full issue - Association of Biotechnology and Pharmacy

Current Trends in Biotechnology and PharmacyVol. 5 (2) 1163-1172 April 2011. ISSN 0973-8916 (Print), 2230-7303 (Online)1169Table 4. Details of the C. fenestratum species-specific markers designed using the ITS1sequence.Plant species Name of the Sequence of the DNA marker (5 - 3 ) ProductmarkersizeC. fenestratum CF1F AGCCTGCACAGCAGAGAGAC 196 bpCF1R CGTTGCCGAGAGTCGTTCreproducible manufacturing techniques andprocedures. Correct identification and qualityassurance of the starting material is an essentialprerequisite to ensure reproducible quality ofherbal medicine, which contributes to its safetyand efficacy. According to WHO generalguidelines for methodologies on research andevaluation of traditional medicines, first step inassuring quality, safety and efficacy of traditionalmedicines is correct identification (22).Most of the cases of accidental herbalmedicine misuse start with wrong identificationof a medicinal plant prescribed (23). Many of thetraditional systems have records where onecommon vernacular name is applied to two ormore entirely different species or genus. For eg.,Ginseng has almost become a generic name with13 different species traded in the world market(23). For example Chinese or Asiatic ginseng(Panax ginseng), American ginseng (Panaxquinquefolius), Siberian ginseng(Eleutherococcus senticosus), Ayurvedicginseng (Withania somnifera) and Russianginseng (Acanthopanax senticosus), to name afew. Such names could create confusion overprescription, which may eventually lead to seriousconsequences.WHO has developed several guidelines forcarrying out standardization procedures of rawherbal products, which basically includepharmacognostical, physico-chemical,pharmacological and toxicological methods (22).Microscopic and macroscopic standards could bedrawn out, where a plant can be differentiatedfrom another entirely different plant which maylook similar in external appearance. Currently,genetic fingerprinting and the use of analyticalquality-control equipments like HPLC andHPTLC are performed on a large scale forstandardization and identification of herbal drugs.Each technique has its limitations (14). DNA levelidentification is gaining popularity as an effective,reliable and simple pharmacognostic tool to resolvethe confusion in taxonomic identification of herbalraw drugs. Because genetic composition is uniquefor each species irrespective of the physical formand is less affected by age, physiological condition,environmental factors, harvest, storage andprocessing. DNA extracted from leaves, stemsor roots of an herb all carry the same geneticinformation and extracted DNA can be storedfor longer duration as they are stable (10).Panax (ginseng) is a representative genusof medicinal herbs which was subjected to severalmethods of DNA analysis by Chinese includingPCR-RFLP, AFLP, RAPD, SSR, sequencing ofrDNA-ITS region and DNA barcoding (10, 24).Universal PCR primers designed from highlyconserved regions flanking the ITS region,relatively small size (600–700 bp) of the ITSregion and high copy number (>100 per cell)enable easy amplification of the ITS region (10,14). ITS sequence has reduced variability withinthe species (25). These advantages have madeITS region and ribosomal RNA gene sequenceMolecular Marker to distinguish Coscinium fenestratum