full issue - Association of Biotechnology and Pharmacy

More documents

Recommendations

Info

Current Trends in Biotechnology and PharmacyVol. 5 (2) 1163-1172 April 2011. ISSN 0973-8916 (Print), 2230-7303 (Online)1169Table 4. Details of the C. fenestratum species-specific markers designed using the ITS1sequence.Plant species Name of the Sequence of the DNA marker (5 - 3 ) ProductmarkersizeC. fenestratum CF1F AGCCTGCACAGCAGAGAGAC 196 bpCF1R CGTTGCCGAGAGTCGTTCreproducible manufacturing techniques andprocedures. Correct identification and qualityassurance of the starting material is an essentialprerequisite to ensure reproducible quality ofherbal medicine, which contributes to its safetyand efficacy. According to WHO generalguidelines for methodologies on research andevaluation of traditional medicines, first step inassuring quality, safety and efficacy of traditionalmedicines is correct identification (22).Most of the cases of accidental herbalmedicine misuse start with wrong identificationof a medicinal plant prescribed (23). Many of thetraditional systems have records where onecommon vernacular name is applied to two ormore entirely different species or genus. For eg.,Ginseng has almost become a generic name with13 different species traded in the world market(23). For example Chinese or Asiatic ginseng(Panax ginseng), American ginseng (Panaxquinquefolius), Siberian ginseng(Eleutherococcus senticosus), Ayurvedicginseng (Withania somnifera) and Russianginseng (Acanthopanax senticosus), to name afew. Such names could create confusion overprescription, which may eventually lead to seriousconsequences.WHO has developed several guidelines forcarrying out standardization procedures of rawherbal products, which basically includepharmacognostical, physico-chemical,pharmacological and toxicological methods (22).Microscopic and macroscopic standards could bedrawn out, where a plant can be differentiatedfrom another entirely different plant which maylook similar in external appearance. Currently,genetic fingerprinting and the use of analyticalquality-control equipments like HPLC andHPTLC are performed on a large scale forstandardization and identification of herbal drugs.Each technique has its limitations (14). DNA levelidentification is gaining popularity as an effective,reliable and simple pharmacognostic tool to resolvethe confusion in taxonomic identification of herbalraw drugs. Because genetic composition is uniquefor each species irrespective of the physical formand is less affected by age, physiological condition,environmental factors, harvest, storage andprocessing. DNA extracted from leaves, stemsor roots of an herb all carry the same geneticinformation and extracted DNA can be storedfor longer duration as they are stable (10).Panax (ginseng) is a representative genusof medicinal herbs which was subjected to severalmethods of DNA analysis by Chinese includingPCR-RFLP, AFLP, RAPD, SSR, sequencing ofrDNA-ITS region and DNA barcoding (10, 24).Universal PCR primers designed from highlyconserved regions flanking the ITS region,relatively small size (600–700 bp) of the ITSregion and high copy number (>100 per cell)enable easy amplification of the ITS region (10,14). ITS sequence has reduced variability withinthe species (25). These advantages have madeITS region and ribosomal RNA gene sequenceMolecular Marker to distinguish Coscinium fenestratum
Current Trends in Biotechnology and PharmacyVol. 5 (2) 1163-1172 April 2011. ISSN 0973-8916 (Print), 2230-7303 (Online)1170as preferred choice for molecular typing. RFLPfingerprints based on 18S rRNA and ITSsequence to distinguish C. fenestratum from itsadulterants Arcangelisia flava and Fibruareatinctoria in the Thai herbal market (26).DNA information may not be directlycorrelated with the amounts of the activeingredients. However, genetic data has its ownadvantages over other methods of authentication.Molecular markers are least affected by age,environmental factors and physiological conditionsof the plant samples they are not tissue specificand thus can be detected at any stage ofdevelopment, with a small amount of sample, inany physical form (14). DNA based methods havebeen successfully used to even authenticateherbal constituents in commercial herbalpreparations in which the components have beenground, boiled, concentrated, dried and blended(10). DNA markers can increase industrialapplication of the molecular techniques (27).The DNA markers described in this studywill be useful in quality control of herbal raw drugsand also in selecting genuine C. fenestratum forresearch. However, DNA markers together withthe chemical fingerprint would improve quality ofherbal medicines.AcknowledgementFinancial support for this study wasprovided by Ministry of Environment and Forests,Government of India as “Centre of Excellence”grant. Authors wish to thank Dr. K. Ravikumar,Dr. Jawahar and Mr. R. Murugan, for collectionof authentic plant samples and useful discussion.Thanks are due to Prof. K.V. Krishnamurthy forhis suggestions in preparing this manuscript.References1. Tushar K.V., George S., Remashree A.B.and Balachandran I. (2008). Cosciniumfenestratum (Gaertn.) Colebr.-A review onthis rare, critically endangered and highlytradedmedicinal species. J Plant Sci., 3:133-145.2. Walter, K.S and Gillett, J.H. (1998). 1997-IUCN Red List of Threatened Plants.Cambridge-International Union forConservation of Nature (IUCN), WorldConservation Union.3. Anonymous. (2006). The AyurvedicPharmacopoeia of India, Part I, Vol V.Government of India, Ministry of Health andFamily Welfare, Department of IndianSystems of Medicine & Homoeopathy, NewDelhi, pp. 60-624. Warrier, P.K., Nambiar, V.P.K. andRamankutty, C.. (1994). Indian MedicinalPlants, a Compendium of 500 species.Orient Longman Limited, Madras, pp. 191-193.5. Shirwaikar, A., Rajendran, K. and PunithaI.S.R.. (2005). Antidiabetic activity ofalcoholic stem extract of Cosciniumfenestratumin streptozotocin-nicotinamideinduced type 2 diabetic rats. JEthnopharmacol, 97: 369-374.6. Rojsanga P, Gritsanapan W and SuntornsukL. (2006). Determination of berberinecontent in the stem extracts of Cosciniumfenestratumby TLC densitometry. MedPrinc Pract., 15: 373-378.7. Wongbutdee J. (2009). Physiological effectsof Berberine. Thai Pharm Health Sci J., 4:78 - 838. Ved DK and Goraya GS. (2008). Demandand supply of medicinal plants in India.Bishen Singh Mahendra Pal Singh, DehraDun.Balasubramani and Venkatasubramanian
Page 3 and 4:
ISSN 0973-8916Current Trends inBiot
Page 6 and 7:
Current Trends in Biotechnology and
Page 10 and 11:
Page 12 and 13:
Page 14 and 15:
Page 16 and 17:
Page 18 and 19:
Page 20 and 21:
Page 22 and 23:
Page 24 and 25:
Page 26 and 27:
Page 28 and 29:
Page 30 and 31:
Page 32 and 33:
Page 34 and 35:
Page 37 and 38:
Page 39 and 40:
Page 41 and 42: Current Trends in Biotechnology and
Page 55: Current Trends in Biotechnology and
Page 133: (December 7-9, 2011)Venue: Karunya
show all

full issue - Association of Biotechnology and Pharmacy

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?