Visualizar Tese - Instituto de Biociências - Unesp

Andreo Fernando AguiarTable 1. Oligonucleotide primers used for real-time PCR amplification of transverseGenes GenBank Accession No Sequence (5’ – 3’)IGF-I NM178866 S: GCTATGGCTCCAGCATDCGA: TCCGGAAGCAACACTCATCCMyoD NM_176079 S: CCTACTACAGTGAGGCGTCCAA: GTGGAGATGCGCTCCACTATMyogenin NM_017115 S: AGTGAATGCAACTCCCACAA: CGTAAGGGAGTGCAGGTTGTTBPNM_001075742S: ATTTGCCAAGAAGGTGAACGA: CCGTAAGGCATCATTGGACTHPRT NM_001034035 S: CACTGGGAAGACAATGCAGAA: ACACTTCGAGGGGTCCTTTTGAPDH NM_001034034 S: AGATGGTGAAGGTCGGAGTGA: GAAGGTCAATGAAGGGGTCAS: primer senso; A: primer antisensoSTATISTICAL ANALYSISStatistical analyses were performed using a software package (SPSS forWindows, version 13.0). To ensure that the data were stable, the statistic procedure wasaccomplished after the preliminary study of the variable related to normality andequality of variance among all groups, with statistical power of 80% for thecomparisons performed. Fiber-type frequency data were analyzed using the GoodmanTest for contrasts intermultinomial and intramultinomial populations (20, 21) to assessdifferences among all groups. Statistical comparisons among the groups were madeusing analysis of variance (ANOVA) for the 1-factor model (65) for body weight, foodintake, muscle weight, mRNA expression and MHC isoforms content values. Whensignificant main effects were revealed, specific differences were assessed using Tukey’spost hoc comparisons. Data are expressed as mean ± SD. Differences were consideredsignificant with a p value of < 0.05.52