* 0.66** -0.39** -0.16* -0.30**
RDC-88 RAHS-131 1.61
0.21 9.98** -0.41 -0.04 0.03 1.34** 1.14** 1.17** -0.05
RDC-88 9747 1.73 -0.10 1.48 0.67 0.06 -0.12** -0.34** -1.96** -3.40** -0.28**
RDC-88 MB-3200 0.17 -0.19 -5.83 -2.65** -0.31** 0.15** -0.66** 3.13** 1.66** 0.30**
RDC-88 BLACH-1 -3.51 0.07 -5.64 2.40** 0.29** -0.06 -0.34** -2.30**
0.56** 0.04
sca effects
CD at 5 % 6.17 0.30 9.29 2.00 0.26 0.09 0.09 0.20 0.21 0.22
18

COMBINING ABILITY ANALYSIS FOR PRODUCTIVITY
Table 3. gca effects of female and male parents for yield and yield components and fibre quality traits in
inter-specific crosses (G. herbaceum L. G. arboreum L.) of diploid cotton
Source
Number
of bolls
per
plant
Boll
weight
(g)
Seed
cotton
yield
per
plant (g)
Ginning
out turn
(%)
Lint
index
(g)
Seed
index
(g)
2.5%
span
length
(mm)
Uniformity
ratio (%)
Fibre
strength
(g/tex)
Micronaire
value
(g/in)
Female parent
RAHS-14 -0.45 -0.09* -3.29* 0.40** 0.07** 0.06** -1.79** -0.38** -3.38** -0.11**
KS-16 1.29 0.18** 6.84** -0.05 0.00 0.02 0.09 -3.20** 0.27** 0.27**
RDC-53 -1.14 -0.00 -2.07 -1.44** -0.14** 0.11**
1.05** 2.28** 1.67** 0.16**
RDC-88 0.30 -0.09* -1.48 1.09** 0.06** -0.19** 0.65** 1.30** 1.44** -0.32**
GCA lines
CD at 5 % 2.92 0.10 4.32 0.40 0.06 0.05 0.18 0.07 0.12 0.06
Male parent
AK-235 3.67** 0.08* 9.09** 0.97** 0.08** -0.12** -0.60** 0.01 -0.18** -0.01
DLSA-17 0.05 0.17** 4.40** 0.43** 0.06** 0.02 0.39** 0.05 -1.69** -0.02
MDL-2582 -2.48* -0.05 -5.73** -1.36** -0.12** 0.13**
-0.04 2.18** 1.31** 0.11**
MDL-2601 -1.24
-0.21** -7.76** -0.04 -0.02 -0.03 0.25** -2.24** 0.56** -0.07**
GCA testers
CD at 5 % 2.98 0.10 4.32 0.40 0.06 0.0586 0.18 0.07 0.12 0.06
19

IRADDI and KAJJIDONI
Table 4. sca effects of hybrids for yield and yield mponents co and fibre quality traits in inter-specific
crosses (G. herbaceum L. G. arboreum L.) of diploid cotton
Crosses
Number
of bolls
per plant
Boll
weight (g)
Seed
cotton
yield per
plant (g)
Ginning
out turn
(%)
Lint index
(g)
Seed
index (g)
2.5% span
length
(mm)
Uniformity
ratio (%)
Fibre
strength
(g/tex)
Micronaire
value
(g/in)
RAHS-14 AK-235 -4.33* 0.01 -6.09
-0.67* -0.14** -0.11* 0.35* -1.27** 1.54** 0.15**
RAHS-14 DLSA-17 4.17*
-0.05 8.98** 2.11** 0.33** 0.12** 0.57** 0.17** -4.07** 0.25**
RAHS-14MDL-2582 -0.80 -0.23** -13.40**
-0.39 -0.08 -0.08* -0.01 1.65** 2.59** 0.18**
RAHS-14MDL-2601 0.96 0.28** 10.51** -1.05** -0.10* 0.07 -0.91** -0.55**
-0.06 -0.59**
KS-16 AK-235 1.68 -0.24**
-3.21 -3.32** -0.48** -0.22** -1.59** 0.80** -1.90** -0.72**
KS-16 DLSA-17 -1.82 0.12 -4.65
-0.94** -0.06 0.17** 1.03** -0.30** 1.10** -0.51**
KS-16 MDL-2582 2.83 0.24** 15.23** 2.64** 0.36** 0.08 -0.49**
-0.76** -0.19* 0.37**
KS-16 MDL-2601 -2.69
-0.11 -7.37* 1.61** 0.19** 0.02 1.05** 0.26** 0.99* 0.86**
RDC-53 AK-235 1.48 0.17* 4.57 2.13* 0.26** 0.01 1.80** 0.56** 0.49** -0.05
RDC-53 DLSA-17 -2.27
-0.26** -11.99** -0.13 -0.10* -0.22** -1.99** -3.46** 0.53** 0.26**
RDC-53 MDL-2582 -1.36
0.21** 7.13* -1.17** -0.06 0.23** 0.18 1.31** -0.89** 0.26**
RDC-53 MDL-2601 2.15 -0.12 0.29 -0.83** -0.10*
-0.02 0.00 1.59** -0.13 -0.48**
RDC-88 AK-235 1.17 0.06 4.73
1.85** 0.36** 0.33** -0.57** -0.10 -0.13 0.61**
RDC-88 DLSA-17 -0.08
0.20* 7.66* -1.04** -0.16** -0.07 0.39** 3.59** 2.44** 0.00
RDC-88 MDL-2582 -0.67
-0.21** -8.96** -1.08** -0.21** -0.23** 0.33* -2.19** -1.57** -0.82**
RDC-88 MDL-2601 -0.42 -0.05 -3.43 0.28 0.02 -0.03 -0.15 -1.30 -0.80** 0.21**
sca effects
CD at 5 % 5.85
0.20 8.64 0.80 0.12 0.11 0.37 0.14 0.24 0.12
20

COMBINING ABILITY ANALYSIS FOR PRODUCTIVITY
REFERENCES
Bhatade, S. S. 1983. Environmental influence on the magnitude of heterosis in G. arboreum
L. Indian Journal of Agricultural Science. 53 (8): 627-633.
Kajjidoni, S. T. 1982. Heterosis, combining ability and gene action for earliness, yield and
yield components in 2x10 crosses of G. arboreum L. ´ G. herbaceum cotton. M. Sc.
(Agri.) Thesis submitted to University of Agricultural Sciences, Bangalore.
Karande, S. S., Wandhare, M. R., Ladole, M. Y., Waode, M. M and Meshram, L. D. 2004.
Heterosis and combining ability studies in interspecific diploid cotton hybrids for fibre
quality parameters. International Symposiam on Strategies for Sustainable Cotton
Production – A Global Vision 1. Crop Improvement, Dharwad, 23-25 November, 2004.
Kempthorne, O. 1957. An Introduction to Genetic Statistics. John Wiley and Sons, 1 st Edn.,
New York, USA. pp. 456-471.
Laxman, S and Ganesh, M. 2003. Combining ability for yield components and fibre characters
in cotton (Gossypium hirsutum L.). The Journal of Research ANGRAU. 31 (4): 19-23.
Maisuria, A. T., Patel, J. C., Patel, K. G and Solanki, B. G. 2006. Study of best per se
performance, heterosis and combining ability effects for seed cotton yield and its
component characters through GMS system in Asiatic cotton. Journal of Indian Society
for Cotton Improvement. 31 (2): 88-91.
Manickam, S and Gururajan, K. N. 2004. Combining ability analysis for fibre quality in
upland cotton (Gossypium hirsutum L.). Journal of Indian Society for Cotton
Improvement. 29 (2): 86-91.
McCarthy, J., Jenkins, J. N and Wu, J. 2004. Primitive accession derived germplasm by
cultivar crosses as sources for cotton improvement: II Genetic effects and genotypic
values. Crop Science. 44 (4): 1231-1235.
Muthuswamy, A., Vivekanandan, P and Jayaramachandram, M. 2003. Combining ability
and gene action for fibre characters in upland cotton (Gossypium hirsutum L.). Journal
of Indian Society for Cotton Improvement. 28 (3): 127-131.
Neelima, S. 2002. Heterosis and combining ability analysis for yield and yield components
in cotton (Gossypium hirsutum L.). M. Sc. (Agri.) Thesis submitted to Acharya N. G.
Ranga Agricultural University, Hyderabad.
Pavasia, M. J., Shukla, P. T and Patel, U. G. 1999. Combining ability analysis over
environments for fibre characters in upland cotton. Indian Journal of Genetics and
Plant Breeding. 59 (1): 77-81.
Singh, H., Singh, S and Omprakash, 1995. Heterotic response of ten American cotton hybrids
for some quality traits. Journal of Cotton Research and Development. 9 (1): 13-16.
Wilson, F. D. 1991. Combining ability for yield characteristics and earliness of pink boll
worm resistant cotton. Crop Science. 31: 922-925.
21

J.Res. ANGRAU 37(3&4)22-34, 2009
WEED AND CROP RESISTANCE TO HERBICIDES
A. S. RAO
Integrated Weed Management Unit, Regional Agricultural Research Station
Acharya N.G.Ranga Agricultural University
Lam Farm, GUNTUR- 522 034, A.P.
ABSTRACT
Weeds continually pose a serious threat to profitable crop production, and the extent of loss depends
on the degree of infestation. Due to shortage and increased costs of labour, use of herbicides became integral
part of weed management in different crops and cropping systems even in developing countries. However,
their intensive use poses alarming threat to the mankind in the form of environmental pollution, shift in weed
flora and evolution of herbicide resistance in weeds. Herbicide resistant weeds, causes and mechanisms of
resistance, types of resistance, characteristics of resistance, management of herbicide resistant weeds,
herbicide resistant crops, their advantages and disadvantages in effective weed management have been
discussed in this review paper.
INTRODUCTION
Due to the high population growth rate, every endeavour is being made to produce
more grain per unit area per unit time. Of the several methods being adopted, intensive
cropping, efficient water and fertilizer use, breeding photo insensitive short statured crop
varieties responsive to higher levels of fertilizer, chemical control of weeds are some of the
important agronomic practices intended for increasing the existing level of food production.
Use of selective herbicides disturbs the micro-environment of the weed population. Such a
tremendous pressure (80 to 90% weed kill with a single spray) on a weed species, induces
some diversity (genetic, physiological or any other) in the weed species that show adequate
resistance to the herbicides. The manifestation of this behaviour in weed species and its
implications and use of herbicide resistant crops are reviewed in this article. According to
Whitehead and Switzer (1963), resistance in a weed population is usually defined as adequate
tolerance to a concentration of herbicide which at agriculture rates of application would normally
kill susceptible plants. Such resistance usually develops by natural selection, as a result of
repeated application of a herbicide over a number of years and operates at the intra species
level ,resistance is then passed on to the mutant biotype’s progeny.
E mail:sraoatluri@yahoo.co.in
22

WEED AND CROP RESISTANCE TO HERBICIDES
Herbicide Resistant Weeds
The repeated use of herbicides with similar modes of action on the same site over a
period of years (ranging from 5 to 12 years) has resulted in weed biotypes that are resistant
to such herbicides.Since1970, following the discovery of resistance of a biotype of common
groundsel (Senecio vulgaris) to the s- triazine herbicides simazine and atrazine, the
phenomenon of herbicide resistance in weeds have become well known. Prior to 1970, the
only confirmed instance of herbicide resistance, attributed to selection by repeated use of
the same herbicide was the differential susceptibility of wild carrot (Daucus carota) to 2,4-D.
(Anderson, 1996). The following weed species were reported to be resistant for different
herbicides (Table1)
Table 1. Weed species with resistance to different herbicides
Weed species
Herbicide (s) to which resistance observed
(1) (2)
Agropyron repens
Agrotis stolonifera
Alopercurus myosuroides
Amaranthus hybridus
Amaranthus palmeri
Amaranthus powelli
*Amaranthus retroflexus
Amaranthus rudi
Ambrosia artemissifolia
Ambrosia trifida
*Aristolochia bractesta
*Avena fatua
Cardaria chalepensis
Chenopodium album
Chenopodium polyspermum
*Chrozhophora rotteleri
Dalapon Phenoxy acetic acid herbicides
2,4-D
Pendimethalin, chlorosulfurondiclfopmethyl and
several triazines
Triazines
Glyphosate
Triazines
Atrazine
Glyphosate
Atrazine,glyphosate
Glyphosate
Pendimethalin
Proham, diallate,isoproturon, Triallate ,barban
2,4-D
Atrazine
Atrazine
Pendimethalin
23

Table1. contd..
RAO
Weed species
Herbicide (s) to which resistance observed
(1) (2)
Cirisium arvense
*Convolvulus arvensis
Conyza Canadensis
*Cressa critica
*Cucumis trigonus
*Cynodon dactylon
Daucos carota
Digitaria sanguinalis
Digitaria sps.
Echinocloa crusgalli
Erechtites hieracifolia
Euphorbia heterophylla
*Ischaemum rugosum
Kochia scoparia
Lolium multiflorum
Myosotis arvensis
Phalaris arundinacea
Phalaris minor
*Phyllantus maderas patensis
Picea abies
*Poa annua
Polygonum persicaria
Polygonum lapathifolium
Polygonum lapathifolium
Sencio vulgaris
Setaria viridis
Setaria spp.
Setaria spp.
2,4-D and amitrol
2,4-D
Paraquat,glyphosate
Paraquat,oxyfluorfen
2,4-D
Dalapon
2,4 – D
Atrazine
TCA
Dalapon, propanil, metoxuron atrazine
2,4-D
Glyphosate
Anilofos
Chlorosulfuron
Glyphosate
MCPA
Glysophate
Isoproturon,fenoxaprop,clodinafop,sulfosulfuron
Pendimethalin
Glysophate
Metoxuron
Atrazine
Dichlorprop
Atrazine
Atrazine
Metoxuron
Atrazine
Dalapon
24

WEED AND CROP RESISTANCE TO HERBICIDES
Table1. contd..
Weed species
Herbicide (s) to which resistance observed
(1) (2)
*Solanum nigrum
*Sorghum halepense
Sonchus arvensis
Stellaria media
Tripleuro spermum inodorum
Veronica persica
Atrazine
MSMA, dalapon, glyphosate
Amine salt of 2,4-D
Atrazine
MCPA
Atrazine
(Source: Gill et al.,1986: Anderson1996;Das and Duary,1999; Heap,2007;Reddy,2007;Yadav and Malik,2007)
*Weeds of local importance
There is no evidence that any herbicide resistant weed biotypes has occurred through
mutations caused by herbicide, nor is there any evidence to show whether or not these
resistant biotypes were already present prior to herbicide treatment at the sites when they
were detected. Herbicide resistant weed biotypes are presumed to arise through naturally
occuring mutations, form small, pre existing populations of the species. Resistance becomes
apparent when herbicide selection kills off the herbicide susceptible plants, leaving the herbicide
resistant biotype.
Factors regulating the development of resistance
Over reliance /overdependence on herbicides as the only and the principal means of
controlling weeds and continuous use of a herbicide(s) having same mechanism of action in
intensive agriculture indulging only crop monoculture and minimum tillage have been major
causes of herbicide resistance in most weed species (Das and Duary,1999). The factors
regulating the rate of development of resistance are
1. Initial frequency : Herbicide resistance is not entirely due to the mutation caused by
herbicides. In the naturally-existing population of a weed species, the resistant genotypes
are present in varying frequency, may be very low-one in a lakh population. This is its initial
frequency. The development of resistance at the field level depends upon the increase on
the proportion of the resistant genotypes within population. Repeated use of same herbicide(s)
having same mechanism of action results in killing the susceptible biotypes allowing the
resistant individuals to multiply and produce seeds year after year, and thus within few
seasons/years of application the population becomes dominated by resistant biotypes. The
more the initial frequency, the quicker is the appearance of the resistance. This is the starting
point of resistance
25

RAO
2. Use of herbicide(s) : Herbicide(s) having higher efficacy, used as pre/post emergence
and applied frequently over several growing seasons without rotating, alternating or combining
with other types of herbicides favour selective evolution of resistant biotypes of weeds.
3. Soil seed bank : The seed bank acts as a buffer, influencing the rate of appearance of
resistance. The appearance of resistance will be delayed by the recruitment of susceptible
individuals from the seed bank. This depends on the germination dynamics, tillage and
cultivation practices followed. For example zero or no tillage enhance the rate of development
of resistance, as the herbicide applied in this practice kill all the susceptible individuals on
the surface and thus allowing the resistant weed seeds which are deposited in previous
season to germinate in greater proportion. Deep tillage otherwise bury these seeds.
4. Other factors : Mode of inheritance of resistance ,gene flow, mode of pollination, relative
fitness etc. are other factors which are also responsible for regulating the rate of evolution of
resistance.
Mechanism of Resistance
There are three main mechanisms of resistance viz.
1. Altered site of action : Refers to the modification in the binding site of action of a
herbicide due to some genetic changes in biotypes showing resistance compared to the
susceptible ones and thus remains unaffected when the same herbicide is applied to them.
Eg. Resistance in many weeds species/biotypes to most of the triazines, sulfonyl ureas,
dinitro anilines and in some cases of ACCase inhibitors (fenoxprop, fluazifop etc) is developed
through this mechanism
2. Enhanced metabolism : Refers to the rapid degradation and /or conjugation of herbicide
molecules into non –toxic or less toxic metabolites/forms is a major mechanism of resistance
in several weed species Eg. Phalaris minor resistance to isoproturon
3. Sequestration and Compartmentation : Refers to the storing/accumulation of the
herbicides or its metabolites in the cell vacuole or getting sequestered in cells or tissues and
thus gets prevented from reaching to its site of action, is the other mechanism operating
under sequestration and compartmentation. Eg.Resistance to paraquat, a photosynthesis
inhibiting herbicide, in some biotypes of Lolium rigidum (Mathews,1997)
Extent of Resistance
Ryan (1970) observed that resistant biotypes of Senecio vulgaris were not controlled
by pre emergence application of simazine or atrazine at the rate of up to 17.92 kg/ha; while
this limit was found to be only 2.8 kg/ha in experiments conducted by Holliday & Putwain(1977).
26

WEED AND CROP RESISTANCE TO HERBICIDES
A resistant biotype of Chenopodium album was not killed with a dose as high as 40 kg
atrazine/ha (Souza Machado et al., 1977) and 20 kg/ha (Souza Machado and Bandeen,
1978). Kees (1978) reported a biotype of Stellaria media to be unaffected by atrazine 9 kg/
ha.
Types of Resistance :
Three types of resistance as it relates to herbicides and weeds, namely:
1. Herbicide resistance : Refers to a weed biotype that is resistant to one specific herbicide,
as in case of amitrole or glyphosate. However, the term may also be used to denote the
phenomenon of herbicide resistance in weed biotypes.
2. Cross resistance : Refers to a weed biotype that is resistant to two or more chemically
similar herbicides, as those grouped in the same herbicide family, and that have the same
mode of action. For example, a powell amaranth biotype is cross resistant to the uracil
herbicides, bromacil and terbacil.
3. Multiple resistance : Refers to weed biotypes resistant two or more individual or series of
chemically unrelated herbicides, as are those in different herbicide families, which have
different modes of action.
Characteristics of resistance biotypes:
(i)
(ii)
(iii)
(iv)
(v)
Plant resistant to atrazine show some degree of resistance to other herbicides
tested (Barralis et al., 1979).
Resistant biotypes emerged late and flower late than the susceptible
(S-biotypes) ones (Souza Machado & Bandeen, 1978).
Resistant Amaranthus have been suggested to be hybrids between two
closely related species (Gasquez and Compoint, 1980).
Nitrate reductase activity in resistant biotypes of Chenopodium album is not
affected by atrazine (whereas there is 35% reduction in susceptible biotypes)
as reported by Foster et al., (1980) and Lawrence et al., (1980). Similarly
paraquat- resistant biotypes of Conyza possessed significantly higher
superoxide dismutase activity than the susceptible types (Youngman and
Dodge, 1980). Also a high frequency of esterase has been reported from the
triazine resistant Chenopodium album (Gasquez and Compoint, 1981).
Triazine-tolerant parent plants of Amaranthus retroflexus were found to have
small cotyledons.
27

RAO
(vi)
Resistant and susceptible biotypes of Senecio vulgaris have also been
reported (Jodie and Radosevich, 1983) to differ on the basis of growth
depending on the light intensities they are exposed to eg. dry matter
production, height, number of leaves and leaf area of the resistant biotypes
were lower under both the low and high light regimes. Roots/shoot ratios
were lower in the resistant biotype only under high light regimes. Lower
values of these parameters in resistant plants were due to lowered photo
synthetic capacity. Net assimilation rate (NAR) was true for mean leaf area
ratio over a harvest interval. Shading lowered dry weight production, height,
number of leaves, Leaf area (LA), Net assimilation rate (NAR), Relative
growth rate (RGR), Plastachron index (PI) and root/shoot ratio of both
biotypes. Values for these growth parameters for resistant plants were either
similar to or lower than for susceptible plants when grown under low light.
Management of Herbicide Resistant Weeds:
The Herbicide Resistance Action Committee (HRAC) has developed the following
list of strategies for avoiding and managing problems with herbicide resistant weed biotypes
(Abraham et al.,1993; Timothy et al,2000 and David vitolo,2001). Keep in mind that reliance
upon any one strategy is not likely to be effective. The crop grower must use the following
strategies in carefully selected combinations, if herbicide resistant weed problems are to be
avoided or properly managed.
• Use Herbicides only when necessary. Where available, herbicide applications should be
based on economic thresholds. Continued development of effective economic threshold
models should be helpful.
• Use of rapidly degradable herbicides
• Rotate herbicides (sites of action). Do not make more than two consecutive applications
of herbicides with the same site of action to the same field unless other effective control
practices are also included in the management system. Two consecutive applications
could be single annual applications for two years, or two split applications in one year.
• Apply herbicides in tank-mixed, prepackaged, or sequential mixtures that include multiple
sites of action. Both herbicides, however, must have substantial activity against potentially
resistant weeds for this strategy to be effective.
• Rotate crops, particularly those with different life cycles (e.g. rice-pulse). At the same
time, remember not use herbicides with the same site of action in these different crops
against the same weed unless other effective control practices are also include in the
management system.
28

WEED AND CROP RESISTANCE TO HERBICIDES
• IWM approach/Combine, where feasible, mechanical weed control practices such as
rotary hoeing and cultivation with herbicide treatment.
• Include, where soil erosion potential is minimal, primary tillage as a component of the
weed management programme.
• Scout/survey fields regularly and identify weeds present. Respond quickly to changes in
weed populations to restrict spread of weeds that may have been selected for resistance.
• Clean tillage and harvest equipment before moving from fields infested with resistant
weed to those that are not.
• Germination stimulators
• Encourage rail roads, public utilities, highways departments and similar organizations
that use total vegetation control programmes should be encouraged to use vegetation
management systems that do not lead to selection of herbicide resistant weeds.
• Introduction of Herbicide Resistant Crops (HRCs) and Planting new herbicide resistant
crop varieties should not result in more than two consecutive applications of herbicides
with the same site of action against the same weed unless other effective control practices
are also included in the management system.
Herbicide Resistant Crops (GM Crops /Transgenic Crops)
Modern agriculture is dependent upon crop selective herbicides for effective control.
However, it is becoming extremely difficult and costly to find out and develop new herbicide
with favourable weed control properties and friendly environmental characteristics. An alternate
approach is to develop crop resistance to the existing herbicides with desirable properties
(Sankaran, 2001; Yaduraj et al., 2005 and Rao, 2006).To generate herbicide resistance crop
plants, the major approaches used are
1. Conventional breeding-with herbicide resistant biotypes
2. Invitro-mutation selection- by culturing cells or tissues in normally toxic concentrations
of herbicides
3. Mutant selection by somatic hybridization-fusion of prootoplasts in culture from different
plants to combine genetic information to create a new hybrid
4. Genetic transformation-transfer of clone genes into susceptible crop plants.
29

RAO
Table 2. Some of the herbicide resistant crops grouped according to the techniques
of development (Duke, 1998)
Technique Resistance Crops
Traditional selection triazine-resistance Canola
Seed Mutagenesis terbutyn-resistance Wheat
sulfonyl urea- resistance Soybean
imidazolinone- resistance Wheat
Cell selection sulfonyl urea- resistance Canola
atrazine- resistance
Soybean
Genetic Engineering sulfonyl urea- resistance Cotton
glufosinate (basta) resistance Rice, Canola
Glyfosate resistance Cotton, Soybean, Maize, Wheat
bromoxynil- resistance Cotton, Sub clover
2,4-D resistance
Cotton
In this regard, it has been reported that several laboratories around the world have
engineered crop plants that harbour genes for resistance to known potent herbicides (Hatzios,
1987 and Manju Sharma et al.,2003). In crops such as rice, wheat, corn, sugarcane and
soybeans herbicide resistant genotypes may be useful where it is difficult to control weeds
or environmental conditions dictate the use of specific herbicides to which the crop is normally
susceptible. Some of the commercialized transgenic crops with herbicide resistance are
given below.
Table 3. Commercialized transgenic crops with herbicide resistance
S.No Transgenic Herbicide Trademark Agrochemical
crop resistant Designation seed company
1 Rice Glufosinate ammonium Liberty link rice AgrEvo
2 Corn Glufosinate ammonium Liberty link corn AgrEvo
Glyphosate Roundup ready corn Monsanto
Dekalb Genetics
Imidazolinones IMICorn American cynamid
Pioneeretc
Sethoxydim SRCorn BASF/DeKalb
Genetics
30

WEED AND CROP RESISTANCE TO HERBICIDES
Table 2. contd...
S.No Transgenic Herbicide Trademark Agrochemical
crop resistant Designation seed company
3 Cotton Bromoxynil BXN Cotton Rhone–poulene
Glufosinate ammonium Liberty link cotton Agro Evo
Glyphosate Roundup ready cotton Monsanto
Sulfonylureas 19-51a cotton Dupont
4 Soybean Glufosinate ammonium Liberty link soybeans AgrEvo
Glyphosate Roundup readysoybeans MonsantoAsgowseeds
Sulfonylureas STS soybeans DuPont
5 Canola(Bras Glyphosate Roundup readyrape Monsanto
sica napus) Glufosinate ammonium Liberty link canola AgrEvo
Bromoxynil BXN Canola Rhone poulene
6 Tobacco Bromoxynil BXN Tobacco Rhone poulene
7 Sugar Beet Glyphosate Roundup ready beet Monsanto
Advantages
(WSSA,1998)
1. Transgenic herbicide resistant crops decrease the risk of crop injury
2. Decreasing herbicide carry over problem
3. Broadening the spectrum of weeds controlled
4. Using the herbicides that present less risk to the environment
5. The available herbicide can be used in large number of crops
6. Limitations in the choice of rotation crops can be reduced
7. Farmer will have to know about limited number of herbicides to fulfill weed management
needs (simplicity of weed control programme)
8. Use of environmentally safe herbicides that can be used in a cost effective manner
9. Flexibility in application rate and timing
Limitations
1. Herbicide resistant crops(HRCs) promotes increased use of herbicides
2. Exclusive and repetitive use of a specific herbicide may well allow to develop resistant
weeds in course of time
31

RAO
3. Herbicide resistant crops may transfer resistance to related weeds and possibility of
creating ‘super weeds’
4. HRCs may lead to abandonment of alternative weed control practices
5. Loss of farm biodiversity
6. Over reliance on HRCs may increase potential for shift in weed species
7. Increased herbicide residues in food, feed and water
8. Fear of consumers against adverse effects of HRCs
9. Every year farmer has to purchase seeds from seed developer
10. Abandonment of IWM approach
Conclusion
From the literature reviewed, it could be concluded that continuous use of same
herbicide for longer periods leads to development of resistant weeds. For management of
herbicide resistant weed population, no single weed control method is likely to provide effective
control when used exclusively. Therefore, weed control in crop lands should be long term
strategy involving a range of management techniques (i.e. IWM approach).In India, the use
of herbicide resistant crops is still in testing stage, and it may take time for their commercial
use.
REFERENCES
Abraham, C.T., Neer, B. Sarin and Mahesh Jain.1993.Application of biotechnology for weed
management. Proc. of International Symposium, Indian Society of Weed Science,
Hisar, November,18-20, Vol.1:209-219
Anderson,W.P.1996. Weed Science Principles and Practices. West Publishing Co. New
York, pp.125-128
Barralis,G. J., Gasquez, J., Jan and Soffietti, S. 1979.Physiological and ecological behaviour
of broad leaved weeds resistant to atrazine in France. Proc.EWRS symposiumon
the influence of different factors on development and control of weeds,Mainz.pp.217-
224.(c.f. Weed Abstr.29:1177)
Das,T. K and Duary, B.1999.Herbicide resistance in weeds. Annals of Agricultural
Research.20(4):393-398
Duke, S.O. 1998.Herbicide resistant crops-their influence on weed science. Journal of Weed
Science and Technology (Zasso-Kenkuyu, Japan) 43:94-100.
32

WEED AND CROP RESISTANCE TO HERBICIDES
David Vitolo. 2001.Guide lines to the management of herbicide resistant weeds The Herbicide
Resistance Action Committee (HRAC). http://www.gcpf.org/
Foster, R. J., Lawerence, J. M and Herrick, H. E.1980.Nitrate reductase inroots of lamb’s
quarters biotypes resistant and susceptible to atrazine Plant Physiology.65(6
supplement):112
Gill, H.S., Krishna Kumar and Kolar, J.S.1986. Resistance in weed biotypes to herbicides a
review.Indian Journal of Weed Science.18(2):90-105
Gasquez, J and Compoint, J. P.1980.The new atrazine-resistant weeds in France: Amaranthus
retroflexusS.I.ChenopodiumpolyspermumL.Polygonupersicaria L. Chemosphere 9:39-
43 (c.f. Weed Abstr.29:4207)
Gasquez, Jand Compoint, J.P.1981. Isoenzymatic variations in populations of Chenopodium
album L. resistant to and susceptible to triazines. Agro-Ecosystems 7:1-10.(c.f. Weed
Abstr.31:611)
Hatzios, K. K. 1987.Biotechnology applications in weed management:Now and in the future.
Advances in Agronomy.41:325-375
Heap, I. M. 2007.International survey of herbicide resistant weeds on line s.Weed science
Society of America.www.Weed science.org./in.asp.
Holliday, R. Jand Putwain, P.D. 1977.Evolution of resistance to simazine in Senecio
vulgarisL.Weed Research.17:291-296
Jodie, S. H and Radosevich,S. R.1983. Differential growth of two common groundsel(Senecio
vulgaris)biotypes Weed Science.31: 112-120
Kees, H.1978.Observations on the resistance of Chickweed (Stellaria media) to atrazine in
maize.Gesunde Pflanzen.30:137-139(c.f Weed Abstr.28:55)
Lawerence, J. M., Foster, R. J and Herrick, H. E. 1980.Reduction of nitrate and nitrite in
lamb’s quarters biotypes resistant and susceptible to atrazine toxicity. Plant
Physiology.65:984-989
Manju Sharma, Charak, K.S and Ramaiah, T.V. 2003.Agricultural biotechnology research in
India:Status and policies. Current Science. 84(3):297-302
33

RAO
Mathews, J.M.1997. Herbicide resistance.Ed.Stephen B.Powles and Joseph A.M.Hotur. Lewis
Publisher.London pp.317-315
Rao, A.S. 2006. Biotechnology applications in weed management. Proc.National symposium
on ‘Conservation of Biodiversity and Applications of biotechnology’Andhra Loyola
College,Vijayawada,11-12thAug,2006,pp.63
Reddy, K.N. 2007.Herbicide–resistant crop and glyphosate–resistant weeds Abstracts of
papers.’New and emerging issues in Weed Science’,Biennial conference.ISWS/
HAU,HisarNov.2-3,2007.pp.67
Ryan,G.F. 1970. Resistanc of common groundsel to simazine and atrazine. Weed
Science.18:614-616
Sankaran, S. 2001.Eco-friendly weed management options for sustainable agriculture.
Keynote address. First Biennial Conferencein the new millenium, Indian Society of
Weed Science Bangalore, May,23-24.2001 pp.18-19
Souza Machado, V. and Bandeen, J., Stephenson, G.R and Jensen, K.I.N.1977. Differetial
atrazine interfereance with Hill reaction of isolated chloroplasts from Chenopodium
albumL biotypes. Weed Research. 17:407-413
Souza Machado, V and Bandeen, J.D.1978.Atrazine-resistant lamb’s quarters. Weeds Today
9(2):11
Timothy, S. Prather., Joseph, M and Ditomaso, 2000. Herbicide Resistance: Definition and
Management Strategies, Publication 8012, Division of Agriculture and Natural
Resources, University of California.pp.21
WSSA (Weed Science Society of America ).1998.Herbicide Hand book .Supplement to seventh
edition, WSSA, Lawrence, Kansas, USA. pp.79-80
Whitehead,C.W and Switzer. C.M 1963.The differential response of strains of wild carrot to
2,4-Dand related herbicides. Canadian Journal of Plant Sciences.43:255-262
Yadav, A and Malik,R. K. 2007.Herbicide resistance in Phalaris minor and management
options.Abstracts of papers’New and emerging issues in Weed Science’,Biennial
conference.ISWS/HAU,HisarNov.2-3,2007.pp. b73
Yaduraju, N.T., Chandrabhanu and Sushilkumar, 2005.Biological control of weeds:potential
and prospects.Abstract book.First International Weed Science Seminar. West Bengal
Weed Science Society,Kolkata,Jan.21-24.pp.ItoXII
Youngman, R. J and Dodge, A.D.1980. Paraquat resistance in Conyza.Plant Physiology.65(6
supplement):12
34

J.Res. ANGRAU 37(3&4)35-43, 2009
A COMPARATIVE STUDY ON HETEROSIS FOR PRODUCTIVITY AND
FIBRE QUALITY TRAITS IN INTRA-HERBACEUM AND
INTERSPECIFIC(G. herbaceum L. × G. arboreum L.) CROSSES OF
DIPLOID COTTON
VEMANNA IRADDI and S. T. KAJJIDONI
Department of Genetics and Plant Breeding
University of Agricultural Sciences, Dharwad -580 005
ABSTRACT
A comparative study of heterosis was made involving four female parents of Gossypium herbaceum
L. and four male parents of each of G. herbaceum L. and G. arboreum L. These were evaluated to select donor
parents for the exploitation of heterosis for different seed cotton yield, fibre quality traits and seed oil content.
In the present study, superiority of the hybrids was observed over better parent and standard check Jayadhar
for all the characters. The hybrids identified for high yield viz., RDC-53xMB-3200, KS-16xMB-3200,
KS-16xMDL-2582, RAHS-14xMDL-2601, RAHS-14xDLSA-17 and RDC-88 DLSA-17 exhibited significant
positive heterosis for seed cotton yield and fibre quality traits. However, hybrids failed to account heterosis
over check Jayadhar for lint index and ginning out turn except few crosses viz., RAHS-14xMB-3200,
RAHS-14xBLACH-1, RDC-88xBLACH-1, RAHS-14xDLSA-17, RDC-88xAK-235. Although superiority of
intraspecific crosses for seed cotton yield was due to cumulative action of component traits like boll weight and
number of bolls per plant, whereas boll number in interspecific crosses for better expression of heterosis of
seed cotton yield in diploid cotton. However, in the present investigation for seed cotton yield in both sets of
hybrids contribution of boll weight is relatively more than number of bolls per plant.
Cotton the ‘white gold’ enjoys a pre-eminent status among all cash crops in the
country, being the principal raw material for a flourishing textile industry. In India, inspite of
severe competition from synthetic fibres in recent years, it is occupying the premier position
with as much as 70 per cent share in the textile industry. Presently, cultivation of varieties
and hybrids of tetraploid cotton is more risky and non-remunerative. The increased cost of
cultivation of these cotton hybrids is due to high seed cost, more plant protection as they are
susceptible types and needs higher fertilizer dose. On the contrary, diploid cottons virtually
involve low seed cost, low or no cost for plant protection and require comparatively less crop
nutrition.
Looking to this, one will really be optimistic for cultivation of diploid cotton provided
they yield at least on par with varieties and hybrids of tetraploid cotton and must possess
equivalent fibre quality. For development of superior and heterotic hybrids in cotton, it is
essential to have information about the extent of heterosis present in the hybrid combination.
Besides this, the quality of fibre plays major role in pricing and marketing the produce. There
email.id: vemanraddi@gmail.com
35

IRADDI and KAJJIDONI
is need to have more quality consciousness in addition to yield. While evolving new hybrids/
varieties, it is more so particular in diploid cotton which are severely suffering from short
staple length and coarse nature.
Apart from this, one of the most important current scientific paradox with respect to
cotton breeding which has evoked the attention of plant breeder is the diversification of
cotton crop as an oil seed crop besides its fibre because of its nutritionally desirable oil
quality and it can become one of the avenues for shortening the quantum of edible oil import.
MATERIALS AND METHODS
The experimental material for the present study was selected from leading centres
working on diploid cotton and were evaluated to select donor parents and hybrids for different
seed cotton yield, fibre quality traits and seed oil content along with agronomically superior
varieties. Out of the promising collections, 12 parents of two diploid species viz., Gossypium
herbaceum L. and Gossypium arboreum L. were selected. Four females (Gossypium herbaceum
L.) viz., RAHS-14, KS-16, RDC-53, RDC-88 and eight males (Gossypium herbaceum L. and
Gossypium arboreum L.) viz., RAHS-131, 9747, MB-3200, BLACH-1, AK-235, DLSA-17,
MDL-2601 and MDL-2582 were crossed to produce 32 F 1
s.
The 32 F 1
s along with their parents were grown in a randomized block design at Main
Agricultural Research Station, Dharwad during kharif 2006-07 at 90x30 cm spacing.
Observations were recorded on 12 characters including seed cotton yield, yield contributing
characters and fibre quality traits from five randomly selected plants in each replication for
each treatment. The data was analysed as per the procedure given by Kempthrone (1957)
and heterosis was calculated in percentage.
RESULTS AND DISCUSSION
Yield and yield components
The magnitude of heterosis was high for seed cotton yield compared to remaining
traits. Among two sets of hybrids, the intra-herbaceum crosses exhibited better heterosis
than interspecific crosses for seed cotton yield and its component characters (Table 1 and
2). Although, superiority of intraspecific crosses for seed cotton yield was due to the cumulative
action of components traits like boll weight and number of bolls per plant, whereas boll
number in interspecific crosses for better expression of heterosis of seed cotton yield (Bhatade,
1983 and Singh et al., 1995). However in the present investigation in both sets of crosses for
seed cotton yield, contribution of boll weight was relatively more than number of bolls per
plant.
Ten intra herbaceum crosses exhibited heterobeltiosis and three crosses standard
heterosis for seed cotton yield. They also exhibited significant heterosis for seed cotton
36

A COMPARATIVE STUDY ON HETEROSIS FOR PRODUCTIVITY
yield and boll weight. Out of 16 intra herbaceum crosses, the cross combination KS-16 ´
BLACH-1 exhibited high mean seed cotton yield of 82.5 g per plant, with high standard
heterosis of 38.66 per cent over Jayadhar and moderately high boll weight of 1.98 g. The
findings of heterosis are in agreement with the studies of Reddy (2001) and Neelima (2002).
Out of 16 crosses, four crosses KS-16 xMB-3200, KS-16xBLACH-1, RDC-53xMB-3200 and
RDC-88x9747 were identified based on seed cotton yield per plant, seed cotton yield per plot
and fibre quality traits. Among these crosses, two of them viz., KS-16xMB-3200 and
RDC-53xMB-3200 also exhibited significant positive heterosis for fibre quality trait 2.5 per
cent span length.
Seven interspecific crosses exhibited significant standard heterosis for seed cotton
yield. Out of 16 interspecific crosses, the cross combination KS-16xMDL-2582 exhibited
high mean seed cotton yield of 78.25 g per plant, with high standard heterosis of 31.57 per
cent over Jayadhar, it has medium to high boll number and high boll weight of 2.02 g. Four
crosses viz., KS-16xDLSA-17, KS-16xMDL-2582, RDC-53xAK-235 and RDC-88xDLSA-17
exhibited significant positive heterosis for seed cotton yield per plant and boll weight. The
cross KS-16xAK-235 exhibited heterosis for seed cotton yield and number of bolls per plant.
These findings of heterosis are in agreement with the studies of Reddy (2001) and Neelima
(2002). Five crosses RAHS-14xDLSA-17, KS-16xAK-235, KS-16xMDL-2582, RDC-53x
MDL-2582 and RDC-88xDLSA-17 were identified based on seed cotton yield and yield
components and fibre quality traits. The crosses identified for high seed cotton yield viz.,
KS-16xMDL-2582, KS-16xAK-235 and RDC-88xDLSA-17 exhibited significant positive
heterosis for majority of quality traits like 2.5 per cent span length, uniformity ratio, fibre
strength and seed cotton yield.
Economic traits
Among the economic traits included in the study ginning out turn per cent, primarily
depends on seed weight and lint weight. Lint index represents the absolute weight of the lint
produced per seed. This character can be considered as more important in breeding work
rather ginning percentage as it is highly correlated with the lint yield. Lint index is a
complementation of high seed index and high ginning out turn per cent.
In both sets of hybrids, most of the crosses failed to record significant positive
heterosis for ginning out turn and lint index, but exhibited significant standard heterosis for
seed index. Similar findings were also reported by Kajjidoni (1997), Laxman and Ganesh
(2003) and Manickam and Gururajan (2004). Among intra-herbaceum crosses,
RAHS-14x MB-3200 exhibited heterosis for ginning out turn per cent, seed index and lint
index. Among interspecific crosses, RAHS-14xDLSA-17 and RDC-88xAK-235 exhibited
significant positive heterosis for lint index, seed cotton yield and seed index.
37

IRADDI and KAJJIDONI
Fibre quality traits
In recent years, more emphasis is laid on quality traits apart from seed cotton yield.
For 2.5 per cent span length, six crosses exhibited heterobeltiosis and eight crosses accounted
significant standard heterosis. Among intra herbaceum crosses, RDC-53xMB-3200 identified
for high heterosis for seed cotton yield also exhibited significant standard heterosis for 2.5
per cent span length. The results of heterosis are in conformity with the reports of Reddy
(2001), Neelima (2002) and Tuteja et al. (2005). Four crosses manifested heterobeltiosis and
three crosses viz., RAHS-14xRAHS-131, RDC-88xRAHS-131 and RDC-88xMB-3200 recorded
significant standard heterosis for fibre strength. They also recorded significant positive
heterosis over check Jayadhar for 2.5 per cent span length. The present findings corroborate
with Tuteja et al. (2005).
For 2.5 per cent span length, nine crosses recorded high heterobeltiosis while all the
16 crosses were superior over check Jayadhar. The interspecific crosses viz., KS-16x
MDL-2582, KS-16xAK-235, RDC-88xDLSA-17 and RDC-53xAK-235 recorded high heterosis
for seed cotton yield and the quality traits 2.5 per cent span length, uniformity ratio and fibre
strength. The results of heterosis are in conformity with the reports of Reddy (2001), Neelima
(2002) and Tuteja et al. (2005). Ten crosses recorded significant positive heterosis over
better parent and 15 crosses over the check Jayadhar for fibre strength.
Oil content
None of the intra-herbaceum crosses exhibited significant heterosis over standard
check Jayadhar. However seven crosses recorded significant heterobeltiosis for oil content.
Out of these, two crosses viz., KS-16xBLACH-1 and RDC-53xMB-3200 recorded significant
positive heterosis for seed cotton yield and oil content. None of the interspecific crosses,
exhibited significant heterosis over standard check Jayadhar. But, seven crosses exhibited
significant heterobeltiosis. Out of these crosses, KS-16xMDL-2601 exhibited significant
positive heterosis for seed index, 2.5 per cent span length, uniformity ratio, and fibre strength.
The best cross combination for seed cotton yield was KS-16xBLACH-1 among intraherbaceum
crosses. Among these crosses, RDC-53xMB-3200 exhibited significant positive
heterosis for 2.5 per cent span length and seed cotton yield. The best combination for fibre
quality traits was KS-16xMB-3200.
The best cross combination for seed cotton yield among interspecific crosses was
KS-16xMDL-2582. Among these, four crosses KS-16xMDL-2582, RAHS-14xMDL-2601 and
RDC-88xDLSA-17 exhibited significant positive heterosis for seed cotton yield, 2.5 per cent
span length, uniformity ratio, and fibre strength. The best combination for fibre quality traits
was RDC-88xDLSA-17. Among these crosses, RDC-88xDLSA-17 exhibited significant positive
heterosis for 2.5 per cent span length, uniformity ratio and fibre strength.
38

A COMPARATIVE STUDY ON HETEROSIS FOR PRODUCTIVITY
Table 1. Per cent heterosis for yield, yield components and fibre quality traits of Intraherbaceum
Cotton.
Number of bolls
per plant
Boll weight (g)
Seed cotton yield
per plant (g)
Seed cotton yield
per plot (g)
Ginning outturn
(%)
Lint index (g)
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Crosses
RAHS-14 RAHS-131 1.74 -2.01 -3.42 6.02 1.15 10.92 32.08* 27.85*
3.21 -6.86* 15.75 0.43
RAHS-14 9747 1.74 -2.01 18.49* 30.08** 20.31** 31.93** 18.87 15.07 1.63 -11.32** 1.98 -2.96
RAHS-14 MB-3200 0.00 -3.68 4.11 14.29 3.45 13.45 -3.77 -6.85 21.33** 8.65* 36.24** 34.58**
RAHS-14 BLACH-1 -13.19 -16.39* -4.11 5.26 -15.71* -7.56 0.00 -3.20 0.44 2.80
19.03* 18.78**
KS-16 RAHS-131 20.55*
2.01 10.63 3.31 36.36** 13.45 19.70 44.29** -4.31 -7.97* 1.09 2.64
KS-16 9747 12.65 -4.68 24.14** 35.34** 60.61** 33.61** -7.88 11.42 -5.03
--8.66* -4.41 -2.96
KS-16 MB-3200 1.19 -14.38 7.97 13.03 33.84** 11.34
14.39 37.90** -1.84 -5.60 5.39 7.00
KS-16 BLACH-1 21.74* 3.01 27.86** 19.40* 66.67** 38.66** 75.76** 111.87** -21.50** -24.03** -19.00* -17.77*
RDC-53 RAHS-131 20.41* -1.34 8.55 -0.75 33.89** 1.26
-4.88 -28.77* 5.66 1.01 20.05* 8.53
RDC-53 9747 2.45
-16.05* 18.62* 29.32** 43.62** 13.45 30.61 -2.19 -14.93** -18.67** -7.42 -11.90*
RDC-53 MB-3200 20.82* -1.00 2.90 6.77 39.58** 12.61 82.93** 36.99*
5.62 0.98 8.30 7.00
RDC-53 BLACH-1 -0.57 -18.53* 1.15 -7.52 8.89 -17.65* 58.54**
18.72 -5.39 -8.44* 0.08 -0.13
RDC-88 RAHS-131 8.10 2.68 22.94* 0.75 30.10* 7.14 33.70* 12.3 -0.60
-4.93 1.99 4.89
RDC-88 9747 1.06 -4.01 -4.14 4.51 28.57** 5.88
45.65* 22.37 -4.50 -8.66* -2.43 0.34
RDC-88 MB-3200 -3.52 -8.36 -26.09** -23.31* -8.16 -24.37** -17.39 -30.59* -4.27 -8.44* 1.10 3.97
RDC-88 BLACH-1 -21.83* -25.75** 7.89 -7.52 -17.35* -31.93** -23.91 -36.07* 3.07 -0.25 14.84* 18.11**
SE+ 4.02
2.81 0.17 0.13 5.28 4.24 89.08 70.73 1.95 0.95 0.25 0.13
CD at 5 % 8.34 5.95 0.36 0.29 10.94 9.02 184.52 150.17
Contd….1 st page
4.04 2.02 0.54 0.27
39

IRADDI and KAJJIDONI
Table1. contd…..
Seed index (g)
2.5% span length
(mm)
Uniformity ratio (%)
Fibre strength
(g/tex)
Micronaire value
(g/in)
Oil content (%)
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Crosses
RAHS-14 RAHS-131 10.53** 11.14** 12.05** 7.60** 11.20** 2.15** 22.29** 10.07** -13.12** -6.98** 8.16** 1.60
RAHS-14 9747 -9.14** 15.3** 3.71** -0.42 7.88** -0.90** 3.32** -7.00** -11.87** -5.64** 3.57 1.92
RAHS-14 MB-3200 2.92 19.04** -1.51* 4.83** 2.66** 4.40** -7.09** -6.14** -33.57** -28.87** 2.04 -4.15
RAHS-14 BLACH-1 18.20** 23.88** 0.95 2.57** 2.21** -0.54 -0.73 -4.44** -19.20** -13.48** 8.50** 1.92
KS-16 RAHS-131 7.48** 15.76** 2.65** -2.06** 10.90** -0.88** 11.55** -10.93** 0.70 -3.06 -3.59 -5.75*
KS-16 9747 -9.14** 15.33** 1.82** -2.86** 0.82** -10.89** 2.51** -17.51** -4.79** -6.79** 2.60 0.96
KS-16 MB-3200 0.67 16.44** 19.77** 27.48** -23.32** -22.02** -6.90** -5.95** -3.97* -7.55** 3.59 1.28
KS-16 BLACH-1 11.82** 20.44** -6.96** -5.47** 6.55** 3.68** -5.79** -9.32** 0.50 -3.25 6.21* 3.83
RDC-53 RAHS-131 6.43**
7.02** 2.91** 1.74** -1.61** -3.56** -3.56** -2.15** -2.24 -8.03** 7.28** 3.51
RDC-53 9747 -7.19** 17.80** -3.15** -4.26** -9.61** -11.41** -9.69* -8.38** 11.04** 8.70** 3.25 1.60
RDC-53 MB-3200 -8.74** 5.56** -0.47 5.93** -6.64** -4.55** -5.57** -4.20** -5.28** -10.90** 5.30* 1.60
RDC-53 BLACH-1 8.29** 13.56** -2.55** -1.30** -5.18** -7.07** -6.74** -5.39** -7.42** -12.91** 0.99 -2.56
RDC-88 RAHS-131 3.40*
12.98** -2.08** 9.36** 1.88** 8.33** -3.35** 10.96** -2.15 -8.80** 4.24 -5.75*
RDC-88 9747 -9.88** 14.39** -15.34** -5.45** -16.13** -10.82** -40.79* -32.02** -7.91** -9.85** -0.97 -2.56
RDC-88 MB-3200 2.13
18.13** -3.36** 7.93** 2.99** 9.51** -4.32** 9.86** -2.48 -9.66** 11.43** -0.32
RDC-88 BLACH-1 8.74** 18.82** -14.36** -4.35** -11.32** -5.71** -12.03** 1.00 -4.19*
-10.42** 10.00** 1.92
SE+ 0.14
0.04 0.18 0.06 0.16 0.10 0.13 0.10 0.11 0.10 0.52 0.37
CD at 5 % 0.29
0.09 0.40 0.13 0.32 0.21 0.27 0.21 0.24 0.21 1.10 0.79
40

A COMPARATIVE STUDY ON HETEROSIS FOR PRODUCTIVITY
Table 2. Per cent heterosis for yield, yield components and fibre quality traits in inter-specific crosses
(G. herbaceum L. G. arboreum L.) of diploid cotton.
Number of bolls per
plant
Boll weight (g)
Seed cotton yield
per plant (g)
Seed cotton yield
per plot (g)
Ginning outturn (%) Lint index (g)
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Crosses
RAHS-14 AK-235 0.35 -3.34 -8.90 0.00 -5.56 3.57 24.53 20.55 -18.03** -11.40** -11.05 -7.30**
RAHS-14 DLSA-17 13.89 9.70 -7.53 1.50 10.34 21.01** 1.89 -1.37 -9.61** -4.33** 5.73 9.49**
RAHS-14 MDL-2582 -6.94 -10.37 -29.45 -22.56** -39.46** -33.61** -60.38** -61.64** -5.91 -17.90** 5.30 -12.80**
RAHS-14 MDL-2601 1.39 -2.34 -10.27 -1.50 -5.94 3.15 -15.09 -17.81 -18.55** -15.84** -2.62 -9.77**
KS-16 AK-235 32.45** 17.39* 7.89 0.75 50.76** 25.42** 7.58 29.68 -27.09** -21.19** -25.92** -22.79**
KS-16 DLSA-17 5.38 -1.67 36.88** 27.82** 37.00** 15.13* -27.27 -12.33 -20.03** -15.37** -10.91 -7.74**
KS-16 MDL-2582 22.92* 4.01 18.25** 21.80** 58.08** 31.57** 15.15 38.81 -6.12 -9.71** -0.32 1.20
KS-16 MDL-2601 9.41 -7.42 -2.58 -9.02 8.33 -9.87 -34.85* -21.46 -11.75** -8.82** -2.87 -1.38
RDC-53 AK-235 24.53* 10.37 25.82** 15.04* 61.54** 23.53** 36.59 2.28 -15.23** -8.36** -4.21 0.17
RDC-53 DLSA-17 -2.87 -9.36 2.80 -6.02 4.50 -17.18 17.07 -12.33 -21.80** -17.23** -17.45** -14.51**
RDC-53 MDL-2582 5.31 -13.75 5.84 9.02 23.74** 2.94 -12.20 -34.25 -22.80** -26.20** -11.72 -20.20**
RDC-53 MDL-2601 20.82* -1.00 -12.83* -20.30** 16.39 -11.97 43.90 7.76 -23.49** -20.95** -11.25 -17.77**
RDC-88 AK-235 19.37* 13.38 34.31** 3.01 51.53** 24.79** -23.90 -36.07 -8.66* -1.26 6.84 11.35**
RDC-88 DLSA-17 5.63 0.33 28.10** 16.54** 45.00** 21.85** 32.61 11.42 -16.97** -12.13** -12.43* -9.32**
RDC-88 MDL-2582 -3.17 -8.03 -23.50** -21.20** -7.58 -23.11** 13.04 -5.02 -14.15** -17.90** -20.41** -18.14**
RDC-88 MDL-2601 1.06 -4.01 -11.02 -21.05** 0.51 -17.23* 50.00 26.03 -12.36** -9.45** -8.24 -5.63*
SE+ 4.32 2.78 0.11 0.08 5.42 4.07 128.52 105.38 1.61 0.42 0.21 0.07
CD at 5 % 8.95 5.89 0.26 0.19 11.24 8.62 266.20 223.75 3.33 0.90 0.45 0.14
41

IRADDI and KAJJIDONI
Table 2. contd….
Seed index (g)
2.5% span length
(mm)
Uniformity ratio (%)
Fibre strength
(g/tex)
Micronaire value
(g/in)
Oil content (%)
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Heterobeltiosis
Standard
Heterosis
Crosses
RAHS-14 AK-235 12.84* 10.29** -5.38** 10.78** -4.31** 11.42** -9.65** 6.19** -30.45** -25.53** 9.46** 3.51
RAHS-14 DLSA-17 19.53** 16.83** -3.89** 16.10** -4.86** 15.78** -43.84** -32.16** -28.84** -23.80** 2.86 3.51
RAHS-14 MDL-2582 6.99** 15.08** -1.17 11.68** 19.05** 26.41** 6.79** 19.85** -27.68** -22.56** 8.50** 1.92
RAHS-14 MDL-2601 17.74** 15.08** -3.03** 9.03** -7.95** 6.90** -6.73** 1.56** -44.73** -40.82** 6.10* 0.00
KS-16 AK-235 -0.03 7.67** -5.57** 10.56** -6.21** 9.21** -8.64** 7.38** -32.27** -34.80** 3.27 0.96
KS-16 DLSA-17 8.47** 16.83** 4.64** 26.40** -12.78** 6.68** -4.50** 15.35** -28.50** -31.17** 1.90 2.56
KS-16 MDL-2582 8.87** 17.26** 4.30** 17.86** 4.52** 10.98** 11.02** 24.59** -8.14** -11.57** 1.63 -0.64
KS-16 MDL-2601 4.60** 12.66** 11.99** 25.92** -13.05** 0.97** 16.55** 26.91** -2.28* -5.93** 4.90* 2.56
RDC-53 AK-235 17.17** 13.23** 10.75** 29.67** 7.05** 24.65** 8.68** 27.74** -19.31** -24.09** -2.32 -5.75*
RDC-53 DLSA-17 15.48** 11.60** -2.874** 17.37** -7.16** 12.91** -0.80 19.82** -13.31** -18.45** -12.06** -11.50**
RDC-53 MDL-2582 12.82** 21.36**
10.67** 25.06** 25.46** 33.22** 14.37** 28.36** -10.47** -15.77** -5.30* -8.63**
RDC-53 MDL-2601 18.19** 14.21** 11.64** 25.52** 4.25** 21.06** 17.88** 28.36** -29.27** -33.46** 6.20* 2.56
RDC-88 AK-235 3.92** 13.55** 0.34 17.48** 2.91** 19.83** 4.81** 23.19** -14.34** -20.65** 2.70 -2.88
RDC-88 DLSA-17 -0.26** 8.98** 4.33** 26.03** 7.53** 30.78** 6.73** 28.93** -27.14** -32.50** 1.27 1.92
RDC-88 MDL-2582 -1.06** 8.11** 9.64** 23.90** 12.89** 20.03** 7.83** 23.81** -4.28** -45.60** 6.92** -1.28
RDC-88 MDL-2601 -0.32** 8.92** 9.47** 23.08** -5.56 9.67** 7.62** 23.57** -23.94** -29.54** 6.78** 0.64
SE+ 0.11
0.06 0.24 0.17 0.13 0.07 0.13 0.11 0.07 0.06 0.49 0.38
CD at 5 % 0.25
0.12 0.49 0.36 0.26 0.14 0.28 0.24 0.15 0.12 1.03 0.81
42

A COMPARATIVE STUDY ON HETEROSIS FOR PRODUCTIVITY
REFERENCES
Bhatade, S. S. 1983. Environmental influence on the magnitude of heterosis in G. arboreum
L. Indian Journal of Agricultural Science. 53 (8): 627-633.
Kajjidoni, S. T. 1997. Histological basis of genetic male sterility and its utilization in hybrid
development in diploid cottons. Ph. D. Thesis submitted to University of Agricultural
Sciences, Dharwad.
Kempthrone, O. 1957. An Introduction to Genetic Statistics. John Wiley and Sons, 1 st Edn.,
New York, USA. pp. 456-471.
Laxman, S and Ganesh, M. 2003. Combining ability for yield components and fibre characters
in cotton (Gossypium hirsutum L.). The Journal of Research ANGRAU. 31 (4): 19-23.
Manickam, S and Gururajan, K. N. 2004. Combining ability analysis for fibre quality in upland
cotton (Gossypium hirsutum L.). Journal of Indian Society for Cotton Improvement.
29 (2): 86-91.
Neelima, S. 2002. Heterosis and combining ability analysis for yield and yield components in
cotton (Gossypium hirsutum L.). M. Sc. (Agri.) Thesis submitted to Acharya N. G.
Ranga Agricultural University, Hyderabad.
Reddy, A. N. 2001. Heterosis, combining ability and stability analysis of hybrids for yield and
yield components in cotton (Gossypium hirsutum L.). Ph. D. Thesis submitted to
Acharya N. G. Ranga Agricultural University, Hyderabad.
Singh, H., Singh, S and Omprakash, 1995. Heterotic response of ten American cotton hybrids
for some quality traits. Journal of Cotton Research and Development. 9 (1): 13-16.
Tuteja, O. P., Kumar, S., Hasan, H and Singh, M. 2005, Heterosis and interrelationship
between seed cotton yield and qualitative characters in upland cotton (Gossypium
hirsutum L.). Indian Journal of Agricultural Science. 75 (3): 167-171.
43

J.Res. ANGRAU 37(3&4)44-51, 2009
DIVERSITY OF WEEDS IN THE SORGHUM (Sorghum bicolor (L.)
Moench.) FIELDS OF ANDHRA PRADESH
P. KIRAN BABU, M. ELANGOVAN and J. S. MISHRA
Directorate of Sorghum Research (DSR)
Rajendranagar, Hyderabad – 500030, AP
ABSTRACT
The study was conducted during 2007-2009 to identify major weeds of sorghum in different regions
of Andhra Pradesh. Results revealed that the fields were infested with 105 weed species. They belonged to 82
genera and 32 families of which 90 were dicotyledons and 15 monocotyledons. The dominant weed of the
regions belonged to the families amaranthaceae, poaceae, fabaceae, asteraceae, euphorbiaceae and
solanaceae of the regions, Celosia argentea, Digera muricata, Trichodesma indicum, Euphorbia hirta, Tribulus
terrestris, Parthenium hysterophorus, Chloris inflata, Portulaca oleracea, Boerhavia diffusa and Cleome viscosa
were dominant weeds. The most dominant weed species in Rayalaseema region were Digera muricata
(37.87), Celosia argentea (32.85), and Cleome viscosa (21.20). In the Telangana region dominant species
were Digera muricata (42.49), Celosia argentea (38.01) and Parthenium hysterophorus (22.61). In Coastal
Andhra, the dominant species were Digera muricata (41.38), Cleome viscosa (33.06) and Portulaca oleracea
(30.48).
Sorghum (Sorghum bicolor (L.) Moench) is an important cereal crop grown in rainy
and post rainy seasons in semi-arid regions of the country on the marginal lands. In India,
the crop is mostly grown in Maharashtra, Karnataka, Andhra Pradesh, Madhya Pradesh,
Rajasthan, Uttar Pradesh, Gujarat and Tamil Nadu. In Andhra Pradesh, sorghum is cultivated
mainly in Rayalaseema and Telangana zones during the rainy season and in coastal plains
during post – rainy season as rice fallows. The sorghum fields of these zones are infested
heavily with large number of weeds, causing heavy losses to the crop yields. Uncontrolled
weeds in sorghum reduces crop yield by 15-65% depending on the nature and intensity of
weed flora, agro-ecological situations and management practices (Okafor and Zitta, 1991
and Mishra, 1997). The losses due to weeds are more during rainy than post-rainy season.
The nature and intensity of weed flora varies depending on agro – ecological conditions and
management practices. To develop effective and economical weed management practices
in sorghum, it is necessary to identify the weed flora, their nature and intensity. Hence, the
present investigation was undertaken to study the diversity of weeds in sorghum in different
regions of Andhra Pradesh.
MATERIALS AND METHODS
The study was carried during 2007-2009 to identify major weeds of sorghum in different
regions of Andhra Pradesh The state of Andhra Pradesh has 23 districts which are grouped
into three zones: 1). Circar or Coastal Andhra comprising the districts of Srikakulam,
Vijayanagaram, Visakhapatnam, East Godavari, West Godavari, Krishna, Guntur, Prakasam
E-mail: elangovan@sorghum.res.in
44

DIVERSITY OF WEEDS IN THE SORGHUM
and Nellore. 2). Rayalaseema region consists of Kurnool, kadapa, Anantapur and Chittoor
districts and 3). Telangana region includes Adilabad, Hyderabad, Karimnagar, Khammam,
Mahbubnagar, Medak, Nalgonda, Nizamabad, Rangareddy and Warangal districts. The
diversity of weeds in the sorghum fields in all the three regions was studied. All the weeds
encountered in the sorghum fields of each district. In each district having 3-5 field site
villages. In Rayalaseema, Kurnool (Nandikotkur, Nandyal, Atmakur, Kodumur, Yemmiganur),
Kadapa (Badvel, B.Matam, Pulivendula, Jyothi, Rayachoti), Chittoor (Kanipakam, Puttur,
Kambakkam, Satyavedu, Mangalam), Anantapur (Uravakonda, Peddamushtur, Tadipatri,
Gorantla, Vajrakarur). In Telangana region Mahbubnagar (Appapur, vanaparthi, Kollapur, Ija,
Mannanur), Hyderabad (Rajendranagar, Shamsabad), Warangal (Hanmakonda, Khazipet,
Pakal, Warangal). In Coastal Andhra, Prakasam (Giddalur, Kambam, Markapuram, Dornala,
Podili), Nellore (Atmakur, B.Palem, Somasila), Guntur (Macherla, Karempudi, Vinugonda,
Sattenapalli), East Godavari (Draksharamam, Yanam, Ramachandrapuram, Mummidivaram),
Srikakulam (Amudalavalasa, Vemulada, Tekkali, Ichapuram). All the weeds encountered in
the sorghum fields were carefully collected and identified. Random quadrat method was
adopted for studying phyto-sociological attributes of weeds. In each field site quadrat of 1m
x 1m was laid down in each village and a sum of 20 quadrats for each region. These studies
were carried in the flowering stage of the crop.
Vegetation composition was evaluated by analyzing the frequency, density and
Importance Value Index (IVI) according to Mishra (1968) and Curtis and McIntosh (1950). IVI
(Importance Value Index) = Relative Density + Relative Frequency + Relative Dominance.
All the weeds from each quadrat were collected separately in polythene bags. Every
specimen was carefully studied regarding vegetative and reproductive features. Provisional
identification was made following ‘Flora of Presidency of Madras’ (Gamble and Fischer,
1915-1935) and other state, regional and local floras. All the plant families were arranged in
sequence following Bentham and Hooker’s classification (1862-83) with certain exceptions
to accommodate recent modifications adopted after Cronquist (1968).
RESULTS AND DISCUSSION
A total number of 105 weeds species belonging to 82 genera and 32 families were
recorded, of which 90 were dicotyledonous and 15 monocotyledonous species. Six families
amaranthaceae, poaceae, fabaceae, asteraceae, euphorbiaceae and solanaceae were
represented by more than 5 weed species. In Andhra Pradesh, the major weeds were Digera
muricata, Trichodesma indicum, Celosia argentea, Euphorbia hirta, Parthenium hysterophorus,
Tribulus terrestris, Commelina benghalensis, and Cyperus rotundus. A critical study on the
flora of Andhra Pradesh (Pullaiah,1997; Pullaiah and Alimoulali, 1997; Pullaiah and Chennaiah,
1997) revealed the presence of 715 taxa as weeds in crop fields of the state. The weeds of
sorghum comprised of 14.68% of the total weeds encountered in the state crop fields.
45

BABU et al.
Results depicted in table.1 show the acquired density of weeds in these regions.
Euphorbia hirta (1.95 plants/m 2 ) followed by Digera muricata (1.9 plants/m 2 ) Portulaca oleracea
(1.8 plants/m 2 ) and were dominant in the Rayalaseema region. Where as Euphorbia hirta
(2.15 plants/m 2 ), Digera muricata (2.05 plants/m 2 ), and Portulaca oleracea (1.95 plants/m 2 ) in
the Telangana region and Portulaca oleracea (2.10 plants/m 2 ), Euphorbia hirta (2.0 plants/
m 2 ) and Digera muricata (1.80 plants/m 2 ) in the Coastal Andhra region maximum density
were recorded.
The Important Value Index was 37.87 for Digera muricata, 32.87 for Celosia argentea,
and 21.20 for Cleome viscosa in Rayalaseema region. Whereas in Telangana region dominance
of Digera muricata (42.49), Celosia argentea (38.01) and Parthenium hysterophorus (22.61)
was observed. In Coastal Andhra, the dominant species were Digera muricata (41.38),
Cleome viscosa (33.06) and Portulaca oleracea (30.48). These results shows that Digera
muricata in three regions, Celosia argentea in Rayalaseema amd Telangana region, Cleome
viscosa in Rayalaseema and Coastal Andhra were dominant in the sorghum fields. Based on
the presence of weeds in sorghum fields of Rayalaseema having 102 species, Telangana
103 species and coastal Andhra 94 species, these results show that Telangana region weed
infestation was very high it may be due to the availability of abundant nutrient content less
competition with sorghum plants. Telangana region is heavily infected and Coastal Andhra is
low and Rayalaseema is medium.
REFERENCES
Bentham, G and Hooker, J. D. 1862-1883. Genera Plantarum. 3 vols. London.
Cronquist, A. J. 1968. The Evolution and Classification of Flowering plants. London.
Curtis, J. T and Mclntosh, R. P. 1950. The interrelationships of certain analytic and synthetic
phytosociological characters. Ecology 31 : 434-455.
Gamble, J. S and Fischer, C. E. C. 1915-35. Flora of the Presidency of Madras. London
(repr. ed. 1957, Calcutta).
Mishra, J.S. 1997. Critical period of crop – weed competition and losses due to weeds in
major field crops. Farmers and Parliament. XXXIII (6) : 19-20.
Misra, R. 1968. Ecology Workbook. Oxford and IBH Publishing Company Ltd., New Delhi.
Okafor, L.I and Zitta, C. 1991. The influence on nitrogen on sorghum weed competition in the
tropics. Tropical Pest Management. 37 (2) : 138-143.
Pullaiah, T. 1997. Flora of Andhra Pradesh, India. Vol.III. Scientific publishers, Jodhpur.
Pullaiah, T and Alimoulali, D.A. 1997. Flora of Andhra Pradesh, India. Volume. II. Scientific
Publishers, Jodhpur.
Pullaiah, T and Chennaiah, E. 1997. Flora of Andhra Pradesh, India. Volume. I. Scientific
Publishers, Jodhpur.
46

DIVERSITY OF WEEDS IN THE SORGHUM
Table1. Weed density and Importance value Index
Sl. Name of the taxon Family Rayala Telangana Coastal
No. seema Andhra
D IVI D IVI D IVI
1. Cleome aspera Koenig ex DC. Cleomaceae 0.6 2.16 0.4 1.17 0.75 3.67
2. C. viscosa L. Cleomaceae 1.4 21.20 1.25 16.63 1.6 33.06
3. Hybanthus enneaspermus(L.) F.Muell. Violaceae 0.95 7.99 0.6 3.48 0.4 2.18
4. Polygala elongata Klein ex Willd. Polygalaceae 1.05 5.26 0.95 4.36 0.6 2.59
5. Portulaca oleracea (L.) Portulacaceae 1.8 18.95 1.95 21.34 2.1 30.48
6. P. quadrifida L. Portulacaceae 0.95 6.05 0.85 4.88 0.55 2.92
7. Sida acuta Burm. f., Malvaceae 1.05 15.61 1.15 17.99 0.85 12.72
8. S. cordata (Brum.f.) Borssum Walkes Malvaceae 0.75 6.68 0.85 8.16 0.4 2.68
9. Melochia corchorifolia (L.) Sterculiaceae 0.6 6.74 1.15 22.24 0.95 19.30
10. Waltheria indica (L.) Sterculiaceae 0.45 3.31 0.45 3.22 0.35 2.57
11. Corchorus aestuans (L.) Tiliaceae 0.55 6.86 0.55 6.67 0.35 3.62
12. C. trilocularis (L.) Tiliaceae 0.65 9.38 0.75 11.93 0.55 8.30
13. Tribulus terrestris (L.) Zygophyllaceae 1.6 20.79 1.45 16.81 0.45 2.65
14. Alysicarpus bupleurifolius (L.) DC. Fabaceae 0.9 4.09 1.05 5.14 0.65 2.93
15. Indigofera linifolia (L.f.) Retz. Fabaceae 0.6 2.16 0.65 2.39 0.4 1.42
16. I. linnaei Ali Fabaceae 0.9 4.09 0.8 3.31 0.95 5.37
17. Macroptilium atropurpureum (DC.) Urb. Fabaceae 0.3 0.96 0.25 0.72 - -
18. Rhynchosia minima (L.) DC. Fabaceae 0.6 2.80 0.65 3.11 0.5 2.50
19. Tephrosia pumila (Lam.) Pers. Fabaceae 0.45 3.98 0.5 4.69 0.35 3.07
20. T. purpurea (L.) Pers. Fabaceae 0.65 9.38 0.55 6.67 0.45 5.73
21. Vigna aconitifolia (Jacq.) Marechal Fabaceae 0.5 2.62 0.45 2.15 0.1 0.29
47

BABU et al.
Table 1. contd...
Sl. Name of the taxon Family Rayala Telangana Coastal
No. seema Andhra
D IVI D IVI D IVI
22. Cassia pumila Lam. Caesalpiniaceae 0.15 0.41 0.1 0.24 0.15 0.49
23. Mimosa pudica (L.) Mimosaceae 0.1 0.36 0.05 0.13 0.65 11.36
24. Ammania baccifera (L.) var. baccifera Lythraceae - - - - 0.2 1.77
25. Citrullus colycinthus (L.) Schrad. Cucurbitaceae 0.6 11.17 0.45 6.29 0.1 0.54
26. Coccinia grandis (L.) Voight. Cucurbitaceae 0.45 3.98 0.4 3.14 - -
27. Cucumis melo (L.) Cucurbitaceae 0.2 1.47 0.35 3.94 0.1 0.54
28. C. sativus (L.) Cucurbitaceae 0.3 3.49 0.45 7.25 0.15 1.21
29. Mollugo nudicaulis Lam. Molluginaceae 0.6 1.67 0.75 2.25 0.45 1.35
30. M. pentaphylla (L.) Molluginaceae 0.65 1.87 0.4 0.96 0.25 0.64
31. Centella asiatica (L.,) Urban Apiaceae - - - - 0.4 1.42
32. Borreria articularis (L.f.) F. Will. Rubiaceae 0.5 4.82 0.55 5.58 0.25 1.71
33. B. pusilla (Wall.) DC. Rubiaceae 0.95 15.93 0.75 9.91 0.7 10.85
34. Hedyotis corymbosa (L.) Lam. Rubiaceae 0.65 1.87 0.6 1.64 0.5 1.55
35. H. puberula (G.Don) Arn. Rubiaceae 0.6 2.16 0.45 1.38 0.65 2.93
36. Ageratum conyzoides (L.) Asteraceae 0.6 5.54 0.85 10.21 0.55 5.72
37. Blumea mollis D.Don) Merr. Asteraceae 0.2 0.73 0.25 1.01 0.4 2.86
38. Echinops echinatus Roxb. Asteraceae 0.45 3.98 0.45 3.87 0.35 3.07
39. Eclipta prostrata (L.) L. (= E. alba) Asteraceae 0.25 1.21 0.1 0.29 0.6 6.69
40. Parthenium hysterophorus (L.) Asteraceae 1.35 15.16 1.7 22.61 1.3 17.10
41. Tridax procumbens (L.) Asteraceae 1.15 11.30 1.4 15.76 1.25 15.91
42. Vernonia cineria (L.,) Less. Asteraceae 0.9 11.69 0.75 8.10 0.8 11.36
43. Xanthium strumarium (L.) Asteraceae 0.1 0.61 0.05 0.19 - -
44. Catheranthus pusillus (Murr.) G. Apocyanaceae 0.4 2.69 0.55 4.61 - -
48

DIVERSITY OF WEEDS IN THE SORGHUM
Table 1. contd...
IVI
Coastal
Andhra
45. Calotropis gigantia (L.) R. Br. Asclepiadaceae 0.1 1.03 0.1 1.00 0.05 0.36
46. C. procera (W.T. Aiton) R. Br. Asclepiadaceae 0.15 2.01 0.25 5.16 0.1 1.15
47. Coldenia procumbens (L.) Boraginaceae 0.2 0.62 0.15 0.41 0.15 0.49
48. Heliotropium indicum (L.) Boraginaceae 0.25 1.42 0.2 0.95 0.3 2.34
49. H. ovalifolium Forssk. Boraginaceae 0.35 2.13 0.35 2.08 0.1 0.35
50. Trichodesma indicum (L.) R.Br. Boraginaceae 1.6 15.28 1.85 19.37 1.45 15.45
51. Evolvulus alsinoides (L.) Convolvulaceae 0.95 2.35 0.9 2.16 1 2.99
52. Ipomoea pes-tigridis (L.) Convolvulaceae 0.2 0.62 0.35 1.43 - -
53. Merremia gangetica (L.) Cufod. Convolvulaceae 0.95 4.47 1.05 5.14 0.65 2.93
54. M. tridentata (L.) Hallier f. Convolvulaceae 0.7 2.07 0.6 1.64 0.75 2.73
55. Datura metel (L.) Solanaceae 0.25 2.49 0.3 3.39 0.05 0.20
56. D. stramonium (L.) Solanaceae 0.1 0.45 0.15 0.87 - -
57. Physalis minima (L.) Solanaceae 0.15 0.79 0.1 0.40 0.1 0.49
58. Solanum nigrum (L.) Solanaceae 0.25 1.42 0.25 1.38 0.55 6.94
59. S. surattense Burm. Solanaceae 0.8 9.39 0.65 6.23 - -
60. Scoparia dulcis (L.) Scrophulariaceae 0.1 0.22 0.05 0.09 0.25 0.88
61. Striga asiatica (L.) O. Kuntze Scrophulariaceae 0.65 2.44 0.6 2.12 0.4 1.42
62. S. gesneroides (Willd.) Vatke Scrophulariaceae 0.25 0.73 0.15 0.36 - -
63. Verbascum chinense (L.) Santapau Scrophulariaceae 0.25 1.21 0.25 1.18 0.05 0.14
64. Sesamum alatum Thonn. Pedaliaceae 0.2 0.84 0.15 0.53 - -
65. Asystasia gangetica (L.) T. Acanthaceae - - 0.05 0.10 0.35 1.76
66. Indoneesiella echioides (L.) Sreemadh. Acanthaceae 0.35 2.54 0.45 3.87 0.45 4.81
67. Lepidagathis cristata Willd. Acanthaceae 0.15 0.37 0.15 0.36 - -
49

BABU et al.
Table 1. contd...
IVI
Coastal
Andhra
68. Rungia repens Nees Acanthaceae 0.35 0.99 0.45 1.38 0.55 2.27
69. Hyptis suaveolens (L.) Poit. Lamiaceae 0.2 1.47 0.35 3.94 0.1 0.54
70. Leucas aspera (willd.) Link Lamiaceae 0.55 3.08 0.65 3.99 0.4 2.18
71. L. cephalotes (Roth) Spreng. Lamiaceae 0.65 4.10 0.75 5.12 0.45 2.65
72. Ocimum americanum (L.) Lamiaceae 0.7 3.60 0.6 2.73 0.3 1.14
73. Boerhavia diffusa L. Nyctaginaceae 1.45 17.31 1.35 14.74 1.2 14.76
74. B. erecta (L.) Nyctaginaceae 0.6 2.80 0.45 1.73 0.25 0.88
75. Achyranthus aspera (L.) Amaranthaceae 0.7 8.97 0.45 3.87 0.3 2.34
76. Aerva javanica (Burm.f.) Juss. Amaranthaceae 0.15 0.47 0.1 0.26 - -
77. A. lanata (L.,) A.L. Juss. Amaranthaceae 0.4 1.81 0.35 1.43 0.55 3.71
78. Allmania nodiflora (L.,) R.Br. Amaranthaceae 0.65 3.19 0.6 2.73 0.45 2.12
79. Alternanthera pungens Kunth, Amaranthaceae 0.85 5.00 0.95 5.90 0.55 2.92
80. A. sessilis (L.) R.Br. Amaranthaceae 1.05 9.58 0.85 6.38 0.95 9.66
81. Amaranthus viridis (L.) Amaranthaceae 1.3 14.14 1.15 10.98 1 10.59
82. Celosia argentea (L.) Amaranthaceae 1.05 32.85 1.15 38.01 0.55 11.47
83. Digera muricata (L.) C. Martius, Amaranthaceae 1.9 37.87 2.05 42.49 1.8 41.38
84. Gomphrena serrata (L.) Amaranthaceae 0.45 2.20 0.35 1.43 0.35 1.76
85. Acalypha indica (L.) Euphorbiaceae 0.25 1.03 0.4 2.17 0.3 1.66
86. Croton bonplandianum Baill. Euphorbiaceae 0.75 5.25 0.95 7.78 0.65 4.94
87. Euphorbia hirta (L.) Euphorbiaceae 1.95 15.27 2.15 17.69 2 19.29
88. Phyllanthus amarus Schum. & Thonn. Euphorbiaceae 0.6 1.67 0.5 1.28 0.45 1.35
89. P. maderaspatensis (L.) Euphorbiaceae 0.3 0.80 0.15 0.32 0.25 0.74
90. Tragia involucrata (L.) Euphorbiaceae 0.45 2.20 0.35 1.43 0.5 3.16
50

DIVERSITY OF WEEDS IN THE SORGHUM
Table 1. contd...
IVI
Coastal
Andhra
91. Commelina benghalensis (L.) Commelinaceae 0.95 10.29 0.9 9.06 1.15 17.74
92. Cyanotis fasciculata (Roth.) Commelinaceae 0.6 4.48 0.85 8.16 1.1 16.33
Schultes& Schultes
93. Tonningia axillaris (L.,) O. Kuntze, Commelinaceae 0.75 6.68 0.7 5.74 0.95 12.44
94. Cyperus compressus (L.) ssp. Cyperaceae 0.2 0.84 0.25 1.18 0.9 14.15
compressus
95. C. difformis (L.) Cyperaceae 0.35 1.46 0.35 1.43 0.55 3.71
96. C. rotundus (L.) Cyperaceae 0.45 2.20 0.55 3.00 0.7 5.62
97. Apluda mutica (L.) Poaceae 0.95 6.05 1.05 7.02 0.75 4.87
98. Aristida hystrix (L.) Poaceae 0.65 2.44 0.6 2.12 0.5 1.97
99. Arundinella setosa Trin.Gram. Poaceae 0.7 4.66 0.55 3.00 0.45 2.65
100. Chloris inflata Link. Poaceae 1.45 12.79 1.35 10.94 1.6 18.47
101. Chrysopogon fulvus (Sprengel) Chiov. Poaceae 0.65 3.19 0.9 5.38 0.6 3.36
102. Heteropogon contortus (L.) P. Beauv. Poaceae 0.65 3.19 0.75 3.95 0.35 1.44
103. Perotis indica (L.) O. Kuntze. Poaceae 1.15 4.32 0.95 3.17 0.4 1.16
104. Setaria verticillata (L.) Beauv. Poaceae 0.55 2.43 0.4 1.44 0.45 2.12
105. Urochloa panicoides P. Beauv. Poaceae 0.25 0.73 0.35 1.18 0.3 1.14
D = Density, IVI = Importance Value Index
51

J.Res. ANGRAU 37(3&4)52-58, 2009
EFFECT OF INCREMENTAL DOSE OF PHOSPHORUS IN RICE ON
THE YIELD OF BLACKGRAM IN RICE (Oryza sativa) – BLACKGRAM
(Phaseolus mungo) CROPPING SEQUENCE
I. USHA RANI and V. SANKAR RAO
Department of Soil Science, Agricultural College
Acharya N.G.Ranga Agricultural University, Bapatla – 522101
ABSTRACT
A field experiment on rice-black gram relay cropping was conducted at Agricultural College Farm,
Bapatla during 2004-05 to study the need of additional dose of phosphorus for the system over the recommended
dose of 60 kg P 2
O 5
ha -1 to rice. The soil was sandy loam in texture. It was low in available nitrogen (218 kg ha -
1
), medium in available P 2
O 5
(23.2 kg ha -1 ) and rich in available K 2
O (407 kg ha -1 ). The results indicated that the
additional dose of 10, 20 or 30 kg P 2
O 5
ha -1 at tillering and 10, 20 or 30 kg P 2
O 5
ha -1 at primordial initiation stage
significantly increased the soil available phosphorus at maturity stage of rice but there was no effect on soil
available N, K, Fe, Cu, Zn and Mn. There was no direct effect on additional dose of phosphorus on grain or
straw yield of rice but its residual effect significantly increased the seed and haulm yield of black gram. The
most beneficial effect was to apply additional 20 kg P 2
O 5
ha -1 at primordial initiation stage of rice for maximum
productivity with the added advantage of substantial improvement in soil available nitrogen and phosphorus
from the initial 218 to 287 kg N ha -1 and 23.2 kg P 2
O 5
to 38.6 kg P 2
O 5
ha -1 but the soil available potassium
reduced from the initial 407 kg to 369 kg K 2
O ha -1 . The Fe, Cu, Zn and Mn content also recorded slight
reduction.
Relay cropping of black gram in rice on residual moisture and fertility is a common
practice in Krishna- Godavari agro climatic zone of Andhra Pradesh. Fertilizer recommendations
are based on the nutrient requirement of individual crops. The dynamics of nutrient availability
is ignored. Among the major nutrients phosphorus is highly expensive and its utilization by
the crops is often low as it gets immobilized. However, substantial quantity of this nutrient in
the puddled rice fields is available in the soluble form after the harvest of the crop (Gill and
Meelu 1983 and Kundu et al. 1986). Residual nutrient is best exploited by the leguminous
crops for their better root development, nodule formation and nitrogen fixation. Information is
not available on the quantity of phosphorus application to rice which exhibit maximum residual
influence on the performance of relay cropped black gram. Hence, this experiment was
conducted.
MATERIALS AND METHODS
A Field experiment was conducted during 2004-05 at Agricultural college farm,
Bapatla. The soil was sandy loam in texture and the pH was 7.92. It was low in fertility with
0.38 percent organic carbon, 218 kg ha -1 available nitrogen, and medium (23.2 kg P 2
O 5
ha -1 )
E-mail: ineediu@gmail.com
52

EFFECT OF INCREMENTAL DOSE OF PHOSPHORUS IN RICE
in available phosphorus but high in potassium with 407 kg K 2
O ha -1 and the layout was RBD.
There were seven treatments which included the basal application of phosphorus to rice at
60 kg P 2-
O 5
ha -1 with the additional quantity of 10, 20 and 30 kg P 2-
O 5
ha -1 applied at tillering
and primordial initiation stage. A uniform dose of 120 kg nitrogen, 60 kg P 2
O 5
and 60 kg K 2
O
ha -1 was applied to the crop. Entire dose of P and K with 1/3 rd dose of nitrogen was applied
as basal. Rest of the nitrogen was top dressed in two equal splits at maximum tillering and
panicle initiation stage. Rice nursery of variety BPT 5204 was transplanted on 28 th August
2004 and harvested on 4 th December 2004. The seed of black gram variety LBG-645 was
broadcast four days before the harvest of rice and allowed to grow on the residual moisture
and fertility. Initial soil sample and those from different treatments in the rice field at the time
of sowing black gram and after the harvest of this relay crop were analyzed by following
standard procedures (Jackson, 1973).
RESULTS AND DISCUSSIONS
Performance of rice:
The data on soil available nutrients after the harvest of rice due to the influence of
different treatments is presented in Table 1. The results showed that the soil available N
increased from the initial 218 kg ha -1 to 264 kg ha -1 at the time of harvest in response to the
application of recommended dose of fertilizers. The soil available phosphorus increased
almost twice. The initial test value was 23.2 kg P 2
O 5
ha -1 while it is increased to 44.9 kg P 2
O 5
ha -1 at the time of harvest. On the other hand the soil available potassium reduced from the
initial 407 kg K 2
O ha -1 to 390 kg K 2
O ha -1 . The initial test values of micronutrients of Fe, Cu,
Zn and Mn are in the range of 9.58 ppm, 3.68 ppm, 234 ppm and 40.2 ppm, respectively and
they also tended to reduce sharp. The additional dose of 10, 20 and 30 kg P 2
O 5
ha -1 at
tillering or 10, 20 and 30 kg P 2
O 5
ha -1 at primordial initiation stage significantly increased the
soil available phosphorus compared to the availability due to the application of recommended
dose of 60 kg P 2
O 5
ha -1 . The enrichment of soil available phosphorus was not fixed nor it was
entirely absorbed by the crop (Singaram and Kothandaraman, 1994). Initial flooding in rice is
also known to decrease the Al-P and Fe-P, which result in more availability of this nutrient
(Tiwari, 2002). The additional dose of phosphorus did not bring a significant change in the
availability of other nutrients compared to the recommended dose of phosphorus.
The grain, straw yield of rice and 1000 grain weight were not altered by the additional
dose of 10, 20 and 30 kg P 2
O 5
ha -1 applied either at tillering or at primordial initiation stage
compared to the recommended dose of 60 kg P 2
O 5
ha -1 (Table 2). This result implied that the
application of 60 kg P 2
O 5
ha -1 to rice is sufficient and the improvement in the soil available
phosphorus content due to the application of additional dose of phosphorus may benefit the
relay crop (Rao, 1975).
53

RANI and RAO
Table 1. Effect of additional dose of phosphorus app lied to rice on the available N, P, K and micronutrient
status after harvest of rice
Recommended
Treatment Nitrogen
(kg ha -1 )
dose of
phosphorus (60 kg P2O5 ha -1 )
as basal
Recommended dose of
phosphorus as basal +10 kg
P2O5 ha -1 at tillering stage
Recommended
dose of
phosphorus as basal +20 kg
P2O5 ha -1 at tillering stage
Recommended dose of
phosphorus as basal +30 kg
P2O5 ha -1 at tillering stage
Recommended dose of
phosphorus as basal +10 kg
P2O5 ha-1 at primordial
initiation stage
Recommended dose of
phosphorus as basal +20 kg
P2O5 ha-1 at primordial
initiation stage
Recommended dose of
phosphorus as basal +30 kg
P2O5 ha-1 at primordial
initiation stage
Phosphorus
(kg P2O5
ha -1 )
Potassium
(kg K2O
ha -1 )
Iron
(ppm)
Copper
(ppm)
Zinc
(ppm)
Manganese
(ppm)
264 44.9 390 9.29 3.49 2.22 39.4
257 51.4 388 9.23 3.45 2.19 38.7
252 56.3 387 9.20 3.42 2.18 38.5
259 62.7 386 9.14 3.37 2.15 37.4
250 53.8 384 9.06 3.33 2.10 37.1
256 58.5 382 9.05 3.31 2.09 36.7
254 64.4 380 8.98 3.23 2.05 35.8
SE± 7.5 3.5 11.5 0.70 0.45 0.04 1.69
CD at 5 % NS 7.5 NS NS NS NS NS
54

EFFECT OF INCREMENTAL DOSE OF PHOSPHORUS IN RICE
Table 2. Effect of additional dose of phosphorus applied to rice on the test weight,
grain and straw yield of rice.
Treatment 1000 Grain Straw
grain yield yield
weight (g) (kg ha- -1 ) (kg ha- -1 )
Recommended dose of phosphorus(60 kg P 2
O 5
14.8 4183 5019
ha -1 ) as basal
Recommended dose of phosphorus as basal+ 15.0 4195 5064
10 kg P 2
O 5
ha -1 at tillering stage
Recommended dose of phosphorus as basal+ 15.2 4220 5117
20 kg P 2
O 5
ha -1 at tillering stage
Recommended dose of phosphorus as basal + 15.3 4242 5172
30 kg P 2
O 5
ha -1 at tillering stage
Recommended dose of phosphorus as basal + 15.1 4257 5228
10 kg P 2
O 5
ha -1 at primordial initiation stage
Recommended dose of phosphorus as basal + 15.3 4276 5271
20 kg P 2
O 5
ha -1 at primordial initiation stage
Recommended dose of phosphorus as basal + 15.4 4299 5318
30 kg P 2
O 5
ha -1 at primordial initiation stage
SE± 0.3 14 14
CD at 5 % NS NS NS
Performance of black gram:
The relay crop black gram transformed the low available nitrogen status of the soil
to medium. This improvement is expected due to the atmospheric nitrogen fixation by legumes
(Thakuria and Saharia, 1990). But, the soil available phosphorus reduced substantially after
the harvest of blackgram compared to the available quantity after the harvest of preceding
rice in all treatments. Hence it is probable that this residual nutrient might have been utilized
by blackgram. Yet the soil was high in available phosphorus in all the treatments than the
initial value (Table 3). The additional dose of 30 kg P 2
O 5
ha -1 at tillering or primordial initiation
stage to rice was not only sufficient to meet the requirement of the two crops but also left
behind substantially large quantity of 38.8 and 41.3 kg P 2
O 5
ha -1 but the potassium, Fe, Cu,
Zn and Mn content were less than the initial level. The additional dose of phosphorus had no
significant influence on any nutrient except phosphorus. Singaram and Kothandaraman (1992)
also reported that the application of higher doses of phosphorus to rice leave behind larger
residues of this nutrient.
55

RANI and RAO
Table 3. Effect of additional dose of Phosphorus app lied to rice on the available N, P, K and micronutrien
statusafter harvest of black gram
Treatment Nitrogen
(kg ha -1 )
Phosphorus
(kg P2O5 ha -1 )
Potassium
(kg K2O ha -1 )
Iron
(ppm)
Copper
(ppm)
Zinc
(ppm)
Manganese
(ppm)
Recommended dose of
phosphorus (60 kg P2O5 ha -1 )
as basal 312 28.7 373 7.63 3.39 1.76 37.9
Recommended dose of
phosphorus as basal +10
kg P 2O5 ha-1 at tillering
stage 305 34.3 372 7.62 3.36 1.75 37.2
Recommended dose of
phosphorus as basal +20
kg P 2O5 ha-1 at tillering
stage 297 37.9 371 7.69 3.33 1.75 37.1
Recommended dose of
phosphorus as basal +30
kg P 2O5 ha-1 at tillering
stage 292 38.8 370 7.61 3.29 1.74 36.0
Recommended dose of
kg P2O5 ha -1 at primordial
kg P2O5 ha -1 at primordial
phosphorus as basal +10
kg P2O5 ha -1 at primordial
initiation stage 293 35.1 369 7.59 3.25 1.71 35.8
Recommended dose of
phosphorus as basal +20
initiation stage 287 38.6 369 7.60 3.23 1.71 35.4
Recommended dose of
phosphorus as basal +30
initiation stage 283 41.3 368 7.56 3.17 1.69 34.6
SE± 9.8 1.3 11.3 0.07 0.05 0.07 1.69
CD at 5 % NS 2.8 NS NS NS NS NS
56

EFFECT OF INCREMENTAL DOSE OF PHOSPHORUS IN RICE
Black gram produced significantly larger quantity of seed and haulm yield in response
to the additional dose of 10, 20 and 30 kg P 2
O 5
ha -1 applied to the preceding crop of rice at
tillering or primordial initiation stage (Table 4). Maximum residual advantage was harvested
by the application of additional 30 kg P 2
O 5
ha -1 to rice at primordial initiation stage. Black
gram produced grain yield of 984 kg ha -1 and haulm yield of 1828 kg ha -1 . This was on par
with the response due to the additional 20 kg P 2
O 5
ha -1 applied to rice at primordial initiation
stage. Its residual effect enabled the black gram crop to yield 973 kg ha -1 grain and 1783 kg
ha -1 haulm yield. Patel and Thakur (1997) also obtained significant yield response owing to
substantial improvement in grain parameters of black gram owing to the increased availability
of phosphorus in the soil and its absorption by the crop.
That is else to highlight the need to apply additional 20 kg P 2
O 5
ha -1 at primordial
initiation stage in puddled rice to enhance the residual effect in increasing the grain yield of
relay cropped black gram in sandy loam soil medium in available phosphorus status.
Table 4. Effect of additional dose of Phosphorus applied to rice on the seed and
haulm yield of black gram
Treatment Seed yield Haulm yield
(kg ha -1 ) (kg ha -1 )
Recommended dose of phosphorus(60 kg P 2
O 5
ha -1 )
as basal 845 1454
Recommended dose of phosphorus as basal +
10 kg P 2
O 5
ha -1 at tillering stage 898 1580
Recommended dose of phosphorus as basal +
20 kg P 2
O 5
ha -1 at tillering stage 937 1686
Recommended dose of phosphorus as basal +
30 kg P 2
O 5
ha -1 at tillering stage 951 1735
Recommended dose of phosphorus as basal +
10 kg P 2
O 5
ha -1 at primordial initiation stage 936 1691
Recommended dose of phosphorus as basal +
20 kg P 2
O 5
ha -1 at primordial initiation stage 973 1783
Recommended dose of phosphorus as basal +
30 kg P 2
O 5
ha -1 at primordial initiation stage 984 1828
SE± 20 41
CD at 5% 42 87
57

RANI and RAO
REFERENCES
Gill, H.S and Meelu, O.P. 1983. Studies on utilization of P and causes for its differential
response to rice-wheat. Plant and Soil. 74: 211-222.
Jackson, M.L.1973. Soil Chemical Analysis. Prentice- Hall of India pvt. Ltd., New Delhi. pp:
40.
Kundu, S., Kamath, M.B and Goswami, N.N.1986. Evaluation of residual effect of phosphate
in rice-wheat-blackgram-rice cropping sequence using 32 P as a tracer. Journal of Nuclear
and Agricultural Biology. 15(2): 115-119.
Patel, S.R and Thakur, D.S. 1997. Influence of phosphorus and rhizobium on yield attributes,
yield and nutrient uptake of groundnut (Arachis hypogea L.). Journal of Oil Seeds
Research. 14(2): 189-193.
Rao, I.V.S. 1975. Nutritional disorder of crops in Andhra Pradesh. Andhra Pradesh Agricultural
University Publication, Hyderabad, Andhra Pradesh.
Singaram, P and Kothandaraman, G.V. 1992. Residual effect of different phosphatic fertilizers
on available phosphorus of soil in a cropping sequence. Journal of Indian Society of
Soil Science. 40: 213-215.
Singaram, P and Kothandaraman, G.V. 1994 Studies on residual, direct and cumulative
effect of phosphorus sources on the availability, content, and uptake of phosphorus
and yield of maize. Madras Agricultural Journal. 81 (8): 425-429.
Thakuria, K and Saharia, P. 1990. Response of green gram genotypes to plant density and
phosphorus levels in summer. Indian Journal of Agronomy. 35(4): 431-432.
Tiwari, K.N. 2002 Phosphorus In: Fundamentals of soil science (Ed. Sekhon G. S.). Indian
Society of Soil Science, New Delhi. pp.353-368.
58

J.Res. ANGRAU 37(3&4)59-64, 2009
PROBABILITY OF OCCURRENCE OF WET AND DRY SPELLS BY
MARKOV CHAIN MODEL AND ITS APPLICATION TO CASTOR
(Ricinus communis L.) CULTIVATION IN RANGA REDDY DISTRICT
M.A.BASITH and SHAIK MOHAMMAD
Department of Agronomy, College of Agriculture
Acharya N.G. Ranga Agricultural University
Rajendranagar, Hyderabad-500 030
ABSTRACT
Initial and conditional probabilities for expected threshold limits of rainfall are provided for different
weeks to plan cultural operations during the growing period of castor in Ranga Reddy district of Andhra
Pradesh. Threshold rainfall of ≥ 20 mm was estimated to be optimum for land preparation as the soils are
partially moist and rainfall of ≥ 15 mm per week between 25th to 26 th standard weeks ensures good germination
of castor. The initial probability of rainfall occurrence during 22 nd and 23 rd weeks was 6 and 9% whereas it was
50 and 62% for the 25 th and 26 th weeks. The probability of rainfall ≥ 10 mm during seedling establishment was
56, 26, 21 and 68% for the 30 th , 31 st , 32 nd and 33 rd weeks. The initial probabilities for occurrence of rainfall during
reproductive phase were 29, 35, 32, 24 and 35% during the 39 th , 40 th , 41 st , 42 nd and 43 rd weeks respectively.
The conditional probabilities for the following weeks to be wet were 100, 92, 73, 100 and 100% respectively.
The initial probability of rainfall for a low threshold limit of 10 mm for the 48 th standard week during starting of
maturity phase was 56% and conditional probability for the subsequent week to be wet was 100%.
Castor (Ricnus communis L.) is an important and the most dependable non-edible
oilseed crop of poor farmers with poor resource base. It has great industrial and commercial
value. It brings considerable amount of foreign exchange to the country. In India, it is cultivated
over an area of 8.70 lakh hectares producing 11.15 lakh tonnes beans. In Andhra Pradesh,
it is cultivated on 1.57 lakh hectares with a production of 0.8 lakh tonnes. The national
productivity of castor is 1282 kg ha -1 while the average yield in A.P. is 510 kg ha -1 (CMIE,
2009).
Andhra Pradesh ranks second in area and production of this crop next only to Gujarat.
In Andhra Pradesh, it is mainly cultivated rainfed in the districts of Nalgonda, Mahbubnagar
and Rangareddy. Andhra Pradesh has a tropical climate with moderate overlapping of
subtropical weather conditions. The normal annual rainfall of the state is 925 mm with major
portion of 68.5% being contributed by South – West monsoon. The state has a history of
droughts of varying degrees in 3 out of 5 years and rainfed farming is prone for risk (Babu
and Padmaja, 2003).
First order Markov chain model gives the information on initial and conditional
probabilities for various threshold limits of rainfall. Under initial probabilities, the probability
E mail: basith@naarm.ernet.in
59

BASITH and MOHAMMAD
of a given period to be wet or dry is estimated while in the case of conditional probabilities,
if given period is wet or dry, then the chances of following week to be wet or dry and given as
wet/wet or wet/dry are estimated. A period is said to be wet when the weather parameter of
that period exceeds a threshold limit.
Markov chain probability model has been extensively used to find out the wet and
dry spells (Victor and Sastry,1979) and for computation of probability of occurrence of daily
precipitation (Stern,1982). Earlier Agarwal et al. (1984), Pandarinath (1991) and Dalabehara
and Sahoo (1993) used Markov chain probability model for dry and wet spell analysis in
terms of shortest period like week and demonstrated its practical utility in agricultural planning.
Such studies are lacking for Ranga Reddy district to plan and execute the agricultural
operations for the cultivation of castor.
MATERIALS AND METHODS
The experimental site selected is a rainfed belt of Ranga Reddy district. It is located
at an altitude of 542.6 m above mean sea level on 17 o 19' North latitude and 78 o 23' East
longitude. In the National Agricultural Research Project Zonation, it comes under the Southern
Telangana region of Andhra Pradesh. The water holding capacity of the soil is 92 mm per
meter depth. Weekly rainfall data for the past 34 years from 1975 to 2008 was collected from
meteorological observatory of Agricultural Research Institute, Rajendranagar, Ranga Reddy
district.
The method of computing initial and conditional probabilities of occurrence of rainfall
using the first order Markov chain model described by Gabriel and Neumann (1962); Gates
and Tong (1976) and Hann et al. (1976) was followed.
Step - 1:
Compute for each week the number of occasions the weekly rainfall of week i (Ri) ≥
the threshold limit x. If this condition is satisfied in ‘n’ years out of the total N years then the
probability of a given week i is wet (Wi) is given as
þWi = (n/N) x 100, % and thus a given week is dry (Di) is given as
þDi = 100 - Wi, %
These estimates present the initial probabilities of a given week i is wet or dry.
Step - 2:
Compute for each week, the number of occasions
R i
≥ x and R i+k
≥ x
60

PROBABILITY OF OCCURRENCE OF WET AND DRY SPELLS
It is seen in step - 1 that of the N years in n years Ri ≥ x in week i and thus if in n’
years out of n years, R ≥ x, then the probability of getting a wet on week i and week i + k,
i+k
namely a wet week followed by a wet week (if k = 1 [cw/w]) is given as
þ(W/W)i = (n’/n) x 100, %
and thus a dry week followed by a wet week, (D/W) is given as
þ(D/W)i = 100 - (W/W)i, %
These two estimates present the conditional probabilities of a wet or dry week (i + 1)
followed by a wet week (i).
Step - 3:
Compute for each week, the number of occasions, R i
< x but R i+k
≥ x.
It is seen in step - 1 that of the N years in N-n years Ri < x in week i and thus in n” years out
of N - n years R i+k
≥ x, then the probability of getting dry spell on week i and wet on week i+k,
namely a wet week followed by a dry week (if k = 1) [(W/D)i ] is given as
þ(W/D)i = [n”/(N-n)] x 100, %
and thus a dry week followed by a dry week. (D/D) is given as
þ(D/D)i = 100 - (W/D)i, %
These two estimates present the conditional probabilities of a wet or dry week (i + 1)
followed by a dry week (i).
RESULTS AND DISCUSSION
The first order Markov chain analysis for the estimates of initial and conditional
probabilities of rainfall occurrence during the crop growing period was worked out to assess
the likely wet and dry weeks for any two consecutive weeks for effective field operations.
The probabilities of rainfall occurrence for minimum threshold rainfall per week
following the Markov chain model during the rainy season for Ranga Reddy district is presented
in table 1. This will help in planning agricultural operations for probable risk alertness. The
initial probability for ≥ 20 mm rainfall due to summer showers in the 22 nd meteorological
standard week is 6%. In the next week, the probability of this limit improved to 9%. The
conditional probability for this week to be followed by wet week is 100%. The sowing season
spans from 2 nd week of June to 2 nd week of July. Rainfall of ≥ 15 mm is considered as the
minimum threshold per week during this period for good germination of seed. The initial
probability for this limit was 50% for the 25th and 62% for 26 th standard week. The conditional
61

BASITH and MOHAMMAD
probabilities for the present and next week to be wet were 100%. The initial probability for ≥
15 mm was 38% in the 27 th standard week but a high probability of 74% was in the 28 th
standard week with a conditional probability of wet-wet being 100%. Rainfall requirement of
≥ 10 mm per week was considered as the threshold limit for the emergence and establishment
of seedlings. The initial probability for this limit was 56, 26, 21 and 68% for the 30, 31, 32 and
33 rd standard weeks. The probability of rainfall occurrence for the threshold limit of ≥ 15 mm
for seedling growth and development was 12, 3 and 68% for 34,35 and 36 th standard weeks.
The conditional probabilities for the two weeks to be wet were 100 and 96% in the 36 and 37 th
standard week. Water requirement of crop increase during the reproductive development and
growth. Threshold limit was, therefore, increased in the subsequent weeks. The initial
probabilities for occurrence of rainfall during the 39 th , 40 th , 41 st , 42 nd and 43 rd weeks were 29,
35, 32, 24 and 35 % respectively. The conditional probabilities for the following weeks to be
wet were 100, 92, 73, 100 and 100 % respectively. The crop water requirement is relatively
low during its maturity and senile phase. Hence, the threshold limit was scheduled ≥ 10 mm
from 48th standard week. The initial probability of this week to be wet was 56% and conditional
probability for the subsequent week to be wet was 100%.
The first order Markov chain analysis for the estimates of initial and conditional
probabilities of minimum threshold rainfall required for castor crop will help in taking up
effective field operations and risk avoidance.
Table 1. First order Markov chain model for initial and conditional probability of
rainfall occurrence for castor in Ranga Reddy district
Date-Month MSW MTRF
(mm)
Initial Conditional probability %
probability %
Wet- Dry- Wetwet
dry Wet Wet Dry
1 2 3 4 5 6 7 8 9
28 May -3 June 22 20 6 94 100 0 15 85
4-10 June 23 20 9 91 100 0 97 3
11-17 June 24 15 9 91 100 0 10 90
18-24 June 25 15 50 50 100 0 55 45
25 June- 1 July 26 15 62 38 100 0 100 0
2-8 July 27 15 38 62 62 38 100 0
9-15 July 28 15 74 26 100 0 100 0
Dry-
Dry
62

PROBABILITY OF OCCURRENCE OF WET AND DRY SPELLS
1 2 3 4 5 6 7 8 9
16-22 July 29 15 3 97 4 96 11 89
23-29 July 30 10 56 44 100 0 58 42
30 July- 5 Aug 31 10 26 74 47 53 60 40
6-12 Aug 32 10 21 79 78 22 28 72
13-19 Aug 33 10 68 32 100 0 85 15
20-26 Aug 34 15 12 88 30 70 36 64
27 Aug- 2 Sep 35 15 3 97 25 75 3 97
3-9 Sep 36 15 68 32 100 0 70 30
10-16 Sep 37 25 56 44 96 4 100 0
17-23 Sep 38 25 12 88 100 0 27 73
24-30 Sep 39 30 29 71 100 0 43 57
1-7 Oct 40 30 35 65 100 0 50 50
8-14 Oct 41 30 32 68 92 8 50 50
15-21 Oct 42 30 24 76 73 27 35 65
22-28 Oct 43 30 35 65 100 0 46 54
29 Oct-4 Nov 44 20 62 38 100 0 77 23
5-11 45 20 32 68 52 48 85 15
12-18 46 20 53 47 100 0 78 22
19-25 47 20 18 82 33 67 38 62
26-2 Dec 48 10 56 44 100 0 46 54
3-9 49 10 76 24 100 0 100 0
10-16 50 10 29 71 38 62 100 0
17-23 51 10 74 26 100 0 100 0
24-31 Dec 52 10 65 35 88 12 100 0
1-7Jan 1 10 3 97 5 95 8 92
MSW : Meteorological standard week;
MTRF : Minimum threshold rainfall
63

BASITH and MOHAMMAD
REFERENCES
Agarwal, A., Singh, R.V and Chauhan, H.S. 1984. Probability of sequences of wet and dry
days in Nainital Tarai Region. Journal of Agricultural Engineering 21 (4): 61-70
Babu, S.N and Padmaja, K. V. 2003. Evaluation of intercropping systems in Ranga Reddy
district of Andhra Pradesh with reference to castor. Indian journal of Dryland Agriculture
and Development. 18 (1): 75-83
CMIE. 2009. Economic intelligence service, agriculture. Centre for Monitoring Indian Economy
Private Limited. www.cmie.com
Dalabehara, M and Sahoo, J. 1993. On the chances of occurrence of wet and dry days at
regional research station, Bhawanipatna of Kalahandi district of Orissa. Indian Journal
of Power and River valley Development.44 (Feb-March): 37-40
Gabriel, K. R and Neumann, J. 1962. A Markov chain model for daily rainfall occurrence at
Tel Aviv. Quarterly Journal Royal Meteorological Society 88: 90-95.
Gates, P. R and Tong, H. 1976. On Markov chain modeling to some weather data. Journal
of Applied Meteorology 15: 1145-1151.
Hann, T., Allen, P. M and Street, J. D.1976. A Markov chain model for daily rainfall. Water
Resources Research 12: 433.
Pandarinath,N.1991. Markov chain model probability of dry and wet weeks during monsoon
periods over Andhra Pradesh. Mausam. 42(4): 393-400
Stern, R.D.1982. Computing a probability distribution for the start of rains from a Markov
chain model for precipitation. Journal of applied Meteorology. 21(3): 420-423
Victor, V.S and Sastry, P.S.N. 1979. Dry spell probability by Markov chain model and its
application to crop development stage. Mausam. 30: 479-484
64

J.Res. ANGRAU 37(3&4)65-70, 2009
IDENTIFICATION OF PARENTS AND HYBRIDS FOR YIELD AND ITS
COMPONENTS USING LINE X TESTER ANALYSIS IN PIGEONPEA
(Cajanus cajan L. Millsp)
C.V.SAMEER KUMAR, CH.SREELAKSHMI, D.SHIVANI AND M.SURESH
Agricultural Research Station
Acharya N. G. Ranga Agricultural University
Tandur, Ranga Reddy - 501 141
ABSTRACT
Six well adapted lines and four testers of pigeonpea (Cajanus cajan L. Millsp) were crossed in line x
tester design to elicit information regarding the desirable parents and crosses for their use in crop improvement
programmes. The material was raised in a randomized block design with three replications. Sufficient genetic
variability was observed among the parents, lines and crosses for all quantitative traits. Non – additive gene
action predominated for all the traits studied. The estimates of gca effects revealed that the genotypes PRG-
158 and LRG-30 among the lines and among the testers ICP 8863 and ICPL 87119 were the best general
combiners for seed yield and its components and could be utilized in future breeding programme. Significant
sca effect was exhibited by LRG 30 x ICP 8863, PRG 100 x ICP 8863, LRG 30 x ICPL 87119, ICPL 85063 x
ICPL 87119 and PRG 100 x ICPL 87119 for seed yield and could be used for exploitation of heterosis to
achieve high yields.
Pigeonpea (Cajanus cajan (L) Millsp.) is an important pulse crop grown in India with 76% of
global acreage. Possibilities of commercial exploitation of hybrid vigour increased since the
reports of genetic male sterility in pigeonpea and presence of considerable degree of natural
out crossing. Combining ability analysis is frequently employed to identify the desirable
parents and crosses. Therefore, the present study was undertaken to estimate combining
ability for some yield contributing components in pigeonpea.
MATERIALS AND METHODS
The experimental material consisting of twenty four crosses in line x tester design
involving six diverse lines and four well adapted testers were grown along with parents in the
randomized block design with three replications at Agricultural Research Station, Tandur
during kharif 2006-07. Each treatment in a replication had a single row of 5 m length, with 90
x 20 cm spacing. All the recommended crop management practices were followed. Data
were recorded on five random competitive plants from each genotype / replication for days to
cv_sameerkumar@yahoo.com
65

KUMAR et al.
50% flowering, days to maturity, plant height, number of primary branches per plant, number
of pod clusters per plant, number of pods per plant, 100 seed weight and seed yield per plant.
The statistical analysis was done as per procedure given by Kempthorne (1957).
RESULTS AND DISCUSSION
Analysis of variance for combining ability revealed significant differences of the line
x tester component for all the characters, indicating that the material chosen was variable
with respect to traits under investigation. The lines showed significant differences for days
to 50% flowering, days to maturity and 100 seed weight, while the testers exhibited significant
differences for days to 50% flowering, days to maturity, plant height, number of primary
branches per plant, 100-seed weight and seed yield per plant (Table 1).
Partitioning of combining ability variances into fixable additive genetic variance and
non-fixable dominance variance indicated that non-additive gene action play a significant
role in inheritance of all the traits. Therefore, it would be beneficial to build up a population by
inter mating these parents inter se before initiating random mating in F 2
to allow higher
recombination (Rawat, 1982). Preponderance of non-additive gene action for majority of
traits observed was found in agreement with Kumar et al., (2003) and Reddy et al., (2004).
The estimates of gca effect revealed that, the genotypes PRG 100 and LRG 30
among the lines and ICP 8863 and ICPL 87119 among the testers proved as good general
combiners for seed yield per plant (Table 2). The parent PRG 100 was a good general combiner
for all the characters except days to 50% flowering and plant height while LRG 30 was good
general combiner for number of primary branches per plant, number of pods cluster per plant,
number of pods per plant and seed yield per plant.
The lines ICPL 85063 and LRG 38 were the best general combiners for earliness.
Among the testers ICP 8863 was good general combiner for days to 50% flowering, days to
maturity, number of pods per plant, 100 seed weight and seed yield per plant and ICP 84063
and ICP 89044 were good general combiners for earliness. The tester ICPL 87119 was good
general combiner for number of pod clusters per plant, number of pods per plant, 100 seed
weight and seed yield per plant but not for earliness. Crosses involving these parents might
produce heterotic hybrids with high mean performance for respective traits.
High sca effects mostly from the additive and dominant effects existed between the
hybridizing parents. In the present study, significant sca effects were exhibited by five crosses
viz, PRG 100 x ICP 8863, PRG 100 x ICPL 87119, LRG 30 x ICP 8863, LRG 30 x ICPL
87119 and ICPL 85063 x ICPL 87119 for seed yield per plant (Table 3). These crosses could
be used for isolating superior genotypes from segregating generation. It was observed that,
66

IDENTIFICATION OF PARENTS AND HYBRIDS
these crosses also exhibited significant sca effects for number of pods per plant and 100
seed weight. The cross combinations for high gca lines x high gca testers manifested in to
higher sca combinations except in the cross ICPL 85063 x ICPL 87119. These results are in
agreement with the earlier reports of Kumar et al., (2003).
It is evident from the present study that non-additive gene effects were important in
the inheritance of most of the traits. The good general combiner parents viz, PRG 158, LRG
30 and ICP 8863 and ICPL 87119 could be utilized in future breeding programmes.
REFERENCES
Kempthorne, O. 1957. An introduction of Genetic statistics. John Wiley and sons, New
York, pp: 458-471.
Rawat, D. S. 1982. Analysis of reciprocal differences in Indian mustard. Acta Agronomica
Hungarice. 41: 227-233.
Reddy, S. M. Singh, S. P. Mehra, R. B and Govil, J. N. 2004. Combining ability and heterosis
in early maturing pigeonpea (Cajanus cajan L. Millsp) hybrids. Indian Journal of Genetics
and Plant Breeding 64 (3): 212-216.
Kumar, S. Lohit Aswa, H and Dharamaraj, P. 2003. Combining ability analysis for grain
yield, protein content and other quantitative traits in Pigeonpea. Journal of Maharashtra
Agricultural Universities 28: 141-144.
Kumar, K. Ramdhari and Tomar, Y. S. 2003. Combining ability analysis for seed yield and its
attributes in Pigeonpea. National journal of Plant Improvement 5: 124-126.
67

KUMAR et al.
Table 1. Analysis of variance for combin ing ability of the characters in pigeonpea
Source of variation df
Days to
50%
flowering
Days
to
maturity
Plant
height
(cm)
No. of
primary
branches
No. of
clusters /
plant
No. of
pods /
plant
100 seed
weight (g)
Seed yield
Plant (g)
Replications 2 6.39 2.61 46.39 0.66 18.02 610.53 0.35 14.29
Treatments 33 372.69** 373.08** 403.50** 13.50** 403.21** 6157.64** 5.73** 99.22**
Parents 9 499.55** 522.09** 652.73** 12.64** 412.48** 5837.42** 9.47** 79.98**
Parents vs. Crosses 1 634.09** 453.96** 1815.07** 56.74** 15.66 11835.38** 3.32** 226.97**
Crosses 23 311.68** 311.26** 244.61 11.96** 416.44** 6036.12** 4.38** 101.19**
Lines 5 551.06** 837.14** 367.28 11.70 447.21 9226.47 11.95** 63.79
Testers 3 1010.28** 514.98* 541.38* 38.83** 644.99 9420.85 7.67** 385.40**
Lines x Testers 15 92.16** 95.23** 144.38 6.67** 360.47** 4295.74** 1.19** 56.82*
Error 66 3.42 2.71 194.44 1.31 28.10 1586.31 0.22 25.61
68

IDENTIFICATION OF PARENTS AND HYBRIDS
Table 2. Estimates of general combining abilit y effects for lines and testers in pigeonpea
Days to
50%
flowering
Days to
maturity
Plant
height
(cm)
No. of primary
branches/plant
No. of
clusters/plant
No. of
pods/plant
100 seed
weight (g)
Seed
yield/plant
(g)
Lines
PRG-100 -0.22 -2.76** 1.24 1.60** 6.05** 33.79** 1.27** 3.48*
PRG-88 -0.06 -5.68** -0.78 -0.57 -7.64** -1.88 0.74** -2.15
LRG-30 10.03** 15.99** 5.15 0.76* 6.23** 32.62** 0.20 3.68*
LRG-38 -1.89** -1.68** -5.28 -0.87* -3.20* -41.20** -0.90** -2.13
ICPL-85034 -10.81** -7.01** -7.12 -0.80* -5.27** -22.48 -1.40** -2.87
ICPL-85063 2.94** 1.15* 6.77 -0.12 3.83* -0.85 0.10 -0.02
SE (gi) 0.53 0.47 4.02 0.33 1.53 11.49 0.14 1.46
Testers
ICP-8863 -3.36** -1.04** 0.94 0.36 -0.38 20.41* 0.54** 4.28**
ICPL-84036 -1.03* -3.38** -3.56 -1.09** -3.65** -20.67* -0.62** -5.32**
ICPL-87119 10.75** 7.85** 7.36* 1.93** 8.57** 19.19* 0.59** 3.44**
ICPL-89044 -6.36** -3.43** -4.74 -1.19** -4.54** -18.93* -0.51** -2.40*
SE (gj) 0.44 0.39 3.29 0.27 1.25 9.39 0.11 1.19
69

KUMAR et al.
Table 3. Estimates of specific combining ability effects in pigeonpea
Cross Days to
50%
flowering
Days to
maturity
Plant
height
(cm)
No. of
primary
branches
No. of
clusters/
plant
No. of
pods /
plant
100 seed
weight(g)
Seed
yield/plant
(g)
1 PRG-100 x ICP-8863 1.78 4.71** 1.80 1.36* 13.54** 47.10* 0.65* 6.74*
2 PRG-100 x ICP-84036 -5.89** -5.96** -4.14 -2.26** -13.88** -14.59 -0.15 -6.32*
3 PRG-100 x ICP-87119 3.67** 0.82 6.00 0.79 7.80* 48.35* 0.65* 6.76*
4 PRG-100 x ICP-89044 0.44 0.43 -3.66 0.11 -7.46* -45.86 0.60* -1.18
5 PRG-88 x ICP-8863 4.28** 5.29** -0.95 -0.81 0.86 -15.49 -0.50 -2.26
6 PRG-88 x ICP-84036 0.28 0.29 -3.92 1.11 7.90* -10.41 0.12 2.79
7 PRG-88 x ICP-87119 -1.17 -7.60** 3.95 0.62 -4.12 20.92 -0.08 0.86
8 PRG-88 x ICP-89044 -3.39** 2.01* 0.93 -0.92 -4.64 -0.02 0.02 -0.81
9 LRG-30 x ICP-8863 4.53** -0.38 4.22 2.16** 14.79** 49.54* 0.63* 6.77*
10 LRG-30 x ICP-84036 2.19* 4.29** -2.78 -1.01 -8.47** -35.61 0.78** 0.45
11 LRG-30 x ICP-87119 -2.25* 1.07 6.26 0.90 4.48 52.52* 0.64* 6.96*
12 LRG-30 x ICP-89044 -4.47** -4.99** -7.70 -2.05** -10.81** -25.45 -0.95** -4.18
13 LRG-38 x ICP-8863 5.11** 6.62** 6.88 -0.74 -15.35** -36.67 -0.51 -2.95
14 LRG-38 x ICP-84036 -7.56** -3.38** 4.71 0.35 4.12 -11.69 -0.80** -1.01
15 LRG-38 x ICP-87119 2.33* -2.26* -9.91 -0.14 2.57 -56.83* -0.07 -5.14
16 LRG-38 x ICP-89044 0.11 -0.99 -1.67 0.52 8.65** 47.19* -0.17 2.10
17 ICPL-85034 x ICP-8863 -8.31** -6.38** -10.14 -0.38 0.19 -11.29 -0.29 0.46
18 ICPL-85034 x ICP-84036 3.03** 4.96** 7.55 0.34 3.70 18.28 -0.02 -4.94
19 ICPL-85034 x ICP-87119 1.25 1.07 -7.37 -0.61 -7.78* -54.15* -0.17 -1.16
20 ICPL-85034 x ICP-89044 4.03** 0.35 9.97 0.64 3.89 17.17 -0.22 -4.36
21 ICPL-85063 x ICP-8863 -7.39** -9.88** -1.80 -1.59* -14.04** -41.19 -1.73** -4.76
22 ICPL-85063 x ICP-84036 7.94** -0.21 -1.41 1.46* 6.63* 4.02 0.06 -0.39
23 ICPL-85063 x ICP-87119 -3.83** 6.90** 1.07 -1.56* -2.95 47.19* 0.64* 6.72*
24 ICPL-85063 x ICP-89044 3.28** 3.18** 2.14 1.69* 10.36** 6.98 0.72* 3.42
SE (sij) 1.07 0.95 8.05 0.66 3.06 22.99 0.27 2.92
70

J.Res. ANGRAU 37(3&4)71-76, 2009
GENE EFFECTS FOR YIELD CONTRIBUTING CHARACTERS IN
PIGEONPEA (Cajanus cajan L.Millsp) BY GENERATION MEAN
ANALYSIS
C.V. Sameer Kumar, Ch. Sreelakshmi, D. Shivani and M.Suresh
Agricultural Research Station
Acharya N. G. Ranga Agricultural University
Tandur, Rajendranagar - 501 141
ABSTRACT
Estimates of gene effects based on analysis of generation mean obtained for eight characters in four
crosses of pigeonpea indicated the presence of additive, dominance and epistatic gene effects. Among nonallelic
interactions dominance x dominance (l) was of greater magnitude than main gene effects for most of the
characters indicating the importance of heterosis breeding to utilize non- additive gene effects. The additive
gene effects (d) also contributed significantly for different traits like plant height, number of pods per plant and
seed yield in the cross LRG 30 x ICP 8863. Dominant gene effects (h) contributed significantly for most of the
characters in the crosses PRG 100 x ICPL 87119 and LRG 30 x ICP 8863. Selection in segregating generations
of these crosses will be effective for the development of these traits. However, to exploit additive as well as
non- additive gene effects reciprocal recurrent selection procedure may be adopted.
Pigeonpea is an important edible pulse crop in India grown in rainfed and irrigated
conditions. Multiple path ways involving different yield contributing characters influence seed
yield and hence seed yield can also be improved through improvement of yield contributing
characters (Solanki and Joshi, 2000). The estimation of gene effects involved in the inheritance
of yield contributing or quantitative characters are helpful in planning breeding programmes.
Though gene effects for seed yield and other traits have been estimated in pigeonpea,
information on epistatic gene effects is limited. Thus, in the present investigation, genetic
parameters namely, additive, dominance and epistatic gene effects were estimated through
generation mean study for eight quantitative traits in 4 crosses of pigeonpea.
MATERIALS AND METHODS
Experimental material comprised of 6 generations i.e., P1, P2, F1, F2, BC1(F1xP1)
and BC2(F1xP2) of 4 crosses namely PRG 100 x ICPL 87119, LRG 30 x ICP 8863, PRG
100 x ICP 8863 and LRG 30 x ICPL 87119. The six generations of each cross were grown
separately in randomized block design with two replications. In each replication parents and
crosses were randomized separately, P1, P2 and F1 were grown in two rows of 5m length.
The inter and intra row spacing was 1.0 x 0.2 m, respectively. Plant population in segregating
cv_sameerkumar@yahoo.com
71

Kumar et al.
generations varied from 62 to 225 plants. The crop was raised as per standard practices for
rainfed crop. Observations on individual plants were recorded for eight quantitative traits
(Table 1). The data recorded were subjected to weighted analysis of Cavalli (1952) to know
the adequacy of additive dominance model. In the presence of epistasis, the data where any
of the 4, 5, 6 parameters are found adequate in the model of Jinks and Jones (1958) was
subjected accordingly to sequential model in order to obtain more precise estimate for these
parameters. The adequacy of these sequential models was tested by x 2 test.
RESULTS AND DISCUSSION
Significant scaling test for different traits were observed in almost all crosses indicating
the presence of digenic or higher order interactions. The non-significant scaling test (Table1)
indicated the absence of non-allelic interactions for number of branches per plant in all the
crosses except PRG100 x ICP 8863 and number of pods per plant in the cross LRG 30 x
ICPL 87119. Thus inheritance in these characters in the above referred crosses could be
explained on the basis of simple additive-dominance model. The estimates of genetic
parameters m, d and h in these crosses indicated that both additive (d) and dominance (h)
gene effects were responsible for inheritance of traits. Absence of non- allelic interactions
for some characters was also reported by Patel (1996).
The estimates of genetic parameters for different yield contributing traits in the cross
PRG 100 x ICPL 87119 revealed that dominance gene effects (h) govern the inheritance of
all the characters. Epistatic gene effects additive x additive (i) was more important in the
inheritance of plant height and number of clusters per plant. In the same cross dominance x
dominance (l) were more pronounced than additive gene effects for number of pods per
plant, 100-seed weight and seed yield. Similar results were observed by earlier workers
(Kandalkar, 2005 and Singh, 2002).
Dominance gene effects (h) governed the inheritance of all the traits except number
of branches per plant in the cross LRG 30 x ICP 8863. Non allelic interactions viz., additive
x additive (i) and additive x dominance (j) were involved in the inheritance of plant height,
number of pods per plant and 100 seed weight. Epistatic interaction like dominance x
dominance gene effect (l) was also observed for the expression of seed yield. These results
are in agreement with the earlier reports of Hooda et al., (2000) and Oommen et al., (1994).
Dominance gene effects (h) governed the inheritance of mostly yield contributing
traits in the cross PRG 100 x ICP 8863 like days to 50% flowering, days to maturity, plant
height, number of clusters per plant, 100 seed weight and seed yield. In this cross additive
x additive gene effects (i) were also responsible for the inheritance of days to 50% flowering,
72

GENE EFFECTS FOR YIELD CONTRIBUTING CHARACTERS
days to maturity, plant height and number of clusters per plant. However, non- allelic gene
effects additive x dominance (j) also controlled the inheritance of number of branches per
plant and number of pods per plant in this cross.
Cross LRG 30 x ICPL 87119 exhibited the importance of dominance gene effects (h)
for the inheritance of most of the yield contributing traits. In epistatic interactions like additive
x additive (i) govern the inheritance of number of clusters per plant. Non allelic interactions
viz., dominance x dominance gene effects (l) controlled the inheritance of number of clusters
per plant, 100 seed weight and seed yield.
The role of non allelic interactions as indicated by scaling test was not confirmed by
estimates of genetic parameters in crosses PRG 100 x ICPL87119, LRG 30 x ICP 8863 and
LRG 30 x ICPL87119 for number of branches per plant and in the cross LRG 30 x ICPL
87119 for number of pods per plant. It might be due to presence of higher order interactions
for inheritance of these traits. The magnitude of epistatic interaction mainly dominance x
dominance (l) gene effects (l) for most of the traits was higher in almost all traits under study.
Such non additive gene effects may be exploited by heterosis breeding. Additive gene effects
observed in the inheritance of important yield contributing characters like plant height, number
of clusters per plant, number of pods per plant and seed yield in the above crosses can be
utilized in breeding programme by selection method.
The complementary type of gene action observed in cross PRG 100 x ICPL 87119
for most of the yield contributing traits and for number of branches per plant and number of
pods per plant for PRG 100 x ICP 8863 can be utilized in breeding programme. Duplicate
type of gene action observed for other traits is not easy to use in breeding programme. It is
there fore concluded that heterosis breeding may be used where large magnitude of non
fixable gene effects is observed. A sizable amount of additive gene effects observed indicated
that segregating generations of cross LRG 30 x ICP 8863 may be handled to develop inbred/
varieties possessing more number of pods per plant and 100 seed weight. Such type of
inbred /varieties are likely to provide higher seed yield also. Considering the importance of
dominance as well as non-additive gene effects observed in the present study recurrent
selection and diallel selective mating system may be used to exploit both types of gene
effects.
73

Kumar et al.
Table 1. Estimation of genetic parameters in selected pigeonpea crosses evaluated
at ARS, Tandur, kharif, 2007
Character m d h i j l
Cross: PRG 100 x ICPL 87119
Days to 50% flowering 107.07** -10.03** 25.67** 10.46 2.10 6.27
Days to maturity 165.63** -9.23** 28.60** 14.60 3.50 6.13
Plant height 179.30** -20.34** 40.64** 18.75* -4.71* 3.46
Number of branches per plant 14.93** -0.76 2.90 - - -
Number of clusters per plant 83.00** -5.56** 35.27** 23.40** 0.30 -10.53
Number of pods per plant 417.32** -31.63** 56.47* -26.93 11.90 160.47**
100-seed weight 12.27** 0.84** 4.76** 1.27 0.28 6.93**
Seed yield 55.24** -4.15** 1.19 -9.04** -3.51** 31.49**
Cross: LRG 30 x ICP 8863
Days to 50% flowering 109.95** 3.00* 24.40** 7.26** -1.40 -13.93
Days to maturity 169.95** 3.00* 22.93** 17.27** -2.26 -11.00
Plant height 179.12** 18.87** 43.69** 22.73** 12.35** -3.61
Number of branches per plant 16.55** 0.77 0.57 - - -
Number of clusters per plant 82.37** -12.20** 17.70** 8.00 -6.43** 4.20
Number of pods per plant 417.57** 30.03** 147.00** 72.60* -17.30 -52.53
100-seed weight 10.33** -2.20** 5.66** 3.51** -0.36 -1.06
Seed yield 53.35** 3.16* 23.52** 14.73** 3.88** -11.46**
74

GENE EFFECTS FOR YIELD CONTRIBUTING CHARACTERS
Table1. contd….
Character m d h i j l
Cross: PRG 100 x ICP 8863
Days to 50% flowering 97.95 ** -7.57 ** 20.70 ** 13.73 ** -1.07 -2.80
Days to maturity 158.20 ** -7.57 ** 18.43 ** 12.33 ** -1.07 -0.33
Plant height 168.63 ** -8.29 ** 31.31 ** 15.07 * -3.5* -1.06
Number of branches per
plant
14.75 ** -0.67 1.03 -1.80 -0.17 6.40 **
Number of clusters per plant 87.47 ** -2.97 ** 23.50 ** 11.27 * 1.07 -10.73
Number of pods per plant 419.52 ** -4.60 12.00 -68.60** -0.47 167.00**
100-seed weight 12.98 ** 0.31 2.38* 1.23 -0.13 0.01
Seed yield 53.68 ** 0.69 13.91 ** 5.11 1.36 6.72
Cross: LRG 30 x ICPL 87119
Days to 50% flowering 119.30 ** -3.43 ** 11.57 ** 4.20 -2.20* -2.20
Days to maturity 178.95 ** -1.03 13.16** 5.33 -0.07 6.13
Plant height 191.68 ** -6.59 ** 13.56 * 3.41 -2.29 6.41
Number of branches per
plant
15.52**
-1.57** 6.10* - - -
Number 84.73 ** -7.70 ** 33.33 ** 20.73 ** -0.10 -17.60*
of clusters per plant Number of pods per plant 433.62** -3.30 43.20 - - -
100-seed weight 11.21 ** -1.88 ** 0.91 -1.01 -0.17 3.48*
Seed yield 54.56 ** -1.98 ** 15.39 ** 4.37 -1.28 8.76 *
Seed yield 53.68 ** 0.69 13.91 ** 5.11 1.36 6.72
* Significant at 5% level ** Significant at 1% level
75

Kumar et al.
REFERENCES
Cavalli, L. L. 1952. An analysis of linkage in quantitative inheritance. Ed Reive E CR and
Waddington, C. H. pp: 135-144, HMSO, London.
Comstock, R. E. Robinson, H. F and Harvey, P. H. 1949. A breeding procedure designed to
make maximum use of both general and specific combining ability. Agronomy Journal
41: 360-367.
Hooda, J. S. Tomar, Y. S. Vashistha, R. D and Phogat, D. S. 2000. Generation mean
analysis in Pigeonpea (Cajanus cajan (L.) Millsp). Annals of Biology 16: 105-109.
Jinks, J. L. and Jones, M. 1958. Estimation of components of heterosis. Genetics 43: 223-
234.
Kandalkar, V. S. 2005. Genetic analysis of early and medium duration pigeonpea hybrids
(Cajanus cajan (L.) Millsp) crosses involving wilt resistant donor in F1 and F2
generations. Indian Journal of Genetics and Plant Breeding. 65: 184-187.
Oommen, A. Namboodri, K. M. N and Unnithan, V. K. G. 1994. Genetic analysis of some
quantitative characters in pigeonpea. Journal of Tropical Agriculture 32: 109-111.
Patel, A. A .1996. Genetic analysis in castor (Ricinus communis L.) M.Sc (Ag.) Thesis
submitted to Gujarat Agricultural University, S K Nagar.
Perera, A. M. Pooni, H. S and Saxena, K. B. 2001. Components of genetic variation in short
duration pigeonpea crosses under water logged conditions. Indian Journal of Genetics
and Plant Breeding 55: 31-38.
Singh, I. P and Srivastava, D. P. 2002. Combining ability analysis in inter specific hybrids of
pigeonpea. Indian Journal of Pulses Research 14: 27-30.
76

Research Note
J.Res. ANGRAU 37(3&4)77-81, 2009
EVALUATION OF F 1
HYBRIDS OF TOMATO
(Solanum lycopersicum L.)
P.S.SUDHAKAR and K. PURUSHOTHAM
Department of Horticulture, S.V. Agricultural College,
Acharya N.G.Ranga Agricultural University, Tirupati - 517 502.
Tomato (Solanum lycopersicum L.) covers an area of about 5.35 lakh hectares in
India with a production of 9.36 million tones ranking second after Potato (NHB, 2006). Recently,
its cultivation is commercialized due to its rapid development of high yielding potential F 1
hybrids during the last decade. But, it is observed that arrival of huge quantity of the produce
at a time, leads to glut and price fall in the market every season due to lack of specific hybrid
suitable for staggered harvesting in southern zone of Andhra Pradesh. Hence, the present
study was undertaken to evaluate different F 1
hybrids of tomato for higher yield and staggered
harvesting.
The present study was carried out during spring-summer season of 2005-2006 between
the months of December and June at Horticultural garden, S.V. Agricultural College, Tirupati
with 8 hybrids viz., T 1
– JK Asha, T 2
– Lakshmi, T 3
– Lehar, T 4
– Ruchi, T 5
– Abinav, T 6
–
Manisha, T 7
– NS 2535 and T 8
– US 618. The trial was laid out in randomized complete block
design with three replications. All hybrids received a common basal dose of FYM @
5 t ha -1 , 50% of full dose of 150 kg N, full dose of 60 kg P 2
O 5
and 80 kg K 2
O ha -1 at the time
of field preparation. Remaining 50% N was top dressed in two equal splits, one at 30 and the
other at 60 days after planting. Recommended package of practices were followed to raise
the crop under irrigated conditions. Plant height and number of branches per plant were
recorded at 120 days after transplanting. Fruit set (%) was calculated as per formula suggested
by Baruah et al. 1994). The fruit size (cm 2 ) was obtained by multiplying the maximum length
and breadth of the fruit. The fruit size and pericarp thickness were recorded with the help of
vernier calipers. A hand refractometer was used to measure total soluble solids (TSS).
Ascorbic acid content was determined following 2, 6 - dichlorophenol - indophenol visual
titration method. Shelf life was estimated as the time taken by fruits to reach 50% shrivelling.
Data were collected on five randomly selected plants of each plot to record growth, yield and
quality parameters and were subjected to statistical analysis.
E-mail Id: psshorti@yahoo.co.in
77

SUDHAKAR and PURUSHOTHAM
The results presented in table 1 revealed that growth characters varied significantly
among different tomato hybrids. Ruchi showed the tallest plants growing to a height of 143.7
cm with maximum number of 26.0 branches per plant compared to other hybrids. On the
other hand, Lakshmi recorded shortest plants growing to a height of only 103.7 cm producing
15.67 branches per plant. These growth parameters were on par with Lehar and NS 2535.
Plant height of JK Asha was also on par with Lakshmi. This variation in plant growth arose
on account of growth habit of genotypes. Similar kind of variation in growth characters among
different tomato hybrids was also observed by Mohanty et al. (2001).
The hybrids showed significant differences in flowering and maturity. Lakshmi was
the earliest to attain 50% flowering in 24.33 days after transplanting and was on par with JK
Asha (25.00 days) which was in turn on par with Ruchi (27.33 days). On the contrary, Abinav,
NS 2535, Lehar and Manisha were late to flower. They attained 50% flowering in 41.00 to
42.00 days. Raymon (1985) reported that early flowering resulted in early maturity which
indicates earliness of the genotype. In the present investigation, it is evident that early
flowering hybrids Lakshmi, JK Asha and Ruchi matured early in 71.00, 71.33 and 75.33 days
after transplanting compared to late flowering hybrids.
The data presented in the table 2 revealed that highest fruit set of 78.6% was observed
in Abinav compared to rest of the hybrids, while the lowest fruit set of 28.1% was recorded
in Lakshmi which was on par with Ruchi (34.55%). Thus, the hybrids which attained early
and profuse flowering had lower fruit set. These differences in flowering characters might be
attributed to changes in their genotypic habits as reported by Mangal (1981). The early
maturing hybrid Lakshmi produced the highest number of fruits per plant (20.13), yield per
plant (1532 g) and per hectare (567.7q) and was significantly superior over rest of the hybrids.
Moreover, profuse flowering and fruit bearing enabled it to produce more fruits and yield in 3
- 4 pickings as observed in early maturing hybrids when compared to late maturing hybrids
with 5 – 6 pickings. On the contrary, late maturing hybrids Manisha, Abhinav and Lehar
recorded significantly low yields of 395 g, 567 g and 627 g per plant (Table 2). Jasmine and
Ramdas (1993) also reported that early maturing hybrids produced higher yield than late
maturing hybrids. But, synchronization of fruiting in Lakshmi could not enable it to produce
staggered harvests. Similar observations in different tomato genotypes were observed by
Gould (1983) who reported that synchronization of fruiting after a period of profuse flowering
in early maturing cultivars leads to once-over harvesting. The hybrid US618 was the second
best. It yielded 341.0 q ha -1 which was significantly more than rest of the hybrids. The fruit
set of the hybrid was 60.65%. Its unique characteristic is that it provides continuous supply
of fruits through staggered harvests. The habit of indeterminate growth, staggered flowering
and fruiting in hybrid US 618 enabled it to become suitable hybrid for staggered harvesting.
78

EVALUATION OF F 1
HYBRIDS OF TOMATO
In the present investigation, all the hybrids showed significant differences in their quality
characters (Table 3). The largest fruit size of 23.11 cm 2 and weight of 80.42 g were recorded
in the hybrid Ruchi. These parameters were on par in US 618 and Lakshmi. The fruits of Jk
Asha and Manisha had maximum TSS content of 4.8%. The hybrid Ruchi was on par with
these two hybrids. Lakshmi recorded the lowest TSS content of 3.67%. Manisha was very
rich in ascorbic acid content of 19.71 mg 100g -1 and this was on par with ascorbic acid
content of 19.27 mg 100g -1 in US 618, 18.63 mg 100g -1 in NS 2535, 18.09 mg 100g -1 in Abinav
and 16.47 mg 100g -1 in Ruchi. The late maturing hybrids were thus rich in ascorbic acid
content. Elliptical shape fruited hybrid NS 2535 had the thickest pericarp thickness measuring
0.73 cm and longest shelf life of 17.33 days. The pear shape fruited hybrid Abhinav also had
thick pericarp of 0.70 cm and long shelf life of 15 days. The round shape fruited hybrid Ruchi
showed the thin pericarp of 0.5 cm and short shelf life of 9.00 days. Thus, the elliptical or
oblong or pear shaped fruits had thick pericarp thickness and long shelf life than those with
rounded flat and spherical shaped fruits. These findings are in agreement with those of
Vanajalatha (1987). Thus, Lakshmi and US618 can be recommended as suitable hybrids for
higher yield and staggered harvesting.
Table 1. Growth performance of different tomato hybrids
Hybrids Plant Number of Days to 50% Days to
height branches per flowering maturity
at final
plant at
harvest(cm) final harvest
JK Asha 112.33 19.67 25.00 71.33
Lakshmi 103.33 15.67 24.33 71.00
Lehar 108.33 17.67 41.00 93.00
Ruchi 143.67 26.00 27.33 75.33
Abinav 110.33 18.67 42.00 95.00
Manisha 118.33 20.67 41.33 94.00
NS2535 109.33 18.33 41.67 94.67
US618 125.00 21.67 39.33 90.67
SE+ 3.10 0.89 0.86 1.60
CD at 5% 9.41 2.71 2.61 3.42
79

SUDHAKAR and PURUSHOTHAM
Table 2. Fruit yield components of different tomato hybrids
Hybrids Fruit set (%) Number of Yield per Yield
fruits per plant plant (g) q ha -1
JK Asha 41.18 11.75 637.0 236.3
Lakshmi 28.10 20.13 1532.0 567.7
Lehar 53.38 8.51 627.0 232.5
Ruchi 34.55 9.77 785.0 290.9
Abinav 78.60 8.12 567.0 210.1
Manisha 54.37 5.80 395.0 146.3
NS2535 60.14 12.07 865.0 320.5
US618 60.65 12.13 920.0 341.0
SE+ 2.99 1.31 8.0 3.0
CD at 5% 9.08 3.98 24.0 9.1
Table 3. Fruit quality components of different tomato hybrids.
Hybrids Fruit Fruit size Pericarp TSS (%) Ascorbic Shelf life
weight (cm 2 ) thickness acid (days)
(g) (cm) content
(mg 100 g -1 )
JK Asha 54.29 7.68 0.53 4.80 14.04 11.00
Lakshmi 76.15 18.21 0.63 3.67 15.06 13.00
Lehar 73.77 16.48 0.57 3.93 12.11 11.00
Ruchi 80.42 23.11 0.50 4.60 16.47 9.00
Abinav 69.87 15.32 0.70 4.07 18.09 15.00
Manisha 68.12 11.37 0.67 4.80 19.71 14.00
NS2535 71.69 16.31 0.73 4.20 18.63 17.33
US618 75.91 18.19 0.60 4.00 19.27 12.00
SE+ 2.30 2.00 0.03 0.18 1.26 0.68
CD at 5% 6.98 6.29 0.10 0.56 3.81 2.07
80

EVALUATION OF F 1
HYBRIDS OF TOMATO
REFERENCES
Baruah, G. K. S., Arora, S. K and Pandita, M. L. 1994. Effect of Paclobutrazole and nitrogen
levels on fruit yield of Pusa ruby tomato (Lycopersicum esculentum). Indian Journal
of Agricultural Sciences 64: 567-569.
Gould, W. A. 1983. Tomato production, processing and quality evaluation. 2 nd edition, AVI
publishing company, Westport, Connecticut.
Jasmine, A. P. J and Ramadas, S. 1993. Evaluation of certain F 1
hybrids and cultivars of
tomato for yield components. South Indian Horticulture 41 (5): 248-250.
Mangal, J. L., Sidhu, A. S and Pandey,V. C. 1981. Effect of staking and pruning on growth,
earliness and yield of tomato varieties. Indian Journal Agricultural Research 15 (2):
103-106.
Mohanty, B. K. 2001. Varietal performance of tomato in black soils of orissa. Journal of
Research, ANGRAU 29 (4): 22-26
NHB, 2006. Crop wise area, production and productivity of major vegetable crops for the
year 2005-2006 in India. www.indiastat.com. (online statistical database).
Raymon, 1985. Vegetable seed production University of Bath printed in Great Britain at the
pitman press Bath.
Vanajalatha, K. 1987. Studies on the performance of certain tomato (Lycopersicon esculentum
Mill) hybrids and varieties under Hyderabad conditions, M.Sc.(Ag.) thesis submitted
to Acharya N.G. Ranga Agril. University, Hyderabad.
81

Research Note
J.Res. ANGRAU 37(3&4)82-85, 2009
INFLUENCE OF GROWTH HORMONAL TREATMENTS ON SEED
GERMINATION AND SEEDLING GROWTH OF SIMAROUBA
(Simarouba glauca L.)
L. PRASANTHI, P. MAHESWARA REDDY, P. S. SUDHAKAR,
B. BALAKRISHNA BABU and K. RAJA REDDY
Biofuel Scheme, Regional Agricultural Research Station
Acharya N.G. Ranga Agricultural University, Tirupathi - 517 502
Simarouba glauca commonly known as paradise tree belongs to family
simaroubaceae. It is an ever green multipurpose tree, native of EL Salvador, Central America.
It was introduced in India in 1966, exclusively for soil conservation purpose, especially
earmarked for waste lands, bald hills and degraded lands. In recent years, it has attained
greater importance in terms of its potential for edible oil, industrial vegetable oil and biofuel
production. It is a versatile oil tree with productivity potential as high as 2000 kg edible oil per
hectare per year with ability to establish well even in marginal/ wastelands (Syamasundar
and Hiremath, 2001). It can play an important role not only in reducing the shortage of edible
oil/ fat in the country but also limiting country’s dependence on oil imports to meet domestic
oil requirement. Simarouba is mainly propagated through seeds and like other oil seeds,
seeds can be stored only for a limited period with slight reduction in germination percentage.
Even the fresh seeds have germination problems as only 60 percent of seeds are able to
produce normal seedlings. In many of the forestry species, seed germination and seedling
growth is enhanced by externally applied growth promoters. Due to lack of sufficient literature,
an attempt was made to increase the seed germination percentage and seedling growth
in Simarouba glauca with externally applied growth regulators and chemicals.
Freshly harvested Simarouba glauca seeds were collected from Forest Research
Station, BIOTRIM, Tirupati during May 2009 for the present study. The seeds were surface
sterilized with 0.1% mercuric chloride for 30 minutes and thoroughly washed with distilled
water. There were eight treatments replicated four times. The seeds were treated by soaking
in distilled water and growth regulators viz., IAA and GA at concentrations of 150, 200 and
250 ppm for 24 h before sowing and the seeds without any treatment served as control. The
seeds were sown in polybags. The experiment was laid out in completely randomized design.
The study was conducted under shade net conditions during June, 2009 at Regional Agricultural
Research Station, Tirupati. Irrigation was provided by pot watering twice a day. Seed
e mail: prasanthi64@rediffmail.com
82

INFLUENCE OF GROWTH HORMONAL TREATMENTS
germination was counted upto 30 days after sowing. The seedlings started germinating from
12 th day and continued upto 25 th day after sowing. Data on germination time (days), germination
percentage, root and shoot length (cm), total seedling length (cm), fresh and dry weight of
root and shoot (g) and vigour index were recorded. Seedling vigour was measured in terms of
vigour index. It was calculated as vigour index = germination percentage X Total seedling
length (cm) given by Abdul-Baki and Anderson (1973). The data recorded were subjected to
analysis of variance.
The results showed that Simarouba glauca seed germinated in mean 13.45 to 16.45
days. This was not significantly influenced by different treatments. The untreated seed had
a low germination of 64.4%. The high concentration of IAA @ 250 ppm was deleterious and
had also low seed germination of 66.6%. The seeds soaked in distilled water or treated with
IAA or GA @ 150 and 200 ppm for 24 h recorded 100% germination. This could be due to
plant growth regulators which induced metabolization of stored reserves during germination
as reported by Verma and Tandon (1988). Seed treatment with IAA @ 150 ppm significantly
increased not only the length of shoot (14.44 cm), root (30.70 cm) and seedling (45.14 cm)
but also the fresh weight (2.60 g; 1.19 g) and dry weight (0.58 g; 0.26 g) of shoot and root
followed by IAA 200 ppm and GA 200 ppm when compared to control. However, soaking of
seed in distilled water did not influence these variables. The positive response attributed for
enhanced growth of seedlings in terms of shoot and root length as well as for increased
biomass of seedlings with IAA and GA treatments might be due to diffusion of endogenous
auxin and gibberellins like substances (Mathur et al., 1971). Enhancement of germination
and seedling growth with IAA treatment has been reported earlier in Neem by Kumaran et al.,
(1994). The maximum vigour index of 4514 was recorded by treating the seed with IAA @
150 ppm followed by IAA 200 ppm (4280) and was significantly higher than that of control
(2268). Higher germination per cent and seedling length indicated better growth potential of
the seedlings, which in turn positively increased the vigour index in IAA 150 ppm. These
findings are similar to those earlier reported by Radha krishnan and Renganayaki (2008).
Therefore, seed treatment with IAA @ 150 ppm is the best technique to improve the
germination percentage of the seeds, root and shoot length, total seedling length, fresh and
dry weight of root and shoot and eventually to maximize the seedling vigour. Farmers who
cannot afford to purchase IAA or in the event of its non availability can opt seed soaking with
distilled water which is the next best option to improve the germination of seeds.
83

PRASANTHI et al.
Table 1. Effect of growth regulators on seed germ ination and seedling growth of Simarouba glauca
Treatment Germination
time (days)
Germination
percentage
(%)
Shoot
length
(cm)
Root
length
(cm)
Total
seedling
length
(cm)
Fresh weight
of
Shoot
(g)
Root
(g)
Dry weight of
Shoot
(g)
Root
(g)
Vigour
Index
T1 - Control 16.11 64.5 11.92 23.28 35.20 2.18 0.83 0.45 0.14 2268
T2 - Distilled water 13.45 100.0 13.11 25.69 38.80 2.50 0.90 0.53 0.18 3880
T3 - IAA 150ppm 15.11 100.0 14.44 30.70 45.14 2.60 1.19 0.58 0.26 4514
T4 - IAA 200ppm 14.78 100.0 14.19 28.61 42.80 2.57 1.09 0.55 0.22 4280
T5 - IAA 250ppm 16.22 66.6 11.93 29.75 41.68 2.00 0.80 0.43 0.11 2776
T6 - GA 150ppm 15.11 100.0 14.18 25.78 39.96 2.09 0.73 0.35 0.09 3996
T7 - GA 200ppm 15.22 100.0 13.91 26.13 40.04 2.53 1.00 0.54 0.20 4004
T8 - GA 250ppm 16.45 88.5 12.70 24.33 37.03 2.42 0.89 0.48 0.19 3274
SE+ 0.91 10.5 0.87 1.64 2.13 0.11 0.06 0.03 0.005 470
CD at 5% NS 21.3 2.04 3.53 4.56 0.22 0.12 0.06 0.013 1009
84

INFLUENCE OF GROWTH HORMONAL TREATMENTS
REFERENCES
Abdul baki, A.A and Anderson, J.J. 1973. Vigour determination in Soyabean seed by multiple
criteria. Crop Science 13: 630-633
Kumaran, K., Palani, M., Jerlin, R and Surendran, C.1994. Effects of growth regulators on
seed germination and seedling growth of Neem (Azadirachta indica). Journal of Tropical
forest science 6:529-532.
Mathur, D.D., Cuurillon, G.A., Vines, H.M and Hendershoot, C.H. 1971. Stratification effects
on endogenous gibberelic acid in peach seed. Horticulture science 6: 538-539
Radhakrishnan, P and Renganayaki, P.R.2008. Effect of plant growth regulators on seed
germination and seedling growth of stored Simarouba (Simarouba glauca Linn) seeds.
Indian forester 134 (7): 947-949
Syamasundar, J and Hiremath, S.2001. Simarouba oil tree. Booklet published by UAS,
Bangalore in association with National Oilseeds and Vegetable oils Development Board
(ICAR), Gurgoan.
Verma, A.N and Tandon, P.1988. Effect of growth regulators on germination and seedling
growth of Pinus kasiya and Schima khasiana. Indian Journal of forestry 11: 32-36.
85

Research Note
J.Res. ANGRAU 37(3&4)86-91, 2009
STUDY OF HETEROSIS FOR YIELD AND ITS COMPONENT TRAITS
IN PIGEONPEA (Cajanus cajan. L. Millsp)
C.V.SAMEER KUMAR, CH.SREELAKSHMI, D.SHIVANI AND M.SURESH
Agricultural Research Station
Acharya N. G. Ranga Agricultural University
Tandur, Ranga Reddy – 501 141
Pigeonpea (Cajanus cajan (L.) Millsp) is an important pulse crop in India. Its protein
content is approximately 21% which compares well with other important grain legumes.
Exploitation of heterosis is one of the important breeding options for breaking yield barrier. It
offers great possibilities in crop improvement programme and is the only effective conventional
means of combining desirable characters of two or more varieties. Breeding programmes in
pigeonpea are oriented to develop new varieties which have high yield potential and resistance
to pests and diseases. Thus the main objective of the present investigation was to estimate
the extent of heterosis for seed yield and its component characters and to select better
crosses for further breeding.
The present study comprised of six lines, PRG 100, PRG 88, LRG 30, LRG 38, ICPL 85034
and ICPL 85063 and four testers, ICP 8863, ICPL 87119, ICPL 84063 and ICPL 89044 of
pigeonpea. The hybridization was carried out in a line x tester scheme at Agricultural Research
Station, Tandur during kharif 2007. Ten parents along with their 24 hybrids were sown in a
randomized block design with three replications during kharif 2008 adopting 100 x 20 cm
spacing. Entire material comprising parents and F 1
s was sown in 2 rows of each in 5 m
length plot. All the recommended package of practices were followed for raising normal crop.
The observations were recorded on five randomlycompetitive plants for plant height, number
of primary branches per plant, number of pod clusters per plant, number of pods per plant,
100- seed weight and seed yield per plant. Days to 50% flowering and days to maturity was
recorded on plot basis. Sample of 100 seeds was taken for recording their weight. The data
were subjected to analysis of variance for various characters, mean performance of parents
and their hybrids and heterosis.
The analysis of variance revealed that variation among the genotypes was highly
significant for all the characters. The parents showed significant variation for all the characters
studied. The crosses also showed significant variation for all the characters except plant
height. The overall heterosis as tested by using parents vs crosses was significant for all the
characters except for number of clusters per plant. The range of mean performance of hybrids
was higher indicating significant heterosis for all the characters.
cv_sameerkumar@yahoo.com
86

STUDY OF HETEROSIS FOR YIELD AND ITS COMPONENT
The range and mean of heterosis, number of significant heterotic crosses over better
parent and standard hybrid for eight traits are presented in Table 1. Earliness in flowering and
maturity is a highly desirable trait for the crop like pigeonpea. Hence, the crosses exhibiting
heterosis in negative direction are of immense value. The cross ICPL 85034 x ICP 8863
showed highest negative heterosis for days to flowering (-17.63%) and days to maturity (-
11.02%) over standard check ICPL 87119. The magnitude of heterosis was highest for plant
height in cross ICPL 85034 x ICPL 84036 over better parent (24.42%), while maximum
heterosis for primary branches per plant (46.28%) was observed in cross PRG 100 x ICPL
87119 over standard check, ICPL 87119. Significant and highest positive heterosis over
mid parent, better parent and standard hybrid was observed in cross LRG 30 x ICP 8863 for
number of pods per plant. Two crosses viz. LRG 30 x ICP 8863 and LRG 38 x ICP 8863
showed significant positive heterosis over mid parent for 100 seed weight. The cross LRG
30 x ICP 8863 exhibited significant and highest positive heterosis for number of pods per
plant (58.31%) followed by seed yield per plant (54.14%). These results are in agreement
with the earlier findings of Rajesh et al., (2005) and Reddy et al., (2004).
Heterosis for seed yield per plant ranged from -1.25 to 54.14% over better parent
and -3.66 to 53.14% over standard check, respectively. Four crosses viz. PRG 100 x ICP
87119, LRG 30 x ICPL 87119, PRG 100 x ICP 8863 and ICPL 85063 x ICPL 87119 exhibited
significant positive heterosis over mid parent, better parent and standard hybrid check for
seed yield per plant(Table 2). These four hybrids also registered higher seed yield per plant.
Such crosses are likely to give better transgressive segregants and could be used for further
improvement.
The magnitude of heterosis over better parent and standard check varied from cross
to cross for seed yield and its components indicating that all the characters distinctly differed
for mean heterosis and its range in desirable direction. Considerable high heterosis in certain
crosses and low in others revealed that, nature of gene action varied with the genetic make
up of the parents involved in the crosses. Such nature of heterosis helps in identifying
superior cross combinations and exploitation to select better transgressive segregants (Joshi
et al., 2001)
It will be of considerable interest to know the cause of heterosis for seed yield in
pigeonpea. A comparison of heterosis for seed yield per plant in four most heterotic crosses
over better parent and standard check (PRG 100 x ICPL 87119, LRG 30 x ICPL 87119, PRG
100 x ICP 8863 and ICPL 85063 x ICPL 87119 ) along with heterosis for other related characters
indicated that significant and positive heterosis over better parent and standard check for
seed yield per plant was also accompanied by significant and high positive heterosis for
87

KUMAR et al.
number of primary branches per plant, number of pods per plant, number of pod clusters per
plant and 100 seed weight. The cross PRG 88 x ICP 87119 showed significant positive
heterosis for number of primary branches per plant and 100 seed weight over mid parent and
standard check. The cross involving ICPL 85063 x ICP 87119 recorded significant positive
heterosis for number of pods per plant and seed yield per plant over better parent and standard
hybrid check. Similar findings were also reported by Wankhade et al, (2005) and Joshi (2001).
Many top heterotic hybrids for different attributes involved parental combinations of
high x high, high x low and low x low yielder. The present study further suggested that
heterosis for yield should be through component trait heterosis. Hybrid vigour of even small
magnitude for individual yield components may have additive or synergistic effect on the
end product. Graffius (1959) reported that the yield is the end product of multivariable interaction
between yield components. Similar findings were also reported by Mehta et al., (1991).
Thus, on the basis of per se performance and heterotic response the crosses viz., LRG 30 x
ICP 8863, PRG 100 x ICP 8863, LRG 30 x ICPL 87119, ICPL 85063 x ICPL 87119 and PRG
100 x ICPL 87119 appeared to be more suitable for practical plant breeding programme to
exploit heterosis.
REFERENCES
Graffius, J. E. 1959. Heterosis in barley. Agronomy Journal 51: 551-551.
Joshi, H. V., Mehta, D. R and Jadon, B. S. 2001. Heterosis of yield and yield components in
castor hybrids. Journal of Oilseeds Research 18: 164-169.
Kempthorne, O. 1957. An introduction of genetic statistics. John Wiley and Sons, New York,
pp: 458-471
Mehta, D. R., Vashi, P. S and Kukadia, M. O. 1991. Hybrid vigour in castor, Gujarat Agricultural
University Journal 17: 16-22.
Rajesh, R., Wankhade, K. B., Wanjari, G. M., Kadam and Jadhav, B.P. 2005. Heterosis for
yield and yield components in pigeonpea involving male sterile lines. Indian Journal of
Pulses Research 18: 141-143.
Reddy, S. M., Singh, S. P., Mehra, R. B and Govil, J. N. 2004. Combining ability and
heterosis in early maturing pigeonpea (Cajanus cajan (L) Millsp.) hybrids. Indian Journal
of Genetics and Plant Breeding 64: 212-216.
88

STUDY OF HETEROSIS FOR YIELD AND ITS COMPONENT
Table 1. Analysis of variance for co mbining ability of the characters stud ied in line x tester analysis in
pigeonpea
Source of
variation df
Days to
50%
flowering
Days
to
maturity
Plant
height
(cm)
No. of
primary
branches
No. of
clusters/
plant
No. of
pods /
plant
100 seed
weight
(g)
Seed
yield
Plant (g)
Replications 2 6.39 2.61 46.39 0.66 18.02 610.53 0.35 14.29
Treatments 33 372.69** 373.08** 403.50** 13.50** 403.21** 6157.64** 5.73** 99.22**
Parents
Parents vs.
Crosses
9 499.55** 522.09** 652.73** 12.64** 412.48** 5837.42** 9.47** 79.98**
1 634.09** 453.96** 1815.07** 56.74** 15.66 11835.38** 3.32** 226.97**
Crosses
23
311.68** 311.26** 244.61 11.96** 416.44** 6036.12** 4.38** 101.19**
Lines
5 551.06** 837.14** 367.28
11.70 447.21 9226.47 11.95** 63.79
Testers
Lines x
Testers
3
1010.28** 514.98* 541.38* 38.83** 644.99 9420.85 7.67** 385.40**
15 92.16** 95.23** 144.38 6.67** 360.47** 4295.74** 1.19** 56.82*
Error 66 3.42 2.71 194.44 1.31 28.10 1586.31 0.22 25.61
** Significant at 1% level, * Significant at 5% level
89

KUMAR et al.
Table 2. Heterosis over mid parent (H1), better parent (H2) and standard check (H3) in Pigeonpea
S.No Cross Days to 50% flowering Days to maturity
Plant height (cm)
No. of primary
branches/plant
H1 H2 H3 H1 H2 H3 H1 H2 H3 H1 H2 H3
1 PRG-100 x ICP-8863 5.63** 11.54** 2.24 3.75** 6.87** -1.97* 8.96 14.09* 12.33 27.45** 24.40** 38.30**
2 PRG-100 x ICPL-84036 3.06 5.94** -2.88 -1.29 -1.08 -9.65** 2.51 7.62 5.96 -6.12 -7.54 -2.13
3 PRG-100 x ICPL-87119 13.98** 28.32** 17.63** 1.99* 10.09** 0.98 8.98
20.68** 18.82** 27.31** 18.03** 46.28**
4 PRG-100 x ICPL-89044 4.26** 6.99** -1.92 2.91** 3.24** -5.91** 5.05 7.19 5.53 12.81 9.55 15.96*
5 PRG-88 x ICP-8863 4.98** 7.21** 4.81** 0.31 1.24 -3.35** 5.76 10.32 9.42 12.23 -6.70 3.72
6 PRG-88 x ICPL-84036 6.10** 6.62** 3.21* -1.16 1.08 -7.68** 1.09 5.72 4.86 21.87* 4.66 7.45
7 PRG-88 x ICPL-87119 6.49** 15.74** 13.14** -6.54** -1.24 -5.71** 6.35 17.29* 16.33* 29.21**
3.00 27.66**
8 PRG-88 x ICPL-89044 -2.64 -1.99 -5.45** 0.00 2.38** -6.69** 6.22 7.98 7.10 4.29 -9.33 -9.57
9 LRG-30 x ICP-8863 5.14** 12.58** 14.74** 4.26** 9.11** 6.10** 5.64 7.85 16.19* 24.46** 24.16** 38.03**
10 LRG-30 x ICPL-84036 7.67** 18.54** 14.74** 8.76** 17.67** 7.48** -0.99 0.83 9.17 -5.24 -8.65 1.06
11 LRG-30 x ICPL-87119 5.41** 6.15** 21.79** 5.56** 5.56** 12.20** 4.69 8.12 21.36** 19.73** 13.30* 40.43**
12 LRG-30 x ICPL-89044 -3.01* 6.98** 3.21* 3.29** 11.88** 1.97* -1.77 2.92 5.45 -12.52 -16.83* -7.98
13 LRG-38 x ICP-8863 7.64** 14.08** 3.85* 6.29** 10.22** -0.20 7.44 11.75 11.45 2.96 -8.37 1.86
14 LRG-38 x ICPL-84036 0.00 3.17 -6.09** 1.73 2.17* -7.48** 3.25 7.67 7.38 4.49 -3.63 -1.06
15 LRG-38 x ICPL-87119 11.53** 26.06** 14.74** 1.40 10.22** -0.20 -4.14 5.40 5.13 13.13 -3.86 19.15*
16 LRG-38 x ICPL-89044 2.56 5.63** -3.85* 3.36** 3.70** -6.10** 1.65 3.04 2.77 6.70 -0.27 -0.53
17 ICPL-85034 x ICP-8863 -6.20** 11.74** -17.63** 0.33 11.06** -11.02** 2.75 15.14 -0.06 14.12 -5.26 5.32
18 ICPL-85034 x ICPL-84036 12.03** 29.57** -4.49** 9.99** 17.69** -5.71** 10.72 24.42** 7.99 12.99 -3.11 -0.53
19 ICPL-85034 x ICPL-87119 11.56** 42.61** 5.13** 5.81** 23.10**
-1.38 2.29 21.61** 5.55 17.52* -6.44 15.96*
20 ICPL-85034 x ICPL-89044 7.34** 23.91** -8.65** 6.90** 14.25** -8.46** 14.92* 25.29** 8.75 16.74 1.33 1.06
21 ICPL-85063 x ICP-8863 -7.53** -5.35** -3.53* -5.76** -5.67** -8.27** 5.21 5.36 13.51 -4.28 -9.09 1.06
22 ICPL-85063 x ICPL-84036 11.50** 17.22** 13.46** 1.77* 5.17** -3.94** 2.63 2.75 11.00 12.34 10.88 13.83
23 ICPL-85063 x ICPL-87119 2.46 6.31** 13.46** 4.93** 9.70** 6.89** 4.72 10.32 19.18** 1.66 -8.15 13.83
24 ICPL-85063 x ICPL-89044 2.21 7.64** 3.85* 3.97** 7.56** -1.97* 6.84 9.75 12.45 15.05* 14.89* 14.89*
90

STUDY OF HETEROSIS FOR YIELD AND ITS COMPONENT
Table 2. contd….
Cross No. of clusters/plant No. of pods/plant 100 seed weight Seed yield/plant
1 PRG-100 x ICP-8863 10.42* 4.87 11.87* 3.15
0.92 3.15 0.92 3.15 0.92 51.70** 50.13** 22.80**
2 PRG-100 x ICPL-84036 -11.97 -21.51** -24.68** -3.09 -10.31** -3.09 -10.31** -3.09 -10.31** 5.41 -0.95 -20.60**
3 PRG-100 x ICPL-87119 10.98* 2.82 15.67** -1.94 -5.02 -1.94 -5.02 -1.94 -5.02 31.31** 28.18** 7.79
4 PRG-100 x ICPL-89044 -4.36 -14.64** -18.10** 1.50 -3.98 1.50 -3.98 1.50 -3.98 -5.81 -8.52 -26.73**
5 PRG-88 x ICP-8863 -18.16** -24.55** -19.52** -1.14 -4.18 -1.14 -4.18 -1.14 -4.18 9.74 4.14 -14.82*
6 PRG-88 x ICPL-84036 2.88 -5.60 -15.04** 0.36 -2.27 0.36 -2.27 0.36 -2.27 8.14 5.92 -22.21**
7 PRG-88 x ICPL-87119 -15.85** -24.27** -14.80** 7.42* 5.17 7.42* 5.17 7.42* 5.17 18.62* 11.11 -6.57
8 PRG-88 x ICPL-89044 -16.56** -23.37** -31.03** -1.99 -2.30 -1.99 -2.30 -1.99 -2.30 7.80 6.34 -19.72**
9 LRG-30 x ICP-8863 15.08** 6.47 13.57* 12.27** -0.31 12.27** -0.31 12.27** -0.31 58.31** 49.67** 37.43**
10 LRG-30 x ICPL-84036 -1.15 -9.62 -18.02** 11.31** 4.21 11.31** 4.21 11.31** 4.21 -4.79 -15.88* -22.76**
11 LRG-30 x ICPL-87119 10.17* -0.49 11.94* 6.19 -4.85 6.19 -4.85 6.19 -4.85 30.43** 24.94** 14.72*
12 LRG-30 x ICPL-89044 -5.88 -13.87* -21.87** -6.34 -14.21** -6.34 -14.21** -6.34 -14.21** -4.75 -13.22 -20.32**
13 LRG-38 x ICP-8863 -27.02** -37.69** -33.53** 12.54** -6.86* 12.54** -6.86* 12.54** -6.86* 0.07 -12.05 -28.06**
14 LRG-38 x ICPL-84036 13.86* 13.62 -14.25** -7.08 -19.30** -7.08 -19.30** -7.08 -19.30** 16.69 9.70 -22.74**
15 LRG-38 x ICPL-87119 4.75 -12.49** -1.55 8.55* -9.41** 8.55* -9.41** 8.55* -9.41** -9.75 -21.61** -34.09**
16 LRG-38 x ICPL-89044 19.47** 19.35** -9.92 -2.37 -16.88** -2.37 -16.88** -2.37 -16.88** 15.57 5.23 -20.56**
17 ICPL-85034 x ICP-8863 -7.89 -22.66** -17.50** -2.67 -19.19** -2.67 -19.19** -2.67 -19.19** 14.23 4.54 -14.49*
18 ICPL-85034 x ICPL-84036 12.15 10.14 -17.22** -4.54 -16.82** -4.54 -16.82** -4.54 -16.82** 11.30 9.32 -23.01**
19 ICPL-85034 x ICPL-87119 -9.55 -25.64** -16.35** 6.87 -10.53** 6.87 -10.53** 6.87 -10.53** -7.50 -16.39* -29.69**
20 ICPL-85034 x ICPL-89044 10.90 8.80 -18.06** -8.07* -21.48** -8.07* -21.48** -8.07* -21.48** 7.55 2.16 -22.88**
21 ICPL-85063 x ICP-8863 -20.49** -28.39** -23.61** -0.84 -10.88** -0.84 -10.88** -0.84 -10.88** 1.01 -1.12 -15.57*
22 ICPL-85063 x ICPL-84036 20.90** 13.60* -2.90 2.28 -3.01 2.28 -3.01 2.28 -3.01 0.77 -8.05 -21.50**
23 ICPL-85063 x ICPL-87119 1.26 -10.90* 0.24 6.62 -3.29 6.62 -3.29 6.62 -3.29 39.88** 31.78** 12.52
24 ICPL-85063 x ICPL-89044 24.98** 17.55** 0.48 6.64 -1.09 6.64 -1.09 6.64 -1.09 -1.20 -6.92 -20.53**
91

ABSTRACTS
Abstracts of Theses Accepted for the Award of Post-Graduate and
Doctorate Degrees in the Acharya N.G. Ranga Agricultural University,
Rajendranagar, Hyderabad - 500 030
Effect of carriers on the performance of herbicides in rainfed castor
and sorghum
Student: P. Anantha Kumari
Major Advisor: Dr. V. B. Bhanu Murthy
Department of Agronomy
The present study was conducted during Kharif 2003-04 and 2004-05 at Hayathnagar Research
Farm of Central Research Institute for Dryland Agriculture (CRIDA), Hyderabad. In the experiment – I on
castor, alachlor was incorporated into the soil before sowing (PPI) and applied on the same day after sowing
as pre-emergence to weeds and crop as well along with different carriers. Granular form was also tested for
comparison. In the experiment – II on sorghum, atrazine was incorporated into the soil (PPI) and applied after
sowing as pre-emergence spray and also with different carries such as soil, sand and urea. In case of castor,
PPI of alachlor resulted in better weed control under varying soil moisture and rainfall conditions. Application
of alachlor granules was also effective during both the years. Days to 50% flowering was delayed by 22 days
during 2003 and by 20.6 days during 2004. Hand weeding coupled with intercultivation at 20, 40 and 70 DAS
resulted in weed free conditions for most of the crop-growing period that led to taller plants, more leaves per
plant with higher LAI and higher dry matter production and ultimately higher bean yield of 820 kg/ha during 2003
and 961 kg/ha during 2004. The weed control in rainfed sorghum indicated that the early post-emergence
application of atrazine with soil as carrier was most effective during 2003, a good rainfall year and the effect
was slowly improved with passage of time during 2004 till maturity.
The crop growth was good with hand weeding and also in the plots of early post-emergence
atrazine. The days to 50% flowering was delayed by 12.6 days to 20 days due to unweeded conditions during
2003 and 2004, respectively. The returns per rupee invested on early post-emergence atrazine with soil as
carriers were Rs. 14.4 and Rs. 11.1 as against Rs. 2.3 and Rs. 3.7 due to hand weeding. The residues of
atrazine could not be traced but, 2,4-D was found to persist after 45 days of application, based on bioassay
studies. The study clearly showed that PPI of alachlor was highly effective in caster while early post-emergence
application of atrazine with soil was best weed control method in sorghum. Carriers have shown some effect
on weeds and the WCEs were nearly 40-50% in case of pre-emergence herbicides. But carries did not help
in improving the efficiency of post-emergence herbicides. The returns per rupee invested were more with
herbicidal use compared to hand weeding. Ph.D (2007).
92

ABSTRACTS
A Study on impact of ANGRAU production technologies
for selected crops
Student: G. Venkata Murali Major Advisor: Dr. P. Ramesh Kumar Reddy
Department of Extension Education
In Andhra Pradesh, Acharya N. G. Ranga Agricultural University formerly known as Andhra Pradesh
Agricultural University (APAU) plays a major role in agricultural research activities. These research activities
are need based and location specific, which are carried out at RARS as well as at other Research Stations. A
few studies on adoption and performance of agricultural technologies have been conducted in different parts
of the country. The impact of ANGRAU production technologies for selected crops was studied using explorative
research design. Three districts viz., Krishna, Anantapur and Warangal districts, representing Coastal,
Telangana and Rayalasema were selected as sample area. Two mandals were selected from each of the
district. Three villages were selected from each of the mandals. A total of 12 farmers from each selected
village were selected i.e., for each crop four farmers were selected. Thus, a total sample is 216 farmers and
research scientists from concerned crops and all the extension scientists of DAATTCs and KVKs working in
sample districts were selected. The data were collected by personal interview method through pre-tested
interview schedule. Adoption, attitude, productivity, profitability and livelihood improvement of the selected
respondents were included in the study. Statistical procedures like frequency, percentage, standard deviation
and paired‘t’ test were adopted to analyse and interpret the data. Salient findings of the study were a majority
(50%) of rice farmers of Krishna district possessed favorable attitude and medium (41.67%) level of adoption
of recommended ANGRAU technologies. Majority of the respondents (41.67%) had favorable attitude towards
recommended technologies, whereas, majority of the respondents occupied medium category (37.50%) of
adoption and same number of the respondents (37.50%) were fall under low level of adoption of recommended
technologies. Majority of the respondents (45.83%) recorded favorable attitude and low level of adoption
(62.50%) of recommended technologies. Calculated values of the t-test concluded that the‘t’ values were
found to be non-significant for all the impact indicators except physical and natural capital, after adoption of
recommended technologies by groundnut farmers of Warangal district.
Major problems expressed by the research scientists in technology generation of rice, groundnut
and chilli crops were biotype variation in gall midge, lack of effective intercropping system in groundnut and low
participation of extension scientists and farmers at the time of research project proposal suggestions were
given by the research scientists to overcome these problems were more research is needed on different
biotypes, research on specific intercropping system should be needed and encourage the participation of
researchers, extension scientists and farmers during the project proposal. Major problems expressed by the
extension scientists in technology dissemination of rice, groundnut and chilli crop were lack of high yielding
and early maturing varieties, ferti-cum seed drillers are unsuitable to rainfed conditions and no hybrids from
the university. Suggestions given by the extension scientists to overcome these problems were research
scientists should work on plant genetic characters, suitable ferti-cum seed drillers should be designed and
university should concentrate on developing the hybrids. Ph.D (2007).
93

ABSTRACTS
Genetic analysis for yield, its components and fusarium wilt
resistance in castor (Ricinus communis L.)
Student: V. Sridhar
Major Advisor: Dr. Kuldeep Singh Dangi
Department of Genetics and Plant Breeding
The present investigation was carried out at Regional Agricultural Research Station, Palem and
College Farm, College of Agriculture, Rajendranagar, Hyderabad from Kharif, 2005 to rabi 2006-07. Fifty five
germplasm lines/varieties were screened in a wilt sick plot of Fusarium oxysporum f. sp. Ricini at Regional
Agricultural Research Station, Palem, during Kharif, 2005. Of the 55 genotypes screened, nine genotypes
showed resistance to wilt (50% infection). Five lines were crossed with fifteen testers and the resultant seventy
five hybrids along with parents and two standard checks viz., DCH-177 and DCH-32 were evaluated for
combining ability (Line x Tester design) and heterosis. Data were recorded on ten quantitative traits. The
results of combining ability analysis revealed the importance of additive gene action for the characters viz.,
number of nodes upto primary spike, number of capsules per primary spike and 100 seed weight while nonadditive
gene action for plant height, primary spike length, seed yield per plant and oil content. Both additive
and non-additive gene actions were important for the characters like days to 50% flowering and days to
maturity. Among the parents VP-1. LRES-17, DPC-9, DCS-5, RG-2374, RG-1713, RG-1719, 48-1, Haritha,
RG-246 and RG-224 were adjudged as the best general combiners for seed yield per plant, whereas Kranthi,
DPC-9, RG-1417, DCS-9, RG-2724 and RG-224 possessed favourable genes for oil content. Hence, these
female and male parents can be utilized in future breeding programmes to evolve potential hybrids. However,
the parents LRES-17 and DCS-9 and RG-2724 were found to be good combiners for earliness and dwarfness,
apart from seed yield and oil content, respectively.
Since L x T design does not provide comprehensive picture on gene action governing the traits,
generation mean analysis through joint scaling test was studied in four crosses for ten characters. The results
deciphered that, simple additive dominance model exhibited lack of good fit for most of the characters in all the
four crosses studied. Dominance and epistic interations were played a major role in the inheritance of yield and
its components in castor. It can be categorically stated that, reciprocal recurrent selection or diallel selective
mating are the need of the hour to modify the genetic architecture of castor for attaining higher yields. In the
present study, on the basis of per se performance, combining ability, heterosis and wilt resistance for two
hybrids Kranthi x RG-224 and LRES-17 x RG-224 were found most promising for seed yield and other
components. These hybrids may be further evaluated for their stability over locations and years in contrast
environments for exploitation of heterosis on commercial scale. Ph.D (2007).
94

Comparative Studies on Production Potential of Model Agroforestry
Systems under Integrated Nutrient Management Practices in Drylands
Student: E. Rajanikanth
ABSTRACTS
Major Advisor: Dr. M.V.R. Subrahmanyam
Department of Agronomy
The present study was conducted in Alfisols at Students’ Farm, College of Agriculture, Rajendranagar,
Hyderabad during Kharif seasons of 2005 and 2006. The present investigation comprised of two agroforestry
models i.e. guava based agrihorticultural system and hardwickia based agrisilvicultural system. The field
experiment was laid out in spilt plot design with three replications separately in 8 year old guava plantation as
well as in 11 years old hardwickia plantation. Among the different cropping situations studied in guava based
agrihorticultural system, growth parameters like number of branches per plant, number of leaves per plant,
leaf area per plant, leaf area index per plant, dry matter production per plant and crop growth rate, physiological
parameters like photosynthetically active radiation, leaf temperature and different resistance, yield attributing
characters like number of filled pods per plant, 100 pod weight and shelling percentages, pod and haulm yields,
NPK uptake and gross and net monetary returns from the crop significantly increased under solecropping of
groundnut when compared to intercropping of groundnut in nutritioned and unnutritioned guava plantations.
Among different integrated nutrient management practices studied, growth parameters, physiological
parameters, yield attributing characters, pod and haulm yields, harvest index, oil content and NPK uptake
were significantly increased to the maximum extent with the application of recommended dose of NPK in
combination with vermicompost as well as enriched FYM. The next best treatments were application of
recommended dose of NPK either alone or with FYM.
Among the interaction effects between cropping situations and integrated nutrient management
practices, solecropping of groundnut with application of recommended dose of NPK along with vermicompost
as well as enriched FYM showed the best performance in yield attributes characters and pod and haulm yields
in both the agroforestry models studied. However, intercropping of groundnut in pollarded hardwickia trees
proved effective in improvement of yields of groundnut with the same integrated nutrient management practices
when compared to other intercropping situation in pollarded hardwickia plantation which gave higher monetary
returns than solecropping situation. Overall groundnut intercropping either with guava irrespective of nutrition
or with hardwickia trees with pollarding showed better performance of crop growth, yield attributes and yields
next to solecropped groundnut under rainfed situations. Total monetary returns from the system (tree+crop)
were higher under intercropping situations either in guava trees or pollarded hardwickia trees when compared
to solecropping situations with the combination of organic manures especially with enriched FYM or FYM with
the recommended dose of inorganic fertilizers. Ph.D(2007).
95

ABSTRACTS
Studies on genetic divergence, heterosis and combining ability in
paprika (Capsicum annuam L.)
Student: S. Surya Kumari
Major Advisor: Dr. C. Ravi Shankar
Department of Horticulture
The present investigation was carried out at Regional Agricultural Research Station, Lam Farm,
Guntur, during Kharif 2005 to 2007 with 94 paprika accessions to study the genetic variability heritability,
genetic advances as per cent of mean, genetic divergence, character association and path analysis, heterosis
and combining ability for several economic characters in paprika genotypes. The results of multivariate
analysis indicated that, random distribution of 94 paprika genotypes into ten clusters in case of D 2 analysis and
into twelve clusters in case of principal component analysis, which indicated that there is no association of
genetic diversity with geographic diversity. By Mahalanobis’ D 2 statistic, it could be inferred that the fresh fruit
weight per plant followed by oleoresin content and capsanthin content, contributed maximum towards genetic
divergence Based on the inter and intra cluster distance among the groups, fourteen parents were selected 3
from cluster X, 3 from cluster IX and one each from clusters, I, II, III, IV, V, VI, VII and VIII respectively keeping
in view the characters contributed for divergence to obtain better and desirable seggregants. Principal
component analysis identified three principal components (PCs), which contributed 78.47 per cent of cumulative
variance. The population with high PCI values was characterize by fresh fruit yield per plant fresh to dry fruit
recovery percentage, number of fruits per plant, capsanthin content and oleoresin content. Where as population
with high PC2 value was characterizes by high oleoresin content, capsanthin content, fresh to dry pod
recovery percentage, plant spread and days to 50 per cent flowering. Correlation studies indicated significant
positive association of plant height, plant spread, and number of fruits per plant. Fruit girth and seeds per fruit
and capsanthin content with dry fruit per plant. Path analysis studies revealed high positive direct effect of
number of fruits per plant on dry fruit yield per plant. In addition, weight of dry stalkless chillies per plant,
number of seeds per fruit and capsanthin content, which exerted positive direct effect.
The superiority of the hybrids in crosses was estimated over mid parent, better parent and standard
check for all the 17 characters studied. The cultivars Byadigi Kaddi was selected as a standard check. For
high productivity the crosses LCA-436 x CA-960, LCA-428 x KTPL-19, LCA-428 x LCA-424, LCA-436 x
KTPL-19, LCA-432 x KTPL-19 were identified as the best heterotic combinations.
The hybrid LCA-437 x CA-960 is considered to be the best heterotic combination, which has
recorded high oleoresin content (16.7 per cent), maximum capsanthin content (7249 EOA units) and minimum
capsaicin content (0.09%). For all the 17 characters studied except for fruit length, number of seeds per fruit,
and 100 seed weight, about 50 per cent of the crosses recorded significant heterosis over the mid parent. For
characters like plant height, fresh fruit per plant, dry fruit yield per plant, days to maturity and number of fruits
yield per plant, majority of the hybrids showed significant heterosis, whereas for character like seeds mid per
fruit, seed weight, capsaicin, less than 50 per cent of crosses showed significant mid parent heterosis.. But the
combining ability analysis revealed more of SCA variance than GCA variance except for capsanthin content
indicating that non-additive type of gene action was predominant for all the characters studied and additive
gene effect for capsanthin content. Among 14 parents, 7 parents have significant positive gca effect for dry
fruit yield per plant with the maximum observed in LCA-428 (134.49) followed by LCA-436 (111.51) and LCA-
432 (53.45). In the present study the top five hybrids with high per se performance for fresh fruit yield per plant
were LCA-436 x CA-960 (279.7), LCA-436 x B. Dabbi (207.39), LCA-422 x CA-960 (217.19), LCA-431 x
B.Dabbi (220.3) and LCA-414 x B.Dabbi (175.06). These hybrids also exhibited high sca effects for total yield
96

ABSTRACTS
per plant and yield components. Similarly the crosses LCA-437 x KTPL-19 and LCA-437 x CA-960 had
significant sca effects in desirable direction for capsaicin content. The parents of the crosses were positive x
negative general combiners. However, it can be observed that the cross LCA-414 x KTPL-19 can be considered
the best as it has desirable sca effects for quality parameters both capsaicin and capsanthin. Considering the
total yield and quality parameters of paprika in the present study the crosses LCA-436 x CA-960, LCA-436 x
B. Dabbi, LCA-422 x CA-960, LCA-414 x B. Dabbi standout for potential yield and quality characters. However,
the present study has resulted in F I hybrids with higher yield potential but the same did not have maximum
quality parameters. Ph.D(2007).
Integrated Management of Red Rot Disease in Sugarcane Incited by
Colletotrichum falcatum Went
Student: K. Krishnamma
Major Advisor: Dr. T. Vithal Reddy
Department of Plant pathology
Investigations were carried out on microflora associate with phylloplane, rhizosphere and internal
stalk tissue of healthy canes of red rot susceptible sugarcane varieties. Eight species of fungal and eight
bacterial isolates were obtained. Out of them, fungal isolate Trichoderma viride and bacterial isolate
Pseudomonas aeruginosa were found superior to inhibit the red rot pathogen under in vitro conditions. Field
experiments were conducted to find out the most effective method of application of T. viride and P. aeroginose
in reducing the red rot diseases intensity. Soil application alone or soil application together with other treatments
were found to be most effective in reduction of intensity of the disease and also improvement in quantitative
and qualitative parameters. The fungicide hexaconazole 5% EC at 0.002 per cent concentration inhibited the
mycelia growth of the fungus. Under field conditions, the fungicide at 0.2 per cent foliar spary was proved to
be the best in reduction of per cent disease intensity. It also improved the quantitative and qualitative parameters
due to the reduction in the pathogen in the treated canes. Among the 41 sugarcane genotypes screened, 32
genotypes were found to be resistance and four moderately resistant.
In the integrated management of red rot disease, maximum reduction in per cent intensity was
observed when biocontrol agent was applied thrice followed by the treatments received soil application one
time in combination with other treatments. Improvement in quantitative parameters might be due to reduction
in per cent disease intensity. Exploitation of native potential biocontrol agents and need based foliar spray of
the fungicide in combination of other cultural, agronomical strategies has high potential to manage the disease
under field conditions in the absence of resistance genotypes red rot pathogen. Ph.D(2007).
97

ABSTRACTS
Effect of Calcium, Plant growth Regulators, Fungicides and package
material on quality and Shelf Life of Acid Lime
(Citrus aurantifolia Swingle)
Student: Meduri Madhavi
Major Advisor: Dr. K. Hari Babu
Department of Horticulture
A set of four experiments was conducted to find the effect of different pre and post harvest application
of calcium compounds, growth regulators and fungicides, packages materials and their combinations on shelf
life and quality of acid lime (Citrus aurantifolia) cv. Balaji at S.V. Agricultural College, Tirupati, Andhra Pradesh.
Physiological loss in weight of acid lime fruits increased gradually during storage. Pre and post harvest
application of BA reduced the PLW when compared to other treatment and control. Calcium and increase in
concentration of calcium and growth regulators (BA and GA) in pre and post harvest treatments. However,
calcium and magnesium decreased during storage whereas potassium increased gradually with a decrease
at the end of storage Fruit treated with gungicides and untreated fruits exhibits no influence on mineral
composition of Ca, Mg and K. But fruits treated with BA retained better quality and increased shelf life over the
other treatments and control.
With regard to different packages materials, vented polythene lined CFB boxes were found to
reduce PLW, TSS total sugars, titratable acidity, ascorbic acid content and antioxidant enzyme actively.
Further, ripening changes like development of carotenoids were effectively delayed with better retention on
firmness and increase in the shelf life. Mineral like Ca, Mg and K were higher in fruits stored in vented
polythene lined CFB boxes. The treatmental combination with preharvest spray of BA at 30 ppm + postharvest
dip with BA 75 ppm and stored in vented polythene lined CFB boxes was found to be effective in delaying
postharvest changes, improving quality and extending shelf life of acid lime fruits. Ph.D(2007).
Studies on development of transgenic male sterile and restorer lines
in safflower (Carthamus tinctorius L.) using unedited mitochondrial
gene(s)
Student: K. N. Yamini
Major Advisor: Dr. S. Sokka Reddy
Department of Genetic and Plant Breeding
The present investigation was carried out with aim of developing constructs and using then for the
development of transgenic male sterile and restores lines in safflower. In the first phase, studies were taken
up with the aim of identifying suitable candidate genes for this approach. Three safflower mitochondrial genes
viz., atp6, atp9 and nad3, were studied. In the next phase, constructs for induction of transgenic male sterility
and restoration of fertility were developed using the u-nad 3/u-atp9 genes. Vectors for restoration of fertility
based on post-transcriptional gene silencing (PTGS) approach were developed so that they could down
regulate the expression of u-nad/3u-atp9 genes thereby restoring fertility. The full-length antisense constructs
of these u-nads3 and u-atp9 genes were developed under both 35S promoter (SANP and SSAP) and TA29
98

ABSTRACTS
promoter (TANP and TAAP). Also the ihp-RNA vectors against both these genes under 35S promoter (p-ihp
nad 3 and p-ihp atp-9) and under TA29 promoter (p-T-ihp nad3 and p-T atp9) were developed. As reproducible
regeneration and transformation protocols were not available in safflower, attempts were made under the
present investigation towards regeneration of safflower shoots using immature embryos as explants.
The two constructs for induction of male sterility i.e., LBA4404: pBin-TCNN-Bar and LBA4404: pBin-
TCAN-Bar as well as two constructs for restoration of fertility i.e., LBA4404: p-Bin-T-ihp nad3 and LBA4404:
pBin-T-ihp atp9 were used to develop transgenic safflower and tobacco plants. All these transgenic plants
were confirmed by PCR analysis for presence of the transgene and by leaf assays for sensitivity to
phosphinithricin or hygromycin (depending on the vector used). The plants and their flowers were observed
for any morphological differences as well as for pollen fertility. Tissue culture derived shoots of safflower were
lanky and they did not produce many flowers indicating the inherent problem of de novo regenerated shoots.
Among the few transgenic safflower plants that reached flowering, three out of the six obtained with TCNN-Bar
construct and one out of five obtained with TCAN-Bar construct, showed partial sterility (34.2%-69% and 32%
pollens fertility respectively). Of the tobacco transgenic plants that reached flowering, one plant out of thirty
obtained with TCNN-Bar construct was sterile with less that 5% pollen taking up actetocarmine stain and
these pollen germination medium. This study has provided the preliminary ground work and proof-of-concept
that the genes atp9 and nad3 could be used as candidate genes for induction of male sterility in safflower and
tobacco. The future line of work involves further molecular characterization of these transgenic plants along
with development and characterization of more number of transgenic plants with these constructs to provide
a strong footing to this approach. This could lead to development of a complete pollination control system, not
only in safflower, but also in other crops. Ph.D(2007).
Pollution potential of sewage sludge and Urban Compost and Their
Evaluation as Manures in Tomato – Cabbage Cropping Sequence
Student: P. Kavitha
Major Advisor: Dr. K. Jeevan Rao
Department of Soil Science and Agricultural Chemistry
The present investigation entitled “Pollution potential of sewage sludge and urban compost and their
evaluation in tomato – cabbage cropping sequences” was carried out at both in the field (2003 – 04) and
greenhouse conditions simultaneously at College Farm, College of Agriculture, Rajendranagar, Hyderabad.
In order to know the mineralization pattern and to understand the changes in the status of heavy metals of
organic manures and for organic matter fractions, an incubation study was also carried out. The experimental
soil was low in available N (196.3 kg ha -1 ) and P 2
O 5
(21.16 kg ha -1 and medium in K 2
O (305.3 kg ha -1 A
laboratory incubation study incubation study was also conducted to know the transformation of heavy metals
during decomposition of organic manures applied. The treatment for tomato crop in the Kharif 2003 with four
main treatments viz., 0, 50, 75 and 100 per cent RDF and seven sub treatments viz., two levels of each
sewage sludge, urban compost, FYM (20 and 40 T ha -1 ) and control (without manure) and combinations of
fertilizer levels along with organic manorial levels, thus, total of 28 treatments, each replicated thrice was laid
out in a split plot design. The highest fresh fruit yield (43.12 t ha -1 ) and fruit dry matter (3105 kg ha -1 ) of tomato
were resulted in treatment with sewage slugde applied @ 40 t ha -1 along with 100 per cent RDF. Greenhouse
99

ABSTRACTS
also showed higher fresh fruit yield (1142 g pot -1 ), plant dry matter (84.84 g pot -1 ) and head dry matter (82.22
g pot -1 ) with sewage sludge applied @ 40 t ha -1 along with 100 percent RDF.
The mean highest concentration and uptake of all heavy metals in tomato crop resulted with the
application of sewage sludge @ 40 t ha -1 followed by 20 t ha -1. . Application of manures either alone or in
combination with fertilizers did not have significantly influence on quality parameters of tomato fruit at harvest
but highest protein content (18.31 per cent), ascorbic acid (25.50 mg 100 g -1 ) and total soluble solids (4.71 per
cent) were observed in sewage sludge applied @ 40 t ha -1 along with 100 per cent RDF . The highest concentration
of major, micronutrients and heavy metals and their uptake of cabbage was noticed in the sewage sludge
applied@ 40 t ha -1 along with 100 per cent RDF closely followed by sewage sludge applied @ 40 t ha -1 along
with 75 per cent RDF both under field and greenhouse experiments. Whereas the highest Mn concentration
and uptake in plant and head were recorded in sewage sludge applied @ 40 t ha -1 along with 50 per cent RDF.
The results from organic manures incubation study showed that production of humic fractions (humic acid and
fulvic acid) were maximum with sewage sludge (14.23 and 3.42 per cent) followed by urban compost (9.90
and 2.52 per cent) and FYM (9.12 and 2.31 per cent). The HA production increased with increase in period of
incubation from initial to 120 days in all the treatments, while FA production initially increased upto 80 days and
decreased thereafter.
The highest benefit : cost ratio obtained in treatment with sewage sludge applied @ 40 t ha -1 along
with 50 per cent RDF for tomato (2.77) and residual sewage sludge applied @ 40 t ha -1 along with 100 per cent
RDF for cabbage crop (5.51). However, applied data of economic analysis (from both the crops i.e., tomato
and cabbage) indicated that the highest B:C ratio (3.88) was obtained with sewage sludge applied @ 40 t ha -
1
along with 75 per cent RDF. To obtain higher income and to maintain better soil conditions, application of
sewage sludge @ 40 t ha -1 along with 75 per cent RDF for tomato – cabbage cropping sequence is
recommended. Ph.D(2007).
Studies on the effect of Pre and Post Harvest handling technologies
on Extension of vase life of carnation flowers (Dianthus caryophyllus
L.)cv. Domingo
Student: N.Sunanda Rani
Major Advisor: Dr. R. Chandra Sekhar
Department of Horticulture
The present investigation entitled “Studies on the effect of pre and post harvest handling techniques
on extension of vase life of carnation cut flowers, College of Agriculture, Acharya N. G. Ranga Agricultural
University, Rajendranagar, Hyderabad, during October 2005 to March 2007. A total of nine experiments were
conducted, from which the first experiment was conducted to evaluate the appropriate stage of harvest and
age of mother plant. The flower harvested at paint brush from 6 months old mother plant recorded maximum
vase life (13.62 days) with maximum flower diameter (5.98 cm) and quality, though the flowers harvested at
tight bud stage recorded highest vase life (15.67 days) they did not open completely as that of flowers
harvested at paint brush stage. Among the different biocides studies, 8-HQS 300 ppm was very effective in
increasing the vase life of carnation cut flowers. Among the different organic extracts, neem extract at 2 per
cent has recorded maximum vase life over other organic extracts studied. From a set of six experiments, the
100

ABSTRACTS
best treatments were selected based on their physiological, biochemical and anatomical parameters to prolong
maximum vase life, 8-HQS 300 ppm (biocide), neem extract 2% (organic extract), STS 5.5 mM (ethylene
inhibitor) and AgNO 3
50 ppm (mineral salt) were tried in different combinations along with sucrose 5 per cent
commonly for all the treatments to study their combined effect. Among the different treatment combinations
tried, 8-HQS 300 pmm + AgNO 3
50 ppm + sucrose 5 per cent significantly increased the vase life by 209 per
cent over control. Cut carnations were pulsed with best treatment combinations i.e., 8-HQS 300 pmm +
AgNO 3
50 ppm + sucrose 5 per cent for 24 hours and packed with three different packaging material (polythene
sheet, tissue paper, craft paper) at four levels of ventilation (0%, 20%, 40% and 60%) in corrugated fibre board
boxes (CFB). Later, they were stored in room temperature for 4 days (as prevailing in domestic market).
Based on physiological loss in weight, per cent spoiled flowers / wilted or faded flowers was subsequently
evaluated for vase life. The treatment of tissue paper with 20 per cent ventilation CFB recorded maximum
vase life (9.01 days) followed by polythene sheet with 20 per cent ventilation _ CFB (8. 51 days). These
flowers also maintained moderate levels of anthocyanin content in flower petals (4.82 mg Congo Red/g f wt)
compared to other treatments. Ph.D(2007).
“Studies on propogation, production and post harvest storage in
Kakrol( Momordica dioicA Roxb.)”
Student: T. S. K. K. Kiran Patro
Major Advisor: Dr. K. Malla Reddy
Department of Horticulture
A set of seven experiments were conducted to standardize the propagation, production and post
harvest storage methods in kakrol fruits at Agriculture Research Institute and Post Harvest Technology
Laboratory, College of Agriculture, Rajendranagar, Hyderabad, Andhra Pradesh during the period from June
2005 to November 2006.
The experiment on the effect of different chemical temperatures and their combinations on breaking
seed dormancy in kakrol was studied.
The studies on effect of different growth substances and type of cutting on root formation in kakrol
vine cutting revealed that male cuttings treated with IBA at 1500 ppm recorded early and higher percentage of
rooting (92.60), number of roots per cutting, length of the shoot, number of leaves per cutting and percentage
of establishment compared with other treatment combinations.
The studies on the effect of different chemicals on shelf of kakrol fruits revealed that in GA 3
(10 ppm)
physiological loss in weight and percentage of spoilage was lowest, higher total soluble solids, titrable acidity,
ascorbic acid content, reducing sugars and organoleptic score compared with all other chemical treatments.
The studies on the effect of different gauges of polythene bags with different ventilation levels on the
shelf life of kakrol fruits recorded significantly lower physiological loss in weight at 0 per cent ventilation
irrespective of gauges. The spoilage percentage was lower at 0.5 per cent ventilation irrespective of gauges.
The studies on effect of gamma irradiation on the shelf life of kakrol fruits revealed that 0.25 kGy at
room temperature and in cold storage recorded lower physiological loss in weight and percentage of spoilage.
101

ABSTRACTS
Further it also recorded the higher total soluble solids, titrable acidity ascorbic acid content, reducing sugars
and organoleptic score expects total soluble solids than their rest of the irradiation treatments and control. The
number of days of storage in cold storage was 12 days compared to nine days at room temperature storage.
The studies on effect of different chemicals for improving quality of dehydrated kakrol fruit revealed
that among all the treatments, blanching for 30 seconds + 2000 ppm potassium metabisulphite recorded the
higher rehydration ratio and the lower final moisture content of dried pieces, per cent loss of total soluble
solids, per cent loss of titrable acidity, per cent loss of ascorbic acid content and per cent loss reducing
sugars. The study on storage life and quality parameters of rehydrated products revealed a gradual decrease
in cooking quality, texture, colour and appearance, taste, flavor and overall acceptability with increase in
storage period from zero to sixth month except final moisture content of dried pieces which increased with
increase in storage period. Ph.D(2007).
Exploitation of Diverse cytoplasmic male sterile sources for the
development of heterotic hybrids with resistance to Alternaria leaf
blight disease in sunflower (Helianthus annus L.)
Student: M. Sujatha
Major Advisor: Dr. K. Hussian Sahib
Department of Genetics and Plant Breeding
The present investigation entitled “Exploitation of diverse cytoplasmic male sterile sources for the
development of heterotic hybrids with resistance to Alternaria leaf blight disease in sunflower (Helianthus
annus L.)”. was conducted using six different cytoplasmic male sterile lines belonging to diverse cytoplasmic
sources viz., CMS 234A (PET 1), CMS 7-1A(PET 1),DCMS 36 (ARG), DCMA 1 (GIG I), DCMS 15 (GIG 1)
and 20 diverse inbred lines,. The study was aimed to identily the effective restorers for the six diverse CMS
lines, genetics of fertility restoration, extent ot heterosis, combining ability and to identify a potential donor with
resistance to Alternaria leaf blight disease. The experiment was laid out at Directorate of Oil seeds Research,
Rajendranagar, Hyderabad during rabi 2004-05, Kharif 2005, rabi 2005-06 and kharif 2006.
Six elite CMS lines possessing four different cytoplasmic sources were crossed with 20 diverse
inbred lines. The resultant 120 hybrids were evaluated for fertility restoration / maintainer pattern of inbred
lines. Out of 20 inbreds, 16 inbreds restored fertility for CMS 234A (PET 1) and CMS 7-1A (PET 1), 12 inbreds
for DCMS 6 (PET 2), 14 inbreds for DCMS 36 (ARG), 3 inbreds for DCMS 1 (GIG 1) and DCMA 15 (GIG 1).
Out of 120 hybrids, fertility was restored in 64 hybrids. These 64 fertile hybrids were evaluated for yield and
yield contributing traits, diseases reaction against Alternaria leaf blight along with parents ad two standard
checks. Data generated on a set of 40 F 1
s (4lines x 10 testers) were utilized for estimation of combining ability
and heterosis.
The combining ability analysis was studie using four CMS lines, 10 restorers and 40 hybrids. The
estimates of variance components revealed that SCA variance was higher in magnitude compared to GCA
variance except head diameter indicating the predominance of non-additive gene action while additive gene
action for head diameter. Among the lines, DCMA 36 for seeds yield, DCMA 6 for oil content were found to be
good general combiners and possessed favourble alleles for these traits. Among the testers , DRS 9. DRS
102

ABSTRACTS
102, RHA 340 and DRS 34 were adjudged as good general combiners for seed yield, oil content and other
contributing characters. Among the forty cross combinations DCMS 6 x DRS 22, DCM 36 x DRS 16, DCMS
6 x DRS 45, CMS 7-1A x RHA 340, CMS 234 A x DRS 16 were found to be good specific combiners and other
yield contributing characters.
Among the forty hybrids studied for heterosis CMS 7-1A x DRS 45, DCMS 36 x DRS 9 recorded
positive significant heterosis, heterobeltiosis and standard heterosis over two checks (KBSH 1 and PAC
1091) for seed yield and oil content also. These hybrids along with seed yield also recorded significant positive
heterosis for other yield contributing characters.
The 26 parents and 64 hybrids were screened both under field and laboratory conditions for their
resistance / susceptibility against Alternaria leaf blight disease. Four parents CMS 7-1A, DRS 9, DRS 63, DRS
34 and four hybrids CMS 7-1A x DRS 22, CMS 7-1A, DRS 9, DCMS 15 x DRS 9, DCMS 15 x DRS 63 showed
resistance reaction both under fields and laboratory conditions. It was observed that selected lines, testers
and their hybrids showed varied levels of resistance and none exhibited either immune or highly resistant
reaction to the disease. Ph.D(2007).
Evaluation of strains of Beauveria bassiana vuillemin to certain
production parameters and virulence against Spodoptera litura
fabricius
Student: P. Rajanikanth
Major Advisor: Dr. G. V. Subbaratnam
Department of Entomology
Investigation were conducted to evaluate four strains (Bb-13, Bb-11, Bb-5A and Bb-N) and two local
isolates (Bb-L-1 and Bb-L-2) of Beauveria bassiana Vuillemin for their pathogenicity against third instar larvae
of Spodoptera litura Fabricius, stability of their biological properties at various subculturing frequencies, mass
production ability on economically viable substrates and their compatibility with commonly used insecticides.
The effective strain was further evaluated for its bioefficiency in Green house conditions and its genetic
variability was compared with other strains following PCR-based RAPD analysis in the Department of Entomology
and AICRP on Biological control of crop pests and weeds, College of Agriculture, Rajendranagar, Hyderabad
during 2004-06.
In respect of biological properties, the strain Bb-5A was superior with significant higher radial growth,
higher conidial concentration, less time taken germination of spores and high spore viability.
The strain Bb-5A was highly virulent to S.litura followed by strains Bb-N, Bb-13 and Bb-13 and Bb-
11 in decreasing order of virulence. The local isolates Bb-L-1 and Bb-L-2 were least virulent to the insect. The
median lethal time (LT 50
) of the strain Bb-5A was low closely followed by Bb-13, Bb-11 and Bb-N while the local
isolates recorded higher LT 50
values at all the concentrations. The median lethal time values decreased with
increase in concentration for all the strains.
The conidia obtained from 14 days old cultures of B. bassiana were highly virulent to third instar S.
litura larvae compared to the conidia obtained from 7, 21 and 28 days oil cultures.
103

ABSTRACTS
The effect of frequent subculturing of B.bassiana on synthetic medium showed that the reduction in
radial growth, spore concentration, spore viability and pathogenicity were non significant upto seventh and
tenth subculturing but there after the strains recorded low reduction in its biological properties compared to
other strains and was stable.
Sorghum grain was the best substrate and Bb-5A as the effective strain for mass production of
B.bassiana.
B.bassiana strains and isolates were compatible with insecticides spinosad, imidacloprid, indoxiacrab
but not with chloropyriphos.
The analysis of genetic variability of the six strains showed that the strains Bb-13, Bb-11 and Bb-N
formed a single cluster with 100 per cent similarity and local isolates Bb-L-1 and Bb-L-2 formed into a separate
group with no variability. The strain Bb-5A exhibited maximum variability, which further confirmed its phenotypic
superiority over others. Ph.D(2007).
Evaluation of transgenic chickpea for resistance to pod borer,
Helicoverpa armigera (Hubner) (Noctuidae: Lepidoptera)
Student: Rama Krishna Babu Ayyaluri
Major Advisor: Dr. G. V. Subbaratnam
Department of Entomology
Evaluation of transgenic chickpea for resistance to pod borer H. armigera was carried out in Genetic
Transformation and Insect Rearing Laboratory at ICRISAT, Patancheru, Hyderabad.
The transgenic chickpea plants were developed through Agrobacterium-mediated gene
transformation method using a binary plasmid vector pBS 2310 carrying Bt cry1Ac gene for insect resistance
and npt II genes a selectable marker constituted with dual enhancer CaMV 35S promoter harboring in
Agrobacterium strain C 58. Axillary meristem explants of C 235 were infected and co-cultivated with
Agrobacterium.
Molecular analysis of these plants through PCR, RT-PCR, and Southern blot indicated the irrigation
of transgene cry1Ac into the genomic DNA of T 0
, T 1
and T 2
putative transgenic chickpea plants. Variation in the
segregation pattern of transgene was observed in the population of T 1
and T 2
generations. RT-PCR of cDNA
from randomly selected T0 and T1 plants showed expression at Mrna levels. The ELISA studies of T 1,
T 2
and
T 3
generation putative transgenic chickpea plants revealed that accumulation of Bt cry1Ac protein which
varied from 0.035 to 1.86 ng/ 100mg of leaf tissue as against 5-10 ng/ 100mg leaf in Bt cotton.
Bioassay of putative transgenic cry1Ac and cry1Ac chickpea plants against the 1 st instar larvae of
pod borer H. armigera showed considerable variation in terms of larval survival, leaf damage, and larval weight
gain.
The progeny of nine events each of cry1Ac (T 2
) and of cry1 Ab(T 3
) plants grown in contained field
trial were evaluated and the entire plants showed variable results interms of larval survival, leaf damage and
larval weights at the vegetative and flowering stages. The cry1Ac plants performed better compared with
cry1AbT 3
plants. Pod bioassays of cry1Ac transgenic chickpea with 3 rd instar larvae of H. armigera, the plants
104

ABSTRACTS
CPAC 5-7 and 7-7 of T 1
generation and plants CPAC 20-7-7 of T 2
generation showed significant reduction in
larval weight gain compared with non-transformed plants. Some of the plants of T 1
and T 2
generation of cry1Ac
showed resistance and moderately resistance.
In the present study, some of the plants of the progeny of T 0
CPAC 1, 5, 7, 8, 9, 19 and 20 affected the larval
weight gain, but consistency was not observed in the antibiosis performance against H. armigera larvae in
subsequent generations. It is presumed that, the physiology of the plant, interaction of toxic protein with acid
metabolic cycle with in the plant and internal gut environment of the larva due to consumption of the acid
exudates of the plant may influence the potency of the Bt toxin in the chickpea. Hence, to produce transgenics
with higher level of expression of Bt toxins in chickpea plants, the research need to be oriented with due
consideration to all the above factors. Ph.D(2007).
Studies on insects pests of important medicinal plants
Student: K. Vijaya Lakshmi
Major Advisor: Dr. J. Satyanarayana
Department of Entomology
Studies on insect pests of important medicinal plants viz., coleus (Coleus forskohli) (Wiild) Briq,
Wintercherry (Withanai Somnifera) (L) Dunal, Senna (Cassia angustifolia) Vehl, Kalmegh (Andrographis
paniculata) (Burm.F) Nees and Muskmallow (Abelmoschus moschatus) Medic were carried out at Herbal
garden, College of Agriculture, Rajendranagar during July 2005-06.
Two peaks of spike borer (Helicoverpa armigera) population were seen on Coleus (C.forskohli) and
recorded as major pest due to highest spike damage caused by it during the crop growth period.
Nearly five insect pests viz., hadda beetle (Henosepilachna vigintioctopunctata), Fruit borer
(Helicoverpa armigera), red cotton bug (Dysdercus cingulatus), stink bug (Nezara viridula) and cow bug
(Otinotus oneratus) were recorded on Winter cherry. Among them hadda beetle and fruit borer occupied
major pest status as they caused severe leaf and fruit damage, respectively.
Mottled emigrant (Catopsilia pyraanthe) incidence was seen on Senna during active vegetative
stage and designated as major pest due to highest damage potential caused by it, and reached its peak
damage 9.52% during 38 th std week.
Nearly eleven insect pests recorded on Muskmallow viz., Shoot and fruit borer (Earias vitella), fruit
borer (Helicoverpa armigera), leaf roller (sylepta derogate), semilooper (Anomis flava) red cotton bug
(Dysdercus cingulatus), stink bug (Nezara viridula), leaf hoppers (Amrasca biguttula biguttula), aphids
(Aphisgossypii), dusky cotton bug (Oxycarentus hyalinipenis), grass hopper (Cyrtacanthacris ranaceae)
and blister beetle (Mylabris pustulata). Among them shoot and fruit borer and fruit borer were recorded as
major pests due to highest damage caused by the pest.
Biology experiments on shoot and fruit borer under laboratory conditions revealed the average
fecundity of moth was 391.5±0.54 eggs with oviposition period of 7.25±0.53 days. The mean duration of larval
and pupal periods was 11.6±0.85 days and 6.5±0.74 days. Total developmental period was 21.4±0.46 days.
The female moth lived for 16.6±0.65 days and males for 14.53±0.87 days respectively.
105

ABSTRACTS
The efficacy of NSKE, neem oil. Neem aza, Delfin, leaf extracts of Acorus calamus and Jatropha
gossyfolia and DDVP were tested against Spinghip caterpillar (Deiliphia neiirii) on Serpentine root and leaf
rolling caterpillar (Garcillaria acidula) on Aonla.
Per cent of leaf damage due to leaf rolling caterpillar (G.acidula) on Aonla was low (47.49 %) in DDVP
treated plot compared to other treatments after one day of spraying. The best treatment recorded three days
after spraying was DDVP (45.86%). From five days after spraying up to tenth day of spraying DDVP (42.91%)
was found to be the best treatment and Fortune aza (44.73%) recorded as next best treatment in reducing the
per cent leaf damage. M.Sc (Ag). (2007).
Heavy Metal Status of Peri-Urban Agricultural Soils and Crops – An
Ecological Risk Assessment
Student: Mr. V. Chanakya
Major Advisor: Dr. K. Jeevan Rao
Department of Soil Science and Agricultural Chemistry
A survey entitled “Heavy metal status of peri-urban agricultural soils and crops – An ecological risk
assessment” was conducted to assess the long-term effect of sewage and industrial effluents affected water
for irrigation on heavy metal content in soils, plants and ground water, and an ecological risk assessment
process was also carried out as a part of this survey.
Results indicated that the, concentrations of all parameters were higher in water samples of Musi
river bed area than that of Kattedan industrial area and they were found more in water samples collected
during the month of Feb-06 than those collected during Oct-05.
Results from the soils of Musi river bed and Kattedan industrial areas indicated that the values of all
soil parameters except sand were found higher than the control soil. Except clay, pH, CEC and BSP, the
values of all other parameters decreased with increasing depth in both Musi river bed and Kattedan industrial
area soils.
Results obtained by analyzing the plant samples indicated that the concentrations of N, P and K
were found within the optimum range in plants of both Musi river bed and Kattedan industrial areas. While, the
concentrations of micronutrients and heavy metals were found within the permissible limits in edible parts of
the plants of both Musi river bed and Kattedan industrial areas except Pb, which was found to be exceeding
the permissible limits in plants of Musi river bed area in their edible parts. The concentration of major nutrients,
micronutrients and heavy metals were found to be accumulated least in edible parts of most of the plants of
both Musi river bed and Kattedan industrial areas while highest accumulation was found in their roots.
Risk assessment in respect of heavy metal contents in crops grown on these waste waters irrigated
peri-urban agricultural soils of Musi river bed and Kattedan industrial areas indicated that, the consumption of
the produce of these crops by human beings and animals can be safe to present but if consumed continuously
for longer periods may cause health hazards. M.Sc (Ag). (2007).
106

ABSTRACTS
Integrated Nutrient Management Options for Rainfed Castor
Student: A. Shirisha
Major Advisor: Dr. A. Pratap Kumar Reddy
Department of Agriculture
The present study entitled “Integrated nutrient management options for rainfed castor” was conducted
during kharif 2005 on sandy clay loam soil of College Farm, College of Agricultural University.
Primary and secondary spike length was highest with application of 75% RDN + 25% N through
poultry manure (T 5
). Whereas tertiary spike length did not vary due to INM practices. Seed yield obtained from
primary, secondary and tertiary spikes was highest with 75% RDN + 25% N through poultry manure (T 5
) and
this was on par with all other treatments except with control (T 1
).
Stalk yield obtained with 100% RDN (T 2
) was the highest and this was comparable with 75% RDN +
25% N through poultry manure (T 5
), 50% RDN + N through poultry manure (T 6
) and 75% RDN + 25% N
through castor (T 7
). Harvest index was not significant due to INM practices. Oil content did not vary significant
due to INM practices. Oil yield was highest with application of 75% RDN + 25% N through poultry manure (T 5
).
Nitrogen and phosphorus contents in whole plant at maturity was highest with application of 75%
RDN _ 25% N through poultry manure (T5). Total potassium content was not significant with the different INM
practices. Among INM practices, gross returns, net returns and benefits: cost ration were highest with 75%
RDN + 25% N through poultry manure (T 5
). M.Sc (Ag). (2007).
Nitrogen and potassium requirement and their effect on flower yield
and quality of marigold (Tagetes Erecta L.)
Student: A. Krishna Mohan Major Advisor: Dr. G.09 Padmaja
Department of Soil Science and Agricultural Chemistry
With a view to study the “Nitrogen and potassium requirement and their effect on flower yield and
quality of marigold (Tagetes erecta L.)”. A field experiment was conducted on an Alfisol at Students’ Farm,
College of agriculture, Rajendranagar, Hyderabad during Kharif 2005-06. Nitrogen and potassium were
applied as per treatment combinations, each treatment along with recommenced dose of phosphorus (80 kg
P 2
O 5
ha -1 ) . Entire quantity of phosphorus and half of nitrogen and potassium were applied as basal in the form
of single super phosphate, urea and murate of potash, respectively. Rest of nitrogen and potassium was
applied in two equal splits at 30 and 60 DAT.
The results indicated that with increasing levels of nitrogen and potassium application, there was
increase in dry matter production, concentrations of N, P and K and their uptake at both 60 DAT and at
harvest. Higher quantity of dry matter production (9438.6 kg ha -1 ) Concentration of N(2.16%), P(0.90%),
K(1.51 %) and their uptake (200.4, 85.32 and 143.6 kg ha -1 ) were recorded at harvest where N was applied at
120 kg ha -1 (N 3
). Similarly, higher dry matter production (5105.5 kg ha -1 ), concentration of P and K (0.88 and
107

ABSTRACTS
1.81 %) and their uptake (46.78 and 92.83 kg ha -1 ) was recorded at K 3
level, while the concentration and uptake
of N were not found effected by K levels at harvest stage of marigold crop.
The changes in forms of potassium in soil at different stages of crop growth period clearly indicated
that easily available forms of K viz., water soluble NH 4
OAc extractable and exchangeable K were utilized by
the crop, which reflected in increase in K concentration and uptake from initial to 60 DAT. The slowly available
forms were found depleted at later stages (60-100 DAT), indicating the existence of dynamic equilibrium
among these forms of K. With regard to nitrogen, NO 3
N was more utilized by the crop than NH 4
+ N to result
in highest DMP, N-Concentration, uptake and in turn the flower yield.
Based on the results of investigation, it was concluded that application of 120 kg N and 80 kg K 2
O ha -
1
along with 80 kg P 2
O 5
ha -1 is optimum for obtaining highest flower yield with quality improvement in marigold
when grown on light textured Alfisols. M.Sc (Ag). (2007).
Evaluation and standardization of shelf life determining parameters
for Bio pesticide formulation of Metarhizium anisopliac (Metchnikoff)
Sorokin
Student: G. J. Jayakumari
Major Advisor: Dr. S. J. Rahman
Department of Entomology
Investigations were carried out to evaluate certain shelf life determining and other related parameters
of the formulation of Metarhizium anisopliae (Metschinkoff) Sorokin. The influence of different carrier materials
viz., Bentonite, Attapulgite, Talc and Kaolonite was tested for the shelf life of Metarhizium anisopliae formulation.
Similarly, to find out an optimum temperature for an effective storage, four different temperatures viz., refrigerated
(5 0 C), room temperature (22 0 C) and high temperature (40 0 C) were evaluated. The output come of the studies
indicated that among the carrier material, talc based formulations were found to be more suitable with promising
conidial concentration/gm and prolonged viability and pathogenicity.
As the Days After Formulation (DAF) were increasing there was a general trend of decline in all the
above shelf life determining parameters. As far as storage temperature is concentrated, refrigerated temperature
(5 0 C) found to be more suitable than the other temperature ranges tested with high conidial concentration/gm,
maximum conidial viability and highest pathogenicity towards target pest. Overall results suggested that M
.anisopliae formulation made up of talc based powder and packed in milky white polythene material is proved
to have better shelf life with quality of the product maintained especially when stored in refrigerator temperature
(5 0 C) or cool temperature (15 0 C). M.sc (Ag).
108

ABSTRACTS
Nitrogen management in Bt Cotton hybrids under rainfed conditions
Student: Dandu Mohan Das
Major Advisor: Dr. M. Govind Reddy
Department of Agronomy
Afield experiment entitled “Nitrogen management in Bt Cotton hybrids under rainfed condition” was
conducted in the Kharif season during 2006 on clay loam soil at the Agricultural Research Station Adilabad.
The experiment was laid out in a split plot design. The main plots were of 2 Bt cotton hybrids viz., Bunny and
RCH 2 factorially combined with 3 levels of N @ 90, 120 and 150 kg N/ha. The sub plot treatments were the
schedule of application of N in 4 splits at three different time schedules viz., 15-45-75-105, 20-50-80-110 and
25-55-85-115 days after sowing. The results showed that Bunny grew significantly taller than RCH 2 from 45
days after sowing until maturity. It produced significantly more number of sympodial branches (23.97) than
2068 branches per plant by RCH 2. The two hybrids reached the time of square formation and full bloom at the
same time.
The plant height increased significantly from 45 days after sowing until maturity with increase in the
level of N from 90 to 150 kg/ha. The number of sympodial branches per plant, bolls per plant and boll weight
also increased significantly. The days to square formation and full bloom extended significantly by increasing
the level of N from 90 to 150 kg/ha at all the growth stages. The uptake of P and K was also significantly more.
Maximum yield of 2818 kg kapas and 10097 kg stalk was realized by the application of 150 kgN/ha. The
uptake of N increased significantly by increasing the level of N from 90 to 150 kg/ha at all the growth stages.
The uptake of P and K was also significantly more. Maximum yield of 2818 kg kapas and 10097 kg stalk was
realized by the application of 150 kg N/ha. The quality of fibre in terms of ginning percentage and halo length
also improved significantly at this level of fertilization. The crop fertilized with 150 kg N/ha fetched maximum
net returns of Rs. 48714/ha. But maximum net profit per Re. investment was realized at 120 kg N/ha.
Spilt application of N in four splits at 25-55-115 DAS increased the plant height from 45 DAS until
maturity. Also its increased the number of sympodial branches per plant, bolls per plant and boll weight. This
schedule also increased the uptake of NPK with additional 118 kg yield of kapas than that obtained by the spilt
application of N at 15-45-75-105 DAS. The ginning percent and halo length also improved by this spilt application.
The result in a ut shell indicated that the two Bt cotton hybrids Bunny and RCH-2 require 150 kg N/ha to be
applied in four splits at 25-55-85-115 DAS to increase the kapas yield per hectare and improved the quality of
fibre. But it is more profitable with the application of 120 kg N/ha. M.sc (Ag) 2007.
Heterosis and combining ability for yield, yield components and
post – flowering stalk Rot resistance in maize (zea mays L.)
Student: Vijaya Bhaskar Reddy. S
Major Advisor: Dr. (Mrs.) Farzana Jabeen
Department of Genetics and Plant Breeding
The present investigation on “Heterosis and combining ability for yield, yield components and Post
– Flowering Stalk Rot resistance in maize (Zea mays L.)” was under taken with nine lines (BPPTI-28, BPPTI-
36, BPPTI-38, BPPTI-44, CM-211, CM-210, CM-207, BPPTI-33 and ACM-120) and four testers (BPPTI-29,
109

ABSTRACTS
BPPTI-34, BPPTI-35, and BPPTI-43). The analysis of variance revealed significant differences among the
genotypes for all the traits studied. Further, non-additive gene action was found to be preponderant for grain
yield, yield components and PFSR disease resistance in the present investigation, favoring a hybrid breeding
programme.
The combining ability analysis revealed importance of non-additive gene action in governing the
characters studied. Among the parental lines, BPPTI-44 and BPPTI-33 were good general combiners for
earliness viz., days to 50 per cent tasseling, days to 50 per cent silking and days to maturity. The parents
BPPTI-33 and BPPTI-38 for PFSR disease resistance, CM-211 and BPPTI-33 for grain yield contributed
maximum favorable genes. The parents BPPTI-33, CM-211 and BPPTI-38 were good general combiners for
both yield and PFSR disease resistance.
Estimates of heterosis, heterobeltiosis and standard heterosis were variable among crosses in
desirable direction and some of them turned out to be best specific crosses. The cross combinations BPPTI-
44 x BPPTI-35 and BPPTI-44 x BPPTI-29 for earliness, BPPTI-33 x BPPTI-34 and BPPTI-28 x BPPTI-43 for
PFSR disease resistance, CM-211 x BPPTI-29 and CM-211 x BPPTI-43 for yield. Further, the best selected
crosses viz., CM-211 x BPPTI-29, CM-211 x BPPTI-43, CM-120 x BPPTI-29 and BPPTI-33 x BPPTI-43 for
grain yield and PFSR disease resistance may be further exploited in multilocation evaluation before releasing
them for commercial cultivation to the farmer.
Studies on heritability, correlation and path analysis emphasized the need for selection, based on
plant type with greater 100 kernal weight, number of kernals per row, plant height, ear length, number of kernel
rows per ear, ear girth and less disease score since these were found to be the important direct contribution
for grain yield. M.sc (Ag) 2007.
Heterosis and combining ability studies using Pet-1 and ARG
Cytoplasmic sources in sunflower (Helianthus annus L.)
Student: A. Sateesh
Major Advisor: Dr. K. Hussain Sahib
Department of Genetic and Plant Breeding
The present investigation was conducted to develop and evaluate hybrids with one of the alternate
cyptoplasm i.e., ARG-6 by conducting appropriate studies in the extent of heterosis and combining ability of
the parental lines and the resultant F 1
combinations and also to study the character association and direct and
indirect effects of yield attributes on seed yield in sunflower (Helianthus annus L.) at the Directorate of Oil
seeds Research, Rajndranagar, Hyderabad during Rabi, 2006-07. The estimates of heterosis, heterobeltiosis
and standard heterosis were found to be significant among the hybrids for different traits. The general
combining ability studies indicated that the CMS line, CMS 234A recorded highest positive gca effects for seed
yield/ plant, head diameter, oil content, number of filled seeds/head, total number of seeds/head and oil yield/
plant. The hybrids, CMS 234A x DRS-45 among PET-1 and DCMS-41 x registered highest positive sca effects
for oil content and CMS 234A c 6D-1 among PET-1 and DCMS-41 x RHA 348 among ARG-6 cytoplasmic
source hybrids registered highest positive sca effects for oil yield/plant. The result indicated the preponderance
of non-additive gene action for the seed yield and yield contributing trait. The magnitude of average degree of
dominance revealed over dominance is the cause of heterosis for all the traits studied.
110

ABSTRACTS
The present investigation revealed significant correlation among seed yield and yield components
and direct and indirect effects of yield attributes on seed yield. The traits, number of filled seeds/head, total
number of seeds/head, head diameter, 100-seed weight, oil content, oil yield/plant and plant height registered
positive correlation with seed yield. The highest direct effects on seed yield were observed for the traits,
number of filled seeds/head, total number of seeds/head, 100-seed weight and head head diameter. M.sc (Ag)
2007.
Impact of contract farming poultry enterprises in RangaReddy and
Mahaboobnagar District of A.P
Student: Praveen Vulkundkar
Major Advisor: Dr. K. Suhasini
Department of Agricultural Economics
Ranga Reddy and Mahaboobnagar districts were purposively selected for the study. An ultimate
sample of 30 contract broiler farms, 30 non-contract broiler layer farms were selected randomly. Returns per
rupee investment were more on contract farms i.e., 1: 0.48 as against non-contract farms 1: 0.009. The gross
income per 1000 birds was found to be less on contract farms, as these farms were paid a given a sum of
Rs.2.07 on an average per kg of bird as major items of expenditure like chicks, feed and medicines were borne
by hatcheries.
The inputs-puts ration indicates that the returns are more in contract farms against non-contract
farms. The feed conversion ration indicates that feed efficiency increased in contract farms than non-contract
farms. The total costs for 1000 birds were phenomenally higher on non-contract farms over contract farms.
The feed efficiency and performance of the flock was appreciable in broiler contract farms compared to noncontract
farms. Gross income per 100 birds was distinctly higher on non-contract farms over contract farm.
But the returns per rupee of investment on contract broiler farms were substantially more over non-contract
farms. There is a need that the small and medium farmers should be encouraged to produce more cycles per
year, so that they can make efficient utilization of available resources to earn a reasonably good income.
Integration of broiler industry with greater government intervention by providing legal status to the farmers will
help farmers to adopt contracts and produce quality output. Further, in case of sudden out break of diseases
in large scale farmer as well as integrators are probe to risk, therefore insurance can be introduced for poultry
farmers.M.Sc (Ag) 2007.
Crop yield-Weather Relationship for Certain Rainfed Districts of
Telangana Region
Student: Rup Narayan Rano
Major Advisor: Dr. K. Subramanyam Reddy
Department of Statistics and Mathematics
In fitting of crop yield-weather relationship, estimation of time effect or the technology effect is the
basic step. The technology effect is taken as the trend value. The assumption of a continuous time trend yields
was in the form of quantum jumps over time. There may not be continuous increase in the crop yields over the
years; instead, the yields fluctuate around the jumps. In such situations, the trend value was fixed and it was
111

ABSTRACTS
same for the yields belonging to the sub-periods. These sub-periods were formed with the year of quantum
jump as the cut-off point. The trend value was then taken as the sub-period average for elimination of
technology effect. The time effect which assumed fixed values instead of a continuous increase, was analogous
to the behavior of a discrete variable and hence it was termed as the discrete time effect.
Qunatum jumps were observed in the crop yields, where there was sufficient evidence of technological
improvement. These jumps occurred for all the selected crops in all the three districts and coincided with the
subjective/collateral evidence about the introduction of new technology. Hence for these crops, relationships
were obtained with the assumption of a discrete time trend. I t was observed that an overall relationship has
not appropriate to explain the yield variations as it consisted of certain irrelevant repressors. Considering this
behavior, separate relationship were fitted to the different sub-periods existing in the crop yield data and the
analysis revealed the existence of a differential response of the yields to weather. The variables identified in
these relations suitably explain the weather response with respect to the crop growth stages. Hence, it was
concluded that yields under a given technology only could be forecasted (based on weather variables) on the
basis of the corresponding sub-periods relationship (equation).M.Sc (Ag) 2007.

CONTENTS
PART I : PLANT SCIENCES
Isolation and characterization of microsatellites in oil palm (Elaeis guineensis) 1
P CHERUKU, K MANORAMA and S. SIVARAMAKRISHNAN
Combining ability analysis for productivity and fibre quality traits in 13
intra-herbaceum and interspecific (G. herbaceum L. and G. arboreum L.)
crosses of diploid cotton
VEMANNA IRADDI and S. T. KAJJIDONI
Weed and crop resistance to herbicides 22
A. S. RAO
A comparative study on heterosis for productivity and fibre quality traits 35
in intra-herbaceum and interspecific(G. herbaceum L. and G. arboreum L.)
crosses of diploid cotton
VEMANNA IRADDI and S. T. KAJJIDONI
Diversity of weeds in the sorghum (Sorghum bicolor (L.) Moench.) fields of 44
Andhra Pradesh
P. KIRAN BABU, M. ELANGOVAN and J. S. MISHRA
Effect of incremental dose of phosphorus in rice on the yield of blackgram 52
in rice (Oryza sativa) – blackgram (Phaseolus mungo) cropping sequence
I. USHA RANI and V. SANKAR RAO
Probability of occurrence of wet and dry spells by Markov Chain Model 59
and its application to castor (Ricinus communis L.) cultivation in Ranga Reddy District
M.A.BASITH and SHAIK MOHAMMAD
Identification of parents and hybrids for yield and its components using 65
line x tester analysis in pigeonpea (Cajanus cajan L. Millsp)
C.V.SAMEER KUMAR, CH.SREELAKSHMI, D.SHIVANI and M.SURESH
Gene effects for yield contributing characters in pigeonpea (Cajanus Cajan L.) 71
by generation mean analysis
C.V.SAMEER KUMAR, CH.SREELAKSHMI, D.SHIVANI and M.SURESH
PART II : RESEARCH NOTES
Evaluation of F 1
hybrids of tomato (Solanum lycopersicum L.) 77
P.S.SUDHAKAR and K. PURUSHOTHAM
Influence of growth hormonal treatments on seed germination and seedling 82
growth of simarouba (Simarouba glauca L.)
L. PRASANTHI, P. MAHESWARA REDDY, P. S. SUDHAKAR,
B. BALAKRISHNA BABU and K.RAJA REDDY
Study of heterosis for yield and its component traits in pigeonpea 86
(Cajanus cajan. L. Millsp)
C.V.SAMEER KUMAR, CH.SREELAKSHMI, D.SHIVANI and M.SURESH
Abstracts 92

The Journal of Research ANGRAU
(Published quarterly in March, June, September and December)
EDITORIAL BOARD
Dr. L.G. Giri Rao
Director of Extension
ANGRAU - Rajendranagar
Hyderabad
Dr. G. Laxmikanta Reddy
Director of Research
ANGRAU - Rajendranagar
Hyderabad
Dr. Shaik Mohammad
Dean of Post Graduate Studies
ANGRAU - Rajendranagar - Hyderabad
EDITORIAL COMMITTEE
Dr. G. Bhupal Raju
Principal Scientist
ARCRP Micro Nutrients
Agricultural Research Institute
Rajendranagar - Hyderabad
Dr. T. Narsi Reddy
Professor and Head
Department of Plant Pathology
College of Agriculture - Rajendranagar
Hyderabad
Dr. A. Sharada Devi
Professor & University Head
Dept. of Apparel & Textiles,
College of Home Science
Hyderabad
EDITOR
Dr. Shaik Mohammad
Dean of Post Graduate Studies
ANGRAU - Rajendranagar - Hyderabad
MANAGING EDITOR
Dr. P. Gidda Reddy
Principal Agricultural Information Officer
Agricultural Information & Communication Centre and Press,
Rajendranagar - Hyderabad - 500 030
Annual
Individual : Rs. 250/- author
Institution : Rs. 1000/-
RESEARCH EDITOR
Dr. K.B. Eswari
AI&CC and Press, Rajendranagar, Hyderabad - 500 030
SUBSCRIPTION TARIFF
Dr. G. Sravan Kumar
Associate Professor
Department of English
College of Agriculture - Rajendranagar
Hyderabad
Life
Individual : Rs. 1000/-
(till Retirement)
Reprints Charges : Rs. 50/-
DDs may be sent to Managing Editor - Journal of Research ANGRAU - Agricultural Information &
Communication Centre and Press - Agricultural Research Institute -Rajendranagar - Hyderabad - 500 030

J. Res. ANGRAU Vol. XXXVII No. 3&4 pp 1- 112, July-Dec., 2009
ANGRAU-Press/722/500/091
Regd. No. 25487/73
Printed at ANGRAU Press, Hyderabad and Published by Dr. Shaik Mohammad, Dean of Post
Graduate Studies and Editor of Journal of Research ANGRAU, Administrative Office,
Acharya N.G. Ranga Agricultural University, Rajendranagar, Hyderabad - 500 030
AI&CC e-mail: aicc_press@yahoo.co.in
J. Res. ANGRAU Vol. XXXVII No. 3&4 pp 1- 112, July-Dec., 2009

THE JOURNAL OF RESEARCH ANGRAU
DECLARATION CERTIFICATE TO BE SUBMITTED BY THE AUTHOR(S)
Certified that the article entitled —————————————————— —— — ———
————————————————————————————————————————
1. is based on my / our original research work / M.Sc / Ph.D thesis (strike off
whichever is not applicable)
2. The article has been seen by all the authors and the order of authorship is agreed.
3. The results presented have not been published or submitted for publication else
where in part or full under the same or other title
4. The names of the authors are those who made a notable contribution.
5. No authorship is given to anyone who did not make a notable contribution.
S.No. Name/s Present address Permanent address Signature
1.
2.
3.
CERTIFICATE BY THE COMPETENT AUTHORITY
( Professor & Head of the Department/ Principal Scientist of the station/ Associate
Director of Research).
Certified that the article —————————————————————————
————————————————————————————————————————
———————————————authored by ———————————————————
—————————————————————————— is fit for publication. It fulfills
all the requirements for publication in the Journal of Research ANGRAU.
Name :
Signature :
Office seal :
Note: In case it is not possible to obtain the signature of a particular author for reasons
beyond his/her reach, the reasons thereof should be explained.

Statement about ownership and other particulars about
THE JOURNAL OF RESEARCH ANGRAU
Form IV (See Rule 8)
1. Place of Publication : The Acharya N.G. Ranga Agricultural University,
Rajendranagar, Hyderabad - 500 030
2. Periodicity of Publication : Quarterly
3. Printer’s Name : Dr. Shaik Mohammad
Nationality : Indian
Address : Dean of Post Graduate Studies and Editor of Journal of
Research, ANGRAU
Acharya N.G. Ranga Agricultural University
Rajendranagar, Hyderabad.
4. Publisher’s Name : Dr. Shaik Mohammad
Nationality : Indian
Address : Dean of Post Graduate Studies and Editor of Journal of
Research, ANGRAU
Acharya N.G. Ranga Agricultural University
Rajendranagar, Hyderabad.
5. Editor’s Name : Dr. Shaik Mohammad
Nationality : Indian
Address : Dean of Post Graduate Studies and Editor of Journal of
Research, ANGRAU
Acharya N.G. Ranga Agricultural University
Rajendranagar, Hyderabad.
6. Name and address of the : The Acharya N.G. Ranga Agricultural University,
individuals who own the Rajendranagar, Hyderabad - 500 030 (A.P.)
newspaper & partners or
share holders holding more
than one per cent of the
total capital
I, Dr. Shaik Mohammad hereby declare that the particulars given above are true to
the best of my knowledge and belief.
Dated :
Signature of Publisher

SUBSCRIPTION ENROLLING FORM
I/we, herewith enclose D.D. No............................................
.......................................dated..................................
for Rs. ............................... drawn in favour of Managing Editor, Journal of
Research ANGRAU, Agricultural Information & Communication Centre, ARI Campus,
Acharya N.G. Ranga Agricultural University, Rajendranagar, Hyderabad - 500 030
as individual annual/individual life/Institutional annual Membership for Journal of
Research ANGRAU for the calendar year (January - December) ..................
S.No. Name of the Address for Name of the article Signature
authors Correspondence contributed
1.
2.
3.
4.
Note : The receipt of payment will be sent only if a self addressed and stamped envelope
is enclosed along with your DD.

GUIDELINES FOR THE PREPARATION OF MANUSCRIPT
1. Title of the article should be short, specific, phrased to identify the content and indicate
the nature of study.
2. Names should be in capitals prefixed with initials and separated by commas. For more
than two authors the names should be followed by ‘and’ in small letters before the end
of last name. Full address of the place of research in small letters should be typed
below the names. Present address and E-mail ID of the author may be given as foot
note.
3. The full length paper should have the titles ABSTRACT, MATERIALS AND METHODS,
RESULTS AND DISCUSSION, REFERENCES-all typed in capitals and bold font - 12.
The research note will have only one title REFERENCES.
4. ABSTRACT: The content should include the year, purpose, methodology and salient
findings of the experiment in brief not exceeding 200 words. It should be so framed
that the reader need not refer to the article except for details.
5. INTRODUCTION : Should be without title and indicate the reasons which prompted the
research, objectives and the likely implication. The review of recent literature should
be pertinent to the problem. The content must be brief and precise.
6. MATERIALS AND METHODS : Should include very clearly the experimental techniques
and the statistical methods adopted. Citation of standard work is sufficient for the well
known methods.
7. RESULTS AND DISCUSSION : Great care should be taken to highlight the important
findings with support of the data well distinguished by statistical measures like CD, r,
Z test etc. Too descriptive explanation for the whole data is not desirable. The treatments
should be briefly expressed instead of abbreviations like T 1
, T 2
etc. The discussion
should be crisp and relate to the limitations or advantages of the findings in comparison
with the work of others.
8. REFERENCES : Literature cited should be latest. References dating back to more
than 10 years are not desirable. Names of authors, their spelling and year of
publication should coincide both in the text and references. The following examples
should be followed while listing the references from different sources.
Journals and Bulletins
Abdul Salam, M and Mazrooe, S.A. 2007. Water requirement of maize (Zea mays L.) as
influenced by planting dates in Kuwait. Journal of Agrometeorology. 9 (1) : 34-41

Hu, J., Yue, B and Vick, B.A. 2007. Integration of trap makers onto a sunflower SSR
marker linkage map constructed from 92 recombinant inbred lines. Helia.
30 (46) :25-36.
Books
AOAC. 1990. Official methods of analysis. Association of official analytical chemists.
15 th Ed. Washington DC. USA. pp. 256
Federer, W.T. 1993. Statistical design and analysis for intercropping experiments. Volume
I: two crops. Springer – Verlag, Cornell University, Ithaca, New York, USA.
pp. 298-305
Thesis
Ibrahim, F. 2007. Genetic variability for resistance to sorghum aphid (Melanaphis sacchari,
Zentner) in sorghum. Ph.D. Thesis submitted to Acharya N.G. Ranga Agricultural
University, Hyderabad.
Seminars / Symposia / Workshops
Naveen Kumar, P.G and Shaik Mohammad 2007. Farming Systems approach – A way
towards organic farming. Paper presented at the National symposium on integrated
farming systems and its role towards livelihood improvement. Jaipur, 26 – 28
October 2007. pp.43-46
Proceedings of Seminars / Symposia
Bind, M and Howden, M. 2004. Challenges and opportunities for cropping systems in a
changing climate. Proceedings of International crop science congress. Brisbane –
Australia. 26 September – 1 October 2004. pp. 52-54
(www.cropscience 2004.com 03-11-2004)
Tables and Graphs : The data in tables should not be duplicated in graphs and vice versa.
Mean data for main treatment effects should be presented with appropriate SE± and
CD values wherever necessary. The 2 or 3 way tables should be furnished only if
the results are consistent over years and are distinguished to have consideration of
significant practical value. SE± and CD values however, should be furnished in the
tables for all interactions and should be explained in the results and discussion. The
treatments should be mentioned atleast in short forms if they are lengthy, but not
abbreviated as T 1
, T 2
and T 3
etc. The weights and measures should be given in the
metric system following the latest units eg. kg ha -1 , kg ha –1 cm, mg g -1 , ds m -1 ,
g m -3 , C mol kg -1 etc.

Typing : The article should be typed in 12 pt font on A 4
size paper leaving a margin of 5 cm
on all sides. There should be a single line space between the rows in abstract and
double line in rest. Check up the manuscript thoroughly for errors before submitting
it for publication.
Note : Latest issue of the Journal may be consulted. Further details can be obtained from
the book “Editors style Manual, edn 4. American Institute of Biological Sciences,
Washington DC”.
Website : www.angrau.net
ESSENTIAL REQUIREMENTS FOR CONSIDERATION OF PUBLICATION OF ARTICLES
1. Research of not less than 2 years and of high standard will be considered as full
length paper. If necessary, it will be considered for short communication.
2. Research of one year should be submitted in the style and format of short
communication.
3. The total number of pages should not exceed 10 for full paper and 5 pages for short
communication including tables and figures. The figures should be legible.
4. Old research which terminated 5 years before the date of submission will not be
considered.
5. All the authors should subscribe for the Journal
6. The manuscript should be submitted in triplicate as per the guidelines of the Journal
to The Dean of Post Graduate Studies and Editor, The Journal of Research ANGRAU,
Administrative Office, Rajendranagar, Hyderabad – 500 030.
7. The manuscript should accompany the declaration certificate and subscription
enrolment form.
8. The authors should accept the editorial / referees comments until the quality of
the paper is improved.
9. The revised manuscript should be submitted in duplicate along with a compact disk.
REVIEW PROCESS
The articles will be initially screened by the editors. It will be sent to an expert
for peer review only if it contains adequate original information and is prepared as per
the guidelines. The author, then, may also be asked to revise it if the expert desires.
After getting the article suitably revised and edited, it will be placed before the editor for
a final decision. The accepted article will be finally checked for language and grammar
by the English editor before being sent to the press. The decision however to publish
the paper lies with the editor even if the article is approved by the expert. Any article
which is not able to meet the expected standard or is not prepared in conformity with
guidelines will be rejected without assigning any reason.

2
2
2
N
The original research articles are
invited from all over the globe
The Global users can now retrieve
the articles from Journal on the
repository of Commonwealth
Agricultural Bureaux
International(CABI) on
www.cabi.org
and
our website
www.angrau.net
REMEMBER
A FOOL COLLECTS THE DATA
A WISE MAN SELECTS THE DATA
2