full issue - Association of Biotechnology and Pharmacy

More documents

Recommendations

Info

Current Trends in Biotechnology and PharmacyVol. 5 (2) 1163-1172 April 2011. ISSN 0973-8916 (Print), 2230-7303 (Online)1167a)b)Fig. 3. a) GQ496588. Coscinium fenestratum internal transcribed spacer 1, complete sequence; and 5.8Sribosomal RNA gene, partial sequence b) GQ496589.Coscinium fenestratum 5.8S ribosomal RNA gene, partialsequence; and internal transcribed spacer 2, complete sequenceand their homology percentage with the respectiveITS region of C. fenestratum is given in the Table3. Variations in the ITS sequences was observedamong the different species studied.Development and Validation of Speciesspecificmarker for C. fenestratum: NCBIprimer blast tool was used to develop and validatethe species-specific markers for C. fenestratum.On in silico analysis, a primer set (CF1F andCF1R) indicated a high specificity foramplification of 196 bp only from the ITS1sequence of C. fenestratum (Table 4). Thesynthesized oligos were incorporated in a PCRreaction individually with the genomic DNA ofC. fenestratum and its adulterant species.Electrophoretic separation of the ampliconindicated 196 bp product only with the C.fenestratum samples and it did not give any nonspecificamplification with the other test speciesunder study (Figure 4).DiscussionHerbal medicinal products may vary incomposition and properties, unlike conventionalpharmaceutical products prepared from synthetic,chemically pure materials by means ofFig. 4. PCR amplification with CF1F and CF1R using the genomic DNA of C. fenestratum and its adulterant species LaneM – 100 bp ladder; 1 to 5 – C. fenestratum accessions; Lane 6 to 8 – B. aristata; Lane 9 to 11 – B. asiatica; Lane 12 to 14– B. lycium; Lane 15 to 17 – M. umbellataMolecular Marker to distinguish Coscinium fenestratum
Current Trends in Biotechnology and PharmacyVol. 5 (2) 1163-1172 April 2011. ISSN 0973-8916 (Print), 2230-7303 (Online)1168Table 1. Details of the plant samples used in the study.S No. Name of the species Place of collection Accession No.1 C. fenestratum Bangalore market, KA L/06/09/0312 Kanyakumari, TN L/06/12/0153 Pune, MH L/07/02/0334 Bangalore market, KA L/07/04/0155 Nadavayal forest, Wayanad, KL L/07/08/0106 B. aristata Potter’s hill, Shimla, HP L/08/09/0127 Shillaru, Shimla, HP L/08/10/0088 Potter’s Hills, Shimla, HP L/08/10/0119 B.asiatica Mulshi, Mussoorie, HP L/07/12/00110 Saharan-Nahar Road, HP L/08/09/01311 Saharan-Nahar road, HP L/08/09/01612 B.lycium Karol, Manikaran, HP L/06/06/03713 Shillaru, Kangra, HP L/08/10/00914 Chail, Solan, HP L/08/10/01015 M. umbellata Kannimarsholai, Tiruchi, TN L/07/04/00116 Sirumalai hills, Dindigul, TN L/07/07/05317 Mavanatham, Erode, TN L/09/03/009Table 2. Details of the primers used for amplifying the ITS1 and ITS2 regions of C. fenestratumPrimer detailsRegion Direction Name of Primer sequence (5’ 3’) Size of the GenBankthe primer amplicon accession No.ITS1 Forward ITS 1 TCCGTAGGTGAACCTGCGG 245 bp GQ496588Reverse ITS 2 GCTGCGTTCTTCATCGATGCITS2 Forward ITS 3 GCATCGATGAAGAACGCAGC 386 bp GQ496589Reverse ITS 4 TCCTCCGCTTATTGATATGCTable 3. The homology score in the ITS regions of C. fenestratum with its adulterant speciesAdulterant Species GenBank Homology %accession no. ITS1 ITS2B. aristata GQ259132 43.87 37.03B. asiatica GQ259133 52.55 34.44B. lycium GQ259134 51.53 35.18M. umbellata AY514063 52.04 56.66Balasubramani and Venkatasubramanian
Page 3 and 4:
ISSN 0973-8916Current Trends inBiot
Page 6 and 7:
Current Trends in Biotechnology and
Page 10 and 11:
Page 12 and 13:
Page 14 and 15:
Page 16 and 17:
Page 18 and 19:
Page 20 and 21:
Page 22 and 23:
Page 24 and 25:
Page 26 and 27:
Page 28 and 29:
Page 30 and 31:
Page 32 and 33:
Page 34 and 35:
Page 37 and 38:
Page 39 and 40: Current Trends in Biotechnology and
Page 55: Current Trends in Biotechnology and
Page 133: (December 7-9, 2011)Venue: Karunya
show all

full issue - Association of Biotechnology and Pharmacy

Create successful ePaper yourself

Delete template?

Save as template?