Tour-de-Force

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Appendix DCell cycle synchronizationCell cycle synchronization is obtained via a double thymidine block, as the cell lines are not suited forcentral elutriation and will not suffer from disadvantages as inhibition of cell growth and apoptosis whenusing serum deprivation. Nocodazole is used to synchronize cells in M-phase, in order to have cellsynchronized for a full cell cycle.Reverse-transcription real-time PCRRT-PCR has the unique quality that is able to detect and quantify even minimal amounts of RNA. As weare looking at fluctuating levels of different compounds throughout the cell cycle (and the mRNA levels ofthese compounds could become very low in certain phases) it would be wisest for us to use this techniqueas it will provide the most accurate quantification.It is recommendable to use a two-step RT-PCR instead of a one-step RT-PCR. Normally a RT-PCR isdone in two steps: the reverse transcription and the actual PCR. However, it is also possible to do thesetwo steps simultaneously. A two-step RT-PCR provides more sensitivity and a longer conservation ofreagents. For all PCR experiments BrdU pulse labelling is used to indicate in which phase in the cell cycleit is. Facilities from the University Utrecht laboratories will be used for visualization.Mitochondrial DNA to nuclear DNA ratioQuantitative real-time PCR will be used to measure the mitochondrial DNA to nuclear DNA ratio. Thefollowing primer sequences will be used for the mitochondrial fragment: forward primer MitHu3130F,AGGACAAGAGAAATAAGGCC, reverse primer MitHu3301RAAGAAGAGGAATTGAACCTCTGACTGTAA. For the nuclear fragment, forward primer APP137FTTTTTGTGTGCTCTCCCAGGTCT and reverse primer APP210R TGGTCACTGGTTGGTTGGC will beused. These probes will be labelled with TAMRA at the 3’ end and FAM at the 5’ end. Probe oligosequences will be mit3153T, TTCACAAAGCGCCTTCCCCCGTAAATG for the mitochondrial fragmentand APP161T, CCCTGAACTGCAGATCACCAATGTGGTAG for the nuclear fragment. TaqManfluorogenic probes will be used to enable detection of the aforementioned PCR products that accumulateduring the PCR cycles (Ashley et al., 2005).PPAR family (PRC, PGC-1α and PGC-1β) mRNA levels1 µg of total RNA will be then treated with DNase I (Applied Biosystems) before being treated with M-MLVReverse Transcriptase (Applied Biosystems). The synthesized cDNAs will be amplified using specificprimers: PRC sense primer, 5′-GCAACAGCC GTTCTGT-3′; PRC antisense primer, 5′-CTGCAAATGCCTCCTC-3′, PGC-1α (sense, 5’-TCAGTCCTCACTGGTGGACA-3’; antisense, 5’-TGCTTCGTCGTCAAAAACAG-3’). TaqMan (5'-FAM;3'-TAMRA) probes will be used.Cyclin D1, D2, D3, E1, E2 cdk2, cdk3, cdk4, cdk6, NRF-1, mRNA levelsWe will be using SYBR Green, a commonly used probe for detecting the desired PCR product. It is themost convenient method to use when examining a large number of mRNA targets, as no specific probedesign (as with Taqman or Molecular Beacons) for every single mRNA target has to be done.We propose to buy a RT 2 First Strand Kit (Superarray Bioscience). This kit contains almost all theessential components to do a RT-PCR, both for the reverse transcription and the actual PCR. It also hascomponents that ensure the removal of genomic DNA from the PCR. As discussed before, we decided touse SYBR Green for fluorescent detection; this component has to be bought separately (SuperarrayBioscience). The primers for the specific compounds we want to investigate are all, except for NRF-2,available at the same company.Specific Primers required: (Cyclin D1, D2, D3, E1, E2 cdk2, cdk3, cdk4, cdk6 NRF-1, PRC)Unfortunately, no commercial primer is available for NRF-2, as its sequence has not been fully establishedyet. However, the sequence of the α subunit has been determined. Therefore, we will order a customprimer against the α subunit (Invitrogen). Although this might not give entirely accurate results about NRF-2 mRNA levels, it will provide a close identification. As RT-PCR is a rather lengthy method, especiallySCI 332 Advanced Molecular Cell Biology Research Proposal 112