Initial sequencing and analysis of the human genome - Vitagenes

articlesthe IAC anticodon for a Val tRNA could recognize GUU, GUC andeven GUA codons. Were this same I34 to be utilized in two-codonboxes, however, misreading of the NNA codon would occur, resultingin translational havoc. Eukaryotic glycine tRNAs represent aconserved exception to this last rule; they use a GCC anticodon todecode GGU and GGC, rather than the expected ICC anticodon.Satisfyingly, the human tRNA set follows these wobble rulesalmost perfectly (Fig. 34). Only three unexpected tRNA speciesare found: single genes for a tRNATyr-AUA, tRNAIle-GAU, andtRNAAsn-AUU. Perhaps these are pseudogenes, but they appear tobe plausible tRNAs. We also checked the possibility of sequencingerrors in their anticodons, but each of these three genes is in a regionof high sequence accuracy, with PHRAP quality scores higherthan 70 for every base in their anticodons.As in all other organisms, human protein-coding genes showcodon biasÐpreferential use of one synonymous codon overanother 258 (Fig. 34). In less complex organisms, such as yeast orbacteria, highly expressed genes show the strongest codon bias.Cytoplasmic abundance of tRNA species is correlated with bothcodon bias and overall amino-acid frequency (for example, tRNAsfor preferred codons and for more common amino acids are moreabundant). This is presumably driven by selective pressure foref®cient or accurate translation 259 . In many organisms, tRNAabundance in turn appears to be roughly correlated with tRNAgene copy number, so tRNA gene copy number has been used as aproxy for tRNA abundance 260 . In vertebrates, however, codon bias isnot so obviously correlated with gene expression level. Differingcodon biases between human genes is more a function of theirlocation in regions of different GC composition 261 . In agreementwith the literature, we see only a very rough correlation of humantRNA gene number with either amino-acid frequency or codon bias(Fig. 34). The most obvious outliers in these weak correlations arethe strongly preferred CUG leucine codon, with a mere six tRNA-Leu-CAG genes producing a tRNA to decode it, and the relativelyrare cysteine UGU and UGC codons, with 30 tRNA genes to decodethem.The tRNA genes are dispersed throughout the human genome.However, this dispersal is nonrandom. tRNA genes have sometimesbeen seen in clusters at small scales 262,263 but we can now see strikingclustering on a genome-wide scale. More than 25% of the tRNAgenes (140) are found in a region of only about 4 Mb on chromosome6. This small region, only about 0.1% of the genome, containsan almost suf®cient set of tRNA genes all by itself. The 140 tRNAgenes contain a representative for 36 of the 49 anticodons found inthe complete set; and of the 21 isoacceptor types, only tRNAs todecode Asn, Cys, Glu and selenocysteine are missing. Many of thesetRNA genes, meanwhile, are clustered elsewhere; 18 of the 30 CystRNAs are found in a 0.5-Mb stretch of chromosome 7 and many ofthe Asn and Glu tRNA genes are loosely clustered on chromosome 1.More than half of the tRNA genes (280 out of 497) reside on eitherchromosome 1 or chromosome 6. Chromosomes 3, 4, 8, 9, 10, 12,18, 20, 21 and X appear to have fewer than 10 tRNA genes each; andchromosomes 22 and Y have none at all (each has a singlepseudogene).Ribosomal RNA genes. The ribosome, the protein syntheticmachine of the cell, is made up of two subunits and contains fourrRNA species and many proteins. The large ribosomal subunitcontains 28S and 5.8S rRNAs (collectively called `large subunit'(LSU) rRNA) and also a 5S rRNA. The small ribosomal subunitcontains 18S rRNA (`small subunit' (SSU) rRNA). The genes forLSU and SSU rRNA occur in the human genome as a 44-kb tandemrepeat unit 264 . There are thought to be about 150±200 copies of thisrepeat unit arrayed on the short arms of acrocentric chromosomes13, 14, 15, 21 and 22 (refs 254, 264). There are no true completePheLeu171 UUU203 UUC73 UUA125 UUGAAA 0GAA 14UAA 8CAA 6Ser14717211845UCUUCCUCAUCGAGAGGAUGACGA10054Tyrstopstop12415800UAUUACUAAUAGAUAGUAUUACUA11100CysstopTrp991190122UGUUGCUGAUGGACA 0GCA 30UCA 0CCA 7Leu127 CUU187 CUC69 CUA392 CUGAAG 13GAG 0UAG 2CAG 6Pro17519717069CCUCCCCCACCGAGGGGGUGGCGG110104HisGln104147121343CAUCACCAACAGAUGGUGUUGCUG0121121Arg4710763115CGUCGCCGACGGACG 9GCG 0UCG 7CCG 5IleMet165 AUU218 AUC71 AUA221 AUGAAU 13GAU 1UAU 5CAU 17Thr13119215063ACUACCACAACGAGUGGUUGUCGU80107AsnLys174199248331AAUAACAAAAAGAUUGUUUUUCUU1331622SerArg121191113110AGUAGCAGAAGGACU 0GCU 7UCU 5CCU 4Val111 GUU146 GUC72 GUA288 GUGAAC 20GAC 0UAC 5CAC 19Ala18528216074GCUGCCGCAGCGAGCGGCUGCCGC250105AspGlu230262301404GAUGACGAAGAGAUCGUCUUCCUC010148Gly112230168160GGUGGCGGAGGGACC 0GCC 11UCC 5CCC 8Figure 34 The human genetic code and associated tRNA genes. For each of the 64codons, we show: the corresponding amino acid; the observed frequency of the codon per10,000 codons; the codon; predicted wobble pairing to a tRNA anticodon (black lines); anunmodi®ed tRNA anticodon sequence; and the number of tRNA genes found with thisanticodon. For example, phenylalanine is encoded by UUU or UUC; UUC is seen morefrequently, 203 to 171 occurrences per 10,000 total codons; both codons are expected tobe decoded by a single tRNA anticodon type, GAA, using a G/U wobble; and there are 14tRNA genes found with this anticodon. The modi®ed anticodon sequence in the maturetRNA is not shown, even where post-transcriptional modi®cations can be con®dentlypredicted (for example, when an A is used to decode a U/C third position, the A is almostcertainly an inosine in the mature tRNA). The Figure also does not show the number ofdistinct tRNA species (such as distinct sequence families) for each anticodon; often thereis more than one species for each anticodon.894 © 2001 Macmillan Magazines Ltd NATURE | VOL 409 | 15 FEBRUARY 2001 | www.nature.com