Haematologica 2004;89: supplement no. 6 - Supplements ...

haematologicahJournal of Hematologyjournal ofhematologyISSN 1592-8721educational editionMensile – Sped. Abb. Post. – 45% art. 2, comma 20B, Legge 662/96 - Filiale di Pavia. Il mittente chiede la restituzione dei fascicoli non consegnati impegnandosi a pagare le tasse dovutevolume 89supplement no. 6september 2004published by theferrata-stortifoundation,pavia, italys6VIII Congress of theItalian Society ofExperimentalHematologyPavia,September 14-16, 2004

haematologica – Vol. 89, supplement n. 6, September 2004 - pp. 1-198

haematologicaeditorial boardeditor-in-chiefMario Cazzola (Pavia)deputy editorsJoan Bladé (Barcelona), Carlo Brugnara (Boston), Rosangela Invernizzi (Pavia), Francesco Lo Coco (Roma),Paolo Rebulla (Milano), Gilles Salles (Lyon), Jordi Sierra Gil (Barcelona), Vicente Vicente Garcia (Murcia)assistant editorsGaetano Bergamaschi (Pavia), Luca Malcovati (Pavia), Vittorio Rosti (Pavia)scientific societies committeeSergio Amadori (Roma Italian Society of Hematology), Maria Benedetta Donati (Santa Maria Imbaro, Italian Societyof Hemostasis and Thrombosis), Gianluca Gaidano (Novara, Italian Society of Experimental Hematology), MomciloJankovic (Monza, Italian Association of Pediatric Hematology/Oncology), Fernando Martínez Brotons(Barcelona, Spanish Society of Thrombosis and Hemostasis), Ciril Rozman (Barcelona, Spanish Association ofHematology and Hemotherapy)consulting editorsAdriano Aguzzi (Zürich), Claudio Anasetti (Seattle), Justo Aznar Lucea (Valencia), Carlo L. Balduini (Pavia),Michele Baccarani (Bologna), Giovanni Barosi (Pavia), Yves Beguin (Liège), Javier Batlle Fonrodona (A Coruña),Marie Christine Béné (Vandoeuvre Les Nancy), Dina Ben-Yehuda (Jerusalem), Mario Boccadoro (Torino),David T. Bowen (Dundee), Juan A. Bueren (Madrid), Dario Campana (Memphis), Marco Cattaneo (Milano),Michele Cavo (Bologna), Thérèsa L. Coetzer (Johannesburg), Francesco Dazzi (London), Valerio De Stefano (Roma),Judith Dierlamm (Hamburg), Meletios A. Dimopoulos (Athens), Ginés Escolar Albadalejo (Barcelona), Elihu H. Estey(Houston), J.H. Frederik Falkenburg (Leiden), Felicetto Ferrara (Napoli), Lourdes Florensa (Barcelona),Jordi Fontcuberta Boj (Barcelona), Renzo Galanello (Cagliari), Paul L. Giangrande (Oxford), Paolo G. Gobbi (Pavia),Lawrence T. Goodnough (St. Louis), Sakari Knuutila (Helsinki), Yok-Lam Kwong (Hong Kong), Bernhard Laemmle(Bern), Mario Lazzarino (Pavia), Ihor R. Lemischka (Princeton), Franco Locatelli (Pavia), Gabriel Márquez (Madrid),Estella Matutes (London), Cristina Mecucci (Perugia), Giampaolo Merlini (Pavia), Charlotte Niemeyer (Freiburg),Ulrike Nowak-Göttl (Münster), Michael O’Dwyer (Galway, Ireland), Alberto Orfao (Salamanca), Antonio Páramo(Pamplona), Stefano A. Pileri (Bologna), Giovanni Pizzolo (Verona), Susana Raimondi (Memphis), AlessandroRambaldi (Bergamo), Vanderson Rocha (Paris), Francesco Rodeghiero (Vicenza), Guillermo F. Sanz (Valencia),Miguel Angel Sanz (Valencia), Jerry L. Spivak (Baltimore), Alvaro Urbano-Ispizua (Barcelona), Elliott P. Vichinsky(Oakland), Giuseppe Visani (Pesaro), Neal S. Young (Bethesda)editorial officeLuca Arcaini, Matteo Giovanni Della Porta, Igor Ebuli Poletti, Marta Fossati, Michele Moscato, Lorella Ripari,Rachel Stennerofficial organ ofAEHH (Spanish Association of Hematology and Hemotherapy)AIEOP (Italian Association of Pediatric Hematology/Oncology)SETH (Spanish Society of Thrombosis and Hemostasis)SIE (Italian Society of Hematology)SIES (Italian Society of Experimental Hematology)SISET (Italian Society for Studies on Hemostasis and Thrombosis)Direttore responsabile: Prof. Edoardo Ascari; Autorizzazione del Tribunale di Pavia n. 63 del 5 marzo 1955.Editing: m Mikimos - Medical Editions, via A. Fogazzaro 5, Voghera, ItalyPrinting: Tipografia PI-ME, via Vigentina 136, Pavia, ItalyPrinted in September 2004Haematologica is sponsored by educational grants from the following institutions and companies:IRCCS Policlinico S. Matteo, Pavia, ItalyUniversity of Pavia, ItalyJosé Carreras International Leukemia Foundation

haematologicaThe origin and power of a nameAncient Greekαιµα [aima] = blood;αιµατος [aimatos] = of blood,λογος [logos]= reasoningScientific Latinhaematologicus (adjective) = related to bloodScientific Latinhaematologica (adjective, plural and neuter,used as a noun) = hematological subjectsModern EnglishJournal of Hematology2003 JCR ® Impact Factor = 3.453h

supplement 6, September 2004Table of ContentsVIII Congress of the Italian Society of Experimental HematologyPavia, September 14-16, 2004* * * * *Main Program . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1PostersBest Abstracts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15Oral CommunicationsC01. Molecular Hematology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19C02. Hematopoietic Growth Factors . . . . . . . . . . . . . . . . . . . . . . . . 24C03. Non-Malignant Hematology. . . . . . . . . . . . . . . . . . . . . . . . . . . 29C04. Stem Cell Transplantation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34C05. Acute Leukemias. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40C06. Chronic Myeloproliferative Disorders . . . . . . . . . . . . . . . . . . 45C07. Malignant Lymphomas. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50C08. Multiple Myeloma . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56PO01. Acute Myeloid Leukemia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62PO02. Acute Lymphoid Leukemia. . . . . . . . . . . . . . . . . . . . . . . . . . . . 74PO03. MDS/PNH. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80PO04. Molecular Hematology I . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89PO05. Molecular Hematology II . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96PO06. Multiple Myeloma I . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103PO07. Multiple Myeloma II. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112PO08. Non-Oncological Hematology . . . . . . . . . . . . . . . . . . . . . . 122PO09. Myeloproliferative Disorders . . . . . . . . . . . . . . . . . . . . . . . . 130PO10. Stem Cell Transplantation I. . . . . . . . . . . . . . . . . . . . . . . . . . 143PO11. Stem Cell Transplantation II . . . . . . . . . . . . . . . . . . . . . . . . . 153PO12. Chronic Lymphocytic Leukemia and Lymphoma . . . 163PO13. Lymphomas and Lymphoproliferative Disorders I . . 173PO14. Lymphomas and Lymphoproliferative Disorders II . 183Index of authors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iHaematologica 2004; vol. 89; supplement no. 6 - September 2004(indexed by Current Contents/Life Sciences and in Faxon Finder and Faxon XPRESS, also available on diskette with abstracts)http://www. haematologica. org/

2Main Programhepatic peptide hepcidin, a key regulator of ironmetabolism in mouse models. In normal conditionsonly 1-2 mg iron are absorbed daily from the gut and25-30 mg are released from macrophages to circulatingtransferrin. These amounts can be increasedaccording to the needs of the erythron (erythroid regulator)or reduced on the basis of iron stores (storeregulator). In Hemochromatosis iron absorption andrelease are greater than normal and are unrelated tothe body needs, making this disorder a suitable modelto study iron homeostasis. Different genetic typesof Hemochromatosis have been identified. HFE-relatedHemochromatosis, the first recognized disorder,affects prevalently middle aged males, has low penetranceand variable clinical phenotype. JuvenileHemochromatosis on the contrary is characterizedby early onset, severe iron overload and clinical complicationsin both sexes. Iron absorption in HFEHemochromatosis can still increase, whereas it ismaximal in the juvenile type. The present evidenceindicates that both disorders involve hepcidin. JuvenileHemochromatosis results from the absence ofhepcidin, rarely through direct mechanisms (hepcidinmutations), more commonly through mutations ofthe newly discovered hemojuvelin protein. Patientswith hemojuvelin mutations have no measurable urinaryhepcidin. Evidence is accumulating that HFE-Hemochromatosis is due to reduced hepcidin production,which is inappropriate to the degree of ironloading. Accordingly, HFE is involved in the hepcidinincrease that follows iron loading and it is thus acomponent of the store regulator, whose function isto block iron absorption. The Juvenile Hemochromatosisproteins, hepcidin and hemojuvelin, are componentsof the erythroid regulator, which requiresthat hepcidin is switched off to allow maximal ironabsorption. A third type of Hemochromatosis is dueto inactivation of transferrin receptor 2 (TFR2), amember of the transferrin receptor family, whosefunction in iron metabolism is uncertain. The resultingdisorder is characterized by iron overload early inlife, but runs a clinical course milder than the juvenileform. The TFR2 relationship with hepcidin is stillspeculative. From clinical and experimental findingswe suggest that TFR2 has a role distinct from HFE inhepcidin activation. This is in agreement with theobservation that normal TFR2 cannot compensatethe lack of HFE in HFE-Hemochromatosis. Genomicmedicine applied to Hemochromatosis is openingnew perspectives in our understanding iron homeostasis.REGULATION OF ERYTHROPOIESISVannucchi AMU. F. di Ematologia, Università degli Studi, AziendaOspedaliera-Universitaria Careggi, Florence, ItalyErythropoiesis, the events that lead to the formationof mature erythrocytes, is the result of complexdifferentiation processes that, starting from theprimitive hematopoietic stem cell, proceed througha number of intermediate progenitor and precursorscells. The cellular compartments involved in thisprocess have been identified and characterized basedon their ability to give rise to colonies of differentappearance (CFU-GEMM, BFU-E, CFU-E) and proliferativepotentialities when cultured in vitro underdefined stimulatory conditions; one of the essentialevents in the process is the expression on the membraneof developing cells of receptors for erythropoietin(EPOR), whose density reaches a maximum ofaround 1,000 molecules/cells at the proerythroblaststage. The binding of EPO to the receptor homodimerinduces a change in the conformational statusof the molecule with ensuing activation of the Januskinase 2 (JAK2), that on turn binds EPOR itself at thelevel of a Box1 motif. Downstream signalling pathwaysinvolve at least phosphatidylinositol 3 kinase,Stat5, and Ras. The essential non-redundant role ofEPO and its receptor in erythropoiesis has beenstrengthened by the generation of mice with deficiencyof the corresponding gene (knockout mice).The liver of both Epo -/- and EpoR -/- fetus containsnormal numbers of BFU-E and CFU-E progenitors,suggesting that neither the hormone nor the receptorare required for erythroid lineage commitment ofthe hematopoietic stem cell; however, definitive erythropoiesisis blocked, resulting in embryonic mortalitydue to severe anemia. Indeed, the principalfunction of EPO-EPOR system is that of rescuingcommitted progenitors from apoptosis, at least partiallyby regulating the expression of bcl-xL. A similarphenotype has been shown also for Stat5a -/- 5b -/-embryos, that are severely anemic due to a high rateof progenitor apoptosis as the consequence of defectiveactivation of the bcl-xL promoter by Stat5.Ofnote, the defect induced by the Stat5a -/- 5b -/- geneticmanipulation is not apparent in the adult life due tocompensatory mechanisms possibly involving Stat1and/or Stat3.Among other cytokines playing a role inerythropoiesis, the kit ligand (KL, or stem cell factor,SCL) and its receptor (c-kit, or SCFR) are preferentiallyinvolved in the early stages of progenitor proliferationand maturation; the number of SCFR moleculesprogressively declines from pluripotenthematopoietic progenitors to CFU-E, and are absentin the morphologically recognizable erythroblasts.Co-administration of SCF and EPO, both in vitro andhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 20043in vivo, results in potent stimulation of erythropoiesis.Finally, non-cytokine mediated signals may have aprofound impact on erythropoiesis, as it is the casefor glucocorticoids, whose stimulatory effects aresupported by a number of clinical and experimentalobservations; they might be especially involved inthe regulation of stress erythropoiesis, since micegenetically deficient in glucocorticoid receptorsmount an inappropriate erythroid response. Theactivity of glucocorticoids in stress erythropoiesis isantagonized by p53, as shown by the faster responseto anemia in p53 -/- mice; one mechanism for thisinteraction might be the ability of p53 to inhibit theexpression of c-myb, therefore favouring differentiationversus proliferation. The existence of strict connectionsbetween the erythroid and the megakaryocyticdifferentiation lineages, initially supposedfrom the frequent coexpression of erythroid andmegakaryocytic phenotypic markers and differentiationpotentialities in human and erythroleukemiccell lines, has received experimental validation in thelast few years following the demonstration that: i) acommon bipotent erythroid-megakaryocytic progenitor(MEP) normally exists in hematopoiesis; ii) duringnormal and, especially, under stress erythropoiesisin the mouse, bipotent, non-clonogenic erythroidmegakaryocyticprogenitors are found in both thebone marrow and the spleen; and iii), by manipulatingin vitro culture conditions, mature glycophorin-A + erythroblasts retain the potentiality to differentiateinto CD41 + polyploid megakaryocytes.The different processes that occur during erythropoiesisare regulated at the molecular level by a networkof interacting transcription factors, that ultimatelyact by regulating the transcriptional activityof erythroid-specific genes, at the same time exertingcomplex self-regulatory functions. The erythroidspecificprototype transcription factor is representedby GATA-1, a zinc-finger protein whose consensussequences have been found in the promotersand/or enhancers of all erythroid genes examined upto now (including globin genes, EPOR, and GATA-1itself); the gene for GATA-1 is on the X-chromosome.Gata-1 is first activated at the level of pluripotenthematopoietic progenitors, then its expression iseither down-regulated during myeloid commitment,or maintained and progressively increased in progenitorscommitted to the erythroid lineage. GATA-1molecules contain a COOH-terminal and N-terminalzinc finger, and a region involved in the stabilizationof binding to palyndromic DNA sequences. The aminozinc finger is required for the binding of an obligatorycofactor, named FOG-1 (that stands for FriendOf GATA-1), that is strictly required for the functionalactivity of GATA-1 on target genes. Beyond the erythroidone, Gata-1 is expressed in cells of megakaryocytic,mast cell, and eosinophilic lineages, andalso in Sertoli cells of the developing testis in themouse. The essential role of GATA-1 in normal erythropoiesishas been shown by gene targeting studiesin mice, that lead to the generation of severalmutants either knockout or knockdown for the gene.Hemizygous male Gata-1 knockout mice die early ingestation due to severe anemia with arrest of maturationat a proerythroblast stage. GATA-1 -/- cellsundergo rapid apoptosis, indicating an essential roleof GATA-1 in both cell survival and cell maturation.In vitro, GATA-1, also in cooperation with EPO, selectivelyinduces the expression of bcl-xL but not of bcl-2, maintaining erythroid cell viability during terminalmaturation. Cellular levels of GATA-1 at 1 /4 ofnormal ones, such as in Gata-1 low knockdown mice,are relatively well tolerated in the adult life, probablydue to some still unclear compensatory mechanism;furthermore, in some experimental conditions,other transcription factors, such as GATA-2, may substitutefor GATA-1. On the other hand, the erythroidphenotype of FOG-1 -/- mice was reminiscent that ofGata-1 knockouts, while, interestingly, these miceshowed a complete defect of megakaryocytopoiesisto suggest a GATA-1 independent role in early stepsof megakaryocytopoiesis. Other transcription factorsthat serve a role in erythropoiesis are represented byEKLF, NF-E2, and SCL/tal1; about the latter, conditionalknockout of SCL/tal1 showed reduced basaland stress erythropoiesis due to the loss of earlyprogenitors, a defect in common with the megakaryocyticlineage, while myeloid cell development wasunaffected.Studies of transcriptional profile and activity ofdifferent classes of erythroid progenitor and precursorcells, together with the invaluable in-vivo modelsrepresented by genetically modified animals, areproviding new information about the regulation oferythropoiesis not only under steady state, but especiallyunder stress conditions; hopefully, these informationwill help in the understanding of the pathogenesisof complex anemias, and possible, in thedevelopment of more specific therapies.THE MOLECULAR REGULATION OF MEGAKARYOCYTEDIFFERENTIATIONCatani LHematology and Medical Oncology Institute “ L. e A.Seragnoli”, University of Bologna, ItalyCells comprising the megakaryocyte (MK) lineageinclude a bipotential erythro-MK progenitors, MKprogenitors (BFU-MK and CFU-MK), post-mitoticMKs still capable of undergoing endoreduplicationand more differentiated polyploid MKs undergoingterminal maturation. This process is regulated by ahaematologica vol. 89[suppl. n. 6]:september 2004

4Main Programcomplex network of interacting cytokines, growthfactors and extracellular matrix proteins. 1,2 The exactnature of master control genes regulating MK lineage-specificdevelopment remains still obscure.However, genetic studies have recently provided richinsights into the molecular and transcriptional regulationof MK differentiation and thrombopoiesis.Furthermore, knowledge accumulated by studyingmouse models and the defects in patients withhereditary thrombocytopenia. 3,4 Recent advanceshave highlighted the particular importance of fourtranscriptional regulators, GATA-1, FOG-1, FLI-1, andNF-E2, of distinct stages in MK differentiation,extending from the birth of early committed progenitorsto the final step of platelet release. 3 Studiesinvolving selective knockout of GATA-1 expressionin the Mks of mice 5 and others involving overexpressionof GATA-1 in cell line models 6 revealed akey role for GATA-1 in the differentiation of MKs.Most recently, GATA-1 mutations altering either theFOG-binding or the DNA binding domain of the proteinhave been described to be associated withhuman inherited diseases characterized by alterationsin the MK and the erythroid differentiationpathways (3). NF-E2 is a hetero-dimeric factor andthe p45 subunit appears to be free to associate withany of the three small-Maf subfamily. 7 Mice lackingp45 NF-E2 show megakaryocytosis and severethrombocytopenia leading to fatal hemorrhage. Lossof p45 NF-E2 interferes with MK maturation at anadvanced stage: ultra-structural studies reveal amarkedly reduced number of granules and failure toform platelet fields. Therefore genes that are regulatedby NF-E2 are critical to terminal Mk maturationand platelet formation. 8 However, up to date, nohuman diseases have been associated with NF-E2deregulation. Experimental evidences suggest alsothat the FLI-1 oncogene, associated with Ewing's sarcomain humans and experimental Friend virusinducederythro-leukemia in mice, plays an importantrole during the normal development of MKs. 3Inactivation of the FLI-1 gene in mice is embryoniclethal. FLI-1 knockout mice produce small, undifferentiatedMK progenitors with abnormal ultra-structuralfeatures such as reduced alpha-granules numbersand disrupted demarcation membrane systems.Levels of MK-specific genes normally expressed lateduring differentiation, such as GPIX, are also markedlyreduced. 9 An especially rare condition called Paris-Trousseau syndrome seems to occur by virtue ofhemizygous loss of the FLI-1 gene. 10 On this basis,within a linear hierarchy of transcriptional regulationin MK differentiation, the transcriptional control ofthe genesis of the bi-potential erythro-MK progenitorsremains mysterious. Experimental evidencessuggest that FOG-1, a GATA-1 co-activator, acts earlyin MK development without the involvement ofGATA-1 and then again later in a GATA-dependentpathway. Studies on mouse and human MK coloniespoint to positive regulation of proliferation of MKprogenitors by NF-E2 and negative regulation byGATA-1. Further cytoplasmic maturation is impairedin the absence of FLI-1 or GATA-1 in mice and whenhuman GATA-1 is mutated such that it interactspoorly with its cofactor FOG-1. Finally, plateletrelease is regulated by NF-E2, probably through coordinateactivation of many genes that reorganize thecytoskeleton and transport organelles into proplatelets.References1. Bruno E, Hoffman R. Human megakaryocyte progenitor cells. SemHematol 1998; 35: 183-91.2. Long MW. Megakaryocyte differentiation events. Sem Hematol1998; 35:192-9.3. Shivdasani RA. Molecular and transcriptional regulation of megakaryocytedifferentiation. Stem Cells 2001;19:397-407.4. Balduini CL, Iolascon A, Savoia A. Inherited thrombocytopenias: fromgenes to therapy. Haematologica 2002; 87:860-80.5. Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH. A lineage selectiveknockout establishes the critical role of transcription factorGATA-1 in megakaryocyte growth and platelet development. EMBOJ 1997;16:3965-73.6. Visvader J, Adams JM. Megakaryocytic differentiation induced in416B myeloid cells by GATA-2 and GATA-3 transgenes or 5-azacytidineis tightly coupled to GATA-1 expression. Blood 1993;82:1493-501.7. Catani L, Vianelli N, Amabile M, Pattacini L, Valdre' L, Fagioli ME etal. NF-E2 expression in normal and malignant megakaryocytopoiesis.Leukemia 2002;16:1773-81.8. Shivdasani RA, Rosenblatt MF, Zucker-Franklin D, Jackson CW, HuntP, Saris CJ et al. Transcription factor NF-E2 is required for plateletformation independent of the actions of thrombopoietin/MGDF inmegakaryocyte development. Cell 1995; 81:695-704.9. Spyropoulos DD, Pharr PN, Lavenburg R, Jackers P, Papas TS, OgawaM, Watson DK. Hemorrhage, impaired hematopoiesis and lethalityin mouse embryos carrying a targeted disruption of the Fli-1 transcriptionfactor. Mol Cell Biol 2000;20:5643-52.10. Shivdasani RA. Lonely in Paris: when one gene copy isn't enough. JClin Invest 2004;114:17-9.TRANSCRIPTIONAL TARGETS OF ACUTE MYELOID LEUKEMIAFUSION PROTEINSAlcalay MIFOM - Fondazione Istituto FIRC di Oncologia Molecolare,Milan; IEO - Istituto Europeo di Oncologia,Milan, ItalyAcute myelogenous leukemias (AMLs) are characterizedby heterogeneous chromosomal rearrangementsthat generate fusion proteins with aberranttranscriptional regulatory activities. 1 AML fusionproteins interfere with the process of myeloid differentiation,determine a stage-specific arrest ofmaturation and enhance cell survival, and transgenicmice display increased risk of myeloid leukemias,haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 20045suggesting that they induce a pre-leukemic state. 1-3The abnormal regulation of transcriptional networksinduced by AML-fusion proteins occurs through commonmechanisms that include recruitment of aberrantco-repressor complexes, alterations in chromatinremodeling, and disruption of specific subnuclearcompartments. 4,5 The identification and analysis ofcommon and specific target genes regulated by AMLfusion proteins is of fundamental importance for thefull understanding of acute myeloid leukemogenesisand for the implementation of disease-specific drugdesign. We have performed a systematic analysis offusion protein targets genes in diverse model systemsusing Affymetrix oligonucleotide chips. First,we analyzed transcriptional modulation after expressionof the AML1/ETO, PML/RAR and PLZF/RAR fusionproteins in U937 hemopoietic precursor cells. 6 Wethus identified 1555 genes regulated concordantlyby at least two fusion proteins that were further validatedin patient samples, and finally classifiedaccording to available functional information. Theanalysis of functionally homogenous groups of genesthat are coherently regulated by fusion proteinsrevealed that: i) genes involved in maintenance of thestem-cell phenotype are induced; ii) genes that regulatehematopoietic stem cell (HSC) commitment ordifferentiation are repressed, iii) DNA repair genes,mainly of the base excision repair (BER) pathway, arerepressed. Functional studies confirmed that ectopicexpression of AML fusion proteins constitutively activatespathways leading to increased stem cell renewal(e. g. the Jagged1/Notch pathway) and provokesaccumulation of DNA damage through repression ofBER. Expansion of the stem cell compartment andinduction of a mutator phenotype may therefore representrelevant features underlying the leukemicpotential of AML-associated fusion proteins. Acutepromyelocytic leukemia (APL) is a distinct subtype ofAML characterized by a differentiation block at thepromyelocytic stage. APL patients respond to pharmacologicalconcentrations of all-trans retinoic acid(RA) and, at the cellular level, disease remission correlateswith terminal differentiation of leukemicblasts. 7,8 The PML/RAR oncogenic transcription factoris responsible for both the pathogenesis of APLand for its sensitivity to RA. 7 PML/RAR functions byde-regulating RA target genes critical to myeloid differentiation,which are thought to represent thedownstream effectors of the fusion protein's oncogenicpotential. RA is thought to act by antagonizingPML/RAR-dependent gene regulation, therebyfavoring terminal differentiation. Analysis of the regulatorypathways impaired during leukemogenesisand reactivated during RA-induced differentiationmay therefore contribute to the identification of newmolecular targets for leukemia therapy. We analyzedgene expression profiles of RA-treated APL blastswith the aim of identifying physiological targets ofRA therapy, and identified 1056 common targetgenes. 9 We compared these results to those obtainedupon RA treatment of U937 cells lines, and foundthat transcriptional response to RA is largely dependenton the expression of PML/RAR. Several genesinvolved in the control of differentiation and stemcell renewal are early targets of RA regulation, andmay be direct effectors of RA response. Modulationof chromatin modifying genes was also observed,suggesting that specific structural changes in localchromatin domains may be required to promote RAmediateddifferentiation. Mutual cross-talk betweentranscriptional regulatory pathways is essential fortriggering differentiation. Computational analysis ofupstream genomic regions in RA target genesrevealed non-random distribution of transcriptionfactor binding sites, indicating that specific transcriptionalregulatory complexes may be involved indetermining RA response.References1. Alcalay M, Orleth A, Sebastiani C, Meani N, Chiaradonna F, CasciariC, et al. Common themes in the pathogenesis of acute myeloidleukemia. Oncogene 2001;20(40):5680-94.2. Bernardi R, Grisendi S, Pandolfi PP. Modelling haematopoietic malignanciesin the mouse and therapeutical implications. Oncogene2002;21(21):3445-58.3. Downing JR. The core-binding factor leukemias: lessons learnedfrom murine models. Curr Opin Genet Dev 2003;13(1):48-54.4. Minucci S, Nervi C, Lo Coco F, Pelicci PG. Histone deacetylases: acommon molecular target for differentiation treatment of acutemyeloid leukemias? Oncogene 2001;20(24):3110-5.5. Faretta M, Di Croce L, Pelicci PG. Effects of the acute myeloidleukemia--associated fusion proteins on nuclear architecture. SeminHematol 2001;38(1):42-53.6. Alcalay M, Meani N, Gelmetti V, Fantozzi A, Fagioli M, Orleth A, etal. Acute myeloid leukemia fusion proteins deregulate genes involvedin stem cell maintenance and DNA repair. J Clin Invest2003;112(11):1751-61.7. Minucci S, Pelicci PG. Retinoid receptors in health and disease: coregulatorsand the chromatin connection. Semin Cell Dev Biol1999;10(2):215-25.8. Huang ME, Ye YC, Chen SR, Chai JR, Lu JX, Zhoa L, et al. Use of alltransretinoic acid in the treatment of acute promyelocytic leukemia.Blood 1988;72(2):567-72.9. Meani N, Minardi SP, Licciulli S, Gelmetti V, Lo Coco F, Nervi C, etal. Molecular Signature of Retinoic Acid Treatment in AcutePromyleocytic Leukemia. submitted for publication 2004.STEM CELLS MOBILIZATIONCarlo-Stella C, Gianni AM“Cristina Gandini” Medical Oncology Unit, IstitutoNazionale Tumori and Chair of Medical Oncology,University of Milan, ItalyCytokine-mobilized hematopoietic stem cells(HSCs) have significantly increased indications andfeasibility of stem cell transplantation (SCT), whiledramatically reducing transplant-related morbidityand mortality. Autologous HSCs have now an estab-haematologica vol. 89[suppl. n. 6]:september 2004

6Main Programlished role in the management of neoplastic diseases,such as non-Hodgkin lymphomas or acute myelogenousleukemias, and their use is also increasinglyexplored in a variety of cancers who might benefit ofdose-intensification. Similarly, allogeneic HSCs representthe preferred stem cell source in HLA-mismatchedtransplantation and are gaining anincreased consensus for HLA-identical allografting.The availability of adequate amounts of HSCs representsan essential prerequisite for the feasibility ofhigh-dose therapy programs. Optimal mobilization ofautologous peripheral blood progenitor cells (PBPCs)in cancer patients requires both chemotherapy andgrowth factors, whereas allogeneic PBPCs are mobilizedby short courses of granulocyte colony-stimulatingfactor (rhG-CSF). Due to either prior chemoradiotherapyor disease-related factors, a substantialproportion of cancer patients fail to mobilize optimalamounts of CD34 + cells. Failure to mobilize therequired target cell dose of CD34 + cells may alsooccur in healthy donors. Improving stem cell mobilizationis of relevance not only for poor mobilizers orgraft engineering procedures, but also for gene therapyprograms as well as for stem cell-based cellreplacementtherapy. Stem cell mobilization mightbe enhanced either (i) by interfering with the mechanism(s)regulating hematopoietic stem cell trafficking,i. e., transmigration through the luminal endotheliumto extravascular bone marrow spaces inhoming and the reverse in mobilization, or (ii) byusing early-acting cytokines capable of expandingmarrow progenitors.Drugs interfering with stem cell trafficking. Thelocalization of hematopoietic cells to the bone marrowinvolves developmentally regulated adhesiveinteractions between hematopoietic cells and stromalcells. A wide variety of cell adhesion molecules(CAMs) participate in the adhesion of HSCs to stromalcells and their associated extracellular matrixcomponents. The α4β1 integrin plays a key role inhoming of HSCs/HPCs to marrow stroma and administrationof function-blocking antibodies againstα4β1 integrin or its cellular receptor, vascular celladhesion molecule-1 (VCAM-1), inhibits homing andinduces PBPC mobilization.The polydeoxyribonucleotide Defibrotide is avidlybound to vascular endothelium and significantlydecreases expression of CAMs, such as P-selectin andintercellular adhesion molecule-1 (ICAM-1), onendothelial cells. We have recemtly shown that inmice and nonhuman primates, Defibrotide significantlyenhances the frequency and absolute numberof a broad spectrum of hematopoietic progenitors,including committed progenitors and primitive LTC-IC, which are mobilized into the circulation by rhG-CSF. In mice, on day 3 of treatment, the combinedDefibrotide/rhG-CSF injection results in WBC andPBPC counts equal to those observed after 5 days ofrhG-CSF injection, suggesting that Defibrotide additionmay decrease the frequency of administrationand total amount of rhG-CSF required for harvestingsufficient blood stem cells for transplantation. Alternatively,the combined Defibrotide/rhG-CSF mobilizationregimen may significantly increase the totaldose of PBPCs collected during a standard mobilizationprocedure in healthy donors or cancer patients.In vivo homing experiments in mice show that Defibrotideadministration reduces bone marrow homingof transplanted CFCs or CFDASE-stained Sca-1 + lin -cells while inducing their accumulation in the blood,strongly suggesting that Defibrotide-enhanced mobilizationis mediated by disruption of the recirculationof mobilized progenitors back into bone marrow,and not by an additive effect on the physiology ofrhG-CSF administration.Drugs expanding bone marrow progenitors. Humangrowth hormone (rhGH) has been shown to have aremarkable promoting activity on the in vitro growthof human erythroid and myeloid progenitors. In vivo,rhGH acts as a multilineage hematopoietic growthfactor. In mice, rhGH given for 7 days increases thenumber of splenic and bone marrow progenitor cells,as well as bone marrow cellularity. In rats, rhGH givenfor 28 days reverses age-associated loss of bonemarrow hematopoietic cells. By studying mice withimpaired bone marrow function due to aging and irradiation,we have recently shown that injection ofrhGH (2.5 mg/kg/day, i. p., for 35 days) is associatedwith: (i) reduction in the number of adipocytes andincrease in the number of marrow hematopoieticcells; (ii) significant increase (p ≥0.05) of the meanfemur CFC content with growth values approachingthose of young control animals; (iii) restoration ofrhG-CSF-elicited mobilization of PBPCs. Based onthese pre-clinical studies, the activity of rhGH inenhancing CD34 + cell mobilization elicited bychemotherapy plus rhG-CSF has been evaluated in 16hard-to-mobilize patients, i. e., those achieving a peakof circulating CD34 + cells ≤10/µL, or a collection ofCD34 + cells ≤2x10 6 /kg. Patients who had failed a firstmobilization attempt with chemotherapy plus rhG-CSF (5 µg/kg/day) were re-mobilized with chemotherapyplus rhG-CSF and rhGH (100 µg/kg/day). Ascompared with rhG-CSF, the combined rhGH/rhG-CSFtreatment induced significantly higher (p ≤. 05) medianpeak values for CD34 + cells/µL (7 vs 29), CFCs/ml(2,154 vs 28,510), and LTC-IC/mL (25 vs 511). FollowingrhG-CSF and rhGH/rhG-CSF, the median yields ofCD34 + cells per leukapheresis were 1. 1x10 6 /kg and2.3x10 6 /kg (p ≤. 008), respectively; the median totalcollection of CD34 + cells were 1. 1x10 6 /kg and6x10 6 /kg (p=0.008), respectively. No specific sideeffect could be ascribed to rhGH, except a transienthyperglycemia occurring in two patients. Reinfusionhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 20047of rhGH/rhG-CSF-mobilized cells following myeloablativetherapy resulted in prompt hematopoieticrecovery. In conclusion, our data demonstrate that inpoor mobilizers addition of rhGH to rhG-CSF allows toefficiently mobilize and collect CD34 + cells with maintainedfunctional properties. In conclusion, drugsinterfering with stem cell trafficking or cytokinescapable of expanding bone marrow progenitors arenow available and represent attractive tools to beexplored in the setting of stem cell mobilization.References1. Gianni AM, Siena S, Bregni M, et al. Granulocyte-macrophagecolony-stimulating factor to harvest circulating haemopoietic stemcells for autotransplantation. Lancet. 1989;2:580-5.2. Gianni AM. High-dose chemotherapy and autotransplants: a time forguidelines. Ann Oncol. 1997;8:933-935.3. Bensinger WI, Martin PJ, Storer B, et al. Transplantation of bonemarrow as compared with peripheral-blood cells from HLA-identicalrelatives in patients with hematologic cancers. N Engl J Med.2001;344:175-181.4. Siena S, Schiavo R, Pedrazzoli P, Carlo-Stella C. Therapeutic relevanceof CD34+ cell dose in blood cell transplantation for cancertherapy. J Clin Oncol. 2000;18:1360-1377.5. Verfaillie CM. Adhesion receptors as regulators of the hematopoieticprocess. Blood. 1998;92:2609-2612.6. Papayannopoulou T, Craddock C, Nakamoto B, Priestley GV, WolfNS. The VLA4/VCAM-1 adhesion pathway defines contrasting mechanismsof lodgement of transplanted murine hemopoietic progenitorsbetween bone marrow and spleen. Proc Natl Acad Sci (USA).1995;92:9647-9651.7. Carlo-Stella C, Di Nicola M, Magni M, et al. Defibrotide in combinationwith granulocyte colony-stimulating factor significantlyenhances the mobilization of primitive and committed peripheralblood progenitor cells in mice. Cancer Res. 2002;62:6152-6157.8. Carlo-Stella C, Di Nicola M, Longoni P, et al. Mobilization of primitiveand committed hematopoietic progenitors in nonhuman primatestreated with Defibrotide and recombinant human granulocytecolony-stimulating factor. Exp Hematol. 2004;32:68-75.9. Carlo-Stella C, Di Nicola M, Milani R, et al. Age- and irradiationassociatedloss of bone marrow hematopoietic function in mice isreversed by recombinant human growth hormone (rhGH). Exp Hematol.2004;32:171-178.10. Carlo-Stella C, Di Nicola M, Milani R, et al. Use of recombinanthuman growth hormone (rhGH) plus recombinant human granulocytecolony-stimulating factor (rhG-CSF) for the mobilization andcollection of CD34+ cells in poor mobilizers. Blood. 2004;103:3287-3295.ROLE OF NK CELL ALLOREACTIVITY IN ALLOGENEICHEMATOPOIETIC TRANSPLANTATION FOR ACUTE MYELOIDLEUKEMIARuggeri L, Capanni M, Mancusi A, Aversa F,Martelli MF, Velardi ADivision of Hematology and Clinical Immunology,University of Perugia, ItalyHLA haplotype-mismatched transplants are at riskof T cell mediated alloreactions in the host-versusgraftas well as in the graft-versus-host direction.Rejection is controlled by the conditioning regimenand “megadoses” of hematopoietic cells. GVHD isprevented by T cell depletion of the graft. 1 Thesetransplants however can rely on another type ofalloreactivity, mediated by natural killer (NK) cells,which is triggered by MHC mismatches between specificNK clones in the donor repertoire and theirinhibitory HLA class I ligands on recipient cells. 2 HCmolecules protect normal cells from NK cell-mediatedlysis. 3 The lack of expression of self MHC moleculeson target cells results in susceptibility to NKcell-mediated lysis (missing self recognition). HumanNK cells discriminate between allelic forms of MHCmolecules via clonally-distributed receptors, termedKIRs (from Killer Cell Ig-like Receptor), that are specificfor epitopes that are shared by MHC class I alleles,i. e. group 1 and group 2 HLA-C alleles, and HLA-Bw4 alleles (Table 1). As KIRs are clonally distributed,each cell in the repertoire bears a different receptoror, less frequently, two or more receptors. However,every mature NK cell expresses at least one receptorthat is specific for self HLA class I molecules. Thisensures the generation of alloreactive NK cellsbetween individuals who are mismatched for eitherone of the two subgroups of HLA-C alleles and/orthe HLA-Bw4 allele group. For example, individualswho express Group 2 HLA-C alleles and possess NKcells that express KIR specific for Group 2 HLA-C alleles(KIR2DL1) are alloreactive against cells from individualswho do not express Group 2 HLA-C alleles(who are homozygous for Group 1 HLA-C alleles).Individuals who express Group 1 HLA-C alleles possessNK cells with KIR specific for Group 1 HLA-Calleles (KIR2DL2 and/or KIR2DL3) and are alloreactiveagainst cells from individuals who do not expressGroup 1 HLA-C alleles (who are homozygous forGroup 2 HLA-C alleles) (Figure 1). In HLA haplotypemismatchedhematopoietic transplantation with apotential for GvH NK-mediated reactions, theengrafted stem cells give rise to an NK cell wave ofdonor origin which regenerates the same repertoireas the donor's, and so includes high-frequencies ofdonor-vs-recipient alloreactive NK cells. 9 Donor-versus-recipientNK cell alloreactivity reduced the risk ofleukemia relapse in 57 acute myeloid leukemia (AML)patients at high risk of relapse, while improvingengraftment and protecting against GvHD. 2Table 1. HLA-class I allele specificity of the main inhibitory KIR.KIRKIR2DL1KIR2DL2/3KIR3DL1HLA-class I specificity“Group 2” HLA-C alleles expressing Lys80(such as, -Cw2, -Cw4, -Cw5, -Cw6)“Group 1” HLA-C alleles expressing Asn80(such as -Cw1, -Cw3, -Cw7, -Cw8)HLA-Bw4 alleles (e. g. HLA-B27)haematologica vol. 89[suppl. n. 6]:september 2004

8Main ProgramAn updated analysis of transplantation outcomes of93 AML patients transplanted from haploidenticaldonors from 1993 through January 2004 demonstratestransplantation from NK alloreactive donorsenhances engraftment (rejection rate 10% in theabsence of NK alloreactivity, vs 2% in its presence),does not increase the risk of GvHD, but indeed appearsto protect from it (9% vs 3%) and exerts a remarkablecontrol of leukemia relapse. Probability of relapse is68% for the 53 patients transplanted from non-NKalloreactive donors vs 15% (p

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 20049are ubiquitously expressed, thus T cells may also targetnormal tissues leading to graft versus host disease(GvHD). Minor H antigen specific T cells are infact detectable in patients with active GvHD. 3 Inagreement with these findings, we have found thatpregnancy is able to prime minor H antigen specificT cell responses, both autosomal and anti HY (malespecific), 4 thus explaining the increased incidence ofclinical GVHD when multiparous female are used asstem cells. 5 Maximising GvL responses while minimisingany accompanying GvHD presents a majorchallenge to the more extensive application of thesetherapies. A strategy adopted in the attempt to separatethe GvL and GvHD effects, is to target minor Hantigens expressed specifically on haemopoietic tissuessuch as HA-1 and HA-2. In a skin explant assay,T cells specific for the ubiquitously expressed HYantigen were able induce high grade GvHD, whereashaemopoietic specific T cells only induced GvHDif skins were previously incubated with HA-1 andHA-2 peptides. 6 Other groups have observed thatthe infusion of T cells specific for a single immunodominantminor H antigen, irrespective of its tissuespecific expression, can eradicate leukaemic cellswithout causing GvHD. 7 Our clinical data with theuse of donor lymphocyte infusions (DLI) to treatleukaemia relapse after allografting shows that thetiming of DLI influences the occurrence and severityof GvHD. The incidence of GvHD in patients receivingDLI more than one year post transplant comparedfavourably with that of those who received DLI withinthe first year (14% and 46%, respectively). In fact,pre-transplant conditioning causes changes to gutepithelium, resulting in systemic dissemination ofbacterial endotoxins, thereby initiating a cytokinecascade (cytokine storm) producing an inflammatoryenvironment favouring GvHD. 8 We have demonstratedthat the in vitro migration of T cells in thepresence of irradiated endothelial cells is greatlyenhanced. We have confirmed these findings havebeen confirmed in vivo in animal models. An alternativeapproach to reduce GvHD rely on the exploitationof CD4 + CD25 + immunoregulatory T cells (Treg). Afew studies in murine models have documented thatTreg prevents acute GvHD. Interestingly this GvHDmodulation by donor Treg seems to occur withpreservation of the graft versus tumor effect (GvT) inmice. 9 We have observed that patients who relapseafter allografting exhibit a high number of circulatingCD4 + /CD25 + Treg. This increase is paralleled by anenhanced immunosuppressive activity in vitro. A furtherinteresting option may derive from the evidencethat mesenchymal stem cells (MSC) of bone marroworigin suppress naïve and memory T cell responses totheir cognate antigens. 10 The observed suppressionis directed at the level of T cell proliferation ratherthan effector function. The suppressive nature ofMSC together with their role in supporting hemopoiesismakes them an ideal candidate in SCT. Potentially,MSC co-infused with the haemopoietic stemcell graft could inhibit the generation of alloreactivedonor lymphocytes while facilitating engraftment.References1. Marijt WA, et al., Hematopoiesis-restricted minor histocompatibilityantigens HA-1- or HA-2-specific T cells can induce completeremissions of relapsed leukemia. Proc Natl Acad Sci USA, 2003.100:2742-7.2. Klein CA, et al., The hematopoietic system-specific minor histocompatibilityantigen HA-1 shows aberrant expression in epithelialcancer cells. J Exp Med 2002; 196:359-68.3. Mutis T, et al., Tetrameric HLA class I-minor histocompatibility antigenpeptide complexes demonstrate minor histocompatibility antigen-specificcytotoxic T lymphocytes in patients with graft-versushostdisease. Nat Med 1999; 5:839-42.4. James E, et al., Multiparity induces priming to male-specific minorhistocompatibility antigen, HY, in mice and humans. Blood 2003;102:388-93.5. Atkinson K, et al., Female marrow donors increase the risk of acutegraft-versus-host disease: effect of donor age and parity and analysisof cell subpopulations in the donor marrow inoculum. Br JHaematol 1986; 63:231-9.6. Dickinson AM, et al., In situ dissection of the graft-versus-host activitiesof cytotoxic T cells specific for minor histocompatibility antigens.Nat Med 2002; 8:410-4.7. Fontaine P, et al., Adoptive transfer of minor histocompatibility antigen-specificT lymphocytes eradicates leukemia cells without causinggraft-versus-host disease. Nat Med 2001; 7:789-94.8. Hill GR, Ferrara JL. The primacy of the gastrointestinal tract as a targetorgan of acute graft-versus-host disease: rationale for the useof cytokine shields in allogeneic bone marrow transplantation. Blood2000; 95:2754-9.9. Edinger M, et al., CD4+CD25+ regulatory T cells preserve graft-versus-tumoractivity while inhibiting graft-versus-host disease afterbone marrow transplantation. Nat Med 2003; 9:1144-50.10. Krampera M, et al., Bone marrow mesenchymal stem cells inhibit theresponse of naive and memory antigen-specific T cells to their cognatepeptide. Blood 2003; 101:3722-9.POST-TRANSPLANT IMMUNE RECONSTITUTION AFTER ANERGICLYMPHOCYTES INFUSIONRoncarolo MG, Bacchetta R, Gregori S, Battaglia MSan Raffaele Telethon Institute for Gene Therapy(HSR-TIGET), Milan, ItalyRegulatory T cells are essential for the inductionand maintenance of tolerance to self, allo and exogenousantigens. The main subsets of CD4+ regulatoryT (Tr) cells are the Type 1 regulatory (Tr1) cells and theCD4+CD25+ Tr cells. Although the mechanisms ofaction of Tr cells remain to be clarified, it is wellestablished that Tr1 cells regulate immune responsesvia an IL-10 and TGF-β-dependent mechanism. Incontrast, CD4+CD25+ Tr cells control immune homeostasismainly by cell contact-dependent interactions.Both types of Tr cells have been extensivelystudied in preclinical and clinical models, and theirtherapeutic immune modulatory potential in allo-haematologica vol. 89[suppl. n. 6]:september 2004

10Main Programgeneic transplantations was described. Severalattempts have been made to improve the outcome ofallogeneic hematopoietic stem cell transplantation,in order to cure a wide number of patients with noalternative therapies. The use of highly purified stemcells has significantly improved the myeloid cellsengraftment however, good control of GVHD andrapid and consistent immune reconstitution, remainto be achieved. Therefore, ex vivo and in vivo strategiesaimed at inducing long-term tolerance preservingAg-specific immune responses, are desired.We are investigating different approaches basedon the immunomodulatory effect of IL-10, aimed tothe adoptive transfer of regulatory T-cells in patientswho received a T-cell depleted allogeneic transplantationswith different HLA disparities.The in vivo administration of human recombinantIL-10 gave conflicting results, despite the antiinflammatorycapacity and the potent suppressiveeffect on T-cell mediated allogeneic responses of thiscytokine. This was mainly due to the fact that IL-10can affect different types of cells with both dosedependentand activation-state dependent effects.Conversely, we demonstrated that in vitro, the additionof IL-10 in primary MLR consistently inducesalloAg specific unresponsiveness in total PBMC frommismatched or haploidentical donors. IL-10 anergizedT cells preserve the ability to respond to nominalAgs, such as Tetanus toxoid and Candida albicans,and to viral Ags, such as EBV, indicating theAg-specificity of IL-10 induced anergy. The unresponsivenessobserved in proliferation is associatedwith a decreased frequency in alloAg specific CTLpand in a decreased ability of the anergized cells, comparedto untreated cells, to induce in vitro host-specificskin tissue damage. Anergized T cell culturescontain Ag-specific Tr1 cells, which are present asprecursor cells. A clinical protocol has been developedfor adoptive transfer of ex-vivo IL-10 anergizedT cells of donor origin to patients undergoing allogeneichematopoietic stem cell transplantation. Apilot clinical trial has been defined and it is currentlyongoing. Preliminary testing of the T cells from thehaploidentical donors towards their recipientsincludes anergy tests, CTLp, immune responses ofanergized cells and skin explant assays. Patientstransplanted with haploidentical hematopoietic stemcells are enrolled to receive the infusion of anergizedcells, according to a dose-escalating protocol, shortlyafter the stem cell engraftment. The number ofpatients treated is still limited and follow-up data onimmune reconstitution and incidence of GVHD arepreliminary. One of the limitations of this protocolhas been the difficulty in reaching an effectiveimmune reconstitution with the low number of cells,which can be infused across the high HLA disparity.This ex-vivo experimental protocol has been recentlyimproved by the use of recipient's immature dendriticcells (iDC) treated with IL-10 and or anti-CD45mAb, which can increase the suppressive effect ofthe anergized cultures by increasing the frequency ofinduced regulatory T cells. The use of pre-treated iDCcould lead to the advantage of infusing higher numberof cells, and therefore to a more rapid immunereconstitution.As a novel approach to obtain alloAg specific tolerancein vivo, we recently investigated the possibilityto induce Tr1 cells in vivo by using IL-10 togetherwith novel immunosuppressive drugs, which donot interfere with TCR-mediated Ag recognition, suchas rapamycin. This experimental model consists inthe combined use of IL-10 together with rapamycinto prevent organ rejection. In this model, rapamycinand IL-10 treatment induce antigen-specific Tr1 cellswhich maintain self-tolerance.Overall, these different approaches demonstratethe feasibility to modulate antigen-specific immuneresponses towards the induction of long-term tolerancevia differentiation of Tr cells.This work was partially founded by the Italian Ministryof Health and by Fondazione Telethon.References1. Cohen, JL, Trenado, A, Vasey, D, Klatzmann, D, Salomon, BL. (2002).CD4(+)CD25(+) immunoregulatory T Cells: new therapeutics forgraft-versus-host disease. J Exp Med 196, 401-6.2. Groux, H, Bigler, M, de Vries, JE, Roncarolo, MG. (1996). Interleukin-10 induces a long-term antigen-specific anergic state in humanCD4+ T cells. J Exp Med 184, 19-29.3. Groux, H, O'Garra, A, Bigler, M, Rouleau, M, Antonenko, S, de Vries,JE, Roncarolo, MG. (1997). A CD4+ T-cell subset inhibits antigenspecificT-cell responses and prevents colitis. Nature 389, 737-742.4. Jonuleit, H, Schmitt, E, Steinbrink, K, Enk, AH. (2001). Dendritic cellsas a tool to induce anergic and regulatory T cells. Trends Immunol22, 394-400.5. Levings, MK, Sangregorio, R, Roncarolo, MG. (2001). HumanCD25+CD4+ T regulatory cells suppress naive and memory T-cellproliferation and can be expanded in vitro without loss of function.J Exp Med 193, 1295-1302.6. Roncarolo, MG, Bacchetta, R, Bordignon, C, Narula, S, Levings, MK.(2001). Type 1 T regulatory cells. Immunol Rev 182, 68-79.7. Sakaguchi, S, Sakaguchi, N, Shimizu, J, Yamazaki, S, Sakihama, T,Itoh, M, et al. (2001). Immunologic tolerance maintained by CD25+CD4+ regulatory T cells: their common role in controlling autoimmunity,tumor immunity, and transplantation tolerance. ImmunolRev 182, 18-32.8. Shevach, EM. (2002). CD4+CD25+ suppressor T cells: more questionsthan answers. Nature Rev Immunol 2, 389-400.9. Taylor, PA, Lees, CJ, Blazar, BR. (2002). The infusion of ex vivo activatedand expanded CD4(+)CD25(+) immune regulatory cells inhibitsgraft-versus-host disease lethality. Blood 99, 3493-3499.10. Zeller, JC, Panoskaltsis-Mortari, A, Murphy, WJ, Ruscetti, FW, NarulaS, Roncarolo MG, Blazar BR. (1999). Induction of CD4+ T cellalloantigen-specific hyporesponsiveness by IL- 10 and TGF-beta. JImmunol 163, 3684-91.haematologica vol. 89[suppl. n. 6]:september 2004

12Main ProgramAcknowledgments: this work has been supportedby grants AIL (Associazione Italiana contro le Leucemie)and AIRC (Associazione Italiana per la Ricercasul Cancro).NEW TYROSINE KINASE INHIBITORS IN CHRONIC MYELOIDLEUKEMIAMartinelli G,* Soverini S,* Rosti G,* Cilloni D, # BassiS,* Amabile M,* Izzo B, ° Poerio A,* Castagnetti F,*Ottaviani E,* Grafone T,* Terragna C,* Renzulli M,*Testoni N,* Santucci MA,* de Vivo A,* Pane F, °Saglio G, # Baccarani M **Institute of Hematology and Medical Oncology“Seràgnoli”, University of Bologna; ° CEINGE AdvancedBiotechnologies and Department of Biochemistryand Medical Biotechnology, University of Naples“Federico II”; 3 Division of Hematology and InternalMedicine, Department of Clinical and BiologicalSciences, University of Turin; 4 Novartis Pharma, Origgio,ItalySpecific tyrosine kinase inhibitors (TKIs) are rapidlydeveloping clinical tools applied for the inhibitionof malignant cell growth and metastasis formation.As a general tumor model, the chimerical Bcr-Ablprotein expressed by chronic myeloid leukemia (CML)cells has constitutive tyrosine kinase activity. Imatinib,an ATP-competitive selective inhibitor of Bcr-Abl, has unprecedented efficacy for the treatmentof CML. The most common imatinib resistance mechanisminvolves Bcr-Abl kinase domain mutationsthat impart varying degrees of drug insensitivity. Toovercome resistance, several approaches have beenstudied in vitro and in vivo. They include dose escalationof imatinib, combination of imatinib withchemotherapeutic drugs, alternative Bcr-Ablinhibitors (TKIs), inhibitors of kinases downstream ofBcr-Abl, farnesyl and geranylgeranyl transferaseinhibitors, histone deacetylase, proteasome andcyclin-dependent kinase inhibitors, arsenic trioxidestrategies. Further investigations into the molecularmechanisms of disease and how to specifically targetthe abnormal processes will guide the design ofnew treatment modalities in future clinical trials.This review highlights the development of TKIs as aspecific molecularly targeted therapy and the principalmechanisms of TKIs resistance. Aspects of diseasemonitoring are covered as well as resistance toimatinib and strategies to overcome resistance, suchas alternative signal transduction inhibitors and drugcombinations. Perspectives for further developmentare also discussed.This study was supported by Cofin 2003 (M. Baccarani),AIL, AIRC, Fondazione Del Monte di Bolognae Ravenna, FIRB and Ateneo 60% grants.TRANSCRIPTIONAL THERAPYNervi CDepartment of Histology and Medical Embryology,University “La Sapienza” & San Raffaele Bio-MedicalScience Park of Rome, Rome, ItalyLocal remodeling of chromatin and dynamicchanges in nucleosomal packaging of DNA are keysteps in the regulation of gene expression that affectproper cell function, differentiation and proliferation.Chromatin regulators by altering gene expressionthrough chromatin modification might representnovel clinical anti-cancer drugs. Histonedeacetylation is a distinct feature of the repressedstate of gene transcription, whereas acetylation ofhistones indicates the transcriptionally active genes.Transcriptional repression of retinoic acid (RA) targetgenes due to the an aberrant recruitment of histonedeacetylases (HDACs) and DNA Methyltransferasesby the acute promyelocytic leukemia (APL)-associatedRARα-fusion proteins is the molecular eventunderlying the block at the promyelocytic stage ofmyeloid differentiation and leukemogenesis in thisacute myeloid leukemia (AML)-M3 FAB subtype. 1-3Paradoxically, APL is also the most striking clinicalsuccess of a RA-based differentiation therapy inhuman neoplasia, and has became the molecularparadigm for therapeutic approaches utilizing differentiatingagents. 1-3 Indeed, pharmacological dosesof RA can release the HDAC repressor complexand recruit the multisubunit histone acetyltransferases(HAT) activation complex on RA target genes,resulting in terminal differentiation of PML/RARαpositiveAPL blasts, which account for more than90% of APLs. 1-3 While non-APL AML subtypes arenot sensitive to retinoids, 1 an altered expression andactivity of enzymes with chromatin remodeling functionsuch as the HDACs, HATs or of their bindingpartners is present in other AML subtypes. Indeed, asa result of the t(8;21) chromosomal translocationassociated with AML-M2, the HAT-interactingdomain of the hematopoietic transcription factorAML1 is lost and replaced by region of ETO interactingwith a protein complex containing HDAC activity.The resulting AML1-ETO fusion protein also formsoligomeric structures that lead to transcriptionalrepression of AML1 an RA signaling pathways andblock of myeloid differentiation. 2,4 Furthermore, RAand nuclear hormone receptors transcriptional coregulatorswith putative HAT activities (such as p300,CBP, MOZ and TIF2), are present in chromosomalrearrangements associated with some AML cases. 5,6A structure function analysis of the MLL-CPB productof the t(11;16) translocation demonstrated thatfusion of both the bromodomain and HAT domain ofCBP to the amino portion of MLL induces full trans-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200413formation and the leukemic phenotype in vivo. 5,6 Inaddition, recent experimental evidence indicate thatthe RA signaling pathway is involved in normal andpathological myelopoiesis. 1 Functional RA responsiveelements are present in the promoter region of transcriptionfactors involved in granulocytic myelopoiesis,1 suggesting that a regulated expression ofRA responsive genes may be crucial for effectivemyeloid differentiation. In agreement, with thishypothesis are our observations indicating that inAMLs, regardless of their underlying genetic alteration,the RA-signaling pathway is constitutivelyrepressed through an HDAC-dependent mechanism.2,7,8Therefore, it appears that in AMLs differentgenetic alterations resulting in common patterns ofderegulated gene expression may lead to differentiationblock and myeloid leukemogenesis. Drugs modulatingacetylation status of histones might representa novel therapeutical approach to reprogramleukemic cells to differentiation and to eradicate theneoplastic cells. Interestingly, the global chromatinremodeling activity of these inhibitors affects onlyfew (4-10%) selected genes. 6 This specificity, alongwith the low in vivo toxicity of these compounds,raises the possibility of their clinical use. 6,9 Clinicaltrials are currently evaluating their potential use fora transcriptional therapy of neoplasia and leukemia.6,10References1. Melnick A, Licht JD. Deconstructing a disease: RARa, its fusion partners,and their roles in the pathogenesis of acute promyelocyticleukemia. Blood 1999;93:3167-215.2. Minucci S, Nervi C, Coco FL, Pelicci PG. Histone deacetylases: a commonmolecular target for differentiation treatment of acute myeloidleukemias? Oncogene 2001;20:3110-5.3. Lo Coco F, Zelent A, Kimchi A et al. Progress in differentiation inductionas a treatment for acute promyelocytic leukemia and beyond.Cancer Res. 2002;62:5618-21.4. Gelmetti V, Zhang J, Fanelli M et al. Aberrant recruitment of thenuclear receptor corepressor-histone deacetylase complex by theacute myeloid leukemia fusion partner ETO. Mol Cell Biol 1998;18:7185-92.5. Redner RL, Wang J, Liu JM. Chromatin remodelling and leukemia:new therapeutic paradigms. Blood. 1999;94:417-28.6. Johnstone RW, Licht JD. Histone deacetylase inhibitors in cancertherapy: is transcription the primary target? Cancer Cell. 2003;4:13-8.7. Ferrara FF, Fazi F, Bianchini A et al. Histone deacetylase targetedtreatment restores retinoic acid signaling and differentiation inacute myeloid leukemia. Cancer Res. 2001;61:2-7.8. Gottlicher M, Minucci S, Zhu P et al. Valproic acid defines a novelclass of HDAC inhibitors inducing differentiation of transformedcells. EMBO J 2001;20:6969-78.9. Nervi C, Borello U, Fazi F et al. Inhibition of histone deacetylaseactivity by trichostatin A modulates gene expression during mouseembryogenesis without apparent toxicity. Cancer Res. 2001;61:1247-9.10 Marks PA, Richon VM, Rifkind RA. Histone deacetylase inhibitors:inducers of differentiation or apoptosis of transformed cells. J NatlCancer Inst. 2000;92:1210-6.haematologica vol. 89[suppl. n. 6]:september 2004

14Main Programhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200415BEST ABSTRACTSBEST-01FISH DIAGNOSIS OF CIZ TRANSLOCATIONS IN ACUTE LYM-PHOBLASTIC LEUKEMIALa Starza R*, Aventin A°, Martini A, # Angioni A, @Pierini V,* Foà R, § Hagemeijer A, # Bilhou Nabera C, +Martelli MF,* Marynen P, # Mecucci C**Ematologia, Policlinico Monteluce, Università diPerugia; ° Hospital de Sant Pau, Hematology, Barcelona,Spain; # Center for Human Genetics and VIB, Universityof Leuven, Campus Gasthuisberg, Leuven, Belgium;@ Laboratory of Cytogenetics, "Bambin Gesu"Hospital, Rome, Italy; § Hematology, University "LaSapienza", Rome, Italy; + Hematology, University ofVictor Segalen Bordeaux 2, Bordeaux, FranceRearrangements of 12p13/CIZ with the TET (TLS,EWSR1, and TAF15) proteins, namely TAF15/17q11or EWSR1/22q12 identifies a clinical-hematologicalentity among acute lymphoblastic leukemia (ALL), inboth children and adults. We collected seven casesof ALL showing a t(12;17)(p13;q11) (five cases) or at(12;22) (p13;q12)(two cases). Patients with t(12;17)were males and females, aged between 4-44.Immunophenotype showed positivity for CD34and CD19 in all cases. HLA-DR and CD22 were positivein the four cases tested. In 4/5 patients at leastone myeloid antigen (CD13 and/or CD33) wasexpressed. Only the pediatric case showed expressionof CD10 in 30% of bone marrow blasts. The twopatients with t(12;22) were one male and onefemale, 4 and 29 years old, respectively. In both casesthere was a coexpression of myeloid (both CD13and CD33) antigens, and the pediatric patient wasCD10 positive. All patients achieved complete remissionafter intensive chemotherapy. Six patients arealive with a median follow-up of 48.5 months (range8-89). Appropriate diagnostic tools for metaphaseand interphase FISH were developed. BAC433J6spanning the 12p13/CIZ breakpoint in all cases isuseful for interphase-FISH investigations at diagnosisor during disease monitoring. DNA probes generatedby LD-PCR for the 5' (probe 8.2) and the 3'(probe 9.6) of CIZ are helpful to show translocationof the 5'CIZ to both der(17) and der(22), with the 3'CIZ retained on der(12). These probes were adaptedto metaphase-FISH in order to confirm 12p13/CIZinvolvement. A paradigmatic example is representedfrom one case of ALL with a t(10;12)(p12;p13) atkaryotype, in which a complex genomic changeinvolved the CIZ gene with insertion of the 5'endwithin band p13 of chromosome 19.FISH is a uniquetool to diagnose chromosomal recombinations of CIZassociated acute lymphoblastic leukemia.This work was partially supported by CNR-MIURand FIRB.BEST-02TRAIL DECOY RECEPTORS,TRAIL-R3 AND TRAIL-R4, MEDIATERESISTANCE OF ACUTE MYELOID LEUKEMIA CELLS TO TRAILRiccioni R, 1 Pasquini L, 1 Mariani G, 1 Saulle E, 1Rossini A, 1 Diverio D, 2 Pelosi E, 1 Vitale A, 2Chierichini A, 4 Cedrone M, 4 Lo Coco F, 3 Foà R, 2Peschle C, 1 Testa U 11Dipartimento di Ematologia, Oncologia e Medicinamolecolare, Istituto Superiore di Sanità, Rome;2Dipartimento di Biotecnologie Cellulari, Università“La Sapienza”,Rome; 3 Cattedra e Divisione di Ematologia,Università Tor Vergata, Ospedale S. Eugenio,Rome; 4 Divisione di Ematologia, Ospedale San Giovanni,Rome.The TNF related apoptosis-inducing ligand (TRAIL),also known as Apo2 ligand (Apo2L), is a member ofthe structurally related TNF family of cytokines. TRAILcan bind to at least four different cell surface receptors:TRAIL-R1 (also called DR4) and TRAIL-R2 (alsocalled killer /DR5) are receptors with two cysteinerichextracellular ligand-binding domains and a cytoplasmicdeath domain that signals upstream caspaseactivation, TRAIL-R3 (also called DcR1 o TRID) andTRAIL-R4 (also called DcR2 or TRUNDD) are GPIanchoredsurface receptors lacking a functionalactive intracellular death domain. These two receptorsare thought to protect cells from TRAIL-mediatedapoptosis as decoy receptors by competing withthe functionally active TRAIL R1 and TRAIL R2 forbinding to TRAIL. The unique features of TRAIL, withrespect to CD95 L and TNF-α, is considered its abilityto induce apoptosis in a variety of malignant cells,including several of hematopoietic origin, displayingno toxicity on normal cells and tissues. The antitumoractivity of TRAIL was explored in hematologicmalignancies and few studies have evaluated TRAILsusceptibility of AML cells, showing a low sensitivityof AML blasts to the cytotoxic effects of TRAIL;however, it is not clear whether the mechanism ofresistance to TRAIL is constitutive or inductive. Theaim of our study was to investigate the biologicactivity of TRAIL on AMLs and to determine themechanism of their resistance to apoptosis. In ourhands, the blasts cells isolated from the large majorityof patients with AML are resistant to apoptosisinduction of TRAIL (annexin V test), showing a peculiarexpression pattern of TRAIL receptor (TRAILRs)haematologica vol. 89[suppl. n. 6]:september 2004

16Oral Communicationsexpression. TRAILR expression was explored at proteinlevel using specific monoclonal antibodies. Wefound that TRAIL R3 and TRAIL R4 are expressed inthe majority of cases, TRAIL R1 on about 30% of cases,while TRAIL R2 only in two cases out 44 analyzed.In spite the heterogeneity of the cases analyzed,pertaining to all FAB subtypes, it is possible tocorrelate TRAILR expression pattern with differentAML subgroups. Interestingly the expression ofTRAIL-R1 is limited to AMLs with monocytic features,as supported by the presence of CD14 andCD11b antigens. AML M3 express TRAIL-R3 andTRAIL-R4 in the majority of cases, while TRAIL-R1and TRAIL-R2 were usually undetectable. MembraneTRAIL-bound was observed in the majority of APLpatients (4/5), while it was observed only in a lowpercentage of the other AML subtypes. Given theresults we explored the effect of fusion proteinPML/RAR-α on TRAIL/TRAILRs expression and on themodulation of TRAIL sensitivity. Using U937 as a cellularsystem we showed that induction of thePML/RAR-α protein in these cells was associatedwith a downmodulation of both TRAIL-R1 expressionand TRAIL-mediated cytotoxicity (i. e. , U937cells expressing PML/RAR-α became resistant toTRAIL). Treatment of APL blast with retinoic acid wasassociated with a marked downmodulation of TRAILexpression and with no modification of the sensitivityto TRAIL (i. e. , the cells remained resistant toTRAIL-mediated cytotoxicity). According to the theseresults we suggest that AMLs are resistant to TRAILdue to the expression of TRAIL decoy receptors andto the down modulation of TRAIL-R1. Furthermore,the expression of TRAIL membrane bound on the surfaceof APL blasts may confer a condition ofimmunologic privilege to these cells.BEST-03BONE MARROW STROMAL CELLS (BMSC) FROM ACUTEMYELOID LEUKEMIA PATIENTS: INTERACTION WITH NATURALKILLER CELLSPoggi A,* Negrini S,°* Massaro AM, § * Pierri I, #Balocco M, # Urbani S, & Saccardi R, & Gobbi M, #Zocchi MR §#*Laboratory of Immunology, National CancerResearch Institute, Genoa; # Clinical Hemathology,and °Laboratory of Clinical Immunology, Departmentof Internal Medicine, University of Genoa,Genoa. § Laboratory of Tumor Immunology, Departmentof Internal Medicine, IRCCS San Raffaele,Milan. & Laboratory of Bone Marrow Transplantation,Careggi Hospital, Florence; ItalyNormal blood cell differentiation needs the interactionbetween hematopoietic precursors and bonemarrow stromal cells (BMSC). It is thought thatabnormalities occurring during such interactionsmay contribute to the oncogenesis in acuteleukemias, making of interest the definition of thefunctional role of BMSC in normal hemopoiesis andneoplastic transformation. In this study, BMSC wereobtained from 10 patients suffering from acutemyeloid leukemia (AML), six M0/1 two M2, and twoM5 (according to the FAB classification), 8 out of 10in post-chemotherapy complete remission. BMSCwere obtained from all of these patients and maintainedin culture for two months. These cells wereanalysed for the expression of a panel of surfacemarkers at different culture passages (from 1 to 4).BMSC were CD44+, CD73a+ CD73b+ CD105+, β1integrin+, ICAM1+, HLA-I+, HLA-II+ (variable proportions),CD34- CD14- CD45-, CD31-, and theycould express the stress-inducible MHC-related moleculesMIC-A and the UL16 (induced at the surfaceof cells infected by cytomegalovirus) binding proteinULBP3.These molecules are reported ligands for theNKG2D receptor expressed by Natural Killer (NK) andCD8+ T lymphocytes, effector cells that are thoughtto play a role in host defence against tumors. NKcells have also been shown to regulate normal differentiationof hemopoietic precursor into themyeloid or lymphoid cell lineage. Moreover, it hasbeen stated that NK cells are not able to damageautologous cells, as they receive negative signalsthrough inhibitory receptors, including killer Ig-likereceptors (KIR) or C-type lectin inhibitory receptors(CLIR), which bind to HLA-I discrete alleles. Surprisingly,we found that autologous IL2-activated, butnot freshly isolated, NK cells lysed BMSC, while Tlymphocytes did not kill self or non-self BMSC. Bindingof ICAM-1 expressed by BMSC to its receptor,the integrin LFA-1, expressed by NK cells plays a keyrole in BMSC/NK interaction. More importantly,NKG2D/MICA and/or NKG2D/ULBP3 engagement isresponsible for the delivery of lethal hit. Conversely,it appears that HLA-I molecules do not protect BMSCfrom NK cell-mediated injury. Taken together, thesedata suggest that NK cells, when activated as it mayoccur during the first response to viral infections, areable to eliminate BMSC, thus altering the normalinteractions with hemopoietic precursors and possiblyaffecting their differentiation. This mechanismmight also contribute to the development of aberrantprecursors as observed in acute leukaemias.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200417BEST-04FIRST LIGHT AND HEAVY CHAIN VARIABLE REGION SEQUENCESOF A MONOCLONAL IgG2k CRYOCRYSTALGLOBULINNavazza V,° Perfetti V,° Giorgetti S,* Marchese L,*Palladini G,* Caporali R, # Montecucco C, # Merlini G*°Department of Internal Medicine, Internal Medicineand Medical Oncology, # Department of Rheumatology,*Biotechnology Research Laboratories,Department of Biochemistry, University of Pavia,and IRCCS Policlinico S. Matteo, ItalyCryocrystalglobulinemia is characterized by a monoclonalimmunoglobulin that is both cryoprecipitableand crystal-forming (cryocrystalglobulin). It occours inhumans as a rare complication of lymphoproliferativedisorders. The monoclonal immunoglobulins may crystallizein serum and synovial fluid and are responsiblefor both microcrystalline synovial inflammationand occlusive vasculopathy in kidneys and skin. Atpresent, there are no reports on sequence analysis andtertiary structure of human cryocrystalglobulins. Inthis study, we established the first light and heavychain variable region sequences of a human cryocrystalglobulin(BEL) from a patient with severemicrocrystalline arthropathy, cutaneous purpura andsacroiliitis. Serum cryoprecipitate was composed ofunbound monoclonal IgG∫ at immunofixation (type Icryoglobulinemia) and revealed homogeneous crystalsunder light microscopy. Extra and intracellularlycrystals were also evidenced in synovial fluid. Analysisof bone marrow aspirate showed 4% monoclonalplasma cell infiltration. Total RNA was extracted fromFicoll-separated bone marrow mononuclear cells andcomplete heavy (VH) and light chain (V∫) variabledomain sequences of monoclonal Ig were obtainedby means of an unbiased inverse-PCR strategy.Sequences were then matched in databases to identifyrearranged germline V, D and J segments. Theheavy chain sequence belonged to the ≥2 class and itsvariable region was most closely related (94% identity)to the VH3-30 germline gene (VH3 family)rearranged to D2-2 and JH4b segments, whereas theV∫ region was derived (97% identity) from thegermline V∫L6 (V∫III) rearranged to J∫5.Partial proteinsequence of serum cryoprecipitate confirmed the correctidentification of the monoclonal sequences. Apreviously reported model of murine cryocrystalglobulinemiasuggested that acquisition of positivelycharged amino acids within the VH domain (positions6 and 23) could influence cryoprecipitation. Analysisof human monoclonal IgG2∫ BEL heavy chain variabledomain did not confirm these observations. Proteinmodelling and site-directed mutagenesis studies willbe performed to clarify the role of amino acid substitutionsin immunoglobulin crystal-like aggregation.BEST-05COMPLEMENT IS REQUIRED FOR THE THERAPEUTIC ACTIVITYOF RITUXIMAB IN A MURINE B LYMPHOMA MODEL HOMING INLYMPH NODESDi Gaetano N,* Cittera E,* Nebuloni M,° Vago L,°Golay J,* # Introna M,* #*Department of Immunology and Cell Biology, IstitutoRicerche Farmacologiche Mario Negri, Milan,Italy; # Laboratory of Cellular and Gene Therapy “G.Lanzani”, Division of Haematology, Ospedali Riunitidi Bergamo, Bergamo, Italy °Institute of Pathology,Department of Clinical Sciences “L. Sacco”, Universityof Milan, ItalyThe mechanism of action of rituximab in vivo hasbeen studied using a new B lymphoma model homingin the haematopoietic tissues and lymph nodesof immunocompetent mice best mimicking humanB-NHL. The human CD20 cDNA was introduced intothe 38C13 murine B lymphoma cell line by retroviralinfection. The transduced and selected CD20 +cells stably expressed the CD20 protein and producedtumours in vivo with the same kinetics as wild typecells. Inoculation of 4×10 3 38C13-CD20 + intravenouslyinto syngeneic C3H/HeN mice led to thedevelopment of tumour masses in the spleen, bonemarrow and lymph nodes, detectable from day 15 byPCR, and with a median survival times of 22-23 days.Treatment with 250 µg rituximab i. p. given one day,or up to 10 days after tumour, cured 100% of animals,with disappearance of tumour documented byimmunohistochemitry and PCR analysis. Rituximabdid not inhibit 38C13-CD20+ cell growth in vitro.Depletion of both NK cells and neutrophils did notaffect the therapeutic activity of rituximab in vivo.Similarly removal of phagocytic macrophages usingclodronate-liposomes did not modify the capacity ofrituximab to control tumour growth. On the contrary,the protective activity of the antibody wascompletely abolished after complement depletionwith cobra venom factor. These data demonstratethat complement is required for the therapeuticactivity of rituximab in vivo in an immunocompetentmurine model of lymphoma homing in lymph nodes.haematologica vol. 89[suppl. n. 6]:september 2004

18Oral CommunicationsBEST-06NK CELL CONDITIONING TO T CELL-REPLETE MISMATCHEDBONE MARROW TRANSPLANTATION PROTECTS THYMICSTRUCTURE AND FUNCTIONBurchielli E,* Ruggeri L,* Hafen K,° Perruccio K,°Holländer G,° Velardi A**University of Perugia, Italy; °University of Basel,Switzerland.Conditioning regimens which include alloreactiveNK cells are a new strategy for improving immunereconstitution after mismatched bone marrow transplantation(BMT) as they allow for the concomitanttransfer of high doses of donor T cells without causingGVHD (Science 2002;295:2097). Even in the overtabsence of acute systemic GVHD, the NK conditioningitself, or the transfer of allogeneic T cells mightstill cause acute thymic GVHD, i. e. , damaged stroma,and impaired thymopoiesis and selection of theT cell repertoire. To test this assertion, recipient mice(H-2b) were lethally irradiated and transplanted withmismatched bone marrow cells (H-2d) in the presenceor absence of a lethal dose of allogeneic T lymphocytes(H-2d; 1.5×10 7 ). Some of the recipient micewere conditioned with irradiation and donor alloreactiveNK cells (Ly49A/G2 + , Ly49C/I-). Infusion of NKcells prevented GVHD in all recipients of T-repleteBMT, which otherwise died of GVHD. Conditioningwith NK cells followed by T-replete bone marrowtransplantation did not affect total thymocyte numbersor result in the morphological changes that aretypical of thymic GVHD, i. e. loss of the corticomedullarydemarcation, alterations in the compositionand orientation of epithelial stroma, and generalthymic involution. Analysis of intrathymic T lineagedevelopment demonstrated normal maturationalprogression from the most immature thymocytesto phenotypically mature intrathymic T cells.Examination of the relative distribution of all thymocytesubpopulations did not reveal any of thechanges commonly observed with acute thymicGvHD, i. e. , a loss of double positive thymocytes andan increase in both donor bone marrow-derivedmature T cells and immature precursor cells (Blood2000;96:347). These results demonstrate that the useof an alloreactive NK-based conditioning regimen inconjunction with the adoptive transfer of large numbersof allogeneic T cells affects neither the architecturalorganization nor the cellular composition ofthe thymic stromal compartment nor does it impairregular thymopoiesis. Conditioning with alloreactiveNK cells may, therefore, provide a safe strategy toallow for adoptive immunotherapy without endangeringthymic T cell reconstitution after mismatchedBMT.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200419Oral CommunicationsMOLECULAR HEMATOLOGYCO-01GENE EXPRESSION PROFILING OF NORMAL AND MALIGNANTCD34-DERIVED MEGAKARYOCYTIC CELLSFagioli ME, § Tenedini E,° Catani L, § Vianelli N, §Tazzari PL,* Ricci F,* Tagliafico E,° Ricci P, § Poli M, §Gugliotta L,^ Martinelli G, § Tura S, § Baccarani M, §Ferrari S°Istituto di Ematologia e Oncologia Medica “L. e A.Seràgnoli”, Università di Bologna § ; Servizio di MedicinaTrasfusionale, Ospedale S. Orsola *, Bologna;Dipartimento di Scienze Biomediche, Sezione diChimica Biologica, Università di Modena e ReggioEmilia °; Arcispedale “S. Maria Nuova”, Unità OperativaEmatologia, Reggio Emilia,^ ItalyCD34 + hematopoietic progenitor cells taken fromthe bone marrow of Essential Thrombocythemia (ET)patients and healthy subjects were induced to differentiatealong the megakaryocytic lineage in liquidsuspension cultures by continuous addition of100ng/mL of thrombopoietin. Gene expression profilesof bone marrow CD34-derived megakaryocyticcells (MKs) were compared in patients with ET andhealthy subjects utilizing oligonucleotide microarrayanalysis to identify differentially expressed genesand disease-specific transcripts. We found that proapoptoticgenes such as BAX, BNIP3 and BNIP3Lwere downregulated in ET MKs together with genesthat are component of the mitochondrial permeabilitytransition pore complex (a system with a pivotalrole in apoptosis). Conversely, anti-apoptoticgenes like IGF1-R and CFLAR were upregulated inthe malignant cells, as was the SDF1 gene, whichfavors cell-survival. Based on the array results, wecharacterized apoptosis of normal and ET MKs bytime-course evaluation of Annexin V and sub-G1peak DNA stainings of immature (day 8) and mature(day 14) MKs after culture in serum-free mediumwith an optimal thrombopoietin concentration (100ng/ml) and (Annexin V-positive MKs only) withdecreasing thrombopoietin concentrations (100, 10,1, 0.1 ng/ml). We found that ET MKs were more resistantto apoptosis than their normal counterparts. Weconclude that imbalance between proliferation andapoptosis seems to be a relevant step in malignantET megakaryocytopoiesis.CO-02MOLECULAR CHARACTERIZATION OF HUMAN HEMATOPOIETICCD34 – AND CD34 + STEM CELLSManfredini R, Zini R, Salati S, Siena M, Bianchi E,Fogli M, § Tenedini E, Tagliafico E, Catani L, § LemoliRM, § Ferrari SEDipartimento di Scienze Biomediche, Sez. di ChimicaBiologica, Università degli Studi di Modena eReggio Emilia, Modena, Italy; § Istituto di Ematologiae Oncologia Medica “L. & A. Seragnoli, Università diBologna, ItalyThe existence of murine and human CD34- lineage-(Lin-CD34-) hematopoietic stem cells (HSC)capable to engraft myeloablated hosts has recentlybeen demostrated. CD34- HSC are kinetically quiescent,can be induced to express CD34 and to proliferate,in vitro, upon cytokine treatment and theirhematopoietic activity depends on the expression ofCD34.Furthermore, xenotransplant studies haveshown that the expression of CD34 on human HSCis reversible. In this paper, we attempted to clarifythe molecular mechanisms governing the differentbiological behaviour of different subsets of HSC,according to the expression of CD34 molecule. Tothis end, we used the DNA microarray technology toevaluate the expression profile of Lin-CD34-, Lin-CD34 + and Lin + CD34 + HSC. The analysis of gene categoriesdifferentially expressed showed that theacquisition of CD34 is associated with cell cycleentry and general metabolic activation, such as DNA,RNA and protein synthesis. Moreover, the significantup-regulation in CD34- cells of pathways inhibitingHSC proliferation induces a strong differentialexpression of ciclins, CDK inhibitors and growtharrestgenes. The analysis of transcriptional factorsshows that the expression of CD34 results in the upregulationof self-renewal- and lineage-commitment-relatedgenes. The preferential expression inCD34 + cells of genes supporting the mobilization ofHSC and their homing to the bone marrow, such aschemokine receptors and integrins, gives the molecularbasis for the higher engraftment capacity ofCD34 + cells. Conversely, CD34- cells express preferentiallygenes related to neural, epithelial, and muscledifferentiation. Thus, the molecular expressionprofiles reported here contribute to a more detailedunderstanding of HSC biology and function.haematologica vol. 89[suppl. n. 6]:september 2004

20Oral Communications: Molecular HematologyCO-03GENE EXPRESSION PROFILING OF HUMAN HEMATOPOIETICSTEM CELLS AND TERMINALLY DIFFERENTIATED MYELOIDCELLSZini R, Salati S, Siena M, Bianchi E, Tenedini E,Tagliafico E, Fogli M, § Lemoli RM, § Ferrari SE,Manfredini RDip. di Scienze Biomediche, Sez. di Chimica Biologica,Università di Modena e Reggio Emilia; § Istitutodi Ematologia e Oncologia Medica “L. & A. Seragnoli”,Università di Bologna, ItalyThe comparison of the gene expression profiles ofhemopoietic stem cells (HSC) and terminally differentiatedmyeloid cells can be remarkable for the molecularreconstruction of myeloid differentiation programsand for the identification of new lineage specificmarkers. In this work we studied the geneexpression profile of CD34 + HSC and normal terminallydifferentiated myeloid cells (monocytes, neutrophiland eosinophil) using Affymetrix HG-U95Av2GeneChip array technology. The global gene expressionanalysis showed a significantly higher complexityof mRNAs in CD34 + HSC population comparedwith terminally differentiated myeloid cells.The functional analysis of the differentially expressedgenes, performed using Gene Ontology (GO) MiningTool software, revealed a general metabolic activationin CD34 + cells (activation of DNA replication,transcription and RNA processing, ribosome and proteinsynthesis), while the majority of the preferentiallyexpressed genes in mature leucocytes werefound belonging to the defense immunity GO category.According to these preliminary observations,we found a preferential expression of G1/S cyclinsand CDKs in CD34 + cells, whereas CDK Inhibitors andgenes involved in immune response, such as inflammatorycytokines and chemokines receptors, cytotoxicgranules proteins, oxidative burst enzymes,MHC class II molecules and components of INFgammapathway are up-regulated in differentiatedmyeloid cells. Moreover, we found up-regulated inCD34 + cells the expression of self-renewal and lineagecommitment-related transcription factors (TFs),whereas leucocyte samples showed a preferentialexpression of TFs involved in maintenance of the terminallydifferentiated phenotypes. This work providesa strong molecular support to essential propertiesof the HSC and of terminally differentiatedmyeloid cells; moreover, in vitro functional assayswill allow us to identify the correlations betweenchanges in gene expression occurring in the commitmentphase and the activation of the myeloiddifferentiation program.CO-04EXPRESSION OF TRANSCRIPTIONAL COREPRESSOR NCOR ORITS RECEPTOR INTERACTION DOMAIN AFFECTS LIGANDBINDING TO WILD TYPE RETINOIC ACID RECEPTOR α ANDPML/RARBrambilla D,* # Fiorini R,* # Racanicchi S, §Maccherani C, § Grignani F, § Nervi C* #*Dipartimento di Istologia ed Embriologia Medica,Università “La Sapienza” Rome; # Parco ScientificoBiomedico di Rome San Raffaele, Rome; § Istituto diMedicina Interna e Scienze Oncologiche, Universitàdi Perugia, ItalyAcute promyelocytic leukemia (APL) is associatedwith reciprocal chromosomal translocations involvingthe RARα locus with either PML or more rarelyPLZF. Such fusion proteins inhibit physisologicalretinoid signalling via the RAR/RXR pathway and thisaction is linked to their oncogenic activity which isachieved through aberrant recruitment of nuclearcorepressor molecules such as NCoR or SMRT andhistone deacetylases. A unique feature of PMLRARαexpressing APL is its sensitivity to retinoic acid (RA)therapy, which induces remission by promoting cellulardifferentiation. To investigate the molecularmechanisms of leukemogenesis by PMLRARα and ofacquired RA resistance we addressed the biologicalrole of the interaction of transcriptional regulatorswith nuclear receptors (NR). To this end we expressedthe transcriptional co-repressor NCoR or its interactiondomains (IDC and IDN) into COS-1 cells (in cotransfectionwith RARα and PML/RARα), U937(expressing RARα) and NB-4 (expressing PMLRARα).In these cells we analyzed: i) the molecular interactionsof the above mentioned molecules withradioactive RA ([H3]-RA) through HPLC; ii) theeffects on RA target promoters and iii) differentiationstatus. An IDC with three aminoacids mutatedto alanine in the receptor interaction domain (IDCmut10)or an antisense IDN (IDNAS) were also usedas controls. The results obtained showed that theover-expression of NCoR or of IDC, its domain thatinteracts with the nuclear receptors, stronglyincreases the RA-binding to RARα and PML/RARα.Moreover, IDC increased PMLRARα binding toretinoic acid also when stably transfected into U937induced to express PMLRARα (U937-PR9). In contrast,the over-expression of IDN (another NCoRdomain that interacts with nuclear receptors), IDCmut10,IDNAS and of transcriptional co-activatorsTIF2 and NSD1 did not significantly modifiy thecapacity of RARα and PML/RARα to bind RA. NCoR,IDC and IDN, modified the conformation of the RAreceptors, as shown by tryptic digestion patterns ofRARand PML/RARα. In vitro binding assays with GSThaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200421and his-tagged fusion proteins confirmed these invivo results. In fact, IDC-his peptide caused a dosedependent increase in GSTRAR binding to [ H 3]-RA.The same result was obtained when a SMRT receptorinteraction domain (GSTIDII) was used, while theSMRT PLZF interaction domain (GSTPID2) or an emptyhistidine vector did not modify RA binding pointingout the specificity of this effect. IDC, when transientlytransfected into the NB4 or U937 cell lines,increases the RA induced transcriptional activity ofa Luc-reporter gene controlled by a β-RARE. Insteadthe transient transfection of NCoR or IDN slightlychange this transcriptional activity. Finally, NB4-R4cells (an NB-4 clone resistant to RA) transfected withIDC overcome the differentiation block and are ableto differentiate following RA treatment. Our datahighlight a novel role for transcriptional corepressorsor peptides representing their interaction domainsin modulating ligand binding to nuclear receptors.These results help to analyse the molecular eventsinvolved in RA resistance and in aberrant nuclearreceptor interactions, in order to elucidate new therapeuticalstrategies for handling leukemias characterizedby aberrant NRs.CO-05THE COMBINATION WITH MEK1 INHIBITOR ENHANCESARSENIC TRIOXIDE INDUCED APOPTOSIS OF ACUTE LEUKEMIABLASTSLunghi P,* Lo Coco F,** Salvatore L,* Noguera N,**Tabilio A,° Pelicci PG,°° Bonati A,**Dipartimento di Scienze Cliniche, Università di Parma;**Dipartimento di Biopatologia, Università diRome "Tor Vergata"; °Dipartimento di Medicina Clinicae Sperimentale, Università di Perugia; °°Dipartimentodi Oncologia Sperimentale, Istituto Europeodi Oncologia, Milan, ItalyAccording to recent laboratory studies, the blastcells of most acute myelogenous leukemias (AML)including acute promyelocytic leukemia (APL) showconstitutive activation of extracellular signal-regulatedkinases 1/2 (ERKs 1/2) as well as of the kinasesimmediately upstream of ERK, known as mitogenactivatedprotein (MAP)/ERK kinases (MEKs). Furthermore,we and others have demonstrated thatdown-modulation of MEK1 phosphorylation inhibitsthe proliferation and induces apoptosis of primaryAML blasts. In this study, we firstly aimed at investigatingwhether the combination of arsenic trioxide(ATO) with agents that block the phosphorylation ofMEK1 can potentiate the anti-leukemic action ofATO in APL. We then investigated whether this combinationis capable to enhance apoptosis of non APLacute leukemia primary blasts. For our purposes westudied parental NB4 cell line, an arsenic-resistantNB4 subline (NB4-AsR) derived in our laboratoryfrom the NB4 cell line, primary blast cells of typicalhypergranular APL (M3) carrying PML/RARα fusiontranscript, primary blast cells of AML (M1 or M2)carrying 47, XX, +8 or 46, XX inv (16), of acute monocyticleukemia (M5), of acute lymphocytic leukemiacarrying 46, XX, del (11)(q23). Leukemic cells werepre-treated with PD98059 (Cell Signaling Technology,Beverly, MA, USA) 10, 20 or 40 microM orPD184352 (kindly provided to us by Dr J. S. Sebolt-Leopold, Cancer Molecular Sciences, Pfizer GlobalResearch & Development, Ann Arbor, MI, USA) 1 or2 µM, and then treated with ATO 0.5-2 µM. Wefound that leukemia cells exploit the Ras-MAPK activationpathway to phosphorylate at Ser112 and toinactivate the pro-apoptotic protein Bad, delayingATO-induced apoptosis. Both in APL cell line NB4and in primary blasts, the inhibition of ERK1/2 activityand of Bad phosphorylation by MEK1 inhibitorsenhanced and accelerated apoptosis in ATO-treatedcells. NB4-AsR showed stronger ERK1/2 activity (2.7 fold increase) and Bad phosphorylation (2.4 foldincrease) compared to parental NB4 cells in responseto ATO treatment. Upon ATO exposure, both NB4 andNB4-AsR cell lines doubled protein levels of thedeath antagonist Bcl-xL but the amount of free BclxLthat did not heterodimerize with Bad was 1.8 foldgreater in NB4-AsR than in the parental line. MEK1inhibitors dephosphorylated Bad and inhibited theATO-induced increase of Bcl-xL, overcoming ATOresistance in NB4-AsR. Synergism, additive effects,and antagonism were assessed using the Chou-Talalay method and Calcusyn software (Biosoft, Ferguson,MO). PD + ATO combination synergized forthe induction of apoptosis primarily in arsenic resistantbut also in parental NB4 cells. Furthermore, thecombination PD + ATO significantly increased theATO-induced apoptosis in primary acute leukemiablasts (p

22Oral Communications: Molecular Hematologytosis in cancer cells is based on their degradation/inactivationand/or abnormal signal transductionpathways that activate anti-apoptotic programs.The constitutive active PI3K/Akt and NF-kB pathwaysmediates strong anti-apoptotic signals in manycancer cells. NF-kB is dimeric protein composed ofmembers of the Rel/NF-kB family, including RelA,RelB, c-Rel, p50 and p52. NF-kB dimers are retainedinto the nucleus by the inhibitory protein IkB. Differentstimuli determinates IkB phosphorylationwhich is ubiquitinated and degradated by the 26Sproteosome. Free NF-kB translocates into the nucleuswhere it controls transcription of genes involvedin transformation and protection of apoptosis. CMLis a myeloproliferative disorder characterized by theexpression of the t(9;22) translocation which encodefor the chimeric fusion protein Bcr-Abl. The developmentof the specific inhibitor of the kinase activityof Abl, Imatinib, has completely revolutionizedthe therapy and the prognosis of the chronic phaseof CML. Unfortunately, Bcr-Abl inhibition does notaffect the blast phase of the disease, where traditionalchemotherapy appear to be the only therapeuticalapproach. K562 is a cell line derived from aCML blast crysis which is particularly resistant tomany traditional chemotherapeutic agents such asthe topoisomerase inhibitor Etoposide. In this workwe have first evaluated whether the exposure toEtoposide activates NF-kB in K562. Cells have beentreated with Etoposide for 2 hours and then nuclearextract have been obtained. The transcriptionalactivity of NF-kB has been evaluated with an ELISAmethod that quantified the binding of nuclear NF-kBto its specific DNA binding motif. NF-kB bindingactivity is increased of 2.1 and 3.2 times when cellsare exposed to 10 and 100 microM of Etoposiderespectively. When cells have been pretreated withthe NF-kB inhibitors Resveratrol (30 µM), MG-132 (1µM) and Bay (5 µM), NF-kB has not been activatedby Etoposide. When K562 are exposed to 100 µMEtoposide, apoptosis (evaluated with a Cell DeathDetection ELISA method, which quantified therelease of histone-bound DNA)is un-detectable. Theexposure to the NF-kB inhibitors MG-132, Bay andwith a less extent to Resveratrol determinates amoderate induction of apoptosis. Treatment withboth NF-kB inhibitors and Etoposide causes a markedincrease of apoptosis. To prove that NF-kB inhibitionis the causal mechanism by which cells becomes sensitiveto Etoposide induced apoptosis, we have developeda stable K562 cell line expressing a SuperRepressor-IkB.SR-IkB is a mutated IkB protein whichcan not be degraded. This stable IkB blocks NF-kB inthe cytoplasm. In SR-IkB stable cell lines, Etoposidedoes not activate NF-kB and acts as an apoptosisinducer. These data suggest that the activation ofNF-kB may be responsible of the resistance to Etoposideinduced apoptosis in K562 cell line and that NFkBinhibitors may restore sensitiveness to this conventionalcytotoxic agent.CO-07EVIDENCE OF BIASED USAGE OF IMMUNOGLOBULIN VARIABLEGENES IN AIDS-RELATED NON-HODGKIN'S LYMPHOMA: IMPLI-CATION FOR THE PATHOGENESIS OF THE DISEASEBerra E, 1 Cerri M, 1 Gloghini A, 2 Deambrogi C, 1 RossiD, 1 Franceschetti S, 1 Larocca LM, 3 Carbone A, 2Gaidano G, 1 Capello D 11Hematology Unit, Department of Medical Sciences,Amedeo Avogadro University of Eastern Piedmont,Novara; 2 Division of Pathology, C. R. O. -I. N. T. ,Aviano; 3 Institute of Pathology, Catholic Universityof the Sacred Heart, Rome, ItalyNon-Hodgkin's lymphomas (NHL) represent a frequentcomplication of HIV infection and a majorsource of morbidity and mortality among AIDSpatients.AIDS-related NHL (AIDS-NHL) derive frommature B-cells and are phenotypically and histogeneticallyrelated to germinal center (GC) or post-GCB-cell. AIDS-NHL are classified into: (i) diffuse largeB-cell lymphoma (AIDS-DLBCL); (ii) Burkitt/Burkittlikelymphoma (AIDS-BL/BLL); (iii) plasmablastic lymphomaof the oral cavity (AIDS-PBL); and (iv) primaryeffusion lymphoma (AIDS-PEL). Analysis of immunoglobulinvariable (IgV) genes used by B-cell malignanciesreveals the cell origin of the tumor and itsclonal history following neoplastic transformation.Here we investigated a panel of 67 AIDS-NHL,including 30 AIDS-DLBCL, 21 AIDS-BL/BLL, 6 AIDS-PEL and 10 AIDS-PBL for usage, mutation frequencyand intratumoral heterogeneity of clonal IgVrearrangements. Moreover, to ascertain the role ofantigens and/or superantigens in AIDS-NHL pathogenesis,we analyzed the mutational pattern andCDR3 structure of IgV heavy (H) and light (L) chaingenes. Results where compared to a database of 200DLBCL IgV rearrangements and to the normal B-cellrepertoire. A functional IgVH rearrangement wasfound in 58/65 (89.2%) cases, a functional IgVκchain rearrangement was identified in 17/38 (44.7%)cases and a functional IgV lambda chain rearrangementin 21/38 cases (55.3%). Despite exhaustiveanalysis by multiple PCR strategies, 10% of casesshowed only non functional IgVH and/or IgVLrearrangements, suggesting a cellular origin from B-cells that have lost the ability to express antigenreceptors. Somatic mutations in IgVH and/or IgVLgenes were found in 58/67 (88.1%) AIDS-NHL. Theaverage mutation frequency was 9.42% (median7.50%, range 2.04-23.3%) for IgVH genes and 5.42%haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200423(median 4.20%, range 2.01%-12.5%) for IgVL genes.Unmutated cases included 1/30 AIDS-DLBCL and6/10 AIDS-PBL. IgV germline rearrangements selectivelyassociated with AIDS-PBL (p

24Oral Communications: Hematopoietic Growth FactorsOral CommunicationsHEMATOPOIETIC GROWTH FACTORSCO-09EXTRACELLULAR UTP AFFECTS IN VITRO MIGRATION AND INVIVO HOMING AND ENGRAFTMENT OF CD34 + HEMATOPOIETICSTEM CELLSRossi L,* Fogli M,* Ferrari D,° Pizzirani C,° Vaselli D,°Bertolini F,^ Di Virgilio F,° Baccarani M,* Lemoli RM**Institute of Hematology and Medical Oncology “L.& A. Seràgnoli”, University of Bologna. °Departmentof Experimental and Diagnostic Medicine, Sectionof General Pathology, and Interdisciplinary Centerfor the Study of Inflammation (ICSI), University ofFerrara. ^Department of Hematology and Oncology,European Institute of Oncology, Milan, ItalyRegulatory mechanisms governing homing andengraftment of hematopoietic stem cells are poorlyunderstood: they depend on a complex interplaybetween chemokines, cytokines, growth factors andadhesion molecules in the intricate architecture ofbone marrow microenvironment. Extracellularnucleotides were recently reported as potent proliferativefactors for hematopoietic stem cells; they arealso emerging as chemotactic factors for differentcell types, including vascular endothelial cells, arterialsmooth muscle cells and neutrophils; they alsoregulate the trafficking of specific dendritic cell populations.In this study we asked if the extracellularnucleotide UTP would modulate the migration ofhematopoietic stem cells in response to the chemotacticpeptide CXCL12/SDF-1α. Very low concentrationof UTP (at 10 µM) significantly improved stemcell migration, assayed with the dual-chambermigration system and evaluated with cell countingand clonogenic assays. Phenotypical analysis ofCXCR4 antigen showed that SDF-1a gradients mainlyattract hematopoietic stem cells expressing highlevels of this receptor; whereas, migrating cells, previouslytreated with UTP, showed no substantial differencesin CXCR4 level, compared to non-migratingcells. Furthermore we evaluated actin polymerizationas index of stem cell capacity to respond tochemotactic stimulation and to home to the BMmicroenvironment. UTP-treated CD34 + cells, oncestimulated with SDF-1α, showed a significantincrease in actin polymerization, as indicated by theenhanced fluorescence intensity of FITC-phalloidin.Moreover, xenogenic transplant studies showed thatshort-term pre-incubation with UTP significantlyincreased engraftment efficiency in nonobese diabetic/severecombined immunodeficiency mice. Takentogether, our data suggest that UTP may affectHSC migration and homing in the bone marrow, insynergy with the chemotactic peptide SDF-1α, perhapsactivating a CXCR4-indipendent pathway.CO-10BIDIRECTIONAL NKG2D RECEPTOR-NKG2D LIGAND MEDIATEDCROSS TALK BETWEEN CD34 + BLOOD CELLS AND NK CELLSNicolini B,* Arpinati M,* Urbini B,* Perrone G,*Chirumbolo G,* Baccarani M,* Rondelli D°*Research Center for Transplant Immunology, Instituteof Hematology and Medical oncology "Seragnoli",University of Bologna, °Section of Hematology/Oncology,University of Illinois at Chicago, Illinois,USAIt has been previously demonstrated that purifiedCD34+ cells induce allogeneic T cell proliferation andgeneration of cytotoxic T cells. In this study, weaddressed the hypothesis of whether CD34 + cells mayactivate also NK cells. To test whether CD34 + cellscould directly activate NK cells, immunomagneticallypurified CD3 − CD56 + NK cells were cultured witheither purified allogeneic CD34 + or CD14 + cells, at aratio of 1:1 to 2:1, or with high dose (1000 U/ml) IL-2 for 3-4 days. NK activity was evaluated as theirability to induce the lysis of either NK-sensitive K562or NK-resistant Daudi target cells in a standrad Cr51lysis assay. CD34 + cells induced significantly greaterNK activation than monocytes, as measured as lysisof K562 cells (50±14% vs 15±17%, respectively)(n=4, p=0.02). We then tested whether coculture ofpurified NK cells with CD34 + cells would result in thelysis of NK-resistant Daudi cells (LAK activity). WhileLAK activity was negligible before culture, it substantiallyincreased upon culture with CD34 + cells,but not monocytes (53±11% and 22+/16%, respectively)(n=6, p=0.01). Interestingly, CD34 + cell primingwas comparable to the addition of high dose IL-2 (at 1000 U/ml) that induced a lysis of 49±3% at aE/T ratio of 10:1 (n=4) (p=0.22). NK cells culturedwith CD34 + cells produced greater amounts of IFNgand TNFa as compared to monocytes (500 pg/mL and125 pg/mL vs 50 pg/ml and less than 5 pg/ml).CD34 + -induced NK activation was prevented by anti-NKG2D antibody (mean lysis with anti-NKG2D was10±9% as compared to 46±12% with CD34 + cells(p=0,02,n=3) whereas a blocking anti IL-2 antibodyhad no effect, suggesting that NK cell activation byCD34 + cells involved signaling through NKG2D. Thiswas further confirmed by the observation thatNKG2D was downregulated upon stimulation byCD34 + cells (from >80% before culture to

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200425after coculture with CD34 + cells, n=2 experiments).Furthermore, inhibition of lysis was not due to thepersistence of anti-NKG2D antibody on the surfaceof NK cells as shown by the lack of binding of goatanti mouse IgG on NK cells that had been culturedwith anti-NKG2D. We then evaluated the expressionof NKG2D ligands (MICA and B and ULBP-1, -2 and-3) on the surface of CD34 + cells before and afterculture with either TNFα, GM-CSF and TNFα or purifiedNK cells for 48-72 hrs. Neither MICA/B nor ULBPmolecules were detected on fresh CD34 + cells. Culturewith TNFα, with or without GM-CSF, was notassociated with expression of either NKG2D ligand,whereas purified NK cells induced significant expressionof MICA/B (mean MFI 11+7, n= 3 experiments)but not ULBP (MFI consistently

26Oral Communications: Hematopoietic Growth Factorsfeasibility and efficacy of combining BM-derivedprogenitor cell mobilization with surgical revascularizationaccording to Sen technique. Preliminaryresults obtained in 8 patients with end-stage cardiacfailure are here summarized. Eligibility criteriaincluded: i. age >18 and < 80 yrs. ; ii. coronary arterydisease and severe cardiac failure, with Left VentricularEjection Fraction (LVEF) less than 35%; iii. noneligibility to cardiac transplantation; in addition,patients had to be candidate to a coronary arterybypass graft (CABG) or to any other cardiac surgeryprocedure. Mobilization was induced by the combinedadministration of G-CSF 5 mcgr/kg s. c. b. i. d.+ GM-CSF 2.5 mcgr/kg s. c. /day for 4 to 6 consecutivedays. Surgery was planned at day 4 or 5,according to the level of circulating progenitors. Thestudy has been approved by the local Ethical Committeeand all patients gave a written informed consentbefore entering the study program. So far, eightpatients (6 males, 2 females; median age: 65 yrs,range: 46-75) with refractory, end-stage heart failurereceived the combined procedure. All patientshad had one or more previous myocardial infarction.The surgical procedure included a CABG (7 patients)or a mitral valve replacement (1 patient), associatedwith transmyocardial needle punctures inungraftable fibrotic areas. The areas of scarificationwere identified according to the scintigraphic andechocardiographic finding of death myocardium notsuitable for CABG. Preoperative mobilization inducedan increase in the amount of circulating hematopoieticprogenitors in all patients. Maximal values ofcirculating progenitors were recorded at day 4 ofcytokine administration, with a median peak value of20 CD34 + ve cells/microL (range: 9-67). No deathoccurred in the operative period (0-30 days) and allpatients were discharged from the hospital. Onepatient had a non-fatal ischemic stroke few daysafter discharge due to cerebral embolism secondaryto intraventricular thrombus; in addition, 2 late suddendeaths occurred at 1 and 3 months since theprocedure. At a median follow-up of 16 mos. fromsurgery, 6 patients are alive, 5 of them with markedimprovement in their LVEF. Radionuclide scan examinationshowed improvements in each evaluatedregional seat including the ungrafted areas The studydemonstrates the feasibility of an innovative procedure,combining BM-derived cell mobilization andtransmyocardial scarification. Preliminary results arepromising in terms of improvement of the myocardialfunction. A prolonged follow up in a large seriesof patients is required to define the efficacy of theprocedure.CO-13INTERLEUKIN-21 SYNERGIZES WITH INTERLEUKIN-15 IN PRO-MOTING THE EXPANSION AND NK-CELL DIFFERENTIATION OFCD34-LINEAGE HEMATOPOIETIC STEM CELLSRutella S,*° Bonanno G,^° Contemi AM,* Procoli A,^Mariotti A,^ De Ritis DG,*° Scambia G,^° MancusoS,^° Pierelli L,*°° Leone G*°*Department of Hematology, °UNICATT Cord BloodBank and ^Department of Gynaecology and Obstetrics,Catholic University Medical School, Rome;°°Department of Immunohematology and BloodTransfusion, Viterbo, ItalyHematopoietic stem cells (HSCs) can be operationallydefined by their ability to give rise to precursorsfor the different hematopoietic lineages.Recently, attention has been focused on the existenceof HSCs within the heterogenous compartmentof CD34-lineage- cells. The common γ-chainsignallingcytokines interleukin (IL)-15 and IL-21 candirect the transition from CD34 + HSCs to NK-cellprecursors (NKP). Previously, we demonstrated thathighly purified CD34(-)lineage(-) HSCs from umbilicalcord blood (UCB) differentiate towards the lymphoid/NK-celllineage after in vitro exposure to IL-15in the presence of a stromal cell feeder layer (RutellaS. J Immunol 2003;171:2977). In the present study,we assessed the effects of the closely relatedcytokine IL-21 on NK-cell maturation from UCBCD34(-)lineage(-) HSCs maintained in liquid culturefor up to 50 days. Highly purified CD34 − CD7(-)lineage(-)HSCs were cultured with SCF (20 ng/mL) +Flt-3L (20 ng/ml) either in the presence or in theabsence of either IL-21 (20 ng/mL) or IL-15 (50ng/mL) or the combination of both cytokines. Theacquisition of non-MHC restricted lytic activityagainst tumour cell targets was evaluated using NKsensitive(K562 cells) or NK-resistant (Raji cells) celllines that were co-cultured with graded numbers ofcytokine-differentiated HSCs. IL-21 potentiated theIL-15-induced cell expansion but exerted minimaleffects when used alone. By day +30 of culture,CD34(-)lineage(-) HSCs were expanded 49.04-foldby IL-21 and IL-15 in combination, compared with28.48-fold in cultures performed with IL-15 aloneand with 2.8-fold in cultures maintained with IL-21alone (Table 1). Interestingly, exogenous TGF-β at 5ng/ml significantly inhibited the cytokine-driven proliferationof CD34(-)lineage(-) HSCs (Table 1), inaccordance with previous data on the role of TGF-βin the maintenance of HSC quiescence (Pierelli L.Blood 2000;95:3001). When compared with cellsexposed to IL-15 or IL-21 alone, HSCs primed withIL-21 and IL-15 significantly upregulated the expressionlevels of the T-cell associated antigen CD7, bothin terms of percent positive cells and in terms of flu-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200427orescence intensities. Similarly, the NK-cell-associatedantigens CD56 and NKp46 were detected onhigher percentages of IL-15+IL-21-conditioned HSCswhen compared with IL-15- or IL-21-primed HSCs.Notably, HSCs maintained an immature-like NK phenotype,as evaluated through the expression of CD94and CD16 antigens. KIR acquisition was polyclonal;however, CD158a and CD158b antigens were detectedon a significantly lower percentage of IL-21+IL-15-primed HSCs compared with IL-15-conditionedcells. HSCs differentiated with IL-21 and IL-15 aloneor in combination and further activated with 400IU/ml IL-2 for 72h acquired low but measurable lyticactivity against NK-sensitive K562 cells (averagespecific lysis at 1:10 effector:target ratio = 6% for IL-21+IL-15-primed cells, 9% for IL-21-primed cellsand 8% for IL-15-primed cells). As expected, no lysiscould be demonstrated against NK-resistant Rajicells. Collectively, we demonstrated that IL-21 cansynergize with IL-15 in promoting the generation ofpseudomature CD16 − CD56 ++ KIR low NKP cells fromUCB CD34 − lineage HSCs in the absence of any stromal-cellsupport. Whether in vitro generated, UCBderived,cytokine-expanded NKP may be useful tofight infections, tumors and autoimmunity remainsto be determined.Cytokine combination Fold-expansion (Day +30)SCF + Flt-3L 2.79SCF + Flt-3L + IL-15 28.48SCF + Flt-3L + IL-21 2.8SCF + Flt-3L + IL-15 + IL-21 49.04SCF + Flt-3L + IL-15 + IL-21 + TGF-beta 19.25Data represent median values recorded in 3 independent experiments performed in duplicate.CO-14MAFB OVER-EXPRESSION PROMOTES MONOCYTIC DIFFEREN-TIATION OF CD34 + HEMATOPOIETIC STEM / PROGENITORCELLSGemelli C, Grande A, Montanari M, Zanocco-Marani T, Vignudelli T, Ferrari SUniversity of Modena and Reggio Emilia, Departmentof Biomedical Science, ItalyA large number of reports indicate that commitmentof hematopoietic stem cells (HSCs), along precisedifferentiation lineages, is the consequence ofspontaneous or exogenously induced up-regulationof specific transcription factors. 1,2 Recent studieshave demonstrated the capacity of MafB transcriptionfactor to promote monocytic differentiation ofMyb-Ets transformed avian hematopoietic progenitors.3 MafB is a member of the Maf basic region/leucine zipper transcription factor family and is characterizedby a common carboxy-terminal portionbearing a basic region/leucine zipper domain mediatingDNA binding and homo- and hetero-dimerassembly and by an amino-terminal transactivationdomain. All Maf family members display bindingactivity to a common DNA sequence (MARE, MafRecognition Element), and can either activate orrepress transcription depending on the interactingdimerization partner. 4 In spite of the evidence thatMafB behaves as a determinant of monocytic commitmentin transformed avian hematopoietic progenitors,a clear demonstration of the possible roleplayed by this transcription factor in human normalmonocytopoiesis is still to be established. Based onthis premise the MafB full length cDNA sequencewas cloned in the LXIDELTAN retroviral vectorupstream the Internal Ribosomal Entry Site (IRES)allowing its expression in the context of a bi-cistronictranscript coding for a truncated version of lowaffinity nerve growth factor receptor (DELTAlNGFR),currently used as reporter gene for hematopoieticcells. The obtained retroviral vector, named LMaf-BFLIDELTAN, was used to transduce U937 and THP1human monoblastic cell lines, and human cord blood(hCB) CD34 + hematopoietic stem/progenitor cells.The extent of mono-macrophagic differentiation wassubsequently monitored by morphological andimmunophenotypic analysis. To characterize thegenetic program induced by MafB over-expressionwe also assessed mRNA expression profile in transducedU937 by means of the Affymetrix microarrayapproach. Preliminary results evidenced that retroviralmediated MafB expression lead to inductionmonocyte differentiation antigens (CD14 and CD11b)in U937 and THP1 cells. In addition, morphologicalanalysis performed by MGG staining on MafB transducedand purified U937 cells showed that thesecells assume a monoblast-promocytic morphology.Microarray analysis, performed by comparing transducedto untransduced U937 cells, indicated thatMafB transcription factor hyper-expression lead toinduction of typical differentiation and activationmono-macrophage markers. To verify these data, wepurified hCB CD34 + stem/progenitor cells, transducedthem with the analyzed retroviral vector using aretronectin-assisted protocol, and analyzed theextent of mono-macrophage differentiation byimmunophenotipic and morphological analysis. Atday 7 of culture cells transduced with the LMaf-BFLIDN retroviral vector exhibited a 55±5% expressionof CD14 monocyte-specific antigen versushaematologica vol. 89[suppl. n. 6]:september 2004

28Oral Communications: Hematopoietic Growth Factors13±1% of untransduced NGFR negative control cells.MGG staining of transduced / purified CD34 + , performedat day 14 of culture, displayed a clearmacrophagic morphology as compared to theuntransduced fraction mainly chracterized by elementsbelonging to the granulocyte differentiationlineage.References1. Orkin SH. Diversification of haematopoietic stem cells to specific lineages.Nat Rev Genet 2000;1:57-642. Tenen DG, Hromas R, Licht JD, Zhang DE. Transcription factors, normalmyeloid development, and leukemia. Blood 1997;90:489-519.3. Louise MK, Englmeier U, Lafon I, Sieweke M, Graf T. MafB is aninducer of monocytic differentiation. Embo J 2000;19:1987-97.4. Kataoka K, Fujiwara KT, Noda M, Nishizawa M. MafB, a new Maffamily transcription activator that can associate with Maf and Fosbut not with Jun. Mol Cell Biol 1994; 14:7581-91.CO-15INCUBATION OF MURINE ERYTHROLEUKEMIA CELLS IN SEVEREHYPOXIA INDUCES MASSIVE APOPTOSIS PARALLELED BY AKTAND ERK5 CLEAVAGEGiuntoli S, Rovida E, Barbetti V, Gozzini A,°Dello Sbarba PDipartimento di Patologia e Oncologia Sperimentali,Università di Firenze e ° Divisione di Ematologia, Universitàdi Firenze, Policlinico di Careggi, ItalyWe previously showed that severe hypoxia (0.1%O2) favours the self renewal of murine and humannormal haematopoietic stem cell. The importance ofhypoxia in the regulation of neoplastic stem cellsalso recently emerged. This study was undertaken tocharacterize the effects of hypoxia on a murine erythroleukemiacell line. To this purpose, Friend erythroleukemiacells were incubated in severe hypoxia(0,1% O2) or normoxia (20% O2) for 7 days; cellsincubated in hypoxia (LC1) were then transferred tonormoxia (LC2), to determine their potential foroverall cell number expansion. The colony-formationefficiency of day-7 hypoxic cultures was unreducedwhen compared to that of normoxic cultures; however,the incubation in hypoxia during LC1 reducedcell proliferation rate after transfer to normoxia(LC2). The effects of hypoxia at different incubationtimes were determined with respect to cell cycle andviability. Total cell number was found stronglyreduced after 3 days of incubation in hypoxia whencompared to normoxia. The Annexin-V test showedthat hypoxia doubled the percentage of cells in earlyas well as late apoptosis. At the end of LC1 (day-5/6) almost all cells were in late apoptosis, while survivingcells (2%) were in a quiescent state (G0- G1phase of cell cycle), as demonstrated by flow cytometry.Several molecular parameters were investigatedin hypoxic cultures. Hypoxia was found to interferewith the AKT and ERK5 signalling systems. AKTcleavage, as determined by AKT disappearance andappearance of 40-44 kDa AKT fragments, wasmarked at day 3 of incubation in hypoxia, to increasesignificantly thereafter. Active (threonine/tyrosinephosphorylated) ERK5 was markedly reduced at day3 in hypoxia, to disappear at day 6.On the other hand,the expression itself of ERK5 was significantlyreduced already after a 1-day incubation in hypoxia;the downmodulation of ERK5 was paralleled bythe appearance of a cleaved 30 kDa ERK5 fragment.Under the same conditions, the amount of ERK1/2 inhypoxia was unchanged. These results suggest thatAKT and ERK5 are pro-survival signals in these cellsand are specifically cleaved in hypoxia-inducedapoptosis. The effects of hypoxia on histone acetylationwere also determined. We observed that histoneH4 was hypo-acetylated at day 3, suggestingthat incubation in hypoxia interferes with transcriptionalregulation.CO-16INVOLVEMENT OF THE UROKINASE-TYPE PLASMINOGENACTIVATOR RECEPTOR IN HEMATOPOIETIC STEM CELLMOBILIZATIONSelleri C,* Montuori N,° Ricci P,* Visconte V,°°Carriero MV,** Sidenius N,^ Serio B,* Blasi F,^Rossi G,° Ragno P,° Rotoli B**Division of Hematology, °Institute of ExperimentalEndocrinology and Oncology (National ResearchCouncil) and °°Department of Cellular and MolecularBiology and Pathology, “Federico II” University ofNaples; **National Cancer Institute, Naples, Italy;^Molecular Genetics Unit, Department of Cell Biologyand Functional Genomics, University “Vita-Salute San Raffaele”, Milan, ItalyGranulocyte colony-stimulating factor (G-CSF), assingle agent or in combination with cytotoxic drugs,is widely used in clinical transplantation to inducehematopoietic stem cells (HSC) mobilization intoperipheral blood. Recently, some reports have shownthe involvement of the urokinase-mediated plasminogenactivation system and, in particular, of theurokinase-type plasminogen activator (uPAR) receptorin cell migration and adhesion. We investigatedthe involvement of uPAR in G-CSF-induced mobilizationof CD34 + HSC from 16 healthy donors. Theanalysis of peripheral blood mononuclear cells (PBM-NC) showed increased uPAR expression after the G-CSF treatment in CD33 + myeloid and CD14 + monocyticcells, whereas the mobilized CD34 + HSChaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200429remained uPAR-negative. Western blot analysis witha polyclonal anti-uPAR antibody confirmed a progressiveincrease of uPAR expression in all donorsduring G-CSF stimulation and showed that PBMNCexpressed only the intact form of uPAR. G-CSF-treatmentalso induced increased serum levels of solubleuPAR (suPAR). In almost all cases, cell surface uPARexpression on CD33 + and CD14 + cells and serumsuPAR levels increased to the maximum extent atdays 3-5 of G-CSF stimulations, when CD34 + HSCalso peaked into the circulation. Western blot analysisshowed that after G-CSF treatment there was notonly increase of the intact form of suPAR, but alsoappearance or strong increase of cleaved forms ofsuPAR (c-suPAR) in all analyzed sera. c-suPAR wasable to chemoattract CD34 + KG1 leukemia cells andbone marrow (BM) CD34 + HSC, as documented by invitro migratory response of these cells toward achemotactic suPAR-derived peptide (uPAR84-95).uPAR84-95 induced CD34 + KG1 and BM CD34 + HSCmigration by activating the high-affinity formylmethylpeptide (fMLP) receptor (FPR). In addition,uPAR84-95 inhibited CD34 + KG1 and CD34 + HSCmigration toward the stromal derived factor 1(SDF1), thus suggesting a heterologous desensitationof its receptor CXCR4.Finally, we studied theeffect of uPAR84-95 on the output of clonogenicprogenitors from long-term culture (LTC) of highlypurified BM CD34 + cells from normal donors. Nonadherentcells, weekly removed after a 2 h treatmentwith uPAR84-95, yielded a significant higher numberof clonogenic progenitors as compared to thoseobtained from non-adherent cells of LTC treated withthe scrambled version of uPAR84-95.All together,our data document that G-CSF-induced up-regulationof uPAR on circulating CD33 + and CD14 + cells isassociated with increased suPAR shedding, whichleads to the appearance of serum c-suPAR. c-suPARcould contribute to HSC mobilization by promotingtheir FPR-mediated migration and by inducingCXCR4 desensitation. Our findings suggest a potentialutility of the cleaved form of suPAR, or its derivedchemotactic peptide, in the strategies to optimizeHSC mobilization, especially in G-CSF poor mobilizers.Oral CommunicationsNON-MALIGNANT HEMATOLOGYCO-17AN ASSOCIATION OF PLATELET GLYCOPROTEIN GENE HAPLO-TYPES AND BLEEDING SEVERITY IN PATIENTS WITH PREVIOUS-LY DIAGNOSED VON WILLEBRAND DISEASE (VWD) TYPE 1:RESULTS OF A PILOT STUDY IN 14 ITALIAN FAMILIESFederici AB,* Baronciani L,* Canciani MT,* Cozzi G,*Mistretta C,* Gianniello F,* Peake IR,° Salomon DR,^Kunicki TJ^*Angelo Bianchi Bonomi Hemophilia and ThrombosisCenter, IRCCS Maggiore Hospital and Universityof Milan; °Division of Genomic Medicine, Royal HallamshireHospital, Sheffield, UK, ^The ScrippsResearch Institute, La Jolla, CA, USAVon Willebrand Disease (VWD) type 1 is difficult todiagnose because of bleeding variability and lowheritability of Von Willebrand Factor (VWF) levels.Secondary gene effects that increase risk for bleedingmay modify the phenotype, and platelet adhesionreceptors are prime candidates. We compared a bleedingseverity score and bleeding times to candidategene haplotypes within pedigrees of fourteen indexcases of previously diagnosed VWD type 1, using avariance component model. The 14 families fromMilan have been already enrolled the European studyentitled Molecular and Clinical Markers for Diagnosisand Management of Type 1 von Willebrand Disease(Scientific coordinator: I. R. Peake). VWD type 1patients were classified according to the previousdefinitions of the Scientific Standardization Committee(SSC) on VWF of the International Society onThrombosis and Haemostasis (ISTH) such as individualscharacterized by reduced levels of normal VWFand positive personal-family bleeding history. A bleedinghistory was derived from detailed questionnairesadministered to all the affected and non-affectedmembers (including index cases), and the severityof bleeding was ranked from 0 to 3 in each of 11bleeding categories. Donors were genotyped usingprimer extension method, and nine candidate geneswere selected for this analysis. With respect to bleedingseverity score, ITGA2 haplotype 2 (807C), GP6haplotype b (Pro219) and ITGA2B haplotype 1 (Baka)were found to be associated with increased bleeding(p=0.001, 0.05, and 0.002, respectively). No haplotypeswere associated with bleeding times, and noassociation was observed with six other candidategenes, GP1BA, ITGB3, VWF, FGB, IL6 or TXA2R. Asso-haematologica vol. 89[suppl. n. 6]:september 2004

30Oral Communications: Non-malignant hematologyciation between expression of the VWF promoterhaplotype1 and increased levels of plasma VWF:Ag(p=0.0448) and VWF:RCo ( + =0.024) was also observed.These results establish that genetic differencesin integrin subunits α2 and αIIb as well as GPVI caninfluence the phenotype of previously diagnosedVWD type1.CO-18IN VITRO EXPRESSION STUDY OF A NEW MUTATION (R1308L)FOUND IN A FAMILY WITH TYPE 2B VON WILLEBRAND DISEASECHARACTERIZED BY ALL SET OF MULTIMERS IN PLASMA ANDNO THROMBOCYTOPENIA AFTER DESMOPRESSINBaronciani L, Federici AB, Cozzi G, Beretta M,Canciani MT, Mannucci PMAngelo Bianchi Bonomi Hemophilia and ThrombosisCenter, IRCCS Maggiore Hospital and University ofMilan, ItalyType 2B von Willebrand disease (VWD) is characterizedby enhanced ristocetin-induced plateletagglutination (RIPA) and by loss of high molecularweigh multimers (HMWM) in plasma. A novel 2B vonWillebrand factor (VWF) variant (4173G→T, R1308L)was found in four patients with RIPA (0.3-0.4mg/mL), VWF:Ag (27-51 U/dL), VWF:RCo (23-49U/dL), bleeding time (6-11 min), all set of multimersin plasma and normal platelet count. Interestingly, acommon VWD type 2B mutation, R1308C is characterizedby loss of HMWM, low platelet count andRIPA (0.7-0.8 mg/mL), VWF:Ag (26-48 U/dL),VWF:RCo (13-39 U/dL), bleeding time (10-27 min).Mutated rVWF-R1308L and rVWF-R1308C, weretransiently expressed in Cos 7 cells, and analyzed fortheir ability to bind GpIb receptor along with rVWF-WT. Binding of rVWFs to the GpIb platelet receptorwas tested by an ELISA method (Federici et al.Haematologica 89:77, 2004), at increasing concentrationsof ristocetin (0, 0.125, 0.25 and 0.5 mg/mL),and the rVWF bound to GpIb was revealed by anti-VWF Antibody-HRP reading O. D. 492 nm. The threerVWFs have a similar VWF:Ag and a full set of multimers.Our data demonstrated that the new mutation(R1308L) can enhance the VWF capacity to bindto GpIb receptor, but with lower efficiency comparedto the R1308C variant. This might explain why thesepatients have normal VWF multimers in plasma. Theincreased binding capacity of VWF-R1308L for GpIbdoes not cause its spontaneous interaction withplatelets, or at least, not as efficiently as VWF-R1308C does. The enhanced RIPA of 0.4 mg/mL,observed in patients with VWF-R1308L, versus 0.7mg/mL of VWF-R1308C is probably due to the presenceof all set of multimers, that strongly compensatefor the lower binding capacity to GpIb of thisnew variant.CO-19A FUNCTIONAL SINGLE NUCLEOTIDE POLYMORFISM IN THETHROMBIN-ACTIVACTABLE FIBRINOLYSIS INHIBITOR (TAFI)GENE IN ITALIAN CENTENARIANSSuffritti C,* Coppola R,° Provenzano R,* Moroni B,°Mari D*Internal Medicine Department* , Angelo BianchiBonomi Hemophilia and Thrombosis Centre°, IRCCSMaggiore Hospital and University of Milan, ItalyWe have previously described in centenarians laboratorysigns of marked hypercoagulability, secondaryhyperfibrinolysis, high level of VWF, marker ofendothelial perturbation, and significantly high frequencyof the high risk 4G allele of the PAI-1 -675polymorphism,mutant factor V and prothrombingene G20210A mutation. TAFI is a recently discoveredglycoprotein combining coagulation and fibrinolysis,as TAFI can be activated by thrombin andonce activated potently attenuates fibrinolysis. ThePRIME prospective study recently shows that anincrease in TAFI plasma levels at baseline was associatedwith a higher incidence of angina pectoris.Recently a twins study on heritability of theprethrombotic state demonstrated that TAFI has avery strong genetic component ( 82%). In the codingregion of TAFI the Thr325Ile variation (1040C/T)has been described. Ile at position 325 confers stabilityto TAFIa increasing the antifibrinolytic potential.Purpose of the study. To evaluate the incidenceof TAFI 325Ile/Ile genotype in centenarians selectedwich established enrollment criteria of the ItalianCentenarians Study and in a group of normal subjectsrandomly selected from the same metropolitancommunities. Materials and Methods. 100 centenarians(100-106 yrs) and 100 controls (25-62 yrs)were the cases. The TAFI antigen levels were measuredby ELISA. The identification of TAFI genotypewas carried out by the polymerase chain reaction.The PCR products were digested using the SpeIendonuclease as described by Brouwers et al. Results.The levels of TAFIAg were not different in centenariansand in the controls ( 103+- 50 vs 110+-35). TheIle325 variant (T/T and C/T) results in lower TAFI plasmalevels. A significant difference was detected inthe prevalence of genotypes between centenariansand controls. The T/T genotype is more frequent incentenarians than in controls: 18% vs 7% (p=0.05).Thr325Ile polimorphism is significantly correlatedwith TAFI Ag levels with C/C genotype correspondingwith the highest and the T/T genotype with thehaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200431lowest TAFI Ag levels (centenarians: r=0.62 p= 0.001;controls: r=0,82 p= 0.001). Conclusions. Centenarianshave an increased amount of thrombin generatedby different pathway, factor VII-tissue factor cascadeand by factor XIIa activation and a progressivefibrinolysis expressed by very high levels of D-dimerand plasmin-antiplasmin complex (Mari et al Blood1995, Coppola et al Blood Coagulation and Fibrinolysis1996). Centenarians have increasing frequenceof the T/T genotype, leading to downregulation offibrinolysis which may contribute to the paradox ofthis peculiar population. However the possession ofseveral high-risk alleles and well-known atherothromboticrisk markers appears to be compatiblewith longevity and/or health.CO-20NEW PROGNOSTIC FACTORS IN THE STUDY OF THROMBOTICTHROMBOCYTOPENIS PURPURACulurgioni F, Casula P, Ennas MG, Angelucci EUnità Operativa di Ematologia, Centro TrapiantiMidollo Osseo, Ospedale Oncologico “A. Businco”Asl8 Cagliari, Dipartimento di Citomorfologia, Universitàdegli Studi di Cagliari, ItalyThrombotic thrombocytopenic purpura is a raredisease described for the first time in 1924 byMoschowitz. This disorder occurs with an annualincidence of 1 case for 10 6 residents and 2.7 cases for10 6 according to the TTP HUS Oklahoma Registerdata. In Sardinia, evaluating the 40 cases presentedat the U. O Haematology of Cagliari between 1992and 2003, we have recorded an incidence stronglysuperior than that reported in literature with 8,5 casefor 10 6 /year. The factor that initiates the diseaseseems to be endothelial damage, resulting in theaggregation of platelets into the micro vessels andin the occlusion of terminal arterioles and capillaries.The histopathologyc pattern of TTP shows endothelialcell and detached from the basal membrane,which is then covered by platelet rich thrombi andplatelets aggregates. Platelets aggregation derivesfrom the presence of unusually Large multimericforms of vwF in the plasma of patients with TTP. Thevarious isoforms of ADAMTS 13 (a disintegrin andmetalloprotease with thrombospondin type 1domains 13) gene have biological functions furtherthan the proteolytic activity of vWF. Mutations onADAMTS 13 gene are reported in familial TTP; 65,5%of patients with an activity of ADAMTS13 inferior to5% present antibodies against the vWF cleaving protease.These data suggest that the plasmatic activityof the vWF CP is an efficient prognostic factorsuch as the measurement of the Antigen level andboth depend on the haemostatic conditions ofpatients. Polymorphisms are mutations of DNA thatoccur with a frequency of 1%; 90% of polymorphismsderive from the substitution of a single base(SNP). Some of themes play a role in the gene expressionregulation or in the coded protein function. Otherof them is relevant to determine the resistance totreatment. Aim of this study is searching the presenceof polymorphism into the metalloproteasegenes. It is important to evaluate the frequency ofthe presence of the ADAMTS 13 gene polymorphism,in particular of the mutant P475S, the most commonSNP associated with variation of the activity of thevWF-CP. Studying the metalloprotease MMP1;55,5% of patients with TTP in complete remissionhas show an eterozygosis 1G/2G; 44,4% an omozygosis1G/1G; none 2G/2G. The polimorphisms frequency(1G/2G, 1G/1G) recorded are significantly differentif compared with a Sardinian population of176 individuals random. It could be interesting tofind an association between the polymorphisms ofthe metalloprotease genes and the risk of disease orthe resistance to treatment. It is important to evaluatethe expression of ADAMTS 13, using the RT-PCR, and its activity, the positivity of the mutantP4755, the correlation between genic polimorphismsand the individual susceptibility to the TTP, the quantityof vWF in blood samples and of UL vWF(unusuallylarge multimeric forms of vWF) and the quantityof their proteases. These new molecular techniquesgive us the possibility to monitories thepatient from the exordium of the disease, after theplasma-apheresis cycles, after therapy and duringthe follow-up. Knowing the genetic aspects that maycondition the individual response to therapy and thefamilial correlations could give us the possibility tomake more appropriate therapeutic decisions with asignificant benefit for the patient and also with arelevantCO-21TISSUE FACTOR AND ANGIOGENESIS ARE SIMULTANEOUSLYINHIBITED BY ALL-TRANS RETINOIC ACID (ATRA) INENDOTHELIAL CELL STIMULATED BY ACUTE PROMYELOCYTICLEUKEMIA CELLSFalanga A, Balducci D, Marchetti M, Russo L,Barbui THematology Dept. Ospedali Riuniti di BergamoRemission induction of human APL by ATRA parallelsthe rapid resolution of the associated coagulopathy.This is because ATRA is able to modulate thehemostatic system, including the inhibition of TissueFactor (TF) expression by endothelial cells. TF, themain activator of blood coagulation, is involved intumor angiogenesis. To understand whether ATRAhaematologica vol. 89[suppl. n. 6]:september 2004

32Oral Communicationsmodulation of endothelial TF is associated to theoccurrence of antiangiogenic effects, in this study weevaluated whether ATRA may affect both TF expressionand new capillary-like tube formation by microvascularendothelial cells (HMEC-1) stimulated byleukaemic cell (APL cell NB4). HMEC-1 were incubatedwith NB4 conditioned medium (CM), in thepresence of increasing concentrations of ATRA(0.0001-1.0 µM) or vehicle (control), then TF (activityand antigen) and the capillary-like tube formation(by the Matrigel model) were evaluated. Alsothe effect of ATRA on angiogenesis induced by purifiedproangiogenic factors (i. e. :VEGF and bFGF) wascharacterized. Capillary-like tube formation was examinedunder phase-contrast microscopy and tubelength determined by image analysis software. ControlCM induced a modest tube formation (total tubelength = 330 mm/cm 2 ), which was dose-dependentlydecreased by ATRA, with a 36% inhibition by 1.0µM ATRA (p b-FGF. Inhibition studies withneutralizing MoAbs against proangiogenic factorsdemonstrated that a combination of anti-VEGF +anti-TNFα MoAbs was necessary to 100% inhibitNB4 cell proangiogenic action. In addition, ATRAcompletely inhibited tube formation induced bystandard purified VEGF, b-FGF, and VEGF + b-FGFcombination. In conclusion, in this experimentalsystem, ATRA inhibition of endothelial cell TF wascoupled with angiogenesis downregulation. Whetheror not the two phenomena are interdependentremains to be elucidated. Inflammatory cytokinesalso played a role in our system, which points toATRA as a valuable tool to identify pathways linkingthrombosis, inflammation, and cancer.CO-22IN VITRO DIFFERENTIATION OF ENDOTHELIAL CELLS FROMHUMAN CD133 + CELLSPoloni A, Quagliarini A, Gini G, Pasquini R, BalducciF, Masia MC, Leoni P, Olivieri AClinica di Ematologia, Università Politecnica delleMarche, ItalyRecent findings support the hypothesis that bonemarrow and peripheral blood contain endothelialprogenitor cells. The molecular mechanisms responsiblefor vasculogenesis and angiogenesis are notcompletely understood. Several growth factors areinvolved in regulation of endothelial proliferationand differentiation. In this study we report thatCD133 + cells from human normal bone marrow andgranulocyte colony-stimulating factor-mobilizedperipheral blood can be induced to differentiate invitro into endothelial cells in defined culture conditions.Isolated CD133 + cells were grown onfibronectin-coated plates in different media with ornot fetal bovine and horse serum with the additionof different combination of growth factors. TheCD133 + cell fraction express CD34, DR, CD117,CD105, CD31, but did not express VE-cadherin orvWF. CD133 + cells give rise to hematopoietic progenitors,LTC-IC plated in LDA and endothelial coloniesin collagen based media. When cultured in the presenceof serum, VEGF, FGF-β, IGF-1, TPO, IL6, IL3, SCF,Flt3-lig, CD133 + cells generate both adherent andproliferating nonadherent cells. Phenotypic analysisof the cells within the adherent population reveals70% CD45- cells, no CD14 + cells, 20-25% CD31 +cells, 5-15% CD105, CD34 + , VE-cadherin + and vWF +cells. Nonadherent cells, 90% CD45 + cells, give riseto both hematopoietic and endothelial colonies. Weshowed that, depending on culture conditions,CD133 + cells can be differentiated along theendothelial or the hematopoietic pathway. We don'tknow if CD133 cell population contains separateprogenitors for endothelial and hematopoietic cellsor a common precursor even if several different linesof investigation suggest the presence of functionalhemangioblastic activity in the adult.CO-23MITOCHONDRIAL FERRITIN EXPRESSION IS AN EARLY EVENTIN SIDEROBLASTIC ERYTHROPOIESISInvernizzi R, Tehranchi R,* Travaglino E, Benatti C,Levi S,° Arosio P, # Hellström-Lindberg E*Internal Medicine and Medical Oncology, Universityof Pavia, IRCCS Policlinico S. Matteo, Pavia, Italy;*Department of Medicine, Division of Hematology,Karolinska University Hospital (Huddinge),Stockholm, Sweden; °Department of Biological andTechnological Research, IRCCS S. Raffaele Hospital,Milan, Italy; # Department M. I. and BiomedicalTechnologies, University of Brescia, Brescia, ItalyWe have recently reported an unusual intronlessgene on chromosome 5q23.1 encoding a 242-AAprecursor of a ferritin H-like protein. This 30-kDaprotein is targeted to mitochondria and processedto a 22-kDa subunit that assembles into typical ferritinshells and has ferroxidase activity. This newmitochondrial ferritin (MtF) may play an importanthaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200433role in regulating mitochondrial iron homeostasisand heme synthesis. A mitochondrial accumulationof MtF has been demonstrated in the erythroblastsof refractory anemia with ring sideroblasts (RARS)but not in refractory anemia (RA). On the other hand,some of us have shown that in low-risk myelodysplasticsyndromes (MDS) the enhanced apoptosis ofearly erythroblasts is mediated through a constitutivecytochrome c release from mitochondria, andthat G-CSF strongly inhibits this process. Since preliminaryfindings indicate that cells overexpressingMtF are more resistant to oxidative damage and alsoto the apoptotic signals, we assessed the kinetics ofMtF accumulation during erythroid maturation inMDS in relation to cytochrome c release, as well asthe effect of G-CSF. Our aim was to evaluate atwhich stage of erythroblast differentiation mitochondriaaccumulate MtF in RARS and whether MtFaccumulation reflects a defense mechanism of thecell. CD34 positive cells from the marrow of 9patients with MDS (5 RARS and 4 RA) and from 3healthy donors were cultured for 14 days using a liquid-cultureprocedure, according to previous publications.Samples of cultured cells were removed atdays 4, 7, 11 and 14, cytocentrifuged on glass slides,and analyzed for the distribution of MtF and of cytoplasmicH ferritin (HF) using immunocytochemicalmethods. Translocation of cytochrome c from mitochondriato cytosol was determined by immunofluorescence.Freshly separated CD34 positive cells fromall subjects were negative for MtF. MtF was barelydetectable in few cells from normal samples (0-4%,day 4-14), and RA erythroblasts showed a median of3% (0-8%) positive cells. On the contrary, RARS erythroblastsshowed an early increase in MtF positivecells and a continuous increase during the cultureperiod (day 4: 10%, day 7: 17%, day 11: 13%, day 14:19%). There was no correlation between MtF expressionand cytochrome c release except at day14.Interestingly, G-CSF significantly reduced thecytochrome c release in RARS and to a more moderateextent in RA, and tended to increase MtF expressionin some RARS erythroblast cultures. HF expressionwas variable and not influenced by G-CSF. InMDS it was higher than in normal samples; in RARSthe percentages of positive cells tended to diminishat late stages. In conclusion, our findings show thatthe expression of MtF occurs very early during RARSerythroid differentiation, in cells that are still CD34positive and without any visible iron accumulation.Iron accumulation, probably as a consequence of aprimary defect in iron metabolism, may cause furtherdamage to the mitochondria and result incytochrome c release and apoptosis. Alternativemechanisms, not associated with iron-overloading,may be involved in RA pathogenesis, since these cellsshow cytochrome c release but very moderate MtFexpression. Interestingly, G-CSF treatment seems toinhibit apoptosis by upregulating compensatorymechanisms for cell survival rather than affectingmitochondrial iron metabolism.CO-24ANALYSIS OF CD8 + CD57 + LYMPHOCYTES IN PATIENTS WITHPAROXYSMAL NOCTURNAL HEMOGLOBINURIAGargiulo L,* Cerruti G, # Lastraioli S,* Reverberi D, #Dono M, # Zupo S,º Luzzatto L,*^ Notaro R*Genetica umana,* Diagnostica sindromi linfoproliferative,ºOncologiaMedica C, # IST - Istituto Nazionaleper la Ricerca sul Cancro (Genova) e Universitàdi Genova^, ItalyParoxysmal nocturnal hemoglobinuria (PNH) is anacquired clonal disorder of the hemopoietic stem cell(HSC) characterized by intravascular hemolysis,venous thrombosis, and variable degrees of bonemarrow failure. In PNH a somatic mutation of the X-linked PIG-A gene in HSC results in complete or partialdeficiency of all proteins anchored by the glycosylphosphatidylinositol(GPI) on the membrane ofthe mutated HSC and in its mature progeny. Theclose association between PNH and Idiopathic AplasticAnemia, and numerous other lines of evidencesupport the hypothesis that auto-reactive T cellsmight be the cause of the expansion of the hematopoieticPNH clone(s). Specifically, these T cells mightdamage selectively normal HSC, whereas PNH HSCsurvive and expand because they escape the attack.Our recent observation of a unique patient with PNHand with a large granular lymphocyte (LGL) leukemia(Karadimitris et al. , Br J Haematol 2001;115:1010)has strongly suggested the possibility that this clonalexpansion of T cells, which have a CD8 + CD57 +phenotype, could be responsible for the damage tonormal HSC in this patient. For this reason we havemeasured systematically the percentage of theCD8 +bright CD57 + T cells in the peripheral blood of 15PNH patients and of 18 healthy individuals. The proportionof this cell population was quite variable andvery similar in patients (7.4±6.3; range: 0.8-22.3%)and in healthy individuals (6.5±5.2; range: 0.9-1.2.p>0.5). Next, we have investigated the molecularfeatures of these cells. Sorted CD8 +brigth CD57 + T cellswere characterized with respect to the size distributionof the complementarity-determining region 3(CDR3) of the T-cell receptor (TCR) variable β (Vβ)chain genes. In healthy individuals this analysis yieldsa ladder of normally distributed bands of differentsizes. By contrast, in 13 out of 14 PNH patients thisanalysis has yielded a markedly non-random (oligoclonal)pattern; and in each patient some clones arepredominant. In 6 patients we were able to analyzehaematologica vol. 89[suppl. n. 6]:september 2004

34Oral Communicationsfollow-up samples and after 6 months or more theoligoclonal pattern was persistent. Because thesesequences may give some clue about the identity ofthe target molecules of these T-cell clones, we haveproceeded to sequencing the TCR-Vβ chain genes inthe expanded clones in 7 patients. From each ofthese patients we have observed an average of 25different TCR-Vβ CDR3 sequences (out of an averageof 80 total sequences obtained). In each patient onlyone or two sequences were predominant. From a preliminaryalignment analysis of the TCR-Vβ sequenceswe have found an identical TCR-Vβ sequence in twodifferent patients; and in two other patients we havefound another, nearly identical sequence. Theseobservations support the hypothesis that theCD8 +bright CD57 + T-cell population include a subsetof cells that may be directly implicated in the pathogenesisof PNH.Oral CommunicationsSTEM CELL TRANSPLANTATIONCO-25CORRELATION BETWEEN PRETRANSPLANT RECIPIENT BLOODMDC LEVELS AND ACUTE GVHDArpinati M,* Gianoullia P,* Chirumbolo G,* PerroneG,* Bonifazi F,* Palandri F,* Giannini MB,* BandiniG,* Martelli V,* Sanchini S,* Zagnoli A,* BaccaraniM,* Rondelli D°*Research Center for Transplant Immunology, Instituteof Hematology and Medical Oncology "Seragnoli",University of Bologna, Italy; °Section ofHematology/Oncology, University of Illinois at Chicago,USAAnimal models have suggested that host dendriticcells are essential in the induction of acute GVHDfollowing allogeneic HSCT, through the direct presentationof host alloantigens to donor T lymphocytes.Human DC comprise at least two distinct subsets,i. e. myeloid DC, including their monocytic precursors,that have been associated with the triggeringof alloimmune responses, and plasmacytoid DCthat have been shown to modulate alloimmuneresponses, through induction of Th2 or T regulatoryactivity. Therefore it has been hypothesized that hostmDC and pDC may differentially regulate acuteGVHD. In this study we employed flow cytometry toenumerate both mDC (lin-, HLA-DR + and CD11c + )and pDC (lin-, HLA-DR + and CD123 + ) in the blood ofpatients receiving an allogeneic HSCT. CD14 + monocytenumbers were also determined as mDC precursors.Fifty consecutive patients undergoing HSCTfrom HLA-matched either related (n=28) or unrelated(n=22) donors were enrolled in the study. Thestem cell source was bone marrow in all unrelateddonors, and G-CSF mobilized PBSC in related donors.Indications to transplant were AML (n=12), ALL(n=11), MM (n=10), CML (n=7), NHL (n=6) and HD(n=4). 13 patients (26%) received reduced dose conditioningregimens (RIC). All patients received CsAand MTX as GVHD prophylaxis. Moreover, 26 patients(52%) received ATG before transplant. mDC and pDCPB counts were significantly lower in patients ascompared to 28 age-matched healthy controls [8.8cells/ µL (25 th to 75 th percentile 3.5-14.5) mDC, and2.8 (1.3-5.5) pDC, vs 15.5 (12.1-25.1) and 8.6 (5.6-13.1), respectively] (p 2.3had a significantly higher probability of developingacute GVHD (61% vs 14%, p 395/microL also correlated witha higher incidence of acute GVHD. No correlationwas observed between pretransplant recipient PBmDC, pDC or monocyte counts and chronic GVHD.Since our data suggest a correlation between acuteGVHD and the balance between mDC (including theirmonocytic precursors) and pDC in PB, further studieswill exploit clinical strategies to deplete or inactivatehost mDC before transplant as a means ofGVHD prophylaxis.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200435CO-26IN VITRO SEPARATION OF GVL EFFECT AND GVHR FROMDONOR-DERIVED ANTI-LEUKEMIA CTL LINES: A PERSPECTIVEFOR ADOPTIVE IMMUNOTHERAPY AFTER ALLOGENEIC HSCTMontagna D, Locatelli F, Daudt L, Turin I, Montini E,Lisini D, Zecca M, Moretta A, Comoli P, Maccario RDipartimento di Scienze Pediatriche, Università diPavia, Laboratorio di Immunologia dei Trapianti eUnità Operativa di Oncoematologia Pediatrica,IRCCS Policlinico San Matteo, Pavia, ItalyAdoptive transfer of ex vivo generated donorderivedanti-leukemia CTL lines could be a successfulapproach in preventing or treating leukemiarelapse after allogeneic HSCT. However, a major riskis that of generating cells potentially able to promotethe development of GVHD. This risk could beparticularly relevant in pairs where donor and recipientare HLA-disparate. We previously demonstratedthe possibility of generating and expanding in vitroCTL lines directed towards different types ofleukemia blasts (LB), using both HLA-matched andpartially matched donors as source of effector cells.Some of the anti-leukemia CTL lines displayed a sizeablecytotoxicity against patient non-leukemia cells,even though this alloreactivity was lower than thatobserved against patient LB, especially at the lowesteffector/target ratio. The exact antigen specificity ofthese CTL lines is unknown, even if our data suggestthat, at least part of anti-leukemia T cells, recognizesan antigen only present or upregulated on LB.In order to verify the possibility of separating in vitroT cells able to mediate GVL effect to these involvedin the development of GVHD, one alloreactive antileukemiaCTL line derived from a partially matchedfamily donor was cloned and T cell clones (TCC) weobtained were tested for their capacity to lysepatient LB or patient non-malignant cells, such as T-lymphoblastoid cell line (T-LCL) or fibroblasts (FB).420 TCC were obtained. 281/420 TCC were cytotoxicagainst both LB and T-LCL, while 90/281 lysed alsopatient FB. 16/420 lysed LB and FB, while 64/420were selectively able to lyse only LB (LB-directedTCC). 37/64 LB-directed TCC were CD3 + /CD8 + cells,while the remaining were CD3 + /CD4 + cells. Evaluationof expression of TCR Vβ chains revealed that atleast 14 different families of Vβ TCR regions chainswere represented among LB-directed TCC. Expansionof LB-directed TCC with OKT3, allogeneic feeder cellsand IL-2 allowed us to obtain a great number of antileukemiacells maintaining their specificities. Furtherexperiments are in progress to determine thepattern of cytokine production and HLA-restriction.These data suggests that i) different effector cellscan be differentiate in vitro in response to LB, ii)among an alloreactive anti-leukemia T cell line it ispossible to distinguish and separate T cells expressingdifferent specificities in order to reduce the riskof inducing GVHD after in vivo infusion of these cells.CO-27DONOR ACTIVATING KIR GENES AND SURVIVAL AFTER HAPLO-IDENTICAL HEMATOPOIETIC TRANSPLANTATION FOR ACUTELEUKEMIAMancusi A, McQueen K,* Ruggeri L, Perruccio K,Martelli MF, Parham P,* Velardi AUniversity of Perugia, Italy; *Stanford University, USANK cell alloreactivity impacts beneficially on theoutcome of haploidentical transplantation in AMLpatients (Ruggeri et al. , Science 2002). In a search foradditional donor selection criteria, here we correlatedthe donor KIR genotype with clinical outcome in92 haploidentical transplants (30 ALL, 62 AML). Wecompared outcomes after transplant from donorscarrying A haplotype KIR genes, which encode formainly inhibitory receptors, vs donors carrying Bhaplotype KIR genes, which encode for activatingKIRs (KIR2DS1, 2, 3, 5 and KIR3DS1). Probability ofevent-free survival was higher in AML patients transplantedfrom donors bearing B haplotype genes (60%vs 35%, p=0.1). When the presence of each activatingKIR gene in the donor was analysed against itsabsence, presence of KIR2DS2 appeared to havemediated most of the survival advantage associatedwith B haplotype genes (61% vs 42%, p=0.02). In 30ALL patients we observed no differences in survivalafter transplantation from a donor with either groupA or group B KIR genotypes. We next wonderedwhether the apparent survival advantage of transplantationfrom donors carrying activating KIR geneswas due to an overlap with other well establishedfactors of good prognosis, such as donor-vs-recipientNK cell alloreactivity and transplantation inremission. Transplantation from donors carrying thegroup B genotypes or the KIR 2DS2 activating genewas associated with better outcomes even inpatients transplanted from non-NK alloreactivedonors, so it appears to be independent of NK cellalloreactivity. Analysis of disease status at transplant,that is remission vs relapse, indicated that whenpatients were transplanted in remission, the survivaladvantage conferred by donors carrying the group Bgenotypes was lost. Intriguingly, when patients weretransplanted in chemoresistant relapse the survivaladvantage was markedly evident (53% vs 11%,p=0.05). This survival advantage seemed to be theconsequence of reduced incidence of both fatalinfections and leukaemia relapse. The mechanismunderlying this apparently improved immune competenceremains to be investigated. If these prelim-haematologica vol. 89[suppl. n. 6]:september 2004

36Oral Communicationsinary results are confirmed in a larger series ofpatients, one additional donor selection criterionmay have been identified for poor-risk AML patientstransplanted in chemoresistant relapse.CO-28LONG-TERM FOLLOW-UP OF IN VIVO TELOMERE DYNAMICSAND IN VITRO FUNCTIONAL BEHAVIOUR OF HUMANHEMATOPOIETIC STEM CELLS IN AUTOGRAFTED LYMPHOMAPATIENTSRocci A,* Ricca I,* Della Casa C,* Longoni P,°Compagno M,* Battistelli M,° Francese R,*De Marco F,* Caracciolo D,* Boccadoro M,* FerreroD,* Ladetto M,* Carlo-Stella C,° Tarella C**Divisione di Ematologia dell'Universita' di TorinoAzienda Ospedaliera S. Giovanni Battista, Torino;°Dipartimento di Ematologia e Oncologia Medica,Istituto Nazionale Tumori, Milan, ItalyTelomere length is considered a valuable predictorof the replicative capacity of human hematopoieticstem cells. Indeed, a progressive telomere shorteningcharacterizes in vitro growth of hematopoietic cells.However, less is known on the dynamics of telomereshortening in vivo during physiological aging andfollowing a non-physiological replicative stress. Toinvestigate cellular senescence markers ofhematopoietic cells exposed to replicative stressinduced by bone marrow reconstitution followingstem cell autograft. Thus, the study was aimed toevaluate: i. telomere length and ii. in vitro functionalcharacteristics of bone marrow (BM) and peripheralblood (PB) cells obtained from long-term survivingpatients previously treated with intensivechemotherapy and autograft. Thirty-two lymphomapatients were examined, at a median time of 73months (range 42-125) since autograft. All patientshad received a high-dose sequential chemotherapytreatment followed by peripheral blood progenitorcell (PBPC) autograft. There were 20 male and 12female; their median age at autograft was 40 years(range 21-60). A Southern blot procedure using achemiluminescence-based assay was employed todetermine telomere length on samples from graftedmaterial obtained through leukapheresis at the timeof maximal PBPC mobilization as well as on BM andPB samples obtained at long-term during follow-up.These latter samples were also studied for their invitro functional characteristics, assessed by short(CFU-GM, BFU-E and CFU-Mix) and long-term cultureassays (LTC-IC). All patients were autograftedwith large quantities of hematopoietic stem cells(median autografted CD34 + ve cells/kg: 9,8 x 106,range 2-24). Telomere length was found slightlyshortened in BM mononuclear cells from samplestaken at follow-up compared to samples from graftedmaterial (median telomere length: 6895 bp, range4631-8983 vs 7073 bp, range 4991-9230, respectively;p=ns). No marked differences were observedin telomere evaluation between BM and PB cells. PBtelomere length of follow-up samples was then comparedwith telomere length of PB from age-relatednormal subjects. This allowed to verify that PB telomerestatus felt within the range of normality in all butone autografted patients. BM and PB samples werealso assessed for their in vitro growth characteristics.A slight reduction in committed progenitors wasobserved; however, median values were still withinthe normal ranges. On the contrary, the more immatureLTC-IC population was definitely reduced, withmedian values significantly lower than thoseobserved in control normal subjects. the proliferativestress induced by intensive chemotherapy and postgrafthematopoietic reconstitution does not implymarked telomere loss in BM and PB cells at longterm,provided that large quantities of PBPC are usedfor autografting; ii. stem cells present in the graft orsurviving after high-dose therapy are capable of stablereconstitution of the committed progenitor cellpopulation while immature LTC-IC progenitorsremain persistently impaired even at up to 10 yearssince autograft, in spite of the abundant PBPC autografted.CD38 low CD10 CD34 CD19CD45 low CD10 CD34 CD19CD21 asin CD10 CD34 CD19CD22 high CD10 CD34 CD19CD58 high CD10 CD34 CD19CD13 aberr CD10 CD34 CD19CD33 aberr CD10 CD34 CD19CD10 CD56 aberr CD34 CD19CD15 aberr CD10 CD34 CD19CD66c aberr CD10 CD34 CD19CD65 aberr CD10 CD34 CD19CD10 NG2 disr CD34 CD19TdT low CD10 high CD34 high CD19,TdT low Cµ asin CD34 CD19CO-29REPRODUCIBLE, CLINICAL GRADE GENERATION OF HLA-MATCHED DONOR DERIVED CYTOTOXIC T CELLS AGAINST AMLAND ALL BLASTSBarbui AM, Borleri G, Micò C, Salvi A, Introna M,Rambaldi ADivisione di Ematologia, Ospedali Riuniti di Bergamo,ItalyDuring the past few years several in vitro-protocolshave been described aimed to manipulate donor Thaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200437cells in order to improve graft versus leukemia (GvL)while diminishing graft versus host disease (GvHD)potential. However only few adoptive immunotherapytrials have been reported so far, due to the complexityof such approaches. Aims: We evaluated thepossibility of generating, expanding and characterisingdonor derived cytotoxic T cells (CTL) directedtoward different types of AML and ALL leukaemiausing a rapid, highly reproducible and efficient clinicalgrade in vitro method. Material and methods:After 5 days of in vitro culture with of Stem Span(Life Technologies, Vancouver, Canada) culture medium,GM-CSF (100 ng/ml, Schering Plough), IL-4 (50ng/mL, Euro-Clone, U. K. ) and calcium ionophore(100 ng/mL, Sigma Aldrich, Milan, Italy), we wereable to successfully differentiate all samples of AML(N=13) and B precursor ALL (N=23) into leukemiaderived-antigen presenting cells (LD-APC). No differentiationwas possible when T-ALL (N=3) werestudied. LD-APC showed a mature dendritic cell phenotype(CD40 + , CD83 + , CD86 + and CD80 + ), becameable to uptake dextran FITC and made cord bloodderived naive T cells proliferate. 5 ALL and 4 AMLderived APC successfully generated anti leukemiaCTLs from HLA matched identical sibling (N= 5) orunrelated donors (N= 3) and one haploidentical siblingafter two repeated round of stimulation. After 14days of in vitro culture in the presence of IL-2 (120U/ml, Proleukin), overall growing cells were found ina median of 73% (range 55-99) of initially platedwells. T cell receptor (TCR) cytofluorimetric analysisof both adult and cord blood derived CTL showed askewing from a complete repertoire to an oligo-clonal/clonal pattern. The phenotype was CD3 + CD4 + in53%, CD3 + CD8 + in 10%, and a mixed population ofCD4 + and CD8 + the remaining wells, all sharing aneffector memory T cell profile (CD45 RO + , CCR7 − ,CD62L + , CD27 + , CD11a + and CD28±). Cells with similarphenotype were pulled and further cultured foradditional 14 days in flasks obtaining a maximalexpansion of 150-fold increase. CTL were cytotoxicagainst patient leukemic blasts (median 18% at a E:T ratio of 10:1 after 4 hours) and not against autologousPHA blasts. They were perforine negative,granzyme B positive (median expression was 70%)and that they were able to produce IFNγ upon aspecificstimulation (median expression was 34%). As acomparison LD-APC from 4 ALL patients were usedto generate leukemia reactive CTL from cord bloodnaive T cells. Over in vitro culture naive T cellschanged their phenotype into effector memory cells,became perforine, granzyme and IFN-& # 61543; positiveand more interestingly showed a higher cytotoxicityagainst leukemia blasts as compared to adultCTL (median 45% at E: T ratio 10:1). These experimentswere performed under GMP conditions so toprovide a protocol for further scaling up. Theseresults demonstrated the feasibility to generatehighly cytotoxic, leukemia reactive T cell lines in themajority of AML and ALL patients and provide thebiological background to design clinical protocols ofadoptive immunotherapy in patients with leukemiarelapse after allergenic transplantation.CO-30SECONDARY MYELODYSPLASTIC SYNDROME/ACUTE LEUKEMIAFOLLOWING HIGH-DOSE CHEMOTHERAPY AND AUTOGRAFT: ANANALYSIS OF RISK-FACTORS ON 307 LYMPHOMA PATIENTSTREATED WITH THE HIGH-DOSE SEQUENTIAL (HDS)CHEMOTHERAPY APPROACHBono D, Zanni M, Ricca I, Caracciolo D, Dama E,*Magnani C,*^ Gavarotti P, Bergui L, Cuttica A,Ladetto M, Boccadoro M, Ferrero D, Tarella CDivisione di Ematologia dell'Università di Torino, AOS. Giovanni B. , Turin; *CPO-Piemonte; ^Universitàdel Piemonte Orientale, Novara, ItalyHigh-dose chemotherapy (HDT) with autologousstem cell transplantation is an important therapy forboth non-Hodgkin's Lymphoma (NHL) and Hodgkin'sLymphoma (HL). Its clinical applicability has beenconsiderably amplified by using peripheral bloodprogenitor cells (PBPC). Indeed, HDT with autograftis now the most frequently employed treatment forpatients

38Oral Communicationslow-grade NHL). Median age was 46 yrs. (range 16- 70); there were 180 male and 127 female. Overall,207 patients received HDS as first-line therapy, and100 patients as salvage treatment following one ormore lines of conventional chemo-radiotherapy. TheHDT program included either the original HDS regimenor one of the subsequently developed secondandthird-generation schemes, identified as i-HDS(intensified) and C-HDS (Ara-C-supplemented), asdescribed. Among 307 patients entering the HDSprotocol, 240 concluded the whole program with thefinal autograft. Most patients were autografted withPBPC and only a few received either BM cells aloneor BM cells combined with PBPC. All patients havebeen monitored with clinical, laboratory and radiologicreassessments at given intervals during followup.At a median follow-up of 5.5 yrs. , 134 (65%) of207 patients receiving front-line HDS are presentlyalive, while 44 survive in the group of 100 patientstreated for refractory/recurrent lymphoma. Overall,among 307 patients receiving a HDS approach, 14(4.5%) developed s-MDS/AL (10 after PBPC and 3after BM autografting, 1 after HDS without the autograftprocedure). The actuarial projection of developingsMDS/AL is 4.8% at 5 yrs. Refractory/relapsedstatus at HDS was the only factor strongly associatedwith the development of sMDS/AL (p=0.014 vs.HDS first-line). None of the other clinical characteristics,including age, sex, histology, type of graft andnumber of CD34 + re-infused appeared to be of relevance.The association between disease status atHDS and sMDS/AL development was maintained ifthe analysis was limited to 240 autografted patients.Overall, the incidence of sMDS/AL is one of the lowestreported so far in lymphoma patients treatedwith HDT and ASCT. This indicates that the use of singleagents at high doses does not imply an increasedrisk of sMDS/AL. In addition, the study demonstratesa strong association between sMDS/AL occurrenceand the use of HDT as salvage therapy after one ormore conventional pretreatments. This supports anearly use of HDT and autograft in those high-risklymphoma patients with low chances of cure if treatedwith conventional therapeutic approaches.CO-31REDUCED INTENSITY ALLOGENEIC HEMATOPIETIC STEM CELLTRANSPLANTATION WITH LOW DOSE ALEMTUZUMAB:DECREASED INCIDENCE OF ACUTE GVHD AND TRANSPLANTRELATED MORTALITYDodero A, Milani R, Montefusco V, Zallio F,Carrabba M, Rizzo E, Milanesi M, Corradini PDivision of Hematology, Istituto Nazionale Tumori,University of Milan, ItalyAlthough reduced-intensity conditioning (RIC) regimensinduce engraftment of allogeneic stem cellswith a relatively low toxicity, GVHD remains a significantcause of morbidity and mortality. In vivo Tcell depletion with alemtuzumab (100 mg total dose)has been shown to reduce the incidence of GVHD.However, the in vivo persistence of alemtuzumab atlympholytic concentrations impairs the immunereconstitutionand limits the efficacy of the graft-versus-tumor(GVT) effect. The purpose of our trial wasto test the effect of lower dose of alemtuzumab onGVHD and GVT effect. We have enrolled 26 patientsreceving allogeneic stem cell transplantation (SCT)from HLA identical (n=23) or one-antigen mismatched(n=3) family donor. Patients were conditionedwith a RIC regimen including thiotepa (10mg/kg), fludarabine (60 mg/m 2 ) and cyclophosphamide(60 mg/kg). GVHD prophylaxis consisted ofshort-course MTX and CSA (2 mg/kg). Alemtuzumabwas given at 7.5 (n=16) or 15 mg/ms (n=10) on day-2. Patients with progressive disease (PD) or residualdisease without GVHD, were considered eligible fordonor lymphocyte infusions (DLI). Median age was 57years (range: 41-65). Diagnosis were: MM (n=11),NHL/HD (n=11), MDS/AML (n=4). All patientsreceived a median of two previous lines of therapiesand 54% received a previous autograft. Before SCT,27% of the patients had chemorefractory disease.Twenty-three patients have a minimum follow-upof 4 months (median follow-up 300 days) and areevaluable for toxicity, immunereconstitution, incidenceof acute GVHD, disease response. The estimated1-year TRM was 11%. All patients had a sustainedengraftment. The majority of patients (86%)were full donor (peripheral blood T cells and granulocytes)at day +60 after SCT. Two patients after initialfull donor engraftment experienced a lost of Tcell engraftment concomitant to relapse of disease.The median value of CD4 + and CD8+ at day +90 were130/uL and 200/uL. The median value of peripheraldendritic cells (DC) at day +90 were 3,5/ul for DC1(CD11c + ) and 2,9/ul for DC2 (CD11c-). Chimerismanalysis on DC1 and DC2 cells has been performedon 10 samples: by day +30 more than 95% of DCwere of donor origin. We analyzed TCR (TCR) BVspectratyping in 12 patients: 6 of them, evaluable at9-12 months after SCT, had a recovery of a complexTCR repertoire. Eleven patients (47%) received DLIfor PD (n=6), residual disease (n=2) or for persistenceof CMV infection (n=3). The median time for first DLIwas 190 days. 37% responded to DLI. The overallincidence of grade II-IV acute GVHD pre- and post-DLI were 9% and 39%, respectively (no grade IVGVHD occurred). The incidence of chronic GVHD preandpost-DLI were 0% and 17%, respectively. Currently,21 of 26 patients (80%) are alive: 12 in CR(n=3 molecular remission), 6 in PR and 3 not yethaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200439evaluable for response. Five of 26 patients (19%)died from their underlying disease (n=3) or from TRM(n=2). The estimated 1-year progression-free survivaland overall survival were 54% (95% CI, 28% to80%) and 68% (95% CI, 45% to 91%), respectively.Summary: Our results suggest that: (1) low doses ofalemtuzumab reduces the incidence of de novo acuteGVHD (probably by a depletion of host DC) and promotea rapid immunereconstitution; (2) the encouragingresults in terms of OS suggest that relapsingpatients can be rescued with DLI; 3) the role of alemtuzumabin HLA matched sibling allografts deservestherefore further studies.CO-32A NOVEL STRATEGY FOR CELL THERAPY OF CHRONIC MYELOIDLEUKEMIA USING EX VIVO TREATMENT OF PH POSITIVE CELLSWITH DECITABINE AND WITH THE BY-STANDER TRANSFER OFCD40LQuintarelli C, 1 Izzo B, 1 ° Muccioli Casadei G, 1,2Bartiromo M, 1 Sparacino A, 1 Ciancia R, 4 Biagi E, 2Intrieri M, 3 Luciano L, 4 * Amabile M, 5 Rosti GA, 5Martinelli G, 5 Brenner M, 2 Pane F 11CEINGE - Biotecnologie Avanzate and Dipartimentodi Biochimica e Biotecnologie Mediche, University“Federico II di Napoli”, 2 Center for Cell and GeneTherapy, Baylor College of Medicine, Houston, Tx,USA, 3 Scienze Matematiche, Fisiche e Naturali, Universitàdel Molise, Università; 4 Divisione di Ematologia,Università Federico II di Napoli, 5 Istituto diEmatologia ed Oncologia L. e A. Seragnoli, Universitàdi Bologna, ItalyCML is the prototype of disease that is eradicablein the setting of allogeneic stem cell transplantation(SCT), and the curative response seems to be relatednot only to chemo-radiotherapy received for conditioning,but also and even more to a specific antileukemiaimmunologic effect, referred as graft versusleukemia (GvL). Here we describe a method forcellular immunotherapy of CML, based upon theinduction of expression of PRAME (preferentiallyexpressed antigen of melanoma), a cancer associatedantigen which has been shown to be recognizedby autologous cytotoxic T cells in the context ofMHC-I restriction and on the improvement of thecapacity of the leukemic cell to present the tumorantigen. The expression of PRAME is normally verylow in Ph + positive cells from CML patients at theonset of the disease. Indeed, we analysed bone marrowcells of 10 patients with early chronic phase CMLand found that this protein is expressed, at very lowtiters in only 8 of them. In addition, we incubated theKT1, a Ph + cell line, and Ph + primitive cells fromuntreated patients in the presence of scalar amountof IFN (from 10 to 200 U/mL), of Imatinib (0,1 to 1,0micrM), and of hydroxyurea and we found that themore common used drugs in CML did not modify theexpression PRAME gene. We also treated in vitro thesame Ph positive cells with decitabine, a demethylatingagent which is already used in the treatmentof myelodisplastic syndromes, given the expressionof PRAME is regulated in embryonic cells by methylationstatus at the CpG islands of the promoterregion of this gene. Our findings indicated thatdecitabine showed a dose-dependent (1 to 5micrM)effect in the inducing the expression of PRAME.Indeed, we found that after 48 hours of in vitro incubationof Ph + cells in the presence of decitabine, thelevel of PRAME specific mRNA increased up to 15fold respect the untreated control cultures. Toincrease the capacity of the malignant cells to presentthis tumor antigen, we used the by-standertechnique to induce the expression of CD40L on Ph +CML cells. The method is based on the co-culture ofdecitabine-treated Ph + cells with MCR5 humanembryonic fibroblast cell line, previously transducedwith a adenoviral construct containing the fulllengthcDNA for the CD40L. The transduced MRC5cells express at high level CD40L at their membraneand this latter protein has been shown to have anintrinsic high capacity to transfer to other cells incolture. Indeed, we found that co-culture results inhigh effective transfer of CD40L on Ph + cells andcells harvested from the MRC-5 feeder layer had >70% of expression of CD40L after 48 h of co-culture.Finally, we used ELISpot assay to measure the IFN-g,production from autologous peripheral blood T cellwhen incubated in the presence of Ph positive cellswith by-stander induced expression of CD40L, andverified that the treatment with decitabine aloneinduces 5-fold increase of IFN-γ, while cells treatedwith decitabine and with the by-stander transfer ofCD40L induced 10-fold increase of IFN-γ production.Our results indicate that this combined in vitro treatmentof Ph + cells is able to enhance autologousimmune-mediated control of CML and that thismethod may by useful to develop an effective cellularimmunotherapy of this leukemia.Funding: Supported by Associazione Italiana per laRicerca sul Cancro (AIRC), and COFIN, Ministero dell'Istruzionee Ricerca Scientifica (MIUR), RegioneCampania, Intas (Brussel), EurLeukemiaNet (Brussel),Biogem (Avellino).haematologica vol. 89[suppl. n. 6]:september 2004

40Oral CommunicationsOral CommunicationsACUTE LEUKEMIASCO-33FISH DIAGNOSIS AND MONITORING OF THET(10;11)(P12;Q14)/CALM-AF10 REARRANGEMENT IN AML ANDT-ALLCrescenzi B,* La Starza R,* Romoli S,* Beacci D,*Zucchetti P,° Martelli MF,* Bohlander S, + MecucciC**Sez di Ematologia e Immunologia Clinica, PoliclinicoMonteluce, Università degli studi di Perugia;°Onco-ematologia pediatrica, Ospedale R Silvestrini,Perugia; + Medizinische Klinik and Oliklinik III,Klinikum Grosshadem, Munchen, GermanyCALM/AF10-t(10;11)(p12;q14) is the most frequentchromosomal change in T-cell acute lymphoblasticleukemia (T-ALL),occuring in appproximately 10% ofpediatric and adult cases (Asnafi et al. , Blood 2003).It is also associated with acute myeloid leukemias(AML), and with non-Hodgkin lymphoma. CD7 antigenexpression and T-restricted TCRδ rearrangementsseem to be present also in AML, suggesting that thet(10;11)(p12;q14/CALM-AF10 leukemias may berelated to the TCRγ-δ lineage. Here we report on twopediatric cases with t(10;11)(p12;q14) and diagnosisof T-ALL and AML, respectively. Patient #1.A 13 yearoldboy was referred to the Department of PediatricOnco-Hematology because of bilateral laterocervicallynphadenopathies and gingival haemorrage. Clinicalexamination revealed hepato-splenomegaly.Peripheral blood count was: Hb 11.3 gr/dL, PLT33×10 9 /L, WBC 15.5×10 9 /L (with 40% of blasts). Adiagnosis of ALL L1 was done on bone marrow aspirate.Immunophenotype was consistent with T-cellmature blasts positive for the following antigens:CD45, CD5, CD7, cyCD3, CD10, CD52, CD44, CD3, TdT,CD99.Patient is alive 15 months after diagnosis stillon treatment (Aieop lla 2000). Patient #2. A 12 yearoldgirl was referred because of fever, headache,arthralgia, fatigue, and pallor. Clinical examinationrevealed splenomegaly and inguinal microadenopathies.Peripheral blood count was: Hb 6.1 g/dL, PLT96×10 9 /L, WBC 249×10 9 /L (with 86% of blasts).Diagnosis of AML M1 was based on morphology andcytochemistry (26% of blasts myeloperoxidase positive).The following monoclonal antibodies werepositive: MPO, CD45, CD7, CD44, CD11a, CD11b,CD33, CD71, CD38, and CD34.Patient underwentchemotherapy and autologous bone marrow transplantation(aBMT). Relapse occurred as bone marrowinfiltration and multiple mammary nodules 11months after aBMT. DNA clones spanning the entireCALM gene (RP11-878E11) and flanking the AF10breakpoint (RP11-249M6 for the 3'AF10 and RP11-418C1 for the 5'AF10) were validated for FISH investigationson both metaphase cells, interphase nuclei,and cell cytospins for both diagnosis and monitoringof the malignant disorder.Funding. This work was partially supported by CNR-MIUR and FIRB.CO-34INSERTIONS GENERATING THE 5'RUNX1/3'CBFA2T1 GENE INACUTE MYELOID LEUKEMIA CASES SHOW VARIABLE BREAK-POINTSSpecchia G, 1,2 Albano F, 2 Anelli L, 1,3 Zagaria A, 1,3Liso A, 1 Mancini M, 4 La Starza R, 5 Sebastio L, 6Giugliano E, 7 Saglio G, 7 Liso V, 2 Rocchi M 31Hematology, University of Foggia, Foggia, Italy;2Department of Hematology, University of Bari, BariItaly; 3 Sezione di Genetica, DAPEG, University ofBari, Bari, Italy; 4 Dipartimento di Biotecnologie Cellularied Ematologia, University La Sapienza, Rome,Italy; 5 Hematology Unit, University of Perugia, Perugia,Italy; 6 Medical Genetics Service, A. O. R. N. A.Cardarelli', Naples, Italy; 7 Division of Hematologyand Internal Medicine, Department of Clinical andBiological Sciences of the University of Turin, ItalyTranslocation t(8;21)(q22;q22) is a common karyotypicabnormality detected in about 15% of AcuteMyeloid Leukemia (AML) cases. The rearrangementresults in fusion of the RUNX1 and CBFA2T1 genesgenerating a 5'RUNX1/3'CBFA2T1 transcriptionallyactive fusion gene on derivative chromosome 8 butsome cases with ins(21;8) and ins(8;21) have beenobserved. However, a detailed breakpoints characterizationof the insertion events has never beenreported in literature. Aims. We describe 6 among82 (7.3%) AML cases characterized by an insertionevent responsible for the RUNX1/CBFA2T1 fusion.Using FISH experiments with appropriate BacterialArtificial Chromosome (BAC) and P1 Artificial Chromosome(PAC) probes we were able to perform adetailed molecular cytogenetic characterization of1 case with ins(8;21) and 5 with ins(21;8). Methods.The 6 cases were individuated during screening of 82AML patients bearing the RUNX1/CBFA2T1rearrangement, detected by RT-PCR. Bone marrowsamples were studied by conventional cytogeneticanalysis after 24 or 48 hours culture. Selected BACand PAC clones were used to disclose rearrangementsinvolving the CBFA2T1 and RUNX1 genes. Indetail, the identification of the CBFA2T1 locus washaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200441obtained by using a mixture of BACs RP11-118O8and RP11-777J24, completely encompassing thegene; RUNX1 gene was detected by PAC RP5-1107L6.Results. Five cases showed a functional fusiongene on the der(21) instead of the der(8) chromosomeas a consequence of ins(21;8). The insertionsize was established in all cases and turned out to bevery heterogeneous, ranging from a minimum of 2.4Mb to a maximum of 44 Mb. In one case conventionalcytogenetics revealed a t(8;21)(q22;q22)instead of ins(21;8)(q22;q11q22) as a large chromosome8 region was inserted on der(21). Sequencesencompassing the breakpoints on chromosome 8were compared each other and with the regionincluding RUNX1 gene on chromosome 21, using theGenalyzer software. No significant similarity wasobserved. Conclusions. Overall analysis of the 18 AMLcases bearing ins(21;8) or ins(8;21) (12 reported inliterature and the 6 analyzed in the present study)suggests that (i) this kind of rearrangement seemsnot to be associated with a subset of patients withcommon features in terms of prognosis; (ii) the insertionsare not linked to the presence of additionalcytogenetic rearrangements; (iii) the crucial role that5'RUNX1/3'CBFA2T1 fusion gene plays in leukemogenesisdoes not appear to depend on breakpointlocation and insertion size.CO-35LEUKEMIA-ASSOCIATED IMMUNOPHENOTYPES SUITABLE FORMINIMAL RESIDUAL DISEASE MONITORING ARE FREQUENT INADULT B-LINEAGE ALL AND PERSIST AFTER BLAST-BONE MAR-ROW STROMA CO-CULTUREKrampera M, Perbellini O, Vincenzi C, Zampieri F,Vitale A,* Foà R,* Pizzolo G for the GIMEMA studyGroupDipartimento di Medicina Clinica e Sperimentale,Sezione di Ematologia, Università di Verona, Italy,*Dipartimento di Biotecnologie Cellulari ed Ematologia,Sezione di Ematologia, Università "La Sapienza"di Rome, ItalyWe have used a multiparametric approach, basedon quantitative flow-cytometry, to study whetherthe following leukemia-associated marker combinationsare suitable for minimal residual disease (MRD)detection in adult B-lineage ALL (B-ALL). We foundthat positive cells for these marker combinations innormal/regenerating bone marrow (BM, 10 samples)are less than 0.01% and have peculiar physical propertiesthat allow to discriminate normal cells from B-ALL blasts (56 BM samples). Suitable B-ALL cases,with at least one marker combination expressed by>50% of blasts, were 54/56.Among them, 32expressed more than one marker combination. Theseleukemia-associated immunophenotypes were stable,as they were still detectable at the end of the cocultureof scalar dilutions of blasts with a stromamonolayer. Thus, these marker combination will beused for immunophenotypic MRD detection in adultB-ALL in the forthcoming GIMEMA therapeutic protocol.CO-36IN VITRO TREATMENT OF AML BLAST CELLS WITH NF-KBINHIBITORS RESULTS IN THE DECREASE OF PROLIFERATIONAND INDUCTION OF APOPTOSISDefilippi I, Messa F, Arruga F, Morotti A, Gottardi E,Messa E, Carturan S, Fava M, Capella S, PautassoM, Saglio G, Cilloni DDepartment of Clinical and Biological Sciences,University of Turin, ItalyThe therapeutic results for many patients affectedby acute myeloid leukemia (AML) are at presentlargely unsatisfactory. The overall failure of currenttreatments are even more disappointing in olderpatients who cannot be enrolled in clinical trials withconventional chemotherapy. It is therefore of greatinterest to identify specific molecular targets todesign new therapeutic approaches. Recently, anincreased NF-κB activity has been demonstrated inblast cells from AML patients. The aim of the studywas to evaluate the in vitro effects of the NF-κBinhibitors in AML cell lines and in AML blast cellscollected from 12 AML patients at diagnosis. UnfractionedBM cells (8 cases) or sorted blast cells (4 cases)and HL60 cell line were incubated with the proteasomeinhibitors MG132 and PS341, with the IKbinhibitors Bay 11-7082 and the IKK inhibitorPS1145.The inhibition of NF-kB binding activity wasevaluated using ELISA method and immunofluorescencetechnique with an antibody against NF-κB.The proliferation rate was evaluated by MTT assayand the percentage of apoptotic cells by flow cytometryfor the detection of annexin V positive cells. InHL60 the incubations with of MG132 resulted in aninhibition of NF-κB binding activity of 40%, withPS341 of 65%, with BAY of 43% and with PS1145 of23%. The MG132 was able to decrease the proliferationrate of 63%, PS341 of 69%, Bay11-7082reduced the proliferation of 46% and PS1145 of72%. The reduction of proliferation was associatedwith an increase of apoptosis of 55% with MG132,of 47% with PS341, of 56% with BAY11-7082 and65% with PS1145.Similar results were obtained inBM MNC cells and sorted blast cells from AMLpatients. The incubation with MG132 or PS341resulted in a decrease of proliferation of 50% (range35-65%) and 55% (range 32-69%) respectively andhaematologica vol. 89[suppl. n. 6]:september 2004

42Oral Communicationsboth increased the percentage of apoptosis to amean value of 75%. (range 54-79%). The incubationwith BAY11-7082 and PS1145 decreased theproliferation of 49% (range 37-68%) and 51%(range 39-71%) respectively. The apoptosis wasincreased of 57% and 65% respectively. In additionthe colony growth was evaluated after incubation.The number of colonies was reduced of 89% respectto the control after incubation with MG132, of 74%with PS341, of 35% with BAY 11-7082 and 48% withPS1145.These data demonstrated that the in vitrotreatment with NF-κB inhibitors is able to block theproliferation and to induce apoptosis in AML blastcells. NF-κB may therefore be considered an attractivetarget for a molecular therapy in AML patientsnot candidate for conventional chemotherapy.CO-37DETECTION OF MLL REARRANGEMENTS INCLUDING THEMLL/AF9 FUSION IN ACUTE MYELOID LEUKAEMIA BY ASPECIFIC AND HIGHLY SENSITIVE FISH APPROACHCavazzini F, Cuneo A, Ciccone ML, Bardi A,Tammiso E, Agostini P, Castoldi GSezione di Ematologia, Dipartimento di ScienzeBiomediche e Terapie Avanzate, Università degliStudi di Ferrara, Italy11q23 chromosome translocations involving theMLL gene occur at a 3-5% incidence in acute myelogenousleukemia (AML) and identify a sub-categoryof AML in the WHO classification. A number ofpartner chromosome were identified and the mostfrequent reciprocal translocation is represented bythe t(9;11)(p21;q23)/MLL-AF9, accounting for 30-50% of AML with 11q23 breaks. The identification of11q23/MLL rearrangement is important in clinicalpractice and it is not clear whether the t(9;11) maycarry the same unfavourable prognostic significanceas other 11q23/MLL breaks. Because the molecularapproach to the detection of MLL rearrangements istime consuming and conventional cytogenetics mayhave low sensitivity, we designed a two-step fluorescencein situ hybridization (FISH) approach to thedetection and characterization of MLL breaks,including the t(9;11)/MLL-AF9.Probes. We used as afirst step screening PAC probes dj271a21 anddj167k13 mapping proximal and distal to the 11q23breakpoint. These probes were labelled in green (5prime) and red (3 prime) and carried a minimal overlapresponsible for the green-yellow-red fusion signal.In those cases showing an 11q23/MLL break, asecond step analysis was performed using the sameMLL probes directly labelled in green and BAC probes73e6 and 336o12 labelled in red recognising DNAsequences proximal and distal to the known AF9breakpoints. Samples. The probes were tested on 5normal BM controls, on 25 cases with AML withoutcytogenetic evidence of 11q23 translocation and on24 AMLs with an 11q23 translocation, 8 of whichhad the classical t(9;11)(p21;q23). The investigatorwas unaware as to the result of cytogenetic analysis.Results. More than ninety-eight percent of 1000interphase nuclei from the 5 control samples showedthe expected 2 fusion signal configuration using theMLL probes, and 97,3% of 1000 nuclei showed thenormal 2 green 2 red signal pattern using the MLLand AF9 probes. No case of cryptic 11q23 break wasseen among 25 cases without evidence of 11q23break at cytogenetic analysis. In one patient withsub-optimal quality of metaphase spreads an MLLbreak was detected by interphase FISH. An MLL splitsignal was observed in 56-78% of interphase nucleiin all 24 cases with an 11q23 translocation. In 1 casedeletion of the telomeric portion of MLL was seen in68% of the cells. The second step FISH experimentswere performed in 10 out of 24 cases with documentedMLL break, the remaining cases being currentlyunder investigation. No evidence of MLL/AF9fusion was detected in 6 patients with 11q23translocation other than the t(9;11), whereas a dualfusion signal was seen in 67-91% of the cells in 4patients with cytogenetic evidence of t(9;11). Nopatient with MLL/AF9 fusion showed microdeletionssurrounding the MLL and AF9 genes. We arrived atthe following conclusions: (i) Our first step probesystem has a very high sensitivity and specificity inthe detection of MLL breaks; (ii) It enables detectionof MLL deletions and duplications, which may in partbe missed by commercial probes; (iii) the MLL/AF9probes detected all known cases with t(9;11), with a100% specificity in interphase nuclei; (iv) overall, thefrequency of microdeletions surrounding the MLLand AF9 breakpoints appears to be low.CO-38INTERNAL TANDEM DUPLICATION OF BOTH MLL AND FLT3GENES IN MYELOID LEUKEMIAS WITH TRISOMY 11Rege-Cambrin G,* Giugliano E,* Scaravaglio P,*Serra A,* Michaux L,^ Stul M,^ Hagemeijer A,^Saglio G*Laboratory of Molecular Medicine and Oncology,Department of Clinical and Biological Sciences, Osp.S. Luigi Gonzaga, Orbassano, Italy; ^Center forHuman Genetics, University of Leuven, BelgiumIntroduction. Trisomy 11 as a sole chromosomalabnormality is a rare aberration observed in myelodysplasticsyndrome (MDS) and/or acute myeloblasticleukemia (AML). Molecular characterization of denovo AML with trisomy 11 has shown a consistenthaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200443association with a partial tandem duplication (PTD)of the MLL gene, reported in 20% to 73% of the cases.This rearrangement leads to in-frame fusion of aportion of the proto-oncogene with itself, and thisseems to represent a new genetic mechanism forleukemogenesis. Self-fusion of the MLL gene hasbeen also observed in patients with normal karyotype,although at a much lower frequency. Internaltandem duplication (ITD) has been demonstrated asa oncogene-activating mechanism also in anothergene involved in AML, namely the FLT3 gene, whichencode for a receptor tyrosine kinase widelyexpressed in hemopoietic cells and precursors. FLT3-ITD occurs in approximately 20% of unselected denovo adult AMLs, with a higher frequency in patientswith normal cytogenetics and is associated with poorprognosis in most series. Coduplication of MLL andFLT3 has been first observed by Jamal (Genes ChromCancer 2001) in two cases of AML, one also showingtrisomy 11.Aim of the study: to evaluate the presenceand the possible association of the MLL andFLT3 tandem duplication in 20 patients with myeloidmalignancies carrying a trisomy 11 as a primaryanomaly. Methods: Karyotype was analyzed bothwith standard cytogenetics and FISH with centromericprobe for chromosome11 and double-colorprobe for MLL gene. Southern blot was used to evaluateMLL rearrangement, and MLL-PTD was confirmedby RT-PCR (Caligiuri MA, Cancer Res 1996).FLT3-ITD was analyzed by RT-PCR (Nakao M et al. ,Leukemia 1996). Results: Diagnosis was AML, eitherde novo or secondary, in 15 patients; MDS in 4 cases;myeloproliferative disorder in accelerated phasein one case. We observed a MLL duplication in 41%of the patients with +11 (54% of AML patients). FLT3internal tandem duplication was observed in 31% ofthe patients with trisomy 11 (38.5% of AMLpatients), with a overall incidence similar to thatobserved in patients with normal karyotype. However,4 out of 5 (80%) of the FLT3-ITD + cases alsoshowed MLL-PTD, in contrast to FLT3-ITD negativecases where MLL-PTD was observed in 3/11 (27.3%).Median survival was 14.5 months for the wholegroup of +11 cases, 18 months for the patients negativefor the MLL-PTD and only 6 months for thepatients who had a MLL-PTD. Conclusions: Trisomy11 is associated with a group of AML and MDS characterizedby a poor clinical outcome; more than 40%of these patients also show the internal duplicationof MLL, and these cases have an extremely poorprognosis. FLT3-ITD appears to be quite common inpatients with MLL self-fusion and coexpression ofthe two anomalies could be explained on the basisof a common pathogenetic mechanism and/or similarresponse to genotoxic stress. FLT3 duplicationmay cooperate in determining the poor outcomeobserved in patients with trisomy 11.CO-39COMBINED ANALYSIS OF BCL-2 AND MDR1 PROTEIN IN 256CASES OF ACUTE MYELOID LEUKEMIAMazzone C, Maurillo L, Del Poeta G, Del Principe I,Venditti A, Panetta P, Cox C, Neri B, Ottaviani L,Amadori SCattedra-Divisione di Ematologia, Osp. S. Eugenio,Università di Rome "Tor Vergata", ItalyChemotherapy failure due to cellular drug resistanceis a major problem in the treatment of acutemyeloid leukemia (AML). The objectives of the studywas to investigate the coordinate expression ofMDR1 and bcl-2 proteins in de novo AML. Theexpression of the two proteins was analyzed by flowcytometry in a large series of 256 consecutive casesof AML. The results were achieved as percentage ofpositivity and relative mean fluorescence intensity(rMFI). To determine individual protein levels, anindex which equals the product of the percentage ofpositive cells and rMFI, was also generated. Using acut-off of 800 and 300 of index value for bcl-2 andMDR1, respectively, we identified 4 different classesof AML: 1) double neg; 2) single pos[bcl-2 + MDR1 − ];3) single pos[bcl-2-MDR1 + ]; 4) double pos. The highestincidence of double neg cases was observed inthe M2 class whereas double pos cases occurredmore frequently in the M4, M5 and M6 subgroups.Seventy-eight percent and 71% of M0 and M1,respectively, belonged to the single pos[bcl-2+MDR1-] group (p = 0.00001). Accordingly, therewas a significant association between single pos[bcl-2 + MDR1 − ] pattern and CD34 expression (p =0.00001). In the double pos group, 57% of the caseshad a poor prognosis karyotype, 37% intermediate,and only 6% of the patients had a good prognosiskaryotype (p = 0.04). Twenty-eight percent ofpatients belonging to the double pos categoryachieved CR, whereas for double neg, single pos[bcl-2 + MDR1 − ] and single pos[bcl-2-MDR1 + ] category,the CR rate was 69%, 52% and 56%, respectively (p= 0.00038). In multivariate analysis, the double posstatus independently affected frequency of CR (p =0.008). In conclusions, the combined analysis of bcl-2 and MDR1 allowed different classes of AML to beidentified. Bcl-2 is over-expressed in immature AML,conversely, MDR1 is over-expressed in terminally differentiatedAML. However, the occurrence of the twoproteins is not mutually exclusive since their coordinateexpression defines a distinct subset of AMLwith a very poor prognosis.haematologica vol. 89[suppl. n. 6]:september 2004

44Oral CommunicationsCO-40POTENTIAL USE OF CD40L + BCP-ALL CELLS-LOADED DC TOTRIGGER ANTITUMOR IMMUNITY IN B CELL PRECURSORACUTE LYMPHOBLASTIC LEUKEMIAMarin V,* Bonamino M,* Biondi A,* D'Amico G**Centro Ricerca M. Tettamanti, Dipartimento diPediatria, Università Milano Bicocca, ItalyChildhood B-cell precursor acute lymphoblasticleukemia (BCP-ALL) is the most common form ofcancer in children. Immunization strategies in cancerfrequently have as common denominator the targetingof dendritic cells (DC) with its maturationstage playing a pivotal role in the development offunctional CD8 + T cells and polarization of CD4 + T cellstoward IFN-γ production. The finding that DC canpresent antigens derived from apoptotic cellsprompted us to explore the feasibility of using DCpulsed with apoptotic BCP-ALL cells as adjuvants forstimulating immune responses against leukemiccells. To promote DC maturation during phagocytosiswe induced the expression of CD40L on BCP-ALLcells by bystander transfer from a stable infectedhuman bone marrow stromal cell line (HBMS) highlyexpressing human CD40L. After 24h of co-colture,more than 30% of BCP-ALL cells expressed CD40L.These cells were then induced to undergo to apoptosisby UV irradiation, and co-cultured with immaturemonocytes derived-DC at 2:1 CD40L+BCP-ALLcells/DC ratio for 24 hours. At the end of incubation,DC were analyzed for CD80, CD83 and CD86 expressionby flow cytometry and IL-12p70 production byELISA. DC incubated with CD40L + BCP-ALL cellsexpressed high level (more than 70%) of the maturationmarker CD83, while no CD83 up-regulationwas observed if CD40L- cells were used. Moreover,further maturation induced by phagocytosis ofCD40L + BCP-ALL cells resulted in higher APC activity,associated with higher expression of co-stimulatorymolecules (CD80 and CD86) and higher abilityto stimulate a strong proliferative response of allogenicT cells in MLR assay. In addition, CD40L + BCP-ALL cells-loaded DC secreted IL-12p70 (0,3-2 ng/mL).In selected cases we tested the IFN-γ and IL-4 productionby intra-staining analysis of naive lymphocytesco-cultured with CD40L + BCP-ALL cells-loadedDC. In line with previous finding, these cells able toproduce IL-12p70, induced a very high (30%) Th1polarization. The capacity of CD40L + BCP-ALL cellsloadedDC to induce anti-leukemia cytotoxicity wasdetected by 51 Cr release assay after co-culture withT-cells in an allogenic setting. T-cells and monocytederivedDC were obtained from healthy donors. DCwere pulsed with BCP-ALL cells expressing or notCD40L. After co-colture with CD40L + BCP-ALL cellsloaded-DC,T cells showed strong proliferation inresponse to leukemic cells. Moreover, T-cells culturedwith CD40L+BCP-ALL cells pulsed-DC showed higherreactivity against leukemic cells than those culturedwith BCP-ALL cells pulsed-DC (mean value47.7%, range 30%-74.5% and mean value 13.5%range 0%-20%, respectively). In addition, blocking ofMHC class I on target cells significantly abrogatedleukemic blast lysis. In conclusion, we have demonstratedthat, after phagocytosis of CD40L + BCP-ALLcells, DC matured in potent APC able to generatecytotoxic activity against leukemic cells. Based onthese preliminary findings we suggest that the DCbasedvaccine may be an attractive strategy for BCP-ALL immunotherapy.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200445Oral CommunicationsCHRONIC MYELOPROLIFERATIVE DISORDERSCO-41PRV-1 OVEREXPRESSION, ENDOGENOUS ERYTHROIDCOLONIES, AND REDUCED PLATELET MPL CONSTITUTE INDE-PENDENT PHENOTYPIC VARIATIONS UNRELATED TO CLONALITYOR THROMBOSIS IN ESSENTIAL THROMBOCYTHEMIAAntonioli E, Vannucchi AM, Grossi A, Pancrazzi A,Guglielmelli P, Bogani C, Balestri F, Biscardi M,Bulgarelli S,* Longo G, Bianchi L, Gugliotta L,* Bosi AUniversity of Florence, Dept. Hematology, *HematologyUnit, Arcispedale S. Maria Nuova, Reggio Emilia,ItalyFemales with the monoclonal type of essentialthrombocythemia (ET), based on the X-chromosomeinactivation pattern (XCIP), have been shown in previousstudies to present a higher incidence of thrombosisthan polyclonal ones. We aimed to assess correlationsbetween XCIP, thrombosis, and three epigeneticmarkers of ET, namely PRV-1 overexpression,endogenous erythroid colony (EEC) formation, andreduced platelet Mpl content. PRV-1 expression wasmeasured by Real-Time quantitative PCR, platelet Mplby western blotting, and EEC by standard methylcellulosecultures. Of the 100 patients enrolled, 12 wereexcluded because of XCIP homozygosity or the presenceof an ambigous pattern. Of the 88 subjectsevaluable, fifty-three (60%) had monoclonalmyelopoiesis; clinical characteristics were similarbetween these patients and those with polyclonalmyelopoiesis. However, the frequency of thromboticevents was different in the two groups; in fact, 17 of53 patients with monoclonal myelopoiesis (32.0%)had suffered from clinically and instrumentally documentedmajor thrombosis, either as the initial manifestation(15 cases) or in the follow-up (2 cases), ascompared to 2 out of 35 subjects (5.7%) with polyclonalmyelopoiesis (p=0.009). 28/87 pts had PRV-1overexpression, accounting for 28% and 38% of monoclonaland polyclonal respectively; EEC were foundin 39% of pts, 48% and 28% of monoclonal and polyclonalpts, respectively (p=0.054). Reduced plateletMpl was found in 71% of pts, 75% and 63% of monoclonaland polyclonal, respectively. There was no correlationbetween the presence of any of these abnormalities(nor in multivariate analysis) with XCIP orthrombotic risk. We conclude that the exploited epigeneticmarkers constitute independent phenotypicvariations and are not clustered according to monoclonalityof myelopoiesis in ET; none of them mightserve as a surrogate marker of thrombotic risk in malesubjects with ET as is the XCIP status in females.CO-42GENOMIC DELETIONS ON OTHER CHROMOSOMES INVOLVED INVARIANT T(9;22) CHRONIC MYELOID LEUKEMIA CASESAnelli L, 1,3 Albano F, 2 Zagaria A, 1,3 Liso A, 1 PastoreD, 2 Pannunzio A, 2 Greco G, 2 Rocchi M, 3 Liso V, 2Specchia G 1,21Hematology, University of Foggia, Foggia, Italy;2Department of Hematology, University of Bari,Italy; 3 Sezione di Genetica, DAPEG, University ofBari, ItalyBackground. The Philadelphia chromosome (Ph),due to t(9;22)(q34;q11), is the cytogenetic hallmarkof chronic myeloid leukemia (CML) and is observed inmore than 95% of cases. At diagnosis, in 5-10% ofCML patients the Ph chromosome is derived fromrearrangements, consisting of either simple or complexvariant translocations, other than the standardt(9;22). Large deletions adjacent to the translocationjunction on the derivative 9 chromosome haverecently been identified in patients with CML. Wehave documented and characterized the presence ofsimilar deletions on the third derivative other thanchromosomes 9 and 22 in 4 CML cases with varianttranslocations, using fluorescence in situ hybridization(FISH). Patients and Methods. We studied 11 casesaffected by CML with variant translocations atdiagnosis. FISH analysis was performed using P1 artificialchromosome (PAC) or bacterial artificial chromosome(BAC) probes. Cohybridization FISH experimentswere performed with sets of probes designedto detect deletions flanking the breakpoint region onthe third derivative chromosome. All the deletionswere then studied in detail with an appropriate panelof BAC/PAC clones. A set of 16,19,22 and 12 BAC-PAC clones was used to characterize the deletions incases #1, #2, #3 and #4, respectively. Results. Of the11 cases, 7 (64%) bore large deletions on der(9).Among them, we found 4 cases (57%) withmicrodeletions also on the third derivative chromosome:t(6;9;22) (p12;q34;q11), t(9;13;22)(q34;q14;q11), t(4;9;22) (p15;q34;q11), t(9;22;11)(q34;q11;q13) in cases #1,#2, #3, and #4, respectively.In case #1 the deletion on der(6) showed a sizeof 2.7 Mb, with the loss of 4 known genes; amongthem is TNFRSF21, which encodes for a receptor thatwhen activated, leads to the engagement of componentsof the apoptosis pathway. Case #2 presented adeletion on the der(13) chromosome 6 Mb in size,within which 15 known genes are located; amongthem, three genes are involved in the regulation ofcell proliferation (RB1, RFP2, and DLEU1). Case #3haematologica vol. 89[suppl. n. 6]:september 2004

46Oral Communicationsshowed an extensive deletion of 20.4 Mb on der(4),with loss of 44 known genes; among them are twogenes involved in cell cycle regulation: GAK (cyclin Gassociated kinase) and CTBP1 (COOH-terminal bindingprotein 1). In case #4 the breakpoint characterizationon chromosome 11 allowed us to identify a1.2 Mb deletion; 35 genes with known function arelocated in this deleted region. Three of these genesare involved in the apoptotic mechanism and in cancercells proliferation: REQ, HTATIP, and CST6.Conclusions.Our study showed an association betweendeletions on der(9) and the loss of genomic sequencesof other chromosomes involved in variant t(9;22).FISH analysis of these cases using specific PAC andBAC probes allowed us to precisely define the extensionof genomic material loss and to verify whichgenes were deleted. The observation that in 4 caseswith deletions on the third derivative chromosomethe deleted sequences included tumor suppressorgene and/or other genes involved in signal transductionor in modulation of cell proliferation, may yieldfurther information about the pathogenesis of CML.CO-43GENE EXPRESSION PROFILE OF CD34 + CELLS FROM IDIOPATHICMYELOFIBROSIS PATIENTSGuglielmelli P, Manfredini R,* Bianchi L, Zini R,*Pancrazzi A, Mannelli F, Salati S,* Lombardini L,Bosi A, Ferrari S,* Paoletti F,° Vannucchi AMDept Hematology, University of Florence, *Dip SciBiomed, University of Modena-Reggio Emilia,°Dept Exp Pathol Oncol, University of Florence, ItalyWith the aim to identify differentially expressedgenes and, possibly, disease-specific transcripts,CD34 + cells purified from the peripheral blood ofpatients with idiopathic myelofibrosis (IM) werecompared to CD34 + cells purified from either thebone marrow (BM) or the G-CSF primed leukoapheresis(PB) collected from normal donors. Geneexpression profiling was carried out in triplicate(each sample was the pool of 5 distinct subjects)using Affymetrix HG-U133A GeneChip array, representativeof 22,283 transcripts. The number of geneexpressed was comparable in the two cell populations:10,975 sequences in IM CD34 + vs 10,899 and11,934 in normal BM- and PB-derived CD34 + cells,respectively. A number of genes were differentiallyexpressed; of these, 343 and 151 sequences wereincreased in IM vs normal BM and PB CD34 + cells,respectively. On the other hand, 313 and 147 geneswere decreased in IM vs normal BM and PB CD34 +cells, respectively. The prevalent biological processbranches affected by these changes were traced bymeans of GO Mining Tool software and involved regulationof cell cycle, defense response, cell adhesionand oncogenesis. Among the genes increased in IMvs all normal CD34 + cells we found transcription factorslike WT1, GAS2, (p45)N-FE2, HOXA7, and ETS2;adhesion molecules/differentiation regulators, suchas DLK1, vWF, TIMP3 or CD9, and receptors like leptinreceptor. Among the genes down-regulated, therewere IL-8, pre-B-cell colony-enhancing factor; interestingly,CXCR4, the receptor for SDF-1, was significantlyreduced in IM CD34 + cells, and we speculatethat this fact might be related to the high numberof circulating CD34 + cells in IM. Some genes, liketrophoblast glycoprotein, showed de-novo expression.These data, indicating that the expression profileof IM CD34 + cells has unique features comparedto either BM or PB normal CD34 + cells, might help toidentify gene(s) important for the pathogenesis ofIM, and potentially useful as disease marker(s).CO-44IMATINIB-MESYLATE AS EXPERIMENTAL THERAPY IN SYSTEMICMASTOCYTOSIS WITH D816V C-KIT MUTATION BUT WITHOUTFIP1L1-PDGFRA FUSION TRANSCRIPTRondoni M, Malagola M, Piccaluga PP, Gaitani S,Soverini S, Ottaviani E, Rosti G, Ricci P, Testoni N,Poerio A, Grafone T, De Vivo A, Amabile M, Bosi C,Baccarani M, Martinelli GInstitute of Hematology and Medical Oncology “L.and A. Seràgnoli”, University of Bologna, ItalyHuman systemic mastocytosis (SMCD) is a rare diseasecaused by an abnormal mast cell accumulationin various tissues. It usually occurs as a sporadic diseasethat is often persistent or progressive in adults,and it is often associated with eosinophilia. SM hasbeen supposed to be associated with two classes ofconstitutive activating c-kit somatic mutations: theso-called enzymatic site type (EST) mutations, affectingthe structure of the catalytic portion of thekinase (e. g. , D816V) and the regulatory type (RT)mutations, affecting the regulation of an otherwisenormal catalytic site (e. g. , V560G). Recently, imatinibhas proven effective in the treatment of chronicmyeloproliferative disorders (CMPD) that are associatedwith rearrangement of the PDGFRβ with differentpartners, and recently in some patients withsystemic mastocytosis with eosinophilia (SMCD-eos),characterised by CHIC2 gene deletion. More recently,imatinib mesylate has proven effective in thetreatment of hypereosinophilic syndrome with thepresence of FIP1L1-PDGFRa rearrangement. Kinaseinhibitors blocking constitutive c-kit activation, suchas Imatinib, might be used as therapeutic agents inSMCD, but there is increasing in vitro evidence thatImatinib is able to inhibit both wild-type and ESThaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200447mutant c-kit, but has no effect on RT mutant kit.Here, we report on six patients that met the majorclassification criteria for SMCD, that were symptomaticand that had the diagnosis of SMCD based onbiopsy-proven and histological and immunohistochemistryevidence of Systemic Mastocytosis. Weconsidered two patients as aggressive systemic mastocytosis(ASM), and three of them as indolent sporadicmastocytosis (ISM); one of the patients couldbe considered SM with an associated clonal hematologicnon-mast cell lineage disease (AHNMD) classifiedas SM-NHL. Five of them were male and onefemale. Tryptase serum levels were elevated in all ofthem (>190mg/L). Two patients has both absoluteand perceptually elevated eosinophils in their peripheralblood (45% and 19%, respectively). xWe treatedfour of them with Imatinib therapy (400 mg/die)for a median period of 3 months (range 1,5-5months). Before therapy, mastocyte cells from all ofthem were found positive for A816 mutant of c-Kitand negative for the presence of FIP1L1-PDGFRα,PDGFRβ-ETV6 and FGR1-BCR fusion transcripts,occasionally associated with SMCD with eosinophilia.One patient, with elevated count of eosinophils inperipheral blood, showed an initial response to Imatinib,but lost it after 1 month from the beginning oftreatment. Another patient had a decrease of themastocyte bone marrow infiltration. The remainingtwo patients were non-responsive. Our observationsconfirm the in vitro data showing that Imatinibtreatment is ineffective for SM characterized by ESTc-kit mutations, also if associated with hypereosinophilia.Funding: COFIN 2003, by FIRB 2001, by the Universityof Bologna (60% grants), by the Italian Associationfor Cancer Research (A. I. R. C. ), by the ItalianNational Research Council (C. N. R), and bygrants from the Campania Region, Fondazione delMonte di Bologna e Ravenna and A. I. L.CO-45THE ROLE OF CDK2-CDC25A-CDK2 AXIS IN THE RESISTANCETO STI571 (IMATINIB) OF CLONAL MYELOID PROGENITORSTRANSDUCING THE P210 BCR-ABL FUSION GENEMancini M, Pavan S, Saponaro M, Calabrò A,Brusa G, Santucci MAIstituto di Ematologia e Oncologia Medica "Lorenzoe Ariosto Seràgnoli", Università di Bologna, ItalyUnrestrained progression throughout cell cycle,mostly resulting from the abrogation of G1/S checkpoint,has a key role in the pathogenesis and progressionof Chronic Myeloid Leukemia (CML). It permits,in fact, the illegitimate enlargement of clonalhematopoiesis over its normal counterpart and causesthe genomic instability that drives further evolutiontowards the fully transformed phenotype ofblast crisis. It is conditional upon the constitutivetyrosine kinase of p210 bcr-abl fusion protein thatthrough interactions with a complex network,including signal transcription factors, adaptor proteins,cytoskeletal components and proteins involvedin the DNA repair process, continuously transducesthe mitogenic signal and deleteriously impacts thefidelity of replicated DNA. Accordigly, the tyrosinekinase inhibitor STI571 (Imatinib) is considered, sofar, the first-choice drug in the management of CML.In our previous studies we provided evidence for a ofa role of Cdk2 in bcr-abl-rearranged myeloid progenitorescape from STI571 effects on p210 tyrosinekinase (Mazzacurati et al. , The Hematology Journal5,168-177, 2004). The aim of our present study wasto investigate whether the Chk2-Cdc25A-axis, apathway alternative to p53 in the control of Cdk2activity, may drive CML progenitor clonal evolutiontowards STI571 unresponsiveness. In p210 bcr-abltransduced32D cell clones the resistance toSTI571was, indeed, associated with a significantenhnacement of Cdk2 phosphorylation and activityresulting, in turn, from Cdc25A overexpression, thatis expected to catalyze more efficiently the removalof Cdk2 phosphorylation at Thr14 and Tyr15, andWee1 downmodulation, that would preclude theCdk2 inhibitory phosphorylation at Tyr15.BothCdc25A overexpression and Wee1 downmodulationoccurred independently from p210 bcr-abl amplificationand proceeded from two autonomous pathwys:the dowmodulation and inactivation of Chk2(whose phosphoryaltion addresses Cdc25A towardsthe ubiquitin-dependent/proteasome-mediated degradation)and the upregulation of c-Myc (that is atranscriptional regulator of Cdc25A). In conclusion,our results suggest that Cdk2 may be considered asan additional target in the treatment of CML andChk2-Cdc25A levels as predictors of bcr-ablrearrangedmyeloid progenitor response to STI571.Funding: The study was supported by Università diBologna (ex60% and Progetti Pluriennali), CarisboFoundation, Forlì-CesenaAIL and CIB. GB is therecipient of a grant entitled to Mrs. Lalla Seràgnoli.CO-46SODIUM VALPROATE ENHANCES IMATINIB INDUCEDAPOPTOSIS AND GROWTH ARREST IN BCR-ABL CELL LINESMorotti A, Cilloni D, Pautasso M, Baraban D, MessaF, Arruga F, De Filippi I, Messa E, Carturan S,Rege-cambrin G, Pilatrino C, Guerrasio A,Gottardi E, Saglio GDept. of Clinical and Biological Sciences, Universityof Turin, Italyhaematologica vol. 89[suppl. n. 6]:september 2004

48Oral CommunicationsThe molecular hallmark of CML is the expression ofthe chromosomal translocation t(9;22) which encodesfor the tyrosine kinase Bcr-Abl. The developmentof the specific inhibitor of Abl tyrosine kinaseactivity Imatinib (formerly STI-571, Novartis, Basel,Switzerland) completely revolutionises the therapyand the prognosis of CML patients. Recent clinicaltrials have shown that Imatinib induces completehematological responses in 95% of chronic phaseCML patients. Unfortunately, complete cytogeneticresponses are not achieved in about 30% of Imatinib-treatedCML patients. Moreover in acceleratedphase and in blast phases, Imatinib appears to besensibly less effective. The persistence of neoplasticcells expressing t(9;22) translocation during Imatinibtreatment suggests that sooner or later a clonalexpansion could occur with a relapse of the disease.So additional therapies are required to completelyeradicate residual Bcr-Abl positive cells during Imatinibtherapy. HDAC inhibitors are a new and promisingclass of anticancer drugs, which show impressiveactivities in many cell types. Recent evidences haveattributed to HDAC inhibitors the role of enhancersof Imatinib in CML cell lines. Unfortunately thedescribed drugs are not already available to the clinicalusage. Valproate, which is commonly administratedfor the treatment of epilepsy, has been recentlydescribed as a potent HDAC inhibitor. The aim ofthe present study was to evaluate the ability of Valproateto increase Imatinib-induced apoptosis andgrowth arrest in CML cell lines and in CML patient'sbone marrow samples. In particular we have treatedthe Bcr-Abl positive Imatinib-sensible and resistantK562, KCL-22 and CML-T1 with 5 microM Valproate,0.5 µM Imatinib and with the combination of thetwo drugs. After 48 hours of incubation, cell growth(cell count) and apoptosis (quantified by Cell DeathDetection Elisa) have been evaluated. The associationImatinib plus Valproate enhances Imatinibinduced growth arrest and apoptosis in Imatinib sensiblecell lines. In Imatinib resistant K562 and KCL-22cell lines, the exposure to 0.5 microM Imatinib doesnot affect proliferation nor apoptosis, but when associatedwith Valproate, basal proliferation is reducedof about 50% with a sustained induction of apoptosis.An important effect of Imatinib is the abrogationof CML multilineage colony-forming units (CFU-Mix),granulocyte macrophage-colony-forming unit (GM-CFU) and erythroid burst-forming unit (BFU-e) colonyformation. In Imatinib resistant patients, Imatinibdoes not affect colony formation of bone marrowsamples. We have isolated bone marrow mononuclearcell from two informed patients, in hematologicaland cytogenetic resistance to Imatinib, to testthe clonogenic potential in the presence of Valproate,Imatinib and the association of the two drugs. Imatinibalone have inhibited minimally the growth ofCFU-Mix, GM-CFU and BFU-e colonies but whenImatinib is combined with Valproate the number ofcolonies is sensibly reduced. Bone marrow mononuclearcells of the same patients have been treated for24 hours with Valproate, Imatinib and the associationof the two drugs. At the end of the incubation, apoptosishas been evaluated by flow cytometry detectionof Annexin V. The exposure to Imatinib and Valproatealone do not affect apoptosis of the cells while thecombined exposure determinates an increase ofannexin V positive cells, suggesting an importantinduction of apoptosis. Western blot analysis showsthat the association of the two drugs does not directlyinterfere with the phosphorylation state of Bcr-Abl and its signal transduction. In conclusion, thesedata suggest that the combined therapy, low doseImatinib plus Valproate, could enhance the Imatinibinducedapoptosis and growth arrest. This strategycould contribute to a complete eradication of residualBcr-Abl positive clones in those patients in whichcomplete cytogenetic remission is not reached duringImatinib treatment.CO-47THE IN VITRO TREATMENT WITH NF-KB INHIBITORS IS ABLETO OVERCOME IMATINIB RESISTANCE IN CELL LINES AND CMLRESISTANT PATIENTSArruga F,* Messa F,* Defilippi I,* Morotti A,*Gottardi E,* Carturan S,* Messa E,* Capella S,*Fava M,* Pautasso M,* Saglio G,* Cilloni D**Department of Clinical and Biological Sciences,University of Turin, ItalySeveral data demonstrated that Imatinib resistancemay be due in same patients to the presence of BCR-ABL independent signals responsible for the survivalof the Ph-positive clone despite effective targetingof BCR-ABL. It is therefore of great relevance to identifyalternative molecular targets to block the oncogenicpathway in these subset of patients. Anincreased NF-kB activity has been demonstrated inCML cells and in K562 cells. The aim of the studywas to evaluate the effects of the NF-kB inhibitorsin cell lines and in CML patients sensitive and resistantto Imatinib therapy both alone or in combinationwith this latter. We incubated K562 and KClboth sensitive (s) and resistant (r) cells and the BMcells collected from 6 cytogenetic resistant patients,two of them also hematological resistant with theproteasome inhibitors MG132, PS341 and the IKbinhibitor Bay 11-7082 and IKK inhibitor PS1145.Theinhibition of NF-kB binding activity was evaluatedusing ELISA method and immunofluorescence techniquewith an antibody against NF-kB. The proliferationrate was evaluated by MTT assay and the per-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200449centage of apoptotic cells by flow cytometry for thedetection of annexin V positive cells. In K562s Imatinibincubation reduced the proliferation rate of48%, MG132 of 45%, BAY11-7082 of 40% andPS1145 of 65%. The reduction of proliferation wasassociated with an increase of apoptosis, 30% withImatinib, 25% with both proteasome inhibitors, 28%with BAY11-7082. Similar results were obtained inKCls cells. By contrast Imatinib incubation of K562rand KClr did not result in a significant inhibition ofproliferation. By contrast, the proteasome inhibitorsinduced a reduction of proliferation of 70%, BAY11-7082 and PS1145 of 10% and 22% respectively.Interestingly, the combination of Imatinib withMG132 or PS341 induced a reduction of proliferationof 82% and 89% respectively, and the induction ofapoptosis 54% and 40%. The association of Imatinibwith BAY11-7082 resulted in a reduction of proliferationof 87% and an increased of apoptosis of 59%and the association with PS1145 reduced the proliferationof 87% and increased apoptosis of 67%.Similar results were obtained in CML patients resistantto Imatinib. The association of Imatinib withMG132 resulted in a decrease of proliferation of47%, (range 35-64%) and increase of apoptosis of62%. (range 51-89%). Similar results were obtainedwith thw association of PS341 (mean reduction ofproliferation of 49%. The association with BAY andPS1145 decreased the proliferation of 57 and 61%respectively (range 35-69% for BAY and 29-72% forPS1145) and both increased apoptosis with meanvalue of 56% and 60%. Moreover the colony growthobtained from BM cells after incubations was inhibitedof 70% and 81% with the association of Imatinibwith MG132 and PS341, and was inhibited of61 and 79% with the association with BAY andPS1145 respectively. Finally, these data were confirmedby the experiments performed on K562 cellstransfected with IKb super-repressor which blocksNF-KB in the inactive status. In line with the resultsdescribed, these cells showed a proliferative arrestand an increase of the apoptosis rate. We concludethat NF-kB inhibitors present a potential activity inImatinib resistant cells and particularly, the combinationof Imatinib and NF-kB inhibitors is able tostrongly block the proliferation and to induce apoptosisin cell lines and CML patients resistant to Imatinibtherapy. The combination of Imatinib and NF-KB inhibitors may therefore represent an attractivetherapy for CML resistant patients.CO-48PREDICTION OF RESPONSE TO IMATINIB BY PROSPECTIVEQUANTITATION OF BCR-ABL TRANSCRIPT IN LATE CHRONICPHASE CHONIC MYELOID LEUKEMIA PATIENTSMartinelli G, 1 Rosti G, 1 Pane F, 3 Amabile M, 1Soverini S, 1 Izzo B, 3 Giannini B, 1 Poerio A, 1 CilloniD, 2 Terragna C, 1 Ottaviani E,1 Grafone T,1 De VivoA, 1 Testoni N, 1 Bassi S, 1 Rege Cambrin G, 2 BonifaziF, 1 Gottardi E, 2 Trabacchi E,1 Alberti D, 4 SalvatoreF, 3 Saglio G, 2 Baccarani M 1 (Study and writingcommittee for the Italian Cooperative Study Groupon Chronic Myeloid Leukemia)From the 1 Institute of Hematology and MedicalOncology “L. and A. Seràgnoli”, University of Bologna;2 Division of Hematology and Internal Medicine,Department of Clinical and Biological Science, Universityof Turin; 3 CEINGE Biotecnologie Avanzateand Department of Biochemistry and Medical Biotechnology,University of Naples Federico II; 4 NovartisPharma, Origgio; ItalyImatinib mesylate (STI571), a specific Bcr-Abl tyrosine-kinasesignal-transduction inhibitor, has shownantileukemic activity in clinical studies, becomingthe standard therapy for Philadelphia chromosomepositive(Ph+) chronic myeloid leukemia. Predictionof response to imatinib cannot be anticipated withcertainty by repeated examination of bone marrowmetaphases for the presence of the Ph chromosome.The quantitative reverse-transcriptase polymerasechain reaction (QRT-PCR) has proved extremely valuablefor assessing and monitoring minimal residualdisease in patients who achieve Ph negativity withimatinib mesylate, but few data are available on theuse of QRT-PCR for predicting response to the drug.We used this method on 191 out of 324 chronicmyeloid leukemia patients in the late chronic phaseentered into a phase II clinical trial conducted by theItalian Cooperative Study Group on Chronic MyeloidLeukemia with imatinib 400 mg/day administeredorally as second-line therapy. Bone marrow sampleswere collected before treatment, after 3, 6 and 12months or at the end of study treatment (12 months)while peripheral blood samples were obtained after2, 3, 6, 10, 14, 20 and 52 weeks of therapy. QRT-PCRanalysis was standardized and performed in threedifferent laboratories, and the amount of Bcr-Abltranscript was expressed as the ratio of Bcr-Abl toβ2-microglobulin (β2M). Before imatinib therapy, wefound a different amount of neoplastic transcript inbone marrow and peripheral blood (p>0.001), reflectingthe higher percentage of myeloid precursor inbone marrow. In the nonresponders, the Bcr-Abl:β2M ratio in bone marrow remained substantiallystable during the treatment, while in patientsobtaining a complete, stable cytogenetic responsehaematologica vol. 89[suppl. n. 6]:september 2004

50Oral Communicationsthe transcript ratio decreased significantly from0.246 baseline to 0.0062 after 3 months, to 0.0009after 6 months and to 0.0008 after 12 months.Analysis of blood samples was as informative as bonemarrow at 3, 6, 9 and 12 months. At 2 months (+57days) after the start of imatinib therapy the differencesbetween no cytogenetic response and a complete,stable cytogenetic response were detectable,thus affording an early prediction of the karyotypicresponse to imatinib. We show that, following initiationof imatinib, the early Bcr-Abl level trends inboth bone marrow and peripheral blood samplesmade it possible to predict the subsequent cytogeneticoutcome after 6 and 12 months of treatment,and that these early trends were also predictive ofprogression-free survival.Funding: Supported by: COFIN 2003, by FIRB 2001,by the University of Bologna (60% grants), by the ItalianAssociation for Cancer Research (A. I. R. C. ), by theItalian National Research Council (C. N. R), and bygrants from the Campania Region, Fondazione delMonte di Bologna e Ravenna and A. I. L.Oral CommunicationsMALIGNANT LYMPHOMASCO-49IMMUNOGLOBULIN MUTATIONAL STATUS IN PARAIMMUNO-BLASTIC EVOLUTION OF CHRONIC LYMPHOCYTIC LEUKEMIAMaffei R, Saviola A, Marasca R, Luppi M,Martinelli S, Castelli I, Zucchini P, Torelli GHematology Division, Department of Oncology andHematology, University of Modena and Reggio E,Modena, ItalyThe paraimmunoblastic variant is a rare subtype ofB-cell small lymphocytic lymphoma/leukemia (SLL/L),accounting for approximately 1-2% of cases of B-SLL/L. It is characterized by the diffuse proliferationof cells normally populating the pseudo-proliferatingcenter, the so-called paraimmunoblasts namedby Lennert. These are mitotically active cells and havea distinct cytological appearance, characterized byan high nuclear/cytoplasmic rate, vesicular nucleiand central prominent nucleoli. The clinical course ofthe disease is aggressive, refractory to the standardchemotherapy and rapidly fatal. Data from the literaturewell defined the morphological appearance,but a complete immunophenotypic and molecularcharacterization of this lymphoproliferation is lacking.Here we report 7 cases of a B-cell lymphoproliferativedisorder with morphologic and clinical featuresconsistent with the paraimmunoblastic variantof SLL/L. All cases presented with hepatosplenomegaly,lymph node enlargement or peripherallymphocytosis. Immunophenotypic analysisshowed that the lymphoid cells expressed the CD5,CD19 and FMC7 but not the CD23 antigens. Themorphologic appearance and positivity for CD5 andFMC7 help to distinguish this entity from prolymphocyticevolution of chronic lymphocytic leukemiaand from mantle cell lymphoma, respectively. Themutational status of immunoglobulin genes wasdefined analysing the nucleotide sequence ofrearranged heavy chain variable region (IgVH)obtained by direct sequencing of RT-PCR products inall 7 cases. Considering the classical VH homologycut off value of 98%, 4 patients had unmutated and3 had mutated VH genes. All mutated cases had agerm line homology rate between 96% to 98%.Three cases had VH1 family, in particular VH1-69,VH1-3 and VH1-2, two cases had VH3 family, VH3-15 and VH3-21 in a mutated and an unmutatedpatients respectively, and two cases had VH4 fami-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200451ly, VH4-61 and VH4-39.The majority of patientsstudied used D6 segments (5 of 7), in particular D6-13 was found in three cases. CDR3 length rangedfrom 11 to 21 aminoacids. The sequence of VH geneswas determined both at diagnosis and after paraimmunoblasticevolution, no differences in mutationalpattern have been identified. Furthermore, molecularanalysis of BCL2 and BCL1 genes is also ongoingto investigate whether additional genetic lesionsmay account for the biologic and clinical aggressivenessof this disease. These date suggest thatparaimmunoblastic evolution can arise in bothmutated and unmutated cases. Nevertheless, VH statuswas characteristic of CLL-patients with worseclinical outcome of the disease. No evolution in theIgH rearrangiaments was evident in both VDJ usageand somatic mutations, suggesting no evident role ofgerminal centre ambient in this rare type of CLL progression.CO-50RELATION BETWEEN GENE EXPRESSION PATTERN,IMMUNOGLOBULIN MUTATIONAL STATUS AND CLINICALOUTCOME IN CHRONIC LYMPHOCYTIC LEUKEMIAMarasca R, Maffei R,* Moranti E, Zucchini P, #Asemeria A, Castelli I, Martinelli S, Curotti M,Morselli M, Fontana M, Chiodino C,* Colacci AM, #Serra R, § Furlanello C, Torelli GHematology Unit, Department of Oncology andHematology, University of Modena and Reggio E. ,Modena; *ARPA Emilia-Romagna, Bologna, CentroRicerche Ambientali “Fenice”, Marina di Ravennaand § ITC IRST, Trento, ItalyB-cell chronic lymphocytic leukaemia (B-CLL) is alymphoproliferative disorder characterized by transformedmonoclonal B-cells with the appearance ofsmall mature lymphocytes and with a characteristicimmunophenotype, typically positive for CD5, CD23and CD19 and negative for surface CD22 and FMC7with low expression of IgM/IgD surface immunoglobulins.The relentless accumulation of this smallmature B-cells, which have escaped programmed celldeath and have undergone cell cycle arrest in the G0phase, is the hallmark of B-CLL. Although the mediansurvival of patients with this form of leukaemiais around 10 years, in individual patients the prognosisis extremely heterogeneous, ranging from avery short to a normal lifespan. Despite having severalphenotypic characteristics of naïve B1a cells,CLL have been shown to have somatically mutatedimmunoglobulin variable region genes in more than50% of cases. According to this, CLL patients can bedivided into two subgroups with different clinicalbehaviour and survival. Here, we report the expressionlevels analysis of specific genes known to bedifferentially expressed in CLL subsets as well as ofdifferent genes involved in lymphocytes differentiationand in the germinal centre reaction according tothe immunoglobulin VH mutational status. The statusof Ig genes was assessed analyzing the nucleotidesequence of rearranged heavy chain variable region(IgVH) obtained by direct sequencing of RT-PCRproducts of 61 well characterized B-CLL cases. Consideringthe classical VH homology cut off value of98%, 31 (51%) had mutated (M-CLL) and 30 (49%)had unmutated (UM-CLL) VH genes. The similarityof the VH genes to the closest germ line genesranged from 83% to 100%. Inside mutated group, 6patients (9,8%) had a germ line homology ratebetween 95% to 98% and that group was indicatedas low mutated (LM-CLL). In common with severalother series, we evidenced in the unmutated groupan overuse of VH1 family that was found in 13patients (21,3% of total cases and 43,3% of unmutatedone). The VH1-69 was exclusively used inunmutated CLL (n=8) and demonstrated the highestfrequency accounting for 26,7% of unmutated VHgenes. On the contrary, there was a significant tendencyfor VH3 and VH4 family genes (p=0.001) to beused by the subset that have mutations. In particular,mutated CLL evidenced an elevated frequency ofVH3-23 and VH4-34 family accounting together for38,8% of cases. VH3-21 was only used in two occasionsin unmutated CLL. Again, we found a significantdifference in CDR3 length that was longer inunmutated VH genes (mean=17,6 aa) than in mutatedcases (mean=12,7 aa) (p

52Oral Communicationsing to apoptotic, proliferation, BCR signal transductionand other signatures that could be involved indetermining transformed cell phenotype. Then, geneexpression data were compared each other usingsupport vector machine to identify genes most discriminatingM-CLL and UM-CLL groups in order tocreate a gene-based predictor. Finally, expression ofsome genes involved in BCR signal transduction andgerminal centre reaction were quantified by RealTime PCR. A significant statistical correlationbetween UM-CLL cases and high expression of BCL6,CD38 and ZAP-70 genes was assessed. The same B-CLL cases were also studied by flow-cytometry forCD38 protein levels expressed both as the percentageof CLL positive cells and as antibody-bindingcapacity (ABC). Taken together CD38 data were ableto divide B-CLL patients in groups with peculiar levelof expression and clinical outcome. Again, RNAand protein level of genes involved in cell cycle regulationas p27, CDK3 and Cul-1 were analysed andcompared each other and with mutational VH status.Data analysis revealed that the more statisticallyrelevant parameters related to VH status wereCD38 and ZAP-70 mRNA expression levels as determinedby RealTime PCR.CO-51THE ZAP-70 TRANSCRIPT AMOUNT EVALUATED BY RQ-PCR INPERIPHERAL BLOOD OF CLL PATIENTS CORRELATES WITH THEIgVH MUTATIONAL STATUSCarturan S,* Cerri M,° Gottardi E,* Fava M,* MessaF,* Defilippi I,* Arruga F,* Messa E,* Gaidano G,°Saglio G,* Cilloni D**Department of Clinical and Biological Sciences,University of Turin, Turin, Italy; *Università del PiemonteOrientale "Amedeo Avogadro", Novara, ItalyThe mutational status of immunoglobulin heavychainvariable-region (IgVH) genes in the leukemiccells of chronic lymphocytic leukemia (CLL) is animportant prognostic factor in the disease. We investigatedwhether the quantitative assessment of ZAP-70 transcript amount in CLL cells correlated with theIgVH mutational status. The expression level of ZAP-70 was analyzed in peripheral blood (PB) mononuclearcells separated on a ficoll- hypaque densitygradient, obtained from 42 CLL. Twenty-two out of42 patients showed the mutation of IgVH and 20were unmuteated. The expression level of ZAP-70was established using quantitative RealTime PCRusing a specific set of primers and probe (Assayson-Demand,gene expression products, AppliedByosystems). The values obtained were normalizedusing ABL as housekeeping gene and the final resultswere expressed using the Delta /Delta method. Thefinal numerical values are expressed as 2(e)-Delta/DeltaCt. We stratified the patients according tothe presence or absence of IgVH mutations and weanalyzed the ZAP-70 transcript amount in the twogroups. The unmutated IgVH samples showed significantlyhigher levels respect to the unmutated (p=0,0003 by t test) with a mean value of 2 δ/δCt =0,545(range 0,22-1). The mean value of mutated sampleswas 0,1875 (range 0,04-0,33). These data allow toestablish that all the patients who present ZAP70values above the value of 2 δ/δCt of 0,40 belong tothe group without the presence of IgVH mutationwhile all the patients who present a ZAP70 value of2- δ / δ Ct below 0,2 belong to the group with IgVHmutation. A small number of patients, 6 out of 42,(14%) show values between 0,2 and 0,4, 3 of thempresent the IgVH mutation and 3 are unmutated.These data allow to establish that the quantitativeassessment of ZAP-70 performed on unfractionedMNC cells from peripheral blood of CLL patients correlatewith the presence of IgVH mutations and itmay therefore be considered a rapid and easy surrogateof the mutational analysis in the vast majorityof patients. For the small fraction of borderlinepatients the analysis of IgVH mutations may probablyrepresent the best choice, limiting in this waythe number of candidate patients for this analysis.CO-52TELOMERE LENGTH PREDICTS TIME TO FIRST TREATMENT ANDTIME TO PROGRESSION IN B-CELL CHRONIC LYMPHOCYTICLEUKEMIARicca I,* Compagno M,* Rocci A,* Drandi D,*Francese R,* De Marco F,* Astolfi M,* Mantoan B,*Vallet S*, Dell’ Aquila M,* Bergui L,* Caracciolo D,*Castellino C,^ Ficara F,° Gallamini A,^ Bazzan M,"Marinone C,° Boccadoro M,* Tarella C,* Ladetto M**Divisione di Ematologia dell'Universita' di TorinoAzienda Ospedaliera S. Giovanni Battista, Turin;^Divisione di Ematologia Ospedale Santa Croce eCarle, Cuneo; °Divisione di Medicina Generale A. S.O. S. Giovanni Battista, Turin; "Servizio di Ematologiae Malattie Trombotiche, Ospedale EvangelicoValdese, Turin, ItalyTelomeres are repeated DNA sequences at the endof chromosomes. In a recent study we demonstratedthat telomere length (TL) strongly correlates withthe histopathogenesis of lymphoproliferative disordersand in particular to their origin in relation togerminal center (GC) (Ladetto M et al. , Blood 2004e-pub). The main prognostic feature in B-cell chroniclymphocitic leukemia (B-CLL) is V-IgH mutationalstatus which discriminate V-IgH-mutated GCexperiencedCLL (good prognosis) from V-IgH-unmu-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200453tated GC-unexperienced CLL (poor prognosis). Wethus decided to evaluate the prognostic role of TL inB-CLL and correlate it with V-IgH mutational status.Aims of this study were: i) to assess the prognosticsignificance of TL in B-CLL patients; ii) to verifywhether there is a relationship between TL and V-IgHmutational status in B-CLL patients. We analyzedtelomere restriction fragments (TRF) and V-IgHrearrangements in 83 untreated B-CLL patients.Fifty-four were male and 29 female, their medianage was 54 years (range 38-87). Fourty-sevenpatient were in stage A of Binet, 24 patients were instage B and 12 patients had a poor clinical prognosis(stage C of Binet). TL was evaluated by Southernblot and mutational status of V-IgH rearrangementby direct sequencing. Both approaches have beenpreviously described (Ladetto M et al, Blood 2004 e-pub). Sequences with 2% deviationfrom any known germ line Ig-VH were consideredGC-experienced. Survival analyses were performedusing the Kaplan-Meier method. Overall,median TRF was 5775bp (range 1737-9844bp). Therewere no correlation between TL and patient age, sexand clinical presentation. A cut-off of 4500bp discriminatedtwo subgroups of patients characterizedby different clinical outcome both in terms of timeto first treatment (TFT) and time to progression (TTP).Patients with TL 4500bp had a median TFT of 36months and a median TTP of 36 months (p1 in 102 normal cells) in 23%. A 2 logdecrease of BCL2/IgH + cells was achieved after CHOPand additional 2 logs following Rituximab. By multivariateanalysis, a low level of BCL2/IgH + cells in theBM at diagnosis, was the best predictor for theachievement of a complete clinical and molecularresponse. At 5 years, the Event Free Survival ofpatients with a low or high tumor infiltration in theBM is 59% and 32% respectively. The Freedom FromRecurrence of patients who achieved a molecularresponse in the BM, no matter whether after CHOPalone or CHOP and Rituximab, is 65% as comparedto 33% of patients who did not (p< 0.006). RQ-PCRperformed on BM samples predicts treatmentresponse and long-term clinical outcome in follicularlymphoma patients.haematologica vol. 89[suppl. n. 6]:september 2004

54Oral CommunicationsCO-54NEOPLASTIC B CELL TARGETS OF ALEMTUZUMAB (CAMPATH-1H) AND MECHANISM OF ACTION IN VITROGolay J, Manganini M, Rambaldi A, Introna MLaboratory of Cellular and Gene Therapy “G. Lanzani”,Division of Haematology, Ospedali Riuniti Bergamo,ItalyThe anti-CD52 antibody alemtuzumab has beenapproved for the treatment of fludarabine refractiveB-CLL. We have investigated its mechanism of actionin vitro against B-CLL and B-NHL, and compared itto rituximab. Standard human complement cytotoxicityassays (CDC) were performed on freshly isolatedneoplastic cells. Alemtuzumab lysed the 23 B-CLLsamples through complement activation (mean 80%)much more efficiently than rituximab (mean 16%),presumably due to the higher expression levels ofCD52 compared to CD20 (mean MFI of 1450 comparedto 185, respectively). All other leukaemic Bcells, including 1 PLL, 2 HCL and 6 B-NHL were effectivetargets for both antibodies, with 88% and 85%mean lysis, respectively. Both CD52 and CD20 werehighly expressed in these cells (MFI>500 for CD52and >400 for CD20). ADCC was also studied, usingstandard 51Cr release assays, using peripheral bloodmononuclear cells as effector cells, before and after2-days culture with 1000U/ml IL-2. In contrast toCDC, B-CLL and most B-NHL samples were poorlylysed through ADCC using freshly isolated PBMC aseffector cells, with either monoclonal antibody andregardless of target antigen levels. Antibody dependentlysis could however be significantly increased byculture of the effector cells with IL-2. We concludethat CDC is likely to be an important mechanism ofaction of alemtuzumab in B-CLL and that combinationwith IL-2 may increase its efficacy throughADCC. Other mature neoplastic B cells are good targetsfor alemtuzumab and complement mediatedlysis, making the antibody a good candidate to treatminimal residual disease in the context of non-myeloablativeBMT in B-NHL and B-CLL.CO-55B-CELL DEPLETION AND MOBILIZATION OF LYMPHOMA-FREEPBSC WITH RITUXIMAB AND HIGH-DOSE ARA-C IN FOLLICU-LAR AND MANTLE CELL LYMPHOMAArcaini L, 1 Montanari F, 1 Gargantini L, 3 Orlandi E, 1Iacona I, 2 Brusamolino E, 1 Bonfichi M,1 BernasconiP, 1 Calatroni S, 1 Tenore A, 1 Vanelli L, 1 Troletti D, 1Regazzi M, 2 Morra E, 3 Lazzarino M 11Division of Hematology and 2 Department ofPharmacology, IRCCS Policlinico San Matteo, Universityof Pavia, Italy, 3 Division of Hematology,Niguarda Hospital, Milan, ItalyWe studied a scheme of PBSC mobilization withRituximab and high-dose cytarabine in 36 patientswith relapsed/refractory follicular lymphoma (25grade 1, 7 grade 2, 3 grade 3, 1 transformed) and 7with refractory mantle cell lymphoma enrolled in aprogram of high-dose chemotherapy and autotransplant.13 patients were females and 30 males. Medianage of the whole series was 50 years (range 34-64). After two courses of debulking immuno-chemotherapywith rituximab, vincristine and cyclophosphamide(R-CV), we used a combination of rituximab375 mg/m 2 on day 1 and cytarabine 2 g/m 2every 12 hours on days 2 and 3.A second infusion ofrituximab 375 mg/m 2 was given on day 9.Granulocytecolony stimulating factor (G-CSF) 5 mcg/Kg/daysubcutaneously was started on day 6.No adverseevents occurred during Rituximab administration. Nograde III-IV non-hematologic toxicities wereobserved after HD-AraC; three episodes of grade 3-4 granulocytopenia were registered. Patients neededa median of 1 platelet transfusion (range 0-4)and a median of 0 erythrocyte transfusion (range 0-3). Patients were hospitalised for 3 days (for the firstRituximab infusion and the two days of HD-AraC). Allthe other procedures, including leukaphereses, wereperformed on an outpatient basis. Leukaphereseswere started after a median of 13 days (range 11-16)after the first dose of HD-AraC. The median numberof CD34 + cells collected was 22.48×10 6 /kg (range 4-73.2). Of 23 patients molecularly informative at startof salvage treatment (PCR-positive for bcl-2 or bcl-1 in blood and marrow), all collected PCR-negativecells. Monitoring of peripheral CD19 + and CD20 + B-cells prior to, and throughout the purging periodshowed that a preparative phase with Rituximab,Vincristine and Cyclophosphamide determines a profounddepletion of B-cells in peripheral blood. B-celldepletion persists during the mobilisation phase withRituximab and high-dose cytarabine allowing a collectionof PBSC free of B-cells (median CD19 + andCD20 + cells counts 0%). In conclusion, in patientswith indolent lymphoma, the concurrent administrationof Rituximab and high-dose cytarabine is anefficient method for obtaining in vivo purged lymphoma-freePBSC.CO-56MICRODISSECTION OF LYMPHOMA CELLS IN HCV-ASSOCIATEDPRIMARY SPLENIC LYMPHOMAS INDICATES A DIRECT PATHO-GENETIC ROLE OF VIRAL INFECTIONDe Angelis B, 1 De Renzo A, 2 Picardi M, 2 Ciancia G, 3Perrino G, 3 Perna F, 2 Andretta C, 2 Persico M, 4Pettinato G, 3 Rotoli B, 2 Pane F 11CEINGE - Biotecnologie Avanzate and Dipartimentodi Biochimica e Biotecnologie Mediche, Univer-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200455sity “Federico II di Napoli”; 2 Divisione di Ematologia,University “Federico II di Napoli”, 3 Dipartimento diAnatomia Patologica, University “Federico II diNapoli”, 4 Dipartimento di Medicina Interna, II Universitàdi Napoli, ItalyEpidemiological evidences indicate that HepatitisC virus (HCV), besides liver diseases, is associatedwith extrahepatic diseases, including B cell lymphoproliferativedisorders, such as type II mixed cryoglobulinemia(usually a benign disorder), and overt Bcell non-Hodgkin’s Lymphoma (NHL). A recent reporton regression of splenic marginal zone lymphomaafter anti-viral treatment with interferon and ribavirinhas significantly strengthened the causeeffectrelationship between HCV infection and lymphoma.The molecular basis for viral induced B cellproliferation is still unknown. One possibility is thatHCV stimulates the proliferation of monoclonal Bcells via their HCV-specific B cell receptor (BCR) onthe cell surface and binding of the HCV envelopeproteins (E2) to a cellular ligand, CD81, may alsoenhance this antigen-driven process. To investigatethe relationship between HCV infection and NHL, weused Laser Capture Microdissection (LCM) to isolatethe morphologically normal and neoplastic cells inspleen paraffin-embedded sections of 12 patientswith primitive splenic B-NHL. Eight out of 12patients evaluated in this study, had high-grade (HG)NHL, and the remaining 4 had low-grade (LG) NHL.Serum anti-HCV antibodies were detected in 5 outof the 8 HG NHL patients and in 3 out of the 4 LGNHL patients. LCM is a recently developed techniquethat couples laser-assisted dissection of cell fromtissue sections with microscopic visualization of thesamples and allows rapid and reliable isolation ofpure cells populations, in one step, under directmicroscopic visualization. Using LCM, the normal andmalignant germinal centre cells were isolated fromthe same patient for subsequent analysis. We firstlysearch for the presence and distribution of HCV andfound that in HCV positive LG NHL patients, HCVcoremRNA was detectetable by RT-PCR nestedanalysis only in morphologically neoplastic germinalcentre cells of the microdissected spleen samples,but not in morphologically normal spleen cells of thesame patients. On the other hand, cells dissectedfrom both normal and neoplastic ares of spleen tissuesection from HCV positive HG NHL patientsshowed the presence of HCV-core mRNA at RT-PCRnested analysis. The high tendency of HG LNH cellsto circulate among the focal sites at spleen and boththe blood and lymphatic circulation systems mayexplain this latter result, being the apparently normalareas of the spleen tissue section infiltrated withlymphoma cells. In HCV positive LG NHL patientswith assessed the expression of the BCL2 mRNA thatencodes for an antiapoptotic protein up-regulated inCLL and LG NHL patients. Interestingly, we found thatas expected, the case of primary splenic HCV negativeLG NHL, the levels of expression of this gene wasrather high, while in all the HCV positive patients,neoplastic germinal centre cells had very low levelsof this mRNA. The expression of BCL2 mRNA wasuniformely low in both HCV positive and HCV negativeHG NHL spleen tissue sections. Taken together,these results support the direct role of HCV infectionin the lymphoma transformation in the case of primarysplenic LG NHL, and indicate that the mechanismsof transformation in HCV infected cells may bedifferent respect the HCV negative cases, while at themoment it is less clear the role HCV infection in theHG grade NHL.Funding: Supported by Associazione Italiana per laRicerca sul Cancro (AIRC), and COFIN, Ministero dell'Istruzionee Ricerca Scientifica (MIUR), RegioneCampania, Intas (Brussel), EurLeukemiaNet (Brussel),Biogem (Avellino).haematologica vol. 89[suppl. n. 6]:september 2004

56Oral CommunicationsOral CommunicationsMULTIPLE MYELOMACO-57CYCLOOXYGENASE-2 (COX-2) EXPRESSION IS COMMON INMULTIPLE MYELOMA AND ACTS AS AN ADVERSE PROGNOSTICINDICATORLadetto M,° Vallet S,° Dell'Aquila M,° Montillo L,°Trojan A, § Chiarle R, # Santo L,° Compagno M,°Bertola A,° Falco P,° Cavallo F,° Drandi D,° Ricca I,°Mantoan B,° Pagliano G,° Francese R,° Astolfi M,°Palumbo A,° Tarella C,° Omedè P,° Boccadoro M°°Divisione di Ematologia dell'Universita' di Torino,Azienda Ospedaliera S. Giovanni Battista, Turin,Italy; § Division of Oncology, Department of InternalMedicine, University Hospital, Zürich, Switzerland;#Divisione di Anatomia Patologica, Dipartimento diScienze Biomediche ed Oncologia Umana, Universita'di Torino, Azienda Ospedaliera S. Giovanni Battista,Turin, ItalyIntroduction: a perturbed microenvironment withsecretion of inflammatory cytokines is a typical featureof multiple myeloma (MM). Prostaglandins areamong the most important mediators in inflammationand angiogenesis and play a major role in supportingtumor growth in several solid malignancies.Expression of cyclooxygenase-2 (COX-2), the keyenzyme of prostaglandin synthesis in inflamed tissues,has been documented in many of these cancersand plays a major role in their development. In addition,COX-2 expression often acts as a prognosticindicator associated with poor outcome. Despite ahuge amount of data concerning COX-2 expressionin solid tumors, few data are currently available onits role in hematological malignancies. Particularly inMM there are several biological, epidemiological andclinical considerations suggesting a potentialinvolvement of the prostaglandin pathway. Aim ofthis study is to verify the potential involvement ofCOX-2 in MM and to assess the potential prognosticrole of its expression. Patients and methods: COX-2 expression has been assessed by western blottingas previously described (Du Bois RN, et al, Gastroenterology,1996, 110:1259-1262). Our positive controlwas the COX-2 positive cell line HT-29, whileperipheral blood and bone marrow (BM) from 15healthy donors were employed as negative controls.We assessed a panel of 115 samples obtained by 97patients with plasma cell dyscrasias. Fourteen sampleswere obtained from subjects with MGUS, 66from patients with MM at diagnosis, ten frompatients in clinical remission and 25 from patients atrelapse. In 22 patients, samples taken at differenttreatment phases were available. Four COX-2 positivewere further characterized by immune-histochemistryand/or western blotting on CD138 + andCD138 − cells obtained through the Myltenyi CellSeparation system. Results: a dilution test showedthat our assay is able to detect the presence of HT-29 cells up to a concentration of 2%. COX-2 expressionwas not observed in the 15 normal BM. In contrast,COX-2 expression was noticed in 14% ofMGUS, 35% of MM at diagnosis, 20% of MM inremission and 46% of MM at relapse. COX-2 positivityat diagnosis and relapse appeared to be unrelatedto disease stage, BM plasmocytosis, creatinine,Hb levels, β2 microglobulin. COX-2 expressionappeared to be prognostically important: amongpatients at diagnosis the median time to progressionwas 17 months in COX-2 positive and 32months in COX-2 negative subjects (p

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200457ing of neovessels, however, have so far escapeddetection. Plasma cells are thought as primary inducersbecause they secrete major angiogenic factors,such as VEGF, bFGF and HGF, and their growth precedesby sprouting. Stromal cells behave as secondaryinducers following recruitment and activationby plasma cells. Thirty-two patients were studied atdiagnosis according to the International MyelomaWorking Group criteria for MM (n = 18) and MG(u)(n = 14). MMEC and MG(u)EC were harvested fromthe bone marrow by magnetic microbeads coatedwith Ulex europaeus-1 (UEA-1) lectin, and culturedin RPMI-1640 medium supplemented with 10% FCSand 1% glutamine. Cell were studied for their phenotypeand cytokine production by western blot, RT-PCR and ELISA. EC were also studied for the activationof transduction pathway linked to VEGFR-2 byimmunoprecipitation and western blot. Functionalstudies were also done: EC proliferation in shorttermcultures, Matrigel capillarogenesis assay, evaluationof MMP-2, MMP-9 and uPA activities. Inhibitionexperiments were done by incubation withneutralizing anti-VEGF and anti-VEGFR-2 antibodies.Higher expression of VEGFR-2 and VEGF in MMECthan MG(u)EC and HUVEC was demonstrated by RT-PCR, western blot and ELISA. Western blot of extractsfrom EC cultured in starvation medium showed thatMMEC, but not (or marginally) MG(u)EC and HUVEC,display constitutive autophosphorylation of VEGFR-2 and the ERK-2 associated kinase. When the mediumwas added with neutralizing anti-VEGF-A andespecially anti-VEGFR-2 MoAbs, phosphorylationwas reduced and the two inhibitors had an additiveeffect. As expected, addition of VEGF-A enhancedthe phosphorylation and this, too, was reduced bythe inhibitors in a similar fashion. MMEC displayedhigher proliferative activity than MG(u)EC or HUVECand it was reduced significantly by anti-VEGF-A and,more strongly, by anti-VEGFR-2 MoAbs. MG(u)ECand HUVEC proliferation was not substantially modifiedby these inhibitors. After a 12-hour incubation,MMEC had spread through the Matrigel surface andaligned to form branching, anastomosing tubes withmulticentric junctions arranged in a closely-knit capillary-likemesh. By contrast, MG(u)EC and HUVECproduced a loose and thin mesh with few points.Addition of anti-VEGF or anti-VEGFR-2 MoAb produceda strong inhibition of capillarogenesis.Gelatin-zymography of CM samples showed secretionof the activated MMP-2 (62-kDa form) andMMP-9 (88-kDa) by all EC types. MMEC values wereabout 3 and 4 times higher for MMP-2 and MMP-9than those of MG(u)EC and HUVEC. Addition of VEGFproduced a slight increase in both MMP secretionsand exposure to anti-VEGF-A and/or anti-VEGFR-2MoAbs inhibited slightly secretion. Similar data wereobtained for uPA activity. To sum up, VEGF-A is a keyangiogenic factor in MM. A growth advantage andco-expression at higher levels of VEGF and VEGFR-2in MMEC vs MG(u)EC and HUVEC suggest that aVEGF-dependent autocrine loop is operative inMMEC. VEGFR-2 inhibitors may thus prove effectivein the management of MM by targeting both plasmacells and newly-formed vessels.CO-59TRANSCRIPTIONAL ACTIVITY OF MMSET GENE, INVOLVED INTHE t(4;14)(p16;q32) IN MULTIPLE MYELOMATodoerti K, Ronchetti D, Verdelli D, Marelli S,Castellani S, Maiolo AT, Lombardi L, Neri ALaboratorio di Ematologia Sperimentale e GeneticaMolecolare, U. O. Ematologia 1, Dipartimento diScienze Mediche, Università degli Studi di Milano,Ospedale Maggiore IRCCS, Milan, ItalyMultiple myeloma (MM) is a malignant proliferationof bone marrow plasma cells characterized by ahighly genomic instability involving both ploidy andstructural rearrangements. One of the most frequentabnormality is the t(4;14) (p16;q32) translocation,which occurs in approximately 15-20% of thepatients. The translocation causes the simultaneousdysregulation of two potential oncogenes at the4p16.3 locus, FGFR3 (Fibroblast Growth FactorReceptor 3) and MMSET/WHSC1 (Multiple MyelomaSET domain/Wolf-Hirschhorn Syndrome Candidategene 1). The juxtaposition of endogenous promotersto powerful regulatory regions of the IGH locus(14q32) results in the association of MMSET withthe intronic enhancer of IGH on der(4), whereasFGFR3 is dysregulated on der(14). MMSET codes forthree putative isoforms, generated by mechanisms ofalternative splicing: MMSET 647 (MMSET11), MMSET1365 (MMSET24) and MMSET 584 (RE II-BP). Thefunctions of these proteins are still unknown, butthe presence of evolutionarly conserved domainssuch as SET, PHD, HMG suggest a possible involvementin chromatin remodelling and transcriptionalrepression mechanisms. The only experimental evidenceis relative to the isoform RE II-BP, which bindsa region on the promoter of IL-5 gene, RE-II(Response Element II), repressing its transcription. Inorder to investigate the transcriptional activity ofMMSET isoforms, we constructed vectors expressingfusion proteins in which MMSET11, MMSET24 or RE-IIBP were linked to the Gal4-DNA binding domain(amino acids 1-147). Immunofluorescence analysesof transfected 293T cells, using specific antibodies,showed the nuclear localisation of MMSET11 andMMSET24, whereas RE-IIBP was localised in thecytoplasm. Co-transfections of the MMSET isoformswith a reporter gene (dual luciferase reporter assayhaematologica vol. 89[suppl. n. 6]:september 2004

58Oral Communicationssystem-Promega) in HeLa cells demonstrated thetranscriptional repression activity of MMSET11 aswell as a weak induction on transcription byMMSET24, while RE II-BP showed no effect on thisprocess. MMSET11 deleted constructs were thengenerated in order to map the region(s) responsiblefor the transcriptional repression. The results concerningtwo constructs respectively deleted in theHATH and HMG domains, indicate that the HMGregion seems to repress transcription to a greaterextent. The treatment of HeLa cells with tricostatinA (a specific inhibitor of HDAC activity) causes areduction in the repressional activity of MMSET11demonstrating its dependence on HDAC molecules.The fact that MMSET activity is not completely abolishedby tricostatin also suggests that the transcriptionalrepression is modulated by different mechanisms.Co-immunoprecipitation analyses of 293Ttransfected cells were performed in order to verify apossible interaction between MMSET11 and HDACmolecules and/or other transcriptional co-repressors.The results indicate that MMSET11 interacts withHDAC1 and mSin3B, but not with HDAC2 orHDAC4.Overall, our data suggest that MMSET11 mayact as transcriptional repressor and its deregulatedexpression in MM may contribute to myelomagenesis.CO-60EXPRESSION OF ANNEXINS A2 AND A6 IN MULTIPLE MYELOMA:OPPOSITE FINDINGS BY IMMUNOHISTOCHEMISTRY AND GENEEXPRESSION PROFILINGTiacci E, Pacini R, Tabarrini A, Frenguelli F, Liso A,*Benedetti R, Falini BSection of Hematology and Clinical Immunology,University of Perugia, Italy; *Section of Hematology,University of Foggia, ItalyAmong members of the Annexin family, Annexin-A2 (ANXA2) and Annexin-A6 (ANXA6) are involvedin exocytosis and membrane trafficking in a varietyof cells. Prompted by our interest in investigatingthe potential role of these two proteins in immunoglobulinsecretion by plasma cells (PC), we decidedto use the published micro-array gene expressiondatasets derived from multiple myeloma (MM)patients 1,2 to get insights into the expression profileof ANXA6 and ANXA2 genes in PCs. Mining thesedatasets for the ANXA2 and ANXA6 genes led to theresult that in a large fraction of PC samples ANXA2was highly expressed and ANXA6 was not consistentlyexpressed. To confirm at the protein level thesemRNA findings, we performed immunohistochemicalstudies on B5-fixed paraffin-embedded bone marrowbiopsies from 30 MM patients, that were immunostainedwith specific antibodies against ANXA2(mouse monoclonal antibody,1:200 dilution, TransductionLaboratories) and v (goat polyclonal antibody,1:800 dilution, Santa Cruz Biotechnology),using EDTA/microwave-based antigen retrieval andthe APAAP technique. Notably, neoplastic PCs fromall 30 samples showed an expression pattern oppositeto that suggested by the microarray datasets, i.e. strong expression of ANXA6 protein (with ANXA6-negative erythroid cells serving as internal negativecontrols) and absence of ANXA2 protein (withANXA2 -positive endothelial and myeloid cells servingas internal positive controls). The specificity ofANXA6 immunostaining was further confirmed byWestern blots of purified CD138 + PC lysates fromtwo MM patients that, upon probing with the sameantibody, showed a band of the expected molecularweight for ANXA6 (70 kDa). We next extended theimmunohistochemical analysis of ANXA2 and ANXA6expression also to non-neoplastic PCs in reactivelymph nodes (n=10) and palatine tonsils (n=5),obtaining identical results. These findings suggestthat, if any role is played by ANXA2 and A6 inimmunoglobulin secretion from PCs, attentionshould be focused on ANXA6 rather than ANXA2.This is also in keeping with the involvement ofANXA6 in digestive enzymes secretion from pancreaticacinar cells through interaction with CRHSP-28/TPD52, 3 an epithelial-associated protein that werecently found over-expressed in normal and neoplasticPCs as compared to the other B-cell subsets(Tiacci E and Falini B, unpublished observations). Thediscordant expression at the mRNA and protein levelsof both ANXA2 and ANXA6 genes in PCs add toprevious data on the discrepancy between transcriptionaland translational level of gene expressionreported in other settings. 4 While recognising theimportance of microarray analysis in unraveling transcriptionalsignatures on a genome-wide basis, wesuggest a word of caution when attempting to translatedata from global mRNA-based profiles intoinformations about protein expression of singlegenes.References1. Claudio OJ, Masih-Khan E, Tang H, Goncalves J, Voralia M, Li ZH, etal. A molecular compendium of genes expressed in multiple myeloma.Blood 2002;100:2175-86.2. Zhan F, Hardin J, Kordsmeier B, Bumm K, Zheng M, Tian E, et al.Global gene expression profiling of multiple myeloma, monoclonalgammopathy of undetermined significance, and normal bone marrowplasma cells. Blood. 2002;99:1745-57.3. Thomas DDH, Kaspar KM, Taft WB, Weng N, Rodenkirch LA, GroblewskiGE. Identification of Annexin VI as a Ca2 + -sensitive CRHSP-28-binding protein in pancreatic acinar cells. J Biol Chem. 2002;38:35496-502.4. Falini B, Mason DY. Proteins encoded by genes involved in chromosomalalterations in lymphoma and leukemia: clinical value of theirdetection by immunocytochemistry. Blood. 2002;99:409-26.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200459CO-61CD52 ANTIGEN EXPRESSED ON PRIMARY PLASMA CELLS ANDMULTIPLE MYELOMA CELL LINES IS EFFICIENTLY TARGETED INVIVO BY ALEMTUZUMABCarlo-Stella C, Di Nicola M, Longoni P, Cleris L,Milanesi M, Lavazza C, Milani R, Carrabba M,Formelli F, Gianni AM, Corradini PChair of Medical Oncology, University of Milan;“Cristina Gandini” Medical Oncology Unit, Hematologyand Bone Marrow Transplantation Unit, andDepartment of Experimental Oncology, Milan CancerInstitute, Milan, ItalyMultiple myeloma (MM) is an incurable clonalplasma cell (PC) disorder. Although autologous stemcell transplantation improves survival, most patientsrelapse, and salvage therapy options remain limited.New treatments targeted to the malignant PCs aretherefore needed. Alemtuzumab, a humanized monoclonalantibody to CD52 capable of destroyingCD52 + cells by antibody-mediated cellular cytotoxicityas well as through complement fixation, is currentlyapproved for therapy of chronic lymphocyticleukemia (CLL). In order to evaluate the therapeuticpotential of alemtuzumab for myeloma patients, weexamined CD52 expression on primary malignantmarrow PCs as well as a panel of MM continuous celllines (RPMI-8226, KMS-11, OPM-2, U-266, LP-1). Inaddition, the anti-myeloma activity of alemtuzumabwas evaluated in vivo in a xenotransplant modelof MM in nonobese diabetic/severe combinedimmunodeficient (NOD/SCID) mice. Primary PCs wereenriched from the bone marrow of patients (n = 35)with MM according to CD138 expression. By usingan immunomagnetic technique (Miltenyi Biotec,Germany, EU), highly purified CD138 + cells (medianpurity = 93%; median recovery = 55%) wereobtained and further characterized by 3-color(CD138/CD45/CD52) flow cytometry. On average,63% of MM patients expresssed CD52 on CD138-enriched cells, with a median of 50% PCs expressingCD52. Among our MM patients, 44% had CD45 + PC.Expression of CD52 was equally detected onCD138 + CD45 + and CD138 + CD45 − PCs (p =0.05).Analysis of CD52 expression on MM cell lines resultedin rather heterogeneous findings, with dim positivityon KMS-11, OPM-2 and LP-1, bright positivityon U-266, and negativity on RPMI-8226.CD52expression as evaluated by flow cytometry was confirmedby quantitative PCR analysis of primary PCsand MM cell lines. The in vivo activity of alemtuzumabwas evaluated in a xenotransplant model ofMM in NOD/SCID mice. Mice were inoculated intravenouslywith KMS-11 cells (0.5×10 5 per mice) andwere treated with alemtuzumab (3×1 mg/mouse,subcutaneously, days 4, 7, 9). Endpoint was mice survival.CD52-treated mice were compared to placebotreatedNOD/SCID mice. All placebo-treated mice (n= 18) died after a median survival of 55 days, whereas44% of mice treated with alemtuzumab werealive with a median survival of 76 days (p=0.0001 bylog rank test). No mice experienced any apparenttreatment-related toxicity. According to these data,we conclude that: (1) CD52 is expressed on the plasmacells of a significant proportion of MM patients;(2) alemtuzumab has a strong antitumor activity invivo on CD52-positive MM cell lines; (4) alemtuzumabmight have therapeutic potential in a subsetof MM patients.CO-62FREQUENCY AND PROGNOSTIC RELEVANCE OF T(4;14) IN PRE-VIOUSLY UNTREATED MULTIPLE MYELOMA (MM) PATIENTSRECEIVING EITHER SINGLE OR DOUBLE AUTOTRANSPLANTSRenzulli M, Terragna C, Cavo M, Soverini S, CelliniC, Testoni N, Poerio A, De Vivo A, Amabile M,Giannini B, Ottaviani E, Grafone T, Zamagni E, TosiP, Cangini D, Tacchetti P, Tura S, Baccarani M,Martinelli GIstituto di Ematologia ed Oncologia Medica “L. e A.Seràgnoli”, Ospedale S. Orsola-Malpighi, Universitàof Bologna, ItalyIn patients with MM a number of recurrenttranslocations involving chromosome 14 at band q32have been recently identified, the most commonbeing the t(11;14) and the t(4;14). Both these chromosomalabnormalities are closely associated withparticular presenting features of the disease and mayhelp to identify patients at different risk of death. Inparticular, the t(11;14) predicts for good prognosis,whereas the t(4;14) has been reported to be an unfavorableprognostic feature. The t(4;14) has beendescribed almost exclusively in MM patients,although its exact role in the pathogenesis of thedisease has not fully elucidated. The translocationaffects at least two potential oncogenes, MMSET onder(4) and Fibroblast Growth Factor Receptor 3(FGFR3) on der (14); the role of two additional genes(TACC3 and LETM1) located near the breakpointregion on chromosome 4 has not yet been evaluated.In the present study we investigated the frequencyand the prognostic relevance of the t(4;14)in a series of 63 patients with de novo MM, whowere randomized to receive either a single (Tx-1) ora double (Tx-2) autotransplant as primary therapyfor their disease. For this purpose we analyzed 1) thepresence of t(4;14) by RT-PCR of the hybrid transcriptbetween MMSET and the IgH locus; 2) theoverexpression of FGFR3 by Real-time RT-PCR; 3)haematologica vol. 89[suppl. n. 6]:september 2004

60Oral Communicationsthe relationship between t(4;14), response to highdosetherapy and outcome of autotransplant(s).Overall, the t(4;14) was detected in 17/63 patients(27%), a value slightly higher than that reported byothers. 13/17 patients had both MMSET/IgH fusiongene and FGFR3 overexpression, while 4 patients hadMMSET/IgH but did not overexpress FGFR3.This findingfurther confirms the possible discrepancybetween MMSET/IgH positivity and FGFR3 overexpression.Comparison between t(4;14)+ and t(4;14)-patients revealed that both groups were well balancedwith respect to the most common presentingfeatures of MM. In 36 patients, for whom materialwas available, FISH analysis for the detection of 13qdeletion and/or monosomy was performed. Resultsshowed that t(4;14)+ patients were more likely tocarry also del(13) than t(4;14)- patients (46% vs.29%, respectively). Among patients who attainedstringently defined complete remission followingeither Tx-1 or Tx-2, t(4;14)- patients were 35%, asopposed to 6% of t(4;14)+ patients (p = 0.05, intentionto treat). With a median follow-up of 45months, no difference in overall (OS) was disclosedbetween t(4; 14)- and t(4;14)+ patients, on the contrarythe event free survival turned out significantlylonger in patients without translocation. In summary,27% of our MM patients carried the t(4;14). Inthis cohort of homogeneously treated patients, thet(4;14) predicted for lower response to high-dosetherapy. Longer follow-up is required to assess theinfluence of this abnormalities on OS and EFS.Funding: This work was supported by MURST COFIN2002 and 2003, A. I. R. C. , ATENEO 60% target projects,FIRB 2001, "Hairshow" A. I. L. , “Fondazione delMonte di Bologna e Ravenna” grants, FondazioneCarisbo.CO-63GENE EXPRESSION PROFILING OF MULTIPLE MYELOMAREVEALS A ROLE OF CHROMOSOMAL TRANSLOCATIONS FORTHE DEFINITION OF DISTINCT ENTITIES OF MALIGNANCYMattioli M,* Agnelli l,* Fabris S,* Baldini l,* MorabitoF, + Bicciato S, § Verdelli D,* Nobili l,* Intini D,*Callea V, + Stelitano C, + Maiolo AT, Lombardi L,*Neri A**Laboratorio di Ematologia Sperimentale e GeneticaMolecolare, U. O. Ematologia 1, Dipartimento diScienze Mediche, Università degli Studi di Milano,Ospedale Maggiore IRCCS, Milan; + Divisione diEmatologia e Centro Trapianto di Midollo, AziendaOspedaliera “Bianchi-Melacrinò-Morelli”, ReggioCalabria; § Dipartimento dei Processi Chimici dell'Ingegneria,Università di Padova, ItalyMultiple Myeloma (MM) is a neoplastic disorderof bone marrow plasma cells (PCs) characterized bya marked genetic heterogeneity and an extremelyvaried clinical course, including extra-medullaryforms (plasma cell leukemia, PCL). MM may be precededby a pre-malignant condition called monoclonalgammopathy of undetermined significance(MGUS). Chromosomal translocations involving theimmunoglobulin heavy-chain locus (IGH) and apromiscuous array of partner loci represent early andfrequent genetic aberrations in MM. To provideinsights into the molecular pathogenesis of MM andto investigate the contribution of specific geneticlesions to the clinical variability of MM, we analysedthe gene expression profiles of PCs isolated from 3normal donors and 53 patients affected by differentforms of plasma cell dyscrasias (8 MGUS, 39 MMand 6 PCL) by DNA microarrays representative for~18.000 transcripts. Our results indicate that MM ischaracterised by highly heterogeneous phenotype atthe transcriptional level, while MGUS samples can bedistinguished from PCL and the majority of MM cases.A close correlation was found between distincttypes of chromosomal translocations and specificgene expression profiles in MM. In particular, weidentified a peculiar signature in cases with translocatedMAF and MAFB genes, which involved thederegulation of CCND2 and cell adhesion pathways.Notably, our analysis identified a sub-group of MMpatients characterized by PCL-resembling phenotypeand aggressive clinical evolution who expressed aset of cancer germ line-specific antigens. This findingcould have implications for patients' classificationand immunotherapy in MM. In general, ourstudy supports the notion of a marked heterogeneityof MM and highlights the relevance of differentgenetic lesions. Furthermore, these data may provideinsights into the role of distinct molecular pathwaysin myelomagenesis and contribute to the identificationof novel molecules for targeted therapies.CO-64MULTIPLE MYELOMA: CHROMOSOME 13 ABNORMALITIES(DEL13) DETECTED BY FLUORESCENCE IN SITU HYBRIDIZA-TION (FISH) AND CORRELATION WITH PLASMA CELLIMMUNOPHENOTYPEOmede' P, Ruggeri M, Brunetti M, Falco P, BeggiatoE,* Cavallo F, Bertola A, Bringhen S, Morrone F,Gilestro M, Ferro F, Palumbo A, Bruno B, LiberatiAM,° Petrucci MT, § Boccadoro MDivisione di Ematologia dell' Università di TorinoAzienda Ospedaliera S. Giovanni Battista, Torino,Italy; * Divisione di Oncologia e Ematologia, ASL VI,Cirie' (To), ° Clinica Medica I, Policlinico Monteluce,Perugia, § Dipartimento di Biotecnologie ed EmatologiaUniversità La Sapienza, Romehaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200461Fluorescence in situ hybridization (FISH) is widelyused for the detection of chromosomal abnormalitiesas an alternative to conventional cytogenetic techniques,in particular in hematological malignanciescharacterized by a low proliferative index such asmost plasma cell disorders. In this study, interphaseFISH has been employed to evaluate chromosomalabnormalities in monoclonal gammopathies.Between October 2002 and April 2004 bone marrowaspirates from 164 consecutive patients were evaluatedfor chromosome 13 deletion (del13). 147 werepatients with multiple myeloma (MM), including 102at diagnosis and 45 at relapse, 12 were monoclonalgammopathies of undetermined significance (MGUS)and 5 plasma cell leukemias (PCL). Bone marrowplasma cells were enriched using anti-CD138-coatedmagnetic beads (Miltenyi Biotech, UK) and thepurity determined by flowcytometry with PE-conjugated-antiCD38 monoclonal antibody. The percentageof plasma cells exceeded 85% in all samples.Nuclei from fixed plasma cells were prepared forinterphase FISH analysis using standard methods.Del13 was identified using LSI13RB1 probe (Vysis,UK). For each sample, 200 plasma cells were evaluated.Del13 was identified in 53% of MM, in 75% ofMGUS and in 60% of PCL patients, respectively. Theincidence of del13 was 58% and 48% in MM atdiagnosis and at relapse, respectively. There was nosignificant difference in the prevalence of del13according to age, bone marrow plasma cell infiltrations,serum β-2-microglobulin, and C reactive proteinlevels, clinical stage and immunoglobulin isotype.Del13 was observed more frequently in female(56% vs 34% in non del13 patients, p=0.015) and inpatients with lambda light chains (50% vs 26%,p=0.02); patients with del13 had more frequentlyserum monoclonal paraprotein concentration

62PostersPosterACUTE MYELOID LEUKEMIAPO-001PROGNOSTIC SIGNIFICANCE OF C-KIT MUTATIONS IN COREBINDING FACTOR-LEUKEMIA PATIENTSCairoli R,* Beghini A, § Nadali G,° Elice F, # Lunghi M, +Grillo G,* Brasca P, Nichelatti M,* Pezzetti L,*Lazzarino M, + Rodeghiero F, # Pizzolo G,° Larizza L, §Morra E**Division of Hematology, Niguarda Hospital, Milan;§Division of Biology and Genetics, University ofMilan; °Division of Hematology, Policlinico G. Rossi,Verona; # Division of Hematology, S. Bortolo Hospital,Vicenza; + Division of Hematology, IRCSS PoliclinicoS. Matteo, University of Pavia, ItalyC-KIT point mutations are not a rare event in corebinding factor (CBF) leukaemia; in this setting wepreviously reported the presence of both kinase orextracellular-juxtamembrane mutations in 46% ofpatients. To investigate the prognostic impact of c-KIT gene mutations, we attempted at correlating thepresence of the mutation with the WBC count, thelevel of the WBC-index (WBC×[% BM blasts/100])and the clinical outcome, in 45 CBF-AML patients.The 45 patients, M:F 37/8, had a median age of 46years (range 16-88); cytogenetic showed a t(8:21) in27 cases and inv(16) in the remaining 18.On the basisof a genomic DNA sequencing of c-KIT gene for exon2, 8, 10, 11, 17 mutations, 19 patients (42%), categorizedin the KIT mutated group (KIT + ), showed amutation in either exon 8 (n = 4), exon 17 (n = 13),exon 10 (n = 1) and exon 11 (n = 1). The remaining26 patients, in which the mutation was not detected,were categorized in the KIT non mutated group(KIT-). Considering the whole group of patients, wefound a mean WBC count of 57.7×10 9 /L vs 16.9×10 9 /L(p=0.004) and a mean WBC-index of 40.29 vs 12.56(p=0.019), for KIT + and KIT- respectively. Thirty-sixpatients (age < 60 years) were considered evaluablefor clinical response. At a median follow-up of 20months (range 6-103), we recorded for KIT + and KITrespectively:CR incidence of 93.7% (15/16) vs 100%p=NS); Relapse Incidence 81.2% (13/16) vs 35%(7/20) p=0.015; OS 25% (4/16) vs 75% (15/20),p=0.008 and DFS 12.5% (2/16) vs 75% (13/20)p=0.005.In conclusion, this study confirm the correlationbetween c-KIT mutational status with highWBC count and WBC-index in CBF-AML patients aspreviously reported (Leukemia 2003; 17: 471-472).Furthermore our data indicate a statistical correlationbetween the presence of KIT mutations and both theOS and DFS.PO-002IKB KINASE (IKK) MUTATIONAL ANALYSIS IN ACUTE MYELOIDLEUKEMIA PATIENTSMessa E,* Messa F,* Serra A,* Arruga F,* Defilippi I,*Carturan S,* Gottardi E,* Morotti A,* Cilloni D,*Saglio G**Department of Clinical and Biological Sciences,University of Turin, ItalyRecent studies have assigned a role to the nuclearfactor KB in the leukemic process. NF-kB activationis mediated by phosphorilation of the IkB inhibitorsby the IkB kinase complex (IKK). This event leads tothe IkB proteasomal degradation so allowing thenuclear translocation of NF-kB activated complex.IKB kinase complex is composed by three subunits,IKK α, IKK β and IKK γ. Both α and β subunits has aserine specific catalytic activity. Recent data identifiedan increased activity of NF-kB in blast cellsobtained from acute leukaemia patients (AML) Inaddition, an increased IKK activity has been detectedin AML blast cells but not in normal cells. The aimof the present study was to analyze if the abnormalIKK activity in AML blasts could be due to the presenceof point mutations in IKK kinase domains. Bonemarrow samples were collected from 50 patientsaffected by acute myeloid leukemia (AML) at diagnosis.The FAB distribution was as follow: 6 FAB Mo,7 FAB M1, 10 FAB M2, 4 of them positive for t(8;21),5 FAB M3, 5 FAB M4 with 2 of them presented theinv(16) genetic abnormality, 5 FAB M5, 10 cases ofAML secondary to MDS and 2 cases secondary to solidtumours. Mononuclear cells were separated on aficol hypaque density gradient. After RNA extraction,the RT-PCR reactions were performed with two differentsets of specific primers for both α and β serinekinase subunits. Direct sequencing of both PCRproducts was performed using ABI PRISM 3100genetic Analyzer. The subsequent mutational analysisallow to exclude the presence of mutations in boththe kinase domains analyzed. These data allow todemonstrate that although the enhanced IKK activityin myeloid blasts has been well demonstrated, thiscannot be ascribed to the presence of point mutationsin the kinase domains. Therefore, it could bevery interesting to identify upstream activatinglesions which resulted in the constitutive activationof IKK kinase. Besides the mechanism which leads tothe constitutive activation of IKK kinase activity, thisfinding allows to design a molecular targeted therapyagainst IKK kinase in all the patients affected byacute myeloid leukemia.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200463PO-003DETECTION OF DIFFERENT MLL REARRANGEMENTS IN ADULTACUTE LEUKEMIA BY MULTIPLEX PCR AND FLUORESCENTCAPILLARY ELECTROPHORESISAlbiero E, Novella E, Giaretta I, Madeo D,Rodeghiero FDivisione di Ematologia, Azienda U. L. S. S. N. 6"Vicenza" Ospedale S. Bortolo, Vicenza, ItalyBackground: Chromosome11q23/MLL (mixed lineageleukemia) rearrangements characterize a subgroupof acute leukemias with intermediate prognosis.Their clinical significance is strongly dependent onthe different fusion gene involved, making importantan accurate identification of the specific chimericgene. We have developed two parallel triplex PCR forthe identification of the commonest types of MLLtranslocations in hematologic malignancies of adults,like t(4;11), t(6;11), t(9;11), t(10;11) and t(11;19).Methods: Total RNA from cell samples was reversetranscribed. Amplification of MLL and related fusiongenes was obtained using the primers described byAndersson (2001), but we have paired them differentlyand changed the amplification conditions. Mix1contained a unique 5'MLL-specific external primer incombination with 3' primers specific for AF4, AF9 andAF10 genes, Mix2 contained the 5'MLL primer usedfor the Mix1, in combination with a set of 3' primersspecific for AF6, ELL and ENL genes. Both Mix1a andMix2a contained the internal 5'MLL primer and a setof internal 3' primers for the detection respectively ofAF4, AF9, AF10 fusion genes and of AF6, ELL and ENLgenes. Each assay was carried out with a negativecontrol (cDNA templates were from healthy subjectsand from CML and AML M3 patients) and a reactioncontrol (amplification of a mixture without cDNA).Positive controls from previously studied patientswere available for AF4, AF9 and AF10 genes. If amplificationfragments of appropriate dimensions rangeare obtained after triplex PCR, split-out reactionswere performed. To this were used the common 5'MLLinternal and external primer pairs labeled with twodifferent fluorochromes and the two 3' primers specificfor the chimeric gene previously identified. Fora more accurate size identification, PCR productswere subjected to capillary electrophresis and analyzedby gene scanning in an automatic DNAsequencer ABI Prism 310.Results: A total of 8 acutelymphoblastic leukemias and 22 acute myeloidleukemias, without BCR/ABL and PML/RARA rearrangements,were analyzed. Our paired triplex PCRwas able to detect amplification products ofMLL/AF4, MLL/AF9, MLL/AF10 in all three knownpatients. No false positives were detected in 10 normalsubjects, 20 CML and M3 patients. Conclusions:The multiplex PCR method described here allowed anaccurate and less time consuming identification of atleast three clinically important translocations involvingMLL. Validation of this methodology is underwayfor AF6, ELL and ENL genes. Because of the variabilityof the breakpoints of all the tested genes, the secondstep of fluorescence-based analysis allows amore accurate identification of the product amplificationsize and could be potentially useful to monitorminimal residual disease.PO-004CONTINUOUS SEQUENTIAL INFUSION OF FLUDARABINE ANDCYTARABINE FOR ELDERLY PATIENTS WITH ACUTE MYELOIDLEUKEMIA: A PHASE II STUDYFerrara F, Palmieri S, Mele G, De Simone M,Califano C,* D'Arco AM*Division of Hematology and Stem Cell TransplantationUnit, Cardarelli Hospital, Naples; Division ofHematology, Umberto I Hospital, Nocera Inferiore,ItalyThe prognosis of acute myeloid leukemia (AML) inelderly patients is still poor, therefore new approachesare needed. We previously demonstrated the feasibilityof a regimen based on the combination of fludarabine(F) with cytarabine (ARA-C) given as continuoussequential infusion (CI-FLA). In particular, F wasadministered at a loading dose of 10 mg/m 2 over 15min at day 0 followed by continuous infusion (CI) of20 mg/m 2 /24 hours for 72 hours; ARA-C was given ata loading dose of 390 mg/m 2 over 15 min three hoursand half after FAMP and then as CI over 96 hours at1440 mg/m 2 /24 hours. G-CSF was added at day +15at a dose of 5 µg/kg. Patients achieving completeremission (CR) were programmed to receive an additionalidentical course of CI-FLA. However, after thefirst 20 patients consolidation was reduced by one daydue to excessive toxicity. Following consolidation, G-CSF at 10 µg/kg was given from day 15 with the aimof shortening neutropenia and mobilizing CD34 + cells.Toxicity was recorded according to WHO criteria. Herewe report our updated experience on a larger cohortin order to evaluate results on disease free (DFS) andoverall survival (OS). From December 2001 60 untreatedpatients aged over 60 years with non M3 AML havebeen accrued in two different Institutions. The medianage was 69 years (range 61-82). In 22 patients(37%) a previously diagnosed myelodysplastic syndrome(MDS) preceded the onset of AML. Cytogeneticanalysis showed normal karyotype in 29 patients(48%), complex karyotype or other unfavorable chromosomalabnormalities in 21 (35%), and no mitosis in10 (17%). Of note, 50 patients (83%) were affected byconcomitant disease requiring specific treatment.Overall, 39 patients achieved CR (65%), all followinghaematologica vol. 89[suppl. n. 6]:september 2004

64Postersone course of CI-FLA. There were 10 induction deaths(17%), while 11 patients were primary refractory(18%). The median number of days to neutrophil>1.0x10 9 /L and platelet >20×10 9 /L recovery was 19(7-34) and 19 (9-38), respectively. Patients needed amedian of 3 platelet units (1-13) and 6 blood units (1-22), respectively. All patients experienced severe pancytopeniarequiring broad spectrum empiric antibiotictherapy. Induction deaths were due to infectiousepisodes occurred during the aplastic phase (n=8) andcerebral hemorrhage (n=2). Among remitters, 33 outof 39 (85%) received the programmed consolidationcourse, while in 6 cases therapy was discontinued dueto unresolved infection (n=2), persistent thrombocytopenia(n=2), cerebral hemorrhage occurred after CRobtainment (n=1), patient’s desire (n=1). Twenty-ninepatients were monitorized for the mobilization ofCD34 + cells, collection being successful in 20/29(69%). The median number of CD34 + cells collectedwas 6.5×10 6 /kg (range 2.4-60.3), the median numberof apheresis being 2 (1-3). Overall, 16 patients havereceived autologous stem cell transplantation. At thetime of writing 26 patients are alive: 20 are in continuousCR after a median follow up of 8 months(range2-27), 4 are alive with refractory and 2 withrelapsed disease, respectively. In conclusion, these dataconfirm the feasibility of CI-FLA and the extremelyencouraging results in terms of CR achievement andCD34 + cell collection. Data on DFS and OS are promising,but a longer follow up is needed.PO-005FREQUENT ABERRANT BRCA1 METHYLATION IN SECONDARYACUTE MYELOID LEUKEMIAScardocci A, Mansueto G, Di Ruscio A, Massini G,Gumiero D,* Zollino M, Leone G, Voso MTIstituto di Ematologia e di *Genetica Umana,Universita' Cattolica S. Cuore, Rome, ItalyAberrant DNA methylation has been observed inmany human tumors, in particular in the CpG islandsof tumor suppressor genes. BRCA1 is a tumor suppressorgene that encodes a 1863 amino acid proteinthat is important for regulation of cell proliferation,participation in DNA repair/recombination processesrelated to the maintenance of genomic integrity,induction of apoptosis in damaged cells and regulationof transcription. Recent data reveal that promoterhypermethylation is frequently associated withBRCA1 inactivation in non-inherited breast and ovariancarcinomas. Using a methylation-specific PCR,we studied BRCA1 promoter hypermethylation in 126patients (60 females, 66 males, median age 62 years,range 16-85 years) with acute myeloid leukemia(AML). BRCA1 was hypermethylated in 68/126 (54%)AML samples. The functional role of BRCA1 hypermethylationwas confirmed in 46 patients whose RNAwas available, where hypermethylation correlated toloss of expression. Eight of 22 methylated sampleswere RT-PCR-negative for BRCA1 expression, whileonly 1 of 24 unmethylated samples were PCR-negative(p=0.009). BRCA1 promoter hypermethylationwas more frequent in females than in males (40/60,67% versus 28/66, 42%, p=0.008, OR= 2.7, 95% C. I.=1.3-5.6). Twenty-five patients had a leukemia secondaryto a previous malignancy (s-AML), treatedusing chemo- and/or radiotherapy in 19 patients. Asignificant association between s-AML and BRCA1promoter hypermethylation was found (19/25, 71%versus 49/101, 49%, p=0.01, OR= 3.4, 95% C. I. =1.2-9.1), in particular when restricting the analysis totherapy-related AML (16/19, 84% versus 52/107,49%, p=0.005, OR=5.6, C. I. =1.5-20.5). Interestingly,all 6 patients (100%) treated for a previous breastcancer were hypermethylated for BRCA1.Patientswith white blood counts higher that 30 x 109/L alsohad a significantly higher frequency of BRCA1 hypermethylation,when compared to patients with whiteblood counts lower than 30×10 9 /L (37/78, 47% versus41/78, 53%, p=0.05, OR=2.7, C. I. 1.1-7.0). Nodifferences were noted when looking at age, blastcellspercentage in the bone marrow, karyotype, FABsubtypeand response to treatment. Since aberranthypermethylation of different genes has been reportedin therapy-related AML, BRCA-1 hypermethylationcould be one of the transformation pathways ins-AML, related to inefficient DNA repair, followingantiblastic treatment. On the other hand, this studypoints to a possible link between genetic instabilityrelated to BRCA1 inactivation in non-inherited breastcancer and secondary leukemic transformation.PO-006MINIMALLY DIFFERENTIATED ACUTE MYELOID LEUKEMIA(AML-M0) EXPRESSES HIGH LEVELS OF BCL-2 AND LOWLEVELS OF MDR1 PROTEINNeri B, Ottaviani L, Mazzone C, Del Poeta G,Del Principe I, Maurillo L, Venditti A, Amadori SCattedra e Divisione di Ematologia, Osp. S. Eugenio,Università di Rome "Tor Vergata", ItalyTwo-hundred and 56 consecutive cases of de novoAML were studied for the expression of bcl-2 andMDR1.Within this series, 28 (11%) patients withAML-M0 were identified. The results were expressedas relative mean fluorescence intensity (rMFI) and anindex which equals the product of the percentage ofpositive cells and rMFI. Bcl-2 MFI was significantlyhigher in M0 (median 24.6, range 10.3-107), M6(median 23.4, range 4.2-83) and M1 (median 18.2,haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200465range 3.4-87.4) subtypes (p = 0.00001), whereasMDR1 MFI was higher in M5 (median 11.4, range 1.6-69.1) and M4 (median 6.9, range 1-56), comparedwith the other FAB subgroups (p = 0.00001); in AML-M0, the value of MDR1 MFI was the lowest (median1.6, range 0.9-20). Conversely, we observed the highestvalue of bcl-2 index in M0 (median 1732, range241-10025), M6 (median 1606, range 290-3616) andM1 (median 1437, range 146-7604) (p = 0.00001),whereas MDR1 index was the highest in M5 (median851, range 6-4975) and M4 (median 397, range 3-3920). This first step of analysis demonstrates thateach FAB subgroup expresses bcl-2 and MDR1 in aquite heterogeneous amount, so that a given quantitativecombination of the two proteins may bepeculiar for a specific AML subtype. Based on this, wedesigned a ratio dividing the value of bcl-2 index bythat of MDR1 (bcl-2:MDR1 ratio); the bcl-2:MDR1ratio was then calculated for each FAB subgroup. Bcl-2:MDR1 ratio was very high in AML-M0 (median 101,range 1-10025) (p = 0.00001); therefore, AML-M0qualifies as a true distinct entity due to a predominantexpression of bcl-2, whereas the remaining FABsubtypes express variable level of both bcl-2 andMDR1 proteins, or MDR1 protein alone. To furtherinvestigate these aspects, we also calculated theCD34 and CD71 index; the latter was used as an indirecttool to explore the cell-cycle status. The highestvalue of CD34 index was found in AML-M0 (median6076, range 1-95100) (p = 0.00001); in line with this,we also observed a direct correlation between CD34index and bcl-2:MDR1 ratio (r = 0.37, p = 0.00001).Finally, the value of CD71 index was very low in AML-M0 (median 80.5, range 1.7-10025) (p = 0.00001),consistent with a lack of proliferative activity. Froma clinical point of view, the median age of patientswith AML-M0 was 64 years (range 30-78), 12 werefemales and 16 males. The presenting median whiteblood cell count (WBCc) was 7.4×10 9 /L (range 0.7-122×10 9 /L). The median age of patients with non-M0 AML was 62 (range 18-78), 104 females and 124males, presenting median WBCc 20×10 9 /L (range 1.1-390×10 9 /L); the difference in WBCc between AML-M0 and non-M0 AML patients was statistically significant(p = 0.006). The CR rate for AML-M0 andnon-M0 AML group was 43% (12/28) and 66%(153/228), respectively (p = 0.02). Finally, AML-M0had a shorter duration of survival (p = 0.030) anddisease free survival (p = 0.06). In conclusion, ourresults suggest that in AML-M0 bcl-2 is overexpressedand may represent a key-protein involvedin the chemo-resistance process. This has therapeuticimplications since the use of apoptosis inducersmay be indicated for improving treatment outcomein this subgroup.PO-007DETOXIFICATION POLYMORPHISMS, INCLUDING GSTT1 AND/ORM1 DELETIONS AND THE CYP1A1*2A ALLELE, ARE NEGATIVEPROGNOSTIC FACTORS FOR ACUTE MYELOID LEUKEMIA,INDEPENDENT OF FLT3-ITDVoso MT, D'Alò F, Scardocci A, Valentini L, Guidi F,Di Ruscio Al, Mansueto G, Gumiero D, Hohaus S,Leone GIstituto di Ematologia, Universita' Cattolica S. Cuore,Rome, ItalyInternal tandem duplications (ITD) and mutations atcodon Asp835 of FLT3 (fms-like tyrosine kinase 3) arethe most frequent aberrations in acute myeloidleukemia (AML) and are a powerful negative prognosticfactor. Aberrations of FLT3 are not associated withkaryotypic abnormalities, and are especially helpful indetermining prognosis in patients with a normal karyotypewho are at intermediate risk. We have previouslyshown the prognostic impact of deletions of 2enzymes of the xenobiotic detoxification pathway,GSTT1 and GSTM1, for the outcome in patients withAML particularly in patients with an intermediate riskkaryotype (Voso et al. , Blood 2002; 100:2703). We weretherefore interested on possible interactions betweendefects in the xenobiotic detoxification pathway ofglutathione S-transferase (GSTM1, GSTT1, GSTP1) andcytochrome p450 (CYP1A1*2A, *2B and *4 alleles) andFLT3 aberrations. Study population included 170patients with AML (79 females, 91 males), of a medianage of 62 years (range 16-87 yeras). The prevalenceof FLT3-ITD in our patients was 15.3% (26/170), whilethat of Asp835 was 4% (3/74). A significant associationbetween FLT3-ITD and white blood counts higherthat 30×10 9 /L was found (13/42, 30.9% versus 6/97,6.2%, p=0.000, O. R. 6.8, 95% C. I. 2.4-19.1). No associationsbetween FLT3-ITD and age or gender werefound. Patients with a complex karyotype had a lowerincidence of FLT3-ITD than those with normal karyotypeor a balanced translocation. Patients with AMLand associated myelodysplasia or leukemia related tochemotherapy for a previous malignancy also had alower incidence of FLT3-ITD, when compared topatients without MDS or with a de novo AML (0/37,0% versus 26/122, 21.3% p=0.000, O. R. 0.04, 95% CI0.002-0.8, and 0/17, 0% versus 26/153, 17%, p=0.08).This indicates that leukemias following myelodysplasiaor a previous chemotherapy may follow pathwaysdifferent from those due to FLT3 activation. Looking atGST, the GSTM1 null genotype was detected in 47%AML patients and the GSTT1 null genotype in 26% ofpatients, while 12.5% of patients had a double-nullgenotype. The prevalence of CYP1A1*2A, *2B and *4alleles was 8.1%, 7.7% and 21%, respectively. We havepreviously reported patients' characteristics associat-haematologica vol. 89[suppl. n. 6]:september 2004

66Postersed to GST deletions and CYP1A1 alleles. The prevalenceof the GSTP1Val mutation was studied in 151patients. Eleven patient (7.3%) were homozygous forthe Val/Val mutated genotype, 47 (31.1%) had a heterozygousIle/Val GSTP1 genotype, and 93 (61.6%) hada normal Ile/Ile GSTP1 genotype. No associationsbetween GSTP1 allelic variants and patients' characteristicsor prognosis were found. In 112 patientsreceiving standard induction therapy, an associationbetween FLT3-ITD-positivity and toxic deaths, shorterdisease-free and overall survival was found. Five of 11toxic deaths (45%) versus 17 of the remaining 101patients (16.8%) were ITD-positive (p=0.04, OR 4.1,95% CI 1.1-15). The median DFS and OS of patientswith positive FLT3-ITD were 4.8 and 7.2 months, comparedto 13.7 and 16.8 months in patients withoutFLT3-ITD (p=0.03 and p= 0.02). As previously shown,and with longer follow-up, the presence of one GSTdeletion (T1 and/or M1) was not associated to toxicdeaths, but confirmed to be a negative prognostic factorfor survival (median DFS and OS for patients withGST deletions 8.8 and 13.2 months versus 17.3 monthsand 29.4 months in patients without deletions, p=0.01p= 0.02, respectively). CYP1A1*2A also identified aprognostically unfavorable group of patients (medianDFS 5.6 versus 14 months, p=0.002, and median OS10.5 versus 17 months, p= 0.006). The multivariateanalysis using the Cox regression model confirmed thatthe presence of GSTM1 and/or GSTT1 deletions,CYP1A1*2A and FLT-3-ITD were independent prognosticfactors for survival. These data confirm that theindividual detoxification profile may be a useful prognosticmarker, independent of FLT3-ITD, in patientswith AML.PO-008METABOLIZING ENZYMES AND ACUTE LEUKEMIA:ROLE OF GENETIC POLYMORPHISMAgueli C, Rizzo V, Cammarata G, Fabbiano F, MirtoS, Cannella S, Pagano M, Cascio L, Marfia A,Santoro ADipartimento di Ricerca Clinica e BiotecnologieLaboratorio di Ematologia e Citogenetica Molecolare;Az. Osp. “V. Cervello”, Palermo, ItalyEveryone has a unique combination of polymorphictraits that modify susceptibility and response to drugs,chemicals and carcinogenic exposures. Toxicants towhich an individual is exposed are bio transformedand eliminated from the body after metabolic conversionmediated by Phase I and Phase II xenobioticmetabolizingenzymes. Phase I enzymes catalyzehydroxylation, reduction and oxidation reactions ofxenobiotics (carcinogens/drugs), often convertingthem into more active or toxic compounds. Phase IIenzymes catalyze conjugation reactions (glucuronidation,acetylation, methylation), thereby convertingthe metabolites into non-reactive, water-solubleproducts that are eliminated from the organism.Genetic polymorphism in the genes encoding fordrug-metabolizing enzymes, underlying the variationin enzyme activity, can modify individual susceptibilityto cancers as well as the response to therapy. Westudied different common polymorphisms in thegenes encoding for cytochromes CYP3A4 and CYP2E1,glutathione S-transferases (GST-M1), NAD(P)H:quinone oxidoreductase (NQO1) in 79 patients affectedby acute leukaemia (AL) and 75 healthy control. Atotal of 7 allelic variants were evaluated, in particularthe NULL genotype for GST-M1, three CYP3A4 singlenucleotide polymorphisms (SNPs): A-392G,T15615C and T20072C, two CYP2E1 SNP: C1053T andG1293C, SNP C609T for NQO1.Sequences and selectedpolymorphisms were retrieved from www. ncbi.nlm. gov/ web-site. Genotypes were examined by apolymerase chain reaction (PCR) approach. Briefly,sequences of interest including the polymorphic siteswere amplified by a first PCR followed by a secondsingle base extension reaction using oligonucleotidesappropriately designed to detect the SNPs and fluorescentlylabelled dideoxinucleotide. The latter reactionwas performed using the SNAPshot assay(Applied Biosystem). SNP-PCR products were detectedby capillary electrophoresis on a DNA Genetic Analyzer(ABI PRISM 3100 Applied Biosystem, CA). Collecteddata were visualized on a fluorescent histogramand analyzed by using ABI GeneScan software(Applied Biosystem, CA, USA). The analyzed ALpatients showed an incidence of CYP3A4, CYP2E1 andGST-M1 genotypes similar to that founded in the controlgroup. In fact we found 12,6% heterozygousityfor CYP3A4 and 10% in control group; a frequencyof CYP2E1*5 allele of 17,7% in AL group and 20% incontrol group; a frequency of 38% of GST-M1 NULLin AL group and of 37% in control group. Furthermorewe found only significant different distributionof NQO1 allele 609T in AL group (44%) versus controlgroup (27%) (χ 2 test of Pearson = 5,8). Our data showsimilar conclusions for some respect to those reachedin previous investigations while identifying a differentfrequency of NQO1 609T genotype among tumors.We realize more patients need to be genotyped andother genes involved in the study to support solid conclusions.A number of studies have investigated drugmetabolizing enzymes polymorphisms but their analysiswas restricted to evaluate single or a limited numberof SNPs. In our opinion the best approach is toextend the analysis to many candidates in order torepresent a most comprehensive allelotype profileallowing for further, more refined associationsbetween xenobiotic metabolizing pathways, the riskof cancer and response to therapy.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200467PO-009QUANTITATIVE SINGLE CELL DETERMINATIONS OF ERK PHOS-PHORYLATION AND REGULATION IN RELAPSED AND REFRACTO-RY PRIMARY ACUTE MYELOID LEUKEMIA CELLSRicciardi MR, 1 McQueen T, 1 Chism D, 1 Milella M, 1Kaldjian E, 2 Sebolt-Leopold J, 2 Konopleva M, 1Andreeff M 11Departments of Blood and Marrow Transplantation,Section of Molecular Hematology and Therapy, TheUniversity of Texas, M.D. Anderson Cancer Center,Houston, Texas USA; 2 Cancer Molecular SciencesDepartment, Pfizer Global Research &Development,Ann Arbor, Michigan, USAConstitutive activation of the MEK/ERK pathway isfrequently observed in primary acute myelogenousleukemia (AML) samples, but not in normal CD34 +progenitors. ERK promotes cell growth and viabilityof leukemic cells, and its constitutive activation is anindependent prognostic factor for survival in AMLpatients. We observed that the specific MEK inhibitorCI-1040 impaired cell growth and survival, abrogatingclonogenicity of leukemic cells. No data is availableon the effects of MEK inhibitors on primaryrelapsed/refractory AML cells. We applied a flowcytometry technique to quantitate the expression ofphosphorylated ERK (p-ERK) in AML samples and normalCD34 + progenitor cells, and evaluated the in vitroeffects of CI-1040.We analyzed p-ERK levels inbone marrow or peripheral blood samples from 42primary AML patients (16 samples collected fromAML at diagnosis and 26 from relapsed/refractoryAML). Highly purified normal bone marrow and G-CSFmobilized CD34 + progenitors were collected and usedas controls. ERK activation was analyzed using amonoclonal antibody specific for p-ERK and Kolmogorov-Smirnovstatistics. Results were expressedas D values (D), which allows the objective quantitationof differences in fluorescence intensity. Sampleswith D > 0.1 were considered positive. In addition, weevaluated changes of p-ERK induced by short-termcell culture (up to 24h) in FCS (10%)-containingmedium in the presence or absence of MEK inhibitor(CI-1040, 3uM). Cell viability and phosphatidylserineexternalization were determined. Normal bone marrowCD34 + cells at most weakly expressed p-ERK(D=0.07±0.035), while G-CSF mobilized CD34 + cellsexhibited markedly levels of p-ERK (D=0.56±0.038).Likewise, marked p-ERK levels were found in 83.3%(35/42) of the AML samples, with a mean D valueequal to 0.32±0.04.No differences between samplesat diagnosis and relapsed/refractory samples withrespect to p-ERK levels were observed: D values were0.36±0.06 vs. 0.30±0.05 (p=n. s. ). Next, we examinedeffects of the specific MEK inhibitor CI-1040.In AMLcell lines with constitutive ERK phosphorylation, CI-1040 completely inhibited ERK activation. In primaryAML, a statistically significant decrease in p-ERKlevels were detected after a 24 hour incubation withCI-1040 D=0.46±0.04 to D=0.31±0.04 (p=0.00027).Newly diagnosis and relapsed/refractory sampleswere equally sensitive to the inhibitory effects of CI-1040. CI-1040 did not induce apoptosis compared tovehicle in all but one samples examined. In conclusion,the increase in p-ERK levels that were detectedin mobilized normal circulating CD34 + cells was likelydue to activation by G-CSF. In contrast, high levelsof p-ERK observed in the majority of primary AMLsamples suggest a disregulation of the MEK/ERKpathway, which is apparently independent of diseasestage. CI-1040 inhibited ERK activation in vitro withoutinducing apoptosis. Consequently, MEK inhibitorsmay be more effective in combination with cytotoxicagents for the therapeutic modulation of AML. Ourprevious data have suggested striking synergism withapoptosis modulators.PO-010VALPROIC ACID PLUS RETINOIC ACID INDUCE MYELOID DIF-FERENTIATION IN CHEMOTHEAPY-RESISTANT ACUTE MYELOID LEUKEMIA PATIENTSCimino G, 1 Lo Coco F, 2 Minucci S, 3 Careddu A, 4Fiorini R, 4 Finolezzi E, 1 Noguera N, 2 Travaglini L, 4Gelmetti V, 4 Diverio D, 1 Fenu S, 1 Mancini M, 1Tatarelli C, 4 Aloe Spiriti MA, 1 Petti MC, 1 Venditti A, 2Mandelli F, 1 Amadori S, 2 Pelicci PG, 3 Nervi C 4Departments of Cellular Biotechnology andHematology 1 and Histology and Medical Embryology,4 University “La Sapienza”, Rome, Italy; Departmentof Hematology University of Tor Vergata, Italy; 2European Institute of Oncology, Milan, 3 ItalyThe anti-epilettic drug valproic acid (VPA) has beenrecently shown to possess inhibitory activity againsthistone deacetylases. In vitro treatment of fresh acutemyeloid leukemia (AML) blasts showed that, in combinationwith retinoic acid (RA), VPA triggers myeloiddifferentiation. Pre-clinical studies in murine modelsof leukemia, renal and lung metastases showed thatVPA has anti-tumoral activity through a differentationmechanism. We have designed a phase II clinicalstudy in which VPA was combined with RA (VPA-RA) in the treatment of non-APL AMLs. Eigth chemotherapy-resistantor high risk AML patients (medianage 61.5; range 31-66 years) not eligible for additionalintensive therapy, were treated at the HematologyUnits of the Universities “La Sapienza” and TorVergata of Rome, Italy. VPA (Depakin[Sanofi-Wintrop])was administrated from day 1 to day 28, at theinitial dosage of 10 mg/kg/die p. o. with dose escala-haematologica vol. 89[suppl. n. 6]:september 2004

68Posterstion until optimal VPA plasma levels (80-110 µg/mL).RA (Vesanoid [Roche]) at the dosage of 45 mg/m 2 p.o. /d, divided in two administrations, was added atoptimal VPA plasma levels or at day 14 to day28.Peripheral blood and/or bone marrow sampleswere collected at day 0, 3, 7, 14, 21, 28 for the evaluationof histone acetylation and for morphologic,immunophenotypic, cytogenetic, and molecular studies.Four patients had a history of MDS, three patientshad a FAB M0, M1 and M2 de novo AMLs, while theremaining case was a myeloid blast crisis (FAB M0)from a Ph+ve CML. Of the other seven patients, onehad normal kariotype, one a pseudodiploid [der(12)],one a hyperdiploid (+8) K, one a complex K with a 7qalterationwhile in the three remaining cases thekaryotype is not available. Pre-treatment leukemicinfiltration ranged from 22% to 95%. VPA plasmalevel >60 g/mL was reached between 8 to 28 days (median 14.5 days). In three patients VPA-RA treatmentinduced hyperleukocytosis (> 50×10 9 /L) at day16, 21 and 24, respectively, treated with chemotherapy(HU in two cases and low dose Ara-C in 1 case).Hematological improvement (50% decrease inpacked red blood cell or platelet transfusion requirement)was observed in one case while a stable diseaseand disease progression were observed in five andtwo cases, respectively. All patients showed featuresof myeloid-monocytic and/or eritroid differentationof the leukemic clone, as revealed by morphologic,cytochemical, immunophenotypic analyses and Q-RT-PCR of myeloid gene expression (GATA 1, MPO,CSF2R, etc. ). High degree of myeloid differentiationcorrelated with early achievement of therapeutic VPAplasma levels and histone hyper-acetylation, as measuredby immunocytochemistry and immunoblottingusing antiacetylated histone H3 antibodies. Finally,differentiation of the leukemic clone was proven byFISH analysis showing the presence of the +8 and7q- in maturing elements in patients whose leukemiablasts carried these cytogenetic lesions. VPA-RA combinatorialis a well tolerated treatment that inducephenotypic changes of the leukemic clone throughchromatine remodelling. Further studies are neededto optimise this regimen with the aim of improvingclinical response in leukemia patients.PO-011USE OF MYLOTARG IN ELDERLY PATIENT WITH RELAPSEDACUTE MYELOID LEUKEMIA: EFFICACY AND TOXICITYLi Gioi F, Floridia PM, Santonocito AM, Figuera A,Di Giacomo V, Longo G, Mineo G, Russo MDivisione di Ematologia, Ospedale S. Vincenzo, Taormina,ItalyAcute myeloid leukemia (AML) is the most commontype of acute leukemia in older adults. Treatmentof AML in the elderly is complicated not only bycomorbidities but also by the high prevalence of poorprognosis markers. Relapse represents the mainadverse prognostic factor in patients with AML.Mylotarg (gemtuzumab ozogamicin, CMA-676;Wyeth-Ayerst Laboratories, Philadelphia, PA, USA)has recently been approved for the treatment ofCD33 + acute myeloid leukemia in elderly relapsedpatients. To investigate the efficacy and toxicity ofMylotarg, we report the case of a 71-year-old malewho was admitted in our departiment of Hematologyin November 2003 for fourth relapse of acute myeloidleukemia. Bone marrow aspiration confirmed thepresence of 60% of blasts cells. Blasts immunophenotypein bone marrow showed CD33, CD13, Cd117and MPO positivity. Cytogenetic study on bone marrowshowed normal cariotype. The patient had previouslyreceived several cycles of chemotherapy(Anthracycline, ara-c, fludarabine) achieving completebut temporary response (CR3 duration < 6months). Since the patient had received the maximundose tolerated of anthracycline, the treatment planincluded mylotarg (6 mg/mq by i. v. infusion over 2hours for two successive cycles on day 1 and 21) andara-c (1.5 g/mq on day 3-5). Patient achieved completeremission with incomplete platelet recovery onday +52. Except grade 4 myelosuppression (accordingto WHO score), although heavy pretreated, thepatient no experienced FUO sepsis, hyperbilirubinemia,VOD, nephrotoxicity and mucositis. Actually heis undergoing periodical follow up to evaluate byflow-cytometric analysis of bone marrow the rate ofCD 117 and CD33 positivity and re-start at once theMylotarg treatment without Ara-C. In conclusion thissalvage regimen could be able to induce CR in thissubset of poor prognosis AML patients, without significanttoxicity. A longer follow up is needed to evaluatethe efficacy.PO-012TOXICITY AND EFFICACY OF AUTOLOGUS STEM CELL TRANS-PLANTATION IN ELDERLY PATIENTS WITH ACUTE MYELOIDLEUKEMIARicci F, Cairoli R, Marenco P, Tedeschi A, Grillo G,Ripamonti C, Brasca P, Montillo M, Nosari AM,Morra EDivision of Hematology, Niguarda Hospital, Milano,ItalyOutcome of acute myeloid leukemia (AML) inpatients aged >60 years is characterized by shortduration of remission with less than 25% probabilityof remaining disease-free after 4 years (Buchner,Best Practice and Research, 2001). Aim of this studywas to evaluate the toxicity and the efficacy of auto-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200469logus stem cell transplantation (ASCT) using HD-Busulfan as conditioning regimen in elderly patientswith AML. Patients and methods. Between December1997 to January 2004, 11 patients with diagnosis ofde novo AML (4 cases) or MDS-AML (7 cases), medianage 62 years (range 59-66), F:M = 5:6, wereenrolled in this study. According to cytogenetic pattern,2 patients were categorized in the high riskgroup and the remaining 9 patients in the intermediaterisk. At the enrolment 10 patients were in firstcomplete remission (CR) and one patient in secondCR. The preparative regimen was Busulfan 16 mg/kg.Leukocytes and neutrophil recovery was acceleratedby CSF administration in all cases. Patients receiveda median of 8×10 6 /kg (range 4,12-16,1) unmanipulatedPBSC, harvested after completion of the secondconsolidation course. Results. All patients were evaluatedfor side-effects, duration of chemotherapyinducedcytopenia and infections. The median time toreach a neutrophil count > 500/µL was 11 days (range8-16); a platelet count >20000/µL and > 50000/µLwere observed after a median of 11 days (range 0-34)and 13 days (range 0-46, respectively. CSF wasadministrated for a median time of 10 days. We didnot record toxic deaths. Four patient experienced aWHO grade I-II liver toxicity. Two patients with severemucositis required a continuous infusion of narcoticsfor pain control. During neutropenia we recorded 4episodes of FUO, 1 pneumonitis and 1 sepsis (Staphylococcusepidermidis). With a median follow-up of 9months from ASCT (range 3-16), the relapse incidencewas 73% (8/11 patients), the overall survival45% (5/11 patients) and the disease free survival 27%(3/11); at the present time only 3 patients are in continuousCR, 3, 4 and 12 months after ASCT. Conclusions.These results indicate that HD-Busulfan as conditioningregimen has good tolerability and mild toxicity,but poor efficacy in obtaining long-term disease-freesurvival in elderly AML patients submittedto ASCT.PO-013IMPACT OF BONE MARROW AND INFUSED RESIDUAL LEUKEMICCELLS ON RELAPSE AFTER AUTOLOGOUS BONE MARROWTRANSPLANTATION IN ACUTE MYELOID LEUKEMIA PATIENTSBuccisano F, Maurillo L, del Poeta G, Mazzone C,Tamburini A, Del Principe MI, Consalvo MI,De Fabritiis P, Cudillo L, Picardi A, Lo Coco F,Amadori S, Venditti AHematology, Tor Vergata University and OspedaleS. Eugenio, Rome, ItalyFlow cytometry represent a method to detect minimalresidual disease (MRD) in the vast majority ofacute myeloid leukemia (AML) patients. The presentstudy was designed to determine to what extentautologous stem cell transplantation (ASCT) mightimpact on the level of MRD in 31 patients enrolledonto intensive chemotherapy protocols EORTC/GI-MEMA AML10/12 (induction, consolidation, ASCT).Furthermore the same immunologic fingerprint hasbeen used to trace the amount of residual leukemiccells in the graft of 12 patients receiving peripheralblood stem cell (PBSC). By using a threshold of 3.5×10 -4bone marrow leukemic cells, 12 out of 31 patients(39%) were MRD+ before ASCT whereas the remaining19 (61%) were MRD-. Within a median time of 7months from ASCT all of the 12 patients in the MRD+situation had a relapse, whereas 5 of 19 pts (26%)who were MRD- before the transplant relapsed afterASCT, within a median time of 11 months. The differencein relapse rate between the MRD + and MRD −group was highly significant (p

70Posterseffective biotechnological drug for refractory andrelapsed AML but is associated with an incidence ofapproximately 20% of Grade 3 or 4 hyperbilirubinemiaand liver hypertansaminasemia and it can inducethe development of potentially fatal hepatic venoocclusivedisease (VOD) that occurs when GO is usedeither as a single agent or when it is given with othercytotoxic agents. VOD, diagnosed by Seattle andBaltimore standard criteria, include hyperbilirubinemia,painful hepatomegaly, fluid retention or suddenweight gain. Generally, the median time of occurrenceof VOD is 25 days (range 10-35) after the firstdose of Mylotarg. Recently, promising results in thetreatment of established VOD with Defibrotide werereported suggesting the use of Defibrotide as a prophylacticregimen for hepatic VOD. Defibrotideinduces the release of the plasminogen activator andreduces the blood levels on the plasmin inhibitors.Moreover, it increases the synthesis of PGI2, that is astrong inhibitor of platelet aggregation and an inducerof vessel dilatation, without affecting the coagulation.Therefore, it prevents ischemic and thromboticevents that are both present in VOD. We report ourexperience on 4 patients treated with Mylotarg regimenand Defibrotide prophylaxis. Four consecutivepatients (3 females and 1 male, median age: 55 years,range 38-70 years) with CD33 + AML were admittedbetween October 2003 and April 2004.They wereaffected by relapsed (older patients) or refractory(younger patients) AMLs. They received Mylotarg atthe dose of 6 milligrams/m 2 , day 1 and 14 and Defibrotideprophylaxis, 10 milligrams/kilo/day intravenously,from day -1 to day +30.Before GO therapyBilirubin, AST and ALT values were in normal range.VOD was never observed in our series, but 2 patientshave developed grade 2 hypertransaminasemia/hyperbilirubinemia.Another patients showed on day+13 abdominal pain and transient hypertransaminasemia/hyperbilirubinemiathat disappearedafter 5 days. An abdomen US demonstrated the presenceof gallbladder stones. The remaining patientshowed no toxicity signs. Although GO inducedsevere thrombocytopenia it was never observed anincrease of the incidence of haemorrhage signs. Onthe other hand, Defibrotide administration was welltolerated and it was never observed any toxicity signduring the long-lasting administration. GO induced aPR in the two patients who were resistant to the previoustreatments. Moreover, the other two patientsachieved a CR and a PR, respectively (Table 1). Twopatients died four and six months after therapy,respectively. We have not found death due to therapytoxicity. Conclusions: Defibrotide is a well toleratedagent that could be useful for the prophylaxis ofVOD in patients treated with GO. Further studies areneeded to confirm the effectiveness to prevent VOD.Pts Sex Age Diagnosis 1th line GO AST ALT Ongoing GO therapy VODtherapy therapy Bilirubin Liver Hyperresponse response before GO Transaminitis bilirubinemia1 M 46 Sec Resistant P. R. normal grade 2 moderate NOMDSAML2 F 38 de novo Resistant P. R. normal normal normal NOAML 1th(FAB M2) 2nd line3 F 70 de novo C. R. P. R. normal grade 2 moderate NOAML Relapse(FAB M4) after 12 mo.4 F 66 de novo C. R. C. R. normal grade 2AML Relapse transient normal NO(FAB M2) after 14mo.PO-015EARLY MORTALITY RATE IN ACUTE MYELOID LEUKEMIA PRE-SENTING WITH HYPERLEUKOCYTOSISMarbello L, Ricci F, Nosari AM, Mancini V, Cozzi P,Luchesini C, Ravelli E, Ciapanna D, Morra EDivisione di Ematologia dell'Ospedale NiguardaCa'Granda, Milan, ItalyAcute myeloid leukemia (AML) presenting withhyperleukocytosis is generally considered of poorprognosis due to increased early death rate (within 7days from the beginning of therapy) and a lowresponse to initial chemotherapy. Early mortalityreported in literature is 20-40% and it is particularlyfrequent when initial white blood cell count (WBC)is above 100×10 9 /L, due to intracerebral hemorrhageor respiratory distress related to leukostasis. Somestudies have proposed leukapheresis to mechanicallylower the number of leukemic cells in peripheralblood in order to prevent these fatal complications(Bunin and Pui 1985; Porcu et al. 1997). BetweenMarch 1995 and March 2004, 42 patients with newlydiagnosed AML, median age 56 years (range 17-80years), admitted to our institution with an initial WBChigher than 100×10 9 /L ( median 157×10 9 /L, range102-345×10 9 /L) were scheduled to receive chemotherapywithout leukapheresis using hyperhydratation,uricosuric agents and urine alkalinization. Afterinduction therapy complete remission rate (CR) wasachieved in 13 patients (30%). Early death occurredin 9 cases (21%), 7 due to intracerebral hemorrhageand 2 to respiratory distress. In 2 cases early deathoccurred before beginning chemotherapy. In the oth-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200471er 7 patients death occurred after a median of 3 days(range 2-4) from the beginning of therapy. Conclusion.In our study hyperleukocytosis was confirmed asan adverse prognostic factor to achieve CR (only30%). In our experience early death rate is the sameas the rate reported in literature in AML patients withhyperleukocytosis who underwent leukoapheresis.PO-016MULTIPARAMETRIC IMMUNOPHENOTYPING IN ADULT ACUTELEUKEMIA: CORRELATION WITH KARYOTYPIC ABNORMALITIESMestice A,* Casanova M,° Liso A,° Leo M,* PastoreD,* Carluccio P,* Ciuffreda L,* Pietrantuono G,*Sibilla S,* Giannoccaro M,* Specchia G,° Liso V**Hematology, University of Bari; °Hematology,University of FoggiaImmunophenotyping is an essential method for thediagnosis and classification of acute lymphoblasticleukemia (ALL) and is particularly important for thecorrect identification of minimally differentiatedacute myeloid leukemia (AML). Furthermore,immunophenotyping has been reported to be able todetect aberrant phenotypes, to identify minimalresidual disease and to correlate with structural chromosomalabnormalities such as t(15;17), t(8;21) andinv(16) in AML and t(9;22) and t(4;11) in ALL. Weevaluated the correlation between immunophenotypicfindings and karyotypic abnormalities in a largecohort of adult acute leukemia patients to assesswhether immunophenotyping can suggest the presenceof structural chromosomal abnormalities. In agroup of 415 cases of adult acute leukemia (125 B-ALL, 290 AML); median age 47 yrs. (range 14-91), weanalyzed the immunophenotypic findings, investigatedwith a large panel of monoclonal antibodies,together with the karyotypic abnormalities, detectedby conventional cytogenetics and/or RT-PCR. Accordingto the FAB criteria there were 14 M0, 26 M1, 87M2, 72 M3, 5 M3v, 37 M4, 6 M4eo, 27 M5, 12 M6and 4 M7 cases. Of 125 B-ALL cases 28 (22%) hadt(9;22) and 6 (5%) t(4;11). In the AML group t(15;17)was found in all M3 cases, while t(8;21) was observedin 7% (1 M0, 16 M2, 2 M4) and inv(16) in 3% (1 M2,7 M4eo) of AML cases. In ALL with t(9;22) weobserved a significantly higher expression of CD10,CD34 and CD13 (p=0.007, 0.014, 0.036, respectively)while n ALL with t(4;11) CD10 was absent but therewas a high frequency of CD15 expression (p=0.001).The predictive value of immunophenotyping fort(9;22) was even more evident (p

72Postersdirectly to maintenance therapy. Low dose chemotherapyconsisted, in the first 11 patients, of 6-thioguanine (Thioguanine) 40 mg/day×3/5 weeks. Inthe next 17 patients a 14 day course of ARA-C (Aracytin)8 mg/m 2 s. c×2/day + 6-mercaptopurine (Purinethol)50 mg/day was substituted for one 6-thioguaninecourse every 3 months. The whole treatmentstarted after a median of 2.5 months (0.5-4) from CRachievement and was continued until relapse or 4years of continuous CR. The median age of the 28patients was 65.5 (29-73). All patients were ineligibleto allogeneic BMT and shared one or more poorprognostic factors, including age >60 (21), therapyrelateddisease (4), previous relapse (2), resistance tofirst induction treatment (3), leukocytosis >20×10 9 /L(6). Cytogenetic analysis was successfully performedin 18 patients: 12 displayed a normal caryotype whileunfavourable chromosome abnormalities weredetected in 6.The treatment was well tolerated, withoutmajor toxicity. After a median follow up of 37months (9-62), median CR duration and survival ofthe whole group of patients, as well as of patientsabove the age of 60, reached 22 (1-61+) and 23 (4-63+) months, respectively, with a 25% 4 year actuarialsurvival. Diagnosis (AML vs. MDS), type of inductiontherapy with/without consolidation treatmentdid not affect CR duration or survival. Inclusion oflow dose ARA-C in the maintenance therapy wasassociated with a trend towards a longer CR durationthat, however, did not reach a statistical significance.Conversely, the 12 patients with a normal caryotypedisplayed a significant longer CR and survival (35%and 40%, respectively, at 4 years; p=0.03 and 0.049)compared to those with abnormal or unknown caryotype(10% at 4 years). In conclusion, our maintenancetherapy confirmed, at a longer follow up, theprolongation of CR and survival, compared to literaturedata, in a group of poor prognosis AML and MDSpatients and is probably worthy to be tested in a largercasistic.PO-018PERICENTRIC CHROMOSOME 8 INVERSION ASSOCIATED WITHTHE 5'RUNX1/3'CBFA2T1 GENE IN ACUTE MYELOID LEUKEMIACASESAlbano F, 1 Specchia G, 1,2 Zagaria A, 2,3 Anelli L, 2,3Liso A, 2 Cuneo A, 4 Mancini M, 5 Rocchi M, 3 Liso V 11Department of Hematology, University of Bari, BariItaly; 2 Hematology, University of Foggia, Foggia,Italy; 3 Sezione di Genetica, DAPEG, University ofBari, Bari, Italy; 4 Dept. of Hematology, University ofFerrara, Ferrara, Italy; 5Dipartimento di BiotecnologieCellulari ed Ematologia, University La Sapienza,Rome, ItalyIntroduction. Translocation t(8;21)(q22;q22) is acommon karyotypic abnormality detected in about15% of acute myelocytic leukemia (AML) casesinvolving the CBFA2T1 (also known as ETO) andRUNX1 (also known as AML1) genes. Moreover, insertionsgenerating the 5'RUNX1/3'CBFA2T1 gene havebeen described from 1 to 8.5% of AML cases. Wereport two AML cases with the 5'RUNX1/3'CBFA2T1fusion gene on der(8) short arm, generated by a pericentricchromosome 8 inversion followed by a t(8;21)translocation. A detailed molecular cytogenetic characterizationof breakpoints has been performed.Design and Methods. The two cases were identifiedduring screening of 82 AML patients bearing theRUNX1/CBFA2T1 rearrangement detected by RT-PCR.Both patients were diagnosed and tested by conventionalcytogenetic analysis and fluorescence in situhybridization (FISH). Results. FISH co-hybridizationexperiments with CBFA2T1 and RUNX1 probesrevealed, in both cases, the presence of a single unexpectedfusion signal on the 8p derivative chromosomein addition to single signals on normal 8 and 21chromosomes. Moreover, faint CBFA2T1 and RUNX1signals were observed on the long arm of der(8) andder(21) chromosomes, respectively. These data suggestedthat a pericentric chromosome 8 inversioninvolving CBFA2T1 gene occurred and that the chromosome21 was rearranged with the 8p derivativechromosome. To define the breakpoint on the 8pderivative chromosome, we performed FISH experimentswith appropriate probes located at chromosome8 short arm. These studies revealed differentbreakpoint locations at 8p21.3 and 8p21.1. Discussion.FISH pattern observed in the two reported casesis caused by a t(8;21) translocation following achromosome 8 pericentric inversion. To date, pericentricinversions accompanying t(8;21) translocationhave never been reported. Our results confirmthe critical role that the 5'RUNX1/3'CBFA2T1 fusiongene plays in leukemogenesis independently from itslocation. These data suggested that the mechanismleading to the 5'RUNX1/3'CBFA2T1 chimeric gene isheterogeneous, as it can be associated with differentchromosomal rearrangements.PO-019CLINICOBIOLOGIC FEATURES IN 5 PATIENTS WITH ACUTEMYELOGENOUS LEUKEMIA AND A NOVEL TRANSLOCATIONT(2;3)(P21;Q26)Cuneo A, Trubia M, Albano F, Cavazzini F, Bardi A,Ciccone M, Rege Cambrin G, Giugliano E, MozzanaR, Hernandez J, Fabbiano F, Romano A, Quarta G,Magro D, Mancini M, Specchia G, Mecucci C, SaglioG, Lo Coco F, Castoldi GIstituto di Ematologia, Università di Ferrara, Istitutohaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200473di Ematologia, Università di Orbassano (Torino), Istitutodi Ematologia, Università La Sapienza e UniversitàTorVergata, Rome; Istituto di Ematologia, Universitàdi Bari; Istituto di Ematologia, Università diPerugia; Institute of Hematology, UNiversity of Salamaca;Divisione di Ematologia, Ospedale di Brindisi;Divisione di Ematologia, Ospedale di Reggio Calabria;Divisione di Ematologia, Ospedale di Gallarate;Divisione di Ematologia, Ospedale "Cervello" diPalermo; Divisione di Ematologia, IFOM, Milan, ItalyChromosome translocations involving the EVI1gene at 3q26 were detected in 1-3% of de novo acutemyelogenous leukemia (AML). In the majority of cases,the inv(3)(q21q26) or the equivalent t(3;3)(q21;q26) define the 3q21q26 syndrome, consistingof AML/MDS with normal or elevated platelet countand dismal prognosis; however other rare 3q26translocations were described, the significance ofwhich is not known. A novel balanced translocation,t(2;3)(p21;q26) was found in 5 patients with acutemyelogenous leukemia, 4 of whom were drawn froman unselected series of more than 900 patientsenrolled in the GIMEMA trials since 1999.Thesepatients were characterized by molecular cytogeneticstudies and by hematologic studies. The t(2;3)(p21;q26) was the stemline-defining anomaly in allcases; additional chromosome aberrations in twopatients were +15 and +14.In 3 cases EVI1 splittingwas detected by FISH; studies are in progress for theremaining two patients. EVI1 expression was testedby qPCR in 4 patients using normal BM cells as control,using primers able to discriminate between theEVI1 and MDS-EVI1 transcripts. An 8-10-fold EVI1overexpression was detected in all patients, whereasMDS-EVI1 overexpression was not detected. Medianage at presentation was 50 years (range 36-59); WBCcount ranged between 2,9×10 9 and 122,6 (median6,2); Hb levels ranged between 8,3 gr/d and 9,7(median 8,7); the median platelet count was 104×10 9(range 54-171). Moderate splenomegaly wasobserved in 1 patient. The FAB diagnosis was AML-M4 in 2 cases, AML-M1, M2 and M5 in 1 case each.Multilineage dysplasia as defined by the WHO groupwas seen in 3 out of 4 cases. CD34 + was observed in4 out of 5 cases, CD13 and/or CD33, and or MPO testedpositive in all cases, lymphoid markers were notexpressed, with the exception of CD7 positivity in 1patient. Despite aggressive treatment includingantrhracycicline plus cytarabine in conventional doses,with or without etoposide, complete remissionwas achieved in 1 patient only, who showed prolongedthrombytopenia after induction. Remissionwas not achieved after salvage treatment, with theexception of a 4-month response in 1 patient followingthe FLAG regimen. Aploidentical allogeneicbone marrow transplantation achieved CR in 1patient who subsequently died of infection; only partialshort lasting response was seen in 1 patient submittedto unrelated-donor BMT. One patient is alivein first CR at 6 months; 4 patients died after 4-14months. These findings suggest that the t(2;3)(p21;q26) is a recurrent primary chromosome aberrationin de novo AML identifying a specific diseasesubset with the following distinctive features: i) EVI1involvement and overexpression; ii) MDS features ofthe nonblast cell population; iii) severe clinical outcomedue to primary chemoresistance.haematologica vol. 89[suppl. n. 6]:september 2004

74PostersPosterACUTE LYMPHOID LEUKEMIAPO-020DAUNOXOME AND ARA-C AS REINDUCTION CHEMOTHERAPY INRELAPSED ACUTE LYMPHOBLASTIC LEUKEMIA.HIGH COMPLETE REMISSION RATE DESPITE OVEREXPRESSIONOF MULTIDRUG RESISTANCE (MDR) RELATED PROTEINCandoni A, Damiani D, Michelutti A, Masolini P,Tiribelli M, Michelutti T, Calistri E, Fanin RDivision of Hematology and Bone MarrowTransplantation, University Hospital, Udine, ItalyThe treatment of relapsed adult acute lymphoblasticleukemia (ALL) is frequently unsuccessful with currentchemotherapy regimens and often there is anoverexpression of Multidrug Resistance (MDR) relatedproteins. Liposomal encapsulation make daunorubicinless sensitive to the efflux effect of P-glycoprotein(PGP) and in vitro data indicate that liposomalencapsulateddaunorubicin (DaunoXome-DNX) ismore toxic than daunorubicin (DNR) against ALL celllines. In this study we assessed the in vivo and in vitroefficacy and toxicity of DNX and Cytarabine (Ara-C) as reinduction chemotherapy in 25 relapsed ALLpatients (pts). The expression of MDR related proteins(PGP, MRP, LRP) was also analyzed. There were 12males and 13 females, median age 35 yr (range 16-58), 6 ALL T and 19 ALL B, Ph + 8/25 (32%), Bcr-Abl +9/25 (36%). The leukemic cells expression of MDR andthe DNR and DNX retention and induction of apoptosiswere evaluated in all cases. Seventeen of 25 (68%)pts were at first relapse and eight (32%) at second orsubsequent relapse. Nine (36%) pts relapsed after anallogenic BMT. DNX was given at the dose of 80mg/m 2 /day (days 1-3) in the first 11/25 pts (44%) andthen at the dose of 100 mg/m 2 /day (days 1-3) in 14/25(66%) of cases. In all pts Ara-C was administered atthe dose of 2 g/m 2 (days 1-5). Twenty pts (80%)achieved a complete remission (CR) and 2/25 (8%)entered a partial remission (PR) for an overall response(OR) rate of 88% (22/25) with a tolerable toxicity andwithout significant cardiotoxicity. At relapse 18/25(72%) cases overexpressed at least one MDR relatedprotein compared to 9/25 (36%) cases at diagnosis(p=0.01). The response rate was not affected by MDRoverexpression and in vitro results showed an higheruptade and apoptotic cell death of DNX compared toDNR. Twelve pts subsequently underwent allogenicbone marrow transplantation (11 MUD-BMT, 1 siblingBMT). The overall survival was 43% at 12 months.These data show the efficacy (OR rate 88% and CRrate 80%) of DNX plus Ara-C as reinduction therapyin very poor-risk ALL and also confirmed that DNXcan overcome the MDR in vivo. The co-administrationof G-CSF could reduce the hematologic toxicityby improving granulocyte recovery. Moreover the highrate of remissions and good clinical tolerance in pretreatedpts also suggest a possible role of DNX in frontline ALL chemotherapy regimens.PO-021REAL-TIME QUANTITATIVE POLYMERASE CHAIN REACTION FORTHE MESUREMENT OF MINIMAL RESIDUAL DISEASE IN ADULTACUTE LYMPHOBLASTIC LEUKEMIACammarata G, Fabbiano F, Di Raimondo F,* Mirto S,La Rosa M, Palumbo G,* Scimè R, Messana F, BrunoG, Santoro ADipartimento di Ricerca Clinica e Biotecnologie,Divisione di Ematologia con Trapianto di MidolloOsseo, A. O. “V. Cervello”, Palermo; *Dipartimento diScienze Biomediche, Sezione di Ematologia, Universitàdi Catania, ItalyAlthough patients with acute lymphoblasticleukaemia (ALL) can achieve complete clinical remission,many ultimately relapse. The relapse resultsfrom residual cancer cells that persist in patientbelow the limits of detection by standard techniques.Therefore, considerable effort has been directed atdeveloping techniques that sensitively detect minimalresidual disease (MRD). Molecular investigations ofMRD levels and the dynamics of MRD in childhoodALL has proven superior to the other standard criteria(age, sex, and WBC) in distinguishing patients athigh, intermediate and low risk of relapse. To dateclinical implications of MRD in adult ALL patientshave been less investigated. Measurement of MRDcan be obtained by Real-time quantitative PCR (RQ-PCR) analysis of immunoglobulin and T-cell receptorgene rearrangements, breakpoint fusion regions ofchromosome aberrations or fusion-gene transcripts.In this study we included 10 B-cells ALL patients(median age 33, range 18-54 years), recruited at oursinstitutions. Molecular studies were performed atdiagnosis to identify a MRD-PCR target for eachpatient. In eight patients an unique IgH generearrangement was found and in two patients a BCR-ABL rearrangement (one p190 and one p210). Themolecular rearrangement of the IgH genes was studiedby sequencing on a ABI PRISM 310 Genetic Analyzer(Applied Biosystems- Big Dye Terminator CycleSequencing Kit). Patient specific oligonucleotides andprobes were designed spanning the V-D-J junctionalregions (PrimerExpress software). We performed RQ-PCR assays on a ABI PRISM 7900 platform with Taq-Man probes and to determine the sensitivity andaccuracy of patients specific MRD assay we per-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200475formed serial dilutions of known amounts of diagnosticDNA in normal DNA. These experimentsdemonstrate that a sensitivity higher than 10 –4 , 10 –5has been reached for all patients. We examined thereproducibility of the method by comparing resultsobtained from triplicate samples. We used a RelativeQuantification method by comparing target and controlgenes cycle threshold (δδCt). A single copyTelomerase gene TEL was selected as control gene.BCR-ABL fusion gene expression was analyzed usingoligonucleotides, probes and control gene (Abelson)standardized in Europe Against Cancer (EAC) programprotocol. Eight patients were evaluated for the outcomeanalysis ( median follow up 12mo, range 7-40)the others two pts were actually excluded from evaluationbecause of a shorter than 3 months follow-up.Five pts showed a reduction of MRD level >3log afterinduction therapy, one achieved a 3 log reductionMRD only after consolidation therapy; all these ptsare in complete remission at a mean follow-up of 18months. The others two pts had a lower rate decreasetherefore they were considered bad responders. Onebad responder patient received an allogenic bonemarrow transplantation six months after diagnosisand achieved a >3log reduction after transplant, theother bad responder patient showed a persistent andincreasing level of MRD during the follow-up andsubsequently relapsed 21 months after the diagnosis.The present study involves only few patients and thefollow up is relative short but it is clear that thismethod provides interpretable data that can beapplied for risk assignment in adult ALL such as inpaediatric setting.PO-022EARLY DETECTION OF RESIDUAL DISEASE BY Q-RT-PCR OF THEHYBRID BCR/ABL TRANSCRIPT IS A POWERFUL PREDICTOR OFTREATMENT RESPONSE IN ADULT PHILADELPHIA-POSITIVEACUTE LYMPHOBLASTIC LEUKEMIAIzzo B, 1 Cimino G, 2 Camera A, 3 Vitale A, 2 QuintarelliC, 1 Picardi M, 3 Specchia G, 4 Mancini M, 2 Cuneo A, 5Mecucci C, 6 Martinelli G, 7 Saglio G, 8 Rotoli B, 3Mandelli F, 2 Foà R, 2 Pane F 11CEINGE - Biotecnologie Avanzate and Dipartimentodi Biochimica e Biotecnologie Mediche, University“Federico II di Napoli”, 2 Dipartimento di BiotecnologieCellulari ed Ematologia, University “La Sapienza”Rome; 3 Divisione di Ematologia, University “FedericoII di Napoli”, 4 Divisione di Ematologia, University ofBari; 5 Dipartimento di Scienze Biomediche e TerapieAvanzate, University of Ferrara; 6 Dipartimento diMedicina Clinica e Sperimentale, Universiy of Perugia;7 Istituto di Ematologia “L. &A. Seragnoli”, Universityof Bologna; 8 Dipartimento di Scienze Biomedicheed Oncologia Umana, University of Turin, ItalyPh + acute lymphoblastic leukemia (ALL) is a subgroupof ALL with dismal prognosis and high risk oftreatment failure. Despite high dose chemotherapyinduces complete response (CHR) in 70-80% ofPh+ALL patients, most of them experience earlyrelapse. Imatinib has been shown to induce a CHR inabout 60% of patients with relapsed or refractoryPh+ALL. However median time to progression is only2.5 months. Recent studies showed that childhoodPh+ALL show a heterogeneous response to treatmentand that response to prednisone and molecularresponse may predict remission duration and overallprognosis. In this prospective study we evaluated thelevel of residual disease in a series of 45 adult Ph + ALLpatients enrolled into the GIMEMA ALL0496 andLAL2000 protocols, to verify whether early detectionof chemosensitivity may be used to predict the outcomeand to identify patients at risk of early relapse.Both protocols included an induction period withhigh dose daunorubicin and a consolidation treatmentaccording to the HAM protocol. Based on theavailability of a HLA-identical siblings, allogeneichemopoietic stem cell transplantation (SCT) wasscheduled. The levels of residual BCR/ABL transcriptswere assessed in bone marrow samples twice (afterinduction and after consolidation) by a Q-RT-PCRassay standardized from our group in the context ofthe European Study Group on MRD. Four patientsresistant to induction and two with a clinical followupshorter than 6 months were excluded from evaluation.Thirty-nine patients were evaluable for theoutcome analysis (median follow-up 14mo, range 6-48). Twenty-one patients had the P190 type ofBCR/ABL junction, five the P210, and three cases hadboth types of transcripts. At diagnosis the mean levelof BCR/ABL transcript, expressed as ratio to theGUS control gene, were 1,20 (range 0.23-10.30); nodifference was found between patients expressingP190 and P210.Patients were operationally dividedinto two groups based on the Q-RT-PCR assay ofbone marrow BCR/ABL mRNA levels: 27 patients witha level of residual disease below 0.01 (>2 logs ofreduction) after induction therapy, and below 0.001(>3 log of reduction) after consolidation therapy wereconsidered good molecular responders (GMRs), whilethe remaining 12 cases who, despite the achievementof CHR, had a lower rate of decrease of residualdisease at both time points, were considered poormolecular responders (PMRs). Clinical follow-upshowed that early reduction of residual leukemicmass is an independent and powerful prognosticparameter. In the GMRs the actuarial estimated probabilityof relapse-free survival, disease free survivaland overall survival at two years was 31%, 44%, and44%, as compared to 0%, 0%, and 0% in the PMRs(p = 0.0029, 0.001 and 0.03, respectively), withoutregard to transplant procedure, which were per-haematologica vol. 89[suppl. n. 6]:september 2004

76Postersformed in half the patients in both groups (13/27 inGMRs and 6/12 in PMRs). At the end of study 13 GMRpatients and only one PMR were alive. Furthermore,only in four cases, all belonging to the GMR group,salvage therapy, including Imatinib, resulted in a secondremission. Our data indicate that, as documentedin the children, also adult Ph+ALL comprisespatients with heterogeneous sensitivity to treatment,and that early quantitative assessment of residualdisease is a powerful prognostic parameter in thisdisease.Funding: Supported by Associazione Italiana per laRicerca sul Cancro (AIRC), and COFIN, Ministero dell'Istruzionee Ricerca Scientifica (MIUR), RegioneCampania, Intas (Brussel), EurLeukemiaNet (Brussel),Biogem (Avellino).PO-023INTEGRATED ANALYSIS OF GENE EXPRESSION AND SINGLENUCLEOTIDE POLYMORPHISMS: IDENTIFICATION OF ADISTINCTIVE GENE EXPRESSION SIGNATURE ASSOCIATED WITHLOH ON CHROMOSOME 9P IN ADULT ALLChiaretti S, § * Li X, † Gentleman R, † Li C, † Mancini M,*Mecucci C, ¥ Vitale A,* Foa R,* Ritz J §Departments of Medical Oncology § and BiostatisticalScience, † Dana-Farber Cancer Institute, Departmentof Medicine, Brigham and Women's Hospital,Harvard Medical School, Boston MA. USA Departmentof Cellular Biotechnologies and Hematology,*“La Sapienza” University, Rome, Italy; Haematologyand Bone Marrow Transplantation Unit, ¥ PoliclinicoMonteluce, University of Perugia, ItalyBackground. In acute lymphocytic leukemia (ALL),previous studies have demonstrated that specificgenetic rearrangements are associated with distinctivegene expression signatures defined by high-densityoligonucleotide microarrays. Characteristicexpression signatures associated with ALL1/AF4,E2A/PBX1, BCR/ABL and TEL/AML1 rearrangementshave provided insights into the mechanisms of malignanttransformation and are also likely to improvethe identification and classification of leukemia cellswith these abnormalities. Nonetheless, many casesof ALL do not carry known molecular abnormalitiesand do not exhibit unique gene expression profiles. Inthese cases, the mechanisms of malignant transformationremain unknown. Aims. Our goal was todevelop an integrated genetic approach to discovernew mechanisms of malignant transformation in ALLand to define the gene expression signatures associatedwith these genetic abnormalities. Methods.Gene expression profiles were determined in leukemiacells from 95 adult patients with B-lineage ALL usingAffymetrix U95Av2 GeneChips. Within this group,high density SNP analysis was performed on 18 samplesof normal hematopoietic cells and tumor cellsfrom the same patients using Affymetrix GeneChipMapping 10K Arrays. Patients were enrolled in theItalian protocol GIMEMA 0496.Results. Paired SNPanalysis of normal and ALL DNA revealed the presenceof LOH in a portion of chromosome 9p (9p13.3to 9p24.3) in 4 of 16 cases (25%). This deletion wasnot detected using conventional cytogenetic methods.FISH analysis confirmed the presence of ahomozygous deletion at 9p21 in 2 of these samples,whereas the 2 remainder cases showed a normal copynumber, suggesting that in these 2 patients a deletionfollowed by duplication occurred. Analysis ofgene expression based exclusively on genes locatedin this area identified two genes differentiallyexpressed: ADFP was found more highly expressed,whereas a transcript whose function is unknown wasfound expressed at low levels. Analysis of geneexpression in these cases revealed increased expressionof a set of 20 genes and reduced expression ofa set of 18 genes. Using this gene set, we examineda larger series of 40 adult ALL cases without previouslydefined molecular rearrangements. This analysisidentified 1 additional case with a similar patternof gene expression, suggesting that also this samplemay have a LOH in 9p region. Summary. These resultsshow that SNP analysis is a powerful tool to identifygenetic abnormalities that are not detected byconventional cytogenetic techniques. Furthermore,these results demonstrate that integrated analysis ofgene expression combined with SNP-based comparisonof leukemia and normal cells can identify previouslyunknown groups of tumors with distinct geneticprofiles. Further studies can now be undertaken tobetter define the genetic mechanisms of malignanttransformation in these leukemias.PO-024TUMOR LYSIS SYNDROME IN ACUTE MATURE B-LYMPHOBLAS-TIC LEUKEMIA (L3 ACCORDING FAB CLASSIFICATION) PATIENTFloridia PM, Santonocito AM, Figuera AS, Li Gioi F,Russo MDivisione di Ematologia, Ospedale "S. Vincenzo",Taormina, ItalyTumor lysis syndrome (TLS) is a life-threateningmetabolic complication that occurs in malignancieswith large tumor burden and highly proliferative cells,including lymphoma and leukemia. The lysis oftumour cells and the subsequent release of the intracellularcontents leads to hyperkalemia, hyperphosphatemia,hyperuricemia, hypocalcemia, increasedlactic dehydrogenase (LDH), activation of disseminatedintravascular coagulation, and often renalhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200477function impairment. These complications may leadto acute renal failure and dialysis and therefore havea negative impact on the outcomes of patients withmalignancies that otherwise are potentially curable.We described a case of tumor lysis syndrome in acuteB-lymphoblastic leukemia patient treated withadministration of rasburicase, a recombinant urateoxidase that converts uric acid into the soluble compoundallantoin. A 68 year old woman was referredto our emergency department for hyperleucocytosis,anemia, mild decrease in platelet number and acuterenal failure. At the anamnesis the patient revealedfive days of persistent fever (38.5°C) with mild dispnea,treated with a wide spectrum antibiotic (oralamoxicillin with clavulanic acid) and two doses of 20mg of methilprednisolon in 24 hours. The patient wasadmitted in our hematology department and a centralvenous line was positioned in the succlavian vein.An i. v. therapy with 2000 ml/day per square meterof 0,9% saline solution associated with furosemide1,5 mg/Kg i. v. /day was started. In addiction, sodiumbicarbonate infusion was administred and stoppedwhen a urine pH > of 7,5 was reached. In order toobtain a rapid reduction of uricemia blood levels andimprove the renal failure, rasburicase at the dose of0,20 mg/Kg/day in 50 ml of 0,9% saline solution wasadministred in 30 minutes for seven days. At the sametime, a complete hematological evalutation withbone marrow aspirate for morphologic, immunologic(TdT-, HLA-DR + , CD10-, CD19 + , CD20 + , CD24 + , Sig + ,µCyt. ) and cytogenetic analysis [t(8;14)(q24;q32)]was performed and the diagnosis of mature acute B-lymphoblastic leukemia (L3 according FAB classification)was done. We also performed a complete cardiacevaluation. After 12 hours form hospital admission,because of the rising leukocytes number levels,and the progressive normalization of renal funcion achemotherapy treatment according B-NHL 83 protocol(Hoelzer et al. ) was started. Treatment describedwas efficent in preventing the patient from dialysistreatment and from delay in chemotherapy treatment.In particular, rasburicase showed a great efficiencyin reducing blood uricemia level within fewhours after the first dose. It is efficient within 12hours after the treatment, for renal function inpatients with blood uricemia level. TLS is poor complicancein treatment of high growth fraction. Classicalprophylaxis of tumor lysis syndrome consists ofhydration, alkalinization, and use of the xanthine oxidaseinhibitor allopurinol. The limitations of allopurinolinclude slow onset of action, insufficient efficacyin many high risk patients and the ability to partecipatein significant drug-drug interactions withcommon chemotherapeutic agents. The use of allopurinolleads to the accumulation of xanthine, whichmay crystallize and precipitate in the renal tubules.Urate oxidase acts by converting uric acid into allantoin,which is 5-10 times more soluble than uric acidand therefore is rapidly excreted by the kidneys.PO-025MONITORING MRD IN PH POSITIVE ACUTE LYMPHOBLASTICLEUKEMIA BY THREE DIFFERENT MARKERSMiglino M, 1,2 Grasso R, 1,2 Colombo N, 1,2 Varaldo R, 1,2Garrone A, 1,2 Fugazza G, 1 Canepa L, 1,2 Clavio M, 1,2Bruzzone R, 1 Canepa P, 1,2 Pierri I, 1,2 Ballerini F, 1,2Sessarego M, 1 Gobbi M 1,21Dept. of Internal Medicine (DIMI ), University ofGenoa, Italy; 2 Dept. of hematology and Oncology,Azienda Ospedale S. Martino e Cliniche UniversitarieConvenzionate, Genoa, ItalyAcute lymphoblastic leukemia (ALL) is a clonal disorderof hematopoietic stem cells resulting in proliferationand expansion of leukemic cells. Progress inour understanding of molecular mechanisms hasmade it possible to increasingly recognize the role ofmolecular abnormalities in the leukemogenic process.We have studied the expression of three bio-molecularmarkers involved in the pathogenesis and progressionof ALL. The Philadelphia chromosome (Ph)and its molecular product, the Bcr-Abl fusion proteinp190, are the most frequently detected cytogeneticmolecularabnormalities in adults ALL patients,resulting in a worse prognosis. Another useful tool toinvestigate every lymphoproliferative disorders is theIgH gene rearrangement which has been shown to bean easily detectable marker of minimal residual disease(MRD). Recent studies have revealed that inacute leukemias there is an overexpression of Wilm’stumor 1 gene (WT1). Therefore this phenomenonmight be exploited as a marker to establish the presence,the persistence or the reappearance of leukemichematopoiesis. We have studied five Ph positive,CD10 positive ALL patients. Three out of them havebeen treated with Fludarabine-containing regimen,the other have received a combination of vincristine(VCR), cyclophosphamide (CTX), daunomicin (DNM),and steroids as induction therapy. Two patients whohad a matched sibiling donor underwent allogenicbone marrow transplantation in cytogenetic completeresponse, both of them have died, one for recurrentdisease, the other for transplant related toxicity.Three patients who were not eligible for high dosetherapy, were maintained with 600 mg/day imatinibmesylatetherapy for 45 days, followed by daily mercaptopurineand weekly metotrexate for 45 days, anda re-induction VCR CTX, DNM and steroids. All thesepatients are still alive in good clinical conditions andin cytogenetic complete response. We have studiedthe expression of BCR-ABL qualitative, WT1 quantitativeand IgH gene rearrangement in these fivehaematologica vol. 89[suppl. n. 6]:september 2004

78Posterspatients correlating data with the disease status. Theresults of molecular analyses are summarized in thetable below.Our data shows the feasibility and the usefulnessof monitoring MRD by three different markers. In ourhand the most predictive index is IgH monoclonalrearrangement. The prognostic value of the expressionof WT1 gene is still under investigation. The significanceof the persistence of the p190 transcript isa useful marker. After the advent of Imatinib a newscenario may be represented. The patogenetic stepof leukemogenesis can be studied and the abovementioned neoplastic markers might acquire a differentprognostic value. The lineage specific extrinsecneoplastic marker, that is IgH rearrangement, mayidentify a clonal instable population that has not yetacquired the intrinsec marker ( the p190 transcript ).The overexpression of the WT1 gene may identify theclonal instability of this leukemic clone. So the presenceof p190 transcript represents the last patogeneticevent and is a strong index of impendingrelapse. We think that the identification of MRD at aprecox patogenetic step is the goal of the treatmentof Ph positive ALL. WT1 expression may be the simplestmethod to stratify the patients in differentprognostic and therapeutic subgroups.PO-026P-ERK1/2 AND P21CIP-1/WAF1 IN ACUTE LYMPHOBLASTICLEUKEMIA CELLS: EFFECTS OF THE MEK INHIBITOR PD98059Gregorj C, Petrucci MT, Scerpa MC, De Cave F,Mazzola F, Lemma T, Vitale M, Paoloni F, Milella M,Foà R, Tafuri ADept of Biotecnologie Cellulari ed Ematologia, University“La Sapienza” of Rome, Div. of Medical OncologyA, Regina Elena Cancer Institute, Rome, ItalyThe mitogen activated protein kinase (MAPK) pathwaylinks cellular signals (proliferation, differentiationand apoptosis) from the cell surface to the cytoplasmic/nuclearevents. Extracellular signal-regulatedkinase-1/2 (ERK) are serine/threonine kinasesinvolved in the MAPK pathway. Prolonged MAPK activationmay increase one of the cell cycle negativeregulators, the p21CIP1/WAF1 (p21) expression,resulting in cell cycle arrest and cytoprotective effectsagainst chemotherapeutic agents. The aim of ourstudy was to evaluate the role of phospho-ERK (p-ERK) and p21 in leukemia cell lines and in primaryblasts from 118 adult acute lymphoblastic leukemia(ALL). Expression of p-ERK and p21 were evaluated byflow cytometry using a specific monoclonal antibodyfor p-ERK1/2 (clone E10) and p21CIP-1/WAF1. Phospho-proteinexpression was analyzed using the Kolmogorov-Smirnovstatistic test (D-value). Resultswere confirmed by Western blot analysis. HumanK562 and RPMI8866 cells express p-ERK (D-value=0.47and 0.38, respectively), as well as normalPMA-activated PBL (D-value=0.37), whereas restingPBL and normal CD34 + cells exhibited minimal levelsof p-ERK (D-value=0.04 and 0, respectively). Only theRPMI8866 cells expressed p21 (D-value=0.32),whereas the K562 did not; resting PBL exhibited lowp21 levels (D-value=0.18). Expression of p-ERK (Dvalue>0.10) was found in 38/118 adult ALL cases(32.2%), ranging between 0 and 0.72, while 44.9% ofcases (53/118) showed p21 levels higher than0.15.Both proteins were significantly associated withhigher WBC values (>20x10 9 /L): p=0.015 and p=0.04for p-ERK1/2 and p21, respectively. No correlationwas found between other clinical characteristics (age,sex, leukemia phenotype). A proportion of sampleswas in vitro exposed to the MEK inhibitor PD98059(25 mM) which induced a significant (p=0.0142)downregulation of the p-ERK expression (from a D-value of 0.09±0.11 at time 0 to 0.03±0.06 after 24h).In contrast, an increased expression of p21 (D-value0.15±0.07 and 0.32±0.29, respectively; p=0.015) wasnoticed following treatment with the MEK inhibitor.In summary, our study shows that both p-ERK andp21 are expressed in a significant proportion of adultALL samples and both p-ERK appear to be associatedwith higher WBC counts. The MEK inhibitorhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200479PD98059 was able in vitro to downregulate expressionof p-ERK1/2 in samples from ALL patients. Theimportance of these results in terms of chemosensitizationof ALL cells is under evaluation.PO-027EXPRESSION OF BCRP IN ADULT ACUTE LYMPHOBLASTICLEUKEMIA: ROLE AND CORRELATIONS WITH OTHER MDR-RELATED PROTEINSGregorj C, Petrucci MT, De Cave F, Scerpa MC,Lemma T, Mazzola F, Vitale A, Vignetti M, Foà R,Tafuri ADept. of Biotecnologie Cellulari ed Ematologia, University“La Sapienza” of Rome, ItalyThe transporter breast cancer resistance protein(BCRP) was recently described as an additional proteininvolved in the multidrug resistance phenotype. Thisprotein is an ATP-binding cassette (ABC) half-transporterwhich mediates energy-dependent drug effluxand is associated with drug resistance in solid tumors(breast, gastric and colon cancer) and in acute myeloidleukemia (AML). However, the role of BCRP in acutelymphoblastic leukemia (ALL) remains to be established.The aim of our study was to evaluate in samplesfrom adult ALL patients the frequency of BCRPexpression and its correlation with other MDR-relatedproteins: the P-glycoprotein 170 (P-gp170), themultidrug resistance-associated protein (MRP1) andthe lung resistance protein (LRP). Human leukemic celllines and primary samples from 110 untreated ALLpatients were evaluated for BCRP, P-gp170, MRP1 andLRP expression by flow cytometric techniques. BCRPprotein expression was analyzed by the monoclonalantibody BXP-34 and the analysis was performed bythe Kolmogorov-Smirnov (KS) statistic test (D-value).Detection of BCRP in the cell lines MCF7 pcDNA3 andMDA231 pcDNA3 showed lower protein levels (D-value=0.12±0.11 and 0.09±0.06, respectively), whereasthe cell line MCF7 pcDNA3 clone8 and MDA231 pcD-NA3 clone 23 expressed BCRP at higher levels (D-value= 0.44±0.21 and 0.33±0.11, respectively). Analysisof ALL primary samples showed a BCRP expression (Dvalue>0.15) in 69/110 (62.7%) cases, with a meanvalue of 0.32±0.19 (range 0.00-0.87, median 0.33) inthe overall population. BCRP expression resulted higher(0.34 ± 0.03) in samples from patients with whiteblood cell (WBC) counts >100×10 9 /L, compared to alower value (0.26±0.13) found in patients with WBCless then 100 ×10 9 /L (p=0.06). No significant differencewas found between BCRP expression and clinical characteristics.The analysis was then extended to the otherMDR-related proteins: P-gp170 expression wasdetected in 21.7% (D-value⁄0.05) of cases, while MRP1and LRP (D-value ⁄ 0.20) were found in 48.8% (mean0.21±0.30, ranging 0.00-0.93) and 37% (mean0.23±0.27, ranging 0.00-0.92) of cases, respectively.The majority of cases showing absence of MRP1expression resulted negative for LRP (50.4%; p=0.001).Among the 110 samples, 72 of them were analyzedsimultaneously for the expression of BCRP and MRP1which resulted significantly correlated (R= 0.44; p=0.0001): 45.8% of samples were negative for both proteins,while 13.9% expressed both BCRP and MRP1proteins. In fact, MRP1 negative samples showed lowerBCRP levels (m= 0.30, range 0-0.60) compared toMRP1 positive cases (m= 0.38, range 0-0.87)(p=0.017). The BCRP expression was not correlatedwith the P-gp170 and LRP expression. In summary, ourstudy shows that BCRP, MRP1 and LRP are expressedin a significant proportion of adult ALL samples. BCRPexpression is associated with a higher WBC count andhigher MRP1 levels. MRP1 and LRP were also reciprocallyassociated. The role of the simultaneous expressionof all these proteins in the chemoresistance ofadult ALL patients is under evaluation.PO-028Not publishedPO-029CAN CONSTITUTIONAL ABNORMALITIES OF 11Q23, NOT INVOLV-ING MLL, BE INVOLVED IN PATHOGENESIS OF CHILDHOODACUTE LEUKEMIA? A CASE REPORT ABOUT A CONSTITUTIONALTRANSLOCATION T(11;13)(Q23;Q34) IN A CHILD WITH ACUTELYMPHOBLASTIC LEUKEMIAPrudenzano A,* Spedicato F,° Stani L,* Pricolo G,*Pisapia G,* Palazzo G,* Amurri B,* Spirito F,*Mazza P*Struttura Complessa di Ematologia, PresidioOspedaliero S. G. Moscati, ASL TA/1; °LaboratorioAnalisi, Settore di Genetica, ASL TA/1, Taranto, Italy11q23 abnormalities are often seen in childhoodacute lymphoblastic leukemia, being characterizedby a high heterogeneity of the partner chromosomalbands (at least 80 different loci) and in most casesdisrupt the MLL gene which is thought to be crucialfor leukemogenesis. We report about a 2.5-year oldchild who was diagnosed B-acute lymphoblasticleukemia in June 2001.Flow cytometric analysisrevealed a Common phenotype (CD19 + CD10 + CD34 +CD22 + cymu-) with a very dim expression of myeloidantigens CD13 and CD33.Cytogenetic analysisshowed the presence of 11/11 metaphases carrying areciprocal translocation between the long arm ofchromosome 11 (band q23) and that of chromosome13 (band q34), resulting in a t(11;13)(q23;q34)translocation. This finding was initially interpreted ashaematologica vol. 89[suppl. n. 6]:september 2004

80Postersleukemia-related and thus coherent with literaturedata about 11q23 alterations in childhood leukemia,except for the partner chromosomal band 13q34which resulted rarely reported. The patient was thenfollowed-up with morphology, cytogenetics, immunophenotypeat each step of therapy. Surprisingly,after induction, consolidation and even during maintenance,clinical and laboratory findings were consistentwith complete hematologic remission asassessed by morphology and immunophenotype,while cytogenetics always showed all metaphasespositive for t(11;13). Remission lasted until November2003, when overt hematological relapse occurredexhibiting phenotypic switches, mainly a decreasedexpression of CD34 and an increased expression ofCD33 myeloid antigen. Nevertheless, karyotype didnot change and again all metaphases were t(11;13)positive. We thus postulated that the patient carrieda constitutional rather than a leukemia-relatedtranslocation. The analysis of peripheral blood T-lymphocytesstimulated with PHA resulted strongly consistentwith this hypothesis, as they carried the sametranslocation. Obviously, the translocation could havebeen occurred in a totipotent hematopoietic stemcell rather than in a somatic cell during embryonicdevelopment: a skin biopsy could confirm the lasthypothesis, but to date it hasn't yet been investigated.However, it seems to be an acquired rather thanan inherited translocation, as the t(11;13) was notfound in parents. Analysis of MLL rearrangement wasperformed by double-color FISH in bone marrow andperipheral blood of the patient, but it showed no MLLdisruption, as the breakpoint in 11q23 was locatedoutside and centromeric to MLL (350 kb distant fromMLL bcr). Because of the availability of an unrelatedHLA-matched female donor, the patient underwentallogeneic bone marrow transplantation in April2004.At day +30 after transplantation, cytogeneticsshowed the disappearance of t(11;13) along with thepresence of a 46,XX karyotype, thus documenting aprompt engraftment. In conclusion, if data will beconfirmed, we could have probably found a novelconstitutional translocation involving 11q23 not previouslyreported from the literature, with the exceptionof the non-Robertsonian translocation t(11;22),which, however, is not associated to leukemia.Though MLL was not disrupted in our patient, othercandidate genes mapping in 11q23 such as RCK,LARG, etc. , known to be implicated in leukemogenesis,could be involved. If this is the case, we canspeculate that this congenital 11q23 aberration couldbe responsible for the initiation of the leukemicprocess at an early stage of development and in turnthis assumption provide new insights into the molecularpathogenesis of childhood acute leukemia.PosterMDS & PNHPO-030RESPONSE OF MYELODYSPLASTIC PATIENTS TO RHUEPO:MOLECULAR PATHWAYS ASSAYED WITH MACROARRAYSCortelezzi A, 1 Pellegrini C, 2 Silvestris I, 1 Bosari S, 2Maiolo AT, 1 Fracchiolla NS 11Unità Operativa Ematologia 1, IRCCS OspedaleMaggiore Policlinico di Milano; Dipartimento diScienze Mediche, Università degli Studi di Milano;2Dipartimento di Medicina, Chirurgia, OdontoiatriaUniversità degli Studi di Milano, ItalyAmong myelodysplastic syndromes, the cases withIPSS low/intermediate 1 risk classes, present as themain clinical problems infections, due to leukopenia,and transfusion need of platelets and/or packed redblood cells. Recently, promising results have beenobtained in the treatment of MDS related anemia, byhigh dosage recombinant human erythropoietin (rhE-PO) treatment, in the cases with low endogenous EPO.In our patients we have reproduced these clinicalresults. Based on these premises, in order to evaluatethe molecular basis of the rhEPO response in MDSpatients, we choose to investigate the differentialgene expression in the bone marrow erythroid cellsexpressing glycophorin (Gly+) of EPO-responders (ER)and EPO-non responders (ENR) MDS patients, usingcommercially available macroarrays (Clontech). Weanalysed 3 ER and 3 ENR MDS patients (RA andRARS). BM erythroid cells, after Ficoll density gradient,were separated by positive selection using animmunomagnetic procedure (MACS, glycophorin isolationkit; Miltenyi Biotech, Auburn, CA). The purityof Gly+ cells after magnetic immunosorting was testedby flow-cytometry and was superior to 97%, in allthe cases. RNA extraction, cDNA synthesis andmacroarrays hybridization and analysis were performedfollowing manufacturer instructions (ClontechLaboratories, Palo Alto, CA, USA). The data werevalidated on 4 differentially expressed genes by realtime RT-PCR TaqMan technology, obtaining resultsthat were superimposable to the macroarrays ones.Using a stringent cut off of an at least three fold differencein gene expression, we obtained a differentialpattern of expression in ER and ENR patients, BMGly+ erythroid cells. In particular, ER patients presentedthe up-regulation of PCNA, cytochrome P450reductase, serine/threonine-protein kinase PLK1(STPK13), apolipoprotein E precursor (APOE), growtharrest & DNA-damage-inducible protein 153haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200481(GADD153), prothymosin α (ProT-α; PTMA) and highmobility group protein (HMG-I). On the other hand,in the same group, we found a down regulation ofretinoic acid receptor β (RXR-β; RXRB), DNA topoisomeraseI (TOP1), interleukin-2 receptor α subunit,interleukin-6, protein kinase MLK-3, rap1 GTPaseactivating protein 1 (RAP1GAP), metalloproteinaseinhibitor 1 precursor (TIMP1), RCL growth-related c-myc-responsive gene, hepatocyte growth factor-likeprotein. Summary/Conclusions: ER and ENR MDSpatients present a different pattern of gene expression.These results may provide the basis for earlytesting of the genes differentially expressed in ER andENR patients in order to elucidate their role in theprognostication of rhEPO response in MDS patientswith low endogenous EPO levels.PO-031AN ALTERED LECAM1/ICAM1 RATIO ON CD34 + BLAST CELLSPREDICTS LEUKEMIC PROGRESSION IN MDS PATIENTSMazzone C, Buccisano F, Neri B, Maurillo L,Del Poeta G, Tamburini A, Del Principe MI,Irno Consalvo M, Abruzzese E, Lo Coco F,Amadori S, Venditti AEmatologia, Università di Rome Tor Vergata edOspedale S. Eugenio, Rome, ItalyInteraction of adhesion molecules (AM) with bonemarrow (BM) microenvironment regulates hematopoieticprogenitor growth and survival. Consequently,the abnormal growth and proliferation observed inMDS/secondary acute myeloid leukemia (sAML) couldbe related to defective adhesive properties within thestem cell compartment. In this view we compared, ina three colour flow cytometric assay, the expressionof β1-β2 integrins, Lecam1, CD44 and ICAM1 onCD34 + progenitor cells from BM of 66 patients (pts)affected by MDS (34 RA, 2 RARS, 23 RAEB, 7 RAEBt)or sAML (18) and 17 healthy donors (HD). The expressionof AM was measured as percentage, ratio ofmean fluorescence intensity (rMFI) and AM index(AMI = product of rMFI and percent positive cells). Inthe MDS/sAML group, a lower Lecam1 AMI wasobserved (p

82PostersCD33/CD16, CD13/CD16, CD45/CD16, CD11b/CD16patterns showed an increased proportion of immaturecells with a reduction of mature granulocytes inMDS patients: calculated ratios of immature onmature cells resulted significantly higher in MDS thanin controls (p values 0.02-0.001), and positively correlatedwith the degree of morphological myeloiddysplasia (r values 0.30-0.67, p

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200483(range 0-51%). Dpl was localized on the blast surfaceor, seldom, in a cytoplasmic perinuclear area. Thequantitative RT-PCR (TaqMan) assay demonstratedrather high mRNA levels in HL-60 and K562 cells andin almost all AML and MDS cases, but barelydetectable levels in normal bone marrow (p=0.004).These differences were confirmed by the results of insitu hybridization studies. PRND expression did notdiffer significantly in early (median 13%, range 0-51%) and advanced MDS (median 21%, range 2-40%) nor in the IPSS subgroups; moreover, Dpl levelsdid not predict disease progression in MDS. InAML PRND expression was unrelated to the morphologicalsubtype and there was no correlation betweenDpl levels and clinical or laboratory findings such asage, leukocyte count or karyotype. In conclusion, forthe first time the expression of PRND has beendemonstrated in human bone marrow cells. The molecularmechanism responsible for its overexpressionin transformed cells is unknown; however, the differentialexpression of the Dpl protein in AML and MDSversus healthy subjects makes it a possible leukemiaassociated antigen with a potential attractive role astarget for immunotherapy; moreover, Dpl could beused to quantitate minimal residual disease aftertreatment. On the other hand, PRND expression inHL-60 and K562 cells may provide a model to studygene regulation and protein function.PO-034COMBINATION OF ERYTHROPOIETIN AND THALIDOMIDE:NO EVIDENCE OF A SYNERGISTIC EFFECT ON ANEMIA OFPATIENTS WITH MYELODYSPLASTIC SYNDROMESMusto P, Cascavilla N, Falcone A, Sanpaolo G,Bodenizza C, Scalzulli P, Nobile M, Dell'Olio M,Mantuano S, Melillo L, Carella AM, Beltrami G,Greco MM, La Sala AHematology and Stem Cell Transplantation Unit,IRCCS “Casa Sollievo della Sofferenza”, S. GiovanniRotondo, ItalyPrevious studies have indicated that both recombinanterythropoietin (r-EPO) and thalidomide may beeffective in improving anemia of some patients withmyelodysplastic syndromes (MDS). Characteristically,subjects with no or very low need of transfusionsand reduced levels of endogenous EPO have the bestprobability of responding to r-EPO. On the other hand,thalidomide may induce erythroid responses in sometransfusion-dependent patients with high serum EPOlevels. This suggests that the mechanisms of actionof these two drugs are probably different and that,therefore, a synergistic effect could be possible. Herewe report the final results of a pilot clinical trialwhich explored the potential therapeutic effects ofthe combination of r-EPO and thalidomide in heavilyanemic MDS patients. Thirty transfusion-dependentpatients (median Hb level 7.1 g/dl, range 5.3-8.5) with low-to-intermediate-1 risk MDS accordingto IPSS (18 males and 12 females, mean age 62.5years, range 41-81), previously unresponsive to r-EPO(n. 15) or thalidomide (n. 15) employed as singleagents, received r-EPO at the dose of 40.000/U s. c. ,once-weekly, in combination with thalidomide (100mg/d p. o. for one week, to test tolerance, and then200 mg/d) for 8-12 weeks. According to WHO classification,there were 10 refractory cytopenias withtrilineage dysplasia (RCMD), 13 refractory anemias(RA), 4 RA with ring sideroblasts (RARS)and 3 RA withexcess of blasts type I (RAEB-1). Twenty-threepatients did not evidence any erythroid response(IWG criteria) or did not tolerate thalidomide andstopped the treatment. Four patients within thegroup of those previously unresponsive to r-EPOalone achieved a hematological erythroid improvement(HI-E, 3 major, 1 minor) under combined therapy.In order to verify the real synergy of the associationor the simple efficacy of the new drug adjuncted,after 12 weeks these responders continued withthalidomide alone. When r-EPO was withdrawn, all ofthem maintained their response, thus suggesting thatonly thalidomide was effective in these patients.Three of MDS previously unresponsive to thalidomidealone achieved a HI-E (1 major, 2 minor) after theadjunct of r-EPO. Again, when thalidomide was withdrawn,these patients maintained their response, thussuggesting the efficacy of r-EPO, but not that of theassociation, in these subjects. Since none of thesepatients lacked his response when re-allocated to thenew single-drug arm, a further step with r-EPO plusthalidomide, originally planned to confirm the possibilityof a synergistic effect in patients lacking theirresponse after discontinuation of the combined therapy,was not necessary. Our data do not support thehypothesis of a synergistic effect for the associationof r-EPO and thalidomide in MDS. It seems insteadthat two populations of patients can be identified,according to their sensitivity to r-EPO or, alternatively,to thalidomide.PO-035IN PATIENTS WITH MYELODYSPLASTIC SYNDROMES RESPONSETO RHUEPO AND G-CSF TREATMENT IS RELATED TO ANINCREASE OF CYTOGENETICALLY NORMAL CD34 + CELLSRigolin GM, Della Porta M, Ciccone M, Bugli AM,Zenone Bragotti L, Mauro E, Fraulini C, Russo RossiA, Bardi A, Cuneo A, Castoldi GSection of Hematology, Department of BiomedicalSciences, University of Arcispedale S. Anna, Ferrara,Italyhaematologica vol. 89[suppl. n. 6]:september 2004

84PostersIn myelodysplastic syndromes (MDS) the use ofrecombinant human Epo (rHuEpo) has been extensivelyinvestigated with the aim to increase hemoglobinlevels and to reduce transfusion requirement.To this extent, we recently demonstrated thatresponse to rHuEpo might be related to the proliferationof karyotypically normal erythroid precursorspossibly representing residual normal erythroid elements.Some clinical studies have shown that treatmentwith rHuEpo in combination with granulocytecolony-stimulating factor (G-CSF) may synergisticallyimprove the rate of response with many long-lastingresponses. Biological studies have demonstratedthat G-CSF acts by inhibiting spontaneous cytochromec release and mitochondria-dependent apoptosisof MDS hematopoietic progenitors. However, itremains unclear whether, in vivo, the response torHuEpo and G-CSF treatment is also related to theproliferation of residual cytogenetically normalCD34 + progenitor cells which are still present in thebone marrow of MDS patients. In the present work,by FISH analysis, we have therefore investigated, in13 MDS patients with known cytogenetic abnormalities,the in vivo dynamics of response of CD34 + cellsto rHuEpo and G-CSF treatment. We found that, aftertreatment, responding patients presented a significantlylower proportion of FISH abnormal CD34 + cellsthan before treatment (p=0.003) and in comparisonto unresponsive cases (p=0.007). Response to treatmentwas associated with a reduced degree of apoptosisin CD34 + cells (p=0.021): however, no differencein telomere length was observed in respondingpatients after growth factor administration. In conclusion,the present data suggest that, in MDSpatients with known cytogenetic abnormalities,response to rHuEpo and G-CSF may correlate withthe presence and with the proliferation of residualcytogenetically normal but potentially defectiveCD34 + progenitor cells which retain the capability torespond to exogenous growth factors.PO-036DETECTION OF MYELOBLASTIN (MBN) GENE OVEREXPRESSIONIN PATIENTS AFFECTED BY MYELODYSPLASTIC SYNDROMESAND ACUTE MYELOID LEUKEMIAMessa F, Carturan S, Gottardi E, Fava M, Arruga F,Defilippi I, Messa E, Morotti A, Grillo S, Saglio G,Cilloni D*Department of Clinical and Biological Sciences,University of Turin, ItalyMyeloblastin (MBN) gene codes for a serine proteasewith a broad spectrum of proteolytic activity.MBN is probably involved in the control of proliferationof myeloid leukemia cells and it confers factorindependentgrowth to hematopoietic cells whenabnormally expressed. The aim was to study the roleof MBN gene in the setting of acute myeloidleukemias (AML) and Myelodysplastic syndromes(MDS) and to verify whether MBN could represent amarker of leukemic and myelodysplastic hematopoisis.We analyzed the expression levels of MBN in 113BM samples collected at diagnosis from AMLpatients. The FAB distribution was as follows: M0=5,M1=12, M2=38, M3=12, M4=37, M5=5, M6=4.19out of 38 FAB M2 patients were characterized byt(8;21) and 16 out of 37 FAB M4 cases by inv(16).Moreover we analyzed the expression levels in 57 BMand 42 peripheral blood (PB) samples from 88 MDSpatients 44 RA, 32 RAEB and 12 secondary-AML). Ascontrol, we analyzed the MBN expression in 15 BMand 40 PB samples from healthy volunteers. Theexpression level of MBN was established using quantitativeRealTime PCR based on a specific set ofprimers and probe (Assays-on-Demand, gene expressionproducts, Applied Byosystems). The valuesobtained were normalized using ABL as housekeepinggene and the final results were expressed usingthe δ/δ Ct method. The final numerical values areexpressed as 2 -δ/δCt. We found that MBN gene issignificantly overexpressed in BM samples from AMLpatients. The mean value of 2(e)-Delta/DeltaCt inAML cases analyzed was 540, range 1,5-5043.Wefound that MBN is expressed at lower levels in AMLFABM0 and FABM1, (mean value 13 and 35 respectively)it increases in AML FABM2 (mean value of 2 -δ/δCt :1051) and FABM3 (mean value of 2 -δ/δCtt:251) and in AML FABM4 (mean value of 2 -δ/δCt:510) and it decreases again in FABM5 (meanvalue:218) and FABM6 (mean value:49). Interestingly,patients affected by AML FABM2 and FABM4 withthe presence of the t(8,21) and inv(16) showed significantlyhigher values of MBN respect to the sameFAB subtypes with normal karyotypes. The mean valueof 2 -δ/δCt obtained in BM samples from patientswith AML1/ETO-positive FABM2 AML compared toAML1/ETO-negative FABM2 cases was 1522 vs 164(p=0,0001). Similar differences were detected by analyzingFAB M4 cases with and without theCBFβ/MYH11 fusion transcript (mean value of 2 -δ/δCt:961 vs 150) (p= 0,0002). The MBN overexpressionwas detected in 60% of PB samples from RA patients(mean value: 10, range 3-268), and in all the cases ofRAEB (mean value 201: range:128-803) and secondaryAML (mean value 589, range 207-7131).Moreover, in these patients we could demonstrate agood correlation between the percentage of blastcells and MBN transcript amount. These data allow todemonstrate that MBN gene may probably play animportant role in the leukemic transformation. Thequantitative assessment of MBN expression can be auseful marker of leukemic and myelodysplastichaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200485hematopoiesis. Finally, MBN could probably representa good leukemia antigen for an immunotherapeuticapproach.PO-037THALIDOMIDE ALONE OR IN COMBINATION WITH OTHERAGENTS FOR THE TREATMENT OF 248 PATIENTS WITHMYELODYSPLASTIC SYNDROMES (MDS)Candoni A, Raza A,* Lisak L,* Galili N,* Mumtaz M,*Silvestri F, Fanin RDivision of Hematology and Bone Marrow Transplantation,University Hospital, Udine, Italy, *Sectionof Myeloid Diseases and Myelodysplastic SyndromesCenter, Rush University, University of Illinois,Chicago, USAThe last decade has been one of increasing interestand activity devoted to a better definition of thepathologic basis of MDS as well as identification ofnovel therapeutic targets in these diseases. Thalidomidewas chosen for clinical trials in MDS for its threeimportant properties: the anti-TNF, anti-angiogenicand immune-modulatory effects. A total of 248 MDSpatients (pts) have received thalidomide (between100 and 400 mg orally daily) either alone (83 pts) orin combination with other agents (165 pts) at theRush MDS Center. All pts were symptomatic andneeded to be treated. The mean age on thalidomideprotocols was 67±11 years and 160 pts were males.As per FAB groups: RA 89, RARS 41, CMML 13, RAEB86, RAEB-t 19.According to IPSS score: low-risk 40,Int-1 126, Int-2 53, high risk 29.Responses wereassessed using the International Working Group criteria(IWG). Overall, of 248 MDS pts 52 (21%)obtained an hematologic response. A survival analysisshows that the 52 pts who responded have a bettersurvival compared to pts. who did not respond totherapy (p=0.0002, log-rank test). When the ptsreceived thalidomide as a single agent (83 MDS pts., 49 with RA/RARS, 56 low or Int-1 IPSS) we documented21 (18%) responses (with 10 pts acquiringtransfusion independence after a median of 16weeks). There were some bi- and tri-lineage responsesbut the most hematological responses wererestricted to the erythroid series. The majority ofresponders belonged to the refractory anemia (RA)or RA with ringed sideroblasts (RARS) categories. Thesame results were obtained when thalidomide hasbeen combined with ciprofloxacin and dexamethasone(66 MDS pts, 49 with RA/RARS, 53 low or Int-1IPSS, overall responses 17%). In other three studiesthalidomide has been combined with other antineoplasticagents: thalidomide plus arsenic trioxide-ATO(28 MDS pts, 18 with RAEB/RAEB-t), thalidomide plustopotecan (45 MDS pts, 39 with RAEB/RAEB-t) andthalidomide plus etanercept (26 MDS pts, 3 withRAEB/RAEB-t). Overall in these protocols we documented25 (25%) responses both in the RAEB/RAEBtand in the RA/RARS cases; however the duration ofresponse in RAEB and RAEB-t pts was shorter than inthose with RA or RARS. Biological studies showedthat arsenic trioxide and thalidomide combinationproduces multi-lineage hematological responses particularlyin MDS pts with inv(3)(q21q26.2) and highpre-therapy EVI1 expression. These data, taking intoaccount the differences of the population in the variousstudies, show that about 20-25% of MDS pts,with any FAB or IPSS score, can achieve a responseto thalidomide alone or in combination. However onlythe pts with a low IPSS score or a low grade MDS(RARS or RA) are able to maintain this response andcan reach a better survival; instead the pts with RAEBand RAEB-t have shorter response duration and noclear advantage on survival. Recently more potentand effective thalidomide analogs (such as CC5013-Revimid) have been introduced into clinical trials atthe Rush MDS Center with very promising results(higher hematologic/cytogenetic responses and bettertolerance compared to thalidomide) especially inpts with low and Int-1 risk MDS and in those with adel (5q) cytogenetic abnormality.PO-038INCIDENCE, CLINICAL-BIOLOGICAL FEATURES AND PROGNOS-TIC SIGNIFICANCE OF DEL(5Q) IN PATIENTS WITH MYELODYS-PLASTIC SYNDROMESBernasconi P, 1 Boni M, 1 Klersy C, 2 Cavigliano PM, 1Giardini I, 1 Calatroni S, 1 Rocca B, 1 Zappatore R, 1Caresana M, 1 Quarna J, 1 Lazzarino M 11Università degli Studi di Pavia, Divisione di Ematologia,Policlinico San Matteo IRCCS, Pavia, 2 DirezioneScientifica, Unità di Epidemiologia Clinica e Biometria,Policlinico San Matteo IRCCS, Pavia, ItalyAn interstitial deletion of the long arm of chromosome5, del(5q), is the most common deletion inpatients with myelodysplastic syndromes (MDS),being observed in about 10-15% of patients. Thecytogenetic defect is associated with macrocytic anemia,normal or elevated platelet number and peculiarmorphological features, especially hypolobulatedmegakaryocytes. These last are so typical to be highlypredictive of the del(5q) syndrome. From a prognosticpoint of view patients with the del(5q) syndromehave a significantly better clinical outcomethan those with other karyotype abnormalities.Recently, the WHO committee for the classificationof neoplastic diseases has recognized del(5q) syndromeas a separate entity. The aims of the presentstudy were to establish the incidence of the del(5q)haematologica vol. 89[suppl. n. 6]:september 2004

86Postersin our series of 376 consecutive MDS patients, to correlatethe defect with peculiar morphological features,to determine whether the breakpoints of theinterstitial deletion, the presence of one additionaldefect and an increased medullary blast count affectedoverall survival (OS) and event-free survival (EFS).Cytogenetic analyses were carried out at diagnosis onbone marrow cells with a trypsin-Giemsa bandingtechnique. Metaphase cells were obtained fromshort-term unstimulated cultures. Whenever possibleat least twenty metaphases were analysed and tenfully karyotyped. An isolated del(5q) was discoveredin a 32 patients, while a del(5q) plus one additionaldefect in 13.The median age of single del(5q) patientswas 60 years (35-80 years). Male to female ratio was1:1, but it changed to 1:1.7 when only refractory anemia(RA) and refractory anemia with ringed sideroblast(RARS) were examined. Twenty patients wereclassified as RA and RARS, 8 as refractory anemiawith excess of blasts (RAEB), 2 as RAEB in transformationand 2 as chronic myelomonocytic leukemia(CMML). The 20 patients with less advanced MDSshowed erythroid hypoplasia and hypolobulatedmegakaryocytes as their most prominent morphologicfeatures. In particular the former morphologicalfinding was discovered in about 50% of patients.Considering del(5q) plus one additional defect fourpatients were classified as RA, 4 as RAEB, 2 as RAEBtand 2 as CMML. The median survival for patientswith an isolated del(5q) was 138 months, while thatof patients with an increased medullary blast countor with del(5q) plus one additional abnormality was38 and 50 months respectively. When we comparedpatients with an isolated del(5q) versus those withdel(5q) plus one additional defect death rates were7.5 (95% confidence intervals, CI=2.9-19.8) vs 25.6(95% CI=12.2-53.9) with an hazard ratio of 0.2 (95%CI=0.1-0.8) and death/progression rates were 11.5(95% CI=5.1-25.8) vs 33.6 (95%CI=17.5-64.6) withan hazard ratio of 0.3 (95%CI=0.1-0.8). Patients withsingle del(5q) presented a significantly better OS andEFS in comparison to those with del(5q) plus oneadditional defect (p values= 0.01 and 0.02). No differencein OS and in EFS was seen in relation eitherto the different breakpoints of the interstitial deletionor to the amount of dysplasia. Death occurred in 8patients with an isolated del(5q) and in 7 patientswith del(5q) plus one additional defect, whileleukemic evolution occurred in 11 and in 9 patientsof each group respectively. In addition we could notsegregate patients with single del(5q) from thosebelonging to the good-risk cytogenetic category asdefined by the International Prognostic Scoring System(IPSS). In fact OS and EFS for both patient groupswere similar. The same occurred when patients withdel(5q) plus one additional defect were compared tothose belonging to the IPSS intermediate-risk cytogeneticscategory. In conclusion our study strengthensthe WHO definition of del(5q) as a separate entitywithin MDS subgroups but also suggests thatpatients with an otherwise typical 5q-syndrome butwith an increased blast count or with additionaldefects should not be included within this entity.PO-039PAROXYSMAL NOCTURNAL HEMOGLOBINURIA PATIENTSDISPLAY HIGH FREQUENCY OF CIRCULATING T LYMPHOCYTESEXPRESSING ACTIVATING ISOFORMS OF INHIBITORY SUPER-FAMILY RECEPTORSNegrini S, #$ Zocchi MR, & Massaro AM, #& Gargiulo L,*Serra M,* Notaro R,* Luzzatto L,* Poggi A ##Laboratory of Immunology, Istituto Nazionale per laRicerca sul Cancro, Genova; $ Laboratory of ClinicalImmunology, Dipartimento di Medicina Interna,University of Genoa, & Laboratory of Tumor ImmunologyIstituto Scientifico San Raffaele, Milan, Italy;*Laboratory of Human Genetics, Istituto Nazionaleper la Ricerca sul Cancro, Genova, ItalyRecently, it has been reported that a minor subsetof T lymphocytes express at the cell surface KIRand/or CLIR members of the Inhibitory ReceptorSuperfamily (IRS). These T cells would representchronically stimulated memory cells expanded duringviral infection or autoimmune responses. Paroxysmalnocturnal hemoglobinuria (PNH) is a clonal disorderof the hematopoietic stem cell (HSC) characterized bydeficiency of glycosylphosphatidylinositol (GPI) membrane-linkedproteins. It has been proposed that normalHSC are selectively eliminated by autoreactive Tcells, while PNH HSC can escape this killing and thussurvive and expand. The identity of autoreactive Tcells and their target are still elusive. We have analyzedthe surface expression and function of IRSmembers in T cells of PNH patients. We found thatthe proportion of KIR + or CLIR + cells within CD3 + cellswas consistently higher in PNH patients than inhealthy donors. In addition, the ratio betweenCD3 + KIR + and CD3-KIR + or CD3-CLIR + and CD3-CLIR +was >1 in 8 out of 12 PNH patients, whereas thisratio was >1 only in 3 out of 30 healthy donors. Thisindicates that, beside by the increase of CD3 + IRS +cells, PNH patients are characterized by a decrease ofCD3-IRS + Natural Killer cells. A minor fraction ofCD3 + IRS + T cells express TCR γδ (belonging to the Vδ2subset) and the remaining large fraction of these cellswas TCR αβ + . PNH CD3 + IRS + T cells were characterizedby a powerful cytolytic activity when triggeredthrough the engagement of KIR or CLIR receptors.This indicates that CD3 + IRS + T cells express IRSbelonging to the activating type. Clonal analysisrevealed that in the large majority of T cell cloneshaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200487derived from PNH patients the engagement of eitherKIR or CLIR elicited activation of cytolysis, whileCD3 + IRS + T cells from healthy donors expressed IRSof the inhibiting type. The ligation of IRS on CD3 + IRS +T cell clones of PNH patients induced a strong productionof TNF-α and IFN-γ. Finally, GPI- cells wereless sensitive than their GPI+ counterpart to CD3 + IRS +mediated killing. Altogether these findings suggestthat CD3 + T cells expressing the activating isoformsof IRS are increased in PNH patients and thus theymay include auto-reactive effector cells involved inthe pathogenesis of this disease.PO-040LARGE GRANULAR LYMPHOCYTIC-LEUKEMIA, PAROXYSMALNOCTURNAL HEMOGLOBINURIA AND APLASTIC ANEMIA:T-CELL CLONALITY BY TCR ANALYSIS SUPPORTS AN UNIQUEPATHOGENIC MECHANISMRisitano AM,* &§ Maciejewski JP, # Selleri C,*Wlodarski M, # Plasilova M, # Young NS, &# Pane F, §Rotoli B**Division of Hematology, University of Naples “FedericoII”, § Division of Biochemistry and CEINGE, Universityof Naples “Federico II”, Italy. &# ;HematologyBranch, National Heart, Lung and Blood Institute,NIH, Bethesda, MD, # Division of Hematopoiesis andExperimental Hematology, Taussig Cancer Center,Cleveland, OH, USALarge granular lymphocytic (LGL)-leukemia is characterizedby expansion of phenotypically and morphologicallydistinct lymphocytes; paroxysmal nocturnalhemoglobinuria (PNH) is a non-malignantclonal disease of hematopoiesis defective in surfaceexpression of glycosylphosphatydylinositol-anchoredproteins; idiopathic aplastic anemia (AA) is a putativelyimmune-mediated attack of hematopoiesis. Allthese conditions are characterized by marrow failure,involving one or more hematopoietic lineages. Weinvestigated the T-cell compartment by T-cell receptor(TCR) analysis in patients with these diseases,seeking dominant T-cell clones. Flow cytometryanalysis of the TCR; chain was combined with moleculartechniques for precise analysis of the complementaritydetermining region 3 (CDR3), which determinesthe antigen specificity of T-cells. Clonal populationswere finally characterized by sequencing ofthe TCR-CDR3.We analyzed peripheral blood lymphocytesof a total of 108 patients (45 with LGLleukemia,24 with PNH and 39 with AA). Flow cytometryanalysis of the TCR-V; usage demonstrated amassive expansion of CD8 + T-cells harboring a singleTCR-V; subset in most LGL cases; few exceptionsshowed expansion of two V families. In contrast, usuallyPNH and AA patients showed an oligoclonal patternof expansion, most patients having two or threeover-utilized V; subsets. Some PNH cases showedextreme expansion of one TCR-V; subset, resemblingwhat observed in LGL patients. The CDR3 pools fromthe expanded V; subsets were amplified by RT-PCRusing a common constant (C) and the specific Vprimers; CDR3 size analysis (spectratyping) showedpredominant peaks in all CD8 expansions, regardlessthe specific disease. For confirmation of clonality, Vfamilies showing a skewed CDR3-length pattern werecloned in bacteria and single colonies weresequenced. As expected, clonality was found in allLGL cases, with an identical CDR3 sequence generallyobtained from more than 50% of colonies; in afew cases, subdominant clones were also demonstrated,suggesting that more than one clone mayaccount for the LGL expansion. CDR3 pools ofexpanded CD8 V subsets from PNH and AA patientsshowed high level of redundancy, and several CDR3clonotypes were identified. Clonotypes were allpatient-specific, with no preferential usage of particularV or J; furthermore, protein alignment algorithmdid not show any structural homology, likely asresult of the extreme HLA-class I heterogeneity. However,in two AA patients sharing 3 out of 4 class Iantigens, clonotypes were almost identical (98%homology), strongly suggesting a public/semi-publicHLA-restricted immune response. A longitudinalanalysis was possible in some patients: four AA caseswere serially studied after treatment with antithymocyteglobulin-based immunosuppressive regimen.In all cases, great concordance between clonotypeprevalence and blood counts was observed:dominant clones increased with progressive or notresponsivedisease, while decreased after successfulimmunosuppression, eventually rising up in the presenceof clinical relapse. Similar observation was possiblein two LGL patients receiving cytoreductiveagents; in contrast, two PNH patients who did notreceive any treatment showed a progressive increaseof the dominant clone. In conclusion, we documentedthat T cell clonality may be demonstrated in differentmarrow failure syndromes, regardless the primarydisease. Theoretically clonality may result fromthe specific disease (such as a malignant LGL-clone);however we believe that it reflects a common pathogenicimmune mechanism. According with thishypothesis, an antigen-driven immune response mayunderlie LGL, PNH and AA; the nature of the specificantigen(s), the efficiency of the target killing andadditional biological features of the T cell clones mayall influence the relative clinical manifestations ofmarrow failure versus T cell proliferation.haematologica vol. 89[suppl. n. 6]:september 2004

88PostersPO-041FUNCTIONAL ANALYSIS OF T LYMPHOCYTES IN PAROXYSMALNOCTURNAL HAEMOGLOBINURIA PATIENTSAlfinito F,* Terrazzano G, § Becchimanzi C,* Sica M, §Rotoli B,* Zappacosta S, § Ruggiero G §*Chair of Haematology, Department of Clinical andExperimental Medicine, § Chair of Immunology,Department of Cellular and Molecular Biology andPathology, University of Naples " Federico II",Naples, ItalyPNH is an acquired haematological disorder characterisedby a clonal haemopoiesis derived from adefective stem cell. Clonal population exhibits deficiencyof the GPI anchor on the cell membrane as aconsequence of the alteration of an enzyme (locatedon the X chromosome) involved in the synthesis ofthe GPI anchor. PNH patients usually are alsocytopenic because of hypoplastic residual clonalhaemopoiesis. Some data suggest a close relationshipbetween PNH and autoimmune diseases, thereforewe have been investigating the functionalbehavior of T lymphocytes in PNH patients in whichare present two lymphocytic populations: one clonal(GPI defective) and the other normal. Our preliminarydata indicate that in the clonal PNH T lymphocytescompartment is present a decreased responseto TCR-dependent triggering as represented byreduced proliferation, cytokine production and CD154expression. Interestingly,an altered response to activationstimuli of the normal policlonal T lymphocytecompartment has been observed.PO-042FINAL RESULTS OF A PILOT STUDY EVALUATING THE ROLE OFDARBEPOETIN α IN TREATING ANEMIA OF PATIENTS WITHLOW-INTERMEDIATE RISK MYELODYSPLASTIC SYNDROMESMusto P, Balleari E,* Grossi A,** Falcone A, SanpaoloG, Bodenizza C, La Sala A, Ghio R,* Carella AM^Hematology and Stem Cell Transplantation Unit,IRCCS "Casa Sollievo della Sofferenza", S. GiovanniRotondo; *DIMI, Hematology-Oncology Section, Universityof Genoa; **Hematology, "Leonardo da Vinci"Institute, Florence; ^Hematology, S. Martino Hospital,Genoa, ItalyDarbepoetin-α (DPO) is a molecularly modified erythropoietin,characterized by the presence of augmentedsialylated carbohydrated content in its structurewhich permits a prolonged serum half-life anda possible increased in vivo biologic activity. DPO iscurrently licensed in Italy for the treatment of renaland chemotherapy-induced anemia. However, nopublished data are so far available about the role ofDPO as single agent in anemic patients with myelodysplasticsyndromes (MDS). Here we report the conclusiveresults of a pilot study in which we investigatedthe safety and the efficacy of DPO in MDS.Nineteen anemic patients (Hb < 9.5 g/dL, twelvetransfusion-dependent) with low-to-intermediate-1risk MDS according to the International PrognosticScoring System (IPSS) were entered into this study.Thirteen were males and 6 females. Mean age was63.7 years (range 42-84). According to WHO classification,there were four refractory cytopenias withtrilineage dysplasia (RCMD), seven refractory anemias(RA), four RA with ring sideroblasts (RARS), oneof which with multilineage dysplasia (RCMD-RS),three RA with excess of blasts type I (RAEB-1) andone 5q- syndrome. Two patients had a moderatedegree of renal failure and two were MDS secondaryto chemotherapy for solid tumors. Five patients hadpreviously received r-EPO without significantimprovement of Hb levels or transfusional needings.All patients received DPO (Nespo, Dompe'-Biotec, or,alternatively, Aranesp, Amgen, Milan, Italy) at thedose of 150 mcg s. c. once-a-week (q. w), for at least12 weeks, without additional therapies. Such a dosecorresponded approximately to a mean of 30.000 Uper week of recombinant α or β r-EPO, consideringthe median weight of our patients (64.8 kg, range54-85). The drug was kindly provided free of anycharge by both producing Companies, on a compassionatebasis therapeutic program. Local Ethic Committeeapproved the study and patients gave writteninformed consent. All patients completed 12 weeks oftherapy at least. Fourteen patients, including all subjectswho had previously received r-EPO, did not showany improvement in Hb levels or transfusional supportand interrupted the study. Five patients (3 RA, 1RARS and the patient with 5q- sindrome) respondedto DPO (overall response 26.3%; C. I. 95%: 21%-38%;three major and two minor erythroid hematologicalimprovements, according to IWG criteria). Three outof responders maintain stable hemoglobin levels >9.5 g/dl after 11, 12, and 20 months of treatment,respectively. In two of them DPO is currently givenevery two weeks. One patient had a drop in his Hblevels after eight weeks of DPO therapy, due to thedevelopment of iron deficiency and required substitutivetherapy to achieve a new response. One patientlost the response after 16 weeks. The fifth responderdied after 5 months, due to causes unrelated to DPOtreatment. No relevant adverse events or significantside effects were recorded throughout the study period.In particular, no case of pure red cell aplasia(PRCA), thrombosis, leukemic evolution or uncontrolledhypertension was observed. All responders hadbaseline serum levels of endogenous EPO < 200miu/ml, (four < 100 miu/mL), no or very low red-celltransfusion requirement, no excess of blast in bonehaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200489marrow, a diagnosis of MDS performed no more than4 months before treatment with DPO, a single lineage(erythroid) involvement. Our results suggest that DPOis safely given and may be effective in a proportionof MDS. Percentage and possible predictive factors ofresponse appear to be similar to those obtained withr-EPO in these patients.PosterMOLECULAR HEMATOLOGY IPO-043GENE EXPRESSION PROFILE OF CHRONIC MYELOID LEUKEMIASTEM CELLSSalati S, Zini R, Bianchi E, Siena M, Tenedini E,Tagliafico E, Fogli M, § Rossi L, § Amabile M, §Testoni N, § Martinelli G, § Lemoli RM, §Baccarani M, § Ferrari S, Manfredini RDip. di Scienze Biomediche, Sez. di Chimica Biologica,Università di Modena e Reggio Emilia; § Istituto diEmatologia e Oncologia Medica “L. & A. Seragnoli,Università di Bologna, ItalyTo obtain comprehensive information about thegenes involved in BCR/ABL-dependent leukemogenesiswe studied the gene expression profile of lin-CD34 − , lin-CD34 + , and lin + CD34 + hematopoietic stemcells (HSC) from 8 chronic myeloid leukemia (CML)patients and 6 normal donors using Affymetrix HG-U95Av2 GeneChip array. Molecular caryotyping andquantitative analysis of BCR/ABL transcript demonstratedthat within lin-CD34- the% of leukemic cellsare 32%, whereas leukemic cells represent 60% ofthe total lin-CD34 + cells. Hierarchical clusteringanalysis paired normal lin-CD34- to CML lin-CD34-cells, CML lin-CD34 + to CML lin + CD34 + cells and normallin-CD34 + to normal lin + CD34 + cells. Comparisonanalysis performed with Affymetrix MAS 5.0 softwarerevealed 370 genes differentially expressed in allCML HSC subpopulations when compared to normalcounterparts. The up-regulated genes in CML sampleswere found belonging to the cell cycle, mitosis, DNAreplication and DNA repair Gene Ontology (GO) categories,whereas immune response, defense response,antigen presentation and antigen processing GO categoriesare up-regulated in normal samples. BCR/ABLmodulates expression of genes which are involved incell cycle regulation, DNA repair, apoptosis, like bcl2family members and malignant progression, likeangiogenic cytokines. Moreover, in CML samples wefound down-modulation of genes involved in antigenprocessing and presentation, so the ability of CMLHSC to function as Antigen Presenting Cells (APC)may be compromised. This study expands the knowledgeon the genetic programs of CML and may representa source of potential targets for CML therapeutics.haematologica vol. 89[suppl. n. 6]:september 2004

90PostersPO-044FISHING NUP98 INVOLVEMENT IN HEMATOLOGICALMALIGNANCIES WITH 11P15 KARYOTYPIC CHANGESLa Starza R,* Crescenzi B,* Rosati R,* Gorello P,*Schoch C, # Romoli S,* Testoni N,° Santoro A, +Martelli MF,* Mecucci C**Ematologia, Policlinico Monteluce, Università degliStudi di Perugia, Perugia, Italy, # Labor fur Leukaemie-diagnostik,Medizinische Klinik III, Munchen,Germany, ° Ematologia, Istituto Seragnoli, Universitadi Bologna, Italy + Ematologia, Università di Palermo,Palermo, ItalyNUP98 gene is one of the so-called promiscuousgenes as at least 15 partners of translocations areknown. It is involved in both de novo and secondaryhematological malignancies such as acute myeloid(AML) and lymphoid leukemias (ALL), Ph-positivechronic myeloid leukemia (CML), T-cell non-Hodgkin’slymphomas. In order to pick up NUP98 rearrangements,we set up a FISH approach with DNA clonesselected for NUP98 and in some cases for the putativepartner genes. We collected twelve cases with aNUP98 translocation and the following diagnosis: 2T-ALL with t(4;11)(q12;p15); one refractory anemiawith excess of blasts and a cryptic ins(5;11) (q35;p15p14); three AML-M2 and one Ph + CML witht(7;11)(p15;p15); one AML with t(8;11) (p11.2,p15);one secondary AML-M2 with t(10;11) (q22;p15); twoAML-M2 with t(11;12) (p15;q13); and one AML-M4with inv(11)(p15q22). NUP98 was investigated byFISH with clone RP5-1173K1 spanning exons 10 to 20of the gene. Additional experiments were performedwith clones selected for the following partner chromosome/genes:5q35/NSD1 (CTC-549A4), 7p15/HOXA (RP1-170K19, 170O19, 18M17, 113H19,167F23), 8p11.2/NSD3 (RP11-350N15), 12q13/HOXC(RP11-877M13, 578A18, 219N9). The RP5-1173K1clone detected NUP98 rearrangements in all casesresulting in three hybridization signals on normal 11,on der(11), and on the partner chromosome. Thisapproach allowed us to identify a crypticNUP98/NSD1 fusion resulting from an insertion ofthe 5NUP98 within the 5q35/NSD1 locus. Clonesselected to study known partner chromosomes/geneswere validated: insertion of 5;NUP98 into NSD1 wasdemonstrated with double colour experiment usingRP5-1173K1 and CTC-549A4; 3/4 patients witht(7;11) showed the same breakpoint at 7p15 withinclone RP1-170O19; the t(8;11) can be easily detect bycombining RP5-1173K1 and RP11-350N15 in doublecolour since two fusion signals are present on bothder(8) and der(11). In one case of t(11;12) the12q13/HOXC breakpoint was narrowed within RP11-877M13.FISH is a useful tool to perform wide screeningof NUP98 involvement. We validated a number ofclones to study specific NUP98 translocations. Thesetools will be helpful to unravel the incidence and theclinical impact of NUP98 rearrangements.Funding: This work was partially supported by CNR-MIUR, and FIRB.PO-045TELOMERASE ACTIVITY IN ACUTE PROMYELOCYTIC LEUKEMIA(AML-M3): A STUDY ON 35 PATIENTSCalatroni S, 1 Bernasconi P, 1 Klersy C, 2 Rocca B, 1Boni M, 1 Cavigliano PM, 1 Giardini I, 1 , Zappatore R, 1Caresana M, 1 Quarna J, 1 Lazzarino M 11Università degli Studi di Pavia, Divisione di Ematologia,Policlinico San Matteo IRCCS; 2 DirezioneScientifica, Unità di Epidemiologia Clinica e Biometria,IRCCS Policlinico San Matteo, Pavia, ItalyTelomerase is formed by two subunits TERC, theRNA template needed for telomere synthesis, andhTERT, the rate-limiting catalytic protein subunit.Telomerase plays a crucial role in preserving thelength of telomeres, nucleoprotein structures positionedat the end of eukaryotic chromosomes. Physiologicalerosion of telomeres occurs after subsequentrounds of cell division and prevents tumour formationby limiting cell life span. However, when some tumorsuppressor genes (namely TP53 or RB-1) are targetedby mutations, the cell enters a period of geneticinstability and may acquire additional geneticdefects. Some of these cells die by apoptosis, whileothers survive due to constitutive activation oftelomerase. Therefore, it is not surprising that hTERTactivity has been found amplified in many haematologicaldisorders. The aims of the present study wereto evaluate whether hTERT activity was correlatedwith peculiar clinical parameters, with the presenceof FLT3 internal tandem duplication (ITD) and withrelapse in 35 LAM-M3 patients. The thirty-fivepatients entered in the present study were analysedat the onset of the disease and during the follow-up.hTERT relative quantification was obtained througha real-time polymerase chain reaction whichemployed SybrGreen I, a DNA-binding fluorescentdye. Serial dilution of total RNA from the K562 cellline were used to set the standard curve for real-timequantification. hTERT expression was normalized toABL and calibrated on K562.In order to make statisticalanalysis hTERT values were dichotomised so thatpatients could be subdivided in those with high andlow hTERT activity. Comparisons of hTERT values duringthe follow-up were made by using a regressionmodel for repeated measurements and correlationswith clinical parameters and relapse were obtained byapplying the Spearman test and Cox regression. Eighteenpatients were males and seventeen females;haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200491their median age was 42 years (range 8-71). All thepatients except five, who died during the inductionchemotherapy, achieved a complete remission (CR)after a median time of 42 days (range 32-68). Themedian follow-up time is now 29 months (range 0-92). Twenty-three patients are in CR after a medianfollow-up time of 29 months (range 3-92), while sevenhave relapsed after a median follow-up time of 20months (range 9-42). A second CR was achieved in allthese last patients except in one who presented highhTERT transcript levels along with FLT3 ITD. Thispatient died just before performing an allogeneicbone marrow transplantation (Allo-BMT). Two otherpatients in second CR underwent an allo-BMT. One ofthem with high hTERT transcript levels and FLT3 ITDexperienced a third relapse but succeeded in reachinga new CR after additional intensive chemotherapy.The other patient with low levels of hTERT transcriptlevel and without FLT3 ITD is in an un-maintainedCR 24 months from the transplant. A highwhite blood cell (WBC) count either at clinical diagnosisor at relapse was the only clinical parameterwhich was significantly correlated with high hTERTtranscript levels (p=0.037). Mean hTERT transcriptlevel were 6.4 (range:0.7-9.9) for patients with highWBC and 4.9 (range: 0.3-14.7) for those with normalWBC at the onset of the disease. High hTERT valueswere observed in five out of the six FLT3 ITD positivepatients. Considering all the patients hTERT levelspresented ups and downs during the follow-up. Weevaluated whether hTERT values determined eitherat clinical diagnosis or at one hundred-eighty daysfrom it could predict relapse. We found that relapserate was 4.7% (95% confidence intervals, CI=0.6-33.0) for patients who at the onset of the diseasehad low hTERT transcript levels versus 15.9% (95%CI=6.2-42) for patients who had high levels. Theselast patients showed a hazard risk of relapse of 4.3%(95% CI=0.48-39) (p=0.14). These same significantcorrelations were found for hTERT values determinedat one hundred-eighty days from the onset of thedisease. At this time relapse rate was 6.8% (95% CI:0.9-48) for patients with low hTERT values versus21.7% (95% CI: 7.0-67) for those with high levels.These last patients showed a hazard risk of relapse of3.5% (95% CI: 0.37-34) (p=0.23). In conclusion i)highhTERT values are significantly correlated with highWBC count; ii) are more often seen in patients withFLT3 ITD; iii) are predictive of relapse independentlyof whether they are determined at diagnosis or atone hundred-eighty days from it.PO-046EPIGENETIC EVENTS INVOLVED IN THE TRANSCRIPTIONALSILENCING OF RA-TARGET GENES IN ACUTE MYELOIDLEUKEMIAFazi F,* # Gelmetti V,* # Pascale S,* # Travaglini L,* #Diverio D,° Lo Coco F, § Pelicci PG, ? Nervi C* #*Dipartimento di Istologia ed Embriologia Medica,°Biotecnologie Cellulari ed Ematologia, Università“La Sapienza” e § Biopatologia Università “Tor Vergata”,Rome; # Parco Scientifico Biomedico di Rome SanRaffaele, Rome; ? Istituto Europeo di Oncologia,Milan, ItalyAberrant recruitment of HDAC activities favoringhypermethylation of target promoters underlies thepathogenetic action of AML-associated fusion proteinAML1/ETO. Recent studies indicate that HDACare present in complexes containing DNA-methyltransferase(DNMT's) and methyl-CpG bindingdomain proteins (MBDs) to remodel chromatin andlink deacetylation-mediated gene silencing to DNAmethylation. Our previous observation indicated thata transcriptional repression of RA-signaling pathwayunderlies the pathogenesis of non APL AML-M2 andAML-M4.Using Southern blot analysis of genomicDNA and by methylation- specific PCR (MSP) wefound that the RARβ2 promoter region containingthe β-RARE and transcription start site is methylatedin 7/9 AML-M2, 9/10 AML-M4 and in 6/8AML1/ETO positive samples. The region located in the5'portion of the exon 1 of RARβ2 is methylated in 9/9AML-M2, 8/10 AML-M4 and 8/8 AML1/ETO positivesamples. Neither of these RARβ2 regions is foundmethylated in CD34 + normal hemopoietic precursors.RARβ expression is detectable in normal CD34 + cellsbut not in any of the 24 AML cases analyzed. Weanalyzed whether the expression of AML1-ETO intohematopoietic progenitors induces repression of RAsignalingpathway by affecting the methylation statusat RA-target genes. By using AML patients blastsand cell lines carrying an endogenous AML1/ETO(Kasumi and SKNO) or stably transfected with an HAtagged AML1/ETO (U937-AE) as cell model systemour preliminary results indicates that: i) AML1/ETO ispresent on AML1 (p14arf) and RA (RAR?2) targetgene promoters complexed with DNMT and MBDactivities as shown by chromatin immunoprecipitation(ChIP) assay; ii) in the absence or in the presenceof RA, the expression of AML1-ETO down-regulatesin a dose-dependent manner the transactivation of atransiently transfected 5Kb RARβ promoter; iii) theexpression of AML1-ETO induces hypermethylationof the promoter/exon1 region of RARβ2 gene; iv)both histone deacetylase and DNA methyltransferaseinhibitors relieve the transcriptional repression of RAtarget genes and restore the differentiation responsehaematologica vol. 89[suppl. n. 6]:september 2004

92Postersof AML blasts to RA. In summary this preliminaryresults suggest that an aberrant hypermethylation atRA target gene is present in non APL AML blasts. Inaddition, the expression of AML1/ETO affects themethylation status of RA-target genes thus extendingthe rationale for a transcriptional therapeuticalapproach in AMLs.PO-047MEK1 INHIBITION AND ARSENIC TRIOXIDE COMBINEDTREATMENT INDUCES APOPTOSIS OF LEUKEMIC CELLS BYMODULATION OF P73 PROTEINSLunghi P,* Costanzo A,** Levrero M,°^ Bonati A**Dipartimento di Scienze Cliniche, Università di Parma;**Dipartimento di Dermatologia, Università diRome "Tor Vergata"; °Laboratory of gene expression,Fondazione Andrea Cisalpino, Università di Rome "LaSapienza"; ^Dipartimento di Medicina Interna, Universitàdi Cagliari, ItalyWhereas the role of p53 in stress responses is wellestablished, recent advances strongly support a pivotalrole for the p53 paralog p73 in the execution ofdrug-induced cell death and chemosensitivity of cancercells in both p53 wild type and p53 null tumors.p73 is sufficient to trigger cell death independentlyof the status of p53 and, conversely, p53 requires p73to induce apoptosis. We recently demonstrated thatdownmodulation of ERK activity inhibits the proliferationand induces the apoptosis of primary acutemyelogenous leukemia (AML) blasts. Furthermore, weshowed that combination of MEK/ERK pathwayinhibitors with arsenic trioxide (ATO) enhances ATOinduced apoptosis not only in primary acute promyelocyticleukemia (APL) blasts but also in primaryblasts of other AML subtypes. To better understandingthe mechanisms of this successful combination,we studied the behaviour of p73-p53AIP1 pathway inNB4 (promyelocytic) and K562 (Ph + ) leukemic celllines, both of them carrying an inactive p53.Leukemiccell lines were pre-treated with PD98059 (Cell SignalingTechnology, Beverly, MA) or PD184352 (kindlyprovided to us by Dr J. S. Sebolt-Leopold, CancerMolecular Sciences, Pfizer Global Research & Development,Ann Arbor, MI, USA), and then treated withATO 1 microM (NB4) or 2 µM (K562). We observedthat the combined treatment significantly increasedthe amount of apoptotic cells, as compared to ATOalone, in both cell lines. Molecular analysis indicatedthat the treatment with PD98059 or PD184352promoted the accumulation of endogenous TAp73alfa (transactivation competent, pro-apoptotic andanti-proliferative isoform) and the reduction ofδNp73 (dominant negative, antiapoptotic and proproliferativeisoform); TAp73α transcriptional activationand its tyrosine phosphorylation, resulted inp21 up-regulation, and significant cell growth inhibition.ATO reduced DeltaNp73 levels and increasedp300 acetyltranferase-mediated acetylation ofendogenous TAp73; TAp73 acetylation correlated wellwith its recruitment to the apoptotic target genesBax and p53AIP1.The combined treatment with MEK1inhibitors and ATO enhanced the affinity of phosphoacetylatedp73 for the p53AIP1 promoter in vivo, asdetermined by chromatin immunoprecipitationexperiments, leading to p53AIP1 up-regulation andfurther increase of apoptosis. Finally, the percentageof sub-G1 apoptotic NB4 and K562 cells after 72hours of treatment with MEK1 inhibitor PD184352 (1µM) and ATO was significantly diminished in cellstransfected with TAp73 siRNA relative to cells transfectedwith control siRNA. These findings indicatethat p73 is a major determinant of PD+ATO efficacyin leukemia cells carrying an inactive p53, and suggestthat modulation of p73 proteins expressionand/or function might represent in the future a newmolecular target for leukemia treatment.PO-048SNP MINING BY NANOGEN DEVICE: A SENSITIVE TOOL FOR THEIDENTIFICATION OF BCR/ABL MUTATIONS IN PH + PATIENTSCorradi B,° Piazza R,* Monn K,^ Masera G,°Gambacorti Passerini C,* Biondi A,° Cazzaniga G°°Centro Ricerca Tettamanti, Monza, Italy; *DipartimentoOncologia Sperimentale Istituto NazionaleTumori, Milano, Italy; ^Nanogen Europe, Stuttgart,GermanyBackground: it was recently shown that resistanceto Gleevec (STI571) in patients with CML or Ph + ALL,is associated with different single amino acid substitutionsin distinct positions, known to be importantfor STI571 binding within the ABL kinase domain. Thepresence of mutations pre- and post-Gleevec treatmentis currently included in the laboratory followupof CML and Ph+ALL patients receiving that drug.However most of the current available methods areeither not enough sensitive or time-consuming. Aim:to test the feasibility to use the SNP mining byNanogen device for the rapid identification ofBCR/ABL mutations. Methods: Nanogen (San Diego,CA, USA) developed a method for the de novo discoveryof genetic variations, including singlenucleotide polymorphisms (SNPs) and mutations, onmicroelectronic chip devices. The method combinesthe features of electronically controlled DNAhybridization on open-format microarrays, withmutation detection by a fluorescence-labeled mismatch-bindingprotein. Electronic addressing of DNAstrands to distinct test sites of the chip allows par-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200493allel analysis of several individuals. Viceversa, severalSNPs/mutations can be tested in few individuals.This microelectronic chip-based mutation discoveryassay may substitute time-consuming sequencingstudies and will complement existing technologies ingenomic research. Results: in a preliminary series ofexperiments, we demonstrated that a point mutationin ABL could be identified in a 10 copies dilution ofa plasmid carrying the mutation, and in a 10 4 BMsample dilution of a single patient resistant toGleevec. The analysis of a larger patient series by parallelcloning/sequencing and SNP mining is still inprogress. Conclusion: for the sensitivity and the shorttime required for the analyses of different patientssamples, or multiple time points during follow-up,the Nanogen device represents an alternative toDHPLC or cloning, for the rapid identification ofBCR/ABL mutations and monitoring of BCR/ABLmutations during Gleevec treatment.PO-049FUNCTIONAL ANALYSIS OF THE PAX5/TEL CHIMERIC PROTEINFazio G,° Palmi C,° Bonamino M,° Cassetti A,* VillaA,* Biondi A,° Cazzaniga G°°Centro Ricerca Tettamanti, Monza, Italy; *ConsorzioMIA Dipartimento di Neuroscienze, Università degliStudi di Milano-Bicocca, Milan, ItalyBackground: we previously cloned the PAX5/TELchimeric gene, originated from the translocationt(9;12)(q11;p13) in an ALL adult patient. Recent dataindicate that PAX5/TEL fusion defines the cytogeneticentity dic(9;12)(p13;p13). PAX5/TEL is likely to bean aberrant transcription factor, resulting from joiningthe 5' region of the partner gene PAX5 (a transcriptionfactor essential for B cell development) tothe 3' region of TEL/ETV6 (Ets-family DNA bindingdomain). Aim of the study was to investigate thefunctions of the PAX5/TEL chimeric protein as apotential oncoprotein. Methods: we have cloned theFLAG-full length chimeric PAX5/TEL cDNA in theretroviral vector pMSCV-IRES-GFP (MigR1). NIH3T3murine fibroblast and IL-3 dependent murine proBBa/F3 cells lines were transduced with the retroviralconstruct to analyze subcellular localization andtransforming activity of PAX5/TEL. Results: immunofluorescenceanalysis showed a specific nuclear localizationof the chimeric protein in NIH3T3.Soft-agarcolony forming assay of NIH3T3 infected withMigR1-PAX5/TEL did not show a significant transformingactivity of the chimeric protein. IL-3 dependentmurine proB Ba/F3 cells infected with MigR1-PAX5/TEL showed modulation of cellular growth rate;single subclones expressing the chimeric proteinshowed a decreased growth respect to control subclones.In addition, the expression of PAX5/TEL inBa/F3 did not induce IL-3 growth independence. Insummary, preliminary results did not show oncogenicactivity of the PAX5/TEL fusion. Further analysis areneeded to evaluate the functional role of the chimericPAX5/TEL protein in Ba/F3 and other hematopoieticcell lines.PO-050EPIGENETIC MODIFICATIONS IN A T(8;21) ACUTE MYELOIDLEUKEMIA CELL LINE CAUSED BY ADMINISTRATION OF THEHDAC INHIBITOR D1Barbetti V, Rovida E, Gozzini A,° Giuntoli S, SantiniV,° Dello Sbarba PDipartimento di Patologia e Oncologia Sperimentali,Università di Firenze e °Divisione di Ematologia,Policlinico di Careggi, Università di Firenze, ItalyThe acute myeloid leukemia (AML) cell line Kasumi-1is characterized by the translocation t(8;21),manifested with the expression of AML1/ETO fusionprotein, responsible for HDAC recruitment, determiningtranscriptional repression of target genesinvolved in myeloid maturation. We recently demonstratedthat sodium butyrate and the stable prodrugxylitol butyrate derivative (D1) are able as singleagents to restore histone acetylation and granulocyticmaturation in Kasumi-1 cell line, as well as inprimary AML blasts. D1 differentiative effects wereconfirmed by increased membrane expression ofCD11b and CD15, decrease of CD34 and reduction ofblasts absolute number. These effects were paralleledby massive induction of apoptosis as well as reductionof cell number. Acetylation and methylation ofspecific lysine residues on histone H4 and H3 hasbeen associated with transcriptional regulation. Theacetylation pattern of lysine residues of histone H4was investigated. K5 and K16 residues were notacetylated in the absence of D1 and their acetylationstrongly increased after 6 h D1 administration. K8and K12 residues showed a basal acetylation whichwas further increased although not markedly. Lysinemethylation of histone H3 was evaluated. D1 determineda reduction of di-methylated K9 H3, related togene silencing. Di-methylated K4 H3, related to bothgene silencing and transcriptional activation, wasunmodified after D1 administration. These histonemodifications paralleled D1-induced transcriptionalactivation of AML1/ETO target genes. The cyclindependentkinase inhibitors (CDKi) belonging to theCip/Kip family are known to be involved in cell cycleas well as apoptosis and cancer. D1 determined anincrease of p21/cip1 expression and a decrease ofp27/kip1.Appearance of a conspicuous amount ofp57/kip2, an as yet uncharacterised oncosuppressor,haematologica vol. 89[suppl. n. 6]:september 2004

94Postersafter 72-96 h treatment with D1 was observed. Thematuration effects of D1 were further investigated atmolecular level. D1 was found to modulate theexpression of transcription factors important for terminalcell differentiation. In particular, C/EBPepsilon,PU. 1, c-jun, AML1/ETO as well as C/EBPα expressionwas modified after exposure to D1.These results suggestthat HDAC inhibition determines profound generemodelling trough specific epigenetic modifications.PO-051QUANTITATIVE DEVELOPMENT OF COMPETITIVE REVERSETRANSCRIPTASE PCR (QC-RT-PCR) FOR DETECTION OF MINI-MAL RESIDUAL DISEASE (MRD) AND MONITORING ANTI-LEUKEMIC THERAPY RESPONSE IN POSITIVE PHILADELPHIACHROMOSOME LEUKEMIASiddiqui RT, Qureshi JA, Iqbal ZResearch Lab. , National Institute For Biotechnology& Genetic Engineering (nibge), Jhang Road, Faisalabad,PakistanChronic myelod leukemia (CML) and acute lymphoidleukemia (ALL) to are the most common Philahelphiachromosome positive leukemia in adults andchildren, respectively. More Philadelphia chromosomepositive CML and ALL have treatment options thanothers like Hydroxyurea, Interferon and Gleevec.However, monitoring of therapy is very necessary toknow the response of the patients to anti-leukemictherapy. Introduction of molecular biology techniqueslike PCR etc. revolutionized the research related tobiomedical sciences. As single BCR-ABL fusion transcriptacts as oncogene in Philadelphia chromosomepositive CML & ALL, it can be detected by Reversetranscriptase (RT) PCR. Two types of BCR-ABLtranslocations to are possible i. e. b3a2 and b2a2,which can detected by 71 RT-PCR two to their sizedifference of base pairs. Both transcripts to were PCRamplified and cloned. They to were used as internalcompetitors to develop to Quantitative Competitive(QC) RT PCR. Positive This newly developed PCR assayis very specific to count the number of cancerouscells for microlitre Philadelphia ChromosomeLeukemia patients. Before Blood samples collectedfrom patients, during and after anti-leukemic therapycan be analysed by this QC RT PCR method todetermine the response of the patients. Intimate Ifpatients to are resistance to one therapy, alternativestherapy can be advised well. Thus this method willhelp in more efficient clinical management ofPhiladelphia Chromosome positive CML & ALL cases.PO-052E-CADHERIN PROMOTER IS HETEROGENEOUSLY HYPERMETHY-LATED IN BC-CML CELLSPastorelli R, Gozzini A, Bosi A, Tombaccini D,Santini VDiv. of Hematology, Dept Critical Area Medicine andDept. of Experimental Pathology and Oncology, Universityof Florence, ItalyClassical cadherin adhesion molecules are fundamentaldeterminants of cell-cell recognition thatfunction in cooperation with the actin cytoskeleton.They form a superfamily of molecules mediating calciumdependent cell-cell adhesion (N-cadherin, T-cadherin or CDH13, E-cadherin). E-cadherin servesas a widely acting suppressor of invasion and growthof epithelial cancers, and its functional eliminationrepresents a key step in the acquisition of the invasivephenotype for many tumors. Moreover E-cadherincan negatively regulate, in an adhesion-dependentmanner, the activation of divergent classes ofreceptor tyrosine kinases (RTKs). Hypermethylation isa frequent mechanism for silencing tumor suppressorgenes. This is a potentially reversible epigeneticchange, and it is the target of a novel class of anticancercompounds with demethylating activity.Chronic myeloid leukemia (CML) cells show a deficientβ1 integrin-mediated adhesion to stroma andare unresponsive to integrin mediated inhibition ofproliferation. Defective adhesion properties coulddirectly be due to bcr/abl protein effects on actincytoskeleton and to its tyrosine kinase activity, butcould also be determined by lack of expression ofcadherins due to promoter hypermethylation, a phenomenonobserved in CML for abl, calcitonin 1 geneand bcr sequences. Bi-allelic hypermethylation of theE-cadherin gene CpG island is common in acuteleukemia, but its role in CML progression has not jetbeen elucidated. The methylation status of E-cadheringene and its protein expression were evaluated.We investigated whether hypermethylation in theCDH1 promoter region was present in chronic phaseand blast crisis (BC) CML primary cells and whetherit could be modified by in vivo imatinib treatment. Wealso analyzed the effect of hypomethylating agentson the re-expression of E-cadherin. Cells wereobtained after informed consent from patients withCML at diagnosis and after imatinib treatment andfrom patients with myeloid CML-CB. The analysis wasperformed by methylation specific PCR (MSP). MSPdiscriminates unmethylated alleles on the basis ofDNA sequence alterations after bisulfite treatmentof DNA, which converts only unmethylated cytosinesto uracils. Sodium bisulphite genomic sequencingwas used to fully characterize the methylation patternsof the CpG island associated with the E-cad-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200495herin gene promoter. Hypermethylation of CDH1 promoterwas present in 60% of BC-CML, but only in10% of CML chronic phase. Cells obtained after imatinibtreatment did not show a modified pattern ofmethylation. Genomic bisulfite sequencing of CMLcells confirmed dense methylation across the CpGisland. Downstream signalling mechanisms, includingthe activation of STAT3 and Akt were examined byWestern blot, together with E-cadherin protein surfaceexpression indicating lack of activation of signallingmolecules and defective expression of theprotein in the methylated samples.PO-053P210 BCR-ABL TYROSINE KINASE INHIBITS APOPTOTIC CELLDEATH THROUGH MULTIPLE PATHWAYS PREVENTING EARLYMITOCHONDRIAL ACTIVATIONCalabrò A,* Mancini M,* Brusa G,* Farinelli G,*Barbieri E,° Cammelli S,° Santucci MA**Istituto di Ematologia e Oncologia Medica "Lorenzoe Ariosto Seràgnoli" e °Istituto di Radioterapia"Luigi Galvani", Università di Bologna, ItalyThe resistance to apoptotic death has a key role inthe illegitimate enlargement of chronic myeloidleukemia (CML) hematopoiesis over its normal counterpartand in the genetic instability that drives clonalevolution of bcr-abl-rearranged myeloid progenitorstowards the fully transformed phenotype of blastcrisis. It results from multiple events preventing proapoptoticpathways (Trail-DR4, Fas-ligand and Baxinduction, Bax and Bad translocation to the membranesof subcellular organelles such as mitochondriaor endoplasmic reticulum, cytochrome-c release andcaspase-3 activation) and/or enhancing pro-survivalsignals such as Bcl-2, Bcl-xL and survivin, and ismostly conditional upon the tyrosine kinase of p210bcr-abl fusion protein. Our study addressed the matterof p210 bcr-abl tyrosine kinase effects on expressionlevels and subcellular locations of proteins thattrigger apoptotic death in response to extrinsic orintrinsic signals by antagonizing anti-apoptotic Bcl-2 and Bcl-xL at the mitochondrial membranes. To thepurpose, in individual cell clones generated from themurine myeloid 32D cell line transduced with a temperature-sensitive(ts) p210 bcr-abl construct (lackingthe abl constitutive tyrosine kinase activity at thenon-permissive temperature of 39°C) we investigatedtranscriptional induction and post-transcriptionalmodifications of pro-apoptotic signals in responseto growth factor withdrawal, starvation, TNF-α andtyrosine kinase inhibitor STI571.Trail-DR4, Fas, Baxand Bim transcriptional induction, initiator caspase 8,9 and 12 activation, Bad dephosphorylation, Bidcleavage and Bax and Bak aggregation at the mitochondrialmembranes preceding citochrome-c releaseand executioner caspase activation are prevented byp210 bcr-abl tyrosine kinase through interactionswith multiple trascription factors including Stat5,PI3K/Akt, Foxo3A and c-Myc. Our results may behelpful to design novel therapeutic strategies intendedfor targeting gene products relevant for CML progressionin addition to p210 bcr-abl tyrosine kinase.Funding: The study was supported by Università diBologna (ex 60% and Progetti Pluriennali), CarisboFoundation, Forlì-CesenaAIL and CIB. GB is the recipientof a grant entitled to Mrs. Lalla Seràgnoli.haematologica vol. 89[suppl. n. 6]:september 2004

96PostersPosterMOLECULAR HEMATOLOGY IIPO-054MAPKS ARE INVOLVED IN THE SURVIVAL AND DIFFERENTIATIONOF A T(8;21) ACUTE MYELOID LEUKEMIA CELL LINE AND AREMODULATED BY THE HDAC INHIBITOR D1Rovida E, Gozzini A,° Barbetti V, Giuntoli S,Santini V,° Dello Sbarba PDipartimento di Patologia e Oncologia Sperimentali,Università di Firenze e °Divisione di Ematologia,Policlinico di Careggi, Università di Firenze, ItalyAcute myeloid leukemia (AML) is a disease characterizedby a block of maturation. Genes coding forcore binding factors are rearranged in a considerablesubset of AML cases and result in the altered interactionof CBF subunits with transcriptional co-regulators(NCoR/SMRT). Recruitment of HDAC is alsoaltered in this subtype of AML, and a subsequenttranscriptional repression of target genes involved inmyeloid maturation is determined. We recentlydemonstrated that sodium butyrate and the stableprodrug xylitol butyrate derivative (D1) as singledrugs restore histone acetylation and granulocyticmaturation in the t(8;21)-positive Kasumi-1 cell line,as well as primary CBF-AML blasts. These effects areparalleled by massive apoptosis as well as reductionof cell number. The mitogen-activated protein kinases(MAPK) have been shown to regulate a wide varietyof cellular processes, such as cell proliferation,differentiation and apoptosis. D1 induced ERK activation(peaks at 2-6h and 48-72h) and a transientactivation of p38.JNK activity was also modulatedfollowing D1 treatment, with differences among theJNK isoforms. Specific inhibitors of the ERK, p38 andJNK pathways (PD98059, SB203580 and SP600125,respectively) were then used to investigate the roleof MAPK in the biological effects determined by D1administration to Kasumi-1 cells. Inhibition of ERK1/2 and JNK determined a significant decreased incell number. P38 inhibition did not affect cell numberwhile inhibiting the D1-induced decrease. Inhibitionof ERK and JNK were ineffective in the D1-induced decrease. Decrease of cell number wascaused by induction of apoptosis, as determined bythe Annexin V test. In particular, ERK and p38 inhibitiondid not determine significant apoptosis. JNKinhibition determined a marked apoptosis which wassimilar to that induced by D1, while the treatmentwith both D1 and SP600125 induced an additiveeffect. Inhibition of the ERK and p38 pathways didnot interfere with D1-induced apoptosis. Theseresults were confirmed by western blotting evaluationof caspase-3 activation. Indeed, caspase-3 precursordecreased and the active caspase formappeared after a 24 h treatment with D1 andSP600125 alone, while the combination of D1 withSP600125 determined maximal effects. Caspase-3activation was unchanged by the treatment withPD98059 or SB203580, alone or in combination withD1.PD98059 and SP600125 were able to induce aconspicuous maturation, as revealed by morphologicalanalysis. These data were not supported byimmunophenotype data. None of MAPKs inhibitorsinterfered with D1-induced maturation. It is worthpointing out that none of the above MAPK inhibitorsmodulated histone acetylation which occurs after D1treatment of these cells. D1-induced modulation ofMAPK, which seems to be involved in Kasumi 1 survivaland maturation, suggests that the butyratederivative exerts its action also via HDAC-unrelatedpathways.PO-055COVALENT MODIFICATIONS OF HISTONE H4 NH2-TERMINALTAILS ASSOCIATED WITH P210 BCR-ABL TYROSINE KINASEBrusa G,* Parisi D,° Calonghi N,^ Calabrò A,*Mancini M,* Zuffa E,* Arcangeli E,* Santucci MA**Istituto di Ematologia e Oncologia Medica "Lorenzoe Ariosto Seràgnoli", °Istituto di Gastroenterologia e^Istituto di Biochimica "G. Moruzzi", Università diBologna, ItalyCovalent modifications of the core histone tails,includind acetylation, methylation, phosphorylation,ADP-ribosylation and ubiquitination govern the chromatineaccessibility and create binding surfaces forprotein recognition (such as the bromodomain foracetylated lysines and the chromodomain for methylatedlysines), therefore dictating the rate of genetranscription. We investigated the impact of p210bcr-abl tyrosine kinase of chronic myeloid leukemia(CML) on the acetylation and methylation at individuallysine residues within the NH2-terminal tails ofhistone H4, an integral component of transcriptionalcompetence at the onset of S phase. To the purpose,we used RP-HPLC coupled with electrospraymass spectrometry (LCMS) to resolve the single H4species (non-acetylated and mono-, di- or threeacetylated)and enzymatic digestion coupled withMALDI mass spectrometry to define the individuallysine residues involved in acetylation and methylationprocesses. In single cell clones generated fromthe murine myeloid 32D cell line transducing a temperature-sensitive(ts) p210 bcr-abl construct (thatowns constitutive tyrosine kinase activity at the per-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200497missive temperature of 33°C, but lacks it at the nonpermissivetemperature of 39°C) the inhibition ofp210 bcr-abl tyrosine kinase induced by 1 µM STI571was associated with a significant (p

98Postersanalyse the transcribed HUMARA and/or IDS alleleson mRNA obtained from purified populations ofplatelets and/or granulocytes. Balanced XCIP wereconfirmed in 4 out of 5 analysable PV and in 9 out 11analysable TE patients. The demonstration of polyclonalhematopoiesis in women with a typical clinicalpicture of ET has already challenged the dogmathat CMDs derive from clonal proliferations ofhematopoietic stem cells. Our findings demonstatespolyclonal hematopoiesis also in PV patients. Fourwomen had unequivocal clinical features and metthe diagnostic criteria for PV, but consistently showedpolyclonal XCIP. This indicates that PV is heterogeneouswith respect to lineage involvement. In someindividuals, the abnormal clone might be restricted toerythroid cells and/or might be capable of sustainingan increased red cell production despite its limitedsize. The fact that all women with myelofibrosis withmyeloid metaplasia showed clonal or ambiguous XCIPclearly indicates that this condition represents a truestem cell disorder in most instances.PO-058BCR-ABL1/E6A2 TRANSLOCATION IS SENSIBLE TO IMATINIBMESYLATERoti G,* Crescenzi B,* La Starza R,* Ballanti S,*Piattoni S,^ Gottardi E,° Fava M,° Saglio G,°Martelli MF,* Mecucci C**Ematologia, Università Degli Studi di Perugia;^Medicina Interna e Scienze Oncologiche, UniversitàDegli Studi di Perugia; °Dipartimento di Scienze Clinichee Biologiche, Università di Torino, ItalyA 37-year old man was admitted to our Hospital inSeptember 2003 for fever of unknown origin. Laboratorytest revealed anemia (hemogloblin 10.9 g/dL,MCV 97fl), and leukocytosis (38000/mm 3 ). The bloodfilm showed a full spectrum of mature and immaturemyeloid cells with a marked increase of myelocytesand mature neutrophils. Neutrophilic alkaline phosphatasewas normal. Bone marrow biopsy and aspiratewere consistent with a chronic phase of chronicmyeloid leukemia (CML). Cytogenetic analysisshowed a 46, XY, (9;22)(q34;q11) karyotype in only40% of metaphases. FISH, with a single fusion probeshowed 90% of positive interphase nuclei. The doublefusion probe revealed one single fusion plusaccompanying deletion of ABL1. Multiplex PCR failedto identify BCR-ABL1 transcripts corresponding top190, p210, or p230 proteins. Sequence analysis ofthe fusion region of amplified cDNA fragmentrevealed joining between e6 exon of BCR and a2 exonof ABL1. 1 Complete hematologic and molecular cytogeneticremission has been obtained with Imatinib(dose 400mg/day). Patient is at present under molecularmonitoring. Conclusion: BCR-ABL1 fusion genedue to e6a2 junction is a rare event in chronicmyeloid leukemia (2-5). As far as we know, for thefirst time Imatinib is proved as succesful treatment inthis unusual molecular presentation of CML(6-7).Funding: the work was partially supported fromMIUR-CNR and AIRC.References1. van Dongen JJM, Macintyre EA, Gabert JA, Delabesse E, Rossi V,Saglio G, et al. Standardized RT-PCR analysis of fusion gene transcriptsfrom chromosome aberrations in acute leukemia for detectionof minimal residual disease. Report of the BIOMED-1 ConcertedAction: Investigation of minimal residual disease in acuteleukemia. Leukemia 1999;13:1901-282. Hochaus A, Reiter A, Skladny H, Sick C, Berger U, Guo RB, et al. A novelBCR-ABL fusion gene in e6a2 in patient with Ph chromosomenegative chronic myelogenous leukemia. Blood 1996;88:2236-40.3. Dupont M, Jourdan E, Chiesa J. Identification of e6a2 BCR-ABL fusionin a Ph positive CML. Leukemia 2000;14:2011-2.4. Schultheis B, Wang L, Clark RE, Melo JV. BCR-ABL with an e6a2fusion in CML diagnosed in blast crisis. Leukemia 2003;17:2054-55. Colla S, Sammarelli G, Voltolini S, Crugnola M, Sebastio P, GiulianiN. e6a2 BCR-ABL trancripts in chronic myeloid leukemia: is it associatedwith aggressive disease? Haematologica 2004;89:611-3.6. O’Brien SG, Guilhot F, Larson RA, et al. Imatinib compared with interferonand low dose cytarabine for newly diagnosed chronic phasechronic myeloid leukemia. N Engl J Med 2003;348:994-10047. Peggs K, Mackinnon S. Imatinib mesylate-the new gold standard fortreatment of chronic myeloid leukemia. N Engl J Med 2003; 348:1048-50.PO-059MOLECULAR ANALYSIS OF THE IMATINIB-INDUCED COMPLETECYTOGENETIC RESPONSE IN CHRONIC MYELOGENOUSLEUKEMIAMiglino M, 1,2 Canepa L, 1,2 Grasso R, 1,2 Varaldo R, 1,2Fugazza G, 1 Clavio M, 1,2 Colombo N, 1,2 Bruzzone R, 1Pierri I, 1,2 Ballerini F, 1,2 Canepa P, 1,2 Sessarego M, 1Gobbi M 1,21Department of Internal Medicine (DIMI), Universityof Genova, Italy; 2 Department of Haematology andOncology, Azienda Ospedale S. Martino e ClinicheUniversitarie Convenzionate, Genoa, ItalyThe introduction of Imatinib has greatly modifiedthe picture of CML significantly increasing the numberof complete remissions that were very few withprevious therapies. The new scenario allows to studysome events regarding the early phases of neoplasticclone development and its relationship with normalhaematopoiesis. Imatinib mesylate has been shownto powerfully and selectively inhibit ABL1 proteintyrosine kinase activity and to suppress in vitro and invivo growth of BCR-ABL positive cell lines. Treatmentof CML in chronic phase (CP) with Imatinib mesylateproduces hematologic remission in more than 90%of interferon resistant patients leading to a majorcytogenetic response in almost 50% of them. We per-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200499formed clonal analysis of CP-CML female patients,using X-linked polymorphic marker HUMARA to confirmthat also Imatinib-induced complete cytogeneticresponses are associated with the restoration of atrue polyclonal haematopoiesis. Furthermore we analyzedthe residual amount of p190 and p210 transcripts,in order to study the relationship betweenresidual neoplastic clone and normal (i. e. polyclonal) haematopoiesis. Our results are referred to marrowsample performed after one year of Imatinib mesylatetherapy. We studied 14 CP CML females, enrolled inthe Novartis-sponsored multi-institutional Phase IItrials, who reached a complete cytogenetic responsewith Imatinib mesylate therapy. Nine patients hadbeen previously treated with αIFN, but this therapywas interrupted for intolerance (n. 7) or lack of anycytogenetic response after one year of therapy (n. 2).Five patients had received a short course of Hydroxyurea.Before the start of Imatinib therapy all caseshad a predominance of Ph positive metaphases inunstimulated bone marrow. Glivec was administeredat the dosage of 400 mg/die. In 13 patients a sustainedcomplete cytogenetic remission was documentedin a median of 6 follow up samples (range 3-9). In one patient metaphases were available for studyonly in one sample, which however did not disclose Phmetaphases. FISH analysis was performed in everymarrow sample during the follow up. Bcr/ablrearrangement. P210 transcript was detected by RT-PCR in each patient before starting therapy. Its persistencewas documented in all patients during completecytogenetic remission (in a median of 6 samples).After one year of therapy P190 transcript wasfound in 9 out of 14 patients during CCR while it wasdetectable only in two patients before the start ofImatinib therapy. The analysis of X-linked polymorphicmarker HUMARA was performed after 12 months ofimatinib therapy, during CCR. All patients were informative( i. e. heterozygous ) for clonal analysis. All butone samples revealed a polyclonal pattern of X methilationafter HPA II digestion confirmed by densitometryanalysis. The observation that 13 out of 14patients exhibited a polyclonal pattern of X inactivationduring complete cytogenetic response confirmsthe recent evidence that imatinib is able to restore apolyclonal hematopoiesis in CML patients. The presentmolecular study of patients in CP-CML in CCR inducedby imatinib-mesylate discloses some clonal heterogeneity.Besides physiological haematopoiesis, whichis largely predominant, as indicated by the analysis ofX-linked polymorphic marker HUMARA, at least twosubclones seem to coexist; the first expressing thep210 protein, the second expressing the p190.Furthermore,the monoclonal pattern observed in onepatient of our series and the recent observation ofthe possibile occurrence of clonal cytogenetic abnormalitiesin patients with CML in polyclonal remissionafter imatinib suggest that a neoplastic stem cell lackingbcr-abl rearrangement, may acquire further cytogeneticalterations different from Philadelphia chromosome.There is the possibility that imatinib therapymay prevent the expansion of Ph positive clonesand that, in addition to stem cell genetic instability,other cytotoxic treatments may favour clonal evolution.PO-060GENOMIC UNBALANCES ASSOCIATED WITH THE RESISTANCETO IONIZING RADIATIONS OF A HUMAN OSTEOSARCOMA CELLLINE (SAOS) DETECTED BY COMPARATIVE GENOMICHYBRIDIZATION (CGH-BASED TECHNIQUEBrusa G,* Hattinger C,° Serra M°, Astolfi A,**Saponaro M,* Cammelli S,^ Santucci MA,* Barbieri E^*Istituto di Ematologia "Lorenzo e Ariosto Seràgnoli",**Dipartimento di Patologia Sperimentale-Sezionedi Cancerologia e ^Istituto di Radioterapia "LuigiGalvani", Università di Bologna; °Laboratorio diRicerca Oncologica, Istituti Ortopedici Rizzoli, Bologna,ItalyResistance to ionizing radiations (IR) is one majorproblem in the clinical management of osteosarcoma(OS) and marks the clonal evolution of tumor cellstowards a more aggressive phenotype. Genome-widescreening techniques will be therefore helpful touncover genomic unbalances eventually associatedwith specific characteristics of OS cells, includingtheir radio- and/or drug-resistance. Here, we reporton the results of a comparative genomic hybridization(CGH)-based technique to achieve informationson the genomic profile associated with radio-resistancein a human OS cell line, named SAOS, that lacksthe p53-dependent radio-response. Radio-resistantSAOS subline was generated from the parental cellline following three rounds of low dose (10 Gy)/lowdose rate (0.05 Gy/min) gamma irradiation performedat 24 hr intervals. Genomic unbalances associatedwith the development of radio-resistance wererevealed by the co-hybridization of SpectrumGreenlabeledDNA from radioresistant SAOS and SpectrumRed-labeledDNA from parental cell line onAmpliOnc (GenoSensorTM Array 300) microarrays,representing the oncogenes and the tumor suppressorgenes most frequently altered in human cancers(for the complete list of spotted targets see: Mao et al., Genes Chromosomes Cancer 35,144-155,2002). Thestatistical analysis of obtained results was performedby normalized test-to-reference ratios of the includedspots for each target calculated by the massmethod according to a previously published work(Hattinger et al. , Europ J Cell Biol 82,483-493,2003).The radio-resistance of SAOS OS cells was associat-haematologica vol. 89[suppl. n. 6]:september 2004

100Postersed with the gain of the inherent DNA sequence copynumber relative to 11 genes and no losses. In moredetail, the amplification relative to tymidine kinase 1(mapping at 17q25.2-q25.3), telomeric BAC and YACregions (mapping at chromosomes 9 and 2, respectively)and EGR2 (a component of the mitochondrialapoptotic loop mapping at 10q21.3) was very significant,whereas the amplification relative to twotelomeric sequences (mapping at 19p and 2p loci,respectively), to the chromosome segregation 1-likeCAS (mapping at 20q13 locus), the cycloxigenase 2(mapping at 1q31.1), the ERBB2 sequence (located atthe 17q21.1 locus) and the Myc (mapping at8q24.12-q24.13 locus) showed a borderline statisticalsignificance. Genomic unbalances associated withradio-resistance exhibited discrete differences comparedwith methotrexate-resistance, suggesting thatOS cells utilize different pathways to repair the damageinduced by reactive oxygen species or metabolicdefects. Additional studies currently in progress ongene expression of parental and radio-resistant SAOScells, performed on U133A microarrays fromAffymetrix, will help to elucidate whether in OS lackingp53-dependent response to IR the radioresistancehas specific genomic markers.Funding: The study was supported by Università diBologna (Progetti Pluriennali), Carisbo Foundationand Forlì-CesenaAI. GB is the recipinet of a grant entitledto Mrs. Lalla Seràgnoli.PO-061QUALITATIVE AND QUANTITATIVE MOLECULAR ASPECT INACUTE PROMYELOCYTIC LEUKEMIASCulurgioni F, Adamo F, Ennas MG, Angelucci EUnità Operativa di Ematologia, Centro TrapiantiMidollo Osseo, Ospedale Oncologico “A. Businco” Asl8 Cagliari-Dipartimento di Citomorfologia,Universitàdegli Studi di Cagliari, ItalyThe acute promielocytic leukemia (APL) is a heterogeneousgroup of acute myeloid leukemia's herexpression is 10-15%, it is M3 for the FAB (French-American-British -Cooperative -Group) classification.The APL is clinically Characterized from elevate sensibilityat the acid trans-retinoic (ATRA) therapy. Inthis study we evaluated the quantitative and qualitativemolecular investigation and the clinic utility inthe exordium and follow-up phases. The cells are separatedwith ficoll, then the RNA is extracted andcDNA is obtained with reverse transcription reaction.Investigation of Hybrid transcript PML/RAR from t(15,17) is performed on all samples. Various isoformswith RT-PCR are investigated. The qualitative PCRhave a 1/1000 cell (single PCR) as sensibility, and1/10000 cell (nested) as sensibility. The BIOMED I protocoluse, is a standardized method, with short time,it has a confirmation test too. On all samples hybridtranscript PML/RAR is quantificated, with the Real-Time PCR investigation. The sensibility of this methodis too elevated in relation at qualitative PCR as far as10e7 cells. Further to Forward and Reverse primers,there's a marcate probe with a reporter and aquencher: in this way for every single copy of transcripta fluorescent signal is emitted and recorded bya sensor. Transcript copies are showed from exordium,after 1 month, after 2 months, after 3 months tillof PCR come negative. The role of quantitative molecularinvestigation is evidenced in this study. Inexordus and follow-up phase, because of the elevatedsensibility of Real-Time PCR, is possible recognizemolecular relapse not visible with other morphologicmarkers. The increase of transcript copies is evidencedby positive signals. In this way, is possible touse an appropriate therapeutic selection.Funding. Studio realizzato con i finanziamenti dell'Assessorato Igiene e Sanita' della Regione SardegnaPO-062IL-12 GENE EXPRESSION INTO AML-DERIVED DENDRITIC CELLSOVERCOMES T-CELL FUNCTIONAL IMPAIRMENT INDUCED BYLEUKEMIC MICROENVIRONMENTCurti A,° Pandolfi S,° Aluigi M,° Isidori A,°Alessandrini I,° # Chiodoni C, # Testoni N,°Colombo MP, # Baccarani M,° Lemoli RM°°Institute of Hematology and Medical Oncology “L.& A. Seragnoli”, University of Bologna; # Immunotherapyand Gene Therapy Unit, Istituto Nazionale perlo Studio e la Cura dei Tumori, Milan, ItalyAcute myeloid leukemia (AML) cells may be differentiatedinto leukemic dendritic cells (AML-DC).AML-DC have superior immunogenicity than not-differentiatedcounterpart, but their antigen-presentationcapacity within an inhibitory tumor microenvironmentis unknown. As potent anti-tumor cytokine,interleukin (IL)-12 contrasts immune evasion bytumors. To test the effect of leukemic microenvironmenton AML- DC/T interaction, T cells were incubatedwith AML-DC in presence of supernatant ofhuman leukemic cell line, K562. As a result, T cellproliferation decreased and Th1 cytokine profile waslost. T cells were the target of this inhibition asdemonstrated by reduced T-cell-derived IFN-γ productionupon non specific stimulation and by the lackof effect of leukemic supernatant on phenotype andcytokine production of CD40L-matured AML-DC. We,then, transfected AML- DC with human IL-12 genesby using a non-viral method, nucleofection. TransfectedAML-DC produced significant amount of IL-12,still showed DC-like phenotype and better allostim-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004101ulatory capacity than primary AML blasts andexpressed leukemia-specific cytogenetic abnormalities.IFN-γ production by T cells cultured with IL-12-transduced AML-DC increased as compared to thatobtained with mock-transduced DC. More importantly,T cells stimulated by IL-12-producing AML-DC in presence of inhibitory leukemic supernatantstill maintained a Th1 cytokine pattern. In conclusion,IL-12 genes may be expressed into AML-DC byusing a novel non-viral method which does not modifytheir phenotypical, cytogenetic and functionalfeatures. The constitutive production of IL-12 byAML-DC results in increased antigen-presentationcapacity and counteracts the inhibition of leukemicmicroenvironment on T cells.PO-063EVIDENCE OF THE OCCURRENCE OF NAD(P)H OXIDASE ACTIVI-TY IN HEMATOPOIETIC STEM CELLS: POSSIBLE INVOLVEMENTIN O2 SENSING AND ROS-MEDIATED DIFFERENTIATION SIG-NALLINGPiccoli C, a Ria R, b Scrima R, a Boffoli D, aTabilio A, b Capitanio N bDepartments of a Biomedical Science, University ofFoggia, Foggia and b Clinical and ExperimentalMedicine, University of Perugia, ItalyDespite of the growing interest in the field of stemcell research, promizing important advance in thebasic understanding of cell differentiation as well asin the cell-based therapeutic clinical application, 1 abiochemical metabolic characterisation of this uniquecell type is lacking. This study was aimed to partly fillsuch gap focusing attention on the terminal oxidativemetabolism. The cell type chosen was humanhaematopoietic stem cell (HSC) mobilised from bonemarrow by cytokine (G-CSF) treatment and collectedfrom peripheral blood. 2 The protocol of cell isolationbased on positive immuno-selection by a monoclonalantibody raised to CD34 antigen (a specificsurface marker of HSCs) resulted in never less than99% of phenotipically homogeneous cell population.The main results obtained by an extensive analysiscarried out on such HSC samples can be summarisedas follow: a) polarographic measurements of endogenousrespiration of whole cells revealed a CN-sensitiveoxygen consumption rate of about 0.05 nmolesO2/min/10 6 cells, which was indicative of a very lowmitochondrial oxidative metabolism when comparedwith that of other cell types. b) confocal microscopyimaging of HSCs, confirmed the presence of a few butfunctional delta p-generating mitochondria (detectedby uncoupler-sensitive mito-tracker); an extensiveand quantitative analysis of the cell populationrevealed an inverse correlation between the mitochondrialcontent and the intensity of the signalattributable to the CD34 stem cell marker. In addition,analysis of the mitochondrial intracellular networkof other cell types allowed to relate and compare therespiratory activity to the mitochondrial area. c) thesmall amount of mitochondrial respiratory complexesin HSCs was verified by differential spectrophotometricanalysis on whole cell lysate and by bluenative2D SDS-PAGE analysis of the oxidative phosphorylationcomplexes in isolated mitoplasts. d) a reexaminationof the CN-insensitive endogenous respiration,amounting to about 50% of the overallendogenous respiration, revealed that this was completelyabolished by DPI (a specific inhibitor offlavoenzymes) and sensitive to externally added catalaseand/or superoxide dismutase, suggesting theinvolvement of a NAD(P)H-oxidase-like activity convertingO2 to O2 – . This was verified by the occurrenceof ter-butyl isotiocyanide shiftable absorbance peaksat 425 and 558 nm, indicative of the presence ofcytochrome b558, the NAD(P)H oxidase prostheticgroup. d) reverse-PCR amplification of total RNA cellextracts followed by sequencing showed the expressionin HSCs of membrane bound and cytosolic subunitsof the NAD(P)H oxidase (gp91phox-NOX2,p22phox, p67phox, p47phox). Furthermore crossimmunoprecipitationanalysis revealed the occurrenceof an assembled complex and the phosphorylationstate of the p47 cytosolic subunit.Taken all together these results show that the mitochondrialoxidative phosphorylation capacity of theCD34 + hematopoietic stem cell is very low whencompared with that of other cell types. This could bea consequence of the low energy demand of the G0-phase in which the resting HSC rely. The very lowtension of O2 of the bone marrow stromal microenvironment(stem cell niche), could also be a factorconditioning the expression of the oxidative phosphorylationsystem. It is noteworthy, however, thepresence of mitochondria able to locally generate andmaintain a transmembrane potential as shown by theconfocal microscopy analysis. This was particularlyevident in a sub-population of the CD34 + cells apparentlyexpressing lower level of the surface marker(whose progressive lost is indicative of commitment),suggesting a role of the mitochondrial oxidativemetabolism in the early stage of HSCs differentiation.The novelty emerged from this study is the discoveryof the presence of a NAD(P)H oxidase activityin HSCs (never reported before). Although both thecatalytic and regulatory subunits of the NAD(P)H oxidasesystem are expressed and assembled, the activity,measured as DPI-sensitive oxygen consumptionrate, is much lower then that of macrophagic cellswhere the NAD(P)H oxidase serves as a powerful oxygenproducing bactericide system. Low active isoformsof the macrophagic NAD(P)H oxidase have,haematologica vol. 89[suppl. n. 6]:september 2004

102Postershowever, been reported in other non macrophagiccells and it has been suggested their involvement inoxygen radical-mediated intracellular signalling. 3 Itis tempting to suggest that following activation byexternal stimuli, the HSC NAD(P)H oxidase might beinvolved in a ROS-mediated intracellular signallingleading (or contributing) to cell differentiation. Thenature of the external stimuli, the type of oxygenreactive species, the targets of the activated intracellularsystem are under investigation to validateour hypothesis.References1. Donovan PJ, Gearhart J. The end of the beginning for pluripotentstem cells. Nature 2001;12:414.2. Tabilio A, Falzetti F, Giannoni C, Aversa F, Martelli MP, Rossetti M,et al. Stem cell mobilization in normal donors. J Hemother 1997;6:227-34.3. Sauer H, Wartengerg M, Hescheler J. Reactive oxygen species asintracellular messenger during cell growth and differentiation. CellPhysiol Biochem 2001;11:173-86.PO-064CARBOXY-TERMINAL FRAGMENT OF OSTEOGENIC GROWTHPEPTIDE REGULATES MYELOID DIFFERENTIATION THROUGHRHOAFazzi R,° Galimberti S,° Pacini S,° Mattii L,*Cervetti G,° Buda G,° Petrini M°°Department of Oncology, Transplant and AdvancedTechnologies in Medicine, Hematology Division,University of Pisa; *Department of Human Morphologyand Applied Biology, Section of Histology andGeneral Embryology; University of Pisa, ItalyThe carboxy-terminal fragment of osteogenicgrowth Peptide (sOGP10-14) is a pentapeptide withbone anabolic effects and hematopoietic activity. Thelatter activity appears to be largely enhanced by specificgrowth factors. To study the direct activity ofsOGP10-14 on myeloid cells, we tested the pentapeptideproliferating/differentiating effects in HL60cell line. In this cell line, sOGP10-14 significantlyinhibited cell proliferation, and enhanced myeloperoxidasesand NBT reducing ability. Moreover, itinduced cytoskeleton remodelling and small GTPbindingprotein RhoA activation. RhoA, which isknown to be involved in the HL60 differentiation,mediated these effects as shown by using its specificinhibitor, C3.Treatment with GM-CSF had a comparablesOGP10-14 activity, and treatment with bothgrowth factors showed enhanced effects. Theseresults strongly suggest that sOGP10-14 acts directlyon HL60 cells by activating RhoA signallingalthough other different possibilities cannot be ruledout.PO-065HB FEDERICO II, A NOVEL HAEMOGLOBIN VARIANT (β 106LEU →VAL) ASSOCIATED WITH A β-THALASSEMIA PHENOTYPEGrosso M,* Morelli E,° Puzone S,* Sessa R,*Petruzzelli R,* Papa V, * Esposito P,* Alfinito F,°Izzo P**Dipartimento di Biochimica e Biotecnologie Medichee CEINGE-Biotecnologie Avanzate, °Cattedra diEmatologia, Università degli Studi di Napoli FedericoII, Naples, ItalyHemoglobinopathies are monogenic disorderswidespread overall, characterized by great heterogeneityin molecular pathology and encompassingthe complex and partially overlapping groups ofhaemoglobin variants and thalassemia syndromes. Sofar, about 700 hemoglobin variants have been identified;some of them show decreased stability, due tothe type and/or the location of the amino acidinvolved in the substitution. Several mechanisms forthe decreased stability of a haemoglobin variant, givingrise to an extreme variability both of the instabilitylevel and the possible clinical manifestations,have been proposed. Although it is generally agreedthat the clinical effects depend on the presence of anabnormal protein, it cannot be excluded that a DNAmutation could lead to transcription of an aberrantmRNA with decreased stability because of changes inthe secondary structure. The aim of this study was toset up a method based on the noticeable and carefulreal-time PCR method to quantify mRNA levels ofhemoglobin variants showing thalassemic features.β-thalassaemic mutations analysis was carried outon DNA and RNA obtained from leucocytes and reticulocytesrespectively, collected from whole blood.RNA molecules measurement was performed on aniCycler instrument from Bio-Rad Laboratories usinga common reverse and two allele-specific forwardprimers, in combination with SYBR Green I as thedetection format. Recently, a patient showing a typicalβ-thalassemic trait was referred to our laboratoryfor molecular characterization. Screening of the mostcommon β-thalassemic mutations (β+-87, β°6,β°IVSI-1, β+IVSI-6, β+IVSI-110, β°39, β°IVSII-1,β+IVSII-745) in the Mediterranean population resultednegative. Sequence analysis showed solely thepresence of a mutation at heterozygous level in thethird exon of the β-globin gene, causing the substitutionof Leu with Val residue (CTG→GTG) at codon106 and producing a novel haemoglobin variant. Thisvariant, which we named Federico II, was undetectableat the cation-exchange HPLC analysis, whileonly a small abnormal peak (7% of total haemoglobin)was revealed at the reverse-phase HPLC. To verifywhether the extremely low level of this varianthaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004103was due to a reduced mRNA synthesis, measurementof the β-globin mRNA by real-time PCR were performed.We found that the β-globin mRNA levels ofthe proband were comparable to those detected incarriers of common β-thalassaemic mutations andabout three-fold lower than those of a normal subject,thus confirming a quantitative β-globin geneexpression defect in the proband. Furthermore, toassess that defective β-globin expression was associatedto the mutant allele, evaluation of allele-specificmRNA expression performed in the probandrevealed a strong disequilibrium in the expressionlevels of normal and aberrant mRNA species. The levelof abnormal β-globin mRNA was about 20-foldlower than the normal one, thus indicating either adecreased transcription rate or instability of mutantmRNA molecules. Our date confirm and reinforce previousobservations which indicate that substitutionsat codon 106 could result in thalassemic or hemolyticphenotypes. Putative molecular mechanisms at thebasis of the lowered expression rate, as well as proteinstability and functionality features of this novelvariant are under investigation.PosterMULTIPLE MYELOMA IPO-066HIGH ACTIVITY OF CK2 SERINE-THREONINE KINASE SUSTAINSSURVIVAL AND PROLIFERATION OF MULTIPLE MYELOMA CELLSAND ITS BLOCKADE CAUSES GROWTH ARREST, APOPTOSISAND ALTERED NFKB SIGNALINGPiazza F,*^ Ruzzene M,°^ Barbon F,*^ Di Maira G,°^Cabrelle A,*^ Bonanni L,*^ Trentin L,* Binotto G,*Pinna LA,°^ Semenzato G*^*Department of Clinical and Experimental Medicine,Immunology-Hematology Branch and ^VenetianInstitute of Molecular Medicine, Unit of HaematologicalMalignancies and °Department of Biochemistry,University of Padua, ItalyMultiple myeloma (MM) pathophysiology is characterizedby the aberrant activation of several signallingpathways triggered by external stimuli. CK2(casein kinase II) is a ubiquitous serine-threoninekinase whose activity is elevated in proliferating andtransformed cells. The role fo CK2 in oncogenic transformation,apoptosis and cell cycle progression hasrecently become matter of intense research. Due toits functional connection with signalling moleculespivotal for plasma cell survival, such as those implicatedin the TNFα/NFkB, IGF1/PI3K/AKT and Wnt/βcateninpathways, CK2 is likely to play a central rolein MM cell biology. We investigated the role of CK2in MM plasma cell survival and cell cycle progression,in the regulation of the IkB/NFkB dependentpathway and in the modulation of MM cell sensitivityto chemotherapeutics. CK2 protein levels andenzymatic activity were analyzed in MM cell linesand highly purified CD138 + plasma cells from MMpatients. To hamper CK2 function we used novelcompounds that selectively inhibit CK2 activity andafterwards analyzed MM cell survival, apoptosis, cellcycle progression and MM cells sensitivity tochemotherapeutics. After CK2 block, we checked IkBprotein levels at basal and TNFα stimulated conditionsand NFkB DNA binding by EMSA and transcriptionalactivity by luciferase assay. We found that CK2protein is over-expressed and its kinase activity isincreased in MM cell lines and purified CD138 + plasmacells from patients, as compared to control (restingperipheral blood lymphocytes and splenic B lymphocytes).Disruption of CK2 enzymatic activity withselective agents caused a dose-dependent cytotoxiceffect as judged from increased apoptosis and cellcycle arrest in G2-M. Moreover, both the extrinsichaematologica vol. 89[suppl. n. 6]:september 2004

104Postersand the intrinsic apoptotic pathways were triggeredby such treatment. CK2 blockade coupled withchemotherapeutics resulted in an additive cytotoxiceffect. Basal and TNFα dependent IkB degradation, aswell as NFkB transcriptional activity upon TNFα stimulationwere impaired by CK2 blockage in MM cells.A partial nuclear co-localization of the catalytic asubunit of CK2 and p50/p105 was observed by confocalmicroscopy in MM cells. Moreover, endogenousp50/p105 and CK2 could be immunoprecipitated inMM cell lines. We conclude d that CK2 is a kinase pivotalfor survival and proliferation of MM cells and itsselective blockade is strongly cytotoxic to malignantplasma cells. CK2 regulates IkB protein levels andNFkB transcriptional activity, this latter effect beingpossibly mediated through physical association withNFkB transcription factors. Our findings suggest thatthe CK2 inhibition could be exploited as a novel therapeuticapproach for MM.PO-067N-RAS AND K-RAS MUTATIONAL ANALYSIS IN NEWLYDIAGNOSED MULTIPLE MYELOMA PATIENTS: EVIDENCE FORTWO NOVEL ACTIVATING MUTATIONSoverini S, Cavo M, Tosi P, Terragna C, Zamagni E,Cellini C, Ottaviani E, Amabile M, Renzulli M, PoerioA, Grafone T, Cangini D, Tacchetti P, Tura S,Baccarani M, Martinelli GIstituto di Ematologia e Oncologia Medica "Seràgnoli",Università di Bologna, ItalyThe RAS family members are among the most commonlymutated oncogenes in multiple myeloma(MM). Activating mutations of N-RAS and K-RAShave been demonstrated to result in growth factorindependence and suppression of apoptosis of MMplasma cells. Nevertheless, the incidence and prognosticsignificance of RAS gene mutations in MM hasto date been reported with some discrepancies. Thisissue has now gained new interest since the recentdevelopment of novel anticancer drugs (such as thefarnesyl transferase inhibitors) acting by blockingoncogenic RAS-signaling pathway, which could besuccessfully exploited for the therapy of a subset ofMM patients. We investigated RAS gene mutations in85 newly diagnosed MM patients, who were randomizedto receive either a single or double autologousperipheral blood stem cell (PBSC) auto-transplant(s),following remission induction chemotherapywith VAD and high-dose cyclophosphamide. Forthis purpose, genomic DNA obtained from bone marrowsamples was analyzed by primer-specific amplificationof N- and K-RAS exons 1 and 2, followed bydirect automatic sequencing. We detected a total of31 point mutations in 30 out of 77 (39%) evaluablepatients. Nine mutations were found in N-RAS: oneat codon 12, two at codon 13 and six at codon61.Twenty-two mutations were found in K-RAS: eightat codon 12, four at codon 13, five at codon 16, twoat codon 31, two at codon 61.One patient showedevidence of two distinct K-RAS mutations (both atcodon 13 and at codon 61). To our knowledge, this isthe first time that K-RAS mutations at codons 16(AAG to AAC) and 31 (GAA to CAA) are reported inMM. To date, such mutations have been found onlyin adrenocortical tumors and have recently beendemonstrated as activating. No significant associationwas observed between any RAS mutation andage, gender, bone marrow infiltration, stage of disease,immunoglobulin isotype, creatinine, C-reactiveprotein and β-2-microglobulin levels. As far asresponse to treatment was concerned, no major differencesemerged between patients with and withouta mutated RAS gene. However, patients whoshowed mutations affecting K-RAS codons 12 and13 (n=12) had a significantly shorter event-free survival(EFS; median, 21 vs. 32 months; p = 0.03) withrespect to patients who did not (n=65). It is concludedthat: a) RAS activating mutations are a frequentevent (39%) in newly diagnosed MM patients;b) in our series of patients treated with high-dosechemotherapy and single or double PBSC autotransplant(s),K-RAS mutations at codons 12-13 are associatedto a worse outcome in terms of EFS, thus confirmingthe hypotesis that different RAS gene mutationscause a different degree of activation of thedownstream effector pathways. Analysis of a largerseries of patients is required to consider the impacton clinical outcome of the previously unreported K-RAS mutations at codon 16 and 31.Funding: This work was supported by University ofBologna, Progetti di Ricerca ex-60% (M. C. ); by MIURand FIRB projects; by COFIN 2003, by the Italian Associationfor Cancer Research (AIRC), by the Fondazionedel Monte di Bologna e Ravenna and by AIL.PO-068RANK/RANKL EXPRESSION IN MULTIPLE MYELOMA BONEMARROW ENVIRONMENT AND ITS ROLE IN IL-6 AND IL-11UP-REGULATIONColla S, Morandi F, Rizzoli V, Giuliani NCattedra di Ematologia, Università di Parma, ItalyThe receptor activator of NF-kB ligand (RANKL) hasa critical role in osteoclast activation. Recently it hasbeen demonstrated that human multiple myeloma(MM) cells up-regulate RANKL in human bone marrowstromal cells (BMSC). To further investigate therole of RANKL in the pathophysiology of MM we haveevaluated the expression of RANKL and its receptorhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004105RANK in MM cells and in the BM environment andthe potential role of RANKL in the interaction ofmyeloma cells with the microenvironment. First, wefailed to detect RANKL in several human myelomacell lines (HMCLs) and fresh purified MM cells. RANKwas expressed in BMSC and endothelial cells but notin myeloma cells. Consistently, RANKL had not adirect effect on myeloma cell survival. RANKL treatmentsignificantly induced an increase of interleukin(IL)-6 and IL-11 secretion by both BMSC andendothelial cells. Moreover, in a co-culture systemwe found that myeloma cells up-regulated both IL-6and IL-11 secretion by BMSC and endothelial cellsthrough the cell-to-cell contact. The presence of theRANK-Fc that blocks the RANK/RANKL interactionsignificantly inhibited HMCLs induced secretion ofIL-6 and IL-11. Our data provide new notions on therole of RANKL system in the pathophysiology of MM.PO-069CHEMOKINE RECEPTORS CXCR3 AND CXCR4 EXPRESSION ANDROLE IN PLASMA CELL MALIGNANCYGiuliani N, Bonomini S, Hojden M, Colla S, MorandiF, Sammarelli G, Rizzoli VCattedra di Ematologia, Università di Parma, ItalyChemokine receptors, CXCR3 and CXCR4, areexpressed on normal B and plasma cells beinginvolved in regulation of chemotaxis and migration.In this study we have evaluated the potential expressionand role CXCR3 and CXCR4 on human myelomacells. First we found that fresh purified CD138 + plasmacells obtained from 25 multiple myeloma (MM)patients at the diagnosis expressed both CXCR3 andCXCR4 on the membrane in a wide range of expression.A significant increase of both chemokine receptorswas found in comparison with normal subjects,moreover a correlation between CXCR3 expressionand the clinical stage of MM patients was found.Human myeloma cell lines (HMCL), RPMI-8226,OPM-2, XG-1, XG-6, OPM-2 established frompatients with plasma cell leukemia, also expressedCXCR4 at high intensity. CXCR3 was expressed in 2(RPMI-8226 and OPM-2) out of 5 HMCL tested atlower intensity. CXCR3 expression was cell cycledependent being associated with the proliferativephase of cell cycle. In addition CXCR3 expression onHMCL, detected by both flow cytometry andimmunoistochemistry, was up-regulated during cellapoptosis induced with CD95 stimulation or IL-6deprivation. Using an ELISA test we have also demonstratedthat 3 out 4 HMCL produced the CXCR3 ligandIFNgamma inducible protein (IP-10). A significantinhibitory effect on HMCL apoptosis was observed bytreating them with IP-10 at concentration rangingbetween 50 to 100 ng/ml. In conclusion our data indicatethat myeloma cells express CXCR3 and CXCR4with a different pattern and at higher intensity ascompared to normal subjects and that CXCR3 expressionby myeloma cell is correlated with cycle andapoptosis and in turn CXCR3 activation by IP-10 canaffect myeloma cell survival.PO-070HUMAN MYELOMA CELLS INHIBIT OSTEOBLAST FORMATIONAND DIFFERENTATION IN THE BONE MARROW ENVIRONMENTGiuliani N, Morandi F, Colla S, Bonomini S,Hojden M, Rizzoli VCattedra di Ematologia, Università di Parma, ItalyMultiple myeloma (MM) is a plasma cell malignancycharacterized by the high capacity to induceosteolytic lesions. The histomorphometric studies,performed in MM patients, have demonstrated thatMM patients with high plasma cell infiltrate or activedisease are characterized by a lower number ofosteoblasts and a decreased bone formation thatcontributes, together with the increased osteoclastactivity, in the development of bone lesions. Howeverthe mechanisms by which myeloma cells reducebone formation are not completely identified. In thisstudy first we have investigated the effect of humanmyeloma cell lines (HMCLs) on proliferation and survivalof osteoblast-like cell lines MG-63 and primaryhuman osteoblast cells (hOB) in a co-culture system.We found that conditioned medium (CM) ofRPMI-8226, U266, XG-1 and XG-6 significantlyreduced the number osteoblastic cells and suppressedosteoblast proliferation of both MG-63 and hOB.HMCLs are able to significantly induce apoptosis ofhuman osteoblastic cells either in presence orabsence of a transwell insert even if the cell-to-cellcontact condition was more effective. CD95/FAS+osteoblastic cells, as MG-63, are more sensitive toHMCLs apoptosis. Consistently the presence of blockinganti-FAS ligand Ab in the co-culture reduced thepro-apoptotic effect but not completely. Similarly wefound that blocking anti-TRIAL Ab also reducedosteoblast apoptosis but did not completely blunt thepro-apoptotic effect of TRIAL positive HMCLs. Further,we have investigated the effect of HMCLs on the formationof osteoblast progenitors in long-term humanbone marrow (BM) cultures. In this system we foundthat HMCLs significantly inhibited both the numberof the Colony Forming Unit-fibroblast (CFU-F) after15 days and of the CFU-OB after 21 days either inpresence or absence of a transwell system even if thecell-to-cell contact induced a more potent inhibitoryeffect. Moreover, in a co-culture system, we foundthat myeloma cells inhibited the osteoblast dif-haematologica vol. 89[suppl. n. 6]:september 2004

106Postersferentation by BM stromal cells inhibiting theosteoblast marker osteocalcin and collagen I. In conclusionour date indicate that human myeloma cellsinhibit osteoblast proliferation, induce osteoblastapoptosis and decrease human osteoblastogenesis.These effects could be responsible of the decreasedbone formation observed in MM patients.PO-071EXPRESSION OF OSTOPONTIN BY HUMAN MYELOMA CELLSAND ITS INVOLVEMENT IN MYELOMA INDUCED ANGIOGENESISColla S,* Morandi F,* Mancini C,° Lazzaretti M,°Crugnola M,* Rizzoli V,* Giuliani N**Cattedra di Ematologia and °Anatomia patologica,Università di Parma, ItalyOsteopontin (OPN) is a multifunctional bone matrixglycoprotein that interacts with CD44 as major receptor.OPN has been shown to be involved in angiogenesis,cell survival and tumor progression. In this studywe have investigated the production and the potentialrole of OPN in multiple myeloma (MM). First, we foundthat human myeloma cells expressed OPN mRNA andits regulating gene the core-binding factor (CBFA1).OPN protein production and release by myeloma cellshave been also demonstrated by westernblot analysisand ELISA assay, respectively. Moreover we found thatIL-6 and IGF-I induced an increase of OPN productionby myeloma cells and in turn OPN stimulated myelomacell proliferation. In an in vitro angiogenesis systemwe show that OPN production by myeloma cellscontribute to the pro-angiogenetic effect of myelomacells. OPN production was investigated in 52 newlydiagnosed MM patients stage I-III. In this cohort ofpatients we found that purified bone marrow (BM)CD138 + MM cells from 20 out of 52 patients expressedOPN. Higher OPN protein levels were detected in BMplasma of MM patients in comparison to control subjects,moreover BM angiogenesis was significant higherin MM patients positive for OPN as compared tothose negative. In conclusion our data highlight thatOPN is directly produced by human myeloma cells anddetected in a subset of MM patients with higherangiogenesis suggesting a potential involvement ofOPN in the pathophysiology of MM.PO-072VASCULOGENESIS IN PATIENTS WITH MULTIPLE MYELOMATHROUGH BONE MARROW MACROPHAGESRusso F, Ria R, Roccaro AM, Scavelli C, Cirulli T,Di Pietro G, Vacca A, Dammacco FDepartment of Internal Medicine and Clinical Oncology,University of Bari Medical School, Policlinico,Bari, ItalyTumor neovascularization forms through angiogenesis(sprouting from existing vessels) and vasculogenesis(sprouting from precursor mesenchymalcells). In embryo, cells of this type cluster and differentiateinto hematopoietic stem cells and at peripheryinto endothelial precursor cells (or angioblasts)which ultimately give rise to vessels. In post-natallife, angioblasts exist in peripheral blood and tissues,where differentiate into vessels under angiogenicstimuli, including VEGF and bFGF produced byischemie or tumor cells. Angiogenesis is importantfor progression of multiple myeloma (MM). It is alsoimportant as a prognostic factor. Plasma cells secretegrowth and differentiation factors for endothelialcells (EC), such as VEGF, bFGF, hepatocyte growth factorand angiopoietins, which are indeed highly foundin the bone marrow than peripheral blood. Vasculogenesisin MM, however, is still under scrutiny. Herewe investigated some aspects of vasculogenesis inMM generated from bone marrow macrophages.These cells were isolated from heparinized aspirateswith anti-CD14-conjugated microbeads, and left todifferentiate into endothelial cells upon exposure toVEGF and bFGF. Macrophages were stimulated dailyfor one week with VEGF at a 50 ng/ml medium and/orbFGF at 10 ng/ml. Stimulated macrophages werestudied by immunocytochemistry, western blot andRT-PCR for their phenotype and angiogenic capacityin the in vitro Matrigel assay. As a control, the THP-1 macrophage cell line (American Type Culture Collection)differentiated by exposure to PMA for 72hours was used. By using RT-PCR, resting macrophagesshowed expression of CD14, while not that ofFVIII-related antigen (FVIII-RA) and CD34.By usingwestern blot and immunolocalization, we showedthat stimulated macrophages developed a typicalendothelial cell phenotype, expressing FVIII-RA, VEcadherin,Tie-2/Tek and, to a lesser extent, VEGFR-2.They lost the CD68 molecule. The CD34 control moleculewas absent in the THP-1 cells as well as in bothresting and stimulated macrophages. After a 24-hourculture on matrigel and exposure to VEGF and bFGF,macrophages formed a closely-knit capillary plexuswith multicentric junctions, similar to that producedby MM endothelial cells. To sum up, these data suggestthat bone marrow macrophages of MM patientscan transform into endothelial cells under an angiogenicstimulus and contribute to MM vascularizationvia mechanisms of post-natal vasculogenesis. Resultsalso confirm that angiogenic cytokines may representa target for therapeutic management of MM.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004107PO-073EARLY AND LATE RECOMBINATIONS AT THE IMMUNOGLOBULINκ LIGHT CHAIN LOCUS OF MUTLIPLE MYELOMA: EVIDENCE OFRAG ACTIVITY IN GERMINAL CENTERSPerfetti V,° Colli Vignarelli M,° Palladini G,°Navazza V,° Giachino C, # Merlini G*°Department of Internal Medicine, Internal Medicineand Medical Oncology, and the *BiotechnologyResearch Laboratories, IRCCS Policlinico S. Matteo,Department of Biochemistry, University of Pavia, and#IRCCS Fondazione Maugeri, Pavia, ItalyB cells may undergo sequential rearrangements atthe light chain loci, despite already expressing lightchain receptors. This phenomenon, known as secondaryrearrangement, may occur during differentiationin the bone marrow (receptor editing) and in theperiphery, at some point of the germinal center reaction(receptor revision). To study light chain recombinationsthat preceded the development of a marrowplasma cell we used multiple myeloma as a singlecell-model and, taking advantage of the fact thatIg light chains usually rearrange before Ig ones, weused PCR to analyze the Ig locus of twenty-nine Igmyeloma cases. The results indicated that all Ig alleleswere inactivated via rearrangement of the κdeleting element, more frequently to a V segment(69%) than to the intronic recombination signalsequence (31%). Eighteen alleles (16 myelomaclones) had previous V-J attempts, and these revealedincreased utilization of distal V and J gene segments(J 56%), a marker of multiple sequential rearrangement.In-frame V-J rearrangements were found inapproximately 1/3 of available joints (5/18, with oneinvolving a V pseudogene), each one in differentmyeloma clones: 3 were identical to germline (i. e.compatible either with editing in the bone marrow orwith revision before the onset of somatic changes),while 1 had several nucleotide substitutions indicatinginactivation after the germinal center reactionhad been initiated. The present findings have relevancefor light chain genetics and support the viewthat developing B-cells may undergo both early andlate recombinations at the light chain locus. Sustainedactivity of recombination-activating genesmay contribute to immunoglobulin translocations inB-cell neoplasias.PO-074CHARACTERIZATION OF ONCOGENE DYSREGULATION IN MULTI-PLE MYELOMA BY COMBINED FISH AND DNA MICROARRAYANALYSESFabris S,* Agnelli l,* Mattioli M,* Baldini l,*Ronchetti D,* Morabito F, + Verdelli D,* Nobili l,*Intini D,* Callea V, + Stelitano C, + Maiolo AT,*Lombardi L,* Neri A**Laboratorio di Ematologia Sperimentale e GeneticaMolecolare, U. O. Ematologia 1, Dipartimento diScienze Mediche, Università degli Studi di Milano,Ospedale Maggiore IRCCS, Milan; + Divisione di Ematologiae Centro Trapianto di Midollo, Azienda Ospedaliera“Bianchi-Melacrinò-Morelli”, Reggio Calabria,ItalyMultiple myeloma (MM) is a neoplastic proliferationof plasma cells characterized by a marked biologicaland clinical heterogeneity. Dysregulation ofdistinct putative oncogenes, as a result of chromosomaltranslocations involving the IGH locus at14q32, occurs frequently in MM. Such oncogenicevents are thought to be linked with the transformationand clonal evolution of malignant plasmacells and may have a significance in the definition ofdifferent entities of the disease. In the present study,the expression profiles of FGFR3/MMSET, CCND1,CCND3, MAF and MAFB, involved respectively in thet(4;14)(p16.3;q32), t(11;14)(q13;q32), t(6;14)(p21;q32), t(16;14)(q23;q32), and t(14;20)(q32;q12),were investigated on purified plasma cell populationsfrom 39 MM and 6 plasma cell leukemia (PCL)patients by DNA microarray analysis and comparedwith the presence of translocations as assessed bydual-color FISH or RT-PCR. The t(4;14) was found in6 MM patients, the t(11;14) in 10 patients (9 MMand 1 PCL), the t(6;14) in one MM case, the t(14,16)in three cases (2 MM and 1 PCL), and the t(14;20) inone PCL. Traslocations were associated with spikedexpression of target genes in all cases. In addition,gene expression profiling allowed to the identificationof putative chromosomal translocations dysregulatingthe CCND1 (1 MM and 1 PCL) and MAFB (1MM and 1 PCL) without any apparent involvement ofimmunoglobulin loci. Notably, all of the translocationswere found to be mutually exclusive. Interestingly,marked increased levels of MMSET expressionhave been found in one MM case in which a 4p16.3allele was localized on an unidentified chromosome.Overall, our data support the notion that translocations(either or not involving the IGH locus) representthe mechanism of dysregulation of putative oncogenesprimarily involved in myelomagenesis and suggestthe importance of combined molecular cytogeneticsand gene expression approaches for the detectionof genetic aberrations in MM.haematologica vol. 89[suppl. n. 6]:september 2004

108PostersPO-075NONMYELOABLATIVE ALLOGRAFTING FOLLOWING AUTOGRAFT-ING IS FEASIBLE AND HAS A STRONG ANTI MULTIPLE MYELO-MA ACTIVITYCarella AM,* Beltrami G,° Corsetti MT,* Scalzulli P,°Cascavilla N,° Nati S,* Carella AM Jr,° Greco M,°Musto P°From the *Division of Hematology/BMT Unit, AziendaOspedale San Martino e Cliniche UniversitarieConvenzionate, Genova, Italy; °Division of Hematology/BMTUnit, IRCCS Casa Sollievo dellaSofferenza, San Giovanni Rotondo (FG), ItalyBackground: The development of reduced intensityconditioning regimens (RICT) has renewed interestin allografting for patients with multiple myeloma(MM). Taking advantage of this new approach, wepostulated that combining maximal tumor reductionachieved with autografting and the benefits of RICT,we could achieve more cures of multiple myeloma(MM) with acceptable toxicity. Design and Methods:Sixteen patients, 51 years of age (range, 36-63) withpreviously treated stage III MM were given melphalan140 mg/m2 and autologous peripheral bloodprogenitor cells (PBPC) reinfusion. The regimen-relatedtoxicities were moderate with a median of 8 and11 days of neutropenia and thrombocitopenia,respectively. Forty-six to 156 days later (median, 79days), the patients received fludarabine plus 2 Gy TBIand HLA-identical donor mobilized PBPC. Postgraftingimmunosuppression consisted of cyclosporine(CSP) and mycophenolate mofetil (MMF). Engraftmentoccurred in 14 patients (87%). Results: Thusfar, 10 patients (62%) are alive with 9 of them incontinuous complete remission 11-36 months (median,30 months) after transplants. Grade II-III acuteGVHD occurred in 7 patients (43%) but no patientdied of aGVHD. Three patients (18%) developedextensive chronic GVHD requiring intensive therapy.Six patients died; five of them of progressive diseaseand one of progressive disease combined with extensivecGVHD and interstitial pneumonitis. Conclusions:This 2-step approach is feasible and demonstrated tohave a strong antimyeloma activity with reduceddeaths due to acute toxicities.PO-076POLYMORPHISMS OF METHYLENTETRAHYDROFOLATE REDUC-TASE (MTHFR) AND SUSCEPTIBILITY TO MULTIPLE MYELOMAChiusolo P, Reddiconto G, Fiorini A, Farina G, LaurentiL, Putzulu R, Palladino M, Bellesi S, Sora' F, RossiE, Tarnani M, Di Mario A, De Stefano V, Leone G,Sica SIstituto di Ematologia, Università Cattolica del SacroCuore, Rome, ItalyMTHFR reduces methylenetetrahydrofolate tomethyltetrahydrofolate which is the main methyldonor for homocysteine remethylation to methionineand for DNA methylation. Two MTHFR polymorphismhave been recently described 677C to T and 1298 Ato C. These polymorphism are associated withreduced activity of the enzyme promoting a genomichypomethylation which would result in a reducedrisk of carcinogenesis. Moreover the reduced functionleads to the increase of 5,10 methylenetetrahydrofolatewhich increases the amount of thymidilate availablefor the DNA synthesis. A relationship betweenthese polymorphisms and the susceptibility to colorectalcancer and acute leukemia has been recenltyreported demonstrating that individuals with variantallele (677T and 1298C) have lower susceptibilityto these cancers than individuals with the wildtype variants (677C and 1298A). Aims and Methods:In the present study we examined the prevalence ofboth MTHFR polymorphism among 100 multiplemyeloma (MM) patients and 100 MM age and sexmatched healthy controls. Patients characteristicswere: M/F 55/45, median age at diagnosis 62y (range34-87). Of these patients 10 were in IA stage, 36 inIIA, 2 in IIB, 50 in IIIA and 2 in IIIB stage. Seventeenpatients had a prior history of monoclonal gammopathiesof uncertain significance (MGUS). Fiftypatients received standard chemotherapy (melphalanwith prednisone or dexamethasone), 35 chemotherapyfollowed by autologous/allogeneic peripheralblood stem cell transplantation, 1 patient radiotherapyalone and 14 were untreated. Ninety-twopatients are alive, while 8 patients died after a mediantime of 51 months (range 12-83). The median follow-upwas 24 months (range 1-216). Nineteenpatients obtained complete response to chemotherapy,39 partial response, 19 nineteen, 15 were notevaluable. The control population consisted of 100individuals without cancer history. Results: Amongthe 100 patients the frequency of 677 wild type (CC)was 31% compared to 36% in controls. The heterozygousmutants genotype (CT) was detected in44% of MM patients vs 45% in controls, while thehomozygous mutants (TT) had a frequency of 25% vs19% in patients vs controls. The frequency of 1298wild type (AA) was 48%in patients group comparedto 50% in controls. The heterozygous mutants genotype(AC) was detected in 44% of MM patients vs37% in controls, while the homozygous mutants (CC)had a frequency of 8% vs 13% in patients vs controls.In the group with a prior history of MGUS for theC677T polymorphism 52.9% of patients were normal,41% were heterozygous and 5.8% werehomozygous and regarding polymorphism A1298Chaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200410935.2% of patients were normal, 52.9% were heterozygousand 11.7% were homozygous. Conclusions:MTHFR reduces methyleneTHF to MethyTHF, which isthe main methyl donor for homocysteine remethylationto methionine and thus DNA methylation. Onthe other hand the substrate methyleneTHF acts ascofactor of thymidilate sinthase necessary for DNAsynthesis. The two polymorphisms 677CT and 1298ACare associated with a reduced activity of the enzyme.Previous studies have described a lower risk of coloncancer and acute lymphoblastic leukemia. In contrastto these observation we described a lack of correlationbetween hese polymorphisms and the susceptibilityto ALL in the Italian population. In the presentstudy we report an analysis regarding the associationbetween the susceptibility to MM and polymorphismsin the gene encoding the enzyme MTHFR. Statisticalanalysis did not disclose any significant associationbetween MTHFR polymorphisms and MM but inthesubgroup of patients with a prior history of MGUS wefound a lower prevalence of the 677TT genotype(5.8% vs 25% in the myeloma group, p=0,043). Thisdata could suggest that patients with MGUS and677TT polymorphism develop less likely in MM. Obviouslythe small sample size imposes some cautions infact further studies are necessary to confirm theinfluence of the MTHFR and the role of folate inmyeloma pathogenesis.PO-077GENE EXPRESSION PROFILING OF HUMAN MYELOMA CELLLINESAgnelli l,* Mattioli M,* Fabris S,* Verdelli D,*Todoerti K,* Bicciato S, + Maiolo AT,* Lombardi L,*Neri A**Laboratorio di Ematologia Sperimentale e GeneticaMolecolare, U. O. Ematologia 1, Dipartimento diScienze Mediche, Università degli Studi di Milano,Ospedale Maggiore IRCCS, Milan, Italy; + Dipartimentodei Processi Chimici dell'Ingegneria, Universitàdi Padova, Padua, ItalyMultiple Myeloma (MM) is a neoplastic disorder ofbone marrow plasma cells (PCs) characterized by amarked genetic heterogeneity. In particular, it hasbeen demonstrated that MM PCs show complex chromosomalaberrations, the most frequent of which arechromosomal translocations involving theimmunoglobulin heavy-chain locus (IGH) and apromiscuous array of partner loci. The result of thesegenomic alterations is the deregulation and overexpressionof the target genes as a consequence of theirjuxtaposition to regulatory sequences of the IGHlocus. The best characterised IGH translocationsinclude t(11;14), t(4;14), t(14;16) and t(6;14), whichrespectively lead to the deregulated expression of theputative oncogenes CCND1, FGFR3/MMSET, MAF andCCND3 and have been identified in the majority ofMM cases and human myeloma cell lines (HMCLs). Toinvestigate the functional significance of differentgenetic lesions and the mechanism of action of differenttarget genes we used Affymetrix DNA microarraysto analyse the gene expression profiles of a panelof 20 HMCLs that have been characterised for themore frequent IGH translocations. In particular, thepanel included 8 HMCLs positive for t(4;14), 5 positivefor t(14;16); 3 for t(11;14), 1 for t(6;14) and 5negative for any known IGH translocation. The unsupervisedanalysis showed that samples clustering wasonly partially driven by the presence of the main chromosomaltranslocations. However, supervised analysisperformed on HMCLs groups homogeneous for distincttypes of IGH translocations, identified specificgene expression profiles associated with each of thederegulated genes. Furthermore, supervised analysisperformed on HMCLs negative for any known IGHtranslocation identified specific up-regulation of a setof cancer germ line-specific antigens in these samples.Our analysis provides insights into the molecularpathogenesis of MM by identifying a number of genesspecifically modulated as a result of different translocations.Given the evidence that distinct types ofchromosomal translocations may be associated to differentclinical and prognostic outcome, the validationof these findings on MM patients will be discussed.PO-078EVALUATION OF BONE RESORPTION MARKERS IN NEWLYDIAGNOSED MULTIPLE MYELOMA PATIENTS TREATED WITHTHALIDOMIDE + DEXAMETHASONE AND ZOLEDRONIC ACIDCangini D, Tosi P, Zamagni E, Cellini C, Tacchetti P,Perrone G, Tura S, Baccarani M, Cavo MIstituto di Ematologia e Oncologia Medica "Seragnoli",Università di BolognaBone involvement is frequently observed in multiplemyeloma (MM) patients both at diagnosis andduring the course of the disease. Evaluation of biochemicalmarkers of bone turnover could offer adynamic perspective of the effects of a given therapyon bone metabolism. In patients who wereenrolled in the Bologna 2002 phase II clinical trialand treated at our center, markers of bone resorption(urinary NTX, PYR and DPYR and serum crosslaps) andbone formation (bone alkaline phosphatase-BAP andosteocalcin) were routinely evaluated at diagnosisand at various time points during therapy. By studydesign, all patients received four months of combinedthalidomide (100mg/d for two weeks and 200 mg/dthereafter) and dexamethasone (40 mg/d, on d 1-4,haematologica vol. 89[suppl. n. 6]:september 2004

110Posters9-12, 17-20/28 d on odd cycles and on d 1-4/28 d oneven cycles) therapy (THAL-DEX) as induction ofremission before peripheral blood stem cell (PBSC)collection with high-dose cyclophosphamide andsubsequent double autotransplants upon treatmentwith melphalan 200 mg/m 2 . Zoledronic acid (ZOLEacid) was administered at 4 mg/28 d for at least 9months. Data from 35 patients (19M, 16F, medianage = 53 years) who underwent the first treatmentphase have been collected so far. After 4 months oftherapy with THAL-DEX and ZOLE acid a significantdecrease in mean urinary NTX (57.1 *7.2SEnmol/mmol crea vs 20.45*3.3SE, p=0.000) and serumcrosslaps ( 5786*846SE pmol/L vs 2108*324SE,p=0.000) was observed. In patients who respondedfavorably to THAL-DEX (n = 25), a significant reductionin both serum crosslaps (77%) and urinary NTX(72%) was observed, while in refractory patients (n= 10) no significant change was detected (30%decrease in urinary NTX and 29% reduction in serumcrosslaps). A significant decrease in bone formationmarkers was also observed in both sensitive andrefractory patients, this can be attributed to DEXtherapy; however, this finding needs to be confirmedat a subsequent analysis performed at the end of thewhole treatment program. It is concluded that amongall the markers of bone turnover, serum crosslaps andurinary NTX are the ones most strictly related to actualbone resorption; combined THAL-DEX and ZOLEacid administered as primary therapy for patientswith newly diagnosed and symptomatic MM seem tobe highly effective in reducing bone resorption,although the relative contribution of each of thesedrugs cannot yet be determined.PO-079THALIDOMIDE IN COMBINATION WITH DEXAMETHASONE ANDCYCLOPHOSPHAMIDE FOR RELAPSED/REFRACTORY MULTIPLEMYELOMACaravita T,* Siniscalchi A,* Niscola P,° Santinelli S,*Ottaviani L,* Buccisano F,* Montanaro M,°De Fabritiis P,* Amadori S**Hematology, University “Tor Vergata”, St. EugenioHospital, Rome, Italy; °Hematology, MontefiasconeHospital, Viterbo, ItalyThe anti-myeloma effect of thalidomide (Thal) hasbeen demonstrated in several clinical trials. Recentdata have also indicated that Thal can increase thetherapeutic effect of chemotherapy and might beable to overcome drug resistance. Response rates of25% with Thal used as a single agent, and up to 75%,when used in combination with other agents, havebeen observed. The optimal schedule, dosage andassociation with other drugs is still not established.To evaluate the feasibility and efficacy of Thal in combinationwith Dexamethasone (Dex) and cyclophosphamide(CTX) for relapsed/refractory multiplemyeloma (MM). Between October 2001 and April2004, 30 patients (pts) (20 M/10 F) withrelapsed/refractory MM were enrolled in an openlabeltrial of oral low dose Thal (100-200 mg/day)plus Dex(40 mg, day 1-4, every month) and CTX (500mg iv/week). Main pre-treatment characteristicswere the following: median age 68 years (range 42-79); median B2M 6.25 mg/L (range 1.2-11.6); medianbone marrow plasma cell infiltration 60% (range4-100) and median time from MM diagnosis to treatmentwas 41 months (range 6-132). All pts wereheavily pre-treated: in particular, 19 pts received amedian of 3 pre-treatment chemotherapy regimens(range 1-5) and 11 underwent autologous stem celltransplantation. In addition, 20 pts showed diseaseprogression during previous treatment with Thalalone or combined with Dex. With a median followupof 12 months (1-24), all 30 pts were evaluable forresponse. According to the EBMT/IBMTR/ABMTR criteria,23 (66.6%) showed a degree of response,including 2 cases who had a complete remission, 15a partial response and 6 a minimal response; 4 pts(23.4%) showed no change and 3 (10%) a progressivedisease. At present, 11 pts are alive and 8 arestill maintaining the response from a median of 12months (1-24), with a 30% EFS and 30% OS at 2ys.According to WHO criteria, adverse effects weremoderate (grade 2 were observed, while 2 pts experiencedneutropenia requiring supportive treatment with G-CSF. Other side effects included grade

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004111undifferentiated precursors (or angioblasts), differentfrom angiogenesis in which vessels origin from existingones. Several studies have shown the presence ofcirculating and tissue angioblasts also in post-natallife. These cells are able to differentiate into endothelialcells and other several histotypes under specificstimuli. There are some evidences that vasculogenesisalso takes place in post-natal life in ischemic tissueand tumors. In tumors, near angiogenesis, vasculogenesiscontributes to the formation of the microvascularplexus that is important for local and systemic diffusion.Here, we show that hematopoietic stem cellsof multiple myeloma (MM) patients, purified with ananti-CD133 antibody from peripheral blood aftermobilization with cyclophosphamide and G-CSF, areable to differentiate into cells with endothelial phenotypeafter about 20 days culture upon exposure toVEGF and bFGF. Stem cells were seeded in 75 cm 2flasks coated with fibronectin in IMDM supplementedwith 10% fetal bovine serum (FBS), 10% horse serum,10 -6 M hydrocortisone, 50 ng/mL VEGF and 10 ng/mLbFGF. During the culture, stem cells gradually changedtheir phenotype, lost the typical antigen of undifferentiatedstem cells (CD133), and acquired a matureendothelial cell phenotype. By using western blot andRT-PCR we demonstrated that this phenotype is characterizedby a high expression of VEGF receptor-2(VEGFR-2/KDR), factor-VIII-related antigen (FVIII-RA)and VE-cadherin. By using immunofluorescence, weshowed that this differentiation process went on slowlyin step with the culture. Actually, parallel to theendothelial antigen expression, cells adhered to thefibronectin, spread and acquired the typical endothelialcell shape. Finally, after about 20 days culture, differentiatedcells were able to form a capillary networkon Matrigel (capillarogenesis) upon a 24hour exposureto both VEGF and bFGF. In conclusion, our datasuggest that angiogenic VEGF and bFGF released byMM plasma cells may induce the differentiation ofhematopoietic CD133 + stem cells into endothelial cellsthat, near angiogenesis, contribute to the developmentof a tumoral vascular tree, thus promoting MMprogression and diffusion. These data confirm the usefulnessof antiangiogenic drugs, particularly the VEGFand bFGF inhibitors, in the therapeutic managementof MM.PO-081VINORELBINE, CYCLOPHOSPHAMIDE AND G-CSF AS MOBILIZA-TION REGIMEN FOR PATIENTS WITH MULTIPLE MYELOMACopia C, Pocali B, Schiavone EM, Annunziata M,Falco C,* Graziano D,* Ferrara FDivision f Hematology and Stem Cell TransplantationUnit; *Transfusional Medicine Service; CardarelliHospital, Naples, ItalyHigh dose cyclophosphamide (HD-CTX) is the mostcommonly used mobilizing regimen for patient withmultiple myeloma (MM). However, this regimenresults in substantial hematologic and extrahematologicaltoxicity, often needing hospitalisation. In addition,the time to collection is variable. Differentattempts have been made in order to investigate theefficacy and toxicity of alternative approaches aimingat collection of peripheral blood stem cells (PBSC)with reduction of side effects and costs of the procedure.Accordingly, we adopted a combination regimenbased on the combination of vinorelbine (VNB)and CTX. From July 2003 to April 2004, 25 consecutivepatients with MM received VNB 30 mg/m 2 intravenously(iv) on day 1 and CTX 1500 mg/m 2 /iv on day2, followed by G-CSF 10 µg/Kg/ from day 3 to CD34positive (CD34 + ) cells peak, all in an outpatient setting.The median age of patients was 57 (range 37-73) and the stage at diagnosis was II in all cases. In19 patients VNB-CTX was given as part of a first linetherapy after 3 courses of VAD with (n=6) or without(n=19) thalidomide. In 6 patients (25%) the VNB/CTXmobilization regimen was given after a second or furtherline of chemotherapy; of note, among these 4patient had been previously autografted. Collectionwas successful in 19/19 (100%) untreated patientand in 3 out of 6 (50%) pretreated cases, 1 of whichhad been previously autografted. The peak value ofCD34 + cells was observed after a median of 9 days(range 8-11). Overall, following mobilization a medianof 8.7 CD34 + cells (range 2.2-17.4) were collectedafter a median of two apheretic procedures (range 1-2). Of note, the median number of CD34 + cells collectedwas of 8.8 (1.22-15.36) for untreated patientsas compared to 4.4 (4.0-17.4) for pretreated. Therewere no episodes of grade 3-4 neutropenia or thrombocytopenia,while one patient required one packedrbc unit. Fever or hemorrhage did never occur, andthere was no episode of extrahematologic toxicity.Among 22 mobilizing patients, 18 did actually receiveautologous stem cell transplantation, while 4 arewaiting for the procedure. Hematopoietic recovery inautografted patients was fast with a median time toneutrophil and platelet recovery of 12 and 14 days,respectively. We conclude that VNB/CTX regimenresults in highly efficient mobilization of CD34 + cellin patients with MM and represents an appealingalternative to HD-CTX therapy. Major advantagesinclude predictable time for collection, negligible toxicity,feasibility on an outpatient basis, and consequentreduction of costs. Data on pretreated patientsneed to be comfirmed on larger series.haematologica vol. 89[suppl. n. 6]:september 2004

112PostersPosterMULTIPLE MYELOMA IIPO-082CURRENT ISSUES IN TOTAL BODY SCINTIGRAPHY WITHSESTAMIBI IN MULTIPLE MYELOMAPizzuti M, Fe A,* Attolico I, Filardi N, Vertone D,Mussolin l,* Nappi A,* Schiavariello S,* Martino L,*Ricciuti FU. O. di Ematologia, Ospedale San Carlo, Potenza; *U.O. di Medicina Nucleare, Ospedale San Carlo, Potenza,ItalyTotal Body scintigraphy with Technetium-99m Sestamibi(Mibi) has been used for many years to evaluatethe bone lesions of patients with MultipleMyeloma (MM) and since the early trials it has beencompared with skeletal radiology. We have evaluated58 patients with MM. Mibi scintigraphy was positive(score >2) in 44 patients, with a pattern ofuptake diffuse (D) in 32, focal (F) in 2, diffuse + focal(D+F) in 10.The score correlated with stage, plasmacells invasion and monoclonal protein. Mibi scintigraphywas positive more often than skeletal X-ray,but not all the bone lesions showed by X-Ray correspondto zones of higher Mibi uptake. Comparison toMagnetic Resonance Imaging (MRI) showed that adiffuse uptake pattern did not always correspond toosteolytic areas. This is due to the fact that Mibiscintigraphy is based on cell metabolism whereas theother imaging methods account for structural lesions.Moreover, Mibi did not prove effective in identifyingsmall lesions ( 4 had an aggressive disease(resistance to treatment, early relapse). The role ofscintigraphy with Sestamibi in follow up is betterdefined. The average score of our patients respondingto treatment decreases from 4.2 to 2.8.In resistantpatients it does not change. After relapse it goesback to the levels measured at diagnosis. This correlationis particularly useful in not secreting MM. Weguess a correlation between a fast wash out of Mibifrom neoplastic plasma cells and expression ofP170.In 12 patients with score > 4 we performed asecond scan after 2 hours, comparing the score on thecervical dorsal spine and normalizing by the half lifeof Mibi. In 8 cases the wash out was >50%. It is tooearly to draw conclusions on these preliminaryresults. 5 of the 8 patients with a fast wash out havebeen treated with Thalidomide and 4 of themobtained a good response. We might guess thatThalidomide activity is not influenced by the excretionmechanisms of the cells, linked to P170 expression,that cause the premature wash out of Mibi. Thescintigraphy with Mibi can support conventionalimaging methods to provide indications for prognosisand response to therapy in patients with MM. Afast wash out of Mibi could correlate with resistanceto chemotherapy but not with response to Thalidomide.Total Body scintigraphy with Technetium-99mSestamibi (Mibi) has been used for many years toevaluate the bone lesions of patients with MultipleMyeloma (MM) and since the early trials it has beencompared with skeletal radiology. We have evaluated58 patients with MM. Mibi scintigraphy was positive(score >2) in 44 patients, with a pattern ofuptake diffuse (D) in 32, focal (F) in 2, diffuse + focal(D+F) in 10.The score correlated with stage, plasmacells invasion and monoclonal protein. Mibi scintigraphywas positive more often than skeletal X-ray,but not all the bone lesions showed by X-Ray correspondto zones of higher Mibi uptake. Comparison toMagnetic Resonance Imaging (MRI) showed that adiffuse uptakePO-083BORTEZOMIB (VELCADE) AS SALVAGE THERAPY FORADVANCED MULTIPLE MYELOMA: A MULTICENTRE SURVEY OFITALIAN PATIENTS TREATEDOUTSIDE OF CLINICAL TRIALSMusto P, Cascavilla N, Spriano M,* Zambello R,°°Guglielmelli T,^ Catalano L,** Balleari E,° Falcone A,Sanpaolo G, Bodenizza C, La Sala A, Mantuano S,Scalzulli P, Nobile M, Dell'Olio M, Melillo L, GrecoM, Beltrami G, Carella AM Jr, Carella AM*Hematology and Stem Cell Transplantation, IRCCS"Casa Sollievo della Sofferenza", S. Giovanni Rotondo;Hematology* and DIMI,° S. Martino Hospital,Genova; Clinical and Experimental Medicine, Universityof Padova;°° Hematology, S. Luigi GonzagaHospital, Orbassano;^ Chair of Hematology, FedericoII University, Napoli*, Italy*Bortezomib (VELCADE, formerly PS-341, Millennium)is a novel first-class agent that inhibits the proteasome,a multicatalytic cellular enzyme whoseactivity entails several molecular mechanisms,including, in particular, the NF-κB pathway. Recentphase I-II clinical trials have demonstrated the efficayhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004113of bortezomib in about one-third of patients withrefractory-relapsed multiple myeloma. Other phaseIII studies are in progress or have been recently concluded.We reviewed the current experience of sixItalian Institutions in which myeloma patientsreceived (or are still receiving) bortezomib as salvagetreatment. Twenty-four patients affected by multiplemyeloma (14 males, 10 females; mean age 62 years,range 44-78), relapsed (n. 9) or resistant (n. 15) after2-8 lines of treatment, were recorded. Fifteenpatients had previously undergone single or tandemautologous stem cell transplantation, while 22patients had also received thalidomide. One patientwas in progression after non-myeloablative allogeneictransplantation. In 18 patients bortezomibwas given at the dose of 1.3 mg/m 2 body surfacetwice weekly for two weeks, followed by 10-12 dayswithout treatment (one cycle). One patient alsoreceived dexamethasone and one patient dexamethasoneplus thalidomide. A reduced dose of 0.8mg/m 2 was administered in seven subjects receivingconcomitantly liposomal-doxorubicin (12 mg/m 2 ) anddexamethasone (20 mg for 4 days) every cycle. A totalnumber of 60 cycles was administered (range 0.5-6per patient). Two patients with very advanced diseaseand relevant co-morbidities died of cardiac failureand cerebral hemorrhage, respectively, after thefirst two doses. Three additional patients died of progressivedisease during or shortly after bortezomibtreatment. Grade 3-4 WHO hematological toxicity(mainly thrombocytopenia) occurred in four patients,determining the need of reducing or temporarilystopping the treatment. Fungal pneumonia (candida)was observed in a patient receiving combinedtherapy. Four patients experienced minor infections.In another patient a cutaneous leucocytoclastic vasculits(diagnosed by skin biopsy) developed underbortezomib therapy. Diarrhoea, constipation, somnolence,nausea, vomiting, fever, bone pain and mildneurological symptoms were observed in elevenpatients. So far, fourteen patients are evaluable forresponse. According to Bladè criteria, one patientachieved complete remission (CR), which lasted twomonths, nine patients obtained partial remission (PR),four patients evidenced stable (SD) or progressive(PD) disease. Six patients with PR maintain theirresponse after 2-9 months. In one of them, relapsedafter double autologous stem cell tranplantation, aprogram of unrelated, non-myeloablative stem celltransplantation could be started after response tobortezomib. In 3 patients with PR the disease relapsedafter 4-6 months. Responding patients also had evidenceof improved hemoglobin values, performancestatus, quality-of life and levels of non-involvedimmunoglobulins. As of May 30, 2004, 17 patientsare alive and 12 out of them are still on bortezomibtherapy. Updated results will be presented at theMeeting. Our data confirm that bortezomib may representan effective treatment for patients withrelapsed/resistant myeloma. The role of this drug insubjects with less advanced disease, in particular asfront-line or maintenance therapy, alone or in combinationwith other agents, warrants to be explored.PO-084IN VITRO GENERATION OF ANTIMYELOMA ACTIVITY BY ZOLE-DRONIC ACID: ROLE OF EFFECTOR (CD45- CD27-) γδ T CELLSMuraro M, 1 Mariani S, 1 Pantaleoni F, 1 Foglietta M, 2Fiore F, 2 Nuschak B, 1 Peola S, 1 Castella B, 1 CosciaM, 2 Boccadoro M, 2 Massaia M 1,21Laboratorio di Ematologia Oncologica, Centro diRicerca in Medicina Sperimentale, 2 Divisione diEmatologia dell’ Università di Torino, Dipartimentodi Medicina ed Oncologia Sperimentale, OspedaleSan Giovanni Battista, Turin, ItalyThe role of innate effector cells such as macrophages,NK cells, NKT cells and γδ T cells in naturaltumor immunity and tumor immunotherapy hasrecently been revisited. Circulating V γ 9 / V δ 2 T cells (1-5% of peripheral blood T cell) are naturally activatedby aminobisphosphonates (NBPs), a new class of drugscommonly used in MM and other cancer patients toeffectively prevent osteoclast activation and skeletalrelated events. The aim of this work was to investigatethe immunomodulatory properties of zoledronic acid(Zol), the most potent NBP clinically available. Wehave investigated in 45 normal donors and 45 MMpatients the in vitro reactivity of gammadelta T cellsto Zol. Zol induces a rapid expansion (7 days) of gammadeltaT cells in normal donors and MM patients inthe presence of very low doses of IL-2. However, themean total number of γδ T cells was lower in MMpatients. This reflected the presence of 50% of MMpatients whose γδ T cells did not proliferate to Zol[non-responders (NR)]. Unexpectedly, the antitumoractivity generated by Zol against myeloma cell linesand primary myeloma cells was similar in NR and MMpatients whose gammadelta T cells proliferated to Zol[responders (R)]. Depletion and blocking experimentsshowed that antimyeloma activity was strictly dependenton gammadelta T cells in R and NR. Phenotypingshowed that R and NR had distinct distribution inmemory (CD45RA- CD27 + ) and effector (CD45RA-CD27-) γδ T cells. The former were the predominantsubset in R, whereas the latter were the predominantsubset in NR. Memory γδ T cells display high proliferativecapacity and low effector function, whereaseffector gammadelta T cells show the opposite pattern.This can explain why R and NR have differentproliferative capacites, although they have the samecapacity to generate antitumor activity. In conclu-haematologica vol. 89[suppl. n. 6]:september 2004

114Posterssion, the immunomodulatory activity of Zol is mainlymediated by the effector subset of γδ T cells.PO-085EFFECTS OF ZOLEDRONIC ACID ON MARROW MICROENVIRON-MENT IN MULTIPLE MYELOMACorso A, Ferretti E, Lunghi M, Zappasodi P,Mangiacavalli S, De Amici M,* Rusconi C, VarettoniM, Lazzarino MDivision of Hematology, and Laboratory ofimmuno-allergology, Dept. of Pediatrics*, IRCCSPoliclinico San Matteo, University of Pavia, ItalyIn multiple myeloma (MM) plasma cells localizewithin the bone marrow interacting with the stromalcells through the expression of cell-surface adhesionmolecules. These induce myeloma cells growth mediatedby autocrine and paracrine production of severalcytokines (IL-6, IL1-β, TNF-α, etc. ). The aim of thisstudy was to investigate the capacity of zoledronicacid (Zol) to interfere in vitro with bone marrow stromalcells (BMSCs) from patients with MM. The effectof Zol on BMSCs proliferation was analysed usingMTT assay. After 3 days of treatment Zol caused adose-dependent decrease of cell number (p

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004115present between the percentage of plasma cell bonemarrow infiltration and the eosinophil count or theentity of its increase. Furthermore, no difference inthe eosinophil count or in the magnitude of increasewas observed among the different degree of response(from minimal to complete response). Finally, none ofthe thalidomide's side effects was correlated to theeosinophilia. In conclusion, our evaluation in patientstreated with a combination of Thalidomide, Dexamethasoneand Cyclophosphamide indicates that thistreatment might work through stimulation ofimmune system that in turn could be responsible forthe increase of sCD30 and eosinophils but the relationshipbetween these modifications and the efficacyof the treatment remains to be clarified.PO-087USE OF PERCUTANEUS KYPHOPLASTY FOR PAINFUL VERTE-BRAL BODY FRACTURES IN PATIENTS WITH ONCO-HEMATOLOG-ICAL DISEASESPostorino M,* Franceschini l,* de Laurenzi F,*Buccisano F,* Giannì L,* Renzi D,* Faccia S,* Ales M,*Cerretti R,* De Angelis G,* Masala S,° Fiori R,°Arcese WG,* Cantonetti M,* Amadori S**Chair of hematology and,°Department of Diagnosticsfor Images and Interventional Radiology, PoliclinicoTor Vergata, University Tor Vergata of Rome,ItalyVertebral fractures are the most important sourceof morbidity in patients with multiple myeloma (MM)and one of the most disabling effect of a prolongedcorticosteroid therapy for haematological patients(pts). Non-operative treatments such as cytotoxicdrugs and radiotherapy (in patients with MM) oranalgesic medications and bisphosphonates (in allpatients) are increasingly used but any of theseagents is effective in relieving pain in all cases. Surgicalmanagement generally involves vertebrectomyand reconstruction with PMMA (polimetilmetacrylate)bone cement, but this technique is not suitablefor the treatment of patients with multifocal vertebrallesions. Another treatment for vertebral fracturesis the vertebroplasty that involves the percutaneousinjection of PMMA into a fractured vertebral body;however this procedure does not reexpand a collapsedvertebra, it can just reinforce and stabilizefracture and it is often related to leakage of PMMAthrough cortical defects, with epidural compressionof neural elements. A recent modification of vertebroplastyis the percutaneous balloon kyphoplasty(PBK): under general anesthesia, a 13-gauge needleis introduced trough a small dermatotomy andadvanced to the posterior aspect of each pediclealong its superolateral cortex; the needle is directed,medially and caudally through the pedicle; then,using a hand-mounted drill, bilateral channels arecreated to reach the posterior tract of VB. Throughthe channel a high-pressure balloon is introducedand inflated to reduce the VB back to its originalheight; the cavity so obtained is subsequently filledwith the PMMA. Balloon inflation and the PMMA fillingwere performed under fluoroscopy vision.Between March and December 2003 we underwent7 patients to percutaneous kyphoplasty: 4 pts wereaffected by MM and 3 pts were affected by Lymphomanon Hodgkin, with vertebral fractures aftercorticosteroid therapy. In the group of pts with MMmedian age was 72 years (range 70-83), the averageof vertebral fractures for patient was 2 (range 1- 4)and the pts with multiple fractures underwent 2treatments; in this group, the pre-treatment Karnofskyperformance status was 40 ( range 60-30) andVAS-score (pain score with points assigned subjectivelyby the patients in a range 0, absence of pain,and 10, maximum pain) was 9 (range 8- 10), respectively;after treatment Karnofsky grade and VASscorewere 80 (range 50-90) and 2 ( range 2-5),respectively. In the group of pts with lymphomamedian age was 65 years (range 60-73) and they presentedan isolated vertebral fracture; before treatmentin the Karnofsky performance status grade was50 (range 50-60) and VAS-score was 8; after treatmentKarnofsky grade and VAS-score were 90 and 2,respectively. In conclusion, kyphoplasty was effectivein relieving pain and improving life quality of thepatients. Moreover in pts with MM the exothermicreaction of PMMA injected into the vertebral bodymay contribute to the effect of the procedure. Thesafety and efficacy of this procedure needs to be evaluatedin a larger number of patients.PO-088DOWN-MODULATION OF ERK PROTEIN KINASE ACTIVITYINHIBITS VEGF SECRETION BY HUMAN MYELOMA CELLSGiuliani N,* Lunghi P,° Morandi F,* Colla S,*Bonomini S,* Hojden M,* Rizzoli V,* Bonati A°*Cattedra di Ematologia,; °Dipartimento di ScienzeCliniche, Università di Parma, ItalyThe mitogen-activated protein (MAP) cascade leadingto the activation of Extracellular signal-RegulatedKinases 1/2 (ERK1/2) is critical for regulatingmyeloma cell growth, however the relationship ofERK1/2 activity with Vascular Endothelial Growth Factor(VEGF) production and the effects of its downmodulationin myeloma cells are not elucidated. Inthis experimental study we found that the treatmentwith MAP/ERK Kinase 1 (MEK1) inhibitors PD98059 orPD184352 produced a reduction of phospho-ERK1/2haematologica vol. 89[suppl. n. 6]:september 2004

116Posters(p-ERK1/2) levels in myeloma cells of more than 80%and prevented the increase of p-ERK1/2 induced byIL-6.MEK1 inhibitors also induced a significant inhibitionof myeloma cell proliferation and blunted thestimulatory effect induced by IL-6.A significant inhibitionof basal VEGF secretion by myeloma cells aloneor in a co-culture system and the suppression of thestimulatory effect of IL-6 on VEGF has been observedby either PD98059 or PD184352 Moreover, we foundthat the PI3K kinase inhibitors but not p38 MAPKinhibitors reduced VEGF secretion by myeloma cellsand increase the inhibitory effect of MEK1 inhibitors.In an in vitro model of angiogenesis, we demonstratedthat MEK1 inhibitors impair vessel formationinduced by myeloma cells and restored by VEGF treatment,suggesting that the down-modulation ofERK1/2 activity reduces myeloma-induced angiogenesisby inhibiting VEGF secretion.PO-089T CELL-REGULATION OF OSTEOCLAST FORMATION AND SUR-VIVAL INVOLVING OPG/TRAIL INTERACTION IN AN IN VITROMODEL FROM HUMAN MULTIPLE MYELOMAColucci S, Rizzi R,* Brunetti G, Mori G, Colaianni G,Liso A,° Capalbo S,* Liso V,* Zallone A, Grano MDepartment of Human Anatomy and Histology,*Hematology Section, Department of Internal Medicineand Public Medicine, University of Bari MedicalSchool, Bari, Italy, °Hematology Section, Departmentof Medicine, University of Foggia, Foggia, ItalyMultiple myeloma (MM) is a B-cell neoplasm characterizedby clonal expansion of malignant plasmacells in bone marrow (BM), with frequent occurrenceof lytic bone disease resulting from an enhanced boneresorption, related to increased osteoclast (OC)recruitment and activity and low bone formation. Theinteraction between MM cells and BM microenvironmentis essential for maintenance and progressionof the disease process. On the basis of the novel paradigmfor T cells as regulators of bone turnover, weinvestigated the potential involvement of MM T cellsand their expression of the major mediators of osteoclastogenesis.Therefore, we performed in vitro studiesusing unfractionated peripheral blood mononuclearcells (PBMCs) derived from 32 MM patients, and32 subjects with nonneoplasic disease lacking anyskeletal involvement as controls; parallel T celldepletedPBMC cultures from the MM patients wereestablished as well. In the unstimulated unfractionatedPBMC cultures from the MM patients with lyticbone lesions, we detected the spontaneous formationof numerous large TRAP+ bone resorbing OCswith a longer survival whereas in the same type ofculture derived from the MM patients without osteolysisand controls, we demonstrated smaller andfewer OCs not exhibiting a longer survival. On theother hand, in T cell-depleted MM PBMC cultures,exogenous macrophage-colony stimulating factor(M-CSF) and receptor activator of nuclear factor(NF)-kB (RANKL) were necessary to the formation ofOCs, not displaying however a longer survival. Ourcultures represent a good in vitro model to study theeffect of MM T cells on osteoclastogenesis, being aMM and stromal cell-free system. RANKL appeared tobe the major osteoclastogenic cytokine involved inthe spontaneous OC formation, as confirmed by theinhibitory effect exerted on it by RANK-Fc. BesidesRANKL, we detected the overexpression of osteoprotegerin(OPG) and TNF-related apoptosis inducing ligand(TRAIL) by fresh T cells isolated from the MMpatients with lytic bone disease, at both mRNA andprotein levels. All these cytokines were alsodetectable in the media collected from the unfractionatedPBMC cultures. OPG is a soluble decoyreceptor of TRAIL that competes with RANKL forbinding to TRAIL, whose antagonizes the osteoclastogeniceffect preserving the bone mass. In our culturesystem the persistence of osteoclastogenesisoccurring in the presence of T cells, despite the highlevels of OPG, could be explained by OPG binding toTRAIL, that may be favoured by the elevated TRAILlevels detected in the media. Moreover, neutralizinganti-TRAIL antibodies caused a dose-dependent inhibitionof the spontaneous osteoclastogenesis, thatrecurred after the addition of exogenous RANKL.Thus, OPG/TRAIL interaction could inhibit both OPGanti-osteoclastogenic activity and TRAIL apoptosisinducingactivity. Our findings indicate a T cell-regulationof MM OC formation and survival throughRANKL, OPG and TRAIL overexpression, possiblyinvolving OPG/TRAIL interaction.PO-090IDENTIFICATION OF A NOVEL IGH-MMSET FUSION TRANSCRIPTIN A HUMAN MYELOMA CELL LINE WITH T(4;14) CHROMOSO-MAL TRANSLOCATIONIntini D,* Fabris F,* Storlazzi CT, + Otsuki T, § Ciceri G,*Verdelli D,* Lombardi L,* Mariano Rocchi M, + Neri A**Laboratorio di Ematologia Sperimentale e GeneticaMolecolare, U. O. Ematologia 1, Dipartimento diScienze Mediche, Università degli Studi di Milano,Ospedale Maggiore IRCCS, Milan; + DAPEG, SezioneGenetica, Università di Bari, Italy; § Department ofHygiene, Kawasaki Medical School, Kurashiki,Okayama, JapanOver the last few years, it has been shown that IGHtranslocation involving a wide range of partner lociare frequent events in plasma cell dyscrasias, beinghaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004117present in approximately 50% of monoclonal gammopathyof uncertain significance, 60% of intramedullarymultiple myeloma (MM), 70-80% ofextramedullary form, and virtually all of humanmyeloma cell lines. The most frequent and well characterisedIGH translocations include the t(11;14)(q13;q32), t(4;14)(p16.3;q32), t(14;16) (q32;q23) andt(6;14)(p21;q32) involving CCND1, FGFR3 andMMSET/WHSC1, MAF and CCND3 genes, respectively.Three newly established human myeloma cell lines(KMS26, KMS28BM and KMS34) have recently beenfound to express high levels of FGFR3 transcripts byRT-PCR. The evidence of FGFR3 expression promptedus to investigate the presence of t(4;14) in these celllines using dual-colour FISH and RT-PCR. The dissociationof the signals specific for FGFR3 and MMSETand association of FGFR3 and the constant regions ofIGH locus were detected in all three cell lines. Thepresence of IGH-MMSET fusion transcript was investigatedby means of the RT-PCR using ms6r primercoupled with JH or Imu1 primers. The KMS34 andKMS26 cell lines showed IGH-MMSET fragments similarto those expected in the MB4-1 and MB4-3 typebreakpoints. In the KMS28BM, an IGH-MMSET fragmentsmaller than that specific for the MB4-3 wasdetected with either JH-ms6r or Imu1-ms6r primers.The direct sequencing of this fragment revealed thepresence of MMSET exon 6 sequences, but theabsence of the entire MMSET exon 5, suggesting theoccurrence of a novel breakpoint within intron 5 ofthe gene. The cloning of a genomic IGH rearrangedfragments resulting in the translocation revealedthat: 1) the switch mu region was joined to a switchγ1 sequence, thus suggesting that the recombinationevent between the IGH and 4p16.3 occurred after alegitimate class switch recombination; 2) the 4p16.3sequence juxtaposed to switch γ1 was derived froma MMSET region located upstream of untranslocatedexon 1 (295 bp upsteam of the KMS11 breakpoint).Further analyses revealed that the 4p16.3 breakpointwas followed by an internal deletion of 13141nucleotides involving MMSET sequences containingtranslated exons 3-5.This novel fusion transcript representsa rare event since it was not detected in 8HMCLs and 26 primary MMs with the t(4;14) investigatedin our laboratory.PO-091MOLECULAR AND BIOLOGICAL CHARACTERIZATION OF THREENOVEL INTERLEUKIN-6 DEPENDENT HUMAN MYELOMA CELLLINES (CMA-01; CMA-02; CMA -03)Verdelli D,* Fabris S,* Nobili L,* Guerneri S, + BaldiniL,* Maiolo AT,* Lombardi L,* Neri A**Laboratorio di Ematologia Sperimentale e GeneticaMolecolare, U. O. Ematologia 1, Dipartimento diScienze Mediche, Università degli Studi di Milano,Ospedale Maggiore IRCCS; + Laboratorio di GeneticaMedica, Istituti Clinici di Perfezionamento, Milan,ItalyHuman multiple myeloma cell lines (HMCLs) representa very useful tool in the characterization ofprimary myeloma cells and in the understanding ofsome biological features of multiple myeloma (MM)such as interaction with growth factors, involvementin angiogenesis processes, response to anticancerdrugs. Moreover, in the last years several chromosometranslocations affecting the immunoglobulinloci (Ig) have been identified by molecular analysis inHMCLs. We report the establishment of three novelHMCLs (CMA-01; CMA-02; CMA-03) derived frommalignant plasma cells at the extra-medullary phaseof the disease. Peripheral mononuclear cells were culturedin IMDM supplemented with 10% FCS and20U/ml recombinant human IL-6.After 30-40 daysthe cells started to grow and they are still maintainedin the same culture conditions. The three cell lineswere Epstein-Barr virus negative. Immunophenotypicanalyses were performed by mean of FACSCaliburflow cytometry. In particular, all cell lines showed abright expression of CD138 while CD126 is expressedat variable levels. CMA-01 cells expressed cytoplasmicand surface IgD lamnda, CMA-02 expressed IgGkappa and CMA-03 expressed IgA kappa. Expressionof CD45, CD56, CD20, CD19 and CD117 was alsoanalysed. Cytogenetic analysis revealed a hypotetraploidcomplex karyotype with many numerical andstructural abnormalities in all cell lines. FISH analysiswas performed in order to investigate the presenceof the most frequent translocations involving the IGHlocus, found in MM. Using specific probes we detectedt(11;14)(q13;q32.3) in CMA-01 and t(14;16)(q32.3;q23) in CMA-02 deregulating Cyclin D1 andMAF genes, respectively. The t(8;14)(8q24;q32),involving the MYC locus, was present in all the threecell lines in complex chromosomal rearrangements.To characterize the proliferation pattern of the celllines we analysed the growth curve and DNA distribution,the IL-6 dependency and the cloning efficiencyin soft agar. The population doubling time wasevaluated from the growth curve of cells exponentiallyproliferanting and was estimated as 72, 110 and84 hours, in CMA-01, CMA-02 and CMA-03 respectively.The cells grow at low saturation density (5×10 5cells/mL) and are strictly dependent on IL-6 presencein culture medium. A low but appreciable cloningefficiency (about 1%) was detected in all three celllines.haematologica vol. 89[suppl. n. 6]:september 2004

118PostersPO-092ROLE OF THE MEVALONATE PATHWAY IN THE IMMUNOMODULA-TORY ACTIVITY OF ZOLEDRONIC ACIDPantaleoni F, 1 Mariani S, 1 Muraro M, 1 Peola S, 1Nuschak B, 1 Foglietta M, 1,2 Castella B, 1 Fiore F, 1,2Coscia M, 1 Boccadoro M, 2 Massaia M 1,21Laboratorio di Ematologia Oncologica, Centro diRicerca in Medicina Sperimentale, 2 Divisione diEmatologia dell’ Università di Torino, Dipartimentodi Medicina ed Oncologia Sperimentale, OspedaleSan Giovanni Battista, Turin, ItalyThe mevalonate pathway yields to the synthesis ofcholesterol, farnesyl pyrophosphate (FPP) and geranylgeranylpyrophosphate (GGPP). FPP and GGPP playa key role in protein isoprenylation. This consists in thecovalent transfer of farnesyl and geranyl geranylgroups from FPP and GGPP to regulatory proteins. Afterisoprenylation, proteins such as Ras, Rho and Ractranslocate to the inner surface of plasma membraneand exert their regulatory activity on several cell functions.Zoledronic acid (Zol) is a potent inhibitor of FPPsynthase. Zol belongs to the family of aminobisphosphonates(NBP) and is clinically used to treat bonelesions in multiple myeloma (MM) and other cancers.Inhibition of FPP synthase by Zol induces the intracellularaccumulation of mevalonate metabolites such asisopentenyl-pyrophosphate (IPP). It has been shownthat exogenous IPP activates the small subset of circulatinggamma/delta T cells expressing the Vgamma9/Vdelta2TCR. These are innate effector cells withthe capacity to naturally recognize microbic compounds,structurally related to IPP. Upon activation,γ/δ T cells exert cytotoxic activity against a variety ofpathogens and certain tumor cells of hematopoieticorigin. We have recently shown in normal donors andMM patients that Zol induces the proliferation of naiveand memory gamma/delta T cells and the activation ofeffector γ/δ T cells. The aim of this work was to explorethe role of the mevalonate pathway in the immunomodulatoryactivity of Zol. In the first series of experiments,peripheral blood mononuclear cells (PBMC)from normal donors and MM patients were incubatedfor 7 days with 1 micromolar Zol and 10 units/ml ofinterleukin-2 (IL-2) in the absence or in the presenceof Mevastatin (Mev). Mev is a specific inhibitor ofhydroxyl-methylglutaryl coenzyme A reductase(HMGR), the key enzyme in the mevalonate pathway.We have found that Mev at concentrations rangingfrom 25 to 1 micromolar completely abrogated thecapacity of Zol to induce the proliferative expansion ofmemory γ/δ T cells, and the generation of antitumoractivity in effector γ/δ T cells. These data indicate thatthe immunomodulatory activity of Zol is dependenton the mevalonate pathway of PBMC. Next, we askedwhether Zol also targeted the mevalonate pathway intumor cells. It has recently been proposed that tumorcell lines of hematopoietic origin have an increasedHMGR activity which can be sensed by innate immunity,namely gamma/delta T cells. To address this issue,we have incubated several myeloma and lymphomatumor cell lines with Zol for 18 hours and then mixedwith PBMC and cocultured for 4 days in the presenceof Zol and IL-2. On day 5, total counts of residualtumor cells were scored. We have observed that a briefexposure to Zol renders tumor cells able to induce theproliferation of memory gamma/delta T cells andgreatly enhances their sensitivity to the effector functionsof γ/δ T cells. When tumor cells were incubatedwith Zol in the presence of Mev, they became resistantto the effector functions of gamma/delta T cells. Thus,the immunomodulatory activity of Zol is also dependenton the mevalonate pathway of tumor cells. Interestingly,Zol-treated tumor cell lines showed differentsensitivity to T cells, suggesting that this pathway canhave different levels of activity in tumor cells and playa role in host immune recognition.PO-093RANDOMIZED STUDY OF ZOLEDRONATE VS OBSERVATION INPATIENTS WITH EARLY-STAGE, ASYMPTOMATIC MYELOMA: ANINTERIM REPORTMusto P, Falcone A, Guglielmelli T,^ Caravita T,*Niscola P,° Balleari E,°° D'Arena G,** Sanpaolo G,Bodenizza C, La Sala A, Mantuano S, Scalzulli P,Nobile M, Dell'olio M, Melillo L, Greco M, BeltramiG, Carella M, Cascavilla NHematology and Stem Cell Transplantation, IRCCS"Casa Sollievo della Sofferenza", S. Giovanni Rotondo;Hematology, S. Luigi Gonzaga Hospital, Orbassano;^Chair of Hematology, Tor Vergata University,Rome*: Hematology, Montefiascone Hospital;° DIMI,S. Martino Hospital, Genova;°° Hematology, Vallodella Lucania Hospital**, ItalyWe have recently reported that prophylacticadministration of pamidronate, a second generationbisphosphonate, is not useful to prevent or delay diseaseprogression in patients with untreated, earlystagemyeloma, although this treatment may reducethe number of cases developing skeletal events, thuspossibly changing the clinical manifestations of thedisease at progression (Musto et al. , J Clin Oncol2003; 21:3177-8, Musto et al. , Leuk Lymphoma 2003;44:1545-8). However, no data are currently availableabout the role of zoledronate, a more potent, thirdgeneration bisphosphonate, in this specific setting ofpatients. Therefore, on June, 2001, we started a randomized,multicentre trial to compare the effects ofone-year administration of zoledronate as singletherapy vs simple observation in asymptomatichaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004119patients with monoclonal gammopathy fulfilling thediagnostic criteria of stage IA, IIA or smoulderingmyeloma, without evidence of bone lesions. Patientsstrictly diagnosed as having true MGUS were excluded.The aim of this study was to establish whetherzoledronate may influence rate, time to and type ofprogression in these otherwise untreated patients. Asof May, 2004, seventy-four patients (40 males, 34females; mean age 67.4 years, range 41-85) havebeen enrolled and randomized (1:1) to receive (n. 37)or not (n. 37) zoledronate (Zometa, Novartis Pharmaceuticals,Origgio, Italy) for one year or until progression,on an out-patient basis, at the dose of 4 mgas 15' i. v. single monthly infusion. Current medianfollow-up is 18 months. Until now, no severe adverseevents have been recorded during the study. In theobservational arm two patients were lost at followupafter six and twenty months, respectively. Asymptomatchypocalcemia, without need of interruptingthe treatment and promptly corrected by substitutivetherapy, occurred in nine of patients receiving zoledronate.To-date, no relevant reduction of M-componentor marrow plasmocytosis has been observed.There have been four (10.8%) progressions requiringtreatment in the group receiving zoledronate andseven (18.9%) within the controls. Median time-toprogressionwas 19 and 15.3 months, respectively.Among the eleven patients who required chemoradiotherapyduring follow-up in both arms, bonelesions and/or hypercalcemia at the time of progressionwere observed in 5/7 of controls, and in 1/4 ofpatients treated with zoledronate. Thus, in this interimanalysis, a slight trend in favour of zoledronatearmwas seen. The next evaluations of our trial,including a larger number of patients with prolongedfollow-up, could clarify whether the use of zoledronatemay really contribute to modify the naturalhistory of these patients.PO-094THE COMBINATION OF THIOTEPA, FLUDARABINE AND MELPHA-LAN IS EFFECTIVE AS REDUCED INTENSITY CONDITIONIG FORALLOGENEIC TRANSPLANTATION IN MULTIPLE MYELOMAMajolino I, Gabriel Arana M, Riccardi M, LocasciulliA, Bacigalupo A, Di Bartolomeo P, Scimé R, OlivieriA, Narni F, Bregni M, De Fabritiis P, Musso M,Corradini P, from GITMOOspedale S. Camillo, Rome; Ospedale S. Martino,Genova; Ospedale Civile, Pescara; Ospedale V. Cervello,Palermo; Ospedale di Torrette, Ancona; Policlinico,Modena; H. San Raffaele, Milano; Ospedale S.Eugenio, Rome; Clinica La Maddalena, Palermo; IstitutoNazionale Tumori, Milan, ItalyWe have demonstrated that allogeneic transplantationis able to induce clinical and molecular remissionin a high proportion of MM patients (Bone MarrowTransplant 2003;31:767-73). However, standarddoseconditioning still results in a high TRM. Toreduce mortality, a low-intensity conditioning of fludarabine3×30 mg/m 2 , thiotepa 10 mg/kg and melphalan80 mg/m 2 with HLA-identical sibling stem celltransplantation was designed. GVHD prophylaxis islow-dose MTX plus CSA, but the latter is rapidlytapered following transplantation. PCR analysis forIgH gene rearrangement is employed for MRD investigation.Up to now, 34 patients (38-68 y, median 53)were allografted, at 3-123 mo from diagnosis (median11), 21 of them as late treatment after single(n=12) double (n=8) or triple (n=1) autograft and 12as part of their front-line treatment, following adebulking with only 3-4 courses of VAD. At the timeof conditioning, 8 were in CR, 17 in PR, 4 were refractoryand 5 had progressive disease. They received5.5×10 6 /Kg (median) CD34 + cells (range 1.6-10.6),and 2.8×10 8 /Kg CD3 + cells (range 0.4-6.1) from BM orG-CSF-primed PB. Engraftment occurred in all, with14 days to >0.5×10 9 /L granulocytes (range 10-17)and 12 days to >20×10 9 /L platelets (range 4-21).aGVHD >grade I developed in 43% of evaluable pts,but it never was > grade II. cGVHD developed in 68%.Transplant response was assessed at day +90.19 outof the 27 (70%) evaluable pts were in CR, includingthe 9 who were already in CR at the time of allograft,while 5 acquired only a PR. Only 2 pts died for transplant-relatedcauses (TRM=6%). Four patientsrelapsed and four are in progression after partialremission. 22 patients are currently alive at a medianFU of 9.6 mo, 13 of them in continuous CR. OS is57% and EFS is 30% at two years. Reduced-intensityconditioning with fludarabine, thiotepa and melphalanis well tolerated even in patients with previousautograft(s) and ensure a good remission of disease.Data of IgH-gene rearrangement are being producedand will possibly shed light on the significanceof CR after this treatment.PO-095PROGNOSTIC ROLE OF MINIMAL RESIDUAL DISEASE INMULTIPLE MYELOMA PATIENTS AFTER NON-MYELOABLATIVEALLOGENEIC TRANSPLANTATIONGalimberti S, 1 Benedetti E, 1 Morabito F, 2 Papineschi F, 1Callea V, 3 Fazzi R, 1 Stelitano C, 3 Andreazzoli F, 1Guerrini F, 1 Ciabatti E, 1 Martino M, 2 Nobile F, 3Iacopino P, 2 Petrini M 11Department of Oncology, Transplant and Advancesin Medicine, Section of Hematology, University ofPisa; 2 Bone Marrow Transplant Unit, and 3 HematologyUnit, Hematology Department, A. O. ReggioCalabria, Italyhaematologica vol. 89[suppl. n. 6]:september 2004

120Postershis study evaluates the prognostic value of molecularmonitoring of minimal residual disease (MRD) in20 patients with multiple myeloma (MM) treated bya tandem transplant program. The therapeutic strategyincluded autologous transplantation (PBSCT) followedby non-myeloablative allogeneic transplant(NMT). Half of patients were conditioned with fludarabineand cyclophosfamide and the remainingcases with fludarabine and low-dose TBI. All patientscompleted their program and engrafted; 9 patients(45%) developed aGVHD (grade 1-4) during the first42 days of follow-up. Six patients (30%) developedcGVHD at a median of 145 days, with two cases thatdeveloped extensive cGVHD. After a median followupof 35 months, 7 patients (35%) had died, 3 ofthem because of disease progression. Actuarial incidenceof transplant-related mortality (TRM) was20%, with no significant correlation with GVHD. Theoverall PFS at 24 months from the NMT was 51%. Inunivariate analysis, a shorter PFS was associated withadvanced stage at diagnosis (p=0.03) and with failureof PBSCT (p=0.048). The allogeneic procedureresulted offer a higher MRD eradication rate thanautologous transplantation: after PBSCT, only 3patients (15%) achieved PCR-negativity, versus 11(61%) after NMT. The IgH rearrangement, evaluatedby fluorescent PCR, was adopted as surrogate forMRD status. MRD after allogeneic graft did not significantlycorrelate either with clinical response orwith chimerism. Seventy-five percent of patientsachieved full donor chimerism, which was more frequentlyobserved in cases presenting cGHVD (p=0.01)and positively associated with overall survival (OS).The eradication of MRD had a favorable impact on 2-year OS. In fact, 76% of patients with no detectableMRD were still alive versus 34% of persistently IgHpositivecases (p=0.03). Finally, MRD did significantlycorrelate with disease progression, considering thatall progressed cases resulted PCR-positive versus 43%of patients with stable disease (p=0.02). These datasustain the relevant role of molecular monitoring inMM patients undergoing NMT. MRD monitoringwould assist physicians in making additional therapeuticdecisions to better control this haematologicalmalignancy.PO-096PHASE I-II TRIAL OF ANTI-CANCER VACCINATION FOR MULTI-PLE MYELOMA PATIENTS USING DENDRITIC CELLS PULSEDWITH TUMOR IDIOTYPE (ID) OR ID (VDJ)-DERIVED PEPTIDESCurti A,° Cellini C,° Terragna C,° Tosi P,° Comoli P,*Massaia M, @ Ferri E,° Isidori A,° Cavo M,° BaccaraniM,° Lemoli RM°°Institute of Hematology and Medical Oncology “L.& A. Seràgnoli”, University of Bologna, Bologna;*Laboratory of Immunology, Department of Pediatrics,University of Pavia, Pavia; @ Chair of Hematology,University of Turin, Turin; ItalyThirteen multiple myeloma (MM) patients weretreated with two courses of high-dose chemotherapywith peripheral blood stem cell support and thenentered in a clinical study of anti- Id. vaccinationwith dendritic cells (DC). DC were generated frompositively selected circulating monocytes accordingto good manufacturing practice guidelines, in FCSfreemedium in cell culture bags, in presence of GM-CSF plus IL-4 followed by either TNF-α or a cocktailof IL-1-β, IL-6, TNF-α and prostaglandin-E2. CD14 +monocytes were enriched from 16.1±5.7% to95.5±3.2% (recovery 67.9±15%, viability >97%).After cell culture, phenotypic analysis showed that89.67;6.6% of the cells were DC: we obtained2.89±1×10 8 DC/leukapheresis which represented24.5±9% of the initial number of CD14 + cells.Notably, the cytokine cocktail induced a significantlyhigher percentage and yield (31±10.9 of initialCD14 + cells) of DC than TNF-α alone, secretion oflarger amounts of IL-12, potent stimulatory activityon allogeneic and autologous T cells. Storage in liquidnitrogen did not modify the phenotype or functionalcharacteristics of pre-loaded DC. The recoveryof thawed, viable DC, was 78±10%. Ten patients inpartial remission after autologous stem cell transplantationreceived a series of by-monthly immunizationsconsisting of three subcutaneous and twointravenous injections of Id-keyhole limpet hemocyanin(KLH)-pulsed DC (5×-, 10×, 50×10 6 cells and10×-, 50×10 7 cells, respectively). The patient-specificId was used as whole protein in 4 patients whereas6 additional patients had their DC charged with Id(VDJ)-derived HLA class I restricted peptides. Theadministration of Id-pulsed DC was well toleratedwith no clinically significant side effects. So far, 6patients have been fully evaluated for their immunologicresponse to DC vaccination. Six of 6 patientsdeveloped a humoral and T-cell proliferative responseto KLH. Moreover, 5/6 showed circulating IFN-gamma-secretingT cells by Elispot. None of the patientsmounted a B-cell response to Id whereas 6/6 developeda Id-specific T-cell proliferative response and4/6 IFN-γ-secreting T cells. Delayed-type hypersensi-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004121tivity (DTH) tests showed 6/8 and 2/8 patients responsiveto KLH and tumor Id, respectively. Ten out of thirteenpatients have completed vaccination schedule.With a median follow up of 20 months, 4/10 patientshave stable disease, 2 patients are in CR, 1 patientobtained clinical response and 3 patients progressed.In summary, positive selection of circulating CD14 +monocytes allows the generation of mature andfunctional DC suitable for clinical trials and cryopreservationdoes not affect the phenotype and functionof pre-loaded DC. Moreover, injections of cryopreservedDC pulsed with tumor Id or Id-derived peptidesare safe and induce T-cell tumor-specificresponses.PO-097PURIFICATION OF ALLOGENEIC IDIOTYPE-SPECIFIC T LYMPHO-CYTES ACCORDING TO IFN-γ PRODUCTION FOR ADOPTIVEIMMUNOTHERAPY IN MULTIPLE MYELOMA PATIENTSCurti A, Pandolfi S, Isidori A, Baccarani M, LemoliRMInstitute of Hematology and Medical Oncology “L. &A. Seràgnoli”, University of Bologna, BolognaIn multiple myeloma patients, adoptive immunotherapythrough allogeneic donor lymphocyte infusionsresulted in well-documented graft versusmyeloma effect, but it is associated with high incidenceof graft versus host disease. The idiotype (Id)expressed by MM cells can be regarded as a tumorspecificantigen and it has been used for immunotherapy.To enhance antitumor immunity and reducealloreactivity, allogeneic T cells were activatedagainst tumor-derived Id and then purified accordingto IFN-gamma production. Total peripheral bloodmononuclear cells from healthy donors were incubatedwith autologous monocyte-derived dendriticcells generated in the presence of GM-CSF and IL-4and pulsed with patient-derived Id protein. Cells weremaintained in serum-free medium and supplementedduring the priming phase with IL-7 and IL-12. Subsequently,the T-cell culture was restimulated every7 days with pulsed DC in the presence of low dosesof IL-2. After 2 or 3 stimulations, the percentage ofIFN-γ-producing T cells was as high as 5-10%,whereas that observed in presence of not stimulatedT-cells was undetectable. Based on their IFN-gammaproduction, T cells were isolated by using a commercialimmunomagnetic IFN-γ capture assay. The purityof enriched IFN-γ-producing T cells rangedbetween 60 and 90% as evaluated by flow cytometry.The yield was 60% of pre-selection IFN-γ positiveT cells and cell viability after selection was 80%.Functionally, IFN-γ purified T cells showed better Idspecificproliferative response when compared bothto not-stimulated T cells and to stimulated but notpurified T cells. Moreover, addition of not-stimulatedT cells resulted in significant reduction of allogeneicCD34 + -derived colony-forming capacity. Conversely,the absolute number of allogeneic totalcolony-forming units-cells was not affected by IFNγpurified T cells. These data demonstrate that IdspecificT cells may be generated from healthy donorsand significantly enriched on the basis of their IFNγproduction. Id-specific IFN-vpurified T cells havebetter anti-Id response and reduced alloreactivitythan unselected T cells.haematologica vol. 89[suppl. n. 6]:september 2004

122PostersPosterNON-ONCOLOGICAL HEMATOLOGYPO-098DUAL EFFECT OF ARSENIC TRIOXIDE ON HEMOPOIESIS:INHIBITION OF ERYTHROPOIESIS AND STIMULATION OFMEGAKARYOCYTOPOIESISSaulle E, Riccioni R, Pelosi E, Rossini A, Petrucci E,Pasquini L, De Tuglie G, Calabrò L, Stafsnes M,Peschle C, Testa UDipartimento di Ematologia, Oncologia e Medicinamolecolare, Istituto Superiore di Sanità, Rome, ItalyArsenic compounds, including arsenic trioxide(As2O3) and arsenic disulfide, utilized in some traditionalChinese remedies, have been demostrated to beeffective for the treatment of Acute PromyelocyticLeukemia (APL), when used at low doses. However,As2O3 is also a potent inducer of apoptosis in a numberof other cancer cells such as AML, gastric cancer,neuroblastoma. The exact mechanism of As203induced apoptosis in the cells is not yet clear. In thepresent study we investigated the effect of As2O3 onerythropoiesis and megakaryocytopoiesis. DuringAs203 treatment of the human erythroleukemic cellline HEL several changes were observed: stimulationof megakaryocytic differentiation, inhibition of severalerythroid markers and induction of apoptosis atthe same time. Particularly,the expression of erythroid-specificreceptors such as c-Kit, Epo-R, GlycA,were downmodulated after As2O3 exposure. Similarobservations have been made in K562 cells. The samephenomenon was observed during unilineage erythroidand megakaryocytic cultures from normalhemopoietic progenitor cells : blockade of erythropoiesisand stimulation of megakaryocytopoiesis, asshown by cell cycle, morphologic and immunophenotypicanalyses. To determine whether the engagmentof caspases is involved in these phenomena weanalyzed the expression of GATA-1 and Tal-1 transcriptionfactors, two targets of caspases, whoseintegrity and activity is essential for the developmentand survival of the erythroid lineage. After exposureof HEL and K562 cells to As203 for 48h we observeda decrease of GATA-1 and Tal-1 expression; moreover,treatment with pan-caspase inhibitor z-VAD incombination with As203, protects GATA-1 fromcleavage. In unilineage cultures of normal erythroidprogenitors the addition of As203 resulted in a blockadeof erythroid maturation at the proerythroblasticstage, associated with a cleavage of both GATA-1and Tal-1 transcription factors. Both the As203-induced inhibition of erythroid cell differentiationand cleavage of transcription factors was blocked byzVAD. In contrast, the addition of As203 to unilineagecultures of normal megakaryocytic precursors did notinduce any cleavage of GATA-1 and Tal-1 transcriptionfactors and induced a stimulation of megakaryocyticmaturation (i. e. , increase in the formation ofthe large polyploid megakaryocytes). The stimulatoryeffect of As203 on megakaryocytic maturationseems to require caspase activation. Experiments arein progress to determine the caspase required for theinhibitory and stimulatory effect of As203 on erythropoiesisand megakaryocytopoiesis, respectively.Our results clearly indicate that the effects of As203on hematopoiesis are lineage specific and the markedinhibitory effect of this compound on erythropoiesiscould explain the development of anemia oftenobserved during therapy based on As2O3 administration.PO-099USE OF THE BLOB ANALYSIS IN THE DEVELOPMENT OF A NEWPROCEDURE FOR THE AUTOMATIC COUNT OF GRANULOCYTESMIGRATING THROUGH MICROPORE FILTERS IN CHEMOTACTICBOYDEN CHAMBERAzzarà A, Chimenti M,* Carulli G, Galimberti S,Fazzi R, Andreazzoli F, Petrini MDivisione di Ematologia, Dipartimento di Oncologia,dei Trapianti e delle Nuove tecnologie in Medicina,Università di Pisa, Italy; Divisione di Ematologia,Dipartimento di Oncologia, dei Trapianti e delleNuove tecnologie in Medicina, Università di Pisa,Italy; * Istituto Di Scienza e Tecnologie dell'Informazione“A. Faedo”. Consiglio Nazionale delle Ricerche,Pisa, ItalyIn this paper we describe a completely new imageprocessing procedure for an automatic assessmentof granulocyte motility in micropore filters. Granulocytemotility was evaluated in perspex chemotacticchambers according to the Boyden method, usingmixed-ester filters between the two compartments.After treatment, the filters were fixed, dehydrated,stained, diaphanized and placed on the electromechanicaltable of a Leitz Hortolux microscope.According to our procedure, the objective is focusedon the upper plane of the filter and a sequence of digitalimages is then acquired at predetermined depthsby means of a video camera. The video signal is sentto a video board which can store digital imagesdefined by 768×576 pixels with 300 µm spatial resolution.The frame grabber works on a personal computerunder the control of the Matrox Inspector(R)software, which uses several options, such as Seg-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004123mentation, Setting and Features. Initially, a decisionthreshold is properly selected, according to agreyscale segmentation threshold. Then, regions oftouching pixels are automatically identified by thesoftware as a blob, each blob corresponding to a cellin the processed image. Setting allows the definitionof the Foreground and the option Remove Blobsregards the situation of Touching Blobs, or the definitionof Minimum Area or Maximum Area (expressedin pixel2). Each image is processed in order to revealthe blobs, produced by the granulocytes, and toextract the plane coordinates (x,y) of the centroid ofeach blob. The results obtained by processing the firstimage of the sequence are compared with the resultsobtained by processing the second one, in order todetect couples of blobs having the same plane coordinatesand to delete one of them. This comparisonis performed considering the results obtained fromsecond and third images, and so on. The completeprocedure is performed in few seconds. The automaticanalysis was compared blind with a traditionalanalysis performed by an optical detection of thecells in each plane: no statistical differences werefound between the two sequences, except for theplane corresponding to 20 µm, wich resulted criticalin the visual way, showing a bias due to the focusingof a large amount of cells under examination, whichleads to count twice the same cells. On the contrarythe software was able to eliminate this artifactualeffect, by recognizing each cell and assigning it to theplane in which it really is. So the procedures performsa reliable and reproducible count of the of the granulocytesin the micropore filters ( without underestimationor overestimation) and determines not onlythe depth reached by the cells, but also their truepropagation curve.PO-100IMMUNOREGULATORY EFFECT OF PR-39, AN ANTIMICROBIALPEPTIDEMalinverni R, Gritti D, Malinverno A, Culacciati D,Gasparetto C, Ross C, § Ricevuti GDipartimento di Medicina Interna e Terapia Medica,Università degli Studi di Pavia, Clinica Medica III,IRCCS Policlinico S. Matteo, Pavia; § Department ofAnatomy and Physiology, Kansas State University,USAIntroduction. Neutrophil antimicrobial peptides arecontained in azurophilic grains of the neutrophil andhave microbicidal properties. They are also secretedby many epithelial cells, and many antimicrobial peptideshave additional effects on innate immunity. PR-39 is a proline-arginine rich antimicrobic peptide,belonging to the sub-family of the cathelicidins. PR-39 was cloned in 1993 from the pig neutrophil. PR-39 blunts neutrophil activation by binding to intracellularSH3 domains during NAD(P)H oxidase assembly.The evidence for the existence of a neutrophiltypeNAD(P)H oxidase in platelets, has been confirmedby the identification of the subunit p67phox,p47phox and a gp91phox. Platelets (PLTs) producereactive oxygen subspecies (ROS) that stimulatedplatelet aggregation and the interaction with neutrophils.PLTs activation is thought to be a key inacute vascular thrombosis. Therefore, prevention ofenhanced platelet activation is a major target of therapeuticstrategies fighting cardiovascular and cerebrovasculardiseases. Since the platelet NAD(P)H oxidasepresents a potential target for PR-39, the aim ofour study was to verify if the PR-39 interferes withactivation, aggregation, production of platelet ROSand platelets-neutrophil interaction. Methods. Westudied the effect of 2 concentrations of PR-39 (5µM,1µM) on platelet function. Platelet Rich Plasma (PRP)or whole blood, incubated with or without PR-39,was tested for aggregation, ROS production and PLT-PMN interaction with and without stimulus. Dihydrorhodamine-123(DHR-123) was used to examinein vitro platelets ROS production with a flow cytometricmethod. 12-phobol-13-myristate acetate(PMA), and f-met-leu-phe (fMLP) were used as agonists.Data are expressed as fluorescence mean intensity(FMI). PLT-PMN complexes were measured usingflow cytometry. Data are expressed as percent of neutrophilswhich co-localized with PLT markers underbasal condition and after blood stimulation with ADP,fMLP or PMA. Platelet aggregation was studied usedPRP stimulated with ADP or thrombin in a CHRONO-LOG aggregometer. Results. PR-39 had no affect onplatelet aggregation. PR-39 at 1 µM had no affect onplatelet ROS production while PR-39 5 µM inhibitedfMLP- (5.307 FMI±0.729 vs 3.589 FMI±0.885,p

124PostersPO-101A WHOLE BLOOD FLOW CYTOMETRIC METHOD TO EVALUATEF-ACTIN POLYMERIZATION IN NEUTROPHILSCarulli G, Azzarà A, Ghimenti M,* Buda G, PietriniP,* Petrini MDivisione di Ematologia, Dipartimento di Oncologia,dei Trapianti e delle Nuove Tecnologie in Medicina;*U. O. di Analisi Chimico Cliniche Specializzate Universitaria,Pisa, ItalyTo reduce artifactual effects in the study of F-actindynamics in neutrophils, we have developed a wholeblood flow cytometric method. Both isolated andwhole blood neutrophils were studied under unstimulatedconditions (at 4° and 37°C) and after stimulationwith 10 nM f-MLP for 15, 30, 60 and 120 sec.Cells were permeabilized by formalin and lysophosphatidylcholine and stained with FITC-phallacidin.The whole blood method did not modify significantlythe scatter properties of whole blood leukocytes andallowed a rapid analysis of F-actin polymerisation. F-actin content was measured after normalization offlow cytometry results, to obtained semiquantitativevalues and avoid differences caused by the use of differentcytometers and operating approaches. F-actinpolymerisation dynamics was very similar when evaluatedby the two different methods, without any significantdifferences in F-actin relative content. Inaddition, we found that differences between F-actincontent at 37°C and F-actin content at 4°C representthe spontaneous capability of polymerising actin: infact, alternating exposure of neutrophils at 4°C and37°C (up to four consecutive cycles) induced alternatingphenomena of polymerisation and depolymerisation.Thus, our whole blood method seems to beable to evaluate not only F-actin polymerisation afterchemotactic stimulus with f-MLP, but also the intrinsiccapability of polymerising actin under ex-vivo conditions.This method can be very useful to evaluatethis important phenomenon when the effects of drugsand growth factors have to be evaluated.PO-102ANTINFLAMMATORY PROPERTIES OF ANTITHROMBIN-IIIGritti D, Malinverno A, Malinverni R, Culacciati D,Gasparetto C, Ricevuti GDipartimento di Medicina Interna e Terapia Medica,Università degli Studi di Pavia, Clinica Medica III,IRCCS Policlinico S. Matteo, PaviaBackground. Current interest focused on the interrelationbetween inflammation and coagulation, andwe have studied the anti-inflammatory properties ofantithrombin-III (AT-III). Cardiac surgery involvingcardiopulmonary bypass leads to fulminant activationof the hemostatic-inflammatory system. Transgenicrecombinant human antithrombin III (rhAT-III) is inphase III clinical trials in the US and Europe as ananti-coagulant and anti-inflammatory agent inpatients undergoing elective cardiac surgery with cardiopulmonarybypass. Effects of AT-III supplementationon the inflammatory response during cardiacsurgery are less well investigated. Cardiopulmonarybypass is associated with extensive granulocyte andmonocyte activation including the release of pro- andanti-inflammatory cytokines and up-regulation ofadhesion molecules including CD11b/CD18 which isresponsible for firm leukocyte adhesion to plateletsand fibrinogen. Blood contact with artificial surfacesdecreases the ability of activated platelets, leukocytesand their aggregates to pass through organ capillaries,and neutrophils sequestration has been implicatedin the inflammatory response associated with cardiopulmonarybypass. AT-III attenuates ischemiainducedleukocyte adhesion and might be able todirectly affect properties of leukocytes during extracorporealcirculation. Methods. We studiedCD11b/CD18 expression on PMN in flowcytometry. Weperformed the in-vitro analysis on basal (B group) andactivated after incubation (20 minutes, 37°C) withformyl-Met-Leu-Phe (fMLP, 10e-6 M) and/or hrAT-III(1 U/ml) expression. We pre-incubated whole bloodwith hrAT-III (20 minutes, 37°C), and then we stimulatedPMN with fMLP (20 minutes, 37°C). Leukocyteaggregation was monitored as the increase in transmissionof light through stirred suspension in aplatelet aggregometer in the first 6 minutes followingstimulation. Leukocytes in platelet-rich-plasma(LPRP) were obtained from heparinized whole bloodby centrifugation. Aggregation was induced by phytoemagglutinin(PHA, 0.24 mg/mL) + hrAT-III at variousconcentration, or with PHA alone after cells incubation(20 minutes, 37°C) with hrAT-III at various concentration.NADPH oxidase activity in PMN, was studiedusing a fluorescent dye suitable for flow cytometry,Diihydrorhodamine 1,2,3 (DHR123). Blood sampleswere preincubated (20 minute, 37°C) with hrAT-III (2.5 IU/mL). We analysed NADPH oxidase activityusing PMA 100 ng/ml and fMLP 1microM as stimuli.Results. After stimulation with fMLP, we confirmed asignificant increase in CD11b/CD18 expression onPMN versus the basal. We observed that AT-III wasunable to affect in vitro expression of integrins, whileAT-III pre-incubation inhibited the fMLP-inducedCD11b/CD18 up-regulation. At the basal condition,fMLP and PMA induced a significant enhance in freeradical production, whereas hrAT-III alone did notactivate NADPH oxidase activity; hrAT-III pre-incubationinhibited the PMA-induced NADPH oxidaseactivation but did not have any effect on fMLP. In thepresence of plasma and platelets, aggregation of nor-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004125mal white blood cells after stimulation with lectin(PHA) is inhibited by AT-III. Conclusions. Our resultssupport the hypothesis that AT-III has an anti-inflammatoryeffect on neutrophils by inhibition of integrinupregulation and oxygen radical production.PO-103NO CHANGES OF ENDOGENOUS VON WILLEBRAND FACTORLEVELS DURING PREGNANCY IN A PATIENT WITH TYPE 2MVICENZA (R1205H)Dallagiovanna S, Canciani MT, Lai V, Moroni B,Cozzi G, Marella O, Castaldo M, Mistretta C,Coppola R, Federici ABAngelo Bianchi Bonomi Hemophilia and ThrombosisCenter, IRCCS Maggiore Hospital and University ofMilan, ItalyWomen with Von Willebrand Disease (VWD) type 1and 2 usually show increasing von Willebrand factor(VWF) levels during pregnancy, due to the constitutiverelease of VWF by the highly vascularized foetoplacentalunit. Patients with type 2M Vicenza arecharacterized by very low plasma levels of VWF activitiesin the presence of supranormal multimers similarto those found in platelet α granules andendothelial Weibel-Palade bodies. Since the originaldescription by Rodeghiero, many other families havebeen reported in different countries (Germany, USA,UK) and two distinct mutations have been identified(R1205H, M740I). However the basic mechanisms ofthis VWD variant remain not completely understooddespite many attempts to study these recombinantVWF mutants after their expression in vitro. We hadrecently the opportunity to follow the pregnancy ofa 37 year-old woman with Type 2M Vicenza R1205H.Before pregnancy, she was exposed to an infusiontrial with desmopressin (DDAVP). During pregnancy,she has been followed with monthly measurementsof FVIII/VWF activities and multimeric analysis ofVWF. Since VWF plasma levels were < 6 U/dL, theVWF:RCo was tested by our sensitive ELISA methodusing recombinant GpIb. Basal levels of BT and FVI-II/VWF activities were the same during the last fiveyears (mean values): BT = 6.30 minutes; FVIII:C=18U/dL VWF:Ag=5 U/dL; VWF:RCo = 3 U/dL, with normalVWF platelet content and supranormal multimersin plasma. She was considered responsive toDDAVP because FVIII:C, VWF:Ag and VWF:RCo werestill relatively high at 2 hours post-DDAVP with valuesof 62, 36 and 32 U/dL respectively. Conversely, thelevels of the FVIII/VWF activities measured at month3, 6, 9 did not change at all during pregnancy. Theseclinical data might support the hypothesis raised byseveral authors that this type 2M VWD variant is dueto defects of constitutive release of VWF.PO-104CHRONIC IMMUNE THROMBOCYTOPENIC PURPURA (ITP):THE ROLE OF PLATELET APOPTOSIS AND DENDRITIC CELLSCatani L,* Fagioli ME,* Tazzari Pl,° Vianelli N,*Rovito M,* Ricci F,° Curti A,* Amabile M,* Preda P, §Lemoli RM,* Conte R,* Baccarani M*Istituto di Ematologia e Oncologia Medica “L. e A.Seràgnoli” *, Università di Bologna; Servizio di MedicinaTrasfusionale ° e Unità Operativa di AnatomiaPatologica § , Policlinico S. Orsola-Malpighi, Bologna,ItalyChronic idiopathic thrombocytopenic purpura (ITP)is an autoimmune disorder characterized by plateletdestruction via antiplatelet autoantibody. New mechanismsof autoimmunity have been recentlydescribed. A growing body of evidence supports therole of dendritic cells (DCs) in the pathogenesis ofautoimmunity. Remarkably, recent results also suggestthat, in particular circumstances, cells dying byapoptosis may trigger a specific immune response. Inthe present study, we were aimed to investigatewhether platelet apoptosis and/or DCs may have arole in the stimulation of the immuno-mediated antiplateletresponse in course of ITP. We studied 10patients with active ITP and 8 healthy subjects. Wefound that ITP platelets, either fresh or in vitro agedfor 3 days at 37°C in a plasma-free buffer, show ahigher expression of phosphatidylserine in comparisonwith their normal counterpart. We thereforeinvestigated the role of caspases in the onset ofplatelet apoptosis and we found that caspases arenot involved. We found that the expression of thepro-apoptotic proteins BAX, BAD e BAK in normaland ITP platelets did not significantly change duringstorage. Furthermore, we failed to detect any significantdifference between normal and ITP platelets(either fresh or aged). We were also aimed to investigatewhether phagocytosis of autologous fresh andin vitro aged platelets, either from healthy subjects orfrom ITP patients, leads to the processing/presentationof platelet antigens by DCs and the cross-primingof T lymphocytes. In order to evaluate if plateletswith apoptotic-associated signals (i. e. phosphatidylserine)are able to induce their uptake by DCs,we firstly double-stained ITP aged platelets withPKH-26 (red fluorescence)/CD41a-FITC and we coculturedthem with immature DCs. Monocyte-derivedDCs readily ingest aged platelets, as documented byflowcytometry analysis. We studied concentration,phenotype and function of monocyte-derived DCs.We found that the cells expressed all surface markersof mature DCs (CD1, CD83 + , CD40 + , CD86 + , CD80 + ,HLA − Dr + , CD14 − ), even though ITP DCs showed a significantlyhigher expression of the co-stimulatorymolecule CD86.Remarkably, we were able to showhaematologica vol. 89[suppl. n. 6]:september 2004

126Postersthat ITP DCs, after pulsing with autologous fresh oraged platelets, stimulated more efficiently autologousand allogeneic T cell proliferation than theirnormal counterpart. This has to be referred, at leastin part, to the significantly higher expression of CD86co-stimulatory molecule in ITP DCs. When we studiedthe effect of allogeneic fresh and aged plateletson the stimulation of lymphocyte proliferation bypre-pulsed DCs, once again we found that ITP DCs aremore efficient to present aged platelet antigens thanthe normal ones. This finding suggests that the T lymphocyteproliferation is due to the increased antigenpresentation capacity of ITP DCs and, to a lesserextent, to the apoptosis of ITP platelets. Furthermore,due to CD86 up-regulation in ITP DCs, our resultssuggest also that CTLA-4 targeting may be a newapproach for future therapeutic purposes of ITP.PO-105ELEVATED PLASMA PROCOAGULANT AND ACTIVATIONPEPTIDES MARKERS IN PATIENTS WITH LUNG CANCERNapolitano M, de Francesco F, Tagliaferro A, SessaM, Bernacchi M, Pedicelli I, Marzo C, De Lucia DLaboratorio di Emostasi e Trombosi e Dipartimento diPneumologia, II Università degli Studi di Napoli, ItalyActivation of coagulation and fibrinolysis withintumour tissues is thought to be associated withtumour growth, angiogenesis, and metastasis; alterationsin haemostatic system are seen frequently inlung cancer correlated with the prognosis of disease.The aim of our study was to detect the hypercoagulabilityin patients with lung cancer as well as tosearch for a specific marker indicating the risk of DVTand PE related to tumour and chemotherapy.We studied 33 patients with histologically confirmedlung cancer, there were 29 men (88 per cent)and 4 women (12 per cent) with a mean age of 60years, 5 patients received chemotherapy. The plasmalevels of the following markers were assessed: prothrombintime (PT), active partial thromboplastintime (aPTT), Factor VIII, von Willebrand Factor (vWF),tissue Plasminogen Activator (t-PA), PlasminogenActivator Inhibitor (PAI-1), prothrombin activationfragment (F1 + 2), D-dimer. MTHFR (C677T), Factor II(G20210A) and Factor V (G1691A) polymorphismswere also tested in 12 patients. The members of thestudy were divided into two groups as patientsreceiving or not chemotherapy. There was a statisticallysignificant increase in Factor VIII, von WillebrandFactor (vWF), prothrombin activation fragment(F1+2) and D-dimer plasma levels in patients comparedwith controls (170±45; 172±40; 3.2±0.8;3.6±0.9 vs 100±20; 105±21; 0.48±0.02; 1.45±0.2).Chemotherapy administration was associated with ahigher increase of these markers (192±50; 181.2±45;3.6±0.8; 6.0±2.0). Tissue Plasminogen Activator (t-PA), Plasminogen Activator Inhibitor (PAI-1) levelswere decreased into the two groups compared withcontrols (2.0±0.3; 55±5.0 vs 7.5±0.5 32.5±1.5). Inseven patients Methylentetrahydrofolate reducatse(MTHFR) polymorphism was found. xThe results ofour study shown here are indicative of an acquiredthrombophilia in patients with lung cancer, enhancedby chemotherapy administration. The molecular basisof this thrombophilic state could be in part due to adisturbance in folathe metabolism associated withan overxpression of coagulation factors geneticallycontrolled by cancer cells. Our findings also demonstratean endothelial dysfunction due to thrombinformation and fibrin deposition into vessel wall byneoplastic cells.PO-106HELICOBACTER PYLOR INFECTION IN CHRONIC IMMUNETHROMBOCYTOPENIC PURPURAScandellari R,* Allemand E, Tezza F, Randi ML,Luzzatto G, Fabris FDepartment of Medical and Surgical Sciences, UOCMedicina Interna, University of Padua MedicalSchool, Padova, ItalyHelicobacter pylori (HP) has been suspected to beinvolved in various autoimmune disorders includingpernicious anemia and immune thrombocytopenicpurpura (ITP). Several uncontrolled studies supporteda pathogenic role of HP in ITP since they showeda 30-70% prevalence of HP infection in ITP and apartial or complete platelet recovery after bacteriumeradication. On the contrary three additional studies,one of which was prospective, failed to confirm thisassociation. We performed a prospective study inorder to investigate the prevalence of HP infection inpatients with ITP and the effect of its eradication onplatelet count. Since September 2003, thirty-twoconsecutive adult patients admitted to our ward forITP were enrolled in the study. Twenty-three patientshad chronic ITP while nine had the acute form (diseaseduration lower than 6 months); 23 were femalesand 9 were males with a mean age of 51 years±19(SD) and with a mean platelet count of 56±42×10 9 /L.HP infection was found in 19 patients (59%) bymeans of the stool antigen test. HP-positive and negativepatients were comparable for age, gender,platelet count, disease duration and therapy regimens.Six HP- positive patients were eligible to theeradication since their platelet count was more than20×10 9 /L and they do not need for starting or modifyingtherapy of thrombocytopenia for at least 3months. They received triple therapy with omeprazolehaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 200412720 mg twice daily plus clarithromycin 500 mg twicedaily and amoxicillin 1 gr twice daily for 7 days, andthe bacteria was eradicated in all. After 6 months offollow-up, a platelet count increase more than 50%of the initial count was observed in three patients(50%). In conclusion, we observed a higher-thanexpectedprevalence of HP in patients with ITP.PO-107PREVALENCE AND NATURAL HISTORY OF HEPATITIS VIRUS CINFECTION IN 350 ITALIAN PATIENTS WITH VON WILLEBRANDDISEASEFederici AB,* Rumi MG,^ Santagostino E,* SoffrediniR,^ Mistretta C,* De Filippi F,^ Mogni S,* BucciarelliP,* Colombo M,^ Mannucci PM**Angelo Bianchi Bonomi Hemophilia and ThrombosisCenter, IRCCS Maggiore Hospital, and University ofMilan, Italy; ^Angela Maria and Antonio MigliavaccaCenter for Liver Diseases, IRCCS Maggiore Hospital,and University of Milan, ItalyHepatitis C is a major cause of morbidity and mortalityin patients with bleeding disorders whoreceived clotting factors concentrates before theavailability of virus-inactivated factors in the mid1980s. Compared to hemophiliacs, patients with vonWillebrand disease (VWD) have been less extensivelyexposed to large-pool concentrates because theycould be treated by desmopressin or cryoprecipitatesprepared by national blood banks. To assess theprevalence and natural history of HCV infection inVWD, 350 patients attending the ABB HemophiliaThrombosis Center in Milan were enrolled in a cohort(types 1=145, 2=184 and 3=21). The 133/350patients (37% males, with types 1=31, 2=84; 3=18)who had been firstly exposed to cryoprecipitate(34%), whole blood and/or plasma (51%), large-poolconcentrates (15%), have been prospectively followedfor five years with assessment of viral markersand liver function tests every six months. Only 2patients had serum anti-HIV. Anti-HCV was found in61 (46%, 4 treated after 1987), 49 (80%) of whomhad serum HCV-RNA, too. HCV genotypes 1, largelypresent in the Italian population of hemophiliacs(68%), were present only in 49% of HCV-RNA-positiveVWD. Median age at infection was 24 years.Serum ALT activity was persistently or intermittentlyhigh in 33 HCV-RNA patients. Cirrhosis and HCCwere detected in 4 and 2 patients, respectively. VWDItalian patients showed a sporadic risk of infectionwith HIV and a lower prevalence of HCV. As expected,HCV genotypes distribution reflects the source ofblood products and might influence the natural historyof HCV in VWD.PO-108BIOCHEMICAL CHARACTERIZATION OF RECOMBINANT VONWILLEBRAND FACTOR (VWF) WITH A TYPE 2B MUTATION(P1337L) COEXPRESSED WITH A TYPE 1 VWF DEFECT (C275R):A COMPLEX MOLECULAR DEFECT IN A PATIENT PREVIOUSLYDIAGNOSED WITH TYPE 2A VON WILLEBRAND DISEASEBaronciani L, Federici AB, Beretta M, Cozzi G,Canciani MT, Mannucci PMAngelo Bianchi Bonomi Hemophilia and ThrombosisCenter, IRCCS Maggiore Hospital and University ofMilan, ItalyIn a patient with apparently type 2A VWD (meanvalues: FVIII:C = 32 U/dL, VWF:Ag = 7 U/dL, VWF:RCo= < 6 U/dL, VWF:CB = 2.0 mg/ml, loss ofhigh and intermediate molecular weight multimers inplasma and low platelet VWF) a transient thrombocytopeniaoccurred after an infusion test with desmopressin.The propositus' brother showed a less severelaboratory data (mean values: FVIII:C = 36 U/dL,VWF:Ag = 17 U/dL, VWF:RCo = 6 U/dL, VWF:CB=1,RIPA = 1.2 mg/ml). The two brothers resulted to becompound heterozygous for mutation P1337L and anovel candidate defect C275R. In their children,mutations were associated with type 2B (P1337L)and type 1 (C275R) VWD. rVWF-P1337L and rVWF-C275R, were transiently expressed in Cos 7 cells, ontheir own, together and with the rWVF-WT. VWFs.rVWFs were tested for VWF:Ag and multimer analysis.Binding of rVWFs to the GpIb platelet receptorwas evaluated by an ELISA method (Federici et al.Haematologica 89:77, 2004), at increasing concentrationsof ristocetin (0, 0.125, 0.25, 0.5, 0.8 and 1mg/mL), and the rVWF bound to GpIb was revealed byanti-VWF Antibody-HRP reading O. D. 492 nm. Onlythe expression of rVWF-C275R alone showed astrongly reduced VWF:Ag in cells medium and a completeabsence of multimers. The remaining rVWFs(P1337L, P1337L/WT and C275R/WT) showed only aslightly reduce VWF:Ag, in comparison to rVWF-WT,and a full set of multimers. GpIb binding assay (Table)showed that rVWF obtained by co-expression ofmutation P1337L with C275R behave very similarlyto rVWF-P1337L.rVWFs Ristocetin Ristocetin Ristocetin Ristocetin Ristocetin Ristocetin0 mg/mL 0.125 mg/mL 0.25 mg/mL 0.5 mg/mL 0.8 mg/mL 1 mg/mLWT 0.066 O. D. 0.071 O. D. 0.128 O. D. 0.154 O. D. 0.691 O. D. 0.924 O. D.P1337L 0.117 O. D. 0.310 O. D. 0.689 O. D. 0.984 O. D. 0.984 O. D. 1.039 O. D.P1337L/WT 0.063 O. D. 0.166 O. D. 0.409 O. D. 0.740 O. D. 0.894 O. D. 1.008 O. D.P1337L/C275R 0.084 O. D. 0.372 O. D. 0.635 O. D. 0.925 O. D. 1.105 O. D. 1.117 O. D.It seems that rVWF-C275R molecules do not contributewith the rVWF-P1337L to form multimers.haematologica vol. 89[suppl. n. 6]:september 2004

128PostersTherefore in the propositus and his brother mutationP1337L results to be present in all the VWF subunits,which might explain their more severe phenotype incomparison with their children that carry only mutationP1337L.PO-109INTERLEUKIN-10 (IL-10) SERUM LEVELS MAY BE SYNERGISTICSWITH LOW-DOSE TACROLIMUS (FK) IN THE TREATMENT OFREFRACTORY IDIOPATHIC THROMBOCYTOPENIC PURPURAIuliano F,* Dardano A,° Levato L,* Fabiano F,*Giulino C,* Battaglia E,** Peta A, Gulletta E°*U. O. DI Ematologia,**Lab. patologia clinica A. O."Pugliese-Ciaccio", Catanzaro °Lab. patologia clinica,Università Magna grecia, Catanzaro, ItalyInterleukin-10 (IL-10) is a key cytokine that is elevatedduring systemic inflammation. The data currentlysuggest that IL-10 is synthesized by variousleukocytes and is important in regulating the productionof other cytokines (interferon-γ, TNF-β andIL-2) by TH1 cells. IL-10 has been found to inhibit theantigen presenting cell-mediated stimulation of TH1cells by inhibiting the production of inflammatorycytokines (IL-1a, IL-6, IL-8 and GM-CSF). Calcineurininhibitors, namely Tacrolimus (FK) and Cyclosporine(CsA) share similar physicochemical properties and acommon mechanism of action. FK in addition showsa strong anti-inflammatory property blocking thesecretion of pro-inflammatory cytokines and an indirectinhibitory effect on the growth and differentiationof B lymphocytes. With this background we carriedout serological studies in a consecutive refractoryITP patients receiving low-doses FK. Five patientswere enrolled in the study. Median age was 50 yrs(range 23-63), M/F=3/2, median time from diagnosiswas 4 months (range 1-24). The drug was givenorally twice a day in order to maintain blood levelsbetween 5-15ng/ml. 5/5 patients (100%) achievedCR (plts > 110 9 /L for > 12 weeks). The median time toCR was 5 months (range 1-9). In order to evaluate theresponse duration, all patients stopped FK therapyafter a median of 5 months from CR (range 2-12). 2pts relapsed after 2 and 1 patient after 3 months. Allof these patients resumed FK therapy and re-achievedCR after 2 months. 1 patient lost CR but remained inPR (plts > 40×9/L for > 8 weeks) at 10 months follow-up;1 patient showed a sustained CR (more than20 months follow up). Cytokine levels were quantifiedby enzyme-linked immunosorbent assay. Bloodfor cytokine assays was collected at day 30,60,90, insodium heparin, placed immediately in ice water, centrifugedand the resulting plasma stored in aliquotsat 80°C within 1 h of phlebotomy. IL-10 levels weremeasured in batches using an enzyme-linkedimmunosorbent assay (ELISA) technique with kitsobtained from R&D Systems (Minneapolis, MN, USA).Serum γ IFN, IL-2 and s-IL-2R levels were also quantified.All samples showed IL-10 serum high levels (>500 pg/mL, range 7.8-500 pg/mL). Interesting, serumγ IFN and IL-2 were below defined cut-off (15 pg/mland 1.2 U/ml) in all pts and serum levels IL-2 receptorwere increased (cut-off 70 pg/ml). Our data suggestthat IL-10 may be involved in limiting and terminatinginflammatory responses in ITP patients. Inthis way IL-10 may be synergistic with FK antiinflammatoryproperty. FK, on the other hand, inhibitsregulatory IL-10 effects on growth and/or differentiationof B cells.PO-110THE ROLE OF RECOMBINANT ACTIVATED FACTOR VIIA IN APATIENT WITH SEVERE THROMBOCYTOPENIA AND LIFE-THREATENING GASTROINTESTINAL BLEEDINGBenevolo G, Franceschetti S, Rossi D, Vendramin C,Conconi AUDA Ematologia, Dipartimento Scienze Mediche,Università del Piemonte Orientale "Amedeo Avogadro",Novara, ItalySevere thrombocytopenia is a common complicationin hematologic malignancies, due to a decreasedplatelet production by bone marrow involvement orto the use of intensive chemotherapeutic regimens.Platelet transfusion is the current standard treatmentfor bleeding episodes associated with severe thrombocytopenia.However, the transfusion complicationssuch as transfusion-trasmitted diseases, plateletrefractoriness, immunomodulation and difficulty toachieve a sufficient supply of platelets from donors,as well as the failure to achieve a proper hemostasisdespite transfusion, prompt the search for therapeuticmeasures that may complement platelet transfusion.Recombinant activated factor VII (rFVIIa) hasbeen shown to improve hemostasis in patients withthrombocytopenia in several studies. We report thecase of a 58-year old man who was diagnosed ashaving primary thrombocythemia in 1974.The patienthad been treated with chemotherapeutic agents,namely hydroxyurea, and later with interferon-α(INF-α) until he developed severe thrombocytopenia,mild anemia and leukocytosis in 2001. The presenceof bone marrow fibrosis, extramedullary hemopoiesisand splenomegaly suggested transformation tomyelofibrosis with myeloid metaplasia. The patientwas treated with supportive therapy until January2003, when the myeloproliferative syndrome evolvedinto acute myeloid leukemia, with monosomy ofchromosome 7.At that time, the patient also developeda thrombotic event (AMI with PTCA on righthaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004129coronary artery). The patient was induced in completehematologic and cytogenetic remission withFLAG regimen and, given the unaivalbility of a bonemarrow donor, consolidated with intermediate dosesof cytosin arabinoside. He relapsed after a diseasefree survival of 6 months as a chronic phase myelofibrosisand thus was treated with thalidomide, prednisoneand androgens without achieving anyresponse. Three months later, the patient presentedwith sudden precordial pain and dyspnea with severeanemia (Hb 4 g/dL) and thrombocytopenia (platelet:6.000/mm 3 ), associated with gastrointestinal bleedingwithout gross lesions at endoscopy repeated inmultiple occasions. Endoscopic examination revealedonly a diffuse bleeding from the gastric mucosa. Apheripheral blood and bone marrow morphologyexamination showed high number of myeloid blastcells. He was transfused with platelets and red bloodcells. However, bleeding continued despite anincrease in the platelet count. Because the patient'scondition was deteriorating rapidly, intravenousboluses of rFVIIa at 100 microg/Kg were administeredin concurrence with platelet transfusion every 3hours for five doses. Bleeding stopped within sixhours and allowed the patient's condition to improvesufficiently to undergo a central venous catheterinsertion, without hemorrhagic complications. Fifteendays later, the gastrointestinal bleeding relapsedwith melena. Endoscopic examinations did not revealgross lesions, whereas a diffuse gastric mucosalbleeding was reported. In concurrence with platelettransfusions, recombinant FVIIa was repeated at adose of 100 µg/Kg every 3 hours for four doses, andthen every 7 hours for ten additional doses with nofurther evidence of bleeding. Adverse effects of rFVI-Ia administration were not observed, despite thepatient's history of AMI. Overall, this case report suggeststhat rFVIIa administered in concurrence withplatelet transfusion appears to be a valid alternativefor controlling bleeding in patients with severethrombocytopenia, especially when platelet tansfusionalone are ineffective.PO-111Not publishedPO-112FATAL HEMOPHAGOCYTIC SYNDROME RELATED TO ACTIVEHHV8 INFECTION IN IMMUNOCOMPETENT SUBJECTS:A NEW ENTITY DIAGNOSED BY MOLECULAR AND IMMUNO-HISTOCHEMICAL METHODSRe A, Capucci MA, Facchetti F,° Barozzi O, PetrellaN, Borlenghi E, Ungari M, Barozzi P,* Ravazzini L,*Torelli G,* Rossi G, Luppi M*Ematologia, Spedali Civili, Brescia; °Anatomia Patologica,Spedali Civili, Brescia; *Dipartimento Integratodi Oncologia ed Ematologia, Sezione di Ematologia,Università di Modena e Reggio Emilia, Modena,ItalyHHV8 is implicated in the etiopathogenesis ofKaposi sarcoma (KS) and rare lymphoproliferative disordersmainly occurring in HIV infected people. Theoccurrence of non-malignant disease such as bonemarrow (BM) failure or hemophagocytic syndrome, intransplant recipients or HIV positive patients with KS,has also been linked with HHV8 infection in occasionalcases. We report the occurrence of a fatalhemophagocytic syndrome in two HHV8 positiveimmunocompetent patients. Patient 1: a 63-year oldwoman was admitted with fever, peripheral cytopeniaand splenomegaly. One month before she hadbeen started on corticosteroid treatment for autoimmunehaemolytic anemia (AHA) and ten days beforeshe had received nefrectomy for renal carcinoma.There was no evidence of metastatic disease and bacterialor viral infection. She received eritropoietin, G-CSF and high dose intravenous immune globulin, withno benefit and died with a rapidly evolving multiorganfailure. Patient 2: a 69-year old man was admittedfor AHA and splenomegaly. He initially respondedto corticosteroid treatment, but rapidly developedpancytopenia and fever. He received high dose intravenousimmune globulin, acyclovir and broad spectrumantibiotics but died with rapidly progressivemultiorgan failure. A BM aspirate or biopsy performedin all two patients showed a normo/hypocellular marrowwith myelodisplastic features associated withsigns of hemophagocitosis, without evidence of lymphomatousinfiltration. HHV-8 DNA was detectedeither in the peripheral blood or in the serum from alltwo patients, by PCR for three different viral genes(orf-K1, the ORF 73 and orf 26). The molecular analysisalso allowed us to determine the HHV-8 subtypewhich was variant A in patient 1 and variant C inpatient 2. The occurrence of different viral genotypesin the two cases was also confirmed by the analysisof ORF 73 polymorphisms. The HHV-8 viral load wasdetermined by real time PCR for orf 26, showing thepresence of an extremely high number of viral copiesin both cases. In patient 1 immunohistochemicalanalysis in the BM biopsy showed the presence ofthe HHV8-LNA positive cells. Pancytopenia withhemophagocytic syndrome, myelodisplastic featuresand AHA occurring in immunocompetent adultsshould be added to the spectrum of clinical pathologicmanifestations associated with HHV8 infection.Its frequency may be underestimated and it should bealways considered in the differential diagnosis ofunexplained peripheral cytopenia. Its prompt recognitionby molecular and immunohistochemical meth-haematologica vol. 89[suppl. n. 6]:september 2004

130Postersods and early effective antiviral treatment may bethe only way to avoid its otherwise rapidly fatal evolution.PO-113A DESCRIPTION OF TWO CASES OF FACTOR V DEFICIENCYCerneca F, Bruno GIstituto per l'Infanzia IRCCS Burlo Garofolo, CentroTrasfusionale-Laboratorio di Patologia dell'EmostasiCongenital factor V deficiency is a coagulation disorder(1:1000000), usually transmitted as an autosomalrecessive trait. Diagnosis is based on coagulationtest showing prolonged activated partial thromboplastintime (PTT), normal thrombin time (TT) andprothrombin time (PT) corrected by normal plasmaadsorbed with aluminium hydroxide or barium salts.The patient 1, a 12-year old girl with thalassemiamajor, was admitted for bone marrow transplantationfrom a male sibling donor mismatched for one locus:on this occasion a heterozigous deficiency of FV(21%)was discovered. A study of the family membersrevealed that the mother also had severe deficiency(1%)but was asymptomatic and multiparous, whereasthe father had normal levels (107%). The FV deficiencywas not considered to be a contraindicationfor transplant, which was performed without the supportof supernatant cryoprecipitate. The patient 2, a14-year old girl, with a negative history until the ageof 7, when she underwent surgery to remove a cutaneousprearicular appendix and FV deficiency (2%)was diagnosed, with bleeding time slightly above normal(9&#8217;). Menarche occurred at age 12, withregular menstruation of normal quantity and lenght.These two cases indicate that there is no correlationbetween the severity of the haemorrhagic symptomsand plasma levels of FV, since severe deficiences areoften silent,probably because the risk of bleedingdepends more on levels of platelet FV,than to levelsin the plasma. In these situations transfusion therapymay not be necessary, thus avoiding the well-documentedrisk associated.PosterMYELOPROLIFERATIVE DISORDERSPO-114ENDOTHELIAL PROGENITOR CELLS ARE INCREASED IN THEPERIPHERAL BLOOD OF PATIENTS WITH MYELOFIBROSIS WITHMYELOID METAPLASIARosti V,* Massa M,° Ramajoli I, # Campanelli R,*Pecci A, § Meli V, † Viarengo Gl,^ Marchetti M, #Barosi G #*Lab. of Organ Transplantation, IRCCS PoliclinicoSan Matteo; °Lab. of Biotechnology, IRCCS PoliclinicoSan Matteo; # Lab. of Clinical Epidemiology, IRCCSPoliclinico San Matteo; § Clinica Medica III, Universityof Pavia and IRCCS Policlinico San Matteo; † Deptof Pediatrics, IRCCS Policlinico San Matteo; ^Immunohematologyand Transfusion, IRCCS PoliclinicoSan Matteo; Pavia, ItalyEndothelial progenitor cells (EPCs) are identified bythe co-expression of the CD34, VEGFR-2, and CD133antigens on their surface and by their capacity toform colonies in vitro. It has been reported that thesecells circulate at a very low extent in the peripheralblood (PB) of normal subjects. We have previouslyshown that patients with Myelofibrosis with myeloidmetaplasia (MMM) have an increased number of circulatingCD34 + cells compared to patients with otherPh-negative myeloproliferative disorders. We havealso recently reported that the bone marrow andspleen of MMM patients are characterised byenhanced angiogenesis. In this study we have testedwhether patients with MMM have a higher numberof circulating EPCs compared to patients with PolycythemiaVera (PV) or Essential Thrombocytemia (ET)and to healthy subjects. Up to 50 ml of PB wereobtained from patients and controls enrolled in thestudy and both cytofluorimetric studies and in vitrocultures were performed. For FACS analysis the followingmonoclonal antibodies were used: FITC anti-CD34, PE anti-CD133, and PerCp anti-VEGFR-2.Endothelial colonies were obtained by plating PBmononuclear cells in the presence of a commercialmedium specific for endothelial cell growth. Colonyidentity was confirmed by in situ staining with monoclonalantibodies towards CD31, vWf, VE-cadherin,CD34, and CD45 and by staining with FITC-labeledUlex europeus agglutinin. The median percentage ofCD34 + CD133 + VEGR-2+ cells in 58 patients withMMM was higher (1.2%, range 0-21.5) than in 11patients with PV or ET (0%, 0-3.2) and than in 12haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004131normal subjects (0%, 0-3.6)(p=0.012, and p=0.001,respectively). Analysis of CD34 + selected cells confirmedthis observation. In fact, the percentage ofCD34 + cells co-expressing the VEGFR-2 and theCD133 antigens was statistically higher in MMMpatients (n=12) than in normal subjects (n=6)(p=0.026). EPC cultures showed that the number ofVE-cadherin + CD31 + colonies in 16 MMM patientswas higher (median 68, range 52-100) than in 8PV/ET patients (9, 4-16) and than in 6 healthy subjects(21, 5-37) (p

132PostersPO-116FIP1L1-PDGFRA FUSION GENE AS A THERAPEUTIC TARGET OFIMATINIB IN HYPEREOSINOPHILIC SYNDROME: CLINICAL ANDBIOLOGICAL FEATURESMartinelli G, 1 Ottaviani E, 1 Cilloni D, 5 Malagola M, 1Rondoni M, 1 Bosi C, 1 Gottardi E, 5 Rosti G, 1 Ricci P, 1Gaitani S, 1 Pane F, 3 Testoni N, 1 Mecucci C, 16 SoveriniS, 1 Piccaluga PP, 1 Amabile M, 1 Tiribelli M, 7 Poerio A, 1Zuffa E, 6 Zaccaria A, 6 Grafone T, 1 De Vivo A, 1 AscaniS, 13 Pileri S, 13 Vivaldi P, 15 Giuseppe V, 8 Fattori P, 9Bocchia M, 10 Serra A, 5 Maurillo L, 11 Fanin R, 7 CrossN, 14 Bertieri R, 12 Baccarani M, 1 Saglio G, 5 MeranteS, 17 Cazzola M, 17 Alimena G, 18 Frassoni F, 19 GalieniP, 20 Ballerini PF, 21 Danesin C, 22 Tecchio C, 22 MorandiS, 23 De Biase E, 24 Russo D, 25 Gobbi M, 26 Gugliotta L, 27Lauria F, 28 Mazza P, 29 Ferrara F, 30 Gherlinzoni F, 22Leoni P, 1 Musto P, 32 Bernasconi C, 17 Majolino I, 33Liberati M 16From the 1 Institute of Hematology and Medical Oncology“L. and A. Seràgnoli”, University of Bologna;2Division of Hematology and Internal Medicine,Department of Clinical and Biological Science, Universityof Turin; 3 CEINGE Biotecnologie Avanzate andDepartment of Biochemistry and Medical Biotechnology,University of Naples Federico II; 4 Novartis Pharma,Origgio; Italy; 5 Divisione di Ematologia OspedaleSan Luigi Gonzaga, Torino, 6 Divisione di Ematologia diRavenna; 7 Istituto di Ematologia di Udine; 8 Divisionedi Ematologia di Pesaro; 9 Divisione di Ematologia diRimini; 10 Cattedra di Ematologia di Siena; 11 Cattedradi Ematologia, Università di Tor Vergata, Rome;12Novartis Pharma, Oleggio, Italy, 13 Department ofPatologic Anathomy - section of Hemolinfopathologies,University of Bologna, 14 Wessex Regional GeneticsLaboratory, Salisbury, UK, 15 O. U. Medicine II, Sectionof Hematology, S. Chiara Hospital Trento, 16 Universityof Perugia, Hematology, 17 Policlinico S. Matteo,University of Pavia, 18 University “La Sapienza” Rome,19Department of Hematology S. Martino Hospital,Genova, 20 Ospedale Generale Provinciale C. G. Mazzoni,Ascoli Piceno, 2 De Gironzoli Hospital, ConeglianoTreviso, 22 Division of Hematology, S. Maria di Ca' FondelloHospital Treviso, 23 Division of Medicine II, Sectionof Hematology, Istituti Ospitalieri di Cremona,Cremona, 24 San Giacomo Hospital, CastelfrancoVeneto, Treviso, 25 University of Brescia, 26 University ofGenova, 27 Division of Hematology, Arcispedale S.Maria Nuova, Reggio Emilia, 28 Hospital “A. Sclavo”,University of Siena, 29 Hospital “SS Annunziata” -Hematology, Taranto, 30 Hospital Cardarelli, Naples,31University of Ancona - Ospedale Regionale di Torrette,32 IRCCS "Casa Sollievo della Sofferenza" - S. GiovanniRotondo, Foggia, 33 Hospital “S. Camillo”, RomeThe hypereosinophilic syndrome (HES) is a rarehematological disorder characterized by abnormaloverproduction and accumulation of eosinophils causingorgan damage. It can be distinguished the secondaryforms, that can be caused by other causes suchas parasitic infections, atopy, hypersensitivity reactions,collagen vascular disease, or tumors, and theidiopathic hypereosinophilic syndrome, for which diagnosticcriteria have been proposed. These include: (1)sustained eosinophilia (1.5×10 9 cells/mmc) present forlonger than 6 months, (2) absence of other knowncauses of eosinophilia, and (3) signs and symptoms oforgan infiltration. HES occurs more frequently in menthan in women, and the usual age of presentation isbetween 20 and 50 years. The organs and systemsmost frequently affected by HES include heart, nervoussystem, skin, lungs, liver, and gastrointestinal. Recently,a novel fusion tyrosine kinase, FIP1-like 1 (FIP1L1)gene to the PDGFR-a gene, has been found to beinvolved in some patients with idiopathic hypereosinophilicsyndrome (HES) responsive to imatinibtherapy, generated by an interstitial deletion on chromosome4q12. We collected blood samples of 141patients with hypereosinophilic syndrome, and we performedreverse transcriptase polymerase chain reaction(RT-PCR) analysis of FIP1L1-PDGFR-a. In our study86 patients were affected by secondary hypereosinophilicsyndrome (60%), 55 patients had idiopathichypereosinophilic syndrome (40%). All the patientswith secondary forms were negative for the presenceof the FIP1L1-PDGFR-a rearrangement, whereas of thepatients with the idiopathic forms 13 were positive.From December 2002 we treated 31 patients with idiopathichypereosinophilic syndrome with different dosesof Gleevec (100-400 mg/die), 13 positive for FIP1L1-PDGFR-a, and 18 negative. 26 patients are male, fiveare female, with a median age of 52 years (range 20-78) and a peripheral blood count of 4,25×10 9eosinophil cells /mmc (range 1.5-18) at diagnosis. Intwelve patients we had a documented organ infiltrationin different organs (lung, heart, skin, kinder). Cytogeneticstudies showed no evidence of either the bcrabltranslocation or TEL-PDGFRb, one patient hadt(5;12)(q33;p13), one patient shown 45,xo, and onet(1,15). All the patients FIP1L1-PDGFR-a positive hada dramatically response to the therapy, with a decreaseof the eosinophil number in the peripheral blood andin the bone marrow smears after seven days of therapy.No relevant toxicity was observed. In seven caseswe studied the sequence of the fusion gene, mixingserially diluted total FIP1L1-PDGFR-a(e)+ RNA (diagnosticsample) with the HL60 cell line, and we wereable to amplify the transcript up to a 1:10(e)4 dilution.Sequence analysis was performed to confirm which isthe breakpoints in PDGFR-a and if the different bandsrepresent splice variants.Funding: Supported by: COFIN 2003, by FIRB 2001,by the University of Bologna (60% grants), by the Ital-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004133ian Association for Cancer Research (A. I. R. C. ), by theItalian National Research Council (C. N. R), and bygrants from the Campania Region, Fondazione delMonte di Bologna e Ravenna and A. I. L.PO-117CLINICAL-HEMATOLOGICAL FINDINGS AND MOLECULARRESULTS IN A NEW SERIES OF CHRONIC EOSINOPHILICLEUKEMIA WITH 4Q12 CRYPTIC DELETIONLa Starza R,* Crescenzi B,* Beacci D,* Gurdo G,*Specchia G, # Nozzoli C, + Foppoli M, § Luciano L,°Matteucci C,* Martelli MF,* Marynen P, § Mecucci C**Ematologia, Policlinico Monteluce, Università degliStudi di Perugia; # Hematology, University of Foggia,Italy; + Hematology, University of Firenze, Italy;§Ospedale San Raffaele, Milano, Italy; °Hematology,University ofNapoli, Italy; § Centre for Human Geneticsand VIB, University of Leuven, BelgiumAccording to WHO criteria, chronic eosinophilicleukemia (CEL) represent myeloproliferative disorderswith increased eosinophils in the peripheral blood(>1.500/mL) lasting more than six months, exsclusionof secondary causes, presence of signs or symptomsof organ involvement, and demonstration of clonalityof eosinophils or increased bone marrow blasts.We report on clinical-hematological and molecularfindings in ten patients with 4q12-/CEL. Cytogeneticswas done on bone marrow cells after culturing24/48 hours. Metaphases were G-banded withWright stain and karyotypes were described accordingto the International System for Human CytogeneticNomenclature (1995). Interphase-FISH was performedwith a set of probes, RP11-120K16, RP11-3H20(kindly provided by Dr P Marynen, University ofLeuven, Belgium), designed to detect 4q12 crypticdeletion which underlies the FIP1L1/PDGFRα rearrangement.In three patients PCR investigationsconfirmed the FIP1L1/PDGFRα fusion protein.Patients were nine males and one female agedbetween 29 and 68.All patients had an hyperleukocytosis(7000-129000/L) with increased eosinophils(range of absolute number: 2088-30048). Increasedbone marrow eosinophils were documented in 5/6patients with available bone marrow biopsy. Splenomegalywas present in 8/10 while hepatomegaly waspresent in all 7 analysed cases. Other signs or symptomsof organ involvement were present in 7/10patients with the following distribution: hearth 3 cases,skin 3 cases, lung 2 cases, central nervous system2 cases. Karyotypes were normal in 7/10 analysedpatients. The cells bearing deletion of clone RP11-3H20 ranged from 43% to 96% at diagnosis. Treatmentwith imatinib mesylate induced rapid hematologicalremission in 7/7 patients. FISH and PCR arecompared in the monitoring of molecular remission.Funding: This work was partially supported by CNR-MIUR and FIRB.PO-118ANTI CD-20 TREATMENT HALTED PROGRESSION OF THEHAEMOLYTIC PROCESS IN MYELOFIBROSIS WITH MYELOIDMETAPLASIA PATIENT (MMM)AND SEVERE TRANSFUSIONDEPENDENT ANEMIA. A CASE REPORTIuliano F, Fabiano F, Mannella A, Rizzo C, Viscomi L,Peta AU. O. di Ematologia. Azienda Ospedaliera"Pugliese-Ciaccio", Catanzaro, ItalySome reports suggest that immunologic mechanismmay play a role in the pathogenesis of anemia inmyelofibrosis with myeloid metaplasia (MMM). Moreover,rituximab,a chimeric monoclonal antibodyagainst CD-20, has been increasingly recognised as auseful therapeutic agent for immuno-mediated disorders.We report of a patient suffering from MMM andsevere transfusion dependent anemia in wich anti CD-20 treatment halted progression of the haemolyticprocess. A 70-year-old male was diagnosed on January1997 as MMM low risk,pathologic stage II withnormal karyotype. Diabetes and paroxysmal atrial fibrillationwere co-morbidities. Because of thrombocytosisand abdominal discomfort due to liver and spleenenlargement, hydrea was given at dose of 20 mg/Kgthree times weekly. Treatment with danazol 200mg/daily, rHuEPO 10000 U scx3 weekly and folic acidwas added 5 years later, when Hb level dropped below90 g/L. Nevertheless a median of 2 packaged red bloodcell units was needed monthly. Increased serum levelsof unconjugated bilirubin and LDH,a slightly reductionin serum haptoglobin and C3c along with a mild reticulocytosis,were sugestive of hemolytic anemia, despiteDAT negative test (IgG, IgA, C3d), CD55, CD59 normalflow cytometric assay, normal GP6D level and absenceof cold agglutinins in the plasma. According to publisheddata concerning the cyclosporine-A effects inimproving anemia in MMM, a cyclophosphamide doseof 100 mg/daily was performed. The patient becametransfusion free in 5 months and he did not need anytransfusion for one year long. At the time of relapse,EDX was stopped and after three months of azatioprinetreatment,anemia progressively worsened and thepatient became heavily transfusion dependent. Keepingin mind his clinical history,we decided to treat thepatient with rituximab to inhibit the underlyingimmunologic mechanism. Rituximab was given in a500 mg total dose, once weekly on 4 consecutivetimes. Response to treatment was evaluated by theimprovement of the parameters of hemolysis, such asdecrease in bilirubin and LDH, increase in Hb levelshaematologica vol. 89[suppl. n. 6]:september 2004

134Postersand of course, as reduction in transfusional need. Threeweeks after the last rituximab infusion, Hb level rapidlyimproved, reaching 11 g/L, and the patient did notneed any blood transfusion for the following threemonths. Stricking, bilirubin and LDH progressivelydecreased about of 50%. An immunomediated mechanismnegatively affects erythropoiesis in MMM. Furthermorea negative Coomb's test does not excludeautoimmune hemolytic anemia in such of patient. Rituximabis a chimeric monoclonal antibody directedagainst normal and malignant mature B-lymphocytesand results in prolonged and severe B-cell depletion.By this mechanism Rituximab inhibits autoimmuneresponse against erythroid progenitor cells and/or circulatingred cells. Rituximab may also interfere withcross-talk between T and B cells in blocking the releaseof cytokines known to impair erythropoiesis, eg. TNFαand IFNγ. Case reports on the use of rituximab inMMM patient with immune-haemolytic anemia arevery scant. Our results suggest that this such ofapproach is very encouraging, but further investigationsare warranted.PO-119SUSTAINED COMPLETE MOLECULAR REMISSION AFTER DIS-CONTINUATION OF IMATINIB THERAPY IN CML PATIENTSMerante S, Orlandi E, Bernasconi P, Malabarba L,Calatroni S, Boni M, Rocca B, Lazzarino MDivision of Hematology,IRCCS Policlinico San Matteo,Università di Pavia, ItalyImatinib mesylate (IM) therapy leads completecytogenetic response (CCyR) in the majority ofpatients with chronic myelogenous leukemia (CML) inchronic phase. A few pts achieve complete molecularremission (undetectable BCR-ABL by Q-PCR). Aimof this study was to describe the clinical outcome offour patients (see Table below) who discontinued IMtherapy after obtaining a complete molecular remissionin bone marrow and peripheral blood. The relativequantification of BCR-ABL transcript was performedby real-time PCR using SybrGreen I as double-strandedDNA binding fluorescent dye. Bothforms of p210 BCR-ABL transcript (b2a2 and b3a2)were detectable with the same set of oligonucleotidesby analysing dissociation curves. A serialdilution of total RNA from K562 cells was used toconstruct a standard curve for real-time quantification.The sensitivity threshold for BCR-ABL mRNAquantification was fixed at 10 -4 dilution standardmRNA, corresponding to 6pgs of RNA. BCR-ABLexpression levels were normalized to ABL mRNAexpression and calibrated on K562. The 4 pts wereinterferon pre-treated with a long history of disease.One pt had obtained a CCyR on IFN and crossed toImatinib because of IFN-intolerance, the other 3 wereIFN-refractory. None of them had a familiar donorfor allotransplant or had an indication for unrelatedtransplant. While on IM therapy at 400 mg/daily, nopatient required dose reduction or suspension due tohematologic or non-hematologic toxicity. Allobtained CCyR at month 6.Negativity of Q-PCR wasdocumented at month 9 in two pts and at month 12in the other two. At the time of IM withdrawal,patients had been in continuous complete molecularremission for a period ranging from 13 to 19 monthsand showed normal morphology and negative cytogeneticsat bone marrow examination. Reasons forIM withdrawal were patient's refusal of treatment inone, suboptimal adherence to the prescribed dose inthe other 3.Patients are still monitored by Q-PCRevery 3 months on peripheral blood and bone marrow.All 4 patients are currently Q-PCR negative after 6 to8 months from IM discontinuation. Despite theabsence of detectable disease by Q-PCR, these ptsmay have subclinical quiescent Ph'-positive stem cellsthat can be a source for disease relapse; but is alsopossible that control of minimal residual disease mayoccur by the normal marrow. However, although thefollow-up is relatively short, these data show that inselected patients with complete sustained molecularresponse to Imatinib, unmaintained molecular remissionmay persist after drug withdrawal.Gender/ Sokal Date Hemat Cy Resp Time Time to Time to Time from F-U afterage risk Diagn Resp to to from Diag CCyR Q-PCR Q-PCR neg IMa-IFN a-IFN to IM Tx neg to IM withdrawalwithdrawal1 M/60 low 1990 yes NR 137 6 9 13 82 F/51 high 1999 yes CCyR 33 -- 12 17 73 F/52 int 1995 yes NR 66 6 12 14 74 M/63 low 1998 yes NR 33 6 9 19 6All timimg measures are in months.PO-120CO-TREATMENT WITH DIFFERENT HDAC INHIBITORS AND IMA-TINIB MESYLATE RESTORES STI SENSITIVITY IN RESISTANTBCR/ABL POSITIVE CELLSGozzini A, Pastorelli R, Benvenuti M, Bosi A,Tombaccini D, Santini VDept. Of Critical Area Medicine, Dept of ExperimentalPathology and Oncology, University of Florence,ItalyImatinib mesylate (STI571, Glivec) is a powerfulinhibitor of the tyrosine kinase activity of Bcr/Abl, theoncoprotein responsible for chronic myeloid leukemia(CML). Histone deacetylase inhibitors (HDIs), shorthaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004135chain fatty acids such as sodium butyrate, suberoylanilidehydroxamic acid (SAHA), and valproic acid,represent a novel class of agents that act by promotinghistone acetylation. This in turn leads to transcriptionalactivation of diverse genes. HDIs have beenshown to induce maturation and apoptosis in varioushuman leukemia cells. Recently, SAHA has beendemonstrated to enhance STI571 induced apoptosis inCML cells. We evaluated the effect of combination ofImatinib with several HDAC inhibitors, a stable prodrugxylitol derivative of butyrate (D1), valproic acidand SAHA on Bcr/Abl positive cell lines, LAMA84 andK562, and on LAMA84 resistant subline, LAMA84RR0.6 and 8 CML-blastic crysis resistant to STI primarycells. The anti-proliferative effects of HDIs as singleagents and in combination with STI were analyzed.Both LAMA and K562 cell growth was inhibited byD1, with an IC50 of about 0.5 mM and to valproicacid with an IC50 of 0.5 microM, respectively. On thecontrary, LAMA84R0.6 showed a cross resistance toboth D1 and valproic acid, with IC50 >2 mM and >2µM. Co-treatment with STI571 (0,2-1,0 µM) and D1(0,5-1,0 mM) strongly inhibited cell proliferation,resulting in a marked synergistic effect in sensitive. Inresistant subline, the ID50 was significantly modified.In LAMA84 and LAMA84R inhibition of cell growthwas paralleled by induction of apoptosis, as demonstratedby Annexin V positivity and caspase-3 cleavage,as well as by cell cycle analysis. Interestingly,Imatinib as single agent induced a blockade of cellcycle in G0/G1 phase, exerting a cytostatic rather thana cytotoxic effect, whereas co-exposure to Imatiniband butyrates resulted in a marked activation of apoptoticpathways. We further evaluated the effect of asequential scheduled treatment. LAMA84 andLAMA84R cells were exposed to HDIs for 24 hours,then throughly washed and incubated with Imatinibfor 48 hours. This drug scheduling induces apoptosisin Bcr/Abl+cell lines, more potently than simultaneousexposure to butyrate and imatinib. Restoration ofSTI sensitivity in LAMA84R cells was demonstratedonly after simultaneous treatment with HDIs and imatinibas well as after the sequential scheduled treatment.These findings show that Imatinib/bytyratescombination may overcome in vitro resistance to Imatinib,and suggest that the strategy of combiningSTI571 with histone deacetylase inhibitors warrantsconsideration in CML and related hematologic malignancies.We also evaluated by Western Blotting therole of P-Tyr and Hsp90, a molecular chaperoneinvolved in signal transduction, cell cycle regulationand cell survival. The fusion protein Bcr/Abl could besubject to ubiquination and protesomal degradationin absence of Hsp90.PO-121CHRONIC MYELOID LEUKEMIA WITH AN UNCOMMON E8-INT-A2BCR/ABL FUSION TRANSCRIPT (P200) AND ATYPICAL HEMA-TOLOGICAL FEATURES: REPORT OF A CASE PRIMARILY RESIS-TANT TO IMATIMIBDiverio D,* Scaramucci L,° Niscola P,° Anghel G,°Giuliani N,* Gomes V,^ Luzi G,° Palombi F,° Foà R,*Montanaro M°*Department of Human Biotechnologies and Hematology,“La Sapienza" University, Rome; °HematologyUnit, ASL Viterbo, ^Department of Pathology, ASLViterbo, ItalyThe hallmark of chronic myeloid leukemia (CML) isthe chromosomal translocation t (9; 22)(q34; q11.2).In most cases, the resulting fusion genes give rise todifferent length products corresponding to chimericBCR-ABL proteins of 210 or, more rarely, 190 or 230kDa, respectively. We report the case of a patientsdiagnosed as having CML, showing atypical hematologicfeatures and a very uncommon BCR-ABLrearrangement. A 45-year old woman, only son, wasreferred to our attention because of a normochromicanemia, thrombocytosis and a mild basophilia, discoveredthrough a routine blood count. On admission,Hb was 11.7g/dl, Hct 33.1%, white blood cells4,650/mL (neutrophils 1,870/mL, lymphocytes2,440/mL, monocytes 190/mL, eosinophils 69/mL andbasophils 280/mL) and platelets 531,000/mL. A comprehensivelaboratory work-up showed no furtherabnormalities. Physical and imaging examinationsrevealed no pathological findings; no spleen or liverenlargements were found. The peripheral bloodsmears confirmed the thrombocytosis and the mildincrease in the number of basophils; some hypogranulatedand banded neutrophils were also noted. TheBM was markedly hypercellular mainly because of agranulocytic and megakaryocytic hyperplasia. Mostmegakaryocytes were monolobulated. Myelodisplasticfeatures, such as hyposegmented and hypogranulatedgranulocytes, were also found. The G-bandedkaryotype revealed a typical t (9; 22) chromosomaltranslocation in 5 of the 25 (20%) metaphases analyzed.Reverse transcription-polymerase chain reaction(RT-PCR) analysis, using primers derived frombcr exon e1 and abl a3, showed an atypical amplificationband. Sequencing analysis of the PCR productrevealed that the breakpoint on the BCR gene fellwithin exon 8.Moreover, the portion of exon e8 ofthe BCR gene was not directly joined to ABL exon a2due to an insertion of 15bp derived from ABL intronb1, giving rise to an in-frame e8-int-a2 BCR-ABLfusion transcript. This latter was translated into ap200 BCR-ABL protein. Further molecular analysesexcluded the activation of the some genes, which arehaematologica vol. 89[suppl. n. 6]:september 2004

136Posterscurrently under study because of their suggestedrelationship with a good response to imatinib, suchas the platelet-derived growth factor receptor β(PDGFRB), the FIP1L1-PDGFR (α) and the FGFR1fusion tyrosine kinases. The patient received standarddose of imatimib mesylate for six months withoutbenefit, as demonstrated by the evidence of the t (9;22) chromosomal translocation in 7 of the 14 (50%)metaphases on conventional cytogenetic studies andby the persistence of the molecular transcript by RT-PCR analysis. To date, given the availability of severalHLA identical marrow unrelated donors, the patientis waiting to receive allogenic stem cell transplantationin the aim to achieve the cure of disease. In conclusion,we characterized a rare type of chimericBCR-ABL mRNA transcript in a patient with an atypicalPhiladelphia chromosome positive CML. Althoughthe expression of the p200 protein in CML have beenyet reported (Martinelli G et al. , Hematologica 2000)our patient, showed very atypical hematological features,such as the lack of leukocytosis and of splenomegaly,mimicking a combined myeloproliferative/myelodisplasticdisorder. To the best of ourknowledge, this is the first patient of CML expressingthe p200 protein reported in the imatinib era andthe first case of unresponsiveness to this agent.PO-122IMATINIB IN LATE CHRONIC PHASE CML PATIENTS.LONG-TERM MOLECULAR EVALUATION IN COMPLETECYTOGENETIC RESPONDERSBassi S, 1 Amabile M, 1 Martinelli G, 1 Rosti G, 1Trabacchi E, 1 Castagnetti F, 1 Giannini B, 1 Cilloni D, 2Izzo B, 3 De Vivo A, 1 Testoni N, 1 Rege Cambrin G, 2Soverini S, 1 Luatti S, 1 Iacobucci I, 1 Gottardi E, 2Dorigo A, 4 Pane F, 3 Salvatore F, 3 Saglio G, 2 BaccaraniM 1 (on behalf of the GIMEMA CML Working Party)1Institute of Hematology and Medical Oncology “L.and A. Seràgnoli”, University of Bologna; 2 Division ofHematology and Internal Medicine, Department ofClinical and Biological Science, University of Turin;3CEINGE Biotecnologie Avanzate and Department ofBiochemistry and Medical Biotechnology, Universityof Naples Federico II; 4 Novartis Pharma, Origgio, ItalyImatinib (Ima) is a tyrosine-kinase inhibitor, highlyeffective in CML. The proper follow-up of Imatreated patients is based on cytogenetic (conventionaland FISH, as appropriated) and molecular tecniques:particularly, complete cytogenetic responders(CCgR) require the assessment of molecular response(MR) through a molecular quantification. The longtermmolecular follow up of these patients wouldallow to evaluate the rate of overall and major molecularresponse and the prognostic impact of differentlevels of bcr-abl transcript reduction, given thesame, complete, cytogenetic result. The GIMEMA CMLWorking Party conducted a phase II clinical trial(CML/002/STI571) in late chronic phase CML patients,resistant to or intolerant of recombinant interferon.During this study,the cytogenetic response wasassessed after 3, 6, 12 months on Ima and every 6months thereafter. The MR was evaluated (bone marrow)at the same check-points. MR was assessed withReal-time quantitative (Taqman) RT-PCR and wasexpressed as the ratio between BCR/ABL and β2-microglobulin×100.The lowest level of detectability ofthe method is 0.00001 (major molecular response).Since August 2000 284 patients were enrolled andtreated with Ima 400 mg/daily. One-hundred andfifty-one out of 284 (53%) obtained a CCgR; 114/151(75%) obtained the CCgR within 12 months on Ima.Ninety-one/114 patients (80% of CCgR respondersor 32% of the whole patient population) maintainedthe CCgR in the long-term (stable CCgR). The resultson the MR of these CCgR have been published (Blood2004; 103:2284-2290): the median value of MR was0.0008 after 12 months and 0.0001 after 24 months,the transcript level being undetectable in 22 cases. Areduction of the transcript level of more than 2 logswas achieved in all but nine cases of CCgR vs noneof 23 cases of partial cytogenetic responders. Theseresults, with a median follow-up of 36 months, willbe updated.Funding: Study supported by COFIN2003 (M. Baccarani),AIRC, AIL, Fondazione Del Monte di Bolognae Ravenna, FIRB2001.PO-123ROLE OF CIRCULATING CD34 + CELLS IN THE DIAGNOSIS ANDFOLLOW-UP OF PATIENTS WITH CHRONIC MYELOPROLIFERA-TIVE DISORDERSRumi E,* Passamonti F,* Vanelli L,* Malabarba L,*Pungolino E,° Consensi E,* Tenore A,* Picone C,*Pascutto C,* Morra E,° Lazzarino M**Division of Hematology, University of Pavia MedicalSchool & IRCCS Policlinico S. Matteo, Pavia, and°Division of Haematology, Niguarda Cà GrandaHospital, Milan, ItalyRecently, our group (Passamonti et al. , Haematologica2003) demonstrated that an increased numberof circulating CD34 + cells is an integral feature ofmyelofibrosis with myeloid metaplasia (MMM). Tosubstantiate these results, we expanded previousdata. In a prospective study, we evaluated the clinicalutility of this parameter in 298 consecutivepatients with chronic myeloproliferative disorders(CMDs). These included 121 patients with polycythemiavera (PV), 113 with essential thrombo-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004137cythemia (ET), and 64 with MMM. We prospectivelyfollowed 103 with sequential (yearly) enumerationof circulating CD34 + . The median number of circulatingCD34 + cells was 2.3×10 6 /L (range 0-5) in 20control subjects, 2.3×10 6 /L (range 0-14) in PV,2.4×10 6 /L (range 0-14) in ET, and 96×10 6 /L (range 4-4620) in MMM. We confirmed on a larger number ofpatients that the best cut-off value for distinguishingbetween MMM and PV or ET is 15×10 6 /L, athreshold that can be reliably employed in the differentialdiagnosis of CMD. The sequential evaluationof CD34 + cells showed that MMM evolving fromPV or ET is associated with elevated circulating CD34 +cell counts. In conclusion, enumeration of circulatingCD34 + cells should be included in the workup ofpatients with CMD.PO-124MOLECULAR AN CYTOGENETIC RESPONSE TO IMATINIB MESY-LATE IN CHRONIC MYELIOD LEUKEMIA PATIENTS: EXPERIENCEOF A SINGLE CENTERNovella E, D'Emilio A, Guercini N, Montaldi AM,Albiero E, Giaretta I, Madeo D, Rodeghiero FDepartment of Cell Therapy and Haematology, SanBortolo Hospital, Vicenza, ItalyBackground and Objectives. Chronic myeloidleukemia (CML) is a clonal disorder associated withPhiladelphia (Ph) translocation t(9;22). An Abl tyrosinekinase inhibitor, imatinib mesylate (STI571, Gleevec),induces complete cytogenetic remissions in at least70% of previously untreated patients. It is very effectivein chronic phase (CP) patients, resistant or intolerantto interferon (INF) and in both accelerated phase(AP) patients and blast crisis, where conventionalchemotherapy and INF are ineffective. To date, littledata are available concerning molecular remission.The aim of this study was to evaluate the cytogeneticresponse (CgR) and the molecular response (MolR)in a group of CML patients enrolled in a therapeuticprotocol with imatinib mesylate at our Departmentbetween January 2001 and July 2003.Design andMethods. We studied 39 adult CML patients (3 AP, 36CP), with a median age of 53 years (range 25-71),receiving imatinib mesylate at the standard recommendeddose (400mg day), after failure of INF therapyor as single agent. The CgR was defined accordingto UK Medical Research Council practice as complete(0%Ph+ metaphases), major (1-34%Ph+ methaphases),partial (35-65%Ph+), minor(66-95% Ph+) and noresponse (95-100% Ph+). The MolR was defined bytwo consecutive negative samples, using nested-PCRapproach. Samples for cytogenetic and molecularanalysis were collected every 3-6 months. The riskscore was calculated using both available score systems,Sokal's score and Euro score. Low risk cases weredefined by a score 1480 (Euro). The remaining cases were classified asintermediate. Results. Ten of 36 CP patients receivedonly imatinib mesylate, while the others were previouslytreated with INF and/or hydroxyurea. Twentysevenwere low risk cases, the remaining were pooledin the intermediate risk group. Patients were observedfor a period of 4-37 months. Twenty-five of 34patients, with Ph+ mosaicism from 20 to 100%,reached a complete CgR. The median time to responsewas 8 months; 25% responded within 3 months. Twopatients, already in CgR prior to imatinib treatment,did not relapse after 16 and 26 months of treatment.Two patients had major response, three minor and 6no response. Two of the three AP patients treated haddisease progression and died, the third returned in CP.MolR was observed for one patient, who reached amajor CgR before starting imatinib; to date, thispatient remains in MolR, after 36 months of treatment.Recently, two other patients reached MolR inthe last bone marrow sample collected, but confirmationis necessary. Interpretation and Conclusions.Based on this relatively small cohort of patients, weconclude that treatment with standard doses of imatinibmesylate allow to reach a CgR in a high proportion(73,5%) of cases, but only in few of them a MolRis attained (2.9%). No correlation was found betweenrisk profile and response to therapy. Higher doses ofimatinib may be more effective to achieve a higherrate of sustained molecular remission.PO-125CYTOGENETIC AND MOLECULAR RESPONSE IN A SMALLCOHORT OF CHRONIC MYELOID LEUKEMIA PATIENTS TREATEDWITH LOW DOSE IMATINIBLuciano L, Pane F, Lucania A, Arcamone M, Izzo B,Quintarelli C, De Angelis B, Guerriero A, Salvatore F,Rotoli BDivision of Hematology and CEINGE, Federico IIUniversity, Naples, ItalyThe new tyrosine kinase inhibitor STI 571 (Imatinib)is an innovative therapy for patients with chronicmyeloid leukemia (CML). It induces complete hematologicalremission in the majority of patients inchronic phase and a complete cytogenetic responsein about 60% of them. The drug is well tolerated andhas a manageable side effect profile. For patients inchronic phase, Imatinib is used at the standard doseof 400 mg/day, even if dose adjustment is sometimesnecessary due to side effects. The hematologic andcytogenetic responses are reported to be more frequentin patients taking > 350 mg/day than < 350haematologica vol. 89[suppl. n. 6]:september 2004

138Postersmg/day (Haematologica 2002;87: N Engl J Med2001;344). We analyzed the hematological and cytogeneticresponse in a small cohort of patients whoreceived imatinib at dose < 350 mg/day. We treated20 patients at < 350 mg/day because of side effectsor elevated age. The patients were followed up withphysical examination complete blood count and differentialweekly for the first month, every 15 daysfor the second month and monthly thereafter; renaland liver parameters were checked monthly. A bonemarrow aspiration was performed every 3 to 6months after the start of therapy. Of the 20 patients,13 received the standard dose of 400 mg/day for amean of 54.3 days and reduced the dose thereafterbecause of side effects (persistent leukopenia andthrombocytopenia intense leg pain often withreduced motility requiring non-steroidal anti-inflammatorydrugs in absence of previous hystory of arthritis).Six patients were started with 300 mg/daybecause of age or cardiac failure. The Sokal risk stratificationin this group of patients was: 14 patients inlow risk, 4 in intermediate risk and 2 patients in highrisk. All patients received a mean dose of 229,411mg/day with a mean follow-up of 11,9 months (range9,2- 33,6 ). All patients started with the lower doseachieved hematological remission in a mean of 18,5days; those who reduced the dose for side effectsremained in complete hematological remission. 19/20patients showed a major cytogenetic response after3-6 months of therapy. During the follow up, in twopatients a dose escalation was needed after sixmonths, because of cytogenetic relapse; one patientstopped treatment because of hepatic failure; 8patients remain in hematological and cytogeneticresponse, but not in molecular response; 9 patients,indeed, has showed molecular response too, withmarked decrease in p210 RNA copies. These data suggestthat even with reduced doses Imatinib may giveexcellent responses in selected CML patients.PO-126EMERGENCE OF TRISOMY 8 IN PH-NEGATIVE CELLS DURINGIMATINIB MESYLATE THERAPY IN A CML PATIENT: A CASEREPORT AND REVIEW OF THE LITERATUREDoretto P,° Ermacora A,* Cappelletti P,° Virgolini L*°Department of Laboratory Medicine, Service of ClinicalPathology, *II Division of Medicine, AziendaOspedaliera S. Maria degli Angeli, Pordenone, ItalyThe recent introduction of imatinib mesylate, thenovel Abl-specific kinase inhibitor, represents a veryimportant therapeutic option in chronic myelogenousleukemia (CML), inducing complete cytogeneticresponse (CCR) or major cytogenetic response (MCR)in a considerable number of patients in all CML phases.In a few CML patients who obtained a cytogeneticresponse, the development of additional chromosomalaberrations in Ph-negative cells during imatinibmesylate treatment has been recently described. Themost common cytogenetic abnormality observed wastrisomy 8.We report a case of an old CML patient,pretreated only with hydroxyurea, who was administeredimatinib for disease progression to acceleratedphase. The metaphase karyotypic analysis performedafter 6 and 12 months of imatinib therapyrevealed the appearance (in MCR) and persistence (inCCR) of a new aberrant Ph-negative clone with trisomy8.Morphological analysis of bone marrow performedafter 6 and 12 months of therapy, showedatypical megakariocytic hyperplasia, mild dysplasticfeatures of myelopoiesis, dysplastic erythropoiesis.Twenty-four months later the patient is still in CHr(complete hematological response). The biological,clinical and prognostic significance of this phenomenonis still in debate: although the development oftrisomy 8 in Ph-negative cells seems not represent apotential adverse event, however the reports are stilllimited and the follow-up is too short. We welcomefurther studies and a case register for the evaluationof long-term significance of this abnormality andmoreover we recommend a close monitoring of allCML patients on imatinib by classical cytogeneticanalysis even after achieving CCR.PO-127DETECTION OF FIP1L1-PDGFR FUSION GENE IN ELEVENPATIENTS WITH HYPEREOSINOPHILIARocca B, 1 Bernasconi P, 1 Calatroni S, 1 Boni M, 1Cavigliano PM, 1 Giardini I, 1 Zappatore R, 1 CaresanaM, 1 Quarna J, 1 Invernizzi R, 2 Girino M, 2 Cilloni D, 3Ottaviani M, 4 Martinelli G, 4 Lazzarino M 11Università degli Studi di Pavia, Divisione di Ematologia,Policlinico San Matteo IRCCS, Pavia; 2 Universitàdegli Studi di Pavia, Clinica Medica II, PoliclinicoSan Matteo IRCCS, Pavia; 3 Università degli Studi diTorino, Azienda Ospedaliera San Luigi Gonzaga, Torino;4 Università degli Studi di Bologna, Istituto diEmatologia ed Oncologia Medica “L & A. Seragnoli”,Policlinico Sant’ Orsola, Bologna, ItalyChronic eosinophilic leukemia (CEL) and idiopathichypereosinophilic syndrome (IHES) are rare hematologicaldisorders showing unexplained and persistentperipheral blood hypereosinophilia due toeosinophil overproduction by the bone marrow. Theirclinical course may be indolent or aggressive withfunctional damages targeting various peripheralorgans. The World Health Organization (WHO) hasestablished accurate diagnostic criteria for CEL andIHES: presence of hypereosinophilia (>1.5×10 9 /L) per-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004139sisting for more than 6 months with signs and symptomsof organ involvement, absence of causes ofreactive eosinophilia (parasitic infections, allergicreactions). In addition, CEL is diagnosed in patientswith proven clonality (patients either with a cytogeneticor a molecular defect), in contrast IHES in all theother cases. Recently, a novel fusion gene, FIP1L1-PDGFRA, resulting from an 800 kb interstitial crypticdeletion on chromosome 4q12, has been identified asthe recurrent clonal molecular abnormality inpatients with CEL. The FIP1L1-PDGFRA chimeric gene,which may be identified by in situ hybridization (FISH)or by nested RT PCR, produces a constitutively activetyrosine kinase, strongly inhibited by imatinib (STI-571). Recent evidence suggests that patients withhypereosinophilia are responsive to imatinib, whichinduces rapid and complete hematologic remissionsat lower doses than those given to patients withchronic myeloid leukemia. Nevertheless, a clinical andgenetic heterogeneity of the disease is suggested bythe fact that not every FIP1L1-PDGFRA positivepatient responds to imatinib therapy and that 40% ofthe responsive patients are FIP1L1-PDGFRA negative.In the present study a RT PCR assay was used fordetecting the chimeric transcript FIP1L1-PDGFRA intwelve patients who fulfilled the WHO criteria forIHES and CEL. In particular nine patients were malesand three females; their median age was 51.5 (22-70). All patients had been submitted to cytogeneticanalysis which showed a completely normal chromosomepattern. In addition, FISH with probes specificfor the chromosome breakpoints most frequentlyinvolved in hypereosinophilic syndromes but not forFIP1L1 and PDGFRA was also applied. It alwaysshowed a normal pattern. As far as RT PCR is concerned,total RNA was extracted from peripheralblood or bone marrow mononuclear cells, usingRNeasy kit (Qiagen) and reverse transcribed with randomhexamers and SuperScriptII (Invitrogen) accordingto manufacturers conditions. Nested PCR amplificationwas performed with the following primers:FIP1L-F1 ACCTGGTGTGATCTTTCTGAT and PDGFRA-R1TGAGAGCTTGTTTTTCACTGGA; FIP1L-F2 AAAGAGGAT-ACGAATGGGACTTG and PDGFRA-R2 GGGACCGGCT-TAATCCATAG, into a final reaction volume of 50 ml.PCR products were analysed by 2.5% agarose gelelectrophoresis. A FIP1L1-PDGFRA chimeric transcriptwas detected in three out of the twelve patients.Therefore, basing on WHO criteria the three FIP1L1-PDGFRA positive patients were classified as CEL,whereas all the other 8 were considered IHES. Theformer patients were included in the Italian CooperativeStudy on Idiopathic Hypereosinophilic Syndrome(HES) and underwent treatment with escalating dosesof imatinib. Two patients were monitored withqualitative RT PCR, achieved negative results andtherefore entered a molecular and hematologicalcomplete remission (CR). In conclusion our resultsconfirm that FIP1L1-PDGFRA positive CEL must beconsidered a rare well-defined clinicobiological entity,highly responsive to imatinib.PO-128A CASE OF PHILADELPHIA NEGATIVE CHRONIC MYELOIDLEUKEMIA WITH THE ABL/BCR FUSION GENE ONCHROMOSOME 9Giambanco C, Gervasi F, Ferraro AL, Lo Verso R,Bernasconi P,° Cavigliano PM,° Pagnucco GU. O. Ematologia A. R. N. A. S. Civico-Benfratelli, G.Di Cristina e M. Ascoli, P. O. M. Ascoli °Istituto diEmatologia IRCCS Policlinico San Matteo, Universitàdi Pavia, ItalyChronic myeloid leukemia (CML) is probably themost extensively studied human malignancy. Themolecular hallmark of CML is the formation of a bcrablfusion gene, usually formed as a consequence ofthe Philadelphia (Ph) translocation involving chromosomes9 and 22.Approximately 5% of patientswith CML do not reveal the Ph chromosome cytogeneticallyand are termed Ph-negative CML cases. Wereport the case of a patient, admitted to anotherinstitution, who was made a diagnosis of Ph-positiveCML. Initially, the patient received administration ofinterferon having a severe reaction then a daily oraladministration of Imatinib mesylate (formerly STI571:Glivec TM) was started at 400 mg daily, but the druggave all sorts of unpleasant symptoms. A hydroxyureatherapy was defined. Of late the patient referred toour clinic for a second opinion and treatment. Cytogeneticanalysis showed a normal karyotype whereasthe reverse transcriptase polymerase chain reactiontechnique revealed a rearrangement of the M-bcr and expression of a chimeric bcr/abl mRNA ofb2a2 configuration. We have performed fluorescencein situ hybridization (FISH) analysis using a commerciallyavailable dual color, dual fusion, bcr-abltranslocation probe (Vysis), which revealed atypicalsignal patterns in all mitoses observed: the presenceof the bcr-abl fusion was found to be localized tochromosome 9 long arm, an abl probe signal wasobserved on the other chromosome 9 and two bcrsignals of different sizes on each of chromosomes 22.Other cases of a fusion abl and bcr gene localized tochromosome 9q34, and not on chromosome 22q11,have been documented in the literature, and the clinicaldata reported a poor therapeutic response andoutcome in such patients, suggesting a possibleworse prognostic impact of this aberrant location ofthe bcr-abl. We decided to start therapy with Glivecat daily doses of 100 mg considerably lower thanthose dosages required for the treatment of CML andhaematologica vol. 89[suppl. n. 6]:september 2004

140Postersno severe reaction were observed. After six months oftherapy, our patient is in haematologic remission; insitu hybridization detected the bcr-abl fusion to belocated on both chromosomes 9 in 10% of themetaphases examined, while the remaining cellsshowed co-localization at only one of the chromosomes9.In despite of fact that the patient showed nocytogenetic response, the haematologic remission isprobably due to outstanding efficacy of Glivec thatbinds to a CML chimeric product leading the bindingsite in the catalytic center of the kinase in considerationof proved growth inhibitory effects. In the presentstudy, we demonstrated that FISH analysis playsan increasing role in the diagnosis and monitoringtherapeutic response of CML patients with unusualPh translocation; in fact, if M-bcr specific primersare used in such patients, the expression of a typicalbcr-abl mRNA will be obtained, precluding the possibilityto define a subgroup of patients with differentclinical and prognostic outcome compared totheir bcr-abl-positive counterparts. Furthermore,since a favourable clinical course is confirmed in thiscase of tolerance of Glivec at low doses, we suggestthat the routine use of FISH analysis might have animpact on the choice of treatment.PO-129INTRASPLENIC CHEMOTHERAPY IN PATIENTS WITH CHRONICMYELOPROLIFERATIVE DISORDERS AND HYPERSPLENISMFilardi N, Molfese V,* Pizzuti M, Attolico I,Vertone D, Ricciuti FU. O. di Ematologia, *Radiologia Ospedale San Carlo,Potenza, ItalyChronic myeloproliferative disorders (CMD) maycause severe hypersplenism with subsequent cytopeniaand abdominal pain. When conventional therapyfails, splenectomy or splenic irradiation remain theonly therapeutic option for hypersplenism. Intra-arterialchemotherapy through a percutaneous arterialcatheter, which is often used for the treatment ofsolid tumors, is not commonly used in malignanthematologic diseases. In our study we performedintrasplenic infusion of cytosine arabinoside (ARA-C) in patients with CMD in which conventional therapyhad failed or had been too toxic, to improve theblood cell count and reduce the volume of spleen andthe abdominal pain. We treated 3 patients, 2 femaleand 1 male, median age 65 years (range 53-77); 2 ofthem had myelofibrosis with myeloid metaplasia(MMM), 1 had Philadelphia negative chronic myeloidleukemia (Ph-CML). A Port-a-cath was implanted atthe upper third of the right thigh. The right femoralartery was punctured and the splenic artery wasselectively catheterised. Intrasplenic ARA-C wasadministered at the dose of 10mg/m 2 /day for 5 consecutivedays/month, continuous infusion. The dosagewas increased each month by 10 mg/m 2 /day up to amaximum of 50 mg/day for 5 consecutivedays/month. We observed in all patients reduction ofthe spleen volume (4 cm reduction on average) andimprovement of the abdominal pain and of the anemia(1.5 g/dl increase on average). Two of the threepatients are alive (12 and 8 months after the beginningof intrasplenic chemotherapy), one underwentsplenectomy two months after the beginning ofintrasplenic chemotherapy and died two months aftera MUD BMT. We did not observe any hematologictoxicity. Local haemorrhage occurred in two of thethree patients when the PAC was implanted. In CMDwith hypersplenism, with pain and cytopenia, anintrasplenic chemotherapy may be useful. This procedurereduces the abdominal pain and the spleenvolume and slightly improves the blood cell countwithout showing haematologic toxicity. It is veryimportant to check carefully the platelet count andclotting tests when the PAC is implanted to avoidlocal haemorrhages.PO-130BONE MARROW NECROSIS DURING TREATMENT WITH IMATINIBMESYLATE FOR A BLASTIC CRISIS OF CHRONIC MYELOIDLEUKEMIACampiotti L, Codari R, Ultori C, Solbiati F,Marchesi C, Grandi AMDipartimento Medicina Clinica, Università dell’Insubria,Varese, ItalyBone marrow necrosis is a rare event that occoursafter chemotherapy for acute leukemia or othermalignant disease. We describe a case of a 67-yearold man affected by chronic myeloid leukemia, BCR-ABL positive, started with a myeloid blastic crisis. Thepatient performance status was excellent and theonly clinical sign of the disease was splenomegaly(longitudinal diameter 20 cm). At the diagnosis wefound: high leukocytic count (WBC 190.000 mm 3with 70% of myeloid blast), mild anemia (HB 10gr/dL), normal platelet count. Hepatic and renal testwere normal. The patient began treatment with 600ml/die of imatinib mesilato associated for the firstweek with hydroxyurea 2gr/die. The treatmentinduced a rapid desapperance of blasts. After 20 daysthe patients developed a severe aplasia that requiredsupportive treatment with red cells and platelettransfusion, administration of G-CSF. Treatment withimatinib mesilato was stopped. Together with aplasiathe patient reported an intense pain at the left legthat increased during walking. A bone scanning withtecnetium did not evidence abnormal accumulation.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004141T1 weighted magnetic resonance imaging scanningof the legs showed, in both femours, diffused roundlesions with a low signal intensity without significativecontrast impregnament in T2 weighted imaging:this was indicative of bone marrow necrosis. Usuallyit is asymptomatic,it develops in large bones (femoursand pelvis) and its extent is directly related to thedisease stage. This is the first report of bone marrownecrosis occuring during treatment with imatinibmesilato at standard dosage. Therefore our experiencesuggests the need of special care when treatingfor the first time with imatinib mesilato patientsaffected by advanced stage of chronic myeloidleukemia, in order to rapidly detect complicancesrelated with a too rapid blasts apoptosis.PO-131CYTOGENETIC RESISTANCE AND HEMATOLOGICAL SENSITIVITYTO IMATINIB THERAPY IN CML: THE ROLE OF APOPTOSISRELATED GENEMiglino M, 1,2 Angelini I, 1,2 Grasso R, 1,2 Colombo N, 1,2Garrone A, 1,2 Varaldo R, 1,2 Canepa L, 1,2 Fugazza G, 1Clavio M, 1,2 Bruzzone R, 1 Canepa P, 1,2 Pierri I, 1,2Ballerini F, 1,2 Sessarego M, 1 Gobbi M 1,21Department of Internal Medicine (DIMI), Universityof Genova, Italy; 2 Department of Haematology andOncology, Azienda Ospedale S. Martino e ClinicheUniversitarie Convenzionate, Genova, ItalyThe introduction of Imatinib has greatly modifiedthe picture of CML significantly increasing the numberof complete remissions that were very few withprevious therapies. Imatinib mesylate has been shownto powerfully and selectively inhibit ABL protein tyrosinekinase activity and to suppress in vitro and invivo growth of BCR-ABL positive cell lines. It seemsthat escape from apoptosis may be a requisite eventin the development of malignant neoplasms. Genesthat can influence cell viability versus cell death havebeen described, including genes belonging to the bcl-2 family. Related genes of this large family encodeproteins that regulate apoptosis both in a negativeand, in some instances, positive fashion. In addition,alterations in the expression of these genes maycause aberrations in cell death and thus contribute tocancer. We evaluated, by reverse transcriptase polymerasechain reaction (RT-PCR), the expression ofgenes related to apoptosis, such as bcl-2, bax, bcl-X,and survivin, in cytogenetic resistant, but haematologicalsensitive to Imatinib patients. We comparedsuch results with the expressions of apoptosis relatedproteins in blastic phase of CML patients and indiagnosis samples. We studied 10 patients, enrolledin the Novartis-sponsored multi-institutional PhaseII trials. All these patients after 24 months of Imatinibtherapy were in maintained complete haematologicalresponse while all analyzed metaphases showedthe persistance of Ph chromosome. The data obtainedfrom these patients were compared with thoseobtained from the study of 5 diagnosis sample, 5cytogenetic responders to Imatinib therapy and 2myeloid and 2 lymphoid blastic phases. (i) Bcl2expression: bcl2 gene expression was found in 10/10cytogenetic resistant patients and in 5/5 diagnosissamples. Bcl2 expression was absent in cytogeneticresponders and in blastic phase patients. (ii) Survivinexpression: survivin gene expression was found to bepositive in the 24 cases studied. (iii) x- Bax expression:bax gene expression was found to be positive inall the haematological responders. Among the diagnosissample 3 cases disclosed the gene expression.Two high risk patients do not show bax gene expression.The 2 myeloid blastic crisis samples lost geneexpression while in 2 lymphoid blastic crisis theexpression was still detectable. (iv) Bcl-X expression:In all the blastic crisis and in the diagnosis samplesthe gene expression was not present. The 10 cytogeneticresistant cases studied disclosed the presence ofthe expression with the preponderance of the antiapoptoticisoform. The complete cytogenetic samplesdisclosed or the absence of gene expression (two cases)or the prevalence of the proapoptotic isoform. Itis thus possible that in those patients who achievehaematological but not genetic remission due to specifictyrosine-kinase inhibitor, can occur, both a blockin proliferation and an immediate reactivation whichshould be mediated by a pathways involved in theimmortalization of the neoplastic clone. The understandingof these processes may be of help in determiningthe pathogenesis of this diseases and in thetherapeutically trials.PO-132CYTOGENETIC AND MOLECULAR HETEROGENEITY IN ATYPICALCHRONIC MYELOID LEUKEMIAGiugliano E,* Cilloni D,* Rege-Cambrin G,*Scaravaglio P,* Gottardi E,* Pini M,^ Mancini S,°Saglio G**Laboratory of Molecular Medicine e Oncology,Department of Clinical and Biological Sciences,Ospedale S. Luigi Gonzaga, Orbassano; ^Divisione diEmatologia, Ospedale di Alessandria; °Divisione diEmatologia, Ospedale San Camillo, Rome, ItalyChronic myeloid leukemia (CML) is characterizedin 95% of the cases by the presence of the BCR/ABLfusion gene, that constitutively actives a tyrosinekinase, usually in association with the t(9;22)(q34;q11) translocation. However a small number ofcases (5%) exist that appear to be quite similar tohaematologica vol. 89[suppl. n. 6]:september 2004

142PostersCML for clinical and haematological features but donot present the BCR/ABL chimeric protein; up to nowthis group of patients is included in the BCR/ABL negativeCML or atypical CML or CML-like MPD group.We report 13 cases that were associated with aPhiladelphia negative, BCR/ABL negative myeloproliferativedisorder characterized by leukocytosis (consistingprimarly of mature neutrophilis and neutrophilprecursor in the peripheral blood), presence of immaturedysplastic myeloid cells in bone marrow andperipheral blood, low basophil count, monocytosis(

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004143PosterSTEM CELL TRANSPLANTATION IPO-134PEG-FILGRASTIM AFTER AUTOLOGOUS PERIPHERAL BLOODSTEM CELL TRANSPLANTATION FOR HEMATOLOGICAL MALIG-NANCIES: PRELIMINARY RESULTSPiccirillo N, De Matteis S, Laurenti L, Chiusolo P,Reddiconto G, Farina G, Sorà F, De Vita S, d'OnofrioG, Leone G, Sica SUniversità Cattolica del Sacro Cuore, PoliclinicoUniversitario A. Gemelli, Istituto di Ematologia, Rome,ItalyHigh-dose chemotherapy with autologous peripheralblood stem cell transplantation (aPBSCT) hasbeen used for the treatment of several malignanciesbecause of a more rapid haemopoietic recovery thanautologous bone marrow transplantation (ABMT),and also less supportive care and a shorter hospitalization.Myeloid growth factors (G-CSF and GM-CSF)were introduced into clinical practice to accelerateneutrophil recovery after PBSCT in order to shortenthe duration of neutropenia, although there is noconsensus about their indications and schedules ofadministration. Recently Peg-Filgrastim, a G-CSFform characterized by a increased plasma half-life,has been approved for clinical use. It was developedlinking a 20-kd polyethylene glycol molecule to theN-terminal of the Filgrastim molecule. This modificationimplies a greater physical and thermal stability,the resistance to enzymatic degradation and thedecreased renal clearance; therefore, neutrophilmediatedclearance becomes the predominant routeof elimination; lower is neutrophil count, higher isdrug plasmatic level. Recent clinical trial have shownthat a single 6 mg dose of Peg-Filgrastim perchemotherapy cycle can reduce the duration ofchemotherapy-induced neutropenia as safely andeffectively as daily administered Filgrastim. Althoughin our institution the use of G-CSF after unmanipulatedaPBSCT is not a routinely procedure, in order toverify the efficacy and feasibility of use of Peg-Filgrastimin transplant setting, we administered topatients submitted to aPBSCT for haematologicalmalignancies a single subcutaneous dose of 6 mgPeg-Filgrastim on day +1 after stem cells infusion. Inthis study there were 8 patients, 3 female, 5 male,median age was 49 years (range 34-62), 5 affectedby non-Hodgkin's Lymphoma, 3 affected by MultipleMyeloma; disease status at transplant was progressivedisease in 2 patients, partial remission in 2patients and complete remission in 4 patients. Conditioningregimens were BuMel (Busulfan 4 mg/kgon day -5 through -2; Melphalan 90 mg/m 2 on day -1) in 7 patients, HDMel (Melphalan 100 mg/m 2 onday -3 and -2) in 1 patients. On day 0 patientsreceived a median of 7.4×10 6 /kg CD34 + (range 3.9-16.5×10 6 /kg). We evaluated hematological engraftment,and other clinical outcomes; all results areexpressed as a median value in Table 1. All patientsshowed a prompt engraftment and were dischargedon the average of 16 days after cell infusion. Peg-Filgrastimadministration was well tolerated in all but1 patient reporting bone pain for three days afterdrug administration. No erythema or other locallesion appeared at the site of the injection. Our preliminarydata showed feasibility, safety and efficacyof Peg-Filgrastim administration after aPBSCT forhaematological malignancies. Drug administrationresulted in an expected acceleration of neutrophilrecovery without detrimental effect on the overallengraftment providing, with single administrationschedule, a better compliance and comfort forpatient. Based on these data is now ongoing a largerstudy in order to assess the potential benefits ofthis approach on the other clinical outcomes such assepsis occurrence, days of fever, antibiotic therapy,length of hospitalization and economical impact ofPeg-filgrastim.haematologica vol. 89[suppl. n. 6]:september 2004

144PostersPO-135THE ATG-SAPORIN-S6 IMMUNOTOXIN CAUSE A COMPLETEDEPLETION OF ACTIVATED T CELLSFarini V, Polito L, Stirpe F, Tazzari PL,° Bolognesi ADipartimento di Patologia Sperimentale, Universitàdi Bologna, Bologna, Italy; °Servizio di Immunoematologiae Trasfusionale, Policlinico “S. Orsola”, Bologna,ItalyT-cells play a key role in priming GVHD (graft-versus-hostdisease) or the immune response to allogeneictransplanted organs. After encountering theantigen, T-cell fate can be apoptosis, anergy or activation.Currently the main immunosuppressive agentsact inhibiting the various steps of T-cell activationpathway or causing lymphocyte depletion. 1 ATG, antithymocyteglobulin, held on the early success of solidorgan transplantation in the 1960-70s, and in the1980s, it found new roles combating GVHD in thebone marrow transplant unit and treating aplasticanemia. 2 Recently, there have been reports that ATGalso benefits some patients with myelodysplastic syndrome.3 Immunosuppressive therapies with combinationsof ATG and chemotherapic drugs (cyclosporine,cyclophosphamide, fludarabine, ecc. ) induceresponses up to 70% of patients. However theseresponses can be often transient. An efficient way toimprove antibodies effects is to conjugate them totoxic moieties, in order to obtain immunotoxins,chimeric proteins with specific efficacy. 4 In this preliminarywork we studied the cytotoxic effect of ATGconjugated to the ribosome-inactivating protein (RIP)saporin-S6.RIPs are plant toxins, whose enzymaticactivity was identified as polynucleotide:adenosineglycosidase. 5 Saporin-S6 and ATG were linked via adisulphide bond between chemically inserted sulphydrylgroups and the conjugate was purified by gelfiltration. After conjugation saporin-S6 maintainedits enzymatic activity, evaluated on a cell-free proteinsynthesis system (rabbit reticulocytes lysate), and ATGretained the same lymphocyte binding properties ofthe native antibody. This immunotoxin was able toinduce apoptosis in lymphocytes stimulated either viaCD3/CD28 and PHA, with AC50 (concentration causingapoptosis in 50% of cells) of 27-64 pM, respectively.In the same conditions a mixture of saporin-S6and ATG was almost 10000 times less active. Unstimulatedlymphocytes resulted much less sensitive toimmunotoxin than activated cells (AC50 about 10nM). ATG-saporin-S6 also resulted cytotoxic on severallymphoma cell lines. RIP incremented its toxicityon target cells by 3 logs upon conjugation with ATG.In all cell lines protein synthesis was completely inhibitedby the immunotoxin at 10 nM concentration. Thiscytotoxicity was also confirmed by another extremelysensitive assay based on ATP detection.References1. Aw MM. Transplant immunology J Pediatr Surg 2003;38:1275-80.2. Simpson D. BioDrugs 2003;17:147-54.3. Yazji S, Giles FJ, Tsimberidou AM, et al. Leukemia. 2003;17:2101-6.4. Bolognesi A, Polito L. Mini Rev Med Chem 2004;4:563-85.5. Barbieri L, Battelli MG, Stirpe F. BBA 1993;1154:237-82.PO-136USE OF ELISPOT FOR THE DIAGNOSIS AND MONITORING OFKAPOSI SARCOMA IN TRANSPLANT PATIENTSBarozzi P, Luppi M, Rasini V, Ravazzini L, Bosco R,Fontana G, Riva G, Potenza L, Morselli M, Torelli GDipartimento Integrato di Oncologia ed Ematologia,Sezione di Ematologia, Università di Modena e ReggioEmilia, Modena, ItalyKaposi sarcoma (KS) is a vascular tumor of hemopoieticorigin occurring in immunosuppressedpatients, including AIDS and transplant patients. Wehave learned from studies of EBV-related PTLDs thatthe viral load should be combined with other diagnosticmethods to increase its predictive value. Additionalmonitoring of the EBV-specific T-cell immuneresponse may further improve the ability to predictPTLD in transplant recipients. The aim of the presentstudy was to set up a specific and sensitive assay toevaluate the dynamics and prognostic value of monitoringHHV8-specific T cell immune response in additionto HHV8 DNA load in patients with KS. To assessthe presence of HHV8-specific cytotoxic T-lymphocyte(CTL) activity, we adopted the single-cell IFNgammarelease EliSpot assay. Three previously identifiedHHV8-specific CD8 HLA-A*02-restricted CTLepitopes (9-10 AA residues long), derived from onelatent (K12) and two lytic (gH, gB) antigens, wereused to stimulate PBMCs from an HIV-negativepatient with KS receiving long-term immunosuppressivetherapy including methotrexate, cyclosporinand steroids for rheumatoid arthritis. Both HHV8 CTLactivity and viral load (real-time PCR) were evaluatedover a six months period on sequential blood samples.HHV8-specific CD8 T cell response wasdetectable (89-100 SFC/10(e)6 PBMCs) for all threepeptides before KS, but became absent simultaneouslythe appearance of KS cutaneous lesions, indicatinga correlation between a lower T cell responseand the presence of disease. In contrast, HHV8 DNAload was poorly detectable (2-20 viral copies/ug DNA)over the time. In conclusion, in HIV-negative KSpatients the predictive value of HHV8 load determinationis limited. In these patients EliSpot assay maybe considered a reliable method for monitoringHHV8-specific immune response providing a valuableparameter to guide therapy. We are currently assess-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004145ing the predictive value of EliSpot in transplantpatients with KS.PO-137CYTOTOXIC ACTIVITIES OF HUMAN HLA IDENTICAL DONORDERIVED CYTOKINE INDUCED CELLS (CIK) AGAINST ACUTEMYELOID BUT NOT LYMPHOID LEUKEMIA BLASTSBarbui AM, Borleri G, Micò C, Salvi A, Introna M,Rambaldi ADivisione di Ematologia, Ospedali Riuniti di Bergamo,ItalyCytokine induced killer (CIK) cells have beendescribed as strong lytic effectors against differenttypes of solid tumors. Although CIK are CD3 + CD8 +CD56 + cells, they induce tumor lysis through a T cellreceptor (TCR) indipendent recognition, throughNKG2D receptor. Recently it has been reported thatCIK cells are able to induce graft versus leukemia(GvL) but not graft versus host disease (GvHD). Aimsof the study: to develop a reproducible clinical grademethod to ex-vivo expand CIK cells from peripheralblood of HLA identical hematopoietic stem celldonors, and to characterize their lytic activity againstacute myeloid and lymphoid blasts. Peripheral blood(30 ml) from HLA identical familiar (N= 9) or unrelateddonors (N= 7) were collected at time of bonemarrow donation or in case of G-CSF mobilizeddonors, at time of their clinical examination. AfterFicoll separation, pheripheral blood mononuclear cells(PBMC) were cultured in vitro in 10 mL of RPMI 1640,in the presence of 10% clinical grade FCS, 2nM Glutammine,Penicillin/Streptomicin and 1000U/ml IFNγ(Gammakine © ). The day after 50 ng/ml of anti-CD3(OKT-3, Orthoclone) and 500 U/ml of IL-2 (Proleukin,) were added to the culture and cells were maintainedat a concentration of 0.5×10 6 cells/mL in the presenceof only IL-2. The cytotoxicity of CIK cells was determinedby Calcein AM release assay. In our culturecondition the proportion of CD3 + CD56 + cytotoxiccells, increased from 1-3% of total mononucleatedcells of normal donors at day 0 up to 80% (median55%) at day +21 of in-vitro culture. Moreover amedian 10 times fold increase in the absolute cellcount was observed, with a median 25 fold increaseof CD3+ cells, while CD3 + CD56 + CD8 + subset showeda 350 times fold increase. Starting from 30 ml peripheralblood a median number of 400 X 106 CD3 + CD56 +affector cells can be obtained over 21 days of in vitroculture. Cell sorting experiments using CD56 magneticmicrobeads showed a strong cytotoxic potentialagainst the standard NK target (K 562 cell line,median cytotoxicity at 4 hours of 45% at a E:T ratioof 10:1). Donor derived CIK cells were tested againstHLA identical patient derived blasts (5 AML, 8 ALL).Cytotoxicity was documented only against myeloidtargets, indipendently from their FAB classification(at 4 hours median cytotoxicity of 20% with a E:Tratio of 10:1). These experiments were performedunder GMP conditions so to provide a protocol forfurther scaling up. Conclusion: HLA identical donorderived CIK cells can be always expanded ex vivo ina reproducible, clinical grade and effective way,showing a high cytotoxic potential against myeloidbut not lymphoid leukemia blasts. These pre clinicaldata allow the design of new adoptive immunotherapyprotocols for the treatment of acute myeloidleukemia patients relapsing after HLA identical allogeneicstem cell transplantation.PO-138MONITORING OF MYELOID AND PLASMACYTOID DC NUMBERSAND FUNCTION IN THE PERIPHERAL BLOOD AND BONE MAR-ROW OF PATIENTS WITH CHRONIC GVHD FOLLOWING ALLO-GENEIC HEMATOPOIETIC STEM CELL TRANSPLANTATIONArpinati M, Chirumbolo G, Perrone G, Falcioni S,Bonifazi F, Bandini G, Martelli V, Sanchini S, ZagnoliA, Baccarani M, Rondelli DResearch Center for Transplant Immunology, InstituteSeragnoli, University of Bologna, Italy. Section ofHematology/Oncology, University of Illinois at Chicago,USAAlthough dendritic cells (DC) have been shown toinitiate acute GVHD, their role in chronic GVHD isunknown. Human DC comprise at least two distinctsubsets, i. e. myeloid DC, that have been associatedwith the triggering of alloimmune responses, andplasmacytoid DC, that have been shown to modulatealloimmune responses, through induction of Th2 or Tregulatory activity. In this study we evaluated thenumber and function of mDC and pDC either circulatingin the PB or residing in the BM of patients withor without chronic GVHD at > 100 days after HSCT.Patients with signs and symptoms compatible withchronic GVHD were included in the study, providedthey had not received yet induction therapy with corticosteroids(n=18). Patients without chronic GVHDafter > 100 days follow up were included as controls(n=8). Follow up was comparable among the twogroups [median 303 days in GVHD patients (25th to75th percentile 259-411) vs 393 (180-591) in controls(p=n. s. )]. Furthermore, no difference wasobserved among the two groups as regarding age,stem cell source, conditioning regimen, disease stateand whether they were still taking non-steroidalimmunosuppressive drugs. Peripheral blood samplesfrom patients and controls were analysed for mDC(identified as BDCA1 + CD19 − ), pDC (identified asBDCA2 + ) and monocyte (identified as CD14 + ) numbershaematologica vol. 89[suppl. n. 6]:september 2004

146Postersthrough a flow cytometry-based assay. The expressionof homing molecules and chemokine receptors(CD62L, CD49e, CXCR3, CXCR4, CCR5 and CCR7) aswell as maturation-related molecules (CD40, CD80,CD83 and CD86) on the surface of each DC subsetwas also determined. No significant difference wasobserved in median pDC, mDC and monocyte PBnumbers between patients and controls, althoughpatients had a trend toward higher mDC counts [6cells/ µL, (25 th to 75 th percentile 3.8-13.2) vs 2.5 (1.4-5.2) (p=0.18)]. However pDC:mDC ratio was significantlylower in GVHD patients [0.5 (0.3-0.8) vs 1.5(1.2-2.6) (p=0.03), suggesting selective loss of pDC.Expression of chemokine receptors and costimulatorymolecules on pDC, mDC and monocytes was notdifferent among the two groups, suggesting that thematuration status of DC circulating in PB was notaltered in patients developing chronic GVHD. As PBDC have been shown to constitutively migrate toperipheral organs, including the BM, where antigenpresentation to T cells may occur, DC numbers andfunction were analysed in BM samples from 6 out of8 patients in the control group. Interestingly, bothBM pDC and mDC expressed significantly higher levelsof CXCR4 than their PB counterparts [MFI=290±143 vs 180±126 in pDC (p=0.03) and 323±127vs 87±43 in mDC (p=0.03)]. Moreover, expression ofCD86 on BM mDC was also significantly increased[MFI= 75±27 vs 27±12 (p=0.04)]. These data suggestedthat both mDC and pDC can actively migrateto the marrow, thus potentially increasing their abilityto stimulate T cells. Furthermore, serum levels ofseveral chemokines, including IP-10, ITAC, GROα,Lymphotactin and SDF, were significantly higher inGVHD patients, confirming that chronic GVHD ispotentially associated with DC migration to peripheralorgans. Thus chronic GVHD may correlate with areduced pDC:mDC ratio, possibly due to increased Tcell activation by mDC and/or decreased T cell regulationby pDC. Moreover, PB circulating mDC and pDCappear to actively migrate to peripheral organs. Evaluationof DC phenotype and function in the BM ofGVHD patients may shed light on the role of distinctDC subsets in the pathogenesis of chronic GVHD.PO-139IMATINIB THERAPY IS THE FIRST THERAPEUTIC OPTION FORCHRONIC MYELOID LEUKEMIA PATIENTS RELAPSED AFTERALLOGENEIC STEM CELL TRANSPLANTATIONPalandri F, Martinelli G, Bandini G, Benedetti F, 3Amabile M, Bonifazi F, Usala L, 1 Angelucci E, 1Tiribelli M, 2 Fanin R, 2 Pizzolo G, 3 Arpinati M,Falcioni S, Giannini MB, Angela P, Rosti G, SoveriniS, Baccarani MIstituto di Ematologia ed Oncolologia Medica “L. e A.Seragnoli” Bologna; 1 Struttura Complessa di Ematologiae Centro Trapianto Cellule Staminali Emopoietiche,Ospedale Oncologico Armando Businco,Cagliari, 2 Istituto di Ematologia di Udine, 3 Istituto diEmatologia e Dipartimento di Medicina Clinica eSperimentale, Policlinico Gian Battista Rossi, Universita'di Verona ItalyWe studied clinical and molecular follow-up of 16patients with chronic myeloid leukemia (CML) relapsingafter allogeneic stem cell transplantation (SCT).Disease at the time of treatment with Imatinib was inchronic phase (CP) in all but three patients who werein accelerated phase (2 patients) or in blastic crisis(one). All of them were in cytogenetic relapses. Themedian interval between relapse and start of Imatinibtherapy was 34 months (7-156). Two patients hadfailed treatment with donor lymphocyte infusions priorto Imatinib; three patients had received therapywith IFN α and two with hydroxiurea (HU). All patientswere treated with Imatinib (400 or 600 mg/daily),without significant hematological toxicity. The overallhematological response rate was 100% and thecomplete cytogenetic response (CCR) was 100% for allpatients either relapsed in CP or AP. Complete molecularresponses, intended as 3 logs reduction of BCR-ABL/B2M were obtained in 15/16 patients in threemonths, independent from the phase of the disease atthe moment of relapse. One patient (UPN 1) achieveda CMR after 15 months of therapy. With a medianfollow-up after relapse of 19 months (range 4-32),the estimated 2-year survival for all patients was100%. Mixed chimerism has been evaluated in 9patients and after Imatinib therapy was assesed asfull donor in all but one of them. We conclude thatImatinib has significant activity against CML inrelapse after allogeneic bone marrow transplantationwith durable cytogenetic remissions and significantmolecular 3 log reduction of BCR-ABL/B2M obtainablein all patients. Imatinib therapy is the first therapeuticoption to be proposed for chronic myeloidleukemia patients who relapse after allogeneic stemcell transplantation.Funding: FIRB 2001; COFIN 2003, Fondazione delMonte di Bologna e Ravenna, AIL, AIRC, Ateneo diBologna 60% (Baccarani).haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004147PO-140NATURAL KILLER CELL CONDITIONING TO T CELL-REPLETEMISMATCHED BMT CONFERS IMMEDIATE RESPONSIVENESS TOINFECTIOUS CHALLENGESRuggeri L,* Perruccio K,* Montagnoli C,° Romani L,°Velardi A**Haematology and Clinical Immunology, °Microbiology,University of Perugia, ItalyIn haploidentical transplants, T cell depletion isessential for preventing GvHD but it is responsiblefor slow T cell recovery and 35% infection-relatedmortality. Therefore, new strategies to protectpatients from infections, while not causing GvHD, arenecessary. Conditioning regimens which includealloreactive NK cells could be a new strategy forimproving immune reconstitution. In murine MHCmismatched BMT models they allowed for the concomitanttransfer of high doses of T cells withoutcausing GVHD. Aim of the study: assessment ofimmunity to pathogens in mice given standard T celldepletedmismatched BMT vs mice given alloreactiveNK-based conditioning and T cell-replete mismatchedBMT. After transplant, a low virulence strainof Candida Albicans was infused to determinewhether 1) mice survived infection and 2) specific Tcell immunity could be elicited (vaccination) to achallenge with a high virulence Candida Albicansstrain given two weeks after vaccination. The challengewould be fatal in healthy non-vaccinated mice.Mice receiving standard conditioning (TBI) and T celldepletedBMT were extremely susceptible to earlypost transplant infection and up to day +12 succumbedto even low virulence Candida. From day 13onwards they survived the low virulence infectionbut specific T cell immunity was not elicited untilafter day 35, as they all died from the high virulencechallenge. They survived and developed immunityonly six weeks after BMT. In contrast, after an alloreactiveNK cell-based conditioning (TBI plus 8×10 5Ly49A/G2 + , Ly49C/I- NK cells) and T-replete (20×10 6T cells) mismatched BMT, recipient mice withstoodthe early (day +3) infection with the low-virulenceCandida strain. They mounted a protective T cellmediatedimmunity which allowed them to survivethe challenge with the high-virulence Candida strainand, concomitantly, were protected from GVHD. Thetime-kinetics of donor-type T cells and CD11c + DCsrecovery were much faster after NK-based conditioning.This study proposes a strategy to protect haploidenticaltransplant recipients from infections,while not causing GvHD.PO-141TCR SPECTRATYPE MOLECULAR MONITORING IN PATIENTSAFFECTED BY MULTIPLE MYELOMA AFTER NON-MYELOABLA-TIVE TRANSPLANTATIONGalimberti S, 1 Morabito F, 2 Benedetti E, 1 CaraccioloF, 1 Fazzi R, 1 Andreazzoli F, 1 Ciabatti E, 1 Martino M, 2Cuzzola M, 2 Console G, 2 Iacopino P, 2 Petrini M 11Department of Oncology, Transplant and Advancesin Medicine Section of Hematology -University ofPisa; 2 Bone Marrow Transplant Unit, HematologyDepartment, A. O. Reggio Calabria, ItalyAfter allogeneic stem cell transplantation, thereconstituting immune system seems to play animportant role in the eradication of malignancy, themost convincing evidence coming from the demonstrationthat infusion of donor lymphocytes couldinduce satisfying haematological and molecularresponses. Analysis of T-cell receptor (TCR) rearrangementby fluorescent PCR has proven to be an availableand useful tool for the in vivo characterizationof immune response. Changes of TCR spectratype dueto the relative expansion or regression of clonal T-cellpopulation can be detected by this molecular techniqueand correlated with events occurring duringfollow-up, in particular with virus infections, acuteand chronic graft-versus-host disease (GVHD) andgraft-versus-tumor effect. We analyzed T cell receptor(TCR) subfamilies in 20 patients who underwentallogeneic non-myeloablative transplant. In the normalspectratypes, PCR products were typically distributedin a Gaussian fashion, with an average of 7-9 different peaks. In our patients, TCR shapes frequentlydeviated from this normal pattern by havingfew predominant peaks, in the 60% of cases the patternbeing biclonal. Moreover, all patients presenteda skewed T-cell pattern for the whole follow-up, evenafter 18-24 months from the graft. Nine patientsdeveloped acute GVHD (aGVHD); in 83% of them TCRsubfamilies concomitantly showed new T-cell peaks.On the other hand, average score of TCR complexitydid not differ between patients with or withoutchronic GVHD. Moreover, CMV reactivation wasdetected in 31% of patients; in no case TCR spectratypechanged concomitantly to the CMV antigenpositivity. Even the chimerism status was not significantlycorrelated with the evolution of TCR profiles.Of the 10 patients that showed detectable changesof TCR spectratypes during follow-up, 4 were persistentlymixed chimeras and 3 retained their full donorpattern. As surrogate of minimal residual disease(MRD), the IgH rearrangement was monitored; 61%of patients had at least one PCR-negative BM sampleduring follow-up. Interestingly, the eradication ofMRD had a favorable impact either on OS or progressionrate. In the 61.5% of patients a new clonalhaematologica vol. 89[suppl. n. 6]:september 2004

148Posterspredominant TCR peak preceded or appeared concomitantlyto the achievement of the IgH-negativity.On the other hand, 4 cases converted back to theIgH-positivity during follow-up; interestingly, in twoof them the area of a clone previously characterizedas recipient-specific resulted significantly increased.These results suggest that different T populations sustainGVM and GVHD and that analysis of TCR spectratypecould be a useful tool for monitoring patientswho underwent non-myeloablative allogeneic transplant.PO-142REDUCED INTENSITY CONDITIONING REGIMEN FOR ALLO-GRAFTING FOLLOWING CYTOREDUCTIVE AUTOGRAFTING FORMETASTATIC BREAST CANCERCarella AM,* Beltrami G,* Corsetti MT,* Nati S,*Gonella R,° Ballestrero A,° Patrone F°From the *Division of Hematology/BMT Unit, AziendaOspedaliera e Cliniche Universitarie ConvenzionateOspedale San Martino, Genova and °Departmentof Internal Medicine, DIMI, Genova, ItalyBackground: The development of reduced intensityconditioning regimens (RIC) has decreased the risksof allografting to a level warranting such investigationaltrial. For patients without sibling donors, autograftinghas been explored as a method to enhancethe efficacy of chemotherapy in advanced solidtumors. This pilot study combined both the proceduresin order to maintain the benefit of bothapproaches with acceptable toxicity. Methods: Thefeasibility of this tandem transplant procedure wasevaluated in 17 patients with metastatic breast cancer.At a median of 51 days after autografting, thepatients received a RIC followed by donor mobilizedHLA identical peripheral blood progenitor cells. Donorlymphocyte infusions were given to 12 patients withstable mixed chimerism and/or progressive diseasewho did not show signs of aGVHD. Results: Eleven(64%) out of 17 patients achieved sustained engraftment.Three patients who were resistant to conventionaltherapy achieved PR after autografting and CRafter allografting; another no-responsive patientachieved PR for an overall response rate of 4/17(22%). No early TRM was observed during the firstdays. Grade ⁄II acute GVHD occurred in 5 patients(29%) and extensive chronic GVHD in 5 patients(29%). All the responses were accompanied by theoccurrence of GVHD. At April 2004, 5 out of 17patients (29%) are alive 90-2160 days (median, 1320days) from this 2-step approach. Conclusions: Tandemtransplant is a feasible procedure in metastaticbreast cancer patients; and the exploitation of GVHDis a promising finding.PO-143DIFFERENCES BETWEEN QUANTITATIVE CMV-PCR IN PLASMAAND CMV ANTIGENEMIA ASSAY IN MONITORING PATIENTSAFTER ALLOGENEIC STEM CELL TRANSPLANTATION (SCT)Picardi A, Gentile G,° de Fabritiis P, Capobianchi A,°Spagnoli A, Cudillo L, Dentamaro T, Tendas A,Mirabile M, Ciotti M,* Amadori S, Martino P°Hematology and Clinical Pathology*, University TorVergata and Hematology°, University La Sapienza,Rome, ItalyHuman cytomegalovirus infection (HCMV) representsthe most common and potentially severe viralcomplication in patients undergoing hematopoieticSCT; therefore, the effective anti-CMV treatmentstrategy must be based on a sensitive and reliablediagnostic assay to rapidly evaluate active CMVinfection. Pp65 antigenemia (pp65Ag) is consideredthe standard assay to detect CMV infection; however,whether PCR assay for detection of CMV DNA inplasma may anticipate pp65Ag is still controversial.The aim of the study was to investigate the usefulnessof a quantitative plasma PCR test and compareit with the pp65Ag for detection of CMV infectionfollowing SCT. Between December 2002 and June2004, 28 patients underwent an allogeneic SCT fromeither an HLA-identical sibling (23) or an unrelateddonor (5). All patients were weekly monitored forCMV infection by both quantitative CMV-PCR in plasma(COBAS AMPLICOR CMV MONITOR Test with lowerlimit detection of 600 copies/ml plasma) and pp65Ag during the first 100 days after SCT. As CMV prophylaxis,Acyclovir was given either at standard orhigh dose in related or unrelated transplants, respectively.No patients received specific Ig, Gancyclovir,Foscarnet or Cidofovir as CMV prophylaxis. Pre-emptivetherapy with Gancyclovir or Foscarnet was startedat the first detection of antigenemia (> 1 positivecell). Plasma CMV DNA was not considered for clinicaldecision making. Overall, 20/28 patients (71.4%)had CMV infection within 100 days from SCT: in 11patients, CMV was detected by pp65 alone, in 8 byboth methods and in 1 by PCR alone. Pp65Ag positivityafter SCT was earlier (median 41 days, range 0-100) than plasma PCR assay (median 48 days, range5-55). A total of 369 blood samples were analyzed.CMV was detected in 45 samples (12%) by a singleor both methods. PCR detected a median of 1230copies/ml (range 770-22600) while pp65Ag showeda median of 6 positive/150000 total PMN examined(range 1-400). Overall, 15 samples were found to bepositive by PCR and pp65-antigenemia, 25 sampleswere pp65Ag positive but PCR CMV negative, 5 wasPCR positive/pp65Ag negative, and 324 were negativeby both assays. Three patients developed CMVdisease (10,7%) detected by both methods in 2/3 cas-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004149es; only 1 patient developed intestinal CMV diseaseresponding to antiviral therapy, despite negativepp65Ag and PCR assays. Three patients died of transplantrelated mortality (1 infection, 1 grade IVaGVHD, 1 CMV disease + aGVHD) and 3 of diseaseprogression. In conclusion, pp65Ag detected CMVinfection earlier than plasma PCR in our allogeneicSCT recipients.PO-144PHASE II STUDY OF A SINGLE PEGFILGRASTIM INJECTION ASADJUNCT TO CHEMOTHERAPY TO MOBILIZE STEM CELLS INTOPERIPHERAL BLOOD OF RESISTANT/RELAPSED LYMPHOMAPATIENTSIsidori A, Tani M, Bonifazi F, Zinzani PL, Curti A,Motta MR, Rizzi S, Giudice V, Farese O, Rovito M,Alinari L, Conte R, Baccarani M, Lemoli RMInstitute of Hematology and Medical Oncology L. &A. Seràgnoli, University of Bologna, BolognaThe primary end point of the study was the successfulmobilization of a target cell dose of 2×10 6CD34 + cells/kg in lymphoma patients receiving ifosfamide,epirubicin and etoposide (IEV) chemotherapyand a fixed dose (6 mg) of pegfilgrastim given assingle subcutaneous injection. An open-label phase IIstudy including 25 relapsed or refractory patients(Hodgkin's disease=4; aggressive non-Hodgkin's lymphoma=21)was conducted to evaluate the efficacyof pegfilgrastim, in combination with salvagechemotherapy, mobilizing CD34 + stem cells intoperipheral blood. Following chemotherapy, allpatients had grade 4 neutropenia with a medianduration of 1.5 days (1-3). Pegfilgrastim treatmentwas well tolerated and only 2/25 patients requiredpain-control medication. CD34 + cells were mobilizedin all patients. The median (range) peak value ofperipheral blood CD34 + cells after IEV chemotherapyand pegfilgrastim was 141/µL (12.8-386) andoccurred almost invariably on day +14 (13-16).Twenty three/25 patients underwent a single apheresisto collect a median of 8.7 CD34 + cells/Kg (1.8-17.3). Twenty four/25 patients (96%) reached the targetcell dose of 2×10 6 CD34 + cells/kg. High concentrationsof circulating CD34 + cells (> 50/µL) wereobserved for several days after the achievement ofthe peak value. Sixteen patients have been transplantedso far with pegfilgrastim-mobilized CD34 +cells and all of them showed a rapid and sustainedengraftment after high-dose chemotherapy. Ourresults show that pegfilgrastim as adjunct tochemotherapy is a predictable and highly effectivemobilization regimen in lymphoma patients.PO-145TRANSFERRING FUNCTIONAL IMMUNE RESPONSES TOPATHOGENS ACROSS THE HLA BARRIER AFTER MISMATCHEDHEMATOPOIETICTRANSPLANTATIONPerruccio K, Tosti A, Burchielli E, Topini F, Carotti A,Aversa F, Velardi ASezione di Ematologia ed Immunologia Clinica,Dipartimento di Medicina Clinica e Sperimentale,Università degli Studi di Perugia, ItalyRe-building immunity to pathogens after full HLAhaplotype-mismatched transplant could be hastenedby transferring immune T lymphocytes. The obstacleis lethal GVHD. We generated over 1,200 AspergillusspecificCD4 + clones from 10 donors and over 3,000CMV-specific CD4 + clones from 25 CMV-positivedonors. 1-10% of clones displayed cross-reactivity torecipient alloantigens. Non recipient-reactive cloneswere used for adoptive therapy. Transplant recipientswere given a single shot of adoptive therapy (10 withAspergillus-specific cells and 25 with CMV-specificcells) ranging from 10 5 to 3×10 6 /Kg cells on day +20after transplant. The only case of GvHD occurred inthe patient who received 3×10 6 /Kg cells. In a controlgroup of 46 recipients who had not received adoptivetherapy, Aspergillus- and CMV-specific T cells werefirst detected 9-12 months after transplant (by LDA).In the control group of 13 recipients, who had notreceived Aspergillus adoptive therapy, all displayedpositive Aspergillus Galactomannan antigenemiawhich persisted for several weeks after transplant.Six of 13 had pneumonia and all of them died ofaspergillosis. In the 10 transplant recipients whoreceived adoptive therapy with anti-Aspergillusclones all displayed positive antigenemia. After adoptivetherapy antigenemia decreased significantly in allof them. All of the 10 patients had aspergillosis andonly 1 died. The remaining 9 cleared the disease. Inthe CMV adoptive therapy study, 30/33 patients whodid not receive anti-CMV T-cell clones underwentrepeated CMV reactivation. 12/33 developed CMVdisease, lethal in 9.In the 25 patients who receivedCMV-specific cells, there was a quick (2-3 wks)recovery of CMV-specific specific T cells thatremained stable over time (monitored for ~1 year).CMV antigenemia became negative from 2-3 weeksafter the infusion onwards in 18 patients. Sevenpatients had CMV disease at the time of the infusion.Five cleared the disease and 2 died. None of the other18 patients developed CMV disease. Finally, in 2transplants from CMV-negative donors into CMVpositiverecipients, we used pre-transplant recipientcells to obtain CMV-specific, non donor-reactiveclones. Their post-transplant infusion did not causehaematologica vol. 89[suppl. n. 6]:september 2004

150Postersrejection or cytopenia, was followed by prompt andstable recovery of CMV-specific T cells, and controlledCMV reactivation. DNA polymorphism indicatedCMV-specific clones were of recipient origin, unlikethe other T cells which were of donor origin. Thisstudy identified safe and effective ways to re-buildimmunity to pathogens after haploidentical transplantation.PO-146IMMUNOREGULATION MEDIATED BY BONE MARROW-DERIVEDMESENCHYMAL STEM CELLS (BM-MSC). EVIDENCE THAT BM-MSC CAN EXHERT BOTH IMMUNOSUPPRESSIVE ANDIMMUNOSTIMULATORY EFFECTPoggi A,* Urbani S, $ Massaro AM,* # Negrini S,* +Zocchi MR, # Saccardi R $Laboratory of Immunology, National Institute forCancer Research, 16132-Genoa $ Laboratory of BoneMarrow Transplantation, Careggi Hospital, Florence;#Laboratory of Tumor Immunology, San RaffaeleScientific Institute, Milan; + Department of InternalMedicine, University of Genoa, ItalyIt has been reported that bone marrow-derivedmesenchymal stem cells (BM-MSC) exhert a strongimmunosuppressive effect on mixed lymphocytereaction (MLR). This effect is thought to be mediatedby immunosuppressive cytokines including transforminggrowth factor (TGF)-β and/or hepatocytegroth factor (HGF). This immunosuppressive effectmay favour both engraftment of bone marrow transplantationand decrease the incidence of graft versushost reaction. To better understand the functionalconsequences of BM-MSC/lymphocytes interaction,we analysed whether BM-MSC can activate, ratherthan inhibit, lymphocyte subsets. To this aim weobtained BM-MSC from either healthy donors (n=4)or from patients (n=10) suffering from acute myeloidleukemia (AML) in post-chemotherapy completeremission. BM-MSC did not express typicalhematopoietic markers such as CD34, CD45 andCD14 but bore CD105, CD73, CD166, CD29, CD44,CD54, HLA-A B C antigens. In addition, they did notexpress CD133.We found that BM-MSC, used asstimulators, trigger the production of TNF-α, but notof IFN-gamma, by allogeneic peripheral bloodmononuclear cells (PBMC) upon 24 hrs stimulation.Importantly, this effect was evident in 3 out of 7 BM-MSC/PBMC co-cultures. In these PBMC, activationmarkers including CD25 and CD69 were highly upregulated.Indeed, BM-MSC can function as good stimulatorin co-culture with allogeneic PBMC. Experimentsaimed to define whether this phenomenon islinked to the different HLA class I antigens expressedby BM-MSC and PBMC are in progress. BM-MSCpopulations constitutively produced TGF-β andstrongly inhibited (up to 90%), in a dose dependentmanner, MLR when used as a third party. Interestingly,we noticed a strong expansion of NK and T lymphocytesexpressing CD94 in MLR in the presence ofBM-MSC suggesting that these cells can favour theproliferation of lymphocytes bearing members ofInhibitory Receptor Superfamily (IRS), resembling thereported expansion of NK and/or T cells observed inpatients early after bone-marrow transplantation.Altogether, these findings indicate that BM-MSC canalso activate, beside inhibit, different lymphocytessubsets. Thus, a deeper analysis of the molecularmechanism underlying their interaction with lymphocytesis mandatory, prior to employ them in therapeutictrials.PO-147INCIDENCE, OUTCOME AND RISK FACTORS OF CHRONIC GVHDAFTER UNRELATED DONOR STEM CELL TRANSPLANTATION: ASINGLE CENTER EXPERIENCESkert C, Patriarca F, Sperotto A, Damiani D, CernoM, Geromin A, Prosdocimo S, Stocchi R, Fanin RDivision of Hematology, University Hospital of Udine,ItalyChronic graft-versus-host disease (GVHD) is animportant cause of late morbidity and mortality afterallogeneic stem cell transplantation (SCT). Its incidenceand severity are increased by the use ofmatched unrelated donors (MUD) and of peripheralblood as stem cells source, which is becoming moreand more frequent. The purpose of this retrospectivestudy was to analyze incidence, outcome and riskfactors of chronic GVHD after MUD-SCT. 46/57patients who undewent SCT from unrelated donorwere evaluable for chronic GVHD. Median age was31,5 (14-56) years and median follow-up was 18 (4-77) months. CyA was adminstered intravenously (i. v.) in continuous infusion from the day before transplant(3 mg/kg/day) and orally at i. v. equivalent dosefrom 4th week after SCT. MTX was administered i. v.on day +1 (15 mg/mq) and on day 3, 6, 11 (10 mg/m 2 ).CyA was tapered from day 100 or according to clinicalassesment. In all patients CyA was monitored forsteady-state levels during the period of continuousinfusion and for through levels during the period oforal intake. Several indipendent variables were analyzedas possible risk factors for the development andthe severity of chronic GVHD: sex, age and status ofdisease at SCT, source of stem cells, infused cell dose,sex mismatch, CMV reactivation, acute GVHD. Thehazard ratio for other variables (1.mean CyA bloodconcentration during 1 st , 2 nd , 3 rd , 4 th and 5 th monthand 2. rate of CyA concentration during 2 nd , 3 rd , 4 thhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004151and 5 th , expressed as percentage of Cya concentrationduring 1 st month, taken as 100%) was calculated asincremental hazard ratio. In the first case the risk forthe event was associated with an increase of CyAconcentration of 25 ng/mL. In the second the risk forthe event was associated with an increase of CyAconcentration rate of 10%. 38/46 (83%) patientsdeveloped chronic GVHD at a median time after SCTof 7 months (range: 3-11). Chronic GVHD was extensivein 19 out of 46 patients (41%). The overall survival(OS) did not significantly differ in patients withand without chronic GVHD (limited or extensive).Patients with extensive chronic GVHD had a significantlyhigher disease free survival (DFS) than patientswith limited chronic GVHD (at 2 years DFS: 88% vs51%, p=0,016). No differences were evidenced in DFSamong patients with and without chronic GVHD andamong patients with extensive chronic GVHD andwithout GVHD. Acute GVHD (grade >= II) (HR=2.5;p=0.03) was significatively associated with the probabilityof developing chronic GVHD in multivariateanalysis. Acute GVHD (grade >= II) (HR=4.6;p=0.006), CyA blood concentration during 4 th month(incremental HR= 0.8; p=0.003) and rate of CyA concentration(incremental HR=0.68; p=0.003) duringthe same month were proved to be significative inmultivariate analysis for extensive chronic GVHD. Therate of CyA tapering during the 4th month and thegrade of acute GVHD seem to influence the severityof chronic GVHD after MUD-SCT. In our series, limitedand extensive chronic GVHD did not differ forimpact on survival even if the DFS was higher inpatients with extensive than in patients with limitedGVHD; moreover DFS was not different amongpatients with extensive chronic GVHD and patientswithout GVHD. In adequate immunologic responsecould be at the base of the absence of chronic GVHD.This fact, together with the absence of immunosupressivetherapy, leads to a reduction of the risk ofrelapse and of transplant related mortality (TRM). Onthe other hand, the strong graft versus leukemiadespite the intensive immunosuppressive therapycould reduce the risk of relapse in the case of extensivechronic GVHD, counterbalancing the risk of TRM.PO-148HIGH SERUM LEPTIN IN PATIENTS WITH CHRONIC GRAFTVERSUS HOST DISEASE AFTER HEMATOPOIETIC STEM CELLTRANSPLANTATIONSerio B,* Tauchmanovà L,° Matarese G,^ Ricci P,*Carella C,** De Rosa G,* Cerciello G,* Lombardi G,°Colao A,° Rotoli B,* Selleri C**Division of Hematology, and °Department of Molecularand Clinical Endocrinology and Oncology,“Federico II” University of Naples, ^Institute of ExperimentalEndocrinology and Oncology, ResearchNational Council, Naples, and **Department ofInternal Medicine “F. Magrassi”, Second Universityof Naples, ItalyLeptin is an adipocyte-derived hormone of thelong-chain helical cytokine family playing a regulatoryrole in the neuronal control of body weight byinhibiting food intake and stimulating energy expenditure.Recently, it has been documented that leptinexerts a direct effect on T-lymphocyte responses, promotingTh1 and suppressing Th2 cytokine production.Increased serum leptin values have been found afterheart, liver, kidney and stem cell transplantation(SCT). The reasons and the mechanisms responsiblefor such a post-transplant increase are still unclear.We measured serum leptin concentration in a groupof 60 transplanted patients and in 60 healthy subjectswith similar age and body mass index (BMI).Relationships with age, gender, body mass index(BMI), gonadal status, lymphocyte subpopulations,Th1 and Th2 cytokine secretion, inflammation andtime elapsed since transplant were investigated.Serum leptin level was significantly higher in transplantedpatients compared to controls; in addition, itwas higher after allo-SCT than after autologous(auto)-SCT, expressed as absolute value and after normalizationfor BMI. In 15 patients who were prospectivelyevaluated prior to and after allo-SCT, pre-transplantlevels overlapped those of controls, while afterSCT serum leptin increased two- to ten-fold. The typicalsexual dimorphism (higher leptin in females) persistedin both transplant settings but was set up athigher levels. Significantly higher leptin values werefound in 21 patients affected by chronic graft versushost disease (cGVHD) compared with those free ofthis complication. The physiological correlation withBMI was lost in the allogeneic setting, indicating astrong influence of factors other than the nutritionalstatus on circulating leptin. No relationship wasfound between serum leptin levels and time fromtransplant, age, cortisol, C-reactive protein, and T-lymphocyte CD4-to-CD8 ratio. Among the cytokinessecreted by lymphocytes (IL-4, IL-5, IL-10, IL-2, IFNγand TNF-α), only serum IFN-γ was found higher inallo-SCT patients compared with auto-SCT patientsand normal controls. Within allo-SCT patients, meanIFN-γ levels were higher in patients with than inpatients without cGVHD. Moreover, a significant correlationbetween leptin and IFN-γ was found onlywhen allotransplanted patients with IFN-γ values>15 pg/ml were considered. Based on the evidencethat leptin increase may contribute to the onset ofimmune response, we also investigated in vitro consequencesof leptin blockade on T cell activation in amixed lymphocyte reaction (MLR) from 5 HLA-mismatchedcouples of responder and stimulator T-lym-haematologica vol. 89[suppl. n. 6]:september 2004

152Postersphocytes. Anti-leptin blocking antibodies partiallyinhibited T cell activation in MLR, suggesting a linkbetween leptin and T-lymphocyte activation in theallo-SCT setting. In conclusion, we found greaterincrease in serum leptin after allo-SCT than auto-SCT, with the highest levels in patients with cGVHD.Loss of the physiological relationships between leptin,BMI and gonadal function, the correlationbetween serum leptin and IFN-γ levels in the allogeneicsetting, and the marked inhibitory effect ofleptin-blockade on T cell activation in primary MLRsuggest that T-cell activation after allo-SCT may beresponsible for the leptin increase, which in turnmight subsequently contribute to the maintenance ofthe immune attack leading to cGVHD.PO-149SUCCESSFUL OF COLLECTION PERIPHERAL STEM CELL WITHPEG-FILGRASTIM IN RELAPSED LYMPHOMASSpecchia MR, Mazza P, Prudenzano A, Palazzo G,Pricolo GC, Stani LStruttura Complessa di Ematologia Ospedale“S. G. Moscati” Taranto, ItalyPegfilgrastim comprises the protein filgrastim towhich a 20 kD polyethylene glycol (PEG) molecule isbound covalently to the N-terminal methionineresidue of filgrastim. The addition of the PEG moleculereduces renal clerance of pegfilgrastim (PF) andincreases the serum half-life more than filgrastim.This longer half-life facilitated neutrophil recoverywith fewer injections. Several studies show that a singleinjection of PF is effective to induce neutrophilrecovery following severe neutropenia after chemotherapy.Few data are now available on the efficacyof PF in the recovery of granulopoiesis in patientsundergoing ABMT or marrow donors for BMT. In anongoing study we present our experience on a seriesof patients with relapsed lymphomas planned forPBSCT. With the aim to present the feasibility and thetolerability of PF we analyse our preliminary datasince January 2004 up to May 2004.The selection ofpatients was focused on those already treated byalmost one line of therapy and relapsed or progressed;the salvage treatment plan included the PBSCT as partof sequential therapy with a debulky phase and consolidationwith high dose chemotherapy rescued byPBSC. The study consisted on the administration of PFone single dose of 6 mg 5 days following DHAPscheme which consisted of Desametasone 40 mg/dayover four days, Cisplatin 100 mg/m 2 over 24 hourscontinous infusion and Cytarabine 2000 mg/m 2 b. d.. The evaluation of CD34 cells was done daily startingfrom the day after the administration of PF up to the3 day of collection of a minimum cumulative numberof CD34 cells of 2.5×10 6 /Kg. Data are available on 7patients, 4 males and 3 females, mean age 54 years(range 32 to 72 years). The diagnosis consisted of 3non-Hodgkin's lymphomas of B origin with an highgradehistology, 2 B non-Hodgkin's low-grade lymphomas,1 Hodgkin’s disease and 1 Breast metastaticcancer. All patients were previously treated by acombination chemotherapy showing some responsebut all were with active disease at the time of studystarted. The results show that all patients reached anadeguate number (> of 20/µL) of circulating CD34cells with a range from 9 to 11 days from the end ofchemotherapy DHAP and 4 to 6 days from the administrationof PF. All patients needed only one procedureof apheresis and the collected number of CD34 cellswas 8.4×10 6 /Kg (range 4.5 to 26.3), with a median ofCD34 cells of 70/µL (range 54 to 192). One patientwas already successfully infused with PBSC, while theother patients haven't yet undergone PBSC transplantation.Adverse events related to PF were mild tomoderate bone pain. Our conclusion is that PF is safeand effective for collection of CD34 cells finalized toPBSCT. The preliminary data suggest that the peripheralblood progenitor cell mobilization by PF are comparableor greater than those achieved with daily filgrastimand the convenience of the single dose of PFmay improve patients' complicance and quality of life.PO-150NEW NON-VIRAL METHOD FOR GENE TRANSFER INTO NORMALAND TUMOR BONE MARROW-DERIVED PRIMARY CELLSAluigi M, Fogli M, Rossi L, Pandolfi S, Curti A, IsidoriA, Ferri E, Baccarani M, Lemoli RMIstituto di Ematologia ed Oncologia Medica“L. e A Seràgnoli” Ospedale S. Orsola, BolognaThe availability of genetically modified cells is anessential prerequisite for many scientific and therapeuticapplications including functional genomics,drug development, and gene therapy. Unfortunately,the efficient gene transfer into primary cells is stillproblematic. Whereas viral strategies are time consumingand involve safety risks, non-viral methodsproved to be inefficient for most primary cell types.The Nucleofector technology is a novel gene transfertechnique designed for primary cells and hard-totransfectcell lines. In this study we tested the potentialof the Nucleofactor technology on different normaland tumor human BM-derived primary cells likeCD34 + cells, mesenchymal stem cells (MSC), dendriticcells (DC) and leukemic-derived DC. By means ofpEGFP expression vector (circular and linearized) weshow high transfection efficiency within all the cellpopulations analysed ranging from 70% in CD34 + to24% in DC. Cell toxicity was variable mainly depend-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004153ing on the cellular model. Phenotypic analysisrevealed no substantial antigenic alterations at differenttimepoints after nucleofection in all cells testedat the functional level. Nucleofected MSC stillretained the potential to differentiate in bothadipocytes and osteocytes while AML-DC could stillinduce an allogenic T cell response even if at a lowerextent compared to non- transfected cells. Moreover,the nucleofection of AML-DC with a IL-12encoding vector produced significant amount of thebiological active cytokine as evaluated by ELISA. Inconclusion, the Nucleofactor technology appears tobe a useful tool for the engineering of hematopoieticand non-hematopoietic BM-derived cells.PosterSTEM CELL TRANSPLANTATION IIPO-151COMPLETE CLINICAL REMISSION AFTER HIGH-DOSE IMMUNESUPPRESSION AND AUTOLOGOUS HEMATOPOIETIC STEM CELLTRANSPLANTATION (HSCT) IN SEVERE REFRACTORY CROHN'SDISEASEScimè R,* Tringali S,* Cavallaro AM,* Santoro A,*Indovina A,* Casà A,** Montalbano L,** Rizzo A,°Cottone M**Divisione di Ematologia con Trapianto OspedaleV. Cervello *, Istituto di Medicina Generale ePneumologia Università di Palermo**, Servizio diAnatomia Patologica Ospedale V. Cervello°, ItalyCrohn's disease (CD) is an immune-mediated diseasebut it is not clear that autoimmunity is theunderlying pathogenesis. Steroid is the main treatmentbut 30% of patients are dependant or resistantto this drug. In the last years antibody to TNF havebeen introduced in the treatment of acute steroidresistant disease and for maintenance of disease;despite good response 20 to 30% of patients are orbecome refractory. Recently high-dose immunosuppressivetherapy with HSCT has shown to determinelong clinical. We report a case of a colonic Crohn'sDisease (CD) refractory to immunosuppressive therapyin a 53 -yrs- old man who underwent autologousHSCT with selected CD34+ cells. CD was diagnosedon February 2001 because of bloody diarrhoea, severeoral and pharingeal aphtous lesions and pyoderma.The patient had first received a course of methylprednisoloneobtaining a clinical remission, but whentreatment was stopped relapse was observed.Steroids together with azathioprine were then startedbut the appearance of severe arthritic pains andmyalgias lead to the suspension of azathioprine.Infliximab was started at dosage of 5 mg /kg at 0, 15and 45 days with a complete clinical response (CDAI< 150). A maintenance treatment with Infliximab wascontinued every 8 weeks, but after the first year oftreatment the duration of the response graduallyshortened, so on March 2003 methotrexate (25 mgi. m weekly) was added to Infliximab. On April 2003the patient had a severe clinical and colonscopicrelapse with extension of the disease to the rectum.The steroid dependence, the refractoriness to MTX,the intolerance to azathioprine associated with theshortening of time response duration to Infliximabwere considered an indication to surgery (temporarycolostomy or left colectomy with definitive colosto-haematologica vol. 89[suppl. n. 6]:september 2004

154Postersmy), which the patient refused. HSCT was then proposed.On July hematopoietic peripheral stem cellswere mobilized using cyclophospamide 2 g/m 2 and G-CSF (lenograstim) 10 mcg /kg. A total of 9.9×10 6 /kgCD34 + cells were collected by two aphereses proceduresand the cells were then enriched by CD34 + positiveselection using the CliniMAX device. On Augustthe patient underwent high-dose immunosuppressionwith cyclophosphamide 50 mg/kg on days-5,-4,-3 and -2 and equine ATG (Merieux ®) at the dosageof 90mg/kg from day -4 to day -2 followed on day 0by the infusion of 3.3×10 6 /kg CD34 + selected cells.The post transplant course was uneventful with onlyone episode of culture-positive fever (staph. Epidermidis)treated with specific antibiotic therapy whilehe was neutropenic. Severe neutropenia (ANC95% donor cells) in FLU/MEL,FLU/TBI and FLU/CY at days +30 were 76%, 22%, 0%,respectively; at days +90 were 95%, 60%, 0%. InFlu/Mel protocol for HD patients (pts) the rate of CDCat days +30 was 100%; for NHL pts at days +80, +90were 80%, 100% respectively. In Flu/TBI protocol forMM pts at days +30, +90 +180 were 43%, 64%,100%. In Flu/Cy protocol for NHL pts at days +30,+90 +180 were 25%, 25%, 100%; for Kidney pts atdays +30, +90 +180 were 0%, 14%, 29%; for Breastpts at days +30, +90 +180 were 0%, 0%, 0%. AcuteGVHD occurred in 5/22 (23%) pts undergoingFlu/Mel, in three of them were grade > II (2 died),while 7/22 (32%) developed chronic GVHD, none ofthem died of it. In four (21%) pts treated with Flu/TBIprotocol, grade III-IV acute GVHD was observed (2died), chronic GVHD occurred in 9/19 (47%) pts andone of them died of it. Finally in Flu/Cy protocol acuteGVHD was absent, while 4/23 (17%) pts developedchronic GVHD. Donor lymphocyte infusion (DLI) weregiven to 10 pts who had progressive desease (2 developedGVHD and one of them Complete Remission),and to 7 pts for mixed chimerism (none of themdeveloped CDC). Thirty patients (47%) are alive todate. Our study shows that Flu/Mel protocol hasunincreased transplant related mortality, mainly dueto higher incidence of acute GVHD, while chronicGVHD occured in all three protocols. We cannot evidentiateacute GVHD in patients that underwentFlu/Cy conditioning regimen because at day +90 noneof them achieved complete donor chimerism.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004155PO-153A CASE OF REFRACTORY MYCOSIS FUNGOIDES RESPONDING TOALLOGENEIC TRANSPLANT IMMUNE EFFECTAnghel G,^* Locasciulli A,* Scaramucci L,^ NiscolaP,^ Montanaro M,^ Remotti D,* Cruciani G,*Majolino I*^U. O. Ematologia, ASL Viterbo, Ospedale di Montefiascone(Viterbo); *U. O. Ematologia e TMO, AziendaOspedaliera San Camillo-Forlanini, Rome, ItalyA 36 year-old man with chronic dermatitis presentedin October 2001 with a 2 cm diameter erythematousplaque on the left side of the neck. Routinelaboratory tests, including serum lactate dehydrogenase(LDH) were within normal range. A biopsywas performed and a diagnosis of large-T-cell mycosisfungoides (MF)was made. A comprehensive workup,including a trephine marrow biopsy and a totalbodyCT scan did not reveal other disease localizations.The patient received 12 courses of MACOP-B(metotrexate, adriamicin, cyclophosphamide, vincristine,metyl-prednisolone and bleomicin) followedby involved-field radiotherapy (30 Gy) attaining a 2months regression of the neck skin lesion. In May2001, the patient developed a new nodular plaque onthe upper external side of the right leg. A new biopsyconfirmed the disease progression and a secondlinechemotherapy with DHAP (dexamethasone,cytarabine and cis-platinum) was started. Howeverbut new skin lesions soon developed, and the patientwas shifted to the IGEV combination (ifosphamide,gemcitabine, epirubicine and etoposide), with a partialregression of the skin lesions. Following the thirdIGEV course, as soon as the CD34 + cells rapidly peakedin the peripheral blood during the G-CSF priming, astem cell apheresis was performed (collected CD34 +cells = 9.4×10 6 /kg). In December 2002, after highdose(180 mg/sqm) melphalan the patient was rescuedwith his peripheral blood stem cells. Engraftmentwas rapid and complete, but no diseaseresponse was obtained. The patient had an HLA-identicalsister, who was primed with G-CSF 10 mg/kg/daysubcutaneously, and her peripheral blood stem cellscollected by apheresis on day 5.In February 2003, thepatients was conditioned with anti-CD52 MoAb(Campath-1H) 30 mg/day for 3 days, followed bythiothepa 10 mg/kg (day -6), cyclophosphmide 30mg/kg (dd -4, -3) and fludarabine 30 mg/m 2 (dd -4,-3). As graft he received 8.9×10 9 /kg CD34 + cells fromhis sister peripheral blood. GVHD prophylaxis consistedof CSA 2 mg/kg IV from day -1 to +12, followedby CSA 4 mg/kg orally from day 12.PMN (>0.5×10 9 /L)and platelet (>20×10 9 /L) engraftment occurred onday 10 and 11, respectively. Skin lesions however,remained unmodified during the following 3 months,and CSA was therefore tapered and withdrawn onday +42.Since the skin lesions still persisted unmodified,and there was no evidence of GVHD, the patientreceived a treatment course with his donor lymphocyteinfusions. One donor lymphocytes infusion (DLI)was performed on day +84.Extensive chronic cutaneousand mucous GVHD was observed 2 monthsafter lymphocyte infusion (+140). Shortly after, acomplete regression of the hematologic picture, confirmedby skin biopsy was attained. GVHD was effectivelycontrolled by metil-prednisolone (0.2 mg/kg)tapered and than withdrawn 3 months after. Lateinfective complications consisted in 3 episodes ofbacterial pneumonia occurred in the last 2 months.He has been followed as outpatient and at the presenttime he is disease free, at 15 months after allogeneicBMT. The course of MF is generally indolent,except when transformation to a large T-cell lymphomaoccurs (> 25% large cells on biopsy). Age (>60y) and extracutaneous spreading were found to beassociated with poor prognosis, while mean survivalfrom transformation to death is 19.4 - 22 months inthe reported series (Diamandidou E, 1998, Blood;Vergier B, 2000, Blood). In our case, graft-vs-tumoreffect controlled the disease and induced a long-termremission. Whether this effect was potentiated byCampath-1H is difficult to establish. We suggest apotential role of Campath-based nonmyeloablativeSCT in patients with large-cell transformed mycosisfungoides.PO-154HIGH DOSE-THERAPY WITH AUTOLOGOUS PERIPHERAL BLOODSTEM CELL TRANSPLANTATION FOR WALDENSTROM'SMACROGLOBULINEMIACaravita T, Siniscalchi A, Santinelli S, Tendas A,Picardi A, De Fabritiis P, Amadori SHematology, University “Tor Vergata”, St. EugenioHospital, Rome, ItalyWaldenström's macroglobulinemia (WM) is anincurable rare B-cell malignancy. Standard doses ofalkylating agents or purine analogues effect responserates of up to 50%; however, CR are infrequent andthere are no cures. Recently, anti-CD20 monoclonalantibody therapy has been successfully used in thetreatment of WM, while the role of High-Dose Therapy(HDT) followed by Stem Cell Transplantation (SCT)in WM has not been established. AIM: to evaluatethe efficacy and feasibility of an up-front strategy ofHDT, serotherapy and Autologous Peripheral BloodStem Cell Transplantation (APBSCT) for WM. MATE-RIAL AND METHODS: Between April 2001 and October2003 six male patients (pts) with symptomaticWM were enrolled in an open-label trial of HDT(CHOP 3 courses, Rituximab 375 mg/m 2 x4, CTX 4haematologica vol. 89[suppl. n. 6]:september 2004

156Postersgr/m 2 +GCSF) followed by SCT conditioned by Melphalan200 g/m 2 . Main pre-treatment characteristicswere the following: median age 53.5 years (range 41-66); median B2M 3.86 mg/L (range 0.6-6.6); medianbone marrow lymphoplasmacytic infiltration 55%(range 30-80). Three out of six pts were HCV positive.The EBMT/IBMTR/ABMTR criteria were used for definitionof response, while toxicity was graded accordingto WHO criteria. RESULTS: All but two pts mobilizedadequate numbers of stem cells: one patientwas lost at the follow-up before mobilization, whilethe other required a second mobilization to harvesta sufficient number of PBSCs. All the five mobilizedpts underwent APBSCT. Median time from WM diagnosisto SCT was 11 months (range 10-13). Promptand complete hematological recovery was observedin all cases. There was no treatment-related mortalityand toxicities were manageable. With a medianfollow-up of 24 months (6-30), all the 5 patientswere evaluable for response and achieved a partialresponse after the APBSCT. Currently, all patients arealive without clinical or serological signs of diseaseprogression. CONCLUSIONS. Although the number oftreated pts is too small to draw any significant conclusion,our preliminary data indicate that the associationof HDT with Rituximab followed by APBSCT inWM is feasible and long-term disease control can beachieved in selected pts.PO-155IMATINIB MESYLATE (GLIVEC) PRE-TREATMENT DOES NOTINFLUENCE THE OUTCOME OF ALLOGENIC HEMATOPOIETICSTEM CELL TRANSPLANTATION IN PHILADELPHIA-POSITIVELEUKEMIASTiribelli M, Marin L, Calistri E, Geromin A, SimeoneE, Candoni A, Sperotto A, Damiani D, Fanin RClinica Ematologica, Policlinico Universitario di Udine,ItalyAs the role of Imatinib mesylate (Glivec) is gainingground in the treatment of Philadelphia-positive(Ph+) leukemias, its effects on subsequent allogenicstem cell transplantation (SCT) are still largelyunknown. Some recent reports seems to indicate ahigher transplant-related mortality in patients pretreatedwith Imatinib for Ph + acute leukemias, butother studies on Ph + acute lymphoblastic leukemia(ALL) patients do not confirm this data. We reportour experience with Imatinib therapy preceding allogenicSCT in patients with Ph + leukemias (ALL orCML). Ten patients (4 ALL and 6 CML) were treatedwith Imatinib before allogenic SCT at our Institution.The median age at diagnosis was 40 (range: 30-55)years. The ALL patients received 2 to 4 courses ofchemotherapy; Imatinib therapy was started whenhematologic recovery after the fourth cycle was documented,or after the second course in the resistantpatients. Imatinib daily dose was 400 mg, then roseto 600 if tolerated. The CML patients received eitherinterferon-based therapy (3) or hydroxyurea ± cytarabinethen were switched to Imatinib due to intolerance(400 mg) or progression to accelerated - blasticphase (ABP) (600 mg). Six patients started Glivecin remission or chronic phase (CP), four were resistantor in ABP. Four patients were in cytogenetic response,two also in molecular remission. Imatinib therapy wasgiven for a median of 6 months (range: 2-18) prior toallogenic SCT. Seven patients (4 ALL and 3 CML)maintained or improved the degree of response, withtwo cases attaining a major cytogenetic response.Two ALL patients relapsed after 3.5 and 5 months,one CML patient lost cytogenetic response at twelvemonths and later progressed to AP. Three CMLpatients, one in late CP and two in ABP, were primaryresistant to Imatinib. Tolerance to Imatinib wasgenerally good, with 4/10 patients developing gradeIII or higher toxicity (hematologic toxicity in two cases,hepatic in the other two). Imatinib therapy wasstopped at a median of 1 month (range: 0.5-5) beforetransplantation. Allogenic SCT was performed incytogenetic remission in three patients, CML-CP inone, ABP in four and relapse of ALL in two cases.Eight patients (80%) underwent transplantation froma matched unrelated donor (MUD), two from an HLAidenticalsibling. Stem cell source was peripheralblood (PB) in 3/10 cases, bone marrow in 7/10.MedianCD34 + dose was 3.9×10 6 /kilograms (range: 0.5 -6.4). Conditioning regimen included cyclophosphamide(CY) and TBI in eight patients, BUCY ± ATGin two. GVHD prophylaxis consisted of cyclosporineand short-course methotrexate. Nine out of tenpatients engrafted, with a median time to neutrophiland platelet recovery of 19 (range: 13-29) and 22.5(range: 17-130) days respectively. Two patients developeda grade III-IV acute GVHD (skin, liver, bowel)and died 27 and 55 days after SCT, the former stillaplastic. Of the eight patients surviving more thanthree months, four (50%) developed a chronic GVHD,mild or moderate in three cases and severe in one,with cutaneous and pulmonary involvement. Threepatient, who didn't suffered from cGVHD, relapsedafter 3.5, 4 and 5.5 months: two patients died whilethe third attained remission after a second transplant.One CML patient, despite a moderate cGVHD,relapsed at molecular level after 7 months, butreturned BCR/ABL-negative with Imatinib therapy.With a median follow up time of 16 months afterSCT (range: 1-26+), 5/10 patients (1 ALL and 4 CML)are alive, in first (3) or second (2) remission. Threepatients experienced major infections: two Gramnegativepneumonias and one HSV. One patient hadCMV reactivation. Our experience confirms the safe-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004157ty of Imatinib therapy preceding allogenic SCT. Pretreatmentwith Glivec for CML or Ph + ALL does notseem to affect the transplant procedure in terms ofengraftment, incidence of GVHD (both acute andchronic) or infections.decrease the IST, improved the quality of life, minimisingthe long-term drugs related side effects. Evenfrom an economical point of view ECP demonstratedto be a cost-effective therapeutical approach especiallyfor long term survivals.PO-156EXTRACORPOREAL PHOTOCHEMOTHERAPY: AN IMMUNOMODU-LATION APPROACH FOR ACUTE AND CHRONIC GVHDDel Fante C, Bergamaschi P, Viarengo GL,Salvaneschi L, Perotti CServizio di Immunoematologia, Medicina Trasfusionale,Centro di Immunologia Dei Trapianti, Irccs PoliclinicoS. Matteo, Pavia, ItalyAcute and chronic GvHD strongly affect morbidityand mortality after allogeneic stem cell transplantation.The immunosuppressive therapy (IST) administeredin order to control GvHD manifestationsengraves on the post-transplant related infectionsand on the development of secondary malignancies.Furthermore IST strongly impairs the quality of lifeand growth in children. In this scenario, a new therapeuticalapproach based on immunomodulationrather than on a more aggressive IST is desirable.Extracorporeal Photochemotherapy (ECP) is a newtherapeutic strategy consisting in a mononuclearcells (MNC) collection by a blood cell separator, dilutionof the collected MNC with saline after 8-Methoxy Psoralen addition, irradiation with UV-Alight and the reinfusion of the manipulated MNC tothe patient. This treatment has many advantagescompared to other similar techniques: low extracorporealvolume (200 mL), short procedure time (2hours), highly enriched MNC concentrate, homogeneousand efficient MNC irradiation, Hct less than2% in the bag, a constant concentration of 8-MOP(2 ng/ml) in the leukapheresis product and, finally,low costs. We present our results about 91 patients(50 adults, 21 pediatrics) affected with grade II-IVchronic GvHD (Skin, mucosaes, liver and lung) and20 pediatric patients affected with grade II-IV acuteGVHD (skin, mucosaes, liver, gut). ECP treatmentschedule was: 2 consecutive procedures per week for2 weeks, followed by 2 courses every two weeks for3 times and finally by 2 procedures monthly. Theresponse rate in adult and pediatric patients withcGvHD was 82% and 75% respectively, while in thepediatric setting with aGvHD the overall responserate was 62%. We were able to taper or suspend theIST in 79,3, 65,7% and 58% of adults and childrenwith cGvHD and children with aGvHD respectively.ECP demonstrated its effectiveness as a second linetherapy in the treatment of GvHD, its safety and tolerabilitywas excellent. Finally, the possibility toPO-157EFFICACY OF SEQUENTIAL THERAPY WITH ANTI-CD20 (RITUX-IMAB) AND PBSCT IN B LYMPHOPROLIPHERATIVE DISORDERS:PHASE II STUDYMazza P, Maggi A, Specchia MR, Pricolo G, Stani L,Prudenzano A, Amurri B, Palazzo GSruttura Complessa di Ematologia Ospedale“S. G. Moscati” Taranto, ItalyA phase II study to valuate the efficacy of sequentialtherapy including purging with anti-CD20 monoclonalantibody (Rituximab) in conjunction with highdose therapy and PBSCT in lymphoprolipherative disorderswas performed. Treatment consisted of 4 CHOP,two mobilizations of CD34 cells with high-dose (HD)Cytoxan (CTX) + G-CSF and HD Aracytin (ARA-C) + G-CSF. Both therapies were followed by Rituximab aspurging in vivo and PBSCT with BEAM conditioningregimen was planned as last phase. Values consistedat each step of bone and marrow biopsy with immunephenotype of cells and molecular biology of marrowsample; detection of purging efficiency with the samemethods was also done. Up to December 03, 42patients completed the entire program: 14 had beenafter relapse from previous treatment, 28 patients asup-front therapy. Histology included Follicular CenterCell Lymphoma (FCCL) in 17 pts, Diffuse CentroblasticLymphoma (DCBL) in 2 pts, LymphoplasmacyticLymphoma (LPL) in 7 pts, mantle cell lymphoma (MCL)in 6 pts and chronic lymphocytic leukemia (CLL) in 10pts. Twenty-two pts had leukemic syndrome. After thefirst phase with CHOP, all patients had a residual diseasedetected by immune phenotype or molecularbiology. Following the first mobilization by CTX andfirst Rituximab 21 pts (50%) obtained a CR withabsence of minimal residual disease. After the secondmobilization by ARA-C and second Rituximab, 36pts obtained a CR. Following the last phase withPBSCT 40 pts obtained CR. One patient died for Gramnegative sepsis during cytopenia following PBSCT, onept had cerebral hemorrage and one fulminant hepatitis,5 and 8 months after the end of program, respectively.Molecular remission was obtained in 85% ofvaluable pts. 32 pts remain in CR at a follow-up rangingfrom 8 to 50 months, mean 23 months. Resultsaccording to histology revealed a clinical and molecularremission in 93% of FCCL, a clinical and molecularCR of 60% and 20%, respectively, of CLL, a clinicalremission of 40% of LPL, a clinical and molecularhaematologica vol. 89[suppl. n. 6]:september 2004

158Postersremission of 100% of MCL and a clinical remission of100% of CBL. In conclusion this study shows thatsequential purging in vivo therapy with the combinationof Rituximab and high dose therapy followed byPBSCT is highly effective in inducing CR in most of CD20 chronic lymphoprolipherative disorders, however itseems that the efficacy is best expressed in FCCL andMCL.PO-158RELATIONSHIP BETWEEN CHIMERISM KINETICS OF LYMPHOE-MOPOIETIC SUBPOPULATIONS AND OUTCOME IN 35 PATIENTSRECEIVING ALLOGENEIC NON-MYELOABLATIVE STEM CELLTRANSPLANTATIONLucesole M,* Olivieri A,* Poloni A,* Capelli D,*Buscemi L,° Trappolini S,* Montanari M*, Gini G,*Troiani M,* Scortichini I,* Re R,* Leoni P**Clinica di Ematologia; *Clinica di Medicina Legale,Ospedali Riuniti, Ancona, ItalyChimerism analysis following allogeneic stem celltransplantation (SCT) is used to document clinicalevent such as engraftment, graft rejection orleukaemic relapse, but little is known about theestablishment of chimerism in the different hematopoieticsubpopulations in the setting of non-myeloablativeSCT. We have analysed chimerism in samplesof peripheral blood, CD3+cell fraction and inbone marrow from 35 patients receiving allogeneictransplantation (between 04/99 and 02/04) from HLAidentical sibling. Patients were conditioned with twodifferent regimens of reduced-intensity conditioning:twenty-five patients received the associationFludarabine 60mg/kg, Cytoxan 60 mg/kg andThiotepa 10 mg/m 2 (group A); then patients receivedthe same dose of thiotepa plus cytoxan 100 mg/kg,but without the inclusion of fludarabine (group B).The median follow up was 300 days(32-1333); themedian age of patients was 50 yrs (range 23-71), 16were male and 19 female. All patients engrafted andthe overall incidence of grade 3-4 acute GVHD was14% and the non relapse mortality was 14%. Theevaluation of chimerism was performed in the bonemarrow cells, in peripheral blood and in the followingsubpopulations: CD3+ cells and in mesenchymalcells; at days 15,30, 60, 90 and 180 after transplantation,by using the PCR-based method for VNTR andSTR microsatellytes analysis; the CD3+ and CD56+subpopulation analyzed have been obtained withMinimacs device while the mesenchymal cells (MSC)were analyzed after triple passage on Petri dishes ofthe adherent cells. The chimerism in the peripheralblood at day +30 was >95% in 22/25 (88%) patientsof group A while only 5 out of the 9 patients conditionedwithout fludarabine achieved the completechimerism; in the bone marrow the chimerism wascomplete in 16/22 group A patients (73%) and in5/10 group B patients; the CD56 population evaluatedin 14 patients showed a complete chimersim in allgroup A patients and in 3/5 group B patients. In theCD3 + population (evaluated in 23 patients) thechimerism was complete in 9/16 of those receivingfludarabine and in 1/7 of those conditioned withoutfludarabine. At day +90, in 23 evaluable patients thechimerism of PB and bone marrow remained completein 15/20 group A patients while in only 3/8(37%) of group B patients; also the CD3+ populationin the fludarabine group showed complete chimerismin 88% (14/16) compared with 22% in the othergroup; the CD56+ population evaluated in 8 patientsshowed complete chimersim in all (7 conditionedwith Fludarabine and one without fludarabine). Finallyin the 10 patients evaluable for chimerism in MSC,6/10 had no detectable donor cells while in 4 the percentageof MSC donor was ranging from 23 to 86%.Severe GVHD was observed in 5/35 patients, all conditionedwith fludarabine; this suggests that theestablishment of early complete chimerism in thelymphoid population could facilitate the onset ofsevere GVHD in this subset of patients.PO-159UNRELATED HEMATOPOIETIC STEM CELL TRANSPLANTATION INTHALASSEMIA: ROLE OF KIR POLYMORPHISMLa Nasa G, Ventrella A,* Giustolisi GM,* Locatelli F,°Vacca A, Piras E, Floris R, Caocci G, Carcassi C*U. O. Ematologia - Centro TMO, P. O. "R. Binaghi",Cagiari, Italy; *Cattedra di Genetica Medica, Universitàdegli Studi di Cagliari, Italy; °OncoematologiaPediatrica, IRCCS Policlinico S. Matteo, Pavia, ItalySeveral reports suggest that natural killer (NK) cellsmay be involved in rejection and GVHD followingallogeneic bone marrow transplantation. Human NKcells express structurally diverse non-inhibitory andinhibitory receptors including the killer cell immunoglobulin-likereceptors (KIR). These receptors areencoded by a family of 14 polymorphic genes and arecharacterized by the number of Ig domains (KIR2D orKIR3D) and by the length of their cytoplasmic tail,which can be long (L), with an inhibitory function, orshort (S) with an activating function. Ligands of KIRare represented by HLA class I antigens at the A, B,Cw and G loci and are likely to play a significant rolein the control of immune response and, probably, alsoin hematopoietic stem cell transplantation. In thisstudy, we evaluated whether KIR genotype differencesbetween HLA-identical donors and recipientshad an impact on acute GVHD (grade II-IV)and rejection.29 donor/recipient pairs, completely identicalhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004159for the HLA-A, B and Cw loci, were selected for analysis.In 10 out of 29 pairs (34%), the donor KIR genotypewas included in the recipient KIR genotype (theaddditional KIR genes carried by the recipient butabsent in the donor may increase the risk of rejection);in 6 pairs (21%), the recipient KIR genotypewas included in the donor KIR genotype (the additionalKIR genes present in the donor but absent inthe recipient may increase the risk for GVHD); in 2pairs (7%) there was complete identity for the KIRgenotype; in the remaining 11 donor/recipient pairs(38%) the KIR genotypes were different. When thedonor KIR genotype was included in the recipientgenotype, the incidence of GVHD was 30% (3/10pairs). When the recipient KIR genotype was includedin the donor genotype (high risk for GVHD), theincidence of GVHD was 67% (4/6 pairs). GVHD inrecipients with different KIR genotypes was 27%(3/11 pairs). However, none of these differences weresignificant. Of the 5 total cases of rejection, 4 pertainedto the highest risk group (donor KIR genotypeincluded in the recipient genotype) and only one casepertained to one of the other categories (p = 0.03).Despite the relatively small size of the study, theresults obtained suggest a possible role for the KIRgenotype in the pathogenesis of GVHD and rejectionin the course of bone marrow transplantation.PO-160ACUTE HEPATIC FAILURE AS ONSET OF PROGRESSIVE SCLERO-DERMATOUS CHRONIC GRAFT-VERSUS-HOST DISEASE AFTERDONOR LYMPHOCYTE INFUSION: A CASE REPORTSkert C, Patriarca F, Zaja F, Tomadini V, Fanin RDivision of Hematology, University Hospital of Udine,ItalyDonor lymphocyte infusion (DLI) is an importanttherapeutic chance for the relapse post conventionalallogeneic stem cell transplantation (SCT) and a therapeuticcomplement in non-myeloablative transplant.GVHD post-DLI still results in significant morbidityand mortality. A 28-year-old man with acute myelogenousleukemia (AML) underwent allogeneic SCTfrom his HLA-identical brother in July 2002, in firstcomplete remission. The conditioning regimen consistedof busulfan and cyclophosphamide. CyclosporinA (CyA) and short course methotrexate were given forGVHD prophylaxis. Acute GVHD was not observed.Relapse of AML was documented five months afterSCT and CyA was discontinued. The disease wasresistent to several salvage therapies and only Ara-Cin continuous perfusion for 20 days was effective. InMay 2003, the patient received the first (DLI) containing2,5×10 7 /kg of CD3.One month later a completechimerism was evidenced in bone marrow andperipheral blood. The patient developed a grade IIIacute GVHD, involving skin and liver, responsive tomethilprednisolone. A second DLI with 2,5×10 7 /kg ofCD3 was given in July 2003.Acute GVHD of grade Iinvolving skin was evidenced on day + 21.Progressivechronic GVHD with lichenoid changes of mouth andliver involvement, confirmed by liver biopsy, developedfrom day +41. The assessment of liver functionshowed increased serum transaminase, cholestasisenzyme and LDH (460 IU/L): ALP 312-GPT 158, AST144, ALT 198 IU/l. Immunosuppressive therapy wasnot started to reduce the risk of relapse and in consequenceof the non-severity of GVHD. 105 days after2nd DLI, the patient acutely developed an anasarcaticcondition due to hepatic failure with decreasedalbumin (24 gr/l) and cholynesterasis (2721 IU/l), andincreased protrombin time (40 seconds). Transaminaseand cholestatic enzyme were stable, except foran increase of ALP (420 U/l); total bilirubin remainednormal. RT-PCR for serum HCV,HBV,EBV,HH6,VZV,HSV and CMV antigenemia were negative. γ-globulin(IgG 2069 mg/dl policlonal) and anti-nuclear antibodyincreased (1:2500). Ecography and dopplersonography didn't demonstre any alteration. A secondliver biopsy was not conclusive because of an inadequatefixation of the sample. A therapy with albuminand diuretics i. v. was immediately started. The initialsigns of sclerodermatous changes in the forearms andin the lower legs become evident with the reductionof the anasarca. The immunosuppressive therapy withCyA was given orally at dose of 1-2 mg/kg/days. Liverfunction normalized in three weeks with resolutionof anasarca. Scleroderma remained stable untilday +145 after 2nd DLI; then it extended in the arms,legs, thorax and abdomen and diffuse joint contracturesdeveloped. Scleroderma wasn't improved by theincreased dose of CyA (3-5 mg/kg/day), the associationof prednisone (1-2 mg/kg/day) and the followingaddition of methotrexate i. v. An acute hepatic failureevidenced an unusual flare of chronic GVHD. Anautoimmune-like reaction inside a chronic GVHDprobably acted on a liver which was damaged byantiblastic therapies and emosiderosis, causing hepaticfailure without a previous real acute hepatitis.Another interesting point is the relatively rapid resolutionof anasarca and hepatic failure, immediatelyafter the beginning of immunosupressive therapy,against the progression of scleroderma. It can behypothesized that a Th2-type reaction was the triggerof hepatic and sclerodermic flare; another hypothesisis that a Th2-response was followed by the shifttoward a Th1-response. The first immunosuppressivetherapy could have stopped Th2 reaction but not Th1and/or the flow of cytokines and chemokines, whichactivate fibrosis through TGF-a. The characteristiccourse of GVHD post-DLI, similar to chronic GVHD butoften with a development time typical of acute GVHD,haematologica vol. 89[suppl. n. 6]:september 2004

160Posterswould require an early and intensive immunosuppressivetherapy, specially in presence of scleroderma,but the beginning of the therapy is often retardedto reduce the risk of relapse. The decision aboutwhich cases require an immunosuppressive therapyand when it should be started is still an open question,specially post-DLI. An answer could come froma more precise knowledge of the immunologic phenomenainvolved. These phenomena seems to changenot only with GVHD type (acute, chronic or post-DLI),but with time and target organs as well.PO-161EVALUATION OF THE PROLIFERATIVE ACTIVITY OF HEMATOPOI-ETIC PROGENITORS FROM LEUCAPHERESIS IN DIFFERENTHEMATOLOGIC MALIGNANCIESBonfichi M, Marseglia C, Troletti D, Caldera D,Vanelli L, Brusamolino E, Perotti C,* Del Fante C,*Alessandrino EP, Lazzarino MDivision of Hematology, IRCCS Policlinico San Matteo,University of Pavia, Pavia;*Immunohematologyand Transfusion Service IRCCS Policlinico San Matteo,Pavia, ItalyIn 516 consecutive subjects, enrolled in a BMT programwith peripheral blood progenitor cells (PBSC)and submitted to leucapheresis (LK) between January1994 and april 2004, we studied the progenitor proliferativeactivity in each collection and the correspondingCD34 + cells percentage. The patients wereaffected by high-grade or resistant non-Hodgkin'slymphoma (NHL, n=145), follicular non Hodgkin'slymphoma (FNHL, n=29), Hodgkin's disease (HD,n=79), multiple myeloma (MM, n=130), acute myeloidleukemia in first CR (AML, n=54) chronic myeloidleukemia in chronic phase (CML, n=54), chronic lymphocyticleukemia (CLL, n=4) idiopathic myelofibrosis(IM, n=5), AL amyloidosis (AA: n. 4); 45 healthy volunteerdonors (VD) are also included in this series. ThePBSC mobilizations were obtained with G-CSF afterhigh dose chemotherapy (HD-CTX, IGEV or DHAP inHD, HD-CTX, IPAD or DHAP in NHL, R-HDAra-C inFNHL, HD-CTX or D-CEP in MM, HD-Ara C in AML,IM, CLL, mini ICE in CML). G-CSF alone was used in AAand VD. The leucapheresis were performed with aCS3000 Plus (Baxter) or Spectra (Cobe), processing atleast 2,5 blood volume per procedure. The collectionstarted when CD34 + cell count was more than 20/µLand was stopped when CD34 + cells collected weremore than 4×10 6 /Kg. Independently from mobilizingchemotherapy, the LK number was not significantlydifferent in all subjects analyzed, (mean 1.9 LK,p=0.16). Twenty% pts (n=106) required 3 collections,5% (n=28) needed 4 and 2,4% (n=13) needed 5 ormore leucapheresis. In NLH and HD patients the CFU-GM number and the percentage of CD34 + cells detectedin the 1 st LK were significantly higher than in 2 nd(NHL: CFU-GM 263±360 vs 148±191×10 5 cells, %CD34 2.3±2.9 vs 1.3±1.4 cells; HD: 226±386 vs89±00×10 5 cells, 1,7±2.1 vs 0.82±0.74). However, theCFU-GM growth, although does not reach statisticalsignificance, decreased from the 1st to the last LK inall category of pts except in CML and MI pts when theprogenitor number resulted progressively increased(CFU-GM/10 5 cells: CML 1 st LK: 104±91:2nd LK:131±90; IM 1 st LK: 564±467, 2 nd LK: 627±116). In conclusionthe kinetic and the proliferative activity aresimilar in PBSC collected from NHL, HD, MM, AA ptsand VD. A different growth pattern was shown by IMand CML cells, probably due to the peculiar biology ofthese disorders.PO-162Not publishedPO-163CHARACTERIZATION AND GENE EXPRESSION PROFILE OF AMESENCHIMAL STEM CELL CLONEMarongiu MF,* Scintu F, # Reali C, # Pillai R, # Badiali M, +Sanna A, + Argiolu F, + Sogos V, # Ristaldi MS**Istituto di Ricerca di Neurogenetica e Neurofarmacologiadel CNR, Cagliari, Italy; # Dipartimento diCitomorfologia, Università degli Studi di Cagliari,Italy; + Centro Trapianti di Midollo Osseo, OspedaleRegionaleper le Microcitemie, Cagliari, ItalyHuman bone marrow contains at least two types ofadult stem cells: hematopoietic stem cells (HSCs) andmesenchimal stem cells (MSCs). HSCs have beenwidely characterized and have been used in the clinicalpractice for decades. On the other hand MSCshave reached the scene only recently, neverthelessthey are one of the most promising stem cell types forexperimental and clinical applications. Several peculiarcharacteristics of this stem cell type make themso attractive: 1) they are easily accessible; 2) theyare relatively easy to expand in culture; 3) they canbe genetically manipulated; 4) they can differentiatein several cell types in vitro and in vivo; 5) they cantransdifferetiate (i. e. differentiate in a cell type ofdifferent embryonic origin) in vitro and in vivo.Despite the appealing of MSCs as a therapeutic toolthe knowledge of their biology is still very limited.An other drawback is the fact that there is no specificmarker that identify unequivocally MSCs. ThereforeMSCs have different characteristics in differentlaboratories and are probably a combination of celltypes. Recently a multipotent cell has been clonallyisolated from MSCs: the multipotent adult progeni-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004161tor Cells (MAPCs). MAPCs are able to differentiate inall the cell types of an organism when tested in an invivo assay, recalling embryonic stem cells (ES) characteristics.In particular it has been shown thanMAPCs participate to the erythroid compartment.MAPCs are valuable tool for gene therapy since theireasiness of manipulation and the recent successfulgene targeting by homologous recombination. Inorder to better understand the biological nature ofMSCs (and possibly MAPCs) we are carrying out agene expression profile on a single cell clone isolatedfrom a population of MSCs. The single cell clonehas been isolated from human bone marrow aspirateand has been expanded in colture in an undifferentiatedstate for more than 20 doubling. The clone hasbeen characterized by immunocytochemistry beingpositive for several markers consistent with its undifferentiatedstate. We have also tested its capacity totransdifferentiante into glia and neurons. Total RNAhas been extracted and a Sequence Analysis of GeneExpression (SAGE) has been carried out. A library hasbeen constructed containing about 60.000 tags, representingthe MSC trascriptome. Preliminary resultsindicate a complex pattern of gene expression, whichwill be further investigated.PO-164AUTOLOGOUS PERIPHERAL BLOOD STEM CELL TRANSPLANTA-TION FOLLOWED BY INTERLEUKIN-2 ADMINISTRATION INACUTE MYELOID LEUKEMIA PATIENTS IN IST COMPLETEREMISSIONTrisolini SM, Capria S, De Propriis MS, Dessanti Ml,Diverio D, Guarini A, Villivà N, Foa R, Mandelli F,Meloni LDipartimento di Biotecnologie Cellulari ed Ematologia.Università La Sapienza Rome, ItalyInterleukin-2 (IL2) is a cytokine with antitumoractivity. When administered after autologous stemcell transplantation, it appears to reproduce the graftversus leukemia effect of allogeneic transplant andpossibly prolong disease-free survival (DFS). Since1999 at Hematology Department of Rome, 43 AMLpatients in Ist CR received PBSCT after BU-CY conditioningregimen. All patients received high-dosehydroxyurea followed by cytarabine, daunorubicinand etoposide as induction treatment, and daunorubicinand high dose cytarabine as consolidation. In 28out of 43 patients, a post-autograft immunotherapywith IL2 was planned. An absolute neutrophil counthigher than 1,000/mL, a stable platelet count greaterthan 50,000/mL and no evidence of active infectionswere required to start the treatment. IL2 was administeredsubcutaneously on 5 consecutive days, on amonthly basis, for 1 year or until relapse. The dosageof IL2 was 4×10 6 IU on day 1, followed by 8×10 6 IUon days 2 through 5.All patients received during IL2therapy paracetamol and prophylactic trimethoprim/sulfamethoxazoleto prevent bacterial infections.Fifteen out of 28 patients were treated with IL2after PBSCT. One patient is too early. One patientrefused treatment and 11 were not eligible: 2 patientsbecause of psychological disorders, 3 patientsbecause of documentation of active infection aftertransplant, 2 patients who relapsed without PLTSrecovery and 4 patients who showed a delayedplatelet recovery at a median of 149 days (range 124-209) from transplant. Among the 15 evaluablepatients, IL2 therapy was started after a median of108 days from autograft (range 35-200). No patienthad high grade toxicity requiring treatment discontinuation.All patients showed fever (38-39°C) witharthralgia (5/15 patients), 4-6 hours after IL2 administration.The majority of patients showed gastrointestinaltoxicity (grade 1-2) in the form of nauseaand vomiting (10/15), diarrhoea (4/15) and transienttransaminase increase (2/15). Skin toxicity (grade 1-2) was observed as desquamation (7/15), rash andpruritus which required systemic measures (4/15) andinjection site reactions (5/15). With regard to hematologicaltoxicity (grade 2-3), transient neutropenia(2/15) and thrombocitopenia (4/15) were observed,requiring a 50% dose reduction in 2 patients. Onepatient showed irritability, during drug administration,not requiring dose modification. One patientshowed herpes simplex infection requiring oral treatment.In all cases, toxicity completely recovered within48 hours from IL2 discontinuation. Seven patientscompleted the treatment and are in CCR. Fivepatients are still on therapy. Three patients showeddisease relapse after 2 (CNS relapse), 4 and 11 monthsof IL2 treatment, respectively. Our study shows thatthe IL2 therapy was often delayed after PBSCTbecause of a delayed stable platelet reconstitution.Based on our experience, it appears that low-doseIL2 after PBSCT is a feasible approach devoid of serioustoxicity. A randomized trial is currently ongoingin the context of EORTC/GIMEMA AML12 protocol todocument whether or not IL2 is capable to enhancingthe likelihood of DFS after PBSCT.haematologica vol. 89[suppl. n. 6]:september 2004

162PostersPO-165SPONTANEOUS MOBILIZATION OF BONE MARROW-DERIVEDHEMATOPOIETIC AND ENDOTHELIAL PROGENITOR CELLSAFTER ORTHOTOPIC LIVER TRANSPLANTATIONTalarico S,* Loggi E,° Catani L,* Andreone P,°Baccarani U, § Grazi Gl,^ Vetrone G,^ Fogli M,*Gramenzi A,° Lorenzini S,° Bernardi M,° Pinna AD,^Baccarani M,* Lemoli RM*Istituto di Ematologia e Oncologia Medica “L. & A.Seràgnoli” *; Dipartimento di Medicina Interna,Cardioangiologia ed Epatologia°; Dipartimento diDiscipline Chirurgiche, Rianimatorie e dei Trapianti^Università degli Studi di Bologna - Clinica Chirurgica,Centro Trapianti Fegato-Rene-Pancreas § ,Universitàdegli Studi di Udine, ItalyLiver regeneration after tissue injury is dependenton two resident cell populations. Whereas moderatecell loss is restored by mature hepatocytes, moresevere liver injury induces the activation of hepaticoval stem cells. Recently, the bone marrow has provento be a third source of liver-repopulating cells. However,little is known regarding the mechanisms ofmobilization of bone marrow stem cells into peripheralblood after liver injury, their concentration, phenotypeand function. In the present study, peripheralblood mononuclear cells of 22 patients undergoingorthotopic liver transplantation (OLT) for liver failureand/or hepatocarcinoma and 6 patients submittedto partial hepatectomy (PH), were characterizedphenotipically by flow-cytometry analysis. Fivehealthy subjects were used as control population.Hematopoietic (CD34, CD133, CD90, CD38) andendothelial markers (KDR, FLT-1, CD31, VE-Cadherin,vonWillebrand Factor) were monitored before (day -1) and after (days +1, 3, 7 and 14) the surgical procedure.A time-course evaluation of the colony formingactivity of hematopoietic progenitors was alsoassessed in semisolid culture. Our results demonstratethat half of the OLT patients mobilized CD34 +hematopoietic progenitor cells into peripheral bloodwith a peak value at day +7 after OLT (0.23±0.30cells/mm 3 vs 1.95±2.71 cells/mm 3 ; p 0.007). In addition,we found an increase of early CD34 + /CD90 +(0.11±0.16 cells/mm 3 vs 0.51v0.72 cells/mm 3 ) andCD34 + /CXCR4 + progenitor/stem cells (0.21±0.38cells/mm 3 vs 1.18±1.46 cells/mm 3 ; p 0.03) after 7days from OLT. Clonogenic assay confirmed the mobilizationof hematopoietic progenitor cells on day + 7and +14 from OLT and a positive correlation wasobserved between colony forming capacity and thenumber of CD34 + cells on day + 7.Furthermore, thenumber of CD133 + (0.33±0.51 cells/mm 3 vs 1.46±2.07cells/mm 3 ; p 0.006) and CD34 + /KDR + (0.03±0.1cells/mm 3 vs 0.39±0.75 cells/mm 3 ; p 0.04) endothelialprogenitor cells was also significantly increasedon day +3 from OLT along with CD31+, VE-Cadherin+,and FLT-1+ mature endothelial cells. Whenwe analyzed patients submitted to PH, we found apattern of stem cell mobilization similar to that displayedby patients undergoing OLT. We also analyzedthe serum levels of the following cytokines (SCF, HGF,SDF-1, IL-6) before and after 7 days from OLT: onlythe SCF serum levels were significantly increased onday +7 (1332±283 pg/ml) in comparison with thebasal levels (1053±239 pg/ml; p 0.009). In conclusion,a significative proportion of patients submitted toOLT show a spontaneous mobilization of hematopoieticand endothelial progenitor cells into peripheralblood. Whether these mobilized cells partecipate toliver regeneration remains a matter of speculationand has to be determined further.PO-166PEG-FILGRASTIM AS MOBILIZING AGENT: A CASE REPORTMusto P, Scalzulli P, Cascavilla N, Dello Iacono N,*Fania G,* Centra M*Hematology and Stem Cell Transplantation Unit,Transfusional Service,* IRCCS "Casa Sollievo dellaSofferenza" Hospital, S. Giovanni Rotondo, ItalyPeg-filgrastim is a novel granulocyte-colony stimulatingfactor (G-CSF) characterized by prolongedactivity and unique mechanisms of clearance. Thisdrug is licensed in Italy for preventing and treatingneutropenia after chemotherapy in solid and hematologicalmalignancies. The efficacy of peg-filgrastimas mobilizing agent has not been extensivelyinvestigated. Here we report the case of a patient inwhom peg-filgrastim was employed to induce mobilizationof autologous peripheral blood stem cell(PBSC). A 62 year-old male patient affected by stageIIIA multiple myeloma was enrolled on January, 2004,in a front-line intensive chemotherapic programplanned to perform tandem autologous stem celltransplantation. The patient was in partial remissionafter two cycles of DAV (doxorubicin, vincristine anddexamethasone) and had successfully collected8.7×10 6 /kg CD34 + PBSC after one cycle withcyclophosphamide (4 g/m 2 body surface), followed byrecombinant G-CSF at the dose of 10 mcg/kg s. c for7 days. According to the protocol applied, a secondadministration of cyclophosphamide at the dose of 4g/sqm was given two months after the first mobilization.Since the number of CD34 + cells previouslycollected was sufficient to perform both plannedautologous transplantations, we decided, afterinformed consent was achieved, to use peg-filgrastimfor the second mobilization. Forty-eight hoursafter cyclophosphamide, a single dose of peg-filgrastim(6 mg) was given subcutaneously. Whitehaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004163blood cell (WBC) nadir was reached on day +7(1.7×10 9 /L). Two consecutive leucaphereses were performedon day +9 and +10, when WBC counts were8.6×10 9 /L and 7.7×10 9 /L and CD34 + cells were 0.3%and 0.2%, respectively. A total amount of 2.5×10 6 /KgCD34 + PBSC was collected. No relevant adverse effectwere recorded. The patient referred only moderatebone pain at WBC recovery. The program of autologoustransplantation is currently on-going. Thesedata indicate that a single dose of peg-filgrastim iseffective in mobilizing PBSC in combination withchemotherapy. However, in our patient, the totalamount of CD34 + PBSC collected was lower than thatpreviously obtained by using high dose G-CSF in thesame setting. Optimal timing and doses and comparisonwith G-CSF, in terms of efficacy, safety and costs,warrant to be investigated in ad-hoc studies.PosterCHRONIC LYMPHOCYTIC LEUKEMIAAND LYMPHOMAPO-167EXPRESSION OF KILLER INHIBITORY RECEPTOR (KIR) CD158BON RESIDUAL TCR α/β OR γ/δ T CELLS IN B-CELL CHRONICLYMPHOCYTIC LEUKEMIA (B-CLL) MODULATE THEIR CYTOTOX-IC ACTIVITYDe Totero D,* Clavio M,^ Gobbi M,^ Abbondio C,*Pietra G,° Mingari C,° Ferrini S**Immunopharmacology and °Immunology Lab,National Institute for Cancer Research; ^Chair ofHematology and Oncology, Dept of Internal Medicine,University of Genoa; Genoa, ItalyIn CLL the primary event is the malignant trasformationof CLL B cells. Defects of the residual cellularcompartment (i. e. natural killer, T and dendritic cells),however, affect immune responses against neoplasticcells and lead to disease progression. Administrationof cytotoxic cells such as natural killer (NK) andnatural killer-like T (NKT) cells, expanded in vitro, mayrepresent a novel opportunity in CLL treatment, butthe difficulties found in ex vivo establishment ofappropriate cytotoxic cells (CTL) recognizing theleukemic clone represent a limiting step in developmentof cellular immunotherapies. In an attempt toclarify expression of molecules involved in modulationof immune response, we here evaluated KIRsexpression in a series of CLL patients, all with stabledisease, at stage A and out off treatment. Among 16patients studied, we could detect in 7 a significantexpression of the p58.2 molecule (CD158b). Moreoverin one patient we observed that the CD158b +subset, representing half of the entire CD3 + /CD8 +population, expressed a unique TCR Vβ region (Vβ23).Cloning of purified CD19 − /CD4 − cells, allowed us toisolate two TCR α/β (Vβ23 + ) CD3 + /CD8 + and one TCRγ/δ (γ9/δ2) CD3 + /CD8 − T cell clones (TCC), all expressingp58.2.In functional studies we demonstrated thatthe addition of the anti-p58.2 moAb blocked cytotoxicityof these TCC (both TCR α/β and γ/δ) in CD3-redirected killing assay with P815.Furthermore, cytotoxicityof the gamma/delta TCC against 221 EBV cellline was inhibited by Cw4 but not Cw3 HLA expressionon 221 cells. Altogether these findings suggestthat expression of KIR with inibitory activity by oligoclonalT cell expansions in B-CLL may contribute toimmune evasion of leukemic B cells from T cell control.haematologica vol. 89[suppl. n. 6]:september 2004

164PostersPO-168TLR7 AND TLR9 LIGANDS EXHIBIT IMMUNOSTIMULATORYACTIVITIES ON CHRONIC LYMPHOCYTIC LEUKEMIA B CELLSFilì L,* Brugnolo F,* Sampognaro S,* Liotta F,* CosmiL,* Manuelli C, # Santini V, § Ciolli S, § Bosi A, § MaggiE,* Romagnani S,* Annunziato F,* Parronchi P**Dept of Internal Medicine, Section of Immunoallergology,# Dept. of Dermatological Sciences and § Dept.of Hematology, University of Florence, ItalyNatural and synthetic Toll-like Receptor (TLR) ligandscan activate cells of the innate immunity andsome of them also show the ability to modulateimmunocompetent cells. In particular, short-lenghtCpG-containing motif oligodeoxynucleotides (CpG-ODNs) can stimulate proliferation and differentiationof murine and human B cells. More recently, imidazoquinolineshave been demonstrated to stimulatenormal human B cells through a TLR7 (and 8)-mediatedsignaling. Chronic lymphocytic leukemia (B-CLL)cells represent a mature malignant counterpart of Bcells characterized by high apoptosis rate in vitro,unresponsiveness to ordinary agents promoting differentiationand proliferation. Limited data are knownon TLR in B-CLL cells. In our study, the analysis ofTLR1-10 by real-time PCR showed that highly purifiedCD5+ B-CLL cells expressed TLR7 and 9 whereasTLR8 and TLR1-5 were negative. We then comparedthe effects of TLR7-ligand R-848 (Resiquimod)with the phosphorothioate CpG ODNs DSP30 and2006 which bind to TLR9.For control, LPS and syntheticdouble strand RNA poly I: poly C were used. R-848 was able to induce a significant proliferation ofCD5+ leukemic B cells in almost all the analyzed B-CLL (90% cases) in a dose-curve manner with a similarrate of proliferation to CpG-ODNs. CFDA-SEanalysis confirmed that CD19+CD5+ cells wereresponsible for thymidine-uptake. The stimulatoryeffect was directed to B cells as the depletion of PDCsdid not affect the proliferative response. More interestingly,R-848 induced a strong up-regulation ofcostimulatory molecule expression (CD40, CD80,CD86) together with increased expression of CD20and MHC class II molecules and R-848 and CpG-ODNpre-incubated B cells also exhibited increased stimulatoryability to allogeneic T cells in MLR even atvery low E:R ratios (1:500). Finally, R-848 and, in amore limited way, CpG-ODNs were able to stimulatethe differentiation of B-CLL cells into actively IgMproducingcells. Taken together, our data indicate thatResiquimod is a potent immunomodulator to inducematuration of neoplastic B cells to stimulate an efficientT cell response in some haematologic malignancies.PO-169HIGH LEVELS OF ACTIVATED CASPASES IDENTIFY PATIENTSWITH INCREASED RISK OF DISEASE PROGRESSION IN B-CELLCHRONIC LYMPHOCYTIC LEUKEMIADel Poeta G, Del Principe MI, Luciano F,Irno Consalvo M, Mazzone C, Suppo G, Marini R,Maurillo L, Venditti A, Buccisano F, Bruno A,Piccioni D, Franchi A, Meoni G, Amadori SCattedra di Ematologia, Università “Tor Vergata”,Ospedale S. Eugenio, Rome, ItalyB-cell chronic lymphocytic leucemia (B-CLL) is adisease characterized by the progressive accumulationof tumor cells which do not proliferate rapidly,but fail to undergo death. Even though almost allperipheral blood B-cells are arrested in G0 phase ofthe cell cycle, a proliferating pool of cells might beinvolved in disease progression. As a matter of fact,increased clonal expansion of leukemic B-CLL cells inprogressive patients might be due to proliferation inexcess of apoptosis. A central component of thisapoptotic machinery is a proteolytic system thatinvolves a family of proteases called caspases. Thesecaspases can be divided into two groups: largeprodomain containing upstream initiators (caspase-8, caspase-9), which may initiate the proteolytic cascade,and small prodomain containing downstreameffectors (caspase-2, caspase-3, caspase-6), which inturn can amplify the signal by cleaving initiator-caspasesand kill the cell by cleaving key intracellulartargets. In order to define the prognostic impact ofthese apoptotic enzymes on the clinical outcome ofB-CLL, we investigated 178 patients, median age 65years, 88 males and 90 females. Activated caspases2, 3, 6, 8 and 9 were determined on cellular cytosolicextracts through a spectrophotometric detectionof the chromophore p-nitroanilide (pNA) after cleavagefrom the labeled substrates (VDVAD for caspase-2, DEVD for caspase-3, VEID for caspase-6, IETD forcaspase-8 and LEHD for caspase-9). The pNA lightemission was quantified using a microplate reader at400-405 nm. Caspases activities were evaluated bythe absorbance ratio samples/background readings(O. D. ). A mean value of all caspases activities (2, 3,6, 8 and 9) was calculated for each B-CLL patient. Thethreshold of positivity was set at > 0.082 O. D. medianvalue. With regard to patients characteristics, 53had low Rai stage, 120 intermediate stage and 5 highstage. No significant correlations were foundbetween modified Rai stages or β2-microglobulin andcaspases activity levels. On the other hand, there wasa very significant association between high caspasesactivity levels and lymphocyte doubling time (LDT)

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004165caspases activity and high bcl-2 levels (p=0.05).Finally, there was only a trend of association betweenlow ZAP-70 or CD38 levels and low caspases activity(p=0.1, not significant). With regard the clinicaloutcome, impressive shorter progression-free survival(PFS) and overall survival (OS) were observed inpatients with higher caspases activity levels (18% vs93% at 9 years; p

166PostersFR and/or CDR clustering of mutations in virtually allcases. Selection of FR3 aminoacidic substitutions andspecific VH and VL CDR3 features, combined with abiased usage of VL genes, suggest that VH3-72 B-CLLexpress a highly homologous Ig structure recognizinga common epitope or, for cases with less conservedCDR3, various epitopes of the same antigen. Finally,because VH3-72 is virtually restricted to highly stableB-CLL, its detection may contribute to prognosticscores aimed at predicting for prolonged survival.PO-171MOLECULAR AND CLINICAL REMISSION CAN BE FREQUENTLYATTAINED AFTER REDUCED INTENSITY CONDITIONING ANDALLOGENEIC TRANSPLANTATION, IN PATIENTS WITH RELAPSEDCHRONIC LYMPHOCYTIC LEUKEMIA OR LOW-GRADELYMPHOMASCarrabba M,° Farina L,° Rizzo E,° Dodero A,°Zorzan E,° Locasciulli A, § Olivieri A, # Rambaldi A, $Scimè R, f Santoro A, f Tarella C,^ Bregni M,*Milani R,° Corradini P°°Hematology Division, Istituto Nazionale Tumori,University of Milano; § Hematology Division, OspedaleSan Camillo- Rome; # BMT Unit, Ospedale Le Torrette,University of Ancona; Hematology Division,Ospedale of Bergamo $ ; f BMT Unit, Ospedale Cervello,University of Palermo;^Hematology Division, OspedaleMolinette, University of Torino; *BMT Unit,Ospedale S. Raffaele-Milan, ItalyBackground: Graft-versus-leukemia effect (GVL)after allogeneic stem cell transplantation (allo-SCT)has been already described in chronic lymphocyticleukemia (CLL) and indolent lymphomas. Clinicalresponses can be achieved after cyclosporin withdrawal,donor lymphocyte infusions (DLI), and withthe onset of graft-versus-host-disease (GVHD). In thepresent study we have evaluated the frequency ofmolecular remissions after reduced intensity conditioning(RIC) followed by allo-SCT. Methods: 40patients with relapsed disease (22 CLL/SLL, 16 FCL, 1MALT, 1 lymphoplasmacytic lymphoma) were enrolledin a prospective, multicenter phase II study. Medianage was 55 years (range: 32-69). The median numberof previous chemotherapy regimens was 3 (range1-5) and 10 of 40 patients (25%) had already faileda previous autograft. Disease status at transplantwas: chemorefractory disease in 32% of patients,partial or complete remission (CR=9; PR=17) in 62%;and minimal response in the remaining 6%. The conditioningregimen consisted of thiotepa 10 mg/kg,fludarabine 60 mg/ms and cyclophosphamide 60mg/kg. GVHD prophylaxis consisted of short coursemethotrexate and cyclosporin 2 mg/Kg/die. Minimalresidual disease (MRD) was monitored by nested PCRfor IgH or Bcl-2 genes. In 4 PCR-positive patients (2CLL and 2 FCL), a TaqMan based quantitative monitoringwas also employed. For the two patientsaffected by CLL we designed a patient-specific IgHTaqMan system, whereas for the two FCLs we used apreviously described TaqMan primer and probe setfor Bcl-2 rearrangement. Results: All patientsengrafted; 22 of 40 were in CR at day +30 aftertransplant. A molecular marker was found in 22patients. Eighteen of 22 patients having a markerwere alive: 10 of them attained the molecular remissionOne patient died of transplant-related-mortality(GVHD and infection) while he was still in molecularremission. Seven patients never attained PCRnegativity and 3 of them relapsed within a mediantime of 360 days from allo-SCT; one of them attainedthe molecular remission after chemotherapy and DLI,without developing GVHD. Eight of 11 patients whobecame PCR-negative between day +90 and +180developed acute and/or chronic GVHD, supportingthe hypothesis of a GVL effect. Two of the 4 patientsmonitored by quantitative PCR achieved the PCRnegativity at day +30 and +90 after allo-SCT, whilethe other 2 patients were persistently MRD positive;in the latter patients the TaqMan PCR could detect anincrease of tumour genomes in the marrow prior tothe clinical relapse. Summary: RIC transplants canproduce clinical and molecular remission. QuantitativePCR monitoring, can be used to tailor post-transplantimmunotherapy.PO-172ROLE OF Vδ1 T LYMPHOCYTES IN B-CLL PATIENTS: RECOGNI-TION OF MIC-A AND ULBP3 EXPRESSED BY LEUKEMIC B CELLSAND UPREGULATED BY ATRAPoggi A,* Castellani S, # Gobbi M, # Michelis G, #Clavio M, # Miglino M, # Steinle A,° Ghia P,° Stella S,°Caligaris-Cappio FM^ Zocchi MR §^#*Laboratory of Immunology, National CancerResearch Institute, Genoa, Italy; # Clinical Hemathology,Department of Internal Medicine, University ofGenoa, Genoa, Italy; °Department of Immunology,Eberhard-Karls University, Tubingen, Germany;°Laboratory of Immunology and Oncology, Institutefor Cancer Research, Candiolo, Italy; § Laboratory ofTumor Immunology and ^Department of InternalMedicine, IRCCS San Raffaele, Milan, ItalyIn this study we analysed 38 patients with B-CLL(23 at low risk stage, 9 at intermediate risk stage,and 6 at high risk stage, according to the Rai modifiedclassification), chemotherapy naïve. Interestingly,circulating Vdelta1 T lymphocytes were increasedin 15/38 patients, all at low risk; once isolated fromperipheral blood Vdelta1 T cells proliferated in vitrohaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004167and produced TNFalfa or IFNgamma in response toautologous B cells. These gammadelta T cells werecytolytic against the murine mastocitoma P815, uponengagement of either TCR or NKG2D with the specificmonoclonal antibodies, suggesting that they have anintact cytolytic function. However, γδ T lymphocytesdid not kill resting autologous tumor B cells, whichlacked the MHC-related MIC-A antigen andexpressed low levels of the UL16-binding-proteins(ULBP) 1 and 3 and undetectable ULBP2 and 4.Thesemolecules are all reported ligands for γδ T cells thatrecognizes them via the NKG2D receptor. Indeed, theVdelta1 T cell subset could lyse the C1R B-cell linetransfected with MIC-A or autologous B-CLL whentranscription and expression of MIC-A and ULBP1 orupregulation of ULBP3 was achieved upon exposureto trans-retinoic acid (ATRA). Moreover, NKG2Dexpressed on Vdelta1 T cells was involved in therecognition of B-CLL on which MIC-A or ULBPs wereinduced by ATRA. Interestingly, in six patients displayinga low number of circulating Vδ1 T cells, andundetectable ULBPs, the disease progressed in thelast year, at variance with patients with high Vδ1 Tlymphocytes and detectable/inducible ULBP3.PO-173DISTINCT NUMBERS OF D13S319 AND RB1 ALLELES INPATIENTS WITH B-CELL CHRONIC LYMPHOCYTIC LEUKEMIAREVEALED BY FLUORESCENT IN SITU HYBRIDIZATIONGiardini I, Bernasconi P, Orlandi E, Cavigliano PM,Boni M, Calatroni S, Rocca B, Zappatore R, CaresanaM, Quarna J, Lazzarino MUniversità degli Studi di Pavia, Divisione di Ematologia,Policlinico San Matteo IRCCS, ItalyIn B-CLL bands 13q12-14 are frequently targetedby interstitial/terminal deletions and therefore aresupposed to contain an as yet uncharacterised tumorsuppressor gene. The aims of the present study wereto establish whether subclones with distinct numbersof D13S319 and RB1 alleles could be simultaneouslypresent in B-CLL patients and whether theyare correlated with any peculiar clinical parameterand disease outcome. FISH was carried out either onmitotic cells or on interphase nuclei obtained fromseventy-one patients. It was performed with twoprobes, i. e. LSI13 and D13S319, both commerciallyobtained from Vysis (Downers Grove, IL, USA) andsimultaneously applied according to manufacturer'sguidelines. A normal cellular pattern was defined bythe presence of two green and two red signals, whilea cell harbouring a deletion/nullisomy was definedby either three or two signals respectively. No patientpresented a nullisomy for both the loci examined.This result was per se sufficient to document effectivehybridisation and allowed us to set the cut-offvalues at 6% for interphase FISH. This last value wasdetermined by analysing two hundred nuclei obtainedfrom ten normal controls and by correcting the meanpercentage obtained for three times the standarddeviation. An abnormal FISH pattern was discoveredin 42-500 from 30 patients (42.2%). The deletion ofone D13S319 locus and of one Rb1 allele was seen innine patients, a cell line with the same pattern (oneD13S319 locus and one Rb1 allele deleted) along withanother one with the deletion of only one D13S319locus in two patients, the deletion of one D13S319locus in ten patients, the deletion of both D13S319locus in two patients, a complex pattern in fivepatients, the deletion of both D13S319 locus alongwith the deletion of one Rb1 allele in one patient andthe deletion of one Rb1 allele in one patient. Patientswith a complex pattern presented the most interestingFISH results. Three of them showed two cell linesone with the loss of one D13S319 locus and the otherwith the nullisomy of the same locus. This patternwas observed in more than two hundred cells. Theremaining two patients with a complex pattern harbouredtwo cell lines one with the deletion of oneD13S319 locus and the other with the nullisomy ofthe same locus and the deletion of one Rb1 allele.This last pattern was discovered in more than onehundred cells. Most of our patients had been investigatedon clinical diagnosis and were in an early diseasestage. In contrast, patients with the monosomyof both the loci were predominantly in advanced diseasestage. According to Binet three patients wereclassified as stage B and three as stage C; accordingto Rai two patients were classified as stage two, twoas stage three and one as stage four. Three patientsexperienced clinical progression. A moclononal proteinwas detected in three patients with the deletionof the D13S319 allele. In conclusion the observationthat B-CLL patients may simultaneously harbour multiplecell lines with different numbers of D13S319and Rb1 alleles suggests that 13q deletion is probablyproduced by chromosome evolution within theneoplastic clones. This suggestion is reinforced by thefact that a spontaneous conversion to a normal FISHpattern occurred in two of our patients who presentedthe deletion of one D13S319 allele on clinicaldiagnosis. In addition, patients with the monosomy ofband 13q14 more frequently have an advanced diseaseand more often experience disease evolution.haematologica vol. 89[suppl. n. 6]:september 2004

168PostersPO-174INDUCTION OF FAS UPREGULATION DOES NOT RENDERCHRONIC LYMPHOCYTIC LEUKEMIA B CELLS SUSCEPTIBLE TOFAS-MEDIATED APOPTOSISChiurazzi F,* Marra N,* Sellitto A,° De Fanis U,°Romano C,° Rotoli B,* Lucivero G°*Division of Hematology, Department of Clinical andExperimental Medicine, Federico II University ofNaples; ° Division of Internal Medicine, Allergy andClinical Immunology, Department of Gerontology,Geriatrics and Metabolic Diseases, II University ofNaples, ItalyChronic lymphocytic leukemia (CLL) is characterizedby a progressive accumulation of long-lived andwell-differentiated clonal B lymphocytes in theperipheral blood, lymphoid tissues and bone marrow.Although CLL pathogenesis is not entirely understood,the progressive increase in lymphocyte counts coupledwith very low proportion of proliferating cells suggeststhat this disease may be primarily determined bydefective apoptosis. Consistently, freshly analyzed CLLB cells express very low levels of membrane Fas (Apo-1, CD95), one of the best known receptors involved intriggering the apoptotic machinery. In the attempt ofexploring new approaches for immunotherapy of CLL,the aims of the present study were: i) to work outmeans to increase Fas expression on CLL B cells; andii) to assess whether Fas-expressing clonal B cellscould be induced to undergo apoptosis following Fasstimulation. Fas upregulation on CLL B cells wasinduced by coculturing clonal B cells with preactivatedautologous T lymphocytes or their supernatants.Intracellular cytokine staining of preactivated autologousT lymphocytes using a panel of monoclonalantibodies (moAbs) specific for Th1 and Th2 cytokines,namely interleukin (IL)-2, IL-4, IL-5, IL-10 and interferon(IFN)-γ, showed these cells to contain mainly IL-2 and IFN-γ. Blocking experiments using moAbs specificfor IL-2 or IFN-γ revealed that the Fas-enhancingactivity in T cell supernatants was mainly due toIFN-γ. However, following stimulation with an agonisticanti-Fas moAb or recombinant human solubleFasL for up to 72 h, Fas-expressing CLL B cells werefound to be resistant to Fas-mediated apoptosis, asassessed by flow cytometry evaluation of annexin V-binding and propidium iodide staining, confirming thenotion that altered apoptosis plays a relevant role inthe pathogenesis of this disease and showing thatthis phenomenon was not due to reduced Fas expression.Finally, immunoblot experiments showed thatCLL B cell resistance to apoptosis was not associatedwith lack of caspase-3, as clonal B cells expressedsimilar levels of this protein as Jurkat T cells, whichwere used as a positive control in all apoptosis experiments.Further research is needed to identify the molecularmechanisms underlying apoptosis resistance inCLL.PO-175MOLECULAR ANALYSIS OF IMMUNOGLOBULIN HEAVY CHAINREARRANGEMENTS AND VH SOMATIC MUTATIONS INLYMPHOPROLIFERATIVE DISORDERS USING LASER CAPTUREMICRODISSECTIONBonello L, Pagano M, Gaiotti G, Francia Di Celle P,Chiarle R,* Palestro G*CeRMS (Center for Experimental Research andMedical Studies), A. S. O. S. Giovanni Battista e *Dip.Scienze Biomediche e Oncologia Umana, Universitàdegli Studi, Turin, ItalyLaser Capture Microdissection (LCM) is a powerfultechnique capable of obtaining target single cellswithout contamination from surrounding populationsfrom histologic and immunostained sections. Combiningthis new approach and the polymerase chainreaction (PCR), clonally rearranged Immunoglobulinheavy (IgH) chain genes are reliably amplifiable inisolated lymphoid cells. Moreover, IgH sequencinganalysis provides a rapid and helpful method toestablish correlation between genetic, morphologyand immunophenotype, even at the single cell level.The degree of somatic hypermutations also improvesthe study of the stage of differentiation of cellsinvolved in the lymphoproliferative disorders. Tryingto evaluate the capability of this novel technique oncomplex and heterogeneous lymphoma tissues, westudied a case of a 64-year-old man, affected byChronic Lymphocytic Leukemia (CLL) with diffuselymphoadenopathy, in which the presence of Reed-Sternberg (R-S) cells raised the possibility of a coexistentHodgkin Disease. In fact, the histological evaluationshowed a Small Lymphocytic Lymphoma (SLL)with large proliferation centers carrying a greatamount of immunoblasts and isolated R-S cells.Immunohistochemical staining demonstrated thatboth small lymphocytic and proliferation centersexpressed CD5, CD20, CD43; the latter were also partiallyCD30-positive. R-S-like cells expressed CD15and CD30 but were CD5 and CD20-negative. Formalinfixed hematoxilin-eosin stained sections andfrozen sections immunostained for CD30 were micromanipulatedusing LCM (Leica DM LMD): singleCD30-positive cells and multiple cells samples fromsmall lymphocytic and proliferation centers were collected.A semi-nested strategy was used for the PCRamplification of the IgH chain gene using consensusprimers complementary to the conserved framework-2 segment of the variable (V) region and to the joining(J) region. PCR products were gel-purified anddirectly sequenced in both directions on an auto-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004169mated capillary system (AB310). The sequences werecompared with published germ line data to identifyV-D-J rearrangements and VH somatic mutations.The results of the IgH sequence analysis showed thepresence of a common predominant clone (VH3-66/DH3-3/JH6) in SLL areas, in proliferation centersand in R-S-like cells. This rearrangement was thesame found in the whole section of the lymph node,supporting a clonal relationship between CLL/SLL andR-S-like cells. In addiction none of the rearrangementsexamined carried VH somatic mutation supportingthe naïve nature of the lymphomatous components.Therefore, LCM followed by PCR andsequencing techniques, provides an important toolfor the investigation of Ig status and the clonal relationshipin purified cells from lymphoma tissues.PO-176CONVENTIONAL CYTOGENETIC ANALYSIS AND INTERPHASE INSITU HYBRIDIZATION IN 28 CASES OF DLBCLZunino A,* Viaggi S,*° Gentile R,^ Massone S,* VitiR,* Zupo S,* Abbondandolo A,*° Ottaggio L**National Institute for Cancer Research, Genova;°Dibisa, University of Genova; ^S. Martino Hospital,Genoa, ItalyDiffuse large-cell lymphoma (DLBCL) is a histologicallywell defined subset of non-Hodgkin lymphomaswhich comprises several entities characterized by differentgenetic, immunophenotypic and clinical features.For example, only 45% of patients achieve acomplete remission, while the remaining patientsdead of the disease, despite treatment. Moreover,DLBCL may arise de novo or may be an evolution ofprevious low grade lymphomas. For all these reasonsDLBCLs result an heterogeneous disease and so farvery few genetic and biological markers are availableto predict the behaviour of these lymphomas.Approximately 50% of DLBCL exhibit chromosomaltranslocations involving Ig heavy chain genes, locatedon 14q32 region, and different partners. The mostfrequently involved partner gene is BCL2 gene. Inthese lymphomas also BCL6, located on 3q27 region,is frequently involved in translocations both with Igheavy chain genes and other genes. The primaryobjective of this study is to assess the value of cytogeneticprofile as marker of response to therapy inDLBCL affected patients. The samples (lymph node orsplenic biopsies) from 28 DLBCL patients have beenanalysed at the diagnosis by conventional cytogeneticsand interphase FISH. Probes for FISH analysiswere chosen to detect the most common aberrationsfound in DLBCL: t(3q27); t(14;18)(q32;q21) and aneuploidiesof chromosomes 7; 12; 18; X. When possible,the karyotypes obtained by conventional bandingtechniques were examined. FISH analysis detectedthe 3q27 region translocation in the 25% of theDLBCL examined. The translocation t(14;18) was presentin only 11% of cases. There was a good correlationbetween karyotype, when available, and interphaseFISH results. The results have been comparedto clinical, immunohystochemical and immunophenotypicaldata.PO-177INTERNATIONAL SURVEY OF PRIMARY EFFUSION LYMPHOMA(PEL)Conconi A, Spina M, Ascoli V, Guillermo-Lopez A,Cortelazzo S, Re A, Ichinohasama R, Sata T, LuppiM, Vallisa D, Bergonzi C, Provencio M, Rossi D,Levine A, Raphael M, Gloghini A, Gaidano G,Carbone A on behalf of the International ExtranodalLymphoma Study Group (IELSG)PEL is a rare B-cell neoplasm characterized by apreferential involvement of fluid-filled body spaces,consistent infection of the tumor clone by humanherpesvirus type-8 (HHV-8) and a close relationshipwith underlying immunodeficiency status of the host.The International Extranodal Lymphoma Study Group(IELSG) coordinated a retrospective survey involving14 international institutions to determine the clinico-pathologicalfeatures and patterns of outcome ofPEL. Fourty-two patients (37 males and 5 females)were registered. Median age at diagnosis was 58years (range 27-102). In 23 (55%) patients an associatedhuman immunodeficiency virus (HIV) infectionwas reported, in one case the diagnosis of PELwas made after a solid organ transplantation, in twopatients other immunodeficiency conditions werepresent. The HHV-8 infection of the tumor clone wasdemonstrated in 34 out of the 38 tested cases,Epstein-Barr virus infection in 13 of 29 cases. CD4count was lower than 200/µL in 18 of the 25 casesin whom the data was available. An ECOG perfomancestatus score >= 2 was observed in 28 patientsand the presence of B-symptoms in 20 patients.Serum LDH was elevated in 20 of the 38 testedpatients. In 4 patients nodal involvement at diagnosiswas reported, in 4 cases at least one extranodalsite of localization other than serous cavities waspresent. A low/low-intermediate risk score accordingto International Prognostic Index was reported in10 cases, an intermediate-high/high risk score in 28cases. Twenty patients received systemic chemotherapy,in 16 cases an anthracycline-based regimen.Intrapleural cidofovir was administered in 3 patients.Twelve HIV+ patients received highly active retroviraltherapy (HAART), four of them as single therapy.xAmong the 38 patients for whom adequate follow-haematologica vol. 89[suppl. n. 6]:september 2004

170Postersup data were available, median overall survival was5 months, median cause-specific survival was 12months and median progression-free survival was 8months. Interestingly, cases of tumor completeregression after implementation of the sole HAART,after intrapleural administration of cidofovir or withoutany treatment were reported. Our data confirmthe poor prognosis of PEL but suggest a possible heterogeneityof this entity with respect to its biologicaland clinical features. A review of the pathological,phenotypical and virological features is forthcomingto validate these preliminary results.PO-178LONG TERM MONITORING OF CANCER-FREE SUBJECTS CARRY-ING NON-LYMPHOMA ASSOCIATED BCL2/IGH REARRANGE-MENTS (NLABR): PROLONGED PERSISTENCE OF CLONALPOPULATIONS POTENTIALLY RELATED TO FLLadetto M, Mantoan B, Pollio B, De Marco F, DrandiD, Ricca I, Vallet S, Compagno M, Astolfi M, Dell’aquila M, Rocci A, Pagliano G, Santo L, Monitillo L,Tamponi G, Boccadoro M, Tarella CDivisione di Ematologia dell'Universita' di Torino,Azienda Ospedaliera S. Giovanni Battista, Torino,ItalyIntroduction: NLABR are frequently observed incancer free-subjects. We have recently observed thatcells NLABR-positive clones can persist up to 60 days(Ladetto et al. , J Clin Oncol 2003). However the longtermkinetics and potential pre-neoplastic role ofcells carrying these rearrangements is unknown. Aimof this study was to perform a long term monitoringof NLABR-positive subjects in order to define the naturalhistory of NLABR-positive clones. Methods: 14NLABR-positive subjects undergoing periodical bloodexaminations for warfarin therapy have been monitoredfor a median time of 12 months (rang 3-24months). NLABR-positive clones have been analyzedusing both nested and real time-PCR according tostandard procedures (Ladetto et al. Exp Hematol2001). Sequence homology of NLABRs has alwaysbeen confirmed by direct sequencing of both forwardand reverse DNA strands of nested PCR products.Results: in seven subjects (50%) prompt disappearanceof PCR positivity was noticed without reappearanceof the rearrangement. This seven subjectshave been monitored for median period of 12 months(range 3-18 months). An unrelated rearrangementwas detected during subsequent follow-up in one ofthese subjects. In the other seven subjects (50%) thesame rearrangement observed at study initiation hasbeen detected one or more times on follow-up evaluations.In four subjects with persistent NLABRs therearrangement detected at diagnosis was consistentlydetected in all follow-up samples, while in three theNLABR detected at diagnosis could be amplified onlyin a fraction of follow-up samples while the remainingturned out to be PCR-negative. Overall, persistentNLABRs could be followed on these subjects for amedian time of 15 months (range 3-28). The medianburden of persistent NLABR-positive clones assessedby real time PCR was 33 rearrangements/106 diploidgenomes (dg) (range

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004171ture distinctive of DLBCL. To investigate wether thesame mechanisam is associated with PMLBCL, weperformed mutational analysis of PIM-1, PAX-5,RhoH/TTF and c-MYC in a panel of 9 PMLBCL. Foreach gene, a region spanning up to 1.5 Kb from thetranscription start site and previously shown to contain>90% of mutations in B-cell lymphoma wasanalysed by PCR amplification and DNA directsequencing. Mutations targeting at least one of the4 genes were found in 5/9 (55.5%) PMLBCL, whilemutations in more than one gene were found only in1/9 (11.1%) cases. Among the four genes tested, onlyPAX-5 was altered in a significant fraction of cases,since it was mutated in 4/9 (44.4%) PMLBCL. In contrast,PIM-1 was mutated in 1/9 (11.1%), RhoH/TTFwas mutated in 1/9 (11.1%) and c-MYC was mutatedin 1/9 (11.1%) PMLBCL. A total of 29 mutationalevents were detected in 9 PMLBCL. The overwelmingmajority of mutations affected PAX-5 (n=24). Themutation frequency for PAX-5, calculated only onmutated cases, was 0.36×10-2/bp and was 2.25 to 9fold higher than that occurring in PIM-1 (0.16×10-2/bp), RhoH/TTF (0.06 x 10-2/bp) and c-MYC(0.04×10-2/bp). The majority of the mutations wererepresented by single base-pair substitution (n=26).Two PMLBCL carried 3 deletions of a short DNAstretch (2-21 bp) affecting PAX-5.Of the 26 singlebase-pair substitutions, eleven were transitions and15 were transversions, with a transition/transversionratio of 0.78 (expected 0.5). These results indicatethat, among germinal center related lymphomas,PMLBCL seems to display a distinct profile of aberrantsomatic hypermutation. In fact, whereas DLBCLis affected by aberrant somatic hypermutation of thePIM-1, PAX-5, RhoH/TTF and c-MYC genes in nearlyhalf of the cases, aberrant somatic hypermutation inPMLBCL targets preferentially the PAX-5 gene, sparingPIM-1, RhoH/TTF and c-MYC. Interestingly, 50-70% PMLBCL carry chromosomal gains of 9p, thatrepresent the most frequent cytogenetic lesion inthese lymphomas. Since PAX-5 is located at 9p13,amplifications and mutations of the PAX-5 locus maycooperate in lymphomagenesis in the context ofPMLBCL. Because PAX-5 mutations occur in the regulatoryregion of the gene and may affect trascription,these alterations may cause deregulated expressionof PAX-5, that is a key gene in the control of B-cell differentiation.PO-180ABERRANT METHYLATION IN THE PROMOTER REGION OF THEREDUCED FOLATE CARRIER GENE IS A POTENTIAL MECHANISMOF RESISTANCE TO METHOTREXATE IN PRIMARY CENTRAL NER-VOUS SYSTEM LYMPHOMASCapello D, 1 Dell'Oro S, 2 Ponzoni M, 3 Ruzzolino P, 4Rossi D, 1 Pasini F, 5 Ambrosetti A, 6 Orvieto E, 7Ferrarese F, 8 Arrigoni G, 3 Foppoli M, 9 Reni M, 2Gaidano G, 1 Ferreri AJM 21Hematology Unit, Department of Medical Sciences,Amedeo Avogadro University of Eastern Piedmont,Novara; 2 Department of Radiochemotherapy, SanRaffaele H Scientific Institute, Milan; 3 Departmentof Pathology, San Raffaele H Scientific Institute,Milan; 4 Servizio Autonomo di Anatomia Patologica,Ospedale Civile Maggiore Az. Ospedaliera, Verona;5Divisione Clinicizzata di Oncologia Medica, OspedaleCivile Maggiore, Verona; 6 Divisione di Ematologia,Policlinico G. B. Rossi, Verona; 7 Istituto di Anatomiae Istologia Patologica, Ospedale Regionale Ca'Foncello, Treviso; 8 Divisione di Radioterapia, OspedaleRegionale Ca' Foncello, Treviso,; 9 Division of InternalMedicine, San Raffaele H Scientific Institute,Milan, ItalyHigh-dose methotrexate (HD-MTX; ⁄1 g/m 2 ) is themost effective drug against primary central nervoussystem lymphomas (PCNSL). The major route for cellularuptake of MTX involves the reduced folate carrier(RFC), a bi-directional anion transporter with highaffinity for reduced folates and antifolates. Defectivetransport via the RFC may be a common mechanismof resistance to antifolates. Studies in patients withacute lymphoblastic leukemia and osteosarcomahave suggested that defective transport via the RFCmay be a common mechanism of resistance to antifolates.Lack of RFC expression in MTX-resistant humantumor cell lines has been ascribed to the aberrantmethylation of RFC gene promoter, since MTX-sensitivehuman tumor cell lines are devoid of this epigeneticabnormality. The aim of this study was to investigatethe prevalence of aberrant methylation of RFCpromoter in PCNSL in immunocompetent patientsand to correlate the methylation status of RFC toMTX resistance and therapeutic outcome. GenomicDNA from biopsy specimens of 40 PCNSL in immunocompetentpatients was used as a template formethylation-specific PCR (MSP) and bisulfite genomicsequencing (BGS) of RFC promoter. Fifty HIV-negativecases of systemic diffuse large B-cell lymphomas(DLBCL) were used as controls. MSP showedevidence of aberrant methylation of the RFC gene in12 of 40 (30%) PCNSL samples and in 4 of 50 (8%)DLCL used as controls (p= 0.01). To further define themethylation status of RFC promoter, representativehaematologica vol. 89[suppl. n. 6]:september 2004

172Posterssamples showing RFC methylation by the MSP assaywere further analyzed by BGS. All cases tested displayedmethylation in virtually all cytosines of theCpG dinucleotides localized in the CpG island. Analysisof RFC mRNA expression was performed by RT-PCR in representative methylated and unmethylatedcases. Methylated samples demonstrated absent ormarkedly low levels of RFC transcript when comparedto unmethylated samples or normal controls. Becauseinfiltrating normal cells are generally present intumor samples, this low level of expression in a fractionof methylated tumors may reflect transcriptionfrom unmethylated normal cells. Impact on outcomeof RFC promoter methylation was assessed in 37PCNSL patients who were treated with HD-MTXbasedchemotherapy ± radiotherapy. Among the 37PCNSL patients treated with HD-MTX-based chemotherapy,RFC promoter methylation was detected in9 cases (24%, M-PCNSL), while 28 (76%, U-PCNSL)scored negative. Three patients with M-PCNSL (33%)and 15 with U-PCNSL (54%) achieved a completeremission after primary chemotherapy. Logisticregression confirmed a near significant associationbetween complete remission rate and RFC promotermethylation (p= 0.07). Moreover, RFC promotermethylation was related to a worse failure-free survivaland overall survival. Although difference in survivalof patients with M-PCNSL or U-PCNSL did notreach significant levels, none of M-PCNSL cases wererelapse-free at 3 years, and all 3-year survivors hadU-PCNSL. Implications of these data are multifold.First, this is the first study analyzing the methylationstatus RFC gene promoter in human tumor samplesand demonstrating the presence of this epigeneticalteration in PCNSL and DLBCL from untreatedpatients. Second, the high frequency of RFC promotermethylation (30%) in PCNSL and the near significantassociation between this epigenetic alterationand complete remission rate, put this epigeneticmechanism among those potentially involved inintrinsic MTX resistance in PCNSL patients. Consequently,our findings suggest that the analysis of RFCmethylation status could allow us to distinguishPCNSL patients treated with HD-MTX-basedchemotherapy in subgroups with different outcomeon the bases of the methylation status of RFC gene.Finally, analysis of RFC promoter methylation mighthave potential role in therapeutic choice and investigationof novel strategies. For instance, MTX transportimpairment may lead to study newer antifolateslike trimetrexate, which does not depend on RFC forcell entry. Alternatively, demethylating agents, like5-aza-2'-deoxycytidine, could be used to restore RFCactivity, reverting MTX resistance.PO-181THE HLA-DR-SPECIFIC MONOCLONAL ANTIBODY 1D09C3EXERTS A POTENT ANTITUMOR ACTIVITY ON MALIGNANT LYM-PHOID CELLS BOTH IN VITRO AND IN VIVOCarlo-Stella C, Di Nicola M, Lavazza C, Cleris L,Zorzan E, Longoni P, Milanesi M, Magni M, FormelliF, Gianni AMChair of Medical Oncology, University of Milano,Milano, Italy; “Cristina Gandini” Medical OncologyUnit, and Department of Experimental Oncology,Milano Cancer Institute, Milan, ItalySignificant proportions of patients with lymphoproliferativedisorders, including non-Hodgkin lymphoma(NHL), relapsed Hodgkin’s lymphoma (HL), andchronic lymphocytic leukemia (CLL) are not curedwith currently available therapeutic strategies. Additionally,due to age restrictions, substantial proportionsof these patients are not eligible for stem celltransplantation. Therefore, new treatments targetedto the malignant clone are needed. The human leukocyteantigen (HLA)-DR is one of three highly polymorphicgenes of the class II major histocompatibilitycomplex, which, under normal conditions, areselectively expressed on cells of the immune system.A fully human antibody of IgG4 isotype, called1D09C3, targeting HLA-DR has recently been generated.It, therefore, was the aim of the present studyto investigate the in vitro and in vivo activity of1D09C3 on a large panel of lymphoma cell lines,including HL (L1236, L428, L540, HDMY-Z, HDLM-2,KM-H2), CLL (JVM-2, JVM-3, JVM-13, MEC-1, MEC-3, EHEB), and NHL cell lines (GRANTA-519, KARPAS-299, SUP-M2). To evaluate the in vitro activity of1D09C3, lymphoma cells (5 - 10×10 4 /mL) wereexposed to 1D09C3 (2.5 µg/mL, 48 hours). At the endof the incubation, viable cell counting was performedby FACS using Flowcount beads, cell survival wasevaluated by the MTT assay, and apoptosis was evaluatedby annexin-V expression. As compared to controls,exposure to 1D09C3 significantly (0.01) reducedthe mean (±SEM) viable cell counts to 30±8%,33±8%, and 14±4% for HL, CLL, and NHL cell lines,respectively. The same figures for cell survival as evaluatedby the MTT assay were 28±7%, 26±9%, and34±11%, respectively. Analysis of annexin-V expressionrevealed significant increases of the percentagesof apoptotic cells in 1D09C3-treated cultures as comparedto controls (HL: 64±8 vs 20±5, P&#8804;. 003;CLL: 33±2 vs 13±2, 0.001; NHL: 53±11 vs 16±4, 0.01).Interestingly, 1D09C3 (2.5 - 10 µg/mL) had no toxiceffect on CD34 + cells, suggesting that the antitumoractivity of this antibody is restricted to HLA-DR + lymphomacells. The in vivo activity of 1D09C3 was evaluatedin a xenotransplant model of human lymphomain nonobese diabetic/severe combined immunodefi-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004173cient (NOD/SCID) mice. Mice were inoculated intraperitoneallywith JVM-2 cells (2.5-10×10 5 per mice)and were treated with 1D09C3 (3×1 mg/mouse, subcutaneously)starting either on day 5 (early stagelymphoma) or on day 14 (disseminated stage lymphoma).Endpoint was mice survival. 1D09C3-treatedmice were compared to placebo-treated NOD/SCIDmice. All placebo-treated mice transplanted with2.5×10 5 (n = 15) and 10×10 5 (n = 15) cells/mousedied after a median survival of 35 and 29 days,respectively. In contrast, all mice transplanted with2.5×10 5 JVM-2 cells/mouse and treated with 1D09C3at an early stage of disease were alive at +120 dayswith no evidence of disease (p=0.0001). Mice transplantedwith 10×10 5 JVM-2 cells/mouse and treatedwith 1D09C3 showed a median survival of 99 daysand 42% of them were alive at +120 days with noevidence of disease (p=0.005). Mice treated for a disseminatedstage lymphoma showed a significant survivaladvantage as compared to controls (52 vs 29days, p=0.0001). No mice experienced any apparenttreatment-related toxicity. In conclusion, 1D09C3 hasno toxic effect on CD34 + cells, whereas it has a strongantitumor activity both in vitro and in vivo on HLA-DR-positive lymphoma cell lines. Such monoclonalantibody offers the potential for a novel therapeuticapproach to lymphoid malignancies.PosterLYMPHOMAS AND LYMPHOPROLIFERATIVEDISORDERS IPO-182METHYLATION-REGULATED EXPRESSION OF CANCER TESTISANTIGENS IN PRIMARY EFFUSION LYMPHOMA: IMMUNOTHERA-PEUTIC IMPLICATIONSCalabrò L,* Fonsatti E,* Altomonte M,* Pezzani l,*Colizzi F,* Nanni P, # Gattei V, # Sigalotti L,* Maio M*°*Cancer Bioimmunotherapy Unit, Department ofMedical Oncology, and the # Clinical and ExperimentalHematology Research Unit, Centro di RiferimentoOncologico, IRCCS, Aviano; *°Division of MedicalOncology/Immunotherapy, Department of Oncology,University Hospital of Siena; Unità BioimmunoterapieOncologiche, Dipartimento di Oncologia Medica,e° Unità di Ricerca Ematologica Clinica e Sperimentale,Rome, ItalyPrimary effusion lymphomas (PEL) are rare forms ofB-cell malignancy that show a peculiar resistance toconventional pharmacologic drugs and a strikinglyadverse prognosis. In this study, cancer testis antigens(CTA) were investigated as potential immunotherapeutictargets in patients with PEL. Baseline expressionof a panel of 11 CTA was highly heterogeneous among5 PEL cell lines. In particular, the investigated CTA werenot expressed in BC-2 and BC-3 cells, while BC-1,HBL-6 and BCBL-1 cells tested positive for 6, 8 and 9CTA, respectively. The DNA hypomethylating agent 5-aza-2'-deoxycitydine (5-AZA-CdR) invariably inducedor up-regulated the expression of all investigated CTAin all cell lines analyzed. The de novo expression ofCTA was still detectable at mRNA and protein level atleast 2 months after the end of 5-AZA-CdR treatment.These findings, and the concomitant up-regulation ofHLA-class I antigens and ICAM-1 by 5-AZA-CdR, supportits clinical use to set-up innovative chemoimmunotherapeuticapproaches in PEL.PO-183EX VIVO ELISPOT MAY BE A NEW TOOL FOR THE EARLYDIAGNOSIS OF MYCOBACTERIAL INFECTION IN HEMATOLOGICPATIENTSPotenza L, Luppi M, Riva G, Morselli M, Barozzi P,Richeldi L,° Losi M,° Luppi F,° Cerri S,° Fabbri LM,°Lalvani A,° Torelli GSection of Hematology, °Respiratory Disease Clinic,Department of Oncology and Hematology, Universityof Modena and Reggio Emilia, Modena, Italyhaematologica vol. 89[suppl. n. 6]:september 2004

174PostersIn the last few years there has been an increasingnumber of reports on Mycobacterial infections (MBI)in hematologic patients. Hairy cell leukemia (HCL)and stem cell transplant (SCT) patients are the muchmore affected categories, with incidence rangingfrom 1% to 9%, but the problem appears to beunderestimated. Despite the availability of new molecularbiology methods, the diagnosis of MBI is oftendelayed with obvious clinical consequences. Tools forMBI diagnosis, such as isolation of mycobacteriathrough acid-fast staining, cultural examination,tuberculin skin test (TST) and ligase chain reaction,are limited by low sensitivity and specificity, expeciallyin immunocompromised host (IH), resultingoften falsely negative, and are time consuming. Consistentwith this, a recent report has shown that inhematologic patients the mean time interval betweenfirst symptoms and diagnosis of MBI was 29 days andwas still longer for patients with atypical MBI orrecipients of corticosteroids therapy. Recently, an exvivo enzyme-linked immunospot (ELISPOT) assay forinterferon-γ (IFN-γ) produced by T cells specific fortwo gene products of Mycobacterium tuberculosis(MT): the early secretory antigen target-6 (ESAT-6)and culture filtrate protein 10 (CFP-10), has beendemonstrated as a rapid, highly sensitive and specifictechnique for the detection of MT infection bothin immunocompetent and Human ImmunodeficiencyVirus infected patients with active, culture-confirmedand or with latent TBC. Here we report thecase of an HCL patient presented with persistentfever, bilateral pleural effusions and multiplehypointense splenic lesions. No common infectionswere documented. Tuberculin skin test resulted negative.Wide-spectrum antibiotics were uneffective.An ex-vivo ELISPOT assay detected, both on peripheralblood and pleural fluid samples, high level ofinterferon-g, produced by T-cells reactive versusESAT-6.On the basis of the ELISPOT assay, althoughin the absence of other confirmatory results, thepatient underwent a four drugs anti-tubercular (TBC)treatment with resolution of the clinical syndrome.Only three weeks later the beginning of anti-TBCtherapy, the blood culture taken at admission becamepositive, confirming the ELISPOT diagnosis of disseminatedMBI. We provide the first clinical applicationof ELISPOT as new tool for the early and specificdiagnosis of MBI in hematologic patients. Ex vivoELISPOT may be potentially useful in term of clinicalmanagement and cost-effectiveness. Further studieson large number of patients are warranted to validatethe clinical efficacy of ELISPOT in hematologicpatients.PO-184GLUTATHIONE S-TRANSFERASE (GST) P1 GENOTYPE ANDPROGNOSIS IN HODGKIN'S LYMPHOMAHohaus S, di Ruscio A, Di Febo A, Massini G,D'Alò F, Guidi F, Mansueto G, Voso MT, Leone GIstituto di Ematologia, Università Cattolica S. Cuore,Rome, ItalyGlutathione-S-Transferase (GST) P1 is a member ofthe GST enzyme superfamily which is important forthe detoxification of several cytotoxic drugs and theirby-products. A single nucleotide polymorphismresults in the substitution of Isoleucine (Ile) to valine(Val) at codon 105 causing a metabolically less activevariant of the enzyme. Recently, the GSTP1 105Valgenotype has been associated with a favorable prognosisfollowing chemotherapy with drugs known tobe GSTP1 substrates in a variety of malignancies, suchas pediatric acute lymphoblastic leukemia, myeloma,breast and colon cancer. We assessed the impact ofthe GSTP1 codon 105 genotype, as well as deletionsof GSTT1 and GSTM1, and polymorphisms of CYP1A1on treatment outcome in 97 patients with Hodgkin'slymphoma. Eleven patients (11%) were homozygousfor the 105Val/105Val genotype, 36 (37%) were heterozygous(105Ile/105Val) and 50 (52%) were homozygousfor 105Ile/105Ile GSTP1 genotype. Ourobserved allele frequency for the GSTP1 105Val allelewas 0.30 (58/194) and was similar to previous reportson allele frequencies for healthy Caucasians. TheGSTP1 Ile105Val polymorphism was associated in adose-dependent fashion with an improved failurefreesurvival in patients with Hodgkin's lymphoma(p=0.02). The probability of 5-year survival forpatients homozygous for the 105Val/105Val GSTP1genotype was 100%, for heterozygous patients 74%(95% CI, 56-85) and for patients homozygous for the105Ile/105Ile genotype 43% (95% CI, 23-61). Whenthe analysis was restricted to 53 patients treated withABVD chemotherapy, the essentially same differencesin failure-free survival were observed (p=0.02) TheCox multivariate analysis showed that GSTP1 codon105 genotype was an independent prognostic factor.There was no association with clinical and pathologiccharacteristics including age, sex, histotype, stageof disease, presence of B-symptoms, bulky diseaseand abnormal laboratory parameters. In conclusion,our results indicate a strong prognostic impact of theGSTP1 genotype on the outcome of patients withHodgkin's lymphoma treated with chemotherapy.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004175PO-185ANTI-HEPATITIS C VIRUS TREATMENT IN INDOLENT LOW GRADEB-CELL NON HODGKIN LYMPHOMA AFFECTED BY HCV INFEC-TION. AN ITALIAN MULTICENTER EXPERIENCEVallisa D,* Bernuzzi P,* Arcaini L,° Sacchi S, § CalleaV,^ Marasca R, § Lazzaro A,* Trabacchi E,* Anselmi E,*Arcari A,* Moroni C,* Bertè R,* Lazzarino M,°Cavanna L**Department of Oncology and Hematology, G. daSaliceto Hospital, Piacenza; °Division of Hematology,IRCCS Policlinico San. Matteo, University of Pavia;§Department of Oncology and Hematology, Universityof Modena; ^Haematology Division, AziendaOspedaliera of Reggio Calabria, ItalyHepatitis C Virus (HCV) is largely, although nothomogenously, diffuse in several countries of theworld. It has been shown to play a role both in hepatocellularcarcinoma and in B-cell non-Hodgkin lymphoma(B-NHL). Up to now the exact biologicalmechanisms that could explain the lymphomagenicrole of the virus are unknown, although severalhypothesises are under investigation. In this studythe role of antiviral (anti HCV) treatment in B-NHLassociated with HCV infection is evaluated. This multicenterexperience was able to study 13 patientsaffected by low grade B-cell NHL characterized byan indolent course (i. e. doubling time more than 1year, no bulky disease): two nodal marginal lymphomas,1 follicular, 4 plasmocytoid, 4 splenic marginal,2 extranodal marginal lymphomas. All of themunderwent only antiviral treatment with peghilatedinterferon and ribavirin. Eight patients experiencedcomplete or good partial haematological responsethat has lasted up to now with a mean follow up of14,1±9,7 months (range 2-24 months). Only onerelapse occurred after the end of treatment. Interestinglycomplete and good partial responses weremore likely to be seen in viral genotype 2 (p=0.035)and were strictly related to the decrease of viral loadunder treatment (p=

176PostersPO-187RELAPSED/REFRACTORY AGGRESSIVE NON-HODGKIN'S LYM-PHOMA PATIENTS: IPAD (IDARUBICIN, CISPLATIN, HD-ARACYTINAND DEXAMETHASONE) REGIMEN AS SALVAGE AND MOBILIZINGTHERAPYNosari A, 1 Baraté C, 1 Gargantini L, 1 Ciapanna D, 1Veronese S, 2 Ricci F, 1 Marbello L, 1 Montillo M, 1Muti G, 1 Ribera S, 1 Cantoni S, 1 Morra E 11Division of Hematology, Hematology-Oncology Dpt;2Pathology Dpt, Niguarda Ca' Granda Hospital,Milan, ItalyBackground. The IPAD chemotherapy regimen - afour-drug (idarubicin, cisplatin, HD-aracytin, dexamethasone)combination scheme - was developed at ourCentre as salvage therapy for patients (pts) withrelapsed/refractory aggressive non-Hodgkin's lymphomas(NHL) needing disease debulking and, in bonemarrow negative pts, PBSC mobilization. Aims. To evaluatesafety profile and efficacy in terms of debulkingand mobilizing potential of the IPAD regimen. Methods:between March 1997 and January 2004, 39 pts (M 20,19; median age 54 yrs, range 18-74), with relapsed/refractoryaggressive NHL (29 DLCL-B including 4primary mediastinal thymic; 5 T- large cell; 5 mantlecell NHLs) received the IPAD regimen as salvage therapy;in bone marrow negative pts, feasibility of PBSCharvest following IPAD was also assessed. A total of 80courses were performed (median 2/pt). Response wasevaluated after 2 courses of therapy using standardparameters. Results. No toxic deaths were observed.Four pts are not evaluable: 3 of 4 are too early to beevaluated, 1 died because of disease progression whilereceiving CT. Among the remaining 35 pts, overallresponse was 51.5% (18 pts, 7 CR, 11 PR); in 11 pts diseaseprogression (P) was observed, while 6 pts had stabledisease (SD) and were considered non-responders.Hematological grade IV toxicity was observed in 21 of39 pts (54%); 4 pts (10%) developed either FUO or bacterialinfections during neutropenia. PBSC harvest wasperformed in 12 bone marrow negative pts and it wassuccessfull in all; among these pts median PBSC harvestwas 6.5 CD34 + ×10 6 /kg (range 2.5 - 90×10 6 /kg).Eight pts underwent autologous bone marrow transplantafter IPAD (2 CR, 4 PR, 1 P, 1 SD); 6 of 8 are currentlyin continuous complete remission (CCR) with amedian follow-up of 13 months (range 1-27). Of the 5CR pts who did not undergo transplant, 1 progressed 2mos from CT, 2 were in CR when they were lost to follow-upafter 11 and 15 mos respectively and 2 are stillin CCR after 4 and 76 mos of follow-up respectively.Conclusions. These preliminary data show that the IPADregimen is fairy well tolerated in pts with aggressive,relapsed-refractory NHL. In our series, response wasobserved in approximately half of these pre-treatedpts. Moreover, our data show that IPAD combination CTis a predictable and highly effective mobilization regimenin this subgroup of pts.PO-188POLYMORPHISMS OF THE INTERLEUKIN 10 GENE PROMOTER ANDSUSCEPTIBILITY TO INDOLENT NON-HODGKIN LYMPHOMASMontefusco V,* Farina L,* Magni M, # Rizzo E,* ZorzanE,* Milani R,* Dodero A,* Mariotti J,* Carrabba M,*Zallio F,* Gianni AM, # Corradini P**Ematologia e Trapianto di Midollo Osseo Allogenico,Istituto Nazionale Tumori, Milano; # Oncologia MedicaC, Istituto Nazionale Tumori, Milan, ItalyEpidemiologic studies on sibling of case subjects andmonozygotic twins have shown the existence of agenetic susceptibility to lymphomas. However it hasnot yet been identified a candidate gene. Interleukin 10(IL10) is an important immunoregulatory cytokine,mainly produced by monocytes, T cells as well ashealthy and neoplastic B lymphocytes. IL10 has strongimmunosuppressive effects, and it stimulates the proliferationand differentiation of B cells. Further, IL10has been shown to have a role in the pathogenesis oflymphomas, acting as an autocrine growth factorwhich up-regulates bcl-2.In vitro studies have shownthat specific polymorphisms located in the promoter ofthe gene are associated with different levels of IL10production. In particular it has clearly been shown thatthe single nucleotide polymorphism in position 1082(IL10-1082) has a notable influence on IL10 production.Likewise, specific Epidemiologic studies on sibling ofcase subjects and monozygotic twins have shown theexistence of a genetic susceptibility to lymphomas.However it has not yet been identified a candidategene. Interleukin 10 (IL10) is an important immunoregulatorycytokine, mainly produced by monocytes, T cellsas well as healthy and neoplastic B lymphocytes. IL10has strong immunosuppressive effects, and it stimulatesthe proliferation and differentiation of B cells.Further, IL10 has been shown to have a role in thepathogenesis of lymphomas, acting as an autocrinegrowth factor which up-regulates bcl-2.In vitro studieshave shown that specific polymorphisms located inthe promoter of the gene are associated with differentlevels of IL10 production. In particular it has clearlybeen shown that the single nucleotide polymorphismin position 1082 (IL10-1082) has a notable influence onIL10 production. Likewise, specific alleles in the tandemrepeated region at locus 1064 (IL10-1064) have beendemonstrated as important factors for graft-versushostdisease occurrence in the setting of allogeneicstem cell transplantation. The aim of our study was tocompare the distribution of these specific IL10 polymorphismsbetween a population of patients affectedhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004177by indolent non-Hodgkin lymphomas and healthy controls.For this purpose we employed a single-allele polymerasechain reaction to discriminate IL10-1082 allelesand we developed a Gene-Scan based system todistinguish the microsatellites of different size at locusIL10-1064.The A polymorphism at the IL10-1082 locuswas considered as a lower IL10 producer respect to theG allele. Likewise, previous studies have suggested thatthe alleles at the IL10-1064 locus had a different clinicalbehaviour depending on the number of the tandemrepetitions, with a cut-off at 12 repetitions. We studied62 healthy controls and 86 patients (38 chroniclymphocytic leukemia, 31 follicular lymphomas, 17mantle cell or marginal zone lymphomas). At locusIL10-1064 we did not find any significant difference inthe allele distribution between healthy controls andlymphoma patients. Also comparing healthy controlsand subgroups with different histology was not informative.The analysis of the IL10-1082 alleles showed adifference between the control group and the chroniclymphocytic leukemia patients, with a prevalence ofthe G allele in the patient population (39 G and 43 Afor chronic lymphocytic leukemia, 41 G and 83 A forcontrol subjects, p=0.04, χ 2 test). None difference wasobserved among the other subgroups of patients. Inconclusion our results suggest that, at least for chroniclymphocytic leukemia, the G allele at locus IL10-1082 has an higher frequency in the patient populationrespect to the control group. Given the influence onIL10 production of this genetic polymorphism, it is reasonableto speculate a role for IL10 production onchronic lymphocytic leukemia pathogenesis. The analysisof the IL10-1064 locus was not informative, suggestingthat this polymorphism may be relevant in otherssettings, but it not appears involved in lymphomapathogenesis.PO-189PHYSIOLOGICAL AND ABERRANT SOMATIC HYPERMUTATIONMECHANISM IN PRIMARY BREAST LYMPHOMA: CLUES FOR THEHISTOGENESIS AND PATHOGENESIS OF THE DISEASEBerra E, 1 Marino M, 2 Capello D, 1 Cerri M, 1Deambrogi C, 1 Rossi D, 1 Franceschetti S, 1Vendramin C, 1 Gloghini A, 3 Carbone A, 3 Gaidano G 11Hematology Unit, Department of Medical Sciences,Amedeo Avogadro University of Eastern Piedmont,Novara, Italy; 2 Division of Pathology, Regina ElenaInstitute, Rome, Italy; 3 Division of Pathology, C. R. O. ,Aviano, ItalyPrimary lymphoma of the breast is a rare disease,accounting for less than 2% of extranodal non-Hodgkin'slymphoma. The majority of cases are of B-cell originand are morfologically classified as diffuse large B-cell lymphomas (DLBCL). Knowledge about the pathogenesisand histogenesis of primary breast lymphomais scarce and new molecular markers are under studyto improve the characterization of the disease. Molecularmarkers of histogenesis are represented bysomatic mutations of IgV and BCL6 genes, that are fisiologicallyacquired by B-cells during T-cell dipendentantigen reaction and characterize lymphomas derivedfrom germinal centre (GC) or post-GC B-cells. The physiologicalmechanism of somatic hypermutation may bemalfunctioning in lymphoma, causing the accumulationof somatic mutations of PAX-5, RhoH/TTF, PIM-1and c-MYC proto-oncogenes, a process known as aberrantsomatic hypermutation. In this study, we aimed atclarifying the molecular histogenesis of primary breastlymphomas by defining the mutational status of IgVand BCL6 genes. Also, we aimed at understanding thepathogenetic role of the aberrant somatic hypermutationprocess in primary breast lymphoma by analyzingthe mutational status of PAX-5, RhoH/TTF, PIM-1 andc-MYC proto-oncogenes. Toward this aim, 13 cases ofprimary breast lymphoma were analyzed for the targetgenes by PCR amplification and direct sequencing. Afunctional IgVH rearrangement was identified in 8/13(61.5%) primary breast lymphomas. All rearrangementsof IgVH genes detected in primary breast lymphomadisplayed somatic hypermutation, with a mutation rateranging from 4.0% to 25.9%. These data suggest aderivation of primary breast lymphomas from GC orpost-GC B-cells. The IgVH gene families utilized includedVH4 (4/8 cases), VH3 (3/8 cases) and VH2 (1/8 case).Mutations of BCL-6 were detected in 7/13 (53.8%) cases,further confirming the finding that primary lymphomasof the breast derive from GC-experienced Bcells. Analysis of aberrant somatic hypermutation ofproto-oncogenes was performed on selected regionsknown to contain >90% of mutations found in lymphoma.Overall, mutations in at least one of the fourproto-oncogenes targeted by aberrant somatic hypermutationwere found in 9/13 (69%) primary breastlymphomas, whereas mutations in more than one genewere found in 4/9 (44%) cases. Each of the four proto-oncogeneswas altered in a significant fraction ofprimary breast lymphomas (PAX-5 in 4/9 cases;RhoH/TTF in 5/9 cases; PIM-1 in 5/9 cases and c-MYCin 2/9 cases). The overwhelming majority of mutationswas represented by single base-pair substitutions(n=36), whereas in only one instance a deletion of ashort DNA stretch was observed. Among the 36 singlebase-pair substitutions detected in primary breast lymphoma,the transition/transversion ratio was 1.76(expected 0.5; p

178Posters1.The association of primary breast lymphoma withaberrant somatic hypermutation of proto-oncogenesexpands the types of aggressive lymphomas marked bythis molecular abnormality and provides clues forunderstanding breast lymphoma pathogenesis. In particular,missense mutations in the PIM-1 coding regioncan deregulate its function, whereas mutations of the5' regulatory regions of PAX-5, RhoH/TTF and c-MYCare expected to influence the expression and regulationof these genes in a fashion similar to that reported forthe BCL-6 gene in B-cell lymphoma. Consistent withthe role of PAX-5 in B-cell differentiation, of RhoH/TTFin signal transduction, and of c-MYC in B-cell growthand fate, deregulation of these genes by aberranthypermutation may contribute to breast lymphomapathogenesis by multiple pathways.PO-190HHV-8 POSITIVE PEL, LONGSTANDING KAPOSI SARCOMA ANDIDIOPATHIC CD4 + T-LYMPHOCYTOPENIAAscoli V,* Natale ME,* Giannakakis K,* Amoruso F, §Carboni V, § Richetta G, § Calabrò ML, # Capello D°*Dipartimento di Medicina Sperimentale e Patologia,§Dipartimento di Dermatologia e Venerologia, UniversitàLa Sapienza, Rome; # Dipartimento di ScienzeMediche e Chirurgiche, Università di Padova, Padova;°Unità di Ematologia, Dipartimento di Scienze Mediche,Università del Piemonte Orientale, Novara, ItalyHuman herpesvirus(HHV-8) associated primary effusionlymphoma (PEL) occurs more frequently in thecontext of HIV-infection. We describe the case of aHHV-8-positive PEL in a HIV-negative Italian womanwith idiopathic CD4+ T-lymphocytopenia. At the age of36 years, the patient developed recurrent effusions inthe pleural cavity after longstanding (> 10 years) Kaposisarcoma (KS). Serologic test for HIV, HBsAg and HCVwere negative. PCR analysis of PBMCs resulted positivefor HHV-8 sequences 7 years before the occurrence ofPEL. For several years the patient had low number oftotal WBCs, CD3 + , CD4 + , and CD8 + T cells. At the sametime, she had hepatosplenomegaly and lymphoadenopatiesthat were never biopsied. We examined6 effusion samples in the course of her last 6months of life. These effusions contained several celltypes: macrophages, lymphocytes, eosinophils, neutrophils,mesothelial cells, and a small proportion ofatypical lymphoid cells of medium-large size togetherwith apoptotic bodies. Molecular studies of the pleuralfluid sediment disclosed HHV-8 but not EBV DNA,and no clonal rearrangements of IgVH, IgVL and TCRgenes. HHV-8 was detected in saliva and again in PBM-Cs. The cytokine profile of pleural fluids is in progress.This case is an unusual example of PEL for two reasons.First, it occurred in the context of a severe form ofimmunodeficiency unrelated to HIV-infection that likelyfavoured the activation of HHV-8.Second, it occurredin a woman; only few papers have described PEL inwomen, including 6 HIV-negative cases (Said et al.Blood 1996; Carbone et al. Br J Hematol 1996; Codish etal. Am J Hematol 2000; Niitsu et al. Ann Hematol 2000;Boulanger et al. Am J Hematol 2004) and 1 HIV-positivecase (Valencia et al. AIDS 1999). Another peculiarityis that the patient originated from a geographicalarea in Campania characterized by high incidence ofclassic KS and not negligible rates of HHV-8 infection(Montella et al. J Viral Hepatol 2004).PO-191MINIMAL RESIDUAL DISEASE HAS NOT A SIGNIFICANT IMPACT ONLONG-TERM OUTCOME OF PATIENTS WITH AGGRESSIVE LYM-PHOMAGalimberti S, 1 Morabito F, 2 Rossi A, 1 Manetti C, 1Caracciolo F, 1 Cervetti G, 1 Cecconi N, 1 Fazzi R, 1Stelitano C, 3 Martino M, 2 Nobile F, 3 Iacopino P, 2Petrini M 11Department of Oncology, Transplant and Advances inMedicine, Section of Hematology, Pisa University;2Bone Marrow Transplant Unit, Hematology Department,A. O. Reggio Calabria, Italy; 3 Hematology Unit,Hematology Department, A. O. Reggio Calabria, ItalyVarious molecular markers, ie IgH, Bcl2, Bcl1 and TCRrearrangements, are now available for both moleculardiagnosis and for the evaluation of minimal residualdisease (MRD) in patients with non-Hodgkin’s lymphomas(NHL). Although these molecular assays aresufficiently sensitive and specific, their predictive rolein minimal residual disease detection is still controversial.In a series of 211 patients affected by aggressiveNHL, autologous transplantation offered a longer PFSonly in high-risk cases, where 5-year PFS was 66% fortransplanted patients vs 44% for cases treated by conventionalchemotherapy. Fifty-eight of these patients(88% with diffuse large cell B LNH) underwent autologoustransplantation (PBSCT) and were evaluated forthe presence of molecular markers (IgH and Bcl2/JHrearrangements) on bone marrow (at diagnosis andafter graft) and on harvests in order to find a possiblepredictive role of MRD on treatment outcome. At diagnosis,37% of patients showed molecular involvementof bone marrow samples; 3% of these cases have beennegative at the histological evaluation. The PCR-positivewas significantly correlated with advanced stageof disease. Thirty-two percent of leukaphereses resultedPCR-positive, mainly when patients were mobilizedin advanced stage of disease or showed a molecularinvolvement of bone marrow at diagnosis. Interestingly,13% of patients with PCR-negative bone marrow atdiagnosis harvested PCR-positive precursors. Thirty-sixhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004179percent of aphereses underwent ex vivo purging, butonly 3% became IgH-negative. Five-year OS was 90%and PFS 71%; molecular status of aphereses, includedthe ex vivo purging, did not significantly conditionlong-term prognosis of our patients. With a medianfollow-up of 37 months, after PBSCT 90% of testedpatients were PCR- negative; the relapse rate was notdifferent between MRD-positive and negative cases. Inconclusion, in opposition to that observed in indolentlymphomas, serial molecular monitoring of MRD usingqualitative PCR techniques could not represent a realprognostic indicator for patients affected by aggressiveNHL.PO-192USE OF A REAL-TIME-PCR ASSAY TO IMPLEMENT STAGING PROCE-DURES IN PATIENTS WITH T(14;18) POSITIVE FOLLICULAR CELLLYMPHOMAFrigeri F, Di Francia R, Nasuti A, Iaccarino G,Catapano O, Russo F, Corazzelli G, Mele G,De Chiara A,* Pinto AHematology-Oncology and *Pathology Units, NationalCancer Institute “G. Pascale”, Naples, ItalyFollicular Cell Lymphoma (FCL) is one of the mostfrequent adult non Hodgkin's lymphomas (NHL) and itsincidence increases with age. Generally it presents anindolent clinical course but is not curable and mayprogress to diffuse large B cell lymphoma. At diagnosis,a diffuse lymphadenopathy and a disseminated disease(stage IV) are frequent. FCL originates from germinalcenter B-cell carrying the t(14;18) translocationwhich results in the juxtaposition of the BCL-2 gene tothe joining region (JH) of immunoglobulin heavy chain.The BCL-2/JH rearrangement can be easily detected byqualitative PCR assay, in about 60-80% of FCL patients,on DNA samples obtained by lymph nodes (LN), bonemarrow (BM) or peripheral blood (PB). t(14;18) detectionby conventional PCR assay provides a useful toolfor i) diagnosis, ii) monitoring of minimal residual disease(MRD), iii) early evaluation of the efficacy of newtherapies (e. g. Rituximab) and iv) gaining relevantprognostic information in FCL. The use of very sensitivenested-PCR asssays, however, may result in the detectionof BCL-2 rearrangement in PB of about 25% ofnormal individuals (frequency increasing with age). Thedevelopment of a quantitative PCR strategy, theoreticallyable to find a cut-off value between the amountsof positive clones found in FCL patients versus thosefound in healthy subjects, may overcome such potentialpitfall. We developed a REAL-Time PCR strategyable to quantify the number of cells carrying the BCL-2/JH rearrangement by the taqman technology. Theabsolute quantification was obtained by serial dilutionof a cloned primer-specific template, exactly quantifiedby competitive PCR against a competitor designed byselecting a sequence not present in the human genometo which BCL-2 specific primers were linked. The sensitivityof our REAL-Time PCR assay was assessed by aserial dilution of DNA extracted from DoHH2 cell lines(carrying BCL-2/JH rearrangement) and expressed asnumber of alleles in 500 ng of DNA (75000 cells). In ourhands the limit sensitivity of the assay was 40 cells/500ng DNA (5.3×10 -4 ). We then exploited the assay toimplement staging procedure at diagnosis in a cohortof 28 FCL patients undergoing chemotherapy with fludarabine+ rituximab containing regimens. Theabsolute amount of t(14;18) positive cells was comparativelyassessed in LN, BM and PB samples at diagnosis.The mean number of alleles detected in 500 ngof DNA (75000 cells) from BM and PB was very similarin our cohort of patients (104.8 and 84.1 respectively),while LN samples yielded a significantly highermean value (10712.3). Real-time PCR results were correlatedwith disease parameters at diagnosis, includingclinical stage, bulky disease, bone marrow involvement,IPI score, performance status, extra-nodal site involvementand presence of B symptoms. Interestingly, a positivecorrelation emerged between the number of positivecells detected at diagnosis on lymph nodes, butnot in PB, and an increased risk of BM and extra-nodalsites involvement. These results, if confirmed on a largernumber of patients, may constitute the basis for amolecular staging in FCL, provide a new molecular toolto assess the risk of disseminated disease at diagnosisand a new important prognostic factor to orientate thetherapeutic strategy.PO-193ANGIOIMMUNOBLASTIC T-CELL LYMPHOMA AND EBV-ASSOCIATEDLARGE B-CELL LYMPHOMA : A CASE REPORTAlvarez Decelis I, Petrò D, Russo F, Giovanardi F,Zannoni M,* Bonomini S, Caramatti C, Mangoni L,Craviotto L, Rizzoli VHematology Unit and Bone Marrow TrasplantationCenter, Parma University; *Surgical and TransplantationDepartment, Parma University, ItalyAngioimmunoblastic T-cell lymphoma (AITL) is a systemicdisease characterized by the monoclonal proliferationof T cells expressig CD3 and CD4.In mostpatiens, the tumor cells are greatly undervaluated bynumerous relative cells. This raises some difficulties,regarding both diagnosis and the investigation of thebiological characteristic of the tumor cells. The clincaloutcome of these patients remains bleak, despiteimprovements in the management of other aggressivelymphomas. We report a rare case of angioimmunoblasticT-cell lymphoma (AILT) and diffuse largeB-cell lymphoma occurring in a 56-year-old womanhaematologica vol. 89[suppl. n. 6]:september 2004

180Posterswith generalizated lymphoadenopathy and hepatosplenomegaly.The patient initially was admitted at alocal hospital, in May 2003, because of fever, sweats,fatigue, generalized pruritus, pharyngodinia and witha single left cervical lymphadenopathy. Histologicexamination of the cervical lymphnode was interpretedas atypical immunoblastic proliferation. After treatmentthe clinical symptoms disappeared and laboratoryfindings normalized. She developed generalized lymphadenopathy10 months later and was referred to ourinstitution for futher evaluation. Laboratory analysisshowed dysprotidemia with polyclonal hypergammaglobulinemia,leukocitosis with eosinophilia, anemiaand thrombocytopenia. The patient presented also apneumoniae pulmonary infection (chest X-ray showeda ground glass aspect) and a EBV infection (identifiedby the polymerase chain reaction). The recent biopsy ofthe cervical node showed typical features of AILT. Flowcytometric immunophenotyping identified an aberrantCD4 + T-cell population that lacked surface CD3.Polymerasechain reacting analysis of the T-cell receptor γgene revealed a clonal rearrangement. In addition tothe AITL, the lymph node showed partial involvementby a diffuse large B-cell lymphoma. The B lymphomacells and the admixed immunoblasts and Reed-Sternberg-likeB cells were positive for Epstein-Barr virus(EBV) by in situ hybridization. Our findings raise thepossibility that EBV-associated large B-cell lymphomais a secondary event in AITL via EBV infection or reactivationfollowed by clonal expansion of an immortalizedEBV-infected B cell clone. The future success indealing with AITL will depend on the progress in understandingthe biology of the disease and in establishinginternational collaborations to test biological discoveriesin large clinical trials.rolling, adhesion and extravasation, in lymphocytehoming and in various phases of cellular-mediatedimmune response. It has been supposed that a variableexpression of adhesion molecules on SMZL lymphocytesmay influence the evolution and pattern ofthe BM infiltrate. This study was performed on 38patients (18 males; 20 females; median age, 66 years;range, 23-79), with diagnosis of SMZL (21 patients) orof Splenic Lymphoma with Villous Lymphocytes (17patients). All patients underwent a bone marrow biopsyat the time of the diagnosis in order to evaluatebone marrow involvement. Histological (haematoxylinand eosin, periodic acid Schiff, Giemsa, and Gomori)and immunophenotypical [Psgl-1 (CD162), E-selectin(CD62-E), L-selectin (CD62-L), HCAM (CD44), ICAM-1 (CD54), and β-1 integrin (CD29)] stainings wereperformed in order to analyse the frequency, degreeand pattern of bone marrow infiltration and evaluatethe expression of a set of adhesion molecules amongthe different patterns of infiltration. A small-B-cell,mature appearing, lymphoid infiltrate was detected inall patients. The intrasinusoidal pattern of infltrationwas constantly observed, alone or in conjunction withother patterns, most frequently nodular or interstitial.As regards adhesion molecule immunophenotype,PSGL1 expression was limited to a low percentage ofneoplastic lymphocytes, mainly in the perisinusoidalregion (Figure 1) and in the peripheral zone of thenodules (Figure 2).PO-194IMMUNOPHENOTYPIC PROFILE AND ROLE OF ADHESION MOLE-CULES IN SPLENIC MARGINAL ZONE LYMPHOMA WITH BONEMARROW INVOLVEMENTTripodo C, Florena AM, Iannitto E, Franco VIstituto di Anatomia e Istologia Patologica, *Divisionedi Ematologia con Trapianto di Midollo Osseo,Università degli Studi di Palermo, ItalySplenic marginal zone lymphoma (SMZL), with orwithout villous lymphocytes, is listed as a well-definedentity in the World Health Organization classificationof lymphoid tumours. The spleen is reported as beingthe primary site of involvement. In bone marrow,which is invariably involved, different patterns of infiltrationhave been described: intrasinusoidal, interstitial,nodular, para-trabecular, and packed. Adhesionmolecules constitute a heterogeneous group of antigenicreceptors which play a major role in leukocyteFigure 1.ICAM-1 was selectively expressed in the coreregion of the nodules (Figure 3) while the intrasinusoidaland interstitial infiltrates were negative, andHCAM was constantly positive in most of neoplasticcells independently from the infiltration pattern. E-selectin, L-selectin and β-1 integrin were constantlynegative. These data strengthen the hypothesisthat bone marrow pattern of infiltation in SMZL/SLVLis influenced by adhesion molecule expression.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004181PO-195INTRAVENOUS ADMINISTRATION OF RITUXIMAB IN CENTRALNERVOUS SYSTEM LYMPHOMASRaspadori D, Forconi F, Tassi M, Parigi S,Dell'Aversano M, Pirrotta MT, Fabbri A, Bucalossi A,Lauria FEmatologia e Trapianti, Università di Siena, ItalyFigure 2.Figure 3.Introduction: Anti-CD20 Monoclonal antibody Rituximabis a pivotal compound for the treatment ofthe majority of CD20+ non-Hodgkin lymphomas.Central nervous system (CNS) lymphomas are infrequentlymphomas, generally of the diffuse large celllymphoma (DLCL) type, that localise either in the leptomeningealcompartment or in the parenchimalcompartment (or both) of the CNS. CNS lymphomashave a bad prognosis and current treatments are allunsatisfactory. We investigated the distribution andefficacy of intravenous rituximab in patients withsystemic DLCL with documented CNS involvment,refractory to conventional treatments. Methods: Rituximabwas administered intravenously at 375mg/m 2 in 3 patients with CNS DLCL. Prior to rituximabinfusion, Lumbar puncture had demonstratedleptomeningeal involvement with neoplastic cells inthe cerebro-spinal fluid (CSF) in 1 case, while soleparenchimal involvement had been demonstrated inthe remaining 2 cases by MRI of the CNS. Serum andliquoral antibody levels were measured concomitantlybefore and after intravenous administration ofrituximab (375 mg/m 2 ) at different time points. Concentrationof rituximab was measured using an inhibitionassay in flow cytometry, by incubating CD20+Raji cell line and PE conjugated anti-CD20 MoAb(Pharmingen) in the presence of serum or CSF.Results: Rituximab was documented in the CSF of all3 patients, with a maximum concentration that wasreached within the first 24-48 hours from the timeof infusion. Plateau concentrations were maintainedfor more than a week after infusion and remaineddetectable even after 2 weeks from infusion. In 2patients where serum and CSF concentrations couldbe compared, we observed that from 1 to 10% rituximabpassed from the serum to the CSF. In the 2 caseswith parenchimal involvement, subsequent clinicaland/or MRI evaluation of the parenchimal massesdocumented scarce benefit on the CNS involvement.Interestingly, however, the patient with leptomeningealinvolvement demonstrated a rapidclearance of tumor cells from CSF. Conclusion: ourpreliminary data demonstrate that rituximab administredto patients with CNS lymphoma can pass theblood-brain barrier and that it can reach concentrationswith potential therapeutic activity, which canbe effective in patients with leptomeningeal involvement.haematologica vol. 89[suppl. n. 6]:september 2004

182PostersPO-196EPRATUZUMAB/SAPORIN-S6: A NEW ANTI-CD22 IMMUNOTOXINWITH A POTENT ANTITUMOUR ACTIVITYPolito L, Farini V, Zinzani PL,° Stirpe F, Bolognesi ADipartimento di Patologia Sperimentale, Universitàdi Bologna, Bologna, Italy; °Istituto di Ematologia eOncologia medica “L. & A. Seràgnoli”, Università diBologna, Bologna, ItalyThe use of monoclonal antibodies as anti-cancertherapies has been widely explored since their initialdevelopment by Kohler and Milstein. 1 In contrast tochemotherapy and radiotherapy specific antibodiescan preferentially bind tumor cells over normal tissues.The vascular nature of most lymphomas suggeststhat they may represent a favorable setting forthis treatment modality. In fact, the first successfuluse of antibodies as treatment for cancer wasdemonstrated in lymphoma, and these agents havenow been employed to benefit thousands of patientswith non-Hodgkin's lymphomas (NHL). 2 CD22 isexpressed at high levels on normal mature B-cellsand on a large proportion of B lymphoma cells. Thehumanized anti-CD22 antibody Epratuzumab (hLL2)was used in clinical trials giving good anti-tumoractivity. It was well tolerated, 16% of the patientsresponded and one third of them achieved CR in aPhase I/II trial. 3 Better results could be obtained couplingthis mAb to a toxin to obtain a chimeric protein,defined immunotoxin. 4,5 In our studies we linkedEpratuzumab to the RIP saporin-S6.RIPs are planttoxins with RNA N-glycosidase activity, which cleaveone or more adenine molecules from ribosomal RNA,thus damaging ribosome in an irreversible manner. 6The effects of Epratuzumab-saporin-S6 were evaluatedas inhibition of protein synthesis on five targetB-lymphoma cell lines: BJAB, REH, D430B, Raji andRamos. Time-course and dose-response experimentswere performed to extrapolate the kinetics of proteinsynthesis inhibition and the concentration ofimmunotoxin giving 50% inhibition (IC50). Conjugationwith Epratuzumab enhanced saporin-S6 cytotoxicityon target cells by at least 3 logs, with IC50in the pM range. No protein synthesis inhibition wasinduced by free mAb. Protein synthesis of CD22-negativeJurkat cells was not affected by the immunotoxinat concentrations up to 10 nM. These resultswere confirmed by another cytotoxicity assay, basedon MTS. We further demonstrated the killing efficiencyof the immunotoxin using a very sensitiveluminometric method, measuring the ATP producedby surviving cells, in time- and dose-response experiments.Moreover, as the final target of an antitumourtherapy is to completely eradicate the disease,the clonogenic growth of target cell lines wasdetermined after exposure to anti-CD22 immunotoxin.A complete elimination of BJAB clones wasreached after a short time (3 h) exposure to the conjugate,at 10 nM concentration vs a 15% inhibitionof clonogenic growth reached with saporin-S6 alone.References1. Kohler G, Milstein C. Eur J Immunol 1976;6:511-519.2. Forero A, Lobuglio AF. Semin Oncol 2003;30:1-5.3.Leonard JP, Coleman M, Ketas JC, et al. Clin Oncol. 2003;21:3051-9.4.Kreitman RJ, Pastan I. Adv Drug Deliv Rev 1998;31:53-8.5.Bolognesi A, Polito L. Mini Rev Med Chem 2004;4:563-85.6.Barbieri L, Battelli MG, Stirpe F. BBA 1993;1154:237-82.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004183PosterLYMPHOMAS AND LYMPHOPROLIFERATIVEDISORDERS IIPO-197HHV-8 POSITIVE PEL IN A HIV-POSITIVE WOMAN FROMCENTRAL AFRICA WITH AGGRESSIVE KAPOSI SARCOMAAscoli V,* Natale ME,* Giannakakis K,* Dell'Isola S,°Mastroianni CM,° Calabrò ML, # Buffolino S, §Floriddia G, § Cimino G §*Dipartimento di Medicina Sperimentale e Patologia,°Dipartimento di Malattie Infettive e Tropicali,§Dipartimento di Biotecnologie Cellulari ed Ematologia,Università La Sapienza, Rome; # Dipartimento diScienze Mediche e Chirurgiche, Università di Padova,Padova, ItalyHuman herpesvirus 8 (HHV-8) associated primaryeffusion lymphoma (PEL) and Kaposi sarcoma (KS)are diseases primarily affecting men. HHV-8 is highlyprevalent in many African countries, wherein it isas common in women as in men. Since the epidemicof HIV, KS has become relatively more frequent inwomen and it can be aggressive and devastating(Nnoruka et al. Int J Dermatol 2003). We herein reportthe case of a HHV-8-positive PEL in a HIV-positive26-year-old black woman. She was born and livedfor 22 years in Cameroon, central Africa, then 4 yearsin Italy. The patient was graduated student whodenied intravenous drug abuse and declared heterosexualunprotected intercourse. Her past medical historywas negative except for malaria during childhood/adolescence.In July 2003 she became symptomaticwith progressive malaise. In August she developeda febrile syndrome associated with Shigella flexineri,and received a blood transfusion because ofsevere anemia (Hb 7.0 g/dL). Serologic test for HIVwas positive (HIV-RNA 5300 copies); CD4 8%; CD494/mm 3 ; CD8 61%. She underwent highly anti-retroviraltherapy. Nonetheless, the patient developedrecurrent pleural effusions, high fever and widespreadlymphoadenopatic, visceral and mucocutaneous KS.The course of disease was aggressive and deathoccurred in November. Effusions contained largeatypical lymphoid cells that were not numerous inthe first fluid but increased in number in the subsequentsamples. HHV-8 DNA sequences, but not EBV,were detected by PCR in peripheral blood mononuclearcells, saliva and in the pleural sediment. Antibodiesto the latent nuclear antigen (LNA-1) ORF 73revealed nuclear staining in atypical lymphoid cells.PCR analysis of the pleural sediment disclosed noclonal rearrangements of the Ig heavy chain gene.The failure of Ig PCR in PEL has been reported previously(Fais et al. Leukemia 1999; Hamoudi et al.Leukemia Research 2004). Sequencing of the ORF K1gene is in progress to document the HHV-8 strain.This case is an example of HHV-8 associated PEL inan African woman with HIV-related immunodeficiency.Few papers have described PEL in women: 6HIV-negative cases (Said et al. Blood 1996; Carboneet al. Br J Hematol 1996; Codish et al. Am J Hematol2000; Niitsu et al. Ann Hematol 2000; Boulanger etal. Am J Hematol 2004) and 1 HIV-positive case inwhich, however, the proof of HHV-8 infection is lacking(Valencia et al. AIDS 1999). To our knowledge,PEL has never been reported in Africans. In Cameroon,HHV-8 seroprevalence is high (28-62%; up to 55%in pregnant women), HHV-8 infection takes placeduring childhood by non-sexual casual routes, and KSwas relatively frequent also before the spread of HIVinfection epidemic (8/1000 men) (Gessain et al. Int JCancer 1999).PO-198EFFECT OF DEXRAZOXANE ON TOTAL PLASMA ANTIOXIDANTCAPACITY AND ON QT DISPERSION IN LYMPHOMA PATIENTSDURING ANTHRACYCLINE-BASED CHEMOTHERAPYCervetti G,* Franzoni F,° Galetta F,° Cecconi N,*Rossi A,* Femia FF,** Fazzi R,* Regoli F,** Santoro G,°Petrini M**Department of Hematology, °Department of InternalMedicine, University of Pisa, Pisa, **Institute ofBiology and Genetics, University of Ancona, ItalyAnthracyclines are widely used in the treatment oflymphomas but their clinical efficacy can be limitedby acute and chronic toxicity, in particular cumulativecardiac damage. Several approaches have beenattempted to reduce cytotoxicity of these antineoplasticagents, such the use of drugs with potentialcardio-protective action. Dexrazoxane clorhydrate(Cardioxane®), a synthetic bisdiketopiperazine tworingedcompound which hydrolyzes to an EDTA analog,seems to be able to reduce cardiac toxicity bybinding to free and bound iron, thus reducing theformation of anthracycline-iron complexes and thegeneration of free radicals which are toxic to cardiactissue. In daily practice, parameters of systolic function(left ventricular ejection fraction or fractionalshortening) are employed to detect cardiotoxicity, butthese methods are not able to identify acute cardiacdamage. The determination of QT dispersion mayidentify patients at risk of the development of earlyheart failure. The main purpose of the present studywas to assess the effect of epirubicin-based chemotherapy(PROMECECytaBOM) on plasma free radicalhaematologica vol. 89[suppl. n. 6]:september 2004

184Postersantioxidant capacity of patients with Non-HodgkinLymphoma (NHL), and the effect of supplementationwith dexrazoxane on plasma antioxidant status. Secondaryobject was to evaluate the activity of dexrazoxaneon QT interval dispersion in the same subsetof patients. Methods. 14 untreated patients 60 yearsof age with newly-diagnosed aggressive NHL andtreated with ProMECECytaBOM, were selected for thestudy. Other inclusion criteria were: performance status0-3 (ECOG), normal cardiac function (EF 50%).The patients were randomly allocated to receive ornot dexrazoxane clorhydrate (40 mg/m 2 ) after epirubicininfusion. Peripheral blood samples in EDTA wererecovered at baseline, after epirubicin infusion, andone hour later. Oxidative stress was evaluated bymeasuring at the beginning and at the end of thetreatment plasma malondialdehyde (MDA) and plasmaantioxidant capacity as its ability to antagonizethe oxidation of α-keto-gamma-methiolbutyric acidby hydroxyl radicals. The results are expressed as totaloxyradical scavenging capacity (TOSC) units. Moreover,all participants underwent 12-lead electrocardiogram(ECG) at baseline, after epirubicin infusion,and one hour later. QT intervals were measured fromsurface electrocardiograms and QT dispersion wasdefined as maximum QT - minimum QT occurring inany of the 12 leads. QT dispersion was corrected (QTc)for heart rate according with Bazett's formula.Results. One hour after the end of epirubicin infusion,plasma MDA was significantly increased (2. 8±0.3 vs.5.8±1.1 mol/l, p

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004185PO-200NEW PROSPECTS FOR INDUCTION OF ANTI-LYMPHOMA IMMUNI-TY USING DNA VACCINES EXPRESSING CHEMOKINE-PARTICLESCoscia M,°* # Ruffini P, a&# Neelapu S°, & Kwak LA,° ,&Biragyn A §°Experimental Transplantation and ImmunologyBranch, NCI, Frederick, MD; *IRSP, SAIC-Frederick,Frederick, MD, USA # on leave of absence from Divisionedi Ematologia dell’ Universita di Torino, Laboratoriodi Ematologia Oncologica, CeRMS, AziendaOspedaliera San Giovanni Battista, Torino, Italy; Divisionedi Oncologia Medica Falck, Ospedale NiguardaCa’ Granda, Milan, Italy & Department of Lymphomaand Myeloma, MD Anderson Cancer Center, Houston,TX; § LI/GRC/NIA/NIH, Baltimore, MD, USAMain obstacle for development of cancer vaccinesis that tumor antigens are often non-immunogenicand vaccines do not elicit antigen specific cellularresponses. The delivery of target antigens in a DNAvaccine format allows to include molecules withimmunological properties that can improve the efficacyof the immunization. Recently we demonstratedthat tumor-derived Idiotype fragments (scFv)genetically fused with proinflammatory chemoattractantselicited protective antitumor immunity inmice. Herein we report that an efficient chemokinereceptor-mediated uptake, followed by processingand presentation of antigens via the MHC class IIpathway, is the mechanism by which chemokinefusion constructs elicit responses, in vitro and in vivo.Experiments with inhibitors of intracellular traffickingsuggest that chemo-attractant fusion proteinswere processed and presented through early/lateendosomal and Golgi compartments, and stimulatedsignificative IFN-gamma release by an antigen-specificCD4 + T cell clone. This observation was also confirmedusing human fusion proteins; specifically,chemokine fusion proteins facilitated the uptake andpresentation of a human lymphoma Idiotype fragment(sFv), and stimulated a patient derived tumorspecificCD4 + T cell line. Next, we wanted to furtherincrease efficacy of the chemokine-based vaccinesby combining them with enhanced immunogenicityof large aggregates, such as a self-assembled 24-nmHBsAg particles, a source of current human HBV vaccine.We generated vaccine formulations expressingchemokine-Id on the surface of HBsAg and tested inmice whether these chimeras would elicit anti-Idresponses. Our preliminary results demonstrate thatrecombinant HBsAg, carrying the chemokine Idfusions,elicits both anti- HBsAg and Id-specific antibodies.The strategy we describe is simple and potentand in combination with DNA vaccination strategymay be used for immunotherapy of B cell malignanciesand other clinically relevant diseases.PO-201CYCLOSPORIN-A REVERSAL OF GROWTH FACTOR-REFRACTORYIMMUNO-MEDIATED BONE MARROW APLASIA FOLLOWINGRITUXIMAB-FLUDARABINE-CYCLOPHOSPHAMIDE THERAPY INFOLLICULAR CELL LYMPHOMASFrigeri F, Nasuti A, Di Francia R, Marcacci G,Iaccarino G, Napolitano M,* Pinto AHematology-Oncology and *Clinical-ImmunologyUnits, National Cancer Institute “G. Pascale”, Naples,ItalyFollicle center lymphoma (FCL) is among the mostcommon types of non-Hodgkin lymphoma (NHL), representingabout 40% of all adult lymphomas in Westernpopulations. Usually patients present disseminateddisease at diagnosis with frequent bone marrow(BM) involvement. FCL is characterized by anindolent clinical course with long survival, but it stillremains an incurable disease. Current therapy includealkylating agents, purine analogs and/or anthracycline-basedchemotherapy. The inclusion of Rituximabin therapeutic regimes for FCL appears tomarkedly improve disease control. Results from differentstudies concordantly indicate that associationof Rituximab to chemotherapy may result in the optimalcontrol of minimal residual disease (MRD), aswitnessed by a signficant clearence of lymphomacells from BM and peripheral blood. However, Rituximab-implementedchemotherapy regimens may beassociated to an increased risk of severe immunosuppressionin FCL patients. The risk may be particularlysignificant when Rituximab is associated withpurine analogs such as Fludarabine. We describe thecase of a 27 years-old male patient, with FCL G1stage IA, diagnosed in July 2002, who, after one yearof watch and wait strategy, displayed a progressionto stage IV disease, with involvement of multiplelymph node sites at both sides of the diaphragm andBM infiltration. Molecular studies, on BM and peripheralblood (PB) cells, evidenced the typical t(14;18)translocation with BCL-2/JH rearrangement at theMajor Breakpoint Region (MBR) on the BCL-2 gene.The patient received six courses of a regimen includingfludarabine and cyclophosphamide (Flu-Cy), withthe inclusion of eight Rituximab infusions startingfrom the fourth cycle of chemotherapy. Soon aftercompleting the therapeutic program, the patientobtained a clinical and molecular remission butdeveloped a severe pancytopenia (neutr. 0.3×10 9 /L,lymphs. 0.4×10 9 /L, Plts. 17.0×10 9 /L, Hgb 9.2 g/dL) thatrequired hospitalization. Bone marrow was severelyhypoplastic with impaired maturation of myeloid anderythroid series, marked reduction of megakaryocytesand no evidence of disease relapse. An immunophenotypicstudy showed a marked increase ofhaematologica vol. 89[suppl. n. 6]:september 2004

186PostersCD16/CD56 + (NK) cells and CD8/CD57 + (CTL) cells inthe BM (10% and 2%, respectively) and PB. Based onthese results, the patient was started on high-dosesteroids, methotrexate and vincristine, associated tosupportive therapy with blood transfusions andgrowth factors (erithropoietin plus G-CSF), withoutimprovement of the pancytopenia, which persistedfor the subsequent 40 days. The patient was thereforeswitched to Cyclosporin-A (CSA; 400 mg/day)and after three weeks the hemogram started tosteadily improve reaching acceptable values (neutr.1.0×10 9 /L, lymphs. 0.9×10 9 /L, Plts. 50.0×10 9 /L, Hgb12.8 g/dL) by day +180 of continuos treatment. CSAwas then discontinued and the hemogram showed afurther improvement reaching normal neutrophils(3.7×10 9 /L) and Hgb (13.0 g/dL) levels by day+210.Platelet levels, however, remained as low as60.0×10 9 /L, without further improvement to date.Immunologic studies disclosed that improvement ofthe hematologic picture was associated to the concurrentdecrease of abnormal NK and CTL cell populationsin BM and PB, which accounted for less than1% at day +180.Molecular disease monitoring byconventional and Real-Time PCR, performed at day+210, confirmed the continuous complete remission,with absence of t(14;18)+ cells in both BM and PB.Our data indicate that CSA is effective for reversinggrowth factors-refractory autoimmune bone marrowaplasia triggered by Rituximab-Fludarabine combinations.Whether an immuno-mediated antineoplasticeffect, exerted by NK and CTL cells, abnormallyexpanded after chemo-immunotherapy, might contributeto long-term disease control, remains to beestablished.PO-202DECREASED FACTOR VII ACTIVITY IN LOW-GRADENON HODGKIN’S LYMPHOMACampiotti L, Codari R, Ultori C, Solbiati F, MarchesiC, Grandi AMDipartimento Medicina Clinica, Universotà Insubria,Varese, ItalyAcquired coagulation disorders associated withlymphomas are serius coagulopathy affecting elderlypeople with low grade lymphomas or myeloma.Usually they are due to an amyloidosis-associateddecrease of factor VII and X; less frequently autoantibodiesagainst factors VIII, IX,V are detected andrarely against factors VII, XIII and protrombin. Wedescribed a 69-year old man with a low grade lymphoma(splenic marginal zone lymphoma ) affectedby an anusuall form of acquired coagulopathy. At thediagnosis all coagulative parameters were normal anda bone marrow biopsy showed a nodular localizationof lymphoma. Two months after splenectomy thepatient showed mild epistaxis and petechias at bothlegs. Routine screening tests evidenced an high internationalnormalized ratio (INR 4.4 ), wheras APTT, fibrinogen,D-dimerand platelet count were normal.Clinical examination and total body TC excluded signsof progression of disease. Subsequent analysis founda normal activity of factor VIII and IX but a markedreduction of factor VII activity (40%) that was notrestored by addition of fresh plasma. The patient wastreated wih six course of chemotherapy (cyclophosphamidevincristine prednisone ) but the INR did notchange ( INR 3.9). Because of lack of major bleedingand other signs related to the lymphoma togetherwith unchanged INR value,we stopped the therapy.After six months the patient still has an high INR,without signs of disease progression,as well as withoutany further bleeding. We concluded that thepatient was affected by a paraneoplastic bleedingdisorder probably caused by an acquired antibodydirected against factor VII. We judged interesting todescribe this case because the decrised factor VIIactivity induced only one mild epistaxis,whereas inthe few published case reports factor VII antibodiesare always associated to severe bleeding.PO-203ROLE OF OCCULT INFECTION OF HEPATITIS B VIRUS ON VIRUSREACTIVATION OCCURRING IN NON-HODGKIN LYMPHOMAPATIENTS TREATED WITH CHEMOTHERAPYPersico M, Persico E, Picardi M,* Rotoli B,* Torella R,De Renzo A*internal Medicine And Hepatology Unit, *HematologyUnit, Federico II University, Naples; Internal Medicineand Hepatology Unit, SUN. *Hematology Unit, FedericoII University, Naples, ItalyBased on the evidence on liver tissue and bloodsera of specific gene fractions of HBV (core, s and xgenes) the occult infection of HBV was demonstrated.Epidemiological evidences suggest the possiblerole of occult infection as cofactor of disease inhepatitis C virus (HCV) related chronic hepatitis andas possible aetiological agent of liver cancer (HCC).Aim of the present study was to test the role of occultHBV infection in HBV related reactivation in patientsundergone to chemotherapy for NHL. Patients andMethods: a cohort of 55 NHL patients were studied.They all were tested for routine blood examinationand among all the other examinations to stage thedisease, they were asked to perform liver biopsy priorthe treatment. All gave informed consensus. Onliver tissue and serum of all patients but HbsAg positiveones, three gene fractions of HBV were assayed(core, s and x) by PCR according to Raimondo et al.haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004187All the patients were followed trough the time ofexposure to the drug and after discontinuation.Results: 18 out of 55 (33%) were HbcAB+; 15 wereHCV-RNA + (27%) and 6 HbsAg+ (10%). Prevalenceof HbsAg is overestimated representing a selectedgroup of subjects. HbsAg + patients were treated withpre-emptive lamivudine therapy and had no HBVreactivation after chemotherapy discontinuation.Three HbcAB+ patients who were also positive forcore and s genes on liver tissue experienced HBVrelated hepatitis reactivation. These subjects werecompared to a historical group of HbsAg+ patients (n.9) who also had a disease reactivation under thesame circumstances (pre lamivudine era). In bothgroups lamivudine promptly dominated the pathologicalprocess and all the patients recovered. Conclusions:occult infection plays a major role in HBVreactivation in treated NHL patients as well as overtHBV infection. Nevertheless, its onset is not as frequentas in HbsAg+ patients, though the prevalenceof HbcAB+ patients is high. Lamivudine pre-emptivetreatment should be considered in selected class ofHbcAB+ subjects.PO-204N-GLYCOSYLATION SITES ARE INFREQUENTLY ACQUIRED IN THEB-CELL RECEPTOR OF MUTATED HAIRY CELL LEUKEMIAForconi F, Rossi D,° Palummo N,^ Raspadori D,Trentin L,* Gaidano G,° Leoncini L,^ Lauria FDivisione di Ematologia e Trapianti, Dipartimento diMedicina Clinica e Scienze Immunologiche Applicate,Università di Siena °U. O. Ematologia, Dipartimentodi Scienze Mediche e IRCAD, Università AmedeoAvogadro del Piemonte Orientale, Novara; ^Istitutodi Anatomia Patologica, Università di Siena;*Dipartimento di Medicina Clinica e Sperimentale,Università di Padova, ItalyImmunoglobulin (Ig) variable (V) region gene analysisdelineates critical features of the clonal history ofa B-cell tumor. It identifies whether antigenencounter by a normal mature B cell has activatedsomatic mutation. This is generally restricted to thegerminal center (GC), and isotype switch events mayalso occur there. For both mechanisms, the enzymeactivation-induced cytidine deaminase (AID) is critical.B-cell tumors of GC origin tend to acquire N-glycosylationsites as a consequence of somatic mutationin the tumor VH genes. A high incidence of novelN-glycosylation sites introduced by somatic mutationis observed in the VH genes of GC derived follicularlymphoma (FL). Sites are positively selected andare uncommon in normal memory B cells, and mayhave a role in growth and behaviour of GC tumors.Sites are not characteristic of mutated chronic lymphocyticleukemia or myeloma, indicating no acquisitionof glycosylation sytes by post-GC tumors. Themajority of hairy cell leukemias (HCL) have mutatedVH genes, with low levels of intraclonal heterogeneity,while 15% cases carry completely unmutated VHgenes (100% homology to germline). HCL commonlyexpresses multiple immunoglobulin (Ig) functionalisotype transcripts in single cells, germline IH-CHtranscripts, and AID, but not circle transcripts. Thesefeatures are indicative of ongoing isotype switchevents, which generally take place in the GC in normalcircumstances. However, histological featuresand lack of GC markers in HCL, point to mutationaland switching events activated by environmental factorsat extrafollicular sites (Forconi F. , Blood submitted).To determine whether glycosylation of the B-cellreceptor is a a feature of HCL, we analysed VH genesequences of 35 HCL available from our lab (n=21) orfrom the literature (n=14) and scanned the deducedamino acid sequence for the introduction of N-glycosylationAsn-X-Ser/Thr (where X is any amino acidexcept Pro, Asp or Glu) motifs. Thirty-three ouf of 35cases carried mutated VH genes (range 87-98.6%),while 2 cases carried completely unmutated VHsequences. Novel sites were rarely acquired in HCL(6/33), with a frequency (18%) comparable to that ofnormal memory B cells (p>0.05), and different fromthat of GC tumors, including FL (p

188Postersby PBSCT, as the general population. As of December2003, we enrolled 17 HIV-positive pts (14 M/3F;median age 40 yrs; 4 HD/13 NHL; 5 pts completed thetreatment and are now in follow-up), and 10 HIVnegativepts with high grade NHL (6M/4F; medianage 62 yrs; 5 completed the treatment and are nowin follow-up). Before the induction therapy, meanvalue of CD4 count/mm(e)3 was 190+123 in HIVpositiveand 340+301 in HIV-negative pts, with nosignificant differences. On the contrary, CD4/CD8ratio in HIV-positive pts was significantly lower thanin HIV-negative pts (0.2 vs 1.2), as well as CD56 count(54+45 vs 140+96 p=0.01). Before the conditioningtreatment, CD4 count was still lower in HIV-positivepts, but CD4/CD8 ratio was less than 1 in both groups.CD4 count nadir was reached during aplastic periodand was similar in both groups (109+104 vs 122+86).CD4/CD8 ratio was 0.2 and 0.5 in both groups,respectively. Three mos after PBSCT, CD4 countreturned to baseline in HIV-positive pts (174+71),while in HIV-negative pts it was still 100 cells lowerthan baseline (240+95). Moreover, CD4/CD8 did notreturn to baseline values in HIV-negative pts andremained low as in HIV-positive pts. CD56 populationreturned to baseline values faster than CD4 populationin both groups, but it remained significantly lowerin HIV-positive pts. During follow-up no significantdifferences were seen in the incidence of opportunisticinfections. All HIV-positive pts were onHAART and HIV-viremia was 500/µL were 11(8-19) and for PLT>30000/mL were 14 (3-80). Overall,5 pts relapsed, 3 of them with bcl-2 positive and2 with bcl-2 negative bone marrow; additional 4 ptsdied, 1 for PD, and 3 still in CR for severe infectious.With a median follow-up of 5 years (2-12) from thediagnosis and 3 years (0.8-5.2) from the start of theprotocol, 10 out of 18 pts are still in CR. These resultssuggest that the use of 2-CDA for NHL pts withrelapsing disease is feasible and could represent apossible alternative regimen for indolent NHL pts. Wedidn't observe any correlation between the bcl-2 statusand the possibility to achieve a complete remissionand the probability of subsequent relapse.PO-207HODGKIN'S DISEASE IN THE BONE MARROW ANDHEMATOPHAGOCYTIC SYNDROME: A CASE REPORTTonelli S, Carrieri G, Capitelli M, Fontana MC,Cioni G, Ferrari A,* Luppi M,* Torelli G*Unità Operativa di Medicina Interna, Ospedale diPavullo nel Frignano, Dipartimento di MedicinaInterna, Azienda USL di Modena, Italy; *Dipartimentodi Oncologia ed Ematologia, Università degli Studidi Modena e Reggio Emilia, Modena, ItalyHemophagocytic syndrome (HPS) is characterizedby systemic activation of benign macrophages showingestensive phagocytosis of hematopoietic cells.Diagnostic parameters are fever, hepatosplenomegaly,fatigue, liver dysfunction, cytopenia and hyperferritinemia,hypofibrinogenemia or hypertriglyceridemia.HPS can be associated with infections, malig-haematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004189nant lymphoma or autoimmune disease. We report acase of a 73-year-old woman with a 6-months historyof weight loss, fatigue, progressive wasting andloss of appetite. She had no specific family history;deep venous thrombosis of a left lower extremity tenyears before. Physical examination at admission toour hospital showed pale face, light jaundice, leftsubmaxillary lymph node 1 cm of diameter, bilateraledema of lower extremities and few crackles in thebilateral lower lobes. There was neither fever norhepatosplenomegaly. Complete blood count revealedpancytopenia: white blood cell count of 1600 leukocytesper mm 3 with neutrophllis 47%, platelets count54000 per mm 3 , reticulocyte count 17‰; there wasa mild reduction of hemoglobin level (10 g/dL). Bloodchemistries were as follows: serum creatinine level0.51 mg/dL, bilirubin 2.03 mg/dL, alkaine phosphatase574 U/L, gammaglutamyltransferase 132U/L; serumaspartate aminotransferase 78U/L, serum alanineaminotransferase 51U/L and serum lactate dehydrogenase751U/L. Erythrocyte sedimentation rate was5 mm first hour, level of reactive C-protein was 0,38mg/dL, β2 microglobulin was 7,6 mg/dL. Ferritin was2235 ng/mL, serum gammaglobulines were very low,in particular immunoglobulines G were 326 mg/dL,immunoglobulines A 44 mg/dL and immunoglobulinesM 6 mg/dL, total proteins were 3.6 g/dL andaptoglobin was 7 mg/dL. Markers for cancer (CEA,alfa fetoprotein, Ca 15.3, Ca 19.9) were not impaired.A severe coagulation disorder was found: prothrombinactivity was 65% (INR 1.46); activated partialthromboplastin time was indeterminable; serum fibrinogenwas 64 mg/dL; antithrombin III was 46%; D-Dimer 0.6 mg/L; Coombs test was normal. Eleventhand twelventh coagulation factors levels were lowerthan normal. Anti-nuclear antibodies (ANA) and antidoublestranded DNA antibodies (anti-ds DNA) werenegative such as anti lupus coagulant antibodies(LAC). Serology including hepatitis A, B, C, HIV werenegative. Chest x-ray, toraco-abdominal computedtomography and ecocardiography were normal;abdominal ultrasound revealed a moderate hepatomegalywith diffuse hyperdense aspects like steatosisand fibrosis. During the hospitalization the generalcondition of patient impaired, full blood countstarted to deteriorate, liver function also deterioratedwith light hyperbilirubinemia (bilirubin 2.9 mg/dL),hypertransaminasemia (serum aspartate aminotransferase100 U/L and serum alanine aminotransferase80 U/L) PT prolongation and progressive hypofibrinogenemia(48 mg/dL) without cutaneous and mucosalhemorrhagic manifestations. On the tenth hospitalday the patient showed mental confusion: braincomputed tomography and magnetic risonance werenormal. Early cytomegalovirus (CMV) antigen expressionresulted negative; nested polymerase chain reaction(PCR) assay for CMV DNA and EBV PCR on lymphocyteswas positive but EBV DNA was low (twentycopies per hundred thousand cells). Serology forherpesvirus (1,2,6,8) and varicella, HBVDNA and parvovirusB19 on plasma by PCR was negative. Bonemarrow aspirate showed a popolation of lymphocytes,macrophages, Reed-Sternberg cells and aspectsof haemophagocitosis. The multilobulated giant cellswere positive for CD30 (Ki-1); NPM-ALK was negative.The diagnosis was: mixed cellularity Hodgkin'sdisease associated to hemophagocytic syndrome.Combination chemiotherapy (MOPP) was startedcontaining vincristine (1,4 mg/m 2 , day 1,8), prednisolone(40 mg/m 2 day 1-14 cycles 1 and 4 only),procarbazine (100 mg/m 2 metre day 1-14), mechlorethamine(6 mg/m 2 day 1,8). Coagulation test exibitedapparent recovery after MOPP but the patientquickly developed severe pancytopenia: transfusionsof 3 units of packed red blood cells and 8 units ofplatelets were necessary. During the fourteenthchemiotherapy day the patient developed fever anddespite supportive therapy, antibiotic and antimicoticdrugs, the clinical course was fulminant. Thepatient died: the cultures of blood were positive fora multidrug resistent Pseudomonas aeruginosa. Thestool culture was positive for Clostridium difficile.Conclusions. Hodgkin's disease with involvement ofthe bone marrow is often associated with short survival.For this reason aggressive combination chemiotherapyis necessary. When a patient has Hodgkin'sdisease associated with massive hemophagocytosisand bone marrow involvement the prognosis is bad.Aggressive chemiotherapy is the only proposed treatmentbut it is almost always not efficacious.PO-208MULTISPECTRAL IMAGING AUTOFLUORESCENCE MICROSCOPY:A NEW FIELD IN LYMPH NODE DIAGNOSISCarrai V,* Alterini R,* Monici M,° Fusi F,° Basile V,°Rigacci l,* Nassi L,* Capaccioli G,* Bosi A**UO Ematologia, Azienda Universitaria OspedalieraCareggi, Firenze; °Centro di Eccellenza Optronica,Università degli Studi di Firenze, ItalyNormal and pathologic cells and tissues containmolecules (fluorophores) capable of emitting fluorescentlight under an ultraviolet exciting irradiation.The main fluorophores are aromatic aminoacids,flavins, lipopigments and reduced pyridine nucleotides.This phenomenon, called autofluorescence,could be studied with a Microspectrofluorometry anda Multispectral Imaging Autofluorescence Microscopy(MIAM) technique: we used this tecnique toanalyse tissue sections obtained from lymph nodebiopsies performed for diagnostic purpose in patientswith enlarged lymph nodes. We analyzed ten lymphhaematologica vol. 89[suppl. n. 6]:september 2004

190Postersnode biopsies, three from patients with follicularreactive hyperplasia, seven from patients with neoplasticdiseases (Hodgkin's disease (four) and solidmalignancy (three); we also analysed a normal lymphnode. Specimens were cryo-preserved and sections3-4 micron thick were obtained and mounted onslides with distilled water. Cover glasses were put onthe sections and MIAM analysis was carried outimmediately to avoid tissue oxidation, which couldcause signal changes. MIAM was performed with anapparatus constituted of an inverted epifluorescencemicroscope and a digital cooled camera. Monochromaticimages were combined to form a single redgreen-blue(RGB) colour image. Blue fluorescenceemission originates from collagen, elastin and nicotinamideadenine dinucleotide phosphate; green fluorescenceoriginates from flavins. Red fluorescenceoriginates from lipopigments, whose tissue accumulationis due to aging and stress. Sections were alsomorphologically (ematoxilin and eosin stain) andimmunohistochemically evaluated to compare theautofluorescence images. RESULTS: The fluorescencepattern of reactive hyperplastic nodes showed thetypical lymph node organization, with low emittinglymphatic follicles separated by strongly fluorescentconnective trabeculae (mainly composed by collagenand elastin). In Hodgkin's disease the fluorescenceimaging showed a loss of the normal lymph nodearchitecture, with intense fluorescent cells oftenclustered in small groups. The comparison withimmunostained sequential sections suggests thatthese highly fluorescent cells could correspond to theReed- Sternberg's cells. Fluorescence imaging ofbiopsies from patients affected from metastatic gastrointestinalcarcinoma showed peculiar alterations:in a sample we observed tubular shaped structures.Autofluorescence images obtained from cryo-preservedbiopsies with MIAM analysis permitted to distinguishmorphological differences among neoplasticand non-neoplastic tissues, without a chemicalmanipulation of samples. It also offered a satisfactorycomparison with standard (morphological andimmunohistochemical) microscopy. This could be thebackground for further applications of this technique,like the development of probes for non-invasive evaluationof superficial lymph nodes and for laparoscopicand mediastinal evaluation of deep, mediastinaland abdominal lymph node.PO-209SYNCHRONOUS DIAGNOSIS OF RELAPSING NON-HODGKIN’SLYMPHOMA AND CHRONIC MYELOMONOCYTIC LEUKEMIA INAN OLD MANImprota S, Quirino AA, Carola A, Gonnella F,Nitrato Izzo G, Russolillo S, Mastrullo LU. O. di Ematologia, P. O. “San Gennaro”, ASL Napoli1,Naples, ItalyA 77-year old man was admitted on march 2002with a history of fever, abdominal pain and vomiting.Laboratory values showed anemia (hemoglobin: 10,8g/dl), thrombocytopenia (14×10 9 /L platelets) and mildleukocytosis (14×10 9 /L leukocytes: 30% neutrophils,1% basophils, 30% lymphocytes, 49% abnormalmature monocytes). Physical examination showedliver and spleen enlargement and multiple lymphoadenomegaliesin all superficial sites. Bone marrowaspirate disclosed high cellularity, with monocyticmaturing cells accounting for 30% of nucleatecells, three-lineage dysplastic features and lymphocytepopulation within normal values. The flowcytometry immunophenotyping on myeloid populationwas positive for CD14, CD13, CD15, CD33,CD11b, CD11c, CD4, HLA-DR and negative for CD34;no evidence of clonal excess in lymphoid populationwas present. Caryotypic finding and molecular analysisdidn't show abnormalities. Bone marrow biopsyconfirmed the hyperplastic monocytosis withoutimmature precursors or pathological lymphoid infiltration,suggesting the diagnosis of CMML type 1according to WHO classification. CT scan revealedcervical, axillar, mediastinal, abdominal lymph nodeinvolvement and moderate hepatosplenomegaly.Node biopsy demonstrated a CD20 + clonal lymphocytepopulation, with the cytologic features of centroblasticcells, suggestive for diffuse large B cell lymphoma.Interestingly, a concomitant monocytoid populationwas also detected. Thereafter, the patientreceived 6 cycles of CHOP regimen every 28 days.Restaging of patient, performed with CT scan, bonemarrow aspiration and biopsy, showed a reduction ofsleen size and no evidence of node involvement. Bonemarrow examination showed persisting monocytosiswithout blast excess and displastic features. Asexpected, therapy against lymphoma did not showany efficacy on CMML but there was no progressionof desease. The patient was not furtherly treated forboth the old age and poor compliance. One year later,on September 2003, patient developed a diseaseprogression of both lymphoproliferative disorder andCMML as showed by physical examination, bone marrowbiopsy, TC scan and laboratory findings. Then hewas given combined treatment with Fludarabine (25mg/m 2 i. v. , day 1-3) and Mithoxantrone (8mg/m 2 i.v. , day 1) every 28 days for three cycles that werehaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004191completed on December 2003.After therapy heachieved a complete remission of the lymphoproliferativedisorder and a partial remission of CMML.Patient is presently alive and without treatment, incontinous complete remission for lymphoma but withall the features of chronic myelomonocitic leukemia,without transfusion requirement. Associationbetween lymphoma and CMML is rare. Only three arethe published cases until to-day. Two of them are T-lineage lymphomas, and the remaining a breast B-lymphoma. Coexisting untreated lymphoproliferativedisease and myelodisplasia has been reported ascasual in a serie of 1198 patients affected by myelodysplasias(Forlensa, Leukemia and Lymphoma 1996).Only in 5 diagnosed CMMLs concomitant lymphoidand myeloid disease was found. However, all lymphomaswere B cell low grade NHLs. This is, at ourknowledgment, the first report of a B cell high gradeNHL coexisting at diagnosis with CMML.PO-210ABERRANT SOMATIC HYPERMUTATION OF PROTO-ONCOGENESIN POST-TRANSPLANT LYMPHOPROLIFERATIVE DISORDERSCerri M, 1 Capello D, 1 Muti G, 2 Rambaldi A, 3 PaulliM, 4 Gloghini A, 5 Berra E, 1 Deambrogi C, 1 Rossi D, 1Vendramin C, 1 Morra E, 2 Pasqualucci L, 6 Carbone A, 5Gaidano G 11Hematology Unit, Department of Medical Sciences& IRCAD, Amedeo Avogadro University of EasternPiedmont, Novara; 2 Division of Hematology, OspedaleNiguarda Ca' Granda, Milan; 3 Division of Hematology,Ospedali Riuniti, Bergamo; 4 Department ofPathology, IRCCS Policlinico San Matteo/Universityof Pavia; 5 Division of Pathology, Centro di RiferimentoOncologico, Istituto Nazionale Tumori, IRCCS,Aviano, Italy; 6 Institute for Cancer Genetics, ColumbiaUniversity, New York, USAPost-transplant lymphoproliferative disorders (PTLD)are a heterogeneous group of lymphoproliferationsarising in solid organ transplant recipients recivingimmunosuppresive therapy. To date, only few molecularlesions of the cellular genome have been associatedto the pathogenesis of PTLD. It has been recentlyshown in diffuse large B-cell lymphoma (DLBCL) ofthe immunocompetent host and in HIV-non-Hodgkinlymphoma that aberrant somatic hypermutation(SHM) activity can affect multiple genetic loci, includingthe proto-oncogenes PAX-5, Rho/TTF, PIM-1 andc-MYC. Mutations involve 5' untranslated regions aswell as coding sequences, are independent of chromosomaltranslocations to the immunoglobulin (Ig)genes and display features and distribution typical ofIgV SHM, suggesting that this process is malfunctioningin lymphoma. The knowledge that PTLD derive fromGC-related B-cells that have been exposed to the SHMprocess prompted our analysis of aberrant somatichypermutation in PTLD. Twenty-five monoclonal B-cellPTLD classified into polymorphic PTLD (P-PTLD; n=5)and monomorphic lymphoma including DLBCL (n=18),and BL/BLL (n=2) formed the basis of our study. Mutationalanalysis was performed by amplification anddirect sequencing of a region spanning up to 1.5 Kbfrom the transcription start site and previously shownto harbor over 90% of the mutations. Mutations targetingat least one of the 4 proto-oncogenes werefound in 7/25 (28%) PTLD. All mutated cases were representedby DLBCL (7/18; 38.8%). One single case harboredmutations in more than one gene. PAX-5 wasmutated in 4/25 (16%) PTLD, c-MYC was mutated in3/25 (12%) PTLD, Rho/TTF was mutated in 1/25 ( 4%)PTLD, while PIM-1 was not mutated in any case. Mutationswere independent of EBV infection since aberranthypermutation occurred in 3/13 EBV positive PTLD and4/12 EBV negative PTLD. The mutation frequency ofeach gene in mutated cases ranged from 0.4 to 8.5×10 -3bp. Mutations were of somatic origin, as confirmedby analysis of normal DNA from the same patient inselected cases. Mutations were heterozygous andshared features of IgV SHM process. These included: i)the predominance of single base pair substitutions(n=29), with only one deletion; and ii) a preference fortransitions (n=16) over transvertions (n=13), with ahigher than expected transition/transvertion ratio(observed=1.23; expected=0.5). In the case of c-MYC,one mutation was located in the coding exons leadingto a Ile129Val aminoacid substitution affecting thetransactivation domain of the c-MYC protein and carryingpotential functional consequences. Based onnonparametric statistical analysis (Kruskal Wallis andMann-Whitney test with Bonferroni adjustment formultiple comparison), the frequency of aberrant hypermutationin PTLD/DLBCL did not differ from that ofAIDS-DLBCL but was lower than that reported in DLB-CL of immunocompetent hosts (p

192PostersPO-212ANALYSIS OF IGV GENES SUGGESTS THAT MOST POST-TRANS-PLANT LYMPHOPROLIFERATIVE DISORDERS DERIVE FROM B-CELLS THAT HAVE FAILED THE GERMINAL CENTRE REACTIONCerri M, 1 Muti G, 2 Oreste P, 2 Berra E, 1 Deambrogi C, 1Dotti G, 3 Rossi D, 1 Lucioni M, 1 Gloghini A, 4 CarboneA, 4 Morra E, 2 Paulli M, 5 Rambaldi A, 3 Gaidano G, 1Capello D 11Hematology Unit, Department of Medical Sciences,Amedeo Avogadro University of Eastern Piedmont,Novara; 2 Divisions of Hematology and of Pathology,Ospedale Niguarda Ca' Granda, Milan; 3 Division ofHematology, Ospedali Riuniti, Bergamo; 4 Division ofPathology, C. R. O. -I. N. T. , Aviano; 5 Institute ofPathology, University of Pavia, ItalyPosttransplant lymphoproliferative disorders (PTLD)represent a frequent source of morbidity and mortalityamong solid organ transplant recipients receivingimmunosuppression therapy. PTLD are generally of B-cell origin and comprise a histologic spectrum rangingfrom polyclonal hyperplasia to overt lymphoma.Based on WHO classification, PTLD are classified inearly reactive lesions, polymorphic PTLD (P-PTLD) andmonomorphic PTLD, comprising diffuse large B celllymphoma (DLBCL) and Burkitt/Burkitt-like lymphoma(BL/BLL). Although recent studies have elucidated thehistogenesis of PTLD, a detailed molecular analysis ofIgV heavy (H) and light (L) chain genes is currentlylacking. Here we investigated a panel of 54 monoclonalPTLD, including 16 P-PTLD, 35 DLBCL and 3BL/BLL for usage, mutation frequency and mutationpattern of clonal IgVH and IgVL rearrangements. Wedirectly sequenced a total of 58 IgVH and 57 IgVLrearrangements amplified from genomic DNA. A functionalIgVH rearrangement was identified in 47/54(87.0%) cases. Four cases yeilded only an out of frameIgVH rearrangement or a rearrangement renderednonfunctional by introduction of a stop codon due tosomatic hypermutation (crippling mutation). Threecases showed hybrid Ig VDJ rearrangements: two caseswith a V-V fusion rearrangement and one case witha J-J fusion rearrangement, suggesting a failedattempt of heavy chain receptor revision in germinalcentre (GC) reaction. Despite extensive investigationby multiple PCR strategies, a functional IgVLrearrangement was found in only 25/54 (46.3%) cases.Eleven out of 25 (44.0%) cases harbored IgV kapparearrangement and 12/25 (48.0%) cases harboredfunctional IgV lambda rearrangements. Two casesshowed the presence of both IgV kappa and IgV lambdafunctional rearrangements. Among PTLD carryingsolely nonfunctional IgVL rearrangements, 7/54(13.0%) cases showed a crippled rearrangement and11/54 (20.4%) cases harbored only an out of frameand/or inactivated IgV kappa gene. Inactivationoccurred by rearrangement involving the κ-deletingelement (KDE). In 11/54 (20.4%) cases, no IgVLrearrangement was identified. Overall, only 23/54(42.6%) PTLD displayed both a functional IgVH and afunctional IgVL rearrangement. Analysis of V, D and Jfamily usage in productive IgVH rearrangements didnot show any significant difference with respect tothe normal mature B-cell repertoire. Analysis ofsomatic hypermutation of IgV genes showed the presenceof somatically hypermutated IgVH and/or IgVLgenes in 45/54 PTLD (83.3%). Conversely, IgV rearrengementsof 9/54 (16.6%) PTLD were in germlineconfiguration, suggesting a derivation from B-cellsthat have not experienced the GC-reaction. Amongmutated cases, the average mutation frequency was8.83% (median 8.43%, range 2.10%-24.1%) for IgVHgenes and 7.37% (median 6.71%, range 2.30%-26.0%) in IgVL genes. Thirty-two cases (71.1%)showed highly mutated (mutation frequency >6%)IgVH and/or IgVL genes, a condition that, in normal B-cell, results in lower affinity for antigen and apoptosis.Analysis of the distribution of replacement andsilent mutations in functional IgVH and/or IgVLsequences showed tendency to conserve FR sequencesand maintain antigen binding in 20/34 (58.8%) cases.A higher than expected number of CDR replacementmutations, suggesting selection for high affinityantigen binding, occurred in 14/34 (41.2%) cases.Overall, our data suggest that most PTLD arise from B-cells that have experienced the GC-reaction and frequentlydisplay impaired B-cell receptors (BCR). Sincea functional receptor is required for the survival ofnormal B-cells during their transit throughout the GC,PTLD development seems frequently associated withrescue from apoptosis and expansion of B-cells thathave failed the GC-reaction. One mechanism mightinvolve EBV infection, with the expression of theoncoproteins LMP1 and/or LMP-2A that mimic thesignals normally generated by CD40 and BCR. Notably,virtually all PTLD with nonfunctional IgVH and/or IgVLrearrangement analyzed in this study, carried EBVinfection.PO-213HYPERMETHYLATION OF THE 5' CPG ISLAND OF THE FHIT(FRAGILE HISTIDINE TRIAD) GENE THROUGHOUT THE SPEC-TRUM OF B-CELL NEOPLASIA MALIGNANCIES AND AIDS-NHLDeambrogi C, 1 Capello D, 1 Rossi D, 1 Franceschetti S, 1Berra E, 1 Cerri M, 1 Vendramin C, 1 Gloghini A, 2Carbone A, 2 Gaidano G 11U. D. A. Ematologia, Dipartimento di Scienze Mediche& IRCAD, Università del Piemonte Orientale “A.Avogadro”, Novara; 2 Divisione di Anatomia Patologica,CRO, Aviano, Italyhaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004193DNA methylation of CpG sites in the promoterregions of genes is a frequent acquired epigeneticevent in the pathogenesis of many human cancers.This modification has important regulatory effectscausing loss of gene expression. To date, studies ofaberrant promoter methylation in B-cell lymphoidneoplasia have revealed the occurrence of epigeneticalterations of several genes with multiple functions.FHIT (Fragile Histidine Triad) is considered aputative tumor suppressor gene located at theaphidicolin FRA3B site of chromosome 3p14.2.TheFHIT gene encodes a triphosphate hydrolase that catalyzesthe hydrolysis of intracellular dinucleosidepolyphosphates and is involved in control of cellgrowth and apoptosis by modulating the intracellularconcentration of polyphosphates. Here we analyzed404 B-cell malignancies of the immunocompetenthost and 97 tumor samples of AIDS-related non-Hodgkin lymphoma (AIDS-NHL) by methylation-specificpolymerase chain reaction (MSP) of the FHITgene. Among precursor B-cell neoplasms, FHIT hypermethylationoccurred in 6/21 (28.6%) acute lymphoblasticleukemias (ALL). Among indolent lymphoproliferativedisorders, FHIT hypermethylation wasrestricted to 14/97 (14.4%) B-cell chronic lymphocyticleukemia (B-CLL), 1/11 (9.1%) marginal zonelymphoma (MZL), 3/10 (30.0%) MALT lymphoma,2/18 (11.1%) follicular lymphoma (FL), 1/6 (16.7%)hairy cell leukemia (HCL), and 2/16 (12.5%) lymphoplasmocytoidlymphoma (LPL). Among aggressive B-cell lymphomas, FHIT hypermethylation occurred in18/135 (13.3%) diffuse large B-cell lymphomas (DLB-CL), and in 8/40 (20.0%) Burkitt's lymphomas; in particular,among DLBCL, only few sub-groups wereinterested by this aberrant mechanism, including 12/73 (16.4%) systemic nodal B-DLCL, 2/5 (40%)CD30+ anaplastic B-DLCL, 1/7 (14.3%) CD5 + B-DLCL,and 3/16 (18.8%) primary central nervous systemlymphomas (PCNSL). Primary mediastinal DLBCL(n=9), primary splenic DLBCL (n=6), and DLBCL transformedfrom FL (n=9) or MALT-NHL (n=9) showed noFHIT hypermethylation. Also, FHIT hypermethylationwas absent in primary effusion lymphoma (PEL) (0/4),and in mantle cell lymphoma (0/18). Finally, FHIThypermethylation occurred in a fraction of multiplemyeloma (MM) (6/28; 21.4%). With respect to AIDSrelatednon Hodgkin's lymphomas (AIDS-NHL), thatrate of FHIT hypermethylation rate was similar in allthe categories analyzed. In particular, FHIT hypermethylationoccurred in 7/48 (14.6%) AIDS-DLBCL, 5/27(18.5%) AIDS-BL, and 1/15 (6.7%) AIDS-PEL. No FHIThypermethylation was detected in AIDS-BLL (Burkitt'slike lymphoma; 0/7). Overall, these data indicatethat inactivation of FHIT gene by aberrant hypermetylationmay have a role in the pathogenesis of afraction of B-cell neoplasms of immunocompetentand HIV-infected patients.haematologica vol. 89[suppl. n. 6]:september 2004

194Postershaematologica vol. 89[suppl. n. 6]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004Iindex of authorsname, pageAbbondandolo A 169Abbondio C 163Abbruzzese L 187Abruzzese E 81Actis Dato GM 25Adamo F 100Agnelli l 60, 107, 109Agostini P 42Agueli C 66Albano F 40, 45, 72Alberti D 49, 131Albiero E 63, 137Alcalay M 4Ales M 115Alessandrini I 100Alessandrino EP 160Alfinito F 88, 102Alimena G 132Alinari L 149Allemand E 126Aloe Spiriti MA 67Alterini R 189Altomonte M 173Aluigi M 100, 152Alvarez Decelis I 179Amabile M 12, 39, 46, 49, 59, 89, 104, 125, 131, 132, 136,146Amadori S 43, 64, 67, 69, 81, 110, 115, 148, 155, 164Ambrosetti A 171Amoruso F 178Amurri B 79, 157Andreazzoli F 119, 122, 147Andreeff M 67Andreola G 188Andreone P 162Andretta C 54Anelli L 40, 45, 72Angela P 146Angelini I 141Angelucci E 31, 100, 146Anghel G 135, 155Angioni A 15Annunziata M 111Annunziato F 164Anselmi E 175Antonioli E 45Arcaini L 53, 54, 175Arcamone M 137Arcangeli E 96Arcari A 175Arcese WG 115Argiolu F 160Arosio P 32Arpinati M 24, 34, 145, 146Arrigoni G 171Arruga F 21, 41, 47, 48, 52, 62, 84Ascani S 132Ascoli V 169, 178, 183Asemeria A 51Astolfi A 99Astolfi M 52, 56, 170Attolico I 112, 140Aventin A 15Aversa F 7, 149Azzarà A 122, 124Baccarani M 12, 19, 24, 25, 34, 46, 49, 53, 59, 89, 100, 104,109, 120, 121, 125, 131, 132, 136, 145, 146, 149, 152,162Baccarani U 162Baccega M 25Bacchetta R 9Bacigalupo A 119Badiali M 160Baldini l 60, 107, 117Balducci D 31Balducci F 32Balestri F 45Ballanti S 98Balleari E 88, 112, 118Ballerini F 77, 98, 141Ballerini PF 132Ballestrero A 148Balocco M 16Bandini G 34, 145, 146Baraban D 21, 47Baraté C 176Barbetti V 28, 93Barbieri E 95, 99Barbon F 103Barbui AM 36, 145Barbui T 31, 53Bardi A 42, 72, 83Baronciani L 29, 30, 127Barosi G 130Barozzi O 129Barozzi P 129, 144, 173Bartiromo M 39Basile V 189Bassi S 12, 49, 131, 136Battaglia E 128Battaglia M 9Battistelli M 36Bazzan M 52Beacci D 40, 133Becchimanzi C 88Beggiato E 60Beghini A 62Bellesi S 108Beltrami G 83, 108, 112, 118, 148, 154Benatti C 32, 82Benedetti E 119, 147Benedetti F 146Benedetti R 58Benevolo G 128, 170Benvenuti M 134Beretta M 30, 127Bergamaschi G 97Bergamaschi P 157Bergonzi C 169Bergui L 37, 52Bernacchi M 126Bernardi M 162Bernasconi C 132haematologica vol. 89[suppl. n. 9]:september 2004

IIVIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004Bernasconi P 54, 81, 85, 90, 134, 138, 139, 167Bernuzzi P 175Berra E 22, 165, 170, 177, 191, 192Berretta M 187Bertieri R 132Bertola A 56, 60Bertolini F 24, 25, 188Biagi E 39Bianchi E 19, 20, 89Bianchi L 45, 46Bicciato S 60, 109Bilhou Nabera C 15Binotto G 103Biondi A 23, 44, 92, 93Biragyn A 185Biscardi M 45Blasi F 28Boccadoro M 25, 36, 37, 52, 56, 60, 71, 113, 118, 170Bocchia M 132Bodenizza C 83, 88, 112, 118Boffoli D 101Bogani C 45Boggi S 97Bohlander S 40Bolognesi A 144, 182Bonamino M 23, 44, 93Bonanni L 103Bonanno G 26Bonati A 21, 92, 115Bonello L 168Bonferroni M 71Bonfichi M 54, 142, 160Boni M 85, 90, 134, 138, 167Bonifazi F 34, 49, 145, 146, 149Bonifazi R 25Bono D 37Bonomini S 105, 115, 179Borlenghi E 129Borleri G 36, 145Bortolin MT 187Bosari S 80Bosco R 144Bosi A 45, 46, 94, 134, 164, 189Bosi C 46, 132Brambilla D 20Brasca P 62, 68Bregni M 119, 166Brenner M 39Bringhen S 60Brugnolo F 164Brunetti G 116Brunetti M 60Bruno A 164Bruno B 60Bruno G 74, 130Brusa G 47, 95, 96, 99Brusamolino E 54, 160Bruzzone R 77, 98, 141Bucalossi A 181Bucciarelli P 127Buccisano F 69, 81, 110, 115, 164Buda G 102, 124Buffolino S 183Bugli AM 83Bulgarelli S 45Burchielli E 18, 149Buscemi L 158Cabrelle A 103Cairoli R 62, 68Calabrese L 188Calabrò A 47, 95, 96Calabrò L 122, 173Calabrò ML 178, 183Calafiore AM 25Calatroni S 54, 85, 90, 134, 138, 167Caldera D 160Califano C 63Caligaris-Cappio FM 166Calistri E 74, 156Callea V 60, 107, 119, 175Calonghi N 96Camaschella C 1Camera A 75Cammarata G 66, 74Cammelli S 95, 99Campa E 71Campana S 71Campanelli R 130Campiotti L 140, 186Campogrande M 1Canciani MT 29, 30, 125, 127Candoni A 74, 85, 156Canepa L 77, 98, 141Canepa P 77, 98, 141Cangini D 59, 104, 109Cannella L 8Cannella S 66Cantonetti M 115Cantoni S 176Caocci G 158Capaccioli G 189Capalbo S 116Capanni M 7Capella S 41, 48Capelli D 158Capello D 22, 165, 170, 171, 177, 178, 191, 192Capitanio N 101Capitelli M 188Capobianchi A 148Caporali R 17Cappelletti P 138Capria S 161Capucci MA 129Caracciolo D 36, 37, 52Caracciolo F 147, 178Caramatti C 179Caravita T 110, 118, 155Carbone A 22, 169, 170, 177, 191, 192Carboni V 178Carcassi C 158Careddu A 67Carella AM 83, 88, 108, 112, 148, 154Carella AM Jr 108, 112Carella C 151Carella M 118Caresana M 85, 90, 138, 167Carlo-Stella C 5, 36, 59, 172Carluccio P 71Carola A 69, 190Carotti A 149Carrabba M 38, 59, 166, 176Carrai V 189Carrieri G 188Carriero MV 28Carturan S 21, 47, 48, 52, 62, 84haematologica vol. 89[suppl. n. 9]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004IIICarulli G 122, 124Casà A 153Casanova M 71Cascavilla N 83, 108, 112, 118, 154, 162Cascio L 66Cassetti A 23, 93Castagnetti F 12, 131, 136Castaldo M 125Castella B 113, 118Castellani S 57, 166Castelli I 50, 51Castellino C 52Castoldi G 42, 72, 83Casula P 31Catalano L 112Catani L 3, 19, 125, 162Catapano O 179Cavallaro AM 153Cavallo F 60Cavanna L 175Cavazzini F 42, 72Cavigliano PM 85, 90, 138, 139, 167Cavo M 59, 104, 109, 120Cazzaniga G 23, 92, 93Cazzola M 132Cecconi N 178, 183Cedrone M 15Cellini C 59, 104, 109, 120Centra M 162Cerciello G 151Cerneca F 130Cerno M 150Cerretti R 115Cerri M 22, 52, 165, 170, 177, 191, 192Cerri S 173Cerruti G 33Cervetti G 102, 178, 183Chiaretti S 76Chiarle R 56, 168Chierichini A 15Chimenti M 122Chiodino C 51Chiodoni C 100Chirumbolo G 24, 34, 145Chism D 67Chiurazzi F 168Chiusolo P 108, 143Ciabatti E 119, 147Ciancia G 54Ciancia R 39Ciapanna D 70, 176Ciccone M 42, 72, 83Ciceri G 116Cilloni D 11, 12, 21, 41, 47, 48, 49, 52, 62, 84, 132, 136,138, 141Cimino G 67, 75, 183Ciolli S 164Cioni G 188Ciotti M 148Cirulli T 56, 106, 110Cittera E 17Ciuffreda L 71Clavio M 77, 98, 141, 163, 166Cleris L 59, 172Codari R 140, 186Colacci AM 51Colaianni G 116Colao A 151Colizzi F 173Colla S 104, 105, 106, 115Colli Vignarelli M 107Colombo M 127Colombo MP 100Colombo N 77, 98, 141Colucci S 116Comincini S 82Comoli P 35, 120Compagno M 36, 52, 56, 170Conconi A 128, 169, 170Consalvo MI 69Consensi E 136Console G 147, 184Conte R 125, 149Contemi AM 26Copia C 111Coppola R 30, 125Corazzelli G 179Corradi B 92Corradini P 38, 59, 119, 166, 176Corsetti MT 108, 148Corsini C 188Corso A 114Cortelazzo S 169Cortelezzi A 80Coscia M 113, 118, 185Cosmi L 164Costanzo A 92Costanzo C 187Cottone M 153Cox C 43Cozzi G 29, 30, 125, 127Cozzi P 70Craviotto L 179Cremonesi L 1Crescenzi B 40, 90, 98, 133Cross N 132Cruciani G 155Crugnola M 106Cudillo L 69, 148Culacciati D 123, 124Culurgioni F 31, 100Cuneo A 42, 72, 75, 83Curci P 184Curotti M 51Curti A 100, 120, 121, 125, 149, 152Cuttica A 37Cuzzola M 147Dallagiovanna S 125D'Alò F 65, 174, 175Dama E 37Damiani D 74, 150, 156D'Amico G 44Dammacco F 56, 106, 110D'Arco AM 63D'Arena G 118D'Emilio A 137d'Onofrio G 143Danesin C 132Dardano A 128Daudt L 35Dazzi F 8Deambrogi C 22, 165, 170, 177, 191, 192De Amici M 114De Angelis B 54, 137De Angelis G 115haematologica vol. 89[suppl. n. 9]:september 2004

IVVIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004De Biase E 132De Cave F 78, 79De Chiara A 179De Fabritiis P 69, 110, 119, 148, 155De Fanis U 168De Filippi F 127De Filippi I 21, 47Defilippi I 41, 48, 52, 62, 84de Francesco F 126De Francesco R 184de Laurenzi F 115Del Fante C 157, 160Della Casa C 36, 71Della Porta MG 81, 83, 142Della Starza I 53Dell'Aquila M 52, 56, 170Del Poeta G 43, 64, 69, 81, 164Del Principe I 43, 64Del Principe MI 69, 81, 164Del Vecchio I 82Dell'Isola S 183Dell'Aversano M 181Dell'Olio M 83, 112, 118Dell'Oro S 171Dello Iacono N 162Dello Sbarba P 28, 93De Lucia D 126De Marco F 36, 52, 170De Matteis S 143De Paoli P 187De Propriis MS 161De Renzo A 54, 186De Ritis DG 26De Rosa G 151De Simone M 63De Stefano V 108De Totero D 163De Tuglie G 122De Vita S 143De Vivo A 12, 46, 49, 59, 132, 136Dentamaro T 148Dessanti Ml 161Di Bartolomeo P 119Di Febo A 174, 175Di Francia R 179, 185Di Gaetano N 17Di Gennaro G 187Di Giacomo V 68Di Maira G 103Di Marco R 114Di Mario A 108Di Nicola M 59, 172Di Pietro G 56, 106, 110Di Raimondo F 74, 114Di Ruscio A 64, 65, 174, 175Di Virgilio F 24, 25Diverio D 15, 67, 91, 135, 161Dodero A 38, 166, 176Dono M 33Doretto P 138Dorigo A 136Dotti G 192Drandi D 52, 56, 170Elice F 62Ennas MG 31, 100Ermacora A 138Esposito P 102Fabbiano F 66, 72, 74Fabbri A 181Fabbri LM 173Fabiano F 128, 133Fabris F 116, 126Fabris S 60, 107, 109, 117Facchetti F 129Faccia S 115Fagioli ME 19, 125Falanga A 31Falcioni S 145, 146Falco C 111Falco P 56, 60Falcone A 83, 88, 112, 118Falini B 58Falzetti F 110Fania G 162Fanin R 74, 85, 132, 146, 150, 156, 159Farese O 149Farina G 108, 143Farina L 166, 176Farinelli G 95Farini V 144, 182Fattori P 132Fava M 41, 48, 52, 84, 98, 131Fazi F 91Fazio G 23, 93Fazzi R 102, 119, 122, 147, 178, 183Fe A 112Federici AB 29, 30, 125, 127Femia FF 183Fenu S 67Ferrara F 63, 111, 132Ferrarese F 171Ferrari A 1, 188Ferrari D 24, 25Ferrari M 1Ferrari S 19, 27, 46, 89Ferrari SE 19, 20Ferraro AL 139Ferreri AJM 171Ferrero D 36, 37, 71Ferretti E 114Ferretti L 82Ferri E 120, 152Ferrini S 163Ferro F 60Ficara F 52Figuera A 68Figuera AS 76Filardi N 112, 140Filì L 164Finolezzi E 67Fiore F 113, 118Fiori R 115Fiorini A 108Fiorini R 20, 67Florena AM 180Floriddia G 183Floridia PM 68, 76Floris R 158Foa R 53, 76, 161Foà R 15, 41, 75, 78, 79, 135, 165Fogli M 19, 20, 24, 25, 89, 152, 162Foglieni B 1Foglietta M 113, 118Foli C 71Fonsatti E 173haematologica vol. 89[suppl. n. 9]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004VFontana G 144Fontana M 51, 188Foppoli M 133, 171Forconi F 181, 187Formelli F 59, 172Fracchiolla NS 80Franceschetti S 22, 128, 170, 177, 192Franceschini l 115Francese R 36, 52, 56Franchi A 164Francia Di Celle P 168Franco V 180Franzoni F 183Frassoni F 132Fraulini C 83Frenguelli F 58Frigeri F 179, 185Fugazza G 77, 98, 141Furlanello C 51Fusi F 189Gabriel Arana M 119Gaidano G 22, 52, 165, 169, 170, 171, 177, 187, 191, 192Gaiotti G 168Gaitani S 46, 132Galbiati S 1Galetta F 183Galieni P 132Galili N 85Galimberti S 102, 119, 122, 147, 178Gallamini A 52Gallì A 97Gallo E 184Gambacorti Passerini C 92Gambini D 1Gargantini L 54, 176Gargiulo L 33, 86Garrone A 77Gasparetto C 123, 124Gattei V 173, 187Gaudio F 184Gavarotti P 37Gelmetti V 67, 91Gemelli C 27Gentile G 148Gentile R 169Gentleman R 76Geromin A 150, 156Gervasi F 139Gherlinzoni F 132Ghia P 166Ghimenti M 124Ghio R 88Giachino C 107Giambanco C 139Giannakakis K 178, 183Gianni AM 5, 59, 172, 176Giannì L 115Gianniello F 29Giannini B 49, 59, 131, 136Giannini MB 34, 146Giannoccaro M 71Gianoullia P 34Giardini I 85, 90, 138, 167Giaretta I 63, 137Gilestro M 60Gini G 32, 158Giordano A 184Giorgetti S 17Giorgi M 25Giovanardi F 179Girino M 138Giudice V 149Giugliano E 40, 42, 72, 141Giuliani N 104, 105, 106, 115, 135Giulino C 128Giuntoli S 28, 93Giuseppe V 132Giustolisi GM 158Giustolisi R 114Glennie S 8Gloghini A 22, 169, 177, 191, 192Gobbi M 16, 77, 98, 132, 141, 163, 166Golay J 17, 54Gomes V 135Gonella R 148Gonnella F 69, 190Gorello P 90Gottardi E 21, 41, 47, 48, 49, 52, 62, 84, 98, 132, 136, 141Gozzini A 28, 93, 94, 134Grafone T 12, 46, 49, 59, 104, 131, 132Gramenzi A 162Grande A 27Grandi AM 140, 186Grano M 116Grasso M 71Grasso R 77, 98, 141Grazi Gl 162Graziano D 111Greco G 45Greco M 108, 112, 118Greco MM 83, 154Gregori S 9Gregorj C 78, 79Grignani F 20Grillo G 62, 68Grillo S 84Gritti D 123, 124Grossi A 45, 88Grosso M 102Guarini A 161, 165, 184Guercini N 137Guerneri S 117Guerrasio A 47Guerriero A 137Guerrini F 119Guglielmelli P 45, 46Guglielmelli T 112, 118Gugliotta L 19, 45, 132Guidi F 65, 174, 175Guillermo-Lopez A 169Gulletta E 128Gumiero D 64, 65Gurdo G 133Hafen K 18Hagemeijer A 15, 42Hattinger C 99Hellström-Lindberg E 32Hernandez J 72Hohaus S 65, 174, 175Hojden M 105, 115Hojden M, 105Holländer G 18Iaccarino G 179, 185haematologica vol. 89[suppl. n. 9]:september 2004

VIVIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004Iacobucci I 136Iacona I 54Iacopino P 119, 147, 178, 184Iannitto E 180Ichinohasama R 169Improta S 69, 190Indovina A 153Intini D 60, 107, 116Introna M 17, 36, 54, 145Invernizzi R 32, 81, 82, 138Iqbal Z 94, 97Irno Consalvo M 81, 164Isidori A 100, 120, 121, 149, 152Iuliano F 128, 133Izzo B 12, 39, 49, 75, 131, 136, 137Izzo P 102Kaldjian E 67Klersy C 85, 90Konopleva M 67Krampera M 41Kunicki TJ 29Kwak LA 185Ladetto M 25, 36, 37, 52, 56, 170Lai V 125Lalvani A 173La Nasa G 158La Rosa M 74Larizza L 62Larocca LM 22La Sala A 83, 88, 112, 118La Starza R 15, 40, 90, 98, 133Lastraioli S 33Laszlo D 188Laurenti L 108, 143Lauria F 53, 132, 181, 187Lavazza C 59, 172Laylor R 8Lazzaretti M 106Lazzarino M 54, 62, 81, 85, 90, 97, 114, 134, 136, 138,142, 160, 167, 175Lazzaro A 175Lemma T 78, 79Lemoli RM 19, 20, 24, 25, 89, 100, 120, 121, 125, 149, 152,162Leo M 71Leoncini L 187Leone G 26, 64, 65, 108, 143, 174, 175Leoni P 32, 132, 158Levato L 128Levi S 32Levine A 169Levrero M 92Li C 76Li X 76Liberati AM 60Liberati M 132Li Gioi F 68, 76Liotta F 164Lisak L 85Lisini D 35Liso A 45, 58, 71, 72, 116Liso V 40, 45, 71, 72, 116, 184Lo Coco F 15, 21, 67, 69, 72, 81, 91Lo Verso R 139Locasciulli A 119, 155, 166Locatelli F 35, 158Logan J 165Loggi E 162Lojacono A 1Lombardi G 151Lombardi L 57, 60, 107, 109, 116, 117Lombardini L 46Longo G 45, 68Longoni P 36, 59, 172Lorenzini S 162Losi M 173Luatti S 131, 136Lucania A 137Lucesole M 158Luchesini C 70Luciano F 164Luciano L 39, 133, 137Lucioni M 192Lucivero G 168Lunghi M 62, 81, 114Lunghi P 21, 92, 115Luppi F 173Luppi M 50, 129, 144, 169, 173, 188Luzi G 135Luzzatto G 126Luzzatto L 33, 86Maccario R 35Maccherani C 20Maciejewski JP 87Madeo D 63, 137Maffei R 50, 51Maggi A 157Maggi E 164Magnani C 37Magni M 172, 176Magro D 72Maio M 173Maiolo AT 57, 60, 80, 107, 109, 117Majolino I 119, 132, 155Malabarba L 97, 134, 136, 142Malagola M 46, 132Malcovati L 81, 142Malinverni R 123, 124Malinverno A 123, 124Mancini C 106Mancini M 40, 47, 67, 72, 76, 95, 96Mancini S 141Mancini V 70Mancusi A 7, 35Mancuso S 26Mandelli F 67, 75, 161Manetti C 178Manfredini R 19, 20, 46, 89Manganini M 54Mangiacavalli S 114Mangoni L 179Mannella A 133Mannelli F 46Mannucci PM 30, 127Mansueto G 64, 65, 174, 175Mantoan B 52, 56, 170Mantuano S 83, 112, 118Manuelli C 164Marasca R 50, 51, 175Marbello L 70, 176Marcacci G 185Marchese L 17Marchesi C 140, 186haematologica vol. 89[suppl. n. 9]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004VIIMarchetti M 31, 130Marella O 125Marelli S 57Marenco P 68Marfia A 66Mari D 30Mariani G 15Mariani S 113, 118Mariano Rocchi M 116Marin L 156Marin V 44Marini R 164Marino M 177Marinone C 52Mariotti A 26Mariotti J 176Marongiu MF 160Marra N 168Marseglia C 142, 160Martelli MF 7, 15, 35, 40, 90, 98, 133Martelli V 34, 145Martinelli G 12, 19, 39, 46, 49, 59, 75, 89, 104, 131, 132,136, 138, 146, 188Martinelli S 50, 51Martini A 15Martino L 112Martino M 119, 147, 178Martino P 148Marynen P 15, 133Marzo C 126Masala S 115Masera G 92Masia MC 32Masolini P 74Massa M 130Massaia M 113, 118, 120Massaro AM 16, 86, 150Massini G 64, 174, 175Massone S 169Mastroianni CM 183Mastrullo L 69, 190Matarese G 151Matteucci C 133Mattii L 102Mattioli M 60, 107, 109Maurillo L 43, 64, 69, 81, 132, 164Mauro E 83Mauro FR 165Mazza P 79, 152, 157Mazzola F 78, 79Mazzone C 43, 64, 69, 81, 164Mazzucato M 187McQueen K 35McQueen T 67Mecucci C 15, 40, 72, 75, 76, 90, 98, 132, 133Mele G 63, 179Meli V 130Melillo L 83, 112, 118Meloni L 161Meoni G 164Merante S 132, 134Merchionne F 110Merlini G 17, 107Messa E 21, 41, 47, 48, 52, 62, 84Messa F 21, 41, 47, 48, 52, 62, 84Messana F 74Mestice A 71Michaux L 42Michelis G 166Michelutti A 74Michelutti T 74Michieli M 187Micò C 36, 145Miglino M 77, 98, 141, 166Milanesi M 38, 59, 172Milani R 38, 59, 166, 176Milella M 67, 78Mineo G 68Minervini MM 154Mingari C 163Minucci S 67Mirabile M 148Mirto S 66, 74Mistretta C 29, 125, 127Molfese V 140Monici M 189Monitillo L 170Monn K 92Montagna D 35Montagnoli C 147Montalbano L 153Montaldi AM 137Montanari F 54Montanari M 27Montanaro M 135, 155Montanaro M, 110Montecucco C 17Montefusco V 38, 176Montillo L 56Montillo M 68, 176Montini E 35Montuori N 28Morabito F 60, 107, 119, 147, 178Morandi F 104, 105, 106, 115Morandi S 132Moranti E 51Morelli E 102Moretta A 35Mori G 116Moroni B 30, 125Moroni C 175Morotti A 11, 21, 41, 47, 48, 62, 84Morra E 53, 54, 62, 68, 70, 136, 176, 191, 192Morrone F 60Morselli M 51, 144, 173Motta MR 149Mozzana R 72Muccioli Casadei G 39Mumtaz M 85Muraro M 113, 118Musso M 119Musto P 83, 88, 108, 112, 118, 132, 162Muti G 176, 191, 192Nadal E 8Nadali G 62Nanni P 173Nano R 82Napolitano M 126, 185Nappi A 112Narni F 119Nassi L 189Nasuti A 179, 185Natale ME 178, 183Nati S 108, 148Navazza V 17, 107haematologica vol. 89[suppl. n. 9]:september 2004

VIIIVIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004Nebuloni M 17Neelapu S 185Negrini S 16, 86, 150Neri A 57, 60, 107, 109, 116, 117Neri B 43, 64, 81Nervi C 12, 20, 67, 91Nichelatti M 62Nicoletti F 114Nicolini B 24Niscola P 110, 118, 135, 155Nitrato Izzo G 69, 190Nobile F 119, 178Nobile M 83, 112, 118Nobili l 60, 107, 117Noguera N 21, 67Nosari AM 68, 70, 176Notaro R 33, 86Novella E 63, 137Nozzoli C 133Nuschak B 113, 118Olivieri A 32, 119, 158, 166Omedè P 25, 56, 60Oreste P 192Orlandi E 54, 134, 167Orvieto E 171Otsuki T 116Ottaggio L 169Ottaviani E 12, 49, 59, 104, 131, 132Ottaviani L 43, 64, 110Ottaviani M 138Pacini R 58Pacini S 102Pagano M 66, 168Pagliano G 56, 170Pagliano M 1Pagnucco G 139Palandri F 34, 146Palazzo G 79, 152, 157Palestro G 168Palladini G 17, 107Palladino M 108Palmi C 23, 93Palmieri S 63Palombi F 135Palumbo A 56, 60Palumbo G 74Palumbo GA 114Palummo N 187Pancrazzi A 45, 46Pandolfi S 100, 121, 152Pane F 12, 39, 49, 54, 75, 87, 131, 132, 136, 137Panetta P 43Pannunzio A 45Pantaleoni F 113, 118Paoletti F 46Paoloni F 78Papa V 102Papineschi F 119Parham P 35Parigi S 181Parisi D 96Parlotti E 53Parronchi P 164Pascale S 91Pascutto C 81, 136, 142Pasini F 171Pasqualucci L 191Pasquini L 15Pasquini R 32Passamonti F 97, 136, 142Pastore D 45, 71Pastorelli R 94, 134Patriarca F 150, 159Patrone F 148Paulli M 170, 191, 192Pautasso M 21, 41, 47, 48Pavan S 47Pavone V 184Peake IR 29Peccatori F 188Pecci A 130Pedicelli I 126Pelicci PG 21, 67, 91Pellegrini C 80Pelosi E 15, 122Pennisi A 114Peola S 113, 118Perbellini O 41Perfetti V 17, 107Perla G 154Perna F 54Perotti C 157, 160Perrino G 54Perrone G 24, 34, 109, 145Perrone T 184Perruccio K 18, 35, 147, 149Persico E 186Persico M 54, 186Peschle C 15, 122Peta A 128, 133Petrella N 129Petrini M 102, 119, 122, 124, 147, 178, 183Petrò D 179Petrucci E 122Petrucci MT 60, 78, 79Petruzzelli R 102Petti MC 67Pettinato G 54Pezzani l 173Pezzetti L 62Piattoni S 98Piazza F 103Piazza R 92Picardi A 69, 148, 155Picardi M 54, 75, 186Piccaluga PP 46, 132Piccioni D 164Piccirillo N 143Piccoli C 101Picone C 136Pierelli L 26Pierini V 15Pierri I 16, 77, 98, 141Pietra D 97, 142Pietra G 163Pietrantuono G 71Pietrini P 124Pilatrino C 47Pileri S 132Pileri SA 170Pillai R 160Pini M 141Pinna AD 162Pinna LA 103haematologica vol. 89[suppl. n. 9]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004IXPinto A 179, 185Piras E 158Pirrotta MT 181Pisapia G 79Pizzirani C 24, 25Pizzolo G 41, 62, 146Pizzuti M 112, 140Plasilova M 87Pocali B 111Poerio A 12, 46, 49, 59, 104, 131, 132Poggi A 16, 86, 150, 166Poli M 19Polito L 144, 182Pollio B 170Poloni A 32, 158Ponzoni M 171Postorino M 115Potenza L 144, 173Preda P 125Pricolo G 79, 157Pricolo GC 152Procoli A 26Prosdocimo S 150Provencio M 169Provenzano R 30Prudenzano A 79, 152, 157Pulsoni A 53Pungolino E 136Putzulu R 108Puzone S 102Quagliarini A 32Quarna J 85, 90, 138, 167Quarta G 72Quintarelli C 39, 75, 137Quirino A 69Quirino AA 190Qureshi JA 94, 97Rabascio C 188Racanicchi S 20Ragno P 28Ramajoli I 130Ramasamy R 8Rambaldi A 36, 53, 54, 145, 166, 191, 192Randi ML 126Raphael M 169Rasini V 144Raspadori D 187Ravazzini L 129, 144Ravelli E 70Raza A 85Re A 129, 169Re R 158Reali C 160Reddiconto G 108, 143Regazzi M 54Rege Cambrin G 49, 72, 136Rege-Cambrin G 42, 47, 141Regoli F 183Remotti D 155Reni M 171Renzulli M 12, 59, 104, 131Restagno G 1Reverberi D 33Ria R 56, 101, 106, 110Ribatti D 56Ribera S 176Ricca I 36, 37, 52, 56, 71, 170Riccardi M 119Ricci F 68, 70, 125, 176Ricci P 19, 28, 46, 132, 151Ricciardi MR 67Riccioni R 15, 122Ricciuti F 112, 140Ricevuti G 123, 124Richeldi L 173Richetta G, 178Rigacci L 53, 189Rigolin GM 83Ripamonti C 68Risitano AM 87Ristaldi MS 160Ritz J 76Riva G 144, 173Rizzi R 116Rizzi S 149Rizzo A 153Rizzo C 133Rizzo E 38, 166, 176Rizzo V 66Rizzoli V 104, 105, 106, 115, 179Rocca B 85, 90, 134, 138, 167Roccaro AM 106Rocchi M 40, 45, 72Rocci A 36, 52, 170Rodeghiero F 62, 63, 137Romagnani S 164Romani L 147Romano A 72Romano C 168Romoli S 40, 90Roncarolo MG 9Ronchetti D 57, 107Rondelli D 24, 34, 145Rondoni M 46, 132Rosati R 90Ross C 123Rossi A 178, 183Rossi D 22, 128, 165, 169, 170, 171, 177, 187, 191, 192Rossi E 108Rossi G 28, 129Rossi L 24, 25, 89, 152Rossini A 15, 122Rosti G 12, 46, 49, 131, 132, 136, 146Rosti GA 39Rosti V 130Roti G 98Rotoli B 28, 54, 75, 87, 88, 137, 151, 168, 186Rovida E 28, 93Rovito M 125, 149Ruffini P 185Ruggeri L 7, 18, 35, 147Ruggeri M 60Ruggiero G 88Rumi E 97, 136, 142Rumi MG 127Rupolo M 53, 187Rusconi C 114Russo D 132Russo F 56, 106, 110, 179Russo L 31Russo M 68, 76Russo Rossi A 83Russolillo S 69, 190Rutella S 26haematologica vol. 89[suppl. n. 9]:september 2004

XVIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004Ruzzene M 103Ruzzolino P 171Saccardi R 16, 150Sacchi S 175Saglio G 11, 12, 21, 40, 41, 42, 47, 48, 49, 52, 62, 72, 75,84, 98, 131, 132, 136, 141Salati S 19, 20, 46, 89Salomon DR 29Salvaneschi L 157Salvatore F 49, 136, 137Salvatore L 21Salvi A 36, 145Sammarelli G 105Sampognaro S 164Sanavio F 25Sanchini S 34, 145Sanna A 160Sanpaolo G 83, 88, 112, 118Santagostino E 127Santinelli S 110, 155Santini V 93, 94, 134Santo L 56, 170Santonocito A 114Santonocito AM 68, 76Santoro A 66, 74, 90, 153, 166Santoro G 183Santucci MA 12, 47, 95, 96, 99Saponaro M 47, 99Sata T 169Saulle E 15, 122Savino L 154Saviola A 50Scalzulli P 83, 108, 112, 118, 162Scambia G 26Scandellari R 126Scaramucci L 135, 155Scaravaglio P 42, 141Scardocci A 64, 65, 175Scavelli C 56, 106Scerpa MC 78, 79Schiavariello S 112Schiavone EM 111Schoch C 90Scimè R 74, 119, 153, 166Scintu F 160Scortichini I 158Scrima R 101Sebastio L 40Sebolt-Leopold J 67Selleri C 28, 87, 151Sellitto A 168Semenzato G 103Serio B 151Serra A 42, 62, 132Serra M 86, 99Serra R 51Sessa M 126Sessa R 102Sessarego M 77, 98, 141Sibilla S 71Sica M 88Sica S 108, 143Siddiqui RT 94, 97Sidenius N 28Siena M 19, 20, 89Sigalotti L 173Silvestri F 85Silvestris I 80Simeone E 156Simonelli C 187Siniscalchi A 110, 155Skert C 150, 159Smid M 1Soffredini R 127Sogos V 160Solbiati F 140, 186Sorà F 108, 143Soverini S 12, 46, 49, 59, 104, 131, 132, 136, 146Spagnoli A 148Sparacino A 39Specchia G 40, 45, 71, 72, 75, 133Specchia MR 152, 157Spedicato F 79Sperotto A 150, 156Spina M 169, 187Spirito F 79Spriano M 112Stafsnes M 122Stani L 79, 152, 157Steinle A 166Stelitano C 60, 107, 119, 178Stella S 166Stirpe F 144, 182Stocchi R 150Storlazzi CT 116Stul M 42Suffritti C 30Suppo G 164Tabarrini A 58Tabilio A 21, 101, 110Tacchetti P 59, 104, 109Tafuri A 78, 79Tagliaferro A 126Tagliafico E 19, 20, 89Talarico S 162Tamburini A 69, 81Tammiso E 42Tamponi G 170Tani M 149Tarella C 25, 36, 37, 52, 56, 166, 170Tarnani M 108Tassi M 181Tatarelli C 67Tauchmanovà L 151Tazzari Pl 125, 144Tecchio C 132Tedeschi A 68Tehranchi R 32Tendas A 148, 155Tenedini E 19, 20, 89Tenore A 136Terragna C 12, 49, 59, 104, 120Terrazzano G 88Testa U 15, 122Testoni N 12, 46, 49, 59, 89, 90, 100, 131, 132, 136Tezza F 126Tiacci E 58Tirelli U 187Tiribelli M 74, 132, 146, 156Todoerti K 57, 109Tomadini V 159Tombaccini D 94, 134Tonelli S 188Topini F 149haematologica vol. 89[suppl. n. 9]:september 2004

VIII Congress of the Italian Society of Experimental Hematology, Pavia, September 14-16, 2004XITorella R 186Torelli G 50, 51, 129, 144, 173, 188Tosi P 59, 104, 109, 120Tosti A 149Trabacchi E 49, 131, 136, 175Trappolini S 158Travaglini L 67, 91Travaglino E 32, 81, 82Trentin L 103, 187Tringali S 153Tripodo C 180Trisolini SM 161Troiani M 158Trojan A 56Troletti D 54, 160Trubia M 72Tura S 19, 59, 104, 109Turin I 35Ultori C 140, 186Ungari M 129Urbani S 16, 150Urbini B 24Usala L 146Vacca A 56, 106, 110, 158Vago L 17Valentini L 65Vallet S 52, 56, 170Vallisa D 169, 175Valsecchi L 1Vanelli L 81, 136, 160Vannucchi AM 2, 45, 46Varaldo R 77, 98, 141Varettoni M 114Vaselli D 24, 25Velardi A 7, 18, 35, 147, 149Venditti A 43, 64, 67, 69, 81, 164Vendramin C 128, 170, 177, 191, 192Ventrella A 158Verdelli D 57, 60, 107, 109, 116, 117Veronese S 176Vertone D 112, 140Vetrone G 162Viaggi S 169Vianelli N 19, 125Viarengo Gl 130, 157Vignetti M 79Vignudelli T 27Villa A 23, 93Villivà N 161Vincenzi C 41Viora E 1Virgolini L 138Viscomi L 133Visconte V 28Vitale A 15, 41, 75, 76, 79Vitale M 78Viti R 169Vitolo U 184Vivaldi P 132Voso MT 64, 65, 174, 175Zaccaria A 132Zagaria A 40, 45, 72Zagnoli A 34, 145Zaja F 53, 159Zallio F 38, 176Zallone A 116Zamagni E 59, 104, 109Zambello R 112Zampieri F 41Zanni M 37Zannoni M 179Zanocco-Marani T 27Zappacosta S 88Zappasodi P 114Zappatore R 85, 90, 138, 167Zecca M 35Zenone Bragotti L 83Zini R 19, 20, 46, 89Zinzani PL 53, 149, 182Zocchi MR 16, 86, 150, 166Zollino M 64Zorzan E 166, 172, 176Zucchetti P 40Zucchini P 50, 51Zuffa E 96, 132Zunino A 169Zupo S 33, 169Weng L 8Wlodarski M 87Young NS 87haematologica vol. 89[suppl. n. 9]:september 2004