Haematologica 1999;84: supplement to no. 9 - Supplements ...

Haematologicaestablished in 1920 editor-in-chief: Edoardo Ascari ISSN 0390-6078Journal of Hematologyvolume 84, suppl. to number 9, September 1999Official Organ ofthe Italian Society of Hematologythe Italian Society of Experimental Hematologythe Spanish Association of Hematology and Hemotherapythe Italian Association of Pediatric Hematology Oncology37th Congress ofthe Italian Society ofHematologySeptember 26-29, 1999Centro Congressi LingottoTurin, ItalyABSTRACTSOwned and published by the Ferrata Storti Foundation, Pavia, ItalyMensile – Sped. Abb. Post. – 45% art. 2, comma 20B, Legge 662/96 - Filiale di PaviaIl mittente chiede la restituzione dei fascicoli non consegnati impegnandosi a pagare le tasse dovute

Selected Communications

37 th Congress of the Italian Society of Hematology3CS01HAEMATOLOGICAL DATAMODIFICATIONS AFTER ACUTEEXPOSURE TO HIGH ALTITUDE,POSSIBLE IMPLICATION FORDETECTION OF RECOMBINANTERYTHROPOIETIN MISUSEM. BONFICHI, A. BALDUINI B , A. LORENZI, C MARSEGLIA,L. ARCAINI, L. MALCOVATI, L. BERNARDI°, C. PASSINO°,G. SPADACINI°, P. FEIL $ , C. KEYL*, A. SCHNEIDER*,A. BOIARDI M , G. BANDINELLI F , R.E. GREENE $ , C. BERNASCONIInst. of Hematology Lab. of Biotechnology B ,and Cl. Medica I°, IRCCS Policlinico S. Matteo,Pavia,Univ. of Pavia, IRCCS Besta M , Milan and UOSM Nuova F , Florence, Italy; CCUUniv.Regensburg*, Germany, Highlands Univ. $ LasVegas NM.USAErythropoietin is possibly misused by athletesin sports to improve performance.Presently there is no discernible and specificmethod to identify erythropoietin administrationfor doping control. Gareau etal. (Nature 380, 113, 1996) recently reportedthe possible correlation betweensoluble transferrin receptor/ferritin ratio(sTfr/ftn) and hematocrit (Ht) and hemoglobin(Hb) levels in athlete doping evaluation.The aim of this study is to discussthe modifications of the sTrf/ftn ratio associatedto hemoglobin and hematocrit withthe acute exposure to high altitude in 24western subjects, normally living at sea levels.The data were collected during a scientificexpedition to the “Pyramid”, the CNRlaboratory situated in the Kumbu Valley(Nepal) at 5050 m. The blood harvests wereperformed at standard condition (Katmandu)(A),at the arriving to the Pyramid, after6 days walking from 2800 m till 5050m(B) and after 8 days of permanence atthe Pyramid (C). The results are reportedin the following tableA B C(Standard) (Arrival at 5050 m) (Departurefrom Pyramid)Hb g/dl 14.0±1.5 14.7±1.5* 15.±1.5*°Ht % 43.9±1.9 43.4±3.4 45.4±4.3*°STFR/Ftn ratio 1.37±3.4 1.57±2.3 2.48±3.3*Epo mIU/ml 9.7±3.9 28.7±13* 25.5±15.8** p

4 September 26-29, 1999 - Torino-Lingotto, Italya general mechanism associated with AMLpathogenesis. We tested the in vitro effectof ATRA, as differentiating agent in combinationwith the HDAC inhibitors, tricostatinA and sodium phenylbutyrate in non-M3AML cell lines and primary cells from patients.We found that such combinationenhanced ATRA response of AML blasts, asevaluated by morphological, functional andimmunophenotypic studies including NBTdye reduction assay and flow cytometryanalysis of differentiation markers andpropidium iodide stained cells. Modificationof the acetylation status of histones wasassessed by immunocytochemistry usinganti-acetylated histone H3 antibodies. Finally,we found that in AML blasts, HDACinhibitors potentiate or restore ATRA signalingon specific ATRA-responsive promoteractivities and target gene expression.These findings suggest that therapeutic targetingof transcription may prove effectivein non-APL AMLs.CS03EPIDEMIOLOGY ANDCHARACTERIZATION OFLYMPHOPROLIFERATIVE DISEASES(LPD) VIRUS G (HGV) POSITIVE:CORRELATION WITH HEPATITIS CVIRUS INFECTIONA. DE RENZO, M. PERSICO*, E. PERSICO*, G. FALZARANO,C. DI GRAZIA, R. NOTARO, R. TORELLA*, B. ROTOLIHematology Unit, Federico II University, Naples.*Internal Medicine and Hepatology Unit,II University of Naples, ItalyA high prevalence of HCV positivity hasbeen shown in Italy in several lymphoproliferativemalignancies except HodgkinDisease (HD). Based on biological similaritiesbetween HCV and HGV, we havesearched if even HGV shares any epidemiologicalrelation with LPD. We have alsoevaluated clinical and histological parametersof HGV+ LPD in order to identify possibleHGV-associated peculiarities. Comparisonwith the general population and withHCV+ LPD were also made. Patients andMethods:170 pts. and 134 healthy blooddonors. Routine blood examination and anti-HCV determination (ELISA II confirmed byRIBA II) were performed in the two groups.Polymerase chain reaction (PCR) was usedfor HCV-RNA and HGV-RNA determination.Histology was reported for all patients accordingto the WF. Statistical analysis:Fisher’s exact test and Chi-square. Results:Overall, HGV prevalence in the group of patientswas significantly higher than in thecontrol group (10.5% vs 1.5%); the sameresult was found for HCV, but no HGV+ patientwas coinfected with HCV. In addition,while HCV prevalence was elevated in allB-LPDs and was not different from the controlgroup for HD patients, HGV was mainlydiffused among both NHL and HD patients.The primary site of disease in HGV+ LPDwas in all cases a lymph node.NHL HD MM WM CLL TOTAL Controlsn 33 71 48 9 9 170 134HGV+ 4(12%) 11(15%) 3(6%) 0 0 18(10.5%) 2(1.5%)HCV+ 5(15%) 2(2.8%) 4(8%) 4(45%) 2(22%) 17(10%) 3(2.2%)Conclusions: 1) HGV prevalence seems tobe significantly increased in patients witha LPD. 2) HGV prevalence is not associatedto the prevalence of HCV. 3) HGV might havea role in lymphomagenesis in NHL and HD.CS04UMBILICAL CORD BLOOD TRANSPLANTFROM UNRELATED HLA-MISMATCHEDDONOR IN CHILDREN WITH HIGHRISK LEUKEMIAW. ARCESE, C. GUGLIELMI, A.P. IORI, M. SCRENCI,D. CARMINI, A.M. TESTI, M.L. MOLETI, A. MENGARELLI,G. CIMINO, L. ELIA, C. RAPANOTTI, P. PERRONE,L. LAURENTI, G. GENTILE, A. ROMANO, L. DE FELICE,F. MANDELLIDipartimento di Biotecnologie Cellulari edEmatologia, University “La Sapienza” Rome, ItalyIn the last four years 15 children withhigh-risk leukemia (12 ALL, 2 AML and 1CML) underwent cord blood transplantation(CBT) from unrelated HLA mismatched donorat a median of 99 days from the startof search. Nine patients were transplantedin 2nd CR, 1 in accelerated phase, 3 at relapseand 2 patients in first CR. Conditioningregimen (F-TBI, VP-16, CY and ALS)and prophylaxis of GVHD (CSA and 6-methylprednisolone)were identical for all patients.Neutrophils >0.5 x 10 9 /L werereached at a median of 33 days from transplant,but in 4 cases we observed an autologoushematopoietic reconstitution (3

37 th Congress of the Italian Society of Hematology5spontaneous, 1 after autologous BM rescue).Acute grade = II and extensive chronicGVHD were observed in 4/15 (27%) and 2/8 (25%) evaluable cases, respectively. Fivepatients died (3 from transplant relatedtoxicity and 2 from relapse). The degree ofHLA disparity, also extended to moleculartyping for HLA-C and DQB1 loci, was notsignificantly correlated either with the rateof engraftment or with the occurrence andseverity of GVHD or with transplant-relatedmortality. The 3 years probabilities of survival,event-free survival and disease-freesurvival were 65%, 58% and 63%, respectively.CBT from HLA mismatched unrelateddonor is a valid alternative to unrelated BMtransplant for children with high-risk leukemia.CS05G-CSF SELECTIVELY MOBILIZES TH2-INDUCING DENDRITIC CELLS (DC2)M. ARPINATI, M. LOKEN, C. ANASETTIIstituto di Ematologia e Oncologia Medica“Seragnoli”, Università di Bologna, Italy;Fred Hutchinson Cancer Research Center, Seattle,WA, USAAllogeneic transplantation with G-CSFmobilized peripheral blood stem cells(PBSC) grafts doesn’t induce a higher incidenceof acute GVHD, although the dose ofT cells is 20-fold higher than in marrowgrafts. T-lymphocytes from G-CSF treatedanimals preferentially produce IL4 and IL10,Th2-like cytokines which are associated withdiminished GVHD inducing ability. We hypothesizedthat G-CSF mobilizes antigenpresenting cells (APC) which induce T lymphocytesto differentiate to Th2. DendriticCells can be classified in DC1 and DC2, accordingto their ability, respectively, of inducingnaive T cells to differentiate to Th1-like and Th2-like effector cells. We used aflow cytometric method to count DC1 andDC2 in peripheral blood of normal donorsbefore or after G-CSF treatment. Both DC1and DC2 were positive for HLA-DR andnegative for lineage markers (lin) (CD3,CD14, CD16, CD19, CD20, CD34, CD56 andIgM). DC1 and DC2 could be identified accordingto the expression of the adhesionmolecule CD11c, which was positive on DC1and negative on DC2, and of the IL3 receptorα chain (CD123), which was positive onDC2 and negative on DC1. G-CSF administrationfor 5 days at 16µg/kg/die increasedperipheral blood DC2 counts from a medianof 4.9x10 6 /L (n=9) to 24.8x10 6 /L(n=13) (p=0.009), while DC1 counts didnot change (from 11.2x10 6 /L to 10.1x10 6 /L) (p=0.52). DC1 purified either from normalor G-CSF treated donors induced allogeneicnaive T cells to produce IFNγ, whichis typical of Th1 responses, while DC2 inducedallogeneic naive T cells to produceIL4 and IL10, which are typical of Th2 responses.Allogeneic PBSC grafts (n=8) containeda higher dose of DC2 than marrow(n=15) (median dose 2.6x10 6 /Kg vs0.5x10 6 /Kg) (p=0.006), with a comparabledose of DC1 (0.8x10 6 /Kg vs 1.0x10 6 /kg)(p=0.4). The presentation of host antigenson donor DC2 might polarise donor T lymphocytesto Th2 cells, thus reducing theirability to attack and damage host tissues,and to cause GVHD.CS06ALK + LYMPHOMAS (“ALKomas”):A DISTINCT MOLECULAR, PATHOLOGICAND CLINICAL ENTITYB. FALINIInstitute of Hematology, University of Perugia, ItalyThe t(2;5)(p23;q35) associated to CD30 +anaplastic large cell lymphoma (ALCL)causes the fusion of the nucleophosmin(NPM) and ALK (anaplastic lymphoma kinase)genes leading to the production of aNPM-ALK chimeric oncoprotein. We generatedmonoclonal antibodies (mAbs) againstthe cytoplasmic portion of ALK protein (mAbALKc) and the N- and C-terminus of theNPM molecule (mAbs NPMa and NPMc) andused them to study the expression of theseproteins in over 2,000 lymphomas (repre-

37 th Congress of the Italian Society of Hematology7CS08G20210A PROTHROMBIN MUTATIONAND ASSOCIATED RISK FOR DEEPVEIN THROMBOSISV. DE STEFANO, P. CHIUSOLO, K. PACIARONI, I. CASORELLI,E. ROSSI, A. DI MARIO, G. LEONECattedra di Ematologia, Università Cattolica, RomaThe G20210A prothrombin gene mutation(FII-A) is associated with increased circulatinglevels of prothrombin and is a riskfactor for deep vein thrombosis (DVT). Weinvestigated 334 patients with DVT of thelegs objectively documented (M/F 151/183,median age 43 years, range 2-86) and 456healthy controls (M/F 266/190, median age44 anni, range 7-93). Heterozygous genotypefor the FII-A was found in 32 patientswith DVT (9.6%) and in 12 controls (2.6%);other 78 patients with DVT (23.3%) and11 controls (2.4%) had a differentthrombophilic genotype (deficiency of naturallyoccurring coagulation inhibitors, factorV Leiden). The odds ratio (OR) for DVTassociated with FII-A was 3.5 (95% CI 1.7-7.3) after adjustement for otherthrombophilic inherited conditions. Afterstratification according to the circumstancesof the first DVT (absence or presenceof a circumstantial risk factor), FII-Awas associated with an increased risk bothfor spontaneous DVT (OR 3.8, 95% CI 1.6-9.3) and DVT secondary to circumstantialrisk factors (OR 3.3, 95% CI 1.5-7.5); afterfurther stratification according to the ageof the first DVT (lower or higher than 45years) and comparison to controls youngeror older than 45 years, FII-A was foundassociated with an increased risk for secondaryDVT in the individuals younger than45 years (OR 6.6, 95% CI 2.0-21.0) andwith an increased risk for spontaneous DVTin in the individuals older than 45 years(OR 4.8, 95% CI 1.6-14.2). Among the heterozygouscarriers of FII-A the percentageof individuals having been previously exposedto circumstantial risk factors (pregnancy,surgery, hormonal treatment) was64% (9/14) when the first DVT occurredbefore 45 years and 25% (2/8) (p=0.07)when the first DVT occurred after 45 years.The FII-A genotype was not found associatedwith an increased risk for recurrentDVT in 202 patients referred for a DVT thatoccurred in the previous years (in 103 casesas the only thrombotic event; median observationtime after the first thrombosis 4.5years) (relative risk 1.1, 95% CI 0.4-3.4).In conclusion the heterozygous G20210Aprothrombin gene mutation is associatedwith a moderate increase in thrombotic risk;clinical expression needs a concomitant circumstantialrisk factor or a prolonged exposureto the mutated genotype.CS09MUTATIONS OF BCL-6 AND OFIMMUNOGLOBULIN VARIABLE GENESIDENTIFY DISTINCT MOLECULARSUBSETS OF B-CELL CHRONICLYMPHOCYTIC LEUKEMIA AND REVEALHETEROGENEITY IN THE HISTOGENESISOF THE DISEASED. CAPELLO, 1 F. F AIS, 2 D. VIVENZA, 1 G. MIGLIARETTI, 1C. ARIATTI, 1 C. VOLTA, 1 N. CHIORAZZI, 3 G. GAIDANO, 1M. FERRARINI 21Division of Internal Medicine, Department ofMedical Sciences, Amedeo Avogadro University ofEastern Piedmont, Novara; 2 Clinical Immunology,IST, University of Genoa, Genova, Italy; 3 Departmentof Medicine, North Shore University Hospitaland NYU School of Medicine, Manhasset, NY, USAB-cell chronic lymphocytic leukemia (B-CLL) is a B-cell tumor involving CD5 + smalllymphocytes that express CD23 and low levelsof surface immunoglobulins (Ig). Withinthis definition, there is heterogeneity inmorphology, genetic lesions and clinicalcourse. Previous studies indicated that leukemicCD5 + B cells, like their normal counterpart,use Ig variable (IgV) genes thatexhibit minimal, if any, somatic diversity.However, recent reports indicate that a fractionof B-CLL display IgV gene mutationsconsistent with antigen stimulation andselection. In order to further elucidate thebiologic heterogeneity of B-CLL, we haveanalyzed a panel of 28 B-CLL for the presenceof mutations in the 5’ non coding-regionsof the BCL-6 proto-oncogene and, forcomparison, of IgV genes. Mutations of BCL-6 are acquired during B-cell transit throughthe germinal center (GC) and, similar toIgV mutations, represent a histogeneticmarker of GC or post-GC derivation of agiven B-cell. BCL-6 mutations were detectedin 10/28 cases (36%). The average frequencyof BCL-6 mutation was 2.4 x 10 -3bp (range: 1.3-5.4 x 10 -3 / bp) and the mutationalpattern was similar to that observed

8 September 26-29, 1999 - Torino-Lingotto, Italyin B-cell disorders known to derive from GCor post-GC cells, namely follicular lymphomaand B-lineage diffuse large cell lymphoma.Mutations of IgV genes occurred in15/28 (54%) B-CLL and in some instanceswere consistent with antigen selection. Allcases of B-CLL harboring BCL-6 mutationswere found to display also IgV mutations.Conversely, a fraction of B-CLL cases (5/28; 18%) harbored mutations in IgV genesbut not in BCL-6. Thirteen out of twentyeight(46%) B-CLL cases displayedunmutated IgV and BCL-6 genes, consistentwith derivation from naive, pre-GC B-cells. The implications of these data arethreefold. First, the heterogeneity of BCL-6and IgV mutations indicate that B-CLL ismolecularly and histogenetically heterogeneous.Second, the presence of BCL-6 and/or IgV mutations in a proportion of B-CLLcorroborates the notion that a subset ofcases are derived from a mature, antigenexperienced B-cell. Third, BCL-6 mutationsprovide a novel molecular marker for diseasemonitoring. Overall, these resultsprompt investigations aimed at defining theclinical relevance of the histogenetic heterogeneityof B-CLL as defined in this study.CS10INCOMPATIBILITY FOR CD31 ANDHUMAN PLATELET ANTIGENS (HPA)AND ACUTE GRAFT-VERSUS-HOSTDISEASE AFTER BONE MARROWTRANSPLANTATIONC.L. BALDUINI, F. FRASSONI, P. NORIS, G. GIORGIANI,M. MORDINI, C. KLERSY, S. BELLETTI, P. SPEDINI,M. MARTINETTI, R. MACCARIO, A. BACIGALUPO, F. LOCATELLIMedicina Interna e Oncologia Medica, UnitàBiometrica, Immunoematologia e Trasfusionale,IRCCS S. Matteo-Università di Pavia e Ematologia,Ospedale S. Martino, GenovaBone marrow transplantation (BMT) is oftencomplicated by acute graft-versus-hostdisease (aGVHD). In patients transplantedwith an HLA-matched donor, the occurrenceof this complication is believed to befavoured by disparities at minor histocompatibilityantigens (mHA). However, few ofthese antigens have been identified. Wesought to determine whether donor-recipientincompatibility for HPA-1, HPA-2, HPA-3, HPA-5 or CD31 (codon 125) represent arisk factor for aGVHD and typed these polymorphicmolecules in 120 bone marrow donorsand their HLA-identical recipients. 70patients were children: 37 were transplantedfrom siblings, whereas the remaining33 underwent BMT from unrelated volunteers.50 patients were adults and receivedBMT from siblings. Typing of HPA andCD31 was performed by molecular biologytechniques on genomic DNA isolated fromdonor-recipient pairs before BMT. In theoverall patient population, a strong statisticalcorrelation (p 0.003) was observedbetween donor-recipient CD31-incompatibilityand grade II-IV aGVHD (aGVHD incompatible pairs 31.0%, in non-compatiblepairs 60.6%). No significant associationbetween aGVHD and incompatibility for anyof the HPA’s was found, although a possiblerole in aGVHD for some of the HPA’swas suggested by the observation that thehigher the number of donor-recipient incompatibilitiesat CD31/HPA polymorphisms,the stronger the risk of aGVHD.Analysis of pediatric subpopulation confirmedthe role of CD31 mismatch in aGVHDand identified a direct correlation (p 0.04)between the number of CD31/HPA incompatibilitiesand aGVHD. Moreover, HPA-3incompatibility predicted aGVHD occurrencein HLA-A2 patients (p 0.04), suggesting thatHPA-3 mismatch was recognised in an HLA-A2-restricted fashion. In the adult’s subpopulation,the frequency of both donorrecipientmismatches for HPA/CD31 andsevere aGVHD was low and no statisticalcorrelation was found. In conclusion, ourdata suggest that allelic variants of CD31(codon 125) or HPA-3 can serve as mHA inBMT recipients from HLA-identical donors.CS11DETECTION OF ABNORMAL PRE-TRANSPLANT CLONES IN PROGENITORCELLS OF PATIENTS WHO DEVELOPEDMYELODYSPLASIA AFTERMYELOABLATIVE THERAPYE. ABRUZZESE, J.E. RADFORD, J.S. MILLER,J.J. VREDENBURGH, P.N. RAO, M.J. PETTENATI, A. TENDAS,D.D. HURD, S. AMADORICattedra di Ematologia, Università Tor Vergata,Roma, and Comprehensive Cancer Center, WakeForest University, Winston-Salem, NC, USASecondary myelodysplastic syndromes(MDS) have been reported with increasingfrequency after autologous transplantation.

37 th Congress of the Italian Society of Hematology9It is not clear whether the MDS results fromthe pre-transplant conventional-dose chemotherapyor from the high dose therapy(HDT) used for the transplant procedure.To address this question we studied pretranplantmarrow or stem cell specimensfrom 12 patients who had received HDT withautologous marrow or stem cell transplantfor the treatment of a lymphoma (7) or solidtumor (5) and have subsequently developedMDS. Post-transplant bone marrow specimensobtained at the time of the MDS diagnosisexhibited one or more MDS-relatedcytogenetic abnormalities. These abnormalitieswere used as markers to determineretrospectively, using fluorescence in-situhybridization (FISH) whether the abnormalMDS clone was present pre-transplant.Mean age at time of transplant was 38 years(range 25-65) with 5 males and 7 females.All but one had received chemotherapy and/or radiotherapy prior to HDT. Time betweendiagnosis and HDT ranged from 1-96months; time from HDT and MDS diagnosiswas 10-60 months. Cryopreserved, pretransplantbone marrow or peripheral bloodstem cell specimens obtained at the timeof harvest, or archival bone marrow smearswere used. Standard cytogenetic analysishad been performed pre-transplant in 4 patients,showing a normal karyotype. Thefollowing cytogenetic abnormalities wereexamined: del(5)(q31), -5, -7, +8, -11, -21, using FISH probes (Vysis) for interphaseanalysis. In 9 of 12 cases, the same cytogeneticabnormality/ies observed at thetime of MDS diagnosis was detected in asymptomaticpre-HDT specimens, in 20-46%of the cells examined. This finding supportsthe hypothesis that stem-cell damage leadingto post-transplant MDS may result fromprior conventional-dose chemotherapy, andmay be unrelated to HDT or the transplantationprocess itself.CS12ESSENTIAL THROMBOCYTHAEMIA:PROGNOSTIC FACTORS IN THE ITALIANSERIES OF TWO THOUSAND PATIENTSL. GUGLIOTTA, M. LAZZARINO, R. MARCHIOLI, A. AMBROSETTI,S. BARAVELLI, M. BAZZAN, E. CACCIOLA, R. CALORI,A. CIOCCA VASINO, A. DE VIVO, M. FIACCHINI, G. FINAZZI,L.GARGANTINI, A. GROSSI, P.G. IANNACCARO, T. LEVA,U. MAGRINI, M.R. MARFISI, V. MARTINELLI, M.G. MAZZUCCONI,A. MORELLI, A. NOVARINO, F.PALMIERI, E. POGLIANI, F. RADAELLI,L. RANDI, G. REGE CAMBRIN, F. RONCO, M. RUGGERI, S. RUPOLI,D. RUSSO, S. SACCHI, L.VALDRÈ, N. VIANELLI,F. RODEGHIERO, T. BARBUI, S. TURA FOR THE GIMMC (GRUPPOITALIANO MALATTIE MIELOPROLIFERATIVE CRONICHE)A series of 2139 patients with diagnosis ofEssential Thrombocythaemia (ET), done between1976 and 1996 in 60 HaematologicalCenters of GIMMC and verified according toPVSG criteria, have been retrospectivelyevaluated mainly to define the prognosticfactors. The patients, 1315 females and 824males, with median age 59 years (21% under40 and 23% over 70 years), at diagnosishad a median platelet count of 910x10 9 / L(25% 1200), splenomegaly(21%), hepatomegaly (25%), peripheralgranulocyte precursors (8%), functionalsymptoms (35%), thrombotic risk factors(40%), haemorrhage (5%) and thrombosis(15%). The follow-up was 5.2 ±3.1 years(median 4.4). The treatment was:antiplatelet drugs 78% (ASA 49%), cytostaticdrugs 82%, (alkylating molecules38%, HU 48%, IFN α 22%, Anagrelide 2%).During the follow-up the platelet count (10 9 /L) was 70 years RR 25.2), thethrombosis at onset (RR 1.5), the peripheralgranulocyte precursors (RR 1.8), the plateletcount during the follow up >1000x10 9 /L(RR 2.1). The role of antiplatelet and cytostaticdrugs (type, dose, duration) will befurtherly described.

37 th Congress of the Italian Society of Hematology13APLASTIC ANEMIA ANDACUTE LEUKEMIACO01ACUTE LEUKAEMIAIMMUNOPHENOTYPING IN BONEMARROW ROUTINE SECTIONSP. P. PICCALUGA, S.A. PILERI, S. ASCANI, G. VISANI,G. FRATERNALI ORCIONI, M. MILANI, M. PICCIOLI, S. POGGI,E. SABATTINI, D. SANTINI, B. FALINIInstitute of Hematology and Medical Oncology“L. e A. Seràgnoli” - Service of Pathologic Anatomyand Haemopathology - University of Bologna, ItalyImmunohistochemistry of acute leukaemiasin bone marrow paraffin sections iscommonly thought to be useless becauseof the poor preservation of many lineagerelatedmarkers. However, the recent developmentof monoclonal antibodies againstfixative-resistant epitopes and of new antigenretrival techniques has expanded thepossibility of accurately testing routinesamples. To asses the rilevance of paraffinsection phenotyping in lineage determination,110 amples from acute leukaemia patientswere studied by specific antibodiesagainst CD1a, CD3, CD15, CD20, CD34,CD68, CD79a, TdT, myeloperoxidase,glycophorin A and factor VIII-related antigen.59 acute myeloid leukaemias, 39 precursorB-cell acute lymphoblasticleukaemias (B-ALLs), 7 T-ALLs and 5 mixedprecursor B-cell/myeloid acute leukaemiaswere included. The combination of themarkers employed allowed the identificationof the cell lineage (myeloid, lymphoidor mixed) in all the cases and, in some instances,of phenotypic profiles characteristicof distinct acute leukaemia subtypes.According to the results obtained, bonemarrow biopsy may be regarded as a reliabletool for acute leukaemia diagnosis; thisobservation is of practical relevance especiallyfor the classification of cases whichlack circulating blasts in the peripheral bloodor showing dry tap at bone marrow aspiration.CO02CYTOGENETIC STUDY OF 256 ADULTPATIENTS WITH ACUTELYMPHOBLASTIC LEUKEMIA (ALL) ATDIAGNOSISM. MANCINI ON BEHALF OF THE GIMEMA COOPERATIVE STUDYGROUPDepartment of Cellular Biotechnology and HematologyUniversity “La Sapienza” of RomeA prospective conventional cytogenetic(CC) investigation on 256 adult patientswith ALL entered into the GIMEMA 0496 trialhas so far been carried out on bone marrowsamples taken at diagnosis and centralized,by overnight dispatch, in Rome. Acytogenetic result was obtained on 163/256(64%) of the cases analyzed. The patientswere classified into cytogenetic subgroupsby structural abnormalities and, subordinately,by ploidy, to highlight structuralchanges of prognostic relevance. A karyotypewas considered as normal if an abnormalclone was not identified on the analysisof at least 10 cells. Abnormal karyotypeswere detected in 101/163 (62%) cases successfullyinvestigated. The following cytogeneticsubgroups have been identified:t(9;22)(q34;q11) (36 cases, 22%),t(4;11)(q21;q23) (10 cases, 6%), del(6q)(10 cases, 6%), del(7q) (5 cases, 3%), ≤than two structural or numerical changes(23 cases, 14%), ≥ than three structural ornumerical changes (17 cases, 10%). Whenclassified by ploidy the 163 cases were distributedas follows: hypodiploid (4 cases,2.5), normal (62 cases, 38.5%),pseudodiploid (73 cases, 45%), low hyperdiploid(16 cases, 10%), high hyperdiploid(6 cases, 4%), hypotriploid (2 cases, 1%).The interim correlation with the clinicaloutcome has been done on 124/256 patientswith at least three months follow-upfrom diagnosis. Eighty-five of these patientswere cytogenetically categorized by structuralchanges. As expected, patients withthe Ph chromosome and t(4;11) had a significantlyworse outcome, with percentagesof relapse of 63% and 57% (p= 0.027),respectively. A high relapse rate (67%) wasobserved in patients with del(6q), a subgroupconsidered to have a favorable prognosis.Overall, patients with an apparentlynormal karyotype did significantly betterthan those with an abnormal karyotype(85% vs 48% of patients in persistent com-

14 September 26-29, 1999 - Torino-Lingotto, Italyplete remission, p=0.005). Also of interestwas the apparently poor prognosis (46%of relapses) of cases classified as notevaluable because of less than 10 apparentlynormal metaphases. This study highlightsthe feasibility of a centralized cytogeneticinvestigation and re-emphasizes theprognostic role of cytogenetics for adult ALL,providing a rationale for the developmentof stratified treatment approaches based ondiagnostic cytogenetics.CO03PROGNOSTIC SIGNIFICANCE OF CD56EXPRESSION IN ACUTE MYELOIDLEUKEMIA PATIENTSD. RASPADORI, M. LENOCI, S. BIRTOLO, G. NARDI,C. SESTIGIANI, A. GOZZETTI, D. RONDELLI *, N. TESTONI *,D. DAMIANI **, M. MICHIELI **, F. LAURIACattedra di Ematologia Università di Siena,*Istituto di Ematologia e Oncologia Medica“Seràgnoli”, Università di Bologna,**Cattedra di Ematologia, Università di UdineCD56 (NCAM) is a 220 kd glycoproteinpredominantly expressed on human naturalkiller cells. It has been reported thatCD56 antigen is expressed also in acutemyeloid leukemia cells (AML), generallyassociated with monocytic morphology andextramedullary envolment. Recently, it hasbeen shown that in t(8;21) AML the expressionof CD56 antigen identifies patientswith poor prognosis. On the basis of theserecent findings, we evaluated surface CD56expression of leukemic cells in 113 newlydiagnosed AML patients and results werecorrelated with other prognostic factors andclinical outcome. CD56 antigen was presentin 29/113 cases (26%) with a percentageof positive cells ranging from 11% to 97%(median 43). No correlation was found withFAB cytotype or chromosomal abnormalities.CD34 antigen was coexpressed in 16/29 (55%) of CD56 positive cases. Followingstandard intensive chemotherapy a significantreduction of complete remissionrate was recorded, in fact only 37% of CD56positive evaluable patients achieved completeremission, while the remaining patientswere resistant to the treatment orexperienced only a partial response. In conclusion,since it appears that CD56 expressionon myeloid blasts identifies patientswith poor clinical outcome our results suggestthat CD56 analysis may be useful toidentiefy AML patients which need a moreaggressive therapeutic approach.CO04C-KIT MUTATIONS ARE A RELATIVELYFREQUENT EVENT IN PROGRESSIONOF AML M2A. BEGHINI 1 , R. CAIROLI 2 , P. PETERLONGO 1 , C. RIPAMONTI 1 ,C. MECUCCI 3 , E. MORRA 2 , L. LARIZZA 11Dept. of Biology and Genetics, Medical Faculty,University of Milan, Italy; 2 Division of Hematology,Niguarda Hospital, Milan, Italy; 3 Hematology andBone Marrow Transplantation Unit, University ofPerugia, ItalyDetection of a novel activating c-kit mutation(Asp816Tyr) in a patient with AMLM2 with mast cell involvement and karyotype47, t(8;21) +4 ( 1,2 ) raises two mainquestions: i) the role of c-kit mutation inthe observed leukemia, ii) the incidence ofc-kit mutations in AML M2. Study of thedosage of the mutated c-kit allele in leukemicblasts carrying trisomy 4, the chromosomewhere the c-kit gene is located,demonstrated that tris 4 leads to duplicationof the mutated allele in blasts carryingthe primary t(8;21) rearrangement.Trisomy 4 thus appears associated withleukemia progression. To address the secondquery AML M2 with the typical antigeniccombination (CD34 + , CD117 + , CD13 +and CD33 + ) and t(8;21), with or withoutadditional numerical chromosomalchanges, were selected and screened forknown mutations at codon 816, such asthe observed Asp816Tyr and theAsp816Val, which is prevalent in mastocytosis.Digestion of amplified DNA usingrestriction enzymes suitable to distinguishbetween the normal and the mutated alleleallowed to identify the Asp816Valmutation in three out of nine cases investigated.Significantly, the first case has at(8;21) +4 karyotype, the second hast(8;21) +13, while the third carries at(2;8;21). These findings indicate that activatingc-kit mutations are not a rare eventin AML M2, a CD117 + FAB subtype, likelyprone to c-kit mutation and responsive tomutation effects. The prognostic meaningof c-kit mutation as regards leukemia evolutionshould be evaluated by accurate fol-

37 th Congress of the Italian Society of Hematology15low-up of positive patients as compared tonegative patients carrying t(8;21).1Beghini A. et al. BMCD 24(2): 262, 19982Beghini A. et al. Blood 92(2): 701, 1998CO05TEL/AML1 REARRANGED CHILDHOOD ALLE. BARISONE, C. LANZA, G. VOLPE * , G. MAINERO, E. SICCA,L. FARINASSO, A. MANAZZA, F. FAGIOLI, G. BASSO,G. SAGLIO * , E. MADONDipartimento di Scienze Pediatriche edell’Adolescenza e * Dipartimento di ScienzeBiomediche-Università degli Studi di TorinoThe t(12;21)(p13;q22) translocation,cryptic at the cytogenetic level (0,05%) hasresulted to be the most frequent geneticabnormality when investigated by molecularanalysis for the TEL/AML1 hybrid transcript(20-25%). This translocation hasbeen associated with age 1-10 years, B precursorlineage involvement (frequently withmyeloid antigens coexpression), and excellentEFS(90% at 5 years). In order to investigatethe prognostic significance of TEL/AML1 presence at diagnosis of ALL, we havestudied the preliminary results of the prospectivestudy on childhood ALLs consecutivelydiagnosed at our Institution between1/5/95 and 31/12/98, and uniformelytreated with the multicentric AIEOP protocol.The TEL/AML1 transcript has been investigatedby RT-PCR on the diagnostic BMsamples, and detected in 18/75 patients(24%). All rearranged patients had B-precursorinvolvement, myeloid markers in 13/18 and age 1-7 years (median: 4). 73/75patients went in CR: 18/18 in the t(12;21)positive group and 55/57 in the negativegroup. During follow-up (4-48 months, median20) 9 patients experienced a BM relapse:3/18 (16,6%) in the rearrangedgroup, 6/55 (10,9%) in the negative group.The 3 relapses observed in the TEL/AML1patients have occurred in off-therapy (1stCR lenght: 28,28,40 months), while in thenegative group 5/6 relapses have occurredduring treatment (1st CR lenght10,10,12,13,15 months) and only in 1 casein off-therapy (30 months). At present, 3/3 TEL/AML1 positive relapsed children arealive in 2nd CR (follow-up 5-8 months),contrasting with only 2/6 alive in the TEL/AML1 negative series. Our data show thatTEL/AML1 rearranged patients, thoughbearing the typical favourable biological andclinical findings and good therapeutic response,may relapse with an unexpectedand relatively high rate when compared tothe t(12;21) negative series. However inthe TEL/AML1 relapsed patients 1st CRappears to last longer (of at least 12months) than in the negative group. Ourdata, though will undoubtely benefit fromadditional follow-up, appear to argueagainst the “excellent” prognostic significanceof TEL/AML1 rearrangement and warnagainst the proposal of considering a lessintensive treatment in these patients.CO06MULTI DRUG RESISTANCE IN ACUTEPROMYELOCYTIC LEUKEMIA (APL):A LOW PGP, LRP AND MRP EXPRESSIONMAY CONTRIBUTE TO THE HIGHSENSITIVITY TO CHEMOTHERAPY OF APLA. ERMACORA, M. MICHIELI, D. DAMIANI , A. MICHELUTTI,P. M ASOLINI, A. BERTONE, G. FUGA, L. MARIN,S. PROSDOCIMO, M. BACCARANIDivision of Haematology, Department of Medicaland Morphological Research, Udine UniversityHospital, ItalyAcute Promyelocytic Leukemia (APL), is abiologically and clinically well defined subtypeof Acute Myelocytic Leukemia that froma clinical perspective shows an high sensitivityto Anthracyclines. We hypothesizedthat APL blasts may have low levels of drugtransporter proteins. Therefore the expressionof the P-Glycoprotein (PGP), of theMultidrug Resistance associated Protein(MRP), of the Lung Resistance related Protein(LRP) and the Intracellular DaunorubicinAccumulation (IDA) were evaluatedin consecutive 23 APL cases diagnosed atthe Division of Haematology of the UniversityHospital of Udine based on morphology,detection of the t(15;17) and/or chimericfusion transcript PML/RARa betweenfebruary 1990 and december 1998. PGP,LRP and MRP expressions were evaluatedby flow cytometry using the MRK-16, theLRP56 and the MRPm6 monoclonal antibodies.The IDA was evaluated by flowcytometry after a 2 hour incubation in 1000ng/ml Daunorubicin. A PGP, LRP, and MRPoverexpression was defined for MRK-16,LRP56 and MRPm6 Mean Fluorescence Indexhigher than 6, 5 and 3 respectively that

16 September 26-29, 1999 - Torino-Lingotto, Italyis for PGP, LRP or MRP expression higherthan the ones observed in non MDR cell linesand in normal mononuclear cells taken frombone marrow of healthy donors. A defect ofIDA was defined by Normalized Mean FluorescenceIndex lower than 300 that is foranthracycline levels lower than the onesobserved in normal mononuclear cells takenfrom bone marrow of healthy donors. Atonset, the median MRK-16 MFI was 3.6(range 2.7 – 5.6), the median LRP56 MFIwas 2.4 (range 1.1 – 6.0) and the medianMRPm6 MFI was 1.3 (range 1.0-2.3). Nocases were defined as PGP or MRPoverexpressing. An LRP overexpression wasobserved in 1/23 cases. The mean IDA was402 ± 101. A defect of IDA was found in 2/23 cases. During the period of the study, 6patients relapsed and the MDR phenotypehas been resetted. Again at the first relapse,only one case overexpressed LRP and hada defect of blast cells’ IDA. This study suggeststhat a low PGP, LRP and MRP expressionand the absence of defects of anthracyclineAccumulations may contribute inproviding the biological basis for the highsensitivity to chemotherapy of APL.CO07ACUTE PROMYELOCYTIC LEUKEMIA(sAPL) FOLLOWING A PREVIOUSMALIGNANCY. EXPERIENCE OF GIMEMAL. PAGANO, A. PULSONI, L. MELE, G. AVVISATI, V. ZAGONEL,T. BARBUI, C. PETTI, M. KROPP, S. CIOLLI, R. CERRI,A. NOSARI, G. VISANI, E. POGLIANI, B. ALLIONE,E. DI BONA, R. INVERNIZZI, L. MELILLO, P. COSER,S. RUPOLI, F. EQUITANI, M. FALDA, A. LEVIS, P. CITARELLA,A. RECCHIA, F. DI RAIMONDO, A. DE RIENZO,G. LEONE, F. MANDELLI FOR GIMEMAObjective: To evaluate the clinical andlaboratory characteristics of adult patientsaffected by sAPL developed after a previousmalignancy (PM). Design: Retrospectivestudy, conducted over a fourteen-yearsperiod (1984-1997). Setting: 62 hematologydivision in tertiary care or universityhospital. Results: During the study periodwere observed 51 sAPL (m/f ratio 17/34,median age 57 y, range 27-76). The mostfrequent PM was breast cancer (15 cases),followed by NHL (9) and uterus cancer (7).The median time from PM diagnosis to sAPLwas 36 months (range 8-366). PM wastreated in 14 cases (27%) with surgeryalone. In the other 37 cases (73%), patientsreceived chemotherapy (10 cases,20%), radiotherapy (17 cases, 33%) orchemo-radiotherapy combination (10 cases,20%). M3 variant was found in 7 patients.Thirthy-seven patients performed a cytogeneticstudy: 3 patients had a normalcaryotype, 31 had t(15;17); in 3 casesfailed. Molecular biology study was doneon 36 patients: 21 were BCR1 positive, 3BCR2 positive and 10 BCR3 positive. In 2patients it failed. Other 15 patients did notperform molecolar biology study. On thewhole only in 6 patients diagnosis of M3was based on morphological criteria only.Allpatients received a treatment for sAPL: 35patients were treated with AIDA protocol(idarubicin plus ATRA), 8 with ATRA alone,and 8 patients received chemotherapy includingantracyclines plus cytarabine.Fourty-three patients achieved a CR (84%)and 8 patients died in induction (16%). Themedian duration of CR was 27 months (2-128) and the median overall survival was27 months (0-130), but the median survivalof patients who achieved CR was 29months (4-130). At the time of analysis 33patients were alive in CR. Nine patients relapsedand died (2 for hemorrhage, 4 forAPL, 2 for infection; one patient developedmelanoma). One patient was lost at followup.Conclusion: Prognosis of acute leukemiafollowing another malignancy is characterizedby a bad prognosis. In our seriewe observed that, contrarily to the othersAML, the CR rate and the outcome of sAPLis similar to that observed in primary APL.CO08ACUTE MYELOID LEUKEMIAFOLLOWING ESSENTIALTHROMBOCYTHEMIA (ET)M. BONI, P. BERNASCONI, P.M. CAVIGLIANO, C. ASTORI,S. CALATRONI, L. MALCOVATI, M. CARESANA, C. BERNASCONIIstituto di Ematologia, Università di Pavia, Divisionedi Ematologia, Policlinico San Matteo IRCCS, PaviaTwo-hundred eighty-four ET patients werestudied at our Institute in a fourteen yearsperiod. At the time of diagnosis all caseshad a normal chromosome pattern and allwere ABL/BCR negative on RT-PCR analyses.All the patients received pipobroman(25 mg/day as starting dose) as first linetherapy. Twenty-four cases did not respondto this treatment and therefore 19 received

37 th Congress of the Italian Society of Hematology17HU (1g/day) and 5 busulfan (4 mg/day).Ten patients developed AML after a medianfollow-up of 104 months. Among them 5had received only pipobroman, 2pipobroman and HU and 3 pipobroman andbusulfan. Seven cases yielded a suitablenumber of metaphases and all of themshowed complex rearrangements involvingmore than three chromosomes. Conventionalcytogenetics detected a 17p deletionin 2 cases. In order to establish theincidence of this structural abnormality, frequentlyobserved in AML following ET wedecided to perform FISH analyses with ap53 dygoxigenated probe (red spot) onmetaphase and interphase cells. This probewas applied in association with chromosome17 specific centromeric probe (green spot)in order to evaluate the incidence of falsepositive/false negative results. Adel(17)(p11) was observed in 4/7 caseswith a suitable number of metaphases butin 7/10 cases in whom interphase cells onlywere examined. Morphologically the Pelger-Huet anomaly and vacuolated neutrophilswere observed in the peripheral blood of 6cases. As far as the treatment received isconcerned del(17p) occurred in the 4/5cases who had been administered pipobromanonly and in 2 treated withpipobroman and HU. Our data indicate thatdel(17p) is frequently observed in AML followingET and is not related to previoustreatment.CO09ACUTE LYMPHOBLASTICLEUKAEMIA(ALL) IN THE ELDERLY:RESULTS OF TREATMENTS IN ACOHORT OF 106 PATIENTSL. ANNINO, M. LAMANDA, L. PAGANO*, A. CAMERA**,G. LEONE*, B. ROTOLI**, F. MANDELLIDpt of Cellular Biothecnology and Hematology,University “La Sapienza” of Rome;*Hematology,Catholic University “Sacro Cuore”, Rome; **Hematology,University “Federico II” , Naples, Italyof 106 older (>60yrs) ALL pts, observed in3 Centers from January 1969 to March1999, are discussed. Of 105 pts - 43 males/63 females, median age 68.5 yrs, range 60-90 yrs- median haematological parameters,at diagnosis, were: Hb 9 g/dl, WBC count11.8x10 9 /l,Plts80.x10 6 /l.Immuno-phenotypewas evaluable in 84pts: 71 were B-lineage ALL,1S(Ig)+, 5 T-ALL, 6My+ALL and1 Stem Cell Leukaemia.Cytogenetics wasavailable in 27 pts: t(9;22)(q 34; q 11),andt(4,11)(q21; q23) were found in 7 and 3pts respectively; 9 pts were BCR/abl+ (4p210+, 3 p210/190+, 2p190+),3 ALL/AF4+. At onset lumbar punction (LP) wasdone in 49 pts,CNS involvement waspresent in 5. As induction pts weresubsetted in 2 groups: group A included 58pts- median age 71yrs - treated with palliative2 drug (VCR+PDN) induction, groupB 48 pts- median age 66 yrs- treated withintensive induction including Anthracycline.From 1983 these pts were enrolled in theGimema adult ALL trials: 0183(16),0288(19), 0394(1), 0496 (2). CNS prophylaxis- LP+ cranial Rx, systemic ID methotrexate-was applied in 44 pts. During inductionGrowth Factors were used in fewcases,>50% of pts were treated as out-pts.TOT. CR(%) REFR. I.D. CCR SURVmedian(mos) median(mos)106 71(67) 15 20 6.2 7.5PALLIATIVE 58 32(55) 12 14 5.6 8.3INTENSIVE 48 39(81) 3 6 8.0 9.5During follow-up 78% and 66% of pts relapsedin group A and B respectively. As ofApril 1999 16 pts - 4 in group A and 12 ingroup B- are alive: 13 in 1st CCR from amedian time of 20 mos, 1 (p210+) in 2ndCR, 1 (p190+) in 3th CR and 1 with activedisease.The median age is increasing in thewestern countries,an increased incidence ofALL could be occurred in the >60 yrs agepopulation; thus the therapeutic strategybecome a prominent issue in the yrs tocome.In the past yrs ALL in the elderly was considereda rare disease, characterized by apoor prognosis, since age in itself representsone of the most important prognosticfactors negatively influencing both the CRrate and disease outcome.In this retrospectivestudy the clinical characteristics, thetypes of treatment and disease outcome

18 September 26-29, 1999 - Torino-Lingotto, ItalyMOLECULAR BIOLOGY ANDCYTOGENETICSCO10SUPERIORITY OF ALLOGRAFTINGOVER AUTOGRAFTING IN TERMS OFMOLECULAR REMISSIONS INMULTIPLE MYELOMA PATIENTSP. CORRADINI, C. VOENA, C. TARELLA#, M. ASTOLFI#,M. LADETTO#, A. SANTORO*, A. BACIGALUPO°, M. MUSSO^,M. BOCCADORO#, I. MAJOLINO*, A. PILERI#BMT Unit Istituto Scientifico San Raffaele - Milano;Divisione Universitaria di Ematologia, Torino;°Divisione di Ematologia II, Genova;*Unità Trapianto Midollo Osseo, Palermo;^Divisione Universitaria di Ematologia - PalermoWe have planned a molecular monitoringof minimal residual disease (MRD) in patientsachieving complete remission (CR)after autologous or allogeneic transplantationof hematopoietic cells. Clonal markersbased upon the rearrangement of IgH geneswere generated for each patient and usedfor PCR detection of MRD. Fifty-one patientsentered the program and 36 achieved CR.MRD analysis has been performed on 29patients (15 autologous and 14 allogeneic)having a molecular marker. Our data showthat molecular remissions are rarelyachieved (7%) with high-dose (HD) chemotherapyfollowed by single or doubleautografting. In addition, we give a furtherdemonstration that virtually all peripheralblood progenitor cell (PBPC) and bone marrowharvests contain residual myeloma cellseven when the collection was scheduledafter repeated courses of high-dose chemotherapy.All patients reinfusing PCR-positiveharvests remained positive, and 8 of13 had already a relapse. Two patients wereautografted with PCR-negative harvests:one is in clinical and molecular remission;one suffered an extramedullary relapse 25months post-transplant. In the allograftingsetting, a higher proportion of patients(50%) achieved the molecular remission;there were 3 relapses, two in the PCR-positiveand one in the PCR-negative group. Thesizeable fraction of patients achieving molecularremission after PBPC allografting isa promising finding in an incurable disease.Further studies on a larger panel of casesare required to clarify the clinical relevanceof molecular remission in myeloma patients.CO11MOLECULAR ERADICATION OFMULTIPLE MYELOMA IS POSSIBLEAFTER ALLOGENEIC AND AUTOLOGOUSTRANSPLANTATION OFHEMATOPOIETIC CELLSC. TERRAGNA, G. MARTINELLI, M. CAVO, R.M. LEMOLI,G. BANDINI, E. ZAMAGNI, S. RONCONI, P. TOSI,S. MANGIANTI, M.R. MOTTA, M.S. ZAGARELLA, N. TESTONI,M. AMABILE, E. OTTAVIANI, S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli”, University of BolognaTo assess the role of autologous and allogeneicbone marrow transplantation of hematopoieticcells in patients with multiplemyeloma (MM), we planned molecularmonitoring of minimal residual disease(MRD) for patients in complete clinical remission(CR) after auto- or allo-transplantation.Clonal markers based upon the rearrangementof immunoglobulin heavychaingenes were generated on 44/52 MMpatients who achieved CR (14 allogeneic,13 single and 17 double autografting). Inthe allografting setting, 26/68 (38.2%)patients achieved CR: of 14 patients havinga molecular marker, 7 patients (10.3%)achieved molecular remission (MCR). In theautografting setting, a total of 36/161(22.3%) patients achieved CR and weredivided in different groups based on autotransplantationprocedures. 82 patientswere submitted to high-dose chemotherapyfollowed by single autografting; 71 of them(subgroup A) received a single un-manipulatedautograft: 8 patients achieved CR(11.2%) and 6 of them were studied bypatient-specific marker: 1 achieved MCR(1.4%). 11 patients (subgroup B) receiveda single double-selected autograft (CD34+/Blin- cells): 7 achieved CR (1 non-secretory)(63.6%) and all were studied by patient-specificmarker: 1 achieved MCR(9.1%). 79 patients were submitted todouble autografting: 62 patients (subgroupC) undergone double un-manipulatedautografting and 15 of them achieved CR(24.1%); 12 were molecularly studied and1 patient obtained MCR (1.6%). 17 patients(subgroup D) were re-infused with selected

37 th Congress of the Italian Society of Hematology19apheresis (CD34+ cells): 6 of them achievedCR (35.3%) and 5 were molecularlystudied: 1 patients obtained MCR (5.9%).We showed that virtually all un-manipulatedperipheral blood progenitor cells harvestscontain residual myeloma cells. Only fewCD34+ and CD34+/Blin- grafts were PCRnegative.This work was supported by Italian Associationof Cancer Research (A.I.R.C.), by Italian C.N.R.no. 98.00526.CT04, by MURST 40% targetprojects and by “30 Ore per la Vita” A.I.L. grants.CO12REAL-TIME PCR FOR QUANTITATIVEEVALUATION OF RESIDUAL DISEASEIN MULTIPLE MYELOMA (MM) USINGTHE IMMUNOGLOBULIN HEAVY CHAIN(IgH) GENE REARRANGEMENT#°M. LADETTO, # J.W. DONOVAN, °A. PILERI, # J.G. GRIBBEN#Department of Adult Oncology, Dana FarberCancer Institute, Harvard Medical School, BostonMA, USA. °Cattedra di Ematologia, Università diTorino, Torino, ItalyDespite intensified treatments, patientswith MM have shown a nearly constant persistenceof PCR-detectable disease. Thereforequalitative PCR analysis has no prognosticsignificance and quantitative approachesare probably required to identifyhigh-risk patients. Real-time PCR is a novelquantitative method for PCR analysis thatproved effective for MRD detection whenchromosomal translocations are used asclonal markers. In this study, we developeda real-time PCR approach based on the IgHrearrangement and assessed its effectivenessin 31 MM patients. Because of the highcost of producing patient-specific reportingprobes, VH family-specific consensus probeswere used in association with tumor-specificprimers. A number of mismatches betweenclonal IgH sequences and consensusprobes could not be avoided. However,probe effectiveness was easily predictableby the number and quality of such mismatches.We demonstrate that few probesallow successful real-time PCR in 100% ofpatients. Our data show that shorteramplicons allow more sensitive and effectivereal-time PCR. Sensitivity has beenassessed for the whole panel of patientsand is around 10 -4 . Finally, assay reproducibilityand accuracy were extensively evaluated,in order to validate our method. Reproducibilitywas assessed by performingreal time PCR on 22 DNA samples in twodifferent rounds of amplification. At eachamplification, three replicates were generated.Good agreement was observed (correlation> 0.98) both within the same runand in different runs. Real-time PCR hasalso shown good accuracy. In the presenceof 50 or more target copies, our methodcould easily discriminate two fold differencesin tumor contamination. In addition,dilution experiments with cell lines showeda close correlation between calculated andexpected values. Our data thus indicate thatreal-time PCR using the IgH rearrangementis feasible, accurate, reproducible and notexceedingly expensive. We plan to use thisapproach to evaluate the kinetics of residualdisease in a panel of patients with both MMand non-Hodgkin lymphoma with persistentPCR detectable disease after auto- and allotransplantation.CO13PATIENT’S SPECIFIC PRIMERS FORRESIDUAL DISEASE ASSESSEMENT INCLL AUTOGRAFTINGA. SANTORO, R. SCIMÈ, P. CATANIA, A. INDOVINA,S. CANNELLA, S. TRINGALI, I. MAJOLINODivisione di Ematologia e Unità TMO, Ospedale“V. Cervello”, PalermoVariable regions (VDJ) of the Ig heavychain genes rearrangement are clone-specificand can be used as tumor marker in Bneoplasias. Thirty patients with advancedstage chronic lymphocytic leukemia (CLL)were enrolled in an autograft program withpurified CD34 + cells . Minimal residual disease(MRD) was evaluated in peripheralblood stem cells (PBSC) harvest, and inthe bone marrow after autografting . Themolecular rearrangement of the IgH geneswas studied by PCR using primers specificto the framework 3 region (FR3) with a consensusprimer from joining region (JH) (22patients). The amplification with the FR3primer failed in a single patient and it wasnecessary the used a panel of primers specificto the framework 1 region (FR1) of thedifferent VH families, together with JHprimer. In order to identify the nucleotidesequence of the rearranged variable region

20 September 26-29, 1999 - Torino-Lingotto, ItalyVDJ, and then design tumor-specific primers,the sequence of the third complementaryregion (CDR3) was obtained by directsequencing the clonal VDJ-PCR product.MRD was detected using patient specificCDR3 and JH primers In 23 of 24 patientsstudied (96 %) a molecular marker wasavailable. All patients had a PCR-positiveharvest before and after CD34+ cellsimmunoselection (13 patients). Afterautografting 7 out of 11 patients, studiedwith specific-primers, obtained a molecularremission. Five patients were stable PCRnegative (3-24 months), the other 2 becamePCR positive at 18 and 36 monthsrespectively, with none clinical evidence ofrelapse. The sesitivity of the method wasaround 10 -5 cells. High-dose chemotherapyis able to provide molecular remission inCLL, but its role in terms of disease freesurvival remains unknown.CO14CLINICAL VALUE OF RT-PCRMONITORING OF RESIDUAL DISEASEIN PATIENTS WITH t(4;11) ACUTELYMPHOBLASTIC LEUKEMIAG. CIMINO ON BEHALF OF THE GIMEMA COOPERATIVE STUDYGROUPDipartimento di Biotecnologie Cellulari edEmatologia, Università degli Studi “La Sapienza” -RomaTwenty-three patients (21 adults and 2infants) with ALL1/AF4-positive ALL patientswere prospectively monitored by RT-PCRbetween January 1992 and February 1999.At presentation, a rearranged configurationof the ALL1 gene and/or a t(4;11) translocationwere present in all cases. Followinghigh-dose intensive induction and consolidationchemotherapy without bone marrowtransplantation, all patients achieved acomplete hematologic remission. By nestedRT-PCR (sensitivity 10 -4 ), conversion to PCRnegativity was observed in 10 cases (43%).All 13 patients who remained PCR positiverelapsed at a median time of 4 months(range 1 - 20). Of the 10 patients who attainedconversion to PCR negativity, 5 convertedagain to PCR positivity within 1 to14 months. All 5 progressed to hematologicrelapse at 2, 3, 4, 7 and 7 months, respectively,from the reapparence of the ALL1/AF4 transcript. For patients who never convertedto RT-PCR negativity, the actuarialprobability of relapse and survival was100% and 0% at 14 and 24 months, respectively.By contrast, for the 10 patientswho reached a molecular remission, relapseand survival rates were 71% and 53% at84 and 100 months, respectively. A statisticallysignificant difference between the twogroups was observed with regard to theactuarial survival rate (p < 0.005). Altogether,this study represents the first prospectiveanalysis of residual disease monitoringcarried out in a substantial group oft(4;11) ALL patients. Our results emphasizethe clinical relevance of RT-PCR basedmethods for the monitoring of minimal residualdisease in this leukemic subset.CO15SERUM-FREE TRANSDUCTION OFMOBILIZED BLOOD CD34+ CELLS, ASPART OF A CLINICAL GENE MARKINGPROTOCOLS. DEOLA, A. AIUTI, J. DANDO, F. FICARA, C. BORDIGNON,M. BREGNIBone Marrow Transplantation Unit, IstitutoScientifico H san Raffaele, and Telethon Institute forGene Therapy (TIGET), Milano, ItalyIn the context of a hematopoietic cell genemarking program in patients undergoinghigh-dose chemotherapy with autograftingof mobilized blood progenitors, we developedan efficient short-time CD34+ celltransduction method, using clinical-gradeculture reagents and serum-free culturemedium. Selected CD34+ cells were transducedwith a retroviral vector encoding forthe truncated form of the human low-affinityreceptor for nerve growth factor(∆LNGFR), in the presence of clinical-graderetronectin. The time of cell manipulationwas 3.5 days, and included a 24-hr cellprestimulation, one 12-hr transduction, anda 48-hr culture period after transduction.Gene transfer rate was assessed by indirectflow cytometric evaluation of surface∆LNGFR expression. During the procedurethe cells were cultured in X-VIVO10 medium,without serum and with clinical-gradecytokines (thrombopoietin, Flt3-ligand andsteel factor) at 50 ng/ml concentration. Wehave compared this strategy to a conventionaltransduction procedure, that used thesame conditions except for the utilization

37 th Congress of the Italian Society of Hematology21of IMDM supplemented with 10% FCS. Resultsare reported in the Table:Day 0 Day 3.5 Percent Day 3.5 PercentCD34+ cells CD34+ cells transduction transduced transduction(x10e3) (x10e3) cells (x10e3) of input cellsX-VIVOSerum-free 653 1,135 14.8 167.9 25.7IMDM10% FCS 587 722.2 16.1 116.2 19.7Despite of a comparable rate of transduction,serum-free conditions resulted inhigher absolute numbers of transducedCD34+ cells (167 vs 116x10e3), due to anincreased CD34+ cell expansion rate, witha favorable balance between rate of transductionof CD34+ cells and the maintenanceof an undifferentiated cell phenotype. Weconclude that a short-time serum-freetransduction procedure is not only feasiblefor clinical purposes, but also increasesoverall gene transfer rate in comparison toconventional methods.CO16NK CELL RECOGNITION OFHETEROLOGOUS GENES USED FORGENE THERAPYC. LIBERATORE, M. CAPANNI, N. ALBI, I. VOLPI, E. URBANI,L. RUGGERI, A. MENCARELLI, A. TOSTI, K. PERRUCCIO,FR. GRIGNANI, A. VELARDIDipartimento di Medicina Clinica e Sperimentale,Università di PerugiaNK cells express receptors (KIR) which,upon interaction with their MHC class Iligands, produce a signal inhibiting killingof the autologous cell. Thus, NK cells areactivated in response to the missing expressionof self class I molecules on target cells,such as some allogeneic cells (see abstractby Ruggeri et al. in this meeting). KIR alsodistinguish peptides. Consequently, NK cellrecognition of class I alleles on target cellsis prevented, and NK lysis is triggered, byamino acid substitutions along protectivepeptides loaded onto class I molecules(Malnati M. et al, Science 1995). Replacementof self peptides with endogenouslysynthesized viral peptides may trigger theNK cell killing of virus-infected cells(Mandelboim O. et al., PNAS 1997) . Thisstudy investigated the role of NK cells aseffectors of an immune response againstautologous cells modified by gene therapy.T lymphocytes were transduced with LXSN,a retroviral vector adopted for human genetherapy which carries the selectable markergene neo, and the autologous NK responsewas evaluated. We found a) infection withLXSN makes cells susceptible to autologousNK cell-mediated lysis, b) expression of theneo gene is responsible for conferring susceptibilityto lysis, c) lysis of neo expressingcells is clonally distributed and mediatedonly by NK clones which exhibit HLA-Bw4 allele specificity and bear KIR3DL1, aBw4-specific NK inhibitory receptor, and d)the targets are cells from HLA-Bw4 + individuals.Finally, neo peptides anchoring tothe Bw4 allele HLA-B27 interfered withKIR3DL1-mediated recognition of HLA-B27,i.e., they trigger NK lysis. Moreover, neogene mutations preventing translation of 2of the 4 potentially non-protective peptidesreduced KIR3DL1+ NK clone-mediated autologouslysis. Thus, individuals expressingBw4 alleles posses an NK repertoire withthe potential to eliminate autologous cellsmodified by gene therapy. By demonstratingthat NK cells can selectively detect theexpression of heterologous genes, theseobservations provide a general model of theNK cell-mediated control of viral infections(J Exp Med 1999, in press).Supported by TelethonCO17CO-EXPRESSION OF MET AND ITSLIGAND HEPATOCYTE GROWTHFACTOR (HGF) IN HHV-8 + PRIMARYEFFUSION LYMPHOMAD. CAPELLO, 1 M. PRAT, 1 M. GALLICCHIO, 1 E. MEDICO, 2D. VIVENZA, 1 D. BUONAIUTO, 1 A. GLOGHINI, 3 G. AVANZI, 1A. CARBONE, 3 G. GAIDANO, 1 P. COMOGLIO, 2 G. SAGLIO 41Department of Medical Sciences, Amedeo AvogadroUniversity of Eastern Piedmont, Novara;2IRCC, University of Torino, Candiolo;3Division of Pathology, Centro di RiferimentoOncologico - Istituto Nazionale Tumori, Aviano;4Division of Internal Medicine and Hematology,Department of Clinical and Biological Sciences,University of Torino, Orbassano, ItalyPrimary effusion lymphoma (PEL) is a peculiarcategory of non-Hodgkin lymphoma(NHL) characterized by consistent infectionby HHV-8. PEL selectively grows in liquidphase in the serous body cavities with noformation of solid tumor masses. The bio-

22 September 26-29, 1999 - Torino-Lingotto, Italylogic basis of this growth pattern is unclear.Previous studies suggested that PEL tumorcells reflect a pre-terminal stage of B-celldifferentiation (pre-plasmacells). To corroboratethis hypothesis, we have studiedPEL (n=13) for co-expression of MET andits ligand HGF, which, in the hematopoieticsystem, are selectively co-expressed bymultiple myeloma neoplastic plasmacells.For comparison, a panel of high grade B-cell NHL composed of B-lineage diffuse largecell lymphoma and Burkitt lymphoma (n =34) was also tested. Expression of MET wasanalyzed by multiple assays, including reversetranscriptase-polymerase chain reaction(RT-PCR), flow cytometry, immunocytochemistry(ICC), Western blot, and in vitrotyrosine kinase activity assay (TK assay).Expression of HGF was analyzed by RT-PCR,scatter assay, and ELISA. All PEL tested coexpressedMET and HGF by RT-PCR. Coexpressionof MET and HGF mRNA was selectivefor PEL and scored negative in otherB-cell NHL types. Flow cytometry and/or ICCanalysis demonstrated MET protein expressionin selected PEL samples and analysisby TK assay demonstrated that the METreceptor expressed by PEL is functionallyactive. Western blot analysis showed a basalconstitutive phosphorylation of MET in allPEL analyzed, suggesting constitutive receptoractivation. Scatter and ELISA assaysdemonstrated that PEL cells release functionallyactive HGF protein (range: 0.5 ->10 ng/ml). In vitro stimulation of PEL cellswith HGF induced a rapid increase of phosphorylationof the MET 145 kD b-chain,confirming functional integrity of the MET/HGF loop. The implications of these dataare twofold. First, co-expression of MET/HGFis a selective feature of PEL among NHL andcorroborates the hypothesis that PEL is histogeneticallyrelated to pre-terminally differentiatedB-cells. Second, because HGFinduces proliferation and motility, the MET/HGF signal pathway may affect the biologicproperties and growth pattern of PEL.CO18CONSTITUTIVE EXPRESSION ANDTYROSINE PHOSPHORYLATION OF SHCPROTEINS IN CHRONICMYELOGENOUS LEUKEMIAA. BONATI 1 , C. CARLO-STELLA 3 , P. LUNGHI 1 , R. ALBERTINI 1 ,S. PINELLI 1 , E. MIGLIACCIO 2 , G. VALMADRE 1 , E. RIDOLO 1 ,I. TASSONI 1 , A. TABILIO 4 , P. DALL’AGLIO 1 , P.G. PELICCI 1,2the 1 Institute of Medical Pathology University of Parma;2the European Institute of Oncology, Milano;3the Chair of Hematology, University of Parma;4the Chair of Hematology, University of Perugia, ItalyShc cytoplasmic proteins, including p66 Shc ,p52 Shc , p46 Shc , are among the targetsthrough which growth factor receptorstransmit mitogenic signals. Shc proteinsbecome phosphorylated upon activation ofboth receptor tyrosine kinases (RTKs) andsurface receptors that have no intrinsic TKactivity but can signal by recruiting andactivating cytoplasmic TKs. Unlike parentalcells, fibroblasts overexpressing a humanShc cDNA acquire partial independencefrom exogenous growth factors, show anchorage-independentgrowth and formtumours in nude mice. Using continuousleukemic cell lines, Shc proteins have beenshown to be substrates of BCR/ABL fusionproteins. In this study, we investigated theexpression and tyrosine-phosphorylationstatus of Shc proteins in chronic myelogenousleukemia (CML) primary cells. CD34 +cells from CML in blast crisis (n = 11) aswell as CD34 + and CD34 - cells from CML inchronic phase (n = 4) were studied. NormalCD34 + and CD34 - cells from healthydonors were also analyzed. Shc isoforms,including p52 Shc , p46 Shc and p66 Shc , weredemonstrated to be expressed and stronglytyrosine-phosphorylated in CML in blasticphase and in CD34 + cells of CML in chronicphase. In contrast, Shc proteins were notphosphorylated in normal marrow-derivedCD34 + cells which showed low or barely levelsof Shc proteins tyrosine-phosphorylation.The lack of tyrosine-phosphorylationof Shc proteins in normal CD34+ cells reflecteda inactive functional status sinceboth Shc expression and tyrosine-phosphorylationwere instead found in the normalperipheral blood CD34+ cells from G-CSFtreated samples A co-immunoprecipitationof Shc proteins with p210 BCR/ABL or p190 BCR/ABLbut not with normal p145 ABL was observedin CD34 + leukemic cells. Tyrosine-

37 th Congress of the Italian Society of Hematology23phosphorylation of the three Shc isoformswas present in the immunoprecipitates.These results suggest that Shc protein phosphorylationis an important step of activationof signalling pathways in CML CD34 +cells; this behaviour could create a cascadeof oncogenes activation beginning withp210 BCR/ABL and p190 BCR/ABL constitutive phosphorylationwhich in turn activate Shc proteins.The nature of adaptor proteins of Shcisoforms may facilitate to engineer novelmolecules to inhibit their functions, thusblocking the dysregulated proliferation triggeredby BCR/ABL by sparing CD34+ normalhematopoietic precursors.

24 September 26-29, 1999 - Torino-Lingotto, ItalyMULTIPLE MYELOMACO19CHROMOSOMAL ABERRATIONS INNEWLY DIAGNOSED MULTIPLEMYELOMAN. TESTONI, D. RUGGERI, P. TOSI, C. CARBONI,S. PELLICONI, E. IACURTI, G. MARTINELLI, S. RONCONI,E. ZAMAGNI, M.CAVO, S. TURAIstituto di Ematologia ed Oncologia Medica“Seràgnoli”, Università di BolognaCytogenetic studies in multiple myeloma(MM) are often limitated, because of difficultiesto obtain a sufficient number ofevaluable metaphases, due to the low proliferativeactivity of neoplastic clone. Up tonow, few studies have assessed the impactof specific abnormalities on prognosis andfocused on short survival for patients withaberrations of chromosome 13 (monosomyor partial deletion) and 11q13 (partial deletionor translocation). We have studiedthe karyotypic pattern of 54 newly diagnosedpatients with MM, enrolled ontomyeloablative therapy “Bologna 96” protocol.An abnormal karyotype was detectedin 21 patients (42.9% of evaluable patients).Almost all patients showed a complexpattern, with hyperdiploidy in 5 patients(23.8%), pseudodiploidy in 9 patients(42.9%) and hypodiploidy in 7 patients(33.3%). The number of affected chromosomesranged from 1 to 17 (median number5), with at least one trisomy in 47.6%,one monosomy in 42.9% and one translocationin 76.2% of patients with abnomalkaryotype. The most common numerical aberrationswere chromosomes 3, 5, 9 e 15trisomies and chromosome 13 monosomy;while the structural aberrations involvedmostly 14q, 1p, 11q, 1q, 16p, 12p. Theinvolvement of 14q32 represented the mostcommon abnormality in MM. We have founda cytogenetic involvement of the 14q32 inabout 30% of abnormal cases; these included3 patients with t(11;14) (q13;q32)and 1 patient with a variant t(1;11;14)(q21;q13q32). Preliminar studies ofevaluable patients, at least after the firstphases of therapeutic protocol, the responserate was 25% in the patients with chromosome13 aberrations and 46.7% in the patientswith normal karyotype. No patientwith chromosome 13 aberrations is in remission,while 27.3% of the patients withdiploidy and 7.1% of the patients with otherabnormalities are in remission. Further observationsof follow-up of these patients arenecessary to define the possible role of chromosomalaberrations on prognosis in MM.CO20LOSS OF TCR DIVERSITY IN MULTIPLEMYELOMA PATIENTS AFTER HIGH-DOSE CHEMOTHERAPY ANDPERIPHERAL BLOOD PROGENITORCELL TRANSPLANTATIONS. MARIANI, M. COSCIA, B. BESOSTRI, S. PEOLA,M. FOGLIETTA, A. BIANCHI, J. EVEN*, G. RESTAGNO°,M. BOCCADORO, M. MASSAIA. A. PILERIDivisione Universitaria di Ematologia, Torino, Italy;°Dipart. di Patologia Clinica, O.I.R.M. Sant’Anna,Torino, Italy *Inserm U2777/Dept. d’Immunologie,Institut Pasteur, Paris, FranceThe remission phase is currently consideredas the most appropriate setting fordelivery immunotherapy-based regimens.However, little is known about the T-cellimmune competence status of MM patientsin first remission after high-dose chemotherapyand peripheral blood progenitor cell(PBPC) transplantation. We have investigatedthe overall complexity of the TCR repertoireexpressed by MM in first remissionby estimating the reciprocal usage of functionalBV gene segments and measuring ineach of them the distribution of the CDR3region lenght. Starting from cDNA samples,we used a combination of two PCR reactions,the second one named run-off andmade with fluorescent oligonucleotides;then, the results have been submitted to asoftware analysis. On average, the 33.6%of the total TCRBV repertoire in each individualMM showed an oligoclonal CDR3lenght distribution vs the 3.2% in the controls.The TCRBV repertoire analysis wasextended to MM patients at diagnosis andpatients with monoclonal gammopathy ofundetermined significance (MGUS). On average,oligoclonality involved the 18.0%and 5.5% of the whole TCRBV repertoire inMM patients at diagnosis and MGUS, respectively.Thus, evolution from MGUS toovert MM is associated with a loss of TCR

37 th Congress of the Italian Society of Hematology25diversity, while the further loss of TCR diversityobserved in the remission phase islikely due to the transplantation procedureitself. Thus, any immunotherapy-based approachdelivered in the remission phaseshould be aimed at: 1) recruiting tumor-specificT-cell effector clones; 2) recovering theoverall complexity of the TCR repertoire.CO21CLINICAL VALIDATION OFDIAGNOSTIC CRITERIA FOR LOW RISKIgG MGUSL. BALDINI, A. GUFFANTI*, M. COLOMBI, A. ALIETTI,M.L. LA TARGIA, R. CALORI, G. ANNONI°, A.T. MAIOLOServizio di Ematologia,°Divisione di Geriatria,Università degli Studi, Ospedale Maggiore,I.R.C.C.S. and *Divisione di Medicina I, Ospedale“Fatebenefratelli e Oftalmico”, MilanDuring the course of a recent investigationof 386 patients with MGUS monoclonalgammopathy (Blood: 87, 3, 912, 1996), wedefined the hematological variablescharacterising a group of patients at verylow risk of evolution (low-risk MGUS), inwhom a non-invasive diagnostic approachand a relatively contained follow-up couldbe adopted. We here report the follow-updata relating to a group of patients withlow-risk IgG MGUS, with the aim of validatingour previous proposal in terms ofthe risk of evolution into multiple myeloma(MM). The diagnostic criteria of low-risk IgGMGUS were as follows: serum MC ≤1.5 g/dL; absence of Bence-Jones proteinuria;normal serum polyclonal Ig levels, hematiccrasis and renal function; absence of symptoms.Since 1996, the patients satisfyingthese criteria at diagnosis have not undergoneskeletal radiology or bone marrow aspiration;the frequency of clinical and hematologicalexaminations is four-monthlyin the first year, si-monthly in the second,and annually thereafter. The frequency ofevolution into MM was evaluated in 178 patientwith low-risk and 140 with non lowriskIgG MGUS. The distribution of the mainclinical variables were as follows (low-riskvs non low-risk): M/F ratio: 0.93 vs 0.73;median age: 59 (21-84) vs 61 (20-86)years; κ/λ ratio: 1.86 vs 1.78; median serumMC (g/dL): 1.2 (0.2-1.5) vs 1.9 (0.5-3.5). The median follow-up was 80 (24-240)vs 66 (12-156) months. Only one patientin the first group developed symptomaticMM (8 years after diagnosis) vs. 16 in thesecond group (4 stage I, 12 stage II-III; 6deaths) (p

26 September 26-29, 1999 - Torino-Lingotto, Italyspectively. All the patients that were enrolledto treatment were consideredevaluable (intention-to-treat); a responsegreater than 50% was obtained in 51% ofcases (MIP = 49%, MP = 55%, p = ns), 16patients (6.7%) showed a complete remissionwith disappearance of M componentat immunofixation (MIP = 8%, MP = 5%, p= ns). Patients enrolled in MIP protocolshowed significantly lower PMN counts aftertreatment (WHO grade 3-4 neutropeniaafter courses 1, 2, 5 and 6; p

37 th Congress of the Italian Society of Hematology27sions of melphalan 100 mg/m 2 (MEL100)were delivered. Clinical outcome of myelomapatients receiving MEL100 was thencompared with that of patients receivingmelphalan 200 mg/m 2 followed by autologoustransplantation (AT) and oralmelphalan and prednisone (MP) conventionalchemotherapy. After cyclophosphamide(4gr/m 2 ) and G-CSF (10 µg/Kg/die)three leukapheresis were performed andharvests cryopreserved. Melphalan 100 mg/m 2 (MEL100) was infused with stem cellsupport and repeated after 2 months. Thethird MEL100 course was only delivered topatients who did not reached complete remissionafter 2 MEL100 courses. Seventyonemyeloma patients up to the age of 74entered the protocol at diagnosis. After thefirst course, the median duration of severeneutropenia and thrombocytopenia was 5and 2 days respectively. Transfusion requirementwas needed in 60% of patients.Mucositis was observed in 14% of patients.Fever of unknown origin was the major extra-hematologictoxicity affecting 27% ofpatients, and requiring hospitalisation in25%. No cumulative toxicity was observedafter the second and third course. The clinicaloutcome of patients receiving MEL100was compared with 71 pair matches (medianage 64) selected from patients treatedat diagnosis with MP to match for age andß2-microglobulin. Patients receivingMEL100 were also compared with historicalcontrol of 54 patients treated at diagnosiswith single or double AT. Completeremission was 47% after MEL100, 5% afterMP, and 50% after AT. Median eventfreesurvival was 34 months in the MEL100group, 17.7 months in the MP group, and38.9 months in the AT. Both MEL100 andAT had a significantly longer event-free survival(p < 0.0002) than the MP group. Medianoverall survival was 56+ months forMEL100, 48 months for MP, and 77.4months for AT. In conclusion, we have demonstratedthat MEL100 is a safe and effectiveprocedure. Compared with MP, bothMEL100 and AT improved clinical outcomeof myeloma patients.CO25MULTIPLE MYELOMA: THE NUMBER OFREINFUSED PLASMA CELLS INPATIENTS TREATED WITHINTENSIFIED CHEMOTHERAPY IS NOTRELATED TO PATIENT PROGNOSISP. O MEDÉ, A. PALUMBO, A. DOMINIETTO, C. ARGENTINO,S. BRINGHEN, F. GIARETTA, L. GIACCONE, C. RUS,B. ORTOLANO, S. TRIOLO, A. PILERI, M. BOCCADORODivisione Universitaria di Ematologia, AziendaOspedaliera S. Giovanni Battista di Torino, Torino, ItalyIn Multiple Myeloma (MM), a major concernin autotransplant with PBPC is representedby the presence of contaminatingtumor cells always detected in PB andstaminoapheresis products by molecular biologytechniques. Reinfusion of plasma cells(PC) during autotransplant could be relatedto disease recurrence in MM. The relationshipbetween the number of reinfused PC,response to chemotherapy and event-freesurvival (EFS) have been evaluated in 77MM patients at diagnosis treated with intensifiedchemotherapy between March1995 and December 1998. PBPCmobilisation was obtained with cyclophosphamideand G-CSF; patients were thentreated with melphalan 100mg/m 2(MEL100) followed by PBPC support. Twoto three courses were administered with atwo-months interval. PC were detected andquantitated by cytofluorimetric analysis bylabelling cells with monoclonal antibodies.Anti-CD38, CD138, and anti-cytoplasmic Igwere used to identify PC. Median numberof reinfused PC was 4.02 x10 6 /Kg (range:0.5-30.94). No correlation has been demonstratedbetween the number of reinfusedPC and response to chemotherapy: patientsreaching CR received 3.75x10 6 /Kg PC, whilethose with a PR or no response received5.9 and 3.2x10 6 /Kg PC, respectively. Similarly,no correlation was observed betweenthe number of reinfused PC and EFS. EFSwas 40.9 months for patients receiving lessthen 4.02 x10 6 /Kg PC, 36.4 months forthose receiving more than median value(p=0.55). Phenotypical analysis of BM andcirculating PC present in staminoapheresiscollections showed a marked difference insurface antigen pattern: BMPC are predominantlyCD45-, CD19-, CD56+, while contaminatingPC are CD45+, CD19+, CD56-;proliferative activity of PC, analyzed bycytofluorimetric techniques, was signifi-

28 September 26-29, 1999 - Torino-Lingotto, Italycantly higher in contaminating PC thanBMPC (18.6% +/-2.7% vs 2.5% +/-1.2;p

37 th Congress of the Italian Society of Hematology29chemosensitive disease and female sex;progression-free survival=chemosensitivedisease. Case-matching analysis betweena subgroup of 12 pts receiving PBSC-alloTX and a control subgroup of pts who weretransplanted with BM revealed a lower TRMand a higher frequency of chronic GVHD inthe PBSC subgroup as compared to the BMsubgroup (13% vs. 42% and 20% vs. 45%,respectively). Finally, retrospective detectionof MRD by ASO-PCR showed persistentlynegative PCR results in 8 out of 12pts who attained clinical remission and couldbe evaluated. Four of these pts remainedin continuous clinical and molecular CR for3 to 9 yrs. It is concluded that allo TX canbe actually offered to MM pts at a risk ofdeath comparable to that expected with anyother hematologic malignancy. This procedureis associated with prolonged clinicaland molecular remission in a certain fractionof pts, especially if they are femalesand/or have chemosensitive disease at TX.

30 September 26-29, 1999 - Torino-Lingotto, ItalyHEMOSTASIS ANDTHROMBOSISis highly associated with LPD and MPD:therefore a form of AvWS must be supectedwhen an excessive bleeding occurs in patientswith LPD and MPD.CO28ACQUIRED VON WILLEBRANDSYNDROME (AvWS) IS HIGHLYASSOCIATED WITH LYMPHO-MYELO-PROLIPHERATIVE DISORDERS:REPORT ON 211 CASES OF THEINTERNATIONAL REGISTRY OF AvWSA.B. FEDERICI, J.H.RAND, P. BUCCIARELLI, P.M. MANNUCCI(ON BEHALF OF THE INTERNATIONAL SCIENTIFIC SUB-COMMITTEEON VWF)Angelo Bianchi Bonomi Hemophilia ThrombosisCenter, IRCCS Maggiore Hospital - University ofMilan, Italy and Mount Sinai Medical Center, NewYork, USAIntroduction: Acquired von Willebrandsyndrome (AvWS) is a rare acquired bleedingdisorder similar to the congenital vWDin terms of laboratory findings. Diagnosisof AvWS can be very difficult and treatmenthas usually been empirical. Aims of thestudy: a retrospective analysis of the patientswith AvWS reported to propose betterstrategies to identify and characterizenew cases of AvWS. Methods: A questionnaire,devised to collect specific informationon AvWS, was sent to all the membersof ISTH. Results: Information about 221patients from 50 Centers world-wide werecollected and analyzed by the coordinators.AvWS was associated with lympho-proliferative(LPD,47%) or myelo-proliferative(MPD,19%) disorders, cardiovascular diseases(CVD,13 %), neoplasia (NEO,7 %)and others diseases (OTH,14 %). The results(as % or mean values) are:AvWS (total,221): LPD(98) MPD(40) CVD(27) NEO(14) OTH(32)sex (% of male) 59 38 56 50 46age at onset (yrs, mean) 63 46 57 61 62bleeders (%) 70 38 11 50 50in follow-up (%) 58 18 59 50 67vWF:Ag (U/dL, mean) 25 68 120 32 31vWF:RCo(U/dL,mean) 8 22 68 17 7fVIII:C (U/dL,mean) 21 33 131 23 25pos anti-FVIII/vWF (%) 14 2 n.t. 14 12Effective therapy with:ddavp (%) 31 15 7 21 19fVIII/vWF conc (%) 38 5 7 43 22immunoglobulin (%) 16 0 0 14 3Conclusions: our data suggest that AvWSCO29MOLECULAR MECHANISMSPREDISPOSING TO ISCHEMICJUVENILE STROKED. DE LUCIA (1), S. PEZZELLA (1), V. DEL GIUDICE (1),M. LAURETANO (1), G. MAISTO (1), R. MAROTTA (1),F. DE FRANCESCO (2), M. MARGAGLIONE (3), E. GRANDONE(3), G. DI MINNO (4), M.L. PAPA (5)(1) Institute of General Pathology and Oncology,(2) Institute of Internal Medicine, UniversityFederico II of Naples. (3) Unit of Atherosclerosisand Thrombosis, IRCCS; San Giovanni Rotondo(FG). (4) Institute of Internal Medicine andGeriatry, University of Palermo. (5) Laboratory ofHaemostasis and Thrombosis, New PellegriniHospital; NaplesThe main causes of ischemic stroke areatherothromboembolism and thromboticocclusion of lipohyalinotic small-diameterend arteries. Marked differences are alsoseen between younger and older patientsas to the risk factors of stroke. In juvenile(40 years) patients the classicalcardiovascular risk factors of hypertension,diabetes, high cholesterol, myocardial infarction,and cardiac arrhytmias are seen.Although 4% of cerebral infarcts in theyoung can be attributed to hematologic disturbancesthat predispose to thrombosis,the frequency of cerebral infarcts causedby prothrombotic states is not known. Toevaluate the role of gene polymorphismsin the genesis of cerebral infarcts in youngpatients, we quantitated these mutationsin a group of patients with idiopathic cerebralinfarction and compared the resultswith those of healthy control subjectsmatched for age and sex. We genotyped164 consecutive patients under 40 years ofage with cerebral infarction of undeterminedcause. Mutations in FV and FII genes, andpolymorphisms in MTHFR, PAI-1 and ACEgenes were carried out. Factor V Q506 allelewas found in 7 (4.3%) patients comparedto that observed in control group (2;1.2%. X 2 =.001; p=ns). Factor II A20210

37 th Congress of the Italian Society of Hematology31allele was depicted in 17 (10.3%) patients(in 1 at homozygous form) compared to 3(1.8%) in controls (X 2 =.9; p= ns). TheC677T transition in the MTHFR gene wasfound in 72 (44%) at heterozygous stateand in 39 (24%) at homozygous state.Genotype frequencies in control subjectswere 58 (35%) for heterozygotes and 12(7.3%) for homozygotes (X 2 =5.19;p=0.02). PAI-1 4G allele was detected in120 (55.2%) patients compared to thatfound in control group (77, 30.4%; X 2 =5.3;p= 0.02). The frequency of D allele in ACEgene polymorphism was 61% in patientswhile in controls ranged 37% (X 2 =4.0;p=0.04). Our data show that polymorphismsof the genes of the natural anticoagulantsystem and vascular vessel wall aremore frequent in young individuals sufferingfrom ischemic stroke compared tohealthy subjects. From a clinical point ofview, these informations would be beneficialfor studies which will investigate inheritedbasis of arterial brain thrombophilia.CO30MODULATION OF THEHYPERCOAGULABLE STATE BYALL-TRANS-RETINOIC ACID INPATIENTS WITH BREAST CANCERA. FALANGA, *S. TOMA, R. CONSONNI, *R. PALUMBO,*P. RAFFO, S. MARZIALI, **G. DASTOLI, T. BARBUIHematology Dept., Ospedali Riuniti, Bergamo;* National Cancer Istitute , CBA, Genoa; and**Roche S.p.a., Monza; ItalyActivation of the hemostatic system andthrombotic complications are frequent inmalignant disease. The differentiatingtherapy with all-trans-retinoic acid (ATRA)efficiently controls the severe coagulopathyassociated with acute leukemias. To evaluatewhether ATRA is able to modulate bloodclotting activation and thrombotic eventsalso in solid tumors, we have prospectivelystudied fifty-five consecutive patients withlocally advanced operable breast cancerenrolled in a phase Ib Italian study of biologicalactivity and safety of ATRA ±Tamoxifen (Tam) ± Interferon alpha 2(IFN). Pre-operatively, patients (n = 5 /group) were treated for 21 days with escalatingdoses ATRA (15, 45, 75 mg/m2/don alternate days; groups A15, A45, A75)or ATRA + 20mg/d T (groups A+T) or ATRA+ Tam + 3 M IU/d INF (groups A+T+I).Two groups received Tam (group T) or INF(group I) alone, respectively. Plasmasamples from all subjects were obtained atbaseline, on days 7, 14 and 21 of therapyand 30 days after operation (performedwithin 28 days from start). Parametersmeasured were: 1. markers of hypercoagulation(TAT complex, F1+2, D-Dimer,FVIIa); 2. fibrinolysis proteins (t-PA, PAI-1, and euglobulin lysis area [ELA]); and 3.endothelium activation markers (thrombomodulin[TM] and von Willebrand factor[vWF]). At baseline the overall cancer patientgroup showed levels of TAT, F1+2, D-Dimer, FVIIa and PAI-1 significantly greaterthan those of a control non-cancer subjectgroup. During treatment, the hypercoagulationmarkers were not different betweenA15, A45, A75 groups, but after operationwere decreased in A45 and A75groups compared to A15. In A+T groups,there was a significant decrease in TAT, D-Dimer and FVIIa levels compared to thegroup on T alone (F1+2 and FVIIa;p

32 September 26-29, 1999 - Torino-Lingotto, ItalyCO31INCREASED PREVALENCE OFTHROMBOSIS IN PATIENTS WITHMULTIPLE CAUSES OFTHROMBOPHILIAG.FINAZZI, R. CONSONNI, S. MARZIALI, M. ZANOTTI,T. B ARBUIDivisione di Ematologia, Ospedali Riuniti di BergamoFrom 1984 to 1999 we studied 275 patientswith hereditary thrombophilia belongingto 105 families. 253 (92%) patientsshowed a single cause of thrombophilia(FVLeiden =149; FII20210=57; PC =13;ATIII =14; PS =20), whereas 22 had twoor more associated causes of congenital oracquired thrombophilia (FVLeiden+FII20210=9; FVLeiden+HOCys=3; FVLeiden+LAC=1; FII20210+PS =1; FII20210+PC= 1;PC+HOCys =1; FII20210+LAC=4;FVLeiden+FII20210+HOCys = 1; FVLeiden + LAC+HOCys = 1). In this study we compared thetwo groups of patients with single or multiplethrombophilic defect for the prevalence,type (arterial or venous) and recurrenceof thrombosis and age of onset of thefirst thrombotic event. The prevalence ofthrombosis was significantly higher(p

37 th Congress of the Italian Society of Hematology33tologous platelet concentrates may be considered.To evaluate this technique, we appliedit to women undergoing myeloablativetherapy for high-risk breast cancer. Plateletswere collected by plateletapheresis atplatelet rebound following cyclophosphamideadministration, frozen and reinfusedwhen platelet count dropped below 20x10 9 /l after thiotepa and L-PAM + autologousstem cell transplantation. In a first groupof 32 patients, platelets were cryopreservedin 5% DMSO at -180°C after computer-controlledrate (CR) freezing. Platelet loss duringfreezing-thaw-wash procedure was37%. 28 patients required platelet support:24 received only autologous platelets, while4 required additional allogeneic support.Mean corrected count increment (CCI) at 1hour was 8.7x10 9 /l (CCI in 15 control patientssupported with fresh allogeneic platelets:13.3). In vitro release reaction andaggregation of cryopreserved platelets was60% of fresh allogeneic platelets. In a secondgroup of 14 women, autologous plateletswere cryopreserved in 2% DMSO-ThromboSol either by direct insertion in a-80°C freezer or by CR freezing and storagein liquid nitrogen. Platelet loss was 50%in both groups. 6 of 7 patients receivingplatelets cryopreserved at -80°C (meanCCI: 2.0) required additional allogeneicplatelet support, while only 1 of 7 patientsreceiving transfusion of CR frozen plateletsrequired allogeneic transfusion (mean CCI9.1). With both freezing techniques, plateletaggregation was reduced to 25% of controland 25% of platelets had increased surfaceexpression of activation antigens andreduced expression of GPIb. MembraneGPIIb-IIIa was reduced only in plateletscryopreserved at -80°C. In conclusion, autologoustransfusion of cryopreserved plateletsis feasible and storage in liquid nitrogenwith 5% DMSO following CR freezingis actually the method of choice.CO33PLATELET TRANSFUSION AFTER BEAMHIGH-DOSE CHEMOTHERAPY INPATIENTS WITH LYMPHOMA:PROGNOSTIC FACTORS ANDGENERATION OF A RISK MODELA. ROSSI, S. CORTELAZZO, P. BELLAVITA*, E. OLDANI,V. GOTTARDI. T. BARBUIDivisione di Ematologia e *Servizio diImmunoematologia e Centro Trasfusionale, Osp.Riuniti di BergamoPurpose: to identify risk factors for chemotherapy-inducedthrombocytopenia requiringplatelet transfusions (PT) in patients(pts) with non-Hodgkin lymphoma (NHL)or Hodgkin’s Disease (HD) undergoing autologousstem cell autotransplant (ASCT)after BEAM high-dose chemotherapy (HDC).Patients and methods: since May 1989to March 1999 171 pts (median age 45years, range 16-67) with NHL or HD weretreated with BEAM HDC followed by ASCT.The graft consisted of peripheral blood stemcells (PBSC, 149 pts), bone marrow (BM,18 pts) or both (4 pts). In 94 pts the transplantwas given as part of upfront therapywhile in 77 pts was carried out as part ofsalvage treatment for resistant or relapsedNHL or HD. PT were given prophylacticallyif platelet count was less than 20.000/mcland therapeutically whenever necessary.The following prognostic factors were examined:characteristics at presentation[age, gender, histology, stage, performancestatus, LDH, extranodal sites, previous chemotherapyregimens and cycles, PT beforetransplant], at transplant time [number ofCD34+ cells reinfused, type of reinfusion(BM- vs PBSC vs BM+PBSC), platelet count,state at transplant (CR vs PR vs NR/PROGR)] and after transplant [infections,hemorrhagic events, G-CSF, red blood celltransfusions]. Results: 32% of pts in firstline and 38% of resistant or relapsed ptswere transfused more than 2 times and significanthemorrhagic events (EORTC grade2) were observed in 23% and 24% of thetwo groups. The use of G-CSF, infections,platelet count 45 years were associatedwith increased need of PT byunivariate analysis; only N° of CD34+ cells(0.046), G-CSF (0.009), platelet count less

34 September 26-29, 1999 - Torino-Lingotto, Italythan 100.000 /mmc (0.000) and source ofstem cells (0.006) retained prognostic significanceby multivariate analysis. Usingthese 4 parameters, a risk model was createdgiving each variable an arbitrary riskcoefficient of 1. Thus, the calculated probabilityof being transfused more than 2times was 5%, 32% and 89% for pts with0,1 and more than 1 risk factor respectively.Conclusions: The risk index detected inthe setting of transplanted lymphoma ptscould be useful to identify pts at high riskfor chemotherapy-induced thrombocytopeniarequiring PT. This group might be suitablefor exploring the role of thrombopoieticfactors to reduce the need for platelet support.CO34PLATELET ACTIVATION INCONCENTRATES FOR TRANSFUSIONUSE; A STUDY WITH THE EMPLOYMENTOF THE ANNEXIN VA. SANTAGOSTINO, V. BOLIS, R. CAMINITI, P. PROSPERI,M. ROCCELLA CONTIServizio di Immuno-ematologia, Ospedale S.Andrea,VercelliPrevious studies demonstrated that theemployment of a recombinant placentalprotein, the annexin V, might represent avery highly sensitive and specific methodto recognize activated platelets. This proteininteracts with the prothrombinasebindinganionic phospholipids exposed onplatelet surface upon activation. This probeis more sensitive than others previouslyutilized for in vivo and in vitro detection ofactivated platelets including monoclonalantibodies like CD63, CD62p and PAC1. Inthe present study we wanted to applyannexin V test in order to evaluate the plateletsactivation state in concentrates collectedby apheresis, conducted with anAutopheresis Baxter, and in concentratescollected by centrifugation from single donorunits. This test has been performed onday 1, in order to establish some differencesin preparation tecniques, and on day3 and 5 to evaluate the influence of conservation;furthermore we have evaluatedpH, the white blood cell and the plateletcount to investigate possible correlations.The percentage of activated plateled hasbeen evaluated by flow cytometry utilizinga double staining Annexin V FITC/CD41 PE.We performed 119 determinations on 90platelet concentrates and on 29 apheresisunits. The mean value of annexin V on day1 was 7.3+8.3 in the platelet concentratesand 4.8+5.2 in apheresis units (p=n.s.).In the first group the percentage of unitswith activated platelets>10% was 29%while in the second group it was 45%(p=0.1). During conservation we have seena gradually costant increment of the positivityof annexin V and the increment ofthe value were stronger in the units withhigh value on day 1. The comparison betweenthe value obtained on day 1, 3 and 5was performed with variance analysis andshowed significant differences (p=0.01). Atthe same time we noted during conservationa progressive reduction in the value ofpH (mean value of day 1: 7.4, of day 5:7.0; p=0.008). The application of the linearregression test showed a significantcorrelation between reduction of pH andincrement of annexin V even if a highervalue of annexin did’nt always correspondto a lower value of pH. Furthermore we havenot found a significant correlation betweenpercentage of platelet activation and whiteblood cell count or platelet count. In conclusionthe employment of the annexin Vin order to evaluate platelet activation isan easy, simple and sensible method forthe periodic evaluation of quality productionand conservation of platelet concentrates.CO35RETICULATED PLATELETS ANDGLYCOCALICIN: A NOVEL APPROACHIN THE STUDY OFTHROMBOCYTOPENIAA. STEFFAN, P.F. BALLERINI *C. MURARI *, M.BOCCALON*,L.ABBRUZZESE, G.C. DONATI*, L. DE MARCOBlood Bank I.R.C.C.S. Aviano (PN),*Nucleo Ematologico Operativo, Med I, De GironcoliHospital Conegliano (TV)Thrombocytopenia is a pathological conditionconsequent to a large variety ofcauses. It may depend on a decreasedplatelet production or an increased plateletconsumption. The identification of the underlyingpathological mechanism is importantfor a correct clinical, prognostic andtherapeutic strategy. Determination of

37 th Congress of the Italian Society of Hematology35platelet life-span, evaluation of bone marrowmegakaryocytes and platelet morphologyare largely used in distinguishingthrombocytopenia due to defective productionor accelerated peripheral destruction.The diagnostic value of platelet antibodiesis still not completely understood. Recentlytwo new non invasive assays have beeenintroduced: the Glycocalin (proteolitic fragmentof GPIb) which seems to be able toevaluate the platelet turn-over and ReticulatedPlatelet Count (the percentage ofyoung platelet), indicating a shift towardsincreased thrombopoiesis, therefore a peripheralmeasure of bone marrow activity.A total of 72 patients was selected for thisstudy (17 Acute ITP, 35 Chronic ITP, 20Aplastic). We have also studied 60 healthysubject matched for age and sex , as control.The results are summarized in the followingtable:NORMAL Acute ITP Chronic-ITP APLASIA(60) (17) (35) (20)PLT x10 3 /ml 235±45 32.8±32.3 75.9±22.9 77±38PRET % 0.95±0.3 5.05±2.85* 2.56±1.44* 1.0±0.3GLC mg/ml 0.8±0.2 0.92±0.34 0.92±0.35 0.43±0.31GLC Index 0.9±0.2 19.7±23.6* 3.1±1.68* 1.28±0.36Direct Ac anti-plts - 4 positive 9 positive -Indirect Ac anti-plts - 8 positive 6 positive -* p

36 September 26-29, 1999 - Torino-Lingotto, ItalyCHRONIC LYMPHOCYTICLEUKEMIA AND LYMHPOMASCytogenetic and fluorescence in situ hybridization(FISH) analyses were performed,to study the clinicobiologic significance ofacquired deletions involving the ataxiateleangiectasialocus (ATM-) in 135 non-Hodgkin’s lymphomas (NHL). An hemizygousATM- was seen in 44-88% of cells in18 cases (13.3%): 5 patients had a B-cellhigh grade NHL, 8 patients had B-cell lowgradeNHL, 5 patients had a T-cell lymphoma.Twelve out of 18 ATM- patients hada complex karyotype, 13 out of 18 had morethan 90% abnormal metaphases (AA karyotypestatus); +12, 13q14 deletion or 17p13deletion were seen in 8, 4 and 4 cases, respectively.Patients with ATM- had morefrequently a T-cell phenotype (p=0.009),complex karyotype (p=0.001) and AAkaryotype (p=0.008) as compared withpatients without ATM-. Dual colorcohybridization of a BCL1 probe or TCL1probe and of the ATM probe showed ATMtobe possibly a secondary event in 4 BCL1rearranged cases and to be an early eventin 2 TCL1 rearranged lymphomas. A highlysignificant correlation was found betweenATM- and shorter survival (p=0.0002). Thiscytogenetic lesion maintained its prognosticimportance in multivariate analysis(p=0.0036), along with complex karyotype(p=0.017), performance status(p=0.0005), serum LDH level (p=0.0055),male sex (p=0.001) and splenomegaly(p=0.0268). Though possibly not representinga primary genetic lesion in the majorityof cases, acquired ATM- has a clinicobiologicimportance in NHL, possibly representing amajor cytogenetic determinant of outcome.CO37ACQUIRED DELETION OF THE ATAXIATELEANGIECTASIA (ATM) LOCUS INNON-HODGKIN’S LYMPHOMA:CORRELATION WITHCLINICOBIOLOGICAL FEATURESA. CUNEO, R. BIGONI, G.M. RIGOLIN, M.G. ROBERTI,A. BARDI, M. NEGRINI, S. SABBIONI, G. RUSSO,M.G. NARDUCCI, C. MINOTTO, P. AGOSTINI, A. TIEGHI,D. CAMPIONI, R. MILANI, N. PIVA, G. CASTOLDIDipartimento di Scienze Biomediche e TerapieAvanzate - Sezione di Ematologia and Dipartimentodi Medicina Sperimentale e Diagnostica - Sezione diMicrobiologia University of Ferrara, Italy andIstituto Dermopatico dell’Immacolata, Roma, ItalyCO38PERIPHERAL BLOOD CD 38 CELLEXPRESSION PREDICTS SURVIVAL INB-CELL CHRONIC LYMPHOCYTICLEUKEMIA (CLL)F. MORABITO, M. MANGIOLA, C. STELITANO, B. OLIVA,V. CALLEA, M. CUZZOLA, P. IACOPINO, F. NOBILE,°F. MALAVASI, M. BRUGIATELLIDipartimento di Emato-Oncologia, AO Reggio Calabria;°Istituto di Biologia e Genetica, Università di AnconaThe aim of this study was to evaluate theprognostic impact on survival of CD38 expressionof peripheral blood lymphocytesin 161 previously untreated CLL patients.All cases fulfilled the recommended diagnosticcriteria and showed dim SIg, CD5 + ,CD19 + , CD23 + immunological pattern. Allpatients were prognostically stratified accordingto Rai and Binet stages and TotalTumor Mass (TTM) score. Rai stages weregrouped in 0, I-II and II-IV stages, accordingto NCI CLL guidelines. Bone marrowbiopsy was performed in 113 cases andevaluated in agreement with Rozman criteria.Doubling time (DT) calculated in 115patients was < 12 months in 12 cases only,possibly because more than half patientsreceived first line chemotherapy at diagnosisbecause of advanced disease; thus, thisparameter could not be included in the prognosticevaluation. Lymphocytes of patientsyounger than 60 years showed significantlylower CD38 percentage mean value as comparedto older patients (p=0.016). On theother hand, a brighter CD38 cell expressionwas documented on lymphocytes ofpatients with a TTM score < 9 as comparedto those with higher TTM score. Similarly,CD38 mean fluorescence intensity (mfi) wasdifferently distributed among Rai stages.Both the percentage and the mfi valuescorresponding to the 25th, 50th, and 75thpercentiles were calculated. After giving ascore of 0, 1, 2 and 3 for each percentile, arisk model was designed based on bothpercentage and mfi values, by summingindividual scores. A favorable prognosticgroup (CD38 score < 3) and a high riskgroup (CD38 score > 3) were identified. Af-

37 th Congress of the Italian Society of Hematology37ter a median follow-up of 36.5 months(range 0.17-214.2), 32 out of 161 patientsdied (19.9%). Patients with a CD38 score3(percentage censored 86% and 71%,p=0.0026). Age, sex, Rai and Binet stages,TTM score and bone marrow histology patternentered a Cox regression multivariateanalysis along with CD38 score. This latterremained the only variable with a significantimpact on survival (p=0.0103; RR 3.5,95% C.I. 1.3-9.2).CO39VASCULAR ENDOTHELIAL GROWTHFACTOR LEVEL IS A MARKER OFDISEASE-PROGRESSION IN EARLY CLLS.MOLICA, G. VITELLI, D*. LEVATO, G.M. GANDOLFO*,V. LISO°Divisione Ematol, Az. Osped. “Pugliese-Ciaccio”,Catanzaro; * Serv. Patol. Clinica, IRCCS, “Ist. ReginaElena”, Roma; ° Cattedra Ematol, Università BariEvidence for abnormal angiogenesis in thebone marrow (BM) of pts with CLL has beenrecently reported (Kini et al, Blood1998,10:717a). However, clinical implicationsof such a finding are not completelyundestood. With this background we startedwith the present study specifically aimedat measuring with an enzyme linkedimmunosorbent assay (ELISA) serum levelsof VEGF (Quantikine R, R & D System)in 68 CD5-positive B-cell CLL pts. Levelsof S-VEGF ranged from 5.9 to 1190 pg/ml(median, 194.8 pg/ml). Although, a higherthan the median value of S-VEGF was associatedwith a more advanced clinical stage(P = 0.01). no correlation was found withserological markers representative of tumormass such as LDH (P = 0.701), β-2 m (P =0.251) and IL-6 (P = 0.331). Observationsin other types of cancer suggesting thatincreased levels of S-VEGF have a pivotalrole in promoting progression of neoplasticdisease, led us to investigate such an associationin 42 CLL stage A pts. After amedian follow-up time of 13 mo. (range, 2to 40 mo.) 13 out of 42 (31.7%) pts progressedto a more advanced clinical stage(i.e., 7 to stage B and 6 to C); the risk ofdisease-progression (DP) being 31% at 24mo. Pts whose S-VEGF serum levels wereabove the median value had an increasedrisk of DP (median, 33 mo.) in comparisonwith those whose S-VEGF levels were belowthe median value (median not reachedat 40 mo; P = 0.01, HR 0.235, 95% C.I.0.084 to 0.773). Interestingly, characteristicsof stage A pts stratified according tomedian level of S-VEGF were alike with respectto main prognostic features such asRai substage (P=0.08), absolute PB lymphocytosis(P=0.368), LDT (P=0.870), BMhistology (P=0.952) β-2 m (P=0.128). Finally,elevated levels of S-VEGF added prognosticinformation to the subclassificationof stage A. Median time of PFS was 6 mo.for pts belonging to non-smoldering CLL andS-VEGF > median value while it was notreached at 40 mo. by pts with smoldering+ non-smoldering with S-VEGF < medianvalue (P

38 September 26-29, 1999 - Torino-Lingotto, Italyther courses. Patients with progressive (PD)or stable disease (SD) after 3 and 6 coursesof chemotherapy respectively, stoppedtreatment and were evaluated for survival.150 eligible patients entered the trial: 75were randomised to receive FLU and 75CHL+P. 142 patients are valuable for response(NCI criteria), 69 in FLU arm and73 in CHL+P arm. Response rate (CR+PR)was 71% (46+25) in FLU arm and 71%(37+34) in CHL+P arm. Refractory CLL(SD+PD) were 19% (10+9) and 18%(11+7) respectively. Toxicity was comparablein the two treatment groups. ResponseDuration (RD) is longer in the FLU arm (28mo. vs. 21; p=0,007). Our results confirmthe high effectiveness of FLU in the treatmentof untreated CLL: CR rate is fasterand more frequent compared with CHL+P,but further investigations need to confirmthe results on survival.CO41CLINICAL AND BIOLOGICAL RESULTSON 20 CHRONIC LYMPHOCYTICLEUKEMIA (CLL) PATIENTS (PTS)AFTER UNMANIPULATED PERIPHERALBLOOD STEM CELL TRANSPLANT(PBSCT)G. MELONI, A. PROIA, S. CAPRIA, F. MAURO, M. VIGNETTI,R.C. RAPANOTTI, G. CIMINO, I. CORDONE, P. DE FABRITIIS,R. FOA*, F. MANDELLIDipartimento di Biotecnologie Cellulari edEmatologia, Università “La Sapienza”, Roma;*Dipartimento di Scienze Biomediche e OncologiaUmana, Università di Torino, ItalyAs of January 1995, 20 high-risk CLL pts,median age 46.5 (21-58), in complete remission(CR) after fludarabine, were offereda PBSC collection and reinfusion programfollowing high-dose chemotherapy. Due tounsatisfactory PBSC collection, 4 pts receivedbone marrow cells. Sixteen pts receivedPBSC with a median number ofCD34+ cells of 3.55 (1.5-11.3) x 10 6 /Kg.All pts engrafted: median time to neutrophils>0.5 x 10 9 /L and to platelets >20 x10 9 /L was 12 and 15 days respectively. Onept died early (2 months) after autograft forinfection. Fourteen on 19 evaluable ptsshowed during the post-transplant followupa molecular remission, 3 of them presenteda molecular relapse at 16, 24 and28 months from PBSCT, being actually inclinical CR 8 (2 pts) and 13 (1 pt) monthsfrom molecular relapse. Clonality was persistentlyobserved at moleculer level in 5pts, 1 of them died for secondary neoplasia17 months after PBSCT, 2 showed a clinicalrelapse at 26 and 33 months from transplantand 2 pts remain in clinical CR at 6and 15 months from PBSCT. The projecteddisease free survival probability is 0.54 (+/-0.2) at 44 months from transplant, while theoverall survival probability is 0.85 (+/- 0.5).After PBSCT, immunological analysisshowed a persistent inversion of CD4/CD8ratio and marked decrease of total peripheralCD4+ cells. At 12 months from transplant,the absolute median number of circulatingCD4+ cells/µl was 325 (4-648) forthe 12 evaluable pts and, at 24 months,410 (40-792) for the 8 evaluable pts. Ourdata suggest that, despite the use ofunmanipulated PBSC, autograft could beuseful in prolong molecular and clinical remissionsin high-risk CLL pts responding tofludarabine therapy. The long-lasting impairmentof immune repertoire after transplanthas to be taken in account in the ptsmanagement.CO42NEW TREATMENT APPROACH FORREFRACTORY OR RELAPSED CHRONICLYMPHOCYTIC LEUKEMIA: PRELIMINARRESULTS WITH ANTI-CD20 MABTHERAL. BERGUI, S. CAMPANA, M. LADETTO, F. ZALLIO,B. ORTOLANO, I. RICCA, P. GAVAROTTI, A. PILERI, C. TARELLADipartimento di Medicina e Oncologia Sperimentale,Div. Univ. Ematologia; Az. Osp. S.Giovanni Battistadi TorinoPreliminary trials in relapsed low-gradelymphoma have shown that chimeric anti-CD20 monoclonal antibody Rituximab(MabThera) is a new therapeutic option forCD20+ B-cell lymphoma. So far, most studieshave been performed in recurrent follicularforms; less is known on MabTheraactivity in other low-grade subtypes andchronic lymphocytic leukemia (B-CLL). Herewe report preliminary results on MabTheraefficacy in 7 patients with refractory or relapsedB-CLL. All patients had CD20+ B-CLL; they were either in second or furtherrelapse or refractory to initial therapy; 4 ofthem presented with very high lymphocytecounts (up to 280.000/µL), low gam-

37 th Congress of the Italian Society of Hematology39maglobulin levels and history of recurrentinfections; 2 had autoimmune anemia and/or thrombocytopenia. MabThera was givenat 375 mg/m 2 over 8-hour i.v. infusion, for4 consecutive weekly administrations. Allpatients received adequate i.v. hydration.MabThera was well tolerated; chills and feveroften developed during the first infusion,but subsided following steroids. Nosevere complications occurred. A rapid andsustained peripheral B-cell decrease wasobserved in all patients, with lowest valuesreached within few hours after MabTherainfusion. A striking lymphocyte count reductionwas observed in the 4 patients presentingwith massive peripheral blood involvement:their median lymphocyte countdropped from 88.000/mL to 3.300/mL after4 MabThera courses; a variable extentof response could be documented also inbone marrow, lymph nodes and spleen; bycontrast, minor responses were observedin the 2 patients with autoimmune anemiaand thrombocytopenia. This preliminaryexperience indicates that MabThera maybe an effective therapeutic option also forB-CLL. It allows to avoid the use of aggressivecytoreduction. This makes MabTheraparticularly suitable for heavily pretreatedB-CLL patients, who are at high risk of infectionwhen managed with presently availablechemotherapeutic drugs.CO43HCV INFECTION IN NHL:CLINICO-PATHOLOGICALCORRELATIONS IN 260 CASESA. AMBROSETTI, C. VISCO, R. ZANOTTI, L. LENZI, B. AMATO,C. CRIPPA, G. TODESCHINI, M. RICETTI, G. PERONAClinical and Experimental Medicine Department,Section of Hematology, University of Verona, ItalyThe association between Hepatitis C virusand B-lymphoproliferative disease (includingNHL and mixed cryoglobulinaemia)has been reported in various studies, especiallyfrom Italy. The association betweenHCV and NHL has not been confirmed inGreat Britain, whereas in Italy the prevalenceof HCV positivity varies between 9%and 42%. In our series we evaluated thecorrelation between HCV infection andclinico-pathological features of associatedlymphomas. Design and Methods: We retrospectivelyanalyzed 260 patients withovert-NHL (histological diagnosis was madeaccording to REAL classification), all fromour geographical area (north-east of Italy).Only patients without obvious risk factorsfor HCV infection were included in the study.We tested their serum for the presence ofHCV antibodies (ELISA and RIBA) and mostof the positive were also examined for thepresence of HCV-RNA (by RT-PCR) and ofcryoglobulins. We also evaluated 100 patientsfrom the same area, with others oncohaematologicaldisorders, as controls.Results: HCV antibodies were present in48/260 (18,4%) NHL patients. The infectionwas documented before the diagnosisof NHL (1-8 yrs) in most of the positives.The prevalence of HCV infection in generalpopulation in Italy varies between 0,8% and2,8%; in our control group it was 4%. ViralRNA was found in the serum of 93% (28/30), cryoglobulins in 78% (18/23) of testedpatients. None of the 15 T-NHL cases wasHCV+. Of note, marginal zone lymphomas(in particular non-gastrointestinalMALTomas) had the highest rate of HCV+cases (33,3%) followed by lymphoplasmacitoidlymphomas (28%). Positivepatients were also significantly characterizedby a primitive extranodal localization(54% vs 28%, p

40 September 26-29, 1999 - Torino-Lingotto, Italydard risk according to the InternationalPrognostic Index (IPI), were enrolled in amulticenter, 1:1 randomized study. Of the199 patients evaluable, 101 were allocatedto the FLU arm (6 monthly cycles of FLU 25mg/m 2 /day on day 1 thru 5), and 98 to theFLU-ID arm (6 monthly cycles of FLU 25mg/m 2 /day on day 1 thru 3 and idarubicin12 mg/m 2 on day 1). On the FLU arm, CRand PR rates were 47% and 37% respectively,while on the FLU-ID arm, they were39% and 42% respectively. In-depth analysisof the CR rate with respect to histologictype showed that FLU treatment appearedto be superior to FLU-ID against follicularlymphomas (60% vs. 40%), while FLU-IDwas more effective against non-follicularlymphomas (small lymphocytic 43% vs.29%, immunocytoma 38% vs. 23%, respectively).No striking differences wereobserved between the two protocols interms of overall response or toxicity, whichwas generally mild. However, with a medianfollow-up of 19 months, only 29 (62%)patients who received FLU alone have maintainedtheir first CR, as compared to 32(84%) of those who received FLU-IDtherapy. Although the FLU-ID regimen maynot significantly improve the induction ofCR in most LG-NHL patients, our preliminarydata do suggest that with respect toFLU alone it may be capable of conferring alonger-lasting CR and that it is superior interms of CR rate in small lymphocytic andimmunocytoma subtypes.CO45STUDY OF THE IMMUNOSUPPRESSIONAFTER FLUDARABINE,CYCLOPHOSPHAMIDE ANDDEXAMETHASONE (FLUCYD) ININDOLENT LYMPHOMAhad transformed lymphoma or CLL-Richter.Treatment: fludarabine 25 mg/m2/day + cyclophosphamide350 mg/m2/day + dexamethasone20 mg/day in 3-day courses repeatedevery 4 weeks. Twenty two pts received5-6 courses and 2 pts 3-4 courses.The overall response rate was 79% (8 CR,11 PR, 5 failures); 11 pts relapsed or progressed(3 to 19 mos from response); eightpts are still in CR or PR 3 to 27 monthsfrom response. The CD4+ and CD8+ lymphocytecounts decreased during therapy.In 19 responders monitored off-therapy at3, 6, 9, 12 months after Flucyd or until relapse/progression,CD4+ and CD8+ countswere persistently low with minimal recoveryover time:CD4+/µLCD8+/µLMedian Range Median RangePre-treatment 484 142-1865 520 82-2372After three courses 260 71-912 394 129-2000Final 198 71-637 399 90-30003 months F-U (N = 19) 202 96-705 440 145-33006 months F-U (N = 13) 205 105-604 460 263-17919 months F-U (N = 12) 252 155-818 462 150-150012 months F-U (N = 8) 229 135-466 465 240-1200During treatment, 16 infectious episodesoccurred in 11 pts. No delayed opportunisticinfections occurred in responders whileoff therapy. Five pts evolved into high-gradeB-cell NHL and in 1 pt transformation washighly probable on clinical grounds. Theincidence of transformation (25%) was nothigher than expected. In conclusion,fludarabine combined with cyclophosphamideand dexamethasone is effectivetherapy for indolent lymphoma. This combinationproduces prolonged T-lymphocytopenia.However, T-cell dysfunction in patientsachieving response is not associatedwith higher incidence of infections and doesnot influence clinical outcome.M. LAZZARINO, E. ORLANDI, G. PAGNUCCO, C. ASTORI,L. ARCAINI, L. VANELLI, C. BERNASCONI,Istituto di Ematologia, Università di Pavia;Divisione di Ematologia, IRCCS Policlinico San Matteo,Pavia, ItalyWe monitored post-treatment immunosuppressivetoxicity of the Flucyd combinationin 24 pts with advanced low-grade NHL (21pts) or CLL (3 pts). Median interval from diagnosis:44 mos (7-126); median no. of previouschemotherapies: 2 (1-4). No patient

37 th Congress of the Italian Society of Hematology41AUTOLOGOUSTRANSPLANTATIONCO46HUMAN HERPESVIRUS-8 (HHV-8)VIREMIA OCCURS IN AUTOLOGOUSPERIPHERAL BLOOD STEM CELL(PBSC) TRANSPLANT PATIENTS ANDIS ASSOCIATED WITH CLINICO-PATHOLOGIC MANIFESTATIONSOTHER THAN KAPOSI’S SARCOMA (KS)M. LUPPI, P. BAROZZI, K. CAGOSSI, A. DONELLI, F. NARNI,M. MORSELLI, R. TROVATO, R. MARASCA, *T.F. SCHULZ,§K. STASKUS, G. TORELLIDept. of Medical Sciences. Section of Hematology,Modena, Italy. *Dept. of Medical Microbiology. Liverpool,U.K. § Dept. of Microbiology, Minneapolis, U.S.A.We used polymerase chain reaction (PCR)with degenerate primers targeting the DNApolymerase gene of herpesviruses, to investigatethe presence of herpesviral sequencesin the sera collected from 14 autologousPBSC transplant patients, showingat least one pathologic event after transplantation,in absence of a documentedbacterial, fungal or viral (other than herpes)infection. During this survey, we documentedthe early occurrence of HHV-8 viremiain two lymphoma patients, undergoingunselected PBSC transplantation andreceiving immunoglobulin and i.v. acyclovirprophylaxis. Using PCR with primers specificfor two different regions of HHV-8 genome(ORF 26 and K1), we detected HHV-8 sequences in the sera collected immediatelybefore and/or concomitant with clinicalevents in both patients. HHV-8 genomeswere classified on the basis of the sequencingof the hypervariable K1 region, as variantA and variant C respectively. SerumHHV-8 DNA was no longer detectable afterthe disappearance of the clinical symptoms.Clinical events associated with the detectionof HHV-8 viremia were: fever, cutaneousrash, diarrhoea, elevated aminotransferases,in one patient (at day +12)and fever and bone marrow (BM) failure inanother patient (at day +62). Of note, thespecific HHV-8 latent transcript (T0.7) couldbe detected in stromal cells in the aplasticbone marrow from the latter patient, by insitu hybridization. Both patients had antibodiesto HHV-8 antigens, as detected by alytic immunofluorescence assay (IFA) beforetransplantation so that active HHV-8infection probably reflects viral reactivation.HHV-8 infection is associated with an increasedrisk of post-transplant KS, in recipientsof kidney allografts, but KS is exceptionalin the setting of autologous andallogeneic BMT patients. Our study shows,for the first time, that HHV-8 viremia mayoccur, in absence of KS, also in the settingof autologous PBSC transplantation, at leastin our geographical area (the lower Po valley,Northern Italy), where HHV-8 seroprevalencein the blood donor population isabout 13%. HHV-8 may be considered inthe differential diagnosis of the possiblecauses of graft failure in the setting of autologoustransplantation.CO47EFFECTS OF HIGH DOSECHEMOTHERAPY GIVEN WITH G-CSFON THE HEMOSTATIC SYSTEMACTIVATION IN PATIENTS WITHBREAST CANCER UNDERGOINGAUTOLOGOUS TRANSPLANTATIONA. FALANGA, M. MARCHETTI, A. VIGNOLI, S. MARZIALI,S. BERTOLETTI, B. COMOTTI, T. BARBUIDept. Hematology, Ospedali Riuniti, Bergamo, ItalyChemotherapy and hematopoietic growthfactors increment the risk of thrombosis inmalignancy. New protocols for breast cancertherapy include autologous transplantationof CD34+ hematopoietic progenitorcells (HPC) mobilized in peripheral bloodby high dose cyclophosphamide (CTX, 7g/mq) for 1 day followed by G-CSF (5µg/kg/d). We have previously observed that G-CSF administered to healthy donors of HPCinduces a transient hypercoagulable state(Blood, 1999). To verify whether CTX hasadditional effects on the hemostatic systemactivation induced by G-CSF, we havestudied 18 consecutive patients with stageII breast cancer receiving CTX and G-CSFfor HPC mobilization. Plasma markers ofhypercoagulation (TAT, F1+2, D-dimer),endothelial (TM, vWF, t-PA and PAI-1) andleukocyte activation (elastase, myeloperoxydase[MPO]) were determined at the

42 September 26-29, 1999 - Torino-Lingotto, Italyfollowing time intervals: 1. basal (T0), 2.after CTX, before starting G-CSF (T1), and3. at the end of G-CSF, before HPC apheresis(T2). Results were compared to those obtainedin 26 consecutive HPC healthy donorsreceiving G-CSF alone (10µg/kg/d).At baseline (T0), the plasma levels ofhypercoagulation markers of the patientswere significantly greater than those ofhealthy donors (p

37 th Congress of the Italian Society of Hematology43within 6 mos). So far, 90 pts. are alive, witha projected overall survival of 78% at 7 yrs.,at a median follow up of 3.5 yrs.. We concludethat PBPC autograft after Mitox/L-PAMis well tolerated at both early and late follow-upand implies low and reversiblecardiotoxicity.CO49IMMUNE RECONSTITUTION AFTERAUTOLOGOUS PERIPHERAL BLOODSTEM CELL TRANSPLANTATIONG. PAGNUCCO, L.VANELLI, E.P. ALESSANDRINO, S. CABERLON,P. PICCIONI, M.A. MAIOCCHI, A. TENORE, E. CONSENSI,D. CALDERA, P. ZAPPASODI, E. BRUSAMOLINO, M. LAZZARINO,C. BERNASCONIIstituto di Ematologia, Università di Pavia. Divisionedi Ematologia, Policlinico S. Matteo IRCCS, PaviaWe studied the phenotypic immunologicreconstitution of different subsets of T, Band NK cells after autologous peripheralblood stem cell transplantation (PBSCT)within the first 3 months following transplantation.The recipients were 36 consecutiveadults (median age 45 years, range 21-62), who had received autologous PBSCTfor multiple myeloma (N.=14), high-gradenon-Hodgkin’s lymphoma (N.=13),Hodgkin’s disease (N.=7), chronic myeloidleukemia (N.=2); 49 healthy subjects agematchedwere also studied as control group.In transplant recipients, tests were performedbefore transplant and at 30, 60, 90days after bone marrow take. Peripheralblood lymphocyte subsets were studied bydirect immunofluorescence and flowcytometry, using a FACS (FACSort, BectonDickinson) and a lyse-no-wash sample processingof total peripheral blood. We demonstratein this study that: 1) the recoveryof CD3+ T-cells is prompt, within the firstmonth post-transplantation, and appearsmainly due to early and faster reconstitutionof CD3+/CD8+ T cells, reachingsupranormal levels and resulting in an invertedCD4/CD8 ratio during the study period;2) the reconstitution of CD3+ T-cellsshows a marked increase in activated HLA-DR+/CD3+ and CD8+/CD57+ lymphocytesby 60 days after bone marrow take; 3) therecovery of the CD4+ T-cells is markedlydelayed during the first three months aftertransplantation, with a predominance ofmemory-type CD29+/CD4+ T-cells, whichare in the normal range during the studyperiod, and a relative absence of naïve-typeCD45RA+/CD4+ T-cells; 4) an early anddurable overshoot of CD5+/CD19+ B-cellsabove normal levels is observed during thestudy period, whereas CD20+ B-cells reconstitutionis reached at three months; 5)CD16+/CD56+/CD3- NK lymphocytes showa faster recovery with a significant increaseby 60 days following PBSCT. These data onthe kinetics of post grafting immune reconstitutionmay have biological and clinicalrelevance.CO50FACTORS AFFECTING VIRALINFECTIONS AFTER AUTOLOGOUSPERIPHERAL BLOOD PROGENITORCELL TRASPLANTL. CORVATTA, M. BRUNORI, M. OFFIDANI, A. OLIVIERI,M. MONTANARI, A. MELE, M. MONTRONI*, E. COSTANTINO*,P. L EONIDepartment of Haematology, *Depatment ofMedicine, Ancona University of MedicineViral infections that occur 100 days afterbone marrow transplantation (BMT) aremostly due to cytomegalovirus (CMV) andvaricella zoster virus (VZV), the incidenceof the later is around 30% in allogenic BMTand around 20% in autologous BMT. Veryfew reports analized viral infections afterautologous peripheral blood progenitor celltransplant (PBPCT) and the largest seriesreported a frequency ranging from 6 to31%. It is possible that the recovery patternof circulating T or NK cells play a criticalrole in the development of viral infections.Our study included 164 patients (medianage 47 years, range 16-68; M/F=84/80) affected by lymphoid malignancies (77NHL, 19 HD, 35 MM and 5 LLA), solid tumors(16) and myeloid malignancies (9AML, 3 CML). Before PBPCT 53 patients(31%) were in complete remission, 93(57%) in partial remission and 20 (12%)with disease progression. All patients hada good performance status although a lotof them were heavly pretreated (79 patientshad been received > 2 chemotherapy regimes,85 a number of chemoptherapycourses > 10). PBPCT included high doseMelphalan (140-200 mg/mq) administeredalone or in combinatoin in most patients(70%) and stem cell support, with a me-

44 September 26-29, 1999 - Torino-Lingotto, Italydian of CD34+ cells reifused of 6 x 10 6 /kg(range 0.51-51.3). Seventy patients (43%)received a steroid dose higher than 180 mgduring or following PBPCT. Flow cytometricanalysis of the lymphocyte subsets wasperformed at 1, 3, 6, 9, 12 months in thefirst year following the transplant and every6 months in the subsequent years. Wetherefore investigated the viral infectionsoccurring 30 days after PBPCT. Twentyninepatients (17,7%) developed viral infection(1 (0.6%) CMV and 28 (17%) VZV). FatalCMV infection occurred 35 days after transplantwhereas the median onset of VZV infectionswas 10 months after transplant(range 1.2-18.8 months). The actuarial riskof VZV was 12% at 12 months and 18% at24 months. Twentyeight patients hadmetameric herpes zoster and only one patientdeveloped varicella. The median CD4+cells count remained < 400/µl until 12months following PBPCT (1 th month=249/µl; 3 th month=260/µl; 6 th month=287µl; 9 thmonth=245/µl; 12 th month=383/µl). Theactuarial probability of achieving 400 CD4+cells resulted of 30% at 3 months, of 50%at 6 months and of 55% at 12 months.Univariate analysis showed that age, diagnosis,previous chemotherapy, dose of steroidadministred, CD34+ cells reinfused andlymphocyte count at 1 mounth (400

37 th Congress of the Italian Society of Hematology45stroma formation and aplasia duration. Ourdata would confirm the reduced hemopoieticcapacity and the impaired microenvironmentin the patients with AML in remission.This marrow damage may be diseaserelatedor induced by the aggressive chemotherapyregimens used in induction andconsolidation.CO52SELECTION AND TRANSPLANTATIONOF AUTOLOGOUS CD34+B-LINEAGENEGATIVE CELLS IN ADVANCE PHASEMULTIPLE MYELOMA (MM) PATIENTS:A PILOT STUDYR.M. LEMOLI, G. MARTINELLI, A. OLIVIERI, M.R. MOTTA,S. RIZZI, C. TERRAGNA, G. LEOPARDI, M. BENNI,S. RONCONI, I. CANTORI, D. RONDELLI, S. MANGIANTI,P. LEONI, M. MONTANARI, M. CAVO, S. TURAInstitute of Hematology and Medical Oncology“L. & A. Seràgnoli”, University of Bologna, Bolognaand Hematology Service University of Ancona,Ancona, ItalyIn this study we evaluated the feasibilityof sequential positive and negative selectionof stem cells to achieve tumor-freeautografts in MM. Moreover, we assessedthe safety and the hematopoietic efficacyof the transplantation of doubly selected(CD34+B-lineage negative) autologouscells. Fourteen MM patients with advanceddisease had their PBSC mobilized withcyclophosphamide (Cy; 7 gr/m 2 ) and G-CSF.CD34+ cells were enriched in 12 of the patientsby the avidin-biotin immuno-absorptiontechnique. Subsequently, CD10+,CD19+, CD20+ and CD56+ cells (B-lincells) were removed by immunomagneticdepletion. Minimal residual disease (MRD)was detected by flow cytometry and polymerasechain reaction (PCR) based molecularanalysis of the patient specific IgHcomplementary-determining region III(CDRIII). All the patients were reinfusedwith CD34+B-lin negative cells after administrationof high-dose melphalan (Me; 200mg/m 2 ). Positive/negative selection of stemcells resulted in a median recovery of 33.3%of the initial content of CD34+ cells (range13.4-67%) with a median purity of 72.7%(40-97.6%). All the evaluable patients haddetectable disease in PBSC collections.Molecular assessment showed the persistenceof myeloma cells in 6/7 cases afterthe first step of positive selection of CD34+cells. However, molecular evaluation of IgHCDRIII region showed the disappearanceof tumor cells in 6/7 patients followingnegative depletion of B-cells. Twelve patientsreceived a median of 3.9 x 10 6 CD34+B-lin negative cells/Kg (range 1.2-6.5) andshowed a rapid reconstitution of hematopoiesis.The median time to an absoluteneutrophil count (ANC) ≥ 0.5 x 10 9 /L was12 days and to 20 and 50 x 10 9 platelet/L14.5 and 19.5 days, respectively. The mediantime to hospital discharge afterreinfusion was 15.5 days. These resultswere superimposable with those of twosimilar cohorts of patients who receivedeither unmanipulated PBSC or positivelyselected CD34+ cells after the same conditioningregimen. No late infections wereobserved. We conclude that autotransplantationof purified CD34+ B-lin negative cellsis associated with a rapid and sustainedrecovery of hematopoiesis and lowperitransplant morbidity. Sequential positiveand negative enrichment of stem cellsmay reduce tumor cell contamination in B-cell malignancies below the lower limit ofdetection of molecular analysis.CO53A NEW EFFECTIVE PURGINGTECHNIQUE FOR AUTOLOGOUSTRANSPLANTATION IN MULTIPLEMYELOMAA.M. BARBUI, A.RAMBALDI, B.COMOTTI, M.BUELLI, P.VIERO,N. BELLI, C.MANZONI, G.M. BORLERI, G.P. DOTTI, T. BARBUIDiv. di Ematologia Ospedali Riuniti di Bergamo, ItalyTo reduce the tumor cell contaminationof G-CSF mobilized peripheral blood circulatingprogenitor cells (CPC), we developeda two-step negative selection procedurewhereby CPC can be effectively purged ofcontaminating neoplastic cells by magneticmicrobeads and a SuperMACS separator(Miltenyi Biotech, Germany) (Rambaldi etal., Blood 1998). We applied this purgingtechnique to Multiple Myeloma patientsusing anti CD19, CD56, CD10 and CD138microbeads for in vitro purging. Thirthy-fournewly diagnosed MM patients received 3cycles VAD followed by Cyclophosphamide(CTX, 7 gr/sqm) + G-CSF (5 mcg/kg/day)for stem cell collection. Thereafter they wererandomized to receive autologous unmani-

46 September 26-29, 1999 - Torino-Lingotto, Italypulated CPC (Arm A, 18 patients) versushighly purified plasma cell-purged (Arm B,16 patients) to support tandem sequentialtransplants (TRX) conditioned withMelphalan (200 mg/sqm) and Melphalan(140 mg/sqm) plus Total Body Irradiation(TBI, 1200 cGy) for the second transplant.Aims of this study were to evaluate: a) theefficacy of in vitro purging on the neoplasticplasma cell fraction, b) the quality ofthe hematopoietic and lymphoid reconstitutionafter transplantation. Byimmunophenotype and PCR analysis performedwith consensus oligonucleotideprimers for the CDR3 region of rearrangedheavy chain alleles we can demonstrate thatin all cases the unmanipulated aphereticproducts contained a heavy plasma cellcontamination as opposed to the purifiedstem cell fraction obtained after in vitropurging which showed a remarkable(> three logs) reduction of tumor cell contamination.Two apheresis were sufficientto meet the required minimum criteria of 5x 106 CD34+ cells/kg to support each transplantand to have a back-up source ofunmanipulated stem cells. The hematologicengraftment was rapid and not different inthe two arms. The immunologic reconstitution(as determined by enumeration of T,B and NK cells) was comparable in botharms and no transplant related mortalitywas seen so far. These results suggest thelack of any significant hematologic and immunologictoxicity associated with transplantationof plasma cell-purged CPC. Theclinical benefit of this procedure still remainsto be determined.CO54PBPC AUTOTRANSPLANTATION INELDERLY PATIENTS: A SINGLE CENTEREXPERIENCEM. MONTANARI, A. OLIVIERI, M. BRUNORI, D. MASSIDDA,D. CAPELLI, A. POLONI, R. CENTURIONI*, I. CANTORI,M. LUCESOLE, M. CANDELA^, P. LEONIDepartment of Hematology, Ancona University,Italy, *Internal Medicine of Civitanova MarcheHospital, Italy, ^Department of Internal Medicine,Ancona, Italy(median 63); 12 were female and 13 male;11 patients were affected by Multiple Myeloma(MM), 5 High-Grade non HodgkinLymphoma, 4 Low-Grade non Hodgkin Lymphoma,3 Acute Myeloid Leukemia, 1Chronic Lymphocytic Leukemia and 1 BreastCancer; the performance status (WHO) was0-1. Six patients were in first complete remission(CR), 19 patients received salvagetherapy after failure (11 relapse, 7 partialremission and 1 progression disease) offirst-line chemotherapy. All patients receivedchemotherapy + G-CSF for PBPCmobilization, leucafereses were performedwhen the circulating CD34+ cell count was• 20/µl starting on day + 13 as average(range: 11-18). After salvage chemotherapy,5 patients obtained CR, 12 a partialremission (PR) and 2 had progressionof disease (PD). A median of 6 (3-14) x10 6 /kg CD34+ cells and 48 (20-315) x 10 4 /kg CFU-GM were collected. Patients receivedhigh-dose therapy consisting in Melphalan(6 cases), Busulfan-Melphalan (6 cases),Mitoxantron-Melphalan (5 cases), Thiotepa-Melphalan (2 cases), Busulfan-Cyclophosphamide(3 cases), BEAM (1 case), TBI orTBI + Melphalan (1 case respectively). Fourpatients affected by MM underwent a secondautotransplantation with Busulfan-Melphalan as conditioning regimen. Weobserved 1 toxic death during the first 100days for interstitial pneumonia; the engraftmentwas rapid and complete in all patients;the hemopoietic reconstitution was characterizedby 11 (range: 8-15) days to reachneutrophils • 500/µl; 13 (range: 10-83)days to reach platelets • 20,000/µl and 17(range: 11-60) days to reach platelets• 50,000/µl; patients were generally discharged15 days after the PBPC reinfusion.After transplantation 18 patients are in CR,5 are in PR and 1 showed PD; at present 16patients are alive (9 in CR, 4 in PR and 3 inrelapse) and 8 died for PD with a medianfollow-up of 14 months (4-50). In conclusionin our experience the PBPC mobilizationand transplantation is feasible in patientswith age > 60 years and the toxicityof this procedure is acceptable with an earlytransplant related mortality of 4%.Between May 1994 to November 1998 weenrolled 25 consecutive patients (age > 60years) for PBPC autologous transplantation.The age ranged between 60 to 67 years

37 th Congress of the Italian Society of Hematology47MYELODISPLASIA ANDCHRONIC MYELOCYTICLEUKEMIACO55CYTARABINE INCREASES KARYOTYPICRESPONSE AND SURVIVAL IN ALPHA-IFN TREATED CHRONIC MYELOIDLEUKEMIA PATIENTS: RESULTS OF ANATIONAL PROSPECTIVERANDOMIZED TRIALG. ROSTI, F. BONIFAZI, A. DE VIVO, E. TRABACCHI, S.TURAON BEHALF OF THE ITALIAN COOPERATIVE STUDY GROUP ON CML(ICSG ON CML)Inst. of Hematology and Clinical Oncology “L. andA. Seràgnoli”, St. Orsola Univ. Hospital, BolognaBetween Feb. 1994 and March 1997 theICSG on CML recruited 837 newly diagnosedCML pts: 540 eligible pts with Ph+ and/orbcr/abl+ CML in 1 st CP were randomized toIFN alone (265 pts) at a starting dose of3.10 6 IU/d, increased to 9.10 6 IU/d fromthe 14 th day onward or IFN + 10 daysmonthly courses of cytarabine, 40 mg/kg/d s.c. (275 pts). The endpoints were: hematologicalresponse (HR) at 6 mos, karyotypicresponse (KR) and overall survival.The analyses were performed as to April,1999 when the mean observation periodwas 24 months (1-42). At 6 months 80%of IFN arm pts at risk got a HR as comparedwith 87% of IFN+LDAC pts; The bestKR to date is presented belowIFN(n.265)IFN+LDAC (n.275)Best KR N.(% of random.) N.(% of random.)KR absent (0% Ph-) 55 (20) 50 (18)KR minimal (1-32% 42 (16) 32 (12)Ph-neg)KR minor (33-65% 31 (12) 39 (14)39 (14)vPh-neg)KR major (66-99% 31 (12) 39 (14)Ph-neg)KR complete (100% 19 (7) 38 (14)Ph-neg)Total evaluated 175 (67) 205 (72)The rate of major+complete KR is significantlyhigher for the IFN+LDAC arm (77/275, 28%) with respect to IFN arm (50/265, 19%) (p = 0.01). It’s noteworthy thedouble proportion of complete KR amongIFN+LDAC pts. With a median observationperiod of 24 months, 3 yrs survival is 85%for IFN+LDAC and 80% for IFN alone. Overallsurvival is significantly better forIFN+LDAC with respect to IFN alone (p =0.03).CO56IN VITRO RESISTANCE OF CHRONICMYELOID LEUKEMIA CFU-GM TOGROWTH FACTORS DEPRIVATION ISSUPPRESSED BYRETINOIDS ± α INTERFERONC.FOLI, D. FERRERO, E. CAMPA, F. GIARETTA, B. ORTOLANO,A. PILERIDivisione di Ematologia dell’Università di Torino;Az. Osp. San Giovanni Battista, Torino, ItalyBcr-abl fusion protein determines, intransfected murine cell lines, both resistanceto growth factor deprivation and increasedproliferative response to interleukin3 (IL3). However, conflicting results havebeen reported about growth factor requirementby CFU-GM. We cultured progenitorenriched(median value of CD34+:45%)CML cells, taken from patients with 100%Ph 1+ bone marrow (BM) mitosis, in agarculture with scalar concentrations of IL3 orGM-CSF (0.02 – 20 ng/ml) for CFU-GM assay.Cells were also cultured in liquid medium(IMDM + 10% fetal bovine serum)without growth factor addition, for 7-11days, starting from 5 x 10 4 cells/ml. In parallelcultures either all-trans (ATRA) or 13-cis retinoic acid (cRA) (5 x 10 -7 M) ± interferonα (IFN) (300 U/ml) were included inthe medium. CFU-GM concentration wasmonitored at day 0, 4, 7 and 11 of culture.Identical experiments were performed withBM cells of control subjects. An increasedresponse to both IL3 and GM-CSF was evidencedby CFU-GM from 1/2 patients, with80% of maximal colony growth at 0.02 ng/ml (v.n.10-42%). Two more patients displayedanalogous CFU-GM hypersensitivityto GM-CSF and one to IL-3 only. In liquidcultures normal CFU-GM from 7 BM samplesdecreased steadily (36±22% of day 0 valueat the 7 th day, 27±19% at day 11), whereasCML CFU-GM increased or remained unchangedin 13/16 cases and slightly decreasedin 3 (average CFU-GM recovery oftotal cases: 120±46% at day 7, 117±45%at day 11). However, ATRA, cRA, and, par-

48 September 26-29, 1999 - Torino-Lingotto, Italyticularly, ATRA+ IFN and cRA+IFN reducedCML CFU-GM recovery to normal values:58±32, 60±38, 30±20, 33±23% respectivelyat the 7 th day, 28±35, 29±36, 18±8,7±6% at day 11. In conclusion, CFU-GMhypersensitivity to CSFs seems unfrequent,while resistance to growth factor deprivationis a common feature of CML CFU-GM.The association of either cRA or ATRA +αIFN at therapeutical concentrations cancompletely abolish in vitro that survivaladvantage, bringing further evidence to apossible role of retinoids in combined treatmentmodalities.CO57LIMITED NUMBER OF Ph-POSITIVESTEM CELLS SUSTAIN RELAPSE AFTERALLOGENEIC BONE MARROWTRANSPLANTATIONF. FRASSONI, M. PODESTÀ, G. PIAGGIO, A. PITTO, O. FIGARI,M. SORACCO, M.T. VAN LINT, *G. FUGAZZA, *M. SESSAREGO,A. BACIGALUPODipartimento di Ematologia, Divisione Ematologia IIOspedale S. Martino Genova, *Dipartimento MedicinaInterna Università di GenovaWe have performed cytogenetic analysison bone marrow cells and on progenitor cellcolonies in a patient who relapsed after allogeneicBMT for CML. She was subsequentlytreated with donor lymphocyte infusions(DLI) and achieved cytogenetic remissionafter 175 days from the first DLI.Two Philadelphia-positive clones were identifiedat relapse. One clone displayed anadditional chromosomal abnormality:46,XX,t(3;11)(p21;p15),t(9;22)(q34;q11),del(13)(q14q34) probably induced by radio-chemotherapyin a single Ph-positiveprogenitor. This clone was able to sustain20% of Ph-positive hemopoiesis for 5months and therefore displaying the characteristicsof a “stem cell”. We would takethis result to suggest that a limited numberof leukemic stem cells are responsibleof relapse after allogeneic BMT in patientswith CML. This is also supported by the factthat long term culture initiating cells (LTC-IC) were all donor derived Ph-negative,whereas the majority of BM cells were Phpositive.All together these data may be permissiveof a high response rate to DLI andmay also explain the slow pace of the diseaseat the relapse following BMT.CO58LOW DOSE INTERFERON IN ESSENTIALTHROMBOCYTHAEMIA: REMISSIONMAINTENANCE AND THROMBOSISFREE SURVIVALM. BAZZAN*, 1 A. CIOCCA VASINO, A. VACCARINO,G. TAMPONI, P. SCHINCO, B. POLLIO, 2 D. ROTA,2M.A. PISTONE, 2 L. GRISO, A. PILERIDivisioni Universitaria e 1 Ospedaliera di Ematologia,Ospedale Molinette,Torino e 2 Gruppo Piemonteseper lo Studio TE 93 - ItaliaIn the period February 1994 – December1996, 208 patients with Essential Thrombocythaemia(ET) were diagnosed, 42 out ofthese (20.2%) were selected for treatmentwith recombinant alpha-2b interferon (IFN)plus the antiaggregant indobufene. Majorinclusion criteria were: no previous chemotherapy,age less than 60 years, athrombo-haemorrhagic event and/or serioussymptoms of disturbed microvascularcirculation and/or platelets more than900.000/mm 3 . The IFN dosage was 3 MUthree times every week for two consecutiveyears. After this period, patients wererandomly assigned to either stop IFN or tocontinue one more year with the weeklyfixed single dose of 3 MU. At diagnosis 9patients out of 42 had had a thromboticevent. At Jan 1999 the overall observationperiod was 111 years/patient. 34 patientsout of 42 completed the 2 years of treatment:21 patients had a complete response(CR, plts

37 th Congress of the Italian Society of Hematology49of patients with a long follow-up. IFN plusindobufene allowed to obtain a good thrombosis-freesurvival and, in some patient, along last-ing remission maintenance, alsoafter IFN withdrawal.CO59LEUKEMIA AND CARCINOMA INPATIENTS WITH ESSENTIALTHROMBOCYTHEMIA TREATED WITHHYDROXYUREAG. FINAZZI, M. RUGGERI*, F. RODEGHIERO*, T. BARBUIDivisions of Hematology, Ospedali Riuniti diBergamo e Ospedale S. Bortolo di Vicenza*Treatment with hydroxyurea (HU) is indicatedin patients with essential thrombocythemia(ET) but retrospective studieshave raised concern about the long-termleukemogenic risk of this agent. We updateda randomized clinical trial of HU vs. no chemotherapythat started in 1990 to examinethe long-term effect of the drug, in particularthe development of secondary malignancies.We randomized 114 patientswith ET and age >60 years or previousthrombosis to HU (56 cases) or nocytoreductive therapy (NT, 58 cases). Twopatients (1.7%) were lost to follow-up and29 (50%) shifted from the NT group to theHU group during the observation period,mainly because of a thrombotic event. Patientswere followed up for a median of 73months. Analysis was by intention to treat.In the HU group, 46 of 54 patients (85%)are alive, compared with 49 of 58 patients(84%) in the control group (n.s.). Five patients(9%) in the HU group had thrombosisand 26 (45%) in the control group.Thrombosis-free survival was significantlydifferent in the HU and control groups(p

50 September 26-29, 1999 - Torino-Lingotto, ItalyBCL-XL was negative in controls. BCR-ABLwas negative in all subjects. In our study,presence of EEC (both in BM and PB) has a100% specificity and 84% sensibility in diagnosingPV. Presence of EEC is especiallyuseful in patients with absence of clinicalcriteria for PV. In ET, the EEC may be presentbut always together with the s-CFU-Mk.According to other authors, also in this studywe found a low specificity of BCL-XL due toits presence in ET.CO61NEOANGIOGENESIS CORRELATESWITH IN VITRO PATTERN OF GROWTHOF MYELODYSPLASTIC CELLSA. CORTELEZZI, G.C. PRUNERI*, B. SARINA, R. MAZZA,S. CRISTIANI, F. BERTOLINI^, C. CATTANEO, N.S. FRACCHIOLLA,I. SILVESTRIS, G. LAMBERTENGHI DELILIERS°Serv. Aut. di Ematologia, Istituto di AnatomiaPatologica* , Centro Trapianti Midollo°, OspedaleMaggiore, IRCCS; Unità di onco-ematologia^,Istituto Europeo di Oncologia, Milan, ItalyThe growth of new blood vessels from preexixtingvessels and capillaries, orneoangiogenesis, is crucial for tumor development.Recently Perez-Atayde suggestedthat angiogenesis can play a pivotalrole also in leukemia. This prompted us toinvestigate the role of blood vessels generationin the pathogenesis and progressiontowards leukemia in myelodysplasticsyndromes (MDS). With this aim we evaluatedmicrovessel density (MVD) in bonemarrow biopsies from MDS patients, healthycontrols and subjects affected by infectiousdiseases (ID) and hyperplastic BM; MVDfigures were then correlated with the in vitropattern of growth (leukemic vs non leukemicaccording to Sawada et al) of myelodysplasticbone marrow mononuclear cells(BMMNC). Patients and Methods: 30 MDSpatients, 14 normal controls and 5 patientswith ID were enrolled. Bone marrow biopsieswere immunostained with anti CD34QBEnd/10 monoclonal antibody to evaluate(MVD) and hot spot, i.e. areas with thelargest number of vessels (HS). BMMNCwere obtained after gradient centrifugationand evaluated for CFU-GM in conventionalagar assay. Results: MVD and HS weresimilar in controls and ID (respectively MVD6±2 vs 10±8; HS 13±4 vs 19±13) and significantlyhigher in MDS (MVD 21.5±7, HS34±10; p

37 th Congress of the Italian Society of Hematology51p=0.009) and RA patients (3144±1063/mL;p=0.01) compared to normal donors (5656± 474/mL). Using methylcellulose colonyassay, circulating colony forming-unit cells(CFU-C) were even more decreased in patientswith hypoplastic MDS and RA comparedto normal donors (52±13 and 93±24/mL vs 276±27; p

52 September 26-29, 1999 - Torino-Lingotto, ItalyBIOLOGYCO64STI571 ERADICATES BCR/ABL+LEUKEMIC CELLS IN NUDE AND SCIDMICE, DEPENDING ON THE INITIALTUMOR LOADC. GAMBACORTI-PASSERINI, R. BARNI, P.LE COUTRE,G.M. CORNEO, P. PIOLTELLI, L. CLERIS, E. MARCHESI,F. FORMELLI, E.M. POGLIANIIstituto Nazionale Tumori, Milano, Italy and Sectionof Hematology, S. Gerardo Hospital, Monza, ItalySTI571 is a selective inhibitor of both theABL kinase as well as of the BCR/ABL oncogenickinase and has been shown to inhibitthe proliferation of BCR/ABL+ cell lines aswell as of fresh cells obtained from CMLpatients. We recently showed that STI571,when administered p.o. at 160 mg/kg threetimes per day for 11days, causes continousin vivo block of the BCR/ABL kinase activityand eradicates the growth of 50x10 6 humanBCR/ABL+ leukemic cells (KU812) injectedin the flank of nude mice. When thetreatment was initiated 24 hours after leukemiccell injection, eradication of tumorgrowth was obtained in all treated animals(18/18). When animals were treated 8 daysafter injection, with an estimated tumor loadof 3-400 x 10 6 cells, nodules disappearedin all animals within 10 days; however in41% of treated animals (9/22) the tumorreappeared between 16 and 19 days aftertreatment discontinuation. This differenceis statistically significant (p = 0.0018).Treatment at day 15 (tumor load of 10 9cells) resulted in regression of nodules butno animal was cured. Retreatment of relapsedanimals did not obtain permanenteradication of leukemic growth, and in vivoSTI571-mediated inhibition of the BCR/ABLkinase activity was reduced or absent. Prolongationof treatment duration from 11days to 18 days also failed to decrease therisk of relapse. BCR/ABL+ leukemic cellsobtained from relapsed animals were retestedin vitro for sensitivity to STI571 by3HTdR uptake and showed in general thesame sensitivity as parental cells. The mainvariable able to predict the efficacy ofSTI571 in eradicating leukemic growth inthis nude mouse model is represented bythe initial tumor load; leukemic cells obtainedfrom relapsed mice do not appearintrinsically resistant to STI571. These datashow that the number of leukemic cellspresent at the beginning of treatment representan important variable, even whenconsidering a specific anti-leukemic treatment.Additional data obtained in SCID miceinjected with fresh CML cells from patientsin chronic phase support the above mentionedresults, and will also be presented.CO65PULSE OF LOW DOSE FLUDARABINEAVOIDS SELECTION OF DOXORUBICINRESISTANT CLONE IN K562 CELL LINEP. D’ANDREA, S. RUSSO, G. IACCARINO, L. DEL VECCHIO*,R. DI NOTO*, G. ABATE, F. FRIGERIDivision of Hematology, I. N. T. “G. Pascale”, and*Division of Hematology, AO Cardarelli, NapoliFludarabine (F-ARA-A) is a purine analoguewith a cell cycle specific activity. Itinhibits DNA synthesis by two differentmechanism: 1) direct blocking DNA elongationand 2) decreasing cellular dNTPsthrough inhibition of ribonucleotide reductase.There are also some evidences thatFludarabine could be incorporated intomRNA inhibiting gene expression. It is wellknown that K562 cell line have a baselineexpression of gp170 and hence it is possibleto select doxorubicin resistant cloneafter exposure to increasing level of thedrug. Gp170 is the best studied mechanismsupporting Multi Drug resistance (MDR). Itis a membrane efflux pump that impairsaccumulation of widely-used lipophilic drugsincluding antracyclines, epipodophillotoxinsand vinca alkaloids. In the past Verapamiland its analogues were frequently used invitro to revert gp 170 action but in vivothey showed troublesome side effects. Inour laboratories parental K562 cells wereexposed to Doxorubicin (DXR) at concentrationof 25 nM combined to weekly pulseof 0,5 µg/ml (1,38 µM) of Fludarabine. Inthis case no selection of MDR clones occurred.On the contrary, the treatment ofK562 parental cells by DXR alone allowedthe emergency of drug resistant clones. Atthe concentration used, Fludarabine did notmodify the doubling time and growth patternof K562 cells but increased the

37 th Congress of the Italian Society of Hematology53percentage of S phase up to 80%.Cytofluorimetric analysis, performed usingMRK16 antibody showed that pulse ofFludarabine treatment revert the K562gp170 baseline expression. Moreover immunocytochemicalanalysis, performed usingJSB1 antibody on both, DXR and DXRplus Fludarabine treated cells, confirmedthat inhibition of selection was due to theblock of gp 170 expression by Fludarabine.In fact, while the resistant cells obtainedafter direct exposition to DXR were markedlypositive to JSB1 antibody, those treatedwith DXR plus Fludarabine were not. If invitro results will be further confirmed, lowdoses of Fludarabine can result in a usefulclinical approach.This work was supported by Ricerca FinalizzataMinistero della Sanità – Quota FSN91CO66CHARACTERIZATION OF THEBIOLOGICAL EFFECTS OF A NOVELRETINOID ON AML CELLSA. GOZZINI, V. SANTINI, B. SCAPPINI, P. LEFEBVRE*,C. CHOMIENNE*, P. ROSSI FERRINIDivisione di Ematologia, Università di Firenze,Azienda Ospedaliera di Careggi, Firenze; Laboratoirede Biologie Cellulaire Hèmatopoiètique,Univ. ParisVII, Hopitàl St. Louis, Paris*Retinoids are modulators of cellular proliferationand differentiation in many celltypes and their diverse effects are mediatedby three distinct isoforms of receptorsRAR (, ,). In this study we characterized anovel derivative of retinoic acid (pat. WO97/02030) and compared its activity to thatof known retinoids. The new molecule andknown retinoids have similar chemical properties,by studies with HPLC and spectrophotometeranalysis, but the new compounddoes not own the typical sensitivityto the light. Acute promyelocytic leukemia(APL) cell lines, HL60, NB4 and KASUMI,as well as primary (APL) cells were culturedin RPMI 1640 with 15% FCS for 3, 4, 6 days,supplemented with the retinoic acid newderivative 10mM, 100 nM, 1 mM or all-transretinoic acid (ATRA) at the same doses. Afterthat time, we evaluated: cells counts, morphology,flow cytometric analysis of cellcycle,detection of apoptosis evaluatingAnnexin V binding. Our results showed thatthe new molecule blocked proliferation atthe same extent as ATRA 1 µM and 100 nM,while it resulted toxic at 10 µM. After 4 daysof culture, cells in S-phase were only11.72% when exposed to the new retinoid1 µM, compared with 42.49% of controlcultures. Consistent data were obtainedwith ATRA 1 µM. Total cell number was decreasedafter treatment with novel retinoid.Annexin V test demonstrated inductionof cell line apoptosis: 30% of apoptosiscompared with 9.96% of control in HL 60,23% vs 6% in Kasumi, the percentage wasnot significant in NB4 cells; as well as inprimary APL cultures. These data were supportedby the morphological observation ofapoptotic bodies as well as by the appearanceof pre-G1 peak in flow cytometricanalysis of cell-cycle. Moreover, we performedtransient transfection in COS-1 cellswith the expression vector pSG5/RARα andPSG5/RXR, showing that the new moleculeinteracted with the nuclear retinoid receptorsRXR, and the effect amplified by interactionwith heterodimer RXR-RARα. Preliminarystudies with fractionation of HL 60 andNB4 nuclear extracts over FPLC showed thatthe new molecule binding affinity for theendogenous nuclear receptors is strongerthan that of ATRA. These observationshelped to analyze whether the new retinoidimplies different therapeutic strategies,so to be possibly used in alternative to theknown retinoids in the treatment of resistant(APL).CO67IDENTIFICATION AND ISOLATION OFA NORMAL BIPOTENT ERYHTROID-MEGAKARYOCYTIC CELL PRECURSORSA.M. VANNUCCHI, S. LINARI, F. PAOLETTI, C. CELLAI,R. CAPORALE, M. SANCHEZ, G. VISCONTI, G. MIGLIACCIO,A.R. MIGLIACCIO, P. ROSSI FERRINIDiv. Hematology, Univ. Florence & Ist. Sup. Sanità,RomeBased on several in vitro data supportingthe existence of a bipotent, erythroid andmegakaryocytic, cell precursor, we soughtto identify such a cell in normal tissues..First, to clarify until when hematopoieticcells remain bipotent for erythroid andmegakaryocytic differentiation, we analyzed(by RT-PCR) the expression of erythroid (α-

54 September 26-29, 1999 - Torino-Lingotto, Italyand β-globin and erythropoietin receptor,EpoR)- and megakaryocytic (acethylcholineesterase, AchE, glycoprotein IIb, GpIIb andthrombopoietin receptor, Mpl) genes insingle colonies derived from early (BFU-E,CFU-Mk and CFU-GM) and late (CFU-E)murine progenitor cells. Almost all (90 %)the erythroid bursts and megakaryocyticcolonies (out of a total of 70 colonies) andnone of the CFU-E- and CFU-GM-derivedcolonies (out of 30-40 colonies) investigatedexpressed both erythroid and megakaryocyticgenes. These data suggested that thebipotent cell precursor is intermediate betweenBFU-E and CFU-E. Then we analyzedby FACS the expression of TER-119 and 4A5(two surface markers specific for erythroidand megakaryocytic cells) in marrow andspleen cell suspensions from normal miceand from mice recovering from the anemiainduced by phenyl-hydrazine (PHZ). TER-119 + /4A5 + double positive cells were identifiedin the marrow from normal mice(1.3±0.6%) and in the marrow (3.8±0.8%,p

37 th Congress of the Italian Society of Hematology55onstrate that a single physiologic signal (i.e.CD40 crosslinking) does not only improvethe immunogenicity of ALL cells but alsoinduce them to produce a potent chemoattractantfor activated T cells. Moreover,ex-vivo generated autologous anti-leukemiaCTLs express CCR4 and respond to MDCby migrating through endothelium, underscoringthe rationale for the use of CD40-stimulated leukemia cells in vaccinationstrategies for the treatment of ALL.CO69CELLULAR LOCALIZATION OF HUMANHERPESVIRUS-8 (HHV-8) ANDEXPRESSION OF HHV-8 CELL-HOMOLOGOUS GENES IN HIV NEGATIVELYMPHOPROLIFERATIVE DISEASESR. TROVATO, M. LUPPI, P. BAROZZI, R MARASCA, M. MORSELLI,K. CAGOSSI, G. TORELLIDept. of Medical Sciences. Section of Hematology.Modena, ItalyThe occurrence of HHV-8 infection in lymphoidtissues is rare and the cell types infectedare largely unknown. Recently, HHV-8 genome has been shown to contain genesencoding homologues to cytokines,oncoproteins and cell cycle regulatory andsignaling proteins, that have been acquiredfrom the host cell. We explored whethertranscription of HHV-8 genes may occur inlymphoid tissues, in vivo, and also studiedthe cellular localization of the virus by insitu polymerase chain reaction (PCR). Thus,we used reverse transcriptase PCR to lookfor the expression of the HHV-8 genes homologousto human interleukin-6 (IL-6),cyclin-D, BCL-2 and interleukin-8 receptor(G-protein-coupled receptor-GCR-) in twocases of benign lymphadenopathy with giantgerminal center hyperplasia and increasedvascularity and in two cases ofCastleman’s disease (CD). None of thesegenes was expressed in the case of benignlocalized CD of hyalin-vascular (HV) type,and only vIL-6 and vCyclin-D were transcribedin the two cases of benign lymphadenopathies.In contrast all four genes weretranscribed in the case of multicentricCastleman’s disease of plasma cell type (PC)type with aggressive clinical course and intwo cases of primary effusion lymphomas(PEL). HHV-8 was localized in lymphoid andmonocyte-macrophage cells scattered in theinterfollicular regions of both lymphadenopathieswith giant germinal center hyperplasiaand increased vascularity, but not inendothelial cells. Our study reports, for thefirst time, that HHV-8 genes homologousto cell genes, may be transcribed in lymphoidtissues in vivo, out of the KS and AIDSsettings. The differential expression of HHV-8 genes homologous to cellular genes involvedin cell proliferation (v-cyclin-D andvGCR) and apoptosis (vIL-6 and vBCL-2)suggests that they may influence thelymphoproliferative process associated withthis herpesviral infection. The distributionof HHV-8 infected cells in non neoplasticlymph nodes outside of the germinal centersresembles that of Epstein-Barr virusinfectedcells in the lymph nodes in thecourse of infectious mononucleosis.CO70THE CARBOXYTERMINAL REGION OFG-CSF RECEPTOR TRANSDUCESPHAGOCYTOSIS SIGNALSV. SANTINI *, B. SCAPPINI *, A. GOZZINI *, P. ROSSIFERRINI*, A.D. SCHREIBER*Dept of Hematology, University of Florence, Italy;Hematology/Oncology Division, University of PennsylvaniaSchool of Medicine, Philadelphia, PA, USAGranulocyte colony stimulating factor (G-CSF) induces proliferation and maturationof myeloid progenitor cells, but plays alsoan essential role in promoting functionalactivities of mature granulocytes, like phagocytosis.We have demonstrated that Shc,Syk and Lyn kinases are independently tyrosinephosphorylated after G-CSF stimulationof 32d murine myeloid cells transfectedwith human wild type (WT) G-CSF-R. We showed that tyrosines 764 and 729of G-CSF-R cytoplasmic domain are crucialfor activation of Shc and Syk, respectively.Syk kinase role in granulocytic precursorproliferation and maturation has not beencompletely clarified. It has been demonstratedthat Syk kinase is required for Fcγreceptor mediated phagocytosis in monocytes/macrophagesand that in a COS-1 cellmodel system, co-transfection of Syk kinasewith FcγRI and its g chain subunit enhancesphagocytosis 5-7 fold, while cotransfectionof Syk with FcγRIIA enhancesphagocytosis ~2 fold. In order to examine

56 September 26-29, 1999 - Torino-Lingotto, Italythe influence on granulocytic function of G-CSF induced Syk activation, we analyzedthe pattern of tyrosine phosphorylation of32d myeloid cells WT/G-CSF-R transfectants,and DA/G-CSF-R natural occurringtruncated mutant (D715). In the lattermutant the ITAM (immunoreceptor tyrosine-basedactivation motif)- like motifof G-CSF-R is lacking. The ITAM motif containsthe binding sites for Syk. We thenstimulated G-CSF-R transfectants and mutantswith G-CSF 100 ng/ml for 10 minutesand analysed at light microscopy phagocytosisof sheep red blood cells, after 30minute incubation in a 37 °C shaking waterbath. DA/G-CSF-R mutant did not showSyk phosphorylation after stimulation. 32dWT/G-CSF-R transfectants had a baselinephagocytosis of 10 ± 2 % (300 cells scored),but after G-CSF stimulation 44 ± 5 % ofcells were phagocytic. The truncated DAmutant had only 1% of cells showing phagocytosis,and no increase was obtainedafter stimulation with G-CSF. A possible interpretationmodel proposes Src tyrosinekinase interaction with Syk kinase as anearly event in signaling cascades responsiblefor transmitting extracellular signalsfrom surface receptors to cytoplasmic pathwayscrucial for functional response. In ourknowledge, this is the first evidence indicatingG-CSF-R signals phagocytosisthrough a specific region. As we demonstratedthat the same region of the receptoris responsible for Syk activation, weconcluded that the phagocytic activitystimulated by G-CSF in 32d WT/G-CSF-Rtransfectants is modulated by the caroboxyterminalregion of the receptor via Syk.CO71DIAMOND-BLACKFAN ANEMIA:ROLE OF THE RPS19 GENE IN THEITALIAN POPULATIONU. RAMENGHI 1 , E. GARELLI 1 , M.F. CAMPAGNOLI 1 , A. BRUSCO 2 ,A. CARANDO 1 , M.R. GOVONI 3 , F. MASSOLO 4 , B. NOBILI 5 ,S. VAROTTO 6 , F. LOCATELLI 7 , I. DIANZANI 8Department of Pediatrics 1, and Dept of Biochemistry,biology and Genetics 2, University of Torino;Depts of Pediatrics University of Ferrara 3, Modena4, Napoli 5, Padova 6, Pavia 7 and Dept. of MedicalSciences, University of Eastern Piedmont 8Diamond-Blackfan anemia (DBA, MIM105650) is a congenital red cell aplasia,associated with a wide range of physicalabnormalities. Recently, mutations in ribosomalproteins 19S (RPS19) were identifiedin some DBA patients. The RPS19 gene,located within 19q13.2 region, encodes ribosomalprotein S19, the first structuralribosomal protein found to be involved in ahuman disease. RPS19 includes six exons,the first of which untraslated. Mutationswere found in 25% of DBA patients. Toevaluate the impact of mutations in RPS19in pathogenesis of DBA in the Italian population,we screened for mutations 49 Italianpatients; mutations were identified in9 families (18.4%), always in heterozygosity(deletion of the entire gene, -633insAGCC, 53insAGA, 237insG, W52X, R62W,R94X, R101H, IVS5 1G→A). Most mutationswere located in exon 4 (5/9), two are sharedby more than one patient (not consanguineousindividuals) and/or by patiens fromother population. Two cases were familial;the others were sporadic. One parent showsisolated macrocitosis, suggesting variableexpressivity of DBA. High ADA levels werefound in most patients who carry a mutationin RPS19, but also in patients with anormal gene. Similarly, we have not foundmutation-phenotype correlations. It is likelythat other factors contribute to the variableexpressivity of DBA, as shown by twonon-concordant monozygotic twins from ourpanel. The identification of DBA gene hasimmediate implications for clinical practice:it allows molecular diagnosis of the diseaseand genetic counselling in DBA families:parents with a sporadic DBA child can bereassured on the risk of recurrency, whereasprenatal diagnosis is possible for inheritedmutations.CO72BONE MARROW ERYTHROIDEXPANSION IN β THALASSEMIA.EVALUATION BY FLOW CYTOMETRYF.CENTIS, L. TABELLINI, O. BUFFI, L. GUERRA, B. PERSINI,P. T ONUCCI, G. LUCARELLIDivisione di Ematologia Centro Trapianto MidolloOsseo Az. Osp. “S.Salvatore” Pesaro - ItaliaStudies at the bone marrow level representa crucial aspect in the understandingof many hematological abnormalities includedthe β thalassemias. Beta thalassemiamajor is an hereditary disease characterized

37 th Congress of the Italian Society of Hematology57by ineffective erythropoiesis which leads toexpansion of the erythron and severe anemiadue to intramedullary programmed celldeath (apoptosis) of the erythroid precursors.In this study we have defined quantitativelyby flow cytometry, the erythroid expansionin 78 transfusion-dependent βthalassemic patients evaluating the wholebone marrow mononuclear cells reactivity(absolute number) to the CD36 and theCD71 antigens. The ineffective erythropoiesishas been also quantified (absolute number)evaluating the ealy apoptotic (AnnexinV positive) erythroid precursors (CD45negative). Our results show that the extentof the erythroid hyperplasia directlycorrelates with the extent of the earlyapoptosis (CD36 vs CD45-AnV+ r =0.90p

58 September 26-29, 1999 - Torino-Lingotto, ItalyHODGKINAND NON-HODGKINLYMPHOMASCO73TUMOR BURDEN (TB) AS PRIMARYPROGNOSTIC FACTOR IN HODGKIN’SDISEASE (HD)?P.G. GOBBI 1 , M.L.GHIRARDELLI 1 , M. SOLCIA 2 , G. DI GIULIO 2 ,F. MERLI 3 , G. NADALI 4 , R. BERTÈ 5 , O. DAVINI 6 , A. LEVIS 7 ,C. BROGLIA 1 , G. CARNEVALE MAFFÈ 1 , R. DORE 2 , E. ASCARI 1Med. Int. e Oncol. Med. 1 , Ist. di Radiologia 2 ,Univ. di Pavia, IRCCS S. Matteo; Serv. Ematologia,Arcispedale S. M. Nuova, Reggio E. 3 ;Catt. Ematologia, Univ. Verona 4 ; Sez. Ematologia,Osp. Civile, Piacenza 5 ; I Radiodiagnostica,Osp. S. Giovanni B., Torino 6 ; Div. Ematologia,Osp. SS. Antonio e Biagio, Alessandria 7The volume of TB present at diagnosiswas measured in 121 patients with HD,treated in the last 10 years (median follow-up:44 months). Patients were selectedonly through the availability of both magneticrecords of total body CT scan and ultrasonographicdimensional evaluation of thesuperficial lymph node not included in theCT scans. CT scans had to be serial andcontiguous and the identified lesions hadto be tridimensionally reevaluated and measuredthrough the elaboration resources ofthe CT equipment. In the majority of patientsthe enlarged lymph nodes not includedin the CT images were measuredwith a Toshiba ultrasound instrument bymeans of a 7 mHz probe. The TB of the 121patients, resulting from the sum of the volumesof all the lesions mesured on the CTand US scans, ranged from 4 and 985 ccm(175.114 ± 195.055). The prognostic valueof TB was investigated in relation to timeto treatment failure (TTF). In two distinctmultivariate analyses, the first including,the second not including serum ß2-microglobulin (ß2-m) among covariates(because of its lack in many clinical recordsat diagnosis), the parameters statisticallymost related with prognosis were the following(statistical P between brackets): TB(0.0006), ß2-m (0.008), ESR (0.012),Karnofsky index (0.019); or, without ß2-m, TB (

37 th Congress of the Italian Society of Hematology59to 36 Gy to uninvolved and involved sites,respectively; bulky disease received up to44 Gy. Gonadal function in women was assessedby hormonal tests and mensesevaluation; fertile women were given anestrogen-progesteron combination for ovarianprotection, while most of young menhad their semen cryopreserved.The treatmentprogram was completed in a medianof 6.2 months (range: 5-10). Complete remission(CR) rate was 88% after 4 ABVD(69 patients) and 98% after the adjunctiveRT. The 5-year relapse-free survival (RFS)is 97%; two of 3 relapsing patients hadachieved only partial remission after ABVD.The 5-year overall survival is 98%; two patientsdied to date, one of disease progressionand one of small cell lung carcinoma.Therapy-related long-term toxic events includedtwo cases of polmonary fibrosis withsymptomatic interstitial disease, one caseof dilated cardiomyopathy with cardiac failure(all patients had received mediastinalirradiation), and hypothyroidism requiringreplacement therapy in five cases. Fertilitywas preserved in young women and fournormal pregnancies were registered. Nocases of secondary leukemia occurred. Inearly-stage Hodgkin’s disease not undergoingstaging laparotomy, the combinationof a brief CT consisting of 4 cycles of ABVDand limited irradiation was effective andproduced a 97% RFS at 5 years. A prolongedmonitoring of potential long-termsequelae of therapy and evaluation of theirimpact on the quality of life are mandatoryin this curable setting of patients.CO75HIGH-DOSE SEQUENTIAL (HDS)REGIMEN AS SALVAGE TREATMENTFOR REFRACTORY/RELAPSEDHODGKIN’S DISEASE: A MULTICENTREEXPERIENCEI.L.I. Centres started a prospective programwith the high-dose sequential (HDS) chemotherapyregimen as salvage treatmentfor relapsed or refractory Hodgkin’s Disease(HD); besides, data from previous experiencesgained with HDS in the managementof progressing HD were collected. Aims ofthis study were: i. to evaluate feasibilityand efficacy of HDS in relapsed/refractoryHD in a multicentre setting; ii. to defineoverall curability of HD patients by combiningcure rate after first line therapy alongwith salvage with intensive chemotherapy.So far, 46 patients have been enrolled inHDS programs at 8 Italian institutions. TheHDS schedule includes the sequential administrationof high-dose (hd) cyclophosphamide(7 gr/sqm) followed by peripheralblood progenitor cell (PBPC) harvest, hdmethotrexate(8 gr/sqm), hd-etoposide (2gr/sqm) and finally hd-mitoxantrone (60mg/sqm) + L-Pam (180 mg/sqm) followedby PBPC autograft. Main patient characteristicsat HDS start were as follows: medianage 28 yrs. (range 16-50), stage III-IV= 25 pts., B symptoms=24 pts., BM involvement=6pts., PS ³2=9 pts., refractorydisease=17 pts., 1 st relapse=21 pts., ›1 strelapse=8pts. Thirty-seven pts. have completedHDS and are evaluable. There were3 treatment-related deaths (TRM=8%); 5more pts. had disease progression; CR wasachieved by 5 out of 13 refractory pts, 10out of 16 pts. in 1 st relapse and 6 out 8 pts.>1 st relapse. Overall, CR was achieved by21 out of 37 evaluable pts. (57%); so far,there was no relapse among pts. in CR. Inconclusion, this preliminary analysis showsthat HDS is feasible in a multicentre setting;its toxicity can be considered moderate,since all patients were variably pretreated;the CR rates obtained both in relapsedand refractory pts. are promising interms of therapeutic efficacy of the scheme.C. TARELLA, M. LIBERATI, R. ROMANO, P. COSER,C. ROSANELLI, U. VITOLO, A. DE CRESCENZO, N. DI RENZO,M. DELL’OLIO, M. FEDERICO, F. ZALLIO, P. GAVAROTTI, A. LEVISDivisioni di Ematologia, Oncologia e Clinica Medicadi Torino, Perugia, Bolzano, S. Giovanni Rotondo,Modena, Alessandria – Intergruppo Italiano Linfomi(I.L.I.)The Italian Lymphoma Intergoup (I.L.I.)comprehends most Italian Centres involvedin the management of lymphoma. In 1996

60 September 26-29, 1999 - Torino-Lingotto, ItalyCO7610-YR FOLLOW UP IN 246 PATIENTSWITH ADVANCED STAGE DIFFUSELARGE CELL LYMPHOMA (DLCL)TREATED WITH STANDARD 12 WEEKCHEMOTHERAPY: LATE RELAPSES ANDLATE TOXICITIESU. VITOLO, S. CORTELLAZZO, C. BOCCOMINI, E. BRUSAMOLINO,G. TODESCHINI, C. TARELLA, A.M. LIBERATI, M. BERTINI,R. CALVI, R. FREILONE, A. GALLAMINI, G. LUXI, V. MENEGHINI,L. ORSUCCI, D. ROTA SCALABRINI, F. SALVI, T. BARBUI,C. BERNASCONI, F. GRIGNANI, G. PERONA, A. PILERI, E. GALLOFor the Italian Multiregional non Hodgkin’s LymphomaStudy Group: U.O.A Ematologia, Az. Osp. S. GiovanniBattista, TorinoIntroduction: new intensive approachesgive promising results in the treatment ofDLCL, but they need to be compared withthe long term results achievable with priorregimens.Patients and Methods: in orderto define the cure rate, late toxicities andlate relapses, a long term analysis was performedon 246 patients (age 15-60) withadvanced stage DLCL treated with MACOP-B (200) or VACOP-B (46) regimens from1986 through December 1993. Results:median follow up was 115 months. Seventy-six% achieved a CR, 9% a PR, 11%showed a NR and 4% died of toxicity. 10-yrs OS is 58% and 10-yrs FFS is 53%.Among 185 CRs 52 pts relapsed. Late relapses(>2 yrs from the completion oftherapy) occured in 9 pts. Seven pts relapsedwith aggressive DLCL, one with follicularlymphoma and one showed aHodgkin’s disease. Five are alive in secondCR and four died of lymphoma. Late toxicities(>1 year from the completion oftherapy) were recorded in 28 pts: 7 femoralhead osteonecrosis, with a median timeoff chemotherapy of 15 months; 6 cardiactoxicities (4 cardiomyopaties, one ischemicdisease and one arythmia) at a mediantime off therapy of 60 months; 5 severeperipheral neuropathy, one renal failure,one pulmonary fibrosis and one viral encephalitis.Seven pts, in CR of lymphoma,showed a second cancer, with a median timeoff therapy of 70 months: 2 developed acutemyelogenous leukemia and died of this disease,5 had solid tumors (2 lung, 1 breast,1 gastric and one head and neck cancer)and two of them subsequently died of that.Actuarial risk to develop a second cancerwas 6% at 10 years. Conclusions: 50% ofpts with advanced stage DLCL are curedwith conventional chemotherapy. Howeverlate relapses may occur even after 8 years.11% of pts developed late toxicities. Secondaryneoplasia risk is not negligible. Longterm follow up data must be reported todraw definite conclusions in the outcomeof DLCL patients and may be useful as historicalcomparison in new trials.CO77RISK-FACTORS T IN DIFFUSE LARGECELL LYMPHOMA AT FIRST RELAPSE.A STUDY OF THE ITALIANINTERGROUP FOR LYMPHOMASC. GUGLIELMI, M. MARTELLI, M. FEDERICO, P.L. ZINZANI,U. VITOLO, C. TARELLA, G. SANTINI, N. DI RENZO,G. BELLESI, L. RESEGOTTI ON BEHALF OF THE INTERGRUPPOITALIANO LINFOMI WITH: GISL, GRUPPO BOLOGNA-ROMA,GRUPPO MULTIREGIONALE, NHLSG, EMATOLOGIA “LA SAPIENZA”ROMA, EMATOLOGIA FIRENZE AND EMATOLOGIA UNIV.TORINODipartimento di Biotecnologie Cellulari edEmatologia, Università “La Sapienza”, Roma, ItalyIntroduction: The objective of thepresent study was to identify risk groups inadult patients (pts) with diffuse large celllymphoma (DLCL) at first relapse (R1).Methods: we studied 448 pts representing>90% of relapses observed in a decade(88-97) of prospective trials of initial chemotherapyby 4 multicenter groups and by3 cen-ters in Italy. Median time to R1 was381 days from diagnosis (Dx), 92% relapsed3.5 yrs ago. Median age atR1 was 55 yrs (16-85) and median followupis 3.3 yrs. Overall response (CR+PR) was63% (similar in various salvage regimens)and high-doses + stem cell transplant(HDSCT) was added in 89 pts. At 3 yrs,overall survival (OS) was 35% and progression-freesurvival (PFS) was 26%. OS andPFS were compared (log-rank) by: histology(WF, high vs in-termediate; REAL, largeB vs peripheral-T vs anaplastic CD30+),phenotype (B vs T), time to R1 (1yr from Dx), age at R1 (65),LDH at R1 (N vs >N), stage at R1 (I-II vsIII-IV), performance status (PS) at R1 (0-1vs >1). Age at R1, overall response to salvagechemotherapy and HDSCT intensificationwere included in the Cox models toadjust factors related to OS and PFS atunivariate analysis. Results: Univariate:

37 th Congress of the Italian Society of Hematology61OS and PFS were related with WF histology,with time to R1 and with age-adjustedIPI factors at R1 (LDH, stage and PS). Multivariate:1 atR1 (RR=2.4, CI 95%=1.8-3.2) were adversefactors (AFs). No. of AFs at R1(0,1,2) identified 3 risk groups (p

62 September 26-29, 1999 - Torino-Lingotto, Italypatient, II in 7, III in 5 and IV in 23; 10presented B symptoms; the IPI score was0-2 in 29 cases and ≥ 3 in the remaining 7.Of the 29 untreated patients 16 achievedCR, 8 PR, 4 PD and 1 was early withdrawnfrom the study due to acute viral hepatitis;subsequently, 4 relapsed and 3 died (2 ofdisease progression, 1 of causes unrelatedwith the disease). In the pretreated group3 patients obtained CR, 2 PR and 1 PD; 3 ofthese died (1 of progressive disease, 1 of anew relapse, 1 of myocardial infarction duringtherapy). With a 16-month median follow-up,OS was 0.82 and DFS 0.79. G-CSFwas administered to all the patients but 2with a median delivery during the wholeregimen of 8400 µg per patient. Mean cumulativeDI was 0.81. Grade 3-4 hematologicaltoxicity consisted in 3 cases of anemia,8 of leucopenia and 2 of thrombocytopenia;the same grade nonhematologicalone involved liver in 2 cases, heart in 1 (theabove mentioned death), digestive mucosain 2 and peripheral nerves in 1. In conclusion,the iso-DI sequential variant of theProMECE-CytaBOM regimen can be consideredfeasibile, relatively not much toxic, andcan be administered on an outpatient basis.A limited use of G-CSF is required (about3 vials after each drug administration). A randomizedtrial with the original ProMACE-CytaBOM regimen can be proposed.CO80AUTOLOGOUS STEM CELLTRANSPLANTATION (ASCT) FOR ADULTLYMPHOBLASTIC LYMPHOMA (LBL) INFIRST REMISSION: RESULTS FROM ARANDOMIZED TRIAL OF THE EUROPEANGROUP FOR BLOOD AND MARROWTRANSPLANTATION (EBMT) AND THEUK LYMPHOMA GROUP (UKLG)G. SANTINI, J.W. SWEETENHAM, M. MARTELLI, S. SIMNETT,M. GUELFI, P. BRUZZI, M. PARMAR, W. QIAN, A. NAGLER,H. HOLTE, A.H. GOLDSTONEDept. of Haematology, S. Martino Hosp., Genova, ItalyThe aim of this multi-center study was tocompare the effectiveness of conventionaltreatment with high-dose therapy (HDT)plus ASCT in improving survival and DFSof 1 st remission adult LBL patients. FromNovember 1992 to April 1997, 119 adultpts with LBL from 33 European centres enteredthe EBMT/UKLG LY01 study. All ptswere treated with standard remission/inductiontherapy. Responding pts wererandomised to either conventional doseconsolidation/ /maintenance therapy (CT)or HDT and ASCT. In some centres, pts withHLA-identical sibling donors were registeredfor the trial, but proceeded to allogeneicBMT without randomisation. Randomisedpts relapsing after CT who responded tosalvage therapy received ASCT in 2 nd remission.Pts characteristics: Male 83, female36; median age 26 years (range 14to 65); Ann Arbor stage III/IV 83, T cell80; LDH elevation 64. Results: Responseto induction therapy: CR 67 (56%), PR 31,NR/PD 9; toxic death 1; protocol violation1; inevaluable 7. Sixty-five pts wererandomised (31 ASCT, 34 CT). Reasons forfailure to randomise: NR/PD 16; toxicity ofinduction therapy 5; allogeneic BMT 12;protocol violation 6; patient refusal 12. Forrandomised pts, the 3yr actuarial relapsefree survival is 56% in the ASCT arm, versus14% in the CT arm (p=0.08). Corresponding3yr actuarial overall survivals are62% and 52% respectively (p=0.98). Conclusions:These results suggest that ASCTis superior to conventional dose chemotherapyas post-remission therapy for adultLBL. The fact that overall survival is thesame for both arms may reflect the effectivenessof ASCT in 2 nd remission for patientswho relapse after conventional consolidationtherapy.CO81CIS-PLATINUM, IDARUBICIN,PREDNISONE (CIP) ASCONSOLIDATION THERAPY FORELDERLY NHL PATIENTS AFTERP-VABEC REGIMEN. AN ITALIANMULTICENTER RANDOMIZED STUDYM. MARTELLI, F. CARACCIOLO, V. DE SANCTIS, F. PALOMBI,A. PERROTTI, A. ANDRIANI, P. ANTICOLI, E. IANNITTO,M. PETRINI, F. MANDELLIDip. di Biotecnologie cellulari ed Ematologia, Univ.La Sapienza Roma, Hematology Univ. Pisa, HematologyUniv. Tor Vergata RomaBackground: In an our previous phaseII study the P-VABEC regimen resulted anactive and well tolerated therapy for elderlypatients (pts) with diffuse large cell NHL

37 th Congress of the Italian Society of Hematology63(JCO 11- 2363,1993). In spite of a high rateof CR the overall response rapidly decreasedfor a remarkable incidence of relapses.Purpose: To evaluate the activity and toxicityof CIP consolidation therapy after P-VABEC versus standard P-VABEC regimenin a prospective a randomized study. Patientsand methods: From October 1995to April 1999 were enrolled 152 previouslyuntreated pts with diffuse large cell NHL(according to REAL), median age of 70 yrs(range 60-85), stage II-IV. The CIPschedula, started 21 days after the end ofP-VABEC, consisted of : Cis-platinum(40mg/td day 1), Idarubicin (15mg/m 2 day8), and Prednisone (40mg/td days 1-4/ 8-11) repeat every 21 days for a total of 3cycles. So far 113 patients are evaluablefor the response, 65 pts randomized for P-VABEC (group 1) and 48 for P-VABEC-CIP(group 2). According to the age-adjustedInternational Prognostic Index (IPI) 52 ptswere considered as Low Risk (IPI 0-1) and61 as High Risk (IPI 2-3). Results: With amedian follow up of 18 months (range 1-46) the CR rate, OS and EFS at 2 yearswere 63%, 58%, 54% in the group 1 and62%, 72%, 68% in the group 2 (p= ns). Ifwe consider pts with High Risk the OS was42% and 80% (p=0.08) and the EFS was40% and 57% (p=0.27) respectively in thegroup 1 and group 2. In the Low Risk groupthe OS was 95% and 73% (p=0.10) andEFS was 78% and 76% (p=0.5) respectively.The CIP consolidation regimen hasbeen a safety and well tolerated chemotherapyfor all pts. Mortality-related chemotherapyoccurred in 3 (3%) of the ptsduring P-VABEC. Conclusions: Our preliminaryresults showed that CIP consolidationtherapy did not improve the survival of elderlyNHL pts previously treated with P-VABEC. The study is still ongoing, additionalpts and follow up will be need for definitiveresults.

64 September 26-29, 1999 - Torino-Lingotto, ItalyALLOGENEICTRANSPLANTATIONIgG. In view of the high cost of HDIgG, theseresults may have economic as well medicalimpact for allogeneic bone marrow transplantprocedures.CO82HIGH VS. LOW DOSE OF POLYVALENTINTRAVENOUS IMMUNOGLOBULIN INALLOGENEIC HEMOPOIETIC STEM CELLTRANSPLANTSN. MORDINI, R. ONETO, B. BRUNO, M. SORACCO,T. LAMPARELLI, F. GUALANDI, G. BERISSO, S. BREGANTE,A.M. RAIOLA, A. LOMBARDI, M.T. VAN LINT, A. BACIGALUPODepartment of Hematology, Ospedale San Martino,Genova, ItalyThe role of high dose intravenous IgG(HDIgG) in the Allogeneic Bone MarrowTreansplantation setting is still under investigation,since there are contrasting clinicalreports. In this study we compare twodifferent dosese of human HDIgG in a randomizedprospective trial. Primary endpoints are infections, severity of acute graftversus host disease and transplant relatedmortality. Secondary end points are daysof hospitalization, chronic graft versus hostdisease, days of intravenous antimicrobialand immunosoppresor therapy, incidence oftransplant related TTP. Patients wererandomised to received 100 mg/kg/weekof HDIgG (Group A; n=38) or 400 mg/kg/week og HDIgG (Group B ; n=37) from day-7 to day +100. The two groups were comparablefor age, diagnosis disease statusand acute graft-versus host prophhylaxis.In spite of the different median concentrationof seric IgG, we did not see significantdifferences between the two groups interms of incidence of infections (local or disseminate),development of interstitial pneumonia(10 vs. 13), development of CMV infection(20 vs 24). Regarding acute GvHD,grade 0-I, II, III_IV were observed in 22vs 22, 14 vs 12 and 2 vs 3 patients respectivelyfor the two arms.Chronic GvHD wasabsent in 5 vs 5, limited in 20 vs 19 andextensive in 13 vs 13.The days of hospitalization,of fever, of intravenous antibiotics,of intravenous immunosuppressive agentsand the TTP index were not significantlydifferent. Actuarial 1 year TRM is 16% vs15% respectively. Conclusions: No differenceswere observed in two groups of patientreceiving 100 or 400 mg/kg/week ofCO83EXPRESSION OF ADHESIONMOLECULES ON NORMAL CD34 + STEMCELLS: A POSSIBLE ROLE IN MYELOIDENGRAFTMENT AFTER ALLOGENEICTRANSPLANTATIONF. BUCCISANO, A. VENDITTI, G. DEL POETA, A. TAMBURINI,L. MAURILLO, A.M. EPICENO, B. DEL MORO, T. CARAVITA,S. SANTINELLI, F. ZINNO, A. LANTI, G. ADORNO, A. BRUNO,S. AMADORIHematology, Tor Vergata University, Rome, ItalyThe expression of adhesion molecules onCD34 + cells from healthy donors has beenstudied in order to evaluate their role inhematopoietic reconstitution after allogeneicstem cell transplantation (alloSCT).Twenty-two patients (pts.) affected by hematologicaldiseases (4 MM, 5 MDS, 2 CML,2 AML, 1 CLL, 3 NHL, 4 ALL, 1 SAA) wereincluded in the study. Median age was 45years (range 2-60); 13 pts. received peripheralblood stem cells (PBSC), 9 bonemarrow (BM). The median number of CD34 +cells infused was 2.8 x10 6 /kg (range 1.3-5.7) and 8.7 x10 6 /kg (range 2.8-15.6) forBM and PBSC recipients, respectively(P

37 th Congress of the Italian Society of Hematology65total number of CD34 + stem cells (r –0.46,r –0.54, r –0.67, r –0.51 vs. r –0.42). In amultivariate analysis, the number ofLecam + /CD34 + cells approached the statisticalsignificance for PLT engraftment(P=.052). We conclude that the expressionon CD34 + stem cells of L-selectin and CD11cmay identify subsets of hematopoietic precursorswith unique biologic features promotinga faster myeloid recovery afteralloSCT.CO84MONITORING OF MIXED CHIMERISMAFTER ALLOGENIC TRANSPLANTATION:MULTIPLEX AMPLIFICATION WITHFLUORIMETRIC DETECTIOND. MADEO, A. CAPPELLARI, C. CASTAMAN, U. PIZZOLATO,F. RODEGHIERODepartment of Hematology, San Bortolo Hospital,VicenzaWe evaluated the feasibility and the sensitivityin detecting mixed chimerism afterallogenic transplantation of BM or PBSC usinga commercially available kit (AmpFlSTRProfiler Plus - PE Applied Biosystems) andABI Prism 310 as detecting system. Themultiplex amplification of 9 different shorttandem repeats (STR) and of amelogeninlocus is carried out in a single reaction tube.ABI Prism 310 detects the fluorescent signaland calculates the fragment size andthe peak area. The sensitivity and linearityof this method has been tested on a serialdilution of whole blood and genomic DNAmixed in various proportions. The allele concentrationin the 15 dilution samples testedranged from 0.25 % to 99.75 %. The linearityof the response assessed in the interval10 - 90 % showed a coefficiency regressionof 0.99. The mean sensitivity was1.5 % (range 0.5 - 2.5), which was greaterthan that previously reported (Thiede etal.1998, Scharf et al. 1995). In 25 donorrecipientcouples the mean number of lociuseful to assess relapse was 5.9 (range 3-11). We monitored 21 cases of allogenicBM o PBSC transplantation (18 from familydonor and 3 MUD) before, 1, 2 and at least6 months from transplantation (range 1-24). In 6 patients mixed chimerism was observed,with a range of donor allele percentageranging from 1-3 %. This percentagedid not change over time and has notbeen correlated with relapse. Fragment dimensionreproducibility (cv 0.21, range0.12-0.5) was confirmed either by qualitycontrol on a DNA sample either byamelogenin repeatability on all the patients.In conclusion, the present system is sufficientlyrapid, sensible and specific for theevaluation of mixed chimerism after BM orPBSC transplantation.CO85CONVENTIONAL AND MOLECULARCYTOGENETICS IN BONE MARROWTRANSPLANTED PATIENTSL. LUCIANO, F. FRIGERI*, C. SELLERI, G. DE ROSA,A. GUERRIERO, P. D’ANDREA*, G. ABATE*, B. ROTOLIDivision of Hematology, Federico II University, and* Division of Hematology, National Cancer Institute“Pascale”, NaplesWe need to find more sensitive and specificmethods for detecting and monitoringchimerism after allogeneic bone marrowtransplantation (alloBMT). Conventional cytogeneticanalysis allows to analyze onlyproliferating cells, and after alloBMT it couldbe difficult to get a sufficient number of goodquality methaphases. Recently in sex mismatchedalloBMT recipients, FISH analysiswith sex chromosome probes (X-Y FISH)proved to be more sensitive and specificthan conventional cytogenetics: X-Y FISHexamines both proliferating and restingcells, thus giving information on the numberof residual host cells, even if nomethaphases are avaible. A techniquewhich can be considered alternative to insitu hybridization could be the primed insitu labelling (PRINS), a method for labellingspecific DNA sequences by annealingan oligonucleotide DNA primer to thedenaturated DNA on glass slides and extendingit enzimatically in situ with the incorporationof labelled nucleotides. We setup this technique on both bone marrow andperipheral blood smears using X and Y primersin ten sex-mismatched transplantedpatients . Preliminary data show a highspecificity and the same sensitivity of FISH.However, this method is faster (about 2hours) and approximately ten times lessexpensive than FISH.

66 September 26-29, 1999 - Torino-Lingotto, ItalyCO86SECONDARY FAILURE OF PLATELETRECOVERY IN HEMATOPOIETIC STEMCELL TRANSPLANTATION (HSCT)B. BRUNO, T. GOOLEY, K. SULLIVAN, C. DAVIS,W.I. BENSINGER, R. STORB, R.A. NASHFred Hutchinson Cancer Research Center, Universityof Washington Medical School, Seattle,WAAfter HSCT, the recovery of platelet counts(PLT) is not always sustained, even thoughother cell lineages may return to normalranges. The purpose of this study was tocharacterize secondary failure of plateletrecovery (SFPR), defined as the first day ofdecline of PLT below 20000/µl, for 7 consecutivedays or requiring transfusionswithin 7 days, after sustained platelet recovery(PLT ≥50000/ml for 7 consecutivedays without transfusion support) in a largeseries of patients undergoing HSCT. Thestudy population consisted of 2871 consecutivepatients transplanted at the FHCRCfrom Jan.’90 to Mar.’97. Patients were observedfrom the day of transplant until thefirst occurrence of relapse, second transplant,or discharge home. SFPR not due todisease recurrence was observed in 285/2153 (13%) of allogeneic patients and 36/718 (5%) of autologous patients, with amedian time of onset at day 63 (range 21-156) and at 44 (range 24-89) daysposttransplant, respectively. Concomitantneutropenia was present in 57/285 (20%)of allogeneic and 7/36 (19%) of autologouspatients; 32/57 (56%) and 4/7 (57%) respectively,were on ganciclovir. By multivariateanalysis, a transplant from an unrelateddonor, GVHD prophylaxis other thanmethotrexate and cyclosporine, and timedependant variables such as developmentof grade II-IV GVHD, impaired renal andliver functions, and infections were highlysignificant risk factors. CMV infections werethe only significant risk factor in the autologoussetting. Baseline variables, knownto correlate with platelet recovery, such assource of stem cells, cell dose infused, typeof disease and disease status were not associatedwith a higher risk of developingSFPR. Most bone marrow aspirates performedon thrombocytopenic patientsshowed trilineage engraftment indicatingdefective thrombopoiesis or decreasedplatelet survival. One-year mortality was51% in allotrasplants and 44% in autotransplantswith SFPR. The hazard of deathwas significantly higher in patients who experiencedSFPR (HR=2.8 for allogeneicHSCT, HR 2.1 for autologous HSCT). SFPRis associated with adverse prognosis. Abetter understanding of the pathophysiologyis warranted to design effective treatmentstrategies in a group of patients withpoor outcome.CO87CTL-p ANALYSIS IN STEM CELLSTRANSPLANTATION (BMT) FROM HLA-IDENTICAL SIBLINGSF. LOCATELLI*, P. AFFATICATI^, M. FALDA*, F. MARMONT*,S. ROGGERO^, A.M. DALL’OMO^, C. CERETTO*,E.S. CURTONI^, E. GALLO**Centro Trapianti Midollo-Ematologia Osp.-Torino;^Immunologia dei Trapianti-Università di TorinoIn BMT setting, current matching policiesare based on a “structural matching”, i.e.donor-recipient identity for the HLA antigensor genes analysed. Nevertheless acutegraft vs host disease (aGvHD) occurs evenin the presence of a complete “structuralmatching”, whereas sometime recipientsfrom a known mismatched donor do notdevelop significant aGvHD. The definitionof a “functional matching” may help to assessthe clinical relevance of mismatchesfor known HLA antigens, minor histocompatibilityantigens (mHA) or undefined antigensnot detected by current methods. Theprecursor frequencies of donor antirecipientcytotoxic T-lymphocytes (fCTL-p) wereshown to predict the occurrence of GvHDafter BMT from unrelated donors. In thepresent study, the CTL-p frequency and theincidence and severity of aGvHD in 42 BMTfrom HLA-identical sibling for onco-hematologicaldiseases have been compared, inorder to assess the value of CTL-p assay indonor selection and possibly in the graduationof GvHD prophylaxis. Pre-BMT conditioningwas TBI-CY in 21 pts., Thiotepa-CYin 14 and Bu-CY4 in 7. GvHD prophylaxisconsisted of CyA + MTX in all cases. Siblingdonors were selected on the basis ofHLA identity using serological typing forHLA-A,B,C antigens, whereas HLA-DRB,DQA, DQB was tested by molecular analysis.All CTL-p assays were performed in theGvH direction, with donor cells as respondersand recipient cells as stimulators. Donor/recipientspairs were divided into high

37 th Congress of the Italian Society of Hematology67(>1/100.000) and low (

68 September 26-29, 1999 - Torino-Lingotto, Italytions. NK cell clones of donor origin wereobtained from transplanted recipients andtested for lysis of recipient’s cryopreservedpre-transplant lymphocytes. Despite theabsence of GvHD, we detected high frequenciesof NK clones which killedrecipient’s target cells. Lysis followed therules of NK cell alloreactivity, being blockedonly by the MHC class I KIR epitope whichwas missing in the recipient. Thealloreactive NK clones also killed 100% ofthe allogeneic myeloid leukemias tested(and only a minority of ALLs). Therefore,potential in vivo targets are myeloid leukemias,as they were susceptible to allogeneicNK killing in vitro, but also host lymphocytesmediating rejection, because assessmentof allogeneic NK lysis was routinelyperformed against activated lymphocytes.No myeloid relapses or graft rejectionswere observed in the 20 patientstransplanted from donors with HLA-basedpotential for transfer of anti-recipient NKcell alloreactivity. To date the 5 myeloidrelapses and the 7 rejections have occurredin the other 41 patients. In conclusion, thepresent study uncovers one biological aspectof mismatched hematopoietic transplantation,i.e., the unexpected post-graftingemergence of donor NK cells which donot recognize host alloantigens and which,in the absence of GvHD, kill recipient targetcells in accordance with the laws of NKcell alloreactivity. KIR epitope-mismatchingin the GvH direction may confer uniquepotential for GvL effect and for engraftment(Blood 1999, in press).Supported by AIRC grant to AV and FIRC fellowshipsto LR and IVCO90ENGRAFTMENT IN NOD/SCID MICE OFHUMAN CORD BLOOD CD34 + CELLSAFTER EX VIVO EXPANSIONthe low number of cells that are available.Ex vivo expansion of CB stem cells mightbe used to overcome this limitation. Wehave previously reported that CD34 + CBcells can be expanded in vitro, for severalmonths, in stroma free cultures in the presenceof FL+TPO±IL-6±SCF. Recently a newapproach has been developed to establishan in vivo model for human primitive hematopoieticprecursors by transplantinghuman hematopoietic cells into sublethallyirradiated NOD/SCID mice.We have examined the expansion of SCID-Repopulating Cells (SRCs) during stromafree suspension cultures of human CD34 +CB cells. Groups of sublethally irradiatedNOD/SCID mice were injected with 10,000and 20,000 unmanipulated CD34 + CB cellswhich were cryopreserved at the start ofcultures, either the cryopreserved correspondingprogeny of initial 10,000 or 20,000CD34 + cells that were cultured for 4, 8 and12 weeks in presence of FL, MGDF, SCF andIL-6. Mice were sacrificed 6-8 weeks posttransplant and BM and spleen were assessedfor human engraftment by flowcytometry, DNA analysis, growth of humanmyeloid and erythroid progenitors and LTC-IC. These techniques reliably detect humancells at very low levels in a murine background.Mice that had been injected with10,000 or 20,000 cryopreserved unculturedCD34 + cells did not show any sign of engraftment.Conversely, mice injected withthe cryopreserved and expanded cells generatedby 10,000 or 20,000 initial CD34 +cells showed a good level of engraftment.These results support and extend our previousfindings that CD34 + CB stem cells(identified as LTC-IC) could indeed be grownand expanded in vitro for an extremely longperiod of time.W. PIACIBELLO, F. SANAVIO, A. SEVERINO, L. GAMMAITONI,A. DANÈ, G. CAVALLONI, M. AGLIETTADept of Biomedical Sciences and Human Oncology,Hematology/Oncology Section, University of Torinoand IRCC Candiolo, ItalyAlthough cord blood (CB) comparesfavourably to other hemopoietic stem cellsources in regard to a number of parameters,its use in large patients is limited by

37 th Congress of the Italian Society of Hematology71APLASTIC ANEMIA ANDACUTE LUKEMIAP001MDR1 IS A POOR PROGNOSTICFACTOR IN ADULT ACUTELYMPHOBLASTIC LEUKEMIA PATIENTSUNIFORMLY TREATED ACCORDING TOGIMEMA 0496 PROTOCOLA. TAFURI ON BEHALF OF THE GIMEMA COOPERATIVE STUDYGROUPEmatologia, Dipartimento di Biotecnologie Cellularied Ematologia, Università “La Sapienza”, RomaCellular drug resistance is one of the reasonsof treatment failure in acute leukemia.Overexpression of the multidrug resistancegene (MDR1) and its protein (Pgp)has been frequently correlated with poorprognosis in acute myeloid leukemia (AML),particularly in elderly patients. In contrast,less information is available on the role ofMDR in acute lymphoblastic leukemia (ALL),especially in adult cases. Aim of our studywas to evaluate the incidence and prognosticvalue of the MDR1 protein, as well as itsfunctional expression, in newly diagnosedadult ALL patients uniformly treated accordingto the GIMEMA 0496 protocol. In 222cases, we measured by two flow cytometrictests the P-gp expression (MRK16) and theRhodamine 123 (Rhd123-E) functional dye/drug efflux with/without the MDR1 modulatorVerapamil. The results were analyzedusing the Kolmogorov-Smirnov statisticmethod (D-value) and the mean fluorescenceindex (MFI). P-gp expression rangedbetween 0 and 0.77 with a D-value > 0.01(MDR+) in 26% of cases (58/222). Analysisof the 138 patients so far evaluatedshowed a significantly (p=0.003) higherfrequency (81%) of MDR- patients (P-gp)who achieved a complete remission (CR)compared to MDR+ patients (53%). A significantly(p=0.03) higher frequency (65%)of relapse was recorded in the group ofMDR+ patients. Moreover, a significant(p=0.002) difference in the median (m)event-free survival (EFS) was found betweenP-gp positive and negative patients:5.5 vs 12 months, respectively. In addition,detection of the functional dye/drug effluxshowed a Rhd 123-E ranging between 0.38and 3.66, with a value > 1.10 (MDR+) in14% (23/167) of patients. A significant(p=0.009) difference in CR achievementwas also observed between efflux negativeand positive patients (80% vs 50%). Theseresults show that MDR1 is overexpressedin only a quarter of adult ALL patients; however,these cases are characterized by alower likelihood of achieving CR, a higherincidence of relapse and a shorter EFS duration.The poor prognostic impact of MDR1overexpression so far recorded in the ongoingGIMEMA 0496 protocol, suggests thepossible use of MDR1 modulator agents ina proportion of adult ALL patients.P002FLUDARABINE AND HIGH DOSE OFCYTOSINE ARABINOSIDE FOR THETREATMENT OF REFRACTORY ACUTELEUKEMIA OF CHILDHOODS. CHIARETTI , M.L. MOLETI, R. BATTISTINI, S. BERNASCONI,F. GIONA, A.P. IORI, A. PESSION, R. RONDELLI, A.M. TESTI,F. MANDELLIDipartimento di Biotecnologie Cellulari edEmatologia,”Università La Sapienza”, Roma;Clinica Pediatrica, Università di BolognaFludarabine (FLUDA) and high dose Cytosine-arabinoside(HD-ARA-C) associatedor not of granulocyte stimulating factor (G-CSF) have been utilized for treatment ofpoor prognosis acute leukemias, showingefficacy and feasibility in adults. These resultsprompted to employ this schedule alsoin pediatric patients. At University of Romeand Bologna, FLUDA (30mg/sm/day for 5days) associated with HD-ARA-C (2 gr/sm/day for 5 days) with or without G-CSF (fromday 1 to PMN recovery ) (FLA or FLAGschema), was used to treat children withadvanced acute leukemia. Twenty-nine childrenwere enrolled: 19 were male and 10female, with a median age of 8 ys (range2-17); 17 had a diagnosis of acute lymphoblasticleukemia (1 first early relapse, 2 firstresistant relapse, 13 second relapse, 1 thirdrelapse), 12 of acute myeloid leukemia (3first early relapse, 1 first resistant relapse,1 second relapse, 1 third relapse, 6 primaryresistant). Sixteen received G-CSF. In 3 childrenwith an available bone marrow donor,chemotherapy was administered in orderto obtain bone marrow aplasia, immediately

72 September 26-29, 1999 - Torino-Lingotto, Italyfollowed by conditioning and BMT: 2 of themare in complete continuos remission at 26and 41 months, and the other relapsed 9months after transplantation. Twenty-sixreceived protocol FLA/FLAG as salvage chemotherapy.In this group the response rate(CR+PR) was 58%: 12 (6 acute lymphoblasticleukemia, and 6 acute myeloid leukemia)obtained complete remission, 3 (1acute lymphoblastic leukemia, 2 myeloidleukemia) achieved partial remission (M2bone marrow) and 11 were resistant. Nineof the responders are alive and 6 died atmedian follow-up of 5 months (range 1-43months). Myelosuppression was the majortoxicity with a median time of neutropeniaof 16 days (range 7-35), and thrombocytopeniaof 18 days (range 11-29); 15 FUOand 11 sepsis occurred.; any other side effectswere observed. In conclusion, in ourexperience protocol FLA/ FLAG resulted effectiveand feasible in heavily preatreatedchildren with advanced acute leukemia.P003DOSE-INTENSIVE THERAPYINCLUDING STEM-CELLTRANSPLANTATION IMPROVEsOUTCOME IN ADULT ACUTELYMPHOID LEUKEMIA (ALL)G. DEL POETA, F.BUCCISANO, L.MAURILLO, A.VENDITTI,M.C.COX, A.TAMBURINI, L.MORINO, A.RICCITELLI,M.POSTORINO, M.I. DEL PRINCIPE, L.CUDILLO, B. DEL MORO,M.MASI AND S.AMADORIDept. of Hematology, University “Tor Vergata”, RomaIn an attempt to improve long-term disease-freesurvival (DFS) in ALL, from 1995to 1998 we treated 21 adult patients withnewly diagnosed ALL with a dose-intensiveregimen. The induction phase consisted ofcytarabine (H-Ara-C) 3 g/m2/d for 5 daysand Mitoxantrone (H-MTZ) 80 mg/m2 as asingle dose on day 1. This combination wasrepeated for consolidation at reduced doses(Ara-C 3g/m2/d for 3 days and MTZ 40mg/m2 on day 1). Prednisone (40 mg/m2/d),triple intrathecal therapy and GM-CSF werealso included. Up till now, 15 patients underwentautologous (10) or allogeneic (5)stem cell transplantation. To evaluate theefficacy of this new approach, we performeda historical comparison with a conventionalprogram such as the LAL 0288 GIMEMAprotocol used in 44 ALL patients from 1988to 1994 at our Institution. No significantdifference was found between these two patients’groups with regard to medianage, WBC count, FAB distribution,immunophenotype (B or T), cytogenetics(Ph1 chromosome), myeloid markers andP-glycoprotein expression. With regard toclinical outcome, number of early toxicdeaths was found to be comparable amongLAL 0288 cases and H-Ara-C/MTZ ones (8/44 and 3/21) as well as the rate of completeremission (CR) (88% v. 95.2%). Onthe contrary, the relapse rate was significantlyhigher among pts treated with theLAL 0288 (64.2% v. 22.2%; P=0.004).Moreover, overall survival and continuousCR (CCR) at 3 years were significantlylonger in the dose-intensive treated pts(61% v. 22%; P=0.017 and 65% v. 27%;P=0.016, respectively). However, within“poor risk” ALL subset (15 Ph1+; 7 matureB-cell), no significant difference was notedwith regard to CR achievement and relapserate between the two regimens; a trend fora longer survival and CCR was found inPh1+ H-Ara-C/MTZ pts (P=0.204 and=0.137, respectively). This dose-intensiveapproach assures rapidly high CR rates andlonger DFS, even if long-term benefit appearsto be restricted mainly to patientswith “standard risk” ALL.P004NEGATIVE PROGNOSTIC RELEVANCEOF CD45RA EXPRESSION IN ADULTACUTE LYMPHOBLASTIC LEUKEMIAN. CASCAVILLA, G. D’ARENA, L. MELILLO, M.M. GRECO,A.M. CARELLA, M.R. SAJEVA, R. MATERA, M. CAROTENUTODepartment of Hematology, IRCCS, “Casa Sollievodella Sofferenza” Hospital - San Giovanni RotondoThe flow cytometric expression of 220 kDisoform of CD45 (CD45RA) antigen on 51adult ALL (M 27, F 24; FAB L2 38, L1 13;Early Pre-B 6, Common 28, Pre-B 5, EarlyT 6, Late T 6; mean age 39.8 yrs., range16-81) has been analysed. CD45RA hasbeen positive > 20% on 32 cases (62.7%).The pattern of expression has been differentamong B and T lineage ALL: in B lineageALL, no preferential relationship withthe antigenic classes was identified; on thecontrary, in T lineage ALL, it was expressedonly on 4 early T ALL and completely lackedon late T ALL. With respect to negative

37 th Congress of the Italian Society of Hematology73cases, in the group expressing CD45RA asignificantly higher incidence of L2 cytotype(84.4% vs 57.9%, p 0.039), B lineage ALL(87.5% vs 57.9%, p 0.02), MyAg+ ALL(50% vs 21%, p 0.037), CD34+ ALL (87.5%vs 63.1%, 0.046) and t(9;22) or BCR/ABL+ALL (34.4% vs 21%, p NS) has been noted.In addition, in CD45RA+ ALL the mean age(43.3 yrs. vs 33.8, p 0.08), peripheralWBC count (36.600 vs 21.200, p 0.06) andserum levels of LDH (1292 vs 729, p 0.08)were higher. In 16 cases flow cytometricanalysis of CD95, bcl-2 and MRK16 has beenperformed: interestingly, an increased incidenceof MDR phenotype has been observedin CD45RA+ ALL, however, the tendencyto apoptosis was analogous in the 2groups. All cases underwent GIMEMA protocolsfor ALL: 0183 in 6 cases; 0288 in 16cases; 0394 in 7 cases; 0496 in 22 cases.C.R. has been achieved in 22 CD45RA+ ALL(68.7%) and 17 CD45RA- ALL (89.5%) (p0.08). Independently from the protocolused, in B lineage ALL as well as in T lineageALL a close relation between CD45RApositivity and lower response to therapy hasbeen observed. In CD45RA+ ALL the O.S.median has been shorter than CD45RA- ALL(10 vs 25 months, p 0.024). Multivariateanalysis (including CD45RA, CD34, MyAg,Ph’, B/T lineage, age, sex, WBC, FAB) confirmedthe negative influence of CD45RAon the survival (p 0.0016, relative risk 6.8).In conclusion, our data demonstrate a negativeclinical relevance of CD45RA expressionon adult ALL. Larger studies are neededto confirm prognostic validity and to definethe functional basis of this antigen.P005ALL 0496 GIMEMA PROTOCOL:IMMUNOPHENOTYPICCHARACTERIZATION IN 270 ALLPATIENTS AT DIAGNOSISA.VITALE, ON BEHALF OF THE GIMEMA COOPERATIVE STUDYGROUPDipartimento di Biotecnologie Cellulari edEmatologia, Università “La Sapienza”, RomaAs of October 1996 GIMEMA has activatedthe 0496 ALL therapeutic protocol for thetreatment of adult acute lymphoblastic leukemia(ALL). Within this protocol, a centralizationof a unified biological characterizationcarried out at diagnosis and duringthe clinical follow-up has been activated.The aim of the present interim analysis wasto evaluate the immunophenotypic profileof a group of adult ALL patients enrolled inthe same therapeutic protocol and to assessif the expression of myeloid antigenhad a prognostic impact on the achievementof complete remission (CR) afterinduction therapy. So far, theimmunophenotype of 270 patients is available:217 patients had B-lineage ALL (80%)and 53 had T-lineage ALL (20%). Within B-progenitor ALL, the expression of at leastone of the myeloid antigens CD13 and CD33was found in 76 of 199 tested cases (38%),while CD34 positive expression was demonstratedin 172/213 cases (81%); theexpression of CD117 was investigated in30/217 cases and proved positive in 1/30(3%). In T-ALL, the expression of at leastone of the myeloid antigen was recorded in11 of 47 tested cases (23%); such antigenswere associated with a CD7 positivityin 11/11 (100%), while in only 4/11 (36%)was CD2 co-expressed. CD34 positivity waspresent in 14/50 (28%) of T-ALL; CD117was found in 5 of the 13 tested cases (38%).This first analysis of an ongoing largemulticenter study confirms that the presenceof CD13 and/or CD33 associated antigensis less frequent in T-ALL comparedwith B-progenitor ALL (23% vs 38%) andthat CD34 positivity is, as expected, higherin B-progenitor ALL compared with T-ALL(81% vs 28%). The results concerning theexpression of the CD117 refer to an insufficientnumber of cases to allow any meaningfulcorrelation. Of the 270 ALL patientsanalyzed at diagnosis, information regardingthe achievement of CR after inductiontherapy is at moment available for 200 patients.No difference in the rate of CR wasobserved for myeloid antigen negative andmyeloid antigen positive B-progenitor ALL(80% vs 72%); on the contrary, a significantlyhigher remission induction rate wasobserved in myeloid antigen negative T-ALLpatients compared with myeloid antigenpositive T-ALL patients (84% vs 43%,P=0.04). The complete data analysis referredto the immunophenotypic profile ofthe patients enrolled in the 0496 ALLGIMEMA protocol will be presented at thecongress.

74 September 26-29, 1999 - Torino-Lingotto, ItalyP006COMPLETE REMISSION (CR) IN ACUTEMYELOID LEUKEMIA (AML) WITHt(8;21) FOLLOWING TREATMENT WITHG-CSF: FLOW CYTOMETRYC ANALYSISOF IN VIVO AND IN VITRO EFFECTSON CELL MATURATIONP. BOCCUNI 1 , R. DI NOTO, G. MELE, A. VIOLA, C. RUSSO,S. COSTANTINI 1 , A. DELLO RUSSO 1 , C. LO PARDO 1 ,L. DEL VECCHIO 1 , F. FERRARADivisione di Ematologia and 1 Immunoematologia,Ospedale Cardarelli, NapoliG-CSF was employed as a“tailored inductiontherapy” in a 75 years patient affectedby AML with t(8;21). One year before hehad been diagnosed with prostate cancerextensively invading bladder. Bone marrowsmear examination revealed 52% blast cellinfiltration with frequent Auer rods. Patient’sblast cells were CD34+, CD19+, a phenotypehighly predictive of t(8;21); therefore,the patient was started on daily G-CSF at450µcg/m 2 . Few days later, cytogenetic examinationconfirmed t(8;21)(q22;q22).Following 14 days of G-CSF, CR wasachieved after a progressive increase ofWBC count along with appearance of myeloidmaturing cells. Cell maturation anddisappearance of blasts were confirmed byCD45-gating technique (CD45 vs side-scatter),modified by the introduction of a preliminarygating for nucleated cells with LDS-751. Three months later, relapse occurred.The patient was restarted on G-CSF andachieved a second CR. While in second CR,the patients died from complications dueto prostate carcinoma (massive urinary tracthemorrage). In order to compare the effectsof G-CSF with other differentiationagents, bone marrow cells were culturedfor 7 d in the presence of 0.5mM arsenictrioxide (As 2O 3) or 0.5 µM all-trans retinoicacid (ATRA) or 60 ng/ml GM-CSF or 55 ng/ml G-CSF. Control cultures without inducerswere also established. In order tocytometrically quantify the maturing effectof inducers, we simultaneously analyzedCD11b and CD66b in a two-color assay.Gate was set on myeloid cells, excludingnormal residual lymphocytes. No significantmaturation was observed with As 2O 3, ATRAand GM-CSF, while G-CSF promoted amarked shift towards mature cells. Thesefindings were confirmed by morphologicalanalysis of cytospins. At 7 days, BM samplestreated with G-CSF showed 70 % maturingcells (neutrophils/bands), while controls,As 2O 3, ATRA and GM-CSF treated samplesshowed 8%, 3%, 4% and 5% maturingmyeloid cells, respectively. In conclusion,we showed that blast cells from t(8;21) AMLundergo striking neutrophilic differentiationfollowing in vivo and in vitro exposure toG-CSF, adding further clinical and experimentalbasis for the use of G-CSF in t(8;21)AML befire or concomitantly with chemotherapy.P007EXTRAMEDULLARY RELAPSE IN APATIENT WITH ACUTELYMPHOBLASTIC LEUKAEMIAFOLLOWING ALLOGENEIC BONEMARROW TRANSPLANTATIONS. IMPERA, F. INDELICATO, N. FILARDI, G.O. MANENTI,S. GANCI, G. GUIDO, C. SIMILI, G. MILONE, R. GIUSTOLISICattedra e Divisione di Ematologia con Trapianto -CataniaIsolated extramedullary relapse in unusualsites, following allogeneic bone marrowtransplantation (BMT) for adult Acute LymphoblasticLeukemia (ALL), is a rare complication,associated with a poor prognosis.We present a case of an extramedullaryrelapse in the breast plus skin of a 29year old women 7 months after BMT performedfor a Ph-positive ALL in first completeremission. In april 1998, the patient,presented with bilateral breast masses anda 2cm cutaneous nodule on the scalp. Biopsyshowed an ALL infiltrate on both sites.Immunohistochemestry showed positivestains in these cells by monoclonal anti-CD19, CD10, CD34; polymerase chain reaction(PCR) demonstrated BCR/abltrascript positivity. Bone marrow and cerebrospinalfluid were not involved and noBCR/abl trascript was detectable in thesesites. Complete response of the breast andcutaneous masses was obtained with localirradiation ( 4600 cGy). The patient remainsin complete remission 13 months after relapse.It can be speculated that allogenicBMT was effective in eradicating the initialclone but it was not in preventing the emergenceof a new clone in extramedullarysites. The BCR/abl negativity in bone mar-

37 th Congress of the Italian Society of Hematology75row at diagnosis of an extramedullary relapsemay be useful in predicting prognosisin these patients.P008VERY RARE OCCURRENCE OFILIOPSOAS HEMATOMA DURINGACUTE MYELOGENOUS LEUKEMIA(AML)G. MORANO, G.A. BRUNETTI, I. CARMOSINO, M. BRECCIA,S. MECAROCCIDepartment of Biotecnologie Cellulari edEmatologia, University “La Sapienza” RomeHematoma of iliopsoas muscle is a relativelycommon finding during somecoagulopathies, tipically characterized byhaemorrhages in the muscle-scheletric apparatus(haemophilias, anticoagulantdrugs): it is seldom been observed duringthrombocytopenia and never been reportedduring AML, in which are commonparenchimal and cutaneous haemorrhages.We describe the occurrence of iliopsoashematoma in a patients aged 62 years withRAEB t evolved in AML (October’97): dueto age and previous myelodysplastic phase,he received supportive care and Hydroxyurea,with a good control of AML and excellentquality of life but persistent severethrombocytemia (PLTS < 10 x 10 9 /l). OnDecember’98, he presented a lumbosacralpain with irradiation to left leg; as he hadreferred a previous discal herniation, a lumbarRx and TAC were performed, resultingboth negative. The antalgic treatment withParacetamole + oppioids achieved partialpain relief. On February’99, he was admittedto our Hematological Emergency Unitfor a new increment of pain with irradiationto inguino-crural area and antalgicthigh flexion. Ecography and CT scan ofinguino-crural area revealed an ovoidaldisomogeneous mass (diameters 12.8 x 5.8cm) in the context of iliopsoas muscle, consistentwith a diagnosis of hematoma. Therewere no previous traumatic event as wellas no local finding. Coagulative profileshowed only a mild prolongation of PT-INR(1.34). As the patient was not eligible for asurgical drainage due to thrombocytopenia(PLTS 9 x 10 9 /l), he received daily PLTSconcentrates, antifibrinolytic treatment,steroids and oppioids. After 10 days of treatment,he achieved a pain relief, with reductionof the mass (diameters 10.4 x 4.0cm), and was discharged. Three weeks later,there was a new exacerbation of inguinocruralpain, concomitant with hyperleukocytosis:echography and CT scan showedan enlargement of hematoma (trasversaldiameter 9.5 cm), with exstension to Scarpatriangle. The patient died on April’99 fromdisease progression. Our report outlinesthat a hematoma of iliopsoas muscle mayrarely occur also in thrombocytopenic patients,without coagulopathies and/or otherappreciable causes.P009PRIMARY TESTICULAR GRANULOCYTICSARCOMA: CASE REPORTC. FIORANI, G. VINCI, P. SPADAFORA, B. CASOLARI,M. COSENZA V. MEDICI, G. BONACORSI, * R. FELICINI,S. SACCHIDipartimento di Scienze Mediche Oncologiche eRadiologiche. Università degli Studi di Modena eReggio Emilia; *Dipartimento di Medicina Clinica eSperimentale. Università degli Studi di PerugiaA rare case of a 35 year old patient withprimary testicular granulocytic sarcoma isdescribed. In August 1997 the patient developeda painless testicular mass, low fever,dysuria, and bone pain treated unsuccessfullywith antibiotics and NSAID. For thepersistence of these symptoms, a testicularbiopsy and then an orchiectomy wasperformed: histological diagnosis of diffuseinfiltration by an unclassifiable malignanttumor was made. During staging, bonemarrow (BM) biopsy and peripheral blood(PB) was normal, while CT scan revealedabdominal lymph nodes enlargement. InJanuary 98 the patient was admitted to ourhospital for further management. After afew days, patient suddenly developed leukemiaand diagnosis of AML (FAB M5a) wasmade. Testicular mass specimens were reviewedand myeloblastoma with amonoblastic differentiation diagnosis wasmade. Cytogenetic analysis was abnormal:(47XY,+8; XY, +8, add(9q). After treatmentwith idarubicin, cytosine-arabinoside andetoposide (ICE) a BM and PB remission wasachieved but pelvic mass persisted. In April98 the patient had BM relapse and byreinduction treatment (ICE) a CR with disappearanceof pelvic mass was obtained.In May 98 the patient underwent an allogeneic(aploidentical) bone marrow trans-

76 September 26-29, 1999 - Torino-Lingotto, Italyplantation, after conditioning treatmentwith TBI and polichemoterapy. In October1998 the patient presented a new BM andextramedullary relapse and therefore hewas treated unsuccessfully with low dosecytosine arabinoside and infusion of totalCD3+ donor lymphocytes. The disease wasresistant to therapy and patient died inDecember 1998. Conclusion: Primary testiculargranulocytic sarcoma is relativelyrare, with only 4 documented cases reportedin the literature. In our patient , primarytesticular involvement occurred 6 monthsbefore the leukemic bone marrow infiltration,with initial bone marrow and peripheralblood normal pattern. The clinical outcomeof our case, despite allogeneic BMT,confirms the poor prognosis of this disease.P010PRIMARY GRANULOCYTIC SARCOMA:PRESENTATION OF A CASEM. TRESOLDI, P. ONIDA, A. MALINGHER, S. AGLIONE,C. SALMAGGI, L. CAMBA*, M. MARCATTI*, P. SERVIDA*,M. PONZONI#Department of Medicine, *Bone Marrow TransplantationUnit and Department of Hematology,#Department of Pathology, Ospedale San Raffaele,MilanoIntroduction: Granulocytic sarcoma (GS)is a tumor, composed by neoplastic myeloidcells, that involves extramedullary sites,more commonly bones, skin, soft tissuesand lymphnodes. It develops during AML,myeloproliferative syndromes andmyelodysplastic syndromes. Primary GS(PGS), that occurs in patients without anyprevious or concomitant blood disorder, isa rare disease (only 189 cases since 1965);if not treated it evolves into AML. The mostdifficult differential diagnosis is with largecell malignant lymphoma, but also withundifferentiated neoplasms, and it must besupported by specific stainings (MPO andCAE) and immuno-histochemical techniquesfor myeloid markers. As PGS is a systemicdisease, it must be treated with the sametype of polichemotherapy used for AML.Surgery and radiotherapy play a secondaryrole. Case report: 28 years old male patient,affected with right sciatica, fever andanemia (normal WBC and PLT). MNRshowed pathologic tissue in T11, L1 andright iliac crest. There was evidence of aserum oligoclonal component at proteinelectrophoresis and of a reactive bone marrowplasmacytosis with neoplastic CD68+and MPO+ elements in involved tissue biopsy(right PSIS); normal bone biopsycontrolaterally. As a diagnosis of PGS wasmade, the patient received an inductionchemotherapy (ICE scheme) was done andwe observed PR 1 month afterwards. Thecourse of the disease was complicated by aserious fungal pulmonary infection, treatedby surgery. Then we observed CR 3 monthsafter the single induction CT. The patientunderwent a consolidation treatment withautologous peripheral blood stem cellstransplantation. He is in CR after 3 yearsfrom diagnosis. Discussion: PGS is a raredisease, without characteristic clinical,laboratory and instrumental features, thatmust be diagnosed using myeloid specificmarkers. Its treatment is based on CT usedfor non M3 AML, with by Ara-C and ananthracycline, possibly followed by consolidationwith donor or autologous bone marrowtransplantation. Only such an aggressivetreatment can ensure an improvementof the otherwise poor prognosis.P011POLYRADICULONEUROPATHY AS AFORM OF RELAPSE IN A PATIENTWITH ACUTE MEGAKARYOCYTICLEUKEMIAL. CALABRÒ, A. ALONCI, G. BELLOMO, C. QUARTARONE,F. DI BASSIANO, A. D’ANGELO, S. NERI, C. MUSOLINODivision of Hematology, University of MessinaIntroduction: Central and peripheralnervous system recurrence is rare in acutemyelocytic leukemia, however, it needs tosuspect this complication when there areneurological clinical signs. We report an unusualcase of polyradiculoneuropathy in apatient with acute megakaryocytic leukemiaafter 20 months in complete remission.Case Report: A 66 year old man was admittedto our hospital for slowly progressive,asymmetrical limbs weakness withnumbness and burning dysesthesias. Hewas affected by long-lasting type 2 diabetes.Twenty months ago, he had been diagnosedas having acute megakaryocytic leukemiaand achieved hematologic remissionwith combined chemotherapy (cytarabineand mithoxantrone). There was no lympho-

37 th Congress of the Italian Society of Hematology77adenopathy or organomegaly. On neurologicalexamina-tion there were tetraparesis,absent tendon reflexes and flexor plantarresponses; Lasegue and Kerningmanoeuvres were positive. Morphologicexamination of bone marrow and peripheralblood was consistent with completehematologic remission. EMG demonstretedneurogenic changes with denervation inlower limb muscles. A magnetic resonanceimaging scan (MRI) of the spinal cordshowed an extradural infiltration in the spinalcanal at C6-D1 level and a direct invasionof cauda. A lumbar puncture disclosedthe presence in the cerebrospinal fluid of700/•l cells with typical blastic morphologicfeatures (CD33+, CD13+). A diagnosis ofacute myelocytic leukemia relapse with intramedullaryspinal cord tumor involvementduring hematological remission was made.Our patient presented a chronic peripheralneuropathy likely related to diabetes, whodeveloped a cervical and lumbosacralradiculopathy due to a neoplastic infiltration.We underline the complexity of diagnosisand the need to suspect a relapsewhen there are neurological clinical signs.P012EXTRAMEDULLARY RELAPSE OF Ph1+ACUTE MYELOID LEUKEMIA ANDSTERNAL CONSUMPTION AFTERAUTOLOGOUS PERIPHERAL BLOODSTEM CELL TRANSPLANTN. CANTORE, S. VOLPE, B. SANTULLI, G. MARCACCI,A. FOTINO, F. PALMIERI, E. VOLPEServizio di Ematologia - Unità di Terapia IntensivaEmatologica e Trapianto - A.O. “San G. Moscati” -AvellinoThe majority relapses of acute leukemiasafter allogeneic or autologous stem celltranplant occur predominantly in systemicforms or combined with an extramedullaryrelapse. Isolated extramedullary relapsesafter stem cell transplant are unusualevents. A 56 year-old male with Ph1+ acuteleukemia (FAB M5a) was transplanted withPBPC in August 1997 during first CR as partof EORTC-GIMEMA AML10 protocol. Theconditioning regimen was BU-CY. In December1998 he was admitted to our servicebecause of thoracic pain and dyspnea. Thoracicx-ray and CT scan showed pleural effusionand consumption of a sternal portionwas also found. Cytospin preparationsof pleural effusion showed a tapetum ofblast cells with FAB M5a morphology. Thesame immunophenotype of blast cells at diagnosisand relapse was found (CD13+,CD33+, HLA-DR+, CD4+, CD45RA+) exceptfor lesser expression of CD11b andCD11c, and c-kit and MPO negativity. Theblast cells were Ph1 positive at cytogeneticanalysis and bcr/abl rearrangement atmolecular analysis was found. Fine needlebiopsy on osteolytic lesion of sternumshowed a peripheral blood cells only andabsence of marrow cells. The patient wastreated with systemic chemotherapy (MICE)but unfortunately died of ARDS after 45days.P013LUNG TOXICITY FOLLOWING FLANTREATMENT FOR ACUTE LEUKEMIAM. SALVUCCI,E. ZUFFA, R. ZANCHINI, A.L. MOLINARI,V. POLETTI*, A. ZACCARIAHematology Unit, AUSL, S.Maria delle Croci Hospital,Ravenna; *Thoracic Diseases Department,AUSL, Maggiore Hospital, BolognaWe report two cases of severe pulmonarytoxicity following the administrationof a chemioterapeutic regimen containingFludarabine (FLUDA), 30 mg/mq/daily x 5days, Cytarabine(Ara-C) 2g/mq/daily for 5days and Mytoxantrone (MYTO) 6 mg/mq/daily for 3 days.(FLAN). Case 1. A 31 yearold man with ANLL M2 received FLANtherapy after acchieving partial remissionwith ICE. Seven days after therapy discontinuation,he developed fever, dyspnoeawith marked oxygen desaturation. An highresolution computerized tomografy (HRCT)showed bilateral pulmonary ground glassopacities, consistent with interstitial involvement.BAL showed total cells 30.000/mm3 with erythrocytes and rare macrophages.BA biopsy showed haemorragicalveolitis. He received empirical antibioticaltherapy and high dose prednisolone. Bloodcoltures were positive for Staph.Simulans.Six days later clinical symptoms and bloodgas abnormalities had resolved, and a lungHRCT control showed a moderate improvementof the ground glass opacities. CR wasobtained. A lung biopsy performed 20 dayslater showed a patchy interstitial mononuclearcell inflammation and intralveolarloose fibrotic bands, compatible with drug

80 September 26-29, 1999 - Torino-Lingotto, ItalyP017IDAURIBICIN AS SINGLE AGENT FORTREATMENT OF ACUTE MYELOIDLEUKEMIA IN THE ELDERLYG. MINEO, F. DI RAIMONDO, P. FIUMARA, P.M. FLORIDIA,G. ABBATE, G.A. PALUMBO, S. BAGNATO, M. SALERNO,G. LONGO, R. GIUSTOLISIDivisione e Cattedra di Ematologia con Trapianto,Ospedale Ferrarotto, CataniaA long plasmatic half-life, around oneweek, is a unique feature of idarubicin andits metabolite (idarubicinol). On the basisof this pharmacological feature, we evaluatedthe efficacy of low doses of IDA administeredat weekly intervals in elderlypatients affected by AML, not eligible foraggressive treatments. IDA dosage was 10mg/m2 if administered e.v. and 30 mg/m2by oral route. From Jan ’95 we included inthis study 27 patients, 16 females and 11males, with a median age of 68 (range 53-80) so divided: I) 12 patients with de novoAML; II) 8 patients with AML secondary toMDS; III) 7 patients with relapsed or refractoryAML. In the I group 7 out of 12 patients(58 %) achieved CR lasted for 1+, 2+, 22+,2, 5, 19 and 24 months respectively. Onepatient achieved PR, two were resistant and2 died during treatment. In the II group,only two patients out of 8 (25 %) achievedCR with a duration of 1+ and 16 monthsrespectively. Three achieved PR and 3 diedduring treatment. In the III group only onepatient (14 %) achieved CR that lasted for7 months; 2 patients achieved PR and fourdied during treatment. In the whole series,median number of courses was 3 (range 1-12). All patients experienced hematologicaltoxicity grade III and IV that didn’t allowus to maintain the weekly schedule andin 9 patients induced a stop of treatment.On the basis of these data, last 5 patientsof this study have been treated with IDA ata biweekly schedule, with the same antitumoractivity and less hematological toxicity.Our experience indicates that treatmentwith IDA as single agent at low doses has agood antileukemic activity in elderly patientswith de novo, previously untreatedAML. For other patients the therapeutic advantageof this approach is limited.P018TRANSPLANTATION OF AUTOLOGOUSPERIPHERAL BLOOD STEM CELLSAFTER HD-ARA-C CONSOLIDATIONCHEMOTHERAPY FOR ADULTS WITHACUTE MYELOID LEUKEMIA IN FIRSTREMISSIONC. CASTAGNOLA, E.P. ALESSANDRINO, A. CORSO,P. BERNASCONI, M. TAJANA, P. ZAPPASODI, M. DELLA PORTA,G. PAGNUCCO, C. BERNASCONIIstituto di Ematologia,Università di Pavia, IRCCSPoliclinico S.Matteo. PaviaPost-remission therapy is required to preventor delay relapse in patients with acutemyeloid leukemia (AML). Uncontrolled trialshave suggested that intensive post-remissiontherapy may prolong the completeremission (CR). The purpose of this studywas to evaluate the feasibility and efficacyof HD-ARAC consolidation chemoterapy followedby autologous infusion of peripheralblood stem cells (PBSC) mobilized by G-CSF in adult patients with AML in first CR.Sixteen consecutive patients with AML infirst remission (median age 53, range 21-60) underwent HD-ARAC consolidation chemotherapy(3g/m 2 every 12 hours x 4doses) used as a method of in vivo purgingfor the purpose of an autologous PBSCtransplantation. After mobilization by G-CSFa median of 2 collections (range 1-3) wasrequired to obtain a median of 7.9x10 8 peripheralblood mononuclear cells/kg (range2.9-23) and a median of 6.1x10 6 /Kg CD34-positive cells (range 2.7-8.4). In 3 of 16patients we were unable to mobilize andtherefore to collect an adequate progenitorcell dose. Eight patients have already receivedmyeloablative chemotherapy (CCNU600 mg/m 2 first day, VP16 900 mg/ m 2 andAra-C 900 mg/ m 2 for 3 days c.i.) followedby the infusion of PBSC. All the collectedcells were infused two days after the conditioningregimen. The median time to neutrophilsrecovery was 13 days (range 10-14) and for platelets was 12 (range 8-13).The transplantation related toxicity wasmild, including only a mucositis in 3 of 8patients. After a median follow up of 9months (range 3-18), 6 of 8 patients whounderwent autologous PBSC transplantationare still in CR, 1 died of pneumonia 6months after transplantation and 1 is alivewith persistent leukemia. Our results dem-

37 th Congress of the Italian Society of Hematology81onstrate that autologous transplantation ofchemotherapy mobilized PBSC, is feasiblein an unselected population of adult patientswith AML in first remission with minimaltoxicity. However, a longer follow-up isneeded to evaluate whether this form oftransplantation produces a significant improvementin leukemia free survival.P019RETROSPECTIVE ANALYSIS OFPATIENTS AGED > 80 YEARS WITHACUTE MYELOGENOUS LEUKEMIAI. CARMOSINO, R. LATAGLIATA, M.A. ALOE SPIRITI,P. ANTICOLI BORZA, V. BONGARZONI, M. BRECCIA,M. D’ANDREA, G.M. D’ELIA, P. NISCOLA, A. SPADEA,B. MONARCADepartment of Biotecnologie Cellulari edEmatologia, University “La Sapienza” RomeThe occurrence of Acute MyelogenousLeukemia (AML) in patients aged >80 yearsis increasing, due to the progressive agingof general population in western countries.To analyze characteristics and clinical courseof these patients, we evaluated retrospectively41 patients (25 male and 16 female,median age 82 years) consecutively diagnosedat our Institution from 1/88 until 12/98. 21 patients were diagnosed with bonemarrow aspirate (marrow blasts > 30%),20 patients were diagnosed only with peripheralblood smear (peripheral blasts >30%). Median haematological parametersof patients at onset were as follows: Hb 8,5g/dl (range 3,9-14,3), WBC 7.4 x 10 9 /l(range 1.1-100), PLTS 56 x 10 9 /l (range 10-1.230), peripheral blasts 46% (range 3-100). 9/41 patients (21.9%) showed PS 0-1 according WHO, 22/41 (53.7%) PS 2 and10/41 (24.4%) PS 3-4: 6/41 patients(14.6%) had a previous myelodysplasticphase. As concern concomitant diseases,9/41 patients (21.9%) had a cardiologicalimpairement requiring specific treatment,9/41 (21.9%) an arterial hypertension undertreatment, 9/41 (21.9%) diabetes mellitustreated with insulin or oral drugs, 3/41 (7.3%) chronic respiratory diseases and2/41 (4.9%) chronic renal impairement: 12/41 patients (29.2%) did not have any concomitantdisease. After diagnosis, 6 patientswere referred to other Institutions, 35 havebeen followed at our Institution with conservativeapproach [17/35 (48.5%) excludedfrom intensive chemotherapy onlyfor age > 80 years]. 10/35 patients (28.6%)received supportive care only, 25/35(71.4%) needed conservative chemotherapy(with Hydroxyurea or 6-Thioguanine+ AraC) after a median period fromdiagnosis of 9 days (range 0-253). Mediansurvival (SV) of 35 patients was 100 days(range 5 - 734): 14/35 patients (40%) survived> 6 months, 4/35 (11.4%) survived> 1 years. PS > 2 and WBC > 50 x 10 9 /l atonset showed a bad prognostic significancefor SV. Our experience confirms the needof a conservative approach in such patients,with a longer SV than intensively treatedpatients (DeLima et Al, Br J Haematol93:89-95,1996) and probably a better qualityof life. The employ of more effective conservativechemotherapies/supportive careand a standard home-care service will amelioratethe severe prognosis of these patients.P020FLAG PROTOCOL FOR ACUTE MYELOIDLEUKEMIA AT ONSET IN ELDERLYA.M.CARELLA, N. CASCAVILLA, M.M. GRECO, L. MELILLO,M.R. SAJEVA, G. D’ARENA, M. CAROTENUTODivision of Hematology, IRCCS “Casa Sollievo dellaSofferenza” San Giovanni RotondoIn the last four years we have tried FLAGprotocol (Fludarabine, ARA-C, G-CSF) inpatients (pts) with acute myeloid leukemia(AML) with unfavourable prognosis (refractory,relapsed or post-MDS) obtaining goodresults. On this basis, we treated 15 elderly(>60 years) pts suffering from AML denovo (5) or secondary, previously untreated.Mean age was 64.6 years (range 59-73).Nine pts shown a normal caryotype, 2 chromosomalabnormalities (inv 9; 44 XY -3-7), 4 did not have evaluable metaphases.Nine pts (60%) achieved CR, 3 (20%) PR,1 pt was resistent, 2 died during the hypoplasticphase for sepsis. All pts in CR receiveda second course of FLAG regimen asconsolidation. The other pts were consideredoff-study. Pts in PR were observed withsupportive therapy and oral chemotherapy(to date 2 are alive at +5 and +8 months).One pt died during hypoplastic phase afterthe second course of FLAG for sepsis. Afterconsolidation therapy 4 pts received amaintenaince therapy with low-dose ARA-

82 September 26-29, 1999 - Torino-Lingotto, ItalyC, 3 received monthly cycles with oralIdarubicin plus low-dose ARA-C or Thioguanineor Etoposide for 6 courses. One pt underwentto autologous peripheral bloodstem cell transplantation. Mean duration ofCR was 8.4 months (range 1-13). Six ptsrelapsed (4 died for disease progression, 2alive with disease), while 2 are to date infirst CCR. (+5 and +10 months, respectively).Overall median survival was 7months (range 1-18). The neutrophil(>500) and platelet (>50,000) recoveryrequired a median of 18 and 30 days fromthe end of therapy, respectively. Prolongedneutropenia resulted in 13 febrile episodes2 FUO, 6 Gram-, 4 Gram+, 1 Candida). Inconclusion, our data clearly show that FLAGregimen in elderly pts with AML is a higheffective regimen with low toxicitity.P021FLUDARABINE, ARABYNOSIL CYTOSINEAND IDARUBICIN (FLAI) +/- ALLTRANS RETINOIC ACID, A NOVELCOMBINATION OF NON MDR-RELATEDDRUGS FOR TREATMENT OF PATIENTSWITH NEWLY DIAGNOSED ACUTEMYELOID LEUKEMIA1D. RUSSO, 1 M. MICHIELI, 1 A. MICHELUTTI, 1 L. MARIN,1A. BERTONE, 2 G PRICCOLO, 3 I. PIERRI, 4 D. RASPADORI,4A. BUCALOSSI, 5 E. ZUFFA, 6 G. MARTINELLI, 6 N. TESTONI1Clinica Ematologica, Policlinico Universitario diUdine; 2 Divisione di Ematologia, Ospedale SSAnnunziata, Taranto; 3 Cattedra di Ematologia,Dipartimento di Medicina Interna, Università diGenova; 4 Cattedra e UO di Ematologia, OspedaleSclavo, Siena; 5 Servizio di Ematologia, Ospedale S.Maria delle Croci, Ravenna; 6 Istituto di Ematologia eOncologia Medica, Università di BolognaWe report here on a phase II multicentrictrial whereby the combination ofFludarabine, Arabinosyl Cytosine andIdarubicin (FLAI) was given as first-line inductiontherapy to 71 newly diagnosed patientswith acute myeloid leukemia (AML)(except FAB-M3 subtype). Patients aged 65 years(20 cases) were induced to CR with MiniFLAI(x 3 days) and consolidated with a secondidentical course. The patients who had WBCless than 25 x 10 9 /L (31 cases) receivedthe triple combination plus all-trans retinoicacid (ATRA). A complete remission wasachieved in 74% patients aged < 65 yearsand in 33% patients older than 65 years.The main toxic effect was myelosuppressionand the incidence of microbiologically orclinically proven infections was about 40%in both groups of patients. The Pgp-expressionin bone marrow blasts was evaluatedin 42/71 (59%) patients by an indirect immunofluorescencemethod with the anti-Pgpmonoclonal antibody MRK-16. Interstingly,no significant difference in the CR rate wasobserved between the patients Pgp+(MFI > 6) and the patients Pgp- (MFI < 6).The treatment with ATRA neither increasesthe CR rate nor downregulates the expressionof Pgp in myeloid blasts. These resultssuggest that the FLAI regimen is a promisingfirst-line induction therapy for youngerAML patients who are either Pgp- or Pgp+.P022CLINICAL OUTCOME OF ACUTEMYELOID LEUKEMIA (AML) IN THEELDERLY RELAPSING FROM CRACHIEVEMENTF. FERRARA, S. MIRTO^, M. ANNUNZIATA, C. COPIA,S. PALMIERI, S. CIOLLI*, A. SPASIANO, F. POLLIO, F. LEONI*Divisione di Ematologia, Ospedale Cardarelli,Napoli; ^Divisione di Ematologia, OspedaleCervello, Palermo; *Divisione di Ematologia,Università di FirenzeComplete remission (CR) is achieved in40-60 % of elderly AML, but most patientsdo relapse. Few data are available as concernsthe clinical outcome of relapsed patients;in particular, little is known as far asany potential benefit from a second aggressivechemotherapy (AC). In this study, weinvestigated a series of 99 consecutive relapsedAML patients aged more than 60.There were 53 males and 46 females, medianage was 65 (61-79). At diagnosis, 83patients had been given anthracyclines andcytarabine (ARA-C) ± etoposide, 16 hadbeen treated with FLAG (Fludarabine, ARA-C and G-CSF). Most patients had been consolidatedwith the same regimen employedat induction. The median duration of 1 st CR

37 th Congress of the Italian Society of Hematology83was 8 months (1-50). At relapse, 58 (58%)were treated with AC consisting of high doseARA-C in 7 cases (12%), intermediate doseARA-C plus idarubicin or mitoxantrone in28 (48%) and FLAG in 23 (40%). Fifteenpatients (15%) received low dose ARA-C(LDARAC) and 26 (26%) had no treatmentor hydroxyurea (HU) in case of leukocytosis.The choice of treatment was mainlybased on clinical conditions, even thoughother factors such as patient’s and relativeattitude, concomitant diseases and, lessfrequently, distance from the hospitalplayed an additional role. The overall CRrate was of 26% (26/99). According totreatment, CR was obtained in 23 out of58 patients (40%) following AC, 3 out of15 (20%) in the group of LDARAC, and 0(0%) in patients who did not receive anytreatment or HU (p=0.001). Median survivalwas of 5 months for AC, 8 months forLDARAC and 3 months for palliation(p:0.02). There was no difference in survival(p=0.38) and duration of 2 nd CR(p=0.23) between AC and LDARAC. However,patients managed with LDARAC requiredless hospitalization (p=0.001), lessdays of fever (p=0.004) and less supportivetherapy in terms of platelet units(p=0.001), blood units (p=0.002) and daysof intravenous antibiotic therapy (p=0.007)as compared to AC group. We conclude thatAC is not useful for elderly AML patients inrelapse, LDARAC resulting in comparableresults on survival with substantial advantagein terms of quality of life and costbenefitratio.P023HIGH DOSE ARA-C (HDARAC) ASCONSOLIDATION TREATMENT OF COREBINDING FACTOR ACUTE MYELOIDLEUKEMIA (cbf-AML)M. ANNUNZIATA, C. COPIA, S. PALMIERI, C. DI GRAZIA,A. SPASIANO, G. MELE, R CIMINO, F. FERRARAAML with t(8;21) and inv(16) (cbf-AML)are characterized by distinct biomolecularand clinical features. In particular, patientswith cbf-AML have been reported to takesubstantial advantage from consolidationwith repeated courses of HDARAC. Herewe report the disease characteristics andtreatment results from a series of 10 patientswith cbf-AML, 8 with t(8;21) and 2with inv(16), who were given HDARAC asconsolidation therapy. One patient withinv(16) AML had massive extra-hematologicalinvolvement (bilateral renal masses)There were 7 males and 3 females, medianage was 35 (range 22-58). All patients receivedan induction therapy consisting ofICE (idarubicin 10 mg/sqm on days 1,3,5;ARA-C 100 mg/sqm as continuous infusionfrom day 1 to 7; etoposide 100 mg/sqmfrom day 1 to 4). Following complete remission(CR) achievement, patients wereconsolidated with NOVIA regimen, whichconsists of intermediate dose ARA-C (500mg/sqm q12h from day 1 to 6) andmitoxantrone (10 mg/sqm from day 4 to6). Patients still in CR after NOVIA, wereprogrammed to receive three cycles ofHDARAC (3 gr/sqm q12h on days 1,3,5) atintervals of three/four weeks depending onhematological recovery. Patients were hospitalizedto be given HDARAC, dischargedsoon at the end of therapy and readmittedin the cytopenic phase. The median followupat the time of writing is 34 months (range18-70). All patients received the threeplanned courses of HDARAC; each courseinduced marked cytopenia requiring intensivesupportive treatment (median plateletunits and median blood units 5 and 4, respectively).The median hospitalization periodwas of 14 days (6-22). At the presenttime, 9 patients are in continuous CR; onerelapsed at 16 months and achieved secondCR with FLAG regimen (Fludarabine,ARA-C and G-CSF). This patient underwentallogeneic bone marrow transplantation in2 nd CR and died three months later while inCR from severe graft versus host disease.The remaining 9 patients are alive and in1 st CR, all off-therapy. Survival at 5 years isprojected at 84 %. Our data seem to confirmCancer and Leukemia Group B experienceconcerning the efficacy of repeatedcourses of HDARAC in cbf-AML. However,further studies on larger series are needed.Divisione di Ematologia, Ospedale Cardarelli, Napoli

84 September 26-29, 1999 - Torino-Lingotto, ItalyP024A COOPERATIVE STUDY FOR ACUTEMYELOID LEUKEMIA (AML),REFRACTORY ANEMIA WITHEXCESS OF BLASTS (RAEB) ANDMYELOID BLAST CRISIS OF CHRONICMYELOID LEUKEMIA (BCCML) IN THEELDERLY (>60 YEARS): CLINICALRESULTSE. DI BONA, A. D’EMILIO, F. RODEGHIERO FOR “AD HOC”COOPERATIVE GROUPDiv. di Ematologia, Ospedale San Bortolo, VicenzaFrom January 1996, the Hematology Departmentof Vicenza has proposed to 37Departments of General Medicine of Venetoregion a cooperative study for AML, AREBand BCCML patients >60 years old or notelegible for intensive chemotherapy. Up toDecember 1998, 140 cases have been referredfor diagnosis (98 AML, 35 RAEB/RAEB-t, 6 BCCML). Sixty-two (52 AML, 5RAEB/RAEB-t, 5 BCCML) have been enrolledin the study and treated with 2-3 coursesof Idarubicin 15 mg/m 2 and Etoposide 100mg/m 2 every 12 hours, days 1, 3, 5; Thioguanine200 mg/m 2 , days 1-5. Male/female ratiowas 1.1, median age 66 years (range 58-78). At diagnosis, 18% of pts showed hemorrhagicsymptoms, 30% had fever, 45% hada WHO performance status ≥2. Median blastcell count was 3.8x10 6 /l (0-174.6), plateletcount 64x10 6 /l (9-1240); cytogeneticabnormalities were found in the 51% ofcases. Median time of in hospital admissionwas 28 days (0-121). Sixty-four percentof pts stayed in hospital during one of2-3 courses administered, 22% were givencomplete therapy as out-patient. Twenty(32.3%) pts achieved CR, 9 (14.5%) had amore than 50% blastic reduction (partialremission, PR); 6 (9.7%) pts died duringinduction, 4 infection, 2 cardiovascularevents; 27 (43.5%) showed resistance. Allinduction related deaths were males (χ 20.03). Thirdy-five (56.4%) completed 2courses, 21 (33.8%) 3 courses. Median CRduration was 200 days (44-1115+); medianoverall survival was 214 gg (22-1130),but it was significantly different in CR or PRpts compared with resistant cases (355 vs96 dd, log rank p=0.0003). None of the examinedparameters resulted predictive ofachieving remission or long term surviving.This multicenter, cooperative study confirmsthe effectiveness of oral chemotherapyin AML and RAEB in the elderly and definesits feasibility as out-patient.P025A COOPERATIVE STUDY FOR ACUTEMYELOID LEUKEMIA (AML),REFRACTORY ANEMIA WITH EXCESSOF BLASTS (RAEB) AND MYELOIDBLAST CRISIS OF CHRONIC MYELOIDLEUKEMIA (BCCML) IN THE ELDERLY(>60 YEARS): ORGANIZATIONRESULTSE. DI BONA, A. D’EMILIO, F. RODEGHIERO FOR “AD HOC”COOPERATIVE GROUPDiv. di Ematologia, Ospedale San Bortolo, VicenzaThe median age of myeloid onco-hematologicaldisorders is above 65 years. Patients,their families and social collectivitymore and more often require a cure, butintensive chemotherapy has failed to permita lasting remission due to i) biologicallimits for the pt and toxicity; ii) low costeffectiveness;iii) psycological reasons oftenconnected to the need of longhospitalisation; iv) supply and organizativeproblems. Some authors have reportedencouraging data about oral chemotherapyin the elderly. Therefore, we have offeredsome General Medicine Departmentsaround the Veneto region to partecipate toa clinical therapeutic trial for AML, RAEBand BCCML in the elderly or in pts notelegible for intensive intravenous chemotherapy.The aim of the study was: i) togive a therapeutic chance to a larger numberof pts; ii) to conduct the therapy nearthe pt’s house, as out-patient when possible;iii) to organize a collaborative groupfor peripheral therapy of hematological malignanciescoordinated by a central referralcenter. Protocol design included a trainingphase (two meetings per year, formativetraining at the referral center) and a clinicaltherapeutic phase including both supportiveand chemotherapic schedules (1-3cycles with Idarubicin 15 mg/m 2 andEtoposide 100 mg/m 2 every 12 hours, days1, 3, 5; Thioguanine 200 mg/m 2 , days 1-5). Between January 1996 and December1998, 62 pts have been enrolled by the

37 th Congress of the Italian Society of Hematology85Hematology dept and other 23 out of 37partecipating centers. 33/62 pts received atotal of 68 courses at the peripheral centers.There were no significative differencesbetween patients treated at the referral andat peripheral centers in terms of complete(17.2% vs 45.5%) and partial (17.2% vs12.1%) remission, infectious events (47.6%vs 56.5%), intravenous antibiotics (64.7%vs 60.9%) and antimicotics (29.4% vs26.1%), platelet (31.5 U vs 29.9 U) andRBC (8.3 U vs 7.8) transfusions, number ofcourses given as in- or out-patient (26 and25 vs 41 and 27), median survival (194 vs252 days) and complete remission duration(165 vs 220 days). Our results demonstratethat oral chemotherapy for elderlypatients with AML, RAEB or BCCML is feasibleat peripheral general medicine department,if well coordinated and supported bya hematology department.P026OUTCOME OF SALVAGE TREATMENTFOR RELAPSE AFTER AUTOLOGOUSTRANSPLANTATION IN ACUTEMYELOID LEUKEMIAF. MARMONT, B. ALLIONE, E. AUDISIO, A. CIOCCA-VASINO,S. D’ARDIA, F. LOCATELLI, M. FALDA, E. GALLOU.O.A. Hematology, San Giovanni Battista Hospital,TorinoThirty-five patients with Acute MyeloblasticLeukemia (AML) underwent autologousbone marrow and/or peripheral blood progenitorcell transplantation (ASCT) while infirst complete remission (CR) after inductionand consolidation therapy according tothe EORTC-GIMEMA AML10 protocol. Thepreparative regimen was TBI/CY in 4 cases(11.4%) and BU/CY2 in 31 cases (88.6%).The stem cells source was : bone marrow(18 pts. = 51.4%), peripheral blood cells(11 pts. = 31.4%) and marrow + peripheralblood (6 pts. = 17.1%). Two pts.(5.7%) died in persistent aplasia (at 10.7and 11.9 months); 15 pts. (42.9%) relapsedand 18 pts. (51.4%) are alive incontinuous complete remission (CCR). Theactuarial overall survival is 60.5% at 70months. Relapse incidence was not influencedby the stem cells source (p=0.62).The median event-free survival after ASCT(EFS) was 16 months (range 1.6 – 70months). The median remission duration afterASCT was 6.2 months (range 2.3 – 18.5months) in relapsed patients. The mediansurvival from relapse was 5.5 months. Relapsedpatients were treated with: MEC 3pts. (20%), MEC+PSC833 1 pt. (6.7%),FLAG 8 pts. (53.3%), transplantation fromHLA-identical sibling 1 pt. (6.7%). Two pts.(13.3%) were offered only supportivetherapy and their survival was 2.8 and 10months. A total of 7 second CR (46.6%)were obtained. Their outcome is reportedin the table:Pat.N° Therapy CR (months) Status7 ALLO-BMT 50.3 Alive in CCR30 FLAG 5.5 Relapsed and Died60 FLAG+MUD 6.1 Died (TRM)63 FLAG 22.3 Alive in CR65 FLAG 7.2 Alive in CR79 FLAG 9.5 Alive in CR89 MEC+PSC833 2.4 Alive in CRSalvage therapy with FLAG regimen mayinduce a significant number of second CRafter a relapse following ASCT. New agentsreverting multi-drug resistance (MDR-1)may provide additional therapeutic chances.P027CASE REPORT: ACUTE MYELOIDLEUKEMIA FOLLOWING LIVERTRANSPLANTG. MUTI, S. CANTONI, P.L. ORESTE*, A. NOSARI, G. GINI,V. MANCINI, L. PEZZETTI, L. INTROPIDO, A. DE GASPERI°,M. DRAISCI, E. MORRADepartment of Hematology, Institute of Pathology*,Department of Intensive Care°, Niguarda Ca’ GrandaHospital, Milan, ItalyIn September 1997 a 32 years old womenunderwent liver transplant (tx) because ofHCV related chirrosis and splenectomy becauseof splenic artery aneurism. The immunosuppressiveregimen comprised inductionwith Antilymphocyte serum, followedby Azatioprine, Cyclosporine and steroids.In the immediate post transplant period thepatient experienced graft-rejection (gradeI-II), responsive to steroid therapy, and CMVreactivation, controlled by Ganciclovir. Shewas discharged 45 days from tx, in goodclinical condition and with normal hematologicalparameters. At 150 days from tx,the patient was re-admitted to Hospitalbecause of fever, rapidly progressive jaundice,and poor clinical status. Blood testrevealed increased LDH (2.900 U/L, n.v.

86 September 26-29, 1999 - Torino-Lingotto, Italy100-500), WBC 10x10 9 /L, Hb 9.7mg/dl, plt32x10 9 /L). Peripheral blood smear showed4% blast cells. Morphological, cytochemical,and cytofluorimetric examinations ofBone Marrow were consistent with acutemyeloid leukemia (FAB M4): Sudan B±,NASDA NaF inhibition+, acid phosphatase+,CD13+, CD14+, CD15+, CD33+, DR+.Cytogenetic studies showed multiple nonclonalabnormalities (47X, 1p+, 7q+, 9p-,14p+, +4, +mar). The patient died of multiorganfailure before chemotherapy could beinstituted. Abdominal nodes, liver, adrenalslung involvement, and multiple leukemicvessel thrombosis were found at autopticexamination. Acute myeloid leukemia isunusual in transplanted patients: it representsonly 4% of neoplasm developing aftersolid organ transplant. In the literature,A.M.L. has been reported rarely after kidneytx and only one case is reported after livertx. The lapse of time between tx and A.M.L.is usually longer in other reported case (median5 years) and median survival is 2,2months (range 0.03-24). Our case is peculiarin that A.M.L. developed early (5 mos)after tx, and multiple extramedullary involvement,also in the allograft was present; theclinical course was rapidly fatal.P028FLAG-IDA AS INDUCTION TREATMENTFOR ADULT ACUTE MYELOIDLEUKEMIA: PRELIMINARY REPORTF. L EONI, S. CIOLLI, C. MARRANI, C. NOZZOLI, F. SALTI,P. ROSSI FERRINIChair and Division of Haematology, CareggiHospital, FlorenceAML patient’s outcome has substantiallyimproved intensifying post-remissiontherapy, mainly with BMT. However, mostpatients result ineligible. Thus, to lengthenDFS many efforts have been focused oninduction chemotherapy. The FLAG protocol,based on the synergism betweenFludarabine and AraC, has been provedactive and well tolerated; moreover theaddition of Idarubicin (FLAG-Ida) has beenreported as effective in high risk AML. Toevaluate whether an high-dose inductionregimen could prevent the emergence ofchemoresistant clones resulting in a betterquality of remission, from March 1998to February 1999 we treated 22 consecutiveadult AML patients 38°C (8 FUO and 3 documented infection);2 had transient grade 2 liver toxicity. 19/20 CR pts received consolidation: 2 diedwhile aplastic, 3 relapsed before ABMT. AtApril 1999, 16 patients are alive, 15 in firstCR and all resulted eligible for the designedtransplant program. 4 underwent BMT, 5had a successful bone marrow harvest andreceived ABMT, 6 are waiting. Median timefrom CR to BMT or ABMT was 2 and 4months, respectively. Conclusion: FLAG-Ida is very active, carries acceptable toxicityand post-remission transplant programis feasible. A longer follow up is needed todraw any conclusion about the real impactof this regimen on OS and DFS.P029A HIGH COMPLETE REMISSION RATEIN ELDERLY PATIENTS WITH ACUTEMYELOID LEUKAEMA (AML) TREATEDWITH THE “MANCHESTER” PROTOCOL(MP)L. CAMBA, L. BELLIO, M. BERNARDI, F. CICERI, C. CORTI,M. MARCATTI, P SERVIDA, E. ZAPPONE, A. VICARI*,C. BARGIGGIA, E. BENAZZI, P. RONCHI, M. TRESOLDI*,S. ROSSINIDepartments o Haematology and *MedicineOspedale S Raffaele, MilanoTen consecutive elderly patients (pts) withAML (whose clinical and haematological

37 th Congress of the Italian Society of Hematology87data are found in the table) have beentreated with the MP (BJH. 1991, 79, 415-420). Pts 1,4,7 had a MDS, pts 2,4,7,8 sufferedfrom a neoplastic disease; pt 3 hadischaemic heart disease. Toxicity. medianthrombocytopenia and neutropenia were 20and 23 d; infectious toxicity: 8 documentedinfections and 2 FUO; no cardiac toxicityoccurred. Outcome. CR was obtained in 9pts (90%): in 6 pts after the 1 st and in 3(2,6,9) after the 2 nd course of MP. Therewas only one early death : pt 7, who diedwith refractory disease (BM blasts 38% atday 28). Cytogenetics became normal in 3pts (1,4,5). Consolidation with a 2 nd or a 3 rdcourse was carried out in 5 pts; 3 refusedfurther treatment (1,2,4). Six of the 9 pts(67%) in CR relapsed after 4 to 39 (median26) weeks; 1 pt (8) died of cancer ofthe pancreas still in CR after 64 weeks. Only1 of the 6 relapsed pts (pt 4) was salvagedwith a further MP course and achieved his2 nd CR; he was then transplanted with autologousPB stem cells, but died in 3 rd relapse38 weeks post transplant. As for theother 5 relapsed pts, 3 died of leukaemiaand 2 are alive and treated with palliativechemotherapy. In conclusion, MP seems toinduce a high rate of CR’s in elderly pts withAML, is well tolerated and causes littlehaematological and systemic toxicity. However,more effort should be made in maintaininga CR in this age group.Pt Age Gender Diagnosis Karyotype MDS CR Relapse Alive1 82 F M2 t(8;21) yes yes yes yes2 65 M M4 t(5;17) no yes yes no3 71 F M4e inv16 no yes yes yes4 75 M M4 -Y yes yes yes no5 65 M M4 complex no yes yes no6 65 F M4 complex no yes yes no7 72 M M4 complex yes no - no8 60 M M4 normal no yes yes no9 72 M M4 normal no yes yes yes10 78 F M0 normal no yes yes yesP030FLAG vs ICE AS INDUCTIONTREATMENT FOR ACUTE MYELOIDLEUKAEMIA IN THE ELDERLYF. LEONI, S. CIOLLI, C. NOZZOLI, C. MARRANI, P. BERNABEI,P. ROSSI FERRINIWith standard antracycline/ARA-c inductionnearly 50% of CR can be achieved. Althoughmany induction failures are due totoxic deaths, the major concern is resistantleukaemia. Since tolerance to chemotherapyis much lower in the elderly, thetreatment of choice should carry acceptabletoxicity without loosing its efficacy onleukemia’s resistance. The association ofFludarabine, ARA-c and G-CSF (FLAG) hasbeen shown active and well tolerated in highrisk AML. Thus, elderly AML pts (FAB-M3excluded) admitted to our Institution sinceFeb 1997 and considered eligible for chemotherapywere designed to receive FLAGas induction and idarubicin 10 mg/sqm i.v.d 1-2 plus etoposide 175 mg/sqm i.v. d 1-2 as consolidation. We compare resultswith those achieved in an historical controlgroup treated with idarubicin 8 mg/sqm d 1,3,5, ARA-c 200 mg/sqm d 1-7 andetoposide 60 mg/sqm d 1-5 (ICE) as inductionplus one more course as consolidation.RESULTS: 42(82%) out of the 51 AMLpts observed since Feb 1997 were allocatedto FLAG while only 77(55%) out of the 139pts, observed from Jan 1992 to Jan 1997,were considered eligible for ICE. Median agewas 70 vs 66 yrs in the FLAG and ICE protocolrespectively; AHD were 55% vs 41%.Although comparable rates of CR and RDwere registered (55% vs 48%; 31% vs36%), nearly all responding pts (96%) enrolledin the FLAG study achieved CR afterone cycle vs 73% within ICE group. MedianOS and DFS were 12 vs 9 and 10 vs 11months, in the FLAG and ICE protocol respectively(p=n.s.). An overall lower toxicityof the FLAG regimen was observed, allowingthe enrollment of a significantlyhigher percentage of referred pts. Comparingthe outcome of all pts, treated oruntreated, observed during both study periods,an improvement of OS related to theFLAG introduction was revealed. CONCLU-SIONS: Improvement of survival in elderlypts is related mainly to the achievement ofCR. FLAG induction plus IDA/etoposide consolidationis active, well tolerated and maybe an advisable option for most elderly AMLpts. However, DFS remains an unresolvedproblem and more effective postremissionapproaches are needed.Chair and Division of Haematology, CareggiHospital, FlorenceTreatment of elderly AML pts is still amajor challenge for the haematologists.

88 September 26-29, 1999 - Torino-Lingotto, ItalyP031PROGNOSTIC IMPLICATIONS OF CD34EXPRESSION IN ADULT AML: A SINGLECENTRE EXPERIENCEG. PRICOLO, L. STANI, A. PRUDENZANO, P. MAZZA,B. AMURRI, M. CERVELLERA, G. PALAZZO, A. MANNADiv. of Haematology, “G. Moscati” Hospital, TarantoThe expression of the pluripotent stem cellantigen CD34 was evaluated at diagnosisin 16 adult patients with AML (14 de novoAML and 2 secondary AML), entered on amulticentre study group (LAM-UDINE), inorder to examine the correlation betweenCD34 expression on leukemic blasts anddisease-free survival (DFS). Only patientsunder 65, who received the same inductionchemotherapy, were available for the study.The cases were diagnosed according to FABcriteria and included M0 (1 case), M1 (3cases), M2 (1 case), M4 (9 cases), M5 (2cases). CD34 expression was analyzed bymultiparameter flow cytometry. Defining acase as positive when > or =20% of bonemarrow cells collected at diagnosis expressedthe CD34 antigen, we identified twogroups: pts. CD34+ (10 cases) and pts.CD34- (6 cases). Median age of two groupswas respectively 51.8 yrs (range 17-65) and47.7 yrs (range 34-60). Only 7 out of 10(70%) CD34+ patients achieved completeremission (CR) after induction chemotherapy,compared to 6/6 (100%) CD34-cases. Relevant differences in remissionduration between the CD34 positive andCD34 negative groups were found: medianDFS was 6.4 mo (2-22) vs. 14.0 mo (9-24). However, significant results withineach group were found when age was takeninto account: in the CD34+ group older pts.(median age 61 yrs, range 54-65) hadshorter remission when compared toyounger pts (median age 30.3 yrs, range17-40) with a median DFS of 2.86 vs. 14.7months.; similarly, in the CD34- group remissionwas shorter in older pts (medianage 56.3 yrs, range 51-60) vs. younger (39yrs, range 30-53) with a median DFS of11.3 vs. 17.0 mo. Remarkably, cytogeneticabnormalities had no significant relevancesince no association was found either withCD34 expression nor with DFS. In conclusion,in our experience, CD34 expressionmay be associated with reduced probabilityto achieve CR and with shorter DFS inolder patients. However, the identificationof a bad prognosis subgroup of CD34+ AMLpatients should be confirmed on larger series.P032ASSESSMENT OF MARROW LEUKEMICINDEX (MLI), AGE AND CD34 INCLINICAL OUTCOME OF ELDERLY AMLPATIENTS TREATED WITH STANDARDCHEMOTHERAPYG. SPECCHIA, F. ALBANO, D. PASTORE, I. ATTOLICO,A. RICCO, P. CARLUCCIO, M. LAMACCHIA, G. DEBELLIS,V. LISOHematology-University of Bari-ItalyAcute myeloid leukemia (AML) is mainlya disease of the elderly, who account formore than 50% of its incidence among thegeneral population. We analyzed a cohortof 120 consecutive cases of de novo AML inorder to identify clinical and laboratory parameterswith prognostic significance. Themedian age was 68 yrs (range, 60-86; 64M,56F). Distribution according to FAB criteriawas as follows: M0 (9), M1(3), M2(57),M4(18), M5(12), M6(20), M7(1). Sixty-nine(58%) pts. were defined as eligible for standardchemotherapy (SC) and were treatedwith induction therapy including MTZ 7 mg/m 2 on days 1, 3 and 5, Etoposide 100 mg/m 2 for 5 days, ARA-C 100 mg/m 2 for 7 days.After Complete Remission (CR) the pts. received2 cycles of the same protocol (MICE).The 51 (42%) pts. non eligible for standardtreatment received palliative care. Forpts. treated with standard chemotherapythe MLI (Leukemia 10:1443-52, 1996), representingthe residual (%) of initial leukemiccell mass (% blast x cellularity), wascalculated. We also evaluated most of thecommonly employed prognostic factors forAML, including WBC count, LDH, the expressionof CD34 and Pgp 170. The mainclinical characteristics at presentation of the69 pts. eligible for induction treatment werecompared with those of the 51 pts. whounderwent palliative treatment. In the latterpts., poor performance status was morefrequently observed (PS>2 25% vs 5%,p=0.003), as well as older age (>70 53%vs 21%, p

37 th Congress of the Italian Society of Hematology89with 1,2 months in the palliative treatmentgroup (p

90 September 26-29, 1999 - Torino-Lingotto, Italydrugs (1: sarcolysin; 2: HU;2: IFN), while45 were treated with multiple drugs accordingto the following protocols: 13 ABVD; 7MOPP; 10 MaMa; 1 MVPP; 2 Macop-B;2Promace-MOPP; 2 Chop; 1 Gimema LAL02.88; 1 Gimema LAP 8303; 1 Gimema LAM84.02; 2 French protocol for LAL La1074; 1Italian protocol LMC 73; 1 Italian protocolLMC 74. Longer observation and increaseof observed cases confirms what we reported6 years ago: as already more widelydocumented for patients who started treatmentunder the age of 18,many drugs usedin the treatment of hematological malignanciesmay maintain fertility also in maleand female patients older than 18,withoutapparent anomalies in pregnancies and offspring,at least in short time observation.P035THE IMPACT OF KARYOTYPE ON THEOUTCOME OF 148 DE NOVO AMLPATIENTS TREATED AT DIAGNOSISWITH STANDARD INDUCTION ORFLUDARABINE COMBINATIONSM. CLAVIO, I. PIERRI, G. BELTRAMI, S. GATTO, M. MIGLINO,L. CANEPA, S. QUINTINO, R. CERRI, M. RISSO, M. SPRIANO,A.M. GATTI, P. GHIRLANDA, M. CAVALIERE, D. PIETRASANTA,F. B ALLERINI, E. DAMASIO, M. SESSAREGO, M. GOBBIDepartment of Haematology, S. Martino Hospitaland University of GenoaThe following table reports the impact ofkaryotype on the outcome of 148 de novoAML patients who underwent first line inductiontherapy with standard regimens(Ara-C + antracyclin ± etoposide) orfludarabine combinations (FLAG, FLANG,FLAG-IDA) and received allogeneic or autologousbone marrow transplantation,when possible. Fav kar: t(8;21), inv(16).Unf kar: -5,5q-,-7/7q,11q abn, 17 abn,del(20q), dmns, +13,complex karyotypes(>3 abn). Int kar: normal and all otherabnormalities.Standard therapyFludarabine combKaryotype: Fav Int Unf Int UnfN. pts 8 79 14 43 11Mean age 49 53 46 58 67(range) (35-63) (17-85) (20-72) (33-87) (52-75)N. CR 6/8 50/79 5/19 P.004 22/33 5/13 p .08%CR 75 63 36 67 38%Surv(3ys) 44 31 8 P.003 27 13 p .02%DFS(3ys) 50 36 25 p.n.s. 37 25 p n.s.In 38 secondary AML patients receivingfludarabine combinations karyotype had amajor influence on CR rate: 10/20 (50%)and 4/20 (20%) CRs in patients with intermediateand unfavourable karyotype, respectively(p 0.05). Survival and DFS werepoor in both groups. Our data confirm thestrong prognostic value of karyotype in denovo and secondary AML patients.Fludarabine combinations achieved promisingresults in patients with intermediateprognosis karyotype. The problem ofunfavourable karyotipic alterations remainsunresolved.P036PROGNOSTIC FACTORS IN THETREATMENT OF AML WITHFLUDARABINE COMBINATIONS(FLAG-FLANG-FLAG-IDA)M. GOBBI, M. CLAVIO, I. PIERRI, G. BELTRAMI, S. GATTO,P. CARRARA, D. PIETRASANTA, S. QUINTINO, F. BALLERINI,R. CERRI, B. MASOUDI, M. RISSO, M. SPRIANO, E. BALLEARI,S. GARRÈ, R. GHIO, M. SESSAREGO, E.E. DAMASIODept.of Haematology, S. Martino Hospital andUniversity of GenoaFrom January 1993 to February 1999 146patients (mean age 57 years, range 17-87)with non M3 acute myeloid leukaemia (AML)have been treated in Genoa with FLAG(Fludarabine 30 mg /sqm, Ara-C 2 g /sqm,G-CSF 300 mcg/die, for 5 days), FLANG(Fludarabine 30 mg /sqm, Ara-C 1 g /sqm,mitoxantrone 10 mg/sqm, G-CSF 300 mcg/die, for 3 days) and FLAG-IDA (as FLANGbut with idarubicin 12 mg/sqm). Ninetyeightpatients had de novo AML (57 untreated).Forty-eighy patients evolved fromMDS or were therapy related (42 treated atdiagnosis). Factors influencing the outcomeof patients treated at diagnosis are reported(6 auto and 5 allo BMT were performed asconsolidation): [M. sur = mean survival inmonths; int kar= intermediate karyotype;rel = relapsed; ref = refractory].CR/tot (%) 3ys DFS 3ysSurv M. surp % p % pAge < 60 22/42(52) n.s. 52 .05 28 .005 13Age > 60 27/57(47) 16 9 10De novo (60)10/22 (45) 20 14 12

37 th Congress of the Italian Society of Hematology91CR/tot (%) 3ys DFS 3ys Surv M. surp % p % pInt. kar. 38/63 (60).002 31 n.s. 20 .007 13Poor kar. 8/31 (26) 38 10 8First line 49/99 (49) n.s. 32 n.s. 16 .05 11Rel / ref 24/47 (51) 27 7 8In conclusion: CR rate was clearly influencedby karyotype. Survival of all patientswas affected by age, karyotype and pretreatment.The history of MDS or the exposureto chemoradiotherapy lessened CR rateand survival but only of patients youngerthan 60 years. In all patients treated asfirst line therapy DFS was affected by age.P037PROGNOSIS IS CORRELATED WITHTHE RATIO OF PRO- VERSUS ANTI-APOPTOTIC MITOCHONDRIALMEMBRANE PROTEINS IN ACUTEMYELOID LEUKEMIA (AML)G. DEL POETA, L. MAURILLO, A. VENDITTI, F. BUCCISANO,M.C. COX, A. TAMBURINI, B. DEL MORO, A.M. EPICENO,A. BRUNO, M.I. DEL PRINCIPE, G. SUPPO, M. MARTIRADONNA,M. MASI, S. AMADORIDept. of Hematology, University “Tor Vergata”, RomaThe involvement of mitochondria inapoptosis is demonstrated by the crucialinteractions between bcl-2 and proapoptoticrelated oncoproteins (bax, badand bak). Moreover, the monoclonal antibody(MoAb) APO2.7 which reacts with a38 kDa mitochondrial membrane protein(7A6 antigen) highlights an early event ofapoptosis. In order to evaluate the clinicalsignificance of spontaneous apoptosis inAML, we investigated 7A6 and bcl-2 expressionin 60 patients, 26 females and 34males, median age 56 years. All patientswere treated with intensive chemotherapyregimens (EORTC/GIMEMA AML10 andAML13 protocols), except for the FAB M3cases, treated according to the GIMEMAAIDA protocol. Bcl-2 and 7A6 expressionswere determined on flow cytometer (EpicsXL, Coulter) using an anti-bcl-2 124 FITCMoAb (Dako) and APO2.7 PE Moab(Immunotech), respectively. Bcl-2 andAPO2.7 were evaluated as mean fluorescenceintensities (MFI), calculated as theratio of bcl-2 or APO2.7 MoAbs mean/negativecontrols mean. The results were expressedas an index (APO) obtained by dividingMFI APO2.7/ MFI bcl-2. The thresholdfor considering AML cases as “apoptotic”was set at the APO median value > 1.5.APO < 1.5 patients were associated bothwith immature FAB M0-M1 classes(P=0.039) and with CD34 positivity (20/29; P=0.018). There was a significant correlationbetween low or high cytogeneticrisk class and APO index > or < 1.5(P=0.009). With regard to clinical outcome,a significant difference in complete remission(CR) rate was found between APO 1.5 patients (51.7% v.88.5%; P=0.003). Overall survival and CRduration were significantly longer (P=0.017and = 0.007, respectively) in APO >1.5patients. In multivariate analysis, only APO(P=0.003), age (0.009) and WBC(P=0.043) were confirmed independentprognostic factors for CR achievement. Inconclusion, low 7A6/bcl-2 ratio might explainthe poor outcome of patients treatedwith very intensive regimens and mightinduce to treat the APO

92 September 26-29, 1999 - Torino-Lingotto, Italyand as percentage of positive cells. The resultswere expressed as an oncoprotein index(bcl-2 OPI), wherein OPI equals theproduct of the percent positive cells and theMFI value.The threshold of positivity wasset at the OPI median value ³ 800. Bcl-2OPI > 800 was strictly correlated both withFAB M0-M1 classes (P 800 (24/32; P= 0.007). Moreover, patients with bcl-2 OPI

37 th Congress of the Italian Society of Hematology93P040SOLUBLE INTERLEUKIN-6 LEVELS ANDCLINICAL OUTCOME IN ACUTEMYELOID LEUKEMIA (AML)G. SUPPO, A.TAMBURINI, G. DEL POETA, A. BATTAGLIA,A.M. EPICENO, L. MAURILLO, A. VENDITTI, F. BUCCISANO,M.C. COX, B. DEL MORO, M.I. DEL PRINCIPE,M. MARTIRADONNA, M. MASI, S. AMADORIDept. of Hematology, University “Tor Vergata”, RomaCurrent evidence suggests that interleukin-6(IL-6) is produced by myeloid blastcells as a growth stimulating factor. In orderto define a possible prognostic role,serum IL-6 levels were measured in 63patients with newly diagnosed AML, 27 femalesand 36 males, median age 52 years,all treated by intensive chemotherapy regimens.IL-6 determination was carried outby a means of an enzyme immunoassay kit(IL-6 EASIA, Bouty). The threshold of positivitywas set at ≥8.5 pg/ml, as recommendedby the manufacturer. No significantcorrelation was noted between FABclasses, WBC count, CD34 antigen, P-glycoproteinexpression and IL-6 levels. On theother hand, all cases (6/6) with very lowretinoblastoma (Rb) protein expressiondetected by flow cytometry had a higherthan 8.5 pg/ml IL-6 levels. With regard toclinical outcome, a significant difference incomplete remission (CR) rate was foundbetween IL-6 positive and IL-6 negativecases (50% v. 86.4%; P=0.004). Higher IL-6 levels were significanlty correlated withchemoresistance to first line chemotherapy(P=0.026). Moreover, IL-6 negative casesshowed a trend for a longer survival (P=0.089). We performed a further analysiswith the exclusion of patients belonging toFAB M2 class because they had a good clinicaloutcome although almost all (16/18)showed IL-6 values higher than 8.5 pg/ml.In this patients’ subset, we observed a trendof correlation between good/intermediatecytogenetics and IL-6 levels lower than 8.5pg/ml (11/17; P=0.064). Also differencesbetween IL-6 positive and negative patientsin CR achievement (P=0.002) and overallsurvival (P=0.038) were reinforced removingFAB M2 subgroup. Finally, in multivariateanalysis in which were entered age,WBC count, P-glycoprotein expression, cytogeneticsand IL-6, IL-6 levels (P=0.013)were confirmed as an independent prognosticfactor for CR achievement. Our resultssuggest that the high IL-6 serum concentrationsmight be considered as a biologicalfactor with a significant impact onprognosis of AML.P041PURE GRANULOBLASTIC APLASIAS. ROCCO, L. CATALANO, C. SELLERI, P. RICCI, A. SEVERINO,A.M. RISITANO, M.L. BARONE, M. VOLPICELLI, M. ROSSI,M.R. VILLA, A. CAMERA, B. ROTOLIDiv. di Ematologia, Università Federico II, NapoliA 54 year old male was referred to ourunit in March 1999, because of neutropeniaoccurred after a febrile syndrometreated with drugs including noraminopyrine.He had received diagnosis of congenitalicthyosis. Fever, stomatitis, absoluteneutropenia (WBC 2500/µL, N 0/µL, Hb13.1 g/dL, Plt 294.000/µL), increased liverenzymes (ALT 5 x n.v., γGT 5 x n.v., AP 4 xn.v.), anti-EBV IgM and IgG were found atour observation. Selective granuloblasticaplasia was documented by bone marrowcytology and histology. Double fluorescenceflow cytometry analysis of peripheral bloodshowed an expanded CD8+/DR+ (75%)and CD8+/CD69+ (40%) population, andan increased number of CD8+/IFNγ expressingcells (65%). In vitro culture performedin methylcellulose showed reduced CFU-GMcolony growth. Coculture studies demonstratednormal bone marrow progenitorgrowth from healthy subjects in presenceof patient’s serum, and growth inhibition inpresence of patient’s peripheral lymphocytes.The cytotoxic activity of patient’s lymphocyteswas confirmed using Jurkat cellsor normal 51 Cr labelled granulocytes as targets.Molecular analysis showed rearrangedTCR in about 20% of mononuclear cells.G-CSF and GM-CSF at doses of 300 mcg/dwere both ineffective. Partial and transientneutrophil increase (N 2500/µL), precededby an eosinophil spike, was obtained withhigh dose steroids (dexamethasone 40mg/d for 4 days). The patient is now takingCSA at doses of 100 mg/d, but neutrophilcount is still low. This case confirm the cellularmediated pathogenesis of granuloblasticaplasia. The roles of noramidopyrin and EBVinfection are still uncertain, as well as thesignificance of the clonal T cell expansion.

94 September 26-29, 1999 - Torino-Lingotto, ItalyP042ACUTE PROMYELOCYTIC LEUKEMIAFOLLOWING MYELODYSPLASIA ANDFANCONI-LIKE SYNDROMES. ROCCO, L. CATALANO, C. SELLERI, M. PICARDI,L. LUCIANO, B. ROTOLICatt. di Ematologia, Università Federico II, NapoliWe describe the case of a young womanaged 30, affected by a congenital syndromecharacterized by short stature, café au laitcutaneous spots and erythrocyte macrocytosis,with normal karyotype and absenceof spontaneous or DEB-induced chromosomalinstability. Same signs were presentin a sister, and macrocytosis was presentalso in the mother and in another sister. InOctober 1998 we detected cytopenia (WBC2500/µL, N 500/µL, plt 132000/µL, Hb 11,2gr/dL, MCV 110 fL). Bone marrow diagnosiswas AREB (myeloid blasts about 15%,increased marrow fibrosis, normal karyotype,absence of spontaneous or DEB-inducedchromosomal instability). In February1999, blood counts worsened (Hb 6.6g/dL, WBC 1000/µL, N 280/µL, plt 30000/µL) and signs of immunological hemolysisappeared (positive DAGT test, retics.250000/µL) with presence of circulatingblasts. Bone marrow aspirate showed 40%myeloid blasts, some of them looking asatypical promyelocytes. Molecular biologyshowed presence of the hybrid transcriptPML/RARalpha, and translocation 15;17 wasdetected by citogenetics.The patient wasenrolled in the GIMEMA LAP-AIDA protocol,and is now recoverig from cytopeniawithout evidence of marrow blast excess.Although almost all juvenile MDS evolve tosecondary AML, APL following MDS is extremelyrare. Only two cases of APL-likeleukemia following MDS have been describedso far (Najfield, Genes ChromosomeCancer, May 1994), with complex karyotypicalterations, absence of typical molecularand cytogenetical markers and poor prognosis.We are currently evaluating the molecularresponse in our patient. There is aHLA identical sibling, but she is the sistersharing the Fanconi-like syndrome.P043LOW DOSES OF G-CSF AND Cy-A IN ACASE OF SEVERE NEUTROPENIAASSOCIATED WITH CLONAL T-CELLPOPULATIONL. CICOIRA, F. PANE*, M.R. VILLA, M. VOLPICELLI,V. MARTINELLICattedra di Ematologia and *CE.IN.GE.Dipartimento di Biochimica e Biotecnologie Mediche,Facoltà di Medicina e Chirurgia, Università degliStudi di Napoli Federico IIAcquired severe chronic neutropenia is arare autoimmune disease, in some casesassociated with a T-cell clonal population.One therapeutic option is Cyclosporin-A(Cy-A); this immunosuppressive drug isoften effective, but side-effects do limit itsuse for a long time. Growth factors (G-CSF,GM-CSF) improve the number of circulatingneutrophils. A standard therapeuticapproach is based on Cy-A to mantein aplasma concentration of 100-200 ng/ml andG-CSF 300 ug/die. We have used an originalassociation of very low doses of G-CSFand Cy-A to treat a patient affected by severeneutropenia associated with a not wellclassifiable chronic connectivitic disease.In 1992 a 59 year old woman, was diagnosedto have an autoimmune disease withsevere neutropenia; a CD3+ and DR+ populationwas demonstrated by flow-cytometry,which proved to be clonal by rearranged Tcell receptor gene (R-TcR) in bone marrow(BM). Treatment is summarized in the table.In 1997 the R-TcR was not found. At presentthe patient is alive and well, plasma CyA is≅ 30 ng/dl, blood pressure is normal, neitherhypertrichosis nor gastro intestinal painare present. Very low doses of CyA, G-CSFand prednisone (2.5 mg/die) are giving tothis patient a good quality of life during afour years follow up.TIME THERAPY NEUTROPHILS SIDE EF/HOSDec91-Feb93 PDN/OBS < 1.000 SEPSIS/YES: 5Feb93-Feb95 Cy-A HYP, diarrhea/3-400mg/die ≅ 1.000 YES: 8Feb95-Apr95 OBS N ≤ 250 SEPSIS/NOApr95-May98 Cy-A50mg/die +G-CSF ≅ 3.000 NO/NO300mg/weekMay-Jun98Cy-A50µg/die ≅ 1.500 SEPSIS/NOSince Jul98Cy-A50mg/die +G-CSF ≅ 3.000 NO/NO300µg/weekPDN = prednisone 75 mg; OBS = observation;EF = side effects;HOS = ospitalizations: times; HYP = hypertension.

37 th Congress of the Italian Society of Hematology95P044CONGENITAL DYSERYTHROPOIETICANEMIA TYPE II: A CLINICALEXPERIENCE OF A SINGLE CENTREV.BONGARZONI, P. ANTICOLI BORZA, I. CARMOSINO,A. AMENDOLA, M. BRECCIA, E. DI BARTOLOMEO, F. GIONA,B.MONARCA, F. MANDELLIDepartment Biotecnologie Cellulari ed Ematologia-University “La Sapienza”- RomaCongenital Dyserithropoietic Anemia TypeII (CDAII) is a rare genetic disorder characterizedby ineffective erythropoiesis anddyserythropoiesis due to a decreasedglycosylation of erythroid membrane’s band3 and 4.5. A variable degree of anemia,splenomegaly and jaundice are usuallypresent. We reporte five cases followed atour institution: two males and three femaleswith a median age at diagnosis of 23 years( range 22-33 years). CDAII was diagnosedby bone marrow examination, Ham’s testand membrane protein analysis by meanof polycriylamide gel electrophoresis. Fourpatients had at diagnosis normocytic anemia,anisocytosis, hyperbilirubinemia, elevateserum lactate dehydrogenase activityand splenomegaly. Only one patient wasasymptomatic but he was studied for a relationshipwith a female affected by CDAII. Three of five patients received a correctdiagnosis of CDAII after splenectomy. Thesepatients had an alterate osmotic fragility oferythrocytes (AGLT 50, Osmored and Autohemolysis)and detection of spherocytes inthe peripheral blood, which have been proposedas a screening tests for diagnosis ofHereditary Spherocytosis. The persistentanemia and hyperbilirubinemia after splenectomysuggested a bone marrow examinationand Ham’s test, which showed thecorrect diagnosis of CDAII. However, afterthe splenectomy these patients had a riseof the hemoglobin level and a reduction ofthe clinical signs of hemolysis. Therapy ofCDAII is not well codified. Splenectomy isnot able to cure this entity, but it may behelpful to decrease transfusional requirementin many patients. This finding maybe explained by a rate of peripheral hemolysisdue to a splenic sequestration.P045ALL-TRANS RETINOIC ACID IN THETREATMENT OF RAEB-T.A CASE REPORTM. PINI, A. BARALDI, L. DEPAOLI, P. FRACCHIA, S. PONZANO,F. S ALVI, A. LEVISEmatologia - Az. Ospedaliera SS.Antonio e BiagioC.Arrigo. AlessandriaAll-trans retinoic acid (ATRA)-a potentdifferentiation agent-that is successfullyused as a therapy for acute promyelocyticleukemia(APL), has not shown the sameefficacy in myelodysplastic syndromes(MDS). In this case-report we are showingthe result of a single therapy’s experiencewith ATRA for MDS. The patient is a maleof 58 years old who was diagnosed, in April1998, a refractory anaemia with excess ofblasts in transfomation (RAEB-T). At thediagnosis, his haematological parameterswere as follows: i) important pancytopenia(Hb 7.5 gr/dl, WBC 1.0x10 9 /l nocirculanting blast cell, platelets 45x10 9 /l),ii) Bone marrow(BM) appearedhypercellular, with maturation defect mostlyof erytroid lineage and 26% of myeloid blastcells ( CD-13 + , CD-33 + , CD34 + , HLA-DR +/-CD-14 - ), c) normal karyotype (46 XY). Thepatient started on conventional inductionchemotherapy for AML (AML-10 protocol byGIMEMA group). The BM evaluation afteraplasia showed a picture of no response(22% of blast cells). For this reason, it wasstarted, (June 1998), ATRA therapy( 45mg/sqm/d). At the beginning of the treatmentthe haematological parameters were as follows:Hb 8.6 gr/dl (trasfused), WBC 0.6x109/l, platelets 7x10 9 /l (refractory totrasfusion). At the four week of therapy withATRA the blood count began to rise. Thetherapy was continued, at the same posology,for six months. It has been documenteda progressive improvement of thehaematological situation (Hb>11gr/dl, almostcomplete normalization of WBC andthe rise of platelets up 70x10 9 /l). The BMexamination has showed, at three followingcontrols, maturative defects but lessthan 5% of blast cells. ATRA related sideeffects have not been observed. This casereport, although sporadic, gives the startingpoint for further considerations: i) thepatient has not presented PML-RARα rearrangement,ii) the ATRA’s action has notrestricted all over the time,there has been

96 September 26-29, 1999 - Torino-Lingotto, Italyno transient response and no evidence ofdevelopment of cellular resistance to ATRA,iii) the ATRA’s action appears specific. Indeedthe ATRA interrumption after six monthsof therapy has brought about a change inthe blood count (drop-out of the Hb andplatelets levels). This alteration has beenreversed with the restart of ATRA at the sameposology. In conclusion even though we havedealt only a unique case, we think that wouldbe interesting to evaluate the ATRA role,alone or in combination with other agent, ona more wide group of MDS.P046ACUTE PROMYELOCYTIC LEUKEMIADURING PREGNANCY: DESCRIPTIONOF THREE CASESU. CONSOLI, P.M. FLORIDIA, M. SALERNO, S.M. RICCIOLI,C. CARASTRO, G. MINEO, G. ABBATE, F. STAGNO,G.A. LONGO, C.R. MELI, R. GIUSTOLISIInstitute of Hematology, University of Catania, ItalyThe development of acute leukemia inpregnancy is a rare event, with an estimatedincidence of 0.9-1.2 cases per 100.000 peryear, with the majority of cases occurringin the second and third trimesters. Acutepromyelocytic leukemia (APL) is an uncommonform of acute myeloid leukemia usuallyassociated with disseminated intravascularcoagulation (DIC). Pregnancy in patientswith APL is an extreme rare eventwhich requires special consideration tomaximize the probability of survival of bothmother and fetus. Here we describe threecases of APL developing during the first andthe third trimester of pregnancy. Obstetricand oncologic management of these patientsis discussed. Therapeutic doses ofATRA, seems to overcome the maturationblock in the promyelocytes. Vitamin A derivativesare known to be teratogenic inearly pregnancy but their use in advancedpregnancy seems to be safe for both motherand fetus until delivery. The use ofanthracyclines during pregnancy is alsocontroversial. Recently we observed threewomen in the 8 th , 38 th and 39 th week of pregnancywho developed an APL and underwentrespectively to therapeutical abortion,elective caesarean, and a spontaneous delivery.The first two patient wereasimptomatic and the diagnosis was madeduring routine laboratory tests that showedthrombocytopenia and laboratory DIC. Inthese two patients treatment with ATRA andidarubicin was started after surgical procedureand the first patients is alive and inRC at 5 months from diagnosis, the secondpatients gave birth to an healthy baby withno major complication during the delivery,she is in alive and in RC at 6 months fromdiagnosis. The third patients was treatedwith ATRA at the time of the diagnosis and,after a week of treatment with the disappearanceof the laboratory signs of DIC, shegave birth to an healthy baby. The patientunfortunately died during induction treatmentbecause of renal failure. Within thespectrum of AML, APL is rare, but is of specialimportance because of its distinctivepotential life-threatening coagulopathy andgood prognosis once complete remission isachieved. The treatment of APL during pregnancyis controversial and the importantdecision by the patient need to be madebased on medical, ethical, religious, andother personal issues. Proper informed consentrequires a comprehensive review ofthese issue and must involve all caregiversand family members.P047PROGNOSTIC RELEVANCE OF CD56EXPRESSION IN ACUTEPROMYELOCYTIC LEUKEMIA (APL)F. FERRARA, E.M. SCHIAVONE*, M.DE SIMONE*,P. B OCCUNI^, M. ANNUNZIATA, C. COPIA, C. DI GRAZIA,S. COSTANTINI^, F. PANE°, R. CIMINO, L. DEL VECCHIO^Divisione di Ematologia, TERE e ^Servizio diImmunoematologia, Ospedale A. Cardarelli,;°CEINGE, Università Federico II, NapoliWe investigated the impact of CD56 expressionin a series of 43 consecutive patientswith APL. All showed the t(15;17);29 were analyzed for PML/RARα: all werepositive (22 bcr1 and 9 bcr3, respectively).30 patients (70%) had classical APL, 13(30%) had variant APL. Induction consistedof ATRA plus chemotherapy in 31 patients(76%) and of Idarubicin ± ARA-C in 12(24%). Consolidation was identical for allremitters. Median age was 38 years (range15-68). The overall complete remission (CR)rate was 86 % (37/43). Samples were consideredCD56+ when more than 20 % offreshly collected bone marrow cells stainedwith Leu-19 moab. CD56 expression wasfound in 13 patients (30%). There were nodifferences between CD56+ and CD56- sub-

37 th Congress of the Italian Society of Hematology97group as concerns white blood count(p:0.6), fibrinogen level (p:0.28), FDP(p:0.23), variant APL (4/13 vs. 4/30;p:0.35), and DIC (9/13 vs. 20/30; p:1).Finally, there was no difference as far asATRA administration in induction therapy(24/30 or 80 % in CD56-APL vs. 7/13 or 54% in CD56+APL; p: 0.1). On the contrary,CD56+ patients more commonly had a bcr3rearrangement (4/7 or 57% vs. 3/22 or14%; p:0.03). CR rate was of 10/13 (77%)in CD56+ and 27/30 (90%) in CD56-APL(p:0.34). The median survival (OS) for allpatients has not been reached after a medianfollow-up of 37 months and survivalat 60 months is 58%. However, OS at fiveyears was 26 % for CD56+APL and 75%for CD56-APL (median 15 months vs. notreached; p: 0.005), while disease free survival(DFS) at 60 months was 43% and 83%(median 20 months vs. not reached;p:0.03). While these data seem to confirman adverse outcome for CD56+APL, analysisof ATRA treated patients provides discordantresults. As matter of fact, when weanalyzed the group receiving ATRA pluschemo as induction, we did not find significantdifference (median OS and DFS notreached for both CD56+ and CD56-APL, p:0.48 and 0.56 respectively). In conclusion,our data demonstrate that CD56 expressionis significantly associated with bcr3rearrangement and worse prognosis in APL.However, ATRA treatment is able to stronglysoften the prognostic impact of CD56 expression.Analysis on larger series is warrantedto further clarify this question.P048EVALUATION OF THE ACCURACY OFCYTOLOGICAL DIAGNOSIS IN THEIDENTIFICATION OF PML-RARαPOSITIVE CASES OF ACUTE NONLYMPHATIC LEUKEMIA (ANLL)Since 1994 at our hospital the determinationof pml-rara is available and resultsare given within 24-48 hours. Hence inductiontreatment programs including all-transretinoic acid (ATRA) can be selected for ptswith ANLL on the basis of the presence ofpml-rarα, irrespectively of FAB classification.To assess the incidence of discrepanciesbetween the results of cytomorphologicalclassification and of pml-rarα detection,the slides of 47 cases of ANLL at diagnosisconsecutively submitted to pml-rarα analysiswere blindly reviewed by an experiencedcytomorphologist (R.I.). Of 45 evaluablecases, 24 were diagnosed as acute promyelocyticleukemia (APL) (19 FAB M3 and5 FAB M3v). Pml-rarα transcript was detectedin 21/24 APL (19/19 M3 and 2/5M3v), and in 1/21 non promyelocytic ANLL.Therefore, the cytological diagnosis of APLdetected pml-rarα positivity with a sensitivityof 95,5% (21/22), a specificity of86,9% (20/23), a positive predictive valueof 87,5% (21/24), and a negative predictivevalue of 95,2% (20/21). The diagnosticaccuracy was 91,1% (41/45), very highfor a diagnosis of classical APL (M3) (19/20: 95%) but low for a diagnosis of variantAPL (M3v) (2/5: 40%). Cytogenetic analysis,available in 44/47 cases, proved lesssensitive, since it detected the t(15;17) in13/22 pml-rarα positive cases. Of the remaining9 cases, 8 showed a normal karyotypeand 1 showed a double abnormality(4p+, 17q+) with rarα rearrangement documentedat Southern. The t(15;17) was absentin all pml-rarα negative cases. Pmlrarαpositivity correlated with in vivo ATRAsensitivity in all evaluable cases includingthe patient with atypical karyotype, whoobtained a complete remission with ATRAalone after being refractory to an inductioncourse with conventional daunomycin andcytarabine (3+7). We conclude that theavailability of the result of pml-rarα detectionshortly after ANLL diagnosis improvesthe accuracy of cytomorphological classificationand seems warranted in cases of APLM3v, where it could significantly contributeto a correct use of ATRA.G. ROSSI, E. CARIANI, D. FINAZZI, MA. CAPUCCI,A. PASCARELLA, F. ZANETTI, A. REGAZZOLI, R. INVERNIZZISezione di Ematologia, III e I Laboratorio Analisi,Spedali Civili, Brescia; Dipartimento di MedicinaInterna ed Oncologia Medica, Università degli Studidi Pavia, Pavia

98 September 26-29, 1999 - Torino-Lingotto, ItalyP049AN UNUSUAL CASE OF ACUTEPROMYELOCYTIC LEUKEMIA:DIAGNOSTIC APPROACHM. BONFERRONI*, C. CASTELLINO*, A. FRUTTERO§,M. GRASSO*, D. MATTEI*, F. PUGNO§, A. GALLAMINI*Haematology Department*, Pathology department§,S.Croce Hospital, CuneoA 26 year-old female was admitted to ourhospital in December 1998 for pancytopenia.Laboratory parameters were: Hb 3,4gr./dL plts 33x10 3 /µL WBC 550x10 3 / µL,blasts 1%; fibrinogen 88 mg/dl, PT 70%,aPTT 30", D-dimer 19 µg/ml, lysozime 3,5mg/l. Bone marrow aspirate yelded littlematerial containing very few leukemic cellswith convoluted nuclei and basophilic cytoplasmdevoid of granules. No hypergranularpromyelocytes could be shown. BM biopsyshowed a cellular infiltrate of indifferentiatedcells CD34+, peroxidase +. An increase ofreticulin was also observed. Theimmunophenotype of bone marrow blastswas: CD33/HLA-DR-, CD9 +/-, CD33+,CD13+, CD2/CD33+, CD34+. Cytogeneticanalysis revealed a normal-female karyotype.Based on the DIC screen, RT-PCR forPML/RARα was performed and resultedpositive for a trascript of bcr 1 type. A diagnosisof APL variant was made. Inductiontherapy with ATRA and Idarubicin wasgiven, with prompt resolution of laboratoryDIC. The patient achieved molecolar remissionafter the first consolidation courseand remained negative at the last followupin April ‘99. This case illustrated potentialdifficulties in diagnosing some case ofAPL by morphology and immunophenotypealone. Bone marrow was difficult to aspirateand trephine biopsy was fully replacedby blasts without evidence of hypergranularpromyelocytes containing Auer rods; secondly,reticulin fibrosis has been reportedas an unusual feature in APL; finally theimmunophenotype had not a APL standardprofile. Distinctive feature of classical APLinclude the lack, or low expression of HLA-DR and CD34, combined to a positivity ofCD13, CD33 and CD9. CD2 positivity hasbeen only recently associated with the M3vor with the short ( bcr3) PML/RARα transcripttype. In conclusion we describe anunusual case of M3v with a distinctiveimmunophenotype CD2 and CD34 positivewith a bcr1 transcript type. It is suggestedthat molecolar analysis for PML-RARαtrascripts should be investigated 1) in AMLwith evidence of DIC 2) in AML suggestingM3v for the presence of hypergranularpromyelocytes or blasts with multiple Auerrod, and 3) in all AML showing an M3immunophenotype.P050WITH ADEQUATE EARLYTRANSFUSIONAL SUPPORT ALL-TRANS-RETINOIC ACID SIGNIFICANTLYREDUCES THE INCIDENCE OF EARLYHEMORRHAGIC DEATH DURINGINDUCTION THERAPY OF ACUTEPROMYELOCYTIC LEUKAEMIAG. VISANI, L. GUGLIOTTA, P. TOSI, L. CATANI, N. VIANELLI,G. MARTINELLI, E. OTTAVIANI, N. TESTONI, F. NOCENTINI,R. PASTANO, P.P. PICCALUGA, A. ISIDORI, S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli” - University of Bologna - Italy;Hematology Div. - Arcispedale Reggio Emilia- ItalyEarly hemorrhagic death (within the first10 days of tretment - EHD -) is reported asthe main cause of death during inductiontherapy for acute promyelocytic leukaemia(APL). Cooperative trials have so far failedto demonstrate any difference in the incidenceof EHD during induction regimensbased on all-trans-retinoic acid (ATRA) andin purely chemotherapeutic ones. We retrospectivelyanalyzed a consecutive seriesof 86 APL patients, diagnosed and treatedat our Institution from 1982. 43 patientsreceived combination chemotherapy withantracyclines and cytosine arabinoside(January 1982 to December 1991), whileinduction of the remaining 43 was basedon ATRA alone or on a combination of ATRAand antracyclines (January 1992 to October1996).There were significantly less inductiondeaths in the ATRA group (9 vs 2overall and 8 vs 1 of EHD, p = 0.01). Theintensity of PLT transfusion support in thefirst 5 days was significantly higher in theATRA group (p=0.02). Hemostatic evaluationsshowed an early reduction of D-Dimerin the ATRA group. No cases of morphologicalresistance were observed in the ATRAgroup after induction. In addition the numberof relapses ocurring in the first 24months from the achievment of CR was significantlylower in the ATRA group (15 vs

37 th Congress of the Italian Society of Hematology997, p = 0.01), with a disease free survival at2 years of 67 % vs 31 %. In conclusion,ATRA appears to be able to significantly reducethe incidence of EHD, increasing thenumber of possible long term remitters.Finally, we suspect that the raised early PLTtransfusion support in the ATRA group couldhave contributed to the reduction in EHD.P051CYTOGENETICS AND FISH FOLLOW-UPIN SEVERE APLASTIC ANEMIA (SAA)C. ASTORI, P. BERNASCONI, P.M. CAVIGLIANO, M. BONI,L. MALCOVATI, S. CALATRONI, C. BERNASCONIIstituto di Ematologia, Università di Pavia, Divisionedi Ematologia, Policlinico San Matteo IRCCS, PaviaSAA is a rare hemopoietic stem cell diseasewith a progonosis that has improvedwith the use of immunosuppressive therapy(IS) and with the administration of G-CSF.As SAA patients now reach a longer followuptheir risk of developing a clonal malignantstem cell disorder has increasedachieving an incidence of 10-42%. Hereinwe report 5 SAA cases who evolved in MDS/ANLL after IS therapy. This last treatmentincluded Cyclosporine A (Cy A) and methylprednisolonein all cases. In 2 cases acourse of Anti-lymphocytice globulin (ALG)in addition to G-CSF, methylprednisolonewas also given. One of these two patientsunderwent G-CSF for fourteen months, theother for only one month. When MDS/AMLevolution occurred all the cases developedclonal rearrangements on cytogeneticanalyses. However, in four of them fluorescencein situ hybridization (FISH) identifiedthe clonal population already at diagnosis.In the last one, on the contrary, itdemonstrated that the clonal defect, monosomy7, occurred during the IS therapy(nineteen months after the initiation of G-CSF). Our data point out that FISH is ofparamount importance in discriminatingbetween true SAA from hypoplastic MDS,identified by clonal chromosome defectsalready present at the onset of the disease.Moreover our results lead us to hypothesizethat monosomy 7 might have been inducedby G-CSF therapy.P052BONE MARROW THERAPEUTICALAPLASIA IN ACUTE LEUKEMIA ANDSOME PROGNOSTIC FACTORSINFLUENCING ITZ. FICO, I. RUKA, P. XHUMARIHaematology Div., Tirana Hospital “Madre Teresa”Aplasia after chemotherapy for Acute Leukemiarepresents one fase with high risk ofcomplications. Therefore for the specificconditions in our Service it is useful to studythe temporary limit and the depth of aplasiafollowing the protocol used actually forALL and AML and the prognostic factors thatinfluence the severity and the duration.From January 1996 to November 1997 35patients were studied (m/f-21/14; medianage 45 years, range 15-65) in therapeuticaplasia, all enrolled on the onset. Eigtheenpatients (51,4%) had ALL; 15 of them weretreated according to the following schedule:VCR 3mg d 1,8,22; Daunoblastina 60mg/mq d 8,9,10 and 22,23,24; Prednisone125 mg d 1-28.The 3 remaining patientswere treated according to the followingschedule: VCR 2 mg/week for 4 weeks,Prednisone 100 mg/mq d 1-28. Seventeenpatients (48,6%) with AML were treatedaccording to the following schedule:Adriamicina 30 mg/mq d 1,2,3, VCR 1 mg/mq d 2¸Ara-C 100 mg/mq d 1-7.The estimationof therapeutic aplasia was performedbased on the neutrophyl count inperiferic blood (4 grades of neutropenia:1° > 1000/ µl, 2° 500-1000/ µl, 3° 200-500/ µl , 4°< 200/ µl). Contemporaneously wehave evoluated the hemogram, bone morrowaspiration, haematochemical parameters,bacteriological examination (swob,urine colture, stool carrage, blood colture)and radiological examination (Rx standard).No patient underwent antibiotic prophylaxisneither received growth factors. The mediandays on bone marrow aplasia was 22,7days in patients with ALL and 18,6 days inthose with AML; the difference did not haveany meaningful statistic results. Most patientswith ALL, 13/18 (72,2%), showedgrade 3° neutropenia and 3/18 had grade4° neutropenia. 11/17 patients with AML(64%) showed grade 4° of neutropenia andin 5/17 patients (29,4%) neutropenia grade3 was observed. In 21/35 patients (60%) inaplasia a Gram- infection (E.Coli) was discovered.9/35 patients (25,7%) had a Gram+

100 September 26-29, 1999 - Torino-Lingotto, Italyinfection, 17/35 (48,5%) a viral infection(HSV) and in 32/35 patients (91,4%) an oralcandidosis (C.Albicans) was diagnosed. Allpatients with fever have been treated withampicyllina (3 g/day iv ), gentamicyna(80 mgx2/day iv), thrimetoprimsulphametosazole(2 cpx2/days). Five patientsdied, 4 (80%) for infection and 1 (20%)for cerebral haemorrhage. The only factoraffecting the severity of bone marrow aplasiaproved to be the neutrophyl count beforechemotherapy (p500/µ. In nonresponders on day 120 a new IS courseshould be repeated. The treatment was welltolerated, 1 patient dyed for sepsis on day45, while 10/11 patients are alive; the follow-upmedian time is 1054 days (range61-2828). Nine (82%) responded to treatment(5 CR and 4 PR) with a median timeof 85 days (range 45-519). One pt is notresponder after two IS courses. Our dataon paediatric patients showed that themortality was significantly reduced in comparisonwith protocols without G-CSF(44%). Some patients showed increase inANC, but achieved TI very late. We suggestto delay a second IS course in theseslow-responders to avoid further iatrogenicinjury. CSA should be slowly tapered at leastone month after the completehaematological reconstitution.P054GM-CSF TREATMENT OF ULCERS OFTHE ORAL CAVITY IN NEUTROPENICPATIENTS SUFFERING FROMMALIGNANT HAEMOPATHIESP.F. B ALLERINI, C. MURARI, M. BOCCALON, R. SPINAZZÈ,*A. STEFFAN, +V. ZAGONEL, G. ZAMBIANCO, G.C. DONATIFrom the Division of I Medicine of De GironcoliHospital, Conegliano (TV), *Blood Bank I.R.C.C.S.Aviano (PN), + Medical Oncology Medica I.R.C.C.S.Aviano (PN)Oral aphtha in a neutropenic patient sufferingfrom malignant haemopathy is animportant clinical problem because of itssymptomatic nature, recurrence, possibleinterference with chemotherapy, and difficultyof treatment. GM-CSF granulocyte andmacrophages growing and maturing factorstimulates the migration and maturation ofthe monocytes in macrophagic cells, itstimulates the dendritic cells and the proliferationof keratinocytes, it increases thesynthesis of collagen and causes the proliferationof endothelial cells. We have treated10 oral aphthae in 7 patients (4 males, 3females; average age: 72; range: 65-78)

37 th Congress of the Italian Society of Hematology101suffering from secondary oral aphthae thathad not responded to the traditional therapy(targeted therapy with antibiotics, esetidineand topical nystatin) for 2-30 days ( median:20 days) and chronic neutropeniawhile they were also affected by malignanthaemopathy (AML-M2 1, AREB 4, NHL 2).5 patients had an isolated aphtha lesion;one patient a twice recurring isolated lesion,one patient had three lesions. Thelesion biggest diameter was inferior-equalto 5 mm in 4 cases and superior to thisvalue in 3 cases. All patients had a seriousneutropenia when the administration tookplace (PMN mean =250 mmc, range: 150-430 mmc), which persisted in all cases afterthe disappearance of the lesions, in spiteof the administration of GM-CSF (300 mcgper day) in patients with AML and NHL, whohad been continuously treated for at least2 weeks (mean: 20 days) with 25 mg ofprednisone per day. 75 mcg of GM-CSF weregiven, with multiple intra-lesion infiltrations.The lesions were cured in 4.5 days on average(range: 2-8). Clinical improvementalso included the disappearance of pain andthe patients began to eat before they completelyrecovered. There were no side effectsdue to the administration of the drug.In two cases the follow up was interruptedbecause of the death of the patients, after3 months and after forty days respectively,without any documented relapses. The 5other patients have a negative follow-upafter 3 months (range: 2-5 months).patients (ALL and AML) to evaluate the incidenceof these infections and antimicrobialsusceptibility of blood isolates. A totalof 422 febrile episodes occurred in 201 enrolledpatients (42 ALL, 159AML) and 152(36%) bloodstream infections (PBIs) weredocumented with 19 polymicrobial sepsis.Of 175 organisms responsible of BPIs, 76(44%)were gram negative bacilli: 34(45%)strains of Ps. aeruginosa, 22 (29%)of E. coli, 11 (15%) of KES group and 8(11%) of others. Out of 34 Ps. aeruginosaBPIs (27 in monomicrobial, 7 in polymicrobial),17 were isolated in induction, 4 inconsolidation and 13 in relapse or refractorydisease. Death was recorded in 59%of monomicrobial sepsis (9 in induction, 7in relapse) and in 57% of polymicrobial (2in induction, 2 in relapse); all strains–relateddeath were multiresistant. Antimicrobial susceptibilitydisplayed a resistance rate of 57%to amikacin, of 60% to gentamicin, of 59%to ceftazidime, of 25% to piperacillin,of 25%to imipenem, of 70% to aztreonam. Ourdata confirm the high incidence and mortalityrate of Ps. aeruginosa infections inacute leukemic patients; moreover the highmultidrug resistance suggests thatexstensive antimicrobial use may play a rolein the selection of resistant strains in apathogen intinsically resistant, with thesubsequent increase of beta-lactamase andfailure of bacterial eradication. Immediatecontrol of antibiotic resistance is stronglyrecommended for appropriate therapy.P055PSEUDOMONAS AERUGINOSAINFECTIONS: INCIDENCE ANDANTIMICROBIAL SUSCEPTIBILY INFEBRILE ACUTE LEUKEMIC PATIENTSR. FANCI, C. PACI, R.L. MARTINEZ, P. PECILE*, A. FABBRI,P. ROSSI FERRINIDepartment of Hematology and University ofFlorence, *Dept. of Bacteriology and Virology,Careggi Hospital, FlorencePseudomonas aeruginosa infections arestill responsible for high morbidity and mortalityrates in acute leukemic patients; inaddition prologed use of antibiotic oftenexerts a selection pressure for the emergenceof multidrug resistant strains. FromJanuary 1995 to December 1997, we examinedfebrile episodes in acute leukemicP056HCV INFECTION AND HEMATOLOGICMALIGNANCIESL. SANTOLERI, E. SILINI*, A. NOSARI, M. MONTILLO,A. STRINCHINI, G. MUTI, L. GARGANTINI, L. BARBARANO,R. CAIROLI, P. MARENCO, E. MORRADpt. of Hematology, Niguarda Ca’ Granda Hospital,Milan, *Dpt. of Pathology, University of Pavia, ItalyIn the period Aug 1997-Aug 1998 HCV-RNA positivity (genotype 1b) was observedin 13 pts who are the object of this report.11/13 pts were hospitalized in multiple bedrooms on subsequent hospital admissions(1 MDS, 4 AML, 2 ALL, l granulocytic sarcoma,1 NHL, 1 MM, 1 CML), 1/13 (CML) ina single bed room, 1/13 (ITP) was an outpatient.11/13 pts received chemotherapy;13/13 received blood products from HCV-

102 September 26-29, 1999 - Torino-Lingotto, ItalyRNA neg. donors. Routine HCV antibodies(anti-HCV) were tested at first admissionand were negative in all pts. HCV-RNA PCR,performed on serum stored at first admission,showed positivity in 5/13 pts; the remainingpts were found HCV-RNA positiveon subsequent admissions (median followup13 mos; range 5-17). Seroconversionwas observed in 12/13 pts: in 4/12 wassynchronous with HCV-RNA positivity, in 8/12 it occurred subsequently (median latency4.5 mos, range 2-12). One pt remains anti-HCV neg. at 17 mos from first admission.5/13 pts developed acute hepatitis whichresolved. Two pts died of hematologic disease(ALL, CML-BC). A high degree of identity,with scarce temporal evolution of sequences,was found in 10/12 pts on analysisof hypervariable region 1 nucleotidicsequences (HVR 1) which was performedin 12/13 pts. The 2 remaining pts withoutsequence identity were the one hospitalizedin a single bed room and the outpatient.Conclusions: 1) In spite of HCV infectionthe scheduled chemotherapy wasadministered; 2) HCV disease seems to havea low prognostic impact on hematologic disease;3) Disease- and chemotherapy-relatedimmunosuppression makes hematologic ptshighly susceptible to HCV infection; 4) Inimmunocompromised hematologic pts HCVantibody test was often negative, thereforein this subset of pts screening should bebased on HCV-RNA test; 5) It is possible thatin immunocompromised hematologic pts anergydetermines a low selective pressure onHCV which translates into a low temporalvariability of HVR1; 6) Time-course ofseroconversions, which span a twelve monthsperiod, and patient’s characteristics (immunosuppression,chemotherapy relatedmucosytis) are suggestive of alternative stillunknown routes of transmission of HCV.

37 th Congress of the Italian Society of Hematology103MOLECULAR BIOLOGY ANDCYTOGENETICSP057IMMUNOPHENOTYPIC MINIMALRESIDUAL DISEASE (MRD)MONITORING IN ADULT ACUTELYMPHOBLASTIC LEUKEMIAM. KRAMPERA, A. MAGGIONI, C. VINCENZI, L. MOROSATO,F. SCOGNAMIGLIO, F. BENEDETTI, G. PERONA, G. PIZZOLODepartment of Clinical and Experimental Medicine,Section of Hematology, University of Verona, ItalyThe persistance or reappearance of MRDin childhood ALL represent an extremelynegative prognostic factor. Little informationis available about MRD significance inadult ALL. In our study we evaluated byflow-cytometry the presence of MRD in 20patients (10 T-ALL and 10 myeloid antigenexpressingB-lineage ALL), observed in ourIstitution from May ’94 to February ’99. Theanalysis was performed on BM samples (collectedevery 1-3 months, during and afterinduction therapy), using the CD3/TdT (forT-ALL) and CD19/TdT/CD13 and/or CD33(for B-lineage ALL) marker combinations,respectively. The median follow-up was 28months for T-ALL (range 6-52) and 16months for B-lineage ALL (range 8-24). Allpatients underwent morphological completeremission (CR) during induction therapy. 3/10 T-ALL and 6/10 B-lineage ALL patientsrelapsed. MRD was detected in 3/3 T-ALLrelapsed patients (90, 30 and 68 days beforerelapse, respectively). One T-ALL patientdeveloped an acute myeloid leukemia,being negative for cCD3/TdT combination.MRD was documented in 5/6 B-lineage ALLrelapsed patients: in 3 patients startingfrom 71, 115 and 370 days before relapse,respectively; in 2 patients MRD never disappearedand relapse occurred after 89 daysand 681 days after diagnosis, respectively.MRD was not detected in the last patientbefore relapse, because of a phenotypicswitching with loss of TdT. All the 6 ALL-Tpatients in CR are persistently MRD negative.Conversely, 2/4 B-lineage ALL patientsin CR are MRD+ in some controls. Our datasuggest that the immunophenotypic detectionof MRD is a suitable tool in ALL to identifyin most cases a partial response totherapy or to forsee the clinical relapse ofthe disease.P058PROGNOSTIC SIGNIFICANCE OFTEL/AML1 REAPPEARANCE DURINGFOLLOW-UP OF CHILDHOOD ALLC. LANZA 1,3 , G. VOLPE 3 , E. BARISONE 1 , F. FAGIOLI 1 ,E. GOTTARDI 3 , D. DE MICHELI 3 , M. PIGLIONE 1,3 , G. BASSO 1 ,E. MADON 1 , G. SAGLIO 2,31Dipartimento di Scienze Pediatriche edell’Adolescenza and 2 Dipartimento di ScienzeBiomediche, University of Torino; 3 Laboratorio diMedicina e Oncologia Molecolare-Ospedale San LuigiGonzaga, Orbassano-TorinoThe t(12 ;21) translocation which leadsto the TEL/AML1 fusion transcript has beenassociated with B-precursor lineage involvementand overall favourable clinical outcomein pediatric ALL. Nevertheless we andothers have reported that relapses mayoccur also in TEL/AML1 rearranged ALLs.In order to investigate whether minimalresidual disease (MRD) detection by RT-PCRcould help in monitoring the response totreatment and in identifying the patientsat risk of relapse, we have performed a RT-PCR study on 266 peripheral blood and bonemarrow samples sequentially obtained duringtherapy and in the subsequent followupfrom 23 positive childhood ALLs, treatedhomogeneously with a multicentric protocol.All but 2 of the patients became PCRnegativeat day 42 from the beginning ofthe treatment, at the end of the first phaseof the induction therapy, and all the patientswere PCR-negative by the end of theconsolidation phase, suggesting a high sensitivityof the blast cell population to chemotherapy.In 16 out of 23 patients (69.6%)persistent clinical and hematological remissionwas associated with a constant PCRnegativitythroughout the follow-up. By contrast,7 patients (30.4%) became PCR positiveduring follow-up. In 7/7 of these patientsa hematological relapse was invariablyobserved between 1.5 and 8 monthsafter the PCR conversion. These data showa very significant association between areturn to PCR positivity and subsequentrelapse (Fisher’s exact test 2-sided P-value=0.0001), therefore supporting a clearprognostic role of molecular monitoring inTEL/AML1-positive ALL.

104 September 26-29, 1999 - Torino-Lingotto, ItalyP059CLONALITY MARKERS FOR MINIMALRESIDUAL DISEASE: A T-ACUTELIMPHOBLASTIC LEUKEMIA WITH CNSRELAPSEG. ANSELMI, V. CHIESA, M. LANCIOTTI, A. VALETTO,D. DI MARTINO, F. SCUDERI, G. DINIDept. of Pediatric Hematology and Oncology,G. Gaslini Research Children’s Hospital, Genoa, ItalyWe report a 6 years old case of T-AcuteLymphoblastic Leukemia (ALL). GenomicDNA extracted from bone marrow (BM) cellsat onset, showed a clonal rearrangementVγI Jγ1323. We sequenced the amplifiedDNA fragment identifiing the patient specificprimer (PSP) useful to monitor the follow-up.We identified the reapparence ofthe leukemic clone 3 months before the firstnd the second relapse in the BM. However,the VγI Jγ1323 rearrangement seemed tobe not present in a third relapse observedin the central nervous system (CNS) and inlymphonodes.To get a further clonalitymarker, we evaluated other rearrangementstipical of T-ALL (γ-TCR, δ-TCR, sil-tal deletion)and we identified a VγIV Jγ1323. DNAfrom cerebrospinal fluid and lymphonodesparaffin embedded sections, analyzed byPCR, confirmed the same rearrangement.Now we are analyzing the follow-up sampleswith this new PSP. This case report stressesthe importance to use more then onemarker in the study of minimal residual diseaseto avoid false negative results.P060MOLECULAR REMISSION AFTERPROLONGED INTERFERON-BASEDTREATMENT IN 5 PATIENTS WITHCHRONIC MYELOGENOUS LEUKEMIAE. ABRUZZESE, M. CANTONETTI, G. CATALANO, D. ZANGRILLI,C. COX, R. LENTINI, D.FERRERO, C. FOLI, S. AMADORIHematology, Tor Vergata University, Roma, andHematology, University of TorinoAllogeneic bone marrow transplantationis considered to be the only treatment forchronic myelogenous leukemia (CML) toinduce complete cytogenetic remission andnegativization of BCR-ABL reverse transcriptasepolymerase chain reaction (RT-PCR). Although interferon-alpha (IFN) inducesdurable complete cytogenetic remissionin about 20% of patients, at a molecularlevel RT-PCR usually demonstrates thepersistence of the BCR-ABL transcript. Wedescribe 5 patients treated with conventionaltherapy who have achieved molecularresponse with no evidence of BCR ABLtranscript in multiple samples after longtermfollow-up. Mean age at diagnosis was47 years (range 30-60) with 4 males and 1female. All patients presented with thet(9;22)(q34;q11) translocation and no additionalkaryotypic abnormalities. Molecularbiology with nested primers PCR revealedthe presence of p210 transcriptB3A2. Sokal score was

37 th Congress of the Italian Society of Hematology105P061TYROSINE-PHOSPHORYLATION OFSHC ADAPTOR PROTEINS ANDACTIVATION OF ERK-JNK/SAPK MAPKINASES IN ACUTE MYELOGENOUSLEUKEMIAA. BONATI 1 , P. LUNGHI 1 , R. ALBERTINI 1 , S.PINELLI 1 , E. RIDOLO 1 ,G. VALMADRE 1 , M. SASSI 1 , I. TASSONI 1 , A. TABILIO 3 ,C. CARLO-STELLA 4 , P. DALL’AGLIO 1 , P.G. PELICCI 1,21the Institute of Medical Pathology, University ofParma; 2 the European Institute of Oncology,Milano; 3 the Chair of Hematology, University ofPerugia; 4 the Chair of Hematology, University ofParma, ItalyIn acute myelogenous leukemia (AML)constitutive expression and activation ofintracytoplasmic signalling proteins areimplicated in the autocrine proliferative processesthat may stimulate the growth ofthe leukemic cells. These behaviours mayinduce a proliferative advantage of the tumourcells over their normal hematopoieticcounterparts. The mechanisms involved inthese processes are not yet completely understood.In this paper, we report the resultsof the analysis of signal transductionpathways in twenty five cases of primaryAML. All the cases were examined at diagnosisby studying samples presenting morethan 90% leukemic cells. FAB classificationand immunological and cytogenetic evaluationsof the samples were performed. Westudied the Shc adaptor proteins p52Shc,p46Shc, which activate the RAS/MitogenActivated Protein (MAP) kinase pathway,p66Shc which is RAS/MAP kinase independentand the MAP kinase family membersExtracellular signal Regulated Kinase (ERK)and c-Jun NH2-terminal protein Kinase(JNK) or Stress Activated Protein Kinase(SAPK). CD34+ and CD34- fractions of fourhuman normal bone-marrow were alsoinvestigated. Immunoblottings andimmunoenzymatic assays were performed.Our findings showed that: i) Shc proteinisoforms were constitutively expressed inall the AML cases examined. High tyrosinephosphorylationstatus was seen in themajor part of AMLs, but the levels of tyrosine-phosphorylationof p52/p46Shcisoforms, in most cases, were higher thanthose of p66Shc isoform; moreover, the levelsof phosphorylation of p52/p46Shc weresignificantly higher in the CD34+ AMLs thanin CD34- AMLs examined; ii) activation ofERK was costitutively present in AML; iii)much more higher levels of Shc phosphorylationand ERK activation in AML blaststhan in normal hematopoietic precursorswere present; iv) JNK/SAPK was not activatedin the AMLs examined, but activationoccurred after treatment of the leukemiccells by anisomycin, etoposide, andcytarabine. Activation of JNK by the antileukemicdrugs etoposide and cytarabinecorrelated with DNA fragmentation of theleukemic cells. To our knowledge, our paperis the first that analyzed the behaviourof Shc associated to that of ERK and JNK/SAPK in the same blast cells of patients affectedby primary AML by comparing leukemiccells and normal hematopoietic precursors.Moreover, our functional studiesenriched the knowledges about the mechanismsexploited by MAP kinases in AML.P062DIFFERENT RIBOPHORIN I- EVI 1FUSION TRANSCRIPT MAINTAININGTHE MAJORITY OF THE PR DOMAINARE ASSOCIATED WITH 3q21q26SYNDROME IN ACUTE MYELOBLASTICLEUKEMIA PATIENTSE. OTTAVIANI, G. MARTINELLI, N. TESTONI, G. BORSARU,C. TERRAGNA, V. MONTEFUSCO, M. AMABILE, G. VISANI,R. PASTANO, P.P. PICCALUGA, A. DE VIVO, S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli”, University of BolognaAcute myeloblastic leukemia (AML) withfeatures of myelodysplastic syndrome(MDS) and abnormalities of megakaryocytopoiesisis often characterized by cytogeneticaberrations of 3q21 and 3q26bands, involving in the pericentric inversion-inv(3) (q21q26) - and in the translocationbetween the homologous chromosomes-t(3;3)(q21;q26). This type of leukemiaare show to overexpress the EVI1gene and to have the breakpoints 3’ to thegene. We investigated by RT-PCR the EVI1gene’s expression in 6 cases of AML withinv(3) (q21q26) (4 patients) and witht(3;3)(q21;q26) (2 patients) and we wereable to assess its presence in all of them.In all of them the expression of gene fusionRibophorin I-EVI1 was researched by RT-PCR and we found that the transcriptionalactivation of the EVI1 gene is mediated by

106 September 26-29, 1999 - Torino-Lingotto, Italyenhancer elements associated withRibophorin I gene. In one case the genefusion was different showing a reduction ofRT-PCR expected Ribophorin1-EVI1 fragment:sequence analysis of fragmentshowed in this case carrying typical inv(3)(q21q26), that an aberrant form ofRibophorin1 -EVI1 transcript wasoverexpressed, lacking the majority (157AminoAcid of the 5’ untranslated region ofEVI1 gene). The clinical and morphologicalfeatures of this case showed absence ofmicromegakariocytopoiesys, on the contraryfrequent present in other similar 3q26-3q21 positive cases.This study was supported by the AssociazioneItaliana per la Ricerca sul Cancro (A.I.R.C.), bythe Italian C.N.R. target project nos.98.00526.CT04, by “A.I.L. 30 Ore per la Vita”target project and by M.U.R.S.T. 40% grant.P063A t(8;21) RT-PCR SPECIFIC METHODIN ACUTE MYELOID LEUKEMIASP.F. BALLERINI, *V. GATTEI, *M. DEGAN, C. MURARI,M. BOCCALON, G. ZAMBIANCO, P. BOCCA, G.C. DONATI,*A. PINTONucleo Ematologico Operativo, Divisione Medica I,Ospedale De Gironcoli Conegliano (TV); *UnitàOperativa Leucemie I.R.C.C.S. Aviano (PN)t(8;21) is a genic translocation determiningthe fusion of AML1 gene on chromosome21 to ETO gene on chromosome 8and it is associated with AML (mainly FAB-M2) having a more favourable prognosis.We have elaborated a method of moleculardiagnosis, identifying two pairs of primersfor RT-PCR intended to recognize the twoknow forms of chimeric gene, expressionof alternatively splicing (ETO1 and ETO2):Sense primer (used in both amplificationswith the two different antisense primers):5' CACAAACCCACCGCAAGT 3' (region1137-1154 of AML-1); Antisense primer(D14823): 5' CTCTTCCCGTTTTCGTTCAC3' (region 618-637 of ETO1); Antisenseprimer (D14822): 5' CGACCAGTGAACT GTGCAAG 3' (region 474-493 of ETO 2). Theresults of the amplification of cDNA fromseven patients with AML FAB-M2 have beencompared with those obtained using the pairof primers described in literature by Nuciforaet al. (Blood 81: 883, 1993). Only in thefirst of the seven patients under test therehas been the result of an amplification productof the expected molecular weight: thathappened both with the literature primers,although only after the blotting of DNA andthe ibridization with P32 radiolabelledprobe, and with the pair formed by senseprimer and D14823 antisense, thus obtainingan amplification product well evaluableas a single band of the expected heightwhen still agarose gel. No product of amplificationhas been obtained using D14822antisense: this allows us to suppose that inthe presence of the alternatively splicedtranscript, the specificity of the primer iscomparable with the previous one. Results:Best adjustment of our procedure of amplificationhas allowed us to simplify themethod used to identify t(8;21), thus makinglikely to recognize the presence of thealternatively spliced transcript (ETO2). Suchprocedure can be easily activated also innon highly specialized laboratories for molecularbiology technique, making possiblea wider identification of cases with a morefavourable prognosis for wich it will be necessaryto evaluate a more adequate therapeuticstrategy.P064RNA AND DNA ANALYSIS OF HPRR/TIF1α GENE IN AMLD. GANDINI, C. DE ANGELI, A. CUNEO, G.L. CASTOLDI,L. DEL SENNOBiochem. and Mol. Biol. Dept.; Biomed. and Adv.Terapy Dept., Hematology Section. University ofFerrara, ItalyThe HPRR/TIF1α gene encodes for anuclear protein with structural similarity tothe PML gene of Acute Promyelocytic Leukemia(APL). The gene product appears tobe a ligand-dependent mediator of the AF-2 activity of a variety of nuclear receptors,including RARs, RXRs, vitamin D3 receptor(VDR), and estrogen receptor (ER) (1,2).The ability of HPRR/TIF1a to mediate theactivity of RARα, and the structural similaritywith PML, prompted us to evaluatethe possible role of this gene in the pathogenesisof Acute Myeloid Leukemias. A setof probes spanning the entire c-DNA codingsequence of the gene (3) have beengenerated, and the fragments obtainedhave been utilized as hybridization probesin Northern and Southern blot experiments.

37 th Congress of the Italian Society of Hematology107RNAs from 29 cases belonging to differentsubtypes of AML, according to the FAB Classification,have been analyzed by Northernblot analysis and the level of the expressionof the gene has been compared withthe expression of two different housekeepinggenes, such as G3PDH and β-actin.Southern Blot analysis of HPRR/TIF1α DNAhas been performed in the same group ofpatients in order to study the HPRR/TIF1αgenomic organization. In 28 of the 29 casesHPRR/TIF1α RNA was found expressed butat highly variable levels, with highest valuesin the M1 and M2 subtypes. In theHPRR/TIF1α DNA of the 25 cases so farstudied, no abnormal fragments werefound. Therefore, these preliminary resultssuggest that HPRR/TIF1α appears not to berearranged in the Acute Myeloid Leukemias,but its variable level of expression suggestsa possible role of this gene in the physiopathologyof the myeloid differentiationpathway.1) Gandini D. et al, 1994 Blood, 84, 439a.2) Le Douarin B. et al., 1995 EMBO J. 14, 2020-20333) Thenot S. et al., 1997J Biol Chem; 272:12062-8P065LEUKEMIC CONTAMINATION IN PBSCCOLLECTION AND BM AFTERCONSOLIDATION CHEMOTHERAPY INACUTE LEUKEMIA PATIENTS IN CRD. PASTORE, G. SPECCHIA, A. MESTICE, F. ALBANO, G. MELE,D. MININNI, R. CONTINO, A. SCORCA, V. LISOHematology - University of Bari - Bari, ItalyPeripheral blood stem cell (PBSC) harvestsare widely used in autologous transplantationbecause of their ease of collection andrapid hematopoietic reconstitution. Themajor issue in autologous blood stem celltransplantation (ABSCT) for leukemia iswhether PBSC collections are less contaminatedby leukemic cells than bone marrowmononuclear cells (BMMNC). We comparedleukemic contamination in PBSC collectionsand in BM in 30 patients with acute leukemia(19 AML, 11 ALL). Patients achievingcomplete remission (CR) received consolidationchemotherapy and recombinant humangranulocyte colony stimulating factor(G-CSF) to mobilize the PBSC. Phenotypicalinvestigations (CD34, CD33, CD90, DR,CD117, CD38), progenitor colony formingassays (GEMM-CFU, E-BFU, GM-CFU) and,in 15/30 patients, cytogenetic and molecularstudies were performed in PBSC andBMMNC. The results of cytogenetic andmolecular analyses are reported in the followingtable:Cytogenetic RT-PCRFAB Karyotype Molecular BM PBSC BM PBSCtargetM2 t(8;21) AML1/ETO - - + +M2 t(9;11) MLL/AF9 + - n.a. n.a.M3 t(15;17) PML/RARα - - - -M3 t(15;17) PML/RARα - - - -M3 t(15;17) PML/RARα - - - -M3 t(15;17) PML/RARα - - + -M3 t(15;17) PML/RARα + + + +M4eo inv(16) CBFb/MYH11 - - + -M4eo inv(16) CBFb/MYH11 - - - -M4eo inv(16) CBFb/MYH11 - - + -ALL t(9;22) BCR/ABL + - + +ALL t(9;22) BCR/ABL + - + +ALL t(9;22) BCR/ABL - - + -ALL t(4;11) MLL/AF4 + - + -ALL t(4;11) MLL/AF4 + - + -Our results seem to suggest that leukemiccontamination in AL patients in CR is moredetectable in BM than in PB. Further studiesare needed to confirm these observations.P066FISH ANALYSIS IN A NEWTRANSLOCATION t(3;11)(q21;q23)ASSOCIATED WITH ACUTE MYELOIDLEUKEMIAE. GIUGLIANO, P. SCARAVAGLIO, A. SERRA, T. GUGLIELMELLI,M. DE PETRINI, ^A. TONSO, °C. GENETTA, G. SAGLIO,G. REGE-CAMBRINDipartimento di Scienze Cliniche e Biologiche, Osp. S.Luigi, Orbassano; ^Ospedale Civile di Biella; °Div. diEmatologia, Osp. S.Giovanni Battista, TorinoChromosomal translocations involving theband 11q23 with a variety of partner chromosomescharacterize a subgroup of poorprognosisacute myeloid leukemias (AML)and are usually associated with a rearrangementof the MLL gene. We observed a previouslyundescribed 11q23 translocation ina 70-year-old female with AML, FAB-typeM1. The blasts were MPO+, CD33+, CD13+.CD34+, HLA-Dr+, CD22-, CD3-, CD10-. Thepatient was treated with mini-ICE but diedduring the induction because of progressivedisease. The cytogenetic analysis performedon bone marrow showed a balancedtranslocation t(3;11)(q21;q23) in all cells.At RT-PCR analysis the presence of AF6-MLL, AF9-MLL, ENL-MLL, ELL-MLL fusiontranscripts and MLL duplication, was nega-

108 September 26-29, 1999 - Torino-Lingotto, Italytive. Since genomic DNA for Southern blotanalysis was not available, we couldn’t excludeMLL rearrangements with other genesnot analyzed by PCR. In order to investigatea possible MLL involvement we performedFISH analysis on interphase cellswith a cosmide MLL probe (Oncor,Gaithersburg, USA) which detect the entire8.3 Kb breakpoint cluster region. Thecells showed two signals in all nuclei;metaphase-FISH demonstrated that theMLL gene was retained on the 11q+ derivativechromosome. Therefore, in this newtranslocation the breakpoint on 11q istelomeric with respect to the breaks commonlyinvolved in MLL gene rearrangements.Although the vast majority of 11q23abnormalities in AML involve the MLL gene,sporadic cases have been described wherethe MLL is not involved with FISH analysisand/or Southern blot. Other genes involvedin translocations in leukemia map to the11q23 region, including PLZF and RCK. The3q21 region also contains the genes RBPH1and GR6, rearranged with the EVI1 gene inthe t(3;3) and inv(3)(q21q26). Whetherthese genes are involved in the new t(3;11)remain to be determined.P067MINIMAL RESIDUAL DISEASEDETECTION IN ACUTE MYELOIDLEUKEMIAA. VENDITTI, F. BUCCISANO, A. TAMBURINI, G. DEL POETA,L. MAURILLO, A. BATTAGLIA, B. DEL MORO, M. MARTIRADONNA,I. DEL PRINCIPE, M. POSTORINO, S. AMADORICattedra di Ematologia, Università di Roma TorVergata, Div. di Ematologia, Osp.S.Eugenio, RomaUsing multiparametric flow cytometryanalysis, we have quantified the amount ofminimal residual disease (MRD) after induction,consolidation and autoSCT in 44pts with AML. The primary objective was toevaluate the impact of MRD on clinical outcome;in addition, MRD was correlated toother prognostic factors such as MDR1 phenotypeand karyotype. After induction, a MRDthreshold of 4.5x10 -4 cells was found to discriminatebetween 2 groups of pts: 59% (10/17) of those with ≥ 4.5x10 -4 residual leukemiccells relapsed, whereas 31% (8/18) ofthose with a MRD < 4.5x10 -4 did so (p =N.S.). After consolidation, a threshold of3.5x10 -4 residual leukemic cells divided thepatients in 2 distinct groups with a relapserate of 67% (10/15) and 22% (5/23) (p =0.007). Importantly, at the end of consolidationa no. of residual leukemic cells ≥3.5x10 -4 was significantly correlated withpoor risk cytogenetics (p = 0.004). As forMDR1 phenotype, although a statistical significancewas not reached, we observed that50% (10/20) of pts with ≥ 3.5x10 -4 residualleukemic cells at the end of consolidationwere MDR1 positive, whereas 72% (13/18)of those with < 3.5x10 -4 residual leukemiccells were MDR1 negative. After 12 monthsfrom autoSCT, 11 out of 19 pts are still inCR and the amount of MRD is stable belowthe value of 1.3x10 -4 (median 4.5x10 -5 ,range 0-2x10 -4 ). Fifty percent (4/8) of ptswho relapsed after autoSCT, had a no. ofresidual leukemic cells > 3.5x10 -4 at theend of consolidation, and even the transplantprocedure was not able to significantlyreduce the leukemic burden. In the remaining4 pts who relapsed a progressive increasein MRD was observed (median1.36x10 -1 , range 1.2x10 -4 -1.4x10 -1 ) afterautoSCT, eventually resulting in overt leukemia.In conclusion, the persistence of≥3.5x10 -4 leukemic cells at the end of consolidation1) strongly predicts relapse, and2) is significantly associated with poor prognosiscytogenetics.P068CLINICAL SIGNIFICANCE OF PML-RAR-αTRANSCRIPTS IN ACUTEPROMYELOCYTIC LEUKEMIA INCOMPLETE REMISSION AFTERALLOGENEIC BONE MARROWTRANSPLANTATIONL. MALCOVATI, P. BERNASCONI, E.P. ALESSANDRINO,A. COLOMBO, D. CALDERA, G. MARTINELLI, M. VARETTONI,M. BONI, P.M. CAVIGLIANO, S. CALATRONI, C. BERNASCONIIst. di Ematologia, IRCCS Policlinico S. Matteo, PaviaReverse transcriptase polymerase chainreaction (RT-PCR) for PML-RAR-α trancriptsis usefully employed to evaluate minimalresidual disease (MRD) in acutepromyelocytic leukemia (APL). After conventionalchemotherapy a positive RT-PCR testis highly predictive of clinico-hematologialrelapse. We applied PML-RAR-α RT-PCR tomonitor 8 APL patients in clinical remissionafter allogeneic bone marrow transplantation(allo-BMT). All patients were in firstcomplete remission (CR) at transplant; the

37 th Congress of the Italian Society of Hematology109conditioning regimen consisted of busulfan16 mg/kg and cyclophosphamide 120 mg/kg in all cases. Graft-versus-host disease(GvHD) prophylaxis was performed withcyclosporin A and methotrexate. One patientdeveloped acute GvHD followed by aprogressive mild chronic GvHd; three patientshad a de novo mild chronic GvHD. Allpatients are alive in CR after a follow-upranging from 18 to 65 months. A nestedRT-PCR assay with sensitivity levels of 1/10 5 was carried out on bone marrowsamples every three months after allo-BMTfor the first year and then every six months.MRD was detected in two cases: one patienthad a positive RT-PCR test 16 and 26months post-transplant, the other-oneshowed PML-RAR-α trancripts 10, 16 and36 months post-transplant. One developeda mild chronic GvHD. None of them relapsedand they both are in a long-term clinicohematologicalCR. The remaining 6 caseshave constantly had negative RT-PCR test;three of them developed a mild chronicGvhD at various time intervals after allo-BMT. Our data seems to suggest that thedetection of PML-RAR-α rearrangement afterallo-BMT is not predictive of clinico-hematologicalrelapse, according to a possibleGraft-versus-Leukemia effect. Further dataare needed to confirm this preliminaryobservation.P069A NEGATIVE PML-RARα RT-PCR NOTALWAYS PREDICTS LONG-TERMREMISSION IN ACUTEPROMYELOCYTIC LEUKEMIA (APL)S. CALATRONI, P. BERNASCONI, P.M. CAVIGLIANO, M. BONI,L. MALCOVATI, C. ASTORI, M. CARESANA, M. LAZZARINO,C. BERNASCONIIstituto di Ematologia, Università di Pavia, PoliclinicoSan Matteo IRCCS, PaviaTwelve patients with APL and t(15;17)were monitored during their clinical coursewith conventional cytogenetics, fluorescencein situ hybridization (FISH) and RT-PCR for the PML-RARα transcript. The patients,accrued in the period January1996-December 1998, were studied at diagnosis,in remission and every three months.At the onset of the disease the leukemicclone was discovered by the three techniquesin all the patients. On RT-PCR 5 patientswere bcr1 positive, 3 bcr2 positiveand 4 bcr3 positive. All patients entered CRafter treatment with all-trans retinoic acidand chemotherapy. In 6 PML-RARα transcriptswere noted up to one-two monthsafter CR. Up to now 7 patients are in continuingCR, 3 with consecutive negative RT-PCR and 3 with at least one positive test.The remaining 5 patients have relapsed 10-23 months after CR. In 2 RT-PCR was constantlynegative and relapse occurred twomonths after the last negative analyses. Inthe other 3 PML-RARα transcripts were detectedon at least two consecutive tests andpreceeded.clinical relapse of 2-7 months.Two out of these 3 patients had a low percentageof cells with red-green signals onFISH analyses. In conclusion our data showthat consecutive RT-PCR positive tests alwayspredict an impending relapse. However,the current RT-PCR method, with asensitivity of 10 -4 , does not discover verylow levels of clonogenic cells during remission.This is why in very few patients diseaserecurrence may be preceeded by anegative RT-PCR test.P070MISSENSE MUTATIONS IN THE PML/RARα LIGAND BINDING DOMAIN INATRA-RESISTANT AS 2O 3SENSITIVERELAPSED ACUTE PROMYELOCYTICLEUKEMIAR. MARASCA, P. ZUCCHINI, S. GALIMBERTI*, G. LEONARDI,P. VACCARI, A. DONELLI, M. LUPPI, M. PETRINI*, G. TORELLIDept. Of Medical Sciences, Section of Hematology,University of Modena; Hematology Div., OncologyDept., University of PisaAcute promyelocytic leukemia is characterisedby the chromosomal translocationt(15;17) which yields to the fusionproduct PML/RARα. All-trans retinoic acidinduces differentiation of atypical promyelocytesand clinical remission in APLpatients by binding to the ligand bindingdomain (LBD) of the RARα portion of thePML-RARα chimeric protein. Structural alterationsof the LBD of the PML/RARα havebeen revealed in ATRA resistance APL celllines and in few APL patients with acquiredclinical resistance to ATRA therapy. Weevalueted two APL relapsed patients withclinical resistance to ATRA therapy for the

110 September 26-29, 1999 - Torino-Lingotto, Italypresence of nucleotide mutations in the LBDof PML/RARα gene and then treated witharsenic trioxide (As 2O 3). The screening formutations of the PML/RARα LBD was performedusing as primers in the RT-PCR experimentsdifferent oligonucleotides spanningthe entire LBD. Direct sequencing wasperformed by an unambigous bi-directionalautomatic analysis. Samples representativeof APL onset and relapse were analysedfrom both patients. In both patients, at theATRA resistant relapse, a missense pointmutation in the LBD of the PML/RARα genewas found. The mutations, absent at theAPL onset, lead respectively to anArg272Gln and to an Arg276Trp amino acidsubstitution, according to the sequence ofthe RARα protein. Both patients had a completeclinical and hematological remissionafter treatment with As 2O 3. LBD missensemutations appear to be a significativemechanism of acquired ATRA-resistance invivo, closely related to the clinical APL relapse.The two cases reported here are thefirst in vivo evidence of arsenic trioxide sensibilityof APL relapsed patients who becameATRA resistant for molecular reasons.P071FARNESYLTRANSFERASE INHIBITIONMAY REVERT IN VITRO FAS-MEDIATEDAPOPTOSIS OF CLONOGENIC CHRONICMYELOID LEUKEMIA CELLSC. SELLERI, A.M. RISITANO, G. VARRIALE, P. RICCI,L. LUCIANO, A. SEVERINO, P. DELLA CIOPPA, B. ROTOLIDiv. of Hematology, Federico II University of NaplesThe ras gene transduction pathway is involvedin cell proliferation and transformation.In addition, it has been recently reportedthat ras activation is essential forFas-induced apoptosis in Jurkat cells. Thebcr-abl fusion protein, constitutively activatedin chronic myelogenous leukemia(CML), triggers a ras signal transductionpathway that appears crucial for cellulartransformation. To control cell growth anddifferentiation, ras must move from thecytoplasm to the plasma membrane. Rasfarnesylation is a requisite for membranelocalization of ras and is catalyzed by anenzyme termed farnesyl-protein transferase(FPT-ase). A variety of inhibitors of FPTase,able to block the growth of ras-transformedcell lines, have been used as potentialchemotherapeutic agents for thetreatment of some types of cancer. We haverecently documented that Fas-mediateddownmodulation of bcr/abl results in decreasedproliferation rate of CML bone marrow(BM) progenitors due to apoptosis ofclonogenic cells. We have investigated theeffect of α-hydroxyfarnesylphosphonic acid(FTI), a potent and specific inhibitor of FPTase,alone and in combination with the anti-Fas monoclonal antibody (clone CH11,Amac) triggering apoptosis (1 µg/ml) oncolony-forming unit cell (CFU-C) growth of10 CML patients in chronic phase. FTI treatment(100 µM) did not affect CFU-C CMLgrowth compared to untreated CFU-C(mean percentage ± SD: 55.5±13.3 vs56.5± 12.6). Pretreatment of CML mononuclearcells for 2h with FTI significantlyreverted Fas-mediated inhibition of CFU-Cgrowth (mean percentage of CFU-C ± SD:19.4±6.7 vs 47.7±11.2 with Fas triggeringand FTI + Fas triggering, respectively;p

37 th Congress of the Italian Society of Hematology111sequences of the two internal primers wereconceived so to be contiguous. We performedtwo reactions of amplification. Thefragments obtained from the single reactionsare denaturated and renaturated tofavour the coupling of the two inserts. Reamplifyingwith the same external primersa fragment of DNA identical to original DNAtarget was obtained differing only for thepresence of the 21 base pairs in the core.After electrophoresis and opportune purificationof the DNA extracted from agarosegel, the competitor was re-amplified andsubsequently utilized. Serial diluitions ofthis competitor were added to fixedamounts of sample DNA in several differentreactions and the mixtures subjectedto nested PCR. Quantification of the targetand competitor was made by comparisonof fluorescence intensity by densitometry(results were expressed as BCR/ABL transcripts/µgRNA). The efficiency of thismethod was determined verifying the reappearanceof disease in a case of LMC afterBMT or after treatment with interferon.P073CONCOMITANT EXPRESSION OF THERARE E1/A3 AND B2/A3 TYPES OFBCR/ABL TRANSCRIPT IN A CHRONICMYELOID LEUKEMIA (CML) PATIENTM. AMABILE, G. MARTINELLI, C. TERRAGNA, N. TESTONI,E. OTTAVIANI, V. MONTEFUSCO, A. DE VIVO, 1 M. BACCARANI,P. RICCI, 2 G. SAGLIO, S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli”, University of Bologna; 1 Dept. of Hematology,University of Udine; 2 Dept. of BiomedicalSciences and Human Oncology, University of TurinThe role of the different BCR/ABL fusionproteins in determining the phenotype ofthe Philadelphia chromosome-positive(Ph+) leukemias is still unclear. Only sporadicCML cases expressing exclusively P190have so far been described, but smallamounts of BCR/ABL transcripts with theP190 junction can also be found in CMLpatients expressing P210 and are believedto arise from a mechanism of alternativesplicing of the longer b2a2 or b3a2 component.A rare breakpoint has been identifiedin patients generally showing a mild formof CML, which has been tentatively denominatedPh+ CML. In all these common typesof BCR/ABL fusion, the molecular variabilityis due to a variable breakpoint positionwithin the BCR gene on chromosome 22and the second exon of the ABL gene (a2)is juxtaposed in frame to different portionsof the BCR gene. Very rarely, due to abreakpoint position on chromosome 9 withinthe third intron of the ABL gene, the BCR/ABL fusions show the absence of the ABLexon 2 sequences. So far, only three Ph+ALL and three CML patients displaying a b2/a3 or b3/a3 junction have been described,whereas expression of the e1/a3 BCR/ABLtranscript has been reported only in twopediatric cases of Ph+ ALL. We report thefinding of a CML patient showing a concomitantexpression of both the rare e1/a3 andb2/a3 types of BCR/ABL transcripts, bothlacking the ABL exon 2 sequences. The presenceof a BCR/ABL transcripts was studiedon a sample taken at diagnosis by RT-PCR.We show that both main BCR/ABL fusiontranscripts lacking ABL exon 2 sequencescan be simultaneously expressed by thesame Ph+ clone in a patient showing a classicalform of CML and this adds further complexityto an enigma that puzzles clinicaland molecular hematologists: the relationshipexisting between the BCR/ABL hybridgene structure and the leukemia phenotype.This work was supported by Italian Associationof Cancer Research (AIRC), by Italian C.N.R. no.98.00526.CT04 target project, by M.U.R.S.T.40% and by “30 Ore per la Vita” AIL grantsP074AN ATYPICAL (B3/A3) JUNCTION OFTHE BCR/ABL GENE LACKING ABLEXON A2 IN A PATIENT WITHCHRONIC MYELOID LEUKEMIAM. AMABILE, G. MARTINELLI, C. TERRAGNA, V. MONTEFUSCO,A. TABILIO 1 , S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli”, University of Bologna; 1 Institute ofClinical Medicine, University of PerugiaA small proportion of Ph+ CML patientsfail to express a b2/a2 or b3/a2 transcript.At present 8 Ph+ cases have been reported(3 CML, 4 ALL, 1 unknown) with a variantBCR/ABL mRNA expression lacking ABLexon a2 sequences. We report a furtherpatient with Ph+ CML expressing a rare typeof BCR/ABL mRNA detected by RT-PCR lack-

112 September 26-29, 1999 - Torino-Lingotto, Italying ABL exon a2 sequences (BCR/ABL junctionb3/a3). To our knowledge, this is thethird Ph+ CML patient described with b3/a3 (or e14/a3) BCR/ABL. Our data showthat rare breakpoints outside and inside M-bcr have to be considered in Ph+ CML andthat variant BCR/ABL fusion transcripts andproteins can be expressed in Ph+ CML patients.The two patients with CML phenotypeand b3/a3 transcript showed high WBCcount and progression of the disease duringIFN therapy. Also in our patient a highWBC was seen: this opens the question asto whether this is a characteristic of thisvariant Ph+ syndrome, according with theimmunophenotype. Further studies will beneeded in order to understand the clinicalcharacteristic of these patients in relationto the molecular features. ABL exon a2 encodesfor 58 amino acids, the last 17 ofwhich are part of a stretch of 50 amino acidsthat form the SH3 region of the ABLprotein. The SH3 region is believed to havea negative regulator effect on the kinasedomain (SH1),which phosphorylates thefirst BCR exon. This transphosphorylationof c-BCR could result in Ras signaling,through the binding of the GRB2 SH2 domainto c-BCR, thus suggesting that theSH3 domain may play an important role inregulating the GTP-binding protein. Nevertheless,it has been argued that partial deletionof the SH3 domain has no additionaleffect on kinase activity due to the fact thatinhibitory effect of the SH3 domain is mostprobably counteracted by the presence of5’ bcr sequences in the BCR/ABL protein.This work was supported by Italian Associationof Cancer Research (AIRC), by Italian C.N.R. no.98.00526.CT04 target project, by M.U.R.S.T.40% and by “30 Ore per la Vita” AIL grantsP075TRANSLISIN RECOGNITION SITESEQUENCES FLANK TRANSLOCATIONBREAKPOINTS IN A PHILADELPHIACHROMOSOME POSITIVE CHRONICMYELOID LEUKEMIA PATIENTEXPRESSING A NOVEL TYPE OFCHIMERIC BCR-ABL TRANSCRIPT (E8-INT-A2)M. AMABILE, G. MARTINELLI, C. TERRAGNA, V. MONTEFUSCO,N. TESTONI, E. OTTAVIANI, A. DE VIVO, A. MIANULLI,G. SAGLIO 1 , G. ROSTI, S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli”, University of Bologna; 1 Department ofBiomedical Sciences and Human Oncology,University of TurinA novel type of the chimeric BCR-ABLmRNA transcript was detected in a patientwith Ph+ CML by RT-PCR. Sequence analysisof the fusion region of the amplified cDNAfragment showed a joining between part ofexon e8 of the BCR gene and an intronicsequence of ABL intron Ib spliced on exona2 of the ABL gene, giving rise to an inframee8-int-a2 BCR-ABL transcript. Onlypart of exon 8 of the BCR gene (e8) (intraexonicbreak) was retained. By a GT(GAGT)sequence used as splice donor, 31 bp of theintronic sequence of ABL Ib-int was thenspliced in-frame with exon 2 of ABL gene.The consequent BCR-int-ABL transcript wastranslated in a BCR-ABL protein slightlylarger than p185 BCR-ABL and smaller thanp210 BCR-ABL and p230 BCR-ABL: this proteinof 1804 aminoacid residues and with amolecular mass of 197.5 kilodaltons (kDa)was called p200 BCR-ABL. We showed thatthe 3’ part of bcr exon 8 recombined within,or immediately adjacent to, Alu elementsat the additional site in the BCR-intron IbABL rearrangement. We observed that sequencemotifs similar to consensus bindingsites of the lymphoid-associated Translinprotein are present on both participatingstrands at 22q11 and 9q34 recombinationsites. No differences in clinical presentationof leukemia or laboratory findings atdiagnosis were found between this patientwho expressed the e8-int-a2 BCR-ABL transcriptwith respect to CML patients withexpression of other bcr-abl fusion types.Clinical outcome showed a good responseto α-IFN therapy with complete hematologicalresponse and major karyotypic conver-

37 th Congress of the Italian Society of Hematology113sion. This is the first description of occurrencesof either an intra-exonic break in thegeneration of a BCR-ABL fusion transcriptor of insertion of intronic sequence to generatean in-frame BCR-ABL transcript.This study was supported by AIRC, by the ItalianCNR target project no. 98.00526.CT04, by“AIL 30 Ore per la Vita” target project and byMURST 40% grant.P076ABSENCE OF HTLV-1 INMYELODYSPLASTIC SYNDROMES IN ANAREA NON ENDEMIC FOR THE HTLV-1INFECTIONM. MORSELLI, M. LUPPI, P. BAROZZI, *M. DOMINICI,*D. CAMPIONI, *F. LANZA, K. CAGOSSI, A. PIETRAMAGGIORI,R.TROVATO, R. MARASCA, G. LONGO, G. EMILIA, G. TORELLIDepartment of Medical Sciences. Section ofHaematology, Modena, Italy; *Department ofBiomedical Sciences and Advanced Therapies.Section of Haematology, Ferrara, ItalyRecently Karlic et al. (1) reported the detectionof human T lymphotropic virus 1(HTLV-1), in patients with myelodysplasticsyndrome (MDS), in a non endemic regionof central Europe, indicating a 19% incidenceof HTLV-1. Moreover, cytogeneticanalysis showed the presence of del (5)(q)in 5 out of 8 HTLV-1 positive MDS cases,but only in 1 of 38 HTLV-1 negative cases.The same authors, having observed similarresults in acute myeloid leukemia (AML)cases evolved from MDS (3), suggested thatallelic deletions of 5q-located genes, thattypically occur in MDS, might be associatedwith HTLV-1 infection in central Europe. Weanalyzed by PCR 39 MDS cases from northernItaly, for the presence of HTLV-1, usingprimers for the pol and tax genes. Theamplified products were then hybridizedwith a specific oligonucleotide probe, asdescribed (1,2). The cytogenetic analysisshowed the presence of del (5)(q) in 4 outof 18 patients. In 8 cases, long-term bonemarrow cultures were also obtained, andDNA was extracted from the adherent cellpopulation, composed of fibroblasts (95%),endothelial cells (2%) and macrophages(3%). In contrast with the data reportedby Karlic et al. (1), we found no evidenceof HTLV-1 tax and pol sequences in all the39 patients with MDS from our non endemicarea. In particular this was true also for MDSpatients with documented del (5)(q). Aninvolvement of HTLV-1 infection in humandiseases in non endemic areas is not clearlyestablished. It is well known that antigensof different origin may have cross-reactivitywith HTLV-1 antigens. Our study providesno evidence for a role of HTLV-1 infectionin MDS. However, the presence andpathogenic relevance of still unknown viruses,related or not to HTLV-1 remain apossibility.1) Karlic et al. 1997, Cancer Res 57: 4718-21.2) Kwok et al. 1988, Blood 72: 1117-23.3) Karlic et al. 1998, ISH-EHA Congress, Br JHaematol 102: S 169.P077EXPRESSION OF P53, BCL-2 AND RASONCOPROTEINS AND APOPTOSISLEVELS IN ACUTE LEUKEMIAS ANDMYELODYSPLASTIC SYNDROMESR. INVERNIZZI, A. PECCI, L. BELLOTTI, R. FORMISANO,P. BERGAMASCHI, E. ASCARIMedicina Interna ed Oncologia Medica, Università diPavia, IRCCS Policlinico S. Matteo, PaviaSome oncoproteins are notoriously involvedin the control of cell proliferation,differentiation and apoptosis, and may havea crucial role in oncogenesis. We analysedby immunocytochemistry the expression ofp53, bcl-2 and ras proteins in bone marrowblasts from 62 patients with acute leukemia(AL), 37 myeloid (AML) and 25 lymphoid(ALL) and from 20 patients withmyelodysplastic syndrome (MDS); our aimwas to examine if abnormalities in theirexpression were associated with peculiarbiological and clinical findings, or with analtered apoptosis rate, as measured byTUNEL technique. The oncoproteins wereexpressed with extreme variability, withoutsignificant differences among the variousmorphological or immunological AL subtypes.The mean percentages of bcl-2+blasts were significantly higher in AL thanin MDS (p=0.02), and in MDS with bonemarrow blastosis than in the forms withoutexcess of blasts (p=0.02). The lowest percentagesof apoptotic cells were observedin ALL (mean 1%, p=0.006), whereas inMDS the apoptotic index was higher(16.9%) than in AML (8.6%) and than inthe normal controls (10.8%), with a statisticallysignificant difference only for cases

114 September 26-29, 1999 - Torino-Lingotto, Italyof refractory anemia. Whereas in AL theapoptotic rate was independent of theoncoprotein expression, in MDS it was inverselycorrelated with the bcl-2 level.Among AML patients treated with intensivepolychemotherapy, responders presentedbcl-2 levels tendentially lower than resistantcases, whereas no differences wereobserved in the apoptotic rate. In conclusion,our data are in agreement with thehypothesis that decreased apoptosis andenhanced cell survival are associated withAL, whereas a high level of apoptosis maybe responsible for the ineffective hematopoiesisin MDS; abnormal expression ofoncoproteins, such as bcl-2, may play a rolein the regulation of apoptosis and influencedisease behaviour.P078DISTINCT GENETIC MECHANISMS INSPORADIC AND FAMILIALMASTOCYTOSISA. BEGHINI 1 , C. RIPAMONTI 1 , P. PETERLONGO 1 , A. BELLONI 2 ,E. POGLIANI 3 , R. CAIROLI 4 , A. PESERICO 2 , L. LARIZZA 11Dept. of Biology and Genetics, Medical Faculty,University of Milan, Italy; 2 Dept. of Dermatology ,University of Padua, Italy; 3 Dept. of InternalMedicine, S. Gerardo Hospital, Monza, Italy; 4 Div. ofHematology, Niguarda Hospital, Milan, ItalyMastocytosis is a clonal disease characterizedby heterogeneous clinical presentationwhich may range from the indolentform (Urticaria pigmentosa) to forms withhematological (Mastocytosis with associatedhematological disorder) or systemic involvement(Systemic Mastocytosis). Activatingmutations of c-kit protooncogene (Asp816Val, Asp816Tyr, Asp820Gly) have beenidentified in patients with all forms of sporadicmastocytosis indicating a crucial rolefor c-kit in the physiological differentiationof mast cell lineage. We have subjected tomutation screening by DGGE and sequencing,CDGE or targeted restriction of amplifiedDNA 14 patients, ten with sporadic diseaseat different stages of evolution andfour familial cases with the cutaneous form.The prevalent mutation Asp 816Val hasbeen detected in skin lesions, bone marrowand peripheral blood from eight patients,all with the sporadic form. A mosaiccondition was apparent in all cases, althoughremarkable, modest or low expansionof the mutant clone allowed the mutationto be detected by sequencing, CDGEor only by the sensitive technique of digestionof amplified DNA with endonucleasesable to distinguish between the mutant andthe normal allele. Even by using this latterapproach no c-kit mutation could be detectedin both a three-years old patient andthe familial cases. Segregation analysis ofintragenic c-kit polymorphisms did not evidenceany haplotype sharing between affectedfamily members. A conclusion fromthis set of findings is that genetic mechanismsother than c-kit mutations are likelyinvolved in early-onset and familial mastocytosis.P079EFFECTS OF SYK KINASE ABLATIONON MODULATION OF G-CSF SIGNALTRANSDUCTION IN MYELOID CELLSB. SCAPPINI, V. SANTINI, A. GOZZINI, P. ROSSI FERRINIDivisione di Ematologia, Università di Firenze,Azienda Ospedaliera Careggi, FirenzeGranulocyte colony stimulating factor (G-CSF) is a potent inducer of proliferation andmaturation for myeloid progenitor cells. Wehave demonstrated that Shc, Syk and Lynkinases are independently tyrosine phosphorylatedafter G-CSF stimulation of 32Dmurine myeloid cells transfected with humanwild type (WT) G-CSF-R. Role of Syktyrosine kinase in granulocytic precursorgrowth and differentiation has not beencompletely clarified. We showed that tyrosines764 and 729 of G-CSF Rcytoplasmatic domain are crucial for activationof Shc and Syk, respectively. Weanalyzed the pattern of tyrosine phosphorylationof 32D myeloid cells WT/G-CSFtransfectantsand Y729F G-CSF-R mutants.We then analyzed and compared G-CSFphosphorylation activity in 32D/WT cellsincubated with stem-loop Syk antisenseoligodeoxynucleotides (ODNs) targeted toSyk mRNA (kindly provided by A.D.Schreiber). The stem-loop Syk antisenseODN with phosphorothioate modificationwas complexed with cationic liposomes,maintaining its stability. When conveyedinto cells at concentration of 0,2 µM, antiSyk ODN strongly abolished Syk proteinexpression. Antiphosphotyrosine immunoblotof lysates of 32D/WT cells treated with

37 th Congress of the Italian Society of Hematology115Syk antisense ODN and stimulated with G-CSF 100 ng/ml for 10 minutes showed aShc activation even in absence of Syk expression,confirming that its phosphorilationis indipendent of Syk kinase activity. Lynkinase was found also activated in the sameconditions, with no apparent modificationrespect to control untreated cells. On thecontrary, level of phosphorylated IP3Kseemed to be decreasing with ablation ofSyk. G-CSF induced 32D/WT cell proliferationwas not significantly modified in 729FG-CSF-R mutants and after anti Syk ODNtreatment, we thus concluded that Sykkynase in myeloid cells may play a role inevents other than proliferation.P080THE GENE ENCODING THE RINGFINGER-PROTEIN MID1 IS FREQUENTTARGET FOR RETROVIRAL INSERTIONCASBR-M INDUCED MURINELEUKEMIASM. LUNGHI*,M. JOOSTEN,Y. VANKAN, B. LOWENBERG,R. DELWEL, C. BERNASCONI**Institute of Hematology, University of Pavia, Pavia.Institute of Hematology, Erasmus UniversityRotterdam, The NetherlandsGenes involved in human acute myeloidleukemia have mainly been cloned fromchromosomal breakpoints. However, in asignificant proportion of cases no cytogeneticabnormalities have been found, suggestingthe presence of other mutations,e.g. microdeletions or point mutations,which are more difficult to identify. A powerfulalternative for the identification ofcancer genes is retroviral insertion mutagenesisin mice, using slow transformingretroviruses. Provirus may insert near or ina proto-oncogene causing aberrant expressionof this gene. If in multiple independenttumors proviruses are present in aparticular locus, this region is called a commonvirus integration site (cVIS) and marksthe position of a possible cancer gene. Examplesof cVISs, which are also affected inhuman malignancies, are Evi1, NF1 andHoxa7. In order to identify novel cVIS, apanel of 74 CasBR-M retrovirus induced leukemiaswas generated in NIH-Swiss mice.By means of inverse PCR and Southern blotanalysis on these tumors, we identified anovel cVIS in the midline 1 (Mid1) gene.Mid1 is located on the distal short arm ofthe X chromosome (Xp22.3) and is involvedin the human X-linked Opitz G/BBB syndrome,a defect of midline development. Itencodes a 667- amino acid RING-fingerprotein that belongs to a family of transcriptionalregulators, implicated in fundamentalprocesses such as body axis patterningand control of cell proliferation. Three genesof this family have oncogenic potential wheninvolved in chromosomal translocations,resulting in the fusion of their tripartite motif(RING finger, B-boxes and coiled coil domain)with other proteins: PML, RFP (retfinger gene) and the mouse Trf1 gene. Sequenceanalysis pointed out that the integrationsin Mid, present in 40% of our panelof tumors, were all located in the 3’UTR orin the 3'-end of the coding sequence. Preliminaryresults (Northern blot analysis)demonstrated overexpression of this genein a Moloney MuLV-induced myeloid cell line(DA33) with a VIS in Mid1. We are currentlyinvestigating Mid1 mRNA and protein levelsin the complete panel of leukemias includinghumans, the in vitro transfection.P081MOLECULAR CHARACTERIZATION OFTHE PIG-A GENE IN PATIENTSAFFECTED BY PAROXYSMALNOCTURNAL HEMOGLOBINURIAP. BIANCHI, E. FERMO, C. BOSCHETTI, F. BARRACO,D. MANSALVI, M. ZAPPA, C. VERCELLATI, A. ZANELLADivision of Hematology, IRCCS Ospedale Maggioreof Milan, ItalyParoxysmal nocturnal hemoglobinuria(PNH) is an acquired clonal stem cell disordercharacterized by the expansion of anhemopoietic cell clone unable to producethe glycosil-phosphatidyl inositol (GPI)anchor. The clinical symptoms are intravascularhemolysis and hemoglobinuria. Insome cases a relationship between aplasticanemia and PNH has been observed. Thegene involved in PNH (PIG-A gene) is localizedon chromosome X and is splitted in6 exons. A variety of mutations have beenso far reported. The aim of this study wasto investigate the molecular defect in 14PNH patients: 7 males and 7 females, medianage at diagnosis 34 yr (range 24 -48), 6 in aplastic and 8 in hemolytic phase.The diagnosis was made by Ham’s and su-

116 September 26-29, 1999 - Torino-Lingotto, Italycrose hemolysis tests and by red cell CD55and CD59 antigens determination. Thestudy of the entire codifying region andflanking intronic sequences of PIG-A genewas done by SSCP analysis and sequencingafter subcloning in a plasmidic vector.In all patients but three an abnormal electrophoreticpattern was detected by SSCP.The sequence performed in two of them revealedthe presence of two new mutationsconsisting in a 7 bp duplication at nt 604(TCCTGAA) founded in 5 out of 14 totalclones examined (patient PL), and in anucleotide deletion at position 342 (AGGTA- AGTA) detected in 3 out of 14 clone examined(patient SD). Both mutations determinethe creation of a stop codon atnucleotides 609 and 512 respectively.P082HETEROGENEITY OF A-MYBEXPRESSION AND IG SWITCHING INB-CLLM. INTRONA, V. FACCHINETTI, M. LAZZARI, S. BERNASCONI,T. B ARBUI, A. RAMBALDI, J. GOLAYIstituto Ricerche Farmacologiche Mario Negri,Milano and Division of Hematology, Ospedali Riuniti,BergamoA-myb is a proto-oncogene of the familyof myb transcription factors. It is expressedspecifically in the germinal center B cellsand is involved in the regulation of matureB cell differentiation. Furthermore it is regulatedduring the cell cycle. We had previouslyshown that amongst neoplastic humanB cells, A-myb is expressed specificallyin the Burkitt’s lymphoma and B-ALL(L3) cells which show a germinal centerphenotype. In addition, A-myb mRNA wasfound to be expressed at variable levels inabout 40% of CLL cases. This was particularlysurprising since CLL do not show agerminal center phenotype and are not proliferating.We have therefore studied 15cases of CLL in an attempt to understandthe basis for the heterogeneous expressionof A-myb in this class of B cell tumours. A-myb expression did not correlate with surfacephenotype (CD5, CD19, CD20, CD22,CD38, CD39, CD40 and CD71). Analysis ofimmunoglobulin transcripts in Northernblots and by PCR and of the state of Ig rearrangementsin Southern blots suggeststhat A-myb is expressed only in CLL cellswhose immunoglobulin genes have undergoneisotype switching. Finally we showthat the A-myb protein interacts withnucleolin and together with the latter ispresent in protein complex that binds toswitch region DNA. These data suggest thatA-myb may directly regulate the switchingprocess.P083CYTOGENETIC AND MOLECULARANALYSES IN NON-HODGKIN’SLYMPHOMAS (NHL)F. GHERLINZONI, N. TESTONI, B. GAMBERI, P.L. ZINZANI,M. TANI, M. MAGAGNOLI, E. MERLA, D. RUGGERI, C. CARBONI,G. FRATERNALI ORCIONI, E. SABATTINI, S. PILERI, S. TURAInstitute of Hematology and Medical Oncology“L. e A. Seràgnoli”, University of Bologna, ItalyIn the last years, an increasingly amountof biological data concerning NHL has beenaccumulated. The recognition of cytogeneticand/or molecular abnormalities providedwith a significant prognostic value may havea direct clinical impact, contributing to identifycategories of patients (pts) at differentrisk, for whom specific individualized treatmentscan be planned (“tailored therapy”).Cytogenetic and molecular analyses couldalso lead to better define the pathogeneticmechanisms related to neoplastictranformation, as proto-oncogene deregulation,oncosuppressor gene inactivation, orincreased expression of telomerase activity,and may play an important role in termsof monitoring of minimal residual disease.In January 1997 we started a researchproject, with the aim of evaluating severalcytogenetic and molecular parameters concerningNHL. Our first intent was to founda NHL bank: a fraction of any pathologicalspecimen (lymph-node, spleen, bone marrow)sent to our laboratories is immediatelycultured for cytogenetic analysis, accordingto standard methods, while the remainingis frozen in liquid nitrogen for the extractionsof nucleic acids and proteins forsubsequent analysis by PCR, RT-PCR, SSCP,Southern, Northern and Western hybridization.If necessary, FISH analysis is applied.Normal cells and serum of the pts are frozenas well. For each pt, a computerizedform is filled in, including name, age sexcode numbers, histological subtype, site ofbiopsy, stage, cytogenetic and molecular

37 th Congress of the Italian Society of Hematology117patterns, type of therapy, response to therapyand follow-up date. Uptoday 74 NHL specimenshave been collected and examined. Resultsof their analysis will be presented.Progetto realizzato grazie ai fondi raccolti conTrenta Ore per la Vita 1996P084MOLECULAR PROFILE OF EPSTEIN-BARR VIRUS (EBV) INFECTION INHHV-8 POSITIVE PRIMARY EFFUSIONLYMPHOMAL. FASSONE 1 , A. GLOGHINI 2 , M. GUTIERREZ 3 , K. BHATIA 3 ,R. DOLCETTI 4 , D. CAPELLO 1 , D. VIVENZA 1 , V. ASCOLI 5 ,F. LO COCO 6 , L. PAGANI 7 , G. DOTTI 8 , A. RAMBALDI 8 ,U. TIRELLI 9 , G. SAGLIO 10 , A. CARBONE 2 , G. GAIDANO 11Division of Internal Medicine, Department ofMedical Sciences, Amedeo Avogadro University ofEastern Piedmont, Novara; Divisions of 2 Pathology,4Experimental Oncology A and 9 Medical Oncology,CRO, INT, Aviano; Divisions of 5 Pathology and6Hematology, La Sapienza University, Rome; 7 U.O.Infectious Diseases, A.O. of Piacenza; 8 Division ofHematology, Ospedali Riuniti, Bergamo; 10 Divisionof Internal Medicine and Hematology, Departmentof Medical and Biological Sciences, University ofTorino, Orbassano, Italy; 3 Lymphoma BiologySection, NCI-NIH, Bethesda, MD, USAPrimary effusion lymphoma (PEL) is a B-cell lymphoma occurring predominantly inimmunocompromised patients and presentingas effusion in the serous cavities of thebody. HHV-8 infection of the tumour cloneis a sine qua non for the diagnosis of thedisease and the pathogenetic role of HHV-8 is suggested by expression of a subset ofviral genes in tumor cells. In addition toHHV-8, most PEL display coinfection of thetumor clone by EBV, although the contributionof the virus to disease pathogenesis isuncertain. Infact, the pattern of EBV geneexpression in PEL is restricted to EBNA-1, agene required for episomal replication,whereas the EBV transforming genes LMP-1 and EBNA-2 are not expressed. Previousworks suggested that EBV + lymphomasexpressing only EBNA-1 preferentially associatewith sequence variations at the C-terminal domain of the gene, supportingthe hypothesis that mutated EBNA-1 variantsmay contribute significantly to tumordevelopment. Here we defined the molecularfeatures of EBV in a well characterizedpanel of PEL (n=15), including AIDSrelatedPEL (n=12), post-transplant PEL(n=1) and PEL arising in apparently immunocompetentpatients (n=2). As a control,we studied EBV + peripheral blood mononuclearcells (PBMNC) obtained from HIVinfectedindividuals (n=12) without lymphoma.The genotypic pattern of EBNA-1and LMP-1 was investigated by PCR andDNA direct sequencing. EBV type-1 and -2was defined by PCR analysis of EBNA-2 andEBNA-3C genes. Analysis of the C-terminalbinding/dimerization domain of EBNA-1showed a marked degree of sequence heterogeneityboth in PEL and in PBMNC fromHIV + individuals without lymphoma, withno association between specific EBNA-1variants and PEL samples. The determinationof LMP-1 deletion status revealed thepresence of the ∆30LMP-1 gene in 5/15(33%) PEL, while a wild type LMP-1 genewas detected in 10/15 (67%) samples.Based on PCR analysis of EBNA-2 and EBNA-3C, EBV type-1 infection occurred in 11/15(73%) PEL, while EBV type-2 was harboredby 4/15 (27%) samples. These results indicatethat the distribution of EBV variantsdetected in PEL reflects the molecular profileof the virus found in the control population.Therefore, collectively these dataargue against a pathogenetic role of EBV inPEL development.P085AIDS-RELATED PRIMARY CENTRALNERVOUS SYSTEM LYMPHOMASASSOCIATE WITH THE ONCOGENIC∆69LMP-1 VARIANT OF EPSTEIN-BARRVIRUS (EBV)L. FASSONE 1 , A. ANTINORI 2 , P. ORESTE 3 , A. CINGOLANI 4 ,A. GLOGHINI 5 , D. CAPELLO 1 , D. VIVENZA 1 , G. MIGLIARETTI 6 ,M. GUTIERREZ 7 , K. BHATIA 7 , G. SAGLIO 8 , A. CARBONE 5 ,L. M. LAROCCA 9 , G. GAIDANO 1Divisions of 1 Internal Medicine and of 6 Epidemiology,Department of Medical Sciences, Amedeo AvogadroUniversity of Eastern Piedmont, Novara; 2 Division ofInfectious Diseases, INRCCS-Spallanzani, Rome;3Division of Pathology, Ospedale Niguarda Ca’Grande, Milano; Institutes of 4 Infectious Diseases andof 9 Pathology, Catholic University of the SacredHeart, Rome; 5 Division of Pathology, CRO, INT,Aviano; 8 Div. of Internal Medicine and Hematology,University of Torino, Orbassano, Italy; 7 LymphomaBiology Section, NCI-NIH, Bethesda, MD, USAAIDS-related primary central nervous sys-

118 September 26-29, 1999 - Torino-Lingotto, Italytem lymphomas (AIDS-PCNSL) representa major complication of HIV infection andare consistently infected by EBV. Based onthe expression of the EBV-encoded latentmembrane protein-1 (LMP-1) and of thecellular proteins BCL-6 and BCL-2, AIDS-PCNSL may be segregated into distinct phenotypiccategories (LMP-1 + /BCL-2 + /BCL-6 –and LMP-1 – /BCL-2 – /BCL-6 + ) which havebeen suggested to bear clinical relevance.Here, we aimed at characterizing the molecularheterogeneity of EBV infection inAIDS-PCNSL and at defining its relationshipwith the phenotypic variability of thedisease. Forty-six AIDS-PCNSL were includedin the study. The LMP-1 molecularvariant and EBNA-1 hypervariability weredefined by DNA sequencing. Definition ofEBV type-1/type-2 was performed by PCRanalysis. Expression of LMP-1, BCL-2 andBCL-6 was assessed by immunohistochemistry(IHC). A single form of EBV was detectedin 40/44 AIDS-PCNSL based on conventionaltyping. A 69 bp deletion in theLMP-1 C-terminus (∆69LMP-1) occurred athigher frequency in AIDS-PCNSL (7/44;15.9%) than systemic AIDS-NHL (1/33;p

37 th Congress of the Italian Society of Hematology119tations (58% vs 22%, p=0.09). Conclusions:this study suggests that the analysisof BCL6 mutations may provide a furtherrefinement of prognosis in pts with diffuseB-DLCL. Additional studies, with ahigher number of pts, are needed to betterdefine the prognostic role of this geneticlesion.P087DISTRIBUTION AND PATTERN OF BCL-65’ MUTATIONS THROUGHOUT THESPECTRUM OF B-CELL NEOPLASIAD. CAPELLO, 1 U. VITOLO, 2 G. MIGLIARETTI, 3 C. ARIATTI, 1A. GLOGHINI, 4 C. LANZA, 5 J.N. NOMDEDEU, 6 D. VIVENZA, 1L. FASSONE, 1 B. BOTTO, 2 R. FREILONE, 2 V. Z AGONEL, 4G. PALESTRO, 7 G. SAGLIO, 8 A. CARBONE, 4 G. GAIDANO 11Divisions of Internal Medicine and 3 Epidemiology,Department of Medical Sciences, A. AvogadroUniversity of Eastern Piedmont, Novara; 2 Division ofHematology, A.O. S. Giovanni Battista, Torino;4C.R.O. - I.N.T., Aviano; 5 Department of PediatricSciences and Adolescence, 7 DSBOU and 8 Departmentof Clinical and Biological Sciences, Universityof Torino, Torino, Italy; 6 Hematology, HSCSP,Barcelona, SpainGenetic alterations of BCL-6 include grossrearrangements and mutations of the 5’region of the gene. Mutations of BCL-6 areacquired during B-cell transit through thegerminal center (GC), thus representing ahistogenetic marker of GC or post-GC derivationof a given B-cell. In order to definethe distribution of BCL-6 mutations in B-cell neoplasia, and in particular among diffuselarge cell lymphoma (DLCL) subtypes,a panel of 302 B-cell tumors representativeof the REAL classification was subjectedto mutational analysis of BCL-6. Mutationswere absent or rare in tumors of precursorand virgin B-cells, namely acute lymphoblasticleukemia (n=46; p

120 September 26-29, 1999 - Torino-Lingotto, ItalyP088COMMON VARIABLEIMMUNODEFICIENCY (CVI)-RELATEDLYMPHOMAS ASSOCIATE WITHMUTATIONS AND REARRANGEMENTSOF BCL-6: PATHOGENETIC ANDHISTOGENETIC IMPLICATIONSC. ARIATTI, 1 D. VIVENZA, 1 A. MIGLIAZZA, 2 D. CAPELLO, 1G. PARVIS, 3 F. SAVINELLI, 1 L. FASSONE, 1 G. SAGLIO, 3G. GAIDANO 11Division of Internal Medicine, Department ofMedical Sciences, Amedeo Avogadro University ofEastern Piedmont, Novara; 2 Division of Oncology,Department of Pathology, Columbia University, NewYork, NY 10032; 3 Division of Internal Medicine andHematology, Department of Clinical and BiologicalSciences, University of Torino, OrbassanoCVI is the most common symptomaticprimary antibody deficiency syndrome. Patientsaffected by CVI frequently developnon-Hodgkin lymphomas (NHL) with a relativerisk approximating 400. CVI-relatedNHL are represented in virtually all casesby B-lineage diffuse large cell lymphomas(DLCL) which frequently involve extranodalsites and display an aggressive clinical behavior.The molecular pathogenesis of CVIrelatedNHL (CVI-NHL) is unknown. BecauseCVI-related DLCL (CVI-DLCL) clinically andhistologically mimick DLCL arising in otherimmunodeficiency settings, we postulatedthat similar molecular pathways may beshared by CVI-NHL, AIDS-related NHL andposttransplant-related NHL. One such molecularpathway may be represented bygenetic alterations of the BCL-6 protooncogene,which associate with a significantfraction of AIDS-related andposttransplant-related DLCL. Here we aimedat providing a detailed molecular characterizationof CVI-NHL. All cases investigated(n=3) were represented by B-lineage DLCLwhich had developed after a median intervalof 14 years after CVI diagnosis. Rearrangementsof BCL-6 were detected in 2/3cases examined. All three CVI-DLCL alsoharbored point mutations of the BCL-6 5'noncoding regions. The number and molecularpattern of BCL-6 mutations in CVI-DLCL were similar to that detected in DLCLof immunocompetent hosts as well as DLCLarising in other immunodeficiency settings.Microsatellite instability (MSI) occured inone CVI-DLCL devoid of BCL-6 alterations.All CVI-DLCL analyzed scored negative forgenetic lesions of BCL-2, p53, c-MYC, RELas well as for viral infection by EBV andHHV-8. These results bear pathogenetic andhistogenetic implications for CVI-DLCL development.With respect to pathogenesis,the association of BCL-6 rearrangementswith CVI-DLCL suggests that BCL-6 lesionsare a common molecular pathway of immunodeficiency-relatedlymphomas, independentof the precise immunodeficiencysetting. The association with lesions of BCL-6, but not of BCL-2 and p53, suggests thatCVI-DLCL mimick the “de novo” molecularpathway of DLCL (BCL-6 rearrangements)as opposed to the pathway of “transformed”DLCL (BCL-2 + p53 lesions). These dataalso clarify CVI-DLCL histogenesis. Sincemutations of BCL-6 are acquired duringnormal B-cell transit through the germinalcenter (GC), the association of BCL-6 mutationswith CVI-DLCL suggests that theselymphomas are histogenetically related togerminal center B-cells. In addition, thefinding of BCL-6 mutations in CVI-DLCLsheds light on the immunobiology of CVI,demonstrating that this immunodeficiencyis permissive for a major molecular mechanismnormally active in the GC.P089EVALUATION OF “MTS1” GENEDELETION, A CYCLIN-DEPENDENTKINASE INHIBITOR, IN NHLV. MEDICI, F. GIACOBBI, G. BONACORSI, G. VINCI,M. COSENZA, P. TEMPERANIDepart.Medical Sciences-Internal Medicine andHematology Section, University of ModenaData on molecular processes, which regulateand control cell cycle progression, haveled to the identification of three majorgroups of proteins. The first two, cyclins andcyclin-dependent kinases (CDK), are consideredto be positive regulators of the cellcycle. The family of the cyclin-dependentkinase inhibitors (CDKi), more recently discovered,are able to interact physically withcyclins and CDKs, inhibiting the formationand the stability of the cyclin-CDK complexesand thus the progression of the cellcycle. One of these inhibitors, the p16 protein,is encoded by the CDKN2 gene, renamedMTS1 (multiple tumor suppressor1), which maps on chromosome 9, band

37 th Congress of the Italian Society of Hematology121p21-22. This protein is able to bind cyclindependentkinase CDK4 and CDK6, therebyinhibiting the formation of the cyclinD/CDK4-6 complexes, which are crucial to theG1/S transition. Inactivation, loss ofheterozigosity and deletion of MTS1 hasbeen found in many solid tumors. To evaluatethe deletion of the MTS1 locus in non-Hodgkin’s lymphomas (NHLs), we selected38 lymphomatous cell populations with differentgrades of malignancy and abnormalkaryotype, 16 of which showed numericaland structural rearrangements of chromosome9. For this molecular cytogeneticstudy we utilized: a) YAC clone 760C6, representativeof the entire MTS1 sequence(G.C.C.,19,273,1997); b) YAC clone 874C7,approximatly 10 Mb up-stream from the760C6; c) probe D9Z1 (Oncor Appligene).FISH analysis of YAC 760C6 detected bothheterozigous and homozigous deletions ofthe MTS1 gene in lymphomatous cells withdifferent 9p rearrangements as well as normalchromosome 9 by conventional cytogenetic.P090SINGLE CELL PCR TECHNIQUE ANDIMMUNOHISTOCHEMISTRYDEMONSTRATE HUMAN HERPESVIRUS-6 (HHV-6) INFECTION OF REED-STERNBERG CELLS IN HODGKIN’SDISEASEP. BAROZZI, M. LUPPI, R. TROVATO, R. MARASCA,*R. GARBER, °A. MAIORANA, G. BONACCORSI, K. CAGOSSI,M. MORSELLI, P. ZUCCHINI, G. TORELLIDepartment of Medical Sciences, Section of Hematologyand °Department of Pathology, Modena,Italy. *PathoGenesis Corporation, Seattle, U.S.A.We studied the expression of HHV-6 antigensof the early (p41) and late (p101K,gp106, gp116) phases of viral cycle in 15non-Hodgkin’s lymphomas, 14 Hodgkin’sdisease (HD) cases, 5 angioimmunoblasticlymphadenopathies, 14 reactive lymphadenopathies,and 2 cases of Rosai Dorfman(RD) disease. In lymphomatous tissues, theexpression of late antigens was documentedonly in reactive cells. Of note, the expressionof the early p41 antigen was detectedin the so-called “mummified” Reed-Sternberg(R-S) cells, in two HD cases showingsuch a high copy number of viral sequencesto be detectable by Southern blot analysis.Single cell PCR technique showed HHV-6DNA also in isolated, viable R-S cells. BothHD patients were female, 27 and 28 yr oldrespectively, and the histologic type wasnodular sclerosis/lymphocyte depleted. Ofinterest, both cases were Epstein-Barr(EBV) negative as assessed by in situ forEBER transcript and immunohistochemistryfor latent membrane protein 1 expression.In reactive lymphadenopathies, theHHV-6 late antigen expressing cells wereplasma cells, histiocytes and granulocytes,in interfollicular areas. In both cases of RDdisease the p101K showed an intense stainingin follicular dendritic cells of germinalcenters, while the gp106 exhibited an intensecytoplasmic reaction in the abnormalhistiocytes, which represent the histologichallmark of the disease. The expression ofHHV-6 antigens is tightly controlled in lymphoidtissues in vivo, but the detection of aunique pattern of viral late antigen expressionin RD disease suggests a possiblepathogenetic involvement of HHV-6 in somecases of this rare disorder. We provide thefirst in vivo evidence of HHV-6 tropism forR-S cells in EBV negative HD disease inyoung adults.P091RETROVIRAL-MEDIATED GENETRANSFER TO HUMAN CORD BLOODSTEM CELLS WITH IN VIVOREPOPULATING POTENTIALF. S ANAVIO, M.T. SCIURPI, L. LANFRANCONE, P.G. PELICCI,M. AGLIETTA, W. PIACIBELLODept. of Biomedical Sciences and Human Oncology,IRCC Institute for Cancer Research, Torino UniversityMedical School, and European Institute ofOncology, MilanoTransduction of pluripotent hematopoieticstem cells using recombinant retrovirusesforms the basis of most current strategiesfor the correction of single gene defects.The availability of a rapid selectable marker,such as the Green Fluorescent Protein (GFP)is thought to be of great importance to studymajor variables influencing the efficiencyof gene transfer as well as to track the progenyof transduced cells. In the present studya retroviral expression vector (PINCO) thatallows high efficiency transfer and selectionof hematopoietic progenitor cells has

122 September 26-29, 1999 - Torino-Lingotto, Italybeen used to infect CD34+ cord blood cellsrecruited to proliferate and self-renew in astroma-free suspension culture in the presenceof FLT3 ligand (FL), Thrombopoietin(TPO), Stem Cell Factor (SCF) andInterleukin 6 (IL6). Starting from a MoloneyML-Retroviral vector, a GFP-EBV/Retroviralvector has been generated which expressesthe GFP as selectable marker (under thecontrol of the CMV promoter) and incorporatesa nuclear replication and retention ofthe EBV for episomal replication. CD34+cells were separated from several cord bloodsamples and then pooled, to overcome differencesbetween samples. Cells werepreincubated in a stroma-free liquid culturefor as little as a few hours up to severalweeks. Gene transfer procedure was carriedout by using viral containing supernatantsproduced by the Phoenix amphotropicpackaging cell line. CD34+ cells were efficientlytransduced; trasduction efficiencywas dependent upon the presence of serum,duration of prestimulation of the cellsand conditions of exposure to viral supernatants.30 to 50% of the colonies generatedby the CD34+ cells were fluorescent.GFP-expressing cells were also detected inthe (Long Term Culture- Initiating Cells)LTC-IC assay after 5 to 6 weeks of cocultureon irradiated stroma layers. During thetransduction procedure the absolute numbersof LTC-IC increased more than 10-foldand the number of CFU-GM+BFU-E+CFU-Mk increased more than 50-fold. Bone marrowcells of NOD/SCID mice which weretransplanted with CD34+ cells after transfectionprocedures did contain variable percentagesof human cells (4 to 20%), a goodpercentage of which were positive.P092T-LYMPHOCYTE FUNCTION AFTERRETROVIRAL MEDIATED THYMIDINEKINASE GENE TRANSFER AND G418SELECTIONS. DI FLORIO, M. DI IANNI, G. VENDITTI, L. OLIVIERI,A. TABILIOHaematology and Clinical Immunology Section,Department of Clinical and Experimental Medicine,Perugia University, Perugia, ItalyGeneration of an efficient Graft-versus-Leukemia effect (GvL) in patients withhaematological malignancies who relapseafter allogeneic bone marrow transplantation,depends in part on the number of infusedT-lymphocytes. At present GvL cannotbe achieved without inducing concomitantGraft versus Host Disease (GvHD), thusone strategy is to try to modulate this GvL/GvHD ratio. We engineered human T-lymphocyteswith herpes virus thymidine kinase(HSV-tk) and neomycine resistancegenes (Neo), using an LXSN-derived vectorwhich confers a ganciclovir-specific sensitivityto the transduced T-cells. Ten transductionprocedures were performed usinglymphocytaphereses products obtainedfrom healthy donors. We used 2 differenttechniques: standard cell-free supernatantinfection and co-cultivation. Transductionefficiency was evaluated by semiquantitativePCR. We analysed immunophenotiping, proliferation,Interleukin 2 (IL-2) production,alloreactivity in a mixed lymphocyte cultureand clonogenicity during the different stagesof retroviral infection and selection. 7 daysselection with 0.6 mg/mL G418 resulted ina cell population which was inhibited by gvctreatment (10 days Gcv 1µg/ml). The percentageof infected cells increased from 1-5% before selection to over 90% after G418selection when viral supernatant infectionwas used, and from 30-40% to over 90%in the co-cultivation experiments. HSV-tktransduction and G418 selection did notchange the lymphocyte phenotype. Trivialdifferences emerged between controls andinfected populations at all timepoints demonstratingthat retroviral infection has minimaleffects on lymphocyte subset composition.The transduced selected lymphocytesexpressed CD3 in 86.9 to 94%, CD4 in 54to 83.6%, CD8 in 45 to 62%, HLA-DR in55.5 to 86.7% of cells. The expression ofCD16 + ranged from 4.3 to 4.7% and CD19 +from 0.6 to 3.2%. We demonstrated thattransduced/selected populations, thoughless responsive to IL-2 than control cells,retained their proliferative activity,alloresponsiveness, ability to produce andrespond to IL-2. Compared with controlpopulations, their clonogenicity, as assessedby Limiting Dilution Assays (LDA) was reducedafter retroviral infection and G418selection by 1.6 and 2.9 logs respectivelywith both viral supernatant incubation andcoculture procedures. These results showT-lymphocytes can be transduced on a largescale using tk-Neo vector. However retroviralvector infection and G418 selection significantlyreduce T-lymphocyte clonogenicityas defined by Limiting Dilution Analy-

37 th Congress of the Italian Society of Hematology123sis (LDA). Since this assay is a very sensitivemethod for detecting and quantifyingfunctional T-lymphocytes, our results couldhave important implications for defining thenumber of engineered T-lymphocytes requiredto generate an efficient GvL.P0935-AZACYTIDINE AND PREVENTION OFPROVIRAL DNA HYPERMETHYLATION:IMPLICATION FOR GENE THERAPYM. DI IANNI, G. VENDITTI, S. DI FLORIO, A. TERENZI,A. TABILIOHaematology and Clinical Immunology Section,Department of Clinical and Experimental Medicine,Perugia University, Perugia, ItalyRetroviral vectors efficiently insert exogenousgenes into a wide range of humancells and have been extensively studied inan attempt to develop gene therapy protocols.Although gene transfer is generallysuccessful, high level, long-term expressionin primary cells is problematic. One of themajor drawbacks is in vitro and in vivo inhibitionof transgene expression because ofDNA methylation. The DNA demethylatingagent 5' azacytidine (aza-C) is reported toreactivate transgene expression (Hoeben etal., J. Virol. 65:904, 1991). We used abicistronic retroviral vector to transduce theU937 human cell line. Through an InternalRibosome Entry Site (IRES) sequence thevector co-transfers the Herpes Simplex Virustype 1 thymidine kinase gene (HSV-tk),which induces sensitivity to ganciclovir(gcv), and a marker gene, the bacterialbeta-galactosidase gene (lacZ). The cloneused for further studies (VB71) was 90%lacZ+ and ganciclovir sensitive. Tumourswere induced in SCID mice by intraperitonealinjection of VB71 cells (3x10 6 ). GroupI (controls) was injected with 3x10 6 cells;group II with cells followed by 5’aza-C (2mg/Kg every 48 hr until tumour onset);group III cells followed by gcv (10 mg/Kgfrom day + 1 after VB71 injection and prolongeduntil the onset of tumour); groupIV cells + aza-C as in group II + gcv as ingroup III. Long-term analysis of lacZ geneexpression in the VB71 clone showed thepercentage of lacZ positive cells remainedstable for 1 month and then fell significantlyto about 2% after 2 months culture. Treatmentof the population containing 2% oflacZ positive cells with aza-C for 3 daysraised the percentage of lacZ positive cellsto baseline values. LacZ positive cells in thetumour masses after sacrifice was weak (1-2%) in control group, while in mice treatedwith aza-C was mantained at 90%. Thedelay in tumour onset was significanlylonger when animals were treated with bothaza-C and gcv (p

124 September 26-29, 1999 - Torino-Lingotto, Italysignificant effect was observed onuntransduced populations. No differenceswere seen in terms of immunophenotypingin the different lymphocytes subpopulations.Using the standard supernatant infection,the rate of infection was extremelylow (< 5%). After adding the centrifugationstep or performing supernatant infectionon fibronectin fragments coated wells,PCR analysis showed a 30-40 % rate oftransduced cells. After infection by co-cultivationthe rate of transduced cells was 30-40%. PCR analysis after G418 selection inall 4 different infection protocols showed a95-100% of transduced cells. These resultsdemonstrate centrifugation and fibronectinbased protocols provide equivalent rates oftransduced cells. Co-cultivation, even ifequally efficient in terms of infection rates,seems be more toxic for transduced cells.Furthermore lack of reproducibility andsafety makes co-cultivation unsuitable forclinical studies. In conclusion, we suggestthe centrifugation-based protocol is, whenlarge quantities of T lymphocytes are beingprocessed, easier to perform than thefibronectin-based protocols.P095EFFICIENT EX-VIVOIMMUNOSELECTION OF ∆LNGFR-TRANSDUCED MOBILIZED CD34+ CELLSS. DEOLA, M. BREGNI, F. FICARA, J. DANDO, C. BORDIGNON,A. AIUTITelethon Institute for Gene Therapy (TIGET), andBone Marrow Transplantation Unit, IstitutoScientifico H. San Raffaele, Milano, ItalyGene marking represents a unique modelto study the biology of transplantation, andto predict the feasibility of hematopoieticgene therapy approaches for genetic andmalignant diseases. Problems related to thisstrategy are low transduction rate of CD34+cells, host immune response to thetransgene, and the competition byunmanipulated CD34+ cells infused togetherwith marked cells to ensure hematopoieticrecovery. We have designed a genemarking protocol in patients undergoingautografting after high-dose chemotherapyfor solid tumors. In this study, mobilizedCD34+ cells will be transduced with aretroviral vector encoding for the truncatedform of the human low-affinity receptor fornerve growth factor (∆LNGFR), which isexpressed on the cell surface of transducedcells, and then ∆LNGFR+ cells will be selectedfor transgene expression. Reinfusionof marked CD34+ cells as the prevalentsource of hematopoietic cells should avoidcompetition by unmanipulated cells, andallow to study the short- and long-termreconstitution and the differentiation potentialof transduced CD34+ cells. For thispurpose, we transduced mobilized CD34+cells in the presence of retronectin andcytokines (TPO, Flt3-ligand and SCF at 50ng/ml), and evaluated by indirect flowcytometry the expression of the markergene over time, in order to decide the optimaltiming for selection of transduced cells.∆LNGFR+ cells were purified by a MINIMACSMultisort immunoselection device, using abiotinylated anti-NGFR antibody andstreptavidin-conjugated microbeads. In preliminaryexperiments, we observed7.7+0.45% and 14.4+0.75% recovery(mean+SD) of NGFR+/CD34+ cells at 24and 48 hours, respectively, thus we choseto select transduced cells at 48 hours. Resultsare as reported in the TablePOST-POST -∆LNGFRINPUT TRANSDUCTION IMMUNOSELECTIONCD34+ CD34+ NGFR+/ CD34+ NGFR+ NGFR+/CD34+CD34+PERCENT 91+8.5 80.6+3.0 17.0+3.2 71.5+15.1 87.0+10.5 92.2+7.4YIELD 100 142.1 24.0 15.5 18.6 14.3The immunoselection 48 hours post-transductionimproved NGFR+/CD34+ cell purityfrom 17.0% to 92.2%, with a final yieldof 59.5% of transduced CD34+ cells. TheMINIMACS immunoselection system offersthe possibility to scale up the procedure ina clinical setting.P096EVALUATION OF EXPRESSION ANDPHOSPHORYLATION STATUS OF SHCADAPTOR PROTEINS AND ERK-JNKMAP KINASES IN EX VIVO EXPANDEDHEMATOPOIETIC STEM CELLSL. GAMMAITONI, S. PINELLI, P. LUNGHI, A. ALBERTINI,M. GUNETTI, W. PIACIBELLO, A. BONATI, M. AGLIETTADept of Biomedical Sciences and Human Oncology,Hematology/Oncology Section, University of Torinoand IRCC Candiolo, Italy; Institute of MedicalPathology, University of Parma, ItalyAim of our studies was to obtain useful

37 th Congress of the Italian Society of Hematology125information for better understanding therole of Shc adaptor proteins and ERK-JNKMAP kinases in human cord blood hematopoieticself-renewing stem cells. The idealmodel could be represented by CD34 + CBcells which are induced to expand in thepresence of FL and TPO, and CD34 + CB cellswhich are induced to differentiate after IL3addition. Shc adptor proteins showed anhigh phosphorylation status in the expandedCD34 + CB cells, before and afterIL3 addition. In particular, the levels ofp66Shc isoform expression and phosphorylationin the expanded CD34 + CB cellsafter IL3-induced differentiation significantlyincreased, suggesting that thisisoform could play a specific role in themechanisms of stem cell differentiation.Conversely, p46/p52Shc isoforms couldhave the prevalent function to transmit signalsthat stimulate the expansion of the selfrenewingpool of CD34 + CB cells, under thenegative control of p66Shc. Both p42/p44ERK isoforms resulted strongly activatedin the CD34 - CB cells after IL3 addition.Phosphorylation levels of p42ERK wereabout twofold higher in the CD34 + CB cellsbefore IL3 addition than in the CD34 + CBcells after IL3-induced differentiation. Thesedata support an important activity of ERKin the mechanisms of stem cell differentiation.JNK MAP kinases showed an high phosphorylationstatus in the CD34 + CB cells inbasal condition, after expansion with FL andTPO, and after IL3-induced differentiation.These data suggest that JNK may participatein the mechanisms that regulate hematopoieticstem cell proliferation anddifferentiation.To conclude, we found thatsurvival, self-renewal and differentiation ofhematopoietic stem cells are regulated bya network of signaling proteins. The differentphases of hematopoiesis are regulatedby subtle balance of the expression levelsand the activity of the different adaptorproteins and kinases and of their isoforms.P097INVOLVEMENT OF H-NUC GENE INPOLIPLOIDIZATION OFMEGAKARYOCYTESG. CAVALLONI, E. ALLIA, A. DANÈ, M. SIRENO, E. LAMAS,W. PIACIBELLO, C. BRÉCHOT, M. AGLIETTADept of Biomedical Sciences and Human Oncology,Hematology/Oncology Section, University of Torinoand IRCC Candiolo, Italy; University of Paris,Necker Enfants-malades, FranceTerminal differentiation of megakaryocytesis characterized by cell size growth,increase of ploidy and generation of specificproteins such as platelet factor 4, β-thromboglobulin, CD41, CD42, CD61. It hasbeen shown that endomitosis is a majorcause of megakaryocyte polyploidization,although the underlying mechanism islargely unknown. Based on recent datashowing the involvement of nuc2 and Tg737genes on yeast and hepatocyte polyploidcell formation, we used human leukaemiccell lines K562 to investigate the role of h-nuc in late stage of megakaryocytic differentiationincluding polyploidization andfunctional maturation. In this study twodifferent types of pharmacologic modulatorsof the cell cycle, nocodazole and TPA,were used to investigate the mechanism ofmegakaryocytic differentiation. K562 cellswere seeded in the absence or presence ofeither nocodazole or TPA and flow cytometryanalysis was performed to measure DNAcontent and the expression of CD41 as specificmarker for megakaryocytic differentiation;in addition total RNA was isolated andsubjected to Northern blot analysis for nuc2mRNA expression. Results deriving fromthese experiments show that treatment withmicrotubule depolymerizing agent,nocodazole, preferentially inducespolyploidization of K562 cells with a relativelysmall increase in CD41 marker. About80% of the cells after 24 hours of treatmentbecome 4N. TPA also had a similareffect on cells, but it was much weaker thanthat nocodazole; the percentage of polyploidcells was maximal between 3 to 5 days,with about 20%. In contrast TPA provokeda dramatic increase in CD41 expression.These results raise the idea that two distinctprocesses of the late stage of megakaryocyticdifferentiation, polyploidizationand cytoplasmic maturation, may occur independently,although they must be inter-

126 September 26-29, 1999 - Torino-Lingotto, Italyrelated. Preliminary data obtained fromNorthern blot analysis indicated that therewas a low increase of nuc2 mRNA expressionafter 24 hours of treatment withnocodazole and after 48 hours of treatmentwith TPA.P098SSP-PCR HLA-DR AND HLA-A “LOWRESOLUTION” IN THE EVALUATION OFCONTAMINATION BY MATERNALDECIDUA IN PRENATAL DIAGNOSISP. RANIERI, A. PALMA, D. CAMPANALE, G. DELIOS, N.TANNOIAChair of Hematology II – University of BariPossibility of contamination by maternalcells in the CVS prenatal diagnosis has beendescribed. That could be caused by physicians’unskilfulness in drawing or in separatingfetal material. The contamination ofcells with maternal chromosome set couldhave serious consequences for the diagnosis.To solve this problem new laboratorymethods have been used to detect contaminationof maternal cells in fetal tissues obtained.To data different methods of molecularbiology have been used to examinepolimorfic regions in the DNA among themIgJH (chromosome 14), Apo–B (chromosome2), D1S80 (chromosome 1) andothers.Setting up a sensible, specific, informative,simple and cheaper method hasbeen our objective. We consider the molecularanalysis of regions with great polymorphismsuch as HLA genes II class(DRB1) and I class (A) in the prenatal diagnosisa particularly valid method. Chorialvillus have been drawed at 11 st week ofpregnancy during prenatal diagnosis of ßthalassemia. Contamination of fetal DNAwith maternal DNA at 0.5%, 1 %, 3%, 5%have been set up to evaluate the sensibilityof the method. The allelic characterizationof the family nucleus and of the contaminationshave been realized by amplificationof DNA by SSP-PCR (Dynal kit)method, using kits HLA-DRB1 “low resolution”and HLA-A “low resolution”. Tensamples of fetal DNA have been examinatedbefore and after simulation of contamination.For our results the methods is not sensiblefor a contamination of 0.5%. The patternof maternal bands begins slightly evidentfor a contamination of 1%, but it isnot diagnostic. Tha maternal HLA patternis undetectable from fetal one for contaminationsof 3% and 5%. To conclude, theHLA molecular study is a sensible, specific,fast (about 3 hours) and useful method inthe prenatal diagnosis of genetic deseases.P099PCR-DETECTION OF RESIDUALMYELOMA CELLS AFTER POSITIVESELECTION OF CD34+ CELLS WITHMILTENYI IMMUNOMAGNETIC CELLSORTING SYSTEM*C. VOENA, *E. ZAPPONE, C. CASTELLINO, * M. SALOMONI,*L. FARINA, P. OMEDÈ, M. BOCCADORO, A. PILERI,*P. CORRADINI*Unità Trapianto di Midollo Osseo, IstitutoScientifico H.S. Raffaele, Milano; DivisioneUniversitaria di Ematologia; Az. OspedalieraSan Giovanni Battista - Torino, ItalyHigh-dose (HD) chemotherapy followed byautologous transplantation of hematopoieticcells is increasingly used for the treatmentof multiple myeloma (MM). We andothers have already demonstrated thatautologous grafts are virtually always contaminatedby residual myeloma cells. Inorder to reduce tumor cell contamination,several in vitro purging strategies have beendeveloped. In this study, we have evaluatedthe efficacy of the Miltenyi cell separationsystem both on small and large scaleexperiments. The Miltenyi MiniMACS hasbeen used to test 14 peripheral blood progenitorcell (PBPC) harvests from 6 patientswith MM. PBPC were collected after cyclophosphamide7g/sm followed by G-CSF 5mcg/kg. The MiniMACS system was usedfor small scale positive selection of CD34 +cells. Samples from PBPC harvests containeda mean of 98.5 x 10 6 cells (range78-180), with a 2,5% mean percentage ofCD34+ cells (range 0.48-11). The meanpurity after the selection was 94.5% (range54-99.3), whereas the mean CD34 + recoverywas 34% (range 10-73). Myeloma cellcontamination has ben evaluated beforeand after in vitro purging by nested-PCRwith a molecular marker derived from IgHgene rearrangement. Our results show thatit is possible to obtain PCR-negative cellsafter in vitro purging procedures (3 of 6evaluable harvests). Based upon these findings,we have started large scale experiments.PBPC from 3 MM patients (contain-

37 th Congress of the Italian Society of Hematology127ing a mean of 24 x 10 9 nucleated cells) havebeen purged using CliniMACS device. Thepositive selection of CD34 + cells resulted ina highly purified population of hematopoieticprogenitor cells with a mean purity of90.4% (range 81-96.2), and a mean recoveryof 77.2% (range 76.4-78.4). Afterpurging procedure, plasma cells wereconsistenly reduced by flow cytometryanalysis; qualitative and quantitative PCRanalysis is ongoing.P100ALLOGENEIC BONE MARROWTRANSPLANTATION IN BLYMPHOPROLIFERATIVE DISEASE:MINIMAL RESIDUAL DISEASEANALYSIS DURING THE FOLLOW-UPR. GRASSO, M. MIGLINO, D. PIETRASANTA, G. PALMISANO,G. BERISSO, L. CANEPA, I. PIERRI, M. CLAVIO, S. QUINTINO,M. CAVALIERE, G. BELTRAMI, S. GATTO, F. BALLERINI,P. CARRARA, A. BACIGALUPO, M. GOBBIDepartment of Haematology, S. Martino Hospitaland University of GenoaAllogeneic bone marrow transplantation isa therapeutic approach for Blymphoproliferative diseases that is oftenable to cure the patients. However in somecases after a variable period the disease relapses.Our study purpose is to identify aclonality marker suitable in the analysis ofeach case. IgH gene rearrangement can bea useful tool to investigate the nature of theremission. In our lab we have recently standardizeda PCR technique of IgH locus,simple, rapid and reliable based on the sequentialamplification primed by the consecutiveuse of oligonucleotide specific forVH leader, FR1, FR2, FR3 and JoiningConsesus Region of the variable region ofIgH locus. The amplified product is visualizedon SSCP with poliacrylamide gradientthat enable us to obtain a run based onthe lenght of the band and its nucleotidesequence. Until now we have studied 40patients (18 ALL, 2 high grade NHL, 5 LLC,7 multiple myeloma and 8 low grade NHL).Our study shows that in low gradelymphoproliferative disease the disappearanceof the clonal band often occurs afterseveral months from the transplantation.In high grade and acute lymphoproliferativediseases the wash out of neoplastic cells ismore rapid. The donor lymphocytes administeredpost transplant in some high riskpatients are often able to accelerate or inducethe disappearance of clonal rearrangementband. In every case the reappearanceof the clonal band following a period ofmolecular complete remission is predictiveof disease relapse.P101DOUBLE BCR/ABL FUSION SIGNALSDETECTED BY A HIGHLY SENSITIVEFISH METHOD TO IDENTIFY t(9;22) INADULT ACUTE LYMPHOBLASTICLEUKEMIAM. MANCINI ON BEHALF OF THE GIMEMA COOPERATIVE STUDYGROUPDepartment of Cellular Biotechnologies and Hematology,University “La Sapienza” Rome, Italyt(9;22) (q34;q11) occurs in about 25%of adult acute lymphoblastic leukemia(ALL). In view of the very poor prognosis,the identification of such cases is mandatory.While the efficacy of FISH analysis withABL and BCR probes in chronic myelogenousleukemia is well documented, its role in ALLhas so far been investigated in small seriesof selected patients. In such studies, probesdetecting a single BCR/ABL fusion signalon the Ph chromosome (S-FISH) were used.We performed a prospective dual color FISHstudy in 47 consecutive adult ALL patients(16 females and 31 males, median age 34,range 17-59) included in the GIMEMA 0496ALL trial. New commercial DNA probes(Oncor, Gaithesburg, MD) that spanthe common breakpoints of thet(9;22)(q34;q11) and that detect a doubleBCR/ABL fusion signal (D-FISH) both on theabnormal chromosome 9 and on the Phchromosome, have been utilized. By D-FISH, the number of false positive cellsdecreases dramatically. In fact, the percentageof cells with false positive fusion signalsfound in normal controls was only1.2%, so the cut-off level could be fixed at3% (mean ± 3SD). The results were comparedwith conventional cytogenetics (CC)and RT-PCR in order to evaluate the reliabilityand specificity of this FISH methodfor the detection of the Ph translocation.Four of the 47 cases studied (8.5%) provednot evaluable by FISH, probably due to bonemarrow cell damage related to the overnightsample dispatch. In the remaining 43

128 September 26-29, 1999 - Torino-Lingotto, Italysamples, interphase D-FISH detected aBCR/ABL fusion in 11 (25%) with a highpercentage of rearranged nuclei (median55% range 48-84%). CC was carried outsuccessfully in 22/43 cases (54%) and aclassical t(9;22) was identified in 7 (17%);the remaining 4 cases with a BCR/ABL rearrangementby D-FISH, were notevaluable by CC. RT-PCR was performed in41 cases and a BCR/ABL fusion gene wasfound in 10 (24%); all these cases werealso positive by D-FISH. One case with at(9;22) by CC, confirmed by D-FISH, provedrepeatedly negative by RT-PCR. InterphaseD-FISH emerges as a very reliable tool forthe detection of BCR/ABL in ALL patients atdiagnosis. Its sensitivity is clearly higherthan CC and it may also identify cases withunusual BCR/ABL breakpoint.P102ACUTE MYELOID LEUKEMIAEVOLVING FROM MYELODYSPLASIA: -FISH CHARACTERIZATION OF “dmin”CHROMOSOMESP. TEMPERANI, G. GIACOBBI, G. BONACORSI, P. BAROZZI,G. EMILIA, G. TORELLIDept Medical Science - Internal Medicine andHematology Section - University of ModenaCancer cells may contain multiple copiesof structural normal oncogenes such as C-MYC or multidrug resistance genes such asMDR1. Double minute chromosomes (dmin)are a cytogenetic manifestation of gene amplificationand a sign of disease progressionrather than a primary malignant event.We describe a case of 52-year-old womandiagnosed with Polycythemia vera (PV) in1975. She received busulfan therapy forapproximately twenty years, then she developedmyelodysplasia (ringedsideroblasts, dysgranulocytopoiesis andexcess of blasts) that evolved in overt leukemia.Peripheral blasts, over 45%, werepositive for myeloid markers. The patienttreated with Idarubicin plus high dose ofARA-C died during induction therapy dueto pneumonitis. The first cytogenetic analysis,performed during the acute phase onpheripheral blast cells, showed a karyotype:45,XX, -3, -5, mar7, +8, add(12p),del(13q), add(17p), -19, +mar, dmin. Fluorescencein situ hybridization (FISH) byThree-Color procedure was performed toidentify the nature of the dmin chromosome.The results of this screening defineda unique origin of this DNA which resultedfrom chromosome 13. Two ampliconsmapped on chromosome 13, band q14 andq32, were described in rabdomiosarcomaand two genes associated with leukemogenesis,ZNF198 and LCP1, were mappedon band q12 and q14 respectively. In orderto identify the “native” locus of dmin’s DNAwe are planning FISH analysis, with a panelof YAC and PAC clones rappresentative ofthe described bands of chromosome 13, andexperiments of dmin chromosomes microdissectionfollowed by retrohybridisation ofDOP-PCR product of their DNA.P103CYTOGENETIC OF AML AND “RARE”STRUCTURAL CHROMOSOMEREARRANGEMENTSP. TEMPERANI, F. GIACOBBI, G. BONACORSI, D. DINI,V. MEDICI, C. FIORANI G. LONGO, G. TORELLI, G. EMILIASez.Med.Int.-Ematologia - Univ. ModenaCytogenetic, molecular and molecularcytogeneticstudies of AMLs describe manychromosome and gene mutations associatedmore or less specificaly to the varioustypes of leukemia. However, the picture ofthe AMLs genome remain to be completed.Data collection based on large series andcommon parameters will be useful to makecorrelations between clinical features andcell-biology aspects. We reexamined cytogeneticand FISH data, obtained from leukemicpopulations of AMLs, from 1989 upto March 1999. All AMLs constist of 156cases: 14 (9,6%) have undergoing myelodysplasia;3 (1,9%) are secondary. FollowingFAB classification M4 (29%) e M3 (23%)result to be prevalent, while M5 (13%)-M2(9%) -M1 (8.5%) are less frequent and M0(4%) -M6 (1.2%)-M7 (0,6%) very rare. Nocytogenetic was obtained in 11 cases (7%)owing absence or poor mitoses, while44,8% of leukemic populations show normalkaryotype; even though we can notexclude the presence of criptic or molecularrearrangements, or non-proliferatingcells. 55% AMLs showed genomic and/orchromosomal anomalies, that we have orderedon their prevalence and associationwith FAB subgroups. We distinguished: a)alterations prevalent and specifically asso-

37 th Congress of the Italian Society of Hematology129ciated with a FAB phenotype, such ast(15;17) 89,7% M3, t(8;21) 78% M2; b)alterations not prevalent but specific of aFAB subgroup, such as inv(16) 11,4% M4,t(9;11) 6,6% M5 ; c) not prevalent and notselective but associated with the myeloidlineage, such as +8 14,5% or rearr. 3q21-26; d) alterations which show myelodysplasticorigin such as del(5q) and del(7q);e) “rare” quantitative and structural alterationsmeaningly leukaemogenesis related,such as del(9q) (1,5%) and t(6;9), or secondaryanomalies associated with chemoterapyor drug resistance, such as rearr.11q23, dmin and HSR. Out of group e) wedescribe four “rare” (2.7%) rearrangementswith breakpoint at 21q21-22.1: 1 M1 witht(2;21), 1 M1, 1 M7 hyperdiploid, 1 M4 withmyelodysplasia, showing an add(21q) withunidentified chromosome partners.P104FREQUENCY OF CHROMOSOME 17MONOSOMY IN P53 EXPRESSINGCHRONIC LYMPHOCYTIC LEUKEMIAS. MASI, F.R. MAURO, * S. SODDU, P. DE FABRITIIS,I. CORDONEDip. di Biotecnologie Cellulari ed Ematologia,Università “La Sapienza”, Roma; *Lab. diOncogenesi Molecolare, Ist. Regina Elena, RomaThe p53 gene is a tumor suppressor geneoften inactivated by deletion and/or mutationin most types of solid tumors. p53mutations lead to a marked increase in proteinhalf-life with intracellular high concentrationsof the p53 protein. Detection of thep53 protein by immunological techniquesgenerally corresponds to a gene mutation.Although tumors with p53 protein accumulationin the absence of gene lesions maybe observed, we have shown that a highp53 protein concentration in chronic lymphocyticleukemia (CLL), observed in approximately15% of cases, is strongly associatedwith p53 gene mutations and is amarker of poor prognosis. Since p53 is localizedon chromosome 17, the abnormalitiesof which are significantly correlated witha poor prognosis in CLL, we have investigatedthe frequency of chromosome 17monosomy in CLL cases with an increasedconcentration of p53 protein (p53 pos CLL).To identify p53 protein accumulation wehave used the DO-7 (Dako) monoclonalantibody by immunocytochemical technique.An enzymatic in situ hybridizationwith the centromere specific DNA probe forchromosome 17 was used to identify monosomy17 on CLL. In a proportion of cases,the presence of p53 gene mutations wasalso investigated by direct sequencing ofthe entire cDNA. Fortyseven p53 pos CLL,with a median percentage of p53 positivecells of 29% (range 1-97), and 17 p53 negCLL were tested for monosomy of chromosome17. Four of the 47 p53 pos CLL (8.5%)were monosomic with a median percentageof monosomic cells of 77% (range 38.5-91). Within the 17 p53 neg CLL, 17 monosomywas not found both in the 13 wildtype p53 and in the 4 cases with the mutatedgene. Our results document an higherfrequency of chromosome 17 monosomy inp53 pos CLL. Furthermore, we have observedthe coexistence of monosomic andnon-monosomic cells, as well as of p53positive and negative cells, within the sameleukemic population. This underlines thecomplexity of the p53 disregulation pathwaythat appears as a late event in the progressionof the disease. Moreover, the associationof monosomy 17 with p53 proteinaccumulation and/or gene mutationsupports the recessive model of the tumorsuppressor activity of the p53 gene in CLL.(S. Masi was supported by a fellowship fromFIRC)P105PROGNOSTIC VALUES OF Ph’ADDITIONAL CYTOGENETICABNORMALITIES IN CML - A SINGLECENTER EXPERIENCEE. DONTI, G. VENTIDONTI, C. GRADASSI, A.R. BETTI,A. BASSETTI, N.AL. SHARJABY, V. METTIVIER, C. ARDIASIA,E. MANFROI, V. CAPPARELLA, A.M. LIBERATISez.Med.Int. e Sci. Oncol. Univ. Perugia, Oncologia-RietiAim. To investigate whether Ph’ chromosomevariants and/or cytogenetic clonalevolution affected the response and/or survivalof 63 pts with chronic myelogenousleukemia (CML) treated with IFN-a aloneor in combination with ARA-C. Results. Ph’chromosome variants were observed at thetime of diagnosis in 3 pts and, in 1, later,during treatment. In this last pt, the Ph’ t

130 September 26-29, 1999 - Torino-Lingotto, Italyvariant was associated with the loss of cytogeneticrespose (KR) and disease clinicalevolution. Of the remaining 3 pts, 2achieved a KR (1 complete and 1 minor).The survival was of 147 and 53 mths respectively.In the 3 rd pt, in which the Ph’ tvariant was associated with the iso (17q)other chromosome alterations were observedlater in the course of disease. Thepost-clonal evolution and overall survivaldurations were 1and 19 mths respectively.Loss of Y chromosome was documented in4 pts, in 2 at diagnosis and in 2 later in thecourse of disease. One of the 2 pts with theearly loss of the Y chromosome is in KRand molecular remission 18 mths post-diagnosisand the other had a long chronicphase with 115 mths survival. In the other2 pts, the loss of Y chromosome was associatedwith hematologic progression and apost-evolution survival of 3 and 5 mths.Trisomy 8 was documented in 6 pts duringtherapy. Frequent partial or complete remissionsof trisomy 8 were induced withmodest therapeutic modifications. This specificclonal evolution was not associated withclinical progression or shorter survival.Double Ph’ chromosome also emerged duringtherapy in 4 pts, in 2 alone, in 1 with -6q and in 1 with multiple chromosomalabnormalities. A worse prognosis was documentedonly when double Ph’ with associatedwith other chromosomal abnormalities.In 4 pts, the cytogenetic follow-upshowed the emergence of unusual cytogeneticclones. In the former 3 pts, the postevolutionsurvival was of 4,6 and 14 mthsrespectively. Conclusions. The prognosticsignificance of Ph’ chromosome variants and-Y chromosome clone seems to be relatedto the time of emergence of these cytogeneticevolutions. Trisomy 8 and double Ph’alone are not associated with a worseprognosis. The iso 17q and multiple cytogeneticabnormalities precede and are associatedwith disease progression and poor prognosis.P106A NEW TRANSLOCATIONt(3;16)(q26;p13), IN A CASE OFAML-M0M.C. COX, A. SCANZANI, A. VENDITTI, G. DEL POETA,P. PANETTA, R. SGRO, A. BRUNO, F. BUCCISANO, M. MASI,S. AMADORICattedra di Ematologia, Università Tor Vergata,Ospedale S. Eugenio, RomaA 62-years-old-man came to our attentionin April ’96 with pneumonia, anemiaand thrombocytopenia (Hb=10,7 g/dl,Plt=103.000/ml, WCC= 5580/ml,). Bonemarrow smear showed 10% of blasts; inJune he evolved in acute myeloid leukemia(bone marrow blasts=56%). The cytochemicalreactions were negative forSudan black-B, myeloperoxidase and esterase.The immunophenotype showed positivityfor the following markers:CD13=93%, CD33=70%, TdT=65%,CD34=100%. The patient diagnosed forAML-M0 was enrolled in the EORTC-GIMEMAAML-13 protocol. Because of cardiac failure,after the first cycle of chemotherapyhe remained off-therapy, nonetheless heattained complete hematologic remissionthat lasted five months. Cytogenetic examinationcarried out at disease onset was afailure. Chromosome analysis was repeatedwhen the patient relapsed: t(3;16)(q26;p13) was the sole karyotypic anomaly.A similar translocation was reported in acase of anaplastic large cell lymphoma,though the breakpoint on chromosome 3was q27, the site of the BCL6 gene. Translocationsinvolving the 3q26 locus bearingthe MDS1/EVI1 gene rearrangement, withvarious partners (3q21, 5q21, 12p13,13q13, 21q22) are described in AMLs andare generally associated with dismegacaryocytopoiesis,PLT values above100.000/ml and older age. Because of theclinical setting (PLT>100.000 and age>60)and the involvement of the 3q26 locus, wesuppose that this case represents a newtranslocation involving the MDS1/EVI1gene.

37 th Congress of the Italian Society of Hematology131P107A NEW CHROMOSOMALTRANSLOCATION t(6;10)(q27; q11) INA PATIENT DIAGNOSED FORMYELOFIBROSIS WITHHYPEREOSINOPHILIAM.C. COX, A. SCANZANI, M. CANTONETTI, E. ABRUZZESE,G. DEL POETA, P. PANETTA, R. SGRO, M. MASI, S. AMADORICattedra di Ematologia, Università Tor Vergata,Ospedale S. Eugenio, RomaA 41-years-old-man suffering from fever,asthenia and sweating lasting since threemonths, came at our institution in October’98. Physical examination revealedhepatosplenomegaly. Blood testing showedleucocytosis, anaemia and thrombocytopenia(wcc=21.000/ml, Hb=8,3 g/dl,PLT=77.000/ml). The peripheral bloodsmear showed a leuco-erytroblastic picturewith tear-drops erytrocyte and 40% of eosinophils.In the bone marrow smear 10%myeloblasts , increased number of dysplasticmegakaryocyte and a predominance ofeosinophilic precursor were observed.Threphine marrow biopsy showed besidesmyeloid precursor hyperplasia, markedsigns of fibrosis. The PAL score was 0. TheRT-PCR detection of the BCR-ABL transcriptwas negative. All known causes of hypereosinophiliawere ruled out. Cytogeneticanalysis of marrow cells showed at(6;10)(q27; q11) as the sole chromosomeanomaly. The karyotype carried out on peripherallymphocyte excluded the constitutionalnature of the translocation. This caseis of interest because of the peculiar clinicalfeatures associated with this new chromosomalrearrangement.P108CYTOGENETIC AND MOLECOLARCYTOGENETIC CHARACTERIZATION OF6 NEW CASES OF IDIOPATICHYPEREOSINOPHILIC SYNDROMER. BIGONI, A. CUNEO, R. MILANI, R. RESCA, M.G. ROBERTI,A. BARDI, C. MINOTTO, N. PIVA, G. CASTOLDIDipartimento di Scienze Biomediche e TerapieAvanzate - Sezione di Ematologia, Università diFerrara, ItalyIdiopatic hypereosinophilic syndrome(HES) is defined by peripheral bloodeosiniphilia greater than 1,500µL for longerthan 6 months, absence of other apparentetiologies for eosiniphilia, presence of signsand symptoms of organ involvement. Assuch, HES may be either a reactive conditionor a chronic myeloproliferative disorder.We studied morphologic, cytogeneticand hematologic features in 6 patients fulfillingthe above criteria for the diagnosisof HES. To increase the sensitivity of cytogeneticanalysis, interphase FISH studieswere performed to detect some cryptic chromosomelesions involving the regionsknown to be frequently affected in myeloproliferativedisorders (i.e. BCR/ABL, 5q31,7q22, 11q23, 13q14, 17p13). Two patientshad clonal karyotype anomalies: a 3q25-27 deletion was seen in one; unrelatedclones with +14 and +11 in another patient,who carried a criptic 5q31 deletionas detected by FISH). No chromosome lesionwas detected by karyotyping and interphaseFISH in the remaining 4 cases.Two patients had lung involvement, twohepatosplenomegaly (one patient with3q25-q27 deletion); endocardial diseasewas associated with splenomegaly in thepatient with 5q31 deletion. One patientshowed during the course of the diseasemyocardial fybrosis, transitory ischemicattach, increasing eosinophil peripheralblood count. This patient developed resistanceto steroid and hydroxyurea and wasplaced on inteferon-therapy which obtaineda satisfactory clinical and hematologic controlof the disease. HES is a clinically andbiologically heterogeneous condition, thecharacterization of which may benefit ofcytogenetic investigation.P109CD117 EXPRESSION IN AML:CORRELATION WITH KARYOTYPE ATDIAGNOSISR. CAIROLI, G. SPECCHIA, S. RIBERA, L. PEZZETTI,L. INTROPIDO, G. GRILLO, A. MESTICE, I. ATTOLICO,B. BRANDO, V. LISO, E. MORRADept of Hemathology, Niguarda-Cà Granda Hospital,Milan and University of Bari, Bari. ItalyPatients and methods. 142 AML patients(median age 52 years, range 16-88)were studied at diagnosis from July 1994to December 1998. Immunophenotypic

132 September 26-29, 1999 - Torino-Lingotto, Italyanalysis was carried out using a FACSCalibur Beckton Dickinson flow cytometer.Peripheral blood or bone marrow sampleswere labeled with MoAb 95C3 (Immunotech)to detect the c-kit antigen by directimmunofluorescence. 121 out of 142 patients(85%) evaluable for cytogeneticswere stratified on the basis of the modifiedChicago classification (Cancer GenetCytogenet 1989, 40 : 203-216).Results:Tot t(8;21) t(15,17) Abn 5/7 Dyploid IperD Otherabn(16)N 121 15 20 15 41 13 17CD117+ 108 15 13 11 37 11 21(%) (89) (100) (65) (73) (90) (85) (70)N= number of patients; CD117+ = positivitywas defined as ≥ 20% of stained leukemicblasts; IperD = Iperdyploidia. The column“Other” groups: 3 cases with Abn 11q,7 cases with Pseudodyploidia and 7 caseswith Ipodyploidia. Conclusions. We founda significant correlation between CD117expression and t(8;21)/abn(16)(χ 2 = 0.01; Fischer’s exact test = 0.03); inaddition we observed in AML with dyploidkaryotype and t(15;17) a trend of positivity(χ 2 = 0.052) and a trend of negativity(χ 2 = 0.06) respectively.P110STUDY OF CHROMOSOMEALTERATIONS IN HAEMATOLOGICPATIENTS WITH PROFESSIONALEXPOSURE TO MUTAGENICSUBSTANCESsubjects and the evaluation of fragile siteand chromosome breakage in peripherallymphocyte Materials and Methods:Newlydiagnosed haematological patients weregiven a questionnaire in order to single outthose who had been exposed to mutagenicchemical substances because of their jobs,along with control subjects with similarhaematological disease but without an historyof exposure. Exposed subjects werethen interviewed in order to calculate anexposure index. In patients and controls weanalysed the karyotype of marrow cellsbesides studying the induction of fragilesites and chromosome breakage in peripherallymphocyte after exposure toaphidicoline. Results:We selected 29 patients(15 AML, 4 CML, 4 ALL, 1 neutropenia,3 MDS, 2MPS and 1 aplastic anemia)and 69 controls. We did not sort out differencesbetween cases and controls as regardsthe presence of clonal chromosomealterations. Exposed subjects did not showa prevalence of unfavourable karyotypicaberrations. We observed a strong correlationbetween professional exposure and thedetection of chromosome breakage andfragile sites. Moreover the number of differenttoxic substance to which a patienthad been exposed seemed to be particularlyrelevant in determining chromosomedamage. We did not detect a peculiar karyotypicprofile in patients who were exposedto chemicals, but the analysis of chromosomalbreakage and fragile sites seems tobe a sensitive tool for evaluating and monitoringthe individual susceptibility togenotoxic damage.M.C. COX, A. SCANZANI, R. SGRO, P. PANETTA,G. DEL POETA, A. VENDITTI, M. CANTONETTI, M. MASI,S. AMADORICattedra di Ematologia, Università Tor Vergata,Ospedale S. Eugenio, RomaThe rising incidence of neoplastic diseasesis mainly attributed to the prolongation oflife-span and to the exposition to more andmore chemical and physical agents capableof directly either indirectly damage the DNA.Within three years we selected 29 patients,with various hematologic disorders, whowere professionally exposed to chemicalsknown to be or supposed to be mutagenic.The goal of our research was to study theclonal chromosomal aberrations in exposed

37 th Congress of the Italian Society of Hematology133MULTIPLE MYELOMAP111LONG TERM CULTURED BONE MARROWCELLS FROM MULTIPLE MYELOMAPATIENTS GIVE RISE TO HIGHERNUMBER OF ENDOTHELIAL COLONIESTHAN MGUS PATIENTS AND NORMALCONTROLSM. DOMINICI, D. CAMPIONI, F. LANZA, R. MILANI,S. MORETTI, G. CASTOLDIInstitute of Hematology, University of FerraraIn vivo and in vitro models suggest thatsome bone marrow microenvironmental elements(fibroblast and endothelial cells)may create favorable conditions for multiplemyeloma (MM) cells growth. In thissense, MM is often associated with theappareance of an increased number of endothelialcells (ECs) in the bone marrowspecimens (BMS). Thus, to assess whetherthe in vivo ECs overgrowth in MM could reflectan in vitro spontaneous event, longtermcultures (LTC) were performed avoidingselective medium for ECs proliferation.Briefly, bone marrow mononucleated cells(BMMNCs) from 33 MM patients (13 untreated;11 treated with melphalan; 9 receivedDAV therapy) from 8 patients withmonoclonal gammopaty of undeterminedsignificance (MGUS) and from 8 healthysubjects, were seeded (1x10 6 /ml) in LTCmediumin collagenated petri dishes. Colonyevaluation was carried out on 15 th day byimmunohistochemical reaction for FactorVIII, Collagen I-II-II and CD68. Endothelialcolonies (CFU-En) appeared as smallclusters, FactorVIII+ formed by slightlyelongated and sometimes binucleated cells.Statistical analysis (U test) showed that themean number of CFU-En/10 6 BMMNC inuntreated MM samples (2,07 s.d.+/-1,3)were significantly (p

134 September 26-29, 1999 - Torino-Lingotto, Italypatients and only 3 (18%) of them gavebirth to phlogistic occurences. Instead betweenthose having a low St/Sp ratio 8patients ( 89% ) expoused a infection’s history.Conclusions. Although these dataneed to be confirm in a high group of patientsour results indicate that a low St/Sppredicts the risk of bacterial infections betterthan clinical staging and conventionalimmunologycal markers as serum n.m.immunoglobulin and evaluation of CD4 andCD8 T lymphocytes.P113CYTOFLUORIMETRIC EVALUATION OFB CELL CLONALITY IN BONE MARROWOF IgM MGUSL. CRO, A. CIANI, M. COLOMBI, L. NOBILI, C. VENER,N. ZUCAL, D. INTINI, G. CICERI, R. CALORI, A.T. MAIOLO,L. BALDINIServizio di Ematologia, Centro G.Marcora, OspedaleMaggiore IRCCS, MilanoTraditional morphological methods still donot allow the quantitative determination ofpathological bone marrow levels in IgMMGUS. The aim of this study was to verifythe usefulness of cytofluorimetric (CFM)evaluation of the bone marrow lymphoidpopulation in medullary blood after erythrocytelysis using the following cell markers:CD19, CD3, CD5, CD23 and surface k/λ chains. The study involved 28 patients(median age: 70 (45-81) years; M/F ratio:1.4) who satisfied the following diagnosticrequirements: serum MC IgM concentration

37 th Congress of the Italian Society of Hematology135totic index of pathologic cells without beingselective. Addition of further Il-6 andGM-CSF to the Chang medium has permittedus to obtain a superior number ofmetaphases but not to increase the incidenceof chromosome aberrations, observedin 42% of cases. In conclusion, wethink that the use of Chang medium ± Il-6 and GM-CSF is a valid alternative and aneasy standardizable method to study chromosomeaberrations in MM, even if a furthermodulation of growth factor is requiredto select pathological clonal cells. Moreover,it must be outlined that chromosomalanalysis should be performed together withinterphase FISH to detect aneuploidies,translocations and submicroscopic deletions,that seem to characterize MM.P115abstract not receivedP116THE EXPRESSION OF CYCLIN D1 INMULTIPLE MYELOMA (MM)CORRELATES WITH THE DEGREE OFBONE MARROW INFILTRATION ANDTHE CLINICAL STAGE OF THE DISEASEG. PRUNERI*, A. NERI, S. VALENTINI*, N. CARBONI*,L. LOMBARDI, A. ALIETTI, C. VENER, A. CIANI, M. COLOMBI,L. BALDINI*II Servizio di Anatomia Patologica and Servizio diEmatologia, Istituto di Scienze Mediche, Universitàdi Milano, Ospedale Maggiore, I.R.C.C.S., MilanCyclin D1 regulates the transition betweenphases G1 and S of the cell cycle.Its overexpression is a characteristic signof mantle cell lymphoma, and is due to thetranslocation t(11;14)(q13;q32). Recentstudies indicate about 20% of MMs show atranslocation t(11;14), but the frequencyof cyclin D1 overexpression and its clinicalsignificance have not been sufficientlyinvestigated. To this end, we immunohistochemicallyanalysed cyclin D1 expression(ABC, DCS6 antibody, dilution 1mg/ml) ina series of 83 csecutive bone marrow biopsies(10 normal, 25 MGUS and 48 MM).Cyclin D1 was expressed in none of thenormal, one MGUS (4%) and 12 MM cases(25%) (p=0.057). The hemopoietic cells inall of the samples were invariably negative,with immunoreactivity being limited to thenuclei of plasma cells. Cyclin D1 was expressedat diagnosis in 9/40 MM cases(22.5%), and during relapse in 3/8 cases(37.5%) (p=0.654). In the patients withprimary MMs, cyclin D1 expression was associatedwith clinically advanced stages,being present in 2/23 stage I (8.7%), 2/6in stage II (33.3%) and 5/11 stage IIItumours (45.4%) (p=0.044). Furthermore,it was more expressed in the clinicallysymtomatic (8/22, 36.4%) than in the asymptomaticpatients (1/18, 5.5%)(p=0.026). Finally, cyclin D1 expressionwas more frequently observed in cases witha high degree of bone marrow infiltration,being present in 2/20 (10%) cases with aninfiltration of 50% (55.5%)(p=0.022). These data indicate that theexpression of cyclin D1 in MM is associatedwith more aggressive tumours, although itspossible prognostic role and correlationwith the presence of translocation t(11;14).P117IDENTIFICATION OF BONE MARROWAND CIRCULATING PLASMACELLS BYFLOW CYTOMETRYD. VENERI, V. MENEGHINI, *M. FRANCHINI, L. LENZI,F. BENEDETTI, R. ZANOTTI, G. PERONA, G. PIZZOLODepartment of Clinical and Experimental Medicine,Section of Hematology, University of Verona, and*Transfusion Centre, Azienda Ospedaliera ofVerona, ItalyWe evaluated the immunophenotypic patternof bone marrow (BM) and circulatingplasmacells in patients with multipe myelomaat diagnosis and in healthy donors.BM and blood (PB) samples were incubatedwith the following antibody combinations:CD38-FITC/CD19-PE-CY5/CD56-PE; CD38-PE/κ- o /λ-FITC (following cell permeabilization).Evaluation was performed byflow cytometry on 100,000 BM cells (17myeloma, 7 from BM donors after informedconsent) and 500,000 PB cells (8 myelomaat diagnosis, 8 blood donors). Results wereas follows:

136 September 26-29, 1999 - Torino-Lingotto, ItalyMYELOMACONTROLSPB BM PB BMCD38 brigth 8/8 17/17 7/8 7/7CD38 bright /µL 9.5 (1.36-6.37) 2.5(0-8)#*CD56 7/8 15/17 0/7 0/7*CD19 1/8 2/17 5/7 7/7κ o λ restriction 4/8 17/17 0/7 0/7* co-expression in >20% of CD38+ cells; #p=n.s.In agreement with previous reports, ourdata show that CD38 bright and cytoplasmiclight chain co-expression easily identifiesPB and BM plasmacells. Normal and myelomaBM plasmacells are mostly identifiableby their characteristic immunophenotypicprofile (myeloma: CD19-, CD56+,light chain restriction; normals: CD19+,CD56-, no light chain restriction). The lowlevel of circulating plasmacells and the variableexpression of their immunophenotypicpattern do not allow a safe distinction betweennormal and neoplastic plasmacellsin PB.P118TGFβ AND sVCAM-1 IN MULTIPLEMYELOMA AND MONOCLONALGAMMOPATHY OF UNDETERMINEDSIGNIFICANCES. MISSO°, B. FEOLA°, O.A. SPADA*, L. BENE*,S. FORMISANO^, N. SCARPATO^, A. MINERVA°, C. MAROTTA°°Blood Transfusion Service Caserta, *Department ofHaematology II A.O. Cardarelli Napoli, ^BloodTransfusion Service University Hospital Federico II,Napoli, ItalyThe TGFβ is a protein of 25 KDa withunique and potent immunoregulatory properties.Several authors think that solublefactors from MM cell lines inhibit the activationof cultured T-cells by this cytokine.This phenomena is underlined by no expressionof IL-2Rα (CD 25)in stimulated T-lymphocytes.The sVCAM-1 is the solublecountpart of adhesion molecule (VCAM-1)expressed at low levels by bone marrowstromal, dendritic and endothelialcells.Serum levels of sVCAM-1 are reportedto be elevated in B-CLL and to represent aprognostic factor in Binet staging.The aimof this study has been to check if differentserum levels of these factors could be importantin prognosis and diagnosis of B-cellpathology ,as multiple myeloma (MM) andmonoclonal gammopathy of undeterminedsignificance (MGUS).In this study were included40 MM patients ,at diagnosis anduntreated ,60 MGUS and 50 healthy controls(blood donors).The MM patients weredivided into four groups : IgG (24), IgA (7),κ chain (4), λ chain (5). Serum assays weredetermined by E.I.A. technique (sVCAM-1DIACLONE RESEARCH and TGFbAMERSHAM INTERNATIONAL PLC) ,accordingto the manufacturer’s instruction. Theresults obtained are shown below.TGFβ1sVCAM-1MM 62.66+/-39.25 2325.26+/-397.72 ng/ml p=0.000MGUS 95.17+/-54.22 2456.40+/-278.34 ng/ml p=0.000CONTROLS 4.70+/-2.7 685.00+/-487 ng/mlThe results indicate a statistic increase eitherin MM patients or MGUS ones vs controls.The Spearman’s test shown that thereis no statistic variation compared to MM andMGUS ones. We suggest that these solublefactors are sensitive and reliable tool fordetecting MM and MGUS but not have differentdiagnostic between the two diseases.Moreover, the sVCAM-1 is not correlated inMM staging while it is a prognostic factor inB-CLL.P119HUMAN HERPESVIRUS 8 (HHV8) ANDMULTIPLE MYELOMAR. FANCI, * A. AZZI, C. PACI, * R. DE SANTIS,* S. CIAPPI,G. LONGO, A.BOSI, P. ROSSI FERRINIDepartment of Hematolgy, *Dept. of Microbiology,University of Florence and Azienda OspedalieraCareggi, FlorenceHuman herpesvirus 8 (HHV8), the lastherpesvirus discovered in 1994, also knownas Kaposi’s sarcoma-associated herpesvirus(KSHV), is strongly associated withKaposi’s sarcoma (KS), body-cavity-basedB cells lymphomas (BCBL) and multicentricCastleman’s disease. More recentlyHHV8 sequences were found in bone marrowdendritic cells from patients with multiplemyeloma (MM), but not in healthycontrols, suggesting a potential causal orpromotional role for the virus in this malignancy,possibly through expression of viralIL-6 (v IL-6). However further molecularand serological studies gave contrastingresults. To clarify a possible association ofHHV8 with MM, we detected HHV8 sequencesby PCR in long-term cultured dendriticcells (3-5 weeks) from bone marrow

37 th Congress of the Italian Society of Hematology137biopsies of patients with MM, with monoclonalgammopathy of undetermined significance(MGUS), with non Hodgkin-lymphomas(NHL) and of healthy bone marrowdonors. ORF 26 sequences have beendemonstrated in 4 of 15 MM (27%), in 1 of6 MGUS (16%), in 3 of 21 NHL: 2 follicularlymphomas, 1 chronic lymphocytic leukemia(14%), but no in 4 healthy bone marrowdonors. ORF K1 sequences have alsobeen detected by PCR in the ORF 26 positivesamples. Our results confirm that HHV8genome is detectable in bone marrow stromalcells of MM patients, but viral sequenceswere also found in other lymphoproliferativediseases.P120NO CORRELATION BETWEEN HUMANHERPESVIRUS 8 (HHV-8) ANDMULTIPLE MYELOMAP. GALIENI 1 , A. BONCI 2 , S. POLLINI 2 , M. TOZZI 1 , G. SCALIA 1 ,D. LASZLO 1 , G.M. ROSSOLINI 2 , F. LAURIA 11Cattedra e U.O. di Ematologia, 2 Dipartimento diMicrobiologia-Biologia Molecolare, Università diSiena, ItaliaThe human herpesvirus type 8 (HHV-8)has been recently identified. HHV-8 hasbeen shown to bear several genes, includinginterleukin 6 (IL-6) gene. Some lateststudies showed that this virus is present inbone marrow dendritic cells of patients withmultiple myeloma (MM), indicating that theHHV-8 bone marrow infection can transforma monoclonal gammapaty of undeterminedsignificance (MGUS) in MM. Other researchesdidn’t confirm this result and theyexpessed different considerations about therole of HHV-8 in the development of MM.In this study plasma samples of 53 patientswith plasma cell dyscrasias (MM 32 cases;MGUS 20 cases; plasma cell leukemia 1case) have been analyzed for HHV-8 antibodiesby ELISA using recombinant p65antigen and IFA using BC-3 cell line. Furthermore,in all patients the presence ofHSV-1 was verified to exclude a profoundinhibition of the humoral immune response,often present in these patients. Our resultspointed out that 2/32 (6%) MM patients,and 2/20 (10%) MGUS patients showed apositivity to HHV-8 antibodies. The onlycase of plasma cell leukemia was negative.At the contrary, the antibodies against HSV-1 were found in almost all cases. Our resultsdemonstrated an antibody positivityagainst HHV-8 in a low percentage of patientsaffected with plasma cell dyscrsias,without any real difference with the onefound in healty people. This study is inagreement with the previous study thatstated non-relationship between HHV-8 infectionand MM.P121ADHESION MOLECULES (CD56 ANDCD43) IN PLASMA CELLPROLIFERATIONR. GRIMALDI, S. IMPROTA, E. SAVARESE, *L. CATALANO,*C. CALIFANO, *A. DE RENZO, °G. AMENDOLA, *B. ROTOLIServizio Immunotrasfusionale e °Divisione diPediatria, Ospedale S. Leonardo, Castellammare diStabia, Napoli; *Divisione di Ematologia, Facoltà diMedicina, Università Federico II, NapoliFlow cytometry techniques are makingpossible the identification of normal andneoplastic plasma cells by surface moleculeanalysis. We are studying the expressionof two adhesion molecules, CD56 andCD43, on normal (NP) and clonal plasmacells (monoclonal gammopathy of undeterminedsignificance [MGUS]; multiple myeloma[MM]; refractory or progressive multiplemyeloma [R-MM]; plasma cell leukemia[PL]). CD56 is an isoform of the humanneural adhesion molecule (N-CAM),and it is involved in cell-to-cell homotypicinteractions. CD43 is a sialoglycoproteininvolved in homotypic anti-adhesion mechanismsby providing a repulsive barrieraround cells due to its extended conformationand negative charge of sialylated residues.Normal and clonal plasma cells wereidentified by flow cytometry using anti-CD138 MoAb and double-labeled with anti-CD56, -CD43, -κ and -λ MoAbs.CD43 CD56NP 5/5* 0/5MGUS 8/10 2/10MM 0/8 8/8R-MM 2/2 2/2PL 1/1 0/1*n. of positive cases(>20% of positive cells)/n. oftested casesOur preliminary results confirm previousstudies on CD56 expression in MM, andshow interesting positive or negative cor-

138 September 26-29, 1999 - Torino-Lingotto, Italyrelations with CD43 expression. Indeed, thelatter molecule seems to be faintly expressedon normal plasma cells and inMGUS; it is absent in responsive or stableMM and seems highly expressed in progressiveMM and in PL. If confirmed, these datamay help in differentiating normal andclonal plasmacells as well as responsive vsrefractory disease.P122EVALUATION OF ANGIOGENICFACTORS (VEGF, bFGF AND HGF) INBONE MARROW AND PERIPHERALBLOOD OF MULTIPLE MYELOMAPATIENTSF. DI RAIMONDO, M.P. AZZARO, G. SORTINO, G.A. PALUMBO,S. BAGNATO, R. GIUSTOLISICattedra e Divisione di Ematologia con Trapianto,Ospedale Ferrarotto, CataniaSeveral recent experimental data indicatethat angiogenesis may play a role in progressionof multiple myeloma (MM). VascularEndothelial Growth Factor (VEGF) isrecognized as the most important solublefactor for normal angiogenesis and a recentstudy indicates that VEGF mRNA isexpressed by myeloma cells. Morever, additionalangiogenic factors may have a rolein neoplastic angiogenesis of multiple myeloma.On these basis, levels of VEGF, basicFibroblast Growth Factor (bFGF) andHepatocyte Growth Factor (HGF), weremeasured by enzyme-linked immunosorbentassay (ELISA) in the plasma obtainedboth from peripheral blood (PB) and bonemarrow (BM) aspirates of 14 patients affectedby plasma cell disorders. This seriesincludes 2 patients affected by MGUS, 6early stage MM (5 at diagnosis and 1 in CRafter autoBMT) and 6 stage II-III MM (4 atdiagnosis and 2 previously treated). In allcases levels of VEGF, bFGF, and HGF weremore elevated in BM than in PB and therewas a good correlation between BM and PBvalues. Patients affected by MGUS had thelowest levels of angiogenic factors both inBM and PB with the exception of high VEGFlevels in BM. Mean levels of all three angiogenicfactors either in BM or in PB werealways lower in early stage MM than in moreadvanced stages. The following table showsmean values and ranges in pg/ml.PAZ. VEGF BFGF HGFBM PB BM PB BM PB2 MGUS 148 20 34 0.1 1543 426 MMInitial Stage 86 27 58 5.4 2365 1011(35-143) (10-44) (13-174) (0.1-31) (946-6600) (413-2581)6 MMAdvancedStage 437 79 173 151 3803 1368(49-1984) (34-152) (38-700) (3-647) (684-9000) (466-2031)There was no correlation among the threeangiogenic factors levels except some degreeof correlation between bFGF and HGFBM levels (r=0.74). However, two patientswith aggressive disease had very high levelsof each angiogenic factor both in BMand PB. No correlation was found betweenVEGF, bFGF, and HGF levels and percentageof plasmacells, M protein level, osteolyticlesions, Hb, CRP and beta-2microglobulin. Since angiogenetic factorsmay be released by normal cells in responseto hypoxia, we also evaluated erythropoietin(EPO) levels (that correlate with thehypoxic stimulus) both in PB and BM plasmaof these patients. We found that there wasno difference in PB and BM EPO levels. EPOwas higher than normal in only two patients,both of them with a mild anemia (Hb level10 and 11 g/dl). EPO levels correlated withBM VEGF (r =0.9) but not with bFGF or HGF.These data confirm that several angiogenicfactors may play a role in MM. Their level inBM is always higher than in PB. Elevatedlevels of one or more of these factors maybe expression of an aggressive disease.However, further studies are necessary todetermine the exact role and the consequenthierarchy of these factors in the angiogenicpathway of MM.P123MOLECULAR AND CLINICAL FOLLOW-UP IN MULTIPLE MYELOMA AFTERSTEM CELL TRANSPLANTATIONP. CHIUSOLO, S. SICA, N. PICCIRILLO, G. GIORDANO,L. LAURENTI, E. ORTU LA BARBERA, V. DE STEFANO,A. DI MARIO, G. LEONEDivisione Ematologia Istituto di Semeiotica Medica-Università Cattolica Sacro Cuore RomaWe investigate the molecular and clinicalfollow-up of patients with multiple myeloma.Twenty-eight consecutive patientswere submitted to autologous (27pts) orallogeneic stem cell transplantatation (1).IgH rearrangement was assessed by PCRanalysis in 21 patients (F/M:9/12, median

37 th Congress of the Italian Society of Hematology139age 53, range 41-62 ). Eighteen patientsunderwent unselected stem cell transplantation(uSCT) as a single or double procedure,9 patients underwent CD34+ stemcell transplantation (CD34+SCT) and 1 patientreceived allogeneic bone marrowtransplantation (alloBMT). All but one patientsreceived aIFN as maintainance.Fourteeen patients achieved CR, 5 patientsachieved PR and 2 patients are not yetevaluable. Median follow up after transplantationwas 26 months (range 1-87). Molecularanalysis was performed on stemcell harvest in 13 patients and serially onbone marrow sample during follow-up aftertransplantation in 21 patients. Stem cellharvest was found to be PCR+ in all patientswith no difference after CD34+ stemcell selection. At follow-up all but one patientssubmitted to autologous SCT remainedPCR+ despite continuous clinicalcomplete remission (CR). One of these patientsrelapsed at 12 months after uSCT.Patients in PR were included in the studyand showed persisting PCR+. One patientsubmitted to autologous SCT was found tobe PCR- at a follow-up of 87 months andshe remains in continuous clinical CR. Thepatient submitted to allogeneic BMT is incontinuous clinical CR despite PCR+ at afollow up of 39 months. Disappearance ofIgH rearrangement in multiple myelomapatients is exceedingly rare after autologousSCT without any difference betweensingle, double or purged procedure. Inthese patients the harvest remains PCR+even after CD34+ selection. aIFN has noimpact on molecular residue. The persistenceof PCR+ signal does not predict forsubsequent relapse and is not in contrastwith a long-standing clinical remission. Thesignificance of PCR+ in the eradication andfollow-up of multiple myeloma after SCTremains to be defined.P124DECREASED ANTIGEN PRESENTATIONBY FRESHLY ISOLATED DENDRITICCELLS IN PATIENTS WITH MULTIPLEMYELOMAM. RATTA, R. VESCOVINI, A. CURTI, F. FAGNONI,M. PANTUCCI, G. VISCOMI, P. SANSONI, S. TURA, R.M. LEMOLIInstitute of Hematology and Medical Oncology “L. eA. Seragnoli”, University of Bologna, Alfa WassermannLaboratory, Bologna, Italy; Department ofInternal Medicine, University of Parma, Parma, ItalyIn this study we report the characterizationof dendritic cells freshly isolated fromthe peripheral blood or derived from highlypurified circulating CD14+ cells from thesame multiple myeloma patients. CirculatingDC were obtained after centrifugationover subsequent metrizamide gradients,whereas CD14+ cells were differentiated toimmature DC with GM-CSF and IL-4 for 6-7 days and then induced to terminal maturationby the addition of TNFα or stimulationwith CD40L. Phenotypic analysisshowed that 90 ± 6 % of cells recoveredafter GM-CSF and IL-4 stimulation expressedall surface markers of immature DC(CD1a+, CD40+, CD80+, CD86+, HLA-DR+, CD83-, CD14-). The subsequent exposureto maturation stimuli determinedthe downregulation of CD1a and theupregulation of CD83, costimulatory moleculesand HLA-DR and induced the secretionof large amounts of IL-12. Functionally,immature monocyte-derived DC (Mo-DC) were extremely efficient in stimulatinga proliferative response of allogeneic lymphocytesand were capable of presentingsoluble proteins such as KLH, Tetanus Toxoid(TT) and a tumor-Ag such as the patient-specificidiotype to autologous T-cells.When DC derived from CD14+ cells fromhealthy volunteers were analyzed, we didnot find any difference with samples fromMM patients as for cell yield, phenotypicprofile and functional characteristics. Incontrast, freshly isolated DC showed a decreasedcapacity of stimulating a proliferativeresponse of allogeneic T-cells and ofautologous T-cells to KLH and TT either incomparison with normal donor isolated DCor Mo-DC obtained from the same MM patients.In particular, circulating DC isolatedfrom myeloma patients were not capableof presenting the patient-specific idiotypeas whole protein or Fab fragments to T-cells.

140 September 26-29, 1999 - Torino-Lingotto, ItalyIn conclusion, circulating DC are functionallydefective as compared to Mo-DC. Therefore,they do not appear to be optimal targetfor immunotherapy strategies. This findingmay also be important to elucidate theimmunologic tumor escape in MM.P125EFFICIENT PRESENTATION OF TUMORIDIOTYPE TO AUTOLOGOUS T-CELLSBY CD83+ DENDRITIC CELLS DERIVEDFROM HIGHLY PURIFIEDCIRCULATING CD14+ CELLS INMULTIPLE MYELOMA PATIENTSM. RATTA, A. CURTI, M. FOGLI, M. PANTUCCI, G. VISCOMI,S. TURA, R.M. LEMOLIInstitute of Hematology and Medical Oncology“L. e A. Seragnoli”, University of Bologna andAlfa Wassermann Laboratory, Bologna, ItalyIn this study we report the generation andfunctional characterization of dendritic cells(DC) derived from circulating CD14+ cellshighly purified from the leukapheresis productsof multiple myeloma (MM) patients.CD14+ cells were differentiated to immatureDC with granulocyte-macrophagecolony-stimulating factor (GM-CSF) andinterleukin-4 (IL-4) for 6-7 days and theninduced to terminal maturation by the additionof tumor necrosis factor (TNF-α) orstimulation with CD40L. Phenotypic analysisshowed that 90 ± 6% of cells recoveredafter GM-CSF and IL-4 stimulationexpressed all surface markers typical ofimmature DC (CD1a+, CD40+, CD80+,CD86+, HLA-DR+, CD83±, CD14-). Subsequentexposure to TNF-α or CD40L inducedthe downregulation of CD1a andupregulation of CD83, HLA-DR andcostimulatory molecules and augmented thealloreactivity of mature DC. Moreover,maturation stimuli induced the secretion oflarge amounts of IL-12. Immature DC demonstrateda high capacity of uptaking andprocessing soluble antigens (Ag) as shownby the FITC-dextran assay. After terminalmaturation induced by TNF-α, monocytederivedDC (Mo-DC) were capable of presentingsoluble proteins such as Keyholelimpet hemocyanin (KLH) and Tetanus Toxoid(TT) to autologous T cells for both primaryand secondary immune response.Conversely, pulsing of mature (CD83+) DCwas less efficient for the induction of theproliferation of autologous T-lymphocytes.More importantly, CD14+ cells-derived DCstimulated autologous T-cell proliferation inresponse to a tumor-Ag such as the patient-specificidiotype (Id). Again, T-cellactivation was better achieved when DCwere pulsed before induction of terminalmaturation and Fab Ig fragments were usedas compared to the whole protein. WhenDC derived from CD14+ cells from healthyvolunteers were analyzed, we did not findany difference with samples from MM patientsas for cell yield, phenotypic profileand functional characteristics. In conclusion,our studies demonstrate that mobilizedCD14+ cells purified by high-gradient magneticseparation may be an efficient sourcefor the generation of a homogeneous cellpopulation of mature and fully functionalDC suitable for clinical trials in MM. We alsoshow a clinically applicable protocol for theefficient pulsing of DC with the tumor Ag Idbased on the biologic characteristics of DCat different stages of maturation.P126MONOCLONAL GAMMAPATHIES:NATURAL HISTORY OF 482 PATIENTSG. FRIGERIO, M. DURO, G. SCOGNAMIGLIO, F. ALBERIO,A. BERETTAOspedale “VALDUCE”, Amb. di Oncoematologia -Como, ItalyObjective: Estimate of probability of malignanttransformation from monoclonalgammapathy of undetermined significance(MGUS) to overt myeloma and evaluationof possible predictive factors of this event.Methods and results: A series of 482 consecutivepatients (226 women, 256 men,aged from 12 to 92 years – mean 64) withmonoclonal gammapathy were followed-upfrom a minimum of 6 and a maximum of237 months (median 41; total time ofobservation 21785 months=1815 years). Atdiagnosis 41 patients (8.5 %) were classifiedas overt myeloma according toDurie & Salmon; 7 patients (1.5 %) asmacroglobulinemia, 5 women (1 %) ascryoglobulinemia and 4 patients (0.8 %)as amyloidosis. The other 425 patients(88.2 %) were classified as MGUS. Thetransformation from MGUS to overt myelomaoccurred to 30 patients after a fol-

37 th Congress of the Italian Society of Hematology141low-up of a range from 7 to 185 months(median 44): the estimated overall rate oftransformation is 7.06 % (95 % C. I.: 6.29-8.04 %). Only one man evolved to amyloidosisand two women to macroglobulinemia.After the malignant transformation15 patients (50 %) died because of myeloma(range of survival: 6-62 months;median 13). From the remaining 395 patients13 (3.3 %) died because of not relateddiseases and in 12 (3.0 %) the monoclonalprotein seem disappeared after arange from 7 to 46 months. A statisticalanalysis of a Multiple Logistic Regressionmodel with stepdown method showed thatESR (p=0.0007), Bence-Jones proteinuria(p=0.0015), serum IgG level (only for IgGMGUS; p=0.0059), all evaluated at time ofdiagnosis, and the time of follow-up(p=0.0076) were significant predictive factorsfor malignant transformation. The othervariables evaluated on the model not statisticalsignificant were: serum level of LDH,creatinine, calcemia, proteinemia, albuminemia,the heavy and light chains involved(rates of malignant transformation:IgG-k 7.6 %; IgG-λ 6.1 %; IgA-k 7.7 %;IgA-λ 15.0 %; IgM-k 2.1 %; IgM-λ 5.6 %;p=0.39), the hemoglobin level and plateletcount, the bone-marrow plasmocytosis,age and sex.P127EVOLUTION IN 116 PATIENTS WITHIgM MGUSA. ALIETTI, M.L. LA TARGIA, P. GOBBI, R. BERTÈ, V. CALLEA,M. GOLDANIGA, M. COLOMBI, L. BALDINI, V. SILINGARDI PERIL GISLServizio di Ematologia, Istituto di Scienze Mediche,Università degli Studi, Ospedale Maggiore, IRCCS,Milan, ItalyAn evaluation was made of the clinicalevolution of 116 patients with asymptomaticIgM mononclonal gammopathy, in 100of whom the presence of serum MC was achance finding; in the remaining 16 patients,it followed the appearance of thefollowing symptoms: neuropathy (12cases), hemorrhagic (3 cases) or infectivediathesis (1 case). The clinical and laboratorycharacteristics at diagnosis were thefollowing: M/F ratio 69/47, median age 63years (34-81), serum MC concentration of1.59±0.74 g/dL, Bence Jones proteinuriapresent in 27 cases, reduced serum polyclonalIg in 15 cases, cryoglobulinemia andthe presence of serum anti-HCV antibodiesin respectively 6 and 15 cases. Bone marrowaspirate cytology revealed lymphocyticand plasma cell infiltration of respectively21.8±6.2% and 3.1±3.7%; bone biopsylymphoid infiltrate was 16.7±13.8%. Themedian follow-up of the population as awhole was 48 months (12-168). One hundredpatients were defined as having IgMMGUS on the basis of the following criteria:serum MC

142 September 26-29, 1999 - Torino-Lingotto, Italy100samples by cellulose acetate electrophoresisand immunofixation determination withspecific antibodies on agarose gel. The aimof this study is to asses the prevalence ofMCs in an homogeneous population andtheir relationship with other disease. Thisstudy has been divided into two periods:1016 MCs were identified from 1981 to 1990and 721 from 1991 to 1995. The observeddata suggest an increase in number of MCsfrom the 1 st to the 2 nd period (1991-1995),specially in males; this is probably due tothe improvement of diagnostic methods andto a more frequent use of the laboratoryexams. Dividing MCs by class, these arethe results: 1.268 IgG (735 κ, 533 λ), 173IgA (78 κ, 95 λ) e 279 IgM (209 κ, 70 κ).Each group was subdivided according totheir related disease:500MC-IgG MC-IgA MC-IgMMGUS MYELOMA TUMOURS ASSOCIATED17 were Bence Jones Protein only (8 κ, 9λ). Myeloma and Waldestrom’s macroglobulinemiarepresent 5-10% of all MCs;these data are similar to that reported oninternational literature. MCs related to neoplasmare 17-22%: in particular 9% of IgAgammapathies are associated to digestivetract neoplasm and 8% of IgM type toNHL other than Waldestrom’s macroglobulinemia.P129THE OUTCOME OF MYELOMA PATIENTSTREATED WITH DIALYSISM. GRASSO, M. BONFERRONI, C. CASTELLINO, D. MATTEI,F. MARAZZI*, A. GALLAMINIHematology Department, S.Croce Hospital, Cuneo;*Nefrology Department, S.Croce Hospital, CuneoMultiple Myeloma (MM) is associated withchronic renal failure in 20-40 % of cases atdiagnosis. The prevalence of renal failureis related as well to the nature of the monoclonalcomponent. Few studies have correlatedsurvival and hemodialysis in patientswith MM. We reviewed the outcome of 15patients with myeloma and irreversiblechronic renal failure treated with dialysisin our institution over a 17 year period(1981-1998). Patients’ characteristics wereas follows: median age 59 years (48-82),ratio M/F 9/6, Durie-Salmon stage III in 11patients, stage II in 4 patients. Light-chainmyeloma accounted for 53% of the casesand Bence Jones proteinuria was identifiedin > 90% of the patients. IgD myeloma waspresent in 2 patients. In 73% of the patientsdialysis was performed at diagnosis,while in the other patients it was started16-60 (median 37,5) months after diagnosis.All the patients were treated with chemotherapyusing different schedules:melphalan and prednisone, intermediatedosecyclophosphamide and VMCP/VBAP.There were 12 patients evaluable for response:of these only one patient is stillalive at present, eleven have died. No CRwas observed and despite a partial remissionin 53% of the patients nobody regainednormal renal function. Progression of myelomaand infection were the most frequentcauses of death. The median overall survivalwas 32 months, which is similar toother control studies of patients with normalrenal function, treated with standardchemotherapy and a median survival of 3years. In conclusion we confirmed a higher% of light-chain myeloma in pts with severerenal impairment than in pts with normalrenal function. We observed that dialysisdid not have any influence on survivalin MM, nor any benefits on renal function.P130A CASE OF RENAL WALDENSTROMF. NIFOSÌ, G. SBOLLI, B. FERRARI, R. BERTÈ, D. VALLISA,G. CIVARDI, L. CAVANNA1 st Division of Internal Medicine - Hematology,Piacenza HospitalBackground: Renal disease in Waldenstrom’smacroglobulinaemia (WM) is generalhyconsidered more rare and less severethan multiple myeloma (MM). Howevera primary renal/perirenal appearancerepresent 6% of cases in the literature.When present, glomerular injury is thoughtto be the most serious problem. In our studywe describe a case of diffuse interstitial involvementand the relative clinical, laboratory,instrumental, prognostic and therapeuticcharacteristics are discussed here.

37 th Congress of the Italian Society of Hematology143Case Report: A 73-year-woman whit WMfor the previous two years but withoutchemoterapy, was admitted to our divisiondue to rapid worsening of bone pain withdecreasing renal function. The laboratoryexams showed: erytrosedimentation rate125 mm/h, IgM 2540 IU/ml, IgA 47 IU/ml,beta-2-mycroglobulin 8.0 IU/ml, normocromicnormocytic anemia, urea 79 mg/dl,creatinin 2.2 mg/ml, creatinin clearance14.4 ml/min. Total bone Rx-examinationshowed non osteolytic lesions. Bone marrowbiopsy showed a pattern of diffuse infiltrationby lymphoplasmocytoid, smalllymphoid and plasmacellular elements(80%). Abdomen ultrasound (US) examinationshowed enlarged kidneys withhyperechogenic pattern of cortical regionand non-homogenic pattern by diffuse andvanishing hypoechogenic areas on corticalregions on the both sides. US-guided renalbiopsy showed: a) interstitial infiltration bysuch as bone marrow elements and secondaryfibrosis and atrophy of tubuli; b)poor mesangial positivity for IgM and negativityfor IgA, IgG, C3, C1q and fibrinogenat immunofluorescence studies. The patientwas treated with clorambucyl and prednisonefor nearly two months, but thistratment was ineffective and renal functionrapidly worsened (urea 183 mg/dl, creatinin4.5 mg/dl). The treatment with cyclophosphamide500 mg, vincristin 1 mg, prednisone60 mg for 3 cycles every 4 weeksshowed a clinical improvement and a disappearanceof hypoechoic lesions at USexamination. Discussion: WM is a lowgradeB cell malignancy. The tubulointerstitialrenal involvement is possible and itis characterized by the following pictures:a) bilateral picture; b) US alterations; c)progressive decrease of renal function; d)resistence to clorambucyl and so more aggressivetreatment is required. We emphasizethe need to evaluate the renal functionand US pattern of kidneys. However,renal biopsy is usually required for a definitivediagnosis, correct prognostic estimationand the selection of suitable treatment.P131PREVALENCE OF D.I.S.H. IN M.G.U.S.D. PARENTE, A. FEBBRARO, N. PAPPONE*, C. DI GIROLAMO*,M. GALEAZZI°Ematology Service Ospedale ”Sacro Cuore di Gesù”Benevento, *”Salvatore Maugeri” Foundation-IRCCS, Telese (BN); °University of Siena; ItalyMonoclonal gammopathy of uncertain significance(MGUS) is a B cell disease whichmay progress to multiple myeloma; an associationbetween diffuse idiopathic skeletalhyperostosis (DISH) and myeloma hasbeen recently described. No data exist onprevalence rate of DISH in MGUS and onits role played in the evolution of thegammopathy. Fifty-two consecutive patients(22 F, 30 M, mean age 65.9 years, range48-85) affected by MGUS according to Kylewere studied. Twenty-nine of them (55.8%) had a mean duration of disease of 22.4months (range 1-67), while the remainings(44.2%) were consecutively identifiedamong all the subjects attending theEmatology Service of the “S.Cuore” Hospitalfor routine analysis. A complete laboratorypanel and functional assessment ofaxial skeleton were carried out in all thepatients. Serum C-reactive protein (CRP)was also determined and a cut-off levelcomputed on a 40 blood donors populationwas also identified. DISH was diagnosedaccording to Resnick’s criteria and its prevalencewas compared to that identified ingeneral white population in a previousstudy. Seventeen cases of DISH (14 M, 3 F,mean age 68.0 years, range 53-84) wererecognized. Our results reveal that theprevalence rate of DISH in patients affectedby MGUS is significantly higher then in thegeneral population, with an age and sexadjustedrate ratio (using the 1980 censusof the US white population) of 5.54 and a95% confidence interval ranging from 3.53to 8.70. Males revealed a significant increasedprobability of developing DISH,even controlling for age, (multiple logisticregression model: B= -0.65, p=0.05) togetherwith those with a gammopathy characterizedby A and M classes of immunoglobulins(T test, p= 0.03); monoclonal diseaseduration and serum immunoglobulinlevel in patients with IgG-gammopathywere related to a increased probability ofdeveloping DISH (multiple logistic regressionmodel: B=-1.91, p=0.02 and B=0.001, p=0.05 respectively). No relation-

144 September 26-29, 1999 - Torino-Lingotto, Italyship was found between prevalence of DISHand both presence and level of CRP. It couldbe hypothesized that onset of DISH in patientsaffected by MGUS could reflect a morepronounced action played by growth factorsin the proliferation of B cells. A negativeprognostic role toward the developmentof multiple myeloma in MGUS patients couldbe consequently hypothesized for DISH.P132MULTIPLE MYELOMA PRESENTINGWITH EXTENSIVE EXTRAMEDULLARY,LYMPHOMA-LIKE, DISEASEA. GALLAMINI*, F. PUGNO§, M. GRASSO*, M. BONFERRONI*,D. MATTEI*, C. CASTELLINO*, R.M. LANTERMO§*Hematology division, §Pathology department,S. Croce Hospital, Cuneo, ItalyIntroduction: Extramedullary plasmocytoma(EMP) is a rare neoplasm accountingfor 4% of plasma cell tumors, characterizedby solitary or multiple biopsy-provenplasma cell tumors, normal bone marrow,and low concentrations of monoclonal paraprotein.Multiple visceral microscopic involvementhas been shown in more than70% of multiple myeloma (MM) at autopsy;however, the presence of gross tumor outsidethe marrow is an exceedingly rareevenience in MM at diagnosis. Results: Wereport 10 cases of MM admitted to our hematologyunit from 1984 to 1997, characterizedby a lymphoma-like presentation,with massive extrascheletric invasion oflimph nodes and spleen. The median agewas 62.5 years (range 46-73), male to femaleratio was 4/6. The isotype was IgA in4 patients (pts.), IgG in 1, Bence-Jones in1, and 4 were nonsecreting myelomas. 8pts out of 10 showed high marrow infiltration(>75% both on aspirate and trephinebiopsy) by myeloma cell, with the followinghistotype: plasmocytic in 4 cases,lymphoplasmacyic in 3 cases and plasmablasticin 1 case. In one pt. bone marrowshowed a moderate lymphoplasmacyticinfiltrate, while in another pt. no plasmacells could be detected both on aspirateand on bone marrow biopsy. These twopts. (the former with low serum levels ofM-component, the latter with a nonsecretingtumor) therefore fullfilled the diagnosticcritetria for EMP. All the pts but onehad disseminated bone lytic lesion on X-ray examination; the only pts with a negativeX-ray of the skeleton (affected by EMP),demonstrated also a negative MRI of theentire spine. In all cases serum LDH valuesat diagnosis were within the normal range,with a mean value of 287 mU/ml (144-446),while ∃ 2-microglobulin was significantly elevated(> 6 U/l) in only one pt. In all casesthere was at least one extramedullary lesion(EML) histologically proven: in 6 pts.only one site was documented by biopsy,in 1 pt. two sites, in 2 pts three sites, in 1pt four sites, for a total of 18 sites. Theextramedullary regions involved were thefollowing: limph nodes in 9 pts., liver in 4,subcutaneous tissue in 4, orbit in 2, spleenin 1, leptomeningeal in 1 The biopsied EMLshowed the following cytotype: plasmocyticin 10 pts, lymphoplasmacytic in 6 pts. andplasmablastic in 2 pts. The immunohistochemicalstudy on paraffin-embeddedbioptic material showed a clonal plasmacell population EMA+ CD 38+, CD 138+,with monotypic cytoplasmatic Ig restrictionin all cases.Two pts have been treated withmelphalan and prednisone , 1 with CVP, 1with CHOP, 2 with VMCP/VBAP, 2 with intermediate-dosecyclophosphamide, and 2with high-dose melphalan and ABMT. Aftera median follow-up of 96 months 5 pts died8, 10, 21, 26, 28 months after diagnosis,for progressive disease; the median survivalof the entire group was 28 months.Among the pts. surviving more than 60months, there were the two pts. affectedby EMP and one myeloma pt. with massiveadenopathic involvement. The mean survivalof the two EMP pts was70.5 months,while the median survival of the other myeloma-pts.was 24.5 months. Conclusions:From this study the following conclusionscould be drawn: • EMP is a plasma cell neoplasmwith a relatively good prognosis inrespect to “classic” MM. • MM presentingwith lymphoma-like, extensive extramedullaryvisceral lesions is a rare plasma celldisorder with a rapid course and a very dismalprognosis.

37 th Congress of the Italian Society of Hematology145P133BLOOD LIPID PROFILES INHEMATOLOGIC NEOPLASMSL. CALABRÒ, A. ALONCI, G. BELLOMO, G. SPATARI,C. QUARTARONE, O.TRINGALI, M. CINCOTTA, D. SAMÀ,C. MICALI, C. MUSOLINODivisione di Ematologia e Centro Trasfusionale,Università di MessinaIntroduction: Abnormal blood lipid profiles,have been reported in human malignancies.So, it is likely an overall involvementof tumoral cell metabolism. The AIMof this study was to evaluate clinico-biologicalimplications of altered lipid profilesin oncohaematologic patients. Patientsand Methods: The plasma lipids, lipoproteinsand apolipoproteins were determinedat the time of diagnosis in 50 previouslyuntreated patients (32M,18F, mean age 61years), 15 with Multiple Myeloma (MM), 19with lymphoproliferative disorders (LNH,LLC), 6 with acute leukemia (AL), and 10with chronic myeloproliferative disorders(CMD). Results were correlated with knownprognostic serum markers, such aslactate dehydrogenase (LDH), beta-2-microglobulin (β2m), thymidine kinase(TK), and soluble molecules (sICAM-1andsVCAM-1). Results: Altered blood lipid profileswere observed in oncohaematologicpatients. Statistically significant values includedelevated triglyceride levels (163.93± 115.43 vs 122 ± 98 mg/dl), reducedCholesterol ( 150.33 ± 50.75 vs 205 ± 35mg/dl), HDL-C (30.31 ± 13.84 vs 45 ± 10mg/dl) and Apo A (101.07 ± 42.72 vs 55,76mg/dl) levels. Significant correlations werefound between the cholesterol, β2m and TKlevels in patients with Multiple Myeloma(p

146 September 26-29, 1999 - Torino-Lingotto, ItalyP13599mTc-sestaMIBI SCINTIGRAPHY INWALDENSTRÖM’S MACROGLOBULINEMIAG. FALZARANO, A. DE RENZO, *S. DEL VECCHIO,L. CATALANO, *F. DI GENNARO, C. CALIFANO,*M. SALVATORE, B. ROTOLICattedre di Ematologia e di *Medicina Nucleare,Università Federico II, NapoliWaldenström’s Macroglobulinemia (WM)is characterized by nodular or diffuse lymphoid-plasmacell infiltration in bone marrow,increased serum monoclonal IgM proteinand frequent hepatosplenomegaly; lyticbone lesions are rare. Using 99m Tc-sestaMIBIbone scanning in multiple myeloma (MM),we have obtained not only images of focaluptake, but also images of diffuse skeletaluptake, proportional in intensity and extensionto the degree of plasma cell bonemarrow infiltration. This characteristicproved to be of potential use to quantitatedisease activity in MM. In the present workwe evaluated the utility of 99m Tc-sestaMIBIbone scanning in WM. We studied 8 patients,all with serum monoclonal IgM protein> 1 g/dl. Total body images were obtainedby scanning patients with a largefield of view camera (Elscint APEX SP6), 10minutes after the injection of 555 MBq of99mTc-sestaMIBI, and were ranked using ascore (MIBI score) based on intensity andextension of the skeletal uptake. The results,shown in the table, demonstrate acorrelation of the MIBI score with the degreeof limphoid-plasma cell bone marrowinfiltration and with the level of serummonoclonal IgM component (MC).MIBI scorePat. Age BM:%L/PC MC g/dl Extension Intensity Total1 47 5 2.3 1 1 22 58 8 1.1 0 0 03 66 9 1.1 0 0 04 71 10 2.7 1 1 25 71 20 1.6 3 1 46 54 40 1.2 3 2 57 72 67 2.2 3 2 58 84 85 4.3 3 3 6P136BONE MARROW UPTAKE OF99mTc-sestaMIBI IN PATIENTS WITHMULTIPLE MYELOMA*R. FONTI, *S. DEL VECCHIO, A. DE RENZO,*F. DI GENNARO, *L. PACE, L. CATALANO, C. CALIFANO,G. FALZARANO, *M. SALVATORE, B. ROTOLIHematology Unit and * CNR Nuclear MedicineCenter, Federico II University, NaplesIn a previous study, we showed the abilityof 99m Tc-sestaMIBI scan to identify activedisease in patients with multiple myeloma(Pace L. et al. Eur J Nucl Med; 25:714-720, 1998). In particular, asemiquantitative score of extension andintensity of bone marrow (BM) uptake correlatedwith stage of disease and plasmacell infiltration. In order to quantitate BMuptake of 99m Tc-sestaMIBI and to testwhether the radiotracer is localized withinthe plasma cells, BM samples from 23 multiplemyeloma patients and 3 healthy donorswere studied. After centrifugation overFicoll-Hypaque gradient, cell suspensionswere incubated with 1x10 6 cpm of 99m TcsestaMIBIfor 1 hour at 22°C. After severalwashes in ice-cold PBS, 99m Tc-sestaMIBIuptake was expressed as the percentage ofradioactivity specifically associated to thecells (specific cell activity /total activity).The intracellular localization of the tracerwas assessed by microautoradiography. Asub-group of 18 patients underwent 99m TcsestaMIBIscan a week apart from BM biopsy.Whole-body images were obtained 10min after the i.v. injection of 555 MBq ofthe radiotracer. The extension and intensityof 99m Tc-sestaMIBI uptake were gradedaccording to the semiquantitative scorepreviously described. A statistically significantcorrelation was found between in vitrouptake of 99m Tc-sestaMIBI and both BMplasma cell infiltration (r=0.51, p

37 th Congress of the Italian Society of Hematology147P137MYELOMA MONITORING BY99mTc-sestaMIBI SCINTIGRAPHYC. CALIFANO, A.M. PINTO*, F. DI GENNARO*, L. CATALANO,S. DEL VECCHIO*, L. PACE*, A. DE RENZO, M. SALVATORE*,B. ROTOLICattedre di Ematologia e di *Medicina Nucleare,Università Federico II, NapoliSkeletal X-ray survey is the conventionalmethod for studying bone marrow involvementin multiple myeloma (MM), but it cannotbe used as indicator of bone diseaseactivity after therapy. Conventional bonemarrow scintigraphy by 99m Tc-MDP is of novalue, because it does not detect bone lesionsin MM. Recently, 99m Tc-sestamibi, agamma emittent tracer used for myocardialperfusion studies, has been proposedas an imaging agent for a variety of humantumors, including MM. A previous comparativestudy with conventional skeletal surveyperformed in untreated or relapsedpatients showed that 99m Tc-sestamibi tracessites of active disease, showing skeletal andsoft tissue localizations. We compared 99m Tcsestamibiscans performed in five patientsbefore and after treatment for MM. Anteriorand posterior whole-body scans wereobtained 10 minutes after i.v. injection of555 MBq of 99m Tc-sestamibi, using a largefield of view camera (Elscint APEX SP6).Abnormal scans showed diffuse pattern ofuptake which were proportional to bonemarrow plasmacytosis, and focal uptake ifosteolyses (>0,8cm) were present. Pretreatmentabnormal 99m Tc-sestamibi scansbecame normal after effective therapy intwo cases. Conversely, three patients withevidence of refractory disease showed persistenceor increased pathological uptake.We are currently studying a larger numberof patients in order to evaluate the contributionof this method for assessing treatmentresponse in MM.P138ROLE OF SODIUM PAMIDRONATE INTHE THERAPY OF MULTIPLE MIELOMAM. TRESOLDI, F. ZUCCA, A. MALINGHER, G. COLOMBO,E. ZAPPONE*, A. PESCAROLLO*Department of Medicine, *Bone Marrow TransplantationUnit and Department of Hematology,Ospedale San Raffaele, MilanoIntroduction: Lytic bone disease and itscomplications are a matter of major concernin MM. Sodium pamidronate (PAMI)and other biphosphonates are the drugs ofchoice in controlling bone disease. Aim ofour study was the evaluation of this treatmentin a group of patients with stage IIIMM. Methods: We compared two groupsof patients. The first group (1990-1993) wastreated with conventional chemotherapyalone. The second group (1994-1997) wastreated with PAMI too, 90 mg i.v. every 28days. The evaluation of treatment efficacywas performed at 12, 18, and 24 monthsconsidering paramethers of some bonemetabolism (serum calcium and creatinine;number of bone lesions and fractures) andof disease activity (CRP, beta2microglobulin,albumin and MC). Results: At 12 monthsbetween the two groups (11 patients each)there was no evidence at Student’s-T testof a significant difference in the progressionof lytic lesions. After 18 (8 patientsper group) and 24 months (5 patients pergroup) in patients who did not receive PAMIthe increase in bone lesions proved statisticallysignificant (p

148 September 26-29, 1999 - Torino-Lingotto, ItalyP139PAMIDRONATE REDUCESMONOCLONAL IMMUNOGLOBULINSERUM LEVELS IN PLASMACELLDYSCRASIASG. BOLOGNA, S. CHIOCCHI, S. TARASCONI, D.GUARNERI,N. GIULIANI, P. BRESCIANI, C. MANCINI, P. SANSONI,F. QUAINIDepartment of Internal Medicine and BiomedicalSciences, University of ParmaMonoclonal gammopathies of undeterminedsignificance (MGUS) involve 3% upto 10% of the aged normal populationwhere osteoporosis is frequently observed.Bisphosphonates are widely used in thetreatment of primary and secondary bonediseases. In addition to the inhibitory actionon bone resorption, in vitro andin vivo studies on a second generationbisphosphonate, pamidronate, have documentedits antiproliferative activity on neoplasticplasmacells. To determine whetherpamidronate is able to affect immunoglobulin(Ig) secretion in plasmacell dyscrasias,20 osteoporotic patients with MGUS, 10 withmultiple myeloma (MM) and 2 withWaldenstroem Macroglobulinemia weretreated with 6 cycles of intravenouspamidronate 90 mg, monthly. The levels ofmonoclonal Ig were measured by serumelectrophoresis, immunofixation andnephelometry. Hematological and completebiochemical parameters were monitoredthroughout the course of therapy. In addition,Bone Mineral Density (BMD) andInterleukin–6 (IL-6) serum levels wereevaluated at the beginning and at the endof treatment. Results indicated thatpamidronate significantly decreased by20% (p

37 th Congress of the Italian Society of Hematology149dronate hasn’t induced changes in serumconcentrations of myeloma proteins, whileusing it every two weeks a reduction wasobserved (Dhodapkar). This could reflectwhat was observed in vitro (effects doseand time dependent) and could provide arevision of dose intensity of drug.P141QUANTIFICATION OF THE BENCEJONES PROTEINURIA IN THE FOLLOW-UP OF MICROMOLECULAR MULTIPLEMYELOMAP. YOUMSI, D. ASTORINO, C. DI BELLO, P. NAPOLI*,M. BOCCADORO, S. BATTAGLIO, A. PILERILaboratorio Ematologia Universitaria, AziendaOspedaliera “S. Giovanni Battista”, Torino;*Laboratorio Analisi, Ospedale Evangelico Valdese,TorinoMicromolecular multiple myeloma is characterizedby monoclonal free light chainsproduction which constitute the Bence JonesProteinuria (BJP). While there are somevalid methods for qualitative analysis of freelight chains, reliable systems for quantificationare not avaible. The clinical value ofquantitative evaluation of BJP in the monitoringof micromolecular multiple myelomahas been appraised. Moreover, we verifiedif the BJP quantification in 24 hours’ samplesmay be reliable. Some authors suggest toperform the evaluation in extemporaneoussamples to avoid the risk of proteic degradationfrom bacterical proteasis. Nephelometricquantification at time 0, after 24hours and after 48 hours from collection in50 urine samples has been performed.Urines were collected not sterily and keepup at 4°C. Samples contained a quantityof free light chains variable between 0,02g/l and 18g/l .Values obtained had a variationof 3,9% (sd ± 2,1); so proteic degradationin 24 hours’ samples does not affectthe quantification of BJP. We esaminated20 cases of micromolecular multiple myelomafor a period variable from 12 to 36months from diagnosis. In all casesexaminated, increase or decrease of BJPcorresponded respectively the increase orthe decrease of bone marrow plasma cells,confirming the correlation between free lightchains and tumoral burden. Qualitativemethods are needed at diagnosis (immunofixation);quantitative evaluation ofBJP by nefelometric methods are usefulfor disease monitoring, and proteic degradationdoes not play a relevant role in 24hours’ urine samples.P142IgD MONOCLONAL COMPONENTS ANDNEPHELOMETRIC DETERMINATION OFKAPPA/LAMBDA RATIOP. NAPOLI*, D. ASTORINO, C. DI BELLO, P. YOUMSI,M. BOCCADORO, S. BATTAGLIO, A. PILERI*Laboratorio Analisi, Ospedale Evangelico Valdese,Torino; Laboratorio Ematologia Universitaria,Azienda Ospedaliera “San Giovanni Battista”, TorinoThe Kappa / Lambda ratio (KLR) it’s normallyused in the monitoring of monoclonalgammaphaties. Often it’s indicated as theunique way to follow by nephelometricanalysis IgD monoclonal components, sincean anti-IgD antiserum it’s not available forthis instrument.The imbalance of KLR withoutIgG, IgA, or IgM monoclonal componentsit’s indicative of IgD or IgE monoclonalcomponents or free light chains. Inour laboratory four cases of IgD myelomaare been detected: at nephelometric measurementall samples had low levels of IgG,IgA, IgM, but only two of them showed KLRimbalance. Other two samples showed onlyan ipogammaglobulinemia, without anyevidence of a serum monoclonal component.Serum protein electrophoresis andimmunofixation showed an IgD monoclonalcomponent. In all cases the monoclonalcomponent represented the largest part ofseric immunoglobulins. The immunofixationexcluded the possibility of heavy chain diseasebecause it was possible to find in allcases the lambda monoclonal light chain(not detectable by nephelometer). The twosera without imbalance of KLR were treatedwith 2-mercapto ethanol at 1% for 30’at37°C in order to break S-S links and makelight chains recognizable by respective antisera.The value of KLR did not change after30’of treatement; after twelve hours ofincubation the value of KLR, even reduced,was not out of normal range. The nephelometricevaluation and the KLR is often (50%of cases) not able to detect IgD monoclonalcomponent even after a prolonged reductionof S-S links with 2-mercapto ethanol.

150 September 26-29, 1999 - Torino-Lingotto, ItalyP143SOLUBLE RESPONSES TO KLH INMYELOMA PATIENTS RECEIVINGIDIOTYPE-KLH CONJUGATES ASTUMOR-SPECIFIC VACCINES: ANINTERNAL CONTROL TO ASSESS THEIRIMMUNE COMPETENCE STATUSC. DI BELLO, D. ASTORINO, P. YOUMSI, P. NAPOLI*,M. BOCCADORO, M. MASSAIA, S. BATTAGLIO, A. PILERI,Lab. Ematologia Universitaria, Azienda Ospedaliera“San Giovanni Battista”, Torino; *Lab. Analisi,Ospedale Evangelico Valdese, TorinoIt is matter of debate whether the immunesystem of patients with multiplemyeloma (MM) can fully respond to antigenicstimulation in vivo after high-dosechemotherapy and peripheral blood progenitorcell (PBPC) transplantation. Thisissue is particularly relevant since immunebasedinterventions are currently under investigationin the setting of minimal residualdisease. We have evaluated the kinetics ofsoluble responses to KLH in 8 MM patientsreceiving idiotype/KLH conjugates as tumor-specificvaccines as a maintenancetherapy after high-dose chemotherapy andPBPC transplantation. KLH is commonlyused as a protein carrier to make idiotype(Id) immunogenic, but it can also be exploitedas an internal control to evaluatethe efficacy of the immunization schedule.Patients received a total number of 7 subcutaneousimmunizations. Antibody responseswere evaluated by comparingprevaccine serum samples with samplescollected after each single immunization,and one year after the last injection of Id/KLH conjugates. On average, there was aneightfold increase in anti-KLH antibody titerat the end of the vaccination. IgM antibodieswere detected after the first immunizationin 7/8 MM patients; they increasedafter the second, and reached the highestvalues between the third and the fifth immunization.IgG antibodies appeared afterthe first immunization in 8/8 patients; theywere boosted by subsequent immunizationsand reached the highest values between thefourth and the sixth immunization. Interestingly,IgG antibodies remained detectableup to one year after the last immunizationin 8/8 patients. By contrast, no increasewas observed in the titers of specificanti-Id antibodies Thus, the kineticsof antibody responses to foreign antigensis normal in MM after high-dose chemotherapyand autologous PBPC transplantation.However, more effective immunizationschedules are needed to obtain comparableresponses to self-antigens such as autologousId.P144INTERMEDIATE-DOSECYCLOPHOSPHAMIDE (3g/m 2 )+HIGH-DOSE DEXAMETHASONE IN MULTIPLEMYELOMA PATIENTS RELAPSINGAFTER AUTOLOGOUS STEM CELLTRANSPLANTE. ZAMAGNI, S. RONCONI, P. TOSI, M. CAVO, S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli” - Bologna University, ItalyIntermediate-dose cyclophosphamide hasshown effective in multiple myeloma (MM)patients refractory or relapsed after conventionalchemotherapy. In this study weaimed at evaluating the efficacy of this drugschedule when administered to patientsrelapsed after autologous stem cell transplant.From October ’97 to January ’99 13MM patients (9 male, 4 female) were administeredcyclophosphamide 1.5g/m 2 onday 1 and 3, in combination to dexamethasone40mg daily on day 1 to 4. Patient hadrelapsed after a median period of 12 months(range 4-41 months) after a single (n=8)or a double (n=5) autologous peripheralblood stem cell transplant. In 2 patientsprogression of the disease was demonstratedby the appearance of new bone lesions.A total of 26 courses were administered(median/patient=2, range 1-3); treatmentwas well tolerated, 5 patients experienceda WHO grade 3-4 neutropenia, while1 had severe thrombocytopenia. Therapywas completed on outpatient setting in 11patients, 2 patients required hospitalizationfor infectious complications that promptlyresolved. Out of 13 patients, 11 had a measurabledisease and were thus evaluable forresponse; 4 of them (36%) showed a reductionof M component >50%, in onecase a transiently negative serumimmunofixation was demonstrated. The remainingpatients showed a minor response(1 case) or disease progression (6 cases).Median duration of the response was 10

37 th Congress of the Italian Society of Hematology151months. All the patients showed a reductionof bone pain, when present. The preliminaryresults of this study prompt to findnovel and more effective salvage therapiesfor MM patients relapsed after autologoustransplant, including the administration ofa second line of (sub)myeloablative therapywith autologous stem cell rescue. The roleof this latter therapeutic strategy requiresvalidation by controlled studies.P145D-CEP FOR RESISTANT ORPROGRESSIVE MULTIPLE MYELOMA.A PILOTE STUDY*A. ANDRIANI, *M. BIBAS, °A. ROMANO* Dept. of Medicine, Section of Hematology, Osp.San Giacomo; ° Trasfusional Center, Osp. NuovoRegina Margherita ASL RomaFollowing the Barlogie’s experience weused the same therapy protocol withcontinuos infusion administration in thetreatment of resistant or progressive myeloma.We have treated 11 patients (6 M,5 F) range of age between 52 to 73 years(medium age 62) pretreated I, IIand III line chemotherapy (MPL+PDN,VAD o DAV, M2, MEV, CTX+DMZ,HDCTX+autotrasfusion, auto-transplant)their life aspectative being only few months;MMIgG (7k e 2l) 1 , MM (1) and 1 MMIgD(k). In all the patients were applied a centralvenous catheter port-a-cath like ordemi-appliable for continuos infusion for 4days of CDDP 25 mg/die, VP16 80 mg/die,CTX 750 mg/die. In addition was effectedone infusion of DMZ 40 mg/die. On 7 th daywas started G-CSF 5 ug/kg s.c. for day tillhematological recover, and in case of transfusiondependent anemia, was started EPO10000 UI for 3/days/w. The cycle was repeatedevery 28 days. In case of importanthematological toxicity or important infectionscomplicances the cycle was reducedto 3 days. Results: in 5 patients the infusionwere reduced as a consequences ofrenal insufficiency and in the IV° cycle wechanged the the CDDP with EADM 10 mg/mq i.c. for 4 days. One patient died afterthe second cycle for cardiac complicancedue to amiloidosys and 1 as a consequenceof cerebral accident with>100000 plts/mm3. Both during positive therapeutic answer2 patients have shaved a disease progressionbetween the II° and III° cycle; 4patients have concluded the six cicles having:2 RC (reduction > 75%) and 2 RP. 5patients have started the EPO but only in 3patients are valuable for response. Conclusions:the protocol with continuos CDDP,CTX, VP infusion may be useful in progressiveor resistant multiple myeloma. Our datashowed a 40% of answers, but we foundthe regimen toxic for previous treated patients.P146CYCLOPHOSPHAMIDE ANDPREDNISONE IN ADVANCED MULTIPLEMYELOMA PATIENTSB. ROSAIA, E. CAPOCHIANI, F. CARACCIOLO, F. PAPINESCHI,M. PETRINIDiv. di Ematologia, Dip. di Oncologia Universitàdegli Studi di PisaActually standard chemotherapy producesan average objective response (OR) of 60%in previously untreated patients, but lessthan 20% are in ongoing remission at 5years. Till to-day the most active regimenin refractory myeloma is VAD despite to seriousadverse effects. The problem ariseswhen the patients become refractory to bothmelphalan and al VAD or when patients’clinical conditions cannot let to tolerate orafford intensive therapy. A series of clinicalstudies have reported that the cyclophosphamideas a single drug or in combinationchemotherapy regimens is able to increaseduration of survival in this group of patients.From January 1990 to January 1997, 15patients with advanced multiple myelomareceived a chemotherapeutic regimen withcyclophosphamide and prednisone (CTX-ID1-3). Cyclophosphamide was administeredto 600 mg/m 2 i.v on day 1 e 3 and prednisonewas administered 2 mg/kg p.o fromday 1 to day 4 and from day 11 to 15, everythree weeks for six cycles. Median agewas 67.4 years (range 58-75); ratio male/female was 12/3. The M component wasIgG in 6 patients, IgA in 5, IgD in 1, lightchain kappa in 9 e light lambda in 6; 3showed micromolecolare myeloma. Fivepatients were stage II A ,1 II B, 8 III A, 1III B (Durie e Salmon staging): in stage Bmean creatinine level was 2.1 mg/dL. Beforetreatment mean hemoglobin level was11.4 g/dL, mean platelet count 216 x 10 9 /

152 September 26-29, 1999 - Torino-Lingotto, ItalyL, mean white blood cell count di 5 x 10 9 /L.The performance status (ECOG) was 1 in12 patients, 2 in 2 patients and 3 in 1 patient.The average duration of disease was1.8 years (range 1-3). Six patients receivedCTX-ID 1-3 as second-line therapy, 6 asthird-line therapy and 3 as more than thirdlinetherapy. Eight patients were relapsedstatus and 7 were refractory status. Nopatient showed a severe hematological andextra-hematological toxicity (WHO grade 3-4). The low toxicity has allowed us toadiminister the therapy without hospitalization.Our regimen resulted with a responserate of 73%: 33% of patients reached areduction of M component > 50% and 40%> 25 but < 50%. The mediam survival was23 months. The median progression-freesuvival for responder was 6 months. The responserate and moderate clinical toxicitysuggest that CTX-ID 1-3 could be given witha good outcome in non responder to standardchemotherapy patients.P147ORAL THERAPY WITH IDARUBICINAND DEXAMETHASONE FORREFRACTORY OR RELAPSINGMULTIPLE MYELOMAF. R OSSINI, I. MICCOLIS, S. BOLIS, M. PARMA, F. RIVOLTA,E.M. POGLIANIHaematology Unit. University of Milan. Monza Hosp.VAD regimen is widely employed in thetreatment of refractory or relapsing myeloma.While effective, this regimen requiresa central venous catheter andhospitalisation because of continuous fourdays infusion. To overcome these problems,different “VAD-hybrids” have been developed.We have employed a regimen includingonly oral therapy, with idarubicin anddexamethasone; this regimen, while maintaininga dose-intensity similar to otheridarubicin containing regimens, includes achronic prolonged administration ofidarubicin. Patients: Patients with multiplemyeloma in progression-relapse were included;no upper age limit was defined.Patients with recent myocardial infarctionor with LVEF lower than 50% were excluded.Therapy: Five or six courses of oral ZDtherapy were given; they included:Idarubicin 3 mg/sqm/day days 1,3,5,8,10,12,15,17,19; next course was plannedto start at day 36. Starting form course 2,idarubicin dosage could be increased to 6mg/sqm/day according to hematologicaltoxicity. Dexamethasone was given at adose of 40 mg/day days 1->4 and 8->11.Support with growth factors was allowed.Maintenance was begun one month afterthe end of last course and included α-interferon3 * 10^6 units three times a weekand Dexamethasone 40 mg/day days 1->4 every other month. Results: 10 pts weretreated (6 males 4 females), 5 IgG, 2 IgA,2 BJ, 1 IgD); mean age was 64 (range 41-74); mean duration of disease was 29months (range 9-52). Three pts had progressivedisease after MP; 7 were relapsed(mean distance from last therapy 14.4months. Three had already receivedadriamycin (median dosage 300 mg.) andfour pts dexamethasone (mean dose 900mg.). Three had received an autologousstem cell transplantation (median 18months before) after treatment with VAD,cyclophosphamide (7 g/sqm), EDHAP,melphalan (140 mg/sqm). At the beginningof ZD therapy, three patients were in stageII and 7 in stage III. Mean marrowplasmacellular infiltration was 43% (range17-90%). Outcome: Three patients achieveda complete remission (now maintainedat 2, 7, 13 months); two patients a partialremission, 1 stable disease; one pt died formyeloma progression after two courses;three pts have not yet concluded inductiontherapy. No patient had to stop therapybecause of cardiac toxicity; no pt had to behospitalized because of infectious or othercomplications.P148A PILOT STUDY WITH ORALIDARUBICIN AND VINORELBINE INPATIENTS WITH ADVANCED MULTIPLEMYELOMAP. MUSTO, M.L. VIGLIOTTI, M.P. PETRILLI, G. D’ARENA,C. BODENIZZA, A. FALCONE, S. MANTUANO, G. SANPAOLO,P.R. SCALZULLI, M. CAROTENUTODivision of Hematology, IRCCS “Casa Sollievo dellaSofferenza”, S. Giovanni Rotondo, Italy.In order to explore the therapeutic role ofthe combination of oral idarubicin (IDA) withvinorelbine (VNR), 19 patients (7 m and12 f, mean age 61.3 yrs, range 35-76) withstage IIIA, relapsed or resistant (after 2 to

37 th Congress of the Italian Society of Hematology1535 lines of CT +/- RT) multiple myeloma (MM)entered this pilot study. Previous treatmentsmainly included oral melphalan plusprednisone, VAD or VAD-derived regimens,intermediate dose cyclophosphamide plusdexamethasone, i.v. melphalan, interferon.Five patients had also undergone high dosechemotherapy followed by one or moreperipheral blood stem cell transplants. M-component was IgG in 11 patients, IgA in5, while 3 patients had light chain or nonsecretory MM. IDA (ZAVEDOS, Pharmacia-Upjohn) was given at the dose of 12 mg/sqm p.o. on days 1, 3 and 5, every 4 weeks;VNR (NAVELBINE, Pierre-Fabre Pharma)was administered as 15’ i.v. infusion of30 mg/sqm, every two weeks. One patientdied after four days of treatment with severepancytopenia. Four subjects interruptedthe study after one month becauseof progressive disease (3 patients) and cardiacfailure (1 patient with pre-existing valvulardefects). Six patients experiencedsevere (WHO 3-4) hematological toxicity,while in 2 subjects nausea and vomitingoccurred. Among the 13 patients who havecompleted at least 2 and until to 6 monthlycycles, 5 showed progressive disease, 4manifested a clinical response with reductionof bone pain and stabilization or moderatereduction of M-component and bonemarrow plasma cell infiltration, 4 achieveda decrease of M-component > 50 %. Interestingly,all 4 major responders were characterizedat baseline by limited or evenabsent neoplastic marrow infiltration andshowed extramedullary localizations of thedisease (skin, liver, breast, muscles, pelvis,intracranial), which completely disappearedunder treatment with IDA + VNR.Response duration ranged from 2 to 11months. We conclude that the associationof oral IDA and VNR may have significanteffects in a subset of heavily treated patientswith advanced MM. Extramedullarydisease seems to be particularly sensitiveto this regimen.P149AMIFOSTINE IN CONJUCTION WITHH.D.VP16 AND G-CSF ENABLES PBSCCOLLECTION IN MULTIPLE MYELOMAPATIENTS WHO FAILED CTX INDUCEDMOBILIZATIONV. PITINI, C. ARRIGO, G. ALOI, C. MICALI*, M. PICCIOTTO,A. CASTRO, F. LA TORREDepartment of Medical Oncology, *Blood Center,University of Messina,ItalyCurrently high dose cycloposphamide(CTX) 4-7 g/mq plus haematopoietic growthfactor is considered one of the most effectivemethod to mobilize PBPC even if in M.M.patients PBPC harvesting might be moredifficult than in patients with other malignancies. Recent studies suggested thathamifostine stimulates in vivo hematopoiesisand enhance PBPC mobilization whenused in addition to epirubicin and G-CSFand that high dose VP16 or regimen VP16containing may be considered a suitablealternative for those patients who fail CTXinduced mobilization. We report our experiencewith a high dose of etoposide (VP16)2g/mq plus G-CSF 10µg/kg started 24 hafter chemotherapy and administered untilthe last day of leukapheresis plusamifostine iv for 5 days (day 0: 1000mg ;days 1 –4: 500mg/d), in four patients withM.M. who failed mobilization with CTX 5g/mq plus G-CSF 10 µg/kg (CD34+ cells /µlmedian peak values : 8.5) after 3 regimensof VAD and before melphalan 100mg/mq(Mel 100) at day 30° - 90° - 150°. All patientswere stage III (Durie and Salmon),mean age 55 years ; PS 1-2; 1 female; 3male ; 2 IgGK; 1 IgGλ, 1IgAK. VP16 plusG-CSF and AMI resulted in a statisticallysignificant (P

154 September 26-29, 1999 - Torino-Lingotto, ItalyP150AUTOLOGOUS PERIPHERAL BLOODSTEM CELL TRANSPLANTATION (APBT)FOR MULTIPLE MYELOMA:THE EXPERIENCE OF A SINGLECENTREL. CAMBA, M. MARCATTI, P. SERVIDA, E. ZAPPONE,M. BERNARDI, F. CICERI, F. DI MARCO*, M. TRESOLDI*,A. VICARI*, C. BARGIGGIA, E. BENAZZI, P. RONCHI,S. ROSSINIBMT Unit, Haematology and *Medicine Departments,S. Raffaele Hospital, Milan, ItalyHDCT (high dose chemotherapy) andAPBT has improved survival of patients(pnts) with MM in advanced DS stage, withrefractory or progressing disease and relapsedafter conventional chemotherapy.Recently, we have transplanted sixteen pntswith MM with the following pretransplantfeatures: 13 pts with DS IIIA, 1 pt with DSIIA, 2 pts with DS IIIB. Eleven pts weretreated with VAD, 1 pt with MP, 3 withMP→VAD, 3 with VAD + local radiotherapy.Two pts were transplanted with refractoryand progressing disease, all the others werestill responsive to 1 st and 2 nd line treatment.PB progenitor cells were mobilised with cyclophosphamide7 gr/mq and G-CSF. TwoHDCT regimens were employed: the 1 st 10patients received TBI 10Gr + Mel 140 mg/mq (MTBI), the following 6 pnts weretreated with Mel 200 mg/mq (M200).Haematological toxicity was similar for bothtypes of HDCT: median neutropenia andthrombocytopenia duration was 11 vs 11.5and 11 vs 12 days respectively. In neitherHDCT protocols were there transplant relateddeaths (TRD). Seven of the 9 MTBIand 2 of the 6 M200 pnts died 3 to 42 and4 to10 months post APBT respectively. Thechief cause of death was disease relapse orprogression. This was particularly aggressivein early relapsed pnts: rapid progression,plasma cell leukaemia, extramedullarydisease. Two MTBI pts went for a 2 ndAPBT with M200 following relapse: 1 diedin disease progression and polyneuropathy,the other is currently in stable disease.Another MTBI pt received a BMT from herHLA-compatible brother, but died of pulmonaryaspergillus 35 days post BMT. Theseresults, albeit limited to a single BMT centre,confirm 1) the low TRD rates in APBTfor MM both with TBI and non-TBI HDCTprotocols, 2) it emphasizes the low responserate when APBT is carried out in progressingor refractory disease. Finally, it si worthnoting the high incidence of aggressive diseaseforms of MM in pnts with early relapseafter HDCT and APBT.P151HAEMATOLOGIC ENGRAFMENT ANDCLINICAL OUTCOME IN MYELOMAPATIENTS TREATED WITH HIGH-DOSETHERAPY AND REINFUSED WITHPOSITIVELY SELECTED PERIPHERALBLOOD PROGENITORS CELLSF. PATRIARCA, R. FANIN, D. DAMIANI, S. GRIMAZ,F. SILVESTRI, A. GEROMIN, A. SPEROTTO, M. CERNO,A. ERMACORA, R. STOCCHI, F. ZAJA, M. BACCARANIDivision of Haematology and Departement of BoneMarrow Transplantation. University Hospital, UdinePositive selection of peripheral blood stemcell (PBSC) has been investigated in multiplemyeloma (MM) with the aim to reduceplasma cell (PC) contamination of theleucaphereses and improve clinical outcomeof autografted patients. In our Centre 39untreated patients, with stage II and III MM,younger than 65 years, started on an highdosetherapy consisting of 4 VAD cycles,collection of PBSC mobilized by 7g/m 2 Cyclophosphamide+ G-CSF, myeloablativetreatment with 12mg/Kg Busulfan plus 120mg/m 2 Melphalan. In 23/39 patients (59%)the leukaphereses were processed to positivelyselect CD34+ cells using anavidin-biotin immunoaffinity device(CEPRATE,CellPro). A reduction of PC contaminationup to 2 log was evaluated in thepostselection products by a biparametriccytofluorimetric tecnique (CD138,cytoplasmatic light chain). Haematologicreconstitution and clinical outcome of the23 patients reinfused with selected CD34+cells (SEL group) were compared with the16 patients reinfused with unselected cells( UNSEL group). No statistical differencewas observed between the 2 groups regardto median duration of neutropenia andthrombocytopenia, haematologic support,incidence of febrile episodes andbacteriemias. At a median follow-up of 18months after ASCT (5-34), continuous completeremissions were 7/23 (32%) in theSEL group and 4/16 (25%) in the UNSEL

37 th Congress of the Italian Society of Hematology155group; continuous partial remissions were10/23 (42%) and 5/16 (31%) respectively.Two patients in the SEL group and one patientin the UNSEL group were dead for progressivedisease. Our data shows that positiveselection allows a rapid engrafment ofhaematopoiesis and a low morbility. Longerfollow-up is needed to evaluate the effectof CD34+ selection on the clinical outcomeafter ASCT.P152AUTOLOGOUS PERIPHERAL STEM CELLTRANSPLANTATION (APSCT) IN 34MULTIPLE MYELOMA (MM) PATIENTSP. DESSALVI, P. CASULA, M.G. CABRAS, G. LUXI, G. BROCCIADivisione di Ematologia, Ospedale Oncologico“A. Businco”, CagliariMaterials. From 01.02.94 to 16.03.99,on 34 patients with MM (18 M and 16 F,median age 56.5, range 39-66) 56 APSCTwith unmanipulated cells aftermyeloablative chemotherapy were performed;there were 20 tandem APSCT, and1 triple. The patie nts either followed nationalprotocol Bologna 96 and its earlierversions (or followed it a latere due to incompletemeeting of the inclusion criteria[group 1, n = 22]); or were transplantedoff protocol due to previous chemotherapy(group 2, n = 12). The median diagnosistransplanttime was 180 (155-807) and 600(171-4940) days, respectively. Results. Asto 7.04.99, 25 patients are alive and 9 died(6 of MM, 2 TRM, 1 infection). Overall survival(all patients) is 49% at 1850 days.Progression-free interval: probability 20%at 1580 days. No difference was observedbetween first and second transplants interms of toxicity. Among the 12 off-protocolpatients, a subset of 8 patients was considered.All of them entered the autotransplantphase after a conventional treatmentperiod of at least 360 days (time diagnosis-transplantation371 to 4940 days). 8/8patients had received melphalan/ PDN ±VAD or CTX; 2/8 were also given IFN-α for1.5-2 years. No difference was found betweenthese 8 pretreated patients and theremaining 26 (APSCT front-line) in termsof overall survival and of progres sion-freeinterval. Furthermore, transplant-relatedtoxicity was approximately the same. Ofparticular interest is that, in our patients,peripheral CD34+ cells harvesting, althoughsignificantly poorer in the 360 dd pretreatedpatients (median CD34+ 5.76 vs11.88 x 10 6 /kg, p = 0.0006), was stillenough to allow at least 1 APSCT (and 2 intwo cases). Conclusions. APSCT withunmanipulated cells in multiple myelomadoes not appear to obtain the eradicationof neoplastic cells; on the other hand, thisprocedure seems reasonably safe and ofmoderate toxicity (TRM among our patients= 3.5%). Our results on 8 patients pretreatedwith conventional chemotherapy ±IFN-α - although some bias due to patients’selection is likely to have occurred - wouldsuggest that a delay of autotransplantation,at least in some patients with favorableprognostic factors at diagnosis, could beworthy of further investigation.P153DOUBLE AUTOLOGOUS PERIPHERALBLOOD STEM CELL TRANSPLANT INMULTIPLE MYELOMA PATIENTSS. RONCONI, M. CAVO, P. TOSI, E. ZAMAGNI, M. BENNI,R.M. LEMOLI, M.R. MOTTA, S. RIZZI, S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli”, Bologna UniversityAutologous peripheral blood stem celltransplant has shown better results comparedto conventional chemotherapy inmultiple myeloma (MM), as it allows administrationof higher doses chemotherapywith negligible systemic toxicy. In order tofurther increase dose intensity, double autologoustransplant has been recently proposed.In our Institution, between October’94 to October ’97, 47 patients (29 male,18 female, median age 49 years), withnewly diagnosed symptomatic MM, havecompleted a therapeutic program including4 courses of conventional chemotherapy(VAD), followed by cyclophosphamide 7g/sqm + G-CSF 5µg/kg/day and peripheralblood stem cell collection (median 17.2 X10 6 CD34/kg). Patients have been subsequentlysubmitted to double autologousstem cell transplant (ASCT), preparativeregimens were melphalan 200mg/sqm(ASCT1) and busulfan 12mg/kg+melphalan 140mg/sqm (ASCT2). Mediantime to therapy completion was 14 months,the procedure was well tolerated, mediantime to PMN > 500/mmc was 10 days after

156 September 26-29, 1999 - Torino-Lingotto, Italyboth transplants; febrile episodes weremore frequent after ASCT2 (59.2% vs28%), extra-hematologic toxicity wasmerely represented by oral/gastrointestinalmucositis and was comparable (15%and 21%) after ASCT1 and ASCT2 respectively.The whole therapeutic program determineda progressive increase in the percentageof stringently defined completeremissions (CR); disappearance of M proteinat immunofixation analisys was demonstratedin 2% of patients after VAD, 6%after cyclophosphamide, 25% after ASCT1and 36% after ASCT2. The probability ofachieving CR was higher in patients whohad previously shown sensitivity to conventionalchemotherapy (60% vs 28% inchemorefractory patients). Our preliminarydata demonstrate that double autologousstem cell transplant is a safe preocedureand can progressively increase the percentageof CR. Results of controlled trials comparingsingle vs double ASCT, however, areneeded in order to determine the effectson survival. One of such trials (Bologna ’96),coordinated by our Insitution, is presentlyunderway.P154DOUBLE VERSUS SINGLE AUTOLOGOUSTRANSPLANTATION OFHEMATOPOIETIC CELLS IN MULTIPLEMYELOMA PATIENTS INCREASES THERATE OF CLINICAL REMISSION BUTNOT OF MOLECULAR REMISSIONC. TERRAGNA, G. MARTINELLI, M. CAVO, R.M. LEMOLI,G. BANDINI, E. ZAMAGNI, S. RONCONI, P. TOSI,S. MANGIANTI, M.R. MOTTA, M.S. ZAGARELLA, N. TESTONI,M. AMABILE, E. OTTAVIANI, S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli”, University of BolognaTo assess the role of molecular analysisin the clinical follow up of patient with multiplemyeloma (MM), we have planned molecularmonitoring of minimal residual disease(MRD) for patients in strictly definedcomplete clinical remission (CR) after singleor double autologous transplantation. 240MM patient entered in the study: 68 ptswere autotransplanted from HLA identicaldonor; 172 were autotransplanted: 82 witha single and 90 with a double autotransplant.Clonal markers based upon the rearrangementof immunoglobulin heavychaingenes were generated and used formolecular monitoring after transplantationon 44/52 MM patients who achieved CR(14 allogeneic, 13 single and 17 doubleautografting ) having a molecular marker.In the allografting setting, 15/68 (22%)patients achieved CR; 14 patients in CRhaving a molecular marker were submittedto a retrospective molecular analysis:10 patients (14.7%) achieved molecularremission (MCR). In the autografting setting,a total of 36/172 (20.9%) patientsachieved CR; in 30 patients in CR we obtaineda patient-specific marker and thepatients were submitted to prospectivemolecular analysis. 82 patients were submittedto high-dose chemotherapy followedby single autografting; 71 of them receiveda single un-manipulated autograft: 8 patientsachieved CR (11.2%) and 6 of themwere studied by means of patient-specificmarker: 1 achieved MCR (1.4%). 11 patientsreceived a single double-selectedautograft (CD34+/Blin- cells): 7 achievedCR (1 non-secretory) (63.6%) and all werestudied by means of patient-specificmarker: 1 achieved MCR (9.1%). 90 patientswere submitted to doubleautografting: 62 patients undergone doubleun-manipulated autografting and 15 ofthem achieved CR (24.1%); 12 were molecularlystudied and 2 patients obtainedMCR (3.2%). 28 patients were re-infusedwith selected apheresis (CD34+ cells): 7of them achieved CR (25%) and 5 weremolecularly studied: 1 patients obtainedMCR (3.6%). So, 5/172 autotransplantedpatients obtained MCR.This work was supported by Italian Associationof Cancer Research (A.I.R.C.), by Italian C.N.R.no. 98.00526.CT04 , by MURST 40% targetprojects and by “30 Ore per la Vita” A.I.L. grants.

37 th Congress of the Italian Society of Hematology157P155AUTOLOGOUS PERIPHERAL BLOODSTEM CELL (PBSC) DOUBLETRANSPLANTATION AS FIRST LINETREATMENT FOR MULTIPLE MYELOMA:PRELIMINARY RESULTSM. TRIBALTO , G. ADORNO, T. CARAVITA, L. CUDILLO,T. DENTAMARO, S. SANTINELLI, A. SINISCALCHI, A. VENDITTI,M. LIBERATI, A. TABILIO, M. MARTELLI, S. AMADORIDivision of Hematology, Tor Vergata University,Rome; Division of Hematology, University ofPerugiaThis study was designed as follows: 1)Pre-transplant cytoreduction by mean of 3monthly cycles with a VAD-like treatment;2) PBSC collection after mobilizationtherapy with ciclophosphamide 7 g/sm +G-CSF; 3) Conditioning therapy withmelphalan (60 mg/sm) + busulphan (16mg/Kg) followed by the infusion of PBSC;4) II autotransplant, to be performed within6 months, for patients not achieving CR, orat the moment of relapse, with melphalan,200 mg/sm, as conditioning regimen, plusPBSC mobilised with G-CSF alone. 5) Maintenancetherapy with interferon, at conventionaldosage. Starting from January, 1996,21 consecutive patients (14 males, 7 females,median age 56, range 34-61) enteredthe study. After a median follow-upof 23 months, 14 patients completed thefirst transplant, achieving 5 of them the CR,(lasting 9+, 18+, 21+, 22+, and 27+months), 8 the PR, while 1 patient did notrespond (

158 September 26-29, 1999 - Torino-Lingotto, Italybut 36% after MEL120. Severe mucositiswas 10% after MEL80, 14% after MEL100and 44% after MEL120. Herpes Zooster infections,pneumonia and gastrointestinaltoxicities were encountered in 5-10% ofpatients and their incidence did not significantlychange among different melphalandose groups. After MEL80, MEL100 andMEL120, no response was 15%, 12% and15% respectively; partial response (>50%)was 85%, 88%, and 85%; complete remissionwas 28%, 47% and 43%. All data areon intent to treat basis. Median event-freesurvival was 31 months for patients receivingMEL80, 34 for MEL100, and 30+ monthsfor MEL120. In conclusion, the differentmelphalan doses tested showed clinical efficacyand slight increase in toxicity afterMEL120.P158WALDENSTROM’SMACROGLOBULINEMIA: A CASEOF CURE?R. BERTÈ, D. VALLISA, G. CIVARDI, B. FERRARI, G. SBOLLI,G. NIFOSÌ, L. CAVANNA1 st Division of Internal Medicine - Hematology,Piacenza HospitalWaldenstrom’s macroglobulinemia (WM)is a low-grade lymphoproliferative disorderinvolving monoclonal B lymphocytes synthesizingIgM immunoglobulin. Increasedcirculating IgM proteins cause: hyperviscositysyndrome including skin and mucosalbleeding, visual disturbances, and a varietyof neurological manifestations. No standardprognostic classification has provenpredictive value thus making managementdecisions difficult. We report a patient affectedby WM who achieved complete remissionunder chemotherapy and splenectomy.In 1984 a 41-year-old white man wasadmitted with a two months history of fingerpain exacerbated by cold. Physical examinationrevealed splenomegaly and hyperviscositysindrome. Serum protein electrophoresisdisclosed a monoclonal spike of10g/dl substained by IgM kappa. Completeblood count revealed only mild anemia.Bone marrow biopsy showed infiltration bysmall lymphocyte population consistentwith low-grade B-cell lymphoma. The patientunderwent 10 plasmapheresis, thereafterhe was treated with a chemotherapyregimen consisting of vincristine, cyclophosphamide,busulphan prednisone (M2 Protocol)until april 1985. At the end of treatmentsplenectomy was executed. At bonemarrow reevaluation clonal lymphocyticinfiltration was not detected, IgMmonoclonal protein disappeared atimmunofixation as well as finger pain. Thepatient was manteined on chlorambucil andprednisone until 1987. His complete remissionis lasting 14 years; the patient wasreevaluated in April 1999: bone marrow isnormal, immunofixation discloses no Mcomponent. Survival in WM is variable, witha median of 5 to 7 years. The prognosis ofWM is quite similar to other indolent lowgradelymphomas. WM is reported, so far,as a not curable disease. The current case,indeed, shows that W.M. may achieve C.R.and, occasionally moreover, may be cured.P159ACQUIRED BLESSING DISORDER INMULTIPLE MYELOMA WITH ALAMYLOIDOSIS: IMPROVEMENT AFTERCHEMOTHERAPY + E.V.IMMUNOGLOBULINSA. DARBESIO, P.C. SCHINCO*, E. BERTOLDO,N. RAVARINO°, V. BATTISTINIDivisione di Medicina, Ospedale Civico di Chivasso;*Divisione di Ematologia dell’ Università di Torino;Azienda Ospedaliera S. Giovanni Battista di Torino;° Divisione di Anatomia Patologica, OspedaleMauriziano Umberto IAcquired clotting disorders related to thepresence of plasmatic inhibitors (usuallyfactor VIII inhibitor) can be features of autoimmuneor neoplastic diseases or appearas primitive events. Acquired factor X deficiencyhas been described in cases of ALamyloidosis, probably related to adsorptionby amyloid fibrils. Here we describe the caseof a 68 year old man with multiple myelomaand systemic amyloidosis who presentedwith severe blessing, related to factor Xdeficiency, and subsequently improved afterchemotherapy + i.v. immunoglobulins.The patient, affected by multiple myelomaand systemic AL amyloidosis since 1996,relapsed in March 1999 after previouschemoterapy with melphalan and prednisone.He presented important hemorrhagicsigns: petechiae and large hematomas.Laboratory tests showed prolonged PT

37 th Congress of the Italian Society of Hematology159(INR 4.2) and aPTT (95”), moderate thrombocytopenia(70000/ml), normal ATIII andD-dimer values. Factor X was moderatelydecreased (23%), with possible presenceof plasmatic inhibitors; conversely, factorVIII, XI and fibrinogen were in the normalrange. Seric monoclonal component was 2.4g/dl. The patient was treated with i.v. cyclophosphamide(500 mg/m 2 /day x 2) +prednisone, high dose i.v. immunoglobulins(400 mg/kg/day for 8 days), and prothrombincomplex concentrates. Resolutionof hemorragic symptoms and improvementsof laboratory values (INR 3.2; aPTT 56”)were obtained. Our case confirms the possibility,in AL amyloidosis patients, of factorX deficiency related to plasmatic inhibitors,with more severe hemorrhagic symptomsthan expected on the basis of laboratoryvalues. The possibility of clinical andlaboratory improvement following adequatetherapy makes it advisable an accurate coagulationscreening, and particularly factorX dosage, in diagnostic procedures forAL amyloidosis patients.P160MULTIPLE MYELOMA AND BONEMARROW EPITHELYOID GRANULOMAS:A REACTIVE, THERAPY-SENSITIVEMANIFESTATION, INDEPENDENT FROMDISEASE’S ACTIVITYM. MARINO, A. ANDRIANI* , M. BIBAS* , P. D’ALESSANDRO,F. STELLA, M.E. MARTINIDept. of Pathology and *Division of Medicine,Hematology section, S.Giacomo Hospital, ASL RM A,RomeA 65-years old female patient with amonoclonal Ig G (k) gammopathy, followedby our Hematology since 1995, developedin 1996 a myeloma. She was treated with6 cycles of Melfalan and Prednisone, and acomplete remission was achieved in Decemberof the same year. In 1997 the monoclonalserum component increased, andmultiple osteolytic lesions appeared.Therefore the patient was treated with Interferonand AREDIA cycles. In December1997 for the first time multiple, nonconfluent,non-caseating epithelyoid granulomaswere seen in the bone marrow trephinebiopsy, whereas the myeloma cellsconstituted only 5-10% of the bone marrowpopulation. Concomitant sarcoidosis ortbc were excluded. Epithelyoid granulomaspersisted in the bone marrow even in Juin1998 (the myeloma was still in remission).In October 1998 a florid granulomatousreaction was seen in the bone marrowtoghether with an increase of the myelomainfiltration ( 40-60% of the bone marrowpopulation). Epithelyoid granulomas weresurrounded by a conspicuous T-lymphocytepopulation. Since the end of 1998 the patienthas been treated with DAV cycles, andin March of this year a reduction ( 20-25%) of myeloma infiltration in the bone marrowwas achieved, toghether with completedisappearance of granulomas. Epithelyoidgranulomas have been very rarely describedin the bone marrow of myeloma patients.In our case their presence did not correlatewith disease’s activity. Desametazone treatmentcould play a role in the presentgranuloma’s disappearance.P161INTRACTABLE DIARRHEA INAMYLOIDOSIS: SUCCESSFUL USE OFOCTREOTIDE: CASE REPORTA. D’ARCO, P. DANISE, V. SALVATORE, G. AMENDOLA,M. AGRUSTA*, L. PAGANO*Department of Internal Medicine; Division ofCardiology* – Hospital of Cava Dei Tirreni (SA)The Autors report the successful use ofoctreotide to treat intractable diarrhea in apatient with systemic amyloidosis.A 66-year-old man who was occasionally foundto have a MGUS IgG/λ, suffered from weaknessand dysuria since september 1997.Subsequently he developed perinealparesthesias. Prostatectomy failed to improvethe urinary symptoms. Because ofwheight loss and extension of paresthesiashe was admitted into our ward. The testsperformed revealed proteinuria and brightthickness of the heart wall. The suspicionof amyloidosis was confirmed by umbelicalfat biopsy performed in Pavia by Prof.Merliniand a trial with standard dosage of alkeranand prednisone was begun. In the meantime very serious orthostatic hypotensionand intractable diarrhea appeared, with 10-20 daily watery bowel movements. Neurologicaltest showed evident autonomic neuropathy.An endoscopic examination withbiopses and stool cultures were normal ornegative.The patient had an extremely low

160 September 26-29, 1999 - Torino-Lingotto, Italyquality of life and numerous attempts withseveral drugs failed to improve hiscondition.At this point we felt it opportuneto begin therapy with octreotide, 100 mcg,tid, sc: the diarrhea ceased whitin 3 days.The drug was tapered over 10 days and thesymptom reoccurred whitin few days andpromptly ceased again when the therapywas restarted. The patient continued to receivethe drug at a dosage of 100 mcg dailyuntil total and stable normalisation of thebowel movements. From the on he receivedthe drug only when necessary. He died 4months later of heart failure. Conclusion:the involvement of gastroenteric tract iscommon in amyloidosis, but such severediarrhea is unusual. The symptom can haveseveral causes such as amyloid infiltration,bacterial overgrowth and neuropathy. Wecannot be sure of the pathogenesis of thiscase, but the absence of amyloid infiltrationin the samples of the intestinal biopses,the negative cultures and the coexistanceof severe orthostatic hypotension makesauthonomic neuropathy very probable. Wewere able to find only 2 other reports ofthis particular use of octreotide. We think,by now, its usefulness in authonomic diarrheais certain and can be considered.P162abstract not receivedP163PULMONARY AND PLEURIC RELAPSEOF MULTIPLE MIELOMA AFTERCONVENTIONAL THERAPY. OUROBSERVATION ON TWO PATIENTSA.A. QUIRINO, L. MASTRULLO, I. ARONNE, M.L. BOFFA,A. CAROLA, C. COTARELLI, R. IODICE, E. SALERNO,L. ZIELLO, E. MIRAGLIADepartment of Hematology- Hemophilia andThrombosis Center- Cent Thalassemia Center,Nuovo Pellegrini Hospital, ASL NA1, Naples Italy.Chairman prof. E. MiragliaTwo female patients, respectively 75 and72 aged, affected by Multiple Mieloma IgGkand treated with VMCP therapy for anamount of 12 courses. After 8 months followingRC they had a desease relapse allocatedin lungs and in pleura, and a considerablepleural effusion. The C.T. showedsome nodular areas, cm 1 sized, on pulmonaryparenchyma, with related pleuric effusion.The examination of the exudateobtained by thoracentesis, three times performed,determined respectively 3000 and2000 WBC/mc at Coulter cells count.Immunophenotyping performed by flowcytometry with a panel of MoAb, on singleand double fluorescence (CD10, CD20,CD15, CD7, CD3, CD34, HLA-DR, CD45/14,CD19/k, CD19/lamda, CD138/38, CD138/56) demonstrated that 90% of cells had aplasmacellular phenotype and 10% were Blynphocytes, k+ chains expressive. Smearsexamination of pleuric exudate, stained withMay Grunwald Giemsa, confirmed flowcytometric evidences. Bone Marrow examinationsupported desease relapse, confirmedby IFE performed on blood sample.Immunophenotyping of lymphocytes byMoAb didn’t detected plasmacells in peripheralblood. The patients were submitted toVCAP chemotherapy and after 3 courses acomplete resorbtion of pleuric effusion wasachieved and after subsequent 3 courses asignificant loss of pulmonary spots too. Onepatient died after 6 courses because of anacute myocardial infarction, the other patientactually alive is receiving monthlychemotherapy since a plasmacells prevalencein B.M. of 40% and in serum an IgGkvalue of 2510 mg/dl persists.P164GAMMA HEAVY CHAINS DESEASE INPATIENT AFFECTED BY MINKOWSKY-CHAUFFARDE. CUPELLARO, S. GUARINO, A. CHIERICHINI, C. CIABATTA,F. CICCONE, A. CENTRA, S. NARDELLIDepartment of Hematology, S.M.Goretti Hospital,Latina – ItalyIn november 1979, a 41 years old man,was admitted in our department, for ConstitutionalHaemolitic Jaundiced, after splenectomyand gastrectomy in other institution.After a short observation, because ofincreasing lymphocitosis and onset of amonoclonal IgG paraprotein, was diagnoseda B-cell lymphoproliferative cronic disorder.For the presence of mild anaemia,wasstarted a treatment with low doses steroidsand folic acid. After eighteen yearsobservation,the evolution of laboratory parameters(bone marrow biopsy and aspi-

37 th Congress of the Italian Society of Hematology161rate, liver biopsy and immunoelectroforesis)allowed the diagnosis of gamma-heavychains desease. The patient has beentreated with alkylanting agents (chlorambucil-melphalanorally every other month,plus low doses of steroids) with goodresponce,characterized by resolution ofanaemia and decreasing of paraprotein andlymphocitosis. We can suppose tha earlysplenectomy, influenced the evolution ofcronic lymphoproliferative disorder, delaiingthe evidence. Unclear is the onset of rareimmunoproliferative desease, usually no directlyrelated with low grade lymphocitemalignancies.P165A CASE OF AL AMYLOIDOSIS WITHSEVERE CARDIAC, RENAL ANDAUTONOMIC DYSFUNCTIONA. DEL SANTO 1 , M.G. GIOVAGNONI 1 , S. SIBONI 1 ,M. GALLIENI 2 , A. ANELLI 2 , U. GIANELLI 3 , G.C. GERLI 1Cattedra Medicina Interna I 1 , Servizio di Nefrologiae Dialisi 2 , Servizio di Anatomia Patologica 3 , AziendaOspedaliera San Paolo, MilanoWe report the case of a 63 years old malepatient admitted to our hospital because ofsevere postural hypotension with repeatedsyncopal episodes, and peripheral edema.The patient had a past history of silent AMI,hypertension and NIDDM. Laboratory testsshowed non selective glomerular proteinuriain nephrotic range (10 g/24 h), normal renalfunction, a monoclonal band of lightchains class λ was detected in the urine andtwo monoclonal bands of light chains classλ in the serum. A subcutaneous abdominalfat sample resulted positive for amyloid. Arenal biopsy confirmed that the renal damagewas secondary to amyloid deposition.Moderate plasmocytosis (15%) was detectedby bone marrow biopsy, without evidenceof overt multiple myeloma. Cardiacinvolvement was documented byechocardiography (concentric left ventricularhypertrophy, moderate pericardial effusion,ejection fraction in the low-normalrange) and dynamic ECG (atrial and ventricularpremature beats with some ventriculartachycardia runs). There were nosymptoms related to cardiac involvement.Abdominal US documented moderateomogeneous liver enlargement. The autonomicnervous system dysfunction was severe,resulting in invalidating postural hypotensionand constipation. Adrenal glands’infiltration was ruled out by specific hormonaltests and abdominal CT scan. Elasticstockings and oral amines have beensuggested as supportive therapy. The patienthas been treated with supportivetherapy for the nephrotic syndrome andwith high-dose dexamethasone (40 mg perday for 4 days every 20 days). High-dosechemotherapy with stem cells support wasexcluded because of the patient’s age andfor the severe cardiac and autonomic involvement.Three dexamethasone courseshave been performed, with substantial improvementof the patient’s performance statusand better control of the postural hypotension.The prognosis of this patientremains poor, with an expected survival ofone to two years. The multiorgan involvementat the disease’s onset has stronglylimited our therapeutic approach.P166SOLITARY PLASMACYTOMA OF NASALSINUES AND OROFARINX: A CASEREPORTG. GIGLIO*, F. RUSSO°, G. MASTROGIUSEPPE #*Ambulatorio di Ematologia; # Divisione Orl,°Anatomia Patologica. Ospedale Civile “A.Cardarelli”Azienda Sanitaria Ospedaliera di CampobassoNeoplastic proliferation of plasma cellsresults in a population of immunologicallyhomogeneous cells that can produce diffuse(multiple myeloma) or localized ( extramedullaryplasmacytomas and solitaryplasmacytomas of bone) disease. Extramedullaryplasmacytomas (EMPs) arerare plasma-cell tumour may develop insoft tissues most commonly in the respiratorytract or the oral cavity. In the otorhinolaryngolocicliterature these neoplasms arerarely described and their nosological arrangementis often confused. The presenceof a plasma cell neoplasm can be a surpriseand sometimes a diagnostic challengeto be head and neck surgeon. The possibilityof a plasma cell tumour should be neverforgotten in presence of an head and neckneoplasm. Solitary plasmacytomas of thehead and neck, including the larinx, causingupper airway obstruction. The authorsdescribe a case of rapidly expanding EMPinvolving the nasal sinuses and orofarynx

162 September 26-29, 1999 - Torino-Lingotto, Italyof a 77 years old women. The incisional biopsyof rhinopharynx revealed infiltrationof moderatly-differentiate plasmacytoma.The woman was treated with high dose ofdexamethasone (40 mg ev for 4 days everythree weeks) with minimal response inexpectation of radiotherapy. The surgerontreatment was not proposed. Because theseneoplasms may signal the presence of multiplemyeloma full evaluation is required toexclude disseminated disease. Most patientswith solitary plasmacytoma have M-componentsin the serum, and when followedfor long periods most develop diffuseplasma cell myeloma, even when the originallesion was radically excised or irradiated.Recently acquisitions suggested thatextramedullary plasmacytomas canbe classified among the so-called “mucosa -associated” lymphomas. Surgical excision ofextramedullary plasmacytomas followed bycomplementary radiotherapy on the site oftumour is proposed as the best treatmentfor these kind of neoplasm.P167CASTLEMAN DISEASE INASSOCIATION WITH POEMSSYNDROME: A CASE REPORTG. GIGLIOAmbulatorio di Ematologia, O.C. “A.Cardarelli”,AUSL di Campobasso.Castleman disease and Poems syndromeare sometimes associated. Castleman’s disease(CD) is characterized by lymph nodeenlargement due to hyperplasia of abnormallymphoid folicles and paracortical lymphocytichyaline vascular stroma or plasmacytosis.The POEMS syndrome is a uncommonmultisystemic disorder characterizedby the association of polyneuropathy,organomegaly, endocrinopathy, M protein,skin changes and various other systemicclinical signs. Usually it is a manifestationof a type of myeloma of which the chiefcharacteristic is the presence of osteoscleroticlesion, classically seen radiologicallyto be single or multiple. The pathophysiologyof this syndrome remains largely unknown.Circulating levels of proinflammatorycytokines (IL-1 beta, TNF alpha, IL-6) areincreased in patients with POEMS and theirpleiotropic effects realeased secondary toa strong activation of the monocyte/macrophagesystem, take part in the multisystemicexpression of the disease SerumIL- 6 levels in POEMS reflected thedisease activity (higher in active than instable disease) but not the severity ofaccompanyng plasma cell dyscrasia. Increasedproduction of IL-6 could supportthe efficacy of corticosteroid therapy, particularlyin acute clinical situations. Theauthor present a case of 57 years old maleadmitted to hospital with a diagnosis ofprobable liver disease. A physical examinationdisclosed polyadenopathies,epatosplenomegaly, skin abnormalities,ginecomastie, sloping’s edema , ascites,pleural effusion and peripheral neuropathy.The lymph node biopsy showed lymphnode modification typical of Castleman’sdisease. At the same time was demonstratedmonoclonal gammopathy of the IgAl type and bone marrow plasmocytosis(about 10%). A rectal biopsy specimen fordeposits of amyloid was negative. Thepercutaneos liver biopsy not revelead epaticinvolvment. The final diagnosis wasCastleman disease with POEMS syndrome.The patient was treated with success withhigh dose of dexamethasone (40 mg ev)for 4 days every three weeks for twelvemonth and subsequently this improvementhas been maintained up to now with intermittentdexamethasone treatment. We concludethat POEMS syndrome is a hypercytokinemiesyndrome in wich bone marrowplasma cells are not of malignant type.Macrophages are involved in this syndromeand their role has to be further investigatedas well as treatments which act through ananti-cytokine mechanism.P168ALPHA-CHAIN, NON-SECRETINGMULTIPLE MYELOMA: A CASE-REPORTP. MUSTO, V. NIRCHIO*, M. AGAMENNONE°, C. BODENIZZA,A. FALCONE, M. CAROTENUTO, G. PASQUINELLI^,M. BISCEGLIA*Divisions of Hematology and °Ortopedics, *Serviceof Pathologic Anatomy, IRCCS “Casa Sollievo dellaSofferenza”, S.Giovanni Rotondo, and ^Service ofClinic Ultrastructural Microscopy, Policlinico “S.Orsola”, Bologna, ItalyWe report a 64 year-old female patientwho presented at our Institution on January,1997, with a large osteolytic lesion of

37 th Congress of the Italian Society of Hematology163the left humerus. A biopsy performed inanother Hospital had previously suggesteda diagnosis of undifferentiated neoplasia(probably PNET). The patient underwentsurgical proximal remotion of the humerusdue to an initial pathological fracture. Thenew histological analysis evidenced aspectsof plasmocytoid differentiation associatedwith the presence of periteliomatoid cellswithin an abundant mixoid matrix.Immunohistochemial studies showed apositivity for anti-alpha chain antisera andcomplete negativity for various other lineagespecific markers, including both kappaand lambda chains. Ultrastrucural evaluationdemonstrated a “vesicular” plasmocytoidpattern. Diffuse osteolytic lesions and severehypogammaglobulinemia were also documented,while hematological parameters,serum calcium, LDH and beta2-microglobulin were within the normal range.No M-component was detected by serumand urine immunofixation. The percentageof bone marrow plasma cells was 10-12%:immunofluorescence studies confirmed theexclusive presence of alpha chains withinthe cytoplasm of marrow plasma cells. Adiagnosis of alpha-chain, non-secretingmyeloma was made and the patient wastreated with oral melphalan and prednisonefor 9 cycles plus local (left humerus andfemur) RT. A very good clinical responsewas achieved, with stabilization of osteolyticlesions, disappearance of marrow plasmacell infiltration and normalization of immunoglobulinserum levels. A maintenancetreatment with interferon and dexamethasonewas interrupted after three monthsbecause of a pulmonary embolism leadingto a severe cardio-respiratory failure, which,however, partially recovered during the followingmonths. Twenty-eight months afterdiagnosis the patient is alive and in completeremission for myeloma.P169POEMS SYNDROME:CLINICAL CONSIDERATIONSG.B. CAVALLERO, R. MELCHIO, G. GALVAGNO, L. AMBROGIO°,U. STURLESEMedicina II,°Neurologia, Azienda OspedalieraS.Croce e Carle-Cuneopolineuropthy of upper and lower extremitiesdiagnosed as chronic immunedemyelinating polyneuropathy byelectrophisiologic study , sural nerve biopsyand CSF examination in 3 distinct admissionsin Neurology. Plasma exchange, intravenousimmunoglobulins were ineffective,he had transient improvement withcorticosteroid per os. In June1997 he hada congestive heart failure. In September1997, under corticosteroid treatment, hewas admitted to our hospital, because ofrenal failure, painful cutaneous necrosis ofthe lower limbs; he declared diarrhea andimpotence too. Phisical examination revealed:a performance status 3, cachexia,peripheral edema, hepatomegaly and a severe,disabling polyneuropathy as well. Previousinvestigations were remarkable forprimary hypothiroidism, serum IgA-λ paraprotein,mild thrombocytosis. We did notfind amilod in biopsies from the cutis,nerve,bone marrow; bone marrow plasma cellswere normal; an osteosclerotic bone lesionwas found at D10 level of dorsal spine andosseous proliferation in sites of ligamentousattachement (pelvis, humerus). Thepatient’s multiple clinical manifestationsaddressed to a diagnosis of POEMS syndrome:Polineuropathy, Organomegaly(hepatomegaly), Endocrinopathy (hypothyroidism,impotence), M protein (IgA- λ) andSkin lesions(edema, cutaneous necrosis).Recent results suggest a pathogenetic roleof proinflammatory cytokines (IL6, TNFα,IL1β) in POEMS syndrome. Considering thepatient’s clinical conditions, we started atreatment with radiotherapy on D10, highdose dexamethazone, all-trans retinoic acid(drugs inhibiting the production ofproinflammatory cytokines) and sulfasalazinewith improvement of cutaneousnecrosis and resolution of diarrhea; a successivemonthly therapy with cyclophosphamideand melphalan was ineffective andclinical condition had a progressive deterioration.The patient died in October 1998.This new case report of POEMS syndromestresses the importance of an early diagnosisfor this rare multisystem disorder associatedwith plasma cell dyscrasia because,if there is not organ functional deteriorationyet, a high-dose therapy followed bystem cells rescue might improve the prognosis,as in AL amyloidosis.A 57-year-old caucasian man had beenwell until August 1996 when he complainedof progressive, simmetric, sensorimotor

164 September 26-29, 1999 - Torino-Lingotto, ItalyP170HYPOPARATHYROIDISM IN MULTIPLEMYELOMA: REPORT OF A CASEP. Z IGROSSI, M.C. BERTONCELLI, L. PACCAGNINO,G. BORDIN, E. CATANIA, R. GAUNAII Medicina, Azienda Ospedaliera ”Maggiore dellaCarità” NovaraA 57 years old woman, recently operatedof bilateral cataract, had symptoms oftetany. Her daughter died of a connectivetissue disease. Physical examination wasnormal. She had a hypoparathiroidism withserum calcium 4,8mgr/dl, phosphate5,9mgr/dl, magnesium 1,55mgr/dl, urinarycalcium 50mgr/dl and phosphate800mgr,24-h, PTH 6,3picomoles/L (normalvalue

37 th Congress of the Italian Society of Hematology165HEMOSTASIS ANDTHROMBOSISP172PREVALENCE OF MILDHYPERHOMOCYSTEINEMIA ANDASSOCIATION WITH THROMBOPHILICGENOTYPES (FACTOR V LEIDEN ANDG20210A PROTHROMBIN) INPATIENTS WITH DEEP VEINTHROMBOSISV. DE STEFANO, B. ZAPPACOSTA*, S. PERSICHILLI*, E. ROSSI,I. CASORELLI, K. PACIARONI, P. CHIUSOLO, B. GIARDINA*,G. LEONECattedra di Ematologia, Ist. Semeiotica Medica and*Ist. Chimica Clinica, Università Cattolica, RomaMild hyperhomocysteinemia is a risk factorfor deep vein thrombosis (DVT). Interactionof such alteration with thrombophilicgenotypes such as factor V Leiden orG20210A prothrombin has been only partiallyinvestigated. We investigated 111patients with at least one documented episodeof DVT, in 44% of the cases with noevident association of circumstantial riskfactors (M/F 52/59, median age of thethrombotic onset 36 years, 2-81) and 121healthy individuals (M/F 91/30, median age35 years, range 20-78). All the individualswere genotyped for the presence of mutationsin factor V gene (factor V Leiden, FV-L) and in prothrombin gene (G20210A mutation,FII-A); fasting homocysteine wasmeasured in all of them. In patients withDVT the naturally occurring coagulation inhibitors(AT III, proteins C and S) weremeasured. Among the controls 5 individualswere heterozygous carriers of FV-L and3 were heterozygous carriers of FII-A; .themean level of homocysteine was 7.83 µmol/L (SD 2.52). Among the patients with DVTa thrombophilic defect was found in 28cases (25.2%). Homocysteine levels higherthan the control mean +2SD were detectedin 16 patients (14.4%) and in 4 controls(3.3%); after adjustement for other causesof thrombophilia the odds ratio for DVTassociated with hyperhomocysteinemiawas 3.7 (95% CI 1.1-12.3). Hyperhomocysteinemiawas associated with FV-L in 3patients (2.7%) and with FII-A in 3 patients(2.7%); no control individual showedsuch associations. In conclusion mildhyperhomocysteinemia was confirmed to bea risk factor for DVT; the association of mildhyperhomocysteinemia with other thrombophilicgenotypes (FV-L o FII-A) seems toinduce a synergic increase in the risk forDVT to 30-50 fold.P173ASSESSMENT OF THROMBOTIC RISKIN APC-RESISTANT PATIENTSE. STIPA*, V. CORDERO°, M. MARTIRADONNA°,G. CATALANO°, D. ZANGRILLI°, A. SCIARRA*, M. OLIVIERI*,F. OLIVA*, S. AMADORI°°Tor Vergata University, Haematology Chair andDeparment; *S.Eugenio Hospital, RomeSix-hundred twenty-five pts were studiedin our outpatient unit for a period of 42months with a view to assessing the relationshipgoverning the association ofAPCresistance, R506Q Leiden V Factor andthe clinical event. 141 pts were apparentlyhealthy, and 484 had a history of past arterialand/or venous thrombosis. The groupof pts in object was composed of 227 males(36%), and 461 females (64%), their meanage was 47 (range between 15-83). 40%of the thrombotic events occurred at thelevel of CNS and the retina, 25% at thelevel of peripheral vessel, while 26% of theevents was represented by ischaemic cardiopathiesand minor conditions. 46% ofthe pts had a family history of thromboticevents, while 22% of them suffered fromdyslipidosis, and 90% of them hadantiphospholipid antibodies with no clinicalsigns of collagen abnormalities. Noneof the studied pts was taking anticoagulants,but 200 of them were takingantiaggregants (65 of which were non-responders).36% of the pts had overly highplatelet-antiaggregation levels that werethen reconfirmed over time. 2 pts presentedwith an asymptomatic picture of Protein Cdeficiency. APCresistance was observed(with pre-dilution of the sample with V Factordeficient plasma and with cut-off=2) andlater reconfirmed in 88 pts out of 625(14%), most of whom were women. Thirtyeightof them were symptom-free, while 50of them had a past history of thrombosiswith no circumstantial risk factors, such assurgery, estroprogesterone therapy, diabe-

166 September 26-29, 1999 - Torino-Lingotto, Italytes, hypertension, ecc. About half of thesubjects who tested positive underwentmolecular analysis and 67% of them wereshowing the R506Q mutation. We studiedsiblings, parents and the offsprings of 9subjects carrying the dual defect, withmultiple and multi-district thromboses, andwe observed that 7 probands out 24, testedpositive for APCresistance and for the LeidenV Factor. The subjects who tested positive,and who also had a past thombotic history,were given an anti-aggregant therapy, whilesymptom-free pts who tested positive werefollowed-up over time with no evidence offurther thrombotic events. According to ourexperience it does not seem appropriate,nor justifiable to administer a prophylactictherapy to those pts carrying thetrombogenic defect, with the exception ofthose cases where there is an increased risk.P174G 20210 A MUTATION OF THEPROTHROMBIN GENE: GENETIC ANDENVIROMENTAL RISK FACTORSASSOCIATION. A CASE REPORTR. SANTI, M. DEMICHELI, L. CONTINO, A. LEVISCentro Emostasi e Trombosi, Servizio diImmunoematologia, Azienda Ospedaliera“SS.Antonio e Biagio e C.Arrigo”di AlessandriaThe G20210A mutation of the prothrombingene has recently been suggested asan important risk factor for venous thromboembolism.Its role in cerebral ischemiaand in arterial thrombosis is not clear. Howevermany studies show an association betweenG20210A mutation and stroke. Onthe other hand the prevalence of the prothrombin20210 A allele in italian healthpeople is about 3,3%. Case Report. A 50-years-old man was admitted to the hospitalfor an expressive aphasia. The braincomputer tomography showed multiple ischemicareas in the left emisphere. Therewere no occlusions of carotid arteries; electrocardiogramand transesophagealechocardiography did not show any evidenceof heart disease. The anamnesticquestioning reported only arterial hypertensionand when the patient was admitted,blood pressure was normal. There was nopersonal or family history for vascular diseaseor thrombosis. Initial evaluation for ahypercoagulable state included normal levelsincluded normal values of protein C, proteinS, antithrombin III and factor VIII. Thepatient was treated with oral warfarin for 6months and then with ticlopidin. Duringantiplatelet treatment he presented an episodeof retinal thrombosis and he wastreated with an association of ticlopidin andaspirin. A further evaluation of thromboticrisk factors showed the presence of prothrombinG20210A mutation in heterozygoticform. In the family of our patient noother thrombotic events were recorded. Ourhypothesis is that the association ofG20210A mutation and hypertension plaiedan important role in this case. We stressthe importance, in juvenile stroke, of thepresence of a genetic risk factor with anenviromental risk factor.P175RISK OF RECURRENT DEEP VEINTHROMBOSIS IN HETEROZYGOUSCARRIERS OF FACTOR V LEIDEN WITHOR WITHOUT THE G20210APROTHROMBIN MUTATIONV. DE STEFANO, I. MARTINELLI*, P.M. MANNUCCI*,K. PACIARONI, P. CHIUSOLO, I. CASORELLI, E. ROSSI, G. LEONECattedra di Ematologia, Università Cattolica, Romaand * Centro Emofilia e Trombosi Angelo BianchiBonomi, MilanoPoint mutations in the factor V gene (factorV Leiden, FV-L) and in the prothrombingene (G20210A mutation, FII-A) are themost common causes of inherited thrombophilia;the magnitude of the risk for recurrentdeep vein thrombosis (DVT) in carriersof FV-L is controversial and it is notestablished the risk of the patients carryingboth defects (FV-L and FII-A). The expectedprevalence of double carriers in thegeneral population is 1 per 1000 individuals.We investigated 624 patients with previousDVT objectively documented; afterexclusion of 212 patients with other causesof inherited or acquired thrombophilia, weselected 112 patients heterozygous carriersof FV-L, 283 patients with normal genotype,and 17 patients double carriers of FV-L and FII-A. The patient groups did not differin sex distribution, age at the time ofthe first DVT, age at the time of investigation,length of the observation time, andrate of first spontaneous thrombotic event.At the time of investigation 30% of patients

37 th Congress of the Italian Society of Hematology167with or without FV-L have had a recurrentDVT, whereas the cumulative incidence ofrecurrent DVT in double carriers was 65%.The median thrombosis-free survival afterthe first DVT was 13 years in carriers ofFV-L, 16 years in normal individuals, and 5years in double carriers of FV-L and FII-A(Kaplan-Meier analysis). Patients with FV-L only had a risk for recurrence similar tothat of patients with normal genotype (hazardratio 1.1, 95% CI 0.7-1.6); on the otherhand, double carriers had a higher risk forrecurrence than carriers of FV-L only (hazardratio 2.6, 95% CI 1.7-11.5, log-ranktest p=0.02). Considering only recurrencesthat occurred spontaneously, the risk fordouble carriers remained high (hazard ratio3.4, 95% CI 2.5-23, log-rank testp

168 September 26-29, 1999 - Torino-Lingotto, Italyent mobilisation schedules (MAD for NHLpatients and HD-CTX for ALL and MM patients)followed by G-CSF administrationwith the purpose to stimulate peripheralstem cell mobilisation. In every patientsplasma levels of Antithrombin III (ATIII),anticoagulant Protein C (PC) and Protein S(PS) were evaluated. G-CSF was administeredfor a median period of 11 days (9-14) with dosage of 5 µg/Kg/day. In everypatients, after chemotherapy administrationthe ATIII, PC and PS basal levels were inthe normal range. During G-CSF treatmentno alterations were observed in ATIII andPS plasma levels, instead a progressivedecrease happened in PC levels, and amedian reduction (around 30% respect tobasal assay) was measured at the end oftreatment. PC levels reduction did not causeclinical evidence of thrombotic event. Neverthelessit can be favourable for a latentprothrombophilic state, and it could generatethrombotic events in concomitance withother unfavourable factors.P178HETEROZIGOSITY FOR FACTOR VLEIDEN: A FAMILY STUDYM. PAGLIARINO, A. RAVERA*, G. BIAGGI, G. FRANCISCO,P. R OSSETTO, E. VENTURINO, A. MUSCOLINO, R. GUIDO,M. GIROTTOASL 9 Ivrea - Ospedale Civile - Serv. Trasfusionale;*ASL 9 Ivrea - Ospedale Civile - Serv. di CardiologiaWe evaluated Activated Protein C resistance(ACPr) and relative factor V Leidenmutation in a family in which two membershad a history for multiple episodes of DeepVein Thrombosis (DVT).14 subjects wereexamined: they were first screened for APCrtest, then, if positive, they were examinedfor factor V Leiden mutation. Subjects witha positive history of thrombosis were alsoenrolled in a more extensive investigationfor thrombophilia (ATIII, Protein C and S,LAC, Homocisteine). Results: - 10 subjectswere negative for APCr test and had negativehistory for thromboembolism. - 4 subjectswere positive for APCr test and resultedas heterozigous factor V Leiden carriers;In details: - two of them (mother andson, respectively 59 and 29 years old), althoughwithout any thrombophilic risk factors,had multiple episodes of DVT (the sonhad also Pulmonary Embolism) always atsame limb and after trigger events (surgery,trauma, pregnancy). - another subject(58 years old) have a history for smokingand hypercolesterolemia, had myocardialinfarction (occlusion of a minor coronarybranch) and, 7 years after the firstischemic episode, angina, but never hadvenous thrombosis. - last subject (32 yearsold, third subject’s son), although he hadonce undergone orthopaedic surgery for atraumatic event, never had thromboembolism.The analysis of these cases suggeststhat factor V Leiden mutation is not a sufficienttrigger event for venous thromboembolism.In conclusion, we think that othersystemic thrombophilic conditions detection,functional study of venous system andother risk factors study are important inpatients prognosis evaluation and in theprevention of thrombotic event.P179HIGH INCIDENCE OF EARLYTHROMBOTIC COMPLICATIONS INPATIENTS WITH ACUTE LEUKEMIAV. DE STEFANO, S. SICA, F. SORÀ, P. CHIUSOLO, L. LAURENTI,I. CASORELLI, E. ROSSI, F. EQUITANI, K. PACIARONI, G. LEONECattedra di Ematologia, Università Cattolica delS. Cuore, RomaWe investigated 228 patients (M/F 111/117, median age 58 years, range 14-89)consecutively admitted from 1993 to 1998for acute nonlymphocytic leukemia (ANLL,181 cases, 19 M3) and acute lymphoblasticleukemia (ALL, 47 casi). During a totalobservation time of 311 patient-years wedocumented 21 thrombotic events in 18 pts.(M/F 5/13, median age 51 years, range 17-84), accounting for an incidence of 6.7 /100 pt-years. Diagnosis was ANLL in 14cases (5 M3) and ALL in 4; the first eventwas a DVT of the legs in 11 cases (3 withpulmonary embolism), DVT of the arms in2, portal vein thrombosis in 1, cerebral veinthrombosis in 1, ischemic stroke in 3. Fiveevents (28%) were associated with a circumstantialrisk factor (central venous catheter,CVC=2, CVC and hormonal treatment=1, erwinase=1, puerperium=1). Inheritedthrombophilia (G20210A prothrombin) wasdetected in 3 pts. with DVT (2 with recurrence)out of 12 checked. In 12 thromboticpatients (67%) no inherited or acquired riskfactor was identified. The analysis accordingto Kaplan-Meier showed an overall prob-

37 th Congress of the Italian Society of Hematology169ability of thrombosis in 4.4% of all patientsat the onset of disease and in 8.8% within5 months from diagnosis of acute leukemia.Three pts. with ANLL had a recurrentDVT 3, 15 e 37 months after the first event.The risk for thrombosis was similar patientswith ALL and ANLL (hazard ratio 1.03, 95%CI 0.3-3.2). In the M3 patients the probabilityof thrombosis was 10.5% at the onsetand 27.7% within 3 months from diagnosis,with a risk higher than in the otherpatients (log-rank test p= 0.001, hazardratio 4.4, 95% CI 2.8-89.4). A leukocytecount higher than 20x10 9 /L was present in8 cases (6 ANLL -2 M3-, and 2 ALL); inthrombotic patients the count was higher(median 20.5x10 9 /L) than in ANLL pts. (median11x10 9 ) or ALL pts.(median 16.5x10 9 ).The platelet count at the time of the firstthrombosis was higher than 85x 10 9 /L in 9cases; yet in M3 pts. (median 32x10 9 /L)was lower than the count found at the onsetof disease in ANLL pts. (median 48x10 9 /L) or ALL pts. (median 53x10 9 /L); the otherpatients with thrombosis at the time of theevent had a median platelet count of100x10 9 /L. In conclusion acute leukemia isassociated with a thrombotic risk especiallyat the onset of disease and with a normalplatelet count; such risk is particularly highin M3 patients, independently of the plateletcount.P180LIFE THREATENING EMERGENCY CAUSEDBY AN INTRACARDIAC THROMBUSLEADING TO AN ANTIPHOSPHOLIPIDSYNDROME (APS) DIAGNOSIS IN APATIENT WITH AUTOIMMUNEHEMOLYTIC ANEMIA (AHA)F. CELESTI, C. TORROME, G. MORANO, G.A. BRUNETTI,C. GIRMENIA, R. LATAGLIATA, C. MINOTTI, G. ALIMENADepartment of Biotecnologie Cellulari edEmatologia, University “La Sapienza” RomeWe report the case of a right ventricularthrombus detected in a 51-year old womanadmitted to our Hematological EmergencyUnit for anemia. The patient had a historyof AHA successfully treated 33 yrs beforewith steroids and splenectomy, and a recent(1 month before) episode of deepvenous thrombosis treated with s.c. heparin.At hospitalization (7/98) a relapse ofAHA was diagnosed: Coomb’s test was positivefor warm IgG antibodies, hemato-serologicaldata were Hb 7.6 g/dl, MCV 145fl, WBC 12.1 x 10 9 /l, PLTS 128 x 10 9 /l, reticulocytes186%°, total bilirubin 1.85 mg/dl(direct 0.35 mg/dl) and LDH 518 UI/l. Clottingtests were normal, LAC test (KCT) wasin the normal range. An ECG was normal andno cardiocirculatory problems were evident;chest X-ray was negative, abdominalechography was negative for adenomegalies,echodoppler displayed a normalcirculation of the legs. Treatment wasstarted with Methylprednisolon (1.5 mg/Kg/day) and folates. In the subsequent 4 days,while Hb remained stable, a progressivePLTS reduction till 46 x 10 9 /l was observed.On the 5th day the patient presented a suddenepisode of severe acute dyspnoea withmarked hypoxyemia (PO 241.7 mmHg, SatO 282.9%, PCO 231.5 mmHG). Physical examinationrevealed tachycardia and inspiratorytumescence of jugular veins.Echocardiogram showed a mass of 3 cmtight to tricuspidal valve, floating in atriumand extending to right ventriculum in diastole.Heparin was immediately started andthe patient was transferred to CoronaryUnit, where 4 days later she underwentsurgical intervention to remove intracardiacmass in extra-corporeal circulation. PreviousIg administration (800 mg/Kg for 3days) was performed as PLTS count had feltto 29 x 10 9 /l: no blood support was needed.Hystological examination proved the massto be a thrombus. A complete screening forthrombophilia was then performed, showingpositivity for ACA-IgG, DRVV-LAC testand aPCR; ANA, ATIII, C and S protein valueswere normal. A diagnosis of APS wasthen made. The patient is now in good hematologicalconditions, without other clinicalproblems, on treatment with low-dosesteroid and oral anticoagulants. The rareobservation here reported emphasizes theimportance of searching AntiphospholipidAntibodies in patients with AHA, expeciallyif this is associated with other disease manifestationssuch as thrombocytopenia orthrombosis, and submit these patients toaccurate cardiac screening, even when noovert hearth involvement is present.

170 September 26-29, 1999 - Torino-Lingotto, ItalyP181ProC Global A NEW AUTOMATIZEDSCREENING ASSAY FORDETERMINATION OF TOTAL FUNCTIONOF THE PROTEIN C-SYSTEMF. DRAGONI*, D. TORMENE**, P. SIMIONI**, P. ARCIERI*,G. AVVISATI*, F. MANDELLI*, A. GIROLAMI***Dip. Biotecnologie Cellulari ed Ematologia, Univ.degli Studi “La Sapienza”, Roma;** Istituto diSemeiotica Medica, Univ. degli Studi di PadovaProtein C anticoagulant pathway representsa major physiologic inhibitory mechanismfor blood coagulation. A new automatizedfunctional screening assay (ProC Global;Dade-Behring, Milan, Italy) for a totalevaluation of Protein C-system was prospectivelytested in normal subjects and in 120patients with abnormality of the Protein Csystem in order to define the sensitivity,specificity and diagnostic accuracy of thisscreening test. ProC Global test is an activatedpartial thromboplastin time (APTT)based assay in which test plasma is incubatedwith Protac (Snake venom fromAgkistrodon Contortrix). Results of ProCGlobal test were expressed as NormalizedRatio (NR). ProC Global performed in 50patients with Factor V Leiden mutation beforeand after mixing plasma test 1+4 withfactor V deficient plasma, turned out pathologicalin 50/50 (100%) cases (Meanvalue=0.59, Range 0.37-0.69). ProC Globalwas pathological in 32/36 (88.8%)cases with Protein C deficiency ( Meanvalue=0.63, Range 0.34-1.21) and in 26/34 (76.5%) cases with Protein S deficiency(Mean value=0.76, Range 0.5-1.23). ProCGlobal was normal in 40 healthy subjects(20 males, 20 females, mean age 37 yrs.,range 18-60) without Factor V Leiden mutationand with normal values of Protein Cand Protein S. These subjects were consideredour control group. For Factor V Leidenmutation the sensitivity of ProC Global was100%, specificity 100% and diagnostic accuracy100%; for Protein C deficiency thesensitivity was 88.8%, specificity 100% anddiagnostic accuracy 94.7%; for Protein Sdeficiency the sensitivity was 76.5%, specificity100% and diagnostic accuracy 89%.The overall diagnostic accuracy of ProC Globaltest for defect of Protein C-system was92.5%. ProC Global appears to be an effectivenew automatized screening test forthe complete evaluation of Protein C-systemable to identify patients with Factor VLeiden mutation, Protein C and Protein Sdeficiency.P182EFFICACY OF IVIgG IN THEANTENATAL AND NEONATALMANAGEMENT OF FETOMATERNALALLOIMMUNIZATION TO HPA-1aPLATELET ANTIGEN: A CASE REPORTF. FABRIS, R. CONTE*, B. SOINI, T. MAGGINO, M.L. RANDI,A. GIROLAMIDepartment of Medical and Surgical Sciences,University of Padua, Padova; * Transfusion Center,S. Orsola Hospital, Bologna, ItalyFetomaternal alloimmunization to plateletantigen HPA-1a, is the prevalent causeof severe antenatal and neonatalalloimmune thrombocytopenia (NAIT); intrauterinecerebral hemorrhages with cerebralsequelae or fetal loss can occur by20-25 weeks of pregnancy. The recurrenceof NAIT in subsequent pregnancy is high,which justifies antenatal treatment. Howeverthe management of NAIT is uncertain.Concerning antenatal therapy the optionsare the assessment of platelet count byfetal blood sampling, intrauterine platelettransfusions and the maternal treatmentwith IVIgG and/or steroids. Transfusions ofHPA compatible platelets or IVIgG are thepostnatal therapeutic options. A case ofsevere thrombocytopenia (13x10 9 /l platelets)with mucocutaneous bleeding occurredin 1990 in a newborn from a mother (MA)with normal platelet count; thrombocytopeniaspontaneously recovered in the babyover 9 days, whitout treatment. Alloantibodyagainst HPA-1a and negative HPAphenotype (platelet immunofluorescencetest) were demonstrated in the mother andNAIT was diagnosed. MA again becamepregnant in 1998 and serological analysisdemonstrated a high titer of alloantibodyagainst HPA-1a. HLA and HPA genotype(PCR-SSP analysis) revealed in the motherHPA-1b/b, HLA DRB3 and in the husbandHPA-1a/a genotypes. From 21 weeks ofgestation, IVIgG (1g/Kg bw/week) andprednisone (25 mg/day) were given andfetus ultrasonography was regularly performed.After 35 weeks of pregnancy, thealloimmunized woman delivered, by cesareansection, a thrombocytopenic baby

37 th Congress of the Italian Society of Hematology171(25x10 9 /l platelets). IVIgG were given inthe baby as prophylaxis and the thrombocytopeniapromptly recovered whitouthemorrhagic complications. In conclusion,the antenatal and neonatal therapy withIVIgG, seems to be a non-invasive satisfactorymanagement of high-risk pregnancyin this HPA-1a alloimmunized woman.P183POSSIBLE IMPROVEMENT OFIDIOPATHIC THROMBOCYTOPENICPURPURA BY HELICOBACTER PYLORIERADICATIONG. LONGO, G. GANDINI, M. MORSELLI, L. FERRARA,K. CAGOSSI, M. LUPPI, G. TORELLI, G. EMILIADipartimento di Scienze Mediche. Sez. MedicinaInterna ed Ematologia. Università di ModenaIt is known that Helicobacter pylori (HP)might determine gastric mucosa damageby an antigenic cross mimicry betweenLewis antigen expressed by gastric epithelialcells and the bacterium. HP infectionhas been associated with development oflymphoid follicles in the stomach and relatedto the development of gastric MALTlymphoma. Nevertheless, involvement of HPin some autoimmune diseases is still to beelucidated. Immune Thrombocytopenic Purpura(ITP) is caused by autoantibodiesagainst platelets;Bacterial and viral infectionhave been implicated in the disease.Recently, it was reported that HP eradicationcan be followed by an increase in plateletcount in patient with ITP and that theprevalence of such infection in ITP can behigh. To determine whether HP infectioncould be associated with ITP, we evaluated27 patients: 12 males; 15 females, meanage 52.4 years (17-79). ITP was definedby: thrombocytopenia (other causes excluded),megakaryocytic iperplasia in bonemarrow, autoantibodies against platelets(PAIg). HP infection was assessed by C ureabreath test, serum antibodies against HPand, when possible, histologic examinationof speciments obtained by endoscopy. Thepresence of antibodies against hepatitis Cvirus (HCV) was evaluated. Only in 3 patientsthe PAIg were found. All patientsshowed a normal-hyperplastic megakarycytosis.No one was HCV positive. HP infectionwas found in 11 patients (all showedbreath test positivity, of wich 7 were alsopositive for serum antibodies and 2 showedhistologic positivity). Eradication of HP(Amoxicillin 1 g twice daily, clarithromycin250 mg three times daily, pantoprazole 40mg twice daily) was obtained in nine patients.In eight patients the corticosteroid treatmentwas withdrawn before eradication; in threewas manteined owing the low platelets count(< 30.0 x 10 9 /L) at low dose (25 mg prednisone/d). Five patients in whom HP waseradicated had a significant increase in plateletscount after 3 months; the remainingpatient are still monitored. A relationshipbetween HP infection and ITP can be hypothesized;a chronic immunological stimulusor cross mimicry between platelets andbacterium antigens may play a pathogeneticrole in some ITP cases; in some cases,the eradication of HP could be effective inITP improvement.P184IDIOPATHIC THROMBOCYTOPENICPURPURA: 310 PATIENTS OBSERVEDIN A SINGLE HEMATOLOGICALINSTITUTIONN. VIANELLI, L. VALDRÈ, M. FIACCHINI, L. CATANI,*L. GUGLIOTTA, A. DE VIVO, S. TURAIstituto di Ematologia e Oncologia Medica“L. e A. Seràgnoli”, Università di Bologna;*Servizio di Ematologia, Arcispedale“S.Maria Nuova”, Reggio EmiliaIdiopathic thrombocytopenic purpura(ITP) is a rare disease. Chronic ITP involvesmore frequently the adults. Immunesuppressivetreatment with steroids induces astable partial or complete remission in asmall number of patients (pts). Splenectomyis effective in about 80% of cases.However, 20% of ITP pts are refractory toany other treatment. Prolonged severethrombocytopenia is often associated withan high haemorrhagic risk. We present ourexperience concerning 310 chronic ITP pts;202 female and 108 male, had a mean ageand platelet number at diagnosis of 43±19( range 8-87) yrs and 34±28x10 9 /l (range1-147), respectively. The mean follow-uphas been 67±71 (range 2-350) months; 56(18%) of pts have a follow-up >120months. At diagnosis 138 (44%) pts showedminor bleeding events (mean platelet number23±17) and 23(7.4%) had major bleedingevents (mean platelet number 13±11).

172 September 26-29, 1999 - Torino-Lingotto, ItalyDrug therapy (mainly steroids) was employedin about 60% of pts. However, splenectomywas necessary in 35% of pts witha mean diagnosis-splenectomy interval of21±30 months (6 patients were splenectomizedat diagnosis). Splenectomy was effectivein 83% of cases. Relapse occurredin 21% of cases at a mean of 34±63 (1-252) months from splenectomy. Drugtherapy (up to 6 lines of therapy) was effectivein about 50% of refractory or relapsedpts after splenectomy. 35 pts showeda platelet number £ 30x10 9 /l at last followup,with a mean follow-up ³ 36 months.10/35 pts were ³ 60 yrs old and didn’t showdifferent incidence of bleeding events respectto 25/35 younger pts (< 60yrs old).Two young patients (21 and 33 yrs old),with a follow-up > 120 months, showedhaemorrhage (one of which fatal).P185FACTORS PREDICTING THE RESPONSETO SPLENECTOMY OF ADULTS WITHIDIOPATHIC THROMBOCYTOPENICPURPURAF. R ADAELLI, P. FACCINI, M. GOLDANIGA, E. GUGGIARI,E. POZZOLI $ , E.M. POGLIANI*Servizio di Ematologia, Centro Trapianti di MidolloOsseo $ , Istituto di Scienze Mediche, Università diMilano, Ospedale Maggiore, IRCCS; *Divisione diEmatologia, Ospedale San Gerardo, Monza, ItalyAdult idiopathic thrombocytopenic purpura(ITP) is a chronic disease that respondsto steroid therapy in 30-40% of cases; thesecond-line treatment of refractory casesis splenectomy, to which two-thirds of patientsrespond. We retrospectively studied65 splenectomised patients with adult ITP(20 male and 45 female) in order to verifywhether there are any factors that predictthe response to splenectomy. Their meanage at diagnosis and splenectomy was respectively35 and 37 years. The mean postdiagnosisfollow-up was 139 months, andthe mean time between diagnosis and splenectomywas 37 months. All of the patientswere treated with prednisone at an initialdose of 1 mg/kg/day for one month, whichwas then tapered off over the total periodof therapy of 6-8 months. The pre-splenectomyplatelet counts varied from 1,000 to40,000/mm 3 . Twenty-three patients intravenouslyreceived Ig at the standard doseof 400 mg/kg/day for five consecutive days.The response to steroid therapy, i.v. Ig andsplenectomy was classified as follows: completeresponse (CR) > 100,000/mm 3 , partialresponse (PR) 50,000-100,000/mm 3 ,and no response (NR) < 50,000/mm 3 . Thestatistical analysis was made by dividingthe patients into those with a CR or PR,and those with NR. The results of the variousstudies published so far do not allowan unequivocal interpretation, and our ownunivariate analysis did not reveal any significantcorrelation between the success ofsplenectomy and age, sex, platelet countat diagnosis, auto-antibody positivity, thesite of platelet sequestration, the time betweendiagnosis and surgery, or the responseto high-dose intravenous Ig. Finally,the probability of success was higher in thepatients responding better to steroids (p

37 th Congress of the Italian Society of Hematology173NC ZM SS SSmother controlno. glycoproteins molecules/plateletCD41 GPIIbIIIa 3.280 861 920 25.344* 106.575CD41B GPIIb 4.849 543 486 13.585 12.177CD61 GPIIIa 1.642 479 363 23.346 78.512CD42A GPIX 95.362 62.418 58.022 41.634 77.387CD42B GPIb 86.479 66.179 39.503 35.725 79.598*intermediate value of glycoproteins in mother not affectedby GT but carrier of the same diseaseP187THROMBOCYTOPENIA IN HCV +PATIENTSF. SALVI, A. BARALDI, L. DEPAOLI, M. PINI, P. FRACCHIA,S. PONZANO, D. INVERARDI, L. MELE, A. LEVISU.O.A. Ematologia - Az. Osp. SS. Antonio e Biagio,AlessandriaBackground. A relationship betweenhepatitis C virus (HCV) infection and thrombocytopeniahas been proposed. Both a directeffect of HCV infection on stem cell andautoimmune reaction have been suggested.Aim of the work. To study a group ofthrombocytopenic patients in order: a) toevaluate the prevalence of HCV +; b) tocompare the clinical and laboratory featuresat diagnosis between HCV- and HCV+ pts.;c) to analyse results and toxicity of theimmuno-suppressive treatment in HCV+pts. Patients and methods. BetweenJanuary 1994 and December 1998 an idiopathicthrombocytopenic purpura (ITP) wasdiagnosed in 118 patients, negative for HIVserology, with a platelet value lessthan100x10 3 /µl. The presence of anti-HCVantibodies was tested in all patients by athird-generation immunoenzymatic assay.When anti HCV antibodies were present,HCV-RNA was detected by a PCR qualitiveand quantitive analysis. The presence ofplatelet-associated immunoglobulin G(PAIgG) was determined by a competitiveimmunoabsorbent assay against glycoproteinIIb/IIIa, IbIX, Ia/IIa and IV. Results.HCV antibodies were present in 32 (27%)pts. HBSAg was present in only 13 (11%)pts. and it was independent of HCV: in 8out of 86 HCV- pts. (9%) vs. 5 out of 32HCV+ pts. (16%) p=n.s. The HCV+patients,when compared to HCV- ones, showed moreadvanced age (64 vs. 51, p

174 September 26-29, 1999 - Torino-Lingotto, Italytransmission with platelet-poor plasma asreference (100% of transmittance). Aggregationinduced by adenosine diphosphate(ADP), final concentration 2mmol, wascontinously recorded for 3 min and measuredbefore and after preincubation for 3min with 5000 µmol of L-Arg and 250 nmolof sodium nitroprusside (SN), as previouslydescribed (I Neri, M Marietta et al, J SocGynecol Invest 1998;5:192-196), in orderto test the reactivity of platelet L-Arg-NOsystem. For statistical analysis “paired t”and ANOVA tests were used. Results: duringERT we observed a small, although notstatistically significant decrease in baselinePA (87% vs. 75%, p=0.102). L-Arg and SNpreincubation significantly decreased PAonly before ERT (from 87% to 74.5%,p

37 th Congress of the Italian Society of Hematology175opioid receptors and can be stimulated toproduce neuropeptides derived by thepro-opiomelanocortin. In opiate addictsplatelet activity can be decreased by theopioids. Moreover the β-endorphin and thenaloxone significantly reduce the “in vitro”and “in vivo” platelet aggregation inducedby low ADP doses. Our study evaluates theinfluence of different doses of theβ-endorphin and met-enkephalin on plateletactivity. Patients and Methods – Fifteenhealthy subjects were enrolled aftertheir informed consent. The platelet richplasma was pre-incubated with β-endorphin,met-enkephalin (200 pg/ml final concentration)or saline solution (control test). Plateletaggregation induced by ADP and collagen(0.5–1–2 µM and 4 µg/ml final concentrationsrespectively) was measured using amultichannel aggregometer. The statisticalanalysis was performed by the Student’s “t”test for paired data.Results and ConclusionsADP 0.5µM ADP 1µM ADP 2µM Collagen 4µg/mlsaline s. (control)20.2±10.3 32.4±20.8 60.2±20.3 70.2±36.9b-endorphin 12.8±6.3* 33.9±19.9 53.9±26.1 72.8±36.9met-enkephalin 10.3±4.7* 39.4±29.1 59.1±25.8 70.7±41.1*p7500 versus the 11% ofefficacy of RSPu in the same pts (p=0.006).The mean CCI of the group after the administrationof RSPu was of 3729 (range -559 to 13327), whereas when transfusedwith CCPu the mean CCI improved to 7145(range -1488 to 22625) (p10000. In all the pts but one,we found a significant improvement of themean pretransfusional platelet value(p=0.009). Although the mean global efficacyof CCPu transfused was satisfactory,looking at the single pt we found an efficacyvarying from 0% to 100% of transfusedunits. From this experience we con-

176 September 26-29, 1999 - Torino-Lingotto, Italyclude, not all the immunologically refractorypts take advantage of the CCPu’s transfusion.Every single pt needs to be evaluatedin terms of achieved efficacy(CCI>7500) in the context of his clinicalconditions.P192NAPLES HEMOPHILIA COHORT(1984-99): LONG-TERM SURVIVORS,ANTIBODY PREVALENCE TO KSHV/HHV-8 AND KAPOSI’S SARCOMA (KS)G. GIRALDO*, E. MIRAGLIA §, A. ROCINO §, M. MONACO*,F.M. BUONAGURO*, M.L. VISCIANO*, D. RONGA*,E. BETH-GIRALDO**Ist. Naz Tumori “Fondazione G.Pascale” ;§ Divisione di Ematologia-Centro Emofilia eTrombosi, Ospedale Nuovo Pellegrini, Naples, ItalyObyective: a) to establish HIV- 1 RNAlevels in peripheral blood to be correlatedwith CD4+ cell counts and antiretroviraltherapy; b) to determine antibody prevalenceto KS/HHV-8 and Kaposi’s sarcomadevelopment in the Naples hemophilia cohortas well as in healthy blood donors fromSouthern Italy. Methods: The cohort of 291patients has been in follow-up since 1984.99 (34 %) of them were HIV-1 positive.HIV-RNA was quantified by a nucleic acidsequence-based amplification assay. Antibodyprevalence to HHV-8 was determinedby IIF with confirmation by immunoblotanalysis using the TPA-stimulated BCBL-1cell line, which is chronically infected byHHV-8 (lytic antigen). Results:Antiretroviral therapy (AZT) was initiatedin 1988, moving to triple-drug regimens in1997. At the end of 1998 the HIV+ cohortconsisted of 38 patients (38 % long-termsurvivors). A cross-sectional and longitudinalanalysis showed serum RNA levels tobe associated with progression to AIDS andCD4+ T-cell decline. Regarding HHV-8seroprevalence the cross-sectional analysisrevealed 6 % (16 of 291 subjects) seropositivity,comparable to 7 % of 1066blood donors’ sera analysed. Moreover, 9patients (3 %) were coinfected by HHV-8and HIV-1, and 3 (1.03 %) of them developedKS in 1986, ’94 and ’96, respectively.They were HHV-8 seropositive prior tumordevelopment. Conclusion: a) Optimal clinicaland therapeutical management of thepatient was achieved, applying the combinedevaluation of viral and immunologicalmarkers ; b) 1.03 % of epidemic KS inpatients with hemophilia from SouthernItaly represents a 343-fold increase as comparedto classic KS in men from the sameregion (i.e., 3.01/100.000).Supported by Ministero Italiano della Sanità(Ric. Corrente 1998-99)P193PORCINE F-VIII ADMINISTRATION INACQUIRED HAEMOPHILIA.TWO CASES REPORTM. PARMA, D. BELOTTI, G.F. RIVOLTA, M. ANGHILIERI,P. M AFFÈ, E.M. POGLIANIUniversità degli Studi di Milano, HaematologyDivision, San Gerardo Hospital, Monza, ItalyThe presence of F-VIII inhibitors in nonhaemophilicpatients is a very rare event.The clinical presentation is similar to primitivehaemophilia; in fact these patients havean important deficiency in plasma F-VIII.Substitutive therapy often needs non humanF-VIII administration. In this reportwe describe two cases of acquired haemophiliasecondary to lymphoproliferativeor to autoimmune disease. The presence ofa mild title of F-VIII inhibitor was assessedin both patients. In the first one, a 80 yearsaged male, non-Hodgkin lymphoma (NHL)was diagnosed few months before, but notreatment was performed for the bad generalcondition and age. He developed acquiredhaemophilia diagnosed during a severebleeding episode secondary to traumaticlesion on tongue. No clinical benefitwas achieved with corticosteroid therapyand human F-VIII concentrates administration.Then the patient was treated with 100IU/Kg porcine F-VIII on first day and 30IU/Kg on subsequent three days; we observedan increase in circulating F-VIII, andbenefit on bleeding. The second patient wasaffected by degenerative encefalopathy withpositivity of autoimmune markers. He developedacquired haemophilia who was diagnosedafter an episode of haemorrhagicgastritis. Also in this case no improvementwas obtained with human F-VIII administrationso porcine F-VIII was given with aninitial dosage of 100 IU/Kg. The treatmentwas continued for three days, but no significantincrease in plasmatic F-VIII level

37 th Congress of the Italian Society of Hematology177was observed. Notwithstanding bleedingstopped and gastric lesion recovered. Thesetwo cases show different response to administrationof porcine F-VIII in acquiredhaemophilia. Probably, these different responsesare related to the cross-reactivityof F-VIII inhibitor and porcine F-VIII. Neverthelesswe think that porcine F-VIII administrationis a valid approach for bleedingtreatment in patients affected by acquiredhaemophilia.P194ACQUIRED HAEMOPHILIA ANDRHEUMATOID ARTHRITIS:CASE REPORTL. OLIVETTO, D. MANACHINO, A. MUSCO, R. DELLI QUADRI,A. SANTAGOSTINO**, M.E. BOGNIDivisione di Medicina Generale e *ServizioImmunotrasfusionale - Ospedale S. Andrea -Vercelli, ItaliaPatients with acquired haemophilia receivingfactor VIII may produce antibodiesagainst factor VIII. Inhibitors of factor VIIImay rarely be produced without evidenceof congenital haemophilia, and may causea severe form of acquired haemophilia.Immunological inhibitors (factor VIII IgGantibodies) have been reported in systemicerythematosus lupus, whereas non immunologicalinhibitors of factors VIII, IX and Xare occasionally found in immunologicaldiseases and immunoproliferatives syndromeswith paraproteinemia. We report adramatical case of acquired haemophiliasustained by inhibitors of factor VIII whichoccurred in a 62-year-old woman with a 3-years history of rheumatoid arthritis,treated with methylprednisolone and methotrexate,who was admitted in our Departmentbecause of a recurrence of secondarypericardial effusion. The course of her diseasewas ominous: her clinical conditionsrapidly deteriorated with the appearance ofa coagulation disorder resistant to any treatment.We observed an increased aPTT (82”,ratio=2.5), with mild hyperfibrinogenaemia(533mg/L), normal PT(INR=1.16), normal antithrombinaemia III(113%), normal anticardiolipin-IgG(4.6GPL) and IgM (0.8MPL) antibodies.Anticoagulant antibodies were not detected.The coagulation disorder depended on anisolated defect of factor VIII (8%), withnormal activities of the other factors (IX,X, XI) of the coagulation extrinsic pathway;a double determination was able to identifya low title (1U Bethesda) of inhibitorsof factor VIII. Few days after admissionappeared nasal, gastrointestinal, urinary,skin and mucosal bleeding, intrafascial hematomasand, at last, a large intra-abdominalhematoma (φ 7x5cm), followed by notreversible ipovolemic shock, which leadedthe patient to death. Efforts to antagonizethe haemophilic disorder with fresh frozenplasma, DDAVP, high doses of Ig and factorVIII infusions failed. This observation wasremarkable because of the unusual associationrheumatoid arthritis - acquiredhaemophilia with factor VIII inhibitors, producedex novo during a long-time chronicalsteroid and immuno-soppressive treatment,and deserves clinician attention.P195HYPERCOGULABILITY MARKERS INSPONTANEOUS SUBARACNOIDHEMORRAGEM.L. PAPA (1), M. CALDORA (1), F. CAPASSO (1),G. SCHISANO (3), P. NINA (3), L. ALBOLINO (1), F. DEMURTAS (1),V. RUSSO (1), D. DE LUCIA (4), E. MIRAGLIA (2)(1) Laboratory of Haemostasis and Thrombosis, (2)Div. of Hematology; (3) Neurosurgery Div.; NewPellegrini Hospital, Naples. (4) Institute of GeneralPathology and Oncology, II University of NaplesVasospasm is a complication of prognosticrilevance in patients with aneurysmalsubaracnoid hemorrage (SAH). Althoughstudies on CSF fibrinolysis and its correlationwith complications and prognosis inspontaneous SAH have been undertaken,only a few assessments on hemostatic systemexist. We studied the markers of coagulationand fibrinolysis activation in spontaneousSAH to evaluate their correlationwith neurologic status at admission andclinical course with special reference to theoccurrence of arterial spasm and delayedischemic deficits (DID). Fifty-four patientsaffected by spontaneous SAH (30 M and 24F, mean age 45.5±16.7 years) all admittedwithin 24 hours from SAH episode wereenrroled into the study. Clinical status atadmission has been established accordingto the Hunt-Hess scale: 29 patients were ofI-II grade, 14 were of III grade and 11 wereof IV-V grade. Fourty-four (82%) cases were

178 September 26-29, 1999 - Torino-Lingotto, Italyaneurysmal SAH, in the other 10 (18%)cases the angiograms and MRI-angiographywere negative. Fifty healthy subjectsmathched for sex and age acted as controls.Thrombin-antithrombin (TAT), modified antithrombin(ATM), plasminogen activatorinhibitor type 1 (PAI-1), fibrin fragment D-Dimer(s) (D-D), plasmin-antiplasmin complexes(PAP) were carried out. An activationof hemostatic proteasic system may existduring the acute phases of SAH. Significantincreases of TAT, PAI-1, D-D, PAP seems tocorrelate with the clinical status during theinitial stage and subsequent clinical course.Moreover, the patients with syntomatic vasospasmand unfavorable clinical courseshowed the highest plasma levels of D-Dand PAP. The confirmation of these preliminaryfindings by a multicenter study mightbe helpful to identify patients at great riskfor life-treathing SAH complications.P196TREATMENT OF REFRACTORY ANDRELAPSING THROMBOTICTHROMBOCYTOPENIC PURPURAA. NOSARI, N. CARUSO, E. PUNGOLINO, R. CORNEO,G. MUTI, G. BOTTAGISIO, S. RIBERA, L. BARBARANO, E.MORRADepartment of Hematology andImmunotransfusional Service, Niguarda Ca’ GrandaHospital, Milan, ItalyTTP is a rare disease characterized byhemolytic anemia, thrombocytopenia, fever,neurological abnormalities and variable renaldysfunction. Plasma-exchange (pex)with fresh frozen plasma (FFP) has beenshown to be optimal first line treatment,resulting in a reduction of mortality from90% to 20%. In patients unresponsive orrefractory to pex, limited success has beenreported with immunosuppressive therapy(HDIg, Vincristine and, more recently,cyclosporine). Inhibitory antibodies to VonWillebrand factor-cleaving protease havebeen recently identified (Furian e coll. NEJM1998, 339, 1578; Tsai e Lian NEJM 1998,339, 1585) in acute episodes of TTP. From1980 to 1998 29 TTP patients were admittedto our Department, 9 males, 20 females,median age 38 yrs (r:22-78). All patientswere treated with steroids. FFP (3 U/day)only was performed in 6 elderly pts withadvanced neoplastic disease. The other 23patients were divided in responders (15)and non-responders (8) only to pex (mediannumber, range) 3 patients died immediately.In the other 5 non-responding patients thefollowing therapies were added in sequenceto pex : HDIg 400 mg/kg/day x 5 days (response0/4), Vincristine 2 mg ev. x 4-6weeks (response 4/5), cyclo-sporine A 5mg/kg/day (late response after 3 months 1/1). Seven patients relapsed, 2 with multiplerelapses (4 and 8, respectively); 4 respondedto steroid treatment and FFP, 1 onlyto pex, and the multiple relapsing patientsto different therapies in different episodes(only to steroids, only to pex, to HDIg, toVincristine). Conclusion: 1) Deaths occurredonly in the first days of disease; 2)In non-responders patients prolonged immunosuppressivetreatment is often necessaryto obtain a response; 3) Relapses canbe of different severity, and each episodecan respond to different treatment probablybecause of different titer of inhibitory antibody.P197LATE RELAPSES IN THROMBOTICTHROMBOCYTOPENIC PURPURA (TTP)M. MARIANO, F. NARNI, A. DONELLI, D. DINI,G. CECCHERELLI, G. MILANTIHematology and Immunohematology Department,University of Modena and Policlinico HospitalBetween January 1991 and January1996, nine consecutive patients with newlydiagnosed TTP have been treated at ourdepartment. Eight patients were female,and the median age at diagnosis was 34years (mean 37, range 24-56). The patientswere treated with plasma exchange (PE)and antiplatelet agents, and all of themachieved a complete response (CR). Thecharacteristics of the patients and the detailsof the front line treatment have beenpartially reported (“Porpora tromboticatrombocitopenica e plasma exchange: studiodi otto casi”. M. Mariano, G. Milanti, M.G.Baldini, A. Pietramaggiori, A. Donelli, F.Narni. La trasfusione del sangue 40, 186-191, 1995). The aim of this report is toupdate the follow up of these nine patients.Updated march 30th 1999, with a medianfollow up of 64 months (mean 67, range41-102), all patients are alive. Six of themare still in first CR. Three patients had alate relapse at 36, 61 and 83 months fromdiagnosis, respectively. Hemolytic anemia

37 th Congress of the Italian Society of Hematology179and thrombocytopenia were present, andother causes were ruled out (normal coagulationparameters, negative Coomb’stest). In two, upper respiratory tract infectionspreceded the relapse. At relapse, thetreatment consisted of a series of PE utilizingcryoprecipitate-free plasma in associationwith antiplatelet agents and corticosteroids.PE was continued until all indices(platelet value, LDH, aptoglobin and bilirubin)were in the normal range, and this wasobtained after 7, 10 e 15 procedures, respectively.When first described, TTP wasassociated with a 90% mortality within thefirst 12 months. PE has dramaticallychanged the natural course of the disease,with a reported percentage of CR of approximately80-90% in most series. Still, relapsesmay occur after the achievement ofa CR, and especially the risk of late relapseshas not been determined. In our small series,with a median follow up of approximatelyfive years, late relapses occurred inthree out of nine patients. In all cases asecond CR was obtained with PE andantiplatelet agents and is maintained at 4-6 months. An even longer follow up, however,will be necessary to determine howdurable the second remission is.P198THROMBOTIC THROMBOCYTOPENICPURPURA SYNDROME RELAPSE.20 YEARS FOLLOW-UPF. IULIANO, S. MOLICA, L. LEVATO, M. KROPP, D. MAGRO,R. SQUILLACE, A. PETAHaematology Unit.Azienda Ospedaliera “Pugliese-Ciaccio” CatanzaroIn the last few years we have been witnessesof important progresses in the clinicalmanagement of thrombotic thrombocytopenicpurpura (TTP). However, despite theimprovement of overall survival, there is asubset of patients displaying a continuouspattern of relapse. To the best of ourknowledges studies dealing with the evaluationof risk of relapse are virtually absent.With the aim of identifying patient subsetswho are likely to become long-remitters weretrospectively evaluated our series accountingfor 15 TTP patients followed overa 20-year period. As far as response is concerned,it was assessed according to theItalian Cooperative Group for TTP criteria.Severity of disease was assessed in eachpatients on the basis of the score systemsuggested by Rose and Eldor. Relapse impliedthe recurrence of any or all featuresconsistent for a TTP diagnosis occurringafter 4 weeks from the cessation of therapy.Nine patients (60 %) exchaned at least 1volume plasma (PEX) for each section. Themedian number of procedures was 10.1. Sixpatients received FFP infusion (15 ml/Kg/day). All patients received Prednisone (2mg/Kg/day) and antiplatelets therapy atconventional dosage. Additional therapiesconsisted of high dose immunoglobulin infusions0.4 g/Kg/day (2cases) anddefibrotide 400 mg/day (6 cases). A CR wasachieved in 5/8 pts.treated after 1986(63%) and in the 3/7 patients (43%)treated before 1986 (p= 0.809). Patientsobserved in two different periods (beforeand after 1986) were alike when stratifiedaccording to the by Rose and Eldor score(mean score 6.13 ± 0.99; range 5-8 vs4.86±1.35;range 3-5; p=0.62). When ptswere stratified in Early, Late and No Respondersaccording to the changes of eitherLDH (< 500 U/L) or platelets count (>80 x 10E9/L) at 7 days from diagnosis ,thechance of achieving a CR was 100 for ptswho improved both parameters (ERs) 50%for patients who improved (LRs) only oneparameter (LDH or PLT count) and 25% forthose with no improvement (NRs). Thirtysevenpercent of patients (3/8) whoachieved a CR relapsed. No relapse wasobserved after 36 months of continuos remission.Interestingly, all ERs were in firstcontinuous remission after a follow-up timeranging from to 3-16 yrs.Our results inkeeping with those of Sarode et al(Am.J.Hematol.1997; 54 (2): 102-7) outlinethe role played by the time of responseon clinical outcome of TTP.P199PLASMA-EXCHANGE ANDCRYOSUPERNATANT INFUSION IN THETREATMENT OF THROMBOTICTHROMBOCYTOPENIC PURPURAP. CASULA, A.A. DI TUCCI, E. USALA, G. BROCCIADivisione di Ematologia, Ospedale Oncologico“A. Businco”, CagliariIntroduction: In this retrospective studywe reviewed the treatment of 18 consecu-

180 September 26-29, 1999 - Torino-Lingotto, Italytive patients (6 male, 12 female; age 21-55 years) with Thrombotic ThrombocytopenicPurpura (TTP) diagnosed at our institutionfrom July 1992 to March 1999.Three patients were escluded from theanalysis: 2 with TTP secondary to neoplasm,1 with TTP after bone marrow transplantation.A total of 28 episodes of TTP are considered:13 of them are relapses. All episodeswere treated with plasmaticcryosupernatant (CS). Methods: CS wasprepared according to American Associationof Blood Banks recommendations. Thechoice between plasma-exchange (PE) orplasma-infusion (PI) was based on presenceof major neurological manifestations(focal deficits, seizure, coma) or renal failure,considering these patients with a moreunfavorable prognosis. PE was performeddaily employing CS and 5% albumin with1:1 ratio, exchanging approximately 1plasma volume up to LDH and plateletsnormalization. PI (15 ml/Kg of CS) was administereddaily until LDH and plateletscount for 3 consecutive days normalized.All patients received antiplatelet drugs;prednisone (3-5 mg/Kg/die) was administeredin 20 of episodes. Results: Two outof the 9 patients treated with PE died, while7 patients reached a complete response(CR). The other 6 patients were treated withPI, 3 obtained a CR, 3 failed to respondand a CR was achieved after PE; of the 13relapses, 5 and 8 obtained a CR after PEand PI respectively. Conclusions: in ourexperience the PI treatment of TTP patientswithout negative prognosis factors is bothsafe and effective.P200TREATMENT OF REFRACTORYTHROMBOTIC THROMBOCYTOPENICPURPURAM.C. BERTONCELLI , M. BRUSTIA, D. CHIARINOTTI°,G. MASCARO °, L. PACCAGNINO, P. ZIGROSSIII Divisione Medicina Servizio Trasfusionale°Azienda Ospedaliera “Maggiore della Carità” NovaraThrombotic thrombocytopenic purpura(TTP) is a rare, multysistemic disorderwith severe thrombocytopenia andmicroangiopathic hemolytic anemia; theclinical features include fever,renal involvementand neurological signs.About 80% ofacute TTP respond to conventional therapywith plasmaexchange(PEX). We report thecase of a man treated with different therapiesand responding to a prostacyclin analogue.A 42 year old man was admitted toour department because of severe anemiaand drowsiness. The blood tests were: Hgb7,4 gr/dl,reticulocyte 25%, indirect bilirubin1,8 mg/dl, LDH 3655 U/l, platelet13000/mm3, Creatinine 2,5 mg/dl, Creatinine.2,5mg/dl, Coomb’s negative test.The blood film showed an increase in fragmentedcells. Thrombocyte values initiallyrose on daily treatment with PEX (fresh frozenplasma 2000-2300ml per session/daily). However, after 9 PEX the level ofplatelets began to reduce, so we add to thetreatment Ig (400mg/ Kg i.v.daily for5days). After 13PEX and 4PEX (CS)Cryosuper natant (plasma from which cryoprecipitatehas been remo ved), aphasiadeveloped. Intravenous administration ofVincristine, methylprednisolone and Iloprost(1,5 ng/Kg/’/die for 8 days), led to thenormalisation of the blood tests. The patientis still in complete remission 8 monthsafter stopping treatment. Our observationsuggest the hypothesis that defectiveprostacyclin bioavailability could play a rolein the pathogenesis of TTP and that theIloprost should be considered for TTP refractoryto the treatment.P201THROMBOTIC THROMBOCYTOPENIAPURPURA (TTP): IMPORTANCE OFMEDICAL IMPLANTSG. SBOLLI, G. NIFOSÌ, B. FERRARI, R. BERTÈ, D. VALLISA,G. CIVARDI, L. CAVANNA1 st Division of Internal Medicine - Hematology,Piacenza HospitalTTP is a mycroangiopathatic haemoliticanemia characterized by a severe microvasculardisorder of platelet clumping. Throughpresentation of our last 3 cases we emphasizethe importance of medical implants likepossible inciting factors of TTP. Case 1: a43 year-old female, with a intrauterine device(IUD) implanted 3 weeks before, wasadmitted by a diffuse purpura, 20x10 3 /mm 3of platelet count (Plt), not autoimmunehaemolitic anemia (Hb 5.7 gr/dl, Ldh 747IU/L), peripheral blood and bone marrowwas coherent with TTP. The IUD implant wasquickly removed and twenty plasmapher-

37 th Congress of the Italian Society of Hematology181esis (PP)procedures resolved completelypurpura, anemia and thrombocytopenia. At12 months of follow-up she is in completeremission (CR). Case 2: a 73-yearold-male,after an acute myocardialtransluminal coronary angioplasty performeda month before and a treatment byAspirin 100mg and Ticlopidine 250mg twicedaily, was admitted because of mental confusion,fever, not autoimmune haemoliticanemia, thrombocytemia (Plt 7x10 3 /mm 3 ),Hb 7.4gr/dl, Ldh 848 IU/L. Eleven PP carriedto complete clinical and laboratoryrecovery. Up to now the patientis in CR.Case 3: a 32-year-old-man complaintedslight jandice, fever, asthenia after dentalprosthesis was implanted 2 weeksbefore.The patient showed confusion, dysarthriaand cephalalgia with brain TC negativefor focal or diffuse lesions; Ldh 3900IU/L, Hb 7gr/dl, Plt 9x10 3 /mm 3 , schistocytesand fragmented red cells. Dental prosthesiswas removed and PP carried to clinicalrecovery; until now he is in CR. We emphasizedthat medical implants can be incitingfactors of TTP, a diligent history and its rapidremoval together PP treatment can carryto complete recovery.P202COAGULATION STUDIES IN 5 CASESOF PEDIATRIC ESSENTIALTHROMBOCYTHEMIA (ET)M.L. RANDI, C. ROSSI, M.C. PUTTI*, L. ZANESCO*,A. GIROLAMIDip. of Medical and Surgical Science e * Dip. ofPediatrics, University of Padua Medical SchoolAbout 5-10% of total hospitalized childrenhave an increased platelet count. Only aminimal percentage of these cases are dueto essential thrombocythemia (ET), whilemost patients have a reactive or secondarythrombocytosis. ET is a disease of medianadvancedage, characterized by an increasedrisk of thrombotic complications,rare in young age. We report 5 pediatriccases (4 females and 1 male, mean age atdiagnosis 89±47 months, platelet range930-3178 x10 9 /L) in whom a diagnosis ofET in agreement with Polycythemia Verastudy Group criteria has been performed.In 4 cases no hemostatic or thrombotic complicationwas observed during the followup(80.6±6.7 months), while in a femaleof 9 months of age the diagnosis wasachieved because a sub-total thrombosisof inferior cave vein. All the patients havebeen treated with ASA (100 mg/day), withthe exception of the thrombotic baby whois under warfarin therapy. In all these patientsa coagulation study has been performed:PT, PTT, AT III, protein C (activityand antigen), protein S (activity, antigenand free), protein-C-resistance (APC-SR) ,plasminogen, PAI-1 (activity and antigen),anti-phospholipid autoantibodies,homocystein, blood and plasma viscosity,platelet aggregation under ADP (2 mM),adrenalin (10 mM) and collagen (2 mg)stimuli. None of the patients had any alterationof the evaluated tests, including thebaby with cave thrombosis. We concludethat we were not able to recognize in ourgroup of patients any other cause of thromboticrisk than ET.P203ESSENTIAL THROMBOCYTHEMIA INCHILDHOODS. LADOGANA, P.R. SCALZULLI*, A. SPIRITO, P.A. QUITADAMO,R. DE SANTIS, L. MIGLIONICO, M. PASTORE, M. ABATE,A. CILIBERTI, A.M. CARELLA*, M. CAROTENUTO*, P. PAOLUCCIPediatric Hematology Oncology Division,*Hematology Division IRCCS “Casa Sollievo dellaSofferenza”, S. Giovanni RotondoEssential Thrombocythemia (TE) is anMyeloproliferative Sindrome (MPS) characterizedby persistent thrombocytosis forwhich no etiology can be determined. Theother MPS must be excluded by criteria suchas those suggested by the PVSG. Criteriafor diagnosis of ET include platelet count>600.000; normal erythrocyte mass; stainableiron in the marrow or failure of an irontrial to increase erythrocyte mass; absenceof marrow fibrosis and no known cause ofreactive thrombocytosis. As expression ofclonality the presence of spontaneouscolonie (s-CFU-Mk and s-BFU-E) in marrowor in peripheral blood of ET patients can bean interesting diagnostic criteria having, inour experience, a specificity of 100% andsensibility of 80%. The ET is considered tobe a disorder of adulthood (media age 61),but few well documented and describedcases in children are reported and is notclear the real incidence of this disorder inpediatric age. The morbility and mortalityare primarily due to thrombosis or hemor-

182 September 26-29, 1999 - Torino-Lingotto, Italyrhage, with rare istances of leukemic conversion;same patients, particulary thosewho are youngher, have been followed forlong periods of time without complications.We have made diagnosis of ET in 3 young,male patients (median age 8 yr 8m), theyrapresente the 2% of ET diagnosed in ourhospital in the ìlastî in 5 years. In the fristcase we have observed, after 3 yrs fromdiagnosis, a spontaneous normalization ofplatalet counts, the last two cases are asymptomatic,in follow up, without any treatment.In conclusion children with ET appearto have a more benign course thanadults, perhaps because they toleratethrombocytosis of any etiology better. Becausealkylating agents and radiation mayincrease the likelihood of leukemic transformation,these treatment are not recommendfor asymptomatic children.Hydroxiurea should be considered for childrenwho have had thrombotic episodes orhemorrage.P204AUTOIMMUNE HEMATOLOGICALDISEASE ASSOCIATED WITHULCERATIVE COLITISF. RONCONI, F. PALMIERI, M. ANNUNZIATA*, C. COPIA*,A. SPASIANO*, A. VOLPE, S. PALMIERI*, G. STORTI,R. CIMINO*, E. VOLPE, F. FERRARA*Divisione di Ematologia, Ospedale S. GiuseppeMoscati, Avellino; *Divisione di Ematologia,Ospedale A. Cardarelli, NapoliDifferent authors have described associationbetween ulcerative colitis (UC) andautoimmune blood diseases, mainly immunehemolytic anemia (HE) and immunethrombocytopenic purpura (ITP). On a seriesof 222 UC, we observed 2 patients withHE and 2 with ITP, accounting for a frequencyof 1.8 %, that is similar to otherauthors’ experience. Three patients weremale and one female, age ranging from 17to 61 years. In one patient CU and ITP wereconcomitantly diagnosed, while in the othersUC precede the onset of blood diseaseof 12, 21 e 34 months, respectively. In allpatients UC were active and all were treatedwith sulfasalazine. Patients with ITP showedincreased marrow megakaryocytes as wellas increase in IgG platelet associatedanitibodies. The two patients with HEshowed positivity for direct antiglobulin test(DAT) along with hyperbilirubinemia, lowserum aptoglobin and high reticulocytecount. Hemoglobin level was 5.6 gr/dl e 6.2gr/dl, respectively. No patient was affectedby additional concomitant disease. Patientswith ITP received 1 mg/kg/day prednisone;both achieved a substantial increase in theplatelet count which in one patient wasstable even though the count never exceeded60.000/cmm; in this patient steroidswere continued at a reduced intermittentdose. In the second ITP patient,after one month platelets fell at initial level;azathioprine (2mg/kg/day) was given witha stable partial response (platelets > 50000< 100000/mmc) and concomitant improvementin intestinal pain. In the 2 patientswith HE, corticosteroids did fail to induceany response and both were treated withadditional immunosuppressive therapy; oneobtained a complete response followingazathioproine, while the second did not respondto azathioprine and achieved a completeremission with intermediate dose cyclophosphamide(1gr/sqm i.v. days 1,3).Even though anemia completely resolved,in both patients with HE, DAT remainspostive after 12 and 21 months, respectively.In conclusion, our data confirm thepossible association of UC with ITP and HE.In these cases, response to corticosteroidsis poor, therefore additional immunosuppressionis required.P205ANTICARDIOLIPIN ANTIBODIES,BLOOD-BORNE VIRUSES,TRANSFUSIONAL REQUIREMENT ININHERITED BLEEDING DISORDERSG. GAMBA, N. MONTANI, E. SOLDAVINI, M. CAPEZZERA,G. BERTOLINODept. of Internal Meidicne and Medical Therapy,University of Pavia, IRCCS Policlinico San Matteo,Pavia, ItalyIn hemophilia the presence of anticardiolipinantibodies, (ACA) and Lupus Anticoagulant(LA) has been linked to both HCVand HIV infections, and with the presenceof thrombocytopenia or of inhibitors anti-VIII. Aim of our investigation was toevaluate the prevalence of ACA and LA inpatients with congenital bleeding disordersin relation to trasfusional requirements, tothe blood-borne virus exposure, to the pos-

37 th Congress of the Italian Society of Hematology183sible co-expression of thrombocytopeniaand of inhibitor anti-VIII. Patients 63 patientsaged 5 to 88 years with congenitalclotting factor defects: Hemophilia A: 53pts, Hemophilia B: 5 pts, Factor XI deficiency:1 pts, vWD: 1 pts, FVII deficiency:3 pts. 31 had moderate clotting factor deficiencyand they were never infused during12 months preceding the study (12 outthem HCV- and HIV-), 47 pts were HCVpositive (7 coinfected with HIV). Two patientsshowed low titre antibodies anti-FVIII(

184 September 26-29, 1999 - Torino-Lingotto, Italywith APA positivity in 14% of cases, butonly in one case lupus anticoagulant waspositive. It seems note worthy that 18.46%of tested women presented an increasedAPC-r, only in two cases related to factor Vmutation. Therefore, we believe that thistest may be proposed as a screening testin women with history of fetal losses. Thus,the study of combined inherited and acquiredcoagulation disorders could be veryinteresting in order to achieve a better diagnosticdefinition of this syndrome. In 40/65 women (61.53%) no alterations of studiedparameters were found, thus the studyof the “recurrent abortions syndrome” mustalso include the evaluation of obstetric, endocrinologicand other genetic aspects.P207LUPUS ANTICOAGULANT ACTIVITY INPATIENTS WITH GAUCHER’S DISEASETYPE IG. GIUFFRIDA, R. BARONE*, D. CULTRERA, S. SALEMI,C. FERLITO, R. MUSSO, R. GIUSTOLISICattedra e Divisione di Ematologia con Trapianto,Ospedale Ferrarotto, Catania e *Cattedra diPediatria – Università di CataniaGaucher’s disease type I (β-glucocerebrosidasedeficiency) is characterized by thestorage of uncleaved β-glucocerebroside inthe cells of the reticuloendothelial systemleading to bone marrow infiltration,hepatosplenomegaly and skeletal lesions.Haematological changes with anemia andthrombocytopenia are common; clottingfactors and inhibitor deficiency have alsobeen reported but the pathophysiology ofsuch abnormalities is still unclear. We studiedcoagulation factors (FII, FV, FVII, FVIII,FIX, FXI, FXIII) and natural inhibitors (ProteinS, Antihrombin III and Protein C) in 5Gaucher type I patients, aged 24-45 years.According to the Severity Score Index theclinical symptoms were mild in 3 subjects,moderate and severe in the other two respectively.Three were splenectomized.Liver function was preserved, prothrombintime (PT) was normal whereas activatedpartial thromboplastin time (APTT) was significantlyincreased in all the patients. Wedetected lupus anticoagulant activity inthree studied patients which had a significantincrease of IgM (mean 19.8±3 U/ml;n.v.

37 th Congress of the Italian Society of Hematology185lower legs and Raynaud’s phenomenon.High title aCl (IgG, IgM), mild chronic renalfailure and cerebrovascular disease(MNR) were also demonstrated. IgM rheumatoidfactor and circulating immuno-complexes,without ANA, anti-dsDNA, ENA (Sm-RMP, SSA-SSB, Scl-70, Jo-1) and serumcomplement consumption, were detected.Affected skin biopsy revealed inflammatorylesions of subcutaneous arteriolar wall withsegmental iperplasia of smooth musclecells. SS diagnosis was finally posed on thebasis of these histological features, representingan intermediate stage of microscopicalteration of this disease. In this casereport, a simultaneous association of SS toserum aCL detection, nephropathy and mitralvalve disease is described for the firsttime. On the other hand, the detection offew altered autoimmunity parameters andof some systemic disorders without typicalmarkers of connective tissue diseases confirmthe obscure relationships between SSand some immunological disorders.of VL emerged from the evaluation of anumber of parameters in comparison withten cases of laparotomic splenectomy: betterdefinition of the operative area, lessearly and late complications (need of nasogastrictube, fever, pleural effusion, occurrenceof laparocele), less use of drugs, lesshospitalization time, better patient compliance.Requirement for transfusional supportwas identical; the median duration ofthe surgical procedure was slightly longeras compared to the traditional technique.In patient with oversized spleen and whena complete histological examination wasneeded, the operation was performed by aVL technique until complete isolation of organ;the intact spleen was then exteriorizedthrough a proper parietal incision. VLsplenectomy is at present our preferred approachfor splenectomy in several hematologicaldisorders. The main limiting factorsare previous abdominal surgey, higher costsand specific surgeon’s experience in thisprocedure.P209VIDEO-LAPAROSCOPIC SPLENECTOMYIN HEMATOLOGY: NEW STRATEGIESF. CHIURAZZI, F. CORCIONE, M.R. VILLA, B. ROTOLIDepartment of Hematology, Federico II University,Department of Surgery, Monaldi Hospital, NaplesDuring the eighties, video-laparoscopy(VL) has made extraordinary progresses intechnique and materials, expanding considerablyits field of application. In Hematology,VL has been mainly used forcolecistectomy in patients with hemolyticanemia, for large biopsy on abdominalmasses and for hiatal hernia causing irondeficiency. The most frequent meeting pointof hematologists with surgeons is splenectomy.To confirm the undoubted advantagesof this method, we have expanded our experience,introducing some technical modificationfor large sized spleen removal, performedpreviously only by laparotomic surgery.Starting January 1995, we offered avideolaparoscopic procedure to 70 patientswho needed a splenectomy for hematologicaldisorders (ITP, hereditary spherocytosis,Cooley’s disease, AIHA, CLL, IdiopathicMyelofibrosis, primary hypersplenism,thesaurismosis). The median age of patientswas 30 years (range 2–74). The advantagesP210GAS6 TRIGGERED EFFECTS ONADHESION OF HUMANPOLYMORPHONUCLEAR CELLS TOVASCULAR ENDOTHELIUM INNORMOXIA AND HYPOXIAM. GALLICCHIO, M. BRAGARDO, E. OMODEO-ZORINI,F. CAPELLI, I. ROGNONI, M. VIDALI, G. GARBARINO,U. DIANZANI, R. FANTOZZI, C. DIANZANI, G.C. AVANZIDepartment of Medical Sciences, Amedeo AvogadroUniversity of Eastern Piedmont, Novara;Department of Anatomy, Farmacology and ForensicMedecine, University of Torino, ItalyIt is well known that an increased influxof polymorphonuclear cells (PMN) occurs intissues after hypoxia/reoxygenation, andthat they show hyperadhesivity to vascularendothelial cells (EC). However the molecularmechanism of hypoxia/reoxygenationinduced adhesion and diapedesis throughthe vascular endothelium of PMN is poorlyunderstood. In our laboratory we are studyinga protein, named GAS6, expressed onvascular EC, that is a ligand of a new classof tyrosine kinase receptors, Axl, Mer andRse. We have previously demonstrated thatGAS6 inhibits the adhesion of PMN to ECinduced by PAF and other chemokines , butdoes not affect adhesion to resting EC. In-

186 September 26-29, 1999 - Torino-Lingotto, Italyhibition is dose dependent in the concentrationrange of 0.1-1 µg/mL. Treatment ofresting EC with soluble receptor of GAS6(Axl or Rse), significantly potentiated PMNadhesion to EC, suggesting that endogenouslyproduced GAS6 works as anantiadhesive molecule. Therefore we evaluatedthe effect of GAS6 on EC exposed tohypoxia/reoxygenation. We treated EC fortwo hours with N 295% and CO 25% andadhesion is evaluated after 20 min ofreoxygenation. Surprisingly in this modelGAS6 potentiated PMN adhesion, while theenhancing effects of Axl-x and Rse werelost. Then we evaluate whether the differenteffects were due to differences in signalingtriggered by GAS6. Therefore weanalysed the GAS6 effect on hypoxic,normoxic, and normoxic-PAF-treated EC atthe level of protein tyrosine phosphorylationpattern. Preliminary data show thathypoxia, per se, induces protein dephosphorylationin EC.P211ISSUES IN THE ISO-9002 STANDARDSAPPLICATION IN THEHEMOCOAGULATION LABM. MESSINA 1 , C. GRILLO 2 , L. PUTZOLU 1 , E. INCARBONE 1 ,L. PERUGINI 1 , G.C. FIORUCCI 2Dipartimento di Patologia Clinica - 1 SIMT, 2Laboratorio Analisi – Azienda Ospedaliera O.I.R.M.– S.Anna – Torinoin accordance with the guidelines definedin the reference manual by the RAQ. Inparticular each responsible has contributedto the final version of the quality controlmanual by adding procedures and technicalreferences (i.e. about dealing with patients,samples, methods, instruments andcertifications. Specific mandatory courses,held by experts in the field of ISO 9000regulations, have been performed for allinvolved personnel. In addition severalmeetings have been organized by the RAQin order to plan, organize and integrate theactivities amongst the different sectors.These meetings were also aimed to thedetection of arising problems in the applicationof general procedures in each area.Though it has been initially difficult due toshare the acceptance of a “new language”and further workload, a careful evaluationof the manual of Quality Assurance hasproved to be of value in solving most problemsthrough clear guidelines and comprehensiveintructions. SQ application inour lab has been important for several reasons:it has contributed to improve technicalperformances and has introducedregular checks within the different proceduresat various stages, it has also allowedto improve the relations amongst the variousgroups and has started the basis forfurther SQ devolpment within our RegionalReferral Centre for inherited coagulationdisorders.Since few months the Department ofClinical Pathology at the AziendaOspedaliera O.I.R.M.- S.Anna di Torino hasstarted its own Quality Assurance certification.Involved areas include the main Laband some parts of the immunohematologylab (SIMT). A Quality Assurance Manager(RAQ) has been designated. The RAQ hasbeen involved in writing up a referencemanual on quality control and is responsiblefor the coordination and standardizationof the different activities within thegroups, including personnel information andSQ development. In the present study wedescribe the preliminary experience of ourSIMT clotting lab, which is also RegionalReferral Centre for childhood hemophiliaand performs second line investigations notavailable in other regional hospitals. Thedoctors in charge of each group have managedquality assurance within their teams

37 th Congress of the Italian Society of Hematology187CHRONIC LYMPHOCITICLEUKEMIA AND LYMPHOMASP21214q+ IN B-CLL: CLINICOBIOLOGICALFEATURESA. CUNEO, C. MINOTTO, M.G. ROBERTI, A. BARDI,R. BIGONI, J.M. HERNANDEZ, M.A. SANCHEZ,J. SAN MIGUEL, P. AGOSTINI, A. TIEGHI, D. CAMPIONI,R. MILANI, G. CASTOLDIDipartimento di Scienze Biomediche e TerapieAvanzate - Sezione di Ematologia, Università diFerrara, Italy and Institute of Hematology,University of Salamanca, Spain10 patients with a 14q+ chromosome(exlcuding the 11;14, the 14;18 and the14;19 translocations) were identifiedamong approximately 250 cases of B-cellchronic lymphocytic leukemia (CLL). At(6;14)(p12;q32) and a t(4;14)(q21;q32)were identified in 2 cases, 7 and 1 casehad a 14q32 and a more proximal 14q22breakpoint, respectively, exchanging materialwith unknown partners. All casestested had a mixed, nodular and diffusebone marrow infiltration pattern, with a PBmorphology consistent with typical CLL in6 cases, with CLL mixed-cell type and CLL/PL in 2 cases each. No patient had aprolymphocytic transformation, whereas aRichter’s syndrome was diagnosed in 1 caseafter 5 years. All cases were CD5/CD19+;CD23 was positive 8 cases; CD11c was positivein 4 cases; a bright pattern of sIg expressionwas noted in 6 cases. Median ageat diagnosis was 66 years (range: 43-72);5 patients presented in stage A, 3 in stageB, 2 in stage C, with a median leukocytecount of 18 x 10 9 /l (range 11-35). Themedian interval between diagnosis and startof treatment was 6 months: 4 patients diedat 44-86 months; 6 are alive with a medianfollow-up of 52 months. We arrived atthe following conclusions: a) B-CLL with a14q+ chromosome was associated withatypical morphology and immuno-phenotype,but did not show prolymphocytictransformation; b) these patients had atherapy-demanding clinical course and, c)the outcome of the disease appears to beunfavourable as compared with other CLLs.P213THE SEQUENTIAL ANALYSIS OFTRISOMY 12 IN CHRONICLYMPHOCYTIC LEUKAEMIAV. PITINI, C. ARRIGO, G. ALOI, M. PICCIOTTO, A. CASTRO,F. L A TORREDepartment of Medical Oncology, University ofMessina, ItalyRecent data from Auer et al. (1999) suggestedthat trisomy 12 occurring as the solechromosome abnormanlity was associatedwith typical Chronic Lymphocytic Leukaemia(CLL) and had no prognostic value on multivariateanalysis. Interphase fluorescencein situ hybridization (FISH) is able to detectthe trisomy 12 abnormality in up totwice as many cases as conventionalkarytyping, but the clinical significance ofthis, and in particular the value of FISHscreening for trisomy 12 alone, is not clear.Garcia-Marco et al. (1997) performed sequentialFISH over a 4-year period in 30CLL cases. All patients with trisomy 12showed progression of the clone in sequentialanalysis. Raghoebier et al. (1992) reportedstability of the trisomy 12 abnormalityby serial FISH samples on 19 patients.The aim of this study was to evaluatethe clinical significance of FISH-onlytrisomy 12 by accurately monitoring thefrequency of the trisomic clone and correlatethese findings with survival, diseaseprogression and need for treatment. InterphaseFISH was performed on 40 patientsin 1993-1994 and repeated on 25 patientsin 1998. In the original study 12 patientshad stage A disease, (0/12 trisomy 12; 1atypical CLL) 14 stage B (5/14 trisomy 12;3 atypical CLL) and 14 stage C disease (10/14 trisomy 12; 5 atypical CLL). In the follow-upgroup (1998) 5 had stage A disease(0/5 trisomy 12), 12 stage B (6/12trisomy12) and 8 stage C (5/8 trisomy 12). Duringthe study period there were 15 deaths ofwich 13 as CLL related deaths. No significantchange in the size of the trisomy 12clone was seen among the patients showingevidence of disease progression. To conclude,there appeared to be no expansionof the trisomy 12 clone over time in levelsonly detectable by FISH. We have shownno difference in survival, disease progressionor time to treatment in patients withFISH-only detectable trisomy 12.

188 September 26-29, 1999 - Torino-Lingotto, ItalyP214EBV AND HHV8 IN PATIENTSAFFECTED BY B-CLLG.A. PALUMBO, F. DI RAIMONDO, G. MILONE, C. SIMILI,M. SALERNO, M.A. ROMEO, P. GUAGLIARDO, R. GIUSTOLISICattedra e Divisione di Ematologia con Trapianto,Ospedale Ferrarotto, CataniaSeveral viruses are able to produce proteinsthat are analogues to humancytokines, with widespread effects on immuneand haemopoietic systems. In particular,the Epstein-Barr virus (EBV) producesa viral interleukin 10 (vIL-10) andthe HHV8 a vIL-6. On these basis, using ahigh-sensitivity PCR (nested-PCR), weevaluated the presence of both these viruseson peripheral lymphocytes of patientsaffected by chronic lymphocytic leukaemia(B-CLL). In this study we tested 153samples from 65 patients (age 45-86, median67) and 47 normal control subjects(age 38-79, median 60). 43 patients wereat initial stage of disease, 0-I according toRai; 7 at intermediate stage, Rai II; 15 atadvanced stage, Rai III-IV. When thesamples were collected for this study 36patients (age 45-83, median 65) were nottreated; the other 29 (age 45-86, median67) were pretreated. HHV8 was alwaysnegative, both in controls and in B-CLL patients,while EBV was present in 38 out of65 patients. EBV positivity was similar in50 initial/intermediate stage patients (age45-84; median 66) compared to controls:26/50 (52%) vs 24/47 (51%). On the contrary,in the 15 subjects with advanced disease,EBV+ was significantly higher comparedto those at initial/intermediate stage:12/15 (80%) vs 26/50 (p = 0.05, Fisher’sexact test). Furthermore, EBV+ was presentin 69% of pretreated patients, significantlyhigher (p = 0.09 in both cases) than inuntreated patients (50% EBV+) and in normalcontrols (51% EBV+). Although finalconclusions cannot be drawn, the more frequentEBV finding in subjects who werepretreated and/or at more advanced diseasestages could probably reflect a greaterimmunodeficiency in these groups. Thisstate could be further worsened by vIL-10produced by EBV. Regarding HHV8, absentin all samples tested in the study, its eventualpresence in stromal bone marrow cells,where this virus has been reported in otherlymphoproliferative diseases, remains to beinvestigated.P215CHRONIC LYMPHATIC LEUKEMIA BAND HEPATITIS C VIRUS INFECTIONC. MURARI., M.BOCCALON, P. BOCCA, G. ZOTTAREL,P.F. BALLERINI, G.C. DONATINucleo Ematologico Operativo, Divisione Medica 1,Ospedale De Gironcoli - Conegliano (TV)The link between non-Hodgkin B-CellLymphoma (NHL) and HCV is well known.The HCV’s lymphotropism may be thepathogenetic stimulus to the proliferationof lymphocytes. There is not however aknown correlation (which is perhaps a territorialone) between HCV infection andchronic lymphatic leukemia B (B-CLL). Wehave had 6 cases out of 44 (13.6%) patientswho are B-CLL and HCV-Antibodypositive. In 5 of these the search for RT-PCR viral genome sequences provedpositive. The B-CLL diagnosis was arrivedat via cytomorphological and immunophenotypicexaminations of the medullary andperipheral blood. There were no instancesof a significant alteration in liver functionblood chemistry parameters. In two patientsa liver biopsy was performed consistent withchronic portal hepatitis. Only in these twocases was there a weak presence of cryoglobulins.One other patient came to ournotice for severe plastocytopenia resultingfrom increased “turn over” from high dosage(as per index) of glycocalycine, antiplateletantibody positive (direct and indirecttest). Also present were HCV Antibodiesand HCV-RNA positiveness, with no cryoglobulinemia.The cytofluorometric analysisof the medullary blood found a smallpercentage (about 1%) of CD5+ lymphoid,CD19+, and clonal K elements. These resultswere confirmed by subsequent tests.Conclusions: In our small sample of casesHCV infection is significantly correlated withB-CLL (13.6%) of cases. Furthermore thediscovery of a small CD5+ and CD19+ clonein the medullary blood of an HCV positivepatient, without cryoglobulinemia, supportsthe hypothesis of a possible role for the virusin the genesis of the lymphoproliferativeprocess. In these instances considerationcould be given to early intervention withinterferon-alpha treatment for the B-CLL atan appropriate dose and for an appropriateperiod aimed at the eradication of the virus.On the other hand care should be takenwhen considering the use of steroids and

37 th Congress of the Italian Society of Hematology189cytostatics given the possibility of makingthe hepatic process more acute.P216abstract not receivedP217BONE MARROW AND PERIPHERALBLOOD MONOCLONAL B-CELLPOPULATION IN A PATIENT WITHSARCOIDOSISA. DEL SANTO 1 , L. UZIEL 1 , S. PURICELLI 1 , U. GIANELLI 2 ,C. PATRIARCA 2 , S. ROMAGNOLI 2 , G. CARPANI 3 , F. INVERNIZZI 1Cattedra di Medicina Interna 1 , Servizio di AnatomiaPatologica 2 e Servizio Immunotrasfusionale 3 ,Azienda Ospedaliera San Paolo, Milan, ItalyWe report the case of a 58 years old femalepatient, referred to us because of immunehemolytic anemia, giant hepatosplenomegalywith hepatic and splenic focallesions, enlarged mediastinal, abdominaland inguinal lymph nodes, bilateral pulmonaryinfiltrates, moderate general symptoms.The diagnosis of sarcoidosis wasmade by inguinal node biopsy. Peripheralblood and marrow aspirate flow-cytometry,performed because of the finding of atypicalcirculating and marrow lymphocytes,showed an increase in the percentage of B-cells (CD19+, CD22+ and CD23+/-), bearingk light chain restriction. Bone marrowbiopsy was negative for lymphoproliferativedisease. Prednisone, 50 mg per day, wasstarted. After six weeks, general symptomsand immune hemolytic anemia disappeared.CT scans showed the regression ofhepatic and splenic focal lesions, togetherwith liver, spleen and lymph nodes volumereduction. Peripheral blood and marrowaspirate flow-cytometry confirmed the previousfinding of k-light chain restricted B-cells. Bone marrow biopsy revealed lymphoidinfiltration (30%), with intralacunarand paratrabecular aggregates of small andmedium sized lymphocytes, mainly of B-cell origin (CD20+, CD79a+, CD5-, CD23–), but with a moderate T-cell component.The molecular analysis detected monoclonalIgH/FR3 rearrangement on the B-cell marrowpopulation. A mediastinal node biopsywas then performed, which confirmed theprevious diagnosis of chronic granulomatouslymphadenopathy, suggestive for sarcoidosis.The patient is now receiving taperingdoses of prednisone. The finding ofmonoclonal marrow B-cell aggregates, withouthistological evidence of a lymphoproliferativedisease, might represent a normallymphocytic clonal response to antigenicstimulation lacking clinical significance,or might be considered the first stepof a clone selection process ultimately leadingto the development of a lymphoid neoplasmon a preexisting sarcoidosis (sarcoidosis-lymphomasyndrome).P218PERSISTENT POLYCLONAL BLYMPHOCYTOSIS: MORFOLOGICAL,IMMUNOLOGICAL, CYTOGENETIC ANDMOLECULAR ANALYSIS OF ONE CASEC. FIORANI, P. VANZELLI, S. TONELLI, I. CASTELLI, A. TERZI,P. TEMPERANI, G. BONACORSI, S. SACCHIDip. di Scienze Mediche, Oncologiche e Radiologiche,Università degli Studi di Modena e Reggio EmiliaAs far as we know there are not any previousreport of Persistent Policlonal B Lymphocytosis(PPBL) in italian patients. We reportthe case of a heavy smoker female patientaged 43 years, with moderate lymphocytosisdiagnosed as having PPBL. Clinicallyshe was asymptomatic, without splenohepatomegalyand lymphoadenomegaly;peripheral blood smear examination showedthe presence of binucleated lymphocytes;bone marrow was morphologically normal,with slight lymphocytosis withoutbinucleated cells. Immunophenotypeshowed: CD19 + 44%; CD5 + /CD19 + , CD23 + ,IgG + , IgA + cells: in the normal range; IgM +cells 60%; IgD + cells 60%; kappa lightchain 34% and lambda light chain 30%positive cells; CD3 + cells 47%; CD4 + /CD8 +ratio: 3. The patient was HLA-DR10/DR8.The serum IgM were 520 mg/dl policlonal,IgG 1050 mg/dl, IgA 200 mg/dl. There wereanti-EBV antibodies IgG type against theviral capside antigen; DNA analysis of peripheralblood cells by PCR was positive forEBV, using a couple of primers complementaryfor a specific sequence codifying forLMP. Southern blot analysis of the heavychain (JH) Ig gene performed on peripheraland marrow blood was negative forpresence of clonal population. Amplificationsof the major breakpoint region (MBR)

190 September 26-29, 1999 - Torino-Lingotto, Italyand minor cluster region (mcr) of the BCL2/IgH translocation performed by PCR showedthree different rearrangements in the MBRand one in the mcr. The molecular-cytogeneticexamination with probe WCP3 demonstratedthe presence, in 2/53metaphases, of isocromosome +i(3q). Sixmonths later, after the patient quit smoking,there was an improvement of the hematologicaldata: CD19 + cells decrease to25% and we observed a decrease of serumIgM level. The follow up at twenty-fourmonths, after the patient restarted smoking,showed a new increase of CD19 + cellsand in binucleated peripheral blood lymphocytes.The case which we have reportedis a typical one among those described inliterature, a part from the absence of HLA-DR7. Long term follow-up is needed to excludethe risk of malignant evolution of disease.P219abstract not receivedP220ROLE OF CD79b AND CD43 IN THEDIAGNOSIS OF CHRONIC B-CELLLYMPHOPROLIFERATIVE SYNDROMESL. CRO, A. GUFFANTI*, N. ZUCAL, L. NOBILI, C. VENER,A.T. MAIOLO, L. BALDINIServizio di Ematologia, Università degli Studi,Ospedale Maggiore, I.R.C.C.S. and *Divisione diMedicina I, Ospedale Fatebenefratelli, Milan, ItalyThe reactivity of CD79b (recently studiedby Catovski in B-CLL) and CD43 (includedin the REAL lymphoma diagnostic classification)has been evaluated in patients withleukemic forms of chronic B-celllymphoproliferative syndromes, with theaim of establish their diagnostic usefulness.A series of 110 pts with mature B-cellchronic leukemias of extrafollicular origin(CD10-) was subdivided into 4 groups accordingto our scoring system based on SIgintensity and CD5/CD23 reactivity: group1 (53 pts) had cytomorphological andimmunophenotypical characteristics consistentwith classical CLL; group 2 (21 pts),for its SIg intensity and atypical morphology(significantly more frequent than incluster 1: p=.002), had characteristics compatiblewith what we call variant CLL (CLLv);group 3 (15 pts) had characteristicsconsistent with mantle cell lymphoma diagnosis;group 4 included 21 pts with leukemicimmunocytoma and splenic marginalzone lymphoma (with or without villouslymphocytes), HCL and prolymphocytic leukemia.Marker positivity was expressed asgrade 0 (< 20% of CD19 + cells); grade 1(≥ 20 < 60%); grade 2 (≥ 60%); fluorescenceintensity was expressed as the difference,in the log scale, between the medianvalue of positive cells and that of thenegative control: dim ( for a difference of ≤390) and bright (>390). In group 1, CD79bpositivity was much less than in the othergroups (p

37 th Congress of the Italian Society of Hematology191anemia (p=0.03), massive splenomegaly(p=0.000), high LDH (p=0.007), high Beta-2 microglobulin (p=0.006), old age(p=0.001) and male sex (p=0.02).Immunophenotype of CD23 negative patientswas quite homogeneous. Surfaceimmunoglobulin expression was moderate/strong in 19 case (82%). Only one patientswas negative for FMC7 and none of the 13tested expressed CD10. Cytogenetic analysiswas performed in 19 patients and in 14cases (73%) clonal abnormalities werefound. t(11;14)(q13;q32) was found in 5patients, always associated with other chromosomalaberrations. Only one patientshowed a morphological picture of typicalCLL. All the other cases showed abnormalitiesof the nuclear outline or other morphologicalfeatures distinctive from typicalCLL. At the end of the diagnostic work-up,only three patients of this CD23- groupturned to have a relative indolent diseasesuch as Splenic Marginal Zone Leukemia/Lymphoma (SMZL), while the remainingpatients were diagnosed as Mantle Cell Lymphoma(16 patients) or an aggressive formof CLL/PLL that required treatment (3 patients).Only one patients was diagnosedas stage A B-CLL. Among MCL patients, onlythree did not require treatment; 2 weretreated with monoclonal antibody (IDEC)and 3 patients received purine analoguebasedtherapy, all with poor results. Theremaining 8 patients were treated with anaggressive regimen (Hyper-CVAD followedby HD MTX/ARA-C). Notwithstanding theold median age (70 y), 5 of these patientsachieved a complete response. On thewhole, among CD5/CD19+ group, survivalof CD23 negative patients was significantlyworse than CD23 positive. In conclusion,these data indicate that very few of the typicalB-CLL are CD23 negative. Moreover,CD23 negativity in a patient with a CD5/19+ leukemic lymphoproliferative disordershould alert clinicians on the possibility ofan aggressive disease, expecially MCL.These patients have a poor response toconventional therapy and a more intensiveapproach should be considered. On the contrary,of the CD5/19- patients, 15 (47%)were CD23 negative. Eleven of these patientswere classified as SMZL and 4 as follicularlymphoma. CD23 negativity did notidentify a distint subgroup of patients asregard clinical features, diagnosis, responseto therapy and survival when compared toCD23 positive patients.P222LIGHT SCATTERING OF B CHRONICLYMPHOPROLIFERATIVE DISORDERSS. VOLPE, G. MARCACCI, F. CAPONE, G. STORTI, F. RONCONI,A. SEMENTA, E. VOLPEServizio di Ematologia - UTIE - A. O. S. G. Moscati,Avellino, ItalyChronic B lymphoproliferative disorders(B-CLD) with leukemic features are an heterogeneousgroup of conditions and, in thiscontext, B-cell chronic lymphocytic leukemias(B-CLL) are the most prevalent. TheFrench-American-British (FAB) morphologicalcriteria subclassify B-CLL into typical (>90% small lymphocytes) or atypical CLL (

192 September 26-29, 1999 - Torino-Lingotto, ItalyP223CLINICAL PRESENTATION OFCHRONIC LYMPHOCYTIC LEUKEMIA INA DEPARTMENT OF GENERALMEDICINEV. CORDIANO, F. LORA, F. MADDALENA, D. BERSELLI,D. FIORETTIDivisione di Medicina Generale, Ospedale SanLorenzo, Valdagno (VI)Objective. To evaluate the modalities ofthe clinical presentation of Chronic LymphocyticLeukemia (CLL) in our Department,which serves a population of about 60,000inhabitants, between 1997 and 1998.Methods and Results. The IWCLL’s criteria(1) were used for diagnosis and staging.In this retrospective study we identified18 cases of CLL-B. Mean age of thepatients was 69 years, range 43-84. 16/18 (88,9%) were in stage A and 15/18(83,3%) had no symptoms at diagnosis;2/18 (11,1%) had pneumonia, and the patientwith legs paresis had a diffuse infiltrationof the peripheral nerves by a populationof CD20+ small lymphocytes, asshowed by immunoistochemical staining ofthe biopsy of his right sural nerve. The followingtable shows the main clinical characteristicsof our patients.CHARACTERISTC N. PATIENTS (%)SexMale 9 (50)Female 9 (50)Stage (Binet)A 16 (88,9)B 1 (5,5)C 1 (5,5)Lymphocytes at diagnosis10.000 15 (83,3)Modalities of clinical presentationAsymptomatic 15 (83,3)Pneumonia 2 (11,1)Legs paresis 1 (5,5)Conclusions. In our experience an highpercentage, about 90%, of CLL-B diagnosedin the last two years was in stage A.83% of them were asymptomatic at diagnosis,while a percentage of 60% of patientsin an asymptomatic phase has beenreported (2). The small number of patientsis perhaps the main reason of this discrepancy,but it could also reflect a differentmodality of clinical presentation of the diseasein the general medicine units comparedwith the more specialized centersthat, probably, receive a greater number ofselected patients.1. IWCLL. Ann Intern Med 1989;110:236-82. Rozman,C et al. N Engl J Med 1995;333:1052-1057P224LYMPHOCYTOSIS; PRESENTATION OFTWO CASES, CLINICAL ANDIMMUNOPHENOTIPICCHARACTERISATIONA. SANTAGOSTINO, *D. MANACHINO, V. BOLIS, P. PROSPERI,R. CAMINITI, G. CAMISASCA, M. ROCCELLA CONTIServizio di Immmoematologia, * Divisione diMedicina Interna, Ospedale S.Andrea, VercelliAbsolute lymphocytosis was defined bythe presence in peripherical blood of morethan 4000cells/µL; this condition is consideredas primitive when there is an intrinsecdefect of a lymphocitic subpopulation andit often indicates a lymphoprolifertive disorder.Morphological examination is thefirst step for diagnosis but the immunophenotypicalanalysis is the best approach tocharacterize what kind of lymphocyte subpopulationis expanded and to assess theclonality in the case of B-lymphocyte proliferation.In this study we describe two caseswith absolute primitive and persistent lymphocytosisclassified of B-lymphocyte originby immunophenotipic analysis and consideredas polyclonal for the presence of balancedexpression of k and λ light chain ofsurface immunoglobulin. Flow cytometricanalysis was conducted on whole periphericalblood employng a flow cytometer FACScan,Becton Dickinson, and a wide panel of monoclonalantibodies in double staining. Flowcytometric analysis was requested for the twopatients, a 63 year-old man and a 55 yearoldwomen, for a persistent absolute lymphocytosiswithout any other symptom orsign; physical examination in both cases wasnegative. Laboratory data respectivelyshowed: WBC 12.9 and 10.5 x 10 9 /L withlymphocyte percentage of 61% and 68% .There were no anemia nor reduction in plateletcount and laboratory tests for chronic inflammatorydiseases, viral infections andautoimmune diseases were negative.Immunophenotic analysis showed the followingresults:

37 th Congress of the Italian Society of Hematology193The follow up of these patients for two yearsshowed no clinical variation. In conclusionthe immunophenotic analysis was able toshow not only an expansion of B-lymphocytesubpopulation but also to define thepolyclonality of this proliferation. This is animportant criteria to differenziate theseconditions from a true lymphoproliferativedisorder, but the significance of this proliferation,polyclonal or oligoclonal, is yet tobe determined.P225HAEMOPHAGOCYTIC LYMPHO-HYSTIOCYTOSIS IN IMMUNOCOMPETENTSUBJECTS: A Single Centre ExperienceF. CARONIA, S. VASTA, S. TRINGALIDepartment of Haematology, Hospital “V.Cervello”Palermo, ItalyThe haemophagocytic lympho-hystiocytosisis a reactive disorder characterizedby haemophagocytosis taking place in theheamopoetic organs. Two forms are described:1) Related to infections, generallyviral (VAHS), more frequent in immunocompromisedsubjects and often fatal; 2)Familiar (FHL), with poor prognosis: patientscured only by BMT (an Internationalregistry reports 122 cases in 11 Countries).In our Institution two cases of reactivehaemophagocytic syndrome in immunocompetentsubjects have been reported inthe last 10 years. Case 1. Female, 31 yearsold, admitted with fever, arthromyalgia,hepatosplenomegaly, skin rash. The feverresolved following antibiotic and steroid, butsubsequently the patient developed jaundice,flapping tremor with raised AST/ALT,alkaline phosphatase and creatinin. Also:anaemia, low PLT count, low serum fibrinogen,prolonged protrombin time and neutrophilia.The bone marrow examinationrevealed marked haemophagocytosis. Serologicalinvestigation showed positivity forCocsakie B” virus. Signs and symptoms resolvedwith support therapy only. Case 2.Female, 10 years old, admitted for fever,sore throat, lympho-adenomegaly, hepatosplenomegaly,raised LDH. Viral serology(CMV, EBV, etc), TB serology, blood coltures,all negative. Several antibiotic regimensfailed. Chest X-Ray showed interstitial pneumonia,but BAL and broncheal biopsy failedto identify an actiology. Both bone andlinphonode biopsies showed markedhaemophagocytosis. High dose of steroidaltreatment, high doses of intravenous Ig andAcyclovir all failed. Death for respiratoryfailure eventually occurred. Case 1 is a typicalVHAS, Whereas in Case 2, failure to identifythe actiology, young age and fatal outcomeare suggestive of FHL. Reactivehaemophagocytic lympho-hystiocytosis ischaracterized by variable presentation andoutcome, and therefore has to be consideredin differential diagnosis of febrile andcytopaenic patients.P226ANGIOGENESIS IN 20 CASES OFHAIRY CELL LEUKEMIAG. PRUNERI*, D. SOLIGO, S. VALENTINI*, N.CARBONI*,M. COLOMBI, L. CRO, C. LUCHESINI, L. BALDINI,G. LAMBERTENGHI-DELILIERS*II Servizio di Anatomia Patologica and Servizio diEmatologia, Istituto di Scienze Mediche, Universitàdi Milano, Ospedale Maggiore, I.R.C.C.S., MilanIt has been established that angiogenesisis fundamental for the processes of tumoraloxygenation, perfusion, growth, invasionand metastases. Some data indicate that

194 September 26-29, 1999 - Torino-Lingotto, Italyangiogenesis can also be involved intumours of the hemolymphopoietic system,such as non-Hodgkin lymphomas andmultiple myelomas. We thereforeimmunohistochemically analysed angiogenesisin 30 bone marrow biopsies (BMBs)obtained from 20 patients with hairy cellleukemia (HCL): in ten cases, the analysiswas made at diagnosis and after interferontherapy. The normal controls were negativeBMBs taken from patients withHodgkin’s lymphomas or solid tumours. Theimmunohistochemical analysis was madeusing the ABC method modified by the useof microwave oven treatment. The endothelialcells were immunostained with anti-CD34 monoclonal antibody (QBEnd/10,1:10, Signet Laboratories Inc., Dedham,USA). Microvascular density (MVD) wasestimated throughout the BMB at 40x magnificationby calculating the median numberof vessels and the areas with the largestnumber of vessels (“hot spot”).No. MVD (per 40x ) Hot spotsControls 11 6.09±2.01 12.09±4.65HCL (at diagnosis) 20 13.65±3.85 21.90±7.75HCL (after therapy) 10 14.35±3.37 22.70±6.07The mean MVD and hot spot values weresignificantly higher in the HCL cases thanin the controls (p45 U/ml, while for bcl-2to >600 U/ml. Serum s-CD23 was significantlyhigher (p=0.007) in Binet B than inBinet A patients. Moreover, within Binet Astage, 55.6 % (10/18) of patients treatedfor disease progression had sCD23 levels>45 U/ml ; on the contrary, 71.4 % (15/21) of untreated patients had sCD23 valueslower than 45 U/ml (p=0.08). Low bcl-2 levels were prevalently found in Binet Astage (p=0.051), but we found no correlationbetween bcl-2 levels and disease progression.Both high sCD23 and bcl-2 arecorrelated to a lymphocyte doubling time< 6 months (p=0.07 and 0.006 respectively),while high sCD23 is slightly relatedto b-2 microglobulin increase (p=0.153).Ten patients underwent therapy withfludarabine (25 mg/m 2 for 5 days for 6courses every 28 days) and 7 achieved CR.We compared sCD23 and bcl-2 levels beforeand after therapy and found a verysignificant reduction both for sCD23 (mean40.4±12.8 vs 5.2±5.9; p

37 th Congress of the Italian Society of Hematology195P228MODULATION OF CD38 EXPRESSIONIN CHRONIC LYMPHOCYTIC LEUKEMIACELLS THAT UNDERGO APOPTOSISB. OLIVA, M. MANGIOLA, V. CALLEA, M. CUZZOLA,P. IACOPINO, F. NOBILE, M. BRUGIATELLI, F. MALAVASI°,F. MORABITODipartimento di Emato-Oncologia, AziendaOspedaliera Bianchi-Melacrino-Morelli, ReggioCalabria, °Istituto di Biologia e Genetica, Universitàdi AnconaIt is known that B-cell Chronic Lymphocyticleukemia (CLL) lymphocytes spontaneouslydie in vitro after short-term culture,as a consequence of apoptosis. Recently,CD 38 antigen expression in CLL hasbeen studied with heterogeneous results indifferent patients. When CLL cases weresubdivided in two major groups accordingto CD38 expression and samples from caseswith high CD38 expression seem to be moreeasily induced to undergo apoptosis. In orderto better clarify this phenomenon, weanalysed the modulation of CD38 expressionafter the induction of the apoptoticprocess on lymphocyte samples from 24untreated CLL. The agonist MoAb IB4(IgG2a) was employed as anti-CD38 reagent.Apoptosis was determined by PI flowcytometry assay. CD38 expression significantlycorrelated with the level of apoptosis.After spontaneous apoptosis, CD38 remarkablydeclined in 66% of cases, of which mostexpressed CD38>50%. CD38 expressionwas higher in 5/24 CLL cases. Two casesexpressing low CD38 percentage recordedan increase in CD38 expression after bothin vitro and in vivo exposure to chlorambucil,whereas CD38 expression was decreasedin three other cases showing initiallyhigh CD38 expression. The presenceof the agonist anti-CD38 prevented spontaneousapoptosis in 4 out of 10 samplesthat highly expressed the surface antigenCD38. These results are in line with the observationthat germinal center B-cells,which express high level of CD38, show susceptibilityto cell death, suggesting thatCD38 is a marker involved in apoptotic process.On this base it should be possible topostulate that chemotherapy may initiallyeliminate more mature CD38 + cells and thenkill CD38 - cells, likely after a maturationalprocess into CD38 + lymphocytes.P229CD38 EXPRESSION IN B-CELLCHRONIC LYMPHOCYTIC LEUKEMIAAND SMALL LYMPHOCYTIC LYMPHOMAM. GEUNA, G. STROLA, A. VALLARIO, A. FALDELLA,F. C ALIGARIS CAPPIOCattedra di Immunologia Clinica, Università diTorino e Laboratorio di Immunologia Oncologica.I.R.C.C. CandioloThe recent lymphoma classifications(REAL and WHO) group chronic lymphocyticleukemia (CLL) and small lymphocytic lymphoma(SLL) into a single category on theground of their common phenotype andcytomorphologic features. In both instancesmalignant B cells express CD5, CD23, CD43and lack CD10, CD79b and FMC7. MembraneIgs as well as many mature B-cellantigens (i.e. CD20 and CD22) are weaklyexpressed on the cell surface. Recently, adistinction of B-CLL patients in two clinicalcategories has been proposed on the basisof the cell surface expression of CD38 andof Ig V gene mutation status. The CD38+,Ig V gene unmutated group shows a worseclinical outcome. By contrast, the CD38-group of CLL has frequently Ig V gene mutationsand is associated with a better clinicalcourse. We have characterized 24 CLLon peripheral blood and/or bone marrowand 11 SLL on lymph node biopsy by meansof a large panel of monoclonal antibodiesand analyzed the immunophenotypic pattern.All cases were positive for CD19, CD5,CD23 and CD43. CD38 antigen was positiveon the majority of malignant cells in63% of the cases, whereas a variable numberof cases showed positivity for CD9,CD25, CD11c, CD95, CD72, CD74, CD75,CD79b and FMC7 (ranging from 6% to96%). Dividing the whole series in twogroups on the basis of CD38 expression,we found a marked difference in the expressionof many surface antigens. CD9 wasexpressed in 94% of CD38+ cases vs 20%of CD38- (p

196 September 26-29, 1999 - Torino-Lingotto, Italygest that the expression of CD38 may identifytwo groups of chronic CD5+ B lymphoidtumors that differ in their phenotypic pattern.The correlation between SLL and CD38expression is intriguing and may be takento suggest that B CD5+ malignant cell carryingCD38 antigen give frequently rise tolymphomatous disease whereas the absenceof the CD38 is more frequently associatedwith a more frank leukemic pattern.P230STABLE DISEASE IN CHRONICLYMPHOCITYC LEUKEMIA ISCHARACTERIZED BY p27OVEREXPRESSION AND A HIGHERSUSCEPTIBILITY TO ENTERAPOPTOSISM.R. RICCIARDI, C. GREGORJ, M.T. PETRUCCI, C. ARIOLA,R. CERRETTI, F.R. MAURO, R. FOÀ, F. MANDELLI, A. TAFURIEmatologia, Dipartimento di Biotecnologie Cellularied Ematologia, Università “La Sapienza”, Roma eDipartimento di Scienze Biomediche e OncologiaUmana, Università di TorinoB-cell chronic lymphocytic leukemia (CLL)is characterized by the progressive expansionand accumulation of resting clonal Bcells with prolonged survival. Several reportshave demonstrated the role ofapoptosis (APO) in this disease and the influenceof cell cycle regulatory genes (e.g.p53, p27) has been postulated. Whetherthese mechanisms play a role in determiningthe heterogeneous clinical activity of thisdisease is not yet clarified. Therefore, wehave studied the differences in cell cycleand p27 expression, measured by Westernblot, in primary cells from 62 CLL patientswith stable (STD) and progressive disease(PRD). In addition, we have studied in thesetwo groups the susceptibility to enter APO,both in fresh samples and after in vitro liquidculture. WBC values differed significantlybetween the two categories with amean (m) value of 38.5±23.5 (range 11.4-94.9) in STD and 95.5±63.6 (range 10-250)in PRD, though no differences were foundin the percentage of circulating CLL cells.Similarly to normal peripheral blood lymphocytes(PBL), fresh samples werecharacterized by a resting status(G0=97.2%±3.95) and by p27 expression(91.2% of the samples). CLL samples generallyoverexpressed p27 with a mean valueof optical density (OD) of 3.98±2.4, comparedto normal PBL (OD=2.3±0.21), resultingin an OD CLL/PBL ratio ranging between0.12 and 4.85. Detection of p27 inCLL samples grouped for different diseaseactivity showed a significantly (p=0.055)higher mean value of p27 in patient withSTD compared to PRD samples: OD ratio of2.17±1.19 (range 0.26-4.85) vs 1.45±0.85(range 0.12-3.02), respectively. Detectionof APO in fresh CLL samples showed a lowvalue (m=0.75%±0.72) similar to that ofnormal PBL (m= 0.55% ±0.34) and withno difference between STD and PRD. However,the detection of cell susceptibility toentering apoptosis, performed after 24hours of in vitro culture, showed a significant(p=0.026) difference between STD(m=23.47%±14.72) and PRD (m=15.6%±9.17) patients. In conclusion, this studydemonstrates that in CLL, STD samples arecharacterized by increased levels of p27 andby a higher susceptibility to enter APO.Similarly to findings in solid tumors, theresults of this study suggest a role for p27in the activity of the disease and in the inductionof apoptosis.P231EXPRESSION OF THROMBOSPONDINRECEPTOR (CD36) IN B-CELL CHRONICLYMPHOCYTIC LEUKEMIA AS ANINDICATOR OF TUMOR CELLDISSEMINATIONC. RUMI, S. RUTELLA, A. DI MARIO, *L.M. LAROCCA,G. LEONEDept. of Hematology and *Pathology,Catholic University, Rome, ItalyWe investigated the expression of CD36on B-cell chronic lymphocytic leukemia(CLL) and correlated these results with laboratoryand clinical features. CD36 could bedetected on 3% (range 2-5) of normalCD19+ B-lymphocytes and on 45% (30-75)of neoplastic CD19+ B-cells. When CLL patientswere arbitrarily stratified accordingto CD36 staining intensity (weak -score 0-, moderate -score 1-, intermediate -score2- or strong -score 3-), significantly higherHb level/platelet count and significantlyreduced lymphocyte count were recordedin patients assigned to score 0 comparedto patients scoring 1-2 or 3. CLL patients

37 th Congress of the Italian Society of Hematology197expressing CD36 at intermediate-to-strongintensity were more frequently assigned toRai stages III-IV than stages I-II (P=0.005)and stage 0 (P

198 September 26-29, 1999 - Torino-Lingotto, ItalyCD11c on leukemic B-cells. CD11c expressionwas correlated with other B-cell markers(such as CD79b, CD22, and FMC7), diseasestatus, bone marrow (BM) histology,absolute lymphocytosis and lymphocytedoubling time (LDT). From the analysis ofour results there is not any correlation betweenCD11c-expression and CD79b (P=1), FMC7 (P=0.319), and CD22 (P=0.400),respectively. In addition, we failed to demonstrateany association with Rai substages(P=0.432), BM histology (P=0.899), absoluteperipheral blood lymphocytosis(P=0.416), and LDT (P=0.597). In conclusion,although useful for the diagnosis ofhairy cell leukemia (HCL) and prolymphocyticleukemia (PLL), CD11c does not playany role in the identification of immunologicaland/or clinical subgroups of patientswith typical CLL. In the clinical practice,assessment of CD11c expression shouldrepresent a second step evaluation deservedonly for patients displaying immunologicalfeatures of atypical CLL (CD5-and/or CD23-) in order to rule out diagnosisof B-PLL, HCL or its variants.P234INTENSITY OF CD20 EXPRESSION INB-CELL LYMPHOPROLIFERATIVESYNDROMESM.L. LA TARGIA, L. CRO, N. ZUCAL, C. VENER,A. GUFFANTI*, M. COLOMBI, A. CORTELEZZI, A.T. MAIOLO,L. BALDINIServizio di Ematologia, Centro G. Marcora ,Ospedale Maggiore IRCCS and *Divisione diMedicina I, Ospedale “Fatebenefratelli e Oftalmico”,Milan, ItalyThe availability of “humanised” anti-CD20MoAbs for the treatment of B-cell lymphomashas led to a re-evaluation of the intensityof CD20 expression in these neoplasmsinsofar as this is one of the possible variablescapable of conditioning the therapeuticefficacy of the treatment itself. In thisstudy, we used cytofluorimetry to analysethe intensity of CD20 expression (meanfluorescence channel of positive cells minusthe mean channel of the unlabelledcells) in 217 patients with mature B-cellleukemias: 90 with classical CLL, 45 withvariant CLL (CLL-v), 12 with mantle celllymphoma (MCL), 10 with follicular lymphoma(FL), 50 with lymphoplasmacytic(LP-IC) and marginal zone lymphoma(MZL), and 10 with HCL. The intensity ofCD20 expression in these cases was comparedwith that of CD79b, another B-cellmarker. A further evaluation was made ofcell suspensions obtained from pathological(prevalently lymph node) tissues: 18cases of lymphocytic lymphoma (LL), 26cases of lymphoplasmacytic lymphoma (LP-IC), 10 cases of low-grade marginal zonelymphoma (LG-SMZ) and 7 of high-grade(HG-MZL), 40 cases of follicular lymphoma(FL), 10 cases of mantle cell lymphoma(MCL) and 49 cases of large-cell lymphoma(LCL). Among the leukemic forms, the intensityof CD20 and CD79b expressionwas significantly lower in the CLL than inthe non-CLL group (p

37 th Congress of the Italian Society of Hematology199bution stage at diagnosis, survival probabilityand impact of the disease status on actuarialsurvival. Trends of these variableswere analyzed after splitting the whole seriesinto three groups according to the timein which diagnosis was performed: GroupI consisted of 75 pts diagnosed in the period1970-80, Group II was formed of 149pts in whom diagnosis was established between1981 and 1990, group III was composedof 293 pts diagnosed between 1991and 1998. No differences in age (P=0.304)or sex (P=0.427) distribution were foundamong different groups. The same appliedfor pts younger that 55 years who accountedfor 12.9% of group I , 12% of group II and9.7% of group III (P=0.602). The proportionof pts in whom the diagnosis was establishedin low clinical stage was higher inthe group III (72%) in comparison to groupII (52.8%) and group I (26.6%), respectively(P < 0.0001). Differences in stagedistribution affected overall survival whichwas longer for pts belonging to group III(median, 93 months) in comparison to thoseof group II (median,54 months) and groupI (median, 38 months), respectively (P

200 September 26-29, 1999 - Torino-Lingotto, ItalyP237PHARMACOGENETIC ANALYSIS OFFLUDARABINE METABOLISM INLYMPHOCYTES OF PATIENTSAFFECTED BY CHRONIC LYMPHOCYTICLEUKEMIAL. LONI, R. DANESI, C. BLANDIZZI, *M. PETRINI,M. DEL TACCADipartimento di Oncologia, Divisione diFarmacologia e Chemioterapia and *Divisione diEmatologia, Università degli Studi di PisaFludarabine is a purine analog endowedwith effective chemotherapeutic activity inthe treatment of chronic lymphoproliferativediseases, including chronic lymphocytic leukemia(CLL) and low grade non-Hodgkin’slymphomas. Fludarabine is able to inducea high proportion of complete responses inpreviously untreated patients and in subjectswith disease refractory to alkylatingagents (Keating MJ et al., Blood1998;92:1165). Fludarabine monophosphate(F-ara-AMP) is dephosphorylated toF-ara-A by ecto-5’-nucleotidase (ecto-5’-NTor CD73), a membrane-bound enzymewidely expressed on T and B cells, erythrocytesand endothelial cells (Resta R et al.,Immunol Rev 1998;161:95). Fludarabineenters cells by a carrier-mediated transportprocess and undergoes intracellular phosphorylationby the rate-limiting enzymedeoxycytidine kinase (dCK) to F-ara-AMPthat is sequentially phosphorylated to F-ara-ADP and to the active metabolite F-ara-ATP. On the contrary, the dephosphorylationof F-ara-AMP by endo-5’-NT withincells, followed by extrusion of F-ara-A tothe extracellular space, represents a mechanismof drug inactivation and, possibly, resistance.The aim of the present study wasto select gene-specific primers for reversetranscriptase (RT) and polynucleotide chainreaction (PCR) analysis of the dCK and 5’-NT gene expression in order to characterizetheir role in fludarabine response ofpatients with chronic lymphoproliferativedisorders. PCR primers were selected on thebasis of dCK, endo-5’-NT and ecto-5’-NTgene sequence, as available through theGENEBANK repository. RT-PCR analysis wasapplayed to a 50-year-old male patient withCLL relapsed after therapy with alkylatingagents, and partially responsive tofludarabine treatment. Total RNA was extractedfrom peripheral leukemic lymphocytes,and transcribed to complementaryDNA (cDNA) by MLV reverse transcriptase.The cDNA was then used as a template forPCR amplification and the resulting productswere separated by electrophoresis in2% agarose gel in 40 mM Tris-acetate, 1mM EDTA, pH 8. DNA products were visualizedby ethidium bromide staining andidentified as the endo-5’-NT (359 basepairs) and dCK (436 base pairs), with theb-actin gene being used as a positive control;ecto-5’-NT was not detected, however.The present findings demostrate the feasibilityof pharmacogenetic screening offludarabine metabolizing enzymes, whilethe absence of ecto-5’-NT expression maybe the a possible factor contributing to thechemosensitivity to fludarabine in this patient.P238B-CHRONIC LYMPHOCYTIC LEUKEMIA:IMMUNOLOGICAL REMISSION INPERIPHERAL BLOOD.AN ENIGMATIC CASE REPORTE. DE BIASI, F. CAVALLIN, R. DI GAETANO, G. TAGARIELLO,P.G. DAVOLICentro per le Malattie del Sangue, Ospedale CivileCastelfranco Veneto (TV)The main target of the therapy in elderlypeople affected by CLL is to avoid the progressionof the disease using standard treatmentwith Chlorambucil at the dosage of 6mg/m 2 for 10-20 days or without anytherapeutical approach at all. Case report:outpatient 80 years old male in good generalcondition arrived because of the increaseof total white cell (90,000/mm 3 ) with88,000/mm 3 lynphocytes which were prevalentmature, and several Gumprecht shadowsin the smear. Bone marrow biopsyshowed high lymphoid infiltration and almostdisappeared normal myelopoiesis.Peripheral blood and bone marrow flowcytometry evaluation demonstered in boththe samples clearly the presence of typicalimmunephenotype of B-CLL with positivityto CD19 =90%, CD 20 =75%, CD 19 +CD 5 =85% and Lambda clonality SmKappa= 0,5% and SmLambda 50% (B CLL diagnosis,II nd Rai classification). We started astandard treatment with Chlorambucil at thedosage of 10 mg/die. The patient was lostat the follow up and he came back again at

37 th Congress of the Italian Society of Hematology201our clinic a year later referring he prolongedthe therapy for only a manth without anyfurther check up. We analyzed againpheripheral blood and surprisingly we founda total different lymphocytic pattern comparedwith that observed a year before. Infact he had total normal lymphocytic subsets(WBC 4500/mm 3 , Linf. 950/mm 3 ) andlynphocytic subsets with CD19 = 27%,CD20 = 25%, CD19+CD5 =7% and thetotal desappearance of the clonality markersSmKappa =5%, SmLambda =3,5%,and SmK/SmL =1,4% which comfirmed thecomplete immological peripheral remission.In conclusion we think that this case provesthe utility of the phenotypic assessment inimproving the sensibility of the diagnosticcriteria for the determination of minimalresidual disease in CLL and sometime, surprisingly,and without defined explanationswe can observe complete remission in patienttreated with low dose Chlorabucil standardtherapy and for a short period whenin this “era” we are evaluating more aggressiveand high risk approaches to eradicatethe disease also in elderly people.P239MONTHLY INTERMEDIATE DOSECHLORAMBUCIL IN PATIENTS WITHCHRONIC LYMPHOCYTIC LEUKEMIA INELDERLY AGE OR WITH ASSOCIATEDDISEASESC. STELITANO, F. MORABITO, V. CALLEA, M. MANGIOLA,F. NOBILE, M. BRUGIATELLIDip. di Ematologia e Oncologia, Azienda OspedalieraBianchi-Melacrino-Morelli, Reggio CalabriaAim of the study. In order to identify atreatment schedule with low toxicity andsufficient efficacy, we retrospectively evaluatedthe results obtained with monthly intermediate-dosechlorambucil (CLB), withthe possible addition of prednisone (PDN)in patients affected with B-cell chronic lymphocyticleukemia (CLL) in elderly age orwith concomitant diseases. Patients andMethods. Since 1993, 32 subsequent patientsreceived this treatment, twelve weremales, median age was 75 years (55-88range, 19 cases ≥ 75 years). Five cases werepreviously treated. Stage distribution wasas follows: AI 3, AII 6, AIII 2, BII 7,BIII2,CIII 1 and CIV 11 cases; median TotalTumor Mass (TTM) score was 11.45 (3-20);13 cases had associated diseases. Diagnosiswas based on common morphologicaland phenotypic parameters. TTM, calculatedat diagnosis, before and after chemotherapywas used as criteria for response definition.Chemotherapy consisted of 5-10 mg/daytotal dose of CLB, administered monthly for14 days up to complete response (CR) orto maximal response. PDN was added toCLB at the dose of 25-50 mg/day in 11cases. The median number of cycles was 6(1-12), the median total dose of CLB was455 mg (range 200-1200). Median overallsurvival is 86.7 months and the medianfollow-up 35.5. Results. Response distributionwas 16 (50%) CR, 8 (25%) PR, 4(12.5%) NR and 4 (12.5%) PD, with anoverall response rate (CR+PR) of 75% ofcases.Total dose of CLB influenced the responserate. Moreover, the addition of PDNappeared to significantly improve CR rate(X 27.9, p = 0.048). Out of 24 respondingcases, 20 received maintenance chemotherapywith beweekly low-dose CLB: at thetime of the present analysis only 6 casesreceived further chemotherapy because ofprogression. Toxicity was generally modest,mainly consisting in 5 infectious episodes,WHO grade I and II. Conclusions. Fromthe present retrospective study the responserate to this CLB schedule appearsencouraging and comparable to the resultsachieved with more aggressive CLB regimenand with alternative treatments. Sincecases included in this study were more fragilethan the usual CLL patient population,the efficacy and tolerability of this schedulesuggest its more extended use in thissubset of CLL patients.P240FLUDARABINE PLUSCYCLOPHOSPHAMIDE IN THETREATMENT OF PREVIOUSLY TREATEDCHRONIC LYMPHOYD LEUKAEMIAM. SPRIANO, R. BRUNI, M. CLAVIO, F. BALLERINI,M. MIGLINO, I. PIERRI, E. ROSSI, R. VIMERCATI, S. NATI,M. CONGIU, G. SANTINI, M. GOBBI, E. DAMASIOI Division of Haematology, S Martino HospitalGenoa and Chair of Haematology University ofGenoa, ItalyThe purine analogue, Fludarabine (FLU),has shown promising results in the treatmentboth of recurrent advanced LG-LNH

202 September 26-29, 1999 - Torino-Lingotto, Italyand B-CLL. FLU inhibits the repair of DNAdamage caused by radiation and drugs eg.Mitoxantrone (M) and Cyclophosphamide(CY). We report a short retrospective studywith Flu in combination with CY at a singleinstitution in pretreated recurrent/refractoryactive B-CLL. We treated 16 patients withFlu 30 mg/sm i.v plus CY 300 mg/sm i.v.for 3 consecutive days for six courses: agerange 38-68; mean 58 years; 12 males, 4females; 3 were in stage I, 7 in stage IIand 4 in stage III and 2 in stage IV; 8 hadsensitive relapse and 7 were refractory; 1patient had not prior therapy, but had theCLL/PLL variant. Number of previous treatments0-5. Patients were evaluable after aminimum of 3 treatment courses. Responseand toxicity were evaluated according tothe NCI criteria. Complete (CR) and PartialResponse (GPR+PR) were observed in 1(6%) and 2+9 (13+56%), CR+PR = 75%.4 (25%) patients were refractory. We observed3 deaths (1 for PD, 1 for toxicity, 1for Richter Syndrome).Toxicity was moderateto severe in 6 out of 16 pts ; in particularwe observed 4 AIHA and 2 AITP. CD4positive cells evaluated pre and post Txlowered significantly. We conclude thatFluCy is an highly effective regimen in salvagetherapy for heavily pretreated activeB-CLL. Haematological toxicity is acceptablebut often severe with considerable immunesuppression.days in B-CLL patients refractory to conventionalmonochemotherapy. The aim ofstudy was to evaluate the efficacy, the toxicity,and the incidence of infectious complicationsof this treatment schedule in thissubset of elderly patients. Eighteen B-CLLpatients have been enrolled with a medianage of 73 years. According to Binet stagesystem 3 patients were in stage A, and theremaining 15 cases in stage C. Three outof 18 (17%) patients achieved a completeremission (CR), 12/18 (66%) a partial response(PR) with an overall response rate(CR+PR) of 83%, according to NCI/WG responsecriteria. Three patients were consideredresistant. In five cases (4 PR and 1CR) the disease has progressed after 2, 7,3, 9 and 12 months, respectively. Fourpatients out of 18 (22%) developed severeneutropenia (neutrophils < 0.5x10 9 /L) andonly in 1 of them we did register an infectiouscomplication which required treatmentwith systemic antibiotics and granulocytecolony stimulating factor (G-CSF). Nonhematologictoxicity was negligible in allpatients but one, vho despite an adequatewith allopurinol and hydratation, developeda tumor lysis syndrome with transient butsevere renal impairment. In conclusion, ourpreliminary data suggest that the associationof low-dose fludarabine andcyclophosfamide is effective in this subgroupof B-CLL patients.P241LOW-DOSE FLUDARABINE ANDCYCLOPHOSFAMIDE IN ELDERLY B-CELLCHRONIC LYMPHOCYTIC LEUKEMIA(CLL) PATIENTS REFRACTORY TOCONVENTIONAL THERAPYG. MAROTTA, C. BIGAZZI, S. BIRTOLO, S. MARCONCINI,C. SESTIGIANI, F. LAURIADepartment of Hematology – University of SienaDespite major progress in the therapy ofB-CLL in the recent years, some questionsstill remain unresolved. In particular, howto treat elderly patients resistant tochlorambucil is still matter of debate sincepurine analogues although producing highresponse rates often are responsible of anincreased incidence of infections. For thisraison we started a clinical trial with lowdosefludarabine (15 mg/sqm [max 25 mg])and cyclophosfamide (200 mg/sqm) for fourP242FLUDARABINE PLUSCYCLOPHOSPHAMIDE (FLUCY) ASSALVAGE THERAPY OF REFRACTORYAUTOIMMUNE THROMBOCYTOPENIAIN B-CLLL. LENZI, A. AMBROSETTI, V. MENEGHINI, R. ZANOTTI,M. D’ADDA, A. TROLESE, G. PERONA, G. PIZZOLODepartment of Clinical and Experimental Medicine,Section of Hematology, University of Verona, ItalyBackground: the association of chroniclymphoproliferative diseases (especially B-CLL) with autoimmune complications is wellknown. In particular, a frequent incidenceof autoimmune hemolytic anaemia andthrombocytopenia after treatment withFludarabine has been reported. Case-Report:in July 1997 a 52 years old man withdiffuse lymphoadenopathy and lymphocytosis(ly 8,310/µl) was referred to our Sec-

37 th Congress of the Italian Society of Hematology203tion. Hb level and platelet count were normal.A diagnosis of B-CLL, Binet stage A,was made, based on the following data:blood smear morphology (small round lywith Gumprecht shades), bone marrow lymphoidinfiltration of 30%, peripheralimmunophenotype (CD 19+/CD 5+, lowexpression of sIg, CD 23+), lymphnode histology(small lymphocytic lymphoma) andlymphnode immunohistology. In January1998, after disease progression, chemotherapywas started (Chlorambucil 10 mg/d plus Prednisone 25 mg/d for 20 days).Two weeks after the end of the treatmentbleeding symptoms appeared: platelet countwas 2,000/µl. A normal megacariocyte numberwas detectable in the bone marrow aspirateand autoantibodies against GPIIB-IIIAwere present. A diagnosis of autoimmunethrombocytopenia in B-CLL was made.Thrombocytopenia was refractory to Prednisone(1 mg/kg/d), high dose i.v Ig andVincristine. The efficacy of splenectomy wastransient. We decided to try the associationof Fludarabine (30 mg/sqm for 3 days)and Cyclophosphamide (350 mg/sqm for 3days). Soon after the first cycle the plateletcount increased to 100,000/µl. Atpresent, 10 months after the fourth cycle,platelet count is normal with complete continuedremission of B-CLL. Conclusions:in this case, a severe thrombocytopenia,occuring in a B-CLL patient after alkylatingagents and refractory to steroids, high doseIg and splenectomy, responded completelyto FluCy. FluCy may represent an alternativetreatment for autoimmunethrombocytopenias not responding to traditionaltherapy.P243EXCELLENT RESPONSE TOFLUDARABINE IN A PATIENT WITHCLL COMPLICATED BY ITPF. CHIURAZZI, M.R. VILLA, D. GRAZIANO, B. ROTOLIDept. of Hematology, Federico II University, NaplesWBC 9000/µL, Hb 7.6 gr/dL, Plt 4000/µL;N47%, L45%, M8%. Bone marrow aspirationshowed increased number of megakaryocytes;flow-cytometric studies revealed18% of CD19 positive cells. The patientwas treated as first choice with prednisone,then with high dose of intravenousimmunoglobulins and finally with splenectomy;all these procedures did not improvetrombocytopenia. The laboratory follow upgradually showed leukocytosis with increasednumber of lymphocytes. These cellswere CD19+, CD23+, CD5+ and SmIgK+at cytometry. The patient was diagnosedas B-CLL complicated at presentation by ITP.She was treated by chlorambucil and prednisone,with a reduction of lymphocytecount but with no effect on platelet count.As second-line treatment we usedFludarabine at standard dose (25 mg/mqfor 5 days), with a good hematological responseafter three courses. At the end ofthe treatment blood counts showed WBC9500/µL, Hb 14gr/dL, Plt 207000/µL, N52%,L29%, E6%, B2%, M11%; bone marrowwas hypocellular, flow-cytometry identifiedonly 7% CD19-CD5 double positive lymphocytes.In complete remission, the patientunderwent CD34+ mobilization withcyclophosphamide and G-CSF, and herPBSCs were harvested to be used in caseof relapse. Nine months later, the patient isstill in complete remission, with a plateletscount of 220000/µL. Fludarabine treatmentis used for its apoptotic effect onchronic lymphocytic leukemia cells. Duringthis treatment the appearance or the worseningof autoimmune diseases is frequentlyreported; thus, the use of fludarabine isconsidered contraindicated in presence ofautoimmune phenomena. This case showsan unexpected outcome: a resistant autoimmunepurpura recovered afterfludarabine treatment. This anecdotal casesupports the view of some authors that inCLL fludarabine is not controindicated inpresence of autoimmune complications, andthat treatment should not be discontinuedif an autoimmune disease develops duringthe treatment.Autoimmune phenomena are frequentcomplications in lymphoproliferative diseases;immune thrombocytopenic purpura(ITP) occurs in about 2-3% of CLL patientsin early stage or at presentation. In June96, a 30-year old woman developed cervicallymph node enlargement associated withbleeding tendency. Blood counts showed

204 September 26-29, 1999 - Torino-Lingotto, ItalyP244TUMOR LYSIS SYNDROME (TLS) INB-CELL CHRONIC LYMPHOCYTICLEUKEMIA (B-CLL) PATIENTS AFTERFLUDARABINE COMBINATIONREGIMENG. MAROTTA, M. TOZZI, M. LENOCI, S. BIRTOLO,C. BIGAZZI, S. MARCONCINI, F. LAURIADept. of Hematology. “A. Sclavo” Hospital,University of SienaRecently it has been analyzed the frequencyof TLS on 6,137 B-CLL patientstreated with Fludarabine. The resultsshowed a very low incidence (0.33%) andthe authors concluded that the TLS, as acomplication of Fludarabine therapy, wasextremely uncommon. In our Institution,on a previous clinical trial in more than 100patients with chronic lymphoprolipherativedisorders treated with Fludarabine alone (25mg/m 2 days 1 to 5), we never observed aTLS in agreement with that reported byCheson et al. Recently, we started a newclinical trial for B-CLL patients refractory toconventional therapy combining low-dosesof fludarabine (15 mg/m 2 [max 25 mg]) andcyclophosphamide (200 mg/m 2 ) for 4 days.Eighteen B-CLL patients have been enrolledin the study and in two of them (11%),despite the prophylaxis with allopurinol, aTLS was observed. Both patients were inadvanced stage of disease (stage C) andheavily pretreated. The pretreatment absolutelymphocyte number was 81 and 43x 10 9 /L, respectively. In both cases the TLSwas documented within seven days fromthe start of treatment and was associatedto a dramatic reduction of leukocytes (1.9and 1.1 x 10 9 /L, respectively). Both patientsdeveloped a renal failure, severe inthe first case (creatinine 4.4 mg/dl, uric acid50 mg/dl, BUN 204 mg/dl, potassium 8.9mEq/l and calcium 7.5 mg/dl), less severein the other case (creatinine 1.9 mg/dl, uricacid 14 mg/dl, BUN 86 mg/dl, potassium5.5 mEq/l and calcium 8.3 mg/dl). In thefirst patient a dialytic treatment was requiredfor consecutive 8 days in order torestore a normal renal function, while inthe second one an intensive hydration, allopurinoland urinary alkalinization weresufficient. Despite the very limited numberof cases, our study shows that a TLS,generally uncommon in B-CLL patientstreated with fludarabine alone, may be morerelevant in those treated with fludarabinecombination regimen. Therefore, we canconclude that the addition of low-dose cyclophosphamideto fludarabine produce amore rapid and effective responses, but mayincrease the risk of a lifethreatening TLS inthese patients, despite a prophylaxis withallopurinol.P245IS FLUDARABINE SALVAGE THERAPYLESS EFFECTIVE AFTER CONTINUOUSHIGH DOSE CHLORAMBUCIL IN B-CELLCHRONIC LYMPHOCYTIC LEUKEMIAPATIENT?V. CALLEA, F. MORABITO, S. MOLICA°, C. STELITANO,M. MANGIOLA, C. MUSOLINO*, F. NOBILE, M. BRUGIATELLIDip. Ematologia-Oncologia,A.O. Bianchi-Melacrino-Morelli, Reggio Calabria; °Divisione Ematologia,Azienda Ospedaliera Pugliese-Ciaccio, Catanzaro;*Istituto di Medicina Interna, Università di MessinaPurine analogs represent an effectivefront- and second-line therapy in B-cellChronic Lymphocytic Leukemia (CLL). Inparticular, Fludarabine (FAMP), employed assecond-line therapy, induces 45-65% responserate. From 1995, 24 resistant orrelapsed CLL patients from our institutionswere treated with FAMP (25 mg/m 2 /day x 5days). Thirteen cases had previously receivedone line of continuous high-doseChlorambucil (HD-CLB) (15 mg/day up toremission or important toxicity). 11 caseshad previously received conventional chemotherapywith standard dose CLB, orCHOP, or CVP; 7 patients had received 2-3lines of treatment before FAMP therapy.Clinical characteristics of HD-CLB groupwere: stage A 84.6%, B 7.6%, C 7.6% atonset; stage A 7.6%, B 15,3%, C 69,2%before FAMP therapy; 46,1% were resistant(response < PR or response duration< 12 months) and 53.8% relapsed (responseduration > 12 months). Patientsfrom the conventional therapy group weredistributed as follows: stage A 20%, B 50%,C 30% at onset; stage A 9%, B 27.2%, C63.6% before FAMP therapy; 54.5% resistantand 45.4% in relapse. After FAMP theoverall response rate was 65.2%, 46.1% inHD-CLB group and 81.8% in the conventionaltherapy group. Out of 9 cases notresponding to FAMP, 7 were previously

37 th Congress of the Italian Society of Hematology205treated with HD-CLB (4 resistant, 3 in relapse)and 2 with conventional therapy (1resistant and 1 in relapse). Although weare aware of the retrospective character ofthe present analysis and of the limits of thisseries, these findings raise the question ofa possible higher resistance to FAMP afterHD-CLB therapy. If these data will be confirmedby appropriate prospective trials itshould be possible to postulate a cross-reactivitybetween CLB and FAMP, not due tothe drugs, which have different mechanismsof action, but due to CLB administrationmodalities, which could select cellular clonesresistant to subsequent FAMP therapy.P246COMPLETE REMISSION INPROLYMPHOCYTIC LEUKEMIA WITHIDARUBICIN CONTAINING REGIMEN ANDMAINTENANCE WITH α-INTERFERON.REPORT OF A CASER. BERTÈ, D. VALLISA, B. FERRARI, G. CIVARDI, G. SBOLLI,G. NIFOSÌ, L. CAVANNA1 st Division of Internal Medicine - Hematology,Piacenza HospitalProlymphocytic leukemia (PLL) is alymphoproliferative disease that take anaggressive clinicl course and is refractoryto conventional chemotherapy with a shoutsurvival (generally a few months). Here wereport on a patient suffering from B-PLL whoobtained complete response after recivingchemotherapy with regimen CHOP (cyclophosphamide750 mg/sqm day 1,idarubicina 10 mg/sqm day 1, vincristine 2mg day 1, methylprednisone 60 mg/sqmdays 1-5). A 62 year-old woman was admittedto the hospital in June 1993 withfatigue; after physical examination, she wasdiagnosed with splenomegaly 6cm belowthe costal margin. The hematology variableswere tha follows: hemoglobin 11 g/dl, hematocrit33%, WBC count 60x10 9 /l showingan absolute prolymphocytosis,and platelet count 227x10 9 /l. Theimmunophenotype of the peripheal blooddemonstrated a dominant population ofmonoclonal B-cell expressing CD19, CD20and K light chain. the bone marrow wasinfiltrated by 90% prolymphocytic cells.The patient was started on CHOPchemoterapy, prophylactic allopurinol andhydratio were previously administred. Nocomplication were observed after the firstcycle of therapy, after there cycles oftherapy tha patient had become asymptomatic,the splenomegaly had disappeared, thehematologic variable had retutned to normal.The patient recived 8 courses of CHOP,then the chemotherapy was stopped andthe patinet was in complete remission (normalphisical examination, bone-marrow andperipheal blood). In March 1994 α-interferonwas administrated 3 MU every otherday as a maintanence therapy for two years.The patients is now well and in completeremission. We conclude that idarubicin containingregimen is effective for inductionremission a PLL and that α-interferon maybe effective as a maintenance therapy.P247FLUDARABINE AND MITOXANTRONEIN THE TREATMENT OFB-PROLYMPHOCYTIC LEUKEMIAD. GOTTARDI, M. ARAGNO, G. GUIDA, F. CALIGARIS CAPPIODiv. Universitaria di Immunologia Clinica eAllergologia, Ospedale Mauriziano Umberto I, Torinoe Labor. di Immunologia Oncologica, IRCC, CandioloB-prolymphocytic leukemia (B-PLL) is arare lymphoproliferative disorder with arapidly progressive course where therapeuticinterventions are usually unsuccessful.We report a treatment schedule used in 3patients with B-PLL based upon fludarabine(F) 25 mg/mq/d on day 1 to 3 andmitoxantrone (M) 10 mg/mq/d on day 1.All patients had advanced disease, the medianage was 80; 2 of them had aprolymphocytic transformation of B-CLL, theother had a de novo B-PLL. Two patientsalso suffered of NID diabete and one hadchronic bronchitis and sistemic atherosclerosis.Patients had already been treated withchlorambucil and the conventional protocolCOP. Anthracyclines-based regimens andsplenic irradiation were used in two of them.In one case an initial good clinical responsewas followed by no effects of therapy becauseof drug resistance. In the other twocases no response was observed at anytime. A persistent high leukocytosis(>100000/mm 3 ), a huge splenomegaly and,in one case, also a marked anemia andthrombocytopenia prompted us to start apurine analog containing regimen.Fludarabine has shown anti-leukemic ac-

206 September 26-29, 1999 - Torino-Lingotto, Italytivity against B-PLL even in patients resistantto other chemotherapeutic agents. Wechose the association fludarabine andmitoxantrone, an effective regimen for indolentlymphomas, in order to reduce thedose of fludarabine in old patients with highrisk of infections and to increase the probabilityof response with a second chemotherapeuticdrug. The treatment was repeatedat 4-week intervals for a maximumof 3 courses. Antimicrobial prophylaxis wasinstituted with trimethoprim-sulfamethoxazolefrom start until 4 weeks afterthe end of therapy. G-CSF was administredwhen granulocyte count was less then 1000/mm 3 . Corticosteroids were not administeredbecause they increase the risk of infectionand do not ameliorate the response. Aftertwo courses of chemotherapy all patientsshowed a prompt response with a regressionof leukocytosis to the normal rangevalues; in two cases spleen was no longerpalpable and in the third a significant (from10 to 4 cm from the costal margin) reductionof splenomegaly resulted. In the patientwith anemia and thrombocytopeniahemoglobin level and platelets count werenormalized. The treatment was well tolerated,the ematologic toxicity was grade III-IV, but transient and without infections exceptfor a short fever event in the patientwith chronic bronchitis; a transfusional supportwas never necessary. Even if the numberof patients is small and the followupshort (1-4 months), these data suggest thatthe FM protocol is highly promising in patientswith B-PLL and advanced age.P248ALPHA INTERPHERON AS INDUCTIONAND MAINTENANCE THERAPY IN HCL:A LONG TERM FOLLOW UP ANALYSISE.E. DAMASIO, M. CLAVIO, B. MASOUDI, A. ISAZA,M. SPRIANO, E. ROSSI, S. CASCIARO, R. CERRI, M. RISSO,M. SICCARDI, M. TRUINI AND M. GOBBIDept. Haematology, S. Martino Hospital andUniversity of GenoaRecently the use of purine analogues hasrevolutionized the treatment of HCL andincreased the percentage of long term completeresponse. However the real impact onoverall survival is not yet clear. The purposeof this study was to evaluate the longterm outcome of IFN treated patients.We retrospectively evaluated thehaematological features of 82 HCL patientsexamined between 1980 and 1996 (meanfollow up 92 months), and the outcome ofsixty-four patients receiving IFN as first linetherapy (3MU x 3 / week, for 12-18months). IFN was well tolerated and effective.The overall response rate was 91%(CR 13%, GPR 13%, PR 65 %). Forty-onepatients (63%) received IFN 3 MU / weekas maintenance therapy. Twenty-six patientsreceived second line treatment. IFN,2CdA and DCF showed similar efficacy. Theten year projected survival rate of patientsachieving objective response to first linetherapy (CR and GPR 100%; PR 95%)and that of non responders (SD, PD 80%)clearly shows that the type of response doesnot affect survival. Patients who receivedIFN maintenance had a statistically higherPFS than those who did not (p < 0.01).Nine patients were no longer alive at thetime of analysis; three died of disease relatedinfections, 5 of a second malignancyand 1 of acute left ventricular failure whileundergoing therapy . Our study shows thatIFN remains one of the standard therapiesfor this disease, that achieving CR has noprimary relevance for the control of the disease,that relapsed patients remain sensitiveto IFN, that IFN maintenance therapymay guarantee long progression free statusand that good utilization of therapeuticresources may assure HCL patients asurvival rate that is comparable to that ofthe normal, healthy population.P249TREATMENT OF HAIRY CELL LEUKEMIAWITH PENTOSTATIN:A RETROSPECTIVE STUDYF. DI RAIMONDO, G. AMATO, G.A. PALUMBO, S. BAGNATO,F. STAGNO, M. RUSSO, P. GUGLIELMOCattedra e Divisione di Ematologia con Trapianto,Ospedale Ferrarotto, CataniaPurine analogues are now considered asfront line therapy for hairy cell leukemia(HCL). However, the optimal length oftherapy has to be defined, especially forpentostatin (DCF). In this retrospectivestudy we evaluated 16 HCL patients treatedwith DCF at the dosage of 4 mg/m2 everytwo weeks. Fourteen patients were maleand median age was 45 Ys. (range 32-77).

37 th Congress of the Italian Society of Hematology207Seven patients were treated at diagnosis,while 9 were resistant/refractory to interferon.Splenomegaly was present in 8 patientsand 2 had been previously splenectomized.Median number of DCF courseswas 8 with a range from 4 to 14. On thewhole, 14 patients achieved CR and 2 PR.No relapses have been registered after amedian follow up of 13 months. The meanrelative dose intensity (RDI) was 0.94(range 0.6-1.2). Although any correlationbetween RDI and response is not possible,we observed the two PR patients have receiveda RDI below the mean (0.6 and 0.8respectively). Moreover, in 5 patients treatmentwith DCF has been pursued for 4courses only and all these patients haveachieved CR. As regards toxicity, on a totalof 132 courses, we observed 1 episode ofherpes zoster, 5 FUO, 1 pneumonia and onepatients with cerebellar dysfunction. Fromthis retrospective evaluation we can confirmthe strong activity of DCF in HCL. Moreover,our data could support a shorter lengthof treatment (4 weeks) in respect to currentliterature (6-12 courses), thus allowinga reduction of costs and side effects. Itremains to evaluate the role of growth factorsfor maintenance of dose intensity.P250HAIRY CELL LEUKEMIA,2-CHLORODEOXYADENOSINE ANDOCCURRENCE OF MYASTHENIA GRAVISAND VASCULITISG. VIETTI RAMUS *, L. TONDA *, A. DEMARTINI *,R. CAVALLO °, G. DE ROSA ^, D. BELLIS ^DH of Oncology of Medicine Department *, Neurology° and Pathology ^, “Giovanni Bosco” Hospital,ASL 4 Torino, ItalyCase Report. On June 1995 a 56 yearsold man was admitted to the Hospital becauseof anemia (Hb 9,9 g/dl), thrombocytopenia(89.000/mmc) and splenomegaly.Hairy cells were demonstrated in bone marrowbiopsy (80% of bone marrow infiltration).HCL was diagnosed and 2-Chlorodeoxyadenosine (CdA) 0,1 mg/kg/day was administrated by continuous iv infusionfor 7 days. A complete remission wasobtained. On April 1996 diplopia occurredand ocular myasthenia was diagnosed. Subsequentlymyasthenia became systemic. Hewas treated by Anticholinesterase drugs andplasmaphe-resis, with good remission. OnJune 1997 HCL relapsed (5-6% of bonemarrow infiltration). He was treated withCdA 0,15 mg/kg, as iv infusion over 2 h,once weekly for 7 consecutive weeks: a newcomplete remission was obtained. On November1997 a cutaneous vasculitis occurredon legs (skin biopsy: angiitis of smalland medium sized arteries and veins). OnJune 1998 a Raynaud phenomenon appeared.On month later the patient had thefirst of a long series of severe asthmaticattacks, with peripheric eosinophilia (1.000/mmc). The occurrence of cutaneous vasculitis,asthma and eosinophilia are clinicallyconsistent with a Churg-Strauss syndrome(since july 1998 corticosteroid chronictherapy). HCL is still in complete remission.Comment. This patient developed two autoimmunesyndromes (Myasthenia gravisand Vasculitis) after treatment of HCL byCdA. CdA induces severe and long-lastingmodifications in lymphocyte subgroupscounts, with an earlier reduction of CD8 andCD20 than of CD4 and NK. CD8 and NKcounts recover more quickly than CD4 does.The mean length of CD4 reduction is 40months. There are some reports of autoimmunehemolytic anemia after treatmentwith CdA. CdA obtains remissions in 80-90% of HCL, with 50-80% of complete responses.Survival is longer than 15 yearsin some limited clinical series: it is not yetassessed if patients with long lasting remissionsare definitively cured. Relapsesafter CdA treatment are reported in 20-28%of patients: many of them respond to a newtreatment with CdA. Its clinical effectivenessmakes CdA a first choice drug in HCLtreatment. It is not clear if the risk of secondmalignancies and immune illnesses isrelated to HCL or to the treatment with CdA.P251SEVERE AUTOIMMUNE HEMOLYTICANEMIA AND THROMBOCYTOPENIAAFTER PENTOSTATIN IN TWO HAIRYCELL LEUKEMIA (HCL) PATIENTSL. LENZI, A. AMBROSETTI, V. MENEGHINI, R. ZANOTTI,G. TODESCHINI, M.M. RICETTI, A. MAGGIONI, G. PERONADepartment of Clinical and Experimental Medicine,Section of Hematology, University of Verona, ItalyBackground: autoimmune hematologicalcomplications are frequently reported

208 September 26-29, 1999 - Torino-Lingotto, Italyin chronic lymphocytic leukemia after purineanalogues, mainly Fludarabine. Thesecomplications are rare in HCL and havenever been described after Pentostatin(DCF). Case 1: a 30 years old man, with adiagnosis of HCL made in May 1998. At presentation:granulocytes 1,500/µl and plateletcount 50,000/µl. Twenty days after thesecond course of DCF (4 mg/sqm) the neutrophiland platelet count dropped to100/µl and 2,000/µl respectively, accompaniedby fever and bleeding. Normalmegacariocytic and myeloid series wereseen at bone marrow aspiration, thereforesuggesting platelet and granulocyte peripheralconsumption. After steroids (Prednisone1 mg/kg/d) platelet and neutrophilcount rapidly increased. At present, tenmonths later, they are 85,000/µl and 2,200/µl respectively, without other treatment, andthe HCL status is PR. Case 2: a 55 yearsold man, diagnosed as HCL in 1992, alfainterferon as first line therapy was givenwith poor response. After disease progression,he received two courses of 2-CDA in1993 and 1995, both with PR. In 1997, aftera relapse four courses of DCF (4 mg/sqm) were given. A severe autoimmunehemolytic anemia (Hb 6,5 g/dl, Coombs testpositive for IgG autoantibodies) occurredsoon after the fourth dose of DCF. Hemolysisrapidly improved with steroids, followedby splenectomy. At present, 22 months fromoperation, the patient is in CCR of HCL withnormal Hb levels (16 g/dl).P252ANALYSIS OF BCL6 GENE IN NODALMARGINAL ZONE B-CELL LYMPHOMAP. VACCARI, R. MARASCA, P. ZUCCHINI, M. LUPPI,I. CASTELLI, G. CHIOSSI, P. BAROZZI, G. TORELLIDept. of Medical Sciences, Section of Hematology,University of ModenaMarginal Zone B-Cell Lymphoma (MZL)represents a distinct subgroup of B-cell nonHodgkin’s lymphomas (NHL) characterizedby cellular heterogeneity includingcentrocyte-like cells, monocytoid B cells,small lymphocytes and plasma cells. Thereare two major clinical presentations of MZL:extranodal MZL, also termed low grade B-cell lymphoma of MALT-type, that arise inextranodal sites, most commonly in thegastrointestinal tract, and nodal MZL withisolated or disseminated lymph node involvementin absence of extranodal disease.BCL6 gene encodes for a putative transcriptionfactor and is normally expressed in Bcells within germinal centers (GC). BCL6rearrangements due to chromosomal translocationsare present in about 40% of diffuselarge cell lymphomas (DLCL) and 10%of follicular lymphomas (FL). Moreover, somaticmutations clustering within the 5’non-coding region of the BCL6 gene havebeen identified in a large number of B-NHLlikely to arise from cells related to the GC,i.e. DLCL, FL and Burkitt’s lymphomas (BL).Because MZL is actually considered of GCderivation, we decided to evaluate the geneticassessment of BCL6 gene in a seriesof MZL (16 nodal and 3 splenic) cases. GenomicDNAs extracted from tumor sampleswas digested with BamHI and XbaI andhybridized with Sac 4.0 probe specific forthe MTC region of the BCL6 gene. Grossrearrangements of the BCL6 were absentin the MZL samples tested. A 740 bp regionwithin BCL6 intron 1 was evaluated bybi-directional direct sequencing for nucleotidepoint mutations. In two samples (1nodal and 1 splenic) a single point mutationwas evident; in the other two samples(2 nodal) respectively two and four singlenucleotide substitutions were present.These data indicate that mutations in the5’ regulatory non coding sequence of theBCL6 gene are present in a significativeproportion of nodal MZL, supporting thehypothesis of a GC derivation at least in asubset of this type of B lymphoproliferativedisorders. Nevertheless, further studies areneeded to essay the presence of somaticmutatios in VH immunoglobulin gene inorder to evaluate the GC origin and a possibleinvolvement of antigene stimulationin the clonal expansion of nodal MZL.P253AGREEMENT BETWEEN MORPHOLOGYAND MOLECULAR BIOLOGY INFOLLICULAR LYMPHOMAR. ALTERINI, V. CARRAI, A. VANNUCCHI, S. LINARI,L. RIGACCI, S. GLINZ, A. CARPANETO, F. INNOCENTI,G. BELLESI, P. ROSSI FERRINICattedra e Divisione di Ematologia, Università eAzienda Ospedaliera di Careggi, FirenzeBcl-2 is implicated in the regulation of cellgrowth. Traslocation 14;18 causes a deregu-

37 th Congress of the Italian Society of Hematology209lation of the gene with an inibition ofapoptosis and extension of cell life. Morphologicstudy of bone marrow biopsyallowes to define involvement by neoplasticcells. The aim of this study was to evaluatethe correspondence between molecularand morphologic analysis of bone marrow.We observed 72 patients, 54 with follicularlymphoma and 18 with large cell lymphoma.Bone marrow biopsy was plasticembedded and sections were stained withGiemsa. Bcl-2 gene rearrangement (MBR)was analyzed by a nested PCR assay onmononuclear cells from bone marrowsamples. In the table we report results obtainedin patients affected by follicula nonHodgkin’s lymphoma:bcl-2 + Marrow biopsy + 12 patientsbcl-2 - Marrow biopsy - 17 patientsbcl-2 - Marrow biopsy + 1 patientbcl-2 + Marrow biopsy - 24 patientsIn our casistic 67% of follicular lymphomaswere bcl-2 positive and 33% were positiveat morphology. In conclusion this descriptiveanalysis confirms the high rate of bcl-2 positive follicular lymphomas, the correspondencebetween the two techniques waspresent in half of patients. The morphologicalanalysis in our experience allows us toidentify a lower positive cases in comparisonwith molecular analysis. The PCR analysisis able to point out the presence of lymphomacells even in clinical situation of completeremission.P254CHRONIC LYMPHOPROLIFERATIVEDISEASE WITH PREMINENTSPLENOMEGALY: ANALYSIS OF 38CASESM. D’ADDA, R. ZANOTTI, E. TRESOLDI, A. AMBROSETTI,C. BORGHERO, S. SECCHI, M. CHILOSI, F. MENESTRINA,G. PERONA, G. PIZZOLODepartment of Clinical and Experimental Medicine,Section of Hematology and Institute of Pathology,University of Verona, ItalyB-PLL were excluded. Our study includes21 males and 17 females, median age 66years (range 38-92). According to Binet-Rai classification, 13 patients (34%) presentedin IIA stage, 6 (16%) in IIB, 8 (21%)in IIC and the remaining 11 (29%) in III-IV. Medium lymphocyte count at diagnosiswas 40,500/mmc (range 4,000-170,000);all patients had splenomegaly (spleen from5 to 22 cm b.c.m., median 12), and absent(20 cases, 53%) or minimum (18 cases,47%) lymph node involvement. Lymphocytemorphology was typical for B-CLL onlyin one patient and atypical in the others. Inmost cases peripheral immunophenotypewas not typical for B-CLL with moderatestrongsIg expression (32/38 cases,84,3%), reduced coexpression (30% of B cells)of FMC7 (23/33 cases, 70%). Bone marrowhistology, performed in 36/38 cases,was typical for SLL in 20 cases (55.5%).Thirty-four of thirty-eight patients weretreated: with alkylating agents (31 cases)or alfa-INF (3 cases). In addition, 2 patientsreceived fludarabine and 6 spleen irradiation.One patient was splenectomized. Medianfollow up is 52.2 months (range 2-127). Only 9 (23,6) patients died, all of diseaseprogression. The OS at 5 and 10 yearsis 72% and 65%, respectively. Patients inIIA stage are all alive, whereas the OS at 5and 10 years of more advanced stages is64% and 55%, respectively. Unfavourableprognostic factors were age >60 years(p=0.05) and splenomegaly >10 cm b.c.m.(p=0.01). All other variables, includinggender, lymphocyte count and immunophenotype,did not influence the outcome.In conclusion, the presence of prominentsplenomegaly, at presentation, in B type leukemicchronic lymphoproliferative disorders,corresponds to morphological and phenotypicfeatures different from B-CLL. In spite of theadvanced stage their prognosis is often goodand an aggressive approach appears questionable.We evaluated 38 cases of B type leukemicchronic lymphoproliferative disease, nototherwise classifiable, with prominent splenomegalybut absent or minimum lymphnode involvement. Cases with diagnosis offollicular or mantle cell lymphoma, HCL and

210 September 26-29, 1999 - Torino-Lingotto, ItalyP255PRIMARY NON-HODGKIN’S LYMPHOMAS(NHL) OF THE LUNG: ANALYSIS OF 16CASES OBSERVED AT THE INSTITUTE OFHEMATOLOGY AND MEDICAL ONCOLOGY“L. e A. SERÀGNOLI” IN BOLOGNAM. TANI, F. GHERLINZONI, P.L. ZINZANI, M. MAGAGNOLI,E. MERLA, S. ASCANI, S. TURAInstitute of Hematology and Medical Oncology“L. e A. Seràgnoli”, University of Bologna, ItalyPrimary NHL of the lung are very rare,accounting for about 3% of all extranodallymphomas, and are associated with a quitefavourable prognosis. We reviewed our experienceconcerning 16 cases of primaryNHL of the lung, observed since 1987 atour Institute. We defined primary NHL ofthe lung either those cases with exclusivepulmonary and/or bronchial involvement,or those cases with associated extrathoracicdisease, but who presented initially withpulmonary symptoms proved to be causedby NHL. Our series includes 8 males and 8females, mean age 64 years (46-75). Histologicalsubtypes were as follows: lowgrade B-cell MALT lymphoma (11 cases),T-cell lymphoma (2 cases); anaplasticlarge-cell lymphoma, diffuse large cell lymphoma,immunocytoma (1 case). Stage wasI in 7 pts, II in 1 pt, III in 1 pt, IV in 7 pts (3of the latters had also bone marrow involvement).Three pts (18%) had a pleuraleffusion at onset. Diagnosis was made bybronchoscopy ± BAL in 8 cases (50%), byopen lung biopsies in 7 cases, by transthoracicbiopsy in 1 case. Two pts were treatedby surgery only, while the remaining 14 receivedchemotherapy (N-CVP, CHOP,VNCOP-B) alone or plus radiotherapy. Completeremission (CR) was achieved in 12pts (75%), of whom 2 relapsed (16%) inthe lung. After a median follow-up of 61months, 10 pts (62.5%) are alive and inCR, 8 of them (73%) with MALT lymphoma,2 (40%) with non-MALT lymphoma. Thesedata suggest that: 1) in a large fraction ofpts, diagnosis can be made without thoracotomy;2) the great majority of these NHLare low grade MALT lymphomas; 3) prognosisof primary MALT lymphomas of thelung is favourable, even if local recurrencesare possible.P256CYCLOPHOSHAMIDE, FLUDARABINE,MITOXANTRONE AND PREDNISONE INLOW-GRADE NON-HODGKIN’SLYMPHOMAD. MATTEI, M. BONFERRONI, C. CASTELLINO, G. CAVALLERO,C. DI MARCO, M. GRASSO, A. GALLAMINIHematology and Internal Medicine Department,S.Croce Hospital, CuneoIntroduction: Fludarabine, Mitoxantroneand Dexametasone are non-cross resistantagents active alone or in combinations inlow-grade non-Hodgkin’s lymphoma (LG-NHL), yelding response (CR+ PR) in up to94% of pretreated patients. Experimentaldata suggest that the terapeutic efficacy ofalkylators could be increased byFludarabine, which prevents DNA-repair andcould induce apoptosis. Methods: In aphase-II study, we delivered Cyclophosphamide300 mg/m 2 i.v. on day 1-3,Fludarabine 25 mg/m 2 i.v. . on day 1-3,Mitoxantrone 10 mg/m 2 on day 1, Prednisone40 mg/m 2 p.o. on day 1-5 (C-FNOP),given monthly, for 6 planned courses, reducedto 4 for if severe pancytopenia occurred.All the patients received oral prophylacticCiprofloxacin, Trimethoprim/Sulfametoxazole and Acyclovir . WHO grade4 neutropenia was treated with Filgrastimuntil recovery. Seventeen consecutive outpatientshave been enrolled: 8 at diagnosisand 9 pretreated. Patients’ characteristicswere as follows : median age 59 years (38-72), `/a11/6, hysthology: follicular 10 -respectively classified according to NCI-WF,as B 3, C 4, D 3-, lymphocytic 1,monocytoid1, marginal zone 1, mantle cell 1,splenic lymphoma with villous lymphocytes2, discordant lymphoma (follicular WF C /diffuse large cell LNH) 1. Six patients presentedwith stage III, 11 with stage IV withBM involvement (one patient diagnosedwith relapsed follicular NHL refused BM trephinebiopsy , and thereafter was classifiedin clinical stage III). Pretreated patientsincluded 1 refractory, 1 relapsed after42-months -duration CR1, 7 in progressionafter PR obtained after a median oftwo previous schedules (range 1-3). Responsewas evaluated by clinical examinationand CT scan, BM trephine biopsy withflow-cytometric assay. Results: 13 pts.received ≥4 courses (five patients received6 courses, three patients received 5 courses,

37 th Congress of the Italian Society of Hematology211the latter four patients were given with 4courses). 12 were evaluable for response;one patients died of pneumonia after 5courses, before that whole-body CT-scanwas performed. Four patients still in treatment,received < 3 courses and wereevaluable for toxicity. CR was obtained in8 out of 12 patients, VGPR with desappearanceof all adenopathies and a minimalpersisting BM infiltration in 4 out of12. After a median follow-up of 12 months(range 4-17), 8 complete-reponders are stillin CR. Four partial-responders are aliveafter a median follow-up of 15 months(range 14-18). One partial-responder, diagnosedwith mantle cell NHL, previouslyrefractory to 4 courses of CNOP, relapsedafter 13 months. We didn’t performroutinary RT-PCR assay for bcl 2expressionin our patients, but a patient in CRachieved a molecular response with negativityof RT-PCR assay for bcl 2lasting untilnow 17 months. Hematological toxicity accordingWHO was grade 3 for platelets in6/17 pts and grade 4 in 3/17 pts. Grade 4neutropenia was recorded in all patients,after the fourth course in 16 out of 17 cases,but only after 2 courses in a 65-year-oldwoman. Infectious toxicity was representedby lethal pneumonia in one patient, and S.Epidermidis septicemia in another patient.We performed BM LTC-IC assay in 4 previouslyuntreated patients after the treatment.Such assay yelded 0/1x10 6 platedcells in all cases, confirming the severe stemcell damage induced by Fludarabine. Conclusions:C-FNOP is an effective regimenin LG-NHL, but is faced by significant hematologicaltoxicity , and could induce asevere stem-cell damage, preventing feasibilityof stem cell transplantation.P257FLUDARABINE (FLU) IN COMBINATION:AN EFFECTIVE THERAPY FOR RELAPSEDOR REFRACTORY LOW-GRADENON-HODGKIN’S LYMPHOMA (LGL)G. SANTINI, S. NATI, M. SPRIANO, A.M. CONGIU,G. MARINO, E. ROSSI, R. VIMERCATI, D. PIERLUIGI,M. CLAVIO, M. GOBBI, E. DAMASIODepartment of Haematology, S.Martino Hospital,Genova, ItalyFLU, alone or in combination, reportedencouraging results in LGL. We performeda phase II study to evaluate, in two combinationschedules, the efficacy and toxicityof FLU in relapsed and in refractory LGL.(A) First schedule: FLU 30 mg/m 2 /d. 1-3,cytoxan 300 mg/m 2 /d. 1-3; (B) Secondschedule: FLU 25 mg/m 2 /d. 1-3, cytoxan300 mg/m 2 /d. 1-3, mitoxantrone 10 mg/m 2 /d. 1. Treatments were repeated at 4-week intervals for a maximum of 6 coursesFrom June 1996 to November 1998, 44adult pts with LGL of Groups A (10 pts), B(13 pts), C (16 pts), E (5 pts) / WF enteredtrials (A) and (B). Trial (A): patients22; male 9, female 13; median age 50 years(range 29 to 73); Ann Arbor stage III/IV,6/16; Status of pts at FLU: PR1 8, relapse11, NR 3; median previous CT lines three(range 1 to 5). Trial (B): patients 22; male13, female 9; median age 56 years (range36 to 71); Ann Arbor stage II/III/IV, 2/8/12; Status of pts at FLU: PR1 8, relapse 6,NR 8, median previous CT lines three (range1 to 5). Results = Trial (A): CR 12 (55%),PR 7 (32%), NR/PD 3 (13%); Trial (B): CR9 (41%), PR 7 (32%), NR/PD 6 (27%). Extra-haematologicaltoxicity was mild and didnot require delay of treatment. Haematologicaltoxicity was present in both groups ofpatients. The most frequent was neutropenia:Trial (A), grade 1-2 = 63%, grade 3-4= 37%; Trial (B), grade 1-2 = 54%, grade3 = 36%. In group (A) 5 pts. died: 1 ofsepsis and 4 of lymphoma. In group (B) 4pts died of lymphoma. The FLU combinationwas active in pts with relapsed or refractoryLGL in both treatment group. Overalltoxicity was acceptable and, in general,restricted to haematological toxicity.P258COMBINATION OF FLUDARABINEWITH CYCLOPHOSPHAMIDE (FLUCY)AS SALVAGE THERAPY IN PATIENTSWITH LYMPHOPROLIFERATIVEDISEASESV. MENEGHINI, L. LENZI, A. AMBROSETTI, R. ZANOTTI,G. NADALI, D. VENERI, G. TODESCHINI, M. SORIO, C. VISCO,G. PERONADepartment of Clinical and Experimental Medicine,Section of Hematology, University of Verona, ItalyBackground: Fludarabine, either aloneor in combination with other antineoplasticdrugs, has been used with promising resultsas first or second line treatment in B-

212 September 26-29, 1999 - Torino-Lingotto, ItalyCLL and related disorders, and in indolentnon Hodgkin lymphomas. Aim of this studywas to evaluate the combination ofFludarabine and Cyclophosphamide (FluCy)as salvage therapy in advanced and pretreatedchronic lymphoproliferative diseases.Patients and Methods: 17 non consecutivepatients, aged 47 to 77 years (median60), M/F = 14/3, with a diagnosis oftypical (7) or atypical (3) B-CLL and indolentNHL(7), including 3 mantle cells lymphomas.Treatment: Fludarabine 30 mg/sqm for 3 days + Cyclophosphamide 350mg/sqm for 3 days every 4 weeks. Results:an average of 3,5 courses (range 2 to 6)were given. Median time from the diagnosisto FluCy was 63 months (range 5 to149). Most patients had previously receivedvarious lines of treatment with alkylatingagents, anthracyclins containingpolichemotherapy and/or Fludarabine. In allpatients disease was progressing beforeFluCy. The overall response rate was 53%(9/17) with 18% (3/17) CR and 35% (6/17) PR. The mean response duration was15 months. Mean granulocyte nadir was 1.4x 10 9 /µl. The toxicity consisted prevalentlyof infectious complications. After a medianfollow up of 110 months from the diagnosis,8/17 (47%) patients were died of diseaseprogression. Conclusions: FluCy associationwas effective in previously pretreatedpatients with advanced and progressingchronic lymphoproliferative diseases.Toxicity was mild. These preliminary resultshave to be confirmed in larger studies.P259LOW-GRADE NON HODKGINLYMPHOMAS (LG-NHL) IN THEELDERLY: IMPACT OF A NEWLOW-DOSE FLUDARABINE BASEDCOMBINATION REGIMEN (FLEC)M. BOCCHIA, C. BIGAZZI, S. MARCONCINI, S. BIRTOLO,F. FORCONI, R. ALGERI*, F. LAURIAConventional doses of Fludarabine (FLU)alone or in combination with other drugshave been reported to be effective in thetreatment of LG-NHL. Particularly, FLU andCyclophosfamide (CY) or FLU andMitoxantrone or Idarubicine combined regimenshave shown considerable therapeuticactivity both as first line and salvagetherapy. Nevertheless, severe neutropeniaand infective complications have been reportedin a significant number of patients(pts), specifically if elderly. The aim of thisstudy was to evaluated the efficacy andtoxicity of a new regimen combining lowdoseof FLU, Epirubicine (EPI) and CY (FLEC)in advanced elderly LG-NHL pts. Twentyoneconsecutive de novo or relapsed LG-NHL pts >= 65 years old entered the study.FLEC regimen was as follows: EPI 30mg/m 2 i.v. on day one, plus FLU 15mg/m 2 /dayi.v. (max 25mg) and CY 250 mg/m 2 /dayi.v. for 4 days. Courses were repeatedmonthly (max 5 cycles). The table belowshows pts’ characteristics and responserate. All 8 pts who achieved CR had neverrelapsed after 2 to 26 months with a medianduration of 10 months. Only 4/10 PRshave so far progressed. Median overall survivalwas 10 months. Therapy-related toxicitywas mild and transient (grade IV neutropeniain 33% of pts, fever of undeterminedorigin in 28% of pts) with no documentedinfections.N° of pts CR(%) PR(%) CR+PR(%)All patients 21 8(38) 10 (48) 18 (86)Stage: I-II 3 3 (100) / 3 (100)III-IV 18 5 (28) 10 (55) 15 (83)Prior Therapy: none 14 6 (43) 6 (43) 12 (86)>1 regimen 7 2 (29) 4 (57) 4 (86)LDH level Normal 12 5 (42) 7 (58) 11 (100)Elevated 11 3 (27) 3 (27) 6 (54)*BM involvement 16 5 (31) 7 (44) 12 (75)**PB involvement 6 2 (33) 3 (50) 5 (83)Bone Marrow **Peripheral BloodFLEC regimen appears to be an effectivetreatment for elderly LG-NHL pts producingan overall response rate (86%) in therange of other published FLU-based combinationswithout exposing the pts to infectiouscomplications.Department of Hematology, University of Siena,Italy and * Oncology Service, Grosseto, Italy

37 th Congress of the Italian Society of Hematology213P2602-DEOXYCOFOMICIN (DCF)+PREDNISONE (PDN): A COMBINEDTHERAPY FOR SPLENIC LYMPHOMAVILLOUS LYMPHOCITES (SLVL)L. ANNINO, M. LAMANDA, S. MASI, E. PESCARMONA,M. FLAMINIO, F. MANDELLIDpt. of Cellular Biothecnology and Hematology,University of Rome “La Sapienza”DCF was the first purine analogue usedin B and T lymphoproliferative chronic disordersshowing a good activity in Hairy CellLeukemia (HCL). SLVL is a chronic diseasecharacterized by leukocytosis and splenomegalywith immunophenotype characteristicssimilar to HCL but it was not responderto Alpha Interferon or other conventionalchemotherapic approach. Up to date splenectomyis a largely used treatment in SLVL.We refer the preliminary experience of acombined therapy based on the associationDCF+ PDN in SLVL. A 52 years old man,affected by SLVL was referred to our Departmentin March 1994. At diagnosis WBCcoun was 84x10 6 /l and epato-splenoadenomegalywas present. Theimmunophenotype study from peripheralblood showed a B-lymphoproliferativechronic disease CD5+, sCD22+,FRC-7+ andCD38+ with light lambda Ig chains. Electronmicroscopy confirmed SLVL diagnosis.In April 1994 the patient underwent splenectomy;successively- because ofpersistance of adenomegaly and leukocytosis,-the patient was treated with monthlycycles of Chlorambucil + PDN (12 cycles)obtaining Partial Response in September1995.In May 1996 disease progression wasdocumented. Disease was stable until July1998, in October 1998 he started chemotherapywith DCF (4mg/m2/die x 3days) +PDN (50 mg d.t/ die x5days) every threeweeks for 6 cycles. At the end of treatmentthe patient was considered CompleteResponder (CR):peripheral blood parameterswere normal, the immunophenotypestudy from peripheral blood was negative,bone marrow biopsies resulted negative,total body TAC documented a disappearanceof adenomegaly. The treatment waswell tolerated: no episodes of both hematologicaland non hematological toxicity orinfections were recorded. The associationDCF+PDN demostrated to be active in SLVL.However a larger cohort of patients is requiredto confirm this preliminary resultand to establish if this approach could havea curative role in this disease.P261RITUXIMAB AND COMPLEMENTINDUCED LYSIS OF NEOPLASTIC BCELLS IS REGULATED BY CD55M. INTRONA , J. GOLAY, L. ZAFFARONI, G.M. BORLERI*,F. T EDESCO#, G. DASTOLI°, T. BARBUI*, A. RAMBALDI*Istituto Mario Negri, Milano, *Division of Hematology,Ospedali Riuniti, Bergamo, °Roche Italia, Milano#University of TriesteRituximab (humanised anti-CD20 MAb) isproving a useful therapeutic agent in thetreatment of B-NHL. Its mechanism of actionincludes antibody-dependent cellularcytotoxicity (ADCC) and complement dependentcytotoxicity (CDC) leading todepletion of normal and neoplastic B cellsfrom the circulation. In follicular lymphomas(FL), the response rate is about 50%of the patients. Rituximab is also being consideredfor the treatment of other CD20+B cell neoplasias such as chronic lymphocyticleukemia (CLL) and high grade lymphomas.We have therefore initiated an invitro study to investigate the basis for theheterogeneity of the response in FL patientsand to determine the response of fresh CLLcells to Rituximab. We investigated the effectof Rituximab on several cells lines. Effectson proliferation in the absence ofcomplement and induction of ADCC werecomparable for all lines. On the other handCDC, measured by acridine orange stainingand FACS analysis, was very heterogeneous.Study of the surface complementinhibitors CD35, CD46, CD55 and CD59 indicatesthat CD55 inhibits CDC in severallines. The relative levels of CD20 expressionon the cell surface may also affect efficiencyof killing. Expression of CD55 andCD20 may thus be of prognostic value topredict the response of neoplastic cells toCDC. More recent data obtained on CLL cellswill be presented.

214 September 26-29, 1999 - Torino-Lingotto, ItalyP262CONSERVATIVE THERAPY OF PRIMARYMALT GASTRIC LYMPHOMAL. ORSUCCI, B. BOTTO, M. BERTINI, C. BOCCOMINI,R. CALVI, F. FICARA, P. PREGNO, R. FREILONE, U. VITOLO,E. GALLODepartemnt of Hematology, S.Giovanni, Torino ItalyIntroduction: Primary Gastric B CellLymphoma of the mucosa associated lymphoidtissue (MALT) is the most frequentextranodal form of NHL. In the past manypatients underwent surgical resection. Currentlythe endoscopic diagnosis is possiblein an increasing number of patients; thesereduces the surgical approach to treatment.Moreover more than 90% of gastric MALTlymphomas are diagnoed in patients withcronic HP-associated gastritis. In limitedstages of low grade gastric MALT lymphomathe cure of HP infection is associated wuthhigh remission rates. In 1995 we started astudy of conservative therapy for primarygastric lymphoma; we treated 22 patients,median follow up is 24 months. Patientsand method. The therapeutic approach isas follow: A) low -grade gastric MALT lymphomastages I-IIa : antibiotic therapyconsisting of amoxycillin + claritromycin+ omeprazole for two weeks B) low-gradegastric MALT lymphoma stages Iib - IIE :antibiotictherapy and chemotherapy chlorambucil10mg/ die for two weeks everymonth,for six courses + radiation therapyIF 36 Gy. C) high-grade localized gastricMALT lymphoma: ACOP-B chemotherapy (Doxorubicin, Cyclophosphamide, Vincristinand Bleomicine) for six weeks + Radiationtherapy IF 36 Gy. Results: Group A= 14patients were treated; CR were achievedin 12; 1 patient was NR and reffered tosurgery and 1 patient obtained a PR .Group B= 4 patients were treated; CR wasachieved in 3, and 1 patient was NR. GroupC= 4 patients were treated,and all achievedCR. Conclusion: conservative therapy inMALT lymphoma is feasible and surgery isnot strirctly required in the treatment ofgastric lymphoma. The cure of HP infectionis associated with high remission rate in limitedstages of low grade gastric MALT lymphoma.These results must be confirmedby a higher number of patients.P263THERAPY WITH GEMCITABINE INPRETREATED PERIPHERAL T-CELLLYMPHOMA PATIENTSP.L. ZINZANI, M. MAGAGNOLI, F. GHERLINZONI, C. CELLINI,S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli”, University of Bologna, ItalyGemcitabine is a novel nucleoside analogue.Promising results have been seenagainst most solid tumors; like thearabinosylcytosine analogue, gemcitabinemay be an active drug in lymphoproliferativemalignancies. We tested it in pretreated peripheralT-cell lymphoma patients with isolatedskin involvement. We performed aphase II study with the drug in 24 pretreatedpatients with peripheral T-cell lymphoma,11of whom had advanced stagemycosis fungoides (MF), and 13 with peripheralT-cell lymphoma unspecified(PTCLU). Patients were treated at days 1,8, and 15 of a 28 day schedule at the dosageof 1200 mg/m 2 for a total of threecourses. Of the 24 patients, 4 (17%)achieved complete response (CR) and 14(58%) partial responses (PR); the remaining6 showed no benefit from the treatment.The overall response rate was 75%. Amongthe responders, 2 CR and 8 PR were documentedin the PTCLU patients and 2 CR and6 PR in MF patients, respectively. The medianduration of the response was 12months. Treatment was well tolerated; hematologictoxicity was mild and no nausea/vomiting or organ toxicity was recorded. Inconsideration of its significant activity andits modest toxicity profile, the role ofgemcitabine deserves further evaluation inthe management of pretreated and untreatedpatients with peripheral T-cell lymphoma.

37 th Congress of the Italian Society of Hematology215P264HAEMOPOIETIC STEM CELLTRANSPLANTATION IN CHRONICLYMPHOCYTIC LEUKEMIAR. SCIMÈ*, S. TRINGALI*, A. SANTORO*, M. MUSSO°,A. OLIVIERI^, R. FELICE*, A.M. CAVALLARO*, M. MONTANARI^,P. IACOPINO • , G. MARIANI°, P. LEONI • , I. MAJOLINO*Div. di Ematologia, Osp. Cervello, Palermo*, Div. diEmatologia, Policlinico Palermo°, Div. di Ematologia,Univ. di Ancona^, Div. di Ematologia, Osp. ReggioCalabria • , ItalyWe report the results of haemopoieticstem cell transplantation in 17 poor prognosisCLL patients (A=1, BI=I, BII=13,CIV=2). Nine out of 17 have received amedian of 2 previous chemotherapy lines(1-4). Initial treatment consisted of fludara30 mg/m 2 for 3 days, followed by CY 4g/m 2+ G-CSF 5 mcg/Kg/day as mobilizing regimen.Patients with

216 September 26-29, 1999 - Torino-Lingotto, Italy(69%), and 1 of 11 MCL (9%). It is noteworthythat after autografting, most of thepatients with PCR-negative harvests maintaineda durable clinical and molecular remission.Fisher’s exact test showed a significantlyhigher relapse rate in PCR-positivepatients. Conclusion: high-dose chemotherapywas able to provide clinical andmolecular remissions in a sizeable fractionof FCL, but novel treatment modalities arerequired for SLL and MCL. A combined approachusing monoclonal antibody therapy(rituximab) plus high-dose chemotherapymight be planned.P266CLINICAL-MOLECULAR REMISSIONSAFTER INTENSIVE SEQUENTIALTHERAPY AND BLOOD PROGENITORCELLS AUTOTRANSPLANTATION INHIGH RISK LOW-GRADE NON-HODGKINLYMPHOMAM. OFFIDANI, A. OLIVIERI, A. MELE, M. MONTANARI,M. BRUNORI, L. CORVATTA, M. LUCHETTI*, M. CANDELA*,G. PELLICCIA^, P. LEONIDepartment of Haematology, *Depatment ofMedicine, Ancona University of Medicine;^Division of Medicine, S. Elpidio a Mare HospitalHigh risk Low-Grade non-Hodgkin Lymphoma(LG-NHL) is an uncurable diseasewith conventional chemotherapy, with shortlife expectancy. Autologous blood progenitorcells transplantation (BPCT) followingintensive chemotherapy has been consideredfor young patients affected by highrisk LG-NHL. From April 1997 to December1998 we enrolled 15 patients (m/f - 11/4;median age 53 years, range 37-62) affectedby LG-NHL (5 follicular, 3 mantle, 2 lymphocytic,4 lymphoplasmocytoid and 1 peripheralT cell) stratifical into three groupsapplying the International Prognostic Index(intermediate risk 53,3%, high- intermediate40% and high 6,7%). Nine patients(60%) were at diagnosis, while 6 patientswere pre-treated with less than two chemotherapyregimens. Treatment consistedof four alternate cycles of FND (Fludarabine25mg/mq days 1-3, Mitoxantrone 10 mg/mq on day 1, Dexamethazone 20mg days1-5) and HyperCHOP (Adriblastine 60mg/mq day 1, Vincristina 1,4mg/mq day 1,Prednisone 100 mg/mq day 1-5, Cyclophosphamide3 g/mq day 1) followed by DHAP(1-3 courses) and collection of blood progenitorcells and autologous BPCT. Conditioningregimen consisted of Mitoxantrone60mg/mq and Melphalan 180mg/mq. Thirteenpatients underwent full therapeuticprogram while 2 patients received only FND/HyperCHOP chemotherapy. Complete remission(CR) was obtained in 11/13 patients(84,6%), partial remission (PR) in 2/13(15,4%) [7/15 achived CR after FND/HyperCHOP (46,6%), 6/15 achived PR(40%) and 2/15 were not responder (NR)(13,4%)]. During sequential chemotherapyfever >38°C was observed in 6/15 patients(40%); four patients required domiciliaryantibiotic therapy and two patients neededhospitalization. Grade IV (WHO) neutropeniaoccurred in 4/15 pazients (26,7%) andgrade III neutropenia in 11 patients(73,3%). Grade IV trombocytopenia wasobserved in 3/15 patients (20%), grade IIIin 8/15 patients (53,3%) and grade II in 4patients (26,7%). Grade III mucositis occurredin 4/15 patients (26,7%). Only 6patients underwent transplantation becausein 6 patients stem cells harvest was notsuitable for transplant and 1 patient refusedit. With median follow-up duration of 20month, 2/13 patients developed diseaseprogression (and 1 died); 11/13 patientsare in CR, with a median event free survivalof 26 months [95%CI (18-34)]. Threeout of four patients with BCL-2 positive follicularlymphoma achieved molecular remissionfollowing FND/HyperCHOP chemotherapyand remained BCL-2 negative after19, 16 and 10 months. FND/HyperCHOP/DHAP chemotherapy is feasible with notnegligible haematological and extrahaematologicaltoxicity. Activity of this chemotherapyapproach seems to be excellentin particular for BCL-2 positive follicularlymphoma. Difficult in collecting blood progenitorcells is probably due to lymphomabiology or to previous chemotherapy. Furtherstudies and a longer follow-up arewarrented to asses the outcome of thesepatients with follicular lymphoma whoachieved molecular remission after FND/HyperCHOP chemotherapy.

37 th Congress of the Italian Society of Hematology217AUTOLOGOUSTRANSPLANTATIONP267AUTOTRANSPLANT FORHEMATOLOGICAL MALIGNANCIES:LAMINAR FLOW OR CLEAN ROOM?A. LUCANIA, L. PEZZULLO, G. DE ROSA, B. ROTOLIDepartment of Hematology, Federico II University,Medical School, Naples, ItalyAim of this study was to evaluate the feasibilityof autologous bone marrow transplant(AuBMT) for hematological malignanciesin conventional ward as compared tosterile rooms. From 1990 up to the present51 AuBMT have been performed in our institution(27 AML, 12 NHL, 7 HD, 5 MM). Ofthese, 17 (10 from BM and 7 from PBSC)were performed in sterile rooms (S), and34 (23 from BM and 11 from PBSC) in singlerooms of the conventional ward (C). Conditioningregimens were 24 BuCy2, 4BAmsaVC, 9 BAVC, 3 CBV, 6 BEAM and 5Melphalan. There were no significant differencesbetween C and S groups in termsof days with fever, mucositis, diarrhoea andi.v. antibiotic therapy (respective mediansin days: 1/1; 2/2.5; 0.5/1; 6/5). Documentedinfections were more numerous(12/34, 35%) in the C group than in the Sgroup (4/17, 23.5%), without reading astatistical significance (p=0.6). We confirmeda faster hematological recovery inthe PBSC group; in this group median daysof mucositis and i.v. antibiotic therapy wererespectively 1 and 2 days, while in the BMgroup median days were 4 and 8 respectively(p=0.02 and 0.05). Only 1 patient ofthe C group died in aplasia. AuBMT is a procedurefeasible in the conventional ward,using simple precautions of maximumhygiene and no admittance of visitors.P268A RETROSPECTIVE COMPARISON OFTUNNELLED AND NON-TUNNELLEDCENTRAL VENOUS CATHETERS (CVC)IN BMT RECIPIENTSG. IRRERA, A. ROSSETTI, R. CONDEMI, L. RUSSO,M. AZZARÀ, D. CORTESE, O. IACOPINO, M. CUZZOLA, P. IACOPINOCentro Trapianti Midollo Osseo, Az. Ospedaliera,Reggio CalabriaLong term venous access is necessary inBMT recipients for administration of bloodcomponents, antineoplastic agents and frequentmonitoring of blood parameters. Theinitial costs of non-tunneled CVC are lowerthan that of tunnelled CVC, but considerablyhigher costs might incur in non-tunnelledCVC as a result of more frequentcomplications. We retrospectively evaluatedinfectious and mechanical complicationsoccurred during the life of 201 implantedCVC - 54 tunnelled (Group A) vs 147 nontunnelled(Group B). The lines were insertedbefore autologous (166) or allogeneic (35)BMT and the removal was determined byreasons summarized below:Removal for: Tunnelled (A) Non-tunnelled (B)Infection CVC-related 12 29Thrombosis 1 3No longer useful 28 103Death with CVC 3 12Spontaneous go-out 1 9The strains isolated by CVC coltures weremainly Gram+ (Group A: 11 S. Epidermidis,3 S. Species; Group B: 16 S. Epidermidis,16 S. Species, 2 S. Oralis, 1 Acinetobacter,1 Gemella Hemol. and 3 Pseudomonas).“Antibiotic barrier” with high dosage of antibioticwas used if staphylococci were isolatedby at least two consecutive culture.This approach saved from removal 8 CVCin the Group A and 6 in the Group B. Themean duration of tunnelled and non-tunneledCVC was 142.1 and 24.1 days, respectively.The risk of complications is increasedas the time of exposure to CVC,therefore, we calculated the number of adverseevents per 1,000 days. Although thetotal number of adverse events was low,untunneled CVC were removed more frequentlybecause of complications. In conclusion,our data suggest that a tunneledcatheter makes more sense if it will be used

218 September 26-29, 1999 - Torino-Lingotto, Italybefore or after the transplant, despite theinitial expense.Supported by AIL, Regione Calabria and UEP269THE ROLE OF AMIFOSTIN INCONDITIONING REGIMEN.PRELIMINARY RESULTSF. C ICCONE, A. CHIERICHINI, C. CIABATTA, A. CENTRA,E. CUPELLARO, S. GUARINO, S. NARDELLIDepartment of Hematology – S. Maria GorettiHospital – Latina, ItalyAmifostin is a drug able to reduce chemotherapy-relateddamages as well as tostimulate the stem cell growth. We plannedto use Amifostin at two different schedulesto prevent organ toxicity and possibly toverify the maturative action on the stem cellin different conditioning regimen of autologousmarrow or blood trasplantation. 12patients have been until now registered: 11males and 1 female, median age 38 yrs. (r.21 – 69), with diagnosis of AML (4 cases),ALL (2), NHL (3), and MM (3). 6 patientsreceived a dose of 740 mg/sm (group A) and6 a dose of 910 mg/sm (group B). In groupA , the conditioning regimen was: BUCY (2AML), BAVC (2 NHL), HD-M (2 MM). Wedidn’t observe neither hypotension or othersevere adverse reaction, only mild nauseaand vomiting in 4/6 pts.; the chemotherapyrelatedtoxicity resulted: mucositis: gradeI-II 3/6 – grade III-IV 0/6; cardiac, renal,hepatic or pulmonary toxicity: 0/6; fever:grade I-II 4/6 – grade III-IV 0/6. In groupB conditioning regimen was: BIVC (2 AMLand 2ALL), BAVC (1 NHL), HD-M (1 MM); asfor immediate adverse reaction, all patientsshowed quite good tolerance; as for organtoxicity: mucositis: grade I-II 1/6 – gradeIII-IV 4/6; cardiac: grade I-II 2/6 – gradeIII-IV 0/6; renal: grade I-II 1/6 – grade III-IV 0/6; hepatic and pulmonary 0/6; fever:grade I-II 2/6 – grade III-IV 3/6. Time tohematologic recovery didn’t show remarkabledifferences in the two groups. Organtoxicity was unrelevant and transient in themajority of cases. Final remarks: the protectiveaction of Amifostin in our preliminarystudy seems largely confirmed; the use ofthe higher dose (910 mg/sm) didn’t giveany advantage, on the contrary, the mostimportant toxicities were distibuted in patientsof group B. Time of take didn’t seeminfluenced by Amifostin, at least in our experience.In the future, we ‘ll surely use thestandard dose of 740 mg/sm for all patients,and improve our experience by a largeramount of cases.P270PRETREATMENT WITH AMIFOSTINEREDUCES EXTRAHEMATOLOGICALTOXICITY OF AUTOLOGOUS PBPCTRANSPLANTATIONA. OLIVIERI, A. POLONI, D. CAPELLI, M. CONGIU*,D. MASSIDDA, G. MARINO*, M. MONTANARI, M. OFFIDANI,M. LUCESOLE, M. CANDELA^, G. SANTINI*, P. LEONIClinica di Ematologia, Ancona, Italy; ^Clinica Medica,Ancona, Italy; *Div. di Ematologia, Genova, ItalyAmifostine (WR-2721; Ethyol), a thiolcompound, has been shown to protect normaltissues from radiotherapy, alkylatingagents and cisplatin-induced toxicity withoutloss of antitumor effects. Furthermoreamifostine showed to be effective in treatingacute radiation mucositis but a possiblerole in preventing mucositis and speedingup auto-graft kinetics has never been investigated.We compared therefore twogroups of 33 and 35 patients, who respectivelyreceived (group A) or not (group B)amifostine (740 mg/m 2 ) in addition to theconditioning regimen (containing MelphalanHD alone or with Mitoxantrone or Busulfanor Thiotepa) followed by the autologousinfusion of PBPC. The patients resultedmatched for age, sex, diagnosis, diseasestatus, conditioning regimen, pre-transplanttreatment and number of CD34+ cells infused.Amifostine was well tolerated at thisdose level. Vomit grade 1-2 was the moreimportant side effect (55%), only one patientdeveloped grade 3 vomit. Hypotensionand hypocalcemia occured in eightpatients respectively, however the interruptionof infusion was never required. The useof amifostine was associated with significantlyless mucositis, since the incidenceof severe mucositis (grade 3-4) was 27%in group A and 53% in group B (p=0.006).Furthermore the median duration of severemucositis was 0 days in group A versus 7days in group B (p=0.004). The incidenceand duration of analgesic therapy was alsosignificantly lower in group A (20% and 0days), when compared with group B (68%and 6 days) (p=0.0001). We also observed

37 th Congress of the Italian Society of Hematology219a lower incidence of severe vomit (9% vs34%; p=0.01), diarrhea (3% vs 33%;p=0.01), and nausea (3% vs 25%; p=0.01)in group A in comparison with group B. Nodifferences were revealed between the twogroups of patients for the hematologicalrecovery assessed by days to achieve 500PMN/µl and 20,000 PLT/µl. In conclusionamifostine reduces the incidence and theduration of severe mucositis, the use ofanalgesic drugs after high dose Melphalan(• 120 mg/m 2 ) followed by PBPC autotransplant.P271ERYTROPOIETIN AFTER AUTOLOGOUSSTEM CELL TRANSPLANTATION CANREDUCE TRASFUSIONALREQUIREMENT?C. CIABATTA, A. CHIERICHINI, C. CICCONE, E. CUPELLARO,A. CENTRA, S. GUARINO, S. NARDELLIDept. of Hematology, S.Maria Goretti Hospital,LatinaWhile G-CSF after transplantation (autologousas well as allogenic) is usually administered,the role of Erythropoietin in reducingthe number of blood transfusions is stilldebated. We report our experience, consistingin the association of these two growthfactors given on day +1 after auto stem cellsinfusion (G-CSF 5 mcg/Kg/day and r-Hu-EPO 10.000 U in alternate days until Hb levels> 10 g/dl). 27 patients have beenevaluted: M 17, F 10, median age 40 (r. 17-66); ANLL 5, ALL 3, NHL 8, LH 2, MM 9; 23underwent auto-PBCP, 2 Bone Marrow, 1BM+PBCP; conditioning regimens were :BAVC or BIVC (HD-Ida), BEM, BEAM, BU-CY,HD-M. The average of reinfused CD34 was8,1x 10 /Kg. Median time to PMN > 500mmc and Platelets> 50.000/mmc was 9days (r. 1-24) and 10 days (r. 3-195) respectively.We evalueted transfusion requirementin packed red cells (PRC) units untilday + 30 and / or Hb> 10 g/ dl in 3 consecutivedetections: median overall PCR infusedwas 2 U; if we consider the numberof transfusions related to diagnosis: ANLLm.6 U (r. 2-12), ALL m.2 (r.2-8), NHL m.2(r. 0-6), HL 0 and MM m.0 (r. 0-9); relatedto conditioning regimen: BAVC 2 (r. 0-4),BIVC 6 (r. 2-8), BU-CY 6 ( r. 2-12 ), BE (A)M2 (r. 0-4), HD-M 0 (r. 0-8). We observed thatthe highest transfusion requirement wasdirectly related to disease (i.e. ALL, ANLL),and then subsequently related to the scheduleof conditioning regimen (most aggressive:BIVC, BU-CY); moreover we underlinedthe small number of PRC units transfusedto the patients with Multiple Myelomaand Malignant Lymphomas. In conclusion,we presume that Erythropoietin really canbe useful in reducing transfusion need, butsome controlled trials should allow to removeany possible perplexity.P272PERIPHERAL BLOOD STEM CELLTRANSPLANT. A SINGLE CENTREEXPERIENCE WITH NICOOL PLUS-DMCE. CAMPANINI, A. BONINI, P. AVANZINI, L. MASINI,F. M ERLI, F. ILARIUCCI, G. RUSSI, R. BARICCHI, A. MAZZI,L. ALBERTAZZI, M. BRINI, P. RIVASI, L. GUGLIOTTAUnità Operativa di Ematologia, Servizio diImmunoematologia e Trasfusionale, Laboratorioanalisi chimico-cliniche, ASMN, Reggio EmiliaBetween May 1998 and April 1999 weperformed 34 hematopoietic stem cells harvests,31 from peripheral blood and 3 frombone marrow, in 23 adult persons; gender:13 females and 10 males, median age 50yrs (range 21-61 yrs). One of them was adonor for a singeneic transplant while theothers were all patients; their diseases wereNHL (8), HD (4), MM (4), ANLL (2), ALL(1), breast cancer (2), ovarian cancer (1).All patients previously received several conventionalchemotherapy courses; MM wasdefined as small (2) and big (2) disease,the disease phases of other patients were:I CR (7), II CR (1), III CR (3), relapse (2),resistant-relapse (2). Peripheral blood stemcell mobilization was primed with G-CSFalone at the dose of 10 µg/Kg (9 personsincluded the donor), cyclophosphamide (7g/m 2 ) + G-CSF (6 pts), VID + G-CSF (1pt), HD-ARA-C + G-CSF (1 pt), L-PAM (180mg/m 2 ) + G-CSF (1 pt), HD-ARA-C +Mitoxantrone + G-CSF (1 pt), epirubicin +taxanes + G-CSF (1 pt). One pt with lowgrade NHL was submitted to 3 consecutiveperipheral blood stem cell harvests accordingto a high-dose sequential therapy program.G-CSF was administered for a medianof 9.2 days (range 4-15 days). Thebeginning of the harvest was performedaccording to the recovery of PMNs (>0.5 x10 9 /L), platelets (20 x 10 9 /L) and circulatingCD34 + cells. At the time of harvest the

220 September 26-29, 1999 - Torino-Lingotto, Italymean number of CD34 + cells was 98660/ml, median 50540/ml, range 3600-457980/ml. Pre-harvest Hb level was 10.9 g/dl(range 7.9-16.8 g/dl), WBC 19.2 x 10 9 /L(range 2.7-58.1 x 10 9 /L), platelets 140.1 x10 9 /L (range 14-382 x 10 9 /L). A single harvestwas enough in 17 pts. Mobilization andharvest procedures did not show significativetoxicity. At the end of the harvest medianHb level was 10.4 g/dl (range 7.8-14.4g/dl), median Plt count was 81.4 x 10 9 /L(range 14-200 x 10 9 /L), median WBC countwas 22.57 x 10 9 /L (range 4-41.6 x 10 9 /L).Mean MNC number (x 10 8 /Kg) was 6.0,median 5.6, range 0.5-15.9. Mean CD34+cells (x 10 6 /Kg) were 8.3, median 5.6, range0.6-33.2. Hematopoietic stem cells werecryopreserved with Nicool Plus (Air Liquid-DMC-France-PC SAN/SIO-1008) reducingtheir temperature of 1°C/min until -40°Cand then with a reduction rate of 5°C/minuntil -120°C. The in vitro vitality tests wereexcellent (65-85%) with an elevatedclonogenic activity (CFU-GM x 10 4 /Kg:mean 81.5, median 59.8, range 5.4-318.9).Ten patients were autotransplanted ; oneof them were submitted to a double transplantprocedure; transplant-related toxixitywas very low. Peripheral hematopoietic recoverywas: 9.9 days (range 9-14) to PMNs>0.5 x 10 9 /L, 15.6 days (range 12-36) toPlt > 50 x 10 9 /L. In conclusion, despite of asmall number of patients, Nicool Plus procedureseem to warrant a high efficiencygrade for stem cells cryopreservation. Excellentin vitro vitality tests and good peripheralblood cells recovery confirmed goodefficiency of the procedure.P273PURIFIED CD34+ APBSCT BYCliniMACS: PRELIMINARY EXPERIENCEIN ADULT PATIENTS WITHHEMATOLOGICAL MALIGNANCIESE. ORTU LA BARBERA, R. SERAFINI*, S. SICA,G. MENICHELLA*, C. RUMI*, L. PIERELLI*, L. LAURENTI,P. CHIUSOLO, S. CICCONI*, G. LEONEDivisione di Ematologia, *Centro Trasfusionale,Cattedra di Ematologia Università Cattolica delSacro Cuore, RomaAn optimal autologous transplantation inpatients with high risk hematological malignanciesand/or with bone marrow involvementis the reduction of neoplastic contaminationin the graft. Immunomagnetic positiveCD34+ cells selection is one of the avaiabletecnhnique for clinical application. SinceJanuary 1999, in our Institution, five aphereticproducts, obtained from 5 patients withhematological malignancies (4 NHL and 1MM) were purified using CliniMACS (MiltenyiBiotech Inc.) device. The patients medianage was 41 yo ( range 33-50) with amedian body weight of 60 kg (range 55-120) and all pts were in disease progressionand/or with bone marrow involvement. One“large volume” apheretic procedure per patientwas able to obtain the transplantCD34+ cell dose and the purification procedureswere perfomed at the same day ofthe apheresis. Selection procedures werebegun with a median value of CD34+ cellsof 412.6x10 6 (range 341.1-1107) and 6.9x10 6 CD34+/kg (range 2.3-15.6) in theapheretic products. After immunoselectionby CliniMACS device, a median value of255.7x10 6 CD34+ cells (range 238.1-910.1)and of CD34+ cells/kg of 4.9x10 6 (range2.3-15.6) was obtained.The median purityof CD34+ cells after selection was 96,1%(range 90.1-99) with a median CD34+ cellsrecovery of 72%8 (range 69,6-83.1). AfterBuMel conditioning regimen, 3 patientswere reinfused (2 NHL and 1 MM) with selectedCD34+ cells. A CD34+ cells dose of9.6, 15.6 and 4.9 x10 6 /kg respectively werereinfused with early complete trilineageengraftment in all patients (the one with MMwas previously submitted to APBSCT withunselected cells). Our preliminary datademonstrate the feasibility of CliniMACSpurification system in adult patients withhematological malignancies, showing highCD34+purity in the graft and good hematologicalrecovery after high dose chemotherapy.P274“EX VIVO” TREATMENT BY MABTHERA(ANTI-CD20) AND “IN VIVO” PURGINGOF PBSC GRAFT IN B CHRONICLYMPHOCYTIC LEUKEMIA (B-CLL)PATIENTS. VOLPE, G. MARCACCI, F. CAPONE, N. CANTORE, E. VOLPEServizio di Ematologia - UTIE - A.O. S. G. Moscati -Avellino - ItalyMabthera is a chimeric anti-CD20 monoclonalantibody (MoAb) that binds selec-

37 th Congress of the Italian Society of Hematology221tively the CD20 antigen found on the surfaceof malignant and normal B cells, andshows cytotoxicity versus these cells.Mabthera is the first antibody approved andutilized for the treatment of low grade lymphomas.We are conducting a study in orderto use Mabthera for “in vivo” purging ofresidual B cells contaminating PBSC graft,after the MoAb had been binded “ex vivo”on the surface of B-lymphocytes before infusion,in B-CLL patients. We report the firstcase of this study. A 48 year-old man withB-CLL (stage Rai II) was treated byFludarabine 25 mg/mq for 5 days at 28 dayintervals for 4 courses. He achieved normalperipheral blood and bone marrow lymphocytescount, but immunophenotypicanalysis showed that 28.7 % of peripheralblood lymphocytes and 35.7 % of bonemarrow lympho-cytes were CD19+ CD5+.He has undergone PBSC mobilitation usingCTX + VP16 + rhG-CSF. Collection of PBSCwas performed on the 12th day by Freseniusseparator. The aphereses product contained3.6 x 10^6 /Kg CD34+, and 29.7 % of thetotal cells were CD5+ CD19+. Conditioningchemotherapy was BEAM regimen followedby reinfusion of the Mabthera manipulatedharvest. In brief: PBSC were rapidlythawed at 37°C and normal saline (vol1:2) was added drop by drop. After centrifugation(2500 rpm x 15 min.) the supranatantwas discarded and the pellettresuspended with 100 ml of RPMI 1640medium. Mabthera was additioned (100 mgfor each bag) and after a 30' incubation (atR.T.) the cells were washed with RPMI 1640medium. Evaluations on the final materialshowed a viability of 92% with a recoveryof 67% of the total CD34+ cells collectedprior to cryopreservation. The patient waspremedicated with acetamino-phen plusdiphenhydramine and the cells rapidly infused(2.4 x 10^6 / Kg CD34+ were finallyinfused). Hematological recovery was on16th day (PMN > 500 /mmc) and on 24thday (Plts > 50.000 /mmc); complicationswere limited to neutropenic fever and mildmucositis. The patient is now in clinic-hematologicalremission 4 months after thetransplant with normal white blood countand 0.07 % of the lymphocytes are CD19+.P275IMMUNOLOGIC RECONSTITUTIONAFTER AUTOLOGOUS TRANSPLANTWITH BONE MARROWOR PERIPHERAL BLOODSTEM CELLSG. DE ROSA, L. PEZZULLO, A. LUCANIA, M. CAVALCANTI,E. COSENTINI, C. CACCIAPUOTI, B. ROTOLIDepts. of Hematology and Immunohematology,Federico II University Medical School, Napoli, ItalyWe have investigated the immunologicalreconstitution after autologous stem celltransplant by enumerating lymphocyte subsetsduring the first year after transplantin 18 patients who had received autologousbone marrow (BM) and in 16 patients whohad received autologous peripheral bloodstem cells (PBSC). At three months thePBSC group showed a more rapid recoveryof total lymphocytes and of CD3+, CD4+,CD8+, CD19+ and NK cells. At 6 monthsthe BM group showed a higher number ofCD3+ and CD8+ cells, while the PBSCgroup had higher number of CD4+ and NKcells. At 12 months both groups had a similarnumber of CD3+ cells, but CD4+ andNK cells predominated in the PBSC group,while CD8+ and CD19+ cells predominatedin the BM group. Thus, it seems that thesource of stem cells can influence the relativeproportion of lymphocyte subsets. Atransplant with PBSC cells brings aboutearlier normalization of the CD4/CD8 ratio,while a transplant with bone marrowcells is followed by inverted CD4/CD8 ratioeven one year after transplant, due toa selective expansion of CD8+ cells. It remainsto be ascertained the biologicalmeaning of different patterns of repopulation;in particular, whether different patternsof immunological reconstitution arerelevant for the incidence of post transplantrelapses.

222 September 26-29, 1999 - Torino-Lingotto, ItalyP276FOLLOW-UP OF HHV-8 AND EBVINFECTIONS IN PATIENTSUNDERGOING ABMTP. GALIENI 1 , A. BONCI 2 , D. MOSCHETTINI 2 , D. LASZLO 1 ,S. POLLINI 2 , M. TOZZI 1 , D. DONATI 2 , G. SCALIA 1 ,G.M. ROSSOLINI 2 , F. LAURIA 11 Cattedra e U.O. di Ematologia, 2 Dipartimento diMicrobiologia-Bilologia Molecolare, Università diSiena, ItaliaDetection and reactivation of human herpesvirustype 8 (HHV-8) has seldom beentaken into consideration after bone marrowtransplantation (BMT). Epstein-Barrvirus (EBV) infection does not seem to causeclinical problems in the setting of autologousand allogenic BMT, but sometimesnon-Hodgkin lymphomas related to the virusmay appear after allogenic BMT. Thepresent study was planned to evaluate thepossible role and behaviour of HHV-8 andEBV infections after autologous BMT(ABMT). Twenty three adult patients performingABMT have been analyzed for HHV-8 antibodies by ELISA using recombinantp65 antigen and IFA using BC-3 cell line intheir plasma samples. EBV antibodies wereevaluated using recombinant p18 or recombinantEBNA-1 antigen in ELISA test and inIFA using P3HR-1 cell line. Patients weremonitored before ABMT, 90 and 180 daysafter the stem cells infusion. Three out 24ABMT procedures showed a positivity forHHV-8 antibodies in IFA while no reactivityto p65 was found before trasplantation. Thefollowing samples showed no difference inthe antibody titre. All samples, except 2,were positive for EBV antibodies beforetransplantion. No change was observedduring the follow-up period. No patientsshowed clinical signs related to both virusesinfections. So far our results suggest thatHHV-8 infection is not widespread in Italy.Moreover, a HHV-8 and EBV reactivationwere not observed. Our data confirm thatABMT procedure does not induce virus reactivationbecause of the weak immunosuppressivetherapy, however we wouldneed more cases to verify these results.P277ACUTE THROMBOCYTOPENIA AFTERAUTOLOGOUS STEM CELLSTRANSPLANTATIONA. CHIERICHINI, F. CICCONE, C. CIABATTA, S. GUARINO,E. CUPELLARO, A. CENTRA, S. NARDELLIDepartment of Haematology - S.Maria GorettiHospital - Latina – ItalyThe wide application of autologous stemcells transplantation in haematologic malignanciesand longer follow-up, are showingonset of unusual side effects as otherblood disorders. We report two cases ofacute thrombocytopenia after autologoustransplantation. 1 th case report:male,19yrs.,ANLL M4,C.R.,according toAML10 protocol was randomized to receiveautologous bone marrow transplantationafter conditioning regimen BuCy. PMN>1000/mmc day +20;PLT> 100.000/mmcday +50. On day +70 PLT < 30.000/mmc;marrow C.R. with dismorficmagacariocytes; pannel for autoimmunediseseases :negative; direct Dixon’stest:positive; remission of acute thrombocytopeniawith steroids for one month.Relapse of acute leukemia after sevenmonths. 2 nd case report: male,44yrs.,LNHLGM IVm in P.R. with Fludarabine plusIdarubicine; autologous peripheral stemcells transplantation after conditioning regimenBAVC; PMN >1000/mmc day +15; PLT>100.000/mmc day + 34.On day +150PLT < 10.000mmc;pannel for autoimmunediseases and direct Dixon’s test:negative;bone marrow with increased number ofmagacariocytes ;no signs of lymphoma.Failure after steroids for one month Afterfour months persistent thrombocytopeniawithout localizations of malignancy. Immunologicalmanipulation due to intensiveprior chemotherapy and to conditioningregimens may play a role on onset of thisblood disorders. Loss of T-suppressor clonesand modification in surface antigens of hemopoieticcells after transplant processshould be investigated.

37 th Congress of the Italian Society of Hematology223P278CYCLOSPORIN FOR THROMBOTICTHROMBOCYTOPENIC PURPURA AFTERAUTOLOGOUS PERIPHERAL STEM CELLTRANSPLANTATION: CASE REPORTM. BRUNORI, V. AGOSTINI, A. OLIVIERI, S. RUPOLI, P. LEONIDept. of Haematology, Ancona University of MedicineThrombotic thrombocytopenic purpura(TTP) is characterized by thrombocytopenia,microangiopathic haemolitic anaemia,neurological symptoms, renal impairmentand fever. TTP is often secondary to otherdiseases or to the use of some drugs. Itcan also be associated with autologous orallogeneic bone marrow transplantation(BMT). The incidence in allograft and autograftrecipients is about 14% and 7%,respectively. Several factors may be involvedin the pathogenesis of the TTP followingBMT. These include red cell fragmentationcommonly observed after autologousor allogeneic BMT, graft versus host disease,and intensive conditioning therapy. AlthoughPlasma Exchange (PE) is very effectivefor classic TTP with a complete responseof 70-80%, results of PE in themanagement of TTP following BMT are disappointing.Consequently other therapeuticaloptions including immunosoppressivedrugs should be performed. Cyclosporin A(CyA) 300mg/die was first used in TTPmanagement in 1993 with a durable remissionof the disease. Only in few reports CyAwas used in TTP following autologous BMTwith complete response. In September1995, a diffuse large cell non Hodgkin Lymphoma(NHL), stage IIIB was diagnosis ina 43-year-old man. The treatment consistedof six courses of CHOP (cyclophosphamide,doxorubicin, vincristine and prednisone),resulting in complete remission (CR). InNovember 1997, he relapsed and wastreated with three courses of DHAP(Cisplatin, Aracytin, MESNA, Prednisone)achieving a second CR. In March 1998, heunderwent autologous stem cell transplantation,preceded by BEAM (Carmustine,Etoposide, Aracytin Melphalan) regimen asconditioning therapy. In June 1998, TTP wasdiagnosed based on severe anemia, thrombocytopenia(Plt

224 September 26-29, 1999 - Torino-Lingotto, Italyof ANC > 100//µl and of PLT count > 30.000/µl was 8.6 d. (r. 8-10) and 11.8 d. (r. 9-18), respectively. During the early phaseof the engraftment, 6 patients showed amaculopapular skin rash, extending to widepart the bodily surface, with general malaiseand, in 5 cases, with fever

37 th Congress of the Italian Society of Hematology225Twenty-eight were male and 22 were female,median age was 41 years (19-62).Twenty-five patients were affected by NHL,13 MM and 12 HD. Thirty-six patients weresubmitted to unselected PBSCT and 14 toCD34+ immunoselected PBSCT after conditioningregimen (BuMel 20 pts, BuCy2 19pts, BEAM 9 pts, HDMel 2 pts). All patientsachieved complete remission after transplantationwith a median follow-up of 24months (12-97). We did not find cases ofMDS or sAML according to FAB classificationbut some of them showed lineage dysplasiaas dyserithropoiesis, dysgranulopoiesis, ordysmegakaryocytopoiesis. Cytogeneticalabnormalities as: del (5) (q14q34) and lossof Y, with normalization at the subsequentcontrol, were found in two patients. Immunologicalstudy showed total T lymphocytesCD3+ and B lymphocytes CD19 within thenormal range (CD3+ median value: 1242x 10 6 /L, range 46-5435), (CD19+ medianvalue: 293 x 10 6 /L, range 73-2770).Persistant reduction of CD4+ cells (medianvalue: 407 x 10 6 /L, range 40-1146)with concomitant increase of CD8+ cells(median value: 724 x 10 6 /L, range 108-4719) have produced imbalance of CD4/8ratio (median value: 0.6 range 0.1-1.6).Effector cells as T activated cells CD3HLA-DR+ and NK population CD16-56+ wereincreased respect to normal range(CD3HLA-DR+ median value: 293 x 10 6 /L,range 43-2420) (CD16-56 median value:223 x 10 6 /L, range 38-1451).P282RENAL CARCINOMA IN TWO PATIENTSWITH POOR PROGNOSIS NHL TREATEDWITH HIGH-DOSE CHEMOTHERAPYAND PERIPHERAL STEM CELLAUTOTRANSPLANTATIONF. CARACCIOLO, F. PAPINESCHI, E. BENEDETTI,E. CAPOCHIANI, N. CECCONI, G. CARULLI, A. AZZARÀ,B. ROSAIA, R. FAZZI, F. TONELLI, G. CERVETTI, M. PETRINIDip. di Oncologia, Divis. di Ematologia; Universitàdegli Studi di Pisa Azienda Ospedaliera PisanaSolid tumor occurrence is not a rare eventin patients affected by lymphoid malignancies.The development (or the progression)of second malignancies is a potential complicationafter cytotoxic therapy. We reporttwo cases of aggressive NHL who weretreated with high dose chemotherapy andPBSC transplantation and underwent surgeryfor renal carcinoma. Case # 1: 44-years-old woman, NHL subtype G W.F., clinicalstage III B, treated with ProMACE-CytaBOM and subsequently with HDS regimenand auto-PBSC transplantation (accordingto Gianni et al, N Engl J Med 1997).At pretransplantation evaluation a TC scanrevealed a renal lesion; the biopsy showedrenal carcinoma. The patient was nefrectomized,and six weeks after surgery wasperformed haematopoietic auto-transplantationwith PBSC. At + 141 the patient diedfor metastatic cancer, in CR for NHL. Case# 2: 48-years-old man, NHL subtype H WF,clinical stage IV A, treated with HDS regimenand auto-PBSC transplantation. Atpretransplantation evaluation TC scan confirmedthe presence of a nodular lesion ofthe kidney (also present at time of diagnosis).The patient underwent haematopoieticauto-transplantation with PBSC. At +515the patient was nefrectomized for renal cellcarcinoma. At +540 the patient is alive andwell, in CR for NHL. Discussion. Some studieshave showed that in 5% of autopsies otherwiseperformed is present a malignantrenal lesion (Paulson in De Vita Prat Oncol1985). These two reports suggest to evaluatecarefully all residual kidney lesions afterchemotherapy and to define the optimaltiming of the surgical treatment for carcinoma.P283PBPC COLLECTION AFTER G-CSGADMINISTRATION: SINGLE CENTEREXPERIENCE IN 139 PATIENTSA. BOSI, R.SACCARDI, S. GUIDI, M.P. MARIANI, S. CIOLLI,R. CAPORALE, F. PAGLIAI, L. LOMBARDINI, A.M. VANNUCCHI,P. ROSSI FERRINIU.O. Ematologia, Servizio Trapianti Midollo Osseo,Azienda Ospedaliera Careggi, FirenzeBetween august 1994 and April 1999, 139pts (F/M 87/52, median age 44 years, range16-62) diagnosed with NHL(45), breastcancer (44), HDG (19), MM (25), AML (2),ALL (1), AL (1), WD (1), Evans S. (1), weresubmitted to PBPC collection after G-CSFadministration (10-15 µg/Kg) in steadystate.Collections started at day 4 of G-CSFadministration. No major side effects wereobserved and all pts completed the mobilizationprocedure. A total of 324 PBPC col-

226 September 26-29, 1999 - Torino-Lingotto, Italylections were performed (2.4/patient, range1-5). Collections were done by a continuousflow cell separator CS3000 (Baxter); amedian of 10 Liter/harvest (range 5-12) ofPB were processed. In each harvest a mediannumber of 18.56x10 9 TNC (range 0.16-62.2), 3.03x10 8 /kg TNC and 1.37x10 6 /Kgof CD34 + respectively were collected. Foreach patient the number of TNCx10 9 ,TNCx10 8 /Kg and CD34x10 6 /kg were respectively39.68 (4.28-127.11), 6.51 (0.36-24.9) and 3.51 (0.05-31.42). In 30% ofpatients (42/139) the number of collectedCD34 + resulted lower than 2x10 6 /Kg; inthese conditions a second mobilization orBM harvest was performed. The major riskfactor for collection failure was a heavy previouschemo-radiotherapy. These resultsshow that, without any mobilizing chemotherapy,we achieve an adequate collectionof PBPC. This procedure could be of interestfor PBPC strategy organization.P284HIGH-DOSE ETOPOSIDE WITHGRANULOCYTE COLONY-STIMULATINGFACTOR FOR THE MOBILIZATION OFPERIPHERAL BLOOD PROGENITORCELLS: EFFICACY AND TOXICITYG. PUCCI, M. MARTINO, G. IRRERA, G. CONSOLE,G. MESSINA, A. PONTARI, I. CALLEA, A. DATTOLA,G. BRESOLIN*, F. MORABITO, P. IACOPINOCentro Trapianti di Midollo Osseo, *Servizio diImmuno-Ematologia e Trasfusioni, Az. OspedalieraBianchi-Melacrino-Morelli, Reggio CalabriaChemotherapy alone or in combinationwith granulocyte colony-stimulating factor(G-CSF) is administered to mobilize peripheralblood progenitor cells (PBPC). Cyclophosphamide(CTX) is commonly used forthis scope. We previously demonstrated thathigh-dose etoposide (2 g/m 2 ) represents aneffective alternative for mobilization of PBPCeven when other regimens including CTXfailed. The aim of this study was to comparehigh-dose with lower doses ofetoposide on PBPC mobilization and toxicityin 14 patients affected by different neoplasticdiseases (2 acute leukemias, 4 non-Hodgkin’s lymphomas, 2 chronic lymphocyticleukemias, 2 brain tumors, 3 breastcancers and 1 chronic myeloid leukemia).PBPC had failed to mobilize after high-doseCTX (4-7 g/m 2 ) and G-CSF (5µg/Kg) in 10patients; after docetaxel (100 mg/m 2 ) andG-CSF (5µg/Kg) in 3 patients; and after G-CSF (10µg/Kg) alone in 2 patients. Four patientswere untreated. Three patient groupswere formed according to dosage ofetoposide (8 patients at 2g/m 2 ; 4 patientsat 1.6g/m 2 ; 2 patients at 1g/m 2 ). All patientsreceived daily G-CSF (5µg/Kg). Subsequentleukaphereses were performed byAS104 Fresenius cell separator using a C4Ydevice (Biofil, Mo, Italy). CD34 + cell contentwas assayed with a target total cellcollection of 2x10 6 CD34 + cells/Kg. Mediannumber of harvested CD34 + cells/Kg werein the first group, 4.2 (1.4-9.5) and 4.9(range 0.4-18) in the second one. In the 2patients of the third group the number ofCD34 + cells/Kg harvested were 2.6 and32x10 6 . Three cases experienced mucositisWHO grade I, 4 cases needed plateletsupport and 5 received blood transfusion.None of these patients belonged to the thirdgroup. In conclusion, high dose etoposiderepresents a valid alternative in patients inwhich previous mobilization therapies havefailed. However, additional cases should bestudied to establish whether etoposide administeredat lower dose (1 g/m 2 ) providesefficient mobilization as well lower toxicity.Supported by AIL, Regione Calabria and UEP285FACTORS INFLUENCING THE RECOVERYOF CIRCULATING PROGENITORS CELLS(PBSC) IN PATIENTS WITH MULTIPLEMYELOMA (MM)S. CABERLON, G. PAGNUCCO, A. CORSO, L.VANELLI,M.A. MAIOCCHI, A. TENORE, F. LUNGHI, E. BRUSAMOLINO,M. LAZZARINO, C. BERNASCONIIstituto di Ematologia, Università di Pavia. Divisionedi Ematologia, Policlinico S. Matteo IRCCS, PaviaWe have studied the factors influencingPBSC mobilization after HD-CTX plus G-CSF(Filgrastim, 5 µg/Kg/day) in 53 consecutivepts with MM included in the autologousPBSCT program of our Center betweenNovember 1995 and March 1999. HD-CTXwas the first treatment in 3 pts, 28 pts hadreceived prior treatment with VAD regimen,in 22 pts HD-CTX was used after MPH+PDor multiple regimens including local RT oralpha-IFN. CTX was used at a dose of 4 g/m2 in 54 pts and of 7 g/m2 in 8 pts. PBSC

37 th Congress of the Italian Society of Hematology227collection was started when the absolutenumber of CD34+ cells in the blood exceeded20/µL. We have done 114leukapheresis in 51 pts with a mean CD34+cells content of 3.3 x10^6/Kg (range 0.1-19.9); in 34 pts the total number of CD34+cells exceeded 4 x10^6/Kg; this target wasachieved with 1 leukapheresis in 7 pts, with2 in 21 pts and with 3 or more in 6 pts. In16 pts the total number of CD34+ cellswas lower than 4 x10^6/Kg. 2 pts didn’thave a sufficient mobilization. A secondmobilization round with HD-CTX plus G-CSFwas done in 8 pts, only in 5 the apheresisprocedure was possible. We have found thatthe following factors have an adverse impacton PBSC mobilisation and collection:1) a time interval from diagnosis of MM >24 months: mean value of CD34+ cells/µLin the blood 15 vs 39; mean leukaphereticproduct 1.9 vs 3.6 x10^6/Kg; median intervalfrom HD-CTX to leukapheresis 13 vs11 days; total number of CD34+ cells collected61 vs 309 x10^6/Kg; % of successfulleukapheresis 19 vs 31. 2) prior chemotherapywith alkylating agents and alpha-IFN: mean value of CD34+ cells/µL in theblood 18 vs 39; mean leukapheretic product2.2 vs 4 x10^6/Kg; median intervalfrom HD-CTX to leukapheresis 12 vs 11days; total number of CD34+ cells collected116 vs 254 x10^6/Kg; % of successfulleukapheresis 13 vs 39. 3) furthermore ptswith refractory MM had lower PBSC collection:mean value of CD34+ cells/µL in theblood 7.3 vs 52; mean leukapheretic product0.9 vs 4.2 x10^6/Kg; median intervalfrom HD-CTX to leukapheresis 13 vs 11days; total number of CD34+ cells collected30 vs 80 x10^6/Kg; % of successfulleukapheresis 3 vs 31.P286PERIPHERAL BLOOD STEM CELL(PBSC) MOBILISED BY G-CSF INMULTIPLE MYELOMA (MM) PATIENTSFOLLOWING TWO DIFFERENTSTREATMENT MODALITIESBackground: Using standard chemotherapyfor MM patients, no cures have beenobserved and only 5% of patients live longerthan 10 years. During the last 10 years, anumber of studies have shown that autologousstem cell transplantation is a usefulsalvage therapy for refractory and relapsedMM and a safe and effective consolidationtherapy for patients responding to initialconventional chemotherapy. We report ourexperience in mobilizing PBSC by G-CSFafter 2 different schedules of cyclophosphamide(CTX) administration and dosage.Patients and Methods: From November1991 to January 1999, 59 consecutive newlydiagnosed MM patients (pts) with a medianage of 47 yrs ( range 32-59 yrs), respondingto standard chemotherapy, entered thisevaluation. Before mobilization of PBSC with5 µg/Kg/day of G-CSF, 25/59 pts (45.7%)received 7 gr/m 2 of CTX on day 1 (group A)and 34/59 pts (54.3%) received 1.2 gr/m 2of CTX on day 1 and 3 (group B). Of the 59pts, 28 were males and 31 females, as forthe type of MC: there were 35 IgG, 16 IgA,2 IgD and 6 BJ. Clinical and biological characteristicswere similar between the twogroups. Results: Results as median valueand range are reported in the followingtable:# CD34 + # Days to Days to %Collected apheresis PLTS PMN Responsex10 6 /Kg >50000 >500 >50%Group A: 8.16 3 14 11 92(# = 25) (2.75-39,8) (1-5) (9-106) (6-19)Group B: 3.33 1 15 13 85(# = 34) (2.09-13.1) (1-3) (8-40) (8-24)All patients in group B were treated as outpatients without severe toxicities. Whilethose in group A required hospitalization.Conclusions: The obtained results indicatethat lower dose are similar to higher doseof CTX as for PBSC collected, days to PLTSand PMN recovery and rate and type of response.However, only a longer follow-upwill clarify whether or not there is differencein term of response and survival durationin the two different groups of patients.M. RIBERSANI, M.T. PETRUCCI, G. LA VERDE, S. TRASARTI,R. BELLUCCI, N. VILLIVÀ, A. PULSONI, G. AVVISATI,F. MANDELLIEmatologia, Dipartimento di Biotecnologie Cellularied Ematologia, Università “La Sapienza”, Roma

228 September 26-29, 1999 - Torino-Lingotto, ItalyP287RETROSPECTIVE ANALYSIS OF THREEDIFFERENT LEVELS OF HIGH DOSECYCLOPHOSPHAMIDE AS APERIPHERAL BLOOD STEM CELLMOBILIZING THERAPYP. M AZZA, G. PALAZZO, B. AMURRI, M. CERVELLERA,A. MAGGI, G. PRICOLO, L. STANI, A. PRUDENZANODiv. of Haematology, “G. Moscati” Hospital, TarantoWe report a retrospective analysis of 51pts with several malignancies undergoingautologous PBSC transplantation and receivinghigh dose cyclophosphamide (CTX)as mobilizing therapy. The role of threeschedules of CTX was investigated: 16 ptsreceived 3-4gr/sqm CTX, 14 pts received5-6 gr/sqm CTX whereas the remaining 21pts were treated with 7gr/sqm CTX. Thedifferent schedule of CTX administered ineach group was related to the disease, theage of patient and often to the cardiac status.Two patients of the first group werenot evaluable since they never reached theminimum number of CD34+ cells(2.5x10^6/kg). The median age of patientsin the third group was significantly lowerthan the other two groups (41.9 yrs vs. 60.1and 61.7 yrs respectively) because pts.older than 60 years never received morethan 5 gr/mq CTX. The median number ofaphereses in each group resulted inverselycorrelated to the dose of CTX: 2.28 collectionsin patients receiving 4gr/sqm CTX,1.92 in those receiving 5-6 gr/sqm CTX and1.76 in the group receiving 7 gr/sqm CTX.Moreover , the total number of CD34+ cellsharvested increased with the dose of CTXadministered: 6.96x10^6 CD34+cells/kg,8.18x10^6 CD34+cells/kg and 10.8x10^6CD34+ cells/kg were collected respectivelyin patients receiving 4gr/sqm, 5-6gr/sqmand 7 gr/sqm CTX. The need of hospitalizationin order to receive supportive carewas 1/16 patients (7%) in the first group,6/14 pts (42%) in the second group and14/21 (66%) in the third one. No procedure-relateddeaths were observed. In conclusion,the schedule of CTX 5gr/sqm seemsto exert a sufficient mobilization ofCD34+cells in all patients, no major sideeffects and an acceptable need for supportivecare.P288COLLECTION OF PERIPHERAL BLOODPROGENITOR CELLS: EVALUATIONS TOOPTIMIZE THE CD34 + YIELDG. MARCACCI, S. VOLPE, N. CANTORE, F. CAPONE,R.P. CARRAFIELLO ° , A. VOLPE, E. VOLPEServizio di Ematologia e U.T.I.E. – ServizioImmunotrasfusionale ° Azienda Ospedaliera “S.G.Moscati” – AvellinoIn order to optimize the “timing” of mobilizedperipheral blood CD34 + progenitorcell (PBPC) collection, we evaluated 45 patientsafter mobilizing chemotherapy treatment(14 MM after CTX 7 gr/sqm + G-CSF;23 NHL after CTX + VP16 + G-CSF; 8 AML).The first CD34 + evaluation was performedwhen WBC count was > 800/mmc. In thisfirst day of evaluation, we never performedPBPC apheresis in any case, even if CD34 +>20/µl: in fact, we never observed a CD34 +decrease in the successive day of evaluation.In the second day, we newly evaluatedCD34 + , their absolute count numberand the difference (∆I) between the countof the second day respect to the first day.When ∆I > 2.5, we performed PBPCapheresis, only if a final CD34 + yield > 3 x10 6 /kg was preview (with a theoric estimationreferred to 10 L of processed blood and50% of efficiency). Patients, who didn’tsatisfied this preview goal, were remandedto a third day of evaluation, even if CD34 +count was > 20/µl. Patients with ∆I > 2.5never showed a CD34 + decrease, in the thirdday of evaluation. A total of 34 patientsshowed a ∆I > 2.5 in first evaluation : 10performed PBPC collection in second dayand 24 in third day. Two patients, with ∆I 2.5, satisfing so our timing criteriaand therefore, they performed PBPC collectionin the fourth day. A total of 36 patientsperformed a single PBPC apheresis,with a mean of 7.2 ± 6.2 x 10 6 /kg CD34 +(range 2.2 – 33.9; median 5.9). The 9 patients,with ∆I < 2.5 in all daily evaluations,have performed 2 apheresis each one, witha mean of 1.4 ± 0.4 x 10 6 /kg CD34 + , foreach harvest. By this method of CD34 +evaluation, we performed, in the 45 examinedpatients, a total of 54 PBPC apheresis,with a mean of 1.2 apheresis/patient. Ourdata show that, in adjunct to the absolutenumber of peripheral CD34 + cells, the estimationof ∆I during the CD34 + mobilizing

37 th Congress of the Italian Society of Hematology229program, could represent the main tool tosuggest us on the “timing” to perform anoptimal PBPC collection.P289PERIPHERAL BLOOD PROGENITORCELLS (PBPC) COLLECTION INPATIENTS WITH ACUTE LEUKEMIA:IMPACT OF FLUDARABINE (FAMP)PREVIOUS EXPOSUREM. MONTILLO, A. TEDESCHI, *A. OLIVIERI, R. CAIROLI,*M. MONTANARI °F. FERRARA, A. NOSARI, L. SANTOLERI,*P. LEONI, E. MORRADept of Haematology Niguarda Ca’ Granda HospitalMilan, *University Dept of Haematology TorretteHospital Ancona and °Dept of HaematologyCardarelli Hospital NaplesHigh dose chemotherapy followed by PBPCreinfusion is reported to improve survivalin a wide variety of hematologic malignancies.Some concern was brought forwardabout factors influencing PBPC collectionand among them if purine analogs previousexposure impaires the success of theprocedure is still controversial. In order toinvestigate PBPC collection in patientstreated with FAMP containing regimens foracute leukemia we compared the yield obtainedfrom these patients with others patientswith acute leukemia that did neverreceive purine analogs. Patients of bothgroups had been previously treated withanthracyclines and received G-CSF to mobilizeCD34+ cells. The first group included15 patients, 9 AML and 6 ALL, median agewas 27 years (range 16-56), they receivedFAMP containing regimens as salvagetherapy as 7 patients were in relapse and 8showed a resistant disease. The secondgroup was represented by 19 patients, 7AML and 12 ALL, median age was 36 years(range 18-63), all of them in first completeremission. A successfully collection ofCD34+ >2.5 x10 6 /kg was obtained in 73%of patients treated with FAMP containingregimens and in 63% of patients that didnot received FAMP. The collection characteristicsof both group are shown in the tablebelow:Acute Leukemia patients treated with FAMPCD34+ cells N° pts (%) Dx FAMP mg/sqm (range) N° LK>2.5 x10 6 /kg 11 (73) 300 (150-300) 22.5 x10 6 /kg 12 (63) / 2

230 September 26-29, 1999 - Torino-Lingotto, Italyery after ICE-FLAN-FLAN were not significantlydifferent from those in the previouslycited group treated with ABMT performedafter ICE-NOVIA, without fludarabine. Weconclude that fludarabine-containing regimensseverely impair mobilization and collectionof PBSC in AML patients and seemunsuitable when PBSC autotransplantationis programmed.P291FLUDARABINE (FLUDA) COMBINATIONREGIMEN MAY ADVERSELY AFFECTPERIPHERAL BLOOD STEM CELL(PBSC) HARVESTING AND INFLUENCECD34+ SUBSET COLLECTION.PRELIMINARY DATAand of blood stem cell collections and PBSCtransplantation performed, our preliminarydata seem to be in agreement with previousvery preliminary reports on the role ofFLUDARA in affecting PBSC collection in termsof CD34 + cells. Moreover, it is conceivablethat FLUDARA may play an adverse role alsoon CD34 + CD33 - yields, that might influenceengraftment platelet kinetic in PBSC transplantation.P292PROGENITOR CELL MOBILIZATION,HARVEST AND REINFUSION:FEASIBILITY OF THE PROCEDURE INELDERLY NON-HODGKIN’S LYMPHOMAPATIENTSD. LASZLO, P. GALIENI, M. TOZZI, G. SCALIA, D. RASPADORI,M. BOCCHIA, F. LAURIADept. of Hematology, University of Siena, ItalyFLUDARABINE (FLUDA) based chemotherapyhas shown promising results as first-linetherapy in patients with hematological malignancies.However, some preliminary reportshave focused the attention on thepossibility that this purine analogue mayaffect PBSC yields. We evaluated PBSC collectionfrom 12 consecutive patients, 4 withacute myeloid leukemia (AML) and 8 withlow-grade non Hodgkin lymphoma (LG-NHL), who received FLUDA based chemotherapyregimen before PBSC mobilization.For each collection we evaluatedCD34 + x10 6 /kg cells, CFU-GMx10 4 /kg andCD34 + /CD33 - x10 6 /kg, to distinguish earlystem and multipotent progenitor cells.Among the 4 AML patients, one had an unsuccessfulmobilization, while the other 3patients harvested ³ 3.5 x10 6 /kg CD34 + .Among the 8 LG-NHL, two (25%) had anunsuccessful mobilization, and 5 a suboptimalyield (< 2 x10 6 /kg CD34 + ). CD34 + /CD33 - subset collection was poor both inAML than in LG-NHL patients, with a medianvalue of 0.28 x10 6 /kg, and 0.03 x10 6 /kg, respectively. Patients submitted to PBSCtransplantation, showed a slower kinetic ofplatelets engraftment (+120 d in AML patients,+ 30 d in LG-LNH) when comparedto non-fludarabine treated patients showingsimilar characteristics at mobilizationand receiving the same conditioning regimen.Despite the low number of patientsP. GAVAROTTI, F. ZALLIO, L. BERGUI, D. CARACCIOLO,A. CUTTICA, A. CUCCI, F. GIARETTA, W. TASSI, A. PILERI,C. TARELLADip. Med. Oncol Sperim., Chair of Hematology, andBlood Bank; Az Osp S.Giovanni Battista, TorinoThe use of mobilized peripheral blood progenitorcells (PBPC) has been introduced inthe last decade as a simple procedure forchemoradiotherapy intensification in patientswith non-Hodgkin’s lymphoma (NHL).This strategy is now generally employed inthe management of high-risk NHL patientsaged less than 60-65 yrs. Few data areavailable on the feasibility of PBPC harvestand reinfusion in elderly NHL patients, agedover 60-65 yrs. To address this issue, wehave evaluated the extent of progenitor cellmobilization and the possibility of PBPCcollection and reinfusion in a series of 22NHL pts. aged between 61 and 80 yrs. (median68). Main patient clinical features included:histologic subtypes: Burkitt’s=1,DLCL=10, mantle-cell=3, low grade=8; BMinvolvement=11; high LDH=14; Stage III-IV=19; Performance Status 3-4=18. Mobilizationwas induced by intermediate-dosechemotherapy, consisting of cyclophosphamide4 gr/sqm (16 patients), etoposide 1.5gr/sqm (4 patients) or epirubicin 120 mg/sqm (2 patients). G-CSF (5µgr/kg/day) wasalways given following chemotherapy untilPBPC harvest. PBPC mobilization could beelicited in 18 out of 22 pts. Median peakvalues of circulating CD34+/µL and CFU-GM/ml were 23 (range 4-210) and 1,530(range 450-62,900), respectively. All pa-

37 th Congress of the Italian Society of Hematology231tients could undergo PBPC harvest; a medianof 2 (range 1-3) leukaphereses wereperformed, with a median processing of 9.6blood liters per leukapheresis. No majorcomplication occurred during mobilition andcollection procedures. Median quantity ofharvested progenitor cells per patient was4.7 x 10 6 CD34+/kg (range: 0.3-46) or 16.8x 10 4 CFU-GM/kg (range: 1.6-209). So far,PBPC have been reinfused following an intensifiedchemotherapy in 15 patients, withexcellent tolerability, with the exception ofa fatal pneumonia observeded in a patientwith cerebral NHL. Thus, the use of autologousPBPC is a feasible option in elderlyNHL patients, opening the way to new therapeuticstrategies based on chemotherapyintensification.P293MOBILISATION OF HEMOPOIETICPERIPHERAL BLOOD STEM CELLS INMETASTATIC OSTEOSARCOMAS ANDHIGH RISK BRAIN TUMORSM. BERGER, F. FAGIOLI, R. GHIGNONE, P. ASTARITA,A. AVAGNINA, E. VASSALLO, A. BRACH DEL PREVER,L. BESENZON, E. MADONDepartment of Pediatrics- University of Turin- ItalyIntroduction. Autologous peripheralblood stem cells transplants permits anincrease of radio and chemotherapy in orderto improve antitumor effect of treatment.The aim of our study was to evaluatethe capacity of a single course ofCyclophosfamide and Etoposide plus G-CSFto mobilize hemopoietic stem cells in peripheralblood and to study hemopoieticreconstitution after transplant both in untreatedand heavely chemo-treated patients.Patients and methods. 19 patientswith metastatic osteosarcomas (4 with synchronousand 15 with metachronous metastasis)and 10 with high risk brain tumorwere enrolled in our study. Patients underwenta single course of Cyclofosphamide 4gr/m 2 and Etoposide 200 mg/m 2 for threedays plus G-CSF 10 µg/Kg. Of eachapheresis CD34+ cells, CFU-GM and LTC-IC were assayed.Osteosarcoma patients underwent 2 coursesof Carboplatinum 1.8 gr/m 2 and Etoposide1.5 gr/m 2 over four days while brain tumorpatients received a single course of Thiotepa900 mg/m 2 and Etoposide 1.5 gr/m 2 overthree days. Results. We observed granulocyteengraftment (ANC>500) by day 11(range 7-16) for osteosarcomas and by day12 (range 9-16) for brain tumor patients.Platelets engraftment was reached by day15 (range 7-30) for osteosarcomas and byday 35 (range 16-138) for brain tumor patients.No main differences were observedbetween osteosarcoma patients withsyncronous or metachronous metastasis.Each patient underwent a bone marrowaspirate on day 28 and mononuclear cellswere tested for clonogenic ability.

232 September 26-29, 1999 - Torino-Lingotto, ItalyConclusion. A mobilizing regimen withCyclofosphamide, Etoposide and G-CSF allowsa high yield of CD34+ cells and CFU-GM in each patients, while LTC-IC contentwas lower in brain tumor patient apheresis.Platelet engraftment and LTC-IC content onday 28 after transplant was also slowler inthis latter group of children. This may bedue to a lower dose of LTC-IC infused or toa major bone marrow microenviromentdemage of conditioning regimen. A studyof stromal cella to address this point is inprogress.P294ICE AS CONDITIONING REGIMEN INPBSC TRANSPLANTATION IN HIGH-GRADE NON HODGKIN’S LYMPHOMAA. BOSI, L. RIGACCI, M.P. MARIANI, R. ALTERINI, S. GUIDI,F. I NNOCENTI, R. SACCARDI, F. BERNARDI, A. VANNUCCHI,L. LOMBARDINI, G. BELLESI, P. ROSSI FERRINIHaematology Dept. and BMT Unit of Florence ItalyWe report here the results of high dosechemotherapy with ICE (Ifosfamide 3000mg/m2 -6 –5 –4 -3, Carboplatin 500 mg/m2 -6 –5 –4 , Etoposide 300 mg/m2 –6 –5 -4) in a group of high-grade NHL patients(pts). We have treated 31 pts from 1993to 1997. Clinical characteristics were: female15, male 16; stage I bulky 5, stage II8, stage III-IV 18; 11 with sistemic symptoms;14 pts had mediastinic bulky disease;16 were in first complete remission (CR), 5were in second or third CR, 7 were partialresponders and 3 refractory to chemotherapy.Peripheral blood stem cells weremobilized in all patients with G-CSF 15 µg/Kg for 3-4 days. No treatment-related mortalitywas observed. Nonematologic toxicitywas minimal with 10% of severe mucositis(grade 3 WHO), 2 pts were noted tohave hepatic toxicity (grade 2 WHO). Noother clinically significant toxicities wereobserved. After a median follow-up of 24months (range 3 – 53) overall survival was88%. The only clinical characterictic statisticallysignificant for survival was stage (I-II vs III-IV). After a median follow-up of 21months (range 1 – 51) 23 pts were freedomfrom disease, and disease-free survival(DFS) was 65%. These characteristicswere significantly associated with DFS:presence of bulky disease p .02 (93% vs59%), stage I-II p .004 (100% vs 55%),complete remission at ABMT p .007 (81%vs 60%). We confirm the efficacy of thiscondictioning regimen and its feasibility inan heterogenic group of high-grade nonHodgkin’s lymphoma patients.P295CONSOLIDATION RADIOTHERAPYFOLLOWING HIGH-DOSECHEMOTHERAPY WITH PERIPHERALBLOOD PROGENITOR CELL (PBPC)AUTOGRAFT IN LYMPHOMA PATIENTSG. ROSSI, G CARTIA, D. CARACCIOLO, F. ZALLIO,P. G AVAROTTI, C. TARELLADivisioni Universitarie di Radioterapia e diEmatologia - Dip. Ospedaliero di Oncologia,Az. Osp. S. Giovanni Battista di TorinoThe high-dose sequential (HDS) chemotherapyregimen has been shown to be effectivein the treatment of high-risk non-Hodgkin’s lymphoma (NHL) and Hodgkin’sDisease (HD). The regimen takes advantageof the use of mobilized PBPC for thefinal autograft phase. At the University Divisionof Hematology in Torino, high-riskNHL and relapsed HD patients (pts.) are

37 th Congress of the Italian Society of Hematology233generally managed with either original ormodified HDS. Pts. presenting with bulkydisease or with slowly responsive mass arecandidate to receive consolidation RT within1 to 3 mos. since autograft. RT feasibilityand toxicity was evaluated in 46 patientstreated with HDS + consolidation RT between1994 and 1998. All pts. receivedhigh-dose Mitoxantrone+L-Pam as conditioningregimen and were autografted withlarge quantities of PBPC. Main patient characteristicsincluded: median age 40 yrs.(range: 18-66); M/F=29/17; intermediatehighgrade NHL=33, intermediate-low gradeNHL=10, relapsed HD=3. RT was given to22 pts. with bulky disease, 12 slowly responsivepts., 9 pts. with extranodal disease;RT was also administered to 3 pts.with diffuse, non-bulky abdominal masses.Overall, 19 pts. received involved field (IF)-RT to mediastinum (30.6 Gy for pts. in CRand 36 Gy for pts. in PR). Severe pancytopeniaoccured in 1 patient and impliedRT discontinuance; 4 more pts. had prolongedtrombocytopenia (Plts < 100.000/µL for one year); 2 pulmonary fibrosis alsooccurred. Non mediastinal, IF-RT (11 abdominalfields) was given to 22 more pts.;RT was performed in 2 different sites in 5pts. In all cases, RT could be completedwithout major toxicities. Among pts. withabdominal lymphoma, 10 underwentwhole abdomen irradiation. Severetrombocytopenia occurred in all patientsand implied discontinuance in 9 patients;in 2 patients trombocytopenia was prolonged;one patient died for sepsis duringpersistent severe pancytopenia. In conclusion,our experience points against wholeabdomen RT due to its elevatedhaematological toxicity; by contrast, IF-RT,both to nediastinum and to abdomen,seems feasible with acceptable toxicity. Thisis likely due to the rapid and stable hemopoieticreconstitution following PBPCautograft, further supporting their use inautograft procedures.P296AUTOLOGOUS PERIPHERAL STEMCELLS TRANSPLANTATION IN HEAVILYPRETREATED PATIENTS WITH NONHODGKIN’S LYMPHOMAA.M. MAMUSA, P. CASULA, M.G. CABRAS, P. DESSALVI,G. LUXI, G. BROCCIADivisione di Ematologia, Ospedale Oncologico“A. Businco”, CagliariPurpose: To assess the feasibility and theefficacy of HDS followed by autologous peripheralblood stem cell (PBSC) transplantationin heavily pretreated patients withNon Hodgkin’s Lymphoma (NHL). Patientsand methods: Sixteen patients, (9 maleand 7 female, median age 39 years, range26-60 years) with relapsed (9 patients) orrefractory (7 patients) NHL were referredbetween 1993 and 1998 for PBSC collectionbefore high dose (HD) chemotherapy.Twelve patients had diffuse large cell lymphoma,two had diffuse mixed cell type andtwo had diffuse small cleaved cell type. Thepatients had stage IV disease (n=8), stageIII (n=6) and stage II (n=2). The mediannumber of previous cycles of chemotherapywas 12 (range 4 to 24). The mobilitationprocedure was performed in 2 patients withG-CSF alone, 5 patients received MAD chemotherapyplus G-CSF and 9 received highdose Cyclophosphamide with G-CSF. Conditioningregimen consisted of BEAM (n=6),Bu-Cy (n=2), Mitox-L-PAM ( n=1) and Thio-Tepa-L-PAM. Results: The median numberof apheresis procedures was 2.2 (range 1-5) resulting in a median of 6.6 x 10e6 CD34+ cells/Kg. Hemopoietic reconstitution,blood and platelets transfusions support,infectious complications and overall hospitalizationwere not different from those recordedin patients who performed PBSCtransplantation as first line treatment. Twopatients died for progressive disease aftermobilization of PBSC, 2 did not performedPBSC transplant and 2 are too early forevaluation. Of the remaining 9 patients, 3died for progression of lymphoma at 5, 23and 37 months, 6 achieved a complete responseand are alive at 1, 2, 4, 7, 17 and60 months. Conclusions: Adequate PBSCmobilization can be obtained in heavilypretreated lymphoma patients and HD chemotherapywith autologous PBSC transplantationcan be employed as salvage treatmentfor these patients. However we need

234 September 26-29, 1999 - Torino-Lingotto, Italya much longer follow-up for efficacy valutationof this treatment.P297FEASIBILITY AND PRELIMINARYRESULTS OF A HIGH DOSECHEMOTHERAPY (HDC) WITHAUTOLOGOUS STEM CELLTRANSPLANTATION (ASCT) INELDERLY PATIENTS WITHAGGRESSIVE NON-HODGKIN’SLYMPHOMA (NHL) IN RELAPSEU. VITOLO, P. PREGNO, M. BERTINI, C. BOCCOMINI,B. BOTTO, R. CALVI, R. FREILONE, L. ORSUCCI, A. TONSO,E. GALLOU.O.A. Ematologia, Az. Osp. S.Giovanni Battista,TorinoIntroduction: elderly patients (> 60 yrs)are usually considered not elegible for HDC.However, most of them might tolerate HDCwith age-adjusted protocols. A pilot studyhas been started in patients (pts) with aggressiveNHL to test the feasibility of thistype of therapy. Patients and Methods:the therapeutic scheme includes threephases: A) 2 courses of DHAP (at 75% ofthe total dose); B) intensification with a 2-day course of Mitoxantrone 8 mg/m 2 plushigh-dose cytarabine (HDARAC) 1500 mg/m 2 /12hr plus dexamethasone 4mg/m 2 /12hrand G-CSF 5µg/Kg/d from day +3 to harvestperipheral blood progenitor cells(PBPC); C) ASCT conditioned by BCNU 200mg/m 2 d -6, ARA-C 200 mg/m 2 /12hr plusVP-16 100 mg/m 2 /12hr dd -5→-3,Melphalan 120 mg/m 2 d -2, reinfusion ofat least 8 x 10 6 /Kg CD34+ cells, G-CSF 5µg/Kg from day +1. Since January 1998 sixpts have been enrolled: median age 64 yrs(62-70), 3 with diffuse large cell lymphomas,2 with transformed follicular NHL and1 with mantle cell NHL. Three pts were infirst early relapse (< 12 months), one in2nd and 2 in partial remission. Five pts werepreviuosly treated with antracycline containingregimens. All pts, at time of relapse,had advanced disease, 4 were at intermediate-highor high risk IPI. Results: anadequate PBPC yield was obtained in all ptswith a median of 14 x 10 6 /Kg CD34+ cells(range 8.6-22) and 52.7 x 10 4 /Kg CFU-GM(range 21-109). All pts were autografted.The median times to achieve engraftmentwere: 10 days (8-14) to neutrophils >0.5 x10 9 /L and 11 dd (9-15) to platelets >10 9 /L. Only one patient suffered from severetoxicities (pulmonary aspergillosis and PTE).No other toxicities (WHO >1) were recorded.Five pts achieved a CR and one,with mantle NHL, a PR. One relapsed anddied of progressive CNS lymphoma. Conclusions:these preliminary results suggestthat also in elderly pretreated pts a goodPBPC yield is achieavable after an intensifiedchemotherapy with Mitoxantrone andHDARAC. This allows an ASCT with an ageadjustedBEAM regimen that is feasible andeffective with low toxicity.P298CHEMOSENSITIVITY IS THESTRONGEST PREDICTOR OFAUTOTRANSPLANT EFFICACY INPATIENTS WITH RESISTANT,RELAPSING OR TRANSFORMEDAGGRESSIVE NON-HODGKINLYMPHOMAS. CORTELAZZO, F. LUSSANA, A. ROSSI, M. GHIELMINI,E. OLDANI, V. GOTTARDI, F. BENEDETTI, M. CANTINI,U. VITOLO, E. POGLIANI, G. ROSSI, R. ZAMBELLO,F. RODEGHIERO, F. CAVALLI, T. BARBUIEmatologia, Ospedali Riuniti, Bergamo; Cattedra diEmatologia, Università di Verona; U.O.A.Ematologia, Dipartimento di Oncologia,Torino;Ematologia, Ospedale S.Gerardo, Monza; 3°Medicina, Ospedali Civili di Brescia; Ematologia,Ospedale di Vicenza, Italy, and Div. di OncologiaMedica, Istituto Oncologico della Svizzera ItalianaPurpose: To investigate the role of differentfactors in predicting the outcome ofa large series of patients with resistant,relapsing or transformed (RRT) aggressivenon-Hodgkin lymphoma (NHL) who weretreated with high dose chemotherapy(HDCT) and autologous hemopoietic stemcell transplantation (ASCT). Patients andMethods: Since September 1986 to July1998 120 patients (median age 46, range16-65 years) from 6 Italian and 1 Swisscenters with resistant (n=32), relapsing(n=71) or transformed (n=19) large celllymphoma (DLCL) were consecutivelytreated with high-dose sequential therapy(HDS) (Gianni et al,1997) (n=76), or DHAPor other salvage chemotherapy (n=44),followed by ASCT conditioned with BEAM

37 th Congress of the Italian Society of Hematology235(n=59) or high dose melphalan andmitoxantrone (HDMM) (n=61). Results:The 100-day mortality was 5%. Sixty-fivepatients (54%) achieved complete remissionafter ASCT. Probabilities of overall survival(OS) and disease-free survival (DFS)at 3 years were 32 and 41 %, respectively.The following prognostic factors were examined:age, IPI, HDS vs DHAP, BEAM vsHDMM, number of previous treatments,bulky disease, B symptoms, bone marrowinvolvement, chemosensitivity to salvagetreatment before transplantation. Cox multivariateanalysis showed that chemosensitivitywas the strongest survival predictorfollowed by B symptoms and bone marrowinvolvement. Conclusion: This analysisconfirms that a proportion of RRT DLCLpatients responds to salvage treatment includingHDS or other conventional protocols.Moreover, HDCT supported by ASCT isassociated with a long term DFS in about40% of patients, especially in those withchemosensitive disease. From these datait is not clear whether HDS offers an advantageover conventional treatment assalvage therapy. Thus, to further enhancethe cure rate of these bad risk NHL patientsa search for new and more effectivepretransplant salvage programs is warranted.P299OVERWEIGHT HAS AN ADVERSEPROGNOSTIC IMPACT IN HIGH-DOSECHEMOTHERAPY AND AUTOGRAFTPROGRAMS FOR NON-HODGKIN’SLYMPHOMA PATIENTSC. TARELLA, D. CARACCIOLO, P. GAVAROTTI, C. ARGENTINO,F. ZALLIO, P. CORRADINI, D. NOVERO^, C. MAGNANI°,A. PILERIDipartimento di Medicina e Oncologia Sperimentale,Div. Univ. di Ematologia; ^Anatomia IstologiaPatologica II; °Epidemiologia dei Tumori.Az. Osped. S.Giovanni Battista di TorinoIntensive chemotherapy with autograft isnow widely employed in high-risk non-Hodgkin’s lymphoma (NHL). Despite detailedevaluation of disease-associatedprognostic factors, no information is availableon overweight impact in autograft programs.To determine whether overweighthas prognostic value for NHL patients receivingintensive chemotherapy with autograft,a retrospective review was performedon 121 NHL patients treated withhigh-dose sequential (HDS) chemotherapyincluding peripheral blood progenitor cell(PBPC) autograft. All patients presentedwith high-risk prognostic features, they receivedHDS either at disease onset (92 patients)or at disease recurrence (29 patients).Body mass index (BMI) was calculatedas weight in kilograms divided by thesquare of the height in meters; overweightwas defined as BMI ≥ 28. With a medianfollow-up of 3 years, the estimated 9-yearOS and EFS for the entire group were 58%and 49%, respectively. 28 patients (23%)had BMI ≥ 28. Their median OS and EFSwere 2.2 and 1.4 years, respectively,whereas median OS and EFS for the referencegroup have not been reached, with a9-year projection of 65% and 55%, respectively(p

236 September 26-29, 1999 - Torino-Lingotto, ItalySince February 1997, 29 MM patients (16males, 13 females), median age 54 years(range 38-68) received autologous peripheralblood stem cells transplantation, aftera conditioning regimen with Idarubicin (21mg/m 2 i.v. c.i. on days -9 to -8) + Busulphan(4mg/kg oral on days -5 to -2) + Melphalan(60 mg/m 2 i.v. on day -1). The median numberof CD 34+ cells reinfused was 3.27(range 1.17-13.1) x 10 6 /kg. After SCreinfusion all patients received rhG-CSF(5mcg/kg/sc/d) until neutrophil recovery.A part conventional supportive measuresduring cytopenia all patients were givensterilized baby-foods. All pts engrafted. Themedian time to recovery of neutrophils (>0.5 x 10 9 /l) and of platelets (> 20 x 10 9 /l)was 11 days (range 9-17) and 12 days(range 7-271) respectively. During neutropenia28/29 pts presented fever with 19documented sepses. Major extrahaematologicaltoxicity was gastrointestinal:all pts experienced severe mucositisrequiring opioid therapy in most of them;but in only 7 pts total parenteral nutritionwas necessary. Mucositis resolved at thetime of haemopoietic reconstitution. Onepatient died on day +24 due to pneumoniaof unknown etiology. The median time fromthe beginning of conditioning and dischargefrom the hospital was 24 days (range 20-29). Our experience suggests that the combinationof Idarubicin/Busulphan/Melphalanappears a promising alternative regimen forPBSCT in multiple myeloma. The transplantrelatedtoxicity was accettable, and hematologicalrecovery was fast both for granulocytesand platelets. Long term efficacy isunder evaluation.P301HIGH-DOSE MELPHALAN INASSOCIATION WITH BCNU ANDETOPOSIDE FOR AUTOLOGOUSPERIPHERAL BLOOD STEM CELL(PBSC) TRANSPLANTATION INMULTIPLE MYELOMA (MM)females) with MM underwent autologousperipheral blood stem cell (PBSC) transplantationat our Center within the period January1995 to January 1998. Six patients werein stage IA, 15 in stage IIA and 4 in stageIIIA. The preparative regimen was the following:BCNU 600mg/m 2 intravenously(i.v.) on day -4, Etoposide 1500mg//m 2i.v. on day -3 and MEL 200mg/m 2 i.v. onday -2. The median time elapsed from diagnosisto PBSC collection was 445 days(range 24-2967). In all patients PBSC mobilizationwas carried out with high doseCyclophosphamide 4g/m 2 i.v. followed byG-CSF 5µg/kg subcutaneosly forty-eighthours later. The median number ofapheresis procedures per patient was 2.0(range 1-6). At the time of the transplant 2patients were in CR, 8 in PR, 4 with minimalresponse, 6 in no change and 5 withprogressive disease. The median time fromdiagnosis to autologous PBSC infusion was552 days (range 181-3116). The meannumber of mononuclear cell was 7.05x10 8 /kg (range 2.5-18.7), that of CD34 positivecells was 8.73x10 6 /kg (range 3.9-19.8) andthat of CFU-GM was 45.95x10 4 /kg (range14.7-99.0). Engraftment occurred in allpatients after a median time of 14 days(range 10-23). Nineteen patients sufferedfrom mucositis, it was of WHO grade I in11 cases and of WHO grade II in 8. Duringthe period of pancytopenia 22 patients developedacute febrile episodes. A sepsis wasseen in 5 patients, a pneumonitis in 4 anda parotitis in 2. One patient died of infectivecomplication. A reduction of DLCO wasnoted in 11 patients. After discharge a viralinfection was observed in 10 cases (3positive Citomegalovirus antigenemias and7 Herpes Zoster). Six patients were in CR,6 in PR, 11 in a plateau phase and 1 inprogression at day +100 posttransplant.After a median follow-up of 851 days(range 264-1522) 17 patients are alive, 2in RC, 8 in a plateau phase and 7 in progression.The median response duration(CR+PR) was 526 days (range 60-1175).Ourpreparative regimen induced a response in56% of cases with active disease.P. BERNASCONI, E.P. ALESSANDRINO, A. COLOMBO, D. CALDERA,M. BONFICHI, G. MARTINELLI, L. MALCOVATI, M. VARETTONI,M. MAIOCCHI, E. BRUSAMOLINO, G. PAGNUCCO, C. CASTAGNOLA,A. CORSO, C. BERNASCONIIstituto di Ematologia, Università di Pavia, PoliclinicoSan Matteo, PaviaTwenty-five patients (12 males and 13

37 th Congress of the Italian Society of Hematology237P302BUSULFAN AND MELPHALAN ASCONDITIONING REGIMEN FOR ABMTIN AMLM. TOZZI, P. GALIENI, D. LASZLO, G. SCALIA, A. BUCALOSSI,F. LAURIADept. of Haematology, University of SienaMelphalan (M) is an alkylant agent with awell-known dose-response effect inthe treatment of solid tumors andhaematological disorders. However only alimited experience with high dose M in childhoodacute leukemias has been reportedand the association M+TBI has shown themost promising results. From July 96 toOctober 98, 9 patients (pts) with AML underwentABMT at our Institution with a conditioningregimen including M (140 mg/mq)and Busulfan (Bu) (16 mg/kg in pts 60 yearsold). As rescue, seven pts received PBSCand two pts BM. Four pts were males and 5pts females, with a median age of 51 years(range 17-68). Three pts were >60 yearsold. Seven pts had a “de novo” AML, while2 pts a secondary AML. Five pts had a normalkariotype, one had a t(8;21), one hada inv16 and 2 pts had a complex kariotype.A median of 2.5 x10 6 /kg CD34+ cells wasreinfused. As major extra-haematologictreatment-related toxicity 9/9 pts developeda mucositis episode, which was severe(grade III WHO) only in two of them. Themedian time for neutrophil recovery was19 days (range 16-32) while for plateletwas 32 days (range 17-117). All 3 pts >60years old behaved as younger patients interms of toxicity and haematologic recovery.Overall, 3/9 pts relapsed at + 44, +111,+284 respectively and died, while the remaining6 pts are alive and relapse-free witha median follow-up of 14 months. In conclusion,the association M+Bu appears tobe a safe conditioning treatment for AMLpts undergoing ABMT, also in elderly. However,short follow-up and the small numberof pts included in our study don’t allow anyconclusive evaluation of the antileukemiceffect of this high-dose regimen.P303LATE RELAPSE AFTER AUTOLOGOUSBONE MARROW TRANSPLANTATION INACUTE MYELOID LEUKEMIA (AML)C. ANNALORO, V. G. BERTOLLI, A. DELLA VOLPE, D. SOLIGO,E. TAGLIAFERRI, G. LAMBERTENGHI DELILIERSCentro Trapianti di Midollo and Istituto di ScienzeMediche, Ospedale Maggiore IRCCS and Universitàdegli Studi di MilanoOver the last eleven years, we haveautografted 34 AML patients (17 male, 17female: median age 44 years, range 20-57) with unpurged bone marrow as lateintensification of first CR. Previous treatmentshad been an idarubicin-based protocolin nineteen, other idarubicin protocolsin ten and a daunorubicin-based protocolin five patients. The conditioning regimenincluded HD-Ara-C, HD-CTX and 10Gy fractionated TBI. As of April 1999, themedian follow-up of the censored patientswas 95 months (range 12-132); 11 patientshad relapsed 6-64 months (median 12) afterautologous bone marrow transplantation(BMT), three had died during CR 6-12months after autologous BMT, and 20 werealive and in CCR. Nine relapses occurredwithin 18 months. One male AML-M1 patientin the daunorubicin group relapsed 64months after autologous BMT. His posttransplantoutcome had been characterizedby delayed platelet recovery (he becametransfusion-independent on day +431), butthe subsequent course was uncomplicateduntil he experienced isolated bone marrowrelapse. One AML-M1 female patient in thedaunorubicin group relapsed 36 monthsafter autologous BMT; she had achievedneutrophil and platelet recovery on day +28and +31, respectively and her post-transplantoutcome had been uncomplicated untilisolated bone marrow relapse. Late AMLrelapses after autologous BMT are infrequentlyobserved and are still the matterof occasional reports. In many cases, therelapse is attributable to the extramedullarypersistence of leukemic cells. The findingof two cases of late isolated bone marrowrelapse in such a small series as this isparticularly uncommon, and no relevantelements could be found in the follow-upof either case. The former experienced avery late platelet recovery, but the long timeinterval before relapse seems to rule outany association between the two phenom-

238 September 26-29, 1999 - Torino-Lingotto, Italyena. Both of the late relapses occurred inthe small daunorubicin group, and so a lessintensive antileukemic activity favouring thelong-term persistence of disease. could besuspected.P304HIGH FREQUENCY OFEXTRAMEDULLARY RELAPSE INPATIENTS TRANSPLANTED FOR ACUTEMYELOID LEUKEMIAL. PEZZULLO, G. DE ROSA, A. LUCANIA, C. SELLERI,B. ROTOLIDepartment of Hematology, Federico II University,Medical School, Naples, ItalyExtramedullary localizations (EM) of acutemyeloid leukemia (AML) are infrequent atdiagnosis and difficult to eradicate with conventionalsystemic chemotherapy (CHT).Aim of the study was to evaluate frequencyof EM relapse in patients < 65 years treatedwith CHT alone in comparison with transplantedpatients (either allogeneic orautoBMT ). Two cohorts of patients weresufficiently similar for age and treatmentprotocol. The CHT group (historical control)was composed by 101 patients treated whenBMT was not a routinary approach, medianage 47y, range 12-65. All transplanted patientswere conditioned with BuCy2; 35underwent alloBMT and 25 autoBMT ( medianage 39y, range 10-65). In the BMTgroup 22/60 patients relapsed ( 12/35alloBMT and 10/25 autoBMT); of them, 15(68%) were hematological and 7(32%) EM;in the CHT group 47/101 patients relapsed;of them, 43 (91%) hematological and4(9%) EM (p= 0.01). Of the 7 EM relapsesoccurred in the BMT group, 4 were registeredin the alloBMT group and 3 in theautoBMT group. The higher frequency of EMrelapses in AML transplanted patients isprobably due to insufficient eradication bythe conditioning regimen (sanctuary sites?).This hypothesis is supported by the absenceof difference in terms of EM relapsesbetween alloBMT and autoBMT. New conditioningregimens with drugs having a greatertropism for sanctuary sites are required.P305MOBILIZATION ANDTRANSPLANTATION OF PBSC IN 32PATIENTS WITH HIGH-RISK ORMETASTATIC BREAST CANCERC. PATTI, M. CUSIMANO, A. INDOVINA, A. TRAINA,F. VERDERAME, A. SANTORO, R. SCIMÈ, A.M. CAVALLARO,V. LEONARDI, P. CATANIA, S. CANNELLA, L. CASCIO,R. MARCENÒ, I. MAJOLINO, B. AGOSTARADiv. Hematology and BMT Unit, Osp.V.Cervello andDiv. Oncology, Osp. M.Ascoli, Palermo, Osp. CiviliRiuniti Sciacca ItalyTwenty-three patients (pts) with high riskbreast cancer (median N+ 15, range 8-26)and 9 with metastatic disease (6 ≥ 2nd relapse,3 Ist Rel ) were included in a programof autologous PBSC transplantation.At mobilization, median age was 44 yrs (24-59). PBSC mobilization was achieved withFEC100 in 18 pts, VP16 2 g/sqm in 2 pts,Epirubicina 120-150 mg/sqm in 7 pts, Cyclophosphamide(Cy) 2.4-4g/sqm in 5 pts.Chemotherapy (CT) was always followed byG-CSF 5-10 µg/Kg. In a single patient withan heavily pre-treated metastatic diseasePBSC mobilization failed and bone marrowwas harvested. The mean peak of circulatingCD34+ cells was 134.4 ± 118 x 10e6/L. Mobilization and PBSC collections weremade outpatiently . Mean CD34+ cells collectedwas 9.17 ± 6.8 x 10e6/Kg with amedian of two aphereses. Twenty-eight ptshave been transplanted, 20 with high-riskand 8 with metastatic disease. Three out of8 metastatic pts underwent a double transplant.A complete engraftment was observedin all pts (median time to ANC >0.5 and Platelets > 25x 10E/L , 10 and 11days respectively). After transplant, gradeI-II mucositis and grade II-III nausea/vomiting(WHO) occurred in almost all cases,with a median of 2 febrile days and 20 dayshospital stay. Transfusional support consistedof 1 (0-4) RBC and 1 (0-5) apheresesplatelet unit. No death from treatment relatedcomplications occurred. After transplant,7 metastatic pts are evaluable forresponse: 5 obtained a CR, 1 a VGPR and1 showed no response, DFS and OS were28% and 42% at median FU 16 months (7-39) respectively. Among high risk pts atdiagnosis only 1 relapsed after 9 months(DFS is 95% and OS 100% after medianFU 17 months [1-25]). In conclusion ourdata show that high-dose CT followed by

37 th Congress of the Italian Society of Hematology239PBSC rescue is devoided of toxicity. Currentlyresults are encouraging in high riskpts and in I relapse, while metastatic diseasein > 2 nd relapse can hardly be curedby high dose therapy.P306HIGH-DOSE TREATMENT WITHAUTOLOGOUS STEM CELL SUPPORT INTHE ADJUVANT THERAPY OF NODE-POSITIVE BREAST CANCER PATIENTA. GEROMIN, F. PATRIARCA, R. FANIN, D. DAMIANI,M. CERNO, A. SPEROTTO, L. CLOCHIATTI, C. SACCO,G. CARTEI, M. BACCARANIDivision of Haematology and Departement of BoneMarrow Transplantation, Udine University Hospital,P.zale S. Maria della Misericordia, UdineThe role of autologous stem cell transplantation(ASCT) is under investigation inthe setting of the adjuvant treatment ofbreast cancer. In our Centre 29 node-positivepatients underwent 4 FEC (Fluorouracil,Epirubicin, Cyclophosphamide) cyclesand a collection of peripheral blood stemcells (PBSC) primed by G-CSF, if 4 to 9 axillarynodes were positive (standard-riskarm); if >9 nodes were involved (high-riskarm), the patients were started on a collectionof PBSC primed by Cyclophosphamide(CTX) and G-CSF and then 8g/m 2Methotrexate plus Vincristine and 2 cyclesof Epirubicin. The conditioning regimen consistedof Thiotepa with either Melphalan(high-risk arm) or CTX (standard-risk arm).Median age was 47 years (30-56) and mediantime between diagnosis and ASCT was7 months (4-15). Cytocheratin-positive cellswere detected by cytofluorimetric tecniquein the leukaphereses of 4/29 (14%) patientsand positive selection was performed beforereinfusion. Median time to neutrophil(>1x10 9 /L) and platelets ( 98%).Twenty-five pts achieved the requiredCD34+ cell number (4.0 – 17.0 x 10 6 /kg;median 9.35) with 1-6 aphereses (median2). Three pts did not achieve the target ofCD34+ cell number (1.29, 1.65 and 2.41 x10 6 /kg): two received only 1 course ofHDEC (in the first pt a bone marrow harvestwas added), one presented progressivedisease before HDEC. Until now 17 ptshave undergone 2 courses of HD-CT and 6cases 1 cycle, for a total of 40 courses; in 4cases the first transplant is ongoing. Conditioningregimen was well tolerated, alsoin the case of second transplant. Mediantime to ANC>500 and PLT>25000 was respectively10 days (7-14) and 11 days (8-14). Neither renal nor hepatic toxicity wasregistered; mucositis g. I was observed in

240 September 26-29, 1999 - Torino-Lingotto, Italy11 pts, g.II in 7. Three pts with mts at diagnosisare alive in CR at 15 and 31 mofrom diagnosis, 2 is alive in PR and 4 arealive with disease. Fiveteen of 19 cases withmetachronous mts are alive (8 CR, 6 withdisease, 2 lost follow-up). Preliminary dataof the present study show that a singlecourse of CTX and VP16 allows the collectionof an adequate number of PBSC fortwo transplants, even in a subset of heavilypretreated pts. The conditioning regimenwith Carboplatin and VP16 is well toleratedwith mild toxicity, which is not increasedafter the second megatherapy course. Withthe limits of the small number of cases andthe short follow-up, this approach might bepromising in the treatment of pts with poorrisk of osteosarcoma, who currently arenot cured by conventional regimens.

37 th Congress of the Italian Society of Hematology241MYELODISPLASIAAND CHRONIC MYELOCITICLEUKEMIAP308COEXISTENCE OF CHRONICLYMPOCYTIC LEUKEMIA AND CHRONICMYELOID LEUKEMIA IN THE SAMEPATIENTV. TINI°, C. ANDRIZZI°, F. LO COCO*, G. CIMINO*,M. MONTANARO°°ASL Viterbo - P.O. di Montefiascone. U.O. diEmatologia; *Dipartimento di Biotecnologie Cellularied Ematologia-Università “La Sapienza”, RomaWe describe here a case of CML that supervenedsix months after the diagnosis ofCLL. There are few reports about the coexistenceof the two diseases in the samepatient; generally, CML is metachronous toCLL and is believed as therapy-related. L.A.,M, 65, was visited because lymphocytosis:WBC were 14.7x10 9 /l (PMN 3.01x10 9 /l,Lymphocytes 11.050x10 9 /l, Monocytes 1.47x10 9 /l). Many ruptured cells were presentin the blood smear. Clinical examinationshowed enlargement of the axillary andneck lymph nodes and hepatomegaly, butnot splenomegaly.The serum LDH was inthe normal range. Immunological analysisof the peripheral blood lymphocytes showeda majority of cells CD19/CD5 and CD23positive, CD 22 negative, restricted for lightchain of the l type. Six months later, theWBC rose to 90x 10 9 /l; 53x10 9 /l were myeloidcells with the typical morphology ofCML. The LDH rose upper the normal limits.The histological examination of a bonemarrow biopsy showed the expansion of themyeloid compartment and the nodular infiltrationby lymphoid cells CD20 positive.The cytogenetic examination of the bonemarrow showed the t(9,22)(q34;q11) in the100% of the metaphases. The transcriptBCR/ABL (both p190 and p210 type) wasdemonstrated by RT-PCR; Southern Blotanalysis already revealed the rearrangementof the JH region of the gene codingfor immunoglobulin heavy chain. We startedthe treatment of CML with Hydroxyurea,2000 mg/die; we observed, in the followingweeks, the hematological remission ofthe myeloid component and the persistenceof the lymphocytosis. The interest of ourcase lies a) in the lack of any previous chemotherapyfor CLL and b) in the nearly simultaneousoccurrence of the two leukemias.A putative acquired stem cell abnormalitycould be demonstrated or excludedby the separation of the two cell populationsand by performing in both the geneanalysis.P309FAMILIAL CHRONIC MYELOIDLEUKEMIAL. LUCIANO, D. PARENTE, A. FEBBRARO, P. DELLA CIOPPA,F. PANEHematology Department, Federico II University,Naples; Hematology Service, FatebenefratelliHospital, Benevento, ItalySome chronic myeloproliferative disorderssuch as essential thrombocythemia andpolycythemia vera may occasionally showfamilial occurrence; familiar forms of chronicmyeloid leukemia (CML) are extremelyrare.We describe here a case of CML in twosiblings. In April ’92 a 64 year old womanwas diagnosed as Ph+ bcr/abl + CML andstarted αIFN therapy. In June ’92 sheachieved hematological complete remissionand in November ’92 a cytogenetic majorresponse. At present, she is in hematologicaland cytogenetic remission in maintenancetherapy. The 58 year old patient’sbrother received diagnosis of CML in May’94. He started αIFN therapy and achievedhematological complete remission in August’94 and a major cytogenetic response inJanuary ’95. The patient is still in hematologicaland cytogenetic remission with αIFNmaintenance therapy. Family history showsthat the mother and one sister died of ovaricneoplasia and two brothers forhepatocarcinoma. HLA analysis performedin the two patients did not show identity .There is in literature only one case of familialmultigenerational CML (Lillicrap DA,Sterndale H. Familial chronic myeloid leukemia.Lancet 1984; ii:699). In our casethe family history suggests an inherited tendencyto neoplasia. It is possible that amutation in a DNA repair gene could be aninitiating step for a cascade of multipledownstream mutations in tumor suppressoror proto-onco genes, as in other familialmalignancies. We are performing molecularstudies in the attempt of clarifyingthis issue.

242 September 26-29, 1999 - Torino-Lingotto, ItalyP310EXTRAMEDULLARY BLAST CRISIS OFCHRONIC MYELOID LEUKEMIAL. LUCIANO, P. DELLA CIOPPA, A.M. RISITANO, F. CHIURAZZI,*F. FAZIOLI, B. ROTOLIDepartments of Hematology and *Orthopedics,Federico II University, NaplesExtramedullary blastic crisis of chronicmyeloid leukemia (CML) is a rare event (almost4% of blastic crises). The most frequentsites involved are lymph nodes. Wedescribe here a case of extramedullary blasticcrisis of CML in the bone, with subsequentbone marrow involvement. In April’94 a 56 year old woman was diagnosed asPh+ bcr/abl+ CML and started αIFN + lowdose ARA-C therapy. The patient achievedcomplete hematological remission withmajor cytogenetic response. From June ’95to June ’98 molecular analysis showed minimalresidual disease only. In February ’99,in complete hematological remission, thepatient complained of bone pain, localizedin the right arm. Conventional X ray showeda right humerus metadiaphysial fracture. Afine needle aspiration revealed myeloidblast cells. Calcemia and serum alkalinephosphatase levels were high. The patientunderwent an operation of endomedullaryreduction and started local radiotherapy. InApril ’99 the patient developed a mass onthe anterior side of the second right rib thatshowed myeloid blast cells by fine needleaspiration. Bone marrow aspiration revealedthe presence of CD34+ CD7+ CD13+CD33+ CD117+ CD36+ CD61+ CD11b+blast cells (53%), suggesting M7 type. Thepatient is having a good response to chemotherapywith VP16, Mitoxantrone andARA-C. Special features of this case are theinvasive blastic transformation in a patientwith initial excellent response to αIFN, andthe tendency to mieloma-like osteolytic lesions.P311SECONDARY MALIGNANT NEOPLASMSUBSEQUENT TO CHRONICMYELOPROLIFERATIVE DISORDERS (MD)D. TEBALA♦, B. MARTINO‡, F. RONCO‡, C. CARIDI♦,D. PRINCI♦, °°F. TOMA, °°G. BRANCATI,°°R. CURIA,F. NOBILE‡, P. IACOPINOCentro Trapianti Midollo Osseo, DivisioneEmatologia‡, Registro Tumori♦,°°AssessoratoRegionale alla Sanità, Reggio CalabriaSecondary neoplasms, particularly acuteleukemia, are well-known complications inpatients with polycythaemia vera (PV), essentialthrombocythaemia (TE) or idiopathicmyelofibrosis (IMF). Furthermore, it is wellestablished that treatment with cytotoxicagents is associated with an increased riskof secondary neoplasm. Consequently, weare aiming at minimizing the use ofmyelosuppressive therapy. In this study weevaluate the results of our strategic approachcomparing the incidence of secondaryneoplasm in 308 patients (93 PV, 116TE, 99 IMF) with that of normal subjectsliving in the same area. To estimate the riskof secondary neoplasm, the number of person-yearof observation was compiled forsubgroups of the cohort defined by age, sexand disease. Rate of incidence of cancer andleukemia (resulted from Registro Tumori)were used to calculate the expected numberof cases. The number of person-yearsat risk was calculated from the date of diseaseuntil the date of last contact, death,diagnosis of a new cancer, or completion ofthe study, whichever occurred first. Themedian duration of follow-up was 4.1 years(range 0.2-36.8). Treatment consisted ofradiation or/plus alkilating agents in 43.9percent of the patients. Secondary neoplasmdeveloped in 29 patients: 12 hadsolid cancers, 16 had acute leukemia, and1 had non-Hodgkin’s lymphoma. There weresignificantly elevated incidence rate of allneoplasm combined and of leukemia in MDpatients as compared with that of normalsubjects (5.01 vs. 1.46 and 2.88 vs. 0.07,respectively). The cumulative incidence ofany secondary neoplasm was 30.7% at 20years. A half of this risk was due to acuteleukemia (15.7 percent). The cumulativeincidence of acute leukemia was highest inIMF patients (37.1% at 20 years), whereasit was lowest in ET (1.7%). PV had an intermediaterisk of developing acute leuke-

37 th Congress of the Italian Society of Hematology243mia (10.5%). Finally, the cumulative risksof secondary neoplasm and acute leukemia(at 10 years) were not correlated with treatments.In conclusion, our data confirm theincreased incidence of nonhematologicalmalignancies and acute leukemia in theseMD and suggest that modern therapeuticapproach can reduce the risk of secondaryneoplasm due to the therapy.Supported by AIL, Regione Calabria and UEP312BLASTIC TRANSFORMATION OFPh - NEGATIVE CHRONICMYELOPROLIFERATIVE DISEASESI. ATTOLICO, A. RICCO, G. SPECCHIA, D. PASTORE, P. CARLUCCIO,M. LAMACCHIA, F. ALBANO, D. MININNI, V. LISOHematology - University of Bari - ItalyChronic myeloproliferative diseases(CMPD) are clonal disorders of a pluripotenthemopoietic stem cell. The tendencyto evolve into Acute Leukemia is a wellknowncharacteristic of Chronic MyeloidLeukemia, unlike Ph negative chronic myeloproliferativedisorders. Although this tendencyis considered as a part of the naturalhistory of the disease, it clearly increasesafter the administration of cytotoxic agents.Acute transformation is usually of myeloidphenotype, whereas acute lymphoid leukemiais seldom observed. Acute leukemiasfollowing Ph- CMPD are characterized byabrupt onset in most cases, by poor prognosisand a marked predominance of themyeloid phenotype. Aim of the presentstudy was to analyze blastic transformationoccurring during Ph- CMPD. We considered346 patients affected by CMPD (216ET, 43 PV, 82 MF, 5 atypical CML), all Phnegative and BCR-ABL negative and weanalyzed the clinical and hematologicalcharacteristics of 29 (8%) patients, 19males and 10 females (6 ET, 1 PV, 20 MF, 2atypical CML), who developed blastic transformation;median age at diagnosis was 63years (range 41 - 82). All patients weretreated with hydroxyurea (5HU) during thechronic phase. Acute transformation occurredafter 10 to 166 months from diagnosis(median interval 31 months). The diagnosisat evolution was in all cases acutemyeloid leukemia (1 M0, 2 M1, 19 M2, 4M4, 1 M5, 2 M7, according to the FAB criteria).Molecular analysis revealed persistentnegativity of the BCR-ABL transcript .Thepatients received different cytotoxic treatmentsaccording to their performance status,cardiac, renal and hepatic function (12with 5HU and 6MP, 9 with VP16 and 6TG, 4with Mitox and Ara-C standard doses, 4 withAra-C at standard doses alone). In all patientsthe disease stabilized for a fewmonths after chemotherapy but no conversionto chronic phase was observed. Afterevolution, overall survival was 3 months(range 1-16 months). Blastic transformationin Ph- CMPD seems to be a less frequentevent than in CML, poorly responsiveto therapy, with a worse prognosis.P313IFN AND ORAL FORMULATION OFLDAC (YNKO1) IN CML: PRELIMINARYRESULTS OF A ICSG ON CMLPROTOCOLG. ROSTI, F. BONIFAZI, E. TRABACCHI, A. DE VIVO ON BEHALFOF THE ICSG ON CMLInstitute og Haematology and Clinical Oncology“Seràgnoli” Institute, University of BolognaRationale: Currently the golden standardtreatment of chronic myeloid leukemia(CML) in first chronic phase (CP) isbased on Interferon-a (IFN) associated withlow dose Ara-C (LDAC). A phase II, singlearm, clinical protocol based on the associationof IFN and a new oral formulationof LDAC (YNKO1) has been performed bythe Italian Cooperative Study Group (ICSG)on CML. In a 12 months period (1/98- 1/99), 91 pts with a newly diagnosed Ph+,first CP CML have been enrolled: they receiveda combination of IFN (3 IMU/sm forthe first week up to 5 IMU/sm from secondweek onward) and YNKO1 (600 mg/daily/14 days monthly for 12 months; dosagewas adjusted according to toleranceand hematological toxicity + 300 mg,maximum dose 1200 mg/daily). Patients:Gender distribution was 44/47 males andfemales respectively; the mean age was50 ys (extr. 22-71) and the Sokal risk distributionout of 74 evaluable pts was 29(40%), 34 (47%) and 11 (23%) pts forthe low, intermediate and high group respectively.Results: Currently 63 pts areevaluable for hematological response (HR)at 3 months: 40 pts (63%) were in com-

244 September 26-29, 1999 - Torino-Lingotto, Italyplete HR, 12 (18%) in partial/no HR and11 (18%) went off protocol for BMT (2),toxicity (3), refusal (3) or other reasons(3). As far as the cytogenetic response,scored accordingly to the ICSG on CMLcriteria, within 6 months, 8 pts (22% ofthe evaluable) showed a minimal response(Ph negative metaphases: 1-32%), 13 pts(33%) a minor response (Ph neg: 33-65%)and 6 (15%) pts a major or complete response(Ph neg: 66-100%). More comprehensivedata on the hematological andcytogenetic response as well as toxicity willbe presented.P314AUTOLOGOUS BONE MARROWTRANSPLANTATION IN CML AFTER INVIVO PURGING WITH INTERFERON:BOLOGNA EXPERIENCEF. BONIFAZI, G. ROSTI, C. CELLINI, E. TRABACCHI, A. DE VIVO,G. MARTINELLI, N. TESTONI, S. TURAInstitute of Haematology and Clinical Oncology“Seràgnoli” Institute, University of BolognaTen patients received an autologous bonemarrow transplantation (ABMT) after an invivo purging with recombinant interferona(IFN). The patients were all low Sokal risk,aged medianly 41 years (extr. 21-53); theyhave been referred to our Institution betweenMarch 19991 and December 1995Details about IFN course, bone marrow harvestand hematological recovery after highdose busulfan (16 mg/kg total dose) andmelphalan (60 mg/ sm) are presented below.IFN was resumed medianly after 5.5 monthsfrom ABMT (range: 2-15): the fixed dosagewas 3 IMU/TIW. CYTOGENETIC RE-SPONSE (CR): 7/10 patients were in completeor major CR (66-100% Ph neg) beforeABMT; 3/10 were in minimal CR (

37 th Congress of the Italian Society of Hematology245P315TREATMENT OF CHRONIC MYELOIDLEUKEMIA WITH IFN-α OR IFN-α ANDARA-C COMBINATION: A SINGLECENTER EXPERIENCEA.M. LIBERATI, A.R. BETTI, R. PACE, G. SALVUCCI,N.AL SHARJABY, M. SCHIPPA, P.S. DEGLI ANGELI,A. BASSETTI, E. DONTI, V. METTIVIERSection of Internal Medicine and Oncology Science,Univ. PerugiaAims: the aims of this study were to confirmor not:1) the therapeutic usefulnessof IFN-α therapy and 2) the response tothe combination of IFN-α and low-dose (25-40mg/die) ARA-C used at diagnosis or assecond line therapy (after 12 mths) in acohort of chronic myeloid leukaemia (CML)pts treated in a single centre. Patients:71 CML pts (32-39 F/M), 67 Ph’+ and 4Ph’-, but all bcr-abl rearranged were studied.Fifty-nine pts were observed from 1985to March 1999 while 12 were diagnosed beforethe 1985. Seven newly diagnosed ptswere not treated with IFN-α (3 wereallotransplanted and 4 received conventionalchemotherapy). Of the remaining 52pts, 43 were treated with IFN-α alone andthe other 9 with the combination of IFN-αand ARA-C. This combination was alsoadministared to 24 pts already treated withIFN-α for more than 1 year because of IFNαfailure to induce cytogenetic response(KR), loss of KR to IFN-α alone or to improvethe quality of KR achieved with IFNαtherapy. Results: 33 KR have been obtainedin the 51 Ph’ positive patients inwhom serial cytogenetic analysis were performed.In 8 Ph’+ pts, cytogenetic analysiswas not repeated because of patient refusal(4), early death (1), disease progression(1) or to short ongoing treatment duration(2) at the time when this analysis was performed.Eight pts achieved a complete (C),and 7 a major (M) KR. Five of the 8 CKRwere observed in response to the IFN-αalone and 3 to the IFN-α and ARA-C combination.Two CKR were documented in ptstreated late with IFN-α (1) or IFN-α-Ara-Ccombination (1). Furthermore persistentmolecular disease remission (negative PCR)was documented in 2/8 pts who obtained aCKR. Eighteen pts achieved a minor (Mr)or minimal (Min) KR. Fifteen of the 18 KRwere observed in response to IFN-α aloneand 3 to the early (2) or late (1) IFN-α ARA-C combination therapy. The overall survivalfor the 63 pts treated with IFN-α alone orin combination with ARA-C is 51 mths (1-213). The median survival duration is 104+mths (12-187) for the 15 pts (10 still alive)who obtained a CKR or MKR,63.5 mth (17-213) for the 18 pts (5 still alive) with a Mr-Min KR and 24 mths (10-184) for the 18pts (4 still alive) with no KR.P316EXTRAMEDULLARY BLASTIC PHASE OFCHRONIC MYELOID LEUKEMIA (CML)MIMICKING T-LYMPHOBLASTICLYMPHOMA: A CASE REPORTE. DI BONA, C. SCHIAVOTTO, R. SANCETTA, U. PIZZOLATO,M. STELLA, F. RODEGHIERODivisione di Ematologia e Servizio di Genetica,Ospedale San Bortolo, VicenzaExtramedullary blastic phase of CML occursin less than 5% of the cases, mostly inlymph nodes, central nervous system andbone. About 30% of the cases are B-lymphoidtype. Very few cases have been reportedwith T-cell phenotype. We describea patient with chronic phase of CML andlymph nodes enlargement at presentation;biopsy was consistent with T-lymphoid blastinfiltration. The patient, a 51 years-oldwoman, has been suffering from nocturnalsweat and weight loss during the last sixmonths. At admission, she showed largeright cervical glands and moderate liver andspleen enlargement. The white blood cellcount was 230x10 6/ l (neutrophil 50%, eosinophil2%, basophil 2%, lymphocytes 12%,monocytes 3%, metamyelocytes 10%,myelocytes 10%, promyelocytes 6%,orthocromatic erythroblast 2%, blasts 3%),hemoglobin 9.6 g/dl, platelets 220x10 6 /l.Bone marrow aspirate was consistent withchronic phase of CML, with blasts

246 September 26-29, 1999 - Torino-Lingotto, Italyimmuno-enzymatic technique. Hystologicexamination showed a pattern consistentwith high-grade lymphoma, CD43 and CD3positive. PCR amplification of γ-T-cell receptorshowed monoclonal rearrangement.FISH analysis performed on smear of lymphnode aspirate using specific cosmid probesfor Philadelphia chromosomes demonstratedthe typical fusion signal in 50% ofnuclei. Clinical, morphological and immunologicfeatures of the present case couldindicate the presence of two distinct diseases,but the evidence of Philadelphiachromosome in lymph node blast leads toconclude that lymphomatous cells originatefrom the same clone as CML.P317PROTOCOL ROFERON/CML;A LONG-TERM FOLLOW-UPE. ZUFFA, A. ZACCARIA ON BEHALF OF THE ITALIAN COOPERATIVESTUDY GROUP ON CHRONIC MYELOID LEUKEMIAHematology Unit, AUSL, S. Maria delle CrociHospital, RavennaInterferon alpha (α-IFN) was reported tobe active in the treatment of Chronic MyeloidLeukemia (CML), in term of inducingcytogenetic remissions and inproving survival.We update here the results achievedcomparing α-IFN and conventional chemotherapy(CHT-Hydroxyurea-HU) in the treatmentof Ph+ CML. The protocol Roferon/CML recruited 322 patients between June1986 and July 1988, with a randomization2:1 either to α-IFN or Hu (218pts in a-IFNarm and 104 in CHT arm). On March 1999,81 patients are alive; the median survivalis longer for a-IFN assigned patients (76mosv.s. 52mos, p=0.001) with a median follow-upof living patients of 124 months,range 100-144mos. The survival is strictlyrelated to the Karyotypic Response (KR).The patients treated with α-IFN who did notachieve KR survived similary to patientstreated with conventional CHT. In α-IFNarm, 44 pts are alive in first chronic phaseand 35 (80%) had a KR at least once. InCHT arm 11 pts are alive in first chronicphase and 7 (64%) had some degree ofkaryotypic conversion, even if minimal.Sokal score calculated at diagnosis was relatedwith KR rate and survival. In α-IFNarm the overall KR rate was 32% and 15ptsare at present in major or complete cytogeneticremission, still receving low-doseinterferon. Late α-IFN treatment relatedtoxicity was neither more frequent nor differentfrom early toxicity, but after the firstfive years of therapy no more cases of neurologictoxicity were observed and the maincause of treatment discontinuation werecronic fatigue and muscolo-skeletal pains.Finally we observed a secondary tumor in3 pts in α-IFN arm (1.5%) and in 3 pts inCHT arm (3%) and the development of asecondary neoplasia appears to be unrelateto the type of treatment.P318AUTOLOGOUS TRANSPLANTATIONWITH PHILADELPHIA CHROMOSOMENEGATIVE STEM CELLS MOBILIZED INFIRST CHRONIC PHASE-CHRONICMYELOID LEUKAEMIAF. PAPINESCHI,* F. CARACCIOLO,* E. BENEDETTI,*S. GALIMBERTI,* C. FAVRE,** F. GRECO,***E. CAPOCHIANI,* G. CARULLI,* A. AZZARÀ,* N. CECCONI,*R. TESTI,* M. PETRINI**Dipartimento di Oncologia Università degli Studi diPisa, Divisione di Ematologia. ** Servizio diCriopreservazione, *** Sezione Aferesi del CentroTrasfusionale, Azienda Ospedaliera PisanaPatients with Ph+ Chronic Myeloid Leukaemia(CML) who are non responders toInterferon therapy and/or not elegible toallogeneic transplantation have very poortherapeutic options. Autografting, in differentways performed and with differentsources, is one of the options now underinvestigation. Carella et al. have reportedthat an intensive chemotherapy given inearly chronic phase of CML results in highnumber of circulating Ph negativehaemopoietic progenitor cells. We report themedium term results obtained in 3 women(age:38, 54 and 39). The first patient previouslytreated with a 8 months IFN regimenwithout any cytogenetic response, wastreated with ICE and mobilized in 15 th day.Conditioning regimen Bu 16 mg/kg,Reinfusion: 8.2 x 10 6 CD34+ > 90% PhandBCR/ABL +. She engrafted succesfullyat +21. Regenerating marrow cells wereall Ph – and 25 months later she has a minorcytogenetic response. (30 % Ph- cells.)The other two patients were treated at diagnosiswith mini-ICE, mobilized at +14 and+15 and reinfused respectively 7.0 and 2.7x 10 6 cells CD 34+. 100 % Ph negative,

37 th Congress of the Italian Society of Hematology247BCR/ABL+. Conditioning regimen Bu 16mg/kg. Regenerating marrow cells were allPh – . At +19 and +13 month respectivelythey have a mayor cytogenetic response(90% and 65%) and hematological remission.The three patients are now in maintenancewith IFN. Although probably notcurative a early purging in vivo seems ableto offer a long term survival in CML .P319TRANSLOCATION t(7; 14) (p15; q32) INBASOPHILIC BLAST CRISIS OF Ph + CMLF. GIACOBBI, P. TEMPERANI, G. BONACORSI, V. MEDICI,T. ARTUSI, G. EMILIADip. Scienze Mediche - Sez. Med. Int.-EmatologiaUniv. ModenaPh + chronic myeloid leukemia (CML) usuallyprogress to blast crisis (BC) that canhave lymphoblastic, myeloblastic or, infrequently,erythroblastic and monoblasticcharacteristics. CML occasionally progressto a basophilic and eosinophilic crisis. BCfrequently shows additional karyotypicchanges as + 8, i(17q) and Ph duplication.We report a case of CML with thrombocytosisthat progressed to a basophilic BC witha 46, XX, t (9;22), t (7;14) (p15;q32) inthe same clone. A 63-yr-old female diagnosedas CML in October 1994. At diagnosisa mild thrombocytosis (520 x 10 9 /l) andbasophilia (5%) were present. Karyotype:46, XX, t(9;22). BCR/ABL positive. A treatmentwith IFN and hydroxyurea, led to ahemopoiesis control until November 1997when platelet counts increased (up to 1.200x 10 9 /l). At this time: karyotype: 46,XX,t(9;22); basophils 11%, blasts 3%. Spleen3 cm palpable. Therapy with hydroxyureaplus thioguanine was effective until February1999 when leukocyte counts rapidly increasedtogether with splenomegaly; incontrast, the platelet counts decreased.After 1 month the blood film showed: Hb10 g/l; WBC 170 x 10 9 /l with basophils 40%,blast 7%; platelets 60 x 10 9 /l; the spleen34 x 15 cm enlarged. The bone marrow biopsyshowed an enormous increase ofgranulopoiesis, a decrease of erythropoiesisand an almost absent megakaryopoiesis;the blast forms were about 8% and thebasophils markedly increased. A mild fibrosiswas present. The karyotype was 46, XX,t (9;22),t (7;14) (p15;q32) [20]/46, XX,t(9;22)[3]. A treatment with idarubicin andaracytin led to a marked reduction of leukocytosisand splenomegaly, but the patientdied by myocardial failure, 1 mo. later. Toour knowledge, only 2 cases of translocationinvolving 7p and 14q in hematologicneoplasias, were reported: 1 Ph-positive ALLwith t (7;14) (p12;q32) (Maekawa,1984) and1 case of childhood AML with t(7;14)(p15;q32) (Raimondi,1989). The t (7;14) isoften found in ataxia-telangiectasia (AT) patients:the breakpoints are usually at 7p14or 7q35. Our patient has no signs of AT. Ofinterest, the basophilic BC arose with a coincidentalmegakaryopoiesis failure and afast, marked spleen enlargement. At 7p15several genes are located, involved in myeloiddifferentiation, as HOXA9 and HOX1G;the T-cell receptor gamma (TCRG) is therealso present. At 14q32 the immunoglobulinsuperfamily genes are located and alsothe transcriptional factor CEV14 and the T-cell leukemia -lymphoma 1 gene (TCL1). Itis likely that some of these genes involvedin the translocation can support the pathogeneticmechanisms of disease progression.P320THROMBOSIS-FREE SURVIVAL ANDLIFE EXPECTANCY IN 187CONSECUTIVE IN PATIENTS WITHESSENTIAL THROMBOCYTHAEMIAG. TAMPONI, M. BAZZAN, P. SCHINCO, A. VACCARINO,C. FOLI, *G. GALLONE, A. PILERIDepartment of Haematology, Ospedale SanGiovanni Battista, and * Department of InternalMedicine, Maria Vittoria Hospital, Torino, Italy187 consecutive patients with EssentialThrombocythaemia (ET) were diagnosedand followed by our Haematology Departmentin the period October 1980 - November1994. The overall follow up was 773years/patient. Thrombosis-free survival andoverall survival were calculated in the wholecohort; the same parameters were thancalculated after arbitrarily dividing thewhole cohort in two groups, according tothe median age at diagnosis (55 years).50% of patients had at least one thromboticepisode within 9 years after diagnosis.The thrombosis-free survival curvescalculated in patients younger or older than55 at diagnosis were comparable. About85% of patients were alive 10 years after

248 September 26-29, 1999 - Torino-Lingotto, Italydiagnosis. The survival curves of patientsyounger and older than 55 at diagnosis werenot significantly different in the observationperiod and the observed mortality (7patients) in patients aged less than 55 atdiagnosis was significantly higher than expected(1.68 cases). The relative risk ofdeath was 4 times greater (SMR=4.17 -95% C.I. 1.6-8.6, p

37 th Congress of the Italian Society of Hematology2492 of which were lethal. At 452 months, survivalwas 91%. Four cases of second malignanciesand 3 cases of leukemia transformationwere observed. In conclusion, PVhas a favourable prognosis; leukemic transformationand second malignancies are rareevents; BSF is the elective therapy in olderpatients, providing a rapid response andlong periods off-therapy.P323STUDY OF BCR/ABL STATUS INPATIENTS WITH PHILADELPHIANEGATIVE ESSENTIALTHROMBOCYTHEMIA1D. RUSSO, 1 M. TIRIBELLI, 2 G. DAMANTE, 2 L. PELLIZZARI,2D. FABBRO, 3 G. MARTINELLI, 3 N. TESTONI, 4 D. CAUFIN,1A. MICHELUTTI, 1 L. MARIN, 1 A. BERTONE1Clinica Ematologica, Policlinico Universitario diUdine; 2 Dipartimento Scienze e TecnologieBiomediche, Università di Udine; 3 Istituto diEmatologia e Oncologia Medica “ L. e A. Seràgnoli”,Università di Bologna; 4 Laboratorio di Citogenetica,Servizio di Anatomia Patologica, Az. Ospedaliera S.Maria degli Angeli, PordenoneThe absence of Philadelphia chromosome(Ph-neg) is one of the diagnostic criteria ofEssential Thrombocythemia (ET). RecentlyBlickstein et al. (1) reported that 12 (50%)out of 25 patients with Ph-neg. ET, carrythe BCR/ABL transcript on the molecularlevel. The characteristics of the BCR/ABLpositive patients were similar to the onesof BCR/ABL negative patients, except for asignificant increased patients’age. By usinga reverse transcriptase polymerasechain reaction (RT-PCR), with a sensitivityof 1-10 cell/million, we evaluated the BCR/ABL transcripts in bone marrow cells of 44Ph-neg ET patients. None patient was foundto be BCR/ABL positive. Thus, our resultsdo not confirm the previous observationsreported by Blickstein et al. (1). The BCR/ABL status in ET patients remains to be furtherinvestigated.ReferencesBlickstein D., Aviram A., Luboshitz J et al. BCR/ABL transcripts in bone marrow aspirates ofPhiladelphia-negative Essential Thrombocythemiapatients: clinical presentation. Blood1997; 90: 2768-2771P324PLASMA HOMOCYSTEINE LEVELS INPOLYCYTHAEMIA VERA ESSENTIALTHROMBOCYTHAEMIAM.C. CARRARO, M.L. BIONDI,* N.N. FANTINI, O. TURRI,*S.M. SIBONI, E. GUAGNELLINI,* A. DEL SANTO,S. TARTAGLIONE, G.C. GERLICattedra di Ematologia Istituto di ScienzeBiomediche Ospedale San Paolo, and *LaboratorioAnalisi Chimica Clinica e Microbiologia, OspedaleSan Paolo, MilanSubjects with Polycythaemia Vera (PV)and Essential Thrombocythaemia (ET) havean increased risk for thrombotic events.Since elevated homocysteine levels are anindependent risk factor for atheroscleroticvascular disease, we investigated plasmahomocysteine in PV and ET patients. 16 patientswith PV, ranging between 41 and 79years, and 4 with ET, ranging between 29and 71 years, were examined for plasmahomocysteine. 10 subjects with secondaryerithrocytosis (SE) and 15 healthy controlswere matched for sex and age. 15 PV patientsand 7 with SE underwent chronictreatment with phlebotomy; 6 with PV, 4with SE and 3 with TE underwent chronictreatment also with aspirin; 4 with PV and2 with ET with cytoreductive therapy.Plasma homocysteine was determined byFPIA Homocysteine Reagent IMx System(ABBOTT). The mean hematocrit in PV patientswas 0.47 ± 0.03 and in SE subjectswas 0.49 ± 0.01. All patients had serumfolate and cobalamin at normal levels. 2subjects with PV and 1 with SE had veryhigh plasma homocysteine levels (respectively35.0 mmol/L, 67.0 mmol/L, 36.9mmol/L) and therefore they were not includedin the statistical analysis. Plasmahomocysteine levels in PV and SE patientsresulted significantly increased (respectively16.4±4.7µmol/L and 17.0±4.9 µmol/L, p< 0.0001) from healthy controls(9.2±1.8 µmol/L) and ET subjects(10.1±1.72 µmol/L). There was no statisticalrelationship between genotype of MethyleneTetraHydroFolate Reductase and homocysteinelevels. Nine of PV patients and4 with SE had had thrombotic events in thefar past. No statistical relationship betweenhomocysteine and age, sex and the therapywas observed. Preliminary data show thathigh levels of homocysteine in subjects withPV and SE, undergone to phlebotomy, with

250 September 26-29, 1999 - Torino-Lingotto, Italynormal levels of serum folate and cobalamin,might be related to primitive or secondaryerythrocytosis and might contributeto thrombotic risk The observation of 3subjects (10%) with very increased plasmahomocysteine levels deserves further evaluation.P325ESSENTIAL THROMBOCYTHAEMIA:THROMBOTIC COMPLICATION IN ASINGLE-CENTRE RETROSPECTIVESTUDY OF 221 PATIENTSF. R ADAELLI, P. FACCINI, R. CALORI, E. TAIOLI, A.T. MAIOLOServ. di Ematologia, Istituto di Scienze Mediche,Università di Milano, Ospedale Maggiore IRCCS, ItalyWe retrospectively studied the prevalenceof thrombosis, the possible risk factors associatedwith it and the effect ofcytoreductive on their incidence in 221 patients(139 female and 82 male) with EssentialThrombocythaemia (ET) treated atour Centre between January 1980 and December1997. ET was diagnosed on thebasis of modified PVSG criteria. The medianage at disease onset was 57 years(range 19-86) and the platelet count was1048 ± 447/mm 3 ; 69% of the patients weresymptomatic. In the 170 patients who underwentbone marrow biopsy, the resultswere compatible with ET, and there weresigns of mild fibrosis in 22% of cases. Ofthe 148 patients who underwent cytogeneticanalysis, the results were normal in76%. The results of BCR-ABL rearrangement(carried out in 49 patients) were negativein all cases. The thrombotic risk factorswere a family history of thrombosis in48/163 patients (29%), a positive personalhistory of thrombosis in 47 (21%), arterialhypertension in 70 (32%), diabetes mellitusin eight (4%), and smoking in 72/205(35%). During the median follow-up ofseven years, 26% of the patients presentedthrombotic complications. Cytoreductivetherapy was administered to 122 patients,87 (71%) of whom with hydroxyurea. Fortyfourpatients died: eight of leukemia, sevenof solid tumors, one of NHL, seven of acutemyocardial infarction, six of stroke, two ofhemorrhage (one cerebral hemorrhage),and 13 of various other causes. Univariateanalysis did not reveal any statistically significantcorrelations between thromboticevents and a family history of thrombosis,sex, smoking, diabetes, dyslipidemia orplatelet count at diagnosis (< or ≥ 1,500,00/mm 3 ). However, a smaller number of eventsoccurred in patients with a negative personalhistory of thrombosis, in those agedless than 45 years, and in normotensivepatients (p< 0,05). The patients givencytoreductive treatment had a lower risk ofdeveloping thrombosis than those not receivingany therapy (RR= 0.3; 95%CI: 0.1-0.8). The major risk of thrombosis was observedin patients treated with aspirin (RR=2.4; 95%CI: 0.9-6.6).P326ESSENTIAL THROMBOCYTHEMIA DONOT EXPRESS BCR-ABL TRANSCRIPTSR. MARASCA, F. LANZA*, D. VALLISA§, C. DE ANGELI*,P. Z UCCHINI, D. GANDINI, P. TEMPERANI, M. LUPPI,L. CAVANNA§, G.L. CASTOLDI*, G. TORELLI, G. EMILIADept Medical Sciences - Internal Medicine andHematology Section, University of Modena;*Institute of Hematology, University of Ferrara;§Division of Internal Medicine, PiacenzaEssential thrombocythemia (ET) is a clonaldisorder characterized by marked thrombocytosisof unknown aetiology that, accordingto the PVST do not carry Ph chromosome.Recently, some authors (Blickestein,1997, from Israel), reported 25 Ph-negativecases, followed for a median of 22.5mo (range 17-63), 48% of which showedpositivity for BCR-ABL transcripts. The possibilityof a new variant of ET was suggested.Subsequently, other groups (Marasca,1998; Hackwell, 1999), on near equivalentseries, were unable to confirm these observations.We investigated a larger seriesof ET p, diagnosed fulfilling the PVSG criteria.93 p were enrolled (43 men, 50 women;median age 56 y, r. 23-98). The plateletcounts were from 600 to 900 x 10 9 /L (45 p)or from 1,050 to 2,700 x 10 9 /L (48 p). Allpatients were Ph-. 64 p express high LAPvalue and 29 normal; splenomegaly,

37 th Congress of the Italian Society of Hematology251low-up was 45.97 mo (r. 6-240): but 60.95mo (r. 24-114) for 31 p and 81.78 mo (r.36-240) for 48 p 14 p were followed forless 12 mo (range 6-11). The clinical-hematologicfeatures remained unchanged inall patients, with 3 exceptions: 1 p. (BCR-ABL positive) progressed to blast crisis 12y after diagnosis, via myelofibrosis 6 y afterthe diagnosis; 2 p. (BCR-ABL negative)progressed to myelofibrosis 6 and 10 y afterdiagnosis; respectively 1 p died by BCand 1 p by stroke. 15 p out of 45 with less900 x 10 9 /L platelets showed marked plateletcount after 16-30 mo. The data fromour patients, coming from the same area,Northern Italy, showed that ET do not expressBCR-ABL transcripts. Technical differencesseem unlikely to explain the discrepancywith other authors, ever since methodologyand assay sensitivity appear similar.Enviromental and/or racial factors mighthave a role. Diagnostic accurancy, alternativemethodologies such FISH and “quantitative”PCR in positive cases, a longer follow-up,might allow to a better understandingof ET.P327NUCLEAR FACTOR-ERYTHROID2 (NF-E2) EXPRESSION IN ESSENTIALTHROMBOCYTHAEMIAL. CATANI, M. AMABILE, G. MARTINELLI, M. LAI, L. VALDRÈ,N. VIANELLI, *L. GUGLIOTTA, S. TURAIstituto di Ematologia e Oncologia Medica “L. e A.Seràgnoli” - Università di Bologna - *Servizio diEmatologia, Arcispedale S. Anna, Reggio EmiliaNf-E2 is a transcription factor crucial forregulating erythroid specific gene expression.It is expressed in stem cells and inthe more differentiated cells of the erythrocytic,mastocitic and megakaryocytic lineages.Two isoforms have been identifiedand denominated a and f. NF-E2 seems tobe very important for megakaryocyte terminaldifferentiation since mice lacking thetranscription factor show the arrest ofmegakaryocyte cytoplasmic maturation andprofound thrombocytopenia. Since plateletproduction is elevated in EssentialThrombocythaemia (ET), NF-E2 might playa role in the occurrence of the disease. Inthe present study, we have evaluated NF-E2 expression (both mRNA and protein) inmegakaryocytic cells obtained by patientswith ET (5 cases) and in normal controls (3cases). Megakaryocytic cells have beenobtained after liquid culture in a serum-freemedium plus Thrombopoietin (100 ng/ml).Megakaryocytes have been isolated after12-14 days of culture by means ofimmunomagnetic beads and CD41 antibodyin order to obtain a pure population.. NF-E2 mRNA has been tested by RT-PCR whileflow cytometry has been used for proteinassesment. The two isoforms, a and f, havebeen both identified in ET and normalmegakaryocytic cells and the a isoform ismore expressed than the f form. NF-E2 proteinwas expressed by CD41 positive cellsboth in ET and in normal cells. However,NF-E2 protein intensity expression washigher in ET samples than that observed innormal controls (MIF 3.2 vs 1.9). In conclusion,our results suggest that NF-E2might play a significant role in the increasedplatelet production of ET.P328PREGNANCY AND SPONTANEOUSNORMALIZATION OF PLATELET COUNTIN A PATIENT WITH ESSENTIALTHROMBOCYTHEMIAG. MULEO, R. SANTORO, P. IANNACCAROCentro Emofilia, Servizio di Emostasi e Trombosi,Azienda Ospedaliera “Pugliese-Ciaccio”, CatanzaroEssential thrombocythemia (ET) is achronic myeloproliferative diseasecharacterised by thrombocytosis, excessivemegakaryocytes, haemorrhages, thromboticcomplications and miscarriage. It isrelatively frequent in young women in fertileage. We present the case of a woman(P.F.) of 34 years affected by ET. All the caseof secondary thrombocytosis were excluded;the diagnosis was morphologicallyconfirmed by a bone marrow examinationand cytogenetic studies excluded the presenceof Philadelphia chromosome. At thediagnosis the platelet count was 820.000/mmc, the patient reported headache andpresented splenomegaly. She immediatelybegan therapy with platelet inhibitors, keepinga platelet count from 610.000/mmc to854.000/mmc, without cytoreductive treatment.Thirteen months later, the patient waspregnant and simultaneously started a slowand spontaneous reduction of platelet count

252 September 26-29, 1999 - Torino-Lingotto, Italywhich normalised ad 12 th week of pregnancy.Platelet count was normal for all thepregnancy. Patient had a natural deliveryof a healthy baby at 40 th week. After thedelivery platelet count gradually rose untilto 810.000/mmc.P329ATYPICAL CONGENITALDYSERYTROPOIETIC ANEMIA:A CASE REPORTM. ZAPPA, C. BOSCHETTI, C. VERCELLATI, P. BIANCHI,M. MARIANI, L. CANEVA*, P. MORANDI, D. SOLIGO#,A. ZANELLADivision of Hematology IRCCS Ospedale MaggioreMilano, Italy. *Fondazione Mattarelli OspedaleFatebenefratelli, Milano, Italy . # Centro Trapianti diMidollo IRCCS Ospedale Maggiore Milano, ItalyCongenital dyserythropoietic anemias(CDA) are a heterogeneous group of disorderscharacterized by ineffective erythropoiesiswith prominent dysplastic featuresof the erythroid precursors in the bonemarrow. Three types of CDA have beendefined based on differences of marrowerythroblast abnormalities; however, severalCDA variant have been described.Thisreport describes the clinical, hematologicaland biochemical features of a 34 yearsold woman with atypical congenitaldyserythropoietic anemia. The patient displayedanemia early in childhood and requiredRBC transfusions only in two occasions.During the last 10 years the hematologicalparameters were stable (Hb 8-9g/dL, normal or mild reticulocytosis,unconjugated bilirubin 1.8-4 mg/dL). At thetime of the study at physical examinationshe was pale and the spleen was slightlyenlarged. The laboratory data showed moderateanemia without reticulocytosis, increasedunconjugated bilirubin andelliptocytes, schistocytes, dacriocytes werefound in peripheral blood smear. Osmoticfragility tests, screening for abnormal orunstable hemoglobins and Coombs testwere negative. The Ham’s test was not informativesince also the acidified controlwithout complement was positive The redcells showed increase agglutinability withanti-i antibody. Ferrokinetic studies showedan increased plasma iron clearance and ahigh rate of ineffective iron turnover. Thestudy of the red cell membrane proteinsby SDS-PAGE revealed a slight deficiencyof protein 4.1 and the search of reticuloendoplasmicmarker for CDA II (GRP78)by western blotting analysis was negative.Rare binucleated and multilobulated erythroblastsand a few intercytoplasmaticbridges were found at bone marrow examination.Electron microscopy revelead markederithroblastosis and kariorrhexis in almost50% of erythroblasts. In conclusion thecase here reported can not be classified inany of known CDA type and could be consideredas new CDA variant.P330TRANSIENT MYELODYSPLASIADURING PREGNANCYC. CALIFANO, L. LUCIANO, L. CATALANO, A. GUERRIERO,S. ROCCO, °R. GRIMALDI, °G. AMENDOLA, B. ROTOLIDiv. of Hematology, Federico II University, Napoli,°Immunohematology Service and Pediatric Division,S. Leonardo Hospital, Castellammare di Stabia(Napoli)A 33 year-old multipara was referred toour unit in January 1998 for pancytopeniadetected during the ninth month of agemellary pregnancy, which worsened immediatelyafter delivery. PE showed onlymoderate splenomegaly. The patient wastaking folic acid and vit. B12. Her bloodcounts showed severe macrocytic anemia(Hb 5,6 g/dL; MCV 99 fL), thrombocytopenia(plt 49000/µL) and moderate leucopenia(WBC 4100/µL N 85%). Anysocytosis,poikilocytosis, absence of schistocytes,reticulocytopenia and hypogranular neutrophilswere also observed in peripheralsmears. Bilirubin was normal. Transaminasesand LDH were increased (AST 55 U/L; ALT 48 U/L; LDH 879 U/L). Serologicalwork up for B and C viral hepatitis was negative.Prothrombin time, activated partialthromboplastin time and fibrinogen werenormal. Serum ferritin was increased (853ng/ml). Bone marrow examination showeddyserythropoiesis (macrocytosis, asynchronousmaturation, vacuolization) hypogranularmyelopoiesis and micromegakaryocytes.Sideroblasts were absent. Deletionof chromosome 20q was detected bycytogenetics. The patient received 6 unitsof packed red cells. Her blood counts slowlyincreased and became normal after 3months. Last bone marrow examination

37 th Congress of the Italian Society of Hematology253(April 1999) showed normal hemopoiesis,with persistent macrocytosis and chromosome20q deletion in 5/12 metaphases. Itis known that oestrogens may inhibit hemopoiesis;in addition, hormonal changesduring pregnancy may favour a clonal expansion.It is possible that in this patient apre-existent abnormal clone expanded itselfeither directly or by temporary suppressionof the normal hemopoietic lineages.Prolonged clinical and cytogenetical followup might help in clarifiyng this unusual case.P331PERIPHERAL ASPECTS OFMYELODYSPLASIA DETECTED BYH3-BAYER AUTOMATIC CELL COUNTERP. VICINANZA, L. CATALANO*, S. ROCCO*, D. CAPUTO#,M. VICINANZA, B. ROTOLI*Servizio di Medicina di Laboratorio e #Divisione diMedicina Generale, A. O. S.Giovanni di Dio e RuggiD’Aragona, Salerno. *Divisione di Ematologia,Università Federico II, Napoli.Aiming to verify the existence of parametersallowing to suspect the diagnosis of aMyelodysplastic syndrome (MDS), we havestudied peripheral blood of 29 patients affectedby MDS according to FAB classification(RSA:2, RA:20, RAEB:3, RAEB-T:1,CMML:3) by an automatic hematologicalanalyzer (H3-Bayer). This autoanalyzercounts 10 4 cells/sample using both principlesof flow cytometry and of perox cytochemistryand is able to give more than20 parameters, directly measured or calculated.Our attention was focused on threeparameters: RDW-R, PDW-R and LI, whosemedians were found significantly differentfrom those verified in a normal populationof 100 subjects. RDW-R gives the grade oferythrocytic anisocytosis obtained as differencebetween the parameter directlycalculated (RDW-CV) and the theoretic values(RDW-Cva) for that number of erythrocytesand MCV. RDW-R is a measure ofthe anisocytic degree of the examined redcells. PDW-R has the same meaning, appliedto platelets: it is as higher as the degreeof platelet anisocytosis. The lobularityindex (LI) is the ratio between polymorphicand mononuclear nuclei, and it gives informationsabout the degreee of segmentationof polymorphs compared to mononuclearcells. In MDS patients red cell morphology,expressed as RDW-R, was significantlyaltered due to macrocytic and hypochromicerythrocytes. The analysis of plateletanisocytosis, expressed as PDW-R, revealedsignificant differences due to thepresence of microthrombocytes. Finally, LIwas costantly reduced, due to the presenceof hyposegmented (pseudoPelger) neutrophils,absolute neutropenia and blast cellincrease. These preliminary data confirmsome typical characteristics of MDS (anemia,macrocytosis, neutropenia, thrombocytopenia)and underline the presence ofmicrothrombocytes. Even very small populationsof peripheral blasts can be detectedthanks to the high number of counts performed.P332TWO YEAR FOLLOW-UP OFCYCLOSPORIN-A IN HYPOPLASTICMYELODYSPLASTIC SYNDROMESL. CATALANO, C. SELLERI, C. CALIFANO, L. LUCIANO,M. VOLPICELLI, S. ROCCO, G. VARRIALE, P. RICCI, B. ROTOLIDivision of Hematology, Federico II University,Napoli, ItalyLymphocyte abnormalities in myelodysplasticsyndromes (MDS) have been repeatedlydescribed, but the role of the immunesystem in the pathogenesis of these clonaldisorders is still controversial. An active roleof lymphocytes has been implicated in suppressingnormal hemopoiesis in MDS withhypoplastic marrow. We have investigatedin vitro and in vivo activity of cyclosporin-A(CSA) on hemopoiesis in nine consecutivepatients affected by hypoplastic MDS. CSAwas given at daily doses of 1-3 mg/kg for aminimum of three months. After a meanperiod of 21 months of treatment, hemoglobinwas significantly and persistentlyincreased in two cases, hemoglobin andplatelets in other two, platelets in one. Twopatients showed a transient response, onepatient did not tolerate the treatment, onepatient is near to a significant response. Byflow cytometry, circulating CD34 + cells werefound decreased in MDS patients comparedto normal donors. In vitro effects of CSA oncirculating hematopoietic progenitors werestudied by methylcellulose colony assay. Inabsence of CSA, CFU-C were markedly decreasedin all patients. At concentration invitro similar to that found in plasma after

254 September 26-29, 1999 - Torino-Lingotto, Italyoral administration, CSA significantly increasedcolony-forming unit cells (CFU-C)in 3/9 hypoplastic MDS. In 3/5 cases in vitrotesting was able to predict a positive clinicalresponse to CSA, and in 3/4 cases anegative response. Good tolerance and significantprolonged results in 50% of casessuggest a trial with CSA as first line treatmentfor this subgroup of MDS patients. Invitro study may predict the clinical responsein the majority of patients.P333IMMUNOSUPPRESSIVE TREATMENT INMYELODYSPLASTIC SYNDROMES:STUDY OF 12 PATIENTSC. FINELLI, G. VISANI, P. RICCI, N. TESTONI, G. MARINO,A.M. MIANULLI, R. PASTANO, P. PICCALUGA, S. TURAIstituto di Ematologia e Oncologia Medica“L. & A. Seràgnoli”, Università di BolognaThe current treatment of the myelodysplasticsyndromes (MDS) is unsatisfactory,apart from allogeneic stem cell transplantation.However, the latter is feasible onlyin a minority of cases. Any other therapeuticoption can lead to partial remission inno more than 10-30% of pts. Recently,favourable results have been obtained withimmunosuppressive regimens, similar tothose employed in aplastic anaemia, i.e.ATG + corticosteroids (Molldrem JJ, 1997)or cyclosporin (Jonasova A, 1997). From1980, we observed in our Institution 12 pts(5 males, median age 56, range 18-77 yrs)with MDS (refractory anaemia in 10 pts, 1pt with RAEB and 1 with secondary MDS)who showed a partial or complete responseto a corticosteroid and/or immunosuppressivetreatment. Severe anemia was presentin all the cases (transfusion-dependent in11 pts), 2 pts showed neutropenia and 3pts thrombocytopenia (transfusion-dependentin 1 pt). The bone marrow was hypocellularin 4 cases, and normo-or-hypercellular in the remaining 8 pts, with a moderatelymphoid infiltration in 5/12 subjects.Karyotype was abnormal in only 2 cases(5q- and -7, respectively). 10/12 pts respondedto corticosteroid therapy (0.5-2mg/Kg/die), with discontinuance of transfusions, after 2-12 (median 4) weeks. 4/5pts showed a response to cyclosporine (withrHuEPO in 1 pt), 1 pt achieved remissionafter 3 courses of cyclophosphamide, andanother pt responded to the association ofcorticosteroids and azathioprine. A therapeutictrial with corticosteroids and/or immunosuppressiveagents seems thereforeworthy, particularly in low-risk MDS, andwhen allogeneic stem cell transplantationis not feasible.P334SOLUBLE TRANSFERRIN RECEPTOR(sTfR) IN PATIENTS WITHMYELODYSPLASTIC SYNDROMES(MDS) TREATED WITH RHUEPO ORAMIFOSTINEA. GROSSI, A. FABBRI, V. SANTINI, F. LEONI, C. NOZZOLI,G. LONGO, G. PAGLIAI, S. CIOLLI, P. ROSSI FERRINIDivision of Hematology, Policlinico Careggi, FlorencesTfR is considered a reliable index of totalbone marrow erythroid activity, andchanges in its serum levels during treatmentsaiming at correcting impaired erythropoiesismay reflects the efficacy oftherapy. In a multicenter italian trial a groupof 89 patients with low-risk MDS and hemoglobin≤ 9 gr/l was enrolled and randomizedto receive rHuEpo s.c. (150 U/Kg/day) or placebo for 8 weeks (Br. J. Haematol103: 1070, 1998). sTfR was evaluatedat days 0 and 28, and it was found that atday 28 levels were significantly higher thanat baseline only in patients responsive totherapy; moreover an increase lower than18% predicted for non response (predictivepower 93%). These data confirmed theresults observed by Cazzola et al. in a previousstudy (Blood 79: 29, 1992). We havecompleted another study in which 26 patientswith low-risk MDS (13 RA, 2 RARS,2 CMML, 9 RAEB with blasts < 10%) weretreated with the phosphorylated aminothiolagent Amifostine (Ethyol) (200 mg/m 2 x 3/week for 4 weeks), and 5 patients withbone marrow blasts ≥ 10% (high riskMDS)with Amifostine for 6 weeks in combinationwith low dose ARA-C (LDARA-C)(10 mg/m 2 twice a day) during the first 3weeks of treatment. Granulocytes increasedin 13/26 (50%) and platelets in 9/26(34%); hemoglobin and retyculocytes increasedin 6/26 (23%) and 11/26 (42%)patients respectively. In high-risk patients1 CR and 2 PR were observed. Basal andweek 4 sTfR levels in patients with MDS

37 th Congress of the Italian Society of Hematology255were significantly higher than in a controlpopulation (P 50% increment in PMN or Plt value) wereobserved in 41% of RA/RARS and in 55%of high risk patients. A greater than 50%reduction in erythrocyte transfusion requirementwas detected in 42% of transfusedpts. Response did not correlate to anyknown risk factor and had a median durationof 8 months. Median survival was 79,18, 14, 21 months in RA/RARS, RAEB,RAEB-t and CMML pts, respectively. Survivalwas significantly longer in responsiveRAEB and RAEB-t pts (median 30 and 22months, respectively) compared to non responders(9 and 6 months, respectively)(p:0.001). Response did not affect survivalin other MDS groups. Our combinationtherapy may represent a valuable treatmentfor MDS patients unsuitable to more aggressivetherapies.P336rHU-EPO FOR THE TREATMENT OFSEVERE ANEMIA IN MYELOFIBROSISWITH MYELOID METAPLASIA:EXPERIENCE IN 10 PATIENTSA. MARINO, B. MARTINO, F. RONCO, E. OLIVA, F. NOBILEDivisione di Ematologia, Dipartimento di Emato-Oncologia, Az. Ospedaliera Bianchi-Melacrino-Morelli, Reggio CalabriaAnemia is the principle condition that influencesthe quality of life of patients withidiopathic myelofibrosis and myeloid metaplasia(MMM). Supportive therapy is stilltoday the essential treatment that compensatesfor deficient bone marrow production.There are few reports in the use of recombinanterythropoietin (rHU-EPO) in MMM.We describe our experience with rHU-EPO

256 September 26-29, 1999 - Torino-Lingotto, Italyin 10 patients, 5 males and 5 females, meanage 70.6 ± 6.9 sd. All of them had a lowPerformance Status (WHO 2-3). Treatmentwas initiated 2 to 47 months (median 4)after diagnosis. Nine had an advanced histologicalstage (III-IV). Two patients weresplenectomized, 1 had ungergone splenicradiotherapy and 8 were being treated withhydroxyurea. Average Hb was 7.8 ± 0.8 g/dL (6.5-9.1). Five patients were transfusion-dependantand transfusion needs wereparticularly high in 3 patients (2.3, 3.7 and4 transfusions/month, respectively). Nopatient had other signs of bone marrow failure.Five patients had splenomegaly. Allreceived subcutaneous rHU-EPO 100-150U/Kg 3 times weekly for a minimum of 8weeks. The 5 patients that had not receivedtransfusions continued to not necessitatesupportive therapy and median Hb increasedfrom 7.9 (7.4-9.1) to 8.8 (8.4-10.5)within 4 weeks. Of the 5 patients that dependedon transfusions, transfusion-rate didnot improve in 3, decreased in 1 and becamenull in 1. There were few adverse effects;moderate spleen enlargement wasobserved in only one patient. In conclusion,rHU-EPO represents a useful therapy in thetreatment of anemia secondary to MMM.P337FLANG IS AN EFFECTIVE ANDWELL-TOLERATED REGIMEN FORBLASTIC PHASE OF CHRONICMYELOPROLIFERATIVE DISORDERSM.R. SPECCHIA, S. BARULLI, S. RUPOLI, B. GUIDUCCI,°G. DISCEPOLI, P. LEONIDepartment of Hematology, Ancona University ofMedicine,° Cytogenetic Laboratory Hospital Salesi,AnconaBlast crisis (BC) of Chronic MyeloproliferativeDisorders (CMD) (Ph 1 + and Ph 1 -) isdifficult to control with any therapy.Multiagent chemotherapies, commonlyemployed for remission induction in AcuteMyeloid Leukemia (AML), can produce clinicalresponses, but at the cost of long periodsof hospitalization and considerable toxicity.The therapeutic efficacy of Fludarabinecontaining regimens (FLAG and FLANG) hasrecently been shown in high-risk AML.Promising results with FLAG and FLANGwere also reported in anecdotic cases ofPh1+ Chronic Myeloid Leukemia (CML) inBC. We aimed to evaluate the efficacy andtolerability of FLANG regimen for treatmentof CMDs in BC. Six patients were enrolled,5 males and 1 female aged between 52 and70 (median 66 yrs). Four patients had CML,2 patients had Idiopatic Myelofibrosis (IMF).FAB subtypes were the following: M0 3, M43. CML patients had progressive diseasedespite hydroxyurea and/or interferon andlow dose cytarabine treatment whereas thetwo patients with IMF received FLANG asfirst-line treatment. Six patients weretreated with one course of FLANG and 3patients with two additional courses. Allpatients had cytogenetic analysis of bonemarrow performed immediately before thefirst course with FLANG. Abnormal karyotypeswere found in 5 patients (4 CML and1 IMF); in additional to the t(9;22) 3 patientswith CML showed complex cytogeneticaberrations. After the first cycle of chemotherapyoverall complete remission (CR)was achieved in 4 patients (67%) and partialresponse (PR) in 2 (33%). The mediantime of granulocyte recovery (PMN >1x10 9 /L) was 17 days (range 12-27) and 50x10 9 /L platelets were reached at a median of 22days (range 15-50). During the neutropenicphase 4 cases of fever of unknown origin, 6episodes of documented sepsis, 1 case ofpneumonia, 1 of pulmonary aspergillosisand 1 of nasal cellulitis were diagnosed.Despite considerable cytoreduction, supportivetherapy was limited: the transfusionalneed ranged 2-16 units (median 10)for RBC and 2-15 units (median 6) for platelets.Non-hematologic toxicity was mild,mainly consisting of mucositis (I-II WHO).Neither signs nor symptoms of cardiac orrenal impairment were detected. Cytogeneticanalyses performed on bone marrowcells after treatment were evaluable in 5patients. A progressive clearance of Ph1+metaphases (from 100% to 27%) was detectedin 1 patient and the disappearanceof isochromosome 17q was documented inanother patient. No cytogenetic responsewas achieved in 2 CML patients. The medianDFS was 3.5 months (range 2-6) witha median follow-up of 6 months (range 2-19). Our study shows that a remarkablepercentage of patients with CMD in BC canachieve remission with very few side-effects.The overall CR rate is higher than CRrates previously reported in patients affectedby AML with FLAG and FLANG. Despitehigh hematologic responses, FLANGis likely to be less effective in obtainingcytogenetic responses. Therefore this regi-

37 th Congress of the Italian Society of Hematology257men seems to play a role in eliminating onlythe malignant clone of the overt leukemicphase but not the preexisting myeloproliferativedisorder.P338HYPERHOMOCYSTEINEMIA INMYELODYSPLASTIC SYNDROMESCORRELATES WITH CARDIOVASCULARAND AUTOIMMUNE DISEASEA. CORTELEZZI, N.S. FRACCHIOLLA, M. MOTTA,F. BAMONTI-CATENA, M.A. FASANO, B. SARINA,R. CALORI, C. CATTANEO, A.T. MAIOLOServizio Autonomo di Ematologia, Ist. ScienzeMediche, Ospedale Maggiore IRCCS, Milano, ItalyHyperhomocysteinemia (HH) is an independentcardiovascular risk factor. We measuredfasting plasma homocysteine (H) in27 patients affected by myelodysplasticsyndromes (MDS; AR 8, ARS 5, AREB 11,AREB-t 2, LMMC 1). H was measured byIM x-Homocysteine FPIA method with anautomated analyzer IMx (Abbott). The cutoffin healthy volunteers was 13.2 µmol/L.HH was found in 10 (37%) cases (interval13.56-31.15, median 19.7 µmol/L). Ofthem, 4 presented cardiovascular events(CVE; deep venous thrombosis 1 case; ischemiccardiopathy 2 cases; pulmonaryembolism 1 case) and 6 autoimmune disease(AID; polymyalgia rheumatica 2 cases;Behcet 1 case; rheumatoid arthritis 1 case)or auto-antibodies (AA; anti-mitochondria1 case; ANCA 1 case). In particular, 4/5cases (80%) with CVE, and 6/11 cases withAID/AA (54%) presented HH. None of the11 cases without CVE or AID/AA presentedHH. HH in MDS was significantly associatedwith CVE/AID/AA (χ 2 , p=0.000952), and itsfrequency was higher than reported in normalindividuals age/sex matched. To evaluatethe specificity of the HH/MDS association,we measured H in 69 patients (pts)with ischemic cardiopathy (IC; 40 pts) orrheumatoid arthritis (AR; 29 pts). HH wasfound in 18/69 pts (9 IC, 9 AR; interval13.22-42.69, median 15.2 µmol/L). The incidenceof HH is higher in MDS with CVE/AID/AA (62.5%) than in the IC/AR controlgroup (26%). Even if there is only a trendto statistical significance (χ 2 , p=0.065) betweenthe two groups (possibly due to limitedsample size), the median H level is significantlyhigher in the MDS CVE/AID/AAgroup than in the IC/AR (Mann-Whitneytest, p=0.0001). In conclusion:1) in MDSpatients HH is associated with CVE/AID/AA(χ 2 , p=0.000952); 2) the median H level issignificantly higher in MDS patients withCVE/AID/AA than in control patients affectedby CVE (IC) or AID (AR)( Mann-Whitney test, p=0.0001). Based on theseevidence, it is possible to speculate thatMDS patients may have a genetic and/oracquired defect in the H metabolism, leadingto HH, that in turn exert its toxic effecton endothelium (contributing to CVE) or oncell membranes, causing alteration of surfaceantigen recognition (contributing toAID/AA). Further studies are necessary tovalidate this hypothesis.P339AMIFOSTINE AS A SINGLEAGENT IN THE TREATMENT OFMYELODYSPLASTIC SYNDROMESV. PITINI, C. ARRIGO, G. ALOI, M. FALDUTO*, M. PICCIOTTO,M. ARAGONA, F. LA TORREDepartment of Medical Oncology, *Department ofPatologic Anatomy, University of Messina, ItalyAmifostine (Ethyol) is a phosphorylatedaminothiol that protects Bone Marrow (BM)progenitors and other normal tissues fromthe toxicities of ionizing radiation andantineoplastics drugs. In clonogenic assays,preincubation exposure to amifostine promotesformation and survival of primitivehematopoietic progenitors frommyelodysplastic (MDS) BM in a dose dependentfashion. To further define the hematologiceffects of amifostine 10 patients(median age 62 years), with a histologicallyconfirmed diagnosis of de novo MDS,received treatment with amifostine 300mg/m 2 , three times a week for three consecutiveweeks followed by 2 weeks observation.Study candidates had a FAB morphologictype other than chronic myelomonociticleukemia (6 RA, 2 RAEB, 2 RAEB-T), PS less than or equal to 2, expectedsurvival of at least 3 month. All patientswere anemic and 8 patients were RBC transfusiondependent. 4 patients had neutropenia

258 September 26-29, 1999 - Torino-Lingotto, Italy3 and 4). Among patients with thrombocitopenia,2 had an increase in plateletcount exceding 50% of baseline. No participantsachieved transfusion indipendence,subjective improvement was reportedin all patients. Reticulocyte count increasedin 4 patients (3RA,1RAEB) ranging from 1.2to 4.1%. Sequential bone marrow biopsiesof 1 patient with AREB-T showed a 50%decrease in blast cell counts. Amifostine isan interesting compound wich merits furtherstudy as a treatment for MDS.P340ATRA AND LOW DOSE CYTOSINEARABINOSIDE FOR THE TREATMENTOF HIGH RISK MYELODYSPLASTICSYNDROMESA. TAMBURINI, A. VENDITTI, M.T. SCIMÒ, F. BUCCISANO,G. DEL POETA, L. MAURILLO, M. POSTORINO, I. DEL PRINCIPE,M. TRIBALTO, M. MASI, S. AMADORICattedra di Ematologia, Università di Roma TorVergata, Div. di Ematologia, Osp.S.Eugenio, RomaTwenty-two patients with high riskmyelodysplastic syndrome (HRMDS) weretreated with a 10 days course of oral ATRA(45mg/m 2 ) and subcutaneous low dose cytosinearabinoside (LDARAc) given at thedose of 20 mg twice a day. The courses wererepeated monthly until response or progression;in case of response the therapy wasadministered until relapse. Morphologic diagnosiswere RAEB in 11, RAEB-t in 6, andCMMoL in 5 patients; in all cases, bonemarrow blast infiltration was greater than10% (median 20%, range 12-30%). Whenclassified according to the InternationalPrognostic Scoring System (IPSS), all thepatients fell within the intermediate/highrisk categories. Nineteen patients weremales and 3 females; the median age was69 years (range 25-90); 3 patients werepreviously treated with conventional chemotherapy,and 1 of them also underwentautologous bone marrow transplantation.Overall, 7 of 22 patients (32%) achieved aresponse: 5 (23%) were classified as completeresponders and 2 (9%) as partial responders.Fifteen (68%) patients did notachieved any response and progressed toovert leukemia (11) or died of complications(3); the remainder is still on therapy,with no modifications from baseline. Theoverall median survival was 9.7 months(range 1-20), whereas the median survivalof responders was 15 months (range 7.7-20); the median duration of response was10 months (range 6-17.2). Moderate to severehematological toxicity and infectionswere the most common side-effects. In conclusion,the association of ATRA and LDARAcmay be effective in approximately 30% ofHRMDS. Optimizing this approach might bepursued by selecting, on a biological basis,those cases more likely to respond or byincorporating other differentiating agentsor growth factors.P341AMIFOSTINE IN THE TREATMENT OFMYELODYSPLASTIC SYNDROMES:CLINICAL RESULTS AND BIOLOGICALEFFECTSR. INVERNIZZI, A. PECCI, R. FORMISANO, P. BERGAMASCHI,C. LUCOTTI, L. MALABARBA, E. ASCARIMedicina Interna ed Oncologia Medica, Università diPavia, IRCCS Policlinico S. Matteo, PaviaRecently it has been hypothesized thathigh levels of apoptosis may be responsiblefor the ineffective hematopoiesis that characterizesmyelodysplastic syndromes(MDS); various oncoproteins and cytokinesmay be involved in the regulation of thisphenomenon, through the liberation of intracellularfree radicals. The antioxidantactivity of amifostine justifies its use inMDS, since it determines a reduction of thecellular free radicals, which are mediatorsof apoptosis, consequently stimulating hematopoiesis.We treated with amifostine atthe dose of 200 mg/m 2 i.v./3 times a weekx 3 consecutive weeks 3 patients with primaryMDS (1 RA, 2 RAEB, 2 M, 1 F, aged62, 63 and 64 years), with serious or symptomaticcytopenia, who had not respondedto previous therapies. In all cases at least4 cycles of treatment were given at intervalsof 2 weeks. The clinical and hematologicalresponse was evaluated accordingto the criteria of List et al. (Blood 1997;90:3364-9); also evaluated was the influenceof amifostine on some biological parameters.In the case of RA, characterizedby anemia and neutropenia, a significantincrease of neutrophils was observed afterthe 1 st cycle, but with no reduction of thetransfusion requirement. In the 2 RAEBcases an increase of neutrophils and reticu-

37 th Congress of the Italian Society of Hematology259locytes occurred after the 2 nd cycle, withreduction of the marrow blasts in one case(from 12% to 5%). The cultures in vitro ofthe hematopoietic progenitors showed increasedCFU-E and CFU-GM in all cases. Theapoptotic index, evaluated with the TUNELtechnique on bone marrow aspirate, diminishedsignificantly after the 2 nd cycle, respectivelyfrom 26% to 3%, from 24% to2% and from 33% to 7%, while the expressionincreased in the immature bonemarrow myeloid cells of the bcl-2 oncoprotein,notoriously involved in the regulationof apoptosis. In conclusion, our findingsshow a fair hematologic response to amifostinein MDS, with confirmation in vitroof the stimulation of hematopoiesis and withmorphologic demonstration of reduction ofapoptosis levels in bone marrow.P342FAMILIAL MYELOPROLIFERATIVEDISORDERS IN FIVE UNRELATEDFAMILIESR. SANTORO, G. MULEO, P. IANNACCAROCentro Emofilia, Servizio di Emostasi e Trombosi,Azienda Ospedaliera “Pugliese-Ciaccio”, CatanzaroMyeloproliferative diseases (MD) are disorderscharacterised by clonal expansion ofmyeloid lineages. Though MD are acquireddiseases, several cases have been reportedwith familial accurence. We studied fiveunrelated families in which the affectedsubjects fulfilled diagnostic criteria for essentialthrombocytemia (ET) or for chronicmyelocytic leukemia (CML). In the first familytwo sisters (D.M. and D.F.) were affectedET, diagnosed simultaneously at the agesof 70 and 69. In both cytogenetics excludedPhiladelphia (Ph’) chromosome; no fibrosisin the bone marrow. In the second family abrother (B.D.) and a sister (B.M.R.) wereaffected ET at the age of 52 and 61, respectively.In the first case diagnosis werecarried out after deep venous thrombosis(splenic vein), in the second cases patienthad portal thrombosis two months after ETdiagnosis, in spite of myelosuppressivetherapy and with platelet inhibitors. In thethird family, we followed for ET, mother(V.E.), 61 year old at the diagnosis, in whichhave excluded Ph’ chromosome and fibrosis.A year later, in different Centre, her sonwas affected chronic myelocytic leukemiaPh’+, at the age of 25. Fourteen monthslater, the son died for blastic crisis. Patientis alive, four years from the diagnosis. Inthe fourth family, two sisters (P.M. and P.C.),55 and 59 years old, were affected ET andCML Ph’+, respectively. In the first, still livingnine years from diagnosis, we have excludedPh’ chromosome and fibrosis. Thesecond, treated in different haematologicalCentre for CML Ph’+, is still living two yearsfrom diagnosis. In the fifth family two cousins(P.V. and P.F.), 75 and 68 years old atthe diagnosis, were treated for CML and ET,respectively. In conclusion myeloproliferativedisorder, though are acquired diseases,sometimes accur with familial recurrence.P343HYDROXYUREA – INDUCED LEGULCERATIONS: REPORT OF 5 CASESS. BIRTOLO, S. MARCONCINI, C. BIGAZZI, M. LENOCI,A. BUCALOSSI, F. LAURIADept. of Hematology, University of SienaHydroxyurea (HU) therapy is an effectiveagent in the treatment of chronic myeloproliferativedisorders and, less commonly,in non neoplastic diseases. Amongseveral side-effects, HU may producehyperpgmentation and face and hands’desquamation. Recently, leg ulcers havealso been described. Five patients with HU–induced leg ulcerations were identified afterreviewing the medical records of 71patients (7%) with various myeloproliferativedisorders treated with HU during thelast 10 years (1991-1999) at our Division.Table 1 summarizes the clinical features ofpatients who developed skin ulcers after HUtherapy.

260 September 26-29, 1999 - Torino-Lingotto, ItalyP344CUTANEOUS ULCERS ASSOCIATEDWITH HYDROXYUREA THERAPYR. SANTORO, P. IANNACCARO, G. MULEOCentro Emofilia, Servizio di Emostasi e Trombosi,Azienda Ospedaliera “Pugliese-Ciaccio”, CatanzaroCutaneous painful ulcers were tipically locatednear the malleoli but were occasionallyfound over the tibia and the calves.Multiple ulcers were seen in 2 patients. Inall patients, leg ulcerations resolved aftersome weeks of HU discontinuation althoughno consistent correlation between the doseor duration of prior HU therapy and leg ulcerswas found. The pathogenetic mechanismof cutaneous ulcerations during HUtreatment is not definitely clarified but inchronic lesions, the histologic findings aresimilar to the lesions of the cutaneous occlusivevasculopathy. In order to test thevascular hypothesis of cutaneous ulceration,the coagulative, fibrinolitic and platelet assessmentis now in progress in these patientsand also in those who did not showany ulcer episode after treatment with HU.In conclusion, some patients with myeloproliferativedisorders may develop duringHU treatment leg ulcers which tend to resolvewith discontinuation of therapy.Hydroxyurea (HU) is an established andwell tolerated therapy for myeloproliferativedisorders (MD). Side effects are fewand include myelosuppression and oral ulcers,while cutaneous toxicity is rare. Wepresent here 6 patients with skin ulcers,developed after therapy with hydroxyurea,in myeloproliferative diseases. Five pts withessential thrombocytemia (ET) and one ptwith chronic myelogenous leukemia (CML)which received HU at doses of 0,5-2,5 g/day, developed skin ulcers. In the patientaffected to CML, therapy with hydroxyureawas associated to a-interferon. Ulcers developedin the lower extremities in adjacentto the malleoli and, in four patientsthere was a precise relation with a previoustrauma. No patients had evidence ofvascular insufficiency, infection or vasculitis.Patients’ median age (all of them arefemale) was 56 years. Skin ulcers developedafter a period of therapy with HU of1-3 years and discontinuation of therapyleaded, after several months, to slow healingof the ulcers. Cutaneous ulcers representsrelatively rare side effects of therapywith HU, the etiology of which is not stillcompletely understood.P345A NEW VARIANT OF CDA TYPE IG. AMENDOLA, R. GRIMALDI, L. CATALANO*, C. CALIFANO*,L. REYNAUD • , A. LAMBIASE • , G. BORGIA • , B. ROTOLI*Div.of Pediatrics and Immunohematology, Hospitalof Castellammmare di Stabia, Napoli, *Div. ofHematology and • Div. of Infectious Disease,Federico II University, NapoliA 9 year old boy was referred for jaundicein 1996. Jaundice in the neonatal periodand cholelithiasis requiring medicaltreatment for two episodes of acutecholestasis in 1998 were present in his pastmedical history. Physical examination revealeda jaundiced child, with no dysmorphicfeatures, and with a mildly enlarged

37 th Congress of the Italian Society of Hematology261spleen. Basal work-up showed compensatedhemolytic anemia (Hb 12.3 g/dL, Retics4.5x10 5 /µL, MCV 94 fL), hyperbilirubinemia(T/I: 2.4/2.24 mg/dL), increased LDH (687U/L). Serum B12, folate and virological statuswere all normal; the Coombs test wasnegative. Blood film showed marked anisocytosisand poikilocytosis. His parents werenot consanguineous and had normal bloodcounts; the sister, 12 year old, showed mildsign of hemolysis (Hb 13 g/dL; Retics4.1x10 5 /µL, MCV 91.5 fL, T/I bilirubin: 1.46/1.29 mg/dL) and mildly increased LDH (439U/L). Hb electrophoresis, HbA2 and HbF levels,red cell osmotic fragility test, SDSpolyacrilamidegel electrophoresis of erythrocytemembrane proteins, red cell enzymestudies, acidified serum lysis test (Hamtest), urinary hemosiderin, anti-I and antiiagglutination tests were normal or negativein both patients. Bone marrow cytologyshowed erythroid hyperplasia, witherythroid and myeloid megaloblasticchanges. Marrow iron stores and cytogeneticstudies were normal. Transmissionelectron microscopy revealed a spongy(swiss-cheese) appearence of the erythroblasticheterochromatin. In vitro culturestudies showed reduced number of colonies,especially from BFU-E cells. Erythrokineticstudies showed red cell life span reducedin the propositus (13 days, n.v.>30 days),and normal in the sister (31 days) with nohepatic or splenic radioactivity excess. Webelieve that these two patients suffer froma variant of CDA I. CDA are a heterogeneousgroup of uncommon red cell disorders.Originally, three types of CDA wererecognized (Heimpel and Wendt, HelveticaMedica Acta, 1968). Subsequently, a numberof additional subtypes have been described(Wickramasinghe, BJH 1997 and1998). The genetic lesion causing CDA Ihas not yet been identified. In our youngpatients there are features of CDA I (autosomalrecessive inheritance, macrocytosisin peripheral blood and bone marrow, abnormalultrastructural appearence of theerythroblastic heterochromatin) without thecharacteristic internuclear chromatinbridges in erythroid precursors.P346INCREASED EXPRESSION OFFAS-LIGAND ON BONE MARROWPROGENITOR CELLS OF PATIENTSWITH CHRONIC MIELOID LEUKEMIAC. SELLERI, J.P. MACIEJEWSKI°, P. RICCI, G. VARRIALE,A.M. RISITANO, L. LUCIANO, P. DELLA CIOPPA, B. ROTOLIDivision of Hematology, Federico II University ofNaples, and °Hematology Branch, NHLBI, NIH,Bethesda, MD.Bone marrow (BM) progenitor cells ofchronic myeloid leukemia (CML) expressFas-R (CD95) constitutively and its triggeringresults in decreased proliferation ratedue to apoptosis of clonogenic cells. Wehave shown that IFN-α enhances the expressionof CD95 on CML progenitor cellsand renders them more susceptible toapoptosis induced by Fas-Ligand (CD95-L).Recently, we have documented that Fasmediatedmodulation of bcr/abl results indifferential effects on apoptosis of CML cellsand may correlate with clinical response tointerferon-α (IFN-α). Constitutive expressionof CD95-L has been implicated in theimmune evasion of several types of tumorcells. We have investigated the expressionof CD95-L in 20 patients with CML in chronicphase and its modulation by IFN-α in vitro.By Western blotting performed on T-celldepleted BM cells, we documented thatCD95-L was strongly expressed in 9/10 CMLin chronic phase and more intensely in 2/2patients in blastic crisis, whereas it wasweakly expressed in normal BM hematopoieticcells. Using two-color flow cytometrywith FITC-conjugated anti CD95-L(Pharmingen) and PE-conjugated anti CD34(Becton-Dickinson), performed in the presenceof the metalloproteinase inhibitorK8103 (10µM) to prevent CD95-L shedding,we found that CD34 + BM CML cells in thechronic phase showed significantly higherexpression of CD95-L (mean percentage ±SEM of CD34 + CD95-L + within CD34 + cells:40 ± 12, n=8) compared to CD34 + BM normalcells (CD34 + CD95-L + : 14.5 ± 6.5, n=7;p= 0.01). In addition, we found that IFN-αwas not able to modify CD95-L expressionon CML BM cells. Our results indicate that:i) CML BM progenitor cells constitutivelycoexpressed CD95 and CD95-L; ii) CD95-Lexpression may exceed CD95 expression onCML cells inducing a specific immune toleranceto the CML clone and/or its escape

262 September 26-29, 1999 - Torino-Lingotto, Italyfrom immune surveillance; iii) IFN-α maymodulate the balance between CD95 andCD95-L expression on CML BM cells, byupregulating CD95 but not CD95-L, therebyimproving their elimination by the immunesystem.P347PREDICTING THE PROGRESSION TOSEVERE ANEMIA IN MYELOFIBROSISWITH MYELOID METAPLASIA.RETROSPECTIVE ANALYSIS OF 100CASES IN A SINGLE INSTITUTIONB. MARTINO, F. RONCO, M. COMIS, G. IARIA, A. MARINO,F. M ORABITO, E. OLIVA, N. RANIERI, I. VINCELLI, F. NOBILEDipartimento di Emato-Oncologia, Az. OspedalieraBianchi-Melacrino-Morelli, Reggio CalabriaWe retrospectively analyzed 100 consecutivecases of Myelofibrosis with myeloidmetaplasia (MMM) in order to define featuresassociated with the development ofsevere anemia and overall survival. Seventy-ninecases, without severe anemia atdiagnosis, could be evaluated for the occurrenceof this complication and nearly33% of them developed anemia. Inunivariate analysis, male sex, age over 60years, low platelet count and presence ofcirculating erythroblasts were significantlyinfluencing the time to the development ofsevere anemia. The latter 3 parametersretain their significance in multivariateanalysis. A score risk identified a high riskgroup with a median time to severe anemiaof 36 months and a low risk group inwhich anemia did not appear. The overallsurvival of the entire series was 48 months.In multivariate analysis older age and lowplatelet count significantly influenced survival.Three risk groups with different mediansurvivals were developed. Since themajority of patients were in the intermediaterisk group, the parameters with prognosticpower in this setting were furtheranalyzed. The level of marrow fibrosis andpresence of circulating erythroblasts wereidentified as adverse prognostic factors inCox regression analysis. In conclusion, accordingto our experience, it is possible topredict the development of severe anemiaand survival through the analysis of prognosticfeatures at presentation.P348MYELODYSPLASTIC SYNDROMES(MDS): PROGNOSTIC SIGNIFICANCEOF CELL CULTURE, CYTOGENETICPATTERN AND CD34 EXPRESSIONA. LORENZI, M. BONFICHI, A. BALDUINI*, C. MARSEGLIA,P. BERNASCONI, M. BONI, E.P. ALESSANDRINO, G. PAGNUCCO,L. VANELLI, C. BERNASCONIInstitute of Hematology, Univ. of Pavia. IRCCSS.Matteo Pavia. Laboratory of Biotechnology*, Univ.of Pavia. IRCCS S.Matteo PaviaThe heterogeneity which characterise MDShas been until now an important hindranceto a correct clinical-prognostic definition.The aim of our study was to evaluate theimpact on overall survival of three biologicalvariables: progenitors proliferation invitro, surface antigen CD34 expression andchromosomal pattern. Mononuclear bonemarrow cells from 21 patients with primaryMDS (according to FAB criteria: 8 RAEB-T,5 RAEB, 7 RA, 1 RARS) at onset were studiedfor progenitor hemopoietic growth (CFU-GM, BFU-E and CFU-GEMM), CD34 positivecell counting and cytogenetic pattern. Incomparison with normal laboratory range,in all samples we have observed a decreasedin vitro growth: we have found reductionof CFU-GM and BFU-E growth andabsence of CFU-GEMM colonies. Colonynumber has shown a significant correlationwith survival (p

37 th Congress of the Italian Society of Hematology263proliferation may be useful parameters tobe considered for improving the prognosticefficacy in MDS. In particular if in vitro proliferationcould be a sign of normal maturationand effective hemopoiesis, and if thehigher CD34+ expression could indicate abnormalmaturation and ineffective hemopoiesis,we think that karyotype andCD34 expression evaluated on cells derivedfrom the single progenitor colony couldprovide further indications about clinical andprognostic utility of these parameters.aspirates or peripheral blood and seeded inliquid cultures with different concentrationsof As 3O 2. Cell cycle distribution andapoptosis induction were evaluated afterfive days by cytofluorimetric analysis. Theresults show that blast cells respond toAs 3O 2treatment by an increase in theirapoptotic fraction, while no significant variationin cell cycle distribution is observed.The significance of these data for the therapeuticuse of As 3O 2is under evaluation inour Center and will be discussed.P349APOPTOSIS-INDUCING THERAPY INMYELODYSPLASTIC SYNDROMES:PRELIMINARY RESULTS WITHARSENIC TRIOXIDEA. DONELLI, C. CHIODINO, T. PANISSIDI, R. RONCAGLIA*,R. MARASCA, F. NARNI, G. TORELLISection of Hematology , Department of Medicine,University of Modena and * Immuno-hematologyand transfusion center, Azienda Policlinico, ModenaWe observed a good correlation betweenthe in vivo response and the in vitro responseof cells from a patient with retinoicresistantAML-M3 treated with Arsenic Trioxide.The in vivo-in vitro correlation wasmaintained during progression of thedisease.The response in vitro was evaluatedby induction of apoptosis in liquidcultureThere is a limited range of therapeuticoptions for patients suffering frommyelodysplastic syndromes (MDS) or acuteleukemias resistant to conventional chemotherapy.MDS are characterized by the apparentparadox of peripheral cytopenias andnormo-or hypercellular bone marrow. It hasbeen hypotesized that an increased rate ofcell proliferation compensate the increasedrate of cell death in MDS bone marrow.However, the therapeutic approaches basedon this hypothesis have been disappointingso far. Failure of conventional therapiesas well as the good correlation observedfor AML-M3 prompted us to evaluate theeffect of a different strategy in this groupof diseases, based on apoptosis inductionof neoplastic cells. We evaluated blast cellsobtained from a series of patients with MDS(n=8), secondary AML (n=2) , AML-M0(n=1),and myelofibrosis in blast crisis(n=1). For the in vitro study, mononuclearcells were separated from bone marrowP350SERUM CYTOKINES ANDMYELODYSPLASTIC SYNDROMES(MDS): CLINICAL AND BIOLOGICALIMPLICATIONSP. M USTO, G. SANPAOLO, R. MATERA, M. MINERVINI,M. CAROTENUTODivision of Hematology, IRCCS “Casa Sollievo dellaSofferenza”, S. Giovanni Rotondo, ItalySerum levels of 11 cytokines with hematopoieticactivity were determined atdiagnosis in 120 MDS patients by meansof EL ISA assays (50 RA, 20 RARS, 25 RAEB,12 RAEB-T, 13 CMMoL). Overall, medianvalues of EPO (395 +/- 106 vs 15 +/- 5miu/ml, p < 0.001), G-CSF (301 +/- 160vs 10 +/- 4 pg/ml, p < 0.001), GM-CSF(52 +/- 12 vs 2 +/- 0.2 pg/ml, p < 0.02),TNF (39+/- 8 vs 10 +/- 3 pg/ml, p < 0.05),IL-1 beta (213 +/- 155 vs 40 +/- 6 pg/ml,p < 0.04), IL-8 (3230 +/- 1310 vs 50 +/-17 pg/ml, p < 0.001), M-CSF (992 +/- 464vs 200 +/- 20 pg/ml, p < 0.001) and TPO(555 +/- 108 vs 126 +/- 31 pg/ml, p

264 September 26-29, 1999 - Torino-Lingotto, Italy8 and TNF were measured in RAEB-T andCMMoL, respectively. Despite high circulatinglevels of G-CSF and GM-CSF, all patientstreated in vivo using these cytokinesshowed a significant increase in WBC count.In patients treated with r-EPO an erythroidresponse occurred only in some subjectswith unadequate EPO serum levels (O/Pratio < 0.8) with respect to the degree ofanemia, while no response was seen in patientswith increased TNF and/or IL-1 beta.Thus, the combination of unadequate productionof stimulating cytokines (i.e. SCF)with the excess of inhibitory molecules onhematopoiesis likely contributes to themarrow failure of MDS and represents thebasis for a more rational clinical use of oldand new growth factors in these patients.P351APOPTOSIS IN MYELODYSPLASTICSYNDROMESM.C. SACCHI**, L. TARTUFERI**, L. CALCAGNO**,F. S ALVI**, L. DE PAOLI**, M. PINI**, A. BARALDI**,G. BONELLI*, F.M. BACCINO*, A. LEVIS***Dip.di Med. ed Oncol. Sper., Centro CNR CIOS;Università degli Studi di Torino; **U.O.A. diEmatogia, Azienda Ospedaliera di AlessandriaIntroduction. A positive modulation ofapoptosis has been recently proposed in thepathogenesis of myelodysplastic syndromes(MDS). Some previous studies reportgreatly high values of apoptosis in the marrowof MDS patients (Raza et al., Blood86:269, 1995; Feneaux, 1996; Aul et al.,1998) and have suggested that increasedapoptosis of bone marrow cells could be themajor mechanism underlying this phenomenon.Patients and Methods.Twenty-twocases of MDS, including seven RA, eightRAEB, four RAEB-t, three CMML and threenormal marrows were analysed. Morphologicaland immunoistochemical analysis ofapoptosis was made on all bone marrowbiopsy samples, and in 10 of these casesflow cytometric analysis was also performed.The TUNEL technique was executedon bone marrow smears with the APOTAGkit (Oncor). Fas antigen, Fas Ligand, p53,Bcl-2 and ki-67 protein expression were determinedby immunocytochemistry on bonemarrow smears using DX2 (Dako), A11 (Kamya Biomedics Company), Do7 (Dako),Mib-1 (BioGenecs) and Clone 124 (Dako)MoAbs, respectively. For a further investigationof apoptotic cells in MDS, we usedtwo different flow cytometric techniques:1) Annexin V and simultaneous stainingwith Propidium Iodide in order to discriminatenecrotic from apoptotic cells; 2) measurementof hypodiploid cells that allowsto identify apoptotic cells as a sub-G 0/1peak. Results. In the three bone marrowcontrols, no morphological evidence ofapoptosis and < 1% TUNEL positive cellswere seen. In the 22 MDS cases we observeda very low percentage of cells showingmorphological evidence of apoptosis.The TUNEL positive cells were less than 2%in 15 out of the 22 MDS cases, while in theremaining 7 cases (3RA, 2 RAEB and 2RAEB-t) the percentage of positive cellsranges from 3 to 6%. According to this result,we observed a very low rate of AnnexinV positive-Propidium Iodide negative cells(< 4%) and it was difficult to check thepresence of the hipodyploid DNA. Bcl-2, ki-67 and p53 expression didn’t show considerablevariations in the MDS subgroups;however, it was interesting to note that in4 patients, including 1 RA and 3 RAEB-t,exists an inverse correlation between thepercentage of Bcl-2-positive cells and theTUNEL-positive one. The expression of thecell-surface receptor Fas (CD95) and itsligand (Fas-Ligand), in both immunocytochemicalstaining and flow cytometricanalysis, was similar to controls (< 3%) in15 cases and it was increased up to 10% inthe remaining 8 cases (all RA). Conclusions.These results suggest that MDS maybe characterised by apoptotic rates lowerthan those reported in literature. Therefore,a further improvement in the comprehensionof the apoptotic phenomenon in MDSis requested, in order to define what is theexact role of apoptosis in MDS pathogenesisand evolution.P352IN VITRO IRON CHELATION DYDESFERRIOXAMINE REDUCES APOPTOSISOF MYELODYSPLASTIC CELLSA. CORTELEZZI, C. CATTANEO, M. D. CAPPELLINI*, B. SARINA,S. CRISTIANI, L. DUCA*, N.S. FRACCHIOLLA, I. SILVESTRIS,G. LAMBERTENGHI DELILIERS°Serv. Aut. di Ematologia, Centro AnemieCongenite*, Centro Trapianti Midollo°, OspedaleMaggiore, IRCCS, Milano, ItalyIron overload, due to the increased ab-

37 th Congress of the Italian Society of Hematology265sorption following the anemic state, is usuallyobserved in MDS patients, evenuntransfused. This pathologic phenomenongenerates low molecular weight iron complexesor non-transferrin bound iron (NTBI),which in turn favourish the formation ofpotentially toxic oxygen derivatives. OxidativeDNA damage seems to be implied inincreased apoptotic rate of MDS CD34+. Wetherefore evaluated if in vitro iron chelationby desferrioxamine could reduce inoxydative damage and thus apoptosis inMDS. Patients and Methods. Seven MDSpatients (FAB) and 10 normal subjects wereevaluated. Serum NTBI was evaluated bymeans of HPLC. The bone marrow mononuclearcells (BMMNC) were separated bymeans of gradient centrifugation and thenincubated for 24h with IMDM + autologousserum 10% ± desferrioxamine 0.5 µmol/ml. Apoptosis was evaluated by means ofTdt/dUTP on fresh and incubated samples.Results. Serum NTBI levels were higher(p

266 September 26-29, 1999 - Torino-Lingotto, ItalyP354ANALYSIS OF CLONALITY OF LONGTERM CULTURE-INITIATING CELLS INFEMALE PATIENTS WITHMYELODISPLASTIC SYNDROMESM. GALLICCHIO, E. OMODEO ZORINI, F. CAPELLI, I. ROGNONI,M. VIDALI, D. DE MICHELI, A. SERRA, E. GOTTARDI,G. SAGLIO, G.C. AVANZIDepartment of Medical Sciences, Amedeo AvogadroUniversity of Eastern Piedmont, Novara; Division ofInternal Medicine and Hematology, Department ofClinical and Biological Sciences, University ofTorino, Orbassano, ItalyThe Myelodisplastic syndromes (MDS) arean heterogeneus group of stem cell disorderscharacterized by maturational defectsof marrow hematopoietic cells, resulting incytopenia, morphologic dysplasia and ineffectivehematopoiesis. These disorders derivefrom clonal expansion of abnormalmultipotent hematopoietic progenitor cells.Recent studies have demonstrated that residualpolyclonal hematopoietic progenitorcells can be detected in the bone marrowof MDS. Aim of this work is to evaluate theclonality of totipotent hematopoietic progenitorcells in female patients with MDS.We have analysed 4 female patients, withMDS. Clonality was evaluated by the analysisof the polymorphism of a short tandemrepeat in the X-linked human androgenreceptor(HUMARA) gene. In each patientswe evaluated peripheral blood granulocytes,colonies derived from unpurified bone marrowprecursors and long term culture-initiatingcells (LTC-IC). LTC-IC were obtainedfrom bone marrow mononuclear cells enrichedusing the negative selection StemCellmethod (CD34 + , CD38 - , HLADR - , CD33 - ),cultured in liquid medium for 3 weeks withSCF, TPO and FL and then cultured for twoadditional weeks in semi-solid medium.Three patients had a monoclonal pattern inperipheral blood granulocytes, monoclonalitywas also detected in peripheral bloodlymphocyte in two cases. Stem cell clonalitywas completely evaluated in one patient:colonies from unpurified bone marrow precursorwere monoclonal, whereas LTC-ICwere polyclonal. Preliminary data, obtainedin other two patients, confirm that LTC-ICare polyclonal. These results, if furtherlyconfirmed, suggest that policlonal totipotentprogenitor cells are still present in thebone marrow of MDS patients.

37 th Congress of the Italian Society of Hematology267BIOLOGYP355LEVELS OF IL-4, IL-10 AND INF-γ INTHE SERUM AND IN THE PBMCCULTURE SUPERNATANTS FROM 31PATIENTS WITH HEMATOLOGICALMALIGNANCIESG. MANTOVANI, A. MACCIÒ, P. LAI, E. MASSA, M.C. MUDU,L. MURA, C. MULASDepartment of Medical Oncology, University ofCagliari, ItalyObjectives. We studied the productionof TH 1-type versus TH 2-type cytokines bylymphocytes of patients (pts) with hematologicalmalignancies: these cytokines mayplay a role in disease progression.Interleukin (IL-)4 and IL-10 are cytokinesproduced by TH 2-type whereas interferon(IFN-)γ is produced by TH 1-type lymphocytes.The major antineoplastic activity isplayed by host’s TH 1-type cells. A shift fromTH 1-type cytokines towards TH 2-type is consideredan evidence and a possible causeof cancer progression. Methods. We studiedthe levels of IL-4, IL-10 and IFN-γ inthe serum and in the culture supernatantsfrom PHA- or anti-CD3 monoclonal antibody(MoAb)-stimulated peripheral blood mononuclearcells (PBMC)] in 36 pts (mean age57.3 years, range 23-83) with hematologicalmalignancies [14 non-Hodgkin’s lymphoma(NHL), 6 Hodgkin’s lymphoma (HL),10 multiple myeloma, 4 hairy cell leukemia(HCL), 1 chronic myelogenous leukemia(CML) and 1 chronic lymphocytic leukemia(CLL)]. Ten age-sex-matched normalsubjects were used as controls. The pts withNHL, HL and HCL were divided in twogroups: those with active disease (AD) andthose in clinical complete remission (CR);the pts with myeloma were all AD whereasthe pts with CML and CLL were in CR. Results.Serum levels of IL-4 and IFN-γ werein the same range in pts (either AD or CR)and in control group. Serum levels of IL-10were significantly higher in pts with NHL,HL and HCL with AD as compared either topts with NHL, HL and HCL in CR, myeloma,CML, CLL or controls. The levels of IFN-γ inculture supernatants from PHA- or anti-CD3MoAb-stimulated PBMC were in the samerange in controls and in all pts except thatwith HCL (AD), in whom the levels werehigher. The levels of IL-4 were higher inculture supernatants from PBMC of pts withNHL, HL, HCL (AD) and myeloma than thoseof pts in CR and controls. The levels of IL-10 were higher in culture supernatants fromPBMC of pts with AD in comparison withthose of pts in CR and controls. The culturesupernatants from PBMC of pts with HCL inCR had lower levels of IL-10 than that of ptwith AD, even if those levels were higherthan controls. Conclusions. These resultssuggest that in hematological malignancies,especially with AD, there is a shift from TH 1-type to TH 2-type cytokine production, whichmay play a role in disease progression. OnlyPBMC from pt with HCL (AD) were able torelease high amounts of IFN-γ.Work supported by C.N.R., Rome, A.P.“A.C.R.O.”, Contract No. 96.00588.PF39P356INTERLEUKIN-11 INHIBITSINTERLEUKIN-12 PRODUCTION BYMONOCYTES, BUT NOT BY DENDRITICCELLS (DC)A. CURTI, M. RATTA, M. FOGLI, S. CORINTI, G. GIROLOMONI,F. RICCI, P. TAZZARI, S. TURA, R.M. LEMOLIInstitute of Hematology and Medical Oncology“L. e A. Seragnoli”, University of Bologna; Instituteof Transfusional Medicine, University of Bologna;Institute of Dermatology “Immacolata”, RomaInterleukin-11 (IL-11) has recently beenshown to suppress IL-12 production bymacrophages and this finding has been associatedwith the prevention of acute graftversus-hostdisease (GVHD) in a murinemodel. In this study, we determinedwhether IL-11 inhibits IL-12 secretion byDC which represent the major source of thiscytokine. No significant effect of IL-11 wasobserved on both the cellular yield and theabsolute number of DC propagated fromCD34+ cells and from CD14+ cells in thepresence of specific growth factors. In particular,phenotypic analysis showed that 90± 6 % of cells derived from CD14+ cellsand recovered after 6-7 days of GM-CSFand IL-4 with or without IL-11 stimulationwere CD1a+, CD40+, CD80+, CD86+, HLA-DR+, CD83-, CD14-. The same antigenicpattern, typically associated with immature

268 September 26-29, 1999 - Torino-Lingotto, Italydendritic cells, was observed on 22 ± 5 %of the cells derived from CD34+ cells andrecovered after 12 days of stimulation inthe presence and in the absence of IL-11.Moreover, IL-11 did not modify the maturationof DC, induced by the exposure toLPS and to CD40L. Functionally, DC generatedwith or without IL-11 showed the sameproperties in stimulating a proliferative responseof allogeneic lymphocytes and ofautologous lymphocytes, coincubated in thepresence of soluble proteins such as Keyholelimpet hemocyanin (KLH) and TetanusToxoid (TT). We then evaluated the capacityof IL-11 to inhibit the production of IL-12 by IFN-γ primed monocytes and by immatureDC induced by LPS and by CD40Ltransfected fibroblasts, respectively.Whereas, these maturation stimuli wereoptimal inducers of IL-12 secretion anddetermined the upregulation on immatureDC of CD83 and the downregulation ofCD1a, IL-11 inhibited IL-12 production bymonocytes, but not by DC derived fromCD34+ cells and CD14+ cells and did notaffect dendritic cell production of TNFα, IL1βand IL-10. In conclusion, IL-11 does notappear to be capable of preventing a cytotoxicTh1+ immune response by inhibitingIL-12 production by professional antigenpresenting cells such as DC.P357OPTIMIZATION OF CYTOKINECOMBINATIONS FOR EX VIVOEXPANSION OF HUMANHEMATOPOIETIC PROGENITORS INTOTHE MEGAKARYOCYTIC LINEAGEA. DANÈ, S. BRUNO, G. CAVALLONI, W. PIACIBELLO,M. AGLIETTADept of Biomedical Sciences and Human Oncology,Hematology/Oncology Section, University of Torinoand IRCC Candiolo, ItalyPatients treated with high-dose chemotherapyusually develop thrombocytopenia,one of the major risk factor in cancer treatment.Ex-vivo expansion of human hematopoieticprogenitors cells into the megakaryocytic(Mk) lineage and subsequentreinfusion, could be a new therapy to shortenthe period of chemoterapy induced thrombocytopenia.We investigated the ability ofcombinations of different hematopoieticgrowth factors to generate ex-vivo early andlate Mk progenitors. To optimize the cytokinecombinations for ex vivo expansion of humanhematopoietic progenitors into themegakaryocytic lineage, cord blood (CB)-derived CD34 + cells were cultured in thepresence of various cytokine combinations(MGDF, SCF, IL-3, IL-6), cultured for 7, 14,21 and 28 days and analyzed for cell number,phenotype and clonogenic ability. Allcytokine combinations induced formation ofa high percentage of CD41 + cells carryingmorphological features of megakaryocytesand showing signs of polyploidization. Thecombination of MGDF and SCF was found tobe sufficient to obtain high absolute numbersof megakaryocytes and the addition ofIL-3 and IL-6 did not significantly increasein megakaryocyte number. The same growthfactor combinations were used to investigatemegakaryocytic differentiation onimmunoselected CD34 + (CB) cells after 4weeks of expansion in presence of MGDF,SCF and FL; this combination allowed, invitro, extensive amplification and self-renewalof very primitive progenitors from CB(Piacibello, Blood 1997). We analyzed thecells at day 7, 14, 21, 28 for cell number,phenotype, morphology and clonogenic ability.In cultures with MGDF alone a net proliferationwas not observed, whereas only alow increase of absolute number of CD41 +cells was observed. In contrast MGDF+SCFresulted to be sufficient to generate a greatnumber of megakaryocytes and in additioninduced an increase of cellular proliferation.However MGDF is neither necessary nor sufficientto generate a full-proliferative/maturationalin vitro response within the megakaryocytecompartment.P358VARIATION IN QUANTITATIVEEXPRESSION OF CD34 AND CD117SURFACE ANTIGENS DURINGMOBILIZATIONG. D’ARENA, N. CASCAVILLA, R. MATERA, M. CAROTENUTODivision of Hematology, IRCCS “Casa Sollievo dellaSofferenza”, San Giovanni Rotondo, ItalyAdhesion molecules are thought to be involvedin the induced (by chemotherapyand/or growth factors administration) overshootof hematopoietic progenitor cells(HPCs) into the peripheral blood (PB) fromthe bone marrow (BM). We performed a

37 th Congress of the Italian Society of Hematology269quantitative analysis by means of flowcytometry aiming to investigate whetherquantitative changes in the expression ofCD34 (HPCA-2) and CD117 (c-kit receptor),both adhesion molecules, occur duringmobilization. For this purpose we used calibratedstandardized phycoerythrin (PE)-conjugated beads (QuantiBRITE, BectonDickinson, USA) to test PB samples consecutivelycollected after mobilizationtherapy (cyclophosphamide 5-7 g/m 2 + G-CSF) from 9 cancer patients (3 multiplemyeloma, 3 breast cancer, 2 non-Hodgkin’slymphomas, 1 neuroblastoma) and BMsamples from the same patients just beforestarting mobilization. CD34-PE andCD117-PE antigens (the latter on gatedCD34-FITC positive cells) were detected asnumber of molecules/per cell (antibodybinding capacity, ABC). Mean baseline levelsof CD34 and CD117 molecules in BMwere 21,023 ± 10,120 (range: 8,116 –35,199) and 6,124 ± 2,628 (range: 3,490– 10,775), respectively. On the other hand,in PB just before the first leukapheretic collection,the mean number of CD34 ABC was18,384 ± 9,235 (5,332 – 3,558), while itwas 13,016 ± 6,110 (range: 5,332 – 3,558)the next day. However, CD117 ABC meannumber was 2,824 ± 728 (range: 1,470 –11,285) and 3,171 ± 975 (range: 1,937 –5,738) on the first and second leukaphereticdays, respectively. Furthermore, the mostintriguing observation was the progressivereduction of CD34 molecules number alongwith the increasing number of CD117 moleculesduring the mobilization starting fromthe day in which circulating CD34+ HPCsappear until their collections. These findingssuggest that down-regulation of CD34along with up-regulation of CD117 occurrduring the mobilization kinetic and suchchanges are probably involved in the overshootof HPCs from BM into the blood.We report the results of ex vivo expansionexperiments of cultured CD34 cells ina new serum free medium (StemPro-34SFM - Life Technologies) and stimulatedwith several cytokines (IL1β, IL3, IL6, SCF),either in combination with EPO, flt3 ligand(FL) and TPO or alone (basal cytokines).CD34+ cells were collected from 3 patientswith multiple myeloma after mobilisationwith high-dose cyclophosfamide (7 g/ m 2 )and G-CSF (5 µg/kg/die) and positively selectedby immunoadsorption columns(Ceprate® SC). The mean purity of the selectedfraction of CD34+ cells was 89 %.Enriched CD34+ cells were cultured in a15.6 mm well plate at a concentration of30x10 3 /mL. Autologous serum was added(2 %) and basal cytokines added with orwithout EPO, FL and TPO. Cells were incubatedat 37°C, in humidified atmospherewith 5% CO 2. At day 7 an equal volume ofthe medium used on the first day was addedand incubation prolonged for 5 additionaldays. On seeding and at day 7 and 12 thenumber of cells, viability, their clonogeniccapability, the expression of CD 34, 13, 33,61, GlyA and DNA ladder were evaluated.P359INFLUENCE OF DIFFERENT CYTOKINESON THE EFFICIENCY OF EX VIVOEXPANSION OF CD34 AND CFU CELLSUSING A NEW SERUM FREE MEDIUMD. MADEO, A. CAPPELLARI, C. CASTAMAN, F. RODEGHIERODepartment of Hematology, San Bortolo Hospital,Vicenza

270 September 26-29, 1999 - Torino-Lingotto, ItalyThe addition of FL, TPO and EPO to thecocktail of cytokines does not modify thenumber of cells grown. FL alone induces aslight increase of the number of CD34+ cellsat 7 days, of CFU-GM at 12 days and a decreaseof CD117+ cells at day 12 (from 12to 8%). The addition of EPO significantlyincreases the number of GlyA+ cells amplifyingat day 7 the number of CFU-E. Onthe contrary, GlyA+ cells and CFU-E decreaseafter adding FL and/or TPO. Thepercentage of CD13 and CD33 positive cellsremains stable as well as the expression ofCD 61 and the number of platelets in themedium, whatever the combination ofcytokines used (data not shown). In conclusion,the new serum free medium appearsto be suitable for an efficient CD34+expansion and to maintain the clonogenicpotential of CFU cells.P360EFFICIENCY OF EX-VIVO EXPANSIONOF PBPC IN A NEW SERUM FREEMEDIUMD. MADEO, A. CAPPELLARI, C. CASTAMAN, F. RODEGHIERODept. of Hematology, San Bortolo Hospital, VicenzaWe tested the efficiency of a new serumfree liquid medium (StemPro-34 SFM - LifeTechnologies) in the expansion of peripheralblood progenitor cells (PBPC). The resultswere compared with those obtainedwith RPMI1640 + Glutamax (Brugger etal.,1995). PBPC were collected from 3 patientswith multiple myeloma aftermobilisation with Cyclophosfamide (7 g/ m 2 )and G-CSF (5 µg/kg/day) and purified byimmunoadsorption (Ceprate® SC) with anaverage purity of about 90%. Enriched PBPCwere cultured at a concentration of 30x10 3 /mL. Autologous serum (2%) was addedalong with a fixed concentration of rhIL-1β(3 ng/mL), rhIL-3 ( 100 ng/mL), rhIL-6 (100ng/mL), rhSCF (10 ng/mL) (basalcytokines). Furthermore, rhEPO (1U/mL)and/or rhFL (50 ng/mL) were also added insome experiments. After 7 days of incubationan equal volume of basal medium wasadded and incubation prolonged for 5 additionaldays. Clonogenic potential wasassayed at days 0, 7 and 12 in mediumcontaining 0.9% methylcellulose, 30% FBS,1% BSA, 10 -4 M 2-ME, 3U/mL EPO, 50 ng/mL SCF, 10 ng/mL GM-CSF, 10 ng/mL IL-3.After 14 days colonies were counted andexpressed as BFU-E/CFU-E, CFU-GM, CFU-GEMM, the sum is expressed as ColonyForming Cells (CFC). On seeding and at day7 and 12, cell number, viability, clonogeniccapability, positivity for CD 34, 13, 33, 61,GlyA, and 117 and DNA ladder were evaluated.After 12 days, the StemPro mediumgave a larger yield of total cell number aswell as of clonogenic potential. CFU-E and,to a lesser extent, CFC increased in bothmedia at day 7 with EPO. An increased productionof CD34+ cells by FL in RPMI mediumat day 12 and of CFU-GM at day 12by FL in StemPro medium was observed.With RPMI GlyA increased from 3 to 35%at 7 days and CD13 decreased from 75 to35% when feeded with EPO, whereas noincrease was observed with StemPro (5%and 80% respectively). In conclusion, thesepreliminary results suggest that this newmedium is comparable as to efficiency inexpansion and clonogenic capability to thatof a widely used medium.P361PHENOTYPIC CHARACTERIZATION OFPURIFIED AND EX VIVO EXPANDEDUMBILICAL CORDBLOOD CD34 + CELLSC. FERUGLIO, W. MALANGONE, O. BELVEDERE, S. LAVARONI,R. SPIZZO, A. DONINI, G. DEL FRATE, E. TONUTTI,P.G. SALA, A. DEGRASSIConsorzio Fenice, Dip. di Pat. e Med. Sper. e Clin.,Dip. di Sci. Chir., Università di Udine; Lab. di Anal.Chim.-Clin.,Osp. di Udine; Div. di Ostetricia, Osp. diS. Daniele del FriuliEx vivo expansion of umbilical cord blood(UCB)CD34 + hematopoietic stem cells couldovercome the limitednumber of cells obtainedfrom a single UCB collection. In thisstudy weanalyze UCB CD34 + cells phenotypebefore and after ex vivo expansion.CD34 + cells were purified from 13UCBsamples by immunomagnetic separation(Miltenyi, Germany). The meanCD34 +cell purity was 85.1±9.5% (mean ± SD).Purified cells were cultured in medium containingSCF, EPO, IL-1§,IL-3 and IL-6 for14 days at 37 ¡C in a 5% CO 2atmosphere.Nucleated cell number and viability wereassessed by TrypanBlue exclusion test onday 7 and 14. The expression of CD34 anda panel ofdifferentiation markers (CD33,CD36, CD61, CD71, CD38 and HLA-DR)

37 th Congress of the Italian Society of Hematology271wasevaluated by flow cytometry on day 0,7 and 14 (FACScan, Becton Dickinson,USA).Total viable cell number increased 11.7±7.9and83.3±29.6 folds after 7 and 14 days ofculture, respectively. Theexpression ofdifferentation antigens is reported in thefollowingtable.% positive cells (mean ±SD)DAY 0 DAY 7 DAY 14CD34 85.1±9.5 5.8±5.7 0.6±0.4CD33 70.5±18.1 64.2±18.4 32.1±11.9CD36 23.3±12.8 62.4±15.9 60.2±16.7CD61 20.2±16.1 10.2±4.9 7.7±6.8CD71 16.0±6.7 92.1±8.7 78.4±14.3CD38 92.3±4.5 72.0±21.2 38.5±11.9HLA-DR 93.7±5.5 63.7±27.9 59.3±30.7Phenotypic analysis of ex vivo expandedcells allows theevaluation of various hematopoieticlineages and represents ausefulparameter to monitor the expansionprocedure.Supported in part by the Consiglio Nazionaledelle Ricerche n. 97.04090.CT04, theAssociazione Italiana per la Ricerca sulCancro (AIRC) and the Consorzio Universitariodel FriuliP362PHENOTYPIC AND FUNCTIONALDIFFERENCES BETWEEN CD34 + STEMCELLS FROM UMBILICAL CORD BLOODAND MOBILIZED PERIPHERAL BLOODO. BELVEDERE, C. FERUGLIO, W. MALANGONE, G. ASTORI,M.L. BONORA, A. DONINI, C. RINALDI, C. SAVIGNANO,F. BIFFONI, A. DEGRASSIConsorzio Fenice, Dip. di Pat. e Med. Sper. eClin.,Dip. di Sci. Chir., Università di Udine; Lab.Anal. Chim.-Clin.,CentroImm.-Trasf., Osp. di UdineIn this study we analyze the phenotypeand in vitroproliferative capacity of hematopoieticCD34 + stemcells purified from umbilicalcord blood (UCB) and mobilizedperipheralblood (mPB). CD34 + cells werepurified from 49UCB and 5 mPB samplesby immunomagnetic selection (Miltenyi,Germany).Purified cells were double stainedwith anti CD34 and CD71, CD36,CD61,CD7, CD19, or CD33, and triple stained withanti CD34, CD38 andHLA-DR and then analyzedusing a FACScan flow cytometer. Inorder toevaluate the proliferative capacity,CD34 + cells purified from 13 UCB and 5 mPBsamples were cultured in mediumcontainingIL-1§, IL-3, IL-6, SCF e EPO. After 14 daysof culture cellswere harvested and viablecells’ number was assessed by TrypanBlueexclusion test. After purification, themean CD34 + cell purity was 85.49 ± 7.08and 97.06 ± 0.84% for UCB andmPB,respectively. No significant differencewas observed betweenCD34 + cells from UCBand mPB in terms of expression of lineageassociatedmarkers CD71, CD36, CD61,CD7, CD19, CD33. However, a significantlyhigherpercentage of pluripotent stem cells(CD34 + CD38 - ) in UCB compared to mPB wasdetected, as reported in the following table:UCBMPB% CD34 + CD38 + DR + 91.74±3.76 97.36±1.92% CD34 + CD38 + DR - 3.19±1.95 2.5±1.85% CD34 + CD38 - DR + 3.43±2.12* 0.24±0.18% CD34 + CD38 - DR - 1.81±1.54* 0.04±0.03* p

272 September 26-29, 1999 - Torino-Lingotto, Italydence for a complex regulatory mechanismfor Epo production that involves Eporeceptor(R).Hep3B cells were found to expressEpo-R on the cell surface, as identifiedby FACS analysis using the biotinylatedligand and immunocytochemistry; the numberof Epo-R molecules was about 2,100/cells, and were of the low-affinity type. Epo-R was also identified by SDS-PAGE analysis,as a protein of about 68-kDa, analogousto the molecule expressed on erythroidcells. The mRNA for Epo-R was identifiedy RT-PCR amplification followed byhybridization with the cloned hEpo-R cDNA.The Epo-R expressed on Hep3B cells wasnot involved in a proliferative response afterexposure to Epo (0.2-200 U/ml); however,a slight though significant, reductionin Epo mRNA levels was observed in hypoxiccells after the addition of exogenousEpo to the medium. While about 40% ofEpo-R molecules were internalized at 37 °C,no significant modification of the numberof EpoR molecules on the cell surface wasobserved after exposure to hypoxia. Therefore,EpoR seems to be involved in a feedbackregulation of Epo synthesis in Hep3Bcells. To further characterize the relationshipsbetween EpoR and its ligand in Epoproducingcells, we looked at other cellularcomponents known to be linked to theEpoR in erythroid cells. We found thatHep3B cells also express GATA-1 and GATA-2, but not GATA-3, mRNAs (by RT-PCR) andproteins (by immunocytochemistry); thesetranscription factors were expressed in bothnormal and hypoxic cells, with no regulationof their expression by hypoxia. Exposureof the cells to Epo, however, induced aburst of GATA-1/GATA-2 expression, whichcould be linked to the signal mediated byexogenous Epo. In conclusion, these datasupport a model in which a functionallyactive regulatory complex based on EpoRmay be involved in the regulation of erythropoietinproduction by Hep3B cells; of concernmay be that an autocrine regulatorymechanism for Epo synthesis has recentlybeen demonstrated also in primary murineerythroid cells.P364IN VITRO EXPANSION OF HUMANHEMOPOIETIC CELLS IN DEFINEDSERUM-FREE MEDIUMB. ROSSI, E. ZANOLIN, C. VINCENZI, G. PIZZOLO,G. PERONA, G. NADALIDepartments of Clinical and Experimental Medicine,Section of Hematology, and Medical Statistic,University of Verona, ItalyClarification of the mechanisms that regulatehemopoietic cell expansion in vitrowould be facilitated by the identification ofdefined culture conditions. We report theresults of seven experiments with cordblood (CB) and three experiments withbone marrow (BM) CD34+ cells using twocombinations of cytokines: “A”) G-CSF, IL-3, IL-6, SCF, EPO, IGF-1, bFGF; “B”) combinationA plus FLT3 ligand (FL) and TPO.Cultures of 5x10 3 immunoselected CD34+cells (purity range 74-95%) were performedin serum-free liquid medium withoutserum sobstitutes. Cultures wereweekly fed by replacement of half of themedium and tested for cell viability, percentageof CD34+ cells and colony formingcells (CFC) content for a minimum of 6weeks. The area under the curve (AUC)obtained by plotting the logarithm of thenumber of viable cells, CD34+ cells andGM-CFC per well, towards the week of culturewas used as index of cell expansion.Comparisons were performed using theMann-Whitney test. Using CB CD34+ cellsa significant difference was obtained betweenthe two combinations of cytokineswhile the difference obtained using BMCD34+ cells did not reach a statistical significance.

37 th Congress of the Italian Society of Hematology273By the analysis of the AUC we confirm ourprevious report about the additional effectsof FL and TPO to other cytokines for theexpansion of hemopietic cells in serum freeex vivo culture. Furthermore, our data suggesta possible different expansion capabilityof CD34+ cells from different sources.P365EX-VIVO EXPANSION OF CD34 + CELLSFROM MOBILIZED PERIPHERAL BLOODAND BONE MARROWA. SEVERINO, E. PERISSINOTTO, A. MAGNINO, W. PIACIBELLO,M. AGLIETTADept of Biomedical Sciences and Human Oncology,Hematology/Oncology Section, University of Torinoand IRCC Candiolo, ItalyHematopoietic progenitors cells in humanbone marrow (BM) and mobilized peripheralblood (MBP) have been shown to beeffective sources for hematopoietic reconstitutionfollowing myeloablative therapy,but sometimes the quantities collected areinadequate for transplant. The synergisticactivity of FL, SCF and MGDF on cord bloodhematopoietic progenitors have been previouslydemonstrated. We have investigatedthe effect of these cytokines, with or withoutthe addiction of IL6 and IL3, on ex vivoexpansion of BM and MBP. Ex vivo expansionof CD34 + cells from BM and MBP couldprovide the necessary number of progenitorscells for hematopoietic reconstitution.CD34 + cells from BM and MPB were culturedin stroma free suspension cultures in thepresence of FL, SCF, MGDF, IL-3 or IL-6which were added alone or in various combinationsat the beginning of the culturesand then replaced twice a week. Cells wereharvested weekly, counted and aliquotswere kept for assessment ofimmunophenotype, CFC and LTC-IC. Whensuspension cultures were extended forlonger periods of time, the combinationcontaining FL, SCF, MGDF±IL-6 proved capableof supporting a prolonged expansionfor up to 16 weeks and reached 125,000-fold the initial number. Accordingly, also theoutput of committed progenitors persistedand kept increasing up to 12-15 weeks (upto > 7,000-fold). Limiting Dilution Analysesshowed that not only LTC-IC persisted,but also underwent a certain degree of expansion(up to 100-fold at week 4 to 6).We have noticed that, in contrast to CB experiments,for the expansion of CD34 + cellsfrom BM and MPB, FL and MGDF were necessary,but not sufficient to allow such anexpansion. In fact, in addition to these twogrowth factors, other growth factors, amongwhich SCF, IL-6, (IL-6+IL-6R) and also verylow doses of IL-3 seem to be important formaintenance and amplification of BM andMPB more primitive stem cells. This representsa first step towards larger scale culturesfor transplantation and gene therapyprotocols.P366CAPILLARY CITOFLUORIMETRY INASSESSING HAEMATOPOIETICPRECURSORS AFTER PERIPHERALBLOOD STEM CELL MOBILIZATION INHEALTHY DONORST. ZEI, D. ALFONSI, A. SANTUCCI, S. MARCHI, F. FALZETTI,A. TABILIOHaematology and Clinical Immunology Section,Department of Clinical and Experimental Medicine,University of Perugia, Perugia, ItalyThe use of peripheral blood mobilized stem

274 September 26-29, 1999 - Torino-Lingotto, Italycells is becoming widespread as rescuetherapy after myeloablative chemo-radiotherapyin autologous transplant. Recentlythe use in allogeneic BMT has required oneven more accurate rapid and reproduciblequantification of CD34 + cells upon whichshort and long-term haemapoietic reconstitutiondepends. Several flow-cytometrysystems (FCS) have been used to detectthe stem cells but the results are discrepant.Recently Capillary Citofluorimetry (CFF)has been used to detect CD34 + cells in peripheralblood before and after mobilizationwith haemapoietic growths factors. Wereport our results with this technique in rhG-CSF mobilized peripheral blood stem cellsin healthy donors to quantify the CD34 + cellsdestined for patients undergoing allogeneictransplant. 86 peripheral blood samples wereanalyzed using 1) capillary citofluorimetry(IMAGN 2000, Biometric Imaging Inc., USA)2) flow-cytometry (Epics, Coulter, USA)using the Milano protocol, and 3) clonogenictests for CFU-GM and BFU-E. The CFC yieldof CD34 + cells correlated with the FCS yield(r 2 =0.49). Linear correlation emerged betweenthe CFC CD34 + yield and the CFU-GM (r 2 =0.47) and BFU-E (r 2 = 0,30) . However,the absolute number of CD34 + detectedby CFC was significantly lower(p

37 th Congress of the Italian Society of Hematology275constitutively expressed on professionalAPC which can bind to specific T cell receptorssuch as CD28 and CTLA-4. Since a subsetof normal CD34 + hematopoietic progenitorsis also CD86 + , in this study we analyzedCD86 expression on acute myelogenousleukemia (AML) blasts. 27 out of 43(63%) consecutive AML cases (M1=7,M4=13, M5=7) showed CD86 expressionon ≥10% of blast cells. By three-color flowcytometry analysis CD86+ blasts resultednegative for both CD14 and CD34 in 6 cases,partially positive for CD14 in 12 cases, partiallypositive for CD34 in 3 cases, while inthe other 6 cases both CD86 + CD14 + andCD86 + CD34 + populations were present.CD86 + blasts induced an allogeneic T-cellproliferative response in primary and in secondaryMLR in 7/7 experiments, and a cytolyticresponse in 1/5 experiments. Also,different proportions of CD86 + blasts rapidlydifferentiated into mature DC after 3days in vitro culture with GM-CSF and IL-4, as defined by electron microscopy, phenotypicexpression of CD86, CD80, CD40,CD83, CD1a and HLA-DR, and ability of inducingT cell proliferation and CTL generation.These data suggest that CD86 expressionmay identify monocytoid blasts independentlyon CD14 and CD34 expression.Furthermore, since CD86 + blasts seem notto induce immune tolerance and may rapidlydifferentiate into DC, these findingsmight be helpful for developing new strategiesof anti-tumor vaccination.P369MDS DENDRITIC CELLS AREPHENOTYPICALLY ANDFUNCTIONALLLY DIFFERENT FROMTHOSE OBTAINED IN HEALTHYSUBJECTSThe development of a specific T-cell responserequires optimal presentation ofantigens by a MHC class II molecule, anddelivery of one or more costimulatory signalsprovided by professional antigen presentingcells such as dendritic cells (DC) tonaive T-cells. Using a combination of GM-CSF and IL-4 we have evaluated the possibilityto generate in vitro DCs from the peripheralblood mononuclear fraction of patientsaffected by myelodysplastic syndromes(MDS) and we have investigatedtheir phenotypic and functional similarityto DCs generated in a similar way fromhealthy donors. DCs were studied by flowcytometry using a combination of monoclonalantibodies (CD1a, CD4, CD14, CD45,CD54, CD80, CD83, CD86, and class II)while their ability to induce allogeneic cellproliferation was evaluated in the mixedleukocyte reaction (MLR). After 10 days ofculture, reduced numbers and percentagesof DCs were obtained in MDS subjects.When compared to normal subjects, MDSDCs were found to present a significantlower intensity of expression of CD1a, CD54,CD80, and class II molecules. MDS DCswere able to stimulate an allogeneic MLRbut their ability to prime T lymphocytes wasless potent than in normal subjects. MDSDCs also showed a reduced receptor-mediatedendocytic capacity, evaluated by FITCdextranendocytosis. A combined FISHimmunophenotypic analysis demonstratedthat MDS DCs have the same cytogeneticabnormality of the malignant clone. On thewhole, our findings suggest that in MDSsubjects there may be a defect in themechanism of antigen uptake and presentation,which may probably contribute tothe development of the disorder, and to theincreased susceptibility to infectious diseasein these patients. Further studies areneeded to determine the mechanisms,which may account for these phenotypic andfunctional DC defects in MDS patients.G.M. RIGOLIN^*, W. HIRST^, A. BUGGINS^,C. SNEDDON^, G. CASTOLDI*, G.J. MUFTI^^Dept. of Haematological Medicine, King’s Collegeof Medicine, London, UK; *Dept. of BiomedicalSciences, Haematology Section, University ofFerrara, Italy

276 September 26-29, 1999 - Torino-Lingotto, ItalyP370FLT-3 LIGAND SYNERGIZES WITHINTERLEUKIN-6 AND STEM CELLFACTOR TO PRESERVE A PRIMITIVEHEMATOPOIETIC STEM CELLPHENOTYPE AND TO FACILITATERETROVIRAL TRANSDUCTION IN VITROF. BERGER 1 , K. SCHWARZ 2 , P. BOSSOLASCO 1 , H. SCHREZENMEIER 3 ,B. KUBANEK 3 , T. LICHT 4 , G. LAMBERTENGHI-DELILIERS 1 , D. SOLIGO 11Fondazione Matarelli, Bone Marrow TransplantationUnit, IRCSS Ospedale Maggiore, Milan, Italy, 2 Dept.of Internal Medicine III, Technical University ofMunich, Germany, 3 Dept. of Transfusion Medicineand Internal Medicine III, University of Ulm,Germany, 4 Lab. of Molecular Biology, NationalCancer Institute, Bethesda, USAA major goal of current research in hematopoiesisis efficient transfer of genes tohuman peripheral blood stem cells (PHSC)which possess extensive proliferative capacitybut are elusive targets for retroviral genetransfer. To achieve stable long-term geneexpression in multiple lineages of the hematopoieticsystem, culture conditions arerequired by which these cells are activatedwithout being differentiated. In the presentstudy, we analyzed immunomagneticallyseparated CD34 + HLA-DR low cells from mobilizedperipheral blood grown in the presenceof various combinations of growth factorsfor the preservation of a primitive stemcell phenotype. Virtually all CD34 + HLA-DR lowcells excluded rhodamine-123 (Rho) by thetime the cultures were initiated, but thisprimitive Rho low phenotype was subsequentlylost in the presence of interleukin-(IL-) 3 alone or combined with other factors.In contrast, Flt-3 ligand (FL), stem cellfactor (SCF) and IL-6 maintained the Rho lowphenotype in the majority of cells for at least5 days, both when used as single factorsand in combination. Moreover, the combinationof FL, SCF and IL-6 stimulated proliferationof CD34 + HLA-DR low cells, which isa prerequisite for retroviral gene transfer.Next, we investigated which cytokine combinationsfacilitate stroma-free transductionof primitive hematopoietic cells. CD34 + HLA-DR low cells, grown on fibronectin-coatedplates, were transduced for 5 days with 2daily changes of cell-free supernatant fromPA317-based retroviral producer cells whichcontained an MDR1 cDNA, flanked byHarvey virus long-terminal repeats. Integrationof proviral MDR1 cDNA into primitivehematopoietic cells was then analyzedin a microwell long-term culture system.Wells containing cobblestone areas derivedfrom single CD34 + HLA-DR low cells were analyzedby PCR and Southern hybridization.Proviral MDR1 cDNA was detected in 68%of the progeny of CD34 + HLA-DR low cellswhich had been stimulated with FL, SCF andIL-6 during transduction, and in 45-60% ofcells stimulated with IL-3 containing growthfactor combinations. Our study shows thatefficient retroviral transduction of primitivehematopoietic progenitor cells is feasible.However, IL-3 is not practical since it maycause differentiation with loss of stem cellphenotype under the given culture conditions.P371GM-CSF, TNFα, ATRA or 1α,25-(OH) 2D 3REGULATE THE EXPRESSION OF THEPROTOTYPICAL MITOGENIC PEPTIDEHB-EGF IN NEOPLASTIC AND NORMALMYELOID CELLSA. RIGO, M.A. CASSATELLA*, G. PERONA, G. PIZZOLO,F. VINANTEDept. of Clinical and Experimental Medicine, Sectionof Hematology & *Department of Pathology, Sectionof General Pathology, University of Verona, ItalyHeparin-binding EGF-like growth factor(HB-EGF) is a widely expressed EGF superfamilymember. It induces mitogenic and/or chemotactic activities towards smoothmuscle, endothelial and epithelial cells, fibroblastsand astrocytes through bindingto EGF receptors 1 or 4. Membrane-boundHB-EGF exerts growth activity and adhesioncapabilities and possesses the uniqueproperty of being the receptor for diphtheriatoxin (DT). Using molecular (RT-PCRcloning, Northern blot, flow cytometry,ELISA) and functional (mitogenic activityon BALB/c 3T3 cells, sensitivity to the proapoptoticeffect of DT) approaches we studiedthe expression of HB-EGF in acute myeloidleukemia (AML) primary cells and celllines (ML-3, HL-60), normal monocytes(Mo) and polymorphonuclear granulocytes(PMN) either in basal conditions or uponstimulation with GM-CSF, TNFα, ATRA,1a,25-(OH) 2D 3or numerous other agonists.AML cells of various FAB subtypes, ML-3 and

37 th Congress of the Italian Society of Hematology277HL-60 cells as well as Mo expressed andreleased a fully functional HB-EGF in basalconditions. Stimulation with GM-CSF, TNFα,ATRA, 1α, 25-(OH) 2D 3upregulated mRNAand membrane expression/release of HB-EGF peptide. AML primary cells and PMN,which did not express HB-EGF in restingconditions, expressed it at mRNA and proteinlevel, following incubation with GM-CSF.The effects of GM-CSF on HB-EGF mRNAexpression in PMN were concentration-dependent,reached a plateau after 1-2 hoursof stimulation and did not require proteinsynthesis. HB-EGF was detected by flowcytometry on cell membrane and by a specificELISA in the culture medium. At thesame time, PMN acquired sensitivity to theapoptosis-promoting effect of DT, which,moreover, specifically suppressed the GM-CSF-induced priming of fMLP-stimulatedsuperoxide anion release. By contrast, otherclassic agonists (including LPS, phagocytableparticles, G-CSF or various ILs)failed to induce HB-EGF in PMN. Becausewe could not demonstrate expression of HB-EGF receptors on the cells studied, we tendto exclude HB-EGF-related autocrine mechanisms,especially in AML cells and PMN.Previous studies and the HB-EGF gene promoterorganisation strongly suggested thatRas pathway was involved in GM-CSF-inducedHB-EGF upregulation. Thus, we provideevidence that HB-EGF is specificallyinducible by GM-CSF, TNFα, ATRA, 1α, 25-(OH) 2D 3in myeloid cells and represents anovel peptide to be included in the repertoireof AML- and PMN-derived cytokines.P372A CASE OF CHRONIC T CELLLYMPHOCYTOSIS AFTER ACUTEREACTIVATION OF EBVK. CAGOSSI, M. LUPPI, M. MORSELLI, G. EMILIA, P. BAROZZI,G. LONGO, A. PIETRAMAGGIORI., R. MARASCA, G. TORELLIDepartment of Medical Sciences, section ofHaematology Modena ItalyEBV infection is associated with both acytotoxic T-cell response directed againstEBV-infected B lymphocytes and a transientincrease in Large Granular Lymphocites(LGL) with enhanced NK activity. We studieda patient 82 years old with a IdiopaticTrombocytopenic Purpura (ITP) treated withlow dose of corticosteroides for threemonths. In the last year the patient hasbeen admitted to hospital for a month withfever, illness and malaise with laboratoryevidence of liver function impairement. Serologicstudies showed an increse of AST(107 u/L) and ALT (164 U/L), leukopenia (WBC 1900/mmc), neutropenia (380/mmc)mild lymphocytosis and monocytosis. TheEBV serology suggested a chronic or reactivatedEBV infection, with the presence ofanti early antigen (EA) and a appearanceof anti-EBV associated nuclear antigen(EBNA).Two months after dimission thepatient showed an increase in peripheralblood LGL. The LGL were shown to have aT cell CD3+ CD8+ CD57+ CD56+ CD16-phenotype and were associated with a persistentneutropenia and increased serumimmunoglobulin G (2100 mg/dl), RA testpositive, ANCA negative. The serology ofEBV indicating the disappearance of IgMand an increase of IgG and persistence ofEBNA. Eight months later we observed thepersistence of neutropenia and lymphocytosis.The marrow aspiration showed anexcess of intermediate maturative fases ofgranulocitopoiesis. The patient nevershowed the feature of infectious mononucleosis(lymphadenopathy, tonsillarswelling and sore throat). He showed anatypical persistent polyclonal lymphcytosiswith an increase of CD8+ citotoxic T cellsand associated neutropenia for a period of8-9 months. The case reported here raisesthe possibility that EBV infection may beassociated with benign forms of chronicatypical lymphocytosis and neutropenia inimmunocompetent patient.P373MUCORMYCOSIS IN NEUTROPENICHEMATOLOGIC PATIENTSA. NOSARI, P.G. ORESTE*, M. MONTILLO, R. CAIROLI,M. DRAISCI, G. MUTI, A. MOLTENI, A. TEDESCHI,L. GARGANTINI, L. SANTOLERI, E. MORRADept. of Hematologv, Dept. of Pathology, NiguardaCa’ Granda Hospital, Milan, ItalyIn the last few years mucormycosis hasbeen reported in leukemic, lymphoma andbone marrow transplanted patients. From1987 to March 1999 we observed 13 casesof Mucor, 10 males and 3 females, medianage predominantly in aplastic post-chemotherapypatients (10/13), affected by acuteleukemia (11 cases) and non-Hodgkin’s

278 September 26-29, 1999 - Torino-Lingotto, Italylymphoma (2 cases). Seven patients hadprogressive hematologic disease. At onsetall patients were neutropenic (N

37 th Congress of the Italian Society of Hematology279Capnocytofaga canimorsus) or Protozoa(Babesia spp., Plasmodium spp.) have tobe considered.We report the case of a femalepatient, (M.M.) 25 years old,splenoctized at 4 years old due to an hereditaryspherocytosis, not subjected topreventive vaccine.The day before the hospitalizationshe’s had hyperpyrexia precededfrom shudders, vomiting and diarrhoea.At the moment of the hospitalizationshe was purple, in soporific state withhypotension.Following were theematochemical tests results: WBC 27.000(N 93, L2. M1, E1, MMC3), Hb 16 g%, PLT27.000, PT 45% INR 1,7, aPTT 53’’Ratio1,56, Fibrogen 213 mg/dl, AntitrombineIII 52%, D-Dimer 48000 ug/ml,Creatininemia 4,3 mg%, SGOT 371-SGPT324, Bilirubinemia 2,9 mg%, CerebralTACnegatve, Thorax XR .negativeApneumoniae streptococcus has had beensepareted from the emocoltures. The dayafter a serious multiorganic disorder hasbeen found (respiratory, cardiocirculatory,renal and epatic insufficiency, coma, DIC)and the patient has been transfered to intensivetherapy departement for the mechanicalventilation. In the torax XR someshaded nodular elements, prevalent in theright lung, have been found. The patienttemperature had fallen after three tests ofantibiotical combinations aimed from theantibiogram. A subsequent positive evolutionwith complete recovery of themultiorganic disorder has been observed inthe next 2 months. The reported case confirmsthe persistence of the sepsy risks inthe lifetime and the decisive value of thevaccinations as preventive action of the postsplenectomy infective complications togetherwith or as alternative to a continuousantibiotical prophylaxis with daily oralpenicillin monodose.patients; in many cases it is caused byfungi. Trying to identify prognostic factorsfor outcome, we analysed 145 cases ofpneumonia in patients with haematologicalneoplasia. Table shows some of the mostsignificant differences among the threegroups, defined according to the outcome.Mean hospital stay at the diagnosis of pneumoniawas one of the most significant prognosticfactors: this probably reflects a differentetiology of hospital acquiredpneumonias, especially fungal. Mean ANCat the onset of pneumonia is another determinantof outcome; the prognostic significanceof the rate of patients whose ANCfell under 100/mm3 at some time duringpneumonia reflects the importance on ANCevolution.P376PNEUMONIA IN PATIENTS WITHHAEMATOLOGICAL NEOPLASIA.ANALYSIS OF PROGNOSTIC FACTORSF. ROSSINI, M. VERGA, M. ISELLA, E.M. POGLIANI,G. CORNEOHaematology Unit, University of Milan, MonzaHospitalPneumonia remains one of the most severecomplications in cancer neutropenic

280 September 26-29, 1999 - Torino-Lingotto, ItalyP377CHRONIC HEPATOSPLENICCANDIDIASIS IN PATIENTS WITHHEMATOLOGICAL MALIGNANCYL. PAGANO, L. MELE, F. EQUITANI, C. VERGINE, A. DI FEBO,S. MAZZOTTA, M. SANGUINETTI *, G. MORACE *, G. LEONEInstitute of Semeiotica Medica and Institute ofMicrobiology *, Catholic University of the SacredHeart, RomeFrom January 1986 to December 1998 weobserved 19 patients (pts), affected by ahematological malignancy (14 AML, 2 ALL,2 NHL, 1 MM; m/f 10/9, median age 32,range 19-66) who developed a chronic hepaticand/or splenic candidiasis when recoveredfrom the post-chemotherapy aplasia.The diagnosis was made evaluatingclinical parameters: fever unresponsive toantibiotic treatment (19/19), hepato- and/or splenomegaly (19/19), abdominal pain(6/19), diarrhea (6/19), jaundice (4/19),vomiting (4/19); microbiological features:previous candidemia (7/19), developmentof yeasts in samples collected by biopsy (5/10), positive coprocultures (5/6), positiveserology (12/16), hematochemical examinations:high neutrophil count (18/19), increasedplatelet count (12/19), anemia (15/19), increase of the alkaline phosphatasetwo-fivefold (17/19), high values of hepaticenzymes (AST/ALT, γGT, Lap) twofold (6/19), hyperbilirubinemia (4/19); imagingcriteria: evidence of target lesions in liverand/or spleen at ultrasonographic examination(19/19), and at CT-scan (10/10).Only three out of six transcutaneous hepaticbiopsies and two out of four biopsiesperformed in course of laparoscopy allowedus a diagnosis. The results achieved bythese procedures are consistent with theusual situation to perform them later thanthe start of the antifungal treatment in relationshipwith a low performance status ofthe patient. All patients received antifungaltreatment: 15 pts were treated withAmphotericin B (AmB, median dose 1 mg/kg/die, range 0.8-1.2, total median dose1200 mg, range 550-2800), in associationwith 5-Fluocitosine in 5 cases (median dose150 g, range 55-230); four pts more weretreated with Fluconazole (400-800 mg/die)for a median time of 32 days (range 19-46). Three months after the onset of thiscomplication, no deaths related to the infectionswere recorded. Ten patients subsequentlyunderwent another chemotherapy,6 pts died for progression of malignancy,finally 3 pts were not able to receiveulterior treatments. In our experience,the most sensitive parameter for a serialmonitoring of infection resulted alkalinephosphatase, whereas imaging examinations(echo- and CT-scan) not rarely presenta difficult interpretation (residual diseaseor active abscesses?).P378INFECTIONS DUE TO FILAMENTOUSFUNGI IN PATIENTS WITHHEMATOLOGICAL MALIGNANCIESL. PAGANO*, L. MELE, P. RICCI, C. GIRMENIA, A. NOSARI,M. BUELLI, M. PICARDI, B. ALLIONE, F. EQUITANI,L. CORVATTA, D. D’ANTONIO, M. MONTILLO, L. MELILLO,L. CUDILLO, A. TONSO, C. SAVIGNANO, A. CHIERICHINI,M.E. TOSTI, A. CENACCHI, G. BUCANEVE, A. BONINI,P. M ARTINO AND A. DEL FAVERO FOR GIMEMA- INFECTIONObjective: To evaluate the characteristicsof patients (pts) affected by hematologicalmalignancies who developed a filamentousfungi infection (FFI) and to ascertainthe factors influencing the outcome.Design: A retrospective study, conductedover 1988-1997. Setting: 14 hematologydivision in tertiary care or university hospital.Patients: Patients with hematologicalmalignancies (HM) with a histologically and/or microbiologically documented FFI wereincluded. Results: We observed 391 pts(m/f 262/129; average 49 y) (225 AML, 67ALL, 30 CML, 22 NHL, 12 MDS, 10 Aplasia,7 HD, 8 CLL, 5 MM, 5 HCL). Before the onsetof infection 311 pts (80%) were neutropenicfor an average of 14 d and whenFFI was diagnosed 277 pts (71%) had anANC < 0.5x10 9 /l. An antifungal prophylaxiswas used by 313 pts (80%). The primarysites of infection observed were: lung 321pts (85%), nose and paranasal sinus 44 pts(11%), other sites 19 pts (5%); in 7 ptshad multiple localization at the onset. Diagnosisin vivo was made in 310 pts (79%),while in other in 81 pts (21%) only at autopsy.Chest x-ray was positive in 77% ofpts with pulmonary FFI, while thorax CTscan was positive in 95% of cases. Theagents of FFI were: Aspergillus in 296 pts;Mucorales in 45 pts; Fusarium in 6 pts andother species in 4 pts. In other 40 pts theagent of FFI was not identified. A recoveryfrom neutropenia was observed in 166 pts

37 th Congress of the Italian Society of Hematology281(42%). The treatment of choice was amphotericinB (amB), given to 284 pts (73%).198 pts (51%) died for infection. Atunivariate analysis age, use of glucocorticoids,neutropenia at the onset of FFI, multiplepulmonary localizations, Mucoralesetiology influenced negatively the outcomefrom FFI, while neutrophil recovery, kind oftreatment and a total dose of amB >25 mg/kg were correlated with FFI improvement.At multivariate analysis glucocorticoids,Mucorales etiology negatively influenced theoutcome of FFI, while neutrophil recoverywas significantly correlated with FFI improvement.Conclusions: FFI occurs mostfrequently in pts with hematological malignancies,and it is characterized by a highmortality rate. Our study, on a large cohortof patients, indicates that among the variousfactors that could influence the outcome,neutrophil recovery is the most relevant.P379EARLY INTERLEUKINE-6 DETECTIONCOULD BE A USEFUL PROGNOSTICMARKER IN FEBRILE PATIENTSM. CUZZOLA, G. IRRERA, O. IACOPINO, A. CUZZOCREA,G. MESSINA, G. PUCCI, M. MARTINO, G. CONSOLE,*G. DOLDO, F. MORABITO, *G. CAMINITI, P. IACOPINOCentro Trapianti Midollo Osseo, * Servizio diRianimazione, Azienda Ospedaliera, Reggio CalabriaProinflammatory citokines (CKs), such astumor necrosis factor- α (TNF-α) and itssoluble receptor (sTNF-RI), interleukin-6(IL-6) and interleukin-8 (IL-8) may play animportant role in the genesis of septic shocksyndrome. It is not clear whether thesemediators may be implicated in the pathogenesisof fever of unknown origin (FUO).We studied CK production in a group of 8breast cancer autologous bone marrowtransplanted patients in neutropenic phasewho presented FUO. A group of 5 patientswith fever of a microbiologically documentedorigin from the Intensive Care Unit(IUC) of the same hospital was also included.In all patients, plasma samplesbefore the onset of fever and serial samplesthereafter at time 0, 2, 6, 12, 24, 36, 48,72, 96 and 144 hours were obtained for CKdetermination (ELISA). Before the onset offever, CK production in both groups wascomparable to that of normal subjects. Atfever presentation, TNF-α production remainedconstant (median peak 20 pg/ml).An increase in sTNF-RI receptor level wasobserved in both groups with a median peakof 6000 pg/mL in the neutropenic group and10.000 pg/ml in the septic group and thisresponse was sustained even after defervescence.Similarly to TNF-α, IL-8 concentrationdid not change in both groups andwas detectable at 6 and 12 hours from feveronset in only two neutropenic patientswith a peak of 60 and 150 pg/ml, respectively.In contrast, circulating IL-6 becamedetectable in all patients within the first 6hours and was significantly higher in 4 septicpatients (1500 pg/ml) that presentedwith poor outcome as compared to levelsin the only septic patient that healed (250pg/mL) and in the neutropenic transplantedgroup (200 pg/ml). Moreover, in the neutropenicgroup as well as in the only septicpatient that healed, IL-6 concentration decreasedto normal levels at resolution offever, whereas levels remained high in theother 4 patients dead for sepsis. In conclusion,higher levels of circulating IL-6 atbeginning of fever seem to correlate with apoorer prognosis. A larger study populationis necessary to confirm whether earlyIL-6 plasma detection may be useful toidentify risk categories among febrile patients.Supported by AIL, Regione Calabria and UEP380GRANULOCYTE COLONY-STIMULATINGFACTOR PERTURBS LYMPHOCYTEMITOCHONDRIAL FUNCTION ANDINHIBITS CELL CYCLE PROGRESSIONS. RUTELLA, C. RUMI, R. MOROSETTI, L. PIERELLI, S. SICA,G. LEONEDept. of Hematology, Catholic University, Rome,ItalyWe evaluated the effects of recombinanthuman granulocyte-CSF (rhG-CSF) on lymphocytemitochondrial function [DiOC 6(3)incorporation and generation of reactiveoxygen species (ROS)] in normal donorssubmitted to CD34 + peripheral blood progenitorcell (PBPC) mobilization for allogeneictransplantation. CD4 + DiOC 6(3) low andCD8 + DiOC 6(3) low T-lymphocytes increasedand reached 35% (range 30-41) and 15%

282 September 26-29, 1999 - Torino-Lingotto, Italy(range 12-22) of circulating T-cells, respectively,on day 4 of rhG-CSF administration.Hypergeneration of ROS could be demonstratedin most CD4 + T-lymphocytes and in3% (range 2-5) of circulating CD8 + T-cells.Interestingly, rhG-CSF determined no alterationof mitochondrial function if addedto allogeneic PBMC in vitro, thus suggestingindirect effects mediated by soluble factors;when PBMC were challenged with PHAin the presence of donor serum, both perturbationof mitochondrial transmembranepotential (∆ψ m) and hypergeneration of ROSwere induced, lymphocytes were predominantlyarrested in G 0phase of the cell cycleand displayed fragmentation of genomicDNA. No modifications of Bcl-2 staining intensitywere observed irrespective of thepresence or absence of donor serum. Ourfindings demonstrate a disruption of lymphocyte∆ψ minduced by as yet unrecognizedimmuno-regulatory soluble mediator(s)elicited by rhG-CSF; these phenomenamight occur in vivo after encountering antigens,leading to enhanced activation-inducedprogrammed cell death of alloreactiveT-cells, and might account for the unexpectedlyreduced incidence and severity ofacute GVH disease after allogeneic PBPCtransplantation.P381CD30 TRIGGERING MODIFIES CXCR4AND MIP-1α EXPRESSION INCD4 + /CD30 + L540 CELLSCD30, a TNF-family receptor up-regulatedby IL-4, is preferentially expressed and released(sCD30) by persistently activatedTh2/0 lymphocytes. In HIV infection, highserum sCD30 at diagnosis has been foundby us and others to be an independent prognosticfactor characterising a population atrisk of fast progression to AIDS. The biologicallink between tendency to releasehigh sCD30 and disease progression is notwell understood. Because the role of CCR5and CXCR4 as HIV coreceptors and theassociation of some CCR with defined Th1-or Th2-oriented cytokine patterns havebeen recently recognised, we evaluated thepossibility that CD30 may transduce signalsregulating CCR5 or CXCR4 and/or theirligands RANTES and MIP-1α. To this purpose,we chose to use the CD4 + /CD30 + cellline L540, an established model to studyCD30-mediated activation. This cell linebasally expressed CCR5 (MFI: range 65-105) and CXCR4 (MFI: range 101-120)(mAb from Pharmingen). In standard cultureconditions, L540 cells spontaneouslyreleased low amounts of MIP-1α (range 20-41 pg/mL) and RANTES (0.3-80 pg/mL),whereas PMA stimulation induced highamounts of both CC (Amersham ELISA kit).CD30 triggering experiments using agonisticmAbs (M44 and M67, Immunex) inducednuclear mobilisation of NFkB in supershiftassays and, at 48 hours, a clear-cut downregulationof CD30 (p=0.008) that correlatedwith increased sCD30 concentrationin culture supernatants (mean±SEM, basal19.3±5.5 vs stimulated 99.8±12 U/mL,p=0.0006; DAKO ELISA kit). By contrast,CXCR4 was clearly upregulated. This wasassociated to no effect on the production ofRANTES (≤3 pg/mL) and to an apparentlyinhibitory effect on the release of MIP-1α(mean±SEM, basal 33.9±9 vs stimulated10.8±2.3 pg/mL, p=0.026). However, experimentsincluding RPA analyses showedan early faint induction of MIP-1α mRNA,as compared to stimulation with PMA whichstrongly induced MIP-1α. Thus, CD30 crosslinkingcan lead to a modulation of CXCR4and MIP-1α expression in L540 cells andrepresents a candidate novel regulatorymechanism effective during T cell primingand activation.A. RIGO, L. MOROSATO, G. PERONA, G. PIZZOLO, F. VINANTEDepartment of Clinical and Experimental Medicine,Section of Hematology, University of Verona, ItalyP382EXPRESSION AND ROLE OF CD30/CD30LAND Fas/FasL IN HUMAN ENDOTHELIALCELLSB. ROSSI, M.M. RICETTI, F. VINANTE, M. KRAMPERA,C. VINCENZI, G. PERONA, G. PIZZOLODipartimento di Medicina Clinica e Sperimentale,Sezione di Ematologia, Università di Verona, VeronaBackground: inflammatory reactions andimmunity involve close interactions betweenendothelial cells (ECs) and immunocompetentcells underneath the effect of severalcytokines. The CD30-CD30 ligand(CD30L) and the Fas-Fas ligand (FasL) havebeen implicated in the regulation of cellturnover in the immune system. This study

37 th Congress of the Italian Society of Hematology283addresses the question of whether thesemolecules are expressed in human endothelialcells and are functional in mediatinglymphocytes proliferation and death.Cells and reagent: Human umbelical veinendothelial cells (HUVEC) were isolated asdescribed by Jaffe and grown in medium199 additioned with 20% fetal bovin serum;the human T cell leukemia line Jurkatand human T cell lymphoma Karpass-299were manteined in RPMI medium 1640 with10% fetal bovin serum; peripheral bloodlymphocytes were isolated by Ficol-Hypaque separation. The following mAbswere used: anti-CD30 andCD30L, anti CD95and CD95L, anti CD54, anti CD3; HUVECwere stimulated with IL-1, TNF, IL-2, IL-4,gamma-IFN, progesterone, dexametazoneGM-CSF and EPO. Methods: flow cytometricanalysis was used for the evaluation of Fas/FasL and CD30/CD30L expression; PCR wasutilized to detect the presence of CD30/CD30L transcripts; apoptosis was detectedwith propidium iodide and annexina stainingby flow cytometry. We demonstratedthat a) appreciable levels of Fas are expressedon HUVEC and this expression ismarkedly upregulated by gamma-IFN; b)FasL is also detectable but at lower levelsthan on Jurkat cells; c) CD30L is constitutivelypresent in HUVEC, as also demonstratedby PCR, but at low levels; d) CD30is never expressed; e) preliminary experimentsindicate that ECs activate can induceapoptosi in cell lines. Our resultssuggest that ECs may play a role in controllingvia apoptosis lymphocyte proliferation.P383RESTORATION OF THE IMMUNECOMPARTMENT IN CHRONIC MYELOIDLEUKEMIA PATIENTS INCOMPLETEREMISSIONM. BRECCIA, A. GUARINI, A. VITALE, E. MONTEFUSCO,M.C. PETTI, A. ZEPPARONI, F. MANDELLI, R. FOÀDipartimento di Biotecnologie Cellulari edEmatologia, Università “La Sapienza”, Roma eDipartimento di Scienze Biomediche ed OncologiaUmana, Università di Torino, ItaliaIn chronic myeloid leukemia (CML) therole of the immune compartment in thecontrol of the disease is suggested by manyevidences. We have studied the immunophenotypeof circulating lymphocytes, thecapacity of TNFα and IFNγ production bylymphocytes, as well as the cytotoxic activityagainst the NK susceptible and NKresistant cell lines K562 and Raji in 12 CMLpatients in complete remission after treatmentwith interferon alpha (IFN) or hydroxyurea(HU) and in 3 CML patients at thetime of diagnosis. Peripheral blood mononuclearcells (PBMNC) were incubated withmonoclonal antibodies against CD3, CD4,CD8, CD16, CD56, CD122, CD25, CD15,CD20 and intracellular TNFα and IFNγ. Inthe 12 patients in complete remission, theoverall mean percent of CD3+ lymphocyteswas 48.7% ± 10.5; CD4 and CD8 were respectively36.8% ± 10.1 and 19.8% ± 7.5,with a CD4/CD8 ratio of 1.73 ± 1.2. TheNK associated antigens CD16 and CD56were expressed respectively in 9.5% ± 4.2and 16.5% ± 4.8 of PBMNC. No notabledifferences were observed between IFN andHU treated patients. Interestingly, anincresead proportion of CD4/CD25 positiveT cells was noted in all patients, with anoverall mean expression of 20.5% ± 4.9.Spontaneous NK function was 23.6% ±14.3; this was associated with a high IL2generated LAK activity, with an overall killingof 60.2% ± 22.7. In the 9 evaluatedpatients (6 treated with IFN and 3 with HU),14.0% ± 8.2 of CD4, 10.8% ± 4.6 of CD8and 6.0% ± 3.2 of CD56 lymphocytesshowed intracellular production of TNFα;5.3% ± 2.7 of CD4, 12.1% ± 5.7 of CD8and 5.6% ± 3.4 of CD56 cells produced intracellularIFNγ. In the 3 patients studiedat diagnosis we observed an inverted ratioCD4/CD8 (0.48% ± 2.3), no presence ofactivated CD4 cells (0.88% ± 1.8), a verylow NK function (3.6% ± 1.5), and a reducednumber of NK cells capable of producingintracellular TNFα (1.1% ± 0.5) andIFNγ (0.86% ± 1.3). These results indicatethat in CML patients in complete remissionafter treatment, the immune compartmentappears restored, functionally competentand activated, suggesting that immunemediated strategies in this phase of the diseasemay be worthy of further investigation.

284 September 26-29, 1999 - Torino-Lingotto, ItalyP384DIFFERENTIATION AND FUNCTIONALACTIVITY OF DENDRITIC CELLS FROMMONOCYTES OF PATIENTS WITHCHRONIC MYELOID LEUKEMIAR. BELLUCCI, A. GUARINI, M. BRECCIA, M. NANNI,E. MONTEFUSCO, P. DE FABRITIIS, *R. FOÀDipartimento di Biotecnologie Cellulari edEmatologia, Università “La Sapienza” Roma;*Dipartimento di Scienze Biomediche e OncologiaUmana, Università di TorinoChronic myeloid leukemia (CML) is aclonal myeloproliferative disorder characterizedby the Ph cromosome and the BCR-ABL fusion gene. This functional sequencerepresent a tumor specific antigen, suitablefor immunotherapy approaches. In thisstudy, we have evaluated the ability ofdendritic cells, generated from patients withCML at diagnosis, to stimulate autologousT lymphocytes obtained from the same patientsat the time of hematological remissionafter chemoterapy, as well as allogeneicT lymphocytes obtained from normaldonors. Peripheral blood cells from 10 patientswere separated by Ficoll-Hypaquedensity gradient and cultured either immediatelyor after cryopreservation. Mononuclearcells (2.5x10 6 /ml) were incubatedfor 90 min in RPMI with 10% FCS. At theend of the incubation time, non-adherentcells were removed and GM-CSF (100ng/ml) and IL-4 (50ng/ml) containing mediumwas added onto the adherent monocytes.After 7 days of culture, TNFα at 20 ng/mlwas added for further 2 days. At this time,100% of the cells were HLA-DR+, while amean of 26.3±3.3% were CD1a+/CD14-.In the 3 cases studied by interphase FISH,the BCR-ABL fusion gene was found in allcultivated cells. Lymphocyte proliferationtests, carried out in 4 cases, showed thatthe dendritic cells generated from monocytesof CML patients at diagnosis have avalid functional activity, both in autologousand in allogeneic conditions, significantlysuperior than that observed with unculturedmononuclear cells from the same patients.In agreement with other observations of ourgroup, these results confirm that the immunesystem of CML patients in hematologicalremission following treatment iscompetent and suggest the possibility ofobtaining leukemic dendritic cells capableof stimulating on autologous lymphocyteresponse.P385AUTOMATED RETICULOCYTES (Ret.)COUNTING BY FLOW CITOMETRY (FC):USELFULNESS AND LIMITS INHAEMATOLOGICAL DISORDERSA. FRAGASSO, C. MANNARELLA°, G. MARATIA*, A. SACCOUnità Operativa di Medicina Interna, °ServizioImmunotrasfusionale, *Laboratorio analisi PresidioOspedaliero Matera, ASL N°4, MateraAccording to maturity, automated Ret.counting by FC identifies three subclassesnamely HFR, MFR, LFR (high, medium, lowfluorescence rates); the MFR+HFR/LFRX100ratio characterizes the reticulocyte maturityindex (RMI). Using an automated Ret.counter (SISMEX R-3000), we evalueted192 patients with haematological disordersprior to any treatment: chronic myeloid leukemia(CML) 2; haemolytic anaemia (HA)17; aplastic anaemia (AA) 2; acute bloodloss anaemia (ABL) 16; acute leukemia (AL)19; megaloblastic anaemia (MA) 28; idiopathicmyelofibrosis (IM) 2; myelodisplastycsyndrome (MDS) 14; chronic lymphociticleukemia and myeloma (CLL-MM) 21;anaemia of chronic disorders (ACD) 13; irondeficiency anaemia (IDA) 58. The Ret. areespressed as an absolute count (N°X10 6 µL)and results are given as the mean±SD; 78healthy subjects were used as controls.Depending on the Ret. N° and RMI resultswe have identified three groups (GR).1. Ret. N°↑, RMI↑: HA (RetN°2051±804;RMI 48±25.8), ABL (Ret.N°1566±550; RMI35±11.5). 2.Ret.N°=↓, RMI↑: CML(Ret.N°734±348; RMI 62.6±29.6), AA(Ret.N°288±165.5; RMI 37.7±11), AL(Ret.N°305±290; RMI 31±18.7), MA(Ret.N°299±164; RMI 29.6±13), IM(Ret.N°485±107.5; RMI 22±16), MDS(Ret.N°478±256; RMI 22±8.8). 3. Ret.N°=,RMI=↓: CLL-MM (Ret.N°483±293; RMI15.3±12.5), ACD (Ret.N°472±186; RMI13.3±11), IDA (Ret.N°992±62.2;RMI8.2±2.1). The GR1 Ret. pattern signals anadeguate erythroid response to anemia; onthe contrary the GR2 Ret. pattern showsan ineffective erythropoiesis; the RMI increasein GR2 is partially due to the interferenceof high number of WBC (AL, CML).The method explains the pathophisyology

37 th Congress of the Italian Society of Hematology285of anaemias, but the overlapping and wideSD of data hampers the differential diagnosisin macrocytic (MA, MDS) and normomicrocyticanaemias (ACD, IDA); on theother hand it is effective in monitoringtherapy response.P386MEMBRANE PHOSPHOLIPIDASYMMETRY IN CIRCULATINGERYTHROBLASTS OF PATIENTS WITHβ THALASSEMIA INTERMEDIA(1)L. FROGHERI, *F. DORE, *S. BONFIGLI, (1) L. GUISO,(1)G. MADDAU, (1) P. PISTIDDA, (1) M. LONGINOTTI(1)Istituto CNR Patologia del Sangue – Sassari;*Istituto di Ematologia Università di SassariIn patients with severe β-thalassemia theenhanced programmed cell death, observedin early stage erythroid bone marrow precursorsby DNA breakdown products studies,is probably caused by the unmatchedα-globin chain accumulation. Among theearly manifestations of apoptosis in all celltypes studied to date is loss of the asymmetricdistribution of plasma membranephospholipids, which results in exposureanionic phospholipids, including phosphatidylserine(PS), on the extracellular leafletof the plasma membrane. This exposure ofPS plays an important role in red cell pathologyand it can be detected in individualcell by flow cytometry using fluorescein labeledannexin V. In this study we evaluatedthe erythroid apoptosis by determinationof PS exposure on circulating erythroblastsof 15 patients with β-ThalassemiaIntermedia (TI) with different genotypesand clinical phenotypes. Our results indicatethat in all thalassemic patients a variablesubpopulation of peripheral erythroblastsexpose PS on their outer surface. Themean value of Annexin V positive erythroblastswas.2.71%, but the number of suchcells vary dramatically from patient to patient,from as low as that found in normalcontrols (0.3%) up to 10 %. Any differencewas observed between the number ofAnnexin V positive eryhtroblasts and thalassemicgenotypes or clinical findings (degreeof anemia, transfusion or chelation therapy,splenectomy) and serum erythropoietin levels.In particular a significant correlationwas found between Annexin V positiveerythroblasts and total globin chain imbalance(p

286 September 26-29, 1999 - Torino-Lingotto, Italypositive and haptoglobin was absent, a X-rays survey of vertebral column showedgeneralised osteoporosis with vertebral collapses.Because of the presence of severeosteoporosis steroid dosage was progressivelyreduced until discontinuation whileazathioprine dosage was increased; moreover,pamidronate infusion was started.Following this treatment, Hb levels reached10,5 g/dl even though elevatedunconjugated bilirubin and reticulocytosispersisted. Ten months later the patient wasagain hospitalized for acute pancreatitisassociated with gallstones and treated bysurgical removal of the gallbladder. The reappearanceof a hypermolitis crisis (Hb 6.3g/dl) despite adeguate treatment promptedus to use oral CyA (Sandimmun Neoral-Sandoz) at 10 mg/Kg. The patient rapidlyresponded to treatment and the CyA wasreduced after 20 days at 3 mg/Kg. After sixmonths of treatment with CyA the Hbreached 12 g/dl with normalization of lacticdehydrogenase, bilirubin and aptoglobin.After 18 months of therapy with CyA alonethe patient despite the persistent positivityof direct Coombs test, is still clinically respondingwith normal value of Hb. Our caseindicated that CyA may be a reasonablealternative to splenectomy or cytotoxictherapy in steroid-resistant autoimmunehemolytic anemia.P388QUANTITATIVE ANALYSIS OF BONEMARROW ASPIRATES BY AUTOMATICCELL COUNTERC. PAPARO 1 , M. DE FILIPPI 1 , G. CAMETTI 2 ,E. REVERSO GIOVANTIN 11Laboratorio Analisi, 2 Medicina Interna, Osp.Maggiore, Chieri (TO)We analysed fifty bone marrow aspirateswith the automatic hematology analyzerCell Dyn 3500 (ABBOTT - ROMA). Materialsand Methods - Samples were takenfrom the upper rear part of the iliac crestwith a siringe, placed in test tubes withEDTA, filtered to remove solid particles, andanalysed twice with the resistant RBC modeto obtain complete red cell lysis. The automaticcount provided two WBC values: 1)WIC: impedance analyzer of all nuclei, includingerythroblasts (NRBC), taken as theabsolute value of the bone marrow cellularity;2) WOC: absolute optical analysis,differentiating WBC only. NRBC were calculatedindirectly according to the formula:(WIC-WOC)/WOCx100, and expressed inrelation to 100 WBC. The means of each ofthe samples of the two counts were calculatedand, on the basis of the WIC, subdividedinto three classes: 1°) reduced cellularity,2°) normal cellularity, 3°) increasedcellularity. Under the microscope, cellularitywas evaluated on the biopsy section ata small magnification, after May-Grunwald-Giemsa staining, and expressed as percentageon the basis of the number of adiposespaces. Results - In the following table,results are expressed in absolute values(cells/µL) and as microscope-evaluated cells(on biopsy section), expressed as percentage.1 class. B.sect. 2. class. B.sect. 3 class B.sect.N.of cases 13 27 10media 10709

37 th Congress of the Italian Society of Hematology287plants (7 cord, 2 bone marrow, 1 PBSC)and 13 autologous transplants (2 bonemarrow, 11 PBSC). Methods: Units arecryopreserved in 200 ml volume and 10%DMSO. A common triple bag is modified:200 ml dextran40 5% and albumin 2,5%in the first bag, 300 ml saline/alb.5% inthe plasma bag. The first bag solution istransferred to the thawed unit, then backfor the first centrifuging. Surnatant is discardedinto the rbc bag (PAGGS) and secondwash transferred from the plasma bag.After the second spin, surnatant is discardedinto the plasma bag. Saline/alb.5% is addedto reach final volume (100mL). After samplingfor quality control tests, the unit istransfused through a peripheral venousaccess. Results: the procedure is fast (50k/uL 12-77days). Estimated DMSOconcentration in the final unit is more thanten times lower. Conclusions: A doublewashing procedure in sterile closed systemkeeps in the laboratory the crucial step ofthawing cryopreserved stem cells. Dextran/albumin solution reduces the hypotonicshock of direct infusion into patient’s bloodand allows final viability and clonogenictests. Leucocytes are absent in the discardedfractions: the cell loss is probablydue to lysis and/or clumping of non viablegranulocytes. Infusion is safer and lesstoxic, particularly for children.P390INCIDENCE OF MALIGNANTHEMOPATHIES IN CALABRIA,A REGION WITH A POPULATION OF 2MILLIONG. CONSOLE, V. CALLEA‡, F. RONCO‡, D. TEBALA♦,C. CARIDI♦, D. PRINCI♦, °°R. CURIA, F. NOBILE‡,P. IACOPINOThe evaluation of incidence and geographicaldistribution of hematological malignanciesis essential to adequate allocationof resources and health care services.It is also a useful source of medical informationconcerning diagnostic and therapeuticapproaches. Two sources of data wereused: 1) a computerized file containinghospital-discharge abstracts, with diagnosesand procedures for all the hospitalizationsin Calabrian residents; 2) a computerizeddata base maintained by RegionalHematological Registry of Calabria, an Italianregion with 2.070.203 inhabitants. Allcases were coded and classified accordingto the ISTAT Classification, 9 th Revision1975. In 1997, 985 new cases of hematologicalmalignancies with a standard rateof 51.91 per 100.000 inhabitants were diagnosed.The incidence in our region, inwhich Agriculture and Services are the mainoccupations, is higher than in other Italianregions. In particular, it is higher than inModena (rate 44.73 per 100.000 inhabitants),that has very different social andeconomical characteristics, as well as inRagusa (rate 31.40 per 100.000 inhabitants),the closest geographical area in whichthere is a Cancer Registry. The highest incidencerate of all hematological malignancies,but Hodgkin’s disease, was observedin the population who are >64 years of age.Male sex was prevalently affected with 546cases (rate 57.46), while 439 cases (rate46.08) were female. The most frequenthematological malignancies where Non-Hodgkin’s Lymphoma (310 cases; rate16.22) and Chronic Lymphoid Leukemia(190 cases; rate 9.95). Acute LymphoidLeukemia was registered in 50 patients -23 were children (rate 1.2), 15 were in agegroup between 15 and 64 years (rate 0.8)and 12 were >64 years of age (rate 0.6).In contrast, Acute non Lymphoid Leukemiawas prevalent in the older people. Finally,the geographical distribution of the diseaseswas highly variable. Further data are beinganalyzed to seek social and geological correlatesto the hematological phenomenonin our Region.Supported by AIL, Regione Calabria and UECentro Trapianti Midollo Osseo, DivisioneEmatologia‡ ,Registro Tumori EmatologiciRegionale♦,°°Assessorato Regionale alla Sanità,Reggio Calabria

288 September 26-29, 1999 - Torino-Lingotto, ItalyP391IDENTIFICATION OF Hb J-OXFORD BYMASS SPECTROMETRY ANDENDONUCLEASE RESTRICTIONDNA ANALYSISD. PARENTE 1 , A. FEBBRARO 1 , A.M. SALZANO 2 , V. CARBONE 2 ,E. FOGLIETTA 3 , P. PUCCI 2,41Servizio di Ematologia, Ospedale S. Cuore di Gesù,Benevento; 2 Centro Internazionale di Servizi diSpettrometria di Massa, CNR-Università di NapoliFederico II, Napoli; 3 Associazione Nazionale per laLotta contro le Microcitemie in Italia, Roma;4Dipartimento di Chimica Organica e Biologica,Università di Napoli Federico II, NapoliHb J-Oxford is a rare abnormal hemoglobinalso known as J-Interlaken and N-Cosenza containing an anomalous α chaincarrying the substitution Gly→Asp at α15.This variant had previously been describedin Sicily combined with a β°-thalassemia,in American Italians and an English family.This communication reports the identificationof Hb J-Oxford in a female patient fromBenevento (Italy) with normal hematologicaldata. A detailed structural characterisationof the variant hemoglobin was carried outby mass spectrometric procedures: thehemolysate containing the variant Hb wasdirectly fractionated and analysed by “online”liquid chromatography-electrospraymass spectrometry (LC/ESMS) techniques.The accurate determination of the molecularmass leads to the identification of theabnormal globin chain. The mass spectralanalysis, in fact, showed the presence ofan abnormal a chain displaying α massvalue of 15184.2±0.8 Da, 58 Da higher thanthe normal α chain The variant globin wasdigested with trypsin and the resulting peptidemixture was directly analysed by ES/MS/MS showing the occurrence of an aminoacid replacement Gly→Asp at position 15.Endonuclease restriction DNA analysis ofboth α 1and α 2genes is currently under investigationwith the aim to provide a rapidand easy procedure for the identification ofthis asymptomatic variant hemoglobin.P392PAROXYSMAL NOCTURNALHAEMOGLOBINURIA: RETROSPECTIVESTUDY OF 17 PATIENTS OBSERVED INA SINGLE INSTITUITION, OVER APERIOD OF 31 YEARSC. FINELLI, P. RICCI, G. VISANI, D. RONDELLI, M. LAUDADIO,G. MARINO, A.M. MIANULLI, P. PICCALUGA, S. TURAIstituto di Ematologia e Oncologia Medica“L. & A. Seràgnoli”, Università di BolognaParoxysmal nocturnal haemoglobinuria(PNH) is a clonal haematologic disease characterizedby intravascular haemolysis, peripheralcytopenia, and by the risk of thromboticepisodes and renal failure. PNH canonly be “cured” by allogeneic stem celltransplantation (Saso R, 1999), but the indicationsof such approach are controversial,as the disese has -often a chroniccourse, with a 10-20% of spontaneous clinicalremissions (Hillmen P, 1995). In thisstudy we retrospectively analyze the clinicalcourse of 17 pts with PNH (7 males, 10females), who were observed at our Institutionsince 1968. The diagnosis was madeby Ham test, and, since 1998, by flowcytometric assay (CD59 on erythrocytes andgranulocytes). All the patients showed overtlaboratory signs of intravascularhaemolysis. Mean age of diagnosis was of31 (range 19-72) yrs. In 3/17 pts, the diagnosisof PNH was made during the follow-upof aplastic anaemia (after 53, 72,and 141 months, respectively). We alsoobserved 5 other patients with aplasticanaemia who showed a positive Ham testand/or deficit. of CD59, but without significanthaemolysis. 9/17 pts received packedred cell transfusions. 2 pts died because ofPNH (1 because of thrombosis, and theother because of pancytopenia). Thromboticevents occurred in 6 pts, 2 pts developedacute, reversible renal failure. One pt gavebirth to a healthy new-born, in spite ofpreeclampsia. 2 pts responded to androgentherapy (danazol), and in 3 pts a spontaneous,sloow and progressive clinical improvementwas recorded.

37 th Congress of the Italian Society of Hematology289P393IN VITRO AND IN VIVO EFFECT OF L1ON HEMOPOIETIC PROGENITORS INTHALASSEMIA PATIENTSF. TIMEUS, N. CRESCENZIO, F. LONGO, A. DORIA,N. TARTAGLIA, A. PIGAPediatric Hematology/Oncology Dpt., University ofTorino, ItalyL1 (1,2-dimethyl-3-hydroxypyrid-4-one)has been utilized since some years as aniron chelating agent in clinical trials in humans.During L1 treatment neutropenia andagranulocytosis have been reported. In aprevious study we demonstrated that L1shows a direct dose-related inhibitory effecton BFU-E and CFU-GM from CD34+ cellsof normal subjects. In the present studywe evaluated the in vitro effect of differentconcentrations of L1 on peripheral bloodCFU-GM from 32 transfusion -dependentbeta-thalassemia patients (mean age =15.9 years; range 7-22). Eight normal subjectswere studied as controls. L1 displayeda greater inhibitory effect on CFU-GM fromthalassemia patients than from controls(chelator concentrations causing 50% inhibitionof colonies, IC50, calculated byprobit analysis, = 43.9+1.5 and 58.6+1.1microM, respectively, p

290 September 26-29, 1999 - Torino-Lingotto, Italygery is caused by mechanical prosthesismalfunction in about 80% of patients andby xenograft tissue prosthesis malfunctionin about 20% of patients. No case ofhemolytic anemia after pure mitral valverepair has been found by Medline research.Our case demostrates that pure valve repairwithout prosthesis may be responsibleof a severe hemolytic anemia.P395AUTOIMMUNE HAEMOLYTIC ANAEMIADUE TO IgA ANTIBODIES°F. ALFINITO, °G. FALZARANO, G. FRATELLANZA, F. GIGLIO,S. FORMISANO, °B. ROTOLI°Cattedra di Ematologia e Dipartimento diImmunoematologia, Università Federico II, NapoliA positive direct antiglobulin test (DAT)is an essential condition to define diagnosisof AIHA; rarely DAT negativity delayssuch a diagnosis. Here we report the caseof 60 y.o. lady who suffered since one yearfor a chronic haemolytic anaemia DAT negativethat required transfusional therapy:Ham test resulted positive with both autologousand etherologous serum. This positivitydesappeared when hetherologous serumwas complement free and was significantlyreduced with the aoutologous one.Cytofluorimetric investigation did notshowed typical elements of ParoxysmalNocturnal Haemoglobinuria. DAT performedin gel phase with monospecific sera showedan intense positivity for IgA and a weakpresence of IgG. Red blood cell half-life ,eximated by using 51 Cr, was dramaticallyreduced (4 days) with evidence of extravascularhaemolysis ( spleen and liver) andurine loss of 51 Cr. The patient, because diabetic,underwent laparoscopic splenectomywith subsequent complete reconstitution ofblood values. AIHA with IgA are extremelyrare, less rarely are associated with IgG andor IgM antibodies, haemolysis often is almostsevere with extra and intravascularlocalization because IgA are recognized bya specific macrophages Fc receptor and canalso activate complement trhough an alternativepathway. DAT negativity was inour case probably due to antibodies weaklybound on red cell membrane; DAT performedin gel phase allowed to avoid washingprocedures that usually eliminate antibodiesweakly bound.To discover IgA AIHAit is necessary to use monospecific antiserabecause anti IgA immunoglobulin concentrationis particularly reduced in theglobal.reagent. Ham test positivity is notspecific, it can be ascribed to the action ondamaged red cells of excess complementacitavated in the precence of reduced pH.P396A NEW PYRIMIDINE 5’NUCLEOTIDASE VARIANT?F. ALFINITO, F. FERRARO, S. ROCCO, S. MATARESE°,M. SINDONA, V. MARTINELLI, B. ROTOLICattedra di Ematologia, Università Federico II,°Clinica Pediatrica II Università, NapoliPyrimidine 5’Nucleotidase ( P5’NT) deficiencyis the enzyme defect that, after PKand GPI, more frequently produces chronicnon spherocytic haemolytic anaemia. Thehyperhaemolytic status occurs when a moleculardefect is present on both alleles. Sofar only 40 cases have been described, and10 of them were characterized accordingto the ICSH recommandations (1989). TheP5’NT gene sequence is still unknown. Herewe report the biochemical characterizationof three new cases of P5NT deficiency. Patientsare not family related and live inSouth Italy. Patients main clinical andhaematological data:Cases Age Sex Hb Ret P/P P5NT Spleney g/dl 10 9 /L γP/Hb ctomy1 19 F 9.4 600 1.13 1.66 NO2 24 F 8.0 400 1.10 2.0 YES3 1 M 7.5 350. 1.00 2.9 NOn. v. 12-14 6-15 2±0.25 9±1.9Biochemical studies:Cases Km UMP Stability Optimal Ph Electrophore45°C % sis%1 0.85 100 6 1102 4.40 100 6 1003 3.10 100 6 100n. v. 1.03± 0.25 100 7 100In comparison with the other cases previouslyreported, our data show that reducedaffinity for substrate and decreased optimalPh are shared by all variants except forcase 1, which exibits a normal value for KmUMP. This discrepancy may suggest a newP5’NT biochemical variant. Further studiesare needed to confirm this statement.

37 th Congress of the Italian Society of Hematology291P397IRON-DEFICIENCY ANEMIA AS THEPRESENTING SIGN OF CELIACDISEASEC. QUARTARONE, L. NOCILLI, G. BELLOMO, G. SPATARI,A. ALONCI, C. MUSOLINODivisione di Ematologia- Università di MessinaSince the beginning of the use ofAntigliadin Antibodies (AGA) in the screeningof coeliac disease (CD) we have observedan increasing in the total number ofcases diagnosed in adult age. We report thecase of a 42 year old femal with a 11-yearhistory of iron-deficiency anemia of unknownorigin and refractory to iron therapy.Repeated radiological investigations in thepast had revealed no abnormality of thegastrointestinal system. Antigliadin andantiendomysial antibody test performed atour hospital was positive. Upper gastrointestinalendoscopy and jejunal biopsiesconfirmed the diagnosis of coeliac disease.We underline the need to look for CDin patients with unexplained hypochromicanemia.P398IMPLICATION OF Fas/Apo1 AND NF-kBIN RESISTANCE TO DRUG INDUCEDAPOPTOSIS IN MDR LEUKEMIC CELLSM. TOLOMEO, S. GRIMAUDO, G. CANNIZZO, E. BARBUSCA,F. PORRETTO, M. MUSSO, M. MELI, L. DUSONCHET,V. ABBADESSA, R. PERRICONE, A. CAJOZZOCentro Interdipartimentale di Ricerca in OncologiaClinica (CIROC) and Istituto di FarmacologiaUniversità di PalermoWe observed that HL60R, a multidrug resistant(MDR) P-glycoprotein (Pgp)-expressingcell variant derived from HL60 leukemiccells, was resistant to apoptosis inducedby anticancer drugs both MDR- andnot MDR-related. The MDR reversing agentverapamil was able to reverse partially theresistance to daunorubicin (DNR), leadingto a complete block in G2-M, but it wasunable to restore the sensitivity to druginduced apoptosis. While the expression ofp53 and BCL-2 was the same in both celllines, HL60R cells, in contrast to HL60, didnot express Fas/Apo 1 and were resistantto the anti-Fas agonistic MoAb CH11. Tounderstand whether the loss of Fas expressionplays an important role in the resistanceto drug induced apoptosis, sensitiveHL60 cells were treated with DNR in combinationwith two anti Fas blocking MoAbs,(DX2 or ZB4,) and two anti FasL blockingMoAbs (NOK-1 or NOK-2). No inhibition ofDNR-induced apoptosis was observed withthese blocking MoAbs. Moreover, the exposureto the caspase 1, 3, 8, and 9 inhibitors(YVAD-CHO, YVAD-CMK, DEVD-CHO, Z-LEHD-fmk respectively) did not modify thepercentage of apoptosis induced by DNR inHL60 cells. However, this percentage wasdecreased by the pan-caspase inhibitorZVAD-fmk. Interestingly, we observed thatresistance to apoptosis could be almostcompletely inhibited when HL60R cells weretreated with the NF-kB inhibitor pyrrolidinedithiocarbamate(PDTC). PDTC restored thesensitivity to apoptosis induced by DNR andby different anticancer drugs which are notsubstrates of Pgp. On the contrary, PDTCconferred a significant protection towarddrug induced apoptosis in sensitive HL60cells. These data indicate that the Pgp expressionand the loss of Fas expression arenot implicated in the resistance to drug inducedapoptosis. The ability of the NF-kBinhibitor PDTC to almost completely restorethe sensitivity to drug induced apoptosis inHL60R cells suggests a possible involvementof NF-kB in apoptosis resistance in MDR cellsand may support the possible use of NF-kBinhibitors in drug-resistant malignancies.P399LIPOSOME ENCAPSULATEDDAUNORUBICIN DOUBLESANTHRACYCLINE TOXICITY IN CELLLINES SHOWING AN ATYPICAL MDRA. MICHELUTTI, M. MICHIELI, D. DAMIANI, A. ERMACORA,P. M ASOLINI, C. SKERT, R. STOCCHI, T. MICHELUTTI,J. PAÑOS, D. RUSSO, M. BACCARANIDivision of Haematology, Department of Medicaland Morphological Research, Udine UniversityHospital, ItalyDaunoxome (DNX) is a combination ofDaunorubicin (DNR) with a liposomal targetingsystem developed with the aim ofdelivering more drug to tumor than to normaltissues since it has been shown thatliposomes stand a better chance of pen-

292 September 26-29, 1999 - Torino-Lingotto, Italyetrating and accumulating the leaky vasculatureof solid neoplastic tissues than theone of normal tissues. In drug-selected celllines with a PGP overexpression, DNX allowedhigher DNR accumulations and higherdrug toxicity than free DNR suggesting thatliposomal anthracycline could be a suitabledrug for treatment of PGP positiveleukaemias. The aim of this study was totest the possibility that DNX increases theanthracycline toxicity in cell lines with anMRP or an LRP overexpression in order toidentify mechanisms of anthracycline resistancedue to defects in drug transport ortrafficking that would be counteract by liposome-encapsulatedDNR. Cellular kineticand accumulation were evaluated by flowcytometry. Drug toxicity was evaluated bya microcultured growth inhibition assay(MTT) after a 7 day continuous exposure to0.1- 2000 ng/ml DNX. Free DNR and parentalnon MDR cell lines were used as acomparison. In both parental non MDRcell lines the dose-response curves of DNXclosely paralleled the ones obtained withfree DNR. On the contrary, in the drug selectedsublines with an MRP (GLC4-ADR150)or an LRP (SW-1573/2R120) overexpressionDNX was about 2.5 fold more toxic thanfree DNR. In the drug selected lines thereversal agents SDZ PSC 833 (PSC) and D-Verapamil (D-VP) caused only moderateincreases of free DNR toxicity while had noeffect on DNX. On the LRP overexpressingcell line neither kinetic nor the cellular accumulationof the anthracycline was markedlychanged during DNX or free DNR treatment.The MRP overexpressing cell lineshowed only a trend towards an higher DNRaccumulation under liposomal DNR exposure.In conclusion, the liposomal formulationdoubles DNR toxicity in cell lines withan Atypical MDR associated to an MRP orLRP overexpression. The increase in DNRtoxicity due to the liposome encapsulation,is higher than the one given by adding classicalMDR reversal agents as PSC or D-VPto the free anthracycline. This data enlargesthe in vitro bases that supports ongoingresearch in the field of new drug targetingsystems.P400CYTOTOXICITY AND CELL CICLECHANGES INDUCED BY A PROTEASOMEINHIBITOR ON LEUKEMIC CELLSF. SERVIDA 1 , G. LAMORTE 1 , D. SOLIGO 2 , D. DELIA 3 ,N. QUIRICI 1 , G. LAMBERTENGHI DELILIERS 21Fondazione Matarelli, 2 Centro Trapianti di Midollo,IRCCS, Ospedale Maggiore, and 3 Istituto NazionaleTumori, Milan, ItalyThe proteasome, a multicatalytic proteasecomplex, is the major non-lysosomal machinerythat is responsible for the degradationof cellular proteins by ATP/ubiquitindependentproteolysis; it maintains thecorrect concentrations of individual proteins,either at steady state or undergoing controlledfluctuation. This control is especiallycritical for effect on molecules such ascyclins, transcriptional activators and componentsof signal transduction pathways.We tested on different myeloid leukemic celllines (HL-60, K-562, AR-230, RwLeu-4 andKG-1a) the effects of a proteasome inhibitor(PI) on cell proliferation and cell cycle.A strong cytotoxic effect of the PI was noticedon the HL-60, RwLeu-4 and AR-230cell lines (IC 508-10 nM), while KG-1a andK-562 were more resistant (IC 50up to 500nM). The cell cycle, examined by flowcytometry after DNA staining withpropidium iodide, was not significantly alteredby the PI in the KG-1a and AR-230cell lines even at high doses of the inhibitor,while an inversion of the G 1over theG 2/M ratio was found in HL-60, RwLeu4 andK-562 treated with 5 nM, 10-30 nM and25-30 nM of inhibitor, respectively. Anapoptotic subdiploid peak was also observedin the HL-60 at doses of inhibitor >10 nM.The effect of the PI was also evaluated onthe clonogenic assays (CFU-GM) of CD34 +cells from normal and leukemic fresh humanbone marrow samples. Our resultsshowed that the inhibitor had a higher effecton leukemic samples (IC 5010 nM) thanon normal bone marrow (IC 5050 nM), suggestingthat the inhibitor was more cytotoxicto leukemic cells than to normal cells.Our data seem to indicate that proteasomeinhibitors, alone or in combination withother drugs, might be capable of bypassingresistance to conventional chemotherapeuticsin myeloid leukemias.

37 th Congress of the Italian Society of Hematology293P401CD34+ CELLS RESPONSE TO AS 2O 3TREATMENT IN VITROC. CHIODINO, A. DONELLI, T. PANISSIDI, R. RONCAGLIA*,R. SABBATINI, F. NARNI, G. TORELLISection of Hematology Oncology, Department ofMedical Sciences, and* Immuno-hematology andtransfusion center, University of Modena andAzienda Policlinico, Modena.It has been known, in the last two years,that AML-M3 patients resistant to conventionaltreatment can be successfully treatedwith As 2O 3. The mechanisms determiningthe outcome of this therapeutic strategy arebeing actively pursued in fresh human leukemiccells and cell lines in several laboratories.So far the literature data point to apro-apoptotic effect of As 2O 3treatment. Thiseffect seems specific for leukemic cells andis accompanied by a decrease in the cyclingcompartment. Since hematopoieticcells provide a good experimental systemto study the “decision fork” betweenapoptosis and cell cycle arrest, we used thissystem to address two problems: the cellcycle kinetics of normal human hematopoieticstem cells in culture, as well as theeffect on these cells of As 2O 3treatment. Inparticular, the aim of the study presentedhere is to assess the effect of As 2O 3treatmenton cell cycle distribution and inductionof apoptosis in human hematopoieticstem cells. To this purpose, we obtainedsamples from bone marrow as well as peripheralblood cells. Samples from eitherhealthy donors or mammary carcinomapatients without bone marrow involvementwere used for these studies. CD34+ cellswere selected through immunomagneticseparation and tested in liquid short-termcultures. Several culture conditions with andwithout As 2O 3in the micromolar range weretested. Cell cycle distribution as well as theinduction of apoptosis were evaluated in onestep using biparametric cytofluorimetricanalysis of cell cycle combined with TdT-assay.The data obtained until now show thatin short-term assays As 2O 3treatment doesnot affect the cell cycle kinetics of normalCD34+ cells. The relevance of these studieson the development of therapeutic strategieswill be discussed.P402IN VITRO CHRORAMBUCIL FAILS TOSYNERGIZE WITH ASPIRIN IN B-CELLCHRONIC LYMPHOCYTIC LEUKEMIAF. PROCOPIO, I. CALLEA, A. DATTOLA, A. CUZZOCREA,V. CALLEA, C. STELITANO, P. IACOPINO, M. BRUGIATELLI,F. MORABITODipartimento di Emato-Oncologia, Az. OspedalieraBianchi-Melacrino-Morelli, Reggio CalabriaIn the last few years some in vitro drugcombination studies have been reported inB-cell Chronic Lymphocytic Leukemia (CLL).We recently demonstrated a synergy betweenchlorambucil (CLB) and deflazacort,purine analogs and mitoxantrone. Moreover,the phenomenon of synergism betweenmethylxanthine derivatives and the alkylatingagent was also proven. It has beenrecently reported that aspirin (ASA) inducesapoptosis in CLL cells by activation ofcaspases involving cycloxygenase-independentmechanisms. In addition, decrease incell viability is ASA dose- and time-dependent.ASA effect is limited to relatively highconcentrations, which, translated in vivo,could not be tolerated in a clinical setting.This finding suggested us to evaluate thepossibility of a synergistic effect betweenCLB and ASA. Samples from 12 CLL patients,in the vast majority previouslytreated, were tested after at least a monthfrom the last therapy. MTT assay was performedto assess cell viability. The dosedependentcytotoxic effects of the drugswere studied in each sample by culturingCLL cells with 100-0.1 µg/ml CLB and 1000-0.1 µg/ml ASA. The lethal dose (LD)50 valuesand drug interactions, evaluated by themoltiplicative and the maximum model,were calculated by a home-made software.CLB-LD50 values were not significantlymodified at any ASA concentrations. Theinteractions between CLB and ASA, testedin 240 combinations resulted as synergisticin 34 (14.1% of the total), additive in59 (24.6%) and antagonist in 147 (61.2%).In conclusion, these very preliminary resultssuggest that the combination of thealkylating agent with ASA may not be aneffective treatment in CLL at least in thisseries of patients. However, a more extendedstudy on a higher number of casesis still needed in order to verify a possibledifference between previously treated anduntreated patients.

294 September 26-29, 1999 - Torino-Lingotto, ItalyP403CORRELATION OF IN VITRO DRUGSENSITIVITY WITH CLINICALOUTCOME IN ADULT AMLA. MESTICE, G. SPECCHIA, A. PANNUNZIO, A. RICCO, I. ATTOLICO,P. CARLUCCIO, M. LAMACCHIA, M. ROSSINI, V. LISOHematology - University of Bari - ItalyAdvances in chemotherapy and supportivecare have significantly improved theprognosis of patients with AML, but 5-35%of them fail to respond to induction therapyand up to 80% of patients who achieve completeremission relapse within two years.Drug resistance is presumed to be the majorcause of these chemotherapy failures.Several studies have reported the clinicalrelevance of both long-term clonogenic andvarious short-term non-clonogenic in vitrodrug-resistance assays. In particular the MTTassay is a rapid simple automated test basedon the reduction by living cells ofdimethylthiazol-diphenyl-tetrazolium bromideto a coloured formazan product. Aftertwo days of drug exposure in vitro responsesof leukemic samples can be measured byspectrophotometry. We evaluated in vitrochemosensitivity with the MTT assay in blastcells from adult patients with AML at onsetof disease. Sixty-two patients (median age55yrs, range 25 - 70 yrs) with AML diagnosedaccording to the FAB criteria (2 M0, 3 M1,32 M2, 7 M4, 12 M5, 5 M6, 1 M7) were includedin our study. The drugs tested wereARA-C, MITOX, DNR, IDA and VP-16; eachdrug was tested in different concentrationsin triplicate. We also evaluated the cytotoxicityof ARA-C plus VP-16 or DNR or IDA orMITOX, in different concentrations. Leukemiccell survival (LCS) was calculated by thefollowing equation: LCS=OD treatedwells/OD control wells x 100. Sensitivitywas defined as less than 50% LCS at thehighest concentration of the drug. We foundin vitro sensitivity in 79% of samples testedwith IDA, in 73% with DNR, in 62% withMITOX, in 47% with VP-16 and in 44% withARA-C. The combination of ARA-C plus VP-16 showed a significantly higher cytotoxicitythan ARA-C or VP-16 alone, whereas thecytotoxicity of DNR, IDA and MITOX was notincreased by ARA-C. The MTT test correlatedwith the in vivo response in 62% of patients.Notably patients with a correlation betweenthe MTT test and the in vivo response weresignificantly younger than patients with nocorrelation.P404FAS-LIGAND EXPRESSED ON ACUTEMYELOID LEUKEMIA CELLS MAY KILLFAS POSITIVE JURKAT CELLSC. SELLERI, J.P. MACIEJEWSKI°, P. RICCI, G. VARRIALE,A.M. RISITANO, C. CALIFANO, M. PICARDI, A. CAMERA,A SEVERINO, B. ROTOLIDivision of Hematology, Federico II University ofNaples and °Hematology Branch, NHLBI, NIH,Bethesda, MDInteraction of Fas-ligand (CD95-L) withthe extracytoplasmic domain of the Fas receptor(CD95) has been shown to triggerthe apoptotic cell death process. CD95-L isexpressed by several types of hematopoieticand non-hematopoietic neoplastic cellsand has been suggested to play a role intumor escape from immune surveillance.We examined Fas-L expression on bonemarrow (BM) blast cells from 31 patientswith acute myeloid leukemia (AML). UsingWestern blotting analysis with a monoclonalantibody anti-CD95-L (clone G247-4,Pharmingen) we documented that 13/25AML showed strong expression of CD95-L.By two color flow cytometry with a FITCconjugatedanti CD95-L (Pharmingen) anda PE-conjugated anti CD34 (Becton-Dickinson), performed in the presence ofthe metalloproteinase inhibitor K8103 (10mM) to prevent CD95-L shedding, we foundthat 3/6 AML showed high levels (>20% ofpositive cells within the leukemic population)of CD95-L. The cytotoxic activity ofCD95-L positive AML cells from 10 patientswas assayed by using coculture experimentswith 51 Cr-labeled CD95 + Jurkat cells as atarget, at a target/effector ratio of 1/10.We found that CD95-L positive AML cellsshowed enhanced cytotoxic activity comparedto monocyte-depleted BM cells from5 normal donors (mean percentage ± SEMof lysis: 72 ± 13 vs 43.2 ± 3) and it waspartially reverted by pretreatment of Jurkatcells with a CD95 blocking monoclonal antibody(ZB4, Amac) (mean percentage oflysis: 15.7 ± 6). These findings suggestthat: i) AML cells may express high levelsof CD95-L; ii) membrane-bound Fas-L onAML cells is functionally active and it maybe involved in the evasion of AML cells fromimmune attack.

37 th Congress of the Italian Society of Hematology295P405EXPRESSION AND FUNCTION OF THE67 kDa LAMININ RECEPTOR INNORMAL AND ACUTE LEUKEMIA CELLSN. MONTUORI°, P. RAGNO°, G. VARRIALE, A.M. RISITANO,A. CAMERA, M. PICARDI, C. CALIFANO, G. ROSSI°,B. ROTOLI, C. SELLERIDepartment of Cellular and Molecular Biology andPathology° and Division of Hematology, Federico IIUniversity of NaplesThe 67 kDa laminin receptor (67LR) is anon-integrin protein with high affinity forlaminin, that plays a critical role in basementmembrane invasion and metastasis.Using a Western blotting analysis for theexpression levels of 67LR, with a polyclonalanti-67LR antibody, we have documentedenhanced 67LR expression in 40% of 53 denovo AML. 67LR + AML frequently exibitedM4 or M5 morphology and expressed CD14and CD11a. We could not detect 67LR expressionin normal bone marrow cells(n=5), in B-ALL (n=5), in CLL (n=5) andCML in chronic phase (n=8). We also foundthat 67LR was strongly expressed inmyelomonocytic THP1 and U937 cells andwas weakly expressed in promyelocytic HL-60 cells. In HL-60 cells, 67LR expressionalmost disappeared after retinoic-inducedgranulocytic differentiation, whereas itstrongly increased after phorbol ester-inducedmonocytic differentiation. Using twocolor flow cytometry with PE-conjugatedanti CD34 (Becton-Dickinson) and apolyclonal anti-67LR conjugated with aFITC-secondary antibody (Sigma), in 2 AMLM4 we confirmed that 67LR was highly expressedon CD34 + blast cells, whereas itwas weakly expressed on blast cells of AMLM3 and on CD34 + cells from normal donors.Using a colorimetric assay, we found that67LR positive AML showed an higher adhesionto laminin compared to 67LR negativeAML and normal BM cells; the adhesion wasspecific, since in vitro addition to laminincoatedwells of recombinant 37 kDa lamininreceptor precursor (37LRP), which is thecytoplasmic precursor containing bothlaminin binding domains of cell surface67LR, significantly reduced laminin bindingof AML cells. In conclusion, our resultsindicate that the expression of 67LR is enhancedin some subsets of AML cells, allowingthem to adhere to laminin and maybe a useful additional lineage-associatedantigen to identify monocytic oriented AML.P406MIXED BACKBONE ANTISENSEOLIGONUCLEOTIDE TARGETINGPROTEIN KINASE A MAY INDUCEGROWTH INHIBITION OF HUMANPRIMARY CHRONIC LYMPHOCYTICLEUKEMIA CELLS IN VITROC. SELLERI, M.R. VILLA, °R. CAPUTO, F. CHIURAZZI,P. RICCI, °G. TORTORA, B. ROTOLIDivision of Hematology and °Oncology, Federico IIUniversity of NaplesPhosphodiesterase inhibitors, such astheophylline which cause intracellular accumulationof cyclic adenosine monophosphate(cAMP), have been reported to induceapoptosis in chronic lymphocytic leukemia(CLL) cells. It has been shown thatdownregulation of protein kinase type I(PKAI) by the site-selective cAMP analogue8-chloro-cAMP, is involved in cell growthinhibition of different types of cancer cellsin vitro and in vivo. It has also been documentedthat several phosphorotiorateantisense oligonucleotides targeting theregulatory subunit RIα of PKAI inducegrowth inhibition and differentiation of avariety of human cancer cell lines. Recently,it has been shown that antisense oligonucleotideswith mixed backbone structure (MBO),containing 2'-O-methylribonucleoside segmentsat the 5’ and 3’ ends, exhibit improvedpharmacokinetic and bioavailabilityproperties in vivo. We investigated the cytotoxiceffect of a novel mixed backbone18-mer antisense oligonucleotide (HYB 165)that targets the N-terminal 8-13 codons ofthe RIα subunit of PKAI, on primary CLLcells in vitro. Using the colorimetric MTT assay,we found that HYB 165 was able toinduce a dose-dependent growth inhibitionin 8/13 CLL at doses ranging between 0,1and 1 µM after 5 days of incubation (meanpercentage ± SD of cell growth inhibition:31±19 and 44±12 at 0.1 and 1 µM, respectively),corresponding to about 50% of cellgrowth inhibition induced by 0.3 mg/ml offludarabine (mean percentage ± SD of cellgrowth inhibition: 75). These preliminaryresults suggest that MBO antisense oligonucleotidestargeting PKAI induce growthinhibition in primary CLL cells in vitro andmay be of therapeutic value in CLL.

296 September 26-29, 1999 - Torino-Lingotto, ItalyHODGKINAND NON-HODGKINLYMPHOMASP407INTERNATIONAL PROGNOSTIC SCORE(IPS) IN ADVANCED HODGKIN’SDISEASE: IS USEFUL IN EVALUATINGOVERALL SURVIVAL (OS)A. GUARINI, V. PAVONE, A. RANA, M. RIENZO, T. VALENTINO,P. CURCI, T. PERRONE, F. GAUDIO, V. LISOHaematology Department, University of Bari - ItalyObjective: Aim of our retrospective studyis to evaluate IPS (Hasenclever ASH 96) inadvanced HD, the impact on OS and if it isable to identify subsets of pts requiring moreaggressive treatment. Patients and Methods:The presenting feature of 194 adults(≥16 years) seen at our Department between1988 and 1996 with clinical stage ofIIb (83 pts), III (79 pts) and IV (32 pts)were reviewed. Median age was 38 years(range 16-84); 59 pts (30,4%) were ≥45years old. 103 pts (53,1%) were male; Histologicalsubtypes were: nodular sclerosisin 104 (53,6%), mixed cellularity in 65(33,5%), lymphocyte predominance in 11(5,7%), lymphocyte depletion in 11 (5,7%)and unclassifiable in 3 (1,5%). Hemoglobin< 10.5 g/dl were found in 29 pts, serumalbumin

37 th Congress of the Italian Society of Hematology297months (range 3-208 months). All patientsreceived CT: 139 MOPP/ABVD (69.8%) and60 ABVD (30.2%); in 110 cases (55.2%)with the adjunct of radiotherapy. 183/199patients (92%) achieved CR. Actuarial OSat 5 years and 10 years was 86% and 71%and EFS 70% and 67% respectively. In 164/199 cases (82.4%) a complete set of datawas available to calculate the prognosticscore according to Hasenclever and Diehl.Less than 3 adverse factors were presentin 105 patients (64%) and ≥3 in 59 (36%).At 5 years EFS was 72% vs 64% (p=ns)and OS 96% vs 75% (p=0.016) for the twogroups of patients respectively. In our patientsHasenclever and Diehl prognosticscore was only predictive for OS. Whenapplied to our series this score was unableto identify subgroups of patients with highrisk of progression eligible for high-dosechemotherapy as first line treatment. Newapproaches combining clinical and biologicalinformation (e.g. serum level of sCD30and/or IL-10) might better identify poor riskpatients.P409A FIVE DRUG REGIMEN (VEBEP) INTHE TREATMENT OF HODGKIN’SDISEASEA. DE RENZO, L. PEZZULLO, *A. D’ARCO, #A. ANDRIANI,G. FALZARANO, C. DI GRAZIA, L. SANTORO, **A. FEBBRARO,**D. PARENTE, M. SINDONA, R. NOTARO, B. ROTOLIHematology Unit, Federico II University, Naples;*Osp. Cava Dei Tirreni; #Osp. S. Giacomo, Roma;**Osp. Fatebenefratelli, BeneventoFrom 1992 to 1999 we have treated 193patients affected by Hodgkin’s disease (HD)with a five drug AVBD-like regimen, includingvinblastine (6 mg/sqm day 1, 15), epirubicine(40 mg/sqm day 1, 15), bleomycine(10 mg/sqm day 1, 15), etoposide (80mg/sqm day 1 to 3 and 15 to 17), and prednisone(40 mg/sqm day 1 to 5 and 15 to19) (VEBEP). In comparison with the ABVDregimen we used epirubicine (less cardiotoxicthan adriamycin), replaced dacabarzinewith etoposide (more active, better tolerated,with less gonadal toxicity), and addedprednisone, integral part of the classicalMOPP regimen. Aims of this study were toevaluate whether such a regimen, consolidatedby involved field radiation therapy,could improve complete remission (CR) rateand duration in patients with HD. Inclusioncriteria were histological diagnosis ofHD at any stage, age >14, absence of concomitantrelevant diseases. Of the enrolledpatients (83 males and 110 females, medianage 28 years), 168 were evaluable (22too early, 2 died for unrelated causes, 1lost at follow up). Stage distribution wasI=21, II=109, III=25, IV=13. CR has beenobtained in 152 patients (90.5%), partialremission in 9 (5.4%), 7 patients were resistant(4.1%). Extra hematological toxicitywas negligeable, never reaching grade3 according to WHO criteria, with the exceptionof alopecia, observed in all patients.Female patients in fertile age showed nosignificant modification of their menstrualcycle. Two male patients had children aftertreatment. Up to date, no secondary malignancyhas been observed. VEBEP appearsto be a regimen highly effective andwell tolerated in the treatment of HD.P410MOPPEBVCAD (A) vs. MOPPEBVCyED(Y) IN ADVANCED HODGKIN’SDISEASE: INADEQUACY OF THECONCEPT OF DOSE-INTENSITY IN THEINTERPRETATION OF RESULTSC. BROGLIA 1 , P.G. GOBBI 1 , M.P. PETRILLI 2 , R. BERTÈ 3 ,S. MOLICA 4 , F. ANGRILLI 5 , E. IANNITTO 6 , M.L. GHIRARDELLI 1 ,C. PIERESCA 1 , N. DI RENZO 2 , L. CAVANNA 3 , E. ASCARI 1 FORTHE GISL (GRUPPO ITALIANO STUDIO LINFOMI)Med. Int. e Oncol. Med., Univ. di Pavia, IRCCS S.Matteo 1 ; Div. Ematol., “Casa Sollievo dellaSofferenza” S. Giovanni R. (FG) 2 ; Sez. di Ematol.Osp. di Piacenza 3 ; Div. di Ematol. Osp. diCatanzaro 4 ; Dip. di Ematol.-Oncol., Osp. diPescara 5 ; Catt. Ematol., Univ. di Palermo 6The MOPPEBVCAD (A) regimen showedvery good results in the treatment of advancedHodgkin’s disease (H), with 94% ofCR and 0.78 of 5-year FFS. The number ofsecond tumors recorded so far is comparablewith that observed with other 6-7 drug regimens,however a concern of GISL investigatorsis to substitute some of the 3 alkylatingagents and/or the nitrosurea withoutreducing clinical effectiveness. In 1993 arandomized trial was started with the originalMOPPEBVCAD schedule vs. a variant ofit – MOPPEBVCyED – in which (in mg/sm)CCNU 100 po, 1° day of cycles 2, 4 and 6,was replaced by CTX 650 iv, and MPH 3 po,

298 September 26-29, 1999 - Torino-Lingotto, Italydays 1°-3°, was replaced by VP-16 100; theschedule remained unmodified as to all theother drugs (NH2 6 iv 1° day of cycles 1°,3°,5°; VDZ 3 iv day 1°; Pred 40 po days 1°-14°; EPI 40 and VCR 1.4 iv day 8°; PCZ poday 8°-14°; VBL 10 and BLM 6 iv day 15°).The end-points were the following: replacementof 2 of the most myelotoxic drugs, increaseof average cumulative dose intensity(DI), al least maintenance of response rate.Sixty-seven patients were enrolled, withdisease stage IIB in 18, IIIA in 7, IIIB in 23,IVA in 8 and IVB in 11; 12 had bulky mass,8 bone marrow involvement. Regimen A wasadministered to 35 patients, regimen Y to32. The distribution at diagnosis of the prognosticallyimportant characteristics waswell-balanced. Median follow-up was 48months. In the A arm all patients completelyresponded; in the Y arm 30 CR, 1 PR and 1NR were recorded. The average cumulativeDI was 0.75 ±0.13 (regimen A) vs. 0.84 ±0.09 (regimen Y) [P=0.002]. Single drugcumulative DI was 0.79 for CCNU, 0.80 forMPH (regimen A) vs. 0.82 for CTX and 0.86for VP-16 (regimen Y); all the remainingdrugs showed a mean 10% increase in therregimen Y compared with regimen A. The5-year projected FFS was 0.77 (A) vs. 0.63(Y). Nonhematological toxicity was comparablewhile the hematological one was ratherhigher in the arm A; however, only grade 3-4 thrombocytopenia was significantly morefrequent. One case of fatal myelodisplasiawas recorded in arm A, 1 kidney carcinoma(successfully treated) in arm Y. In conclusion,substitution of 2 severely myelotoxicdrugs allowed a significant DI increase forall drugs, but response and survival did notimprove. Contrary, they tended to becomepoor.P411PARTICULAR IMMUNOPHENOTIPICPATTERN OF T-LYMPHOCYTE IN ALYMPHONODE INVOLVED IN HODGKINDISEASE (HD): AN ANALYSIS WITHFLOW CYTOMETRYReed-Sternerg cell and its variants representthe characteristic elements of the HD,but they are the minority of the cells of thepathologic tissue. In this study we wantedto analyze by flow cytometry the lymphoidpopulation of an inguinal lymphonode involvedby HD. For this aim cellular suspensionwas analyzed by three color flowcytometry employng FACScan flow cytometer(Becton Dickinson) and a wide panelof monoclonal antibodies (MoAb). The diagnosisof HD, lymphocyte rich classical HD(REAL-C provisional entity), was performedon an inguinal lymphonode byopsy in a 26year old patient in Ann-Arbor stage I A. Thehistological analysis showed a subvertedarchitecture with nodal and diffuse proliferationof small lymphocytes andpartial formation of nodes with Bimmunophenotype. Within small lymphocytepopulation there were largest lymphoidcells with vescicular and plurilobatednucleus and Reed-Sternberg cells CD20+sometimes CD30+ and CD15+. Furthermorethere were eosinophil and histiocyticcells. The analysis performed by flow cytometerwith an immunolgical gate on CD45 bright cells involving more than 95% ofthe total population showed the followingresults:MoAb % MoAb % MoAb % MoAb %CD19 22 HLA-DR 89 CD4 72 CD56 1CD19/CD5 3 CD2 80 CD4/CD45RA 10 CD57 1CD19/CD10 2 CD5 80 CD4/CD45RO 62 CD16 1CD19/CD43 7 CD7 80 CD4/CD25 60 CD30 1CD19/K 11 CD3 39 CD4/CD26 56 CD15 2CD19/λ 9 TCR αβ 38 CD8 8CD20 21 TCR γδ 1 CD1a 0In conclusion immunophenotypic analysis,even if it was not diagnostic for HD, showeda prevalent T lymphocyte subpopulationwith a particular pattern (DR+, CD25+,CD4+) and with an atypical absence of CD3surface marker on 50% of T lymphocytes.The importance of this population in thiscase of HD is not clear and it must to benoted that it was absent both in bone marrowand in peripheral blood.A. SANTAGOSTINO, *G.ANGELI, *A. OTTINETTI, V. BOLIS,°G. FORTI, M. ROCCELLAServisio di Immunoematologia, *Servizio diAnatomia Patologica, °Divisione di MedicinaGeriatrica, Ospedale S.Andrea, Vercelli

37 th Congress of the Italian Society of Hematology299P412A RETROSPECTIVE ANALYSIS OFHODGKIN DISEASE IN RELAPSE ORREFRACTORY PHASE TREATED WITHHIGH DOSE CHEMOTHERAPY (HDC)AND AUTOLOGOUS STEM CELLSTRANSPLANTATION (ASCT)P. PREGNO, U. VITOLO, M.C. BERTONCELLI, M. PIZZUTI,M. BERTINI, C. BOCCOMINI, B BOTTO, R CALVI, R FREILONE,F. MARMONT, L. ORSUCCI, A. LEVIS, E. GALLOHematogy Departments: S. Giovanni Battista,Torino and SS Antonio e Biagio, Alessandria, ItalyIntroduction: standard chemotherapy(SC) often offers disappointing results inrefractory or relapsed HD patients (pts). Abetter failure free survival (FFS) rate(40-50%) can be obtained with HDC+ASCT.Patients and Methods: between 1986 and1998 41 pts were treated with HDC+ASCT.The median age was 27 years (14-60), 25pts were males and 16 females. The histologywas: PL 4 , SN 31, CM 5 and DL 1.Four pts were in partial remission (PR), 9refractory after 1 st line chemotherapy and28 in relapse (1 with chemoresistant diseaseand 27 sensitive) of which 12 occurring< 1 year from 1 st complete remission(CR). Twentyfour pts previously receivedMA/MA or ABVD, 17 > 2 lines of therapy.Median time from diagnosis to transplantwas 21 months (6-164) and all pts weretreated with almost one course of (SC) beforeHDC+ASCT. At the time of salvage chemotherapy22 pts were in stage I-II and 19in stage III-IV; no pt had bone marrow (BM)involment. Myeloablative regimen included:CBV in 11 pts, BEAM in 10 and Mitoxantrone+Melphalanin 20. Nine pts were transplantedwith BM, 19 with peripheral bloodstem cells (PBSC) and 13 with both. Mostof pts did not receive radiotherapy postASCT. Results: median time to reach>0.5x10 9 /l N was 11 days and >50 x 10 9 /lPlts was 15 days. We observed only onetoxic death, 4 severe infections (WHO 3-4), but 15 mucositis (WHO I-II). CR wasobtained in 36 pts (88%). With a medianfollow up of 31 months 4-year disease freesurvival, FFS and overall survivall rateswere: 49%, 43% and 57% respectively. TheFFS was affected only by the status of diseaseat the transplant: refractory orchemoresistant relapsed pts had aFFS=30% at 7 months, whereas pts in PRhad a FFS=75% and those with sensitiverelapse 43% at 4 years with a median followup of 31 months. Conclusions:HDC+ASCT is a feasible therapy with lowtoxicity in these pts, in particularly usingPBSC. This procedure improves the outcomeof PR or sensitive relapsed pts after a I stline SC. In refractory pts this approach mayoffer a chance of cure, however the resultsobtained are not so good and better conditioningregimens and/or other treatmentsmust be investigated.P413HIDOSE CHEMOTHERAPY (hdc) ANDAUTOLOGOUS STEM CELLTRANSPLANTATION (ASCT) INAGGRESSIVE HODGKIN DISEASE (HD)IN PARTIAL REMISSION (PR)V. PAVONE, A. GUARINI, T. PERRONE, A. ZONNO, F. GAUDIO,P. CURCI, A. RANA, A. OSTUNI, T. VALENTINOHaematology, University of Bari - Italy20 patients (pts) with aggressive HD inPR after induction treatment with MOPP/ABV/MIME/DHAP regimen were treatedwith HDC (BEAM), and autologous stem celltransplantation (ASCT). Histology wasnodular sclerosis in 13 pts (65%), mixedcellularity in 6 (30%) and lymphocytedepletion in 1 (5%). Median age 28,5yrs(16-53). Stage III+IV was present in 15pts (75%) and IIB with Bulky disease in 5(25%). Extranodal disease in 8 (40%),LDH>500UI/L in 13 (65%), ß2µ >2.5mg/ml in 5 (25%) were the most frequentunfavourable prognostic factors at diagnosis.Median time from diagnosis to HDC was6,5 months. Three or more adverse prognosticfactors were documented in 77,4%of pts. CR rate was 65%. Median durationof CR is 15,2 mths. No treatment relateddeaths, but ten bacteriemias and three CMVinfections were documented. Median followup is 27 mths, and 36 mths projected eventfree survival is 72%. Our results are infavour to perform hi-dose-chemotherapyand ASCT earlier in the management of HDpts, with more then three adverse prognosticfactors present at diagnosis andachieving PR after induction treatment.

300 September 26-29, 1999 - Torino-Lingotto, ItalyFig1: TREATMENT PROTOCOLMOPP ABV MIME MOPP ABV MIME DHAP BEAM+g-csf +g-csf +g-csf PBSCC→PBSCTDay 1 8 21 42 49 70 100Fig.2: PTS CHARACTERISTICSN° of Pts 20Disease status at ASCT - PR 100%>= 3 adverse prognostic factors 77,4%CR 65%TRP 0%Follow up months 27EFS 36 months 72%P414QUALITY OF LIFE AND ARTIFICIALINSEMINATION IN FEMALES TREATEDFOR HODGKIN’S DISEASE (HD)FIVET (in vitro fecundation and embryotranfer intrauterine) or ICSI (oocyte intracytoplasmicinsemination). Endometrialmaturation was obtained giving estradiol(4-6 mg/os/die regarding to ultrasonography)and progesterone (50-200 mg/i.m./die). Steroidal therapy was administereduntil the 13th-14th week with regard toplacental functionality. 3/6 females underwentcesarian section because of twin-birthor complications during the third trimesterof pregnancy (gestosis). This study confirmsthe possibility to have full-term pregnancieswith the help of steroidal therapy andovocyte donation in females treated for HD,confirming that, a careful clinico-obstetricsurveillance is important.A.P. ANSELMO, E. CAVALIERI, D. FUNARO, C. ARAGONA*,F. MANDELLIDipartimento di Biotecnologie Cellulari edEmatologia and * Riproduzione assistita II IstitutoClinica Ostetrica e Ginecologica Università LaSapienza RomaWe are more and more worried about consequencesof antiblastic therapy on fertility.Is this the result of advances? We believethat we have achieved a doubleprogress: first, because about 70% of patients(pts) with HD achieve recovery; second,because, in these pts, quality of lifeafter the delivery has improved. What percentageof pts affected by HD is still fertileafter treatment? Unfortunately, this percentageis low especially considering advancedstage HD pts treated with high-dosechemotherapy (CHT) and radiotherapy (RT).For years, we have been trying to reducegonad damage to improve psychologic statusof these pts, not only affected by a neoplasia,but also warned on the possibility ofsterility. It is obligatory to advise youngmale pts to analyse and freeze semen. It isnot easy to carry out these procedures infemale pts; on the other hand, hormonotherapyduring treatment, to preventgonad damage, have not produced the expectedresults. Uterus preserves, also duringnatural or iatrogenic menopause, capacityto respond to steroidal hormones andto permit implantation and development ofembryo obtained through ovocyte donationand in vitro fecundation. Our study concernssix young females in early menopauseafter treatment with CHT and RT for HD(v.table); they carried their pregnancysafely to term through oocyte donation andA greater attention to this problem wouldbe advisable, considering aspects concerninglegislative course of regulation of medical-caretechniques in our Country and thepossibility to safeguard the fertility in thesepts. Taking care of this delicate matter, couldbe a signal for pts that we believe couldachieve recovery. In summary, focusing theattention on long-survival pts, we set a

37 th Congress of the Italian Society of Hematology301goal: to improve their quality of life ashealth must be considered as psychophysicalwell-being as a whole.P415HODGKIN DISEASE IN THE ELDERLY:A RETROSPECTIVE STUDY OF 82PATIENTSM.M. RICETTI, A. AMBROSETTI, R. ZANOTTI, A. TROLESE,G. PIZZOLO, G. PERONADipartimento di Medicina Clinica e Sperimentale,Cattedra di Ematologia, Università di Verona,VeronaIncreasing age in Hodgkin disease (HD)is associated with a poorer prognosis. Weretrospectively studied 82 consecutiveunselected patiens, older than 60 years(range 61-85; 38 men, 44 women), diagnosedas having HD from january 1975 todecember 1998 in the Division of Hematologyof Verona. Mixed cellularity (57,6%)was the most frequent histologic subtype;67% of patients had advanced stage at diagnosis(III-IV) and 50% had B-symptoms;the frequency of mediastinal involvementand primitive infradiaphragmatic presentationwas low; concurrent disease (cardiac,respiratory, renal) were present in 64% ofpatients. Eleven patients were treated withradiotherapy alone (14%), 44 with chemotherapyalone (56%), wile 21 received combinedtreatment (27,6%). Complite remissionwas obtained in 58 patients (75%), 20of whom relapsed. Patients had an 5-yearoverall survival (OS) rate of 50%, not significantlydifferent from the 5-year diseaserelated survival (DRS) rate (52%). Due tothe retrospective nature of the study, it wasnot possible to obtain exact data on all thepatients regarding dates and doses of drugsand radiotherapy and use a dose-intensitymodel. Instead, a simplified grouping wasperformed according to the amount of treatmentgiven and to treatment intensity.Group A: received 80% or more of the totalintented dose of terapy with no or minordelay, the 5-year OS was 85%, group B:received 40-80% of a planned total dose oftherapy and had 38% of OS, group C: receivedless than 40% and had 18% of OS.The main reasons for inadequate treatmentwere toxic side effects (septicaemia, myocardialinfarction, cytopenia) or progressive/non responding disease. The treatment protocolschanged significantly over the 23-year study period but after 1983 thechemoterapy regimen was principallyMOPP/ABVD. Patients treated after 1983 (n°49), who received more adeguate treatment,showed better OS (60%). The authorsconclude that the inability to giveadeguate treatment seems to be the majordeterminant of the poorer overall survivaltime of older patients with HD.P416HIV-ASSOCIATED HODGKIN’SDISEASE. CLINICAL AGGRESSIVENESSAND HIGH FREQUENCY OF BONE-MARROW INVOLVEMENT IN A SINGLE-CENTRE STUDY OF 17 CONSECUTIVEPATIENTSA. RE, G. ROSSI, S. CASARI,°G. CRISTINI, *G.P. CADEO,*G.P. CAROSI°Sezione di Ematologia, III Divisione di MedicinaGenerale; °Cattedra di Malattie Infettive; *Divisionedi Malattie Infettive, Spedali Civili, Università diBrescia, Brescia, ItalyHIV-associated Hodgkin’s disease (HD) isa clinical entity only partially known. Severalreports suggest an increased incidenceof HD in HIV-positive patients (pts), althoughfirm epidemiologic evidence is stilllacking, with peculiar clinico-pathologicalfeatures and an unfavourable outcomewhen compared with HD pts without HIVinfection. The optimal therapeutic approachfor these pts is still unknown. Since theonset of HIV epidemics to April 1999 wehave observed 17 cases of HIV-associatedHD. The clinico-pathological features of thepts were as follows: mean age 35 (22-58),IVDU 12/16 (75%), median CD4+ count atHD diagnosis 155/cmm (41-339), previousAIDS 5 (29%), histologic subtype CM 4/16(25%), NS 7/16 (44%), not classifiable 5/16 (31%), stage III-IV 14 (82%), B symptoms14 (82%). Peculiar of HIV-positive ptswere the high incidence of stage IVB (10/17: 59%) and of bone marrow involvement(8 pts at diagnosis, in 2 cases as the solelocalization, and 2 pts at relapse, 10/17:59%), and the clinical aggressivenessthat prevented us from treating 4 patients(24%) (2 early deaths and 2 autoptic diagnosis).Of 13 pts who received treatment,one stage II patient received only radio-

302 September 26-29, 1999 - Torino-Lingotto, Italytherapy while all the others were treatedwith ABVD or ABVD-derived regimens incontrolled phase II multiinstitutional studies(GICAT). Of 13 evaluable pts, 6 (46%)achieved complete remission (CR) and 1partial remission (PR); the overall remissionrate was 54%. Two pts relapsed, 1 diedfor HD and the other is alive with refractorydisease. Both relapses occurred in the bonemarrow, in patients with previouslyuninvolved marrow. Four pts are currentlyalive in continuous CR after a median followup of 44 months (6-88). At 5 years theactuarial probability of DFS is 54% and ofOS 26%. In this single-centre study of 17consecutive patients, HIV-associated HDshowed unusual aggressive clinical featuresand a high frequency of bone marrow involvementeither at diagnosis and at relapsewith a particularly poor prognosis.P417IDIOPATHIC THROMBOCYTOPENICPURPURA (ITP) IN PATIENTS WITHHODGKIN’S DISEASE (HD) INREMISSION (CR)A.M. D’ARCO, P. DANISE, G. SALVATI, G. NAPOLI,G. AMENDOLA, A. DE RENZO*Department of Internal Medicine, Hospital of CavaDei Tirreni(SA); Institute of Hematology, UniversityFederico II, NaplesThe Autors report on two cases of ITP inpatients with HD in CR. Case 1. A 50-yearoldwoman was admitted with cough anddyspnea.The patient was fully investigated(CT, echo, mediastinal and bone marrowbiopses) and a diagnosis of HD CM in stageII A with bulky mediastinum was made.The patient achieved CR after 6 cycles ofVEBEP protocol (VBL, VP16, BLEO,EPI,PDN)and RT (36 Gy) to the mediastinal area.3months later she showed purpura andthrombocytopenia (28x10 9 /L) while in completeremission. Leucocyte count, Hb level,bone marrow biopsy, pattern of autoantibodiesand the researche of relapse of theHD were normal or negative. PDN was begun(1 mg/Kg) and tapered. The plateletsincreased within one month and are stillnormal 6 months after the stop therapy. Arecent restaging confirmed the remissionof the Hodgkin disease. Case 2. A 30-yearoldwoman was admitted with cough, temperatureand mediastinal opacity. The investigationsrevealed a HD SN in stage IIB, with bulky mediastinum. The patientachieved CR after 6 cycles of VEBEP and RT(30,6 Gy). After 14 months she showed mildthrombocitopenia (80x10 9 /L).A completerestaging failed to reveal either a relapseor a myelodyspalsia.The patient achievedspontaneous remission after 4 months; thenrelapsed and remitted again. At the moment,above 1 year after the onset of PTI,she is in complete remission for both diseases.Conclusion: ITP is a frequent complicationof lymphoproliferative diseases becauseof a generic disreactive ground andemergence of autoimmune clones.The basicdisease and PTI have often anindipendent course. In our cases the thrombocytopeniabegan when the patients werein CR. An additional responsibility for theimmunosuppression of the chemoradiotherapeuticregimen may be presumed.P418UNUSUAL EXTRANODAL RELAPSE IN APATIENT WITH GOOD PROGNOSISHODGKIN DISEASEL. SANTORO, R. NOTARO, G. FALZARANO, *A. D’ARCO,+G. LIMITE, °L. PANICO, A. DE RENZODivisione di Ematologia, + Dipartimento Cl. Med.Chir. e Chirurgia Generale ed Oncologica,°Anatomia Patologica, Università Federico II,Napoli;*Div. Medicina Osp. Cava Dei Tirreni(Salerno); ItalyPrimitive Non Hodgkin Lymphoma of thebreast is a rather uncommon diagnosis:from 1928 to 1998 only 69 cases have beendescribed. Much rarer is Hodgkin Disease(HD) involvement of the breast. In October1989 a 18 year-old woman received diagnosisof HD nodular sclerosis, stage II-A(cervical and mediastinum), after a stagingwork up which included laparotomy withdiagnostic splenectomy. She received extendedfield (mantle) radiation therapy ata dose of 150 cGy/day for a total of 45 Gy.The patient remained in complete remissionfor 7 years. In December 1996 a nodulein the left breast was removed. Biopsyshowed HD recurrence, with no other siteinvolved (stage I-E). Polychemotherapy wasstarted, but the patient died from pneumoniacomplications during the aplastic phasefollowing the second course. Breast tumorsoften develop as a second malignancy years

37 th Congress of the Italian Society of Hematology303after chest radiotherapy in young women,the tumor generally arising on the edge ofthe irradiation field. This case was peculiarbecause breast biopsy revealed HD recurrencebut not breast cancer (and breast isan extranodal site rarely involved in HD),and because the interval between HD presentationand relapse was unusually long,simulating the occurrence of a secondaryneoplasia. It could be argued that the stagingsplenectomy may have had some rolein favoring the late relapse, by reducingimmunosurveillance against a minimal residualdisease. In literature two cases ofprimitive HD of the breast (Shouten et aland Ariad et al.) and only one case of earlybreast recurrence of HD have been reportedso far.P419EPIDEMIOLOGY OF NON-HODGKIN’SLYMPHOMAS: DISTRIBUTION ANDINCIDENCE RATES OF THE MAJORSUBTIPES ACCORDING TO THE REALCLASSIFICATION IN MODENAPROVINCEM. BANZI, T. ARTUSI, A. MAIORANA, V. SILINGARDI,M. FEDERICODepartment of Medical, Oncological and RadiologicalSciences of Modena and Reggio Emilia University,Division of OncologyIn the last 15 years, the wider use of immunohistochemistryand citogenetic andmolecular analysis, has provided much newinformations about the lymphomas, resultingin recognition of new entities and refinementof previously recognised diseasecategories. Indeed it has become evidentthat the two classification systems morewidely used, the Working Formulation andthe Kiel Classification, were inadequate.Then, in 1994, the International LymphomaStudy Group (ILSG) has proposed a newclassification scheme based on the morphologic,immunologic, citogenetic features and, sometimes, their clinical presentation andcourse, and postuleted normal counterpartin the immune system. Due to a poor knowledgeabout the incidence of NHL, classifiedaccording to the REAL, we have developedan epidemiologic study of new 473 consecutiveNHL cases (245 male, 228 female) registeredat Cancer Registry of Modena fromJanuary 1988 to December 1991. The medianage at diagnosis was 64 yr. (range 9-93). Slides of 409 cases (86,5%) were reviewedby two of our Authors (A.T., A.M.)and reclassified according to the REAL.Three hundred and forty four patients(84%) had B-cell neoplasm, 55 (13%) T-cell neoplasm and 10 (0,2%) were consideredunclassifiable. Diffuse large B-cell lymphomawas the most common diagnosis(32,3%) followed by extranodal marginalzone B-cell lymphoma of the MALT (13,3),follicle centre lymphoma (11,6 %) andmantle cell lymphoma (6,7%). Thelymphoplasmacytoid lymphoma was 3,4%,but it resulted 13% when we consideredWaldestrom’s Macroglobulinaemia too. The5 yr. survival was 43% (38% in male and46% in female, p=0,07). Respectively the5 yr. survival was 31% in DLBCL, 66% inEMZBCL, 55% in FCL and 44% in MCL. Accordingto the REAL classification, distributionof our 409 cases has confirmed thatNHL constitute a heterogeneous group ofmalignancies with many different clinicalbehaviours.P420EXPRESSION OF CYCLIN D1, D3 AND BIN NHL AND ITS CORRELATION WITHPROLIFERATIVE INDEX (Ki67)L. RIGACCI, R. ALTERINI, V. CARRAI, F. INNOCENTI,A. CARPANETO, G. BELLESI, P. ROSSI FERRINIHaematology Departement, University and CareggiHospital of Florence, Florence ItalyCyclines are proteins which have beenimplicated in the control of mitosis in alleukaryotes. Ki-67 is a nuclear-associatedproliferation antigen and it is express in allcycle phases except for G0. We want todefine the expression of those cyclines inNHL tissues and we would evaluate theircorrelation with proliferative index and theirexpression in these diseases. Using theAPAAP method we performed the followingantibodies in 53 cases of NHL: anti-CyclinD1, anti-Cyclin D3, anti-Cyclin B and anti-Ki67. Cyclin D1 was expressed in 13 cases(24%), it was present in all 7 mantle celllymphoma subset with high positivity. CyclinD3 was expressed in 10 patients it waspresent in four mantle cell lymphoma andit has a low expression in some large celllymphomas, it was not present in follicular

304 September 26-29, 1999 - Torino-Lingotto, Italylymphomas. These two cyclines werecaracterized by a prevalent expression inadvanced stage (>80%), symptomaticcondiction (>80%) and high value ofLDH(>70%). Cyclin B, with nuclear expression,was present (more than 60% of positivity)in 32 pts, Ki67 was positive in 22cases. Ki67 was highly expressed in all largecell lymphomas but no in follicular one, itwas significantly positive in pts with highLDH value. Cyclin B was also present in follicularlymphoma (53%) and in mantle celllymphoma (6 out 7). Cyclins D1 and D3were not correlated with proliferative index,on the contrary cyclin B was strictly fittedwith Ki67 expression, its presence in a portionof follicular lymphoma will probablyallow to identify more aggressive nodularpattern.P421SERUM LEVELS OF THE sCD30MOLECULE IN ANAPLASTIC LARGECELL LYMPHOMA (ALCL):RELATIONSHIP WITH THEEXPRESSION OF NPM-ALK P80 FUSIONPROTEINM. MICHELETTI, G. NADALI, M. CHILOSI, L. MOROSATO,G. PERONA, G. PIZZOLODepartment of Clinical and Experimental Medicine,Section of Hematology, and Institute of Pathology,University of Verona, ItalyThe expression of the NPM-ALK P80 fusionprotein, generated by the t(2;5) translocation,occurs in approximately 60% ofALCL. These cases consistently show a T/null phenotype and CD30 expression. Thesoluble form of the CD30 molecule (sCD30)is released into circulation by proteolyticcleavage of the membrane molecule andcan be detected by enzyme-linked immunoassay. We evaluated the sCD30 serum levelsin 13 patients with immuno histologicallyrecognized CD30+ T/null ALCL in relationshipwith the P80 expression. Detectionof the ALK protein was performed withthe moAb ALKc. Patients were 7 males and6 females with a median age of 34 years(range 8-77 yrs.). The P80 fusion proteinwas detected in 7/13 cases (54%). Statisticallysignificant higher sCD30 serum levelswere detected in P80+ patients comparedto P80- patients.ALCL sCD30 U/ml sCD30 U/ml pmean ±S.D. median (range)P80 + n= 7 2,641.8±1,599.2 2,538 (660-4,920) 0.0027P80 - n= 6 132.1±135.8 118 (3-327)P80+ cases had more advanced disease,lower median age and higher incidence ofsystemic symptoms when compared to P80-cases (stage III-IV in 7/7pts. vs. 1/6 pts.,median age 22yrs. vs. 60 yrs., B symptoms6/7 pts. vs. 3/6 pts., extranodal involvementin 6/7 pts. vs. 2/6 pts.) All patientswere treated with different third generationchemotherapy regimens. Among P80+cases the complete remission was achievedby 5/7 patients and 2/5 subsequently relapsed.Complete remission was obtainedby 5/6 P80- patients and 4 of them eventuallyrelapsed. A statistical difference interms of prognosis could not be demonstratedbetween P80+ and P80- cases. Ourobservation support the hypothesis thatthese two subgroups of ALCL are likely torepresent homogeneous deseases based onthe presence or absence of the molecularabnormality.P422SOLUBLE CYTOKINES IN HODGKIN’SDISEASE RELATE AT DIAGNOSIS WITHDISEASE ACTIVITY AND CLINICALSTAGEC. VENER, A. GUFFANTI*, M. POMATI, M. COLOMBI,A. ALIETTI, M.L. LA TARGIA, M. GOLDANIGA,F. BAMONTI-CATENA, L. BALDINIServizio di Ematologia, Università degli Studi,Ospedale Maggiore, I.R.C.C.S. and *Divisione diMedicina I, Ospedale “Fatebenefratelli e Oftalmico”,MilanoIntroduction: The purpose of this studywas to analyse the correlation between serumlevels of different cytokines and clinicolaboratoristicfeatures suggestive of worseprognosis, in a group of patients withHodgkin’s disease (HD). Methods: 31 pts(median age: 30 yrs; M/F: 13/18; stage I/II vs III/IV: 19/12; B symptoms: 12; bulkydisease and extranodal disease: 9) with denovo diagnosed HD were investigated. Serumlevels of sCD30, TNFα, TNF receptor Iand II, IL 6, IL 6 receptor, IL 10, sICAM-1were evaluated at diagnosis, and comparedwith: sex, age (≤/>30), stage (I-IIvsIII-IV),systemic symtoms, bulky disease, ESR (

37 th Congress of the Italian Society of Hematology305≥40), cupper (≤/>170), WBC count (≤/>15.000), prognostic score (PS) accordingto Hasenclever (33.15, IL6 >12.43,TNFα >29.71, IL6-R >57, TNF-RI >3.23)that significantly relate with older age, systemicsymtoms, bulky disease and highstages, ESR, cupper, WBC count and PS.Conclusions: Our study shows the associationof high levels of IL6, sCD30, TNF-RIand TNFα with advanced or worse prognosisdisease. In a multiparametric stagingapproach of HD cytokines evaluation maybe of potential value in identifying patientseligible for more intensive therapies.P423THE POOR PROGNOSTICSIGNIFICANCE OF BONE MARROW(BM) INVOLVEMENT IN DIFFUSELARGE CELL LYMPHOMA (DLCL)C. BOCCOMINI, U. VITOLO, E. ORLANDI, S. CORTELLAZZO,G. TODESCHINI, C. TARELLA, R. FREILONE, M. BERTINI,B. BOTTO, R. CALVI, L. ORSUCCI, P. PREGNO, G. LUXI,E. GALLOFor the IMRNHLSG UOA Ematologia Az. Osp.S. Giovanni Battista, TorinoIntroduction: the adverse prognosticsignificance of BM involvement is not alwaysrecognised. Patients and Methods:between 1986 and 1993, 246 patients (pts)with advanced stage DLCL were treated withMACOP-B (200) or VACOP-B (46). Medianage was 45 years (range 15-60); 19% hada PS >1; 47% a LDH level greater thannormal; 46% had stage II disease, 21%stage III and 33% stage IV; 52% a bulkydisease, 19% >1 extranodal sites and 10%had large cell BM involvement. Accordingto the Age-Adjusted IPI score, 25% wereat low risk (L), 36% at low-intermediate(LI) risk, 37% at intermediate-high (IH) riskand 8% at high (H) risk. Results: medianfollow-up was 115 months; 75% achieveda CR that decreased significantly throughIPI groups: 90%, 77%, 65% and 56%.Nine-yrs overall survival (OS), DFS and failurefree survival (FFS) rates decreased fromthe low risk group to the high one. OS was78%, 66% 42% and 22%; DFS was 85%,70%, 60% and 40% and FFS was 76%,54%, 39% and 22%. A Cox multivariateanalysis with FFS as end-point, includingall clinical characteristics, was performed:BM involvement and IPI score were the onlysignificant independent factors affecting FFSrates (p

306 September 26-29, 1999 - Torino-Lingotto, Italysistent with our previous reports, HCVmarkers were detected in 76/209 patients(37%). In this study, HCV infection confirmedits statistical prevalence among oldages and female sex. Extranodal localizationwas documented in 104 patients(50%), and it was not influence by the presence(46%) or absence (51%) of HCV infection.Stomach was the more frequentextranodal localization we detected 31/209(15%). Other frequent extranodal localizationswere in order: spleen (7%), skin (5%),bowel (4%), orbit (4%), liver (6%), muscle(2%) etc. Stomach was more involvedamong HCV- patients (p=0.03) and MALTlymphoma was slightly more frequent thandiffuse large cell lymphoma. In two cases,we were able indeed to detect the simultaneouspresence of MALT lymphoma and diffuselarge cell lymphoma in the same stomach.Consistent with previous observations,our data suggest that lymphomatous involvementof the stomach be sustained byother etiological agents than HCV. On theother hand, orbital involvement by lymphomaprevailed in patients with HCV infection(2/133 versus 8/76, p=0.003), eightamong 10 orbital involvement revealed tobe MALT lymphoma. Despite several reports,involvement of the liver and spleenwere not influenced at all by HCV infection.Equally, cutaneous and intestinal involvementother than stomach did not differ inthe 2 groups. In our cohort of patients 4muscle involvement were detected. In conclusion,we underlie the great amount ofextranodal localization in our lymphomatouspatients. However, only lymphomatousorbital involvement might prove to be favoredby HCV infection, while stomach involvementwas lower in HCV+ than in HCVpatients.P425ULTRASOUND GUIDED BIOPSY OFABDOMINAL LYMPHONODESD. VALLISA, G. CIVARDI, R. BERTÈ, G. SBOLLI, G. NIFOSÌ,B. FERRARI, L. CAVANNAUltrasonography (US) and computed tomography(CT) guided percutaneous biopsyof abdominal lesions has become a widleypractised procedure and many investigatorshave reported favorable results withbiopsies of various organs, but there haveonly been a few reports about biopsy of theabdominal lymphonodes. The aims of thisreport is to evaluate the overall accuracyand the safety of US-guided fine-needleaspirationand tissue-core biopsy of abdominallymphonodes in a series of 50 patients.US-guided fine needle biopsy of abdominallymphonodes was performed in 50 patientsin our Division from June 1995 to December1998. The biopsies were performedunder US guidance. A 22 gauge Chibaneedle for aspiration cytology was used asfirst step in all the patients; a rapid cytologicstain was performed in all cases andwenhever it suggested the diagnosis of lymphoma,tissue core biopsy was carried outwith a 21 gauge to allow a definite diagnosisof lymphoma. The biopsies showed metastasisfrom adenocarcinoma in 18 patients(36%), from carcinoma in 4 (8%), frommelanoma in 1. Non Hodgkin’s lymphoma(NHL) was diagnosed in 15 patients (30%),among this patients 2/15 (13%) had provenlymphoma, diagnosed before the US guidedbiopsy; in 13/15 (86%) the US-guided biopsywas the first diagnostic procedure: 2patients showed low-grade, 5 intermediateand 6 high grade NHL. In 3 additional casesthe biopsy was suggestive but not diagnosticfor lymphoma, the surgical biopsyshowed Hodgkin’s disease in 2 andCastleman disease in 1. Benign disorderswere diagnosed in 6 patients and includedmycobacteria in 2 and lymphoadenitis in 4.In 3 patients (6%) the biopsies failed toobtain adequate tissue, due to necrosis and/or fibrosis. Diagnostic tissue was obtainedby US-guided biopsy in 47 of the 50 patients(94%) with abdominal lymhoadenopathy,in 44/50 (88%) cases, a definitivediagnosis was made, while in 3 cases thebiopsy stronghly suggested the diagnosisof lymphoma. No complications occurred;this technique is a simple and safe way toobtain specimens for cytological and histologicaldiagnosis from abdominal lymhonodesaroiding more expensive proceduressuch as laparoscopy or laparotomy.1 st Division of Internal Medicine - Hematology,Piacenza Hospital

37 th Congress of the Italian Society of Hematology307P426ULTRASOUND GUIDED FINE NEEDLEBIOPSY OF THE SPLEEN IN SUSPECTEDHAEMATOLOGICAL MALIGNANCIES:HIGH CLINICAL EFFICACY AND SAFETYIN A MULTICENTER ITALIAN STUDYG. CIVARDI, D. VALLISA, R. BERTÈ, A. GIORGIO, C. FILICE,M. CAREMANI, E. CATURELLI, M. POMPILI, I. DE SIO,E. BUSCARINI, L. CAVANNA1 st Division of Internal Medicine - Hematology,Piacenza Hospital and The Multicenter Focal SpleenLesion Study GroupPurpose: To obtain more information ontechnical problems, clinical efficacy andsafety of Ultrasound Guided Fine NeedleBiopsy (UG FNB) of the spleen in a largeseries of patients with suspectedhaematological malignancies. Materialsand methods: We collected the experiencewith UG FNB of the spleen in patients withsuspected haematological malignanciesfrom eight Italian clinical centers that utilizedthis technique for at least ten years.A collection schedule was sent to all centersto collect all information abut technique,resultsa and complications of UG FNBof the spleen. Results: We analyzed 398biopsy procedures both on focal splenic lesionsand on splenic parenchyma. The overallaccuracy was 90,9% for the whole series,84,9% for cytologic sampling, 88,3%for microhystological sampling and 90,3%for the double biopsy. Tissue core biopsywas better in patients with suspected lymphoma(90,9 vs. 68,5% for cytology). Complicationrate was low (less than 1% formajor complication and 5,2% for all complications).Conclusions: UG FNB of thespleen is a very effective diagnostic procedurewith low (but not negligible) risk. Inoverall indications, aspiration cytology andcore needle biopsy show similar diagnosticyeld, except for the diagnosis of splenic lymphoma,in which core needle biopsy showedbetter results.P427ULTRASOUND–GUIDED BIOPSY OF THESPLEEN: A SINGLE INSTITUTION.REPORT ON 130 PATIENTSR. BERTÈ, G. CIVARDI, D. VALLISA, G. NIFOSÌ, B. FERRARI,G. SBOLLI, L. CAVANNA1 st Division of Internal Medicine - Hematology,Piacenza HospitalUltrasound (US) and computed tomography(CT) can guide percutaneous biopsies,however little literature exsists concerninguse of these procedures for splenicdisease. This can be due to bleeding risk,difficulty in access, uncommonnes of focalsplenic lesions. Initially we approached thisarea with hesitation performing only USguidedfine-needle aspiration biopsy ofsplenic focal lesions in patients with lymphoma,subsequentaly we performed alsoUS-guided splenic tissue core biopsy in patientswith or without focal lesions of thespleen. The purpose of this paper is tosummarize our experience with US-guidedbiopsies in the spleen performed in 130patients and to report the technique, precautions,results and complications. Onehundred and thirty patients underwentpercutaneous splenic biopsies at our Institution;conditions necessary to do thebiopsy were: normal thromboplastin time,prothrombine activity more than 50%, andplatelet count higher than 7x10 9 /l. Thesplenic biopsies were performed withsonographic localization, acces routeswere selected to avoid colon, pancreas,kidney, lung and pleura. All focal lesionswere checked initially with a 22-gaugeneedle for aspiration cytology and tissuecare biopsy was done only in lesions suspectedto be of lymphomatous nature atrapid citologyc stain. In patients withoutfocal lesions splenic biopsies were performedeither with 22-gauge needle foraspiration citology and 21-gauge Surecutfor tissue core histology. In three patientswith abscesses dranaige catheters were insertunder US-guidance. Diagnostic tissuewas obtained by US-guided biopsy of thespleen in 126 of the 130 patients (96%).Thirty patients showed malignant disease:23 non-Hodgkin’s lymphoma, 1 Hodgkin’sdisease, 5 metastatic carcinoma, 1 sarcoma.One hundred patients showed nonmalignant disease: cists 6, abscesses 5,

308 September 26-29, 1999 - Torino-Lingotto, Italytubercolosis 5, granulomatosis 3, normalsplenic tissue in the other patients (biopsiesperformed as a staging procedure inpatients with a previously diagnosed lymphoma).Only two patients showed subcapsularhematoma which resolved spontaneously.Our results suggest, that carefullyperformed biopsy and drainage techniquesapper to be safe and may conservethe spleen by avoiding splenectomy.P428abstract not receivedP429PROGNOSTIC SIGNIFICANCE OF TWODIFFERENT STAGING SYSTEMS (SS)FOR PRIMARY GASTRICNON-HODGKIN’S LYMPHOMAS(G-NHL)L. GARGANTINI 1 , M. CAROLI COSTANTINI 3 , G. LANDONIO 2 ,P. BERNUZZI 1 , L. BARBARANO 1 , P. ORESTE 3 , L. SANTOLERI 1 ,A. TEDESCHI 1 , E. MORRA 1Division of Hematology 1 ,Division of Oncology 2 ,Department of Pathology 3 , Niguarda Ca’ GrandaHospital, Milan,ItalyStaging classification of G-NHL is controversial.To assess the usefulness of twoproposed SS (Lugano ’93 and TNM adjusted),we performed a clinical and histopathologicalre-evaluation of 74 pts withprimary G-NHL (mean age 64 yrs, M/F ratio1.5). 62 pts underwent surgical resectionand 12 had endoscopic biopsy only. Allcases were B-cell type: 29 were classifiedas low grade and 45 as high grade. 68showed the MALT type features. Stage wasassessed according to the Lugano ’93criteria,and to the TNM SS adjusted byShimodaira (Cancer, 73, 2709, 1994), whichmore precisely evaluates the anatomicalextent of tumor involvement.26 pts with completely resectable lesionsand two pts Lugano stage II1 and TNM stageII with severe coexisting disease, receivedno chemotherapy (CHT). 44 pts were submittedto CHT (mainly CHOP) 36 of whichafter surgery. 4 pts received anti Helicobactertherapy (anti HP). Treatment outcomeis as follows:Total 74 CR PR Progr. RelapseResection 26 21 1 4 4CHT 8 6 2 - -Res + CHT 36 30 2 3 4Anti HP 4 1 1 2 -Median follow-up is 46.5 mos (1-190). Theoverall 5- and 10-year survival rate is 72%and 56% respectively, and DFS 87% (plateauafter 30 mos). Significantly differentsurvival was found for grade of malignancy.Stage I disease assessed by TNM SS, wasassociated with significantly better survival.In conclusion this study confirm the importanceof a careful staging with assessmentof the infiltration of the gastric wall as consideredmainly in the TNM SS.P430PRIMARY HEPATIC LYMPHOMASA. DE RENZO, M. PERSICO*, I. DE SIO*, R. NOTARO,G. FALZARANO, L.E. SANTORO, B. ROTOLIHematology Unit, Federico II University, Naples;*Internal Medicine and Hepatology Unit,II University of Naples, ItalyPrimary hepatic non-Hodgkin lymphoma(PHL) is rarely reported; to date, nomore than 100 cases have been describedall around the world. Since 1995 we observedsix histologically documented casesof PHL.Lugano’93 N 5-yr surv 10-yr TNM N 5-yr surv 10-yrStage I 39 81 66 % Stage I 22 90% 81%Stage II1 15 72% 54% Stage II 24 69% 48%Stage II2 10 51% 25% Stage III 26 63% 46%Stage IIE 8 62% 62%Stage IV 2Stage IV 2

37 th Congress of the Italian Society of Hematology309may lead to prolonged CR. The frequentassociation of these lymphomas with HCVconfirm a possible role of this virus inlymphomagenesis.P431LGL PROLIFERATION: FOLLOW UP OF12 CASESD. MANACHINO, A. SANTAGOSTINO*, L. OLIVETTO, M. BOGNIDivisione di Medicina Generale e *ServizioImmunotrasfusionale - Ospedale S. Andrea -Vercelli, ItalyNone of the patients showed general signsof disease. Two patients had abdominalpain, in all the others the diagnosis wasoccasional. Histology showed intermediateseveredegree of malignancy according toW.F. in 5/6 patients, with high prevalenceof B cell lymphomas. Virology was studiedin all patients: none was HbsAg or HIVpositive; 3/6 patients were HCV positive andhad increased serum ALT. Tumor markers(a 1FP and CEA) were normal. Five patientsreceived chemotherapy, using the CEOPregimen, 1 patient with a single focal lesionreceived surgical treatment (partialhepatectomy). 5/6 reached complete remission;only one patient with HCV-related cirrhosisdied of hepato-renal syndrome, incomplete remission from lymphoma. Conclusions:PHL is rare but not exceptional(6 out of 210 NHL observed in our Unit inthe last 4 years). The prevalent histologicaltype is B cells with a intermediate-severedegree of malignancy. Chemotherapy(or even surgery in case of monofocality)Large granular lymphocytes (LGLs) represent10 to 15% of normal peripheralmononuclear cells. LGLs can be classifiedinto two major lineages CD3- CD56+ NKand CD3+ CD57+ cytotoxic lymphocites.Clinical and immunological studies allowedthe identifications of 5 clinical conditions:T-LGL leukemia, reactive LGL proliferation,NK LGL leukemia, chronic NK lymphocytosis,reactive NK lymphocytosis. T-LGL andNK-LGL leukemias are considered as twodistinct clinical conditions. We present 12cases of “LGL proliferation” diagnosed in theProvince of Vercelli (184.000 inhabitants).Mean age was 63 years (range 31-72). Inall patients phenotyping and routine laboratoryinvestigations were carried out. Expansiveclonal investigations were only performedin 4 patients with anemia and/orbacterial infectious. Ten out of 12 patientswere CD3+ CD57+, two out of 12 were CD3-CD56+, one had reactive NK lymphocytosiswith Rheumatoid Arthritis and one hadNK-LGL aggressive leukemia with cutaneousinfiltrates, organomegaly, B symptomsand died in 4 months despite chemotherapy.During a mean follow up of 19 months 3out of 10 patients developed anemia +/-recurrent infectious. Clonal study alloweda diagnosis of T-LGL leukemia. 7 out of 10patients were asynptomatic and were labelledas “reactive LGL proliferation”. It isour opinion that characterization of “rare”hematological diseases by expensive laboratoryinvestigations, i.e. TCR gene rearrangementstudies, should be limited toselected symptomatics cases.

310 September 26-29, 1999 - Torino-Lingotto, Italyinterstitial pneumonia wih pulmunary failureand was admitted to an intensive careunit. In this occasion a lymph node biopsywas performed. The histologic examinationshowed an epithelioid population with someblasts scattered through out. The latters hadthe following phenotype: CD30+, EMA+,TIA-1+, CD3±, CD4±, CD1a-, CD8-, CD21,CD68-, CD79-, CNA.42-, MPO-, glycophorin-.A diagnosis of anaplastic large cellslymphoma (ALCL) was made. This hypothesiswas confirmed by further immunostainsthat showed a cytoplasmatic and nuclearpositivity for ALK protein and the N-terminalportion of the NPM protein, thus supportingthe presence of the ALCL-associatedtranslocation (2;5)(p23;q35). Thistranslocation generates a hybrid gene,which encodes for the chimeric protein NPM/ALK. The patient was treated with anantiblastic regimen and obtained a completeremission. This case emphasizes the relevanceof the new anti-ALK and anti-NPMantibodies for the diagnosis of ALCLs, alsoin cases with a prominent reactive componentobscuring the neoplastic population.In the past, cases like this, curable withmodern therapies, have often been regardedas “iperimmune reactions” with patientloss.P432ALK PROTEIN IDENTIFICATION BYMONOCLONAL ANTIBODIES IS ANUSEFULL WAY IN THE ANAPLASTICLARGE CELLS LIMPHOMASDIAGNOSIS: A CASE REPORTP.P. PICCALUGA, S. ASCANI, G. FRATERNALI ORCIONI,B. FALINI, S.A. PILERIInstitute of Hematology and Clinical Oncology“Seràgnoli” - Service of Pathologic Anatomy andHemopathology - University of Bologna, ItalyA 9 year female was hospitalized for supraclavicularadenopathy and high fever.Phisical examination and CT-scan showeda mediastinal mass and an hepato-splenomegaly.A tick bite was referred. Serologicaltests revealed a weak positivity for antirickettsialantibodies; a specific antibiotictherapy, in association with antifungalagents and corticosteroids, was administered.After a transient improvement ofsymptoms, the patient developed a severeP433PRIMARY ADRENAL NON-HODGKINLYMPHOMA REVEALED BYAUTOIMMUNE HEMOLITIC ANEMIA.REPORT OF A CASE WITH DIAGNOSISBY FINE-NEEDLE ULTRASONICALLYGUIDED BIOPSYB. FERRARI, R. BERTÈ, D. VALLISA, G. CIVARDI, G. SBOLLI,G. NIFOSÌ, L. CAVANNA1 st Division of Internal Medicine - Hematology,Piacenza HospitalPrimary localized adrenal non-Hodgkinlymphomas (NHL) are extremely rare. Only28 observations have been reported so far,with a very poor prognosis: a median survivalof 12.5 weeks. The authors report apatient with primary non-Hodgkin lymphomaof the right adrenal gland presentingwith severe autoimmune hemolitic anemia(AIHA). A 78-year-old man was admittedto our department with severe anemia;the hemoglobin value was 6.5 g/dl and the

37 th Congress of the Italian Society of Hematology311direct Coombs’ test was positive. A steroidtreatment with metylprednisolone 2mg/Kg/day did not improve the hemolitic process.Abdominal ultrasound examination showeda right hypoechogenic suprarenal massmeasuruing 10 x 9 cm; fine-needle aspirationand tissue-core biopsy revealed non-Hodgkin lymphoma (NHL) of low-gradetype. Staging procedures: clinical examination,total body computed tomographyscan, bone-marrow biopsy, gallium scan,abdominal magnetic resonance imaging didnot disclose other sites of involvement andstrongly supported a diagnosis of primaryNHL of right adrenal gland. Hormone assayswere within normal limits. The patientwas treated with chemotherapy, CVP regimen(cyclophosfamide, vincristine, prednisone),with a good regression of the adrenalmass after 6 courses and normalizationof Hb level and negativity of Coombs’tests. The importance of this case lies inthe very rare occurrence of this disease, itsassociation with AIHA, the diagnosis madeby ultrasound guided biopsy, the good responseto treatment, if compared with casespreviously described, and the good survivalrate (still alive after 12 months).P434PRIMARY LYMPHOMA OF THEPROSTATE: REPORT ON TWO CASESS. PALMIERI, F. RONCONI*, A. SEMENTA*, A. BISOGNO*,M. ANNUNZIATA, C. COPIA, S. DOMIZIO^, F. DI FIORE^,R. CIMINO, G. TESTA^, F. FERRARADivisione di Ematologia, Ospedale Cardarelli,Napoli; *Divisione di Ematologia, Ospedale S.G.Moscati, Avellino; ^Divisione di Urologia, OspedaleMonaldi, NapoliPrimary lymphoma of the prostate (PPL)is a rare malignancy of prostatic glande,accounting for less than 1 % of untreatednon Hodgkin lymphoma (NHL) and less than0.1 % of all prostate cancers. Here we describetwo patients diagnosed as havingPPL, observed at our institutions among atotal of 687 NHL (0.003 %). The two patientswere aged 30 and 67 years, respectively.Both presented with symptoms oflower urinary tract obstruction and in bothrenal failure, secondary to bilateral hydronephrosis,was observed. B symptoms wereabsent. According to histology, one patientwas classified as large cell lymphoma, whilethe second as small lymphocytic (immunocytoma).In both patients, diagnosed wasperformed by radical prostatectomy. Computerizedtomography of the chest, abdomenand pelvis did not reveal lymphonodenopathies;bilateral bone marrow aspirateand biopsy were negative for marrowinvolvement. Either prostate specific antigenor serum lactate dehydrogenase levelswere normal in both patients. At diagnosisthe patient with large cell lymphoma wasmanaged with chemotherapy (CHOP). Following1 cycle, urinary obstruction symptomsand renal failure disappeared. After afollow-up of 48 months, he is in completeremission normally attending to his occupation.The patient with immunocytoma didnot receive any treatment following surgeryand was free of symptoms for 5 months.Then, left latero-cervical lymphoadenopatiesappeared in absence of any otherclinical signs. Nodal biopsy confirmed theinitial diagnosis. The patients was treatedwith 6 courses of CEOP and achieved CRafter the third cycle. Two years later, a secondrelapse was observed involving laterocervical,axillary and mediastinal lymphonodes.In addition, gastric localization wasdemonstrated by endoscopy and multiplebiopsies. Once again, histologic examinationshowed small lymphocytic lymphoma.Fludarabine was given as mono-chemotherapy(6 cycles) with achievement of secondCR lasting 18 months up to the time ofwriting. Although PPP is rare, it should beconsidered in the differential diagnosis oflower urinary tract obstruction. Chemotherapyappears useful and prolonged CRand/or cure may be achieved.P435ASSOCIATION BETWEEN MULTIPLEMYELOMA AND NON HODGKINLYMPHOMA: DESCRIPTION OF TWOCASESD. FERRARI, L. MIGLIORINI*, R. BAIARDINI, S. BRUNATIUnità di Ematologia, Ospedale di Abbiategrasso(MI); Servizio di Anatomia Patologica, Ospedale diMagenta (MI)*The association between Multiple Myeloma(MM) and Non-Hodgkin Lymphoma (NHL)is rare. We describe two cases of MM associatedto gastric non MALT NHL. CASE 1: a85 year old female was followed for MM IgGk, diagnosed in 1989. At first admission

312 September 26-29, 1999 - Torino-Lingotto, Italybecause of bone pain and mild anemia, shehad a Monoclonal Component (MC) of 4 gr/dl, presence of BJ proteinuria, and marrowinfiltration (30% atypical plasmacells).There were not osteolytic bone lesions. Thepatient was treated with Alkeran and Prednisone,reaching complete remission (CR).On December 1995 she was treated againfor relapse (fever, anemia, pain, 40% marrowplasmocytosis) with chemotherapy(M2). The patient reached CR again. Gastrectomywas performed on September1999 for a huge gastric ulcer; Helycobactertest was positive. The diagnosis was diffuselarge B cell NHL, stage IV, with diffusethoracic and abdominal nodal and splenicinvolvement. The MC was not increased butBJ proteinuria was present. Osteolytic craniallesions appeared. Bone marrow wasinfiltrated only by MM (30% atypicalplasmacells). The patient was started withFludarabine. CASE 2: a 82 year old malewas admitted for gastric diffused large Bcell NHL, involving fundus, corpus, distaloesophagus and liver. Helycobacter testwas positive. MC IgG lambda was 2 gr/dl.Marrow plasmocytosis was 30%, withoutlymphoma cells. The patient was treatedaccording to mini-CEOP protocol (6 cycles)and he reached CR. Control after therapyconfirmed MM in bone marrow. There is noevidence of lymphoma relapse, 16 monthsafter the end of therapy. Conclusions: therarity of the association MM/NHL indicatesa casual relation between the two diseases.MM has a favourable course, with long survivalin the first case, and no symptoms inthe second. Non MALT lymphoma, in thesecases, was in advanced stage and aggressive.Nontheless, we observed an impressiveregression of lymphoma in the secondcase, while we need a longer follow-up toevaluate the outcome of the first case.P436BONE MARROW’S GRANULOMAS INNON-HODGKIN’S LYMPHOMAD. DINI, G. BONACORSI, *A. CAVICCHI, *V. MONTARARIDiv. Ematologia Az. Ospedaliera Modena,*Div. Medicina Ospedale CrevalcoreGranulomatous lesions of bone marroware a possible occurrence in patients withlymphoproliferative diseases. The picturescan consisted of lesions showing small lymphocytesintermingled with abundant benignepithelioid cells and with giant cells,or of foci of malignant lymphoma containingcollection of epithelioid cells formingdiscrete granulomas, or of small lymphocytesand histiocytes associated withplasmacells and eosinophils. We observeda 61 years old woman after bone marrowbiopsy, made for presence of auto-antibodyanti IgG C3d but without signals ofhaemolisis, showed a lymphomatous infiltrationof small B-Lymphocytes. Total bodycomputed thomography and abdominalecography excluded further localizations oflymphoproliferative disease, and patientwent to follow-up, without special treatments.Control of bone marrow biopsy,made six months after, showed lymphomatousinfiltration arising from paratrabecularregions and constituted, prevalently, ofsmall B-lymphocytes, but, partly, ofimmunoblastic cells: near and inside theareas of lymphomatous infiltration wereepithelioid granulomas. Total body computedthomography showed evidence ofsmall lymphonodes in middle mediastinumand in left sovraclavear and axillary regionand evidence of small splenomegaly(bipolar diameter = 13,4 cm): notpleuroparenchimal lesions. Negative theclinical and laboratory’s data of infectionsand, in spite of reference of recent nodoseerythema, normality of ACE dosage and ofradiological tests excluded a concomitantsarcoidosis (patient refuse execution ofBAL). Although the pathogenesis and clinicalsignifiance of the granulomatous lesionsof the bone marrow in malignantlymphoproliferative diseases are unkown,these lesions should be differentiated fromlesions present in other diseases, speciallyin flogistic-infectious disorders, inautoimmune sindromes, in lipid granulomas.P437POLYMYALGIA RHEUMATICA ANDLYMPHOPROLIPHERATIVE DISEASES:A FORTUITOUS ASSOCIATION?M. MONTANARO, C. ANDRIZZI, R. CIAFRINO, M. MORUCCI,V. TINIASL Viterbo - P.O. di Montefiascone;U.O. di EmatologiaWe describe two cases of polymyalgia

37 th Congress of the Italian Society of Hematology313rheumatica (PMR), characterized by the appearance,more than four years after thediagnosis, of a lymphoprolipherative disease.Case 1: C.S., 74, M, complained ofpain at shoulder girdle since 12 months,without signs of joint inflammation. ESRwas 118 (1 st h); normocytic anemia waspresent (Hb: 9.5 g/dl). We diagnosed PMRand we started steroid therapy (0.25 mg/kg/die at the beginning, then 1 mg/kg/diebecause the persistence of the pain). Onemonth later the symptoms resolved and ESRand Hb were in the range of normality. Thesteroid therapy was continued, at lower dosage,for the following 4 years. 55 monthsfrom the diagnosis of PMR, splenomegalywas detected and severe anemia and thrombocytopeniasupervened. A bone marrowaspirate showed the presence of lymphoidblasts. The final evolution of the clinical picturewas a therapy-resistant Acute LymphoblasticLeukemia. Case 2. T.ML., 60, F, presentedwith a story of pain localized at thepelvic and shoulder girdle since two months.ESR was 131 (1 st h), Hb was 8.5 g/dl. Thephysical examination was normal. A wholebody CT and a bone X-ray were negative. Abone marrow biopsy showed erythroid andmegacaryocytic hyperplasia. We made a diagnosisof PMR and we started steroidtherapy (0.5 mg/kg/die). We observed arapid normalization of the ESR, the disappearanceof the anemia and the relief ofthe symptoms. Steroid therapy was continued,at very low dosage, for almost 4years. 48 months after the diagnosis ofPMR, we noted the enlargement of thelymph nodes of the neck.. A biopsy of oneof these nodes was performed. The histologicalexamination revealed a LymphocyticLymphoma. A bone marrow aspirate showedan interstitial lymphocytic infiltration. Immunologicalanalysis of peripheral bloodfailed to detect clonal B-cells. PMR may beassociated to neoplastic hematological diseases,synchronous or metachronous. Ourtwo cases highlight the advisability of aprotracted clinical observation of PMR patients,even if in clinical remission, becausethe late onset of the hematological manifestations.Case-control studies are needed,however, to investigate if PMR has to beconsidered as a potential paraneoplastic hematologicalsyndrome.P438INTRAVASCULAR LYMPHOMATOSIS:A CASE REPORTA. ABBADESSA, V. BELSITO PETRIZZI, L. LIGUORI,M. DE RIENZO, O. VILLANI, C. DE LUCA, P. FERRAVANTE,C. ZECCA, S. IACCARINO, G. DE SIMONE, M. GARCIA,G. ABBADESSADip. Intern. Clin. Sper. “F. Magrassi”. II Univ. degliStudi. NapoliBackground. Intravascular Lymphomatosis(IVL) is a rare, aggressive non-Hodgkinlymphoma (NHL), histologically characterizedby intravascular proliferation of neoplasticcells. Most are B-cell lineage, althoughT-cell-related tumors are described.Virtually any organ can be affected, especiallynervous system and skin, rarely kidneys,bone marrow and lymph nodes. Fever,dementia, nodular skin lesions orplaques and less frequently dispnea anddiffuse interstitiopathy are the commonestsyndromes. These pleiotropic pictures causethe frequent diagnosis post-mortem andmisinterpretation with vasculitis, multivasculardementia, occult neoplasms, infections.We report a case with bone marrow,renal and nervous involvment. Case report.A 63-year-old-man with anemia (7g/dl), leucopenia (2000/mmc), thrombocytopenia(19.000/mmc) and mild renal failure(creatinine 2 times normal value) wasadmitted for dispnea, cough and leg pain.There was reduction of kidney volumetry,ecographically documented. Renal biopsywas not performed, because of piastrinopenia.LDH (554 U/L), ferritine (880 µg/ml) and β-2 microglobulin (4,8 µg/L) wereabnormal. Bone marrow biopsy revealedinfiltration of large lymphoid cells, consistentwith a diagnosis of IVL. A VACOP-Bprotocol was partially carried out for toxicity.One month later the patient experiencedproximal muscle weakening, weight loss,nocturnal intense sweating and dizziness.A CEOP protocol was administered as a secondline, stopped again for toxicity. A newbone marrow biopsy proved negative forlymphoma, despite of persisting of the pancytopenicsyndrome. So dexamethasonewas empirically administered, resulting insafe hematological counts. Discussion. IVLis a rare NHL, consisting of multisistemicproliferation of neoplastic cells within intravascularspaces. An abnormal expressionof homing receptors could explain the trappingof neoplastic cells within small ves-

314 September 26-29, 1999 - Torino-Lingotto, Italysels. The clinical course of this disease isaggressive for occurrance of acute or chronicvascular failure of affected organs, especiallyif diagnosis and treatment are delayed.Our case, for the uncommon clinicalpattern and the response to treatment,points out IVL in the differential diagnosisof similar clinical presentations for the relevanceto establish an early treatment.P439MegaCEOP: CYCLOPHOSPHAMIDE(CTX) AND EPIRUBICINE (EPI)ESCALATION IN AN INTENSIFIEDSCHEME FOR THE TREATMENT OFPOOR PROGNOSIS AGGRESSIVE NONHODGKIN’S LYMPHOMA (NHL)B. BOTTO, U. VITOLO, G. TODESCHINI, M. PIZZUTI,M. BERTINI, C. BOCCOMINI, R. CALVI, R. FREILONE,V. MENEGHINI, P. PREGNO, L. ORSUCCI, E. GROSSO,G. PERONA, E. GALLOHematology Departments: S. Giovanni Battista,Torino; Univerisity of Verona; S. Carlo, PotenzaIntroduction: this pilot trial was conductedto determine the maximum tolerateddose intensity (MTDI) of CTX and EPIin the CEOP regimen. Methods: the MTDIof CTX and EPI was defined as the DI thatproduced a grade 4 WHO toxicity in at least25% of the courses delivered or a grade 4non hematologic toxicity in 20% of the pts.Standard CEOP doses were: CTX 750 mg/sqm + EPI 65 mg/sqm + VCR 1,4 mg/sqmd1 and PDN 40 mg/sqm dd 1-5 every 21days. The doses of CTX and EPI were escalated,mantaining the same doses of VCRand PDN. Courses were given at 14 day intervalsfor 6-8 courses, according to fourDI steps, as follows: 1 st level CTX 1000mg/sqm, EPI 100 mg/sqm (3 pts, 18courses); 2 nd level CTX 1000 mg/sqm, EPI110 mg/sqm (3 pts, 18 courses); 3 rd levelCTX 1200 mg/sqm, EPI 110 mg/sqm (20pts, 136 courses); 4 th level CTX 1500 mg/sqm, EPI 110 mg/sqm (2 pts, 14 courses).Results: 28 pts were enrolled: median age48 yrs (range 22-65), 21% had stage IIbulky, 11% stage III and 68% stageIV, 32%had BM involvement and 25% >1 extranodalsites. Sixty percent were at intermediate-highor high risk according to IPI. Thetwo pts treated on DI level four sustainedgrade 4 hematologic toxicity in 27% of thecourses. For this reason DI level three wasconsidered to be the MTDI. At DI level three18% of 136 courses determinated a grade4 neutropenia. Only one pt developed agrade 3 infection and no toxic deaths wererecorded. The median delivery time to completesix courses was 86 days (ideal time:84). Relative DI (DI given/planned DI) forCTX and EPI were: 0.99 and 0.98 respectively.Fifteen of 20 pts (75%) treated atthe MTDI obtained a CR: only one relapsedwith 83% DFS rate. With a median followup of 4 yrs the OS and FFS rates for the 20pts treated at the DI 3 rd level were 73%and 63%. Conclusions: megaCEOP regimenat the third DI level allows to safelyescalate the DI of CTX and EPI (240% and250%), compared to standard CEOP and isfeasible and effective in the treatment ofpoor prognosis aggressive NHL.P440CHOP INTENSIFICATION (ICHOP) INAGGRESSIVE LYMPHOMAS: MAXIMALDOSE-INTENSITY (DI) OFDOXORUBICIN (DOX) ANDCYCLOPHOSPHAMIDE (CTX)M. BALZAROTTI, C. CESANA, F. LATTERI, A. NOZZA,A. BERTUZZI, G. BIANCOFIORE, R. BUFALINO, A. SANTOROU.O. Oncologia Medica ed Ematologia, IstitutoClinico Humanitas- MilanoDose-intensity of single agents CTX andDOX plays a crucial role in the therapeuticoutcome of aggressive non Hodgkin’s lymphoma(NHL). In a previous report (Annalsof Oncology, May 1999), the feasibilitry andsafety of the ICHOP regimen up to CTX 1750mg/mq without GCSF and up to CTX 2750mg/mq with GCSF was demonstated. Inorder to further increase the dose intensityof DOX and CTX, the ICHOP regimen wasdelivered every 14 days in 20 patients (pts)consecutively treated from April 1997 toJanuary 1998. DOX dose was fixed at 75mg/mq whereas CTX was esacalated by 250mg/mq in consecutive cohorts of at leastthree pts, starting from 1750 mg/mq, inassociation with G-CSF 300µg s.c./d fromday 7 to day 12 of each cycle. Nine, sevenand four pts were treated at CTX dose-levelof 1750, 2000 and 2250 mg/mq, respectively.At 2250 mg/mq dose-level, 3/4 ptsexperienced dose-limiting toxicity, as de-

37 th Congress of the Italian Society of Hematology315fined by standard criteria. Relative DI (RDI)and actual (received) DI (ADI) of DOX andCTX, calculated according to Hryniukmethod, were standardized to standardCHOP (conventionally given a DI of 1), andthan compared to the maximum DI obtainedin the previous study. The results are reportedin the following table:CTX Dose (mg/mq)750* 2750** 1750 2000(N=9) (N=7)Interval (Days) 21 21 14 14CTXRDI 1 3,7 3,50 4ADI 3,59 3,39 3,35DOX RDI 1 1,5 2,25 2,25ADI 1,49 2,18 1,92* Standard CHOP, ** I-CHOP (Previous Study)In conclusion, the ICHOP regimen givenevery 14 days allows a two-fold and threefoldincrease of DOX and CTX DI, respectively,as compared to standard CHOP. Itrepresents the maximum deliverable DI ofthe two drugs on an outpatient basis withacceptable toxicity in.P441HOW DO AGGRESSIVE NON-HODGKIN’S LYMPHOMA PATIENTSTREATED WITH THIRD-GENERATIONREGIMENS (MACOP-B AND F-MACHOP)FARE IN THE LONG-TERM?M. MAGAGNOLI ON BEHALF OF AN ITALIAN COOPERATIVE STUDYGROUP ON LYMPHOMASInstitute of Hematology and Medical Oncology“Seràgnoli”, University of Bologna, ItalyA total of 348 patients aged

316 September 26-29, 1999 - Torino-Lingotto, Italyadriamycin and cyclophosphamide in ACVBPis approximately 150% compared to CHOP.Stem cell transplantation after high-doseCT was used only in relapsed pts withchemosensitive disease after 2 cycles ofMINE. Median age in both groups is 49.5.After a median follow-up of 18 months (3-52), results are as follows:CR/PR REL DFS (2y) Survival (3y)ACVBP 27/29 (93%) 10/27 (37%) 63% 67%CHOP/VACOP 20/22 (91%) 5/20(25%) 65% 70%Actuarial DFS and survival curves do notdiffer between the two groups. Over 95%of the scheduled CT dose intensity could beactually delivered in both groups. Amongpts treated with ACVBP, grade 3-4 toxicityoccurred in 28% of cases and one patientdied of meningoencefalitis during treatment.These preliminary results show thatthe use of dose-intensive CT with G-CSFsupport is feasible and may confer to patientswith IPI poor-risk DLCL a better prognosis,similar to that of good-risk patientstreated with standard CT.P443DIFFUSE LARGE CELL NON-HODGKIN’SLYMPHOMA. RETROSPECTIVEANALYSIS OF 450 PATIENTS TREATEDAT A SINGLE CENTERG. BELLESI, L. RIGACCI, R. ALTERINI, F. INNOCENTI,F. BERNARDI, G. LONGO, P. ROSSI FERRINIDepartement of Haematology University andCareggi Hospital Florence, ItalyDiffuse large cell lymphoma was shownto be a curable malignancy with chemotherapy.First generation regimens (FGR)are considered standard treatment of thisdisease. We report a retrospectiva analysisof 450 patients (pts) entered from 1976to 1996 in our Department. 176 pts weretreated with Fi2 a FGR a CHOP-like schemebut with a different scheduling, 135 weretreated with a third generation regimen(TGR) (MACOP-B 47 and BAVEC-MiMA 88pts) and 139 over 65 years were treatedwith a protocol specifically devised for elderlypeople (MiCEP). The CR rate of wholegroup was 71% (73% 65);at a median follow-up of 5 years the 10years overall survival, disease-free survivaland progression-free survival were respectively54%, 70% and 55%. Major prognosticvariables were: sex, stage (I-II vs III-IV), bone marrow positivity and responseto therapy. Age was not a variable significantlyrelated to survival in this casistic. Ifwe divided the group according to age inthe younger (under 65 years) we observeda 10 years overall survival (OS) of 56% andwe do not have any difference in survivalaccording to therapy (first or third generationregimens) but we have found that thegroup of pts treated with TGRs had a worstclinical behaviour (LDH, bulky disease andadvanced stage). Furthermore pts treatedwith BAVEC-MiMA and MACOP-B showed aearlier plateau in overall survival curves incomparison with pts treated with first generationregimen (5 years vs 9 years). Thegroup of patients over 65 years treated withMiCEP showed an OS at 10 years of 58%and the only one significant variable wasresponse to therapy. In conclusions even ifthis is a retrospective and unicentric analysiswe observed that with a long follow-up(over 10 years) TGRs offer identical resultsin a subset of pts with worse clinical characteristicscompared to FGRs and a specificprotocol in elderly people can influence theoutcome in this subset of pts and offer themidentical possibility of cure in comparisonto younger pts.P444PRIMARY CENTRAL NERVOUS SYSTEMLYMPHOMA (PCNSL), AN EMERGINGEXTRANODAL LYMPHOMA: RESPONSETO SEQUENTIAL HIGH DOSE ARA-CAND HIGH DOSE MTX IN 18 PATIENS(PTS)V. PAVONE, A. GUARINI, T. PERRONE, A. RANA, T. VALENTINO,F. GAUDIO, P. CURCI, V. LISOHematology, University of Bari, ItalyCentral nervous system involvement bylymphoma is frequent in HIV infected persons,but also in not immunocompromisedhost. The treatment of PCNSL is still controversial.Radiotherapy alone has an highrelapse rate. Chemotherapy can inducelonger lasting remissions, but the real benefitof different chemotherapeutic agentsin combination (mainly high dose MTX andhigh dose ARA-C) with or without radiation,is still unknown. We treated 18 pts withPCNS nHL. The median age was 49 y (17-

37 th Congress of the Italian Society of Hematology31774 y). 15 large cell B nHL 2 small cleavedand 1 had Burkitt lymphoma. 4 pts had lymphomacells in the CSF and only one bonemarrow involvement was documented. Chemotherapyconsisted of two courses of DHAP(Cisplatin 100 mg /sqm 24h C.I., i DoseARA-C 2gr/sqm x 2days, Dexamethazone40 mg/sqm x 4 days), followed by twocourses of Hi Dose MTX (5gr/sqm),intratecal ARA-C and MTX plus cranial radiation.5 (27.7%) pts reached CR and 4(22.2%) PR (Relapse Rate 50%). 9 (50%)pts progressed during treatment program.Median duration of CR was 36 mths. 4 pts(22.2%) are still alive and 2 pts are inCCR, but all pts in PR progressed.. No ptsin PR or NR after chemotherapy achievedCR after cranial irradiation. No death treatmentrelated was documented. Our treatmentplan seems to be of acceptable toxicityand efficacy in PCNSL.TREATMENT SCHEDULEDHAP+ARA-C-MTX ITDHAP+ARA-C-MTX IT HiDMTX(5g/mq)HiDMTX(5g/mq)Restaging Cranial irradiationRESPONSE TO TREATMENTPts 18 CR 5(27.7%) PR 4(22.2%) NR 9(50%)CCR 2(11.1%) Relapse Rate 50%Median duration of CR: 6 monthsP445PRIMARY NON HODGKIN’S LYMPHOMAOF BONE: 11 PATIENTS SUCCESSFULTREATEDM.G. CABRAS, P. CASULA, P. DESSALVI, A.M. MAMUSA,G. BROCCIADivisione di Ematologia, Ospedale Oncologico“A. Businco”, CagliariIntroduction: Primary non Hodgkin’slymphoma (NHL) of bone constitutes about5% of extranodal lymphomas. It is difficultto decide the optimal treatment for this typeof lymphoma because of its rarity. Patientsand methods: Eleven patients (7 male and4 female; median age 52 years, range 20-78) with primary NHL of bone were followedat our institution from March 1993 to June1998. Ten patients had diffuse large celllymphoma and one monocytoid cell type.For diagnosis open curretting biopsies wereobtained in all patients. Bone involvementwas multifocal in two patients and solitaryin the others, involving scapula (4), humerus(3), verthebrae (2), clavicula (1),tibia (1) and femur (1). The affected boneexibited a lytic appearance on plain film andCT scans. Bone marrow biopsy was negativein all patients. Five patients had stageI disease and 6 stage II. Bulky disease occurredin 4 patients. The International PrognosticIndex was high-intermediate in 3patients, low-intermediate in 4 and low in4. Chemotherapy consisted of ACOP-B(Doxorubicin, Cyclophosphamide, Vincristine,Bleomycin and Prednisone) in 5 cases,Vacop-B (Etoposide, Doxorubicin, Cyclophosphamide,Vincristine, Bleomycin andPrednisone) in 2 cases, Mini-CEOP (Cyclophosphamide,Epi-Doxorubicin, Vincristineand Prednisone) in 3 and high dose chemotherapy(Cycloposphamide, Etoposide,Methotrexate) followed by autologous peripheralstem cell transplantation in 1. Involvedfield radiotherapy (36-46 Gy) wasadministered to ten. Results: The treatmenthas been well tolerated, all patientsare in CCR with a median follow up of 28months (range 4-61), 1 patient developedcolon cancer 2 years after radiotherapy(tibia and inguinal lymphonodes). Conclusions:We think that multiagent chemotherapyplus involved field radiations improvesprognosis and course of the disease,considered a systemic disease.P446GAUCHER’S DISEASE: THE GIMEMA(Gruppo Italiano Malattie Ematologichedell’Adulto) COOPERATIVE GROUPEXPERIENCEF. GIONA*, A. AMENDOLA*, F. MANCINI*, T. BARBUI**,P. LEONI^, G. ROSSI^^, M. BACCARANI°, A.M. VACCARO°°,M. FILOCAMO#, R. GATTI#, F. MANDELLI**Ematologia, Dipartimento di Biotecnologia Cellulareed Ematologia, Università “La Sapienza “, Roma;**Divisione di Ematologia, Ospedali Riuniti,Bergamo; ^Istituto di Ematologia, Nuovo Ospedale“Torrette”, Ancona; ^^Sezione di Ematologia eTrapianti, Spedali Civili, Brescia;°Cattedra diEmatologia, Policlinico Universitario, Udine;°°Laboratorio di Metabolismo e BiochimicaPatologica. Istituto Superiore di Sanità, Roma;#Laboratorio di Diagnosi Pre Postnatale delle MalattieMetaboliche-Istituto G. Gaslini-Genova, ItalyType I Gaucher’s disease can be characterizedby symptoms of hypersplenism andbone marrow failure arising at adulthoodand mimiking a haematologic disease. Thus,the identification of the disease can be madeat hematogical centers. On November 1997,

318 September 26-29, 1999 - Torino-Lingotto, Italy69 GIMEMA Centers were checked througha questionnaire in order to find out if andhow many patients with Gaucher diseasewere followed. 10/69 Centers reported 50patients with Gaucher disease. Of 50 reportedpatients, 32 (10 males and 22 females),with a median age at diagnosis of34 years (range 4-76 years), affected byGaucher disease (type I: 49; type 3: 1),diagnosed at 5 haematological Institutions,have data available. As concomitant disease,1 patient was affected by Down syndromeand 1 had monoclonal gammopathy.Symptoms leading the patients to refer toa haematologist were: hepatosplenomegaly(17 cases) and/or splenomegaly (3 cases)and/or anemia (12 cases) and/or thrombocytopenia(5 cases) with bleeding (3 cases)and/or bone pain (5 cases); 2 patients werereferred after splenectomy and 1 child withtype 3 Gaucher disease after diagnosis. Thediagnosis of Gaucher disease was made bybone marrow aspiration (19 cases) or spleenbiopsy (3 cases) or bone marrow biopsy (2cases) or β-glucocerebrosidase level activity(8 cases), Altogether, 24 patients weretested for β-glucocerebrosidase level activity.The molecular analysis was performedin 25 patients, but data are available in 23patients; the identified genotypes were thefollowing: N 370S/L444P (7 patients),N370S/? (8 patients), N370S/ rec NciI (4patients), N370S/2123insA (1 patient);D409H/D409H (1 patient); D409H/? (1patient),N370S/complex (1 patient). At thetime of evaluation, the clinical features werethe following: hepatosplenomegaly (19cases) and/or hepatomegaly (7 cases) and/or bone involvement (16 cases); neurologicinvolvement in 1 child. 10 patients receivedsplenectomy at a median age of 47 years(range: 4-54 years). Median value of hemoglobinwas 12 g% (range 7.5-15.5 g%)and platelet count ranged betweeen 46 to428 x 109/l (median 107 x 109/l). The enzymereplacement therapy, firstly withalglucerase (Ceredase, Genzyme) and atpresent with imiglucerase (Cerezyme,Genzyme), was started in 21 patients (medianage: 37 years; range: 4-78) becauseof hepatosplenomegaly (14 patients) orhepatomegaly (5 patients) and/or skeletalinvolvement (14 patients) and/or neurologicinvolvement (1 patient) from a median timeof 25 months (range 1-70 months). Thedosage of enzyme therapy ranged between16 U/Kg/montly to 30U/kg/montly in typeI Gaucher disease; while one child with type3 Gaucher disease is receiving 120U/Kg/montly. The frequency of enzyme infusionswas not uniform: 16 patients received enzymereplacement every 2 weeks, 4 patientsevery a week, no data are availablefor 1 patient. These data suggest that theinvolvement of adulthood hematologists isimportant: 1) to plan an adequate diagnosticapproach; 2) to identify patients whocan benefit by enzyme replacementtherapy; 3) to treat patients with an uniformschedule.P447LANGERHANS CELL HISTIOCYTOSIS:THE GIMEMA (Gruppo Italiano MalattieEmatologiche dell’Adulto)COOPERATIVE GROUP PROSPECTSF. GIONA, A. AMENDOLA, M.L. MOLETI, W. BARBERI,F. MANDELLIEmatologia, Dipartimento di Biotecnologie Cellularied Ematologia, Università “La Sapienza “, RomaHistiocytosis is a rare disease, more frequentin children as compared to adults, inwhich incidence is estimated 1:600.000.Onset may show various clinical evidences;thus various specialist may be involved suchas: hematologists, thorax surgeons, dermatologists,neurosurgeons, dentists,orthopedicians, pneumologists, radiologists,radiotherapists. For this reason while forchildren almost only pediatricians are involvedand since a number of years variousinternational cooperative protocols are utilized,for adults data are only fragmentaryincluding a small number of patients. Forsuch reason during the XIV annual meetingof the Histiocyte Society, held in Kyotoin 1998 the attention has been focused onadult histiocytosis, stimulating to activelyparticipate in drawing up prospective cooperativestudies. However, also previouslywe felt the need to try and collect theexeperiences within the cooperative groupGIMEMA (Italian Group of Adult HematologicalDiseases). Infact in November 1997,69 GIMEMA centers have been contactedat first via fax and thereafter by letter, witha simple questionnaire in order to find outif and how many patients with histiocytosiswere followed. In the affirmative, if theywere interested in participating in a retrospectiveand/or prospective study. 29 outof the 69 centers contacted sent a reply:11 centers showed to be interested in a

37 th Congress of the Italian Society of Hematology319retrospective study, while 24 were interestedin participating in prospective studiesboth diagnostic and therapeutical. As awhole 40 patients had a diagnosis of histiocytosis.Thereafter a very simple datacollection form was sent for the retrospectivestudy with a twofold aim; to presentthe data at the XV annual meeting of theHistiocyte Society which will be held inToronto from 21 to 23 September 1999 andto have the basis for possible prospectivestudies. The cooperative prospective studiesin adults are important because theywould make omogenous both therapy andevaluation criteria: 1) of diagnosis 2) of extensionof disease 3) of response to therapy.Such cooperative studies could be carriedout at national level within the GIMEMAgroup and/or at international level withinthe Histiocyte Society. The GIMEMA prospectivestudy should envisage a well defineddiagnostic protocol with centralizeddiagnosis which should allow the definitionof the disease extension and therefor anadequate therapeutic approach. An importantrole should have biological studies suchas: the study of cellular and humoral immunity,the study of autoimmunity, cytogenetics( where possible ), the dosage ofchitotriosidase and cytokines. Within theHistiocyte Society have already been proposed:a second line protocol which envisagesthe use of 2Cda and a first line protocolin case of isolated involvment of centralnervous system.P448A CASE OF DETRUSOR AREFLEXIAAFTER VINCRISTINE INCLUDINGCHEMOTHERAPY IN NON HODGKINLYMPHOMAV. MENEGHINI, L. LENZI, G. GIUSTI*, S. CICUTO*,L. LUSUARDI*, G. TODESCHINI, S. SECCHI, G. PERONADepartment of Clinical and Experimental Medicine,Section of Hematology and*Division of Urology, University of Verona, ItalyIntroduction: treatment with Vinca Alkaloids,particularly Vincristine, iscommonly associated with dose correlatedand reversible peripheral and/orautonomic neuropathy. The autonomic neuropathypresents frequently withgastrointestinal dysfunction (even paralyticileus), but only few cases of acontractilebladder have been reported. We describea case of urinary retention after treatmentwith Vincristine including polichemotherapyin non Hodgkin lymphoma. Case-Report:a 46 years old woman was investigated atour Institution on April 1997 for superiorvena cava syndrome and bulky mediastinalmass. A diagnosis of primary mediastinallarge B cell NHL with sclerosis wasmade; the bone marrow biopsy was positivefor lymphoma infiltration. We concludedfor clinical stage IV Ab with bulkydisease and intermediate-high internationalaged-adjusted prognostic index. From Mayto August 1997 the patient underwent eightcourses of MEGA-CEOP protocol, six dosesof intrathecal Methotrexate (15 mg) forCNS profilaxis and radiotherapy on theresidual mediastinal mass (35 Gy). Thecomplete remission of disease was obtained.From December 1997 the patientbegan to suffer from distal sensomotorpolyneuropathy and chronic urinary retention(postmicturition residual: 2.000 ml).Neurologic evaluation confirmed the suspectof a peripheral neuropathy. Thevideourodynamic examination pointed outa reduced vesical sensibility and detrusorareflexia. The Lapides test confirmedthe hypersensitivity secondary to parasympatheticdenervation. The patient wasadministered with Urecholine 2,5 mgx3/dsubcutaneously for 15 days associated todaily selfcatheterization. An urodynamic reevaluation4 months later showed acomplete recover of the sacral parasympatheticactivity and a normal detrusorcontractility.P449NON-HODGKIN’S LYMPHOMAS INSICKLE-βTHALASSEMIA PATIENTSTREATED WITH CHEMOTHERAPYG.A. PALUMBO, F. DI RAIMONDO, G. SORTINO, M.P. AZZARO,M. ALESSI, C. SIMILI, R. GIUSTOLISICattedra e Divisione di Ematologia con Trapianto,Ospedale Ferrarotto, CataniaSickle-βthalassemia is a relatively frequentdisease in the Mediterranean area,and particularly in Sicily, due to thecoexistency of quantitative and qualitativehaemoglobin mutations. Often the affectedsubjects show vaso-occlusive painful crisesand are heavily transfused. Moreover, most

320 September 26-29, 1999 - Torino-Lingotto, Italyof these patients are (surgically or functionally)splenectomized. During last yeartwo patients affected by sickle-βthalassemiawith a diagnosis of non-Hodgkin’s lymphoma(NHL) were referred to ourOncohaematology Service. The first was amale, 36 years old, who was diagnosed asickle-βthalassemia just after he was bornand splenectomized when he was 2. He wasfound a follicular NHL, mixed small cleavedand large cells (C according to Working Formulation),stage IIB. Bcl-2 rearrangement,that we searched by PCR (both MBR andmcr), was negative. Markers for HBV andHCV were positive, while HIV was negative.Hb was 9 g/dl, LDH was normal, the performancestatus (PS) was 1 according toWHO. The International Prognostic Index(IPI) was 0 (Low). The second patient wasa female, 51, who was diagnosed a sickleβthalassemiawhen she was 19 and splenectomizedat 21. She had cholecystectomyat 23 for bilirubin gallstones. At 48 diffuselymphoadenomegaly was present, but repeatedbiopsies were non informative orgive evidence for reactive lymphadenitis.At last, when she was 51, a diagnosis of B-cell NHL, diffuse with large cells (W.F. G),was made on a tonsillar biopsy. So she wasreferred to our Institution. The stage wasIIIB. Markers for HBV and HCV were positiveand a virus-related hepatopathy waspresent too. HIV was negative, Hb was 9.8g/dl, LDH was normal, PS was 2 and IPIwas 2 (Low-Intermediate). Chemotherapywas administered to both patients, accordingto CEOP/CNOP alternating scheme (aCHOP-like scheme where Adriamycin wasreplaced by Epirubicin at 50 mg/m2 andMitoxantrone at 10 mg/m2 respectively).The former patient received 4 chemotherapycourses followed by radiotherapy on anaxillary lymphnode whose diameter remained> 2 cm. The latter patient received6 CEOP/CNOP courses. In both patients theestimated dose-intensity was fully administered.No painful crises were registeredduring chemotherapy. Haematological andneurological toxicity was never greater than2 according to WHO. Cutaneous toxicity(alopecia) was of grade 3. In both cases acomplete response was obtained, stillpresent since 10 and 8 months respectively.The second patient had a vertebral collapse(L4-L5) and a melena event for a gastriculcer after 8 monyths since chemotherapycompletion. LNH onset in subjects affectedby sickle-βthalassemia could be explained,to some extent, by the known immunodeficiencypresent in this state. Furthermore,a key role may have been played by HCV,whose positivity is accompanied by agreater incidence of NHL. In any case, thesetwo patients show how these NHL can betreated with standard chemotherapy protocols,without any dose reduction and obtaininggood results, despite sickleβthalassemia.P450LIVER DYSFUNCTION IN HEPATITIS CVIRUS ASSOCIATED NHL UNDERGOINGCHEMOTHERAPYG. LONGO, M. LUPPI, L. POTENZA, L. FERRARA, G. GANDINI,M. MORSELLI, K. CAGOSSI, N. D’APOLLO, R. MARASCA,G. EMILIA, G. TORELLIDepartment of Medical Science Modena and ReggioEmilia University - ItalyHepatitis B virus reactivation during or atwithdrawal of chemotherapy is well known.However less is known about hepatic alterationsin hepatitis C virus (HCV) patientswho are undergoing chemotherapy. Thus weinvestigated liver dysfunction in 20 patientswith HCV associated NHL comparing themwith 40 NHL cases without HCV. Median agewas 58y (21-85) in NHL without HCV and64y (34-84) in HCV patients. Men were 40%in HCV cases vs 57% in NHL without HCV.All 20 patients with HCV was HCV Ab+confirmed by RIBA test and by RT-PCR forHCV-RNA in serum and in neoplastic tissue;in 12 cases (60%) hepatic biopsy wasperformed. Histotype distribution in HCVpatients was: follicular (CFL) 6(30%); marginal(MZL) 6 (30%); anaplastic large cells(ALCL) 5 (25%); lymphoplasmocytoid (LPL)2 (10%) and 1 (5%) chronic lymphocyticleukemia (CLL). Histotype in patients withoutHCV was: CFL 15 (37%); ALCL 10(25%); MZL 6 (15%); peripheral T zone 4(11%); LPL 2 (11%); mantle cell (MTL) 2(5%) and 1 (2%) CLL. All patients withaggressive NHL were treated with CHOPregimen whilst no aggressive NHL weretreated with COP or CVP regimen. Functionalliver parameters were tested on theday of therapy and after 7 days each coursefor 6 times and then every month for 1 year.When hepatitis reactivation was observedinterferon therapy was started. Before aduring treatment patients without HCV didnot present any hepatic dysfunction. At start

37 th Congress of the Italian Society of Hematology321of therapy HCV psatients had slight alterationsof hepatic function as: AST 45 (13-192); ALT 43 (13-148); GT 58 (9-282); atthe end of therapy AST 90 (14-365); ALT94 (17-362) and GT 268 (13-1388). Hepaticdysfunction was significatively presentduring and at the end of therapy in HCV patientscompared with NHL without HCV: GTp = 0.07; AST p = 0.007; ALT p = 0.05;alkaline phosphatase was not statisticallysignificant. Liver dysfunction in 10 out of20 HCV patients during treatment we observed:progressive increase of cholestasisin 2 cases; increase of AST and ALT in 7 pts(5 patients 3-5 times higher than normalvalue and in 2 cases 15 and 40 times); alterationof hepatic function at withdrawalof chemotherapy in 1 case. Therapy produceda normalisation data of hepatic functionin 2 patients. HCV infection may induceliver damage in NHL during chemotherapy.An option for interferon in combinationwith chemotherapy may be usefullyconsidered.P451LONG TERM FOLLOW-UP OF MiCEPPROTOCOL IN THE TREATMENT OFINTERMEDIATE-HIGH GRADE NONHODGKIN’S LYMPHOMA OF ELDERLYL. RIGACCI, G. BELLESI, R. ALTERINI, F. INNOCENTI,F. BERNARDI, G. LONGO, P. ROSSI FERRINIDepartement of Haematology University andCareggi Hospital Florence, ItalyIn the last years we observed an incrementof lymphoproliferative disease in elderlypeople. For this reason the use of protocolsspecifically devised for these patientsis gown-up. Since 1989 in our Departementwe have utilized MiCEP protocol which useddrugs with lower organ toxicity. From 1989to 1997 we have treated 145 LNH patientsaged more than 64 years with histotype F-G-H according to Working Formulation.Characteristics of patients were: 77 female,69 male, 67 I-II stage, 78 III-IV stage, 31patients presented bone marrow positivity,50 patients were over 74 years old andaccording to IPI 48 were score 1, 40 score2, 39 score 3 and 18 score 4-5. The medianage was 73 years (range 65 – 88). 94patients out 145 obtained compelte remissionafter MiCEP therapy (65%). With amedian follow-up of 5 years, the overallsurvival (OS) was 53% and the significantprognostic factors were stage (I-II vs III-IV), LDH value and the number of lymphnodes involved. Disease-free survival (DFS)of 94 patients was 74% and the significantprognostic factors were stage (I-II vs III-IV), LDH value and number of nodes involved.In a multivariate analysis LDH valueand number of nodes involved confirmedtheir significance. In conclusion these resultsconfirmed those reported in the pastwith a longer follow-up and we think thatthe observation period is in this group veryimportant.P4528-WEEK VNCOP-B VERSUS 12-WEEKVNCOP-B IN ELDERLY PATIENTS WITHHIGH GRADE NON-HODGKIN’SLYMPHOMA (HG-NHL). PRELIMINARYRESULTS FROM AN ONGOINGPROSPECTIVE RANDOMIZED CLINICALTRIALF. GHERLINZONI ON BEHALF OF COOPERATIVE STUDY GROUP ONMALIGNANT LYMPHOMASInstitute of Hematology and Medical Oncology“L. e A. Seràgnoli”, University of Bologna, ItalyAge has been recognized as the majorprognostic variable in patients (pts) withHG-NHL. In the last years, numerous chemotherapyregimens specific for elderly ptshave been devised. We recently reported(JCO, 89: 3974, 1997) that a 8-weekMACOP-B-like scheme, VNCOP-B, is feasibleand effective in elderly HG-NHL pts, andthat the use of G-CSF reduces significantlyinfection and neutropenia rates. The purposeof this randomized study was to evaluatewhether the addition of 4 more weeksof therapy to standard 8-week VNCOP-Bcould improve clinical results in terms ofcomplete remission (CR) rate, overall survival(OS) and relapse-free survival (RFS),without modifying the incidence of toxicevents. Since March 1996, 226 previouslyuntreated HG-NHL, aging 60 years andolder, coming from 22 italian institutions,were randomized to receive either 8-weekVNCOP-B (group A) or 12-week VNCOP-B(group B). Randomization was 1:1. G-CSFwas administered subcutaneously in all pts,starting on day 2 of every week for 5 consecutivedays. The two groups are fully com-

322 September 26-29, 1999 - Torino-Lingotto, Italyparable in terms of clinical and pathologicfeatures. Median age is 69.8 years. Medianfollow-up is 13 months. CR rates are 54%in arm A and 50% in arm B, and did notdiffer between pts aged less or more than70 years. 17% of complete responders inarm A relapsed, versus 23% in arm B. Inarm A, 7% of the pts died from causes unrelatedto NHL, compared to 5% in arm B.No differences were recorded in terms ofnumber of pts with at least one toxic eventsof any WHO grade (73%), or at least onegrade III-IV toxic event (46%). Hospitalizationrate was the same in the two groups(11%). 3-yrs projected OS is 61% in arm Aand 62% in arm B. International PrognosticIndex was significantly associated withthe outcome (P=0.00000) in both arms.These still preliminary data suggest that theaddition of 4 more weekly drug administrationsto standard 8-week VNCOP-B doesnot translate into a better response to treatment,nor into higher toxic effects.P453COMPARISON BETWEEN CHOP ANDALTERNATING THERAPY CEOP/CNOPIN ELDERLY NON-HODGKIN’SLYMPHOMA PATIENTSF. DI RAIMONDO, S. BAGNATO, G. MILONE, G.A. PALUMBO,M. RUSSO, R. GIUSTOLISIDivisione e Cattedra di Ematologia con Trapianto,Ospedale Ferrarotto, CataniaIn a previous report (Milone et al. SIE1997, SS33) we reported that an alternatingtherapy CEOP/CNOP is effective and welltolerated in elderly patients affected by NHL.On this basis we have compared the resultsof this schema to those obtained inelderly patients treated with the more conventionalCHOP. In a retrospective study weevaluated 42 patients affected by intermediate-highgrade NHL, > 60 years of age,and treated at the onset of the disease.Fourteen patients were treated with CHOPwhile 28 have received the alternatingtherapy CEOP/CNOP, where Adriamycin hasbeen replaced by Epirubicin (50 mg/m2)and Mitoxantrone (10 mg/m2) respectively.The two groups were comparable for performancestatus and histology. The groupof patients treated with CHOP had a medianage of 66 Ys and 3/14 were > 70 Ys.Those treated with CEOP/CNOP had a medianage of 69 Ys and 14/28 were > 70 Ys.Compared to CEOP/CNOP, the CHOP grouphad a higher percentage of stage III-IV (71Vs 60 %), elevated LDH (35 Vs 17 %) and,as a consequence, an higher percentage ofhigh or intermediate/high IPI (71 Vs 50 %)but the difference was not statistically significant.The CR rate was 50 % (7/14) forpatients treated with CHOP and 60 % (17/28) for CEOP/CNOP. No difference in theresponse rate was observed on the basis ofdose-intensity, while patients with a low IPIhad a high percentage of CR in both groups.Both regimens were well tolerated and theinterval between courses was maintainedin 13/14 patients treated with CHOP and20/28 with CEOP/CNOP. We observed 5 infectiousepisodes in the group of CEOP/CNOP and 1 in the group CHOP. Of the 24patients who have obtained CR, only 2 relapsed,1 for each group. After a medianfollow up of 22 months, 82 % of the patientstreated with CEOP/CNOP are alive,versus 57 % of patients who received CHOPand had a median follow up of 16 months.The difference between the two survivalcurves is statistically significant (p=0.05).From this retrospective preliminary evaluationwe can conclude that, in patients >60 years, alternating therapy CEOP/CNOPis able to induce a response rate similar toCHOP and, in the long run, it could be advantageousfor survival.P454LONG TERM F.U. OF P-VEBEC, ATREATMENT SPECIFICALLY DEVISEDFOR ELDERLY PATIENTS AFFECTED BYDIFFUSE LARGE CELL LYMPHOMAS(DLCL)M. BERTINI, R. FREILONE, U. VITOLO, B. BOTTO,C. BOCCOMINI, R. CALVI, L. ORSUCCI, P. PREGNO,2D. ROTA SCALABRINI, 3 A. GENUA, 4 F. DI VITO, E. GALLO1Ematologia ospedaliera Torino, 2 Oncologia osp.Mauriziano Torino, 3 Clinica Medica Perugia,4Oncologia AostaPopulation based studies have confirmedthe overall poor prognosis of elderly patientswith DLCL. Elderly pts have more co- morbidity,and it is generally stated that thetoxicity of chemotherapy is higher in thisage group. Since 1991 to 1995 we havetreated 84 pts affected by DLCL with aweekly schedule: P-VEBEC (Ann. Oncol.

37 th Congress of the Italian Society of Hematology3235,895-900,1994 ). Some pts received G-CSF 5 mcg/Kg on days 2 -5 of every weeks.The median age was 71 years , 42 weremale; 47 pts had bulky disease, 38 LDHabove normal, 33 stage IV and 14 hadB.M. involvement, 29 had P.S:>1 and 30age adjusted IPI score inter -mediate -high/high.73 pts (87%) achieved CR and theadverse prognostic factors for CR were :LDH above normal (p=0.0001), IPI scoreintermediate-high/high (p=0.007), the timeto complete the schedule in more than 64days planned and relative dose intensity(RDI) < 80% (p=0.03 ). The toxicity wasmild with only one toxic death; the use ofgrowth factor improve the relative dose intensityof drugs, and RDI > 80% improveCR rate. With a Median F.U. of 46 monthsthe O.S. is 40%; the prognostic factors that(p1, advancedstage,BM involvement, IPI score intermediate-high/high.Five patients died in CR,:two of acute vascular disease, two ofcomorbidity one of unknown causes. TheD.F.S. rate was 59% with the latest relapseat 55 months; we can obtain 3 second remission, two with RT in site of relapse and1 with chemotherapy. The prognostic factorsaffecting significantly (p 2 x N) 2Stage IV 9 Performance status: 0 - 1 11; 2 - 3 9HISTOLOGYLarge cell 13 Follicular center diffuse 3Immunoblastic 2 Mantle cell 2Table ITable IIB. RONCI, M. PERSIANI, M. BARTOLINI, P. IACOVINO, E. PIRO,E. ORTU LA BARBERA, A. FREMIOTTIAzienda Ospedaliera S. Giovanni-Addolorata,Roma, Unità Operativa Dipartimentale di EmatologiaIn order to plain a chemotherapic regimenpointed at the elderly patient, from

324 September 26-29, 1999 - Torino-Lingotto, ItalyP456QUALITY OF LIFE EVALUATION IN ARANDOMIZED STUDY (MINI-CEOP VSP-VEBEC) FOR ELDERLY PATIENTSAFFECTED BY AGGRESSIVE NONHODGKIN’S LYMPHOMAF. MERLI 1 , M. BERTINI 2 , R. MOZZANA 3 , P. AVANZINI 1 ,R. BERTÈ 4 , F. GRASSO 5 , G. PAVIA 6 , V. CLÒ 7 , M. PIZZUTI 8 ,A. DE PAOLI 9 , L. RESEGOTTI 21Servizio di Ematologia Reggio Emilia, 2 EmatologiaOspedaliera Torino, 3 Medicina Gallarate (VA),4Medicina 1° Piacenza, 5 Oncologia Aosta, 6 MedicinaRho (MI), 7 Oncologia Modena, 8 Ematologia Potenza,9Medicina Legnano (MI) for Intergruppo ItalianoLinfomi (IIL)Objective.We considered quality of life(QOL) such a possible parameter to choicethe golden standard treatment for elderlypatients affected by aggressive NonHodgkin’s Lymphoma (NHL). In fact this isan important criterium in patients with alimited expectation of life. Design andMethods. We utilized the EORTC QLQ-C30(version 2) questionnaire. The QLQ-C30 incorporatesnine multi-item scales: five functional(physical,cognitive,role,emotionaland social), three symptom (fatigue,painand nausea/vomiting) and a global healthand QOL scale.It was administered atdiagnosis,during treatment and at the endof it. Results. From June 1996 to March1999 225 patients were randomized betweenMini-CEOP and P-VEBEC.At the moment125(56%) patients answered to atleast the initial questionnaire, but only80(36%) completed it also at restaging andwere finally evaluable.Before the therapyP-VEBEC group presented a median globalQOL significantly worse (p 0.029) than Mini-CEOP group.This data agree with I.P.I. andKarnofsky performance status. At the endof treatment role,emotional and cognitivefunctioning were improved while physicaland social functioning were unchanged.Thesymptoms decreased. No difference wasnoted between two groups in these areas.The patients in P-VEBEC arm assessed theirfinal global health really better (p 0.038).The improvement was not so important inMini-CEOP arm. Conclusions. EORTC QLQ-C30 is a reliable instrument to evaluateQOL in elderly patients affected bylymphoma.The improvement of globalhealth status and QOL after chemotherapystrengthens the intent to treat also for thesepatients.The study is ongoing and we ‘ll seeif the differences between two arms wereconfirmed.P457EVALUATION OF EFFICACY,TOLERABILITY AND QUALITY OF LIFEOF P-VEBEC VS MINI-CEOP, TWOREGIMENS SPECIFICALLY DEVISEDFOR ELDERLY PATIENTS AFFECTED BYDIFFUSE LARGE CELL LYMPHOMA(DLCL): PRELIMINARY RESULTS OF ARANDOMIZED TRIAL* M. BERTINI, 1 F. MERLI, 2 R. MOZZANA, 3 M. CABRAS,4R. ROMANO, *U. VITOLO, 5 V. CLÒ, 6 C. STELITANO,7A. DE PAOLI, 8 V. FREGONI, * E. GALLO, 8 L. RESEGOTTI*Ematologia Ospedaliera, Torino; 1 EmatologiaReggio Emilia; 2 Medicina Gallarate(Varese); 3Ematologia Cagliari; 4 Clinica medica Perugia; 5Oncologia policlinico Modena; 6 Medicina Legnano(Milano); 7 Medicina Busto Arsizio (Varese) for 8Intergruppo Italiano Linfomi (I.I.L.)A real increase on the incidence of NHLhas been documented in Italy in recentyears (1988-1991). The cumulative risk(Rcum) index was of 0.7% for males andof 0.5% for females in pts aged from 0 to64 and was 1.3% for males and 0.8% forfemales in pts aged from 0 to 74, with anincrese of 0.6% for male and 0.3% for femalesin ten years. On the other hand DLCLis a curable disease in about 50% of youngpatients; this is not true in pts aged morethan 65, so elderly people affected by DLCLis increasing and the disease isn’t curableyet. The endpoints of this study were toevaluate the feasibility, CR, OS, DFS andthe quality of life of elderly patients randomizedto receive P-VEBEC chemotherapy,a weekly regimen or Mini-CEOP every 21or 28 days. From June 1996 to March 1999241 patients affected by DLCL were enrolledand treated in a multicenter study conductedby the Intergruppo Italiano Linfomi(I.I.L.). The inclusion criteria were : age> 65 years, stage II bulky ,III or IV, PS =75years 36%in both groups; male 38% vs 47%; LDH >normal 39 % vs 56%; PS>=2 24 %vs 32%;

37 th Congress of the Italian Society of Hematology325bulky disease 26 %vs 30%; the only casuallyclinical difference was the IPI prognosticgroups intermediate high/high 42% vs60 % (p=0.02). Major severe toxicities(WHO grade 3 or 4) were equally recordedbetween the two groups : cardiac 3% vs5%; neurological 6% vs 8%; infections 3% vs2%; toxic death were 4% vs 5%. Neutropeniawas observed in 20% vs 36%; G-CSF was used in 48% vs 63%. Patients whorequired hospitalization were 48% vs 38%,with some variations among center. So far167 pts out of 241 have completed thetherapeutic program 72 % vs 67 %.Fortysix percent achieved CR; relapse occurredin twenty percent of CR spatients.The time to complete the two regimeswas in agreement to the time scheduled(88% vs 82%). With a median F.U. of15 months the OS, DFS and EFS were respectively49%,77%,45%. This study isongoing and the results have not yet beenanalysed separately between the two regimens.A study on quality of life is referredseparately.P458MULTICENTER EVALUATION OF THEEFFICACY OF INTENSIFIED HIGH-DOSE SEQUENTIAL (i-HDS) REGIMENAS PRIMARY TREATMENT FORMANTLE-CELL LYMPHOMAC. TARELLA, P. COSER, M. MITTERER, F. BENEDETTI,E. TRESOLDI, U. VITOLO, M. BERTINI, M. MARTELLI,A. CUTTICA, D. CARACCIOLO, P. CORRADINI, A. PILERIDip. Med. e Oncol. Sperimentale, Div. Univ.Ematologia; Div. Osp.. Ematologia, Az. Osp.S.Giovanni di Torino; Divisioni Osp. e Univ. diEmatologia di Bolzano, Verona e RomaMantle-cell lymphoma (MCL) has beenidentified as a distinct entity in the last fewyears. In the past, it was generally includedamong indolent lymphomas and managedwith conventional schemes, such as COP orCHOP. With this approach, median survivalfor MCL patients is around 2-3 years. Peculiarimmunophenotypic and molecular featuresnow clearly recognize MCL patient.Due to the more accurate diagnostic toolspresently available, efforts have been recentlyaddressed to find more effectivetreatments. In this view, we have developedan intensive high-dose (hd) sequentialscheme (i-HDS), specifically designedfor MCL and other subtypes, characterizedby low chemosensitivity and frequent bonemarrow involvement. The i-HDS includes:i. tumor debulkying with 2 APO±2 DHAPcourses; ii. sequential administration of hdVP16, methotrexate and cyclophosphamide;iii. PBPC harvest; iv. autograft withhd-mitoxantrone + L-PAM followed by PBPCreinfusion. We and other italian Centresemployed i-HDS as first-line treatment forMCL pts. aged < 60 yrs. Results obtainedin 17 pts. are here reviewed. Main patientcharacteristics included: median age=50yrs. (range 20-63), M/F ratio=11/6, stageIV=16, extranodal sites=6, BM involvement=15.Overall, i-HDS was well tolerated,with hematologic toxicity analogous to thatobserved with the original HDS. There were2 progressions under treatment; 3 pts.achieved partial remission and 12 (70%)a complete remission (CR); 7 pts. are incontinuous CR, at a median follow-up of 2yrs. At present, 13 pts. are alive and 4 diedfor disease-related causes. At a median follow-upof 3 yrs., median survival has notbeen reached and a 64% survival is projectedat 7 yrs. Thus, i-HDS proved to befeasible and effective in the managementof MCL, allowing prolonged survival in patientswhose life expectancy is relativelyshort if managed with conventional chemotherapy.P459POOR PROGNOSIS DIFFUSE LARGECELL LYMPHOMA (DLCL): FEASIBILITYAND TOXICITY OF HIGH DOSECHEMOTHERAPY (HDS) WITHAUTOLOGOUS STEM CELL SUPPORT(ASCT) vs INTENSIFIEDCHEMOTHERAPY MegaCEOP IN AMULTICENTER RANDOMIZED TRIALU. VITOLO, A.M. LIBERATI, G. LAMBERTENGHI DELILIERS,M. BERTINI, R. CALVI, R. FREILONE, L. BALDINI,M. BRUGIATELLI, N. DI RENZO, M. FEDERICO, G. LUXI,G. PARVIS, V. PAVONE, M. PETRINI, F. SALVI, M. SBORGIA,G. TODESCHINI, E. GALLOUOA Ematologia Az S. Giovanni Battista, Torino forIntergruppo Italiano Linfomi (IIL)Introduction: poor prognosis DLCL faredpoorly with standard chemotherapy with CRand Failure Free Survival (FFS) rates < 50%and 30-40% respectively. High dose or in-

326 September 26-29, 1999 - Torino-Lingotto, Italytensified chemotherapy have been reportedwith promising results in pilot trials. Amulticenter cooperative study have beenstarted by the IIL to compare feasibility,toxicity and outcome of HDS regimen withASCT vs an outpatient intensified chemotherapyregimen (MegaCEOP). Patientsand methods: pts 1, 75% LDH > normal, 54% bulkydisease, 19% stage II, 24% stage III and57% stage IV, 24% >1 extranodal sites and22% were BM+. Severe toxicities(WHO >2) were as follows in groups A vsB: cardiac 6% vs 3%; peripheral neuropathy6% vs 3%; renal 6% vs 0%; mucositis28% vs 6% and infections 21% vs 3%.Thirty-one pts in group A and 13 pts ingroup B required RBC trasfusions, and 38vs 2 plateled support.Two pts died of toxicity:one (HDS) due to aspergillosis and one(MegaCEOP) due to sepsis. Six pts did notcomplete the program: 3 goup A (2 toxicitiesand 1 progression) vs 3 group B (1toxicity and 2 progressions). Sixty-seven% achieved a CR, 10% a PR, 20% a NRand 3% died of toxicity. With a medianfollow up of 20 months OS is 62%, DFS76% and FFS 54%. CR and FFS rates werenot affected by BM involvement or IH vs Hrisk IPI. Conclusions: the study is ongoing;HDS+ASCT or intensified chemotherapymay by delivered in a cooperativesetting without severe toxicities. Toxic deathrate is comparable with standard chemotherapy.In a group of very poor prognosisDLCL pts these therapies seem to have agood efficacy.P460IFOSFAMIDE, EPIRUBUCIN,ETOPOSIDE (IEV) FOLLOWED BYAUTOLOGOUS STEM CELLTRANSPLANTATION (ASCT) ASSALVAGE THERAPY FOR DIFFUSELARGE CELL LYMPHOMASM. MARTELLI, S. CAPRIA, C. GUGLIELMI, L. SCARAMUCCI,S. TRISOLINI, P. DE FABRITIIS, F. PALOMBI, M. GOZZER,G. LUZI, F. MANDELLIDipartimento di Biotecnologie Cellulari edEmatologia Università ”La Sapienza” RomaPurpose: To evaluate prospectically theefficacy of IEV chemotherapy followed byHigh-Dose Chemotherapy (HDC) and ASCTfor patients (pts) with diffuse large cell lymphomas(DLCL) refractory or relapsed toa conventional chemotherapy. Patientsand methods: From 11/91 to 5/98, 56pts with DLCL received IEV chemotherapy.42 pts were in first relapse of which 21early relapse (12 months)(LR), 8 in second relapse and 6 refractoryto induction therapy (RI). Twenty/42 ptsin first relapse had an high-risk IPI ( score2-3) at relapse. IEV schedula consisted of:Ifosfamide 2500 mg/sqm d.1-3, Epirubicin100mg/sqm d.1, Etoposide 150mg/sqmd.1-3.One course was given every 21 daysfor a total of 3. All pts who achieved aresponse to IEV were intensified with BEAC/BEAM-HDC and ASCT. The source of stemcells was bone marrow in 25 pts. From February95 all pts were mobilized with G-CSF given at day +5 after the third courseof IEV and 17 /20 (85%) collected > 2x10 6CD34/kg PBSC. Results: 42/56 (75%) ptsof which 40/50(80%) relapsed and 4/6(66%) refractory (RI) obtained a PR/CRto IEV and were considered elegible for intensificationwith HDC-ASCT. Two of 40 relapsedpts did not receive HDC+ASCT(1,low PS; 1 refusal). After a median followup of 23 months (15-88) the 3-yrsOSand EFS for all 56 pts were 43% and 20%respectively. Two(4%) transplant-relateddeath were observed. The 3-yrs OS andEFS were 56% vs 17% (p

37 th Congress of the Italian Society of Hematology327(p

328 September 26-29, 1999 - Torino-Lingotto, Italy(1-47) from transplant and 33 months (10-57) from diagnosis. Fourteen patients(23%) relapsed after ASCT, and 9 of them(17%) died because of disease progression.One patient (1.7%) died for treatment relatedcomplications (sepsis). Fifty patients(83%) are alive, and 45 (75%) are in remission.For patients at diagnosis, the 3year estimated overall survival (OS) andevent free survival (EFS) is, respectively,73% (95% C.I. = 55-91) and 70% (95%C.I. = 55-85). From transplant, the 2 yearestimated EFS is 72% (95% C.I. = 60-84)for the entire cohort of patients. These dataconfirm that, in NHL patients, ASCT is arelatively safe procedure characterized bya low treatment related mortality. In ourhands, a significant difference is observedbetween B-cell and T-cell lymphomas as awhole (3 year estimated OS 82% and 41%,respectively). Our series is heterogeneousand, for some subtypes identified by theR.E.A.L. Classification, the follow up is short.Nevertheless, our data suggest that the bestresults can be obtained in B-DLCL,mediastinic B cell lymphomas, ADLC lymphomasand follicular lymphomas. On thecontrary, a very high relapse rate is typicalof peripheral T-cell lymphomas: for thesepatients, as well as for patients with refractorydisease, the search of new therapeuticstrategies is mandatory.P463VACOP/B, HIGH-DOSE CYTOXAN ANDHIGH-DOSE THERAPY WITH PBPCRESCUE FOR AGGRESSIVE NHL WITHBONE MARROW INVOLVEMENT:CLINICAL AND PROGNOSTICSIGNIFICANCEG. SANTINI, M. CONGIU, A. OLIVIERI, P. COSER,C. GUARNACCIA, I. MAIOLINO, T. CHISESI, P. LEONI,L. SALVAGNO, A. PORCELLINI, R. SERTOLI, A. RUBAGOTTI,V. RIZZOLI FOR THE NON-HODGKIN’S LYMPHOMA CO-OPERATIVESTUDY GROUPDepartment of Hematology, S. Martino Hospital,Genova, ItalyAggressive NHL with BM involvement atdiagnosis has a poor prognosis. Using conventionalchemotherapy, 5-year probabilityof survival and failure-free survival(FFS) are 20% and 12%, respectively. From1992 to 1994 a study which includedVACOP-B x 8 courses followed by highdosecytoxan (HDCY) and HDT with PBPCautografting as front-line therapy in 40successive patients (groups F-G-H-K/WF),with BM involvement at diagnosis, was performed.Median age of patients was 51yrs.(range 19-56); 25 were male and 15female; median BM involvement was 35%(range 8%-90%). Patients receivedVACOP-B chemotherapy, followed by HDCY(7 gr/m 2 /single dose) plus G- or GM-CSF(5 mcg/Kg) to reduce tumour burden andcollect PBPC. With a median number of 3aphereses a median of 11.3x10^6/KgCD34+ cells were collected. Twenty-ninepatients underwent PBPC autografting afterMelphalan +TBI or BEAM regimen. Accordingto intention to treat, 29/40 patients(72.5%) achieved CR: 11/40(27.5%), after VACOP-B treatment; 7/40(17.5%), after HDCY; 11/40 (27.5%), afterhigh-dose therapy. The statistical analysisshows a 5-year probability of survivalof 42%, with a probability of DFS andFFS of 39% and 34%, respectively. A statisticalanalysis of morphology and extentof BM infiltrate, and clinical features accordingto the IPI, in terms of OS, DFSand FFS was performed. This analysis didnot show any statistical factor predicting apoor outcome excluding B symptoms atdiagnosis. This study suggests that highdosesequential therapy may improve theoutcome of these patients. However arandomised study is required to comparethis strategy of treatment with conventionalchemotherapy.P464HIGH-DOSE CYCLOPHOSPHAMIDE(HDCY) FOLLOWED BY HIGH-DOSETHERAPY (HDT) WITH AUTOGRAFTINGCAN IMPROVE THE OUTCOME OFRELAPSED OR RESISTANTNON-HODGKIN’S LYMPHOMAS WITHINVOLVED OR HYPOPLASTIC BONEMARROWG. SANTINI, C. DE SOUZA, M. CONGIU, G. MARINO, S. NATI,E. DAMASIODepartments of Hematology, S. Martino Hospital,Genova, ItalyWe report our experience of HDCY followedby HDT and peripheral blood progenitorcell (PBPC) autografting in aggressive

37 th Congress of the Italian Society of Hematology329non-Hodgkin’s lymphomas who have failedconventional treatment. From 1991 to1996, 54 consecutive patients pre-treatedwith a median of two chemotherapy linesentered the study. Eighteen patients (33%)were still responders to conventional chemotherapy(sensitive relapse), and 20 patients(37%) were in partial response (PR)after chemotherapy (CT). Sixteen patients(30%) were resistant to conventional CTeither ab initio (non responder) or in relapse(resistant relapse). Thirty-nine patientshad bone marrow involved by diseaseand fifteen had hypoplastic marrowfollowing conventional treatment. Patientsreceived HDCY (7gr/m 2 ) and G-CSF or GM-CSF in order to collect PBPC. Median collectedCD34 + cells was 12.3 x 10 6 /Kg (range0.7-197). After HDT (BEAM or Melphalan +TBI) 50 patients underwent PBPCautografting. According to the intention totreat, 44 (81%) out of 54 patients achievedcomplete remission (CR) (50% after HDCYand 31% after HDT).Status Pts(n°) CR after HDCY CR after HDT final CRPR 20 11 (55%) 4 (20%) 15/20 (75%)Sens/Rel 18 13 (72%) 4 (22%) 17/18 (94%)Res/Rel 4 1 (25%) 2 (50%) 3/4 (75%)NR 12 2 (16.5%) 7 (58.5%) 9/12 (75%)Procedure related death occurred in 6 patients(11%), one after HDCY and 5 afterautografting. Twenty-nine (66%) out of 44patients are still in CR 7 to 63 months (median27 months) after the procedure. Threeyearprobability of survival, disease-freesurvival and progression-free survival are63%, 64% and 52% respectively. In conclusion,HDCY is an effective procedure notonly in mobilizing PBPC, but also in reducingtumour burden. HDT with PBPC supportmay further improve the outcome inthis category of high-risk non-Hodgkin’slymphomas.P465THREE STEP HIGH-DOSECHEMOTHERAPY IN POOR PROGNOSISNON-HODGKIN LYMPHOMAM. CLAVIO, A. BALLESTRERO, F. FERRANDO, M. MIGLINO,R. GRASSO, R. GONELLA, A. GARUTI, I. PIERRI, L. CANEPA,G. BELTRAMI, D. PIETRASANTA, E. VALLEBELLA, M. GOBBI,F. PATRONEDivisions of Haematology and Oncology, Departmentof Internal Medicine (DIMI), University ofGenoaTwenty-five patients (pts) with intermediate-highrisk (international prognosticindex) non-Hodgkin’s lymphoma (NHL) receivedHDT, seventeen of them either asfirst line treatment (10) or as consolidationafter conventional dose chemotherapy (7),and 8 at relapse (4) or with refractory disease(4). Histologic subtypes were diffuselarge cell (23) and anaplastic large cell (2).HDT included three phases: 1) cyclophosphamide6-7 g/sqm day 1 with GM or G-CSF support, 5-8 µg/kg/day, days 2-14 andperipheral blood progenitor cells (PBPCs)collection, 2-4 leukaphereses; 2)mitoxantrone (NOV) 60-90 mg/sqm days -4 + melphalan (L-PAM) 160-180 mg/sqmday -1 and PBPCs rescue; 3) etoposide(ETO) 500 mg/sqm/day + carboplatin(CARBO) 500 mg/sqm/day days -3, -2, -1and PBPCs rescue. After PBPCs reinfusionhaematologic recovery was fast and completewith a short duration of neutropeniaand thrombocytopenia. The main nonhaematologic toxicities were mucositis anddiarrhoea. In the first line / consolidationgroup, after a median follow-up of 30months, 14 of the 17 pts are alive and disease-free(82%); 2 pts obtained CR butrelapsed and died 20 and 14 months aftertreatment; 1 pt did not respond to HDT anddied of progressive disease. Pts treated atrelapse or with refractory disease had aworse outcome (2 patients alive in CCR at37 and 42 months; 6 patients dead of diseaseat 4,4,6, 11, 18 and 18 months fromtransplant). When used in the setting of firstline or consolidation treatment the HDTherein described is a safe and effective regimenfor intermediate-high risk NHL andmay represent a substantial improvementwith respect to conventional chemotherapy.

330 September 26-29, 1999 - Torino-Lingotto, ItalyP466MACOP-B, HIGH-DOSECYCLOPHOSPHAMIDE, G-CSF ANDMYELOABLATIVE CHEMOTHERAPYWITH AUTOLOGOUS STEM CELLTRANSPLANTATION AS FRONT-LINETHERAPY IN HIGH-RISK DIFFUSELARGE CELL LYMPHOMAE. BRUSAMOLINO, P. BERNASCONI, G. PAGNUCCO,E.P. ALESSANDRINO, F. LUNGHI, G. MARTINELLI, M. BONFICHI,C. CASTAGNOLA, A. CALDERA, A. COLOMBO, L. MALCOVATI,C. KLERSY, M. LAZZARINO, C. BERNASCONICattedra di Ematologia, Università di Pavia, IRCCSPoliclinico S. Matteo, Pavia, ItalyTo improve on the outcome of patientswith intermediate- and high-risk diffuselarge cell lymphoma according to the InternationalPrognostic Index (IPI), an intensivefront-line regimen was initiated in1995 consisting of both conventional andmyeloablative chemotherapy (CT) followedby autologous peripheral blood progenitorcells infusion. Preliminary results are illustrated.The first part of the program consistedof CT with MACOP-B for 12 weeks. Asingle dose of cyclophosphamide (7 gm/m 2 )was then administered as intensificationfollowed by G-CSF (5 µg/Kg) on days 3 to12 for the harvesting of peripheral bloodprecursor cells (PBPC). Mieloablative CTconsisted of CVB regimen: carmustine(600mg/m 2 , day 1), etoposide (30 mg/Kg,day 2) and cyclophosphamide (50 mg/Kg,days 3-4), followed by autologous PBPCinfusion. As of January 1999, 33 patients(pts) entered this study; the median agewas 35 yrs (range: 13-55). Histology included21 pts with diffuse large cell lymphoma,9 with mediastinal lymphoma withsclerosis, 2 with peripheral T-cell and 1 withanaplastic CD30 + lymphoma. High tumorburden was present in 66% of pts; 58%had 2 and 42% 3 or 4 risk factors accordingto IPI. Complete remission (CR) rateafter MACOP-B was 55% (18 pts), and partialresponse rate 28%. Median time fromhigh-dose cyclophosphamide (HDCTX)+G-CSF to WBC and platelet nadir was 8 and10 days, respectively. A minimum of 4 x10 6 /Kg CD34 + cells was considered necessaryfor PBPC transplantation. So far, 22patients received PBPC autografting; themedian time from the end of MACOP-B toPBPC infusion was 3 months. Disease statusbefore PBPC was as follows: 16 patientshad no evidence of disease and 6 had residualdisease after MACOP-B and HDCTX;three of them entered CR after myeloablativetherapy. At the end of program,71% of the patients had achieved CR; the18-months overall survival and RFS were69% and 79%, respectively. Median timefrom PBPC infusion to hematological recoverywas 12 days; the most frequent toxicitieswere mucositis (21% of pts) and fever(79% of pts), with no life-threatening episodes.Treatment-related death occurred ina single case from interstitial lung disease.Intensive front-line therapy with MACOP-Band myeloablative CT followed by PBPCtransplantation in intermediate- and highriskdiffuse large cell lymphoma is feasiblewith moderate toxicity.P467HIGH-DOSE CHEMOTHERAPY WITHREPEATED PBPC HARVESTS ANDREINFUSIONS: HIGH CLINICALRESPONSE IN LARGE CELLNON-HODGKIN’S LYMPHOMAD. CARACCIOLO, F. ZALLIO, I. RICCA, M. MASSAIA,S. CAMPANA, L. BERGUI, P. BONDESAN, M. DI NICOLA,A. PILERI, A.M. GIANNI, C. TARELLADip. Med. Onc. Sperim. - Div. Univ. Ematologia -A.O. S.Giovanni di Torino e Un. Trapianto Midollo,Ist. Naz. Tumori - MilanoImprovements in the cure rate of aggressivenon-Hodgkin’s lymphoma (NHL) havebeen reported with the high-dose sequential(HDS) chemotherapy program, asshown by the randomized study comparingthis approach to MACOP-B. However, a nonnegligiblefraction of patients still do notachieve cure; in addition, in the originalHDS study criteria for patient inclusion werevery restricted. Trying to increase antitumorefficacy of HDS and to extend this approachto as many patients as possible, wedesigned an intensified HDS scheme(megaHDS), including hd-cyclophosphamide(CY), hd-ARA-C, hd-VP16+Cisplatinand final hd-Mitoxantrone+L-PAM. The administrationof such an intensive programtakes advantage of the possibility to harvestand reinfuse peripheral blood progenitorcells (PBPC) following each hd-course.The megaHDS was employed as front-linetreatment in 23 consecutive NHL patients

37 th Congress of the Italian Society of Hematology331(pts.), who are now evaluable for toxicityand clinical response. Main patient featureswere: median age 42 yrs. (range 18-56),M/F: 16/7, stage ≥III: 14; bulky: 11; ↑­LDH:13, symptoms: 20, aa-IPI score ≥2: 17,BM+: 4. Histologic subtypes included: follicularlarge-cell=1, B-diffuse large cell=16;CD30+=3; T-diffuse large cell=2;trasformed=1. The scheme could be completedby 17 pts.; reasons for treatmentdiscontinuation were: disease progression(3 pts.), severe infection (2 pts.), fatal cerebralaspergillosis (1 pt.); in addition, therewere 3 more lung infections, 2 systemicCMV infections that did not preclude programcompletion. There were 2 PR, 1 followedby rapid disease progression; 17 pts.(74%) reached a Complete Remission (CR):all these pts. are presently in continuos CRafter 6 to 27 mos. since HDS. With a medianfollow-up of 15 mos., the estimated 2-year OS and EFS were 78%. We concludethat a more extensive use of PBPC may allowfurther HDS intensification; preliminarresults indicate the high antitumor efficacyof the new program, as documented by theabsence of disease recurrence in pts.achieving CR.

332 September 26-29, 1999 - Torino-Lingotto, ItalyALLOGENEICTRANSPLANTATIONP468PERIPHERAL BLOOD STEM CELLS(PBSC) MOBILIZATION IN 32 HEALTHYDONORSD. CALDERA, E.P. ALESSANDRINO, P. BERNASCONI,A. COLOMBO, G. MARTINELLI, M. VARETTONI, L. MALCOVATI,D. TROLETTI, G. PAGNUCCO, L. VANELLI, *C. PEROTTI,C. BERNASCONIIstituto di Ematologia, *Serv. di Immunoematologiae Trasfusione, IRCCS Policlinico S.Matteo, PaviaIn the last years, the allogeneic PBSCtransplantation has been proposed as effectivealternative to allogeneic bone marrowtransplantation (allo-BMT) for the treatmentof various hematological malignancies.PBSC are mobilized with G-CSF andthen collected by leukapheretic procedure.In this study we retrospectively considered32 healthy suitable donors, HLA-fullmatched with as many oncohematologicalpatients waiting for allo-BMT, who underwentPBSC mobilization between April 1994and April 1999. 21 subjects were male and11 female, with a median age of 37 years(23-59). In all the donors, the mobilizationwas performed by G-CSF at the dose of10µg/kg/day, after informed consent. Themobilization was monitored by WBC andCD34+ cells count; a CD34+ cells count ≥20/ml represented the starting point forPBSC collection, while a CD34+ count ≥4x10 6 /kg of recipient body weight determinedthe interruption of the procedure. TheI PBSC collection was actuated after 3 daysof G-CSF administration in 11 donors, after4 days in 18 and after 5 days in 3; themedian number of leukapheresis for eachdonor was 2 (1-2). At the time of I collectionthe median value of WBC was 39x10 9 /L (17.7-62), with a mean count of mononuclearcells of 10.5x10 8 /kg (4.2-22.5) andCD34+ cells of 6.7x10 6 /kg(4-12.9). Themobilization and collection of PBSC weregenerally well-tolerated. We noticed nomajor adverse events; 28/32 subjects sufferedmuscle-skeletric pain, 2/32 showeda moderate splenomegaly with spontaneousresolution over 1 week, 7/32 experimenteda moderate trombocytopenia. In allthe recipients the take was documented andthe recovery of hematopoiesis was satisfactoryand sustained. In our experience,the PBSC mobilization was well-toleratedand effective, then it can be considered agood alternative to bone marrow harvest.P469ALLOGENEIC BONE MARROWTRANSPLANTATION USING G-CSFPRIMED BONE MARROWF. LI GIOI, G. MILONE, F. INDELICATO, G. GUIDO, F. STAGNO,N. FILARDI, R.D. PELUSO, G. INGHILTERRA, O. MANENTI,T. FIANDACA, R. GIUSTOLISICattedra e Divisione di Ematologia con Trapianto,CataniaIn allogeneic transplantation, G-CSF primingof bone marrow cells before harvest mayshorten time to engraftment and may lowerthe risk of GvHD; this latter effect could beexpected to occur by G-CSF-inducedcytokine modulation (th2 polarisation). Wedescribe our experience in six cases of allogeneicbone marrow transplantation inwhich we used, as inoculum, bone marrowcells harvested after G-CSF priming of thedonor. Glycosilated G-CSF (Myelostim –Italfarmaco) at the dosage of 5 mg/Kg/daywas administered to 6 donor for 3 days,s.c, and bone marrow harvests were doneon the 4th day. Underlying disease were:2 CML, 2 AML, 2 ALL; in all cases donor\recipientpairs were HLA identical sibling,BU-CY schedule was used as conditioningregimen and CSA+MTX short courseas GvHD prophylaxis. For each case weevaluated graft characteristics and posttransplant hematopoietic recovery. G-CSFstimulated BM transplants were comparedto a group of 15 allogeneic PBPC tranplantsdone in our Institute. G-CSF primed bonemarrow harvests showed, compared toPBPC collections, a lower number of MNCand CD34+ cells. However these two groupsof tranplants did not differs in term of plateletand neutrophil recovery (Plt>50000/cmm ANC>500/cmm), and in duration ofsevere bone marrow aplasia (100100).

37 th Congress of the Italian Society of Hematology333In our preliminary experience G-CSF primedallogeneic Bone Marrow seems to lead, indeed,to a fast hematopoietic recovery,longer follow up is needed to determine C-GvHD rate.P470EARLY PBSC COLLECTION TIME(DAY 4°) IS ASSOCIATED WITH FASTPLATELET RECOVERY AFTERALLOGENEIC PBSC TRASPLANTSG. INGHILTERRA, G. MILONE, G. GUIDO, R.D. PELUSO,F. LI GIOI, N. FILARDI, F. STAGNO, F. INDELICATO,R. GIUSTOLISICattedra e Divisione di Ematologia con Trapianto,CataniaAt the start of our PBSC AllogeneicTrasplant program we established to variatethe day of the first PBSC collection, atday 4° or at day 5°, according to contingentfactors i.e. availability of cell separator(CS 3000 Plus). From Feb. 97 to Dec.98 we have performed 12 PBSC trasplantsin 11 patients. In 6 donors PBSC collectionwas started at day 4° of mobilizationtherapy, while in the others at day 5°. Bothgroups of donors were comparable for theamount of CD34+ in the peripheral bloodat day 4° (average 52 ± 15,6 mmc versus52,7 ± 26,6 mmc p = 0,95). 11 patientswere trasplanted, 6 of these received PBSCcollected at days 4° and 5° (1° group) and6 were trasplanted with PBSC collected atdays 5° and 6° or at day 5° only (2° group).PBSC were infused at day 0, after 36 h ofthe chemotherapy end. The infused CD34+amount was similar in both groups (9 ±2,6 x 10e6/Kg 1° group versus 8 ± 1,9 inthe 2° group p = 0,36), also the infusedCFU-GM amount was similar (170 ± 76,5 x10e4/Kg 1°group versus 120 ± 102 in the2° p = 0,32). GVHD prophilaxis schedulewas CSA plus MTX short-course for all patients,no patient had evidence of VOD.Granulocyte recovery was similar in bothgroups (11 days 1° group versus 12 daysin the 2° group). The patients that weregiven PBSC collected at days 4° and 5° (1°group) showed a more rapid platelet recoverythan patients given PBSC collected atdays 5° and 6°. In fact, threshold of 50000mmc was achieved in average at 16° day1° group, while an average of 30 days wereneeded in the 2° group (T-Test p = 0,05Mann Whitney p = 0,06). Platelet engraftmentof PBSC harvested on day 4° seemsdifferent from that of PBSC collected later.P471CHOICE OF ALLOGENEIC STEM CELLSSOURCE BASED ON RISKCATHEGORIESM. FALDA*, F. LOCATELLI*, F. MARMONT*, V. TASSI^,E. LOVISONE*, C. DE FALCO*, S. D’ARDÌA*, E. AUDISIO*,E. GALLO**Centro Trapianti Midollo-Ematologia Osp.-Torino;^Banca del Sangue-TorinoPeripheral blood derived stem cells (PBSC)as a source for allogeneic transplantationalternative to bone marrow (BM) are ableto shorten aplasia duration, thus reducingthe post transplant risk of infectious diseases,while the higher number oflympohocytes in the inoculum could enhancethe antitumoral effect of the transplant.In our Institution from 1995 to 1998the choice of the source of stem cells was

334 September 26-29, 1999 - Torino-Lingotto, Italyguided by considerations on disease stageor on patient conditions. Advanced diseaseswere considered acute myeloblastic leukemia> RC1, acute lymphoblastic leukemia> RC2, chronic granulocytic leukemia > CP1and myelodisplastic syndromes. Also lymphomasand myelomas were regarded asadvanced diseases, since these patients(pts) received 2 or more therapy lines beforetransplantation. At high risk were consideredthose pts which during previoustherapies experienced severe infectiouscomplications or important toxicities. Duringthese four years 85 patients were transplantedwith HLA identical siblings, 38 withBM cells and 47 with PBSC. Conditioningtherapy consisted mainly in CY-TBI for BMpts and Thiotepa 15–CY 150 for PBSC pts.Engraftment was significantly earlier inPBSC pts, 11.9 vs 18.9 days for neutrophiles> 500 (p=0.0004), 13.5 vs 19.3 days forplatelets > 30.000 (p=0.0016). The hospitalstay was shorter for PBSC pts., 29.8 vs36.9 days (p=n.s.), but no difference wasevidenced on fever duration (7.7 vs 7.59).There was no increase in acute Graft vs HostDisease (GvHD) > grade III (10.5% for BMtransplants vs 8.5% for PBSC recipients),nor increase in extended chronic GvHD(38.24 vs 42.86% respectively). No differencesin transplant related mortality (TRM)were deteceted in the two groups ( 10.85% in BM pts. vs 18.14 % in PBSC pts.), norin overall survival (O.S.) and in event freesurvival (E.F.S.). PBSC transplantation confirmsas a valid choice in in this series ofpts. at high risk or with advanced disease.P472CD34 STEM CELL SELECTION USINGTHE CliniMACS SYSTEM FORMISMATCHED ALLOGENEICTRANSPLANTATIONF. FALZETTI, C. CARLO STELLA*, F. AVERSA, T. ZEI,R. IACUCCI OSTINI, D. ALFONSI, L. OLIVIERI, A. TABILIOHaematology and Clinical Immunology Section,Department of Clinical and Experimental Medicine,University of Perugia, Perugia, Italy; *Bone MarrowTransplant Unit, National Cancer Institute, MilanCD34 + stem cell selection is used in allogeneicBMT to remove T-lymphocytes whichare responsible for Graft vs Host Disease(GvHD) from the inoculum. In recent yearsCD34 + cells have been selected by meansof several different techniques based oncolumn affinity (the Ceprate system) orimmunomagnetic beads (the Isolex 300isystem). The degree of T-cell depletion wasalways sufficient to prevent GvHD inmatched transplants (threshold dose of T-lymphocytes

37 th Congress of the Italian Society of Hematology335ney or liver or bowl) combined with the bonemarrow (BM) infusion from the same donorseems to ameliorate the organs attachmentand contemporary it seems to be ableto reduce the duration of immunosuppressivetherapy. Our study is a part of a finalizedproject devoted to the study of tolerance.the transplants were performed inswines (2-3 months old large white landragepigs, mean weight 25.2 kg - range 24-28kg) with kidney (k) and bm obtained fromthe same not identical, with mixed lymphocytecultures, unrelated donor. The bm cells(1.3±0.83 x10 8 cells/Kg of the recipient)were harvested from the donor’s iliac crests,cryopreserved at –80°C and infused after 7days (day: +7) from the K transplantation(day: 0). The immunosuppressive therapywith FK 506 and mycophenolate mofetilstarted at the day 0 for 30 days. Out ofnine transplanted animals four are till nowevaluable. Marrow hemopoietic progenitorcells (CFU-GM, BFU-E, CFU-GEMM) wereevaluated at the day 0, + 15, + 30, + 45and + 60. The tests were performed withmononuclear cells from light density separation(Ficoll-Hypaque 1077 g/dl); 1x 10 5cells/ml were plated, in triplicate, in methylcellulosewith foetal calf serum (20%),bovine seric albumin (2%). Recombinanthuman erythropoietin (4 U/ml) and a humanGM-CSF 100 mg/ml were used as CSF.The progenitor growth/10 5 cells was at theday 0: CFU-GM 28.5 ± 16.5, BFU-E 116 ±79, CFU-GEMM 2 ± 2; at the day + 15:CFU-GM 242 ± 104, BFU-E 245 ± 165, CFU-GEMM 4 ± 4, at day +30: CFU-GM GM 100± 54, BFU-E 262 ± 125, CFU-GEMM 2 ± 1.One animal died after 31 days for intestinalobstruction. Till now only a case stoppedthe immunosuppressive therapy and it isalive and well over 60 days from K transplant:its progenitor growth was as follows:at day +45 CFU-GM 42, BFU-E 2 and atday + 60 CFU-GM 258 BFU-E: 12. In conclusionaccording to the actual data it ispossible to show the presence ofprolipherative activity of the hemopoieticprogenitors after 2 months from the doubletransplantation (kidney and marrow). Theprogenitor growth increase observed immediatelyafter the transplants could be ascribedto cytokine production tied immunologicphenomenons. It is possible that theincrease of our serie numerousness and thechimerism analysis, with the molecular biology,could corroborate such hypothesis.P474IDARUBICINE, BUSULPHAN ANDCYCLOPHOSPHAMIDE FORALLOGENEIC STEM CELL TRANSPLANTIN MALIGNANT HEMOPATHIES ATHIGH RISKA.P. IORI, C. GUGLIELMI, A. ROMANO, S. BERNASCONI,L. LAURENTI, G. GENTILE, W. ARCESEDipartimento di Biotecnologie Cellulari edEmatologia, Università “La Sapienza”, Roma, ItalySince June 1996, we adopted a conditioningregimen that included Idarubicine (IDA-BUCY) in 24 consecutive patients (pts) (3children) transplanted from an HLA-identicalsibling for high-risk malignant hemopathy.IDA-BUCY included: idarubicine, 21mg/m 2 /day c.i. days -12 e -11; busulphan,4 mg/Kg/day from day -7 to -4; cyclophosphamide,60 mg/Kg/day from day -3 to -2.Donor cells (BM=18, PBSC=6) were infusedon day 0. GVHD prophylaxis was CSA in 5pts and CSA+MTX in 19. Median age was28 yrs (3-43), 3 CMV-ve pts had a CMV+vedonor and 9 male pts had a female donor.Diagnosis and disease phase at transplantwere: 8 ALL (2 Ph+ in CR1, 6 CR2, 2 moreadvanced), 7 AML (4 CR2, 3 more advanced),5 CML (3 CP2. 2 more advanced),2 NHL (1 CR4, 1 resistant relapse), 1 MM inCR1 e 1 RAEB-t chemoresistant. Twenty ptswere evaluated, 4 “too early”. All engraftedin a median of 17 days (12-23). Grade III-IV mucositis was observed in 92%, but wasnot associated to an high transplant relatedmortality (only 1 septic death). Acute GVHDwas observed in 11 pts (grade I=6, II=5)responsive to 6MP (2 mg/Kg). With a medianfollow-up of 8 months (3-31) 6 ptsrelapsed (5 in andanced phase at transplant)and 13 pts were alive in CR. Actuarialsurvival and EFS indicate that allogeneictrasplants from an HLA-identical siblingwith the IDA-BUCY conditioning regimenis an effective and tolerable treatmentfor pts with malignant hemopathies at highrisk.

336 September 26-29, 1999 - Torino-Lingotto, ItalyP475NON MYELOABLATIVE CONDITIONINGCHEMOTHERAPY FOR ALLOGENEICSTEM CELL TRANSPLANTATION INPOOR RISK HEMATOLOGICMALIGNANCIEST. DENTAMARO, L. CUDILLO, A. PICARDI, G. ADORNO,M. POSTORINO, A. SCANZANI, A. TAMBURINI, F. BUCCISANO,S. SANTINELLI, M. MASI, S. AMADORIHematology, University Tor Vergata, St. EugenioHospital, RomeIn March 1997 we initiated a study to assessthe feasibility of allogeneic stem celltransplantation (alloSCT) from HLA matchedsibling donors after non myeloablative conditioningregimens in patients with advancedhematologic malignancies. 11 patientswere enrolled in this study: 2 MDS, 5MM, 1 CLL, 1 CML, 1 ALL and 1 NHL with amedian age of 58 years (39-66). 7 patientsreceived Fludarabine (30 mg/m 2 /d x 3 days)with either Cytoxan at 300 mg/m 2 /d x 3days (3 pts) or Thiotepa at 5 mg/kg/d x 2days (2 pts) or Melphalan 100 mg/m 2 (2pt); 1 pt was conditioned with Cytoxan (300mg/m 2 /d x 3 days) and Thiotepa (5 mg/kg/d x 2 days). The last 3 pts receivedFludarabine (30 mg/m 2 /d x 4 days) andThiotepa (5 mg/kg x 2 days). 10 patientsreceived G-CSF mobilized peripheral bloodstem cells and 1 bone marrow. GVHD prophylaxisconsisted of CSA either alone orcombined with short course MTX. Treatmentwas well tolerated with minimal organ toxicity.Two pts maintained an adequate numberof neutrophils and platelets throughoutthe entire post transplant period. 1 pt (MM)died on day +42 in aplasia for cerebralbleeding. Full donor chimerism was documentedin 10 patients on day +20. 9 ptsachieved CR: 3 pts (1 CML, 1 MM and 1NHL) are alive in CR with extensive cGVHDon day +365, +630 and +780, respectively;2 pts (1 ALL and 1 MM) died in CR for IP onday +42 and +120, respectively; 4 pts (2MDS, 1 CLL and 1 MM) relapsed after 32,44, 50 and 58 days from transplantation: 2pts (1 CLL and 1 MM) are alive in relapseon day +545 and +630 respectively; 1 MDSpt died on day +74 for grade IV aGVHDoccurring after CSA withdrawal for diseaserecurrence; 1 MDS pt died on day +290 forprogressive disease. 1 MM pt achieved aPR (persistence of a rib plasmocytoma) anddied on day +150 for IP. aGVHD was documentedin 7 pts: it was moderate in 5 pts;severe aGVHD occurred in 2 pts (1 MDSand 1 MM in CR) after CSA discontinuationfor disease recurrence and for renal toxicity,respectively. These data suggest thatnon myeloablative Fludarabine-based chemotherapyis sufficient for allowing engraftmentof donor hematopoietic cells withminimal organ related toxicity. Furthermanipulation of the GVL effect (donor lymphocyteinfusion, IL-2) might improve controlof residual disease in pts at high risk ofrelapse.P476ALLOGENIC HEMOPOIETIC STEMCELL TRANSPLANTS AFTERNON-MYELOABLATIVE CONDITIONINGREGIMENM. MARTINO, G. CONSOLE, G. IRRERA, G. MESSINA,A. DATTOLA, I. CALLEA, F. MORABITO, P. IACOPINOCentro Trapianti di Midollo Osseo e terapie ematooncologichesovramassimali, Dipartimento diemato-oncologia, Azienda Ospedaliera Bianchi-Melacrino-Morelli, Reggio CalabriaAllogenic bone marrow transplantation isan effective treatment for numerous hematologicalmalignancies mediated by a Graftversus-Leukemia or -Lymphoma effect.Transplant-related mortality, mostly associatedto patient disease status and age,limits the eligibility for such therapeuticapproach. New non myelo-ablative therapeuticregimens allow engraftment withlower toxicity and mortality. We describeour experience on mini-allograft in a 54-year old female ANLL in 3 rd remission phase,in a 40-year old male myelodisplasia and a

37 th Congress of the Italian Society of Hematology33755-year old female CML in AP. Conditioningregimens consisted of Fludarabine (30 mg/m 2 on days -10 to -5), Busulfan (4 mg/Kgon days -6 and -5) and ATG (10 mg/Kg ondays -4 to -1). GVHD prophylaxis consistedof cyclosporin-A. One patient had a neutropenialower than 100/mm 3 . Number ofdays with granulocytes

338 September 26-29, 1999 - Torino-Lingotto, Italywas diagnosed by presence of early viralnucler antigen (EP65) in circulating PMN(antigenemia). CMV antigenemia wasweekly performed: a positive signal(PMN>=1) for CMV infection represented astarting point for antiviral therapy withGanciclovir i.v.(10mg/Kg/die) for 21 consecutivedays. In pts with clinical,hysthological and/or radiological evidenceof CMV disease, combined therapy withantiviral drug and specific Immunoglobulinsi.v. (100.000 IU/Kg/every 2 days) wasstarted. CMV infection occurred in 87/159cases (54%); the incidence of IP was 4.4%(7/159). Five out of seven patients whodeveloped IP were early treated with combinedtherapy, three of them died; 2/7 patientswho started treatment later died withoutresponse. In our study the incidence ofCMV pneumonitis was low, probably due tothe early diagnosis which allows a promptinitiation of therapy; nevertheless the prognosisof IP-CMV related remains poor.P479PCR BASED PRE-EMPTIVE THERAPY OFCMV AFTER ALLOGENEIC SCTRANSPLANTATIONR.D. PELUSO, G.A. PALUMBO, C. SIMILI, G. MILONE,F. L I GIOI, G. INGHILTERRA, F. INDELICATO, G. GUIDO,G.O. MANENTI, T. FIANDACA, N. FILARDI, P. GUAGLIARDO,R.GIUSTOLISICattedra e Divisione di Ematologia con Trapianto,CataniaNeutropenia is the main collateral sideeffect of Ganciclovir (GCV).When used aspre-emptive treatment of CMV reactivationsabout 20% of patients present neutropenia(N

37 th Congress of the Italian Society of Hematology339phylaxis was CsA/MTX and the source ofstem cells was PBCS in 9 and BM in 2 patient,one of them receiving a matchedunrelatedtransplant. Four of them weretreated with low-dose metilprednisolone(MP) for mild acute GVHD (0,5 mg/kg) andtwo with 2 mg/kg MP for moderate aGVHD.Eight patients received pre-emptivetherapy for CMV reactivation accordinglyto our cidofovir protocol (5mg/kg on day0, 3 mg/kg on day 7 and than every 14days at least until day +120 after transplantation);the MUD transplant patientwas under foscarnet prophilaxis and receivedcidofovir for CMV-reactivation; theother two patients were treated for CMVinfection resistant to foscavir andganciclovir. One week after the second doseof cidofovir (day 14 from the beginning oftreatment), all the pts were CMV-Ag negativeexcept one who become negative oneweek later. Only two patients presented atransient CMV Ag-emia reactivation (12 and3/2x10e5 cells) respectively 36 and 48days after the beginning of cidofovir butwere negative a week later. All patientscompleted the treatment except one patientwho died for multiorgan failure andone patient who had a concomitant severeTTP. Nephrotoxicity was never observedwhen a course of probenecid was administeredwith each dose; the drug was welltolerated,one patient presenting occasionallynausea and vomiting and another hada mild urticarial reaction probably relatedto probenecid. No interaction withCyclosporin A was detected and nobodyprogressed to CMV disease. We concludethat this treatment can be safely and effectivelyused in pre-emptive treatment ofCMV disease and in CMV infection resistantto classical treatment; the very longhalf-life of the drug make it particularlyuseful for the treatment of outpatients.P481ACUTE GVHD PREDICTS CMVINFECTION IN ALLOGENEIC BONEMARROW TRANSPLANTATION: STUDYOF 156 CASESE.P. ALESSANDRINO, P. BERNASCONI, A. COLOMBO,D. CALDERA, M. BONFICHI, G. MARTINELLI, L. MALCOVATI,M. VARETTONI, 1 C. KLERSY, C. BERNASCONICentro trapianti di midollo osseo, Istituto diEmatologia; 1 Servizio di Biometria DirezioneScientifica, IRCCS Policlinico S. Matteo, PaviaThere is evidence in clinical transplantationthat CMV might play a role in GvHD: inrecipients of cord-blood-derived stem-celltransplant with prior CMV infection more severeGvHD has been described. Clear evidence,however, that CMV infection or acuteGvhD are risk factors for acute GvHD andCMV infection respectively, is lacking. In thisstudy 156 patients affected with haematologicalmalignancies who received bonemarrow transplant from an HLA identicaldonor, were reviewed retrospectively in theattempt to evaluate possible relationshipbetween acute GvHD and CMV infection.The median age was 34 years ( range 15-54), 90 were males, 66 females. Forty-eightpatients were affected with acute non lymphoidleukaemia, 25 with acute lymphoidleukaemia, 49 with chronic granulocytic leukaemia,4 with severe aplastic anaemia, 24with myelodysplastic syndrome (MDS) oracute leukaemia from MDS, 1 patient wereaffected with non-Hodgkin-lymphoma and 1with Hodgkin disease, 3 with multiple myeloma.Eight-seven patients developed CMVinfection evaluated as positivity for the earlynuclear pp65 protein antigen in circulatingneutrophils . Infection appeared at the mediantime of 36 days from transplant (range20-1125). Acute GvHD occurred in 88 patients(88%) at the median time of 17 days(range 6-95) from transplant. In 14 casesCMV infection occurred before acute GvHD.In forty cases, CMV infection was concomitantor followed acute-GvHD. CMV infectionwas included in a Cox model as time-dependentvariable in the attempt to establish itsvalue as predictor of acute GvHD: we did notfind any relationship (HR 1.17 (0.6-2.26),while acute GvHD resulted to be predictor ofCMV infection (HR 1.88 (1.77-3.02) P=0.008). In this study acute GvHD clearlyappears to precede and favour the developmentof subsequent CMV infection.

340 September 26-29, 1999 - Torino-Lingotto, ItalyP482HIGH LEVELS OF ANTIPHOSPHOLIPIDANTIBODIES ARE ASSOCIATED TO CMVINFECTION IN UNRELATEDALLOGENEIC STEM CELLTRANSPLANTATIONA. MENGARELLI, C. MINOTTI, G. PALUMBO, P. ARCIERI,G. GENTILE, A.P. IORI, W. ARCESE, G. AVVISATIDip. di Biotecnologie Cellulari ed Ematologia,Università degli Studi di Roma “La Sapienza”Antiphospholipid antibodies (APA) are afamily of autoimmune and alloimmune immunoglobulinsthat recognize protein phospholipidcomplexes in in vitro laboratory testsystems. These antibodies have been associatedto several conditions (malignancies,autoimmune disease, infections, useof drugs); moreover, a syndrome capableof inducing thromboembolic disease hasbeen recently associated to the presenceof these antibodies. Aim of this prospectivestudy was to investigate the behaviour ofAPA in subjects affected by hematologicmalignancies undergoing an allogeneic hematopoieticstem cell transplantation, inorder to evaluate wether or not thisbehaviour may contribute to early detectionof severe complications. From March1996 to December 1997, 32 patients undergoingallogeneic stem cell transplantation(ASCT) were prospectively studied untilday +180 from transplant. The meanvalues of IgG and IgM anticardiolipin antibodies(ACA) increased in recipients stemcells from unrelated donor, and a statisticallysignificant difference in ACA IgG meanvalue among unrelated and related transplantedpatients has been demonstratedfrom day +95 to +180 (day +95 P < 0.01;day +120 and +150 P < 0.0003; day +180P < 0.0005). Moreover, 100% of the subjectsreceiving stem cells from an unrelateddonor were high titre APA positive vs 35%of the subjects receiving stem cells from arelated donor (P < 0.01). The reason forsuch a difference may be due to the differentincidence in documented CMV infectionin the 2 groups (83% vs 23%; P < 0.01),as also indicated by the fact that APA positivityis significantly correlated with a CMVinfection (P < 0.05). No relation was foundamong APA and conditioning regimen, acuteor chronic graft versus host disease (GVHD),anticonvulsant or immunosoppressivetherapy. We did not observe any thromboembolicdisorder or veno occlusive disease(VOD).P483THROMBOTIC THROMBOCYTOPENICPURPURA (TTP) LIKE SYNDROME INPATIENTS UNDERGOING ALLOGENEICHEMOPOIETIC STEM CELLTRANSPLANTS AND THE LACTICDEHYDROGENASE (LDH)/PLATELETINDEXA. BACIGALUPO, D. OCCHINI, R. ONETO, B. BRUNO,M. SORACCO, T. LAMPARELLI, F. GUALANDI, D. OCCHINI,N. MORDINI, G. BERISSO, S. BREGANTE, M.T. VAN LINT,A.M. RAIOLADipartimento Ematologia Ospedale San Martino,Genova, ItalyThrombocytopenic thrombotic purpuralikesyndrome (TTP-LS) is a serious complicationof allogeneic hemopoietic stem celltransplants (HSCT). Elevated lactic-dehydrogenase(LDH) levels and low plateletcounts are among the laboratory featuresand a high LDH/platelet ratio (TTP index)is a marker of this syndrome. We haveterefore asked the following questions : (1)how many patients have an elevated TTPindex on day +30 after transplant, (2) whatfactors are associated with a high TTP index,(3) is there a correlation with transplantrelated mortality (TRM) and (4) withclinical symptoms. To answer these questionwe have analyzed 259 consecutivepatients udergoing an allogeneic HSCT,from an HLA identical siblings (n=173), afamily mismatched member (n=22) or anunrelated donor (n=64). The transplant wasunmanipulated in all cases: the source wasbone marrow (BM) in 199 and peripheralblood (PB) in 60. The median age of thepatients was 37 (23-66). The median TTPindex on day +30 was 5, the 75 percentilewas 12. The only factor associated with asignificantly higher TTP index was transplantfrom an unrelated donor (p=0.01),whereas age, gender of donor and recipient,phase of the disease were non predictive.The actuarial TRM was 25% vs 30%(p=0.05) for a TTP index 5 and 22%vs 48% for a TTP index 12(p

37 th Congress of the Italian Society of Hematology341analysis a TTP index of 12 was a good predictorof TRM (p12, 19underwent a plasma exchange (PEX) and11 died (57%) compared to 14/33 deathsin patients not treated with PEX (42%)(p=ns). This study shows that 25% of patientsundergoing an allogeneic HSCT havelaboratory signs of TTP like syndrome onday +30, are more likely to develop clinicalsymptoms and have a significantly greaterrisk of transplant mortality. Because PEXperformed when clinical signs are overt,does not seem to modify the outcome, patientswith a high TTP index of >12, couldbe candidates for a prospective trial of earlyplasma exchange.P484MICROANGIOPATIC HEMOLYTICANEMIA AFTER ALLOGENEICHEMATOPOIETIC STEM CELLTRANSPLANTATIONC. ANNALORO, E. POZZOLI, V.G. BERTOLLI, E. TAGLIAFERRI,A. DELLA VOLPE, D. SOLIGO, G. LAMBERTENGHI DELILIERSCentro Trapianti di Midollo and Istituto di ScienzeMediche, Ospedale Maggiore IRCCS and Universitàdegli Studi di MilanoMicroangiopathic hemolytic anemia(MAHA) is recognized with increasing frequencyas a primary complication after hematopoieticstem cell transplantation(HSCT). In our Institution, 11 out of 149patients (7.4%) undergoing allogeneicHSCT have developed full-blown MAHA.They were seven males and four femalesaged between 19 and 53 years (median 43).The diagnoses leading to HSCT were AMLin three (two second HSCT), ALL in one (secondHSCT), CML in two (one BC), NHL intwo, HD in one and multiple myeloma intwo; the stem cell source was bone marrowin five, cord blood in one and peripheralblood in five cases. The donors wereHLA-identical siblings in seven, MUD in twoand HLA non-identical relatives in two cases.The diagnosis of MAHA was establishedbetween 21 and 89 days after HSCT (median41). In two of the patients, the MAHAoccurred as an isolated complication; theother patients had different combinationsof concurrent illnesses: interstitial pneumoniain five, hemorrhagic cystitis in six, acuteGVHD in five and hepatic VOD in four. Twootherwise critically ill patients received notreatment, four received plasma exchange(PEX), three defibrotide alone, and two(those with isolated MAHA) both PEX anddefibrotide. Only the last two patients arestill alive: one failed to respond to PEX buthad a complete response after defibrotide;the other failed to respond to defibrotidebut partially respondend to PEX. The percentageof MAHA cases in the present seriesis rather low, since only the patientswith an unequivocal clinical and laboratorypicture were included; subclinical forms arelikely to be considerably more frequent.Full-blown MAHA occurred predominantlyin the patients undergoing high risk HSCT,and was generally a further complicationof an adverse outcome. Response to therapywas very poor and, as also the literaturecontains conflicting results, an optimaltherapeutic strategy is far from being established.This is particular frustrating sinceMAHA may occur as an isolated life-threateningcomplication after an otherwise successfulHSCT.P485LONG-TERM STABILITY OFHEMATOPOIESIS FOLLOWINGALLOGRAFT OF PERIPHERAL BLOODSTEM CELLA. INDOVINA, A. SANTORO, S. CANNELLA, R. SCIMÈ,A.M. CAVALLARO, P. CATANIA, S. TRINGALI, L. CASCIO,I. MAJOLINODivisione di Ematologia e Unità TMO, Ospedale“V. Cervello”, PalermoRecent studies have shown that hematologicrecovery is more rapid after peripheralblood stem cell (PBSC) than after bonemarrow (BM) transplantation also in the allogeneicsetting. The analysis ofhaemopoietic chimerism after allogeneicPBSC transplantation (PBSCT) can give thedefinitive proof of the ability of PBSC toensure a complete and durable engraftment.We retrospectively assessed thelong-term stability and chimerism of hematopoiesisafter allogeneic PBSCT in 34patients with different hematologic disorders.The graft consisted of PBSC alone,with a median of 82.2 x 10 4 /kg (18.2-358.9)

342 September 26-29, 1999 - Torino-Lingotto, ItalyCFU-GM, 8.2 x 10 6 /kg (3.9-24.1) CD34+cells and 2.3 x 10 8 /kg (0.9-8.6) CD3+ cells.The hematologic counts (WBC,PLT,HCT)were analysed at 1 (21 patients), 2 (17patients), 3 (13 patients) and 4 years (6patients), and the pattern of DNAhypervariable regions (microsatellite andminisatellite), was investigated by PCR. Allpatients engrafted >0.5 x10 9 /L PMN cellsand >50x10 9 /L platelets at a median of 14and 15 days, respectively. Twenty-one patientswere evaluated for long-term graftperformance. The hematologic count remainedstable during the whole periodobservation and none of the patients experiencedlate graft failure. Full-donor ormixed hemopoiesis was demonstrated earlypost graft in all patients and the chimeraremained stable over time. Allogeneic transplantationwith unmanipulated PBSC ensuresfast and stable engraftment.P486HEMATOLOGIC RECOVERY AFTERALLOGENEIC BONE MARROWTRANSPLANTATION (alloBMT)A. DOMINIETTO, A.M. RAIOLA, M.T. VAN LINT, T. LAMPARELLI,F. GUALANDI, D. OCCHINI, N. MORDINI, G. BERISSO,S. BREGANTE, F. FRASSONI, A. BACIGALUPODipartimento di Ematologia Ospedale San Martino,Genova, ItalyUnmanipulated allogeneic BMT results inearly and rapid engraftment and severalreports have analyzed predictors, such ascell dose, donor type and the use of growthfactors. On the contrary, there are few reportson the quality of hematologic reconstitutionat a later stage, 1-12 months post-BMT, at a time when many patients experiencedecreasing peripheral blood countsassociated with events such as graft versushost disease and infections. In thepresent study we have analyzed factors influencingplatelet recovery after alloBMT in355 patients (148 CML, 109 AML,66 ALL, 32 OTHERS) who received anunmanipulated hemopoietic stem cell transplant(HSCT). The donor was an identicalsibling (bone marrow in 267 and peripheralblood in 15), a matched unrelated donor(MUD) (n=68) or an identical twin(n=5). GVHD prophylaxis consisted ofcyclosporin A (CS) with or without methotrexate(MTX). The conditioning regimenwas for all patients cyclophosphamide (CY)and fractionated total body irradiation (TBI)(12 Gy in 102 and 9.9 Gy in 253 patients).Median (range) platelet counts on day 20,50, 100, 200, 365, 730 were (X10^9/l)respectively 23, 85, 94, 125, 162, 195. Factorsnegatively influencing platelet countson days 51-100 were acute GVHD graterthan II (p

37 th Congress of the Italian Society of Hematology343responsible for post-grafting immune suppression,we analyzed PBMC type-1 andtype-2 cytokine mRNA profiles at varioustimes post-grafting. Early post-transplant,i.e., at 15-25 days, we predominantly detectedIL-10. Subsequently, IFN-γ and IL-4appeared, but IL-12 failed to be expressedin monocytes up to 12-20 months postgrafting.In contrast to donor CD4+ cells,nearly 100% of the post-grafting CD4+clones expressed IL-4 and IL-10, and manyfailed to express IL-12Rβ2-chain mRNA.When antigen (candida)-specific T cell responsescould first be elicited in vitro 18months post-grafting, they exhibited a type-2 cytokine component (IL-4), typically absentin normal donors. It is possible thatthe early IL-10, by down-regulating IL-12production in monocytes, contributes to theearly (beneficial) immune suppression.However, this may subsequently prevent thedevelopment of protective type-1 responsesand favor non-protective type-2 responses.The same, type-2, cytokine pattern andfailure to develop immunity to fungi arefound in a murine bone marrow transplantationmodel (L. Romani and coll.). In thismodel, immunity to fungi can be improvedby post-grafting anti-IL10 Ab and sIL-4Rtreatment. Combined information from clinicaland experimental transplants may guidefuture therapeutic interventions aimed ataccelerating the post-grafting immune recovery.AIRC grant to A.V., and FIRC fellowshipsto I.V. and L.R.P488MYCOPHENOLATE MOFETIL (MMF) ASTHERAPY FOR REFRACTORY CHRONICGVHD (cGVHD) IN CHILDRENRECEIVING BONE MARROWTRANSPLANTATIONA. BUSCA, E.M. SAROGLIA, E. LANINO*, E. VASSALLO,F. FAGIOLI, L. MANFREDINI*, T. EMANUELI*, G. DINI*,B. NICOLINI # , A. TAGLIABUE # , C. UDERZO #Dept. of Pediatrics, University of Turin;*Istituto “Giannina Gaslini” Genova;#Dept. of Pediatrics, University of Milan, MonzaMMF is an alternative immunosuppressantwhich inhibits the de novo pathway for purinesynthesis. The aim of present studywas to evaluate the safety and efficacy ofMMF as therapy for cGVHD in 14 childrenaged 3-16 years, with hematological disorderswho received allo-BMT from HLA-id sibling(n=8), or matched unrelated donor(n=6). In 12 patients, 98-610 days afterBMT, extensive cGVHD developed and wasunresponsive to conventional therapy includingCSA (n=11), PDN (n=10), Thalidomide(n=3), Azathioprine (n=3),photopheresis (n=3) or MTX (n=2); 2 patientsdeveloped limited cGVHD. The mainindications to start MMF were either progressionof extensive cGVHD despite treatment(n=10), occurrence of CSA/FK506-associated toxicity (n=2), or both (n=2).Patients were treated with MMF at the doseof 20-35 mg/Kg/day in addition to CSA andPDN (n=7), PDN ± photopheresis (n=3),CSA (n=2), CSA-PDN and PUVA (n=1), orAzathioprine (n=1). The time from the onsetof cGVHD to the initiation of MMF treatmentranged between 18-2271 days (median630). A significant clinical improvementwas noted in 3 (23%) of the 13evaluable patients, a moderate improvementwas observed in 6 (46%) patients andwas asssociated to a significant dose reductionof steroid dosage in 4 cases; 1 (8%)patient with limited cGVHD who could nolonger receive CSA/FK506 due to severecomplications showed no change in clinicalextension of the disease, but steroid dosagecould gradually be reduced; 3 (23%)patients had no response. The median durationof therapy was 5 months (range 1-15); MMF was discontinued after 15 days –6 months in 6 patients for the followingreasons: parents choice (n=2), liver toxicity(n=2), poor compliance (n=1) and noresponse (n=1). Adverse GI events wereobserved in 4 patients, 2 developed severeliver toxicity (n=2), and 1 leukopenia;4 patients experienced opportunisticinfections. All patients are currently alive,12 have karnofsky scores ≥70%; 10 patientshave active cGVHD requiring immunosuppressivetherapy. These preliminary resultssuggest that MMF can be used safely inchildren with cGVHD. Prospective clinicaltrials are needed to assess the impact ofMMF in the treatment of cGVHD.

344 September 26-29, 1999 - Torino-Lingotto, ItalyP489MEMBRANOUS GLOMERULONEPHRITISIN ONE PATIENT SUBMITTED TOALLOGENEIC PERIPHERAL BLOODSTEM CELLS (PBSC)TRANSPLANTATION: A SINGULARPRESENTATION OF CHRONIC GvHD(cGvHD)M. VARETTONI, E.P. ALESSANDRINO, C. ESPOSITO*,P. BERNASCONI, D. CALDERA, A. COLOMBO, G. MARTINELLI,G. FASOLI*, L. MALCOVATI, C. BERNASCONIInstitute of Hematology and Operative Unit ofNephrology*, IRCCS Policlinico San Matteo, PaviaKidney is seldom a target of cGvHD. Asfar as we know, renal involvement in cGvHDhas been described only in patients submittedto allogeneic bone marrow transplantation.Here we report a case of membranousglomerulonephritis associated withcGvHD in one pt submitted to allogeneicPBSC transplantation. A male, aged 56, affectedwith ANLL from MDS refractory toconventional treatment, was submitted toallogeneic PBSC transplantation from anHLA-identical brother. GvHD prophylaxiswas performed using cyclosporine A (CyA),metylprednisolone (MP) and a short courseof methotrexate (MTX); CyA was discontinuedon day +25 because of intoleranceand prophylaxis was continued with steroidsgiven along with MTX, administered onceweekly up to day +56. On day +110, ptdeveloped extensive “de novo” cGvHD, involvingskin and mucouses, which was wellcontrolledby steroids. On day +510, the ptexperienced nephrotic syndrome, associatedwith an exacerbation of cGvHD. Determinationof autoantibodies resultednegative. Skin biopsy showed the histologicalpicture of GvHD; we performed a renalbiopsy, by which a diagnosis of membranousglomerulonephritis was established.The pt was treated with prednisone 1 mg/kg/day, with initial amelioration within 2weeks; two months later, edema and massiveproteinuria reappered, despite therapywith corticosteroids, prompting us to startcyclophosphamide; during the treatmentthe pt died of pulmonary embolism. Thecontemporary onset of nephrotic syndromeand exacerbation of preexistent cGvHD suggestsa common pathogenesis for bothevents. In our pt nephrotic syndrome developedlate and had a rapid evolution;therefore, we recommend a prolonged surveillanceafter transplant and a prompt beginningof immunosuppressive treatment.In our case, response to treatment was transitory,maybe due to the use of steroidsalone.P490LIVER NODULAR REGENERATIVEHYPERPLASIA AFTER ALLOGENEICBONE MARROW TRANSPLANTA. LUCANIA, G. DE ROSA, L. PEZZULLO, P. MURETTO°,B. ROTOLIDepts. of Hematology , Federico II University,Medical School, Naples and °Pathology, HospitalS. Salvatore, Pesaro, ItalyA 35 year old patient suffering fromchronic myeloid leukemia in chronic phaseunderwent allogeneic bone marrow transplant(BMT) from his HLA identical brother.Conditioning regimen was BuCy2 and MNCinfused were 1.6x10 8 /Kg. On day +33 agrade IV acute cutaneous GvHD occurred,successfully treated with high doses of steroid.At +6 months, because of a suspicionof hepatic GvHD (increased ALT, AST, γGT,ALP and bilirubin, with negative virologicpattern) the patient underwent liver-biopsy,which showed a picture of liver injury probablyrelated to pharmacologic toxicity. Reductionof the pharmacologic load was initiallyfollowed by improvement of hepaticparameters, but after some weeks a newincrease of hepatolysis and cholestasis indexesoccurred. A repeat liver-biopsy documentedregenerative nodular hyperplasia(NRH). NRH is a rare complication due toaltered liver perfusion, that may cause portalhypertension. Only histology may distinguishbetween liverGvHD, viral reactivation,pharmacologic toxicity or injury as aconsequence of altered perfusion. At +13months from BMT, liver enzymes fluctuateand the patient is monitored for his NRH.

37 th Congress of the Italian Society of Hematology345P491RAPID IMMUNE RECONSTITUTION INMM PATIENTS AFTER ALLOGENEICPBSC TRANSPLANTATIONF. R E, D. RONDELLI, G. BANDINI, M.A. LAUDADIO,D. RASPADORI, B. SENESE, M. ARPINATI, M. STANZANI, S. TURAIstituto di Ematologia e Oncologia Medica“Seragnòli”, Università di BolognaIn this study we analyzed the immunerecovery of 13 MM and 19 AML or CML patientsreceving G-CSF mobilized peripheralblood stem cells allogeneic transplantationfrom HLA-matched siblings.Healthy donorsreceived a treatment with G-CSF at10 µg/kg/d x 5 d s.c. and collected PBSC on day 5and 6. All patients but 1 receivedCsa+methotrexate and 1 Csa+prednisoneas GVHD prophilaxis. Patients received amedian number of 7 x 10 6 CD34+ cells/kg,14 x 10 8 mononuclear cells/kg and 245 x10 6 CD3+/ kg. By flow cytometry we analyzedthe phenotype of T cells (CD3, CD4,CD8), NK (CD16, CD 56, CD57) and Bcells(CD19) at 1, 2, 3, 6 and 12 monthsafter transplant.MM patients exhibited afaster immunologic reconstitution with amedian CD4+ cell number = 370/µl at 6months and = 710/µl at 12 months, whilepatients with myeloproliferative disordersshowed 280 CD4+ cells/µl at 12 monthsafter transplant. At this time the CD4:CD8ratio was normal in patients with MM and

346 September 26-29, 1999 - Torino-Lingotto, Italyognized with the ultrasound digital osteodensitometry,a fast, simple and unexpensivemethod.P493UNRELATED DONOR SEARCH ANDTRANSPLANT: INTENTION TO TREATANALYSIS ON 114 CONSECUTIVEPATIENTSS. GUIDI, A. BOSI, L. LOMBARDINI, R. SACCARDI,A.M. VANNUCCHI, P. ROSSI FERRINIBMT Unit, Dpt Hematology Azienda OspedalieraCareggi, Firenze, ItalyFrom 1989 to March 1999 an unrelateddonor (UD) was searched for 114 consecutivehematological pts referred to our BMTUnit; 68 male, 46 female,52 early, 62 advanced;mean age 28 years old (range8-48). 55 UD (48%) were identified and 45pts were transplanted (81%) 1 patient iswaitinig for transplant and the remainig 6have not been transplanted because of diseaseprogression and three for refusal. Themean interval from formal search to transplantwas 192 days (range 88-1126).DIAGNOSIS N° UD-BMT EARLY-ADVANCEDCML 53 24 13-11ALL 37 14 6-8AML 14 3 0-2SMD 8 45 1-4SAA/MM 2 0 0TOTAL 114 45 20-25Overall survival of the 45 BMT patient was38 % and 0 for the 69 who failed to find anUD, the difference between the two curveswas not statistically significant but onlytransplant group curve reached a plateaux.Main failure causes was TRM in the BMTgroup and disease progression in the otherone.1,0,8,6,4,20,001000200038%UD-BMT=45NO- BMT=6930004000P494OUTCOME OF BONE MARROWTRANSPLANT USING UNRELATEDDONOR IN 35 PATIENTS WITHHEMATOLOGIC MALIGNANCIESA.A. COLOMBO, E.P. ALESSANDRINO, P. BERNASCONI,D. CALDERA, G. MARTINELLI, M. VARETTONI, L. MALCOVATI,M. MARTINETTI*, C. BERNASCONICentro Trapianti di Midollo Osseo, Istituto diEmatologia, Servizio di Immunoematologia eTrasfusione, IRCCS Policlinico San Matteo, PaviaBetween 1990 and February 1999, thirtyfiveconsecutive patients (18M and 17F)with hematological malignancies underwentto MUD transplantation from donors whowere identical for HLA -A, -B, -DR, by serologic(6pts) and by molecular typing, restrictionfragment length polymorphism andsequence-specific oligonucleotide probehybridization analyses, (29 pts). By moleculartyping, 5/29 patients were mismatchedfor DR-B3 or DR-B4/5, and 6/29 for DQ-B;one was DQ-A mismatched and 8/29 weremismatched for C antigens. Two patientshad a combined mismatched for DR-B3/4and C (1 pt) and DQ-B and C (1 pt). Themedian age was 32 years (range 17-51).The diagnosis were: 15 CML ( 9 C-Ph; 6Acc.Ph); 2 SAA; 5 MDS (1RA; and 4 AREB-T) and 12 AL (5 ALL, 7 ANL), 5/12 AL ptswere in CR, 8/12 pts were relapsed. Allpatients received acute GVHD prophylaxiswith the combination of ciclosporine (CSA),Methotrexate (MTX) and methilprednisolone(MP). The preparative regimen consistentof total body irradiation (TBI) andCyclofosfamide (Cy) 60mg/Kg daily for 2days, (24/35), TBI plus Cy and ATG (10 pts)or thiotepa (1 pts). Median infused cellswere 2,9 x10 8 /kg (range 1-5). All patientsexcept two engrafted; 7 patients died earlyof regimen-related toxicity. Ten of 35 patientsdeveloped grade >II acute GVHD; in6 of which GVHD was fatal. Height patientssuffered from limited chronic GVHD and12pts from extensive chronic GVHD. Twopatients died for renal or pulmonary c-GVHDcomplications. Seven patients died of sepsis,2 of VOD, 3 developed fatal cerebralhemorrhage, 1 viral encephalitis, 4 pneumonia,1 CMV disease. Two patients withAL died of relapsed disease. The medianfollow-up is 375 days (range 8-3650) andthe 32% of patients are alive at 3650 days.Multivariate analysis shows that disease

37 th Congress of the Italian Society of Hematology347status, age (< 29y) were significant prognosticvariables associated with better survival:55% vs 10% (p=0.003).P495MATCHED UNITS AVAILABILITY FORITALIAN PATIENTS AS A FUNCTION OFA CORD BLOOD POOL SIZES. RENDINE, E. S. CURTONI, P. FRANCIA DI CELLE,L. BERTOLA, I. BORELLI, F. MARIN, M. BARBANTI*,P. SARACCO^, L. FAZIO^, E. GAY^, A.M. DALL’OMOImmunologia dei Trapianti - Molinette - Torino;IBMDR - Ospedale Galliera - Genova*;Torino Cord Blood Bank-OIRM-Torino^The highly polymorphic nature of HLAsystem reduces the probability that a patientwill find an HLA-compatible unrelateddonor (MUD), especially for patients belongingto regions or ethnical groups not wellrepresented, even if International Registries(BMDW) contain more than 5 million of individuals.Recently, umbilical cord blood(CB) was also used as a source of stem cells,reducing the risk of GVHD, then allowing 1

348 September 26-29, 1999 - Torino-Lingotto, ItalyMUD, by serologic or low resolution moleculartyping. The remaining pts (13/46) identified1 or >1 CB units, in particular onlyone CB unit was phenotypically HLAmatched, whereas in the remaining 12cases there was a disparity for ≥ 1 HLAantigens.Further simulation study was performedin our local registry of n° 319 volunteerdonors and we found n° 4 hypotheticalCB units (n°2 matched and n° 2mismatched, respectively) for other n° 4pts. This study confirms that BMDW registryprovides a stem cell donor for almost90-100% of the pts, if one accepts a donorwith a single or two mismatched antigens.However, the likelihood of finding a CB unitwith higher degree of matching is still limited.Our data also shows that a local registry,even of small dimension, may contributesignificantly in finding a matchedCB units.P497UNRELATED DONOR CORD BLOOD (CB)TRANSPLANTATION: SELECTION OFMATCHED UNITSA. BUSCA, F. NESI, E. VASSALLO, F. FAGIOLI,E.M. SAROGLIA, M. BERGER, P. SARACCO, A.M. DALL’OMO*,E. MADONDepartment of Pediatrics, University of Turin -*Transplant Immunol Molinette, TurinCB transplantation is increasingly used asa new source of hemopoietic stem cells. Asa result, programs for the banking of unrelateddonor umbilical CB have been establishedworldwide. Here we present the preliminaryresults on the outcome of searchesfor potential unrelated donor CB grafts performedby the Dept of Pediatrics-Universityof Turin. Between December 1994 andMarch 1999, 45 children with hematologicalmalignancies (n=36) and congenitaldisorders (n=9), who lacked an appropriatefamily-member donor, began the searchfor a match CB unit. At the same time 31/45 patients entered the program of searchfor an HLA-matched unrelated bone marrowdonor. At the time of initial search,patients had a median age of 9 years (range1-30) and a median body weight of 28 Kg(range 8-64); all patients except 1 werecaucasian. Patients had searched for a CBunit through the Netcord Database, theFrench Cord Blood Bank, the Belgian RedCross-Marrow donor Program Registry andthe New York Blood Center. Matching criteriafor an HLA-matched unit required theCB to share at least 4 HLA antigens withthe recipient after DRB1 high resolutiontyping. 23 units from donors who were initiallymatched with the recipient for at least4 of the recipient’s six HLA-A,B and DR antigensat low resolution (n=12, 4/6 antigensmatch; n=11, 5/6 antigens match)were not typed for HLA-DRB1 alleles by highresolution DNA analysis and were notevaluable. 6 patients did not identify a suitableCB unit. At least one CB unit fulfillingthe matching criteria was identified for 16candidates: 1 of the 16 units was matchedfor 6/6 HLA antigens, 5 for 5/6 and 10 for4/6. 12 patients identified a MUD; 7 patientsfound both a volunteer bone marrowdonor and a match CB unit, 5 of these receiveda CB transplant because of rapidlyevolving disease. When a match CB unitwas available the median time to its identification(DRB1 DNA typing) was 81,5 days(range 12-815) and the median number ofnucleated cells/Kg recipient’s body weightwas 5,7 x 10 7 (range 2,5-19,1). 9 of the 16patients (56%) for whom a suitable CB unitwas identified actually received the transplant;for 5 patients different therapeuticstrategies were pursued, 2 patients hadprogression of their underlying disease. Themedian time to transplantation was 3,5months (range 1-7) from initiation of asearch and 30 days (range 13-112) fromidentification of a match CB unit.P498CORD BLOOD BANKING FOR RELATEDALLOGENEIC AND AUTOLOGOUS USE:A MULTICENTRE EXPERIENCEP. S ARACCO, A. PICARDI*, M. SCRENCI*, D. ADORNO*,A. CALUGI*, D. CARMINI*, G. CORNAGLIA, A. DALL’OMO,R. D’AMELIO*, A. PIGA, L. PERUGINI, W. ARCESE*,A. AMADORI*, E. MADONTorino e Roma Cord Blood BanksCord blood (CB) progenitor cells, obtainedfrom related and unrelated donors, havebeen used increasingly as an alternative tomarrow. CB stem cells (CBS) represent anoptimal vehicle for gene therapy based onthe high efficiency of transduction.Precautory collections of CB for autologoususe may occur to treat previously diagnosed

37 th Congress of the Italian Society of Hematology349or suspected hereditary disorders, or totreat future disease, in families at high riskof developing stem cell curable diseases,prior gene therapy or other manipulationof autologous CBS; collections for relatedallogenic transplant may occur to treat firstdegree relatives, mainly siblings, alreadyaffected or potentially at high risk of beingaffected by stem cell curable diseases.These selected collections may be acceptableat the expenses of public resource, butoverall costs should be restrained andguidelines policies with minimal standardrequirements should be provided. We reporton the experience of the parallel familyCB banking program established at 2GRACE CB Banks (Torino-Az.OIRM S.Annae Roma–Univ. La Sapienza/Tor Vergata Az.S.Eugenio). These banks started their activityrespectively in 1990 and 1994 andachieved ISO9000 QS certification in 1998, within GRACE Network. Selection and recruitmentof cases mainly occur: 1) fromphysicians or health services who followpatients with current transplant needs (90%), 2) during medical history selectionof donors for the unrelated bank (less than1%), 3) from genetic counselling and prenataldiagnosis services (9%). Total dedicatedunits collected were: 129 (125 forrelated and 4 for autologous use ). Type ofdiseases: leukemia/ myelodispl. sy. 71, PNH1, hemoglobinopathies 25 , lymphoma 6,marrow failure sy. 7, neoplasms 10, other9. HLA compatibility among units alreadyeligible for transplant was 20 % and thetransplants performed were 5.The followingissues for related CB banking are stillunder discussion : time of storage, ownershipof CB, modalities for donation andtransfer of units to the unrelated CB bank;moreover it is mandatory to define a specificinformed consent and inclusion criteria(diseases and degree of consanguineity).P499CORD BLOOD “SELECTED” COLLECTIONIN β THALASSEMIA MAJORA. VITUCCI, A. PIETRAPERTOSA, M. CAPOCASALE, A. PALMA,N. TANNOIAChair of Hematology II – University of BariThe high levels of stem and ancestor cells,the low alloreactivity, the low incidence ofGVHD, the low infection of CMV, the fastavailability have pointed the indication ofusing of cord blood as an alternative or additionto bone marrow transplant therapyof many neoplastic haematologic, hereditaryhaematologic diseases. A collectionCenter of cord blood works in Chair of HematologyII of Bari and cooperates withMilan Cord Blood Bank. We developed anactivity of “selected” collection for β ThalassemiaMajor patients; we mean “selected”those collections realized for families whosemember is affected by β Thalassemia Major.We collect cord blood in risk couples forß Thalassemia to whom we have performedprenatal diagnosis at 10 th week of pregnancyby DNA analysis and resulting normalhomozygous or heterozygotes. Simultaneouslywe performed HLA early genomiccharacterization for valuating the hystocompatibility.When hystocompatibility isdetermined cord blood collection have beenplanned at birth c/o Gynaecolocic Clinic ofUniversity of Bari. Collection is performedwith a “closed system” method and afterwardscriopreservated in the Milan CordBlood Bank. To date about 30 colletions havebeen performed, 18 for β Thalassemia. 3patients have been successfully transplantedand are +29, +26 and +19 monthsrespectively. The developement and implementationof selected collection represents,to results of our operative unit, a model ofjob useful to therapy of genetically transmittedand onchoematologic diseases.P500INCREASED UMBILICAL CORD BLOODVOLUME RECOVERY USING ANEWDEVICEO. BELVEDERE, W. MALANGONE, C. FERUGLIO, L. DOROTEA,A. DONINI, G. DEL FRATE, P.G. SALA, A. DEGRASSIConsorzio Fenice, Dip. di Pat. e Med. Sper. eClin.,Dip. di Sci. Chir., Università di Udine; Lab. diAnal. Chim.-Clin., Osp.di Udine; Div. di Ostetricia,Osp. di S. Daniele del FriuliA major problem with the use of placental/umbilicalcord blood (UCB) forhematopoieticstem cells transplantation is thelimited amount of bloodthat can be obtainedfrom a single collection. In this study weevaluatedthe improvement of UCB volumerecovery using a new device. After bloodharvesting for routine testing (average of15ml), UCB was collected from each placenta

350 September 26-29, 1999 - Torino-Lingotto, Italyfollowing commonly used procedures. At theend of UCB flow by gravity, collection wascontinuedusing the device. Such devicecomprises a funnel shaped elementforplacenta support and a system that allowsan independent and adjustable pressureapplication to the maternal and fetalplacental surfaces. 38 UCB samples werecollected. The mean UCB volume collectedby gravitywas 46.7±24.1 ml (mean ± SD,range 8-134 ml). The mean UCB volumecollected using the device was 15.1±7.9ml(range 2-31 ml). The meantotal collectedvolume was 61.8±24.5 ml, (range 21-141.5ml). The average increase of blood volumeobtainedwith the device (volume collectedusing the device / volume collected bygravityfollowing conventional procedures)was 44.2±43.7% (range:4-71%). Theseresults show that UCB collection by gravity,ascommonly performed, results in asignificant amount of blood left in the placenta,that can be harvested by using thedescribed device. Furthermore, collectionyield could be increased by using the devicefromthe very beginning of the procedure.In conclusion, the use of the devicecould decrease the number of collectedunitsdiscarded because of an inadequatevolume and therefore increase thepercentageof UCB units suitable for clinicaluse.P501FUNCTIONAL CHARACTERIZATION OFHUMAN CORD BLOOD PROGENITORCELLS SURVIVING 5-FU TREATMENTF. F AGIOLI*, M. BERGER*, R. GHIGNONE*, A. BUSCA*,L. FAZIO°, F. SANAVIO^, W. PIACIBELLO^, M. AGLIETTA^,E. MADON** Department of Pediatrics – University of Turin.°Regina Margherita’s Hosp.–Transfusional Service.^Department of Biomedical Sciences and HumanOncology – University of TurinThe purification procedure described byBerardi for human adult bone marrow cellshas been applied. Berardi et al. used 5-fluorouracile (5-FU), Stem Cell Factor (SCF)and Interleukin-3 (IL-3) for the isolation ofhematopoietic stem cells of human adultbone marrow. In this progenitor cell purificationcommitted cells expressing the IL-3receptor are induced to proliferation andforced to a 5-FU dependent metabolicdeath, whereas very early and quiescentprogenitors were preserved from apoptosisby the presence of SCF. In our study100x10 6 mononuclear cord blood cells wereincubated for 1 week with SCF, IL-3±5-FU.5-FU treatment killed the most majority ofcommitted and mature cells as shown by:a) the decline in total cellularity (nearly 4logs); b) the abolishment of cell proliferation(from 16 to

37 th Congress of the Italian Society of Hematology351from different sources have not yet beenwidely studied. We therefore compared theultrastructural morphology of immunomagneticallyseparated CD34 + cells from 3normal bone marrow (BM) samples withcord blood (CB) (3 vaginal deliveries and 3caesarean sections) and 3 peripheral bloodstem cells (PBSC) samples. The early signsof myeloid commitment were identified usinga technique revealing endogenousmyelo-peroxidase (MPO) inside the endoplasmicreticulum (ER) and/or granules, andthe transmission electron microscopy (TEM.To determine the frequency of differentiatedmyeloid cells, the CD34 + populationwas divided into 5 groups, on the basis ofthe presence of MPO. Viability and apoptoticdeath were also investigated both by meansof TEM and a TUNEL technique. The TEMcell counts were summarised in this table:MPO Cells with Cells with Apoptotic Othernegative ER and/or >4 MPO+ cells cells(early) =4 MPO+ granulescells granulesCord Blood: 79.0% 6.8% 4.3% 2.6% 7.3%(Vaginal delivery)Cord Blood: 69.6% 6.4% 7.7% 13.9% 2.4%(Caesarean section)Bone Marrow 64.5% 4.6% 24.1% 2.8% 4.0%PBSC 93.0% 5.0% 1.6% 0.2% 0.2%The CD34 + cells from PBSC were morphologicallyvery homogeneous and almostlacking MPO activity: these ultrastructuralfeatures are generally considered typical ofimmature cells. On the other hand, the BMcells were heterogeneous, with the variousfeatures of myeloid differentiation beingwell represented. The ultrastructural characteristicsof CB were instead intermediate.There was no great difference in thepercentage of apoptotic cells among BM,CB from vaginal delivery and PBSC samples;in contrast, the percentage of cells in differentstages of apoptotic death was significantlyhigher in caesarean section CBcells. These observations confirm the phenotypicimmaturity of CB cells in comparisonwith BM, while the morphological immaturityof PBSC does not correlate withwell known clinical and functional data. Wealso suggest that caesarean section maybe associated with less cell viability thanvaginal delivery.P503INCREASED CONTENT OF CD34 + CD38 -HEMATOPOIETIC STEM CELLS IN THELAST COLLECTED UMBILICAL CORDBLOODO. BELVEDERE, C. FERUGLIO, W. MALANGONE, G. ASTORI,A. DONINI, A. MINISINI, L. DOROTEA, M. PITTINO,G. DEL FRATE, E. TONUTTI, P.G. SALA, A. DEGRASSIConsorzio Fenice, Dip. di Pat. e Med. Sper. e Clin.,Dip. diSci. Chir., Università di Udine; Lab. di Anal.Chim.-Clin., Osp. di Udine;Div. di Ostetricia,Osp. di S. Daniele del FriuliPlacental/umbilical cord blood (UCB) is asource ofhematopoietic stem cell for transplantation.In the present study weanalyzethe kinetics of nucleated cells (NC) andCD34 + cells outputand characterize differentCD34 + cell subpopulations obtainedduring a UCB collection. Sequential 15 mlUCB fractions were collected from 26 deliveredplacentas using a new device forUCB collection.NC density in each fractionwas evaluated using an automated cellcounterwhile the expression of CD34,CD38, CD117 and AC133 antigens wasassessedby flow cytometry (FACScan,Becton Dickinson, USA). No significant differencesin NC concentration were observedinsequential UCB fractions. A statisticallysignificant increase in CD34 + cells percentageand absolute number during the UCBcollection wasobserved, which results in a1.91±1.03-fold increase (mean ± SD) inthe percentage of CD34 + cells in the lastvs. first collected fraction. Furthermore,within theCD34 + cell population, the percentageof CD38 - cells (pluripotent hematopoieticstem cells) in the first fraction was3.24±1.39 % (mean ± SD) while in thelast fraction it raised up to34.43±22.62 %(11.15± 6.13-fold increase in the last comparedto the first fraction). Theco-expressionof CD117 and AC133 on theseCD34 + CD38 - cellsconfirmed their hematopoieticnature. These findings demonstratethat the last collectable UCB isrich inCD34 + CD38 - cells that are the most primitiveprogenitors capable of long termhematopoieticreconstitution. Therefore,the optimization andstandardization of thecollection procedures are required to obtainthemaximal UCB recovery from eachplacenta.Supported in part by the Consiglio Nazionaledelle Ricerche n.97.04090.CT04, the As-

352 September 26-29, 1999 - Torino-Lingotto, Italysociazione Italiana per la Ricerca sul Cancro(AIRC)and Fondazione CA.RI.FE.P504IMMUNO-HAEMATOLOGICEVALUATION IN THREE β THMAJOR CORD BLOOD STEMCELLS-TRANSPLANTED SUBJECTSA. VITUCCI, M. CAPOCASALE, A. PIETRAPERTOSA, N. TANNOIAChair Hematology II – University of BariThe immune and erithropoietic recoveryhas been evaluated in three β pediatric patientsaffected by β thalassemia major andtreated with stem cells transplantation fromcord blood and bone marrow in two cases,and one from cord blood. The distributionof the main three populations of circulatinglinphocytes did not show any difference inthe three patients; after two months fromtransplantation T linphocyte populationsCD2, CD3, CD7 represent 2/3-3/5 of theexaminated cells, while the remaining isrepresented from NK cells. After six monthsCD4/CD8 normalized. CD56/CD57 rate, indicatinga cronic antigenic stimulation onimmune system, was more than 1 for 6-9months in the patients treated with cordblood stem cells transplantation, afterwardsnegative in two of the three patients. Inthe patient treated with cord blood stemcells in the first two months CD45 RO ratewas greater than CD45 RA one, afterwardsCD45RA rate increased with a ratio CD45RA/CD45 RO of 2/1 - 3/1. In conclusion weobserved an early immune recovery in thepatients treated with cord blood stem cellstransplantation. About erithropoietic recoverythe Hb F levels resulted higher thanexpected and there was a great differencebetween circulating HbF and we measuredon globin synthesis. We hypothesize thattype of transplantation, donor/recipientgenotype, persistence of cellular clones Fcould be responsible of these results.Erithroipoietic recovery, for our observations,happens in times and phisiologicalmodalities and the HbF levels on globinsinthesis represents a feasible parameterfor evaluation of this process.P505ALLOGENEIC STEM CELLTRANSPLANTATION AS A TREATMENTFOR PATIENTS WITH ACUTEMYELOBALSTIC LEUKEMIA.A SINGLE CENTER EXPERIENCEM. FALDA*, F. LOCATELLI*, F. MARMONT*, A.M. DALL’OMO^,E. LOVISONE*, C. DE FALCO*, S. D’ARDÌA, E. AUDISIO,E. GALLO*Centro Trapianti Midollo-Ematologia Osp.-Torino;^Immunologia dei Trapianti-Università di TorinoBetween 1991 and 1998 44 patients (pts.)with acute myeloblastic leukemia weretransplanted in our Center, 27 in RC1, 9 in>RC1 and 8 with resistant disease. Onepatient received a syngenic transplant, 41were transplanted from an HLA identicalsibling and 2 from an HLA matched unrelated(MUD) donor. The source of stem cellsconsisted in peripheral blood derived stemcells (PBSC) in 16 pts. with advanced diseaseor poor general conditions, bone marrowcells (BM) in 28 pts. In 30 pts. theconditioning regimen was a standard CY-TBI, Bu-CY4 in the remaining. As graft versushost disease (GvHD) prophylaxis, CyA1 mg/Kg + MTX short course in pts. withidentical sibling and CyA 3 mg/kg + MTXstandard dose in pts. with a MUD were administered.Granulocytic engraftment wasobtained in all pts, and significantly earlierin PBSC pts., 13.71 vs 17.46 days toneutrophiles > 500 (p=0.003). Plateletsaplasia also was shorter in PBSC pts., 11.4vs 18.3 days to platelets > 30.000(p=0.02). There is a correspondence betweenaplasia duration and sterile roomhospitalisation (25 vs 44 days, p=0.01). Thesame is not true if days of fever are considered(9.4 vs 9.2). A >grade II acute GvHDoccurred in 47.6% of pts., > grade III in13% of pts. Among the 38 pts. survivingmore than 100 days, 84.2% developed achronic GvHD, extended in 47.4%. Overallsurvival (OS) is 58% at 59 months, eventfree survival (EFS) is 53.9% and diseasefree survival (DFS) 80.9%. Transplant relatedmortality (TRM) is 16.4%. No differencesin OS, DFS, TRM were detected inBM vs PBSC transplants. Moreover, thereare no differences in the two pts. groups,both in acute and chronic GvHD frequency.

37 th Congress of the Italian Society of Hematology353P506CLINICAL OUTCOME AND MINIMALRESIDUAL DISEASE ASSESSMENT BYCYTOGENETIC AND MOLECULARANALYSIS SHOWS THAT ACUTEMYELOGENOUS LEUKEMIA PATIENTSWITH INVERSION OF CHROMOSOME16 ARE CURABLEE. OTTAVIANI, G. MARTINELLI, N. TESTONI, G. VISANI,C. TERRAGNA, G. SAGLIO 1 , V. MONTEFUSCO, A. DE VIVO,F. BONIFAZI, M. AMABILE, S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli”, University of Bologna; 1 Department ofBiomedical Sciences and HumanOncology,University of TurinThe aims of this study were: 1) to detectexpression of a hybrid CBFb-MYH11 transcriptat diagnosis time and after inductionand consolidation chemotherapy in acutemyelogenous leukemia (AML) patients withpericentric inversion of chromosome 16[inv(16)(p13q22)]; 2) to evaluate, in patientswho have achieved complete hematologicaland karyotypic remission (CR), theexistence of minimal residual disease (MRD)in peripheral blood stem cells or in bonemarrow cells collected for autologous transplantationprocedures; 3) to determine clinicaloutcome and to monitor patients atmolecular level during clinical follow-up.MRD of 16 out of 19 consecutive adult patientswith AML and inv(16)(p13;q22) ort(16;16)(p13;q22) who entered CR wasmonitored by CBFβ-MYH11 RT-PCR in theirbone marrow during postremission therapyafter transplantation procedures [bonemarrow, autologous bone marrow transplantation,ABMT with peripheral stem cellcollection (PBSC-ABMT)]. At diagnosis, afteramplification, chimeric cDNAs were detectedin all 19 patients. Three elderly patients(18%) (median age 71 years; range66-72) were only treated with non-ablativeor reduced-dosage chemotherapy and diedof AML progression. 16 patients (84%)(median age 45 yeras; range 26-60)achieved CR after ablative induction andconsolidation chemotherapy. 15 patientsalso gained molecular remission, while oneof these relapsed with clonal evolution ofdisease at three months from diagnosis anddied of leukemia. Of the remaining 14(73%) (median overall survival 34 mths;range 4-65) in first CR, 13 were furtherconsolidated as follows: 3 by BMT from HLAidentical sibling, and 10 by ABMT, in 3 caseswith peripheral blood stem cells collectedafter consolidation (ABMT-PBSC) and in theremaining 7 with unpurged bone marrowstem cells (BM-ABMT). 12 patients (63%)remained in 1st CR and in complete karyotypicand molecular remission (medianvalue of disease free survival 30 mths;range 3-45). Prediction of re-emerging MRDwas possible in one case. All the availablePBSC and bone marrow collections evidencedno MRD. Our results show that themajority of our patients achieved a molecularremission after induction chemotherapy.This study was supported by the Asso-ciazioneItaliana per la Ricerca sul Cancro (A.I.R.C.), bythe Italian C.N.R. and A.C.R.O. target projectno. 98.00526.CT04 and by A.I.L. “30 Ore per laVita” grant.P507MOLECULAR REMISSION IN PCRPOSITIVE ACUTE MYELOID LEUKEMIAPATIENTS WITH INV(16): ROLE OFBONE MARROW TRANSPLANTATIONPROCEDURESE. OTTAVIANI, G. MARTINELLI, N. TESTONI, G. VISANI,C. TERRAGNA, M. AMABILE, R. PASTANO, V. MONTEFUSCO,P.P. PICCALUGA, A. DE VIVO, S. TURAInstitute of Hematology and Medical Oncology“Seràgnoli”, University of BolognaPericentric inversion of chromosome 16[inv(16)(p13q22)] and the relatedt(16;16)(p13;q22), resulting in a chimericfusion of the CBFb and MYH11 genes, areseen in a subset of acute myeloid leukemia(AML) patients. The molecular marker isdetectable by reverse transcription-polymerasechain reaction assay (RT-PCR) onRNA at the time of diagnosis, and could beparticularly useful for monitoring MRD. Severalauthors have reported favorable clinicaloutcomes despite persistence of CBFβ/MYH11 transcript detected by RT-PCR. Wereviewed our series of 19 AML patients withinv(16) translocation. At diagnosis, chimericcDNAs were detected after amplification.Three patients were only treated with nonablativechemotherapy due to their age. Theremaining 16 patients achieved CCR afterablative induction and consolidation chemotherapy.Fifteen of these patients

354 September 26-29, 1999 - Torino-Lingotto, Italyachieved PCR negativity at the end of consolidationchemotherapy. All 15 patientswho achieved PCR negativity are currentlyalive in first (12 cases) or second (3 cases)complete cytogenetic remission (CCR) (medianoverall survival 34 mths; range 3-90),confirming that AML with inv(16) is curableby ablative therapy in a high percentage ofcases. Of the fifteen patients who achievedPCR negativity, 11 were further consolidatedwith BMT as follows: three received allogeneicBMT from an HLA identical sibling, and8 underwent autologous BMT (ABMT) withPBSC. All 3 BMT patients achieved PCRnegativity. Among the 8 patients who receivedABMT, three relapsed at 14, 27 and28 mths from diagnosis and after 6, 20 and22 mths from ABMT. All three patients receivedreinduction chemotherapy, obtaininga second CCR. All the available bonemarrow collections in the other patientswere persistently PCR negative. We confirmthat the majority of our patients treatedwith ablative chemotherapy obtained CCR,most of them with PCR negativity.This study was supported by A.I.R.C., by theItalian C.N.R. target project no. 98.00526.CT04,by “A.I.L. 30 Ore per la Vita” target project andby M.U.R.S.T. 40% grant.P508ALLOGENEIC STEM CELLTRANSPLANTATION INMYELODISPLASTIC SYNDROMES.A SINGLE CENTER EXPERIENCEF. L OCATELLI*, M. FALDA*, F. MARMONT*, B. ALLIONE*,E. LOVISONE*, G. COSTA*, S. D’ARDÌA*, E. AUDISIO*,E. SORMANO^, E. GALLO**Centro Trapianti Midollo, Ematologia Osp.-Torino;^Banca del Sangue-TorinoAllogeneic transplantation in myelodisplasticsyndromes (MDS) is a matter ofdebate and controversy since many years.Data from international registries are consistentwith a high transplant related mortality(TRM). We report the outcome of 17MDS patients (pts.) transplanted between1995 and 1998 in our Center. 5 pts. receivedbone marrow cells (BM), 11 weretransplanted with peripheral blood derivedstem cells (PBSC) and 1 pt. with BM cellsfrom a matched unrelated donor (MUD).Conditioning regimen consisted in Thiotepa15-CY150in pts. receiving PBSC, standardCY-TBI in the remaining. Graft vs host(GvHD) prophylaxis was CyA 3 mg/Kg +MTX short course. Granulocytic engraftment(Neutrophiles > 500) was obtained in allpts., with a median of 32.4 days in BM groupvs 13.5 days in PBSC group (p=0.008).Platelets aplasia also was shorter in PBSCpts., 10.6 vs 23.5 days to platelets > 30.000(p=0.02). Contrasting with published datain the literature, TRM was 20.14%, not sodifferent from what is reported in otheronco-hematologic diseases. Disease freesurvival (DFS) is 55,3% at 15 months, overallsurvival (OS) 30.88% at over 29 monthsand event free survival (EFS) 42.35% at46 months after transplant. Our data, evenif from a small cohort of pts., are consistentwith a sound indication to transplantMDS pts. when a donor is available and theprognosis could be improved if PBSC areused.P509SUCCESSFUL USE OF CD34+ ENRICHEDDONOR LYMPHOCYTE INFUSION IN ACASE OF HODGKIN’S DISEASERELAPSING AFTER ALLOGENEIC BMTG. DE ROSA, L. PEZZULLO, A. LUCANIA, C. SELLERI,N. SCARPATO, B. ROTOLIDepartments of Hematology and of Immunohematology,Federico II University Medical School,Naples, ItalyA 25 year old man affected by Hodgkin’sdisease (HD), stage IV B, mixed cellularity,received bone marrow transplant (BMT)from his HLA identical sister because of refractorydisease. Conditioning regimen wasBuCy; MNC infused were 0.5x10 8 /Kg. Onday +20 the patient developed grade IaGvHD, and hematological recovery wasretarded. At six months from BMT, TCshowed enlargement of mediastinal nodesand Ga 67 scan showed grade II uptake. Asalvage chemotherapy was started (C-MOPP, 3 courses). Because of persistenceof XX mitoses in the bone marrow, we decidedto start adoptive immunotherapy bydonor lymphocyte infusions (DLI). A secondinfusion was enriched with CD 34+ cellsby donor mobilization with rhG-CSF (MNCinfused 1.6 x 10 8 / Kg). Three weeks afterthe second DLI, the patient developed gradeIV aGvHD with cutaneous and hepatic in-

37 th Congress of the Italian Society of Hematology355volvement, successfully treated with CSAand steroid. Cerebral toxoplasmosis developedtwo months later, requiring prolongedantibiotic treatment. CT and gallium scanschecked every three months showed agradual and almost complete disappareanceof the mediastinal nodes. In April 1999, +22months from DLI, the patient has chronicGvHD involving skin and liver, with no evidenceof HD. We may surmise that DLI produced,concomitantly with GvHD, a “graftversus lymphoma” effect leading to lymphomaeradication. DLI efficacy after BMTis well documented in CML relapsed patients,while its use in acute leukemia relapseis still controversial. Reports of efficacyin lymphoma relapse, in particular forHD, remain anecdotal.P510ELIMINATION OF TUMOR BUTHYPERACUTE GVHD AFTERALLOGENEIC CELL THERAPY IN APATIENT WITH METASTATIC BREASTCANCER RESISTANT TO SEQUENTIALAUTOLOGOUS AND MINI-ALLOGENEICTRANSPLANTThere is growing interest in the use ofallogeneic cell therapy for treatment of solidtumors. We report the case of a 28-y-oldwoman with infiltrating ductal breast cancerdiagnosed in 1991 and treated withsurgery, CMF and radiotherapy. In 1997,cancer recurred in the other breast and thepatient again underwent surgery followedby radiotherapy, but in February 1998, thedisease progressed with metastatic spreadto bones, liver, nodes, pleura and bonemarrow. This latter was totally replaced bycancer cells on microscopic examination.The patients was started on a program ofsequential high-dose chemotherapy, withcyclophosphamide 7 g/m 2 , vincristine 1,4mg/m 2 and methotrexate 7 gr/m 2 ,epirubicin 150 mg/mq, followed by selected(CellPro) CD34+ cell autograft. Myeloablationwas thiotepa 600 mg/m 2 andmelphalan 140 mg/m 2 . Despite an apparentresponse, disease persisted on BM biopsy.The patient then underwent a G-CSFprimedPBSC mini-allograft from her singlelocusmismatched sibling. Conditioning wasfludarabine 6 x 30 mg/m 2 , and thiotepa 10mg/Kg. GVHD prophylaxis was cyclosporineand prednisone. As graft she received16x10 6 /kg CD34+ cells and 2x10 8 /Kg CD3+cells, with full molecular donor engraftment.With progression of bone marrow metastaticdisease, but without acute GVHD, on day +36 the patient received a single DLI (10 5 /kg CD3+ cells). On day +52 she developedskin, liver and gut GVHD involvement,that was treated with cyclosporine and prednisoneand partially remitted. A new bonemarrow biopsy at day 114 showed completeremission with absence of metastatic celleven after immunocytochemical stains.However, GVHD progressed and the patientdied on day 150. The case presented hereshows how resistant breast cancer cells mayrespond to alloimmune lymphocytes,though dissection of GVHD and graft-vstumoris mandatory for clinical application.F. FABBIANO, R. SCIMÈ, A. SANTORO, C. PATTI,A.M. CAVALLARO, S. CANNELLA, I. MAJOLINODivisione di Ematologia e Unità Trapianti di MidolloOsseo, Azienda Ospedaliera V. Cervello, Palermo