Characteristics and Outcome of Patients with Influenza A (H1N1 ...

Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 1Characteristics and Outcome of Patients with Influenza A (H1N1)Infection in a Saudi Hospital1 Niveen M. Gad, 2 Zakia Abu-Zahab and 3 Zeinab Zakzouk1 Microbiology and Immunology Department, Faculty of Medicine,Benha University, Egypt. 2 Clinical Pathology and 3 Chest Departments, Faculty ofMedicine for Girls, Al Azhar University, Cairo, EgyptABSTRACTNovel influenza A (H1N1) virus is the pathogen of recent global outbreaks of febrile respiratory infection.Objective: was to describe baseline characteristics, treatment, and outcomes of the majority of patientswith confirmed 2009 influenza A (H1N1). Subjects and methods: Ninety seven patients diagnosed asInfleunza A (H1N1) infection by reverse transcriptase real time PCR (RT-PCR) were analyzed fordemographic data, symptoms and signs, duration of illness, dose and duration of treatment, and clinicaloutcomes. Nasopharyngeal swab or tracheal aspirate were obtained from these patients (52 males and45 females) . Results: Among 95 patients diagnosed as influenza A ( H1N1) ; 74.2% were in age groupfrom 14 to 40. All patients were positive by RT-PCR , all received antivirals and most of them recoveredwithout complications (95/97), with only two complicated. Conclusion: Infleunza A (H1N1) in that Saudihospital was acute respiratory illness which tended to be mild and spread rapidly. Measures is neededfor rapid diagnosis, prevent spreading and effective treatment at the appropriate time.INTRODUCTIONIn April 2009, the first two cases of humaninfection with a novel influenza A (H1N1) viruswere reported in the United States 1 . During thesame period, an outbreak of respiratoryinfection was reported in Mexico 2 . The viruswas found to be an H1N1 virus that wasantigenically and genetically unrelated to humanseasonal influenza viruses and geneticallyrelated to viruses known to circulate in swine 3.Since then it spread all over the world that madethe world health organization (WHO) declaredthe first phase 6 global influenza pandemic ofthe century on June 11, 2009 4 .The reemergence of pandemic influenza hasbeen anticipated since the Hong Kong (H3N2)influenza pandemic of 1968. In recent years,there has been substantial concern that apandemic would involve the novel H5N1 avianflu variant, which has demonstrated an ability tocause severe disease when transmitted tohumans 5 .There are three types of influenza viruses;A, B, and C, belonging to the Orthomyxoviridaefamily of single stranded RNA viruses. Type Aand B are associated with human infection buttype A is associated with more severe ones.Type A viruses are subtyped on the basis of twosurface glycoproteins; hemagglutinin (HA) 16subtypes and neuraminidase (NA) 9 subtypes,which can recombine to create novelcombinations of influenza, which is known asgenetic reassortment. Pigs are susceptible tohuman and avian influenza A viruses; whichmake swine serves as a melting pot to generatednew hybrid viruses 6 .When the seasonal influenza virusesundergo point mutations which modify theirgenomes, it is called antigenic shift. The typicalseasonal influenza viruses exhibit frequent pointmutations that lead to more gradual shifts intheir genomes. This process is known asantigenic drift; and, it is the reason that newinfluenza vaccines must be prepared each year.On the other hand, if there is a reassortment ofthe gene segments leading to the developmentof novel influenza A viruses, it is known asantigenic shift 6 .The novel H1N1 virus has distinctmolecular properties of human, avian, andswine influenza, resulting from antigenic drift,which is the main cause of the seasonalepidemic of swine flu 3 .Live vaccine against influenza was licensedin the United States in 2003, also four antiviralmedications were approved for preventing andtreating influenza. These antivirals include theM2 inhibitors, amantadine (1960’s) andrimantadine (1993), and the newerneuraminidase inhibitors, zanamivir, andoseltamivir (2000). Although the neuraminidaseinhibitors are clinically active against bothinfluenza A and B, the M2 inhibitors are activeonly against influenza A. However, the current83

Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 1H1N1 is susceptible to neuramidinase inhibitorsbut not to M2 inhibitors 6Swine influenza virus (SIV) can betransmitted through droplet and infected fomitis.The symptoms range from fever and anorexia tocoughing, rhinorhea, and gastrointestinal upset.Pneumonia, respiratory failure, and deaths havebeen reported with swine flu infection inhumans; and, as with seasonal influenzaoutbreaks, SIV in humans can worsenunderlying chronic conditions 6 .Warning signs should be watched inpatients with confirmed H1N1 or suspected tobe infected that predict progression to moresevere disease which include shortness ordifficulty of breath, turning blue, bloody orcolored sputum, chest pain, altered mentalstatus, high fever that persists after 3 days, lowblood pressure, recurrence of fever afterimprovement which may indicate secondarypneumonia. In children, danger signs includefast or difficult breathing, lack of alertness,difficulty in waking up and little or no desire toplay 7 .The aim of this work was to describebaseline characteristics, treatment, andprognosis in patients with influenza A (H1N1)admitted to a Saudi hospital and compare ourfindings with similar data published elsewhere.SUBJECTS & METHODSThis study was conducted over 4 months inthe period from September 2009 to January2010, from patients in Chest Department, PrinceAbd El Mohsen General Hospital , MadinahMonawarha .Ninety seven patients wereincluded in the study; (52) males and (45)females. Inclusion criteria consisted of: febrile(> 38°C) acute illness; respiratory symptomsconsistent with cough, sore throat, myalgia orinfluenza-like illness; acute respiratory failurerequiring intensive care unit (ICU) admission;plus microbiologic confirmation of novelinfluenza A (H1N1). Patients were admitted inisolation ward .- According to the regulation of Ministry ofHealth, Kingdom of Saudi Arabia; Anypatient suffered from flu symptoms morethan 3 days ; nasopharyngeal aspirates wereobtained , tested by RT-PCR for H1N1 andstarted ostelemivir treatment and alsocontacts . The continuity of treatment or notwas according to PCR results.- From all patients with flu symptoms; only'confirmed cases' were included in thecurrent study.84- Primary viral pneumonia was defined inpatients presenting during the acute phase ofinfluenza virus illness with acute respiratorydistress and unequivocal alveolaropacification involving two or more lobeswith negative respiratory and blood bacterialcultures.- The ICU admission criteria and treatmentdecisions for all patients were made by theattending physician.- All patients were subjected for:- Medical history taking and clinicalexamination including :1. Demographic data,2. Comorbidities,- Time of illness onset and hospital admission,- Time to first dose of antiviral treatment.- Nasopharyngeal swab specimens werecollected at admission and respiratorysecretions were also obtained in intubatedpatients and put on viral transport media .These specimens were sent to King FahdReferral Hospital for RT-PCR .- Specimens were cultured on Blood,MacConkey's, and Chocolate agars toexclude concomitant bacterial disease.- Blood samples were obtained and subjectedto blood cultures on Bactec 9240 automatedblood culture system to exclude other causesof fever.- Chest radiologic findings at ICU admission.- Intubation and mechanical ventilationrequirements.- Laboratory finding at ICU admission werealso recorded to determine the severity ofillness.- All patients were confirmed by RT-PCR forpandemic H1N1 virus using kits from RocheDiagnostics (Germany) which included:- RNA extraction: 200 ul of binding bufferwas added to 200 ul of samplesupplemented with 4 ul poly A and 50 ulof proteinase K , mixed thoroughly andincubated for 10 min at 72 o C then mixedwith 100 ul binding buffer, transferred tocombined filter and collection tubes ,centrifuged for 35 sec at 8000xg,flowthrough was discarded. 500 ul ofinhibitor removal buffer was added andcentrifuged again for 1 min at 8000xgwith discard of the flowthrough. 450 ul ofwash buffer was added and centrifugedagain 1 min at 8000xg, washed andcentrifuged again, followed by centrifuge10 sec at 13000xg with discard offlowthrough. To elute viral RNA 50 ul ofelution buffer was added and centrifuged

Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 18000xg for 1 min, then RT-PCR wasperformed on viral RNA.- RT: Using transcriptor first strand cDNAsynthesis kit , RNA is reverse transcribedinto single stranded cDNA which can beused directly for subsequent RCR withgene specific primers on conventionalthermal block cycler and real time PCRinstrument . Master mix was prepared byadding 2ul of random hexamer primer,11ul of RNA template then mixture (13ul)incubated at 65 o C for 10 min then placedimmediately in ice. A mixture (7ul) of 4ulof transcriptor reverse trascriptasereaction buffer, 0.5ul of protector RNAseinhibitor, 2ul of deoxynucleotide mix,0.5ul of transcriptor reverse trascriptasewas prepared and mixed with previousmixture of 13ul to make total volume of20 ul . The reaction was centrifuged tocollect liquid in bottom, then incubated10 min at 25 o C followed by 30 min at55 o C. Transcriptor reverse trascriptasewas inactivated by heating at 85 o C for 5min. The reaction was stopped by placingin ice.- The recommended procedure for testingfor the new Influenza A/H1N1 virus is thedetection of the M2 gene for Influenza A.Positive samples are then tested targetingthe specific H1 gene or parallel testing ofboth targets is performed. Theprimer/probe set for detection of InfluenzaA Hemagglutinin HA1 has beenrecommended by the Robert KochInstitute in Berlin, Germany 8. Table (1)shows primers and probes used in PCR.Table 1: Primers and probes for detection of pandemic H1N1 2009 virusAssay and Primer/probe Nucleotide Primer/probe sequence (5 –3 )gene target namelocationHAHAHAHA-359_ForHA-405_RevHA-386_Probe359–381405–424386–403AGCAATTGAGCTCAGTGTCATCATGGGCCATGAACTTGTCTTGFAM-AAAGGTTTGAGATATTCC-BHQ1bM2M2M2M-408-ForM-455_RevM-434_Probe408–432455–485434–450ACAGAAGCTGCTTTTGGTCTAGTGTTGAGACCGATGCTGTGAATCAFAM-TGCCACTTGTGAACAGA-BHQ1- RT-PCR: Master mix was prepared for20 ul capillary tube by adding ; 8.6ulPCR grade water, 2.4ul of MgCl2 , 2ulof fast start master mix and 2ulprimer/probe mix. 5ul of viral RNAsample, positive or negative controlwere dispensed in separate tube with thesame reaction mixture. Mixture weretransferred to the respective of LightCycler ®Capillaries, which werespinned in a microcentrifuge at 700×g(3,000rpm) for 10 sec , and placed intothe Light Cycler ® 2.0 system to startthe PCR program.RESULTSThe current study was conducted on 97patients whom were admitted to hospital due toH1N1 infection .Their age ranged between 12and 75 (mean 34± SD 16.99). Seventy twopatients (74.2%) ranged between 14 and 40years old (mean 25.29 ± 7.98), and 16 patients(16.5%) were less than 52 years old (mean 45 ±4.08). Nine patients (9.3%) were older than 65years old (mean 69 ±3.4). Fifty two patients(53.6%) were males, forty five patients (46.4%)were females, 4 of them were pregnant.All patients included were admitted tohospitals due to flu symptoms more than 3 days,flu symptoms with underlying chronic diseaseor presenting pneumonia. Figure (1) showspercentage of different symptoms in studiedgroup.The most common comorbidities weresmoking (18 patients), lung diseases; mainlybronchial asthma (BA) (11 patients) andexacerbated chronic obstructive lung disease(COPD) (7 patients). Only one patient hadsevere obesity (body mass index > 40). Table(2) shows the comorbidities in the studiedgroup.The average duration of hospital stay wasbetween 5 and 7 days.All patients received initial empiricantibiotic therapy. Most frequent regimens werebeta lactam plus macrolides, In addition twoICU admitted patients received intravenoussteroids.All patients were administered oseltamivir,3 of them were administered higher doseoseltamivir up to 150 mg oral twice a day.85

Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 1Fig. 1: Percentage of signs and symptoms of Infleunza H1N1 in confirmed cases.Table 2: Most common comorbidities ofpatients with pandemic Infleunza H1N1ComorbiditiesNo. ofcases%Number of comorbidities :- Non- 1 comorbidity- >1 comorbidity66201168%20.611.4Type of comorbidity:Smoking 18 18.6%Lung diseases:- BA 112- COPD 27- ARDS 32- Pickwickian syndrome 4 112.4%7.22.11.03Obesity 1 1.03Hypertension 3 3.1Pregnancy 4 4.1Hear diseases :- SVT 5- IHD 6- Rheumatic heart1111.031.031.03Diabetes Mellitus 4 4.1Renal transplant 1 1.03Herpes simplex 1 1.03Allergic Rhinitis 1 1.03Hypothyrodism 2 2.1Cancer 2 2.1Congenital : Down syndrome 1 1.031 Bronchial asthma; 2 Chronic obstructive lungdisease; 3 Acute respiratory distress syndrome4 hypoventilation syndrome;5 supraventriculartachycardia; 6 Ischemic heart diseaseOnly confirmed patients of H1N1 infectionby RT –PCR were included in this study. PCRwas negative in two patients at ICU admission;they were later confirmed to have the infectionthrough further determination of trachealsecretions.All patients in the study were recoveredtotally except 2 who required mechanicalventilation due to viral primary pneumoniawith chest radiograph of bilateral patchyalveolar opacities (predominantly basal) thatprogressed rapidly to affect all lung fields(Acute Respiratory Distress Syndrome) (ARDS)finding.The first patient was female patient, 60years old with COPD, whom complaint startedabout 10 days before admission, this patientdied within 12 hrs. Another 30 years pregnantfemale with BA, who died after 1 month due tomultiorgan failure. Chest computed tomographyscan was performed on this patient and showedairspace consolidation and ground glass opacityin the multilobar and bilateral distribution. Shealso had elevated direct and indirect bilirubin,high creatinine level and high liver enzymes(ALT and AST). For this patient, abdominalultra-sonograghy revealed only congested liverwith normal diameter of common bile duct.An amazing two old women patient, 75years old, with COPD, and ischemic heartdisease (IHD) and who had gastrectomy due toprevious cancer stomach. Another woman 72years with concurrent laryngeal carcinoma.Both recovered without complications.86

Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 1No patient was complicated with secondarybacterial pneumonia or associated withbacteriamia .7 cases of influenza H1N1 were reported innurses due to contact with patientsDISCUSSIONSince 2000, the WHO has promptedcountries to prepare for a potential influenzapandemic. Activities included the introductionof yearly influenza vaccination and a strategicreserve of oseltamivir, antibiotics, andprotective items for health care personnel wasestablished in 2006 9 . Since the emergence of thenovel H1N1 influenza 2009 in mid April, thenumber of confirmed cases has increased tomillions across the world with at least 17000deaths till writing this study 10 .Table 3: Characteristics of 97 patientsconfirmed of H1N1 infleunza virus.VariablesValueAge years (mean ± SD) 34.5± 16.99Male (No. , %) 52 (53.6%)Female (No. , %) 45 (46.4%)Leucopenia (No. , % ) ( 88 , 91% )Less than 3000/mm 3Median number of days (1.5 days ± 0.6)from illness onset toinitiation of antiviral ttt(mean ± SD)No. of patients receiving 97 (100%)antiviral ttt before testingresults available.Duration of oseltamivir tttClinical outcome: (No.,%)CuredDiedTransferredMechanical ventilation(No. , % )- No- YesRange ( 5-10 days)(6 ± 1.8)95 (97.9 %)1 (1.03% )1 (1.03% )95 (97 .9%)2 (2.1%)Most of our patients were young to middleagedand had previously been healthy. Themajority of infections reported have been mild,influenza-like illnesses. This has been reportedin other countries 11,12 .Fever, fatigue and respiratory symptomswere harbingers of disease in almost all cases inthis study and in others 12,13, 14 .The most common comorbidities amongpatients in this study were lung diseases and ahistory of smoking. This agreed with otherstudies 9,12,13 . Also Kumar et al. 12 reported thatamong critically ill patients, obesity has beenshown to be a risk factor for increasedmorbidity, but not consistently with mortality.The association of obesity with severe 2009influenza A (H1N1) infection has been reportedby others 13,14,15 , and may be a novel finding ofthis pandemic.This study has point of strength. It includesboth adults and children from geographicallyand racially diverse settings across MadinahMonawarha region, which improves thegeneralizability of our results to other regions.The tendency of females to develop severe2009 influenza A (H1N1) infection in this seriesis striking. A general female susceptibility hasnot been observed in other influenza case seriesof variable severity including the initial reportsof 2009 influenza A (H1N1) infections 3 . Inmost infectious diseases and related conditionssuch as sepsis and septic shock, males representa larger proportion of cases and have a highermortality 16 . The explanation for increased riskof severe disease and death among females isunclear but the role of pregnancy as a risk factorhas been noted in previous influenzapandemics 17 . In spite of that the 4 pregnantcases in this study recovered completely withoutcomplications, maybe due to the earlyintroduction of antiviral as recommended byWHO 18 .Padilla et al. 9 reported that false negativetest in patients would be more likely if the testwere delayed (as the 2 cases in this study), or ifpatients had limited viral shedding. Theynoticed that patients who tested negative forH1N1 had a milder clinical course than thosewho tested positive but were as much a part ofthe burden of the epidemic as those who werenot tested.Unusual features of severe disease in thecurrent pandemic compared with most previouswell characterized pandemics, including the(probable) H2N2 1890 Russian influenzapandemic, the H2N2 1957 Asian influenzapandemic, and the H3N2 1968 Hong Kongpandemic. In these previous influenzapandemics, an increased predilection forinfection among children and young adults hasbeen documented 19 although mortality curveswere U shaped with increased deaths in the veryyoung and the aged. Data suggested 12,13 thatsevere disease and mortality in the currentoutbreak is concentrated in relatively healthyadolescents and adults between the ages of 10and 60 years, a pattern reminiscent of the W-87

Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 1shaped curve previously seen only during the1918 H1N1 Spanish pandemic 20 . Few patientsolder than 60 years were admitted to the ICU. Apotential biological basis for this observation isthat patients in this age group have a crossreactiveantibody to 2009 influenza A (H1N1) atmuch higher rates than younger patients 21 .(H1N1) 2009 influenza A recorded casefatalityrate of approximately 1% yet this maywell be an overestimate, because testing is nolonger being reported in many regions and evenmany cases expected as mild flu withouttesting 22 . The case-fatality rate in previousinfluenza pandemics has varied widely, and allsuch reports may be inaccurate owing todifficulty in assessing the total number ofcases 23 . The Spanish flu of 1918 (H1N1 ) wasreported as causing 50 million deaths in 500million individuals infected (10% case-fatalityrate), while the Hong Kong flu of 1968-1969caused 33000 deaths among 50 million infected(0.1% case fatality rate) 24 . The case-fatality rateof avian influenza A (H5N1) was initiallyreported to be as high as 60% but is more likelyin the range of 14% to 33% 25 .During the 1918 pandemic, a large numberof deaths were associated with bacterialinfection 26 , but concurrent bacterial infectiondoes not appear to be a major contributingfactor to the severity of illness in our patients,possibly in part because most receivedantibiotics before hospitalization. This goes inhand with 9 . Lung damage was most likely dueto the primary effect of infection with influenzavirus. Possible mechanisms of damage includedirect injury to the respiratory epithelium with asecondary cytokine storm 27 . They alsowondered whether patients, especially thosewho died, had viremia, as was reported inassociation with H5N1 infection, a veryaggressive variety of influenza 28,29 . Coinfectionwith other respiratory viruses could also explainthe increased pathogenicity among patients 30 .Oseltamivir (Tamiflu) and zanamivir(Relenza) reduce viral replication and shedding,and may reduce the risk of more severe illness.Their safety in pregnancy has not beeninvestigated, but without treatment there may bea greater risk of death and premature labour 31,32 .Increasing resistance to oseltamivir has beenreported in other strains of currently circulatinginfluenza A viruses and in H1N1, but, as yet,H1N1 influenza 2009 lineage was not able to betransmitted between patients and almost allcases who developed resistance where inpatients with severe underlying diseases 33 .88WHO new guidelines for use of antiviralsin management of cases recommends thathealthy patients with uncomplicated illness neednot to be treated with antiviral world wide, mostpatients fully recovered without any form ofmedical treatment. Oseltamivir should beadministered to children below 5 years of old,pregnant women and patients with underlyingconditions 18 .In conclusion, most cases of H1N1infection were mild and responded well toantiviral treatment and only minor casesprogressed to cause serious illness and death.Future studies should identify predictive factorsfor severe disease and, especially, theeffectiveness of early treatment and protectionoffered by having influenza vaccination.Immediate strategies for containment havebecome the key factor in preventing the spreadof this virus. Drastic and intense precautionarymeasures are needed to make H1N1 containableand preventable. The role of academies,researchers, educators, media, industry, andinternational agencies is crucial to ensure thatpeople get the right information at the right timeso that the outcome can be positive in this timeof global fear and infectious crisis.REFERENCES1. Centers for Disease Control andPrevention (CDC) 2009. Swine influenzaA (H1N1) infection in two children-Southern California, March-April. MMWRMorb. Mortal Wkly Rep., 58(15): 400-402.2. Centers for Disease Control andPrevention (CDC) 2009. Outbreak ofswine-origin influenza A (H1N1) virusinfection- Mexico, March-April 2009.MMWR Morb Mortal Wkly Rep., 58(17):467-470.3. Dawood, F.S., Jain, S. and Finelli, L.2009. Novel Swine-Origin influenza(H1N1) Virus Investigation Team.Emergence of a novel swine origininfluenza A (H1N1) virus in humans. N.Engl. J. Med., 360(25): 2605-2615.4. Chan, M. 2009. World now at the start of2009 influenza pandemic. http://www.who.int/mediacentre/news/statements/2009/h1n1_pandemic_phase6_20090611/en/index.html.5. Clem, A. and Galwankar, S. 2006. Avianinfluenza: Preparing for a pandemic. J.Assoc. Physicians India, 54: 563-70.6. Galwantar, S. and Clem, A., 2009. Swineinfluenza A (H1N1) strikes a potential for

Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 1global disaster; Journal of Emergencies,Trauma, and Shock, 2: 99-1057. Shun Shin, M., Thompson, M. andHeneghan, C.B.M.J. 2009. Neuramidinaseinhibitors for treatment and prophylaxis ofInfleunza in children: systemic review andmetaanalysis of randomized controlledcontrolled trials. JAMA. 302(17):1872-1879.8. Furuse, Y., Suzuki, A., Kamigaki, T. andOshitani, H. 2009. Evolution of the Mgene of the influenza A virus in differenthost species: large-scale sequence analysis.Virology Journal, 6: 67.9. Padilla, R.P.; Zamboni, D.D.L.; De Leon,S.P.; Hernandez, M., Falconi, F.Q.,Bautista, E., Venegas, A.R., Serrano,J.R., Ormsby, C.E., Corrales, A.,Higuera, A., Mondragon, E. andVillalobos, J.A.C. 2009. Pneumonia andRespiratory Failure from Swine-OriginInfluenza A (H1N1) in Mexico. N. Engl. J.Med. 361, 7.10. World Health Organization 2010. GlobalAlert and Response (GAR). InfluenzaA(H1N1)- update 93. Laboratoryconfirmedcases of new influenza A(H1N1)as officially reported to WHO by StatesParties to the International HealthRegulations (2005).http://www.who.int/csr/don/11. Update, 2009. Infections with a swineorigininfluenza A (H1N1) virus - UnitedStates and other countries, April 28, 2009.MMWR Morb Mortal Wkly Rep. 58: 431-3.12. Kumar, A.; Zarychanski, R. and Pinto,R. 2009. Infection in Canada Critically IllPatients With Influenza A(H1N1). JAMA.302(17):1872-1879.13. Cherit, G.M.; Lapinsky, S.E. andMacias, A.E. 2009. Critically Ill Patientswith 2009 Influenza A (H1N1) in MexicoJAMA. 302(17): 1880-1887(doi: 10.1001/JAMA. 1496).14. Napolitano, L.M., Park, P.J. and Sihler,K.C. 2009. Intensive care patients withsevere novel influenza A (H1N1) virusinfection-Michigan, June 2009. MMWRMorb Mortal Wkly Rep. 58: 1- 4.15. World Health Organization (WHO)2009: Infobase: BMI/ overweight/ obesity.https:// apps.who.int/infobase/.16. Kumar, A., Roberts, D. and Wood, K.E.,2006. Duration of hypotension beforeinitiation of effective antimicrobial therapyis the critical determinant of survival inhuman septic shock. Crit. Care Med., 34(6):1589-1596.17. Beigi R.H., 2007. Pandemic influenza andpregnancy: a call for preparednessplanning. Obstet Gynecol., 109(5): 1193-1196.18. Burch, J. and Stock, C. 2009. Prescriptionof anti influenza drugs for healthy adults: asystemic review and meta analysis. LancetInfect Dis. 3099(09): 70199-9.19. Cunha, B.A. 2004. Influenza: historicalaspects of epidemics and pandemics. Infect.Dis. Clin. North Am., 18(1): 141-155.20. Oxford, J.S. 2000. Influenza A pandemicsof the 20th century with special reference to1918: virology, pathology andepidemiology. Rev. Med. Virol., 10(2):119-133.21. Centers for Disease Control andPrevention (CDC) 2009. Serum crossreactiveantibody response to a novelinfluenzaA (H1N1) virus after vaccinationwith seasonal influenza vaccine. MMWRMorb Mortal Wkly Rep., 58(19): 521-524.22. Global Alert and Response (GAR) 2009.Pandemic (H1N1): World HealthOrganization Web site.http://www.who.int/csr/disease/swineflu/en.23. Fraser, C.; Donnelly, C.A. andCauchemez, W. 2009. WHO RapidPandemic Assessment Collaboration.Pandemic potential of a strain of influenzaA (H1N1): early findings. Science,324(5934): 1557-1561.24. Kerr, J.R., 2009. Swine influenza. J. Clin.Pathol. 62(7): 577 - 578.25. Li, F.C.; Choi, B.C., Sly, T. and Pak,A.W. 2008. Finding the real case-fatalityrate of H5N1 avian influenza. J. Epidemiol.Community Health., 62(6): 555-559.26. Morens, D.M., Taubenberger, J.K. andFauci, A.S. 2008. Predominant role ofbacterial pneumonia as a cause of death inpandemic influenza: implications forpandemic influenza preparedness. J. Infect.Dis., 198: 962-70.27. Ng, W.F., To, K.F., Lam, W.W., Ng, T.K.and Lee, K.C. 2006. The comparativepathology of severe acute respiratorysyndrome and avian influenza A subtypeH5N1- a review. Hum. Pathol., 37: 381-90.28. Hui DS. 2008. Review of clinicalsymptoms and spectrum in humans withinfluenza A/H5N1 infection. Respirology13: Suppl. 1: S10-S13.89

Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 129. Yu, H.; Gao, Z. and Feng, Z., 2008.Clinical characteristics of 26 human casesof highly pathogenic avian influenza A(H5N1) virus infection in China. PLoS One3(8): e2985.30. Merler, S.; Poletti, P.; Ajelli, M.; Caprile,B. and Manfredi, P. 2008. Coinfection cantrigger multiple pandemic waves. J. Theor.Biol., 254: 499-507.31. Cheng, A.C., Dwyer, D.E., Kotsimbos,A.T.C. 2009. ASID/TSANZ guidelines:treatment and prevention of H1N1influenza 09 (human swine influenza) withantiviral agents. Med. J. Aust. 18 Jun.32. Centers for Disease Control andPrevention (CDC) 2009. Novel influenzaA (H1N1) virus infections in three pregnantwomen-United States, April–May 2009.MMWR Morb Mortal Wkly Rep., 58: 497-500.33. World Health Organization (WHO)2010. H1N1 2010 report resistance tooseltamivir- .Rapid development of drugresistance 2009 H1N1 Infleunza reported in2 cases -http://www.who. int/csr/disease/influenza/H1N1.90

Egyptian Journal of Medical Microbiology, January 2010 Vol. 19, No. 1،،الخصائص و الآثار الناجمة في المرضى المصابين بفيروس اتش ١ ان ١في مستشفى سعودي٣٢١د.نيفين جاد د.‏ زآية أبو الذهب و د.‏ زينب زقزوققسم الميكروبيولوجي و المناعة آلية الطب ، جامعة بنها قسم الباثولوجيا الاآلينيكية و قسم الصدريةطب بنات ، جامعة الأزهر،٣٢،١آلية،،:.مقدمة:‏فيروس انفلونزا اتش ١ ان ١ هو المسبب لعدوى الجهاز التنفسي المصاحبة بارتفاع درجة الحرارة الذي انتشر بصورةوبائية أخيراالهدف من هذه الدراسة:‏هو وصف الخصائص الرئيسية للمرض العلاج و الاثار الناجمة عن المرض في المرضى المؤآد اصابتهم بفيروس اتش١ ان . ٢٠٠٩ ١الحالات و طريقة العملتم أخذ مسحة من الأنف أو القصبة الهوائية من المرضى الذين لديهم أعراض انفلونزا من بينهم تم انتقاء فقط المرضى الذينتم التأآد من اصابتهم بفيروس اتش ١ ان ١ بطريقة ال بي سي ارتم دراستهم من حيث الأعراض مدة المرض ، جرعة و مدة العلاج و نتيجة المرض،،.،.(٩٧ مريض ) ٥٢ رجل و ٤٥ أنثى (.النتائج:‏-)---آل الحالات المشمولة بالبحث آانت مؤآدة اصابتهم بفيروس اتش ١ ان ١ بطريقة ال بي سي ار.‏من الحالات آانوا في المرحلة العمرية من ١٤-٤٠ سنة.‏آل المرضى تم علاجهم بمضادات الفيروساتمعظم المرضى ماعدا حالتين تعافوا بدون أي مضاعفاتالاستنتاجفيروس اتش ١ ان ١ يسبب عدوى معتدلة الشدة غالبا في الجهاز التنفسي و لكن ينتشر بسرعة.‏ الاحتياطات واجبة لسرعةالتشخيص و العلاج ومنع انتشار المرض في الوقت المناسب..%٧٤٫٢:91