Characteristics and Outcome of Patients with Influenza A (H1N1 ...

More documents

Recommendations

Info

Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 1H1N1 is susceptible to neuramidinase inhibitorsbut not to M2 inhibitors 6Swine influenza virus (SIV) can betransmitted through droplet and infected fomitis.The symptoms range from fever and anorexia tocoughing, rhinorhea, and gastrointestinal upset.Pneumonia, respiratory failure, and deaths havebeen reported with swine flu infection inhumans; and, as with seasonal influenzaoutbreaks, SIV in humans can worsenunderlying chronic conditions 6 .Warning signs should be watched inpatients with confirmed H1N1 or suspected tobe infected that predict progression to moresevere disease which include shortness ordifficulty of breath, turning blue, bloody orcolored sputum, chest pain, altered mentalstatus, high fever that persists after 3 days, lowblood pressure, recurrence of fever afterimprovement which may indicate secondarypneumonia. In children, danger signs includefast or difficult breathing, lack of alertness,difficulty in waking up and little or no desire toplay 7 .The aim of this work was to describebaseline characteristics, treatment, andprognosis in patients with influenza A (H1N1)admitted to a Saudi hospital and compare ourfindings with similar data published elsewhere.SUBJECTS & METHODSThis study was conducted over 4 months inthe period from September 2009 to January2010, from patients in Chest Department, PrinceAbd El Mohsen General Hospital , MadinahMonawarha .Ninety seven patients wereincluded in the study; (52) males and (45)females. Inclusion criteria consisted of: febrile(> 38°C) acute illness; respiratory symptomsconsistent with cough, sore throat, myalgia orinfluenza-like illness; acute respiratory failurerequiring intensive care unit (ICU) admission;plus microbiologic confirmation of novelinfluenza A (H1N1). Patients were admitted inisolation ward .- According to the regulation of Ministry ofHealth, Kingdom of Saudi Arabia; Anypatient suffered from flu symptoms morethan 3 days ; nasopharyngeal aspirates wereobtained , tested by RT-PCR for H1N1 andstarted ostelemivir treatment and alsocontacts . The continuity of treatment or notwas according to PCR results.- From all patients with flu symptoms; only'confirmed cases' were included in thecurrent study.84- Primary viral pneumonia was defined inpatients presenting during the acute phase ofinfluenza virus illness with acute respiratorydistress and unequivocal alveolaropacification involving two or more lobeswith negative respiratory and blood bacterialcultures.- The ICU admission criteria and treatmentdecisions for all patients were made by theattending physician.- All patients were subjected for:- Medical history taking and clinicalexamination including :1. Demographic data,2. Comorbidities,- Time of illness onset and hospital admission,- Time to first dose of antiviral treatment.- Nasopharyngeal swab specimens werecollected at admission and respiratorysecretions were also obtained in intubatedpatients and put on viral transport media .These specimens were sent to King FahdReferral Hospital for RT-PCR .- Specimens were cultured on Blood,MacConkey's, and Chocolate agars toexclude concomitant bacterial disease.- Blood samples were obtained and subjectedto blood cultures on Bactec 9240 automatedblood culture system to exclude other causesof fever.- Chest radiologic findings at ICU admission.- Intubation and mechanical ventilationrequirements.- Laboratory finding at ICU admission werealso recorded to determine the severity ofillness.- All patients were confirmed by RT-PCR forpandemic H1N1 virus using kits from RocheDiagnostics (Germany) which included:- RNA extraction: 200 ul of binding bufferwas added to 200 ul of samplesupplemented with 4 ul poly A and 50 ulof proteinase K , mixed thoroughly andincubated for 10 min at 72 o C then mixedwith 100 ul binding buffer, transferred tocombined filter and collection tubes ,centrifuged for 35 sec at 8000xg,flowthrough was discarded. 500 ul ofinhibitor removal buffer was added andcentrifuged again for 1 min at 8000xgwith discard of the flowthrough. 450 ul ofwash buffer was added and centrifugedagain 1 min at 8000xg, washed andcentrifuged again, followed by centrifuge10 sec at 13000xg with discard offlowthrough. To elute viral RNA 50 ul ofelution buffer was added and centrifuged
Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 18000xg for 1 min, then RT-PCR wasperformed on viral RNA.- RT: Using transcriptor first strand cDNAsynthesis kit , RNA is reverse transcribedinto single stranded cDNA which can beused directly for subsequent RCR withgene specific primers on conventionalthermal block cycler and real time PCRinstrument . Master mix was prepared byadding 2ul of random hexamer primer,11ul of RNA template then mixture (13ul)incubated at 65 o C for 10 min then placedimmediately in ice. A mixture (7ul) of 4ulof transcriptor reverse trascriptasereaction buffer, 0.5ul of protector RNAseinhibitor, 2ul of deoxynucleotide mix,0.5ul of transcriptor reverse trascriptasewas prepared and mixed with previousmixture of 13ul to make total volume of20 ul . The reaction was centrifuged tocollect liquid in bottom, then incubated10 min at 25 o C followed by 30 min at55 o C. Transcriptor reverse trascriptasewas inactivated by heating at 85 o C for 5min. The reaction was stopped by placingin ice.- The recommended procedure for testingfor the new Influenza A/H1N1 virus is thedetection of the M2 gene for Influenza A.Positive samples are then tested targetingthe specific H1 gene or parallel testing ofboth targets is performed. Theprimer/probe set for detection of InfluenzaA Hemagglutinin HA1 has beenrecommended by the Robert KochInstitute in Berlin, Germany 8. Table (1)shows primers and probes used in PCR.Table 1: Primers and probes for detection of pandemic H1N1 2009 virusAssay and Primer/probe Nucleotide Primer/probe sequence (5 –3 )gene target namelocationHAHAHAHA-359_ForHA-405_RevHA-386_Probe359–381405–424386–403AGCAATTGAGCTCAGTGTCATCATGGGCCATGAACTTGTCTTGFAM-AAAGGTTTGAGATATTCC-BHQ1bM2M2M2M-408-ForM-455_RevM-434_Probe408–432455–485434–450ACAGAAGCTGCTTTTGGTCTAGTGTTGAGACCGATGCTGTGAATCAFAM-TGCCACTTGTGAACAGA-BHQ1- RT-PCR: Master mix was prepared for20 ul capillary tube by adding ; 8.6ulPCR grade water, 2.4ul of MgCl2 , 2ulof fast start master mix and 2ulprimer/probe mix. 5ul of viral RNAsample, positive or negative controlwere dispensed in separate tube with thesame reaction mixture. Mixture weretransferred to the respective of LightCycler ®Capillaries, which werespinned in a microcentrifuge at 700×g(3,000rpm) for 10 sec , and placed intothe Light Cycler ® 2.0 system to startthe PCR program.RESULTSThe current study was conducted on 97patients whom were admitted to hospital due toH1N1 infection .Their age ranged between 12and 75 (mean 34± SD 16.99). Seventy twopatients (74.2%) ranged between 14 and 40years old (mean 25.29 ± 7.98), and 16 patients(16.5%) were less than 52 years old (mean 45 ±4.08). Nine patients (9.3%) were older than 65years old (mean 69 ±3.4). Fifty two patients(53.6%) were males, forty five patients (46.4%)were females, 4 of them were pregnant.All patients included were admitted tohospitals due to flu symptoms more than 3 days,flu symptoms with underlying chronic diseaseor presenting pneumonia. Figure (1) showspercentage of different symptoms in studiedgroup.The most common comorbidities weresmoking (18 patients), lung diseases; mainlybronchial asthma (BA) (11 patients) andexacerbated chronic obstructive lung disease(COPD) (7 patients). Only one patient hadsevere obesity (body mass index > 40). Table(2) shows the comorbidities in the studiedgroup.The average duration of hospital stay wasbetween 5 and 7 days.All patients received initial empiricantibiotic therapy. Most frequent regimens werebeta lactam plus macrolides, In addition twoICU admitted patients received intravenoussteroids.All patients were administered oseltamivir,3 of them were administered higher doseoseltamivir up to 150 mg oral twice a day.85
Page 1: Egyptian Journal of Medical Microbi
Page 5 and 6: Egyptian Journal of Medical Microbi
Page 7 and 8: Egyptian Journal of Medical Microbi
Page 9: Egyptian Journal of Medical Microbi

Characteristics and Outcome of Patients with Influenza A (H1N1 ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?