th - Minnesota CLE

P2012The Midwest Intellectual Property Instituteminnesota Continuing Legal EducationthebookIP10th editionINSTRUCTIONSSEARCHeditors | Stephen R. Baird | David J.F. Gross | Calvin L. Litsey

InstructionsThere are two ways to navigate through theIP Book quickly and easily. They are as follows:Bookmarks & LinksAlong the left-hand side of the screenin the book, you will see a list of “bookmarks.”These bookmarks provide quicklinks to each chapter, as well as tosections within each chapter. Click onthe bookmarks to navigate quickly andeasily through the book.SearchingThe book also is fully searchable. Tosearch for a word or phrase, chooseEDIT from the main menu bar. Fromthe subsequent menu, choose eitherSEARCH or FIND, depending onwhich version of Adobe® Reader®you are using. The SEARCH (or FIND)window should appear and you mayproceed with your search. In addition,a SEARCH” button has been providedfor you on the first page of the book.It’s simply another way to open theSEARCH (or FIND) window.SEARCH

P2012The Midwest Intellectual Property Instituteminnesota Continuing Legal EducationthebookIP10th editioneditors | Stephen R. Baird | David J.F. Gross | Calvin L. Litsey

Minnesota CLE’s Copyright PolicyMinnesota Continuing Legal Education wants practitioners to make the best use of thesewritten materials but must also protect its copyright. If you wish to copy and use our CLEmaterials, you must first obtain permission from Minnesota CLE. Call us at 800-759-8840or 651-227-8266 for more information. If you have any questions about our policy or wantpermission to make copies, do not hesitate to contact Minnesota CLE.All authorized copies must reflect Minnesota CLE’s notice of copyright.MINNESOTA CLE is Self-SupportingA not for profit 501(c)3 corporation established by the Minnesota State Bar Association, Minnesota CLEis entirely self-supporting. It receives no subsidy from State Bar dues or from any other source. The onlysource of support is revenue from enrollment fees that registrants pay to attend Minnesota CLE programsand from amounts paid for Minnesota CLE books, supplements and tapes.© Copyright 2012MINNESOTA CONTINUING LEGAL EDUCATION, INC.A subsidiary of the MSBASt. Paul, MinnesotaALL RIGHTS RESERVEDMinnesota Continuing Legal Education's publications and programs are intended to provide current andaccurate information about the subject matter covered and are designed to help attorneys maintain theirprofessional competence. Publications are distributed and oral programs presented with the understandingthat Minnesota CLE does not render any legal, accounting or other professional advice. Attorneys usingMinnesota CLE publications or orally conveyed information in dealing with a specific client's or other legalmatter should also research original and fully quoted sources of authority.

Minnesota Continuing Legal EducationBoard Members2012 – 2013Hildy BowbeerSaint PaulAngela M. ChristyMinneapolisDyan J. EbertSaint CloudRobert F. EngerMSBA PresidentHibbingKevin D. HofmanMinneapolisMichael J. WahligChairpersonMinneapolisThaddeus R. LightfootMinneapolisNelson PeraltaMinneapolisProfessorJ. David PrinceSaint PaulSteven L. ReyeltsDuluthWilliam F. StuteMinneapolisSusan M. HoldenMinneapolisJason C. KohlmeyerMankatoFrank V. HarrisDirectorSaint PaulProfessorSteven R. SwansonSaint PaulCindy K. TelstadWinonaThe Minnesota CLE Board consists of practicing attorneys from throughout Minnesota as well as oneprofessor representing each Minnesota law school. This provides representation of the interest and effortsof the bench, practicing bar and academic community.Minnesota Continuing Legal Education is a non-profit division of the Minnesota State Bar Association. MinnesotaCLE receives no subsidy from Bar dues or any other source. The only source of support is revenuefrom program tuition and publication sales. The basic ingredient in Minnesota CLE’s success is the involvementof the very best Minnesota lawyers from the practicing bar, bench and academic community. Thesededicated individuals have given generously of their time and talent to make Minnesota CLE courses andits publications what they are today.

acknowledgementsWelcome to the Tenth Edition of The IP Book, a collection of articlespublished in conjunction with the 2012 Midwest Intellectual PropertyInstitute. The Institute is presented by Minnesota CLE, a subsidiaryorganization of the Minnesota State Bar Association.These chapters focus on important developments relating topatents, trademarks, copyrights, and trade secrets. Twenty-five of ourcolleagues in intellectual property practice have spent many hourswriting and editing their contributions to this book. We are extremelygrateful for their willingness to share their time and expertise.We’d also like to thank everyone at Minnesota CLE who worked onthis important and time-consuming project. We are proud to associateourselves with such an excellent team of people.As we continue to improve The IP Book each year, we urge you toprovide any comments or suggestions. Please provide us with anyfeedback, as well as recommendations for future chapters, by e-mail toMegan Manley at mmanley@minncle.org, or call her at 1-800-759-8840.Enjoy.Stephen R. BairdDavid J.F. GrossCalvin L. Litseyi

editorsStephen R. BairdMr. Baird joined Winthrop & Weinstine, PA, as a shareholder in 2003 with over a decade ofsignificant experience in the intellectual property arena. He heads the intellectual propertyand trademark and brand management practice groups, and his practice emphasizestrademark law, related unfair competition law and copyright law. Mr. Baird counsels clientson trademark usage and clearance, branding strategies, domestic and worldwide portfoliomanagement, litigation and enforcement, Internet domain name disputes, licensing andprosecution. He also handles trademark litigation matters in federal district court and inproceedings before the United States Patent & Trademark Office. In addition, Mr. Bairdmanages both large and small U.S. and international trademark portfolios for a wide variety ofcompanies. Prior to his experience in law firms, he was the judicial law clerk to Judge WilsonCowen, Senior Circuit Judge for the United States Court of Appeals for the Federal Circuit.David J.F. GrossMr. Gross is a trial lawyer and partner at Faegre Baker Daniels LLP. In 2007, his winning trialrecord led the American Lawyer to name him one of the top 50 litigators in the United Statesunder the age of 45. In 2008, the National Law Journal recognized Mr. Gross’s completedefense jury verdict in a patent infringement jury trial in Orange County, California, as oneof the top 10 trial victories in the United States. The Minnesota Lawyer has thrice namedhim an “Attorney of the Year” based on trial victories in 2003, 2008 and 2011, and Mr. Grossis one of only a handful of lawyers who has been named to Minnesota Lawyer’s “Circle ofExcellence” based on his winning trial record. He has been recognized as a top intellectualproperty trial lawyer by Best Lawyers in America, Benchmark Litigators, Chambers USA, IPLaw & Business and Super Lawyers. Mr. Gross has also been named by Intellectual AssetManagement (IAM) as one of the world’s leading patent litigators and one of the world’sleading patent practitioners.Calvin L. LitseyMr. Litsey is the head of the Faegre Baker Daniels’ worldwide intellectual property groupand one of its lead litigators for complex intellectual property cases. He has successfullyhandled patent, trade secret, copyright, trademark, advertising, media and entertainmentcases throughout the United States for a wide variety of companies and individuals, includingSeagate Technology, Thomson Reuters, Wyeth, Target, Pella Windows, Warner Bros.,Columbia Pictures, ASCAP, Prince, Lenny Kravitz and others. Mr. Litsey has been consistentlyrecognized as a leading intellectual property litigator in The Best Lawyers in America. He is along-standing editor of The IP Book, and has taught advanced intellectual property litigationseminars as an adjunct professor at the University of Minnesota Law School.iii

authorsSharon D. ArmstrongMs. Armstrong is an associate in the intellectual property practice group at Winthrop &Weinstine. Her practice is focused on the prosecution and enforcement of trademarks andcopyrights, and Internet/domain name enforcement and acquisition. She assists clients innearly all facets of trademark prosecution and enforcement, both foreign and domestic,administrative proceedings before the Trademark Trial and Appeal Board, and intellectualproperty transactions including due diligence, licensing, trademark acquisitions, settlement,consent and coexistence agreements, and other transfers of rights. Ms. Armstrong alsoprovides assistance with intellectual property litigation and arbitration. Prior to joiningWinthrop & Weinstine, Ms. Armstrong was an associate with Greenberg Traurig in LasVegas, Nevada, a law clerk with the National Endowment for the Humanities, and an artsadministrator at the Los Angeles Opera.Larrin BergmanMr. Bergman is a shareholder at Kinney & Lange PA. He is a native of Jud, North Dakota.He received a Bachelor of Science degree in Agricultural and Biosystems Engineering fromNorth Dakota State University, and earned his J.D. from the University of North Dakota(with distinction). Prior to attending law school, Mr. Bergman worked as design engineerfor Beamco in Oslo, Minnesota, where he developed parts for ATVs, personal watercraft,and snowmobiles. While in law school, Mr. Bergman won best brief in the moot courtcompetition. He also spent a semester studying international comparative law at theUniversity of Oslo in Oslo, Norway.Felicia J. BoydMs. Boyd is a partner with Barnes & Thornburg LLP in the firm’s Minneapolis office, whereshe is a member of the firm’s intellectual property department. She focuses her practice oncomplex intellectual property litigation and has led plaintiff and defense litigation on a largevariety of claims related to patents, copyrights, trademarks, and trade dress. Prior to joiningBarnes & Thornburg, Ms. Boyd practiced with Faegre & Benson LLP in Minneapolis. Herlitigation experience spans several industries, including medical devices, software, music,pharmaceuticals, and manufactured goods. Her victories on behalf of clients have includedpreliminary injunction motions, summary judgment motions, favorable settlements, and juryverdicts at trial. She is a registered patent attorney with a bachelor’s degree in chemistryand has represented clients in contested proceedings before the U.S. Patent and TrademarkOffice (USPTO). Ms. Boyd received her B.A. cum laude from St. Olaf College in 1984. Sheearned her J.D. magna cum laude in 1987 from the University of Minnesota Law School.iv

authorsKerry L. BundyMs. Bundy is a partner in Faegre Baker Daniels’ litigation and advocacy group. Sheconcentrates her practice on trade secret litigation and counseling, franchise and distributionlitigation, non-compete cases, international arbitration, and complex commercial litigation.She has represented manufacturers, franchisors, distributors, technology companies, and avariety of other domestic and foreign businesses in state and federal proceedings, as wellas national and international arbitrations. She is qualified and has served as a mediationneutral. Ms. Bundy is co-leader of the firm’s trade secret practice.Julie R. DaultonMs. Daulton is a shareholder in the Minneapolis office of Merchant & Gould. Her practiceemphasizes intellectual property law with a focus on patents. Ms. Daulton’s patentpractice includes portfolio development and strategy in mechanical and electro-mechanicaltechnologies, client counseling, and opinion matters. Her depth of expertise includes writingand prosecuting hundreds of patent applications and conducting invalidity investigations,infringement studies, non-infringement design-around counseling, and competitive patentportfolio analyses. She has prosecuted inter-partes and ex-parte reexaminations andreissues. Ms. Daulton also has coordinated foreign patent oppositions on behalf of thepatent holder and the opposer.Filip De CorteDr. De Corte is currently Chief IP Counsel Europe at Cargill. His practice covers patents,trademarks and intellectual property contracts. Before joining Cargill in 2008, he worked inthe Johnson & Johnson patent department, working in Beerse with Janssen Pharmaceutica(1991-2004), New Brunswick (2004-2007), Brussels (2007-2008). Filip De Corte holds a Ph.D.in organic chemistry. He is a qualified European Patent Attorney and passed the U.S. patentbar exam. He also has an MBA of the Vlerick School of Management. Dr. De Corte taughtpatent law in Antwerp under the auspices of CEIPI (Université de Strasbourg) as well as atthe University of Leuven in the IPR management course. He is council member for Belgiumin the European Patent Institute and he has recently been re-appointed as the chair of theEuropean Practice Committee of the IPO Association.v

authorsJohn A. DragsethMr. Dragseth is a principal of Fish & Richardson, and has been named one of the top 50intellectual property attorneys in the country under the age of 45. His practice centers oncomplex legal analysis and writing – in federal appeals, patent prosecution, reexamination,pre-suit and due diligence investigations, and patent opinions. His prosecution work centerson cloud computing, mobile computing, software, medical devices, and mechanicaltechnologies (including HVAC). Mr. Dragseth has led the briefing on more than 30 appealsto the U.S. Supreme Court and U.S. Court of Appeals for the Federal Circuit, where hewas previously a law clerk to the Honorable Raymond C. Clevenger III. He has extensiveexperience in taking over cases on appeal and framing them for the Federal Circuit, whileworking closely with trial counsel. He also enters cases frequently as a “fixer” -- helpingwith tough and important issues. (The similarities with George Clooney’s “Michael Clayton”character end there.) Mr. Dragseth writes and lectures frequently on a variety of patentlaw topics. He is also an adjunct professor teaching intellectual property litigation at theUniversity of St. Thomas Law School, and has authored case books on patent law andintellectual property litigation (very exciting reads). He was raised on a small grain and sugarbeet farm in northern Minnesota.Erin O. DunganMs. Dungan is an associate based in Briggs & Morgan’s Minneapolis office. She is amember of the intellectual property section and focuses her practice principally in theareas of intellectual property litigation and enforcement, complex commercial disputes,and franchising issues. Ms. Dungan is admitted to practice in state and federal courts inMinnesota and California, as well as before the U.S. Patent and Trademark Office. Shereceived her B.S. in biomedical engineering from Northwestern University and her M.S.E.in biomechanical engineering from Stanford University. She received her law degree fromSanta Clara University School of Law, where she was the articles editor for the Santa ClaraLaw Review and served as a judicial extern for the Honorable Jeremy Fogel, U.S. DistrictCourt for the Northern District of California. Ms. Dungan practiced with two national lawfirms before joining Briggs in 2010.vi

authorsDavid HannaMr. Hanna is a registered patent agent with the USPTO, a law clerk with Patterson ThuenteIP and a volunteer patent researcher for the University of Minnesota, Office of TechnologyCommercialization. In his academic capacity, he has received numerous awards andscholarships for his research in the areas of gene manipulation, protein purification andprenylation, enzyme modification, isoprene synthesis, and Indole Series compoundsynthesis. Before joining Patterson Thuente IP, Mr. Hanna spent one year as a law clerkat a boutique intellectual property law firm, drafting biochemical and mechanical devicepatent applications, both domestic and non-U.S., as well as assisting with infringementand invalidity opinions.Randall A. HillsonMr. Hillson’s present practice centers around coordinating client patent portfolios withbusiness objectives. He has a Ph.D. in Chemistry, and has been writing and prosecutingpatents since 1982 in diverse technical areas including biodegradable polymers, polymersfor coated abrasives and adhesives, magnetic recording materials, ceramics, metallurgy,coal processing, food processing, waste water clean-up, air pollution control, medicaltreatments, medical devices, chemical processes, air filters, fluid filters, engines, optics,conveyor systems, electrochemical processes, and photographic composites. He hasextensive experience in the litigation of patents in both the chemical and mechanicalarts. In October 2003, Mr. Hillson was profiled in IP Law & Business, as one of 10 patentattorneys identified in that publication’s first Patent Hall of Fame. He has also achieved anAV peer review rating by Martindale-Hubbell. Mr. Hillson’s practice areas include chemicaland mechanical patent prosecution and general practice in copyright and trademark law,and intellectual property litigation.vii

authorsRandall E. KahnkeMr. Kahnke is a partner at Faegre Baker Daniels and focuses his practice on complexcommercial litigation and intellectual property litigation. He has been the lead trial attorneyon cases from New York to California and touching three continents. He has extensiveconsulting, pretrial, and trial experience with complex commercial and intellectual propertydisputes. He is a frequent lecturer on issues related to complex business disputes andintellectual property litigation, and he is the past group head of the firm’s business litigationpractice. Mr. Kahnke is a member of the Federal Practice Committee of the United StatesDistrict Court for the District of Minnesota. He is the past president and a member of theboard of directors of the Minnesota Chapter of the Federal Bar Association, a former federallaw clerk, and he has been recognized as a leading litigator in Chambers USA, SuperLawyers,and Best Lawyers in America.Michael M. LafeberMr. Lafeber is a shareholder in the firm of Briggs and Morgan, P.A. He is vice-chair of theintellectual property section and concentrates his practice in intellectual property litigation,including trademark, patent and copyright disputes, cyber law, licensing disputes, and unfairand deceptive business practice claims. Mr. Lafeber is admitted to practice in Minnesota, theU.S. District Court for Minnesota, U.S. District Court for the Western District of Wisconsin,U.S. District Court for the Eastern District of Wisconsin, the U.S. Supreme Court, and theFederal Circuit Court of Appeals. Currently, he serves as a co-chair of the American BarAssociation’s Intellectual Property Roundtable Committee. He is a past member of the boardof directors for the Minnesota Defense Lawyers Association and past chairperson of theMinnesota Defense Lawyers Association New Lawyers Committee. He is also a formerchair of the Defense Research Institute’s Young Lawyers Corporate Counsel Committee.Mr. Lafeber obtained his undergraduate degree in government from St. John’s Universityin Collegeville, Minnesota. He obtained his law degree cum laude from the University ofMinnesota, where he was director of the Civil Rights Moot Court. He served as law clerkto the Honorable Ann D. Montgomery, then U.S. Magistrate Judge, District of Minnesota(currently federal district court judge), and the Honorable Gary Larson, Hennepin Countydistrict court judge. Mr. Lafeber joined Briggs in 2002.viii

authorsAri B. LukoffMr. Lukoff is an associate in Faegre Baker Daniels’ intellectual property group. He focusesprimarily on patent litigation and other intellectual property disputes. After completing hisundergraduate education in chemical engineering, Mr. Lukoff acquired broad technicalexperience working for a packaging company that supplied the medical device andpharmaceutical industries. During law school he clerked for a civil litigation firm and servedas a judicial extern for Judge Diane S. Sykes of the United States Court of Appeals for theSeventh Circuit.Catlan M. McCurdyMs. McCurdy is an associate at Winthrop & Weinstine PA. She focuses her practice on theprosecution and enforcement of trademarks and copyrights in a range of industries, includingnonprofits, technology, restaurant services and fashion. Ms. McCurdy regularly advises inrelation to false advertising and unfair competition claims, the transfer of intellectual propertyassets, and intellectual property agreements. Especially in the fashion industry, She advisesher clients on the placement of trademarks on clothing labels, hangtags, and websites. Shealso provides valuable guidance relating to copyright protection for clothing designs andonline retail services. In addition, she works with clients to secure brand protection for theirtrademarks and brand identity. Prior to attending law school, Ms. McCurdy completed herBachelors of English in the Honors English program at the George Washington University.While in law school, she gained experience as a law clerk at a local law firm and as a researchassistant at the University of Minnesota Law School.David MerrittMr. Merritt is an associate in Faegre Baker Daniels’ intellectual property litigation practicewith a particular focus on trademark, copyright and patent litigation. He is a graduate ofthe University of Virginia School of Law.ix

authorsAaron A. MyersMr. Myers is of counsel to Barnes & Thornburg LLP’s Minneapolis office, where he practicesin the firm’s litigation and intellectual property departments. Mr. Myers has representedclients nationwide in intellectual property, patent, copyright, trade secret and generalcommercial litigation. He has also served as outside general counsel to companies onintellectual property concerns and business matters, and he has experience representingindividuals and companies within the Twin Cities’ thriving medical device industry. Mr.Myers has represented and counseled individuals and companies on intellectual propertymatters involving a wide-range of industries, including medical device, agribusiness,manufacturing, and many other segments. His intellectual property background rangesfrom the familiar to the high-tech, covering everything from fishing lures to interventionalcardiology procedures. His litigation experience includes fuel-injected snowmobile engines,high-pressure liquid extraction of soybeans, embolic protection for medical procedures,pharmaceuticals, computer technologies, adjustable dumbbells, electronic traffic-controltechnology, pontoon boat innovations, adjustable waistbands, industrial mining software,and other technologies. Before joining Barnes & Thornburg, Mr. Myers was a foundingpartner of Myers, Boebel & MacLeod LLP, a Minneapolis law firm focusing on intellectualproperty, commercial litigation, and providing pro bono legal counsel to local artists andactivists. Mr. Myers is admitted to practice law in the state of Minnesota and before theU.S. District Court for the District of Minnesota, in addition to having appeared in numerousother jurisdictions pro hac vice.Brad D. PedersenMr. Pedersen is a partner at Patterson Thuente Christensen Pedersen PA, and concentrateshis practice in the areas of high-technology, computer, software and medical device patentprosecution strategy, licensing and litigation. Mr. Pedersen provides clients with practicaland pragmatic advice on the development, management and enforcement of intellectualproperty portfolios, based on his wide range of experiences. As an inventor, entrepreneurand former in-house counsel, he has a real-world foundation from which to create effectiveintellectual property portfolios and strategies. Serving both as litigation counsel and an expertwitness, Mr. Pedersen has extensive trial experience, in addition to significant experience inpatent prosecution and transactional work. He has also successfully represented companiesin inter partes reexaminations and interference proceedings at the United States Patent &Trademark Office (USPTO). He is a recognized author on issues related to patent reform andis one of the more knowledgeable intellectual property attorneys in the U.S. on the subject.x

authorsCatherine A. SchultzMs. Shultz is an associate at Kinney & Lange, PA. Her practice includes all aspects oftrademark and patent law, including prosecution and litigation. She is a graduate of NotreDame Law School and earned a Bachelor’s of Civil Engineering from the University ofMinnesota.Christopher R. SmithMr. Smith is a partner at Lindquist & Vennum PLLP. As an intellectual property attorney, heapplies his experience and skill in a smart and efficient manner to help businesses create,protect, and enforce their intellectual property rights. With federal trial experience, hehandles litigation and disputes involving nearly all areas of intellectual property and relatedmatters, including patent infringement, trademark infringement, copyright infringement,trade secret misappropriation, right to publicity and defamation, false advertising and unfaircompetition, confidentiality and nondisclosure agreements, and Internet domain names.Known for his creative and practical approach, Mr. Smith has achieved exceptional resultsfor his clients in state and federal courts across the country.Lauren W. SteinhaeuserMs. Steinhaeuser is a member of Faegre Baker Daniels’ intellectual property group, focusingprimarily on litigation. She has been involved in cases throughout the United States forclients including Multi-State Lottery Association, 3M Company, Coloplast and SeagateTechnology. Prior to joining Faegre Baker Daniels, Ms. Steinhaeuser served as Editor inChief of the Wisconsin Law Review and interned for Chief Justice Shirley S. Abrahamsonof the Wisconsin Supreme Court. She received her J.D., cum laude, from the Universityof Wisconsin Law School in 2011, and she also holds an M.F.S. from the University ofWisconsin, Madison and a B.A. from the University of Notre Dame.Christopher R. SullivanMr. Sullivan is a partner in the Lindquist & Vennum intellectual property practice group. Helitigates patent, trademark and copyright disputes to protect and defend the intellectualproperty rights of his clients. Mr. Sullivan also works with his clients on transactionalintellectual property issues to secure positive outcomes in due diligence, licensing,assignments, and intellectual property acquisitions. He is an experienced appellate attorneyand has advocated for his clients in both state and federal courts of appeals. He receivedhis J.D., cum laude, from William Mitchell College of Law in 2005, and his B.A. in computerscience and English from the University of Minnesota.xi

authorsKevin P. WagnerMr. Wagner is a partner in Faegre Baker Daniels’ intellectual property litigation practice.His practice focuses on patent litigation and other complex intellectual property mattersfor clients both large and small. He has litigated throughout North America, Europe, andAustralia, and has won preliminary injunction orders, summary judgment orders, jury trials,and appeals. He earned his J.D. from the University of Wisconsin Law School in 2004, andhis B.A. from Cornell College in 2001.Leita WalkerMs. Walker is a member of Faegre Baker Daniels’ intellectual property group. She focuseson litigation in the areas of advertising and media law, as well as on privacy, data security,and information management issues. She is also a member of the firm’s electronic discoverypractice working group. She received her J.D from the University of Kansas School of Lawin 2006, where she served as the editor in chief of law review and graduated Order of theCoif and valedictorian. Ms. Walker completed her undergraduate degree at the Universityof Kansas in 2002. She is admitted to the bar in Minnesota and Missouri.Bradley J. WalzMr. Walz is a shareholder in Winthrop & Weinstine’s intellectual property group. He primarilyrepresents technology companies on a broad range of complex and strategic legal andbusiness matters relating to cloud computing, software development and distribution, opensource software, data security and privacy, and all aspects of trademark and copyright law. Healso assists with trademark opposition and cancellation proceedings before the TrademarkTrial and Appeal Board and with trademark, unfair competition, copyright, and cybersquattinglitigation in federal district court. Prior to joining Winthrop & Weinstine, Mr. Walz internedwith the Honorable Richard H. Kyle, U.S. District Court for the District of Minnesota.John L. WelchMr. Welch is of counsel to Lando & Anastasi, LLP, in Cambridge, MA, where he specializesin trademark, copyright, and patent counseling and litigation matters. He serves as anexpert commentator and contributor to Allen’s Trademark Digest, a leading monthly digestof trademark decisions of the TTAB. Mr. Welch is also a member of the Editorial Board ofThe Trademark Reporter. His widely-read TTABlog, which focuses on the procedure andjurisprudence of the USPTO’s Trademark Trial and Appeal Board, was selected by ManagingIntellectual Property as one of the top ten intellectual property blogs.xii

managing editorMegan K. Manley, Publications AttorneyMinnesota Continuing Legal Educationpublications teamCassie A. Schober, Desktop PublisherKatie L. Ward, Publications CoordinatorJason C. Delinsky, Publications CoordinatorElizabeth M. Misiaveg-Patel, Program AttorneyMinnesota Continuing Legal Educationxiii

table of contentsChapter 1Federal Circuit Year in Review 2011-2012: Claim Construction Takes a Back SeatJohn A. Dragseth; Fish & Richardson§ 1.1 One – or at Least Section 101 – Is No Longer the Loneliest Number...............................1-1§ 1.2 Willful Infringement – Going, Going, Gone?.......................................................................1-7§ 1.3 A New Year, a New Written Description Case...................................................................1-8§ 1.4 I Do Declare! That Declaratory Judgment Jurisdiction Is Broad.................................... 1-10§ 1.5 Reexamination Grows Up................................................................................................ 1-11§ 1.6 Say What You Means....................................................................................................... 1-13§ 1.7 Inequitable Conduct......................................................................................................... 1-14§ 1.8 Preliminary Injunctions..................................................................................................... 1-15§ 1.9 Prosecution Fun............................................................................................................... 1-16Chapter 2On the Road to Patent Harmonization: An Overview of the AIA andIts Impact on Patent Applicants, Owners and PractitionersBrad D. Pedersen, David Hanna; Patterson Thuente Christensen Pedersen, P.A.§ 2.1 Introduction...................................................................................................................... 2-19§ 2.2 The Main Changes........................................................................................................... 2-20A. First-Inventor-to-File................................................................................................. 2-20B. Fee Setting, But Not Fee Spending, Authority....................................................... 2-28C. Revamped Processes for Challenging Validity at the USPTO................................ 2-281. New Review Proceedings................................................................................. 2-292. Supplemental Examination............................................................................... 2-383. Third-Party Prior Art Submissions..................................................................... 2-39§ 2.3 The Rest of the “Little” Changes..................................................................................... 2-39A. Multi-Defendant and Multi-District Litigation......................................................... 2-39B. Expanded Prior User Rights.................................................................................... 2-40C. Amended Best Mode.............................................................................................. 2-41D. Filing by Assignee................................................................................................... 2-42E. Changes to Marking Requirements—Both False and Virtual................................ 2-42F. Priority Examinations............................................................................................... 2-43G. The Rest of the Smaller Changes........................................................................... 2-43§ 2.4 Conclusions...................................................................................................................... 2-44xv

table of contentsChapter 3Caraco v. Novo: Counterclaims Relating toBrand Name Description of Claim ScopeCatherine A. Shultz, Larrin Bergman; Kinney & Lange§ 3.1 History of the Hatch-Waxman Act................................................................................... 3-47§ 3.2 Case Background............................................................................................................. 3-48§ 3.3 The Ruling of the Supreme Court.................................................................................... 3-49A. When a Patent “Does Not Claim…An Approved Method of Using a Drug”......... 3-50B. The Content of “Patent Information Submitted…Under Subsection (b) or (c) of § 355”..................................................................... 3-50§ 3.4 The Sotomayor Concurrence........................................................................................... 3-52§ 3.5 Conclusion........................................................................................................................ 3-53Chapter 4Mayo v. Prometheus: The Supreme Court of theUnited States Comments on Patents and Laws of NatureRandy A. Hillson, Julie R. Daulton; Merchant & Gould§ 4.1 Background...................................................................................................................... 4-55§ 4.2 The Decision.................................................................................................................... 4-55§ 4.3 Patent Office and Federal Circuit Reaction to the Prometheus Decision....................... 4-61A. The U.S. Patent and Trademark Office.................................................................... 4-61B. The Court of Appeals for the Federal Circuit.......................................................... 4-62§ 4.4 Concluding Comments: Prometheus and Public Policy................................................. 4-63Chapter 5Kappos v. Hyatt: Standard of Review of Patent Office Appeals to the District CourtMichael M. Lafeber, Erin O. Dungan; Briggs and Morgan, P.A.§ 5.1 Introduction...................................................................................................................... 5-67§ 5.2 Procedural History............................................................................................................ 5-68§ 5.3 The U.S. Supreme Court’s Decision: 566 U.S. ___, 132 S. Ct. 1690 (2012)................... 5-69A. Language of the Statute and Principles of Administrative Law............................. 5-69B. Evidentiary and Procedural Rules in Effect Upon Enactment of the Statute........ 5-70C. Weight Afforded to Newly-Admitted Evidence...................................................... 5-72D. Justice Sotomayor’s Concurrence......................................................................... 5-72E. Limitations on the Court’s Holding......................................................................... 5-73xvi

table of contentsChapter 6Divided Infringement: A Legal Standard in En Banc LimboFelicia J. Boyd, Aaron A. Myers; Barnes & Thornburg LLP§ 6.1 Divided Infringement: What It Is, and Why It Matters More Than Ever........................ 6-75§ 6.2 Evolution of the ‘Mastermind’ Standard......................................................................... 6-76§ 6.3 Revealing the Fate of Divided Infringement:The Much-Anticipated Akamai and McKesson En Banc Decisions................................ 6-77A. Akamai Technologies, Inc. v. Limelight Networks, Inc........................................... 6-78B. McKesson Technologies Inc. v. Epic Systems Corp................................................ 6-80§ 6.4 Tea Leaves for a Legal Standard in Waiting.................................................................... 6-82A. The Most Recent Precedent................................................................................... 6-82B. Snapshots From the Amici Briefing........................................................................ 6-83§ 6.5 Conclusion........................................................................................................................ 6-84Chapter 7Developments in the Law of Patent Damages in 2011-2012Kevin P. Wagner, Ari B. Lukoff; Faegre Baker Daniels LLP§ 7.1 Introduction...................................................................................................................... 7-87§ 7.2 Reasonable Royalty Damages......................................................................................... 7-88A. A Reasonable Royalty Can Exceed a Patentee’s ExpectedProfits for the Patented Invention: Powell v. Home Depot, Inc.,663 F.3d 1221 (Fed. Cir. 2011)................................................................................. 7-92B. Non-Patent License Agreements Can Support a Reasonable Royalty:Spectralytics, Inc. v. Cordis Corp., 649 F.3d 1336 (Fed. Cir. 2011).......................... 7-93C. Communications Regarding Patent Licenses Taken To SettleInfringement Claims Are Discoverable: In re MSTG, Inc.,675 F.3d 1337 (Fed. Cir. 2012)................................................................................. 7-94§ 7.3 Equitable Relief................................................................................................................ 7-95A. The Presumption of Irreparable Harm No Longer Applies:Robert Bosch, LLC v. Pylon Manuf. Corp., 659 F.3d 1142 (Fed. Cir. 2011)............. 7-96B. An Injunction Over a Product Will Be Granted Only Upon aShowing That the Patented Feature of the Product Is theBasis for Customer Demand: Apple, Inc. v. Samsung Electronics, Co.,678 F.3d 1314, 2012 WL 1662048 (Fed. Cir. 2012)................................................. 7-98C. A Preliminary Injunction Is Possible with a Strong Case ofInfringement and Validity, and Evidence of Irreparable Harm:Celsis In Vitro, Inc. v. CellzDirect, Inc., 664 F.3d 922 (Fed. Cir. 2012)..................... 7-99D. Ongoing Royalty in the Absence of an Injunction: Bard PeripheralVascular, Inc. v. W.L. Gore & Assocs. Inc., 670 F.3d 1171 (Fed. Cir. 2012)............ 7-100xvii

table of contents§ 7.4 Willfulness and Enhanced Damages............................................................................. 7-100A. The Federal Circuit Reviews the Objective Prong of Willfulness:Powell v. Home Depot U.S.A., Inc., 663 F.3d 1221 (Fed. Cir. 2011)..................... 7-101B. The Objective Inquiry for Willfulness Is Decided by the Judgeas a Matter of Law and Is Subject to De Novo Review:Bard Peripheral Vascular, Inc. v. W.L. Gore & Assocs., Inc.,682 F.3d 1003 (Fed. Cir. 2012)............................................................................... 7-102C. An Opinion-of-Counsel Is Relevant to the Enhancement ofDamages for Willfulness: Spectralytics, Inc. v. Cordis Corp.,649 F.3d 1336 (Fed. Cir. 2011)............................................................................... 7-103Chapter 8Copyright Highlights: Noteworthy Cases 2011-2012Calvin L. Litsey, Leita Walker, Lauren W. Steinhaeuser, David Merritt; Faegre Baker Daniels LLP§ 8.1 Constitutional Issues...................................................................................................... 8-105A. Golan v. Holder, 132 S. Ct. 873 (2012).................................................................. 8-105B. Sony BMG v. Tenenbaum, 660 F.3d 487 (1st Cir. 2011)........................................ 8-106§ 8.2 Copyright Limitations..................................................................................................... 8-106A. Kelley v. Chicago Park District, 635 F.3d 290 (7th Cir. 2011)................................. 8-106B. Oracle America, Inc. v. Google, Inc., No. 3:10-cv-03561,2012 WL 1965778 (N.D. Cal. May 31, 2012)......................................................... 8-107§ 8.3 Fair Use........................................................................................................................... 8-108A. Cambridge Univ. Press v. Becker, No. 1:08-CV-1425,2012 WL 1835696 (N.D. Ga. May 11, 2012)......................................................... 8-108§ 8.4 First-Sale Doctrine.......................................................................................................... 8-109A. John Wiley & Sons, Inc. v. Kirtsaeng, 654 F.3d 210 (2d Cir. 2011)........................ 8-109B. UMG Recordings Inc. v. Augusto, 628 F.3d 1175 (9th Cir. 2011).......................... 8-110§ 8.5 Injunctive Relief.............................................................................................................. 8-111A. Perfect 10 Inc. v. Google, Inc., 653 F.3d 976 (9th Cir. 2011)................................. 8-111§ 8.6 Preemption..................................................................................................................... 8-111A. Forest Park Pictures v. Universal Television Network, Inc.,No. 11-2011-cv, 103 U.S.P.Q.2d 1122 (2d Cir. June 26, 2012).............................. 8-111§ 8.7 Legislative Developments.............................................................................................. 8-112A. SOPA and PIPA...................................................................................................... 8-112xviii

table of contentsChapter 9Recent Developments in Trade Secret Law – 2012Kerry L. Bundy, Randall E. Kahnke; Faegre Baker Daniels LLP§ 9.1 Social Media Issues....................................................................................................... 9-115§ 9.2 The “Reasonable Particularity” Requirement................................................................ 9-117§ 9.3 U.S. Trade Secret Law Extending to Foreign Countries................................................ 9-119§ 9.4 Computer Fraud and Abuse Act.................................................................................... 9-120§ 9.5 Co-Existence of Patents and Trade Secrets.................................................................. 9-121§ 9.6 Rising Damage Awards in Trade Secret Misappropriation Cases................................ 9-122Chapter 10Top Ten Trademark Decisions of 2011-2012Stephen R. Baird, Sharon D. Armstrong; Winthrop & Weinstine§ 10.1 Introduction.................................................................................................................. 10-125§ 10.2 Case Summaries.......................................................................................................... 10-126A. First Nat’l Bank in Sioux Falls v. First Nat’l Bank South Dakota,679 F.3d 763 (8th Cir. 2012)................................................................................. 10-126B. Gucci America, Inc. v. Guess?, Inc.,2012 WL 2304247 (S.D.N.Y. June 18, 2012)....................................................... 10-128C. Maker’s Mark Distillery, Inc. v. Diageo N. Am., Inc.,679 F.3d 410 (6th Cir. 2012)................................................................................. 10-129D. Nike, Inc. v. Already, L.L.C., 663 F.3d 89 (2d Cir. 2011)....................................... 10-131E. Richards v. Burgett, No. 10-C-7580 (N.D. Ill. Dec. 12, 2011)............................... 10-132F. Rosetta Stone Ltd. v. Google, Inc., 676 F.3d 144 (4th Cir. 2012)......................... 10-134G. Seed Services, Inc. v. Winsor Grain, Inc.,2012 WL 1232320 (E.D. Cal. Apr. 12, 2012)........................................................ 10-136H. Universal Furniture Int’l, Inc. v. Frankel,835 F. Supp. 2d 35 (M.D. N.C. 2011)................................................................... 10-137I. The University of Alabama Board of Trustees v. New Life Art, Inc.,103 U.S.P.Q.2d 1070 (11th Cir. 2012)................................................................... 10-139J. Wine Group LLC v. Levitation Mgmt., LLC,2011 WL 4738335 (E.D. Cal. Oct. 5, 2011)......................................................... 10-141xix

table of contentsChapter 11The Top Ten Ttab Decisions of 2011-2012John L. Welch; Lando & Anastasi, LLP§ 11.1 Introduction.................................................................................................................. 11-143§ 11.2 Case Summaries.......................................................................................................... 11-144A. Nike, Inc. v. Maher, 100 U.S.P.Q.2d 1018 (T.T.A.B. 2011) [Precedential]............ 11-144B. Rolex Watch U.S.A., Inc. v. AFP Imaging Corp.,101 U.S.P.Q.2d 1188 (T.T.A.B. 2011) [Precedential]............................................. 11-147C. L’Oreal S.A. v. Marcon, 102 U.S.P.Q.2d 1434 (T.T.A.B. 2012) [Precedential]....... 11-150D. Shutemdown Sports, Inc. v. Lacy,102 U.S.P.Q.2d 1036 (T.T.A.B. 2012) [Precedential]............................................. 11-152E. Reliance Standard Life Ins. Co. v. American National Ins. Co.,Opposition No. 91178996 (Apr. 30, 2012) [Not Precedential]............................ 11-153F. In re the Government of the District of Columbia,101 U.S.P.Q.2d 1588 (T.T.A.B. 2012) [Precedential];In re the City of Houston, 101 U.S.P.Q.2d 1534(T.T.A.B. 2012) [Precedential]............................................................................... 11-154G. Corporacion Habanos, S.A. v. Guantanamera Cigars Co.,102 U.S.P.Q.2d 1085 (T.T.A.B. 2012) [Precedential];In re Compania De Licores Internaciolaes S.A.,102 U.S.P.Q.2d 1841 (T.T.A.B. 2012) [Precedential]............................................. 11-158H. In re the Dot Communications Network LLC,101 U.S.P.Q.2d 1062 (T.T.A.B. 2011) [Precedential]............................................. 11-162I. Doyle v. Al Johnson’s Swedish Restaurant & Butik, Inc.,101 U.S.P.Q.2d 1780 (T.T.A.B. 2012) [Precedential]............................................. 11-163J. Frito-Lay North American, Inc. v. Princeton Vanguard, LLC,100 U.S.P.Q.2d 1904 (T.T.A.B. 2011) [Precedential]............................................. 11-165Chapter 12Top Ten Udrp Decisions for 2011-2012Bradley J. Walz, Catlan M. McCurdy; Winthrop & Weinstine§ 12.1 Introduction.................................................................................................................. 12-167§ 12.2 Case Summaries.......................................................................................................... 12-168A. CEAT Limited, CEAT Mahal v. Vertical Axis Inc./Whois Privacy Services Pty Ltd., Case No. D20111981(WIPO Feb. 20, 2012).......................................................................................... 12-168B. Eagle Mountain Intl., Inc. d/b/a Kenneth Copeland Ministries v.James Vermillion, Case No. FA1110001410420 (NAF Nov. 18, 2011)............... 12-169C. eLegalsupply.com v. Azeras, LLC, Case No. FA1204001438796(NAF May 22, 2012)............................................................................................. 12-170D. Novartis AG v. Fresh Look Consulting, LLC,Case No. FA1110001313477 (NAF Dec. 6, 2011)............................................... 12-172xx

table of contentsE. Sven Beichler v. Chocri GmbH,Case No. D20111629 (WIPO Nov. 17, 2011)...................................................... 12-174F. InterContinental Hotels Corp. v. Pamirsoft Technologies,No. D20111979 (WIPO Dec. 13, 2011)............................................................... 12-175G. The California Milk Processor Board v. Ryan Archer,No. D20111812 (WIPO Dec. 9, 2011)................................................................. 12-177H. Google Inc. v. Chris Gillespie, No. FA1203001434643(NAF May 10, 2012)............................................................................................. 12-178I. Ms. Stefani Germanotta v. oranges arecool XD,No. FA1108001403808 (NAF Sept. 21, 2011)..................................................... 12-179J. Karen Millen Fashions Limited v. Danny Cullen,No. D20111134 (WIPO Sept. 24, 2011).............................................................. 12-180Chapter 13Social Media: 10 Noteworthy Cases in 2011-2012Christopher R. Smith, Christopher R. Sullivan; Lindquist & Vennum, P.L.L.P.§ 13.1 Privacy Rights May Not Extend to Social Media Postings,Even If Deleted, and May Be Subject To Disclosure by Subpoena............................ 13-183§ 13.2 Employee’s Development of Social MediaAccounts May Not Confer Ownership........................................................................ 13-185§ 13.3 Employer May Be Barred from Unauthorized Use ofEmployee’s Social Media Accounts to Promote Employer’s Business..................... 13-186§ 13.4 Social Media Sites May Not Be Liable for Privacy ViolationsUnder the Stored Communications Act and Other StatutesVia Their Sponsored Advertising................................................................................. 13-187§ 13.5 Supreme Court Leaves Social Media Student Speech Disputesto the Various Circuit Courts........................................................................................ 13-188§ 13.6 Facebook Tagging and Mean Comments on Innocuous FamilyPhotos Does Not Constitute Harassment................................................................... 13-189§ 13.7 Facebook Post by Public Employee on a Matter of PublicConcern Is Protected Speech...................................................................................... 13-190§ 13.8 Facebook “Likes” Are Insufficient to Merit Constitutional Protection........................ 13-191§ 13.9 Discovery of an Entire Facebook Profile Must Be ReasonablyCalculated to Lead to the Discovery of Admissible Evidenceor Be Deemed a “Fishing Expedition”......................................................................... 13-192§ 13.10 Jurors Must Be Warned About the Prohibition Against UsingSocial Media to Comment on or Investigate Trial Matters......................................... 13-193xxi

table of contentsChapter 14The Rites of Passage of the European Registered Community DesignsFilip De Corte; Europe Cargill Inc.§ 14.1 Design Rights............................................................................................................... 14-195§ 14.2 The European Stem Cell Debate................................................................................. 14-197§ 14.3 Goods in Transit........................................................................................................... 14-199§ 14.4 The Red Bull Case........................................................................................................ 14-201§ 14.5 Less Is More................................................................................................................. 14-201§ 14.6 “Parsley, Sage, Rosemary and Thyme”....................................................................... 14-203§ 14.7 GOAAAAAAAAAL!!...................................................................................................... 14-204xxii

theIP bookChapter 1the IP Book 2012Federal Circuit Year inReview 2011-2012:Claim Construction Takes a Back SeatJohn A. DragsethFish & RichardsonMinneapolisThe Federal Circuit issues about 100 precedential intellectual property decisions each year. Thisshort chapter attempts to classify the most important of those decisions (and a couple United StatesSupreme Court decisions) into discrete groups, to summarize the rules of those cases, and to comment,however briefly, on the possible meanings of the decisions and the future of patent law.The theme this year, if there is any, is “patent-eligible subject matter” under Section 101 of theU.S. Patent Act. The topic has dominated discussion in the bar, has shown up in numerous differentopinions at the district court, court of appeals, and Supreme Court levels, and still seemingly hasnot been straightened out by the courts. The rest of the topics below are a general grab bag, selectedprimarily based on the relative size of the audience they affect and the level to which they seem toannounce new law.§ 1.1 One – or at Least Section 101 – Is No Longer theLoneliest NumberFor the longest time, we thought anything could be patented if it was non-obvious—since the1970s in the life sciences, and the mid-1990s in software and related technologies. Ignorance wastruly bliss.1-1

Chapter 1 – Federal Circuit Year in Review 2011-2012But it’s all been upset since the United States Supreme Court agreed to hear but generally refusedto decide Lab. Corp. of Am. Holdings, Inc. v. Metabolite Labs., Inc., 548 U.S. 124 (2006) andthen actually did decide Bilski v. Kappos, 130 S. Ct. 3218, 561 U.S. ___ (2010), but largely duckedthe main issues there.This past year was rich in Section 101 decisions, which have started to show a form of “grandunifying theory” that joins the unpredictable arts (represented by Lab. Corp.) with the predictablearts, and particularly software and business methods (represented by Bilski). The lead case that startedthat merger was the Supreme Court’s March decision in Mayo Collaborative Servs. v. PrometheusLabs., Inc., 566 U.S. ____, 132 S. Ct. 1289 (2012). Mayo was a classic bio-pharma case over a patentdirected to a process that involved mentally recognizing that certain blood-test results correlatewith an indication that the patient is getting too much or too little of a certain drug. But becausethe claim did not say what a physician was to do with the mental recognition (e.g., with respect tochanging a dosage for the patient), it was very analogous to common software claims that reciteprocessing without reciting the result of the processing. Mayo thus presented the Prometheus claimsas impermissibly aligning with the court’s cases that invalidated software-related claims that recitedprocessing but did not recite actual real-world uses of the processing (Gottschalk v. Benson, 409 U.S.63, 67 (1972) and Parker v. Flook, 437 U.S. 584, 590 (1978)). Mayo said the claims were unlike thevalidated claims in Diamond v. Diehr, 450 U.S. 175, 185 (1981), where the patent claims recitedcomputer processing but were limited to particular uses of the processing. Mayo reasoned that, justas the claims in Benson and Flook impermissibly preempted all effective uses of certain mathematicalalgorithms, so too did the Prometheus claims impermissibly preempt all effective uses of laws ofnature—natural correlations between drug levels in a patient’s blood and the patient’s general health.While the Federal Circuit disagreed with Mayo twice 3-0, the U.S. Supreme Court agreed 9-0.The Court, at the core of the opinion, concluded that the Prometheus claims did little more thandescribe the natural correlations and thus preempted those correlations and interfered with free competitionaround them:[Our] cases warn us against interpreting patent statutes in ways that make patenteligibility “depend simply on the draftsman’s art” without reference to the “principlesunderlying the prohibition against patents for [natural laws].” They warn usagainst upholding patents that claim processes that too broadly preempt the use ofa natural law. And they insist that a process that focuses upon the use of a naturallaw also contain other elements or a combination of elements, sometimes referredto as an “inventive concept,” sufficient to ensure that the patent in practice amountsto significantly more than a patent upon the natural law itself. We find that theprocess claims at issue here do not satisfy these conditions. In particular, the stepsin the claimed processes (apart from the natural laws themselves) involve well-1-2

the IP Book 2012understood, routine, conventional activity previously engaged in by researchersin the field. At the same time, upholding the patents would risk disproportionatelytying up the use of the underlying natural laws, inhibiting their use in the makingof further discoveries.132 S. Ct. at 1294 (citations and internal quotations omitted). Certain claims added additional features,but those features did not save the extra claims:Id.(1) an “administering” step “simply refers to the relevant [pre-existing] audience,namely doctors who treat patients with certain diseases with thiopurine drugs”and at most simply limit the process insufficiently to a particular environment;(2) certain “wherein” clauses “simply tell a doctor about the relevant natural laws,at most adding a suggestion that he should take those laws into account whentreating his patient,” like Einstein telling other physicists E=mc 2 and trustingthem to use it where relevant;(3) a “determining” step covered whatever way a physician might determine themetabolite levels and thus was “conventional or obvious” “‘[pre]-solution activity’[that] is normally not sufficient to transform an unpatentable law ofnature into a patent-eligible application”; and(4) the combination of the steps was something anyone must do in order to takeadvantage of the natural correlation.On other arguments raised by Prometheus and its amici, the Court answered as follows:(1) the “machine or transformation” test does not “trump” the law of nature exclusion;(2) the narrowness of the law of nature here did not change things because thecreative contribution was equally narrow in such a situation, i.e., “the underlyingfunctional concern here is a relative one: how much future innovation isforeclosed relative to the contribution of the inventor,” and such an analysiswould be a mess in any event;(3) Sections 102 and 103 were not the solution because Section 101 is not “adead letter” as indicated by prior case law, and “to shift the patent eligibilityinquiry entirely to these later sections risks creating significantly greater legaluncertainty, while assuming that those sections can do work that they are not1-3

Chapter 1 – Federal Circuit Year in Review 2011-2012Id. at 1289.equipped to do,” and the government is simply wrong in its idea that 102/103can be applied to such claims by first ignoring any laws of nature and then applying102/103 to the remaining limitations; and(4) the doomsday scenarios of Prometheus’ amici are no more powerful than thoseof Mayo’s amici: “Patent protection is, after all, a two-edged sword.”The prime trailing case in the bio-pharma area is Assoc. for Molecular Pathology v. U.S. Patent& Trademark Office (Myriad), Docket No. 2010-1406 (Fed. Cir. July 29, 2011), which had methodclaims that were similar in many ways to those in Mayo, but also included claims for isolated DNAfragments. The U.S. Supreme Court granted certiorari in Myriad, vacated the Federal Circuit’s priorruling, and remanded for further consideration in light of the Mayo ruling. The Federal Circuit heldargument July 20, 2012, limiting the discussion to the effect of Mayo on the case. The isolated DNAissue was the focus of that case, and had little in common with Mayo because everyone seemed toagree on the legal issue—i.e., whether the DNA, when isolated, is fundamentally (or substantially)different than the endogenous DNA in a human’s body. The answer to that question is more technical,or even philosophical, than it is legal. Indeed, the analogies at the various oral arguments hadcentered on questions such as: “if you carve a baseball bat out of a tree, is it patent-eligible eventhough it technically pre-existed in the tree?,” versus “if you cut the top and roots off a tree, is the treetrunk patent-eligible?” Expect a decision from the Federal Circuit panel in the latest round aroundOctober or November. (Judge Lourie led the panel and his trains always run on time.) Because thepanel seemed not to lean either way at the latest oral argument, the conventional wisdom is that thepanel will rule as it did before by generally confirming the isolated DNA claims.Great uncertainty remains in the software fields, however, and the Federal Circuit decisions arepiling up. Early in the past year, a Federal Circuit panel (Bryson, Dyk, and Prost) found invalid aclaim on a method for verifying a credit card transaction over the internet, in CyberSource Corp. v.Retail Decisions, Inc., 654 F.3d 1366 (Fed. Cir. 2011). The next month, another panel (Rader, Lourie,and O’Malley) validated a patent for a method of distributing copyrighted materials for free in exchangefor a user viewing an advertisement, and where the advertiser then pays for the materials, inUltramercial, LLC v. Hulu, LLC, 657 F.3d 1323 (Fed. Cir. 2011). The Ultramercial court concededthat the “age-old idea that advertising can serve as a currency” would not be patent-eligible, butreasoned that the patent recited a particular real-world application of that broader idea, and involvedan “extensive computer interface.” The Ultramercial panel distinguished CyberSource as a casethat involved “purely mental steps.” With Mayo still pending, the court did not analyze whether theclaims nonetheless effectively preempted all uses of an abstract idea. Rather, its test appears to be:“if the process is simple, it’s invalid, but if the process is really complex, it’s valid.”1-4

the IP Book 2012A later panel (Linn, Plager, and Dyk) had to deal with this split in DealerTrack, Inc. v. Huber,674 F.3d 1315 (Fed. Cir. 2012), where it went the CyberSource route. Specifically, it invalidated,as too abstract, claims directed to a computer-implemented method of managing a credit application—eventhough the claims recited the involvement of various computers and the sending of communicationsover a network. The panel noted that adding “computer-aided method” to the preambleof your claim won’t get you around Bilski: “Simply adding a computer aided limitation to a claimcovering an abstract concept, without more, is insufficient to render the claim patent eligible.” Id.at 1333. The panel contrasted its situation with that of Ultramercial, in which the court found thatthe claims were not abstract because they recited specific functions performed by computers thatcould not be performed by a person using pen and paper. Again, the court seemed to be perpetuatingits “really complicated software” doctrine. The court did at least indicate that the problem withthe claims was that they were “preemptive of a fundamental concept or idea that would forecloseinnovation in this area”—foreshadowing somewhat the U.S. Supreme Court’s Mayo decision. Id. at1331. Senior Judge Plager partially dissented by noting that he believed it would be more efficientif courts simply made Section 101 the last issue they analyzed, so that they could potentially avoidhaving to deal with it altogether.In Fort Properties, Inc. v. American Master Lease LLC, 671 F.3d 1317 (Fed. Cir. 2012), anotherpanel (Prost, Schall, and Moore) invalidated a claim that covered methods of managing tax-deferredreal estate instruments. The analysis was relatively simple, as the panel simply felt that the claim wastoo close to the Bilski claims, and was thus plainly a mere abstract idea, rather than a patent-eligiblereal-world application of an idea.Senior Judge Plager followed up on his DealerTrack dissent by writing the panel opinion inMySpace, Inc. v. GraphOn Corp., 672 F.3d 1250 (Fed. Cir. 2012). There, he expanded on his ideathat Section 101 should be treated last in a case (and hopefully never). With Judge Newman joininghim, he analogized Section 101 to the Bill of Rights—which both deal in broad, fundamental parameters—andreasoned that courts should use the “inherent power to control the process of litigation”by “insist[ing] that litigants address patent invalidity issues in terms of [Sections] 102, 103, and112.” Id. at 1260. In the panel majority’s view, “[t]his would make patent litigation more efficient,conserve judicial resources, and bring a degree of certainty to the interests of both patentees andtheir competitors in the marketplace.” Id. The panel majority, of course, seems to have focused onlyon the “expense” or complication of courts that make the decision, since gathering evidence for aSection 102 or 103 defense is an order of magnitude more expensive than is preparing a Section 101defense.On May 21, the Supreme Court granted certiorari, vacated, and remanded the Ultramercial case(captioned at the Supreme Court as WildTangent, Inc. v. Ultramercial, LLC, Docket No. 11-962(Sept. 15, 2011)), for reconsideration in light of Mayo.1-5

Chapter 1 – Federal Circuit Year in Review 2011-2012Then on July 9, in CLS Bank International v. Alice Corp., Docket No. 2011-1301, __ F.3d __(Fed. Cir. July 9, 2012), another panel (Linn, Prost, and O’Malley) held that parallel claims forsystems, methods, and recordable media (Beauregard) were patent-eligible practical applications.The patents related to a computerized trading platform by which a trusted third party settles obligationsbetween trading parties. On the way to the Section 101 analysis, the panel noted: “[i]t shouldbe self-evident that each of these four statutory provisions—§§ 101, 102, 103, and 112—serves adifferent purpose and plays a distinctly different role. No one section is more important than anyother.” Yet because the Section 101 issue was raised, the panel addressed it and discussed the greatdifficulty of determining whether an invention was a mere abstract idea or an actual implementationof an abstract idea, and discussed the cases that have applied a “preemption” analysis, notingthat “the essential concern is not preemption, per se, but the extent to which preemption results inthe foreclosure of innovation.” The panel identified its ultimate rule as follows: “[i]n light of theforegoing, this court holds that when—after taking all of the claim recitations into consideration—itis not manifestly evident that a claim is directed to a patent ineligible abstract idea, that claim mustnot be deemed for that reason to be inadequate under § 101.” With respect to the claims, the panelfelt that the recitation of computers in the claims played “a significant part in the performance of theinvention,” so that the claims covered “the practical application of a business concept in a specificway.” Judge Prost dissented, believing the claims to be “abstract ideas repackaged as methods andsystems.” Thus, CLS Bank does little to clear the fog.And most recently, on July 26, yet another panel (Lourie, Prost, and Wallach), in Bancorp Servs.,L.L.C. v. Sun Life Assurance Co. of Canada (U.S.), Docket No. 2011-1467, __ F.3d __ (Fed. Cir. July26, 2012), affirmed the rejection of claims directed to methods of managing a so-called “Stable ValueProtected Investment Plan”—claims that have been through two prior appeals without mention ofSection 101. The panel first construed some of the claims to require the use of computers (includingsome Beauregard claims) and others not to, even though the district court had not performed a claimconstruction. But the distinction did not matter, because the claims were essentially parallel versionsof the same claim with different preambles (method, system, and Beauregard), and the panel followedthe direction from CLS Bank and CyberSource that mere differences in the form of claim donot matter: “Thus, under Cybersource and CLS, a machine, system, medium, or the like may in somecases be equivalent to an abstract mental process for purposes of patent ineligibility. As the SupremeCourt has explained, the form of the claims should not trump basic issues of patentability.” As to therecitation of computers in the claims, the panel noted: “[t]o salvage an otherwise patent-ineligibleprocess, a computer must be integral to the claimed invention, facilitating the process in a way thata person making calculations or computations could not.” Finally, the panel found no material differencesbetween the Bancorp claims and the claims in Bilski, and it distinguished Research Corp.as involving claims that “plainly represented improvements in computer technologies in the marketplace”and involved modification and output of computer data structures.1-6

the IP Book 2012All of these cases together show the Federal Circuit’s continuing struggle to deal with Section101. It has abandoned its approach of looking solely to “machines or transformations,” which ithad applied without any conception of why those machines or transformations mattered. And forsoftware cases, it has moved toward a “could you perform it manually on paper” doctrine, withoutexplaining why such a distinction matters. The author submits the ultimate anchor for any suchanalysis is whether the claim effectively preempts a law of nature, abstract idea, or algorithm. Theother tests then inform that inquiry. For example, the recitation of a machine in a claim may be relevantbecause it may show that the patentee is only trying to cover a particular implementation of anabstract idea or law of nature. But if the machine is a necessary part of getting to, or using, the lawof nature or abstract idea, then its recitation really does not narrow the preemptive effect of the claimand will not make the claim patent-eligible. The same is true with post-solution and pre-solutionactivity—e.g., in Mayo, the gathering of a patient’s blood sample was insignificant as pre-solutionactivity because it was a step that anyone would have had to perform to get to the natural correlationbetween blood chemical levels and patient health—it was “conventional.” Even if one does not thinkthis preemption-based approach is correct (despite the U.S. Supreme Court’s 9-0 agreement withit), it does provide an analytic framework against which to test future opinions—something missingfrom the Federal Circuit’s case law.§ 1.2 Willful Infringement – Going, Going, Gone?In In re Seagate Tech., LLC, 497 F.3d 1360, 1371 (Fed. Cir. 2007) (en banc), the full FederalCircuit held that a willful infringement inquiry has two prongs: (1) an “objective” prong that askswhether the defendant’s legal position was objectively reasonable or not, and (2) a subjective prongthat asks whether the defendant actually knew or should have known that it was infringing. The courtcalled the objective prong a “threshold” inquiry. But the court did not say who—judge or jury—should decide the objective prong.The panel in Bard Peripheral Vascular, Inc. v. W.L. Gore & Associates, Inc., 670 F.3d 1171(Fed. Cir. 2012), initially resolved that issue in favor of the jury, holding that substantial evidencesupported a jury verdict of willful infringement—both on the objective prong and the subjectiveprong. Gore petitioned for panel rehearing and rehearing en banc. The panel granted the petition forthe limited purpose of removing a sentence from the opinion that included a clear factual error (thepanel had confused the Morgan & Finnegan firm with the Finnegan Henderson firm). That was notenough to satisfy the en banc court, though, as it took the very rare step of ordering the panel to fixits opinion. In an updated opinion, the panel recognized that the objective prong is a legal questionsubject to de novo review, and that is to be decided by the court. Bard, Docket No. 2010-1510, __F.3d __ (Fed. Cir. June 14, 2012). Judge Newman dissented throughout the proceeding—noting thatjudgment as a matter of law should have been ordered for Gore on the issue of co-inventorship, thusmooting the willfulness issue (the parties had fought a 28-year interference before the litigation).1-7

Chapter 1 – Federal Circuit Year in Review 2011-2012The decision in Bard v. Gore is too new for us to know its potential impact. Presumably, thedefendants will move for summary judgment on the objective prong before trial, and then move inlimine to exclude damaging evidence that would have been used to prove the subjective prong tothe jury. We can expect the defendants to also argue that, as long as the patentee cannot establish infringementliability as a matter of law, then the defendant must have had a reasonable legal basis forits positions. On the other hand, we can expect the patentees to try to introduce their willful infringementevidence by other means, such as to rebut arguments that asserted claims would have beenobvious (e.g., by introducing objective evidence of nonobviousness in the form of the defendant’salleged copying). Perhaps we’ll have a good update by next year.§ 1.3 A New Year, a New Written Description CaseThere are two main ways to fail the written description requirement. The first is to explicitlyclaim something that is not in your specification. That’s a pretty easy one to understand—i.e., ifyou recite A in your claim, and there is no A in the patent, you clearly have not described what youclaimed.The second way—often termed the “omitted element” doctrine—is when you claim a genus,but disclose only a particular species. This situation is trickier because technically, you have disclosedwhat you’ve claimed—just not all of it. Also, claims cannot automatically be invalid in sucha situation because patentees almost always claim more broadly than they disclose. So the questionhas long been “where do you draw the line?” The unpredictable arts have had an answer since the1990s—though a blurry answer—i.e., if the claimed genus covers too many species and the patentdiscloses too few of those species, then the claim is invalid. (There’s an entirely separate writtendescription doctrine in biotechnology that says a patentee must describe the structure of a gene, andnot just its function or operation.)In predictable arts, the omitted element doctrine was never used and was even criticized. See,e.g., Reiffin v. Microsoft Corp., 214 F.3d 1342 (Fed. Cir. 2000) (Newman, J., concurring) (“Whenthe claim is supported by the patent’s disclosure, is adequately distinguished from the prior art, andotherwise meets the statutory requirements of patentability, neither law nor policy requires that theclaim contain all the elements described in the specification as part of the new machine or method.”);see also Ethicon Endo-Surgery, Inc. v. U.S. Surgical Co., 93 F.3d 1572, 1582 n.2 (Fed. Cir. 1996)(criticizing a district court for “confus[ing] a claim not supported by the specification [because itrecited a specific element not found in the disclosure], which is not allowable, with a broad claim,which is.”).Around 1998, though, Judge Lourie ran into a case about a TV-viewing couch with recliningseats, where the specification showed a “recline” button in a console between the seats and initiallyclaimed the button as being in the console (along with beer can holders). After the defendant pro-1-8

the IP Book 2012duced a couch that would have infringed but for the fact that its buttons were hidden down betweenthe cushions, the applicants amended their pending claims to simply recite the button—but to saynothing about its location. After getting the patent and suing, they admitted at deposition that theynever thought about putting the button anywhere other than the console until they saw the defendant’scouch. Judge Lourie found the claims invalid for lack of written description support—thefacts were just too clear to do otherwise. The case is Gentry Gallery, Inc. v. Berkline Corp., 134 F.3d1473, 1479 (Fed. Cir. 1998).For the next decade, defendants cited Gentry Gallery over and over, and it became the mostdistinguishedcase in Federal Circuit history (distinguished in terms of being set aside on its facts,not in terms of being lauded). The court was afraid of the dangers of extending Gentry Gallery beyondits facts. In fact, in Bilstad v. Wakalopulos, 386 F.3d 1116 (Fed. Cir. 2004), the court indicatedthat, in the predictable arts, a generic claim would be invalid for lack of written description onlyif unpredictability in the relevant art would prevent a skilled artisan from understanding that thenon-disclosed species that was covered by a subsequently-amended generic claim would performsimilarly to the species that was disclosed, or if the specification “specifically distinguishes the priorart as inferior and touts the advantages” of the disclosed species. See also Cordis Corp. v. MedtronicAVE, Inc., 339 F.3d 1352, 1357-58 (Fed. Cir. 2003) (claim to “slots” was supported by written descriptionthat showed only a particular mix of slots because the mixture of slots was not describedas critical to the invention).A few years ago, the court started going the other way (back toward Gentry Gallery) by blastingpatentees who succeeded in getting a broad construction in order to cover an accused implementation(species) that they did not disclose—i.e., the court affirmed the broad constructions, and thenused those constructions to invalidate the claims for lack of written description. These can be called“binary” cases because they usually come up when there are two ways to solve a problem, the applicantinitially disclosed one of the ways, but then broadened the claims to cover both ways. Thefirst was Lizardtech, Inc. v. Earth Resource Mapping, Inc., 424 F.3d 1336 (Fed. Cir. 2005), wherethe panel invalidated claims that covered a discrete wavelength transform (DWT) process generally,and the specification described only a particular implementation of that process. Another was ICUMedical v. Alaris Medical Sys., 558 F.3d 1368 (Fed. Cir. 2009), where the claims originally recitedan IV needle having a spike, and then removed mention of the spike from the claims and accuseda “spikeless” device of infringement. But see Crown Packaging Tech., Inc. v. Ball Metal BeverageContainer Corp., 635 F.3d 1373 (Fed. Cir. 2011) (citing Revolution Eyeware, Inc. v. Aspex Eyewear,Inc., 563 F.3d 1358 (Fed. Cir. 2009) (reversing a summary judgment that found claims invalid wherethe patent identified two problems but claimed a solution to only one of them)).The court repeated such analysis this year in Atlantic Research Marketing Sys., Inc. v. Troy, 659F.3d 1345 (Fed. Cir. 2011). The invention there related to a shield that wraps around the barrel of1-9

Chapter 1 – Federal Circuit Year in Review 2011-2012a machine gun to permit the attachment of things (e.g., laser sights) that cannot be attached to thebarrel. The patent showed a shield that attaches at two points upstream of the barrel (points A and B)but the claims only recited attachment at point A (and thus did not require attachment at B). The accuseddevice attached only at point A. The Federal Circuit’s opinion spent most of its time on claimconstruction, and then simply cited ICU Medical when invalidating the claims, but did not provideany real analysis or discussion on the written description point.So what is there to learn from this? Simply that at least some members of the Federal Circuitconsider the omitted element test in this type of factual situation to be a closed case (but that others,like Judge Newman, think the opposite). This is unfortunate because the omitted element test is oneof the most complicated in patent law, and deserves deeper thought than it is being given.PRACTICE TIPFor your purposes, be very aware of the omitted element test whendrafting claims, and in litigation, always be on the look-out for featuresthat have been removed from claims if you see broadening amendments,continuations, or new claims in the prosecution file.§ 1.4 I Do Declare! That Declaratory Judgment Jurisdictionis BroadIn 2006, the U.S. Supreme Court broadened the Federal Circuit’s standard for declaratory judgment(DJ) jurisdiction in Medimmune, Inc. v. Genentech, Inc., 549 U.S. 118 (2006). Medimmunerevolved around a license dispute between two parties, and more particularly around whether the DJplaintiff had to breach the license before suing. But the decision has had the biggest effect on situationsin which patentees charge others with infringement and seek payment. Previously, the targetedparty could not file a DJ complaint unless it showed some threatening action by the patentee like acharge of infringement and that it had a reasonable apprehension that the patentee would file suit.So the patentee could be careful to cabin its language to threaten the other party but not subject itselfto suit. Medimmune removed that “reasonable apprehension of suit” requirement and told the courtsto look at all the circumstances to determine whether a sufficient dispute exists between the parties.The Federal Circuit has followed Medimmune by loosening its own standards for DJ jurisdiction,stating in its broadest pronouncement until this past year that:[W]here a patentee asserts rights under a patent based on certain identified ongoingor planned activity of another party, and where that party contends that it has the1-10

the IP Book 2012right to engage in the accused activity without a license, an Article III case or controversywill arise and the party need not risk a suit for infringement by engagingin the identified activity before seeking a declaration of its legal rights.SanDisk Corp. v. ST Microelectronics, Inc., 480 F.3d 1372, 1381 (Fed. Cir. 2007).This statement from SanDisk did not stop a district court from dismissing a DJ suit that 3Mbrought after its competitor Avery Dennison’s chief patent counsel told 3M’s chief patent counselthat particular 3M products “might infringe” certain reissue patents owned by Avery Dennison. Thedistrict court was moved by the fact that 3M did not sue until more than a year after the initial discussions.3M argued to the Federal Circuit that the passage of time was not dispositive because the legaldispute still existed—i.e., 3M was still selling the accused products and Avery refused to provide acovenant not to sue. The Federal Circuit agreed with 3M’s argument in 3M Co. v. Avery DennisonCorp., 673 F.3d 1372 (Fed. Cir. 2012), holding that DJ jurisdiction requires more than just “a communicationfrom a patent owner to another party, merely identifying its patent and the other party’sproduct line.” But 3M had more because Avery had also indicated that it had performed an analysisof 3M’s products and was willing to provide claim charts (though it never did send the charts). Andas 3M noted, the delay in filing suit was not fatal according to the Federal Circuit.The 3M decision marks a high-water mark in DJ jurisdiction and serves as a warning to patenteesthat send cease-and-desist letters to others. First, it seems that most communications directedto serious licensing discussions would also raise the specter of DJ jurisdiction (i.e., there is no wayto put another party on notice without creating DJ jurisdiction)—and perhaps it should be that way.Parties can certainly enter stand-still agreements or other mechanisms to encourage open discussionin such situations, while protecting their rights. And the law should be properly balanced so that apatentee cannot put a target on notice and begin accruing damages when the target has no rights. But3M serves as a real warning for patentees to not start mixing it up unless they are ready to followthrough.§ 1.5 Reexamination Grows UpIf you check the USPTO and Federal Circuit dockets, you’ll see them chock full of reexaminationappeals. Reexaminations have been growing in popularity since inter partes reexamination wasadded as a strategic tool, and as parties have learned how to use reexamination as part of a broaderstrategic plan in combination with litigation. So any competent patent attorney needs to understandthe peculiar ins-and-outs of reexamination as much as they already understand Sections 101 and 102.1-11

the IP Book 2012Intervening rights arise when a patentee amends claims in reexamination. The intervening rights aredefensive rights given to third parties to protect them when they took action before the amendedclaims issued, perhaps in reliance on a belief that the original claims were invalid. Intervening rightsdepend on a change in scope of the claims, and the question on appeal in Marine Polymer waswhether such a change in scope can occur without a claim amendment—e.g., as a result of a patenteemaking a disclaimer or similar argument during prosecution. The en banc court found itself boundby the wording of the statute to hold that intervening rights can only arise if there is an actual claimamendment, even if that is an inequitable result:To be sure, patent applicants’ actions and arguments during prosecution, includingprosecution in a reexamination proceeding, can affect the proper interpretation andeffective scope of their claims. But in rejecting HemCon’s request for interveningrights, we are not here interpreting claims. Rather, we are interpreting a statute thatprovides for intervening rights following reexamination only as to “amended ornew” claims.Id. at 1365. The court took solace in its belief that the PTO’s reexamination unit is smart enough torequire patentees to actually amend their claims if they want the claims limited: “[i]f, in reexamination,an examiner determines that particular claims are invalid and need amendment to be allowable,one would expect an examiner to require amendment rather than accept argument alone.” Id. at 1364.§ 1.6 Say What You MeansThe Federal Circuit’s case law on means-plus-function claiming continues to advance, and willdo so until the patents drafted in the golden years of means-plus-function claiming expire. A firstcase reiterates that the “corresponding structure” for such a claim limitation will be only the structureactually disclosed in the specification, and not some additional structure that skilled artisansmay have been able to add to the disclosed structure. More specifically, in Mettler-Toledo, Inc. v.B-Tek Scales, LLC, 671 F.3d 1291, 1296 (Fed. Cir. 2012), the court noted: “[i]f a patentee chooses todisclose a single embodiment, then any means-plus-function claim limitation will be limited to thesingle disclosed structure and equivalents thereof.”The Federal Circuit also continues to invalidate means-plus-function claims as indefinite whenthe patent does not disclose adequate corresponding structure. For example, in Ergo Licensing, LLCv. CareFusion 303, Inc., 673 F.3d 1361 (Fed. Cir. 2012), the court held that a recited “control meansfor controlling [an] adjusting means” was not adequately supported by a specification that discussedcomputers but not algorithms:If special programming is required for a general purpose computer to perform thecorresponding claimed function, then the default rule requiring disclosure of an1-13

Chapter 1 – Federal Circuit Year in Review 2011-2012algorithm applies. It is only in the rare circumstances where any general-purposecomputer without any special programming can perform the function that an algorithmneed not be disclosed.Id. at 1365. Judge Newman dissented, basically arguing that the majority’s holding punishes patenteesby exalting form over substance.And in In re Aoyama, 656 F.3d 1293 (Fed. Cir. 2011), the Federal Circuit invalidated claims to a“reverse logistic means” that generates “transfer data.” The applicant pointed to a flow chart as supposedcorresponding structure, but the Federal Circuit noted that the flow chart identified a numberof results without describing how to achieve the results.Practice TipThe court’s new-found aggressiveness with respect to finding limitationsto be in a means-plus-function format, and then to invalidate suchclaims, is important, and suggests that defendants should be aggressivein this area. For example, defendants that face Beauregard claims(claims that recite a recordable media storing instructions that performcertain method steps when they are executed) may want to arguethat they impermissibly use wholly functional claiming in an apparatusclaim. Or defendants that face software claims that do not use the word“means” may nonetheless want to argue that the claim limitations areworded wholly in functional terms, and thus are subject to means-plusfunctiontreatment.§ 1.7 Inequitable ConductSince the en banc Therasense decision significantly raised the bar for proving inequitable conduct,there has been a predictable decline in the number of inequitable conduct decisions from theFederal Circuit (presumably, defendants are taking a shot at the district court level, and then droppingthe issue if they lose). But there is still room for a court to find inequitable conduct in appropriatesituations. For example, the court affirmed a finding of inequitable conduct in Aventis PharmaS.A. v. Hospira, Inc., 675 F.3d 1324 (Fed. Cir. 2012). The issue of materiality was easy (even underthe Therasense “but for” standard) because the district court had found certain of the claims invalidover the withheld prior art. As for deceptive intent, the district court expressly identified the inventor1-14

the IP Book 2012as lacking credibility, and cited evidence that the inventor truly did understand the withheld prior artto be valuable.PRACTICE TIPWhen the district court sets the issue up properly, the Federal Circuitwill still affirm a finding of inequitable conduct.The court is, however, applying Therasense’s “but for” materiality test in other cases. For example,in Powell v. Home Depot U.S.A., Inc., 663 F.3d 1221 (Fed. Cir. 2011), the court noted thatfailure to update a petition to make special, based on a change in facts that undermined the basisfor the petition, is not “but for” material, because it had nothing to do with whether the claims wereallowed or not, and it also did not rise to the level of “affirmative egregious misconduct” under theonly other pathway to materiality.PRACTICE TIPAll the normal rules for inequitable conduct still apply, but with a warningto apply them more sanely. If you are a prosecutor, continue doingthe right thing, and if you are a litigator who sees wrongful conduct,pursue it—but balance your exuberance against the new reality.§ 1.8 Preliminary InjunctionsPreliminary injunctions have always been hard to get in patent cases—perhaps because districtcourts can avoid dealing with the complex technical and patent issues by simply denying an injunctionbased on lack of irreparable harm. But in important cases, they do come up—like when Applesues Samsung for allegedly copying the iPhone and iPad. The district court denied the preliminaryinjunction and the Federal Circuit affirmed after finding that Apple had not shown a nexus betweenthe alleged infringement and any allegedly irreparable harm: “[i]f the patented feature does not drivethe demand for the product, sales would be lost even if the offending feature were absent from theaccused product. Thus, a likelihood of irreparable harm cannot be shown if sales would be lost regardlessof the infringing conduct.” Apple, Inc. v. Samsung Electronics Co., 678 F.3d 1314 (Fed. Cir.2012). This can be a very exacting standard because products that are successful across a wide range1-15

Chapter 1 – Federal Circuit Year in Review 2011-2012of people generally have numerous positive features that each might be the make-it-or-break-it factorfor a subset of buyers. Thus, no one feature is likely to be the single driver of consumer demand.But, in Celsis In Vitro, Inc. v. CellzDirect, Inc., 664 F.3d 922 (Fed. Cir. 2012), the Federal Circuitupheld a preliminary injunction entered against a defendant, relying on the deferential standard ofreview that such an issue receives, and on the district court’s solid nonobviousness conclusion. JudgeGajarsa dissented, noting that the defendant, to avoid an injunction, only had to prove obviousnessby a preponderance of the evidence, and opining that the invention was “nothing more than a repetitionof steps already known in the art.”§ 1.9 Prosecution FunThe Federal Circuit decides a number of cases each year that affect prosecution, but in this cycle,one stands out. In In re Stepan Co., 660 F.3d 1341 (Fed. Cir. 2011), the court considered when thePatent Board can change a rejection made by an examiner and still affirm the rejection, and whenthe board has changed the rejection so much that the patentee deserves a chance at more prosecutionwith the examiner. Specifically, the examiner had dismissed Stepan’s Rule 131 affidavit after determiningthat a prior public use of the invention qualified as Section 102(b) prior art. The board, incontrast, allowed the applicant to claim priority to an earlier application, so that the rejection becamea Section 102(a) rejection, but the board dismissed the affidavit as being substantively insufficient.The Federal Circuit held that the board’s decision on the affidavit was a new factual finding thatmade for a new ground of rejection, which in turn required new notice and opportunity to respondfor Stepan because notice:Id. at 1346.focuses on the “adverse decisions of examiners” during prosecution which formthe basis of the Board’s scope of review. 35 U.S.C. § 6(b). Because Stepan did nothave prior notice of the Board’s intent to craft and rely on new findings of fact tosupport a §§ 102(a)/103(a) rejection and because it failed to identify this rejectionas a new ground, Stepan’s notice rights were violated. 5 U.S.C. § 554(b)(3); 35U.S.C. § 6(b). Had the Board labeled its rejection as a new ground of rejection,Stepan could have reopened prosecution to address the newly-alleged deficienciesin its Declaration with the examiner.Applicants should be aware of this decision because the board frequently sees rejections it doesnot like and has to act to clean them up. Now, applicants have some ammunition if that clean-up istoo extensive.1-16

the IP Book 2012The U.S. Supreme Court also issued an important prosecution decision, Kappos v. Hyatt, 566U.S. ____, 132 S. Ct. 1690 (2012). The case concerned 35 U.S.C. § 145, by which a patent applicantwho loses at the Patent Board can file a civil action in district court instead of appealing immediatelyto the Federal Circuit. The issue was the sort of evidence the applicant can raise for the first timein the action—i.e., effectively any evidence it wants, or only evidence it could not practically haveraised in the patent office. The Supreme Court agreed with the Federal Circuit and with Hyatt that itwas the former—that the applicant’s ability to introduce new evidence was limited only by the FederalRules of Evidence and Civil Procedure. What does this holding mean? Well, looking backward,very few applicants took advantage of Section 145—on the order of teens per year, with a third ofthose cases coming from Hyatt. But moving forward, applicants may find an advantage in holdingcertain evidence from the technical experts at the patent office in order to get a first review from afederal judge. Thus, as a prosecutor, you can advise your clients about another option that is availableto them—in a patent landscape that is becoming full of complex options and strategies.1-17

theIP bookChapter 2the IP Book 2012On the Road to PatentHarmonization:An Overview of the AIA and Its Impact onPatent Applicants, Owners and PractitionersBrad D. PedersenDavid HannaPatterson Thuente Christensen Pedersen, P.A.Minneapolis§ 2.1 INTRODUCTIONFor the general public, the Leahy-Smith America Invents Act of 2011 (AIA) has been publicizedas a package of reforms that should improve the U.S. patent system. In theory, these improvementswill happen by moving the U.S. patent system closer toward harmonization with other patent systemsaround the world, and by addressing acknowledged problems in the way that the United StatesPatent and Trademark Office (USPTO) sets fees, as well as the ways that the validity of patents canbe challenged at the USPTO instead of in the courts. The ultimate goal of these changes is to encourageinvestment in innovation and, as a result, stimulate job growth.For inventors, patent owners and patent professionals, the AIA represents the biggest set ofchanges to happen to U.S. patent laws since 1836. Initially introduced into Congress in 2005, thefinal bill as signed into law on September 16, 2011, includes three major changes along with a widevariety of other, less significant, changes. Most of the high-profile changes associated with patentlitigation issues, which were included in previous versions of the bills, were ultimately rejected2-19

Chapter 2 – On the Road to Patent Harmonizationand left on the congressional cutting-room floor. Even with all that was cut out, the final bill wasstill more than 150 pages long. See Leahy-Smith America Invents Act, Pub. L. No. 112-29, 125Stat. 284 (2011), available at .Given that many of the major changes are phased in over time and apply prospectively to newly filedpatent applications, it could be a decade or more before the true impact of these changes to the U.S.patent system can be evaluated.This chapter provides an overview of the AIA, and goes into more detail on the shift to a firstinventor-to-filepatent system and the revamped post-issuance proceedings. The chapter points tosome of the changes in best practices for inventors, patent owners and patent professionals that mayhappen as a result of the AIA.§ 2.2 THE MAIN CHANGESThe three major changes to the U.S. patent system that will be implemented under the AIA are:(1) first-inventor-to-file; (2) fee setting, but not fee spending, authority; and (3) revamped processesfor challenging validity at the USPTO.A. First-Inventor-to-FileThe AIA changes the U.S. from the current first-to-invent (FTI) patent system to a first-inventor-to-file(FITF) patent system with a first-to-publish (FTP) grace period by significantly rewritingnew 35 U.S.C. § 102. The new FITF system applies to any application, provisional, new utilityor continuing application, filed after March 16, 2013—the cutover date. For continuing applicationsthat claim priority to cases filed prior to March 16, 2013, the new FITF system will apply for anyclaims in the continuing application that claim subject matter fully supported by an applicationfiled before the cutover date. For applications that include claims having effective priority datesboth before and after the cutover date, the proposed rules indicate that the USPTO will apply pre-AIA law and AIA law to these applications on a claim-by-claim basis depending upon the effectivepriority date of each claim. See, Changes to Implement the First Inventor to File Provisions of theLeahy-Smith America Invents Act, 77 Fed. Reg. 43742 et seq. (proposed July 26, 2012) (hereinafter“Proposed FITF Rules”), and Examination Guidelines for Implementing the First Inventor to FileProvisions the Leahy-Smith America Invents Act, 77 Fed. Reg. 43759 et seq. (proposed July 26,2012) (hereinafter “Proposed FITF Examination Guidelines”).2-20

the IP Book 2012Practice TipPre-AIA law will apply to any continuation-in-part (CIP) or divisionalapplication filed after the cutover and claiming priority to a case filedbefore the cutover; but, a CIP or converted provisional application filedafter the cutover may be governed by either AIA or pre-AIA law dependingupon the effective priority date of each claim.The drafters of the new 35 U.S.C. § 102 sought to simplify the provisions for what is andis not prior art under the new FITF system by defining just two types of prior art and then delineatinga limited number of exceptions to those definitions. Robert A. Armitage, Understanding theAmerica Invents Act & Its Implications for Patenting, 40 Aipla Q.J. 1 (2012). The two types ofprior art under the new FITF system are publicly available prior art as defined by new 35 U.S.C.§ 102(a)(1) and patent filing prior art as defined by new 35 U.S.C. § 102(a)(2). So, prior art existsunder new 35 U.S.C. § 102(a) if a disclosure establishes that:(1) the claimed invention was patented, described in a printed publication, orin public use, on sale, or otherwise available to the public before the effectivefiling date..., [or](2) the claimed invention was described in a patent issued under section 151,or in an application for patent published or deemed published under section122(b), in which the patent or application, as the case may be, names anotherinventor and was effectively filed before the effective filing date ....New 35 U.S.C. § 102(a)(1) and (2) (emphasis added).A disclosure of the claimed invention that was publicly available anywhere in the worldbefore the effective filing date of that claimed invention is publicly available prior art under new 35U.S.C. § 102(a)(1). And, a disclosure of the claimed invention that was described in a later-publishedU.S. patent or patent application, or a PCT patent application designating the U.S., of another inventorthat was effectively filed before the inventor’s effective filing date is patent filing prior art undernew 35 U.S.C. § 102(a)(1). It is important to note the terms highlighted in bold above—“claimedinvention,” “effective filing date,” “inventor,” and “effectively filed”—have all been expressly definedin new 35 U.S.C. § 101, and those definitions are critical to understanding the scope of bothtypes of prior art.2-21

Chapter 2 – On the Road to Patent HarmonizationThe change to a FITF system brings the United States closer to, but not into completeharmonization with, other FTI patent systems around the world. Brad Pedersen & Justin Woo, The‘Matrix’ for First-Inventor-to-File: An Experimental Investigation into Proposed Changes in U.S.Patent Law, 1 Cybaris An Intell. Prop. L. Rev. 1 (2010), available at .By focusing only on what is publicly accessible, the various kinds of “secret” prior art thathad been available under the old 35 U.S.C. § 102, such as offers for sale and prior, non-public invention,may not be considered prior art for patent applications governed by the AIA. David J. Kappos,Examination Guidelines for Implementing the First-Inventor-to-File Provisions of the Leahy-SmithAmerica Invents Act, U.S. Patent & Trademark Office 22 (July 17, 2012), available at (last updated July 26, 2012). The FITFsystem under the AIA eliminates the Hilmer doctrine and accords foreign national applications theirforeign filing date if they are filed directly in the U.S. or as a PCT application designating the U.S.and published in one of the 10 current official PCT languages. The change to FITF also phases outinterference proceedings and replaces them with a new “derivation” proceeding for claims governedby the AIA. Proposed FITF Rules, 77 Fed. Reg. at 46627; New 35 U.S.C. § 135.The following figures depict what will be publicly available and patent filing prior art, bothdomestically and internationally under the new FITF system.Figure 1A2-22

the IP Book 2012Figure 1BIn addition to simplifying and harmonizing what is prior art, the AIA also tries to simplifywhat will not be considered prior art by new 35 U.S.C. § 102(b), which defines the exceptions tothe two types of prior art. New 35 U.S.C. § 102(b)(1) describes two exceptions that apply only topublicly available prior art, and new 35 U.S.C. § 102(b)(2) describes three exceptions that apply onlyto patent filing prior art. For publicly available prior art, a disclosure under new 35 U.S.C. § 102(a)(1) is excepted from being considered prior art for a given patent application by an inventor if thepublicly available art is not more than one year prior to the effective filing date of the given patentapplication, and:(A) the disclosure was made by the inventor or joint inventor or by anotherwho obtained the subject matter disclosed directly or indirectly from the inventoror a joint inventor [or](B) the subject matter disclosed had, before such disclosure, been publiclydisclosed by the inventor or a joint inventor or another who obtained the subjectmatter disclosed directly or indirectly from the inventor or a joint inventor.New 35 U.S.C. § 102(b)(1)(A) and (B) (emphasis added).The first exception for publicly available prior art under new 35 U.S.C. § 102(b)(1)(A) applieswhen the publicly available prior art represents the inventor’s own work. In this exception, afull one-year grace period is given to the inventor, just like under the current 35 U.S.C. § 102(b) pro-2-23

Chapter 2 – On the Road to Patent Harmonizationvision. The second exception for publicly available prior art under new 35 U.S.C. § 102(b)(1)(B) applieswhen the publicly available prior art represents a subsequent disclosure by anyone else. In thisexception, independently developed third-party publicly available prior art will not be consideredprior art for a given patent application if the subject matter had previously been publicly disclosed byor for the inventor. This second exception to publicly available prior art establishes a first to publish(FTP) grace period that creates a less than one-year grace period which applies to publicly availableprior art of others, but the FTP grace period only starts after the inventor was the first to publish thesubject matter that later becomes publicly available prior art by another.For patent filing prior art, a disclosure made in a patent filing under new 35 U.S.C. § 102(a)(2) is excepted from being considered prior art for a given patent application by an inventor if:(A) the subject matter disclosed was obtained directly or indirectly from theinventor or a joint inventor [or](B) the subject matter disclosed had, before such subject matter was effectivelyfiled under subsection (a)(2), been publicly disclosed by the inventor or a jointinventor or another who obtained the subject matter disclosed directly or indirectlyfrom the inventor or a joint inventor [or](C) the subject matter disclosed and the claimed invention, not later than theeffective filing date of the claimed invention, were owned by the same personor subject to an obligation.New 35 U.S.C. § 102(a)(2) (emphasis added).The first exception for patent filing prior art under new 35 U.S.C. § 102(b)(2)(A) applies whenthe patent filing of another actually represents the inventor’s own work that was directly or indirectlyobtained from the inventor. The second exception for patent filing prior art under new 35 U.S.C.§ 102(b)(2)(B) applies to the FTP grace period to patent filings of others that pre-date the effectivefiling date of the inventor’s application, but post-date a publication made by or for the inventor thattriggers the FTP grace period. If a patent filing by another is within that window (before the effectivefiling date but after start of the FTP grace period), then the second exception can remove thatfiling as prior art for purposes of evaluating the patentability of the inventor’s application. The thirdexception for patent filing prior art under new 35 U.S.C. § 102(b)(2)(C) incorporates the so-called“team exception” of old 35 U.S.C. § 103(c) where the patent filings of others working for the samecompany or for a joint research and development project cannot be used as prior art. The “team exception,”however, now applies not only to issues of obviousness, but also anticipation, and the timeperiod for when parties must be on the same team starts as of the filing date, not the date of invention.2-24

the IP Book 2012The single biggest change under the FITF system for patent practitioners who prosecutepatent applications is the elimination of “swearing behind” as an option for removing prior art thatwas between a date of invention and a filing date. The second biggest change under the FITF systemis the proactive publication that is required to trigger the FTP grace periods. The impact of each ofthese changes is depicted in the following scenarios.2-25

Chapter 2 – On the Road to Patent HarmonizationPractice TipThe two biggest changes under the new FITF system are: (1) the lossof the “swearing behind” option, and (2) the proactive publication triggerrequired for starting the FTP grace period.For additional scenarios illustrating the impact of these and other AIA changes, see BradD. Pedersen, The America Invents Act (AIA): More Complicated than 3D Chess? (Mar. 28, 2012),available at .The USPTO has recently promulgated proposed Rules and Examination Guidelines for theFITF provisions of the AIA. David Kappos, Changes to Implement the First Inventor to File Provisionsof the Leahy-Smith America Invents Act, U.S. Patent & Trademark Office (July 17, 2012),available at (last updatedJuly 26, 2012); David J. Kappos, Examination Guidelines for Implementing the First-Inventor-to-File Provisions of the Leahy-Smith America Invents Act, U.S. Patent & Trademark Office (July 17,2012), available at (last updatedJuly 26, 2012).In general, the proposed rules for FITF adopt an applicant-proactive approach by askingapplicants to provide within four months of the application filing date: (i) a certified copy of any foreignpriority application (Proposed FITF Rules, 77 Fed. Reg. 43742, 43754–55 (proposed July 26,2012) (to be codified at 37 C.F.R. pt. 1)), (ii) an indication of which law will apply, pre-AIA or AIA,for each claim (id. at 43755–56), (iii) copies of any public disclosures that may be used to invokethe FTP grace periods (id. at 43755), and (iv) whether the application is eligible for the so-called“team” exception with respect to cases that are commonly assigned. Id. at 43757–58. The incentivesfor these early submissions include according them a presumption of correctness without furthersubstantiation. Applicants will have the ability to later rebut a cited reference in a rejection based onchoice of law or invocation of an FTP grace period or team exception provision, but only by submittinga declaration, with supporting evidence about the relationship of the disclosure to the inventorsand the public nature of the disclosure. Id. at 43755–56. Going forward, Rule 1.130 will be for AIAdeclarations about FITF cases, and Rule 1.131 will be for pre-AIA declarations about FTI cases.The USPTO also has proposed a very narrow application of the FTP grace period againstothers. As proposed, the USPTO would only allow the use of the FTP grace period against others in2-26

the IP Book 2012situations where there are not even insubstantial or trivial differences in the subject matter used toinvoke the FTP grace period and the subject matter of others that was first publicly available duringthe FTP grace period. David J. Kappos, Examination Guidelines for Implementing the First-Inventor-to-FileProvisions of the Leahy-Smith America Invents Act, U.S. Patent & Trademark Office31 (July 17, 2012), available at (last updated July 26, 2012). This is an issue for which there is likely to be significant commentand debate as the question of whether the FTP grace period should be accorded a narrow or broadinterpretation under the AIA has been squarely presented by witnesses testifying to both the Houseand Senate Judiciary Committees during hearings in May and June 2012. Implementation of theLeahy-Smith America Invents Act and International Harmonization Efforts Before the S. Comm. onthe Judiciary (June 20, 2012) (statement of David J. Kappos, Secretary of Commerce for IntellectualProperty & Director, United States Patent & Trademark Office), available at . The proposed examination guidelinesmay also create challenges for applicants who have prior publications, as there will be a working presumptionthat any authors named on a publication that may be exempt under the FTP grace periodswill be assumed to be inventors on the corresponding patent application. Id. at 26.Another issue in the recently proposed regulations and guidelines for FITF is whether ornot a sale of technology that is not otherwise publicly available (so-called “secret prior art”) shouldbe considered prior art under the AIA. On this issue, the USPTO is seeking comment from the publicon whether or not secret prior art based solely on the sale of a product is in fact prior art goingforward under the AIA. David J. Kappos, Examination Guidelines for Implementing the First-Inventor-to-FileProvisions of the Leahy-Smith America Invents Act, U.S. Patent & Trademark Office20 (July 17, 2012), available at (last updated July 26, 2012).All of the new Section 102 provisions require considerable and careful study, includingreading and rereading the language many times, before the full import of the changes made in theFITF system can be appreciated. The provisions dealing with the FTP grace period are a good exampleof how a quick read of the new statutory language can lead to misconceptions about what is beingsaid in these provisions. The language of new 35 U.S.C. § 102(b)(1)(B) uses the terms “disclosed”and “disclosure” four times, but in reference to only two different disclosures—the disclosure ofanother that is being evaluated for whether the exception applies, and the disclosure by or for theinventor that is required to trigger the start of the FTP grace period. But the language at the end ofthe subsection about obtained directly or indirectly from the inventor does not apply to the disclosureof another being evaluated; that language only applies to the disclosure by or for the inventor that isrequired to trigger the start of the FTP grace period.2-27

Chapter 2 – On the Road to Patent HarmonizationThe changeover to the new FITF system goes into effect on March 16, 2013. AIA§ 3(n)(1). However, given that the FTP grace period can begin up to 12 months before then, an understandingof the new FITF system is already a must for patent professionals and inventors.Practice TipNew 35 U.S.C. § 102 that implements FITF is concise, but complex.Practitioners need to spend the time studying and understanding thisstatute before it goes into effect on March 16, 2013. There are manypotential pitfalls and complexities for anyone who unknowingly files applicationswith priority dates that bridge across this cutover date.B. Fee Setting, But Not Fee Spending, AuthorityWhile the Senate version of the bill would have completely ended what has come to beknown as “fee diversion” or the ability for Congress to divert to the general tax fund any moniescollected by the USPTO above the appropriated budget in a given fiscal year, the final version of theAIA falls short of giving the USPTO complete control over its funding and spending. The USPTOnow has the ability to set its own fees, subject to public hearings and congressional oversight. AIA§ 10(a)(1). But any excess monies collected will be deposited in a specific trust account that wouldrequire congressional authorization before the USPTO could access those funds. New 35 U.S.C.§ 42(c)(2). A sunset provision ends this authority in seven years. AIA § 10(i)(2). The current schedulefor the USPTO fee-setting authority to be fully implemented should happen by February 2013.C. Revamped Processes for Challenging Validity at the USPTOThe AIA phases out existing inter partes reexamination proceedings and, in its place, createsseveral new post-issuance review proceedings: post-grant review, inter partes review, and thetransitional program for covered business method patents. It also gives patent owners a new optionto effectively “cleanse” a patent from specific charges of inequitable conduct by requesting asupplemental examination. In addition, the AIA provides a meaningful opportunity for third partiesto submit prior art during the entire examination of a patent application, including the ability andrequirement to comment on the relevance of the submitted art.2-28

the IP Book 20121. New Review ProceedingsMajor changes were made by the AIA to the manner in which post-issuance proceedingswill be conducted by the USPTO. These changes were primarily in response to a general sensethat the decade-long experiment with inter partes reexamination has failed to achieve the ideal of amore efficient and less expensive alternative to patent litigation. To address these concerns, the AIAprovides for a new set of “review” proceedings and changes interference proceedings to derivationproceedings.The new post-issuance review proceedings are designed to provide a more effective optionfor determining patent validity at the USPTO by imposing a statutory one-year timeline on the“trial” phase of the proceedings and by having them run by an administrative patent judge (APJ) asan adjudication rather than an examination. The adjudication process provides for limited/manageddiscovery and an oral hearing with a preponderance of the evidence burden of proof applied to themoving party on any motions. The APJs who will run these new kinds of proceedings are part ofthe Board of Patent Appeals and Interferences (BPAI), which is now renamed the Patent Trial andAppeal Board (PTAB).Different sections of the AIA show how U.S. patent law will change from the currentregime of ex parte reexamination (EPX) and inter partes reexamination (IPX) to a new regime thatstill includes EPX proceedings, but replaces IPX proceedings with three different kinds of “review”proceedings—post-grant review (PGR) (only for FITF patents and then only in the first nine monthsafter issuance to challenge any issues), inter partes review (IPR) (for all patents regardless of prioritydate but only after the first nine months from issuance and only based on printed publications orpatent owner statements), and covered business method patent review (CBM) (at any time for allpatents regardless of priority date, but only by parties charged with infringement to raise any issueon asserted business method patents, including Section 101 issues).IPR is the most limited of the new review proceedings, similar to the scope of currentIPX that can be initiated only after a so-called “first window” of nine months after issuance, and notmore than one year into any co-pending litigation. New 35 U.S.C. § 315(b). PGR is a more expansiveproceeding that can be initiated only during the first window of nine months after issuance. Anygrounds of invalidity can be raised in PGR, and the standard for initiating such a review is higherthan for IPR as the petitioner must prove that the invalidity of the patent at issue is more likely thannot. New 35 U.S.C. § 324(a). CBM uses the same procedures as PGR, but can be invoked only bysomeone sued or threatened with a patent covering non-technological aspects of financial transactions.AIA § 18(a)(1)(B).All of the new review proceedings technically begin one year after enactment of theAIA—on September 16, 2012. AIA § 6(c)(2)(B) (IPR); AIA § 6(f)(2)(A) (PGR); AIA § 18(b)(1)2-29

Chapter 2 – On the Road to Patent Harmonization(CBM). IPR proceedings will apply to all issued patents, instead of only patents issued after November1999 like the current IPX proceedings. See AIA § 6(c)(2)(A). Because PGR only applies topatents issued under the new FITF patent system that goes into effect on March 16, 2013, the rolloutof PGR proceedings will naturally be delayed and more gradual. See AIA § 6(f)(2)(A). CBM proceedingswill use the same procedures as PGR and likely will form the bulk of the early uses of PGRproceedings until more FITF patents are granted, but CBM proceedings are transitional in nature asthere is a sunset provision that repeals CBM proceedings after eight years. AIA § 18(a)(3)(b).If all of these changes work as envisioned, it should mean that the new review proceedingswill become a separate path for challenging patent validity that runs in series with patent litigationto arrive at a single, less expensive resolution; rather than the current approach, which has seenpatent reexaminations being used as a simultaneous, parallel-path decision process that sometimescan create different outcomes. Whether demand for these new review proceedings will be a trickleor a torrent is uncertain and may depend on how potential patent infringement defendants view thesuccesses and failures of the early adopters of these proceedings.Table I presents an overall comparison of the various features of EPX, IPX, IPR, PGRand CBM proceedings with respect to: (i) thresholds for initiating the proceeding, (ii) timing forinitiating the proceeding, (iii) patents covered by the proceeding, (iv) scope, grounds and basis forreview in the proceeding, and (v) estoppel effect of the proceeding.Ex ParteReexam(EPX)Inter PartesReexam(IPX)Inter PartesReview(IPR)Post-GrantReview(PGR)Sec. 18Proceeding(CBM)Threshold• 35 U.S.C.§ 303(a) (currentlaw): Substantialnew questionof patentability(SNQ)• Reasonablelikelihood ofprevailing (RLP)• SNQ continuesto apply topre-9/16/11requests• 35 U.S.C.§ 314(a): RLP• 35 U.S.C.§ 315(a): Hasnot “filed” a civilaction challengingvalidity• 35 U.S.C.§ 324(a):“Morelikely than not”(MLTN) that atleast one claim isunpatentable• 35 § 325(a)(1)Must not havefiled a civil actionchallengingvalidity• Sec. 18(a)(1)(B):must be suedor charged withinfringement• Otherwise sameas PGR2-30

the IP Book 2012Ex ParteReexam(EPX)Inter PartesReexam(IPX)Inter PartesReview(IPR)Timing • Any time • Any time • 35 U.S.C.§ 311(c)• After later of:- Nine monthsafter issuance(reissuance); or- PGR isterminatedPatents Covered All Filed post Nov.1999Scope, Grounds,Basis for ReviewEstoppel:• Civil actions• ITC• PTOTable I• 35 U.S.C.§§ 302 and 301(current law):Patents andprintedpublications• None• 35 U.S.C.§§ 311(a) and301 (currentlaw): Patents andprintedpublications• 35 U.S.C.§ 315(c) (currentlaw): “Raised orcould have raised”• Applies to civilactions, not ITC• Also not to PTOAll patents• 35 U.S.C.§ 311(b): Patentsor printedpublications• 35 U.S.C.§ 312(a)(3)(B):Can be supportedby expertopinions,affidavits, etc.• 35 U.S.C.§ 315(e):• “Raised orreasonably couldhave raised”(RORCHR)• May not “assert”issue• Final writtendecision• Civil actions, ITC& PTOPost-GrantReview(PGR)• 35 U.S.C.§ 321(c): lessthan nine monthsafterissuance (orreissuance)• 35 U.S.C.§ 325(f): Nochallenge tonon-broadenedreissue claimsafter originalnine-month PGRperiodOnly FTFG patentissued under theAIA• 35 U.S.C.§ 321(b): Issuesrelating toinvalidity under§ 282(b)(2) or (3)• 35 U.S.C.§ 324(b): Novel orunsettled questionimportant to otherpatents or patentapplications• 35 U.S.C.§ 325(e):• RORCHR• May not “assert”issue• Final writtendecision• Civil actions, ITC& PTOSec. 18Proceeding(CBM)• Sec. 18(a)(1)(B):• Any time aftersuit or charge ofinfringement• Sec. 18(a)(1)(A)/(d):• “Coveredbusiness methodpatents”• Not“technologicalinventions”• Same as PGR• Sec. 18(a)(1)(D):• Any ground“raised” (notRORCHR)• Otherwise sameas PGR2-31

Chapter 2 – On the Road to Patent Harmonizationa. Thresholds and Timing for Review ProceedingsIt is important to understand the terminology and timing that will be used in thesenew review proceedings. A typical timeline for a “proceeding” is shown in Figure 3 that includes aninitial petition phase (three-six months) and the subsequent trial phase (12 months). A “petitioner” isthe party seeking to initiate a review proceeding by filing a “petition,” and the “owner” is the patentowner. An APJ assigned to the case will determine whether the relevant threshold for initiating thereview proceeding has been met and decide whether to institute a trial for the proceeding.PetitionFiledPOPreliminaryResponseDecisiononPetitionPO Response& Motions toAmend ClaimsPetitionerReply to POResponse &OppositiontoAmendmentPO Replyto Oppositionto AmendmentGrandHearingFinalWrittenDecisionNo more thanThree months Three months Three months One monththree monthsPODiscoveryPeriodPetitionerDiscoveryPeriodPODiscoveryPeriodHearingSet onRequestPeriod forObservationsand Motions toExclude EvidenceFigure 2 – Petition and Trial PhaseNo more than 12 monthsLike current IPX proceedings, an IPR petition can only be based on a ground thatcould be raised under the provisions of the relevant new or old 35 U.S.C. § 102 or § 103, and onlyon the basis of prior art consisting of patents or printed publications. New 35 U.S.C. § 311(b); 37C.F.R. § 42.104(b)(2) (2012); new 35 U.S.C. § 314(a). To meet the threshold to initiate a trial, an IPRpetition must demonstrate a reasonable likelihood that the petitioner would prevail as to at least oneof the claims challenged. 37 C.F.R. § 42.108(c) (2012).A PGR proceeding is only available for patents issuing from applications subjectto the FITF provisions of the AIA. AIA § 6(f)(2). Unlike an IPR petition, however, PGR may makechallenges based on Sections 101, 102, 103, and 112, except best mode. New 35 U.S.C. § 321(b);37 C.F.R. § 42.204(b)(2) (2012). PGR may only be requested on or prior to the date that is ninemonths after the grant of a patent or issuance of a reissue patent. New 35 U.S.C. § 321(c); 37 C.F.R.§ 42.202(a) (2012). The threshold for a PGR proceeding is whether the PGR petition demonstrates2-32

the IP Book 2012that it is more likely than not that at least one of the claims challenged in the petition is unpatentable.New 35 U.S.C. § 324.The only patents eligible for CBM review are certain covered business methodpatents generally defined in the AIA as a method or corresponding apparatus for performing dataprocessing or other operations for a financial product or service. See AIA § 18(d)(1), 37 C.F.R.§ 42.301(a) (2012). The business method patent definition excludes patents for technological inventions.See AIA § 18(d)(1); 37 C.F.R. § 42.301(b) (2012). Rule section 42.301(b) provides that solelyfor purposes of CBM review, the following will be considered on a case-by-case basis to determineif a patent is for a technological invention based on whether the claimed subject matter as a whole:(1) recites a technological feature that is novel and unobvious over the prior art; and (2) solves a technicalproblem using a technical solution. Both FTI and FITF patents are eligible to be challenged.AIA §§ 6(f)(2)(A), 18(a)(1). Most importantly, the petitioner must be sued or charged with infringementof a patent in a manner sufficient to support a filing for declaratory judgment in order to file apetition for CBM review. AIA § 18(a)(1)(B); 37 C.F.R. § 42.302(a) (2012). Otherwise, the thresholdand procedures for a CBM proceeding are the same as for a PGR proceeding. AIA § 18(1)(a).If the appropriate threshold has been met in view of the petition and any ownerresponse filed by the patent owner, then a “trial” will be declared and the parties will receive botha standing order and a case-specific scheduling order that will dictate the manner in which the proceedingwill be undertaken. Changes or additions to the standing and case-specific orders, and othermatters related to the management of the review proceeding, may be made by filing a “motion”which will be considered by the APJ either as part of a quickly scheduled telephonic hearing, or ifmore briefing is required, by further motion papers as scheduled by the APJ during the telephonichearing.The appropriate threshold for successfully getting a review proceeding initiatedwas the subject of significant contention during passage of the AIA. In recent congressional hearings,there has been discussion of a possible “technical” amendment to the language for the thresholdstandard to change from “reasonably could have raised” to just “raised”. See Implementation of theLeahy-Smith America Invents Act and International Harmonization Efforts Before the S. Comm. onthe Judiciary (June 20, 2012) (statement of David J. Kappos, Secretary of Commerce for IntellectualProperty & Director, United States Patent & Trademark Office), available at .b. Rules for the Review ProceedingsThe rules for the new review proceedings are found in 37 C.F.R. Part 42, SubpartsA, B, C, D, and E. They are intended to represent a reasonable and workable way to conduct thereview proceedings in a timely and just manner at a reasonable cost, given the contested nature of2-33

Chapter 2 – On the Road to Patent Harmonizationsuch proceedings. The rules loosely follow the model of the existing contested-case rules, found in37 C.F.R. Part 41, Subparts A and D, which, in conjunction with the standing order of the currentBPAI for interferences have generally been managed so that the current average pendency fromdeclaration to judgment in less than one year.Fees - The final rules made some modifications to the ways in which fees for areview proceeding are calculated. While the base fees of $27,200 for IPR and $35,800 for PGRreviews stayed the same, additional charges based on the total number of claims challenged are nowcalculated on a per-claim basis for each claim in excess of 20 at $600 per claim for IPR and $800 perclaim for PGR. 37 C.F.R. § 42.15(a)-(b) (2012). The fee structure now supports filing of a single petitionper patent, instead of multiple petitions per patent as had been suggested in the rules as initiallyproposed. In its comments to the final rules, the USPTO indicated that further changes to somewhatreduce these fees and possibly allow for small entity discounts may be made once the USPTO formallysets the fees for the review proceedings under its new fee setting authority in February 2013.Managed Discovery - By imposing a one-year period in which the review is tobe conducted (potentially expandable by six months), no matter how complicated the proceeding,Congress has mandated that the USPTO employ expedited proceedings that should improve uponcurrent IPX proceedings. It is expected that the petitioner, in requesting one of these new review proceedings,will place its best foot forward from the start so that the process can be concluded withoutbacktracking and second thoughts.Congress made clear that discovery in the new review proceedings was to be limitedin scope and evinced its concern about the abuse of discovery by specifying that the directorwas to prescribe sanctions for abuse of discovery. New 35 U.S.C. §§ 316(a)(5)-(6), 326(a)(5)-(6).37 C.F.R. § 42.12 (2012). Discovery under the rules will be “managed discovery” maintained withinlimits prescribed by the APJ upon a party’s motion. Experience in interferences has shown that(1) many issues are resolved in a telephone conference with an APJ without a motion actually beingfiled, and (2) “fishing expedition” kinds of discovery are avoided.The rules contemplate what the PTAB has termed a “motion-based” proceeding,but the “motions” in such a proceeding are not of the type typically encountered in federal court litigation.In fact these PTAB motions are simply the procedural vehicles for the parties’ presentationsof their substantive positions.The rules allow for two types of discovery: (1) routine discovery, and (2) additionaldiscovery. 37 C.F.R. § 42.51(b)-(c) (2012). The APJ may also authorize live testimony, where critical,to assess credibility. For example, a judge may attend a deposition in appropriate instances. 37C.F.R. § 42.53(a) (2012). Routine discovery is intended to assist the parties in assessing the meritsof their respective positions, to avoid harassment in the proceeding, or to reach settlement. The ob-2-34

the IP Book 2012ligation on the parties to voluntarily engage in routine discovery is meant to reduce costs to partiesby making basic information readily available at the outset of the proceeding. Routine discoveryincludes: documents cited, cross-examination for submitted testimony, and information inconsistentwith positions advanced during the proceeding.A party must request any discovery beyond routine discovery, which is referredto as additional discovery. A party seeking additional discovery in IPR and derivation must demonstratethat the additional discovery is in the interests of justice. See, e.g., new 35 U.S.C. § 316(a)(5);37 C.F.R. § 42.51(c) (2012). A party seeking additional discovery in PGR and CBM will be subjectto the lower good-cause standard. See, e.g., new 35 U.S.C. § 326(a)(5); 37 C.F.R. § 42.224 (2012).Claims—Amendment and Construction - Because the new review proceedingsare adjudications and not examinations, owner amendments to the claims in a review proceedingare not intended to be limitless. The USPTO will interpret the statutory language of “a reasonablenumber of substitute claims” that may be proposed under 35 U.S.C. § 316(d)(1)(B) and § 326(d)(1)(B) to be generally about the same total number of claims being amended, or newly presented, ina review proceeding as were initially challenged for the patent. 37 C.F.R. §§ 42.121(a), 42.221(a)(2012). Petitioners are encouraged to propose claim constructions for important claim limitations,and owners are encouraged to respond with their own claim constructions. The APJ will rule onclaim constructions using a broadest reasonable interpretation standard similar to the standard currentlyused in EPX and IPX. 37 C.F.R. §§ 42.100(b), 42.200(b) & 42.300(b).Time and Page Limits - The rules make clear that the new review proceedings arenot meant to be a complete substitute for litigation. The most obvious limits to these new reviewproceedings are the time-frame limits of 35 U.S.C. §§ 316(a)(11) and 326(a)(11) and the way inwhich the rules impose page limits on the various filings. The final rules impose fairly strict limits onpages that can only be waived by a separate motion for extra pages – 60 pages for an IPR petition,80 pages for a PGR petition, and 15 pages for most motions, with equivalent pages for responsesto each. 37 C.F.R. § 42.24(a) (2012). Each page must be double spaced in 14-point font. 37 C.F.R.§ 42.6(a) (2012). Evidence is expected to be put in by affidavit that will not count toward the pagelimits, but claim charts are recommended and will count toward pages limits, although the claimchart can be single spaced. 37 C.F.R. § 42.6(a)(2)(iii) (2012). The time-frame and/or page-numberlimits will, to some extent, hamper at least some patent owners or petitioners, particularly those whohave large numbers of claims and/or large numbers of grounds of review. To ameliorate these issues,the comments to the final rules suggest that petitioners may want to group claims to be arguedtogether on the same grounds in a manner similar to grouping claims for purposes of appeal duringoriginal prosecution.Pro Hac Vice Representation - The PTAB may recognize counsel pro hac viceduring a proceeding upon a showing of good cause, subject to such conditions as the board may2-35

Chapter 2 – On the Road to Patent Harmonizationimpose, such as agreeing to be bound by the USPTO’s Code of Professional Responsibility; however,a lead counsel who is a registered patent attorney must be appointed for each review. 37 C.F.R.§ 42.10(c) (2012). Similarly, the board may take action to revoke pro hac vice status, taking intoaccount various factors, including incompetence, unwillingness to abide by the UPSTO’s Code ofProfessional Responsibility and incivility. 37 C.F.R. § 42.10 (2012).Sanctions, Hearings and Settlements - Sanctions are available for abuse of thereview proceeding process. The AIA requires the USPTO to prescribe sanctions for abuse of discovery,abuse of process, or any other improper use of the proceeding, such as to harass or causeunnecessary delay or an unnecessary increase in the cost of the proceeding. See new 35 U.S.C.§§ 316(a)(6), 326(a)(6); 37 C.F.R. §§ 10-11, 42.12 (2012). Sanctions may include: order holdingfacts to have been established, order expunging a paper, order excluding evidence, order precludinga party from obtaining/opposing discovery, order providing compensatory expenses, including attorneys’fees; and judgment or dismissal of the petition.The AIA permits a party to request an oral hearing as part of the review proceeding.See new 35 U.S.C. §§ 316(a)(10), 326(a)(10); 37 C.F.R. § 42.70 (2012). The length of the hearingwill be set on a case-by-case basis, taking into account the complexity of the case.The AIA encourages settlement in IPR/PGR/CBM/derivation proceedings. A settlementin IPR/PGR/CMB terminates the review proceeding with respect to the petitioner, and thePTAB may terminate the proceeding or issue a final written decision. See new 35 U.S.C. §§ 317,327; 37 C.F.R §§ 42.73-42.74 (2012). In a derivation, a settlement will be accepted by the PTABunless it is inconsistent with the evidence of record. New 35 U.S.C. § 135(e); 37 C.F.R. § 42.73,42.74 (2012).The AIA provides that where an IPR/PGR/CBM trial is instituted, and not dismissed,the board shall issue a final written decision. The decision shall address the patentability ofany claim challenged and any new claim added. See new 35 U.S.C. §§ 318(a), 328(a); 37 C.F.R.§ 42.73 (2012). For a derivation, the PTAB shall issue a written decision that states whether an inventornamed in an earlier application derived the claimed invention from an inventor named in thepetitioner’s application without authorization. New 35 U.S.C. § 135(b); 37 C.F.R. § 42.73 (2012).Estoppel - In terms of estoppel, a petitioner in IPR/PGR/CBM may not requestor maintain a proceeding before the USPTO with respect to any claim on any ground that is raisedor reasonably could have been raised. See new 35 U.S.C. §§ 315(e)(1), 325(e)(1); 37 C.F.R.§ 42.73(d)(1) (2012). A petitioner in IPR/PGR/CBM may not assert in district court or the InternationalTrade Commission (ITC) that a claim is invalid on any ground the petitioner raised, andin IPR/PGR, any ground that reasonably could have been raised. See new 35 U.S.C. §§ 315(e)(1),325(e)(2); AIA § 18(a)(1)(D). The Final Rules also implement by rule what can be considered the2-36

the IP Book 2012equivalent of a prohibition against recapture across any member of a patent family. A patent ownerwhose claim is cancelled is precluded from taking action inconsistent with the adverse judgmentincluding obtaining in any patent, a claim is not patentably distinct from a finally refused or canceledclaim. 37 C.F.R. § 42.73(d)(3) (2012). In a derivation, a losing party who could have movedfor relief, but did not so move, may not take action inconsistent with that party’s failure to move.Where a party receives a split judgment (wins on one claimed invention, loses on another), estoppeldoes not attach to the subject matter for which a favorable judgment was obtained. 37 C.F.R.§ 42.73(d)(2) (2012).Appeal - A party dissatisfied with a non-final or final decision may file a requestfor rehearing with the board. The request must specifically identify all matters the party believes theboard misapprehended or overlooked. 37 C.F.R. § 42.71(c) (2012). A party dissatisfied with the finalwritten decision in IPR/PGR/CBM may appeal to the Federal Circuit. See new 35 U.S.C. §§ 319,329. A party dissatisfied with a final decision in a derivation may appeal to the Federal Circuit, 35U.S.C. § 141(d), or seek remedy through a civil action, 35 U.S.C. § 146. See 37 C.F.R. § 90.2 (2012).c. Derivation ProceedingsThe rules for derivation proceedings have clarified two important issues. First, therules resolve what was a potential ambiguity in the AIA: When can the one-year period for copyingstart that can otherwise bar a petitioner from invoking a derivation proceeding, the publication of therespondent’s claim or the publication of the petitioner’s claim? New 35 U.S.C. § 135(a); 37 C.F.R.§ 42.403 (2012). The rules limit the one-year time period to the publication of the respondent’sclaim. This is the better interpretation and is consistent with the current understanding of how theone-year statute of repose in interferences works.Second, the rules resolve that the standard used for measuring a derivation willnot be an “anticipation” style derivation standard where the party alleging derivation has to provecommunication of each and every element of the count to the deriver as is currently the law forinterferences. Gambro v. Baxter, 110 F.3d 1573 (Fed. Cir. 1997). Instead, the rules proscribe the useof the older “obviousness” style derivation standard where the party alleging derivation only has toprove communication of the elements from which the invention would have been obvious as wasformerly the law for interferences. New England Braiding v. Chesteron, 970 F.2d 878 (Fed. Cir.1992); DeGroff v. Roth, 412 F.2d 1401 (CCPA 1969); Agawam v. Jordon, 74 U.S. 583 (1868).2-37

Chapter 2 – On the Road to Patent HarmonizationPractice TipThe best advice for the new review proceedings and derivation proceedingis to be prepared. Beyond the newness and uncertainty ofthese proceedings, the timing and page limits effectively mandate thateach party does its homework as early as possible.2. Supplemental ExaminationEffectively, supplemental examination provides a new route into the existing ex partereexamination that confers additional benefits. Upon submission of the additional materials that needto be cleansed as prior art, the USPTO will determine within three months whether the new materialpresents a “substantial new question of patentability.” New 35 U.S.C. § 257(a). If so, an ex partereexamination will be started. Otherwise, a certificate confirming patentability will be issued. New35 U.S.C. § 257(b). The USPTO will be charged with ensuring that no active fraud has occurredand will also need to promulgate regulations on exactly how the additional materials being reviewedmust be presented, along with the fees required for a supplemental examination. New 35 U.S.C.§ 257(e). Successfully navigating a supplemental examination proceeding is supposed to protect thepatent and the patent owner from charges of inequitable conduct, but not the attorney(s) representingthem. The final rules for supplemental examination backed away from what were perceived asonerous requirements initially proposed for this process in response to public comments. As a result,a request for supplemental examination can be filed for a fee of $5,140 for processing the requestthat can include up to twelve items of written prior art that will be considered by the USPTO, anda fee of $16,120 that is refunded if an ex parte reexamination is not ordered. The only substantiverequirement on the patent owner is to provide a detailed explanation of the relevance and manner ofapplying each item of information to each claim for which supplemental reexamination is requested,along with an optional explanation of how the claims patentably distinguish over the items of information.37 C.F.R. § 1.610(b)-(c) (2012).Practice TipEven with the changes in the final rules, it still seems unlikely that therewill be any significant use of the supplemental examination proceeding.Practitioners should watch closely the results and outcomes of anyearly participants in this process.2-38

the IP Book 20123. Third-Party Prior Art SubmissionsUnder the old patent law, third parties were limited to submitting prior art within a shortwindow after publication of a patent application and were handcuffed in their ability to comment onthe art submitted. Under the AIA, in situations where a competitor, for example, is monitoring theprogress of a given patent application, that competitor may choose to submit prior art during examinationas a way to preempt the issuance of overly broad claims in that patent application.New 35 U.S.C. § 122(e) provides that any third party may submit for USPTO considerationany patent, published patent application or printed publication of “potential relevance” tothe examination of a patent application. The written submission must be made before a notice ofallowance or before either six months after first publication or a rejection of any claim, whichever islater. The submission must contain (1) a concise description of relevance, (2) a fee prescribed by thedirector, and (3) a statement affirming the submission complies with the Section 122. To implementthis provision, the final rule creates a new 37 C.F.R. § 1.290, entitled “Submissions by Third Partiesin Applications.” The new rule applies to any application filed before, on or after the enactment date,and is effective September 16, 2012. To encourage use of this provision, a relatively small fee of$180 is required for every 10 documents or fraction thereof submitted, however no fee is requiredfor three or fewer documents filed with a first and only submission. 37 C.F.R. § 1.17(p). Submissionsmay be made via the electronic filing system, but this is not required, and service on the applicantis not required. The USPTO will notify applicants by email of compliant third-party submissions.§ 2.3 THE REST OF THE “LITTLE” CHANGESThe AIA also includes many other changes that are of a minor and technical nature in terms ofUSPTO organization, or relating to investigations and reports that the USPTO will be required toundertake. As for the rest of the changes that will impact both prosecution and litigation of patentsunder the AIA, the following is a quick summary of some of these “little” changes.A. Multi-Defendant and Multi-District LitigationThe AIA changed one technical aspect of patent litigation that throws an additional wrinkle intowhat had been the fastest growing area of patent litigation—infringement suits against multiple, differentdefendants over the same patents. By limiting joinder of multiple defendants, a patent owneris no longer able to join multiple defendants in the same lawsuit on the same patent. This provisionwent into effect immediately, and prevents a litigation tactic commonly used by non-practicing entitiesof filing a single lawsuit against multiple defendants based only on the fact that it is a commonpatent being infringed. New 35 U.S.C. § 299; AIA § 19(d).2-39

Chapter 2 – On the Road to Patent HarmonizationWhile each defendant is now assured of its own, separate trial under the AIA, practical joinderof multiple defendants for purposes of consolidated discovery may still be possible under thejudicial case management approach of multi-district litigation (MDL). The judicial panel on multidistrictlitigation (JPML) recently confirmed the use of MDL as a viable option to litigating multipleinfringement suits with different defendants over the same patent after the AIA. Under 28 U.S.C.§ 1407, MDL can be used to transfer separate patent infringement actions pending in multiple districtsfor centralized pre-trial proceedings. See In re Bear Creek Technologies, Inc., MDL No. 2344(J.P.M.L. May 2, 2012).Practice TipWatch the development of MDL decisions in patent cases on whatkinds of fact patterns will support joinder of separate patent lawsuits forpurposes of centralized pre-trial proceedings.B. Expanded Prior User RightsThe AIA expands prior user rights as a personal defense to patent infringement based onprior use by that entity. The AIA also expands the scope of the defense from only patents coveringcomputer business method uses to all patents. This expansion of a personalized defense to infringementbased on prior use comes as part of the exchange for eliminating secret prior use as a categoryof “prior art” under the new Section 102. Successfully establishing this defense, however, will not besufficient to invalidate a patent under Sections 102 or 103. New 35 U.S.C. § 273(g).Patents owned by universities or tech transfer organizations are subject to an exception fromthe expanded prior user defense, but this exception does not apply “if any of the activities required toreduce to practice the subject matter of the claimed invention could not have been undertaken usingfunds provided by the federal government.” New 35 U.S.C. § 273(e)(5)(B). This appears to revivethe prior user defense against university patents for inventions related to stem cell research or humancloning, as well as any other inventions in research areas that are prohibited from receiving federalfunding.2-40

the IP Book 2012Practice TipA prior user defense can now be used by anyone under the AIA whowas an actual prior user, but beware the limits on transferability of theprior user defense.The prior user defense is personal and cannot be transferred in isolation, but can be transferredas part of a larger, good faith sale of the business or line of business “for other reasons.” New35 U.S.C. § 273(e)(1)(B). Once transferred, assertion of the prior user defense is limited to “sites”where the “uses” occurred before the later of the effective filing date or the date of transfer of theright. New 35 U.S.C. § 273(e)(1)(C). There is also a potential trap for the unwary as the prior userdefense lapses for later activities if the prior use was continued for a time, abandoned and then resumed.New 35 U.S.C. § 273(e)(4). Unfortunately, there is little guidance in the statute or case lawas to how broadly or narrowly these provisions would be applied.C. Amended Best ModeWhile continuing to remain a technical requirement for a patent application, best mode canno longer be used in litigation as a way to invalidate a patent. The elimination of failure to disclosebest mode as a defense took effect immediately and applies to proceedings commenced on or afterSeptember 16, 2011. New 35 U.S.C. § 282; AIA § 15. The provision applies to any applicationfiled after the effective date and includes applications claiming priority to applications filed priorto the effective date. The provision does not modify current patent examining practices for applicationcompliance with the best mode requirement of 35 U.S.C. § 112. See Memorandum to PatentExamining Corps from Robert W. Bahr, Senior Patent Counsel and Acting Assoc. Comm’r for PatentExamination Policy, U.S. Patent & Trademark Office, Requirement for a Disclosure of the BestMode (Sept. 20, 2011), available at (last visited June 28, 2012).Practice TipDisclosure of the “best mode” will still be a “best practice” in preparingpatent applications, even though it can longer be used as a defense inpatent litigation.2-41

Chapter 2 – On the Road to Patent HarmonizationD. Filing by AssigneeThe AIA makes it easier for an assignee to file and prosecute a patent application for anyinventors who are under a contractual obligation to assign their inventions. New 35 U.S.C. § 118.The changes will also enable the individual who is under the obligation to effectively execute anoath or declaration within an assignment document. See new 35 U.S.C § 115(b). The ability to usea combined oath and assignment will solve some existing issues, such as when an inventor is willingto sign a declaration but not an assignment of authority and legal responsibility to represent theinventor as opposed to the assignee. The final rules also allow an assignee to file a patent applicationaccompanied by appropriate proof of an obligation of the named inventors to assign the applicationright to the assignee, e.g., an assignment or employment agreement. 37 C.F.R. § 1.46(b) (2012). Assigneescan start using these mechanisms after September 16, 2012.It is expected that employment agreements may be modified to include the language aboutobligation to assign, preferably in the form of a confirmation of obligation to assign that is a separatelyexecuted exhibit or attachment to the employment agreement. This approach would reducethe need for additional consideration in executing the document for existing employees, and mayeliminate the need to disclose the entire employment agreement.One open issue with respect to these new provisions is how the statute and USPTO regulationswill deal with the various state statutes imposing certain limits on an employee’s obligation toassign, e.g., inventions made outside of regular employment and without use of company resources.Practice TipConsider updating employment agreements to add an exhibit confirmingan employee’s obligation to assign inventions as a way to take advantageof changes to the oath and declaration requirements.E. Changes to Marking Requirements—Both False and VirtualThe AIA retroactively changes the requirements for false patent marking lawsuits to significantlylimit the flood of qui tam cases that had been filed in recent years. Now, allegations of falsemarking are limited solely to those raised by actual competitors who can prove actual damage as aresult of any mismarking. New 35 U.S.C. § 292. This provision took effect immediately and appliesto court cases pending or commenced on or after September 16, 2011. AIA § 16(a)(2), 16(b)(4). Inaddition to limiting lawsuits for false patent marking to only those filed by actual competitors, the2-42

the IP Book 2012AIA provides that patent owners may mark their products by using a web page on the Internet. New35 U.S.C. § 287.F. Priority ExaminationsThe AIA provides for a fast track prosecution option known as “Track One” that allows applicantsto have their cases be given priority to ensure final disposition (a notice of allowance or finalrejection) within one year of the filing date. The only requirements to enter the fast track option area limit on the number of claims (four independent and 30 total claims that stays in place throughoutthe prosecution of the application) and an increased fee ($4,800). AIA § 11(h)(1)(A).There is an initial limit of 10,000 requests per fiscal year to allow the USPTO to evaluatehow this program does, or does not, impact the length of normal prosecution. However, it does notappear that current usage of the fast track option will threaten these initial limits. On December 19,2011, the USPTO extended the prioritized examination procedure to allow for review of requests forcontinued examination in existing plant and utility applications. See Changes to Implement the PrioritizedExamination for Requests for Continued Examination, 76 Fed. Reg. 78,566 (Dec. 19, 2011)(to be codified 37 C.F.R. pt. 1). Statistics for the priority examination proceedings can be found onthe USPTO website. See Patents Examination, available at (last modified June 27, 2012).In addition, the AIA authorizes the USPTO director to promulgate regulations related to priorityexamination of certain “important” technology areas. The technology-related priority examinationis expected to be similar to current regulations for green technologies and goes into effect onSeptember 16, 2012 after final regulations are promulgated. New 35 U.S.C. § 2(b)(2)(G); AIA § 25.Practice TipConsider using the new “fast track” option when clients want quickfeedback on an invention, or where the product life cycle is short.G. The Rest of the Smaller ChangesEasier Opportunities to Correct Patents - In several places throughout the bill, the AIAremoves various requirements that a party show lack of deceptive intent in order to seek some typeof correction or modification to the patent by reissue, disclaimer or the correcting of the names ofinventors on the patent. See new 35 U.S.C. §§ 116, 251, 253, 256 & 288.2-43

Chapter 2 – On the Road to Patent HarmonizationNo Patenting of Human Organisms - The AIA included a single sentence on patentinghuman organisms, stating that “[n]otwithstanding any other provision of law, no patent may issueon a claim directed to or encompassing a human organism.” AIA § 33. The provision does notchange existing law or longstanding USPTO policy that a claim encompassing a human being isnot patentable. The provision merely codifies the existing USPTO policy that human organisms arenot patent-eligible subject matter. Id. See Memorandum to Patent Examining Corps from Robert W.Bahr, Senior Patent Counsel and Acting Assoc. Comm’r for Patent Examination Policy, U.S. Patent& Trademark Office, Claims Directed to or Encompassing a Human Organism (Sept. 20, 2011),available at (last visitedJune 28, 2012).Lower Fees for Micro-Entities - The AIA adds a category for small and start-up patentapplicants who would receive a 75-percent reduction in USPTO fees. These newly defined “microentities”include higher education organizations. New 35 U.S.C. § 123.Willful Infringement - The AIA codifies current case law on willful infringement to theextent that the failure to obtain or present advice of counsel shall not be considered as a factor indetermining willful infringement. New 35 U.S.C. § 298; AIA § 17(a).No Patents for Tax Strategies - Any strategy for reducing, avoiding or deferring tax liabilityis no longer sufficient to differentiate a claimed invention from the prior art whether the strategywas known or unknown at the time of the invention or filing. However, a method, apparatus, technology,computer program, or system is not covered under the new provision if it is (1) used solelyfor preparation of a tax return or other tax filing, or (2) used solely for financial management to theextent it is severable from any tax strategy and does not restrict the use of the tax strategy by anytaxpayer or tax advisor. The effective date for the tax strategies provisions was immediate uponenactment and will apply to patents issued or pending on that date. AIA § 14(e). See Memorandumto Patent Examining Corps from Robert W. Bahr, Senior Patent Counsel and Acting Assoc. Comm’rfor Patent Examination Policy, U.S. Patent & Trademark Office, Tax Strategies Are Deemed to BeWithin the Prior Art (Sept. 20, 2011), available at (last visited June 28, 2012).§ 2.4 CONCLUSIONSAlthough general observations and predictions can be made regarding how the patent communitywill react to the AIA, there are relatively few hard and fast conclusions. There are rumors ofpotential technical clarification and/or corrective legislation in store for the AIA, but recent hearingsin the House and Senate Judiciary Committees have yet to result in any proposed legislation. Therehas already been a flurry of rule making, both proposed and final, and future case law will furtherdefine elements of the AIA. Certainly, any time the rules of the game change as significantly as they2-44

the IP Book 2012have been changed under the AIA, there are overhead costs during the transition period associatedwith educating everyone involved with the patent system about the new rules of the game. Only timewill tell how the changes put into effect by the AIA impact our patent system as a whole once thetransition period has run its course.2-45

theIP bookChapter 3the IP Book 2012Caraco v. Novo:Counterclaims Relating to Brand NameDescription of Claim ScopeCatherine A. ShultzLarrin BergmanKinney & LangeMinneapolis§ 3.1 History of the Hatch-Waxman ActThe Drug Price Competition and Patent Term Restoration Act, known as the Hatch-WaxmanAct, was passed into law in 1984, thereby establishing the framework for the modern system ofgeneric drugs. The act set out the process by which marketers of generic drugs can seek approvalof their products and bypass clinical testing by relying on the safety and efficacy studies originallysubmitted by the brand name manufacturer.When a brand name drug manufacturer is seeking approval of a new prescription drug, it mustfile a new drug application (NDA) with the Food & Drug Administration (FDA). 21 U.S.C. § 355.This NDA discloses much information regarding the drug. It includes information regarding drugsafety and efficacy based on trials, drug components, proposed labeling indicating uses for the drug,and the patent number and expiration date of any patent covering the drug. 21 U.S.C. § 355(b), (d).For method-of-use patents, the FDA requires a use code from the brand name manufacturer whichdescribes the approved patented uses of the drug, although these are not verified for accuracy. 21*Special thanks to Kinney & Lange summer associate Dan Bruzzone for his assistance with this chapter.3-47

Chapter 3 – Caraco v. NovoC.F.R. § 314.53(c)(2)(ii)(P)(3), (e). The FDA then publishes the information regarding patents, expirationdates, and use codes in a book called the “Orange Book.”The Hatch-Waxman Act allows a generic manufacturer to rely on the approval of the brandname drug by filing an abbreviated new drug application (ANDA). However, if the generic manufacturerseeks to market a generic equivalent of a drug prior to the expiration of a patent covering thepatented drug (as listed in the Orange Book), a paragraph IV certification or a section viii statementmust be submitted to the FDA.A paragraph IV certification is a statement that the patent(s) covering the drug and/or method ofuse are invalid or will not be infringed. Submission of the paragraph IV certification requires that thegeneric manufacturer submit a proposed label that is materially identical to the brand name manufacturer’slabel. 21 U.S.C. § 355(j)(2)(A)(vii)(IV). If a paragraph IV certification is made, the brandname drug manufacturer then has 45 days in which to bring suit against the generic manufacturer forinfringement, with the infringing act being the filing of the paragraph IV certification. If the brandname manufacturer does file suit, then the FDA must wait for one of the following to occur beforeit can approve the ANDA: the patent expires, the lawsuit resolves issues of noninfringement and/orvalidity, or 30 months have passed. If the brand name manufacturer does not file suit within 45 days,the FDA can approve the ANDA. This still leaves the brand name manufacturer with the option offiling a patent infringement suit based on the sales of the generic drug.A section viii statement typically involves drugs where the drug compound patent has expired,but a method-of-use patent is still in force. For a section viii statement, the generic manufacturermust submit a label to the FDA that contains approved uses of the drug, but does not include anypatented uses of the drug. For approval of the section viii statement, the FDA compares the use codessubmitted with the NDA of the brand name drug (as listed in the Orange Book) with the uses on theproposed label. 21 U.S.C. § 355(j)(2)(A)(viii). If there is any overlap, the FDA cannot approve theANDA.The Hatch-Waxman Act also contains a section commonly called the Hatch-Waxman Amendments,enacted in 1999. The Hatch-Waxman Amendments give generic manufacturers a counterclaimunder paragraph IV to seek “an order requiring the [NDA] holder to correct or delete the patentinformation submitted by the holder under subsection (b) or (c) of this section on the ground thatthe patent does not claim either – (aa) the drug for which the application was approved; or (bb) anapproved method of using the drug.” 21 U.S.C. § 355(j)(5)(C)(ii)(l).§ 3.2 Case BackgroundNovo Nordisk manufactured a brand name diabetes drug called repaglinide. It obtained twopatents related to the drug: U.S. Patent No. RE37,035 (the ‘035 patent), with claims covering the3-48

the IP Book 2012compound of the drug, and U.S. Patent No. 6,677,358 (the ‘358 patent), a method-of-use patent coveringone method of use. The FDA approved the drug for three different methods of use. The ‘035patent expired in 2009, and the ‘358 patent expires in 2018.In 2005, Caraco filed an ANDA for a generic equivalent of repaglinide, initially with a paragraphIV certification in relation to the ‘358 patent only (assuring the FDA that it would not market thedrug until the ‘035 patent expired in 2009). Novo Nordisk filed suit against Caraco for infringementbased on the paragraph IV certification. After this filing and at the suggestion of the FDA, Caracochanged its approach and filed a section viii statement with a proposed label that only included thetwo approved uses for the drug not covered by the ‘358 patent.Prior to FDA approval of the section viii statement, Novo Nordisk changed the use code associatedwith its NDA to a use code that included all three methods of use that the FDA had approvedfor the drug. Because the FDA is only allowed to approve proposed labels that do not overlap withuse codes supplied by the brand name manufacturer, Caraco’s ANDA was not approved. Caracothen filed a counterclaim under paragraph IV of the Hatch-Waxman Act, attempting to require NovoNordisk to amend its use code back to the original single use.The district court granted summary judgment to Caraco, ordering Novo Nordisk to ask the FDAto revert back to the original use code. Novo Nordisk A/S v. Caraco Pharm. Labs., Ltd., 656 F. Supp.2d 729 (E.D. Mich. 2009). The Federal Circuit reversed, interpreting the language of the counterclaimstatute as requiring Caraco to demonstrate that the ‘358 patent does not claim any approvedmethod of use. The Federal Circuit also held that the “patent information” under the counterclaimonly extended to the patent number and expiration date, not the use codes, removing the availabilityof the counterclaim as a tool to force correction of use codes. Novo Nordisk A/S v. Caraco Pharm.Labs., Ltd., 601 F.3d 1359 (Fed. Cir. 2010).The U.S. Supreme Court granted certiorari on the issue of “whether Congress has authorized ageneric company to challenge a use code’s accuracy by bringing a counterclaim against the brandname manufacturer in a patent infringement suit.” Caraco Pharm. Labs, Ltd. v. Novo Nordisk, 132S. Ct. 1670, 566 U.S. __, slip op. (2012).§ 3.3 The Ruling of the SUPREME CourtIn an opinion authored by Justice Kagan, the Supreme Court unanimously ruled that a genericdrug manufacturer may file a counterclaim to force correction of an overbroad use code. In ruling onthis case, the U.S. Supreme Court split this into a two part inquiry:1. “decide when a ‘patent does not claim…an approved method of using’ a drug” and3-49

Chapter 3 – Caraco v. Novo2. “determine the content of ‘patent information submitted…under subsection (b) or (c)’of § 355.”Each of these was examined in the context of the entire statute, especially keeping in mind the“remedy for a prevailing counterclaimant is an order requiring the brand ‘to correct or delete’ thatpatent information.” Id. at 10.A. When a Patent “Does Not Claim…An Approved Method of Using a Drug”In reaching its conclusion that the phrase “when a patent does not claim…an approvedmethod of using a drug” refers to when a patent does not claim a particular single use of a drug, theSupreme Court looked mainly to the context of the phrase “not an.” In doing so, the Supreme Courtrelied on a variety of colorful examples, including one in which it took a shot at the New York Mets.Id. at 12.On this point, Novo Nordisk argued that the phrase “not an” meant that the patent does notclaim any approved method of using a drug, removing Caraco’s standing to bring the counterclaim(as the ‘358 patent did claim one approved use of the drug). Caraco argued that the phrase “not an”meant that at least one approved method of using a drug was not covered, allowing Caraco to bringa counterclaim on the two FDA approved uses which were not covered in Novo Nordisk’s ‘358 patent.Id. at 11.In assessing these arguments, the Supreme Court examined the statutory context of theHatch-Waxman Amendments and section viii, pointing out that congressional intent of the Amendmentswas to authorize the FDA to approve the marketing of a generic drug for particular unpatenteduses. Section viii was passed to provide a “mechanism for a generic company to identify those uses,so that a product with a label matching them can quickly come to market.” Id. at 13. On this basis,the Court completely dismissed Novo Nordisk’s arguments that that one patented use makes thecounterclaim not available and found that the statute allowed for a counterclaim when a particularapproved method of using a drug was not covered by a patent.B. The Content of “Patent Information Submitted…Under Subsection (b) or(c) of § 355”On the issue of use codes, Novo Nordisk put forth a number of bases to argue that “patentinformation” extended only to the patent number and expiration date, not use codes, and thereforethe counterclaim was not available to correct use codes.First, Novo Nordisk looked to the language of the regulations for an NDA to argue that“use codes may sweep more broadly than the patent” because they require applicants to provide “adescription of each approved method of use or indication.” It argued that the inclusion of the word3-50

the IP Book 2012“indication” referred generally to what a drug does, which would allow the brand name manufacturerto include more than simply the currently patented uses in the use codes. The SupremeCourt however, explicitly rejected this argument by pointing out that the regulation, “when quoted infull,…[requires] that the brand provide ‘a description of each approved method of use or indicationand related patent claim of the patent being submitted.’” Id.Novo Nordisk next sought support for its position based on a previous congressional billthat would have required brand name manufacturers to file more information including “a descriptionof the approved use covered by the [patent] claim” in method-of-use patents and would havegiven generic manufacturers a civil action (not just a counterclaim) to challenge an overbroad descriptionby a brand name manufactuer. S. 812, 107th Cong., 2d Sess., § 103(a)(1), p.7 (2002). NovoNordisk argued that because this bill died in the House of Representatives, the bill that did pass (thecurrent Hatch-Waxman Amendments) could not have meant to extend to that information. While theSupreme Court did look at the history of the current statute as well as the previous (failed) proposedlegislation to reject Novo Nordisk’s arguments, it clearly stated that “[a] bill can be proposed forany number of reasons, and it can be rejected for just as many others” and the interpretation of currentstatutes, without more, cannot rely on assuming Congress was rejecting a previously presentedsimilar bill. Caraco Pharm. Labs., slip op. at 21 (internal citations omitted).PRACTICE TIPRelying on a previous bill that failed to pass without more is not likelyto be persuasive.In deciding that “patent information” extends to use codes, the Supreme Court looked indepth at the language of the cited sections, and the corresponding implementing regulations. Thecited sections (35 U.S.C. § 355 (b) and (c)) require an NDA applicant to submit patent informationincluding “the patent number and the expiration date of any patent claiming the drug or a method ofits use…and govern[s] the regulatory process by which brands provide additional patent informationto the FDA, both before and after an NDA is approved.” Caraco Pharm. Labs., slip op. at 16. Inaddition, these sections “provide the basis for the regulation requiring brands to submit use codes,”because the form on which brand name manufacturers submit their use code specifically states thatthe information is “provided in accordance with Section [355](b) and (c).” Id. Based on the SupremeCourt’s past interpretations of “submitting under,” the Court found the phrase to reach “beyond themost barebones information to other patent materials the FDA demands in the regulatory process.”Id. Because use codes are fundamental to the proper workings of the section viii statement under theHatch-Waxman Amendments (the FDA relies on the use codes submitted in determining whether3-51

Chapter 3 – Caraco v. Novoto approve ANDAs and an overbroad use code restricts the FDA’s ability to approve ANDAs), usecodes come within the scope of the statute, and thus a counterclaim is available to correct them.PRACTICE TIPStatute interpretation can involve looking to implementing regulations.The Supreme Court also looked to the remedy associated with the Hatch-Waxman Amendments,allowing a claimant to “obtain an order requiring the brand[name manufacturer] to ‘corrector delete’ its patent information § 355(j)(5)(c)(ii)(I)” to support the interpretation that the counterclaimextends to use codes. Rejecting Novo Nordisk’s argument that Congress included “correct”in the statute to fix typos in patent numbers, the Court interpreted the inclusion of the remedy ofcorrecting as available for when a brand name manufacturer uses an overbroad use code. CaracoPharm. Labs., slip op. at 19. Novo Nordisk next argued that the counterclaim should apply only tothe specific circumstances present in the case that may have prompted the Hatch-Waxman Amendments.Mylan Pharm., Inc. v. Thompson, 268 F.3d 1323 (Fed. Cir. 2001). In Mylan (decided priorto the Hatch-Waxman Amendments), the Federal Circuit found that the generic manufacturer hadno cause of action to seek delisting in the Orange Book in a situation where the patent listed by thebrand name manufacturer did not cover the product or the method of use. However, in that situation,the generic manufacturer would be able to file a paragraph IV certification and obtain a judgment ofnon-infringement, enabling the FDA to approve an ANDA. In recognizing that the only remedy foran overbroad use code is a counterclaim under the Hatch-Waxman Amendments, the Supreme Courtruled that it was both applicable and valuable in this situation. Caraco Pharm. Labs., slip op. at 24.§ 3.4 The Sotomayor ConcurrenceIn her concurring opinion, Justice Sotomayor points to the flaws still left in the regulatory systemrelating to the generic approval process. Upon the submission of an overbroad use code by abrand name manufacturer, “the generic manufacturer can …submit an ANDA with a paragraph IVcertification (which requires a proposed label materially identical to the brand name manufacturer’slabel, see ante at 24), wait for the brand name manufacturer to institute suit, file a counterclaim, litigatethe counterclaim, and if successful in securing the correction of the use code, return to the startof the process and do what it always wanted to do – file an ANDA with a section viii statement anda carve-out label.” Caraco Pharm. Labs., slip op. at Concurrence, page 2.3-52

the IP Book 2012PRACTICE TIPBrand name manufacturers should carefully weigh the benefits anddownsides of bringing suit on the filing of a paragraph IV certificationby a generic manufacturer.Because the remedy for an overbroad use code requires the generic manufacturer to pursue boththe paragraph IV certification and the section viii statement, despite only desiring a section viii, thecurrent regulatory system adds expense and delays the generic entry into the market. The systemperpetuates incentives for a brand name manufacturer to submit an overbroad use code, and relieson the brand name manufacturer to first bring suit based on the paragraph IV certification beforeany counterclaim for a correction of the use code can be brought. If the brand name manufacturerchooses not to bring suit, the counterclaim is not available, and the generic manufacturer is stuckwith the proposed label, which would induce infringement on any patented use. Id. at page 3. JusticeSotomayor calls on Congress and/or the FDA to fix these and to bring clarity to the requirementsrelated to use codes.PRACTICE TIPKeep watch for Congress and/or the FDA to respond to Justice Sotomayor’schallenge to fix flawed mechanisms still in the regulatoryscheme and bring clarity to use code requirements.§ 3.5 ConclusionGeneric drug manufacturers may use the counterclaim under the Hatch-Waxman Amendmentsto force a correction of a use code that inaccurately describes a brand name manufacturer’s patent ascovering a particular method of using a drug. It is likely that this counterclaim mechanism will beused when a brand name manufacturer files an infringement claim based on a paragraph IV certificationand the use code does not mirror the claims of the existing patent. It remains to be seen whetherthe FDA and/or Congress will address the regulatory issues still present, as requested in JusticeSotomayor’s concurrence.3-53

Chapter 3 – Caraco v. NovoPRACTICE TIPBrand name drug manufacturers should review all use codes to ensurethe claims of existing patents are precisely reflected to protect againstcounterclaims by generic manufacturers3-54

theIP bookChapter 4the IP Book 2012Mayo v. Prometheus:The Supreme Court of the United StatesComments on Patents and Laws of NatureRandy A. HillsonJulie R. DaultonMerchant & GouldMinneapolis§ 4.1 BackgroundOn March 20, 2012 the Supreme Court of the United States issued its unanimous opinion, authoredby Justice Breyer, in Mayo v. Prometheus, 566 U.S. __, 132 S. Ct. 1289 (2012), hereinafter“Prometheus,” to the effect that two patents, U.S. Pat. 6,355,623 and U.S. Pat. 6,680,302, eachincluding claims relating to optimizing therapeutic efficacy for treatment of certain disorders, are invalid.The decision was a reversal of a Federal Circuit decision in favor of the patents. Many believethe U.S. Supreme Court decision, authored by Justice Breyer, threatens patents in medical and biotechfields and removes financial incentives that are currently propelling business in this area. See,e.g., Steven Seidenberg, New Laws of Nature Law, A.B.A., July 2012, at 20; Thomas Engellenner,‘Mayo v. Prometheus’: fire but no light, The Nat. L. J., April 9, 2012.Here, the Prometheus decision is reviewed, along with its implications.§ 4.2 The DecisionThe patents at issue relate to the use of thiopurine drugs in the treatment of autoimmune diseases,such as Crohn’s disease. Both patents contain method claims. The claimed methods address4-55

Chapter 4 – Mayo v. Prometheusa problem in determining whether, for a particular patient, a given dose of the thiopurine drug istoo high, risking side effects, or too low, so as to be ineffective. The inventions relate to correlatinglevels of certain metabolites with the likelihood that a particular drug can cause harm or be effective.The Supreme Court characterized claim 1 of the ‘623 patent as typical of the patent. That claimreads as follows:1. A method of optimizing therapeutic efficacy for treatment of an immunemediatedgastrointestinal disorder, comprising:(a) administering a drug providing 6-thioguanine to a subject having saidimmune-mediated gastrointestinal disorder; and(b) determining the level of 6-thioguanine in said subject having said immunemediatedgastrointestinal disorder,wherein the level of 6-thioguanine less than about 230 pmol per 8x10 8 redblood cells indicates a need to increase the amount of said drug subsequentlyadministered to said subject andwherein the level of 6-thioguanine greater than about 400 pmol per 8x10 8 redblood cell indicates a need to decrease the amount of said drug subsequentlyadministered to said subject.The Supreme Court decision is based on interpretation of the section of the federal patent lawstatute that defines patentable subject matter, which reads as follows:Whoever invents or discovers any new and useful process, machine, manufacture,or composition of matter, or any new and useful improvement thereof, may obtaina patent therefor, subject to the conditions and requirements of this title.35 U.S.C. § 101.Section 101 of the statute can be viewed as the “public policy” section of the patent law. It isan indication of which subjects, as a matter of policy, are (and by implication are not) patentablewithout regard to novelty (35 U.S.C. § 102) or nonobviousness (35 U.S.C. § 103). The United Statespolicy with respect to patentable subject matter is very broad, as can be understood by review ofSection 101.As observed by the Supreme Court, it has long been held that this provision contains an implicitexception to the effect that laws of nature, natural phenomenon, and abstract ideas are not patentable.Prometheus, 132 S. Ct. at 1293. In citing the 1972 Gottschak opinion, the Court observed “phenom-4-56

the IP Book 2012ena of nature, though just discovered, mental processes, and abstract intellectual concepts are notpatentable, as they are the basic tools of scientific and technological work.” Id., citing Gottschalkv. Benson, 409 U.S. 63, 67 (1972). An assertion of the Court is that “monopolization of those toolsthrough the grant of a patent might tend to impede innovation more than it would tend to promote it.”Prometheus, 132 S. Ct. at 1293. Although no proof of this contention was offered or cited, the Courtdid acknowledge that “too broad an interpretation of this exclusionary principle could evisceratepatent law. For all inventions at some level embody, use, reflect, rest upon, or apply laws of nature,natural phenomena or abstract ideas.” Id.According to the Court, the issues raised by the patents under consideration in Prometheus lie“at the intersection of these basic principles.” Id. at 1294. The Court said that its mission was todetermine “whether the claimed processes have transformed ... unpatentable natural laws into patenteligible applications of those laws.” Id. Ultimately, the Supreme Court concluded that the patentclaims had not done so, and therefore were unpatentable under Section 101. Id. at 1305.The Court was skeptical of the invention as indicated by its observations that in the prior art,scientists already understood that the levels in a patient’s blood of certain metabolites, including theselected ones at issue here, could be correlated with the likelihood that a particular dosage of a drugcould cause harm or prove ineffective. Id. at 1295. The issue, observed the Court, is that those in thefield did not know the precise correlations between metabolite levels and likely harm or ineffectiveness.Id.The Federal Circuit decision under review was one in which the Federal Circuit had initiallyreversed a district court decision of invalidity, Prometheus Labs. v. Mayo Collaborative Services,581 F.3d 1336 (Fed. Cir. 2009), and then again, 628 F.3d 1347 (Fed. Cir. 2010), on remand from theSupreme Court in view of Bilski v. Kappos, 561 U.S. __, 130 S. Ct. 3218 (2010). As to Section 101,the position of the Federal Circuit was that because the claim processes specify the steps of “administering”and “determining,” and because the steps involve the transformation of the human body orblood taken from the human body, the patents satisfy the “machine or transformation test” and, thus,would pass the Section 101 requirement. 628 F.3d at 1355.In setting up its analysis, the Supreme Court observed, “the Prometheus patents set forth lawsof nature – namely, relationships between concentrations of certain metabolites in the blood andthe likelihood that a dosage of a thiopurine drug will prove ineffective or cause harm.” 132 S. Ct.at 1296. The Court further remarked, “while it takes a human action (the administration of a thiopurinedrug) to trigger a manifestation of this relation in a particular person, the relation itself existsin principle apart from any human action.” Id. at 1297. The question, according to the Court, waswhether the claims do significantly more than simply describe the natural relation, i.e., do they “addenough to their statements of the correlations to allow the processes they describe to qualify as4-57

Chapter 4 – Mayo v. Prometheuspatent-eligible processes that apply natural laws?” Id. The Supreme Court ultimately concluded thatthe answer is no. Id. at 1305.The Court said that if a law of nature is not patentable, then neither is a process reciting a law ofnature “unless that process has additional features that provide practical assurance that the process ismore than a drafting effort designed to monopolize the law of nature itself.” Id. at 1297. The opinioncharacterized the claimed processes as doing nothing more than “tell[ing] doctors interested in thesubject about the correlation that the researchers discovered.” Id. In doing so, the Court noted thatthe patent recited “an administering step, a determining step and a wherein step,” but these additionalsteps were concluded to be insufficient to transform the nature of the patent claim from a claim to alaw of nature. Id.As to the administering step, the Court dismissed its significance as merely referring to the relevantaudience, namely doctors who treat patients with selected diseases, considered to be a preexistingaudience who had long used thiopurine drugs in treating patients with autoimmune disorders.Id. The “wherein” clause was dismissed by the Court as simply telling a doctor about the relevantnatural laws, “at most adding a suggestion that he should take those laws into account when treatinghis patient.” Id. The “determining step” was concluded to merely tell a doctor to determine the levelof relevant metabolites in the blood, through whatever process the doctor and the laboratory wishedto use. Id. Methods for doing so were observed by the Court to be well known and in existence in theprior art. Id. at 1298. The Court added that to consider the claimed steps to be seen as an “orderedcombination” added nothing to the laws of nature that was not already present when the steps wereconsidered separately. Id.In the decision, the Supreme Court relied on controlling precedent of Diamond v. Diehr, 450U.S. 175 (1981) and Parker v. Flook, 437 U.S. 584 (1978). Diehr found the claims of the patent beforeit patentable, while Flook did not. In Diehr, the patent at issue related to a method for moldingraw uncured rubber into various cured, molded products. The process in the patent used the knownArrhenius equation to determine when, depending on certain parameters, to open the mold holdingthe rubber. The overall process was considered patent eligible because of the way the additional stepsof the process integrated the equation into the process as a whole. Those steps included “installingrubber in a press, closing the mold, constantly determining the temperature of the mold, constantlyrecalculating the appropriate cure time through the use of the formula and a digital computer, andautomatically opening the press at the proper time.” Diehr, 450 U.S. at 177-79. In Prometheus, theSupreme Court noted that it was never suggested that the claimed process steps in Diehr “were incontext obvious, already in use, or purely conventional.” 132 S. Ct. at 1299.The Prometheus Court characterized the process in Flook as providing a method for adjustingalarm limits in catalytic conversion of hydrocarbons. Certain operating conditions were continuouslymonitored during a conversion process and were used to signal inefficiency or danger when4-58

the IP Book 2012they exceeded certain limits. The claimed process was an improved system for updating those alarmlimits through the steps of measuring the current level of the variable, using an apparently novelmathematical algorithm to calculate current alarm limits, and adjusting the system to reflect the newalarm limit values. The Court in Flook characterized the claimed process as doing nothing other thanproviding an unpatentable formula for computing an updated alarm limit. Flook, 437 U.S. at 586.In comparing the claims in Prometheus to the claims in Diehr and Flook, the Court observed thatthe Prometheus claims presented “a case for patentability that is weaker than the (patent-eligible)claim in Diehr and no stronger than the (unpatentable) claim in Flook.” Prometheus, 132 S. Ct. at1299. The Court said that, beyond picking out the relevant audience, the claim simply instructeddoctors to measure the current level of the relevant metabolite, use the laws of nature to calculate thecurrent toxicity/inefficacy limits, and reconsider the drug dosage in light of the law. Id.In concluding that the claims are more similar to the situation in Flook than in Diehr, the Courtsaid the claims in Prometheus,add nothing specific to the laws of nature than what is well understood, routine,conventional activity, previously engaged in by those in the field. And since theyare steps that must be taken in order to apply the laws in question, the effect is simplyto tell doctors to apply the law somehow when treating their patients.Id. at 1299-300. The Supreme Court stated that the process in Diehr was not so characterized andthat in Flook, it was characterized in roughly the same way.In the decision, the Court looked for additional background to buttress its decision, asserting itcould be found in an English case Neilson v. Harford, Webster’s Patent Cases 295; the previous SupremeCourt decision Bilski, 130 S. Ct. 3218; and another previous Supreme Court decision Benson,409 U.S. 63; each of which was briefly reviewed in the Prometheus decision. Prometheus, 132 S.Ct. at 1300-01.The Prometheus Court also commented on the Federal Circuit’s decision to uphold the patenteligibility of the claims. The Federal Circuit had reasoned that the claimed processes were patenteligible, under Supreme Court precedent, “since they involve transforming the human body byadministering a thiopurine drug and transforming the blood by analyzing to determine metabolitelevels.” 628 F.3d at 1355. The Supreme Court asserted that the first of the transformations wasirrelevant, asserting that the “administering” step simply helps pick out the group of individualswho are likely interested in applying the law of nature. It was asserted that the second step couldbe satisfied without transforming the blood, should science develop a totally different system fordetermining metabolite levels that did not involve such transformation. Prometheus, 132 S. Ct. at1303. The Court also observed that “regardless, in stating that the machine or transformation test is4-59

Chapter 4 – Mayo v. Prometheusan important and useful clue to patentability, it has neither said nor implied that the test trumps the‘law of nature exclusion.’” Id.According to the Court, Prometheus was arguing that, because the particular laws of nature thatthe patent claims were narrow and specific, the patent should be upheld. The Supreme Court dismissedthe argument, asserting that the underlying functional concern is “a relative one: how muchfuture innovation is foreclosed relative to the contribution of the inventor.” Id. The Supreme Courtfurther opined “even a narrow law of nature ... can inhibit future research.” Id. In any event, observedthe Court, its cases “have not distinguished among different laws of nature according to whether ornot the principles they embody are sufficiently narrow.” Id.The Supreme Court also dealt with an argument presented by the U.S. government in an amicusbrief that virtually any step beyond a statement of a law of nature itself should transform an unpatentablelaw of nature into a potentially patentable application sufficient to satisfy the law. The Courtcharacterized the argument as suggesting that the mitigating circumstances would be the questionof whether Section 102 (novelty) and Section 103 (nonobviousness) were met. Id. In particular, theCourt characterized the government as arguing that the claims likely failed for lack of novelty underSection 102. Id. The Court responded that such an argument would make the law of nature exceptionof Section 101 patentability a “dead letter” and concluded that the approach was not consistent withprior law. Id.Prometheus, supported by several amici, also argued that denying patent coverage here wouldsignificantly interfere with the ability of medical research in making valuable discoveries. But theCourt dismissed this argument by noting there were arguments to be made on both sides of this point,and was, thus, not persuaded. Id. at 1304-05. In the conclusion of the decision, the Court said that,with respect to policy, Congress can craft more finely tailored rules where necessary. Id. at 1305.In sum, the Supreme Court reached an interpretation under Section 101 that was not supportedby the Federal Circuit or the U.S. Patent and Trademark Office, the government agency that originallyissued the patents. In doing so, the Supreme Court concluded invalidity under Section 101,when there were many assertions made by the Court that would more logically fit under an analysisbased on novelty or obviousness under Section 102 or Section 103. Indeed, in its analysis underSection 101, the Court inserted principles relating to prior art in a somewhat disconcerting analysis.4-60

the IP Book 2012§ 4.3 Patent Office and Federal Circuit Reaction to thePrometheus DecisionA. The U.S. Patent and Trademark OfficeThe U.S. Patent and Trademark Office (Patent Office) reacted to the Prometheus decisionby issuing a memorandum to the examining corps. The memorandum stated:Process claims having a natural principle as a limiting element or step shouldbe evaluated by determining whether the claim includes additional elements/steps or a combination of elements/steps that integrate the natural principleinto the claimed invention such that the natural principle is practically applied,and are sufficient to ensure that the claim amounts to significantly more thanthe natural principle itself ... to determine whether the requirements of Section101 are met.Andrew H. Hirshfeld, Deputy Commissioner for Patent Examination Policy, 2012 Interim Procedurefor Subject Matter Eligibility Analysis of Process Claims Involving Laws of Nature, Memorandumto the Examining Corps, July 3, 2012. In the document, central inquiries for subject mattereligibility are outlined as follows:1. Is the claimed invention directed to a process, defined as an act, or a series of actsor steps? (If no, the analysis is not applicable.)2. Does the claim focus on use of a law of nature, a natural phenomenon, or naturallyoccurring relation or correlation (collectively referred to as a natural principle)? (Ifno, this analysis is complete.)PRACTICE TIPWhere possible, if filing a process claim that invokes a law of nature, tryto phrase the claim so that the natural principle is not a limiting elementor step in the claim.3. Does the claim include additional elements/steps or a combination of elements/steps that integrate the natural principle into the claimed invention such that thenatural principle is practically applied, and are sufficient to ensure that the claim4-61

Chapter 4 – Mayo v. Prometheusamounts to significantly more than the natural principle itself? (If no, the claim isnot patent-eligible.)PRACTICE TIPIf filing a process claim that includes a natural principle, include stepsthat narrow the scope of the claim in a way that is not considered routineor purely conventional.In the Patent Office memorandum, extensive guideline information and example claimsare provided, and persons authoring patents in this field are directed to its extensive comments. It isapparent that prosecution of such patents will likely involve organizing the patent application andsubmissions to the Patent Office in a manner showing that the inquiries are appropriately satisfied.That is, it appears that the Patent Office wants to issue patents in this area by providing a roadmap,with guidelines and checklists, in an effort to satisfy the Section 101 inquiry as directed by the SupremeCourt.B. The Court of Appeals for the Federal CircuitAs indicated previously, the decision in Prometheus was an overruling of the Federal Circuit.That is, the scope of Prometheus and any effect it has on changing patent practice will likelybe reflected in Federal Circuit decisions. However, the Federal Circuit seems generally not in agreementwith the Supreme Court on the Section 101 interpretation issue. It is likely then, that the FederalCircuit will find ways to limit the reach of Prometheus to the extent that it can.A likely new decision in which the scope of Prometheus will be considered by the FederalCircuit is Ass’n for Molecular Pathology v. Myriad Genetics, Inc., 653 F.3d 1329 (Fed. Cir. 2011),vacated and remanded 2012 U.S. LEXIS 2356 (March 26, 2012). In Myriad, the Supreme Courtvacated a Federal Circuit ruling that the claims were patentable and ordered the lower court to reconsiderthe case in view of Prometheus. 2012 U.S. LEXIS 2356. The oral arguments were held onJuly 20, 2012. Kevin E. Noonan, Federal Circuit Hears Oral Argument in AMP v. USPTO Remand,July 23, 2012, available at, .Myriad involves isolated DNA claims, i.e. composition claims. Myriad has argued that theSupreme Court decision in Prometheus should have no impact on whether genes can be patentedbecause the decision concerned method claims, not composition claims. Supplemental Brief for the4-62

the IP Book 2012Appellants at 5, Ass’n for Molecular Pathology v. Myriad Genetics, Inc., No. 2010-1406 (Fed. Cir.2012). Ultimately, this case seems likely to be decided by the Supreme Court.§ 4.4 Concluding Comments: Prometheus and Public PolicyPatent suits do not come into existence in a vacuum. They generally reflect business issues,circumstances, and calculations. The issue for one party is typically to maintain income stream. Forthe other party, it is typically a calculation to see if, in the final analysis, a business direction could bemade more cost-effective by removing the patent hurdle to it (a so-called “efficient breach”).The economic and public policy issues for balancing were referenced by the Supreme Courtin Prometheus, but they were not given significant attention by the Court in reaching its decision.Patents raise two principal issues: providing for opportunity to obtain return on investment in innovation,and thus to stimulate such investments; and, quid pro quo for disclosing the innovation early,via the patent application publication processes, to ensure dissemination of information and to avoidthe need for repetitive investigation and waste of resources. The Supreme Court’s decision can beargued, if broadly applied, to undermine both of these interests.In 2008, the authors of this chapter presented an extensive discussion of the developing trendof anti-patent commentary and concerns, under the title: The Case Against Patents: Negative Perceptionsabout Patents, How They’re Playing Out in the Law, and What It Means for Your Practiceand Your Client’s Valuable Assets, presented at the Midwest IP Institute in September 2008. The papercan be viewed at .This paper presented numerous citations to newspaper articles and Internet commentary. Many ofthe negative comments reported in the paper were paranoid, and in some instances, irrational. Muchof the development of the negative trends were concerns about access to, and costs of, pharmaceuticalsand medical care. As observed by the authors, even the AARP was taking anti-patent positions,presumably because of a perception that patents were leading to more expensive health care andpharmaceuticals. Indeed, the AARP joined in a brief of amici curiae in Prometheus, predictablyagainst the patents.In the United States, there is no process for “compulsory licensing” in situations such as the onesinvolved here. Thus, one cannot seek (without permission of the patent holder) to apply a medicaltechnique once learned, while merely paying a fixed royalty for the privilege to do so. Rather, thepatent holder has the right to prevent the practice, and the infringer runs the risk of willful infringementand concomitant punitive damages and attorneys’ fees, if the patent is simply ignored.These factors elevate the debate and place pressure on the potential infringer to develop argumentsfor invalidity, so as to avoid financial liability. The litigation that results then does not reflectwell the balancing of interests and policies associated with the patent system and its purposes; but4-63

Chapter 4 – Mayo v. Prometheusrather, the litigation reflects the specific foci and financial interests of the litigating parties. The SupremeCourt, of course, is aware of this lack of balanced reflection of the interests, and this is whatleads to observations such as the ones in the closing comments of the decision of the Court that thepublic policy issue is for the legislature to consider and evaluate. If the U.S. Congress wishes tochange the law or modify the law regarding what is patentable, the Supreme Court knows that Congresscan do so. If Congress wishes to mitigate the effects of the existence of such patents, while atthe same time manage the financial incentives for the research, the Supreme Court knows there aretechniques available to accomplish these objectives.The public policy considerations, even without a change in the law, are worth pondering. Ifpatents were not available for such inventions, there is at least some question whether the researchwould be financed. As soon as a well-financed medical research group does engage in the research,basically for the purpose of satisfying its own staff’s inherent curiosity or desires to improve treatmentfor patients, consider the patent implications. Does the medical research facility have an incentiveto publish the results, so that individuals at other medical facilities can learn of the developmentapplied and build on it? There would be no financial incentive for doing so. The patent systemprovides the financial incentive, and once the application is filed, publication would not damage thepotential financial value of the invention. In the absence of potential for patent protection, wouldthe publication nevertheless occur? In some instances, the facility may choose not to publish the development;rather, the facility may choose to publish its remarkably high rate of effectively treatingthe medical problem without adverse consequences. Thus, at least for a period of time, until othertreatment facilities either rediscover the same techniques or learn them through slow dissemination,the only patients to whom the benefit of the research accrues are those of the specific facility thatdeveloped and discovered the approach.The presence of the patent system, as well as the implications of the publication of informationthat results, changes the outcome. The other research facilities, however, that want to practice theinvention need to deal with the patent rights and implications. It is not possible to “settle” on a clearbalancing of the interests because they will differ from situation to situation in specifics.Commentary following Prometheus has been extensive. See, e.g., Andrew Baluch, More Ammofor the new weapon to knock out patents, The Nat. L. J., May 10, 2012, available at ; Harold C. Wegner, Mayo v. Prometheus: Implications for “Composition[s] of Matter,”April 27, 2012, available at ; Robert R. Sachs, PunishingPrometheus: The Supreme Court’s Blunders in Mayo v. Prometheus, March 26, 2012, available at; Paul Cole, Prometheus v. Mayo – The Wrong Rat?, May 6, 2012,available at . Much of it has focused on problems faced by patentattorneys with the implications of the decision. Nevertheless, the Patent Office Memorandum of July3, 2012, suggests the Patent Office intends to continue to issue patents similar to the ones in Pro-4-64

the IP Book 2012metheus, with merely a requirement in the record that the checklist in the Patent Office memorandumis satisfied. Thus, if the Patent Office will not stop issuing patents including Prometheus-type claims,then it will be left to the courts to fight over the application of Prometheus.4-65

theIP bookChapter 5the IP Book 2012Kappos v. Hyatt:Standard of Review of Patent Office Appeals tothe District CourtMichael M. LafeberErin O. DunganBriggs and Morgan, P.A.Minneapolis§ 5.1 INTRODUCTIONIn Kappos v. Hyatt, the U.S. Supreme Court examined the extent to which a patent applicantseeking review of a decision of the Patent Trial and Appeal Board (the Board) in a federal districtcourt action is able to introduce new evidence not previously submitted to the United States Patentand Trademark Office (PTO). By way of background, a patent applicant who is unhappy with thedecision of the Board regarding a patent application has two options: (1) appeal the decision directlyto the Court of Appeals for the Federal Circuit under 35 U.S.C. § 141, or (2) file a civil action in federaldistrict court against the director of the PTO under 35 U.S.C. § 145. The Hyatt decision focusedon the latter option.The Supreme Court held that: (1) there are no limitations on a patent applicant’s ability to introducenew evidence in a Section 145 proceeding beyond those limitations already present in theFederal Rules of Evidence and the Federal Rules of Civil Procedure; and (2) if new evidence ispresented, the district court must make de novo factual findings, taking into account both the newevidence and the administrative record before the PTO. This chapter reviews the procedural history5-67

Chapter 5 – Kappos v. Hyattof the case and provides an overview of the Supreme Court’s opinion in Kappos v. Hyatt, 566 U.S.__, 132 S. Ct. 1690 (2012).PRACTICE TIPThe 2011 Leahy-Smith America Invents Act (AIA), changed the nameof the Board of Patent Appeals and Interferences to the “Patent Trialand Appeal Board.” See Pub. L. No. 112-29, § 3, 125 Stat. 284, 290(2011). The AIA, enacted while the Hyatt case was pending, did notsubstantively affect the Court’s analysis. See 132 S. Ct. at 1694, n.1.§ 5.2 PROCEDURAL HISTORYIn 1995, Gilbert Hyatt filed a patent application that included 117 claims. The examiner deniedall of Hyatt’s claims for lack of an adequate written description. Hyatt appealed to the Board, whichdenied all but 38 claims. Hyatt then filed a civil action in federal district court under Section 145against the director of the PTO. During the district court proceeding, Hyatt introduced a writtendeclaration identifying portions of the patent specification that he contended supported the claimsthat the Board determined were unpatentable. The district court refused to consider Hyatt’s declaration.Left only to consider the administrative record before the PTO, the district court reviewed theevidence under the deferential “substantial evidence” standard provided in the Administrative ProcedureAct (APA) and granted summary judgment to the director.Hyatt appealed the district court’s decision to the Federal Circuit, and a divided panel affirmed.While the majority acknowledged that “in appropriate circumstances new evidence may be submittedto the district court in a § 145 action” and that review in a Section 145 action is therefore “notstrictly confined” to the administrative record, it also held, “neither are [§ 145] proceedings whollyde novo.” Hyatt v. Doll, 576 F.3d 1246, 1269 (Fed. Cir. 2009). That decision was vacated, however,and the Federal Circuit agreed to rehear the appeal en banc.The en banc Federal Circuit held that patent applicants are free to introduce new evidence in aSection 145 proceeding, subject only to the limitations imposed by the Federal Rules of Evidenceand the Federal Rules of Civil Procedure, even where an applicant has no justification for failing topresent the evidence to the PTO. Hyatt v. Kappos, 625 F.3d 1320, 1331 (Fed. Cir. 2010). The en banccourt also held that where new evidence is presented in a Section 145 proceeding, the district courtmust make de novo findings to take that evidence into account. Id. at 1336. The U.S. Supreme Courtgranted certiorari.5-68

the IP Book 2012§ 5.3 THE U.S. SUPREME COURT’S DECISION: 566 U.S. ___ , 132 S. Ct.1690 (2012)In challenging the Federal Circuit’s en banc decision, the director argued that the district courtshould admit new evidence in a Section 145 action only if the proponent of the evidence had noreasonable opportunity to present it to the PTO. The director also argued that when new evidenceis introduced, the district court should overturn the PTO’s factual findings only if the new evidenceclearly establishes that the agency erred. 132 S. Ct. at 1695-96. The Court construed the director’sarguments as based on “the premise that § 145 creates a special proceeding that is distinct from atypical civil suit filed in federal district court and that is thus governed by a different set of proceduralrules.” Id. at 1696.A. Language of the Statute and Principles of Administrative LawAddressing the director’s arguments, the Court first evaluated the text of Section 145. Thestatute provides:An applicant dissatisfied with the decision of the Board of Patent Appeals andInterferences in an appeal under section 134(a) of this title may, unless appealhas been taken to the United States Court of Appeals for the Federal Circuit,have remedy by civil action against the Director in the United States DistrictCourt for the Eastern District of Virginia if commenced within such time aftersuch decision, not less than sixty days, as the Director appoints. The court mayadjudge that such applicant is entitled to receive a patent for his invention, asspecified in any of his claims involved in the decision of the Board of PatentAppeals and Interferences, as the facts in the case may appear and such adjudicationshall authorize the Director to issue such patent on compliance withthe requirements of law. All the expenses of the proceedings shall be paid bythe applicant.35 U.S.C. § 145. The Court recognized that the plain language of the statute does not impose anyunique rules of evidence or heightened standard of review for an action brought under Section 145.See 132 S. Ct. at 1696.PRACTICE TIPVenue change! The AIA changed the venue for Section 145 actionsfrom the United States District Court for the District of Columbia to the5-69

Chapter 5 – Kappos v. HyattPRACTICE TIP, CONT’DUnited States District Court for the Eastern District of Virginia. See Pub.L. No. 112-29, § 9, 125 Stat. 284, 316 (2011).The Court next analyzed applicable principles of administrative law. The director arguedthat because the district court in a Section 145 proceeding reviews the decision of the PTO—an executiveagency with specific authority and expertise—it should defer to the PTO’s factual findings.The director also pointed to the traditional rule requiring a party to exhaust his or her administrativeremedies in arguing that a district court should consider new evidence only if the party did not havean opportunity to present it to the PTO. See 132 S. Ct. at 1696. The Court disagreed.The Court recognized that the APA limits judicial review of an agency decision to the administrativerecord, but noted that Section 145 proceedings are not so limited because the districtcourt can consider new evidence. Id. Because the district court acts as a factfinder in consideringnew evidence, the Court noted that it makes little sense for the district court to defer to the PTO’sfactual findings because “[t]he PTO, no matter how great its authority or expertise, cannot accountfor evidence that it has never seen.” Id. In this regard, the Court held that the district court must makeits own findings de novo and does not act as a “reviewing court” as envisioned by the APA. Id.The Court also held that the principles of administrative exhaustion—the purpose of whichis to avoid premature interruption of the administrative process—do not apply to a Section 145proceeding because the PTO’s proceeding is complete by the time a Section 145 proceeding is initiated.In other words, there is no potential in a Section 145 action to prematurely interrupt the PTO’sprocess. Id. at 1697. In addition, the Court noted that Section 145 does not provide for remand to thePTO to consider new evidence and there is no need for such a procedure because the district court,unlike a court of appeals, can receive new evidence and act as a factfinder. Id.B. Evidentiary and Procedural Rules in Effect Upon Enactment of theStatuteHaving not been persuaded that the text of the statute or principles of administrative lawsupport an evidentiary limit or a heightened standard of review for Section 145 proceedings, theCourt next examined the evidentiary and procedural rules that were in effect when Congress enactedSection 145 in 1952. The immediate predecessor to Section 145 was codified in 1878 as RevisedStatute § 4915, and the core language of that statute “remains largely unchanged in § 145.” 132 S.Ct. at 1698. The Court pointed to the case of Butterworth v. United States ex. rel. Hoe, 112 U.S. 50(1884), which contrasted the remedy provided by R.S. § 4915 against a technical appeal from the5-70

the IP Book 2012patent office: while an appeal from the patent office was “confined to the case as made in the recordof that office,” a proceeding under R.S. § 4915 was “heard upon all competent evidence adduced andupon the whole merits.” 132 S. Ct. at 1698, quoting Butterworth, 112 U.S. at 61. In this regard, theButterworth Court viewed a proceeding under R.S. § 4915 as “an original civil action, seeking denovo adjudication of the merits of a patent application.” Kappos, 132 S. Ct. at 1698.The director urged the Court to disregard Butterworth and instead follow the holding ofMorgan v. Daniels, 153 U.S. 120 (1894), which held that the PTO’s findings should not be overturnedby “a mere preponderance of the evidence.” Kappos, 132 S. Ct. at 1698, quoting Morgan, 153U.S. at 124. In Morgan, however, neither party presented additional evidence to the district court.See Kappos, 132 S. Ct. at 1698. Moreover, unlike Butterworth, where the patent applicant challengedthe Board’s denial of his patent application, Morgan addressed an interference proceeding.See id. at 1699. Although interference proceedings were originally governed by R.S. § 4915, theyare now governed by Section 146 of the Patent Act, and therefore do not implicate Section 145. Seeid. Accordingly, the Court was not convinced that Morgan should guide its decision, and instead followedButterworth in holding that a district court may consider “all competent evidence adduced” ina Section 145 proceeding “and is not limited to considering only new evidence that could not havebeen presented to the PTO.” Id. at 1700, quoting Butterworth, 112 U.S. at 61. The Court thereforeheld that patent applicants may introduce new evidence in Section 145 proceedings subject only tothe Federal Rules of Evidence and the Federal Rules of Civil Procedure. Id.The Court also held that where new evidence is presented in a Section 145 proceeding ona disputed issue of fact, the district court should make a de novo finding, taking into account thenewly presented evidence along with the evidence before the Board. According to the Court, thismakes sense because the district court is the first tribunal to hear the new evidence in question. In thisregard, it is the district court’s duty to “assess the credibility of new witnesses and other evidence,determine how the new evidence comports with the existing administrative record, and decide whatweight the new evidence deserves.” Kappos, 132 S. Ct. at 1700.PRACTICE TIPHad Hyatt elected to appeal the Board’s decision directly to the FederalCircuit pursuant to Section 141, the court’s review of the Board’s decisionwould have been limited to the administrative record before thePTO, and Hyatt would have been prohibited from introducing any newevidence. See 35 U.S.C. § 144; Kappos, 132 S. Ct. at 1694. In addition,because the APA applies to Section 141 proceedings, the Federal5-71

Chapter 5 – Kappos v. HyattPRACTICE TIP, CONT’DCircuit would have been able to set aside the factual findings of thePTO only if they were unsupported by substantial evidence. See 132S. Ct. at 1694.C. Weight Afforded to Newly-Admitted EvidenceFinally, the Court addressed considerations regarding the weight that may be afforded thepatent applicant’s newly-admitted evidence. The Court noted that while the PTO has special expertisein evaluating patent applications, the district court should not defer to the PTO’s factual findingswhere the PTO evaluated a different set of facts. Accordingly, the Court held that the district courtshould have broad discretion over the weight to be given new evidence. See 132 S. Ct. at 1700.PRACTICE TIPPatent applicants and their attorneys should not be encouraged bythis decision to withhold evidence from the PTO. As the Court noted,“[a]n applicant who pursues such a strategy would be intentionally undermininghis claims before the PTO on the speculative chance that hewill gain some advantage in the § 145 proceedings by presenting newevidence to a district court judge.” 132 S. Ct. at 1700.D. Justice Sotomayor’s ConcurrenceJustice Sotomayor, joined by Justice Breyer, concurred with the decision in full, but electedto note some additional observations. Citing Barrett Co. v. Koppers Co., 22 F.2d 395 (3d Cir. 1927),she observed that “there may be situations in which a litigant’s conduct before the PTO calls intoquestion the propriety of admitting evidence presented for the first time in a § 145 proceeding beforea district court.” Kappos, 132 S. Ct. at 1701. In Barrett, the Third Circuit prohibited the patenteefrom introducing evidence in a R.S. § 4915 proceeding that it had “expressly refused to disclose”during PTO proceedings. See Kappos, 132 S. Ct. at 1701, quoting Barrett, 22 F.2d at 396. The patenteein Barrett was estopped from introducing the evidence so as not to profit from its own wrongdoing.See id., quoting Barrett, 22 F.2d at 397.5-72

the IP Book 2012There was no suggestion in Hyatt that the patent applicant’s failure to present evidence tothe PTO was deliberate, and the concurrence agreed that the applicant was entitled to present the newevidence. However, Justice Sotomayor also noted,I do not understand today’s decision to foreclose a district court’s authority,consistent with the ordinary course of equity practice and procedure, to excludeevidence deliberately suppressed from the PTO or otherwise withheldin bad faith .... I understand courts to retain their ordinary authority to excludeevidence from a § 145 proceeding when its admission would be inconsistentwith regular equity practice and procedure.Id. at 1702 (internal quotations omitted).PRACTICE TIPThe concurring opinion emphasizes once again that the Hyatt decisionshould not be construed as encouraging a patent applicant to withholdevidence from the PTO in the hope of introducing it in a Section 145proceeding, because there is a risk that the court may exclude suchevidence. Moreover, to the extent a district court elects not to excludethe evidence, it may still use its broad discretion to afford such evidencelittle or no weight.E. Limitations on the Court’s HoldingWhile the Hyatt decision clarified the procedure for allowing and reviewing new evidencein a Section 145 proceeding, the Court did not address the appropriate standard of review when nonew evidence is presented in such a proceeding. The Federal Circuit’s holding on this issue thereforeremains untouched: “If the parties to a § 145 action do not introduce any new evidence before thedistrict court, the court reviews the case on the same record presented to the agency and the reviewingcourt must apply the APA’s substantial evidence standard to Patent Office fact findings.” Hyatt,625 F.3d at 1336.5-73

theIP bookChapter 6the IP Book 2012Divided Infringement:A Legal Standard in En Banc LimboFelicia J. BoydAaron A. MyersBarnes & Thornburg LLPMinneapolis§ 6.1 Divided Infringement: What it is, and why it mattersmore than everThe enforceability of many of today’s patents will turn on the issue of whether and when patentowners can enforce their patents in situations where multiple actors, rather than a single individualor entity, combine to practice the patented invention. The issue of “divided infringement” or “jointinfringement” refers to the issue of determining whether there is patent infringement as a matter oflaw where multiple actors combine to practice the limitations of a particular patent claim.Divided infringement, as a legal issue, is more prevalent and relevant than at any time in the historyof patent jurisprudence. The confluence of “The Internet Age” with increasingly evolved businessparadigms—remote and stratified business models, company outsourcing, increased relianceon non-employee consultants, global e-commerce, or other business innovations—has brought theissue of divided infringement to the height of visibility among patent law topics. As technology andbusiness evolve hand-in-hand, companies are increasingly using integrated business methods andworking with other companies and organizations to divide business processes and outsource stepsin order to increase profitability, minimize the risk of liability, or both. These integrated methods,while great for businesses and sometimes valuable for consumers, also create opportunities to avoidliability for patent infringement by performing particular steps of a patent claim but delegating the6-75

Chapter 6 – Divided Infringementperformance of the remaining steps to another entity. Depending on whom one consults, this is eithervery bad or very good for patent law and the economy.Divided infringement as a disputed legal issue often distills to “form over substance” argumentsthat recognize that direct infringement under 35 U.S.C. § 271 typically requires that a single partyperform every limitation of the asserted patent claim, while also recognizing that there are manysituations in which a putative infringer arguably should not be permitted to avoid a legal findingof infringement merely by arranging for a third party to perform one or more steps of the assertedpatent claim. The Federal Circuit has grappled with how to solve this issue for years. The law as towhether two parties working together can be found liable for jointly infringing a patent has evolvedover time, and may very well be at a tipping point. At the time this book was published, the Courtof Appeals for the Federal Circuit was reviewing two divided infringement decisions en banc. TheFederal Circuit’s forthcoming en banc guidance could dramatically shift the law of divided infringement,maintain the present legal standard, or in all likelihood fall somewhere in between.§ 6.2 Evolution of the ‘Mastermind’ StandardThe topic of divided infringement is by no means new. Before the Federal Circuit’s decision inthe landmark case BMC Resources (discussed below) in 2007, courts used primarily two lines ofreasoning when analyzing joint infringement: (1) an agency theory, or (2) a cooperation or “someconnection” theory. The agency rationale has appeared in a number of cases, one of the earliest beingin Mobil Oil Corp. v. W.R. Grace & Co., where the court held that the defendant, in effect, madeeach of its customers its agent in completing the infringing step of heating the catalysts, knowing thatthe infringing step would be promptly and fully completed by customers. 367 F. Supp. 207, 253 (D.Conn. 1973). The Cross Medical Prods., Inc. v. Medtronic Sofamor Danek, Inc. case, a much morerecent case, also used the agency rationale to support the court’s decision. 424 F.3d 1293 (Fed. Cir.2005). The case involved a claim construed to require connection of a bone interface in an anchor tothe spinal bone. The Cross Medical court held that Medtronic, a screw manufacturer, did not directlyinfringe because the claim required a surgeon to set the screw into the bone, thereby performing thefinal step. Id. The court reasoned that because the doctors were not agents of Medtronic, Medtronicwas not liable as a direct infringer. Id. at 1311.Some courts have held that when cooperation or “some connection” between the infringing partiesis found, divided infringement exists. Courts have used the cooperation theory in a number ofcases, including both Shields v. Halliburton Co. and E.I. DuPont De Nemours & Co. v. MonsantoCo. Both courts reasoned that a company could not avoid infringement of a patented process byhaving another party perform one step of the method and that when infringement results from thecombined action of two or more parties, they are all jointly liable for infringement. See Shields v.Haliburton Co., 493 F. Supp. 1376, 1389 (W.D. La. 1980); E.I. DuPont De Nemours & Co. v. Mon-6-76

the IP Book 2012santo Co., 903 F. Supp. 680, 735 (D. Del. 1995). The Federal Circuit continued with the conceptthat cooperation or “some connection” between parties would constitute infringement and held inOn Demand Machine Corp. v. Ingram Indus., Inc. that where more than one entity together performsall of the elements of a claim, and the infringement is the result of this combined action, they can bejoint infringers with joint liability. 442 F.3d 1331, 1345 (Fed. Cir. 2007).In 2007, the Federal Circuit attempted to pronounce a more definitive standard governing dividedinfringement. In the landmark BMC Resources case, the Federal Circuit reinforced the conceptthat a single entity must perform all elements of a claim, unless there is a “mastermind” thatcontracts out the steps to another entity or otherwise “directs or controls” the other party or parties.BMC Resources, Inc. v. Paymentech, L.P., 498 F.3d 1373, 1381 (Fed. Cir. 2007). The Federal Circuitrecognized that this standard may encourage parties to enter into “arms-length agreements” toavoid direct infringement. The court concluded, however, that it preferred that reality to expandingthe scope of direct infringement. Id. The court explained that expanding direct infringement to includemultiple parties infringing in concert would “subvert” indirect infringement because indirectinfringement requires intent, something not required by direct infringement. Perhaps more significant,the Federal Circuit explained that such concerns could be addressed by “proper claim drafting”focusing on a single actor. Id. Not surprisingly, whether patent prosecutors are fairly to blame forarguably “divided” patent claims is one of the more hotly debated topics of patent law today.The cases following the BMC Resources decision continued to raise the standard of what constitutes“direction and control,” making it more difficult for patent holders to prove infringement. Thefollowing year, the Federal Circuit issued its Muniauction decision, further elaborating on the definitionof “mastermind,” and establishing that an arm’s-length transaction is not sufficient to establish“control or direction” even in circumstances where the accused infringer maintained control overthe accused system and provided direction on how to use it. Muniauction, Inc. v. Thomson Corp.,532 F.3d 1318, 1329-30 (Fed. Cir. 2008). Muniauction highlighted what many critics considered thefundamental flaw with the Federal Circuit’s standard: that one could essentially facilitate, or perhaps“aid and abet,” practicing the patented invention without liability for infringement—as long as theaccused infringer did not technically control the third party supplying the final step. In other words,it was arguable that by the end of 2010 the Federal Circuit had gone away from the “directs or controls”standard to what effectively became a “controls” legal standard.§ 6.3 Revealing the Fate of Divided Infringement: The Much-Anticipated Akamai and McKesson En Banc DecisionsIn the spring of 2011, the Federal Circuit set two cases for en banc review that both addressedthe legal standard for divided infringement: Akamai Technologies, Inc. v. Limelight Networks, Inc.and McKesson Technologies Inc. v. Epic Systems Corp. On November 18, 2011, the Federal Circuit6-77

Chapter 6 – Divided Infringementheld oral arguments on the Akamai and McKesson cases to determine the appropriate legal standardfor divided infringement. At the time of publication, the Federal Circuit’s en banc rulings in McKessonand Akamai were expected to come down shortly. The following is a description of both cases’background.A. Akamai Technologies, Inc. v. Limelight Networks, Inc.Akamai Technologies, Inc. (Akamai) and Limelight Networks, Inc. (Limelight) offeredcompeting content delivery services that improved the functionality and speed of their customers’websites. Akamai and Limelight used content delivery networks (CDNs) to direct some or all requestsfor content to the CDN rather than the content provider’s website, thereby reducing the timenecessary to load a webpage. The ‘703 patent owned by Akamai described a four-step method tostore embedded objects on the CDN while the customer’s webpage remained on the content provider’sservers. Moving copies of a webpage object onto a CDN required modifying an object’s Internetaddress—a process known as “tagging.” Limelight structured its business so that it performed threeof the four patented steps, but left the “tagging step” to be performed by the customer.The Federal Circuit considered whether Limelight could be held liable for infringementof the ‘703 patent, even though it only performed three of the four steps. The lower court grantedjudgment as a matter of law, stating that Limelight did not infringe the ‘703 patent and the FederalCircuit affirmed, holding that in order to establish joint infringement under 35 U.S.C. § 271(a), a patentholder had to establish either (1) an agency relationship between the parties who performed themethod steps, or (2) a contractual relationship in which one party was contractually obligated to performthe steps. Akamai Techs., Inc. v. Limelight Networks, Inc., 629 F.3d 1311, 1320 (Fed. Cir. 2010).The Federal Circuit vacated its Akamai opinion on April 20, 2011 pending en banc review.Akamai Techs. v. Limelight Networks, 419 Fed. Appx. 989, 2011 WL 1518909 (Fed. Cir. Apr. 20,2011). The Federal Circuit asked the parties to file new, additional briefs on a specific question: “Ifseparate entities each perform separate steps of a method claim, under what circumstances wouldthat claim be directly infringed and to what extent would each of the parties be liable?” The FederalCircuit heard oral argument on November 18, 2011.The Federal Circuit in its 2010 decision concluded “that there can only be joint infringementwhen there is an agency relationship between the parties who perform the method steps or when oneparty is contractually obligated to the other to perform the steps.” Akamai, 629 F.3d at 1320. In itspetition for rehearing en banc, Akamai argued against the strict “agency or contract” standard, relyingin large part on traditional joint or vicarious liability doctrines to advocate a rule that preventsparties from avoiding infringement by splitting up the steps of the method claim. Akamai assertedthat the appellate panel erred by inserting a “single entity” requirement into 35 U.S.C. § 271(a). It6-78

the IP Book 2012argued that there was no precedent or policy underlying the Patent Act to restrict infringement ofa method claim to only a single actor. See Brief for Plaintiff-Appellant on Rehearing En Banc at 5.Akamai further argued in its petition that the language of the infringement statute, 35 U.S.C.§ 271, requires a “single entity” rule for patent infringement. The statute provides: “[W]hoever withoutauthority makes, uses, offers to sell, or sells any patented invention, within the United States, orimports into the United States any patented invention during the term of the patent therefor, infringesthe patent.” 35 U.S.C. § 271(a). Akamai took the position that nothing in the language of the statuteor the legislative history suggested that “whoever” referred to a single entity; rather, Akamai argued,common knowledge and dictionary definitions define “whoever” as “whatever person or persons.”Brief for Plaintiff-Appellant on Rehearing En Banc at 5 (emphasis added). Accordingly Akamai contendedthat the panel had erroneously progressed toward an agency or contract standard as the solemeans for establishing joint infringement, a belief based primarily on the mistaken view that only asingle entity was capable of infringement. Id. at 8. Akamai urged the entire court to, at the very least,apply and set as the test going forward a broader, more flexible fact-based “direction or control” testas opposed to the rigid and narrow “agency or contractual relationship.” Id. at 17-18.In essence, Akamai’s argument was centered on common law tort principles. While Akamaiagreed with the view that the most common type of vicarious liability is based on respondeatsuperior or agency law, it argued that there were at least three additional common law doctrines ofvicarious liability that may apply in patent cases. See id. at 1. First, Akamai contended that, pursuantto the BMC Resources holding, if one party “directs or controls” another to perform a step of amethod claim, those steps may be attributed to the directing or controlling party as if the party hadperformed the steps itself. Id. Secondly, they argued that performance of the steps of a method claimby two or more parties “acting in concert” should make the parties jointly and severally liable fordirect infringement. Id. at 2. Finally, it asserted that those who had actual or constructive knowledgethat all steps that constituted the patented method were being carried out and knew that such conductwould result in tortious injury should be held liable for direct infringement. Id. at 3. Innocent parties,who were merely carrying out steps in isolation without any knowledge, would avoid liability.“There is simply no reason why a party who performs all steps of a method claim is liable, but partieswho perform some steps and (1) direct or control the performance of others, (2) act in concert withanother to perform all the steps, or (3) knowingly combine their acts with those of another to performall the steps should be able to avoid liability.” Id. at 42-43.Limelight countered Akamai by presenting four key arguments. Limelight first argued thatbecause direct infringement is a strict liability tort, “pure vicarious liability” forms the only basis foracknowledgment. See Brief for Defendant on Rehearing En Banc at 15-16. Vicarious liability for theacts of a third party only applies, Limelight argued, if the defendant “directs, commands, or knowinglyauthorizes” the acts in question. Id. at 16. Limelight contended that Akamai failed to satisfy6-79

Chapter 6 – Divided Infringementthis standard and further that Limelight had no ability to control their customers’ actions either basedon the parties’ relationship or on a contractual obligation owed by the content providers. Id. at 16-17.Second, Limelight argued that the conduct-attribution rules argued by Akamai were inapplicablebecause 35 U.S.C. § 271(a) could not include a “knowledge” requirement. Limelightasserted that Akamai’s argument for finding infringement from “looser” forms of influence over athird party’s conduct were incorrect because direct infringement is a strict liability tort and does notdepend on fault. See id. at 17. Recognition of such a tort would undermine the strict liability natureof direct infringement by making a defendant’s liability for direct infringement turn on awareness ofa third party’s conduct. Id. at 18.Third, Limelight argued that broader attribution rules would compromise the independentform of liability for indirect infringement under 35 U.S.C. § 271(b) and (c). Id. at 40. By allowinga defendant to be liable for direct infringement based on “nothing more than knowledge that thecustomer will carry out the step would allow imposition of liability based on third-party conduct inthe absence of proof of knowledge and intent which would conflict with the intent and knowledgerequirements of (b) and (c).” Id. at 40-41.Fourth, Limelight contended that prior precedent on joint infringement relied on agency,contract, or indirect infringement and therefore Akamai’s argument was unsupported by precedent.Id. at 24-25. Limelight defended the narrow rule, as earlier interpreted on its behalf, that an agencyor contractual relationship must exist before direct infringement is found. Limelight observed thatthis interpretation was consistent with the standard articulated in BMC Resources and Muniauction,and that to permit attribution of conduct in the absence of direction or control would conflict withand also undermine the intent embodied in the infringement statute. Id. at 41.B. McKesson Technologies Inc. v. Epic Systems Corp.The McKesson patent involved an electronic method of communication between healthcareproviders and patients involving personalized web pages for doctors and their patients and facilitatingcommunication between patients and doctors, which offered a patient more information thanone could glean during a typical visit to a physician’s office. See McKesson Techs., Inc. v. Epic Sys.Corp., No. 2010-1291, slip op. at 2-3 (Fed. Cir. Apr. 12, 2011). Epic Systems developed and sold“MyChart” software that allowed healthcare providers to “associate medical records with a patient’spersonal webpage and allow[ed] the patient to communicate with … healthcare providers online.”Id. at 3. Epic Systems licensed MyChart to healthcare providers who then offered the product topatients.The Federal Circuit initially found that because “users acted principally for their own benefitand under their own control…without an agency relationship or contractual obligation, the MyChart6-80

the IP Book 2012users’ actions [could not] be attributed to the MyChart providers, Epic’s customers.” Id. at 8 (citationomitted). The Federal Circuit implied that merely providing software to a party or even encouraginguse of software was not enough to establish “direction or control.” Id. In the dissent, Judge Newmanopined that it was a mistake to turn the “single-entity” concept into an absolute rule, as opposed toconducting fact-based inquiries guided by the usual rules of vicarious liability. Id., J. Newman dissent,9-15. Judge Newman’s dissent staked out the effect such a rule of law would hold for patentholders and inventors:A patent that cannot be enforced on any theory of infringement, is not a statutorypatent right. It is a cynical, and expensive, delusion to encourage innovatorsto develop new interactive procedures, only to find that the courts will notrecognize the patent because the participants are independent entities. Fromthe error, confusion, and unfairness of this ruling, I respectfully dissent.Id. at 17 (Justice Newman, dissenting). Both Judge Bryson and Judge Newman called for en bancreview and, on May 26, 2011, the Federal Circuit accepted McKesson’s appeal for en banc review.McKesson Techs. v. Epic Sys. Corp., 2011 WL 2173401 (Fed. Cir. May 26, 2011). The circuit acceleratedthe usual briefing deadlines, giving McKesson less than a month to file a new brief on thefollowing questions:1. If separate entities each perform separate steps of a method claim, under whatcircumstances, if any, would either entity or any third party be liable for inducinginfringement or for contributory infringement? See Fromson v. Advance OffsetPlate, 720 F.2d 1565 (Fed. Cir. 1983).2. Does the nature of the relationship between the relevant actors—e.g., service provider/user;doctor/patient—affect the question of direct or indirect infringementliability?McKesson, much like Akamai’s argument, advocated that courts should consider tort-relatedprinciples when determining how divided infringement should be treated. Brief for Plaintiff onRehearing En Banc at 17. First, McKesson argued that “a party that knowingly combines its actionswith those of another to commit a tort is liable even if each party’s acts, ‘standing alone,’ would notbe wrongful, but together they cause harm to the Plaintiff.” Id. at 13. Second, McKesson arguedthat a party that “directs, controls, induces or fails to exercise a right to control another’s action isresponsible for that action.” Id. Finally, McKesson reasoned that a party that “does a tortious act inconcert with another or pursuant to a common design with him shares liability for the tort.” Id. at 14.McKesson argued that the Federal Circuit had incorrectly moved away from tort law doctrine andhad “erred in effectively converting the ‘direction or control’ standard into a ‘control’ one and limitingliability to only two forms of control: an agency relationship or contractual obligation.” Id. at 27.6-81

Chapter 6 – Divided InfringementMcKesson also relied on the importance of the doctor-patient relationship and advocatedthat this special relationship gives rise to liability. “The doctor-patient relationship raises an especiallystrong inference that patients act pursuant to their doctors’ directions. Patients may not belegally obligated to follow those directions, but when they do, the doctors are responsible for theresulting conduct.” Id. at 14.Epic, much like Limelight, argued that the BMC Resources and Muniauction decisionsproperly interpreted the patent statutes and that to allowpatentees to pursue indirect infringement claims without strict-liability of directinfringement or to combine the actions of multiple parties to cobble togethera showing of direct infringement of a method claim without evidencesufficient to hold one party liable for another’s conduct runs contrary to theCongressional intent behind the Patent Act and well-settled Supreme Courtprecedent.Brief for Defendant on Rehearing En Banc at 11.Epic also disagreed with McKesson’s argument that labels of specific relationships betweenactors who perform different steps of a method claim determine whether or not direct infringementhas occurred. Id. at 12. Epic argued that Congress defined direct infringement as a strict liability offenserequiring performance of all elements of patent claims. Id. Epic further argued that the FederalCircuit had correctly preserved the division between the strict liability direct infringement offenseand the knowledge-based indirect infringement offense and that to adopt McKesson’s argument,“would obsolete knowledge and intent-based claims of indirect infringement.” Id. at 13-14.§ 6.4 Tea Leaves for a Legal Standard in WaitingA. The Most Recent PrecedentThe cases that have been decided while the patent world waits for the en banc decisions may(or may not) shed light on potential nuances of the forthcoming en banc rulings. In January 2011,the court issued its ruling in Centillion Data Sys. v. Qwest Communs. Int’l, Inc., 631 F.3d 1279 (Fed.Cir. 2011). The patent in Centillion disclosed a system for collecting, processing, and delivering informationfrom a service provider, such as a telephone company, to a customer. Id. In Centillion, theFederal Circuit found that there was direct infringement by the customer because the customer “putsthe system as a whole into service, i.e., controls the system and obtains benefits from it.” Id. at 1285.It is important to distinguish between the direct infringement and indirect infringement analysis inCentillion, but, regarding the direct infringement issue, the court held that Qwest was not a direct6-82

the IP Book 2012infringer because it did not direct its customers to perform any steps, nor were the customers agentsof Qwest. Id. at 1287.The District of Delaware, in Kenexa Brassring Inc. v. Taleo Corp., followed Centillion bystating that “use,” for purposes of infringement, requires that a party must put the invention into serviceor, in other words, control the system as a whole and obtain a benefit from it. No. 07-521-SLR,2011 U.S. Dist. LEXIS 57208, at *4 (D. Del. May 26, 2011). A party need not exercise physical ordirect control over each individual element of the system. “[D]irect infringement by ‘use’ of a systemclaim requires a party to use each and every element of a claimed system.” See Centillion Data Sys.,LLC v. Qwest Commc’ns Int’l, Inc., 631 F.3d 1279, 1284 (Fed. Cir. 2011). Much like Qwest, Taleomade the “back-end” processing elements, but never “used” the entire claimed system because itnever put into service the personal computer data processing means. Kenexa Brassring, Inc., 2011U.S. Dist. LEXIS 57208, at *4. The court denied the plaintiff’s motion to reconsider a finding of noinfringement, stating that although the defendant made back-end processing elements, it never usedthe entire claimed system. Because it never put the display of the source data stream into service—requiring the user to click on a hyperlink in order to do so—there was no infringement. Id.In a very recent divided infringement case, the Tropp v. Conair Corp. court clarified thatthe Muniauction court did not hold that vicarious liability was the only way to satisfy the control ordirection standard. The Tropp court argued that this decision only made clear that (1) mere “armslength”cooperation is not sufficient; and (2) vicarious liability, if established, is sufficient. Tropp v.Conair Corp., No. 08-CV-4446, 2012 U.S. Dist. LEXIS 25064, at *13 (E.D.N.Y. Feb. 22, 2012);Muniauction, 532 F.3d at 1329-30. The court held that Muniauction left some open space to be testedin subsequent litigation, such that a “later case could still hold that it is not necessary to show factssufficient to support traditional vicarious liability.” Tropp, 2012 U.S. Dist. LEXIS 25064, at *13.The court reasoned that defendants were relying on an “exaggerated view of the certainty and staticdeterminism of the law of divided infringement.” Id. The court accordingly denied the defendant’smotion for attorneys’ fees. Id. at *14.B. Snapshots From the Amici BriefingJust as one might read tea leaves from decisions coming down while the en banc cases awaitdecision, the amici curiae briefing might also provide ideas on where the Federal Circuit could takedivided infringement. Numerous organizations have provided such briefs for the pending en bancquestions.For example, the American Intellectual Property Law Association (AIPLA) submitted anamicus brief in support of a change to the existing law of divided infringement. AIPLA’s brief advocatedthat the single-entity rule for deciding method-claim infringement where multiple actors performthe claim steps had “created loopholes that dramatically reduce the exclusive rights conferred6-83

Chapter 6 – Divided Infringementby validly issued patents.” Amicus Brief of Am. Intell. Prop. Law Ass’n in Support of Reversal, butin Support of Neither Party, at 2. AIPLA argued that under 35 U.S.C. § 271(a), proof of infringementrequires evidence of performing all steps of the method claim; however, it does not require that asingle entity perform all of those steps. Id. Furthermore, AIPLA argued, determining direct infringementbased on whether the participants had an agency or contractual relationship only invites adefendant to outsource steps to avoid infringement. Id at 18. AIPLA argued that an “analysis shouldnot require an agency relationship between the parties who perform the method steps or contractualobligation but instead should conform to traditional tort law basis for patent infringement.” Id. at 4.AIPLA’s brief submitted that the current law has “created a gaping loophole that renders issued andfuture patents in important technologies virtually unenforceable.” Id.Another notable organization, the New York Intellectual Property Law Association(NYIPLA), submitted an amicus brief arguing that existing patent law doctrines should determineinfringement of method claims. Amicus Brief of Am. Intell. Prop. Law Ass’n in Support of theDefendant-Appellee, at 3-4. NYIPLA advocated that arguably divided patent claims should:“(i) receive the same protection as any other type of invention best protected by method claimsand (ii) not compel a change in the law that will generate a ripple effect of uncertainty beyond thenarrow confines of the present dispute or the Akamai appeal.” Id. at 4. NYIPLA, fearing arbitraryprecedent, argued that there was no need to create a new special class of infringers who would “existat the whim of the patentee that cobbles together different persons—not working in common or in aprincipal-agent relationship—to create an act of infringement that did not exist before.” Id. NYIPLAurged the Federal Circuit to follow precedent and uphold the ruling in Akamai and continue toemploy the narrower, more rigid “contractual or agency relationship” standard.§ 6.5 ConclusionCommentators and critics will continue to speculate on what the Federal Circuit will or shoulddo with the issue of divided infringement and the questions pending before the Federal Circuit enbanc. There are reasonable arguments to be made all around. It may be beneficial for the FederalCircuit to soften the standard, thereby protecting patent holders from infringers that are effectivelyattempting to circumvent the system and ultimately obtain the fruits of inventions that patent lawswere designed to protect. Others might argue that the Federal Circuit should closely follow precedentand maintain the rigid “agency or contractual” relationship standard so as not to blur the linebetween indirect and direct infringement and to encourage business methods that ultimately avoidinfringing issued patents and thereby promote competition and economic health. The Federal Circuitcould uphold the “agency or contract” standard from Akamai, uphold the “direction or control”standard but provide explication on the types of relationships that would satisfy that standard, choosea more lax “some connection” standard that would benefit patent owners, or come up with a legalstandard rooted in existing tort doctrines. The Federal Circuit has an incredibly broad array of op-6-84

the IP Book 2012tions—which perhaps explains why the Federal Circuit has taken so much time to issue its criticalen banc rulings.Whatever the Federal Circuit decides, the court’s decision is unlikely to lack for impact or critique.Developments in this area of patent law could significantly affect business models, litigationoutcomes, and facets of business and intellectual property for years to come. The decisions implicatepatent lawyers, patent litigators, and transactional lawyers charged with drafting documents andnegotiating business relationships that minimize their clients’ liability risks. The Federal Circuit’sopinion might render certain patent claims effectively unenforceable and, at the least, could significantlyimpact how certain patent claims are drafted going forward. In short, the stakes are high, andmany hope that the forthcoming en banc rulings will provide some critical, long-awaited guidanceon one of the most difficult and relevant areas of patent jurisprudence today.6-85

theIP bookChapter 7the IP Book 2012Developments in the Law ofPatent Damages in 2011-2012Kevin P. WagnerAri B. LukoffFaegre Baker Daniels LLPMinneapolis§ 7.1 IntroductionOver the last several years the Federal Circuit made major changes to the law of reasonableroyalty damages, all of which increased the burden on the plaintiff to prove the damages it sufferedas a result of the alleged infringement and made large damage awards more difficult to achieve.Specifically, in Lucent Technologies., Inc. v. Gateway, Inc., 580 F.3d 1301 (Fed. Cir. 2009), the courtstressed the requirement for a patent plaintiff to satisfy the entire market value (EMV) rule beforeit could base its reasonable royalty analysis on the revenues obtained for an entire product whenthe patented feature represented only a small portion of the product as a whole. See also CornellUniversity v. Hewlett-Packard Co., 609 F. Supp. 2d 279 (N.D.N.Y. 2009); IP Innovation LLC v. RedHat, Inc., 705 F. Supp. 2d 687 (E.D. Tex. 2010). In ResQNet.com Inc. v. Lansa, Inc., 594 F.3d 860(Fed. Cir. 2010), the court emphasized reliance on comparable license agreements over other formsof proof regarding damages. And in Uniloc USA, Inc. v. Microsoft Corp., 632 F.3d 1292 (Fed. Cir.2011), the court struck down the 25-percent rule of thumb, further shifting the reasonable royaltyanalysis toward the use of more concrete proof of damages.The past year saw a marked decrease in watershed reasonable royalty opinions from the FederalCircuit. Instead, both parties and district courts around the country struggled to adapt to the new state7-87

Chapter 7 – Developments in the Law of Patent Damages in 2011-2012of the law on reasonable royalties. The Federal Circuit itself considered only two reasonable royaltycases worthy of publication over the past year. See Powell v. Home Depot, Inc., 663 F.3d 1221 (Fed.Cir. 2011); Spectralytics, Inc. v. Cordis Corp., 649 F.3d 1336 (Fed. Cir. 2011). In both of those cases,the Federal Circuit affirmed the jury’s reasonable royalty award after hearing evidence based on atraditional Georgia Pacific analysis that focused on real world indicators of the economic value ofthe inventions in dispute.Rather than continuing to remake the law of reasonable royalty damages, over the past year, theFederal Circuit turned its attention to the standards for injunctive relief, ongoing royalties, willfulness,and enhanced damages. In each of these areas, the court made significant changes to the law,but changes that were not fully unexpected following the U.S. Supreme Court case of eBay Inc. v.Mercexchange, L.L.C., 547 U.S. 388 (2006) affecting injunctions, and the Federal Circuit’s en bancdecision In re Seagate Technology, 497 F.3d 1360 (Fed. Cir. 2007) affecting willfulness.Each of these developments from the past year in the law relating to remedies for patent infringementis addressed below.§ 7.2 Reasonable Royalty DamagesThe struggles of both parties and district courts in adapting to the new standards for determiningreasonable royalty damages are perhaps best illustrated by decisions in the remanded cases of LucentTechs. Inc. v. Microsoft Corp. and ResQNet.com, Inc. v. Lansa, Inc.Lucent was initially awarded $358 million in reasonable royalty damages, but this award wasoverturned because it was based on an application of the EMV rule without sufficient evidence thatthe accused feature provided the basis for customer demand. Lucent Techs., 580 F.3d 1301, 1336‐39(Fed. Cir. 2009). The accused feature in Lucent was a date-picker feature used within MicrosoftOutlook. Id. at 1317. Outlook was sometimes sold as a stand-alone product and other times bundledwith the three other products in the Microsoft Office suite. See id. at 1320.On remand, Lucent’s damages expert started with the 109.3 million licenses to Microsoft Officeand the 250,000 licenses to Outlook that had been sold during the relevant damages period. LucentTechs. v. Microsoft Corp., No. 07-CV-2000 H, 2011 U.S. Dist. LEXIS 130571, at *19 (S.D. Cal.Nov. 10, 2011). He then relied on survey evidence from another Lucent expert, which found that 43percent of Outlook users used the drop-down calendar and that seven percent of those individualswould not have purchased Outlook without the accused date-picking feature. Id. at *20. By multiplyingthese figures together, Lucent’s expert opined that Microsoft stood to lose 3.3 million in sales ifit could not include the date-picker function in Outlook. Id. To monetize this potential loss, Lucent’sexpert determined that Microsoft’s average revenue from selling Outlook as a stand-alone productwas $67 per license. Id. at *20-21. Microsoft’s average revenue from the bundled Office products7-88

the IP Book 2012was $98, but Lucent’s expert attributed $67 of this revenue to Outlook based on the Outlook salesprice, the fact that Outlook was the most-used of the included Office products, and based on comparativepricing between bundles that included Outlook with those that did not include Outlook. Id.When 3.3 million in potential lost sales is multiplied by $67 per sale, Lucent’s expert opined thatMicrosoft could have lost as much as $221 million in revenue if it did not include the accused feature.Id. at *22. Nearly $140 million of this represented Microsoft’s profit. Id. at *23. Based on thisamount at risk, and his analysis of the Georgia Pacific factors, he opined that Microsoft and Lucentwould have essentially split this amount in a hypothetical negotiation, with Microsoft agreeing to alump sum payment of $70 million. Id. at *26-27. The jury agreed and awarded $70 million in reasonableroyalty damages. Id.After trial, Microsoft moved for remittitur and/or a new trial contending that despite this detailedanalysis, Lucent’s expert had still overvalued the accused feature. Id. at *57-59. Lucent concededthat it could not satisfy the EMV rule, but asserted that it had properly apportioned Microsoft’s revenueto determine the value of the accused components. Id. at *30. The court ultimately disagreed.Id. at *40, 42-43. The court focused on Lucent’s apportionment of the $98 of revenue from sales ofOffice, and found that attributing $67 of this revenue to Outlook but only $31 to Word, PowerPoint,and Excel was not justified. See id. at *43. As an alternative, the court divided the $98 pot into fourequal portions for the four included products, resulting in an apportionment of $24.55 for Outlook.Id. at *43-44. This change resulted in a remittitur of the total damages award to $26.3 million, adrastic reduction from the jury award on remand of $70 million, and a far cry from the original awardof $358 million. Id. at *45.The complexity of the reasonable royalty analysis was also reflected in ResQNet, but the stakeswere far smaller. The original damages award in ResQNet was just over $500,000, but this awardwas struck down by the Federal Circuit because it did not take into account the most relevant comparablelicense agreements. ResQNet.com, Inc. v. Lansa, Inc., 594 F.3d 860, 876-78 (Fed. Cir. 2010).On remand, the issue of damages was tried to the judge, with ResQNet’s expert focusing in far moredetail on the royalty rates from two available comparable license agreements. ResQNet.com, Inc. v.Lansa, Inc., 828 F. Supp. 2d 688, 694-95 (S.D.N.Y. 2011). Those license agreements involved morethan just the asserted patents, however, and the court took issue with both parties’ attempts to apportionthose rates among the licensed patents. See id. Specifically, the plaintiff’s expert stated thatthe inclusion of multiple patents would have a “downward influence” on the rates without furtheranalysis. Id. at 695. The defendant’s expert simply divided the agreed upon rates by the number ofincluded patents. Id. The court found that “both approaches must be rejected.” Id. Ultimately, inconsideration of the available comparable license agreements and the remaining Georgia Pacificfactors, the court settled on a reasonable royalty rate of three percent, which resulted in a total awardof $164,265. Id. at 698.7-89

the IP Book 2012mand. Id. at *6. There was evidence that the patented fan contributed to the weight andfuel consumption required of these engines, and that the fan was an important feature,but the court did not consider this proof sufficient. Id. at *7. Similarly, in Carefusion303, Inc. v. Sigma Int’l, No. 10-CV-0442-DMS, 2012 WL 392808 (S.D. Cal. Jan. 3,2012) the court rejected application of the EMV rule where the plaintiff submittedevidence that the claimed sensor contributed to the overall safety of the accused infusionpumps, and that the safety drives customer demand. Id. at *2. The court foundit insufficient that the claimed component contributed to an intermediary feature thatdrove customer demand. Id. at *3. Characterizing this argument as “appealing,” thecourt nevertheless found that under such an argument any component that contributesto safety could be characterized as the basis for customer demand, and that allowingsuch an argument would undercut the EMV rule altogether. Id.3. Can the EMV rule ever apply without evidence that the patented component is the basisfor customer demand?In Mondis Tech., Ltd. v. LG Electronics, Inc., No. 2:07–CV–565–TJW–CE, 2011 WL2417367 (E.D. Tex. June 14, 2011), one court answered this question in the affirmative,finding that use of the revenues from the entire accused product was economically justifiedbased on 13-16 comparable license agreements that all used the same royalty base.Id. at *2-3. In contrast, in Lighting Ballast Control, LLC v. Philips Electronics NorthAmerica Corp., No. 7:09–CV–29–O, 2011 WL 7575006 (N.D. Tex. June 10, 2011), thesame argument was rejected, with the court finding that the plaintiff’s expert requiredproof that the patented feature was the basis for customer demand before he could comparehis asserted royalty to the profitability defendants had achieved from selling theirproducts as a whole. Id. at *5-7.4. Can rules of thumb other than the 25-percent rule be used?After Uniloc struck down the 25-percent rule of thumb, some parties turned to other“rules of thumb” to try to fill this hole. In both Oracle America, Inc. v. Google, Inc., 798F. Supp. 2d 1111 (N.D. Cal. 2011), and Mformation Techs., Inc. v. Research in MotionLtd., No. C 08–04990-JW, 2012 WL 1142537 (N.D. Cal. Mar. 29, 2012), the plaintiffsattempted to rely on the Nash bargaining solution as part of their damages analysis. Accordingto the Nash model, the goal is to identify both the profits that each party couldexpect without a deal and the surplus created by their cooperation. Oracle, 798 F. Supp.2d at 1119. Each party then receives the same profits it would expect without a deal andthe remaining surplus is divided evenly between them. Id. In Oracle, use of the Nashbargaining solution was harshly criticized as yet another rule of thumb that was not adequatelytied to the facts of the case. Id. at 1120-21. The court excluded reliance on this7-91

Chapter 7 – Developments in the Law of Patent Damages in 2011-2012method, and stated that “[t]he Nash bargaining solution would invite a miscarriage ofjustice by clothing a fifty-percent assumption in an impenetrable façade of mathematics.”Id. In contrast, in Mformation the court allowed the plaintiff’s expert to rely onthe Nash bargaining solution as a check on his reasonable royalty analysis under theGeorgia Pacific factors. 2012 WL 1142537, at *2-3.5. What is the proper hypothetical negotiation date?It has long been the rule that a hypothetical negotiation should be conducted on the dateof first infringement. There remains an open question as to whether the “date of firstinfringement” should be the date of first sale or the date of first manufacture. Again,district courts have split on this issue within the past year. In Boston Scientific Corp.v. Cordis Corp., 777 F. Supp. 2d 783 (D. Del. 2011), the court rejected the defendant’scontention that the hypothetical negotiation would have occurred on the first date ofmanufacture in the U.S., and instead held that the date of first sale was the relevant date,citing Wang Labs., Inc. v. Toshiba Corp., 993 F.2d 858, 869 (Fed. Cir. 1993). In contrast,in Oracle America, Inc. v. Google Inc., the court fell back on the principle of “firstinfringement,” and reasoned that “[w]here an accused product is developed and testedhere in the United States, however, ‘use’ and therefore infringement will almost alwaysbegin well before the first sale.” 777 F. Supp. 2d at 1116. As a result, the Oracle courtheld that the hypothetical negotiation should occur on the date of first manufacture. Id.While each of the above questions remains to be answered definitively by the Federal Circuit,the Federal Circuit did clarify three issues within the past year relating to reasonable royalty damages.A. A Reasonable Royalty Can Exceed a Patentee’s Expected Profits for thePatented Invention: Powell v. Home Depot, Inc., 663 F.3d 1221 (Fed. Cir.2011)A reasonable royalty is not capped by an infringer’s expected profits. GoLight, Inc. v. Wal-Mart Stores, Inc., 355 F.3d 1327, 1338 (Fed. Cir. 2004). This is because an infringer can always takesteps to continue making the product, including, for instance, raising the price to cover the royaltypayments. See id. In the Powell case, the court addressed the converse issue: whether a reasonableroyalty can exceed a patentee’s expected profits.In Powell, a jury awarded the plaintiff $15 million as a lump sum reasonable royalty on apatent covering a safety guard for saws. 663 F.3d at 1237-38. This corresponded to a royalty rate ofabout $7,500 per infringing unit. Id. The defendant argued that the rate was unreasonable because7-92

the IP Book 2012in 2004, the plaintiff and defendant had signed an agreement, and that agreement would have nettedthe plaintiff about $2,500 per unit in profit. Id.The Federal Circuit first rejected the defendant’s argument based on the facts. Id. at 1238.In particular, the court found that at the time the 2004 agreement was executed, the parties wereuncertain as to whether the plaintiff’s saw guard would work. Id. The hypothetical negotiation wasdeemed to have occurred two years later when infringement began, however, and by that time, theplaintiff’s invention had been proven to work. Id.Next, the court addressed the defendant’s argument that a reasonable royalty is capped as amatter of law by the patentee’s expected profits on the invention. Id. at 1238-39. Noting how “an infringer’snet profit margin is not the ceiling by which a reasonable royalty is capped,” the court heldit was “equally appropriate” to not limit a reasonable royalty by a patentee’s expected profits. Id. at1238. Thus, “[w]hile either the infringer’s or the patentee’s profit expectation may be considered inthe overall reasonable royalty analysis ... , neither is an absolute limit to the amount of the reasonableroyalty... .” Id. at 1238-39.The court then affirmed that substantial evidence supported the jury verdict, finding proofin the amount the defendant paid to replace an inferior product with the infringing device, as well asthe benefits of the patented device over the available alternatives. Id.B. Non-Patent License Agreements Can Support a Reasonable Royalty:Spectralytics, Inc. v. Cordis Corp., 649 F.3d 1336 (Fed. Cir. 2011)In ResQNet.com Inc. v. Lansa, Inc., 594 F.3d 860 (Fed. Cir. 2010), the Federal Circuit emphasizedthat only licenses that are comparable to the patent-in-suit are appropriate evidence in thereasonable royalty analysis. One year later, in Spectralytics, the court affirmed the use of an agreementthat was not a license, but a sales commission agreement, as evidence of a reasonable royalty.649 F.3d at 1346-47.Spectralytics sued Cordis Corporation and its exclusive supplier, Norman Noble, alleginginfringement of a patent used to create metal stents. Id. at 1339. A jury found that the defendants hadwillfully infringed, and awarded Spectralytics a five-percent royalty. Id. The district court grantedSpectralytics’ motion for a permanent injunction, enhanced damages, and attorneys’ fees. Id. Afterrejecting a challenge to the jury verdict of validity, the Federal Circuit turned to the damages award.Id. at 1341-45.The defendants argued that the reasonable royalty award was unsupported by the evidencebecause it exceeded the cost of adopting a non-infringing alternative. Id. at 1346. Furthermore, thedefendants argued that the only source for a five-percent royalty rate was a sales agreement betweenNorman Noble and its salesperson, according to which the salesperson was paid a five-percent com-7-93

Chapter 7 – Developments in the Law of Patent Damages in 2011-2012mission. Id. at 1346. The defendant argued that the amount of a sales commission agreement was“not related to any of the standard measures of infringement damages.” Id. at 1346. The court rejectedthis argument, finding that the commission was relevant to the amount that Norman Noblewas willing to pay to procure a business relationship with its customer, Cordis. Id.Furthermore, the court found the sales commission rate was not the sole evidence in supportof the jury verdict. Id. For example, the plaintiff’s expert testified that a 20-percent royalty ratewould be reasonable, and Norman Noble’s profit margin on the infringing device was 67 percent.Id. at 1346-47. Lastly, Spectralytics’ sale of its assets for $4 million plus 25 percent of any patentinfringement recovery did not mean that the jury overvalued the patent. Id. at 1347. Rather, the courtindicated, the asset sale price reflected the uncertainty associated with the then-pending patent infringementclaim. Id. As a result, the evidence provided a reasonable basis for the damages verdict.Id.C. Communications Regarding Patent Licenses Taken To SettleInfringement Claims Are Discoverable: In re MSTG, Inc., 675 F.3d 1337(Fed. Cir. 2012)In 2008, MSTG sued AT&T and other cellular telephone service providers for infringingits patents that covered 3G mobile technology. Id. at 1339. In 2009, MSTG expanded its litigationand sued other cell phone service providers and device manufacturers. Id. Most of the defendantssettled by taking a license, and one defendant entered into an option contract permitting it to take alicense at a later time at a predetermined rate. Id. In addition, MSTG licensed the patents-in-suit to atechnology consortium, giving it the right to sublicense the patents. Id. In sum, all of the defendantsexcept AT&T exited the case. Id.During discovery in the case against AT&T, MSTG produced six of the license agreementsand the option contract. Id. AT&T moved to compel MSTG to produce all documents “reflectingcommunications between MSTG or its attorneys, on the one hand, and either licensees or partiesthreatened with infringement by MSTG, on the other.” Id. at 1340. A magistrate denied AT&T’smotion to compel. Id.Later, after MSTG’s expert opined that because the licenses were “litigation related compromises,”they were not comparable to the competitive positions of MSTG and AT&T, AT&Tmoved the court to reconsider its earlier ruling. Id. The magistrate granted the motion because thecommunications could be used to impeach the expert. The district court approved the order. Id.In seeking a writ of mandamus at the Federal Circuit, MSTG argued that the court shouldadopt an evidentiary settlement privilege that would shield its earlier licensing negotiations fromdiscovery. Id. The Federal Circuit looked to Federal Rule of Evidence 501, which authorizes the7-94

the IP Book 2012federal courts to define new privileges by interpreting the “common law ... in light of reason andexperience.” Id. at 1342-43. The court considered six aspects of the privilege in making this assessment.First, it looked to the “policy decisions of the States,” and found that no states had recognizedsuch a privilege outside the context of mediations. Id. at 1343. Second, it looked to whether Congresshad considered the issue, and found Federal Rule of Evidence 408, which shields evidence ofsettlements from being used to prove the “validity or amount of a disputed claim or to impeach bya prior inconsistent statement or contradiction.” Id. at 1343-44. Rule 408, however, did not create abroad privilege, the court found, and the rule allowed the use of settlement negotiation communicationsfor other purposes. Id.Third, the court looked to the recommendations of the Advisory Committee of the JudicialConference, and found that a settlement privilege was not included on the committee’s list of recommendedprivileges. Id. at 1345. Fourth, the court noted that the Supreme Court “requires that a partyseeking judicial recognition of a new evidentiary privilege under Rule 501 demonstrate ... that theproposed privilege will effectively advance a public good.” Id. The court found that although theprivilege would advance trust and communication between opposing parties, the interest was insufficient.Id. Fifth, the court found that the settlement privilege would be difficult to administer becauseit would “necessarily have numerous exceptions.” Id. at 1345-46.Sixth, the court found that the sanctity of settlement discussions and the public policy supportingsettlements could be effectively managed by a protective order. Id. For example, the courtnoted, the Sixth Circuit and many district courts require a heightened showing before settlementcommunications will be ordered to be produced. Id. at 1347-48. However, the Federal Circuit refusedto describe the appropriate limits on discovery in more detail, and “reserve[d] for another day[that] issue.” Id. at 1347.§ 7.3 Equitable ReliefIn eBay Inc. v. MercExchange, L.L.C., 547 U.S. 388 (2006), the Supreme Court ruled that whendeciding whether to issue an injunction in a patent case, courts must apply the traditional four-partequitable test. Under that test, a patentee seeking an injunction must show:(1) that it has suffered an irreparable injury; (2) that remedies available at law, suchas monetary damages, are inadequate to compensate for that injury; (3) that, consideringthe balance of hardships between the plaintiff and the defendant, a remedyin equity is warranted; and (4) that the public interest would not be disserved by apermanent injunction.Id. The Court in eBay also rejected the district court’s broad classifications that a “plaintiff’s willingnessto license its patents,” and a plaintiff’s “lack of commercial activity in practicing the patents”7-95

Chapter 7 – Developments in the Law of Patent Damages in 2011-2012showed that it would not be irreparably harmed absent an injunction. Id. at 393. The Court instructedthat “traditional equitable principles do not permit such broad classifications.” Id. In addition, theCourt rejected the Federal Circuit’s “general rule ... that a permanent injunction will issue once infringementand validity have been adjudged.” Id. at 393-94. In applying this general rule, the Courtheld that “the Court of Appeals erred in its categorical grant of such relief.” Id. at 394.The eBay decision called for a case-by-case determination, and as a result, the Federal Circuithas been active in the area. The court this year did away with the rule that infringement creates apresumption of irreparable harm, and also did away with injunctions where a patented component ofa product does not create customer demand for the product containing the component. Other decisionsaddressed preliminary injunctions and the award of an ongoing royalty in lieu of an injunction.A. The Presumption of Irreparable Harm No Longer Applies: Robert Bosch,LLC v. Pylon Manuf. Corp., 659 F.3d 1142 (Fed. Cir. 2011)Although the eBay Court rejected the Federal Circuit’s “general rule” that injunctions wouldissue following a finding that a valid patent has been infringed, the Court left open the question ofwhether irreparable harm could be presumed by the infringement of a valid patent. The Federal Circuitanswered this question in Robert Bosch, LLC v. Pylon Manuf. Corp., 659 F.3d 1142 (Fed. Cir.2011) with a clear answer: No. The court stated that “[w]e take this opportunity to put the question torest and confirm that eBay jettisoned the presumption of irreparable harm as it applied to determiningthe appropriateness of injunctive relief.” Id. at 1149.The Federal Circuit continued that the fact of patent infringement can weigh toward irreparableharm, however, and noted that its holding “does not swing the pendulum in the oppositedirection.” Id. This is because the “fundamental nature of patents as property rights grant[] theowner the right to exclude.” Id. Accordingly, courts should not “entirely ignore” this right and thus,“[w]hile the patentee’s right to exclude cannot justify an injunction, it should not be ignored either.”Id.The Federal Circuit also endorsed the view in Justice Roberts’ concurrence in eBay thatcase precedent should be given due weight. Id. at 1150. In particular, precedent granting injunctionsshould be followed “in traditional cases ... where the patentee and adjudged infringer both practicethe patented technology.” Id.In the Bosch case, the district court denied an injunction because it found that there weremore than two competitors in the market, and further, because the patentee’s products covered bythe patent-in-suit were not a core part of its business. Id. at 1146. On appeal, the Federal Circuitreversed, finding that the district court committed two errors of law.7-96

the IP Book 2012First, the district court erred in finding that the presence of additional competitors cutsagainst irreparable harm. Id. at 1151. Rather, irreparable harm is not inconsistent with “picking offone infringer at a time.” Id. (quoting Pfizer, Inc. v. Teva Pharms. USA, Inc., 429 F.3d 1364, 1381(Fed. Cir. 2005)). A contrary rule, the court explained, would allow a later infringer to point to thepresence of a now-licensed first infringer when opposing an injunction. Id. As a result, the courtexplained, while the presence of a two-supplier market “may well serve as a substantial ground forgranting an injunction,” the presence of additional competitors does not, absent additional facts,weigh against a finding of irreparable harm. Id. As applied to the facts in the Bosch case, the evidenceshowed that the instant case was the third of four patent infringement actions in which thepatentee pursued infringers. Id. Consequently, the presence of additional competitors in the marketdid not weigh against a finding of irreparable harm. Id.Second, the district court erred in considering that the portion of the patentee’s business thatrelated to the patent was a “non-core” part of its overall business. Id. at 1152. The court held that“[i]njuries that affect a ‘non-core’ aspect of the patentee’s business are equally capable of being irreparableas ones that affect more significant operations.” Id. Allowing consideration of the non-coreaspect of the patentee’s business in this context incentivizes a company to subdivide its operationsinto individual subsidiaries. Id. “No one could seriously contend,” the court explained, “that the irreparabilityof any particular injury should turn on incidental details such as a patentee’s corporatestructure.” Id. Nevertheless, the fact that a patentee’s product is a core part of the patentee’s businesscan weigh in favor of granting an injunction; however, the fact that a product is not a core part doesnot weigh against granting an injunction. Id.In part because of those errors of law, the district court erred in finding that the patenteewould not be irreparably harmed. Id. The court found that the patentee and the defendant competedin all of the relevant markets. Id. at 1152-53. More particularly, Bosch and Pylon had approached andcompeted for business from Wal-Mart. Id. at 1153. Bosch secured the contract, but failed to makea timely delivery, and afterward, Wal-Mart gave the business to Pylon instead. Id. Wal‐Mart alsorefused Bosch’s later attempts to regain the business. Id.Pylon argued that Bosch had failed to prove that the loss of the Wal-Mart business wascaused by Pylon and not by other market competitors. Id. at 1154. The court relied on the shiftingburdens of proof in rejecting Pylon’s argument. Id. It held that “[w]hile the party seeking an injunctionbears the burden of showing lost market share, this showing need not be made with directevidence. Here, Bosch made a prima facia showing of lost market share, and Pylon proffered no evidenceto rebut that showing.” Id. at 1154. Similarly, Pylon failed to rebut Bosch’s testimony of priceerosion and Pylon’s ability to pay damages, both of which weighed towards irreparable harm. Id.The court then turned to the other factors, finding first that Pylon’s likely inability to paypast damages showed that money damages would be an inadequate substitute for an injunction. Id.7-97

Chapter 7 – Developments in the Law of Patent Damages in 2011-2012at 1155-56. As for the balance of hardships, the fact that Pylon was much smaller than Bosch had noeffect, because “[a] party cannot escape an injunction simply because it is smaller than the patenteeor because its primary product is an infringing one.” Id. at 1156. Moreover, “requiring Bosch tocompete against its own patented invention ... places a substantial hardship on Bosch.” Id. As for thefinal factor, the public interest, the court found that Bosch’s right to exclude competitors balancedequally with Pylon’s right to compete. Id.A majority of the panel, Judges O’Malley and Reyna, ordered that the case should not beremanded and that the injunction issue. Id. at 1157. Judge Bryson however, dissented in part. Id. Heagreed with the majority as to the abrogation of the presumption of irreparable harm and the districtcourt’s errors, but took issue with the remand order. Id. at 1157. Judge Bryson found that there weredisputed issues of fact as to the nature of the competition between Bosch and Pylon, and whetherBosch had suffered harm in marketplace due to Pylon, and that these issues required additionaldevelopment of the record. Id. at 1157-58. Judge Bryson also contended that absent a remand, therelative size of the parties would not be given appropriate weight. Id. at 1159.B. An Injunction Over a Product Will Be Granted Only Upon a ShowingThat the Patented Feature of the Product Is the Basis for Customer Demand:Apple, Inc. v. Samsung Electronics, Co., 678 F.3d 1314, 2012WL 1662048 (Fed. Cir. 2012)Apple sued Samsung for infringement of three design patents and one utility patent thatcovered smartphone and tablet computer technology. Id. at *1-2. Apple moved for a preliminary injunctionseeking to block the accused Samsung devices from being imported into the United States.Id. at *2. The district court denied the motion, finding that Apple failed to show it was reasonablylikely to succeed on the merits for two design patent infringement claims, and failed to show it wouldbe irreparably harmed absent an injunction. Id.Apple made two primary arguments regarding irreparable harm to the district court. Applefirst argued that the infringement of its design patent would erode the distinctiveness of Apple’ssmartphone design, resulting in a loss of goodwill. Id. at *3. The district court rejected this argumenton the grounds that Apple had failed to show that brand dilution was likely to occur. Id. Apple alsoargued that it competed with Samsung for first-time smartphone purchasers, and that the initial purchasedecision would have long-term effects on the consumer’s choice of product due to consumers’reluctance to switch networks or smartphones. Id. at *4.The district court accepted this theory, but nonetheless concluded that Apple failed to connectSamsung’s infringing conduct to Apple’s loss of market share and loss of goodwill. Id. The districtcourt also looked to Apple’s failure to enforce its patents against two other allegedly infringingphones, and Apple’s alleged four-year delay in filing its suit against Samsung. Id. In addition to the7-98

the IP Book 2012injunction issues, on appeal the Federal Circuit also addressed validity arguments as to two of thedesign patents.As for the injunction, the Federal Circuit addressed the “nexus” requirement that the districtcourt placed on the irreparable harm analysis, holding that “the district court was correct to requirea causal nexus between Samsung’s infringement and the alleged harm to Apple.” Id. at *7. This isbecause, the court explained, “[s]ales lost to an infringing product cannot irreparably harm a patenteeif consumers buy that product for reasons other than the patented feature. If the patented feature doesnot drive the demand for the product, sales would be lost even if the offending feature were absentfrom the accused product.” Id. The court distinguished the case of i4i Limited Partnership v. MicrosoftCorp., 598 F.3d 831 (Fed. Cir. 2010) because in that case, although the defendant’s infringingadd-on feature to the Microsoft Word product was not the basis for customer demand for MicrosoftWord, the market for the plaintiff’s add-on product would have been eradicated absent an injunction.Apple, 2012 WL 1662048, at *8. In Apple’s case, however, the market effects of continued infringementon Apple would be much less severe. Id.The Federal Circuit also found that Apple failed to show that any brand or design distinctivenessdilution was likely to occur. Id. As for the delay analysis, the Federal Circuit “decline[d]Apple’s invitation to reject the district court’s delay analysis altogether,” and rather found that itsconclusions as to nexus and delay together demonstrated that Apple was unlikely to be irreparablyharmed absent an injunction. Id. at *9.The majority remanded the case to the district court for a determination of whether to issuea permanent injunction for infringement of the one design patent for which the Federal Circuitreversed the district court’s finding of invalidity. Id. at *13. Judge O’Malley dissented on this point,and argued that a remand would unnecessarily delay injunctive relief, and that the panel’s decisiondemonstrated that all of the requirements for a preliminary injunction had been met. Id. at *14.C. A Preliminary Injunction Is Possible with a Strong Case of Infringementand Validity, and Evidence of Irreparable Harm: Celsis In Vitro, Inc. v.CellzDirect, Inc., 664 F.3d 922 (Fed. Cir. 2012)Celsis owned a patent covering a method of preparing multi-cryopreserved liver cells. Id.at 924. Celsis sued CellzDirect, and its successor companies (called collectively here, as in the case,LTC), and moved for a preliminary injunction. Id. at 924-25. The district court found, and the FederalCircuit affirmed, that Celsis was likely to show that the patent-in-suit was valid and infringed.Id. at 926-29.As for irreparable harm, the Federal Circuit found that LTC’s infringement was likely tocause irreparable harm based on Celsis’ unrebutted evidence that Celsis and LTC were competitors,7-99

Chapter 7 – Developments in the Law of Patent Damages in 2011-2012that LTC significantly discounted prices for its competing products, and that Celsis was required todrop the price for its products (which it generally did not discount) in order to compete with LTC.Id. at 930. Furthermore, Celsis’ products were nearing the end of a growth phase, and at the end ofthe growth phase, Celsis’ products would lead the market and have the largest revenues. Id. Celsisalso showed that LTC’s infringement would cause irreparable harm because customers bought productsin bulk and at irregular times. Id. Celsis’ expert also testified that the infringement would harmgoodwill and reputation. Id. at 930-31.As for the balance of hardships, the Federal Circuit found that the effects on Celsis of losingthe value of its patent and suffering irreparable harm would outweigh the loss of goodwill and reputationto LTC. Id. Lastly, the public interest favored an injunction, because the strong enforcementof patent rights supports investment and drug and development research. Id. at 931-32. Furthermore,Celsis could meet any consumer demand for LTC’s enjoined products. Id.D. Ongoing Royalty in the Absence of an Injunction: Bard PeripheralVascular, Inc. v. W.L. Gore & Assocs. Inc., 670 F.3d 1171 (Fed. Cir. 2012)An Arizona jury found that W.L. Gore infringed Bard’s patent, and awarded Bard approximately$102 million in lost profits and $83.5 million in reasonable royalty damages, which wereenhanced by the court to a total of $371 million for Gore’s willful infringement. Id. at 1191. Onappeal, the Federal Circuit affirmed the willfulness finding (a decision which was later vacated onpanel rehearing), see Bard Peripheral Vascular, Inc. v. W.L. Gore & Assocs., Inc., 682 F.3d 1003(Fed. Cir. 2012), discussed supra.The Federal Circuit also addressed the district court’s denial of Bard’s motion for a permanentinjunction. Bard, 670 F.3d at 1192-93. Rather than issue an injunction, the district court grantedBard an ongoing royalty from a compulsory license. Id. The district court set 12, 15, and 20-percentroyalty rates for three distinct types of Gore products. Id. The district court reasoned that 12.5 and15 percent were appropriate rates for stent grafts, while 20 percent was appropriate for surgicalgrafts because Bard competed with Gore for surgical grafts, and Bard would be entitled to a largerroyalty for those products. Id. The district court also concluded that the ongoing royalty rate shouldbe higher than the 10-percent reasonable royalty rate found by the jury because the ongoing royaltyrate reflected the fact that Gore would be infringing a patent on an ongoing basis absent a compulsorylicense. Id at 1193. The Federal Circuit affirmed the district court’s decision on these ongoingroyalty rates. Id.§ 7.4 Willfulness and Enhanced DamagesIn abrogating the duty of due care in In re Seagate Technology, 497 F.3d 1360 (Fed. Cir. 2007)(en banc), the Federal Circuit adopted a two-part test for willfulness. First, “a patentee must show7-100

the IP Book 2012by clear and convincing evidence that the infringer acted despite an objectively high likelihood thatits actions constituted infringement of a valid patent.” Id. at 1371. Second, and only if the objectiveprong is satisfied, “the patentee must also demonstrate that this objectively-defined risk (determinedby the record developed in the infringement proceeding) was either known or so obvious that itshould have been known to the accused infringer.” Id. The Federal Circuit considered this standardin two cases this year, and provided guidance regarding whether the objective prong is an issue forthe judge or for the jury. In a third case, the court considered the standard for awarding enhanceddamages after a finding of willfulness has been made.A. The Federal Circuit Reviews the Objective Prong of Willfulness: Powellv. Home Depot U.S.A., Inc., 663 F.3d 1221 (Fed. Cir. 2011)Powell brought suit against Home Depot, alleging infringement of a patent related to radialsaw technology. Id. at 1226-28. A jury found that Home Depot willfully infringed the patent-in-suit,and awarded Powell $15 million in damages. Id. at 1228. The district judge enhanced the damagesby $3 million, and also awarded Powell $2.8 million in attorneys’ fees. Id. On appeal, the FederalCircuit affirmed issues of claim construction, infringement, and validity that supported the verdict.Id. at 1229-35.Home Depot also challenged that its infringement had been willful, and the parties“disagree[d] as to whether [the judge or] the jury [wa]s the sole decider of the objective prong ofthe willful infringement inquiry and the type of evidence that may be presented to the jury regardingwillful infringement.” Id. at 1235-36. For instance, Home Depot contended that the jury shouldhave been permitted to consider that the judge denied Powell’s motion for a preliminary injunction,that the question of inequitable conduct was a close question, and also Home Depot’s positions onclaim construction. Id. Powell, on the other hand, contended that Home Depot waived its argumentsregarding the proper types of evidence by not presenting them to the district court. Id.The Federal Circuit held that “[u]nder the objective prong, the answer to whether an accusedinfringer’s reliance on a particular issue or defense is reasonable is a question for the courtwhen the resolution of that particular issue or defense is a matter of law.” Id. at 1236. The subjectiveprong may not be considered by the jury unless the judge first determines that the defendant’s actionsexhibited objective recklessness. Id. at 1236-37.Although that general rule survived subsequent decisions by the Federal Circuit, the divisionof duties between the judge and the jury regarding objective recklessness in Powell wereabrogated in part by the panel rehearing opinion in Bard Peripheral Vascular, Inc. v. W.L. Gore &Assocs., Inc., No. 2012-1510, 682 F.3d 1003 (Fed. Cir. 2012). For instance, in Powell, the court heldthat where the defendant’s defense to willfulness is based on the reasonableness of a factual defense,the issue is properly considered by the jury. 663 F.3d at 1237. In Bard, discussed infra, the court held7-101

Chapter 7 – Developments in the Law of Patent Damages in 2011-2012that the reasonableness of any defense is a question that must ultimately be decided by the judge,because the reasonableness of a defense is a mixed question of law and fact. Bard, slip op. at 4. Furthermore,while in Powell the court held that where the defense depends on both questions of lawand questions of fact, the objective recklessness is properly considered by both the judge and jury,663 F.3d at 1237; in Bard, the court held that the judge is always the ultimate arbiter of objectiverecklessness. Bard, slip op. at 9.In Powell, the Federal Circuit held that Home Depot’s defenses to willfulness were correctlydecided by either the judge or jury, depending on whether the issues turned on issues of law orissues of fact. Powell, 663 F.3d at 1238. Issues of claim construction and inequitable conduct weredecided by the judge, while the defense of non-infringement was decided by the jury. Id. The courtfound that the predicate findings on claim construction and no inequitable conduct supported theconclusion of willfulness, and accordingly, affirmed the finding of willfulness. Id.B. The Objective Inquiry for Willfulness Is Decided by the Judge as a Matterof Law and Is Subject to De Novo Review: Bard Peripheral Vascular, Inc.v. W.L. Gore & Assocs., Inc., 682 F.3d 1003 (Fed. Cir. 2012)An Arizona jury awarded Bard more than $185 million in past damages, which the districtcourt increased by a factor of two based on the jury’s finding of willfulness. On appeal, the FederalCircuit first considered the willfulness verdict in Bard Peripheral Vascular, Inc. v. W.L. Gore & Assocs.,Inc., 670 F.3d 1171 (Fed. Cir. 2011). A panel affirmed the willfulness verdict on the groundthat Gore had been aware of Bard’s patent for a long time, and that Gore’s invalidity defenses werebased on the same art that had been rejected by the PTO during an interference. Id. at 1190. Thepanel noted that “[b]ased on this evidence alone, it would have been reasonable for the jury to findthat Gore [infringed] despite an objectively high likelihood that the [products] infringed the valid‘135 patent.” Id. As discussed below, this conclusion was later vacated on panel rehearing.As for the subjective prong, the court found that Gore’s opinion-of-counsel defense wasdeficient, in part because the opinion’s basis for invalidity was contrary to statements Gore made tothe USPTO while prosecuting another patent. Id. Furthermore, the opinion was not “premised on thebest evidence available because it excluded certain available evidence that was relevant to Gore’sinvalidity defense.” Id. (internal quotations omitted).In response to a petition for en banc rehearing, the court vacated the portion of the 2011opinion relating to the objective prong for willfulness, and issued a modified opinion. Bard PeripheralVascular, Inc. v. W.L. Gore & Assocs., Inc., No. 2010-1510, 682 F.3d 1003 (Fed. Cir. 2012).More particularly, the panel reconsidered whether the objective prong of the Seagate test should bedecided by the jury or the judge. Bard, slip op. at 3-4.7-102

the IP Book 2012The court held that “we conclude that simply stating that willfulness is a question of factoversimplifies the issue. While the ultimate question of willfulness based on an assessment of thesecond prong of Seagate may be a question of fact, Seagate also requires a threshold determinationof objective recklessness.” Id. at 6. As for that determination, “[t]his court ... holds that the objectivedetermination of recklessness, even though predicated on underlying mixed questions of law andfact, is best decided by the judge as a question of law subject to de novo review.” Id. at 6-7.However, a lack of objective recklessness can be predicated on either an underlying questionof law (i.e., claim construction) or a question of fact (i.e., anticipation). Id. at 7. In either case,the court held the ultimate question of whether the defense was reasonable is decided by the judge asa matter of law. Id. More particularly, when the basis for recklessness is founded on a pure questionof law, then recklessness itself is decided solely by the judge. Id. When the basis is founded on aquestion of fact, although the judge may allow the underlying facts regarding the defense to be firstdecided by the jury, the ultimate question of recklessness “should always be decided as a matter oflaw by the judge.” Id. at 9.Because the district court judge did not decide whether Gore had acted in an objectivelyreckless manner, the case was remanded for such a determination. Id. at 10.C. An Opinion-of-Counsel Is Relevant to the Enhancement of Damages forWillfulness: Spectralytics, Inc. v. Cordis Corp., 649 F.3d 1336 (Fed. Cir.2011)In the Spectralytics case, the court awarded the plaintiff enhanced damages following a juryverdict of willfulness. The Federal Circuit vacated the enhancement of damages because the districtcourt mixed the application of the Seagate test for willfulness with the Read factors for enhanceddamages. Spectralytics, 649 F.3d at 1349.In applying the Read factors, the district court found that the defendants did not carefullyinvestigate the patent-in-suit until trial, but added that “the Court discounts this factor in light ofSeagate’s abrogation of the duty of due care.” Id. at 1347-49. The Federal Circuit held that eventhough Seagate removed the presumption of willful infringement from an infringer’s failure to usedue care to avoid infringement, “Seagate did not change the application of the Read factors withrespect to enhancement of damages when willful infringement under § 285 is found.” Id. at 1349.The court also addressed the award of attorneys’ fees. Id. The district court had not separatelyconsidered attorneys’ fees, but rather granted the award in conjunction with its award of enhanceddamages for willfulness. Id. The Federal Circuit noted that while “similar considerations may berelevant to both enhanced damages and attorney fees,” Sections 284 and 285 are not co-extensive.Id. As an example, the court added, attorney or litigation misconduct may give rise to an award of at-7-103

Chapter 7 – Developments in the Law of Patent Damages in 2011-2012torneys’ fees but not enhanced damages. Id. In light of its decision on enhanced damages, the FederalCircuit vacated the award of attorneys’ fees. Id.7-104

theIP bookChapter 8the IP Book 2012Copyright Highlights:Noteworthy Cases 2011-2012Calvin L. LitseyLeita WalkerLauren W. SteinhaeuserDavid MerrittFaegre Baker Daniels LLPMinneapolis§ 8.1 CONSTITUTIONAL ISSUESA. Golan v. Holder, 132 S. Ct. 873 (2012)The Tenth Circuit analyzed the constitutionality of protecting foreign works removed fromthe public domain and protected by the Uruguay Round Agreements Act (URAA). Golan v. Holder,609 F.3d 1076 (10th Cir. 2010). The plaintiffs contended that the URAA violated the First Amendmentbecause it severely restricted the use of foreign works. The Tenth Circuit did not agree, andfound that the URAA was narrowly tailored to accomplish the substantial government interest ofbringing the United States into compliance with international treaties and protecting U.S. copyrightinterests abroad. This year, the U.S. Supreme Court affirmed the Tenth Circuit in a six-to-two decision.Golan, 132 S. Ct. at 894. Justice Ginsburg’s opinion concluded that, “[n]either the Copyrightand Patent Clause nor the First Amendment ... makes the public domain, in any and all cases, a territorythat works may never exit.” Id. at 878. Justice Breyer dissented, joined by Justice Alito, findingthat Congress exceeded its permissible limits when it enacted a statute “that withdraws works fromthe public domain, brings about higher prices and costs, and in doing so seriously restricts dissemi-8-105

Chapter 8 – Copyright Highlightsnation ... all without providing any additional incentive for the production of new material,” andthereby essentially failing “to serve copyright’s traditional public ends.” Id. at 903, 908.PRACTICE TIPThe Supreme Court’s decision may indicate its intention to leave copyrightpolicy to Congress in the future. With the rise of large and activeInternet companies such as Google weighing in on the copyright issuesof the day, including filing an amicus brief in support of the plaintiffs inthis case, it will be interesting to see how copyright protections developin the political realm.B. Sony BMG v. Tenenbaum, 660 F.3d 487 (1st Cir. 2011)In 2010, the District of Massachusetts held that it was contrary to due process to awardexceedingly high statutory damage amounts for illegally downloading and distributing copyrightedmusic. Sony BMG v. Tenenbaum, 721 F. Supp. 2d 85 (D. Mass. 2010). The First Circuit consideredthe issue, however, and found the district court had committed reversible error by bypassing the issueof common law remittitur. Sony BMG, 660 F.3d at 508.In reaching this conclusion, the First Circuit reasoned that “[I]f the district court had orderedremittitur, there would have been a number of possible outcomes that would have eliminated theconstitutional due process issue altogether, or at the very least materially reshaped the issue.” Id. at511. Particularly important was the choice Sony should have had between remittitur and a new trial.Id. Also of note was the First Circuit’s chastisement of the lower court’s assumption that statutorydamages should be considered akin to punitive, rather than to compensatory, damages. Id. at 514.Holding that the court “contravened the rule of constitutional avoidance,” the First Circuit reversedthe award reduction, reinstated the original jury verdict and award, and remanded for considerationof the remittitur issue. Id. at 508-09.§ 8.2 COPYRIGHT LIMITATIONSA. Kelley v. Chicago Park District, 635 F.3d 290 (7th Cir. 2011)In Kelley, the Seventh Circuit made it hard to imagine any circumstance where living organismswould ever be copyrightable. In this case, the court held that because living organisms are notfixed—they grow and change—they are not eligible for copyright protection. Id. at 303.8-106

the IP Book 2012Chapman Kelley is a well-known artist who in 1984 received a permit from Chicago toinstall two elliptical flower beds in a local park. In 2004, the Chicago Park District cut the size of thegarden in half due to maintenance problems stemming from what was a 60,000 square foot garden.Kelley sued the Park District, alleging that it had violated his “right of integrity” under the VisualArtists Rights Act of 1990 (VARA). VARA was passed by Congress as part of the Berne Convention,and it brought with it a limited form of the French copyright law pertaining to the “moral rights ofan artist.” 17 U.S.C. § 106(a).The Seventh Circuit rejected Kelley’s VARA claim on the grounds that for a work to be protectedunder VARA, it must first be copyrightable. The court held that while Kelley’s garden passedthe test for originality, it “lack[ed] the kind of authorship and stable fixation normally required tosupport a copyright.” Kelley, 635 F.3d at 303. Furthermore, “unlike originality, authorship and fixationare explicit constitutional requirements” that must be met for copyright protection. Id. The courtconcluded that “authorship is entirely a human endeavor” and that “works owing their form to theforces of nature cannot be copyrighted.” Id. at 304. So even though Kelley outlined and constructeda beautiful garden that many viewed as “art,” the Seventh Circuit further restricted the possibilitythat copyright will ever protect a living organism.B. Oracle America, Inc. v. Google, Inc., No. 3:10-cv-03561, 2012 WL 1965778(N.D. Cal. May 31, 2012)Shortly after acquiring Sun Microsystems, Oracle America sued Google, accusing it ofinfringing Oracle’s newly-acquired copyrights and patents in the popular programming languageknown as “Java.” The court found Google liable for the incidental copying of nine lines of sourcecode and awarded Oracle nominal damages, but made it clear that if Oracle wanted to protect its ApplicationProgramming Interfaces (APIs), it should have obtained patent protection.Section 102(b) of the Copyright Act states that copyright protection does not extend to “anyidea, procedure, process, system, method of operation, concept, principle, or discovery.” BecauseGoogle wrote its own source code for the copied structure and organization of the APIs, the courtdetermined that it did not infringe upon any copyrightable subject matter. Moreover, the Java programminglanguage required Google to use identical programming to have the program functionin an identical manner. The court held that under the merger doctrine, “when specific instructions,even though previously copyrighted, are the only and essential means of accomplishing a given task,their later use by another will not amount to an infringement.” Id. at *19. Finally, under the namesdoctrine, “names and short phrases are not copyrightable.” Id. at *33. Therefore, Google’s use ofidentical names for its 37 APIs did not infringe.Both Oracle’s “Java” and Google’s “Android” smartphone software platforms includeAPIs, which are sets of pre-written programs containing “packages” or folders that enable the de-8-107

Chapter 8 – Copyright Highlightsvice to carry out different commands. Id. at *2. In this case, Google replicated the exact names andfunctions of 37 of Java’s 166 packages. Id. at *5. Because Google did not copy line-for-line theOracle program, the court addressed whether the “structure, sequence, and organization” of the JavaAPIs—all of which were copied by Google—could be protected by copyright. Id. at *19. In citinga number of long-standing tenets of copyright law, the court held that the “structure, sequence, andorganization” of the APIs was not copyrightable.§ 8.3 FAIR USEA. Cambridge Univ. Press v. Becker, No. 1:08-CV-1425, 2012 WL 1835696(N.D. Ga. May 11, 2012)In Cambridge University Press v. Becker, academic institutions received some guidanceregarding how to use copyrighted works for educational purposes. In this case, the Northern Districtof Georgia applied the fair-use doctrine and found that of the 99 infringement claims asserted, onlyfive survived. Id. at *163.The publishers bringing the case alleged that the defendant academic institution, GeorgiaState University, had infringed their copyrights by allowing unlicensed portions of the plaintiff’scopyrighted books to be posted electronically and made accessible to students. Id. at *1. The defendantsasserted a fair-use defense. Id.In determining if a particular use is “fair use,” section 107 of the Copyright Act providesfour factors that must be considered: (1) the purpose and character of the use, (2) the nature of thecopyrighted work, (3) the amount and substantiality of the portion used in relation to the copyrightedwork as a whole, and (4) the effect of the use upon the potential market for or value of the copyrightedwork. The court in this case found that factors (1) and (2) weighed in favor of the defendants,emphasizing that Georgia State was a nonprofit educational institution using nonfiction informationalor educational excerpts for the purpose of teaching and scholarship. Id. at *40.The bulk of the analysis therefore came down to factors (3) and (4). With regard to factor(3), the court looked at the length and value of the excerpts at issue compared to the length of thebook and the value of a chapter in and of itself. Id. It concluded that if a book is not divided intochapters, or has fewer than 10 chapters, copying more than 10 percent of the pages without payinga licensing fee is not permissible. Id. at *41. If the book has 10 or more chapters, copying more thanone chapter without paying is not permissible. Id. The court also held that this factor would favorthe defendant only where access to the excerpts was limited to students enrolled in the course andto the term of the course, and where the students were prohibited from further distributing copiesof the work. Id. Finally, the court held that the chapter must fulfill a legitimate purpose in the curriculumand be narrowly tailored to accomplish that purpose. Id. With regard to the final factor, the8-108

the IP Book 2012court found that unpaid use of such a small excerpt is permissible where permissions are not readilyavailable at a reasonable price and in a convenient format. Id.The court denied the vast majority of the plaintiff’s infringement claims, either because theplaintiff failed to present a prima facie case of copyright infringement or because of the applicationof the fair-use doctrine. Where the court found infringement, the court gave extra weight to factor(4), tipping the balance in favor of the plaintiff by looking to revenue from book sales and permissionsover the life of the book and finding that permissions were an “important part of the value ofthe copyright.” Id. at *58-59, 66-67, 76-77, 162-63. The court also found infringement where theexcerpt represented “the heart of the work,” thus giving it greater value in relation to the entire book.Id. at *158-59.§ 8.4 FIRST-SALE DOCTRINEA. John Wiley & Sons, Inc. v. Kirtsaeng, 654 F.3d 210 (2d Cir. 2011)In John Wiley & Sons, Inc. v. Kirtsaeng, the Second Circuit held that the first-sale doctrinedoes not apply to works manufactured outside of the United States.The plaintiff published academic and scientific books and journals sold both domesticallyand abroad. Id. at 212-13. Books sold abroad were manufactured by its wholly owned subsidiary inAsia. Id. at 213. The defendant was a student who had moved to the United States to pursue a collegeeducation. Id. To help pay for school, his family shipped him textbooks printed by the plaintiff’sAsian subsidiary, which he would then sell on websites like eBay. Id.The plaintiff sued for copyright infringement based on this allegedly infringing resale of itsbooks. The defendant appealed the district court’s ruling that the first-sale doctrine was not a validdefense.Section 602(a)(1) of the Copyright Act provides that importing copies of a work purchasedoutside of the United States without the authority of the copyright owner constitutes infringementof the owner’s exclusive right to distribution. In comparison, the “first-sale doctrine,” as codifiedin Section 109(a), provides that the owner of a copy of a work “lawfully made under this title,” isentitled to sell that copy without authorization from the copyright owner.In John Wiley, the Second Circuit balanced Section 602’s broad allocation of control tocopyright holders over the importation of their works with Section 109’s limitation on their controlof distribution following the first sale by interpreting “lawfully made under this title” to mean “madein territories in which the Copyright Act is law.” Id. at 217-22. The court reasoned that broad powerover importation is meaningless if any purchaser of any work has the right to resell the work at his8-109

Chapter 8 – Copyright Highlightsor her discretion. Id. at 221. The court therefore limited the application of the first-sale doctrine toworks manufactured in the United States. Id.B. UMG Recordings Inc. v. Augusto, 628 F.3d 1175 (9th Cir. 2011)UMG Recordings, along with the rest of the recording industry, took a hit in this case whenthe Ninth Circuit upset one of the recording industry’s long-standing practices. The court held thatthe first-sale doctrine protected recipients of unsolicited, free promotional CDs who then turnedaround and sold the works.As part of its regular practices, UMG Recordings typically puts together and ships promotionalCDs all over the country to “music critics and radio disc jockeys” on behalf of its artists. Id. at1177. Much like in the book industry, these shipments are unsolicited and there is no prior agreementmade between UMG and the recipient of the promotional disc. However, the CDs generally featurea label that reads:Id. at 1178.This CD is the property of the record company and is licensed to the intendedrecipient for personal use only. Acceptance of this CD shall constitute anagreement to comply with the terms of the license. Resale or transfer of possessionis not allowed and may be punishable under federal and state laws.The defendant in this case, Augusto, was not one of the recipients of the CDs, but he regularlyacquired the promotional discs to sell online where he would advertise them as “rare industryeditions” or “Promo CDs.” Id. UMG in turn sued for copyright infringement.Augusto argued that the “first-sale doctrine” allowed him to re-sell the CDs. The Ninth Circuitagreed. UMG had no prior agreement with its recipients, made no attempt to track the CDs, andoperated on a large scale of distribution. The court held that even though the CDs were given away,based on UMG’s distribution habits, the first-sale doctrine still applied. The court confirmed that nolicense was ever created between UMG and the recipients; rather, UMG was granting ownershiprights. Id. at 1183. Finally, even if the first-sale doctrine did not apply, the court confirmed that thiswas “unordered merchandise” and therefore it conferred on the recipients the “right to retain, use,discard, or dispose of [the CDs] in any manner that [they] see[] fit, without obligation to the sender.”Id. at 1181 (citing the Unordered Merchandise Statute, 39 U.S.C. § 3009).8-110

the IP Book 2012§ 8.5 INJUNCTIVE RELIEFA. Perfect 10 Inc. v. Google, Inc., 653 F.3d 976 (9th Cir. 2011)As part of the continued battle between Perfect 10 and Google, the Ninth Circuit joined theSecond Circuit in holding that, after eBay v. MercExchange, 547 U.S. 388 (2006), a plaintiff in acopyright case does not enjoy a presumption of irreparable harm when seeking preliminary injunctiverelief.Perfect 10 provides a subscription-only website featuring images that fall into the “adultentertainment” category. In the past, Google’s search engine has displayed images that are copyrightedby Perfect 10 but has removed them on a regular basis when complaints are received. Uponremoving images from its search pages, Google forwards the copyrighted information, along withthe original source links, to an organization called chillingeffects.org. Google’s practice of forwardingall removed images from its search engine to chillingeffects.org allows an individual to accessthe links to the copyrighted images from the website if he or she so desires.The district court denied Perfect 10’s motion for a preliminary injunction against Googlebecause Perfect 10 was unable to show it would suffer irreparable harm without the injunction.The Ninth Circuit concluded that the U.S. Supreme Court’s decision in eBay governedthis case. Although eBay was a patent case, the Ninth Circuit held that it required abrogation of the“longstanding presumption ‘that a plaintiff likely to prevail on the merits of a copyright claim isalso likely to suffer irreparable harm if an injunction does not issue,’ because this presumption is‘inconsistent with the principles of equity set forth in eBay.’” Perfect 10, 653 F.3d at 980 (quotingSalinger v. Colting, 607 F.3d 68, 75-79 (2d Cir. 2010)). The Ninth Circuit held that eBay applies incopyright cases and that “the propriety of injunctive relief in cases arising under the Copyright Actmust be evaluated on a case-by-case basis in accord with traditional equitable principles and withoutthe aid of presumptions or a ‘thumb on the scale’ in favor of issuing such relief.” Id. at 980-81 (quotingMonsanto Co. v. Geertson Seed Farms, 130 S. Ct. 2743, 2757 (2010)). Perfect 10’s petition forcertiorari was denied on March 5, 2012.§ 8.6 PREEMPTIONA. Forest Park Pictures v. Universal Television Network, Inc., No. 11-2011-cv, 103 U.S.P.Q.2d 1122 (2d Cir. June 26, 2012)In this case, the plaintiffs developed an idea for a television series and submitted it to thedefendant TV network. Id. at *3. Four years later, the network produced and aired a television showstrikingly similar to that developed by the plaintiffs but without their consent and without compen-8-111

Chapter 8 – Copyright Highlightssation for the idea. Id. at *4. The plaintiffs subsequently sued for breach of an implied contract. Id.at *5.Section 301 of the Copyright Act expressly preempts a state law claim “if (i) the work atissue ‘comes within the subject matter of copyright’ and (ii) the right being asserted is ‘equivalent toany of the exclusive rights within the general scope of copyright’” as required by Section 106. Id. at*6 (quoting 17 U.S.C. § 301(b)). The Second Circuit concluded that the subject matter requirementwas met, because the plaintiffs’ written idea submission was a work of authorship fixed in a tangiblemedium that the defendant allegedly used. Id. at *8-9. But the Second Circuit also concluded that thedefendant failed to prove equivalency.Section 106 grants copyright owners exclusive rights—reproduction, performance, distribution,and display. A state law is equivalent to one of those exclusive rights if the state law couldbe minimized by one of the exclusive rights. Id. at *10. A state law is not equivalent if an “extra element”is needed in addition to the exclusive rights in order to create a state law cause of action. Id.The Second Circuit found that extra elements were required in this case because “there areseveral qualitative differences between [an implied-in-fact] contract claim [requiring the networkto pay plaintiff for the use of its idea] and a copyright violation claim.” Id. at *11. For example, theCopyright Act does not create an express right for the copyright owner to receive payment; for thestate claim, the plaintiff must prove mutual assent and valid consideration, which are not required bythe Copyright Act; and such a claim asserts rights against the contracting party, not the public, unlikecopyright. Id. at *11-12. Because the plaintiffs alleged an enforceable implied-in-fact contract thatincluded a promise of payment for disclosure, the court held that its claim was not preempted by theCopyright Act.With this ruling, the Second Circuit joined the Ninth Circuit in creating an uphill battlefor movie studios and TV networks that regularly face “idea theft” cases and can no longer easilydismiss such claims.§ 8.7 LEGISLATIVE DEVELOPMENTSA. SOPA and PIPAThe Stop Online Piracy Act (SOPA) and the Protect Intellectual Property Act (PIPA) madewaves this year as media companies and online and tech companies clashed over fighting onlinepiracy versus censoring online content. The bills were aimed at foreign websites that provided piratedcopyrighted material, from music and movies to purses and sunglasses. The bills would haverequired websites to remove links to other sites that provided pirated content, spurring concerns inthe online world regarding pressure to comply with unrealistic regulations and the possibility of8-112

the IP Book 2012abuse and censorship. In an unprecedented coordination of online activity, some 75,000 websitestemporarily went dark on January 18, 2012 in protest against the bills.The campaign against the bills was impressively successful. Original supporters withdrewtheir support; the White House spoke out against the legislation as then written. Two days after theblackout, the legislature indefinitely tabled the bills. While this will by no means be the end of thediscussion, the controversy and reaction that SOPA and PIPA provoked could signal a new era inthe development of copyright policy. As the public and private sectors struggle to define legal rightsin the online sphere, the SOPA/PIPA experience has shown the power of major online companiesto not only rally their users, but win against the historically powerful media companies. So whileGolan shifted copyright policy to Congress, SOPA/PIPA indicates that the real power behind policydevelopment, or at least discourse, is actually online.8-113

theIP bookChapter 9the IP Book 2012Recent Developments inTrade Secret Law – 2012Kerry L. BundyRandall E. KahnkeFaegre Baker Daniels LLPMinneapolisIn the past year, courts have addressed several important issues relating to trade secret law.These issues include the reasonable particularity requirement for plaintiffs, misappropriation of socialmedia accounts, extension of U.S. trade secret law abroad, split of authority on the interpretationof the Computer Fraud and Abuse Act, co-existence of patents and trade secrets, and huge damagesawards.§ 9.1 Social Media IssuesIn two recent cases, PhoneDog v. Kravitz, 2011 U.S. Dist. LEXIS 129229 (N.D. Cal. Nov. 8,2011) and Eagle v. Morgan, 2011 U.S. Dist. LEXIS 147247 (E.D. Pa. Dec. 22, 2011), federal courtshave considered claims that social media tools constitute trade secrets.In the Northern District of California, the internet company PhoneDog brought an action againstone of its former employees, Noah Kravitz, which alleged that his continued use of a companyTwitter account constituted a misappropriation of trade secrets. PhoneDog, 2011 U.S. Dist. LEXIS129229, at *1. As part of Kravitz’s employment, he managed content on PhoneDog’s website and theTwitter account. Id. at *2. PhoneDog alleged its company Twitter account contained trade secrets,specifically the compilation of subscribers and the password used to access the account. Id. at *1.9-115

Chapter 9 – Recent Developments in Trade Secret Law – 2012At the time Kravitz ended his employment, PhoneDog requested that he relinquish use of the Twitteraccount. In response, Kravitz changed the account handle to “@noahkravitz,” which redirectedPhoneDog’s 17,000 Twitter followers to his new personal account that Kravitz continued to use. Id.at *3. PhoneDog filed suit against Kravitz asserting a claim of misappropriation of trade secrets,among other claims, and alleged $340,000 in damages. Id.Kravitz filed a motion to dismiss, arguing that the identity of the Twitter followers and thepassword to the account were not trade secrets under the California Uniform Trade Secrets Act(UTSA). Id. at *15-17. Specifically, he argued that the Twitter followers were publicly availableand not secret, and that the password did not derive the requisite actual or potential independenteconomic value to be considered a trade secret under the UTSA. Id. The court nevertheless refrainedfrom engaging in any detailed analysis about whether the information would be considered a tradesecret and did not discuss whether the public nature of Twitter usernames would affect its decision.The court ultimately rejected Kravtiz’s motion to dismiss, and held that PhoneDog “sufficientlydescribed the subject matter of the trade secret with sufficient particularity” to survive the claim. Id.at *4.In a similar case in the Eastern District of Pennsylvania, the court denied (in part) a motion forjudgment on the pleadings related to a former employee’s use of her LinkedIn account after she wasterminated. Eagle, 2011 U.S. Dist. LEXIS 147247, at *52. Dr. Linda Eagle initiated the suit againstEdcomm and claimed that the company hijacked her LinkedIn account after she left the company.Id. at *3-5. Edcomm filed a misappropriation of trade secrets counterclaim under the PennsylvaniaUniform Trade Secrets Act, 12 Pennsylvania Consolidated Statutes § 5301, alleging that Eagle’sLinkedIn account was the company’s proprietary information and was “used for Edcomm businessand Edcomm personnel developed and maintained all connections and much of the content onher account.” Id. at *8. Edcomm argued that Eagle, who regained control of her LinkedIn accountafter initiating her lawsuit, had “wrongfully misappropriated both Edcomm’s connections on theLinkedIn account and Edcomm’s telephone number” which constituted Edcomm’s proprietaryinformation. Id.Eagle argued that because Edcomm’s website disclosed the identity of more than 1,000 clients,Edcomm’s “customer information” could not constitute a trade secret. Id. at *30. In addition, Eagleargued that the identity of Edcomm’s instructors was publicly available on their LinkedIn profiles.Id. The court agreed, stating that Edcomm “has not identified any information that meets both elementsof the definition of ‘trade secret’ under Pennsylvania law: (1) having independent economicvalue to others and (2) being the subject of reasonable efforts to maintain its secrecy.” Id. at *32-33.Absent the identification of a potentially cognizable “trade secret,” the court ruled that the tradesecret claim “must fail.” Id.9-116

the IP Book 2012Surprisingly, despite the court’s skepticism about classifying Eagle’s LinkedIn account as atrade secret, the court was willing to entertain Edcomm’s allegation of Eagle’s misappropriationof the LinkedIn account as “misappropriation of an idea.” Id. at *38. While Eagle argued that Edcommfailed to allege facts that would show that it made a substantial investment of time, effort, andmoney into the LinkedIn account, Edcomm countered that its employees developed the accountsand maintained the connections, which was the method used by Edcomm to contact instructors andspecific personnel within its clients. Id. The court found that the conflicting allegations requiredfurther discovery and denied the motion for judgment on the pleadings as to the misappropriationcounterclaim. Id.At this stage, courts have not provided definitive guidance about whether social media toolsconstitute trade secrets. What these cases do illustrate, however, is the need for clear corporate socialmedia policies. If a company has a Twitter or Facebook or LinkedIn account that an employee maintains,policies should clarify what will happen to that account should the employee leave. Clearlystated policies which address the possibility of account turnover will help protect the social mediaassets the company has developed.PRACTICE TIPTrade Secrets and Social MediaIn the two previous cases, federal courts rejected motions to dismisstrade secret claims related to former employees’ alleged misappropriationof Twitter and LinkedIn accounts. The cases illustrate the need forclear corporate social media policies.§ 9.2 THE “Reasonable Particularity” RequirementIt is not unusual for plaintiffs to file trade secret complaints that include only vague or generalizedallegations about the trade secrets that they allege were misappropriated by a defendant. Suchpleading practices can be attributed to a number of considerations: the complexity of the trade secretinformation at issue, the amount of evidence a plaintiff has about actual misappropriation, thereluctance to place such information in pleadings—even if under seal, or a counsel’s interpretationof liberal pleading requirements. Regardless, when served with generalized pleadings, many defendantsobject, and ask the court to order the plaintiffs to provide more specificity so that everyoneknows with reasonable particularity what trade secret information is at issue. In recent years, courtshave agreed to do so with more regularity. A handful of cases over the past year reinforced thistrend. Courts in Pennsylvania, New York, and Michigan entered orders staying discovery against9-117

Chapter 9 – Recent Developments in Trade Secret Law – 2012the defendant until the plaintiff provided more particularity about what trade secrets were allegedlymisappropriated. See e.g., Hill v. Best Med. Int’l, Inc., 2011 U.S. Dist. LEXIS 123845 (W.D.Pa. Oct. 24, 2011) (precluding BMI from conducting any further discovery before it stated, withreasonable particularity, the trade secrets allegedly misappropriated); see also MSCI Inc. v. Jacob,No. 651451/2011, 2012 N.Y. Misc. LEXIS 1852 (N.Y. Sup. Ct. Apr. 20, 2012) (barring plaintiffsfrom further discovery until they identified, with reasonable particularity, which of the parts of theirsource codes are alleged trade secrets); Dura Global Techs., Inc. v. Magna Donnelly Corp., 2011U.S. Dist. LEXIS 111479 (E.D. Mich. Sept. 29, 2011) (staying discovery of defendant’s trade secretinformation until after plaintiff filed a particularized trade secret list).Dura Global is illustrative of how central a fight over trade secret identification can become inthe course of litigating a trade secret case. In Dura Global, the plaintiff filed suit alleging trade secretmisappropriation, unfair competition, and patent infringement and served discovery. The defendantopposed the discovery request and filed for a protective order, arguing that the plaintiff should firstidentify with particularity the alleged trade secrets at issue before being allowed to proceed withdiscovery. The court granted the motion and stayed discovery of the defendant’s trade secret informationuntil after Dura filed a particularized trade secret list. Dura Global, 2011 U.S. Dist. LEXIS111479, at *6.In January 2008, Dura filed its first list of trade secrets, which the judge found did not describethe trade secrets with reasonable particularity. Id. at *7 (“Plaintiffs must create a list rather than adocument in the style of a brief. The list should omit general references such as control plans, processplans, design reviews, drawings and work instructions and replace them with specific referencesto concrete documents.”) The judge did not dismiss the claims, but rather gave Dura another chanceto set forth with reasonable particularity the trade secrets allegedly misappropriated, warning Dura“that sanctions may hereafter be awarded for failure to list their trade secrets with reasonable particularity.”Id. at *9. Dura filed two more amended lists of trade secrets which the judge continued tofind vague and generalized, and finally allowed Dura to re-file another trade secret list, but only withthree of the six originally pleaded trade secrets.Dura ultimately was able to add new claims of misappropriated trade secrets, however. OnNovember 5, 2009, Dura filed its proposed final pretrial order, which included new claims of misappropriatedtrade secrets. Id. at *21. The defendant brought a motion to strike, but in late 2011, thejudge denied the defendant’s motion. Id. at *32. The court held that since the defendant producedan enormous amount of documents around the close of discovery (discovery which Dura arguedincluded strong evidence of misappropriation), in order to avoid any prejudice to Dura, the courtwould allow the addition of the new trade secret claims, and a limited amount of discovery relatedto the new claims.9-118

the IP Book 2012PRACTICE TIPReasonable Particularity RequirementCourts are continuing to require plaintiffs to allege their trade secretswith “reasonable particularity” before allowing plaintiffs to continue withdiscovery.§ 9.3 U.S. Trade Secret Law Extending to Foreign CountriesThe Federal Circuit recently affirmed a decision of the United States Trade Commission barringimportation of a product made in China because it misappropriated a United States company’s tradesecrets. TianRui Group Co. v. ITC, 661 F.3d 1322 (Fed. Cir. 2011). The court first held that federalcommon law applied in order to determine what constituted a misappropriation of trade secrets sufficientto establish an “unfair method of competition” under Section 337 of the Tariff Act. Id. Thecourt then went on to hold that Section 337 applied to imported goods produced through the use ofmisappropriated trade secrets even when the misappropriation happened out of the country. Id.This decision provides a significant domestic remedy for U.S. companies whose manufacturingprocesses were misappropriated overseas. As long as the imported goods compete with the domesticgoods, there is jurisdiction. Id. at 1332, 1337. This means that U.S. companies can now seek expedient,domestic relief from the International Trade Commission (ITC) without seeking relief in expensiveand complex foreign legal systems. This decision also falls in line with the trend toward thefederalization of trade secret law, which is currently governed by state law. It still remains to be seenwhether a unified federal common standard applied in ITC trade secret actions will be applied in amanner consistent with the various state laws, or whether it will help embolden previous lawmakers’attempts to pass federal trade secret legislation.PRACTICE TIPExtension of U.S. Trade Secret Law to Foreign CountriesAnother significant development in trade secret law was the FederalCircuit applying Section 337 of the Tariff Act to bar imported goods producedthrough the use of misappropriated trade secrets even when themisappropriation happened out of the country.9-119

Chapter 9 – Recent Developments in Trade Secret Law – 2012§ 9.4 Computer Fraud and Abuse ActRecently, plaintiffs have been using the Federal Computer Fraud and Abuse Act (CFAA), 18U.S.C. § 1030, to establish federal jurisdiction, thus giving them the ability to litigate their tradesecret claims in federal court. The CFAA prohibits the intentional access of a protected computer“without authorization”; however, there is a growing split about whether “without authorization”applies to insiders who misappropriate the information accessed, or solely to outside hackers andothers who have no permission to use the computer for any purpose. Compare Int’l Airport Ctrs.,L.L.C. v. Citron, 440 F.3d 418, 420-21 (7th Cir. 2006) (interpreting the term “without authorization”broadly to include any time an employee violates their duty of loyalty), with Diamond Power Int’lv. Davidson, 540 F. Supp. 2d 1322, 1343 (N.D. Ga. 2007) (finding “without authorization” appliesonly to entirely unauthorized access of a computer system by an outsider); see also LVRC Holdings,L.L.C. v. Brekka, 581 F.3d 1127 (9th Cir. 2009) (holding that in order for a person to use a computer“without authorization,” the person must not have received permission to use the computer for anypurpose, meaning an employee who accessed the computer with permission did not access a computer“without authorization” regardless of how they used the information).The Ninth Circuit, sitting en banc, recently narrowed the CFAA in a criminal case by affirmingthe dismissal of charges against a man who allegedly stole trade secrets from his prior employer.United States v. Nosal, 676 F.3d 854 (9th Cir. 2012) (en banc). The Ninth Circuit found that theCFAA applies only to hackers and not to employees who violate the company’s private computerusepolicies. Id. Nosal left his employer and then recruited employees who were still working atthe employer to start a competing business. Before leaving their employer, the employees accessedconfidential data they were authorized to access, but passed it along to Nosal in violation of the company’sstrict confidentiality policy. The court remained “unpersuaded by the decisions of [its] sistercircuits that interpret the CFAA broadly to cover violations of corporate computer use restrictions orviolations of a duty of loyalty.” Id. at 862. It upheld the dismissal of the CFAA charges, finding thatthe access was authorized. Id.Although the other circuit courts seem to be interpreting the CFAA broadly, see e.g., UnitedStates v. Rodriguez, 628 F.3d 1258 (11th Cir. 2010); United States v. John, 597 F.3d 263 (5th Cir.2010), the Ninth Circuit continues to follow in the path it blazed with Brekka, 581 F.2d 1127. Thereare a growing number of district courts that have also followed the plain language of the CFAA, byholding that it “targets the unauthorized procurement or alteration of information, not its misuse ormisappropriation.” Nosal, 676 F.3d 854 (citing Shamrock Foods Co. v. Gast, 535 F. Supp. 2d 962,965 (D. Ariz. 2008)); see also Orbit One Commc’ns, Inc. v. Numerex Corp., 692 F. Supp. 2d 373,385 (S.D.N.Y. 2010); Diamond Power Int’l, Inc. v. Davidson, 540 F. Supp. 2d 1322, 1343 (N.D. Ga.2007). This split highlights the importance of computer security policies for companies interested inprotecting any confidential information.9-120

the IP Book 2012PRACTICE TIPComputer Fraud and Abuse ActThe Ninth Circuit interpreted the Computer Fraud and Abuse Act narrowly,further rejecting the broad interpretation by its sister courts. Thisadds to the growing split of authority over the interpretation of “unauthorizedaccess” under the CFAA, which highlights the need for strictelectronic security policies.§ 9.5 Co-Existence of Patents and Trade SecretsAn increasingly common defense in trade secret cases which involve inventions or technologyis that the plaintiff’s prior publicly available patent or patent application discloses the trade secrets,thus waiving any related trade secrets claims. However, a recent case from the United States Courtof Appeals for the Fifth Circuit refused to adopt such a broad rule and requires a district court toexamine the facts of each trade secret case. Tewari De-Ox Sys. Inc. v. Mountain States/Rosen, L.L.C.,637 F.3d 604 (5th Cir. 2011).Tewari and Mountain States/Rosen L.L.C. (MTSR) signed a nondisclosure agreement, afterwhich Tewari demonstrated its product to MTSR. Tewari claimed during this demonstration that herevealed trade secrets which MTSR later misappropriated. Id. at 607. MTSR was granted summaryjudgment by the district court because it found that Tewari’s trade secrets were either disclosed in aprior 2004 patent application or were already known in the industry. Id. at 608.The Fifth Circuit found that any information disclosed in patent applications by the owner is nolonger a trade secret; however, just because each element of the process used was disclosed does notpreclude the finding that the owner of the method has trade secrets, since any unique combinationsof previously disclosed elements could constitute a trade secret. Id. at 610. One of the trade secretsalleged by Tewari was “a tri-gas mixture in combination with the Tewari zero-oxygen process publishedin 2004.” Id. at 613 (emphasis in original). The court focused on the fact that combinationsof prior disclosed processes could constitute trade secrets, as could the knowledge of how to adapt asystem and best practices associated with the use of the technology. This suggests that even thoughone may have a patent, to the extent that the patent holder withholds trade secrets, such as uniquecombinations, the trade secrets can co-exist with patents.9-121

Chapter 9 – Recent Developments in Trade Secret Law – 2012PRACTICE TIPCo-Existence of Patents and Trade SecretsIn the Fifth Circuit case, Tewari, the court held that trade secrets canexist, even where the elements have been exposed in prior patents,because there could be a unique combination that qualifies as a tradesecret. The existence of a patent does not automatically dismiss theclaim of related trade secrets.§ 9.6 Rising Damage Awards in Trade SecretMisappropriation CasesThere are several different types of damages available in trade secret cases and the potential recoverycan be quite large. Not only are juries awarding maximum compensatory damages, but courtsare also awarding exemplary or punitive damages, as well as attorneys’ fees and costs.On January 18, 2011, Mattel and MGA began their second trial in the seven years after theNinth Circuit vacated a jury verdict awarding Mattel $100 million in damages and control of theBratz line. In April of 2011, a jury found Mattel had misappropriated trade secrets for the Bratz dollsand awarded MGA $88.5 million in damages. On August 4, 2011, a California federal court judgereduced the jury award to $85 million due to a duplication error, and then tacked on another $85 millionin exemplary damages because the jury found willful and malicious misappropriation. Mattel,Inc. v. MGA Entm’t, Inc., 801 F. Supp. 2d 950 (C.D. Cal. 2011).In addition to exemplary damages, the court also awarded attorneys’ fees and costs for both thecopyright and trade secret claims for a total damages award close to $310 million. Id. (awardingclose to $2.2 million in reasonable attorneys’ fees and $350,000 in costs for trade secrets claims);Mattel, Inc. v. MGA Entm’t, Inc., No. CV 04-9049, 2011 U.S. Dist. LEXIS 85998, at *11 (C.D. Cal.Aug. 4, 2011) (awarding over $105 million in attorneys’ fees and almost $32 million in costs forcopyright claims). Mattel is currently appealing the damages in the Ninth Circuit.Similarly, a federal court jury awarded compensatory damages of $26.2 million and exemplarydamages of $68.2 million in a contract and trade secrets suit that accused consulting firm, Accenture,of reneging on a joint marketing deal. Wellogix, Inc. v. Accenture, L.L.P., 823 F. Supp. 2d 555 (S.D.Tex. 2011). However, because Wellogix had requested only $18.2 million in exemplary damages,the district court found that the actual jury award of $68.2 million so exceeded the amount requested9-122

the IP Book 2012that it granted Accenture’s motion for new trial or remittitur, and ordered Wellogix to choose a newtrial or accept a $50 million reduction in the punitive damages award. Id. at 574.In a recent arbitration, a Minnesota arbitrator awarded $525 million to Seagate in its trade secretsuit against Western Digital and one of its workers, a former employee of Seagate, but did not awardpunitive damages or attorneys’ fees and costs. Mao v. Seagate Tech. L.L.C., No. 65 160 00129 07,American Arbitration Association (Nov. 18, 2011) (Schumacher, Arb.), available at .The numbers got even bigger in a trade secret case in Virginia. On September 14, 2011, a federalcourt jury in Virginia awarded DuPont $919.9 million in unjust enrichment damages in its trade secretscase against Kolon, pursuant to Virginia Code Annotated § 59.1-338A, the damages provisionof the Virginia Uniform Trade Secrets Act. The jury also found that Kolon had willfully and maliciouslymisappropriated 149 of DuPont’s trade secrets. The judge upheld the total award of damages,making it one of the largest jury verdicts in a trade secrets case. E.I. DuPont de Nemours & Co. v.Kolon Indus., No. 3:09-cv-58, 2011 U.S. Dist. LEXIS 134821 (E.D. Va. Nov. 22, 2011).PRACTICE TIPPotential DamagesJuries and courts continue to hand down large damages awards, includingawarding punitive damages and attorneys’ fees.9-123

theIP bookChapter 10the IP Book 2012Top Ten TrademarkDecisions of 2011-2012Stephen R. BairdSharon D. ArmstrongWinthrop & WeinstineMinneapolis§ 10.1 IntroductionThis year’s top ten trademark decisions are all over the map. The courts have considered issuesas wide-ranging as jurisdiction via social media, the extraterritorial reach of U.S. injunctions, personalliability for trademark infringement, the protectability of dripping wax, and a variety of others.This chapter includes some of the past year’s trademark cases that received the most press, includinghousehold brand names like Google, Gucci, and Guess. It also covers cases regarding brandsand products that may never pass most consumers’ lips, including purveyors of agricultural seeds,furniture, and banking services.*Special thanks to Martha Engel, associate, and Matthew Robinson, summer associate, at Winthrop & Weinstine,P.A., for their assistance on this article.10-125

Chapter 10 – Top Ten Trademark Decisions of 2011-2012§ 10.2 Case SummariesA. First Nat’l Bank in Sioux Falls v. First Nat’l Bank South Dakota, 679 F.3d763 (8th Cir. 2012)First National Bank South Dakota (FNB South Dakota) and the First National Bank inSioux Falls (FNB Sioux Falls) were engaged in an ongoing dispute about the use of the terms “FirstNational” and “First National Bank in Sioux Falls.” In 1997, the district court permanently enjoinedFNB South Dakota from using the disputed terms or any name “confusingly similar” to them, withina ten-mile radius of Sioux Falls, but did not extend the injunction to FNB South Dakota’s legal name,“First National Bank South Dakota,” in Sioux Falls. This injunction was affirmed.In 2005, FNB South Dakota applied with the state to open a branch office at a different locationin Sioux Falls, just two blocks from the main office of FNB Sioux Falls. FNB Sioux Falls suedagain, this time under both the Lanham Act and common law trademark infringement.FNB South Dakota appealed the injunction, arguing that the second suit was barred underres judicata, that FNB Sioux Falls’ “confusion log” should not have been admitted into evidence, andthat the evidence was insufficient to support a finding of likelihood of confusion. FNB Sioux Fallscross-appealed for attorneys’ fees and a reversal of the court’s statement that FNB South Dakota affiliates’names “appear” not to infringe.Regarding res judicata, the court of appeals determined that the current action did not involvethe same “cause of action” as the 1997 case since FNB South Dakota applied to open a branchoffice at a different location in 2005, which was closer to FNB Sioux Falls. Because the nucleus ofoperative facts had changed, the action was not barred by res judicata.FNB Sioux Fall’s “confusion log” contained over 1500 entries from FNB Sioux Falls employeesrecording all interactions that suggested confusion. FNB South Dakota contended that thelog itself was inadmissible double hearsay, and the appeals court agreed. The employees were notdeclaring their own state of mind, but rather attempting to document a third party’s state of mind.The log also did not qualify as a present-sense impression because the entries were logged after theincidents occurred. Accordingly, the district court erred in admitting the “confusion log” into evidence.Nonetheless, the appeals court determined that this was harmless error because, while the logitself was inadmissible, trial testimony by the employees about confusion they had witnessed wasnot hearsay.The court of appeals determined that the evidence presented to the district court was sufficientto support a finding of likelihood of confusion. FNB South Dakota alleged that the districtcourt never made a factual finding that its full legal name created actual confusion with FNB Sioux10-126

the IP Book 2012Falls’ marks, but the court of appeals noted that actual confusion does not need to be shown in orderto prevail. The district court sufficiently concluded that the “South Dakota” in FNB South Dakota’slegal name was insufficient to differentiate the banks within FNB Sioux Falls’ territory. FNB SouthDakota also argued that the employee testimony was not confusion by consumers, but rather byvendors, delivery people and careless (rather than confused) consumers. The court of appeals observed,however, that confusion of non-purchasers is also relevant, and even if testimony regardingnon-purchasers was removed, ample evidence of customer confusion remained. Finally, FNB SouthDakota argued that the survey evidence presented was not properly conducted because the controlwas improper and it did not distinguish between the commercial banking market (FNB South Dakota’sprimary business) and the retail banking market (FNB Sioux Falls’ primary business). Thissurvey showed 19 percent of consumers would be confused, although FNB South Dakota’s ownsurvey showed 13 percent of consumers would be confused. The court of appeals concluded that thedistrict court did not clearly err in admitting the survey, and that its finding of a likelihood of confusionwas not clearly erroneous.In analyzing the attorneys’ fees issue, the court of appeals noted that, attorneys’ fees maybe awarded in exceptional cases where a defendant’s unlawful conduct was willful and deliberate. Adistrict court’s award for attorneys’ fees is reviewed for an abuse of discretion. The court of appealsdetermined that the main issue of the litigation was the new actions taken by FNB South Dakotasince 1997, which were not exceptional, and concluded that the district court did not abuse its discretion.Finally, FNB Sioux Falls contended that the district court’s statement that First NationalBank of Omaha and First National of Nebraska would not infringe FNB Sioux Falls’ marks was anerroneous advisory opinion. The court of appeals concluded that the statement in the opinion wasmeant to address the hardship concerns of FNB South Dakota to change its name. Given that it hadother established business names, the court concluded that FNB Sioux Falls could operate under adifferent name and trademark, such as its two other bank names. The district court did not make anyfinding as to whether these names infringed on FNB Sioux Falls and the court of appeals refused tostrike this language.PRACTICE TIPA confusion log may not be admissible itself, but witness testimonyregarding customer confusion may be admissible.10-127

Chapter 10 – Top Ten Trademark Decisions of 2011-2012B. Gucci America, Inc. v. Guess?, Inc., 2012 WL 2304247 (S.D.N.Y. June 18,2012)In this trademark infringement case between two global fashion icons, Gucci sued Guessfor infringement, dilution, and/or counterfeiting of four of its trademarks and one of its trade dresselements on over one thousand stock keeping units (SKUs) in an attempt to “Gucci-fy” Guess’ productline. These marks included the Green–Red–Green Stripe mark (GRG Stripe), the Repeating GGPattern, the Diamond Motif Trade Dress, the Stylized G Design mark (Stylized G), and the ScriptGucci Design mark (Script Gucci). Gucci also sought cancellation of Guess’ Quattro G Pattern Logotrademark on the basis of abandonment.As an initial matter, the court found that Gucci had sold billions of dollars’ worth of merchandisebearing the GRG Stripe, the Repeating GG Pattern, the Diamond Motif Trade Dress, andthe Stylized G mark over decades. Over the course of more than 40 pages, the court painstakinglylaid out its evaluation of the protectability of the marks, the similarity of the parties’ marks, theweight to be given survey and damage expert opinions, and a variety of other evidence and arguments.First, the court found that Gucci had proven that Guess and its licensees had infringed Gucci’strademarks and trade dress under the Lanham Act and New York common law. Specifically,the court found that certain Guess products sold under certain SKUs violated Gucci’s rights in itsRepeating GG Pattern/Diamond Motif Trade Dress, the GRG Stripe, and the Stylized G. However,no Guess-branded products infringed on the Script Gucci trademark.Second, the court found that certain Guess products sold under certain SKUs were likely todilute Gucci’s rights in its Repeating GG Pattern/Diamond Motif Trade Dress, and the GRG Stripe.However, the court stated that use of stripes in any other colors was not likely to cause dilution byblurring. The court also stated that because Guess’ use of the Square G commenced before the markbecame famous, it could not dilute the mark as a matter of law. It also found that Guess’ use of thevisually dissimilar Script Guess mark was not likely to dilute the Script Gucci mark.Third, the court found that Guess had never used the Quattro G Pattern in a square orientation,and the evidence showed that it has no intent to do so. The only use that Guess had made ofthe Quattro G Pattern was in a diamond orientation, which created a distinct commercial impressionfrom its use in a square orientation. Accordingly, the court cancelled the registration. However, thecourt denied Gucci’s counterfeit claim, noting that courts uniformly restrict such claims to those situationswhere entire products have been copied stitch-for-stitch.Finally, the court conducted a lengthy discussion of damages and remedies. The court determinedthat Gucci was not entitled to actual damages in the form of a reasonable royalty, but that10-128

the IP Book 2012Gucci was entitled to an accounting of profits for the defendant’s use of the GRG Stripe and QuattroG Pattern. The court found that Guess had engaged in innocent use of the Square G mark becauseGuess had adopted its mark without actual or constructive knowledge of Gucci’s mark and used itbefore Gucci registered its mark. Accordingly, Gucci was entitled to receive a total damage awardof $4.6 million.PRACTICE TIPEven famous or very well-known brands can step on each others’ toesin the area of trademark.C. Maker’s Mark Distillery, Inc. v. Diageo N. Am., Inc., 679 F.3d 410 (6th Cir.2012)Maker’s Mark Distillery, Inc. (Maker’s Mark) obtained a trademark registration for thedripping wax seal element of its trade dress in 1985. In 1995, Cuervo began to produce and distributeits Reserva de la Familia tequila, which by 2001 was capped with a red dripping wax seal.In 2003, Maker’s Mark brought claims of state and federal trademark infringement and federaltrademark dilution against Cuervo, which counterclaimed for cancellation of Maker’s Mark’sregistration. The district court held that the Maker’s Mark trademark is valid and that Cuervo hadinfringed, and permanently enjoined Cuervo from using a red dripping wax seal but denied Maker’sMark’s claim for damages and held that Cuervo did not dilute the mark.Cuervo appealed the district court ruling arguing that: (1) the district court was incorrectin determining that the red dripping wax seal is not aesthetically functional and therefore invalid;(2) some of the court’s factual findings regarding likelihood of confusion factors were flawed; and(3) the balancing of those factors was improper.Regarding the claim of aesthetic functionality, the Sixth Circuit noted that a trademark registrationmay be invalidated if a non-reputational injury or interference to a competitor’s ability tocompete in the market is created by one party’s exclusive use of their registered aesthetic feature.The court considered two tests widely adopted in the Sixth Circuit for aesthetic functionality: thetest for comparable alternatives and the effective competition test. Both tests seek to determine if theprotection of a specific trade dress element leaves comparable alternatives available for competitorsto utilize. If there are no comparable alternatives available for use by competitors, the protection ofthe trade dress element in question should be invalidated because it unfairly hinders the ability ofcompetitors to compete in the market. In this case, the appellate court agreed that it is not difficult or10-129

Chapter 10 – Top Ten Trademark Decisions of 2011-2012costly for competitors to utilize comparable alternatives and “design around” Maker’s Mark’s registereddripping wax seal and thus determined that the mark is not aesthetically functional.Regarding the claim that the district court’s factual findings regarding certain confusionfactors were flawed, Cuervo appealed the findings regarding the wax seal’s strength, similarity toCuervo’s wax seal, and actual confusion.First, considering the mark’s strength, the appellate court was not persuaded by Cuervo’sarguments that the district court erred by: (1) disregarding third-party use of red dripping wax seals,(2) failing to give weight to the lack of survey evidence regarding the mark’s recognition, (3) relyingtoo heavily on Maker’s Mark advertisements without evidence of the advertisement’s circulationdata, and (4) relying on too broad of a prospective purchaser base. The Sixth Circuit agreed with thedistrict court that the Maker’s Mark red dripping wax seal is “an extremely strong mark due to itsunique design and the company’s singular marketing efforts.”Second, considering the similarity of the marks, the appellate court was not persuaded byCuervo’s argument that the presence of “house marks” on each party’s product is significant. It notedthat, in the distilled spirits industry, many companies produce multiple types of spirits and that mostcustomers are unaware of affiliations between various companies or brands. Thus, the presence of ahouse mark does not automatically mitigate confusion.Third, considering actual confusion, the Sixth Circuit was not persuaded by Cuervo’s argumentthat the district court erred in assigning neutral weight to the fact that neither party producedsubstantial evidence related to actual confusion. Because Cuervo sold their Reserva bottle for such alimited period of time and in limited quantities, the lack of evidence of actual confusion was reasonableand insignificant.Ultimately, the court of appeals balanced the likelihood of confusion factors, applying itsown analysis to the three factors discussed above and adopting the findings of fact from the districtcourt for the remaining unchallenged factors. In doing so, the Sixth Circuit excluded the neutral factorsand found that the majority of remaining factors (strength, relatedness of the goods, similarity,and marketing channels) weighed in favor of Maker’s Mark and supported a finding that the likelihoodof confusion between the products is strong and that Cuervo infringed on the Maker’s Marktrademark.10-130

the IP Book 2012PRACTICE TIPThe fact that a trade dress feature has some utilitarian value does notmean that it is a functional feature.D. Nike, Inc. v. Already, L.L.C., 663 F.3d 89 (2d Cir. 2011)In 2009, Nike, Inc. filed a complaint against Already, LLC d/b/a Yums (Yums) assertingclaims of trademark infringement, false designation of origin, unfair competition, and trademarkdilution regarding two athletic shoe designs and related trademark registrations for configurations.Yums counterclaimed for declaratory judgment and cancellation of Nike’s trademark registrationin question. In March 2010, Nike delivered a covenant not to sue to Yums and, shortly thereafter,moved to dismiss its claims and Yums’ counterclaims on the grounds that the covenant removed thecourt’s subject matter jurisdiction. The court agreed.Yums appealed, arguing that the district court dismissed its counterclaims over Yums’ objectionsand not in keeping with Federal Rule of Civil Procedure 41(a)(2) which provides that an action“may be dismissed over the defendant’s objection only if the counterclaim can remain pendingfor independent adjudication.” However, the Second Circuit stated that when a separate event, in thiscase the covenant not to sue, independently deprives the court of an Article III case or controversy,Rule 41(a)(2) is irrelevant. The appellate court concluded that Nike’s covenant not to sue, independentof Nike’s voluntary dismissal of their claims, divested the district court of subject matter jurisdictionand consequently necessitated the court’s dismissal of Yums’ counterclaims.Yums also argued that, regardless of the dismissal of Nike’s underlying action, its counterclaimunder the Declaratory Judgment Act was independently sufficient to vest federal subject matterjurisdiction upon the court. The Second Circuit disagreed, stating that the Declaratory JudgmentAct does not expand the subject matter jurisdiction of the federal courts and that a valid covenant notto sue can deprive the court of an Article III case or controversy, thus eliminating the federal subjectmatter jurisdiction.In addressing whether Nike’s covenant eliminated the case or controversy at issue in thedeclaratory judgment counterclaim, the appellate court applied the totality of the circumstances testfrom MedImmune, Inc. v. Genentech, Inc., 549 U.S. 118 (2007) and considered (1) the languageof the covenant; (2) whether the covenant covered past, present, and future activity and products;and (3) any intentions of Yums to develop new potentially infringing products not covered by thecovenant.10-131

Chapter 10 – Top Ten Trademark Decisions of 2011-2012The court of appeals noted that Nike’s covenant not to sue was sufficiently broad, coveringpast, present, and future activity and products, and was unconditional and permanent. The comprehensivescope of the Nike covenant rendered the threat of litigation between the parties “remote ornonexistent” even if Yums expanded its production dramatically. Thus, no justiciable case or controversyexisted sufficient to confer subject matter jurisdiction upon the court.Finally, Yums contended that its counterclaim for the cancellation of the Nike mark underthe Lanham Act created an independent basis for federal subject matter jurisdiction regardless ofthe dismissal of Nike’s underlying trademark infringement claim. However, a court is authorized tocancel a mark only “in any action involving a registered mark.” The Second Circuit reasoned thatthe language of the Act clearly authorizes a court to cancel a registered mark only in connectionwith a separate jurisdictionally supportable claim involving a registered trademark and noted thatcancellation of a trademark under the Lanham Act is in essence a remedy for trademark infringementrather than an independent basis for jurisdiction. Because the covenant not to sue had resolved theunderlying trademark infringement claims, cancellation of the mark under the Lanham Act was nota sufficient basis to independently confer federal jurisdiction.PRACTICE TIPA unilateral covenant not to sue may short circuit an opponent’s counterclaims.E. Richards v. Burgett, No. 10-C-7580 (N.D. Ill. Dec. 12, 2011)In 2000, defendant Burgett offered to sell its rights in its STECK family of trademarks, usedin connection with pianos, to the plaintiff. The plaintiff and Burgett’s negotiations regarding themarks continued through 2001, at which time the plaintiff gave Burgett a check for $33,500, whichBurgett cashed, as a first installment payment prior to an agreement. At the same time, the plaintiffand Burgett also had been negotiating an agreement under which the plaintiff would buy Burgett’sSOHMER trademark. After the plaintiff ended these negotiations, he filed his own intent to use applicationfor the SOHMER mark.In February 2002, Burgett signed the assignment for the STECK marks and had it notarized.At that time, Burgett notified the plaintiff that if he did not withdraw his SOHMER trademark application,Burgett would not send him the STECK assignments. The plaintiff did not withdraw hisapplication for the SOHMER mark. Burgett did not send the STECK assignment documents to theplaintiff, and the plaintiff never signed the STECK sales agreement. Burgett destroyed the original10-132

the IP Book 2012documents in 2002. Burgett never returned the $33,500 to the plaintiff, and the plaintiff did notmake any additional payments to Burgett for the STECK marks. The plaintiff later stated in a sworndeclaration that when he refused to abandon his application for the SOHMER mark in 2002, hisnegotiations with Burgett relating to the STECK marks “ceased, without any agreement ever havingbeen executed.”In 2002 or 2003, Burgett licensed use of the STECK marks to the defendants ASC andWelkin, which began advertising and selling pianos bearing the STECK marks in the United Statesin 2003. In September 2010, during discovery in litigation regarding the SOHMER mark, the plaintiffreceived copies of the STECK assignment documents that the defendant signed in 2002. Theplaintiff argued that these documents constituted assignment of the marks eight years earlier, andpromptly recorded the assignment for the STECK marks with the USPTO, after which he filed suit.In analyzing the issue of whether the assignment was completed and valid, the court turnedto Illinois general principles of contract law to determine that Burgett did not assign the marks to theplaintiff. First, the sales agreement, of which the assignment was a part, provided that it was effectiveas of the date it was signed by the parties. As the plaintiff never signed the agreement, it neverbecame effective. The mere fact that these documents were signed internally at Burgett in contemplationthat the transaction would be completed in the future was not evidence that the deal was infact done. Second, Burgett conditioned the sale of the STECK marks on the plaintiff’s withdrawalof his application for the SOHMER mark, a condition that the plaintiff did not fulfill. While Burgettretained the plaintiff’s first installment payment, it was also true that the plaintiff never made theremaining payments for the marks. Third, the plaintiff understood for years that no agreement hadbeen reached, which the court found to support Burgett’s lack of intention to complete the assignment.Finally, while the Lanham Act provides that recording a trademark assignment is prima facieevidence of the execution of the assignment, prima facie evidence of execution is not the same asconclusive evidence of the validity of an assignment. The existence of a recorded assignment doesnot preclude a party from establishing its ownership of the mark in federal court.The court concluded that Burgett did not assign the STECK marks to the plaintiff. Since theplaintiff had no rights in those trademarks, his trademark and other claims failed.PRACTICE TIPRecording a trademark assignment does not constitute conclusive evidenceof the execution and validity of the assignment.10-133

Chapter 10 – Top Ten Trademark Decisions of 2011-2012F. Rosetta Stone Ltd. v. Google, Inc., 676 F.3d 144 (4th Cir. 2012)Rosetta Stone, an industry leader in language-learning products and online services, hadan ongoing dispute with Google over use of Rosetta Stone’s marks in keyword advertising used onGoogle. Rosetta Stone contended that third-party usage of its trademarks in keyword advertisingconfused and misled Internet users into purchasing counterfeit Rosetta Stone software. The districtcourt granted Google’s motion to dismiss Rosetta Stone’s claim for direct trademark infringement,contributory infringement, vicarious trademark infringement, and trademark dilution. Rosetta Stoneappealed.On the direct trademark infringement claim, the district court only addressed three of thenine factors relevant to a likelihood of confusion inquiry—intent, actual confusion, and the sophisticationof the consuming public. The Fourth Circuit found that the district court’s failure to address allnine factors was not reversible error, as these factors aren’t intended to be exhaustive or mandatory.The court of appeals agreed that, particularly in a nominative use such as that in keyword advertising,many of the nine factors are not relevant, but noted that the district court should have provideda brief explanation of why it found a particular factor unnecessary to address.The court of appeals reversed the district court’s grant of summary judgment for Google onthe direct trademark infringement claim based on the three disputed factors. With respect to intent,Google expected increased revenue after it relaxed its trademark usage policy in 2009. The court ofappeals concluded “that a reasonable trier of fact could find that Google intended to cause confusionin that it acted with the knowledge that confusion was very likely to result from its use of the mark.”Regarding actual confusion, the district court concluded that none of the witnesses were confusedabout the source of the purchase but only as to whether what they purchased was genuine or counterfeit.But, an infringement occurs if it is likely to confuse the relevant consumer as to affiliation, connectionor sponsorship. The district court found that since the sponsored link conformed to Google’spolicies, there was no confusion. The court of appeals rejected this as irrelevant. The district courtalso considered in-house studies conducted by Google to analyze actual confusion as irrelevantbecause they were not specific to ROSETTA STONE. The Fourth Circuit disagreed and found thatthese studies were probative as to actual confusion. Finally, on “sophistication of the consumingpublic,” the district court found that consumers willing to pay Rosetta Stone’s prices would be ableto distinguish between the sponsored links and organic results. While a determination of consumersophistication based on the price of a product is acceptable, this determination would be applicableonly after a bench trial. The court of appeals determined that there was sufficient evidence in therecord to create a question of fact and thus summary judgment was inappropriate.The Fourth Circuit also reversed the district court’s holding that the use of marks as keywordswhen entered into Google’s AdWords program is protected under the “functionality doctrine,”which preserves the distinction between a trademark and the functional features of a product (which10-134

the IP Book 2012are protectable under patent law). However, as the court of appeals noted, ROSETTA STONE is notfunctional to the language-learning products and the functionality doctrine does not apply to GoogleAdWords’ use of trademarked keywords.Regarding contributory infringement, the district court found that while Google allowedthird parties to bid on Rosetta Stone’s trademarks as keywords, Rosetta Stone did not establish thatGoogle knew or should have known of actual infringements based on Tiffany Inc. v. eBay, Inc., 600F.3d 93 (2d Cir. 2010). Tiffany was an appeal from a bench trial, where the district court weighedthe evidence as a trier of fact. The court of appeals therefore concluded that there was sufficient evidenceto establish a question of fact as to whether Google committed contributory infringement andreversed the district court’s grant of summary judgment.The court of appeals affirmed the district court’s grant of summary judgment on vicariousinfringement. While Google jointly controlled the appearance of ads or sponsored links on a searchresults page, there was no evidence to suggest that Google acted jointly with the advertisers to controlcounterfeit Rosetta Stone products.The court of appeals also affirmed the district court’s grant of summary judgment on unjustenrichment for Rosetta Stone’s failure to allege facts that implied that Google promised to pay RosettaStone a portion of the revenue generated from this keyword advertising. Rosetta Stone did notallege any facts supporting its general assertion that Google should have expected to pay RosettaStone to use the marks.Finally, regarding Rosetta Stone’s claim for dilution, the court of appeals reversed the districtcourt’s grant of summary judgment for Google. The district court held that Rosetta Stone didnot present the requisite evidence that Google was using the marks to identify its own goods andservices and did not show that Google’s use of the mark was likely to impair the distinctivenessor harm the reputation of Rosetta Stone’s marks. The court of appeals concluded that 15 U.S.C.§ 1125(c)(3)(A) provides a fair use defense in dilution actions. Thus, Google had the burden toestablish that it used the mark other than as a source identifier, not Rosetta Stone. In considering aclaim for dilution, even if the mark is not being used to identify Google’s own goods and services,the defendant’s use must qualify as a fair use. The district court did not determine whether therewas a fair use and erroneously based its conclusion on the mark not being used to identify Google’sown goods and services. Google’s use of the marks must still be a fair use, and the court of appealsdetermined that the district court erred by not analyzing whether the mark is fair use. In addition, thecourt of appeals found that the district court erred in concluding that Google’s use did not impair orharm the reputation of Rosetta Stone’s marks based on an increase in recognition of Rosetta Stone’smark since Google relaxed its trademark usage policy. The degree of recognition is only one of sixstatutory factors required to show dilution by blurring (15 U.S.C. § 1125(c)(2)(B)), and the courterred by only addressing this factor. The court of appeals also suggested that, on remand, the district10-135

Chapter 10 – Top Ten Trademark Decisions of 2011-2012court should reconsider whether ROSETTA STONE was a famous mark as of 2004, which is theyear Rosetta Stone alleged that Google began diluting the mark.PRACTICE TIPWhere sufficient evidence has been presented creating a genuine issueof fact, summary judgment is inappropriate for a likelihood of confusionanalysis.G. Seed Services, Inc. v. Winsor Grain, Inc., 2012 WL 1232320 (E.D. Cal. Apr.12, 2012)In August 2010, Seed Services, Inc. (Seed Services) contracted with Winsor Grain, Inc.(Winsor) and William Cook (Cook), the owner and president of Winsor, to purchase certain assets,including the U.S. trademark registration for CALIFORNIA GOLD for agricultural seeds. Shortlythereafter, Seed Services filed suit alleging breach of contract and trademark infringement. SeedServices alleged that Cook infringed upon the CALIFORNIA GOLD mark by registering it in Australiaand attempting to make sales to customers in Saudi Arabia. Seed Services sought a preliminaryinjunction against Winsor and Cook prohibiting their use of certain trademarks in connection withthe sale of alfalfa seed in the Middle East.In April 2011, the Cook Land and Cattle., Ltd. (CLAC) registered the CALIFORNIA GOLDmark in Australia. Cook argued that despite being sole owner of CLAC, CLAC was an Australiancompany doing business solely outside the United States and that the court had no jurisdiction overCLAC. The court however, disagreed, and stated that while CLAC was neither a party to the casenor a U.S. company, Cook was responsible for the actions of CLAC. Thus, CLAC was subject to thereach of the court.Cook also argued that because CLAC had not completed any actual sales under the CALI-FORNIA GOLD name, an injunction was improper. However, the court noted that in a trademarkpreliminary injunction action, evidence of imminent infringement is sufficient. Consequently, whileCLAC had not yet completed a sale using the CALIFORNIA GOLD brand, they clearly intended,and were actively attempting, to do so.The court then addressed the four-part preliminary injunction test as applied in trademarkactions: (1) Seed Services’ probability of success on the merits, (2) irreparable harm if the injunctionwere not granted, (3) the balancing of the equities, and (4) the public interest associated with grantinga preliminary injunction. The court found in favor of Seed Services on all four factors.10-136

the IP Book 2012The court then turned to the extraterritorial nature of the injunction sought by Seed Services.To support the extraterritorial reach of an injunction under the Lanham Act, the court stated that theremust be: (1) an effect on American foreign commerce, (2) sufficient injury to Seed Services underthe statute, and (3) sufficiently strong American foreign commerce interests and links in relation tothose of other nations involved.The court held that the first and second factors were easily satisfied because Seed Services’foreign market share in the Middle East seed industry had diminished, potentially causing significantmonetary injury. The third factor, balancing the American foreign commerce interests and links withthose of the other nations involved, was further split into seven areas of consideration. The courtlooked to the: (1) level of conflict with foreign laws, (2) nations involved, (3) likelihood of compliance,(4) potential effects on the United States and elsewhere, (5) intent to harm U.S. foreign commerce,(6) foreseeability of effects, and (7) overall importance within the U.S.The court, in weighing these factors, noted that while the effects, importance, and impact ofthe injunction on the United States and other nations was not clear, no direct conflicts with the lawsof other nations would arise from prohibiting Cook’s use of the CALIFORNIA GOLD mark in theMiddle East. Therefore, the court held that the facts supported barring CLAC’s use of the CALI-FORNIA GOLD mark despite the extraterritorial reach of the order.PRACTICE TIPU.S. injunctions for trademark violations may have extraterritorial reach.H. Universal Furniture Int’l, Inc. v. Frankel, 835 F. Supp. 2d 35 (M.D. N.C.2011)In 2004, in a prior proceeding in the same court, Universal Furniture International, Inc.(UFI) filed claims against Collezione Europa USA, Inc. (Collezione) alleging copyright infringement,violation of the Lanham Act, and violation of North Carolina’s Unfair and Deceptive TradePractices Act. The court concluded that Collezione had violated UFI’s copyright and had passed offUFI’s furniture as its own.In 2008, UFI filed a complaint against Paul Frankel, co-owner of Collezione, asserting thatFrankel was personally liable to UFI directly, contributorily, and vicariously for the acts of Collezioneas found by the court in the 2004 proceeding.10-137

Chapter 10 – Top Ten Trademark Decisions of 2011-2012UFI argued that in its new lawsuit against Frankel, principles of collateral estoppel precludedrelitigation of identical liability issues, thus, “all findings of fact, conclusions of law, and otherrulings” made by the court in the 2004 proceeding should be incorporated in the proceeding againstFrankel. It then asserted that Frankel was personally liable for the actions of Collezione found by thecourt in the 2004 proceeding. Both parties filed motions for summary judgment.In addressing UFI’s collateral estoppel agrument, the court applied the collateral estoppelfactors, delineated in In re Microsoft Corp. Antitrust Litigation, 355 F.3d 322, 326 (4th Cir. 2004),stating that in order to estop relitigation of the issues UFI must demonstrate that: (1) the current issueis identical to the issue previously litigated, (2) the issue was actually resolved in the previouslitigation, (3) the issue was critical and necessary to the previous judgment, (4) that the previousjudgment was final and valid, and (5) that Frankel had a full and fair opportunity to litigate the issuein the previous proceeding.In addition, the court determined that because UFI was attempting to estop Frankel fromlitigating an issue allegedly resolved in the prior proceeding it was deemed “offensive collateralestoppel” and a heightened level of scrutiny was applied. Consequently, in addition to the five factorsdiscussed above, the court also addressed (1) whether Frankel could have been easily joinedas a defendant in the prior proceeding, (2) whether Frankel had an incentive to vigorously defendthe issue in the prior proceeding, (3) whether Frankel had won any other litigation to determine thesame issue, and (4) whether procedural opportunities were not available in the prior proceeding thatwould have been available in the subsequent proceeding. The court found that all of these factorswere met in the prior proceeding. The court held, however, that it could not, as a matter of law, applycollateral estoppel to the issue of damages because in the prior proceeding Frankel’s incentive tovigorously defend on this issue of damages against Collezione was not as strong considering that itwas very likely that Frankel believed the corporate veil stood between the damages awarded againstthe company and his own personal liability for those damages.Next, the court looked to Frankel’s personal liability for the infringing acts of Collezione,as found in the 2004 proceeding and incorporated into the present proceeding. In addressing Frankel’spersonal liability for the Lanham Act violations of Collezione, the court referenced the districtcourt’s 2004 decision stating that in order to establish a violation of the Lanham Act, UFI had toprove “(1) that the furniture at issue originated with Plaintiff; (2) that Defendant falsely designatedthe origin of the furniture; (3) that the false designation of origin was likely to cause consumerconfusion; and (4) that Plaintiff was harmed.” The court reasoned that because factors (1), (3), and(4) were proven in the prior proceeding and did not reference a specific defendant, they were automaticallysatisfied with regard to Frankel. The court determined, however, that in order to proveFrankel’s liability and satisfy factor (2), UFI had to show that Frankel personally played a legallycognizable role in falsely designating the origin of the furniture.10-138

the IP Book 2012The court then looked to Frankel’s role within Collezione and noted that he was the vicepresident, chief operating officer, secretary, treasurer, director, and part owner of Collezione. It alsolooked at Frankel’s day-to-day operations within Collezione in which he was overseeing order fulfillment,the flow of products, invoicing, customer communications, and overall decision making.The court determined that Frankel knew, or had reason to know, of Collezione’s false designationof origin of its furniture in question and nevertheless continued to meaningfully participate in itsdistribution. Consequently, the court held that, as a matter of law, Frankel was personally liable forCollezione’s false designation of origin in violation of the Lanham Act.PRACTICE TIPIndividuals may be held personally liable for the infringing acts of theirorganizations.I. The University of Alabama Board of Trustees v. New Life Art, Inc., 103U.S.P.Q.2d 1070 (11th Cir. 2012)Daniel A. Moore painted football scenes for his alma mater, the University of Alabama,since 1979. These paintings accurately depicted the trademark uniforms of the “Crimson Tide.” Between1979 and 1990, Moore created these paintings without any relationship with the University,and the University was aware of Moore’s works. From 1991 to 1999, Moore entered into a licensingagreement with the University to sell items featuring other trademarks that would come with acertificate or stamp indicating that they were licensed products. Other Crimson Tide paintings andprints created by Moore were not part of these agreements during that time.In 2002, the University decided that Moore needed permission to use the Crimson Tide’suniforms in all of his works. Accordingly, Alabama sued Moore for breach of contract, trademarkinfringement and unfair competition. The district court granted summary judgment to Moore withrespect to paintings and prints, but granted summary judgment to the University with respect to calendars,mugs and other products.In appealing the district court’s decision, Alabama argued that the language of the licensingagreements prohibited any depiction of their uniforms in Moore’s paintings, arguing that theuniforms and team colors are “licensed indicia.” The term “licensed indicia” was defined broadlyto include “names, symbols, designs and colors of the [University], including without limitation,the trademarks, service marks, designs, team names, nicknames, abbreviations, city/state names inthe appropriate context, slogans, logographics, mascots, seals and other symbols associated with or10-139

Chapter 10 – Top Ten Trademark Decisions of 2011-2012referring to the [University].” The agreement stated that Moore “shall not use the Licensed Indiciafor any purpose other than upon or in connection with” explicitly licensed indicia and all licensedindicia required a ® or the “TM” symbol beside it.The appeals court found that the licensing agreements were ambiguous as to whether theuniforms and team colors are “licensed indicia” and the agreement implied that the parties intendedlicensed indicia to refer to packaging or labels placed upon products (like a mug) rather than as thecontent of a painting, print or calendar image. In addition, the appeals court found that there wasconsiderable “course of dealing” evidence on the part of the University’s relationship with Moorethat supported the conclusion that the University did not intend these paintings to violate the licensingagreements. The appeals court thus rejected the University’s argument.While the appeals court agreed with the district court’s assessment of the relative strengthof the mark and the low degree of likelihood of confusion, the court concluded that Moore’s paintings,prints and calendars did not infringe the University’s trademark rights based on First Amendmentgrounds. While Moore sold his paintings for financial compensation, they were still entitled tofull protection under the First Amendment. The appeals court applied the balancing test of Rogersv. Grimaldi, 875 F.2d 994 (2d Cir. 1989), wherein the Lanham Act “should be construed to apply toartistic works only where the public interest in avoiding consumer confusion outweighs the publicinterest in free expression.” This test is applicable generally to works of artistic expression. Here,the depiction of the uniforms was artistically relevant to the underlying expression needed to memorializea football scene in a painting and Moore never indicated that the unlicensed works wereendorsed or sponsored by the University. Therefore, the appeals court ruled that the paintings, prints,and calendars did not violate the Lanham Act.Regarding the mugs and other “mundane products,” the appeals court found that Mooredid not have an “unfettered right to produce derivative works” featuring his paintings. It found thatMoore’s copyright in his paintings did not convey a right to use, it merely conveyed a right to excludeothers from certain acts.Moore argued that the University had acquiesced to his actions. Acquiescence requiresproof that: (1) the plaintiff actively represented it would not assert a right or claim, (2) the delay betweenthe active representation and assertion of the right or claim is not excusable, and (3) the delaycaused the defendant undue prejudice. “Active consent” only requires conduct on the plaintiff’s partthat amounts to an assurance to the defendant, express or implied, that the plaintiff will not asserthis rights against the defendant. The record related to the parties’ agreement and course of dealingwith respect to the mugs and other “mundane projects” was unclear. The court of appeals thereforereversed the district court’s holding that the licensing agreement applied to these products and remandedto the district court for further findings.10-140

the IP Book 2012PRACTICE TIPProperly defined terms and construction of a licensing agreement arecritical.J. Wine Group LLC v. Levitation Mgmt., LLC, 2011 WL 4738335 (E.D. Cal.Oct. 5, 2011)In 2007, The Wine Group LLC (Wine Group) began producing CUPCAKE-brand wine; in2010 it launched a RED VELVET variety of CUPCAKE wine as well as a CUPCAKE-brand vodka.Later that year, Levitation Management, LLC (Levitation) and Tipton Spirits, L.L.C. d/b/a DesireeVodka Company, L.L.C. (Tipton) launched its own line of vodka called DESIRÉE, which includedboth CUPCAKE and RED VELVET varieties. In June 2011, Wine Group sued Tipton for trademarkinfringement and Tipton moved to dismiss the action for lack of personal jurisdiction pursuant toFederal Rule of Civil Procedure 12(b)(2).In evaluating the issue of personal jurisdiction, the court used the following three-prongtest: (1) whether the non-resident defendant had purposefully directed its activities towards California,(2) whether the claim at issue arose out of the defendant’s activities within California, and(3) whether the court’s exercise of jurisdiction is reasonable.To establish Tipton’s minimum contacts in California, Wine Group focused primarily onTipton’s Internet activity—namely its Facebook page. Wine Group argued that Tipton’s Facebookpromotions constituted promotional activities aimed at California consumers that were sufficient togive rise to jurisdiction—even though Tipton had not sold any vodka in California.Wine Group argued that Tipton’s website invited visitors to “follow them on [its] Facebook[page],” on which Tipton posted its product information, and in which Tipton provided an interactivemedium for users to post messages and for Tipton to respond. Tipton used its Facebook page tosolicit “Brand Ambassador” applications from Facebook users. Wine Group also alleged that twoposts were from California residents and that five of Tipton’s “friends” on Facebook claimed to livein California.The court found that Tipton’s actions in setting up and maintaining an interactive Facebookpage satisfied the first prong of purposeful availment. The court stated that Tipton acted intentionallyin that it “designed and launched their website, registered metatags with Google, created their Facebookpage, and used that to interact with their fans.” The court stated that Tipton knew its actions10-141

Chapter 10 – Top Ten Trademark Decisions of 2011-2012were likely to cause harm suffered in California because it knew that Wine Group’s principal placeof business was in California.The court also stated that Tipton’s actions were expressly aimed at California. Noting that“[t]he invention of the Internet has posed a challenge to traditional jurisdictional analysis and courtshave struggled with the question whether tortious conduct on a nationally accessible website isexpressly aimed at any, or all, of the forums in which the website can be viewed,” the court foundthat, given the interactive and commercial nature of Tipton’s online activities, Tipton had expresslyaimed its activities toward California in order to support jurisdiction. Consequently, the court deniedTipton’s motion to dismiss for lack of personal jurisdiction.PRACTICE TIPThe interactive nature of a Facebook page may be sufficient to establishpersonal jurisdiction—even if the defendant’s goods are not availablefor purchase in the state in question.10-142

theIP bookChapter 11the IP Book 2012The Top Ten Ttab Decisionsof 2011-2012John L. WelchLando & Anastasi, LLPCambridge, MA§ 11.1 IntroductionAfter treading water for a decade or more, dilution-by-blurring made a sudden splash in theTrademark Trial and Appeal Board (TTAB) pool during the past year. The board relaxed its requirementthat a plaintiff show that the marks at issue are identical or substantially similar in order to wina dilution claim, but it tightened its focus on proof that any association between the marks will causea diminution of the distinctiveness of the famous mark. The net result is a continuing uncertaintyover the likelihood of success when a party pursues a dilution claim.The issue of fraud continued to tread water at the TTAB. In fact, not a single fraud claim hasbeen upheld by the board since the CAFC issued its Bose decision in August 2009. In one case, theboard ducked the fraud issue altogether by basing its ruling on the unpleaded ground of nonuse,while in another it refused to find fraud despite a knowingly false and material half-truth made to theUSPTO, because the accused party’s earlier-filed specimen of use had told the whole truth.Although fraud may be in the TTAB doldrums, the issue of bona fide intent, or lack thereof, hassurfaced with increasing frequency. In one decision, the board found a lack of bona fide intent basedin part on the applicant’s history of filing intent-to-use applications for the famous marks of others,but never using the marks. In another, it ruled that an applicant had overcome the lack of documen-11-143

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012tary support for its alleged bona fide intent by showing that the goods involved were consistent withan extension of the applicant’s current product line.Lanham Act Section 2(b) cases are rare indeed, but a pair of TTAB decisions applied this statutorybar in affirming refusals to register the official seals of two municipalities, and an application toregister the top-level domain name (TLD) .MUSIC as a trademark and service mark was torpedoedby a mere descriptiveness refusal.In other rulings of interest, the board clarified the nature of the proof necessary to establish thata mark is primarily geographically deceptively misdescriptive under Section 2(e)(3) of the LanhamAct. In a significant procedural ruling, the board tossed overboard a party’s attempt to obtain sweepinge-discovery. And finally, in a strange case indeed, the TTAB gave the heave-ho to a photographer’sgroundless petition for cancellation of a registration for a service mark comprising goatssituated on the roofs of retail stores and restaurants.§ 11.2 Case SummariesA. Nike, Inc. v. Maher, 100 U.S.P.Q.2d 1018 (T.T.A.B. 2011) [Precedential]The TTAB sustained Nike’s opposition to registration of the mark JUST JESU IT for variousitems of athletic apparel, finding the mark likely to cause confusion with and likely to dilute (byblurring) the famous and registered mark JUST DO IT for overlapping clothing items. Significantly,the board jettisoned its former “substantial similarity” or “near identity” test for dilution, insteadholding that the marks need only be “sufficiently similar in their overall commercial impressions”that the requisite “association” exists for a finding of blurring. 100 U.S.P.Q.2d at 1030.The applicants, appearing pro se, admitted that the JUST DO IT mark is famous for Section2(d) purposes. Of course, this du Pont factor weighed heavily in Nike’s favor; because it is a famousmark, JUST DO IT is entitled to wide latitude of protection, and the degree of similarity between themarks necessary to support a conclusion of likely confusion declines. Moreover, the required degreeof similarity is also lessened because the goods are identical in part.The board found the marks to be similar in overall appearance and pronunciation. But as tomeaning, not so much:[O]pposer has shown that its mark has been viewed as a “battle cry.” Themeaning of applicants’ mark is ambiguous, not just as a three-term phrase witha middle term that evokes “Jesus” (but appears not to be itself an Englishword), but even when that middle term “Jesu” is combined with “it” to formthe word “Jesuit.” Despite this ambiguity in the meaning of applicants’ mark,the overall commercial impression of the parties’ marks is similar because giv-11-144

the IP Book 2012en the fame of opposer’s mark, the public is likely to view applicants’ mark assimilarly being a call to action, even though it is unclear what action is beingurged.Id. at 1022.Nonetheless, the board concluded that, given the fame of opposer’s mark and the similarityof appearance, pronunciation, and overall commercial impressions, the marks are similar for likelihoodof confusion purposes.The applicants argued that their mark is a humorous parody, but the board was not amused:“[W]here, as here, a defendant appropriates a trademarked symbol such as a word or picture, notto parody the product or company symbolized by the trademark, but only as a prominent means topromote, satirize or poke fun at religion or religious themes, this is not ‘parody’ of a trademark.” Id.at 1023.Weighing the relevant du Pont factors, the board found confusion likely.Turning to dilution, the board first looked to the three elements of a claim for dilution-byblurring:(1) whether the opposer’s mark is famous; (2) whether the mark became famous prior to thefirst-use date (here, constructively, the filing date of the application) to register the challenged mark;and (3) whether the applied-for mark is likely to blur the distinctiveness of the opposer’s famousmark.The standard for fame in the dilution context is more stringent than for fame in the Section2(d) likelihood of confusion context. Nonetheless, Nike established the fame of its mark withoverwhelming proofs. Pervasive third-party references and media discussion about JUST DO ITreflected the extreme popularity of the mark. The evidence showed that JUST DO IT has “made itsway into the popular culture at all levels.” Id. at 1024. Several independent studies identified thisslogan as among the most well-known in the country.Nike has spent more than six billion dollars in advertising the JUST DO IT mark duringits 20-year lifespan. Well-known sports figures such as Michael Jordan, Bo Jackson, and LeBronJames have been featured in its advertising. The mark appeared on 900 million shoeboxes in theyears 2005-2010 and Nike has sold more than 27 million units of products that bear the mark JUSTDO IT or include the mark or “JDI” in the style name of the product. Nike owns three incontestableregistrations for the mark, each of which was issued without resort to acquired distinctiveness underSection 2(f) of the Lanham Act.Moreover, Nike proved that its mark, used continuously since 1989, became famous wellbefore the applicant’s earliest available priority date.11-145

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012As to likely blurring, the board looked to the six non-exhaustive factors set forth in Section43(c)(2)(B) of the Lanham Act:(i) The degree of similarity between the mark or trade name and the famousmark; (ii) The degree of inherent or acquired distinctiveness of the famousmark; (iii) The extent to which the owner of the famous mark is engagingin substantially exclusive use of the mark; (iv) The degree of recognition ofthe famous mark; (v) Whether the user of the mark or trade name intended tocreate an association with the famous mark; and (vi) Any actual associationbetween the mark or trade name and the famous mark.Nike’s mark was registered on the principal register as an inherently distinctive mark, andno other uses of the phrase by third parties were proven. Nike established that its mark is “so distinctivethat the public would associate the term with the owner of the famous mark even when itencounters the term apart from the owner’s goods or services.” Id. at 1028, quoting Nasdaq StockMarket Inc. v. Antartica S.r.l., 69 U.S.P.Q.2d 1718, 1735 (T.T.A.B. 2003).As to exclusivity, Nike vigorously enforces its rights in the mark and denies all requests forpermission to use the mark, even in connection with religious activities. Applicant proffered fourthird-party registrations for “JUST ... IT” marks for clothing [JUST JEW IT, JUST BREW IT, JUSTBE IT, and JUST GRAB IT] but the board pooh-poohed that evidence since there was no proof thatthe marks were actually in use, or if so, to what extent. Moreover, the existence of those registrationsdid not persuade the board that “the phrase ‘just ... it’ would be considered a commonly registeredelement such that a mark following this pattern but with a different middle term would thereby berendered, as a whole, distinguishable from opposer’s famous mark.” Id. at 1022.Turning to the degree of similarity between the marks, prior to the Trademark Dilution RevisionAct of 2006 (TDRA), the TTAB generally held that the diluting mark and the diluted mark hadto be “identical or very or substantially similar.” However, the TDRA made substantial changes tothe law of dilution, creating a list of factors to determine blurring. Congress did not include the terms“substantial” similarity, “identity,” or “near identity,” but referred only to the “similarity” betweenthe marks. The Ninth Circuit’s decision in Levi Strauss & Co. v. Abercrombie & Fitch Trading Co.,97 U.S.P.Q.2d 1947, 1958 (9th Cir. 2011), followed that reasoning and concluded that the similarityof the two marks at issue need not be “substantial” in order for the dilution-by-blurring claim tosucceed.In determining the similarity issue, the board used the same test as used in the likelihoodof confusion context; considering the marks in their entireties as to appearance, sound, connotation,and commercial impression.11-146

the IP Book 2012The board concluded that the involved marks are sufficiently similar to “trigger consumersto conjure up” Nike’s famous mark. “Upon encountering applicants’ mark, consumers will be immediatelyreminded of opposer’s JUST DO IT mark and associate the applicant’s mark with opposer’smark.” Nike, 100 U.S.P.Q.2d at 1030.There was no proof of “actual association” between the parties’ marks, since the applicantshad yet to use their mark. Nor was there direct evidence that the applicants “intended to create anassociation with opposer’s famous mark.”The applicants’ parody defense failed, since they were not making any joke as to Nike’smark, but, in the board’s view, were merely trying to take a “free ride” on the association betweentheir mark and Nike’s famous mark, for financial gain.Finally, the board observed that the TDRA did not preclude application of the dilution doctrinewhen the goods are related or competing. Indeed, some courts have said that the closer theproducts, the greater the likelihood of both confusion and dilution.Balancing the relevant factors, the board concluded that “an association exists between theparties’ marks that would impair the distinctiveness of opposer’s famous mark.” Id. at 1032. It thereforesustained Nike’s Section 43(c) dilution-by-blurring claim.Practice TipA plaintiff claiming dilution-by-blurring no longer needs to prove that theinvolved marks are identical or substantially similar.B. Rolex Watch U.S.A., Inc. v. AFP Imaging Corp., 101 U.S.P.Q.2d 1188(T.T.A.B. 2011) [Precedential]By discarding its “substantial similarity” or “near identity” standard for comparing themarks at issue, the TTAB had surely made it easier to prove dilution. But the TTAB’s decision in thiscase may cause difficulties for the dilution plaintiff. The board dismissed opposer Rolex’s dilutionby-blurringclaim, concluding that the opposer had failed to prove that the applied-for mark, ROLL-X, for “x-ray tables for medical and dental use” would, despite an “actual association” between themarks, impair the distinctiveness of the opposer’s famous ROLEX mark.In an important further ruling, the board dismissed Rolex’s claim that the applicant AFPdid not have a bona fide intent to use the ROLL-X mark when it filed its application to register. AFP11-147

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012overcame the prima facie case established by its lack of documentation supporting its alleged bonafide intent, by proving that the filing of the ROLL-X application was consistent with an extension ofits current product line.Fame: The board had little difficulty finding the ROLEX mark to be famous for dilutionpurposes based on nearly one hundred years of use, a lack of any third-party use or registration forsimilar marks, the fact that the mark is a coined and fanciful term, hundreds of millions of dollars inannual sales, tens of millions of dollars in annual advertising expenditures in a variety of media, andunsolicited, “intense” media coverage.Fame When: Most of the opposer’s evidence pre-dated the 2008 filing date of AFP’s intentto-useapplication, leading the board to conclude that the fame of the ROLEX mark was well establishedprior to the applicant’s constructive first-use date.Dilution-by-Blurring: Dilution-by-blurring arises when a substantial percentage of consumers,when seeing the junior party’s mark, are immediately reminded of the famous mark andassociate the junior party’s use with the owner of the famous mark—even if they do not believethat the goods come from that owner. But even if such an association is established, the board mustdetermine whether such association is likely to impair the distinctiveness of the famous mark. 101U.S.P.Q.2d at 1194.The board considered the six non-exhaustive factors set forth in Section 43(c)(2)(B) of theLanham Act. As to the first factor, the similarity of the marks, the board noted that Nike v. Maherembraced a new test based simply on a comparison of the marks as to appearance, sound, connotation,and commercial impression: i.e., whether the marks are sufficiently similar to cause consumersto conjure up the famous mark when confronted with the junior mark. Here, the board found thatthe differences between the marks in appearance, meaning, and commercial impression “greatlyoutweigh any dissimilarities in pronunciation.” Id. at 1195. More specifically, the applicant’s mark islikely to be viewed as comprising the word “roll,” as in moving on rollers, and “x,” as in x-ray. Thusthis factor favored the applicant AFP.The second factor, the distinctiveness of the famous mark, favored Rolex. The third factor,the extent to which the mark owner is engaging in substantially exclusive use of the famous mark,also favored Rolex, as did the fourth factor, the degree of recognition of the famous mark.The fifth factor, whether the junior party intends to create an association with the famousmark, favored AFP. In fact, the only evidence on the issue indicated that the applicant chose the markROLL-X based on the product’s attributes.As to the sixth factor, whether there is an actual association between the junior mark and thefamous mark, Rolex relied on a survey targeted at “animal professionals” responsible for purchasing11-148

the IP Book 2012x-ray tables. When asked if something came to mind when first shown the ROLL-X table, 82 percentsaid yes, and 42 percent of those respondents said it was “Rolex/Watch.” The board found this levelof association to be insufficient to prove a likelihood of dilution:Id. at 1196.This figure is not persuasive given that a higher percentage, 50% of respondentswho replied that something came to mind, thought of a feature of thegoods (portable, rolling) or the actual goods themselves (x-ray tables/equipment).Moreover, the survey results, while showing an “actual association”between opposer’s and applicant’s marks, do not establish that such an associationwould impair the distinctiveness of opposer’s famous mark.The board concluded that the dissimilarity between the marks, the conflicting results of thesurvey, and the lack of evidence of AFP’s intent to create an association, outweighed the recognition,distinctiveness, and substantially exclusive use of the ROLEX mark. Moreover, Rolex did notprovide any evidence of the degree to which its marketing power would potentially be diminished byAFP’s intended use of its mark. Therefore the board dismissed Rolex’s dilution claim.Particularly concerning to a potential dilution claimant is the task of proving diminishmentof the market power of a famous mark in a case where, as here, the challenged mark has not yet beenput into use. Rolex appealed this decision to the CAFC but AFP subsequently withdrew its applicationto register, and so we will not have the benefit of the appellate court’s view on this issue in thiscase.Lack of Bona fide Intent: Rolex also claimed that the applicant, AFP, did not have a bonafide intent to use the ROLL-X mark at the time it filed its application to register. Indeed, Rolex establisheda prima facie case by showing that AFP had no documentation (e.g., labels or advertisingmaterials) to support its claim of a bona fide intent.AFP, however, submitted sufficient evidence to rebut the claim; it promotes and advertisesother imaging products, and it owns the registered mark DENT-X for film processors and x-ray machinesand advertises that mark for its human dental x-ray business. Thus the filing of the ROLL-Xapplication was consistent with an extension of AFP’s product line. In addition, AFP had the capacityto manufacture and market the goods identified in the challenged application.The board concluded that the applicant filed its application in good faith, not merely to reservea right in the ROLL-X mark, and it dismissed the lack-of-bona fide-intent claim.11-149

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012C. L’Oreal S.A. v. Marcon, 102 U.S.P.Q.2d 1434 (T.T.A.B. 2012) [Precedential]Robert Victor Marcon’s brash attempt to register the mark L’OREAL PARIS for “aloe veradrinks” was unceremoniously directed down the TTAB drain. The fame of the marks L’OREAL andL’OREAL PARIS for cosmetics and personal care products was a major factor in the board’s sustainingopposer L’Oreal’s Section 2(d) claim. And Marcon’s pattern of filing intent-to-use applicationsfor disparate goods under the well-known or famous marks of others was a factor in the board’ssustaining L’Oreal’s lack-of-bona fide-intent claim.Likelihood of Confusion: The board began by finding the opposer’s marks, L’OREAL andL’OREAL PARIS, to be famous for cosmetics and personal care products, based on billions of dollarsin sales, significant market share, huge advertising expenditures, extensive media exposure,impressive brand awareness, and consistent ranking by Business Week as one of the world’s “100Top Brands.”Marcon made the “incredible statement” that the fame factor “strongly supports” his casebecause the opposer’s fame is primarily associated with cosmetic products. The board pointed outthat a finding of fame for the senior mark can never support a junior party. Fame expands the scopeof protection accorded a mark. And, the board observed, “[a] strong mark ... casts a long shadowwhich competitors must avoid.” 101 U.S.P.Q.2d at 1438, quoting Kenner Parker Toys, Inc. v. RoseArt Industries, Inc., 22 U.S.P.Q.2d 1453, 1456 (Fed. Cir. 1992).The opposer’s mark L’OREAL PARIS is obviously identical to the applicant’s mark. Moreover,the board not surprisingly found the opposer’s marks L’OREAL to be substantially similar tothe applicant’s mark, since, given the geographically descriptive nature of PARIS, consumers aremore likely to remember the L’OREAL portion of Marcon’s mark.Turning to the goods, the board noted once again that when the marks at issue are identical,a lesser degree of relatedness between the goods is necessary to support a finding of likely confusion.At first glance, cosmetics and beverages “might not appear to be inherently related,” but opposersubmitted “substantial evidence to show several reasons for finding such goods to be related.”L’Oreal, 102 U.S.P.Q.2d at 1439.Third-party registrations and Internet search results revealed companies that sell both cosmeticsand food/beverage products (e.g., MOUNTAIN DEW for lip balm and soft drinks). Theopposer also provided an article discussing the trend of “traditional skin care lines improving lookswith dietary supplements.” The opposer’s vice president testified that L’Oreal is an “innovator” fromwhom customers expect new and different products. Moreover, aloe vera is an ingredient in cosmeticsand personal care products. The board therefore found the involved goods to be sufficientlyrelated for likelihood of confusion purposes.11-150

the IP Book 2012As to trade channels, cosmetics and beverages move through supermarkets, drug stores,and mass merchandisers. The classes of customers are the same: ordinary consumers. The identifiedgoods were not restricted as to price and presumably included inexpensive items that may have beensubject to impulse purchases.Finally, under the 13th du Pont likelihood of confusion factor, the board considered Marcon’sbad faith. It agreed with L’Oreal that “applicant has a history and pattern of filing intent-to-useapplications for a disparate range of products for which he has no industry-relevant experience, andwhere the applied-for marks are identical to some of the best known, previously registered trademarksin the country” Id. at 1441. For example, Marcon has sought to register HEINEKEN for meatjuices, JACK DANIELS for cigars, CHANEL for greeting cards, SOUTHERN COMFORT for beer,and BAYER for mouthwash.This pattern convinced the board that Marcon’s adoption of L’OREAL PARIS was in badfaith. “Such bad faith is strong evidence that confusion is likely, as such an inference is drawn fromthe imitator’s expectation of confusion.” Id. But the board hastened to add that even without this badfaith finding, it would still have found confusion likely. And it did.Lack of Bona fide Intent: Marcon had no documents evidencing a bona fide intent to usethe applied-for mark for aloe vera drinks. He admitted having no industry experience, no businessplan, no potential partners or investors, no logos or packaging, and no concrete activities toward usingthe mark. His vague assertions regarding licensing and outsourcing were “woefully deficient”to establish a bona fide intent. The board therefore concluded that Marcon lacked the requisite bonafide intent when he filed his Section 1(b) application.Marcon’s “demonstrated pattern” of filing applications (16 in all) for the famous or wellknownmarks of others was another basis for finding lack of bona fide intent. The legislative historyof the Trademark Law Revision Act of 1988 provides several examples of objective circumstancesthat “may cast doubt on the bona fide nature of the intent or even disprove it entirely.” One of thesecircumstances is the filing of an excessive number of intent-to-use applications to register marks thatwere ultimately not used.Of course, Marcon’s self-serving statements that he acted in good faith and did not lack abona fide intent proved nothing. Evidence establishing a bona fide intent, or a lack thereof, must beobjective. Here the complete lack of documentation or other objective evidence of Marcon takingactive steps toward use “outweighs any subjective (or even sworn) intent to use the mark.” AndMarcon’s “blatant attempt to obtain registrations of third parties’ well-known marks, and subsequentabandonment of those applications provides significant, additional support” for the board’s conclusion.Id. at 1444.11-151

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012Practice TipA prima facie case of lack of bona fide intent arises from an applicant’slack of documentation to support its alleged intent.D. Shutemdown Sports, Inc. v. Lacy, 102 U.S.P.Q.2d 1036 (T.T.A.B. 2012)[Precedential]The TTAB went out of its way to avoid addressing the fraud claim in this cancellationproceeding involving pro se applicant Carl Dean Lacy’s registration for the mark SHUT IT DOWNin standard character form, for 113 clothing items. The petitioner alleged abandonment and fraud,asserting that at the time of filing his application, Lacy had yet to use the mark on any of the goodsand that any subsequent use of the mark had been abandoned. The board granted the petition on theground of abandonment, sidestepped the fraud issue, and ruled that the registration was void ab initiofor nonuse, a ground that was not pleaded.Lacy filed his use-based application on March 15, 2006. During discovery, Lacy stated thathe had offered for sale only four of the 113 items listed in his registration, and that as of August 4,2009, no one had purchased goods from him for the previous five years. Discovery further revealedthat Lacy had no bank account, no tax returns, no sales documents, and no advertisements or promotionalmaterials for the goods. He had no documents relating to first use of the mark. He claimedannual promotional expenditures of about $200, and annual sales of less than $1,000.Abandonment: Lacy admitted that he never used his mark in connection with 109 of theidentified goods, and that he had no intention to do so. Obviously, he failed to rebut the statutorypresumption of abandonment that arises after three years of nonuse.As to the remaining four items that Lacy claimed to have sold, the lack of sales for a fiveyearperiod, coupled with the lack of documentation, established a prima facie case of abandonment.The burden then shifted to Lacy to rebut the presumption of abandonment, but he did not provideany evidence to corroborate his alleged use of the mark in commerce on the four items. His selfservinginterrogatory response stating that he used, or intended to use, the mark on the four items wasdeemed insufficient to rebut the presumption of abandonment. The TTAB therefore found that Lacyalso abandoned his rights to the SHUT IT DOWN mark with respect to the four items.Fraud/Nonuse: The board found it unnecessary to reach the petitioner’s fraud claim becauseit found that the petitioner had made a prima facie case that Lacy did not use his mark on any ofthe goods at the time he filed his application, and Lacy failed to overcome that showing. The board11-152

the IP Book 2012therefore ruled that Lacy’s application was void ab initio for nonuse. It acknowledged that the petitionerdid not include a separate claim alleging that Lacy’s nonuse of the mark rendered the registrationvoid, but it pointed out that, while such separate pleading is preferable, it is not required. Herethere was no doubt that the issue of nonuse was clearly set out in the petition for cancellation andwas tried by the parties.And so the board granted the petition for cancellation.Practice TipThe TTAB has not sustained a single fraud claim since the CAFC’sdecision in Bose in August 2009. We have learned since the Bose decisionthat proving up a fraud claim will be a difficult task. Shutemdownsuggests that the board prefers to avoid even considering a fraud claimwhen possible.E. Reliance Standard Life Ins. Co. v. American National Ins. Co., OppositionNo. 91178996 (Apr. 30, 2012) [Not Precedential]In the only non-precedential decision deemed worthy of inclusion in this unabashedly subjectivecompilation of significant cases, the TTAB again demonstrated its post-Bose reluctance tofind fraud, denying the applicant’s counterclaim for fraud predicated on material false statementsmade to the USPTO during prosecution of the application that yielded the opposer’s pleaded registration.Likelihood of Confusion: The board dismissed opposer’s Section 2(d) challenge to registrationof the mark BENCHMARK RELIANCE for the “issuance and administration of annuities,”finding the mark not likely to cause confusion with the registered mark RELIANCE STANDARDfor insurance underwriting and issuing and administering annuities. Despite a partial overlap in theinvolved services, the board was persuaded to rule in the applicant’s favor by the high degree of careexercised by consumers, the lack of any reported instances of confusion, and the differences in themarks.Fraud Counterclaim: Although it had ruled against the opposer on its Section 2(d) claim, theapplicant was entitled to a decision on its counterclaim for cancellation, since the opposer’s registrationwould otherwise remain as a potential threat to the applicant in other contexts.11-153

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012During prosecution of its application to register RELIANCE STANDARD, the opposersought to overcome a Section 2(d) refusal by stating that it offers its annuity services to employers.But it failed to state that it also sells annuities to individuals through independent agents and brokers.In short, the opposer told a “half-truth.”The opposer did not contest the fact that it knew it renders its annuity services to individuals.Although the false statements at issue were attorney argument, a client is bound by the actions ofits attorney. In any case, the opposer’s officer advised counsel in preparing the argument.The statements were material because they formed “the basis of opposer’s contention thatits services and the services in the cited registration move in different channels of trade and are soldto different classes of consumers.” Slip op. at 27. The false statements “presumably led the examiningattorney to withdraw the likelihood of confusion refusal and approve opposer’s application forpublication.” Slip op. at 28.The board, however, had doubt as to whether the opposer intended to deceive the USPTO.Although “our experience tells us that opposer intended to mislead the examining attorney” by itsstatements, opposer did submit a specimen of use that stated that it “offers a complete portfolio offixed rate annuity products to individuals.” Slip op. at 29. The board must presume that the examiningattorney was aware of that statement in the specimen of use. Consequently the board could not“logically find that there was a willful withholding of facts which, if transmitted and disclosed to theexamining attorney, would have resulted in the disallowance of the registration sought by opposer.”Slip op. at 30. In short, the applicant failed to prove fraud by clear and convincing evidence.Even if the proof of deceptive intent fell short, what about reckless disregard for the truth?The board and the CAFC have yet to rule on whether a reckless disregard for the truth suffices tosupport a fraud finding. Was this case a candidate for such a ruling?F. In re the Government of the District of Columbia, 101 U.S.P.Q.2d 1588(T.T.A.B. 2012) [Precedential]; In re the City of Houston, 101 U.S.P.Q.2d1534 (T.T.A.B. 2012) [Precedential]Section 2(b) of the Lanham Act prohibits registration of any mark that “consists of or comprisesthe flag or coat of arms or other insignia of the United States, or of any State or municipality,or of any foreign nation, or any simulation thereof.” In these two cases of first impression, the TTABruled that Section 2(b) of the Lanham Act means what it says; it bars even a government body fromregistration of its own official insignia.In the first case, the board affirmed a refusal to register the official seal of the District of Columbiafor various goods, including clocks, cufflinks, memo pads, pens and pencils, cups and mugs,and assorted clothing items. Here, there was no dispute that the applied-for mark is the official seal,11-154

the IP Book 2012nor that the District of Columbia (DC) qualifies as a “municipality”under the statute.The board found the language of Section 2(b) to be “plainand clear on its face.” District of Columbia, 101 U.S.P.Q.2d at1594. The text of the statute provides for no exception to the banon registration, even when a governmental entity is the applicant.DC argued that, based on congressional intent,Section 2(b) should be interpreted to include an exception forgovernmental entities seeking to register their own insignia. Butthe board noted that such an exception is absent from the statutory text, and it refused to presumethat Congress intended such an exception. The board pointed out that Section 2(c) and 2(d) of theLanham Act contain express exceptions in their language, and these provisions demonstrate thatCongress was fully capable of providing statutory exceptions when it intended to do so. Moreover,Congress had revisited the trademark law numerous times in 100 years since the prohibition againstregistering governmental indicia was first enacted, and it has not provided the proposed exception.Consequently, the board found it hard to believe that Congress intended this exception to Section2(b) but failed to expressly provide it.The applicant DC contended that this prohibition was originally enacted with the intent ofimplementing the Paris Convention, whose aim was to prohibit others from registering governmentindicia, not governments themselves. The board, however, pointed out that this prohibition was firstenacted into United States trademark law in 1905. Although the Paris Convention now does notrequire signatories to the Convention to prohibit registration of official insignia when authorized bythe relevant government body, prior to 1911 there was no mention of a “registration with authorization”exception. This suggests that prior to 1911, the ban on such registrations was to be applied toall such marks, regardless of authorization or the identity of the applicant. Thus it might be presumedthat in 1905, Congress intended to adopt the more restrictive approach of the 1883 text of the treatythat was then in effect.The fact that Article 6ter of the current Paris Convention does not require the United Statesto bar registration of all governmental insignia was of no help to DC because the Paris Conventionis not self-executing. It creates no rights that the applicant can directly rely on. Even if it were selfexecuting,the Convention requires only that signatories refuse registration without authorization. Itdoes not require signatories to accept registration when authorized.DC also argued that the central purpose of Section 2 of the Lanham Act is to preventconfusion, whereas registration of indicia by the pertinent governmental body would not result inconfusion. But the board easily knocked down that argument, pointing to the ban on immoral and11-155

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012scandalous marks found in Section 2(a) and the various provisions of Section 2(e), none of whichrelate to likelihood of confusion. Likewise, Section 2(b) prohibits registration of marks regardless ofwhether confusion is involved.DC next maintained that Section 2(b) of the Lanham Act is ambiguous, as evidenced by thePTO’s issuance of three third-party registrations for governmental insignia, as well as by the board’sdecision in In re U.S. Dep’t of the Interior, 142 U.S.P.Q. 506 (T.T.A.B. 1964), reversing a refusal toregister a logo of the National Park Service. The board observed, however, that in the Interior case,it concluded that the involved logo was not the type of mark prohibited by Section 2(b) because itwas not an official insignia of national authority. In other words, Section 2(b) does not bar a governmentbody from registration of any and all marks, just insignia of the same class as the flag or coatof arms of the United States.As to the third-party registrations, the actions of the examining attorneys in approving theseapplications did not create any ambiguity in the statute, nor did it provide applicant DC with a rightto register its mark. The board pointed out that arguments based on alleged examining inconsistenciesconsistently have been rejected. Each mark must be reviewed on the record submitted with theapplication.Finally, DC maintained that Section 2(b) of the Lanham Act is unconstitutional becauseit denies the applicant its Fifth Amendment right to due process, and the refusal of its applicationwas unconstitutional because it discriminated against the applicant in view of the three third-partyregistrations of record. The board disagreed on both counts, but more importantly observed thatthe TTAB is not an Article III court and has no authority to declare provisions of the Lanham Actunconstitutional.In the second case, the board followed the same line of reasoning, affirming a Section 2(b)refusal to register the official seal of the city of Houston for variousmunicipal services.Houston asserted that the statute is “silent” as to whethergovernmental entities may register their own official insignia, butthe board flatly disagreed. Section 2(b) categorically provides thatall such insignia are barred from registration. It need not set forth orspell out every subset of marks that falls within the ban.Houston further contended that Section 2(b) was enactedto prevent desecration of the flag and other government symbols bydenying their registration, but not to prevent government bodies from protecting their own insignia.The board was unable to verify Houston’s theory regarding enactment of Section 2(b), but even11-156

the IP Book 2012if it accepted the premise, it does not necessarily follow that Congress intended that governmentsshould be able to register their own indicia; rather it appeared that Congress chose a complete banon registration of such indicia in order to prevent their commercial exploitation. As pointed out inthe District of Columbia decision, Congress could easily have provided an exception in Section 2(b),but it did not do so. Accordingly, the board presumed that Congress intended Section 2(b) to applyuniversally, regardless of the identity of the applicant.Relying on certain language in In re U.S. Dep’t of the Interior, supra, Houston urged that itsought registration of its seal not as a “symbol of authority,” but rather in connection with specificmunicipal services, and therefore its application falls outside the Section 2(b) bar. The board, however,found that to be a misreading of Interior because that case did not support the contention thatthe nature of the involved goods or services is a factor in determining whether Section 2(b) prohibitsregistration.The board in Interior decided that the mark in question was not of the type that fell withinSection 2(b) because it was not similar in kind to the flag or Great Seal of the United States. There,the board discussed the nature of the services involved only in the context of determining whetherthe mark was in fact “the flag or coat of arms or other insignia” of the government. In Interior, themark was used in connection with recreational and educational services and not as an official sealof the government.PRACTICE TIPIf the mark is never used as an emblem of authority, but only to identifysome service or program provided by a government agency, the markdoes not fall within Section 2(b).Moreover, even if it is determined that the mark does fall within the Section 2(b) prohibition,that does not render the goods or services identified in the application to register relevant. Here,the city of Houston’s seal is admittedly an official insignia under Section 2(b), and the applicant’sdiscussion of the particular services recited in its application is of no consequence.Finally, the applicant pointed to the USPTO’s inconsistent treatment of such marks, relyingon a list of 13 third-party registrations. The board noted that the list is of little probative valuebecause it is not even clear that the involved marks are official governmental insignia. In any event,even assuming that the listed registrations are inconsistent with the refusal to register in this case,reversal is not required. The board is not bound by prior decisions of examining attorneys, nor do11-157

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012applicants have a substantive right to consistency. The board must decide each case on the recordbefore it.The board agreed with the applicant that legal determinations should be applied consistently,but the board’s obligation is to make the decision correctly. This obligation may not be abdicatedto examining attorneys. To the contrary, it is the board’s role to correct the examining attorney whoapplies an incorrect legal standard when the case comes before the board. Even if all of the listedregistrations should have been refused registration, those errors do not require the PTO to improperlyregister Houston’s mark.Practice TipSection 2(b) of the Lanham Act bars the registration of official governmentalinsignia, even when the government body is the applicant, andregardless of the involved goods or services.G. Corporacion Habanos, S.A. v. Guantanamera Cigars Co., 102 U.S.P.Q.2d1085 (T.T.A.B. 2012) [Precedential]; In re Compania De LicoresInternaciolaes S.A., 102 U.S.P.Q.2d 1841 (T.T.A.B. 2012) [Precedential]The perpetual popularity of Cuban cigars and Cuban rum in this country, and the governmentalembargo against Cuban goods, has resulted in a flow of decisions involving Section 2(e)(3)of the Lanham Act, which bars registration of a mark that is primarily geographically deceptivelymisdescriptive of the involved goods (or services).There are three elements that must be met to invoke the registration bar of Section 2(e)(3):1. the primary significance of the mark is a generally known geographic location;2. the consuming public is likely to believe the place identified by the mark indicatesthe origin of the goods bearing the mark (i.e., that a goods-place association exists),when in fact the goods do not come from that place; and3. the misrepresentation would be a material factor in the consumer’s decision topurchase the goods.Corporacion Habanos, 102 U.S.P.Q.2d at 1090.11-158

the IP Book 2012The issue of materiality has been the primary focus of recent judicial attention. In thesetwo cases, the TTAB applied the latest rulings from its reviewing courts in deeming GUANTANA-MERA for cigars and OLD HAVANA for rum to be unregistrable under Section 2(e)(3).In February 2008, the board sustained an opposition to registration of the mark GUANTA-NAMERA for cigars, finding the mark to be primarily geographically deceptively misdescriptive.86 U.S.P.Q.2d 1473 (T.T.A.B. 2008). In August 2010, the U.S. District Court for the District ofColumbia reviewed the board’s decision and reversed and remanded, ruling that the board “erred asa matter of law in applying the materiality requirement” of Section 2(e)(3) of the Lanham Act. GuantanameraCigar Co. v. Corporacion Habanos SA, 98 U.S.P.Q.2d 1078 (D.D.C. 2010). In February2012, the board sustained the opposition again, concluding that “a significant portion of consumersof cigars would be materially influenced in the decision to purchase cigars by the geographic meaningof applicant’s mark.” Corporacion Habanos, 102 U.S.P.Q.2d at 1104.The district court found that “Guantanamera” means “girl from Guantanamo,” that theprimary significance of GUANTANAMERA is geographic, that the consuming public is likely tobelieve that the applicant’s cigars originate from Cuba and that cigar tobacco was produced in theGuantanamo province of Cuba. However the district court ruled that the board failed to addressproperly the third element of the Section 2(e)(3) test: the materiality of the geographic representationinherent in the mark. (In this regard, the district court relied on the CAFC’s decision in In re SpiritsInt’l, Inc., 90 U.S.P.Q.2d 1489 (Fed Cir. 2009), decided after the board had ruled in this case.)The court concluded that our decision did not address whether a significantportion of relevant consumers would be materially influenced in their purchasingdecisions; and “[t]o establish a prima facie case, the TTAB or the oppositionmust show that ‘a significant portion of the relevant consumers would bematerially influenced in the decision to purchase the product or service by thegeographic meaning of the mark.’”Corporacion Habanos, 102 U.S.P.Q.2d at 1090, quoting the district court decision, which quoted Inre Spirits, 90 U.S.P.Q.2d at 1495.The board re-opened the opposition proceeding so that the parties could address that oneissue. The parties submitted more than 3,000 pages of additional evidence on that point (much to theboard’s dismay).The applicant’s expert concluded that the primary significance of “Guantanamera” is a famoussong of Cuban origin, that those who do relate the word to Guantanamo, Cuba, do not perceivea connection with cigars, and that even if they do, this would not be a material factor in the purchasingdecision. However, the expert did not conduct any studies or focus groups, but relied only on his11-159

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012“educated perception,” and he did not reveal any methodology by which he reached his conclusions.In short, there was “nothing in the report or his testimony to demonstrate that the report is reliable,”and so it was deemed inadmissible.The question remained whether “a significant portion of the relevant consumers would bematerially influenced in the decision to purchase the cigars by the geographic meaning of the mark.”In Spirits, the CAFC reversed the TTAB because, in finding that MOSKOVSKAYA was primarilygeographically deceptively misdescriptive of vodka, the board failed to consider whether Russianspeakers, who would be deceived into believing that the vodka came from Moscow, constituted a“substantial portion of the intended audience.” The CAFC noted that:[O]nly 0.25% of the U.S. population speaks Russian.… If only one quarter ofone percent of the relevant consumers was deceived, this would not be, by anymeasure, a substantial portion. However, it may be that Russian speakers are agreater percentage of the vodka-consuming public; that some number of non-Russian speakers would understand the mark to suggest that the vodka camefrom Moscow; and that these groups would together be a substantial portionof the intended audience.Spirits, 90 U.S.P.Q.2d at 1496.Spanish speakers constitute more than 12 percent of the United States population. Tensof millions more have received Spanish language instruction in school. The board concluded that“(i) persons who speak Spanish at home, and (ii) persons who do not speak Spanish at home butwho know Spanish, are a substantial portion of the U.S. population.” Corporacion Habanos, 102U.S.P.Q.2d at 1097. Moreover, the applicant’s advertising is aimed at Spanish-speaking consumersand at the general adult population. The board therefore found that “persons who speak or knowSpanish are a substantial portion of the intended audience (or purchasers) of applicant’s goods.” Id.at 1099.The next question, then, was whether these consumers would be deceived by the geographicalmisdescription. The applicant argued that direct evidence of materiality was required, but theboard ruled otherwise. Reviewing the case law, noting the difficulty in obtaining direct evidencefrom purchasers, and observing that the TTAB does not require survey evidence in any proceeding(given the limited nature of its jurisdiction), the board ruled that indirect evidence of materiality wasacceptable in an inter partes proceeding.The applicant next argued that, even if the board was permitted to draw an inference ofmateriality, here there is no evidence that Guantanamo was “famous or otherwise known” in thiscountry for cigar production. Instead, according to the applicant, “Guantanamo is famous for a US11-160

the IP Book 2012Naval Detention center and as it relates to the song titled Guantanamera.” Id. at 1100. The latterargument, however, conflicted with the district court’s finding that “Cuba, or Guantanamo, Cuba isthe primary significance of GUANTANAMERA,” and that the consuming public is likely to believethat the cigars come from Cuba. It also ignored the requirement that the mark be considered in thecontext of the goods.Moreover, the law does not require that the place identified in the mark be “noted for” thegoods in order for the Section 2(e)(3) registration bar to apply. It is enough that the consumer wouldexpect the goods to come from that geographical location.Finally, turning to the question of whether the misdescription would be a material factor inthe purchasing decision, the board answered in the affirmative.Id. at 1103.From the advertisements, webpages, testimony, magazines and cigar publicationsand encyclopedias, we find that opposer has established that sellers ofcigars in the United States market non-Cuban cigars through branding andmarketing associations with Cuba because they believe that consumers valueassociations with Cuba in making purchasing decisions.And so the board concluded that the Spirits test had been met, and it sustained the opposition.In the OLD HAVANA case, the TTAB provided another detailed discussion of Section 2(e)(3), in finding the mark unregistrable for rum.It was undisputed that Havana is a generally-known geographic location, and the boardfound the primary significance of “Havana” to be geographic. Adding the term OLD does not diminishthat primary significance. “Old Havana” is more than a historical reference; in fact, there is asection of Havana that is referred to by the name “Old Havana.”The record did not support the applicant’s assertion that OLD HAVANA primarily evokesa particular lifestyle of a bygone era. Moreover, even if this connection were established, it wouldnot overcome the primary geographic significance because the connection may be made preciselybecause Havana is a city in Cuba. Nor did the evidence support the assertion that there is a “Havana”style or method of rum production.There was no dispute that the applicant’s rum did not originate in Havana, Cuba.As to the connection between rum and Cuba, and particularly Havana, the record showedthat rum is the most famous alcoholic product of Cuba. In fact, Cuba is called the Island of Rum.11-161

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012The applicant argued that consumers know that they cannot buy “real” Cuban rum due to embargorestrictions, and so they will not believe that the applicant’s rum came from Cuba. Instead, they argued,consumers will ascribe the other meanings to “Havana.” The board noted that it has rejectedthis embargo argument in several cases for lack of evidence, and it did the same here.The applicant also pointed to its product labeling, which includes the word “brand” afterOLD HAVANA, indicating that the term is a trademark, not a geographic indicator; the phrase “Cubanstyle rum”; and the phrase “Product of USA.” The board pointed out, however, that this caseconcerned the applied-for mark OLD HAVANA by itself, regardless of what may appear on the label.The applicant further maintained that its rum has a connection with Havana because itspresident was born in Cuba and had 30 years of experience in making “Cuban-style” rum. The boardwas unimpressed. That evidence was too tenuous to show the required substantial current connectionbetween the applicant’s rum and Havana.Finally, the materiality element was satisfied by evidence that Cuba, and particularly Havana,is famous for rum. As the board stated in In re Jonathan Drew, 97 U.S.P.Q.2d 1640 (T.T.A.B.2011) (KUBA KUBA for cigars), direct evidence of materiality is not required. Materiality may beinferred from indirect or circumstantial evidence, such as gazetteer entries and third-party websites.In short, the board found that consumers would care about whether the applicant’s rumcame from Havana, and the misrepresentation conveyed by OLD HAVANA is likely to materiallyimpact the purchasing decision.And so the board affirmed the Section 2(e)(3) refusal.H. In re the Dot Communications Network LLC, 101 U.S.P.Q.2d 1062(T.T.A.B. 2011) [Precedential]Brushing aside several third-party registrations for top-level domain (TLD) marks, theTTAB affirmed a refusal to register the mark .MUSIC in each of five applications, for domain registrationand hosting services, various computer-related services and music-related goods, on theground that the mark is merely descriptive under Section 2(e)(1) of the Lanham Act. The board’sruling was based “on the current marketing environment which is different than the marketing environmentwhen many of the third-party registrations relied upon by applicant were issued.” 101U.S.P.Q.2d at 1067. The examining attorney maintained that “music is a feature of applicant’s goodsand services” and that the period at the beginning of the mark is “mere punctuation that does not alterthe commercial impression of the mark as being something more than just the word ‘Music.’” Theapplicant asserted that .MUSIC is arbitrary with respect to many of the identified services. Furthermore,a TLD does have a source-identifying function, “since by definition the domain names from aparticular TLD emanate from only one domain registry source.” Id. at 1063-64.11-162

the IP Book 2012The applicant also argued that the USPTO had a practice of allowing registration of topleveldomains, including such ICANN-accredited TLDs as dotam, dotfm, .travel, .nu domain, anddotCoop, as well as non-accredited but proposed TLD strings. It noted that “[a]ll of these include domainregistration services, and may include a much broader variety of online services.” Id. at 1064.The board, however, observed that the situation has changed since 1989, when the first fewTLDs were created. In 2000, a dozen more were announced, another one in 2005, and in 2010 the.xxx TLD was approved. Furthermore, in 2011 ICANN announced that “it would greatly increasethe number of top-level domains by allowing nearly any new name in any language.” Id. at 1065.As a result, the board noted, there were groups seeking various top-level domain names,including a group (unaffiliated with the applicant) that was seeking the name .music, which wasintended for use by musicians and the music industry. The board concluded that the public wouldperceive .MUSIC “as a top-level domain associated with the field of music because there has beena concerted public effort to build support for its use as a top-level domain in this field.” Id. at 1067.Id.This finding is based on the current marketing environment which is differentthan the marketing environment when many of the third-party registrations reliedupon by applicant were issued. When many of the third-party registrationswere issued, ICANN was not considering expansion of the roster of domainname extensions. Nor does the record reveal active campaigns to obtain TLDstatus for the marks in those registrations as there is for the .music top-level domain.Therefore, the third-party registrations submitted by applicant for marksconsisting of “dot __________” or “._________” have very limited probativevalue ....Turning then to the goods and services identified in the five applications, the board foundthe mark to be descriptive of “registration of domain names for identification of users on a globalcomputer network,” since “consumers would anticipate that .music identifies the registration of domainnames for a music-related top-level domain.” Id. at 1068. Likewise the mark is descriptive ofInternet hosting services, music publishing and entertainment services, online directory services, andfinally, downloadable content.I. Doyle v. Al Johnson’s Swedish Restaurant & Butik, Inc., 101 U.S.P.Q.2d1780 (T.T.A.B. 2012) [Precedential]In one of the more bizarre TTAB cases in years, the board granted the respondent’s motionto dismiss a petition for cancellation of two registrations for the mark shown below (comprisinggoats on a grass roof) for restaurant services and retail store services. The petitioner, Robert Doyle,11-163

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012failed to allege sufficient facts that would establish his standing, and he failed to state a claim onwhich relief could be granted.Standing: Doyle allegedthat he personally had been or wouldbe negatively affected by the respondent’sregistrations because manyrestaurants and stores have, becauseof the registrant’s marks, “refrainedfrom placing goats on their grass roofs, as a result of which Petitioner has been, and will continued(sic) to be, damaged in that Petitioner has been, and will continue to be, unable to satisfy his desireto take photographs of goats on grass roofs.” 101 U.S.P.Q.2d at 1783 n.3.The standing hurdle is quite low. To have standing, a petitioner must allege facts that, ifultimately proven, would establish that the petitioner has a “real interest,” i.e., a “personal stake,” inthe proceeding. Ritchie v. Simpson, 50 U.S.P.Q.2d 1023, 1025-26 (Fed. Cir. 1999). Doyle failed toclear that hurdle. Although he may have had a real interest or a personal stake in taking photographsof goats on roofs, Doyle did not relate his alleged impairment to the respondent’s service mark: i.e.,there was no allegation that the respondent’s mark somehow prevents him from placing goats on agrass roof and photographing them, or even photographing the goats on the respondent’s restaurants.Moreover, Doyle’s alleged belief that he would be damaged is not reasonable. The respondent’smark does not prevent his photographing goats on grass roofs. Doyle did not allege that heused or wanted to use goat photographs in connection with restaurant or retail store services. Inshort, he failed to allege a reasonable basis in fact to support his claim of standing.Functionality: Doyle’s alleged ground for cancellation was functionality, but he failed torelate that claim to the respondent’s services. In other words, he failed to allege that goats on grassroofs are essential to the use or purpose of restaurant or retail store services.Doyle asserted that goats and sod roofs affect the respondent’s costs by reducing the respondent’senergy and mowing expenses, but that allegation is completely unrelated to the respondent’sservices. Goats on a grass roof might decrease the costs for any business, but functionality must beassessed in connection with the specific services at issue.Doyle also alleged that the registered mark is functional because it is a “form of entertainment”that attracts customers. However, although goats on the roof may attract customers to therespondent’s restaurant, there was no allegation that this method is superior to any other method forattracting customers. Moreover, the board observed that there is “no prohibition against a trade dress11-164

the IP Book 2012mark both functioning to indicate source and being aesthetically pleasing.” Doyle, 101 U.S.P.Q.2d at1783, quoting In re Hudson News Co., 39 U.S.P.Q.2d 1915, 1923 (T.T.A.B. 1996).And so the board concluded that Doyle’s allegations, even if true, could not establish thefunctionality of the registered mark.The board allowed Doyle 20 days to file an amended petition sufficiently alleging standingand a proper claim of functionality. However, it cautioned Doyle to be aware of the “extreme difficultieshe would likely face in ultimately proving that respondent’s mark is functional.”Practice TipNothing prohibits a “trade dress mark” from both functioning as a sourceindicator and being aesthetically pleasing.J. Frito-Lay North American, Inc. v. Princeton Vanguard, LLC, 100U.S.P.Q.2d 1904 (T.T.A.B. 2011) [Precedential]Trademark practitioners breathed a collective sigh of relief when the TTAB, recognizingthe significant differences between civil litigation and TTAB proceedings, denied a motion to compelsweeping e-discovery in this particular case, observing that in TTAB proceedings “the burdenand expense of e-discovery will weigh heavily against requiring production in most cases.” 100U.S.P.Q.2d at 1909.This case concerned the issues of genericness and/or mere descriptiveness of the termPRETZEL CRISPS for “pretzel crackers.” The parties were unable to reach an agreement on a procedurefor handling e-discovery (other than use of the .pdf format). Applicant Princeton Vanguardproceeded to produce tens of thousands of documents (possibly from a prior civil lawsuit), includingelectronically stored information (ESI). Princeton was then dissatisfied with opposer Frito-Lay’s(F-L) production, and moved to compel, claiming that F-L’s electronic discovery efforts were insufficient.F-L argued that the cost ($70,000-$100,000) would far outweigh the benefit.The board discussed at length the role of e-discovery in civil actions and in board proceedings,noting that in the courts “there is an increasing focus on the question of proportionality, andon whether the type of extensive ESI discovery applicant advocates here is always justified.” Id. at1908. In board proceedings, discovery is expected to be less extensive than in court, and demandsfor e-discovery should be carefully scrutinized.11-165

Chapter 11 – The Top Ten Ttab Decisions of 2011-2012Id.In view of our limited jurisdiction, the narrowness of the issues to be decidedby the board, and the concerns expressed by the Federal Circuit, the burdenand expense of e-discovery will weigh heavily against requiring production inmost cases. Parties are advised to be precise in their requests and to have astheir first consideration how to significantly limit the expense of such production.Absent such a showing, the likelihood of success of any motion to compelwill be in question.The board denied applicant Princeton’s motion to compel, in large part refusing to requireF-L to start its document production all over again using the same or similar protocols to those thatPrinceton employed. “Applicant has simply failed to establish that opposer’s method of searchingand producing documents was insufficient as a general matter, given the parties’ failure to agree onan ESI discovery protocol in advance, the nature of applicant’s discovery requests and the issues inthis proceeding.” Id.The board pared down Princeton’s demands and then ordered F-L to produce documents inresponse to certain, narrowed requests.Practice TipIn view of the TTAB’s limited jurisdiction, the burden and expense of e-discovery will weigh heavily against requiring such production in mostcases.11-166

theIP bookChapter 12the IP Book 2012Top Ten Udrp Decisionsfor 2011-2012Bradley J. WalzCatlan M. McCurdyWinthrop & WeinstineMinneapolis§ 12.1 IntroductionOn balance, 2011 proved to be a stable year for Uniform Dispute Resolution Policy (UDRP)filings. The WIPO Arbitration and Mediation Center (WIPO Center) experienced an increased caseload with trademark holders filing a record 2,764 cybersquatting cases covering 4,781 domainnames. This number demonstrates an increase of 2.5 percent and 9.4 percent over the previous highestlevels in 2010 and 2009, respectively. While the WIPO Center faced a rise in filings, the otherUDRP arbitration provider, the National Arbitration Forum (NAF) experienced a four-percent drop.In 2011, trademark holders filed 2,083 cybersquatting cases with the NAF, compared with the 2,177cases filed in 2010. Taking into account both the rise and fall of UDRP filings, the total UDRP filingsat the two principal Internet Corporation for Assigned Names and Numbers (ICANN) accreditedarbitration providers essentially remained unchanged in 2011.While UDRP filings remained stable, there was an overall increase in domain name registrationsin 2011. According to VeriSign’s December 2011 Domain Name Industry Brief, domain registrationsincreased by 8.9 percent in 2011. This overall domain name registration increase and stableUDRP filings marked another year where UDRP filings have declined as a percentage of all domainregistrations.12-167

Chapter 12 – Top Ten Udrp Decisions For 2011-20122011 also marked the approval and implementation of the .xxx top level domain. An .xxx domainname played a role of particular importance in a UDRP complaint filed by Google, Inc. In addition,ICANN also began accepting applications for new top level domains in 2011. ICANN revealednearly 2,000 applications for new generic top level domains (gTLD) as of June 2012. In 2013 wewill surely see the introduction of favorite brands as top level domains, as companies such as Canonhave already announced plans to acquire .canon.§ 12.2 Case SummariesA. CEAT Limited, CEAT Mahal v. Vertical Axis Inc./Whois Privacy ServicesPty Ltd., Case No. D20111981 (WIPO Feb. 20, 2012)CEAT Limited, CEAT Mahal (CEAT) is a tire manufacturer based in India. CEAT is theowner of three registrations for CEAT in standard character form in India, Canada, and the UnitedStates. The Canadian registration issued on June 2, 1978 and has been renewed.Vertical Axis Inc. (Vertical Axis), a company domiciled in Canada, registered the domain name on January 24, 2001. Vertical Axis used a privacy service in connection withthe Whois information for the domain name and used a computer algorithm to selectthe domain name. Vertical Axis used the domain name in connection with apay-per-click (PPC) parked website showing sponsored links and an offer to sell the domain name.In a UDRP proceeding, the WIPO panel found that the domain name was confusinglysimilar to CEAT’s registered CEAT trademark, that Vertical Axis did not have a legitimateinterest in the domain, and that Vertical Axis registered and used the domain in bad faith. The dissentfound that Vertical Axis had a legitimate interest in the domain name and did not registerand use the domain in bad faith.In reaching its decision, the majority found that there was not a legitimate interest in a domainname used for a PPC parking page where the links are unrelated to the dictionary or descriptivemeaning of the domain name. The majority found that there was no dictionary definition for “ceat”and a search of Acronym Finder for CEAT revealed that all the top references were for trade associationsor trademarks. The dissent found that CEAT was widely used as an acronym and that variousacronym websites included several meanings for CEAT, although the meanings were not identifiedby the dissent. The majority concluded that because the links on the website located at the domain name were not related to the descriptive meaning of the domain name, Vertical Axiswas taking advantage of CEAT’s trademark and, therefore, did not have a legitimate interest in the domain name.12-168

the IP Book 2012The majority went on to find that a domain name registrant cannot be willfully blind towhether the disputed domain name may violate the trademark rights of another. It is the registrant’sresponsibility to determine whether its domain name registration infringes or violates someone else’srights. Vertical Axis used an algorithm to select the domain name and did not conduct atrademark search before registering it. The dissent agreed with the majority that a registrant cannotbe willfully blind to whether a disputed domain name violates the trademark rights of another, butfound that there was no evidence demonstrating that Vertical Axis had actual knowledge of CEAT’strademark rights. The majority noted, however, Vertical Axis was domiciled in Canada and CEATobtained a Canadian trademark registration many years before the registration of the domain name. A simple search of the Canadian Trademark Office database would have revealedCEAT’s trademark rights. In addition, the use of a privacy service when the registrant was a companywith no apparent concern with protecting its identity, and the offer to sell the domain, demonstratedVertical Axis’ bad faith registration and use of the domain name.Because Vertical Axis did not have a legitimate interest in the domain nameand had registered and used the domain name in bad faith, the panel granted CEAT’s complaint andordered the transfer of the domain name to CEAT.B. Eagle Mountain Intl., Inc. d/b/a Kenneth Copeland Ministries v. JamesVermillion, Case No. FA1110001410420 (NAF Nov. 18, 2011)Eagle Mountain International, Inc. d/b/a Kenneth Copeland Ministries (Eagle Mountain) isa religious organization that offers a variety of religious goods and services under the KENNETHCOPELAND MINISTRIES, KENNETH COPELAND, and KCM marks. Eagle Mountain federallyregistered these marks and the two marks that were relevant to this case were the KENNETH CO-PELAND MINISTRIES and KENNETH COPELAND mark. The application to federally registerthe KENNETH COPELAND MINISTRIES mark was filed on April 26, 2000, and matured into aregistration on February 27, 2001. The application to federally register the KENNETH COPELANDmark was filed on June 12, 2007, and matured into a registration on October 14, 2008.James Vermillion registered the domain name and used thedomain to promote his alternative theology of organic economics. As part of the promotion of hisalternative theology, Vermillion criticized the Kenneth Copeland Ministries. The website located atthe domain contained pay-per-click advertising and facilitated donationsto Vermillion. Vermillion registered the before Eagle Mountainregistered its KENNETH COPELAND mark, but after the registration of the KENNETH COPE-LAND MINISTRIES mark.The NAF panel found that the domain name was confusinglysimilar to Eagle Mountain’s federally registered KENNETH COPELAND and KENNETH COPE-12-169

Chapter 12 – Top Ten Udrp Decisions For 2011-2012LAND MINISTRIES marks. The panel also found that Vermillion was using the domain name for criticism without intent for commercial gain. Because the domainname was being used for criticism, it was determined the URL was notregistered and being used in bad faith.In connection with the confusingly similar factor, Vermillion argued that the “innocent infringement”defense applied because Eagle Mountain failed to prominently display its KENNETHCOPELAND and KENNETH COPELAND MINISTRIES marks. The panel found that the “innocentinfringement” defense, which is found in 15 U.S.C. § 1114, was not applicable because issuesarising under the policy should “be determined having regard to general and globally accepted principlesof law.” The panel’s treatment of this alleged defense was incomplete.“Innocent infringement” is not a defense to an infringement claim. Rather, “innocentinfringement” limits the relief to a plaintiff after infringement is found. See 15 U.S.C.§ 1114(2)(A)(C). Therefore, Vermillion’s reliance on “innocent infringement” as a defense to a findingthat the domain was confusingly similar to Eagle Mountain’s federallyregistered marks was misplaced.Moreover, “innocent infringement” applies only to a defendant that: (1) solely engagesin the business of printing the mark or violating matter for others, or (2) the mark appears in anadvertisement appearing in a print or electronic publication. See id. Vermillion was not engaged inthe business of printing the mark or violating matter for others, and he was not a publisher of a printor electronic publication. Therefore, none of the exceptions to a finding of infringement applied toVermillion’s registration and use of the domain name.Nonetheless, because the panel found that Vermillion had a legitimate interest in the domain name for criticizing Eagle Mountain, it denied Eagle Mountain’scomplaint.C. eLegalsupply.com v. Azeras, LLC, Case No. FA1204001438796 (NAF May22, 2012)eLegalsupply.com is the owner of a supplemental registration for the ELEGALSUPPLY.COM mark. The ELEGALSUPPLY.COM mark was registered on August 5, 2008. Azeras, LLC(Azeras) registered the domain name on April 9, 2012. The domain name was first registered by another party on March 1, 2007. The website located at the domain name included links to competitors of eLegalsupply.com and a banneroffering the domain name for sale.The NAF panel found that eLegalsupply.com demonstrated it had rights in the ELEGAL-SUPPLY.COM mark because it had a federal registration for the mark on the supplemental register.12-170

the IP Book 2012The panel said “[t]he fact that the trademark is registered on the Supplemental Register and not onthe Principal Register is not a factor to be considered under the Policy.” However, registration of amark on the supplemental register is an admission that the mark is descriptive. Descriptive trademarksare not entitled to protection until they have acquired distinctiveness. A descriptive mark ispresumed to have acquired distinctiveness after five years of substantially exclusive use.The panel’s decision regarding the sufficiency of a supplemental registration to establishtrademark rights was contrary to the panel’s decision regarding the disclaiming of terms in a markthat was made in the Sven Beichler case (discussed later in this chapter), which required the complainantto prove its mark had acquired distinctiveness. In this case, the panel did not require a showingof secondary meaning even though the ELEGALSUPPLY.COM mark had been registered forfewer than five years. Presumably, the panel found the existence of trademark rights when no suchrights existed.The panel also found that the domain name was confusingly similarto the ELEGALSUPPLY.COM trademark. Azeras argued a classic fair-use type of defense that the domain name was comprised of generic or descriptive terms. The panel held thatonly the similarity of the marks is considered in the first factor.The panel found that eLegalsupply.com established its prima facie case that Azeras did nothave a legitimate right or interest in the domain name. Azeras failed to presentsufficient evidence to rebut eLegalsupply.com’s prima facie case.The transfer of a domain name is equivalent to a new registration of the domain. Therefore,Azeras could not step into the shoes of the first owner of the domain name and rely on the March 1,2007 registration date for the domain name to potentially avoid a finding of badfaith registration and use. Therefore, the panel found that Azeras registered the domain name after the registration of the ELEGALSUPPLY.COM trademark. This fact, coupledwith the presence of a website with pay-per-click advertising links to competitor websites of eLegalsupply.com,and banner offering the domain name for sale, led the panel to conclude that Azeras hadregistered and used the domain name in bad faith.Because the panel found that the domain name was confusingly similar to the ELEGAL-SUPPLY.COM mark, that Azeras failed to rebut eLegalsupply’s prima facie case regarding Azeras’lack of a legitimate interest in the domain, and that Azeras had registered and used the domain in badfaith, it granted the complaint and ordered the transfer of the domain to eLegalsupply.com.12-171

Chapter 12 – Top Ten Udrp Decisions For 2011-2012D. Novartis AG v. Fresh Look Consulting, LLC, Case No. FA1110001313477(NAF Dec. 6, 2011)In 2004, Novartis AG (Novartis) federally registered the mark FRESHLOOK in connectionwith contact lenses and eye-health information. It also registered the domain name.Fresh Look Consulting, LLC (registrant) was incorporated on October 3, 2011 for the purposeof providing business advisory and consulting services. Four days later, the registrant registeredthe domain name with GoDaddy. On October 31, 2011, the registrantfiled a use-based federal trademark application for FRESH LOOK claiming October 4, 2011 as itsdate of first use and October 13, 2011 as its date of first use in commerce. The registrant disclaimedthe terms CONSULTING, LLC.GoDaddy’s default under-construction page is the “standard under construction” webpage,which it automatically populates with links to other websites that have some relation to the registereddomain name. The registrant of the domain name with a standard under-construction webpage doesnot earn pay-per-click revenue. The registrant was unaware of GoDaddy’s default under-constructionpage and failed to change the under-construction page associated with the domain to the “generic under construction” webpage.The panel found that the domain name was confusingly similarto Novartis’ federally registered FRESHLOOK trademark because the registrant had disclaimedCONSULTING LLC and used the identical FRESH LOOK terms. The panel also found that theregistrant did not have a legitimate interest in the domain name, andhad registered and was using the domain in bad faith.A complainant must make a prima facie case that the registrant does not have a legitimateright or interest in the disputed domain name. After a complainant meets its burden, the burden thenshifts to the registrant to rebut the complainant’s prima facie case. The panel found that Novartismade its prima facie case that the registrant did not have a legitimate right or interest in the domain name by alleging trademark rights in FRESHLOOK and that theregistrant was not commonly known by the FRESH LOOK CONSULTING, LLC name.Other than the articles of incorporation, the registrant did not provide any evidence to demonstratethat it was commonly known by the FRESH LOOK CONSULTING LLC name. The panelwas not persuaded by the registrant’s argument that it was commonly known by the FRESH LOOKCONSULTING LLC name solely because it was its corporate name. The registrant registered the domain name four days after it incorporated, which is a short periodof time.12-172

the IP Book 2012Before any notice of the dispute, demonstrable preparations to use the domain name or aname corresponding to the domain name in connection with a bona fide offering of goods and servicesmay demonstrate a registrant’s legitimate right or interest in a domain name. The registrant’strademark application was filed three days after Novartis filed the complaint, but the registrant hadbeen using the FRESH LOOK mark in commerce prior to Novartis’ filing of the complaint. Nevertheless,the registrant did not submit any evidence of its common law trademark rights.In addition, the panel was persuaded by the fact that the under-construction page associatedwith the website located at the domain name contained links to websitesoffering competing products to Novartis’ FRESHLOOK product. The panel was not persuadedby the fact that the registrant was unaware of GoDaddy’s default under-construction webpage. Overall,the panel found that the registrant failed to present sufficient evidence to rebut Novartis’ primafacie showing that the registrant did not have a legitimate right or interest in the domain name.The panel also relied on the under-construction page to support its finding that the registrantregistered and was using the domain name in bad faith. “Although thewebsites accessed via the Disputed Domains may be operated by domain parking service providers,that activity is legally and practically attributable back to respondent.” Vance Intl., Inc. v. Abend,Case No. 970871 (NAF June 8, 2007). The panel followed the holding in the Abend case finding“[p]resumably, [Registrant] collects click through fees for each Internet user diverted to the linkedsites. Even if the panel finds that the website is merely a parked site not under [Registrant’s] control,that finding does not necessarily inhibit a finding of bad faith registration and use.” According to thepanel, it was irrelevant whether the registrant had any knowledge of GoDaddy’s default settings oractually earned any revenue from the links populated on the standard under-construction webpage.The panel’s finding was irreconcilable with the general legal understanding of what constitutes “badfaith.”Nevertheless, Novartis’ allegation was that the registrant was not known by the domain, notthat the registrant was not well known, and filed the complaint against the registrant on October 28,2011 (i.e., 25 days after the registrant’s incorporation and 24 days after its claimed date of first use).Because the registrant did not present any evidence that it was well known, the panel presumed thatthe respondent could not become well known in such a short period of time.Because the panel concluded that all of the UDRP policy favored Novartis, it granted thecomplaint and ordered the transfer of the domain to Novartis.12-173

Chapter 12 – Top Ten Udrp Decisions For 2011-2012E. Sven Beichler v. Chocri GmbH, Case No. D20111629 (WIPO Nov. 17,2011)Sven Beichler is the owner of a Swiss trademark registration for MY SWISS CHOCO-LATE.CH, and international registration with extensions of protection in the European Union andUnited States for MY SWISS CHOCOLATE.CH & Design. Beichler’s international registrationclaims a priority date of February 9, 2010. In addition to the three trademark registrations, Beichlerowns the domain name.Chocri GmbH (registrant) registered the on November 8, 2010.The registrant used the domain name to forward traffic to where it operated a website that sold goods that were similar to Beichler’s goods. After Beichler sentthe registrant a demand letter, the registrant stopped forwarding traffic from the domain name.The panel found that Beichler did not have trademark rights in the terms MY SWISSCHOCOLATE.CH, and that the registrant had a legitimate interest in the domain name. Because the panel found in favor of the registrant on the first two factors, it did notaddress the bad faith use and registration factor.As a preliminary matter, the panel criticized Beichler for what it found was a deliberateomission of key facts concerning the extent of his trademark rights in the MY SWISS CHOCO-LATE.CH terms. The panel found that Beichler’s trademark registrations included a design componentand that in the international registration with extension of protection into the United States,Beichler disclaimed the words MY SWISS CHOCOLATE.CH. Nevertheless, the panel did not denythe complaint on this basis.PRACTICE TIPDeliberately omitting essential facts from a complaint may create a basisfor the panel to deny the complaint because such an act violates thedeclaration that is part of the complaint.Beichler did not argue that the design elements of his trademark registrations should bedisregarded, or provide any evidence that the terms MY SWISS CHOCOLATE.CH had acquireddistinctiveness. Because it was questionable whether Beichler had any rights in the MY SWISSCHOCOLATE.CH trademark, the panel found that the first factor favored the registrant.12-174

the IP Book 2012In addition, the website operated by the registrant at the domain name alloweda customer to order an individualized piece of chocolate, and the registrant’s website predatedBeichler’s online retail store operated at the domain name. Given the natureof the registrant’s website, the registrant was exploiting the descriptive nature of the MY SWISSCHOCOLATE terms. Therefore, the registrant had a legitimate right or interest in the domain name.The panel denied Beichler’s complaint because it found in the registrant’s favor on the firsttwo UDRP factors.F. InterContinental Hotels Corp. v. Pamirsoft Technologies, No. D20111979(WIPO Dec. 13, 2011)InterContinental Hotels Corporation (InterContinental) asserted United States federal trademarkregistration rights and Afghan trademark registration rights in the mark INTERCONTINEN-TAL since as early as 1969. From 1969 to 1979, a predecessor of InterContinental licensed theINTERCONTINENTAL mark to the Hotel InterContinental Kabul and was associated with the developmentof the hotel in Kabul. The license was terminated in 1979 following the Russian invasionof Afghanistan, and InterContinental had no further association with the hotel of any kind. HotelInterContinental Kabul continued to operate under the INTERCONTINENTAL mark, despite thetermination of the license agreement.Pamirsoft Technologies (Pamirsoft), a company based in Kabul, Afghanistan created thewebsite and registered the domain in 2005. In an odd conclusion andwithout any further investigation, the panel stated that while it was “of the view that Respondent isunlikely to be the operator of the hotel and much more likely to be a website developer...for practicalpurposes [the] term ‘Respondent’ when used in this decision includes the operator of the hotel aswell as the named Respondent.” Id.InterContinental argued that because Pamirsoft’s use of the INTERCONTINENTAL markstemmed from a failure to abide by the license agreement that was terminated in 1979, all subsequentuse was offensive and Pamirsoft should be unable to take the benefit of any use after 1979 underparagraph 4(c)(ii) of the policy. Pamirsoft did not respond to the complaint, giving the panel onlyInterContinental’s arguments to consider.As for the first element of the policy, the panel found Pamirsoft’s domain name to be confusinglysimilar to InterContinental’s trademark, thus satisfying the first element.Regarding the second element of the policy, the panel first noted that the fact that Pamirsoftfailed to respond to the complaint did not automatically result in InterContinental being granted the12-175

Chapter 12 – Top Ten Udrp Decisions For 2011-2012requested remedy. The panel stated that InterContinental must still establish the three elements of thepolicy, although appropriate inferences could be drawn from Pamirsoft’s default.InterContinental put forth what the panel acknowledged to be “on its face a strong case.”InterContinental demonstrated the international reputation of the InterContinental hotel brand; ownershipof an Afghan trademark registration that predated the registration of the domain name; andthe fact that Pamirsoft was using the domain name in connection with services covered by Inter-Continental’s trademark registration without the authority of InterContinental. The panel also notedthat Pamirsoft must at all material times have been aware of the existence of InterContinental and itsinternationally recognized brand.However, even without an argument from Pamirsoft to consider, the panel found, basedon the evidence put forth by InterContinental, that Pamirsoft and its predecessors had been tradingunder and by reference to the name “Hotel InterContinental [in] Kabul” for nearly 40 years, albeitonly having been licensed by the complainant to do so for the first 10 years. Without any furtherexplanation as to why InterContinental had not corresponded with the alleged infringers for the last32 years or made any attempt to enforce its Afghan trademark registration, the panel concluded thatit was unable to make a positive finding that Pamirsoft had no rights or legitimate interests in thedomain name.Because InterContinental could not satisfy the second element of the policy, the panel foundit unnecessary to address the third element. The panel left both parties with a final observation thatthe UDRP complaint was a “relative sideshow,” with the real threat to InterContinental’s brand beingthe continued use of their mark in Kabul without InterContinental’s permission. Sensing that thepanel had not “been given the full story,” the complaint was denied and the parties were advised toresolve their dispute in a court of competent jurisdiction “with appropriate powers to cross-examineand adduce evidence, rather than under a mechanism such as the Policy intended to address a fairlynarrow category of abusive registration and use of domain names.”Practice TipMonitor the actions of your former licensees. Sending cease-and-desistletters can help you preserve your rights in your trademarks.12-176

the IP Book 2012G. The California Milk Processor Board v. Ryan Archer, No. D20111812(WIPO Dec. 9, 2011)The California Milk Processor Board (the Milk Board) is a dairy industry marketing boardestablished by the California Department of Food and Agriculture. The Milk Board promotes theconsumption of milk and is best known for its long-running GOT MILK? campaign, which has beensaid to be one of the 10 best television advertisements of all time and the most culturally influentialtagline since the advent of broadcast television. The Milk Board has several trademark registrationsfor the GOT MILK? mark around the world, including a U.S. registration made on July 4, 1995.Ryan Archer, an individual from Brea, California, registered the domain name on May 28, 2010. The domain name resolved to a website containing the heading “GotBlue Milk?” with the words “Blue Milk” shaded in blue beside a cartoon figure holding a glass ofblue liquid. The website featured many webcomics drawn by Archer, and the webcomics expresslyrefer to “blue milk” as a beverage mentioned in two Star Wars films and several books based on StarWars characters. The “About” page on the website explained that was a parodywebsite created to poke fun at the famous trademark through the fictional Star Wars product, bluemilk.The panel found the domain to be confusingly similar to the MilkBoard’s trademark GOT MILK? based on “sufficient similarity,” thereby satisfying the first elementof the policy.As for the second element of the policy, Archer explained that he was a Star Wars fan andchose the domain name as parody; thus, his use was noncommercial and fair. The panel noted thattrademark law in the United States recognizes a fair-use parody defense “where the allegedly infringingmark cleverly invokes a trademark, but in a manner that consumers are unlikely to believeoriginated with the trademark owner.” However, the panel was unclear whether Archer had succeededin striking that “delicate balance” necessary for parody. The panel eventually decided it was notnecessary to resolve the trademark parody defense issue given its conclusions on the third element.As for the third element, despite the Milk Board’s allegations that Archer sought to misleadInternet users for commercial gain, the panel found no evidence of actual or intended commercialuse of the domain name. While a noncommercial website could conceivably tarnish the reputationassociated with a mark, the panel noted that the website was used by Archer “simply as an outletfor his creative works” that contained no manifestly objectionable content in the domain name orassociated with the website. Finding the Milk Board unable to satisfy the third element, the paneldenied the complaint.12-177

Chapter 12 – Top Ten Udrp Decisions For 2011-2012H. Google Inc. v. Chris Gillespie, No. FA1203001434643 (NAF May 10, 2012)Google Inc. (Google) owns numerous worldwide trademark registrations for the GOOGLEmark. The United States registration issued on January 20, 2004, and the Canadian registration issuedon January 12, 2001.Chris Gillespie, a United States individual, registered 763 domain names that each includedthe GOOGLE mark in its entirety, followed by another noun, including topics, brands, names of persons,or other trademarks. The domain names at issue included those such as ,, , etc. All of the domain names were registered betweenFebruary 29 and March 10, 2012. At one time, the domain names resolved to a domainname, where Gillespie claimed he could efficiently monitor traffic through the domain names. Thedomain names were then altered to resolve to pay-per-click websites, featuring a link at the top ofthe page that asked, “Interested in this domain?”After Google filed the UDRP complaint, Gillespie filed petitions to cancel two of Google’sU.S. trademark registrations based on a claim that the mark GOOGLE had become generic forsearching the Internet. Gillespie asked that the UDRP proceeding be stayed until a decision had beenmade by the Trademark Trial and Appeal Board (TTAB) on the petitions to cancel.The panel found that until the TTAB made a decision on Google’s registrations, Googlestill had rights in its marks under the UDRP (the policy). Even if Gillespie’s petitions were granted,Google still possessed other trademark registrations, such as the Canadian registration, that would besufficient for it to establish rights under the policy. The panel found the domain names to be confusinglysimilar to Google’s mark, thereby satisfying the first element of the policy.As for the second element of the policy, the panel found that Gillespie was not commonlyknown by the disputed domain names, and that Gillespie’s prior use of the domain names did notamount to a bona fide offering of goods or services. While Gillespie claimed that the domain namesresolved to an .xxx TLD site only for monitoring purposes, the panel found that to be evidence ofGillespie’s lack of rights and legitimate interests in the domain names. The panel also noted that thelink at the top of the resolving websites asking, “Interested in this domain?” was a question normallyused in connection with a sales offer and could not be reasonably interpreted in any other way.Finally, the panel found that Gillespie had registered the domain names in bad faith, fulfillingthe third element of the policy. Gillespie’s registration of 763 domain names in such a shortperiod of time was found to be evidence of a pattern of bad faith domain name registration by thepanel. Gillespie’s bad faith was further evidenced by his use of the disputed domain names, particularlyredirecting Internet users to a .xxx domain promoting a soon to come “gay network.” Having12-178

the IP Book 2012established all three elements required under the policy, the panel granted Google’s complaint andordered the transfer of all 763 domain names to Google.I. Ms. Stefani Germanotta v. oranges arecool XD, No. FA1108001403808(NAF Sept. 21, 2011)Stefani Germanotta, also known as Lady Gaga, is the owner of three U.S. trademark registrationsfor the mark LADY GAGA, two having registered on October 13, 2009 and the third registeredon May 17, 2011. Ms. Germanotta began performing under the name Lady Gaga as early asSeptember 1, 2006 and claimed that she established common law rights in the LADY GAGA markat that time.Oranges arecool XD (the respondent) who identified herself as “Miranda” in variousemails, is an individual who registered the domain name on June 20, 2008, shortlyafter Germanotta’s initial debut and prior to the worldwide release of Germanotta’s first single andalbum. The disputed domain name resolved to an unofficial fan site for Germanotta, created by therespondent, containing tour dates, photographs, video clips, a fan blog, biographical informationabout Germanotta, and links to a site regarding the respondent’s services as a web designer and tothe official Lady Gaga site.The panel found that Germanotta’s trademark registrations and common law rights establishedher rights in the LADY GAGA mark, even though the trademarks were registered after theregistration of the disputed domain name and the panel was unable to determine exactly when Germanotta’scommon law rights in the mark had commenced. Having clarified that Germanotta hadestablished rights in the mark, the panel found the domain name to be identical to Germanotta’strademarks.The respondent’s site, an unofficial fan site at the disputed domain name, was found by thepanel to be a bona fide offering of goods or services under the policy as a noncommercial legitimateuse. The panel found that the respondent’s site met the requirements expressed as “View 1” in theWIPO Decision Overview 2.0: “The registrant of an active and noncommercial fan site may haverights and legitimate interests in the domain name that includes the complainant’s trademark. Thesite should actually be in use, clearly distinctive from any official site, and noncommercial in nature.”In addition to meeting those factors, the respondent’s site included many disclaimers alertingInternet users that the site was “unofficial” and a “fansite only, created by and for fans of lady gaga.”The panel found the disclaimers, which were on the website prior to the filing of the complaint, supportedthe conclusion that the respondent had rights and legitimate interests in the domain name.Having been unable to establish the second element of the policy, the panel did not evaluatethe third element and denied Germanotta’s complaint.12-179

Chapter 12 – Top Ten Udrp Decisions For 2011-2012J. Karen Millen Fashions Limited v. Danny Cullen, No. D20111134 (WIPOSept. 24, 2011)Karen Millen Fashions Limited (Millen) is a company incorporated under the laws of Englandand Wales. Millen has established a worldwide reputation for producing high quality women’sclothing. Millen has been using the KAREN MILLEN mark since 1981 and owns trademark registrationsfor the mark around the world.Danny Cullen, an individual residing in Pasadena, California, registered the domain on April 15, 2011. The domain name resolves to a website devoted to thesale of what appeared to be Millen’s products. Millen contended that the products were counterfeitand of poor quality, but was unable to substantiate these claims when asked to provide supportingevidence. Cullen did not respond to the complaint.The panel found that Millen established rights in the trademark KAREN MILLEN and thatthe domain name consisted of the identical trademark followed by nondistinctive words “outletonline,”and the top level domain; thus, the first element of the policy was satisfied.In determining the rights or legitimate interests of Cullen, the panel found that Cullen wasnot licensed by Millen to use the KAREN MILLEN trademark, but the fact that Cullen was notauthorized to use the mark or sell Millen’s products was not enough for an automatic finding thatCullen had no rights or legitimate interests in the domain name. Millen’s conclusion that the goodsoffered by Cullen were counterfeit was not accepted by the panel based on Millen’s argument thatMillen had not supplied Cullen with the goods, licensed its mark to Cullen, or authorized Cullen touse the domain. The panel was particularly unimpressed with Millen’s lack of further investigation,noting that Millen could have obtained one of the products sold on Cullen’s site and validated theproduct as either being genuine or counterfeit. However, Millen failed to do so, and without anysubstantiated evidence of counterfeit goods, the panel refused to assume the worst merely becausethe goods were sold for a lower price.The only consideration the panel was willing to give Millen was whether the site accuratelydisclosed Cullen’s relationship with Millen. A site must not falsely suggest that it is operated bythe trademark owner. In this case, while Cullen’s site contained no explicit disclaimers, the panelfound that the fact that the website included the word “outlet” and contained poor English languagedescriptions on the site, was enough to prevent “most Internet users of average intelligence” frominferring that Cullen’s site was owned or endorsed by Millen.Having been unable to satisfy the second element of the policy, the panel declined to reviewthe third element and denied Millen’s complaint.12-180

the IP Book 2012PRACTICE TIPIf you are going to make a claim about the quality of goods or servicesbeing offered on a site using your trademark, be sure to have evidenceto support your argument.12-181

theIP bookChapter 13the IP Book 2012Social Media:10 Noteworthy Cases in 2011-2012Christopher R. SmithChristopher R. SullivanLindquist & Vennum, P.L.L.P.MinneapolisSocial media comprises a multitude of forms of electronic communication through which userscreate online communities to share information, ideas, messages, locations, pictures, videos, andother content. In the last five years, social media has dominated much of the focus and attention onnew Internet issues and continues to impact the application and practice of the law. Although socialmedia issues are often intricately intertwined with intellectual property concerns, not all social mediacases are directly related to intellectual property. The following cases highlight some of the recentdeveloping issues regarding social media about which all intellectual property practitioners shouldbe aware.§ 13.1 PRIVACY RIGHTS MAY NOT EXTEND TO SOCIAL MEDIAPOSTINGS, EVEN IF DELETED, AND MAY BE SUBJECT TODISCLOSURE BY SUBPOENAIn April of 2012, the New York Criminal Court denied a defendant’s motion to quash a subpoenato obtain several months of the defendant’s deleted Twitter postings related to his participation inthe Occupy Wall Street protests. People v. Harris, 945 N.Y.S.2d 505 (N.Y. Crim. Ct. 2012). Thedefendant, Malcolm Harris, was one of the over 700 people arrested on the Brooklyn Bridge duringan October 1, 2010 march. By issuing the subpoena, prosecutors hoped to obtain specific, up-to-the-13-183

Chapter 13 – Social Mediaminute information about Harris’ location and conduct leading up to the arrests in order to counterHarris’ defense that police either led or escorted him into the roadway of the Brooklyn Bridge, whichled to his arrest. In denying the Twitter user’s request to bar prosecutors from accessing his deletedtweets, the court held that the defendant did not have standing to quash the subpoena, did not havethe right to intervene, and the subpoena was not barred by the protections of the Stored CommunicationsAct, 18 U.S.C. §§ 2701-2711. Central to the court’s decision was Twitter’s terms of service,which state in part:By submitting, posting or displaying Content on or through the Services, you grantus a worldwide, non-exclusive, royalty-free license to use, copy, reproduce, process,adapt, modify, publish, transmit, display and distribute such Content in anyand all media or distribution methods (now known or later developed).(See .)The court determined that this broad grant to Twitter to disclose account content divests theTwitter account holder of any reasonable expectation of privacy or valid interest in nondisclosure:“Twitter’s license to use the defendant’s Tweets means that the Tweets the defendant posted were nothis. The defendant’s inability to preclude Twitter’s use of his Tweets demonstrates a lack of proprietaryinterests in his Tweets.” Harris, 945 N.Y.S.2d at 508.On May 7, 2012, Twitter itself became directly involved in the case by filing its own motion toquash the subpoena, also arguing that Twitter users do have standing to quash subpoenas seeking toobtain user’s content and that the subpoena violated both the Fourth Amendment protection againstunlawful search and seizure and violated the protections provided by the Stored CommunicationsAct and California’s Uniform Act. The battle over the accessibility of Twitter content was then furtherescalated by the filing of briefs from the American Civil Liberties Union, the Electronic FrontierFoundation and Public Citizen, Inc., in support of Twitter’s position that the individual Twitter accountholders, and not Twitter itself, are the owners of their own tweets and thus they are the propertarget for any discovery or subpoena requests. On July 2, 2012, the court denied Twitter’s motionand ordered it to turn over Harris’ messages, noting that, while laws regarding social media are stillevolving, public speech does not enjoy the protections of private speech regardless of the forum:“What you give to the public belongs to the public. What you keep to yourself belongs only to you.”13-184

the IP Book 2012PRACTICE TIPAdvise clients to carefully vet and monitor the posting of all content toany social media account because it may be obtainable as evidence ina court proceeding without any direct recourse to barring its disclosure,even if the postings have been deleted.§ 13.2 EMPLOYEE’S DEVELOPMENT OF SOCIAL MEDIA ACCOUNTs MAYNOT CONFER OWNERSHIPIn another case relating to social media and ownership, which may be one of the first of itskind, the United States District Court for the District of Northern California held that a mobilenews website company sufficiently stated claims for both negligent and intentional interference withprospective economic advantage against a former editor-in-chief, Noah Kravitz, who continued tooperate a Twitter account that used his former company’s name because that account drove traffic tothe company’s website. PhoneDog v. Kravitz, No. C-11-03474 MEJ, 2012 WL 273323 (N.D. Cal.Jan. 30, 2012).According to the company’s allegations, Kravitz began working for the company PhoneDog inApril of 2006 as a product reviewer and video blogger. PhoneDog alleged that Kravitz was givenand maintained the Twitter account “@PhoneDog_Noah” as part of his employment, and Kravitzsubmitted written and video content to PhoneDog, which was then transmitted to its users throughseveral mediums, including the PhoneDog website and Twitter account. Kravitz accessed the Twitteraccount using a password and used the account to inform and promote PhoneDog’s services onbehalf of PhoneDog. According to the company, all of the “@PhoneDog_[Name]” Twitter accountsused by its employees, as well as the passwords to such accounts, constituted proprietary and confidentialinformation. During the course of Kravitz’s employment, the @PhoneDog_Noah accountgenerated approximately 17,000 Twitter followers. When Kravitz ended his employment, PhoneDogrequested that he relinquish use and control of his Twitter account. Kravitz refused, and insteadchanged the account name to “@noahkravitz” and continued to use the account. PhoneDog allegeddamages resulting from this conduct to be at least $340,000.The court upheld the employer’s claims on a motion to dismiss primarily because the employerwas able to properly allege viable economic relationships it had with its website advertisers thatcould have plausibly been harmed as a result of the former employee’s failure to surrender the socialmedia account. This case is presently ongoing, and its outcome will be watched closely by both employersactive in social media and the social media industry itself.13-185

Chapter 13 – Social MediaPRACTICE TIPAdvise clients to retain physical and contractual control of social mediaaccounts used by employees to promote the employer’s business.§ 13.3 EMPLOYER MAY BE BARRED FROM UNAUTHORIZED USEOF EMPLOYEE’S SOCIAL MEDIA ACCOUNTS TO PROMOTEEMPLOYER’S BUSINESSApproaching the issue of social media account ownership from a different direction, the UnitedStates District Court for the Northern District of Illinois held that a company could be liable fordamages for allegedly unauthorized uses of an employee’s social media account to post marketingmessages that promote the company and appear to have been written by the employee. Maremontv. Susan Fredman Design Group, Ltd., No. 10-cv-7811, 2011 WL 6101949 (N.D. Ill. Dec. 7, 2011).The court ruled that the employee, a marketing director for an interior design firm, could proceedwith federal Stored Communications Act and Lanham Act claims for false association against heremployer arising from her co-workers’ unauthorized use of her Facebook and Twitter accounts topromote the employer’s business. False endorsement under the Lanham Act “occurs when a person’sidentity is connected with a product or service in such a way that consumers are likely to be misledabout that person’s sponsorship or approval of the product or service.” Id. at *4.In this case, employee Jill Maremont worked for an interior design firm in Chicago. As part ofher employment, Maremont wrote a blog hosted on her employer’s website and frequently postedboth to Facebook pages and a Twitter account, all of which included Maremont’s picture and, accordingto Maremont, were personal accounts. It was undisputed in the case that Maremont’s socialmedia accounts were not for the benefit of her employer, although one of the Facebook accountsappeared to have been created for the employer. Maremont used Facebook and Twitter posts topromote the employer by linking them to the employer’s blog and website. Maremont entered andstored all account access information, including passwords for her Twitter and Facebook accounts,on the employer’s server by utilizing an employer-owned computer, although the folder in whichthis information was stored was locked, and Maremont did not grant authority to anyone to accessher personal social media accounts.In September 2009, Maremont was seriously injured in an automobile accident, and duringMaremont’s convalescence her employer posted company messages to Maremont’s Facebook pageand Twitter account and wrote posts that claimed to be from Maremont. Among other holdings, thecourt denied the employer’s motion for summary judgment on the Stored Communications Act and13-186

the IP Book 2012Lanham Act claims, finding that a reasonable jury could find those statutes were violated by theemployer’s conduct.PRACTICE TIPAdvise clients to update their social media policies to clearly delineatepersonal versus work-related social media accounts and usage and toavoid both employers and employees crossing the line between thetwo.§ 13.4 SOCIAL MEDIA SITES MAY NOT BE LIABLE FOR PRIVACYVIOLATIONS UNDER THE STORED COMMUNICATIONS ACT ANDOTHER STATUTES VIA THEIR SPONSORED ADVERTISINGThe federal District Court for the District of Northern California dismissed two separate classaction cases against the social media companies Facebook and Zynga arising out of alleged leakageof user data from Facebook to its advertisers. In re Facebook Privacy Litig., No. C-10-02389 JW,2011 WL 6176208 (N.D. Cal. Nov. 22, 2011); In re Zynga Privacy Litigation, No. C-10-04680 (N.D.Cal. Nov. 22, 2011). Facebook is the largest social networking site in the world with nearly 900million users. Zynga is a gaming company that creates Internet browser-based games and operatesa gaming network for users on the Facebook social networking website. In 2011, Zynga reportedlygenerated approximately 12 percent of Facebook’s revenues.The Facebook litigation centered on the plaintiffs’ objections to Facebook’s disclosure to thirdpartyadvertisers of the Facebook usernames of the plaintiffs who had clicked on advertisements onthe website between February 2010 and May 2010. The plaintiffs claimed violations of the StoredCommunications Act, the Electronic Communications Privacy Act, California’s anti-hacking law,and several state laws. The court reaffirmed its prior dismissal of numerous other federal and Californiastate law causes of action, including claims under the federal Wiretap Act, California ComputerData Access and Fraud Act, and breach of contract, and in particular reaffirmed its prior holding thatthe plaintiffs had failed to state a claim under the Stored Communications Act because the statutecontains an exception that allows a service provider to divulge the contents of a communication to,or with the lawful consent of, “an addressee or intended recipient” of the communication. As thecourt explained,If the communications were sent to Defendant, then Defendant was their “addresseeor intended recipient,” and thus was permitted to divulge the communications to13-187

Chapter 13 – Social Mediaadvertisers so long as it had its own “lawful consent” to do so. In the alternative, ifthe communications were sent to advertisers, then the advertisers were the addresseesor intended recipients of those communications, and Defendant was permittedto divulge the communications to them.In re Facebook Privacy Litig., 2011 WL 6176208 at *2. The Zynga litigation was dismissed under asimilar analysis. After the dismissal of the Facebook action, the plaintiffs moved to amend or alterthe judgment, but that motion was denied. The Zynga order for dismissal has been appealed to theNinth Circuit.PRACTICE TIPPlaintiffs who had hoped to seek damages from social networking sitesthat disclose user information to advertisers will likely have a more difficulttime identifying a legal basis for their claims.§ 13.5 SUPREME COURT LEAVES SOCIAL MEDIA STUDENT SPEECHDISPUTES TO THE VARIOUS CIRCUIT COURTSIn January of 2012, the United States Supreme Court denied certiorari and declined to hear threefree speech rights challenges involving comments that students made about administrators or peerson the now waning social media site MySpace. Two of the cases, each out of Pennsylvania, arosefrom counterfeit MySpace profiles created by students in an effort to mock their principals. In eachcase, the students were punished by the schools even though they did not use school resources tocreate the profiles, nor did they create them during school time. The school districts were sued by thestudents on First Amendment grounds, and the Third Circuit Court of Appeals ruled en banc in 2011that the school districts’ authority to police students did not extend to out-of-school speech. Layshockex rel. Layshock v. Hermitage Sch. Dist., 650 F.3d 205 (3d Cir. 2011) (holding a school could notpunish the student merely because his social media speech reached inside the school); J.S. ex rel.Snyder v. Blue Mountain Sch. Dist., 650 F.3d 915 (3d Cir. 2011) (holding the school district couldnot punish the student for social media statements when it occurred outside the school during nonschoolhours). The decisions in these cases appeared to hinge on a lack of—and lack of a reasonableexpectation of—any material and substantial disruption within the schools.The third case the U.S. Supreme Court declined to hear was out of the Fourth Circuit Court ofAppeals, which instead upheld a West Virginia high school’s punishment of a student who createdand invited classmates to a questionable MySpace group the student insisted was designed to bring13-188

the IP Book 2012awareness to sexually-transmitted diseases but was allegedly created to insinuate another student atthe school had a sexually-transmitted disease. The school’s punishment came after the allegedly-targetedstudent’s parents filed a harassment claim with the school. The punished student had received afive-day suspension and a 90-day ban from most school events, including her position as the school’sreigning “Queen of Charm.”The Supreme Court’s decision not to hear these cases indicates the justices are not ready to addressthe impact of social media upon student free speech jurisprudence and, for the time being, willleave this matter to the various circuit courts to sort out.PRACTICE TIPThe power of schools to punish student speech for speech occurringout of school via social media depends heavily upon the growing bodyof case law in the particular circuit in which the speech takes place.§ 13.6 FACEBOOK TAGGING AND MEAN COMMENTS ON INNOCUOUSFAMILY PHOTOS DOES NOT CONSTITUTE HARASSMENTFor many of us, some photo tagging on Facebook may be unwelcome, but does it constituteharassment? The Minnesota Court of Appeals recently took up this question in Olson v. LaBrie, No.A11-558 (Minn. Ct. App. Feb. 13, 2012), where the court examined the intersection of Facebookphoto tagging, harassment, and privacy.In 2010, the plaintiff, Aaron Olson, sought a harassment restraining order to prevent his uncle,defendant Randall LaBrie, from posting photos of Olson on Facebook. Specifically LaBrie postedphotos of family members in individual and group shots. Images of Olson included a photo of himposing in front of a Christmas tree. The photos also included comments, which the district courtcharacterized as mean and disrespectful. Olson asked LaBrie to remove the photos or alter them toerase his image from the pictures. LaBrie removed the tags identifying Olson in the pictures. Despitenot being LaBrie’s friend on Facebook, Olson initially was able to gain access to the images throughhis mother’s account. Later, Olson was able to view the images using a public search.Olson filed a petition for a harassment restraining order on the basis that the photo commentswere veiled threats against Olson’s safety. Olson further claimed the photos and the comments constituteda “hostile tirade” against him and caused him to be frightened for his safety and to restricthis movements in response. At an evidentiary hearing on the matter, the district court dismissed theharassment petition. The district court concluded that although the photo comments were mean and13-189

Chapter 13 – Social Mediadisrespectful, the photos were innocuous family photographs and insufficient to support a claim forharassment.On appeal, Olson argued that the photos and comments violated his privacy and therefore wereharassment. The court noted that Olson had not raised the privacy issue below and therefore declinedto review it on appeal. Nevertheless, the court examined Olson’s argument and concluded that it didnot constitute harassment. Olson contended that by establishing the basis for an invasion of privacyclaim, the requirements for a harassment restraining order were necessarily met. The court of appealsdisagreed. First, Olson’s invasion of privacy claim was based on a claim for false-light publicity, atort not recognized by the Minnesota Supreme Court in Lake v. Wal-Mart Stores, Inc., 582 N.W.2d231 (Minn. 1998). Second, the court found the invasion of privacy claim to be distinct and apartfrom the harassment claim. Having failed to meet the explicit requirements of the harassment statute,Olson’s claim was properly dismissed.In the end, the court of appeals agreed with the district court that innocuous family photos arenot a proper basis for a harassment restraining order. The court further held that even comments thatare mean and disrespectful—when joined with the family photographs—do not satisfy the harassmentstatute’s requirement of having a substantial adverse effect on the safety, security, or privacyof another.§ 13.7 FACEBOOK POST BY PUBLIC EMPLOYEE ON A MATTER OFPUBLIC CONCERN IS PROTECTED SPEECHThe collision between Facebook postings and First Amendment rights seems to be especiallycontentious in the area of public employees critical of elected officials. Like Bland v. Roberts below,the plaintiff in Mattingly v. Milligan, 2011 WL 5184283 (E.D. Ark. Nov. 1, 2011), was an employeein a government office, in this case the Saline County Clerk’s office. Milligan defeated the incumbentclerk in a hotly contested election. Shortly after Milligan assumed office, four of Mattingly’s coworkerswere dismissed from their jobs. Mattingly posted her feelings of sympathy and sadness forthe terminations to her Facebook wall. The post received multiple responses expressing concern forMattingly and outrage at the Milligan’s decision. Milligan became aware of the posting by constituentphone calls and media reports. Milligan terminated Mattingly because of the constituent phonecalls based on her Facebook postings.Milligan moved for summary judgment to dismiss Mattingly’s claim of being discharged fromher employment for exercising her right to free speech. As directed by the Eighth Circuit, the court’sanalysis first looked at whether the speech was on a “matter of public concern.” Next, the court balancedthe employee’s free speech right against the rights of the public employer. The court agreedwith Mattingly that her Facebook postings addressed a matter of public concern. Mattingly had 1,300Facebook friends, many of whom were residents of Saline County. By virtue of having made the13-190

the IP Book 2012Facebook postings regarding her co-workers’ terminations that were visible by so many residents,and by Miligan’s own acknowledgement that Mattingly’s Facebook postings led to her termination,the court was able to conclude that her speech touched on a matter of public concern.Milligan’s arguments to the contrary were unavailing. First, he claimed the speech was too vagueto merit protection. But the constituent phone calls and Milligan himself indicated he understood thenature of the Facebook postings. The court similarly rejected Milligan’s assertion that Mattingly’sspeech had a private motive of eliciting sympathy and emotional support. The court reasoned, however,that even if the speech was to further her private interests, the Facebook postings were madenot as an employee, but as a private citizen. Furthermore, the court denied Milligan’s claim forqualified immunity under the assertion that no reasonable person would have understood Mattingly’sFacebook posting to constitute a matter of public concern. But the responses to Mattingly’s postings,including the phone calls from constituents and Milligan’s reason for terminating Mattingly, clearlysupported the idea that other people had understood Mattingly’s Facebook postings to be a matter ofpublic concern. By this analysis, the court denied Milligan’s motion for summary judgment.§ 13.8 FACEBOOK “LIKES” ARE INSUFFICIENT TO MERITCONSTITUTIONAL PROTECTIONIn Bland v. Roberts, 2012 WL 1428198 (E.D. Va. Apr. 24, 2012), the court examined whetherFacebook “likes” were sufficient speech to sustain a claim under the First Amendment for retaliatorydischarge. The court concluded that simply liking a Facebook page was insufficient to count asspeech entitled to First Amendment protection.Six plaintiffs, including Daniel Ray Carter, Jr. and Robert McCoy, sued the sheriff of the city ofHampton, Virginia, B.J. Roberts, for violating their First Amendment rights of freedom of speechand freedom of association by supporting Roberts’ challenger in an election. After Roberts wasreelected, each of the plaintiffs was dismissed from his or her employment with the sheriff’s officeunder a variety of reasons. Although the content and manner of the speech differed among the plaintiffs,each expressed some form of support for Roberts’ political challenger. On summary judgment,the court considered whether the claimed speech could serve as a basis for a First Amendment claim,as well as qualified and Eleventh Amendment immunity.For its analysis of the plaintiffs’ speech as public employees, the court used a three-prong test,which required determining: (1) whether the public employee was speaking as a citizen on a matterof public concern or as an employee about a personal matter of personal interest, (2) whether thepublic employee’s interest in speaking on the issue outweighed the government’s interest in providingeffective and efficient public services, and (3) whether the employee’s speech was a substantialfactor in the employee’s termination. The court noted that, as a threshold issue, it must determinewhether speech exists before further analysis can proceed.13-191

Chapter 13 – Social MediaFor their part, Carter and McCoy alleged they made statements on Facebook, of which thesheriff was aware, and which led to their termination. In McCoy’s case, he claimed he posted a messageon Roberts’ challenger’s Facebook wall, which he later removed. The content of the message,however, was not before the court. Thus, the evidence of any speech was non-existent. In analyzingCarter’s speech, the court did note that Facebook posts can be protected speech, but in the absenceof evidence as to the content of the post, McCoy’s claim failed the analysis.Carter, on the other hand, alleged two forms of speech. First, he claimed a Facebook messageof support for the rival candidate. Again, failure to produce any evidence regarding the content ofthe message undermined his claim. In the second instance, Carter was able to demonstrate that he“liked” the opposing candidate’s Facebook page. The court reasoned, however, that merely “liking”a Facebook page is insufficient to merit constitutional protection. The court declined to “infer thecontent of Carter’s posts from one click of a button” on the candidate’s Facebook page. In essence,“liking” a page lacked any substance or specificity by which to have it constitute speech.The court acknowledged that in some instances, Facebook postings have constituted speech. Forexample, in Mattingly v. Milligan, supra, the plaintiff’s post was constitutionally protected speechin the form of a comment in support of her co-workers, recently terminated after an election. TheFacebook comment was sufficiently substantive to merit First Amendment protection. Likewise, inGresham v. City of Atlanta, 2012 WL 1600439 (N.D. Ga. May 7, 2012) the plaintiff’s speech regardingthe arrest of a relative of an Atlanta police investigator was also deemed to be “enough speech tobe considered speaking out as a matter of public concern.” Having failed to demonstrate protectablespeech, Carter and McCoy’s claims were dismissed as a matter of law.§ 13.9 DISCOVERY OF AN ENTIRE FACEBOOK PROFILE MUST BEREASONABLY CALCULATED TO LEAD TO THE DISCOVERY OFADMISSIBLE EVIDENCE OR BE DEEMED A “FISHING EXPEDITION”As social media platforms such as Twitter and Facebook become more integrated into the livesof their users, discovery disputes regarding a user’s content and profile information are likely to becomemore common. In one recent example, Tompkins v. Detroit Metropolitan Airport, 278 F.R.D.387 (E.D. Mich. 2012), the court concluded that wholesale access to the plaintiff’s private Facebookaccount exceeded the scope of discovery under the facts presented.The plaintiff, Lela Tomkins, claimed physical injuries as a result of a slip-and-fall at the DetroitMetropolitan Airport. The defendant sought to have the plaintiff sign a release to grant access to herentire Facebook account. When the plaintiff balked at the request, the defendant sought a court ordercompelling the plaintiff to provide access to the account.13-192

the IP Book 2012The court examined the other cases cited by the defendant on the issues of privilege and privacy.The court concluded that even a “private” Facebook page only accessible to a limited number of usersis generally not privileged. Nor, the court reasoned, was it protected by common law or statutoryconcepts of privacy. Instead, the court looked to see whether the defendant had made a thresholdshowing that the publicly available information demonstrated the plaintiff engaging in behaviorlargely inconsistent with the alleged injuries. The court expressed a concern about allowing thedefendant to “rummage at will through information that the Plaintiff has limited from public view.”Such access would amount to “the proverbial fishing expedition.” Indeed, the court noted that grantingaccess to the entire Facebook account would likely give the defendant “voluminous personalinformation” having nothing to do with the case.In this instance, the defendant failed to meet the court’s threshold. One exhibit consisted ofa photograph of the plaintiff standing holding a small dog. The other relevant exhibit showed theplaintiff pushing a shopping cart. In neither instance, however, was the court able to determine theplaintiff was engaged in any activity that would otherwise be barred by her claimed injuries. Becausethe defendant failed to meet the court’s threshold showing of relevance for the plaintiff’s entire Facebookaccount, the court denied the defendant’s request.§ 13.10 JURORS MUST BE WARNED ABOUT THE PROHIBITION AGAINSTUSING SOCIAL MEDIA TO COMMENT ON OR INVESTIGATE TRIALmattersCases involving jurors posting on or referring to social media during the course of a trial arebecoming more common. This problem is perhaps most notable in the area of criminal trials, butit is becoming more prevalent throughout the judicial system. In one recent case, Massachusetts v.Werner, 967 N.E.2d 159 (Mass. App. Ct. 2012), the Appeals Court of Massachusetts conducted anextensive review of the Facebook postings of two jurors to determine if they had been exposed toextraneous influences to a degree entitling the criminal defendant to a new trial.The defendant, Clare Werner, was convicted of stealing approximately $355,000 from her employer.During voir dire, two jurors posted to Facebook regarding the juror selection process andgeneral negative attitudes towards jury duty. The first juror complained about being selected for ajury and received comments from three friends, including one stating, “Throw the book at ‘em.” Thesecond juror, indicating he did not feel impartial, received a response to “Tell the BOY HOWDIE,I KNOW THEM GUILTY ONES!” After complaining about the possible length of the trial—oneweek—the second juror’s wife replied, “Nothing like sticking it to the jury confidentiality clause onFacebook….Anyway, just send her to Framingham quickly so you can be home for dinner on time.”After reviewing the jurors’ Facebook profiles, defense counsel moved for a new trial and soughta subpoena from Facebook. Without waiting for a response from Facebook, the trial court conducted13-193

Chapter 13 – Social Mediaan evidentiary hearing with the two jurors. In both cases, the court concluded that none of the postingscontained extraneous matter, nor were the jurors exposed to extraneous matter via the Internetor Facebook. The court of appeals agreed, finding that the Facebook postings were “general complaintsabout jury service and silly nonspecific responses to those complaints.” The court found theFacebook postings lacked any specific information. The jurors’ testimony that they had not beenexposed to extraneous matter was deemed credible. In the face of “overwhelming evidence” of thedefendant’s guilt, the court of appeals upheld the denial of a new trial.The court of appeals went on, however, to comment on what it saw as the growing problem ofsocial media’s intrusion into the courtroom. The trial court had given a standard prophylactic instructionof not discussing the case or conducting outside research. The court of appeals indicated that“[m]ore explicit instructions about the use of social media and the Internet may be required.” Suchinstructions should explicitly address prohibitions against the use of electronic communications andsocial media. Thus, the court understood that although the outcome was not affected in this instance,more significant measures would be needed in the future to prevent a mistrial.13-194

theIP bookChapter 14the IP Book 2012The Rites of Passage ofthe European RegisteredCommunity DesignsFilip De CorteEurope Cargill Inc.Belgium§ 14.1 Design RightsOn October 20, 2011, the Court of Justice of the European Union (CJEU) delivered its first substantivedecision on EU-wide design law. Since January 1, 2003, the Organization for Harmonizationof the Internal Market (OHIM) has been accepting applications for Registered Community Designs(RCDs). Not long after that date, a Spanish company called Grupo Promer Mon-Graphic SA(Promer) presented—apparently in confidence—its small promotional toys, the so-called “tazos,”to Frito Lay, a PepsiCo subsidiary. These gadgets are often included in food products for children.On February 4, 2004, PepsiCo also applied to register a design for “promotional item[s] for games,”while Promer had an earlier RCD filing for “metal plate[s] for games.” Noticing the conflict, Promerapplied for invalidity of PepsiCo’s RCD, arguing that PepsiCo’s design lacked novelty and individualcharacter under Article 25(1)(b) of the Design Regulation because of Promer’s earlier RCD.Promer also asserted that PepsiCo’s design was “in conflict” with Promer’s prior design under Article25(1)(d); and moreover that PepsiCo had acted in bad faith. The OHIM invalidated PepsiCo’sRCD on the basis that it was “in conflict” with the prior design but it was not persuaded by Promer’sother arguments. Because Promer’s earlier RCD had not been published at the time of PepsiCo’sRCD application, it could not be taken into account as a prior design for the purposes of Article14-195

Chapter 14 – European IP Caselaw Update25(1)(b). Neither could the alleged confidential nature of the disclosure to Frito Lay be invoked as aground since bad faith is not grounds for invalidity of an RCD. PepsiCo appealed the decision andwon at the board of appeal level. Promer then took the case to the general court, which reversedthe decision again, once more invalidating PepsiCo’s RCD. PepsiCo filed an appeal yet again. Thecentral issue of the case was whether PepsiCo’s RCD was in conflict with Promer’s earlier RCD. Toanswer this question, the court of justice assessed whether PepsiCo’s RCD created a different overallimpression on the “informed user,” taking into account the degree of design freedom of the designer.The CJEU duly followed the advocate general’s suggestion by stating that the informed user is notthe “average consumer” of trademark law, nor a “person skilled in the art” of patent law. Rather, theinformed user “can be said to lie somewhere between the two.” Moreover the CJEU continued that[T]he qualifier ‘informed’ suggests that, without being a designer or a technicalexpert, the user knows the various designs which exist in the sector concerned,possesses a certain degree of knowledge with regard to the features which thosedesigns normally include, and, as a result of his interest in the products concerned,shows a relatively high degree of attention when he uses them.PRACTICE TIPComments of the legal community indicate that the CJEU might havefound the right balance, giving community designs a robust scope ofprotection.All parties agreed that the primary comparison should be between the RCD as shown in theregistration, and the prior design (in this case comparing two line drawings), but PepsiCo arguedthat the general court had based its assessment on an examination of PepsiCo’s physical tazos, ratherthan the design drawings in the RCD. In fact, the advocate general had suggested that the comparisonshould be between the RCD as filed and the prior design, but that the physical tazo could beused “only to confirm the findings already made.” Admittedly, it is extremely difficult to determinewhether a physical object is made to the design. In many cases, the physical object will have additionalmaterial that makes it different from the line drawing or photograph in the RCD. However,the CJEU adopted the advocate general’s approach, noting that “since in design matters the personmaking the comparison is an informed user who is different from the ordinary average consumer, itis not mistaken, in the assessment of the overall impression of the designs at issue, to take accountof the goods actually marketed which correspond to those designs” and that14-196

the IP Book 2012the General Court did indeed base its assessments on the designs in conflict asdescribed and reproduced in the respective applications for registration, with theresult that the comparison of the actual goods was used only for illustrative purposesin order to confirm the conclusions already drawn and cannot be regarded asforming the basis of the statement of reasons given in the judgment under appeal.Consequently, the CJEU dismissed PepsiCo’s appeal. The end effect was that PepsiCo’s RCD,filed in 2003, was declared invalid.PRACTICE TIPThe decision affirms the strength of design rights: designers and practitionersshould feel comfortable making use of these valuable intellectualproperty rights, particularly by registering and enforcing new andinnovative designs.§ 14.2 The European Stem Cell DebateOn December 19, 1997, Olivier Brüstle filed a patent application entitled “NEURAL PRECUR-SOR CELLS, METHOD FOR THE PRODUCTION AND USE THEREOF IN NEURAL DEFECTTHERAPY.” It concerned isolated and purified neural precursor cells, processes for their productionfrom embryonic stem cells and the use of neural precursor cells for the treatment of neural defects.The patent was contested by Greenpeace e.v. before the Bundespatentgericht, which came to theconclusion that the patent was invalid. When hearing the appeal, the Bundesgerichtshof decided, inits wisdom, to refer the request for an interpretative ruling to the CJEU. A judgment was deliveredon October 18, 2011.First consider some background. In 1998 the Directive 98/44/EC on the Legal Protection ofBiotechnological Inventions was voted into law after a long debate. The decision at hand focused onArticle 6 of the so-called Biotech Directive, and more specifically paragraph 6(2)(c).Article 6 of the Directive 98/44/EC on the Legal Protection of Biotechnological Inventionsstates:1. Inventions shall be considered unpatentable where their commercial exploitationwould be contrary to ordre public or morality; however, exploitationshall not be deemed to be so contrary merely because it is prohibited by lawor regulation.14-197

Chapter 14 – European IP Caselaw Update2. On the basis of paragraph 1, the following, in particular, shall be consideredunpatentable:…..(c) uses of human embryos for industrial or commercial purposes;….The court started by deducing from the context and the aim of the Directive that the EuropeanUnion legislature intended to exclude any possibility of patentability where respect for human dignitycould thereby be affected. Moreover, the logical consequence of the tenet—according to thecourt—was that the concept of “human embryo” within the meaning of Article 6(2)(c) of the Directivemust be understood in a wide sense. This interpretation led the court to conclude that anyhuman ovum must, as soon as fertilized, be regarded as a “human embryo” within the meaning andfor the purposes of the application of the Directive “since that fertilization is such as to commencethe process of development of a human being.” However, the CJEU did not stop there. With judicialalacrity, it continued on to say that this classification must also apply to a non-fertilized human ovuminto which the cell nucleus from a mature human cell has been transplanted, and a non-fertilizedhuman ovum whose division and further development have been stimulated by parthenogenesis.(Parthenogenesis means reproduction by a male reproductive cell without fertilization.) The CJEUstated that “[a]lthough those organisms have not, strictly speaking been the object of fertilization,due to the effect of the technique used to obtain them they are capable of commencing the processof development of a human being just as an embryo created by fertilization of an ovum can do so.”Interestingly enough, the court ruled that “it is for the referring court to ascertain, in the light ofscientific developments, whether a stem cell obtained from a human embryo at the blastocyst stageconstitutes a ‘human embryo’ within the meaning of Article 6(2)(c) of Directive 98/44.”However, a second question needed to be addressed. This question hinged upon the use of humanembryos for research purposes, to which the judges came to the conclusion that the exclusionfrom patentability concerning the use of embryos for industrial or commercial purposes also covereduse for purposes of scientific research.And the third and final question, concerning the patentability of inventions which would requirethe prior destruction of human embryos or their use as base material, was also answered in the negative.14-198

the IP Book 2012§ 14.3 Goods in TransitA Belgian court (in case C-446/09) and a U.K. court (Nokia) (in Case C-495/09) referred to theCJEU to enlighten the legal community on the question of custom actions against goods suspectedof infringing intellectual property rights. On December 1, 2011, the court rendered judgment in thejoined cases.The background of both cases were the attempts of trademark owners (or intellectual propertyholders in general) to try and seize goods, originating from a non-E.U. country, in transit or stored ina customs warehouse in the European Union.On November 7, 2002, in the port of Antwerp, the Belgian customs authorities inspected a cargoof electric shavers from China resembling designs of shavers developed by Koninklijke PhilipsElectronics NV (Philips). Since those designs were protected by registrations granting exclusiverights to Philips in a number of states, including Belgium, the Belgian customs authorities suspectedthat the goods inspected constituted pirated goods. Accordingly, they suspended release of the goodson the basis of Regulation No. 3295/94. This regulation of December 22, 1994 lays down measuresconcerning the entry into the community and the export and re-export from the community of goodsinfringing certain intellectual property rights. On December 11, 2001, Philips brought an actionagainst Lucheng Meijing Industrial Company Ltd., the Chinese manufacturer, Far East SourcingLtd., the shipper established in Hong Kong, and Röhlig Hong Kong Ltd. and Röhlig Belgium NV,the forwarding agents, before the Court of First Instance in Antwerp. Philips sought a ruling thatthose undertakings had infringed the design rights for the Philips shavers and copyrights held by it.Furthermore, Philips sought an order for those undertakings to pay damages and for the detainedgoods to be destroyed. Far East Sourcing defended themselves by stating that goods cannot firstbe detained and subsequently classified as “goods infringing an intellectual property right” in theabsence of any evidence that these goods would be put on sale in the European Union. The Courtof First Instance decided to refer a question to the CJEU for a preliminary ruling on the question ofwhether indeed the court needed to take into account the temporary storage status/transit status andwhether it needed to apply the legal fiction that the goods were manufactured in an E.U. memberstate and then decide whether those goods infringe the intellectual property right in question.The facts in the Nokia case were a bit different. In this case, Her Majesty’s Commissioners ofRevenue and Customs, in other words British customs, on the suspicion that they were dealing withfakes, sent samples to Nokia of a number of mobile phones and mobile phone accessories comingfrom Hong Kong and destined for Colombia. Customs had taken some samples after an inspectionon London Heathrow Airport in July 2008. These goods bore a sign identical to a community trademarkowned by Nokia. The trademark holder confirmed that the goods were indeed fake and askedBritish customs whether they would be prepared to seize these goods. British customs replied that inview of the fact that the consignment of goods was destined for Colombia and the fact that they had14-199

Chapter 14 – European IP Caselaw Updateno evidence that the goods would be diverted onto the European Union market, they could not detainthe consignment. However, after obtaining the names of the consignor and the consignee, Nokiamade an inquiry as to the identity of the consignor and the consignee and was unable to identifythem, thereafter concluding that these parties must be disguising their true identity. Nokia informedcustoms that it intended to file an application for judicial review of the decision not to seize. Customsreplied that in view of its policy (following the judgment in Case C-281/05, Montex Holdings) thegoods could not be detained in the absence of evidence showing that diversion of goods onto theEuropean Union market was likely. After dismissal of the action by Nokia against British customsby the High Court of Justice of England and Wales, Chancery Division, Nokia appealed. The courtof appeals referred a question to the CJEU.The CJEU considered it appropriate to consider the cases together because both referring courtsasked, in essence, whether goods coming from a non-member state of the European Union whichare imitations of goods protected in the European Union by an intellectual property right (trademark,copyright, a related right of a design) can be classified as “counterfeit goods” or “pirated goods”merely on the basis of the fact that these goods are brought into the customs territory of the EuropeanUnion, without being released for free circulation there.The CJEU re-emphasized that, in line with previous case law, goods placed under a suspensivecustoms procedure cannot, merely by the fact of being so placed, infringe intellectual property rightsapplicable in the European Union. However, those intellectual property rights may be infringed ifduring such a procedure it becomes clear that these goods will be sold, offered for sale or advertisedto European Union consumers. The CJEU went out of its way to recognize the problem of fraudulentdiversion to European Union consumers. And consequently, the CJEU concluded that goods can beconsidered “counterfeit” or “pirated” where it is proven that they are intended to be put on sale inthe European Union, defined as sold to an E.U. customer, offered for sale or advertised to consumersin the E.U., or apparent from documents or correspondence that their diversion to E.U. customers isenvisaged.PRACTICE TIPEven though this decision could be considered to be opening the doorof European ports to global counterfeit trade, the message is not completelydoom and gloom for intellectual property holders. If there is asuspicion that the “in transit” goods are actually intended to end up onthe European market, then the goods can still be detained and infringementproceedings can still follow.14-200

the IP Book 2012§ 14.4 The Red Bull CaseThe company Smart Drinks supplied the Dutch company, Frisdranken Industrie Winters BV,with empty cans bearing various signs such as “Pitbull.” Frisdranken Industrie Winters BV filled thecans with fizzy drinks upon instruction of Smart Drinks Ltd. and after filling, the Dutch companysent the cans back to Smart Drinks. Smart Drinks Ltd. is a legal entity under the law of the BritishVirgin Islands (which is not part of the European Union).The Redbull GmbH, owning the registration for the RED BULL trademark, sued FrisdrankenIndustrie Winters BV in the Netherlands and the case came before the Hoge Raad. The SupremeCourt of the Netherlands referred a question to the CJEU. The court decided that a service providerwho merely fills cans already bearing signs similar to the trademarks under an order from and onthe instructions of another person, and therefore merely executes a technical part of the productionprocess of the final product without having any interest in the external use of those cans and inparticular in the signs thereon, does not itself “use” those signs. Moreover, the filling of cans is not,by its very nature, comparable to a service aimed at promoting the marketing of cans bearing the“Pitbull” sign and that does not imply the creation of a link between such sign and the filling service.The undertaking which carries out the filling is not apparent to the consumers, which excludes anyassociation between its services and the sign. This seems to be a next step in shrinking the trademarkrealm of protection.§ 14.5 Less is MoreSince June 2011, there has only been one G-decision, i.e. a decision taken by the EnlargedBoard of Appeal of the European Patent Office. The issue at hand was one of the Enlarged Board’s“favorite” topics, namely disclaimers. The word “disclaimer” is used in the context of European patentlaw to refer to special limitations in the claim that express what is actually not claimed. These“negative technical features,” as the Board likes to call them, have already been the subject of thedecisions G1/03 and G2/03. In those two cases (actually consolidated into one proceeding), themembers of the board had to consider the allowability of undisclosed disclaimers as they presentspecial problems under Article 123(2), which is the article in the European Patent Convention thatgoverns “added matter,” because often these disclaimers are introduced during the prosecution andconsequently do not have a literal basis in the application as filed. G1/03 and G2/03 tried to clarifyin which cases disclaimers would be allowable. The first situation wherein a disclaimer would beallowable is to restore novelty by delimiting a claim against state of the art under Article 54(3) EPC1973. Article 54(3) stipulates that European patent applications with an earlier filing date can becited for the purposes of novelty against a European patent application of a later date even thoughthe earlier European patent application is not yet published at the filing date of the latter. A disclaimermay also be used to restore novelty by delimiting a claim against a so-called accidental anticipation.14-201

Chapter 14 – European IP Caselaw UpdateAn anticipation is accidental if the document is so unrelated to the claimed invention that a personskilled in the art would never have considered it when making the invention. And finally the thirdpossibility for a disclaimer arises when one disclaims subject matter which, under Articles 52 to 57EPC 1973, is excluded from patentability for non-technical reasons. The underlying idea behind thetwo first situations is that the inventor could not have known this prior art when he or she wrote thepatent application, and consequently, the inventor should be allowed to cut that embodiment out ofthe claim in an almost surgical manner. Actually, there was—until now—no problem recognizedwith “disclosed disclaimers,” i.e. negative technical features that have a literal basis in the patentapplication as filed. Obviously, it was only a matter of time until a fact pattern would come up toquestion this assumed certitude. And indeed, in its decision T 1068/07 of June 25, 2010, a TechnicalBoard of Appeal referred the following question to the Enlarged Board of Appeal: “Does a disclaimerinfringe Article 123(2) EPC if its subject-matter was disclosed as an embodiment of the inventionin the application as filed?”The patent application 98 920 015 (published as WO 98/49346), relates to catalytic DNA moleculescapable of cleaving other nucleic acid sequences of molecules, particularly RNA, in a sitespecificmanner. The first claim defines a catalytic DNA molecule as having a certain structure andfurther defines a first and a second substrate binding site. The claim ends with the wording:Wherein the first substrate binding region does not have the sequence 5’ CTTTG-GTTA 3’ or 5’CTAGTTA 3’, wherein the second substrate binding region doesnot have the sequence 5’TTTTTTCC3’ and wherein the said catalytic DNA moleculedoes not show site-specific endonuclease activity for the sequence: 5’ –GGAAAAAGUAACUAGAGAUGGAAG – 3’ (SEQ ID NO 125).The disclaimer was introduced to try and render the subject-matter of the claim novel over anearlier published patent application WO 96/17086, the content of which was to a large extent identicalto that of the application. Indeed the applicant and the inventor were the same. The specificsequences that are disclaimed were mentioned in the application that is the subject of the appeal, asprototype sequences. So there is a literal basis in the document for the disclaimer. However, theseembodiments were not described in the application as filed as not being part of the invention. Consequently,the examining division was of the opinion that these sequences were not mentioned as being“disclaimed,” rather they seemed to be part of the invention. As the disclosure in prior art could not,by any standard, be labeled as an accidental disclosure, the examining division decided that this is atype of disclaimer that was not allowed.The Enlarged Board of Appeal answered the question referred to it as follows:An amendment to a claim by the introduction of a disclaimer disclaiming from itsubject-matter disclosed in the application as filed infringes Article 123(2) EPC if14-202

the IP Book 2012the subject-matter remaining in the claim after the introduction of the disclaimeris not, be it explicitly or implicitly, directly and unambiguously disclosed to theskilled person using common general knowledge, in the application as filed.Determining whether or not that is the case requires a technical assessment of the overall technicalcircumstances of the individual case under consideration, taking into account the nature andextent of the disclosure in the application as filed, and the nature and extent of the disclaimed subject-matterand its relationship with the subject-matter remaining in the claim after the amendment.PRACTICE TIPDisclaimers will continue to be a treacherous item in European patentprosecution. This decision emphasizes yet again the importance ofgood fall-back positions defined in the patent application as filed.§ 14.6 “Parsley, Sage, Rosemary and Thyme”What is it with the Enlarged Board of Appeal of the European Patent Office and vegetables? Onemight well wonder. Last year the wise men had come to a decision in G2/07, the Brocolli case, whichwas consolidated with G1/08, the Tomato case, and up goes another question, the Tomato II case.In a quite unique situation, the same patent has given rise to two referrals to the Enlarged Board ofAppeal. The questions that are referred to the Enlarged Board of Appeal for decision are:1. Can the exclusion of essentially biological processes for the production of plants inArticle 53(b) EPC have a negative effect on the allowability of a product claim directedto plants or plant material such as a fruit?2. In particular, is a claim directed to plants or plant material other than a plant variety allowableeven if the only method available at the filing date for generating the claimedsubject-matter is an essentially biological process for the production of plants disclosedin the patent application?3. Is it of relevance in the context of questions 1 and 2 that the protection conferred by theproduct claim encompasses the generation of the claimed product by means of an essentiallybiological process for the production of plants excluded as such under Article53(b) EPC?14-203

Chapter 14 – European IP Caselaw Update§ 14.7 GOAAAAAAAAAL !!Meet Karen Murphy. She owns a pub in Southsea, Portsmouth and while her customers emptytheir pints of ale, they can watch the football (soccer) matches on the television screen. So you mightsay, “what is the problem?”However, the Football Association Premier League (FAPL) runs the leading professional football(this is soccer) league competition for football clubs in England. The FAPL also organizes thefilming of the matches and exercises the television broadcasting rights. The images and ambientsound captured at the match are transmitted to a production facility which adds logos, video sequences,on-screen graphics, music and English commentary. The resulting signal is then sent, bysatellite, to broadcasters in other European Union countries. This broadcaster then adds its own logoand possibly some commentary; after compressing and encrypting it is forwarded by satellite to subscribers,who receive the signal using a satellite dish. At the subscriber’s, the signal is then decodedusing a decoder card. Now the landlady from Southsea acquired a Greek decoder card from a Greekbroadcaster at a much lower price than what she would have had to pay in Britain. However, uponinstigation of the FAPL, Murphy was sued and convicted by the Portsmouth Magistrates’ Court.However, Karen Murphy appealed before the High Court of Justice of England and Wales, whichdecided to refer prejudicial questions to the CJEU for some preliminary questions.The CJEU decided that national legislation which prohibits the import, sale or use of foreigndecoder cards is contrary to the freedom to provide services and cannot be justified either in lightof the objective of protecting intellectual property rights or by the objective of encouraging thepublic to attend football stadiums. Moreover a system of exclusive licenses is also contrary to E.U.competition law if the license agreements prohibit the supply of decoder cards to TV viewers whowish to watch the broadcasts outside the member state for which the license is granted. The FAPLcannot claim copyright in the matches themselves, as those sporting events cannot be considered anauthor’s own intellectual creation. This is a remarkable notion that raised some eyebrows because itis accepted that framing a picture or pictures of a soccer game (or anything else for that matter) is acreative activity. However, the PFLA can assert copyright in various works contained in the broadcasts,for instance, the opening video sequence, the Premier League anthem, etc….The CJEU added that even if national law were to confer comparable protection upon sportingevents—which would, in principle, be compatible with E.U. law—a prohibition on using foreign decodercards would go beyond what is necessary to ensure appropriate remuneration for the holders ofthe rights concerned. Hence, Karen Murphy was allowed to use her Greek decoder, however, she hasto get permission from the author to broadcast in a pub those protected works as they were definedby the court, but not for the rest of the broadcast, which is actually the football game and probablythe most interesting part of the broadcast. Although not a complete victory, the valiant English pubowner claimed a winning goal in her match against the Football League!14-204