CONTENTS
Contents of 41(2) 2013 - acharya ng ranga agricultural university
Contents of 41(2) 2013 - acharya ng ranga agricultural university
- No tags were found...
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
<strong>CONTENTS</strong><br />
PART I : PLANT SCIENCE<br />
Adsorption desorption of Pendimethalin and Oxyfluorfen in Soils of Andhra Pradesh<br />
A.Sireesha, P.C.Rao, P.V.Rao, Ch.S.Ramalakshmi and G.Swapna 1<br />
Studies on the effect of Plant Growth Regulators on Flowering , Corm and Cormel Production<br />
in Gladiolus Gladiolus Grandiflorus L. CV. White Prosperity<br />
G.V. Subba Reddy, M.B. Nageswara rao, K. Umajyothi, K. Sasikala 11<br />
Performance of Drum Seeder in Direct Sown Paddy under Puddled Condition<br />
M.Visalakshi and A.Sireesha 16<br />
Effect of Graded Levels and Time of Nitrogen Application on Nutrient Uptake, Yield and<br />
Economics of Semi-dry Rice Oryza sativa L.<br />
K. Jhansi Lakshmi Bai, K.V. Ramana Murthy and M.Venku Naidu 21<br />
Assessment of Genetic Diversity in Capsicum Spp. by using Morphological and Molecular Tools<br />
S. Joshi, C. Sarma, C. Jangid and H.V. Vijayakumarswamy 26<br />
Estimation of Heterosis for Yield and its Attributing Characters and Study of Intra-spikelet<br />
Competition for Seed Size in Finger Millet Eleusine coracana L.<br />
Parashuram Patroti and Jayarame Gowda 33<br />
Integrated Effect of Organic Manures and Inorganic Fertilizers on Soil Urease Activity<br />
and Yield of Maize-spinach Cropping System<br />
I. Usha Rani. G. Padmaja and P. Chandrasekhar Rao 42<br />
Screening of Local Rhizobial Isolates for Plant Growth Promotion and Biocontrol<br />
Properties against Soil Borne Fungal Pathogens<br />
Bh. Sarvani, R. Subhash Reddy, S. Sumathi and P. Narayan Reddy 46<br />
Characterization and Classification of Rice Growing Soils of Central<br />
Telangana Region of Andhra Pradesh<br />
M.Ramprasad, V.Govardhan, V.Praveen Rao, K.Surekha and M.H.V. Bhave 52<br />
Identification of Superior Parents and Cross Combinations by Using Line X Tester<br />
Analysis in Finger Millet Eleusine Coracana L.<br />
Parashuram Patroti and Jayarame Gowda 59<br />
PART II : SOCIAL SCIENCE<br />
Effect of Front Line Demonstrations and Trainings on Knowledge and Adoption of Integrated Pest<br />
Management Practices by Chickpea farmers of Prakasam District of Andhra pradesh<br />
O. Sarada and G. V. Suneel Kumar 68<br />
PART III : VETERINARY SCIENCE<br />
Effect of Feeding Complete Feed Containg Poultry Litter on Rumen Nitrogen and<br />
Total Volatile Fatty Acids in Sheep and Goats<br />
J. Narasimha, V.Chinni Preetham and S.T.Viroji Rao 74<br />
Efficacy of Controlled Internal Drug Releasing (CIDR) Device on Synchronization of<br />
Estrus and Fertility in Ewes<br />
K. Murali Mohan, K. Sadasiva Rao and K.G. Solmon Raju 78<br />
Effect of NSP Enzymes and Prebiotics alone or in Combination on Performance, Egg Quality,<br />
Nutrient Retention and Gut Health of Laying Hens Fed Corn-Soybean Meal Based Low Energy Diets<br />
J. Narasimha, D. Nagalakshmi, Y. Ramana Reddy and S.T.Viroji Rao 86
Haematological and Biochemical Profile of Ewes Synchronized with Controlled Internal Drug Releasing<br />
Device (CIDR)<br />
K. Murali Mohan, K. Sadasiva Rao and K. Ramchandra Reddy 96<br />
PART IV : HOME SCIENCE<br />
Indian Bread Making Tools - Consumer Evaluation and Design Modification<br />
P. Rajya Lakshmi, D. Ratna Kumari And V. Vijaya Lakshmi 100<br />
PART V : RESEARCH NOTE<br />
Crop Coefficients for Drip and Check Basin Irrigated Castor for Prediction of Evapotranspiration<br />
B. R. Kumar, V. Praveen Rao, K. Avil Kumar, V. Ramulu, M. Uma Devi and P. Raghuveer Rao 107<br />
Study on the Effect of Irradiation on Storage Quality of Tomato Puree<br />
M. Kirthy Reddy and V. Vijayalakshmi 111<br />
Evaluation of Defoliants on Mungbean Vigna radiata L. as Harvesting Tools<br />
B. Padmaja, M. Malla Reddy, S. Malathi and D. Vishnu Vardhan Reddy 115<br />
Yield, Nutrient uptake and Economics of Castor as Influenced by Integrated Nutrient<br />
Management in Pongamia + Castor Agrisilvisystem<br />
K. Indudhar Reddy, S. Hemalatha, G. Jayasree and V. Praveen Rao 118<br />
Nano Food Colours for Product Formulations with Selected Fruits (Papaya and Black Grapes)<br />
and Vegetables (Tomato and Beet Root)<br />
P. Srilatha and K. Uma Maheswari 123<br />
Effect of Organic Fertilisers on Growth, Yield and Quality of Tomato Lycopersicon Esculentum<br />
S. Vani Anusha, P. Prabhu Prasadini, S. Sri Devi and K. Surya Prakash Rao 126<br />
Nutrient Uptake of Microsprinkler Irrigated Wheat Cultivars under Varying Nitrogen Levels<br />
Mathura Yadav, V. Praveen Rao and K. Suresh 131<br />
Effect of Synergist, Triphenyl Phosphate on Resistant Guntur Strain of spodoptera<br />
litura (Fab.) in Cotton<br />
I. Aruna Sri and T. Madhumathi 135<br />
Effect of Harvesting stages and drying methods on Alkaloid Content in Makoi<br />
Solanum Nigrum L.<br />
P.Brahma Sai, B.Amareswari and S.A Vijaya Padma 141<br />
Response of Aerobic Rice to irrigation scheduling and Nitrogen Doses under Drip Irrigation<br />
M . Malla Reddy, B. Padmaja, G .Veeranna and D .Vishnu Vardhan Reddy 144<br />
Drip irrigation schedule for Castor based on Pan Evaporation<br />
B. Ravi Kumar, V. Praveen Rao, V. Ramulu and K. Avil Kumar 149<br />
Character Association and Path Coefficient Analysis for Seed Yield in Quality Protein Maize<br />
Zea Mays L.<br />
K. Vijay Kumar, M. R. Sudarshan, Kuldeep Singh Dangi and S. Madhusudan Reddy 153
J.Res. ANGRAU 41(2) 1-10, 2013<br />
ADSORPTION DESORPTION OF PENDIMETHALIN AND OXYFLUORFEN<br />
IN SOILS OF ANDHRA PRADESH<br />
A.SIREESHA , P.C.RAO, P.V.RAO, CH. S. RAMALAKSHMI AND G. SWAPNA<br />
AICRP on Weed Control, Acharya N.G. Ranga Agricultural University,<br />
Rajendranagar, Hyderabad-500030<br />
Date of Receipt : 19.01.2012 Date of Acceptance :05.01.2013<br />
ABSTRACT<br />
Adsorption desorption of pendimethalin and oxyfluorfen in soils was studied by batch equilibrium technique<br />
at five different initial concentrations of pendimethalin and oxyfluorfen. Adsorption isotherms were confirmed to the<br />
Freundlich equation. The desorption process exhibited pronounced hysteresis in all the soils, which was more<br />
prominent when desorption was carried out at higher concentration of herbicide and the percent cumulative desorption<br />
was high in soils with low organic carbon content of soil. The values of Freundlich constant, K f<br />
were ranged from 0.28<br />
to 2.83 for pendimethalin, and from 0.30 to 3.21 for oxyfluorfen. The Freundlich constants K and n increased with<br />
increasing initial concentration of adsorbed herbicide thus confirming the irreversible nature of the adsorption of<br />
pendimethalin and oxyfluorfen of these soils. The per cent cumulative desorption was high in soils with low organic<br />
carbon content.<br />
INTRODUCTION<br />
When a herbicide is applied to soil, it<br />
undergoes a number of processes which determine<br />
its fate in soil. Herbicides may also remain on the<br />
soil surface due to adsorption process and potentially<br />
affect quality and yield of the next crop cultivated on<br />
the same field. Stable herbicides may be taken up<br />
by a plant forming unwanted residues. Herbicides<br />
when applied to the crop undergo transformation<br />
under the influence of environment. The persistence<br />
of herbicides may cause health hazards and affects<br />
non-target organisms. The fate of herbicides applied<br />
in the soil is governed by various processes such as<br />
adsorption, transformation and transportation in<br />
addition to the influence of factors such as herbicide<br />
application rate, crop type, agricultural practices and<br />
climatic conditions (Arnold and Briggs, 1990; Cheng<br />
1990; Sondhia 2009). Adsorption – desorption is an<br />
important process for determining the ultimate fate<br />
of herbicides in soil because detoxification<br />
mechanisms such as degradation, metabolism,<br />
microbial uptake and mobilization are operative only<br />
on the non-sorbed fractions of the chemical to the<br />
sites on soil mineral or organic surfaces. Adsorption<br />
–desorption influences mobility, persistence,<br />
degradation and volatility of pesticide in soil.(Kalpana<br />
et al., 2002). Adsorption decreases the concentration<br />
of chemical in solution and decrease bioavailability.<br />
Desorption of herbicide is also critical in determining<br />
the herbicide available to the target species or the<br />
loss of herbicide through runoff and percolation which<br />
causes ground water pollution. As there is lack of<br />
information regarding the sorption of these pre<br />
emergence herbicides (which are widely used as pre<br />
emergence in vegetables) the present investigation<br />
was conducted to study the adsorption- desorption<br />
of pendimethalin and oxyfluorfen on four soil types<br />
of Andhra Pradesh. Pendimethalin (N-(1-ethylpropyl)–<br />
3,4-dimethyl-2,6-dinitrobenzenamine) belongs to<br />
dinitroaniline group and Oxyfluorfen (2-chloro-1, (3<br />
ethoxy –4 nitrophenoxy)-4- (triflouromethyl) benzene)<br />
belongs to diphenyl ether group used as pre-plant or<br />
pre emergence application for control of most of the<br />
annual grasses and broad leaved weeds.<br />
MATERIALS AND METHODS<br />
Soil samples were collected from different<br />
agro climatic zones of Andhra Pradesh and at each<br />
selected location, the soil samples were collected<br />
from 15-20 different spots at a depth of 0-22 cm ,<br />
quartered and about 5 to 10 kg of each soil sample<br />
email: sireesha_291@yahoo.co.in<br />
1
SIREESHA et al<br />
was brought to the laboratory , air dried under shade<br />
and processed by passing through a 2mm size<br />
sieve . These 2 mm sieved soils were properly labeled<br />
and stored in cloth bags for further studies. The four<br />
soils of varying in physico chemical characteristics<br />
were used the study (Table 1). Technical grade<br />
pendimethalin (94.5 % purity) obtained from M/S<br />
BASF India Ltd., and technical grade oxyfluorfen<br />
(97 % purity) obtained from M/s Indofil Chemicals<br />
was used .<br />
Adsorption-desorption was conducted by<br />
equilibrating five grams of soils ( 2 mm) and treated<br />
with initial pendimethalin concentrations of<br />
0,10,20,30,40 and 50 µ g mL -1 in 1 X 10 –2 M CaCl 2<br />
solution and incubated for 24 hrs at 27+1 o C . The<br />
soil suspension was later centrifuged at 5000 rpm<br />
for five minutes and five mL of supernatant was taken<br />
out and absorbance of pendimethalin was measured<br />
at 420 nm. To the remaining slurry containing 15 mL<br />
solutions of pendimethalin solution and soil, 5 mL of<br />
CaCl 2<br />
solution (1 X 10 -2 M) was added to make<br />
solution to 20 ml and again incubated for 24 hrs and<br />
centrifuged at 5000 rpm for five minutes to determine<br />
the equilibrium concentration. This process was<br />
repeated for 5 consecutive days. Identical soil blanks<br />
were also maintained simultaneously and the net<br />
absorbance of equilibrium concentration at each stage<br />
was obtained by subtracting the absorbance of<br />
blanks. Similar procedure was followed for<br />
oxyfluorfen and the absorbance was measured at<br />
213nm for oxyfluorfen. The adsorption - desorption<br />
experiment was carried out in quadruplicates. The<br />
amount of herbicide desorbed was calculated as<br />
follows:<br />
Co n = Ce n-1 x 15/20<br />
Where,<br />
Co n = initial concentration of pendimethalin /<br />
oxyfluorfen on n th day<br />
Ce n-1 = equilibrium concentration on (n-1) th day<br />
Amount desorbed on n th day is given by (Ce n – Co n )<br />
x 20<br />
The data obtained from studies on adsorption<br />
of pendimethalin / oxyfluorfen was analysed by using<br />
Freundlich equation and the Freundlich constants were<br />
calculated.<br />
RESULTS AND DISCUSSION<br />
The adsorption isotherms of pendimethalin<br />
and oxyfluorfen were found to be parabolic in nature<br />
with an initial ‘S’ shaped curve. S shaped isotherm<br />
indicates a stronger initial competition of water<br />
molecules to the adsorbent as compared to the<br />
herbicide, thereby indicating the initial resistance to<br />
the adsorption of herbicides to be overcome later by<br />
the co-operative effect of the adsorbed<br />
molecule.(Arvind et al.,2000).<br />
The desorption isotherms did not coincide<br />
with adsorption isotherms. Desorption of both<br />
herbicides from soils indicated that slope of<br />
desorption isotherms was much lower than the slope<br />
of adsorption isotherms and less amount of herbicide<br />
was present in equilibrium solution than during<br />
adsorption. (Fig.1&2 for pendimethalin, Fig.3&4 for<br />
oxyfluorfen). The desorption processes exhibited<br />
hysteresis and the isotherms showed consistent<br />
hysteresis during desorption.(Amit Bist et al., 2005;<br />
Nagamadhuri, 2003; Kalpana et al., 2002; Arvind et<br />
al., 2000; Jenks et al., 1998; Prakash and Suseela<br />
Devi, 1998; Mersie and Sey bold,1996).<br />
The percent cumulative desorption of<br />
pendimethalin varied from 36.8 % to 69.0% for 10 µg<br />
mL -1 , from 29.7% to 53.8 % for 20 µg mL -1 from<br />
21.9 % to 41.6 % for 30 µg mL -1 , from 21.2 % to<br />
40.40 % for 40 µg mL -1 and from 19.0 % to 37.1 %<br />
for 50 µg mL -1.<br />
The percent desorption of oxyfluorfen varied<br />
from 33.10 percent to 23.6 percent for 10 µg g -1 ; from<br />
29.9 % to 19.8% for 20 µg g -1 ; from 21.85 % to 18.3<br />
% for 30 µg g -1 ; from 21.4 % to 16.9 % for 40 µg g -1<br />
and from 20.6 % to 15.4% for 50 µg g -1 . As the initial<br />
2
ADSORPTION DESORPTION OF PENDIMETHALIN AND OXYFLUORFEN<br />
concentration increased there was a gradual decrease<br />
in desorption.<br />
At low level of initial concentrations of the<br />
adsorbed herbicides the desorption isotherms were<br />
close to adsorption isotherms there by indicating an<br />
increase in the degree of irreversibility in adsorption<br />
– desorption. There was a consistent increase in K f<br />
value as the initial concentration increased in all the<br />
soils. Which is an indicative of difficult desorption.<br />
The desorption of pendimethalin in selected<br />
four soils varied in the order:S 3<br />
> S 2<br />
> S 4<br />
> S 1<br />
. The<br />
higher adsorption on S 1<br />
may be due to high organic<br />
carbon and clay content. Freundlich ‘K f<br />
’ values which<br />
indicate the extent of binding of herbicide to the soil<br />
constituents were positively and significantly<br />
correlated with organic carbon (r = 0.94** for<br />
pendimethalin and r = 0.80** for oxyfluorfen), clay<br />
content (r = 0.91** for pendimethalin and r = 0.72**<br />
for oxyfluorfen) and clay + OC (r = 0.92** for<br />
pendimethalin and r = 0.71** for oxyfluorfen). The<br />
role of organic carbon in the adsorption of<br />
pendimethalin and oxyfluorfen is consistent with<br />
reduced biological activity of these herbicides in soils<br />
with high organic carbon content. Organic carbon<br />
content has been shown to be the first critical<br />
parameter positively and significantly correlated with<br />
adsorption of pendimethalin and oxyfluorfen in soils<br />
(Johnson and Sims, 1993; Moreau and Mouvet,<br />
1997).Clay content of soil is said to be another critical<br />
parameter in adsorption of pendimethalin and<br />
oxyfluorfen in soils and its role is often masked by<br />
that of organic matter and this can become a<br />
significant factor when organic carbon content<br />
decreases<br />
The variation in percent desorbed may be<br />
due to heterogeneity involved in different soils, that<br />
vary widely in type and energy of bonding. In general,<br />
higher amounts of herbicide was desorbed during first<br />
washing and the amount progressively decreased<br />
with each subsequent washings. The per cent<br />
cumulative desorption revealed that the adsorption<br />
of these herbicides is almost irreversible indicating<br />
that the soil organic matter and clay content plays<br />
an important role in the adsorption – desorption of<br />
pendimethalin and oxyfluorfen from soil solution<br />
affecting the bio availability of herbicides in soil.<br />
Table 1. Physico-chemical characteristics of soils under study<br />
Soil<br />
pH<br />
EC<br />
(dS/m)<br />
OC<br />
(g/kg)<br />
Sand Silt Clay Texture<br />
S1 7.82 0.22 8.5 55.8 11.0 33.2 Clay loam<br />
S2 8.65 0.29 4.5 84.4 2.0 13.6 Loamy sand<br />
S3 7.71 0.24 3.1 74.40 13.00 12.60 Sandy loam<br />
S4 6.57 0.16 5.3 76.00 0.60 23.40 Sandy clay loam<br />
3
SIREESHA et al<br />
Table 2. Desorption of adsorbed oxyfluorfen from Alfisol (S1)<br />
Table 3. Desorption of adsorbed oxyfluorfen from Alfisol (S2)<br />
4
ADSORPTION DESORPTION OF PENDIMETHALIN AND OXYFLUORFEN<br />
Table 4. Desorption of adsorbed oxyfluorfen from Vertisol (S3)<br />
Table 5. Desorption of adsorbed oxyfluorfen from Vertisol (S4)<br />
5
SIREESHA et al<br />
Table 6. Desorption of adsorbed pendimethalin from Alfisol (S1)<br />
Table 7. Desorption of adsorbed pendimethalin from Alfisol (S2)<br />
6
ADSORPTION DESORPTION OF PENDIMETHALIN AND OXYFLUORFEN<br />
Table 8. Desorption of adsorbed pendimethalin from Vertisol (S3)<br />
Table 9. Desorption of adsorbed pendimethalin from Vertisol (S4)<br />
E.C : Equilibrium Concentration (µg mL -1 ), A.A : Amount Adsorbed (µg g -1 ), A.D: Amount Desorbed (µg g -1 ) C.D : Cumulative Desorbed (%),<br />
C.A :Cumulative Adsorbed (%)<br />
7
SIREESHA et al<br />
O<br />
Table 10. Freundlich K and n values for desorption isotherms of pendimethalin and oxyfluorfen in soil<br />
8
ADSORPTION DESORPTION OF PENDIMETHALIN AND OXYFLUORFEN<br />
30 .00<br />
25 .00<br />
20 .00<br />
15 .00<br />
10 .00<br />
5 .00<br />
0 .00<br />
0.0 0 10 .00 20 .0 0 30.0 0 40 .00 5 0.00<br />
Eq uil i bri um c once nt r a t i on ug/ m L<br />
Amount Adsorbed ug/g<br />
25<br />
20<br />
15<br />
10<br />
5<br />
0<br />
0 10 20 30 40 50<br />
Equilibrium concentr ation ug/m L<br />
Fig 1. Adsorption desorption isotherms of pendimethalin (Soil 1 and 2)<br />
20<br />
Amount Adsorbed ug/g<br />
25<br />
20<br />
15<br />
10<br />
5<br />
0<br />
0 10 20 30 40 50<br />
Equilibrium concentration ug/m L<br />
Amount Adsorbed ug/g<br />
18<br />
16<br />
14<br />
12<br />
10<br />
8<br />
6<br />
4<br />
2<br />
0<br />
0 10 20 30 40 50<br />
Equilibrium concentration ug/mL<br />
Fig 2. Adsorption desorption isotherms of pendimethalin (Soil 3 and 4)<br />
Amount adsorbed ug/g<br />
40<br />
35<br />
30<br />
25<br />
20<br />
15<br />
10<br />
5<br />
0<br />
0 10 20 30 40 50<br />
Equilibrium concentr ation ug/m L<br />
30<br />
25<br />
20<br />
15<br />
10<br />
5<br />
0<br />
0 10 20 30 40 50<br />
Equi li bri um con cent rat io ug/ mL<br />
Fig 3. Adsorption desorption isotherms of oxyfluorfen (Soil 1 and 2)<br />
9
SIREESHA et al<br />
/g<br />
g<br />
u<br />
d<br />
e<br />
rb<br />
s<br />
o<br />
d<br />
a<br />
t<br />
n<br />
u<br />
o<br />
m<br />
A<br />
40<br />
35<br />
30<br />
25<br />
20<br />
15<br />
10<br />
5<br />
0<br />
0 10 20 30 40 50<br />
Equilibrium concentration ug/mL<br />
30<br />
25<br />
20<br />
15<br />
10<br />
5<br />
0<br />
0 10 20 30 40 50<br />
E qui li br iu m conce ntr at ion ug/ mL<br />
Fig 4. Adsorption desorption isotherms of oxyfluorfen (Soil 3 and 4)<br />
REFERENCES<br />
Amit Bist, Anjali Sharma, Srivastava A, Baliram,<br />
Srivastava, P. C and Govindea Singh 2005.<br />
Effect of temperature on adsorption, desorption<br />
of isoproturon on a clay soil. Indian Journal of<br />
Weed Science. 37 (3&4): 247-250.<br />
Aravind, K. Rai., Chhonkan P K and Agnihotri, N. P<br />
2000. Persistence and degradation of<br />
pendimethalin and anilofos in flooded versus non<br />
flooded soils. J.I.S.S.S. 48(1) : 57-62.<br />
Jenks, M. B., Roethy W F and Martin, A. R 1998.<br />
Influence of surface and sub surface soil<br />
properties on atrazine sorption and degradation.<br />
Weed Science 46: 132-138.<br />
Johnson, R .H and Sims, J. T 1993. Influence of<br />
surface and subsoil properties on herbicide<br />
sorption by Atlantic Coastal Plain Soils. Soil<br />
Science 155: 339-348.<br />
Kalpana, Agnihotri, N B and Gajbhiya, V. T 2002.<br />
Adsorption Desorption of imidacloprid on five<br />
tropical Indian soils. Pesticide Research Journal.<br />
14(1): 63-68.<br />
Mersie, W and Seybold, C 1996. Adsorption and<br />
desorption of atrazine, deethylatrazine<br />
deisopropylatrazine and hydroxyatrazine on levy<br />
wetland soil. Journal of Agricultural Food<br />
Chemistry 44: 1925-1929.<br />
Moreau, C and Mouvet, C 1997. Sorption and<br />
desorption of atrazine, deethylatrazine, and<br />
hydroxyatrazine by soil and aquifer solids.<br />
Journal of Environmental Quality 26: 416-424<br />
Nagamadhuri, N .V 2003. Sorption, Presistence and<br />
mobility of atrazine and isoproturaon a physico<br />
chemical study Ph.D thesis submitted to<br />
Acharya N.G. Ranga Agricultural University,<br />
Hyderabad.<br />
Prakash, N. B and Suseela Devi. L 1998. Effect of<br />
organic matter on adsorption desorption of<br />
pendimethalin in soils. Pesticide Research<br />
Journal 10 (2): 202-208.<br />
Singh, RP 1996. Adsorption, Movement and<br />
distribution of carbofuran in different soils.<br />
Pesticide Research Journal. 8 (2): 139-145.<br />
10
J.Res. ANGRAU 41(2) 11-15, 2013<br />
STUDIES ON THE EFFECT OF PLANT GROWTH REGULATORS ON FLOWERING ,<br />
CORM AND CORMEL PRODUCTION IN GLADIOLUS (gladiolus grandiflorus L.)<br />
CV. WHITE PROSPERITY<br />
G.V. SUBBA REDDY, M.B. NAGESWARARAO, K. UMAJYOTHI and K. SASIKALA<br />
Horticulture College and Research Institute<br />
Dr.Y.S.R. Horticulture University, Venkataramannagudem - 534 101<br />
Date of Receipt : 22.09.2012 Date of Acceptance : 12.03.2013<br />
ABSTRACT<br />
The present studies the effect of plant growth regulators on flowering, corm and cormel production in<br />
gladiolus (Gladiolus grandiflorus L.) Cv. White Prosperity were carried out during 2010-2011at Horticulture College<br />
and Research Institute, Dr. Y.S.R. Horticulture University, Venkataramannagudem, West Godavri district in<br />
randomized block design with 9 treatments and 3 replications. Among the floral parameters, TIBA at 150 ppm<br />
recorded minimum number of days to first floret appearance (82.56 days), and 50 percent flowering (90.93 days).<br />
Similarly BA at 100 ppm recorded maximum number of spikes per corm (1.40). However, higher mean spike length<br />
(137.98 cm) and number of florets per spike (14.06) were recorded with GA 3<br />
at 100 ppm. The minimum spike length<br />
and number of florets were observed with TIBA at 150 ppm. In case of corm and cormel parameters, GA 3<br />
at 100 ppm<br />
recorded maximum corm size and weight while BA at 100 ppm recorded maximum number of cormels .m (29.75)<br />
and cormel weight per corm (14.00 g) with highest propagation coefficient (194.20).<br />
INTRODUCTION<br />
Gladiolus Gladiolus grandiflorus L. is<br />
popularly known as ‘Queen of the bulbous flowers’<br />
because of attractive spikes, having florets of<br />
different colours and better keeping quality for 7 to<br />
10 days. It is also known as “Sword lily” because of<br />
the shape of its leaves. Availability of gladiolus cut<br />
flowers round the year helps in better flower<br />
production and marketing on commercial basis. In<br />
recent years, it was found that growth regulators play<br />
an important role in regulating the flower production<br />
in Gladiolus to catch the early and late demands in<br />
the cut flower market (Bhattacharjee, 1984 and<br />
Sharma et al., 1995).<br />
MATERIALS AND METHODS<br />
The experiment was conducted during<br />
2010-2011 at Horticulture college and Research<br />
Institute, Dr. Y.S.R. Horticulture University,<br />
Venkataramannagudem, West Godavari District. The<br />
experiment, spraying of plant growth regulators at<br />
different concentrations viz. GA 3<br />
(100, 150 ppm), NAA<br />
(200, 250 ppm), BA (50, 100 ppm) and TIBA ( 75,<br />
150 ppm) six weeks after planting and the experiment<br />
was laid out in randomized block design with 3<br />
replications. Five plants were randomly selected and<br />
tagged from the net plot area in each treatment and<br />
replication for the purpose of recording the biometric<br />
observations 40,60 and 80 days after planting. The<br />
data was analyzed using computer software<br />
programme by the method of variance outlined by<br />
Panse and Sukhatme (1978).Statistical significance<br />
was tested by F value at 5 per cent level of<br />
significance. Critical difference at 0.05 level was<br />
worked out for the effects that were significant.<br />
RESULTS AND DISCUSSION<br />
Among the plant growth regulators, TIBA<br />
promoted earliness in flowering, however, the plant<br />
growth regulators viz. GA 3<br />
,NAA and BA delayed the<br />
flowering. Delayed flowering was due to delay in flower<br />
bud differentiation and excess vegetative growth. The<br />
early flowering in growth retardant treated plants might<br />
be due to the fact that such plants might have built<br />
up sufficient food reserves at initial stages. These<br />
reserve food could have been utilized for reproductive<br />
growth with the restriction in vegetative growth. The<br />
present findings were in accordance with Ravidas et<br />
al. (1992) and Devi et al. (2007) in gladiolus. Activity<br />
of GA 3<br />
to delay flowering correlates with effectiveness<br />
for promoting stem elongation (King et al., 1993).<br />
Treatments with low concentrations, which showed<br />
minimum leaf area during early growth stage, delayed<br />
flowering significantly. This suggests that certain leaf<br />
area threshold constant is required as an inductive<br />
factor for flowering in gladiolus. This view gets support<br />
email: gajjela.horti05@gmail.com<br />
11
SUBBA REDDY et al<br />
from the observations of Ravidas et al. (1992), Devi<br />
et al. (2007) and Kumar et al. (2007) in gladiolus.<br />
GA 3<br />
, NAA and BA at different concentrations<br />
significantly increased the mean spike length, number<br />
of florets and number of spikes per plant. These<br />
treatments were consistent and equally effective in<br />
increasing the leaf area almost during the entire crop<br />
growth period. The increase in leaf area thereby<br />
increased the assimilate synthesis, might have<br />
contributed to increase in spike length by these<br />
treatments. The increased spike length with GA 3<br />
might<br />
be due to rapid inter nodal elongation as a result of<br />
increased cell division and cell elongation in the<br />
intercalary meristem. As GA 3<br />
promotes vegetative<br />
growth and increases the photosynthetic and<br />
metabolic activities causing more transport and<br />
utilization of photosynthetic products this might have<br />
resulted in increased spike length. Mukhopadhyay<br />
and Banker (1986) also reported significant increase<br />
in spike length with GA 3<br />
in the gladiolus cv.<br />
Friendship. Similar results were also reported by<br />
Ravidas et al. (1992), Devi et al. (2007), Rajesh<br />
Bhalla and Ajay Kumar (2007). Flower inducing ability<br />
of BA was reported by several workers under in vitro<br />
as well as in vivo conditions. Induction of flowering<br />
may be due to its ability to alter the assimilate<br />
distribution (Ogawa and King, 1994) i.e. the theory of<br />
nutrient diversion (Sachs et al., 1979).<br />
TIBA recorded minimum spike length.<br />
Reduced spike length with TIBA might be due to its<br />
ability to inhibit polar transport of auxins in cell<br />
elongation and reduced photosynthetic efficiency.<br />
This view gets support from the observations of<br />
Ravidas et al. (1992) and Devi et al. (2007) in<br />
gladiolus. Number of florets per spike was maximum<br />
with GA 3<br />
, NAA and BA treatments. The lowest<br />
number of florets were recorded with TIBA. Increase<br />
in number of florets per spike with GA 3<br />
treatments in<br />
gladiolus have been reported by Rajesh Bhalla and<br />
Ajay Kumar (2007), Dataram et al. (2001) and<br />
PranavRana et al. (2005), who obtained the highest<br />
number of florets per spike by application of GA 3<br />
at<br />
100 ppm. NAA treatments resulted in production of<br />
maximum number of florets per spike which might<br />
be due to short inter nodel length. The lowest number<br />
of florets per spike with TIBA might be due to reduced<br />
plant height and spike length. Devi et al. (2007) also<br />
reported similar results while investigating with NAA<br />
and TIBA in gladiolus.<br />
Results from the present study indicated that<br />
the number of replacement corms per mother corm<br />
was significantly highest in GA 3<br />
followed by BA and<br />
NAA. PranavRana et al. (2005) reported similar<br />
results with GA 3<br />
treatments (100,250 and 500 ppm)<br />
in gladiolus. Singh et al. (2002) also noticed highest<br />
number of corms per plant by with GA 3<br />
followed by<br />
NAA at 200 ppm and BA at 100 ppm treatments in<br />
gladiolus. TIBA recorded the lowest number of<br />
replacement corms per mother corm. Devi et al.<br />
(2007) also reported similar results with GA 3<br />
, NAA<br />
and TIBA in gladiolus. Gladiolus has two sources<br />
for planting viz. corm and cormel which can serve as<br />
reserve food material in the initial stages, and<br />
photosynthesizing leaves in later stages. Likewise it<br />
has two competing sinks,viz., flower spike and the<br />
developing corm and cormels. Plant growth regulators<br />
in all the concentrations recorded maximum number<br />
of replacement corms, cormels and propagation<br />
coefficient. They might have promoted the sink<br />
activity of developing corm and cormels at the<br />
expense of flower spike, which may be the reason<br />
for increase in number of corms and cormels. Similar<br />
results were also observed by Tawar et al. (2007) in<br />
gladiolus. The increase in size and weight of corms<br />
with the application of plant growth regulators could<br />
be attributed to the ability to increase the number of<br />
leaves which in turn increased the photosynthesis<br />
and photosynthetic assimilates. These assimilates<br />
were transported to the daughter corms, thereby,<br />
increasing their size and weight. Supportively, lowest<br />
values for corm weight were recorded with control.<br />
Similar results of increase in size and weight of<br />
gladiolus corms have been reported by Maurya and<br />
Nagda (2002), Umarao et al. (2007 b) and Vijay Kumar<br />
and Singh (2008). The data on number and weight of<br />
cormels per corm revealed that both the parameters<br />
differed significantly due to plant growth regulator<br />
treatments. Among the plant growth regulator<br />
treatments, more number and maximum weight of<br />
cormels per corm were recorded with BA, followed<br />
by TIBA , GA 3<br />
and NAA. Tawar et al.(2007) and<br />
Havale et al. (2008) have reported that BA 50 ppm<br />
recorded the highest values for number of corms and<br />
cormels, weight of corms and cormels. Maximum<br />
number of cormels and weight of cormels was with<br />
12
STUDIES ON THE EFFECT OF PLANT GROWTH REGULATORS ON FLOWERING<br />
TIBA might be due to their general depression of<br />
vegetative growth, rather than direct effect on<br />
tuberization (Levy et al., 1993; Devi et al.,2007). The<br />
data on propagation coefficient significantly differed<br />
with plant growth regulator treatments. Highest<br />
propagation coefficient was recorded with BA followed<br />
by TIBA, GA 3<br />
and NAA treatments. Similar results<br />
with BA application was observed by Baskaran et al.<br />
(2009).<br />
Table 1. Effect of plant growth regulators<br />
Treatments No. of days taken for No. of<br />
spikes/<br />
Plant Growth<br />
Regulators<br />
plant<br />
Spike<br />
length(cm)<br />
Spike<br />
growth<br />
rate<br />
No. of<br />
florets/<br />
spike<br />
1 st Flower<br />
appearance<br />
50%<br />
Flowering<br />
GA 3 – 100 ppm 95.30 102.73 1.26 137.98 1.44 14.06<br />
GA 3– 150 ppm 94.00 100.20 1.20 133.71 0.95 13.80<br />
NAA- 200 ppm 89.76 94.50 1.33 127.32 0.92 13.13<br />
NAA- 250 ppm 88.36 93.36 1.26 128.66 0.93 13.60<br />
BA – 50 ppm 86.60 90.73 1.26 123.74 0.85 10.76<br />
BA – 100 ppm 86.36 90.93 1.40 125.64 0.87 11.70<br />
TIBA- 75 ppm 84.66 91.10 1.13 91.81 0.58 8.86<br />
TIBA- 150 ppm 82.56 87.46 1.13 87.33 0.50 8.06<br />
Control (Distilled<br />
water)<br />
96.43 104.56 1.06 114.25 0.70 9.53<br />
‘ F ’ value Sig. Sig. Sig. Sig. Sig. Sig.<br />
S E m ± 0.57 0.36 0.07 0.35 0.07 0.30<br />
C D at 5% 1.75 1.10 N.S. 1.07 0.23 0.91<br />
CV % 4.66 3.12 10.44 9.51 15.82 7.55<br />
13
SUBBA REDDY et al<br />
Table 2. Effect of plant growth regulators on number of replacement corms per mother corm, size<br />
of the corm and weight of the corm in gladiolus cv. White Prosperity.<br />
Treatments<br />
Replacement<br />
Size of<br />
weight<br />
No.of<br />
Weight of the<br />
Propagation<br />
Plant Growth<br />
Regulators<br />
corms/<br />
mother corm<br />
the<br />
corm<br />
(cm)<br />
of the<br />
corm<br />
(gm)<br />
cormels /<br />
corm<br />
cormel/corm<br />
(gm)<br />
coefficient<br />
GA 3 – 100<br />
ppm<br />
GA 3 – 150<br />
ppm<br />
NAA- 200<br />
ppm<br />
NAA- 250<br />
ppm<br />
1.49 5.03 34.23 23.58 10.30 147.26<br />
1.25 5.02 31.80 24.80 11.59 157.31<br />
1.16 4.40 28.17 18.84 9.63 127.51<br />
1.16 4.78 29.20 19.20 9.96 127.96<br />
BA – 50 ppm 1.06 4.39 28.52 28.52 13.26 182.39<br />
BA – 100<br />
ppm<br />
1.20 4.39 28.06 29.75 14.00 194.20<br />
TIBA- 75 ppm 1.06 3.50 26.95 26.95 12.14 152.28<br />
TIBA- 150<br />
ppm<br />
Control<br />
(Distilled<br />
water)<br />
1.03 4.11 25.05 28.06 12.31 171.87<br />
1.10 3.39 19.58 12.92 8.06 125.99<br />
‘ F ’ value Sig. Sig. Sig. Sig. Sig. Sig.<br />
S E m ± 0.07 0.14 0.49 0.66 0.15 5.95<br />
C D at 5% 0.23 0.42 1.49 1.25 0.48 18.00<br />
CV % 11.68 5.65 3.11 4.86 7.82 6.69<br />
REFERENCES<br />
Baskaran, V, Misra ,R. L and Abirami K 2009. Effect<br />
of plant growth regulators on corm production in<br />
gladiolus, Journal of Horticultural Sciences<br />
4 (1) :, 78-80.<br />
Bhattacharjee, S. K 1984. The effect of growth<br />
regulating chemicals on gladiolus. Gartenbn<br />
Wissenchaft 49 (3): 103-106.<br />
Dataram, Verma ,J. P and Verma H K 2001.<br />
Preplanting soaking of corms with growth<br />
regulators influences flowering in gladiolus.<br />
Annals of Agri Bio Research 6 (2): 163-167.<br />
Devi, D .U., Sekhar, R .C and Babu, J. D 2007. Effect<br />
of growth regulators on flowering and corm<br />
14
STUDIES ON THE EFFECT OF PLANT GROWTH REGULATORS ON FLOWERING<br />
production in gladiolus cv. Jacksonvilla Gold.<br />
Journal of Research ANGRAU 35 (1): 6-14.<br />
Havale, V. B., Tawar, R. V., Hage, N .D., Kakad,<br />
G. J., Fathepurkar, S .C and Sable, A .S 2008.<br />
Effect of growth regulators and chemicals on<br />
growth and flowering of gladiolus. Asian Journal<br />
of Horticulture. 3(1) : 93-94.<br />
King, R. W., Blundell, C and Evans, L .T 1993.<br />
The behavior of shoot apices of<br />
Liliumtemulentum in vitro as the basis of an<br />
assay system for florigenic extracts. Australian<br />
Journal of Plant Physiology 20 (3): 337-348.<br />
Kumar, P .N., Reddy, Y N and Chandra shekar,<br />
R. 2007. Flower induction in gladiolus cormels<br />
by application of chemicals. Journal of<br />
Ornamental Horticulture 9 (3):174-178.<br />
Levy, D, Sea, brook, JEA and Coleman, S 1993.<br />
Enhancement of tuberization of axillary shoots,<br />
buds of potato Solanumtuberosem L. cultivars<br />
cultured in vitro.J. Exp. Botany 44 : 381- 386.<br />
Maurya, R. P and Nagda, C .L 2002. Effect of growth<br />
substances on corm and cormel yield in gladiolus<br />
Gladiolus grandiflorusL.cv. Friendship. Haryana<br />
Journal of Horticultural Sciences 31(1-2): 60-61.<br />
Mukhopadhyay, A and Banker, G. J 1986. Preplanting<br />
soaking of corm with gibberellic acid modified<br />
growth and flowering of gladiolus cultivar<br />
‘Friendship’. Indian Agriculturist 30(4): 317-319<br />
Ogawa, Y and King, R. W 1994. Flowering in seedlings<br />
of Pharbitis nil induced by benzyladenine applied<br />
under a non-inductive day length Plant Cell<br />
Physiology, 21: 1109-1116.<br />
Pranav Rana, Jitendra, Kumar and Mukesh, Kumar<br />
2005 Response of GA 3,<br />
plant spacing and planting<br />
depth on growth, flowering and corm production<br />
in gladiolus. Journal of Ornamental Horticulture<br />
(New Series) 8 (1): 41-44.<br />
Rajesh, Bhalla and Ajay Kumar 2007. Response of<br />
plant bio-regulators on dormancy breaking in<br />
gladiolus Journal of Ornamental Horticulture<br />
10 (4) : 215-221.<br />
Ravidas, L., Rajeevan, P K and ValasalaKumari<br />
1992.Effect of foliar application of growth<br />
regulators on the growth, flowering and corm yield<br />
of gladiolus cv. Friendship. South Indian<br />
Horticulture 40(6): 329-335.<br />
Sachs, R. M., Hackett W. P., Ramina A and Maloof.<br />
C 1979. Photosynthetic assimilation and nutrient<br />
diversion as controlling factors in flower initiation<br />
in Bougainvillea (San Diego Red) and<br />
NIcotianfatabacum cv. WIs.38 In :MArcelle R,<br />
clysters H and Van Poucke M (eds).<br />
Photosynthesis and plant development. Dr. W.<br />
Junk, The Hague p. 95-102.<br />
Sharma, H. G., Verma, L. S., Jain and Tiwary, B .L.<br />
1995. Effect of foliar application of some plant<br />
growth regulators on growth and flowering of<br />
chrysanthemum var. Move-in-Carvin. Orissa<br />
Journal of Horticulture 23(1-2): 61-64.<br />
Singh, M. K., Parmar, A .S and Rathore, S. V. S<br />
2002. Corm production in gladiolus as affected<br />
by size of cormels and GA 3<br />
application. In:<br />
Floriculture Research Trend in India. Misra R L<br />
and SanyatMisara (eds.). Proceedings of the<br />
National Symposium on Indian Floriculture in the<br />
New Millenium held during 25-27 th February, 2002<br />
at Bangalore. pp. 246-248.<br />
Tawar, R .V., Sable, A .S., Kakad, G. J., Hage, N D<br />
and Ingle M B 2007. Effect of growth regulators<br />
on corms and cormels production of gladiolus<br />
(cv. Jester). Annals of Plant Physiology 21 (2):<br />
257-258.<br />
Umrao, V .K., Vishal, Sharma and Baldev, Kumar<br />
2007. Influence of Gibberellic acid spraying on<br />
gladiolus cv. rose delight. Progressive Agriculture<br />
7 (1-2): 187-188<br />
Vijai, Kumar and Singh, A. R 2008. Effect of GA 3<br />
and<br />
growing medium on growth, flowering and corm<br />
production in gladiolus. Progressive Agriculture<br />
8 (2) :, 165-168.<br />
15
J.Res. ANGRAU 41(2) 16-20, 2013<br />
PERFORMANCE OF DRUM SEEDER IN DIRECT SOWN PADDY UNDER<br />
PUDDLED CONDITION<br />
M.VISALAKSHI and A.SIREESHA<br />
Regional Agricultural Research Station, Acharya N.G.Ranga Agricultural University, Anakapalli -531 001<br />
Date of Receipt : 02.11.2012 Date of Acceptance : 10 .05.2013<br />
ABSTRACT<br />
Field experiments were conducted on direct sown paddy using eight-row drum seeder under puddled<br />
condition in farmers fields of Vizianagaram district, Andhra Pradesh during Kharif season for three years from 2007-<br />
2008 to 2009-2010 to evaluate the efficiency of drum seeder at different seed rates. (20, 30 and 40 kg ha -1 ) and<br />
optimum seed rate was quantified. The results showed that use of drum seeder at 30 kg seed ha -1 recorded increased<br />
grain yield by 26 and 22 per cent (7.58 t ha -1 ) respectively over that of 20 and 40 kg ha -1 seed rate. It was also found<br />
superior to normal transplanting and broadcasting of sprouted seed @ 75 Kg ha -1 . Drum seeder technology at 30 kg<br />
seed per ha reduced the seed rate by 45 kg ha -1 compared to broadcasting of seed on puddled soil and resulted in<br />
higher returns to farmers over normal transplanting/ broadcasting of sprouted seed.<br />
Transplanting is the most common method<br />
of crop establishment in rice cultivation under low<br />
land situation and is highly labour-intensive and<br />
expensive operation. In contrast, broadcasting of seed<br />
causes uneven plant stand, low yields and returns.<br />
In Vizianagaram district, Andhra pradesh, the major<br />
rice area is under tanks and success of crop depends<br />
on rainfall received. In many years overaged<br />
seedlings are planted due to delayed monsoon.<br />
Further, transplanting is not profitable due to high<br />
labour wages and problem of non-availability of labour<br />
during peak period of operation (Singh et al.,2005).<br />
Transplanting alone costs about 15% of total rice<br />
production cost and delayed transplanting due to<br />
labour shortage causes sustainable loss in yield<br />
(Ponnuswamy et al.,1999). Therefore, there is need<br />
of alternative methods to replace transplanting to<br />
tackle the problems of high cost of production and<br />
labour scarcity.<br />
Direct sowing of sprouted seed in puddled<br />
fields using drum seeder reduces the input costs<br />
i.e.,cost of seed, nursery raising, transplanting and<br />
it is a good method under late onset of monsoon .<br />
The present study was conducted in farmers<br />
fields to fine tune drum seeder technology with<br />
different seed rates for its large scale adoption and<br />
higher yields.<br />
MATERIALS AND METHODS<br />
The DAATT Centre,Vizianagaram introduced<br />
8 row paddy drum seeder made of fibre supplied by<br />
KSNM marketing, Coimbatore through AGROS<br />
during kharif, 2007 in Vizianagaram dsitrict. On farm<br />
trials were conducted during kharif season of 2007,<br />
2008 and 2009 to demonstrate the performance of<br />
drum seeder for direct sown paddy under puddled<br />
condition. Five villages were selected to carry out<br />
on-farm trials on purposive random sampling. These<br />
five villages were considered as five replications. Two<br />
hectares was allotted as a representative area for<br />
testing the performance of drum seeder in farmers<br />
fields with 5 treatments viz.,T 1<br />
, farmer’s practice of<br />
transplanting; T 2<br />
, farmer’s practice of broadcasting<br />
seed using 75 kg ha -1 ; T 3<br />
,seeding sprouted seed @<br />
20 kg seed ha -1 using drum seeder; T 4<br />
, seeding<br />
sprouted seed @ 30 kg seed ha -1 using drum seeder;<br />
T 5<br />
, seeding sprouted seed @ 4 0 kg seed ha -1 using<br />
drum seeder . Seeding of nursery was also done on<br />
the same day and 30 day old seedlings were<br />
transplanted in T 1<br />
and 75 kg ha -1 dry seed was<br />
broadcasted in T 2<br />
. In treatments T 3,<br />
T 4<br />
and T 5<br />
,<br />
sprouted seeds were sown at three seed rates using<br />
drum seeder. For direct sowing using drum seeder,<br />
the paddy seeds are soaked in water for 24 hours<br />
followed by incubation in gunny bags for 24-48 hours<br />
depending upon the rice variety and prevailing<br />
temperature. The field was well puddled and levelled<br />
after draining the standing water before sowing to<br />
avoid damage of sprouted seed and to enable water<br />
to spread uniformly over the field. After puddling, the<br />
field is left for 1-2 days for settling of the puddled<br />
soil. Using drum seeder, seed rate required for direct<br />
email: visalamahanthi@yahoo.co.in<br />
16
PERFORMANCE OF DRUM SEEDER IN DIRECT SOWN PADDY UNDER PUDDLED CONDITION<br />
sowing of sprouted seed in pudlled fields was<br />
calibrated by adjusting the drum holes for seed rate<br />
at 20,30 and 40 ha -1 and optimum seed rate required<br />
was quantified by studying the yield parameters. The<br />
pre germinated seeds are sown in 8 rows with 20 cm<br />
spacing using drum seeder. Weeds were kept under<br />
check by operating cono weeder at 10 days after<br />
sowing or by using pre emergence herbicide<br />
oxadiargyl @ 90 g ha -1 with sand mixture at 7 days<br />
after sowing. The field was kept moist and wet, no<br />
standing water in the field upto 20 days after sowing.<br />
Yield attributes and grain yield were recorded in each<br />
treatment plot and the data was statistically analysed<br />
in randomised block design. Cost of cultivation and<br />
net returns of each treatment were calculated on the<br />
prevailing cost of inputs and market prices.<br />
RESULTS AND DISCUSSIONS<br />
Yield parameters<br />
On-Farm trial studies on performance of drum<br />
seeder for direct sown paddy in puddled fields showed<br />
hightest tillers per m 2 ,panicles per m 2 and filled grains<br />
per panicle in T 4<br />
(seeding sprouted seed @ 30 kg ha -<br />
1<br />
seed using drum seeder) followed by T 3<br />
and T 5.<br />
Direct seeding using drum seeder was significantly<br />
higher over transplanting and broadcasting methods.<br />
The lowest tillers per m 2 , panicles per m 2 and filled<br />
grains per panicle were observed with farmer’s<br />
practice of transplanting (Table1).The transplanted<br />
rice matured 10-20 days later than the direct seeded<br />
rice. The higher number of panicle per m 2 in direct<br />
sowing with drum seeder was due to higher number<br />
of mother plants per unit area. Early establishment<br />
of seedlings in direct sown sprouted seed might be<br />
the reason for higher tillers per m 2 than conventional<br />
transplanting. Similar findings were reported by Halder<br />
and Patra (2007).<br />
Grain yield<br />
Grain yield was significantly influenced by<br />
sowing methods. Farmer’s practice of transplanting<br />
(T 1<br />
) recorded the lowest grain yield (Table 2). The<br />
highest grain yield was observed with treatment T 4<br />
(seeding sprouted seed @ 30 kg seed ha -1 using drum<br />
seeder) followed by T 5<br />
(seeding sprouted seed @ 40<br />
kg seed ha -1 using drum seeder). Shekar and Singh<br />
(1991) stated that direct sowing of sprouted seeds<br />
under puddled condition results in significant<br />
improvement in yield attributes and grain yield. Direct<br />
sowing of paddy using drum seeder @ 30 kg ha -1<br />
recorded higher grain yield (26.33 % and 22.45%)<br />
over sowing of sprouted seed @ 20 kg ha -1 and 40<br />
kg ha -1 . Seeding sprouted seed @ 30 kg seed ha -1<br />
using drum seeder recorded higher grain yield<br />
(44.93% and 35.35%) over T 2<br />
(Farmer’s practice of<br />
broadcasting sprouted seed @ 75 kg ha -1 ) and T 1<br />
(Farmer’s practice of transplanting with seed rate @<br />
75kg ha -1 ). Halder and Patra (2007) stated that<br />
seeding of sprouted seeds with 8-row seeder after<br />
puddling increased grain yield (21.5%) over farmer’s<br />
practice of transplanting. Higher grain yield in T 4<br />
was<br />
due to higher panicles per m 2 and filled grains per<br />
panicle. Seeding of spouted seed using drum seeder<br />
@ 30 kg ha -1 and 40 kg ha -1 recorded significantly<br />
higher grain yield than both farmer’s practice of<br />
transplanting and farmer’s practice of broadcasting .<br />
Similar trend was observed during all the three years<br />
of study (Table 2).<br />
Economics<br />
Highest net return was recorded when<br />
sprouted seed @ 30 kg ha -1 was sown using drum<br />
seeder. This was due to higher grain yield and low<br />
cost of cultivation observed in all the three years.<br />
Farmer’s practice of transplanting recorded the lowest<br />
net returns due to low grain yield and higher cost of<br />
cultivation. Highest benefit - cost ratio was recorded<br />
with seeding of sprouted seed @ 30 kg ha -1 using<br />
drum seeder due to higher yield and low cost of<br />
cultivation(Table 2). Farmer’s practice of<br />
transplanting recorded the lowest net return due to<br />
low grain yield. Similar findings were reported by<br />
Halder and Patra (2007). Thus, rice cultivation by<br />
seeding of sprouted seed @ 30 kg ha -1 using drum<br />
seeder under puddled condition gave higher rice grain<br />
yield than farmer’s practice of transplanting /<br />
broadcasting using 75 kg seed ha -1 .<br />
With the adoption of direct sowing in paddy<br />
with sprouted seed @ 30 kg ha -1 using drum seeder,<br />
the paddy farmers could earn a net income of<br />
Rs.36,697/- per hectare compared to that of<br />
conventional transplanting (Rs. 16,261/ha). These<br />
trials conducted at farmer’s fields clearly established<br />
the advantage of direct sowing of paddy using drum<br />
seeder in puddled condition with 30 kg seed ha -1 over<br />
conventional method of transplanting.<br />
17
VISALAKSHI and SIREESHA<br />
Table 1 . Growth, yield attributes and grain yield of rice as influenced by crop establishment methods under puddled conditions<br />
18
PERFORMANCE OF DRUM SEEDER IN DIRECT SOWN PADDY UNDER PUDDLED CONDITION<br />
Table 2 . Grain yield and economics of rice cultivation as influenced by crop establishment methods under puddled conditions<br />
19
VISALAKSHI and SIREESHA<br />
REFERENCES<br />
Halder, J and Patra, A.K. 2007 . Performance of<br />
eight-row drum seeder in direct seeded rice Oryza<br />
sativa under puddled condition. Indian Journal<br />
of Agricultural Sciences. 77(12): 819-23.<br />
Ponnuswamy, K., Santhi, P., Kempu Chetty, N and<br />
Subramaniam, M. 1999. Effect of various<br />
methods of establishment on growth and yield<br />
of rice. Oryza.36(3): 294-5.<br />
Shekar, J and Singh C.M. 1991. Influence of methods<br />
and dates of stand establishment on growth<br />
and yield of rice. Oryza. 28 : 45-48.<br />
Singh, G., Singh, R. G., Singh, O. P.,Kumar, T.,<br />
Mehta, R. K., Kumar, V and Singh, P. P.<br />
2005. Effect of weed management practices on<br />
direct seeded rice Oryza sativa under puddled<br />
low lands. Indian Journal of agronomy. 50(1):<br />
35-7.<br />
20
J.Res. ANGRAU 41(2) 21-25, 2013<br />
EFFECT OF GRADED LEVELS AND TIME OF NITROGEN APPLICATION ON<br />
NUTRIENT UPTAKE, YIELD AND ECONOMICS OF SEMI-DRY RICE<br />
Oryza sativa L.<br />
K. JHANSI LAKSHMI BAI, K.V. RAMANA MURTHY and M.VENKU NAIDU<br />
Department of Agronomy, Agricultural College,<br />
Acharya N.G. Ranga Agricultural University, Naira-532185<br />
Date of Receipt : 21.12.2012 Date of Acceptance : 28.03.2013<br />
ABSTRACT<br />
An investigation was conducted during Kharif 2011 at Agricultural College Farm, Naira to study the response<br />
of semi-dry rice to nitrogen levels and its time of application on nutrient uptake, yield and economics of semi-dry rice.<br />
The experiment was laid out in split-plot design with three replications. Treatments included four rates of nitrogen<br />
application (60, 80,100 and 120 kg/ha) as main plot treatments and five varied timings of nitrogen application [(S!+<br />
S! + S!), (¼+ ¼ + ¼ + ¼), (¼+ ½ + ¼), (¼+ ¼ + ¼ + ¼) at basal, active tillering/ conversion to wet, panicle initiation and<br />
flowering and Leaf Colour Chart (LCC) based application] as sub plot treatments. Application of 120 kg N ha -1<br />
resulted in the highest yield and nutrient uptake as well as higher monetary returns and was significantly superior<br />
to other graded levels of nitrogen. With respect to the time of application, highest nutrient uptake, yield and returns<br />
were recorded at harvesting stage with application of nitrogen in four splits ¼ each at basal, conversion to wet,<br />
panicle initiation and flowering leading to higher productivity.<br />
In India, rice is the principal food crop grown<br />
in an area of 42.2 m.ha with a production 95.9 m.t<br />
and productivity of 2.24 t ha -1 . In Andhra Pradesh, it<br />
is grown in an area of 4.56 m.ha with a production of<br />
7.51 m.t and productivity of 3.02 t ha -1 (Ministry of<br />
Agriculture, 2010-2011). Semi-dry system<br />
successfully exploits the pre monsoon showers<br />
ensuring high water use efficiency and often confronts<br />
moisture stress due to inadequate and ill distributed<br />
rainfall leading to low productivity (Mohanasarida and<br />
Jose Mathew, 2005). Dry seeding with early showers<br />
has been found to produce similar grain yield as that<br />
of transplanting with aged seedlings (Reddy and<br />
Krishna, 1998). Specific management practices like<br />
optimum dose and time of nitrogen application are<br />
required to obtain good yields under semi-dry system.<br />
The area under semi-dry rice is increasing<br />
rapidly due to scarcity of labour in the North Coastal<br />
districts of Andhra Pradesh. At present, the nitrogen<br />
management recommended and adopted for semidry<br />
rice is similar to that of conventionally grown<br />
lowland rice. Improvement in nitrogen management<br />
can be achieved only by planning strategies<br />
responsive to the requirement and temporal variations<br />
in crop nitrogen demand specific to the growing<br />
environment and location. Hence, the present<br />
investigation was taken up to evolve an efficient<br />
nitrogen management strategy for semi-dry rice.<br />
MATERIALS AND METHODS<br />
A field experiment was conducted during<br />
Kharif 2011, at the Agricultural College Farm, Naira<br />
(18.24 0 N latitude, 83.84 0 E longitudes and at an<br />
altitude of 27 m above mean sea level) in semi dry<br />
rice with variety Vasundhara (RGL-2538). The soil of<br />
the experimental field was sandy clay loam in texture,<br />
low in organic carbon (0.31%) and available nitrogen<br />
(180 kg ha -1 ), medium in available phosphorous (52<br />
kg ha -1 ) and potassium (256 kg ha -1 ). Under average<br />
climatic conditions, the area receives 482.9 mm of<br />
total annual rainfall. The mean monthly temperatures<br />
during the rice growing seasons varied from 25 0 C to<br />
34 0 C.<br />
The experiment was laid out in split-plot<br />
design with three replications. Treatments mainly<br />
comprised of four graded levels of nitrogen N 1<br />
(60<br />
kg N ha -1 ), N 2<br />
(80 kg N ha -1 ), N 3<br />
(100 kg N ha -1 ), N 4<br />
(120 kg N ha -1 )] assigned to main plots and five varied<br />
timings of nitrogen application [T 1<br />
(S! at basal + S!<br />
at active tillering + S! at panicle initiation), T 2<br />
(¼ at<br />
basal + ¼ at active tillering + ¼ at panicle initiation +<br />
¼ at flowering), T 3<br />
(¼ at basal + ½ at active tillering +<br />
¼ at panicle initiation), T 4<br />
(¼ at basal + ¼ at<br />
conversion to wet + ¼ at panicle initiation + ¼ at<br />
flowering), T 5<br />
Leaf Colour Chart(LCC) based<br />
application] allotted to sub plots. Nitrogen was<br />
email: ramanaagro16@gmail.com<br />
21
JHANSI et al<br />
applied in splits as per the treatments except in T 4<br />
where the first top dressing of nitrogen was applied<br />
when the system was converted to wet. As per the<br />
standard procedure for applying nitrogen based on<br />
LCC (T 5<br />
) in rice, first application of nitrogen (S! of the<br />
nitrogen dose) was given at 21 DAS. Thereafter, the<br />
observations were made at every 7 days and the top<br />
dressing was scheduled whenever the colour of the<br />
youngest fully expanded leaf fell below critical value<br />
4 of the LCC. Accordingly, the top dressing of S! of<br />
total nitrogen dose was at 54 DAS for all the nitrogen<br />
levels and the remaining S! of the total nitrogen was<br />
applied at 81 DAS for (N 1<br />
) and (N 2<br />
) and at 91 DAS for<br />
(N 3<br />
) and (N 4<br />
). A fertilizer dose of 60 kg P 2<br />
O 5<br />
& 50 kg<br />
K 2<br />
O ha -1 was applied uniformly to all plots. Entire<br />
phosphorous was applied as basal and potassium<br />
was applied in two split doses i.e. T! at basal and S!<br />
at panicle initiation stage. Crop was sown by adopting<br />
a spacing of 20 cm × 10 cm. Nitrogen, phosphorus<br />
and potassium content in plant samples was analysed<br />
by adopting standard procedures as detailed by<br />
Tandon (1993). The data recorded on various<br />
parameters were analyzed following standard<br />
statistical analysis of variance technique suggested<br />
by Panse and Sukhatme (1978).<br />
RESULTS AND DISCUSSION<br />
At all the crop growth stages of observation<br />
the uptake of nitrogen, phosphorous and potassium<br />
were highest with the supply of nitrogen at 120 kg<br />
ha -1 which was significantly superior to other nitrogen<br />
levels tried (Table 1). The lowest uptake of all the<br />
three nutrients was seen at the lower level of nitrogen<br />
(60 kg ha -1 ) compared to that of at higher levels. The<br />
increase in nitrogen uptake at higher levels may be<br />
ascribed to the fact that plant absorbed nitrogen<br />
proportionately as the pool of available nitrogen<br />
improved in soil by the addition of higher amount of<br />
nitrogen. Similar findings were reported by Sudhakar<br />
et al. (2003), Dhurandher and Tripathi (1999) and<br />
Lakpale et al. (1999).<br />
At active tillering stage, Leaf Colour Chart<br />
based nitrogen application recorded highest nutrient<br />
uptake and was significantly superior to rest of the<br />
nitrogen application timings (Table 1).Application of<br />
nitrogen in four splits viz., ¼ each at basal, AT, PI<br />
and flowering ; ¼ each at basal, conversion to wet,<br />
PI and flowering and application of nitrogen in three<br />
splits viz., ¼ at basal + ½ at AT + ¼ at PI were in<br />
parity with each other. At panicle initiation stage,<br />
highest uptake of nitrogen, phosphorous and<br />
potassium were observed with application of nitrogen<br />
in three splits ¼ at basal + ½ at AT + ¼ at PI which<br />
was comparable with LCC based nitrogen application<br />
and both of them were significantly superior to other<br />
timings of nitrogen application. At flowering stage,<br />
the highest nutrient uptake was obtained with<br />
application of nitrogen in three splits S! each at basal,<br />
AT and PI. However it was comparable to that of<br />
nitrogen application in three splits ¼ at basal + ½ at<br />
AT + ¼ at PI and LCC based nitrogen application<br />
and was significantly superior to rest of the timing<br />
of nitrogen application studied.<br />
At crop harvest, application of nitrogen in<br />
four splits ¼ each at basal, conversion to wet, PI<br />
and flowering recorded highest uptake of<br />
phosphorous, potassium and nitrogen by grain as well<br />
as straw and was comparable with LCC based<br />
nitrogen application and nitrogen application in four<br />
splits ¼ each at basal, AT, PI and flowering. All<br />
these were significantly superior to the rest of the<br />
timings of nitrogen application. This might be due to<br />
the improved root system and their foraging ability<br />
which improved the nitrogen absorption. Application<br />
of nitrogen in three splits S! each at basal, AT and<br />
PI, recorded significantly higher uptake of<br />
phosphorous, potassium and nitrogen by grain +<br />
straw than nitrogen application in three splits ¼ at<br />
basal + ½ at AT + ¼ at PI, which recorded the lowest<br />
nutrient uptake.<br />
Application of 120 kg N ha -1 gave highest<br />
grain and straw yield as well as the monetary returns<br />
and was significantly superior to other nitrogen levels<br />
tested (Table 2). This was followed by application of<br />
nitrogen at 100 kg ha -1 which was however,<br />
comparable to that of 80 kg N ha -1 . The lowest grain<br />
yield was registered with the supply of nitrogen at 60<br />
kg ha -1 . Grain yield, straw yield and economic returns<br />
were the highest with application of nitrogen in four<br />
splits of ¼ each at basal, conversion to wet, panicle<br />
initiation and flowering, which were on par with that<br />
of LCC based application and as well as supply of<br />
nitrogen in four splits ¼ each at basal, active tillering,<br />
panicle initiation and flowering stages. Application<br />
of nitrogen each at basal, active tillering and panicle<br />
22
EFFECT OF GRADED LEVELS AND TIME OF NITROGEN APPLICATION<br />
Table 1. Effect of graded levels and time of nitrogen application on nutrient uptake (kg ha -1 ) of semi-dry rice<br />
23
JHANSI et al<br />
Table 2. Effect of graded levels and time of nitrogen application on yield and economics of semi-dry<br />
rice<br />
Nitrogen levels<br />
Grain yield<br />
(kg ha -1 )<br />
Straw yield<br />
(kg ha -1 )<br />
Gross returns<br />
(Rs ha -1 )<br />
Net returns<br />
(Rs ha -1 )<br />
B:C ratio<br />
N 1 - 60 kg N ha -1 3734 5130 39903 23042 1.37<br />
N 2 - 80 kg N ha -1 4275 5825 45682 28582 1.67<br />
N 3 - 100 kg N ha -1 4400 6030 47014 29674 1.71<br />
N 4 - 120 kg N ha -1 4695 6454 50175 32585 1.85<br />
SEm ± 80.42 111.12 855.34 593.99 0.04<br />
CD at 5% 278 384 2960 2055 0.12<br />
CV (%) 7.28 7.34 7.25 8.08 8.15<br />
Time of nitrogen application<br />
T 1 - ⅓ at basal + ⅓ AT+ ⅓ PI 4063 5573 43418 26316 1.54<br />
T 2 - ¼ at basal + ¼ AT + ¼ PI<br />
+ ¼ flowering<br />
4413 6062 47165 29763 1.73<br />
T 3 - ¼ at basal + ½ AT + ¼ PI 3769 5178 40279 23176 1.35<br />
T 4 - ¼ at basal + ¼ at<br />
conversion to wet + ¼ PI + ¼<br />
at flowering<br />
4649 6375 49680 32278 1.85<br />
T 5 - LCC based application 4484 6109 47924 30822 1.80<br />
SEm ± _ 97.89 131.84 1045.21 975.68 0.05<br />
CD at 5% 282 380 3011 2810 0.14<br />
CV (%) 7.93 7.79 7.92 11.87 9.91<br />
initiation produced significantly higher grain and straw<br />
yield as well as economic returns than application of<br />
nitrogen in three splits ¼ at basal + ½ at active tillering<br />
+ ¼ at panicle initiation(Table 2). As yield is a<br />
manifestation of the individual yield components, in<br />
this case also the nitrogen dose and time of<br />
application at critical stages resulted in highest grain<br />
yield which in turn was due to the highest number of<br />
panicles m -2 , number of filled grains panicle -1 and<br />
thousand grain weight coupled with higher nitrogen<br />
uptake and efficient translocation to sink. Similar<br />
results were noticed by various researchers viz.,<br />
Kayam Singh and Tripathi (2007) and Sudhakar et<br />
al. (2003).<br />
REFERENCES<br />
Dhurandher, R. L and Tripathi, R. S. 1999.<br />
Productivity of medium duration rice cultivar<br />
under different sowing methods and nitrogen<br />
levels. Agriculture Science Digest. 19 (3): 267-<br />
271.<br />
Kayam Singh and Tripathi, H. P. 2007. Effect of<br />
nitrogen and weed-control practices on<br />
performance of irrigated direct-seeded rice Oryza<br />
sativa. Indian Journal of Agronomy. 52 (3): 231-<br />
234.<br />
24
EFFECT OF GRADED LEVELS AND TIME OF NITROGEN APPLICATION<br />
Lakpale, R., Pandey, N and Tripathi, R. S. 1999.<br />
Effect of levels of nitrogen and forms of preconditioned<br />
urea on grain yield and N status in<br />
plant and soil of rainfed rice Oryza sativa. Indian<br />
Journal of Agronomy. 44 (1): 89-93.<br />
Mohanasarida, K and Jose Mathew. 2005. Effect of<br />
seed hardening on growth and yield attributes<br />
and yield of semi-dry rice. Research on crops. 6<br />
(1): 26-28.<br />
Ministry of Agriculture, Government of India. 2010-<br />
2011. http:// www.indiastat.com.<br />
Panse, V. G and Sukhatme, P.V. 1978. Statistical<br />
methods for agricultural workers. Indian Council<br />
of Agricultural Research, New Delhi, pp. 361.<br />
Reddy, M. D and Krishna, V. G. 1998. Studies on<br />
crop establishment under different rice cultural<br />
situations. Journal of Research ANGRAU. 26 (1):<br />
66-68.<br />
Sudhakar, G., Solomalai, A and Ravisankar, N. 2003.<br />
Influence of cultivars and levels of nitrogen on<br />
yield, nutrient uptake and residual nutrient status<br />
of soil in semi – dry rice. Agriculture Science<br />
Digest. 23 (2): 88-91.<br />
Tandon, H. L. S. 1993. Methods of analysis of soils,<br />
plants, waters and fertilizers. Fertilizers<br />
Development and Consultation Organization,<br />
New Delhi, India.pp:143<br />
25
J.Res. ANGRAU 41(2) 26-32, 2013<br />
ASSESSMENT OF GENETIC DIVERSITY IN Capsicum spp. BY USING<br />
MORPHOLOGICAL AND MOLECULAR TOOLS<br />
S. JOSHI, C. SARMA, C. JANGID AND H.V. VIJAYAKUMARSWAMY<br />
Department of Plant Biotechnology, University of Agricultural Sciences, Bengaluru - 560065<br />
Date of Receipt : 22.12.2013 Date of Acceptance : 16.03.2013<br />
ABSTRACT<br />
Chilli belongs to the genus Capsicum which possess enormous wealth of genetic diversity. Extent of<br />
genetic diversity determines the success level of crop improvement programme. In the present study, genotypes<br />
were taken from different eco-geographical regions to assess genetic diversity and variability at both morphological<br />
and molecular level. For morphological characterization different yield attributing characters were studied. For<br />
estimation of D2 values GENRES software was used and it was found that all the exotic genotypes and genotypes<br />
from northern part of India clustered together while, two genotypes of southern part of India fell into separate cluster.<br />
Genetic diversity was also estimated at molecular level with the help of capsicum specific SSR markers, Genotype<br />
EC 362980 which belongs to Capsicum chinese and EC 121489 which belongs to Capsicum baccatum were far<br />
apart in dendrogram which showed they were less relative to each other during course of evolution. However, the<br />
remaining genotypes which belongs to Capsicum annum came in between those two species which showed they<br />
might have originated from Capsicum chinense and Capsicum baccatum.<br />
Capsicum is one of the most important spices<br />
cum vegetable crops grown in India. It belongs to<br />
family Solanaceae comprising twenty to thirty species<br />
of new world tropic and subtropics. Modern<br />
taxonomists recognize five major cultivated species<br />
of hot pepper and mild types as Capsicum annum,<br />
Capsicum fruitescense L., Capsicum chinense<br />
jacquin, Capsicum pendulum Wildenow and Capsicum<br />
pubescens Ruig and Pavon (Pickersgill, 1997). Chilli<br />
valued for its characteristic pungency, color and<br />
flavor, besides being rich source of vitamins viz. A,<br />
C and E. India is the largest producer of chilli in the<br />
world (Singh, 2007). An important way to increase<br />
productivity in any crop plant is to first select<br />
desirable genotypes from among the existing<br />
variations and use them in the breeding programmes.<br />
The extent of initial variability/genetic diversity<br />
determines the level of success of crop improvement<br />
programmes. Diversity based on morphological<br />
marker has limitations because of their small number,<br />
while diversity at biochemical level is stage<br />
depending. Molecular markers has an advantage over<br />
these limitations. However, the present study has<br />
been designed to use both morphological and<br />
molecular markers to study diversity among<br />
Capsicum germplasm.<br />
MATERIALS AND METHODS<br />
The experimental material consists of<br />
nineteen cultivars (Table.1) which were sown in poly<br />
bags inside greenhouse and then transplanted to the<br />
main field of Department of Plant Biotechnology, UAS-<br />
GKVK, Bangalore at 30 DAS during Kharif 2010 and<br />
molecular analysis with Capsicum specific primers<br />
were carried out further. Genotypes were evaluated<br />
for eight morphological characters i.e. plant height<br />
(cm), days to 1st flowering, days to 50% flowering,<br />
days to fruit maturity, seed weight (g), fruit length<br />
(cm), fruit weight (g) and number of seeds per plant.<br />
The layout of the experiment was Randomized Block<br />
Design (RBD) with three replications. The mean<br />
values of five randomly selected plants from each<br />
replication were used for data analysis, range, GCV,<br />
PCV, heritability and expected genetic advance as<br />
percent of mean were analyzed. Morphological<br />
diversity among the selected genotypes was<br />
assessed with the help of GENRES software.<br />
A total of twenty-five SSR markers which<br />
are distributed across the genome used for<br />
polymorphism studies (Table 2). For PCR reaction,<br />
20l reaction mixture containing template DNA 2.0l<br />
(20ng/l), 2.0l of both forward and reverse primer<br />
respectively (5 pm/l). 0.20l Taq DNA polymerase<br />
email: shourabhforbt@gmail.com<br />
26
ASSESSMENT OF GENETIC DIVERSITY IN Capsicum spp.<br />
(1U), 2.0l of dNTPs (1mM) and 2.0l of 10X PCR<br />
buffer and remaining sterile water were used. The<br />
bands were manually scored as ‘1’ for the presence<br />
and ‘O’ for the absence and the binary data was used<br />
for statistical analysis. This band data was subjected<br />
to cluster analysis using STATISTICAL software. A<br />
dendrogram was constructed by un-weighted pairgroup<br />
arithmetic mean (UPGMA). The dissimilarity<br />
martrix was developed using Squared Euclidean<br />
Distance (SED), which estimated all the pair wise<br />
differences in the amplification product. Only clear<br />
and unambigous bands were taken into account and<br />
the bands were not scored if they were faint or<br />
diffused, as such fragments possess poor<br />
reproducibility.<br />
RESULTS AND DISCUSSION<br />
All the eight characters under study varied<br />
significantly among nineteen cultivars (Table 3). Plant<br />
height for each cultivar was recorded when first fruit<br />
had begun to ripen in 50 percent of the plants and<br />
significant differences were observed among the<br />
cultivars studied. The maximum plant height was<br />
recorded with the line IC 361897 (45 cm) followed by<br />
IC 397238 (44), while the minimum was recorded with<br />
EC 362928 (32 cm) (Table 4). Significant differences<br />
were observed for days to 50 percent flowering.<br />
Among the cultivars studied IC 119275 (56) took<br />
maximum days while, the line EC 382049 (45) took<br />
minimum number of days to 50 percent flowering.<br />
Considerable differences were observed for days<br />
taken to fruit maturity. Arka suphal, took maximum<br />
(97) days, while EC 362928 took minimum (70)<br />
number to days for fruit maturity. Significant variance<br />
indicated the role of non additive gene action in the<br />
inheritance of all traits.<br />
Fruit weight was highest in IC 119234 (31 g)<br />
and least was in EC 362928 (9 g). Highest 10000<br />
seed weight was recorded in cultivar Arka Suphal (6<br />
g) followed by line IC 361897 (6 g) and lowest seed<br />
weight was recorded in EC 121489 (3 g). Highest<br />
number of seeds per fruit was recorded in line IC<br />
119230 (90) and it was lowest in line IC 381108 (28).<br />
All genotypes displayed considerable amount of<br />
difference in their mean performance with respect to<br />
all eight characters studied. This has also been<br />
exemplified by significant values of mean sum of<br />
square for these traits, which indicated that the lines<br />
under study were genetically diverse.<br />
The phenotypic variance was higher than<br />
genotypic variance for all the characters. Phenotypic<br />
coefficient of variation ranged form 10.06 (days taken<br />
to maturity) to 36.04 (fruit weight). Genotypic<br />
coefficient of variation ranged from 8.28 (days taken<br />
to 50% flowering) to 32.04 (fruit weight). The<br />
estimates of heritability ranged from 37.18 percent<br />
(days taken to 50% flowering) to 98.75 percent (seed<br />
weight). Genetic advance expressed as percentage<br />
over mean ranged from 10.40 per cent (days to 50<br />
percent flowering) to 58.66 percent (fruit weight).<br />
Along with the variability information, genotypic and<br />
phenotypic coefficient of variations and genetic<br />
advance mean is much more essential because these<br />
are more reliable for effective selection. The<br />
phenotypic coefficient of variation (PVC) was higher<br />
than genotypic coefficient of variation (GCV) for all<br />
characters under study which suggest that these<br />
traits studied had low environmental influence. Patel<br />
et. al., 2004 and Kumar et. al, 2007 made similar<br />
observations in their study in chilli. High values of<br />
GCV and PCV were obtained for fruit length (cm),<br />
fruit weight and seeds weight, indicating that variation<br />
for these characters contributes markedly to the total<br />
variability. Heritability value indicates only the<br />
magnitude of inheritance of quantitative character<br />
while genetic advance helps in deciding the selection<br />
procedure to be adopted. However, in the present<br />
study the high heritability along with high value of<br />
genetic advance coupled with medium to high percent<br />
mean of genotypic variance for characters i.e. seed<br />
weight, fruit length (cm), fruit weight and number of<br />
seeds per fruit are of great value for selection as<br />
they are more likely to be controlled by additive gene<br />
effect.<br />
Based on D2 analysis nineteen genotypes<br />
were grouped into two clusters. Among the clusters,<br />
cluster-I was the largest with seventeen genotypes<br />
and cluster-II contain only two genotypes (Arka<br />
Suphal and Arka Lohit). The intra cluster distance in<br />
cluster I was 14.68 and cluster II was 21.83. While,<br />
the inter cluster distance between cluster-I and<br />
cluster- II is 19.89.<br />
Twenty- Five microstatillite primers were<br />
used to amplify the repeated regions in the chilli<br />
samples. Out of twenty five primes, all the primers<br />
were successfully amplified. The dendrogram was<br />
constructed by un-weighted pair-group arithmetic<br />
27
JOSHI et al<br />
mean (UPGMA). The dissimilarity martix was<br />
developed using Squared Euclidean Distance (SED,<br />
which estimated all the pair wise differences in the<br />
amplification product. In the present study<br />
dendrogram was generated for nineteen chilli<br />
genotypes based on similarity coefficient. Based on<br />
the simple matching coefficient, a similarity matrix<br />
was constructed using SSR data to assess the<br />
genetic relatedness among chilli genotypes. The<br />
genotypes were grouped into two major clusters,<br />
cluster I and cluster II containing five and fourteen<br />
genotypes respectively. Cluster I includes line IC<br />
119275, IC 397541, IC 397238 and Arka Suphal which<br />
belongs to Capsicum annum species along with line<br />
EC 362928 which belong to Capsicum chinense<br />
species. All the remaining genotypes were grouped<br />
into cluster II of which only the line EC 121489 belongs<br />
to Capsicum bacctum species and the rest were of<br />
Capsicum annum species.<br />
To sustain high production and productivity<br />
of chilli, a large number of high yielding varieties and<br />
hybrids have been developed as a result of intensive<br />
improvement programmes. In spite of these efforts,<br />
the importance of local cultivars cannot be<br />
underestimated as these are selected and<br />
domesticated over a period of time and sometimes<br />
across generations by the farmers for their adaptation<br />
to different climatic conditions, superior quality,<br />
resistance to biotic and abiotic stresses, medicinal<br />
properties and high yield, Hence, these need to be<br />
preserved and utilizied in crop improvement. It is also<br />
suggested that as the molecular markets are not<br />
affected by environment, they are reliable and rapid<br />
means to assess genetic diversity and to identify<br />
diverse genotypes among the population they have<br />
immense potential in the field o f molecular breeding<br />
for crop improvement.<br />
Table 1. LIST OF GENOTYPES USED IN PRESENT STUDY<br />
Sr.<br />
no.<br />
Botanical name<br />
Identification<br />
number<br />
Origin/<br />
source<br />
1. Capsicum chinense EC 362928 USA<br />
2. Capsicum annum EC 382049 USA<br />
3. Capsicum annum IC 119220 NAR<br />
4. Capsicum annum IC 119222 NAR<br />
5. Capsicum annum IC 119228 NAR<br />
6. Capsicum annum IC 119230 NAR<br />
7. Capsicum annum IC 119232 NAR<br />
8. Capsicum annum IC 119233 NAR<br />
9. Capsicum annum IC 119234 NAR<br />
10. Capsicum annum IC 119221 NAR<br />
11. Capsicum bacctum EC 121489 NL<br />
12. Capsicum annum IC 383136 NAR<br />
13. Capsicum annum IC 119275 NAR<br />
14. Capsicum annum IC 381108 NAR<br />
15. Capsicum annum IC 361897 NAR<br />
16. Capsicum annum IC 397541 NAR<br />
17. Capsicum annum IC 397238 NAR<br />
18. Capsicum annum Arka suphal IIHR<br />
19. Capsicum annum Arka lohit IIHR<br />
*NL: NETHERLAND<br />
*NAR: NBPGR SATELLITE CENTRE, AMRAVATI.<br />
*IIHR: INDIAN INSTITUTE OF HORTICULTRAL RESEASRCH<br />
28
ASSESSMENT OF GENETIC DIVERSITY IN Capsicum spp.<br />
Fig 1. Dendrogram of diversity of nineteen chilli genotypes revealed by SSR loci<br />
Fig 2. SSR gel profile of chilli genotypes with the primer EPMS-683 primer ladder used was 100 bp<br />
Lanes 1 to 19 indicate amplification of DNA of individual genotypes (order as given in Table 1)<br />
ACKNOWLEDGMENT<br />
We are grateful to the Department of Biotechnology (DBT-New Delhi) for providing the fellowship to<br />
the first author and special thanks to the Head of the Department of Biotechnology, UAS-GKVK, Bangalore,<br />
for providing the greenhouse main field and all other infrastructure facilities to carry out the research.<br />
29
JOSHI et al<br />
Table 2. Sequence of twenty-five SSR primer used for molecular characterization<br />
Name Forward primer Reverse primer<br />
EPMS-596 5’CTCGTGCCGTATTTCTGTCA3’ 5’AAGGGCGTGTTTGGTATGAA 3’<br />
EPMS-600 5’ATGGGTACGTGTTTGGGGTA3’ 5’ACTTTATTCCTCGTGCCGAA3’<br />
EPMS-601 5’AAATTGAGAACATCGGTGCC3’ 5’TAAAGAAAGAGCCTCGTGCC3’<br />
EPMS-603 5’GCGGTTCCCTATTTGAAGAA3’ 5’ATAGGGGGAATTGGGTTCC3’<br />
EPMS-628 5’TGCTCCTTAAGACTGGCACC3’ 5’GGGTTCGGCTCTGTTATTGA3’<br />
EPMS-629 5’GCTCGAGGGAGAGAGACTGT3’ 5’GGTCATATGTTTCCATGGGC3’<br />
EPMS-642 5’CAACTTCGCGTTATTGTCCA3’ 5’AGGGCGGACAAAGAAGATTT3’<br />
EPMS-643 5’CCAAGATCAACTCTTACGCTAT3’ 5’CCCCTCAAGAATTCCCTCCAT3’<br />
EPMS-648 5’TGTAAAATAAAATAAGGCTAAAGGCA3’ 5’CAAGAAAGTGTGCCCCAAAT3’<br />
EPMS-649 5’AAGGGTTCTCGAGGAAATGC3’ 5’TCAATCCCAAAACCATGTGA3’<br />
EPMS-650 5’CATGGGTGAGGGTACATGGT3’ 5’AGAGGGAAGGGTTATTTGCC3’<br />
EPMS-654 5’TTCCACTCTTCGAAGCACCT3’ 5’GGTAGGGTTTAACACCGCCT3’<br />
EPMS-658 5’CCTTGAGTAGGCGCACAAAT3’ 5’TTCCTCATTGCTTTTCCCAC3’<br />
EPMS-670 5’TCACAAAGATGGAGAAGGGAA3’ 5’CAATCACTGTCACTGCTACTGCT3’<br />
EPMS-683 5’AAATGGATCCCAACAACCAA3’ 5’GGAGTTGAAAACGGTGGAGA 3’<br />
EPMS-697 5’ATGTCGCTCGCAATTTCACT3’ 5’CGTAGGGAGGAGCGATAGAG3’<br />
EPMS-704 5’GGTCCTCTGATTGGCAACAT3’ 5’GACCTGAAATTGGAGCAAACA3’<br />
EPMS-705 5’TCAACTAGATCCACCACGCA3’ 5’TAACCCGTTGCTCACACTCA3’<br />
EPMS-725 5’TTGAATCGTTGAAGCCCATT3’ 5’ATCTGAAGCTGGGCTCCTTT3’<br />
EPMS-745 5’GTTGTTGGGTGGTACTTGGG3’ 5’GGAAGATCTCAAATGGGTCG3’<br />
EPMS-747 5’CATTGGACGGTTGGTTCTCT3’ 5’TGGAATTGGAACTTCAAGCA3’<br />
EPMS-755 5’CGCTCGCTACCCTTTCATTA3’ 5’AATTTCGGAAGGGCAAAGAT3’<br />
EPMS-762 5’CGGCGAGATATGGACTTGAT3’ 5’CCCACGTTATACCATCCAGG3’<br />
30
ASSESSMENT OF GENETIC DIVERSITY IN Capsicum spp.<br />
Table 3. Range, genotypic variability (GV), phenotypic variability (PV), genotypic coefficient of variation(GCV), phenotypic coefficient of variation(PCV),<br />
heritability (h 2 ) and genetic advance (GA) for growth and yield quality parameters in nineteen genotypes of Capsicum<br />
31
JOSHI et al<br />
Table .4 Mean performance of chilli genotypes for different characters<br />
REFERENCES<br />
Kumar, L.R., Sridevi, O and Salimath, P.M. 2007. Combining ability studies in<br />
chilli. Journal of Asian Horticulture. 3(3):141-147.<br />
Patel, J.A., Pate, M.J., Acharya. R.R., Bhanvadia, A.S and Bhalala, M.K.<br />
2004. Hybrid vigour, gene action and combining ability in chilli ( Capsicum<br />
annum L.) Hybrids involving male sterile lines. Indian Journal of<br />
Genetics. 64(1):81-82.<br />
Pickersgill, B 1997. Genetic resources and breeding of Capsicum spp.<br />
Euphytica 96: 1239-133.<br />
Singh, A.K., Singh, M., Singh, R., Kumar, S and Kalloo, G.K. 2007. Genetic<br />
diversity within the genus solanum (Solanaceae) as revealed by<br />
RAPD markers. Current Science. 90(5): 121-128.<br />
32
J.Res. ANGRAU 41(2) 33-41, 2013<br />
ESTIMATION OF HETEROSIS FOR YIELD AND ITS ATTRIBUTING CHARACTERS<br />
AND STUDY OF INTRA-SPIKELET COMPETITION FOR SEED SIZE IN FINGER<br />
MILLET Eleusine coracana L.<br />
PARASHURAM PATROTI and JAYARAME GOWDA<br />
All India Coordinated Small Millets Improvement Project (AICSMIP),<br />
ICAR, University of Agricultural Sciences, GKVK, Bangalore-560 065.<br />
Date of Receipt : 18.01.2013 Date of Acceptance : 08.03.2013<br />
ABSTRACT<br />
An investigation was carried out at Zonal Agricultural Research Station, University of Agricultural Sciences,<br />
Gandhi Krishi Vignana Kendra, Bengaluru during 2009-10 to estimate the extent of heterosis in hybrids and to<br />
explore intra-spikelet competition for seed size in finger millet in two separate experiments. Heterosis for yield and<br />
yield attributing characters were studied for the hybrids synthesized through Line x Tester mating design using four<br />
lines and four testers. Among 16 hybrids developed, percent heterosis over mid parent and better parent was<br />
negatively significant in most of the hybrids, suggesting the involvement of dominant gene action with negative<br />
effects. The hybrid GE 4596 x L 5 and GE 4596 x GPU 69 had significant and superior per se performance for grain<br />
yield per plant, straw yield per plant, finger length, peduncle length, number of fingers per ear, culm thickness and<br />
number of productive tillers per plant. The five hybrids viz., GE 4596 x L 5, GE 4596 x GE 5095, GPU 28 x L 5, GPU<br />
28 x GE 5095 and GE 4906 x GE 5095 showed significant heterosis for most of the traits over their parents. Three<br />
promising varieties viz., HR 911, PR 202 and GPU 28 were included to know the intra-spikelet competition for seed<br />
size. The results indicated that there was no significant difference in 1000 grain weight, collected from different<br />
position of florets within a spikelet at different positions of spike, suggesting that there was no intra spikelet competition<br />
for seed size under normal environmental conditions and the varieties need to be tested under moisture stress<br />
environment.<br />
Finger millet Eleusine coracana L. Geartn.<br />
ranks first both in area and production among the<br />
‘Nutricereals’ occupying 2.00 m.ha in India with the<br />
highest productivity in the state of Karnataka<br />
(AICSMIP, 2005). Its nature of low input requirement<br />
in terms of labour, technology, costs and high drought<br />
resistance and long storage life makes it a pro-poor<br />
and marginal farmers’ crop. The seeds can be stored<br />
safely for as long as 50 years without pest infestation,<br />
which makes it a traditional component of farmers’<br />
risk mitigation strategies in drought prone regions<br />
(AICSMIP, 2007). It is highly valued as a reserve<br />
food in times of famine. Despite all these merits, this<br />
crop has been neglected from the main stream of<br />
crop improvement programme.<br />
Finger millet being a food crop, yield<br />
improvement is the major goal. Information on<br />
different traits of interest, especially their genetic<br />
control is a prerequisite for planning the genetic<br />
improvement strategies. Finger millet is a highly self<br />
pollinated crop and hybridization in this crop is<br />
restricted due to the small flower size which makes<br />
emasculation a difficult task. In recent years, in spite<br />
of persistent efforts, the newly evolved varieties are<br />
not showing much yield advantage over the varieties<br />
bred and released in earlier years. The efforts made<br />
by Ravikumar et al. (1986) and Gurunathan (2006) in<br />
finger millet, Srivatsav and Yadav (1977) in little millet,<br />
Konstantinov and Linnik (1985), Kolyagin and<br />
Garbatenko (1986) and Ramesh (1990) in proso millet<br />
opens the way and scope for the exploitation of hybrid<br />
vigour in minor millets. Keeping this in view in the<br />
present investigation an effort was made to estimate<br />
the heterosis in finger millet hybrids.<br />
In any crop improvement programme,<br />
breeding for uniform seed size is one of the objectives<br />
and grains of uniform seed size will be preferred while<br />
marketing. But many studies indicated that there is<br />
a variation in seed size in most of the crops while<br />
harvesting. Whether this is true for finger millet also,<br />
is the question. So, in this regard an effort was also<br />
made to know, whether there is any competition<br />
between two florets for photosynthates during<br />
physiological maturity which leads to variation in seed<br />
size or the variation is due to environmental factors.<br />
email: parashu.patroti@rediffmail.com<br />
33
PARASHURAM and JAYARAME<br />
MATERIALS AND METHODS<br />
Heterosis for yield and its attributing traits<br />
Four lines were crossed to four testers in a<br />
line x tester mating design (Kempthorne, 1957) in<br />
kharif-2009, to generate hybrids by following hot water<br />
treatment (Rao and Rao, 1962) for emasculation then<br />
contact method for crossing (Ayyangar and Warrior,<br />
1934). Crossed seeds along with their parents were<br />
sown in nursery during rabi-2009. The hybrids were<br />
first identified in the nursery using purple plant<br />
pigmentation as marker. All the eight parents (4 lines<br />
and 4 testers) together with 16 crosses were evaluated<br />
during rabi-2009. The material was grown in a single<br />
row of 3 m length with a spacing of 30 x 10 cm in a<br />
randomized block design and replicated twice. The<br />
data were recorded on plant height, number of fingers<br />
per ear, number of productive tillers per plant, finger<br />
length, finger width, culm width, peduncle length,<br />
days to 50 per cent flowering, days to maturity, straw<br />
yield per plant, grain yield per plant and test weight<br />
on five randomly selected plants. The analysis of<br />
Randomised Block Design was carried out based on<br />
the methods described by Panse and Sukhatme<br />
(1967) and significance of heterosis was tested using<br />
simple‘t’ test at five per cent and one per cent level<br />
of significance. The magnitude of heterosis was<br />
estimated over mid parent and better parent (Singh<br />
and Chaudhary, 1985).<br />
Intra Spikelet Competition for Seed Size<br />
The material for this study comprised of<br />
mature spike/fingers of three varieties viz., HR 911,<br />
PR 2O2 and GPU 28. These varieties were grown<br />
both in field and pots in green house. Each spike<br />
was divided into three portions. The florets from 1/3 rd<br />
position of top, 1/3 rd of middle and 1/3 rd of bottom<br />
position of spike of each variety were taken<br />
separately. Approximately 100 spikelets from each<br />
portion were selected in all three varieties. In each<br />
finger there are about 70 spikelets, each spikelet<br />
having five to seven complete flowers. However, the<br />
experimental varieties having six florets from each<br />
spikelet from top to bottom of the spike. The positions<br />
of florets in each spikelet were numbered (only six<br />
florets hence numbered from one to six) and the<br />
seeds of particular position were taken out which were<br />
numbered from one to six to a particular bowl which<br />
were also numbered as one to six. Thousand grain<br />
weights of separately collected floret wise seeds of<br />
three different positions was weighed and compared.<br />
Analysis of variance for three factorial Completely<br />
Randomized Design for floret wise seed weight of<br />
three portions of three different varieties was<br />
constructed. The varieties were considered as main<br />
factors. Sub factors were portions (3), because each<br />
variety has been divided into three portions and subsub<br />
factors were 6, because each spikelet consists<br />
of six florets, for which competition between florets<br />
was studied.<br />
RESULTS AND DISCUSSION<br />
Heterosis for yield and related traits<br />
The analysis of variance revealed significant<br />
differences among the parents as well as crosses<br />
for all the traits. Higher level of significance in the<br />
variance of parents vs hybrids for all the characters<br />
clearly indicated the existence of significant level of<br />
average heterosis in the hybrids (Table 2). Non<br />
additive gene action was noticed for all the characters<br />
studied. The results support the findings of<br />
Tamilcovane (1994), Madhusudhan et al. (1995) and<br />
Patel (1994).<br />
Among 16 hybrids developed, per cent<br />
heterosis over mid parent and better parent was<br />
negatively significant in most of the hybrids except<br />
in crosses, GE 6216 x GPU 69 and GE 6216 x GE<br />
5095 for days to 50 per cent flowering and except<br />
GE 6216 x GPU 69 and GE 4906 x GE 5095 for days<br />
to maturity suggesting the involvement of dominant<br />
gene action with negative effects (Table 3). The earlier<br />
reports suggest that early types can be obtained from<br />
crosses which record negative heterosis. Similar<br />
results were obtained by Konstantinov and Linnik<br />
(1985) and Ramesh (1990) in proso millet. Significant<br />
level of heterosis over mid parent and better parent<br />
have been observed for the characters like plant<br />
height, number of productive tillers per plant, straw<br />
yield per plant and grain yield per plant.<br />
From this study, it can be concluded that<br />
the non additive gene action favouring hybridization<br />
to some extent and the crosses, GE 4596 x L 5 and<br />
GE 4596 x GPU 69 are the best crosses for grain<br />
yield and most of the yield contributing characters.<br />
34
ESTIMATION OF HETEROSIS FOR YIELD AND ITS ATTRIBUTING CHARACTERS<br />
Table 1. Mean performance of F 1<br />
’s and their parents for different agronomic traits<br />
35
PARASHURAM and JAYARAME<br />
Table 1. ( contd….)<br />
PH : Plant height (cm) PL : Peduncle length (cm) NFE : Number of fingers/ear<br />
DFL : Days to 50% flowering NPT : Number of tillers/plant DMT : Days to maturity<br />
FL : Finger length (cm) SY : Straw yield (g) FW : Finger width (cm)<br />
GY : Grain yield/ plant (g) CW : Culm width (cm) TW : Test weight/plant (g)<br />
36
ESTIMATION OF HETEROSIS FOR YIELD AND ITS ATTRIBUTING CHARACTERS<br />
Table 2. Analysis of variance for line x tester design with respect to yield and yield attributes in finger millet<br />
* and ** : Significant at 5 and 1 per cent level, respectively<br />
Where,<br />
PLH : Plant height (cm) PL : Peduncle length (cm) NFE : Number of fingers/ear<br />
DFL : Days to 50% flowering NPT : Number of tillers/plant DMT : Days to maturity<br />
FL : Finger length (cm) SY : Straw yield (g) FW : Finger width (cm)<br />
GY : Grain yield/ plant (g) CW : Culm width (cm) TW : Test weight/plant (g)<br />
37
PARASHURAM and JAYARAME<br />
Table 3. Percent heterosis over mid parent (MP) and better parent (BP) for yield and yield attributes in finger millet<br />
38
ESTIMATION OF HETEROSIS FOR YIELD AND ITS ATTRIBUTING CHARACTERS<br />
Table 3 . (Contd….)<br />
Where,<br />
PH : Plant height (cm) PL : Peduncle length (cm) NFE : Number of fingers/ear<br />
DFL : Days to 50% flowering NPT : Number of tillers/plant DMT : Days to maturity<br />
FL : Finger length (cm) SY : Straw yield (g) FW : Finger width (cm)<br />
39
PARASHURAM and JAYARAME<br />
Table 4. 1000 seed weight (g) from different positions of florets within the spikelet at different positions<br />
of spike in three varieties of finger millet.<br />
Genotypes<br />
HR 911<br />
PR-202<br />
GPU-28<br />
Position of<br />
spike Floret-1 Floret-2 Floret-3 Floret-4 Floret-5 Floret-6<br />
Top 3.63 3.62 3.64 3.71 3.78 3.68<br />
Middle 3.71 3.76 3.76 3.81 3.68 3.70<br />
Bottom 3.81 3.65 3.66 3.59 3.80 3.69<br />
Top 3.75 3.78 3.68 3.73 3.64 3.68<br />
Middle 3.78 3.64 3.62 3.67 3.59 3.80<br />
Bottom 3.67 3.73 3.74 3.78 3.74 3.78<br />
Top 3.72 3.76 3.71 3.75 3.78 3.67<br />
Middle 3.56 3.67 3.70 3.74 3.76 3.72<br />
Bottom 3.78 3.68 3.86 3.82 3.68 3.80<br />
Table 5. Analysis of variance for three factorial completely randomized block design for intra spikelet<br />
competition for seed size in finger millet.<br />
Source of variation<br />
Degrees of<br />
freedom<br />
Sum of<br />
squares<br />
Mean sum of<br />
squares<br />
F ratio<br />
Varieties 2 0.0135 0.0068 4.1263**<br />
Portions 2 0.0781 0.0391 2.4938<br />
Florets 5 0.2124 0.0425 7.0620<br />
Variety v/s Portion 4 0.3784 0.0946 15.7272<br />
Variety v/s Florets 10 0.2825 0.0282 4.6958<br />
Portion v/s florests 10 0.1683 0.0168 2.7984<br />
Variety v/s Portion v/s<br />
Florets<br />
20 0.5670 0.0284 4.7131<br />
Error 54 0.3248 0.0060<br />
Total 107 2.0251 0.0189<br />
* and ** : Significant at 5 and 1 per cent level, respectively<br />
Intra Spikelet Competition for Seed Size<br />
Three varieties viz., HR 911, PR 202 and<br />
GPU 28 were studied for intra spikelet competition<br />
for seed size. The seeds from six florets of three<br />
different positions of spikelet were kept separately<br />
in 6 different bowls. Thousand grain weights of<br />
separately collected floret wise seeds of three<br />
different portions weighed (Table 4) and analysis of<br />
variance found non significant for seed weight<br />
between the florets of all the three varieties studied<br />
(Table 5). The results which indicated that there was<br />
40
ESTIMATION OF HETEROSIS FOR YIELD AND ITS ATTRIBUTING CHARACTERS<br />
no intra spikelet competition for seed size in all the<br />
three varieties viz., HR 911, PR 202 and GPU 28, for<br />
translocation of photosynthates under normal<br />
conditions.<br />
From the study it is evident that there is no<br />
difference in translocation of photosynthates from first<br />
seed set to last seed set in three finger millet varieties<br />
under normal conditions. This confirms unlike in other<br />
crops, finger millet shows synchronous blooming and<br />
uniform seed setting where distribution of<br />
photosynthates is uniform from source to sink. If<br />
there is any variation found in seed size that may be<br />
attributed due to environment and these varieties need<br />
to be evaluated under moisture stress environments.<br />
REFERENCES<br />
AICSMIP, 2005. Annual Report of All India<br />
Coordinated Small Millets Improvement Project,<br />
ICAR, Bangalore. pp.24-35.<br />
AICSMIP, 2007. Annual Report of All India<br />
Coordinated Small Millets Improvement Project,<br />
ICAR, Bangalore. pp.32-39.<br />
Ayyangar, G. N. R and Wariar, U. A. 1934. Anthesis<br />
and pollination in ragi, Eleusine coracana Gaertn.,<br />
the finger millet; Indian Journal of Agricultural<br />
Sciences. 4: 386- 393.<br />
Gurunathan. 2006. Line x tester analysis in forage<br />
sorghum, Introduction to sorghum and millets,<br />
Millets News letter 35: 79-80.<br />
Kempthorne, O. 1957. An introduction to genetic<br />
statistics. John Wiley and Sons, New York,<br />
USA. pp. 245-285.<br />
Kolyagin, Y. S and Gorbatenko, T.A. 1986.<br />
Inheritance of useful breeding characters in proso<br />
millet, Ref. Zhu., 8: 65-248.<br />
Konstantinov, S.I and Linnik, V.M. 1985. Utilizing<br />
heterosis in proso millet breeding, Selekt, i.<br />
Semen. USSR., 2: 15-17.<br />
Madhusudan, K., Ramesh, S., Rao, A.M., Kulkarni,<br />
R.S and Savithramma, D.L. 1995.<br />
Combining ability in cowpea. Crop Management,<br />
22(2): 241-243.<br />
Patel, R.N., Godhani, P.R. and Fougat, R.S 1994.<br />
Combining ability in cowpea (Vigina unguiculata<br />
(L) Walp). Gujarat Agril. Univ. Res. J., 20(1): 70-<br />
74.<br />
Rama Rao, V and Rama Rao, K. V. 1962.<br />
Emasculation of ragi flowers (Eluesine.<br />
coracana) by hot water treatment for<br />
hybridization work. The Andhra Agricultural<br />
Journal. 9: 290-292.<br />
Ramesh, S. 1990. Studies on heterosis and genetics<br />
of qualitative characters in proso millet (Panicum<br />
milliaceum L.). M.Sc. (Agri) Thesis submitted<br />
to University of Agricultural Sciences, Bangalore,<br />
India.<br />
Ravikumar, R.L., Shankare Gowda, B.T and<br />
Seetharam, A. 1986. Studies on heterosis in<br />
finger millet. Millets Newsletter, 5: 26-27.<br />
Singh, R.K and Chaudhary, B. D. 1985. Biometrical<br />
methods in quantitative genetic analysis. 1 st Ed.<br />
Kalyani publishers, Ludhiana. pp.58-64.<br />
Srivastava, D.P and Yadav, A. 1977. Heterosis in<br />
Panicum miliare lam. Curr. Res., 6(4): 66-67.<br />
Tamilcovane, S and Jayaraman, N. 1994. Association<br />
between yield components in ragi. J.<br />
Phytological Research, 7(2):193-194.<br />
Panse, V.G and Sukhatme. 1967. Statistical methods<br />
for agricultural workers, ICAR, New Delhi, pp.<br />
140- 145.<br />
41
J.Res. ANGRAU 41(2) 42-45, 2013<br />
INTEGRATED EFFECT OF ORGANIC MANURES AND INORGANIC<br />
FERTILIZERS ON SOIL UREASE ACTIVITY AND YIELD OF<br />
MAIZE-SPINACH CROPPING SYSTEM<br />
I. USHA RANI. G. PADMAJA AND P. CHANDRASEKHAR RAO<br />
Department of Soil Science and Agricultural Chemistry<br />
Acharya N.G. Ranga Agricultural University, Rajendranagar, Hyderabad- 500 030<br />
Date of Receipt : 26.11.2012 Date of Acceptance : 20.02.2013<br />
ABSTRACT<br />
A field experiment was conducted on a red sandy loam soil during rabi and summer seasons of 2009-2010<br />
with a view to study the effect of organic manures, inorganic fertilizers and their integration on soil urease activity and<br />
yield of maize (rabi) - spinach (summer)cropping system. Among the different treatments application of 75% RDF +<br />
25% through vermicompost (VC) recorded significantly highest grain and stover yield (52.4, 60.8 q ha -1 ) at harvest<br />
but, on par with 75% RDF + 25% through poultry manure and 75% RDF + 25% through FYM. The spinach crop<br />
responded favourably to the residual and cumulative treatments and the highest fresh leaf yield (14.7 and 12.4 t ha -<br />
1<br />
) was recorded in cumulative and residual treatments. The soil urease enzyme activity at different growth stages of<br />
maize and at final harvest of spinach revealed that there was increase in enzyme activities upto active growth stages<br />
of crops and later showed a decrease. Significantly highest urease activity was found in T 4<br />
(100% VC) with a value<br />
of 246.7, 308.2 and 138.7 ìg of NH 4+<br />
-N released g -1 soil h -1 at vegetative, tasseling and at harvesting stage of maize,<br />
which was on par with T 8<br />
, T 11<br />
,T 12<br />
, T 2<br />
, T 6<br />
and T 10<br />
and was significantly different from other treatments in maize crop. The<br />
cumulative and residual effects of spinach revealed that the urease activity was higher in cumulative than residual<br />
treatments.<br />
INTRODUCTION<br />
Increased use of chemical fertilizers in an<br />
unbalanced manner has created problem of multiple<br />
nutrient deficiencies, diminishing soil fertility and<br />
sustainable crop yields. Hence integration of organic<br />
manures and inorganic fertilizers is imperative for<br />
improving soil health in cropping systems.<br />
The enzyme urease (urea amidohydrolase)<br />
is an important extracellular enzyme which influences<br />
the availability of plant utilizable forms of nitrogen in<br />
soils. Urease is a unique enzyme because it catalyses<br />
the hydrolysis of urea to ammonia (NH 3<br />
) which is<br />
subsequently transformed to ammonium (NH 4+<br />
) and<br />
nitrate (NO 3-<br />
) ions. Nitrogen fertilizer use efficiency<br />
is influenced by the activity of this enzyme, the<br />
determination of urease activity in soils provides a<br />
good index about the ability of soils to hydrolyze urea.<br />
In general, the urease activity increases with increase<br />
in organic carbon in soils.<br />
Keeping in view the significance of integrated<br />
nutrient management for better nitrogen management,<br />
an experiment was conducted to study the effect of<br />
organics, inorganics and their integration on urease<br />
enzyme activity at different growth stages of maize<br />
and at final harvest of spinach in maize-spinach<br />
cropping system.<br />
MATERIALS AND METHODS<br />
A field experiment was conducted on a red<br />
sandy loam soil at College Farm, College of<br />
Agriculture, Rajendranagar, Hyderabad during rabi<br />
and summer seasons of 2009-2010, with maize and<br />
spinach, respectively. Field experiment was laid out<br />
in randomized block design with 12 treatments,<br />
replicated thrice. The treatments include, T 1<br />
(Control),<br />
T 2<br />
(50% RDNF through inorganic fertilizer + 50%<br />
RDNF through vermicompost), T 3<br />
(75% RDNF<br />
through inorganic fertilizer + 25% RDNF through<br />
vermicompost), T 4<br />
(100% RDNF through<br />
vermicompost), T 5<br />
(100% RDNF through inorganic<br />
fertilizer), T 6<br />
(50% RDNF through inorganic fertilizer<br />
+ 50% RDNF through poultry manure), T 7<br />
(75% RDNF<br />
through inorganic fertilizer + 25% RDNF through<br />
poultry manure), T 8<br />
(100% RDNF through poultry<br />
manure), T 9<br />
(50% RDNF through inorganic fertilizer<br />
+ 50% RDNF through farm yard manure), T 10<br />
(75%<br />
RDNF through inorganic fertilizer + 25% RDNF<br />
through farm yard manure), T 11<br />
(100% RDNF through<br />
farm yard manure), and T 12<br />
(25% RDNF through<br />
inorganic fertilizer + 25% RDNF through<br />
email: usha.soilscience@gmail.com<br />
42
INTEGRATED EFFECT OF ORGANIC MANURES AND INORGANIC FERTILIZERS ON SOIL UREASE<br />
vermicompost + 25% RDNF through poultry manure<br />
+ 25% RDNF through farm yard manure). Maize was<br />
the test crop during rabi season with RDF applied as<br />
N: P 2<br />
O 5<br />
: K 2<br />
O @120:60:60 kg ha -1 . All the manures<br />
and fertilizers were applied as per the treatments. In<br />
summer season, spinach was taken up as a test<br />
crop and 75 percent of recommended dose of N, P<br />
and K were applied in half of the plot pertaining to<br />
each treatment. No fertilizers were applied to another<br />
half of the plot to know the residual effects. Entire<br />
quantity of phosphorus, half of nitrogen and potassium<br />
were applied as basal in the form of single super<br />
phosphate, urea and muriate of potash. Remaining<br />
half of nitrogen and potassium were applied in two<br />
equal splits at 15 and 30 DAS.<br />
Soil of the experimental field is a sandy loam,<br />
slightly alkaline in reaction (pH: 7.21, non saline (EC<br />
: 0.19 dS m -1 ), medium in organic carbon (0.46%)<br />
and available nitrogen (217.8 kg ha -1 ), medium in<br />
available P 2<br />
O 5<br />
(28.7 kg ha -1 ) and K 2<br />
O (285.6 kg ha -1 ).<br />
Apart from the initial soil analysis, the organic<br />
manures used for the study viz., FYM, poultry manure<br />
and vermicompost were also analyzed for their<br />
nutrient contents. Among all the organic manures,<br />
poultry manure found to have highest nitrogen<br />
(1.84%), phosphorus (0.82%) and potassium (1.12%)<br />
followed by vermicompost (1.18, 1.07 and 0.85%)<br />
and FYM (0.50, 0.75 and 0.75%). Urease activity<br />
was assayed by measuring the rate of release of<br />
NH 4<br />
+<br />
from the hydrolysis of urea as described by<br />
Tabatabai and Bremner (1972) with some<br />
modifications as suggested by Dorich and Nelson<br />
(1983).<br />
RESULTS AND DISCUSSION<br />
Grain and Stover yield of maize<br />
The grain and stover yield of maize was<br />
significantly influenced by different levels of organic<br />
manures and inorganic fertilizers (Table 1). The lowest<br />
and highest grain and stover yields were recorded in<br />
control and 75% RDNF + 25% VC, respectively.<br />
However, the yield recorded at 75% RDNF + 25%<br />
VC was on par with that recorded at 75% RDNF +<br />
25% PM, 75% RDNF + 25% FYM and 100% RDNF<br />
and significantly superior over all other treatments.<br />
The percent increase in yield of 75% RDNF + 25%<br />
VC over the control, 100% RDNF, 100% VC, 100%<br />
PM and 100% PM was 143.4, 6.33, 18.9, 20.5, and<br />
22.0, respectively. Conjunctive use of different levels<br />
of chemical fertilizers with any one of the organics<br />
produced higher yields compared to their individual<br />
applications. This was due to the direct availability<br />
of nutrients from inorganic fertilizers and also the<br />
vermicompost containing higher available N, P and<br />
K contents. The enrichment of biological activity and<br />
release of organic acids might have degraded and<br />
mobilized the occluded soil nutrients to available from<br />
Reddy and Reddy (1998). Thus, favourable effect of<br />
poultry manure and vermicompost in the root zone<br />
resulted in increased availability and uptake of<br />
nutrients by the plants which in turn was reflected<br />
through increase in maize grain and stover yield.<br />
Fresh green leaf yield of spinach<br />
The spinach crop responded favourably to<br />
the residual and cumulative treatments after harvest<br />
of maize crop and the highest leaf yield (t ha -1 ) were<br />
recorded in cumulative treatments than their<br />
respective residual treatments (Table 1).<br />
Among the cumulative and residual effects,<br />
the green leaf yield of spinach ranged from 6.71 to<br />
14.68 t ha -1 and 4.89 to 12.37 t ha -1 , respectively. In<br />
both cumulative and residual effects, the treatments<br />
received 100% organic manures (VC/PM/FYM) during<br />
preceding maize crop showed higher leaf yields of<br />
spinach than those with combined application of<br />
organic manures and inorganic fertilizers.<br />
Among the cumulative treatments, the<br />
lowest and highest green leaf yield were observed<br />
with T 1<br />
and T 4<br />
, respectively. The treatment which<br />
received, 100% VC during previous rabi (T 4<br />
) and 75%<br />
RDF to spinach recorded highest fresh leaf yield but<br />
was on par with T 8<br />
and T 11<br />
.<br />
Among the residual effects, the green leaf<br />
yield of spinach varied from 4.89 to 12.37 t ha -1 . The<br />
lowest green leaf yield was recorded in control where<br />
no fertilizers were applied. Though application of<br />
100% VC to rabi maize (T 4<br />
) resulted in highest green<br />
leaf yield of 12.37 t ha -1 , it was on par with 100% PM<br />
(T 8<br />
) and 100% FYM (T 11<br />
). But it was significantly<br />
superior to all the other combined treatments.<br />
The results clearly indicated that application<br />
of 75% RDF to spinach apart from the application of<br />
inorganic and organic manures to maize crop was<br />
sufficient as it ensured ample supply of nutrients and<br />
favoured better growth. The additional fresh green<br />
leaf yield under cumulative effects might be because<br />
of an adequate and balanced supply of nutrients with<br />
43
USHA et al<br />
75% RDF application. It had favourable effect on leaf<br />
and root growth resulting in improvement in the yield<br />
attributes. Thus, the results revealed that though<br />
spinach yield can be obtained without applying<br />
fertilizers (residual treatments), there is a scope for<br />
increasing its production potential by applying 75%<br />
RDF and saving 25% inorganic fertilizers. Similar<br />
observations were made by Reddy, 2007.<br />
Urease enzyme activity<br />
The urease enzyme activity was assayed<br />
at different growth stages of maize and at final<br />
harvest of spinach showed that urease enzyme<br />
activity increased upto tasseling stage in maize and<br />
later showed a decrease. The studies on soil enzyme<br />
activities revealed that the microbial activity is<br />
maximum upto active growth stage of the maize crop.<br />
The sharp increase in the enzyme activities at<br />
tasseling which coincides with the active growth stage<br />
of the crop, enhanced root activity and the release of<br />
extracellular enzymes like urease into soil solutions<br />
during the active growth phase which resulted in<br />
higher rate of mineralization of nutrients in the soil.<br />
The results were in conformity with the findings of<br />
Srirama Chandrasekharan et al., (1997) and Reddy<br />
and Reddy (2008).<br />
Significantly highest urease activity was<br />
found in T 4<br />
(100% VC) at vegetative, tasseling and<br />
at harvesting stage of maize, which was on par with<br />
T 8<br />
, T 11<br />
,T 12<br />
, T 2<br />
, T 6<br />
and T 10<br />
and was significantly different<br />
from other treatments. The lowest urease activity<br />
recorded in control (Table.2).The increase in urease<br />
activity with integrated application of organic manures<br />
and inorganic fertilizers may be attributed to the<br />
increasing population of microorganisms like bacteria<br />
etc., due to increased availability of substrate through<br />
organic manures. Similar findings were reported by<br />
Singaram and Kamala Kumari (2000) and Reddy<br />
(2011).<br />
The cumulative and residual treatments on<br />
spinach revealed that irrespective of the treatments<br />
cumulative showed higher urease activities than with<br />
their corresponding residual treatments (Table 2). This<br />
may be due to luxuriant root proliferation and large<br />
amount of leaf fall leading to nutrient rich<br />
environment, which was more conducive for<br />
proliferation of the microflora for enhanced enzyme<br />
synthesis. Among cumulative and residual<br />
treatments, the treatments which received 100%<br />
organic manures (VC, PM and FYM) to the preceding<br />
maize crop has recorded significantly highest urease<br />
activity at final harvest of spinach.<br />
Table 1. Effect of INM on grain and stover yield of maize and fresh leaf yield of spinach in maizespinach<br />
cropping system<br />
Treatment Yield (q ha - 1 ) Fresh leaf yield (t ha -1 )<br />
Grain Stover Cumulative Residual<br />
T 1 Control 21.5 29.9 6.7 4.8<br />
T 2 50% RDNF + 50% VC 48.1 55.4 12.8 10.7<br />
T 3 75% RDNF + 25% VC 52.3 60.7 9.8 8.5<br />
T 4 100% VC 44.0 48.1 14.6 12.3<br />
T 5 100% RDNF 49.2 57.2 8.8 7.2<br />
T 6 50% RDNF + 50% PM 47.3 53.4 12.2 10.3<br />
T 7 75% RDNF + 25% PM 51.2 59.5 9.7 8.4<br />
T 8 100% PM 43.4 47.4 14.5 12.1<br />
T 9 50% RDNF + 50% FYM 46.8 53.0 12.7 10.4<br />
T 10 75% RDNF + 25% FYM 50.4 58.4 9.4 8.2<br />
T 11 100% FYM 42.9 46.8 14.3 12.0<br />
T 12 25% RDNF + 25% VC + 25% PM +25%<br />
FYM 44.6 50.1 13.3 11.6<br />
SE(m) ± 1.7 1.9 0.6 0.5<br />
CD at 5% 3.5 3.9 1.2 1.1<br />
VC: Vermicompost; PM: Poultry manure; FYM: Farm yard manure; RDNF: Recommended dose of<br />
nitrogen fertilizer<br />
44
INTEGRATED EFFECT OF ORGANIC MANURES AND INORGANIC FERTILIZERS ON SOIL UREASE<br />
Table 2. Effect of INM on urease activity (µg NH 4+<br />
-N released g -1 soil h -1 ) at different growth stages of<br />
maize and at final cutting of spinach in maize-spinach cropping system<br />
Treatment Maize Spinach<br />
Vegetative<br />
stage<br />
Tasseling<br />
stage<br />
Harvest Cumulative Residual<br />
T 1 Control 17.87 20.34 9.45 10.05 7.32<br />
T 2 50% RDNF + 50% VC 23.47 27.68 13.25 15.72 11.54<br />
T 3 75% RDNF + 25% VC 21.25 25.55 11.85 13.54 9.87<br />
T 4 100% VC 26.76 30.82 14.97 17.66 12.76<br />
T 5 100% RDNF 19.24 22.65 10.54 12.49 8.95<br />
T 6 50% RDNF + 50% PM 23.02 27.54 13.09 15.20 11.29<br />
T 7 75% RDNF + 25% PM 21.03 25.29 11.67 13.35 9.76<br />
T 8 100% PM 26.32 30.24 14.80 17.26 12.54<br />
T 9 50% RDNF + 50% FYM 22.84 27.05 12.92 14.75 10.98<br />
T 10 75% RDNF + 25% FYM 20.75 24.91 11.28 13.58 9.82<br />
T 11 100% FYM 25.89 29.87 14.24 16.98 12.34<br />
T 12 25% RDNF + 25% VC +<br />
25% PM +25% FYM<br />
24.62 28.72 13.95 16.32 11.85<br />
SE(m) ± 2.30 2.51 1.39 0.37 0.33<br />
CD at 5% 4.77 5.20 2.88 0.77 0.69<br />
REFERENCES<br />
Dorich, R.A and Nelson, D.W. 1983. Direct<br />
colorimetric measurement of ammonium in<br />
potassium chloride extracts of soils. Soil<br />
Science Society of American Journal. 47 (4):<br />
833-836.<br />
Reddy, B.G and Reddy, M.S. 1998. Effect of organic<br />
manures and nitrogen levels on soil available<br />
nutrient status in maize-soybean cropping<br />
system. Journal of Indian Society of Soil<br />
Science. 46(3): 474-476.<br />
Reddy, K.P.C. 2007. Effect of integrated use of<br />
inorganic and organic sources of nutrients in<br />
maize-groundnut cropping system of Alfisols.<br />
Ph.D thesis submitted to Acharya N G Ranga<br />
Agricutural University, Hyderabad.<br />
Reddy, R.U and Reddy, M.S. 2008. Urease activity<br />
in soil as influenced by integrated nutrient<br />
management in tomato-onion cropping system.<br />
Asian Journal of Soil Science 3 (1): 30-32.<br />
Reddy, T.P., Padmaja, G and Rao, P.C. 2011.<br />
Integrated effect of vermicompost and nitrogen<br />
fertilizers on soil urease activity and yield of<br />
onion-radish cropping system. Indian Journal of<br />
Agricultural Research. 45(2):146-150.<br />
Singaram, P and Kamala Kumari, K. 2000. Effect of<br />
continuous application of different levels of<br />
fertilizers with FYM on enzyme dynamics in soil.<br />
The Madras Agricultural Journal. 87(4- 6): 364-<br />
365.<br />
Sriramachandrasekharan, M.V., Ramanathan, G and<br />
Ravichandran, M. 1997. Effect of different<br />
organic manures on enzyme activities in flooded<br />
rice soil. Oryza. 34: 39-42.<br />
Tabatabai, M.A and Bremner, J. M. 1972. Assay of<br />
urease activity in soils. Soil Biology and<br />
Biochemistry 4: 479-489.<br />
45
J.Res. ANGRAU 41(2) 46-51, 2013<br />
SCREENING OF LOCAL RHIZOBIAL ISOLATES FOR PLANT GROWTH<br />
PROMOTION AND BIOCONTROL PROPERTIES AGAINST SOIL BORNE<br />
FUNGAL PATHOGENS<br />
BH. SARVANI, R. SUBHASH REDDY, S. SUMATHI and P. NARAYAN REDDY<br />
Department of Agricultural Microbiology and Bioenergy<br />
College of Agriculture, Rajendranagar, Hyderabad- 500 030<br />
Date of Receipt : 23.11.2012 Date of Acceptance :06.02.2013<br />
ABSTRACT<br />
Ten bacterial isolates were obtained from fifteen rhizosphere soils of Groundnut and Redgram crops in the<br />
Rangareddy district. These isolates were identified as Rhizobium, based on their cultural, morphological and<br />
biochemical characteristics and were further evaluated for Plant growth promoting attributes like phosphate<br />
solubilization, production of Indole Acetic Acid (IAA), Hydrogen Cyanide (HCN) and siderophore. All the isolates<br />
showed positive results for IAA and HCN production, while 70% of the isolates produced siderophores. Further,<br />
these isolates were subjected to in vitro antagonism against three common soil borne fungal pathogens viz.,<br />
Rhizoctonia solani, Sclerotium rolfsii and Fusarium solani. Due to the production of HCN and siderophore, these<br />
isolates inhibited the mycelial growth of Rhizoctonia solani, Sclerotium rolfsii and Fusarium solani in the range of<br />
32.30- 50.73%.<br />
Among the soil borne fungal diseases of<br />
groundnut, Web blight, caused by Rhizoctonia solani<br />
is the most common disease (Dubey, 2000).<br />
Rhizoctonia solani is a wide spread and an<br />
ecologically diverse soil-borne fungus, causing<br />
different types of diseases in many plant species. It<br />
causes root rot, stem rot, fruit and seed decay,<br />
damping-off, foliar blight, stem canker and crown rot<br />
in various crops (Guleria et al. 2007). Biological<br />
control of plant diseases using antagonistic bacteria<br />
may be considered as a promising alternative to the<br />
use of some hazardous chemical fungicides. In the<br />
present study, ten Rhizobium isolates were obtained<br />
from the rhizosphere of groundnut and redgram crops<br />
and were characterized, screened for IAA, Phosphate<br />
solubilization, HCN, siderophore production and<br />
finally for antagonistic activity with Rhizoctonia solani,<br />
Sclerotium rolfsii and Fusarium solani under in vitro<br />
conditions.<br />
MATERIALS AND METHODS<br />
Isolation of bacterial isolates<br />
Bacterial isolates were obtained from the<br />
rhizosphere of groundnut and redgram crop plants<br />
using Yeast Extract Mannitol Agar (YEMA) as<br />
described by the Vincent, (1970).<br />
Screening of pure Rhizobium isolates for<br />
Phosphate solubilization, production of indole acetic<br />
acid, hydrogen cyanide and siderophores<br />
Phosphate solubilization<br />
This test was performed following spot<br />
inoculation on Pikovskaya’s medium. Clear zone<br />
around the colonies indicates phosphate<br />
solubilization.<br />
IAA production<br />
Production of indole acetic acid (IAA) was<br />
detected as described by Brick et al., (1991).<br />
Bacterial isolates were grown for 72 h in yeast extract<br />
broth tubes at 36±2 0 C. Fully grown cultures were<br />
centrifuged at 3000rpm for 30min. the supernatant<br />
(2ml) was mixed with two drops of Orthophosphoric<br />
acid and 4ml of the Salkowaski reagent (50ml, 35%<br />
of Per chloric acid, 1ml of 0.5M Fecl 3<br />
solution).<br />
Development of pink color indicates IAA production.<br />
HCN production<br />
HCN production was tested by the method<br />
of Lorck (1948). Yeast extract mannitol broth was<br />
amended with 4.4g glycine/lit and bacteria were<br />
streaked on modified agar plate. A Whatman filter<br />
paper no.1 soaked in 2% sodium carbonate in 0.5%<br />
picric acid solution was placed at the top of the plate.<br />
Plates were sealed with Para film and incubated at<br />
36±2 0 C for 4 days. Development of orange to red<br />
color indicates HCN production.<br />
email: arvanibharathula@gmail.com<br />
46
SCREENING OF LOCAL RHIZOBIAL ISOLATES FOR PLANT GROWTH PROMOTION<br />
Siderophore production<br />
Siderophores were detected quantitatively by<br />
CAS Shuttle Assay (Schwyn and Neilands, 1987).<br />
0.5% of cell free culture supernatant was added to<br />
0.5% CAS (Chrome Azurol Sulphate) assay solution<br />
and absorbance was measured at 630nm against a<br />
reference consisting of 0.5ml uninoculated broth and<br />
0.5ml CAS reagent. Siderophore content in the aliquot<br />
was calculated by using the following formula:<br />
% siderophore units =<br />
Where, A r<br />
= Absorbance of reference at 630nm<br />
A s<br />
= Absorbance of sample at 630nm.<br />
Antagonistic activity against fungal pathogens<br />
Antagonism against the fungal pathogens<br />
was performed by dual culture assay (Skidmore and<br />
Dickinson, 1976). One loopful of bacterial suspension<br />
was streaked on potato dextrose agar plate at one<br />
end, which was pre-inoculated with 5days old, 5mm<br />
mycelial discs of test pathogen at the other end.<br />
Control plate was maintained by placing only pathogen<br />
mycelial disc on the plate without bacteria. The assay<br />
plates were incubated at 28 1 0 C for 5 days and<br />
observations were made on inhibition of mycelial<br />
growth of the test pathogens. For each bacterial isolate<br />
three replications were maintained with suitable<br />
controls.<br />
The per cent growth inhibition over control was<br />
calculated by using the formula:<br />
Percent Inhibition =<br />
Growth of Pathogen in control (mm)-<br />
Growth of Pathogen in treatment (mm)<br />
Growth of Pathogen in control (mm)<br />
(In this the percent inhibition in control was taken as<br />
zero percent).<br />
RESULTS AND DISCUSSION<br />
Isolation of Rhizobium isolates<br />
X 100<br />
Fifteen soil samples were collected from<br />
different places of Rangareddy district for the isolation<br />
of Rhizobium isolates. The soil samples were mainly<br />
collected from the rhizosphere of groundnut and<br />
redgram crop plants. All the soil samples were<br />
inoculated on the YEMA (Yeast Extract Mannitol<br />
Agar), based on the colony morphology and cultural<br />
characteristics of the isolates on the above media,<br />
about ten colonies from above plates were selected,<br />
purified on respective media and subjected to gram<br />
staining for morphological examination. The isolates<br />
were named according to village, crop and cultural<br />
characters as SFGR to CFGR. All the isolates were<br />
gram-ve, single isolated rods with gummy white,<br />
round, non spreading, smooth, raised, translucent<br />
mucoid colony and no pigmentation.<br />
Kumar et al., (2010) isolated root nodulating<br />
Sinorhizobium fredii KCC5 from nodules of Cajanus<br />
cajan and disease suppressive soil of tomato<br />
rhizosphere, respectively and studied their<br />
physiological and biochemical characterization which<br />
confirms the purity of these isolates. Joseph et al.,<br />
(2007) isolated a total of one hundred and fifty isolates<br />
from different soils of chickpea from the vicinity of<br />
Allahabad and among them thirty five isolates were<br />
identified as Rhizobium on the basis of morphological<br />
and biochemical characterization. Deka and Azad<br />
(2006) isolated one hundred and fifty seven isolates<br />
of Rhizobium from six pulse crops Cowpea, Green<br />
gram, Black gram, Pigeon pea, Soybean, Groundnut<br />
and studied their physiological and biochemical<br />
characterization which confirms the purity of these<br />
isolates.<br />
Screening of pure Rhizobium isolates for<br />
Phosphate solubilization, production of indole<br />
acetic acid, hydrogen cyanide and siderophores<br />
All the ten Rhizobium isolates showed zone of<br />
phosphate solubilization activity on Pikovskya’s<br />
medium. Out of ten, SFGR showed highest zone of<br />
16mm with 60% Solubilization Efficiency (SE),<br />
followed by AGR, KRR and CFGR which showed<br />
14mm zone with 40% S.E. Remaining isolates<br />
showed SE of 20% with 12mm of solubilization zone.<br />
All the Rhizobium isolates were identified as<br />
IAA producers, of which SFRR was found to be strong.<br />
Two isolates (DGR and CFGR) produced IAA in fewer<br />
amounts, while the remaining showed moderate<br />
production of IAA.<br />
In case of HCN production, all the isolates<br />
showed positive results, of which AGR and KRR<br />
showed strong production. SFGR, SFRR, ARR, DRR,<br />
KGR, SBGR showed moderate production, while other<br />
two (DGR and CFGR) showed weak production.<br />
47
SARVANI et al<br />
Seven of the isolates showed positive results for<br />
siderophore production. Kumar et al. (2010) screened<br />
Sinorhizobium fredii KCC5 from Cajanus cajan and<br />
reported that the strain produced IAA, solubilized<br />
phosphorus and siderophore production. Verma et<br />
al., (2010) evaluated Rhizobium spp. for in vitro PGP<br />
properties and concluded that the bacterial strain was<br />
found to be positive for IAA and phosphate<br />
solubilization.<br />
Joseph et al., (2007) isolated thirty five<br />
Rhizobium spp. from the rhizosphere soils of<br />
chickpea crop plants and screened in vitro for their<br />
plant growth promoting characteristics. Results<br />
revealed that 85.7% of Rhizobium isolates showed<br />
IAA production.<br />
Similarly, Chandra et al., (2007) isolated<br />
Mesorhizobium loti MP6, from root nodules of Mimosa<br />
pudica which induced growth and yield of Brassica<br />
campestris through plant growth promoting attributes.<br />
The isolate MP6 showed production of IAA, HCN,<br />
phosphate solubilization and siderophore production.<br />
Nabi et al. (2005) identified ten strains of Rhizobium<br />
meliloti from the root nodules of Fenugreek (Trigonella<br />
foenum- graceum) and studied for PGP properties.<br />
They concluded that different strains of Rhizobium<br />
meliloti exhibited the properties of IAA, HCN and<br />
siderophore production.<br />
In the present study, the rhizobial isolates can<br />
be graded in the order SFGR>KRR=AGR>SFRR,<br />
based on efficiency.<br />
Antagonistic activity against fungal pathogens<br />
All the ten isolates inhibited Rhizoctonia<br />
solani except DGR, of which SBGR showed highest<br />
% inhibition with 12.6mm zone, followed by DRGR<br />
and CFGR with 44% inhibition and 11mm zone. Least<br />
% inhibition was shown by AGR (39.2%) with 5.6mm<br />
zone.<br />
Six of the ten Rhizobium isolates exhibited<br />
antagonistic activity against Sclerotium rolfsii viz.,<br />
KRR (50.7%), SBGR (49.2%), SFGR (48%), AGR<br />
(48.8%), DGR (45.1%) and SFRR (38.8%).<br />
All the Rhizobium isolates showed potential<br />
in the biocontrol of Fusarium solani. Among which<br />
AGR recorded maximum inhibition of 44.6% with<br />
25.3mm of inhibition zone. The isolates SFGR, SFRR<br />
and CFGR were on par with AGR. DGR showed least<br />
percent inhibition of 32.3% (14mm zone) inhibition.<br />
These findings were found to be similar with those of<br />
Shaban and El-Bramaway (2011) who studied the<br />
biological control of damping off and root rot causing<br />
fungi (Fusarium oxysporum, F. solani, Macrophomina<br />
phaseolina, Rhizoctonia solani and Sclerotium rolfsii)<br />
with antagonistic microorganism (Rhizobium spp and<br />
Trichoderma sp). They revealed that combined effect<br />
of both Rhizobium spp and Trichoderma sp was found<br />
to be beneficial in controlling the fungal diseases of<br />
legume crops.<br />
Akthar et al., (2010), reported that combined<br />
application of Bacillus pumilus and Pseudomonas<br />
alcaligenes with Rhizobium spp. resulted in the<br />
greatest increase in the plant growth, number of pods,<br />
nodulation and root colonization by rhizobacteria, in<br />
Lentil.<br />
Yuan et al., (2008) isolated Sinorhizobium<br />
freudii (L 396) from soybean root nodule and<br />
evaluated antagonistic activity against Heterodera<br />
glycines and pathogens of Soyabean (Glycine max)<br />
root rot. Hatching inhibition rate of cysts treated with<br />
the bacteria suspension at 7 days was 82.9%. L396<br />
displayed antifungal activity to two soyabean root<br />
rot pathogens, especially to Fusarium solani, with 4<br />
mm inhibition zone.<br />
In the present study, out of ten Rhizobium<br />
isolates tested, all the isolates exhibited inhibition<br />
potential against Rhizoctonia solani (Except DGR)<br />
and Fusarium solani. Only six of the isolates showed<br />
inhibition potential against Sclerotium rolfsii. The<br />
isolates that showed maximum inhibition potential<br />
against Rhizoctonia solani were also inhibitory to<br />
Sclerotium rolfsii and Fusarium solani, based on<br />
percent inhibition and vice-versa. Some of the<br />
isolates that showed inhibition to one pathogen were<br />
not inhibitory to the other two pathogens. All the ten<br />
isolates showed HCN production, whereas seven of<br />
the isolates produced siderophores. It can be inferred<br />
that the Rhizobium isolates SFGR, SBGR, AGR and<br />
KRR could be considered for their antagonistic activity<br />
against the three soil borne pathogens. Though KRR<br />
showed higher siderophore and HCN production, it<br />
showed better inhibition to Sclerotium rolfsii.<br />
Comparing the antagonistic activity against these<br />
pathogens and production of siderophores and HCN,<br />
the effectiveness of these isolates is in the order:<br />
SBGR> AGR> SFGR> KRR.<br />
48
SCREENING OF LOCAL RHIZOBIAL ISOLATES FOR PLANT GROWTH PROMOTION<br />
Table 1. Plant growth promoting attributes of Rhizobium isolates<br />
Phosphate solubilization<br />
Isolate<br />
Zone<br />
diameter<br />
(mm)<br />
Solubilization<br />
Efficiency (%)<br />
Nodulation<br />
IAA<br />
HCN<br />
Siderophore<br />
production<br />
SFGR 16 60 + ++ ++ +<br />
SFRR 12 20 + +++ ++ +<br />
AGR 14 40 + ++ +++ +<br />
ARR 12 20 + ++ ++ -<br />
DGR 12 20 + + + +<br />
DRR 12 20 + ++ ++ -<br />
KGR 12 20 + ++ ++ -<br />
KRR 14 40 + ++ +++ +<br />
SBGR 12 20 + ++ ++ +<br />
CFGR 14 40 + + + +<br />
HCN- Hydrogen cyanide IAA- Indole Acetic Acid Nodulation<br />
+ Weak production ++ Moderate production + Nodulation<br />
+++ Strong production “ No production “ No Nodulation<br />
Table 2. Antagonistic activity of Rhizobium isolates against Rhizoctonia solani, Sclerotium rolfsii<br />
and Fusarium solani.<br />
ISOLATE<br />
*Percent Inhibition (%)<br />
Rhizoctonia solani Sclerotium rolfsii Fusarium solani<br />
SFGR 39.62<br />
(38.99)<br />
SFRR 42.59<br />
(40.71)<br />
AGR 39.25<br />
(38.77)<br />
ARR 40.36<br />
(39.42)<br />
DGR 26.66<br />
(31.07)<br />
DRR 44.07<br />
(41.57)<br />
48.06<br />
(43.87)<br />
38.82<br />
(38.53)<br />
48.83<br />
(44.31)<br />
26.60<br />
(31.02)<br />
45.14<br />
(42.18)<br />
28.10<br />
(31.99)<br />
44.09<br />
(41.59)<br />
43.58<br />
(41.29)<br />
44.61<br />
(41.88)<br />
37.43<br />
(37.68)<br />
32.30<br />
(34.60)<br />
39.99<br />
(39.14)<br />
49
SARVANI et al<br />
ISOLATE<br />
*Percent Inhibition (%)<br />
Rhizoctonia solani Sclerotium rolfsii Fusarium solani<br />
KGR 42.96<br />
(40.93)<br />
KRR 39.99<br />
(39.21)<br />
SBGR 46.66<br />
(43.06)<br />
CFGR 44.07<br />
(41.57)<br />
27.73<br />
(31.75)<br />
50.73<br />
(45.40)<br />
49.23<br />
(44.52)<br />
26.60<br />
(31.02)<br />
33.33<br />
(35.21)<br />
38.97<br />
(38.59)<br />
34.35<br />
(35.86)<br />
42.56<br />
(40.69)<br />
Control 00 00 00<br />
CV % 2.92 3.21 6.29<br />
SEM± 0.66 0.71 1.40<br />
CD CDat 0.05<br />
5%<br />
1.98 2.12 4.17<br />
*Mean of three replications Figures in the parenthesis represent angular transformed values.<br />
REFERENCES<br />
Akhtar, M.S., Shakeel, U and Siddiqui, Z.A. 2010.<br />
Biocontrol of Fusarium wilt by Bacillus pumilus,<br />
Pseudomonas alcaligenes and Rhizobium sp.<br />
on lentil. Turk J Biol. 34: 1-7.<br />
Brick, J.M., Bostock R.M and Silverstone S. E.1991.<br />
Rapid insitu assay for indole acetic acid<br />
production by bacteria immobilized on<br />
nitrocellulose membrane. Appl. Environ.<br />
Microbiol. 57: 535–538.<br />
Chandra, S., Choure, K., Dubey, R.C and Maheswari,<br />
D.K. 2007. Rhizosphere competent<br />
Mesorhizobium loti MP6 induces root hair curling,<br />
inhibits Sclerotinia sclerotiorum and enhances<br />
growth of Indian Mustard Brassica campestris.<br />
Brazilian Journal of Microbiology. 38: 124-130.<br />
Deka, A.K and Azad, P. 2006. Isolation of Rhizobium<br />
strains: cultural and biochemical characteristics.<br />
Legume Research. 29(3): 209-212.<br />
Dubey, S.C. 2000. Biological management of web<br />
blight of Groundnut Rhizoctonia solani . J Mycol<br />
Pl Pathol, 30(1): 89 - 90.<br />
Guleria, S. R. Aggarwal, T.S. Thind and Sharma, T.R.<br />
2007. Morphological and pathological variability<br />
in rice isolates of Rhizoctonia solani and<br />
molecular analysis of their genetic variability.<br />
Journal Phytopathology 155: 654-661.<br />
Joseph, B., Patra, R.R and Lawrence, R. 2007.<br />
Characterization of plant growth promoting<br />
rhizobacteria with chickpea Cicer arietinum L.<br />
International Journal of Plant Production. 1(2):<br />
141-151.<br />
Kumar, H., Bajpai, V.K., Dubey, R.C., Maheshwari,<br />
D.K and Kang, S.C. 2010. Wilt disease<br />
management and enhancement of growth and<br />
yield of Cajanus cajan L var. Manak by bacterial<br />
combinations amended with chemical fertilizer.<br />
Crop Protection. 29: 591-598.<br />
Lorck, H. 1948. Production of hydrocyanic acid by<br />
bacteria. Plant Physiol. 1: 142 -146.<br />
Nabi, A., Ahmad, I and Zargar, M.Y. 2005. Screening<br />
of Rhizobium meliloti for plant growth promoting<br />
activities. Applied Biological Research. 7(1/2):<br />
14-17.<br />
Schwyn, B and Neilands, J.B. 1987. Universal<br />
chemical assay for detection and determination<br />
of siderophores. Analytical Biochemistry. 16: 47-<br />
56.<br />
50
SCREENING OF LOCAL RHIZOBIAL ISOLATES FOR PLANT GROWTH PROMOTION<br />
Shaban, W.I and El-Bramawy, M.A. 2011. Impact of<br />
dual inoculation with Rhizobium and Trichoderma<br />
on damping off, root rot diseases and plant<br />
growth parameters of some legumes field crop<br />
under greenhouse conditions. International<br />
Research Journal of Agricultural Science. 1(3):<br />
098-108.<br />
Skidmore, A. M and Dickinson, C H 1976 Colony<br />
interaction and hyphal interference between<br />
Septoria nodorum and phylloplane fungi.<br />
Transactions and Journal of the British Ceramic<br />
Society. 66: 57-74.<br />
Verma, J.P., Yadav, J and Tiwari, K.N. 2010.<br />
Application of Rhizobium sp.BHURCO1 and<br />
plant growth promoting rhizobacteria on<br />
nodulation, plant biomass and yields of chickpea<br />
Cicer arietinum L.. International Journal of<br />
Agricultural Research. 5(3): 148-156.<br />
Vincent, J.M. 1970. A manual for the practical study<br />
of the root nodule bacteria. Blackwell Scientific<br />
publications Oxford and Edinburgh. Pp: 1-3.<br />
Yuvan, W.Y., Yuxi, D and Lijie, Chen. 2008.<br />
Antagonism of Rhizobium against pathogens of<br />
soybean root. Acta Phytopathologica Sinica.<br />
38(6): 607-612.<br />
51
J.Res. ANGRAU 41(2) 52-58, 2013<br />
CHARACTERIZATION AND CLASSIFICATION OF RICE GROWING SOILS OF<br />
CENTRAL TELANGANA REGION OF ANDHRA PRADESH<br />
M.RAMPRASAD, V.GOVARDHAN, V.PRAVEEN RAO, K.SUREKHA and M.H.V. BHAVE<br />
Department of Soil Science and Agricultural Chemistry, College of Agriculture, Rajendranagar,<br />
Acharya N.G. Ranga Agricultural University, Hyderabad- 500 030<br />
Date of Receipt : 20.09.2012 Date of Acceptance : 06.03.2013<br />
ABSTRACT<br />
Ten representative pedons from rice-growing soils of Central Telangana region were characterized and<br />
classified. The results showed that the soils were of sandy loam to clayey in texture with low permeability. In general,<br />
the soils were neutral to slightly alkaline in reaction, high to low in organic carbon, mixed in mineralogy and<br />
moderately deep to very deep. Bulk density increased with depth and values ranged from 1.24 to 1.71 Mg m -3 . Water<br />
retentions of soil at 0.33 bars and 15 bars ranged from 9.8 to 39.1 % and 4.7 to 23.6 %, respectively. Cation<br />
Exchange Capacity and soil pH followed no definite distribution pattern with depth. While the status of available N<br />
was low to medium, the status of available P and K ranged from low to high and the availability decreased with depth.<br />
Based on soil characteristics, the soils of Gajwel (P6) were classified as Entisol, soils of Sanga Reddy (P4),<br />
Eturnagaram (P9) and Ghanpur (P10) were classified as Alfisols, soils of Madhira (P1), Aswaraopeta (P2) and<br />
Malyal (P8) as Inceptisols and soils of Pinapaka (P3) and Siddipeta (P5) as Vertisols.<br />
Rice crop is being grown in Central Telangana<br />
region in diversified soil and resource environs<br />
predominantly under puddling and waterlogging<br />
conditions in lowland systems. There is wide<br />
heterogeneity in soils (red, lateritic, black, alluvial<br />
and colluvial). Nutrient supplying capacity and<br />
availability varied significantly in the waterlogged<br />
environs of low land systems due to the different<br />
farming situations adopted in locale. The consistent<br />
variability and heterogeneity of soil and land resource<br />
environs in the Telangana region is evidently not<br />
supporting with the requirements of rice crop.<br />
Soil characterization determines the soils<br />
individual inherent potentials and constraints for crop<br />
production besides giving detailed information about<br />
the different soil properties. Characterization and<br />
systematic classification of dominant soil groups is<br />
an essential tool and a pre-requisite for soil fertility<br />
evaluation and efficient soil-fertilizer-water<br />
management practices and, thus, crop management.<br />
It is important to standardize site-specific<br />
technologies on the basis of soil types to improve<br />
rice yields, which necessitates soil characterization.<br />
The present study, therefore, was planned to<br />
characterize and classify the rice growing soils of<br />
the Central Telangana region.<br />
MATERIALS AND METHODS<br />
The Central Telangana region is located<br />
between 17p 142 to 18p 212 N latitude and 78p 52<br />
to 81p 62 longitude in south India with mean annual<br />
rainfall of 1167.7 mm, of which 74 per cent which is<br />
received through S-W monsoon (mid-June to mid-<br />
September). Ten representative pedons (P1 to P10)<br />
from Madhira, Aswaraopeta, Pinapaka, Sanga Reddy,<br />
Siddipeta, Gajwel, Warangal, Malyal, Eturnagaram<br />
and Ghanpur were exposed where all horizons were<br />
visible. All pedons were examined morphologically<br />
immediately after rice harvest. Soil samples collected<br />
from each horizon were analysed for different soil<br />
properties viz. particle-size distribution (hydrometer<br />
method), bulk density (core method), water retention<br />
characteristics (pressure plate apparatus), saturated<br />
hydraulic conductivity (constant head method), pH<br />
(1:2.5 soil water solution), organic carbon (Walkley<br />
and Black, 1934), cation exchange capacity (CEC)<br />
by neutral normal NH 4<br />
OAc. The soils were classified<br />
as per soil taxonomy (Soil Survey Staff, 1998 and<br />
Soil Survey Staff, 2006).<br />
RESULTS AND DISCUSSION<br />
Morphology<br />
The colour of the soils is in 10YR, 7.5YR<br />
and 2.5YR hue and varied from brown to dusky red.<br />
email: mullapudiramprasad@yahoo.co.in<br />
52
CHARACTERIZATION AND CLASSIFICATION OF RICE GROWING SOILS<br />
Texture varied from sandy loam to clayey. Texture<br />
of surface horizons of P1, P3, P5, P7 were clayey<br />
and P2, P4, P6, P8, P9, P10 were sandy clay loam.<br />
The paddy soils under study had in general, massive<br />
structure at the surface which broke in to subangular<br />
blocky or angular blocky and ranged from granular to<br />
subangular blocky in pedons. In all surface horizons<br />
the structure was subangular blocky except in P6<br />
which was granular structure and angular blocky in<br />
P3, P5 (Table 1).<br />
Physical characteristics<br />
The silt content ranged from 7.9 to 24.2 per<br />
cent and a gradual increase in clay content in lower<br />
depths was observed in the pedons except P2 and<br />
P6 (Table 2). The increase in clay content is an<br />
indication of illuviation (Pardeep Kumar and Verma<br />
2005; Ratnam et al., 2001). The aggregation in these<br />
soils was poor in surface and sub-surface horizons.<br />
As these soils were under rice cultivation since many<br />
years, the repeated puddling during rice cultivation<br />
could be one of the reasons for poor aggregation in<br />
surface horizons. The poor aggregation in sub-surface<br />
horizons might be because of clay illuviation under<br />
continuous irrigation conditions. Rice soils have poor<br />
aggregation because of puddling or wet tillage that<br />
destroys soil structure (Dey and Sehgal, 1997).<br />
The bulk density increased with depth in all<br />
pedons barring P3 and P4 as exceptions, which<br />
indicated that the lower layers in soil profiles<br />
supporting rice cultivation system became compact<br />
with time. These results are in conformity with the<br />
findings of Ratnam et al., (2001). The farmers plough<br />
with local (desi) plough which disturbs the soil up to<br />
20 cm only and lower layers remain undisturbed for<br />
years together which sometime result in pan<br />
formation. Because of dominance of silt and clay,<br />
the soils retained fairly good amount of water varying<br />
from 9.8 to 39.1 per cent (at field capacity). The<br />
saturated hydraulic conductivity of surface layers<br />
followed the values varying from 1.2 to 10.4 cm hr -1 .<br />
Similar findings were also reported by Reza et<br />
al.,(2010).<br />
Chemical properties<br />
The chemical characteristics of pedons were<br />
presented in table 3. The soils were neutral to slightly<br />
alkaline at surface (pH 6.6 to 8.2) and sub-surface<br />
(pH 6.1 to 8.78) depths. The organic carbon varied<br />
from 7.0 to 11.4 g kg -1 in surface horizons and 2.0 to<br />
9.0 g kg -1 in sub-surface horizons and decreased with<br />
depth. The temperature during rice cultivation ranged<br />
from 13.0 to 39.0 p C. High temperature during most<br />
part of the year might be responsible for high rate of<br />
decomposition and comparatively higher values of<br />
organic carbon in surface horizons than sub-surface<br />
horizons. The CEC values varied from 13.2 to 45.1<br />
cmol(p+) kg -1 in surface horizons and from 16.5 to<br />
51.3 cmol(p + ) kg -1 in sub-surface horizons which could<br />
be in positive correlation with clay content. Similar<br />
findings were also reported by Dhanorkar et al., 2010.<br />
The available N varied from 116 to 385 kg<br />
ha -1 in the surface horizons, whereas sub-surface<br />
horizons had available N in the range of 85 to 257 kg<br />
ha -1 . Majority of the soils fell into low to medium<br />
category with respect to available nitrogen as per<br />
the Muhr et al. 1965. The available P varied from 8<br />
to 65 kg ha -1 in surface and 4 to 61 kg ha -1 in subsurface<br />
horizons. Available K ranged from 108 to 475<br />
kg ha -1 in surface horizons and 94 to 391 kg ha -1 in<br />
sub-surface horizons and soils classified under low<br />
to high in available K content.<br />
Soil classification<br />
Based on morphological, physical,<br />
physico-chemical characteristics of the soils and<br />
climate data, the pedon six was classified in to the<br />
order Entisols (pedon6) which do not have any<br />
diagnostic horizon and possesses lithic contact that<br />
is shallower depth than 25 cm and above 1 m, having<br />
an organic corbon content decreasing with increasing<br />
depth and reaches a level of 0.2 per cent at a depth<br />
of 1.25 m, not permanently saturated with water,<br />
hence placed under the Orthents at sub order level.<br />
As the moisture regime is Ustic, the pedon 6 was<br />
classified as Ustorthents at great group level, but<br />
categorised as Udic Ustorthents at great group level<br />
53
RAMPRASAD et al<br />
because of the present land use condition with good<br />
irrigation practices for cultivation of crops in the last<br />
three decades. The proper utilization of soil and land<br />
resource environs influenced the moisture conditions<br />
greatly leading to storing og moisture in the profile.<br />
The pedons four, nine and ten were classified under<br />
Alfisols because of the presence of an argillic (B t<br />
)<br />
sub-surface diagnostic horizon and the pedons 1, 2<br />
and 8 were classified under the order Inceptisols<br />
because of the absence of any other diagnostic<br />
horizon other than cambic (B w<br />
) horizon. As the<br />
moisture regime is Ustic, the pedons 4, 9 and 10<br />
were classified as Ustalfs, whereas the pedons 1, 2<br />
and 8 were classified as Ustepts at sub order level<br />
and were classified as Haplustepts at great group<br />
level because the pedons have neither duripan nor<br />
calcic horizon and the base saturation is more than<br />
60 per cent at a depth between 0.2 to 0.7 m from the<br />
soil surface. The pedons 2 and 8 were classified as<br />
Typic Haplustepts at sub group level because these<br />
pedons did not have vertic properties and lithic<br />
contact with in 50 cm from the soil surface. The pedon<br />
one was classified as Vertic Haplustepts at sub group<br />
level, considering cracks with in 100 cm of mineral<br />
soil surface.<br />
The pedon four was classified as<br />
“Paleustalfs” at great group level because of the<br />
absence of densic, lithic or para lithic content within<br />
15 cm of the mineral soil surface and the lower one<br />
half of the argilic horizon, one or more sub horizons<br />
with hue of 7.5YR and chroma of 5 or more in 50 per<br />
cent or more of matrix. This pedon was classified as<br />
Udic Paleustalfs at great group level because of the<br />
present land use condition, essentially because of<br />
good irrigation practices that one being followed for<br />
last three decades. The soil and land resource<br />
environs are utilized properly, economically providing<br />
water from various sources and this might have<br />
influenced the moisture conditions greatly. The pedon<br />
nine was classified as “Rhodustalfs” at great group<br />
level because of an argillic horizon that have hue of<br />
2.5YR and the value, moist of three, The pedon 10<br />
was classified as “Haplustalfs” at great group level<br />
because it did have any horizons other than argillic<br />
horizon. Further, these pedons 9 and 10 did not have<br />
vertic properties and lithic contact within 50 cm from<br />
the soil surface. Hence, these pedons are classified<br />
as Typic Rhodustalfs and Typic Haplustalfs at<br />
subgroup level respectively.<br />
The pedons three, five and seven were<br />
classified as Vertisols at order level as they<br />
expressed their morphology very identical and have<br />
clay texture (more than 30 % clay in fine earth fraction<br />
in all the horizons). In these pedons clay exhibited<br />
significant sink–source characteristics and had a<br />
layer of 25 cm (or) more in thickness with an upper<br />
boundary with in 100 cm of mineral soil surface , that<br />
have slickensides which exhibited shiny and smooth<br />
surfaces at interspace of peds and designated as<br />
Bss. These soils had ustic soil moisture regime,<br />
hence these pedons were classified as “Usterts” at<br />
suborder level, At great group level these pedons<br />
were calssified as Haplusterts as they did not have<br />
either salic, gypsic and petrocalcic horizons within<br />
100 cm depth. The pedons had EC less than 4 dS<br />
m -1 and pH more than 4.5. The pedons three, five<br />
and seven were classified as Typic Haplusterts at<br />
subgroup level because these pedons had deep<br />
cracks that remained open for more than 150<br />
cumulative days for most years. Agarwal et al. (2012)<br />
classified the soils of Wardha district of Vidharbha<br />
region into Typic Haplusterts based on above<br />
features.<br />
The results lead to a conclusion that the<br />
rice-growing soils of Central Telangana region of<br />
Andhra Pradesh were shallow to very deep,<br />
moderately well to poorly drained, neutral to slightly<br />
saline, low to high in organic carbon, low to medium<br />
in CEC, moderate to high base saturated and sandy<br />
loam to clayey with variation in relation to<br />
physiography. Regarding nutrient status, the soils<br />
were low to medium in available nitrogen, low to high<br />
in available phosphorous and potassium. Different<br />
rice growing soils of Central Telangana region of<br />
Andhra Pradesh were classified up to sub-group level.<br />
54
CHARACTERIZATION AND CLASSIFICATION OF RICE GROWING SOILS<br />
Location<br />
Horizon<br />
Table 1. Morphological properties of the pedons<br />
Depth<br />
(cm) Colour Mottels Texture Structure<br />
Moist Wet C G T<br />
P1: Fine, smectitic, iso-hyperthermic Vertic Haplustepts<br />
Madhira Ap 0-18 7.5 YR 3/1 -- c m 2 sbk<br />
Bwg 1 18-54 7.5 YR 4/1 -- c m 3 sbk<br />
Bwg 2 54-100 7.5 YR 4/1 -- c m 3 abk<br />
Bw 100-140 7.5 YR 4/1 -- c m 3 abk<br />
P2: Fine-loamy, mixed, iso-hyperthermic Typic Haplustepts<br />
Aswaraopeta Ap 0-12 2.5YR 6/4 2.5YR 3/3 scl m 2 sbk<br />
Bw 1 12-26 2.5YR 6/4 2.5YR 3/3 scl m 2 sbk<br />
Bw 2 26-60 2.5YR 7/6 5YR 3/4 sl f 2 sbk<br />
Bw 3 60-95 2.5YR 6/8 5YR 5/6 scl f 2 sbk<br />
P3: Fine, smectitic, iso-hyperthermic Typic Haplusterts<br />
Pinapaka Ap 0-24 10YR 5/3 10YR 2/2 c m 3 abk<br />
Bw 24-42 10YR 4/3 10YR 2/2 c m 2 sbk<br />
Bss 1 42-89 10YR 4/3 10YR 3/2 c f 2 sbk<br />
Bss 2 89-120+ 10YR 4/3 10YR 2/2 c f 2 abk<br />
P4: Fine-loamy, mixed, iso-hyperthermic Udic Paleustalfs<br />
Sangareddy Ap 0-14 7.5 YR 3/4 5 YR 3/4 scl m 3 sbk<br />
Bw 14-28 7.5 YR 6/6 5 YR 5/6 scl f 3 abk<br />
Bt 1 28-60 7.5 YR 5/4 7.5 YR 3/4 c m 3 sbk<br />
Bt 2 60-95 7.5 YR 7/6 7.5 YR 4/1 c m 3 sbk<br />
Bw 95-120+ 7.5 YR 7/6 7.5 YR 4/1 c m 3 sbk<br />
P5: Fine, smectitic, iso-hyperthermic Typic Haplusterts<br />
Siddipeta Ap 0-16 10YR 3/2 10YR 5/8 c f 3 abk<br />
Bss 1 16-35 10YR 3/2 10YR 5/4 c f 3 abk<br />
Bss 2 35-74 10YR 3/1 10YR 6/2 c f 3 abk<br />
Bss 3 74-110+ 10YR 3/1 10YR 5/6 c f 3 abk<br />
P6: Fine-loamy, mixed, iso-hyperthermic Udic Ustorthents<br />
Gajwel A 0-25 7.5 YR 4/6 -- scl m 2 gr<br />
AC 25-75+ 7.5 YR 4/6 -- scl f 2 gr<br />
P7: Fine, smectitic, iso-hyperthermic Typic Haplusterts<br />
Warangal Ap 0-16 10YR 4/2 7.5YR 6/8 c m 1 sbk<br />
Bss 16-50 10YR 3/2 7.5YR 5/8 c m 2 abk<br />
Bg 50-75 10YR 2/2 7.5YR 6/8 c m 2 abk<br />
Bw 75-110+ 10YR 3/2 7.5YR 6/8 c m 2 abk<br />
55
RAMPRASAD et al<br />
Pedon No and<br />
Location<br />
P8: Fine-loamy, mixed, iso-hyperthermic Typic Haplustepts<br />
Malyal Ap 0-18 10YR 4/2 7.5YR 4/4 scl m 2 sbk<br />
Bw 1 18-30 10YR 4/3 7.5YR 4/4 scl m 2 sbk<br />
Bw 2 30-66 10YR 4/4 7.5YR 4/4 scl m 3 sbk<br />
C 66-155+ 10YR 4/5 7.5YR 4/4 scl f 3 sbk<br />
P9: Fine-loamy, mixed, iso-hyperthermic Typic Rhodustalfs<br />
Eturnagaram Ap 0-12 2.5YR 3/2 -- scl m 1 sbk<br />
AB 12-50 2.5YR 4/6 -- scl f 1 sbk<br />
Bt 1 50-86 2.5YR 4/8 -- scl m 2 sbk<br />
Bt 2 86-98+ 2.5YR 4/6 -- scl m 2 sbk<br />
P10: Fine, mixed, iso-hyperthermic Typic Haplustalfs<br />
Ghanpur Ap 0-15 10YR 3/1 7.5YR 5/1 scl m 3 sbk<br />
Btg 15-40 10YR 3/2 7.5YR 5/6 sc f 3 sbk<br />
Bwg 40-80 10YR 3/1 7.5YR 6/8 sc f 3 sbk<br />
Bg 80-110 10YR 3/1 10YR 5/8 sc f 3 sbk<br />
Bt 110+ 10YR 3/1 10YR 3/2 c f 3 sbk<br />
Table 2. Physical properties of the pedons<br />
Mechanical composition<br />
Bulk H.C<br />
moisture<br />
retention<br />
Horizon (%) density<br />
(%)<br />
Sand Silt Clay<br />
Mg m -3 cm hr -1 33 kPa<br />
1500<br />
kPa<br />
P1: Madhira Ap 36 18 46 1.31 2.1 16.1 11.6<br />
Bwg 1<br />
31 20 49 1.36 1.6 21.8 12.4<br />
Bwg 2<br />
29 20 51 1.32 1.8 19.6 10.8<br />
Bw 27 22 50 1.39 1.2 20.2 10.6<br />
P2:Aswaraopeta Ap 52 22 26 1.38 3.4 14.1 9.8<br />
Bw 1<br />
52 20 28 1.44 1.9 18.6 11.1<br />
Bw 2<br />
64 16 20 1.55 2.1 18.8 12.6<br />
Bw 3<br />
60 19 22 1.71 1.6 19.2 14.7<br />
P3:Pinapaka Ap 29 19 52 1.34 3.2 9.8 4.7<br />
Bw 28 19 53 1.58 1.5 11.7 5.9<br />
Bss 1<br />
29 18 53 1.46 1.6 25.6 8.1<br />
Bss 2<br />
28 15 57 1.38 0.4 24.2 11.2<br />
P4:Sangareddy Ap 53 21 26 1.45 4.2 19.1 11.2<br />
Bw 51 17 32 1.68 2.6 20.1 9.6<br />
Bt 1<br />
35 11 54 1.64 1.8 26.7 13.4<br />
Bt 2<br />
33 12 55 1.54 2.2 29.3 16.6<br />
Bw 35 13 52 1.68 1.6 30.1 14.8<br />
56
CHARACTERIZATION AND CLASSIFICATION OF RICE GROWING SOILS<br />
P5:Siddipeta Ap 20 23 57 1.24 1.2 26.3 14.4<br />
Bss 1<br />
17 24 59 1.3 1.6 34.5 13.1<br />
Bss 2<br />
13 21 66 1.31 1.2 38.3 16.1<br />
Bss 3<br />
14 17 69 1.33 1.1 39.1 16.5<br />
P6:Gajwel Ap 59 12 29 1.56 4.4 16.8 12.6<br />
AC 66 9 24 1.66 4.6 20.4 10.6<br />
P7:Warangal Ap 44 15 41 1.41 1.6 23.1 12.5<br />
Bss 40 15 45 1.41 0.6 25.7 14.2<br />
Bg 39 16 45 1.45 0.1 27.6 15.2<br />
Bw 43 13 45 1.48 0.1 32.9 17.7<br />
P8:Malyal Ap 56 14 30 1.52 3.3 16.6 9.6<br />
Bw 1<br />
52 17 31 1.46 3.3 17.5 10.5<br />
Bw 2<br />
56 12 31 1.46 3.2 24.3 15.8<br />
C 60 14 26 1.48 3.1 26.7 16.5<br />
P9:Eturnagaram Ap 68 8 25 1.52 2.2 11 5.5<br />
AB 68 8 24 1.59 1.4 14.2 8.1<br />
Bt 1<br />
63 8 29 1.6 1.9 15.9 9.7<br />
Bt 2<br />
62 10 29 1.6 1.1 16.2 9.9<br />
P10:Ghanpur Ap 55 15 30 1.29 3.3 18 6.8<br />
Btg 48 15 37 1.34 3.2 23.5 14.8<br />
Bwg 50 14 36 1.36 2.8 33.4 22.6<br />
Bg 48 13 39 1.41 2.4 37.4 21.7<br />
Bt 41 17 43 1.42 0.4 35.8 23.6<br />
REFERENCES<br />
Agarwal, D. V., Ingle, S. R and Khambalkar, H. 2012.<br />
Characterization of some cotton growing soils<br />
of Wardha district of Vidharbha region (M.S.,<br />
INDIA). Journal of Soils and Crops. 22(1): 159-<br />
167.<br />
Dey, J. K and Sehgal, J. L. 1997. Characteristics<br />
and classification of some alluvium derived<br />
paddy and associated non-paddy soils of<br />
Assam. Agropedology. 7: 22-31.<br />
Dhanorkar, B. A., Niranjana, K. V., Koyal, A., Naidu,<br />
L. G. K., Reddy, R. S and Sarkar, D. 2010.<br />
Soil resource inventory of lateritic terrain of<br />
medak district, Andhra Pradesh for sustainable<br />
crop planning. Agropedology. 20 (2): 97-102.<br />
Muhr, G R., Datta, N. P., Subramone, H.S., Dever,<br />
R.F., Leley, V. K and Dimahire, R. L. 1965.<br />
Soil testing in India. United States Agency<br />
for International Development Mission to India,<br />
New Delhi.<br />
Pardeep Kumar and Verma, T. S. 2005.<br />
Characteristics and classification of some rice<br />
growing soils of Palam Valley of Himachal<br />
Pradesh. Agropedology.15(2): 80-85.<br />
Ratnam, B.V., Rao, M. S and Rao, V.S. 2001.<br />
Characteristics of rice growing and non-rice<br />
growing Vertisols from Andhra Pradesh.<br />
Journal of the Indian Society of Soil Science.<br />
49(2): 371-373.<br />
57
RAMPRASAD et al<br />
Reza, S. K., Ahmed, N and Pal, S. 2010.<br />
Characterization, classification and mapping<br />
of soils of Panja-rao watershed, Saharanpur,<br />
Utter Pradesh. Agropedology. 20(2): 124-132.<br />
Soil Survey Staff, 2006 Keys to Soil Taxonomy. 10 th<br />
Edition USDA, Natural Resources<br />
Conservation Service, Washington D. C.<br />
Soil Survey Staff. 1998. Keys to Soil Taxonomy.<br />
Eighth edition, National Resource Conservation<br />
Centre, USDA, Blacksburg, Virginia.<br />
Walkley, A and Black, I.A. 1934. An examination of<br />
the Dogiareff method for determination of soil<br />
organic matter and a proposed modification of<br />
the chromic acid situation method. Soil<br />
Science. 37: 29-33.<br />
58
J.Res. ANGRAU 41(2) 59-67, 2013<br />
IDENTIFICATION OF SUPERIOR PARENTS AND CROSS COMBINATIONS BY<br />
USING LINE x TESTER ANALYSIS IN FINGER MILLET Eleusine coracana L.<br />
PARASHURAM PATROTI and JAYARAME GOWDA<br />
All India Coordinated Small Millets Improvement Project (AICSMIP),<br />
ICAR, University of Agricultural Sciences, GKVK, Bangalore-560 065<br />
Date of Receipt : 07.03.2013 Date of Acceptance : 18.04.2013<br />
ABSTRACT<br />
Field experiment was conducted at Zonal Agricultural Research Station, University of Agricultural Sciences,<br />
Gandhi Krishi Vignana Kendra, Bengaluru during 2009-10. The experimental material consisted of four lines viz.,<br />
GE 4596, GE 6216, GE 4906 and GPU 28 and four testers viz., L 5, GE 5095, GPU 69 and GPU 48. The crosses were<br />
affected in a Line x Tester fashion. The results revealed that among the lines GE 4596 and GPU 28 and among the<br />
testers L 5 and GPU 69 had recorded high per se and gca for yield and most of the yield contributing characters.<br />
Among the hybrid combinations GE 4596 x L 5 and GE 4596 x GPU 69 had significant and superior per se performance<br />
for grain yield per plant, straw yield per plant, finger length, peduncle length, number of fingers per ear, culm<br />
thickness and number of productive tillers per plant. Results from specific combining ability study, revealed that the<br />
crosses viz., GE 4596 x L 5, GE 6216 x GPU 48 and GE 4906 x GPU 48 had significant sca effects for most of the<br />
characters. The hybrids, GE 4596 x L 5, GE 4596 x GPU 69 and GPU 28 x L 5 were from parents with high x high gca<br />
and GE 4596 x GE 5095, GE 6216 x GPU 69, GE 4906 x GPU 69 and GPU 28 x GE 5095 were from parents with high<br />
x low gca combinations. Thus, six crosses are suggested for realization of transgressive segregants in F 2<br />
and<br />
subsequent generations.<br />
Finger millet Eleusine coracana L. Gaertn.<br />
also known as Ragi or African millet is an annual<br />
plant widely grown as an important food crop in the<br />
arid areas of Africa and South Asia. It ranks third in<br />
importance among the millets after sorghum and pearl<br />
millet in India. Finger millet ranks first both in area<br />
and production among the ‘Nutricereals’ occupying<br />
2.00 m.ha with a production of 2.6 million tons in<br />
India with the highest productivity of 3600 Kg/ha in<br />
the state of Karnataka (AICSMIP, 2005). Finger millet<br />
provides staple food for a large section of farming<br />
community and economically weaker sections in<br />
many parts of India. Its nature of low input requirement<br />
in terms of labour, technology, costs and high drought<br />
resistance and long storage life makes it a pro-poor<br />
and marginal farmers’ crop.<br />
The newly evolved varieties are not showing<br />
much yield advantage over the varieties bred and<br />
released in earlier years. The efforts made by<br />
Ravikumar et al. (1986) and Gurunathan (2006) in<br />
finger millet, Srivatsav and Yadav (1977) in little millet,<br />
Konstantinov and Linnik (1985) and Ramesh (1990)<br />
in proso millet opens the way and scope to identify<br />
superior parents and crosses to isolate desired<br />
purelines for yield and other traits. Combining ability<br />
analysis is usually employed to identify the desirable<br />
parents and to study the nature of genetic variation.<br />
Keeping this in view in the present investigation an<br />
effort was made to hybridize the plants with different<br />
geographical origins in order to assess the combining<br />
ability for yield and its attributing traits.<br />
MATERIALS AND METHODS<br />
A field experiment was conducted during<br />
kharif and rabi 2009-10 seasons at Zonal Agricultural<br />
Research Station, University of Agricultural Sciences,<br />
Gandhi Krishi Vignana Kendra, Bengaluru. The<br />
experimental material consisted of eight finger millet<br />
genotypes chosen from the working collection of<br />
germplasm maintained at the Project Co-ordinating<br />
Unit (Small millets), Bengaluru. Among the eight<br />
genotypes four were selected as lines with purple<br />
colour pigmentation at node, leaf juncture and glumes.<br />
The rest four were selected as testers which are devoid<br />
of purple pigmentation. The purple pigmentation is a<br />
dominant character and a useful genetic marker in<br />
identifying true crosses at the seedling stage.<br />
Four lines were crossed to four testers in a<br />
line x tester mating design (Kempthorne, 1957) in<br />
kharif-2009, to generate hybrids by following hot water<br />
treatment (Rao and Rao, 1962) for emasculation then<br />
contact method for crossing (Ayyangar and Warrior,<br />
email: parashu.patroti@rediffmail.com<br />
59
PARASHURAM and JAYARAME<br />
1934). Crossed seeds along with their parents were<br />
sown in nursery during rabi-2009. The hybrids were<br />
first identified in the nursery using purple plant<br />
pigmentation as marker. All the eight parents (4 lines<br />
and 4 testers) together with sixteen crosses were<br />
evaluated during rabi-2009. The material was grown<br />
in a single row of 3 m length with a spacing of 30 x<br />
10 cm in a randomized block design and replicated<br />
twice. The data were recorded on plant height, number<br />
of fingers per ear, number of productive tillers per<br />
plant, finger length, finger width, culm width, peduncle<br />
length, days to 50 per cent flowering, days to<br />
maturity, straw yield per plant, grain yield per plant<br />
and test weight on five randomly selected plants.<br />
The analysis of Randomised Block Design was<br />
carried out based on the methods described by<br />
Panse and Sukhatme (1967). The combining ability<br />
analysis was done according to Kempthorne (1957).<br />
RESULTS AND DISCUSSION<br />
The analysis of variance revealed significant<br />
differences among the parents as well as crosses<br />
for all the traits. Higher level of significance in the<br />
variance of parents vs hybrids for all the characters<br />
clearly indicated the existence of significant level of<br />
specific combining ability in the hybrids. Analysis of<br />
variance for combining ability reveals that the mean<br />
squares due to testers showed significant differences<br />
for plant height, peduncle length, straw yield per plant<br />
and grain yield per plant (Table 1),which indicates<br />
that there was a good level of genetic difference<br />
brought out by the testers. The variance due to line x<br />
tester interaction was significant for all the characters<br />
studied (Table 1). Non additive gene action was<br />
noticed for all the characters studied. These results<br />
supports the findings of Tamilcovane and Jayaraman<br />
(1994) and Ravikumar et al. (1986) in finger millet<br />
and Ramesh (1990) in proso millet.<br />
The combining ability studies of the parents<br />
had brought out the parents with high gca for different<br />
traits. The line GE 4596 showed high gca for plant<br />
height, number of fingers per ear, number of<br />
productive tillers per plant, finger length, days to<br />
maturity, straw yield per plant and grain yield per<br />
plant. The line, GPU 28 showed high gca for finger<br />
length, finger width, culm width, peduncle length and<br />
days to 50 per cent flowering. The tester, L 5 was<br />
identified for high gca effects for straw yield and grain<br />
yield. The tester, GPU 69 showed high gca effects<br />
for plant height, number of fingers per ear, finger<br />
length, culm width, days to maturity, straw yield per<br />
plant and grain yield per plant (Table 3).<br />
Considering the overall assessment of yield<br />
components for high gca and per se performance, a<br />
close correspondence between mean performance<br />
and gca effect was observed among parents. The<br />
lines, GE 4596 and GPU 28 and the testers, L 5 and<br />
GPU 69 had recorded high per se and gca for most<br />
of the yield contributing characters studied (Table<br />
2). These parents might be utilized in the hybridization<br />
programme for selecting superior recombinants.<br />
Tamilcovane and Jayaraman (1994) and Ravikumar<br />
(1986) also identified this kind of good general<br />
combiners in finger millet.<br />
Specific combining ability is the deviation<br />
from the performance predicted under general<br />
combining ability. The sca was due to non-additive<br />
genetic interactions. The hybrid, GE 4596 x L 5<br />
possessed high sca effect for plant height, number<br />
of tillers per plant, finger length, peduncle length, straw<br />
yield per plant, grain yield per plant and 1000 grain<br />
weight. The hybrid, GE 4906 x GPU 48 exhibited<br />
high sca effect for plant height, number of fingers<br />
per ear, finger length, finger width, culm width, grain<br />
yield per plant and 1000 grain weight (Table 4).<br />
Combination of favorable genes from the parents for<br />
the corresponding traits might have resulted in high<br />
sca effects. In the present study, hybrids were<br />
identified with significant and high sca effects for<br />
different characters. Many of these hybrids were from<br />
either one of the parents with high gca or parents<br />
with low x low general combiners. Hence it forms the<br />
evidence that the parents with high or low gca will<br />
have greater probability to have good<br />
complementarily with other parents. Similar results<br />
were obtained by Konstantinov and linnik (1985) and<br />
Ramesh (1990) in proso millet.<br />
For exploiting hybrid vigor, the components<br />
like per se performance and sca effects are important.<br />
Selection based on any of these criteria alone may<br />
not be effective. So selection must be based on all<br />
these parameters. In the present study, the hybrids<br />
were also evaluated on the basis of above said<br />
parameters. Among the 16 hybrids studied GE 4596<br />
x L 5 and GE 4596 x GPU 69 were identified as the<br />
60
IDENTIFICATION OF SUPERIOR PARENTS AND CROSS COMBINATIONS<br />
Table 1. Analysis of variance for line x tester design with respect to yield and yield attributes in finger millet<br />
* and ** : Significant at 5 and 1 per cent level, respectively<br />
Where,<br />
PH : Plant height (cm) PL : Peduncle length (cm) NFE : Number of fingers/ear<br />
DFL : Days to 50% flowering NPT : Number of tillers/plant DMT : Days to maturity<br />
FL : Finger length (cm) SY : Straw yield (g) FW : Finger width (cm)<br />
GY : Grain yield/ plant (g) CW : Culm width (cm) TW : Test weight/plant (g)<br />
61
PARASHURAM and JAYARAME<br />
Table 2. Mean performance of Parents and Crosses for twelve characters in finger millet<br />
62
IDENTIFICATION OF SUPERIOR PARENTS AND CROSS COMBINATIONS<br />
Table 2. ( contd….)<br />
63
PARASHURAM and JAYARAME<br />
Table 3. General combining ability effects of parents for yield and yield contributing characters in finger millet<br />
64
IDENTIFICATION OF SUPERIOR PARENTS AND CROSS COMBINATIONS<br />
Table 4. Specific combining ability effects of crosses for yield and yield attributes<br />
65
PARASHURAM and JAYARAME<br />
Table 5. Proportional contribution of lines, testers and interaction of line x tester for various yield<br />
and yield contributing characters in Finger millet<br />
Characters<br />
Contribution of<br />
females (%)<br />
Contribution of<br />
males (%)<br />
Contribution of<br />
females (%) X<br />
male (%)<br />
Plant height 71.28 7.76 20.96<br />
Number of fingers per ear 78.96 6.75 14.29<br />
Number of productive tillers per plant 27.19 12.59 60.21<br />
Finger length 57.48 14.42 28.1<br />
Finger width 15.72 10.69 73.58<br />
Culm width 32.64 14.75 52.61<br />
Peduncle length 71.38 3.69 24.92<br />
Days to 50% flowering 30.93 20.6 48.48<br />
Days to maturity 59.04 22.5 18.46<br />
Straw yield per plant 54.48 19.35 26.17<br />
Yield per plant 64.17 13.58 22.25<br />
1000 seed weight 48.71 5.29 46.01<br />
Table 6. Estimates of variance components for yield and yield contributing characters in finger millet<br />
Characters 2 gca 2 sca 2 gca/ 2 sca<br />
Plant height 4.80 24.47 0.20 : 1<br />
Number of fingers per ear 0.06 0.11 0.53 : 1<br />
Number of productive tillers per plant 0.00 0.09 0.00: 1<br />
Finger length 0.04 0.29 0.12 : 1<br />
Finger width -0.00 0.01 -0.03 : 1<br />
Culm width 0.00 0.00 0.02 : 1<br />
Peduncle length 1.60 10.52 0.15 : 1<br />
Days to 50% flowering 0.03 0.86 0.04 : 1<br />
Days to maturity 0.17 0.20 0.84 : 1<br />
Straw yield per plant 7.67 55.82 0.14 : 1<br />
Yield per plant 2.68 14.65 0.18 : 1<br />
1000 seed weight 0.00 0.03 0.03 : 1<br />
best crosses since they possessed desirable per se<br />
performance and sca for plant height, number of<br />
productive tillers per plant, straw yield per plant and<br />
grain yield per plant (Table 4).<br />
For all the 12 characters studied, the<br />
contributions of females were considerably more<br />
compared to males to the variance for all the<br />
characters (Table 5). With respect to estimates of<br />
variance components, the variance due to specific<br />
combining ability effects was more for all the traits<br />
than variance due to general combining ability effects<br />
but none of the characters were exceeded unity<br />
66
IDENTIFICATION OF SUPERIOR PARENTS AND CROSS COMBINATIONS<br />
indicating the predominance of non additive gene<br />
action (Table 6). From this study, it can be concluded<br />
that the non additive gene action favouring<br />
hybridization to some extent and the crosses, GE<br />
4596 x L 5 and GE 4596 x GPU 69 are the best<br />
crosses for grain yield and most of the yield<br />
contributing characters.<br />
REFERENCES<br />
All India Coordinated Small Millets Improvement<br />
Project, Annual Report 2005. ICAR, Bangalore.<br />
pp.24-35.<br />
Ayyangar, G. N. R and Wariar, U. A. 1934. Anthesis<br />
and pollination in ragi, Eleusine coracana<br />
Gaertn., the finger millet; Indian Journal of<br />
Agricultural Sciences. 4: 386- 393.<br />
Gurunathan. 2006. Line x tester analysis in forage<br />
sorghum, Introduction to sorghum and millets,<br />
Millets News letter 35: 79-80.<br />
Kempthorne, O. 1957. An introduction to genetic<br />
statistics. John Wiley and Sons, New York,<br />
USA. pp. 245-285.<br />
Konstantinov, S.I and Linnik, V.M. 1985. Utilizing<br />
heterosis in proso millet breeding, Selekt, i.<br />
Semen. USSR., 2: 15-17.<br />
Panse, V.G and Sukhatme. 1967. Statistical methods<br />
for agricultural workers, ICAR, New Delhi, pp.<br />
140- 145.<br />
Rama Rao, V and Rama Rao, K. V. 1962.<br />
Emasculation of ragi flowers (Eluesine.<br />
coracana) by hot water treatment for<br />
hybridization work. The Andhra Agricultural<br />
Journal. 9: 290-292.<br />
Ramesh, S. 1990. Studies on heterosis and genetics<br />
of qualitative characters in proso millet<br />
(Panicum milliaceum L.). M.Sc. (Agri) Thesis<br />
submitted to University of Agricultural<br />
Sciences, Bangalore, India.<br />
Ravikumar, R.L., Shankare Gowda, B.T and<br />
Seetharam, A. 1986. Studies on heterosis in<br />
finger millet. Millets Newsletter, 5: 26-27.<br />
Srivastava, D.P and Yadav, A. 1977. Heterosis in<br />
Panicum miliare lam. Curr. Res., 6(4): 66-67.<br />
Tamilcovane, S and Jayaraman, N. 1994. Association<br />
between yield components in ragi. Journal of<br />
Phytological Research, 7(2):193-194.<br />
67
J.Res. ANGRAU 41(2) 68-73, 2013<br />
EFFECT OF FRONT LINE DEMONSTRATIONS AND TRAININGS ON KNOWLEDGE<br />
AND ADOPTION OF INTEGRATED PEST MANAGEMENT PRACTICES BY<br />
CHICKPEA FARMERS OF PRAKASAM DISTRICT OF ANDHRA PRADESH<br />
O. SARADA and G. V. SUNEEL KUMAR<br />
Krishi Vigyan Kendra, Acharya N.G. Ranga Agricultural University, Darsi – 523 247<br />
Date of Receipt : 21.01.2013 Date of Acceptance : 05.03.2013<br />
ABSTRACT<br />
The study was conducted in Prakasam District of Andhra Pradesh during 2012. The investigation included<br />
50 chickpea farmers from two adopted villages of Krishi Vigyan Kendra who have participated in trainings and Front<br />
Line Demonstrations on Integrated Pest Management practices and 50 other chickpea farmers who have not<br />
undergone trainings and FLDs on IPM from a non-adopted village. More than fifty per cent of beneficiary chickpea<br />
farmers had medium level of knowledge and adoption with respect to Integrated Pest Management practices,<br />
followed by 32.00 and 36.00 per cent of beneficiary farmers under high category respectively. Whereas 40.00 and<br />
48.00 per cent of the non-beneficiary farmers were in low knowledge and adoption categories, respectively. A large<br />
majority of beneficiary chickpea farmers were fully adopting summer ploughing (100.00%), need based plant<br />
protection measures (86.00%), growing of trap crop (78.00%), disease resistant cultivars (62.00%), seed treatment<br />
(56.00%) and partially adopting spraying of neem formulations and erecting bird perches. The major constraints<br />
faced by beneficiary farmers in adoption of recommended Integrated Pest Management practices of chickpea are<br />
non-availability of disease resistant cultivars (98.00%), inputs like bacterial pesticides, pheromone traps (94.00%)<br />
and complex and labor intensive practices of neem seed kernel extract and poison bait preparation (72.00%) etc.<br />
Chickpea is the third most important grain<br />
legume that accounts for nearly 40 per cent of the<br />
total pulse production in India. In India, it is grown in<br />
5.65 mha producing 4.15 m. ton annually with<br />
productivity of 740 Kg ha -1 . In Andhra Pradesh, it is<br />
grown in an area of 5.29 lakh ha with annual<br />
production of 6.28 lakh tons and productivity of 842<br />
Kg ha -1 (Ministry of Agriculture, 2009). Prakasam<br />
district of Andhra Pradesh has highest acreage (0.95<br />
lakh ha.) under chick pea and is rapidly increasing<br />
for the last three or four years by replacing tobacco<br />
and other commercial crops in view of their eroding<br />
profitability when compared to chick pea. In order to<br />
get highest yields from the crop, farmers are using<br />
chemical inputs indiscriminately which has led to pest<br />
resistance and environmental pollution.<br />
The use of pesticides that are used by farmers<br />
to improve production and productivity are beset with<br />
conflicting interests between the farmers on one hand<br />
and society on the other. Even though social<br />
considerations would warrant the use of target<br />
specific pesticides which degrade expeditiously in<br />
the environment, the farmers use those pesticides<br />
that are easily available, cheap and simple to use.<br />
In this context, Front Line Demonstrations<br />
(FLDs) and trainings on recommended Integrated Pest<br />
Management (IPM) practices in chickpea were being<br />
implemented by Krishi Vigyan Kendra (KVK), Darsi<br />
in its adopted villages of Prakasam district for three<br />
years from 2009 to 2011 with the twin objectives of<br />
minimizing environmental pollution and maximizing<br />
the cost benefit ratio. With this background in view,<br />
to know the effect of FLDs and trainings on knowledge<br />
and adoption levels of farmers, this particular study<br />
was taken up with the following specific objectives.<br />
To assess the overall knowledge and adoption<br />
levels of beneficiary and non-beneficiary chickpea<br />
farmers with respect to recommended IPM practices<br />
in chickpea.<br />
To assess the component wise knowledge and<br />
adoption levels of beneficiary and non-beneficiary<br />
chickpea farmers with respect to recommended IPM<br />
practices in chickpea.<br />
email: saradasuneel@gmail.com<br />
68
EFFECT OF FRONT LINE DEMONSTRATIONS AND TRAININGS ON KNOWLEDGE<br />
To elicit constraints of beneficiary farmers in<br />
adoption of recommended IPM practices in chickpea.<br />
MATERIALS AND METHODS<br />
The present study was conducted in<br />
Prakasam district of Andhra Pradesh during 2012.<br />
Two adopted villages viz., Chinarikatla and<br />
Pedarikatla of Konakanmitla mandal were purposively<br />
selected for the study where FLDs and trainings on<br />
IPM practices in chickpea were organized for three<br />
consecutive years 2009-10, 2010-11 and 2011-12 by<br />
KVK, Darsi. From each of the selected adopted<br />
village, 25 beneficiary chickpea farmers who regularly<br />
attended trainings, practically involved in FLDs and<br />
visited IPM demonstration plots were selected. Thus<br />
a total of 50 respondents were purposively selected<br />
for the study. For comparison, another 50 nonbeneficiary<br />
chickpea farmers who were not exposed<br />
to FLD’s and trainings were selected from a nonadopted<br />
village, Laxminagar of Darsi mandal. A total<br />
of 100 (50 beneficiary and 50 non-beneficiary)<br />
chickpea farmers constituted the sample size.<br />
To measure the knowledge and adoption of<br />
IPM practices by chickpea farmers recommended<br />
IPM practices, a schedule comprising of ten<br />
components demonstrated by KVK was developed<br />
and administered to respondents. The data on<br />
knowledge and adoption levels of beneficiary and nonbeneficiary<br />
chickpea farmers was collected by using<br />
pre tested schedule employing personal interview<br />
method. The responses were scored, quantified,<br />
categorized and tabulated using mean, standard<br />
deviation, frequencies and per centage. Each<br />
beneficiary chickpea farmer was also interviewed by<br />
posing open ended questions so as to unearth<br />
constraints he/she has experienced. Based on<br />
frequency and percentage; the major constraints in<br />
adoption of recommended IPM practices were<br />
prioritized.<br />
RESULTS AND DISCUSSIONS<br />
Perusal of table 1 on overall knowledge level<br />
of chickpea farmers on IPM practices gained through<br />
demonstrations and trainings of KVK revealed that<br />
54.00 per cent, 32.00 per cent and 14.00 per cent of<br />
beneficiary farmers are in medium, high and low<br />
categories of knowledge respectively. Whereas, 48.00<br />
per cent of the non-beneficiary chickpea farmers were<br />
with medium knowledge followed by 40.00 and 12.00<br />
per cent with low and high knowledge levels,<br />
respectively (Table 1). This clearly indicated that there<br />
was a significant increase in the knowledge level of<br />
beneficiary farmers with respect to IPM practices of<br />
chickpea from which it can be inferred that when<br />
efforts are made through trainings and FLDs, it is<br />
possible to increase the knowledge level of farmers.<br />
The findings of Vijaya (1995), Yavana Priya et. al.,<br />
(2010) and Sarada and Suneel Kumar (2011) on<br />
various subjects can be quoted to support the present<br />
results.<br />
The results in Table 2 on the practice wise<br />
knowledge level of beneficiary and non-beneficiary<br />
chickpea farmers regarding the technological impact<br />
of FLDs and trainings on specific IPM practices<br />
revealed that cent per cent of the beneficiary farmers<br />
had correct knowledge about deep summer ploughing<br />
as the best IPM practice in reducing the pest load in<br />
chickpea. Also, 92.00 per cent of the beneficiary<br />
farmers had knowledge on need based plant<br />
protection operations. Majority of beneficiary farmers<br />
had knowledge on practices such as sowing of<br />
marigold as trap crop to attract Helicoverpa for egg<br />
laying (88.00%), treating the seeds with a fungicide<br />
before sowing to protect the crop from soil fungal<br />
pathogens (84.00%) and erecting bird perches in the<br />
field to harbor the predatory birds (72.00 %). It was<br />
interesting to note that more than fifty per cent of the<br />
beneficiary farmers had correct knowledge on use of<br />
wilt disease resistant/tolerant varieties (64.00%),<br />
spraying of 5% NSKE or commercially available neem<br />
formulations immediately after noticing egg or early<br />
larval instars of defoliating caterpillars on the crop<br />
(54.00%), application of poisoned bait to protect the<br />
crop defoliation from Spodoptera (52.00%). Less than<br />
fifty per cent of beneficiary respondents had<br />
knowledge with respect to Helicoverpa and<br />
Spodoptera adult population monitoring through<br />
pheromone traps (48.00%) and use of bacterial (Bt)<br />
formulations against the Helicoverpa larval instars<br />
(46.00%). The reason is that these are new practices<br />
which are not practiced from the past and are not<br />
traditional to farmers, hence farmers gained<br />
comparatively less knowledge on these practices.<br />
In case of majority of non-beneficiary<br />
farmers, the knowledge with respect to IPM practices<br />
of chickpea was incorrect for practices such as<br />
spraying of Bt formulations and use of poison baits<br />
(100.00%), need based spraying of plant protection<br />
chemicals (96.00%), seed treatment (94.00%), adult<br />
69
SARADA and SUNEEL KUMAR<br />
population monitoring through pheromone traps<br />
(92.00%), erecting bird perches and use of wilt<br />
disease resistant/tolerant varieties (86.00%),<br />
spraying of 5% NSKE or neem formulations at initial<br />
stages (82.00%) and sowing of marigold as trap crop<br />
for Helicoverpa (64.00%), while the correct response<br />
about deep ploughing during summer was given by<br />
88.00 per cent of respondents.<br />
Results in Table 3 on overall adoption of<br />
chickpea IPM practices by beneficiary and nonbeneficiary<br />
farmers reveals that 36.00 per cent of<br />
the beneficiary chickpea farmers were in high<br />
adoption category as against only 8.00 per cent of<br />
non-beneficiary farmers. Further, 52.00 per cent of<br />
beneficiary farmers and 44.00 per cent of nonbeneficiary<br />
farmers belonged to medium adoption<br />
category in adopting IPM practices of chickpea at<br />
farm level. However, only 12.00 per cent of beneficiary<br />
farmers and 48 per cent of non beneficiary farmers<br />
were found in low category in adopting IPM practices<br />
respectively. This pointed out that the trainings and<br />
FLDs have influenced the beneficiary chickpea<br />
farmers as these efforts have increased the<br />
knowledge levels of beneficiary farmers which in turn<br />
positively influenced their adoption levels. These<br />
findings are in agreement with the results reported<br />
by Naresh (1996) on knowledge and adoption of<br />
improved sericulture practices.<br />
Component wise adoption pattern of specific<br />
IPM practices by chickpea farmers revealed that good<br />
per centage of beneficiary farmers were fully adopting<br />
IPM practices of chickpea (Table 4). Cent per cent<br />
of the beneficiary farmers were practicing deep<br />
ploughing during summer months (100.00%), need<br />
based plant protection measures against defoliators<br />
and pod borers (86.00%), sowing of marigold to attract<br />
the adults of Helicoverpa for egg laying and thereafter<br />
grownup larvae to feed on trap crop (78.00%), growing<br />
of Fusarium wilt disease resistant/tolerant varieties<br />
(62.00%) and treating the seeds with a fungicide for<br />
protection against wilt and root rot diseases (56.00%).<br />
The full adoption response by beneficiary farmers on<br />
the use of poison bait to attract and kill grownup<br />
larvae of Spodoptera was 38.00 per cent only. The<br />
information given during trainings and demonstrations<br />
about these practices might have promoted the<br />
beneficiary farmers to acquire knowledge and adopt.<br />
Further, 64.00 per cent of beneficiary farmers were<br />
partially adopting spraying of 5% NSKE or<br />
commercially available neem formulations at initial<br />
70<br />
stages followed by erecting bird perches in the field<br />
to harbor the predatory birds (56.00%). Thus, IPM<br />
practices which are easy, simple, practicable and<br />
profitable at farm level are adopted by beneficiary<br />
farmers after getting exposed to FLDs and trainings<br />
during the crop season. Also, the technical guidance<br />
was made available to the beneficiary farmers to take<br />
up timely IPM practices in chickpea. Whereas, great<br />
majority of them were not adopting practices which<br />
are complex and not available locally spraying of Bt<br />
formulations (80.00%) and monitoring of adult<br />
population using pheromone traps with lures<br />
(48.00%). Majority of the farmers opined that the<br />
reason behind this non adoption of trained and<br />
demonstrated IPM practices were non-availability of<br />
key inputs locally.<br />
With respect to non-beneficiary farmers,<br />
great majority of them were not adopting the principal<br />
IPM components such as use of Bt formulations,<br />
poison baits (100.00%), seed treatment (96.00%),<br />
pheromone traps (94.00%), neem formulations<br />
(82.00%), bird perches (72.00%) and disease<br />
resistant/tolerant varieties (64.00%). It is noteworthy<br />
to found that 68.00 per cent of non-beneficiary farmers<br />
were fully adopting summer ploughing and practices<br />
such as sowing of trap crop (40.00%) and need based<br />
plant protection operations (34.00%) were partially<br />
adopted by non-beneficiary farmers in chickpea. The<br />
reasons could be, these are age old, traditional<br />
practices followed from fore fathers. Hence though<br />
non beneficiary farmers are not exposed to IPM<br />
demonstrations and trainings, adoption is seen.<br />
Hence, if the farmers are better exposed to IPM<br />
technology through with trainings, field visits, skill<br />
demonstrations and FLDs, with the observation and<br />
analysis of each of the IPM components in chickpea,<br />
it is possible to increase their knowledge levels and<br />
in turn their adoption levels. These extension<br />
methods create an environment in which all the<br />
powerful senses are involved and also the individual<br />
will be given an opportunity to discuss in group and<br />
gain the confidence on IPM practices.<br />
The constraints in adoption as expressed by<br />
the beneficiary farmers while adopting the IPM<br />
practices in chickpea are presented in Table 5. Nearly<br />
cent per cent of the beneficiary farmers expressed<br />
constraints in getting quality seed of disease<br />
resistant/tolerant varieties (98.00%), Bt formulations<br />
and pheromone traps with lures (94.00%). Complexity<br />
in preparing NSKE at farm level (72.00%), labor
EFFECT OF FRONT LINE DEMONSTRATIONS AND TRAININGS ON KNOWLEDGE<br />
intensive practice of preparing poison bait and<br />
application in large area (64.00%), high cost of<br />
pesticides (52.00%) and difficulty in remembering<br />
pesticide dosage calculations (50.00%) were the other<br />
major constraints expressed by beneficiary farmers.<br />
It is logical to derive from the above findings and<br />
discussion that the IPM practices in chickpea which<br />
were disseminated through trainings and FLDs of<br />
Table 1. Categorization of chickpea farmers according to their overall knowledge scores on selected<br />
IPM practices of chickpea crop<br />
S.<br />
No.<br />
Category Beneficiary farmers n=50 Non-beneficiary farmers n=50<br />
Frequency % Frequency %<br />
1 Low 7 14.00 20 40.00<br />
2 Medium 27 54.00 24 48.00<br />
3 High 16 32.00 6 12.00<br />
Total 50 100.00 50 100.00<br />
Table 2. Response analysis of knowledge of chickpea farmers on selected IPM practices<br />
S.<br />
IPM practices Beneficiary farmers N=50 Non- beneficiary farmers N=50<br />
No recommended<br />
CK ICK CK ICK<br />
Frq % Frq % Frq % Frq %<br />
1 Deep summer ploughing 50 100.00 0 0.00 44 88.00 6 12.00<br />
2 Use of wilt disease<br />
32 64.00 18 36.00 7 14.00 43 86.00<br />
resistant/tolerant varieties<br />
3 Seed treatment with<br />
42 84.00 8 16.00 3 6.00 47 94.00<br />
carbendazim/thiaram<br />
4 Sowing of marigold as trap 44 88.00 6 12.00 18 36.00 32 64.00<br />
crop for Helicoverpa<br />
5 Helicoverpa and Spodoptera 24 48.00 26 52.00 4 8.00 46 92.00<br />
adult population monitoring<br />
through pheromone traps<br />
6 Erection of bird perches 36 72.00 14 28.00 7 14.00 43 86.00<br />
20/acre<br />
7 Spraying of 5%NSKE or 27 54.00 23 46.00 9 18.00 41 82.00<br />
neem formulations after<br />
observing egg and early<br />
larval stages of lepidopteran<br />
caterpillars<br />
8 Spraying of 400 gm of 23 46.00 27 54.00 0 0.00 50 100.00<br />
bacterial formulation (Bt) in<br />
200 lts of water twice with<br />
one week interval<br />
9 Use of poison baits for grown 26 52.00 24 48.00 0 0.00 50 100.00<br />
up larvae of Spodoptera<br />
10 Need based spraying of<br />
Acephate 1gm / quinalphos<br />
2.0 ml/ chloripyriphos 2.5 ml/<br />
diflubenzuron 1.0 ml /<br />
Thiodicarb 1.0gm/ lt. water<br />
twice or thrice<br />
46 92.00 4 8.00 2 4.00 48 96.00<br />
CK - Correct Knowledge ICK - Incorrect Knowledge Frq - Frequency<br />
71
SARADA and SUNEEL KUMAR<br />
Table 3. Overall adoption scores of chickpea farmers on selected IPM practices<br />
S. Category Beneficiary farmers n=50 Non-beneficiary farmers n=50<br />
No.<br />
Freq % Freq %<br />
1 Low 6 12.00 24 48.00<br />
2 Medium 26 52.00 22 44.00<br />
3 High 18 36.00 4 8.00<br />
Total 50 100.00 50 100.00<br />
Table 4. Response analysis of adoption of chickpea farmers on selected IPM practices<br />
S.<br />
N<br />
o.<br />
IPM practices<br />
recommended<br />
1 Deep summer<br />
ploughing<br />
2 Use of wilt<br />
disease<br />
resistant/tolera<br />
nt varieties<br />
3 Seed treatment<br />
with<br />
carbendazim/th<br />
iaram<br />
4 Sowing of<br />
marigold as<br />
trap crop for<br />
Helicoverpa<br />
5 Helicoverpa<br />
and<br />
Spodoptera<br />
adult<br />
population<br />
monitoring<br />
through<br />
pheromone<br />
traps<br />
6 Erection of bird<br />
perches<br />
20/acre<br />
7 Spraying of<br />
5%NSKE or<br />
neem<br />
formulations<br />
after observing<br />
egg and early<br />
larval stages of<br />
lepidopteran<br />
caterpillars<br />
8 Spraying of<br />
400 gm of<br />
bacterial<br />
formulation (Bt)<br />
in 200 lts of<br />
water twice<br />
with one week<br />
interval<br />
Beneficiary farmers N=50 Non-beneficiary farmers N=50<br />
FA PA NA FA PA NA<br />
Frq % Frq % Frq % Frq % Frq % Frq %<br />
50 100 0 - 0 0 34 68 0 - 16 32<br />
31 62 0 - 19 38 18 36 0 - 32 64<br />
28 56 14 28 8 16 0 - 2 4 48 96<br />
39 78 10 20 1 2 6 12 20 40 23 46<br />
8 16 18 36 24 48 0 - 3 6 47 94<br />
19 38 28 56 3 6. 3 6 11 22 36 72<br />
14 28 32 64 4 8. 2 4 7 14 41 82<br />
2 4 8 16 40 80 0 - 0 - 50 100.00<br />
72
EFFECT OF FRONT LINE DEMONSTRATIONS AND TRAININGS ON KNOWLEDGE<br />
S.<br />
N<br />
o.<br />
IPM practices<br />
recommended<br />
9 Use of poison<br />
baits for grown<br />
up larvae of<br />
Spodoptera<br />
10 Need based<br />
spraying of<br />
Acephate 1gm<br />
/ quinalphos<br />
2.0 ml/<br />
cloripyriphos<br />
2.5 ml/<br />
diflubenzuron<br />
1.0 ml /<br />
Thiodicarb<br />
1.0gm/ lt. water<br />
twice or thrice<br />
Beneficiary farmers (N=50)<br />
Non-beneficiary farmers (N=50)<br />
FA PA NA FA PA NA<br />
Frq % Frq % Frq % Frq % Frq % Frq %<br />
19 38 15 30 16 32 0 0 0 - 50 100<br />
43 86 7 14 0 - 7 14 17 34 26 52<br />
FA - Fully Adopted PA - Partially Adopted NA - Not adopted Frq - Frequency<br />
KVK were found to increase knowledge and<br />
adoption levels of farmers largely. Hence all KVK’s,<br />
NGO’s, DAATTC’s should intensify their efforts in<br />
popularizing IPM practices and take steps to stand<br />
by the farmer and solve all resource and other<br />
constraints faced at the time of application.This<br />
provides an ample scope for the improvement of<br />
knowledge and adoption among the farmers with<br />
respect to IPM practices in chickpea.<br />
Table 5. Constraints of beneficiary farmers in adoption of recommended IPM practices<br />
S. No. IPM technologies Number Per cent<br />
REFERENCES<br />
1 Non-availability of quality seed of disease resistant/tolerant<br />
varieties<br />
2 Non-availability of Bt bacterial formulations and pheromone<br />
traps with lures locally<br />
49 98.00<br />
47 94.00<br />
3 Complexity in preparing NSKE 36 72.00<br />
4 labor intensive practice of preparing poison bait and<br />
application for large holdings<br />
32 64.00<br />
5 Difficulty in remembering and calculating pesticide dosages 25 50.00<br />
6 High cost of pesticides 26 52.00<br />
Naresh, N. T. 1996. A study on knowledge and<br />
adoption of improved sericulture practices<br />
among trained women in Bangalore rural<br />
district. M. Sc (Agri.) Thesis submitted to<br />
University of Agricultural Sciences, Bangalore<br />
Sarada, O and Suneel Kumar, G. V. 2011. Impact of<br />
Front line demonstrations and trainings on<br />
knowledge levels of brinjal growers with<br />
respect to IPM practices. The Andhra<br />
Agricultural Journal. 58 (4): 545-549<br />
Vijaya, B. V. 1995. Impact of WYTEP training on<br />
farm women in Bangalore district. M. Sc (Agri.)<br />
Thesis submitted to University of Agricultural<br />
Sciences, Bangalore.<br />
Yavana Priya, D., Eswarappa, G and Manjunatha,<br />
B. N. 2010. Knowledge level of farm women<br />
participants of farmer field schools on tomato<br />
cultivation. Mysore Journal of Agricultural<br />
Sciences. 44 (4): 847-851<br />
73
J.Res. ANGRAU 41(2) 74-77, 2013<br />
EFFECT OF FEEDING COMPLETE FEED CONTAINING POULTRY LITTER ON<br />
RUMEN NITROGEN AND TOTAL VOLATILE FATTY ACIDS<br />
IN SHEEP AND GOAT<br />
J. NARASIMHA, V.CHINNI PREETHAM and S.T.VIROJI RAO<br />
All India Co-ordinated Research Project on poultry breeding, College of Veterinary Science,<br />
Sri Venkateswara Veterinary University, Hyderabad-500030<br />
Date of Receipt : 28.12.2012 Date of Acceptance : 22.02.2013<br />
ABSTRACT<br />
A complete feed containing poultry litter (35%) and other feed ingredients were formulated and processed<br />
in to mash. The feed was tested on six each of Nellore rams and indigenous bucks in digestion cum-metabolism trial.<br />
Rumen liquor samples were collected on two consecutive days at 0, 2, 4 and 6 hours of feeding. The H - ion and total<br />
volatile fatty acid concentrations were significantly (P>0.01) higher in sheep than in goats. Irrespective of species<br />
the concentration of total volatile fatty acid increased and attained peak values at 2 and 4 hours of post feeding, thus<br />
showing an inverse relationship of H - ion concentration. The concentration of total nitrogen, TCA insoluble nitrogen,<br />
food and protozoal nitrogen in strained rumen liquor was significantly higher in goats than in sheep. However,<br />
ammonia and residual nitrogen concentrations did not differ significantly between sheep and goats. Time of sampling<br />
had highly (P>0.01) significant effect on all the rumen parameters in both sheep and goats.<br />
INTRODUCTION<br />
The Poultry population in India is 489 million and the<br />
manure availability is estimated to be 12.1 million<br />
tons (Livestock census, 2003). Poultry waste is an<br />
important source of energy as well as un-conventional<br />
non protein nitrogen source for ruminants. In the<br />
present experiment an attempt was made to efficiently<br />
utilize poultry litter in complete feed of sheep and<br />
goats and to study its effect on rumen fermentation<br />
pattern.<br />
MATERIALS AND METHODS<br />
The layer poultry litter required for the present<br />
study was obtained in a single lot from AICRP on<br />
poultry breeding, Rajendra Nagar and was sun dried.<br />
Six each of healthy Nellore rams and indigenous<br />
bucks weighing 18.90±0.80 and 18.50±0.67<br />
respectively were fed complete feed containing<br />
poultry litter (35%), cotton seed hulls (40%), wheat<br />
bran (15%), molasses (8.5%), mineral mixture (1.0%)<br />
and salt (0.5%), Rovimix (vitamin supplement) 10 g<br />
per 100kg. of the ration. The complete feed thus<br />
prepared has protein and energy levels according to<br />
ICAR (1985) recommendations. The experimental<br />
feed was offered to each animal ad libitum (restricting<br />
refusals to 3.5%) in a digestion and metabolism<br />
experiment. The metabolism trial was conducted on<br />
all the twelve animals. After three weeks of<br />
adjustment period, the rumen liquor was collected<br />
from each animal four times, once before feeding (0<br />
hr) and at 2, 4 and 6 hours post feeding. The rumen<br />
liquor samples were analyzed in accordance with<br />
standard procedure for total nitrogen, TCA insoluble<br />
protein nitrogen Cline et al., (1958), residual nitrogen,<br />
food and protozoal nitrogen Singh et al.,<br />
(1986),ammonia nitrogen Schwartz and Schoeman<br />
(1964) and TVFA Bernett and Reid (1957)<br />
concentrations. Feed samples were analyzed for<br />
proximate principles and phosphorus (AOAC 2005)<br />
and calcium by the method of Talapatra et al., (1940).<br />
Statistical analysis of data was done as per the<br />
methods suggested by Nageshwer Rao ( 1983).<br />
RESULTS AND DISCUSSION<br />
The experimental ration and poultry litter were<br />
analyzed for proximate principles and the results are<br />
presented in Table 1. The mean concentrations of<br />
rumen metabolites as affected by species and time<br />
of sampling are shown in Table 2. In the present study<br />
pH was significantly (P>0.01) higher in sheep than in<br />
goats. Irrespective of the species, the concentration<br />
of total volatile fatty acid increased and attained peak<br />
values at 2 hours of post feeding. There is an inverse<br />
relationship of H - ion concentration and total volatile<br />
fatty acids and similar findings were reported by<br />
Venugopal et al., (1998). The concentration of total<br />
nitrogen (105.21), TCA insoluble nitrogen (38.64), food<br />
email: simha_vet@yahoo.com<br />
74
EFFECT OF FEEDING COMPLETE FEED CONTAINING POULTRY LITTER ON RUMEN NITROGEN<br />
and protozoal nitrogen (29.85) were significantly<br />
(P>0.01) higher in goats than in sheep, which<br />
indicated better digestibility of fiber in goats than<br />
sheep. Similar findings were reported by<br />
Shyamadayal et al., (1995) in goats. No significant<br />
(P>0.01) difference in rumen ammonia concentration<br />
was observed between sheep and goats. Time of<br />
sampling had significant (P>0.01) effect both in sheep<br />
and goats. The mean residual nitrogen and ammonia<br />
concentrations did not differ significantly between<br />
sheep and goats. The time of sampling had highly<br />
significant (P>0.01) effect on all the rumen<br />
parameters in both sheep and goats and attained peak<br />
levels at 2 hours of post feeding.<br />
Table 1. Proximate composition of experimental ration and poultry litter (%DM)<br />
Proximate principle Experimental ration (%) Poultry litter (%)<br />
Dry matter 91.25 93.45<br />
Organic matter 80.00 63.21<br />
Crude protein 12.18 15.70<br />
Ether extract 1.87 0.87<br />
Crude fibre 30.17 15.08<br />
Total ash 20.00 36.78<br />
Acid insoluble ash 6.19 12.39<br />
Nitrogen free extract 35.78 31.57<br />
Calcium 0.89 4.57<br />
Phosphorous 0.76 3.7<br />
Table 2. Rumen metabolic profile at different intervals in sheep and goats fed experimental ration<br />
Species<br />
Hours of collection<br />
0 2 4 6 Overall mean pH<br />
Sheep 6.87 6.54 6.85 6.95 6.80 a<br />
± SE 0.34<br />
Goat 6.69 6.39 6.65 6.83 6.64 b<br />
± SE 0.15<br />
Total Volatile Fatty Acids<br />
Sheep 11.08 17.19 14.39 12.39 13.74 a<br />
± SE 1.99<br />
Goat 10.39 15.65 11.02 8.41 11.67 b<br />
± SE 2.39<br />
Total Nitrogen (mg/100ml)<br />
Sheep 77.65 123.32 94.72 77.71 93.35 b<br />
± SE 13.93<br />
Goat 77.51 153.28 107.24 82.82 105.21 a<br />
± SE 23.01<br />
75
NARASIMHA et al<br />
TCA Insoluble Protein Nitrogen (mg/100ml)<br />
Sheep 27.02 38.19 31.48 27.73 31.10 a<br />
± SE 4.02<br />
Goat 27.37 51.06 43.48 32.67 38.64 b<br />
± SE 7.14<br />
Ammonia Nitrogen (mg/100ml)<br />
Sheep 3.33 11.84 8.50 5.08 7.19 a<br />
± SE 2.43<br />
Goat 3.51 11.80 8.52 4.35 7.04 a<br />
± SE 2.45<br />
Food and Protozoal Nitrogen (mg/100ml)<br />
Sheep 22.00 31.31 24.58 21.47 24.84 b<br />
± SE 3.49<br />
Goat 22.50 49.54 25.88 21.46 29.85 a<br />
± SE 8.88<br />
Residual Nitrogen (mg/100ml)<br />
Sheep 25.28 42.39 29.86 23.44 30.24 a<br />
± SE 6.25<br />
Goat 24.14 42.21 29.36 27.78 30.37 a<br />
± SE 7.31<br />
NB: Values bearing different superscripts differ significantly.<br />
REFERENCES<br />
AOAC., 2005. Official methods of analysis.<br />
Association of official analytical chemist.18 th<br />
Ed. Washington. DC. USA.<br />
Barnett, A. J. G. and Reid, R. L. 1957. Studies on<br />
the production of volatile fatty acids from grass<br />
by rumen liquor in an artificial rumen. The<br />
volatile fatty acid production from grass. J.<br />
Agric. Sci. Cam. 48, 315-321.<br />
Cline Jack, H. T. V. Hershberger and Orville G.<br />
Bentley. 1958. Utilization and/or Synthesis of<br />
Valeric Acid during the Digestion of Glucose,<br />
Starch and Cellulose by Rumen Micro-<br />
Organisms in vitro. Journal of Animal Science.<br />
17:284-292.<br />
ICAR. 1985. Nutrient requirement of livestock and<br />
poultry publications and information division<br />
Indian Council of Agricultural Research, New<br />
Delhi.<br />
Livestock census,2003. Department of animal<br />
husbandry, dairying and fisheries. Ministry of<br />
Agriculture, Government of India. http: //dahd/<br />
nic.in/census.htm.<br />
Nageswera Rao,G. 1983. Statistics for Agricultural<br />
sciences. Oxford and IBH Publishing<br />
company, New Delhi.<br />
Singh, B and Negi, S.S. 1986. Studies on the effect<br />
of supplementing extra energy to poultry litter<br />
76
EFFECT OF FEEDING COMPLETE FEED CONTAINING POULTRY LITTER ON RUMEN NITROGEN<br />
rations of sheep. Indian Journal of Animal<br />
Nutrition 3: 76-80.<br />
Shyamadayal, J., Sreedhar, C., Janardhan Reddy,<br />
T and Purushotham, N.P. 1995. Comparative<br />
nutritive evaluation of maize husk in Sheep<br />
and goats. Indian veterinary Journal 72:1045-<br />
1049.<br />
Schwartz, H.N and Schoeman, G.A. 1964. Utilization<br />
of urea by sheep. 1 Rates of breakdown of<br />
urea and carbohydrates in vivo and in vitro.<br />
Journal of Agricultural Sciences 63:289.<br />
.Talapatra, S.K.,Ray,S.C and Sen, K.C. 1940. The<br />
analysis of mineral constituents in biological<br />
materials. Indian Journal of Veterinary Science<br />
and A.H. 10:243.<br />
Venugopal Rao, D., Naidu, M.M and Raghavan G.V.<br />
1998. Effect of feeding complete feed<br />
containing Poultry droppings on rumen nitrogen<br />
and total volatile fatty acids in sheep and goats.<br />
Indian Veterinary Journal 75:662-664.<br />
77
J.Res. ANGRAU 41(2) 78-85, 2013<br />
EFFICACY OF CONTROLLED INTERNAL DRUG RELEASING (CIDR)<br />
DEVICE ON SYNCHRONIZATION OF ESTRUS AND FERTILITY IN EWES<br />
K. MURALI MOHAN, K. SADASIVA RAO and K.G. SOLMON RAJU<br />
Department of Veterinary Gynaecology and Obstetrics, College of Veterinary Science,<br />
Sri Venkateswara Veterinary University, Rajendranagar, Hyderabad – 5000 30<br />
Date of Receipt : 23.01.2013 Date of Acceptance : 28.03.2013<br />
ABSTRACT<br />
The present study was aimed to determine the efficacy of CIDR for synchronization of estrus in ewes. The<br />
ewes were synchronized with controlled internal drug releasing (CIDR) device containing 300 mg of progesterone.<br />
A total of 120 post partum, parous, healthy ewes aged about 2 to 5 years were divided into 5 groups and each group<br />
consists of 24 animals. Each group was further subdivided into 2 groups that consists of 12 animals and were<br />
studied during breeding and non breeding seasons. Group I ewes were considered as untreated control. Ewes in<br />
Group II were treated with CIDR and were left in place for 12 days followed by intramuscular injection of 400 IU of<br />
PMSG at the time of device removal. Ewes in Group III were treated with CIDR and 600 IU of PMSG was given<br />
intramuscularly at the time of removal of CIDR. Ewes in Group IV were treated as in Group II and additionally<br />
supplementation 200 IU of hCG injection at the time of mating. Ewes in Group V were treated as in Group III and<br />
additional injection of 200 IU of hCG at the time of mating. The percentage of ewes responded for synchronization<br />
of estrus was 50.00, 83.33, 100.00, 91.67 and 100.00 in breeding season. While during non breeding season, the<br />
same was 16.67, 83.33, 100.00, 83.33 and 100.00 per cent in Group I, II, III, IV and V, respectively. The time taken for<br />
induction of estrus was low in ewes treated with CIDR during breeding season when compared to that of non<br />
breeding season. The duration of estrus was ranged between 42.68±4.80 to 43.40±4.44 h in different treatment<br />
groups during breeding season. The pregnancy rate was 50.00, 70.00, 83.33, 72.72 and 91.67 per cent in ewes<br />
treated during breeding season and 50.00, 60.00, 75.00, 70.00 and 83.33 per cent during non breeding season in<br />
Group I, II, III, IV and V, respectively. Statistical analysis revealed that treatment with CIDR and season of treatment<br />
had significantly (P
EFFICACY OF CONTROLLED INTERNAL DRUG RELEASING (CIDR) DEVICE ON SYNCHRONIZATION<br />
Group 1 (n=24) served as controls &<br />
received no treatment.<br />
In group 2 (n=24) The ewes were inserted<br />
with the CIDR for 12 days and 400 IU of PMSG was<br />
injected intramuscularly at the time of removal of<br />
device.<br />
In group 3 (n=24) the ewes were inserted<br />
with CIDR for 12 days and 600 IU of PMSG was<br />
administered intramuscularly at the time of removal<br />
of CIDR.<br />
In group 4 (n=24) The ewes were treated<br />
with CIDR for 12 days, 400 IU of PMSG was injected<br />
intramuscularly at the time of removal of vaginal<br />
sponges and injected 200 IU of hCG intramuscularly<br />
at the time of mating.<br />
In group 5 24 ewes were inserted with CIDR<br />
for 12 days and 600 IU of PMSG at the time of<br />
removal of sponges and 200 IU of hCG at the time of<br />
mating was given.<br />
Ewes of all groups were monitored for the<br />
symptoms of estrus by using a teaser ram daily 4<br />
times with an interval of 6 hours for the duration of<br />
30 minutes for five days after withdrawal of<br />
intravaginal CIDR progestagen devices. The ewes<br />
were subjected to pregnancy diagnosis by transabdominal<br />
approach using real time B-mode<br />
ultrasonography (5 to 7.5 MHz). The efficacy of<br />
treatment was measured in terms of estrus response,<br />
pregnancy, lambing, litter size and twinning rates.<br />
RESULTS AND DISCUSSION<br />
Estrus Response<br />
The percentage of estrus response in ewes<br />
synchronized with CIDR in breeding Vs. non breeding<br />
seasons with overall mean in different therapeutic<br />
Groups was presented in Table 1.<br />
PMSG supplementation along with CIDR, the<br />
estrus response rates were in line with the studies of<br />
Sirjani et al. (2011) and Moakhar et al. (2012). But<br />
the researchers used variable doses of PMSG,<br />
progesterone and different kinds of progesterone<br />
preparations in CIDR. Higher estrus response than<br />
the present study was recorded by Ungerfeld and<br />
Rubianes (2002). But Gungor et al. (2007) and Moeini<br />
et al. (2007) observed lower estrus response than<br />
the present study.<br />
Variation in estrus response rate might be<br />
differences in season, breed of sheep (Santos et al.,<br />
2011), type of progesterone and device (Santos et<br />
al., 2011), use of PMSG, time of PMSG injection<br />
(Safdarian et al., 2006), presence of ram in the herd<br />
(Moeini et al., 2007), body condition and management<br />
system (Yadi et al., 2011), nutritional condition,<br />
latitude (Santos et al., 2011) and length of<br />
progesterone treatment (Ustuner et al., 2007).<br />
PMSG was reported to increase synchrony<br />
of estrus and ovulation with more predictability and<br />
precise (Cline et al., 2001) in breeding and non<br />
breeding seasons (Zonturlu et al., 2008). Estrus rates<br />
were greater in ewes treated with hCG might be due<br />
to stimulation of ovarian function in this study (Khan<br />
et al., 2009).<br />
Time taken for induction of estrus<br />
The time taken for expressing estrus after<br />
removal of CIDR in breeding Vs. non breeding season<br />
with overall mean was 35.56±2.36 Vs. 38.53±3.21 h<br />
with 37.05±1.68 h in Group II; 34.78±2.32 Vs.<br />
36.82±2.14 h with 35.80±1.73 h in Group III;<br />
35.63±2.84 Vs. 38.77±2.86 h with 37.20±1.72 h in<br />
Group IV and 34.80±2.21 Vs. 36.27±1.85 h with<br />
35.54±1.75 h in Group V Groups, respectively.<br />
The present findings were in accordance with<br />
the studies of Zonturlu et al. (2008) and Moakhar et<br />
al. (2012). Contrary to this, shorter time for exhibition<br />
of estrus than the present study was reported by<br />
Hashemi et al. (2006). Longer period was taken for<br />
exhibition of estrus than the present study was<br />
observed by Sirjani et al. (2011). Variation in time<br />
taken for expression of estrus might be attributed to<br />
the exposure to ram as well as day of insertion of<br />
vaginal devices in estrous cycle. The time taken for<br />
exhibition of estrus also depends on rate of absorption<br />
and metabolization of each progestagen device as<br />
reported by Romano (2004).<br />
Duration of Estrus<br />
The duration of estrus in ewes synchronized<br />
with CIDR in breeding Vs. non breeding season with<br />
overall mean was 42.68±4.80 Vs. 33.36 ±3.10 h<br />
with 38.02±2.41 h in Group II; 42.95±3.14 Vs.<br />
36.45±2.08 h with 39.70±2.48 h in Group III;<br />
42.86±4.34 Vs. 33.56±3.64 h with 38.21±2.38 h in<br />
Group IV and 43.40±4.44 Vs. 36.81±3.95 h with<br />
79
MOHAN et al<br />
40.11±2.52 h in Group V, respectively. Whereas the<br />
duration of estrus in breeding Vs. non breeding season<br />
with overall mean in untreated control was 26.28±2.48<br />
Vs. 24.87±2.23 h with 25.57±2.36 h. The duration of<br />
estrus was significantly (P
EFFICACY OF CONTROLLED INTERNAL DRUG RELEASING (CIDR) DEVICE ON SYNCHRONIZATION<br />
Table 1. Estrus response, time to onset of estrus and duration of induced estrus in ewes synchronized with CIDR during breeding and non<br />
breeding season<br />
Figures in parenthesis indicated angular values Means bearing different superscripts differed significantly ** P < 0.01 NS : Non Significant<br />
81
MOHAN et al<br />
Table 2. Pregnancy rate, lambing rate, litter size and twinning rate in ewes synchronized with CIDR during breeding and non breeding<br />
season.<br />
Figures in parenthesis indicated angular values Means bearing different superscripts differed significantly ** P < 0.01 NS : Non significant<br />
82
EFFICACY OF CONTROLLED INTERNAL DRUG RELEASING (CIDR) DEVICE ON SYNCHRONIZATION<br />
The increased litter size in the present study<br />
with PMSG administration was in line with the studies<br />
of Yadi et al. (2011) who observed that higher litter<br />
size might be due to PMSG injections. However,<br />
PMSG was believed to increase the number of follicles<br />
and therefore raised twinning and triplets (Timurkan<br />
and Yildiz, 2005) which might be responsible for<br />
recording the higher twinning rate in this study. The<br />
variation in litter size might be due to differences in<br />
the management system, age of the dam, body<br />
condition and breed of the experimental sheep (Moeini<br />
et al., 2007), time and dose of PMSG administration<br />
(Safdarian et al., 2006) and supplementation of hCG<br />
at the time of mating (Timurkan and Yildiz, 2005).<br />
Twinning Rate<br />
The twinning rate in ewes synchronized with<br />
CIDR during breeding Vs. non breeding with overall<br />
mean was presented in Table 2. Significantly (P
MOHAN et al<br />
ewe lambs. Journal of Reproduction and<br />
Fertility. 23: 58 (abstract).<br />
Khan, T.H., Beck, N.F.G and Khalid, M. 2007. The<br />
effects of GnRH analogue (buserelin) or hCG<br />
(Chorulon) on day 12 of pregnancy on ovarian<br />
function, plasma hormone concentrations,<br />
conceptus growth and placentation in ewes and<br />
ewe lambs. Animal Reproduction Science.<br />
102: 247-257.<br />
Khan, T.H., Beck, N.F.G and Khalid, M. 2009. The<br />
effect of hCG treatment on day 12 post mating<br />
on ovarian function and reproductive<br />
performance of ewes and ewe lambs. Animal<br />
Reproduction Science. 116: 162-168.<br />
Khan, T.H., Hastie, P.M., Beck, N.F.G and Khalid,<br />
M. 2003. hCG treatment on day of mating<br />
improves embryo viability and fertility in ewe<br />
lambs. Animal Reproduction Science. 76: 81-<br />
89.<br />
Mandiki, S.N., Noel, B., Bister, J. L., Peeters, R.,<br />
Beerlandt, G., Decuypere, E., Visscher, A.,<br />
Suess, R., Haulfuss, K.H and Paquay, R.<br />
2000. Pre-ovulatory follicular characteristics<br />
and ovulation rates in different breed crosses,<br />
carriers or non-carriers of the Booroola or<br />
Cambridge fecundity gene. Animal<br />
Reproduction Science. 63: 77-88.<br />
Moakhar, H.K., Kohram, H., Shahneh, A.Z and<br />
Saberifar, T. 2012. Ovarian response and<br />
pregnancy rate following different doses of eCG<br />
treatment in Chall ewes. Small Ruminant<br />
Research. 102: 63-67.<br />
Moeini, M.M., Alipour, F and Moghadam, A. 2009.<br />
The effect of Human Chorionic Gonadotropin<br />
on the Reproduction performance in Lory<br />
sheep synchronized with different doses of<br />
Pregnant Mare Serum Gonadotropin outside<br />
the breeding season. Asian Journal of Animal<br />
and Veterinary Advances. 4: 9-15.<br />
Moeini, M.M., Moghaddam, A.A., Bahirale, A and<br />
Hajarian, H. 2007. Effects of breed and<br />
progestin source on estrus synchronization<br />
and rates of fertility in Iranian Sanjabi and Lori<br />
ewes. Pakistan Journal of Biological Sciences.<br />
10: 3801-3807.<br />
Naqvi, S.M.K., Joshi, A., Mathur, A.K., Bag, S and<br />
Mittal, J.P. 1997. Intrauterine artificial<br />
insemination of Malpura ewes in natural estrus<br />
with ram semen. Indian Journal of Animal<br />
Sciences. 69: 180-181.<br />
Nephew, K.P., Cardenas, H., McClure, K.E., Ott,<br />
T.L., Bazer, F. W and Pope, W.F. 1994.<br />
Effects of administration of hCG or<br />
progesterone before maternal recognition of<br />
pregnancy on blastocycyst development and<br />
pregnancy in sheep. Journal of Animal<br />
Science. 72: 453-458.<br />
Nosrati, M., Tahmorespoor, M., Vatandoost, M and<br />
Behgar, M. 2011. Effects of PMSG doses on<br />
reproductive performance of Kurdi ewes<br />
artificially inseminated during breeding season.<br />
Iranian Journal of Applied Animal Science. 1:<br />
125-129.<br />
Ozyurtlu, N., Kucukaslan, I and Cetin, Y. 2008.<br />
Characterization of oestrous induction<br />
response, oestrus duration, fecundity and<br />
fertility in Awassi ewes during the non-breeding<br />
season utilizing both CIDR and intravaginal<br />
sponge treatments. Reproduction in Domestic<br />
Animals. 45: 464-467.<br />
Rhodes, L and Nathanielsz, P .W 1988. Comparison<br />
of a controlled internal drug release device<br />
containing progesterone with intravaginal<br />
medroxyprogesterone sponges for estrus<br />
synchronization in ewes. Theriogenolgy 30:<br />
831-836.<br />
Romano, J.E. 2004. Synchronization of estrus using<br />
CIDR, FGA or MAP intravaginal pessaries<br />
during the breeding season in Nubian goats.<br />
Small Ruminant Research. 55: 15-19.<br />
Safdarian, M., Kafi, M and Hashemi, M. 2006.<br />
Reproductive performance of Karakul ewes<br />
following different oestrous synchronization<br />
treatments outside the natural breeding<br />
season. South African Journal of Animal<br />
Science. 36: 229-234.<br />
Santos, G.M.G., Silva-Santos, K.C., Melo-Sterza,<br />
F.A., Mizubuti, I.Y., Moreira, F.B and Seneda,<br />
M.M. 2011. Reproductive performance of ewes<br />
treated with an estrus induction/<br />
84
EFFICACY OF CONTROLLED INTERNAL DRUG RELEASING (CIDR) DEVICE ON SYNCHRONIZATION<br />
synchronization protocol during the spring<br />
season. Animal Reproduction. 8: 3-8.<br />
Sirjani, M.A., Shahir, M.H., Kohram, H and Shahneh,<br />
A.Z. 2011. Effect of gonadotropin-releasing<br />
hormone (GnRH) treatment on multiple births<br />
in Afshari ewes. African Journal of<br />
Biotechnology. 10: 12358-12362.<br />
Timurkan, H and Yildiz, H. 2005. Synchronization of<br />
oestrous in Hamdani ewes: The use of different<br />
PMSG doses. Bull.Vet. Pulawy. 49: 311-314.<br />
Ungerfeld, R and Rubianes, E. 2002. Short term<br />
primings with different progestagen intravaginal<br />
devices (MAP, FGA and CIDR) for eCGestrous<br />
induction in anoestrus ewes. Small<br />
Ruminant Research. 46: 63-66.<br />
Ustuner, B., Gunay, U., Nur, Z and Ustuner, H. 2007.<br />
Effects of long and short-term progestagen<br />
treatments combined with PMSG on oestrus<br />
synchronization and fertility in Awassi ewes<br />
during the breeding season. ACTAVET,<br />
BRNO. 76: 391-397.<br />
Wheaton, J.E., Windels, H.F and Johnston, L.J. 1992.<br />
Accelerated lambing using exogenous<br />
progesterone and the ram effect. Journal of<br />
Animal Science. 70: 2628-2635.<br />
Yadi, J., Moghaddam, M.F., Khalajzadeh, S and<br />
Solati, A.A. 2011. Comparison of estrus<br />
synchronization by PGF 2<br />
á, CIDR and sponge<br />
with PMSG in Kalkuhi ewes on early<br />
anoestrous season. International Conference<br />
on Asia Agriculture and Animal, IPCBEE. 13:<br />
61-65.<br />
Zeleke, M., Greyling, J.P.C., Schwalbach, L.M.J.,<br />
Muller, T and Erasmus, J.A. 2005. Effect of<br />
progestagen and PMSG on oestrous<br />
synchronization and fertility in Dorper ewes<br />
during the transition period. Small Ruminant<br />
Research. 56: 47-53.<br />
Zonturlu, A.K., Aral, F., Ozyurtlu, N and Yavuzer, U.<br />
2008. Synchronization of estrus using FGA<br />
and CIDR intravaginal pessaries during the<br />
transition period in Awassi ewes. Journal of<br />
Animal and Veterinary Advances. 7: 1093-<br />
1096.<br />
85
J.Res. ANGRAU 41(2) 86-95, 2013<br />
EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON<br />
PERFORMANCE, EGG QUALITY, NUTRIENT RETENTION AND GUT HEALTH OF<br />
LAYING HENS FED CORN-SOYBEAN MEAL BASED LOW ENERGY DIETS<br />
J. NARASIMHA, D. NAGALAKSHMI, Y. RAMANA REDDY and S.T.VIROJI RAO<br />
Department of Animal Nutrition, College of Veterinary Science,<br />
Sri Venkateswara Veterinary University, Rajendranagar, Hyderabad-500 030.<br />
Date of Receipt : 14.05.2013 Date of Acceptance : 07.06.2013<br />
ABSTRACT<br />
A trial was conducted to evaluate pure NSP enzyme combination derived from in vitro studies and<br />
commercially available prebiotic (MOS) to corn-soybean meal based low energy diets singly and combination of<br />
both. The experiment was conducted by using completely randomized design on one hundred and fifty layer birds<br />
(40 weeks) of uniform body weight and production with 5 treatments, six replicates and 5 hens in each replicate for<br />
three laying periods with twenty eight days in each laying period. The performance was measured in terms of egg<br />
production, feed intake, weight changes, feed efficiency, egg quality, nutrient retention, and gut health. The hen day<br />
production (%) in birds fed BD supplemented with NSP enzymes and/or prebiotics were comparable among each<br />
other and also with SD in all the three periods and the same trend was reflected in overall percent hen day<br />
production. The feed intake (g/bird/d), FCR, body weight changes, egg quality traits, tibia ash, retentions of DM, OM,<br />
CF, NFE, GE and phosphorus, in birds fed BD supplemented with NSP enzymes, prebiotics alone or combination of<br />
both did not differ significantly and were comparable to SD. The retention of CP and EE improved (P
EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON PERFORMANCE<br />
health such as villi height (Loddi et al. 2002) and 3)<br />
immune modulation (adjuvant effect) (Ferket et al.<br />
2002). The current study aimed at evaluating the<br />
performance and nutrient utilization and gut health of<br />
white leghorn layers fed a conventional corn-soybean<br />
meal based diet low in ME and supplemented with<br />
NSP enzymes and prebiotics alone and or in<br />
combination.<br />
MATERIALS AND METHODS<br />
Experimental birds and diets<br />
A study was conducted on one hundred and fifty<br />
layers (40 weeks) of uniform body weight and<br />
production to asses the effect of supplementing NSP<br />
enzymes and prebiotics to low energy corn-soybean<br />
meal based diets on egg production, egg quality and<br />
nutrient utilization by randomly allotting them to 5<br />
dietary groups with six replicates per group and five<br />
birds per replicate. The dietary treatments were<br />
standard layer diet (2600 kcal ME/kg) (SD) and one<br />
low energy diet (2300 kcal ME/kg) supplemented with<br />
NSP enzyme complex (xylanase, 60000, cellulase,<br />
400 and â -D glucanase 3200 IU/kg feed) and prebiotic<br />
(MOS) at dose rates of 0.5g / kg. The details of the<br />
experimental diets are presented in Table 1. The<br />
ingredient and nutrient composition of experimental<br />
diets is given in Table 2. Feed was offered ad libitum<br />
to replicate groups of birds in cages for three periods<br />
of 28 days each and reared under standard<br />
management conditions.<br />
Criteria of response<br />
Data on daily egg production was recorded for<br />
each period consisting of twenty-eight days. Percent<br />
hen day (HD) egg production was calculated for each<br />
treatment. Weekly feed intake was recorded and<br />
efficiency of feed utilization was expressed as feed<br />
intake / dozen eggs. The eggs laid during the last<br />
four consecutive days of last laying period were<br />
collected to assess egg quality parameters. Body<br />
weight of each bird was recorded at the beginning<br />
and end of laying period.<br />
Nutrient retention studies<br />
At the end of experiment, a metabolic trial of 4<br />
days duration was conducted to determine the nutrient<br />
utilization and balance of nutrients. The samples of<br />
each feed, feed residue and feces pooled during 4<br />
days period were ground and analyzed for proximate<br />
principles as per the method of AOAC (2005).<br />
Gut health<br />
To study the effect of various dietary energy<br />
concentrations, supplementary effect of NSP<br />
enzymes with or without prebiotic on gut health, the<br />
digesta was collected from distal portion of small<br />
intestine during slaughter. Approximately two g of<br />
digesta was taken in sterile eppendorf tubes for<br />
enumeration of Escherichia coli. Another 2 g of<br />
digesta was collected and centrifuged at 5000 rpm<br />
for 10 minutes at 20 0 c. An aliquot of supernatant<br />
(0.5 to 1 ml) was collected and stored in capped vials<br />
for viscosity determination. The digesta collected in<br />
centrifuge tubes was utilized for measuring the pH.<br />
Histology of intestines<br />
Representative pieces of duodenum of intestine<br />
were collected in 10% formal saline and preserved<br />
for histological studies. After proper fixation the<br />
intestine tissue was trimmed and subjected to over<br />
night washing, dehydration in various percentages<br />
of alcohol, cleaning in xylol, embedding in paraffin<br />
wax for preparation of blocks (Clayden, 1962). The<br />
paraffin blocks were cut in to 5ì thick sections and<br />
stained with routine H and E stain (Culling, 1957)<br />
and used for microscopic examination.<br />
Statistical Analysis<br />
The data was subjected to appropriate statistical<br />
analysis using Statistical Package for Social<br />
Sciences (SPSS) 16 th version and comparison of<br />
means was tested using Duncan’s multiple range<br />
tests (Duncan’s 1955).<br />
RESULTS AND DISCUSSION<br />
Nutrient composition of experimental ration<br />
Nutrient composition (% Dry matter basis) of<br />
standard layer and basal diets is presented in<br />
Table 3.<br />
Hen day production (%)<br />
Basal diet (BD) supplemented with NSP enzymes,<br />
prebiotics or combination of both had no significant<br />
effect on percent hen day production (Table 4) and<br />
the same trend was reflected in all the three cycles<br />
and overall egg production. Though statistically<br />
87
NARASIMHA et al<br />
comparable, the egg production in BD was lower by<br />
6.10% compared to SD and supplementing NSP<br />
enzymes to BD, increased the egg production by<br />
4.15%, while no additional benefit was observed with<br />
prebiotics addition. Sohail et al. (2003) reported<br />
improvement in egg production by 1.2 % with NSP<br />
enzymes (Avizyme containing xylanase, amylase<br />
and protease) added at 0.075% level to corn soybean<br />
based layer diets. Li et al. (2007) reported an<br />
improvement in egg production with supplementation<br />
of FOS at 2, 4 and 6 g/kg to corn soy based diets.<br />
Contrary to the present findings, Scott and Mc Cann<br />
(2005) reported reduced egg production on<br />
supplementation of Avizyme (0.375 g/kg) compared<br />
to control and other feed additives (Biomas 2 g/kg<br />
and organic acid blend 4 g/kg).<br />
Feed intake<br />
Supplementation of NSP enzymes,<br />
prebiotics and combination of both to BD had no<br />
effect on feed intake (Table 4). Similar results were<br />
reported by Ahsan et al. (2005) who observed non<br />
significant effect of enzyme (xylanase 30 U/ml, endo<br />
glucanase 2.5 U/ml and â glucosidase 1.5 U/ml)<br />
added at different levels on feed intake. Scheideler<br />
et al. (2005) also reported non significant effect of<br />
dietary ME and enzyme (Avizyme 1500; xylanase<br />
1000, protease 4000, and amylase 2000 IU/kg)<br />
incorporated at the rate of 0.075% on feed<br />
consumption. Scott and Mc Cann (2005) reported<br />
non significant effect of enzyme Avizyme (0.375 g/<br />
kg) and Biomas (2 g/kg) supplementation to wheat<br />
based diets on feed intake.<br />
Weight gain<br />
In toto, at the end of the experiment all the<br />
birds in all the treatment groups were in positive<br />
weight gain (Table 4). The supplementation of NSP<br />
enzymes, prebiotics to BD had no effect on body<br />
weight gain and the overall weight gains recorded<br />
were comparable among the experimental groups<br />
including SD and BD. Wu et al. (2005) reported no<br />
effect in weight gain in layers by reducing dietary<br />
energy concentration from 2959 to 2719 kcal ME/kg<br />
diet. Supplementing 1.2 % Avizyme (xylanase,<br />
amylase and protease) added to corn soya diets did<br />
not affect body weight gain (Sohail et al. 2003), while<br />
El - Sheikh et al. (2009) observed significant increase<br />
(P
EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON PERFORMANCE<br />
Shell weight (g) and shell thickness (mm)<br />
Inclusion of NSP enzymes and prebiotics<br />
alone or combination of both to BD had no effect on<br />
shell weight and shell thickness (Table 5). These<br />
results are in line with Li et al. (2007) who reported<br />
non significant effect of supplementation of FOS to<br />
layer diets on shell weight and shell thickness. Novak<br />
et al. (2008) also reported no effect of dietary energy<br />
or protein supplemented with or without cocktail<br />
enzyme (800, 8000 and 1600 u/g amylase, protease<br />
and xylanase, respectively) added at 0.0375% level.<br />
Specific gravity<br />
Specific gravity recorded among the<br />
experimental groups i.e., SD, BD and BD<br />
supplemented with NSP enzymes and prebiotics<br />
alone or combination of both was comparable (Table<br />
5) which were in line with the findings of Sohail et al.<br />
(2003) who reported no interaction of enzyme<br />
supplementation energy or lysine on specific gravity<br />
of egg. Inclusion of avizyme 1500 in the diet or<br />
increasing the dietary energy from 2820 to 2906 kcal<br />
of ME/kg feed had no effect (p
NARASIMHA et al<br />
supplementation to standard (ME 2595 kcal /kg and<br />
18.08%) and low dense (ME 2478 kcal /kg and<br />
17.16%) ration (5% less in ME and protein) than their<br />
respective control. Supplementation of NSP enzymes<br />
with prebiotics to low caloric layer diets (300 kcal<br />
less ME than SD) significantly (P
EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON PERFORMANCE<br />
Fig 1. H & E section of deodenum showing congested, moderately short ruptured villi (x200)<br />
Fig 2. H & E section of deodenum showing elongated villi with uniform distribution of goblet cell<br />
activity (x200)<br />
91
NARASIMHA et al<br />
Table 3. Nutrient composition (% Dry matter basis) of layer diets (Analyzed)<br />
Each value is an average of duplicate analysis<br />
Table. 4. percent hen day production, feed intake, feed efficiency, cost per dozen eggs and weight gain of layers fed diets supplemented with<br />
NSP enzymes and prebiotics<br />
Each value is an average of 3 cycles of 28 days<br />
Means with different superscripts in a column differ significantly (P>0.05)<br />
92
EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON PERFORMANCE<br />
Table 5. Egg quality traits of layers fed low calorie diet supplemented with NSP enzymes and prebiotics<br />
Means with different superscripts in a column differ significantly (P
NARASIMHA et al<br />
REFERENCES<br />
Aghaei, A., Tabatabaei, S., Chaji, M and Nazari, M.<br />
2010. Effects of dried whey (Prebiotics) and<br />
probiotics in laying hen’s performance and<br />
intestinal flora. Journal of Animal and<br />
Veterinary Advances 9 : 1996-2000.<br />
Ahsan Ul Haq., Shahbaz, M., Atia Bashir and Shahid<br />
Ur Rehman. 2005. Effect of enzyme<br />
Chaetomium thermophile supplementation on<br />
the production performance of leg horn layers.<br />
Pakistan Journal of Life and Social Sciences<br />
3 (1-2):10-12.<br />
Aman, P and Graham, H. 1990. Chemical evaluation<br />
of polysaccharides in animal feeds.In” feed<br />
stuff evaluation” wise man, J and cole DJA<br />
(eds.) Butterworth London. Pp.161-167.<br />
AOAC. 2005. Official Methods of Analysis of<br />
Association of official Analytical chemists 18 th<br />
Edition (Virginia, USA, Association of official<br />
Analytical chemists).<br />
Clayden, E. C. 1962. Practical section cutting and<br />
staining. 4 th Edition, J and Churchil limited,<br />
Culling, C. F. A. 1957. Hand Book of Histopathological<br />
Techniques. London Butterworth and company.<br />
(publisher) Ltd.<br />
Duncan, D. D. 1955. Multiple range and multiple ‘F’<br />
test, Biometrics. 11:1-42.<br />
El-Sheikh, A. M. H., Abdalla, E, A and Maysa, M. H.<br />
2009. Study on productiveperformance,<br />
hematological and immunological parameters<br />
in a local strain of chicken as affected by<br />
mannan oligosaccharide under hot climate<br />
conditions. Egyptian Poultry Science Journal<br />
29 (1): 287-305.<br />
Ferket, P. R., Parks, C. W and Grimes, J. L. 2002.<br />
Beneûts of dietary antibiotic and<br />
mannoligosaccharide supplementation for<br />
poultry. Proceedings of Multi-State Poultry<br />
Feeding and Nutrition. Conference<br />
Indianapolis, IN. www.feedinfo.com (Scientiûc<br />
Reviews article dated June 19, 2002).<br />
Grashorn, M.A. 2010. Use of phytobiotics in broiler<br />
nutrition – an alternative to in feed antibiotics?<br />
Journal of Animal and Feed Sciences. 19:338–<br />
347.<br />
Hooge, D. M., Sims, M. D., Sefton, A. E., Connolly,<br />
A and Spring, P. 2003. Effect of dietary<br />
mannan oligosaccharide with or without<br />
Bacitracin or Virginiamycin, on live<br />
performance of broiler chickens at relatively<br />
high stocking density on new litter. Journal of<br />
Applied Poultry Research 12: 461-467.<br />
Kim, C. H., Shin, K. S., Woo, K. C and Paik, I. K.<br />
2009. Effect of dietary oligosaccharides on the<br />
performance, intestinal microflora and serum<br />
immunoglobulin contents in laying hens.<br />
Korean Journal of Poultry Science 36 (2): 125-<br />
131.<br />
Li X., Liu L., Li K., Hao, K and Xu, C. 2007. Effect of<br />
Fructooligo saccharides and antibiotics on<br />
laying performance of chickens and cholesterol<br />
content of egg yolk. British Poultry Science<br />
48 (2): 185-189.<br />
Loddi, M. M., Nakaghi, L. S. O., Edens F., M Tucci,<br />
F., Hannas, M. I., Moraes, V. M. B and Ariki,<br />
J. 2002. Mannanoligosaccharide and organic<br />
acids on intestinal morphology integrity of<br />
broilers evaluated by scanning electron<br />
microscopy. In: Proceedings11th European<br />
Poultry Science Conference. Bremen,<br />
Germany. Pp.21.<br />
Novak, C. L., Yahout, H. M and Remus, J. 2008.<br />
Response to varying dietary energy and protein<br />
with or without enzyme supplementation on<br />
leg horn performance and economics, laying<br />
period. Journal of Applied Poultry Research<br />
17: 17-33.<br />
Oliveira, M. C., Rodrigues, E. A., Marques, R. H.,<br />
Gravena, R., Guandolini, G. G and Moraes<br />
V.M. B. 2008. Performance and morphology<br />
of intestinal mucosa ofbroilers fed mannanoligosaccharides<br />
and enzymes. Arquivo<br />
Brasileiro de MedicinaVeterinaria e Zootecnia<br />
60 (2): 442-448.<br />
Ramesh, J and Chandrasekaran, D. 2011. Effect of<br />
pure enzyme mixture supplementation on<br />
performance of laying hens. Indian Journal of<br />
Animal Nutrition 28(1):83-87.<br />
94
EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON PERFORMANCE<br />
Rosen, A. Erin., Greg Blank., Bogdan, A., Slominski.,<br />
Rick, M and Holley, A. 2007. Enzyme<br />
supplements in broiler chicken diets: in vitro<br />
and in vivo effects on bacterial growth. Journal<br />
of the Science of Food and Agriculture. 87 (6):<br />
1009–1020.<br />
Scheideler, S. E., Beck, M. M., Abudabos, A and<br />
Wyatt, C. L. 2005. Multiple enzyme (Avizyme)<br />
supplementation of corn-soy-based layer diets.<br />
Journal of Applied Poultry Research 14 : 77-<br />
86.<br />
Scott, M. D and Mc Cann, M. E. E. 2005. Effect of<br />
wheat variety and enzyme additio on laying<br />
hen performance. British Poultry Abstracts<br />
1(1): 34.<br />
Sohail, S. S., Bryant, M. M., Voitle, R. A and Roland,<br />
D. A. 2003. Influence of dietary fat on<br />
economic returns of commercial Leg horns.<br />
Journal of Applied Poultry Research 12 : 356-<br />
361.<br />
Spring, P. C., Wenk, K. A., Dawson and K. E.<br />
Newman. 2000. Effect of mannan oligosa<br />
ccharide on different cecal parameters and on<br />
cecal concentration of enteric bacteria in<br />
challenged broiler chicks. Poultry Science.<br />
79:205–211.<br />
Switkiewicz, S., Koreleski, J., Arczewska, A. 2010.<br />
Laying performance and eggshell qualityin<br />
laying hens fed diets supplemented with<br />
prebiotics and organic acids. Czech Journal<br />
of Animal Science 55 (7): 294–306.<br />
Wu, G., Bryant, M. M., Voitle, R. A and Roland, D.<br />
A. 2005. Effect of dietary energy on<br />
performance and egg composition of bovans<br />
white and dekalb white hens during phase I.<br />
Poultry Science 84 : 1610-1615.<br />
95
J.Res. ANGRAU 41(2) 96-99, 2013<br />
HAEMATOLOGICAL AND BIOCHEMICAL PROFILE OF EWES SYNCHRONIZED<br />
WITH CONTROLLED INTERNAL DRUG RELEASING DEVICE (CIDR)<br />
K. MURALI MOHAN, K. SADASIVA RAO and K. RAMCHANDRA REDDY<br />
Department of Veterinary Gynaecology and Obstetrics, College of Veterinary Science<br />
Sri Venkateswara Veterinary University, Rajendranagar, Hyderabad – 5000 30<br />
Date of Receipt : 31.01.2013 Date of Acceptance : 18.03.2013<br />
ABSTRACT<br />
The present study was undertaken to study the haematological and blood biochemical parameters in ewes<br />
synchronized with CIDR. The ewes were synchronized with Controlled Internal Drug Releasing (CIDR) device<br />
containing 300 mg of progesterone. A total of 120 post partum, parous, healthy ewes aged about 2 to 5 years were<br />
selected. The ewes were housed in thatched roof sheds with mud flooring and allowed for grazing in the fields and<br />
fed on sufficient green fodder and concentrate feed as per the nutritional requirements. The haemoglobin (Hb), Total<br />
Erythrocyte Count (TEC) were determined by the standard procedures. The serum samples were analysed for total<br />
proteins, serum glucose, serum calcium and serum phosphorus by using standard methods. The total erythrocyte<br />
counts were 8.48±0.12, 8.48±0.16, 8.48±0.17, 8.49±0.15 and 8.45±0.11 million/ml in control, CIDR4, CIDR6, CIDR4h<br />
and CIDR6h groups, respectively. There was no significant difference observed in erythrocyte count during breeding<br />
and non breeding seasons in the ewes treated with CIDR. The haemoglobin levels were 9.46±0.08, 9.47±0.09,<br />
9.45±0.10, 9.47±0.07 and 9.48±0.09 g per cent in control, CIDR4, CIDR6, CIDR4h and CIDR6h groups, respectively.<br />
The haemoglobin levels were significantly (P
HAEMATOLOGICAL AND BIOCHEMICAL PROFILE OF EWES SYNCHRONIZED<br />
in group IV were treated as in group II with additional<br />
treatment of 200 IU of hCG injection at the time of<br />
mating. Ewes in group V were treated as in group III<br />
with additional treatment of 200 IU of hCG injection<br />
at the time of mating. The haemoglobin (Hb), Total<br />
Erythrocyte Count (TEC) were determined by the<br />
standard procedures. The serum samples were<br />
analysed for total proteins, serum glucose, serum<br />
calcium and serum phosphorus by using standard<br />
methods.<br />
RESULTS AND DISCUSSION<br />
The haematological and biochemical values<br />
of ewes synchronized with CIDR were presented in<br />
Table 1. The total erythrocyte counts were 8.48±0.12,<br />
8.48±0.16, 8.48±0.17, 8.49±0.15 and 8.45±0.11<br />
million/ml in control, CIDR4, CIDR6, CIDR4h and<br />
CIDR6h groups, respectively. There was no significant<br />
difference observed in erythrocyte count during<br />
breeding and non breeding seasons in the ewes<br />
treated with CIDR. The total erythrocyte count<br />
observed in present findings were comparable with<br />
the studies of Selvaraj et al. (2004) and Devendran<br />
et al. (2009) and higher values were reported in<br />
Patanwadi sheep by Vinodh Kumar et al. (2009) and<br />
Lipecka et al. (2010). Results of the present study<br />
revealed that season, treatment or type of device<br />
did not exert any effect on the total erythrocyte count<br />
at any time of device kept in place.<br />
The haemoglobin levels were 9.46±0.08,<br />
9.47±0.09, 9.45±0.10, 9.47±0.07 and 9.48±0.09 g<br />
per cent in control, CIDR4, CIDR6, CIDR4h and<br />
CIDR6h groups, respectively. The haemoglobin levels<br />
were significantly (P
MOHAN et al<br />
Table 1. Haematological and Biochemical parameters (Mean ± S.E.) in the ewes synchronized with CIDR<br />
98
HAEMATOLOGICAL AND BIOCHEMICAL PROFILE OF EWES SYNCHRONIZED<br />
serum phosphorus were recorded in cyclic ewes by<br />
Pradhan et al. (1991) and Ramprabhu and<br />
Dhanapalan et al. (1998) who reported lower values<br />
during rainy and winter seasons.<br />
The variations in biochemical profiles were<br />
attributed to seasons, availability of seasonal fodder<br />
(Ramprabhu and Dhanapalan, 1998), availability of<br />
shade area (Singh et al., 2008) and stage of<br />
pregnancy (Obidike et al., 2009).<br />
REFERENCES<br />
Anurud, N.E., Babayemi, O.J and Ososanya, T. 2004.<br />
Haematology of pregnant West African dwarf<br />
ewes fed siam weed-base rations. Tropical<br />
Journal of Animal Science.7:105-112.<br />
Devendran, P., Jayachandran, S., Visha, P.,<br />
Nanjappan, K and Panneerselvam, S. 2009.<br />
Haematological and blood biochemical profile<br />
of Coimbatore sheep. Indian Journal of Small<br />
Ruminants. 15: 98-101.<br />
Dhanotia, R.S. 2004. Text book of Veterinary<br />
Biochemistry, 2 nd Ed. Jaypee Brother, New<br />
Delhi.<br />
Lipecka, C., Olech, M., Gruszecki, T.M., Junkuszew,<br />
A and Kuzmak, J. 2010. Haematological and<br />
biochemical parameters in blood of lambs born<br />
to Maedi-Visna virus infected and uninfected<br />
ewes. Bulletin of the Veterinary Institute in<br />
Pulawy. 54: 135-139.<br />
Mittal, J.P., Maurya, V.P., Anil Joshi and Naqvi,<br />
S.M.H. 2004. Role of nutrition in augmentating<br />
reproduction in sheep. In: Proceedings and<br />
Challenges in Nutrition and feeding<br />
management of sheep, goat and rabbit for<br />
sustainable production. Feb.10-12, 2004<br />
Avikanagar, Rajasthan, India. pp. 246-253.<br />
Obidike, I.R., Aka, L.O and Okafor, C.I. 2009. Timedependant<br />
peri-partum haematological,<br />
biochemical and rectal temperature changes<br />
in West African dwarf ewes. Small Ruminant<br />
Research. 82: 53-57.<br />
Pradhan, K.M., Mohanty, B.N., Ray, S.K.H and<br />
Mohanty, D.N. 1991. A note on serum<br />
biochemical constituents in cycling and<br />
postpartum anoestrus ewes. Indian Journal of<br />
Animal Reproduction. 12: 191-192.<br />
Radostits, O.M., Blood, D.C., Gay, C.C., Arundel,<br />
J.H., Ikede, B.O., McKenzie, R.A and<br />
Tremblay, R.R.M. 1994. Veterinary Medicine:<br />
A textbook of the diseases of cattle, sheep,<br />
pigs, goats and horses. 8 th Ed. Bailliere Tindall,<br />
London. pp. 1726-1727.<br />
Ramprabhu, R and Dhanaphalan, P. 1998. Blood<br />
biochemical profiles of Merino Nilgiri crossbred<br />
sheep. Cherion. 27: 15-18.<br />
Ravindra Reddy, Y., Sarjan Rao, K., Sudhakar, K.,<br />
Ramesh Gupta, D and Gnana Prakash, M.<br />
2010. Biochemical profile of Nellore sheep on<br />
feeding of Azolla and Sheanut cake under<br />
different management systems. Indian Journal<br />
of Small Ruminants. 16: 54-57.<br />
Sejian, V., Maurya, V.P and Naqvi, S.M.K. 2010.<br />
Adaptive capability as indicated by endocrine<br />
and biochemical responses of Malpura ewes<br />
subjected to combined stresses (thermal and<br />
nutritional) in a semi-arid tropical environment.<br />
International Journal of Biometeorology. 54:<br />
653-661.<br />
Selvaraj, P., Mathivanan, R and Nanjappan, K. 2004.<br />
Haematological and biochemical profile of<br />
Mecheri sheep during winter and summer.<br />
Indian Journal of Animal Sciences. 74: 718-<br />
720.<br />
Singh, D.N., Wadhwani, K.N., Arya, J.S., Sarvaiya,<br />
N.P and Patel, A.M. 2008. Effect of housing<br />
systems on blood constituents of ewes during<br />
summer in a subtropical climate. Indian Journal<br />
of Small Ruminants. 14: 252-254.<br />
Vinodh Kumar, O.R., Swarnkar, C.P., Shinde, A.K<br />
and Singh, D. 2009. Heamatological,<br />
biochemical and mineral profile of adult<br />
Patanwadi sheep. Indian Journal of Small<br />
Ruminants. 15: 243-245.<br />
99
J.Res. ANGRAU 41(2) 100-106, 2013<br />
INDIAN BREAD MAKING TOOLS - CONSUMER EVALUATION AND<br />
DESIGN MODIFICATION<br />
P. RAJYA LAKSHMI, D. RATNA KUMARI and V. VIJAYA LAKSHMI<br />
Department of Resource Management and Consumer Sciences,<br />
College of Home Science, ANGRAU, Saifabad, Hyderabad- 500 004<br />
Date of Receipt : 23.06.2012 Date of Acceptance : 24.01.2013<br />
ABSTRACT<br />
Cooking is the most common activity in all homes. Indian Breads made of wheat flour are served hot at<br />
breakfast, lunch or dinner, and are eaten with dry and semi liquid vegetable preparations, as well as with gravies<br />
and other adjuncts. The present study was planned to identify the design deficiencies of most commonly used Indian<br />
bread making tools and suggest suitable design modifications. The four most commonly used tools of Indian bread<br />
making identified from the household survey were evaluated ergonomically. The ergonomic evaluation was carried<br />
out on a multi-parametric approach considering both the subject (sample or respondents) and object (product or<br />
tool) aspects. The dimensions and design features were studied in terms of biomechanical, anthropometric and<br />
psychological aspects of the subjects. As a part of the study, the object aspect, the availability and physical properties<br />
of the existing rolling pins and rolling boards were analyzed to suggest design modifications. It can be concluded as<br />
the ergonomically designed tools will fit the users comfort provide safety and efficiency, so there is a need to design<br />
and develop the tools that are comfortable and efficient to the users.<br />
Different varieties of Indian bread include:<br />
Chapathi, puri, phulka, roti, parotta and bathura are<br />
the main traditional products which form the staple<br />
items in the diet of the majority of the population.<br />
Diet consciousness of people in the present days<br />
has lead to an increase in Indian bread consumption<br />
irrespective of region. Indian breads are normally<br />
made of wheat flour and served hot at breakfast,<br />
lunch or dinner, and are eaten with dry and semi<br />
liquid vegetable preparations, as well as with gravies<br />
and other adjuncts in households. Indian bread making<br />
tools come under the major section of hand tools as<br />
classified based on purpose.<br />
The common tools used in Indian bread making<br />
are the Rolling board and Rolling pin, which are<br />
available in a variety of materials and sizes. In India<br />
these are must-haves in the kitchen. The rolling pin<br />
is used in combination with rolling board (flat circular<br />
chakla). A rolling pin is a cylindrical food preparation<br />
tool used to shape and flatten dough. A rolling board<br />
is an Indian kitchen tool which is a flat, usually<br />
circular board used for rolling kneaded dough into<br />
chapattis. It is vital that the dough does not stick to<br />
the pin and board when rolling. Dough sticking to the<br />
pin has few disadvantages. It takes more time to<br />
complete the job and therefore is less efficient. To<br />
prevent sticking before and during rolling, flour must<br />
be added to the dough and<br />
rubbed on the pins. This changes the texture of the<br />
dough. When the dough sticks to the pin and needs<br />
to be removed, the weight distribution of the dough<br />
becomes inconsistent, thereby creating uneven<br />
thicknesses and therefore uneven temperature when<br />
baking, so that some parts become crisper than<br />
others.<br />
It would be desirable to develop an improved<br />
rolling pin and rolling board to avoid these<br />
disadvantages which allow dough to roll more easily<br />
(Dua et al. 2010). Much work has been reported on<br />
chapatti making machines, and the studies on Indian<br />
bread making tools in India are scanty. Hence, a study<br />
on Indian bread making tools was thought to be<br />
appropriate which may fulfill the user requirements.<br />
The twin cities of Andhra Pradesh i.e.<br />
Hyderabad and Secunderabad were selected<br />
purposively as a study area due to an ever-increasing<br />
number of shopping malls and attractively laid out<br />
stores, liberalisation of economy and a number of<br />
exhibitions of consumer goods has given way to<br />
several well-known brands of goods coming within<br />
the reach of the people and various models of kitchen<br />
tools are available among which Indian bread making<br />
tools are also apart. Exploratory research design was<br />
followed and hundred sample were selected. The tool<br />
selected for collecting the information was an<br />
email: rajiraju.laxmi@gmail.com<br />
100
INDIAN BREAD MAKING TOOLS - CONSUMER EVALUATION AND DESIGN MODIFICATION<br />
interview schedule to obtain a holistic picture of the<br />
Indian bread making tools used by the respondents.<br />
The schedule comprised of three sections was used-<br />
First section covered the general information about<br />
the respondents, second section included details<br />
about various tools used by the respondents for roti<br />
/ chapatti making, their frequency and purpose of<br />
use and third section covered the information about<br />
the tool design and its comfort in handling the tools,<br />
which were felt inconvenient to use from the user’s<br />
point of view. The four most commonly used tools of<br />
Indian bread making were identified from the<br />
household survey and were evaluated ergonomically<br />
using a multi-parametric approach considering both<br />
the subjective and objective aspects. Under subjective<br />
aspects, the six samples from hundred respondents<br />
were selected and the anthropometry, palm index,<br />
grip strength, wrist angle, heart rate and energy<br />
expenditure were the parameters adopted for<br />
ergonomic evaluation. Under the objective aspects<br />
the physical criteria of the identified tools were<br />
considered. The dimensions and design features were<br />
studied in terms of biomechanical, anthropometric<br />
and psycho-physiological aspects of the respondents.<br />
The data collected was coded, tabulated and analyzed<br />
through frequencies and percentages.<br />
The results of household survey carried out<br />
one hundred respondents, showed that the majority<br />
of the users faced problems of muscle fatigue, grip<br />
fatigue, wrist pain and fore arm pain associated with<br />
lack of grip of handles of rolling pin, instability of the<br />
rolling board and sticky nature of the pin and board.<br />
The four most commonly used Indian bread making<br />
tools were identified and evaluated ergonomically<br />
using a multi-parametric approach. The dimensions<br />
and design features of the tools were studied in terms<br />
of biomechanical, anthropometric and psychophysiological<br />
aspects of the respondents. Different<br />
parameters used were anthropometry, palm index<br />
which is calculated by following formula:<br />
Effective Palm area<br />
Palm Index = X 100<br />
Total Palm Area<br />
Wrist angle by flexicurve of 100 cms, reduction in<br />
grip strength by<br />
Grip strength = Sr – Sw / Sr X 100<br />
Heart rate which measured using Stethoscope.<br />
Relative Heart Rate (RHR) is calculated using the<br />
following equation (Robergs and Landwehr, 2002).<br />
RHR = (HR Work – HR Rest) / (HR Max – HR Rest)<br />
* 100<br />
Where<br />
RHR = Relative Heart Rate<br />
HR<br />
= Heart Rate<br />
HR Max = 205.8 – (0.685 x Age)<br />
And energy expenditure during work was calculated<br />
from the given values of average heart rate by using<br />
the regression equation given by Varghese et al.<br />
(1994)<br />
Energy Expenditure kJ/min=0.159<br />
xAvg.working HR(b.min -1 )-8.72<br />
With regard to the object aspect, the availability<br />
and physical properties of the existing rolling pins<br />
and rolling boards were analyzed. Based on the results<br />
design modifications were suggested.<br />
Ergonomic evaluation of existing tools<br />
The selected tools were studied considering two<br />
aspects, objective and subjective evaluation. The<br />
objective aspects are the physical criteria and<br />
features of the tools and subjective aspects are the<br />
quantitative and qualitative information of the<br />
respondents.<br />
Product profile of rolling pin and rolling board<br />
From the table 1 and 2, it is clear that rolling<br />
pin 1 and 3 are of similar dimensions in almost all<br />
aspects. The length of the handle of all the four rolling<br />
pins was found to be uncomfortable. The handles<br />
were devoid of any angle, resulting in wrist deviation.<br />
The weight of rolling pin 2 and rolling board 2 and 4<br />
was more compared to other models. (Figure – 1)<br />
The handles of the pins 1 and 3, 2 and 4 were found<br />
to be similar. The rolling pins of models 1, 2 and 4<br />
are of wood material and model 3 is of plastic. The<br />
rolling boards 1 and 2 are of wooden material and<br />
models 3 and 4 are of plastic and marble. The weight<br />
of the tool helps in rolling the dough easily when<br />
compared to the other parts as mentioned by<br />
Gelberman et al. (1994) in their study on the<br />
ergonomic hand tools indicated that in the design of<br />
hand operated tools, weight of the tool had to be given<br />
due importance along with other parameters.<br />
101
Lakshmi et al<br />
Table 1. Dimensions of rolling pins selected for ergonomic evaluation<br />
Model-1 Model-2 Model-3 Model-4<br />
Material Wood Spindle Plastic Curved<br />
Body length (cm) 16.7 15.2 16.7 17.7<br />
Handle length (cm) 9.1 7.6 9.1 9.1<br />
Total length (cm) 34.5 30.5 34.5 35.5<br />
Body diameter (cm) 4.0 4.0 2.5 4.0<br />
Inner handle diameter (cm) 1.5 1.5 1.5 1.5<br />
Outer handle diameter(cm) 1.5 3.3 1.0 4.0<br />
Weight (g) 148.2 192.8 154.0 171.8<br />
Table 2. Dimensions of rolling boards selected for ergonomic evaluation<br />
Model-1 Model-2 Model-3 Model-4<br />
Material Wood Wood(Decolum) Plastic Marble<br />
Diameter (cm) 25.4 24.3 24.3 24.3<br />
Body height (cm) 1.5 2.5 2.5 1.5<br />
Base height (cm) 4.0 1.5 7.6 1.5<br />
Total height (cm) 5.0 4.0 10.1 2.5<br />
Weight (g) 721.0 898.0 480.0 1480.0<br />
3<br />
1<br />
1 = Model 1<br />
2 = Model 2<br />
3 = Model 3<br />
4<br />
4 = Model 4<br />
2<br />
Fig 1. Tools selected for ergonomic evaluation<br />
102
INDIAN BREAD MAKING TOOLS - CONSUMER EVALUATION AND DESIGN MODIFICATION<br />
Under subject aspect both the Quantitative<br />
and Qualitative measurements like anthropometry,<br />
palm length, palm width, grip diameter, palm index,<br />
grip strength, elbow angles, time of operation<br />
evaluation of user was done. Six willing respondents<br />
were selected for ergonomic evaluation.<br />
Anthropometry<br />
Table 3. Average anthropometric measurements of respondents (N=6)<br />
Dimensions<br />
Measurements<br />
Right hand<br />
Left hand<br />
Palm length (cm) 20.0 19.8<br />
Palm width (cm) 11.4 11.4<br />
Inner grip diameter(cm) 4.8 4.4<br />
Anthropometric measurements that were<br />
studied- palm length, palm width and inner grip<br />
diameter of the sample, and length and width of the<br />
tools. An anthropometer was used to measure the<br />
dimensions i.e., anthropometry of the human body.<br />
Table 3 shows a very minimal variation in palm length.<br />
Palm Index<br />
Table 4. Average Palm Index of the respondents (%) (N=6)<br />
Rolling pin and rolling<br />
board<br />
Right hand<br />
Left hand<br />
Model 1 14.2 14.1<br />
Model 2 18.5 18.8<br />
Model 3 8.2 6.0<br />
Model 4 18.8 17.5<br />
The contact area of the hand with the handle<br />
of the rolling pin is important, the greater the contact<br />
area the better will be the grip. To measure it, the<br />
working area of the handle was painted with lamp<br />
black color and the subjects were asked to hold the<br />
rolling pin as they generally hold them naturally in<br />
the kitchen. An impression of the painted palm was<br />
taken on a plain white paper. Outlines of the painted<br />
area were marked and measured. The equipment<br />
used to conduct the experiment was sliding calipers<br />
and measuring tape. It is evident from the data in<br />
table – 4, that while using model 2 and model 4 rolling<br />
pins the force is distributed to larger area of the palm<br />
compared to other models, increasing the efficiency<br />
of model 3 compared to other models as when grip<br />
force required is distributed to a large pressure<br />
bearing area on the finger and palm to increase the<br />
work efficiency. The result is in accordance with the<br />
study by Hedge and Poncers, (1995) who revealed<br />
that grip force required should get distributed to as<br />
large pressure bearing area on the finger and palm<br />
as possible to increase the work efficiency.<br />
103
Lakshmi et al<br />
Grip strength and wrist angle<br />
As the deviation of the wrist increases the<br />
pressure on the wrist increases therefore fatigue<br />
increases which reduces the grip strength (Varghese<br />
et al. 1994). The deviation of the wrist is more for<br />
model 3 which reduced the grip strength as wrist bend<br />
and hand movements affect interstitial fluid pressure<br />
within the carpal tunnel, and any pressure increase<br />
can compress the median nerve and other structures.<br />
Pressure changes within the carpal tunnel show a<br />
curvilinear relationship between vertical extension/<br />
flexion hand movements and carpal tunnel pressure<br />
increases resulting in increased fatigue and pain in<br />
wrist and fore arm (Rempel et al. 1994). The force<br />
generated decreased and more force has to be applied<br />
while rolling with model 3 resulting in increase of carpal<br />
tunnel pressure as with the hand in neutral posture,<br />
carpal tunnel pressure typically remains below 30mm<br />
Hg. Sustained increases in carpal tunnel pressure<br />
above 30mm Hg are undesirable because they may<br />
detrimentally affect functioning of the median nerve<br />
(Gelberman et al. 1994). Flexion of the wrist beyond<br />
15-40 degrees increases carpal tunnel pressure<br />
beyond 40mm Hg.<br />
Fig 2. Reduction in grip strength (kgs)<br />
Figure 3. Wrist angle (degrees) in deviation<br />
Time taken for Roti Making<br />
The time taken to roll the dough while using<br />
model 2 and 4 was higher when compared to the<br />
other two models because the handles were not comfortable<br />
to hold and roll. The time taken to roll the<br />
dough by model 3 was less compared to others due<br />
to the counter balance of the body and the handle.<br />
The posture of the wrist adopted while using the rolling<br />
pin also influences the force required which in<br />
turn effects the time of operation, as the awkward<br />
posture of wrist and weight of the tool both influences<br />
the cumulative effect of the subject. The present findings<br />
corroborates with the study of Konz (1990) who<br />
reported that the tool should be shaped to allow normal<br />
operation with the hand in neutral position and<br />
as close to the body as possible. Avoiding awkward<br />
postures will have positive effect on the performance<br />
and output. More amount of time was taken to roll<br />
Fig 2. Time taken for roti<br />
the dough for model 4 as the shape of the handle of<br />
the pin was not comfortable which created pressure<br />
at the palm and made the task to complete at slower<br />
pace<br />
104
INDIAN BREAD MAKING TOOLS - CONSUMER EVALUATION AND DESIGN MODIFICATION<br />
Table 5. Difference in heart rate (b.min -1 ) and energy expenditure (kilo joules)<br />
Rolling pin and<br />
rolling board<br />
Heart rate<br />
Energy<br />
expenditure<br />
Model 1 11.3 3.0<br />
Model 2 13.9 4.6<br />
Model 3 9.7 7.5<br />
Model 4 15.1 6.9<br />
Heart rate and energy expenditure of the user<br />
were taken as the indicators to assess the<br />
physiological status of the user. The physiological<br />
evaluation was carried out while using the rolling pin<br />
and rolling board to assess the workload of roti making<br />
using the identified tools.<br />
Energy consumption is the means by which<br />
the severity of physical stress was estimated but it<br />
is evident that energy consumption alone may not<br />
be a sufficient measure. The degree of physical stress<br />
not only depends on the number of kilojoules<br />
consumed but also on the number of muscles<br />
involved and on the extent to which they are under<br />
static load. The same energy consumption by static<br />
muscular effort is distinctly more tiring than if it is<br />
applied to dynamic work. It is evident that work at a<br />
given energy consumption can make different<br />
demands on the heart.<br />
In the present study there is an increase in<br />
heart rate while using model 4. The difference of heart<br />
rate was less pronounced using model 3. While using<br />
model 3 the deviation from the neutral posture is more<br />
resulting in increase of physical stress of rolling the<br />
dough. There is minimum of increase in heart rate<br />
for model 4, where the board is stable and the light<br />
weight body pin. The results are in accordance with<br />
the study by Kroemer and Grandjean (1997) who<br />
mentioned that the heart rate increases linearly with<br />
the work performed, provided it is dynamic, not static<br />
and is performed with a steady rhythm and is<br />
influenced by the posture adopted, force applied and<br />
the type of product. As the heart rate increases energy<br />
consumption also increases. From the experiments,<br />
the problems identified and the suggested<br />
modifications are as follows<br />
Table 6. Design flaws and modifications of pins and boards<br />
Problem Reason Suggested modification<br />
- Decreased grip<br />
strength<br />
- Muscle fatigue<br />
- Sticky nature<br />
of rolling pin<br />
and rolling<br />
board<br />
- Instability of<br />
the rolling<br />
board<br />
- Pressure on<br />
Palm area<br />
while rolling<br />
More force has to be applied by both<br />
the hands due to lack of adequate grip<br />
and light weight material of the rolling<br />
pin in order to roll the dough on the<br />
board.<br />
The adding of flour in order to avoid<br />
sticking the dough to the board and the<br />
pin, the texture changes and the<br />
frequent movement of hand for adding<br />
flour creates pain in hand.<br />
Due to the imbalance of base of the<br />
board make the board move while<br />
rolling<br />
The shapes of the handles and the<br />
length (7.6 cm) of the handles of the<br />
rolling pin tends more force to be<br />
applied on the palm to roll.<br />
The length of the handles can be<br />
increased which would be across the<br />
palm width with the proper grip<br />
diameter of the handles of the rolling<br />
pin.<br />
Provide non-stick finish to the rolling<br />
pin and the rolling board<br />
The board should be designed with<br />
stoppers underneath to avoid<br />
application of high force as the board<br />
can be fixed to a position and roll.<br />
The barrel shaped handles and<br />
increase in length of the handles<br />
across the palm area, avoid the<br />
pressure on the palm while rolling.<br />
105
Lakshmi et al<br />
From the Table 6 it could be concluded that user’s<br />
were not comfortable in handling the available tools<br />
besides they were facing fatigue due to the ill design<br />
features of the tools i.e., the tools were ergonomically<br />
not designed. As the ergonomically designed tools<br />
will fit the users comfort provide safety and efficiency.<br />
So there is a need to design and develop the tools<br />
that are comfortable and efficient to the users.<br />
REFERENCES<br />
Dua, C. G., Edward, J. B and Rick, S. 2010. Silicone<br />
Rolling Pin. United States Patent. Patent<br />
number - US 7,686,752 B2.<br />
Gelberman, R.H., Szabo, R.H and Mortenson, W.W.<br />
1994. Carpal tunnel pressures and wrist<br />
position in patients with colle’s fractures.<br />
Journal of trauma. 24(8):747-749.<br />
Hedge, I and Poncers, R. 1995. Human factors data<br />
guide for evaluation. Journal of Applied<br />
Ergonomics. 11:35-42.<br />
Konz, S. 1990. Bent hammer handles performance<br />
and preference. Journal of Applied Ergonomics.<br />
28:438-440.<br />
Kroemer, K.H.E and Grandjean, E. 1997. The effects<br />
of posture, duration and force on pinching<br />
frequency. International Journal of Industrial<br />
Ergonomics. V edition, Taylor & Francis<br />
Limited. 20:267-275.<br />
Robergs, R. A and Landwehr, R. 2002. The surprising<br />
history of the HR Max = 220 – Age’ equation.<br />
Journal of Exertion Physiology. 5(2). 1 – 10.<br />
Rempel, D., Horie, S and Tal, R. 1994. Carpal tunnel<br />
pressure changes during keying. Marconi<br />
keyboard research conference proceedings<br />
ergonomics laboratory, Berkeley. pp: 1-3.<br />
Varghese, M.A., Atreya, N., Chatterjee, L and<br />
Bhatnagar, A. 1994. Ergonomic Evaluation of<br />
Household Activities. Departmental Research<br />
Report (U.G.C). SNDT Women’s University.<br />
Bombay. New Age International Publishers.<br />
106
Research Notes<br />
J.Res. ANGRAU 41(2) 107-110, 2013<br />
CROP COEFFICIENTS FOR DRIP AND CHECK BASIN IRRIGATED CASTOR FOR<br />
PREDICTION OF EVAPOTRANSPIRATION<br />
B. R. KUMAR, V. PRAVEEN RAO, K. AVIL KUMAR, V. RAMULU,<br />
M. UMA DEVI, AND P. RAGHUVEER RAO<br />
Water Technology Centre, Acharya N.G. Ranga Agricultural University,<br />
Rajendranagar, Hyderabad 500 030<br />
Date of Receipt : 30.01.2013 Date of Acceptance :12.03.2013<br />
The two-step crop coefficient (Kc) x<br />
reference evapotranspiration (ETo) method has been<br />
a successful and dependable means to estimate<br />
evapotranspiration (ET) and crop water requirements<br />
(Praveen Rao and Raikhelkar, 1994). The method<br />
utilizes weather data to estimate ET for a reference<br />
condition (ETo) and multiplies that estimate by a crop<br />
coefficient (Kc) that represents the relative rate of<br />
ET from a specific crop (ETc) and condition to that<br />
of the reference. The reference condition is generally<br />
ET from a clipped, cool season, well-watered grass<br />
(ETo) or from a taller full-cover alfalfa crop (ETr). The<br />
calculation of ET from these surfaces has been<br />
standardized by FAO group of scientists (Allen et<br />
al., 1998).The Kc x ETo approach provides a simple,<br />
convenient and reproducible way to estimate ET from<br />
a variety of crops and climatic conditions (Doorenbos<br />
and Pruitt, 1977; Wright, 1982; Allen et al., 1998).<br />
Developed Kc curves or values represent the ratios<br />
of ETc to ETo during various growth stages. Crop<br />
coefficient values have been reported for a wide range<br />
of agricultural crops (Allen et al., 1998 and 2007).<br />
The Kc is regarded as generally transferable among<br />
regions and climates under the assumption that the<br />
ETo accounts for nearly all variation caused by<br />
weather and climate. Such data is lacking for castor<br />
crop. Hence, the objective of present study was to<br />
derive crop coefficients for drip irrigated castor at<br />
different crop growth stages under variable water<br />
supply levels. Also, methodology for determination<br />
of periodic and peak irrigation requirements was<br />
suggested.<br />
The field experiment was conducted at<br />
College Farm, College of Agriculture, Acharya N.G.<br />
Ranga Agricultural University, Hyderabad (17.19° N,<br />
78.23° E and 543 m altitude) in winter season of 2009<br />
– 10 on a sandy clay soil. The soil was low in N,<br />
medium in P and high in K status and alkaline in<br />
reaction (pH 8.03). The soil water retention capacity<br />
at “0.03 MPa and “1.5 MPa was 0.254 cm 3 cm -3 and<br />
0.130 cm 3 cm -3 , respectively. The available water was<br />
12.4 cm m -1 depth of soil. Soil bulk density was1.43<br />
g cm -3 . The source of irrigation water was open well<br />
with C 3<br />
S 1<br />
water quality. There were seven irrigation<br />
treatments based on surface drip method of irrigation<br />
and irrigation scheduling levels were in the form of<br />
pan evaporation replenishment. The evaporation<br />
replenishment factor viz., 0.4, 0.6 and 0.8 was either<br />
kept constant throughout the crop life or was<br />
combinations of the above at vegetative, flowering<br />
and capsule development stages besides a treatment<br />
of surface check basin irrigated crop at 0.8 IW/CPE<br />
ratio with IW = 50 mm (Table 1). Eight irrigation<br />
treatments were laid out in a randomized block design<br />
with three replications. The dripperlines of 16 mm<br />
diameter were laid out along the crop rows at 1.2 m<br />
spacing with emitters spaced at 0.5 m having a flow<br />
rate of 2 L hour -1 . Flow meters were used to measure<br />
flow rates to each individual treatment according to<br />
designated pan evaporation (Epan) replenishment<br />
factor. Hybrid ‘PCH 111’ was planted on the 7 th of<br />
November 2009 by adopting a row-to-row spacing of<br />
1.2 m and plant to plant distance of 0.5 m in plots of<br />
18.0 m x 7.2 m. A fertilizer dose of 60 kg N, 40 kg<br />
P 2<br />
O 5<br />
and 30 kg K 2<br />
O ha was applied through fertigation<br />
at weekly intervals up to 100 days after sowing. The<br />
crop was harvested in 4-pickings and the last picking<br />
was on the 5 th of April, 2010. The total depth of<br />
irrigation water applied in drip irrigated treatments<br />
varied between 227 mm (0.4 Epan) to 453 mm (0.8<br />
Epan), whereas in surface check basin irrigated crop<br />
it was 450 mm.<br />
email: v.prao@yahoo.com<br />
107
KUMAR et al<br />
For determination of crop ETc the soil moisture was<br />
monitored by delta probe at four locations in various<br />
depths before and after each irrigation and on<br />
intermediate dates in case of incident precipitation.<br />
Effective rainfall was estimated by following standard<br />
procedure (Dastane, 1974) and it amounted to 13.05<br />
mm during crop growing period. The groundwater<br />
contribution (GWc) to ETc was nil. The reference crop<br />
evapotranspiration (ETo) was estimated at specific<br />
crop growth sub-periods based on Penman Monteith<br />
equation (Allen et al., 1998). Thus the data obtained<br />
on ETc of castor and ETo at specific crop growth<br />
sub-periods were used to calculate the crop coefficient<br />
(Kc) as follows<br />
Kc = ETc ÷ ETo<br />
For constructing the crop coefficient curve<br />
(Fig. 1) the crop life of castor was divided into<br />
germination and establishment, vegetative, flowering,<br />
capsule development, seed filling and maturity<br />
periods. To use Kc values for predicting crop ETc<br />
(ETc = Kc.ETo) throughout the crop season, only<br />
ETo estimates on Penman Monteith method from<br />
the new planting site are needed.<br />
As an application of this study in irrigation<br />
water management, the estimates of ETc for castor<br />
crop from the Kc values of highest yielding irrigation<br />
treatment I 6<br />
(drip irrigated at 0.6Epan up to flowering<br />
i.e., 81 DAS and 0.8Epan later on) were used to<br />
determine the actual irrigation requirements for a given<br />
design as follows:<br />
Ir = ETc x Growth period in days<br />
In which, Ir is net irrigation requirement (cm)<br />
for the growth period considered and ETc is crop<br />
evapotranspiration (mm/day).<br />
V at field inlet = (10 ÷ Ea) × (A.Ir ÷1 – LR) m 3<br />
In which, V is gross irrigation requirement<br />
for the period considered (m 3 ); Ea is field application<br />
efficiency (0.9); A is area (1.0 ha); Ir is net irrigation<br />
requirement (cm); LR is leaching requirement (nil);<br />
and Ep is project efficiency under groundwater<br />
irrigation through bore wells (0.9).<br />
Crop Coefficients<br />
Data on crop coefficients (K c<br />
) calculated<br />
based on castor crop ET c<br />
and ET o<br />
derived from<br />
Modified Penman method are presented in Table 1.<br />
The Kc values during the germination and<br />
establishment period were not markedly different from<br />
each other owing to uniform water application, since<br />
the crop was subjected to variable water supply levels<br />
only from 15 DAS. However, at the later growth stages<br />
of vegetative, flowering, capsule development, seed<br />
filling and maturity stages the Kc values were higher<br />
under surface irrigation method as compared to them<br />
under drip irrigated treatments owing to higher<br />
irrigation water depth. The highest value of the Kc<br />
was 1.206 and 1.108 under surface check basin<br />
irrigation (0.8 IW/CPE ratio) and drip irrigation crop<br />
(I 3<br />
), respectively.Likewise the Kc values in I 6<br />
treatment<br />
were comparable to I 8<br />
. Whereas, for I 1<br />
treatment<br />
irrigation at only 0.4Epan at all the crop growth subperiods<br />
(15 to 150 days), the maximum value of the<br />
Kc was 0.566. Thus, the K c<br />
values were primarily a<br />
function of evaporation replenishment factor during<br />
a given crop growth sub-period under drip irrigated<br />
crop and the amount of water applied under surface<br />
check basin irrigated crop. Higher the replenishment<br />
factor i.e., higher the water application level, greater<br />
were the K c<br />
values owing to higher ETc rates since<br />
Kc is a ratio between ETc and ETo.<br />
Crop Coefficient Curve<br />
The crop coefficient curve shown in Fig. 1<br />
was derived from Kc values of I 2<br />
treatment registering<br />
optimal bean yield, maximum net returns with higher<br />
water productivity. For comparision, the Kc curve for<br />
surface check basin irrigated crop (I 8<br />
) raised irrigating<br />
at 0.8 IW/CPE ratio is also depicted in Fig. 1. The<br />
Kc values for I 8<br />
and I 2<br />
treatment varied between 0.436<br />
to 1.206 and 0.411 to 0.804, respectively. The higher<br />
Kc values for surface check basin irrigated castor<br />
crop may be attributed to unavoidable deep<br />
percolation losses and higher soil evaporation owing<br />
to complete wetting of the soil surface (Bucks and<br />
Nakayama, 1982). On the other hand irrigation<br />
scheduling under drip irrigation is evapotranspiration<br />
based with localized wetting pattern (Schwankl et al.,<br />
1996 and Andreu et al., 1997) eliminating deep<br />
percolation losses contributing to lower Kc values.<br />
The Kc value from sowing to establishment was small<br />
in view of very little (incomplete) canopy cover (LAI<br />
= 0.067) and majority of the water loss may be<br />
attributed to evaporation from the soil. Thereafter the<br />
Kc value increased linearly due to increase in crop<br />
ETc as the crop grew rapidly and developed more<br />
108
CROP COEFFICIENTS FOR DRIP AND CHECK BASIN IRRIGATED CASTOR<br />
Table 1. Crop coefficients of castor in relation to ETo by FAO Modified Penman method as influenced by different irrigation treatments<br />
Table 2. Irrigation requirements of drip irrigated castor (variety PCH 111)<br />
109
KUMAR et al<br />
leaf area (LAI = 0.067 to 2.05) from establishment<br />
through vegetative to flowering period to attain Kc<br />
values of 0.760 and 1.049 under I 3<br />
(drip irrigated) and<br />
I 8<br />
(surface check basin irrigated), respectively. From<br />
flowering to capsule development period the Kc<br />
almost remained constant and varied between 0.760<br />
to 0.804 and 1.049 to 1.206. This could be attributed<br />
to full leaf canopy cover (LAI = 2.6) and its<br />
persistence (leaf area duration = 42.3 m 2 days)<br />
intercepting maximum photosynthetically active<br />
radiation. During the final 33-days of crop life the Kc<br />
value decreased precipitously reaching a low value<br />
of 0.320 in I 3<br />
and 0.466 in I 8<br />
treatment. This could be<br />
due to reduction in crop ETc owing to unproductive/<br />
senescence of leaves (LAI = 1.95) and partly due to<br />
reduced root activity.<br />
REFERENCES<br />
Allen, R.G., Pereira, L.S., Raes, D and Smith, M.<br />
1998. Crop evapotranspiration: guidelines for<br />
computing crop water requirements. Irrigation<br />
and Drainage Paper No. 56, FAO, Rome, pp.<br />
300.<br />
Allen, R.G., Wright, J.L., Pruitt, W.O and Pereira,<br />
L.S. 2007. Water requirements. In: Design and<br />
operation of farm irrigation systems, Chapter<br />
8, 2 nd edition. ASAE Monograph.<br />
Andreu, L., Hopmans, J.W and Schwankl, L.J. 1997.<br />
Spatial and temporal distribution of soil water<br />
balance for a drip-irrigated almond tree.<br />
Agricultural Water Management 35:123 – 146.<br />
Bucks, D. A and Nakayama, F. S. 1982.Principles,<br />
practices and potentialitiesof trickle (drip)<br />
irrigation. Advances in Irrigation 1: 219 – 298.<br />
Dastane, N.G. 1974. Effective Rainfall. Irrigation and<br />
Drainage Paper No. 25. FAO, Rome, pp. 62.<br />
Doorenbos, J and Pruitt, W.O. 1977. Crop water<br />
requirements. Irrigation and Drainage Paper No.<br />
24 (revised) FAO, Rome, pp. 144.<br />
Praveen Rao, V and Raikhelkar, S.V. 1994.<br />
Evapotranspiration of sesame in relation to pan<br />
evaporation. Indian Journal of Agricultural<br />
Sciences 64: 771 – 774.<br />
Schwankl, L. J., Edstrom, J. P and J. W. Hopmans.<br />
1996. Performance of microirrigation systems<br />
in almonds. Proceedings of Seventh<br />
International Conference on Water and<br />
Irrigation. Tel Aviv, Israel, pp. 123 – 132.<br />
Wright, J.L. 1982. New evapotranspiration crop<br />
coefficients. Journal of Irrigationand Drainage<br />
Division ASCE 108:57–74.<br />
110
Research Notes<br />
J.Res. ANGRAU 41(2) 111-114, 2013<br />
STUDY ON THE EFFECT OF IRRADIATION ON STORAGE QUALITY<br />
OF TOMATO PUREE<br />
M. KIRTHY REDDY and V. VIJAYALAKSHMI<br />
College of Home Science, Acharya N.G. Ranga Agricultural University, Saifabad, Hyderabad-500004<br />
Date of Receipt : 20.11.2012 Date of Acceptance : 10.05.2013<br />
Fruits and vegetables are living entities and<br />
undergo several physiological changes (Haard and<br />
Salunkhe, 1980). Even five per cent loss of water<br />
causes many vegetables to appear wilted or shriveled<br />
and eventually unmarketable. These characters<br />
significantly limit the storage life of increasing rapidly<br />
both at domestic and international market with major<br />
portion of it being used in preparation of convenience<br />
food. Thus, there exists a need to develop a suitable<br />
technology for processing and preservation of this<br />
valuable produce in a way that will not only check<br />
losses but also generate additional revenue.<br />
Food irradiation is a processing technology<br />
aimed at the improvement of food safety, which has<br />
gained interest of researchers in the fields of food<br />
science and consumer research worldwide during the<br />
past few decades. This technology is already<br />
recognized as a technically feasible method for<br />
reducing postharvest food losses, ensuring the<br />
hygienic quality of food, longer storage of food,<br />
therefore facilitating wider food trade (Jyoti et al.<br />
2009).<br />
As tomato is most important source of<br />
lycopene, a study was undertaken to understand the<br />
effect of irradiation on storage quality of tomato puree.<br />
Fully riped 618 local tomato variety was<br />
purchased from the local market. These tomatoes<br />
were processed into puree using standard method<br />
(Srivastava, 2004).<br />
150 guage polythene bags of size 5x6 inches<br />
were used for packing and storing of the products.<br />
Processed products were subjected to four<br />
treatments. T 1<br />
– Control product in which chemical<br />
preservatives (0.5g of sodium benzoate per kg) is<br />
added and remaining three samples without chemical<br />
preservatives were irradiated using gamma irradiations<br />
at dosages of 0.50 kGy (T 2<br />
), 1.00 kGy (T 3<br />
), 2.00 kGy<br />
(T 4<br />
). Non irradiated and irradiated samples were kept<br />
for storage up to 60 days at ambient temperature.<br />
Samples were analyzed for physico – chemical and<br />
microbial analysis on the day of preparation i.e on 0<br />
day, 30 th day and 60 th day.<br />
Titrable acidity, vitamin C and Total Soluble<br />
Solids was determined by the method developed by<br />
Ranganna (1986), moisture was analysed by the<br />
method AOAC (1990), lycopene content was analysed<br />
by method developed by Ranganna (2001), reducing<br />
sugars were determined by Lane and Eynon method<br />
(AOAC, 1965) and microbial analysis (Total Bacterial<br />
Count, Total Mould Count) was carried out by<br />
Cruikshank et al. (1975). All these were estimated<br />
on 0 day, 30 th day and 60 th day. All the reported values<br />
are the mean of triplicates and the experimental<br />
results were subjected to two way analysis of<br />
variance at (p < 0.05).<br />
Preparation of tomato puree Tomatoes were<br />
thoroughly washed and blanched at 85 o C for 2-3 min.<br />
Tomatoes were passed through pulper to get the<br />
pulp and strained to remove seeds. The strained pulp<br />
was concentrated to 12 percent total soluble solids<br />
(heavy tomato puree).In the control product 0.5g of<br />
sodium benzoate per kg was added as a preservative<br />
in the final stage of preparation and after cooling<br />
packed in polyethylene bags.<br />
Titrable acidity In tomato puree the titrable acidity<br />
increased significantly (p < 0.05) during the storage<br />
period. The acidity values were lower on 0 day<br />
(0.61%) and higher on 60 th day (0.67%). Among all<br />
the treatments highest acidity was observed in T 1<br />
(0.68%), followed by T 3<br />
(0.64%) and lower acidity in<br />
T 2<br />
(0.62%) which was almost same with T 4<br />
(0.63%).<br />
No significant changes were observed among the<br />
observed among the interactions between treatments<br />
and periods. According to Iqbal et al. (2001) the<br />
reason for the increase in acidity could be oxidation<br />
email: kirthy88@gmail.com<br />
111
REDDY and LAKSHMI<br />
of reducing sugars (sucrose), formation of acids by<br />
break down of polysaccharides and by degradation<br />
of pectic compounds and uronic acid. (Table1)<br />
Total soluble solids TSS increased from 0 day<br />
(12.00%) to 60 th day (12.09%) Table 1. A study<br />
conducted by Zindarcic and Pozrl (2006) reported<br />
similar results that soluble solids increased slightly<br />
from 5.06 % to 6.92 % at 5 0 C (during 28 days period)<br />
and from 5.06 % to 6.26 % at 10 0 C (during 21 days<br />
period). Significant differences (p < 0.05) were<br />
observed among treatments of but T 1<br />
(12.05%)<br />
followed by T 2<br />
(12.02%) and T 3<br />
(12.01%) whereas<br />
sample T 4<br />
did not record any changes and retained<br />
same TSS content (12.00%) throughout the period<br />
of study. A slight increase in TSS was observed in<br />
all the products which may be due to loss of moisture<br />
leading to increased concentration of the product<br />
Moisture content The results in Table 1 show that<br />
there was significant difference (p < 0.05) in the<br />
moisture content of puree from 0 day (81.24%) to<br />
30 th day (80.18%). As the storage period increased<br />
moisture content decreased in all treatments.<br />
Decrease in the moisture content of the product may<br />
be due to high temperature and low humidity in the<br />
ambient conditions. Other reason for decrease can<br />
also be attributed to 150 gauge polythene bags, used<br />
for packing the products.<br />
Vitamin C According to Table 1 significant<br />
differences (p < 0.05) were observed in vitamin C<br />
content during the period of storage. Tomato puree<br />
had high vitamin C content on 0 day (38.71mg %)<br />
which then decreased significantly by the 60 th day<br />
(4.17mg %). Rapid decrease in vitamin C content<br />
was observed from 0 day (48.71mg %) to 30 th day<br />
(8.88mg %).<br />
Among all the treatments T 1<br />
recorded higher<br />
vitamin C content (19.03mg %) followed by T 2<br />
(17.97mg %) and least in T 4<br />
(15.19mg %). Vitamin C<br />
content decreased significantly as the irradiation<br />
dosages and days of storage increased. This was<br />
confirmed by Tobback (1977) that ascorbic acid is<br />
very sensitive to ionizing radiation. The ascorbic acid<br />
gets converted to dehydroascorbic acid on irradiation<br />
treatment, which becomes highly unstable leading<br />
to loss of vitamin C.<br />
Lycopene: Results showed that significant changes<br />
(p < 0.05) were recorded in lycopene content. There<br />
112<br />
was a drastic decrease from 0 day (13,318.46 µg %)<br />
to 30 th day (8143.11 µg %) which further decreased<br />
to 3688.80 µg % on 60 th day. Significant changes (p<br />
< 0.05) were noticed among the treatments in which<br />
lycopene content was highest in T 1<br />
(9.462.75 µg %)<br />
and lowest in T 4<br />
(7,527.58 µg %). Significant<br />
differences (p < 0.05) were observed between<br />
treatments and periods. (Table 2). This was justified<br />
by Capanoglu et al. (2008) claimed that the losses in<br />
lycopene of 4.6%, was caused by the removal of<br />
seed and skin during the processing. The additional<br />
loss is presumably attributable to oxidation reactions<br />
taking place during processing treatments.<br />
Reducing sugars Significant changes (p < 0.05)<br />
were observed in reducing sugars in tomato puree<br />
during the storage periods. Tomato puree had higher<br />
reducing sugars on 60 th day (10.37%) when compared<br />
to 30 th day (7.36%) and 0 day (4.41%). (Table 2).<br />
The increase in reducing sugars may be due to<br />
hydrolysis of sugars by acids or due to degradation<br />
of disaccharides to monosaccharides (Reddy,<br />
2004).The values of reducing sugars varied<br />
significantly (p < 0.05) among the treatments.<br />
Reducing sugars were more in T 1<br />
(7.49%) followed<br />
by T 2<br />
(7.44%) and T 3<br />
(7.30%). Lowest reducing sugars<br />
were observed in T 4<br />
(7.28%). Significant changes were<br />
observed in the interaction effects. Reducing sugars<br />
increased on storage period in all the treatments.<br />
Total Bacterial Count and Total Mould<br />
Count On 0 day no bacterial count was recorded in<br />
T 3<br />
and T 4<br />
but T 1<br />
recorded 0.13 cfu g/ml (cfu = Colony<br />
Forming Units) and T 2<br />
recorded 0.10 cfu g/ml. On<br />
30 th day bacterial count was more than double of that<br />
was noticed on 0 day. Highest bacterial count was<br />
recorded in T 1<br />
(0.43 cfu g/ml) and in T 4<br />
nil count was<br />
observed proving that at higher irradiation dosage<br />
bacterial growth could be controlled. Higher bacterial<br />
count was observed in T 1<br />
(0.80 cfu g/ml), followed<br />
by T 2<br />
(0.70 cfu g/ml) and least was recorded in T 4<br />
(0.16 cfu g/ml) on 60 th day (Fig 1). Traces of bacteria<br />
can be attributed to non-sterilization of the<br />
polyethylene covers. No mould growth was noticed<br />
in both tomato puree and crush samples in the entire<br />
period of storage study of 60 days. Similar results<br />
were reported by Langerak and Damen (1978) in<br />
prepacked soup-green stored at 10 0 C.
STUDY ON THE EFFECT OF IRRADIATION ON STORAGE QUALITY OF TOMATO PUREE<br />
Table 1. Physico- chemical parameters of Tomato puree<br />
Table 2. Lycopene and reducing sugar content of Tomato puree<br />
Where T1 = control, T2 = 0.5 kGy, T3 = 1.00 kGy, T4 = 2.00 kGy *significant<br />
113
REDDY and LAKSHMI<br />
Fig. 1. Total bacterial count of tomato puree<br />
REFERENCES<br />
AOAC,1990. Official methods of analysis for<br />
moisture. Association of Official Analytical<br />
Chemists, 14 th Ed. Washington, DC. Vol.2.<br />
AOAC, 1965 Official Methods of Analysis,<br />
Association of Official Analytical Chemists,<br />
Washington, D C 12 th Edition 31.054, 22 :109.<br />
Capanoglu, E., Beekwilder, J., Boyacioglu, D., Hall,<br />
R.D and De Vos, C.H.R. 2008. Changes in<br />
antioxidants and metabolite profiles during<br />
production of tomato paste. Journal of<br />
Agricultural and Food Chemistry 56 (3): 964–<br />
973.<br />
Cruickshank, R., Duguid, J P., Marmion, B P and<br />
Surain, R H A. 1975. Medical Microbiology.<br />
The practice of medical microbiology. Churchill<br />
Livingstone, Edinbargh, London and Newyork<br />
p. 306.<br />
Haard N. F and Salunkhe D.K. 1980. Perspectives<br />
of post harvest physiology. In symposium:<br />
post harvest biology and handling of fruits and<br />
vegetables. AVI publishing Company,<br />
USA.pp:1-4.<br />
Iqbal, S.A., S.Yasmin, Wadud and Shah. W.H. 2001.<br />
Production storage packing and quality<br />
evaluation of Gouva Nectar. Pakistan Journal<br />
of Food Science. 11: 33-36.<br />
Jyoti, P. M., Sukalyan, C., Sandeep, K., Subrata,<br />
P., Jiin-Shuh, J., Alok, C. S., Anindita, C and<br />
Subhas, C. S. 2009. Effects of gamma<br />
irradiation on edible seed protein, amino acids<br />
and genomic DNA during sterilization. Food<br />
Chemistry. 114: 1237–1244.<br />
Langerak, D. I and Damen, G. A. 1978. Influence of<br />
irradiation on the keeping quality of prepacked<br />
soup-greens stored at 10 0 C. In: food<br />
preservation of irradiation. Vol 1 Proc. Series<br />
International Atomic Energy Agency. Vienna,<br />
Austria pp:221: 275-282.<br />
Ranganna, S. 1986. Hand book of Analysis and<br />
Quality control for fruit and vegetable products.<br />
Tata McGraw Hill., New Delhi. 7-12.<br />
Ranganna S, 2001. Handbook of Analysis and quality<br />
control for fruit and vegetable products II<br />
Edition Tata McGraw Hill.<br />
Reddy, G.N.V.V. 2004. Studies on methods on<br />
extraction of sapota juice for optimum yield<br />
and quality. MSc. Thesis submitted to<br />
Acharya N.G. Ranga Agricultural University,<br />
Hyderabad, India.<br />
Srivastava, R.P. 2007. Fruits and Vegetable<br />
preservation. Principles and practices. Tomato<br />
processing. 265-266.<br />
Tobback, P.P. 1977. Radiation chemistry of vitamins.<br />
In : P S. Elias and A.J.Lohen (eds) Radiation<br />
chemistry of major food components. Elsevier<br />
Scientific Publishing Co., New York. PP.213<br />
Žnidarèiè, D., Trdan, S and Zlatiè, E. 2003. Impact<br />
of various growing methods on tomato<br />
(Lycopersicon esculentum Mill.) yield and<br />
sensory quality. Res. Rep., Biotech. Fac.,<br />
Univ. Ljublj., Agric. issue 2. 81: 341-348.<br />
114
Research Notes<br />
J.Res. ANGRAU 41(2) 115-117, 2013<br />
EVALUATION OF DEFOLIANTS ON MUNGBEAN Vigna radiata L.<br />
AS HARVESTING TOOLS<br />
B. PADMAJA, M. MALLA REDDY, S. MALATHI and D. VISHNU VARDHAN REDDY<br />
AICRP on Pigeon pea, Regional Agricultural Research Station,<br />
Acharya N.G.Ranga Agricultural University, Warangal – 506 007<br />
Date of Receipt : 06.12.2012 Date of Acceptance : 10.05.2013<br />
India is the largest producer and consumer of<br />
mungbean and it alone accounts for about 65% of<br />
the world acreage and 54% of the world production<br />
(Singh and Singh, 2011). It is cultivated across the<br />
country throughout the year. Manual harvesting of<br />
mungbean is labour-intensive and hence mechanical<br />
harvesting is an option to overcome labour shortage<br />
and reduce production costs. Mungbean foliage does<br />
not dry or abscise when pods are mature. This is the<br />
major limiting factor in mechanical harvesting. Hence,<br />
plants must be defoliated to facilitate mechanical<br />
harvesting. Moreover, it aids in the addition of organic<br />
matter to the soil through leaf fall before harvesting.<br />
Defoliation is shedding of leaves that usually<br />
occur when the leaves become physiologically<br />
mature. Leaf shedding (abscission) results from<br />
activity of special cells in the abscission layer at the<br />
base of the leaf petiole where it joins the stem.<br />
Several factors like frost, disease, drought and<br />
mineral deficiency cause defoliation. It also can be<br />
artificially induced by the use of certain chemicals<br />
called “defoliants”. Desiccation is drying of plant<br />
tissues due to disruption of cell membranes and rapid<br />
loss of moisture, often resulting in “stuck leaves”.<br />
Defoliants or desiccators are widely used in cotton<br />
production. There are many categories of defoliants.<br />
Hormonal defoliants enhance ethylene production and<br />
/ or inhibit auxin transport in the plant (Gwathmey<br />
and Craig, 2007). The balance of these hormones<br />
affects leaf abscission. Cells in the abscission layer<br />
in the petiole separate due to cell wall degrading<br />
enzymes that respond to decreasing auxin-toethylene<br />
ratio. Herbicidal defoliants injure the plant<br />
causing it to produce ethylene in response. Ethylene<br />
promotes leaf abscission by increasing the activity<br />
of enzymes such as pectinase and cellulase, which<br />
degrade cell walls and middle lamellae in the<br />
abscission zone of the petiole. Defoliation response<br />
of hormonal defoliants is generally more sensitive to<br />
temperature and crop conditions than that of<br />
herbicidal defoliants.<br />
The indeterminate flowering habit of mungbean<br />
coupled with accumulation of more dry matter during<br />
rainy season, can pose many harvesting problems.<br />
Further, in mechanical harvesting, weeds in the field<br />
may also pose problems to the performance of<br />
harvesting machines. Hence herbicides like<br />
Glyphosate (4.0 lit/ha) and Paraquat (2.5 lit/ha) can<br />
be used to remove weeds and to achieve defoliation<br />
(Copur et al., 2010). Bi et al. (2005) reported that<br />
other chemicals like CuEDTA and ZnSO 4<br />
also<br />
promote defoliation of leaves in plants. The ideal<br />
stage of harvesting is when majority of pods are<br />
physiologically mature, and 90% of the pods have<br />
turned either yellow or black. At this stage the crop<br />
attains maximum maturity and will be at optimum<br />
yield and quality. At this stage the crop should be<br />
considered ready for either desiccant or defoliant<br />
application. Available literature indicates that<br />
information on defoliants in mungbean is scanty.<br />
Therefore, an experiment was conducted to assess<br />
the effect of certain chemicals on the defoliation of<br />
mungbean.<br />
The experiment was carried out at Regional<br />
Agricultural Research Station, Warangal during rainy<br />
season of 2009. The soil was sandy loam with a P H<br />
of 7.9 and EC of 0.2 d Sm -1 , low in organic carbon<br />
(0.3%) and available N (263 kg/ha), medium in<br />
available P 2<br />
O 5<br />
(28 kg/ha) and available K 2<br />
O (295 kg/<br />
ha). Mungbean crop variety, WGG-37 was sown on<br />
June 30 th 2009. All the cultivation practices were<br />
followed as per the recommendations to the region.<br />
The experiment was laid out in a Randomized Block<br />
Design comprising seven treatments with three<br />
replications each in plot size of 6.0 x 6.0 m. Spraying<br />
of test chemicals was done at physiological maturity<br />
email: maduri_agron@yahoo.com<br />
115
PADMAJA et al<br />
stage i.e., on 16-09-2009 (78 days after sowing). The<br />
treatments consisted of T 1<br />
: Control (No spray), T 2<br />
:<br />
Urea @ 10%, T 3<br />
: Diammonium Phosphate (DAP)<br />
@ 10%, T 4<br />
: DAP @ 10% + ZnSO 4<br />
@ 0.2%,T 5<br />
:<br />
Paraquat @ 5 ml/lt, T 6<br />
: Glyphosate @ 10 ml/lt<br />
and T 7<br />
: Etherel @ 10 ml/lt. Leaf count/m 2 was taken<br />
before spraying and at 7 and 15 days after spraying.<br />
Mean minimum and maximum temperatures of 25.0-<br />
27.0 C 0 and 32.2-39.0 C 0 , respectively and an amount<br />
of 301.5 mm of rainfall were recorded in 22 rainy days<br />
during the study period.<br />
Results showed that among all the treatments,<br />
spraying of Paraquat @ 5 ml/lt at physiological<br />
maturity caused drying and fall of mungbean leaves<br />
to 96% by the first week and 99% by the end of<br />
second week after spraying, followed by Glyphosate<br />
@ 10 ml/lt which influenced the defoliation to 93 and<br />
97 per cent, respectively (Table 1). These two<br />
herbicides were significantly superior to control as<br />
well as other treatments. These results are in<br />
agreement with Cothren et al. (1999) and Santi et al.<br />
(2000). Spraying of Urea or DAP or Etherel could not<br />
influence defoliation as they were at par with control.<br />
Between the two herbicides, the cost incurred (Rs. /<br />
ha) was lowest with Paraquat (Rs. 1,150/- per ha)<br />
compared to Glyphosate (Rs. 2,175/- per ha). The<br />
cost of application of Etherel was the highest (Rs.<br />
8,250/- per ha) among all the treatments. Deosarkar<br />
et al. (2009) also reported that etherel @ 6000 ppm<br />
could influence complete drying of leaves by 6-7 days<br />
after spraying but leaves remained attached to plant<br />
in cotton.<br />
The seed yield of mungbean was not significantly<br />
affected by spraying of the defoliants. But the cost<br />
of harvesting was reduced in Paraquat applied<br />
treatment (Rs. 2,200/- per ha) followed by Glyphosate<br />
Table 1. Influence of certain chemicals on the defoliation, seed yield and economics of mungbean<br />
Treatment<br />
T 1 : Control (No<br />
spray)<br />
T 2 : Urea @<br />
10%<br />
Before<br />
spraying<br />
% defoliation Seed<br />
yield<br />
(kg/ha)<br />
1<br />
week<br />
after<br />
sprayi<br />
-ng<br />
Two<br />
weeks<br />
after<br />
spraying<br />
One<br />
week<br />
after<br />
spraying<br />
286 112 87 60.84<br />
(50.85)<br />
344 129 87 62.50<br />
(52.02)<br />
T 3 : DAP @ 10% 323 85 54 73.68<br />
(58.99)<br />
T 4 : T 3 + ZnSO 4<br />
@ 0.2%<br />
T 5 : Paraquat @<br />
5 ml/lt<br />
T 6 : Glyphosate<br />
@ 10 ml/lt<br />
T 7 : Etherel @<br />
10 ml/lt<br />
334 79 59 76.35<br />
(62.08)<br />
355 13 3 96.34<br />
(81.26)<br />
428 32 14 92.52<br />
(78.83)<br />
480 121 88 74.79<br />
(61.87)<br />
Two<br />
weeks<br />
after<br />
spraying<br />
69.58<br />
(56.28)<br />
74.71<br />
(60.41)<br />
83.28<br />
(66.25)<br />
82.33<br />
(67.38)<br />
99.15<br />
(87.16)<br />
96.73<br />
(88.03)<br />
81.67<br />
(66.90)<br />
* Values in the parentheses are the arc sine transformation of the percentage<br />
** Labour cost for harvesting (Rs. /day): 100<br />
*** Number of labourers engaged for harvesting in control was 43 man days per ha<br />
Harves<br />
ting<br />
cost<br />
(Rs./ha)<br />
Addition<br />
al cost<br />
incurred<br />
over<br />
control<br />
(Rs./ha)<br />
485 4250 -<br />
497 3400 501<br />
503 3450 736<br />
510 3500 691<br />
490 2200 1150<br />
495 2450 2175<br />
506 2700 8250<br />
SEm+ - - - 5.32 5.37 20.8 - -<br />
CD at 5% - - - 16.39 16.55 NS - -<br />
116
EVALUATION OF DEFOLIANTS ON MUNGBEAN Vigna radiata L. AS HARVESTING TOOLS<br />
treatment (Rs. 2,450/- per ha) due to increased labour<br />
efficiency because of less interference of leaves in<br />
harvesting of pods (Table 1). These results<br />
corroborate with the findings of Rajni et al. (2011) in<br />
Bt cotton. Thus herbicidal defoliants can be<br />
successfully applied for aiding the harvest of<br />
mungbean.<br />
REFERENCES<br />
Bi G, Scagel, C. F., Cheng, L Fuchigani, I. H. 2005.<br />
Effects of defoliants (CuEDTA and ZnSO 4<br />
) and<br />
foliar urea on defoliation, nitrogen reserves and<br />
regrowth performance of almond nursery plants.<br />
Journal of Horticultural Science and<br />
Biotechnology 80: 746-750.<br />
Copur, O., Dernirel, U., Polat, R and Gur, M. A. 2010.<br />
Effect of different defoliants and application<br />
times on the yield and quality components of<br />
cotton in semi-arid conditions. African Journal<br />
of Biotechnology 9(14): 2095-2100.<br />
Cothren, J. T., Jost, P. H and Biles, S. P. 1999.<br />
Cotton desiccation and defoliation<br />
by Paraquat influenced by time of day. Crop<br />
Science 39(3):859-862.<br />
Deosarkar, D. B., Gaikwad, A. R and Patil, S. G.<br />
2009. Effect of etherel defoliant on cotton<br />
variety NH-615 In: Proceedings of National<br />
Symposium on Bt cotton: Opportunities and<br />
prospects, 15-17 November 2009,CICR,<br />
Nagpur, India. Pp 87.<br />
Gwathmey,C.O and Craig, C. C. 2007. Defoliants for<br />
cotton. In: P David (Eds), Encyclopedia of<br />
Pest Management, Volume II, CRC Press,<br />
USA. Pp 135-137.<br />
Rajni, Deol, J. S and Brar, A. S. 2011. Effect of<br />
chemical defoliation on boll opening<br />
percentage, yield and quality parameters of<br />
Bt cotton Gossypium hirsutum . Indian Journal<br />
of Agronomy 56(1): 74-77.<br />
Singh, D. P and Singh, B. B. 2011. Breeding for<br />
tolerance to a biotic stresses in mungbean.<br />
Journal of Food Legumes 24(2): 83-90.<br />
Santi, P., Wilaiwan, P., Suwimol, T and Sumana, N.<br />
2000. Effect of rate and time of Paraquat and<br />
urea applications on mungbean defoliation<br />
before harvesting. In: Proceedings of National<br />
Mungbean Research Conference VIII, 18-20<br />
January 2000, Nakhan Pathom,Thailand. Pp<br />
85-92.<br />
117
Research Notes<br />
J.Res. ANGRAU 41(2) 118-122, 2013<br />
YIELD, NUTRIENT UPTAKE AND ECONOMICS OF CASTOR AS<br />
INFLUENCED BY INTEGRATED NUTRIENT MANAGEMENT IN<br />
PONGAMIA + CASTOR AGRISILVISYSTEM<br />
K. INDUDHAR REDDY, S. HEMALATHA, G. JAYASREE and V. PRAVEEN RAO<br />
Department of Forestry, College of Agriculture, Rajendranagar, Hyderabad- 500 030<br />
Date of Receipt : 04.07.2012 Date of Acceptance : 05.03.2013<br />
One of the need based alternative land use<br />
system replacing the traditional farming system is a<br />
tree based system of cropping i.e., agroforestry which<br />
acts as sustainable land management system<br />
especially in dry land areas.<br />
Pongamia pinnata is a multipurpose tree species<br />
(MPTS) and it is a good nitrogen fixing tree also.<br />
This tree species is sustainable for agroforestry<br />
farming because of its fast growth and nitrogen<br />
fixation. It is the best suited tree for energy<br />
plantations.<br />
Since the gestation period is high in Pongamia<br />
and because of wider spacing between the trees the<br />
interspaces can be effectively used for intercropping.<br />
Castor (Ricinus communis L.) being one of the<br />
important non edible oil seed crop of the country and<br />
also A.P., is largely cultivated under rain fed<br />
condition. Castor is the second most important<br />
oilseed crop of Andhra Pradesh in terms of acreage<br />
and economy after groundnut. The average yields of<br />
the crop were 1346 kg ha -1 and 510 kg ha -1 for India<br />
and Andhra Pradesh respectively (CMIE, 2010) which<br />
was regarded as very low though occupying first rank<br />
in area in the country. For improved production of<br />
castor, application of required quantities of fertilizer<br />
is imperative through sustained soil health. Soil<br />
fertility build up through agroforestry and practice of<br />
integrated nutrient management were suggested as<br />
potential means to increase the soil fertility especially<br />
in dry lands (Reddy et al. 1993).For efficient<br />
production and management of castor in dry lands it<br />
is necessary to seek alternate practices like<br />
integrated nutrient management and soil and moisture<br />
conservation.<br />
Keeping these facts in view, a comprehensive<br />
study is therefore planned in which different<br />
combinations of organic manures and inorganic<br />
fertilizers were applied to Pongamia + Castor agrisilvi<br />
system.<br />
The experiment was conducted during Kharif<br />
2010-11 in alfisols at students’ farm, College of<br />
Agriculture, Rajendranagar, Hyderabad. The soil was<br />
red sandy loam in texture and neutral in soil reaction,<br />
low in organic carbon and available nitrogen and<br />
medium in available phosphorous and potassium. The<br />
experiment was laid out in Randomized block design<br />
with three replications and nine treatments viz., T1-<br />
Control; T2-100% Recommended Dose of Nitrogen<br />
(RDN) (Inorganic);T3-75% RDN (Inorganic); T4-75%<br />
RDN (Inorganic) + 25% RDN (FYM); T5-75% RDN<br />
(Inorganic) + 25% RDN (Neem cake); T6-75% RDN<br />
(Inorganic) + 12.5% RDN (FYM) +12.5% RDN (Neem<br />
cake); T7-50% RDN (Inorganic) + 25% RDN (FYM);<br />
T8-50% RDN (Inorganic) + 25% RDN (Neem cake);<br />
T9-50% RDN (Inorganic) + 12.5% RDN (FYM)<br />
+12.5% RDN (Neem cake) and the requisite amount<br />
of nitrogen was applied through urea as per the<br />
treatments based on the recommended dose i.e., 60<br />
kg N ha -1 . The nitrogen was applied in three equal<br />
splits, first dose as basal and the remaining doses<br />
at 30 and 60 days after sowing (DAS). Whereas<br />
uniform dose of 40 kg P 2<br />
O 5<br />
and 30 kg K 2<br />
O per hectare<br />
were applied through single superphosphate and<br />
muriate of potash respectively as basal dose to all<br />
the experimental plots. The amount of rainfall<br />
received during crop growth period (877.8 mm in 55<br />
rainy days) was adequate for normal growth of crop.<br />
The vegetative stage of crop was healthy due to<br />
uniform distribution of rains but the incessant rains<br />
received during crop growth coincided with flowering<br />
and capsule formation stages and contributed to<br />
severe incidence of castor semilooper and Botrytis,<br />
this in turn affected the seed yield of castor drastically<br />
and hence low yields were recorded in this<br />
experiment.<br />
Seed Yield<br />
Integrated nutrient management treatments<br />
have brought about significant differences in the seed<br />
email: hemalathasingana@gmail.com<br />
118
YIELD, NUTRIENT UPTAKE AND ECONOMICS OF CASTOR<br />
yield of the castor. The seed yields were analysed<br />
statistically and presented in Table 1 and illustrated<br />
in Figure 1.<br />
Among the integrated nutrient management<br />
treatments, maximum seed yield was recorded in T 6<br />
(75% RDN-Inorganic + 12.5% RDN-FYM +12.5%<br />
RDN-Neem cake) (346.30kg ha -1 ) which was on par<br />
with T 2<br />
(100% RDN-Inorganic) (319.60 kg ha -1 ) and<br />
T5 (75% RDN-Inorganic + 25% RDN-Neem cake)<br />
(324.17 kg ha -1 ) and significantly higher over the other<br />
treatments. Significantly lower seed yield was<br />
recorded in T 1<br />
(control) (120.10 kg ha -1 ) than the other<br />
treatments. The reduction may be due to the severe<br />
competition with Pongamia for nutrients and moisture.<br />
The results were in agreement with Mutanal et al.<br />
(2009). Data on correlation coefficients also indicated<br />
that all growth characters and yield attributes were<br />
positively and significantly correlated with seed yield<br />
as it was evident from Table 4.15.<br />
The higher seed yield in T 6<br />
(75% RDN-Inorganic<br />
+ 12.5% RDN-FYM +12.5% RDN-Neem cake)<br />
(346.30kg ha -1 ) could be attributed to conjunctive use<br />
of organic and inorganic sources of nitrogen which<br />
increased the availability of nitrogen for favourable<br />
plant growth and further nitrogen fertilization<br />
increases the cation exchange capacity of plant roots<br />
and thus became efficient in absorption of nutrient<br />
ions (Mathukia and Modhwadia, 1995).<br />
Comparatively low yields of castor were due to<br />
heavy infestation of Botrytis grey mold disease and<br />
more number of rainy days in the crop growth period<br />
(55 rainy days) which coincided with capsule formation<br />
stage. These results were also in conformity with<br />
the findings of Baby and Reddy (1998), Patel et al.<br />
(2005) and Kumar and Kanjana (2009).<br />
Stalk Yield<br />
The stalk yield recorded under different<br />
integrated nutrient management treatments was<br />
analysed statistically and presented in Table 1 and<br />
illustrated in Figure 1.<br />
Integrated nutrient management treatments<br />
have brought about significant differences in the stalk<br />
yield of the castor. Among the integrated nutrient<br />
management treatments, maximum stalk yield was<br />
recorded in T 6<br />
(75% RDN-Inorganic) + 12.5% RDN-<br />
FYM +12.5% RDN-Neem cake) (1423.93 kg/ha) and<br />
it was on par with T 2<br />
(100% RDN-Inorganic) (1361.73<br />
kg ha -1 ) and T 5<br />
(75% RDN-Inorganic + 25% RDN-<br />
Neem cake) (1347.31 kg ha -1 ) and significantly higher<br />
119<br />
over the other treatments. Significantly lower stalk<br />
yield was noticed in T 1<br />
(control) (568.66 kg ha -1 ) than<br />
all the other treatments.<br />
Higher stalk yield in T 6<br />
(75% RDN-Inorganic +<br />
12.5% RDN-FYM +12.5% RDN-Neem cake) (1423.93<br />
kg ha -1 ) was mainly attributed to the increased<br />
availability of major and micronutrients due to<br />
cumulative effect of organic manures like FYM and<br />
neem cake and also due to higher plant height, leaf<br />
area, number of branches and dry matter production<br />
in the treatment. The results were in agreement with<br />
Kumar and Kanjana (2009), Reddy et al. (1993) and<br />
Raghavaiah and Babu (2000).<br />
Harvest Index<br />
The harvest index recorded under different<br />
integrated nutrient management treatments was<br />
analysed statistically and presented in Table 1.<br />
Maximum harvest index was recorded in T 6<br />
(75% RDN-Inorganic + 12.5% RDN-FYM +12.5%<br />
RDN-Neem cake) (24.32%) and statistically it was<br />
on par with all the treatments except with T 1<br />
(control)<br />
(21.12%). Maximum harvest index of castor in T 6<br />
was mainly attributed to partitioning of dry matter<br />
towards seed due to high availability of nutrients by<br />
application of organic manures like FYM and neem<br />
cake. The results were in agreement with Kumar and<br />
Kanjana (2009), Reddy et al. (1993) and Raghavaiah<br />
and Babu (2000).<br />
Oil Content and Oil Yield<br />
The oil content recorded under different<br />
integrated nutrient management treatments was<br />
analysed statistically and presented in Table 1.<br />
Integrated nutrient management practices did<br />
not influence the oil content of castor. Maximum oil<br />
content was recorded in T 7<br />
(50% RDN-Inorganic +<br />
25% RDN-FYM) (52.43%) and it was followed by T 1<br />
(control) (52.37%) and T 8<br />
(50% RDN-Inorganic +<br />
25%RDN-Neem cake) (51.98%). Minimum oil content<br />
was noticed in T 2<br />
(100% RDN-Inorganic) (50.63%).<br />
However, the oil yield was significantly influence by<br />
the INM treatments. T 6<br />
(75% RDN-Inorganic + 12.5%<br />
RDN-FYM +12.5% RDN-Neem cake) (181.57 kg ha -<br />
1<br />
) recorded significantly higher oil yield over all the<br />
other treatments. The increase in the oil yield in T 6<br />
was attributed to higher seed yield obtained in this<br />
treatment.<br />
The oil content in oilseeds is often a genetically<br />
controlled parameter and may not be altered much
INDUDHAR et al<br />
due to external inputs. Similar results were observed<br />
by Baby and Reddy (1998) and Patel et al. (2010).<br />
Seed Yield<br />
Integrated nutrient management treatments<br />
have brought about significant differences in the seed<br />
yield and stalk yield of castor. Among the integrated<br />
nutrient management treatments, maximum seed<br />
yield was recorded in T 6<br />
(75% RDN-Inorganic + 12.5%<br />
RDN-FYM +12.5% RDN-Neem cake) (346.30kg ha -<br />
1<br />
) which was on par with T 2<br />
(100% RDN-Inorganic)<br />
(319.60 kg ha -1 ) and T5 (75% RDN-Inorganic + 25%<br />
RDN-Neem cake) (324.17 kg ha -1 ) and significantly<br />
higher over the other treatments. Significantly lower<br />
seed yield was recorded in T 1<br />
(control) (120.10 kg<br />
ha -1 ) than the other treatments. The reduction may<br />
be due to the severe competition with Pongamia for<br />
nutrients and moisture. The results were in agreement<br />
with Mutanal et al. (2009). The higher seed yield in<br />
T 6<br />
(75% RDN-Inorganic + 12.5% RDN-FYM +12.5%<br />
RDN-Neem cake) (346.30kg ha -1 ) could be attributed<br />
to conjunctive use of organic and inorganic sources<br />
of nitrogen which increased the availability of nitrogen<br />
for favorable plant growth and further nitrogen<br />
fertilization increases the cation exchange capacity<br />
of plant roots and thus became efficient in absorption<br />
of nutrient ions (Mathukia and Modhwadia, 1995).<br />
Higher stalk yield in T 6<br />
(75% RDN-Inorganic +<br />
12.5% RDN-FYM +12.5% RDN-Neem cake) (1423.93<br />
kg ha -1 ) was mainly attributed to the increased<br />
availability of major and micronutrients due to<br />
cumulative effect of organic manures like FYM and<br />
neem cake and also due to higher plant height, leaf<br />
area, number of branches and dry matter production<br />
in the treatment. The results were in agreement with<br />
Kumar and Kanjana (2009), Reddy et al. (1993) and<br />
Raghavaiah and Babu (2000).<br />
Harvest Index<br />
The harvest index recorded under different<br />
integrated nutrient management treatments was<br />
analyzed statistically and presented in Table<br />
Maximum harvest index was recorded in T 6<br />
(75% RDN-Inorganic + 12.5% RDN-FYM +12.5%<br />
RDN-Neem cake) (24.32%) and statistically it was<br />
on par with all the treatments except with T 1<br />
(control)<br />
(21.12%). Maximum harvest index of castor in T 6<br />
was mainly attributed to partitioning of dry matter<br />
towards seed due to high availability of nutrients by<br />
application of organic manures like FYM and neem<br />
cake. The results were in agreement with Kumar and<br />
Kanjana (2009), Reddy et al. (1993) and Raghavaiah<br />
and Babu (2000).<br />
Oil Content and Oil Yield<br />
The oil content recorded under different<br />
integrated nutrient management treatments was<br />
analyzed statistically and presented in Table 1.<br />
Integrated nutrient management practices did<br />
not influence the oil content of castor. Maximum oil<br />
content was recorded in T 7<br />
(50% RDN-Inorganic +<br />
25% RDN-FYM) (52.43%) and it was followed by T 1<br />
(control) (52.37%) and T 8<br />
(50% RDN-Inorganic +<br />
25%RDN-Neem cake) (51.98%). Minimum oil content<br />
was noticed in T 2<br />
(100% RDN-Inorganic) (50.63%).<br />
However, the oil yield was significantly influence by<br />
the INM treatments. T 6<br />
(75% RDN-Inorganic + 12.5%<br />
RDN-FYM +12.5% RDN-Neem cake) (181.57 kg ha -<br />
1<br />
) recorded significantly higher oil yield over all the<br />
other treatments. The increase in the oil yield in T 6<br />
was attributed to higher seed yield obtained in this<br />
treatment.<br />
The oil content in oilseeds is often a genetically<br />
controlled parameter and may not be altered much<br />
due to external inputs. Similar results were observed<br />
by Baby and Reddy (1998) and Patel et al. (2010).<br />
Significant increase in the seed yield and stalk yield<br />
was recorded in the INM treatments over the control<br />
(Fig 1). Among the treatments, significantly higher<br />
seed yield (346 kg/ha) and stalk yield (1424 kg/ha)<br />
was recorded with the application of 75% RDN through<br />
urea and 12.5% RDN through FYM and 12.5% RDN<br />
through neem cake, but was on par with 100% RDN<br />
through urea (320 and 1362 kg/ha) and 75% RDN<br />
through urea and 25% RDN through neem cake (324<br />
and 1347 kg/ha) (Fig.2). However, harvest index was<br />
not influenced by INM treatments. The influence of<br />
INM on the oil content was found not significant.<br />
Similar results were also observed by Baby and<br />
Reddy (1998). But the oil yield per hectare was<br />
significantly higher with the application of 75% RDN<br />
through urea and 12.5% RDN through FYM and<br />
12.5% RDN through neem cake over all the other<br />
treatments.<br />
Hence it can be concluded that for improving<br />
the yield and quality of castor with the sustained soil<br />
productivity, combined usage of organic manures and<br />
chemical fertilizers in the Pongamia based<br />
alleycropping was found to be beneficial.<br />
120
YIELD, NUTRIENT UPTAKE AND ECONOMICS OF CASTOR<br />
Fig.1 Seed and stalk yield of castor as influenced by different INM treatments<br />
Table 1. Growth parameters of castor as influenced by INM treatments in Pongamia based agrisilviculture<br />
system<br />
Treatments<br />
Plant<br />
height<br />
cm<br />
Leaf<br />
area cm 2<br />
Leaf<br />
area<br />
index<br />
Dry matter<br />
production<br />
g/plant<br />
No.of<br />
branches<br />
/plant<br />
T1-Control 95 321.2 0.159 36.30 5.3<br />
T2-100% Recommended Dose of<br />
Nitrogen (RDN) (Inorganic) 149 684.2 0.346 54.50 9.6<br />
T3-75% RDN (Inorganic) 123 464.1 0.229 45.50 7.0<br />
T4-75% RDN (Inorganic) + 25% RDN<br />
(FYM) 144 402.1 0.199 49.07 8.4<br />
T5-75% RDN (Inorganic) + 25% RDN<br />
(Neem cake) 145 666.3 0.353 55.01 8.5<br />
T6-75% RDN (Inorganic) + 12.5% RDN<br />
(FYM) +12.5% RDN (Neem cake) 154 736.4 0.364 58.50 10.4<br />
T7-50% RDN (Inorganic) + 25% RDN<br />
(FYM) 125 439.6 0.217 41.60 8.0<br />
T8-50% RDN (Inorganic) + 25% RDN<br />
(Neem cake) 127 546.1 0.270 42.53 8.2<br />
T9-50% RDN (Inorganic) + 12.5% RDN<br />
(FYM) +12.5% RDN (Neem cake) 142 511.4 0.253 43.67 8.4<br />
S.Em.± 4.2 24.5 0.003 1.51 0.4<br />
CD (P=0.05) at 5%<br />
11.1 74.2 0.021 4.34 0.9<br />
Mean 133.8 530.2 0.265 47.41 8.32<br />
121
INDUDHAR et al<br />
Table 2. Yield parameters of castor as influenced by INM treatments in pongamia based agrisilviculture<br />
system<br />
Treatments<br />
Spike<br />
length<br />
(cm)<br />
Number<br />
of<br />
spikes<br />
per<br />
plant<br />
Number<br />
of<br />
capsules<br />
per<br />
spike<br />
100 seed<br />
weight(g)<br />
Oil<br />
content<br />
(%)<br />
T1-Control 11.3 5.2 11.8 16.2 52.37<br />
T2-100% Recommended Dose of<br />
Nitrogen (RDN) (Inorganic) 19.3 8.7 22.3 21.0 50.63<br />
T3-75% RDN (Inorganic) 14.5 6.0 17.4 18.3 52.53<br />
T4-75% RDN (Inorganic) + 25%<br />
RDN (FYM) 15.8 8.9 20.0 19.8 50.96<br />
T5-75% RDN (Inorganic) + 25%<br />
RDN (Neem cake) 17.1 9.1 21.9 20.0 50.78<br />
T6-75% RDN (Inorganic) + 12.5%<br />
RDN (FYM) +12.5% RDN (Neem<br />
cake) 19.7 9.7 23.1 21.2 52.43<br />
T7-50% RDN (Inorganic) + 25%<br />
RDN (FYM) 14.4 7.3 17.1 19.6 51.64<br />
T8-50% RDN (Inorganic) + 25%<br />
RDN (Neem cake) 16.4 7.4 20.2 18.4 51.98<br />
T9-50% RDN (Inorganic) + 12.5%<br />
RDN (FYM) +12.5% RDN (Neem<br />
cake) 18.2 7.7 20.8 18.7 52.07<br />
S.Em.± 1.0 0.9 0.53 0.9 1.64<br />
CD (P=0.05) 3.0 2.1 1.6 3.0 N.S.<br />
Mean 16.35 7.78 19.4 18.9<br />
REFERENCES<br />
Baby, A and Reddy, T.B. 1998. Integrated nutrient<br />
management in rainfed castor. Journal of<br />
Oilseeds Research. 15 (1): 115-117.<br />
CMIE. 2010. Agriculture. Centre for Monitoring Indian<br />
Economy (CMIE), Private Limited. Mumbai.<br />
June, 2010. 183.<br />
Raghavaiah, C.V and Babu, S.N. 2000. Effect of<br />
seedling time, female: male row proportion and<br />
nitrogen on certified seed production of GCH<br />
4 (VP-1 × 48-1) castor hybrid Ricinus<br />
communis L. Journal of Oilseeds Research.<br />
17(1): 100-106.<br />
Rao, M.M.V.S., Bheemaiah, G and Subrahmanyam,<br />
M.V.R. 2000. Growth and yield of rainfed<br />
groundnut Arachis hypogaea alley cropped with<br />
Albizia lebbeck under integrated nutrient<br />
management. Indian Journal of Agricultural<br />
Sciences. 70 (11): 786-790.<br />
Reddy, G.S., Venkateshwarlu, B and Sankar, G.R.M.<br />
1993. Effect of different organic materials as<br />
source of nitrogen on growth and yield of castor.<br />
Journal of Oilseeds Research. 10 (1): 151-152.<br />
122
Research Notes<br />
J.Res. ANGRAU 41(2) 123-125, 2013<br />
NANO FOOD COLOURS FOR PRODUCT FORMULATIONS WITH SELECTED<br />
FRUITS (PAPAYA AND BLACK GRAPES) AND VEGETABLES<br />
(TOMATO AND BEET ROOT)<br />
P. SRILATHA and K. UMA MAHESWARI<br />
Department of Food and Nutrition, PGRC, Acharya N. G. Ranga Agricultural University<br />
Rajendranagar, Hyderabad-500030.<br />
Date of Receipt : 15.06.2012 Date of Acceptance : 28.12.2012<br />
Colorants become the most sensitive part<br />
of any commodity not only for its appeal as it also<br />
enhances consumer acceptability (Clydesdale, 1993).<br />
With reference to food, colour is a means of<br />
identification, a method of judging quality and a base<br />
for aesthetic value. Colour being the first quality<br />
attribute perceived by the senses, besides flavor,<br />
the colour perception appear to be closely linked to<br />
enjoyment of food. The general objective of adding<br />
colour to foods was to make them appealing and<br />
recognizable (Sampathu et al. 1981).<br />
Nanotechnology commonly refers to any<br />
engineered materials, structures and systems that<br />
operate at a scale of 100 nanometers or less (one<br />
nano meter is one billionth of a meter). Today, major<br />
industrial countries are incorporating nanotechnology<br />
in their innovation systems as they see it as an<br />
engine for wealth creation in the near future (Roco,<br />
2002).<br />
Food companies are currently producing<br />
nanoparticles in emulsions in an attempt to control<br />
the material properties of foodstuffs, such as in the<br />
manufacture of ice cream to increase texture<br />
uniformity (Rowan, 2004). An attempt was made in<br />
the present investigation to incorporate nano particles<br />
into food products and evaluate sensory scores for<br />
colour, flavour, appeal and overall acceptability of<br />
the prepared products.<br />
Two fruits papaya and black grapes and two<br />
vegetables tomato and beetroot were selected as<br />
these fruits are rich sources of natural colours such<br />
as carotenes in papaya, anthocyanins in black<br />
grapes, lycopene in tomato and betalains in beet root.<br />
One kg of each selected fruits and vegetables were<br />
thoroughly washed in hot water and were cut into<br />
thin pieces. These pieces are placed in separate trays<br />
and were subjected to Infrared (IR) drying. After drying,<br />
the samples were cooled and grinded in a conventional<br />
grinder into fine powder. These dehydrated powders<br />
are used for synthesis of Zinc nanoparticles using<br />
oxalate decomposition method.<br />
Two Products viz., kesari and soup mix were<br />
prepared using the nano food colours (NFCs) to<br />
evaluate intensity of extracted colour in foods and<br />
prepared products were kept for sensory evaluation.<br />
Kesari was prepared with fruit (papaya &<br />
black grapes) NFCs and soup mix was prepared with<br />
vegetable (tomato & beet root) NFCs for sensory<br />
evaluation.<br />
Each product was incorporated with 10% NFC<br />
(T 1<br />
)<br />
, 15% NFC (T 2 ) and 20% NFC (T 3 ) .<br />
The sensory scoring was done by a panel of 10<br />
members in the laboratory of Post Graduate and<br />
Research Center using a score card developed for<br />
the purpose. Score card was prepared keeping in view<br />
the quality characteristics of the products. Descriptive<br />
terms were given to various quality attributes like<br />
colour, flavour, appeal and overall acceptance.<br />
Numerical scores were assigned to each<br />
attribute (Joshi, 2006). 5-point hedonic scale was<br />
adopted to score each of the attributes. While scoring,<br />
highest score (5) was assigned to most preferred<br />
characteristic and least score (1) to the least desired<br />
characteristics.<br />
The data regarding sensory evaluation of finished<br />
products was subjected to statistical analysis as per<br />
the procedure described by Panes and Sukhatme<br />
(1985). The experimental design was complete<br />
randomized block design with factorial concept.<br />
email: srilatha2708@gmail.com<br />
123
SRILATHA and UMA<br />
Kesari prepared by incorporating different<br />
concentrations of NFCs from selected fruits (papaya<br />
and black grapes) was subjected to sensory<br />
evaluation.<br />
Colour scores of the treatments showed<br />
significant variations (P < 0.05) in which T 3<br />
(4.40%)<br />
scored highest followed by T 2<br />
(3.20%) and T 1<br />
(4.20%)<br />
in NFC with papaya.<br />
With regard to black grapes also colour<br />
scores among the treatments, showed significant<br />
variations (P< 0.05) in which T 3<br />
(4.70%) scored<br />
highest followed by T 2<br />
(4.0%) and T 1<br />
(3.10%).<br />
Significant (P > 0.05) difference was not<br />
observed in sensory scores for flavour. Among the 3<br />
variations, T 3<br />
(3.80%) recorded highest and T 2<br />
scored<br />
lowest (3.60%) in NFC with papaya and T 3<br />
(4.50%)<br />
recorded highest and lowest score was observed for<br />
T 1<br />
(3.30%) in NFC with black grapes.<br />
In case of product appeal, significant<br />
variation (P < 0.05) was recorded in sensory scores.<br />
T 3<br />
(4.3%) was found to have maximum score for<br />
appeal in comparison to T 1<br />
(3.20%) and T 2<br />
(3.90%)<br />
samples in NFC with papaya. However, in NFC with<br />
black grapes T 3<br />
(4.0%) and T 2<br />
(4.0%) were found to<br />
have equal and good appeal in comparison to T 1<br />
(2.90%) samples.<br />
The overall acceptability scores showed<br />
significant variation (P < 0.05) in which T 3<br />
(4.3%)<br />
scored higher followed by T 2<br />
(4.0%) and lowest score<br />
was observed for T 1<br />
(3.1%) in NFC with papaya and<br />
T 2<br />
(4.5%) scored higher followed by T 3<br />
(4.2%) and<br />
lowest score was observed for T 1<br />
(3.1%) in NFC with<br />
black grapes.<br />
Fig 1. Mean sensory scores for Kesari prepared by incorporating NFCs from fruits (papaya & black<br />
grapes)<br />
T 1<br />
- 10% NFC T 2 -<br />
15% NFC T 3<br />
- 20% NFC<br />
Soup mix prepared by incorporating different<br />
concentrations of NFCs from selected fruits (papaya<br />
and black grapes) was subjected to sensory<br />
evaluation.<br />
Colour scores of the treatments showed<br />
significant variations (P < 0.05) in which T 3<br />
(4.50%)<br />
scored highest followed by T 2<br />
(4.40%) and lowest<br />
score was observed for T 1<br />
(3.10%) in NFC with<br />
tomato.<br />
With regard to beet root, it was observed<br />
that the colour scores among the treatments, showed<br />
significant variations (P< 0.05) in which T 2<br />
(4.30%)<br />
scored highest followed by T 3<br />
(4.10%) and lowest<br />
score was observed for T 1<br />
(2.60%).<br />
Significant (P > 0.05) difference was not<br />
observed in sensory scores for flavour. However<br />
among the treatments T 3<br />
(4.10%) recorded higher<br />
and lower score was observed for T 1<br />
(3.90%) in NFC<br />
with tomato and T 3<br />
(4.0%) recorded highest and<br />
lowest score was observed for T 1<br />
(3.40%) in NFC<br />
with beet root.<br />
On sensory evaluation, significant variation (P <<br />
0.05) was recorded in sensory scores for appeal. T 3<br />
(4.0%) was found to have maximum score for appeal<br />
in comparison to T 2<br />
(3.7%) and T 1<br />
(2.9%) samples<br />
in NFC with tomato. However, in NFC with beet root<br />
T 3<br />
(4.5%) and T 2<br />
(3.9%) were found to have good<br />
appeal in comparison to T 1<br />
(2.40%) samples.<br />
124
NANO FOOD COLOURS FOR PRODUCT FORMULATIONS WITH SELECTED FRUITS<br />
The overall acceptability scores showed<br />
significant variation (P < 0.05) in which T 3<br />
(4.5%)<br />
scored higher followed by T 2<br />
(4.2%) and lowest score<br />
was observed for T 1<br />
(2.6%) in NFC with tomato and<br />
T 3<br />
(4.3%) scored higher followed by T 2<br />
(3.9%) and<br />
lowesr score was observed for T 1<br />
(2.5%) in NFC with<br />
beet root.<br />
Fig 2. Sensory evaluation scores for soup mix prepared by incorporating NFCs from vegetables<br />
(tomato & beet root)<br />
T 1<br />
- 10% NFC T 2 -<br />
15% NFC T 3<br />
- 20% NFC<br />
For the preparation of products T 3<br />
sample<br />
scored highest for all attributes such as colour, flavor,<br />
appeal and overall acceptability for kesari prepared<br />
with NFCs synthesized from papaya and black<br />
grapes. In soup mix prepared by incorporating NFCs<br />
synthesized from tomato and beet root T 3<br />
and T 2<br />
scored highest for colour attribute in tomato and beet<br />
root respectively. Among all T 3<br />
scored highest i.e.,<br />
20% NFC was most acceptable to the panelists. In<br />
both Kesari and Soup mix the quantity of NFCs used<br />
(10%, 15% and 20%) for sensory evaluation was high<br />
because it is assumed that prepared particles (NFCs)<br />
could release the colour into the food material over<br />
an extended period of time which can be considered<br />
as slow-release of the colour. Hence these NFCs<br />
can be used in preserved products which have longer<br />
shelf life for slow release of colour.<br />
REFERENCES<br />
Clydesdale, F. M. 1993. Color as a factor in food<br />
choice. Critical Review of Food Science and<br />
Nutrition. 33: 83-101.<br />
Joshi, V. K. 2006. Sensory Science-Principles and<br />
Applications in Food Evaluation. Agrotech<br />
Publishing Academy, Udaipur.<br />
Panes, V. G and Sukhatme, P. V. 1985. Statistical<br />
methods for agricultural workers, ICAR, New<br />
Delhi.<br />
Roco, M.C. 2002. Government Nanotechnology<br />
Funding: An International Outlook. National<br />
Nanotechnology Initiative. Senate of the United<br />
States (January 16, 2003). 21st Century<br />
Nanotechnology Research and Development<br />
Act.http://www.nano.gov/intpersp_roco.html.<br />
Rowan, D. 2004. “How Technology is Changing our<br />
Food.” The Observer, Sunday, May 16.<br />
Sampathu, S. R., Krishna murthy, N., Shivashankar.<br />
S., Shankaranarayan, R., Srinivasa Rao, P.<br />
N and Lewis, Y. S. 1981. Natural Food<br />
Colours. Indian Packer. March-April: 97-105.<br />
125
Research Notes<br />
J.Res. ANGRAU 41(2) 126-130, 2013<br />
EFFECT OF ORGANIC FERTILISERS ON GROWTH, YIELD AND<br />
QUALITY OF TOMATO Lycopersic esculentum<br />
S. VANI ANUSHA, P. PRABHU PRASADINI, S. SRI DEVI and K. SURYA PRAKASH RAO<br />
Department of Environmental Science and Technology,<br />
College of Agriculture, Acharya N.G. Ranga Agricultural University, Rajendranagar, Hyderabad-500030<br />
Date of Receipt : 28.01.2013 Date of Acceptance : 03.05.2013<br />
Post green revolution chemical fertilizers are<br />
being commonly used by farming community<br />
indiscriminately to meet the population demand for<br />
food. Intensification of fertilization (Hrivna et al., 2002)<br />
and a wide range of fertilizers, imposes the<br />
necessities for detailed analysis on the effect of their<br />
application upon crop yield and nutritional value of<br />
the obtained yield (Domske et al., 2001). However,<br />
organic products use has also been increasing for<br />
various reasons. Organic manures continue to be the<br />
major substances that maintain congenial soil<br />
environment for root growth and would supply<br />
nutrients required for proper growth and development<br />
of plants. However, the lack of supply to meet the<br />
demand paved the way for alternate options such as<br />
use of organic wastes, biofertilisers and organic<br />
fertilizers.<br />
A pot culture experiment was conducted in<br />
the green house of the Department of Soil Science &<br />
Agricultural Chemistry, College of Agriculture,<br />
Hyderabad during kharif 2010 by using medium<br />
textured soil, tomato as test crop, to study the effect<br />
of organic fertilizers on growth, yield and quality. The<br />
experiment was laid out in completely randomized<br />
design. The treatments consists of T 1<br />
(control), T 2<br />
(Inorganic NPK @120-60-60 kg ha -1 ), T 3<br />
(T 2<br />
+ ZnSO 4<br />
@ 25 kg ha -1 ), T 4<br />
(Inorganic N @ 120 kg ha -1 + Bio<br />
Phos @75 kg ha -1 + Bio Potash @75 kg ha -1 ), T 5<br />
(T 2<br />
+ Bio Zn @ 13 kg ha -1 ) and T 6<br />
(T4 + Bio Zinc @ 13 kg<br />
ha -1 ), T 7<br />
(New Suryamin @ 25 kg ha -1 ), T 8<br />
(T 2+<br />
T 7<br />
), T 9<br />
(Aishwarya @ 125 kg ha -1 ) and T 10<br />
(T 2<br />
+ T 9<br />
). Inorganic<br />
N, P and K were supplied through urea, single super<br />
phosphate and muriate of potash, respectively.<br />
The organic inputs used in the pot culture<br />
experiment were analyzed for physico-chemical and<br />
chemical properties by using standard procedures<br />
(Tandon, 1995). Phosphorus, potassium and zinc<br />
were estimated in the triacid extract from finely<br />
ground sample (0.5 gm) digested with 20 ml triacid<br />
mixture consisting of HNO 3<br />
: H 2<br />
SO 4<br />
: HClO 4<br />
in 9:4:1.<br />
Phosphorus content<br />
was determined by<br />
vanadomolybdo phosphoric method, using double<br />
beam UV Spectrophotometer model UV5704SS at<br />
420 nm; K by using flame photometer model CL 361<br />
and<br />
Zinc by using Atomic Absorption<br />
Spectrophotometer model NOVAA300.<br />
Different organic fertilizers with and without<br />
inorganic fertilizers were mixed in the soil before<br />
transplanting as per prescribed treatments. Two plants<br />
were maintained in each pot. Plant samples were<br />
collected at two stages i.e., at vegetative phase (30<br />
DAT) and harvesting phase (90 DAT). Plant<br />
parameters like plant height and drymatter production<br />
were recorded at both the stages whereas chlorophyll<br />
content (with SPAD meter) and leaf area (with model<br />
LICOR-3100) were recorded only at vegetative stage.<br />
Fruit weight was recorded at harvest. Fruit samples<br />
at 90DAT were analyzed for lycopene content<br />
(Ranganna, 1986). The results of pot culture studies<br />
were subjected for statistical analysis as per the<br />
procedures outlined by Snedecor and Cochran (1973).<br />
Characteristics of Bio Phos, Bio Potash, Bio<br />
Zinc, New Suryamin and Aiswarya are shown in Table<br />
1 which indicated that all were acidic and contained<br />
organic carbon, nitrogen, phosphorus, potassium and<br />
zinc. The organic carbon content ranged from 3.05<br />
to as high as 27.8 % in Aishwarya, which was similar<br />
to organic manures as reported in poultry manure as<br />
20.12%, farm yard manure as 17.3% and EM<br />
compost as 15.01% by Mallesh (2009).<br />
email: prabhuprasadini@rediffmail.com<br />
126
EFFECT OF ORGANIC FERTILISERS ON GROWTH, YIELD AND QUALITY OF TOMATO<br />
Table 1. Salient characteristics of organic fertilisers<br />
S. No. Characteristics<br />
Bio<br />
Phos<br />
Bio<br />
potash<br />
Bio Zinc<br />
New<br />
Suryamin<br />
Aishwarya<br />
I. Physico-chemical properties<br />
a) pH 5.03 6.54 6.31 5.77 6.02<br />
b) EC (dS m -1 ) 4.88 6.66 6.45 1.19 5.05<br />
II.<br />
Chemical properties<br />
a) Total Organic carbon (%) 3.23 3.97 4.42 3.05 27.8<br />
Nutrient content<br />
b) Nitrogen (% N) 0.016 0.042 0.032 0.95 1.2<br />
c) Phosphorus (% of P) 1.91 0.4 0.49 0.91 0.68<br />
d) Potassium (% of K) 1.0 2.0 1.25 0.59 2.3<br />
c) Zinc(mg/kg) 1136 1520 2300 1244 1378<br />
Plant growth in terms of height and dry matter<br />
production recorded at vegetative (30 DAT) and<br />
harvest stages (90 DAT) of tomato are presented in<br />
Table 2. Data set out in the Table revealed significant<br />
difference in plant height due to the application of<br />
various treatments. The plant height at vegetative<br />
stage was recorded highest by T 3<br />
(Inorganic NPK<br />
and Zn) and at 90DAT by T 6<br />
(Inorganic N + Bio Phos<br />
+ Bio Potash + Bio Zinc). Combination of organic<br />
inputs along with inorganics also increased the plant<br />
height significantly over organics alone. Similar<br />
benefits with organic fertilizers were reported in green<br />
gram crop by Anuradha (2010). Supply of P, K<br />
through organic fertilizers (T 6<br />
) resulted in increase of<br />
plant height by 14.1 cm i.e., 32% over Inorganic P K<br />
(T 3<br />
). And also it was observed that supply of zinc<br />
through Bio Zinc recorded higher values by 7.8%<br />
compared to that when supplied through inorganic<br />
ZnSO 4.<br />
This could be due to the nutrient composition<br />
of the organic fertilizers viz., Bio Phos, Bio Potash,<br />
Bio Zinc, New Suryamin and Aishwarya which<br />
contained organic carbon, nitrogen and zinc besides<br />
their main nutrient. Makinde (2007) reported highest<br />
maize plant height of 111 cm with organo mineral<br />
fertilizer which was 44 % more than the control plot.<br />
Drymatter production was significantly higher<br />
compared to control in both the stages of crop growth.<br />
Plant dry matter production is a result of Growth<br />
Environment interaction through leaves, stems, roots<br />
and reproductive parts which contribute to dry matter.<br />
Highest dry matter was produced with integrated<br />
approach of application of nutrients as in T 10<br />
(Aishwarya + Inorganic NPK) at 30DAT and in T 6<br />
(Inorganic N + Bio Phos + Bio Potash + Bio Zinc) at<br />
90 DAT, which recorded 11.8 g higher dry matter<br />
when compared to T 3<br />
(Inorganic NPK and Zn ).<br />
Marimuthu et al. (2003) recorded the highest growth<br />
of green gram by the application of 25 Kg P 2<br />
O 5<br />
ha -1<br />
as Mussorie rock phosphate along with enriched<br />
biodigested slurry.<br />
Leaf area recorded at vegetative stage (30<br />
DAT) presented in Table 2 showed significant<br />
127
Vani et al<br />
Table 2. Effect of organic fertilizers on tomato growth, yield and quality<br />
T 1<br />
T 2<br />
T 3<br />
T 4<br />
T 5<br />
T 6<br />
T 7<br />
T 8<br />
T 9<br />
T 10<br />
128
EFFECT OF ORGANIC FERTILISERS ON GROWTH, YIELD AND QUALITY OF TOMATO<br />
variation among different treatments. The highest<br />
mean leaf area (1178.6 cm 2 ) was found in T 6<br />
(Inorganic N + Bio Phos + Bio Potash + Bio Zinc)<br />
where organic fertilizers were applied for P, K and<br />
Zn. There was an increase of 73% in leaf area when<br />
combination of organic and inorganic sources were<br />
used as in T 10<br />
(Aishwarya + Inorganics NPK) when<br />
compared to only application of inorganic NPK (T 2<br />
)<br />
and it was 8.9% when compared to T 9<br />
(Aishwarya<br />
alone). There was 7.2% increase in leaf area when<br />
combination of organic fertilizers and inorganics, T 8<br />
(New Suryamin + Inorganic NPK) were used instead<br />
of organics alone, T 7<br />
(New Suryamin). Organic<br />
fertilizers alone or in combination with inorganics<br />
proved superior to inorganic fertilizers for the reason<br />
that organic fertilizers are multi nutrient sources which<br />
supply different nutrients as shown in Table 1.<br />
Addition of fertilizers either organic or inorganic<br />
increased chlorophyll content also significantly.<br />
Similar results were reported by Anuradha (2010) on<br />
greengram in a pot culture study.<br />
Yield in terms of fruit weight varied from 67.7<br />
to 212 g plant -1 among different treatments (Table 2).<br />
The highest fruit weight was obtained by the treatment<br />
wherein all nutrients were supplied through inorganic<br />
sources along with carbon rich Aishwarya (T 10<br />
)<br />
followed by T 6<br />
(Inorganic N + Bio Phos + Bio Potash<br />
+ Bio Zinc) and T 8<br />
(New Suryamin + Inorganic NPK).<br />
Any organic source either alone or in combination<br />
with Inorganic NPK significantly increased yield over<br />
inorganic NPK. The treatment where only inorganic<br />
NPK (T 2<br />
) was used has recorded 162.4 g per plant -1<br />
which was increased by 10.4 g (6.4%) by the addition<br />
of zinc sulphate in T 3<br />
(Inorganic NPK and Zn) and a<br />
further increase by 18.8 g (10.8%) with replacing zinc<br />
sulphate by Bio zinc (T 5<br />
). An increase of 11.7 % of<br />
fruit was observed when inorganic P and K (T 2<br />
-<br />
Inorganic NPK) were replaced by organic fertilisers<br />
T 4<br />
(Inorganic N + Bio Phos + Bio Potash). Makinde<br />
(2007) reported that the multi nutrients content and<br />
35.5 g kg -1 of organic carbon in organo- mineral<br />
fertilizer resulted in higher yield of 812 kg ha -1 of<br />
melons with 4 t ha -1 of organo mineral fertilizer<br />
compared to control which yielded 347 kg ha -1 . The<br />
superior performance of organic treated plants might<br />
be owing to improvement in physical, chemical and<br />
microbiological environment of soil favoring increased<br />
availability of plant nutrients (Hossain et al., 2009)<br />
which effect the translocation of sugars to the fruits<br />
and hence the weights.<br />
The lycopene content as influenced by<br />
different treatments is presented in Table 2 revealed<br />
the significant effect of organic and inorganic<br />
fertilizers on the lycopene content of tomato. The<br />
highest lycopene content (49 µg g -1 ) was observed in<br />
the treatment T 6<br />
(Inorganic N + Bio Phos + Bio Potash<br />
+ Bio Zinc), followed by T 10<br />
(Aishwarya + Inorganic<br />
NPK).<br />
The study concludes the recommendation<br />
of the use of these organic fertilizers as a part of<br />
INM, either alone or along with inorganics owing to<br />
the beneficial effects observed on growth, yield and<br />
quality of tomato.<br />
REFERENCES<br />
Anuradha, Ch. 2010. Studies on the effect of organic<br />
agricultural inputs on growth, development and<br />
nutrient accumulation in green gram Phaseolus<br />
Aureus Wilczek. M.Sc Thesis submitted to<br />
Acharya N. G. Ranga Agricultural University,<br />
Hyderabad.<br />
Domske, D., Bobrezecka, D., Wojtkowiak, K.,<br />
Warzechowska, A and Sokolowski, Z. 2001.<br />
Influence of fertilization technique on triticale<br />
yield and grain quality. Folia of University of<br />
Agriculture, Stetin, 223, Agriculture, 89:35-40.<br />
(In Polish)<br />
Hossain, M. F., Bhuiya, M.S.U., Ahmed, M and Mian,<br />
M.H. 2009. Effect of organic and inorganic<br />
fertilizer on the milling and physicochemical<br />
properties of Aromatic rice. Thai Journal of<br />
Agricultural Science. 42 (4): 213-218.<br />
Hrivna, L., Richter, T., Losak, T and Hlusek, 2002.<br />
Effect of increasing dose of nitrogen and<br />
129
Vani et al<br />
Sulphur on chemical composition of plants,<br />
yields seed quality in winter rape. Rostlinna<br />
Vyroba. 48: 1-6.<br />
Makinde, E. A. 2007. Effects of an organomineral<br />
fertilizers application on the growth and yield<br />
of maize. Journal of Applied Science Research<br />
3(10):1152-1155.<br />
Mallesh, 2009. Studies on impact of Enriched<br />
microbial (EM) compost application on paddy<br />
and maize. M.Sc Thesis submitted to Acharya<br />
N. G. Ranga Agricultural University,<br />
Hyderabad.<br />
Marimuthu, R., Babu, S and Vairavan, K. 2003.<br />
Response of bio-organic fertilizers with<br />
mussoorie rock phosphate on the yield of<br />
greengram on red lateritic soils. Legume<br />
Research 26 (1): 66-68.<br />
Ranganna, S. 1986. Hand book of Analysis and<br />
Quality Control for Fruit and Vegetable<br />
Products, second edition. Tata Mc Graw-Hill<br />
publishing company limited, New Delhi.<br />
Snedecor, G. W and Cochran, W. G. 1973. Statistical<br />
methods. 6 th Edition. Iowa state University Soil<br />
Analysis. Arner Society Agronomy Publisher.<br />
Tandon, H. L. S. 1995. Methods of analysis of soils,<br />
plants, waters and fertilizers. FDCO, New<br />
Delhi. Pp143.<br />
130
Research Notes<br />
J.Res. ANGRAU 41(2) 131-134, 2013<br />
NUTRIENT UPTAKE OF MICROSPRINKLER IRRIGATED WHEAT CULTIVARS<br />
UNDER VARYING NITROGEN LEVELS<br />
MATHURA YADAV, V. PRAVEEN RAO and K. SURESH<br />
Department of Agronomy,<br />
College of Agriculture, Acharya N.G. Ranaga Agricultural University, Rajendranagar, Hyderabad-500 030<br />
Date of Receipt : 16.03.2013 Date of Acceptance : 11.06.2013<br />
Fertilizers constitute an integral part of<br />
improved crop production technology. Proper amount<br />
of fertilizer application is considered a key to the<br />
higher crop production. Nitrogen (N) is major factor<br />
limiting yield of wheat (Andrews et al. 2004). Optimum<br />
N management to wheat is important for maximum<br />
yield and minimum contamination to environment.<br />
The efficiency of wheat cultivars to N use has become<br />
increasingly important to allow reduction in N fertilizer<br />
use without decreasing yield.<br />
Keeping the above facts in view, a field<br />
experiment was conducted during rabiseason of<br />
2010–11 at Agricultural Research Station, Basantpur,<br />
Medak district in Central Telangana Zone of Andhra<br />
Pradesh. The soil was loamy sand in texture with a<br />
soil pH of 6.4 and had S 1<br />
salinity class (EC 0.96 dS<br />
m -1 ). The experimental soil was low in available<br />
nitrogen (265 kg N ha -1 ), phosphorus (19.59 kg<br />
P 2<br />
O 5<br />
ha -1 ) and medium in available potassium (219.4<br />
kg K 2<br />
O ha -1 ). The treatments consisted of five wheat<br />
cultivars viz.,Sonalika (V 1<br />
), NIDW295 (V 2<br />
),UAS415<br />
(V 3<br />
),NIAW 917 (V 4<br />
) and DWR 162 (V 5<br />
)as main plot<br />
treatments and five levels of nitrogen 0, 80, 120, 160<br />
and 200 kg N ha -1 as sub-plot treatments summing<br />
up to 25 treatment combinations laid out in split-plot<br />
design with three replications. The crop was sown<br />
on 1 st November, 2010. The crop was irrigated based<br />
on 1.0 IW/CPE ratio with 50 mm irrigation water depth<br />
(IW) using micro sprinkler irrigation system. The<br />
seasonal irrigation water depth was 350 mm. The<br />
wheat cultivars were harvested between 15 to 20 th<br />
February 2011.<br />
Plant samples collected for estimation of dry<br />
matter accumulation (grain and straw) at harvest were<br />
analysed for N, P, and K by adopting standard<br />
procedures. Total uptake of N/P/K was calculated<br />
separately by the following formula:<br />
Nutrient uptake (NPK kg ha -1 ) =<br />
Nutrient content % X Dry matter (kg ha -1 )<br />
100<br />
Further the application of fertilizer N and the efficiency of its use by wheat crop were evaluated by<br />
calculating the following fertilizer use efficiency criteria (Crasswell and Godwin, 1984):<br />
Agronomic Efficiency (kg grain Kg -1 N) =<br />
Y N<br />
- Y O<br />
Where, Y N<br />
and Y 0<br />
are crop yields (kgha -1 ) at a certain level of N application [F (kg ha -1 )] and in the<br />
control treatment, respectively.<br />
F N<br />
Recovery Efficiency (kg grain N Kg -1 N) =<br />
U N<br />
- U O<br />
F N<br />
Physiological Efficiency (kg grain Kg -1 N) =<br />
Y N<br />
- Y O<br />
U N<br />
- U O<br />
email: v.prao@yahoo.com<br />
131
MATHURA et al<br />
Where U N<br />
and U 0<br />
are total plant N uptake<br />
(kgha -1 ) in the above ground biomass at a certain<br />
level of fertilizer application [F (kg ha -1 )] and in the<br />
control treatment, respectively.<br />
The mean uptake of nitrogen, phosphorus<br />
and potassium by was 64.91, 22.34 and 38.1 kg<br />
ha -1 , respectively (Table 1). Nutrient (NPK) uptake<br />
was influenced by different cultivars. Variety V 2<br />
(NIDW 295) and V 3<br />
(UAS 415) registered similar<br />
nitrogen, phosphorus and potassium uptake but<br />
significantly higher in comparison to other varieties<br />
viz., V 1<br />
(Sonalika), V 4<br />
(NIAW 917) and V 5<br />
(DWR 162)<br />
owing higher yield. Among the latter varieties V 1<br />
had<br />
performed well in terms of nutrient (NPK) uptake over<br />
V 4<br />
and V 5<br />
, which were on par. Variation in NPK uptake<br />
among varieties differing in their genetic makeup was<br />
Table 1. Nutrient (NPK) uptake (kg ha -1 ) of wheat as influenced by varieties and nitrogen levels at<br />
harvest<br />
Cultivars<br />
Treatments<br />
Seed yield<br />
(kg ha -1 )<br />
Total NPK uptake (grain +Straw)<br />
N P K<br />
V 1 – Sonalika 2569.7 55.36 9.74 30.01<br />
V 2 – NIDW 295 3169.5 73.91 11.24 37.02<br />
V 3 – UAS 415 3091.1 70.28 11.11 36.04<br />
V 4 – NIAW 917 2374.3 43.98 8.50 26.86<br />
V 5 – DWR 162 2447.0 47.85 8.51 28.67<br />
SEd±<br />
141.4<br />
2.17<br />
0.45<br />
0.93<br />
CD at 5%<br />
326.2<br />
5.01<br />
1.03<br />
2.15<br />
Nitrogen Levels<br />
N 0 – 0 kg N ha -1 1645.7 24.13 5.52 18.29<br />
N 80 – 80 kg N ha -1 2734.6 54.57 9.77 31.60<br />
N 120 – 120 kg N ha -1 2930.7 63.98 10.63 34.55<br />
N 160 – 160 kg N ha -1 3168.6 74.49 11.26 36.99<br />
N 200 – 200 kg N ha -1 3172.3 74.72 11.32 37.16<br />
SEd ±<br />
76.8<br />
1.52<br />
0.25<br />
0.86<br />
CD at 5%<br />
155.3<br />
3.08<br />
0.51<br />
1.74<br />
Interaction effect (V x N)<br />
Sub at same level of main treatment<br />
SEd±<br />
171.7<br />
3.41<br />
0.56<br />
1.93<br />
CD at 5%<br />
NS<br />
NS<br />
NS<br />
NS<br />
Main treatment at same or different levels of sub treatment<br />
SEd±<br />
208.8<br />
3.74<br />
0.67<br />
1.96<br />
CD at 5%<br />
NS<br />
NS<br />
NS<br />
NS<br />
General mean 2730.3 64.91 22.34 38.10<br />
132
NUTRIENT UPTAKE OF MICROSPRINKLER IRRIGATED WHEAT CULTIVARS<br />
reported by Mukherjee (2008) and Singh et al. (2010)<br />
owing to their genetic makeup and yield potential.<br />
Each higher level of nitrogen significantly<br />
increased the nitrogen, phosphorus and potassium<br />
uptake over its lower level up to 160 kg N ha -1 (N 160<br />
)<br />
(Table 1) due to increased grain yield. Application of<br />
200 kg N ha -1 (N 200<br />
) did not prove to be advantageous<br />
over N 160<br />
in improving the nutrient uptake. These<br />
results are in conformity with those of Singh et al.<br />
(2011). The interaction effect (V x N) was significant<br />
on nitrogen, phosphorus and potassium uptake. The<br />
NPK uptake pattern in relation to applied N is shown<br />
in Fig. 1. The explained total variation (R 2 ) in NPK<br />
uptake by applied N was significant and amounted<br />
to 99.5%, 99.9% and 99.8%, respectively suggesting<br />
that the nutrient uptake increased with increase in<br />
applied N, but the increase in uptake was not<br />
proportional to the applied N at higher levels (Fig. 1).<br />
The maximum N uptake was not bracketed within<br />
the administered N levels. The predicted maximum<br />
N uptake of 74.6 kg ha -1 was obtained with 214.6 kg<br />
applied N ha -1 . Whereas, the maximum uptake of P<br />
(10.9 kg ha -1 ) and K (35.9 kg ha -1 ) occurred at applied<br />
N levels of 163.7 kg and 171.0 kg ha -1 . Further the<br />
nutrient uptake function did not emerge through the<br />
origin and the value of regression constant (a) was<br />
positive, indicating that some amount of nutrients<br />
are taken up by the wheat crop from native fertility<br />
status.<br />
Fig. 1. Nutrient uptake as a function of applied nitrogen<br />
The agronomic efficiency (AEN), recovery<br />
efficiency (RE) and physiological efficiency (PE) as<br />
influenced by different nitrogen levels is presented<br />
in Fig. 2. Perusal of the Fig. 2 suggests that each<br />
higher level of nitrogen linearly decreased the AEN,<br />
RE and PE. The mean values of AEN, REN and PEN<br />
were 10.37 kg grain kg -1 N, 0.32 kg N kg -1 N, 32.12<br />
kg grain kg -1 N absorbed, respectively.<br />
133
MATHURA et al<br />
Fig. 2. Nitrogen fertilizer use efficiencies for wheat<br />
Thus, it can be concluded that variety NIDW 295 and UAS 415 registered higher NPK uptake at 160<br />
kg N ha -1 . However, fertilizer use efficiencies tended to decrease with increase in N levels.<br />
REFERENCES<br />
Andrews, M., Leap, J., Raven, J.A and Lindsey, K.<br />
2004. Can genetic manipulation of plant<br />
nitrogen assimilation enzymes result in<br />
increased crop yield and greater n-use<br />
efficiency? An assessment. Annals of Applied<br />
Biology 145: 25 – 40.<br />
Crasswell, E.T and Godwin, D.C. 1984. The efficiency<br />
of nitrogen fertilizers applied to cereals in<br />
different climates. Advances in Plant Nutrition<br />
1: 1 – 55.<br />
Mukherjee, D. 2008. Effect of levels of nitrogen on<br />
different wheat cultivar under Mid Hill<br />
situation.RAU Journal of Research. 18: 37 –<br />
40.<br />
Singh, C.M., Sharma, P.K., Kishore, P., Mishra,<br />
P.K., Singh, A.P., Verma, R and Raha, P.<br />
2011. Impact of integrated nutrient<br />
management on growth, yield and nutrient<br />
uptake by wheat. Asian Journal of Agricultural<br />
Research 5: 76 – 82.<br />
Singh, P., Singh, P., Singh, K.N., Singh R., Bahar,<br />
F and Raja, W. 2010. Evaluation wheat<br />
(Triticumaestivum) genotypes for productivity<br />
and economics under graded levels of nitrogen<br />
in Kashmir. Indian Journal of Agricultural<br />
sciences 80: 380 – 384.<br />
134
Research Notes<br />
J.Res. ANGRAU 41(2) 135-140, 2013<br />
EFFECT OF SYNERGIST, TRIPHENYL PHOSPHATE ON RESISTANT GUNTUR<br />
STRAIN OF Spodoptera litura (fab.) IN COTTON<br />
I. ARUNA SRI and T. MADHUMATHI<br />
Department of Entomology, Agricultural College,<br />
Acharya N.G Ranga Agricultural University, Bapatla -522101<br />
Date of Receipt : 12.01.2012 Date of Acceptance : 28.06.2013<br />
Spodoptera litura (Fab.) is the first<br />
lepidopterous pest and second agricultural pest<br />
developed resistance in India. It has the ability to<br />
develop resistance to insecticides used for its control.<br />
Strains of S. litura resistant to cyclodienes,<br />
organophosphates and carbamates have been<br />
detected in all areas where intensive control<br />
operations were carried out with these insecticides.<br />
Synergists increase the lethality of insecticides by<br />
inhibiting insecticide detoxifying enzymes. This<br />
enables synergists to be used as tools for elucidating<br />
resistance mechanisms, especially if they are<br />
specific inhibitors of a particular resistance conferring<br />
mechanism such as detoxification of enzymes and<br />
also play a significant role in enhancing toxicity on<br />
the resistant strain to a greater extent (Kranthi, 2005).<br />
Mechanisms of insecticide resistance can be<br />
identified based on differential mortalities by<br />
combining various categories of synergists with<br />
insecticides (Prabhakar et al., 1988). The synergists<br />
act as useful indicators of metabolic mechanisms of<br />
resistance such as TPP for esterases (Casida, 1970).<br />
The synergist, Triphenyl phosphate (TPP) was tested<br />
with chlorpyriphos, quinalphos, endosulfan,<br />
cypermethrin and methomyl to know their synergistic<br />
effect. Synergists may also affect penetration of<br />
toxicants into insects. Hence, this study was taken.<br />
Experiments were carried out in the<br />
Department of Entomology, Agricultural College,<br />
Bapatla, Guntur district, Andhra Pradesh during two<br />
years viz., 2007-08 and 2008-09. The third instar<br />
larvae weighing 30 mg ± 0.011 S.E. of Guntur strain<br />
of S.litura was selected as the test insect in this<br />
study because it showed higher degree of resistance<br />
to the insecticides compared to Prakasam strain.<br />
Chlorpyriphos, quinalphos, endosulfan, cypermethrin<br />
and methomyl were the test insecticides and<br />
synergist used in the study was Triphenyl phosphate<br />
(TPP) for esterase activity.<br />
Bioassay was done by topical application<br />
method (FAO, 1971). Initially 2.0 per cent stock<br />
solution of the test insecticides and synergist, TPP<br />
was prepared from the technical grade by dissolving<br />
the required quantities after accurate weighment in<br />
acetone. The stock solution thus prepared was<br />
preserved in refrigerator for further use. Individual<br />
working concentrations for each of the test<br />
insecticides (chlorpyriphos, quinalphos, endosulfan,<br />
cypermethrin and methomyl) were prepared from the<br />
2.0 per cent stock solution through serial dilution<br />
technique using acetone as solvent. Two microlitres<br />
of the respective test insecticidal solution was<br />
applied on the dorsum of second thoracic segment<br />
by micro applicator. Three replications were<br />
maintained for each insecticidal concentration with<br />
10 larvae in each replication. Mortality of the larvae<br />
was recorded at 24, 48 and 72 hours after treatment<br />
(HAT). Further test insecticide in combination with<br />
TPP mixture in the ratio of 1:10 i.e., the concentration<br />
of synergist (TPP) was ten times more than that of<br />
the test insecticide was prepared and from that two<br />
microlitres was applied to the third instar S.litura larvae<br />
by topical application method. Three replications were<br />
maintained for each insecticidal concentration with<br />
10 larvae in each replication.<br />
Mortality of the larvae was recorded at 24,<br />
48 and 72 hours after treatment (HAT). The<br />
experiments were repeated so as to get mortality in<br />
the range of 5 – 90 per cent and the data were<br />
subjected to probit analysis (Finney, 1971) using MLP<br />
3.08 software (Ross, 1987) and the respective LD 50,<br />
LD 90<br />
and other parameters were calculated. The log<br />
dose probit (ldp) lines were drawn by plotting log dose<br />
(x) on x-axis and probits of respective doses on y-<br />
axis (Finney, 1971).<br />
email: issaiaruna@gmail.com<br />
135
ARUNA SRI and MADHUMATHI<br />
Assessment of Synergistic Effect<br />
The Synergistic factor (SF) was calculated by dividing<br />
the LD 50<br />
and LD 90<br />
value of the individual test insecticide<br />
with the corresponding LD 50<br />
and LD 90<br />
value of the test<br />
insecticide + synergist mixture at 72 HAT.<br />
Synergistic ratio = LD 50<br />
of the insecticide alone<br />
If the synergistic ratio is<br />
Chlorpyriphos + TPP<br />
LD 50<br />
of the (insecticide + synergists)<br />
1 – Synergistic effect<br />
=1 – Additive effect<br />
During 2007-08, the LD 50<br />
and LD 90<br />
values of<br />
chlorpyriphos in combination with TPP to the third<br />
instar larvae of Guntur strain of S. litura were 0.3336<br />
and 2.5708; 0.1836 and 1.3946; 0.1643 and 0.9616<br />
µg / larva at 24, 48 and 72 HAT, respectively.<br />
The Guntur strain of S. litura recorded the<br />
LD 50<br />
and LD 90<br />
values of 0.3040 and 1.9340 µg / larva<br />
for chlorpyriphos alone at 72 HAT The synergistic<br />
factor due to TPP at LD 50<br />
and LD 90<br />
levels was 1.85<br />
and 2.01, respectively at 72HAT during 2007-08 (Table<br />
1&3).<br />
During 2008-09, the LD 50<br />
and LD 90<br />
values of<br />
chlorpyriphos were 0.2026 and 2.3066; 0.1708 and<br />
1.8280; 0.1596 and 0.6638 µg / larva at 24, 48 and<br />
72 HAT, respectively. The Guntur strain of S. litura<br />
recorded the LD 50<br />
and LD 90<br />
values of 0.2620 and<br />
1.2000 µg / larva for chlorpyriphos alone at 72 HAT .<br />
The synergistic factor at 72 HAT due to TPP at LD 50<br />
and LD 90<br />
levels were 1.64 and 1.81, respectively<br />
during 2008-09 (Table 2&3).<br />
Quinalphos + TPP<br />
During 2007-08, the LD 50<br />
and LD 90<br />
values of<br />
quinalphos in combination with TPP to the third instar<br />
larvae of Guntur strain of S. litura were 0.4186 and<br />
3.1906; 0.2414 and 2.9340; 0.1720 and 0.9379 µg /<br />
larva at 24, 48 and 72 HAT, respectively.<br />
The Guntur strain of S. litura recorded the<br />
LD 50<br />
and LD 90<br />
values of 0.3600 and 2.2160 µg / larva<br />
for quinalphos alone at 72 HAT. The synergistic factor<br />
at 72 HAT due to TPP at LD 50<br />
and LD 90<br />
levels was<br />
2.09 and 2.36, respectively during 2007-08 (Table<br />
1&3).<br />
During 2008-09, the LD 50<br />
and LD 90<br />
values of<br />
quinalphos were 0.3304 and 4.9804; 0.1888 and<br />
2.4928; 0.1588 and 0.7571 µg / larva at 24, 48 and<br />
72 HAT, respectively. The Guntur strain of S. litura<br />
recorded the LD 50<br />
and LD 90<br />
values of 0.3500 and<br />
1.7100 µg / larva for quinalphos alone at 72 HAT.<br />
The synergistic factor at 72 HAT due to TPP at LD 50<br />
and LD 90<br />
levels was 2.20 and 2.26, respectively during<br />
2008-09 (Table 2&3).<br />
Endosulfan + TPP<br />
During 2007-08, the LD 50<br />
and LD 90<br />
values of<br />
endosulfan in combination with TPP to the third instar<br />
larvae of Guntur strain of S. litura were 2.2266 and<br />
27.6715; 1.9179 and 8.7985; 1.7190 and 3.0661 µg /<br />
larva at 24, 48 and 72 HAT, respectively.<br />
The Guntur strain of S. litura recorded the<br />
LD 50<br />
and LD 90<br />
values of 2.0425 and 3.3052 µg / larva<br />
for endosulfan alone at 72 HAT. The synergistic factor<br />
at 72 HAT due to TPP at LD 50<br />
and LD 90<br />
levels was<br />
1.18 and 1.07, respectively during 2007-08 (Table<br />
1&3).<br />
During 2008-09, the LD 50<br />
and LD 90<br />
values of<br />
endosulfan were 1.2456 and 3.3512; 1.0960 and<br />
3.0789; 0.6985 and 1.1452 µg / larva at 24, 48 and<br />
72 HAT, respectively. The Guntur strain of S. litura<br />
recorded the LD 50<br />
and LD 90<br />
values of 1.7072 and<br />
3.2882 µg / larva for endosulfan alone at 72 HAT.<br />
The synergistic factor at 72 HAT due to TPP at LD 50<br />
and LD 90<br />
levels was 1.90 and 2.19, respectively during<br />
2008-09 (Table 2&3).<br />
Cypermethrin + TPP<br />
During 2007-08, the LD 50<br />
and LD 90<br />
values of<br />
cypermethrin in combination with TPP to the third<br />
instar larvae of Guntur strain of S. litura were 0.3550<br />
and 2.0685; 0.2208 and 1.9155; 0.2099 and 1.5215<br />
µg / larva at 24, 48 and 72 HAT, respectively.<br />
The Guntur strain of S. litura recorded the<br />
LD 50<br />
and LD 90<br />
values of 0.4700 and 3.1680 µg / larva<br />
for cypermethrin alone at 72 HAT. The synergistic<br />
factor at 72 HAT due to TPP at LD 50<br />
and LD 90<br />
levels<br />
was 2.24 and 2.08, respectively during 2007-08 (Table<br />
1&3).<br />
136
EFFECT OF SYNERGIST, TRIPHENYL PHOSPHATE ON RESISTANT GUNTUR STRAIN<br />
Table.1. Toxicity of Triphenyl phosphate (TPP) with test insecticides to the resistant larvae of S. litura<br />
during 2007 - 08<br />
Hours<br />
S.No after<br />
treatment<br />
Chlorpyriphos + TPP<br />
1 24<br />
2 48<br />
3 72<br />
Quinalphos + TPP<br />
1 24<br />
2 48<br />
3 72<br />
Endosulfan + TPP<br />
1 24<br />
2 48<br />
3 72<br />
Cypermethrin + TPP<br />
1 24<br />
2 48<br />
3 72<br />
Methomyl + TPP<br />
1 24<br />
2 48<br />
3 72<br />
LD 50<br />
µg / larva<br />
( 95% FL)<br />
0.3336<br />
(0.2538 –<br />
0.4688)<br />
0.1836<br />
(0.1296 –<br />
0.2992)<br />
0.1643<br />
(0.1324 –<br />
0.4500)<br />
0.4186<br />
(0.2890 –<br />
0.7424)<br />
0.2414<br />
(0.1680 –<br />
0.3660)<br />
0.1720<br />
(0.1425 –<br />
0.3560)<br />
2.2266<br />
(1.2280-<br />
12.9480)<br />
1.9179<br />
(1.2348 –<br />
4.1963)<br />
1.7190<br />
(0.9400 –<br />
3.6642)<br />
0.3550<br />
(0.2424 –<br />
0.7146)<br />
0.2208<br />
(0.1510 –<br />
0.4036)<br />
0.2099<br />
(0.1580 –<br />
0.3740)<br />
0.5724<br />
(0.3800 –<br />
0.9740)<br />
0.3580<br />
(0.2420 –<br />
0.5380)<br />
0.3350<br />
(0.2100 –<br />
0.4692)<br />
LD 90<br />
µg / larva<br />
( 95% FL)<br />
2.5708<br />
(0.9632 -<br />
3.5668)<br />
1.3946<br />
(0.6644 –<br />
6.1970)<br />
0.9616<br />
(0.5501 –<br />
2.9204)<br />
3.1906<br />
(1.4474 -<br />
17.6330)<br />
2.9340<br />
(0.9920 -<br />
7.1640)<br />
0.9379<br />
(0.5428 –<br />
2.8430)<br />
27.6715<br />
(8.6443-<br />
386.690)<br />
8.7985<br />
(2.9380-<br />
67.8720)<br />
3.0661<br />
(1.6200-<br />
12.1620)<br />
2.0685<br />
(0.9338–<br />
12.3670)<br />
1.9155<br />
(0.8212-<br />
12.8903)<br />
1.5215<br />
(0.5828 –<br />
5.7600)<br />
5.7162<br />
(2.5780–<br />
27.5760)<br />
3.0340<br />
(1.6240 –<br />
9.2420)<br />
2.8000<br />
(1.9200 –<br />
4.5684)<br />
Hetero<br />
geneity<br />
(χ 2 )<br />
Slope ± S.E<br />
(b)<br />
Regression<br />
equation<br />
Y = a+bx<br />
2.59 1.91 ± 0.27 Y = 5.91 + 1.91x<br />
3.20 1.47 ± 0.28 Y = 6.08 + 1.47x<br />
1.54 1.67 ± 0.28 Y = 6.31 + 1.67x<br />
3.71<br />
1.45 ± 0.29 Y = 5.55 + 1.45x<br />
1.98 1.42 ± 0.25 Y = 5.88 + 1.42x<br />
1.58 1.74 ± 0.23 Y = 6.33 + 1.74x<br />
2.15 1.18 ± 0.35 Y = 4.58 + 1.18 x<br />
2.56 1.95 ± 0.44 Y = 4.44 + 1.95x<br />
1.36 5.10 ± 0.34 Y = 3.8 + 5.10x<br />
0.82<br />
0.70<br />
1.67 ± 0.34 Y = 5.75 + 1.67x<br />
1.37 ± 0.28 Y = 5.90 + 1.37x<br />
1.28 1.49 ± 0.31 Y = 6.01 + 1.49x<br />
6.15<br />
1.22<br />
1.28 ± 0.23 Y = 5.31 + 1.28x<br />
1.38 ± 0.22 Y = 5.62 + 1.38x<br />
4.76 1.39 ± 0.19 Y = 5.66 + 1.39x<br />
137
ARUNA SRI and MADHUMATHI<br />
Table 2. Toxicity of Triphenyl phosphate (TPP) with test insecticides to the resistant larvae of S. litura<br />
during 2008 – 09<br />
Hours<br />
S.No after<br />
treatment<br />
Chlorpyriphos + TPP<br />
1 24<br />
2 48<br />
3 72<br />
Quinalphos + TPP<br />
1 24<br />
2 48<br />
3 72<br />
Endosulfan + TPP<br />
1 24<br />
2 48<br />
3 72<br />
Cypermethrin + TPP<br />
1 24<br />
2 48<br />
3 72<br />
Methomyl + TPP<br />
1 24<br />
2 48<br />
3 72<br />
LD 50<br />
µg / larva<br />
( 95% FL)<br />
0.2026<br />
(0.1140 –<br />
0.3532)<br />
0.1708<br />
(0.1150 –<br />
0.3018)<br />
0.1596<br />
(0.1038 –<br />
0.2942)<br />
0.3304<br />
(0.2060 –<br />
0.5680)<br />
0.1888<br />
(0.1320 –<br />
0.3140)<br />
0.1588<br />
(0.0424 –<br />
0.2460)<br />
1.2456<br />
(1.0320 –<br />
1.5260)<br />
1.0960<br />
(0.9090 –<br />
1.3214)<br />
0.6985<br />
(0.4240 –<br />
0.9350)<br />
0.3324<br />
(0.2140 –<br />
0.5200)<br />
0.1862<br />
(0.1160 –<br />
0.2820)<br />
0.1224<br />
(0.0968 –<br />
0.4620)<br />
0.3582<br />
(0.2260 –<br />
0.6000)<br />
0.2202<br />
(0.1400 –<br />
0.3340)<br />
0.1912<br />
(0.1214 –<br />
0.4260)<br />
LD 90<br />
µg / larva<br />
( 95% FL)<br />
2.3066<br />
(1.3746–<br />
13.8060)<br />
1.8280<br />
(0.7576 -<br />
13.7550)<br />
0.6638<br />
(0.2040 –<br />
4.9200)<br />
4.9804<br />
(2.1020-<br />
26.1480)<br />
2.4928<br />
(0.6980 –<br />
7.6180)<br />
0.7571<br />
(0.4800 –<br />
2.0968)<br />
3.3512<br />
(2.4760–<br />
5.7740)<br />
3.0789<br />
(2.2714 –<br />
5.4748)<br />
1.1452<br />
(0.9600 –<br />
1.4513)<br />
3.6844<br />
(1.8240-<br />
13.2580)<br />
1.9308<br />
(1.0640 –<br />
5.2400)<br />
0.7835<br />
(0.5243 –<br />
1.4240)<br />
5.1174<br />
(2.2180-<br />
25.9560)<br />
2.3152<br />
(1.2340 –<br />
6.8640)<br />
1.5283<br />
(1.0721 –<br />
6.8240)<br />
138<br />
Hetero<br />
geneity<br />
(χ 2 )<br />
Slope ± S.E<br />
(b)<br />
Regression<br />
equation<br />
Y = a+bx<br />
5.38 1.08 ± 0.19 Y = 5.75 + 1.08x<br />
1.46 1.25 ± 0.26 Y = 5.96 + 1.25x<br />
3.20 2.07 ± 0.26 Y = 6.65 + 2.07x<br />
1.38 1.09 ± 0.19 Y = 5.52 + 1.09x<br />
1.64 1.43 ± 0.28 Y = 6.03 + 1.43x<br />
2.13 1.89 ± 0.23 Y = 6.51 + 1.89x<br />
4.04 2.98 ± 0.49 Y = 4.72 + 2.98x<br />
4.42 2.86 ± 0.50 Y = 4.89 + 2.86x<br />
3.14 5.97 ± 0.46 Y = 5.93 + 5.97x<br />
0.16 1.23 ± 0.20 Y = 5.59 + 1.23x<br />
0.53 1.26 ± 0.19 Y = 5.92 + 1.26x<br />
0.46 1.59 ± 0.21 Y = 6.45 + 1.59x<br />
4.49 1.11 ± 0.20 Y = 5.49 + 1.11x<br />
1.46 1.25 ± 0.20 Y = 5.82 + 1.25x<br />
4.03 1.42 ± 0.19 Y = 6.02 + 1.42x
EFFECT OF SYNERGIST, TRIPHENYL PHOSPHATE ON RESISTANT GUNTUR STRAIN<br />
During 2008-09, the LD 50<br />
and LD 90<br />
values of<br />
cypermethrin were 0.3324 and 3.6844; 0.1862 and<br />
1.9308; 0.1224 and 0.7835 µg / larva at 24, 48 and<br />
72 HAT, respectively. The Guntur strain of S. litura<br />
recorded the LD 50<br />
and LD 90<br />
values of 0.4200 and<br />
2.4540 µg / larva for cypermethrin alone at 72 HAT.<br />
The synergistic factor at 72 HAT due to TPP at LD 50<br />
and LD 90<br />
levels was 3.43 and 3.13, respectively during<br />
2008-09 (Table 2&3).<br />
Methomyl + TPP<br />
During 2007-08, the LD 50<br />
and LD 90<br />
values of<br />
methomyl in combination with TPP to the third instar<br />
larvae of Guntur strain of S. litura were 0.5724 and<br />
5.7162; 0.3580 and 3.0340; 0.3350 and 2.8000 µg /<br />
larva at 24, 48 and 72 HAT, respectively.<br />
The Guntur strain of S. litura recorded the<br />
LD 50<br />
and LD 90<br />
values of 0.5247 and 4.2922 µg / larva<br />
for methomyl alone at 72 HAT. The synergistic factor<br />
at 72 HAT due to TPP at LD 50<br />
and LD 90<br />
levels was<br />
1.57 and 1.53, respectively during 2007-08 (Table<br />
1&3).<br />
During 2008-09, the LD 50<br />
and LD 90<br />
values of<br />
methomyl were 0.3582 and 5.1174; 0.2202 and<br />
2.3152; 0.1912 and 1.5283 µg / larva at 24, 48 and<br />
72 HAT, respectively. The Guntur strain of S. litura<br />
recorded the LD 50<br />
and LD 90<br />
values of 0.5140 and<br />
3.5895 µg / larva for methomyl alone at 72 HAT. The<br />
synergistic factor at 72 HAT due to TPP at LD 50<br />
and<br />
LD 90<br />
levels was 2.69 and 2.35, respectively during<br />
2008-09 (Table 2&3).<br />
From the above results it was evident that<br />
synergism with TPP was observed more in<br />
cypermethrin followed by quinalphos, chlorpyriphos,<br />
methomyl and endosulfan at LD 50<br />
level revealing that<br />
the levels of resistance to cypermethrin followed by<br />
quinalphos, chlorpyriphos, methomyl and endosulfan<br />
Table 3. Synergism in S. litura to the test insecticides during two years, 2007 – 08 and 2008 - 09<br />
Insecticide LD 50 LD 90<br />
Synergistic ratio<br />
( 2007 – 08) LD 50 LD 90 (2008 – 09)<br />
Synergistic ratio<br />
LD 50 LD 90 LD 50 LD 90<br />
Chlorpyriphos 0.3040 1.9340 -- -- 0.2620 1.2000 -- --<br />
Chlorpyriphos + TPP<br />
0.1643 0.9616 1.85 2.01 0.1596 0.6638 1.64 1.81<br />
Quinalphos 0.3600 2.2160 -- -- 0.3500 1.7100 -- --<br />
Quinalphos +TPP<br />
0.1720 0.9379 2.09 2.36 0.1588 0.7571 2.20 2.26<br />
Endosulfan 2.0425 3.3052 -- -- 1.7072 3.2882 -- --<br />
Endosulfan + TPP<br />
1.7190 3.0661 1.18 1.07 0.8970 1.5015 1.90 2.19<br />
Cypermethrin 0.4700 3.1680 -- -- 0.4200 2.4540 -- --<br />
Cypermethrin + TPP<br />
0.2099 1.5215 2.24 2.08 0.1224 0.7835 3.43 3.13<br />
Methomyl 0.5247 4.2922 -- -- 0.5140 3.5895 -- --<br />
Methomyl + TPP<br />
0.3350 2.8000 1.57 1.53 0.1912 1.5283 2.69 2.35<br />
139
ARUNA SRI and MADHUMATHI<br />
could be brought down successfully with the synergist<br />
TPP.<br />
The present study was in accordance with<br />
Radhika et al. (2004) who reported that cypermethrin<br />
was synergized by TPP through topical application<br />
in S. litura. Radhika et al. (2005) also reported<br />
REFERENCES<br />
Casida, J. E. 1970. Mixed function oxidase<br />
involvement in the biochemistry of<br />
insecticides. Journal of Agriculture and Food<br />
Chemistry. 18:753-772.<br />
FAO (Food and Agricultural Organization). 1971.<br />
Recommended methods for the detection and<br />
measurement of pest resistance to pesticides.<br />
Tentative method for larvae of Egyptian cotton<br />
leafworm Spodoptera littoralis Biosd. F.A.O<br />
method No.8 Food and Agricultural<br />
Organization. Plant Protection Bulletin. 19:32-<br />
35.<br />
Finney, D. J. 1971. Probit analysis, Cambridge<br />
University, London. Pp. 333..<br />
Kranthi, K. R. 2005. Insecticide resistance –<br />
monitoring, mechanisms and management<br />
manual. Central Institute for Cotton Research,<br />
Nagpur. Pp. 80-94.<br />
synergism of endosulfan in combination with TPP,<br />
conforming the synergistic effect in the present<br />
findings. From the present investigations it was<br />
evident that synergism of chlorpyriphos, quinalphos<br />
and endosulfan was more with TPP which clearly<br />
indicated that TPP could effectively reduce the<br />
esterase activity in the detoxification of<br />
chlorpyriphos, quinalphos and endosulfan.<br />
Prabhakar, N., Coudriet, D. L and Toscano, N. C.<br />
1988. Effect of synergists on organophosphate<br />
and permethrin resistance in sweet potato<br />
whitefly (Homoptera : Aleyrodidae). Journal of<br />
Economic Entomology. 81:34-39.<br />
Radhika, P., Subbaratnam, G. V and Punnaiah, K.<br />
C. 2004 .Role of mixed function oxidases<br />
(MFO) and esterases in the larval population<br />
of Spodoptera litura (Fabr.) to cypermethrin<br />
resistance. Pest Management and Economic<br />
Zoology 12 (2):113-122.<br />
Radhika, P., Subbaratnam, G. V and Punnaiah, K.<br />
C. 2005. Possible mechanisms of resistance<br />
to endosulfan in the larval population of<br />
Spodoptera litura Fab. Annals of Plant<br />
Protection Sciences. 13 (1):14-18.<br />
Ross, G. J. S. 1987. Maximum likely hood program.<br />
The numerical Algorithms Group. Rothamsted<br />
Experimental Station, Harpenden, UK.<br />
140
Research Notes<br />
J.Res. ANGRAU 41(2) 141-143, 2013<br />
EFFECT OF HARVESTING STAGES AND DRYING METHODS ON ALKALOID<br />
CONTENT IN MAKOI Solanum Nigrum L.<br />
P.BRAHMA SAI, B.AMARESWARI and S.S VIJAYA PADMA<br />
College of Horticulture, Dr.YSR Horticultural University, Rajendranagar, Hyderabad-500030<br />
Date of Receipt : 03.10.2012 Date of Acceptance : 12.03.2013<br />
Medicinal plants have been used to cure<br />
human ailments since ancient times. However, today<br />
we find a renewed interest in traditional medicine.<br />
Black nightshade (Solanum nigrun L.), is an annual<br />
herb belonging to the family Solanaceae. The leaves,<br />
berries and the whole herb of this plant are<br />
economically important. The alkaloids, á- solamargine<br />
and á-solasodine have been isolated and identified<br />
from the green, unripe fruits (Ridout et al., 1989). The<br />
berries also contain four steroidal glycol-alkaloids like<br />
á-solanigrine, â-solanigrine, solanourgine and<br />
solarodine. The total alkaloid content of the fruits and<br />
leaves is 0.101 and 0.431 percent, respectively . The<br />
solasodine content of diploid(0.04%) and tetraploid<br />
forms (0.06%) of Solanum nigrum have also been<br />
reported (Banik et al.,1990).<br />
However, no information is available with<br />
regard to appropriate harvesting stage and effect of<br />
drying and storage practices on alkaloid content of<br />
makoi under Hyderabad conditions. Hence, in the<br />
present investigation, it is proposed to identify the<br />
correct stage of harvesting and appropriate drying<br />
methods to obtain maximum amount of alkaloid<br />
recovery per unit area.<br />
A field experiment was carried out to study,<br />
the effect of harvesting stages and drying methods<br />
on alkaloid content of Solanum nigrum L. at College<br />
of Horticulture, Rajendra nagar, Hyderabad, A.P<br />
during December 2009 to May 2010.<br />
The experimental area was ploughed,<br />
harrowed and brought to a fine tilth. Weeds and<br />
stubbles were removed and clods were crushed. The<br />
land was divided into plots (3.0m x 2.25 m) with bunds<br />
of 45 cm were laid out as per plan. Individual plots<br />
were leveled and FYM was applied to each plot and<br />
mixed thoroughly with the soil. Ridges and furrows<br />
were made at 60 cm apart. The recommended dose<br />
of NPK was supplied in the form of straight fertilizers.<br />
N in the form of Urea, P in the form of Single Super<br />
Phosphate and K in the form Murate of Potash. Of<br />
these nutrients, 50% N, full dose of P and K were<br />
supplied as basal dose just before transplanting.<br />
Remaining 50% N was applied as top dressing at 30<br />
days after transplanting. The fertilizers were applied<br />
in the furrows and mixed thoroughly with the soil.<br />
The soil of the experimental site has been<br />
categorized as red sandy loam. The experiment was<br />
laid out in a Completely Randomized Block Design<br />
(CRBD) with three replications. The experiment<br />
consisted of four harvesting stages viz., 100%<br />
flowering stage, Fruiting stage, Mature green berry<br />
stage and Berry ripening stage and three drying<br />
methods viz., Sun drying, Shade drying and Oven<br />
drying at 45 0 C ± 1 0 C, there were 12 treatment<br />
combinations ( Table 1) employed in this study.<br />
Alkaloid yield in main and ratoon crop<br />
The observations recorded on alkaloid yield per<br />
hectare as influenced by harvesting stages and drying<br />
methods in main crop has been presented in Table<br />
2.<br />
Harvesting the crop at mature green berry<br />
stage recorded highest alkaloid yield (48.96 kg ha -1 )<br />
which differed significantly with other stages of<br />
harvesting and the least alkaloid yield (4.03 kg ha -1 )<br />
was recorded when the plants were harvested at 100%<br />
flowering stage. Among drying methods significant<br />
difference were noticed, where in maximum mean<br />
alkaloid yield (30.21 kg ha -1 ) was obtained by shade<br />
drying (D 2<br />
), minimum (17.62 kg ha -1 ) when dried under<br />
sun(D 1<br />
).<br />
email: brahmasai08@gmail.com<br />
141
BRAHMA et al<br />
Table 1. Details of treatments imposed<br />
Treatment<br />
Combination of treatments<br />
T 1<br />
T 2<br />
T 3<br />
T 4<br />
T 5<br />
T 6<br />
T 7<br />
T 8<br />
T 9<br />
T 10<br />
T 11<br />
T 12<br />
H 1 D 1 (100% Flowering stage + Sun drying)<br />
H 1 D 2 (100% Flowering stage + Shade drying)<br />
H 1 D 3 (100% Flowering stage + Oven drying)<br />
H 2 D 1 (Fruiting stage + Sun drying)<br />
H 2 D 2 (Fruiting stage + Shade drying)<br />
H 2 D 3 (Fruiting stage + Oven drying)<br />
H 3 D 1 (Mature green berry stage + Sun drying)<br />
H 3 D 2 (Mature green berry stage + Shade drying)<br />
H 3 D 3 (Mature green berry stage + Oven drying)<br />
H 4 D 1 (Berry ripening stage + Sun drying)<br />
H 4 D 2 (Berry ripening stage + Shade drying)<br />
H 4 D 3 (Berry ripening stage + Oven drying)<br />
Table 2. Effect of harvesting stages and drying methods on alkaloid content in main crop (dry) (kg/ha)<br />
of makoi Solanum nigrum L.<br />
Treatment D 1 D 2 D 3 Mean<br />
H 1 2.25 5.90 3.95 4.03<br />
H 2 8.93 25.04 16.46 16.81<br />
H 3 44.88 53.95 48.05 48.96<br />
H 4 14.44 35.98 23.82 24.74<br />
Mean 17.62 30.21 23.07 23.63<br />
F-test SEm CD@5%<br />
H * 0.52 1.55<br />
D * 0.45 1.34<br />
H×D * 0.91 2.68<br />
The perusal of data presented in Table 3<br />
indicates that of alkaloid yield in ratoon crop as<br />
influenced by harvesting stages and drying methods<br />
followed same trend as in the main crop.<br />
Makoi crop harvested at 100% flowering stage that<br />
gave lowest alkaloid yield (1.93kg ha -1 ) has differed<br />
significantly with the crop harvested at mature green<br />
berry stage that registered maximum alkaloid yield<br />
142
EFFECT OF HARVESTING STAGES AND DRYING METHODS ON ALKALOID<br />
(26.46kg ha -1 ). In ratoon crop, among drying methods<br />
maximum alkaloid content was recovered at mature<br />
green berry stage. Among the drying methods adopted<br />
for recovery of alkaloid content in different parts of<br />
makoi, the optimum recovery was in shade drying<br />
irrespective of stage of harvesting while minimum<br />
recovery was observed in sun drying method. Hence<br />
the quality and quantity of alkaloid recovery was<br />
optimum under shade drying only.<br />
Table 3. Effect of harvesting stages and drying methods on alkaloid content in ratoon crop (dry) (kg/<br />
ha) of makoi (Solanum nigrum L.)<br />
TREATMENT D 1 D 2 D 3 Mean<br />
H1 0.94 2.95 1.90 1.93<br />
H2 2.80 7.78 4.25 4.94<br />
H3 23.91 30.15 25.32 26.46<br />
Mean 9.22 13.62 10.49 11.11<br />
F-test SEm CD@5%<br />
H * 0.17 0.52<br />
D * 0.17 0.52<br />
HD * 0.30 0.91<br />
There was steady increase in total alkaloid<br />
content from 100% flowering stage to mature green<br />
berry stage. Drying methods also influenced the<br />
alkaloid content, where as under sun drying, the<br />
lowest alkaloid content was recorded irrespective of<br />
the stage of harvest. This might be due to<br />
deterioration or decomposition of constituents in the<br />
drying of produce when exposed directly to sun light.<br />
Oven drying has reduced the yield and recorded lesser<br />
alkaloid content when compared to shade dried<br />
herbage. This may be due to the damage to the<br />
tissues or degradation of alkaloid due to high light<br />
intensity. The crop was dried in the oven at 45 0 C ±<br />
1 0 C temperature, but they had low alkaloid, when<br />
compared to shade dried produce. These findings<br />
are in confirmation with the earlier reports of Leela<br />
and Angadi (1992) in mints.<br />
REFERENCES<br />
Banik, A .S., Mukhopahyay D.L.K and Chaudhari,<br />
R.K 1990. Content and purity of extracted<br />
solasodine in some available species of<br />
Solanum. Science and Culture 56 (5): 214-<br />
216.<br />
Ridout,C.L., Price, K.R., Coxon, D.T and Fenwick<br />
G.R 1989. Glyco-alkaloids from Solanum<br />
nigrum L solamargine and alpha solasonine.<br />
Pharmazie 44(10): 732-733.<br />
Leela, N. K and Angadi, S.P 1992. Effect of post<br />
harvest drying of herbage on yield and quality<br />
of essential oil in the Metha sp EC41911.<br />
Indian Perfumer 36(4): 235-237.<br />
143
Research Notes<br />
J.Res. ANGRAU 41(2) 144-148, 2013<br />
RESPONSE OF AEROBIC RICE TO IRRIGATION SCHEDULING AND NITROGEN<br />
DOSES UNDER DRIP IRRIGATION<br />
M . MALLA REDDY, B. PADMAJA, G .VEERANNA and D .VISHNU VARDHAN REDDY<br />
Regional Agricultural Research Station,<br />
Acharya N.G.Ranga Agricultural University, Warangal – 506 007<br />
Date of Receipt : 08.01.2013 Date of Acceptance : 10.05.2013<br />
In Andhra Pradesh, rice is the major crop<br />
grown in an area of 4.4 M ha with a production of<br />
14.2 M t and productivity of 3.2 t ha -1 (CMIE, 2011).<br />
Lowland rice requires around 1000 to 5000 litres of<br />
water for producing one kg grain which is about twice<br />
or even more than wheat or maize water<br />
requirement(Cantrell and Hettel, 2005). However, the<br />
increasing scarcity of fresh water for agriculture and<br />
the equal demand from the non-agricultural sector<br />
threaten the sustainability of the irrigated rice<br />
ecosystem. One of the recent developments is to<br />
grow rice as an upland crop viz. wheat or maize and<br />
named as ‘aerobic’ cultivation. Aerobic rice cultivation<br />
saves water input and increases water productivity<br />
by reducing water use during land preparation and<br />
limiting seepage, percolation and evaporation (Peng<br />
et al., 2012). To make aerobic rice successful, new<br />
varieties and management practices need to be<br />
developed. Optimum irrigation scheduling and nitrogen<br />
nutrition is critical for profitable yield realization of<br />
aerobic rice (Maheswari et al., 2007). Drip irrigation<br />
and fertigation methods have been proved to be the<br />
water and nutrient efficient methods, respectively in<br />
most of the crops apart from increasing the<br />
productivity. Information is not available on the<br />
response of aerobic rice to drip irrigation and<br />
fertigation. Hence, the present investigation was<br />
carried to find out the influence of irrigation scheduling<br />
and nitrogen doses on aerobic rice under drip irrigation<br />
in sandy loam soils.<br />
Field experiment was conducted during<br />
kharif, 2010 at Regional Agricultural Research Station,<br />
Warangal, Andhra Pradesh. The soil of the<br />
experimental site was sandy loam in texture, medium<br />
in organic carbon (0.5), low in available nitrogen (279<br />
kg ha -1 ), available phosphorus (7.7 kg ha -1 ) and<br />
available potassium (74 kg ha -1 ) and electrical<br />
conductivity (EC) as 0.2 d Sm -1 with a pH of 8.1. The<br />
values of field capacity, permanent wilting point and<br />
bulk density were 13%, 5.6% and 1.4 g/cm 3 ,<br />
respectively at a soil depth of 60 cm. The experiment<br />
was laid out in a split plot design with irrigation<br />
schedules (3) as main plots and nitrogen doses (3)<br />
as sub plots. The irrigation schedules consisted of<br />
I 1<br />
: 100 % PE through drip irrigation, I 2<br />
: 150 % PE<br />
through drip irrigation and I 3<br />
: Field saturation and<br />
nitrogen doses were N 1<br />
: 120 kg ha -1 , N 2<br />
: 150 kg<br />
ha -1 and N 3<br />
: 180 kg ha .1 which were replicated thrice.<br />
Rice variety ‘WGL-32100’ (Warangal Sannalu) of 135<br />
days duration was sown by dibbling at 30 cm row<br />
spacing as solid rows with a seed rate of 40 kg ha -1<br />
on 18 th June, 2010. Two common irrigations of 60<br />
mm each were given, one at pre-sowing for good<br />
germination and second at 10 th day after sowing for<br />
crop establishment. Thinning and gap filling was done<br />
at 14 days after sowing. Nitrogen was applied as per<br />
the treatments in the form of urea as fertigation. The<br />
entire dose was split up into six equal parts and<br />
applied through drip with a Ventury fixed to the drip<br />
system at ten days interval starting from 15 days<br />
after sowing. For I 3<br />
treatment, it was applied in three<br />
splits, 1/3 rd each at sowing, active tillering and panicle<br />
initiation stages. Phosphorous @ 60 kg P 2<br />
O 5<br />
ha -1 as<br />
single super phosphate and potassium @ 40 kg K 2<br />
O<br />
ha -1 as muriate of potash were applied to all the<br />
treatments uniformly at the time of sowing as basal<br />
dose. These fertilizers were applied as bands in the<br />
seed furrow. Drip irrigation was given as per the<br />
recommended schedule based on the evaporation<br />
from Open Pan Evaporimeter situated at Regional<br />
Agricultural Research Station, Warangal discounting<br />
the rainfall received. The plot size was 9.6 × 6.0 m.<br />
The experiment was laid out by providing wider<br />
irrigation channels and individual plots were<br />
demarcated by bunds. Irrigation control valve was<br />
provided for each plot. In I 3<br />
treatment irrigation was<br />
email: maduri_agron@yahool.com<br />
144
RESPONSE OF AEROBIC RICE TO IRRIGATION SCHEDULING AND NITROGEN<br />
given as and when required to maintain the soil in<br />
saturation condition throughout the crop growth<br />
period. The amount of water given every time was<br />
measured and summed up. The drip system was<br />
established keeping 60 cm between two lateral lines<br />
to accommodate aerobic rice. One lateral line is lied<br />
between two crop rows. Distance between two<br />
drippers is 50 cm. The discharge rate of drippers is 4<br />
Lph. The diameter of lateral in-line was 16 mm. The<br />
system was operated under a pressure of 1.2-1.5<br />
kg/cm 2 . The source of irrigation water is open well<br />
fitted with 3 H.P. electrical motor. Quantity of water<br />
applied was measured treatment wise with water<br />
meter fixed to the system. Amount of water applied<br />
in I 1<br />
was 220 mm, I 2<br />
: 330 mm and I 3<br />
: 450 mm (9<br />
irrigations each at 50 mm depth). To control the<br />
weeds, pendimethalin @ 1.2 kg a.i. ha -1 was applied<br />
at 24 hours after sowing fb post-emergence<br />
application of pyrazosulfuron ethyl @ 30 g a.i. ha -1 at<br />
25 DAS in rice. They were sprayed using 500 litres<br />
of water ha -1 with flood jet nozzle. A range of mean<br />
minimum temperature of 23.4 to 24.6 0 C and mean<br />
maximum temperature of 29.2 to 34.6 0 C was<br />
recorded during the crop growth period. A total rainfall<br />
of 827 mm was received during the crop season in<br />
46 rainy days. The crop was harvested on 27 th<br />
October, 2010. Pre and post-harvest observations in<br />
respect of both growth and yield parameters were<br />
recorded following standard procedures. Net returns<br />
(Rs. ha .1 ) were calculated by deducting the cost of<br />
cultivation (Rs. ha .1 ) from the gross returns (Rs. ha .1 )<br />
excluding the cost incurred towards installation of<br />
drip system. Nitrogen uptake (kg ha -1 ) was calculated<br />
by considering nitrogen content (%) in grain / straw<br />
at harvest. The other recommended cultural and pest<br />
management practices were adopted.<br />
Application rate of<br />
drip system (mm/hr) = Lph (litres per hour) /<br />
Distance between laterals x<br />
Distance between dippers<br />
= 4 Lph / 0.6 m x 0.5 m<br />
= 13.33 mm/hr<br />
Maintenance of soil under saturated condition<br />
throughout the crop growth period resulted in<br />
significantly taller plants (Table 1) compared to<br />
scheduling irrigation at 100 or 150 % PE. Similarly,<br />
significant number of tillers was recorded with soil<br />
saturation over the other two schedules both at 30<br />
and 60 days after sowing (DAS). In comparision,<br />
scheduling irrigation at 150% PE was found to be<br />
superior to 100% PE with respect to plant height and<br />
tillers/m 2 . Among the nitrogen doses, application of<br />
180 kg N ha -1 resulted in taller plants over 150 kg N<br />
ha -1 which in-turn was significant over 120 kg N ha -1 .<br />
The tiller number/m 2 was also significantly enhanced<br />
with increase in N application i.e., from 120 to 180<br />
kg N ha -1 both at 30 and 60 DAS.<br />
The number of panicles/m 2 was significantly<br />
higher with soil saturation compared to 100 % PE<br />
but at par with 150 % PE (Table 2). The proportion<br />
of unproductive tillers to total number of tillers tend<br />
to increase at 100% PE compared 150% PE or soil<br />
saturation both of which were at par with each other.<br />
Maintenance of soil at saturation significantly<br />
increased the number of filled grains / panicle with<br />
corresponding decreases in chaffyness over 150 %<br />
PE or 100 % PE. In-turn 150% PE differed<br />
significantly with 100 % PE with higher number of<br />
filled grains / panicle but reduced chaffyness.<br />
Significantly longer panicles were recorded with soil<br />
saturation compared to 100 % PE but at par with 150<br />
% PE. However, the 1000- grain weight (g) did not<br />
differ significantly among the different irrigation<br />
schedules. The above results on plant growth and<br />
yield attributes were in accordance with Maheswari<br />
et al. (2007); Ghosh et al. (2012); Mahajan et al.<br />
(2012) and Sridharan and Vijayalakshmi (2012).<br />
Increased dose of N i.e., 180 kg N ha -1 resulted in<br />
higher number of panicles over 120 kg N ha -1 but at<br />
par with 150 kg N ha -1 . Contribution of unproductive<br />
tillers gradually reduced with increase in N dose from<br />
120 to 180 kg N ha -1 . There was a consistent and<br />
significant increase in the number of filled grains /<br />
panicle from 120 to 150 kg N ha -1 and then to 180 kg<br />
N ha -1 . Chaffyness registered the reverse trend to<br />
that of filled grains. Application of 180 kg N ha -1<br />
produced significantly longer panicles than 120 kg N<br />
ha -1 but at par with 150 kg N ha -1 which in-turn was<br />
superior to 120 kg N ha -1 . However, the test weight<br />
was similar with all the three doses of nitrogen. These<br />
results corroborate the findings of Lateef (2010); Devi<br />
and Sumathi (2011) and Rani (2012).<br />
In general, the yield levels are low probably<br />
due to severe Fe deficiency and termites incidence.<br />
The grain yield of aerobic rice recorded with the<br />
irrigation regime of maintenance of just soil saturation<br />
145
Malla Reddy et al<br />
throughout the crop growth period was significantly<br />
higher than the other two schedules i.e., 150 % PE<br />
and 100 % PE which were at par with each other. It<br />
was increased by 20 per cent with the soil saturation<br />
over 150% PE and 46 per cent over 100% PE with<br />
an increased input of 120 and 230 mm of water over<br />
the later two treatments, respectively (Table 3).<br />
However, the difference in straw yield due to different<br />
irrigation schedules was not significant. Scheduling<br />
the irrigation through drip system at 100% PE resulted<br />
in a 25 and 42 per cent increase in water use<br />
efficiency (WUE) over 150% PE and soil saturation,<br />
respectively due to less water input in the former<br />
treatment. But, the net returns (Rs. /ha) were higher<br />
with the irrigation schedule of maintaining soil<br />
saturation compared to 150% PE which was again<br />
better than 100% PE. Maheswari et al. (2007) and<br />
Sridharan and Vijayalakshmi (2012) also reported<br />
increased yields of aerobic rice with increased<br />
frequency and input of water i.e., at 1.2 IW/CPE ratio<br />
compared with microsprinkler irrigation. Nitrogen<br />
doses applied through drip irrigation i.e., fertigation<br />
differed among themselves with respect to grain and<br />
straw yield of aerobic rice (Table 3). Application of<br />
180 kg N ha -1 significantly increased the grain and<br />
straw yield of aerobic rice over 120 kg N ha -1 but at<br />
par with 150 kg N ha -1 . The nitrogen doses 120 and<br />
150 kg N ha -1 were again at par with each other.<br />
Similarly, the higher dose of N resulted in an<br />
improvement of 10 and 24 per cent in WUE, over<br />
150 and 120 kg N ha -1 , respectively. The net returns<br />
also increased by Rs. 2,557/- per ha at 180 kg N ha -<br />
1<br />
compared to 150 kg N ha -1 .<br />
Nitrogen uptake (kg ha -1 ) by the grain as well<br />
as straw was gradually increased with the water input<br />
from 100% PE to soil saturation treatment, even<br />
though the difference was not statistically significant<br />
with respect to the N uptake by straw (Table 4). The<br />
nitrogen doses of 180 and 150 kg ha -1 were at par<br />
with each other with respect to the N uptake both by<br />
grain and straw. Similarly, both 120 and 150 kg N ha -<br />
1<br />
were at par with each other. Interaction effect<br />
between the irrigation schedules and nitrogen dose<br />
with respect to growth, yield attributes, yield and<br />
nitrogen uptake by aerobic rice is not significant.<br />
Similar findings were reported by Devi and Sumathi<br />
(2011), Rani (2012) and Sridharan and Vijayalakshmi<br />
(2012).<br />
Thus, the above results indicated that the<br />
better performance of aerobic rice was possible when<br />
the soil is maintained at saturation throughout the<br />
growth period in sandy loam soils of Telangana region.<br />
Further, application of 150 kg N ha -1 is sufficient for<br />
realising good yields in aerobic rice.<br />
Table 1. Influence of irrigation schedules and nitrogen doses on growth parameters of aerobic rice<br />
under drip irrigation<br />
Treatment<br />
Irrigation schedules (I)<br />
Plant height at<br />
harvest (cm)<br />
Tillers/m 2 at 30<br />
DAS<br />
Tillers/m 2 at<br />
60 DAS<br />
I 1 : 100% PE 78.2 251 308<br />
I 2 : 150% PE 80.1 289 341<br />
I 3 : Soil Saturation 82.4 320 373<br />
SEm+ 0.4 6.8 7.0<br />
CD at 5 % 1.5 26.8 27.6<br />
Nitrogen doses (N) (kg/ha)<br />
N 1 : 120 79.6 266 321<br />
N 2 : 150 80.3 287 340<br />
N 3 : 180 81.4 306 361<br />
SEm+ 0. 5 5.7 5.4<br />
CD at 5 % 1.4 17.6 16.6<br />
Interaction<br />
SEm+ 0.8 9. 9 9.3<br />
CD at 5 % NS NS NS<br />
146
RESPONSE OF AEROBIC RICE TO IRRIGATION SCHEDULING AND NITROGEN<br />
Table 2. Yield attributes of aerobic rice as influenced by irrigation schedules and nitrogen doses<br />
under drip irrigation<br />
Treatment<br />
Panicles/<br />
m 2<br />
Un<br />
productive<br />
tillers/ m 2<br />
at harvest<br />
Filled<br />
grains/<br />
panicle<br />
Chaffy<br />
grains/<br />
panicle<br />
Panicle<br />
length<br />
(cm)<br />
1000-<br />
grain<br />
weight<br />
(g)<br />
Irrigation schedules (I)<br />
I 1 : 100% PE 254 44 128 71 22.0 11.5<br />
I 2 : 150% PE 284 35 146 61 22.6 11.8<br />
I 3 :Soil Saturation 318 31 168 53 23.1 11.6<br />
SEm+ 11.2 2.2 4.2 3.3 0.14 0.07<br />
CD at 5 % 43.8 8.5 16.3 12.8 0.56 NS<br />
Nitrogen doses (N) (kg/ha)<br />
N 1 : 120 266 41 136 67 22.2 11.6<br />
N 2 : 150 285 37 147 65 22.6 11.6<br />
N 3 : 180 304 32 158 56 22.9 11.8<br />
SEm+ 9.2 3.0 2.9 4.0 0.10 0.11<br />
CD at 5 % 28.3 9.4 8.9 12.4 0.31 NS<br />
Interaction<br />
SEm+ 15.9 5.3 5.0 6.9 0.17 0.11<br />
CD at 5 % NS NS NS NS NS NS<br />
Table 3. Yield, Water use efficiency (WUE) and Net returns (Rs. /ha) of aerobic rice as influenced by<br />
irrigation schedules and nitrogen doses under drip irrigation<br />
Treatment<br />
Irrigation schedules (I)<br />
Grain yield<br />
(kg/ha)<br />
Straw yield<br />
(kg/ha)<br />
WUE<br />
(kg/ha mm)<br />
Net returns<br />
(Rs./ha)<br />
I 1 : 100% PE 2450 3755 11.30 4,755<br />
I 2 : 150% PE 2983 4288 9.03 7,318<br />
I 3 : Soil Saturation 3571 4872 7.93 9,282<br />
SEm+ 142 301 - -<br />
CD at 5 % 558 NS - -<br />
Nitrogen doses (N) (kg/ha)<br />
N 1 : 120 2682 3969 8.33 6,639<br />
N 2 : 150 3021 4340 9.41 9,900<br />
N 3 : 180 3300 4607 10.35 12,457<br />
SEm+ 170 179 - -<br />
CD at 5 % 524 550 - -<br />
Interaction<br />
SEm+ 294 309 - -<br />
CD at 5 % NS NS - -<br />
Price (Rs./kg) Grain: 10.3 and Straw : 1.0<br />
147
Malla Reddy et al<br />
Table 4. Influence of irrigation schedules and nitrogen doses on nitrogen uptake (kg/ha) in aerobic<br />
rice under drip irrigation<br />
Treatment<br />
Nitrogen uptake (kg/ha)<br />
Irrigation schedules (I) Grain Straw Total<br />
I 1 : 100% PE 22.31 17.50 39.81<br />
I 2 : 150% PE 28.04 21.64 49.69<br />
I 3 : Soil Saturation 35.29 25.16 60.45<br />
SEm+ 1.32 1.50 2.60<br />
CD at 5 % 5.19 NS 10.21<br />
Nitrogen doses (N) (kg/ha)<br />
N 1 : 120 24.89 19.33 44.22<br />
N 2 : 150 28.66 21.43 50.09<br />
N 3 : 180 32.10 23.54 55.64<br />
SEm+ 1.56 0.87 1.99<br />
CD at 5 % 4.57 2.55 5.84<br />
Interaction<br />
SEm+ 2.71 1.51 3.45<br />
CD at 5 % NS NS NS<br />
REFERENCES<br />
Cantrell, R.P and Hettel, G.P. 2005. Research<br />
strategy for rice in the 21 st century. In:<br />
Toriyama et al., (eds) Rice is life: Scientific<br />
perspectives for the 21 st century. Proceedings<br />
of the World Rice Research Conference,<br />
Tokyo and Tsukuba, Japan, 4-7 November<br />
2004.<br />
CMIE. 2011. Agriculture. Centre for Monitoring Indian<br />
Economy (CMIE), Pvt. Ltd., Mumbai, June,<br />
Pp.183.<br />
Devi, M.G and Sumathi, V. 2011. Effect of nitrogen<br />
management on growth, yield and quality of<br />
scented rice under aerobic conditions. Journal<br />
of Research ANGRAU 39 (3): 81-83.<br />
Ghosh, A., Dey, R and Singh, O.N. 2012. Improved<br />
management alleviating impact of water stress<br />
on yield decline of tropical aerobic rice.<br />
Agronomy Journal 104 (3): 584-588.<br />
Latheef, P.M.D. 2010. Performance of aerobic rice<br />
under different levels of irrigation, nitrogen and<br />
weed management. M.Sc. Thesis, submitted<br />
to Acharya N G Ranga Agricultural University,<br />
Hyderabad.<br />
Mahajan, G., Chauhan, B.S., Timsina, J., Singh, P.P<br />
and Singh, K. 2012. Crop performance and<br />
water and nitrogen use efficiencies in dryseeded<br />
rice in response to irrigation and<br />
fertilizer amounts in northwest India. Field<br />
Crops Research 134: 59-70.<br />
Maheswari, J., Maragatham, N and Martin, G.J. 2007.<br />
Relatively simple irrigation scheduling and N<br />
application enhances the productivity of<br />
aerobic rice Oryza sativa L.: American Journal<br />
of Plant Physiology 2 (4): 261-268.<br />
Peng, N.L., Bing, S., Chen, M.X., Shah, F., Huang,<br />
J.L., Cui, K.H and Jing, X. 2012. Aerobic rice<br />
for water-saving agriculture-A review.<br />
Agronomy for Sustainable Development 32<br />
(2):411-418.<br />
Rani, K.S. 2012. Influence of nitrogen and weed<br />
management on growth and yield of aerobic<br />
rice Oryza sativa L., M.Sc. Thesis, submitted<br />
to Acharya N G Ranga Agricultural University,<br />
Hyderabad.<br />
Sridharan, N and Vijayalaxmi, C. 2012. Crop<br />
performance, nitrogen and water use in aerobic<br />
rice cultivation. Plant Archives 12 (1):79-83.<br />
148
Research Notes<br />
J.Res. ANGRAU 41(2) 149-152, 2013<br />
DRIP IRRIGATION SCHEDULE FOR CASTOR BASED ON PAN EVAPORATION<br />
B. RAVI KUMAR, V. PRAVEEN RAO, V. RAMULU AND K. AVIL KUMAR<br />
Water Technology Centre, Acharya N.G. Ranga Agricultural University,<br />
Rajendranagar, Hyderabad 500 030<br />
Date of Receipt : 16.03.2013 Date of Acceptance :10.06.2013<br />
Raising castor during winter (rabi) season<br />
under irrigation using high yielding varieties and<br />
hybrids is a new dimension in castor production in<br />
Andhra Pradesh for greater stability and higher<br />
productivity. However, shortage of water for irrigation<br />
is being increasingly felt due to pressures from<br />
depleting groundwater levels, rising alternative<br />
demands, water quality degradation and economics.<br />
Therefore, farmers are switching over to drip irrigation<br />
to improve irrigation application efficiency, water<br />
productivity and bean yields. Hence, an experiment<br />
was conducted to study the effect of drip irrigation<br />
schedules based on pan evaporation on castor<br />
performance.<br />
A field experiment was conducted at College<br />
Farm, College of Agriculture, Acharya N.G. Ranga<br />
Agricultural University, Hyderabad (17.19° N, 78.23°<br />
E and 543 m altitude) in winter season of 2009 – 10<br />
on a sandy clay soil. The soil was low in N, medium<br />
in P and high in K status and alkaline in reaction (pH<br />
8.03). The soil water retention capacity at “0.03 and<br />
“1.5 MPa was 0.254 cm 3 cm -3 and 0.130 cm 3 cm -3 ,<br />
respectively. The available water was 12.4 cm m -1<br />
depth of soil. Soil bulk density was 1.43 g cm -3 . The<br />
source of irrigation water was open well with C 3<br />
S 1<br />
water quality. There were seven irrigation treatments<br />
based on surface drip method of irrigation based on<br />
pan evaporation replenishment (Epan) factor. The<br />
Epan factor throughout the crop life were: I 1<br />
, 0.4;I 2<br />
,<br />
0.6 and I 3<br />
, 0.8. Their combinations at vegetative,<br />
flowering and capsule development stages were: I 4<br />
,<br />
0.4 up to flowering (81 days after sowing)and 0.6 later;<br />
I 5<br />
, 0.4 up to flowering (81 days after sowing) and 0.8<br />
later; I 6<br />
, 0.6 up to flowering (81 days after sowing)<br />
and 0.8 later; I 7<br />
, 0.4 up to 50 days after sowing, 0.6<br />
from 51 to 95 days after sowing and 0.8 later. Besides<br />
the above,a check treatment I 8<br />
, surface check basin<br />
method irrigated at 0.8 IW/CPE ratio with IW = 50<br />
mm was included. The eight irrigation treatments were<br />
laid out in randomized block design with three<br />
replications. The dripperlines of 16 mm diameter were<br />
laid out along the crop rows at 1.2 m spacing with<br />
emitters spaced at 0.5 m having a flow rate of 2 l<br />
hour -1 . Flow meters were used to measure flow rates<br />
to each individual treatment according to designated<br />
pan evaporation replenishment factor. Hybrid ‘PCH<br />
111’ was planted on the 7 th of November 2009 by<br />
adopting a row-to-row spacing of 1.2 m and plant to<br />
plant distance of 0.5 m in plots of 18.0 m x 7.2 m. A<br />
fertilizer dose of 60 kg N, 40 kg P 2<br />
O 5<br />
and 30 kg K 2<br />
O<br />
ha was applied through fertigation at weekly intervals<br />
up to 100 days after sowing. The crop was harvested<br />
in 4-pickings and the last picking was on the 5 th of<br />
April, 2010. The total depth of irrigation water applied<br />
in drip irrigated treatments varied between 227 mm<br />
(0.4 Epan) to 453 mm (0.8 Epan), whereas in surface<br />
check basin irrigated crop it was 450 mm.<br />
For determination of crop ETc, the soil<br />
moisture was monitored by delta probe at four<br />
locations and various depths before and after every<br />
irrigation event and on intermediate dates in case of<br />
incident precipitation. Effective rainfall was estimated<br />
by following standard procedure (Rahmanet al., 2008)<br />
and it amounted to 13.05 mm during crop growing<br />
period. The reference crop evapotranspiration (ETo)<br />
was estimated at specific crop growth sub-periods<br />
based on Penman Monteith equation (Allen et al.,<br />
1998). Thus the data obtained on ETc of castor and<br />
ETo at specific crop growth sub-periods were used<br />
to calculate the ETc :ETo ratios.<br />
Average castor bean yield was highest (4281<br />
kg ha -1 ) when irrigations were scheduled by drip daily<br />
at 0.6Epan up to flowering and 0.8Epan later on (I 6<br />
)<br />
with a seasonal water requirement of 399.9 mm, but<br />
it was statistically on par with I 3<br />
(daily drip irrigation<br />
at 0.8Epan throughout the crop life with a seasonal<br />
ETc of 428.1 mm) and I 2<br />
(daily drip irrigation at<br />
0.6Epan throughout the crop life with a seasonal ETc<br />
of 334.5 mm) and significantly superior over I 1<br />
, I 4<br />
, I 5<br />
,<br />
email: v.prao@yahoo.com<br />
149
KUMAR et al<br />
I 7<br />
and I 8<br />
irrigation treatments (Table 1).However, the<br />
crop in I 2<br />
used 93.6 mm and 65.4 mm less water in<br />
comparison to I 3<br />
and I 6<br />
,respectively.Further the crop<br />
in I 2<br />
treatment on an average registered 104.6%,<br />
33.5%, 37.1%, 30.7% and 49.2% more yield over I 1<br />
,<br />
I 4<br />
, I 5<br />
, I 7<br />
and I 8<br />
, respectively. Among all the treatments<br />
lowest castor bean yield was observed in I 1<br />
(daily<br />
drip irrigation at 0.4Epan throughout the crop lifewith<br />
a seasonal ETcof 239.3 mm) treatment. Bean yield<br />
under surface check basin irrigation at 0.8 IW/CPE<br />
ratio throughout the crop life (I 8<br />
) with a seasonal water<br />
requirement of 445.9 mm produced significantly lower<br />
bean yield in comparison to drip irrigation treatments<br />
(I 2<br />
to I 7<br />
) except I 1<br />
. These trends were traced to<br />
favourable soil water balance as evident from crop<br />
evapotranspiration (ETc) : reference crop<br />
evapotranspiration (ETo) ratio (> 1.0 at flowering and<br />
capsule development stage) an indicator of soil water<br />
deficit (Nair et al., 2013) under drip irrigated I 2<br />
,I 3<br />
and<br />
I 6<br />
irrigation treatments. Further the regression of bean<br />
yield on seasonal ET c<br />
revealed a significant<br />
correlation with an explained total variation of 99%<br />
in bean yield as evident from the following equation.<br />
Y = – 9535 + 68.603ETc – 0.0895<br />
ETc 2 (R 2 = 0.99 F-value = 35.7 * )<br />
This favourable soil water balance under I 6<br />
,<br />
I 3<br />
and I 2<br />
treatments aided the crop plants to put forth<br />
improved performance over other treatments, since<br />
water plays a vital role in the carbohydrate<br />
metabolism, protein synthesis, cell wall synthesis<br />
and cell enlargement (Chaveset al., 2002). Therefore,<br />
crop plants in I 6<br />
, I 3<br />
and I 2<br />
treatments had more plant<br />
height, which in turn helped the plants to put forth<br />
more canopy i.e., LAI (Table 1) and dry matter. It is<br />
well documented that cell enlargement is very<br />
sensitive to water deficits and the consequence is a<br />
marked reduction in leaf area (Pettigrew, 2004).<br />
Sudhakar and Rao (1996) opined that the LAI was<br />
the growth characteristic which limited the rate of<br />
dry matter accumulation of castor under soil water<br />
deficits. This improved growth performance in the<br />
form of plant height, LAI and dry matter by the crop<br />
in I 6<br />
, I 3<br />
and I 2<br />
treatments in turn may have contributed<br />
more number of spikes plant -1 with longer spike<br />
length, more number of capsules plant -1 , seeds<br />
capsule -1 and test weight (Table 1). The dependence<br />
of bean yield on growth and yield components was<br />
apparent from the positive and significant (P=0.01)<br />
correlation it had with plant height (r = 0.95), LAI (r =<br />
0.69), dry matter (r= 0.82), spikes plant -1 (r= 0.94),<br />
spike length (r= 0.64), capsules plant -1 (r = 0.90),<br />
seeds capsule -1 (r= 0.84) and test weight (r= 0.91).<br />
The cumulative effect of all these increased growth<br />
and yield traits was well marked on bean yield of drip<br />
irrigated crop in I 2<br />
, I 3<br />
and I 6<br />
treatments.<br />
On the other hand, irrigations at lower<br />
evaporation replenishment factor in I 1<br />
, I 4<br />
, I 5<br />
and I 7<br />
drip irrigated treatments during individual growth subperiods<br />
of vegetative, flowering and capsule<br />
development induced soil water deficits in the crop<br />
root zone. This caused ET c<br />
to fall below in I 1<br />
, I 4<br />
, I 5<br />
and I 7<br />
drip irrigated treatments relative to ET c<br />
under<br />
I 2<br />
, I 3<br />
and I 6<br />
treatments. This unfavourable soil<br />
moisture environment not only reduced the plant<br />
height, LAI, and dry matter but also brought<br />
significant reduction in yield contributing characters<br />
like number of spikes plant -1 , spike length, capsules<br />
plant -1 and test weight (Table 1).The greater sensitivity<br />
of flowering and capsule development period to ET c<br />
deficits in I 1<br />
, I 4<br />
, I 5<br />
and I 7<br />
treatments could be partly<br />
related to the fact that crop reached its peak ET c<br />
requirement (3.97mm day -1 ) during this period.<br />
Additionally, this is the period in which the potential<br />
spike size and capsule number is determined. Thus,<br />
water deficits at flowering period might have caused<br />
abortion of flowers as is evident from the number of<br />
spikes, spike length and capsules plant -1 in I 1<br />
, I 4<br />
, I 5<br />
and I 7<br />
treatments, which limited the total number of<br />
seeds per plant and possibly non-availability of<br />
assimilates to capsules might have reduced the bean<br />
weight(Sudhakar and Rao,1996). All these effects<br />
finally reduced the bean yield in I 1<br />
, I 4<br />
, I 5<br />
and I 7<br />
treatments and the effect of water deficits is well<br />
marked (Table 1).<br />
Whereas, under conventional check basin<br />
irrigation method (I 8<br />
treatment) due to longer irrigation<br />
interval (8 – 12 days)the fluctuations in soil matric<br />
potentials are relatively large as compared to high<br />
frequency (1 – 2 days interval) drip irrigation (Rao,<br />
2011) and this might have affected the crop growth<br />
and yield contributing characters resulting in reduced<br />
crop yields.<br />
Thus, it could be concluded that for higher<br />
bean yield of castor crop grown during winter season<br />
daily drip irrigationat 0.6Epan throughout the crop life<br />
with a seasonal ETcof 334.5 mm is recommended.<br />
150
DRIP IRRIGATION SCHEDULE FOR CASTOR BASED ON PAN EVAPORATION<br />
Table 1. Growth, yield attributes and bean yield of castor as influenced by different irrigation treatments<br />
151
KUMAR et al<br />
REFERENCES<br />
Allen, R.G., Pereira, L.S., Raes, D and Smith, M.<br />
1998. Crop evapotranspiration–Guidelines for<br />
computing crop water requirements. Irrigation<br />
and Drainage Paper No. 56, FAO, Rome, 300p.<br />
Chaves, M.M., Pereira, J.S., Maroco, J., Rodriguez,<br />
M.L., Ricardo, C.P.P., Osorio, M.L., Carvalho,<br />
I., Faria, T and Pinheiro, C. 2002. How plants<br />
cope with water stress in the field.<br />
Photosynthesis and growth. Annals of Botany<br />
89: 907-916.<br />
Nair, S., Johnson, J and Wang, C. 2013. Efficiency<br />
of Irrigation Water Use: A Review from the<br />
Perspectives of Multiple Disciplines.<br />
Agronomy Journal 105 : 351 – 363<br />
Pettigrew, W.T. 2004. Physiological consequences<br />
of moisture deficit stress in cotton. Crop Sci.<br />
44:1265-1272.<br />
Rahman, M.M., Islam, M.O and Hasanuzzaman,<br />
M. 2008. Study of Effective Rainfall for<br />
Irrigated Agriculture in South-Eastern Part of<br />
Bangladesh.World Journal of Agricultural<br />
Sciences 4: 453-457<br />
Rao, V.P. 2011. Drip irrigation of castor pays.<br />
AgroNet News Letter 55.NetafimYiftah, Israel.<br />
Sudhakar, C and Rao, V. P. 1996 Performance of<br />
different crops during post rainy season under<br />
varied moisture regimes in Southern Telangana<br />
region. Journal of Research ANGRAU 22: 113<br />
– 115.<br />
152
Research Notes<br />
J.Res. ANGRAU 41(2) 153-157, 2013<br />
CHARACTER ASSOCIATION AND PATH COEFFICIENT ANALYSIS FOR SEED<br />
YIELD IN QUALITY PROTEIN MAIZE Zea mays L.<br />
K. VIJAY KUMAR, M. R. SUDARSHAN, KULDEEP SINGH DANGI and S. MADHUSUDAN REDDY<br />
Department of Genetics and Plant breeding, College of Agriculture,<br />
Acharya N.G. Ranga Agricultural University, Rajendranagar, Hyderabad-500030<br />
Date of Receipt : 21.02.2013 Date of Acceptance : 25.07.2013<br />
Maize Zea mays L. is an important cereal<br />
crop, next to wheat and rice and it is staple food in<br />
many developing countries (Morries et al 1999).<br />
Maize crop is of great significance due to its demand<br />
for food, feed and industrial utilization. It plays an<br />
important role in world economy and trade. Since<br />
maize protein lacks two essential amino acids lysine<br />
and tryptophan and protein deficiency is characterized<br />
by many growth and health related complications in<br />
humans. Therefore, considerable importance has<br />
been given to Quality Protein Maize (QPM) breeding.<br />
The material for the present study comprised<br />
of sixty three quality protein maize genotypes<br />
(numbered BQML-101 to BQML-163) that were<br />
obtained from Maize Research Centre, Agricultural<br />
Research Institute, Rajendranagar, Hyderabad. The<br />
experiment was carried out at College Farm, College<br />
of Agriculture, ANGRAU, Rajendranagar, Hyderabad<br />
during rabi 2008-09 in a randomized block design with<br />
three replications. Each genotype in each replication<br />
consisted of a single row of fifteen plants with a<br />
spacing of 75cm X 20 cm. Five representative plants<br />
were selected at random from each line and<br />
observations were recorded on each plant for sixteen<br />
traits viz., days to 50 per cent tasseling, days to 50<br />
per cent silking, plant height, ear height, days to<br />
maturity, ear length, ear girth, number of kernel rows<br />
per ear, number of kernel per row, 100-seed weight<br />
(g), ear weight (g), shelling (%), protein content (%),<br />
oil content (%), starch content (%) and grain yield<br />
per plant (g). The correlation coefficients were<br />
calculated as per the method suggested by Johnson<br />
et al. (1955). Path analysis was worked out as per<br />
method suggested by Deway and Lu (1959).<br />
The Correlation coefficients between yield,<br />
its component characters and quality parameters are<br />
presented in Table 1. In this study the values of<br />
correlation coefficients indicated that in general, the<br />
magnitude of genotypic correlation coefficients were<br />
higher than phenotypic correlation coefficients for all<br />
the traits which implied negligible influence of<br />
environmental factors and strong inherent association<br />
between the traits. Grain yield was significantly and<br />
positively correlated with ear weight, number of<br />
kernels per row, ear girth, shelling per cent, 100 seed<br />
weight, number of kernel rows per ear, ear length<br />
and oil content, while days to 50 per cent tasseling,<br />
days to 50 per cent silking, and days to maturity had<br />
negative association with grain yield. The remaining<br />
characters, plant height, ear height, protein content<br />
and starch content did not indicate any association<br />
with seed yield. This indicated that seed yield can<br />
be improved by making selection on the basis of ear<br />
weight, number of kernels per row, ear girth, shelling<br />
per cent, 100 seed weight, number of kernel rows<br />
per ear, ear length and oil content. The traits ear<br />
weight, number of kernels per row, ear girth, shelling<br />
per cent, number of kernel rows per ear and 100 seed<br />
weight which had strong positive correlation with seed<br />
yield could be exploited in breeding programmes.<br />
Similar results were reported by Jayakumar et al<br />
(2007), Hemavathy et al (2008) and Shinde et al<br />
(2009).<br />
Path coefficient analysis that partitions the<br />
correlation coefficient into direct and indirect effects<br />
was worked out and is presented in Table 2. Among<br />
the characters studied, days to 50% silking, ear<br />
height, oil content and starch content had negative<br />
direct effect on grain yield and the remaining<br />
characters had positive direct effect. The character,<br />
ear weight had the highest direct effect on seed yield<br />
and it was followed by days to 50% silking and<br />
shelling per cent. The traits, ear weight and shelling<br />
per cent with high direct effect also had positive<br />
correlation with seed yield while days to 50% tasseling<br />
had significant negative correlation with seed yield.<br />
Days to 50 per cent tasseling had negative indirect<br />
effects through days to 50 per cent silking, ear height,<br />
email: vijay.kk410@gmail.com<br />
153
VIJAY et al<br />
ear length, ear girth, number of kernels per row, ear<br />
weight and shelling per cent. This trait had positive<br />
indirect effects through plant height, days to maturity,<br />
protein content and oil content. Days to 50 per cent<br />
silking showed negative direct effects on grain yield.<br />
This trait had negative indirect effect through ear<br />
height, ear length, ear girth, number of kernels per<br />
row, ear weight, and shelling per cent. This trait had<br />
positive indirect effects through plant height, days<br />
to maturity, protein content and oil content. Starch<br />
content had positive indirect effect.<br />
Plant height had positive direct effects on<br />
grain yield and negative indirect effects on grain yield<br />
through ear height, ear length, number of kernels per<br />
row and ear weight. This trait had positive indirect<br />
effects through days to maturity, ear girth, 100 seed<br />
weight, shelling per cent, protein content and oil<br />
content. Ear height had positive indirect effects<br />
through days to 50 per cent tasseling, plant height,<br />
days to maturity, ear girth, 100 seed weight, shelling<br />
per cent, protein content and oil content. Days to<br />
maturity showed positive direct effect on grain yield.<br />
This trait had negative indirect effects on grain yield<br />
through days to 50 % silking, ear height, ear length,<br />
number of kernels per row, ear weight, 100 seed<br />
weight, and shelling per cent whereas, oil content.<br />
This trait had positive indirect effects through days<br />
to 50 per cent tasseling, plant height, ear girth,<br />
number of kernel rows per ear and protein content.<br />
Ear length had positive direct effects on grain<br />
yield and had positive indirect effects through days<br />
to 50 per cent silking, ear height, ear girth, number<br />
of kernel rows per ear, number of kernels per row,<br />
ear weight, 100 seed weight and shelling per cent.<br />
Starch content had negative indirect effect. Ear girth<br />
had positive direct effect on grain yield. This trait<br />
had positive indirect effects through days to 50 per<br />
cent silking, plant height, days to maturity, ear length,<br />
number of kernel rows per ear, number of kernels per<br />
row, ear weight, 100 seed weight and shelling per<br />
cent.<br />
Number of kernel rows per ear had positive<br />
direct effect on grain yield. This trait had negative<br />
indirect effects on grain yield through days to 50%<br />
tasseling, plant height, protein content and oil content<br />
and had positive correlation with days to 50 per cent<br />
silking, ear height, days to maturity, ear length, ear<br />
girth, number of kernels per row, ear weight, 100 seed<br />
weight, and shelling per cent. Number of kernels per<br />
row had positive direct effects on grain yield and<br />
showed negative indirect effects on grain yield<br />
through days to 50 per cent tasseling, plant height,<br />
days to maturity, protein content and oil content. This<br />
trait showed positive indirect effects on grain yield<br />
through days to 50 per cent silking, ear height, ear<br />
length, ear girth, number of kernel rows per ear, ear<br />
weight, 100 seed weight, and shelling per cent.<br />
Ear weight had positive direct effect on grain<br />
yield. 100 seed weight had positive direct effect on<br />
grain yield. Positive direct effect was shown by<br />
shelling per cent on grain yield. This trait had negative<br />
indirect effects on grain yield through days to 50 per<br />
cent tasseling, ear height, days to maturity and oil<br />
content and had positive indirect effect through<br />
remaining characters viz., days to 50 per cent silking,<br />
plant height, ear length, ear girth, number of rows<br />
per ear, number of seeds per row, ear weight, 100<br />
seed weight, protein content and starch content.<br />
Positive direct effect on grain yield was shown by<br />
protein content. This trait had negative indirect effect<br />
on grain yield at phenotypic level through number of<br />
kernel rows per ear and starch content.<br />
Oil content had negative direct effect on grain<br />
yield. This trait had positive indirect effect through<br />
days to 50 per cent silking, ear height, days to<br />
maturity, ear length, ear girth, number of kernel rows<br />
per ear, number of kernels per row, ear weight and<br />
shelling per cent. Negative indirect effects on grain<br />
yield was exhibited by days to 50 per cent tasseling,<br />
plant height, days to maturity, 100 seed weight,<br />
shelling per cent and protein content and had positive<br />
indirect effect through days to 50 per cent silking,<br />
ear height, ear length, ear girth, number of kernels<br />
per row, ear weight and oil content. Similar results<br />
were reported by Kumar et al. (2006), Jay kumar et<br />
al. (2007), Brar et al. (2008) and Saidaiah et al. (2008).<br />
Among the characters studied, ear length,<br />
ear girth, number of kernel rows per ear, number of<br />
kernels per row, ear weight, 100 seed weight, shelling<br />
per cent and oil per cent had positive and significant<br />
correlation coefficient with grain yield and had positive<br />
direct relationship with ear weight and shelling per<br />
cent. Hence, it might be regarded as these characters<br />
contributed maximum to the seed yield. Thus,<br />
selection based on these characters would result in<br />
improvement in seed yield .<br />
154
CHARACTER ASSOCIATION AND PATH COEFFICIENT ANALYSIS FOR SEED<br />
Table 1. Correlation coefficients among yield and yield attributes in sixty-three genotypes of Quality Protein Maize (Zea mays L.)<br />
* Significant at 5 per cent level, ** Significant at 1 per cent level.<br />
155
VIJAY et al<br />
Table2. Path coefficient analysis indicating direct and indirect effects of components characters on grain yield in sixty-three genotypes of Quality<br />
Protein Maize (Zea mays L.)<br />
Phenotypic residual effect =0.1438 Genotypic residual effect = 0.1057; Bold figures are direct effects<br />
156
CHARACTER ASSOCIATION AND PATH COEFFICIENT ANALYSIS FOR SEED<br />
REFERENCES<br />
Brar, S. P. S., Chawla, J. S.and Pritpal Singh, 2008.<br />
Studies on different selection indices and Path<br />
analysis in Maize Zea mays L. Crop<br />
Improvement 35: 16-19.<br />
Dewey, D. R and Lu, K. H. 1959. A correlation and<br />
path coefficient analysis of components of<br />
crested wheat grass seed production.<br />
Agronomy Journal 51: 515-518.<br />
Hemavathy, A. T., Balaji, K., Ibrahim, S. M., Anand,<br />
G and Deepa Sankar 2008. Genetic<br />
variability and correlation studies in Maize<br />
Zea mays L. Agricultural Science Digest 28:<br />
112-114.<br />
Jayakumar, J., Sundaram, T., Raguramarajan, A.,<br />
and Kannan, S. 2007. Studies on path<br />
analysis in Maize Zea mays L. for grain yield<br />
and other yield attributes. Plant Archives 7:<br />
279-282.<br />
Jayakumar, J., Sundaram, T., Prabu, D. A and Rajan,<br />
A. R. R. 2007. Correlation studies in Maize<br />
Zea mays L. evaluated for grain yield and other<br />
yield attributes. International Journal of<br />
Agricultural Sciences 3: 57-60<br />
Johnson, H. W., Robison, H. F and Comstock, R. E.<br />
1955. Estimates of genetic and<br />
environmental variability in Soybean. Agron.<br />
J. 47: 314-18<br />
Kumar, S., Shahi, J. P., Singh, J and Singh, S. P,<br />
2006. Correlation and path analyis in early<br />
generation inbreds of Maize (Zea mays L.).<br />
Crop Improvement 33: 156-160.<br />
Morries, M. L., Risopous, J and Beck, D. 1999.<br />
Genetic changes in future recycled Maize<br />
seed. A review of the evidence CIMMYT econ.<br />
Working paper no.99-07 Mexico D.E. CIMMYT<br />
P.1.<br />
Saidaiah, P., Satyanarayana, E and Sudheer Kumar,<br />
S. 2008. Association and path coefficient<br />
analysis in Maize Zea mays L. Agricultural<br />
Science Digest 28: 2<br />
Shinde, S. A., Shelki, D. K and Sawargaonkar, G. L.<br />
2009. Intercharacter associations and path<br />
analysis of yield components in rabi Maize.<br />
International Journal of Plant Sciences 4: 49-<br />
51.<br />
157
THE JOURNAL OF RESEARCH ANGRAU<br />
DECLARATION CERTIFICATE TO BE SUBMITTED BY THE AUTHOR(S)<br />
Certified that the article entitled ___________________________________________________________<br />
____________________________________________________________________________________<br />
1. is based on my / our original research work / M.Sc / Ph.D thesis (strike off whichever is not applicable)<br />
2. The article has been seen by all the authors and the order of authorship is agreed.<br />
3. The results presented have not been published or submitted for publication else where in part or full<br />
under the same or other title<br />
4. The names of the authors are those who made a notable contribution.<br />
5. No authorship is given to anyone who did not make a notable contribution.<br />
S.No. Name/s Present address Permanent address Signature<br />
1.<br />
2.<br />
3.<br />
CERTIFICATE BY THE COMPETENT AUTHORITY<br />
( Professor & Head of the Department/ Principal Scientist of the station/ Associate Director of Research).<br />
Certified that the article —————————————————————————————————<br />
——————————————————————————————————————————————<br />
authored by ——————————————————————————————————————————<br />
——————————————————————— is fit for publication. It fulfills all the requirements for<br />
publication in the Journal of Research ANGRAU.<br />
Name :<br />
Signature :<br />
Office seal :<br />
Note:<br />
In case it is not possible to obtain the signature of a particular author for reasons beyond his/her<br />
reach, the reasons thereof should be explained.
Statement about ownership and other particulars about<br />
THE JOURNAL OF RESEARCH ANGRAU<br />
Form IV (See Rule 8)<br />
1. Place of Publication : The Acharya N.G. Ranga Agricultural University,<br />
Rajendranagar, Hyderabad - 500 030<br />
2. Periodicity of Publication : Quarterly<br />
3. Printer’s Name : Dr. P. Chandrasekhar Rao<br />
Nationality : Indian<br />
Address : Professor & University Head , Department of SSAC and<br />
Editor of Journal of Research, ANGRAU<br />
Acharya N.G. Ranga Agricultural University<br />
Rajendranagar, Hyderabad.<br />
4. Publisher’s Name : Dr. P. Chandrasekhar Rao<br />
Nationality : Indian<br />
Address : Professor & University Head , Department of SSAC and<br />
Editor of Journal of Research, ANGRAU<br />
Acharya N.G. Ranga Agricultural University<br />
Rajendranagar, Hyderabad.<br />
5. Editor’s Name : Dr. P. Chandrasekhar Rao<br />
Nationality : Indian<br />
Address : Professor & University Head , Department of SSAC and<br />
Editor of Journal of Research, ANGRAU<br />
Acharya N.G. Ranga Agricultural University<br />
Rajendranagar, Hyderabad.<br />
6. Name and address of the : The Acharya N.G. Ranga Agricultural University,<br />
individuals who own the Rajendranagar, Hyderabad - 500 030 (A.P.)<br />
newspaper & partners or<br />
share holders holding more<br />
than one per cent of the<br />
total capital<br />
I, P. Chandrasekhar Rao hereby declare that the particulars given above are true to the<br />
best of my knowledge and belief.<br />
Dated :<br />
Signature of Publisher
SUBSCRIPTION ENROLLING FORM<br />
I/we, herewith enclose D.D. No...................................................................................<br />
dated..................................for Rs. ............................... drawn in favour of Managing Editor, Journal of<br />
Research ANGRAU, Agricultural Information & Communication Centre, ARI Campus, Acharya N.G. Ranga<br />
Agricultural University, Rajendranagar, Hyderabad - 500 030 as individual annual/individual life/Institutional<br />
annual Membership for Journal of Research ANGRAU for the calendar year (January - December) ..................<br />
S.No. Name of the Address for Name of the article Signature<br />
authors Correspondence contributed<br />
1.<br />
2.<br />
3.<br />
4.<br />
Note :<br />
The receipt of payment will be sent only if a self addressed and stamped envelope is enclosed<br />
along with your DD.
GUIDELINES FOR THE PREPARATION OF MANUSCRIPT<br />
1. Title of the article should be short, specific, phrased to identify the content and indicate the nature of<br />
study.<br />
2. Names should be in capitals prefixed with initials and separated by commas. For more than two authors<br />
the names should be followed by ‘and’ in small letters before the end of last name. Full address of the<br />
place of research in small letters should be typed below the names. Present address and E-mail ID of<br />
the author may be given as foot note.<br />
3. The full length paper should have the titles ABSTRACT, MATERIALS AND METHODS, RESULTS<br />
AND DISCUSSION, REFERENCES-all typed in capitals and bold font - 12. The research note will<br />
have only one title REFERENCES.<br />
4. ABSTRACT: The content should include the year, purpose, methodology and salient findings of the<br />
experiment in brief not exceeding 200 words. It should be so framed that the reader need not refer to<br />
the article except for details.<br />
5. INTRODUCTION : Should be without title and indicate the reasons which prompted the research,<br />
objectives and the likely implication. The review of recent literature should be pertinent to the problem.<br />
The content must be brief and precise.<br />
6. MATERIALS AND METHODS : Should include very clearly the experimental techniques and the<br />
statistical methods adopted. Citation of standard work is sufficient for the well known methods.<br />
7. RESULTS AND DISCUSSION : Great care should be taken to highlight the important findings with<br />
support of the data well distinguished by statistical measures like CD, r, Z test etc. Too descriptive<br />
explanation for the whole data is not desirable. The treatments should be briefly expressed instead of<br />
abbreviations like T 1<br />
, T 2<br />
etc. The discussion should be crisp and relate to the limitations or advantages<br />
of the findings in comparison with the work of others.<br />
8. REFERENCES : Literature cited should be latest. References dating back to more than 10 years are<br />
not desirable. Names of authors, their spelling and year of publication should coincide both in<br />
the text and references. The following examples should be followed while listing the references from<br />
different sources.<br />
Journals and Bulletins<br />
Abdul Salam, M and Mazrooe, S.A. 2007. Water requirement of maize (Zea mays L.) as influenced by<br />
planting dates in Kuwait. Journal of Agrometeorology. 9 (1) : 34-41<br />
Hu, J., Yue, B and Vick, B.A. 2007. Integration of trap makers onto a sunflower SSR marker linkage map<br />
constructed from 92 recombinant inbred lines. Helia. 30 (46) :25-36.<br />
Books<br />
AOAC. 1990. Official methods of analysis. Association of official analytical chemists. 15 th Ed. Washington<br />
DC. USA. pp. 256<br />
Federer, W.T. 1993. Statistical design and analysis for intercropping experiments. Volume I: two crops.<br />
Springer – Verlag, Cornell University, Ithaca, New York, USA. pp. 298-305<br />
Thesis<br />
Ibrahim, F. 2007. Genetic variability for resistance to sorghum aphid (Melanaphis sacchari, Zentner) in<br />
sorghum. Ph.D. Thesis submitted to Acharya N.G. Ranga Agricultural University, Hyderabad.
Seminars / Symposia / Workshops<br />
Naveen Kumar, P.G and Shaik Mohammad 2007. Farming Systems approach – A way towards organic<br />
farming. Paper presented at the National symposium on integrated farming systems and its role<br />
towards livelihood improvement. Jaipur, 26 – 28 October 2007. pp.43-46<br />
Proceedings of Seminars / Symposia<br />
Bind, M and Howden, M. 2004. Challenges and opportunities for cropping systems in a changing climate.<br />
Proceedings of International crop science congress. Brisbane –Australia. 26 September – 1 October<br />
2004. pp. 52-54<br />
(www.cropscience 2004.com 03-11-2004)<br />
Tables and Graphs : The data in tables should not be duplicated in graphs and vice versa. Mean data for<br />
main treatment effects should be presented with appropriate SE± and CD values wherever necessary.<br />
The 2 or 3 way tables should be furnished only if the results are consistent over years and are<br />
distinguished to have consideration of significant practical value. SE± and CD values however,<br />
should be furnished in the tables for all interactions and should be explained in the results and<br />
discussion. The treatments should be mentioned atleast in short forms if they are lengthy, but not<br />
abbreviated as T 1<br />
, T 2<br />
and T 3<br />
etc. The weights and measures should be given in the metric system<br />
following the latest units eg. kg ha -1 , kg ha –1 cm, mg g -1 , ds m -1 , g m -3 , C mol kg -1 etc.<br />
Typing :<br />
Note :<br />
The article should be typed in 12 pt font on A 4<br />
size paper leaving a margin of 2 cm on all sides.<br />
There should be a single line space between the rows in abstract and double line in rest. Verify<br />
the manuscript thoroughly for errors before submitting it for publication.<br />
Latest issue of the Journal may be consulted. Further details can be obtained from the book<br />
“Editors style Manual, edn 4. American Institute of Biological Sciences, Washington DC”.<br />
URL : http://www.angrau.ac.in/Publications.aspx<br />
ESSENTIAL REQUIREMENTS FOR CONSIDERATION OF PUBLICATION OF ARTICLES<br />
1. Research of not less than 2 years and of high standard will be considered as full length paper.<br />
If necessary, it will be considered for short communication.<br />
2. MSc. Research of one year should be submitted in the style and format of short communication.<br />
3. The total number of pages should not exceed 10 for full paper and 5 pages for short communication<br />
including tables and figures. The figures should be legible.<br />
4. Previous research of 5 years old before the date of submission will not be considered.<br />
5. All the authors should subscribe for the Journal<br />
6. The manuscript should be submitted in duplicate as per the guidelines of the Journal to Managing<br />
Editor, The Journal of Research ANGRAU, AICC & ANGRAU Press, ARI Campus, Rajendranagar,<br />
Hyderabad – 500 030.<br />
7. The manuscript should accompany the declaration certificate and subscription enrolment form.<br />
8. The authors should accept the editorial / referees comments until the quality of the paper is improved.<br />
9. The revised manuscript should be submitted in duplicate along with a compact disk.<br />
REVIEW PROCESS<br />
The articles will be initially screened by the editors. It will be sent to an expert for peer review only if<br />
it contains adequate original information and is prepared as per the guidelines. The author, then, may also be<br />
asked to revise it if the expert desires. After getting the article suitably revised and edited, it will be placed<br />
before the editor for a final decision. The accepted article will be finally checked for language and grammar by<br />
the English editor before being sent to the press. The decision however to publish the paper lies with the<br />
editor. Any article which is not able to meet the expected standard or is not prepared in conformity with<br />
guidelines will be rejected without assigning any reason.
ESSENTIAL REQUIREMENTS<br />
FOR CONSIDERATION OF PUBLICATION OF ARTICLES<br />
1. Research of not less than 2 years and of high standard will be considered as full length paper. If<br />
necessary, it will be considered for short communication.<br />
2. M.Sc. Research of one year should be submitted in the style and format of short communication.<br />
3. The total number of pages should not exceed 10 for full paper and 5 pages for short communication<br />
including tables and figures. The figures should be legible.<br />
4. Previous research of 5 years before the date of submission will not be considered.<br />
5. All the authors should subscribe for the Journal<br />
6. The manuscript should be submitted in duplicate as per the guidelines of the Journal to Managing<br />
Editor, the Journal of Research of Research ANGRAU, AI&CC and ANGRAU Press, ARI Campus,<br />
Rajendranagar, Hyderabad.<br />
7. The manuscript should accompany the declaration certificate and subscription enrolment form.<br />
8. The authors should accept the editorial / references comments until the quality of the article is improved.<br />
9. The revised manuscript should be submitted in duplicate along with a compact disk.<br />
10. DD may be drawn in favour of “Managing Editor, Journal of Research, ANGRAU” Payable at Hyderabad.<br />
SUBSCRIPTION TARIFF<br />
ANNUAL<br />
Individual : Rs. 300/- author<br />
Institution : Rs. 1200/-<br />
LIFE<br />
Individual (till retirement) : Rs. 1200/-<br />
Reprints Charges : Rs. 100/- per page<br />
1. Publications : Managing Editor - Journal of Research ANGRAU, AI&CC and ANGRAU Press,<br />
ARI Campus, Rajendranagar, Hyderabad.<br />
2. Publications : The DD should be mailed to the Managing Editor - Journal of Research, ANGRAU<br />
- Press Agricultural Research Institute, Rajendranagar, Hyderabad - 500 030.<br />
least in short forms if they are lengthy, but not abbreviated as T 1<br />
, T 2<br />
and T 3<br />
etc. The weights and<br />
measures should be given in the metric system following the latest units eg. kg ha -1, kg ha -1 cm, mg<br />
g -1 , ds m -1 , g m -3 , C mol kg -1 etc.<br />
Typing : The article should be typed in 12pt font on A 4<br />
size paper leaving a margin of 2 cm on all sides.<br />
There should be a single line space between the rows in abstract and double line in rest.<br />
Note : Latest issue of the Journal may be consulted. Further details can be obtained from the book<br />
“Editors style Manual, edn 4. American Institute of Biological Sciences, Washington DC”.<br />
URL : http://www.angrau.ac.in/Publications.aspx