AGRISAFE FINAL CONFERENCE CLIMATE CHANGE ...

AGRISAFE FINAL CONFERENCE(MARCH 21-23, 2011)CLIMATE CHANGE:CHALLENGES AND OPPORTUNITIESIN AGRICULTURE

Members of the Organising Committee:István LángZoltán BedőErvin BalázsAndreas BörnerOttó VeiszThe papers published in this volume were subjected to peerreviewISBN: 978-963-8351-37-1Published by:Agricultural Research Institute of the Hungarian Academy ofSciences2011Editor:Ottó VeiszNo part of this book can be copied without the written authorisation of the publishersCover design: Attila Vécsy

CLIMATE CHANGE:CHALLENGES AND OPPORTUNITIESIN AGRICULTUREAGRISAFE FINAL CONFERENCEMarch 21-23, 2011, Budapest,Hungary

This publication was funded by the AGRISAFE project(EU-FP7 REGPOT 2007-1 No. 203288).

ContentsINTRODUCTIONClimate change: challenge for training applied plant scientists (The AGRISAFE project)O. VEISZ .......................................................................................................................... 3Climate change in Central Europe: observations and model scenariosL. BOZÓ ........................................................................................................................... 9Agronomy as the science of sustainable food productionJ. R. PORTER ................................................................................................................. 12Agricultural research and biotechnologies: powerful tools in facing global challenges.Experience in Europe and Central AsiaN. ALEXANDROVA ........................................................................................................... 16Climate change and crop production: studies of attribution and adaptation in NorthernBritainP. J. GREGORY ............................................................................................................... 22Maintenance and exploitation of genetic resources for future plant breedingA. BÖRNER, E.K. KHLESTKINA, S. CHEBOTAR, M. NAGEL, M. A. REHMAN-ARIF,K. NEUMANN, B. KOBILJSKI, U. LOHWASSER and M.S. RÖDER .......................................... 26Breeding for improved fusarium head blight resistance in wheatH. BUERSTMAYR ............................................................................................................. 32From gene discovery to complex phenotyping in improving drought adaptationD. DUDITS, J. GYÖRGYEY, É. SÁRVÁRI, B. HOFFMANN, G.V. HORVÁTH, L. SASS, I. VASSand J. PAUK ................................................................................................................... 36Improving abiotic stress tolerance via marker-assisted approachesR. TUBEROSA, M. MACCAFERRI and S. SALVI .................................................................... 44Implications of climate change for water surplus and scarcity and how that affectsagricultural sustainability in HungaryE. J. SADLER, J. M. BAKER and C. RINGLER ..................................................................... 50GENE BANKS AND GENETIC RESOURCESInfluence of hydration conditions upon wheat seed germination after long-term storageO. CHUMYCHKINA and O. RUZHITSKAYA .......................................................................... 59Technological properties of grain and flour in bread wheat lines with introgressions fromAegilops speltoides and Aegilops markgrafIIM.F. ERMAKOVA, A.K. CHISTYAKOVA, L.V. SHCHUKINA, T.A. PSHENICHNIKOVA,E.V. MOROZOVA, A.V. SIMONOV, A. WEIDNER and A. BÖRNER .......................................... 63Screening of Martonvásár wheat breeding materials for dwarfing genes (Rht-B1b and Rht-D1b)G. GULYÁS, Z. BOGLÁR, L. LÁNG, M. RAKSZEGI and Z. BEDŐ ........................................... 67Spanish hulled wheat: a good source of genetic resourcesC. GUZMÁN, L. CABALLERO, L. M. MARTÍN and J. B. ALVAREZ .......................................... 71

Qualitative parameters of oat genotypes in the Slovak avena collectionP. HOZLÁR, D. DVONČOVÁ and M. BIELIKOVÁ ................................................................. 75Screening of Bulgarian wheat varieties and doubled haploid lines for fusarium head blightresistanceG. KOLEV, E. MOLLOVA and G. GANEVA ......................................................................... 78Effect of food source on the biology of the angoumois grain moth Sitotroga cerealellaOlivier (Lepidoptera: Gelechiidae) when feeding on various wheat genotypes (Triticumaestivum L.)L. KOLEVA and G. GANEVA ............................................................................................. 82Increasing the genetic diversity of cereals: develpoment of Triticum turgidum x T.monococcum synthetic hexaploidsM. MEGYERI, P. MIKÓ, I. MOLNÁR and G.KOVÁCS ........................................................... 86Characterization of Triticum timopheevii gene bank accessions to gain useful materials fororganic wheat breedingP. MIKÓ, M. MEGYERI and G. KOVÁCS ............................................................................ 90Production and characterization of wheat-barley introgression linesM. MOLNÁR-LÁNG, É. SZAKÁCS, K. KRUPPA, G. LINC, A. CSEH, I. MOLNÁR, A. FARKAS,S. DULAI, É. DARKÓ and B. HOFFMANN .......................................................................... 94Grain yield and quality traits of local oat genotypesZ. MUT, A. GÜLÜMSER, I. SEZER, H. AKAY, F. ÖNER and Ö.D. ERBAŞ ............................... 98Long-term seed storability in genebank collections – genetic studies in wheatM. A. REHMAN-ARIF, M. NAGEL, U. LOHWASSER and A. BÖRNER .................................... 102Stability of new wheat - Ae. biuncialis addition lines and the selection of Ae. biuncialislength polymorphic wheat SSR markersA. SCHNEIDER and M. MOLNÁR-LÁNG ........................................................................... 106Using maize (Zea mays L.) of Bulgarian local origin as a new source of breeding materialA. SEVOV and V. SEVOV ................................................................................................ 110Development of new wheat/barley translocation lines from cytogenetic materialsproduced in MartonvásárÉ. SZAKÁCS, K. KRUPPA, E. TÜRKÖSI, A. CSEH, I. MOLNÁR and M. MOLNÁR-LÁNG .......... 114Preliminary results on the isolation of polyploid lines from malvaceaeP. SZARVAS, G. KOVÁCS, M. MOLNÁR-LÁNG, M. LÁSZLÓ and M. G. FÁRI ........................ 118Fish characterization of a wheat line carrying leaf rust resistance from T. TimopheeviiA.UHRIN, É. SZAKÁCS, L. LÁNG, Z. BEDŐ and M. MOLNÁR-LÁNG .................................... 122BREEDING TOOLS FOR ABIOTIC STRESS RESISTANCEAssessment of barley breeding germplasm by SSR markers associated with certain QTL’sregarding abiotic stress tolerance and qualityI. ABIČIĆ, A. LALIĆ, S. ŠIMON and I. PEJIĆ ..................................................................... 127Studies on the heat tolerance of a doubled haploid population of microspore originK. BALLA, I. KARSAI, Z. BEDŐ and O. VEISZ ................................................................... 131

Using indirect methods for winter resistance estimation of winter wheat lines and cultivarsM. BATASHOVA, L. DRYZHENKO and V. TISHCHENKO ...................................................... 135Change in crop physiological parameters in a water-deficient environmentS. BENCZE, Z. BAMBERGER, T. JANDA, K. BALLA and O. VEISZ ........................................ 139Effect of herbicides on the chlorophyll content of maize genotypesP. BÓNIS, T. ÁRENDÁS , I. JÓCSÁK, C. MIKECZ,G. MICSKEI and L. C. MARTON ............... 143Rht genes in Ukrainian varieties of bread wheat and their effects on agronomic traitsG. A. CHEBOTAR, S. V. CHEBOTAR, I. I. MOTSNYY, M.P. KULBIDA and YU. M. SIVOLAP .... 147Concept of crop adaptation to the Chernobyl environment based on proteomic dataM. DANCHENKO, K. KLUBICOVA, L. SKULTETY, V. BEREZHNA, N. RASHYDOV andM. HAJDUCH ................................................................................................................ 151Responses of photosynthesis to cold stress in DH maize lines tolerant of oxidative stressE. DARKO, H. AMBRUS, A. SZENZENSTEIN and B. BARNABÁS ........................................... 155Genetic differences in seedling growth under induced water stress, as estimators ofdifferences in osmotic adjustment, in a set of winter wheat (Triticum aestivum L.)cultivarsM. DAVID .................................................................................................................... 159Interaction between cold acclimation, frost tolerance and flower initiation in wheatG. GALIBA, A. VÁGÚJFALVI, I. VASHEGYI, A. SOLTÉSZ, E.J. STOCKINGER,J. DUBCOVSKY and G. KOCSY ........................................................................................ 163Somatic clones of Populus nigra selected and characterized by SSRs, and compared to35S- gshI P. canescens for sulphate uptake capacityG. GYULAI, A. BITTSÁNSZKY, G. GULLNER, GY. HELTAI and T. KŐMÍVES .......................... 167Putative role of cell wall β-d-glucan in oat grain exposed to thermal stressM. HAVRLENTOVÁ, Ľ. DEÁKOVÁ, A. ŽOFAJOVÁ, Š. MASÁR and P. HOZLÁR ....................... 171Evaluation of winter wheat productivity under contrasting environmentsA. IVANOVA, N. TSENOV, D. ATANASSOVA and V. DOCHEV .............................................. 175Effect of drought on grain development in wheatK. JAGER, A. FÁBIÁN, M. RAKSZEGI and B. BARNABÁS .................................................... 179Changes in soybean and wheat yields under non-irrigated conditionsY. KIRKOVA and V. PETROVA ......................................................................................... 183Effect of drought stress on the oil constituents of milk thistle (Silybum marianum Gaertn.cv. Budakalászi)M. MALEKZADE, S.I. MIRMAZLOUM, H. RABI ANGORAN, A. ALIREZALU and P. RADACSI ... 187Improving the frost resistance and adaptability of barley under the conditions of NortheasternBulgariaG. MIHOVA .................................................................................................................. 191Genome-wide association mapping for early and late drought tolerance in a diverse barleycollectionK. NEUMANN, A. F. BÁLINT, F. SZIRA, M. BAUM, R. K. VARSHNEY and A. BÖRNER ........... 195

Reactions of maize inbred lines to the increased UV-B radiation. Climate change as a newchallenge for maize breedersJ. PINTER, I. PÓK, T. JANDA, E. PÁLDI, Z. SZIGETI and C. L. MARTON ............................. 199Genetic variability of spring barley for resistance to drought stress simulated on the scaleof a breeder´s nurseryG. REICHENBERGER, C.C. SCHÖN and M. HERZ ............................................................. 203Comparison of the tolerance and accumulation of Cu and Cd in Phragmites, Salix, andPopulus leavesÉ. SÁRVÁRI, L. GÁSPÁR, Á. SOLTI, A. HAKMAOUI, GY. ZÁRAY, A. GÉMES JUHÁSZ andM. BARON .................................................................................................................... 207Opportunities in breeding for improved stand establishment and seedling vigour in winterwheat (Triticum aestivum L.)G. SERBAN ................................................................................................................... 211EST-based markers associated with QTLs for drought tolerance in barley (Hordeumvulgare) could be used for marker-assisted selectionF. SZIRA, A. BÖRNER, K. NEUMANN, K. Z. NEZHAD, G. GALIBA and A. F. BÁLINT ............. 215Sustainable management of the Devin mineral springE. VALCHEVA, K. STANEVA and V. VANCHEVA ................................................................ 218Calcium dependence of cold regulated genesI. VASHEGYI, Z. TÓTH, E. SEBESTYÉN, V. SOÓS, G. GALIBA and B. TÓTH .......................... 222BREEDING TOOLS FOR BIOTIC STRESS RESISTANCEBiotic and abiotic stress-tolerant plants with elevated antioxidant capacityB. BARNA, A. BITTSÁNSZKY, O. VICZIÁN, L. KIRÁLY, J. FODOR, G. GULLNER, T.KŐMÍVES and Z. KIRÁLY ................................................................................................ 227Monitoring types of the order diptera, pests on vegetable crops - cabbage, onion and garlicY. DIMITROV and N. PALAGACHEVA ............................................................................... 231Tolerance of maize hybrids to European corn borer (Ostrinia nubilalis HBN) in SouthEast RomaniaE. GEORGESCU, L. CANA and C. POPOV ........................................................................ 234Molecular marker-assisted selection in the winter barley breeding program for BYDV(barley yellow dwarf virus) toleranceI. GUINEA, L. VASILESCU and M. CIUCA ........................................................................ 238Impact of climate change on wheat/pathogen interactions and on breeding for hostresistanceM. ITTU, L. CANA and G. ITTU....................................................................................... 242Phenotypic assessment of rice (Oryza sativa L.) genetic resources for abiotic and bioticstress toleranceM. JANCSÓ ................................................................................................................... 246Effect of beneficial bacterial strains isolated from wild plant roots and rhizosphere on theseed germination and plant growth of cultivated cropsÉ. LASLO, É. GYÖRGY, É. TAMÁS, ZS. BODOR and SZ. LÁNYI ............................................ 250

Identification of fusarium head blight pathogens in Hungary using classical methodsE. LÁSZLÓ and O. VEISZ ................................................................................................ 254Agrobacterium-mediated transformation of common wheat (Triticum aestivum L.) usingmature embryosR. MURÍN, L. LÁNG, Z. BEDŐ and K. MÉSZÁROS ............................................................. 258Climate change and plant disease developmentJ. POSTIC, J. COSIC, K. VRANDECIC and V. TADIC .......................................................... 262Ribonuclease activity of uninfected and infected plants of buckwheat varietiesY.R. SINDAROVSKA, O.I. LOZOVA, L.V. YUZVENKO, L.F. DIDENKO and N. YA. SPIVAK ...... 265Influence of fusarium infection on qualitative and quantitative changes in wheat proteinL. ŠTOČKOVÁ, J. BRADOVÁ and J. CHRPOVÁ ................................................................... 269Molecular and traditional approaches for combating major diseases of wheat inMartonvásárG. VIDA, M. CSÉPLŐ, G. GULYÁS, I. KARSAI, T. KISS, J. KOMÁROMI, E. LÁSZLÓ,K. PUSKÁS, Z.L. WANG, Z. BEDŐ, L. LÁNG and O. VEISZ ................................................ 273Properties of buckwheat burn virusL.V. YUZVENKO, O.I. LOZOVA, O.Y. KVASKO, Y.R. SINDAROVSKA, L.F. DIDENKO,N.YA. SPIVAK. and V.L. SHEVCHUK ............................................................................... 277INTERACTION BETWEEN PLANTS AND ENVIRONMENTEvaluation of soil quality indicators for soil contaminated with red sludge in the KolontarareaT. ALSHAAL, É. DOMOKOS-SZABOLCSY, J. KÁTAI, L. MÁRTON and M. FÁRI ...................... 283Phenological and plant morphological traits for oat genotypes under organic andconventional growth conditionsM. BLEIDERE, Z. VICUPE and Z. JANSONE ...................................................................... 287Mitogen-activated protein (MAP) kinase pathways: key players in environmental signaltransduction in plantsR. DÓCZI ..................................................................................................................... 291Variability of yield potential of oats under Slovakian conditionsD. DVONČOVÁ, P. KOVÁČIK and P. HOZLÁR ................................................................... 295Defense response of soybean exposed to cadmium depends on nitrogen supplyI. GOLOVATIUK, B. BÉKÉSIOVÁ, I. MATUŠÍKOVÁ and N. TARAN ........................................ 299Callus induction from mature maize (Zea mays L.) embryos - effect of plant growthregulatorsM. JAKUBEKOVÁ, Ľ. UVÁČKOVÁ, A. PREŤOVÁ and B. OBERT ........................................... 304Effect of cultivar and climate on wheat productivity under different environments inBulgariaK. KOSTOV, G. RACHOVSKA, K. KYZMOVA and Z. YR ...................................................... 308Role of light in the development of freezing tolerance in wheatI. MAJLÁTH, G. SZALAI, V. SOÓS, E. SEBESTYÉN, E. BALÁZS, R. VANKOVÁ, P. DOBREV, I.TARI, J. TANDORI and T. JANDA ..................................................................................... 312

Importance of soil water content to corn (Zea mays L.) production for seedM. MARKOVIĆ, J. ŠOŠTARIĆ, M. JOSIPOVIĆ, H. PLAVŠIĆ and R. TEODOROVIĆ .................. 316Study on the parameters of the yield - irrigation relationship in appleA. MATEV and M. GOSPODINOVA .................................................................................. 320Enzyme polymorphism of seven enzyme systems in maize (Zea mays L.) seedlings underhigh cadmium ions concentrationsP. MÚDRY and B. OBERT .............................................................................................. 324Effects of cadmium and salicylic acid treatment in maizeM. PÁL, T. JANDA and G. SZALAI ................................................................................... 328Assessment of mycoflora on plant residues of winter wheat (Triticum aestivum)M. PASTIRČÁK .............................................................................................................. 332The effect of smoke-derived KAR1 on seed germination and its interplay with theinhibitory compound 3,4,5-trimethylfuran-2(5H)-oneV. SOÓS, E. SEBESTYÉN, A. JUHÁSZ, M. E. LIGHT, L. KOHOUT, M. POSTA, G. SZALAI, J.VAN STADEN and E. BALÁZS .......................................................................................... 336Response of winter wheat genotypes to different environmental conditionsV. SPANIC, G. DREZNER, K. DVOJKOVIC, S. MARIC and V. GUBERAC .............................. 340Effects of genotype and sowing densities on ear yield and shelling percentage of sweetcorn (Zea mays L. var. Saccharata)J. SRDIĆ, M. SIMIĆ, Ž. VIDENOVIĆ, Z. PAJIĆ and V. DRAGIČEVIĆ ................................... 344Pigments, phenolic contents and antioxidant activity of buckwheat seedlings under in vivoand in vitro conditionsO. SYTAR, A.M.M. GABR, I. SMETANSKA and A. KOSYAN ................................................. 348Soaking seeds in salicylic acid may improve the stress tolerance of pea plantsG. SZALAI, I. MAJLÁTH, V. SOÓS, E. BALÁZS, L. POPOVA and T. JANDA ............................ 352Genotype by environment interactions for grain yield of wheat cultivars grown inBulgariaN. TSENOV, D. ATANASOVA and T. GUBATOV .................................................................. 356Effects of water supply and atmospheric CO 2 concentration on the root development ofsorghum and maize plantsB. VARGA and R. MANDERSCHEID ................................................................................. 360Influence of liming and mineral fertilization on soil chemical properties and on the grainand straw yield of winter wheatV. ZEBEC, D. RASTIJA, Z. LONČARIĆ, Z. SEMIALJAC and M. MARTIĆ ................................ 364CROP PRODUCTION FOR SUISTAINABLE AGRICULTUREIdentification of loci affecting grain micronutrient content in cereals using associationmappingA. F. BÁLINT, F. SZIRA and A. BÖRNER .......................................................................... 371Long-term effect of crop production factors on maize productivity in different yearsZ. BERZSENYI, T. ÁRENDÁS, P. BÓNIS and GY. MICSKEI .................................................. 374

Influence of agrometeorological conditions on phonological development of two weeds,common amaranth (Amaranthus retroflexus L.) and (Amaranthus hybridus L.)M. DIMITROVA, C. MOSKOVA and K. KOUZMOVA ........................................................... 378Example of sustainable crop processing, providing mitigationÉ. ERDÉLYI and D. BOKSAI ........................................................................................... 382Potential role of chitinases in the process of somatic embryogenesis of Pinus nigra Arn.L. FRÁTEROVÁ, I. MATUŠÍKOVÁ, J. SALAJ and T. SALAJ ................................................... 386Protein, fat and starch contents of spring and winter oat (Avena sativa L.) cultivars inCentral Southern BulgariaT. GEORGIEVA and P. ZOROVSKI ................................................................................... 390Research on the organic and mineral nitrogen fertilization of winter wheat on forestreddish-brown soil on the Romanian PlainŞ. GIGEL ...................................................................................................................... 394Preliminary results from a comparative trial on French bean grown under organic andconventional cultivation conditionsA. GYÖRGYINÉ KOVÁCS ................................................................................................ 398Sustainable wheat production in a changing climateN. HARNOS and É. ERDÉLYI .......................................................................................... 402Increasing biogas yield per unit area using a new type of silage maize hybridsZ. HEGYI, Z. TÓTHNÉ-ZSUBORI, J. PINTÉR and L. C. MARTON ......................................... 406Sustainable farming on a sandy soilI. HENZSEL ................................................................................................................... 410Organic agriculture in Bulgaria - current status, prospects and constraints to its furtherdevelopmentA. KAROVA ................................................................................................................... 414Testing of wheat productivity using digital imageryT. KAZANTSEV and I. PANAS .......................................................................................... 418Agronomic performance of durum wheat varieties grown in the Thrace region, as afunction of the nitrogen fertilization levelH. KIRCHEV ................................................................................................................. 422Derivative vegetation indices for monitoring of wheat crops: possibilities and limitationsK. KUZNETSOVA and T. KAZANTSEV ............................................................................... 426Research on the productivity and quality of forage pea varieties treated with growthregulatorsN. MINEV, HR. YANCHEVA and N. POPOV ...................................................................... 430Influence of algae-rhizobium inoculation on the nutritional value of Glycine max L. Merr.O. V. PATSKO, V. A. TRETYAKOV, N. Y. TARAN, N. A. VOROBEY and S.Y. KOTS ................ 434Changes in soybean and wheat yields under optimal irrigationV. PETROVA and Y. KIRKOVA ......................................................................................... 438Estimate and use of land in the village of Samuilovo, Sliven regionR. POPOVA and E. VALCHEVA........................................................................................ 442

Evolution of the field crops production in RomaniaG.V.ROMAN, L. I. EPURE, V. ION and M. TOADER .......................................................... 446Influence of environmental factors on soil genesis in an area corresponding to the EastBucharest Plain, RomaniaC. STEFAN and G. BELENIUC ......................................................................................... 450Use of an infrared thermometer to investigate soil and plant water regimesG. STOIMENOV, Y. KIRKOVA and I. POUSHKAROV ........................................................... 454Negative influence of economically important weeds on cottonD. STOYCHEV, M. DIMITROVA and D. DIMOVA ............................................................... 458Natural alternative soil fertilization: analysis of the plant growth-promoting activity ofselected soil bacteriaÉ. TAMÁS, G. MARA, É. LASLO, É. GYÖRGY, L. KÉMENES and S. LÁNYI ............................ 462Chemical composition and yield quality of pseudocereals under Romanian agricultureconditionsM. TOADER and G.V. ROMAN ........................................................................................ 466Saving land resources by increasing digestible dry matter yield per hectareZ. TÓTHNÉ ZSUBORI and C. L. MARTON ......................................................................... 469Stress-related variation in SOD and POX isozyme patterns associated with in vitroandrogenesis in maize (Zea mays L.) and barley (Hordeum vulgare L.)Ľ. UVÁČKOVÁ, T. TAKÁČ, B.OBERT and A. PREŤOVÁ ...................................................... 473Analysis of the conditions required for flax regeneration in vitro via anther cultureZ. ZÁČKOVÁ, B. OBERT and A. PREŤOVÁ ........................................................................ 477Essential amino acid contents of winter and spring oat cultivars (Avena sativa L.) grownin Central South BulgariaP. ZOROVSKI and T. GEORGIEVA ................................................................................... 481

INTRODUCTION

Budapest, Hungary, 2011AGRISAFECLIMATE CHANGE: CHALLENGE FOR TRAINING APPLIEDPLANT SCIENTISTS (THE AGRISAFE PROJECT)O. VEISZAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, HungaryE-mail: veiszo@mail.mgki.huAbstract Agriculture is one of the economic sectors most susceptible to climate change. The success of cropproduction has a fundamental influence on food security, so the elimination or mitigation of losses caused byclimate change is a strategic aim. Basic and applied research on the predicted effects of climate change, usingthe facilities available in one of the largest phytotrons in Europe, has been underway in the AgriculturalResearch Institute of the Hungarian Academy of Sciences (ARI HAS) for almost 20 years. A grant from theEU FP7-REGPOT-2007-1 programme has transformed the institute into a training and research centre for theCentral European region, charged with training scientists, breeders, innovation experts and farmers fromHungary and abroad (primarily from EU countries) to prepare for the consequences of climate change.Key words: research potential improvement, agriculture, plant production, climate change, weather extremesIntroductionThe last century was marked by increases in the atmospheric CO 2 concentration andmean temperature of the Earth, a thinning of the polar ice cap and a rise in the sea level.The cost incurred each year due to increasingly frequent climate anomalies can now bemeasured in billions of dollars. Numerous factors involved in climate change have aninfluence on agriculture, especially plant production. Higher mean temperaturesaccelerate plant development, resulting in a shorter vegetation period and smaller yields.Although the increase in the atmospheric CO 2 concentration has an indirect negativeinfluence due to the greenhouse effect, it also stimulates biomass accumulation, thusincreasing yields.The more intensive temperature increase in the Carpathian Basin, the decrease insummer precipitation (Bartholy and Pongrácz, 2008; Mika, 1991) and the decliningwater reserves make the Hungarian climate prone to drought (Huszár et al., 1999). Onedirect consequence of the increasing CO 2 concentration is that the assimilation rate ofplants is more intense (Wolf, 1996). Elevated CO 2 levels increase both the above-groundand below-ground biomass. The two impacts may interact, as higher carbon dioxidelevels aggravate the negative effect of drought on quantitative yield parameters (Benczeet al., 2007). Different varieties have different levels of adaptability which will make itpossible to select genotypes which can be grown successfully even under changedconditions (Veisz et al., 2005).The weather extremes most frequently experienced in Central and Eastern Europe are verylow or high temperatures, and a deficiency or excess of precipitation. These weatherfactors fluctuate to a greater extent in this region than in Western Europe. Yield losses ofup to 20%, accompanied by a general decline in the stability of ecosystems, are predictedover considerable areas of Europe.Food security is one of the most important components of adaptation to global climatechange, so the training of both scientists and farmers in this field is of major importance.New biological materials and production systems that will be viable under the changedcircumstances must also be developed.Research and training concept of the projectIn Eastern Central Europe, where 28 years out of 100 are dry, and where drought,3

AGRISAFE Budapest, Hungary, 2011flooding and frost damage may all occur in the same year, predicted rises in temperatureare a sharp threat to food safety both in individual countries and on an internationalscale. Adaptation strategies will require complex solutions, involving plant varietiesand production technologies, insurance and relief payments, the costs of which must beshared by farmers, the state and society.Countries with grain surpluses are at an advantage compared with regions faced withstarvation. It is thus extremely important to train experts in the whole of theresearch/development/application innovation chain to create new biologicalmaterials and technologies adapted to new circumstances. As part of the adaptationstrategy, changes in consumer habits should be promoted not only in the interests ofhealthier nutrition, but also regarding their effect on production, energy consumption andemissions.Aspects of climate change currently being investigated at ARI HAS in MartonvásárDetermination of stress tolerance using the tools of cell biology, molecular geneticsand functional genomicsThe primary aim is to identify the genetic factors or genes responsible for stresstolerance, followed by the determination of the natural variability present in stresstolerance genes in cultivated varieties and wild species, and the effect of gene variantson plant traits. Favourable variants can then be utilised in breeding for stress tolerance.Agro-ecological researchThis includes elements of environment protection which, directly or indirectly, contributeto the stabilisation of agricultural production and to the spread of environment-friendlyproduction techniques. The breeding and cultivation of new plant varieties has a directeffect on around two-thirds of the total arable area of Hungary. The work carried out inARI HAS on agro-ecology and production technologies and the answers given to questionsinvolving sustainable agriculture will allow an optimum relationship to be achievedbetween agriculture and the environment even under altered climatic conditions.Long-term experiments on crop productionThese experiments, underway for more than 50 years, can be regarded as fieldlaboratories for the investigation of changes in biotic and abiotic factors and of the longtermenvironmental effects of production technologies, for the measurement of thestability of production technologies, and for an analysis of year effects and genotype ×environment interactions.Phytotron researchMany projects now study how the probable effects of global climate change and climateextremes are correlated with the growth and development of plants, their chemicalquality, and the level of abiotic and biotic resistance. The consequences of the changespredicted for the Central European region, including a rise in the atmospheric CO 2concentration, an increase in mean temperature, greater frequency of days withextremely high temperatures (heat shock) and a reduction in rainfall quantities, areinvestigated first separately and then in combination. The results of agro-ecologicalresearch, studies on the effects of climate extremes, and the environment protectionaspects of crop production are given priority in the breeding of new varieties.4

Budapest, Hungary, 2011AGRISAFEBreeding of field cropsThe wheat varieties bred in ARI HAS include genotypes with excellent frost and droughttolerance, capable of producing significantly above-average yields even in years withextremely cold winters or deficient rainfall, while many of the maize hybrids have gooddrought tolerance. The continuous breeding of such varieties is essential to avoiddamage caused by climate change and to ensure secure food supplies. This will require abroad spectrum of basic research, the investigation of abiotic stress factors, and technicaldevelopments to facilitate breeding. Improvements in genetic variability and adaptabilitywill only be possible through international cooperation.Plant protectionThe pathogen and pest pressure caused by intensive production is a constant challenge, whichcan only be answered by breeding resistant varieties using both conventional andbiotechnological methods. As the result of global warming, the mass appearance of aggressivenew plant pathogens, pests and weeds can also be expected in some regions, so the study ofresistance to pathogens and pests will acquire greater importance and more emphasis will beplaced on the breeding of resistant varieties, which can be cultivated to achieve biologicalenvironment protection using cost-saving production technologies.General aims of the programmeThe international recognition and accumulated know-how of the Martonvásár institute,situated in the middle of the Carpathian Basin, allow it to act as a regional Research,Training and Service Centre providing practical assistance to farmers in Central andEastern Europe in overcoming the unfavourable effects of climate change. By means ofstrategic partnerships based on existing international cooperation, the research potentialhas been expanded by sending young research staff to gain experience abroad, whileinviting colleagues with special methodological knowledge to work in ARI HAS.ARI HAS has one of the biggest phytotrons in Europe, with 50 plant growth units idealfor the simulation of global climate change. In other areas the infrastructure was less upto-date,so the project involved the purchase of equipment suitable for research on theeffect of environmental stress factors.The institute was one of the first in the country to establish spin-off companies for theutilisation of the research results. Regular contact is maintained with numerousknowledge-centred agricultural concerns, helping to satisfy the constant demands ofgrowers for adaptable varieties and for production technologies better suited to changedenvironmental conditions.The training sessions held as part of the project, the publication of new research resultsthroughout Europe and the wise exploitation of research contacts (including twinning)has enabled the research teams at ARI HAS to become better integrated in Europeanresearch, thus strengthening international cooperation.Developments achieved within the framework of the five work programmesWP1: Exchange of know-how and experience by developing strategic partnerships(including twinning) with well-established research teams in the European UnionWithin the framework of this programme, 19 young scientists from ARI HAS spent 3 or6 months in various research centres in Europe learning new research methods whichthey now employ in ARI HAS, while 6 young and experienced scientists from EU5

AGRISAFE Budapest, Hungary, 2011countries institutes visited ARI HAS.WP2: Recruitment of experienced researchers working in the field of environmentalstressesBalázs Tóth PhD returned from the USA in 2008 and rejoined ARI HAS to work on theanalysis of various lipid classes playing a crucial role in environmental stress tolerance(especially cold and drought stress) in cereals.Gergely Gulyás PhD, who did a doctoral course at Tokyo University of Agriculture andTechnology (TUAT), Japan, now works in ARI HAS on the identification of wheat genesrelated to adaptability or to tolerance of biotic or abiotic stresses.Robert Dóczi PhD was a postdoctoral fellow in Prof. Heribert Hirt’s lab at Max F.Perutz Laboratories, Vienna Biocenter, Austria before obtaining a Marie Curie Intra-European Mobility Fellowship from the European Commission to join Prof. LaszloBogre’s lab at Royal Holloway, University of London. He is now studying the role ofMAP kinase pathways in connecting environmental signals to developmental regulation.Mariyana Stamova Georgieva, from the Department of Molecular Genetics, Instituteof Genetics, Bulgarian Academy of Sciences, Sofia, spent 6 months in Martonvásár in2009 learning fluorescent in situ hybridization (FISH) techniques.WP3: Development of research and other equipment for training courses onenvironmental stress research connected with global climate changeA meteorological station has been established for the collection and analysis of localdata on meteorological changes. A fully-equipped, air-conditioned, audiovisual lectureroom seating 40 people has been constructed and installed in the phytotron building foruse by the training sessions. Equipment has been purchased for the determination ofstress tolerance in cereals, for the molecular genetic analysis of plant stress responses,for analysing the effect of drought on leaf area and photosynthesis intensity and forprocessing the data of field experiments. The bioinformatics basis for the tasksundertaken in the project has been improved by constructing multiprocessor workstations, linked in a cluster.WP4: Organisation of training courses and a conference related to climate changefor researchers, breeders, crop producers and managersThe first course, entitled “Facts and Fictions” was held on 27–31 October 2008. Theparticipants heard 16 comprehensive lectures from leading European scientists and tookpart in methodological and technical demonstrations at the National MeteorologicalService. The training course was attended by 23 young scientists from Romania,Ukraine, Czech Republic, Slovakia, Latvia and various Hungarian universities andresearch institutes. A work meeting of FAO experts was held concurrently with thesymposium as a one-day satellite event to acquaint the young scientists with FAOefforts in this field.The second training course “Biotic and Abiotic Stresses” was held on 23–27 March2009. The participants heard 15 lectures on general and specific questions related toplant stress. Twenty-five participants from Romania, Bulgaria, Slovenia, Ukraine,Slovakia, Czech Republic and various Hungarian institutions attended the course. Due tothe success of the satellite FAO meeting at the first symposium a similar event wasorganised at the second symposium.The third training course “Impact of Climate Change on Crop Production” was held on7–11 September 2009. The course was attended by 27 young scientists from 7 EU and6

Budapest, Hungary, 2011AGRISAFE1 non-EU countries. The value of the training session was greatly enhanced by trips toview long-term experiments in Debrecen and Keszthely.The fourth Symposium and Training Course was organised from 12–16 April 2010 andwas entitled “Challenge for Plant Breeding and the Biotech Response”. The growingreputation of these courses was demonstrated by the fact that 60 young scientists appliedto attend the course. The organisers therefore decided to increase the budget to allow 37young scientists from various Hungarian institutes and universities and from 5 EU and 1non-EU countries to participate.The fifth training course “Genetic Resources for High Added Value Plant Breeding”was attended by 28 young scientists from 7 EU and 3 non-EU countries. The value ofthe training session was greatly enhanced by trips to view the research facilities ofCereal Research Ltd. in Szeged.WP5: Dissemination and promotional activities related to climate change inagricultureList of scientific publications: 28 publications in scientific journals, 34 book chapters,14 conference abstracts.List of non-scientific publications: 18 publications in non-scientific journals.Publications intended for university students, lecturers and PhD students:1. Növényvédelem 2009. 45: 629-720. Agroinform Kiadó, Budapest.2. Importance of long-term experiments in the development of crop production,Martonvásár, October 15, 2009.3. Acta Agronomica Hungarica Supplementum 2010. Akadémiai Kiadó,Budapest. 130 p.The issues of the journal MartonVásár published with funds from the project (2009/1,2009/2, 2010/1 and 2010/2) gave detailed information on events related to theAGRISAFE project and on the results of research on global climate change. Thescientific papers and book chapters written with the support of the project are listed onthe website (www.agrisafe.eu).Information sheets (9000 copies) and marketing materials (24000 copies/project year)were published to provide knowledge of direct use to specialists working in small andmedium-sized agricultural enterprisesField days, involving practical demonstrations, were held by institute staff in variousparts of the Carpathian Basin and were attended by a total of around 3000 scientists andfarm experts each year. On these occasions, growers were given information on thefactors influencing cereal production under various agro-ecological conditions and onthe interactions between them, while scientists obtained knowledge on the problems thatreally concern farmers.The new website (www.agrisafe.eu) became available in June 2008, providing detailedinformation on the project and on related research topics. This portal was a great help inorganising the courses included in the project. Young scientists could read about thecourses available and register their intention of attending. The website facilitated thepropagation of information on the courses available as part of the project and allowedparticipants to register online.Results of the programmeThe continuation and expansion of existing bilateral agreements with variousresearch centres and universities in Europe made a great contribution to the7

AGRISAFE Budapest, Hungary, 2011development of ARI HAS into a research and training centre serving the whole ofthe Central and Eastern European region, while the training courses organised foryoung scientists from research institutes and universities from throughout this regionmade ARI HAS even more open to cooperation in research fields related to theinteraction between crops and the environment. The results achieved in all five workprogrammes are of decisive importance for the countries in the region. The breeding ofbasic biological material adapted to the climatic conditions in Central and EasternEurope can only be carried out in the region itself, necessitating the existence and activeparticipation of well-trained plant specialists. Within the framework of the presentproject ARI HAS carried out developments that will help experts working in the regionto overcome the unfavourable effects of global climate change.The cooperation agreements already signed with a number of Central and EasternEuropean countries (Romania, Slovakia, Slovenia, Serbia, Croatia), regular contacts withseed companies and farmers in neighbouring countries, and cooperation with officialsfrom the Ministry of Agriculture and Rural Development provide a firm basis for facingup to global climate change.Based on these contacts and due to the popularity of events organised in the institute,ARI HAS, which has held a leading position in the Hungarian seed market for overfifteen years, is in an ideal position to hold practical sessions (in the field and phytotron)demonstrating the unfavourable effects of climate change and to provide information onhow it is possible to adapt to these changes and to reduce predicted losses.AcknowledgementsThis paper was financially supported by the AGRISAFE 203288 EU-FP7-REGPOT2007-1 programme.ReferencesBartholy, J., Pongrácz, R. (2008): Regionális éghajlatváltozás elemzése a Kárpát-medencében. (Analysis ofregional climate change in the Carpathian Basin.) In: Klímaváltozás: környezet-kockázat-társadalom (ed.:Harnos, Z.). Szaktudás Kiadó, pp. 15-53.Bencze, S., Keresztényi, E., Veisz, O. (2007): Change in heat stress resistance in wheat due to soil nitrogen andatmospheric CO 2 levels. Cereal Res. Commun., 35: 229-232.Huszár, T., Mika, J., Lóczy, D., Molnár, K., Kertész, Á. (1999): Climate change and soil moisture: A casestudy. Physics and Chemistry of the Earth, Part A: Solid Earth and Geodesy, 24: 10. 905-912.Mika, J. (1991): Predictable features of major global warming in Hungary. Időjárás, 95: 265-278.Veisz, O., Bencze, S., Zoltán, B. (2005): Effect of elevated CO 2 on wheat and various nutrient supply levels.Cereal Res. Comm., 33: 333-336.Wolf, J. (1996): Effects of nutrient supply (NPK) on spring wheat response to elevated atmospheric CO 2 .Plants&Soil, 185: 113-123.8

Budapest, Hungary, 2011AGRISAFECLIMATE CHANGE IN CENTRAL EUROPE: OBSERVATIONSAND MODEL SCENARIOSL. BOZÓHungarian Meteorological Service, H-1525 Budapest, P.O.Box 38., e-mail: bozo.l@met.huAbstract Climate variables of Hungary are presented on the basis of homogenized datasets of HungarianMeteorological Service. Results of climate modelling referring to temperature, precipitation and extremevalues are discussed in the paper.Key words: temperature and precipitation trends, climate modelingIntroductionHungary’s climate is influenced by its latitudinal position, location of the country amidsta belt of westerly winds, the cyclonic activity of the temperate climate zone, and finallyby its distance from the Eurasian continental interior, the Atlantic Ocean and theMediterranean Sea. Due to these factors the climate of the country shows largevariability. For climate scenario estimations regional climate models (RCMs) are appliedin Hungary. These models (similarly to the short-range limited area weather predictions)dynamically downscale the global results for a smaller region using them as lateralboundary conditions. Mostly, RCMs describe exclusively the atmospheric part of theclimate system, consequently, they are usually adapted versions of already existingshort-range numerical models. Such adaptation can be realized with modification of thephysical parameterization schemes (e.g., radiation and cloud formation) being relevant atthe involved temporal and spatial scales.Long-term temperature and precipitation trendsHungary is largely affected by climatic warming trends (Bihari et al., 2009). There hasbeen a significant increase in temperature in each season, but statistically, these havebeen for different reasons. The summer season has been warming most notably (by1.12°C since 1901), and the main factor behind this steepest linear trend among theseasons has been the recent hot summers. The winters have warmed the least (by 0.42°Csince 1901), and their warming can be explained by the disappearance of serious coldsnaps by the end of the 20 th century, with temperatures averaging near to those in theperiod between 1971 and 2000. Autumns were cold at the beginning of the studiedperiod, and warm in the mid-20 th century. Springs have shown a similar tendency tosummers, with lower values of positive anomalies.Warming has accelerated since the mid-70s, but its significance is relatively low becauseof the short time period, although it has been 2–3°C over the last 30 years. In line withthe warming tendency, heat waves occur with ever greater frequency. They could beobserved at the beginning of the 20 th century, but practically disappeared during acooling phase from first half of the 50s until the mid-70s and became increasinglyfrequent from the mid-80s onwards. Nowadays, heat waves are a common feature of theHungarian climate.Another indicator of a warming climate is the positive anomaly in mean monthlytemperatures. 12 consecutive months had positive temperature anomalies fromSeptember 2006 until August 2007. This long, warm period (with average temperatures9

AGRISAFE Budapest, Hungary, 2011about 2–3°C higher than the 1971–2000 long-term average) makes the naturalenvironment and humans much more sensitive to less than average precipitation.Increasing temperatures and decreasing precipitation levels are the characteristic featuresof basic Hungarian climate trends, therefore the changes are more appropriate to theSouth European region than alternative locations along the same latitude.The temperature trends in Hungary are similar to that expected of global warming. Thefigures exhibit more noise due to the smaller territory, but they have a similar shape.2007 was the warmest year since 1901 followed by 2000, 1994 and 2002. The warmyears are drier than usual with the exception of 2007, when greater than averageprecipitation fell. Seasons show the same picture and the warmest seasons have occurredin recent years; spring in 2007, 2000 and 2002; summer in 2003, 2007, 1992, 1994 and2002; autumn in 2000 and 2006; and winters 2006/2007 and 1997/1998.No connection has of yet been detected between the short, late spring and early autumnfrosts on the one hand, and the warming tendency on the other. One of the most seriousagricultural disasters happened on 2 May 2007, when the minimum temperaturesdropped to -6°C in the north-eastern part of the country causing severe frost damage inthe apple orchards.Long-term precipitation shows a decreasing trend, but sometimes increasingprecipitation is visible as a shorter term tendency. No significant change can be observedin summer precipitation and there has been a slight decrease in that for winter (6% since1901), which runs counter the results of climate projections obtained from dynamicmodels.The largest reduction in seasonal precipitation was measured in spring (20% since 1901).Autumn has been affected by a smaller, but quite substantial degree, showing a 17%reduction in precipitation. It is likely that the year-to-year variability has a strongerimpact upon the natural environment and humans, than the long-term tendency towardsdecrease.In spite of the decreasing annual amount, the precipitation intensity has increased. Therehas been a growth in the number of days with a higher amount of precipitation. This factdeteriorates the surface water balance, due to the increasing runoff component.Climate modelingThe regional climate models applied at the Hungarian Meteorological Service(ALADIN-Climate and REMO) are different not only in terms of applied numericalschemes and physical parameterization processes, but also in many respects of theirsimulations (Szépszó, 2008; Szépszó and Horányi, 2008). Nevertheless, all theprojections are focusing on the climate change over the Carpathian Basin for the 21 stcentury, therefore, the common (ensemble) evaluation of the results can give a hint forthe extent of climate change and the related uncertainties. If the two models projectsimilar changes, the certainty is higher, while in the opposite case when the results arecontradicting, the common interpretation should be more careful and more emphasisshould be put on the uncertainties. Hereafter projection results for temperature and10

Budapest, Hungary, 2011AGRISAFEprecipitation (annual and seasonal mean values for both models) are shown for twofuture periods (2021-2050 and 2071-2100) with respect to the reference period (1961-1990). It is emphasised that climate change signals are determined on the basis ofdifferences between the (future) projection and (past) reference periods in order to avoidthe possible systematic model errors (this approach assumes that model errorcharacteristics remain the same for the past and future periods).TemperatureThe two regional climate models "agree" in the increase of the mean temperature duringthe 21 st century in the Carpathian Basin: this statement is valid for all seasons, moreover,in a statistically significant way for every period (i.e., the inter-annual variability issmaller than the degree of the change). The increase is continuous in the sense that for2071-2100 its value is larger (3.5 degree in average) than for 2021-2050 (1.7 degree inaverage). Certainly, it does not mean that all the forthcoming years in the future will bewarmer than the reference period: in spite of the positive trend cooler years and seasonscan be anticipated, as well. There is a difference between the precise warming values ofthe two models, especially when considering the seasonal tendencies. The largestdeparture between the two models is for summer in the period of 2021-2050 between 1.4and 2.6 degrees, while for 2071-2100 the same values are 4.1-4.9 degrees. The spatialdetails of the projections show (in agreement of the two models) that the temperatureincrease will be larger in the Eastern and Southern parts of the country.PrecipitationThe precipitation change results are much less clear, since the models mostly "disagree"even in the sign of the changes (which are mostly not significant on top of that). For2021-2050 the models are in agreement regarding the unchanged amount of annualprecipitation and in the slight summer decrease (5-10%). At the same time, there are alsosuch areas (especially over the Northern regions) where both models indicate slightsummer precipitation increase. For spring and winter the RCMs provide rather differentprojections: less than 10% increase and decrease are equally possible for both seasons.For the end of the century both models render a slight annual precipitation decrease,which is around 5%. The main directions of changes simulated for the middle part of thecentury are going to continue with different amplitudes, though. The summerprecipitation decrease can exceed 20% on average for Hungary. In winter one modelshows the possibility of 5% decrease, while the other one projects 30% increase.ReferencesBihari Z., Szalai S. and Bozó L. (2009): Natural Environment - Climate. In: Kocsis K, Schweitzer F (eds.)Hungary in Maps.. Budapest: MTA Földrajztudományi Kutató Intézet, 45-50.Szépszó, G. (2008): Regional change of extreme characteristics over Hungary based on different regionalclimate models of the PRUDENCE project. Időjárás, 112, 3-4 (Special Issue), 265-284.Szépszó, G. and Horányi, A. (2008): Transient simulation of the REMO regional climate model and itsevaluation over Hungary. Időjárás, 112, 3-4 (Special Issue), 203-231.11

Budapest, Hungary, 2011AGRISAFEFigure 1. A yield distribution partitioned into contributons from genotype (G), environment (E) andmanagement (M), showing their approximate contributions for data on Australian wheat yields (Fischer, 2009).In an analysis of Australian wheat yields over the past 100 years (Fischer, 2009) forwhich total yield change was an increase of 1.3% per year, climate change (E)contributed 0.1%, but can be ignored as this is cancelled out by the expansion ofcultivated area onto mainly drier land. Increase in CO 2 level (E) contributed about 0.2%of the increase, G plus (G x M), especially as G x fertilizer response, was worth about0.5% which leaves M on its own to contribute 0.6%. Expressed in percentages relative tothe total yield increase – G on its own contributes about 30%, E about 15%, leaving Mcontributing about 65% of the increase in yield. An agronomist would also note that theG contribution is mostly at the high-end of the distribution and thus raises the alreadyhighest yields in the distribution, whereas M operates mainly at the lower end andcontributes to raising the lowest. It is clearly desirable to have a situation in which ayield distribution over either has both a high mean value and a narrow distribution, bothtemporally and spatially.Using this analysis to consider the impacts of a more variable climate one would expecta lower mean and a widened distribution of yields giving an expanded importance ofmanagement in adapting crops to such climates. If it is argued that agronomic changecan help buffer yields against mean climate change, adaptation to increased weathervariation will require seasonal forecasts to improve. If it is getting hotter in a moreirregular pattern, earlier planting of crops and thereby earlier flowering should help; inthe longer term earlier flowering varieties may be a better option, especially in thoseareas which experience spring frosts. More attention to soil water conservation wouldalso help if it is getting periodically drier, although the near constant gain in yield, perunit increase in evapo-transpiration, means that more water use still means higher yields.Only if warming and water supply permits a farmer to switch from a C3 crop to a C4 one13

AGRISAFE Budapest, Hungary, 2011that has higher water use efficiency or from a spring cereal to a winter one, would therebe a yield gain.Developing countries can be very different from the above, with often large yield gapsarising because of lack of application of existing improved management and often lackof use of or access to improved varieties. In such situations the adoption of improved butalready known management can play a bigger relative role well into the future, but Gprogress should still have an important positive effect, both via potential yield and viayield gap-closing breeding. However, the balance between G and M in developingcountries is likely to side more with M than G, at least in the short-term.Crop breeding and variety choice (ie. G) is in some ways simpler to apply as it permitsone to target the specific bottlenecks in the yield process, which are squeezed even moreby climate change. Breeding wheat in rain-fed environments outside Europe is alreadyconfronting water shortage as a constraint and is already doing its utmost to deal withthis. High temperature effects may be somewhat different, especially if the likelihood ofextreme maximum temperatures occurrences increases and yield responses are nonlinearto this (Semenov, 2009). We need to learn how sensitivity varies with stage ofdevelopment (Porter and Gawith, 1999) and identify the current maximum temperaturethresholds and the variability.Finally, although we may see agronomy and crop science as ’pure’ sciences and immunefrom cultural and political influences, this is far from being the case. Different periods ofhistory in the 19th and 20th centuries have viewed GEM in different political andcultural lights. Soviet agricultural policy until after the 2nd World War was dominatedby the ideas of Lysenko who maintained, in keeping with Marxist theories, thatenvironment was all controlling in determining crop phenotypes and that genetics couldbe ignored as a ’bourgeoise’ science. The ideological deduction from Marxism was thatspring wheat could be ’trained’ to be as resistant to cold as winter wheat but this isclearly not the case and the spring wheats died. This political and ideological failure toappreciate the interaction between GE and M was a contributing factor to the faminesthat occurred in the Ukraine and elsewhere in the Soviet Union in the 1930s and whichlead to the deaths by starvation of millions of people. In contrast, balance in agronomyand the appreciation of GEM was at the forefront of Bourlag’s and others’ greenrevolution in the 1960s and 1970s. Here crops were genetically designed to allow themto respond to managment additions that enabled them to increase yields in unfavourableenvironments. We have taken a backward step from Borlaug’s balanced philosophy withthe current overemphasis on G as the solution to raising agricultural production andsolving agricultural problems. As with Lysenkoism and E, the current fixation on G as’the’ solution has cultural, economic and political roots and has become a self-servingact of faith and mantra for its adherents and followers. In spite of the large scientificinvestments that have been made since the 1980s in plant gene technology, results havebeen modest and modern agronomy should, in my view, seek to reassert the Borlaugphilosophy.ConclusionsDealing with the above balances and trade-offs within the GEM equation and how theydiffer according to regional and geographical context has to become the core of the14

Budapest, Hungary, 2011AGRISAFEscience of agronomy. As such agronomy needs to be recognized as a science just asmuch as is plant gen- and other-nomics. Processes that can be studied at the croppinglevel are just as intellectually challenging as gene sequencing and micro-studies ofmetabolism. However, agronomy has to improve. It has to anticipate and welcome thecontributions that can be made from new developments in other disciplines, such as genetechnology, remote sensing, systems theory and software developments as they areimportant for predictive simulation modelling, Agronomy also has to move away fromits experimental traditions towards more integrated system approaches and focus moreon the multiple functions of agro-systems rather than on individual aspects but hold theprimary focus of understanding, describing and predicting the consequences ofsustainable primary production. Agronomy would not gain from being re-titled‘agronomics’ as this would not capture the need for the cross-disciplinary insightsneeded to advance future food production, but such cross-disciplinarity needs to be builton firm disciplinary pillars.ReferencesFischer, R.A. (2009): Farming Systems of Australia: Exploiting the Synergy between Genetic Improvementand Agronomy, pp. 23-54. In: Sadras V., Calderini D (eds), Crop Physiology. Elsevier, Amsterdam.Porter, J.R., Gawith, M. (1999): Temperatures and the growth and development of wheat: a review. Euro. J.Agron., 10, 23–36.Semenov, M.A (2009): Impacts of climate change on wheat in England and Wales. Journal of the RoyalSociety Lond. Interface, 6, 343-350.The Royal Society of London, Reaping the Benefits, www.royalsociety.org (2009).15

AGRISAFE Budapest, Hungary, 2011AGRICULTURAL RESEARCH AND BIOTECHNOLOGIES:POWERFUL TOOLS IN FACING GLOBAL CHALLENGES.EXPERIENCE IN EUROPE AND CENTRAL ASIAN. ALEXANDROVAFAO Regional Office for Europe and Central Asia, Benczur utca 34, H-1068, Budapest, Hungary, e-mail:nevena.alexandrova@fao.orgAbstract Climate change is a complex issue at local, regional and global level, whose impact on agricultureand related sectors, coupled with recent food and economic crises, is likely to aggravate chronic problems andnegatively affect the sustainability of the sector. Biotechnology, being part of agricultural innovations, includestissue culturing, gene transfer, immunological techniques, molecular genetics, and recombinant DNA methods,and currently, functional genomics, proteomics and metabolomics, combined with bioinformatics, isrecognized as a powerful tool in a broad range of agriculture-related areas. If properly focused,biotechnologies, often combined with traditional knowledge, can offer solutions for a number of both noveland old challenges and thus significantly contribute to the sustainable development of agriculture, livestock,fisheries, forestry and food industry, while adding value to food safety and improved health.Key words: agricultural research, innovation, climate change, agricultural biotechnologies, biosafety, Europeand Central AsiaIntroductionFood is a necessity of life and food security is a common global goal. The world today isfacing numerous challenges as food and financial crises, shortage of water, arable land,energy, loss of biodiversity, all aggravated by climate change and natural disasters and socioeconomicissues (e.g. overpopulation, urbanization, food waste). These factors are placingincreased pressure on agriculture to supply food and raw materials in sustainable way andwhen not properly addressed, they result in dramatic boost of poverty. By 2050 the world’spopulation will reach 9.1 billion, 34 percent higher than today. Urbanization will continue atan accelerated pace to reach about 70 percent compared to 49 percent today. In order to feedthis larger, more urban and richer population, food production (net of food used for biofuels)must increase by 70 percent (FAO, 2009b). The years 2007–2008 saw dramatic increases inworld food prices, creating a global crisis and causing political and economical instability.Moreover, food prices raised again in the begin of 2011, according to the FAO Food PriceIndex for January 2011 and reached the highest level since it started in 1990, above 2008,which translates in 44 million more people thrown into extreme poverty. The main causes of2007-2008 crisis and food price rise in 2011, though not identical, were rooted in thedroughts and floods in grain-producing nations, rising oil prices, increasing arable landcompetition between food crops and biofuels coupled with falling world-food stockpiles.About 30 percent of the population in Europe and Central Asia – about 145 million – areconsidered either poor or vulnerable but this now is expected to rise throughout the Region,increasing by about 5 million people for every 1 percent decline in GDP. In 2009 alone, theRegion faced the reality of an additional 13 million poor or vulnerable people, instead of thenumber falling from 145 to 130 million as expected before the 2007-2008 crisis (WorldBank, 2009). The most recent assessment by the Intergovernmental Panel on Climate Change(Parry et al., 2007) shows that global average temperature increases in excess of 3 o C arelikely to result in lower yields in all regions and in upward pressure on world cereals prices.The countries in Europe and Central Asia with exception of Northern Russia and mountainareas are furthermore expected to bear the burden of climate change (long term effectsassociated with the dramatic increase of the GHGs as a consequence of human activities). Asa result of the climate change, projected to lower the global GDP with 20 percent by 2020,some areas in vulnerable countries could experience increase in risk of hunger.16

Budapest, Hungary, 2011AGRISAFEAgainst this background, it becomes evident that conventional knowledge approaches,technologies and policy frameworks in agriculture are no longer able to adequately addressfood security, especially in view of the increased demand for effective natural resourcemanagement and GHGs mitigation.This paper argues that in order to cope with the above mentioned challenges, the requiredincrease in food production to contribute to food security can be achieved if properlyembedded into innovation policies, programmes and investments in research anddevelopment, technology transfer addressing intellectual property rights (IPRs), includingagricultural biotechnologies and taking into account pressing environmental issues.Results and discussionAgricultural innovation system: evolution and role for agricultural developmentFarmers have always endeavoured to innovate and constantly adapt their farming techniquesto cope with unfavourable weather conditions, draught, freeze, new and old pests, diseasesand other biotic and abiotic stresses. In this line, farmers’ need of knowledge to generate,adapt and implement innovations was always present. However, the conceptual framework ofhow innovation happens and knowledge is shared, has continuously evolved. Driven by theimperatives of world’s economy after the Second World War, the development of newagricultural innovations was the prime responsibility of the public sector research andagriculture extension service, in a top-down approach, considering agricultural research asprovider, extension services as mediator and farmers only as recipient of knowledge. In the1980s, during the “perestroika”, this model was enriched by recognising other actors takingpart of the agricultural knowledge system as private sector and assigning new roles of thetraditional players, thus transforming the linear knowledge flow into more decentralisedmodel. A further stage of knowledge systems evolution was Agricultural Knowledge andInformation Systems for Rural Development (AKIS/RD) (FAO and WB, 2000), whichintegrated education, research and extension having equal contribution for agriculturaldevelopment. Farmers are seen already as partners, not only recipients of knowledge.Currently, agricultural innovation system (AIS) model is in use to respond better to thechallenges of the changing world. Agricultural development takes place in a globalisedsetting, in which the main drivers are dynamic markets and trade. A constantly changingknowledge structure environment is characterized with increased educational degrees amongall stakeholders- researchers, farmers, civil society (NGOs) and the private sector, which areall considered now as initiators of innovation. Information technologies play an increasingrole, allowing transfer of innovations from other sectors to agriculture and diversifying thechannels of knowledge dissemination. Innovations are being focused on bringing newproducts, processes and forms of organization into social and economic use, which requiresthe active and interactive networking of all actors involved in agriculture. In innovationsystems, networks of different players are transient and emerge around specific challengesand tasks at particular points in time (World Bank, 2006).The gears of agriculture innovation systems are often borrowed from other sectors andinclude the use of competitive funds for research and development; the establishment ofpublic-private research consortia, typically around a particular commodity and at times oncross cutting issues (i.e. biotechnology, climate change); decentralized or regional levelinnovation platforms including all stakeholders; decentralized public and private delivery ofextension services, often based on competitive funding for communities and for extensionservice providers; and others. Summing up, the agricultural innovation system, compared toits ancestors, is the conceptual framework of knowledge that is in the position to provide, ifthe correct modus operandi is in place, the flexibility needed to ensure efficient and effective17

AGRISAFE Budapest, Hungary, 2011response to current and future challenges in the agricultural sector, e.g. climate changeadaptation and mitigation, natural resource management and biotechnologies in agriculture. Akey challenge is the adequate level of institutional and organizational development. Theinnovation system focus on network development assumes that these other organizations arealready strong enough, while, in fact, this is still a challenging issue in the countries witheconomies in transition in Europe and Central Asia (Alexandrova and Atanassov, 2010).The role of research in innovation processes for climate change adaptation andbiotechnology and biosafetyTo be successfully implemented, the agricultural innovation system approach requires certainchanges in the behaviour of all actors, acquisition of novel skills and alternation in the role ofresearchers. In the introduction, it has been argued that climate change goes along with theemergence of complex problem situations. The same can be attributed to the controversy inthe society at large about the use of genetically modified organisms (GMOs). Thiscomplexity issue has important implications for the role of scientists and research sincedifferent levels of complexity require different modes of operation by scientists (Funtowiczand Ravetz, 1993; Gibbons et al., 1994). In ‘low complexity’ situations where bothuncertainty and decision stakes are low (i.e., goals are not contested), Funtowicz and Ravetz(1993) argue, scientists can suffice to act as applied scientists and engage in ‘puzzle solving’.If uncertainty and stakes are moderate, scientists can act as consultants; scientific knowledgeis then combined with context-specific expertise and tacit judgements. In case of highuncertainty and decision-stakes, scientists need to engage in post-normal science. They haveto become intensely involved in societal interactions and collaborative forms of research inorder to contribute to the development of shared views and value commitments (Figure 1).Societal stakeholders (the actors in an innovation system), then, become part of an ‘extendedpeer community’ (Funtowicz and Ravetz, 1993).In order to make innovation happen in a network-like configuration to support networkbuilding, social learning and conflict management, the traditional communication andknowledge-sharing strategies should be expanded to include network brokerage, demandarticulation, visioning, facilitation, and others (Leeuwis, 2004; Klerkx & Leeuwis, 2009),wherefrom comes the need that all actors adopt new skills, outside of their professionalspecialisation, e.g. expertise in communication, facilitation, management, including of naturalresources and climate change adaptation. The acquisition of new mentality and skills isparticularly relevant for countries with transition economies (FAO, 2011).Figure 1. Different roles of science in relation to decision-stakes and uncertainties(Functowicz and Ravetz, 1993)18

Budapest, Hungary, 2011AGRISAFEAgricultural biotechnology and biosafetyIn 2010, FAO international technical conference in biotechnologies was held inGuadalajara, Mexico with major objective of the Conference was to take stock of theapplication of biotechnologies across the different food and agricultural sectors indeveloping countries, in order to learn from the past and to identify options for the futureto face the challenges of food insecurity, climate change and natural resourcedegradation. The report from the Conference (FAO, 2010), recognises that agriculturalbiotechnologies encompass a wide-range of tools and methodologies that are beingapplied to an increasing extent in crops, livestock, forestry, fisheries and aquaculture,and agro-industries, to help alleviate hunger and poverty, assist in adaptation to climatechange and maintain the natural resource base, in both developing and developedcountries. They already play a key role in reducing GHG emissions and help addressingtoday’s challenges of climate change, water scarcity, malnutrition, reduced availabilityof agricultural land, producing clean, renewable alternatives to petroleum-based fuels,thus creating millions of jobs over the world. However, the various applications ofagricultural biotechnologies have not been widely used in many developing countries,and have not sufficiently benefited smallholder farmers and producers and consumers.Based on the lessons learned and current demands from the FAO member countries, theconference advocated de facto the use of the pluralistic AIS approach to achieve this,e.g. more research and development of agricultural biotechnologies should be focusedon the needs of smallholder farmers and producers and proper supportive policy andinfrastructure frameworks should be developed and adopted at national level, taking intoaccount agricultural innovation system concept. In this line, effective communicationand participation strategies are necessary to encourage and promote public involvementand empowerment in decision-making processes, regarding the development and use ofbiotechnologies. Stronger partnerships among and within countries will facilitate thedevelopment and use of biotechnologies, including south-south and regional alliances;incorporation of traditional knowledge; and public-private and research partnerships forsharing experiences, information and technologies. Recognising the potential,biotechnologies may have in addressing substantial use of natural resources, climatechange adaptation and mitigation in all agricultural sectors, FAO is also aware of theconcern about the potential risks posed by certain aspects of biotechnology. FAOsupports a science-based biosafety approach that would objectively determine thebenefits and risks of each individual genetically modified organism (GMO). This callsfor a cautious case-by-case approach to address legitimate concerns for the biosafety ofeach product or process prior to its release. FAO was mandated by its member countriesto assist in capacity building in biotechnology and harmonization of biosafetyregulations, to give science-based advice and guidance in biotechnology, and provideaccess to neutral and balanced information to help to improve agricultural productivity indeveloping countries and economies in transition. According to FAO surveys in theCentral and Eastern European region (FAO, 2003, 2006, 2009a) information andcapacity building in agricultural biotechnology and biosafety are important needs forcountries of the region. Donor technical and financial assistance (UNEP/GEF, EU andothers) has been foreseen for developing national legislation and testing facilities inseveral instances, but more help is required. In order to provide the countries withtransition economies in Europe and Central Asia with an access to biotechnologyinnovations and products and to insure that they become an integral part of the countries’19

AGRISAFE Budapest, Hungary, 2011agricultural innovation systems, proper mechanisms and incentives should be identifiedand promoted. FAO’s assistance in the region includes organization of regionalworkshops on biotechnology and biosafety issues (Prague, Czech Republic in 2006,2007 and 2008 with support of a trust fund project of the Czech government) as well assub-regional workshops (in Yerevan, Armenia in 2003; in Tashkent, Uzbekistan in 2008in cooperation with ICARDA). Biotechnology and biosafety capacity buildingprogrammes are part of FAO’s technical assistance to Transcaucasus countries andMoldova, and Croatia.Investments in agricultural research and development (R&D)If the AIS approach and thinking for development began when national and internationalfunding for agriculture development (and research, education, training, and extension)was at its nadir, the situation is now different. The global donor platforms, multilateralinstitutions, international development banks, bilateral institutions, and nationalgovernments are now interesting in reinvesting in agriculture and agriculture institutions.However, all are seeking to support, successful programs and strategies and keyactivities not old models with limited success and limited evidence of the successes.In low-income countries, agricultural R&D continues to be the most productiveinvestment in support of the agricultural sector, followed by investments in education,infrastructure, and input credits. Investments in R&D have very high rates of return(between 30 and 75 percent) and longterm benefits. Massive public and privateinvestments in R&D (estimated at 2002 prices to US$1.1 billion per year) are requiredtoday in order for agriculture to benefit from effective technologies in the future giventhat benefits from agricultural research tend to materialize after a considerable time lag(FAO, 2009c). Increasing private sector involvement in agricultural R&D also meansaddressing issues of intellectual property rights (IPRs) and ensuring that a balance isstruck so that access of poor farmers to new technologies is not actually reduced.Appropriate regulatory systems that are adapted to a country’s needs and effectivelyenforce IPRs will be essential to stimulate private sector investments. The research inEastern Europe and Central Asia, however, is almost exclusively funded by the verylimited pool of public sources. Moreover, the lack of prioritising strategies in agriculturalinnovation as well as the lack of broad communication policy, particularly inbiotechnology and biosafety, led to misconcepts in the general public even for non-GMtechniques and additionally affected the already limited funds for research and adoptionof innovations. The private sector in Eastern Europe and Central Asia is still underdevelopment and so far is not sufficiently stimulated (by national policies) to take part inthe innovation process (Alexandrova and Attanassov, 2010).ConclusionsThe world is facing several challenges at global and regional level that affect foodsecurity, which requires adequate actions today in order to insure our livelihoodstomorrow. In agriculture, promising new technologies, including biotechnologies arealready available and more are to come. A biosafety approach that addresses thelegitimate risk concerns brought by GMOs is developed and agreed internationally, FAObeing active part of the international effort. Further technology transfer and capacitydevelopment are needed however, in order to adopt and generate proper technologies,especially in developing countries and those with economies in transition. To this end, a20

Budapest, Hungary, 2011AGRISAFEpluralistic agricultural innovations concept can provide successful solutions, if properlyembedded in adequate national policies, educational and capacity developmentprogrammes and infrastructure. FAO advocates a shift from interventions focusing onsingle components towards a system-approach aimed at strengthening institutions andstakeholders’ networks to facilitate an inclusive and integrated agriculture innovationsystem fully considering smallholder farmers. Through its technical assistanceprogramme FAO has been supporting participatory processes for improving nationalagricultural innovation systems by involving key stakeholders, including producers andtheir organizations, in assessing current research and extension systems and planning ofinterventions for improving these systems at policy, institutional, human resources, andtechnical level. FAO is continuously providing support to institutional and organisationaldevelopment, functional linkages, and is contributing to the formulation of neededpolicies.ReferencesAlexandrova N.A., Atanassov A.T. (2010): Agricultural biotechnologies in Europe and Central Asia: new challengesand opportunities in a view of crises and climate change. Issue paper for the Regional Session for Europe andCentral Asia on FAO Global Biotechnology Conference, Guadalajara, Mexico 2010http://www.fao.org/fileadmin/user_upload/Europe/documents/Events_2010/Mexico/issuepaper_en.pdfFAO (2003): Status of agricultural biotechnology and biosafety in selected countries of the Balkans, the Caucasus andMoldova. ftp://ftp.fao.org/sd/SDR/SDRR/REUBIOSAFETY4-2.docFAO (2006): The status of agricultural biotechnology and biosafety in Ukraine,http://www.fao.org/sd/dim_kn4/docs/kn4_060601d1_en.pdfFAO (2009a): The status of agricultural biotechnology and biosafety in Belarus,ftp://ftp.fao.org/docrep/fao/011/ak226e/ak226e00.pdfFAO (2009b): How to feed the world in 2050. In: Proceedings of the Expert Meeting on How to Feed the World in2050, 24-26 June 2009, FAO Headquarters, RomeFAO (2009c): Technology challenge.http://www.fao.org/fileadmin/templates/wsfs/docs/Issues_papers/HLEF2050_Technology.pdfFAO (2010): Report of the FAO Technical Conference: Agricultural biotechnologies in developing countries: Optionsand opportunities in crops, forestry, livestock, fisheries and agro-industry to face the challenges of food insecurityand climate change (ABDC-10),Guadalajara, Mexico 1-4 March 2010http://www.fao.org/fileadmin/templates/abdc/documents/report.pdfFAO (2011): Assessment of the human capacity development needs for, and gaps in, the Agricultural AdvisoryServices in Western Balkans, Final Report of the FAO technical cooperation programme facility project“Technical Support for Human Resources Development of Agricultural Advisory Services in Albania, Bosnia andHerzegovina, Bulgaria, FYR Macedonia, Montenegro, Serbia and UNMIK Kosovo” (in press)FAO and World Bank (2000): Agricultural Knowledge and Information Systems for Rural Development (AKIS/RD):Strategic vision and guiding principles, ftp://ftp.fao.org/SD/SDR/SDRE/AKIS.pdfFuntowicz, S.O., Ravetz J.R. (1993) Science for the post-normal age. Futures, 25, 739-755.Gibbons M., C. Limoges, H. Nowotny, S. Schwartzman, P. Scott & M. Trow (1994) The new production ofknowledge. The dynamics of science and research in contemporary societies. Sage Publications, LondonKlerkx, L., & Leeuwis, C. (2009) Establishment and embedding of innovation brokers at different innovation systemlevels: Insights from the Dutch agricultural sector. TechnologicalForecasting and Social Change, 76, 849 - 860.Leeuwis, C. (with contributions by A. Van den Ban) (2004), Communication for rural innovation. Rethinkingagricultural extension. Blackwell Science, Oxford.Parry, M.L., Canziani O.F., Palutikof J.P., van der Linden P.J., Hanson C.E. (edc) (2007), Contribution of workinggroup II to the Fourth Assessment Report on Climate Change, 2007, Cambridge University Press, Cambridge,UK and New York, NY, USAWorld Bank (2006), Enhancing Agricultural Innovation: How to Go Beyond the Strengthening of Research Systemshttp://siteresources.worldbank.org/INTARD/Resources/Enhancing_Ag_Innovation.pdfWorld Bank (2009), Europe and Central Asia World Bank report 2009,http://web.worldbank.org/WBSITE/EXTERNAL/COUNTRIES/ECAEXT/0,,menuPK:258606~pagePK:146732~piPK:64003010~theSitePK:258599,00.html21

AGRISAFE Budapest, Hungary, 2011CLIMATE CHANGE AND CROP PRODUCTION: STUDIES OFATTRIBUTION AND ADAPTATION IN NORTHERN BRITAINP. J. GREGORYSCRI (Scottish Crop Research Institute), Invergowrie, Dundee, DD2 5DA, UKIntroductionWeather and climate have profound effects on crop development and growth (Porter andSemenov, 2005) and, when all other factors such as soil fertility, soil water and weeds,pests and pathogens are managed, determine the potential yield of a crop (Hay andPorter, 2006). Crop models, based on an understanding of how temperature, water andradiation affect key plant physiological processes, have been constructed that allowexploration of the effects of seasonal weather on growth and yield and also permitregional crop production to be estimated (MacKerron and Waister, 1985; Challinor etal., 2007). Fischer et al., (2001) modelled the spatial variation in effects of climatechange anticipated in 2050 on potential yields of rainfed cereal crops. Theydemonstrated that cereal producing regions of Canada, and northern Europe and Russiamight be expected to increase production, while many parts of the world would sufferlosses including the western edge of the USA prairies, eastern Brazil, Western Australiaand many, though not all, parts of Africa. Overall, the results of this and subsequentwork demonstrated that climate change would benefit the cereal production of developedcountries more than the developing countries and thereby increase the number ofundernourished people especially in sub-Saharan Africa.The purpose of this paper is to: i) summarise research that has investigated the currentextent of warming, especially in northern latitudes; ii) outline a methodological approachthat has been used to attribute the potential contribution of climate change to measuredchanges in maincrop potato yields in northern Britain; and iii) to outline ongoingresearch at SCRI to adapt crops to changing climate.Measured climate change and crop productionWhile model predictions of crop responses to projected climate changes are numerous,relatively few assessments have been made of the effects of the measured changes inclimate that have occurred in the last 50 years or so – a period in which the global meanair temperature has increased by 0.13 o C per decade (IPCC, 2001). Gregory and Ingram(2008) reviewed the information available from a range of studies examining climate andyield records at different scales and over different time periods using a wide range ofstatistical and process-based modeling approaches. The majority of such assessmentshave been made on temperate cereals grown in northern mid-latitudes with very littleinformation available for crops in the tropics. Overall, the results are variable anddemonstrate differences in response between crops at the same sites. There are, though,some common features:1. Many of the analyses note an increase in mean temperature of about 1.0 – 1.4 o Cover the last 30-40 years often with a larger change in minimum than maximumtemperatures; none of the studies detected any trend in precipitation.2. Warmer temperatures have resulted in phenological change and there is someevidence for changes to disease incidence and to farming practices. In the UK, 25 of22

Budapest, Hungary, 2011AGRISAFE29 events (including emergence, flowering and harvest of different crops) wereadvanced by an average of 5.5 d in the 1990’s decade compared with the 1980’swith response rates ranging from 4 to 12 d earlier o C -1 for an increase of 1.4 o C inJanuary to March mean air temperature (Sparks et al., 2005). There is someevidence that farmers in northern latitudes have already adapted to the warmertemperature by, for example, sowing spring crops earlier; the date by which 50% ofthe UK sugarbeet crop is sown has advanced by about 15 d since the 1970s (Jaggardet al., 2007).3. There are a few reports of disease incidence occurring earlier in the growing season.For example, In Finland, outbreaks of late-blight on potato occurred 2-4 weeksearlier in crops grown in the period 1996-2002 compared to those grown in 1933-62; shortened rotational periods between potato crops may also have contributed tothis change (Hanukkala et al., 2007). Similarly in Scotland Myzus persicae aphids,carriers of viral diseases to potatoes, have appeared earlier in the growing season(Malloch et al., 2006).4. The effects of changed temperatures (not all are warmer) on crops is complexbecause different species have different base and optimum temperatures fordevelopment, some processes are daytime only (e.g. photosynthesis) while othersoccur throughout the day (e.g. respiration), and many processes are nonlinearlyrelated to temperature (Porter and Semenov, 2005). Cooler temperatures wereassociated with increased yields of wheat in warm countries such as Mexico andIndia, while in mid-latitude countries yields were often increased at highertemperatures because such temperatures facilitated winter growth and/or wereaccompanied by greater irradiance.5. Statistical methods have developed to permit the analysis of long-term weather andyield records and, most recently, the separation of effects of climate change fromthose of genetic and agronomic improvements (e.g. Lobell and Field, 2007).Generally, the climate effects are small relative to the increased yields resultingfrom technological improvements and there are several examples where there hasbeen no apparent effect of the climate change that has already occurred on somecrop yields (e.g. Lobell et al., 2007). This might be because either these crops arewell adapted to both the old and new climates, or varieties and management havebeen adapted to take advantage of the new climate or elements of both.Attribution of climate change – a case study in northern BritainAttributing the contribution of climate change to increases in crop yield is a difficult taskbecause there is no controlled experiment, multiple factors have varied simultaneouslyand the measurements desired may be either unavailable or sporadically recorded.Maincrop potato yields in Scotland have increased by 30-35 t ha -1 since 1960 as a resultof many changes in the industry, but has changing climate contributed to this? Gregoryand Marshall (2011) developed a methodological approach that could be used tocalculate the maximum proportion of the increased yield that might be attributed to thechanged climate. Daily weather data for the period 1960 to 2006 were analysed for fivelocations covering the zones of potato growing on the east coast of Scotland (between55.213 and 57.646 N) to determine trends in temperature, rainfall and radiation. Over the47 years, there were significant increases in annual air and 30 cm soil temperatures (0.2723

AGRISAFE Budapest, Hungary, 2011K decade -1 and 0.30 K decade -1 respectively), but no significant changes in annualprecipitation or in the timing of the last frost in spring and the first frost of the autumn(Table 1); there was no evidence of any north to south gradient of warming.A physiologically-based potato yield model (based on MacKerron and Waister, 1985)was used to simulate crop development and potential yield using the measured weatherdata at each site. Simulated emergence and canopy closure became earlier at all five sitesover the period with the advance being greater in the north (3.7 and 3.6 days decade -1respectively) than the south (0.5 and 0.8 days decade -1 respectively). Potential yieldincreased with time, generally reflecting the increased duration of the green canopy, ataverage rates of 2.8 t ha -1 decade -1 for chitted seed and 2.5 t ha -1 decade -1 for unchittedseed. For the study period, the changed temperature could contribute potential yieldincreases of up to 13.2 t ha -1 for chitted potato (range 7.1 to 19.3 t ha -1 ) and 11.5 t ha -1for unchitted potato (range 7.1 to 15.5 t ha -1 ). This suggests that warming couldcontribute up to 33-38% of the increased potential yield over the period or 22-25% of theincrease in actual measured yields.Table 1. Trends in air and 30-cm soil temperatures, precipitation, radiation and frost occurrence in the period1960-2006. The values shown are ± 1 standard error; the number of observations varied from 38 to 47. Thevalues in brackets are the F-probability that the slope is zero. From Gregory and Marshal (2011).StationAir temp(K per annum)30-cm soil temp (Kper annum)Precipitation(mm per annum)Radiation(hours per annum)Last frost(days per annum)First frost(days per annum)Kinloss0.027±0.004(

Budapest, Hungary, 2011AGRISAFEbeen tackled with genetic solutions involving considerable investment in germplasmresources and genetic and molecular mechanism research leading to durableresistance solutions. These resources will be deployed on the problems of new andemerging diseases.Mechanisms and sources of resistance/resilience to abiotic stresses includingdrought and the cold requirement of soft fruits. As above, germplasm resources willbe directed to these ends.Genetic enhancement for resilience to cope with more variable growing conditions.Development of new crops (including energy crops and those producing moleculesof high value) to take advantage of more favourable growing conditions.AcknowledgementsI thank my colleagues at SCRI for their many contributions to the ideas expressed in thispaper. SCRI receives programme funding from the Scottish Government.ReferencesChallinor AJ, Wheeler TR, Craufurd PQ, Ferro CAT, Stephenson DB (2007) Adaptation of crops to climatechange through genotypic responses to mean and extreme temperatures. Agriculture Ecosystems andEnvironment, 119, 190-204.Fischer G, Shah M, van Velthuizen H, Nachtergaele FO (2001) Global Agro-ecological Assessment forAgriculture in the 21 st Century. International Institute for Applied Systems Analysis, Laxenburg, Austria.Gregory PJ, Ingram JSI (2008) Climate change and the current "food crisis". CAB Reviews: Perspectives inAgriculture, Veterinary Science, Nutrition and Natural Resources, 3, No. 099.Gregory PJ, Marshall B (2011) Attribution of climate change: a methodology to estimate the potentialcontribution to increases in potato yield in Scotland since 1960. (In review).Hannukkala AO, Kaukoranta T, Lehtinen A, Rahkonen A (2007) Late-blight epidemics on potato in Finland,1933-2002; increased and earlier occurrence of epidemics associated with climate change and lack ofrotation. Plant Pathology, 56, 167-76.Hay RKM, Porter JR, (2006). The Physiology of Crop Yield, Second Edition. Blackwell Publishing, OxfordUK.Intergovernmental Panel on Climate Change (2007) Climate change 2007: the physical science basis. Summaryfor Policymakers. Contribution of working group I to the third assessment report of the IPCC. IPCCSecretariat, Geneva, Switzerland.Jaggard KW, Qi A, Semenov MA (2007) The impact of climate change on sugarbeet yield in the UK: 1976-2004. Journal of Agricultural Science, 14, 367-75.Lobell DB, Cahill KN, Field C (2007). Historical effects of temperature and precipitation on California cropyields. Climatic Change 81,187-203.Lobell DB, Field CB (2007) Global scale climate-crop yield relationships and the impacts of recent warming.Environmental Research Letters, 2, 1-7.MacKerron DKL, Waister PD (1985) A simple model of potato growth and yield .1. Model development andsensitivity analysis. Agricultural and Forest Meteorology, 34, 241-252.Malloch G, Highet F, Kasprowicz L, Pickup J, Neilson R, Fenton B (2006) Microsatellite marker analysis ofpeach-potato aphids (Myzus persicae, Homoptera: Aphididae) from Scottish suction traps. Bulletin ofEntomological Research 96, 573-582.Porter JR, Semenov MA (2005) Crop responses to climatic variation. Philosophical Transactions of the RoyalSociety B, 360, 2021-2035.Sparks TH, Croxton PJ, Collinson N, Taylor PW (2005) Examples of phenological change, past and present, inUK farming. Annals of Applied Biology, 146, 531-37.25

AGRISAFE Budapest, Hungary, 2011MAINTENANCE AND EXPLOITATION OF GENETICRESOURCES FOR FUTURE PLANT BREEDINGA. BÖRNER 1 – E.K. KHLESTKINA 2 – S. CHEBOTAR 3 – M. NAGEL 1 – M. A. REHMAN-ARIF 1 – K. NEUMANN 1 – B. KOBILJSKI 4 – U. LOHWASSER 1 – M.S. RÖDER 11 Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Corrensstrasse 3, 06466 Gatersleben,Germany, e-mail: boerner@ipk-gatersleben.de2 Institute of Cytology and Genetics (ICG), Siberian Branch of the RussianAcademy of Sciences, Lavrentjeva Ave. 10, Novosibirsk, 630090, Russian Federation3 South Plant Biotechnology Center, Ovidiopolskaya dor. 3, 65036 Odessa, Ukraine4 Institute of Field and Vegetable Crops, Maksima Gorkog 30, 21000 Novi Sad, SerbiaAbstract As estimated by FAO, world-wide existing germplasm collections contain about 7.4 millionaccessions of plant genetic resources. One of the ten largest ex situ genebanks of our globe is located at theLeibniz Institute of Plant Genetics and Crop Plant Research (IPK) in Gatersleben. Besides the long termstorage and frequent regeneration of the material, molecular tools are used for the characterization andutilization of the germplasm. Here data are presented on: (I) The genetic integrity of long term stored genebankaccessions. Examples are given for self-pollinating (wheat) and out-pollinating (rye) crops. For wheat a highdegree of identity was revealed, which underlines the efficiency of the precautions taken by the IPK genebankto preserve genetic integrity. In contrast, the out-pollinating accessions revealed extensive shifts in allelefrequencies. (II) The genetic diversity of wheat and barley germplasm collected at intervals of 40 to 50 years incomparable geographical regions. Here a qualitative, rather than a quantitative shift in diversity was detected.(III) The inter- and intraspecific variation of seed longevity. Genetic studies were initiated in barley, wheat andoilseed rape. Numerous QTLs were detected, indicating the complex and quantitative nature of the trait. Someof the loci identified are in genomic regions which co-localise with genes determining agronomic traits such asspike architecture or biotic and abiotic stress response. (IV) The exploitation of genebank collections using agenome-wide association mapping analysis of a core collection of wheat. The collection was evaluated for thetrait flowering time. In order to investigate trait-marker associations the wheat lines were genotyped usingdiversity array technology (DArT) markers. Some of the associated and mapped markers were detected ingenomic regions where major genes were described earlier. However, in addition new loci appeared, providingnew opportunities to monitor genetic variation for crop improvement in plant breeding programs.Key words: ex situ germplasm collections, genetic integrity, genetic diversity, seed longevity, associationmappingIntroductionWorld-wide about 1.500 ex situ genebanks comprise 7.4 million accessions of plantgenetic resources for food and agriculture. The eight largest collections are listed in table1 (FAO, 2009).Table 1. The eight largest germplasm collections on the globe.Institution Country AccessionsNCGRP (National Center for Genetic Resources Preservation) USA 508,994ICGR-CAAS (Institute of Crop Germplasm Resources , Chinese Academy of China 391,919Agricultural ScienceNBPGR (National Bureau of Plant Genetic Resources) India 366,333VIR (N. I. Vavilov Research Institute of Plant Industry) Russia 322,238NIAS (National Institute of Agrobiological Science) Japan 243,463CIMMYT (Centro Internacional de Mejoramiento de Maíz y Trigo) Mexico 173,571IPK (Leibniz-Institut für Pflanzengenetik und Kulturpflanzenforschung) Germany 148,128ICARDA (International Center for Agricultural Research in the Dry Areas) Syria 132,793Hosting some 150,000 accessions the ‘Federal Ex situ Genebank of Germany’ inGatersleben is one of the largest in the world. It curates about 63,000 cereals, 27,000legumes, 21,000 vegetables, 14,000 forage crops, 8,000 medicinal and spice plants,6,000 oil crops and 6,000 potatoes (Anonymous, 2010). Major research topics are the26

Budapest, Hungary, 2011AGRISAFEinvestigation of the genetic integrity and diversity, studies of seed longevity as well asthe extensive evaluation and genetic characterisation of the genebank accessions. Herewe present data on the successful utilisation of molecular tools for the characterisationand utilisation of germplasm collections.Genetic integrityOne challenge for ex situ genebanks is the maintenance of the genetic integrity of theaccessions after long term maintenance. Contamination due to foreign pollen or incorrecthandling during multiplication will downgrade the genetic identity of the material.Studies of the genetic integrity of genebank accessions employing molecular markers(microsatellites) are achievable at IPK, because both the ex situ collection, consisting ofseeds from the most recent multiplication and a reference (herbarium) collectiondepositing vouchers of each accession, originated from the initial regeneration aremaintained. In the cereal’s herbarium collection from each accession samples of grainsand complete spikes are deposited.The fingerprinting of several accessions of wheat, which had been multiplied betweentwo and 24 times over a 50 year period, revealed a high degree of identity. Nocontamination due to foreign pollen or incorrect handling during the multiplicationcycles could be identified. This underlines the efficiency of the precautions taken by theIPK genebank to preserve the genetic integrity of self-pollinating species (Börner et al.,2000).In contrast, a similar analysis of out-pollinating rye accessions, regenerated 2 - 13 times,revealed extensive shifts in allele frequencies. Whereas at some loci a decrease or evenloss of alleles was observed, at others even new alleles were detected, suggestive of theintroduction of pollen from other populations. The extent of changes observed wasrelated to the number of multiplication cycles (Figure 1). This result is prompting areview of the regeneration management for out-pollinating species in ex situ collections,specifically related to the optimisation of population size and distance betweenregeneration plots (Chebotar et al., 2003).Allele frequency0,60000,50000,40000,3000R 78 19541956195819930,20000,10000,0000123 136 138 140 142 144 146 148 150 152 154 1561 2 3 4 5 6 7 8 9 10 11 12Allele sizeFigure 1. Variation in allele frequency in grain samples of rye accession R 78 harvested in 1954, 1956, 1958and 1993, demonstrating loss of genetic integrity over multiplication cycles.Genetic diversityConcern has been expressed that human activity, in particular urbanization, thereplacement of traditional agricultural systems by modern industrial methods, and the27

AGRISAFE Budapest, Hungary, 2011introduction of modern high-yielding varieties acts to decrease biological diversity. Atthe IPK genebank materials from several recurrent expeditions to comparablegeographical regions are available for studying the extent of genetic diversity over a 40to 50 year period, e.g. from Austria (1922-1932/1982), Nepal (1937/1971), North India(1937/1976) and Albania (1941/1994). The distribution of the collection sites within thecountries was highly similar and, therefore the material provides an excellent basis toquantify changes in genetic diversity over time. Case studies for wheat and barley havebeen performed (Khlestkina et al., 2004; 2006). Genetic diversity was assessed on thebasis of variation at a selection of microsatellite loci distributed randomly across thegenome. The mean number of alleles and the polymorphic information content at eachlocus were calculated. For both species, the clear picture was one of an overall stabilityin the extent of genetic diversity over the 40 to 50 year collection period in all thegeographical regions investigated. However, there was clear evidence for qualitativechanges in diversity, so that about one third of the alleles detected were unique to asingle collection period (Fig. 2). This indicates that allele flow took place during theevolution from traditional agriculture to modern production systems.A range of other studies examining the genetic diversity of wheat (Donini et al., 2000;Manifesto et al., 2001; Christiansen et al., 2002; Roussel et al., 2004) and barley (Backeset al., 2003; Koebner et al., 2003) cultivars bred over the last century in variousgeographical regions or breeding programs, has similarly revealed little evidence thatdiversity loss has resulted from breeding activity.10Number of allelesper locus864201922/32 1982 1941 1994 1937 1976 1937 1971Austria Albania India NepalCollection siteFigure 2. Mean number of alleles per locus detected in bread wheat accessions collected during collectionexpeditions to Austria (1922/32 and 1982), Albania (1941 and 1994), India (1937 and 1976) and Nepal (1937and 1971). Unique alleles are shown in yellow (first expeditions) or blue (later expeditions) columns, commonalleles are indicated by a colour mix.Seed longevityStudies on seed longevity are of existential importance for crop germplasm preservation.At the IPK research was initiated for a range of crops stored in the genebank over28

Budapest, Hungary, 2011AGRISAFEdecades (Nagel and Börner, 2010). Germination after 26 up to 33 years of storage wasassessed among the different crop species (Nagel et al., 2010). Crops showed highgermination when germinated within 5 years post harvest, but germination of mostaccessions within species separated strongly after 20 years. In particular, wheatgermination resulted between 0 and 87% after 34 years of storage whereas barleyaccessions germinated between 43 and 95% after 35 years (Figure 3). So there isvariation for seed longevity both between crop species, and between accessions of thesame species.Figure 3. Mean germination of wheat (Triticum L.) and barley (Hordeum L.) accessions over various years oftesting demonstrates intraspecific variation for seed longevity after long term storage.Due to the same harvest year, the same cleaning methods and storage conditions of thegenotypes of the species under investigation it can be assumed that differences ingermination are genetically based. For the genetic analysis of seed longevity, we haveapplied accelerated ageing tests based on International Seed Testing Association (ISTA)protocols (ISTA, 2008). QTL mapping was performed for barley (Nagel et al., 2009),wheat (Rehman-Arif et al., 2011, same proceedings) and oilseed rape (Nagel et al.,2011). Results indicate, that e.g. in cereals traits like plant height, husks, spike densityjust as abiotic and biotic factors during the growing season can influence the seedlongevity.Association mapping analysisA core collection of 96 winter wheat genotypes from 21 different countries and fivecontinents was considered for a genome wide association mapping analysis. Thesegenotypes were selected from a larger collection created at the Institute of Field and29

AGRISAFE Budapest, Hungary, 2011Vegetable Crops, Novi Sad, Serbia (Kobiljski et al., 2002). The collection wasphenotyped for the trait flowering time in field plots in Novi Sad during six growingseasons between 1994 and 1999. Genotyping using DArT markers was performed byTriticarte Pty. Ltd. (Canberra, Australia; http://www.triticarte.com.au/). In total weconsidered 874 polymorphic markers. The calculation of testing for an associationbetween markers and traits were done with the software programme TASSEL 2.01(Bradbury et al., 2007). The general linear model (GLM) with including the Q-Matrixfrom STRUCTURE as correction for population structure was used. In addition, weapplied the version TASSEL 2.1 exploiting the mixed linear model (MLM) using Q-Matrix and the kinship-Matrix (Yu et al., 2006). Marker-trait-associations (MTAs)significant in both models and with p < 0.05 in four out of six years were consideredonly.Details for genetic map, population structure and linkage disequilibrium using the givencore collection are presented by Neumann et al. (2010). For flowering time 13 MTAswere detected (figure 4) on chromosomes 1B, 1D (2 markers), 2B, 2D, 4B, 5B, 5D, 6A(2 markers), 6B and 7A (2 markers). The MTA on the short arm of chromosome 2D mayrepresent a major photoperiod response (Ppd) gene whereas the associations in thecentromere regions of chromosomes 1B and 1D may reflect variation at known earlinessper se (Eps) genes.1B 1D 2B 2DS 4B 5B 5DS 6A 6B 7AEpsPpdEpscentromereregionFigure 4. MTAs for flowering time marked by arrows. Positions of comparable genes/QTLs described earlierare indicated below arrows (ellipses).Conclusions- A huge amount of accessions are ‚sleeping‘ in shelves of global ex situ collections.- Storability/longevity of the germplasm in seedbanks is limited i.e. there is a needfor research on genetics/physiology of seed longevity.- The genetic integrity of self-pollinators seems to be stable, open-pollinatorschanged during regeneration cycles.- There is little evidence for a significant narrowing of overall diversity. Aqualitative rather than a quantitative shift appeared.30

Budapest, Hungary, 2011AGRISAFE- Association mapping analysis is a feasible strategy to unlock genetic diversity(detection of new genes/alleles).ReferencesAnonymous (2010): Scientific report 2008/2009, Leibniz-Institut für Pflanzengenetik undKulturpflanzenforschung, Gatersleben. 172 pp.Backes, G., Hatz, B., Jahoor, A., Fischbeck, G. (2003) RFLP diversity within and between major groups ofbarley in Europe. Plant Breed., 122, 291-299.Börner, A., Chebotar, S., Korzun, V. (2000) Molecular characterization of the genetic integrity of wheat(Triticum aestivum L.) germplasm after long-term maintenance. Theor. Appl. Genet., 100, 494-497.Bradbury, P. J., Zhang, Z., Kroon, D. E., Casstevens, T. M., Ramdoss, Y., Buckler E.S. (2007) TASSEL:software for association mapping of complex traits in diverse samples. Bioinformatics 23, 2633-2635.Chebotar, S., Röder, M. S., Korzun, V., Saal, B., Weber, W. E., Börner, A. (2003) Molecular studies on geneticintegrity of open pollinating species rye (Secale cereale L.) after long term genebank maintenance. Theor.Appl. Genet., 107, 1469-1476.Christiansen, M. J., Andersen, S. B., Ortitz, R. (2002) Diversity changes in an intensively bread wheatgermplasm during the 20th century. Mol. Breed., 9, 1-11.Donini, P., Law, J. R., Koebner, R. M. D., Reeves, J. C., Cooke, R. J. (2000) Temporal trends in the diversityof UK wheat. Theor. Appl. Genet., 100, 912-917.FAO (2009) Draft second report on the state of the world‘s plant genetic resources for food and agriculture.Commission on Genetic Resources for Food and Agriculture. CGRFA-12/09/Inf.7 Rev.1, 330pp.ISTA (2008) International rules for seed testing. International Seed Testing Association, Bassersdorf.Khlestkina, E. K., Huang, X. Q., Quenum, F. J.-B., Chebotar, S., Röder, M. S., Börner, A. (2004) Geneticdiversity in cultivated plants – loss or stability? Theor. Appl. Genet., 108, 1466-1472.Khlestkina, E. K., Varshney, R. K., Röder, M. S., Graner, A., Börner, A. (2006) A comparative assessment ofgenetic diversity in cultivated barley collected in different decades of the last century in Austria, Albaniaand India by using genomic and genic SSR markers. Plant Genet. Res., 4, 125-133.Kobiljski, B., Quarrie, S. A., Denčić, S., Kirby, J., Iveges M. (2002) Genetic diversity of the Novi Sad wheatcore collection revealed by microsatellites. Cell & Mol. Biol. Letters, 7, 685-694.Koebner, R. M. D., Dononi, P., Reeves, J.C., Cooke, R.J., Law, J.R. (2003) Temporal flux in the moleculardiversity of UK barley. Theor. Appl. Genet., 106, 550-558.Manifesto, M. M., Schlatter, A. R., Hopp, H. E., Suarez, E. Y., Dubcovsky, J. (2001) Quantitative evaluationof genetic diversity in wheat germplasm using molecular markers. Crop Sci., 41, 682-690.Nagel, M., Börner, A. (2010) The longevity of crop seeds stored under ambient conditions. Seed Sci. Res., 2, 1-20.Nagel, M., Rehman-Arif, M.A., Rosenhauer, M., Börner, A. (2010) Longevity of seeds - intraspecificdifferences in the Gatersleben genebank collections. Tagungsband 60. Tagung der Vereinigung derPflanzenzüchter und Saatgutkaufleute Österreichs, Gumpenstein, Österreich, 24-26 November 2009, 179-181.Nagel, M., Rosenhauer, M., Willner, E., Snowdon, R. J., Friedt, W., Börner, A. (2011) Seed longevity inoilseed rape (Brassica napus L.) – genetic variation and QTL mapping. Plant Genet. Res.:Characterisation and Utilisation, (in press).Nagel, M., Vogel, H., Landjeva, S., Buck-Sorlin, G., Lohwasser, U., Scholz, U., Börner, A. (2009) Seedconservation in ex situ genebanks – genetic studies on longevity in barley. Euphytica, 170, 5-14.Neumann, K., Kobiljski, B., Denčić, S., Varshney, R. K., Börner, A. (2010) Genome-wide associationmapping: a case study in bread wheat (Triticum aestivum L.). Mol Breed., 27, 37-58.Rehman-Arif, M., A., Nagel, M., Lohwasser, U., Börner, A. Long term seed storability in genebank collections- genetic studies in wheat. Proceedings 'Climate Change and Plant Breeding Answers', Joint AGRISAFE –EUCARPIA Workshop for Young Cereal Scientists, Budapest, Hungary, 21-23 March 2011.Roussel, V., Koenig, J., Beckert, M., Balfourier, F. (2004) Molecular diversity in French bread wheataccessions related to temporal trends and breeding programmes. Theor. Appl. Genet., 108, 920-930.Yu, J., Buckler, E. S. (2006) Genetic association mapping and genome organization of maize. Current Opinionin Biotechnology, 17, 155-160.31

AGRISAFE Budapest, Hungary, 2011BREEDING FOR IMPROVED FUSARIUM HEAD BLIGHTRESISTANCE IN WHEATH. BUERSTMAYRBOKU - University of Natural Resources and Life Sciences Vienna, Department for Agrobiotechnology (IFA-Tulln), Institute for Biotechnology in Plant Production, Konrad Lorenz Str. 20, A-3430 Tulln, Austria, e-mail:hermann.buerstmayr@boku.ac.atAbstract Breeding for improved Fusarium head blight resistance is an important task for many wheat breedersalmost worldwide. Genetic variation for this trait is large in the wheat gene pool. Several options for selectionare available, such as phenotypic selection using inoculated experiments and marker-assisted selection usingmolecular markers linked to validated resistance QTLs. A skilful combination of marker-assisted andphenotypic selection appears an attractive strategy for improving this trait in new cultivars.Key words: Fusarium head blight, mycotoxin, wheat, marker-assisted selection, phenotypic selectionIntroductionFusarium head blight (FHB) also called ‘head scab’ or ‘Fusarium ear blight’ (FEB) is animportant fungal disease of cereals including wheat. Although Fusarium spp., includingF. graminearum, F. avenaceum and F. culmorum, can attack every part of the plant,especially the colonization of the ear and the kernels is a serious problem mainly due tomycotoxin contamination of the grains. The disease occurs in most areas of the worldwhere cereals are grown. FHB infections happen especially when abundant inoculum(ascospores or conidia) coincides with warm and wet weather during anthesis. Control ofthe disease is challenging. Detailed information on Fusarium diseases of cereals has beencomplied by Leonard and Bushnell (2003) who report in 18 book chapters a range ofaspects on Fusarium diseases of small grain cereals, including the pathogen, theassociated mycotoxins, resistance breeding and other control options as well as the socialand economic impact of the disease.Importance of the diseaseGrain produced by intensive farming, low-input farming and organic farming are allaffected by FHB. Growing resistant cultivars plays a key role to reduce the threat ofFusarium-mycotoxin contamination of cereals. Resistance to FHB in wheat is ofquantitative, multigenic nature. It is a tedious, expensive and time consuming task forplant breeders to develop FHB resistant cultivars adapted to local conditions.Specificity and components of resistanceResistance to Fusarium head blight is a truly quantitative trait modulated by both thegenotype and the environmental conditions. No immune genotype has been reported todate, but large quantitative variation is evident in the wheat gene pool (see e.g. Snijders1990, Saur 1991, Mesterhazy 1995, Mielke 1995, Buerstmayr et al. 1996, Rudd et al.2001, Zhang et al. 2008, McKendry 2008, Sneller et al. 2010). Unlike resistance to arange of obligate pathogens, resistance to Fusarium head blight appears neither speciesspecificnor race-specific (Mesterhazy 1987, 1988, Stack and McMullen 1985, Snijdersand Van Eeuwijk 1991, Van Eeuwijk et al. 1995, Toth et al. 2008).Fusarium resistance in wheat is modulated by active physiological resistance reactionsand by passive, morphological (e.g. plant height, ear type) and developmental (e.g.earliness) plant characters. Schroeder and Christensen (1963) proposed two componentsof active resistance, designated as type 1 and type 2. Type 1 resistance operates against32

Budapest, Hungary, 2011AGRISAFEinitial infection and type 2 against spread of the disease along the wheat ear. Furthercomponents of resistance have been described such as resistance to the fungal toxindesoxynivalenol (Miller and Arnison 1986, Wang and Miller 1988, Lemmens et al.2005) and resistance to kernel infection (Mesterhazy et al. 1999).Testing of wheat for FHB resistanceEvaluating wheat genotypes for FHB resistance requires a reproducible inoculationmethod and quantitative disease assessment. The severity of FHB is a quantitative traitthat is modulated by genetic factors and environmental conditions influence the infectionprocess leading to significant genotype-by-environment interactions (Campbell andLipps 1998, Fuentes et al. 2005). Therefore, usually measures are taken to provokeFusarium infections and apply uniform inoculum pressure. FHB resistance is a complextrait and not one single, simple way of measuring FHB resistance exists. For a moreinformation on inoculation and evaluation methods see Dill-Macky (2003).Genetics of FHB resistanceDuring the past decade, numerous studies have been published on molecular geneticanalysis of FHB resistance in wheat. A comprehensive overview of the currentknowledge on mapped QTL for Fusarium head blight resistance was provided byBuerstmayr et al. (2009) who summarized the relevant findings from 52 quantitative traitloci (QTL) mapping studies, nine research articles on marker-assisted selection andseven on marker-assisted germplasm evaluation. They illustrated the position ofpublished QTL in a consensus linkage map and provided extensive tables summarizingthe essential information on FHB resistance QTL. In a QTL meta-analysis Löffler et al.(2009) used the results from 30 mapping populations and identified 19 meta-QTL on 12wheat chromosomes, which are in agreement to a large extent with the results fromBuerstmayr et al. (2009). Also Liu et al. (2009) performed a QTL meta-analysis of FHBresistance in wheat. They grouped FHB resistance QTL into 43 clusters on 21 wheatchromosomes and highlighted 19 confirmed QTL on 8 chromosomes. An overview ofFHB resistance QTL found in European winter wheat was published by Holzapfel et al.(2008).Breeding for improved FHB resistanceFor the most part breeding for improved FHB resistance relied on intensive fieldscreening of breeding populations. This strategy has been highly successful and led tothe development of significantly improved cultivars. Recently also marker assistedselection became an attractive option for resistance breeding (Anderson et al. 2007,Buerstmayr et al. 2009, Löffler et al. 2009, Liu et al. 2009, Von der Ohe et al. 2010,Salameh et al. 2010). For example, Von der Ohe et al. (2010) used marker assisted backcrossingof the two spring wheat derived FHB resistance QTL Fhb1 and Qfhs.ifa-5A intotwo different winter wheat cultivars. Lines with the spring wheat derived QTL showedsignificantly improved FHB resistance. In a similar approach Salameh et al. (2010) backcrossedthe same QTL (Fhb1 and Qfhs.ifa-5A) into nine different winter wheat varietiesand obtained a comparable result. The major difference between these two studies wasthat Von der Ohe et al. (2010) found Qfhs.ifa-5A alone almost as efficient as acombination of tow QTL while Salameh et al. (2010) found that Fhb1 alone was almostas efficient as Fhb1 plus Qfhs.ifa-5A combined. A skilful combination of marker assisted33

AGRISAFE Budapest, Hungary, 2011selection for major QTL with subsequent phenotypic selection appears a useful breedingstrategy. In the coming years completely novel approaches using genomic selectionemploying high-density marker genotyping in breeding populations may becomerealistic for wheat improvement (Heffner et al. 2009, 2010).AcknowledgementsI gratefully acknowledge funding of the FHB resistance research at IFA-Tulln by theAustrian Science Funds FWF, project number F3711-B11.ReferencesAnderson, J. A., Chao, S. M., Liu, S. X. (2007): Molecular breeding using a major QTL for Fusarium headblight resistance in wheat. Crop Sci., 47, S112-S119.Buerstmayr, H., Lemmens, M., Grausgruber, H., Ruckenbauer, P. (1996): Scab resistance of internationalwheat germplasm. Cereal Res. Commun., 24, 195-202.Buerstmayr, H., Ban, T., Anderson, J. A. (2009): QTL mapping and marker-assisted selection for Fusariumhead blight resistance in wheat: a review. Plant Breed., 128, 1-26.Campbell, K. A. G., Lipps, P. E. (1998): Allocation of resources: Sources of variation in Fusarium head blightscreening nurseries. Phytopathology, 88, 1078-1086.Dill-Macky, R. (2003): Inoculation methods and evaluation of Fusarium head blight resistance in wheat. InLeonard, K. J., Bushnell, W. R. (ed.) Fusarium Head Blight of Wheat & Barley, Amer. PhytopathologicalSoc., St Paul, 184-210.Fuentes, R. G., Mickelson, H. R., Busch, R. H., Dill-Macky, R., Evans, C. K., Thompson, W. G., Wiersma, J.V., Xie, W., Dong, Y., Anderson, J. A. (2005): Resource allocation and cultivar stability in breeding forFusarium head blight resistance in spring wheat. Crop Sci., 45, 1965-1972.Heffner, E. L., Lorenz, A. J., Jannink, J. L., Sorrells, M. E. (2010): Plant breeding with genomic selection: gainper unit time and cost. Crop Sci., 50, 1681-1690.Heffner, E. L., Sorrells, M. E., Jannink, J. L. (2009): Genomic selection for crop improvement. Crop Sci., 49,1-12.Holzapfel, J., Voss, H. H., Miedaner, T., Korzun, V., Häberle, J., Schweizer, G., Mohler, V., Zimmermann, G.,Hartl, L. (2008): Inheritance of resistance to Fusarium head blight in three European winter wheatpopulations. Theor. Appl. Genet., 117, 1119-1128.Lemmens, M., Scholz, U., Berthiller, F., Dall'Asta, C., Koutnik, A., Schuhmacher, R., Adam, G., Buerstmayr,H., Mesterhazy, A., Krska, R., Ruckenbauer, P. (2005): The ability to detoxify the mycotoxindeoxynivalenol colocalizes with a major quantitative trait locus for fusarium head blight resistance inwheat. Mol. Plant-Microbe Interact., 18, 1318-1324.Leonard, K. J., Bushnell, W. R. (2003): Fusarium head blight of wheat and barley. AmericanPhytopathological Society (APS Press), St. Paul, USA.Liu, S. Y., Hall, M. D., Griffey, C. A., McKendry, A. L. (2009): Meta-analysis of QTL associated withFusarium head blight resistance in wheat. Crop Sci., 49, 1955-1968.Löffler, M., Schön, C. C., Miedaner, T. (2009): Revealing the genetic architecture of FHB resistance inhexaploid wheat (Triticum aestivum L.) by QTL meta-analysis. Mol. Breed., 23, 473-488.McKendry, A. (2008): Native resistance: An essential building block for accelerating the development of Scabresistant soft red winter wheat. Cereal Res. Commun., 36, 135-137.Mesterhazy, A. (1987): Selection of head blight resistant wheats through improved seedling resistance. PlantBreed., 98, 25-36.Mesterhazy, A. (1988): Expression of resistance of wheat to Fusarium graminearum and F. culmorum undervarious experimental conditions. J. of Phytopathol., 123, 304-310.Mesterhazy, A. (1995): Types and components of resistance to Fusarium head blight of wheat. Plant Breed.,114, 377-386.Mesterhazy, A., Bartok, T., Mirocha, C. G., Komoroczy, R. (1999): Nature of wheat resistance to Fusariumhead blight and the role of deoxynivalenol for breeding. Plant Breed., 118, 97-110.Mielke, H. (1995): Untersuchungen zur Anfälligeit verschiedener Weizensorten gegenüber der PartiellenTaubährigkeit (Fusarium culmorum (W.G.Sm) Sacc.). Nachrichtenblatt des DeutschenPflanzenschutzdienstes, 74, 254-262.Miller, J. D., Arnison, P. G. (1986): Degradation of deoxynivalenol by suspension cultures of the Fusariumhead blight resistant wheat cultivar Frontana. Can. J. Plant Pathol,. 8, 147-150.34

Budapest, Hungary, 2011AGRISAFERudd, J. C., Horsley, R. D., McKendry, A. L., Elias, E. M. (2001): Host plant resistance genes for fusariumhead blight: Sources, mechanisms, and utility in conventional breeding systems. Crop Sci., 41, 620-627.Salameh, A., Buerstmayr, M., Steiner, B., Neumayer, A., Lemmens, M., Buerstmayr, H. (2010): Effects ofintrogression of two QTL for fusarium head blight resistance from Asian spring wheat by marker-assistedbackcrossing into European winter wheat on fusarium head blight resistance, yield and quality traits. Mol.Breed., online first, DOI 10.1007/s11032-010-9498-x.Saur, L. (1991): Recherce de géniteurs de résistance à la fusariose de l'épi causée par Fusarium culmorum chezle blé et les especes voisines. (Sorces of resistance to head blight caused by Fusarium culmorum in breadwheat and related species). Agronomie, 11, 535-541.Schroeder, H. W., Christensen, J. J. (1963): Factors affecting resistance of wheat to scab caused by Gibberellazeae. Phytopathology, 53, 831-838.Sneller, C. H., Paul, P., Guttieri, M. (2010): Characterization of resistance to Fusarium head blight in aneastern US soft red winter wheat population. Crop Sci., 50, 123-133.Snijders, C. H. A. (1990): Genetic variation for resistance to Fusarium head blight in bread wheat. Euphytica,50, 171-179.Snijders, C. H. A., Van Eeuwijk, F. A. (1991): Genotype x strain interactions for resistance ton Fusarium headblight caused by Fusarium culmorum in winter wheat. Theor. Appl. Genet., 81, 239-244.Stack, R. W., McMullen, M. I. (1985): Head blighting potential of Fusarium species associated with springwheat heads. Can. J. Plant Pathol., 7, 79-82.Toth, B., Kaszonyi, G., Bartok, T., Varga, J., Mesterhazy A. (2008): Common resistance of wheat to membersof the Fusarium graminearum species complex and F. culmorum. Plant Breed., 127,1-8.Van Eeuwijk, F. A., Mesterhazy, A., Kling, C. I., Ruckenbauer, P., Saur, L., Burstmayr, H., Lemmens, M.,Keizer, L. C. P., Maurin, N., Snijders, C. H. A. (1995): Assessing non-specificity of resistance in wheat tohead blight caused by inoculation with European strains of Fusarium culmorum, F. graminearum and F.nivale using a multiplicative model for interaction. Theor. Appl. Genet., 90, 221-228.Von der Ohe, C., Ebmeyer, E., Korzun, V., Miedaner, T. (2010): Agronomic and quality performance of winterwheat backcross populations carrying non-adapted fusarium head blight resistance QTL. Crop Sci., 50,2283-2290.Wang, Y. Z., Miller, J. D. (1988): Effects of Fusarium graminearum metabolites on wheat tissue in relation toFusarium head blight resistance. J. Phytopathol., 122, 118-125.Zhang, J. X., Jin, Y., Rudd, J. C., Bockelman, H. E. (2008): New fusarium head blight resistant spring wheatgermplasm identified in the USDA national small grains collection. Crop Sci., 48, 223-235.35

AGRISAFE Budapest, Hungary, 2011FROM GENE DISCOVERY TO COMPLEX PHENOTYPINGIN IMPROVING DROUGHT ADAPTATIOND. DUDITS 1 – J. GYÖRGYEY 1 – É. SÁRVÁRI 2 – B. HOFFMANN 4 – G.V. HORVÁTH 1 –L. SASS 1 – I. VASS 1 – J. PAUK 3¹Instute of Plant Biology, Biological Research Center, H.A.S. Szeged² Department of Plant Physiology and Molecular Plant Biology, Institute of Biology, Eötvös LorándUniversity, Budapest,³ Cereal Research Non-Profit Ltd. Szeged,4 Georgikon Faculty, University of Pannonia, Keszthely, HungaryCorresponding author: dudits@brc.huAbstract In Hungary the yield of cereal crops can be significantly limited by water shortage, especially theincreasing frequency of drought seasons can have devastating economic impact for farmers. In attempts toensure yield security plant breeding has a pivotal role and nowadays the successes in production of stresstolerant genotypes depend on combination of traditional and molecular, genomic approaches. Detailedphysiological and transcriptional characterization of sensitive and tolerant plants is expected to provide aconceptional and methodological support for improvement of abiotic stress tolerance. Here we present resultsof comparison between two wheat genotypes representing an escaper (a landrace Kobomugi) and an adaptive(cv. Plainsman V) variants. The yield stability of the Plainsman V plants was linked with improvedphotosynthesis, fructose accumulation and larger root system. Kobomugi plants responded with increase inlipid peroxidation and activation of superoxide dismutases. The gene expression profiles detected bymicroarray analyses of RNAs from roots of plants grown under stress and normal conditions allowed theidentification of various gene clusters highlighting key genes of stress adaptation. Among the candidate genesthe aldose reductase gene has been tested by production of overproducing genotypes. For detailed analysis ofthese wheat plants we have developed a complex stress diagnostic system that is based on various imagingtechnologies. This high-throughput phenotyping provides pixel data for organ size, plant growth rate, thermalimages and chlorophyll fluorescence parameters. The presented experiments may contribute to theestablishment of an integrated platform that combines advantages of functional genomics and phenotyping forsupport ongoing breeding programs.Key words: wheat, drought, root, yield, transcript profiling, aldose reductase, transgenic, imaging.IntroductionWater availability is considered as one of the major limiting factors in agriculturalproduction, therefore the efficient use of water has high priority in ensuring the increasingfood demand. In addition to the soil management and irrigation technologies thephysiological traits of cultivated crops can contribute to yield stability under suboptimalgrowing conditions such as drought. Nowadays, the breeding programs for improvement oftolerance to environmental stresses, yield of biomass and seed can be efficiently supported byQTL analysis, association mapping of genes for correlation of genetic markers withphenotypes, identification, cloning of resistance genes and their transfer into transgenic plants(Takeda and Matsuoka 2008; Tuberosa and Salvi 2006; Zhao et al. 2008).Plants are able to rely on different strategies in reducing damages caused by drought. Theescapers tend to complete their life cycle before the onset of severe stress. Avoidance ofconsequences of drought stress can be realized by maintenance of a high tissue waterpotential through minimizing water loss and maximizing water uptake. Drought tolerance canbe achieved via coordination of physiological and biochemical alterations at the cellular andmolecular levels, including specific gene expression and accumulation of protective proteinsduring drought stress (Chaves & Oliveira 2004). In long-term adaptation based on anavoidance strategy the longer size and higher number of roots can have an important role bytaking up relatively high amounts of residual water even from deeper soil zones (reviewed byShao et al. 2008). Recently, increasing numbers of studies have concentrated on droughttolerance of wheat at physiological and biochemical levels (Izanloo et al. 2008), or analysis36

Budapest, Hungary, 2011AGRISAFEof gene expression in response to severe or mild long-term water deficit (Aprile et al. 2009).Production of transgenic plants is an essential component in functional characterization ofstress-related genes (reviewed by Bhatnagar-Mathur et al.2008). As an alternative approachpreviously we have shown that ectopic synthesis of the alfalfa aldo-keto reductase (MsALR)enzyme in tobacco plants could prevent the increase of drought-induced formation ofhydroxyl radicals, hydrogen peroxide and lipid peroxidation products. These effects couldimprove photosynthetic activity of the transgenic plants under stress conditions (Oberschall etal.2003; Hideg et al. 2003). This approach has also been tested in wheat as shown in thiswork.As we can experience, various phenotyping technologies are gaining significant attentionsand used for characterization of stress responses. The automated system, PHENOPSIS isbased on the analysis of response curves of leaf development to water deficit by comparisonof set of A. thaliana genotypes (Granier et al. 2006). Monitoring leaf growth rate has beenused as indicator for functional status of stressed plants (Chenu et al. 2008).In the present work we aim to highlight some basic components of stress adaptationcapability by complex characterization of two remote wheat genotypes grown in aridclimates. Plainsman V is a North American winter wheat cultivar bred to give an acceptableyield even under drought stress; such an avoidance response is an important component in itsadaptation. Kobomugi is an old, spontaneously selected landrace from inner Asia, with moredependence on the escape responses.Materials and methodsFor identification of yield components and physiological parameters Plainsman V andKobomugi plants were grown in pots with 20 or 40% soil water content as stress treatmentand 60-80% water content as control combination (Sečenji et al. 2010); B. Hoffmannunpublished). Measurement of stomatal conductance and CO 2 assimilation rate of intactleaves were performed at 600 mol m -2 s -1 light intensity with IRGA (LCA-2). Sugars weredetected by the anthrone method after separation by thin layer chromatography (HPTLC, 60F 254 , Merck). Malondialdehyde content was determined according to Heath and Packer(1968). Superoxide dismutase isoenzymes were detected on native PAGE by activity stainingas in Jakab et al. (1999).The gene activity profiles in roots of these genotypes exposed to drought stress for 4 weekswere identified by cDNA microarray as described by Sečenji et al. (2010). For production ofstable wheat transformants the pAHC25 plasmid carrying the selectable bar gene(Christensen and Quail1996) and the MsALR cDNA encoding aldo-keto reductase(Oberschall et al. 2000) was bombarded into embryogenic callus tissues of immatureembryos of CY-45 genotype. In the complex stress diagnostic system growth of wheat plantswas monitored by digital photography. The leaf evaporation was assessed by measuring leaftemperature relative to the surrounding air using sensitive thermo camera.Results and discussionBasic parameters of two wheat genotypes relying on different defence strategies underdrought stressDuring natural selection plants have gained various set of capabilities to cope with extremeenvironmental effects. Understanding the basic molecular mechanisms of these adaptationprocesses and identification of corresponding genes and proteins are essential prerequisitesfor successful use of genomic methods in plant breeding programmes. In the present studieswe compare the water stress responses of the Plainsman V and Kobomugi plants. As shownby Figure 1, these two variants represent extreme cases since Plainsman V plants exhibit high37

AGRISAFE Budapest, Hungary, 2011water use efficiency (WUE) and only 12% yield loss at low water content in the soil. Incontrast these parameters reflect the most severe damage of Kobomugi plants.Figure 1. Correlation between water use efficiency (WUE) and yield potential under low water content of soil.Identification of genotypes with extreme stress responses.Beyond the yield performance the two variants differ significantly in series of physiologicalcharacters (Figure 2). The Kobomugi plants have reduced stomatal opening that is linkedwith less efficient CO ² fixation. The accumulation of fructose in leaves of Plainsman V plantscan provide osmotic protection for cells under stress. The elevated level of lipid peroxidationand CuZn superoxide dismutase activity can be a sign for the escaper nature of Kobomugiplants.Figure 2. Agronomic traits and physiological parameters of wheat genotypes representing an escaper (alandrace Kobomugi ) and an adaptive (cv. Plainsman V) variants under drought stress.Genotype-dependent gene activity profiles in roots: hunting for genes improving stressadaptationBeyond of the detected differences in agronomic traits and physiological functions we canexpect essential changes in gene expression profiles as these two genotypes are compared.Since roots are firstly exposed to the decrease in soil water content and they generate stresssignals to green plant organs, transcriptome analysis of root tissues can provide a deep insightinto molecular bases of stress resistance mechanisms. In roots of the Plainsman V plants,7.4% of the analysed genes demonstrated a more than twofold increase in expression inconsequence of the reduced irrigation, in comparison with 4.7% in Kobomugi plants, with2% of genes displaying increased expression in both genotypes. For down regulated genes,38

Budapest, Hungary, 2011AGRISAFEthe observed frequences of responding genes were 8.4%, 4.9% and 2%, respectively. Up- anddown-regulation of the examined genes occurred mostly in the first 2 weeks of drought stress(Sečenji at al. 2010). Figure 3 presents a characteristic cluster of genes that are up-regulatedonly in drought-treated roots of Kobomugi plants. These data also show typical patterns forindividual genes.Figure 3. Representatives of gene clusters that are specifically activated in root tissues of Kobogumi genotypeexposed to a prolonged period of water limitation.An increase in the synthesis of glyosalase can serve as protective function by the metabolismof glyoxal and methylglyoxal, to less reactive products. The activation curve of glutathioneS-transferase (GST) gene shows a different pattern with a peak in roots exposed to stress forfour weeks. GSTs are glutathione-dependent detoxifying enzymes and the correspondinggenes may be activated by chemical stress factors such as safeners (Dixon and Edwards2010). Different members of GST gene family responded differentially to drought stress inwheat root tissues (Sečenji at al. 2010). The activation of a putative respiratory burst oxidase(RBOH) gene is also specific only for the Kobomugi genotype. These enzymes belong to thefamily of NADPH oxidases transferring electrons from NADPH to an electron acceptorleading to the formation of reactive oxygen species (ROS). ROS production is involved ingrowth of root hair cells through controlling the activity of calcium channels required forpolar growth (Carol and Donan 2006). According to the present transciptome analysis a set ofdrought responsive genes were preferentially activated in roots of Plainsman V plants (Figure4) A significant continuous transcript accumulation was characteristic for a receptor likekinase gene. Figure 4 also shows a strong activation of a nucellin-like asparto protease (AP).The involvement of plant APs in proteolytic processing and protein turnover has also beenproposed (Simoes and Faro 2004). Under water limitation the drought-susceptible commonbean cultivars showed upregulation of an AP gene and enzyme activity (Cruz de Carvalho etal. 2001). Activation of a putative translation initiation factor gene was also detected in rootsof Plainsman V plants exposed to water limitation. In addition to the cultivar specific geneexpression profiles shown here, Sečenji at al. (2010) listed several wheat unigenes that werepermanently up-regulated in Plainsman V and transiently up-regulated in Kobomugi plants.Among those genes encoding plasma membrane H+-ATPase, beta-glucosidase isozyme 2precursor, ribosomal protein L3 and peroxiredoxin proteins showed 4-6 fold change relativeto initial control in mRNA levels during four weeks of drought stress treatment.39

AGRISAFE Budapest, Hungary, 2011Figure 4. Selected genes with significant induction in roots of cv. Plainsman cultivar during water stress.The presented transcriptome data can help to uncover protective pathways functioning inadaptation processes in root tissues of wheat plants.A complex stress diagnosis system for phenotyping of wheat plantsIn accordance with multiple alterations in plant phenotype and physiology, the monitoring ofstress responses requires the simultaneous use of several parameters as organ size, growthrate, water metabolism and photosynthetic function in identification of resistant or sensitivevariants. In the case of drought stress the water limitation can be safely insured undergreenhouse conditions. As shown by Figure 5 significant phenotypic differences can berecognized between wheat plants grown in soil with the relative water content either 20% (fordrought stressed plants) or 60% (for control plants).Figure 5. Growth retardation of wheat plants at low soil water content in greenhouse experiment, based on thecomplex stress diagnostic system.The large scale phenotyping of stressed plants has been already based on digital imageanalysis for the measurement of leaf area and relative growth rate (Chenu et al. 2008; Granieret al. 2006). In the present study individual wheat plants at different developmental stagesand size were photographed from 11 sideways position and the average number of pixels40

Budapest, Hungary, 2011AGRISAFEbelonging to green plant parts were calculated. Based on a calibration curve between thepixel number and the actual above-ground mass we could follow the response of control(CY45) and transgenic lines (AKR284; AKR322; AKR304) that were transformed with theMedicago aldo-keto reductase cDNA gene (Figure 6).Figure 6. Biomass production measured by imaging as above-ground weight of control (CY-45, -□-) andtransgenic (AKR 284-X-; AKR 322-○-; AKR 304-∆-) plants under water deficit conditions.Under limited water supply the transgenic plants (AKR284) showed a reduced growthretardation in comparison to the CY45 plants (Figure 7). Since the actual water status ofstressed leaves is reflected by their temperature the transpiration function of differentgenotypes can be analysed by thermal imaging that allows to determine the temperaturedifference (∆T) between the leaf and surrounding air (Merlot et al. 2002).Figure 7. Differences in damagescaused by water limitation betweencontrol (A) and transgenic (B) plantscarrying the aldo-keto reductase cDNAfrom alfalfa.Figure 8. Thermal imaging of control (CY-45) and transgenic(AKR 284, 304) wheat plants grown at optimal (60% soilwater content) and suboptimal (20% soil water content) watersupply. The temperature of the background was subtractedfrom each picture which thus show the temperature differenceof the plants relative to the environment. The artificial colorscale represents a 5 o C range were temperature decreases in thewhite-red-green-blue direction. The low leaf temperature of thei l li i d il bili fl l41

AGRISAFE Budapest, Hungary, 2011As shown by Figure 8 the T values indicate 3,2-3,6 o C degree difference in the case of wellwateredplants. The normal rate of water evaporation resulted in a lower temperature ofwheat tissues.The limitation in water supply increased the temperature of leaves that is reflected by lowerT value (2.7 o C) in the control plants grown at 20 % soil water content. The thermo imagingdata clearly show the maintenance of transpiration in the case of transgenic plants at waterlimitation. The T values of these plants were also higher than 3 o C and their thermal statuswas not significantly different from the well-watered plants even under water limitation. Thethermal status of the analyzed plants at different water supply can also be evaluated in Figure8. All these studies indicate a better functionality of transgenic plants under drought that wasalso reflected by higher net photosynthetic activities (data not shown).ConclusionsGenetic potential of cultivated plants is one of the key determinants that are responsible foryield security. Originally plant breeding is an intuitive art using a varieties of approaches formodification of gene pools in crop species. Presently it is evident that specific knowledgefrom molecular biology including functional genomics, proteomics, systems biology andmetabolomics has opened a new horizon in identification of agronomic genes andengineering metabolic pathways to optimize traits including stress adaptation. The transcriptprofiling of drought responses in roots has highlighted several candidate genes withactivation under water limitation. Production of transgenic wheat plants with the aldo-ketoreductase overproduction resulted in an improved stress adaption. For characterization ofstress responses we described here a complex stress diagnostic system that allowsphenotyping of genetic variants.AcknowledgementsThis work was supported by grants OTKA T046495, K76273 of the Hungarian National ScienceFoundation, Bio-140-KPI of NKTH, NKTH NAP-Bio-06, OMFB-00515 ⁄ 2007 and WTZHUN 2 ⁄001 of the German-Hungarian bilateral programme.ReferencesAprile, A., Mastrangelo, A. M., De Leonardis, A. M., Galiba, G., Roncaglia, E., Ferrari, F., De Bellis, L.,Turchi, L., Giuliano, G., Cattivelli, L. (2009): Transcriptional profiling in response to terminal droughtstress reveals differential responses along the wheat genome. BMC Genomics, 10, 279.Bhatnagar-Mathur, P., Vadez, V., Sharma, K. K. (2008): Transgenic approaches for abiotic stress tolerance inplants: retrospect and prospects. Plant Cell Rep., 27, 411–424.Carol, R., J., Dolan, L. (2006): The role of reactive oxygen species in cell growth: lessons from root hairs. JExp Bot.; 57, 1829-34.Chaves, M.M., Oliveira, M.M. (2004): Mechanisms underlying plant resilience to water deficits: prospects forwater-saving agriculture. J. Exp. Bot., 55, 2365–2384.Chenu, K., Chapman, S. C., Hammer, G. L., McLean, G., Salah H. B. H., Tardieu, F. (2008): Short-termresponses of leaf growth rate to water deficit scale up to whole-plant and crop levels: an integratedmodelling approach in maize. Plant Cell Environ., 31, 378–391.Christensen, A. H., Quail, P. H. (1996): Ubiquitin promoter-based vectors for high-level of expression ofselectable and/or screenable marker gene in monocotyledone plants. Transgenic Res., 5, 213–218.Cruz de Carvalho, M. H., d’Arcy-Lameta, A., Roy-Macauley, H., Gareil, M., El Maarouf, H., Pham-Thi, A. T.,Zuily-Fodil, Y. (2001): Aspartic protease in leaves of common bean (Phaseolus vulgaris L.) and cowpea(Vigna unguiculata L. Walp): enzymatic activity, gene expression and relation to drought susceptibility.FEBS Lett., 492, 242–246.Dixon, D.,P., Edwards, R. (2010): Roles for stress-inducible Lambda glutathione transferases in flavonoidmetabolism in plants as identified by ligand fishing. The Journal of Biological Chemistry, 285, 4736322–36329.42

Budapest, Hungary, 2011AGRISAFEGranier, C., Aguirrezabal, L., Chenu, K., Cookson, S. J., Dauzat, M., Hamard, P., Thioux, J. J., Roland, G.,Bouchier-Combaud, S., Lebaudy, A., Muller, B., Simonneau, T., Tardieu, F. (2006): FENOPSIS, anautomated platform for reproducible phenotyping of plant responses to soils water deficit in Arabidopsisthaliana permitted the identification of an accession with low sensitivity to soil water deficit. New Phytol.,169, 623–635.Heath, R. L., Packer, L. (1968): Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry offatty acid peroxidation. Archives of Biochemistry and Biophysics, 125, 189–198.Hideg, É., Nagy, T., Oberschall, A., Dudits, D., Vass, I. (2003): Detoxification function of aldose/aldehydereductase during drought and ultraviolet-B (280-320 nm) stresses. Plant Cell Environ., 26, 513–522.Izanloo, A., Condon, A. G., Langridge, P., Tester, M., Schnurbusch, T. (2008): Different mechanisms ofadaptation to cyclic water stress in two South Australian bread wheat cultivars. J. Exp. Bot., 59, 3327–3346.Jakab, J., Király, I., Sárvári, É., Láng, F. (1999): Testing of drought tolerance in wheat varieties on the basis ofphotosynthetic and O 2 scavenging performance. Acta Agr. Hung., 47, 347-356.Merlot, S., Mustilli, A. C., Genty, B., North, H., Lefebvre, V., Sotta, B., Vavasseur, A., Giraudat, J. (2002):Use of infrared thermal imaging to isolate Arabidopsis mutants defective in stomatal regulation. Plant J.,30, 601–609.Oberschall, A., Deák, M., Török, K., Sass, L., Vass, I., Kovács, I., Fehér, A., Dudits, D., Horváth, V. G.(2000): A novel aldose/aldehyde reductase protects transgenic plants against lipid peroxidation underchemical and drought stresses. Plant J., 24, 434–446.Sečenji, M., Lendvai, Á., Miskolczi, P.,. Kocsy, G., Galle, Á.,. Szücs, A.,. Hoffmann, B., Sárvári, É.,.Schweizer, P., Stein, N., Dudits, D., Györgyey, J. (2010): Differences in root functions during long-termdrought adaptation: comparison of active gene sets of two wheat genotypes. Plant Biology, 12, 871–882.Shao, H-B., Chu, L-Y., Jaleel, C. A., Zhao, C-X. (2008): Water-deficit stress-induced anatomical changes inhigher plants. C. R. Biologies, 331, 215–225.Simões, I., Faro, C. (2004): Structure and function of plant aspartic proteinases. Eur J Biochem., 271, 2067-2075.Takeda, S., Matsuoka, M. (2008): Genetic approaches to crop improvement: responding to environmental andpopulation changes. Nature Rev Genet., 9, 444–457.Tuberosa, R., Salvi, S. (2006): Genomics-based approaches to improve drought tolerance of crops. TrendsPlant Sci., 11, 405–412.Zhao, C-X., Guo, L-Y., Cheruth, JA., Shao, H-B., Yang, H-B. (2008): Prospectives for applying molecular andgenetic methodology to improve wheat cultivars in drought environments. C R Biol., 331, 579–586.43

AGRISAFE Budapest, Hungary, 2011IMPROVING ABIOTIC STRESS TOLERANCE VIAMARKER-ASSISTED APPROACHESR. TUBEROSA – M. MACCAFERRI – S. SALVIDepartment of Agroenvironmental Sciences and Technology, University of Bologna, ItalyKey words: abiotic stress, Quantitative Trait Loci, marker-assisted selection, genomicsIntroductionTranslating the knowledge gained from molecular studies is one of the most difficultchallenges faced by the scientific community (Xu and Crouch, 2008; Luo, 2010).Although substantial progress has been achieved in identifying the quantitative trait loci(QTL) regulating adaptation to abiotic stress (Hirel et al., 2007; Maccaferri et al.,2008a), the contribution of this knowledge toward the release of improved cultivars hasso far been limited (Collins et al., 2008; Serraj et al., 2009). This review summarizes themain results achieved in mapping QTL for abiotic stress tolerance and presents exampleson how marker-assisted selection (MAS) has been deployed toward crop improvement.QTL for abiotic stress toleranceDrought. Among the different abiotic stresses, drought has been the one most widelyinvestigated (Tuberosa and Salvi, 2006). Loci that affect root growth under particularabiotic (e.g. high boron: McDonald et al., 2010) and biotic (e.g. nematode: Barloy et al.,2007) constraints are interesting targets for MAS aimed at improving drought resistancethrough a more vigorous root system in crops grown in problematic soils. Both rice andmaize have been extensively investigated for QTL affecting root features(Hochholdinger and Tuberosa, 2009; Coudert et al., 2010; Tuberosa et al., 2011). QTLhave also been identified for other interesting drought-related traits such as carbohydraterelocation (Turner et al., 2010), stay-green (Yadav et al., 2011) and canopy temperature(Reynolds et al., 2011). Notably, major QTL for grain yield under low moisture havebeen described in rice (Bernier et al., 2009), maize (LeDeaux et al., 2006), pearl millet(Yadav et al., 2011) and wheat (Maccaferri et al., 2008b, 2011).Salinity. A number of QTL for Na + accumulation have been reported (Munns and Tester,2008). In particular, Nax1 and Nax2 control shoot Na + accumulation via Na + exclusion indurum wheat (James et al., 2006). Both exclusion genes represent introgressions from anaccession of Triticum monococcum. The Na + exclusion genes have also beenintrogressed into backgrounds of five cultivars of bread wheat by using durum × breadwheat interspecific crosses and marker-assisted backcrossing (MABC).Temperature. The genetic basis of freezing and chilling tolerance in crops appears betterunderstood than that of heat tolerance. Major QTL have been reported for frost tolerancein wheat (Dhillon et al., 2010). Additionally, QTL for chilling sensitivity have beendescribed in maize (Presterl et al., 2007) and rice (Kuroki et al., 2007). QTL for heattolerance were identified in rice (Jagadish et al., 2010) and wheat (Pinto et al., 2010).Submergence. Among cereals, rice is the crop most heavily damaged by submergencestress that periodically affects ca. 15 million ha of rain-fed lowland areas in Asia,(Mackill, 2007). In rice, Xu and Mackill (1996) identified Sub1, a major QTL that44

Budapest, Hungary, 2011AGRISAFEaccounted for a large portion of variability for survival under prolonged submergence.This QTL has already been deployed via MAS for releasing submergence-tolerant cvs.Soil toxicities. Crop yield is reduced in soils containing toxic concentrations of particularminerals (Ismail et al., 2007). An example is provided by soil acidity, which promotesaluminum (Al) toxicity. Major QTL for Al tolerance have been identified in rice (Xue etal., 2007) and sorghum (Magalhaes, 2010). Comparative mapping has indicated possiblehomologies between Al tolerance loci in cereals (Kochian et al., 2005).Low nutrients. Increasing crop N- and P-use efficiency (NUE and PUE, respectively)represents an important objective for ensuring a more profitable and sustainableagriculture. In maize, a set of QTL for NUE, grain yield and its components have beendescribed (Hirel et al., 2007; Coque et al., 2008). Major QTL for P uptake and PUE havebeen identified in soybean (Li et al., 2005), rice (Heuer et al., 2009) and wheat (Su et al.,2006). Notably, the QTL alleles for high-P efficiency were associated with an increase ineither root mass or root hair density. In rice, the application of MABC of the beneficialallele at Phosphate uptake 1 (Pup1), a major QTL for P-uptake efficiency, allowed forup to 4-fold increase in P uptake (Wissuwa et al., 2005). Recent work has validated thevalue of Pup1 to improve rice yield in P-deficient environments (Chin et al., 2010).Improving abiotic stress tolerance via marker-assisted selectionDifferent factors limit the possibility to obtain reliable QTL data and their exploitationvia MAS. Among such factors, the environment dependence of QTL expression is ofgreat importance, particularly for abiotic stress tolerance (Collins et al., 2008). Theseconsiderations underline the importance to evaluate the effects of QTL for abiotic stresstolerance across a broad range of environments (Maccaferri et al., 2008b, 2011). Anothermajor factor that limits the utilization of QTL via MAS is the occurrence of multipleabiotic constraints that inevitably decrease our capacity to correctly predict genotypeperformance based on the information available on the effects of each QTL (Mittler,2006; Pinto et al., 2010). Additionally, an agronomically desirable QTL allelediscovered in non-elite genetic material might not provide any benefit when introgressedinto elite backgrounds, because such allele may already be prevalent in the elitegenepool. With only a few notable exceptions (e.g. Sub1, a major submergence-toleranceQTL in rice: Ismail et al., 2007; Vgt1, a major flowering time QTL in maize: Salvi et al.,2007), a QTL allele transferred to a different background usually shows much smallereffects. Another major cause of inconsistency of QTL effects and outcome of MAS indifferent genetic backgrounds is due to epistasis (Reynolds and Tuberosa, 2008).Drought. To date, the best example for the application of MAS to improve droughttolerance has been obtained in rice, where MABC allowed for the introgression of fourQTL alleles for deeper roots from Azucena into Kalinga III (Steele et al., 2007). Theseefforts have resulted in the release of the first MAS-derived, drought-tolerant rice variety- Birsa Vikas Dhan 111 (PY 84) - in the Indian state of Jharkhand. Another example inrice is provided by a major QTL (qtl12.1) for grain yield (Bernier et al., 2009). Therelative effect of this QTL on grain yield increases as the intensity of drought stressincreases, reaching an additive effect of more than 40% of the trial mean under severedrought stress. MAS in underway at IRRI for introgressing the favourable QTL allele inSwarna. Additional MAS projects for improving drought tolerance are underway in45

AGRISAFE Budapest, Hungary, 2011sorghum for leaf senescence (Harris et al., 2007) and in pearl millet for a major QTL forgrain yield (Yadav et al., 2011). The effects of this QTL have been validated in twoindependent MABC programs in which the 30% improvement in grain yield generalcombining ability expected of this QTL under terminal drought stress conditions wasrecovered in introgression linesSalinity. MAS to improve salinity tolerance in rice is underway at International RiceResearch Institute (IRRI) for introgressing Saltol, a major QTL on chr. 1. SeveralMABC lines have now been developed at IRRI by transferring the FL478-derived Saltolallele in the background of salinity-sensitive popular cultivars (Thomson et al., 2010).Submergence. The best example of successful utilization of MAS to improve abioticstress tolerance relates to the work with Sub1, a major QTL for submergence tolerance inrice (Neeraja et al., 2007). MABC was used to convert six popular submergencesusceptiblerice varieties into tolerant ones able to meet the needs of farmers in floodproneregions (Bailey-Serres et al., 2010). Field testing of the six NILs pairs showed thatSub1 is effective in all target environments and is independent of the recurrent parentbackground. The cultivation of these new varieties has significantly increased yield andfood security for local farmers (Sarkar et al., 2009).Future perspectives and conclusionsDuring the past decade, increasing attention has been devoted to the use of cropmodeling at the whole genotype level and at the level of the single QTL (Hammer et al.,2005; Chapman, 2008; Tardieu and Tuberosa, 2010). Because the vast majority of locifor crop yield per se have a rather small effect (Mackill, 2007), combining thefavourable alleles by MAS to achieve a significant improvement quickly becomesimpractical. In this case, it is preferable to adopt genome selection, rather thanattempting MAS at multiple loci (Bernardo, 2010). Genome selection is facilitated by theavailability of large numbers of markers, particularly Single Nucleotide Polymorphysms(SNPs) that are amenable to high-throughput profiling at very low cost (Rafalski, 2010).Attaining a suitable level of food security requires a strong public-private partnershipbased on the mutual engagement of academia and industry, particularly the seedindustry. Genomics approaches and sequence-based breeding will expedite the dissectionof the genetic basis of abiotic stress tolerance while providing novel opportunities to tapinto wild relatives of crops (e.g. through EcoTILLING). In view of the complexity ofyield, we foresee that genome selection will provide the most powerful way to raise theyield potential to the levels required to keep up with the fast-increasing demand in food,feed, fiber and fuel. MAS will remain a valid option for major loci as long as theireffects will be sufficiently predictable and economically viable. Additionally, QTLcloning will become a more routine activity owing to cheaper sequencing (Varshney etal., 2009), more effective identification of candidate genes through “omics” profilingand more accurate, automated phenotyping (Tuberosa, 2011). QTL cloning providesvaluable opportunitites for genetically engineering of abiotic stress tolerance and for amore targeted search of novel alleles in wild germplasm (Salvi and Tuberosa, 2007).Eventually, a multidisciplinary approach (Passioura, 2010) will allow breeders toundertake better informed and more effective decisions for the release of improvedcultivars able to reduce crop vulnerability to abiotic constraints, thus contributing toenhance the sustainability of agricultural production.46

Budapest, Hungary, 2011AGRISAFEReferencesBailey-Serres, J., et al. (2010): Submergence tolerant rice: SUB1's journey from landrace to modern cultivar.Rice 3, 138-147.Barloy, D., et al. (2007): Marker-assisted pyramiding of two cereal cyst nematode resistance genes fromAegilops variabilis in wheat. Molecular Breeding 20, 31-40.Bernardo, R. (2010): Genomewide selection with minimal crossing in self-pollinated crops. Crop Science 50,624-627.Bernier, J., et al. (2009): The large-effect drought-resistance QTL qtl12.1 increases water uptake in upland rice.Field Crops Research 110, 139-146.Chapman, S. C. (2008): Use of crop models to understand genotype by environment interactions for drought inreal-world and simulated plant breeding trials. Euphytica 161, 195-208.Chin, J. H., et al. (2010): Development and application of gene-based markers for the major rice QTLPhosphorus uptake 1. Theoretical and Applied Genetics 120, 1073-1086.Collins, N. C., et al. (2008): Quantitative trait loci and crop performance under abiotic stress: Where do westand? Plant Physiology 147, 469-486.Coque, M., et al. (2008): Genetic variation for N-remobilization and postsilking N-uptake in a set of maizerecombinant inbred lines. 3. QTL detection and coincidences. Theoretical and Applied Genetics 117, 729-747.Coudert, Y., et al. (2010): Genetic control of root development in rice, the model cereal. Trends in PlantScience 15, 219-226.Dhillon, T. et al. (2010): Regulation of freezing tolerance and flowering in temperate cereals: the VRN-1connection. Plant Physiology 153, 1846-1858.Hammer, G. L., et al. (2005): Trait physiology and crop modelling as a framework to link phenotypiccomplexity to underlying genetic systems. Australian Journal of Agricultural Research 56, 947-960.Harris, K., S. et al. (2007): Sorghum stay-green QTL individually reduce post-flowering drought-induced leafsenescence. Journal of Experimental Botany 58, 327-338.Heuer, S., et al. (2009): Comparative sequence analyses of the major quantitative trait locus phosphorus uptake1 (Pup1) reveal a complex genetic structure. Plant Biotechnology Journal 7, 456-471.Hirel, B., et al. (2007): The challenge of improving nitrogen use efficiency in crop plants: towards a morecentral role for genetic variability and quantitative genetics within integrated approaches. Journal ofExperimental Botany 58, 2369-2387.Hochholdinger, F., and Tuberosa, R. (2009): Genetic and genomic dissection of maize root development andarchitecture. Current Opinion in Plant Biology 12, 172-177.Ismail, A. M., et al. (2007): Genetic and genomic approaches to develop rice germplasm for problem soils.Plant Molecular Biology 65, 547-570.Jagadish, S. V. K., et al. (2010). Genetic analysis of heat tolerance at anthesis in rice. Crop Science 50, 1633-1641.James, R. A., et al. (2006): Physiological characterization of two genes for Na + exclusion in durum wheat,Nax1 and Nax2. Plant Physiology 142, 1537-1547.Kochian, L. V., et al. (2005). The physiology, genetics and molecular biology of plant aluminum resistance andtoxicity. Plant and Soil 274, 175-195.Kuroki, M., et al. (2007): A quantitative trait locus for cold tolerance at the booting stage on rice chromosome8. Theoretical and Applied Genetics 115, 593-600.LeDeaux, J. R., et al.. (2006). Stability of QTL involved in heterosis in maize when mapped under severalstress conditions. Maydica 51, 151-167.Li, Y. D., et al. (2005): QTL mapping of phosphorus deficiency tolerance in soybean (Glycine max L. Merr.).Euphytica 142, 137-142.Luo, L. J. (2010): Breeding for water-saving and drought-resistance rice (WDR) in China. Journal ofExperimental Botany 61, 3509-3517.Maccaferri, M., et al. (2008a): Genomics of tolerance to abiotic stress in the Triticeae. In: Feuillet, C., andMuhelbauer, G. (eds.) Triticeae Genomics. Springer, Dordrecht, Netherlands, pp. 259-318.Maccaferri, M., et al. (2008b): Quantitative trait loci for grain yield and adaptation of durum wheat (Triticumdurum Desf.) across a wide range of water availability. Genetics 178, 489-511.Maccaferri, M., et al. (2011): Association mapping in durum wheat grown across a broad range of waterregimes. Journal of Experimental Botany 62, 409-438.Mackill, D. J. (2007): Molecular markers and Marker-Assisted Selection in rice. In: Varshney, R. K., andTuberosa, R. (eds.) Genomics-Assisted Crop Improvement-Vol 2: Genomics Applications in Crops".Springer, Dordrecht, Netherlands, pp. 147-168.47

AGRISAFE Budapest, Hungary, 2011Magalhaes, J. V. (2010): How a microbial drug transporter became essential for crop cultivation on acid soils:aluminium tolerance conferred by the multidrug and toxic compound extrusion (MATE) family. Annals ofBotany 106, 199-203.McDonald, G. K., et al. (2010): Assessment of the agronomic value of QTL on chromosomes 2H and 4Hlinked to tolerance to boron toxicity in barley (Hordeum vulgare L.). Plant and Soil 326, 275-290.Mittler, R. (2006): Abiotic stress, the field environment and stress combination. Trends in Plant Science 11,15-19.Munns, R., and Tester, M. (2008): Mechanisms of salinity tolerance. Annual Review of Plant Biology 59, 651-681.Neeraja, C. N., et al. (2007): A marker-assisted backcross approach for developing submergence-tolerant ricecultivars. Theoretical and Applied Genetics 115, 767-776.Passioura, J. B. (2010). Scaling up: the essence of effective agricultural research. Functional Plant Biology 37,585-591.Pinto, R. S., et al. (2010): Heat and drought adaptive QTL in a wheat population designed to minimizeconfounding agronomic effects. Theoretical and Applied Genetics 121, 1001-1021.Presterl, T., et al. (2007): Quantitative trait loci for early plant vigour of maize grown in chilly environments.Theoretical and Applied Genetics 114, 1059-1070.Rafalski, J. A. (2010): Association genetics in crop improvement. Current Opinion in Plant Biology 13, 174-180.Reynolds, M., and Tuberosa, R. (2008): Translational research impacting on crop productivity in droughtproneenvironments. Current Opinion in Plant Biology 11, 171-179.Reynolds, M., et al. (2011): Raising yield potential of wheat. I. Overview of a consortium approach andbreeding strategies. Journal of Experimental Botany 62, 439-452.Salvi, S., and Tuberosa, R. (2007): Cloning QTLs in Plants. In: Varshney, R. K., and Tuberosa, R. (eds.)Genomics-Assisted Crop Improvement-Vol 1: Genomics Approaches and Platforms. Springer, Dordrecht,Netherlands, pp. 207-226.Salvi, S., et al. (2007): Conserved noncoding genomic sequences associated with a flowering-time quantitativetrait locus in maize. Proceedings of the National Academy of Sciences of the United States of America 104,11376-11381.Sarkar, R. K., et al. (2009): Performance of submergence tolerant rice (Oryza sativa) genotypes carrying theSub1 quantitative trait locus under stressed and non-stressed natural field conditions. Indian Journal ofAgricultural Sciences 79, 876-883.Serraj, R., K et al. J. (2009): Improvement of drought resistance in rice. Advances in Agronomy 103, 41-99.Steele, K. A., et al. (2007): Field evaluation of upland rice lines selected for QTL controlling root traits. FieldCrops Research 101, 180-186.Su, J. Y., et al. (2006): Mapping QTL for phosphorus-deficiency tolerance at wheat seedling stage. Plant andSoil 281, 25-36.Tardieu, F., and Tuberosa, R. (2010): Dissection and modelling of abiotic stress tolerance in plants. CurrentOpinion in Plant Biology 13, 206-212.Tester, M., and Langridge, P. (2010): Breeding technologies to increase crop production in a changing world.Science 327, 818-822.Thomson, M. J., et al. (2010): Characterizing the Saltol quantitative trait locus for salinity tolerance in rice.Rice 3, 148-160.Tuberosa, R. (2011): Phenotyping drought-stressed crops: key concepts, issues and approaches. In:Monneveux, P., and Ribaut, J. M. (eds.) Drought Phenotyping in Crops: From Theory to Practice.CIMMYT/Generation Challenge Programme, Mexico, pp 3-35.Tuberosa, R., and Salvi, S. (2006): Genomics-based approaches to improve drought tolerance of crops. Trendsin Plant Science 11, 405-412.Tuberosa, R., et al. (2007): Genome-wide approaches to investigate and improve maize response to drought.Crop Science 47, S120-S141.Tuberosa, R., et al. (2011): Genomics of root architecture and functions in maize. In: A. Costol, R.K.Varshney, (Editors): “Root Genomics”, Springer, pp 179-204.Turner, L. B., et al. (2010): Testing water-soluble carbohydrate QTL effects in perennial ryegrass (Loliumperenne L.) by marker selection. Theoretical and Applied Genetics 121, 1405-1417.Varshney, R. K., et al. (2009): Next-generation sequencing technologies and their implications for cropgenetics and breeding. Trends in Biotechnology 27, 522-530.Wissuwa, M., et al. (2005): Is root growth under phosphorus deficiency affected by source or sink limitations?Journal of Experimental Botany 56, 1943-1950.48

Budapest, Hungary, 2011AGRISAFEXu, K. N., and Mackill, D. J. (1996): A major locus for submergence tolerance mapped on rice chromosome 9.Molecular Breeding 2, 219-224.Xu, Y. B., and Crouch, J. H. (2008): Marker-assisted selection in plant breeding: From publications to practice.Crop Science 48, 391-407.Xue, Y., et al. (2007): The genetic basic and fine-mapping of a stable quantitative-trait locus for aluminiumtolerance in rice. Planta 227, 255-262.Yadav, R. S., et al. (2011): Using genetic mapping and genomics approaches in understanding and improvingdrought tolerance in pearl millet. Journal of Experimental Botany 62, 397-408.49

AGRISAFE Budapest, Hungary, 2011IMPLICATIONS OF CLIMATE CHANGE FOR WATERSURPLUS AND SCARCITY AND HOW THAT AFFECTSAGRICULTURAL SUSTAINABILITY IN HUNGARYE. J. SADLER 1 – J. M. BAKER 2 – C. RINGLER 31 Cropping Systems & Water Quality Res., USDA-ARS, Columbia MO, USA, john.sadler@ars.usda.gov2Soil & Water Management Research Unit, USDA-ARS, St. Paul, MN, USA3 International Food Policy Research Institute, Washington, DC, USAAbstract Projected impacts of climate change have included, in addition to warmer temperatures, regionallyvariable effects on precipitation amounts, intensities, and seasonal distribution. Projections downscaled toHungary and surrounding region were identified and their effects on streamflow, other water resources, andagriculture discussed. Finally, ongoing and potential research to adapt to climate change is listed.Key words: Climate change, hydrology, drought, floodIntroductionObservations of increased temperatures and changes in precipitation patterns, includingthe number and frequency of extreme events, have prompted concerns that globalclimate change will adversely impact the hydrologic balance with potentially negativeimplications for humans and ecosystems alike. An increase in the number and intensityof floods and droughts would be of particular concern because of their substantial and attimes tragic impact on humans. The interactions of the several pathways water can takethrough the hydrologic balance complicate any prediction of an aggregate impact offuture changes. For the purposes of this paper, effects of climate change will beorganized according to the major terms in the basin-wide water balance: Precipitation(P), Irrigation (I), Evapotranspiration (ET), Discharge (Q), Deep percolation (D), andchange in water storage in soil or impoundments (dS/dt). All terms can be expressed on avolume per-unit-area basis, producing convenient units of mm per month or year. Theterms are related mathematically: dS/dt = P + I - ET - Q - D.Both the rate of change and the state of the storage term are important considerations.Exceeding storage capacity, either freeboard in impoundments or in soil water holdingcapacity, initiates a direct increase in discharge. Storage of soil water provides a sourceof water uptake to crops and thus increases crop yield in water-scarce conditions.However, excess soil moisture can limit yield or even preclude crop production, whichhas motivated the drainage of millions of hectares of land worldwide, through theinstallation of subsurface perforated pipe or artificial surface waterways. A number ofsoil properties affect the interactions of P+I-ET and thus the rate of change. Storage ofwater in snow at high elevations reduces winter discharge and effectively flattens andbroadens the spring melt discharge peak, which may reduce spring flooding.The objectives of this paper are to examine the expected effects of climate change onwater scarcity and surplus in Hungary, and how those impact agricultural sustainability.We depend on recent research that both downscales global circulation models to providelocal estimates of long-term changes and simulates the effect on streamflow. We addresearch and experiences elsewhere to interpret probable impacts of those changes onsustainability of agricultural production. Finally, we offer a range of potential researchtopics in which plant sciences may contribute toward adapting to climate change.50

Budapest, Hungary, 2011AGRISAFEPhysical characteristics affecting water resourcesDiscussions of effects of potential future climate on water resources require anunderstanding of the physical attributes of the countryside, including topography, landuse, and typical weather. The total Hungarian land area is 93030 km 2 , with three distinctmain regions: the Great Plain, to the east of the Danube, the Transdanube, to the west,and the Northern Hills (http://en.wikipedia.org/, accessed 10 February 2011). Elevationabove sea level ranges from a low of 78 m near the outlet of the Tisza River in the GreatPlains to a maximum of 1014 m in the Northern Hills. Most of the country is low, atelevations

AGRISAFE Budapest, Hungary, 2011land that needs to be irrigated is no longer provided with water resource infrastructure atmanagement-level scales.Projected climateThe CLAVIER (CLimate ChAnge and Variability: Impact on Central and EasternEuRope) project, funded by the European Commission's 6th Framework Programmefrom 2006-2009, included an evaluation of longer term impacts of global climate changefor Hungary, Romania, and Bulgaria. Thus, downscaled climate change projections andmodeled impact on hydrology are available for the region. In most cases, hydrology ofthe Tisza River was selected to represent the area. Data were obtained from the projectweb site (http://www.clavier-eu.org/?q=node/879, accessed 12 February 2011).Within the Tisza River Basin, the results suggest that by 2050 there would be a generalincrease in mean annual air temperature of 1.4-1.6 C, with 0.8-1.2C increases in thespring and greater increases for other seasons, with a high of 1.5-2.0C in winter. Resultsfor precipitation indicate spatial variation within the Tisza watershed, including anincrease of 3.5% in Tisza headwaters but a decrease in other areas of 3-10%. In time,there was a definite increase for winter periods (with a maximum of +14-17% in highelevations), and a general decrease in other seasons for most areas.Effect on flowFor the Tisza River and its tributaries, the CLAVIER results indicate there is expected tobe a small (

Budapest, Hungary, 2011AGRISAFEBreeding for improved WUE is reviewed by Richards et al. (2002), Araus et al. (2002),Passioura (2006, and Richards (2006). Specific approaches involve altering stomatalcontrols and using isotope discrimination techniques to screen for improved transpirationefficiency (Farquhar and Richards, 1984; Farquhar et al. 1989). Root architecture, orhow the roots are distributed in the soil, is an important factor as recent research hasshown (Lynch, 1995; Nord and Lynch 2009). Specific characteristics have been shownto improve drought tolerance (Zhu et al. 2010). Canopy structure can limit both E fromthe soil and T from the plant. Canopy structure and seedling establishment (or standestablishment) characteristics may limit PET and improve WUE over the life of the crop.However, searches indicate there has been much more work on canopy structure inforestry. Overall stress tolerance will be important (heat, drought, and flooding).Tolerance of multiple stress factors is not well studied but some of the stay-greenvarieties perform well under multiple stress exposure. Plants denoted “Stay-Green” tendto be healthier plants with solid root systems and better water relations but the trait isunder genetic control, and is thus a target for breeding (Harris et al. 2007).However, there are likely many aspects of management that have potential for moreimmediate and likely larger improvements. For instance, residue management has beenshown to harvest and conserve water for crop use on deep loess soils (Tomer et al.2005), with seasonally mixed results for soils with claypans that share somecharacteristics with the less permeable soils to the east of the Tisza River. Integratingcover crops in common rotations has been shown to positively affect seasonal water use.Perennial crops, such as for cellulosic bioenergy feedstocks, may improve several keysoil water characteristics in this region. However, it is important it is important tocompare planned biofuel plantations with the ET of previous land use and alternativefarming options. Research in the Netherlands has shown that planting second-generationbiofuels as buffer crops along river stretches can be both profitable and enhance streamwater quality (Kuhlman et al. 2011). Land use changes, such as planting pastures orother perennial crops where annual field crops have been less profitable, should reducefield runoff and stream discharge. Research on the effect of replacing native prairie withmaize-soya rotations in the US corn belt indicates that basin-wide annual streamflowincreased by >1 mm/year in the Mississippi River basin with most of the increase inbaseflow rather than rainfall. These changes were correlated to increased soya area in thebasins studied (Zhang and Schilling 2006). The changes also corresponded with adverseimpacts on basin water quality (Tomer and Schilling 2009). Erosion during that sameperiod raised floodplain levels, causing long-term increases in flooding severity andfrequency (Yan et al. 2010). This suggests substantial potential for affecting hydrologyat a basin scale. At a smaller, within-field scale, precision conservation has suggestedpotential for landscape-scale hydrologic and water quality impacts (Kitchen et al. 2005).Conserving water preserves it for additional uses downstream. The conversion of floodand furrow irrigation to sprinkler irrigation can reduce water use, and the conversionfrom high-pressure to low-pressure sprinklers can further reduce it. Current research insprinkler-irrigated rice has shown both water savings as well as the potential for riceproduction on coarser-textured soils not conducive for flooded rice production.Microirrigation, either surface or subsurface, is being used to further conserve water.Improved irrigation design and management can thus increase crop production per unitwater at the system level and if managed appropriately, at the basin level.53

AGRISAFE Budapest, Hungary, 2011Use of so-called gray water, meaning effluent from agricultural, municipal, or industrialuses, offers both nutrients and water resources. The Research Institute For Fisheries,Aquaculture and Irrigation (HAKI) at Szarvas is working on irrigation with bothhorticultural and aquacultural effluent. Those and other gray water sources represent asubstantial opportunity for water re-use, and therefore conservation. The ongoingresearch to mitigate water quality issues with gray water offers opportunity for synergywith similar needs regarding municipal and industrial gray water.Some of this research is less dependent on expensive facilities needed for geneticimprovements with modern biological methods. However, it will require expertiseoutside of the biological sciences disciplines, including irrigation and tillage engineering,hydrology, physical sciences, meteorology, climatology, and several agronomic sciencesincluding fertility and plant nutrition. While much of this research would interacteffectively with biological sciences, such multi-disciplinarity is often difficult of obtain.Thus, while climate change will likely have adverse impacts on streamflows in the TiszaRiver Basin in Hungary, a range of agronomic management practices, already in useelsewhere, can likely help reduce, if not eliminate, negative impacts from climate changeon agricultural production. Given that climate change will affect all parts of the globe,but differently, it will be important to increase flows of knowledge exchange (as well asflows of real goods) so that agricultural areas in different parts of the world can benefitfrom agronomic management practices already in use elsewhere.AcknowledgementsThis paper was financially supported by the USDA-ARS, Beltsville MD USA, and theInternational Food Policy Research Institute, Washington DC USA.ReferencesAraus, J. L., Slafer, G. A., Reynolds, M. P., Royo C. (2002): Plant breeding and drought in C3 cereals: Whatshould we breed for? Ann. Bot. 89 (7), 925-940.Central Statistics Office. (2004): Agriculture in Hungary 2003, Vol. II – Farm structure survey, Tab. 6.6.Budapest, Hungary, 260 pp., available at: http://portal.ksh.hu/, 07/07/2006.Farquhar, G. D., Richards, R. A. (1984): Isotopic composition of plant carbon correlates with water-useefficiency of wheat genotypes. Aust. J. Plant Physiol. 11, 539-552.Farquhar, G. D., Ehleringer, J. R., Hubick, K. T. (1989): Carbon isotope discrimination and photosynthesis.Annu. Rev. Plant Physiol. Plant Mol. Biol. 40, 503-537.Harris, K., Subudhi, P.K., Borrell, A., Jordan, D., Rosenow, D., Nguyen, H., Klein, P., Klein R., Mullet, J.E.(2007): Sorghum stay-green QTL individually reduce post-flowering drought-induced leaf senescence. J.Exp. Biol. 58, 327-338.Kitchen, N. R., Sudduth, K. A., Myers, D. B., Massey, R. E., Sadler, E. J., Lerch, R. N., Hummel, J. W., Palm,H. L. (2005):Development of a conservation-oriented precision agricultural system: Crop productionassessment and plan implementation. J. Soil & Water Cons. 60(6), 421-430.Kuhlman, T., R. Verburg, J.J. van Dijk, and N. Phan-Drost. 2011. Biomass on peat soils? Feasibility ofbioenergy production under a climate change scenario. Mimeo.Ligetvári, F., Cselotei, L., Kiss, K., Dimény, J., Szilárd, G., Takács-György, K., Kis, S., Helyes, L., Pekár, F.Bozán, C. (2006): Country report from Hungary. Pp.161-250. In: Dirksen, W. and Huppert, W. (ed.),Irrigation sector reform in Central and Eastern European countries. Deutsche Gesellschaft für TechnischeZusammenarbeit (GTZ), Eschborn, Germany.Lynch, J.P. (1995): Root architecture and plant productivity. Plant Physiol. 109, 7-13.Nayak, A., Marks, D., Chandler, D. G., and Seyfried, M. (2010): Long‐term snow, climate, and streamflowtrends at the Reynolds Creek Experimental Watershed, Owyhee Mountains, Idaho, United States. WaterResources Res., 46, W06519, doi:10.1029/2008WR007525.54

Budapest, Hungary, 2011AGRISAFENord, E.A., Lynch, J.P. (2009): Plant phenology: a critical controller of soil resource acquisition. J. of Exp.Bot., 60, 1927-1937; doi:10.1093/jxb/erp018Passioura J.B. (2006): Increasing crop productivity when water is scarce – from breeding to field management.Agric. Water Management, 80, 176-196.Richards RA. (2006): Physiological traits used in the breeding of new cultivars for water-scarce environments.Agric. Water Management. 80, 197-211.Richards R.A., Rebetzke G.J., Condon A.G., van Herwaarden A.F. (2002): Breeding opportunities forincreasing efficiency of water use and crop yield in temperate cereals. Crop Science 42, 111–121.Tomer, M.D., Meek, D.W., Kramer, L.A. (2005): Agricultural practices influence flow regimes of headwaterstreams in western Iowa. J. Env. Qual. 34, 1547-1558.Tomer, M.D., Schilling, K.E. (2009): A Simple approach to distinguish land-use and climate-change effects onwatershed hydrology. J. Hydrol.. 376(1-2), 24-33.Várallyay, G. (2005): Soil Survey and Soil Monitoring in Hungary. ppg 169-179. In: Jones, R.J.A., Houskova,B., Bullock, P., Montanarella, L. (eds), Soil resources of Europe. 2 nd Ed. Eur. Soil Bureau Res. Rep. no 9.Yan, B., Tomer, M.D., James, D.E. (2010): Historical channel movement and sediment accretion along thesouth fork of the Iowa River. J. Soil & Water Cons. 65(1), 1-8.Zhang, Y.K., Schilling, K.E. (2006): Increasing streamflow and baseflow in the Mississippi River since the1940s: effect of land use change. J. Hydrol. 324, 412–422.Zhu, J., Brown, K.M., Lynch, J.P. (2010): Root cortical aerenchyma improves the drought tolerance of maize(Zea mays L.). Plant, Cell & Environment, 33, 740–749.55

GENE BANKS AND GENETIC RESOURCES

Budapest, Hungary, 2011AGRISAFEINFLUENCE OF HYDRATION CONDITIONS UPON WHEATSEED GERMINATION AFTER LONG-TERM STORAGEO. CHUMYCHKINA 1 – O. RUZHITSKAYA 21 Department of Biology, Odessa National University of I.I. Mechnikov, Shampansky lane, 2, 65058, Odessa,Ukraine e-mail: olya1987-04@mail.ru2 Department of Biology, Odessa National University of I.I. Mechnikov, Shampansky lane, 2, 65058, Odessa,Ukraine e-mail: flores@ukr.netAbstract Different viability indicators of winter wheat (Triticum aestivum L.) seeds from 6 cultivars stored for10 years were determined. It was shown that germination potential and the content of malone dialdehyde ofdifferent cultivars were various for all the samples. According to the experimental data, slowing of the wateruptake, with the osmotic active compound polyethylene glycol 8000 (PEG 8000) during seed imbibitionincreases the germination potential of old winter wheat seeds from the cultivars used for the experiment.Key words: Triticum aestivum L., seeds, long term storage, germination, PEG 8000.IntroductionPlant genetic resources are the most valuable base material for the decision of existingand future crop improvement programs. The selection of crop cultures is connectedclosely with constant storage and reproduction of a considerable quantity of seedsamples. Thus the long-term storage of seeds is necessary in order to preserve andprotect plant biodiversity. During storage seeds lose their ability to germinate. Lack ofseed germination does not always mean seed embryo death. According to onehypothesis, damages which appear during seed imbibition are one of the reasons forlosing the ability to germinate (Веселова et al., 1995; Веселова et al., 2003). In thesecases the potential of seed germination can be increased or even renewed.Thus experimental data shows that the conditions under which hydration occurs have asignificant impact on ability to germinate of old wheat seeds.The purpose of our work was to determine different indicators of winter wheat seeds’viability and to investigate the ability of these seeds to increase their germinationpotential by making the water uptake slower with the osmotic active compoundpolyethylene glycol 8000 (PEG 8000) during seed imbibitions.Materials and methodsIn our investigation, we used winter wheat seeds (Triticum aestivum L.) of 6 cultivars(Strumok, Obriy, Nikoniya, Selyanka, Lelya, Albatross). Samples were stored for 10years in a climatic chamber at a temperature of 4 o C. Before storage, seed samples havegermination potential of 85 - 95 % depend on cultivar. Seed samples were gained fromthe collection of The Plant Breeding and Genetics Institute – National Center of Seed &Cultivar Investigation of the Ukrainian Academy of Agricultural Sciences. Seed viabilitywas estimated by the tetrazolium method, vigor test, and the standard germination test.Lipid peroxidation was analyzed in whole seeds and in seed embryos by measuring thecontent of thiobarbituric acid (TBA) - active compounds (Владимиров et al, 1972;Мерзляк et al, 1978). Also lipid peroxidation activity was estimated in embryos of seedsimbibited in PEG 8000. For decreasing the water uptake by seeds osmotic activecompound polyethylene glycol 8000 (PEG 8000) was used. Experimental seeds wereheld in 5 % or 20 % solutions of PEG during 4 hours in the first variant of theexperiment and for 24 hours in the second variant and then were transferred into Petridishes with distillated water. In the third variant seeds were germinated in 5 % or 20 %59

AGRISAFE Budapest, Hungary, 2011PEG during 7 days. In control variant seeds were germinated in Petri dishes at 22-24 o Cwith distillated water during 7 days. Data that was obtained from old seeds wascompared with data obtained for 2006 harvest seeds of same cultivars.Results and discussionAccording to our data presented in Table 1 samples’ germination potential of differentcultivars that were stored for ten years was different for all the samples (from 0 % forObriy cultivar to 64 % for Selyanka cultivar). At the same time, the viability of theseseeds tested according to tetrazolium method that fixes dehydrogenase activity wasmuch higher (from 28 for Selyanka cultivar 67 % for Albatross cultivar). Just Obriycultivar has 4 % viability by tetrazolium method. The biggest difference was obtainedfor Strumok and Albatross cultivars (54 and 67 % accordingly). Thus a considerable partof ungerminated seeds from these seed samples has an alive embryo and its’ germinationpotential probably could be increased.Table 1. Indicators of different cultivars winter wheat seeds’ viability after long term storageCultivar Seed vigor, %Standard germination Viability according topotential, % tetrazolium method, %Obriy 0 0 4Lelya 16 ± 2 36 ± 2 78 ± 1Strumok 20 ± 2 40 ± 2 94 ± 2Nikoniya 24± 2 52 ± 2 84 ± 1Selyanka 60± 1 64± 2 92± 1Albatross 4 ± 2 4 ± 1 71 ± 1Variability of barrier properties of membranes is caused by changes in thephospholipids’ bilayer because of phospholipidic hydrolysis and free radicaloxygenation of polyunsaturated fatty acids (Робертс, 1978; Senaranta, 1988). Reactionsof free radical oxygenation which include reactions of lipid peroxidation are thought themost probable factors of seed ageing during storage.Results of our experiment show that wheat seeds from analyzed cultivars differ on thecontent of malone dialdehyde (MDA) - the last product of lipid peroxidation (Table 2).Table 2. MDA content in the whole wheat seeds and in the seed embryos after 10 years of storageCultivarStandard germinationContent of MDA, nM/gpotential, % in the whole seed in seed embryosObriy 0 28,39±0,65 90,32±0,88Lelya 36 ± 2 23,24±0,73 59,35±0,79Strumok 40± 2 49,03±0,66 74,84±0,46Nikoniya 52 ± 2 28,39±0,43 67,10±0,64Selyanka 64 ± 2 23,23±0,74 51,61±0,58Albatross 4 ± 1 24,52±0,46 74,84±0,56Apparently, from the received data the highest content of MDA was in seed embryosfrom Obriy cultivar with 0 % germination in standard test. And the lowest content ofMDA was in seed embryos from Selyanka cultivar which germination and the viabilityaccording to tetrazolium method was the highest (64 and 92 %). Probably relativly highcontent of MDA in the embryos of seeds with low germination potential can testifyabout possible structural and functional changes in its’ cells membrane system.Results of germinating wheat seeds stored for 10 years and 2006 harvest seeds of samecultivars are shown on Figure 1 and Figure 2.60

Budapest, Hungary, 2011AGRISAFEGermination potential, %3025201510АControl4 hours24 hours7 daysРяд5Ряд6Ряд7Ряд8Ряд9Ряд10Ряд11Ряд12Ряд13Ряд14Germination potential, %90807060504030BControl4 hours24 hours7 daysРяд5Ряд6Ряд7Ряд8Ряд9Ряд10Ряд11Ряд12Ряд13Ряд142051005 % PEG20 % PEG1Variant of theexperimentFigure 1. The influence of water uptake decreasing during 4 hours, 24 hours and 7 days of germinating withPEG 8000 solutions on germinating potential of Albatross cultivar seeds from 1998 (A) and 2006 (B) harvest05 % PEG 20 % PEG1Variant of theexperimentGermination potential, %7060504030АControl4 hours24 hours7 daysРяд5Ряд6Ряд7Ряд8Ряд9Ряд10Ряд11Ряд12Ряд13Ряд14Germination potential, %807060504030BControl4 hours24 hours7 daysРяд5Ряд6Ряд7Ряд8Ряд9Ряд10Ряд11Ряд12Ряд13Ряд142020101005 % PEG 20 % PEG1Variant of theexperimentFigure 2. The influence of water uptake decreasing during 4 hours, 24 hours and 7 days of germinating withPEG 8000 solutions on germinating potential of Strumok cultivar seeds from 1998 (A) and 2006 (B) harvestAccording to our results, the influence of PEG 8000 increased the germination potentialof experimental cultivars’ old seeds in all variants of the experiment (5 or 20 % PEGconcentration, influence of PEG 8000 during 4 hours, 24 hours or 7 days). The biggestincrease of germination potential was gained from old seeds of experimental cultivarsafter germinating them in 5% PEG 8000 for 7 days. Germination potential of Albatrosscultivar’s old seeds has increased 6 times in comparison with control. Excess ofgermination potential in comparison with control for Strumok cultivars’ old seeds was50 %.Thus slowing of the water uptake during seed imbibition increases the germinationpotential of old winter wheat seeds from cultivars used for the experiment.The influence of PEG 8000 on 2006 harvest seeds wasn’t the same for Strumok andAlbatross cultivars. Slowing of the water uptake to Albatross seeds which had 76 %germination in standard test had a negative influence on its’ germination potential. At thesame time, a percent of germinated seeds under PEG influence for Strumok cultivar hadincreased in comparison with the control. Germination potential decreasing underslowing of the water uptake is probably related with germination delay in waterdeficiency conditions. If water uptake regulation in the seed works appropriately,additional slowing of the water uptake will have a negative result on seeds germinationpotential. Thus the difference between seeds of these two cultivars is probably relatedwith the various physiological qualities of seeds.Results of lipid peroxidation processes measuring presented on Figure 3. They showedthat the content of malone dialdehyde (MDA) in the embryos of both cultivars’ old seedsimbibited in 5 % PEG during 24 hours before germinating was lower than in the controlfor 20 %. That may indicate seeds embryo cell membranes stabilization under conditionsof slow water uptake.05 % PEG 20 % PEG1Variant of theexperiment61

AGRISAFE Budapest, Hungary, 201170Content of MDA in seed embryos (nM/g)6050403020ControlPEG, 5 %PEG, 20 %Ряд4Ряд5Ряд6Ряд7Ряд8Ряд9Ряд10Ряд11Ряд12Ряд13Ряд14Ряд151001998 harvest 2006 harvest1998 harvestAlbatross1Figure 3. The influence of slowing of the water uptake with PEG 8000 during 24 hours on the MDA content inseed embryos from Strumok and Albatross cultivars.ConclusionsLong-term storage of seeds is one of the steps on the way to saving plant biodiversity.Conditions under which hydration occurs has a significant impact on the ability togerminate of old wheat seeds. According to the experimental data, slowing of the wateruptake during seed imbibition increases the germination potential of old winter wheatseeds from cultivars used for the experiment. The data obtained by us coordinated withthe data of other authors (Веселова et al, 2006; Хукстра et al, 1999) showed thatdestruction of cell membranes in old seeds because of fast water inflow duringimbibitions. So water uptake regulation by using solutions with high osmotic potentialcan be used in order to avoid possible damages during germination of seeds from seedcollections that lost their viability because of long-term storage.AcknowledgementsThe authors would like to thank Plant Breeding and Genetics Institute – National Centerof Seed & Cultivar Investigation of the Ukrainian Academy of Agricultural Sciences forgiving us collection seed samples. We are grateful to our assistant, Lewis Dorman, forhelping to prepare the article.ReferencesВеселова Т. В., Веселовский В. А. Возможность участия аквапоринов в поглощении воды семенамигороха разного качества // Физиология растений. 2006. — Т. 53, №1. С. 106 - 112.Веселова Т. В., Веселовский В. А., Карташова Е. Р., Терешкина С. Д. Количественное определениепотери жизнеспособности семян сосны при разных способах хранения // Физиология растений. —1995. — Т. 42, №4. — С. 616-621.Веселова Т. В., Веселовский В. А., Усманов П. Д. Гипоксия и повреждения при набухании стареющихсемян // Физиология растений. — 2003. — Т. 50, №6. — С. 930-937.Владимиров Ю.А., Арчаков А.И. Перекисное окисление липидов в биологических мембранах. — М.:Наука, 1972. — 252 с.Мерзляк М.Н., Погосян С. И., Юферова С. Г., Шевырева В. П. Использование 2-тиобарбитуровойкислоты в исследовании перекисного окисления липидов в тканях растений // Науч. докл. высш.шк. биол. науки. — 1978. — №9. — С. 86-94.Робертс Е. Г. Цитологические, генетические и метаболические изменения, связанные с потерейжизнеспособности // Жизнеспособность семян: Пер. с англ. — М.: Колос, 1978. — С. 244-293.Хукстра Ф. А., Головина Е. А. Поведение мембран при дегидратации и устойчивостьангидробиотических организмов к обезвоживанию // Физиология растений. — 1999. — Т.46, №3.— С. 347-361.Senaratna T., Gusse J.F., McRersie B.D. Ageing-Induced Changes in Cellular Membranes of Imbibed SeedAxes // Plant Physiol. - 1988. — V. 73. — P. 85-91.Strumok2006 harvest62

Budapest, Hungary, 2011AGRISAFETECHNOLOGICAL PROPERTIES OF GRAIN AND FLOUR INBREAD WHEAT LINES WITH INTROGRESSIONS FROMAEGILOPS SPELTOIDES AND AEGILOPS MARKGRAFIIM.F. ERMAKOVA 1 – A.K. CHISTYAKOVA 1 – L.V. SHCHUKINA 1 –T.A. PSHENICHNIKOVA, – E.V. MOROZOVA 1 – A.V. SIMONOV 1 – A. WEIDNER 2 –A. BÖRNER 21 Institute of Cytology and Genetics SB RAS, Novosibirsk, 630090 Russia;2 Leibniz-Institut für Pflanzengenetik und Kulturpflanzenforschung (IPK), Corrensstrasse 3, D-06466Gatersleben, Germany;Abstract Bread wheat winter and spring lines with introgressions from the wild cereal species Aegilopsspeltoides and Aegilops markgrafii were studied for technological properties of grain and flour. It was shownthat limited insertions of alien genetic material enlarged the genetic diversity of the traits under study. Lineswith increased gluten content in the grain and improved physical dough properties were found. The novelgenetic resources may be used in breeding practice.Key words: bread wheat, introgression lines, grain quality, physical properties of doughIntroductionBread wheat is one of the staple cereal crops in world agricultural production and isinvolved into selection for different necessary traits worldwide. The wide hybridizationis used as one of the methods of enrichment of wheat germplasm with valuable genes, inparticular, for resistance to fungus diseases. Many lines with the genetic material fromalien species have been developed for transfer of new traits to bread wheat (Friebe et al.1996). These are the introgression lines with substituted or additional chromosomes orthe lines with fragmental insertions of different size into certain wheat chromosomes.A diploid wild cereal Aegilops speltoides, a probable progenitor of B genome of breadwheat, may be one of the sources of valuable agricultural traits. With the use of thisdonor the 'Arsenal' collection of introgression lines of bread wheat on the genetic basisof cv. 'Rodina' was developed (Lapochkina et al. 2003). The accessions of this collectionare resistant to different phytopathogens and are characterized with novel morphologicaland physiological traits. In particular, the new genes for leaf hairiness (Hl2), spikewaxlessness and new allele of Gli-B1 locus were discovered (Pshenichnikova et al.2007). The lines of cv. 'Alcedo' with introgressions from the another wild species, Ae.markgrafii, are characterized with the resistance to leaf rust (Weidner, 2004).Such wheat lines were mostly obtained for study of resistance to fungus diseases butrarely investigated for grain technological traits. The aim of this work was to study theinfluence of the introgressions from these two species into wheat cultivars 'Rodina' and'Alcedo' on milling parameters, gluten content in grain and physical properties of flourand dough.Materials and methodsSpring and winter lines from 'Arsenal' collection with introgressions from winteraccession of Ae. speltoides in spring cv. 'Rodina' and winter lines with introgressionsfrom Ae. markgrafii in cv. 'Alcedo' were used as the material for the investigations.Spring lines of cv. 'Rodina' and winter lines of cv. 'Alcedo' were grown in fieldconditions. The winter lines from 'Arsenal' collection were grown in a green-house withnecessary vernalization requirements. Technological properties of grain and flour were63

AGRISAFE Budapest, Hungary, 2011determined according the methods accepted in Russia (Anonymous, 1988). The studiedlines were partially characterized for introgressions size and position in chromosomes(Salina et al. 2001; Iqbal et al. 2007).Results and discussionCultivar 'Rodina' (control) is characterized with high milling parameters but low physicalproperties of flour and dough (Table 1). Among the winter lines the line 84/98 wsignificantly decreases vitreousness and flour particles size. Earlier, it was showed thatin this line 5A chromosome is substituted for homologous 5S from Ae. speltoides(Pshenichnikova et al. 2010) where the gene for grain softness Ha-Sp is situated. Itseffect on endosperm structure consists in decreasing the both parameters.Table 1. Technological parameters of grain in the winter wheat lines with introgressions from Ae. speltoidesTechnological traitsGluten FlourLines TGW, Vitreousness,content, particlesg%% size, μm'Rodina' 33,0 87,0 38,5 22,2684/98 w 24,8 50,0 48,3 11,6132/98 w 29,3 85,0 46,0 18,3675/98 w 28,7 97,0 37,3 22,13Ae.speltoides0,47 26,3 46,5 -F 05 6.39 9.28FG 10.35* 150.53*** 1.62 ns 19,31*LSD 05 11.3 6.6 - 3,6A wide polymorphism for technological traits was discovered among the spring lines of'Arsenal' collection (Table 2). The line 73/00 i showed a significantly lower 1000 grainweight (TGW) but had a higher gluten content in grain comparing to 'Rodina'. The line82/00 i had a higher TGW and significantly higher gluten content in grain. At the sametime, vitreousness and flour particles size were substantially lower. It may be supposedthat this line carries the introgression from 5S chromosome with Ha-Sp gene on 5Achromosome as the winter line 84/98 w . But in this case only a short arm is substituted asthe line has a spring habit like 'Rodina' having Vrn-A1 gene (Pshenichnikova,unpublished results). In the lines 81/00 i , 84/00 i and 99/00 i TGW and particles size weresignificantly decreased while vitreousness was comparable to 'Rodina'.Only two lines, 69/00 i and 76/00 i surpassed the control for flour strength while the lines73/00 i and 81/00 i had the meanings lower than the poor quality parental cultivar.According Adonina et al. (2004) the line 76/00 i carries the substitution 7D/7S whichpresumably influence positively on dough strength. The line 69/00 i also may carry thesame substitution as the line has anthocyanin pigmentation of plant organs and,therefore, has a high dough strength. At the same time, the line 81/00 i also carries 7D/7Ssubstitution (Adonina et al. 2004) but its flour has a low strength. The 1B/1R substitutionwas found in this line earlier and, accordingly, secalins in gluten protein composition(Pshenichnikova et al. 2007) which has a deleterious effect on the specific rheologicalproperties of dough.Cultivar Alcedo (control) has intermediate milling parameters (Table 3) and showed lowphysical properties of flour and dough in the year of investigation.64

Budapest, Hungary, 2011AGRISAFETable 2. Technological parameters of grain and flour in spring wheat lines with introgressions from Ae.speltoidesLinesTGW,gTechnological traits § Physical parameters of dough (alveograph) §Vitreousness,%Glutencontent,%Flourparticlessize, μmDoughstrength,u.a.Tenacity,P,mmExtensibility,L,mmRodina 27.6 82.6 37.7 20.6 195 67 114 0,669/00i 27.1 91.0 41.4 18.2 401 121 102 1,273/00i 22.2 83.2 50.6 20.9 117 73 59 1,376/00i 27.8 85.4 39.4 20.2 270 93 103 0,981/00i 24.4 78.1 36.1 17.8 145 74 79 0,982/00i 30.0 65.6 45.9 10.3 193 79 90 0,884/00i 24.5 81.0 39.6 16.8 185 82 84 1,099/00i 24.7 77.4 46.1 18.1 221 80 98 0,7F 05 2.4 2.7FG 11.9** 11.0** 31.2** 43.7** 87.8** 53.7** 9.7**7.0**LSD 01 1.8 5.4 2.2 1.2 19.4 4.8 11.5 0.18*** - P

AGRISAFE Budapest, Hungary, 2011AcknowledgementsParticipation in Joint AGRISAFE - EUCARPIA Workshop for Young Cereal Scientistswas partially supported by Mikhail Prokhrov Foundation, Krasnoyarsk, RussiaReferencesAdonina I.G., Salina E.A., Efremova T.T. Pshenichnikova T.A. (2004): The study of introgressive lines ofTriticum aestivum Aegilops speltoides by in situ and SSR analyses. Plant Breeding, 123, 220-224.Anonymous (1988) Method of state variety testing of crops. Moscow, Gosagroprom publisher, 122 p. (inRuss.).Iqbal N., Eticha F., Khlestkina E.K., Weidner A., Röder M.S. Börner A. (2007): The use of simple sequencerepeat (SSR) markers to identify and map alien segments carrying genes for effective resistance to leaf rustin bread wheat. Plant Genetic Resources: Characterization Utilization, 5(2); 100-103.Friebe B., Jang J., Raupp W.J., McIntoch R.A. Gill B.S. (1996): Characterization of wheat-alien translocationsconferring resistance to diseases and pests: current status. Euphytica, 91, 59-87.Lapochkina I.F., Iordanskaya I.V., Yatchevskaya G.L., Zhemchuzhina A.I., Kovalenko E.D., Solomatin D.A.,Kolomiets T.M. (2003): Identification of alien genetic material and genes of resistance to leaf rust in wheat(Triticum aestivum L.) stocks. Proc. 10th Intern. Wheat Genetics Symp. Paestum, Italy, 1-6 September2003, Instituto Sperimentale per la Cerealicoltura, V.3, 1190-1192.Pshenichnikova T.A., Ermakova M.F., Chistyakova A.K. Shchukina L.V., I.F. Lapochkina. (2007):Technological properties of grain and flour in lines with introgression from Ae. speltoides. Tausch.Sel'skokhozyastvennaya biologia, 5, 86-89.Pshenichnikova T.A., Lapochkina I.F. Shchukina L.V. (2007): The inheritance of morphological andbiochemical traits introgressed into common wheat (Triticum aestivum L.) from Aegilops speltoidesTausch. Genetic Resources and Crop Evolution, 54, 287-293.Pshenichnikova T.A., Ermakova M.F., Chistyakova A.K. Shchukina L.V., Berezovskaya E.V., Lohwasser U.,Röder M.S. and Börner A. (2008): Mapping of the quantitative trait loci (QTL) associated with grainquality characteristics of the bread wheat grown under different environmental conditions. Russ J Genet,44, 74-84.Pshenichnikova T.A., Simonov A.V., Ermakova M.F., Chistyakova A.K., Shchukina L.V., Morozova E.V.(2010): The effects on grain endosperm structure of an introgression from Aegilops speltoides Tauch. intochromosome 5A of bread wheat. Euphytica, 175, 315-322.Salina E.A., Adonina I.G., Efremova T.T., Lapochkina I.F., Pshenichnikova T.A. (2001): The genome-specificsubtelomeric repeats for study of introgressive lines T. aestivum Ae. speltoides. EWAC Newsletter,Novosibirsk, 161-164.Weidner A. (2004): Selection and characterization of wheat - Ae. markgrafii introgression lines resistant to leafrust. PhD thesis, Martin-Luther-University Halle Wittenberg, Halle (Saale), 111 p.66

Budapest, Hungary, 2011AGRISAFESCREENING OF MARTONVÁSÁR WHEAT BREEDINGMATERIALS FOR DWARFING GENES(RHT-B1B AND RHT-D1B)G. GULYÁS – Z. BOGLÁR – L. LÁNG – M. RAKSZEGI – Z. BEDŐAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary, e-mail:gulyasg@mail.mgki.huAbstract A total of 597 wheat (Triticum aestivum L.) accessions from 26 countries covering 5 continents wereexamined using the “Perfect” molecular markers to detect Rht-B1b and Rht-D1b semi-dwarfing genes. Many ofthe accessions, 264 out of 597 (44.2%), were from Hungary, including those developed in Martonvásár. Thegene Rht-B1b was detected in a total of 327 (54.8%) accessions, including 196 (74.2%) Hungarian genotypes.The Rht-D1b allele was found in fewer accessions. Overall 132 genotypes (22.1%) contained this allele. Amolecular marker database offering relevant marker information about genotypes could be very helpful forselection, allowing breeders to include varieties with positive results in specific breeding programmes.Key words: semi-dwarf gene, Rht-B1b, Rht-D1b, Triticum aestivumIntroductionThe use of dwarfing genes to reduce plant height, increase harvest index, improvelodging resistance, and increase grain yield has been one of the major strategies indeveloping modern bread wheat (T. aestivum) cultivars. Semi-dwarfing genes in Norin10, Saitama 27, and Akakomugi were initially introduced into Italy, USA and Mexico(CIMMYT) in the first half of the twentieth century, and later spread throughout Northand South America, Europe and Asia (Gale and Youssefian, 1985). Today more than70% of modern wheat cultivars contain major dwarfing genes (Evans, 1998). Innorthwest Europe, the semi-dwarfing alleles Rht-B1b (formerly Rht1) and Rht-D1b(formerly Rht2) are widely used. These genes have comparable mutation in twohomoeologous genes on chromosomes 4B and 4D in the hexaploid wheat genome(Börner et al., 1996; McCartney et al., 2005). The homoeologous genes Rht-B1 and Rht-D1 were molecularly characterized and both mutations were found to involve singlebase-pair changes leading to a TAG stop codon shortly after the start of translation (Penget al., 1999). Furthermore, PCR-based specific markers were developed to discriminatebetween the dwarf genes Rht-B1b and Rht-D1b and their wild-type tall alleles Rht-B1aand Rht-D1a (Ellis et al., 2002).Materials and methodsIn total, 597 wheat accessions from 26 countries covering 5 continents were examined inthis study. Many of the accessions, 264 out of 597 (44.2%), were from Hungary,including those developed in Martonvásár. A significant number of genotypes (215)were from 13 countries of Europe (Table 1).Table 1. Distribution of the accessions used in this studyCountry No. of samples %Europe (Hungary) 481 (264) 80.6 (44.2)America 63 10.6Australia 6 1.0Africa 3 0.5Asia 44 7.4Total 597 100.0For the molecular study, DNA was extracted from the leaves of wheat seedlings with a67

AGRISAFE Budapest, Hungary, 2011QIAcube (Qiagen, Germany) automated workstation using a Qiagen Dneasy Plant MiniKit (Qiagen, Germany) according to the manufacturer’s protocol. The presence orabsence of genes Rht-B1b and Rht-D1b was detected using the molecular markersdeveloped by Ellis et al. (2002).Results and discussionThe Rht-B1b allele was identified in 327 (54.8%) genotypes, including 196 (74.2%) ofthose from Hungary. More than 50% coverage was found in several countries: France(n=55, 52.7%), Croatia (n=6, 100%), Moldavia (n=3, 100%), Romania (n=19, 100%),Italy (n=6, 100%) and Turkey (n=4, 75%). The Rht-D1b gene was found in feweraccessions. Overall 132 genotypes (22.1%) contained this allele. Among the Hungariangenotypes, only 27 (10.2%) possessed the gene (Table 2). Interestingly, nine accessionscontained both semi-dwarfing genes: 2 each from Mexico and Hungary, and 1each fromArgentina, Israel, USA, France and Switzerland. Neither of the two dwarfing genes wasidentified in 146 (24.5%) genotypes (data not presented).Table 2. Occurrence of RhtB1b and RhtD1b in 597 wheat accessionsContinent Country No. of samplesRht-B1b Rht-D1bNo. % No. %Austria 36 1 2.8 2 5.6Croatia 6 6 100.0 0 0.0Czech Republic 12 2 16.7 1 8.3France 55 29 52.7 19 34.5Germany 12 1 8.3 3 25.0Great Britain 4 1 25.0 3 75.0EuropeHungary 264 196 74.2 27 10.2Italy 6 6 100.0 0 0.0Moldavia 3 3 100.0 0 0.0Romania 19 19 100.0 0 0.0Serbia 4 1 25.0 1 25.0Slovakia 8 2 25.0 1 12.5Switzerland 28 12 42.9 13 46.4Ukraine 24 3 12.5 16 66.7Argentina 17 6 35.3 10 58.8AmericaCanada 2 0 0.0 0 0.0Mexico 4 3 75.0 3 75.0USA 40 20 50.0 16 40.0AustraliaAustralia 4 0 0.0 2 50.0New Zealand 2 0 0.0 2 100.0China 23 8 34.8 7 30.4Israel 6 3 50.0 3 50.0AsiaRussia 10 3 30.0 3 30.0South Korea 1 0 0.0 0 0.0Turkey 4 3 75.0 0 0.0Africa South Africa 3 0 0.0 0 0.0Total 597 328 54.9 132 22.1According to the results, either the Rht-B1b or the RhtD1b allele can be found in 75.5%of the investigated materials. However, Borlaug (1968) presented data showing a figureof 90% worldwide. The reason for this difference could be that the introgression of theseGreen Revolution genes into varieties was developed by CIMMYT for use in SouthAmerica and Asia. Nevertheless, according to the present data, accessions from theseparts of the world have only 30–40% frequency for these alleles (Table 3). This study, inwhich 33.3% of the twelve German varieties possessed one of the alleles (8.3% Rht-B1b68

Budapest, Hungary, 2011AGRISAFEand 25% Rht-D1b), reinforces the findings of Knopf et al. (2008), where the two semidwarfingalleles were present in 43.6% of the varieties in Germany. Interestingly, inChina and Germany the frequency of the Rht-D1b allele was higher than that of the Rht-B1b allele (Zhang et al., 2006; Knopf et al., 2008). By contrast, RhtB1b was found inmore accessions than RhtD1b not only in the Hungarian genotypes (74.2% and 10.2%),but also worldwide (54.9% and 22.1%). The semi dwarfing genes Rht-B1b and Rht-D1bwere introduced into Hungary with cultivars originating from South America andWestern Europe (Bognár et al., 2007). The lack of the two alleles in 146 genotypes (datanot presented) can be explained by the fact that in wheat, 21 genes with major effects inreducing plant height have been identified and assigned Rht designations (McIntosh etal., 1995). Therefore, other plant height reducing genes may also be contained by theseaccessions.Table 3. Continental distribution of semi-dwarfing alleles (Rht-B1b and RhtD1b)No. of accessions Rht-B1b % (n) Rht-D1b % (n)Europe 481 58.6 (282) 17.9 (86)America 63 46.0 (29) 46.0 (29)Australia 6 0.0 66.7 (4)Africa 3 0.0 0.0Asia 44 38.6 (17) 29.5 (13)Total 597 54.9 (328) 22.1 (132)ConclusionsThis study demonstrated the widespread presence of the semi-dwarfing genes Rht-B1band Rht-D1b worldwide. The molecular markers used in this study made it possible tocharacterize the genotypes present in the Martonvásár breeding programme. Putting thisinformation into databases could be very helpful for selection, allowing breeders toinclude varieties with positive results in specific breeding programs. In the AgriculturalResearch Institute HAS researchers have put much effort into creating such a databasewith relevant marker information on parental lines and breeding materials in order tofacilitate the breeding of new varieties with better adaptability to a changingenvironment.AcknowledgementsThis paper was financially supported by the AGRISAFE EU-FP7-REGPOT 2007-1project No. 203288.ReferencesBognár, Z., Láng, L., Bedő, Z. (2007): Effects of environment on the plant height of wheat germplasm. CerealRes. Commun., 35, 281–284.Borlaug, N. E. (1968): Wheat breeding and its impact on world food supply. In: Finlay, E. W., Sheperd, K. W.(eds.), Proceedings of the 3 rd International Wheat Genetics Symposium. Australian Academy of Science,Camberra, pp. 5–15.Börner, A., Plaschke, J., Korzun, V., Worland, A. J. (1996): The relationships between the dwarfing genes ofwheat and rye. Euphytica, 89, 69–75.Ellis, M. H., Spielmeyer, W., Gale, K. R., Rebetzke, G. J., Richards, R. A. (2002): “Perfect” markers for theRht-B1b and Rht-D1b dwarfing genes in wheat. Theor. Appl. Genet., 105, 1038–1042.Evans, L. T. (1998): Feeding the Ten Billion: Plants and Population Growth. Cambridge, CambridgeUniversity Press. pp. 133–150.Gale, M. D., Youssefian, S. (1985): Dwarfing genes in wheat. In: G. E. Russed (ed). Progress in PlantBreeding Vol 1. Butterworths. London. pp. 1–35.Knopf, C., Becker, H., Ebmeyer, E., Korzun, V. (2008): Occurrence of three dwarfing Rht genes in German69

AGRISAFE Budapest, Hungary, 2011winter wheat varieties. Cereal Res. Commun., 36, 553–560.McCartney, C. A., Somers, D. J., Humphreys, D. G., Lukow, O., Ames, N., Noll, J., Cloutier, S., McCallum,B. D. (2005): Mapping quantitative trait loci controlling agronomic traits in the spring wheat crossRL44523‘AC Domain’. Genome, 48, 870–883.McIntosh, R. A., Hart, G. E., Gale, M. D. (1995): Catalogue of gene symbols for wheat. In: Li, Z. S., Xin, Z.Y. (eds.), Proc of 8 th Int. Wheat Genet. Symp. pp 1333–1500. China Agricultural Scientech Press, Beijing.Peng, J. R., Richards, D. E., Hartley, N. H., Murphy, G. P., Devos, K. M., Flintham, J. E., Beales, J., Fish, L.J., Worland, A. J., Pelica, F., Sudhakar, D., Christou, P., Snape, J. W., Gale, M. D., Harberd, N. P. (1999):“Green revolution” genes encode mutant gibberellin response modulators. Nature, 400, 256–261.Zhang, X., Yang, S., Zhou, Y., He, Z., Xia, X. (2006): Distribution of the Rht-B1b, Rht-D1b and Rht8 reducedheight genes in autumn-sown Chinese wheats detected by molecular markers Euphytica, 152, 109–116.70

Budapest, Hungary, 2011AGRISAFESPANISH HULLED WHEAT: A GOOD SOURCE OF GENETICRESOURCESC. GUZMÁN 1 – L. CABALLERO 1,2 – L. M. MARTÍN 1 – J. B. ALVAREZ 11 Departamento de Genética, Escuela Técnica Superior de Ingeniería Agronómica y de Montes, Universidad deCórdoba, ES-14071 Córdoba, Spain. Email: ge2gugac@uco.es2 Present address: Megaseed S.A. Estrada 624 (5800) Río Cuarto, Provincia de Córdoba, Argentine Republic.Abstract One of the challenges presented by climate change is the search for sustainable models of agriculture.To attain this goal, and satisfy the increasing demand for unconventional food products, the revival oftraditional crops such as hulled wheat could play an important role. Among the hulled wheat species, threewere widely cultivated in Spain until the mid 20 th century: einkorn, emmer, and spelt. In each of these species,new alleles for the high molecular weight glutenin subunits (HMWGs) and waxy proteins were detected usingthe SDS-PAGE technique. A deeper study of these glutenin and waxy genes, based on sequencing, hasrevealed that some of the hulled wheat alleles were novel. These variants could be used to enlarge the availablegene pool, and to design new cultivars able to adapt to a changing environment.Key words: einkorn, emmer, glutenins, spelt, waxy proteinsIntroductionFrom the mid 20th century, plant breeding based on high-yielding cultivars hascontributed to the narrowing of the genetic base of crops, causing many modern cultivarsto be closely related (Esquinas-Alcázar, 2005). Subsequently, it is necessary to searchfor and conserve plant genetic resources to enlarge the genetic pool and avoid geneticuniformity, which makes crops vulnerable to biotic and abiotic stressors. To face newchallenges arising as a consequence of climate change, sustainable models of agricultureneed to be found.Within the wide complex of wheat species, there is a group defined as ‘hulled wheat’,which refers to the glumes remaining adhered to the grain after threshing. In Spain, threehulled wheat species were widely cultivated until the early 20th century (Peña-Chocarroand Zapata-Peña, 1998): einkorn (Triticum monococcum L. ssp. monococcum ; 2n = 2= 14, AA), emmer (T. turgidum ssp. dicoccum Schrank; 2n = 4 = 28, AABB), and spelt(T. aestivum ssp. spelta L. em Thell.; 2n = 6 = 42, AABBDD). Grain quality dependspartially on two groups of proteins present in the grain: high molecular weight gluteninsubunits (HMWGs), and waxy proteins. The HMWGs influence gluten strength, whereaswaxy proteins (responsible for amylose synthesis) affect starch quality (Nakamura et al.,1995). In the past decade, our research group has carried out studies on the germplasm ofSpanish hulled wheat. The main objective of these studies was to evaluate the allelicvariation of both protein groups, and their possible use in wheat breeding programs.Material and methodsThree collections – 29 accessions of einkorn, 90 of emmer, and 420 of spelt wheat –were obtained from the National Small Grain Collection (Aberdeen, USA), Center forGenetic Resources (Netherlands), and the Centro de Recursos Fitogenéticos-INIA(Alcalá de Henares, Spain), and analyzed.The HMWGs were extracted from crushed endosperm according to the protocoldescribed by Alvarez et al. (2001). Reduced and alkylated glutenin subunits werefractionated in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)gels (T = 8% and C = 1.28%). Gels were stained overnight with 12% (w/v)71

AGRISAFE Budapest, Hungary, 2011trichloroacetic acid solution containing 5% (v/v) ethanol and 0.05% (w/v) CoomassieBrilliant Blue R-250. De-staining was carried out with tap water.For waxy proteins, flour from one grain was mixed with 1 mL of distilled water andincubated at 4C for 24 h. The homogenate was filtered through Miracloth andcentrifuged. The pellet was washed with 1 mL of buffer A (55 mM Tris-HCl pH 6.8,2.3% (w/v) sodium dodecyl sulphate, 2% (w/v) dithiothreitol, 10% (v/v) glycerol), andkept for 30 min at room temperature with the same buffer. Starch was washed threetimes with distilled water, once with acetone, and then air-dried. The residue was mixedwith 80 L of buffer A, heated in boiling water for 2 min, and centrifuged. Twenty L ofsupernatant was run in SDS-PAGE gels (T = 8% and C = 1.28%).Genomic DNA was extracted from young leaves by the CTAB method (Stacey and Isaac1994), and then used to amplify both HMWGs and waxy proteins with specific primers.Results and discussionThe variability and genetic diversity of endosperm storage proteins of einkorn (Alvarezet al., 2006), emmer (Pflüger et al., 2001), and spelt (Caballero et al., 2001, 2004a, b)present in the collections of the Germplasm Bank have been studied. Our surveydetected variation in the composition of the HMWGs of the three hulled wheat species(Fig. 1). Of the allelic variants found in this material, some had not been detected inwheat until now (Caballero et al., 2001, 2004a, b; Pflüger et al., 2001). The lowfrequency of these novel alleles indicates a great possibility of genetic erosion by geneticdrift.Figure 1. Variability detected in the high molecular weight glutenin subunits (HMWGs) of three hulled wheatspecies: A, einkorn; B, emmer; and C, spelt.Three allelic variants were detected at the Glu-A1 m locus (a, b and c) in einkorn wheat.In emmer, four alleles were detected at Glu-A1 (a, c, j and Glu-A1-VII), the latter novel.Additionally in emmer, nine different alleles were identified at the Glu-B1 locus, three ofthem novel and designated as Glu-B1-XV, Glu-B1-XVI and Glu-B1-XVII. In spelt wheat,up to 19 allelic variants (three alleles at the Glu-A1 locus, seven at Glu-B1, and nine atGlu-D1) were found in the evaluated accessions. Some of these alleles have beendescribed previously in bread and durum wheat, whereas others have not beenpreviously found and were named Glu-B1-XVIII, Glu-B1-XIX, Glu-D1-I, Glu-D1-II,Glu-D1-III, and Glu-D1-IV.72

Budapest, Hungary, 2011AGRISAFEPolymorphism was much lower in waxy proteins compared with the HMWGs. In oursurvey (Fig. 2), using SDS-PAGE, two alleles were detected for the Wx-A1 protein ineinkorn: Wx-A m 1a and Wx-A m 1a (Guzman et al., 2009). This was the first report ofpolymorphism of this protein in diploid wheat. Both Wx-A1 alleles had higher mobilitythan the Wx-A1d allele of wild emmer (T. turgidum L. ssp. dicoccoides) found byYamamori et al. (1995). In Spanish emmer, no variation was found for the Wx-A1protein, although three different alleles were detected for Wx-B1: b (null), c* and g(Guzman et al., 2011). These last two had an almost identical electrophoretic mobility toWx-B1c and Wx-B1a from durum wheat, respectively. Molecular characterization byPCR and sequencing analysis of the emmer alleles revealed several amino acid changesin the sequences, when compared with durum wheat, and confirmed that the emmeralleles can be considered novel.Figure 2. Variability of waxy proteins by SDS-PAGE in hulled wheat. Einkorn: Wx-A m 1a (1), Wx-A m 1a (2),and Wx-A1d (3). Emmer: Wx-B1a (1), Wx-B1g (2), Wx-B1c (3), Wx-B1c* (4), Wx-B1a (5), and Wx-B1b (6).Spelt: Wx-A1b (1), Wx-B1b (2), Wx-D1b (3), Wx-D1g (4), Wx-B1a (5), and Wx-B1c (6).Lastly, null alleles were detected for each waxy gene in spelt wheat including theextremely rare Wx-D1b (Guzman et al., 2010), which has been detected previously onlyin five cultivars of common wheat (Yamamori et al., 1995; Urbano et al., 2002). Thisdiscovery enhances the range of parents available for use in waxy wheat (amylose-free)production. Two alleles with different mobility were also detected: Wx-B1c and Wx-D1g. Therefore, the spelt wheat collection studied here showed a high degree ofpolymorphism for waxy proteins. Further, more variability was found when sequencingthe three waxy genes in several accessions, including new alleles for both Wx-A1 andWx-B1 genes.ConclusionsBroad polymorphism was detected for both HMWGs and waxy proteins in Spanishhulled wheat collections. These new allelic variants could affect wheat propertiesthrough transfer to durum or bread wheat or the analysis of hulled wheats themselves.Consequently, this variation could be used to enlarge the available gene pool, and todesign new cultivars able to adapt to a changing environment, without losing quality73

AGRISAFE Budapest, Hungary, 2011standards or industrial food according to the demands of a highly sensitized populationwith food.AcknowledgementsThis paper was financially supported by grants AGL2007-65685-C02-02 and AGL2010-19643-C02-01 fromthe Spanish Ministry of Science and Innovation, co-financed with the European Regional Development Fund(FEDER) from the European Union. The first author thanks the Spanish Ministry of Education (FPU program)for a predoctoral fellowship.ReferencesAlvarez JB, Martín A, Martín LM (2001): Variation in the high molecular weight glutenin subunits coded atthe Glu-H ch 1 locus in Hordeum chilense. Theor. Appl. Genet. 102, 134–137.Alvarez JB, Moral A, Martín LM (2006): Polymorphism and genetic diversity for the seed storage proteins inSpanish cultivated einkorn wheat (Triticum monococcum L. ssp. monococcum). Genet. Resour. Crop Evol.53, 1061–1067.Caballero L, Martín LM, Alvarez JB (2001): Allelic variation of the HMW glutenin subunits in Spainaccessions of spelt wheat. Theor. Appl. Genet. 103, 124–128.Caballero L, Martín LM, Alvarez JB (2004a): Genetic variability of the low-molecular-weight gluteninsubunits in spelt wheat (Triticum aestivum ssp. spelta L. em Thell.). Theor. Appl. Genet. 108, 914–919.Caballero L, Martín LM, Alvarez JB (2004b): Variation and genetic diversity for gliadins in Spanish speltwheat accessions. Genet. Resour. Crop Evol. 51, 679–686.Guzman C, Caballero L, Alvarez JB (2009): Variation in Spanish cultivated einkorn wheat (Triticummonococcum L. ssp. monococcum) as determined by morphological traits and waxy proteins. Genet.Resour. Crop Evol. 56, 601–604.Guzman C, Caballero L, Alvarez JB (2011): Molecular characterization of the Wx-B1 allelic variants identifiedin cultivated emmer wheat and comparison with those of durum wheat. Mol. Breed. (DOI.10.1007/s11032-010-9493-2).Guzman C, Caballero L, Moral A, Alvarez JB (2010b): Genetic variation for waxy proteins and amylosecontent in Spanish spelt wheat (Triticum spelta L.). Genet. Resour. Crop Evol. 57, 721–725.Esquinas-Alcázar J (2005): Protecting crop genetic diversity for food security: political, ethical and technicalchallenges. Nat. Genet. Rev. 6, 946–953.Nakamura T, Yamamori M, Hirano H, Hidaka S (1995): Production of waxy (amylose-free) wheats. Mol. Gen.Genet. 248, 253–259.Peña-Chocarro L, Zapata-Peña L (1998): Hulled wheats in Spain: history of minor cereals. pp. 45–52. In:Triticeae III. (Ed.) Jaradat AA. Science Publishers Inc., New Delhi, India.Pflüger LA, Martín LM, Alvarez JB (2001): Variation in the HMW and LMW glutenin subunits from Spanishaccessions of emmer wheat (Triticum turgidum ssp. dicoccum Schrank). Theor. Appl. Genet. 102, 767–772.Stacey J, Isaac P (1994) Isolation of DNA from plants. pp. 9–15. In: Methods in molecular biology: protocolsfor nucleic acid analysis by non-radiactive probes. (Ed.) Isaac PG. Humana Press, Totawa.Urbano M, Margiotta B, Colaprico G, Lafiandra D (2002): Waxy protein in diploid, tetraploid and hexaploidwheats. Plant Breed. 121, 1–5.Yamamori M, Nakamura T, Nagamine T (1995): Polymorphism of two waxy proteins in the emmer group oftetraploid wheat, Triticum dicoccoides, T. dicoccum, and T. durum. Plant Breed. 114, 215–218.74

Budapest, Hungary, 2011AGRISAFEQUALITATIVE PARAMETERS OF OAT GENOTYPES IN THESLOVAK AVENA COLLECTIONP. HOZLÁR 1 – D. DVONČOVÁ 1 – M. BIELIKOVÁ 21 Plant Production Research Centre Piešťany, Research Institute of Plant Production, Research Breeding StationVígľaš-Pstruša, Slovakia.2 Plant Production Research Centre Piešťany, Research Institute of Plant Production, SlovakiaAbstract The Slovak Avena Collection contains 1073 genotypes. Specific qualitative traits were recorded,including a total of 44 data-processing and 27 descriptive traits. The specific descriptive traits of all the SlovakAvena Collection were evaluated using the Statistica Program. Histograms of specific traits and densityfunctions of the common distribution of these traits were also constructed. The height variability of thecollection was calculated using the traits 1000-kernel weight, volume weight, percentiles of husk, proteincontent, quotient of grains over 2 mm sieve size and crude fibre content.Key words: Avena collection, genetic resources, variability, histogramIntroduction26 species of wild and cultural represent the genetic resources of Avena L., with threelevels of ploidy. Diploid (eg: A.strigosa 2n = 14), tetraploid (eg: A.abyssinica 2n = 28 )and hexaploid (eg: A.sativa, A. byzantina, A. fatua 2n = 42 ). The greatest diversity oflandraces of the genus Avena L. is concentrated in the ex situ collections in Russia andthe United States, but wild species are concentrated mainly in the gene banks of Canada,the United States, Britain and Russia. (Loskutov, 2008).Responsibility for the evaluation of the Avena L. collection is PPRC, RIPP, RBS Vígľaš-Pstruša. The gene bank RIPP implements the conservation and management. At present,the Slovak Avena L. collection consists of 1073 Avena genotypes. A. species of Avenasativa constitutes a decisive share with 1063 genotypes. Avena byzantina is representedby 8 genotypes and Avena fatua with 2 genotypes. All genotypes in the Slovak collectionare hexaploids. Among 1073 genotypes are 269 genotypes with yellow husks, 637 withwhite husks, 58 with black husks, 6 with brown husks, 73 genotypes of oats that arenaked and 30 genotypes where the color of the husks have yet to be identified.Materials and methodsNursery collections are sown each year (Figure 1), into which newly obtained genotypesare inserted from gene banks, breeding, research and harvesting expeditions. At the sametime, two years of worth of nursery are sown from the bred seed (Figure 2) where weevaluate 27 descriptive characterstics , which are recorded in the characteristic database.44 technical characteristics are recorded as well. Selected morphological and biologicalcharacteristics are recorded by classification of Avena L. (IBPGR, 1985). Nurseries aresown for the regeneration of stored seeds in the collection, particularly for reducing thegermination of genotypes or stored in a reduction in number of seeds stored below aspecified threshold for the provision of other workplaces. The total sown annually isfrom 4 000 to 11 000 m 2 of nursery depending on the amount obtained or recoveredthrough proliferated seed. Qualitative parameters: the qualitative characteristic ofproportion of husk was made on a peeling machine. Volume weight of seeds wasdetermined using cylinders intended for this purpose. Steineker sieves were used tostrain the largest grain. A seed calculator was used for the next characteristic, TKW(thousand kernel weight). Carbon and nitrogen were set in the Dumas method into theanalyser CNS 2000 (LECO Corp. (USA). Nitrogenous compounds (proteins) conversion.75

AGRISAFE Budapest, Hungary, 2011The contents dry basis is determined with the automated moisture parser ME 30(Sartosius, Germany).Figure 1. Figure 2.Crude fiber is determined using methods developed by Henneberg and Stohmann. Thequalifying parameters of the entire Slovak Avena collections were selected usingevaluations of work in the Statistica program. Similarly, histograms were implementedfor each character and the function of density within the normal cumulative distributionfor these characters. This allows us to evaluate the variability of characteristics in theentire Slovak Avena collection.Results and discussionOn the basis of the results we can see that the values in percentiles of husk in huskedoats was from 16 to 40 % (Figure 3). A wide variability of characteristics of TKW werealso found when some genotypes of naked oats showed TKW between 10-20 g and somehusked oats up to 50 g (Figure 4). The volume weight of high-husked oats ranged fromless than 40 kg*100l -1 to 70 kg*100 l -1 in some naked oats (Figure 5). The quotient ofgrains over 2 mm sieve displayed the highest variability and varied from 0 to 100 %(Figure 6). The carbon contents did not display high variability with a range from 42 to50.5 % (Figure 7). By contrast, the contents of nitrogen and the total contents of proteinwas found to have a relatively high variability when protein content in some husked oatswas around 8 % and in some naked oats up to 21.5 % (Figure 8). Similarly, contentcharacteristics of crude fibres demonstrated relatively high variability with movementfrom 2.5 % in some naked oats and up to 16.5 % for some husked oats (Figure 9).Number of genotypesHistogram: Volume weight (kg.100l-1)700600500400300200100035 40 45 50 55 60 65 70Figure 5.Histogram: Quotient of grains over 2 mm sieve %350300Number of genotypes2502001501005000 20 40 60 80 100Figure 6.76

Budapest, Hungary, 2011AGRISAFENumber of genotypesHistogram: Carbon contents %30025020015010050041 42 43 44 45 46 47 48 49 50 51Number of genotypes220200180160140120100806040200Histogram: Protein contents (%)6 8 10 12 14 16 18 20 22Figure 7.Figure 8.Number of genotypes200180160140120100806040200Histogram: Crude fiber %0 2 4 6 8 10 12 14 16 18Figure 9.On the basis of an evaluation of select features in the Slovak Avena L. collections wehave evaluated specific qualitative features in the Slovak Avena collection. On the basisof this analyses genotypes that displayed extreme characteristics were selected, whichmay also serve as source materials for breeding or for research purposes.ConclusionsIn reference to the evaluation of the selected characteristics of the slovak Avena L.collection we can state the following:In this work we assess selected qualitative features in the slovak Avena collection,enabling us to assess the variability of the characteristics in the whole slovak Avenacollection.On the basis of tests, genotypes were defined, which showed better qualitativeparameters in our conditions than in other present registered varieties in Slovakia andcan serve as a starting material for breeding.Based on the analysis, genotypes were defined with extreme manifestations in selectedqualitative characteristics that can be used for research purposes.ReferencesLoskutov, I.G. (2008): Strength and Weakness of Covered and Naked Oat: Approaches and Perspectives.Physiology, Ecology and Production, IOC 2008.IBPGR (1985): Oat descriptors. International Board for plant genetic resources, 1985, Rome77

AGRISAFE Budapest, Hungary, 2011SCREENING OF BULGARIAN WHEAT VARIETIES ANDDOUBLED HAPLOID LINES FOR FUSARIUM HEAD BLIGHTRESISTANCEG. KOLEV 1 – E. MOLLOVA 1 – G. GANEVA 21 Department of Plant Protection, Faculty of Agronomy, University of Forestry, Kl. Ochridsky Str.10, 1756Sofia, Bulgaria, e-mail: kolev_g@web.de2 Institute of Genetics of the Bulgarian Academy of Sciences, 1113 Sofia, BulgariaAbstract Fusarium head blight (FHB) is one of the most harmful diseases in many wheat cropping areasworldwide. It can cause enormous economic damage due to yield and quality losses and contaminates the grainwith mycotoxins which are harmful to humans and animals. The cultivation of resistant varieties is one of themost promising strategies to control the FHB severity. The objective of this study was to investigate differentBulgarian wheat varieties and doubled haploid lines for Fusarium head blight resistance and especially forfungal penetration and pathogen spread within the wheat ear. Wheat plants from a population of five doubledhaploid lines and nine varieties were point- and spray-inoculated in field trials at mid-anthesis with a conidialsuspension of Fusarium graminearum. The percentage of infected florets, and the relative thousand-grain andear weight of infected versus control heads were evaluated. The results showed that the varieties “Katia”,“Boliarka”, “Demetra” and “Kristi” and the doubled haploid lines “MO48”, “MO57” and “MO58” weresusceptible to Fusarium spread within the head. A relatively high level of resistance was determined forvarieties “Enola” and “Svilena” and for the doubled haploid lines “MO54” and “MO55”. A high correlation(r=0.76; r=0.74) was observed between the number of infected florets in point-inoculated plants and therelative thousand-grain and ear weight.Key words: Fusarium head blight, Triticum aestivum, resistance, varietiesIntroductionFusarium head blight (FHB) caused by different Fusarium species is among the majorfungal diseases of wheat worldwide. It can cause enormous economic damage by yieldand quality losses and can contaminate the grain with mycotoxins which are harmful tohumans and animals. Several studies have shown that resistance to FHB is horizontal orof non-specific nature (Van Eeuwijk et al. 1995, Mesterhazy et al. 1999) at least for themost prevalent species F. graminearum and F. culmorum. Breeding of geneticallyresistant varieties is the most efficient means to control the FHB and to prevent the foodand feed of mycotoxins contamination.Schroeder and Christensen (1963) have reported several types of resistance to Fusariumhead blight: resistance of type I, which is associated to initial infection and resistance oftype II, associated with the spread of the pathogen within the head. The infection of earsby Fusarium sp. can result in significant reduction of yield and quality (Windels 2000).The objective of the study was to screen different Bulgarian wheat varieties and severaldoubled haploid lines about their susceptibility to Fusarium graminearum. The obtainedinformation can be used to avoid the susceptible cultivars.Materials and methodsPlant materials and field experimentsEight Bulgarian cultivars and five doubled haploid lines derived from the cross “K106”and F 1 hybrid “Gladiator” x “Rusalka” were screened for Fusarium resistance of type I(initial infection) and for resistance of type II (fungal spread within the head). Field trialswere carried out in 2008 at the Institute of Genetics “D. Kostoff”, Bulgarian Academy ofSciences in small plots (30 x 100 cm). The plants were inoculated at the mid-anthesiswith a spore suspension (100 ml m -2 ) consisting 10 5 conidia ml -1 from a single spore78

Budapest, Hungary, 2011AGRISAFEhighly aggressive isolate Вр1-2005 of Fusarium graminearum. The point-inoculated andthe control plants were marked with a wafer and overlapped with plastic bags during thespraying. The same spore suspension in concentration 2x10 4 conidia ml -1 was used forthe single-floret inoculation method.Assessment of Fusarium head blight resistanceDisease was visually assessed on day 10 after inoculation at the growth stage 75 (Zadokset.al., 1974) as percentage (0-100%) or number of visually infected spikelets for eachplot. After ripening 30 wheat heads were harvested manually from each plot. The weightof the heads was recorded to calculate the yield of the inoculated plots versus noninoculatedcontrol. The heads were subsequently manually threshed and used todetermine the thousand grains and the ear weight from each plot.Results and discussionThe investigated cultivars and DH lines showed different genetic diversity in relation toFusarium head blight resistance. In case of the spray inoculation (Fig. 1) the cultivars“Boliarka”, “Demetra” and “Sadovo” as well the lines “K106” and “MO48” showedvariation between 7,0 and 9,3 for the percentage of diseased spikelets. No infected earswere recorded by the cultivars “Petia”, “Katia” and DH lines “MO54”. The yield loses inform of ear weight or 1000 grain weight was not in correlation with the percentage ofinfected spikelets (table 1).1070ear weight1000 grain weight960infected spikelets (%)876543relative yield loses (%)5040302021100SvilenaEnolaBezostayaKatiaPetiaKristiBoliarkaDemetraSadovoMO 48MO 54MO 55MO 56MO 570SvilenaEnolaBezostayaKatiaPetiaKristiBoliarkaDemetraSadovoMO 48MO 54MO 55MO 56MO 57Figure 1. FHB severity and yield loses of different bulgarian wheat cultivars and DH lines after sprayinoculation with F. graminearum. Assesement and effect of resistance to initial infection (type I)1270ear weight1000 grain weight1060number of infected spikelets8642relative yield loses (%)50403020100abc bc acde de abc acde ae acde ae e acde b bc ac acSvilenaEnolaBezostaiaKatiaPetiaKristiBoliarkaDemetraSadovoMO 48MO 54MO 55MO 56MO 57Figure 2. FHB severity and yield loses of different Bulgarian wheat cultivars and DH lines after pointinoculationwith F. graminearum. Assesement and effect of resistance to fungal spread within the ear (type II),Fisher's LSD Test, p≤0,05, = +SDAfter single-floret inoculation the variation between the groups was significant for thenumber of diseased spikelets (P=0,006). The data displayed a distribution with a range of0-10SvilenaEnolaBezostayaKatiaPetiaKristiBoliarkaDemetraSadovoMO 48MO 54MO 55MO 56MO 5779

AGRISAFE Budapest, Hungary, 20115,3 infected spikelets (Fig. 2). The cultivars “Katia”, “Boliarka”, “Demetra” and line“K106” were susceptible to the fungal spread within the head. The mean value was 5,8scabbed spikelets per spike. The most resistant varieties were “Svilena”, “Enola” and“Petia” with mean value of 3,1 infected spikelets as well the DH lines “MO54” and“MO55” with 1,7 respectively 2,8 diseased spikelets per spike. Highly positivecorrelations (r=0,74, r=0,76) were observed between the number of diseased spikeletsand relative thousand grain and ear weight.Number ofdiseasedspikelets 1Table 1. Correlation analysis between FHB severity and yield losesSingle floret inoculationSpray inoculationnumber ofpercentagediseasedspikeletsearweight1000 grainweightof diseasedspikeletsearweightpercentageof diseasedspikelets 11000 grainweightear weight 0.74*** 1 ear weight -0.36 11000 grainweight 0.76*** 0.64** 11000 grainweight -0.003 0.45 1*** P

Budapest, Hungary, 2011AGRISAFEReferencesBai, G., Shaner, G. (2004): Management and resistance in wheat and barley to Fusarium head blight. Annu RevPhytopathol 42:135–161Borojevic, K., Borojevic, K. (2005): The transfer and history of ‘‘Reduced Height Genes’’ (Rht) in wheat fromJapan to Europe. J. Hered. 96, 455-459.Buerstmayr, H., Ban, T., Anderson, J.A. (2009): QTL mapping and marker assisted selection for Fusariumhead blight resistance in wheat – a review. Plant Breeding 128, 1-26.Buerstmayr, H., Lemmens, M., Hartl, L., Doldi, L., Steiner, B., Stierschneider, M., Ruckenbauer, P. (2002):Molecular mapping of QTLs for Fusarium head blight resistance in spring wheat. I. Resistance to fungalspread (type II resistance). Theor. Appl. Genet. 104, 84-91.Draeger, R., Gosman, N., Steed, A., Chandler, E., Thomsett, M., Srinivasachary, Schondelmaier, J.,Buerstmayr, H., Lemmens, M., Schmolke, M., Mesterhazy, A., Nicholson, P. (2007): Identification ofQTLs for resistance to Fusarium head blight, DON accumulation and associated traits in the winter wheatvariety Arina. Theor. Appl. Genet. 115, 617-625.Lin, F., Kong, Z. X., . Zhu, H. L., Xue, S. L., Wu, J. Z., Tian D. G., Wie, J. B., Zhang, C. Q., Ma, Z. Q. (2004):Mapping QTL associated with resistance to Fusarium head blight in the Nanda2419 × Wangshuibaipopulation. I. Type II resistance. Theor Appl Genet 109, 1504–1511Mesterhazy, A., Bartok, T., Mirocha, C.G., Komoroczy, R. (1999): Nature of wheat resistance to Fusariumhead blight and the role of deoxynivalenol for breeding. Plant Breeding 118, 97-110.Schroeder, H.W., Christensen, J.J., (1963): Factors affecting the resistance of wheat to scab caused byGibberella zeae. Phytopathology 53, 831-838Srinivasachary., Gosman, N., Steed, A., Simmonds, J., Leverington-Waite, M., Wang, Y., Snape, J.,Nicholson, P. (2008): Susceptibility to Fusarium head blight is associated with the Rht-D1b semi-dwarfingallele in wheat. Theor. Appl. Genet. 116, 1145-1153.Van Eeuwijk, F.A., Mesterhazy, A., Kling, C.I., Ruckenbauer, P., Saur, L., Burstmayr, M., Lemmens, M.,Keizer, LCP., Maurin, N., Snijders, CHA. (1995): Assessing non-specificity of resistance in wheat to headblight caused by inoculation with European strains of Fusarium culmorum, F. graminearum and F. nivaleusing a multiplicative model for interaction. Theor. Appl. Genet. 90, 221-228.Voss, H.H., Holzapfel, J., Hartl, L., Korzun, V., Rabenstain, F., Ebmeyer, E., Coester, H., Kempf, H.,Miedaner, T. (2008): Efffect of the Rht-D1 dwarfing locus on Fusarium head blight rating in threesegregating populations of winter wheat. Plant Breeding 127, 333-339Windels., C.E. (2000): Economic and social impact of Fusarium head blight: Changing farms and ruralcommunities in the Northern Great Plains. Phytopathology 90,17–21.Zadoks, J.C., Chang, T.T. and Konzak, C.F. (1974): Decimal code for growth stages of cereals. Weed Research15, 415–421.Zwart, R.S., Muylle, H., Van Bockstaele, E., Roldán-Ruiz, I. (2008): Evaluation of genetic diversity ofFusarium head blight resistance in European winter wheat. Theor Appl Genet 117, 813–82881

AGRISAFE Budapest, Hungary, 2011EFFECT OF FOOD SOURCE ON THE BIOLOGY OF THEANGOUMOIS GRAIN MOTH SITOTROGA CEREALELLA OLIVIER(LEPIDOPTERA: GELECHIIDAE) WHEN FEEDING ONVARIOUS WHEAT GENOTYPES (TRITICUM AESTIVUM L.)L. KOLEVA 1 – G. GANEVA 21 University of Forestry, Faculty of Agronomy, 1756 Sofia, Bulgaria2 Institute of Genetics, Bulgarian Academy of Sciences, 1113 Sofia, BulgariaAbstract Laboratory experiments under controlled conditions (28±1°C, 60±10% RH, 14 h photophase) wereperformed to study the biology of Sitotroga cerealella (Oliv.) reared on natural diets of three different wheatgenotypes. S. cerealella reared on the shrunken 1 genotype displayed the longest developmental time (45 d)and the lowest fecundity (99.6 eggs/female). The results showed pronounced differences in the development ofthe Angoumois grain moth depending on the food substrate (different genotypes of wheat). The time ofdevelopment ranged from 37 to 45 days. The rate of survival of the pre-imaginal stage declined when theduration of development increased. In the hybrid line PS2 a 34% lower survival was reported in the preimaginalstage. No significant differences were found between the number of eggs hatched from females rearedon these genotypes. The amylose content of starch in the genotypes was between 17% and 25% and correlatedhighly with the biological parameters of the Angoumois grain moth.Key words: resistance, stored product insects, Sitotroga cerealella, genotypes, Triticum aestivumIntroductionThe Angoumois grain moth Sitotroga cerealella (Olivier, 1789) is an important pest ofcereal in most countries (Jembere et al., 1995). After a successful over wintering inheated rooms, the moth causes significant damage to grain production in the field, too.The rapid spread of the Angoumois grain moth, whose development takes place insidethe grain, leads to a reduction of the absolute mass of seeds, to increase the humidity ofthe grain and can promote the development of fungal and bacterial diseases.The wheat (Triticum aestivum L. AABBDD, 2n=6x=42) is one of the most abundant andwidespread crop plant in the world. Genetic techniques that allow manipulation ofspecific genes have been developed in cereals as a strategy for creating a differentrelation between carbohydrates and proteins in the grain (Glover et al., 1975; Alexanderand Creech, 1977). These modifications can affect both the properties of the cereal grain,and pest-host relationships (Rhine and Staples, 1968; Schoonhoven et al., 1972; Gomezet al., 1983a, b; Tipping et al., 1988, Consoli et al., 1995; Bi et al., 2006; Ashamo, 2010).The resulting changes could be used successfully for control of stored-product insects.The solution to problems in storage of cereals associated with the pesticide residues, therisk of development of insecticide-resistant populations and the protection of theenvironment is possible by developing new technologies of pest control, including thebreeding of pest-resistant varieties.The aim of this study was to trace the development and to identify biological parametersof the second (in storage) generation of the Angoumois grain moth during feeding withdifferent wheat genotypes and to determine the level of attack.Materials and methodsExperimental material: The experiments were carried out with a population of S.cerealella originating from the experimental field and the storage facilities in theInstitute of Genetics, BAS. The following wheat genotypes were tested: winter-spring82

Budapest, Hungary, 2011AGRISAFEcultivar Gladiator113 and highly productive winter-spring wheat lines PS2 and PS6isolated from the hybrid of cultivars Gladiator113 and Rusalka.Determination of the amylose in the grain starch: The amylose content of starch wasdetermined by the method of McDermott (1980).Observation of the biology of S. cerealella: The experiments were carried out withgrain samples, which were hand threshed immediately after wheat harvesting. Afterdetermination of the damage by the first (field) generation, the newly hatched mothswere released into containers for egg deposition. The eggs at the age of 0÷24 h werecounted and placed in glass containers with healthy grains of the different wheatgenotypes. All variants (wheat genotypes, depending on the origin of the seeds and theirsowing time) were carried out in 10 replications and observed under identical andoptimal conditions- 28±1 °C, 60±10% r. h. and 14 h photophase.Statistical analysis: Mathematical treatment of the results was performed with thestatistical computer program SYSTAT 10. The influence of the tested factors wasdetermined by analysis of variance (ANOVA). Mean values were compared by using theTukey’s test.Results and discussionThe relationship between the degree of damage by the first generation of S. cerealellaand time of sowing was determined. In Table 1, the data are presented for the damagecaused by the first generation in the field (BBCH 77-87).Table 1. Degree of damage and survival of S. cerealella (first generation) during feeding on different wheatgenotypesWheat genotypesGladiator 113 PS2 PS6Time of sowingautumn spring autumn spring autumn springDamaged 78.61.4 Mа 80.01.5Mа 42.01.5Pа 47.71.9Pа 80.41.2Mа 82.71.8Mаgrain (%)Survival (%) 70.61.3Mа 71.01.1Mа 38.61.4Pа 39.31.1Pа 71.31.1Mа 74.31.5MаThe mean value compared with the Тukey s test depending on the genotypes (capital letters) and the time ofsowing (small letters), P0.05; no different letters = no significant differenceThe results of the research has shown that the extent of the damage and the percentage ofsurvival do not depend on the factor time of sowing, showed a lasting effect on theinfluence of the factor wheat genotype and do not support the joint action of both factors(Table 2).Table 2. Two factorial analysis of variance (ANOVA) for effect of the sowing time on the degree of damage byS. cerealella during feeding on different wheat genotypesSource Sum of Squares Mean Square/ df F PGenotypes 5514.778 2757.389 2 364.949 0.000 ***Time of sowing 20.056 20.056 1 2.654 0.129 nsGenotypes х Time of sowing 1.444 0.722 2 0.096 0.910 nsError 90.667 7..556 12*** PThe results in Table 3 show that the duration of development of the moth from egg toadult was significantly extended during feeding on the hybrid PS2. The duration of thelife cycle of the moth during feeding on the genotypes Gladiator 113 and PS6 did notdiffer significantly. The values for PS2 were significantly higher than those found in83

AGRISAFE Budapest, Hungary, 2011Gladiator 113 and PS6. A higher percentage of survival of the pre-imaginal stages wasobserved in genotypes PS6 (44-45%) and Gladiator 113 (38-40 %) compared with thePS2 (32-35 %) and percentage of survival of the moths was reduced by extending theduration of the development. On taking into account the egg production, it was foundthat the number of eggs from one female was smaller in the hybrid line PS2, butsignificant differences were not demonstrated between the genotypes.Table 3. Duration of development of S. cerealella (second generation) during feeding on different wheatgenotypeswheat genotypesGladiator113 PS2 PS6Time of sowingautumn spring autumn spring autumn springDevelopmental 38.61.2Mа 40.40.8Mа 44.01.1Pа 45.00.5Pа 35.71.7Pа 32.30.9Pаperiod (days)Survival (%) 74.01.5Mа 72.31.5Mа 51.71.1Pа 49.31.3Pа 81.72.9Mа 82.41.7MаFemale fecundity 1021.5Mа 1031.2Mа 99.62.1Mа 98.00.9Mа 101.70.8Mа 100.61.7Mа(egg/female)The mean value compared with the Тukey s test depending on the genotypes (capital letters) and the time ofsowing (small letters), P0.05; no different letters = no significant differenceThe differences in sex ratio between the moths of the first and second generation fromall genotypes were not foundThe correlation between the biology of S. cerealella and amylose content wasdetermined to suggest the resistance of the genotypes. Table 4 shows the amylasecontent of the different genotypes.Table 4. Amylose content of the grain starchWheat genotypesGladiator113 PS2 PS6Time of sowingautumn spring autumn spring autumn springAmylose content (%) 19.1Ac 17.0Ac 25.0Bc 24.3Bc 21.6Bc 20.1ABcThe mean value compared with the Тukey s test depending on the genotypes (capital letters) and the time ofsowing (small letters), P0,05; no different letters = no significant differenceThe correlation was negatively significant (P

Budapest, Hungary, 2011AGRISAFEthe pre-imaginal stage of S. cerealella when reared on different sorghum and paddyvarieties. Several authors also reported a correlation between the biology of stored pestsand biochemical properties of the grain. The hybrid line PC2 has highest amylosecontent (25 %) compared to the genotypes Gladiator 113 and PC6. Consoli & AmaralFilho (1995) and Ashamo (2010) reported that the lowest survival of S. cerealella rearedis on some corn genotypes and paddy varieties with the high level of amylose. Cogburnet al. (1980) proved a negative correlation between the content of amylose and thedevelopmental period of S. cerealella in feeding on different genotypes of rice.ConclusionsThese results contribute to identify genotypes displaying increased resistance to S.cerealella and their possible use in the breeding schemes. The hybrid line PS2 ischaracterized by a low degree of damage, an extended developmental period of S.cerealella and a low percentage of survival from egg to adult stage. The establishedbiological parameters for S. cerealella and the degree of infestation in hybrid line PC6and cultivar Gladiator 113 have similar values; so they do not demonstrate a differentreaction to the invasion of Angoumois grain moth.On the basis of this study, the development and abundance of S. cerealella in thesegenotypes for a certain period of time can be forecast.ReferencesAshamo, M.O. (2010): Relative resistance of paddy varieties to Sitotroga cerealella (Lepidoptera: Gelechiidae).Biologia, 65 (2), 333-337.Alexander, D. E., Creech, R. G. (1977): Breeding special industrial and nutritional types. In Corn and CornImprovement (Edited by Sprague G. F.), American Society of Agronomy. Madison, WI, U.S.A, 363-389.Consoli, F. L., Amaral Filho, B. F. (1995): Biology of Sitotroga cerealella (Oliv.) (Lepidoptera: Gelechiidae)Reared on Five Corn (Maize) Genotypes. J. srored Prod. Res., 31(2), 139-143.Glover, D. V., Grane, P. L., Misra P. S., Mertz E. T. (1975): Genetics of endosperm mutants in maize asrelated to protein quality and quantity. In Proc. High Quality Profein Maize (Edited by Purdue Universityand CIMMYT), 228-240.Gomez, L. A., Rodriguez, J. G., Poneleit, C. G., Blake, D. F., Smith, C. R. J. (1983a): Influence of nutritionalcharacteristics of selected corn genotypes on food utilization by the rice weevil (Coleoptera:Curculionidae). J. econ. Em., 76, 728-732.Gomez, L. A., Rodriguez, J. G., Poneleit C. G., Blake, D. F. (1983b): Relationship between somecharacteristics of the corn kernel pericarp and resistance to the rice weevil (Coleoptera: Curculionidae). J.econ. Em., 76, 797-800.Jembere, B., Obeng-Ofori, D., Hassanali, A. (1995): Products derived from leaves of Ocimumkilimandscharicum (Labiatae) as postharvest grain protectants against the infestation of three major storedproduct insect pests. Bull. Entomol. Res., 85, 361–367.McDermott, E.E. (1980): The rapid non-enzymatic determination of damaged starch in flour. J. Sci. FoodAgric., 31, 405.Rhine, J. J., Staples, R. (1968): Effect of high-amylose field corn on larval growth and survival of five speciesof stored-grain insects. J. econ. Em., 61, 280-282.Bi RM, Jia HY, Feng DS, Wang HG (2006): Production and analysis of transgenic wheat (Triticum aestivumL.) with improved insect resistance by the introduction of cowpea trypsin inhibitor gene. Euphytica, 151,351–360.Schoonhoven A. V., Wassom, C. E., Horber, E. (1972): Development of maize weevil on kernels of opaco-2and floury-2, nearly isogenic corn inbred lines. Crop Sci., 12, 862-863.Shazali, M. E. H., Smith, R. H. (1985): Life history studies of internally feeding pests of stored sorghum:Sitotroga cerealella (01.) and Sitophilus oryzae (L.). J. stored Prod. Res., 21, 171-178.Tipping, P. W., Rodriguez, J. G., Poneleit C. G., Legg, D. E. (1988): Feeding activity of the maize weevil(Coleoptera: Curcuhonidae) on two dent corn lines and some of their mutants. J. econ. Em., 81, 830-833.85

AGRISAFE Budapest, Hungary, 2011INCREASING THE GENETIC DIVERSITY OF CEREALS:DEVELOPMENT OF TRITICUM TURGIDUM X T. MONOCOCCUMSYNTHETIC HEXAPLOIDSM. MEGYERI – P. MIKÓ – I. MOLNÁR – G. KOVÁCSDepartment of Plant Genetic Resources and Organic BreedingAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, PO Box 19. H-2462E-mail: megyerim@mail.mgki.huAbstract Semi-dwarf einkorn lines with good crossability were identified in order to produce Triticumturgidum x T. monococcum synthetic hexaploids. Two combinations were used to develop the amphiploids:durum x einkorn and emmer x einkorn. After the genome duplication of F 1 seeds, highly fertile synthetichexaploids were developed. The A u BA m genome structure of the synthetic hexaploid progenies was confirmedby GISH. Lines derived from durum x einkorn and emmer x einkorn crosses were studied for agronomicperformance, disease resistance and genetic variability. The durum-based synthetic hexaploid lines showed ahigher level of phenotypic diversity. Selected durum x einkorn synthetic hexaploid lines are currently used inbread wheat improvement to transfer the useful properties of einkorn into cultivated hexaploid wheat via‘bridge-crossing’.Key words: einkorn, synthetic hexaploid, crossabilityIntroductionAmong the Triticeae, einkorn wheat (Triticum monococcum L. ssp. monococcum,2n=2x=14, A m A m ) is thought to be one of the most valuable sources of resistance genesfor cereal breeding (Monneveux et al., 2000). Several cultivated einkorn genotypes havegood agronomic performance; some of them show excellent drought tolerance,allelopathy and straw strength. Moreover, their high tocol and carotenoid contents makethem promising sources for functional food production (Brandolini et al, 2008, Kovács,2008). Unfortunately, the application of cultivated einkorn in wheat breedingprogrammes is greatly limited by their poor crossability with wheat.One possible solution for the utilisation of einkorn in wheat breeding is the developmentof Triticum turgidum x T. monococcum synthetic hexaploids for use as bridge materials.Several durum x einkorn amphiploids (A u A u BBA m A m , 2n=6x=42) have been producedin order to combine the outstanding disease resistance of einkorn with the highproductivity of tetraploid wheat (Gill et al, 1988; Mujeeb-Kazi and Rajaram, 2002,Plamenov et al. 2009). However, these amphiploids contain wild einkorn (T.monococcum ssp. aegilopoides, A b A b ), which has better crossability, rather thancultivated einkorn, which is agronomically more valuable but less crossable.The aim of the present work was the development and agronomic characterization ofnew durum-einkorn and emmer-einkorn synthetic hexaploids. After cytomoleculargenome analysis, the agronomic characterization of the new hexaploids was a furthergoal.Materials and methodsTwo tetraploid Triticum accessions were used to examine their crossability with diploid,cultivated einkorn (Triticum monococcum ssp. monococcum). The female partners weretetraploid durum (T. turgidum ssp. durum, ‘MVTD14-04’) and emmer wheat (T.turgidum ssp. dicoccon, ‘Mv-Hegyes’). The pollinators were five traditional einkornaccessions (ID140, Mv-Alkor, MVGB361, MVGB747 and G11) and five semi-dwarf86

Budapest, Hungary, 2011AGRISAFEeinkorn breeding lines (1T-1, 2T-1, 3T-1, 4T-1 and 3T-3). Crossability was expressed asthe percentage of the number of seeds set to the total number of flowers pollinated.The F 1 hybrids (2n=3x=21; A u BA m ) were cytologically confirmed. The genomeduplication of F 1 hybrid seedlings with 3-5 tillers was achieved by colchicine treatment(0.04%) as described by Barnabás et al. (1991).The genome structure of the Triticum turgidum x T. monococcum synthetic hexaploidlines was characterized by genomic in situ hybridization (GISH). Total genomic DNA ofTriticum urartu was labelled with digoxigenin and used as an A-genomic probe, whilebiotin-labelled DNA from Aegilops speltoides was applied as a B-genomic probe for thediscrimination of the A and B genomes. Digoxigenin and biotin were detected usinganti-digoxigenin-rhodamine and streptavidin-FITC, respectively. The GISH procedurewas carried out according to Molnár et al. (2009).Results and discussionMost crosses with traditional einkorn accessions have failed to produce seeds, except thecombinations durum x ID140 and emmer x MVGB361, where very low seed productionwas obtained (Table 1). Similar results were observed by Bhagyalakshmi et al. (2008) ineinkorn x durum and einkorn x emmer crosses.Table1. Crossability between tetraploid and diploid genotypesNo. ofTetraploid species Einkorn genotypesNo. of seedsflowers♀♂obtainedpollinatedTriticum turgidumssp. durum‘MVTD14-04’Triticum turgidumssp. dicoccon‘Mv-Hegyes’Seed set (%)ID140 273 2 0.7Mv-Alkor 1247 0 0MVGB361 1147 0 0MVGB747 570 0 0G11 640 0 01T-1 398 96 24.12T-1 429 84 19.63T-1 530 87 16.44T-1 568 5 0.93T-3 720 187 25.9ID140 671 0 0Mv-Alkor 840 0 0MVGB361 720 2 0.3MVGB747 572 0 0G11 946 0 01T-1 235 45 19.12T-1 358 61 173T-1 339 69 20.44T-1 341 1 0.33T-3 421 18 4.3Better results were obtained in crosses with semi-dwarf einkorn lines, where the highestseed set percentage was >20%. Differences in crossability were observed between thetwo tetraploid subspecies. The best seed set was obtained for durum x 3T-3 crosses(25.9%), while the emmer x 3T-3 crosses gave the second lowest seed set (4.3%). Twoeinkorn lines with good crossability (1T-1 and 3T-1) were selected for further crosses.Genome duplication was performed on seeds proved cytologically to be triploid, andhighly fertile synthetic hexaploids were developed. Two-colour GISH clearlydiscriminated the A and B genome chromosomes on the basis of their intense green and87

AGRISAFE Budapest, Hungary, 2011orange fluorescent signals, respectively (Fig. 1). Consequently, the A u BA m genomestructure of the new hexaploids was confirmed. However, the A u and A m chromosomescannot be distinguished with this method.Figure 1. Two-colour GISH on mitotic chromosomes of synthetic hexaploid wheat (Triticum turgidum ssp.durum x T. monococcum). The chromosomes of the B genome are green, while the A u and A m chromosomesare orange. Bar = 10m.The F 3 progenies of durum x einkorn crosses and the F 2 progenies of emmer x einkorncrosses were studied for agronomic performance, disease resistance and geneticvariability in the nursery (Table 2). Practically all the lines and genotypes developedshowed excellent resistance against certain wheat diseases (leaf rust, powdery mildew),but not against fusarium. Comparing the two synthetic hexaploid combinations, synthetichexaploid (SH) lines originating from the durum x einkorn cross had better strawstrength and earlier heading than emmer-based SHs. Moreover, durum-based SHsexhibited a very high level of genetic diversity in terms of plant height, flowering time,ear structure and form, and plant growth habit. By contrast, no visible phenotypicvariability was observed among the emmer-based SHs.Selected durum x einkorn synthetic hexaploid lines are currently being used in breadwheat improvement.Table 2. Observation data on SH lines in the nursery. Martonvásár, 2010Plant height Leaf rust Powdery mildewGenotypesHeading date(cm) (0-4)(0-9)Durum x einkorn SHs 21 May-4 June 60-135 0 0Emmer x einkorn SHs 1-3 June 150-160 0 0Durum parent ‘MVTD14-04’ 21 May 70 3 3Einkorn parent ‘1T-1’ 25 May 75 0 0Bread wheat check ‘MvMarsall’20 May 60 3 488

Budapest, Hungary, 2011AGRISAFEConclusionsThe newly produced Triticum turgidum x T. monococcum synthetic hexaploids arepromising genetic resources for wheat breeding. Further investigations have been startedto combine the AG genome of Triticum timopheevii Zhuk. and the A m genome of einkorngenotypes with good crossability.AcknowledgementsThis research was financed by the National Science and Technology Office project(ALKOBEER OM00363) and by the EU Commission FP7 KBBE 245058 SOLIBAMproject.ReferencesBhagyalakshmi, K., Vinod, K. K., Kumar, M., Arumugachamy, S., Prabhakaran, A.J., Raveendran, T.S.(2008): Interspecific hybrids from wild x cultivated Triticum crosses - A study on the cytologicalbehaviour and molecular relations. J. Crop Sci. Biotech. 11, 257-262.Barnabás, B., Pfahler, P.L., Kovács, G. (1991): Direct effect of colchicine on the microspore embryogenesis toproduce dihaploid plants in wheat (Triticum aestivum L.). Theor. Appl. Genet. 81, 675–678.Brandolini, A., Hidalgo, A., Moscaritolo, S. (2008): Chemical composition and pasting properties of einkorn(Triticum monococcum L. subsp. monococcum) whole meal flour. Journal of Cereal Science 47, 599–609.Gill, R.S., Dhaliwal, H.S., Multani, D.S. (1988): Synthesis and evaluation of Triticum durum-T. monococcumamphiploids. Theor. Appl. Genet.75, 912-916.Kovács, G. (2008): Ancient cereals: einkorn and emmer as a source of healthy organic food. EuropeanResearch and Innovation Exhibition, Paris, FranceMolnár, I., Benavente, E., Molnár-Láng, M. (2009): Detection of intergenomic chromosome rearrangements inirradiated Triticum aestivum – Aegilops biuncialis amphiploids by multicolour genomic in situhybridization. Genome 52, 156-165.Monneveux, P., Zaharieva, M., Rekika, D. (2000): The utilization of Triticum and Aegilops species for theimprovement of durum wheat. CIHEAM-Options Mediterraneennes, pp. 71-81.Mujeeb-Kazi, A., Rajaram, S. (2002): Transferring alien genes from related species and genera for wheatimprovement In: Bread wheat - Improvement and production. FAO Plant Production and Protection SeriesNo. 30.Plamenov, D., Belchev, I., Kiryakova, V., Spetsov, P. (2009): Fungal resistance of Triticum durum - T.monococcum ssp. aegilopoides amphiploid. Journal of Plant Disaeses and Protection 116, 60-62.89

AGRISAFE Budapest, Hungary, 2011CHARACTERIZATION OF TRITICUM TIMOPHEEVII GENE BANKACCESSIONS TO GAIN USEFUL MATERIALS FOR ORGANICWHEAT BREEDINGP. MIKÓ – M. MEGYERI – G. KOVÁCSDepartment of Plant Genetic Resources and Organic Breeding, Agricultural Research Institute of theHungarian Academy of Sciences, Martonvásár, PO Box 19. H-2462; : mikop@mail.mgki.hu Abstract The timopheevii group (Triticum timopheevii Zhuk.) of the genus Triticum consists of tetraploidwheats with the genome formula A t A t GG. The Cereal Gene Bank of the Agricultural Research Institute of theHungarian Academy of Sciences (Martonvásár, Hungary) preserves more than 50 timopheevii accessions,including two subspecies (ssp. timopheevii; ssp. armeniacum) and 8 varietas forms, which have been describedin recent years, in order to select ones that are conducive to the improvement of organic wheat breeding. Theaccessions were examined for morphological traits (e.g. heading date) and for resistance to major biotic andabiotic stresses. The morphological parameters of the accessions may determine their tolerance of abioticstresses (e.g. thick pubescence) and their suitability for cultivation (e.g. plant height, ear type). Severalresistance genes located on G genome chromosomes provide outstanding resistance to fungal diseases (e.g.powdery mildew, leaf rust and stem rust), which can be introgressed into modern bread wheat lines. Theaccessions were examined under organic conditions, where the incidence of stress factors is higher than underconventional agricultural conditions, in order to obtain a clearer picture of the differences between theaccessions. Recent results led to the selection of one of the timopheevii accessions (Triticum timopheevii(Zhuk.) Zhuk. var. rubiginosum – Acc. No.: MVGB845). As timopheevii genotypes are tetraploid forms anddirect hybrids with bread wheat are normally sterile, a further aim was to develop a bridge crossing system fortransferring desirable genes into bread wheat. The main strategy is to create a synthetic hexaploid wheat bycrossing the selected line with a semi-dwarf, pre-bred einkorn line (Triticum monococcum L. ssp. monococcum– 1T-1), which was selected for its high crossability with various Triticum species. As the hybrids of thesecrosses are triploids, colchicines-based genome doubling was carried out in order to obtain fertile hexaploidprogenies. The new synthetic hexaploid has a similar genome composition to that of the naturally occurringspecies Triticum zhukovskyi Men. et Ericz. (A t A t GGA m A m ), making it possible not only to improve breadwheat breeding materials, but also to increase the very limited genetic variability of this natural species.Key words: Triticum timopheevii, characterization, synthetic hexaploid, organic breedingIntroductionThe negative effects of global climate change are expected to be more pronounced inorganic agricultural systems, where the resources needed by the crops are mostlylimited, resulting in greater susceptibility. To prevent the yield losses caused by bioticand abiotic stresses, it is necessary to use sources of resistance genes. Wild speciesrelated to cultivated bread wheat (Triticum aestivum L.) are important sources forimproving resistance to these stresses by increasing the genetic diversity of the wheatbreeding base (Mujeeb-Kazi and Kimber, 1985). One promising wild relative is Triticumtimopheevii Zhuk. (2n=4x=28, A t A t GG), which has good drought tolerance, while someaccessions also have favourable agronomic traits. The grain has good bread-makingquality with high protein content (Zhukovsky, 1971). Furthermore, it has outstandingresistance to fungal diseases such as powdery mildew (Blumeria graminis (DC.) Speer),leaf rust (Puccinia triticina Erikss.), stem rust (Puccinia graminis Pers.) and smut(Ustilago tritici (Pers.) Rostrup) (McIntosh and Gyárfás, 1971; Järve et al., 2002). Strictearly selection is required on the accessions in the gene bank in order to introduce linesof this valuable species into the organic breeding program. Most studies on theutilization of the genes responsible for resistance to the above-mentioned diseases haveinvolved direct crosses between Triticum timopheevii and bread wheat (Peusha et al.,1996; Badaev et al., 1995). However, apart from direct crosses between wild relativesand wheat, new synthetic wheat species have also been developed, such as the Triticum90

Budapest, Hungary, 2011AGRISAFEturgidum x T. monococcum synthetic hexaploid wheat (Mujeeb-Kazi and Rajaram,2002). Following this scheme, other synthetic wheat species could be developed bycrossing Triticum timopheevii with a semi-dwarf line of cultivated einkorn with goodcrossability (Triticum monococcum L. ssp. monococcum, 2n=2x=14, A m A m ), thusobtaining a new breeding stock (A t A t GGA m A m ) which could ease the introgression ofvaluable genes into bread wheat at the hexaploid level (bridge-crossing). According toGoncharov et al. (2009) this new species could be named Triticum timococcum. New,einkorn-derived genes for resistance, quality and phenotype can also be transferred intowheat via crosses with lines of this synthetic species, enhancing the amount of valuablecomponents (tocol, carotenoids) in the grains of the progenies (Brandolini et al., 2008).The aim of the present research was to characterize the timopheevii accessions conservedin the Martonvásár Cereal Gene Bank in order to identify those which can be used in thedevelopment of timopheevii-derived synthetic hexaploid wheat.Materials and methodsOverall 56 accessions of Triticum timopheevii (Zhuk.) Zhuk. are preserved in the CerealGene Bank at Martonvásár. Among these accessions 30 belong to the base species with 5varietas forms (var. timopheevii, var. rubiginosum, var. typicum, var. nigrum and var.viticulosum), 18 accessions to the subspecies armeniacum (also known as T. araraticumJakubz.) with 3 varietas forms (var. araxacum, var. nachitacheromicum and var.tumaniani) and 8 to the ssp. timopheevii group (which also includes 3 T. militinae). Dataon these accessions have been gathered directly from the organic nursery of the genebank in Martonvásár in recent years. As meteorological conditions fluctuate stronglyyear by year, all of the accessions were examined in at least two vegetation periods. Themain phenotypic characters, such as growth habit, growth form, heading date, floweringdate and maximum plant height were studied, together with thousand-kernel weight(TKW) for some accessions. Resistance to frequently occurring wheat diseases, such aspowdery mildew, leaf rust and virus infection, was also classified.The successfulness of the crossing was confirmed cytologically, and the genome(2n=3x=21) of the selected hybrid seedlings was doubled by treatment with 0,04%colchicine solution at the 3-5 tiller growth stage (Barnabás et al., 1991). Theregeneration of treated plantlets is now in progress in phytotron chambers.Results and discussionAlmost 2100 data have been collected in recent years. Data for each trait of eachaccession have been averaged to balance out annual differences. An analysis ofagronomically valuable traits revealed that members of the base species and ssp.timopheevii are likely to be more advantageous for organic wheat breeding than those ofthe ssp. armeniacum group. Although the latter have relatively early heading date, theyare more susceptible to fungal and viral diseases, and have a decumbent growth formwith lower yielding ability (lower TKW), which could make their utilization in wheatbreeding more difficult (Table 1).According to the table only 14% of the accessions are spring type, while more than 40%are facultative, maturing after germination in either spring or autumn, which shows thegenetic heterogeneity of the accessions. The results confirmed that all the fungalpathogens examined were able to harm the timopheevii plants, except leaf rust infectionin the case of three T. timopheevii ssp. armeniacum accessions.91

AGRISAFE Budapest, Hungary, 2011Table 1. Main traits of Triticum timopheevii accession groups in the Martonvásár Cereal Gene BankGroup ofaccessionsHeadingdateFloweringdatePlantheight(cm)Growth formGrowth habitErect Decumbent Winter Spring FacultativeBase species3-16Jun7-23Jun35-14018 1 6 2 11var. nigrum 9 Jun 14 Jun 92 1 0 0 0 1var. rubiginosum 8 Jun 12 Jun 111 1 0 0 0 1var. timopheevii6-8 Jun9-13Jun97-1304 1 4 0 1var. typicum7-22Jun10-28Jun115-1333 0 2 1 0var. viticulosum 10 Jun 14 Jun 110 1 0 0 0 1ssp. timopheevii2-20Jun5-24Jun89-1034 1 3 1 1ssp. timopheevii f.militinae17-26Jun23-30Jun40-45 3 0 1 2 0ssp. armeniacum28 May– 14 Jun2-22Jun45-1154 9 6 2 5ssp. armeniacumvar. araxacum24 May– 1 Jun28 May– 5 Jun82-1180 3 1 0 2ssp. armeniacumvar.nachitacheromicumssp. armeniacumvar. tumaniani2 Jun 7 Jun 108 0 1 1 0 031 May 7 Jun 105 1 0 1 0 0After a detailed evaluation of the results, one accession (T. timopheevii (Zhuk.) Zhuk.var. rubiginosum, Acc. No.: MVGB845) was chosen for crossing with a semi-dwarfeinkorn line (T. mon. L. ssp. mon. – 1T-1), which was selected and pre-bred inMartonvásár for the purpose of improving both the agronomic value of einkorn and itscrossability with other Triticum species. In the summer of 2010 almost 2000 flowerswere pollinated, resulting in 255 hybrid seeds (seed set 13%), which had a germinationrate of 91%. Colchicine treatment was carried out and the plantlets are now being grownunder controlled conditions in climate chambers, and will be self-pollinated. The task offurther research will be to regenerate the F 2 hexaploid seeds and to begin selection workon the lines in order to gain useful material for organic breeders, and to increase the very92

Budapest, Hungary, 2011AGRISAFElimited genetic variability of the naturally occuring species Triticum zhukovskyi Men. etEricz. (A t A t GGA m A m ).ConclusionsAfter characterizing all the Triticum timopheevii accessions it can be concluded that newbreeding material could be developed not only from the accession MVGB845, but fromother promising timopheevii accessions in the gene bank, which could form the basis ofnew programs to develop other Triticum timococcum lines, in order to widen the geneticbasis of organic breeding stocks.AcknowledgementsThis research was financially supported by the National Science and Technology Officeproject (ALKOBEER OM00363) and by the EU Commission FP7 KBBE 245058SOLIBAM project.ReferencesBadaeva, E. D., Badaev, N. S., Enno, T. M., Zeller, F. J., Peusha, H. O. (1995): Chromosome substitution inprogeny of hybrids Triticum aestivum x Triticum timopheevii, resistant to brown rust and powdery mildew.Russian J. Genetics, 31, 75-77.Barnabás, B., Pfahler, P. L., Kovács, G. (1991): Direct effect of colchicine on the microspore embryogenesis toproduce dihaploid plants in wheat (Triticum aestivum L.). Theor. Appl. Genet., 81, 675–678.Brandolini, A., Hidalgo, A., Moscaritolo, S. (2008): Chemical composition and pasting properties of einkorn(Triticum monococcum L. subsp. monococcum) whole meal flour. Journal of Cereal Science, 47, 599–609.Goncharov, N. P., Golovnina, K. A., Kondratenko, E. Y. (2009): Taxonomy and molecular phylogeny ofnatural and artificial species. Breeding Science, 59, 492-498.Järve, K., Jakobson, I., Enno, T. (2002): Tetraploid wheat species Triticum timopheevii and Triticum militinaein common wheat improvement. Acta Agron. Hung., 50, 463-477.McIntosh, R. A., Gyárfás, J. (1971): Triticum timpheevii as a source of resistance to wheat stem rust. Z.Pflanzenzücht, 66, 240-248.Mujeeb-Kazi, A., Kimber, G. (1985): The production, cytology and practicality of wide hybrids in theTriticeae. Cereal Res. Commun., 13, 111-124.Mujeeb-Kazi, A., Rajaram, S. (2002): Transferring alien genes from related species and genera for wheatimprovement. In: Curtis, B. C., Rajaram, S., Gómez Macpherson, H. (eds.), Bread Wheat: Improvementand Production. FAO Plant Production and Protection Series, 30. Rome.Peusha, H. O., Enno, T. M., Priilinn, O. (1996): Genetic analysis of disease resistance in wheat hybrids,derivatives of Triticum timopheevii and Triticum militinae. Acta. Agron. Hung., 44, 237-244.Zhukovsky, P. M. (1971): Cultivated Plants and their Wild Relatives. Systematics, Geography, Cytogenetics,Immunity, Origin and Use. Kolos, Leningrad, 121.93

AGRISAFE Budapest, Hungary, 2011PRODUCTION AND CHARACTERIZATION OF WHEAT-BARLEY INTROGRESSION LINESM. MOLNÁR-LÁNG 1 – É. SZAKÁCS, – K. KRUPPA 1 – G. LINC 1 – A. CSEH 1 –I. MOLNÁR 1 – A. FARKAS 1 – S. DULAI 2 – É. DARKÓ 1 – B. HOFFMANN 31 Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary2 Department of Plant Physiology, Faculty of Sciences, Eszterházy Károly College, Eger, Hungary3Department of Plant Sciences and Biotechnology, Georgikon Faculty, Pannon University, Keszthely,Hungary,Abstract The 2H, 3H, 4H, 6HS, 7H and 1HS isochromosomic Mv9kr1/Igri and the 2H, 3H, 4H, 6H and7H Asakaze komugi/Manas wheat/barley disomic addition lines developed in Martonvásár were identifiedwith sequential GISH, FISH and SSR markers. New wheat/barley translocation lines with of 2H, 3H, 6Hand 7H chromosome segments from barley cv. Manas were selected. The 4H addition lines had the highestand the 7H additions the lowest fertility in both cultivar combinations. The wheat/barley addition,substitution and translocation lines were used to determine how the added barley chromosome (segments)influence various agronomic traits (drought tolerance, salt and Al tolerance) in wheat. The good tilleringability of barley was expressed in the 3HS.3BL translocation line. The 7D-5HS translocation and the4H(4D) substitution lines had the most favourable root/shoot ratio of the 11 lines analysed in Keszthely.Manas had better Al tolerance than the two other barley cultivars Igri and Betzes this was manifested inthe Asakaze komugi/Manas addition lines analysed (4H, 6H, 7H). The 2DS.2DL-1HS translocation lineexhibited higher Al tolerance than the parental wheat line Mv9kr1. The 7H Asakazekomugi/Manasaddition line, like the parental barley cv. Manas, was able to retain its CO 2 fixation rate during salt stresswith relatively high stomatal conductance, suggesting it had better tolerance to salt stress than the wheatgenotypes.Key words: Triticum aestivum × Hordeum vulgare hybrids, wheat/barley addition lines, translocationlines, in situ hybridization, Al toleranceIntroductionWheat (Triticum aestivum L.) and barley (Hordeum vulgare L.) are important cerealsworldwide. The intergeneric hybridization of these species makes it possible to transferagronomically useful genes from barley (drought tolerance, soil salinity tolerance,earliness, nutritional parameters) into wheat. New wheat × barley hybrids have not beenreported recently, as crossability between these species is very low (Shepherd and Islam,1981; Molnár-Láng et al., 2000a). The first wheat/barley hybrid was produced by Kruse(1973) and the production of the first set of Chinese Spring/Betzes wheat/barley additionlines was described by Islam et al. (1978). Since then only Koba et al. (1997) hasreported two new addition lines originating from a hybrid between Japanese wheat andbarley cultivars. Wheat/alien addition lines form the starting point for producingtranslocations from selected chromosomes and are also suitable genetic materials forgenome mapping. As there is great genetic variability between barley cultivars forimportant agronomic traits (two or six-row, winter or spring habit, biotic and abioticresistance, etc.) it is advisable to develop addition lines using different barley genotypesin order to map and transfer favourable agronomic characters from barley.Two sets of wheat/barley addition lines were developed in Martonvásár. Wheat/barleyaddition and translocation lines were identified using genomic and fluorescence in situhybridization (GISH and FISH) and SSR markers. The wheat/barley introgression lineswere used to determine how the added barley chromosome (segments) influence variousagronomic traits (drought tolerance, salt and Al tolerance) in wheat.94

Budapest, Hungary, 2011AGRISAFEMaterials and methodsThe plant material consisted of wheat genotypes: Chinese Spring (CS), Asakaze komugi(A. komugi - Japanese) and Mv9kr1 (Molnár-Láng et al., 2000a), barley genotypes:Betzes (2-row North American spring type), Igri (2-row German winter type) and Manas(6-row Ukrainian winter type) and the progenies of the wheat × barley hybrids (CS ×Betzes, Mv9kr1 × Igri, Asakaze komugi × Manas) (Molnár-Láng et al., 2000a)backcrossed with wheat genotypes Mv9kr1 and CS.Barley genomic DNA was labelled with digoxigenin-11-dUTP by Nick translation andused as a GISH probe. The repetitive DNA sequences HvT01, Afa family, pTa71,pSc119.2 and GAA were multiplied and labelled with digoxigenin-11-dUTP or biotin-16-dUTP using PCR. Detection was carried out with anti-digoxigenin-rhodamine andstreptavidin-FITC. GISH and FISH were carried out on mitotic chromosome spreads asdescribed earlier (Molnár-Láng et al., 2000b, Szakács and Molnár-Láng 2007, 2010).PCR reactions were performed as described by Cseh et al. (2009). Wheat and barleymicrosatellites (SSRs) were used for chromosome identification.The drought test involved 17 genotypes: the 2H, 3H, 4H Mv9kr1/Igri, 4H Asakazekomugi/Manas, 2H A. komugi/Betzes and 6H Mv9kr1/Betzes addition lines, the 4H(4D)Mv9kr1/CS/Betzes substitution line, the 3HS.3BL, 2DS.2DL-1HS, 6BS.6BL-4HLMv9kr1/Betzes and 7DL.7DS-5HS Mv9kr1/Igri translocation lines, and the wheat andbarley parental genotypes. Ten seeds of each genotype were sown under a rain shelter,and under irrigated conditions as a control, in three replications in Martonvásár. Therewere three parallel plots per treatment with randomly placed genotypes. Heading time,plant height, tillering, fertility, thousand grain weight, seeds/main spike and seeds/plantwere evaluated after harvest in three years (2008-2010). The field experiment wascarried out at the UP Georgikon Faculty, Keszthely in two years (2008-2009). The samegenotypes were analysed as in Martonvásár, except for the 2H A. komugi/Betzes and 6HMv9kr1/Betzes addition lines, and the CS, A. komugi and Betzes cultivars. Eachgenotype was sown in a 15-m row, with a row spacing of 25cm. Half of each row wascovered with a plastic rain shelter from April until harvest. Measurements were made onthe root/shoot ratio and on the parameters determined in Martonvásár.The Al tolerance of the 17 lines also tested for drought tolerance in Martonvásár and oftwo control wheat cultivars (cv. Atlas, Scout) and two new Asakazekomugi/Manasaddition lines (6H and 7H) was studied by determining root growth in a solutioncontaining 75 μM AlCl 3 at pH 4.0 and by root regrowth after haematoxilin staining. Theresults were compared to those obtained without AlCl 3 at pH 4.0 and 5.5.The same genotypes were grown in half-strength modified Hoagland nutrient solutionfor 4 weeks in a growth chamber. Salt stress was induced gradually in four-week-oldplants through the addition of sodium chloride (100, 200 and 300mM NaCl L -1 ) to thehydroculture medium. The photosynthetic CO 2 fixation, chlorophyll fluorescencequenching and relative water content (RWC) were measured to compare the salttolerance of the genotypes.Results and discussionWheat/barley addition lines were produced in two cultivar combinations: the 2H, 3H,4H, 6HS, 7H disomic and 1HS isochromosomic Mv9kr1/Igri lines and the 2H, 3H, 4H,6H and 7H Asakaze komugi/Manas disomic addition lines. The presence of the barleychromosome pair in the wheat genome was detected using GISH (Figure 1).95

AGRISAFE Budapest, Hungary, 2011Figure 1. Detection of the 6H barley chromosome pair (red) in a wheat background using GISH. Unlabelledwheat chromosomes are blue.The barley chromosomes were identified using FISH with the help of repetitive DNAprobes. The addition lines were multiplied in the phytotron and in the field. The additionlines were genetically stable except for the 1HS isochromosomic Mv9kr1/Igri and the3H A. komugi/Manas disomic additions. The reason for the instability of the 3H A.komugi/Manas addition is not yet known, and will be further investigated.The 3HS.3BL, 2DS.2DL-1HS, 6BL.6BS-4H, 7DL.7DS-5HS and 4D-5HS wheat/barleytranslocation lines were multiplied in the field. New translocation lines carryingsegments of the 2H, 3H, 6H and 7H Manas chromosomes were selected. The 4BS.7HLtranslocation was mapped with the use of 12 wheat and 33 barley SSR markers.The morphological traits (plant height, spike length, seeds/main spike, fertility, tillering)of the wheat/barley addition and translocation lines multiplied in the phytotron and fieldwere analysed. The 4H addition lines had the highest and the 7H additions the lowestfertility in both cultivar combinations. The good tillering ability of barley was expressedin the 3HS.3BL translocation line, which had significantly more tillers than the parentalMv9kr1 wheat genotype under the rain shelter in both the control and the droughttreatments in Martonvásár.The drought tolerance of 17 lines were studied in the field under rain shelters. Thenumber of plants analysed in Martonvásár was very small, and environmental factors,heavy storms and bird damage had a great influence on the results, so the deviation wasvery large, making it difficult to evaluate the data. The root length and the root/shootratio were evaluated under a rain shelter in Keszthely, as this is an importantcharacteristic for drought tolerance (Hoffmann et al., 2009). The 7D-5HS translocationand the 4H(4D) substitution line had the most favourable root/shoot ratio of the 11 linesanalysed in the first year of the experiments.Manas had better salt and Al tolerance than Betzes or Igri. This was manifested in the A.komugi/Manas addition lines analysed (4H, 6H, 7H). The 2DS.2DL-1HS translocationline exhibited higher Al tolerance than the parental wheat line Mv9 kr1 (Darkó et al.,2010).96

Budapest, Hungary, 2011AGRISAFEThe 7H A. komugi/Manas addition line, like the parental cv. Manas, was able to retainits CO 2 fixation rate during salt stress (up to 200 mmol L -1 NaCl) with relatively highstomatal conductance, suggesting it had better tolerance to salt stress than the wheatgenotypes (Dulai et al., 2010). The 2H, 3H and 4H Mv9kr1/Igri addition lines were verysalt-sensitive.ConclusionsThe wheat/barley introgression lines presented here are valuable genetic materials forstudying the effect of individual barley chromosomes on various morphological andagronomic traits in a wheat background. The wheat/barley translocation lines aregenetically stable, making them useful genetic stocks for the physical mapping of wheatand barley chromosomes and for the determination of the chromosomal location of genesresponsible for various agronomic traits in barley.AcknowledgementsThis work was supported by the Hungarian National Scientific Research Fund (OTKA K75 381), the Generation Challenge Programme (CGIAR GCP SP3, G4007.23) and theAgrisafe Programme (EU-FP7-REGPOT-2007-1, grant agreement No: 203288). Theauthors gratefully acknowledge the technical assistance of Mrs J. Bucsi.ReferencesCseh, A., Kruppa, K., Molnár, I. (2009): Incorporation of a winter barley chromosome segment into cultivatedwheat and its characterization with GISH, FISH and SSR markers. Cereal Res. Commun., 37, 321-324.Darkó, É., Barnabás, B. Molnár-Láng, M. (2010): Aluminium tolerance in wheat/barley introgression lines andin their parental genotypes. pp. 359. Society for Experimental Biology. Annual Main Meeting, Abstracts,30th June-3rd July, 2010, Prague, Czech Republic.Dulai, S., Molnár, I., Haló, B. Molnár-Láng, M. (2010): Photosynthesis in the 7H Asakaze komugi/Manaswheat/barley addition line during salt stress. Acta Agron. Hung., 58, 367-376.Hoffmann, B., Aranyi, N., Hoffmann, S., Molnár-Láng, M. (2009): Possibilities to increase stress tolerance ofwheat. Cereal Res. Comm., 37(Suppl.), 93-96.Islam, A. K. M. R., Shepherd, K. W., Sparrow, D. H. B. (1978): Production and characterization of wheatbarleyaddition lines. pp. 356-371. In: Ramanujam, S. (ed.), Proceedings of the 5th International WheatGenetics Symposium, New Delhi, India.Kruse, A. (1973): Hordeum × Triticum hybrids. Hereditas, 73, 157–161.Koba, T., Takumi, S., Shimada, T. (1997): Isolation, identification and characterization of disomic andtranslocated barley chromosome addition lines of common wheat. Euphytica, 96, 289-296.Molnár-Láng, M., Linc, G., Logojan, A., Sutka, J. (2000a): Production and meiotic pairing behaviour of newhybrids of winter wheat (Triticum aestivum) × winter barley (Hordeum vulgare). Genome, 43, 1045-1054.Molnár-Láng, M., Linc, G., Friebe, B. R., Sutka, J. (2000b): Detection of wheat-barley translocations bygenomic in situ hybridization in derivatives of hybrids multiplied in vitro. Euphytica, 112, 117-123.Shepherd, K. W., Islam, A. K. M. R. (1981): Wheat: barley hybrids - the first eighty years. pp. 107-128. In:Evans, L. T., Peacock, W. J. (eds.), Wheat Science - Today and Tomorrow. Cambridge University Press,Cambridge.Szakács, É., Molnár-Láng, M. (2007): Development and molecular cytogenetic identification of new winterwheat/winter barley (Martonvásári 9 kr1/Igri) disomic addition lines. Genome, 50, 43-50.Szakács, É., Molnár-Láng, M. (2010): Identification of new winter wheat – winter barley addition lines (6HSand 7H) using fluorescence in situ hybridization and stability of the whole ‘Martonvásári 9 kr1’-‘Igri’addition set. Genome, 53, 35-44.97

AGRISAFE Budapest, Hungary, 2011GRAIN YIELD AND QUALITY TRAITS OF LOCAL OATGENOTYPESZ. MUT 1 – A. GÜLÜMSER 1 – İ. SEZER 2 – H. AKAY 2 – F. ÖNER 2 – Ö.D. ERBAŞ 11 Department of Field Crops, Faculty of Agriculture, Bozok University, Yozgat, Turkey zeki.mut@bozok.edu.tr2 Department of Field Crops, Faculty of Agriculture, Ondokuz Mayıs University, Samsun, TurkeyAbstract Oats (Avena sativa L.), believed to be of Anatolian origin and cultivated in the time of Christ, hasbeen a very important plant for animal feeding both as grain and green fodder since the first century A.D.Nowadays, oats is still important as a cereal and green fodder, while grain oats have also become important ashuman food and industrial material. The Black Sea Region of Turkey is an important area with rich plantdiversity, because of its traditional use for agriculture and its geographical and ecological diversity. In thisresearch, 251 local oat genotypes were collected in 2008, both from farmer stores and farmers’ fields from theBlack Sea Region of Turkey. These genotypes were tested for grain yield and quality traits in the 2008-09 and2009-2010 growing seasons in Samsun, Turkey. Based on the overall average of the two-year results, the plantheight, grain yield, thousand-kernel weight, screenings percentage>2mm, groat percentage and kernel proteincontent ranged from 89.30-141.10 cm, 1.46-5.72 t ha -1 , 18.50-38.40 g, 69.80-95.80 %, 56.30-75.70 % and8.80-14.80 %, respectively. The results confirmed that local genotypes exhibited considerable differences forgrain yield and some quality traits.Key words: oat, landraces, grain yield, qualityIntroductionTurkey is the centre of origin and/or diversity of many crop species (Davis, 1985; Tan,1998; Özgen et al., 2000). Due to the climate and geographic location, Turkey is also thecenter of origin and genetic diversity of many wild, transitional, and cultivated forms ofannual and perennial plants such as the cultivated species of Allium, Amygdalus, Avena,Beta, Cicer, Hordeum, Lens, Linum, Pisum, Prunus, Secala, Triticum, and Vitis (Tan,1998). Cause of loss of genetic diversity and the stagnation of yields in cereals in lessfavourable areas is agricultural modernisation, conventional breeding and excessiveinput use (Newton et al., 2010). In Turkey, new wheat varieties were primarily adopteddue to higher yields in dryland (Bardsley and Thomas, 2005). Modern crop varietieswere readily adopted by wealthy farmers, who had the capital, education, land and otherinputs to more fully exploit their potential. Many farmers with smaller holdings alsogained access to modern crop varieties and local landraces were lost as the agriculturalsystems altered (Tan, 1998). Oat (Avena sativa L.) is cultivated as an annual crop inseveral regions of the world. Oat is generally grown for both grain and forage forlivestock feed in Turkey. It is used for human food as well as in recent years.Agronomic traits, grain physical traits, and grain composition traits are important for thegrower, miller, and/or consumer (Peterson et al., 2005). Oat is usually grown by farmerswith very small areas to supply their own feed for their limited number of cattle in BlackSea Region where have small field area, traditional agriculture concept, geographicaland ecological diversity. In the region, local oat varieties are generally grown for manyyears by farmers who produced their seed. Poor farmers, however, have been forced tomigrate to the city from the village because of their low social and economic status inrecent years. So, local oat varieties have been lost. The local agricultural geneticmaterial has enormous conservation value, both for the maintenance of the culturalheritage and to assist in crop breeding programs (Ceccarelli, 1994; Bardsley andThomas, 2005). A large number of modern oat cultivars have been derived fromindividual selections from landraces or crosses involving these selections (Katsiotis etal., 2006). In the present study, grain yield and some quality traits of local oat varieties98

Budapest, Hungary, 2011AGRISAFEcollected from the West and Middle Black Sea Region of Turkey were determined. Thisinformation could assist in breeding programs.Materials and methodsA total of 251 oat local oat varieties were used for the present study. Seeds werecollected from farmers’ fields, village threshing grounds and farmer stores of Düzce,Bolu, Zonguldak, Karabük, Kastamonu, Ordu, Sinop, Samsun, Amasya and Tokatprovinces, located in West and Middle Black Sea Region of Turkey, in the period ofMarch-September 2008. Collection sites were selected from village, where landraces hadstill not been replaced by modern cultivars. Field experiments were carried out in rainfedconditions for two winter cropping years (2008-09 and 2009-2010) in the farm of theOndokuz Mayıs University in Samsun, in the Middle Black Sea Region of Turkey (41º21'N, 36 º 15' E, elevation: 195 m). The experiment was established in a clay soil withpH 7.15, organic matter content 2.70%, available P content 22.30 ppm and K 300 ppm(0-30 cm depth). During the growing seasons (October-June), average annualtemperature and total rainfall were 12.3 °C and 522.9 mm, 12.9 °C and 613.5 mm, 11.3°C and 469.2 mm in 2008-09, 2009-2010, long term mean, respectively. The 251landraces were planted in 4.8 m 2 (0.8 by 6.9 m) plots, consisting of 4 row with 20 cmrow spacing, in Augmented Design with four check cultivars on November 18, 2008 andNovember 5, 2009. Plots were fertilized with 40 kg of N ha -1 and 60 kg of P 2 O 5 duringsowing, and 40 kg of N ha -1 was applied at the beginning of the stem elongation stage.Harvest in both years was done in the second half of June. The following characteristicswere evaluated in these trials: Plant height (cm) was measured in cm from soil surface totip of the panicle. Grain yield (t ha -1 ) was determined on the basis of the harvested plotand corrected to a 120 g kg -1 moisture basis. Thousand-kernel weight (g) was calculatedfrom the weight of four sets of 100 kernels plot -1 counting by hand. Screeningspercentage (%) weight percentage of grains larger 2 mm was measured by sieving 100 gof grains on a Sortimat laboratory machine. Groat percentage (%) was determined for thehulled oat genotypes by dehulling 50 g oat seed using a dehuller. Kernel protein content(%) was determined by the Kjeldahl method using a 6.25 factor. Data were subjected tostatistical analysis for augmented design (Federer, 1956) and the adjusted treatment(accession) means were computed after adjusting them for block effects. These treatmentmeans were standardised to mean 0 and standard deviation 1 for further analysis.Statistical analyses were carried out using IRRISTAT statistical package programmedeveloped by International Rice Research Institute.Results and discussionProgress of agronomic characteristics has been the main objective of oat breeders formany years. Breeders have also measured and selected for certain grain physical traitssuch as test weight, kernel weight, and groat percentage (Peterson et al., 2005).Average plant height of the local oat varieties was measured as 115.86 cm. The bigdifference between the lowest and the highest plant height (89.30 cm and 141.10 cm,respectively) indicates that large variation exists among the landraces (Table 1, Fig. 1).Thirty-eight of all tested local varieties showed lodging (data no show). Vilaro et al.(2004) reported that mean plant height of 47 old oat varieties was changed between105.20 cm to 143.30 cm. Similarly, Buerstmayr et al. (2007) indicated that average plantheight of 120 oat genotypes of worldwide origin under different environment ranged99

AGRISAFE Budapest, Hungary, 2011from 80.4 cm to 140.4 cm. They also showed that the majority of the top yielding 50varieties were in the range of 100-120 cm.Table 1. Mean, CV, and range for plant height, grain yield, and some quality traitsTraits N Mean Minimum Maximum CV (%)Plant height (cm) 251 115.86 89.30 141.10 8.44Grain yield (t ha -1 ) 251 3.22 1.46 5.72 23.80Thousand-kernel weight (g) 251 27.93 18.50 38.40 10.12Screenings percentage>2 mm (%) 251 86.77 69.80 95.80 4.85Groat percentage (%) 251 68.09 56.30 75.70 5.09Protein content (%) 251 11.54 8.80 14.80 10.743040253020Frequency152830 302926Mean = 115.8598Std. Dev. = 9.78596N = 251Frequency2034Mean = 3.2161Std. Dev. = 0.76557N = 251105080.00224127100.00111917120.00Plant height (cm)140.00160.00Figure 1. General distribution of plant height of oatlandraces17481221001.002472.0091320163.00272418Figure 2. General distribution of grain yield of oatlandraces15234.00Grain yield (t ha-1)121136505.001016.0050504040Frequency3020424435Mean = 27.9378Std. Dev. = 2.82712N = 251Frequency3020Mean = 86.7701Std. Dev. = 4.21037N = 2513740472631291015151014211718015.0010020.00357925.0030.00Thousand-kernel weight (g)Figure 3. General distribution of thousand-kernelweight of oat landraces355235.0011140.00069.002072.002175.002378.005681.00Figure 4. General distribution of screeningspercentage of oat landraces84.00Screenings percentage (%)87.0090.0093.006196.00Mean grain yield was equal to 3.22 t ha -1 , with a % CV of 23.80 and range of 1.46-5.72 tha -1 (Table 1, Figure 2). Dotlacil et al. (2000) considered a minimum 10% CV a sign ofwide diversity in wheat landraces and obsolete varieties. Observed variation in grainyield might, therefore be sufficient for an effective selection (Table 1, Figures 2). It isthe notion among the breeders that the high level of genetic diversity in a gene poolcontributes to variation. Thousand-kernel weight, which is one of the important qualitycharacters, was figured out as 27.93, ranging from 18.50 and 38.40 g (Table 1, Figure 3).These results are consistent with those of Vilaro et al. (2004) who reported thatthousand-kernel weight ranged from 24.15 to 40.90 g in old varieties, 26.45 to 47.11 g inmodern varieties. Similar results were reported by Wildeman (2004) and Buerstmayr etal. (2007). Average screenings percentage was determined as 86.77%, ranging from100

Budapest, Hungary, 2011AGRISAFE69.80 and 95.80% (Table 1, Figure 4). Mean groat percentage, which is the mainindicator of milling yield, was equal to 68.09%, with a % CV of 5.09 and range of 56.30-75.70% (Table 1). A high groat percentage improves both milling yield and energydensity for livestock. Peterson et al. (2005) found a highly significant and positivecorrelation between groat percentage and test weight in oat genotypes. On the otherhand, they reported that groat percentage was negatively correlated with groat oilcontent. Groat protein and oil content are major quality traits in oat (Avena sativa L.)(Zhu et al., 2004). Mean protein content was determined as 11.54%. The big differencebetween the lowest and the highest protein content (8.80% and 14.80%, respectively)indicates that large variation exists among the landraces (Table 1).ConclusionsA large variation was observed among the landraces. Based on the results of this study,we recommended that landraces of collected from Black Sea Region are the mostsuitable material for oat breeders. Additionally, the level of genetic diversity of the localoat varieties should be assessed to aid in the selection and more efficient utilization ofthis germplasm in breeding programs.AcknowledgementsThis paper was financially supported by the TUBITAK (The Scientific and TechnologicalResearch Council of Turkey).ReferencesBardsley, D., Thomas, I. (2005): Valuing local wheat landraces for agrobiodiversity conservation in Northeast Turkey.Agriculture, Ecosystems and Environment, 106, 407–412.Buerstmayr, H., Krenn, N., Stephan, U., Grausgruber, H., Zechner, E. (2007): Agronomic performance and quality of oat(Avena sativa L.) genotypes of worldwide origin produced under Central European growing conditions. Field CropsResearch, 101, 343–351.Ceccarelli, S. (1994): Specific adaptation and breeding for marginal conditions. Euphytica, 77, 205–219.Dawis, P. M. (1985): Flora of Turkey and the East Aegean Islands. Edinburgh University Press, Edinburgh, UK.Dotlacil, L., Hermuth J., Stehno, Z., Manev, M. (2000): Diversity in European winter wheat landraces and obsolete cultivars.Czech. J. Genet. Plant Breed., 16, 29–36.Federer, W. T. (1956): Augmented (or Hoonuoaku) designs. The Hawaiian planter’s record. Vol. IV, 2nd Edition, 191-208.Katsiotis, A., Germeier, C. U., Koenig, J., Legget, M., Bondo, L., Frese, L., Bladenopoulos, K., Ottoson, F., Mavromatis, A.,Veteläinen, M., Menexes, G., Drossou, A. (2006): Screening a European Avena landrace collection using morphologicaland molecular markers for quality and resistance breeding . EUCARPIA, Cereal science and technology for feeding tenbillion people: genomics era and beyond. Lleida (Spain).13-17, November.Newton, A.C., Akar, T., Baresel, J.P., Bebeli, P.J., Bettencourt, E., Bladenopoulos, K.V., Czembor, J.H., Fasoula, D.A.,Katsiotis, A., Koutis, K., Koutsika-Sotiriou, M., Kovacs, G., Larsson, H., Pinheiro de Carvalho, M.A.A., Rubiales, D.,Russell, J., Dos Santos, T.M.M., Vaz Patto, M.C. (2010): Cereal Landraces for sustainable agriculture. A review. Agron.Sustain. Dev. 30, 237–269.Özgen, M., Adak, M. S., Söylemezoğlu., Ulukan, G. H. (2000): New Approaches of the Plant Germplasm ResourcesConservation and Usage, Turkish Agricultural Engineering Chamber 5th Technical Congress, 17-21 January, 259-284,Ankara, Turkey.Peterson, D. M., Wesenberg, D. M., Burrup, D. E., Erickson, C. A. (2005): Relationships among agronomic traits and graincomposition in oat genotypes grown in different environments. Crop Sci., 45, 1249–1255.Tan, A. (1998): Current status of plant genetic resources conservation in Turkey. In: Zencirci, N., Kaya, Z., Anikster, Y.,Adams, W.T. (Eds.). Proceedings of the International Symposium on In situ Conservation of Plant Genetic Diversity,CRIFC, Ankara, 5–16.Vilaro, M., Rebuffo, M., Miranda, C., Pritsch, C., Abadie, T. (2004). Characterization and analysis of a collection of Avenasativa L. from Uruguay.Plant Genet. Resour. Newslett., 140, 23-31.Wildeman, J. C. (2004): The effect of oat (Avena sativa L.) genotype and plant population on wild oat (Avena fatua L.)competition. Master's thesis. University of Saskatchewan, Saskatoon, SK, Canada. 103 p.Zhu, S., Rossnagel, B. G., Kaeppler, H. F. (2007): Genetic analysis of quantitative trait loci for groat protein and oil content inoat. Crop Sci., 44, 254–260.101

AGRISAFE Budapest, Hungary, 2011LONG-TERM SEED STORABILITY IN GENEBANKCOLLECTIONS – GENETIC STUDIES IN WHEATM. A. REHMAN-ARIF – M. NAGEL – U. LOHWASSER– A. BÖRNERLeibniz Institute für Pflanzengenetik und Kulturpflanzenforshung, Gatersleben, Germany,E-mail: Boerner@ipk-gatersleben.deAbstract The realization of the danger of extinction of plant genetic resources led to the establishment ofmodern gene banks around the world. Gene banks are entrusted with the task of storing, preserving anddistributing the invaluable crop germplasm for future breeding. Seed banks are interested in enhancing seed lifewithout altering its initial genetic makeup. Therefore, it becomes essential to study the mechanism of seedlongevity from both the genetic and the physiological point of view. Very little is known about the geneticbasis of differences in seed quality, because this trait is strongly affected by environmental factors during seedformation, harvest and storage. Using the quantitative trait locus (QTL) mapping approach, numerous loci weredetected, indicating the complex and quantitative nature of seed longevity in wheat. Some of the loci identifiedare in genomic regions which co-localize with genes determining agronomic traits such as spike architecture orbiotic and abiotic stress responses. The results obtained offer prospects for the identification of favorablealleles and the prediction of seed longevity in cereal germplasm collections.Key words: dormancy, gene banks, QTL mapping, seed longevity, Triticum aestivum L.IntroductionAt the heart of agriculture is human innovation; at the heart of this innovation is the vastdiversity of crops that have been developed by farmers for millennia, and more recentlyby scientists as well. Today, much of this diversity is contained in plant collectionswhich are stored, nurtured, and distributed by the world’s crop genebanks. The seeds andother plant material held in these sanctuaries provide the raw material for breeding cropvarieties capable of meeting environmental challenges and demands for increased yield,improved quality, and greater diversity in the human diet (Anonymous, 2001).The factors that influence the life span of seeds include internal factors of the seed,relative humidity and temperature during seed development and in storage, seedmoisture, genetics, and presence of microflora on or inside the seed, mechanical damageand the seed maturity (Copeland and McDonald, 1995).Very little is known about the genetic basis of difference in seed quality because thistrait is strongly affected by environmental factors, during seed formation, harvest andstorage. This can be illustrated by genetically identical seed lots in which individualseeds, even when grown under identical conditions or even when coming from the sameplant, may lose their viability at different intervals after harvest (Clerkx et al., 2004).Here we report the analysis of a bi-parental (ITMI-International Triticeae MappingInitiative) mapping population in order to determine genetic components of seedlongevity in bread wheat (Triticum aestivum L.). Dormancy test was also performed toinvestigate the genetic relationship between longevity and dormancy.Materials and methodsPlant materialsThe ITMI mapping population was created by crossing the spring wheat variety ‘Opata85’ with the synthetic hexaploid wheat ‘W7984’ (Börner et al., 2002) was used in thepresent study. Seeds from 86 and 99 recombinant inbred lines (RILs) of ITMI populationfrom the 2003 and 2009 harvests were available to perform various longevity tests.102

Budapest, Hungary, 2011AGRISAFEArtificial ageing (AA) and controlled deterioration (CD) testsFor AA test, totals of 200 seeds each from ITMI 2003 and 2009 regenerated RILs wereplaced in stainless metal cages in glass jars containing 200 ml deionised water. The glassjars were placed in a climatic chamber. The conditions for artificial ageing were 43 ±0.5°C for 72 h.CD was performed for 200 grains from ITMI 2009 RILs. The initial moisture content ofseeds was measured following the ISTA protocols (ISTA, 2008) and was then increasedto 18% by the addition of deionised water (Hampton and Tekrony, 1995).After a 2 h period of equilibration and a 22 h period of relaxation at 7°C the seeds weresealed in aluminium bags and aged at 43± 0.5°C for 72 h.Germination testFor both controls and artificial ageing treatments four replicates of 50 seeds each wereanalysed performing ISTA standard germination test (ISTA, 2008).Dormancy testSixty seeds per line from 2009 regeneration, directly harvested, were germinated undertwo different temperature conditions: at 20°C for 7 d and at 10°C for 14 d under a lightregime of 12 h light/12 h dark. The percentage of dormant seeds at 10°C and at 20°Cwas calculated. Dormancy index (DI) (Strand, 1965) was also calculated in the followingway:DI = [2(% dormant seed at 10°C) + % dormant seed at 20°C]/3.QTL mappingQTL mapping for seed longevity and dormancy was performed through QGENEsoftware (Nelson, 1997). Single marker and simple interval mapping options were used.Results and discussionLongevity QTLs for ITMI2003Applying AA method, a significant QTL was associated with marker Xcdo1281onchromosome 2A explaining 20.1 % of the phenotypic variation (Fig. 1). This marker isin close proximity of QTL for grain weight identified by Börner et al. (2002). It may bepostulated that seeds with more weight were better and showed more stability after AA.Two other QTLs were also detected on chromosomes 1D and 2D.Longevity QTLs for ITMI2009AA-test identified three minor QTLs for longevity on chromosomes 1D, 3B and 7A withLOD score of 1.84, 2.33 and 2.21, respectively. The markers closely associated withthese QTLs were Xbcd1930a on chromosome 1D; Xgwm376 on chromosome 3B andXbcd1066 in the centromere region of chromosome 7A. CD-test revealed four minorQTLs on chromosomes 1A, 1D, 3D and 6B. The LOD values for these QTLs werevariable and ranged from 2.06 (6B) to 2.89 (1A) (Fig. 1). Chromosome 1A of wheat isknown to harbour genes for resistance against diseases such as powdery mildew andFusarium head blight (Guo et al., 2006; Xue et al., 2006). It may be postulated that sincethe plants that were carrying resistant alleles might have escaped the disease andproduced healthy seeds that maintained their better germinability when subjected to AAor CD tests. The numerous genomic regions contributing in small proportions tolongevity detected here indicate the quantitative nature of seed longevity.103

AGRISAFE Budapest, Hungary, 2011Dormancy QTLs for ITMI2009One major QTL for dormancy was found on chromosome 4AL for 2009 seeds and themarker closely associated with it was Xksug12b. Lohwasser et al. (2005) found a majorQTL for pre-harvest sprouting in the same region using the 2003 seed lots of ITMIpopulation. Since we did not find the QTLs for longevity and dormancy in samepositions, it can be concluded that these phenomena are independently controlled.ConclusionWe are in the beginning of our knowledge regarding genetics of seed longevity in cerealsand particularly in wheat as a plethora of physiological and metabolic adjustmentsoccurring during seed storage over extended periods of time. The identification offavorable alleles will offer perspectives for the prediction of seed longevity ingermplasm collections.Figure1. Longevity and dormancy QTLs for ITMI 2003 and 2009. Arrows on the left side indicate the locationof the associated marker on the chromosome whereas marker name, LOD and R² values are given on the rightside.104

Budapest, Hungary, 2011AGRISAFEAcknowledgementsThis study was a part of the Ph.D program under the framework of the graduate programat the Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) and wasfinanced by Higher Education Commission (HEC), Pakistan in cooperation with GermanAcademic Exchange Service (DAAD), Germany.ReferencesAnonymous (2001): Crop diversity at risk. The case for sustaining crop collections. Imperial college ofscience. Technology and medicine, UK.Börner, A., Schumann. E., Fürste, A., Cöster, H., Leithold, B., Röder, M. S., Weber, W. E. (2002): Mapping ofquantitative trait loci determining agronomic important characters in hexaploid wheat (Triticum aestivumL.). Theor. Appl. Genet., 105, 921–936.Copeland, L. O., McDonald, M. B. (1995): Seed science and technology (3 rd eds.). Chapman and Hall. pp 181–220.Clerkx, E. J. M., El-Lithy, M. E., Vierling, E., Ruys G. J., Vries H. B., Groot, S. P. C., Vreugdenhil, D.,Koornneef, M. (2004): Analysis of natural allelic variation of Arabidopsis seed germination and seedlongevity traits between the accessions Landsberg erecta and Shakdara, using a new recombinant inbredline population. Plant Physiol., 135, 432–443.Guo, P.G., Bai, G. H., Li, R. H., Shaner, G., Baum, M. (2006): Resistance gene analogs associated withFusarium head blight resistance in wheat. Euphytica, 15I, 251–261.Hampton, J. G., TeKrony, D. M. (1995): Handbook of vigour test methods. International Seed TestingAssociation. Zürich. pp 117.ISTA (2008): International rules for seed testing. International Seed Testing Association. Bassersdorf.Lohwasser, U., Röder, M. S., Börner, A. (2005): QTL mapping of the domestication traits pre-harvestsprouting and dormancy in wheat (Triticum aestivum L.). Euphytica, 147, 247–249.Nelson, J. C. (1997): QGENE: Software for marker-based genomic analysis and breeding. Mol. Breed., 3,239–245.Strand, E. (1965): Studies on seed dormancy in barley. Meldinger fra Norges Landbrukshogskole Hoegskole.,44, 1–23.Xu, X. Y., Bai, G. H., Carver, B. F., Shaner, G. E., Hunger, R.M. (2006): Molecular characterization of apowdery mildew resistance gene in wheat cultivar Suwon 92. Phytopath., 96, 496–500.Yu, J., Pressoir, G., Briggs, W. H., Bi I. V., Yamasaki, M., Doebley, J. F., McMullen, M. D., Gaut, B. S.,Nielsen, D. M., Holland, J.B., Kresovich, S., Buckler, E. S. (2006): A unified mixed model for associationmapping that accounts for multiple levels of relatedness. Nat. Genet., 38, 203–208.105

AGRISAFE Budapest, Hungary, 2011STABILITY OF NEW WHEAT AE. BIUNCIALIS ADDITION LINESAND THE SELECTION OF AE. BIUNCIALIS LENGTHPOLYMORPHIC WHEAT SSR MARKERSA. SCHNEIDER – M. MOLNÁR-LÁNGAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, HungaryAbstract The aim of the study was to screen progeny of the BC 2 and BC 3 generations of wheat × Ae. biuncialishybrids to select Aegilops biuncialis chromosomes, differing from the 2M b , 3M b , 7M b , 3U b and 5U bchromosomes found in the wheatAe. biuncialis addition lines produced earlier in Martonvásár and to developU and M genome specific molecular markers. In the course of the experiments 72 wheat SSR markers weretested on wheat line Mv9kr1 and on Ae. biuncialis MvGB642. Forty-eight markers were polymorphic and 24were non-polymorphic between wheat and Ae. biuncialis. In order to determine the chromosomal location ofthese polymorphic markers, a further aim is to test them on wheat–Ae. biuncialis addition lines. Thedevelopment of new wheatAe. biuncialis addition lines is also in progress. The 2U b disomic addition line ismostly stable, as 70% of the progenies contain this chromosome pair. Unfortunately the 6M b disomic additionline proved to be dwarf and sterile. Progenies analysed from the 6U b monosomic addition line did not carry the6U b chromosome. One plant containing the 5M b , 6M b and 7M b chromosomes, and one plant carrying 5U b , 3U band 7U b chromosomes showed very low fertility, both plants produced only 1 seed. Progenies of a plantcarrying the 7U b chromosome pair have not yet been analysed.Key words: Aegilops biuncialis, wheat SSR markers, fluorescence in situ hybridisation, addition linesIntroductionAegilops (goatgrass) species, wich are closely related to cultivated wheat represent alarge reservoir of agronomically useful traits (salt and drought tolerance, diseaseresistance) and also have great adaptibilty to different climate conditions, beingwidespread from Mediterranean climates to the western part of Asia and West China.One aim of hybridisation with alien species is the incorporation of resistance genes intothe gene pool of cultivated wheat. Alien genes can be transferred into cultivated wheatby developing addition or substitution lines or by inducing intergenomic translocations.A number of useful genes from various Aegilops species have already been introducedinto the common wheat background. However, the successful production of geneticmaterial requires a comprehensive understanding of the genetic structure of the speciesbeing used. High genetic variability within the Aegilops species causes polymorphism inthe fluorescence in situ hybridisation (FISH) patterns of the individual chromosomes.Aegilops biuncialis (2n=4x=28, U b U b M b M b ) shows great genetic diversity, whichcomplicates the exact detection of individual Ae. biuncialis chromosomes in the wheatbackground using FISH (Molnár et al. 2011). Due to the high level of FISHpolymorphism, it is necessary to confirm the identification of the Ae. biuncialischromosomes with the help of SSR markers. Although SSR markers are extensivelyapplied, only a small number of microsatellite markers specific to the U and M genomesof Aegilops species have been described (Schneider et al., 2010 a). Therefore the aim ofthe present work was to select further U and M genome-specific SSR markers. Thedevelopment of a whole set of wheat–Ae. biuncialis addition lines would be useful forthe chromosomal location of U and M genome-specific wheat SSR markers. The 2M b ,3M b , 7M b , 3U b and 5U b wheat–Ae. biuncialis addition lines developed so far inMartonvásár (Molnár-Láng et al., 2002; Schneider et al., 2005) do not provide fullinformation about the localisation of the selected wheat SSR markers on the U and Mgenome chromosomes. So the aim of the experiments was to produce new wheatAe.106

Budapest, Hungary, 2011AGRISAFEbiuncialis addition lines, promoting the further selection of U and M genome-specificSSR markers.Materials and methodsThe plant material consisted of progenies of the BC 2 and BC 3 generations of the wheat(Triticum aestivum cv. Mv9kr1) × Ae. biuncialis hybrid, wheat line cv. Mv9kr1, and Ae.biuncialis MvGB642.FISH was carried out according to Szakács and Molnár-Láng (2010) and Molnár-Láng etal. (2010). The repetitive DNA probes used for FISH were: pSc119.2 (Bedbrook et al.,1980), AFA-family (Nagaki et al., 1995) and pTa71 (Gerlach and Bedbrook, 1979).A total of 72 wheat SSR markers were analysed on wheat line Mv9kr1 and on Ae.biuncialis MvGB642. The PCR reaction was carried out in an Eppendorf Mastercycler(Eppendorf-Netheler-Hinc Inc.) according to Schneider et al. (2010 a, b). Agarose gelelectrophoresis was carried out using 2% agarose gels.Results and discussionDuring the experiments several new wheatAe. biuncialis addition lines were developed(Fig. 1 a). The present results showed that the 2U b wheatAe. biuncialis disomic additionline is mostly stable, as 70% of the progenies carry this chromosome pair. The 6M bdisomic addition line was dwarf and all the spikes were sterile. Progenies analysed fromthe 6U b monosomic addition line did not contain the 6U b chromosome. Progenies of theplant carrying the 7U b chromosome pair have not yet been analysed. One plantcontaining the 5M b , 6M b and 7M b chromosomes, and one plant carrying 5U b , 3U b and7U b chromosomes showed very low fertility, both plants produced only 1 seed. TheFISH patterns of the Ae. biuncialis chromosomes in these wheatAe. biuncialis lines,obtained the pSc119.2 AFA family and pTa71 repetitive DNA probes, are visible inFigure 1 a. The FISH pattern of the 7U b chromosome in the 7U b wheatAe. biuncialisaddition line was different from that in the plant containing the 5U b , 3U b and 7U bchromosomes, even though the parental accession of both was Ae. biuncialis MvGB642(Fig. 1 a). Further selection on the BC 2 and BC 3 generations of the wheat×Ae. biuncialishybrids is now in progress.In the course of the experiments 72 wheat SSR primers were tested on wheat lineMv9kr1 and on Ae. biuncialis (Schneider et al., 2010 a). Forty-eight of these werepolymorphic and 24 monomorphic on Ae. biuncialis MvGB642 compared to wheat lineMv9kr1 (Fig. 1 b, c). The banding patterns obtained on Mv9kr1 and Ae. biuncialis usingwheat SSR markers GWM664, GWM164, GWM271, GWM595, GWM601, GWM608,GWM328, GWM341, GWM349, GWM356, GWM358 and GWM397 can be seen inFigure 1 b and c. To analyse the chromosomal locations of the markers that gavepolymorphic PCR products on Ae. biuncialis it is necessary to test these markers onwheatAe. biuncialis addition lines.Experiments by Schneider et al. (2005) and Molnár et al. (2011) showed that variousaccessions of Ae. biuncialis represent a large reservoir of FISH polymorphism. The greatvariability of the FISH patterns complicates the exact identification of individual Ae.biuncialis chromosomes, and the results of SSR analysis on individual Ae. biuncialisgene bank accessions also differ (Schneider et al., 2010 a). FISH is a reliable andpowerful technique for chromosome identification, but it is very time-consuming. SSRmarkers have several advantages over FISH: they are faster, easy to handle, capable of107

AGRISAFE Budapest, Hungary, 2011screening plants on a large scale and able to detect small-sized translocation segments.However, it may be advisable to combine FISH with molecular markers to allow theexact detection and identification of the highly variable U and M genome chromosomesand chromosome segments in wheat.Figure 1 a: From left to right, fluorescence in situ hybridisation (FISH) patterns of the Ae. biuncialischromosomes in the wheat–Ae. biuncialis disomic addition lines 2U b , 6M b and 7U b , in the plant containingchromosomes 5M b , 6M b and 7M b and in the plant carrying chromosomes 5U b , 3U b and 7U b , obtained using therepetitive DNA probes pSc119.2 and AFA family (plus pTa71 for the 6M b addition line and the plant carryingchromosomes 5U b , 3U b and 7U b ). Differences in the FISH patterns of the 7U b chromosomes are labelled witharrows.Figure 1 b, c: Band patterns obtained for the wheat SSR markers GWM664, GWM164, GWM271, GWM595,GWM601, GWM608, GWM328, GWM341, GWM349, GWM356, GWM358 and GWM397 on wheat lineMv9kr1 and Ae. biuncialis MvGB642 (biu642). The most important polymorphic PCR products on Ae.biuncialis are labelled with arrows.ConclusionsPre-breeding is a promising alternative to conserve the genetic variability of wild speciesfor the future. The present results demonstrate that the selection and stabilisation ofwheatAe. biuncialis addition lines is a time-consuming procedure. SSR markersspecific to the U and M genomes of Aegilops species could be used as chromosome108

Budapest, Hungary, 2011AGRISAFElandmarks in the future to facilitate the selection of chromosome segments bearingagronomically useful traits during the pre-breeding process.AcknowledgementsThis work was supported by the Hungarian National Research Fund (PD75450) and bythe János Bolyai Research Scholarship of the Hungarian Academy of Sciences. Thetechnical assistance of Mrs. J. Bucsi, Mrs. E. Türkösi and Mrs. I. Keserű is gratefullyacknowledged.ReferencesBedbrook, J. R., Jones, J., O’Dell, M., Thompson, R. J., Flavell, R. B. (1980): A molecular description oftelomeric heterochromatin in Secale species. Cell, 19, 545–560.Gerlach, W. L., Bedbrook, J. R. (1979): Cloning and characterization of ribosomal RNA genes from wheat andbarley. Nucleic Acids Research, 7, 1869–1885.Molnár, I., Cifuentes, M., Schneider, A., Benavente, E., Molnár-Láng, M. (2011): Association between SSRrichchromosome regions and intergenomic translocation breakpoints in natural populations ofallopolyploid wild wheats. Annals of Botany, 107, 65-76.Molnár-Láng, M., Cseh, A., Szakács, É., Molnár, I. (2010): Development of a wheat genotype combining therecessive crossability alleles kr1kr1kr2kr2 and the 1BL.1RS translocation, for the rapid enrichment of 1RSwith new allelic variation. Theor. Appl. Genet., 120, 1535–1545.Molnár-Láng, M., Linc, G., D. Nagy, E., Schneider, A., Molnár, I. (2002): Molecular cytogenetic analysis ofwheat-alien hybrids and derivatives. Acta Agron. Hung., 50, 303-311.Nagaki, K., Tsujimoto, H., Isono, K., Sasakuma, T. (1995): Molecular characterization of a tandem repeat, Afafamily, and its distribution among Triticeae. Genom,e 38, 479–486.Schneider, A., Linc, G., Molnár, I., Molnár-Láng, M. (2005): Molecular cytogenetic characterization ofAegilops biuncialis and its use for the identification of five derived wheat-Aegilops biuncialis disomicaddition lines. Genome, 48, 1070–1082.Schneider, A., Molnár, I., Molnár-Láng, M. (2010 a): Selection of U and M genome-specific wheat SSRmarkers using wheat–Aegilops biuncialis and wheat–Ae. geniculata addition lines. Euphytica 175, 357-364.Schneider, A., Molnár, I., Molnár-Láng, M. (2010 b): Production and FISH identification of wheat- Aegilopsbiuncialis addition lines and their use for the selection of U and M genome-specific molecular (SSR)markers. Acta Agron. Hung., 58, 151- 158.Szakács, É., Molnár-Láng, M. (2010): Identification of new winter wheat – winter barley addition lines (6HSand 7H) using fluorescence in situ hybridization and stability of the whole ‘Martonvásári 9 kr1’-‘Igri’addition set. Genome, 53, 35-44.109

AGRISAFE Budapest, Hungary, 2011USING MAIZE (ZEA MAYS L.) OF BULGARIAN LOCAL ORIGINAS A NEW SOURCE OF BREEDING MATERIALA. SEVOV 1 – V. SEVOV 21 Agricultural University – Plovdiv, Bulgaria2 Institute of Plant Genetic Resources, K. Malkov – Sadovo, BulgariaE-mail:asevov@yahoo.comAbstract The Bulgarian national maize collection has over 1000 species of local origin, collected fromdifferent geographical regions of the country. Their direct use as a source of breeding material is inappropriatebecause of the presence of many undesirable genes. It is necessary to carry out pre-breeding aimed at creatingmore relevant genomes for producing quality inbred lines, suitable for use in breeding programs. Twelve localpopulations from the collection were selected with good overall performance and close morphologicalcharacteristics, which were used as initials for creating three synthetics. Each synthetic is derived from theunification of four populations. An equal number of seeds was sown for each of them and double propagationin spatial isolation was applied. The new synthetics thus obtained were improved using the half-sib method andtested for productivity. After another cycle of improvement the productivity of the initial populations and thederived synthetics was compared. An increasing level of overall productivity was observed for the varioussynthetics.Key words: maize, maize populations, maize local origin, maize initial synthetics, maize source material,maize collectionsIntroductionThe used in the maize selection initial populations are not so many. In most of the casesthey belong to the most known types – Lancaster and SSS. Some of the scientists(Yugenhemer et al., Tomov et al., 1997) stated that when tracking their origin they cometo several germ plasm sources.Searching of new germ plasm sources is a matter of national programes, (Genov et al.,2004), (Tomov et al., 1997).The national Bulgarian collection contains more than 1000 local maize cultivars,gathered from different country geographic regions. Their studying showed that theyhave unique genomes, characteristic only for some Bulgarian populations (Kostova etal., 2006), (Kostova et al., 2007). This is a great advantage as it enables different germplasm to be used in the selection programmes.The direct local landraces use as a selection material is not suitable due to the presenceof some unfavourable genes.Applying of prebreeding program is necessary for creating of preceding initial genomesfor producing self-pollinated lines.Material and methodsThe experimental work regarding this topic was conducted in PGRI – Sadovo fields inthe period 2007 -2010.12 local populations having similar vegetative period, high for the group generalproductivity and suitable ear characteristics were chosen out of PGRI – Sadovocollection. Three synthetics were produced, each one containing 4 local origins andequal grain numbers are taken of each them. Each synthetic was two years reproduced inspatial isolation in open pollination. The obtained synthetics are tested for productivityapplying field latin rectangle method.The relative productivity of the initial populations was estimated on the base of the earcharacteristics, ear and grain weight.110

Budapest, Hungary, 2011AGRISAFEThe initial synthetics were improved by Halfsib method for eliminating the mostunfavorable genes in the genomes.Results and discussionTable 1. Vegetation period and relative productivity of local populations, selected for synthetics (2007).LocalRelativenumberplantsestimatedGerminationDateSilkingdateIn Table 1 are given the ear characteristics and vegetative period data. The vegetativeperiod is in days and covers the period germination – tesling. Within the group 12varieties having higher productivity are selected. All they have similar vegetative period.Table 2 shows the synthetics tested productivity. Most of them have close productiveabilities and have potential to increase them after applying methods of improvement.The results in table 1 and able 2 enable the populations in the initial synthetics to beclassified considering their geographical origin.Synthetic 1 Synthetic 2 Synthetic 3Voditza N. Pazar BeloslavtziMestna 56 Granitovo SvetlenLomtzi 388 Kula TzarevetzDenitza Stransko AldemirAs a whole the obtained synthetics productivity is higher than the average productivityof the participating populations – Table 3.daysNumberearearmass/kgkernalmass/kgRelativeyield/da1 Svetlen 20 15.05 14.07 60 19 2.115 1.697 3392 Kula 20 15.05 14.07 60 18 2.196 1.800 3603 Mestna 60 20 15.05 15.07 61 19 1.983 1.520 3054 N. Pazar 20 15.05 14.07 60 18 2.110 1.696 3395 Granitovo 20 15.05 15.07 61 19 2.203 1.797 3596 Denitza 20 15.05 14.07 60 19 2.535 2.073 4147 Stransko 20 15.05 14.07 60 20 2.517 2.056 4118 Aldemir 20 15.05 14.07 60 20 2.494 1.978 4029 Lomtzi 388 20 15.05 15.07 61 19 2.318 1.905 38510 Tzarevetz 20 15.05 15.07 61 19 1.995 1.961 39211 Beloslavtzi 20 15.05 15.07 61 20 2.011 1.653 33212 Voditza 20 15.05 15.07 61 19 1.953 1.657 33613 Svoboda 20 15.05 15.07 61 19 1.706 1.353 27014 Pet Kladen 20 15.05 15.07 61 19 1.697 1.353 27015 Muhino 20 15.05 14.07 60 18 1.838 1.445 28916 R. Konare 20 15.05 14.07 60 19 1.837 1.445 29517 Karavelovo 20 15.05 15.07 61 19 1.677 1.360 27218 Blagoslav 20 15.05 14.07 60 19 1.697 1.390 27819 Madan 20 15.05 14.07 60 18 1.536 1.147 25120 Mestna 50 20 15.05 15.07 61 18 1.870 1.392 27821 Mestna 54 20 15.05 15.07 61 18 2.096 1.670 33822 Mestna 56 20 15.05 15.07 61 19 1.723 1.397 28023 Granitovo 20 15.05 14.07 60 19 1.970 1.516 30524 Ekzarh111 20 15.05 15.07 61 17 1.630 1.240 247111

AGRISAFE Budapest, Hungary, 2011Table 2. Synthetics productivitySyntheticsAverage productivity of population in thesynthetic(t ha -1 )Initial syntheticsYield (t ha -1 )synthetic first ciclesynthetic 1 375 412 493synthetic 2 379 427 512synthetic 3 386 450 526№Table 3. Productivity of local cultivar varieties involved in syntheticsAverage Relative yield DifferenceVarieties Class. arithmetic %kg.Warranted1 Beloslavtzi 10 359.25 94.49 -20.96 --2 Svetlen 9 362.50 95.34 -17.71 -3 Kula 5 396.00 104.15 15.79 +4 Granitovo 6 394.25 103.69 14.04 +5 Voditza 12 338.00 88.90 -42.21 ---6 N. Pazar 11 349.00 91.79 -31.21 ---7 Tzarevetz 4 396.25 104.22 15.04 +8 Aldemir 3 399.25 105.01 19.04 +9 Lomtzi 7 388.25 102.12 8.04 +10 Stransko 2 403.00 105.99 22.79 ++11 Mestna 56 8 369.00 97.05 -11.21 +12 Denitza 1 407.75 107.24 27.54 +++GD 5% = 14.64GD 1% = 19.6GD 0.1% = 25.98Relatively, the small increase in the productivity is due to the unfavorable genespresence, which cannot be eliminated without applying several improvement cycles.The higher productivity is helped by the presence of some heterosis. When even onlyone cycle of improvement is applied a better excerpt of the new population is realize andthe productivity grows obviously. The finally received genomes have higher good genesfrequency and the heterosis increases. Further improvement will create a suitablegenome, using it as an initial material in the selection programs.ConclusionsThe integrating of local cultivar groups in synthetics gives the possibility the favorablegenomes from great number populations to be selected and united.The obtained synthetics have a higher productivity in comparison to the average one ofthe initial populations.Due to the elimination of the most of the unfavorable genes, the conducting of theimprovement activities of the obtained synthetics results in greater productive abilitiesand yield structure indicators.112

Budapest, Hungary, 2011AGRISAFEAcknowledgementsThis paper was financially supported by project BG051PO001-3.3.04/17 headed byAssociate Professor Dr. Maya DimitrovaReferencesGenov, M., I. Genova, N Petrovska: (2004): Using of exotic materials in maize selection. Julilee session,Maize Research Institute – Kneja, Bulgaria. 48 – 51.Kostova, A., E. Todorovska, N. Hristov, V. Sevov, A. Atanassov. (2006): Molecular Characterization ofBulgarian Maize Germplasm Collection via SSR Markers. Biotechol and Biotechol Eq. 20/2.Kostova, A., E. Todorovska, N. Hristov, V. Sevov, M. Genov, S. Vulchinkov, A. Atanassov, (2007): Assessingthe Genetic diversity of Bulgarian Maize Germplasm Using Microsatellite Marcers. Mayodica. 52, 251 –255Tomov, N., (1978): New directions and requirements to the maize selection (survey). Agricultural Academy,Sofia, Bulgaria.Tomov, N, Vulchinkov, V. (1997): Maize. Academic publisher “Prof. Marin Drinov”, 135 – 156.113

AGRISAFE Budapest, Hungary, 2011DEVELOPMENT OF NEW WHEAT/BARLEY TRANSLOCATIONLINES FROM CYTOGENETIC MATERIALS PRODUCED INMARTONVÁSÁRÉ. SZAKÁCS – K. KRUPPA – E. TÜRKÖSI – A. CSEH –I. MOLNÁR –M. MOLNÁR-LÁNGAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, HungaryAbstract Gamma irradiation and crossing with the CSph mutant were applied to induce translocations betweenwheat and barley genomes in the 4H(4D) substitution and the Mv9kr1-Igri addition lines. The pattern of theintergenomic chromosome rearrangements was analysed in the mutagenized M 0 and M 1 generations bygenomic in situ hybridization (GISH). A wide variety of chromosomal rearrangements were detected. A newtranslocation line containing a 4HL.5BL centric fusion was identified using repetitive DNA probes (FISH) andSSR markers.Key words: Triticum aestivum, Hordeum vulgare, gamma irradiation, CSph mutant, translocation, in situhybridizationIntroductionBarley (Hordeum vulgare L.), which has a number of desirable traits, is a promisingsource for increasing the genetic diversity of common wheat (Triticum aestivum L.).This crop is known for its adaptability and can be grown in a wide range of climates.Genes that affect vernalization (Hayes et al., 1993), yield (Larson et al., 1996) and earlyheading (Murai et al., 1997) have been mapped to specific barley chromosomes. Barleyis relatively well adapted to water deficit (Ceccarelli, 1987), is regarded as being moresalt tolerant than bread wheat (Colmer et al., 2005) and has special nutritional qualityparameters. Consequently, the transfer of chromosome segments from barley into wheatmay result in new translocation lines carrying important agronomic characters. Wheatbarleyaddition and substitution lines form the starting point for producing translocationsfrom selected chromosomes. Recombination between specific barley chromosomes andtheir wheat homoeologues was induced successfully for the first time by Islam andShepherd (1992) using the Chinese Spring ph1b (CSph) mutant (Sears, 1977), whichcarries the homozygous deletion of the Ph1 gene on the long arm of chromosome 5B.Since the first successful gene transfer from Aegilops umbellulata Zhuk. to wheat (Sears,1956), ionizing irradiation has been widely applied to crop species for the production ofinterspecific translocations. Once alien chromatin is transferred into wheat, it is desirableto identify the translocated chromosome, localize the breakpoint, and estimate theamount of transferred alien chromatin. Genomic in situ hybridization (GISH) provides adirect, visual method of distinguishing parental genomes in hybrids and their derivatives,while fluorescence in situ hybridization (FISH) is a powerful technique for detectingspecific nucleic acid sequences and localizing highly repetitive DNA sequences inspecific regions of individual chromosomes, thus allowing their identification. PCRbasedmolecular (SSR) markers for barley chromosomes also provide suitable tools fordetecting alien chromosome segments in a host genome.The aim of the present study was to induce chromosome rearrangements between wheatand barley genomes using gamma irradiation and the CSph mutant in substitution andaddition lines developed at the Agricultural Research Institute of the HungarianAcademy of Sciences. It is intended to select wheat translocation lines having favourablealien traits (special quality parameters, salt or drought tolerance, etc.) that could serve asbasic materials for the wheat breeding programmes in Martonvásár.114

Budapest, Hungary, 2011AGRISAFEMaterials and methodsWheat-barley disomic addition lines were selected in Martonvásár from the backcrossedand selfed progenies of a hybrid produced by Molnár-Láng et al. (2000) using the winterwheat line Martonvásári 9 kr1 (Mv9kr1) (Molnár-Láng et al., 1996) as maternal parentand the 2-rowed winter barley cultivar Igri as the male parent, and identified using in situhybridization methods (Szakács and Molnár-Láng, 2007; 2010). The 4H(4D)substitution was produced from a spring wheat (Chinese Spring) x spring barley (Betzes)hybrid previously developed by Molnár-Láng and Sutka (1994). After backcrossingtwice with the line Mv9kr1 a spontaneous substitution line was identified usingmolecular cytogenetic methods (Molnár et al., 2007). Chromosome breakages wereinduced in dry seeds of the 4H(4D) substitution and the Mv9kr1 addition lines usingirradiation with 60 Co gamma rays at dosages of 50 and 100 Gy and by crossing the4H(4D) substitution line with the CSph mutant. For genomic (GISH) and fluorescent insitu hybridization (FISH) root-tip metaphase chromosome preparations were made fromgerminating seeds. Total barley genomic DNA was labelled with biotin-16-dUTP ordigoxigenin-11-dUTP using a nick translation mix and used as an H-genome-specificGISH probe. The repetitive DNA sequences Afa-family, HvT01 and GAA wereamplified and labelled with biotin-16-dUTP and digoxigenin-11-dUTP, respectively,using PCR (Nagaki et al., 1995). The pTa71 rDNA clone was labelled with 50% biotin-16-dUTP and 50% digoxigenin-11-dUTP by nick translation. GISH experiments wereperformed according to Sánchez-Morán et al. (1999) with modifications, and FISH wascarried out as reported by Linc et al. (1999). The barley SSR (simple sequence repeat)markers HvM67 and HvM40 were used to identity the translocated barley chromosomearms. The PCR reaction was run on an Eppendorf MasterCycler and the PCR productswere separated using 2.5% agarose gel.Results and discussionGamma irradiation was 100% effective, as chromosome rearrangements could bedetected by GISH between the barley and wheat genomes in every plant of themutagenized (M 0 ) generation of the 4H(4D) substitution line and the Mv9kr-Igriaddition lines. Chromosomal aberrations showed a mosaic pattern, i.e. cells of the sameplant carried different types of translocation chromosomes (Figure 1a). Reciprocal andinterstitial translocations were the most frequent aberrations (about 30–40%). Terminaltranslocations were observed at a frequency of about 25%, while centric fusions wereformed in less than 10% of the cells. GISH analyses of the Mv9kr-Igri addition linesshowed that only reciprocal translocations were transmitted from the M 0 plants into thenext generation. Disomic reciprocal translocations were observed in about 10% of theM 1 progeny plants (Figure 1b).Translocations produced in this way are expected to be stabilized in later backcrossprogenies as a set of introgression lines carrying few but distinct rearrangements. Sixteenplants were grown from the M 0 irradiated seeds of the 4H(4D) substitution line in acontrolled environment and 345 M 1 seeds were developed. The further study of theseseeds is planned in order to determine the transmission rate of translocated chromosomesfrom M 0 into the M 1 generation.115

AGRISAFE Budapest, Hungary, 2011Figure 1. a: Chromosome translocation types revealed by GISH in the M 0 generation of the 4H(4D)substitution line and the Mv9kr1-Igri addition lines. CF – centric fusion, TT – terminal translocation, IT –interstitial translocation, RT – reciprocal translocation. b: Disomic reciprocal translocation in a metaphase cellof a gamma-irradiated addition line. Pairs of reciprocal translocations are indicated with arrowheads andasterisks. Total barley genomic DNA was labelled with digoxigenin and detected with anti-digoxigeninrhodamine(a), or labelled with biotin-16-dUTP and detected with streptavidin-FITC (b). The barleychromosome segments are bright red and bright green. Wheat chromosome segments are unlabelledA total of 250 F 3 and F 4 seeds of the 4H(4D) × CSph mutant cross were analysed usingGISH and monosomic centric fusions were detected in 11 seeds. SSR analysis using the4HS-specific HvM40 and 4HL-specific HvM67 markers revealed the presence of the4HL barley chromosome arm in the translocation. The wheat chromosome arm in thecentric fusion was identified by FISH using the DNA probes pSc119.2, Afa family andpTa71. Each wheat chromosome could be distinguished with a combination of theseDNA probes except for the whole 5D chromosome. It was missing from the plants butthe 5DL chromosome arm could be detected in the translocated chromosome due to itsvery specific FISH pattern. The wheat/barley centric fusion was thus identified as a4HL.5DL translocation. In the F 5 and F 6 generation 22 plants contained this centricfusion in the disomic state and appeared to be genetically stable. Additional centricfusions were detected in two of the 55 F 2 seeds analysed from the 4H(4D) substitutionline × CSph mutant cross. These translocations have not yet been identified. It is possiblethat these seeds may contain the short arm of 4H, as independent segregation is expectedin the F 2 generation.ConclusionsIrradiation and crossing with the CSph mutant were successfully applied to producetranslocations in the 4H(4D) substitution and the Mv9kr1-Igri addition lines.Translocation lines are very useful genetic stocks as they contain 42 wheat chromosomeswith incorporated barley chromosome segments and are thus more stable geneticallythan addition lines. These lines can be tested for favourable agronomic traits underlaboratory and field conditions, and could thus provide new data on genes located onvarious barley chromosome segments. Selected lines can be introduced into breedingprogrammes. The translocation breakpoints can be determined using a combination of in116

Budapest, Hungary, 2011AGRISAFEsitu hybridization (GISH, FISH) and molecular marker techniques, so the newtranslocations may contribute to the development of physical maps for barley and wheat.AcknowledgementsThis paper was financially supported by the Generation Challenge Programme (CGIARGCP SP3 G4007.23) and the Hungarian National Research Fund (OTKA K 75 381) withthe support of the AGRISAFE (No. 203288) EU-FP7-REGPOT 2007-1 project.ReferencesColmer, T. D., Munns, R., Flowers, T. J. (2005): Improving salt tolerance of wheat and barley: futureprospects. Australian J. Exp. Agric., 45, 1425-1443.Ceccarelli, S. (1987): Yield potential and drought tolerance of segregation populations of barley in contrastingenvironments. Euphytica, 36, 265-273.Hayes, P. M., Blake, T. K., Chen, T. H. H., Tragoonrung, S., Chen, R, Pan, A., Liu, B. (1993): Quantitativetrait loci on barley (Hordeum vulgare L.) chromosome 7 associated with components of winterhardiness.Genome, 3, 66-71.Islam, A. K. M. R., Shepherd, K. W. (1992): Production of wheat-barley recombinant chromosomes throughinduced homoeologous pairing. 1. Isolation of recombinants involving barley arms 3HL and 6HL. Theor.Appl. Genet., 83, 489–494.Larson, S., Kadyrzhanova, D., McDonald, C. L., Sorrells, M., Blake, T. K. (1996): Evaluation of barleychromosome-3 yield QTLs in a backcross F2 population using STS-PCR. Theor. Appl. Genet., 93, 618-625.Linc, G., Friebe, B. R., Kynast, R. G., Molnár-Láng, M., Kőszegi, B., Sutka, J., Gill, B. S. (1999): Molecularcytogenetic analysis of Aegilops cylindrica Host. Genome, 42, 497–503.Molnár, I., Linc, G., Dulai, S., Nagy, E. D, Molnár-Láng, M. (2007): Ability of chromosome 4H to compensatefor 4D in response to drought stress in a newly developed and identified wheat-barley 4H(4D) disomicsubsitutiton line. Plant Breeding, 126, 369-374.Molnár-Láng, M., Linc, G., Sutka, J. (1996): Transfer of the recessive crossability allele kr1 from ChineseSpring into winter wheat variety Martonvásári 9. Euphytica, 90, 301–305.Molnár-Láng, M., Linc, G., Logojan, A., Sutka, J. (2000b): Production and meiotic pairing behaviour of newhybrids of winter wheat (Triticum aestivum) × winter barley (Hordeum vulgare). Genome, 43, 1045–1054.Molnár-Láng, M., Sutka, J. (1994): The effect of temperature on seed set and embryo development inreciprocal crosses of wheat and barley. Euphytica, 78, 53-58.Murai, K., Koba, T., Shimada, T. (1997): Effects of barley chromosome on heading characters in wheat-barleychromosome addition lines. Euphytica, 96, 281-287.Nagaki, K., Tsujimoto, H., Isono, K., Sasakuma, T. (1995): Molecular characterization of a tandem repeat, Afafamily, and its distribution among Triticeae. Genome, 38, 479–486.Sánchez-Morán, E., Benavente, E., Orellana, J. (1999): Simultaneous identification of A, B, D and R genomesby genomic in situ hybridization in wheat-rye derivatives. Heredity, 83, 249–252.Sears, E. R. (1956): The transfer of leaf-rust resistance from Aegilops umbellulata to wheat. Brookhaven Symp.Biol., 9, 1–22.Sears, E. R. (1977): An induced mutant with homoeologous pairing in common wheat. Can. J. Genet. Cytol.,19, 585–593.Szakács, É., Molnár-Láng, M. (2007): Development and molecular cytogenetic identification of new winterwheat–winter barley (‘Martonvásári 9 kr1’–‘Igri’) disomic addition lines. Genome, 50, 43–50.Szakács, É., Molnár-Láng, M. (2010): Identification of new winter wheat–winter barley addition lines (6HSand 7H) using fluorescence in situ hybridization and the stability of the whole ‘Martonvásári 9 kr1’–‘Igri’addition set. Genome, 53, 35–44.117

AGRISAFE Budapest, Hungary, 2011PRELIMINARY RESULTS ON THE ISOLATION OFPOLYPLOID LINES FROM MALVACEAEP. SZARVAS 1 – G. KOVÁCS 2 – M. MOLNÁR LÁNG 2 – M. LÁSZLÓ 3 – M.G. FÁRI 11 Department of Plant Biotechnology, Sámuel Diószegi Institute of Agricultural Innovation, Centre ofAgricultural Science, University of Deberecen, Debrecen, Hungary, szarvasp@agr.unideb.hu2 Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary3 Department of Biology, University of South Carolina, Columbia-SC, USAAbstract Polyploidization experiments were initiated based on three traditional methods involving colchicinetreatment on germinating seeds, nodal segments and freshly regenerated shoots (tips).In the first case, where the seeds were germinated on culture medium, covered with colchicine-soaked filterpaper in Petri dishes, only morphologically aberrant plantlets were germinated, which could not be furtheranalyzed. In the second case, where nodal shoot segments were directly treated with colchicine, all thesegments died or were unable to regenerate shoots. In the third treatment shoots were regenerated from nodalsegments. Liquid culture medium supplemented with 0.2% colchicine was added in such a way that the wholeexplant was completely immersed, followed by incubation in the dark for a period of 2 or 4 days. Shoot tips oftreated shoots were cut, transferred onto fresh culture media and rooted. 30-40% of the treated shoots survived.New leaf samples were taken from each shoot for flow cytometry measurements to test for polyploidy. Severalpolyploid shoots were detected, which were planted directly into soil and transferred to the greenhouse forfurther examination.Key words: polyploidy, Sida, Kitaibelia, Lavatera, Háros interspecific hybrid, colchicine, flow cytometryIntroductionPolyploidization is a very important tool for plant breeders. Polyploidy occurs in cellsand organisms when there are more than two paired (homologous) sets of chromosomes.Most organisms are normally diploid (2n), meaning they have two sets of chromosomesin their somatic cells — one set inherited from each parent. Polyploidy may occur due toabnormal cell division during metaphase I in meiosis or in mitotic cell division when thechromosomes stay together after the metaphase (it can be induced by certain agents ormay happen spontaneously). It is most commonly found in plants. Haploidy (one set ofchromosomes, 1n) may also occur as a normal stage in an organism's life (alternation ofgenerations). The occurrence of polyploidy is a common mechanism of speciationresulting new species (Matthew et al, 2008). Body of polyploid plants are generallybigger then diploids and produces much bigger biomass, much bigger flowers and largeramount of secondary metabolites. Polyploidy can be induced in plants and cell culturesby some chemicals (c-mitotic agents): the best known is colchicine, which can result inchromosome doubling, though its use may have other less obvious consequences as well.Oryzalin also known as chromosome doubling agent (Madon et al, 2005). Some virusesalso can induce polyploidy in plant cells. (Broekaert et al, 1978). In plant breedingcolchicine used most commonly to make fertile hybrids. (Aneeta et al, 2010, Rose et al,2004). Polyploidy also occurs common among Mallows in natural populations (Jenniferet al, 2003, Julio et al, 2010). The mallow family containing over 200 genera with closeto 2300 species. Most species are herbs or shrubs but some are trees and lianas. Some ofthe species contains bioatctive components (Gudej, 1991, Gudej et al, 1990). Manyspecies of Althaea and alcea are harvested as ornamental plants in Hungary and over theworld. (Kováts, 2002). Some species of ornamental mallow can make phytoremediatesoils, contaminated heavy metalls (Jia-nv et al, 2007,). Some other species of Mallowsare also potential energy plants. Their biomass productivity is very high however theirsoil demand is moderate to very low. Therefore unessessary the use of good quality soils118

Budapest, Hungary, 2011AGRISAFEfor the production of high amount of lignocellulosic biomass. Cellulose andhemicellulose are the key components for bio-ethanol and the modern industrialchemistry (e.g. modern, biodegradable and other plastics). (Csizinszky et al, 1987).Materials and methodsExperiments were initiated based on three published methods (Dhooghe et al, 2010).1. Germination of seeds on medium, containing colchicines in vitro2. Colchicine treatment of nodal segments in liquid medium, and regeneration ofshoots in vitro3. Colchicine treatments of freshly regenerated shoots, induced from nodal shootsegments, placed on slopedly solidified agar medium, in test tubes in vitroFull strength MS, solid culture medium was used in vitro in case of the first method. Themedium was solidified by 15gl -1 agar, complemented with 2% of Saccharose and puredinto Petry dishes. After solidification in each dish the surface of the medium werecovered with filter paper, previously immersed into 0,2% Colchicine. Seeds were surfacesterilized for the experiments, after presoaking them in liquid MS medium for 20 hours,by rinsing in 96% Ethanol containing 1% Tween-20 solution. Then rinsing in 10% H 2 O 2 ,followed by 10% Ca(OCl) 2 treatment. both for 10-10 minutes (both solution contained0,5% Tween-20 as a deteregent). The sterilized seeds were placed onto the filter paper (6seeds/culture). Untreated strelized seeds were also germinated and used as control forseed viability. The polyploidization experiment was carried out Kitaibela vitifolia,Lavatera sp., Althaea officinalis, Althaea cannabina seeds. In the second experimentsterile nodal shoot segments were directly used for cholchicine treatments. The nodalshoot segments were transferred into 100ml Erlenmeyer flasks, filled with 10ml of liquidMS culture media, containing 0,16% of Colchicine, 2% of Saccharose. 112 nodalsegments were inoculated into Erlenmeyer flask cultures (16 into each). Samples of 4shoots were taken every day and inoculated onto half strength solid MS medium,supplemented with 0,1mgl -1 of IAA, 0,05mgl -1 of IBA and 2% of Saccharose, inErlenmeyer flasks. The experiment was carried out only with Sida species. No shootregeneraton was observed. In the third type of experiment directly sterile shoots freshlyregenerated from nodal shoot segments of shoot cultures were used. The 3-5 cm longshoots were cut into one nodal segments and were transferred onto test tubes slopedlyfilled, with half strength solidified MS culture media, supplemented with 0,1mgl -1 ofIAA, 0,05mgl -1 of IBA and 2% of Saccharose. After 6-8 weeks advetitious shoots wereregenerated. Liquid culture medium supplemented with 0,2% colchicines was addedsuch a way that. the whole explant was completelly immersed, and incubated in dark fora period of 2 or 4 days, then the liquid medium was removed rinsed twice with chohicinefree medium and the shoot regenerated nodal cultures were further incubated in theoriginal solid culture. After 6-8 weeks, the shoot tips of treated shoots were cut with 0,4-1cm long shoot segments and transferred onto fresh culture media in 100ml ofErlenmeyer flasks. Shoots were numbered for further identification. Leave samples weretaken of each shoots for flow cytometry measurements. The shoots were propagated invitro, rooted and planted directly into soil and transferred to green house, for furtherexaminations. The experiment was carried out with Sida sp., Háros interspecific hybridand Althaea cannabina species.119

AGRISAFE Budapest, Hungary, 2011Results and discussionIn the first experiment, only sporadic germination were observed in the control cultures(Althaea officinalis - 35% and Althaea cannabina – 14%) after 6 days. Germination wereeven more poorish in case of seeds treated with colchicine. Sporadic germination onlywere noticed at Althaea officinalis (8%), only after 2-3 week, and Lavatera species (2%),only after 3 month. However, even these seedlings were strongly malformed. They hadswollen, reduced radicle. From Althea officinalis only three seeds germinated at all, andone seedlings was able to further develop, but the shoot was also malformed and diedlater. Only a single seed germinated from Lavatera which also died soon. Most of thedirectly treated nodal shoot segments died, after transferring onto solid culture media incase of second method. Callus production was occasionally observed on some of thesurvived shoot segments but no shoot were regenerated. The third method appeared to bethe most efficient, 30-40% of the treated shoots survived. Development of these shootswere temporarily arrested by the Colchicin treatment, but they continued to grow after amonth. The treatment was found efficient because most of the shoots analysed by flowcytometryshowed altered cytology. Octaploid, tetraploid, putative aneuploid, andmixoploid shoots were also noticed. Special changes of the leaf upper epidermis wereobserved in case of the polyploid shoots. Decreased uniformity of the epidermisorganization, and irregular cell shape and larger cell size were observed. The lowerepidermis also showed these differences including, the larger size of the stoma guardcells in the polyploid shoots compared with controll shoots. Appearance and growingpotencial of some shoots also were different in the green house. Some of the treatedshoots grew more dynamically grew more robust then the control shoots. Other shootsgrew quite normal but early senescence and defoliation were observed. Chimaeric plantsregarding the DNA level in their cells were also found among these shoots, by flowcytometry.ConclusionsPolyploid lines of Sida and Kitaibelia sp. had been produced successfully fromcolchicine treated shoots, freshly regenerated in vitro from nodal segments. Typicalmorphologycal changes were detected in the epidermis and in the guard cells. Thesechanges tipical in case of polyploid plants. The polyploid shoots were propagated andwere rooted successfully in vitro. The different polyploid lines were grown distinctly ingreenhouse.AcknowledgementsThe authors express their special thanks to Mrs. Edit Kotogány for her assistencerendered in flow citometry measurements. The project were supported partly by theengagement of Új Magyarország Fejlesztési Terv (No. GOP-1.3.1.-08/2-2009-007 -Interest Trade Ltd, Nyiregyhaza, Hungary) and partly by the National Research andTechnological Office (NKTH, Budapest, Hungary, Project No. EA-2044-010/2009,Ereky Foundation, Debrecen, Hungary)ReferencesAneeta, P., Julie, A. P., Matthew, N. N., Wallace, A. C., Guijun, Y. (2010): Successful induction of trigenomichexaploid Brassica from a triploid hybrid of B.napus L. and B. nigra (L.) Koch. Euphytica, 176, 87-98120

Budapest, Hungary, 2011AGRISAFEBaquar, S. R. (1976): Polyploidy in the Flora of Pakistan in Relation to Latitude, Life Form, and TaxonomicGroups. Taxon, 25, 621-627Broekaert, D., Van Parijs, R. (1978): Histophotometric DNA measurements onUmbelliferae, SolanaceaeandCompositae, before and after crown gall tumour induction. Protoplasma, 93, 433-442Csizinszky, A. A. and Gilreath, J. P. (1987): Effects of supplemental nitrogen rate and source on biomassproduction by three weed species in fallow vegetable land. Biomass, 12,17-26Dhooghe, E. , Van Laere, K., Eeckhaut T., Leus L., Van Huylenbroeck, J. (2010): Mitotic chromosomedoubling of plant tissues in vitro. Plant Cell, Tissue and Organ Culture, review, 1-15Esipova, M. V. (1978): Use of merhods of indirect identification in isolation of polyploid forms of medicinalcultures. Pharmaceutical Chemistry JournalGriesbach, R. J. (1981): Colchicine-induced polyploidy in phalaenopsis orchids. Plant Cell, Tissue and OrganCulture, 1, 103-107Gudej, J. (1991): Flavonoids, phenolic-acids and coumarins from the roots of althaea-officinalis. PlantaMedica, 57, 284-285Gudej, J., Bieganowska, Ml. (1990): Chromatographic investigations of phenolic-acids and coumarins in theleaves and flowers of some species of the genus althaea. Journal of Liquid Chromatography, 13, 4081-4092Jennifer, A. Tate, and Beryl, B. S. (2003): Paraphyly of Tarasa (Malvaceae) and Diverse Origins of thePolyploid Species. Systematic Botany, 28, 723-737Jia-nv L., Qi-xing, Z., Ting, S., Lean, Q. Ma, Song, W. (2007): Growth responses of three ornamental plants toCd and Cd-Pb stress and their metal accumulation characteristics. Journal of Hazardous Materials, 151,261-267Julio, V S., Marilu, L H. (2010): Karyotype analysis and polyploidy in Palaua and a comparison with its sistergroup Fuertesimalva (Malvaceae). Journal of Systematics and Evolution, 48, 175-182.Kováts, Z. (2002): The breeding of seed-propagated. Open field groable ornamental herbs in Hungary.Hungarian Agricultural Research. Journal of the Ministry of Agriculture and Regional Development, 11, 3Madon, M.; Clyde, M. M.; Hashim, H.; Mohd, Y. Y.; Mat, H. and Saratha, S. (2005): Polyploidy induction ofoil palm through colchicine and oryzalin treatments. Journal of Oil Palm Research, 17, 110-123Matthew, J. Hegartya, and Simon, J. Hiscock (2008): Genomic Clues to the Evolutionary Success of PolyploidPlants. Current Biology, 18, 435-444Rose, J.B. , Kubba, J., Tobutt, K.R. (2004): Chromosome doubling in sterile Syringa vulgaris × S. pinnatifoliahybrids by in vitro culture of nodal explants. Plant Cell, Tissue and Organ Culture, 63, 127-132121

AGRISAFE Budapest, Hungary, 2011FISH CHARACTERIZATION OF A WHEAT LINE CARRYINGLEAF RUST RESISTANCE FROM T. TIMOPHEEVIIA. UHRIN – É. SZAKÁCS – L. LÁNG – Z. BEDŐ – M. MOLNÁR-LÁNGAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, HungaryAbstract T. timopheevii (Zhuk.) is well known for its complex resistance to frequently occurring diseases suchas powdery mildew, leaf rust and stem rust. In Martonvásár, a disease-resistant (powdery mildew, leaf rust)line was selected from the progenies of the Triticum aestivum x Triticum timopheevii amphiploids. This linewas previously identified with C-banding as a 6G(6B) substitution. The fluorescent in situ hybridization(FISH) technique with repetitive DNA probes (Afa-family, pSc119.2, pTa71) was used to identify and followthe 6G chromosome of T. timopheevii. On the T. timopheevii slides, 6G chromosomes were identified first bytheir arm ratios and the characteristic pTa71 signal. Each chromosome of the 6G(6B) substitution line and thecontrol wheat cultivar could be identified with the help of FISH using the same repetitive DNA probes as forT. timopheevii. Chromosome 6G could be clearly identified and its FISH pattern was different from those ofthe 6B chromosome of the control wheat cultivar Fleischmann-481.Key words: FISH, Triticum timopheevii, Triticum aestivumIntroductionImportant agronomic traits of wheat such as disease resistance can be enhanced byincorporating chromosome translocations from wheat related species via crossing.Triticum timopheevii ssp. timopheevii (Zhuk.) is a valuable source of resistance againstseveral fungal diseases that regularly attack wheat. The utility of the species in wheatbreeding has long been studied (Peusha et al. 1996; Järve et al. 2000.) Several diseaseresistance genes from T. timopheevii were identified: the gene Lr18 has not been used inagriculture but would appear to be useful (McIntosh 1983). Leonova et al. (2004)established an introgressive wheat line with durable seedling resistance to leaf rust usingT. timopheevii ssp. viticulosum. Badaeva et al. (1995) produced the powdery mildewresistant line which carried the 6G chromosome of T. timopheevii instead of the 6Bchromosome of wheat, according to C-banding analysis. A dominant powdery mildewresistance gene (Pm27) was localized on chromosome 6B in a T. timopheevii hybrid lineby Järve et al. (2000). Several dominant powdery mildew resistance genes were mappedin T. timopheevii subsp. armeniacum crosses: the gene Pm37 (Perugini et al. 2008) andthe temporarily named MlAG12 gene (Maxwell et al. 2009). C-banding, N-bandingideograms and in situ hybridization data using pSc119.2 probe and were also published(Hutchinson et al. 1982; Badaeva et al. 1991, 1995; Rodríguez et al. 2000; Jiang et al.1994). Fluorescent in situ hybridization (FISH) is a reliable method for the exactidentification of chromosomes. A wheat x T. timopheevii amphiploid was produced inMartonvásár (Belea 1961). According to earlier C-banding experiments, the progenies ofthis amphiploid carry the 6G chromosome of T. timopheevii instead of the 6Bchromosome of wheat (Molnár-Láng et al. 1996). The aim of the present work was toidentify the T. timopheevii chromosomes and to detect the 6G chromosome of T.timopheevii in the 6G(6B) substitution line using fluorescent in situ hybridizationtechnique.Materials and methodsPlant material of Triticum timopheevii (Zhuk.) ssp. timopheevii (gene bank accessionnumber TRI667) from the Gatersleben Genebank (IPK Gatersleben) was used foridentifying the 6G chromosome. The wheat – T. timopheevii 6G(6B) chromosome122

Budapest, Hungary, 2011AGRISAFEsubstitution line was produced in Martonvásár by crossing the amphiploid Fleischmann481/Triticum timopheevii (Belea 1961) with wheat cultivars Mironovskaya 808 andMartonvásári 14 (Mv14). The wheat cultivar Fleischmann 481 was used as a controlplant in the identification of chromosome 6B. Mitotic metaphase chromosomepreparations from the roots of germinating seeds of the plant materials were used forFISH. FISH method was carried out as reported by Linc et al. (1999) with the followingDNA probes on each slide: Afa-family, which is is present in numerous Triticeae species(Nagaki et al. 1995), the B-genome-specific pSc119.2 (Bedbrook et al. 1980), and clonepTa71, containing 8S-5.8S-26S ribosomal DNA (Gerlach and Bedbrook 1979), gives asignal principally in the NOR region of satellite chromosomes.Results and discussionEach repetitive probe gave signals on the chromosomes of T. timopheevii. The 6Gchromosomes could be identified first by the strong pTa71 signal and their arm ratios.Probes Afa-family and pSc119.2 also showed intense patterns.Figure 1. FISH identification of the 6G(6B) substitution line in a partial metaphase cell. Hybridization wascarried out with DNA probes pSc1192. (green), Afa-family (red) and pTa71 (yellow). White arrows indicatethe 6G chromosomes of T. timopheevii. All the other chromosomes show the same patterns as in the controlwheat cultivar.Using FISH and the combination of Afa-family, pTa71 and pSc119.2 probes, thepresence of the 6G chromosome of T. timopheevii can be confirmed in the 6G(6B)substitution line. The chromosome 6G in the substitution line showed the characteristicFISH patterns that are different from those of the 6B chromosome of wheat. In the6G(6B) substitution line, the repetitive probes gave similar signals on chromosome 6Gas in T. timopheevii. Using the three repetitive probes, each chromosomes of the 6G(6B)substitution line could be identified. The differences in FISH patterns betweenchromosome 6B of wheat and chromosome 6G are distinctive (Fig. 1).ConclusionsWild relatives of wheat possess a wide range of resistance against fungal infections. Theuse of these genetic pools could be the basis of integrated plant protection. T.123

AGRISAFE Budapest, Hungary, 2011timopheevii has complex resistance to frequently occurring diseases. A leaf rust andpowdery mildew resistant wheat substitution line carrying chromosome 6G fromTriticum timopheevii (Zhuk.) ssp. timopheevii instead of chromosome 6B of wheat wasproduced in Martonvásár. The presence of the 6G chromosome was confirmed usingfluorescent in situ hybridization technique. In situ hybridization is a promising methodfor tracing the alien chromosome in the disease-resistant 6G(6B) substitution line.AcknowledgementsThis paper was financially supported by the European Union (EU-FP7-REGPOT-2007-1, AGRISAFE No. 203288).ReferencesBadaeva, E.D. Budashkina, E.B., Badaev, N.S., Kalinina N.P. and Shkutina, F.M. (1991): General features ofchromosome substitutions in Triticum aestivum x T. timopheevii hybrids. Theor. Appl. Genet. 82, 227-232Badaeva, E.D., Badaev, N.S., Enno, T.M., Zeller, F.J., Peusha, H.O. (1995): Chromosome substitution inprogeny of hybrids Triticum aestivum x Triticum timopheevii, resistant to brown rust and powdery mildew.Russian J Genetics 31, 75-77Bedbrook, J., Jones, J., O’Dell, M., Thompson, R.D., Flavell, R.B. (1980): A molecular description oftelomeric heterochromatin in Secale species. Cell 19, 545-560Belea, A. (1961): Cercetari privind amfidiploidul Triticum aestivotimopheevi in F2 si in generatiieleurmatoare.Probl Agric 8, 1-21Gerlach, W.L., Bedbrook, J.R. (1979): Cloning and characterization of ribosomal RNA genes from wheat andbarley. Nucleic Acid Res 7, 1869-1885Hutchinson, J., Miller, T.E. (1982): Comparison of Triticum timopheevii with related wheats using thetechniques of C-banding and in situ hybridization. Theor Appl Genet 64,31-40Järve, K., Peusha, H.O., Tsymbalova, J., Tamm, S., Devos, K.M., Enno, T.M. (2000):Chromosomal location ofa T. timopheevii-derived powdery mildew resistance gene transferred to common wheat.Genome 43, 377-381Jiang, J. and Gill, Bikram S. (1994): Different species-specific chromosome translocations in Triticumtimopheevii and T. turgidum support the diphyletic origin of ployploid wheats. Chrom. Res. 2, 59-64Leonova, I., Börner, A., Budashkina, E., Kalinina, N., Unger, O., Röder, M. and Salina. E. (2004):Identification of microsatellite markers for a leaf rust resistance gene introgressed into common wheatfrom T. timopheevii. Plant Breeding 123, 93-95Linc, G., Friebe, B.R., Kynast, R.G., Molnár-Láng, M., Kőszegi, B., Sutka, J. and Gill, B.S. (1999): Molecularcytogenetic analysis of Aegilops cylindrica host. Genome 42: 497-503. doi: 10.1139/gen-42-3-497. PMID:10382296Maxwell, J.J., Lyerly, J.H., Cowger, C., Marshall, D., Brown-Guedira, G., Murphy J.P. (2009): MlAG12: aTriticum timopheevii-derived powdery mildew resistance gene in common wheat on chromosome 7AL.Theor Appl Genet 119, 1489-1495McIntosh, R.A. (1983): Genetic and cytogenetic studies involving Lr18 for resistance to Puccinia recondita.In ’Proceedings of the Sixth International Wheat Genetic Symposium’. pp 777-783. (Fac. Of Agriculture,Kyoto, Japan).Molnár-Láng, M., Kőszegi, B., Linc, G., Sutka, J. (1996): Detection of wheat (Triticum aestivum L./ Triticumtimopheevii Zhuk. addition and substitution and wheat/rye translocation by C-banding and in situhybridization. [Búza (Triticum aestivum L.)/Triticum timopheevii Zhuk. addíció, szubsztitució és búza/rozstranszlokáció kimutatása C-sávozással és in situ hibridizációval.] Növénytermelés 45, 237-245Nagaki, K., Tsujimoto, H., Isono, K., Sasakuma, T. (1995): Molecular characterization of a tandem repeat,Afa-family, and its distribution among Triticeae. Genome 38, 479-486Perugini, L.D., Murphy, J.P., Marshall, D., Brown-Guedira, G. (2008): Pm37, a new broadly effective powderymildew resistance gene from Triticum timopheevii. Theor Appl Genet 116, 417-425Peusha, H.O., Enno, T.M., Priilinn, O. (1996): Genetic analysis of disease resistance in wheat hybrids,derivatives of Triticum timopheevii and Triticum militinae. Acta Agron Hung 44, 237-244.Rodríguez, S., Perera, E., Maestra, B., Díez, M., Naranjo, T. (2000): Chromosome structure of Triticumtimopheevii relative to T.turgidum. Genome 43, 923-930124

BREEDING TOOLS FOR ABIOTIC STRESSRESISTANCE

Budapest, Hungary, 2011AGRISAFEASSESSMENT OF BARLEY BREEDING GERMPLASM BY SSRMARKERS ASSOCIATED WITH CERTAIN QTL’S REGARDINGABIOTIC STRESS TOLERANCE AND QUALITYI. ABIČIĆ 1 – A. LALIĆ 1 – S. ŠIMON 2 – I. PEJIĆ 21 Agricultural Institute Osijek, Južno predgrađe 17, HR-31000 Osijek, Croatia2 University of Zagreb, Faculty of agriculture, Svetošimunska cesta 25, 10000 Zagreb, CroatiaAbstract Breeders around the globe consider breeding for abiotic stress tolerance as something thatpreoccupies their attention more than ever before. Also, the malting industry has some specific demandstowards barley quality improvement. A total of 126 barley cultivars, 78 winter and 48 spring types fromdifferent backgrounds, were screened by SSR markers in order to assess genetic variability among them.Croatian barley cultivars are represented by 66 winter and 27 spring types (total 93). The preliminary datapresented in this paper are derived for markers Bmac181 (chr. 4H), Bmag211 (chr. 1H), EBmac755 (chr. 7H)and HVM54 (chr. 2H). All of them are linked to certain QTLs, either for abiotic stress tolerance or quality,published in a number of studies done on different populations. Specified QTLs are for drought tolerance(pinpointed by markers Bmac181 and EBmac755), viscosity (Bmag211) and hull content (HVM54). Thenumber of alleles per SSR locus averaged 5.5 among elite breeding lines. A number of cultivars for whichspecific allele amplification has been successful, were selected and their distribution displayed. This type ofassay will be useful for determination of the informativeness level of SSR markers used when generating ameaningful classification of elite germplasm. Also, some pointers considering carriers of QTLs of interest canbe highlighted for the future selection of parental lines in the hybridization process.Key words: barley, abiotic stress, quality, SSR, QTLIntroductionIt is well known that barley (Hordeum vulgare L.) is one of the most important cropspecies in the world, and also one of the most representative cereals grown nowadays.Barley also has different roles (dual-role) dependant on what will be its purpose, whetherwe use it for animal and/or human consumption or as a raw material in brewing andpharmaceutical industry. It is thought that it originated from H. vulgare L. ssp.spontaneum which resides even today in the area of the Fertile Crescent (Nevo, 1992).Because of its origin and vast diversity, barley is considered to be relatively resistant towater deficit in general, even though it has the least developed root system incomparison to other small cereals. More knowledge regarding the genetic structure ofbreeding materials could help to maintain genetic diversity, which would sustain longtermselection responses and reduce vulnerability of breeding pograms in that matter(Troyer et al. 1998; Liu et al. 2000). Results of this work will provide some better widthand understanding of germplasm compiled mostly of Croatian cultivars and comparingand detecting the ones which are potential carriers of QTLs for drought tolerance andquality.Material and methodsA total of 126 barley (Hordeum vulgare L.) cultivars (78 winter and 48 spring type) fromdifferent background were screened by SSR markers in order to assess genetic variabilityamong them. Group of Croatian barley cultivars consists of 66 winter and 27 springtypes (total 93). DNA was isolated by CTAB method (Doyle and Doyle, 1990) from leaftissue grown from three seeds (for every sample/cultivar) sown into plastic containerfilled with substrate. Before DNA isolation, the tissue needed to be lyophilized andgrounded with steel beads in order to get powdery texture of the sample. After isolationthe concentration of genome DNA was determined by spectrophotometer. Amplification127

AGRISAFE Budapest, Hungary, 2011process (PCR reaction in Veriti Thermal Cycler, Applied Biosystems) of microsatellitemarkers was carried according to Liu et al. (1996) and Li et al. (2003). PCR productswere then being analyzed with genetic analyzer (ABI 3130 - size standard used:GeneScan 500LIZ, Applied Biosystems) and data was retrieved afterwards viaGeneMapper 4.0 (Applied Biosystems) software.In order to make results valid in this paper and comparable to some point, anothermethod of data collection and analysis has been used in a way of choosing a subset ofwinter barley cultivars (14) where we collated their yield stability parameter withseasonal vegetation periods of accentuated drought stress. In this way a simple patternmechanism is devised which helps determine varieties which have proven themselves asdrought tolerant or susceptible through long term research in situ, combining them withdata collected by SSR marker analysis. Subset of cultivars consists from number ofvarieties which originate from Agricultural Institute Osijek – Croatia (Sladoran, Rex,Zlatko, Titan, Prometej, Barun, Spartak, Bingo, Lord and Princ), BC Institute fromZagreb – Croatia (Favorit), Germany (Tiffany and Vanessa) and France (Plaisant).Software used for data analysis: IRRISTAT, IRRI of Manila, for AMMI1 and AMMI2bi-plot analysis. These trials were set on the locality Osijek and seasonal periodsincluded in data comparison last from the season of 2002/2003 till 2009/2010. Also, todetermine which samples have high grain quality and suspected QTLs for the trait, weincluded spring barley cultivars well known for their high potential in this matter andgrouped samples which posses the same set of alleles. Briefly said, the focus ondetermining drought stress is on barley winter types and quality on spring types. Thereason for this approach is in the fact that winter barley has prolonged vegetation andtherefore it is much likely to be longer under negative influence of water deficiencywhich, at the end, greatly impacts yield. On the other hand when we speak about quality,the spring barley cultivars have the edge over winter types, according to brewingindustry data and demands.Results and discussion1.51.42006/2007Tiffany2002/20030.920.96FavoritVanessa2005/2006PrincLord0.42BarunRex0.442008/2009Bingo Spartak VanessaIPCA1PlaisantSpartak 2006/20072003/20042002/2003IPCA2-0.12PrincSladoran2007/2008RexTitanBingo Barun-0.04Tiffany2009/2010FavoritSladoran ZlatkoZlatko Lo-0.66 2004/20052004/20052003/2004 Prometej Titan2005/2006-0.522009/20102008/2009-1.2Prometej2007/20085.9 6.82 7.74 8.66 9.58 10.5Plaisant-1MEANS, t/ha-1.2 -0.66 -0.12 0.42 0.961.5IPCA1Figure 1. AMMI2 and AMMI1 biplot models of adaptability and stability of cultivars (subset of 14 wintertypes) for grain yield; variety – year (blue – years with over the average rainfall and below averagetemperature; red – years with below average rainfall and over the average temperature; black – years withaverage rainfall and temperature)128

Budapest, Hungary, 2011AGRISAFEResults (Figure 1.) clearly display when drought took place by seasonal overview.Seasons 2002/2003, 2006/2007 and 2008/2009 were overall dry seasons with waterdeficit and sometimes extremely high temperatures throughout the whole vegetationperiod, or through some certain key vegetation growth stages (tillering, flowering, etc.).The most extreme was the season of 2002/2003, and it was used as a reference point fordetermining the adaptable and stable cultivars. One can see (Figure 1.) that foreigncultivars Tiffany and especially Vanessa showed very good adaptability towardsstressful conditions under the season of 2002/2003. This is in accordance to their SSRprofiles shown by Bmac181 and EBmac755 which are the same (Vanessa and Tiffany:Bmac181 – 180 bp allele; EBmac755 – 136 bp allele). This type of SSR signature canalso be found on Croatian cultivar Lord where by pedigree one of the parents is varietyPlaisant with almost the same SSR profile (Bmac181 – 180 bp allele; EBmac755 – 138bp allele). Both of these varieties show similar response to yield stability (AMMI1 biplotmodel – low IPCA1 values!) and little less to adaptability (Lord is more adaptable)which is logically sound considering Plaisant being foreign cultivar. Interestingly,Croatian cultivar Rex is, according to results, one of the most adaptable cultivars in thisresearch even though its SSR profiling is somewhat different then the ones mentionedabove (Bmac181 – 178 bp allele; EBmac755 – 136 bp allele). But pedigree inquiryshows that Rex also has some foreign germplasm within, to be precise a genotype alsoincluded in SSR profiling, by the name Alpha (Bmac181 – 180 bp allele; EBmac755 –136 bp allele) of French origin (Rex: DORAT//ALPHA/MURSA/3/OSK.5-59-6-7); infact, most of Croatian cultivars show differences in allele length on locus Bmac181(Croatian cultivars – 178 and 176 bp allele length; foreign cultivars (mostly German andFrench) – 180 bp allele length). We may conclude that cultivars mentioned above dopossess excellent adaptability towards weather imposed drought stress, especiallyvarieties Rex and Vanessa. Also, this conclusion is concurrent with SSR data acquiredwhere common signature for the two loci can be found (Bmac181 – 180 bp and/orEBmac755 – 136 bp). Ivandic et al. (2003.) stated detection of highly significantassociations at the loci Bmac181 on chromosome 4H for water stress tolerance in barley,explaining that this locus expresses additional effects for grain yield under wellwateredconditions and in an adaptive response to water stress. Chen et al. (2010) used, amongothers, molecular marker EBmac755 placed on chromosome 7H for barley QTLmapping of traits controlling drought resistance, where it was found that this specificmarker is in close proximity to wilting time trait closely related to osmolarity. Chen et al.(2010) further pointed out the importance of mechanism where high osmolarity means alow osmotic potential that results in postponing of plant wilting. I the midst of all this wecan conclude that it is possible to determine carriers for drought tolerance QTLs amongcultivars which partake about 21.8% (17) of the whole number of 78 winter barleycultivars screened in this paper.Spring barley cultivars were screened with SSR markers (Bmag211 – chr. 1H andHVM54 – chr. 2H) to determine the potential carriers of desirable traits among them.Regions on chromosome 1H are well known for their associations with malt extract andother malting attributes (Marquez-Cedillo et al. 2000; Collins et al. 2003; Coventry et al.2003; Panozzo et al. 2003). First of all, distinct foreign high quality (malting) barleygenotypes were determined in order to establish a possible pattern within SSR data.“Pattern group” consists from four high quality cultivars: Triumph (Bmag211 – 184 bpallele; HVM54 – 161 bp allele), Scarlett (Bmag211 – 182 bp allele; HVM54 – 161 bp129

AGRISAFE Budapest, Hungary, 2011allele), Prestige (Bmag211 – 182 bp allele; HVM54 – 145 bp allele) and Barke(Bmag211 – 186 bp allele; HVM54 – 157 bp allele). Genomic region of Bmag211 hasbeen reported to be linked with viscosity trait (Raman et al., 2003) and we can also try todetermine which ones of 48 spring barley cultivars possess the same sized allele. Aninteresting parallel occurred because only about 19% (9) from the whole number ofcultivars have 182 and 186 bp allele size, and seven of those have very high values ofviscosity documented. Screenings for hull content also showed congruent results, almost65% (34) of cultivars examined showed 145 and 161 bp allele size. Von Korff et al.(2008) state that as viscosity and friability are mainly affected by the breakdown of b-glucan and other cell wall polysaccharides, genes affecting b-glucan or b-glucanaseactivity may underlie the QTLs detected for viscosity and friability. It is necessary topoint out the need for further investigation of these samples (48) in order to collect andanalyze data for viscosity and hull content traits to confirm displayed presumptions.ConclusionsThe results hereby shown are very promising and can be used to give certain pointers forSSR markers used. Nevertheless, further analysis of data is needed, and also data fromfield trials and laboratory tests must be obtained in order to achieve clear and broadpicture of germplasm involved. In addition, it will be possible to determine and displaygroups of elite barley lines who presumably carry QTL’s for traits of interest, fromwhich parental lines can be picked for development of future breeding populations.ReferencesChen, G., Krugman, T., Fahima, T.,. Chen, K, Hu, Y., Roder, M., Nevo, E., Korol, A. (2010): Chromosomalregions controlling seedling drought resistance in Israeli wild barley, Hordeum spontaneum C. Koch.Genet Resour Crop Evol, 57, 85–99Collins, H.M., Panozzo, J., Logue, S.J., Jefferies, S.P. and Barr, A.R. (2003): Australian Journal ofAgricultural Research 54Doyle, J.J. and. Doyle. J.L. (1990): Isolation of plant DNA from fresh tissue. Focus 12, 13-15.Ivandic, V., Thomas, W.T.B., Nevo, E., Zhang, Z. and Forster, B.P. (2003): Associations of simple sequencerepeats with quantitative trait variation including biotic and abiotic stress tolerance in Hordeumspontaneum. Plant Breeding, 122, 300-304Li, J.Z., Sjakste, T.G., Roder, M.S., M. W. (2003): Ganal Development and genetic mapping of 127 newmicrosatellite markers in barley. Theor Appl Genet, 107, 1021–1027Liu, Z.W., Biyashev, R.M., Saghai Maroof, M.A. (1996): Development of simple sequence repeat DNAmarkers and their integration into a barley linkage map. Theor. Appl .Genet., 93, 869–876Marquez-Cedillo, L.A., Hayes, P.M., Kleinhofs, A., Legge, W.G., Rossnagel, B.G., Sato, K.,Ullrich, S.E.,Wesenberg, D.M. and the NABGMP (2000): Theoretical and Applied Genetics 101, 173-184.Nevo, E. (1992): Origin, evolution, population genetics and resources for breeding of wild barley, Horedumspontaneum, in the Fertile Crescent. In Barley: Genetics, biochemistry, molecular biology andbiotechnology. Edited by Peter Shewry CAB International Press, London. pp. 19-43.Panozzo, J.F., Lim, O., Eckermann, P., Moody, D., Barr, A., Karakousis, A., Chalmers, K. and Cullis, B.R.(2003): Australian Journal of Agricultural Research 54Raman, H., Venkatanagappa, S., Rehman, A., O'Bree, B. and Read, B. (2003): Graphical genotyping of barleyusing molecular markers linked with malting quality, disease resistance and Al tolerance. BarleyTechnical/Cereal Chemistry 7 – 10 September 2003Troyer, A.F., Openshaw, S.J., and Knittle, K.H. (1998): Measurement of genetic diversity among popularcommercial corn hybrids. Crop Sci. 28, 481–485.von Korff, M., Wang, H., Leon, J., Pillen, K. (2008): AB-QTL analysis in spring barley: III. Identification ofexotic alleles for the improvement of malting quality in spring barley (H. vulgare ssp. spontaneum). MolBreeding 21, 81–93130

Budapest, Hungary, 2011AGRISAFESTUDIES ON THE HEAT TOLERANCE OF A DOUBLEDHAPLOID POPULATION OF MICROSPORE ORIGINK. BALLA – I. KARSAI – Z. BEDŐ – O. VEISZAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary,ballak@mail.mgki.huAbstract A mapping population was created from two varieties considered to be heat-tolerant (Mv Magma)and heat-sensitive (Plainsman V.) in order to study heat stress tolerance and gain a more detailed understandingof the genetic background. After crossing the parental lines, anther cultures were initiated from the F 1generation, resulting in a population consisting of 174 doubled haploid (DH) lines. The heat tolerance of theDH lines was tested during the early stages of grain development, by subjecting them to high temperaturestarting on the 6 th day after heading. Six plants were examined for each line, three of which represented thecontrol, grown under normal conditions in the greenhouse at 19–25ºC, while the other three were exposed toheat treatment at 35ºC for 15 days in the heat stress chamber of the phytotron.The chlorophyll content of the plants was recorded at the end of the heat treatment. When the yellowing of theflag leaves was detected using a Spad Minolta instrument, considerable differences were observed between theresponses of the DH lines, some of which exhibited significant yellowing, while others had good tolerance ofheat stress. After the plants reached harvest maturity, measurements were made on the grain yield, biomass,grain number, thousand-kernel weight and harvest index of each plant. Averaged over the population, hightemperature in the early stage of embryo development was found to cause the greatest reduction in the grainnumber, but considerable differences were observed between the lines. For the majority of lines the grainnumber dropped by 30–40% compared to the control, but the figures for the individual lines ranged from 3–75%. The first step in genetic analysis was bulk segregant analysis, which revealed clearly distinct differencesbetween the heat-sensitive and heat-tolerant bulk samples not only for grain number, but also for yield,biomass, thousand-kernel weight and harvest index.Key words: wheat, doubled haploid population, heat tolerance, grain number, grain yieldIntroductionWeather extremes such as high temperature are now a frequently occurring form ofabiotic stress and cause considerable problems for crop production. It is a well-knownfact that above-optimum temperatures lead to yield reduction and quality deteriorationthrough the blocking of various physiological processes (Fokar et al., 1998; Maestri etal., 2002; Wardlaw et al., 2002). Yield reductions are influenced by the interaction of anumber of processes, including accelerated development and reduced photosynthesis,which occurs due to damage to photosystem II (PSII) (Paulsen, 1994) or to the inhibitionof the Rubisco activase enzyme (Law and Crafts-Brndner, 1999). Yield losses may alsobe induced by enhanced respiration or by the collapse of the respiration system (Lin andMarkhart, 1990) or by a decrease in starch synthesis in the developing grains. Thedamage caused by high temperature is greatly influenced by the developmental stage ofthe plants (Paulsen, 1994). When the stress occurs at the beginning of flowering orduring the development of the spikelets, it reduces the number of potential grains.Applying heat stress treatment during grain filling, on the other hand, influences thetranslocation of photosynthetic assimilates, starch synthesis and the accumulation ofstarch in the grains, thus causing changes in grain quality and weight (Bhullar andJenner, 1985).The first aim of the experiment was to determine the heat tolerance of different lines in adoubled haploid population during the early stages of grain filling by recording yieldsand phenological traits (chlorophyll content; Spad-502 Minolta). The second aim was thegenetic analysis of heat-sensitive and heat-tolerant plants by means of bulk segregantanalysis.131

AGRISAFE Budapest, Hungary, 2011Materials and methodsA population consisting of 174 doubled haploid (DH) lines was developed using theanther culture technique from the F 1 generation of a cross between parental lines foundto be heat-tolerant (Mv Magma) and heat-sensitive (Plainsman V).Depending on the number of DH 0 kernels available, 4–6 plants were raised from eachline under greenhouse conditions, giving a total of 863 plants. Heading was recordeddaily and those heading at approximately the same time were exposed to heat stress onthe 6 th day after heading, in the early stages of grain development. For lines where sixplants were available, three were raised under normal conditions (at 19–25°C) in thegreenhouse, while the other three were treated at 35/20°C (8/16 h) in the heat stresschamber (Conviron PGV-36) of the phytotron (Tischner et al., 1997). The light intensityduring treatment was 350 µmol/m 2 /s.After the plants were returned to the greenhouse, the yellowing of the flag leaves wascharacterised by recording the chlorophyll content, using a Spad-502 Minoltainstrument. When harvest maturity was reached, measurements were made on the yield,biomass, thousand-kernel weight, grain number and harvest index of the plants.The results were analysed as a percentage of the control on histograms (frequencydistribution curves).Results and discussionThe 15-day heat stress treatment caused substantial changes, averaged over the doubledhaploid population. With the exception of main spike mass, significant reductions wereinduced by high temperature treatment in the yield, grain number, harvest index,thousand-kernel weight and biomass (Table 1). In the case of grain mass, grain numberand biomass the lowest values recorded did not differ significantly from those in thecontrol, but the highest values were substantially lower in the heat treatment, with theexception of main spike mass. This confirms the findings of Blum et al. (2001), whoreported that a set of random inbred lines (RIL) responded with a significant yielddecrease to heat stress.The significant decline in the chlorophyll content of the flag leaves also reflected thediverse heat tolerance levels of the lines (Table 1). The results demonstrated that thepopulation included lines capable of remaining almost as green after heat treatment asthe control plants (Fig. 2).The parameters tested revealed that, averaged over the population, high temperature inthe early stages of embryo development caused the greatest reduction in the grainnumber. Nevertheless, substantial differences could be detected between individual lines(Fig. 1A). It was demonstrated by Mohammadi et al. (2004) that exposure to a day/nighttemperature of 35/30°C for 3 days, starting 10 days after flowering, caused a severereduction in the weight of the kernels and spikes. However, these authors observed nochange in the number of grains, in contrast with the present results, where the grainnumber of most lines was reduced by 30–40% compared with the control, though thesevalues ranged from 3–75% over the whole population (Fig. 1B).When the mean grain numbers of the two bulks (heat-tolerant and heat-sensitive) werecompared in the control and heat stress treatments, significant differences were detectedin the heat stress responses of the two groups. Under control conditions there was nosignificant difference between the grain numbers of the heat-sensitive and heat-tolerant132

Budapest, Hungary, 2011AGRISAFEbulks. In the case of heat stress, on the other hand, the grain number of the heat-sensitivebulk exhibited a great decrease, while that of the heat-tolerant bulk was unaffected.The lines forming the heat-sensitive and heat-tolerant groups in the bulk segregantanalysis could be clearly distinguished from each other not only on the basis of grainnumber, but also in terms of yield, biomass, thousand-kernel weight and harvest index.Table 1Changes induced by heat stress in the chlorophyll content and yield of the doubled haploid populationControl Heat stress LSD 5%ParametersMean Range Mean RangeChlorophyll content 45.65 39.6–51.7 23.65* 2.8*–44.5* 1.5Main spike mass (g) 1.8 0.8–2.8 1.7 1.0–2.4 0.5Grain yield (g) 3.55 1.4–5.7 2.39* 1.3–3.5* 0.1Thousand-kernel weight (g) 32.8 24.6–41.1 23.45* 14.6*–32.3* 0.6Grain number 119.15 48.3–190.0 88.6* 46–131.3* 4.9Harvest index 47.55 35.7–59.4 37.15* 25.3*–49.0* 1.3Biomass (g) 7.25 4.3–10.2 5.8* 4.2–7.4* 0.2Frequency of DH lines (%)2520151050AMv MagmaPlainsman V.30 40 50 60 70 80 90 100Grain number Növény per szemszám plant as a a % kontroll of the control %-DH vonalak gyakorisága (db)Frequency of DH lines (%)B121086420Heat-sensitive Heat-tolerantPlainsman V.Mv Magma30 40 50 60 70 80 90 100 110 120 130Grain Szemszám number per a plant kontroll as a %-ban % of the controlFigure 1. Effect of heat stress on the grain number of the whole doubled haploid population (A) andthe frequency distribution of grain number in the heat-tolerant and heat-sensitive bulks (B)10Heat-sensitiveHeat-tolerantFrequency of DH lines (%)9876543210Plainsman V.Mv Magma10 20 30 40 50 60 70 80 90 100Chlorophyll content as a % of the controlFigure 2. Frequency distribution of chlorophyll content in heat-sensitive and heat-tolerant linesConclusionsThe genetic population created for the purpose of this work revealed considerablevariability for tolerance of heat stress, thus allowing it to be used to investigate thegenetic background of heat tolerance.133

AGRISAFE Budapest, Hungary, 2011AcknowledgementsThis paper was funded from the DROPS Project (EU-FP7 No. 244374) and theAGRISAFE Project (EU-FP7-REGPOT 2007-1 No. 203288).ReferencesBhullar, S. S., Jenner, C. F. (1985): Differential responses to high temperature of starch and nitrogenaccumulation in the grain of four cultivars of wheat. Aust. J. Plant Physiol., 12, 363–375.Blum, A., Klueva, N., Nguyen, H. T. (2001): Wheat cellular thermotolerance is related to yield under heatstress. Euphytica, 117, 117–123.Fokar, M., Nguyen, T., Blum, A. (1998): Heat tolerance in spring wheat. II. Grain filling. Euphytica, 104, 1–8.Law, R. D., Crafts-Brandner, S. J. (1999): Inhibition and acclimation of photosynthesis to heat stress is closelycorrelated with activation of ribulose-1,5-bisphosphate carboxylase/oxygenase. Plant Physiol., 120, 173–181.Lin, T. Y., Markhart, A. H. (1990): Temperature effects on mitochondrial respiration in Phaseolus acutifoliusA. Gray and Phaseolus vulgaris L. Plant Physiol., 94, 54–58.Maestri, E., Natalya, K., Perrotta, C., Gulli, M., Nguyen, H., Marmiroli, N. (2002): Molecular genetics of heattolerance and heat shock proteins in cereals. Plant Mol. Biol., 48, 667–81.Mohammadi, V., Qannadha, M. R., Zali, A. A., Yazdi-Samadi, B. (2004): Effect of post anthesis heat stress onhead traits of wheat. J. Agri. Biol., 6, 42–44.Paulsen, G. M. (1994): High temperature responses of crop plants. pp: 365–389. In: Boote, K. J., Sinclair, T.R., Paulsen, G. M. (eds.), Physiology and Determination of Crop Yield. American Society of Agronomy¸WI. Madison, USA.Tischner, T., Rajkainé Végh, K., Kőszegi, B. (1997): Effect of growth medium on the growth of cereals in thephytotron. Acta Agron. Hung., 45, 187–193.Wardlaw, I. F., Blumenthal, C., Larroque, O., Wrigley, C. (2002): Contrasting effects of heat stress and heatshock on kernel weight and flour quality in wheat. Funct. Plant Biol., 29, 25–34.134

Budapest, Hungary, 2011AGRISAFEUSING INDIRECT METHODS FOR WINTER RESISTANCEESTIMATION OF WINTER WHEAT LINES AND CULTIVARSM. BATASHOVA – L. DRYZHENKO – V. TISHCHENKOResearch Plant Breeding Centre of Poltava State Agrarian Academy, str. Skovoroda 1/3, Poltava 36003Ukraine, instagro@ukr.netAbstract Global climate changes exert an influence on winter wheat cultivation, the main cereal of left-bankforest-steppe Ukraine. This region is characterized by the instability of weather conditions, especially in theautumn-winter-spring period. Thus, to obtain stable yields each year independently of winter conditions it isnecessary to use winter wheat cultivars characterized by a high level of adaptation. The breeding program forthe creation of productive winter wheat cultivars with great winter hardiness was developed in the ResearchPlant Breeding Centre for this purpose.Methods for estimating the winter hardiness of winter wheat cultivars and lines were first elaborated andimplemented in the Poltava region. It has been proposed that the main components in winter hardiness arephotoperiodic sensibility and the vernalization period. One method is to use different sowing dates and toanalyse the photoperiodic sensibility of the plants. Another is to analyse the duration of the vernalizationperiod after artificial delays in vegetation in spring time. Genotypic differences between lines are generallyreflected in the number of plants which survived and in productivity.The application of these methods in plant breeding provided an opportunity to select genotypes according tothe level of photoperiodic sensitivity and the duration of the vernalization period under specific weatherconditions. It has been established that Poltava winter wheat cultivars (Levada, Dykanka, Ukrainka poltavska,Manjelia, Sagaidak, Govtva, Vilshana, Sidor Kovpak) have a long vernalization period and strict photoperiodicsensitivity. This solves the problem of winter wheat plant outgrowing in autumn and saves plants under the icecrust and during thawing periods in winter and in low temperature conditions in early spring. In years withunfavorable weather conditions for winter wheat growing and development (low temperatures and long-termice crust) these cultivars showed a sufficiently high level of winter resistance.Key words: winter wheat, winter hardiness, photoperiodic sensitivity, duration of vernalization periodIntroductionThe researches according to indirect methods of winter hardiness estimation have beencarried out at Poltava State Agrarian Academy during last 20 years (Tishchenko et al.,2010). The method of indirect estimation of photoperiodic sensibility (PPS) and durationof vernalization period (DVP) were developed. The basis of PS estimation is sowingterms and the basis of DVP estimation is the time of renewal spring vegetation(Tishchenko et al., 2005).Winter wheat cultivars significantly are different according to duration of vernalizationperiod from 15 to 60 days and more. It is known that demand in DVP is controlled bygenes Vrd1 and Vrd2 and less demand in DVP predominates (20-30 days) (Fayt, 2007).On the other hand photoperiodic sensibility is controlled by genes Ppd1…3, dominantalleles of these genes determine neutral and weak PPS, and recessive alleles determinestrong PPS (long-day cultivars) (Fayt, 2003).PPS and DVP define significantly the level of plant adaptation to growing conditionsand especially to wintering. The differences between genotypes by these signs (PPS andDVP) appear at early developmental stages of plant. Thus, the strong PPS and long DVPdelay development of rudiments of reproductive organs during autumn period andincrease the resistance level to stress environment factors in wintering. The weak PPSand short DVP, vice versa accelerate development but in this case plants perish from thefrost although these plants are characterized by rapid spring aftergrowing.The method of photoperiodic reaction testing winter wheat cultivars is rathercomplicated under laboratory conditions and expensive. We use simpler method ofreaction testing by means of yield according to different sowing terms.135

AGRISAFE Budapest, Hungary, 2011Materials and methodsThe cultivars of Research Plant Breeding Centre of Poltava State Agrarian Academy(RPBC PSAA) and some others Ukrainian cultivars, in general 17 cultivars wereinvolved in this experiment. The experimental fields located in Poltava region, Forest-Steppe zone of Ukraine.Two sowing terms were used for studying the photoperiodic sensibility of givencultivars: the 1 st term is early term –September1; the 2 nd term is late term –October1.The optimal sowing term for winter wheat in this region is from September15 tillSeptember 25.For studying the necessity of vernalization period duration of different cultivars,Medinetz’s method has been used (Medinetz et al., 2006). According to this methodhand-made snow cover is created which delay the renewal time of spring vegetation.Hand-made snow cover was removed for two times: 17 April and 25 April. Then thenumber of survived plants on the 15 th and the 30 th day after the beginning of vegetationwas calculated. Optimal term of the beginning of spring vegetation in this region isfrom 15 March till 25 March.Results and discussionsInvestigated cultivars according to different sowing terms are divided to three groups(table 1). Cultivars of group 1 showed high yield in both sowing terms and it means thatthese cultivars are very sensitive to photoperiod. Kryzhynka cultivar is characterized byhigh sensitiveness in our experiment. These cultivars don’t overgrow under earlysowing terms. This feature is very important for producers especially under conditionsof moisture lack during autumn period.Cultivars of the group 2 showed a low yield under the early sowing term and a highyield under the late sowing term and these cultivars are genotypes with weak or neutralPPS. These cultivars also overgrow during autumn period, accumulate less sugar inleaves, thin out during winter thaw and low temperatures in spring. Under such weatherconditions cultivars of group 2 lose winter-hardiness and correspondingly have lowyield.Cultivars of the group 3 showed a high yield under the early sowing term howeverunder late sowing term can show as well high or lowered yield. These cultivars aresensitive to PPS and middle DVP. Winter wheat cultivars of this group (early sowingterm) attract attention for climatic zones with very instable weather conditions. Thesecultivars intensive grow in spring, it is very important under insufficient moistureduring the period “the beginning of spring vegetation – ear formation”. During autumnperiod these cultivars are characterized with intensive root system growth on thebackground weak development of aboveground part. These cultivars are winter-hardyand actively use winter moisture through well developed root system and that is whyare able to form high yield.Winter wheat cultivars of Research Plant Breeding Centre of Poltava State AgrarianAcademy (RPBC PSAA) according to the results are cultivars which have middle andheightened sensibility to PPS.The yield of given cultivars don’t depend on sowing terms. This fact proves high yieldsof winter wheat cultivars of Poltava breeding in the southern regions of Ukraine in 2005-2010.136

Budapest, Hungary, 2011AGRISAFEThe determination of demand in DVP in winter wheat cultivars was carried outaccording to V. Medinezt’s method of keeping hand-made snow cover (Medinetz et al.,2006).Table 1. Yield of winter wheat cultivars subject to sowing termsYield, c/haCultivarsІ sowing term(September1)ІІ sowing term(October1)Photoperiodic sensibilityVdala 31,7 43,3 neutralDovira 38,3 56,7 neutralVita 41,7 53,3 neutralElegia 41,7 60,0 neutralErmak 41,7 63,3 neutralOdeska 267 51,7 55,0 mid-sensitiveAlbatros odeskiy 50,0 58,3 mid-sensitiveMironivska 68 63,3 61,7 mid-sensitiveKryzhynka 68,3 70,0 high-sensitiveCultivars of RPBC PSAA breedingKolomak 5 46,7 65,0 mid-sensitiveUkrainka poltavska 55,0 65,0 mid-sensitiveLevada 55,0 71,7 mid-sensitiveDykanka 53,3 76,7 mid-sensitiveGovtva 60,0 66,7 mid-sensitiveSidor Kovpak 50,0 76,7 mid-sensitiveVilshana 48,3 58,3 mid-sensitiveSagaydak 63,3 76,7 mid-sensitiveIt has been established that cultivars which showed high percentage survived plants onthe 30 th day after removing snow cover are characterized elongated DVP. Thosecultivars which showed total plant loss on the 30 th day is characterized by short DVP.The cultivars which showed 50% of survived plants are characterized by middle periodof vernalization.The table 1 demonstrates that cultivars with neutral PPS demand the short vernalizationperiod. Whereas sensitive PPS cultivars demand middle and elongated vernalizationperiod.Table 2. Indirect estimation of DVP by full ear number after forced delay of spring vegetationThe number of earsCultivars Natural conditionDelay of vegetationTill 17 AprilTill 25 AprilAlbatros odeskiy 283,8 217,8 (76,7) 178,2Kolomak 3 330,0 323,4 (98,0) 224,4Kolomak 5 360,0 330,8 (91,9) 204,6Ukrainka poltavska 363,0 290,4 (80,0) 145,2Levada 343,2 250,8 (73,0) 138,6Dykanka 448,8 369,6 (82,4) 171,8Manjelia 330,0 217,8 (66,0) 151,8Govtva 448,8 277,2 (61,8) 151,8Sidor Kovpak 440,0 270,2 (61,4) 160,8Vilshana 290,4 264,0 (90,9) 151,8Sagaydak 310,2 297,0 (95,7) 231,0137

AGRISAFE Budapest, Hungary, 2011To confirm the conclusions about demands in DVP we calculate additionally thenumber of full ears. Such indirect method of estimation of demand in DVP presents aview of influence of vernalization period on productivity (table 2).All given cultivars showed the high percentage of survived plants after delay vegetationtill 17 April (from 61% to 98%). Thus these cultivars need the middle or elongatedvernalization period.ConclusionsBecause of unfavourable climatic conditions during autumn-winter-spring period thespecial method of determination of winter hardiness of winter wheat cultivars and linesis used in our Centre. The sign of winter hardiness was divided into such componentsas PPS and DVP.The yield estimation of cultivars according to different sowing terms and forced delay ofspring vegetation give possibilities to select genotypes and estimate lines and cultivarsusing the level of PPS and DVP for special weather conditions. The estimation of winterhardiness for winter wheat cultivars of PSAA breeding is given. It has been establishedthat Poltava winter wheat cultivars (Levada, Dykanka, Ukrainka poltavska, Manjelia,Sagaidak, Govtva, Vilshana, Sidor Kovpak) have long vernalization period and strictphotoperiodic sensibility. It allow to solve the problem of winter wheat plant outgrowingin autumn and save plants under ice crust and in the period of thaw in winter and in lowtemperature in early spring. In years with unfavorable weather conditions for winterwheat growing and development (low temperatures and long-term ice crust) thesecultivars showed sufficiently high level of winter resistance.ReferencesFayt, V. (2003): Genetic system of difference control of vernalization duration in winter common wheat.Cytology and genetics, 37, 5, 57-64.Fayt, V. (2007): Effect of vernalization duratuion control genes (Vrd) on agronomical traits in winter breadwheat. Cytology and genetics, 41, 5, 18-26.Medinetz, V.D., Sleptzov, V.A., (2006): The ecology of spring development of winter wheat., Poltava. (rus)Tishchenko, V., Batashova, M., Chekalin, N. (2010): Main directions of adaptive breeding of winter wheat forForest-Steppe conditions in Ukraine. Abstracts of 8th International wheat conference, St.Petersburg,Russia, 404.Tishchenko, V., Chekalin, N. (2005): The genetic basis of adaptive breeding of winter wheat in the conditionsof Forest-Steppe zone. Poltava. (rus)138

Budapest, Hungary, 2011AGRISAFECHANGE IN CROP PHYSIOLOGICAL PARAMETERS IN AWATER-DEFICIENT ENVIRONMENTSZ. BENCZE – Z. BAMBERGER – T. JANDA – K. BALLA – O. VEISZAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, HungaryAbstract Five cereal varieties (bread wheat, barley and durum wheat) were grown in pots in the phytotron andsubjected to water withdrawal for 7 days during grain-filling. The rate of leaf water loss under drought variedgreatly among the genotypes, influencing the onset of changes in the antioxidant enzyme activities. The largestincreases were recorded for the ascorbate peroxidase (APX), catalase (CAT) and glutathione reductase (GR)activities. Although the most resistant variety had the highest activity for APX, CAT, GR and glutathione-Stransferase(GST), which did not rise further in response to drought, and the most susceptible variety had thelowest values, which increased to the greatest extent under drought, the level of sensitivity could not bepredicted for all the genotypes from the enzyme activity values alone. Stability in the activity of antioxidantenzymes over a wide range of soil moisture content was a better indicator of good tolerance to drought thaneither basic or stress-induced levels or the extent of increase due to drought.Key words: cereals, drought stress, antioxidant enzyme activitiesIntroductionThe last 200 years of extended human activity has resulted in an accelerating rate ofchange in global climatic processes. Many parts of the world are already suffering theconsequences of a 0.76°C rise in the global mean surface temperature since 1850, whileweather anomalies also became more and more frequent and intense during the lastcentury. Water shortage has become a major limiting factor for crop production.Early responses of plants to water deficit include the accumulation of physiologicallyactive compounds, osmolytes, in the cells, helping the organs to retain water (Kameliand Lösel, 1993, Sarker et al., 1999, Niedzwieds-Siegien et al., 2004) Stomatal closureaimed at preventing water loss through transpiration may, however, result in theinhibition of CO 2 exchange, leading to reduced assimilation. The lack of equilibriumbetween electron transport and CO 2 fixation may lead to electrons being transferred toO 2 molecules. Although these mechanisms protect the components of the electrontransport chain from photodamage, the reactive oxygen species (ROS) may react withcell materials. Acting as signals, ROS are able, directly or indirectly, to induce a varietyof genes involved in stress signalling (Apel and Hirt, 2004, Pogány et al., 2006).Investigations involving wheat species and varieties have detected increases in theactivity of glutathione reductase (GR), superoxide dismutase (SOD), catalase (CAT),ascorbate peroxidase (APX), and non-specific peroxidase (guaiacol peroxidase, POD) asa result of water deficiency but the changes in the functioning of these enzymes arediverse (Zhang and Kirkham, 1984, Sairam and Saxena, 2000, Keles et al., 2002,Almeselmani et al., 2009, Takele and Farrant, 2009).The aim of the experiment was to characterize the relationship between drought stresstolerance in terms of water retention, and changes in the antioxidant enzyme system, andto determine whether it has a predictive value.Materials and methodsThe drought stress tolerance of crops was investigated in PGV-36 growth chambers inthe phytotron. Winter wheat (Mv Mambo, Mv Regiment), spring wheat (Lona), winterdurum (Mv Makaroni) and winter barley (Petra) varieties were selected for the tests.Four seedlings in the one-leaf stage were planted in each 3-litre pot directly (spring139

AGRISAFE Budapest, Hungary, 2011wheat) or after vernalization (winter genotypes). Water was withheld for seven daysstarting from the 10 th day after the heading of each genotype. The change in the soilmoisture content was monitored throughout the experiment with an Em50 data loggerand EC-5 soil moisture sensors (ECH2O equipment, Decagon Devices, USA). A soilvolumetric water content (VWC) of 20-30% was taken as the control. During waterstress the soil moisture content decreased to around 6 VWC%. Flag leaf samples werecollected and analysed for absolute water content and the activity of glutathionereductase (GR), glutathione-S-transferase (GST), guaiacol peroxidase (POD), catalase(CAT) and ascorbate peroxidase (APX) at various soil moisture levels (Janda et al.,2008).Results and discussionThe varieties showed differences in water retention, which became clearly visible undervery intense drought. Genotypes more sensitive to water shortage started to wither 3-4days after the beginning of drought stress. The most susceptible variety, Petra, exhibiteda severe drop in the flag leaf water content, while Lona did slightly better. In MvMakaroni, wilting started a little later, on day 4. Winter wheat varieties tolerated waterwithdrawal the best. Mv Regiment did not start to wilt until the 5-6 th day, while MvMambo proved to have excellent drought resistance, as it was able to maintain normalfunctioning till the 6 th day and its water loss was minimal even when water stress wasmost intense.Similarly to the water retention data, considerable variation was found among thegenotypes in the antioxidant enzyme activities, even at the control soil water supply level(Fig. 1). Wheat varieties had the highest basic enzyme activities, while in the otherspecies (durum and barley) the activities were about half this value or even less. Thissuggested that the basic antioxidant enzyme activities were more dependent on thecharacteristics of the species than on the drought tolerance ability of the genotype.Accordingly, the largest increases were observed in genotypes which had low initialactivities, but only when physiological constraints had evolved.The results found here are in accordance with previous findings, where tolerantgenotypes tended to have higher antioxidant enzyme activities at control water levelsthan susceptible ones (Sairam and Saxena, 2000, Sairam and Srivastava, 2001, Khanna-Chopra and Selote, 2007), though there were also exceptions for the enzymesinvestigated (SOD, GR and CAT) for individual genotypes of wheat (Sairam andSrivastava, 2001). This discrepancy was confirmed in the present work. Varieties withlower antioxidant enzyme activities were among the less tolerant ones and the mostsensitive variety (Petra) had the lowest activities for all the enzymes, which increasedunder drought to the highest extent of all the genotypes (Fig. 1).At the same time, the most tolerant variety (Mv Mambo) had one of the highestantioxidant enzyme activities at control soil moisture and water withdrawal did not causesignificant changes in the activities except that of GST. For peroxidase (POD), however,the second most sensitive variety, Lona, had the highest activity even under controlconditions, which did not change due to water stress, while the activities of APX, GST,CAT and GR increased moderately with drought stress. Like Lona at normal soil waterlevel, Mv Regiment also had an outstandingly high value for POD activity, whichdecreased slightly at the beginning of drought stress but then returned to the normallevel. The GR and GST activities increased by 50% even under mild stress. APX activity140

Budapest, Hungary, 2011AGRISAFEalso exhibited a fast increase, but dropped again at low soil water levels. The CATactivity changed in a similar way, though to a lesser extent.Figure 1. Catalase (CAT), ascorbate peroxidase (APX), guaiacol peroxidase (POD), glutathione reductase(GR) and glutathione-S-transferase (GST) activities in the flag leaf of Mv Regiment (Reg), Mv Mambo(Mam), Lona (Lo), Petra (Pet) and Mv Makaroni (Mak) during water stress. Each data point represents themean of five replications. The R 2 values are given for polynomial functions.As a general response to drought stress, the increments in the activities of antioxidantenzymes were most pronounced for CAT, GR and APX. POD activity, however, was141

AGRISAFE Budapest, Hungary, 2011unchanged, while GST exhibited only a slight increase, except in Mv Mambo, where itdecreased moderately.ConclusionsThe results confirmed that the antioxidant enzymes are important in dealing with stress,although evidence was given that high antioxidant enzyme levels do not alwaysguarantee that a genotype has good tolerance to drought. In the same way, low activitydoes not always indicate that a variety has poor tolerance. Physiological characters otherthan antioxidant enzymes may be responsible for good or weak drought tolerance, suchas the effectiveness of CO 2 -binding and/or parameters influencing water retention andwater use efficiency.AcknowledgementsThis research was funded by grants from the National Scientific Research Fund (OTKAK-63369) and the European Union (EU-FP7-REGPOT-2007-1, AGRISAFE No.203288).ReferencesAlmeselmani, M., Deshmukh, P. S., Sairam, R. K. (2009): High temperature stress tolerance in wheatgenotypes: role of antioxidant defence enzymes. Acta Agron. Hung., 57, 1-14.Apel, K., Hirt, H. (2004): Reactive oxygen species: metabolism, oxidative stress and signal transduction. Ann.Rev. Plant Biol., 55, 373-399.Kameli, A., Lösel, D. M. (1993): Carbohydrates and water status in wheat plants under water stress. NewPhytol., 125, 609-614.Keles, Y., Öncel, I. (2002): Response of antioxidative defence system to temperature and water stresscombinations in wheat seedlings. Plant Sci., 163, 783-790.Khanna-Chopra, R., Selote, D. (2007): Acclimation to drought stress generates oxidative stress tolerance indrought-resistant than -susceptible wheat cultivar under field conditions. Environ. Exp. Bot., 60, 276-283.Niedzwieds-Siegien, I., Bogatek-Leszczynska, R., Côme, D., Corbineau, F. (2004): Effects of drying rate ondehydration sensitivity of excised wheat seedling shoots as related to sucrose metabolism and antioxidantenzyme activities. Plant Sci., 167, 879-888.Pogány, M., Harrach, B.D., Hafez, Y. M., Barna, B., Király, Z., Páldi, E. (2006): Role of reactive oxygenspecies in abiotic and biotic stresses in plants. Acta Phytopathol. Entomol. Hung., 41, 23-35.Sairam, R.K., Saxena, D.C. (2000): Oxidative stress and antioxidants in wheat genotypes: possible mechanismof water stress tolerance. J. Agron. Crop Sci., 184, 55-61.Sarker, A.M., Rahman, M.S., Paul, N.K. (1999): Effect of soil moisture on relative leaf water content,chlorophyll, proline and sugar accumulation in wheat, J. Agron. Crop. Sci., 183, 225-229.Sairam, R.K., Srivastava, G.C. (2001): Water stress tolerance of wheat (Triticum aestivum L.) variations inhydrogen peroxide accumulation and antioxidant activity in tolerant and susceptible genotypes. J. Agron.Crop Sci., 86, 63-70.Takele, A., Farrant, J. (2009): Enzymatic antioxidant defence mechanisms of maize and sorghum afterexposure to and recovery from pre- and post-flowering dehydration. Acta Agron. Hung., 57, 445-459.Zhang, J.X., Kirkham, M.B. (1984): Drought stress induced changes in activities of superoxide dismutase,catalase, and peroxidase in wheat species. Plant Cell Physiol., 35, 785-791.142

Budapest, Hungary, 2011AGRISAFEEFFECT OF HERBICIDES ON THE CHLOROPHYLL CONTENTOF MAIZE GENOTYPESP. BÓNIS 1 – T. ÁRENDÁS 1 – I. JÓCSÁK 1 – C. MIKECZ 1 –G. MICSKEI 1 –L. C. MARTON 21 Crop Production Department, 2 Maize Breeding Department of the Agricultural Research Institute of theHungarian Academy of Sciences, Martonvásár, Hungary e-mail: bonisp@mail.mgki.huAbstract The responses of Martonvásár inbred maize lines to normal and double rates of post-emergenceherbicides were tested under small-plot field conditions in two years. The chlorophyll a+b content ofsymptom-free ear-leaves was determined spectrophotometrically after 50% silking to determine whethervarious rates of post-emergence herbicides had any effect on the chlorophyll content at flowering. Thechlorophyll a+b content of the inbred lines was greatly dependent on the year, with values twice as high in thewet year as in the dry year. Treatment with tembotrione + isoxadifen-ethyl had no effect on the chlorophyllcontent in either year. Both rates of mesotrione + terbutylazine reduced the chlorophyll a+b content of onestress-sensitive inbred line in the dry year, but not in the wet year. In the wet year bentazone + dicambaincreased the chlorophyll content, but only for one line was this effect significant irrespective of the dose. Inthe dry year the double dose caused a significant increase in this genotype, but the chlorophyll contents of theother lines did not differ significantly from the control.Key words: chlorophyll content, maize, herbicideIntroductionHerbicide application is essential if intensive maize production is to be successful. Assome herbicides may damage certain maize genotypes under unfavourable conditions, itis advisable to check whether their application is safe before they are widely used. Thisis particularly important for the inbred lines sown for seed production, as these are wellknown to be more sensitive to environmental effects than the hybrids developed fromthem (Berzsenyi et al., 1994; Bónis et al., 2004; Green, 1998; Green and Ulrich, 1993).The damage caused by herbicides may range from alterations imperceptible to the nakedeye to clearly visible symptoms, including plant mortality. In the case of non-lethaldamage, the plants generally exhibit gradual regeneration over the vegetation period, andthe symptoms become masked or may even completely disappear. Biotic and abioticstress factors may cause pathological changes to the photosynthetic apparatus of higherplants (Almási et al., 2005). Some herbicide active agents exert their effect by inhibitingphotosynthetic processes (Kádár, 2010). One characteristic symptom of the majority ofherbicides, especially those acting as photosynthetic electron transport inhibitors, is theyellowing or whitening of the leaves (chlorosis), which is the consequence of theirreversible photodestruction of chlorophyll and other pigments (Szigeti and Vágújfalvi,1983). It was observed by Sunohara et al. (2009) that auxinic herbicides also influencethe chlorophyll content of weeds.The weather extremes occurring in some years may also have a substantial effect on theextent and duration of the abiotic stress induced by herbicides.Materials and methodsThe responses of maize inbred lines to herbicides were investigated in a small-plot fieldexperiment in Martonvásár in two years with very diverse weather conditions. In 2009,which was hotter and drier than usual, the rainfall in the growing season (173 mm) wasonly a little more than half the 30-year mean (312 mm), while the mean temperature was1.3°C higher than the 30-year mean (19°C). In 2010, however, the weather was cool143

AGRISAFE Budapest, Hungary, 2011(17.1°C) and wet (681 mm). The experiment was set up in a three-factor split-plot designwith two replications in 2009 and four replications in 2010, with an untreated controlplot for each treatment. The active agents in the herbicides were as follows: mesotrione+ terbutylazine, bentazone + dicamba, tembotrione+ isoxadifen-ethyl. The treatmentsare presented in Table 1.Table 1. Treatments in the herbicide sensitivity experimentDose ( l a.i. ha -1 )TreatmentNormal Double1. Control - -2. Mesotrione + Terbutylazine 140 + 660 660 + 13203. Bentazone + Dicamba 960 + 270 1920 + 5404. Tembotrione + Isoxadifen-ethyl 99 + 49.5 198 + 99The herbicides were applied post-emergence in the 5–7-leaf stage of three Martonvásármaize inbred lines (Line 1, Line 2, Line 3) using the maximum recommended dose anddouble this dose. Samples were taken after 50% silking from symptom-free ear-leaves.The chlorophyll a+b content was recorded with a Hitachi U-1500 spectrophotometerusing the method of Arnon (1949) in order to determine whether various doses of postemergenceherbicides had any detectable effect on the chlorophyll content duringflowering. The data were evaluated with two- and three-factor analysis of variance usingthe M-STAT C program.Results and discussionThree-factor analysis of variance (Table 2) revealed that the chlorophyll content of themaize leaves was affected to the greatest effect by the genotype in both years and thiseffect was significant at the P=0.1% level. The herbicides had no significant effect in thedry year, while in the wet year they significantly influenced the chlorophyll content ofmaize leaves at the P=0.1% level. The results showed that the herbicide dose had thesmallest effect, which was not significant in either year, averaged over lines and activeingredients.The effect of year and herbicide treatment on the chlorophyll content of inbred lines isillustrated in Figure 1 as a function of the application rate. The decisive effect of the yearis shown by the fact that the chlorophyll a+b content of the ear-leaf was more than twiceas high in 2010 than in the dry year. In 2009 a rise in the mesotrione + terbutylazine dosecaused a significant reduction in the chlorophyll content compared with the control,averaged over the genotypes. In the wet year a reduction was only recorded for thedouble dose, but this was not significant. While treatment with tembotrione + antidotecaused no significant change in the chlorophyll a+b content in either year, the bentazone+ dicamba herbicide combination resulted in a significant increase in the chlorophylla+b content in 2010, averaged over the lines.In the dry year the chlorophyll a+b content of Line 1 was reduced by more than 15% bythe normal dose of mesotrione + terbutylazine and by more than 30% by the double dose(Fig. 2). In the wet year neither dose caused a significant change in the chlorophyllcontent compared with the control. The tembotrione + isoxadifen-ethyl treatment hadpractically no influence on the chlorophyll content of any of the inbred lines in eitheryear. In the wet year the bentazone + dicamba treatment increased the chlorophyllcontent in all three lines, but the rise was only significant, irrespective of the dose, in144

Budapest, Hungary, 2011AGRISAFELine 3. In the dry year a significant increase was only observed for the same genotype inthe case of the double dose, while the chlorophyll contents of the other lines did notdiffer significantly from the control.ConclusionsThe year was found to have the greatest influence on the chlorophyll content of herbicide-treated maize lines atflowering. In the wet year the chlorophyll a+b content was more than twice as high as in the dry year.In both years the line had a significant effect on the chlorophyll content, while the herbicides only influencedthe chlorophyll a+b content of the ear-leaf in the wet year. The dose had no significant effect in either year.The herbicides tested induced diverse responses from the inbred lines. Differences in the chlorophyll contentcould be detected between the lines as a function of year and active ingredient, suggesting that this methodcould be used in later stages of development to identify maize genotypes that, though they exhibit no visiblesymptoms, have not succeeded in completely neutralising the damaging effects of post-emergence herbicides.Table 2. Analysis of variance for the three-factor experimentFactor2009 2010df MQ df MQReplication 1 13654.92 3 3792.48Herbicide (A) 2 11443.35 2 668516.99***Error (a) 2 17694.30 6 47119.97Dose (B) 2 12912.97 2 60893.56A×B 4 25750.75 4 166017.30Error (b) 6 21748.37 18 56912.47Line (C) 2 306545.28*** 2 5321487.47***A×C 4 33192.66* 4 822461.21***B×C 4 13806.75 4 20218.46A×B×C 8 7996.08 8 14910.62Error (c) 18 8826.90 54 52955.58Clorophyll a+b (µḡ mg ) A35003000250020001500100050002009 2010 2009 2010 2009 2010mesotrione+terbutylazine bentazone+dicamba tembotrione+isoxadifen-e.Control Normal dose Double doseFigure 1. Effect of herbicide treatments on the chlorophyll content in different years, averaged over thegenotypes145

AGRISAFE Budapest, Hungary, 2011Inbred line 1.Inbred line 2.Relative chlorophyll content (control=100%)1201008060402002009 2010 2009 2010 2009 2010Relative chlorophyll content (control=100%) A1201008060402002009 2010 2009 2010 2009 2010mesotrione+terbuyilazine bentazone+dicamba tembotrione+isoxadifen-e.mesotrione+terbutylazine bentazone+dicamba tembotrione+isoxadifen-e.normal dosedouble dosenormal dosedouble doseRelative chlorophyll content (control=100%) A120100806040200Inbred line 3.2009 2010 2009 2010 2009 2010mesotrione+terbutylazine bentazone+dicamba tembotrione+isoxadifen-e.normal dosedouble doseFigure 2. Changes in the relative chlorophyll a+b content of inbred lines compared with the control, as afunction of herbicides and doses in different yearsAcknowledgementsThis work was funded by the AGRISAFE project (EU-FP7 REGPOT 2007-1 No. 203288).ReferencesAlmási, A., Sárvári, É., Bóka, K., Lózsa, R., Sági, Z., Gáborjányi, R. (2005): A klorofill-protein komplexváltozásai tobamovírusokkal fertőzött, eltérő rezisztencia-rezisztenciatípusú paprikanövényekben.(Changes in chlorophyll-protein complexes in tobamovirus infected pepper varieties with different levelsof resistance.) Növényvédelem, 41, 349–354.Arnon, D. I. (1959): Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Phys.,24, 1–15.Berzsenyi, Z., Bónis, P., Árendás, T., Berényi, G. (1994): Comparative investigations on the efficacy andselectivity of different herbicides in maize. Z. PflKrankh. PlfSchutz, Sonderh. 14, 457–466.Bónis, P., Árendás, T., Berzsenyi, Z., Marton, L. C. (2004): Herbicide tolerance studies on maize inbred lines.Z. PflKrankh. PlfSchutz, Sonderh. 19, 901–907.Green, J. M. (1998): Differential tolerance of corn (Zea mays) inbreds to four sulfonylurea herbicides andbentazon. Weed Technol., 12, 474–477.Green, J. M., Ulrich, J. F. (1993): Response of corn (Zea mays) inbreds and hybrids to sulfonylurea herbicides.Weed Sci. 41, 508–516.Kádár, A. (ed.) (2010): Vegyszeres gyomirtás és termésszabályozás. Private publication, 382 p.Szigeti, Z., Vágújfalvi, D. (1983): Klorofill fotooxidáció serkentése herbicidekkel és kivédése reduktánsokkal.(Enhancement of chlorophyll photooxidation with herbicides and protection against it with reductants.)Bot. Közl., 70, 159–164.146

Budapest, Hungary, 2011AGRISAFERHT GENES IN UKRAINIAN VARIETIES OF BREAD WHEATAND THEIR EFFECTS ON AGRONOMIC TRAITSG. A. CHEBOTAR 1 – S. V. CHEBOTAR 1 – I. I. MOTSNYY 2 – M.P. KULBIDA 2 –YU. M. SIVOLAP 11 South Plant Biotechnology Center NAASU, Ovidiopolskaya dor., 3, 65036 Odessa, Ukraine,e-mail: sabina-chebotar@rambler.ru2 Plant Breeding and Genetic Institute NAASU, Ovidiopolskaya dor., 3, 65036 Odessa, UkraineAbstract The complex of Rht8c and Ppd-D1a, and the Rht-B1b and Rht-D1b alleles were actively involved inbreeding programs in Plant Breeding and Genetics Institute (PBGI, Ukraine). The effects of dwarfing andphotoperiod sensitivity genes on agronomically important traits are demonstrated in material including breadwheat varieties and analogue lines.Key words: winter bread wheat, dwarfing genesIntroductionThe GA-responsive Rht8c and GA-insensitive Rht-B1b and Rht-D1b dwarfing genes arepresent in the most semidwarf Ukrainian varieties. They are used in breeding programsto overcome lodging. Lodging is an answer on the abiotic stress and the lodgingresistance has high influence on the yield. The mutations in Rht-B1 and Rht-D1 genes inwheat encode proteins involved in GA (gibberellin) signal transduction (Peng et. al.,1999). The alleles Rht-B1b and Rht-D1b lead to translation of DELLA-proteins withdeletion of several amino acids near N-terminus, that are insensitive to GA.The short arm of chromosome 2D of bread wheat carries genes important for theadaptation of wheat varieties. The dwarfing gene Rht8 and the photoperiodicinsensitivity gene Ppd-D1 are linked on the chromosome 2D (Worland et al., 1998) atthe distance 20.9 cM (Pestsova et al., 2002). The allele Ppd-D1a makes shorter durationof vegetative period that allows to avoid drought and high temperatures during the grainfilling (Fedorova, 2004).The aim of our work was to detect the Rht genes in Ukrainian varieties and to investigatetheir effects on agronomically important traits of winter bread wheat.Materials and methodsThe winter wheat varieties that were created in Ukraine in 2003-2010 years and linesanaloguescreated in the 1990 th by V.V. Khangildin on the genetic background ofhistorically well known varieties such as: Kooperatorka, Odesskaya 3, Odesskaya 51,Stepnyak in PBGI, that are genetically different in plant height and contain differentalleles of the dwarfing genes (Chebotar et al., 2010) were used.Allele characteristics of Rht8, Rht-B1, Rht-D1 – dwarfing genes in genotype have beendetected by PCR analysis according to Korzun et al. (1998) and Ellis et al. (2002, 2007)and the test for sensitivity to gibberellic acid (Börner et al., 1987) for the genotypes ofwheat varieties, analogue-lines, parental and recurrent forms. Detection of alleles Ppd-D1 gene has been done by PCR according to Beales et al. (2007).The lines were grown up in field using wide rows in 2004-2009 year conditions. Theconditions of vegetation were diverse, but generally quite favorable for winter wheat.Only in April 2009 a severe drought was observed. More rains and frosty days wererecorded in 2009 and the average temperature in the spring-summer period was higher at1º C than in 2008. During the growing season, harvesting and threshing were determinedthe following characteristics of plants: plant height (PH), stem length (h), heading date147

AGRISAFE Budapest, Hungary, 2011(DH), flowering date (DF), 1000 kernels weight (WTK), productive tillering (PT),number of kernels from the secondary ears (NSE), weight of kernels from the secondaryears (WSE), number of kernels from the plant (NKP), weight of kernels from the plant(WKP), main spike length (l), spike/stem ratio (l/h), number of spikelets in the mainspike (NSS), number of seeds in the spikelet (NKS), number of kernels in the main ear(NKM), kernel weight from the ear (KWE), spike density (D), «coefficient ofsynchronized sprouts» (Cs) (Orlyuk et al., 1989).The data for estimation of correlation characteristics were measured in 2009 andcalculated by program Statistica 8. For the correlation analysis plants were divided intothree groups (morphotypes) depending on their height: high, medium (one dwarfingallele) and dwarf (two dwarfing alleles).Results and discussionAmong winter wheat varieties created in 2003 – 2009 years 73.5 % characterized byRht-D1b, and only 21.7 % by Rht-B1b. Allele Rht8c was present in 90 % of Ukrainianwheat varieties, while Rht8a – in 5 %, the same as Rht8b. Previous investigations ofvarieties created earlier have shown that Rht-D1b allele is highly distributed in geneticpool of Ukrainian wheat varieties developed in PBGI than Rht-B1b, and that nearly 98 %of winter bread wheat varieties have Rht8c allele (Chebotar, 2008). The complex of Rht-D1b and Rht8c alleles is present in the most of wheat varieties created in the Southsteppe region after 1960.The allelic characteristic of dwarfing genes of the analogue lines was shown in theprevious investigations (Chebotar et al., 2010). PCR-analysis of Ppd-D1 alleles hasshown that the varieties which had been selected before 1960, such as Kooperatorka(1929), Gostianum 237 (1929), Odesskaya 3 (1938) and Odesskaya 16 (1958) weresensitive to photoperiod and did not carry any dwarfing gene. Semi-dwarf linesanaloguesthat have been created on the basis of these varieties carry dwarfing genesfrom the parental forms Odesskaya polukarlicovaya and Karlik 1 and are insensitive tophotoperiod.According to the four years of investigations a complex of alleles Rht8c+Ppd-D1adecreased PH by an average 15%, increased by 17% WTK and decreased the rate of thevegetation. Complex of alleles Rht8c+Ppd-D1a+Rht-B1e significantly decreased plantheight (36%) and negatively affected the WTK, reducing it by 15% in comparison withother plants of the same genetic background that have Rht8c+Ppd-D1a alleles. АlleleRht-D1b significantly decresed plants height (14,6%) in 2008 and lead to the reductionof WTK parametr by 15% compared with plants on the same background of allelesRht8c+Ppd-D1a. The complexes of dwarfing alleles and Ppd-D1a allele reduced PHstronger than individual genes (Kertez et al., 1991). Thus, the complex of allelesRht8c+Ppd-D1a+Rht-B1e decreased PH – by an average 52%, and the Rht8c+Ppd-D1a+Rht-B1b complex by 42% compared to the high and photoperiod sensitive plants.To quantify the influence of factor “Line" on the variation of investigated characteristicsthe parameter “influence of factor” (p in L) (Rokitskiy, 1973) has been used. The highestinfluence of factor “Line” was for the trait PH. The lowest influence was on KWE in2009; variability of KWE only by 6.4% is due to the genotype of line in the broad sense,while about 94% of the total variation was dependent from random factors.Analysis of phenotypic (r Ph ) and genotypic (r G ) correlations were done in 2009 accordingto statistical approach Rokitskiy (1973).148

Budapest, Hungary, 2011AGRISAFEThe significant correlations constantly by morphotype were detected between pair oftraits, the dependence between which are direct functional relationship, for example, l/D,(r Ph =- 0.53** ... -0.82**; r G =- 0.87**), or realised through close links with another trait,such as NME-KWE (r Ph = 0.49** ... 0.56**; r G = 0.26), through NKM. Exception in thiscase are pairs of DH-l/h (r Ph = 0.20** ... 0.42**; r G = 0.57**) and h-l (r Ph = 0.46** ...0.57**; r G = 0.85**). All significant phenotypic correlation coefficients between the rateof vegetation (DH and DF) and other parameters were negative (r Ph =- 0,17** ... -0,64**), except for correlations with the l parameter (r Ph = 0.27** and 0.25**) in themiddle height plants and l/h (r Ph = 0.15* ... 0.42**) in all morphotypes. A significantgenotypic correlation coefficients in these pairs of traits were positive (Table 1). Csgenotypic index did not correlate with other parameters.Table 1. Significant genotypic correlations (r G ) between investigated traitsPair of traits r G Pair of traits r G Pair of traits r G Pair of traits r Gh-PT 0.62** PT- WSE 0.60* NSE-NKS 0.70** NKP-NKS 0.74**h-l 0.83 ** PT- NKP 0.62** WSE-NKM 0.58* NKP-KWE 0.62**h-D -0.73** PT- WKP 0.57* WSE-NKS 0.63** WKP-NKM 0.64**DH-DF 0.97** NSE- NKP 0.99** WSE-NKP 0.94 ** WKP-NKS 0.74**DH-l 0.57** NSE- WKP 0.95** WSE-WKP 0.99** WKP-KWE 0.63**DF-l 0.60** NSE- NKM 0.70** WSE-KWE 0.56* NSS-l/h 0.52*PT-NSE 0.65** NSE- KWE 0.58* NKP-NKM 0.74** NKM-NKS 0.93**NKS-KWE 0.80**Root 243210-1-2-3-4Xgwm261, bp192164214-6 -4 -2 0 2 4Root 1Figure 1. Diagramm of in two roots of discriminant function of plantsdifferring by the alleles of Xgwm261. Root 1 contains a complex of the mainear traits, root 2 – a coplex of traits characterised plant development ingeneralBy the use of variance,discriminant and factoranalysis the class ofplants with Rht8c allelewas highly (97.7%)differed from plants withother alleles of Rht8 gene(tested according to theanalysis of Xgwm261 lociFig. 1). The data could beexplained by the linkageof dwarfing allele Rht8cand the photoperiodicinsensitivity allele Ppd-D1a.ConclusionsIn general the breeding program in the steppe of South Ukraine region has resulted in theRht8c and Rht-D1b dwarfing and Ppd-D1a genes in the most modern wheat varieties.The presence of Rht-D1b allele in the varieties of other regions of Ukraine is lesscommon.149

AGRISAFE Budapest, Hungary, 2011The agronomic characteristics of the lines-analogues and tall parental varieties of breadwheat installed significant differences by height, weight of thousand kernels (WTK), therate of development and yield structure elements. The lines-analogues with Ppd-D1agene were earlier in earring and flowering. The WTK parameter of line Kooperatorka K-90 was significantly higher in comparing with dwarf photoperiod insensitive lineanalogueKooperatorka K-70 and high photoperiod sensitive line Kooperatorka. Theproductivity of the main ear has had the significant impact in the yield of the tallvarieties. The influence of the secondary ears is increased in the yield structure of thedwarf or semidwarf lines, particularly, the ears of the second level (0.8 height).Comparison of phenotypic and genotypic correlations between the agronomical traitsshowed their ambiguous, but phenotypic correlations between height and productivity ofthe plants were positive independently from the morphotype. Moderate positivecorrelation between the grain number and the WTK has been revealed in the dwarfmorphotypes.ReferencesBeales, J. et al. (2007) A Pseudo-Response Regulator is misexpressed in the photoperiod insensitive Ppd-D1amutant of wheat (T. aestivum L.) Theor Appl Genet, 115, 721–733.Börner, A. et al., (1987) Preliminary results of screening for GA3 response in wheats of the Gatersleben genebank. Kulturpflanze, 35, 179–186.Chebotar, G. et al. (2010) Effects of alleles of dwarfing and Ppd-D1 genes on the agronomical traits of breadwheat. – Collection of PBGI works, 16 (56), 148–160.Chebotar, S.V. (2008) Allelic characteristic of dwarfing genes in genepool of Ukrainian winter bread wheats.Plant Genetic Recourses, 6, 96–102.Ellis, M.H. (2007) A 192 bp allele at the Xgwm261 locus is not always associated with the Rht8 dwarfing genein wheat (Triticum aestivum L.). Euphytica, 157, 209–214.Ellis, M.H. et al. (2002) “Perfect” markers for the Rht-B1b and Rht-D1b dwarfing genes in wheat. Theor. Appl.Genet., 105, 1038–1042.Fedorova, V.R. (2004) Differences of the effects of photoperiodic sensitivity genes in winter bread wheat. PhDThesis 03.00.15 – Genetics. – Оdessa, PBGI – 19 p.Flintham, J.E. et al., (1997) Optimizing wheat grain yield: effects of Rht (gibberellin-insensitive) dwarfinggenes J. Agric. Sci Camb., 128, 11–25.Kertez, Z. et al. (1991) Effects of Rht dwarfing genes on wheat grain yield and its components under EasternEuropean conditions. Cer.Res.Com., 19 (3), 297–304.Korzun, V. et al. (1998) Genetic analysis of the dwarfing gene (Rht 8) in wheat. Part I. Molecular mapping ofRht8 an the short arm of chromosome 2D of bread wheat (Triticum aestivum L.). Theor. Appl. Genet., 96,1104-1109.Orlyuk, A.P., Korchinskiy A.A. (1989) Physiological and genetical model of winter wheat variety. Кiev: Highschool – 72 p.Peng, J.,et al. (1999) ‘Green revolution’ genes encode mutant gibberellin response modulators. Nature, 400,256–261.Pestsova, E.G. et al. Pedigree analysis of wheat chromosome 2D // Proceedings of the 12th InternationalEWAC Workshop 1-6 July 2002. – Norwich, UK. – P. 122–124.Rokitskiy, P.F. (1973) Biological statistics. Minsk: Highest school – 320 p.Worland, A. J. et al. (1998) Genetic analysis of the dwarfing gene Rht8 in wheat. Part II. The distribution andadaptive significance of allelic variants at the Rht8 locus of wheat as revealed by microsatellite screening.Theor. Appl. Genet. 96, 1110–1120.150

Budapest, Hungary, 2011AGRISAFECONCEPT OF CROP ADAPTATION TO THE CHERNOBYLENVIRONMENT BASED ON PROTEOMIC DATAM. DANCHENKO 1,2 – K. KLUBICOVA 1 – L. SKULTETY 3 – V. BEREZHNA 2 –N. RASHYDOV 2 – M. HAJDUCH 11 Inst. of Plant Genetics and Biotechnology, Slovak Academy of Sciences, Nitra, Slovakia, hajduch@savba.sk2 Inst. of Cell Biology and Genetic Engineering, NAS of Ukraine, Kyiv, Ukraine, danchenko@nas.gov.ua3 Inst. of Virology, Slovak Academy of Sciences, Bratislava, Slovakia, viruludo@savba.skAbstract Almost 25 years ago the worst nuclear environmental disaster in human history occurred at theChernobyl Nuclear Power Plant. Even nowadays, large territories remain substantially contaminated with longlivingradioisotopes. The aim of our study was to elucidate plant adaptation mechanisms toward thepermanently increased level of ionizing radiation, using the high-throughput proteomics approach, thuscreating a system-wide overview of metabolic pathways, potentially crucial for withstanding harmfulmutagenic conditions. Soybean (Glycine max (L.) Merr. var. Soniachna) and flax (Linum usitatissimum L. var.Kyivskyi) were grown in control and contaminated (containing 15 and 9 times more 137 Cs and 90 Sr,respectively) fields in the Chernobyl region. Mature seeds were harvested and the extracted proteins wereseparated using two-dimensional gel electrophoresis. In total, 9.2% of 698 quantified protein spots were foundto be differentially expressed in soybean, but only 4.9% of 720 in flax, suggesting no major effect. Alldifferentially expressed spots were analyzed with the state-of-the-art tandem mass spectrometry technique.Based on acquired protein identities we proposed a working model of soybean adaptation, which includes thefollowing blocks: a) heavy metal-like non-specific adaptation, b) specific protection against radiation damage,c) alteration of storage proteins. Consequently, for flax we suggested that seeds produced under radiocontaminatedsoil conditions, tolerate chronic irradiation through changes in the abundance of proteins fromseveral signaling cascades, along with metabolic and protein folding adjustment. Herein we will combineresults on both species, integrating common molecular pathways into the interaction model and highlightingunique reactions.Key words: ionizing radiation, Chernobyl, soybean, flax, proteomics, seed.IntroductionMore then two decades ago major catastrophe had happened on the Chernobyl NuclearPower Plant (CNPP). As a consequence big territories were substantially contaminatedby radioisotopes. Ionizing radiation induces breakdowns of macromolecules, generationof free radicals, which in turn boost oxidative burst. Primary damage often leads tomutations or even cell death. Effects can proceed toward whole organism level, causingreduced growth rate, morphological abnormalities or disturbances in ontogeneticprogramme. Furthermore, a number of yet purely explainable non-linear phenomenawere observed for low doses, as genome instability or differential gene expression(Esnault et al., 2010). Surprisingly, more or less organisms were able to cope with suchincreased background radiation level. Nevertheless for years to come biota living onnearby lands will continue to receive considerable doses of dangerous beams (Geras'kinet al., 2008). The response of biota to Chernobyl environment is a complex functionbetween radiation dose rate and individual varying species sensitivities.To date there have been quite a few published reports, about changes on molecular level.For instance, it was estimated that the wild plants exposed to ionizing radiation arehypermethylated to protect their genome; also they have significant differences in theexpression of DNA repair genes, upon induction by mutagens (Kovalchuk et al., 2004).As cells respond to ionizing radiation through a complicate network of interconnectedsignaling cascades that are regulating diverse functions, post-genomic techniques havehuge potential in screening whole metabolic network. At the transcriptome level it wasshown, that plants react on acute irradiation similarly, as on other abiotic stresses, while151

AGRISAFE Budapest, Hungary, 2011chronically irradiated plants regulated completely different set of genes (Kovalchuk etal., 2007). Complementary research on global protein level changes under chronicirradiation had not been performed yet. Therefore here we summarize findings of studieson mature soybean and flax seeds, which were harvested from control and contaminatedplots established in the Chernobyl region; subjected to quantitative high-throughputproteomics analysis to unravel possible mechanisms by which these plants withstand theradio-contamination.Materials and methodsCrops (Glycine max (L.) Merr. var. Soniachna and Linum usitatissimum L. var.Kyivskyi) were grown in “contaminated” (located inside 10 km Chernobyl alienationzone) and “clean” (placed around 70 km away) plots. Testing sites were carefully chosento ensure similar edaphic and climatic conditions. Specific 137 Cs radioactivity in the soiland seed samples was measured by low-level γ spectrometry, whereas specific 90 Srradioactivity had been determined by radiochemistry. Proteins were extracted frommature seeds by buffer with phenol. Following that conventional two-dimensionalelectrophoresis (2-DE) separation was performed on orthogonal properties: isoelectricpoint and molecular weight. Resulting protein reference maps were quantitativelystained by Colloidal Coomassie. Analysis of gels was performed by ImageMaster 2DPlatinum v. 4.9. Later on spots of interest, excised from the gels, were subjected totandem mass spectrometry (MS/MS). Firstly, peptides were preseparated on analyticalreverse phase column, using nanoAcquity UPLC system and 15 min 3-50% acetonitrilegradient. Then data was collected on Q-TOF Premier MS/MS instrument. Fragmentationspectra were processed by ProteinLynx Global Server v. 2.4 and queried againsttheoretical database entries.Results and discussionContaminated field, which was located nearby CNPP had 15 times more γ-emitter 137 Csand 9 times more β-emitter 90 Sr comparing to the control. Even more profounddifferences were found for seed accumulation of main dose forming radionuclides:soybean grown on polluted soil absorbed 360 and 132 times, whereas flax 78 and 44times more of 137 Cs and 90 Sr ions respectively. Also on heavily contaminated soilsoybean seeds accumulated much more radionuclides comparing to flax (Figure 1A).Due to the similar physico-chemical properties of both caesium/potassium andstrontium/calcium pairs, these elements can be readily absorbed by plants, causingadditional internal irradiation. In general, the uptake of radionucleotides varies to a largeextent for different plant species (Paasikallio et al., 1994). To find out quantitativedifferences between samples from clean and radioactive plots high-resolution proteinreference maps were generated (Figure 1B). The final dataset contains information fromboth pH 7-10 region of wide-range (3-10 IPG strips) and whole middle-range (4-7 IPGstrips) gels. In total 698 protein were resolved in soybean seeds, 9.2% – 64 were shownto be differentially expressed. Out of 720 flax 2-DE spots 4.9% (35) varied significantlyin abundance. The MS/MS analysis resulted in the identification of 26 and 28 soybeanand flax proteins respectively.All identified proteins were allocated into 10 functional clusters (Figure 2A). Full list ofdifferentially expressed proteins along with quantitative characteristics had beenpublished previously: soybean (Danchenko et al., 2009) and flax (Klubicová, et al.,152

Budapest, Hungary, 2011AGRISAFE2010). Twelve species, all coming from soybean were “Storage Proteins”. Interestingly,previously it has been suggested that storage proteins may play additional roles besidesaccumulation of reserves, for instance tolerance to salt stress (Aghaei et al., 2009).“Transporters” cluster was represented by 2 forms of sucrose-binding protein (SBP,SBP2) and ADP/ATP carrier1 (ANT1) – all of those were less abundant in the seedsfrom contaminated field. In total six differentially expressed proteins were associatedwith “Signaling”, all of them down-regulated in radioactive conditions. Lipoxygenase(LOX) was identified in both cultivars; it is involved in the biosynthetic pathway leadingto the oxylipin alarmones, inducible by stress stimuli (Liavonchanka and Feussner,2006). Another component GF14 ω, belonging to 14-3-3 class of molecular adaptors,was found in flax. Members of 14-3-3 family mediate protein interactions, for instanceduring brassinosteroid hormone action (Oecking and Jaspert, 2009).Figure 1. Radioactive contamination of samples expressed in kBq kg -1 (A). Representative soybean left andflax right gels: middle-range pH 4-7, before red line; pH 7-10 region from wide-range, after red line (B).Figure 2. Functional classification of differentially abundant proteins. Full-coloured entities coming from flax,whereas lighted belong to soybean (A). Interaction model of adaptation toward ionizing radiation (B).Two of the proteins that are down-regulated in flax seeds and one in soybean aremolecular chaperones belonging to “Protein Folding” cluster. The T-complex 1 α sb. is acomponent of the cytoplasmic chaperonin, while BiP is an endoplasmic reticulum (ER)lumenal member of the Hsp70 superfamily (Urade, 2009). Another lumenal molecularchaperone, calreticulin (CRT) is functioning during ER stress in plants (Christensen etal., 2008). Proteins associated with “Stress Response” overall contained 9 entries.Accumulation of a cysteine-rich peptides phytochelatins in plants plays important role intolerance of heavy metal stress. Both glutathione transferase (GT) and cysteine synthase153

AGRISAFE Budapest, Hungary, 2011(CSY) involved in this process were found to be differentially abundant. Threedehydrins exhibited higher and one lower expression in the soybean seeds fromcontaminated field. These are stress-inducible proteins proven to protect against heavymetals as well (Xu et al., 2008). Choline monooxygenase (CMO), less abundant in flaxseeds and betaine aldehyde dehydrogenase (BAD), up-regulated in soybean, work inglycine betaine biosynthetic pathway, which was demonstrated to have a protectiveeffect against radiation-induced damage (Monobe et al., 2005). Finally “PrimaryMetabolism” cluster contained 5 proteins: fructose 1,6- bisphosphate aldolase (FBA), 3-phosphoglycerate kinase (PGK), malate dehydrogenase (MDH) and glyceraldehydes-3-phosphate dehydrogenase (GAPC1).ConclusionsHere we incorporated potential common connections into principal pathways: alterationof storage proteins, shifts in signalling, decreased transcription-folding and response tostress mediated by primary metabolism – are basic components of the overall mechanismthat allows survival in the radio-contaminated Chernobyl conditions (Figure 2B). Themain difference between investigated cultivars is that while storage proteins were mostlyaffected in soybean, flax showed considerable changes in signalling.AcknowledgementsThis investigation was supported by FP7 of the EU grant awarded to M.H. (MIRG-CT-2007-200165), additionally M.D. was financed by the NSP of the Slovak Republic.ReferencesAghaei, K., Ehsanpour, A. A., Shah, A. H., Komatsu, S. (2009): Proteome analysis of soybean hypocotyl and rootunder salt stress. Amino Acids, 36, 91–98.Christensen, A., Svensson, K., Persson, S., Jung, J., Michalak, M., Widell, S., Sommarin, M. (2008): Functionalcharacterization of Arabidopsis calreticulin1a: a key alleviator of endoplasmic reticulum stress. Plant CellPhysiol., 49, 912–924.Danchenko, M., Skultety, L., Rashydov, N. M., Berezhna. V. V., Mátel, L., Salaj, T., Pret'ová, A., Hajduch, M.(2009): Proteomic analysis of mature soybean seeds from the Chernobyl area suggests plant adaptation to thecontaminated environment. J. Proteome Res., 8, 2915–2922.Esnault, M.-A., Legue, F., Chenal, C. (2010): Ionizing radiation: Advances in plant response. Environ. Exp. Bot., 68,231–237.Geras'kin, S. A., Fesenko, S. V., Alexakhin, R. M. (2008): Effects of non-human species irradiation after theChernobyl NPP accident. Environ. Int., 34, 880–897.Klubicová, K., Danchenko, M., Skultety, L., Miernyk, J. A., Rashydov, N. M., Berezhna, V. V., Pret'ová, A., Hajduch,M. (2010): Proteomics analysis of flax grown in Chernobyl area suggests limited effect of contaminatedenvironment on seed proteome. Environ. Sci. Technol., 44, 6940–6946.Kovalchuk, I., Abramov, V., Pogribny, I., Kovalchuk, O. (2004): Molecular aspects of plant adaptation to life in theChernobyl zone. Plant Physiol., 135, 357–363.Kovalchuk, I., Molinier, J., Yao, Y., Arkhipov, A., Kovalchuk, O. (2007): Transcriptome analysis reveals fundamentaldifferences in plant response to acute and chronic exposure to ionizing radiation. Mutat. Res., 624, 101–113.Liavonchanka, A., Feussner, I. (2006): Lipoxygenases: occurrence, functions and catalysis. J. Plant Physiol., 163,348–357.Monobe, M., Uzawa, A., Hino, M., Ando, K., Kojima, S. (2005): Glycine betaine, a beer component, protectsradiation-induced injury. J. Radiat. Res., 46, 117–121.Oecking, C., Jaspert, N. (2009): Plant 14-3-3 proteins catch up with their mammalian orthologs. Curr. Opin. PlantBiol., 12, 760–765.Paasikallio, A., Rantavaara, A., Sippola, J. (1994): The transfer of cesium-137 and strontium-90 from soil to foodcrops after the Chernobyl accident. Sci. Total Environ., 155, 109–124.Urade, R. (2009): The endoplasmic reticulum stress signaling pathways in plants. Biofactors, 35, 326–331.Xu, J., Zhang, Y. X., Wei, W., Han, L., Guan, Z. Q., Wang, Z., Chai, T. Y. (2008): BjDHNs confer heavy-metaltolerance in plants. Mol. Biotechnol., 38, 91–98.154

Budapest, Hungary, 2011AGRISAFERESPONSES OF PHOTOSYNTHESIS TO COLD STRESS IN DHMAIZE LINES TOLERANT OF OXIDATIVE STRESSE. DARKO – H. AMBRUS – A. SZENZENSTEIN– B. BARNABÁSAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, HungaryAbstract Photosynthetic processes were investigated in doubled haploid maize tolerant of oxidative stressunder cold stress conditions. Cold treatment resulted in a great reduction in photosynthetic electron transportprocesses leading to the limitation of carbon assimilation, chlorophyll breakdown and photodamage to PS II.These changes were less extensive in doubled haploid plants tolerant of oxidative stress, which have elevatedantioxidant capacity. Correlations between cold-induced changes in the photosynthetic apparatus and theantioxidant capacity of plants suggested that better protection against oxidative stress contributed to protectingthe photosynthetic apparatus from cold.Key words: doubled haploid maize, cold and oxidative stressIntroductionIn their natural environment, plants often encounter unfavourable conditions (low orhigh temperature, water deficit), which may be associated with the excessive formationof reactive oxygen species (ROS) (Apel and Hirt 2004). Under mild stress, plants cancope with ROS due to their antioxidant defence system, but under severe stressconditions, the balance between the production and scavenging of ROS is disturbed,resulting in oxidative damage to biomolecules (chlorophylls, lipids, proteins, nucleicacids), eventually leading to yield losses or cell death. However, improving theantioxidant capacity to maintain this balance even under severe stress conditions mayresult in an enhanced stress tolerance of plants.At the Agricultural Research Institute of the Hungarian Academy of Sciences, fertile DHmaize plants were selected using the doubled haploid technology and regenerated frommicrospores exposed to ROS progenitors, such as paraquat or t-butylhydroperoxide (t-BuOOH) (Ambrus et al., 2006). Physiological and biochemical tests on the progeniesdemonstrated that the selected DH lines had enhanced tolerance to the oxidative stressinduced by these agents, contained lower levels of ROS and had elevated antioxidantcapacity compared to the original hybrid plants and to control DH (DH C) plants derivedfrom microspores not exposed to agents producing ROS (Darko et al. 2009). The stressresponses of DH maize lines tolerant of oxidative stress were also investigated afterexposure to cold or drought.The results presented here demonstrate the cold-induced changes in the photosyntheticapparatus of DH maize lines tolerant of oxidative stress originating from microsporesexposed to paraquat or t-BuOOH. The role of antioxidant enzymes in protection againstcold stresses was also investigated.Materials and methodsProgenies of DH maize (Zea mays L.) plants selected and regenerated from microsporesexposed to paraquat or t-BuOOH (Ambrus et al., 2006) were used in the experiments.Cold stress was induced by transferring young 2-leaf plants to 8 ºC for 5 days. Controlplants were kept at day/night temperatures of 22/20 C. The light intensity was 200 µmolm -2 s -1 in both growth chambers.Photosynthetic processes were monitored on intact attached leaves by measuring CO 2fixation (infrared gas analyser, LCA-2), chlorophyll a fluorescence (PAM 2000 Chl afluorometer) and leaf chlorophyll (a+b) content (Cary-100 UV-Vis spectrophotometer,155

AGRISAFE Budapest, Hungary, 2011Varian) as described by Darkó et al. (2009). Gas exchange and fluorescence quenchingparameters were determined at the steady state level of photosynthesis after illuminationat 700 or 340 µmol m -2 s -1 light intensity, and calculated according to von Caemmererand Farquhar (1981) and van Kooten and Snel (1990).The role of antioxidant capacity in protecting plants from cold was determined bymonitoring the activities of antioxidant enzymes (superoxide dismutase, SOD; ascorbateperoxidise, APX; catalase, CAT; glutathione reductase, GR and glutathione S-transferase, GST) using spectrophotometric methods as described in Darko et al. (2009).All experiments were repeated three times.Results and discussionIn the temperate zone, maize is often exposed to low temperature during earlydevelopment, resulting in poor photosynthetic performance. This cold-induced decreasein photosynthesis has been associated with photodamage to PS II reaction centres,alterations in leaf pigment composition, decreased electron transport activity, increaseddissipation of excess energy in PS II antennae and lower enzyme activity in the carboncycle (Allen and Ort 2001). Cold-induced changes in photosynthetic parameters werefound to be good indicators of early cold tolerance in maize (Lee et al., 2002).Table1. Photosynthetic parameters of young leaves with and without cold treatmentFv/Fm qP ΔF/Fm’ NPQ Pn gs Chl (a+b)H 22 °C 0.728 0.756 0.369 0.483 7.6 273 1754±1538 °C 0.444 * 0.425 * 0.083 * 0.450 2.12 * 246 1045±148DH C 22 °C 0.702 0.679 # 0.282 0.488 4.42 # 186 1590±1228 °C 0.417 * 0.387 * 0.079 * 0.421 1.92 * 199 755±115PqR1 22 °C 0.699 0.799 0.338 0.486 4.96 # 246 1583±2208 °C 0.530 *# 0.602 *# 0.148 0.632 *# 4.12 *# 240 1174±123PqR2 22 °C 0.700 0.772 0.323 0.541 4.5 # 270 1850±1968 °C 0.553 *# 0.574 *# 0.134 0.661 *# 2.14 263 1484±132PqR3 22 °C 0.718 0.760 0.359 0.518 4.7 # 251 1534±2328 °C 0.502 * 0.547 *# 0.102 0.589 # 2.5 239 1140±152PqR4 22 °C 0.718 0.790 0.367 0.502 4.36 # 243 1687±1728 °C 0.537 *# 0.548 *# 0.126 0.699 *# 3.21 *# 236 1444±124BR1 22 °C 0.770 0.786 0.373 0.481 5.86# 238 1764±1628 °C 0.514 *# 0.592 *# 0.130 0.511 4.35 *# 232 1554±135BR2 22 °C 0.704 0.779 0.346 0.485 6.21# 250 1473±1568 °C 0.511 *# 0.674 *# 0.155 0.587 *# 5.23*# 245 973±105BR3 22 °C 0.758 0.785 0.347 0.504 4.42 # 226 1783±1748 °C 0.550 *# 0.553 *# 0.109 * 0.592 *# 2.65 205 1248±117BR4 22 °C 0.736 0.725 0.303 0.426 4.34 # 252 1654±2028 °C 0.436 0.559 *# 0.104 0.561# 2.85* 248 1388±202Chlorophyll a fluorescence (Fv/Fm, qP, ΔF/Fm’,NPQ, Rfd), carbon assimilation (Pn, μmolCO 2 /m 2 s) andstomatal conductance (gs, μmolH 2 O/m 2 s) parameters and chlorophyll (a+b) contents (μmol chl/ g FW) ofleaves of different DH maize lines and hybrid plants with (8°C for 5 days) and without cold treatment. Forcontrol measurements the plants were kept at 22 °C. * , # values significantly different from the correspondingT22 and H values, respectively.When the hybrid, non-selected and selected DH lines were grown at ambienttemperature, there were no significant differences in fluorescence induction andquenching parameters, such as Fv/Fm (related to the primary charge separation capacityof PSII), qP and ΔF/Fm’ (estimating the quantum yield of PS II photochemistry and156

Budapest, Hungary, 2011AGRISAFElinear electron flux, respectively) and NPQ (reflecting the heat dissipation of excitationenergy) (Table). Similar photosynthetic electron transport activity was detected in all theplants under optimal growing conditions. However, a higher carbon assimilation rate(Pn) was found in the hybrid and BR1 and BR2 plants than in most of the DH lines,when measured at saturated light intensity (Table 1.).When plants were exposed to low temperature stress (8 C) for 5 days, fluorescencequenching parameters (except NPQ) and the CO 2 assimilation rate decreasedsignificantly (Table). Decreases in the primary charge separation capacity (indicated bythe decline in Fv/Fm) and in the efficiency of linear electron transport (reflected in thelow ΔF/Fm’) and increases in the closure of PS II reaction centres (low qP) wereespecially pronounced in hybrid and non-selected DH plants, but less evident inoxidative stress-tolerant plants derived from microspores exposed to paraquat (PqR1-4)or t-BuOOH (BR1-4). In ROS-tolerant plants, the limited photochemical utilization ofabsorbed light energy was accompanied by an increase in the heat dissipation of excessexcitation energy (elevated NPQ) (Table 1.).In maize, as in most C 4 plants, the enzymes responsible for CO 2 fixation have a hightemperature optimum (Crafts-Brander and Salvucci 2002). Low temperature may alsoinduce stomatal closure (Wilkinson et al. 2001). In this study, cold stress resulted in agreatly reduced CO 2 assimilation rate (Pn), especially in the hybrid and DH C genotypes,but the gs parameter, reflecting stomata closure, did not change significantly in anyplants. The absence of stomatal closure and the correlation (r=0.83) between theeffective quantum yield of PS II (ΔF/Fm’) and A suggested that the cold-induceddecrease in photosynthetic activity is primarily associated with the inhibition of electrontransport processes, leading to NADPH depletion. The low photochemical utilization ofabsorbed light energy led to photodamage to PS II reaction centres and to photosyntheticpigment degradation, as found in the leaves of H and DH C plants (Table). The decreasein photosynthetic parameters and the pigment degradation were less pronounced inoxidative stress-tolerant DH plants.The role of antioxidant enzymes in counteracting cold stress was tested by comparingthe antioxidant capacity of selected DH plants to that of non-selected DH C and hybridplants with and without low temperature stress.Relative activities1098765432101GSTGRFv/FmCatalase0,9r = 0,787qPAPXEQYSOD 0,8r = 0,723AHDH CPqR1PqR2PqR3PqR4BR1BR2BR3BR4ControlAHDH CPqR1PqR2PqR3PqR4BR1BR2BR3BR4Cold-treatedFigure 1. A: Relative activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT),glutathione reductase (GR) and glutathione S-transferase (GST) in the leaves of hybrid (H), doubled haploidcontrol (DH C) and paraquat- (PqR1–4) or t-BuOOH-selected (BR1-4) doubled haploid maize plants undercontrol and cold stress conditions. Enzyme activities were normalized to those measured in the control leavesof hybrid plants. An activity level of 1 represented 8.4, 3.37, 15.5, 0.289 and 2.22 μM g -1 FW min -1 activities ofSOD, APX, CAT, GR and GST. B: Correlation between the photosynthetic activities and antioxidantcapacities of the plants.Relative values (cold/control) of photosynthetic parameters0,70,60,50,40,30,20,10Lineáris (qP)Lineáris (EQY)Lineáris (Fv/Fm )Lineáris (A)Br = 0,678r = 0,6084 5 6 7 8 9 10Antioxidant capacity157

AGRISAFE Budapest, Hungary, 2011Antioxidant capacity was calculated by summing the normalized activities of SOD,CAT, APX, GR and GST in maize leaves obtained under the experimental conditionsdescribed above for photosynthesis measurements (Fig. 1A).In both unstressed and cold-treated leaves, most of these antioxidant enzymes exhibitedhigher activities in the oxidative stress-tolerant DH lines than in hybrid and DH C plants,indicating a simultaneous up-regulation of the antioxidant enzymes in paraquat- or t-BuOOH-selected DH lines (Fig. 1A). Cold stress significantly stimulated GR activity inmost of the plants, and that of GST in oxidative stress-tolerant DH lines. Catalase wasalso induced in some oxidative stress-tolerant DH lines (Fig. 1A). Cold stress seemed tohave no effect on SOD or APX activity.Cold and oxidative stress tolerance were found to correlate with antioxidant capacity,with linear correlations between leaf antioxidant capacity and the cold-induced decreasein photosynthetic parameters (Fig. 1B), indicating that the generally high overall level ofantioxidant activity in the selected DH lines and the enhancement of antioxidant enzymeactivity during cold stress could lead to better cold tolerance in maize plants.ConclusionsStudies on the cold stress responses of photosynthesis demonstrated that in hybrid andcontrol DH plants, the low photosynthetic activity, resulting in poor utilization ofabsorbed light energy, the low efficiency of heat dissipation and the limited antioxidantcapacity promoted the formation of ROS under cold stress conditions. In the oxidativestress-tolerant plants however, elevated antioxidant capacity helped to protect thephotosynthetic apparatus against cold stress.AcknowledgementsThis paper was funded by the Hungarian National Scientific Research Fund (Grant No.K 72542).ReferencesAllen, D.J., Ort, D.R. (2001): Impacts of chilling temperatures on photosynthesis in warm-climate plants.Trends Plant Sci. 6, 36–42.Ambrus, H., Darkó, É., Szabó, L., Bakos, F., Király, Z., Barnabás, B. (2006): In vitro selection in maize antherculture with oxidative-stress stimulators. Protoplasma 228, 87-94.Apel, K., Hirt, H. (2004): Reactive oxygen species: metabolism, oxidative stress and signal transduction. Annu.Rev. Plant Physiol. Plant. Molec. Biol. 55, 373-399.Crafts-Brandner, S., Salvucci, M. (2000). Rubisco activase constrains the photosynthetic potential of leaves athigh temperature and CO 2 , Proc. Natl. Acad. Sci. USA 97 13430–13435.Darkó, É., Ambrus, H., Fodor, J., Király, Z., Barnabás, B. (2009): Enhanced tolerance to oxidative stress withelevated antioxidant capacity in microspore derived DH maize plants. Crop Sci. 49, 628-636.Lee, E.A, Staebler, M., Tollenaar, M. (2002): Genetic variation and physiological discrimination for coldtolerance in maize (Zea mays L.). Crop Sci. 42 1919–1929.van Kooten, O., Snell, J. (1990): The use of chlorophyll fluorescence nomenclature in plant stress physiology.Photosynthesis Res. 25, 147–150.von Caemmerer, S., Farquhar, G. (1981): Some relationships between the biochemistry of photosynthesis andthe gas exchange of leaves. Planta 153, 376-387.Wilkinson, S., Clephan A.L., Davies, W.J. (2001): Rapid low temperature-induced stomatal closure occurs incold-tolerant Commelina communis leaves. Plant Physiol, 126, 1566-1578.158

Budapest, Hungary, 2011AGRISAFEGENETIC DIFFERENCES IN SEEDLING GROWTH UNDERINDUCED WATER STRESS, AS ESTIMATORS OFDIFFERENCES IN OSMOTIC ADJUSTMENT, IN A SET OFWINTER WHEAT (TRITICUM AESTIVUM L.) CULTIVARSM. DAVIDDepartment of Plant Physiology, National Agricultural Research and Development Institute, Fundulea,Romania, 1 Nicolae Titulescu Street, e-mail: monica.dvd28@gmail.comAbstract Significant genetic differences in osmotic adjustment in wheat have been reported, mainly byAustralian scientists, and found to be associated with yield performance under some types of water stress. Theidentification of high osmotic adjustment ability in the Romanian winter wheat cultivar Izvor, which had thebest performance under very severe drought in 2003 and 2007, initiated a substantial breeding effort aimed atincorporating this trait across the entire wheat breeding program. There was an obvious need for a simple, fastmethod to estimate the osmotic adjustment ability in a large number of breeding lines. Seedlings were exposedto water stress created by PEG 6000 20%(w/w) and 25%(w/w) solutions, by limiting the amount of water inthe Petri dishes or by gradual drying as the result of lifting the dish lids. Only the relative growth of shoots androots in seedlings exposed to gradual drying was correlated with osmotic adjustment estimated by the pollentest, and could be used for large scale screening in breeding programs for drought resistance in wheat.Key words: drought, osmotic adjustment, seedling tests.IntroductionIt is estimated that presently one third of the land, potentially usable for agriculture, isnot cultivated because of deficient water availability, and on most of the remaining landyields are periodically reduced by drought. This situation will very probably becomeworse, according to most climate change scenarios.Osmotic adjustment is largely recognized as one of the main mechanisms involved indrought tolerance in crops (Zhang et al., 1999), as a higher osmotic adjustment abilitycan contribute to retaining water in cells, and protecting cell proteins and enzymesagainst dehydration. Compared with other drought tolerance mechanisms, osmoticadjustment has the advantage of being activated only under water stress, and therefore itis believed that it does not interfere with the yielding potential under non-stressconditions (Blum, 1996).Substantial differences exist between wheat genotypes in the capacity of mature leavesto accumulate solutes in response to water stress (Morgan, 1983, 1988). There is nowreasonable evidence to show that, in diverse genetic backgrounds, these differences inosmoregulation are positively associated with differences in dry matter and grain yield inthe field (Morgan, 1983, 1988; Morgan et al., 1986).As osmotic adjustment is a cellular mechanism, it is expressed in all plants cell,including pollen grain and this offers a convenient way to characterize germplasm forthis trait (David, 2009; Bănică et al., 2008; Morgan, 1999). This paper focuses on theresponses of the plant to water stress in the first week of ontogeny – when observationsmay be conveniently made on expanding shoots and roots of seedlings growing in Petridishes in the laboratory. Starting from a suggestion made by the Australian scientistMorgan (1988), we investigated differences in shoot and root growth under inducedwater stress, in young seedlings of a set of winter wheat cultivars. We also investigatedcorrelations between seedlings growth under water stress induced by various methodsand pollen test for osmotic adjustment.159

AGRISAFE Budapest, Hungary, 2011Materials and methods18 wheat cultivars from Romania and other countries, selected to represent severalecotypes, adapted to regions that are contrasting for water availability (e.g. Gerek fromTurkey or Apache from France), were used for studying seedlings growth under waterstress conditions.Three experiments were conducted to examine the growth responses of seedlings towater stress:1. Stress imposed by PEG solutions. Thirteen seeds per cultivar were left toimbibition for 3 days in 8 ml distilled water at 1ºC, then seeds were placed forgermination at 21-22ºC for 24h in the dark. Germinated seeds were moved ongermination cotton in Petri dishes (9 cm). 30ml distilled water was added to saturatethe germination cotton. There were three treatments, two stresses and a control.Before applying water stress the very small seedlings and ungerminated seeds wereremoved and the lengths of the remaining coleoptiles and roots were measured (themean length was 11 mm). Thirty ml of 20% (w/w) and 25%(w/w) polyethyleneglycol 6000 (PEG) were added to the stress treatment dishes while 30 ml of distilledwater was added to controls. Shoot and root lengths were measured before and 6days after treatments.2. Stress imposed by limiting water supply. Five seeds per cultivar were left toimbibition for 3 days at 1ºC in 8 ml distilled water, then seeds were placed forgermination at 21-22ºC for 24h. Daily photoperiod was 9.20 A.M – 9.20 P.M.Germinated seeds were moved to Petri dishes (9 cm) on germination cotton. Theresponse of seminal roots and shoots to water stress were examined by varying theamount of water applied. Two levels of watering, 15 ml and 30 ml, were applied onthe germination cotton. Root and shoot lengths were measured before and 6 daysafter treatments.3. Stress imposed by gradual drying. Five seeds per cultivar were left to imbibitionfor 3 days at 1ºC in 8 ml distilled water, then seeds were placed for germination at21-22ºC for 24h. Daily photoperiod was 9.20 A.M – 9.20 P.M. Germinated seedswere moved to Petri dishes (9 cm) on germination cotton and 30 ml distilled waterwas added both for stress treatment and for control. Stress was induced by gradualevaporative loss by lifting the lids in the stressed treatment, having all dishes placedat the same height above the bench to ensure uniform evaporative conditions. Waterwas added to the control dishes when needed. Root and shoot lengths weremeasured before and 6 days after treatment.Growth was determined by measuring the length of coleoptiles, shoots and roots.Data previously obtained about osmotic adjustment capacity (OA), using the test ofpollen developed by Morgan (1999), were used to estimate the relationship with resultsof seedling tests. Details of the method used for pollen test are given by Bănică et al.(2008) and David (2009).Results and discussionSignificant differences between tested cultivars were detected for root and seedlinggrowth, in both control and stressed seedlings (table 1).Relative shoot and root growth under water stress imposed in seedlings by variousmethods were not correlated among themselves. Only results of gradual dryingsignificantly correlated with osmotic adjustment estimated by pollen test (table 2).160

Budapest, Hungary, 2011AGRISAFETable 1. Significance of cultivar effects on shoot growth in seedlings tests under non-stress and water stressControl non-stressedWater stressedRoot Shoot Root ShootGradual drying F 9,282 11.769 5.128 5.517P-value P

AGRISAFE Budapest, Hungary, 2011Figure 1. Relative growth of seedling roots and shoots under water stress imposed by gradual dryingConclusionsRelative growth of seedlings exposed to water stress by gradual drying can provideinformation about genotypic differences in osmotic adjustment and could be used forlarge scale screening in breeding wheat for drought resistance.AcknowledgementsThis study was supported by the National Research & Development Program project„Reducing climate change impacts on wheat yields in Southern Romania”.ReferencesBănică, C., Petcu, E., Giura, A., Săulescu, N. N. (2008): Relationship between genetic differences in thecapacity of osmotic adjustment and other physiological physiological measures of drought resistance inwinter wheat (Triticum aestivum L.). Romanian Agricultural Research, 25, 7-11.Blum, A. (1996): Yield potential and drought resistance: Are they mutually exclusive?. In: M.P. Reynolds et al.(eds.) Increasing yield potential in wheat: Breaking the barriers: 90-100. CIMMYT, Mexico, D.F.David, M. (2009): Osmotic adjustment capacity and cuticular transpiration in several wheat cultivars cultivatedin Algeria. Romanian Agricultural Research, 26, 29-33.Morgan, J. M. (1983): Osmoregulation as a selection criterion for drought tolerance in wheat. Aust. J. Agric.Res., 34, 607-614.Morgan, J. M. (1988): The use of coleoptile responses to water stress to differentiate wheat genotypes forosmoregulation, growth and yield. Annals of Botany, 62, 193-198.Morgan, J. M. (1999): Pollen grain expression of a gene controlling differences in osmoregulation in wheatleaves: a simple breeding method. Aust. J. Agric. Res., 50, 953-962.Morgan, J. M., Condon, A. G. (1986): Water use, grain yield, and osmoregulation in wheat. Australian Journalof Plant Physiology, 13, 523-32.Zhang, J., Nguien, H. T., Blum, A. (1999): Genetics analysis of osmotic adjustment in crop plants. Journal ofExperimental Botany, 50 (322), 291-302.162

Budapest, Hungary, 2011AGRISAFEINTERACTION BETWEEN COLD ACCLIMATION, FROSTTOLERANCE AND FLOWER INITIATION IN WHEATG. GALIBA 1,2 – A. VÁGÚJFALVI 1 – I. VASHEGYI 1,2 – A. SOLTÉSZ 1 –E.J. STOCKINGER 3 – J. DUBCOVSKY 4 , – G. KOCSY 1 ,1 Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary2 Faculty of Information Technology, University of Pannonia, Veszprém, Hungary3 Department of Horticulture and Crop Science, The Ohio State University, Wooster OH, USA4 Department of Plant Sciences, University of California, Davis CA, USAAbstract The requirement for exposure to non-freezing cold temperatures is common to both cold-acclimationand vernalization, suggesting a potential connection between these two processes. Cold-responsive pathwaysare activated during cold acclimation. Among these, the role of the CBF-regulon and redox changes, especiallythe ascorbate-glutathione cycle, were considered. Cold treatment is essential to fulfil the vernalizationrequirement of winter genotypes. Chromosome 5A harbours QTLs for both frost tolerance (Fr-A1 and Fr-A2)and vernalization requirement (Vrn-A1) in wheat. The degree of frost tolerance is dependent on the inductionof CBF genes clustered at the Fr-A2 locus. Plants lose their frost tolerance upon entering the generative phasedue to the expression of Vrn-A1. Two “maintained vegetative phase” (mvp) diploid wheat mutants that carrydeletions encompassing the major vernalization gene (VRN-1) were used to obtain a better understanding ofthis relationship. Homozygous mvp/mvp plants never flower, whereas plants carrying at least one functionalVRN-1 copy (Mvp/-) exhibit normal flowering and high transcript levels of VRN-1 under long days. The Mvp/-plants showed reduced frost tolerance and reduced transcript levels of several cold-induced CBF transcriptionfactors and COLD-REGULATED genes (COR) compared to mvp/mvp plants. We were interested indiscovering whether redox changes induced by cold hardening are related to both frost tolerance andvernalization requirement in a specific genetic system containing chromosome 5A wheat substitution lines.While the observed redox changes were correlated with frost tolerance in the crown of the plants, they wereindependent of the vegetative/generative transition state, monitored on the basis of apex morphology and Vrn-A1 gene expression.Key words: CBF, cold acclimation, frost tolerance, redox changes, vernalization requirement, wheatIntroductionWinter wheat varieties are planted in the fall and, if they have adequate tolerance tosurvive winter freezing temperatures, usually have higher yield potential than springvarieties planted later in the spring because of their longer growing period. Reproductivemeristems are more sensitive to frost damage than vegetative meristems, so smalldifferences in developmental stages may affect plant survival of freezing temperatures.As a consequence of this relationship, allelic differences in genes regulating theinitiation of the reproductive phase via photoperiod (PPD genes) or vernalization (VRNgenes) have a large impact on frost tolerance (Distelfeld and Dubcovsky, 2010). VRNgenes are of particular interest as they are regulated by long exposure to cold but nonfreezingtemperatures, the same conditions required for plant acclimation to freezingtemperatures.During cold acclimation, co-ordinated changes occur in gene expression, protein andmetabolite levels. These include the accumulation of reactive oxygen species (ROS) andchanges in the intracellular redox environment, characterised by a reduction in thecapacities of all redox couples (Schafer and Buettner, 2001). Alterations in the half-cellreduction potential of the ascorbate ⁄ dehydroascorbate (AA ⁄ DHA) and glutathione ⁄glutathione disulphide (GSH ⁄ GSSG) couples may be good indicators of the intracellularredox environment (Schafer and Buettner, 2001). As a consequence of these changes,various defence and regulatory mechanisms are activated through redox signallingpathways (Foyer & Noctor 2009; Szalai et al. 2009). The involvement of ROS in coldacclimation has been shown in wheat, where a very rapid transient increase in H 2 O 2163

AGRISAFE Budapest, Hungary, 2011content was observed in response to cold (Okuda et al., 1991). The aims of the presentwork were: a) to elucidate the effect of the VRN-1 gene on frost tolerance, and b) toclarify whether redox changes during cold acclimation (characterised by changes in theredox potentials of the GSH ⁄ GSSG and AA ⁄ DHA couples) are related to vernalizationrequirement and frost tolerance.Interactions between frost tolerance and vernalization requirementOne feature that distinguishes winter and spring genotypes is the requirement of theformer for a long period (several weeks) of cold temperature to accelerate the transitionfrom the vegetative to the reproductive growth phase, a process called vernalization.Spring genotypes do not have a vernalization requirement and flower in the absence ofextended low temperature exposure. The molecular isolation of VRN-1 revealed that thisgene encodes a MADS-box protein similar to the Arabidopsis meristem identity geneAPETALA1 (AP1). Genotypes with a winter growth habit (vrn-1 allele) show very lowVRN-1 transcript levels until the plants are vernalized. In contrast, spring genotypes(Vrn-1 allele) constitutively express VRN-1 at high levels (reviewed in Distelfeld et al.,2009). Flowering is initiated once VRN-1 transcripts reach a critical threshold level(Loukoianov et al., 2005).The requirement for exposure to non-freezing cold temperatures is common to both coldacclimationand vernalization, suggesting a potential connection between these twoprocesses. After an initial increase in frost tolerance, winter genotypes maintained undercontinuous cold exhibit a progressive decrease in their cold acclimation ability (Fowleret al., 1996). This progressive decrease inversely parallels the fulfilment of thevernalization requirement. A clear decrease in frost tolerance occurs after the shootapical meristem advances to the double ridge stage (Limin and Fowler, 2006). Thesestudies suggest that a regulatory component of frost tolerance is linked to adevelopmental shift between the vegetative and reproductive stages.Role of VRN-1 in the suppression of Cold Regulated (COR) genesThe first major locus affecting frost tolerance and winter hardiness on homoeologousgroup 5 was designated FROST RESISTANCE-1 (FR-1). More recently, a second locuswas mapped on the long arm of homoeologous group 5 in wheat and barley. This locus,designated FROST RESISTANCE-2 (FR-2), is approximately 30 cM proximal to VRN-1and includes a cluster of 11 (or more) C-repeat Binding Factor (CBF) genes affectingfrost tolerance in a number of wheat and barley mapping populations (recently reviewedin Galiba et al, 2009 and Tondelli et al., 2011).Approximately 20% of the Arabidopsis genes whose expression is altered during coldacclimation are directly or indirectly controlled by CBF transcription factors. The directtargets of CBFs in Arabidopsis include the robustly-induced Cold Regulated (COR)genes. Similar candidate CBF target genes in the cereals include COR14b, DHN5, andDHN8. Many of these COR genes are induced at higher levels in genotypes exhibitinggreater frost tolerance than in those having less (reviewed in Galiba et al., 2009). The useof COR14b as an expression QTL to map loci affecting COR expression levels revealedtwo major loci, one of which is coincident with VRN-1 and the second with FR-2(Vágújfalvi et al., 2000; Francia et al., 2004). Genotypes carrying the vrn-1 allele forwinter growth habit express certain CBF genes at higher levels than genotypes carryingthe Vrn-1 allele for spring growth habit (Stockinger et al., 2007). Once winter genotypescarrying the vrn-1 allele are vernalized, CBF transcript levels are dampened relative tolevels detected in non-vernalized plants (Stockinger et al., 2007). This suggests that164

Budapest, Hungary, 2011AGRISAFEVRN-1 somehow acts to repress the expression of CBFs at FR-2, and in turn decreasesfrost tolerance.Triticum monococcum mutants with deletions of the VRN-1 gene fail to flower,indicating that this gene is indispensable for the transition to the reproductive phase(Shitsukawa et al., 2007). Two independent T. monococcum mutants were generatedwith deletions in the complete VRN-1 and in several closely linked genes and weredesignated maintained vegetative phase 1 and 2 (mvp-1 and mvp-2) (Distelfeld andDubcovsky, 2010). The mvp mutants and natural T. monococcum accessions that differin their ability to express VRN-1 under short days were used to investigate the role ofVRN-1 in frost tolerance. The frost tolerance and transcript levels of several CBF andCOR genes were found to be higher in the mvp mutants compared with plants carrying atleast one functional VRN-1 copy. However, the expression of VRN-1 was not as effectivein down-regulating COR14b gene transcription under short days as under long days.Taken together these results suggest that VRN-1 transcription is necessary but notsufficient to down-regulate the COR genes (Dhillon et al. 2010).Redox changes during cold acclimation at the vegetative/reproductive transition ofthe shoot apex in wheatThe relationship between H 2 O 2 content and frost tolerance was demonstrated in barley,since the cold-induced increase in H 2 O 2 level was greater in a frost-tolerant genotypethan in a sensitive one (Dai et al., 2009). This change in the H 2 O 2 concentration thenaffects components of the antioxidant ascorbate-glutathione cycle, which remove excessH 2 O 2 (Foyer and Noctor, 2009). Frost tolerance-dependent alterations were observed inthe GSH concentration of wheat seedlings (Kocsy et al., 2000). Besides GSH, theamount of AA also increased during acclimation, as described in rye (Streb et al., 2002).Cold-induced changes in the activity of ascorbate peroxidase (APX) in leaves werecorrelated with frost tolerance in several cereal species (Janda et al., 2003). Due to thekey role of chromosome 5A in the control of cold acclimation, a special genetic systemconsisting of chromosome 5A wheat substitution lines with different frost tolerance andvernalization requirement was used to study redox changes during cold acclimation(Soltész et al., 2011). The H 2 O 2 , AA and GSH concentrations, AA ⁄ DHA andGSH ⁄ GSSG ratios and the half-cell reduction potential of the GSH ⁄ GSSG couple werecorrelated with the level of frost tolerance after 22 days at 2 o C. None of the parametersstudied showed any relationship with the vegetative ⁄ generative transition state,monitored on the bases of apex morphology and vernalization gene expression (Soltészet al., 2011).ConclusionsThe results from experiments on T. monococcum accessions with differential expressionof VRN-1 under short days suggest that additional genes operating downstream of VRN-1and regulated by long days are required to mediate the negative effect of VRN-1 on frosttolerance. The contribution of redox changes to the maintenance of the frost-tolerantstage is especially important in wheat genotypes with spring habit, because they arealready in the reproductive phase when they are exposed to freezing temperatures.AcknowledgementsThis paper was financially supported by the Hungarian Scientific Research Fund (OTKAK75584), the Norwegian Financial Mechanism (OTKA NNF78866), the National Office165

AGRISAFE Budapest, Hungary, 2011for Research and Technology (NKTH-OTKA K67906, CNK80781) and the EuropeanUnion (AGRISAFE 203288 – EU-FP7-REGPOT 2007-1).ReferencesDai, F., Huang, Y., Zhou, M., Zhang, G. (2009): The influence of cold acclimation on antioxidative enzymesand antioxidants in sensitive and tolerant barley cultivars. Biol. Plant., 53, 257–262.Dhillon, T., Pearce, S.P., Stockinger, E.J., Distelfeld, A., Li, C., Knox, A.K., Vashegyi, I., Vágújfalvi, A.,Galiba, G., Dubcovsky, J.. (2010): Regulation of freezing tolerance and flowering in temperate cereals: theVRN-1 connection. Plant Physiol., 153, 1846–1858.Distelfeld, A., Li, C., Dubcovsky, J. (2009): Regulation of flowering in temperate cereals. Curr. Opin. PlantBiol., 12, 178–184.Distelfeld, A., Dubcovsky, J. (2010): Characterization of the maintained vegetative phase (mvp) deletions fromeinkorn wheat and their effect on VRN2 and FT transcript levels. Mol. Genet. Genomics, 283, 223–232Fowler, D.B., Limin, A.E., Wang, S.Y., Ward, R.W. (1996): Relationship between low temperature toleranceand vernalization response in wheat and rye. Can. J. Plant Sci., 76, 37–42.Foyer, C.H., Noctor, G. (2009): Redox regulation in photosynthetic organisms: signalling, acclimation, andpractical implications. Antiox. Redox Sign., 11, 861–905.Francia, E., Rizza, F., Cattivelli, L., Stanca, A.M., Galiba, G., Tóth, B., Hayes, P.M., Skinner, J.S., Pecchioni,N. (2004): Two loci on chromosome 5H determine low-temperature tolerance in a Nure (winter) ×Tremois (spring) barley map. Theor. Appl. Genet., 108, 670–680.Galiba, G., Vágújfalvi, A., Li, C., Soltész, A., Dubcovsky, J. (2009): Regulatory genes involved in thedetermination of frost tolerance in temperate cereals. Plant Sci., 176, 12–19.Janda, T., Szalai, G., Rios-Gonzalez, K., Veisz, O., Páldi, E. (2003): Comparative study of frost tolerance andantioxidant activity in cereals. Plant Sci., 164, 301–306.Kocsy, G., Szalai, G., Vágújfalvi, A., Stéhli, L., Orosz, G., Galiba, G. (2000): Genetic study of glutathioneaccumulation during cold hardening in wheat. Planta, 210, 295–301.Limin, A.E., Fowler, D.B. (2006): Low-temperature tolerance and genetic potential in wheat (Triticumaestivum L.): response to photoperiod, vernalization, and plant development. Planta, 224, 360–366.Loukoianov, A., Yan, L., Blechl, A., Sanchez, A., Dubcovsky, J. (2005): Regulation of VRN–1 vernalizationgenes in normal and transgenic polyploid wheat. Plant Physiol., 138, 2364-2373.Okuda, T., Matsuda, Y., Yamanaka, A., Sagisaka, S. (1991): Abrupt increase in the level of hydrogen peroxidein leaves of winter wheat is caused by cold treatment. Plant Physiol., 97, 1265–1267.Schafer, F.O., Buettner, G.R. (2001): Redox environment of the cell as viewed through the redox state of theglutathione disulphide ⁄ glutathione couple. Free Radical Biol. Med., 30, 1191–1212.Shitsukawa, N., Ikari, C., Shimada, S., Kitagawa, S., Sakamoto, K., Saito, H., Ryuto, H., Fukunishi, N., Abe,T., Takumi, S., Nasuda, S., Murai, K. (2007): The einkorn wheat (Triticum monococcum) mutant,maintained vegetative phase, is caused by a deletion in the VRN1 gene. Genes Genet. Syst., 82, 167–170Soltész, A., Tímár, I., Vashegyi, I., Tóth, B., Kellős, T., Szalai, G., Vágújfalvi, A., Kocsy, G., Galiba, G.(2011): Redox changes during cold acclimation affect freezing tolerance but not the vegetativereproductive transition of the shoot apex in wheat. Plant Biol., doi:10.1111/j.1438-8677.2010.00429.x.Streb, P., Shang, W., Feierabend, J. (2002): Resistance of cold-hardened winter rye leaves (Secale cereale L.)to photo-oxidative stress. Plant Cell Environ., 22, 1211–1223.Tondelli, A., Francia, E., Barabaschi, D., Pasquariello, M., Pecchioni, N. (2011) Inside the CBF locus inPoaceae. Plant Sci., 180, 39–45.Vágújfalvi, A., Crosatti, C,. Galiba, G., Dubcovsky, J., Cattivelli, L. (2000): Two loci on wheat chromosome5A regulate the differential cold-dependent expression of the cor14b gene in frost-tolerant and frostsensitivegenotypes. Mol Gen. Genet., 263, 194–200.166

Budapest, Hungary, 2011AGRISAFESOMATIC CLONES OF POPULUS NIGRA SELECTED ANDCHARACTERIZED BY SSRs, AND COMPARED TO 35S-GSHI P.CANESCENS FOR SULPHATE UPTAKE CAPACITYG. GYULAI 1,2 – A. BITTSÁNSZKY 3 – G. GULLNER 3 – GY. HELTAI 4 – T. KŐMÍVES 31 Institute of Genetics and Plant Breeding, Fac Ag & Env Sci, Szent István University, Gödöllő 2103, Hungary2 HAS-SIU Research Group for Genetic Conservation, Szent István University, Gödöllő 2103, Hungary3 Plant Protection Institute, Hungarian Academy of Sciences, MTA, Budapest 1525, Hungary4 Department of Chemistry, Szent István University, Gödöllő 2103, HungaryAbstract Microsatellite variations among 36 somatic clones of black poplar (P. nigra) developed in vitro inaseptic culture were analyzed by ALF-SSR with the final aim of selecting new stable SSR clones withimproved phytoextraction capacity through the GSH (glutathione)-dependent sulphate (SO 2- 4 ) metabolism. WTand two 35S-gshI transgenic clones of P. canescens were used as a control.Key words: microsatellites, SSRs, somatic clones, Populus nigra, sulphate uptakeIntroductionBlack poplar (P. nigra) is a fast growing, large, and softwood tree of family Salicaceae,which include about 30 dioecious species, but one Populus lasiocarpa. The poplargenome is extreme small (2n = 4x = 38; 5.5 10 8 bp; 2C = 1.1 pg) (Tuskan et al. 2006).Black poplar has many different hybrids, lines and somatic clones that already suppliednew genetic resources for poplar breeding.The occurrence of genetic variation at microsatellite loci has not resulted in crucialchanges in clone morphology or functional characteristics since these genetic loci aregenerally considered to be outside the coding regions of genomic DNA. However, thepossibility of somatic mosaicism (Lian et al. 2004), and the ‘somaclone breeding’ hasproduced new genotypes in several plant species such as rice, tobacco and, foragegrasses including Festuca and reed canarygrass (Phalaris arundinacea) (Gyulai et al.2005). Genetic variation of somatic clones of the trees developed in vitro has also beenstudied including oak (Quercus robur), kiwifruit (Actinidia deliciosa), pecan (Caryaillinoiensis), micropropagated clones of trembling aspen (P. tremuloides), transgenicblack poplar (P. nigra) and transgenic hybrid aspen (P. canescens) (Bittsánszky et al.2009). Genotyping of new somatic clones was also urged by DUS (Distinctness,Uniformity and Stability) requirements.Materials and MethodsPlant materials: Clones of Populus nigra and P. canescens (two 35S-gshI clones of11ggs, and 6lgl, and the WT) were maintained and micropropagated in vitro according toGyulai et al. (2005) and Bittsánszky et al. (2009).Shoot micropropagation: First, shoot segments (0.5 cm) were laid onto agar mediamedia supplemented with benzyl adenine (BA, 0.5 mg/l) and naphthalene acetic acid(NAA, 0.2 mg/l) followed by incubation for 28 days in a 16 h photoperiod (1000 lux).Auxiliary shoots developed were dissected and transferred onto hormone-free WPMmedia and incubated for an additional 28 days for rooting. Leaves of rooted shoots wereused for leaf disc cultures according to Gyulai et al. (2005).Somatic clones: Somatic clones of black poplar (Populus nigra) were developed fromcallus cultures of leaf petioles of aseptic shoots. A total of 36 stable somatic clones weredeveloped from two explant donor trees. In total, 29 clones (#1 to 29) developed fromtree N-SL (#30) and 6 clones (#31 to 36) developed from tree N-309 (#37).167

AGRISAFE Budapest, Hungary, 2011DNA extraction: Total DNA samples from 0.1 g leaf tissues of each clone wereextracted in CTAB, cethyltrimethylammonium bromide, buffer (Murray and Thompson1980; Doyle and Doyle 1990) followed by RNase-A (from bovine pancreas) treatment(Sigma, R-4875), for 30 min at 37°C. The quality and quantity of extracted DNAsamples were measured by NanoDrop ND-1000 UV-Vis spectrophotometer, whichenables highly accurate analyses of extremely small samples (2 l DNA) withremarkable reproducibility (NanoDrop Technologies, Delaware, USA – BioScience,Budapest, Hungary).PCR: Hot Start PCR was combined with Touchdown PCR using AmpliTaq Gold TMPolymerase (PE Applied Biosystems, #4316753) or PCR Master Mix (Promega,#M7502). Reactions were carried out in a total volume of 25 l containing genomicDNA of 30 ng According to (Gyulai et al. 2005).ALF analysis: SSR fragments were analyzed by ALF (automated laser fluorometer)using ‘ReproGel High Resolution’ PAGE gel (24 %) (Amersham Bioscience, Sweden -AP Hungary, #17-6001-08) applying short thermoplate (#181123-60) with 40 samplescapacity, prior to UV-linkage for 15 min under ReproSet (#18-1125-64). The separationwas carried out by ALF express II DNA Analyser (#18-1125-07) at 850 V, 50 mA, 50 W,50 C for 120 min followed by computer analysis of ALFwin Fragment Analyser 1.03program (#18-1125-92).SSR Primers: Five microsatellite markers were applied at loci of WPMS2, WPMS4,WPMS6, WPMS20 and PTR4.ZnSO 4 treatment in vitro: Leaves were taken from the aseptic shoot cultures and discs(8 mm) were cut and placed onto the surface of tissue culture media WPM supplementedwith a concentration series of ZnSO 4 (10 -1 to 10 -3 M) followed by incubation for 21 daysaccording to Gyulai et al. (2005). Eight leaf discs per Petri dishes (10 cm) were appliedat each concentration in three repetitions.ICP analysis: After 21 days exposure of discs, sulphur contents of discs (mean values ofthree independent measurements) were determined by inductively coupled plasmaemission spectrometry (Zarcinas et al. 1987).Statistics: At least three independent parallel experiments were carried out in each case.Differences between mean values were evaluated by Student's t-test at P = 0.05.Results and DiscussionMicrosatellite variation of somatic clones (1 to 35) of black poplar (Populus nigra)developed from petiole culture of two explant donor trees N-SL and N-309 werecharacterized at five SSR loci. In total, 317 DNA fragments of twenty microsatellitealleles at five SSR loci were determined by ALF (automatic laser fluorometer). Thenumber of alleles per markers ranged from 1 to 6, with an average of 3.3 includingWPMS2 (5 alleles), WPMS4 (6 alleles), WPMS6 (2 alleles), WPMS20 (6 alleles) andPTR4 (1 allele). Molecular dendrogram (SPSS17) based on the presence versus absenceof SSR alleles separated groups of somatic clones by explant donor plants of N-SL andN-309. Polymorphic markers revealed somatic segregants in one clone (#37) of the sixdeveloped from the N-309 tree, and two (#10, #15) of the 29 somatic clones developedfrom the N-SL tree. Sequence analysis and alignments of microsatellites at the locusWPMS-20 revealed a deletion of (TTCTGG) 5 sequence in the N-SL-24 clone comparedto GenBank accession (NCBI AJ297293) with full length of (TTCTGG) 8 .168

Budapest, Hungary, 2011AGRISAFEThe glutathione (GSH) based phytoextraction strategies rely onthe elevated capacity ofplant sulphate (SO 2- 4 ) uptake regulated mainly by ATP-sulphuryylase (Figure 1).Figure 1a. Phylogeny (MEGA5) with bootstrap values (1000) of genes of ATP-sulphurylases of monocots anddicots BLASTED to P.t. (Populus trichocarpa) (NCBI # XM_ _002315711). R.c. – Ricinus communis; G.m. –Glycine max, A.t. - Arabidopsis thaliana, B.o. . - Brassica oleraces, and A.c. – Allium cepa with the highest S-uptake capacity of plants (scale - relative genetic distances).Somatic clones of P. nigra and transgenic clones of P. canescens treated under sulphatestress in vitro showed different S andZn content. Black poplar was found less active inS-uptake compared to grey poplar in concentrations of ZnSO 4 (10 -1 - 10 -3 mol/ /l).460 470 480 490 500 510 520....|....|....|....|....|....|....|....|....||....|....|.... .|....|....|....|...P.t. GAGTTCCTCCAAACACTTCATTTCAACTCGCTCCGTTTGGAAAACGGGTCGGTTGTTAACATGTCGGTGCCTATTGTGGluPheLeuGlnThrLeuHisPheAsnSerLeuArgLeuGluAsnGlySerValValAsnMetSerValProIleValR.c. ..............T........T....GT..T...C.TA.TG.T.....A........T.....T.....G......GluPheLeuGlnThrLeuHisPheAsnCysLeuArgLeuAsnAspGlySerValValAsnMetSerValProIleValG.m. ..............G....................AC.C..TG.T........C..G........A.....C..C...GluPheLeuGlnThrLeuHisPheAsnSerLeuArgLeuAspAspGlySerValValAsnMetSerValProIleValA.t. ..............T........T........A...C.T..CG....C..C..C...........C...........TGluPheLeuGlnThrLeuHisPheAsnSerLeuArgLeuAspAspGlySerValValAsnMetSerValProIleValB.o. ..............T.................T...C.T..CG....A..C..C..C........T........C..CGluPheLeuGlnThrLeuHisPheAsnSerLeuArgLeuAspAspGlySerValValAsnMetSerValProIleValA.c. .......................T.....CA....A.....TG.......CT....A..T...........G......GluPheLeuGlnThrLeuHisPheAsnSerIleArgLeuAspAspGlySerPheValAsnMetSerValProIleValA.c. .......................T.....CA....A.....TG.......CT....A..T...........G......GluPheLeuGlnThrLeuHisPheAsnSerIleArgLeuAspAspGlySerPheValAsnMetSerValProIleValFigure 1b. Consensus sequence alignments and 3-letter translation (BioEdit) ofparts of genes and proteins ofATP-sulphurylases of monocots and dicots BLASTEDto P.t. (Populus trichocarpa) (NCBI #XM_002315711). Consensus sequences (dots), nucleotide substitutions (letters) and amino acid changes(framed) are indicated.Levels of BCF (BioConcentration Factors, the ratio of sulphur content of leaves dividedby sulphurcontent in the medium / media ‘soil’) of grey and black poplar showed an2-increment by the SO 4 concentrations from 27-29(10 -1 M), to158-184 (10-2 M), and563-667 (10 -3 M), respectively (Figure 2).169

AGRISAFE Budapest, Hungary, 2011Sulphur content (g -1 kg DW)100908070605040302010027P nigra-1862994158511840.1 M 0.01 M 0.001MP x can.-1P nigra-2P x can.-259563P nigra-318667P x can.-3218007006005004003002001000BCF (plant / soil)(mol)2000160012008004000P.c.(Lgl-6)P.c.(ggs11)P.c.(WT)P.nigra(Sc)P.c.(Lgl-6)P.c.(ggs11)P.c.(WT)P.nigra(Sc)10-1 10-2 10-3 10-4Figure 2. Sulphur uptake (0 – 100 g -1 kg DW) capacity of three clones of P. nigra compared to P. canescens (Px can.) under an increased concentration range of ZnSO 4 (from 10 -1 mol/l equal to 3.2 g/kg to 10 -3 mol/l 0.031g/kg) (first small black columns in each case). The levels of BCF (0 – 800) (BioConcentration Factors, theration of sulphur content of leaves divided by sulphur content in the medium/soil) are indicated (left).Selective and unequal concentration dependent ion uptake capacity of cation Zn 2+ and anion SO 4 2- of clones ofP. nigra clones compared to P. canescens (35S-gshI Lgl6 and ggs11) treated with ZnSO 4 (10 -1 to 10 -4 mol/l) inaseptic leaf disc cultures (right).When zinc and sulphur content in the plants were calculated by molar concentrations notan equal rather about a 1:2 ratio was observed (Figure 2). The WT (wild type) of P.canescens showed the highest sulphur uptake capacity at 10 -1 M ZnSO 4 supplementation;however 35S-gshI GMO clone Lgl6 showed extreme sulphur content at 10 -3 M ZnSO 4supplementation (Figure 2).ConclusionsThe results indicate the significance of both breeding methods of clone selection andtransgenics (GMO) in poplar breeding.AcknowledgementsThis paper was financially supported by National Scientific Research Fund OTKA-PD-75169.ReferencesBittsánszky A, G Gyulai, G Gullner, J Kiss, Z Szabó, G Katay, L Heszky, T Kömíves (2009): In vitro breeding ofgrey poplar (Populus x canescens) for phytoremediation purposes. J Chemical Technology and Biotechnology,84, 890-894.Gyulai G, M Humphreys, A Bittsánszky, K Skøt, J Kiss, L Skøt, G Gullner, S Heywood, Z Szabó, A Lovatt, LRadimszky, H Roderick, M Abberton, H Rennenberg, T Kőmíves, L Heszky (2005): AFLP analysis andimproved phytoextraction capacity of transgenic gshI-poplar clones (Populus canescens L.) in vitro. Zeitschriftfür Naturfroschung 60c, 523-537.Lian C, R. Oishi, N Miyashita, T Hogetsu (2004): High somatic instability of a microsatellite locus in a clonaltree Robinia pseudoacacia. Theor Appl Genet, 108, 836-841.Zarcinas BA, B Cartwright, LR Spouncer (1987) Nitric acid digestion and multi-element analysis of plant material byinductively coupled plasma spectrometry. Commun Soil Sci Plant Anal, 18, 131-146.P.c.(Lgl-6)P.c.(ggs11)P.c.(WT)P.nigra(Sc)P.c.(Lgl-6)P.c.(ggs11)P.c.(WT)P.nigra(Sc)170

Budapest, Hungary, 2011AGRISAFEPUTATIVE ROLE OF CELL WALL β-D-GLUCAN IN OATGRAIN EXPOSED TO THERMAL STRESSM. HAVRLENTOVÁ 1 – Ľ. DEÁKOVÁ 2 – A. ŽOFAJOVÁ 1 – Š. MASÁR 1 – P. HOZLÁR 11 Plant Production Research Centre Piešťany, Bratislavská cesta 122, SK – 921 68 Piešťany, Slovak Republic,e-mail: havrlentova@vurv.sk2 University of SS. Cyril and Methodius in Trnava, Faculty of Natural Sciences, Nám. J. Herdu 2, SK – 917 01,Trnava, Slovak RepublicAbstract The effect of genotype and environment (e.g. locality and year) on the variability of β-D-glucancontent was studied in 85 oat genotypes of European provenance. The study was carried out on samples fromdifferent localities in two consecutive years (2006 and 2007). Both genetic and environmental factors had asignificant effect on the variability in the contents of the studied polysaccharide. Naked oats contained more β-D-glucan than hulled oats. The content of this polysaccharide was influenced by year, locality, and genotype,and by the year × genotype and year × locality × genotype interactions. Higher amounts of β-D-glucan weredetected in the drier, warmer year of 2007. In the next experiment a set of eight oat genotypes were evaluated,four naked (with an average β-D-glucan content of 4.6%) and four hulled oats (3.5%). The putative protectiverole of β-D-glucan against thermal stress was studied. Seed samples were exposed to temperatures of 20, 30,40, 50, and 60 °C for 7 or 14 days. After heat stress, the seeds were analyzed for their viability. A statisticallyhighly significant negative correlation (r=-0.98**, P

AGRISAFE Budapest, Hungary, 2011The β-D-glucan level was determined using Mixed-linkage Beta-glucan assay procedure(Megazyme, Ireland) (McCleary, 2006). This method is accepted by the AOAC (Method995.16) and the AACC (Method 32-23). Samples were suspended and dissolved in a0.02 M sodium phosphate buffer (pH 6.5), incubated with purified lichenase enzyme,and an aliquot of filtrate was reacted with purified β-glucosidase enzyme. The glucoseproduct was assayed using an oxidase/peroxidase reagent.The polysaccharide’s evaluations were calculated on a dry-weight basis using SartoriusMA 45 (Sartorius AG, Goettingen/Germany). Results were given as mean ± standarddeviation of two independent determinations using SPSS for Windows Release 11.5.1.program. One-way analysis of variance (ANOVA) was used to compare means andTukey HSD (Honestly Significantly Different) post hoc test to analyze the influence ofgenotype and environment, respectively.Results and discussionIn oat, the β-D-glucan content ranged between 1.7 and 5.7%. Our results arecorresponding to the determined β-D-glucan average values of European oat genotypes(3.9% and 3.6%, respectively) published in the literature (Redaelli et al. 2003,Grausgruber et al. 2004). Our results show that naked genotypes dispose of higher levelsof this metabolite (4.4% on average) in comparison with the hulled oat, where the meancontent was 3.3%. The increased β-D-glucan content is connected with the presence ofgene nud for a hulless type of grain. The β-D-glucan content was in our researchinfluenced by year, locality, and genotype, and interactions of year and genotype as wellas interaction of year, locality, and genotype (table 1). Higher β-D-glucan amounts wereshowed in drier and warmer year 2007, what is comparable result of Peterson et al. 1995,Lazaridou et al. 2008, and others. This could be explicable by pretransport of somesubstances in the plant in the direction to the grain (Dupont and Altebach, 2003). Thecontent of β-D-glucan may be partially reduced after a short period of very hightemperatures (Savin et al. 1997). A possible explanation are results of MacNicol et al.(1993), under which the timing of stress factors such as heat and drought, as well ashumidity is important. If these factors occur and express in grain filling period, they donot affect the content of β-D-glucan (Lazaridou et al. 2008).Table 1. Means squares (MS) from analysis of variance in the β-D-glucan content of analysed oat.Source of variability All Naked oats Hulled oatsdf MS df MS df MSModel 40 82.15** 20 109.43** 20 54.86**Year 1 3.38** 1 1.10** 1 2.40**Locality 1 1.02** 1 1.08** 1 0.15**Genotype 9 12.32** 4 1.13** 4 2.57**Year * Locality 1 0.00 1 0.02 1 0.0 3Year * Genotype 9 0.57** 4 0.14** 4 1.11**Locality * Genotype 9 0.16** 4 0.03 4 0.27**Year * Locality * Genotype 9 0.13** 4 0.14** 4 0.14**Error 200 0.02 100 0.02 100 0.01Total 240 120 120** significant at p≤ 0,01 (effect significant at the level α = 0.01)In naked oat, the β-D-glucan content was on average 4.1 - 4.2% in the year 2006 and 4.3– 4.4% in 2007. In hulled oat, it was in the year 2006 in range 2.7 – 3.0% and 3.0 – 3.3%for the next year, respectively. The β-D-glucan content was higher (4.4% and 3.0% in172

Budapest, Hungary, 2011AGRISAFEboth types of grains) in the locality Vígľaš-Pstruša. In Borovce the amounts were in therange 4.1 – 4.2% for naked oat and 2.8 – 3.1% for hulled one. Generally, colderconditions of cultivation are better for oat cultivation. The knowledge of factorsaffecting the content and variability of dietary fibre and its compounds can facilitatemore effective oat cultivation and its further utilization in the industry.In the experiment with heat stress, it can be assumed that the content of β-D-glucan innaked oat was more stabile (and less variable) compared to hulled oat. This trend wasalso observed in the hulled oat Atego with the highest amount of β-D-glucan (data notshown). To evaluate the effect of monitored cell wall polysaccharide in the plantprotection, seeds were after heat exposure analyzed for their viability. Statisticalevaluation of these results showed that in hulled oat time of heat exposure is significantsource of variability in the β-D-glucan content and highly significant sources aretemperature and genotype (table 2). Statistically highly significant were the interactionsbetween heat stress duration, temperature, and genotype. In naked oat, temperature andgenotype, as well as their interactions, were parameters showing statistically highlysignificant variation in the content of β-D-glucan (table 3).Table 2. Analysis of variance in the viability of analyzed hulled oatSource of variabilityMeanAverageDfsquaressquaresP-valueMain effectsA: time of exposure 115.2 1 115.2 0.0010B:temperature 216.175 4 54.0438 0.0007C:genotype 211.45 3 70.4833 0.0003D:replication 0.2 1 0.2 0.8852InteractionsAB 41.675 4 10.4188 0.3677AC 36.9 3 12.3 0.2859BC 131.925 12 10.9938 0.3373Error 484.025 51 9.49069Total (corrected) 1237.55 79Table 3. Analysis of variance in the viability of analyzed naked oatSource of variabilityMeanAverageDfsquaressquaresP-valueMain effectsA:time of exposure 11.25 1 11.25 0.1391B:temperature 43.05 4 10.7625 0.0868C:genotype 112.3 3 37.4333 0.0003D:replication 1.8 1 1.8 0.5505InteractionAB 21.0 4 5.25 0.3890AC 13.85 3 4.61667 0.4347BC 65.45 12 5.45417 0.3846Error 254.1 51 4.98235Total (corrected) 522.8 79Heritability in β-D-glucan content is in the range of 0.27 to 0.58 (Holthaus et al. 1996)and therefore its content is influenced by both, genetic and environmental factors. Heatstress in our experiment we can estimate as a factor influencing the content of analyzedsubstance. A statistically highly significant negative correlation relationship (r=-0.98**,P

AGRISAFE Budapest, Hungary, 2011germination and temperature, therefore we can estimate high temperature as a stressfactor. To analyze the protective effect of cell wall polysaccharide β-D-glucan,correlation relationship between its content and viability was monitored. In naked oat,the correlation coefficient was r=0.55. For hulled oat it was r=0.10. According to thesepreliminary results we can assume that higher content of β-D-glucan in oat grain couldhave a protective role in the abiotic stress occurred in plant. However, more research hasto be done in this area.ConclusionsOut of 85 oat genotypes, naked oat contains more β-D-glucan (4.4% on average) thanhulled one (3.3%). 10 oats with marginal amounts of this polysaccharide were selectedto evaluate the effect of genotype and environment. Higher amounts of β-D-glucan wereshowed in drier and warmer year 2007 and in naked oats. Therefore in our nextexperiment, the possible protective role of cell wall polysaccharide β-D-glucan wasevaluated. Seed samples of four naked and four hulled oats were exposed totemperatures of 20, 30, 40, 50, and 60 °C for 7 and 14 days, respectively, and after heatstress, seeds were analyzed for their viability. The temperature was evaluated as a stressfactor and naked oats were better adapted to environmental conditions and respondedmore plastic to higher temperature. A correlation coefficient r=+0.55 between the β-Dglucancontent and viability was detected in naked oats, upon which we can assume thathigher β-D-glucan content in naked oat has protective role against thermal stress.AcknowledgementsThis work originated thanks to the support within Operational Programme Research andDevelopment for the project: “Transfer, use and dissemination of research results ofplant genetic resources for food and agriculture” (ITMS: 26220220058), cofinancedfrom the resources of the European Union Fund for Regional Development.ReferencesBuckeridge, M. S., Rayon, C., Urbanowicz, B., Tiné, M. A. S., Carpita, N. C. (2004): Mixed linkage(1→3),(1→4)-β-D-glucans of grasses. Cereal Chem., 81, 115–127.Dupont, F. M., Altenbach, S. B. (2003): Molecular and biochemical impacts of environmental factors on wheatgrain development and protein synthesis. J. Cereal Sci. 38, 133-146.Grausgruber, H., Scheiblauer, J., Schönlechner, R., Ruckenbauer, P., Berghofer, E. (eds.) (2004). Geneticvariation for plant breeding, Proc. 17th EUCARPIA General Congress, Tulln, Austria.Holthaus, J. F., Holland, J. B., White, P. J., Frey, K. J. (1996): Inheritance of β-glucan content of oat grain.Crop Sci., 36, 567-572.Hoson, T. (1998): Apoplast as the site of response to environmental signals. J. Plant Res., 111, 167–177.Hoson, T. (2002): Physiological functions of plant cell coverings. J. Plant Res., 115, 277–282.MacNicol, P. K., Jacobsen, J. V., Keys, M. M., Stuart, I. (1993): Effects of heat and water stress on maltquality and grain parameters of Schooner barley grown in cabinets. J. Cereal Sci., 18, 61-68.McCleary, B. V. (2006): Megazyme: Mixed-linkage beta-glucan assay procedure (McCleary method) [online],[cited: 2008-05-06]. Available from .Peterson, D. M., Wesenberg, D. M., Burrup, D. E. (1995): β-Glucan content and its relationship to agronomiccharacteristics in elite oat germplasm. Crop Sci., 35, 965-970.Redaelli, R., Sgrulleta, D., DeStefanis, E. (2003): Genetic variability for chemical components in sixtyEuropean oat (Avena sativa L.) cultivars. Cereal Res. Commun., 31, 185-192.Savin, R., Stone, P. J., Nicolas, M. E., Wardlaw, I. F. (1997): Effects of heat stress and moderately hightemperature on grain growth and malting quality of barley. Australian J. Agricultural Res., 48, 615-624.Lazaridou, A., Chornick, T., Biliaderis, C. G., Izydorczyk, M. S. (2008): Sequential solvent extraction andstructural characterization of polysaccharides from the endosperm cell walls of barley grown in differentenvironments. Carbohydrate Polymers, 73, 621-639.174

Budapest, Hungary, 2011AGRISAFEEVALUATION OF WINTER WHEAT PRODUCTIVITY UNDERCONTRASTING ENVIRONMENTSA. IVANOVA 1 - N. TSENOV 1 -D. ATANASSOVA 1 -V. DOCHEV 21 Dobrudzha Agricultural Institute, General Toshevo, BG-9520, Bulgaria, e-mail: dai_gt@dobrich.net2 Institute of Agriculture and Seed Science “Obraztsov Chiflik”, Rousse, BulgariaAbstract The aim of the investigation was to evaluate the productivity of winter wheat cultivars grown undercontrasting environments at two locations in Bulgaria. They were grown in two successive years: 2006 wasvery favourable for wheat growing, but one of the severest, longest droughts in Bulgaria for the past 30 yearswas recorded in 2007. Drought tolerance was determined by analyzing the correlations between grain yield andits components and by calculating well-known breeding indices. Different groups of winter bread wheatcultivars were grown at two locations: Obraztsov Chiflik - 20 cultivars; DAI - 7 cultivars. To evaluate theresponse of the cultivars to drought in 2007, various breeding indices known to be suitable for the evaluation ofdrought tolerance in wheat were calculated. All possible correlations between productivity, the effect ofagronomic factors and the breeding indices were analyzed using the statistical software Statistica 7. The valuesof the correlations between productivity and a number of breeding indices were opposite according to thegrowing conditions. A high positive correlation with grain yield and its components was established regardlessof the environment for the indices STI, GMP and MP, so these are suitable for the evaluation of cultivars andbreeding material under different conditions and should therefore be widely used. There was also a highcorrelation between these and the other indices (MSTI, YSI and YI), but with the opposite sign in directrelation to stress. Therefore they should be used only under specific conditions. The indices SSI and TOL arenot suitable for the evaluation of drought tolerance because they have significant but opposite correlations withall traits depending on the occurrence of stress.Key words: winter wheat, grain yield, stress, drought tolerance, breeding indicesIntroductionOne of the main directions of wheat breeding is drought tolerance (Richards, 2006).Under the conditions of the Balkan Peninsula, the alternation of seasons with andwithout droughts is typical (Dragovic et al., 1997). Droughts occur annually in Bulgariaon small areas and are seldom long and severe (Knight et al., 2004). It is a prerequisite touse varieties with some tolerance in mass production (Tsenov et al., 2009) that wouldguarantee maximum yields under the dynamics of changeable seasons. There are anumber of well known indices for precise evaluation of drought tolerance under fieldconditions (Mardeh et al., 2006). Collecting such information is necessary; it is easy anddoes not require the application of specific methods. The known (breeding) indices,besides for evaluation, are also used as an instrument of selection in certain countries(Romania, Iran, Turkey and the Ukraine) where winter wheat is grown underenvironments with unpredictable droughts (Halim et al., 2002; Paunescu et al., 2008;Khayatnezhad et al., 2010). According to some Romanian researchers, one of the mostdifficult directions in breeding is developing varieties with high production potentialrealizable under drought as well (Mustatea et al. 2003). The varieties developed haveeither high drought tolerance or high production potential. The combination between thetwo is extremely difficult. In Bulgarian researches these indices have not been applied,so far, with the exception of one investigation of Tsenov et al. (2008).The aim of this investigation was 1) to find out the effect of drought on winter wheatproductivity; and 2) to investigate the possibility for using the well known breedingindices for evaluation of drought tolerance.175

AGRISAFE Budapest, Hungary, 2011Materials and methodsIn 2007 wheat in Bulgaria gave significantly lower grain yields than normal in 2006. Thedirect effect was assessed to 40% decrease in productivity (Tsenov, 2008). Theproductivity of several groups of cultivars was analyzed as follows: 20 well establishedcultivars were tested at Obraztsov Chiflik (20C) and 7 varieties were tested at DAI (7D).The methodology is described in detail by Ivanova et al. (2009). The traits grain yield,number of productive tillers per m 2 , grain yield per spike, 1000 kernel weight andnumber of grains per spike were investigated. This paper provides data only on grainyield. The following indices for drought tolerance were calculated: SSI – stresssusceptible index (Fischer & Maurer, 1978); STI - stress tolerance index and GMP -geometrical mean productivity (Fernandes, 1992); TOL - tolerance index and MP -mean productivity (Hossain et al., 1990); MSTI -modified stress tolerance index (Naberiet al., 1999); YSI - yield susceptible index (Bouslama & Schpaugh, 1984); YI - yieldindex (Gavuzzi et al., 1997). All existing correlations between productivity, the effect ofthe agronomy factors and the breeding indices at the two locations were calculatedseparately using the statistical program Statistica 7.Results and discussionUnder drought, the correlations of grain yield with the drought tolerance indices differedby value and direction. They were negative and significant with the indices STI and TOLin both ecological field trials (data not given). The correlation of grain yield with meanproductivity MP was contrary in the different trials (Table 1). The correlations with STI,GMP, MSTI, YSI and YI were high and significant regardless of the location’senvironment. This indicates that all these correlations can be used for evaluation ofdrought tolerance under field conditions. The question arises whether such indices canbe used for assessment of wheat under favorable conditions without there being presentstress, as a starting point for their calculation. These indices could probably be used forsuch a purpose because the data show high correlation of yield under favorableconditions with the indices GMP, MP and YI (Table 1).Table 1. Correlations of grain yield with drought tolerance indices in two groups of field trialsEnvironments STI GMP MP MSTI YSI YI7 D Drought 0.547 0.546 -0.065 0.941 0.854 0.99720 C Drought 0.984 0.978 0.959 0.994 0.936 0.987Favorable -0.214 0.752 0.794 0.438 0.079 0.608* Values in bold are significant at least of p=0.05As the conditions of wheat growing in Bulgaria are unique each season this means it isalways possible to draw conclusions about drought tolerance. There are regions inBulgaria (Rousse, Sadovo) where drought occurs annually. For the purposes of breedingthese environments must be used to test new breeding materials at different stages of thebreeding process.The data on the correlations between the individual indices indubitably reveal theimportance of indices STI, GMP and YSI (Table 2). They could all together, and eachone individually, be used as a criterion for objective evaluation of drought tolerance as awhole. Grain yield of a cultivar under variable environments, according to the differentcombinations of duration and severity of drought, can be correctly evaluated and176

Budapest, Hungary, 2011AGRISAFEcompared to other known cultivars. The data obtained in this study confirmed the valueof the indices for drought tolerance evaluation not only in cereals (Jafari et al., 2009;Mohammadi et al., 2010) but in other field crops as well (Porch, 2006; Siahsar et al.,2010).Table 2. Correlations between the indices studiedVariables STI GMP MP MSTI YSIGMP 0.97MP 0.89 0.90MSTI 0.89 0.88 0.61YSI 0.45 0.44 0.32 0.78YI 0.77 0.76 0.55 0.94 0.90* Values in bold are significant at least of p=0.05The index YI showed high correlation with grain yield and with the other indices. It isvery suitable for breeding because drought is not necessary to evaluate the yield of agiven variety against the other cultivars or a check. Furthermore, it implies comparisonto a model variety of known drought tolerance instead to the mean values of a group ofvarieties. Thus it is possible to evaluate the response of a variety under changeableenvironments always against another standard. To some extent this is valid for the indexMP as well, which is used in breeding practice, placing the value of the standard insteadof the value of the yield under stress in the formula.It is known from breeding for drought tolerance that the more tolerant the variety is, thehigher the probability of its realizing low yield (in comparison to the other varieties)under favorable conditions. The climate of Bulgaria is a frequent alternation of yearsfavorable for grain yield with years with stress. Therefore proper breeding would requirevarieties with certain tolerance that would not impede the realization of the productionpotential under favorable conditions. From this point of view drought “tolerance” is aproperty each variety should possess to allow not only stable but also high grain yieldsunder annually changeable environments. Drought tolerance is in general mostimportant, though not determining. The evaluation obtained through the investigatedindices concerns the actual tolerance of a given variety and shows the reliability of theindices as breeding criteria under the conditions of Bulgaria.ConclusionsHigh and positive correlation with grain yield and its components regardless of theenvironment was established for the indices STI, GMP and MP. They are suitable forevaluation of cultivars and breeding material under different conditions and shouldtherefore be widely used.There is also high correlation between them and the other indices (MSTI, YSI and YI)although with the opposite sign in direct relation to stress. Therefore they should be usedonly under specific conditions.The indices SSI and TOL are not suitable for evaluation of drought tolerance becausethey have significant but opposite correlations with all traits depending on theoccurrence of stress.ReferencesBouslama, M., Schapaugh, W.T. (1984): Stress tolerance in soybean. Part I. Evaluation of three screeningtechniques for heat and drought tolerance. Crop Science, 24, 933–937.177

AGRISAFE Budapest, Hungary, 2011Dragovic, S., Stanojevic, D., Valentina, A., Karagic, D. (1997): The intensity of drought in Eastern Serbia andits effect on crop production, In: Jevtic, S. and S. Pekic (Ed). Drought and Plant Production. ARI“Serbia”, Belgrade, Yu, 1, 71-81.Fernandez, G.C.J. (1992): Effective selection criteria for assessing stress tolerance. In: C.G. Kuo (Ed.),Proceedings of the International Symposium on Adaptation of Vegetables and Other Food Crops inTemperature and Water Stress, Publication, Tainan, Taiwan, 257–269.Fischer, R.A., Maurer, R. (1978): Drought resistance in spring wheat cultivars. Part I. Grain yield response.Australian Journal of Agricultural Research, 29, 897–912.Gavuzzi, P., Rizza, F., Palumbo, M., Campaline, R.G., Ricciardi, G.L., Borghi, B. (1997): Evaluation of fieldand laboratory predictors of drought and heat tolerance in winter cereals. Canadian Journal of PlantScience, 77, 523–531.Halim, O. A., Sehirali, S., Baser, I.,. Erdem, T, Erdem, Y., Yorgancilar, O. (2002): Water–yield relation andwater-use efficiency of winter wheat in western Turkey. Cereal Research Communications, 30, 367-374.Hossain, A.B.S., Sears, A.G., Cox, T.S., Paulsen, G.M. (1990): Desiccation tolerance and its relationship toassimilate partitioning in winter wheat. Crop Science, 30, 622–627.Ivanova, A., Nankova, M., Tsenov, N., Kirchev, H. (2009): Effect of some agronomy factors on theproductivity of variety Aglika (Triticum aestivum L.) in Dobrudzha region. Proc. of InternationalConference “Lakes and nutrient loads”, Pogradec 24-26 April, 249-255.Jafari, A., Paknejad, F., Al-Ahmadi, M.J. (2009): Evaluation of selection indices for drought tolerance of corn(Zea mays L.) hybrids. International Journal of Plant Protection, 3, 33-38.Khayatnezhad, M., Zaeifizabeh, M., Gholamin, R. (2010): Investigation and selection index for drought stress.Australian Journal of Basic and Applied Sciences, 4, 4815-4822.Knight, C.G., Raev, I., Staneva, M.P. (2004): Drought in Bulgarian, a contemporary an a log for climatechange. Studies in environmental policy and practice. Ashgate, 336.Mardeh, A., Sio-Se., A., Ahmadi, K., Poustini, V., Mohammadi, R. (2006): Evaluation of drought resistanceindices under various environmental conditions, Field Crops Research, 98, 222–229.Mohammadi, R., Armion, M., Kahrizi, D., Amri, A., (2010): Efficiency of screening techniques for evaluatingdurum wheat genotypes under mild drought conditions. Inter. Journal of Plant Protection, 4, 11-23.Mustatea, P., Saulescu, N., Ittu, G., Pãunescu, G., Stere, I., Tanislav, N., Zamfir, M., Voinea, I. (2003):Genotypical differences in wheat response to drought under conditions of the year 2002, RomanianAgricultural Research, 19-20, 39-48.Naberi, A., Majedi, E., Hashemi, A., Rezae, A., NourMohamedi, G. (1999): Efficiency of indexes for toleranceto environmental stresses in field crops and introduction of a new index, Journal of Seed Plant, 15, 390-402.Paunescu, G., Boghic, O. N. (2008): Performance of several wheat cultivars under contrasting conditions ofwater stress, in central part of Oltenia, Romanian Agricultural Research, 25, 13-18.Porch, T.G. (2006): Application of stress indices for heat tolerance screening of common bean. Journal ofAgronomy and Crop Science, 192, 390-394.Richards, R. (2006): Physiological traits used in breeding of new cultivars for water scarce environments.Agricultural Water Manage, 80, 197–211.Siahsar, B.A., Ganjali, S., Allahdoo, M. (2010): Evaluation of drought tolerance indexes and their relationshipwith grain yield of lentil lines in drought-stressed and irrigated environments. Australian Journal of Basicand Applied Sciences, 4, 4336-4346.Tsenov, N., (2008): Effect of drought on the adaptation and productivity of winter wheat during 2007Agronomist, 8, 18-19 (In Bulg).Tsenov, N., Petrova, T., Tsenova, E. (2008): Estimation of grain yield and its components in winter wheatadvanced lines under favourable and drought field environments, In: Breeding 08, InternationalConference “Conventional and Molecular Breeding of Field and Vegetable Crops” 24-27 November, NoviSad, Serbia, 238-241.Tsenov, N., Petrova, T., Tsenova, E. (2009): Breeding for increasing the stress tolerance of winter commonwheat in Dobrudzha Agricultural Institute Field Crop Studies, 5, 59-69 (In Bulg).178

Budapest, Hungary, 2011AGRISAFEEFFECT OF DROUGHT ON GRAIN DEVELOPMENT INWHEATK. JAGER – A. FÁBIÁN – M. RAKSZEGI – B. BARNABÁSAgricultural Research Institute of the Hungarian Academy of Sciences, H-2462, Martonvásár, POB 19.,Hungary e-mail: jagerk@mail.mgki.huAbstract In the present work histological alterations induced in developing wheat kernels by soil droughtstress were studied. Observations were made on the effect of drought stress, applied in a controlledenvironment during early caryopsis development, on the grain morphology, starch content and yield of thedrought-sensitive Cappelle Desprez and drought-tolerant Plainsman V wheat varieties. As a consequence ofwater withdrawal there was a decrease in the size of the embryos and the number of A and B-type starchgranules deposited in the endosperm, while the development of aleurone cells and the degradation of the celllayers surrounding the ovule were significantly accelerated. Drought stress shortened the grain-filling andripening period and severely reduced the yield. With respect to the recovery of vegetative tissues, seed set andyield, the drought-tolerant Plainsman V responded significantly better to drought stress than Cappelle Desprez.Key words: drought stress, embryo, endosperm, histology, starchIntroductionWater shortage has various effects on crop plants, influencing development, morphologyand physiology, and hence the yield of cultivated crops (reviewed by Barnabás et al.2008; Saini and Westgate 2000). Grain filling is the final stage of grain growth incereals, when the fertilized ovaries develop into caryopses. The duration of this perioddetermines the final grain weight, a key component of the total yield. Drought occurringduring early seed development may cause the abortion of developing kernels, resultingin lower seed set, or the shrinking of kernels, leading to yield losses (Blum 1998). Lowerseed mass affects the development and biomass of the seedlings (Aparicio et al. 2002),and thus the carbohydrate reserves and yield of the next generation. Although waterdeficit during kernel development severely affects the yield, no information is availableon drought-induced histological changes in developing wheat kernels. The aim of thepresent work was to reveal the histological alterations triggered in developing wheatkernels by drought stress during early seed development, resulting in yield losses atharvest. For this purpose, observations were made on the development of the embryos,endosperm cells and aleurone cells, changes in the cell layers surrounding the filialtissues at the histological level and the proportion of starch in the kernels, and these werecompared with yield data.Materials and methodsPlants of the drought-sensitive Cappelle Desprez and drought-tolerant Plainsman Vwinter wheat (Triticum aestivum L.) varieties (n = 112 per genotype) were grown inphytotron chambers using the spring climatic programme T1 (Tischner et al. 1997).Drought stress was generated by total water withholding. Stress treatment was appliedfor 5 days from the 5 th to 9 th day after pollination (DAP). Caryopses of control andstress-treated plants were collected 5, 7, 9, 12 and 14 DAP (n = 5 per treatment at eachsampling date) from the central region of the main spike on three different plants of eachgenotype. The kernels were fixed, washed, dehydrated and gradually infiltrated withepoxy resin according to Spurr (1969). Semi-thin sections (1 μm) were cut at thelongitudinal plane of the kernels using an Ultracut-E microtome (Reichert-Jung,Heidelberg, Germany), stained with periodic acid-Schiff (PAS) and Coomassie BrilliantBlue for polysaccharides and proteins, respectively, and examined using a BX51 light179

AGRISAFE Budapest, Hungary, 2011microscope (Olympus, Tokyo Japan) and image analysis software (Cell P , Olympus,Tokyo, Japan). Fully matured control caryopses and those subjected to water withdrawal(n = 5 per treatment), collected from three independent spikes of each genotype, werebroken in half, sputter-coated with gold and examined using a Zeiss EM 910 electronmicroscope in scanning mode. Developing caryopses of both genotypes were collected atthe end of the treatment (9 DAP) and 5 days after re-irrigation (14 DAP) forstereological analysis. The numbers of A and B-type starch granules, protein bodies andendosperm cells per unit volume were calculated according to Weibel and Gomez (1962)in kernels (n = 3 per treatment and sampling date) from the central region of threedifferent spikes of each genotype. The number of cells and of cell compartmenttransections, the volumetric densities and the compartment sizes required for thecalculation of coefficient β were measured on semi-thin sections randomly chosen fromkernels derived from the three spikes. Twenty plants of each genotype were grown tofull maturity and the yield components were determined. All data were pooled meansfrom the replicates and were statistically evaluated using ANOVA (SSPS for Windows,version 10.0). The total starch content of the mature kernels was measured using theMegazyme amyloglucosidase/alpha-amylase method (AACC, 1999) and expressed on adry weight basis.Results and discussionThe nature and extent of damage caused by drought stress, and the ability of a plant torecover from it, depend not only on the severity and duration of stress conditions, butalso on the developmental stage at which a plant encounters the stress (De Leonardis etal. 2007). In the present experiment drought stress during early seed development alteredembryo development, affected the rate of grain filling, induced early senescence, andshortened the grain-filling and ripening period by 10 days in both genotypes, as reportedearlier (Altenbach et al. 2003; Borrás et al. 2003; Nicolas et al. 1985; Plaut et al. 2004;Westgate 1994). During the early stages of development the embryo size in droughtstressedkernels increased in comparison with control embryos of the same age (Fig. 1a,b). In contrast to the increased size and enhanced development observed during and 5days after water withdrawal, mature embryos were significantly smaller (P

Budapest, Hungary, 2011AGRISAFEFigure 1. Micrographs of control (a, c, e, g) and drough-stressed (b, d, f, h) 14-day-old Plainsman V embryos (a, b),endosperm cells (c-f) and cell layers surrounding the filial tissues (g, h). a: aleurone; ce: cellular endosperm; cc: crosscells; ccl: crushed cell layer; co: coleoptile; cr: coleorhiza; eb: epiblast; hy: hyaline layer; ii: internal cell layer of theinner integument; np: nucellarprojection; oi: outer layer of the inner integument; pa: parenchyma; rp: root pole; rt:root tip; sa: subaleurone; sc: scutellum; se: starchy endosperm; sr: seminal root; te: testa; tc: tube cells; vs: vascularstrands; arrow: protein body; arrowhead: B-type starch granule; asterisk: A-type starchgranule. Bars represent 150 μm(a, b); 20 μm (c-h).Endospermcells of drought-stressedPlainsman V kernels contained a significantlyhigher amount of B-type starch granules 14 DAP than Cappelle Desprez. Scanningelectron micrographs ofmature endosperms showed that drought-stressed plants wereunable to overcome theearly deficiency in the accumulation of B-type starch granulesand maturekernels contained fewer B-type starchgranules than the controls. The totalstarch content of mature control kernels was similar in both genotypes (50.6-51.2%).Water withdrawal caused a more significant reduction in the amount of starchreserves inthe drought-sensitive Cappelle Desprez (36.4%) than in Plainsman V (28.5%).A significant increase was found in the number of protein bodies in treated endospermcells of the tolerant genotype (Fig. 1e, f), which is in agreement with the findings ofOzturk andAydin (2004), who reported elevated protein content in the endosperm as theconsequence of seed development under a low soil water regime. Compared to the relevantcontrols theinitiation of protein bodies occurred 2 days earlier intreated kernels. In bothgenotypes the periclinallydivided one-cell-thick aleurone and subaleurone layers over theperiphery of the developing starchy endosperm were detected 3 daysearlier in drought-stressed181

AGRISAFE Budapest, Hungary, 2011than in control kernels, on the 9 th day of development. The depleted layers of the cellularendosperm became progressively compressed in stressed kernels from the 12 th day ofdevelopment, as the endosperm was packed with starch on one side, while the embryo developedfurther on the other. While the crushed layer of empty endosperm cells in stressed kernels wascompletely formed by the 14 th day of development, in control kernels only a few compressed celllayers were visible at the same age (Fig. 1 b, c). The early initiation of the aleurone layer and theformation of the crushed cell layer, the testa and the hyaline layer (Fig. 1g, h) all indicate theoverall enhanced development of treated kernels; however, the drought-induced changes inPlainsman V kernels occurred earlier in all cases than in Cappelle Desprez. According to Percival(1921), the inner integument remains extant and retains its vitality until the grain has reached itsmaximum size. The early breakdown of the cytoplasm of the inner layer and the formation of thetesta in drought-stressed kernels indicate that the Plainsman V caryopses reached their maximumsize 2 days earlier than Cappelle Desprez, 12 DAP and 14 DAP, respectively.ConclusionsIt can be concluded from the microscopic observations, the yield data and the starch content of thegrains that the drought-tolerant Plainsman V variety responded earlier and to a greater extent todrought stress than the drought-sensitive Cappelle Desprez, at both the whole plant and cellularlevels.AcknowledgementsThis work was funded by the National Office for Research and Technology, Republic of Hungary(NKTH 4-064/04), the Hungarian Scientific Research Fund (OTKA 68099), the EconomicCompetitiveness Operational Programme, Republic of Hungary (GVOP 522/3.1) and the EU-FP7-REGPOT 2007-1 (AGRISAFE No. 203288) project.ReferencesAACC (1999): Approved methods of the AACC, Method 76–13. Total starch assay procedure. Megazymeamyloglucosidase/α-amylase method.Altenbach, S.B., DuPont, F., Kothari, K., Chan, R., Johnson, E., Lieu, D. (2003): Temperature, water and fertilizer influencethe timing of key events during grain development in a US spring wheat. J. Cereal Sci. 37, 9–20.Aparicio, N., Villegas, D., Araus, J.L., Blanco, R., Royo, C. (2002): Seedling development and biomass as affected by seedsize and morphology in durum wheat. J. Agric. Sci. 139, 143–150.Barnabás, B., Jäger, K., Fehér, A. (2008): The effect of drought and heat stress on reproductive processes in cereals. Plant CellEnviron. 31, 11–38.Blum, A. (1998): Improving wheat grain filling under stress by stem reserve mobilisation. Euphytica 100, 77–83.Borrás, L., Westgate, M.E., Otegui, M.E. (2003): Control of kernel weight and kernel water relations by post-flowering sourcesinkratio in maize. Ann. Bot. 91, 857–867.De Leonardis, A.M., Marone, D., Mazzucoletti, E., Neffar, F., Rizza, F., Di Fonzo, N., Cattivelli, L., Mastrangelo, A.M.(2007): Durum wheat genes up-regulated in the early phases of cold stress are modulated by drought in developmentaland genotype manner. Plant Sci. 172, 1005–1016.Nicolas, M.E., Gleadow, R.M., Dalling, M.J. (1985): Effect of post-anthesis drought on cell division and starch accumulationin developing wheat grains. Ann. Bot. 55, 433–444.Ozturk, A., Aydin, F. (2004): Effect of water stress at various growth stages on some quality characteristics of winter wheat. J.Agron. Crop Sci. 190, 93–99.Percival, J. (1921): The Wheat Plant. A monograph. Duckworth and Co., London.Plaut, Z., Butow, B.J., Blumenthal, C.S., Wrigley, C.W. (2004): Transport of dry matter into developing wheat kernels and itscontribution to grain yield under post anthesis water deficit and elevated temperature. Field Crop Res. 86, 185–198.Raeker, M.Ö., Gaines, C.S., Finney, P.L., Donelson, T. (1998): Granule size distribution and chemical composition of starchesfrom 12 soft wheat cultivars. Cereal Chem. 75, 721–728.Saini, H.S., Westgate, M.E. (2000): Reproductive development in grain crops during droughts. Adv. Agron. 68, 59–96.Spurr, A.R. (1969): A low viscosity epoxy embedding medium for electron microscopy. J. Ultrastruct. Res. 26, 31–43.Tischner, T., Kőszegi, B., Veisz, O. (1997): Climatic programmes used in the Martonvásár phytotron most frequently in recentyears. Acta Agron. Hung. 45, 85–104.Westgate, M.E. (1994): Water status and development of the maize endosperm and embryo during drought. Crop Sci. 34, 76–83.182

Budapest, Hungary, 2011AGRISAFECHANGES IN SOYBEAN AND WHEAT YIELDSUNDER NON-IRRIGATED CONDITIONSY. KIRKOVA – V. PETROVAInstitute of Soil Science “N. Poushkarov”, Department of Soil Physics, Sofia 1080, 7 Shosse Bankia, Bulgaria.vera_zamfirova@abv.bgAbstract A six-year field experiment on soybean and wheat grown in rotation was conducted in 2004-2010 ona leached meadow-cinnamonic soil in South Bulgaria (experimental field of ISS “N. Poushkarov” inTsalapitza, Plovdiv region. The climatic years were very different, ranging from drought in 2007 (with highprecipitation sums after July) to very wet in 2005 and with very irregular rainfall distribution. Gypsum blocks,designed in ISS “N. Poushkarov”, were used to evaluate the soil moisture content and an infrared thermometerwas used to evaluate the plant water regime, using the difference (dT) between canopy temperature (Tc) andthe temperature of the ambient air (Ta) to evaluate plant water stress and to determine the moment whenirrigation becomes necessary. The soybean yield varied from 212 kg/da in 2007 to 306 kg/da in 2005 and thewheat yield from 301 kg/dka in 2007 to 500 kg/da in 2006. The relationships between the yield and theprecipitation sum in the period May to September for soybean and October to June for wheat, between theyield and the number of days with a temperature >30 o C, and between the number of days with dT>0 and theprecipitation sum were found to have correlation coefficients of R 2 >0,57 up to 0.99.Key words: plant stress, infrared thermometer, canopy temperature, irrigation, soil moistureIntroductionThe soybean is the crop with multilateral application- for fodder, food, industrial,medical goods and ecological purposes. According to Zolotitzkii, (1962), no one otherplant does not produce for 100 days so many proteins and oil, as soybean produce, noone plant in the world does not compete with soybean on the number of the producingproducts. On the base of the great importance soybean is defined as a “strategic” crop forthe 21-st century (Georgiev, 2005). The soybean is a good forerunner for all agriculturecrops as the result of the atmosphere N using by the process nitrogen-fixing (Goranov etal, 1978).A great provocation of the 21 st century is the global climate warming of the planet, thatincludes and our country and requires adapting to climate change the productiontechnology (Slavov and Alexandrov, 1996; Slavov and Georgiev, 2000; Peev et al,2000).The soybean, as a plant of the monsoon climate, requires significant water quantityduring its vegetation for a normal growth and the most during flowering, pod formationand grain feeling.For high yields water requirements (ETM) are 450 to 700 mm season depending onclimate and length of growing period (Doorenboss et al, 1979).According to Enken, (1959) for the soybean the soil drought has a larger meaning thanthe air drought. The soybean does not exacting to soil- it can growth on the all soil types,including the heavy, swampy and acid soils. As the predecessor of the cereals andespecially of the wheat, it was after all other leguminous crops, because it has a deeproot system and consumed more water and P and it harvest is later (in the most dryperiod) than the other and that makes difficult the soil tillage (acad. Popov et al, 1966).The wheat was widely used for human food it is the most spread agricultural plant in theworld, (acad. Popov et al, 1966).It is the plant that leaves a large root mass and stems rest that has a big role in humuscontent increasing in the soil. The wheat cultivation succumbs to full mechanization andnot requires a lot of work.183

AGRISAFE Budapest, Hungary, 2011For high yields water requirements (ETM) are 450 to 650 mm depending on climate andlength of growing period (Doorenboss et al, 1979).The wheat can be characterized as a middle exacting to wet crop. Water requirementsand consumption are different during different growth stages. The wheat is exacting tosoil.The aim of the study was to establish the climate influence on the crops yield that willallow preventing the climate change damages on the agriculture, i. e. to adapt agriculturetechnologies to the climate changes.Materials and methodsSix-year field experiments (2004- 2010) with wheat Bulgarian variety Sadovo 1 andsoybean variety Daniela in rotation were conducted on leached meadow- cinnamonicsoil in the Experimental station of the “N.Pouashkarov” Institute of Soil Science inTsalapitza, Plovdiv district (East Middle South Bulgaria).The soil characterizes as a loamy- sand to light sand- loamy with high content of thesand fraction and low content of the physical clay (0,01mm) and ill (0,001mm) for theupper soil layers and has a tendency to their increasing in the lower soil layers (Kirkova,1991).The field is with altitude 180- 200 m, underground water level 3,8- 4,2 m, the annualtemperature sum is about 4000 o C, it is the most drought Bulgarian area. This requires anirrigation of the crops.Agrotechnics and fertilization were optimal, none limiting the yield, and only the soilwater regime was yield limiting factor. The suitable technologies and preparations wereapplied for canopies without weeds, diseases and enemies.Soil moisture and plant water status were evaluated respectively by gypsum blocks(Kirkova, 1984; Kolev et al, 1983) and infra red thermometer (difference betweencanopy and ambient air temperature- Tc-Ta, Stoimenov, 2001; Kirkova, 2003) during thevegetation season. The precipitation, air temperature and relative air humidity wereevaluated in this time.The relationships “Yield- Precipitation”, “Yield- number of days with T>30 o C”, “Yieldnumberof days with dT>0” were received.Results and discussionThe climatic years (2004-2010) are very different. The precipitations during wheatvegetation period (X-VI) vary from 119 mm in 2004 to 408 mm in 2007 (fig.5), forsoybean vegetation period (V- IX) - from 154 in 2009 to 485mm in 2007(fig.1), whenfor the long period (1955- 2003) the average sum is 214,9mm. The numbers of days withT>30 o C for wheat in 2004 and 2005 is 0 and in 2007- 11, and for soybean in 2005- 2 andin 2007- 41(Fig.1and 4).The yield of soybean under non irrigation conditions for 2010 is the highest comparedwith the other years. (Fig.1).With the rise of the fallen precipitation the yield increased, however, when rainfallexceeded 400 l/m 2 a decrease in yield (fig.2). The decrease in yield may be due inaddition to the deterioration of air regime of soil washing and even part of the nutrientsin the lower soil layers. The “yield-rain” relationship for 2004-2010 is with highcorrelation coefficient R 2 =0.76.184

Budapest, Hungary, 2011AGRISAFETzalapica, 2004-2010, soybean, non irrigated variantsTsalapica 2004-2010, soya non irrigation variants60045500yield, kg/da, sum ofprecipitation l/m250040030020010002004 2005 2006 2007 2008 2009 2010presipitation yield number of days T>30 numbr of days dT>04035302520151050sum of daysYield kg/da4003002001000y = 2E-05x 3 - 0,0271x 2 + 9,1288x - 580,27R 2 = 0,7577100 150 200 250 300 350 400 450 500 550Presipitation l/m2Figure 1. Yields and climatic parameters forthe different experimental yearsFigure 2. Relationship “yield- sum of rain fall”yield kg/dka350300250200y = -1,9939x + 281,29150R 2 = 0,62481005000 5 10 15 20 25 30 35 40 45sum of days T > 30degYield kg/da500450400350300250200150100500Tsalapica 2004-2010, soya non irrigation varianty = -0,9858x 2 + 30,731x + 143,49R 2 = 0,72850 5 10 15 20 25 30 35numbers of days dT>0Figure 3. Relationship “yield- number of days withtemperature above 30 o C”.Figure 4. Relationship “yield- number ofdays with dT>0”.The relationships “yield-number of days T>30 o C” has a correlation coefficient R 2 =0.63(Fig.3). The number of the days (12) in 2004 is smaller than in 2006 and 2007, but thelowest yield in 2004 may be caused from the lowest precipitation amount (Fig. 1).The relationships “yield-number of days dT>0 o C” has a correlation coefficient R 2=0.73(Fig. 4).The wheat grain yield is the highest in 2009 and 2010, (Fig.5).Tzalapica, 2004-2010, wheat, non irrigaed variantsTsalapica 2004-2010, wheat non irrigation variantsyield kg/da, sum ofprecipitation l/m270060050040030020010002004 2005 2006 2007 2008 2009 20104035302520151050sum of daysYield kg/da7006005004003002001000y = -0,01x 2 + 5,1074x - 81,869R 2 = 0,67270 100 200 300 400 500presipitation yield number of days T>30 number of days dT>0Presipitation l/m2Figure 5. Yields and climatic parameters forthe different experimental yearsFigure 6. Relationship “yield- sum of rain fall”The relationship “Yield- precipitation during wheat vegetation season (X- VI) is shownon Fig.6. The rain fall sum is for all vegetation season (X-IV) the correlation with yieldis R 2 =0, 67.The relation ship “yield- number of days with dT>0 has very high correlation (Fig. 7),that shows the negative influence on this indicator on the wheat grain yield.185

AGRISAFE Budapest, Hungary, 2011Tzalapica, wheat, non irigation variant, yield - sum of daysdT>0800yield kg/dka6005004003002001000y = -4,1563x + 521,18R 2 = 0,97110 10 20 30 40Number of days dT>0Figure 7. Relationship “yield- number of dayswith dT>0”.y = -23,657x + 573,16 aR 2 = 0,5794The relation ship “yield- number of days with dT>30 also has very high correlation. It isevident that when increasing the number of days with T> 30 the yield of wheat fell.ConclusionsAs a result of the significantly variation of the climatic factors (from very wet and cool2005 to very warm and with very irregular distributed rainfall 2007) during four yearsexperimental period is obtained the significantly yield variances under non irrigatedconditions.The coefficient of yield variances is significantly higher than the previous studies, whennot so severe climatic conditions.When eliminate the data from so extreme years, the correlation between soybean andwheat yield and climatic factors is better- coefficient of determination (R 2 ) increased andis usually over 0, 57 up to 0,99.ReferencesDoorenbos, J. et al (1979): Yield response to water, FAO Irrigation and drainage paper, 33, Rome, p.193.Enken, V.B. (1959): Soybean, Moskow. (In Russian)Georgiev, G. et al (1999): Soybean production Technology, Sofia. (in Bulg.)Goranov, H. et al (1978): Soybean, Zemizdat, Sofia, pp.45. (in Bulg.)Kirkova et al (1991): Papers of IV National Symposium with International Participation “Physics- agricultureproduction, 1, 237- 248, (in Bulg.)Kirkova, Y. (1984): Design and investigation of sorption soil moisture transducers, thesis, Sofia,(inBulgarian).Kirkova, Y. (2003): Water Use Efficiency under different irrigation regimes of the crops, Sofia, ISS“N.Poushkarov”(in Bulgarian)Kolev, N.,V. at al (1983): Digital device for measurement soil moisture transducers, Agricultural Techniques, 3Kolev,N.V. et al (1985): Physical methods and technical devices for evaluation of soil moisture, InternationalAgrophysics, 1, 107- 114.Oliveira, Dalziza (2002): A new method to estimate crop evapotranspiration from an empirical canopytemperature and energy balance, Dissertation, University of Nebraska- Lincoln.Peev, B. et al (2000): Unsuitable changes in North Bulgaria climate, Plant-growing sciences, 8, 558- 651Popov, A. et al (1966): Plant-growing, v.1; 2, Zemizdat, Sofia, pp.598.(in Bulg.)Shete, D.T. (1994): Effect of available soil water and farming practices on yield of wheat, 17 th EuropeanRegional Conference on Irrigation and Drainage, Varna, v.1, P 1.12, p.101- 106.Shete, D.T. (1994): Effect of soil moisture, farming practices and emergence date on yield of wheat, 17 thEuropean Regional Conference on Irrigation and Drainage, Varna, v.1, P 1.13, p.107- 113.Slavov, N. and G.Georgiev (1997): Agro- climatic dividing into districts of the soybean production in Bulgaria,Plant-growing sciences, 5-6, 18- 21. (In Bulg.)Slavov, N. and V. Alexandrov (1996): Influence of the future climate change on the agro-climatic resources ofBulgaria, Plant-growing sciences, 9, 72- 77.(in Bulg.)Stoimenov,G. (2001): Evaluation and control of plants water regime by electronic devices to avoid waterstress, thesis, ISS “N.Poushkarov”(in Bulgarian)Zolotitzkii, V. (1962): Soybean in away East, Habarovsk, pp. 250. (In Russian)Yield kg/da60040020000 2 4 6 8 10 12Numbers of days dT>0Figure 8. Relationship “yield- number of days withT>30 o C”.186

Budapest, Hungary, 2011AGRISAFEEFFECT OF DROUGHT STRESS ON THE OIL CONSTITUENTSOF MILK THISTLE(SILYBUM MARIANUM GAERTN. CV. BUDAKALÁSZI)M. MALEKZADE. 1 – S. I. MIRMAZLOUM 2 – H. RABI ANGORAN 3 – A. ALIREZALU 1 –P. RADACSI 21 Department of Horticulture, College of Agriculture, Tarbiat Modares University, Tehran, Iran2 Department of Medicinal and Aromatic Plants, Corvinus University of Budapest, Budapest, HungaryE-mail address: Imanmedica@gmail.com3 Horticultural Department, College of Agriculture, Zanjan University, Zanjan, IranAbstract Milk thistle, Silybum marianum Gaertn. (Astraceae) is an annual or biennial plant. It has beenreported that the oil extracted from milk thistle seed contains essential edible fatty acids. The aim of the presentstudy was to determine the effects of irrigation interval on the fatty acid content of milk thistle. The irrigationintervals were D 1 = 5, D 2 = 10, D 3 = 15 days and D 4 = without irrigation for the mentioned crop. Relative watercontent (RWC) was measured to show the water status of the investigated plants. Mature seeds of milk thistlewere used for the analysis of physicochemical properties such as oil content and composition using GC (FID),according to the AOCS standards. The results proved that the irrigation intervals had significant effects on allthe parameters studied. The lowest RWC was measured in the D 4 treatment (60%) and the highest in D 1 (93%).The total oil content decreased by 4% when the irrigation interval was increased, but the amount ofpolyunsaturated fatty acids (PUFA) increased during drought stress. The highest amount of PUFAs: linoleicacid (42.84%) and linolenic acid (0.65%), were measured in D 4 , whereas the highest amount ofmonounsaturated fatty acids (MUFA): oleic acid (36.67%) and gadoleic acid (0.57%), accumulated in D 1 . Themoisture content of the oil in D 4 decreased to 0.37% and the lowest chlorophyll content, pH, acid value and thehighest refraction index were also measured in D 4 . It was proved that drought stress increased the quality ofmilk thistle seed oil. The high content of unsaturated fatty acids (UFA) in the seed oil can justify theimportance of milk thistle seed oil as an attractive candidate for use in food preparation.Key words: milk thistle, oil constituents, irrigation interval, UFA, PUFAIntroductionMilk thistle, Silybum marianum Gaertn. , is a well known medicinal plant. Its medicinaleffects are documented among the alternative medicines referred to as liver and bilerelateddiseases remedy (Kurkin, 2003; Fraschini et al., 2002). Hence milk thistle widelycultivated due to its striking medicinal values.For obtaining silymarin ( The main important active compound), a special difficulty isisolation of the considerable quantity of fatty oils that may reach to approximately 20-35% which is similar to many vegetable oil seeds (Ramasamy and Agarwal, 2008).ThePUFAs namely α-linolenic acid (18:3n-3) and linoleic acid (18:2n-6) are indispensabledietary components in human body (Huang and Brenna, 2001). These compounds cannotbe synthesized in vivo and they must be ingested as part of the diet (Holman, 1969).Hence, milk thistle oil has been suggested as being suitable edible oil and a vitamin Ereach source (El-Mallah et al., 2003).Like many secondary metabolites, fatty acids and phenolic acid are known to be affectedby biotic and abiotic stresses (Beckman, 2000). Among the different environmentalconstraints, drought is the most important abiotic factor limiting crop productivity in butin some cases the change in plant metabolites could be an advantage of the production.The present study aims to determine the fatty acids content and constituents underdrought stress and evaluating the physicochemical properties of milk thistle seed oilgrown in Tehran-Iran. In this paper for the first time we investigated some biochemicalresponses of this plant when submitted to water deficit.187

AGRISAFE Budapest, Hungary, 2011Materials and methodsThe Field Experiment was carried out at Tarbiat Modares University (TMU), with 1215meters altitude above sea level and 242.7 mm annual precipitation.The soil type was sandy loam (pH 7.68; EC 0.9 dSm -1 ), containing total N (0.2%), totalP (19.18 ppm), total K (328 ppm) and 0.92% of organic materials. The milk thistle seedswere directly sown in the plots in February 2009. Irrigation intervals consisted of D 1 = 5,D 2 = 10, D 3 = 15 days and D 4 = without irrigation considered after fourth leavesdeveloped, until the lapse of plant growth at harvesting time. The yield was measuredand the harvested seeds stored for the further studies.Relative Water Content (RWC) was determined to show the water status of theinvestigated plants. After determining fresh weight, they were immersed in distilledwater for 6 hours to estimate turgid weight, and then the disks were dried at 60 °C for 24h to measure dry weight (Weatherly, 1950).Oil Extraction: 100 g of each seed lots were grounded and 15 g of S. marianum seedswere extracted with n-hexane- using a Soxhlet apparatus for 8 hours (AOCS, 1989). Theextracts containing the oil were then separated and rotary-evaporated at 35 C˚.Physicochemical Properties of Oil: The oil content of seed lots was measured byweighting of oil per 100 g of seed. Moisture content of oil has been measured by AOCSmethods (AOCS, 1993). The total chlorophyll content (mg of pheophytin A /kg oil) ofoil samples were measured by spectrophotometer according to Pokorny et al., (1995).The refractive index was measured by refractometer apparatus at 25˚C (Hoseini, 1994).Acid value of the samples were measured and expressed by mg NaOH / g oil (AOCS,1993) and the pH value of the oil samples also was measured.Fatty Acids Composition and GC AnalysisTransesterification and Preparation of Fatty Acid Methyl Esters (FAMEs)FAMEs were produced to the polarity reduction and measure the precise content of totalfatty acids according to the (USP-NF, 2002). The residue was weighed and resuspendedin 10.0mL hexane for GC analysis.GC AnalysisA Unicam 4600 GC instrument with a 30m length with 0.22 mm internal diameter and0.25 µm thickness fused-silica capillary column BPX70 (SGE, Melbourne, Australia)was used. The quantification of FAMEs was realized by integration of the FID peak areaand comparing their retention times with standards (El-Adawy et.al, 1999). All the GCanalyses were run in triplicate and the average values were reported in the work.Statistical analysisThe data were statistically analyzed by (ANOVA) with SAS software. Means werecompared by the Duncan’s multiple range test at P

Budapest, Hungary, 2011AGRISAFETable 1. Physicochemical properties of milk thistle seeds under different irrigation intervals regimeTreatmentMoisture ContentChlorophyllRefract Index pH Value%ScaleAcid ValueD 1 0.61 a 1.55 a 6.78 a 1.25 c 0.48 aD 2 0.61 a 1.52 a 6.70 a 1.26 c 0.48 aD 3 0.41 b 1.27 b 6.56 b 1.36 b 0.44 bD 4 0.37 c 0.55 c 6.54 b 1.45 a 0.34 cMeans in columns with different letters are significantly different at (p≤0.05)The oil composition of milk thistle was determined having 8 detectable fatty acids asshown in table 2.Table 2. Fatty acids composition (%) in oil extracted from milk thistle seeds under different irrigation intervalsregimeSaturated Fatty Acids %Monounsaturated PolyunsaturatedFatty Acids % Fatty Acids %T BehenicAcid(C22:0)ArachidicAcid(C20:0)PalmiticAcid(C16:0)StearicAcid(C18:0)OleicAcid(C18:1)GadoleicAcid(C20:1)LinoleicAcid(C18:2)LinolenicAcid(C18:3)D 1 2.48 c 3.61 c 10.22 a 6.86 c 36.67 a 0.57 a 39.7 d 0.45 dD 2 2.56 b 3.86 b 9.44 b 7.38 b 36.17 b 0.56 a 39.82 c 0.50 cD 3 2.56 b 3.88 b 9.43 b 7.53 a 34.08 c 0.53 b 41.21 b 0.53 bD 4 2.63 a 4.06 a 9.17 c 7.57 a 32.78 d 0.50 c 42.84 a 0.65 aMeans in columns with different letters are significantly different at (p≤0.05)The results of variance analysis of total oil content of milk thistle seed oil under droughtstress are presented in Figure 1.Oil content (%)35302520151050abD1 D2 D3 D4bcTreatmentsFigure 1. Total oil content of milk thistle seed oil under different irrigation intervalsTotal oil content, decreased by almost 5%. The saturated fatty acids (SFAs), namely,behenic, arachidic and stearic acid increased with increasing water deficiency, whereasthe palmetic acid which is also a SFA, decreased under the drought stress. Concerningthe total SFAs content (23% of total oil content), less than 1 percent accursed whileirrigation intervals increased. On the other hand, the variance of the UFAs with almost75% of the total oil content, showed about 0.5% change amongst the treatments. Thehighest amount of MUFAs measured in D 1 for oleic and gadoleic acid with 37.67 % and0.57 %, respectively. Intriguingly, the amount of the PUFAs which are the mostimportant constituents of the edible oils, showed about 5% increase according to thedrought stress.The highest concentration of the linoleic and linolenic acids were measured in D 4 by42.84% and 0.65%, respectively (Figure 2).189

AGRISAFE Budapest, Hungary, 2011C18:3n-3 (%)0,70,60,50,40,30,20,10adcbD1 D2 D3 D4C18:2n-6 (%)44434241403938373635bacdD1 D2 D3 D4TreatmentsTreatmentsFigure 2. Linolenic and linoleic acids concentration (%) of milk thistle seed oil under drought stressThe fatty acid composition in our results was comparable with the statements of Fathiand Azadmard (2009). These seeds have relatively high oil content (25–29%)comparable with the other oilseeds like sunflower.ConclusionAccording to the results of this study, milk thistle seed oil could be a rich source ofpolyunsaturated fatty acids which makes it an interesting candidate from a nutritionalpoint of view. The drought stress can improve the quality of the oil significantly towardsthe increasing of polyunsaturated fatty acids. The extracted oil was similar to sunfloweroil and might be used as a salad oil, as cooking oil alone or mixed with other vegetableoils, especially mixed with saturated oils to improve their nutritional value. Even though,its stability during food preparation as well as during storage, still need more study.ReferencesAOCS. (1989). Official methods and recommended practices of the American Oil Chemist s Society.Champaign: American Oil Chemist s Society, Method Ce-66.AOCS. (1993). Official Methods and recommended practices of the American Oil Chemists’ Society. 4thedition. Champaign. IL: AOCS Press.Beckman, C.H. (2000). Phenolic-storing cells: keys to programmed cell death and periderm formation in wiltdisease resistance and in general defense responses in plants? Physiol. Mol. Plant. Path. 57, 101–110.El-Adawy, T. A., Rahma, E. H.; El-Bedawy, A. A. and Gafar, A. F. (1999). Properties of some citrus seeds.Part 3. Evaluation as a new source of protein and oil. Nahrung, 43, 385-391El-Mallah MH, El-Shami SM, Hassanein MM. (2003). Detailed studies on some lipids of Silybum marianum(L.) seed oil. Grasasy Aceites 54, 397–402.Fathi-Achachlouei, B. and Azadmard-Damirchi, S.(2009). Milk thistle seed oil constituents from differentvarieties grown in Iran. J Am Oil Chem Soc, 86, 643–649Fraschini F, Demartini G, and Esposti D. (2002). Pharmacology of silymarin. Clin. Drug Invest. 22(1), 51–65.Holman R. (1969). Biological activities of and requirements for polyunsaturated acids. Progress in theChemistry of Fats and other Lipids.; 9, 611–680.Hoseini Z. (1994). Common methods in food analysis. Shiraz University Publication. Shiraz, Iran. 210 pp.Huang, M. Ch. and Brenna, J. T. (2001). On the Relative Efficacy of α -Linolenic Acid and PreformedDocosahexaenoic Acid as Substrates for Tissue Docosahexaenoate During Perinatal Development. FattyAcids: Physiological and Behavioral Functions, edited by David I. Mostofsky, Shlomo Yehuda, andNorman Salem Jr. , Chapter6, p.99Kurkin, V. A. (2003). Saint-Mary thistle: a source of medicinals. Pharmaceut. Chem. J. 37(4), 189–202.Pokorny, J. , Kalinova, L. and Dysseler, P.(1995). Determination of chlorophyll pigments in crude vegetableoils. Pure & Appl. Chem., 67(10), 1781-1787Ramasamy, K. , Agarwal, R. (2008). Multitargeted therapy of cancer by Silymarin. Cancer Letters 269, 352–362.USP-NF. (2002). United States Pharmacopeia. 25th Revision and National Formulary. (USP 25-NF 20), 20thed. United States Pharmacopeia Convention, Rockville, MD.Wheatherley, P.E. (1950). Studies in the water relations of the cotton plant. 1. The field measurements of waterdeficits in the leaves. New Phytol. 49, 81–97.190

Budapest, Hungary, 2011AGRISAFEIMPROVING THE FROST RESISTANCE AND ADAPTABILITYOF BARLEY UNDER THE CONDITIONS OF NORTH-EASTERNBULGARIAG. MIHOVADobroudzha Agricultural Institute, General Toshevo, Bulgaria, gm_mihova@abv.bgAbstract Low temperatures are a main limiting factor for barley production in North Bulgaria. Resistance tothis type of abiotic stress is an extremely complex and dynamic character. The necessity to evaluate a numberof indices in various combinations additionally complicates both theoretical investigations on this problem andthe breeding process. Increasing frost resistance is a crucial task in the barley breeding program at theDobroudja Agricultural Institute. As the result of targeted research, considerable genetic variability has beendeveloped. Lines with higher yield stability under stress have been selected.During the 2005–2010 period the adaptability of forage barley lines combining enhanced frost resistance andproductivity was investigated. The years of the study varied significantly with regard to meteorologicalconditions. This allowed the evaluation of the responses of the genotypes to extreme freezing temperatures,recurrent spring cold and drought. Two of the harvest years were favorable for the development of barley. Thevalues of the structural components of the yield showed that some of the breeding lines possessed goodproduction potential and tolerance to various types of abiotic stress. Strong negative correlations betweenimportant economic traits and cold resistance were overcome.Key words: barley, breeding traits, abiotic stress, frost resistanceIntroductionSustainable grain production worldwide and its price are directly dependent on thevariations of climate. A main direction of breeding research work on barley atDobrudzha Agricultural Institute – General Toshevo is developing varieties with highadaptability potential, and with enhanced frost resistance in particular (Mihova andPetrova, 2005). The production of cereals, including barley, is mostly concentrated in thenorth-eastern part of Bulgaria. The yields obtained here considerably exceed the average.A limiting factor for barley production in this region is the unfavorable winterconditions. The winters are with low absolute temperatures often without snow cover,and there is occurrence of warm periods of unhardening and late spring colds. As a resultfrom combining various methods, we developed breeding lines with good combinationbetween the yield components and this type of stress. The possibilities to involve them inbreeding were investigated.The aim of this study was to evaluate the adaptability potential of fodder barley lineswhich combined enhanced frost resistance with good productivity.Materials and methodsThe investigation was carried out at Dobrudzha Agricultural Institute during 2005 –2010. Twelve fodder barley lines of high frost resistance were subjected to investigation(Table 1). Their response was compared to the widely distributed cultivar Veslets, thenational standard for varietal testing. The selection criteria were: different dates toheading and economic maturity, tolerance to the economically important diseases for thisregion (leaf rust and powdery mildew), productivity and resistance to unfavorable winterconditions. Besides under field conditions, frost resistance was preliminary evaluatedunder laboratory conditions as well using the method of Tsenov and Petrova (1984). Theexperiment was designed in five replications, the harvest plot area being 10 m 2 . Thesowing norm was 430 germinating seeds per m 2 . The previous crop was grain peas. Theagronomy practices were in accordance with the adopted technology for growing of this191

AGRISAFE Budapest, Hungary, 2011crop (Gramatikov et al., 2004). The year conditions during the investigated period variedconsiderably (Table 2). Based on the phenotypic characteristics, the investigatedvarieties were compared by using PC analysis (Annicchiarico, 2002; Yan et al., 2007).The experimental data was processed with the help of the program packages MicrosoftExel xp and STATISTICA, release 7.0 (StatSoft Inc., 2004).Table 1. Investigated breeding lines and pedigreeBreeding linesPedigreeDAI 697Skorohod х HemusDAI 316Izgrev x RadonDAI 615(Skorohod x Tirchmir-22) x ProductiveDAI 809(Paralellum 105 x Jerun) x (Kozyr х Hemus)DAI 791Zenit х (Hemus x Miraj)DAI 794Miraj x (Secret х Zenit)DAI 815Radon х IzgrevDAI 489 Vavilon х P 713DAI 513(Cyclone х BIC V/113) x ME 92 II/756DAI 509 Radical х Mirgen 2DAI 286Toman х VavilonDAI 426 Mironovski 87 x P 954Table 2. Differentiation factors by yearGrowing Extreme Extreme Sum of rainfallsseason min t, °C max t, °C (X-VI), mmDifferentiation factors by year2004/2005 -17.0 30.4 421.8 BYDV occurrence2005/2006 -20.0 30.4 403.8Severe winter conditions, occurrence of netblotch2006/2007 -9.5 29.4 187.3Severe drought during the entire growingseason2007/2008 -17.0 32.7 502.6 Favorable conditions2008/2009 -16.5 32.0 579.3 Drought during booting and heading2009/2010 -21.8 32.5 640.7High absolute temperatures during grainfilling, occurrence of leaf rustResults and discussionThe requirements to the new varieties are related to the improvement of an increasingnumber of traits. A large part of them are of quantitative nature. The genotype xenvironment interaction additionally complicates the breeding process and the selectionin the hybrid populations. The combined application of different methods andapproaches allows increasing the efficiency of this process and its shortening.Productivity is a complex polygenic trait which is often evaluated within the context ofsuch terms as adaptability and stability. In most cases these terms are used in differentsenses (Becker and Leon, 1988). Most often adaptability means the genotype’s ability torealize its potential under various environments, while stability is defined within itsnarrower norm of response. The continental climate of the region where DAI is situatedcontributes to the manifestation of different types of stress. The main problems ofenhancing winterhardiness in barley are: the extremely limited world gene pool and thesmall number of suitable sources for developing genetic variability; the different formsof winter resistance manifestation and the complexity of the genetic systems whichdetermine it; the strong genotype x environment interaction; the difficult selection understress due to changes in the heritability regularities; negative correlations with valuable192

Budapest, Hungary, 2011AGRISAFEbiological and economic traits. In this relation it is necessary to investigate the responseof promising materials under changeable environments. The year has a major effect onthe total variation of the productivity in the collection of lines with enhanced frostresistance (Table 3). The differences were significant at genotype level as well. Thepercent of Y x G interaction was 15.8 %. It was accounted for mainly by the differencesin the phenological development of the genotypes and their response to biological stress.PC analysis was applied to compare the production potential of the lines (Figure 1). Thefirst two main components explain 40.52% and 27.00 % of the total variation,respectively. Highest grain yield was obtained in harvest year 2007/08, which wasfavorable for the development of all cereals in this region. Yield was respectively lowerin 2004/05 when the main limiting factor was the occurrence of BYDV. The harvest year2005/06 was favorable for differentiation of the varieties by their winterhardiness. Theabsolute minimal temperatures dropped to -20 o C without snow cover. The registeredproductivity was above the productivity averaged for the investigated period andinsignificantly lower than the productivity in the favorable year. This was due not onlyto the good frost resistance of the materials but also to their successful compensation ofstress through the components of yield. The mean yield obtained in 2006/07, a year ofTable 3. Analysis of variance for grain yieldSource of variation df Sum of squares F F critTotal 389 658.0Year (Y) 5 364.2 164.70 2.24Genotype (G) 12 51.3 9.67 1.78Y x G 60 104.4 3.93 1.36Error 3122,01,5DAI794DAI7911,5DAI316DAI6971,0DAI615DAI809DAI7911,02006/07VesletsDAI8092007/08DAI8150,5PC 10,5 2004/050,0DAI489 2009/10DAI2862005/06PC 20,0-0,5VesletsDAI489DAI815DAI794-0,52008/09DAI426 DAI509DAI513-1,0DAI426DAI513DAI286-1,0DAI316DAI697DAI615-1,5DAI509-1,55,0 5,5 6,0 6,5 7,0 7,5 8,0 8,5Mean Yield, t ha -1-2,0-1,5 -1,0 -0,5 0,0 0,5 1,0 1,5 2,0PC 1Figure 1. Biplot model for grain yield of lines tested during 2005 – 2010 and two-dimensional groupingobtained from the first two principal componentssevere drought, was only slightly lower. A part of the lines combined frost resistancewith early maturation: traits, which are difficult to combine. Under the above conditionsthese lines had advantage over the lines with later dates to heading. Lines DAI 489 andDAI 815 had productivity above the average and good adaptability to changeableenvironments. Line DAI 286 gave lower yield but it also demonstrated good stability.This line was characterized with tolerance to drought and high temperatures during grain193

AGRISAFE Budapest, Hungary, 2011filling. The position of lines DAI 615, DAI 697 and DAI 316 in the upper left corner ofthe biplot implies specific response under stress and higher variation of yield by year.Accelerated development and early date to heading were typical for this group of lines.A high percent of sterility was observed in the group due to the late spring frosts in thisregion. Lines DAI 426, DAI 513 and DAI 509 exhibited very high level of frostresistance. They had higher requirements to vernalization duration and were susceptibleto the photoperiod. This is related to their prolonged pnenological development whichprovides advantage only in years of very unfavorable winters. Lines DAI 809 and DAI791 possessed similar componential structure. The high PC 1 values were an indicationof their positive response to the environment but also of their instability. The lowestyield from these lines was registered in the year with occurrence of BYDV. DAI 794was the line with productivity above the average and stable yields by year.ConclusionsAs a result from purposeful research work towards increasing winter resistance ofbarley, significant genetic variability was developed. Lines with high yield stabilityunder various stress conditions were selected. Some correlations of frost resistance withthe growth rate during winter and the date to heading were broken. Lines DAI 489, DAI815 and DAI 794 are suitable for national varietal testing.ReferencesAnnicchiarico, P. (2002): Genotype × environment interactions. Challenges and opportunities for plantbreeding and cultivar recommendations, pp. 115. In: Plant production and protection paper. FAO, Rome.Becker, H., Leon, J. (1988): Stability analysis in plant breeding. Plant Breeding, 101, 1-23.Gramatikov, B., Penchev, P., Koteva, V., Krusteva, H., Stankov, St.,Navushtanov, St., Zarkov, B., AtanassovaD. (2004): Technology for barley growing. PSSE, Sofia, 64.Mihova, G., Petrova, T. (2005): Tendencies of barley breeding at Dobroudja Agricultural Institute. ScientificWorks , Agricultural University – Plovdiv, , vol. L, book 5, 7-16.StatSoft, Inc., (2004): STATISTICA (data analysis software system), version 7. www.statsoft.com.Tsenov, A. and Petrova, D. (1984): Methods of asses breeding materials of winter cereals and legumes forabiotic stress. Plant science, 21, 77-87.Yan, W., Kang, M., Ma, B., Woods, Sh., Cornelius, P. (2004): GGE biplot vs. AMMI analysis of genotype –by – environment data. Crop Science, 47, 643-655.194

Budapest, Hungary, 2011AGRISAFEGENOME-WIDE ASSOCIATION MAPPING FOR EARLY ANDLATE DROUGHT TOLERANCE IN A DIVERSE BARLEYCOLLECTIONK. NEUMANN 1 – A. F BALINT 2 – F. SZIRA 2 – M. BAUM 3 – R. K VARSHNEY 4 –A. BÖRNER 11 Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Corrensstrasse 3, 06466 Gatersleben,Germany, e-mail: neumannk@ipk-gatersleben.de2 Agricultural Research Institute of the Hungarian Academy of Sciences, Brunszvik u. 2., Martonvásár, Hungary3 International Center for Agricultural Research in the Dry Areas (ICARDA), Damascus Highway, Tel Hadya,Aleppo, Syrian Arab Republic, Syria4 International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) Patancheru 502324Andhra Pradesh, IndiaAbstract Studying drought tolerance interactions in several developmental stages to map QTL in bi-parentalpopulations is often impossible due to low polymorphism (genetic or phenotypic) in at least one stage. Adiverse spring barley collection was investigated for a genome-wide association study and extensive screeningswere examined in the early and adult stages. The genotypes were selected for differences in drought tolerance.Tests in the germination and seedling stages were based on osmotic stress induced by polyethylene glycol. Inthe adult stage, drought tolerance was tested using a rainout shelter, a foil tunnel and with the method ofchemical desiccation using potassium iodide. The spring barley collection includes wild barley, landraces andcultivars. Diversity Array Technology (DArT) markers were used for genotyping. Population structure and theextent of linkage disequilibrium (LD) were studied intensely. The genotypes were divided into wild andcultivated barley and into two- and six-row groups with different origins. The decay of LD is fast, offering afine resolution of the identified loci. The marker-trait associations were calculated in TASSEL using differentgeneral linear and mixed linear models. The complexity of the interaction of relevant traits for droughttolerance could be seen at the genetic level. More than 200 loci were found for all the traits, and many lociwere shared between the different developmental stages. Root traits were often associated with yield traits.Comparison with the literature showed many of the detected loci were involved in earlier studies, sometimesassociated with different, but often with similar or the same traits. Several loci could be identified, wheredehydrins may represent the causal gene. Loci for yield components over a range of different studies were alsoidentified. The results of this study highlighted the difficulties in breeding for drought tolerance, but alsoshowed the value of deep phenotyping and of association mapping for such a complex trait.Key words: barley, drought tolerance, association mappingIntroductionDrought is a major abiotic stress factor that can cause high yield reduction in cropproduction. Global warming will increase the drought frequency and severity especiallyin already affected areas as Africa and large parts of Asia. The predicted high growthrate of human population will act as an aggravating factor. Yield losses of up to 30% forcereals and maize are expected (Rahmstorf and Schellnhuber, 2007). Therefore, breedingfor drought tolerant genotypes is urgent. Gains in cereal yields in the last five decadeswere mainly based on breeding success. But in non-optimal growth areas gain in yieldwas less (Richards, 1996). Breeding for stress environments should be done in stressconditions and therefore requires extensive phenotyping experiments (Ceccarelli, 1989).Though conventional breeding strategies are highly successful, they are slow and theongoing climate change requires fast breeding success for ensuring future foodproduction. Selecting genotypes based on molecular marker information, marker assistedselection (MAS), is such a new breeding strategy. But still the influence of MAS inbreeding is only marginal (Koebner, 2004) because of several disadvantages in biparentalQTL-studies that were used to identify the markers. They include the long timefor population development, a low level of polymorphism and large confidence intervals195

AGRISAFE Budapest, Hungary, 2011for the loci. The poor resolution of the loci is based on large-scale distance linkagedisequilibrium (LD) in the progeny of bi-parental crosses. Using the approach ofassociation mapping avoids those disadvantages. Here, a collection of genotypes is used,what offers more polymorphism and a more representative genetic background and lesstime to build up a collection. Most important is the much finer resolution of the loci, asnatural recombination has already reduced the level of LD. Challenging in this approachis the population structure of such a collection as it can result in false positiveassociations and hence must be investigated and included in the statistical models.Materials and methodsThe barley collection (BC) used for association mapping consists of 223 different springbarley genotypes including cultivars and landraces (Hordeum vulgare subsp. vulgare L.),and wild barley (H. vugare subsp. spontaneum L.). The accessions come from altogetherthirty different countries, but the focus is on the dry areas of the Near East and NorthAfrica as the genotypes were selected for their difference in drought tolerance. DiversityArray Technology (DArT) markers were used for a genome wide association study.Triticarte Pty. Ltd (Canberra, Australia; http://www.triticarte.com.au) provided 703polymorphic DArTs. Population structure was tested with the software STRUCTUREand the resulting Q-Matrix was further used in the calculation of the associations ofmarker and traits. The level of LD was investigated with Tassel regarding the LD in thewhole BC and in the different subgroups. Five different phenotypic experiments wereperformed with the BC, two in juvenile developmental stages and three in adult stage.The two tests in juvenile stage were performed using polyethylene glycol (PEG) toinduce osmotic stress. The germination test was done on filter paper, where the seedsgerminated on Aqua dest. or 15% PEG, respectively. The number of germinated seedswas counted and the maximum root and shoot length and the coleoptile length weremeasured. Hydroponics with Hoagland-nutrient solution in control and Hoagland plus15% PEG in stress condition were used for the seedling test. After two weeks oftreatment maximum root and shoot lengths as well as the root and shoot fresh and dryweights were measured. The three stress experiments in adult stage include a potexperiment in a foil tunnel where water was withheld seven days after flowering, a fieldexperiment using the method of chemical desiccation for simulating severe stress using1.5% potassium iodide (both in Gatersleben), and a rain out shelter test in 2008 and 2009in Martonvasar. In adult stage data for grain yield and yield related traits as thousandgrain weight (TGW) as well as morphological traits were analysed.Results and discussionPopulation structure resulted in the presence of five subpopulations with STRUCTURE.Grouping was based on the differentiation of wild and cultivated barley, as well on rowtype and origin. The level of LD compared to other studies is low. In the BC LD decaysfast within 1 cM to r 2 -values below 0.2. Also in the five subgroups the LD decay is fast,though a bit lower compared to the BC. The fastest decay here showed the wild barleygroup. Fast LD decay offers a fine resolution of possible loci. Phenotypic variation washigh for all traits. Often the subgroups showed significant phenotypic differences;especially the wild barleys (group Q5). They showed a different root system as theyexhibit longer root growth but lower root weights, in contrast to the shorter but denserand hence higher weight of roots in cultivated barley (groups Q1 – Q4). On the other196

Budapest, Hungary, 2011AGRISAFEhand they were the less tolerant in shoot weight in seedling test (Fig. 1). Root lengthcould be a morphological adaptation to avoid drought in nature but this is no advantagein a hydroponic test system.Figure 1. Phenotypic differences in Q-groupsControlStressControlStressRoot length in cmShoot fresh weight in mgaQ1 Q2 Q3 Q4 Q5bQ1 Q2 Q3 Q4 Q5Over all experiments and traits altogether 212 loci were identified. Most of them showedassociations to several traits. Often yield traits and vegetative traits from the early stageswere associated to the same loci. One locus on 2HS (30.2 cM) was associated with grainnumber per plant, yield per plant and yield per line only in the stressed part of the rainout shelter experiment in both years and with the root tolerance index of the seedlingtest. Another locus on 7HS (3.5 cM) showed associations to root and shoot traits in theseedling test as well as to yield related traits in all three adult experiments. While in therain out shelter this locus was associated with TGW in dry conditions only, in the fieldtest in Gatersleben it was linked with TGW in control conditions but in the foil tunnelexperiment with grain weight per plant in stress conditions. While these two loci on 2HSand 7HS are new identified loci for yield traits, several others are in accordance topreviously identified loci. One example is a locus on 2HL (82- 83 cM) that is associatedwith several vegetative traits in both early stages (e.g. coleoptile length in germinationstage, root and shoot length and shoot fresh weight in seedling stage) and with yieldrelated traits in both control and stress conditions in the foil tunnel experiment. Thislocus was identified for yield traits also by Xue et al. (2010) and Pswarayi et al. (2008)and for shoot dry weight by Xue et al. (2009) and Naheif (2009). All these studies usedDArT-markers. Using a consensus map by Wenzl et al. (2006) this locus is also veryclose to Bmag378 that is involved in QTLs for plant height (Pillen et al., 2003), TGWand lodging (Pillen et al., 2004) and may indicate the same locus. At least four lociidentified in our study are in accordance to positions of dehydrins. These LEA D11proteins are accumulated during late embryogenesis and in reaction to dehydration, coldand salt and have a putative role in drought tolerance (Choi et al., 1999). In the range ofDhn6 on 4HS there are four close loci in our study (60 – 65 cM), which haveassociations to traits as root length or tolerance index for shoot fresh and dry weight inseedling stage but also to yield traits. Naheif (2009) identified a locus there linked torelative water content, proline content and root length. Located on 5HL is Dhn9, wherewe found markers associated with the tolerance index of root fresh and dry weight inseedling test, to shoot length in stress in germination test and with yield traits in controlof the chemical desiccation test. The dehydrin cluster of Dhn3, Dhn4, Dhn5 and Dhn7197

AGRISAFE Budapest, Hungary, 2011located on 6HL is in accordance with a locus (68 cM) associated to vegetative traits inboth early stages and to yield and vegetative traits in adult tests and was also associatedwith stress tolerance traits in the study of Naheif (2009). Also located on 6HL is Dhn8,in which range we identified a locus (74 cM) linked to stress tolerance in both earlystages and to yield traits in the foil tunnel experiment. Again in the study of Naheif(2009) root and shoot weights were associated in that region too.ConclusionsDrought tolerance is highly complex and a mixture of traits that interact with each other.Our study showed that association mapping has the power to give insights into thegenetics and interaction of these traits. We could identify new loci and loci that are inaccordance with loci from other association or QTL-studies. Furthermore, knowncandidate genes as dehydrins might be the causing gene for some loci.AcknowledgementsThis paper was financially supported by the Kultusministerium’ of Saxony-Anhalt.ReferencesCeccarelli, S. (1989): Wide adaptation: How wide? Euphytica. 40, 197-205.Choi, D.-W., Zhu, B., Close, T.J. (1999): The barley (Hordeum vulgare L.) dehydrin multigene family:sequences, allele types, chromosome assignments, and expression characteristics of 11 Dhn genes of cvDicktoo. Theor Appl Genet. 98, 1234-1247.Koebner, R.M.D. (2004): Marker-assisted selection in the cereals: the dream and the reality. In P.K. Gupta andR.K. Varshney (ed.) Cereal genomics. Kluwer Academic, Dordrecht, the Netherlands 317–329.Naheif, E.M.M. (2009): Association mapping for drought stress related traits in a structured population withwild and cultivated barley. Ph.D.-thesis Rheinische Friedrich-Wilhelms-Universität Bonn.Pillen, K., Zacharias, A., Leon, J. (2004): Comparative AB-QTL analysis in barley using a single exotic donorof Hordeum vulgare ssp. spontaneum. Theor Appl Genet. 108, 1591–1601.Pillen, K., Zacharias, A., Leon, J. (2003): Advanced backcross QTL analysis in barley (Hordeum vulgare L.).Theor Appl Genet. 107, 340–352.Pswarayi, A., van Eeuwijk, F.A., Ceccarelli, S., Grando, S., Comadran, J. et al. (2008): Changes in allelefrequencies in landraces, old and modern barley cultivars of marker loci close to QTL for grain yield underhigh and low input conditions. Euphytica. 163, 435–447.Rahmstorf, S. and Schellnhuber, H.J. (2007): Der Klimawandel. 4. Aufl., C.H. Beck Verlag oHG, München.Richards, R.A. (1996): Defining selection criteria to improve yield under drought. Plant Growth Regulation.20, 157-166.Wenzl, P., Li, H., Carling, J., Zhou, M., Raman, H. et al. (2006) A high-density consensus map of barleylinking DArT markers to SSR, RFLP and STS loci and agricultural traits. BMC Genomics. 7, 206doi:10.1186/1471-2164-7-206.Xue, D., Huang, Y., Zhang, X., Wei, K., Westcott et al. (2009): Identification of QTLs associated with salinitytolerance at late growth stage in barley. Euphytica. 169, 87–196.Xue, D., Zhou, M., Zhang, X., Chen, S., Wei, K. et al. (2010): Identification of QTLs for yield and yieldcomponents of barley under different growth conditions. J Zhejiang Univ-Sci B (Biomed & Biotechnol). 11(3), 169-176.198

Budapest, Hungary, 2011AGRISAFEREACTIONS OF MAIZE INBRED LINES TO THE INCREASEDUV-B RADIATIONCLIMATE CHANGE AS A NEW CHALLENGE FOR MAIZEBREEDERSJ. PINTER 1 – I. PÓK 1 – T. JANDA 1 – E. PÁLDI 1 – Z. SZIGETI 2 - C. L. MARTON 11 Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary2 Department of Plant Physiology and Molecular Plant Biology, Eötvos Loránd University, Budapest, HungaryAbstract Breeding new inbred lines and hybrids also means the development of tolerance to different bioticand abiotic stress factors, including high UV-B radiation. Measurements were taken in Chile and in Hungaryunder field conditions, and a special phytotron chamber was also used to determine the effect of higher UV-Bradiation levels on photosynthesis. The total anthocyanin content of early-maturing maize lines was more than45% greater in Chile than in Hungary. This suggests that genotypes originating from northern regions were notsufficiently adapted to the higher radiation level. In the late maturing genotypes the high radiation level did notcause any substantial change. Measurements on the activity of antioxidant enzymes confirmed that early inbredlines were more sensitive to UV-B radiation and were less able to eliminate reactive oxygen species and freeradicals than later maturing genotypes.Key words: Zea mays L., maize, inbred line, UV-B radiation, flavone, anthocyanin, climate change, stressacclimation, fluorescence imagingIntroductionThe level of UV-B radiation reaching the surface of the earth is increasing due to thethinning (or depletion) of the ozone layer in the stratosphere over recent decades.Without ozone life on earth would be virtually impossible. Without its cooling effect, thechemical bonds in DNA, which is the basis of all living organisms, would be broken.The ozone layer, which must be of sufficient thickness, is the only thing that regulatesthe intense though vital energy of sunlight. Among the gases responsible for attenuatingthe ozone layer, chlorine, fluoride and bromide cause the most damage. On reaching thestratosphere a single molecule of these gases can destroy hundreds of thousands of ozonemolecules. A decrease of 1% in the ozone layer increases solar radiation by 2%. Basedon the report of a 20-year survey by the U.S. Environmental Protection Agency (EPA) itcan be established that the depletion of the ozone layer averages 2–3% per decade, but insome places is as much as 15% (US EPA, 2010). This severely endangers the wholeecosystem, including both terrestrial and aquatic organisms. Dramatic changes havealready been observed in the plankton. In discussing the direct and indirect harmfuleffects of UV-B radiation on plants, the following important facts should be mentioned(Wang et al., 2008):1. inhibition of photosynthesis; 6. changes in floral morphology;2. damage to DNA; 7. reduction in pollen quantity, quality andviability;3. changes in morphology and phenology; 8. species-specific effects on growth andreproduction;4 decrease in biomass accumulation; 9. increasing seed abortion rate etc.5 negative growth responses;Studies on the negative effects of UV-B radiation have mostly been made on thevegetative parts of the plants and fewer studies have dealt with the generative organs(Demchik et al., 1996). Hundreds of plant species have been studied so far, in whichradiation has been found to have a decreasing effect on photosynthesis, while causing a199

AGRISAFE Budapest, Hungary, 2011visible (e.g. pigmentation) or measurable (e.g. flavonoids as antioxidants) increase in thedefence mechanisms.Materials and methodsIn the breeding programme of the Maize Breeding Department of the AgriculturalResearch Institute of the Hungarian Academy of Sciences, the breeding of new inbredlines and hybrids includes the development of tolerance to various biotic and abioticstress factors, including high UV-B radiation, to which inbred lines react verysensitively. The importance of this was realized in the winter nursery in Chile, whereexperience gained over the last 16 years has shown that UV-B radiation is approximately30-35% greater than in Hungary (Fig. 1), leading to a higher proportion of pollenmortality, flowering asynchrony, barrenness, seed abortion, etc.3025Mean course of the daily sums of biologically effective UVirradiation on the basis of 5 years in Martonvásár (Hungary) inMay, June, July and in Buin (Chile) in November, December,January+5,1 differenceMED2015105010 20 30 40 50 60 70 80 90MED: Minimal Erythema Dose1 MED=21 mJ/m 2daysFigure 1. Radiation in Buin (Chile) and in Martonvásár (Hungary)In the course of the experiment the same inbred lines, having different maturity periodsand genetic backgrounds, were tested for five years in Chile and Hungary. The testsfocused on anthocyanin, a flavonoid derivative involved in the absorption of damagingUV-B radiation. The fluorescence imaging technique was used (Chaerle et al., 2000),which involves exposing maize leaves to UV-B radiation under laboratory conditionsand measuring fluorescence spectra at various wavelengths (440, 690 and 740 nm).Measurements were also made on the thickness, structure and waxiness of the epidermis,which also plays an important role in the defence mechanisms.Results and discussionAveraged over years and varieties (maize inbred lines) the total anthocyanin content ofthe leaf samples was significantly higher in Chile than in Hungary (Fig. 2). This waspresumably a response to the negative stress represented by higher UV-B radiation at themetabolic level (Lois, 1994). In the early-maturing flint lines the anthocyanin contentswere more than 45% greater than those recorded in Hungary. This suggests that thesegenotypes, which were bred, developed and selected in northern regions (e.g. Canada),were not sufficiently adapted to the higher radiation level. This could explain why theenhanced UV-B radiation caused a sharp rise in the quantity of anthocyanin (whichabsorbs the dangerous radiation) in these samples. In the late maturing genotypes theinitial content of the protective compound anthocyanin was higher at both locations, soin these types the high radiation level was not a problem and did not cause anysubstantial change (Pintér et al., 2007).200

Budapest, Hungary, 2011AGRISAFE0,8Absorbance values of 5 early lines at the average of fivee xperimental ye ars (Martonvás ár, B uin)+45,4% differenceA530-A479/g0,60,4+71,9%+25,2% +45,9%+42,8%+41,0%0,20,0L2-E L3-E L4-E L9-E L10-EMartonvásár BuinFigure 2. Anthocyanin absorbance values of the maize samples in Buin (Chile) and Martonvásár (Hungary)Fluorescence ratios, calculated from the data, clearly illustrate the effect of UV-Bradiation on photosynthetic processes, usually associated with a decline in functioningability (Szigeti, 2008). Maize genotypes in different maturity groups were compared andthe F440/F690 ratio (indicative of the stress level) was found to be higher in latematuring lines with high anthocyanin content. As a result, these genotypes had goodtolerance and good adaptability to higher UV-B radiation. The fluorescence imagingmethod applied in the present work was found to be ideally suited for detecting theexposure of plants to stress, but it provides valuable additional information when used incombination with other methods for determining the level of photosynthesis. In thepresent work, a special phytotron chamber was also used to determine the effect ofhigher UV-B radiation levels on photosynthesis. During this type of environmental stressthe level of reactive oxygen species (ROS) increases dramatically, which may causesignificant damage to cell structures (MacKernes, 2000). Normally the cells are able todefend themselves against ROS damage by means of enzymes such as superoxidedismutase, catalase and glutathione peroxidase (B). In epidermal and subepidermaltissues, flavonoids such as anthocyanins play an important role in protection against theinjuries caused by strong UV-B radiation (Caldwell, 1971). The measurements alsoconfirmed the sensitivity of certain early maize genotypes, revealed as a reduction in netphotosynthetic activity. Measurements on the activity of antioxidant enzymes confirmedthat early inbred lines were more sensitive to UV-B radiation and were less able toeliminate reactive oxygen species and free radicals than later genotypes.ConclusionsNowadays the physiological reactions of the plants are being intensively investigated inorder to learn how cultivated plants tolerate harmful abiotic stress factors such as highUV-B radiation, which have increased as a result of global climate change (Caldwell etal., 2007). The photosynthetic apparatus of some plant species appears to be wellprotected from direct damage by UV-B radiation. The leaf optical properties of thesespecies apparently minimize the exposure of sensitive targets to UV-B radiation. Abetter understanding is needed of the mechanism of tolerance to increased UV-Bradiation and of the interaction between UV-B and other environmental factors in orderto adequately assess the probable consequences of a change in solar radiation (Teramura201

AGRISAFE Budapest, Hungary, 2011et al., 1994). Besides high yield and quality, the breeding of germplasm resistant ortolerant to various biotic and abiotic stress factors is also important for almost allcultivated species. We are still far from being able to produce plants tolerant to UV-Bradiation using molecular biotechnological methods, but experts from all over the worldagree that efforts must be made to estimate the physiological and genetic reactions of themost important crops (e.g. wheat, soybean, maize) to increased UV-B radiation, basedon field experiments, and to use this information in future plant breeding.All these experiments provide direct, useful information for maize breeders and helpthem produce new inbred lines that can be used as the parents of new hybrids with bettertolerance at the cell and DNA level to destructive UV-B radiation, one of the mostdangerous consequences of global climate change (Walbot et al., 2006). In order toovercome the harmful effects of radiation, genetic resources and selection and filteringmethods must be elaborated for the selection of parental lines which will lead to the todevelopment of hybrids with improved tolerance to high UV-B radiation.This may contribute to the solution of the biggest challenge of the 21 st century: toprovide the continuously growing human population with food via sustainableagriculture in a permanently changing and unpredictable ecosystem.AcknowledgementsThis paper was financially supported by the National Scientific Research Fund (T 042621)and by the AGRISAFE project (EU-FP7-REGPOT 2007-1 No. 203288).ReferencesCaldwell, M.M. (1971): Solar UV irradiation and the growth and development of higher Plants. In:Photophysiology (A.C. Giese, ed.) Vol. 6., Academic Press, New York, pp.131-177.Caldwell, M. M., Bornman, J. F., Ballaré, C. L., Flint, S. D., Kulandaivelu, G. (2007): Terrestrial ecosystems,increased solar ultraviolet radiation, and interactions with other climate change factors. Photochemicaland Photobiological Sciences 6, 252-266.Chaerle, L., Van der Straeten, D. (2000): Imaging techniques and the early detection of plant stress. Trends inPlant Sci., 5, 495-501.Demchik, S. M., Day, T. A. (1996): Effect of enhanced UV-B radiation of pollen quantity, quality, and seedyield in Brassica rapa (Brassicaceae). American Journal of Botany 83 (5): 573-579.Lois, R. (1994): Accumulation of UV-absorbing flavonoids induced by UV-B radiation in Arabidopsis. Planta,194, 498-503.MacKernes, S.A.H. (2000): Plant responses to ultraviolet-B (UV-B: 280-320nm) stress: what are the keyregulators? Plant Growth Regulation 32:1, 27-39.Pintér, J., Kósa, E., Hadi, G., Hegyi, Z., Spitkó, T., Tóth, Z., Sziget, Z., Páldi, E., Marton, L. C. (2007): Effectof increased UV-B radiation on the anthocyanin content of maize (Zea mays L.) leaves. Acta AgronomicaHungarica 55, 7-17.Szigeti, Z. (2008): Physiological status of cultivated plants characterised by multi-wavelength fluorescenceimaging. Acta Agron. Hung., 56, 223-234.Teramura, A.H., Sulivan, J.H. (1994): Effects of UV-B radiation on photosynthesis and growth of terrestrialplants. Photosynth.Res., 39, 463-473.US EPA (2010): Environmental Indicators: Ozone Depletionhttp://www.epa.gov/ozone/science/indicat/Walbot, V., Casati, P. (2006): Impact of UV-B radiation on corn (Zea mays L.). Energy Research at Stanford2005-2006.http://gcep.stanford.edu/pdfs/SI3U6jOMPAIgwkaiBD_77Q/walbot_ers06.pdfWang, Y., Qiu, N., Wang, X., Ma, Z., Du, G. (2008): Effects of enhanced UV-B radiation on fitness of analpine species Cerastium glomeratum Thuill. Journal of Plant Ecology 1 3, 197-202.202

Budapest, Hungary, 2011AGRISAFEGENETIC VARIABILITY OF SPRING BARLEY FORRESISTANCE TO DROUGHT STRESS SIMULATED ON THESCALE OF A BREEDER´S NURSERYG. REICHENBERGER 1 – C.-C. SCHÖN 2 – M. HERZ 31Bayerische Landesanstalt für Landwirtschaft, Institut für Pflanzenbau und Pflanzenzüchtung, IPZ 2b; AmGereuth 8 D-85354 Freising, Germany, Gabriela.reichenberger@lfl.bayern.de2 Lehrstuhl für Pflanzenzüchtung, Technische Universität München, Emil-Ramann-Str. 4, 85350 Freising,GermanyAbstract As tolerance against drought stress becomes a more and more important challenge for breeders, it isnecessary to identify and validate methods to screen and select for resistance to drought stress in barley. Forthis purpose a collection of 78 spring barley accessions was tested for the variability of important parameters:for instance, nitrogen content in green leaves, canopy temperature, chlorophyll fluorescence and variousagronomic parameters. Under drought stress, simulated in a rainout shelter, genotypes showed differences forthese parameters. Stress was applied during the heading of the plants. In a second trial the barley genotypeswere chemically treated to induce drought stress under the conditions of a breeder’s nursery. Chemicaldesiccation is an easy and cost-efficient way to simulate drought stress. A comparison with the desiccationunder the rainout shelter was made to show whether chemical desiccation is a cheaper and easier solution forbreeders. For genetic studies ten SNP markers per chromosome were selected to assess polymorphism betweenthe barley cultivars. At the end of the project an association mapping approach will be performed to identifycorrelations between the genotype and the phenotype under drought stress.Key words: barley, drought stress, markers, rainout shelter, chemical desiccationIntroductionWater deficit is one of the prevalent causes of crop yield loss. Increased plant toleranceto drought stress is considered among the most important parameters to increase cropyield (Suprunova et al. 2007). The first consequence of drought stress in plants is theclosure of stomata to avoid water loss. Accordingly photosynthesis is limited, due tolimited uptake of because CO 2 . Light energy which is not used for photosynthesis isdelivered as heat or fluorescence. Further, chlorophyll is degraded. Followingparameters were determined: accumulation of 13 C (Ferrio et al. 2001), increase of canopytemperature (Olivares-Villegas et al. 2007), chlorophyll fluorescence (Dutta et al. 2009)and nitrogen degradation (Olivares-Villegas et al. 2007). Drought stress during growth isalso cause of high protein, low extract content and low enzyme capacity (Schuster et al.1976).In this study 78 barley varieties were tested in different scenarios under drought stress.Aim is the validation of effective selection methods which are easy and cheap to use in abreeder´s nursery. For this purpose SNP markers were designed to compare phenotypicwith genotypic data in an association study.Materials and methodsA selection of 78 spring barley varieties was chosen, including varieties from countrieswith hot and dry summers, old German and high yielding varieties, some nude varietiesand some from Bavarian breeders.Drought was simulated in two different ways, in the Rain out shelter (ROS) undercontrolled field conditions and chemically induced by a 5% potassium iodide solution,which provokes the plants to close the stomata (Regan et al. 1993). Soil moisture wasmeasured by tensiometers. For comparison all plants were grown in additionalenvironments. First environment (MA) was located next to the second environment in203

AGRISAFEBudapest, Hungary, 2011the ROS and grew under natural conditions. In this environment also the chemicaldesiccation(Chd, third environment) experiment was performed.Chlorophyll status within the leaves was measured by SPAD Meter ( SPAD-502,Minolta, Osaka, Japan). This transmission measurement was carried out onceat the endof May andthen once a week from the end of Juneuntil the middle of July. Chlorophyllfluorescence was measured by Junior PAM(Heinz Walz GmbH, Effeltrich,Germany).This methodis very time-consumingand was only made twice on threevarieties. Canopy temperature was measured byinfrared thermometer and –camera.During growth typical agronomical parameters (heading, ripening, plant high) wereobserved. After harvestyield, protein content, humidity, thousand kernel weight andharvest index were measured.Results and discussionSoil moisture measurements in the ROS in 2010 showed that the soil has no plantavailable water into a depth of 100cm. Drought stress was applied to the heading of theplants from14th to 28thof June. In MA the soil was saturated with water until the end ofJune, followed by a veryhot and dry July. Soil hadno availablewater withinone week.Results ofSPAD measurements are presented in Figure 1 and 2. Thefirst twomeasurements, barley varieties differ in a range of10 measurement units. With incipientdrought stress in the middle of July, the range increase up to 20 measuring units.According to environment plants respond different. The well watered plantsfrom MA(Fig.1A) were very sensitive to theheat and drought in July. Chlorophyll contenddecrease immediately and the plantsgot senescent. The varieties in the ROS (Fig.1B)which grewadapted to the low wateravailability showed very high chlorophyll contentat the end of June. In July the chlorophyll contentt was lower incomparison to the MA,but fewer plants were senescent. After the chemical desiccation(Fig.2) in June, duringthe headingof the plants, chlorophyll content decreases immediately.6050403020100B: ROS 201026.05.2010 24.06.2010SPADAbessinischeÄgyptenAlexisArg. DH 168Arg. DH 22AspenBarkeBidoBr 8993a3BRS 195CarismaChil.BraugersteEngledow IndiaExtractF7799HindukuschIronKiaLenkaLotosMarnieNoraPolygenaRagusa aShakiraSofia Nr. 204StreifUnionVollaFigure 1: SPADmeasurements at different pointsof time in the MA (A), ROS (B)204

Budapest, Hungary, 2011AGRISAFE3020100C: Chemical desiccation 201024.06.2010SPADAbessinische (ETH)AC 01/506/6Ägypten (ET)Arg. Mutante 6519Arg. Mutante 6519AspenAspenAuraBarkeBarkeFigure 2: SPAD measurements atdifferent points of time in the chemical desiccationFigure 3: Correlation between ChD andROS respectively MAFigure 3 reflects the correlation between ChD and ROS on the one hand and with MA onthe other hand. Both show correlations to each other. The higher the values of SPADmeasurement in ROS respectively MA, the higherthe values inCdh. Yield reflects theSPAD measurements (not pictured). Crop yields inthe ROS are located between 150 and350g per row, in MA between 100 and 300g and inthe chemical desiccation between 20and 200g per row. It is interesting that the thousand kernel weight (TKG) in manyvarieties doesn’t differ substantially (Fig.4).TKG [g]706050403020100AbessinischeÄgyptenAlexisArg. DH 168Arg. DH 22AspenBarkeBidoBr 8993a3BRS 195CarismaChil.BraugersteEngledow IndiaExtractF7799BaronesseBidoBorema (Bra)Br 8993a3BraemarBRS 195 (Bra)CalculeCARISMACDC McGwire (Kan)Emperor (Kan)EunovaExtractF7799Hindukusch (AFG)IPZ 24727IRONKiaLawinaLenkaLibanon (RL)LotosTKG ROS 2010 TKG MA2010HindukuschIronKiaLenkaLotosMarnieNoraPolygenaRagusa aShakiraMackay (AUS)MarroccainPamella Blue (ETH)PowerRagusa a (YU)ScarlettSHAKIRASimonaSofia Nr. 204 (BG)SUNSHINEUnionTKG ChemB 2010Sofia Nr. 204StreifUnionVollaFigure 4: Thousandkernel weight ofROS, MA and ChD205

AGRISAFE Budapest, Hungary, 2011xP [%]20151050Xp ROS 2010 Xp Chem 2010 Xp MA 2010Figure 5: Protein content of ROS, MA and ChDThe low yield in the chemical desiccation plots reflects very high protein contents, up to17%, of the kernels after harvest. The protein contents in the other environments were ina normal range between 9 and 12% (Fig.5). Some varieties like Eunova, F7799 and Kiashow similar results in TKG and protein content in every environment. These aresuggested to be very interesting for further breeding programs.ConclusionsComparing the different environments and simulation methods of drought stress, thechemical desiccation showed that most varieties react immediately after treatment.Plants started senescence despite lacking assimilates in the kernels which led to highprotein contents in many varieties. Similar reactions were measured in the ROS and MA.The similar respond of many varieties in different environments (ROS, MA and ChD)indicates that the chemical desiccation is a plausible method to simulate drought stress. Itseemed to be a good alternative to the simulation of drought stress in the rain out shelter.With SPAD measurements it is able to differentiate the varieties and to picture theirdifferent respond to drought stress. Similar reactions in TKG and protein content reflectsome very interesting varieties for further breeding programs.Other methods like 13 C and thermal measurements will be evaluated soon. SNP datasetand phenotypic data will be compared in an association study.AcknowledgementsThis paper was financially supported by the Bavarian State Research Center forAgriculture.ReferencesDutta S, Mohanty S, Tripathy B (2009) Role of Temperature Stress on Chloroplast Biogenesis and ProteinImport in Pea. Plant Physiology, 150, pp. 1050–1061Ferrio J.P., Bertran E., Nachit M., Royo C., Araus J.L. (2001) Near infrared reflectance spectroscopy as apotential surrogate method for the analysis of 13C in mature kernels of durum wheat. Aust. J. Agric. Res.,52, 809-816Olivares-Villegas J.J., Reynolds M.P., McDonald G.K. (2007) Drought-adaptive attributes in the Seri/Babaxhexaploid wheat population. Functional Plant Biology, 34, 189-203Reagan K.L., Whan B.R., Turner N.C. (1993) Evaluation of chemical desiccation as a selection technique fordrought resistance in a dryland wheat breeding program. Aust. J. Agric. Res., 44, 1683-91Schuster, Weinfurtner, Narziss (1976) Die Bierbrauerei, Die Technologie der Malzbereitung. Ferdinand EnkeVerlag Stuttgard, 6. Auflage, S.8Suprunova T., Krugman T., Distelfeld A., Fahima T., Nevo E., Korol A. (2007) Identification of a novel gene(Hsdr4) involved in waqter-stress tolerance in wild barley. Plant Mol Biol, 64, 17-34206

Budapest, Hungary, 2011AGRISAFECOMPARISON OF THE TOLERANCE AND ACCUMULATIONOF CU AND CD IN PHRAGMITES, SALIX, AND POPULUS LEAVESÉ. SÁRVÁRI 1* – L. GÁSPÁR 1,6 – Á. SOLTI 1 – A. HAKMAOUI 2 – GY. ZÁRAY 3 –A. GÉMES JUHÁSZ 4 – M. BARON 51 Department of Plant Physiology and Molecular Plant Biology, Eötvös University, Budapest, Hungary2 Department of Biology, Abdelmalek Essaâdi University, Tetouan, Morocco3 Department of Chemical Technology and Environmental Chemistry, Eötvös University, Budapest, Hungary4 Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary5 Department of Biochemistry and Cell and Molecular Biology of Plants, Estación Experimental del Zaidín,Granada, Spain6 Department of Plant Biology and Plant Biochemistry, Faculty of Horticultural Science, Corvinus University,Budapest, Hungary*corresponding author: e_sarvari@ludens.elte.huAbstract The effects of Cu (16, 47, 79 µM) and Cd (45 and 89 µM) treatment were studied on the toxicelement contents and photosynthetic performance of leaves of Salix, Phragmites and Populus plants grown inhydroponics to compare the tolerance and accumulation of Cu and Cd in these macrophytes and theirsuitability for phytoremediation. Though excess Cu did not translocate into the leaves, it had a marked effecton growth, while photosynthetic parameters (fluorescence induction and thylakoid development) were onlyslightly influenced, with the exception of CO 2 fixation. The moderate effects of Cd on photosynthesis weremore or less proportional with its translocation to the leaves. The highest translocation was found in poplar,particularly at the lower Cd concentration. The results underline the phytoextraction potential of Salix andPopulus on Cd-polluted sites.Key words: heavy metal, cadmium, copper, phytoremediationIntroductionHeavy metals could be enriched in the environment by human activity such as mining,industries, atmospheric deposition, excessive use of agrochemicals and waste disposal.The toxicity of heavy metals is well known. Photosynthesis, which deeply influencesplant productivity, is one of the most heavy-metal-sensitive processes in plantmetabolism (van Assche and Clijsters, 1990; Kučera et al., 2008). Copper is an essentialmicronutrient for all plants and is required for many enzyme systems. At highconcentration, however, Cu causes oxidative stress, and numerous inhibitory effects onphotosynthesis have been reported (Yruela, 2005). Cu has become a widespreadpollutant due to its increasing use in industry and use as a fungicide, in agriculture.Cadmium is a toxic element without any physiological function in plant metabolism.Cadmium ions are easily translocated into the leaves in many plant species, where giverise to diverse inhibitory effects on plant metabolism including photosynthesis (Sanita diToppi and Gabbrielli, 1999; Kučera et al., 2008). By inhibiting photosynthesis, Cd isalso involved in the formation of active oxygen species, which cause deleteriousmembrane damage (Sanita di Toppi and Gabbrielli, 1999).Phytoremediation is an efficient environment cleanup technology for removal of heavymetals from polluted sites via stabilization or sequestration in harvestable plant tissues(Pilon-Smits, 2005). Salix spp. are new interesting agricultural crops for bio-fuels butthere is also a growing interest to use it for remediation of sludge and industriallypollutedland (Robinson et al., 2000). It is able to accumulate high levels of heavy metalssuch as Cd, Zn and Cu (Greger and Landberger, 1999). Phragmites australis has a broadgeographical distribution in the world, and can withstand extreme environmentalconditions, including toxic concentrations of heavy metals, such as Zn, Pb and Cd (Ye etal., 1997). Populus spp. are important tree species in forestry. Due to their high annual207

AGRISAFE Budapest, Hungary, 2011biomass production and good tolerance against elevated metal levels, they arepromisingly introduced into in situ phytoremediation (Di Lonardo et al., 2011).We analysed the effects of different Cu and Cd concentrations on the elementaccumulation in leaves and photosynthetic performance of Salix, Phragmites, andPopulus plants grown in hydroponics. Thus, we have compared the tolerance andaccumulation of Cu and Cd in these plant species, and their suitability forphytoextraction of these metals.Materials and methodsReed (Phragmites australis (Cav.) Trin. ex Steudel) rhizomes and willow (Salixpurpurea L.) cuts were sprouted in vermiculite and water, respectively, for about twentydays. Reed seedlings, willow rooted cuttings and micropropagated poplars (Populusjaquemontiana (Haines) Kimura var. glauca cv. Kopeczkii) were grown in hydroponics(modified Hoagland solution of ¼ strength, iron source: 20 µM Fe-EDTA) in a growthchamber (14 h light (120 µmol m -2 s -1 )/10h dark) at 25±2°C with relative humidity of 60-70%. About 4 weeks after replanting, CuSO 4·5H 2 O was added at concentrations of 16,47 and 79 µM and CdCl 2 at concentrations of 45 and 89 µM for 10 days (solutionschanged in every two days).14 CO 2 fixation (cpm cm -2 ) was determined according to Láng et al. (1985). Fluorescenceinduction measurements were performed as it was given in Solti et al. (2008).Parameters were calculated as: F v /F m =(F m -F 0 )/F m ; F/F m ’=(F m ’-F t )/F m ’; NPQ = (F m -F m ’)/F m ’.Element contents were determined by TXRF (Varga et al., 1997). Chlorophyll(Chl) content of leaves and thylakoid preparations was determined according to Porra etal. (1989). Isolation of thylakoids and separation of chlorophyll-protein complexes byDeriphat PAGE were carried out as previously described (Sárvári and Nyitrai, 1994).Results and discussionHydroponics is a useful method to elucidate changes in physiological mechanisms ofplants under metal toxicity. In this way, we have tested the toxicity of Cu and Cd inSalix, Phragmites, and Populus to determine if these plants show sufficient tolerance tobe used in phytoremediation of either Cu or Cd contaminated sites.Sensitivity of leaf growth was in the order of Populus > Salix >> Phragmites under bothCd and Cu stress (Table 1). Stress induced growth inhibition may be connected with thereduction in the transpiration rate (Sanita di Toppi and Gabbrielli, 1999) and in CO 2fixation (Table 2). None of the studied plants translocated excess Cu into the leaves as inBorghi et al. (2007). Under Cd treatment, only low amount of Cd accumulated inPhragmites leaves as also found by Bonanno and Lo Giudice (2010), while Cdtranslocated in huge amount to Salix and Populus leaves. Leaf iron content markedlydecreased under both Cd and Cu stress in agreement with Kučera et al. (2008), while Zntranslocation in Populus was only stimulated at low Cd supply.208

Budapest, Hungary, 2011AGRISAFETable 1. Growth and element content (mg g -1 DW, mean±SD) of leaves of Phragmites (Ph), Salix (S), andPopulus (P) plants treated with Cd (45, 89 µM) and Cu (16, 47, 79 µM). DW – dry mass, Ctrl - control.Cu stress decreased the CO 2 fixation capacity of leaves moderately, while photosystem(PS)II activity did not change (Table 2) in agreement with lack of Cu translocation intothe leaves (Table 1). The sensitivity of CO 2 fixation may be related to the effects ofheavy metals on transpiration and stomatal closure (Barceló and Poschenrieder, 1990).Under Cd stress, inhibition of Calvin cycle enzymes is also involved (van Assche andClijsters, 1990). Cd treatment influenced PSII activity (F/F m ’) slightly more in poplarthan in reed and willow.Table 2. Photosynthetic parameters of Phragmites (Ph), Salix (S), and Populus (P) plants treated with Cd (45,89 µM) and Cu (16, 47, 79 µM): Chl content (µg Chl cm -2 leaf material), Chl a/b ratio, CO 2 fixation (cpm cm -2 ,% of control) and selected fluorescence induction parameters. Values (mean±SD) of treated leaves are given aspercentage of the control (Ctrl).Under heavy metal stress, a reorganization of thylakoids occurred (Table 2: Chl a/bratio), even if the Chl concentration in leaves only moderately changed (Table 2). Cdstressed Phragmites or Cu treated plants showed slight, more or less uniform decrease ofall Chl-protein complexes, the PSII core being a little more sensitive (not shown). Incontrast, PSII was relatively more stable than LHCII and particularly PSI in Cd stressedSalix and Populus as it was found by Solti et al. (2008). Though the iron content ofleaves decreased similarly in all three plants, and it was reduced only slightly more byCd than Cu, the development of the photosynthetic apparatus was more strongly affectedby Cd stress with stronger impact on Populus and Salix than on Phragmites,proportionally to the Cd content of leaves. Higher tolerance of poplar than found earlier(Solti et al., 2008) was due to the higher iron supply (20 µM vs. 10 µM).209

AGRISAFE Budapest, Hungary, 2011ConclusionsAll three plants were sufficiently tolerant to Cu and Cd (Phragmites < Salix < Populus),though CO 2 fixation as well as the development of thylakoid complexes in Populus andSalix were slightly more sensitive. None of these plants accumulated Cu in the leaves,but high phytoextraction capacity for Cd was found in Salix and Populus.AcknowledgementsThis paper was financially supported by the NATO Science Program (COST 977480).ReferencesBarceló, J., Poschenrieder, C. (1990): Plant water relations as affected by heavy metal stress: a review. J. PlantNutr., 13, 1–37.Bonanno, G., Lo Giudice, R. (2010): Heavy metal bioaccumulation by the organs of Phragmites australis(common reed) and their potential use as contamination indicators. Ecol. Indic., 10, 639–645.Borghi, M., Tognetti, R., Monteforti, G., Sebastiani, L. (2007): Responses of Populus×euramericana (P.deltoides×P. nigra) clone Adda to increasing copper concentrations. Environ. Exp. Bot., 61, 66–73.Di Lonardo, S., Capuana, M., Arnetoli, M., Gabbrielli, R., Gonnelli, C. (2011) Exploring the metalphytoremediation potential of three Populus alba L. clones using an in vitro screening. Environ. Sci.Pollut. Res. 18, 82–90.Greger, M., Landberger, T. (1999): Use of willow in phytoextraction. Int. J. Phytoremed., 1, 115123.Kučera, T., Horáková, H., Šonská, A. (2008): Toxic metal ions in photoautotrophic organisms.Photosynthetica, 46, 481–489.Láng, F., Sárvári, É., Szigeti, Z. (1985): Apparatus and method for rapid determination of photosynthetic CO 2fixation of leaves. Biochem. Physiol. Pflanzen., 180, 333336.Pilon-Smits, E. (2005): Phytoremediation. Annu. Rev. Plant Biol., 56, 15–39.Porra, R. J., Thompson, W. A., Kriedemann, P. E. (1989): Determination of accurate extinction coefficientsand simultaneous equations for assaying chlorophyll a and b extracted with four different solvents:verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochim.Biophys. Acta, 975, 384394.Robinson, B. H., Mills, T. M., Petit, D., Fung, L. E., Green, S. R., Clothier, B. E. (2000): Natural and inducedcadmium-accumulation in poplar and willow: implications for phytoremediation. Plant Soil, 227,301306.Sanita di Toppi L., Gabrielli R. (1999): Response to cadmium in higher plants. Env. Exp. Bot., 41, 105130.Sárvári, É., Nyitrai, P. (1994): Separation of chlorophyll-protein complexes by Deriphat polyacrylamidegradient gel electrophoresis. Electrophoresis, 15, 384394.Solti Á., Gáspár L., Mészáros I., Szigeti Z., Lévai L., Sárvári É. (2008): Impact of iron supply on the kineticsof recovery of photosynthesis in Cd–stressed poplar (Populus glauca). Ann. Bot., 102, 771–782.Varga, A., Záray, Gy., Fodor, F., Cseh, E. (1997): Study of interaction of iron and lead during their uptakeprocess in wheat roots by total reflection X-ray fluorescence spectrometry. Spectrochim. Acta, 52B, 1027–1032.Ye, Z. E., Baker, A. J. M., Wong, M. H., Willis, A. J. (1997): Zinc, lead and cadmium tolerance, uptake andaccumulation by the common reed, Phragmites australis (Cav.) Trin. Ex Steudel. Ann. Bot., 80, 363370.van Assche F., Clijsters H. (1990): Effects of metals on enzyme activity in plants. Plant Cell Environ., 13,:195206.Yruela I. (2005): Copper in plants. Braz. J. Plant Physiol., 17, 145–156.210

Budapest, Hungary, 2011AGRISAFEOPPORTUNITIES IN BREEDING FOR IMPROVED STANDESTABLISHMENT AND SEEDLING VIGOUR IN WINTERWHEAT (TRITICUM AESTIVUM L.)G. SERBANNational Agricultural Research Institute of Fundulea, Romania.Abstract Improving stand establishment and seedling vigour are priority objectives in the wheat breedingprogram at the National Agricultural Research & Development Institute Fundulea, because these traits canimprove wheat performance under drought, by allowing earlier leaf cover of the ground and reducing waterloss through evaporation from the soil, and by earlier and faster root growth, in order to increase the amount ofwater accessible to the crop. This study was aimed at exploring the available genetic diversity for coleoptilelength and leaf width in a set of winter wheat genotypes.Coleoptile length showed significant variation among cultivars carrying the Rht-B1b genes, thus offering someopportunity of improving stand establishment in these genotypes.Coleoptile length was much affected by the activation of amylase activity, as a result of rains just beforeharvest time. Exploiting genetic variation in the response of coleoptile length to conditions favouring theinitiation of sprouting should contribute to the better stability of stand establishment.Significant variation was found among the studied genotypes for the width of the second leaf. The widestleaves were found in a line derived from a Triticale/2*wheat cross. This line offers new opportunities forimproving seedling vigour in wheat.Key words: seedling vigour, stand establishment, coleoptile length.IntroductionEarlier leaf cover of the ground, in order to reduce water loss through evaporation fromthe soil, as well as earlier and faster root growth in order to increase the water amountaccessible to the crop, are desirable traits for improving wheat performance underdrought. These traits became particularly important in the context of expected climatechanges. Both earlier leaf cover and faster root growth can be achieved in wheat byimproving stand establishment and seedling vigour.Stand establishment, especially in dry autumns, is much influenced by coleoptile length.The problem of poor seedling emergence has become particularly important for wheat inrecent decades because of the global adoption of giberelic acid (GA) - insensitivesemidwarf cultivars, with reduced height principaly due to the presence of GA –insensitive alleles, Rht-B1b and Rht-D1b (Keytes et al., 1989). Rht-B1b is present inmost present Romanian wheat cultivars (Săulescu, 2001).Replacing GA insensitive height reducing genes with GA sensitive ones (such as Rht 8)has been suggested as a way of improving stand establishment in semi dwarf wheat(Richards et al., 2001). However in South Romania Rht 8 carriers were reported to yieldless than Rht-B1b carriers (Mustătea et al., 2000).Coleoptile length is also dependent on seed quality, which can be significantly affectedby pre-sprouting as a result of rains just before harvest (Cseresnyes et al., 1985), butgenetic variation in coleoptile length response to pre-harvest rains has not beeninvestigated.Seedling vigour is directly related to early leaf area, which was found by Australianscientists to be correlated with the leaf width of first two leaves (Richards et al., 2001).Genetic variation for seedling vigour among currently grown semi dwarf cultivars wasreported to be small, but barley achives almost double the leaf area of wheat primarilybecause of its earlier emergence, larger embryo, and greater specific leaf area (Lopez-211

AGRISAFE Budapest, Hungary, 2011Castaneda et al., 1996). New genetic variation for these traits has to be identified inwheat.This study was aimed at exploring the available genetic diversity for coleoptile lengthand leaf width in a set of Rht-B1b semi dwarf winter wheat genotypes.Materials and methodsFor the study of coleoptile length, 15 Romanian semi dwarf winter wheat cultivars, allcarriers of Rht-B1b were tested, using seed harvested before and after rains, whichcumulated 21.3 mm. Although in seed harvested after rains sprouting was not visible,seed quality was affected. Seeds selected for uniformity were planted at uniform depth(10 mm) in trays filled with sand. After a 3 days period, at 1°C, trays were introduced ina growth chamber at 20°C, where the light was excluded. The coleoptile length wasmeasured with a ruler, when coleoptile growth ceased and the first leaf appeared.For determining the width of second leaf, 17 Romanian semidwarf winter wheatcultivars, along with one Triticale cultivar and two barley cultivars (as controls), wereplanted at uniform depth (10 mm) in trays filled with sand and placed in light at 20°C.Second leaf width was measured when this leaf was fully developed and the third leafhad appeared.Results and discussionColeoptile length was significantly affected by cultivars, harvesting date and theirinteraction (Table 1). Significance of cultivar effect on coleoptile length is particularlyimportant as all cultivars were carriers of the same GA-insensitive height reducing gene.Rains that occurred before the second harvest date significantly reduced coleoptilelength, on average by 1.5 cm, as a result of their effect on seed quality (Table 2). Thesignificant interaction suggests that cultivars reacted differently to pre-harvest conditionsthat affected seed quality.Table 1. ANOVA for coleoptile length in fifteen cultivars and two harvesting datesANOVASource ofVariation SS df MS F P-value F critCultivars 133.15 14 9.51 49.32 1.63E-79 1.715Harvest date 260.07 1 260.07 1348.67 3.3E-133 3.86Interaction 38.35 14 2.73 14.20 6.8E-28 1.71Error 80.99 420 0.19Total 512.56 449Several cultivars were identified, which had significantly longer coleoptiles than others,using seed from both harvest dates (Table 2). These included the cultivars Delabrad,Noroc and Glosa. This suggests some possibilities exist to improve stand establishmentin Rht-B1b semidwarf winter wheat.Coleoptile length in seed harvested before rains was significantly correlated with thatdetermined in seed harvested after rains (r = 0.633**), but obvious deviations from theregression line were present (Figure 1). Cultivars like Glosa and Delabrad had aboveaverage coleoptile length in both conditions, while others, like F02872G2-101 andDropia showed large reductions of coleoptile length in weathered seed. This suggests212

Budapest, Hungary, 2011AGRISAFEthat opportunities exist to improve stability of stand establishment, by reducing thenegative effect of rains before harvest.Table 2. Coleoptile length of fifteen cultivars, at two harvesting datesHarvested before rainsHarvested after rainsCultivar Coleoptile length Cultivar Coleoptile lengthF02872G2-101 9.10 ± 0.43 a Glosa 7.28 ± 0.31 aDelabrad 8.78 ± 0.63 ab Delabrad 7.19 ± 0.34 aNoroc 8.72 ± 0.73 ab Monada 6.87 ± 0.28 bGlosa 8.71 ± 0.50 b Fl.85 6.80 ± 0.45 bDropia 8.38 ± 0.47 c Noroc 6.61 ± 0.46 bcMonada 8.28 ± 0.26 cd Miranda 6.53 ± 0.35 bcFaur 8.06 ± 0.38 de Faur 6.42 ± 0.55 cdIzvor 8.04 ± 0.25 de Litera 6.39 ± 0.43 cdFl.85 8.04 ± 0.29 de F02872G2-101 6.17 ± 0.31 cdLitera 7.93 ± 0.59 e Dropia 6.17 ± 0.46 cdNikifor 7.26 ± 0.36 f Nikifor 6.17 ± 0.46 cdMiranda 7.24 ± 0.27 f Izvor 6.03 ± 0.39 deOstrov 7.22 ± 0.67 f Otilia 5.98 ± 0.41 deBoema 6.69 ± 0.46 g Ostrov 5.98 ± 0.33 deOtilia 6.60 ± 0.41 g Boema 5.66 ± 0.58 fAVERAGE 7.94 AVERAGE 6.42(Values in the same column followed by the same letter are not significantly different at P

AGRISAFE Budapest, Hungary, 2011Table 3. Width of second leaf in barley, triticale and wheat cultivarsSpecies Cultivar Width of second leaf (mm)Barley Compact 7.62 ± 0.35 aBarley Andreea 7.32 ± 0.40 bTriticale Stil 6.17 ± 0.33 cWheat F06659G1-1 5.95 ± 0.15 dWheat Pitar 5.30 ± 0.25 eWheat Fl.85 5.27 ± 0.25 eWheat Izvor 5.00 ± 0.01 fWheat Otilia 4.75 ± 0.34 gWheat Litera 4.72 ± 0.25 gWheat Doina 4.70 ± 0.25 gWheat Delabrad 4.42 ± 0.33 hWheat F02872G2-101 4.02 ± 0.19 iWheat Dropia 4.00 ± 0.02 ijWheat Nikifor 3.85 ± 0.23 jWheat Glosa 3.80 ± 0.25 jkWheat Noroc 3.75 ± 0.25 jklWheat Monada 3.67 ± 0.24 jklWheat Miranda 3.62 ± 0.22 klWheat Faur 3.60 ± 0.38 lWheat Boema 3.42 ± 0.24 lBoth barley and triticale had significantly wider leaves than all wheat cultivars; only lineF06659G1-1 was close to triticale and significantly superior to all other wheat cultivars.This line, obtained from a cross Triticale/2*wheat (Săulescu et al., 2010) could open newopportunities in breeding for improving seedling vigour in wheat.ConclusionsSignificant differences were detected between Romanian semi dwarf winter wheatcultivars for coleoptile length and second leaf width. These differences could beexploited in breeding for improved stand establishment and seedling vigour.ReferencesCseresnyes, Z., Baleanu, M., Vorovenci, O., Zaharia, V., Florea, M. (1985) Some factors affecting germinationand vigour in wheat seeds. Annals of NARDI Fundulea 52, 143-154.Keytes, G.J., Paolillo, D.J., and Sorells, M.E. (1989): The effects of dwarfing genes Rht1 and Rht2 on cellulardimensions and rate of leaf elongation in wheat. Ann. Bot. 64, 683-690.Lopez-Castaneda, C., Richards, R.A., Ferquhar, G.D., and Wiliamson, R.E. (1996): Seed and seedlingcharacteristics contributing to variation in seedling vigor among temperate cereals. Crop Sci. 36,1257-1266.Mustăţea, P., Săulescu, N.N., Ittu, Gh. (2000): The effect of semidwarfings genes and vernalizationrequirement genes on the response to late emergence in winter wheat. Annals of NARDI Fundulea 57, 7-18.CseresnyesRichards, R.A., Condon, A.G and Rebetzke, G.J. (2001): Traits to improve yeld in dry environments. InAplication of physiology in wheat breeding (Eds. , 88-100.Săulescu, N.N. (2001): Romanian Wheat Pool. In "The World Wheat Pool - a history of wheat breeding", (Eds.A.P. Bonjean and W.J. Angus), Lavoiser Publishing, Londres, Paris, New York, 333-349Săulescu, N.N., Ittu, Gh., Ciuca, M., Ittu, M., Mustatea, P. (2010): Transfering usful rye genes to wheat, usingTriticale as a bridge. Abstracts of oral and poster presentation , 8th I.W.C., 78-79.214

Budapest, Hungary, 2011AGRISAFEEST-BASED MARKERS ASSOCIATED WITH QTLS FORDROUGHT TOLERANCE IN BARLEY (HORDEUM VULGARE)COULD BE USED FOR MARKER-ASSISTED SELECTIONF. SZIRA 1 – A. BÖRNER 2 – K. NEUMANN 2 – K. Z. NEZHAD 2,3 – G. GALIBA 1 –A. F. BÁLINT 11 Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary, e-mail:balinta@mail.mgki.hu2 Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), D-06466 Gatersleben, Germany3 Department of Agronomy and Plant Breeding, College of Agriculture, Isfahan University of Technology,Isfahan, IranAbstract Although many drought-related QTLs have been identified in various genetic backgrounds usingdifferent experimental designs, the molecular and physiological basis of yield under water-limited conditions isstill poorly understood. To improve our knowledge on the genetic control of osmotic and drought tolerance andon marker-assisted selection, the Oregon Wolfe Barley mapping population was subjected to both osmotic anddrought stress. Overall, when investigating numerous environments and replications, 40 QTLs were identifiedin three developmental stages using the high-resolution EST-based map available for OWB. Among the fiveloci showing significant effects in at least two developmental stages, the region that co-segregated withGBM1359 on 7H showed one of the most promising effects on stress tolerance. Based on the EST sequencesthis appears to be a serine/threonine phosphatase 2A catalytic subunit, which is a negative regulator of abscisicacid signalling. Its putative phenotypic effect was tested on 39 barley landraces and cultivars and a significantcorrelation was found between the allelic composition of GBM1359 and osmotic tolerance and yield. Thisstudy presents a relevant example of the use of reliable QTL data in the candidate gene approach, while alsodemonstrating how the results could be practically utilized in marker-assisted selection.Key words: QTL, drought, marker-assisted selection, barleyIntroductionDrought tolerance is an essential part of yield stability under both Mediterranean andcontinental conditions. In central Europe, especially in Hungary, drought mainly occurspost-anthesis during the grain-filling period (terminal drought). Over the last few yearscrop production has also been affected by early season water deficit due to unusually drysprings. Hence, identifying and understanding the genetic background of water deficittolerance in different developmental stages is crucial both for the improvement ofcommercial cultivars in this region and for basic research. Therefore, the present workfocussed not only on adult stage experiments, but also on early developmental stages,which have been less intensely investigated and are likely to attract greater interest dueto climate change.The aims of the study were the following: (1) Identification of reliable osmotic stressanddrought tolerance-related QTLs at different developmental stages. (2) Determinationof new candidate genes based on QTL analysis. (3) Verification of the usefulness ofidentified markers for marker-assisted selection (MAS) using barley landraces andcultivars.Materials and methodsQTL mapping was performed at three developmental stages (germination, seedling andadult stage) on 94 doubled haploid (DH) lines of the spring habit OWB population(‘DOM’ בREC’) (Hordeum vulgare subsp. vulgare). The population was mapped using643 EST markers (Grain Genes database: barley OWB Stein 2006;http://wheat.pw.usda.gov/ggpages/map_shortlist.html).215

AGRISAFE Budapest, Hungary, 2011In order to confirm the results achieved using the OWB population 39, agronomicallyvaluable cultivars and landraces were used.The testing of the OWB population in all three developmental phases (germination,seedling, adult) was carried out in a total of nine experiments (Experiments 1–9, fordetails see Szira et al., 2011).The QTLNetwork V2.0 program was primarily used for QTL analysis, which applies themixed-model based composite interval mapping (MCIM) method.The sequences of EST markers located in the peak region of QTLs found to influenceseveral traits in at least two developmental phases were subjected to a protein-basedhomology search. The protein-based comparison was made using the BLASTX 2.2.19program against the NCBI non-redundant database.Results and discussionThe 94 lines of the OWB population were examined in three phases of development(seedling, young plant and adult plant stage) in various independent, replicatedexperiments modelling water deficiency. The phenotypic data were used for QTLanalysis and a total of 38 QTLs influencing shoot and root length, shoot dry weight,yield parameters and physiological traits were identified. The joint consideration of theindividual QTLs revealed five regions that influenced several traits related to droughttolerance in at least two phases of development. These regions were located on the 2H,5H, 6H and 7H chromosomes. It was also proved that the effect of certain QTLs differedin different developmental phases, confirming that drought tolerance is a developmentphase-specific trait.The rice homologues exhibiting the greatest similarity to the EST markers located at thefive newly identified regions in barley were determined. As the rice genes are betterannotated, they can help to draw conclusions on the possible functions of the genes/ESTsequences known to be found in these QTL regions in barley. On the basis of the presentresults, the most likely candidate genes for the five regions were determined, and furtherstudies are planned to determine their precise role.Drought tolerance analysis was carried out on a barley collection consisting of 39genotypes in order to check the results obtained with the OWB population in anindependent genetic background. Three selected microsatellite markers were genotypedon the variety collection in an attempt to find correlations between the allele type of themarkers and the distribution of phenotypic values. With all three markers significantdifferences were found for the yield per spike between genotypes belonging to differentallele types under stress conditions. The results suggest that markers GBM1404,GBM1498 and GBM1359 could be suitable for the marker-assisted selection of droughttolerantgenotypes, but this needs confirmation on a wider range of genetic material.ConclusionsIt can be seen from the present experiments on drought tolerance that the resultsachieved in seedlings and young plants do not always conform with those obtained intests on adult plants. This suggests that osmotic and drought stress tolerance is adevelopment phase-specific trait and that experiments should be carried out in variousstages of development if loci influencing stress tolerance are to be identified.The effect of regions associated with drought tolerance, identified on the two-parentalmapping population, was confirmed on agronomically valuable lines with a different216

Budapest, Hungary, 2011AGRISAFEgenetic background. These results could promote the application of marker-assistedselection even for traits as complex as drought tolerance. However, if the wideapplicability of the three microsatellite markers selected on the basis of the presentresults is to be confirmed, further experiments will be required on a larger number ofagronomically valuable barley lines.The mean distance of the markers on the genetic map of the OWB population is 1.8 cMand the most probable location of the newly identified loci can be given with a precisionof 0.0–5.9 cM. In addition to the candidate genes identified in the present work, thisregion contains numerous other genes which could also be responsible for thephenotypic effects detected. It is also possible that the effect of the QTLs identified,which influence several traits, is not due to the pleiotropic manifestation of single genes,but to that of several closely linked genes. The separation of these potential genes/loci,and the exact determination of the physical distance covered by these regions and of howmany genes they contain, will only be possible after a physical map of barley has beencompiled.AcknowledgementsThis work was supported by the National Office for Research and Technology [GVOP-3.1.1-2004-05-0441/3.0] and the German-Hungarian Project ‘Plant Resource’[OMFB00515/2007]. The purchase of the Qiagen QIAxcel fragment analyser wasfinanced by AGRISAFE (EU-FP7-REGPOT- 2007-1 No.203288). The work presentedhere was also partially supported by a Bólyai Fellowship to A. F. Bálint.ReferencesSzira, F., Börner, A., Neumann, K., Nezhad, K. Z., Galiba, G., Bálint A. F. (2011) Could EST-based markersbe used for the marker-assisted selection of drought tolerant barley (Hordeum vulgare) lines? Euphytica.Manuscript published online 07.12.2010. DOI: 10.1007/s10681-010-0317-6.217

AGRISAFE Budapest, Hungary, 2011SUSTAINABLE MANAGEMENT OF THE DEVIN MINERALSPRINGE. VALCHEVA – K. STANEVA – V. VANCHEVAAgricultural University – Plovdiv, BulgariaAbstract Groundwater can be found all over the territory of Bulgaria and plays an important role in theformation of the natural environment, while also serving as a water source, which satisfies the various needs ofthe population and the economy as a whole.In order to assess the role, the place and the significance of the groundwater as a water resource and anecological factor, it is necessary to take into consideration the fact that it has a different origin compared tosurface waters and this determines its different physical and chemical properties and composition.The groundwater discovered in the region of the town of Devin is related to the Quaternary water-bearinghorizon. The comparatively small depth at which it was found and the use of the mineral water for differentpurposes by the population in the Devin region are the main reasons for conducting this hydrogeologicalsurvey.Key words: mineral water, quality, use, pollution, protectionIntroductionThe groundwater is an element of the non-renewable mineral resources of every country.It is an important abiotic component of the ecosystem. In order to preserve the ecologicalbalance in it, it is necessary to study the hydrothermal and the hydrodynamic propertiesof the water systematically.The increased exploitation of the natural groundwater is connected with its protectionfrom pollution.As a rule, the confined groundwater is naturally protected from direct pollution comingfrom the surface. The unconfined groundwater is vulnerable to pollution to a differentextent. It is mainly fresh, cold water and serves as a main source of drinking water. Thepollutants in this water are much more that those in rivers and, therefore, the process ofself-purification is slow and usually takes many years.Materials and methodsIn order to prepare a hydrogeological report on the assessment of the local exploitationresources of sounding No. 5, the following activities were performed:Collecting and processing archive documentation. We studied 5 archive items (reports)from Geoengineering JSC – Asenovgrad, Geofund – Sofia and the Ministry ofEnvironment and Water of Bulgaria and we also collected some additionalhydrogeological information from the Municipality of Devin and Devin JSC, town ofDevin.We also conducted a hydrogeological research whose purpose was to define thecharacteristics of mineral water – turbidity, temperature and taste.Analysis of a technical project for equipping the opening of sounding No. 5 in a way thatwill allow us to measure the operational delivery rate and register the remainingpressure.Analysis of the operational delivery rate, the remaining pressure and the temperatureduring the period from October to December.218

Budapest, Hungary, 2011AGRISAFEThe measurement of the delivery rate was made by mounting a water-meter on thecentral water piping and the pressure was measured by means of a pressure gauge fittedon the opening of the sounding.Water samples were taken to determine the ion content. We also conducted tworadiological and two microbiological analyses.The chemical and the radiological analyses were performed at LGI Ltd., city of Sofiaand the microbiological analyses were made at the Hygiene and EpidemiologyInspectorate in the town of Plovdiv.The purpose of this study was to conduct a hydrogeological survey of the groundwater inthe region of Devin and observe the sustainability of its parameters.Results and discussionThe town of Devin is located in a small basin in the easternmost area of the WestRhodopes. The river Devinska flows through the field and into the river Vacha a fewkilometers below the town. The town is the centre of the Devin settlement system. It islocated near the towns of Smolyan and Plovdiv.The town of Devin is located in an area affected by the influence of the Mediterraneanclimate. Winters are mild and summers are relatively hot. The average annual rainfallvaries from 500 to 710 mm/m 2 and the average annual temperature of the air is 9-10 o C.Winds are slight, mainly coming from the west in winter and summer and from the eastin spring. The relief is highly indented, ranging from low to medium mountainous relief.The difference between the lowest and the highest point of the region is 700-1000 metersand the average altitude of the basin is 720 meters.The region subject to the research has been studied well in terms of geology. It fallswithin the scope of the Shiroka laka fault zone. The central area in this zone is the BigShiroka laka fault located at 110 0 and 120 0 with a slope of 50 0 – 60 0 towards thesouthwest. Within the scope of the fault belt there are several graben depressions such asthe Devin graben. Its western and northern sections are buried under the rhyolite layerand its southern section has been marked by a fault towards south-southwest. The Devingraben is a hydrogeological structure with fissure-fault thermal mineral water.Fissure water, fissure-layer water, groundwater and thermal mineral water are formed inthe region that was subject to the research.Fissure water – it is accumulated in the rhyolites and the volcanites of Bratsigovo – theDaspat volcano massif. These are mainly infiltration types of water draining off invarious places along the slopes and the foothills of the massifs. The delivery rate of thenatural springs is 0,010 – 0,100 l/sec.Fissure-layer water – it is formed in Paleogenic sediment breccia, conglomerates,sandstone and breccia conglomerates. It is formed as a result of the flowing ofatmospheric water along fissures and when it reaches impermeable layers, it startsmoving upwards. The delivery rate of the springs is 0,010 – 0,500 l/sec.Groundwater – it is drained at the place of contact of Quaternary deposits with the areaof draining. The delivery rate of the springs is a function of the quantity of rainfall.These springs are descending.Thermal mineral water – a natural source of mineral water is the spring called “Barutenoizvorche”, which comes from the Paleogenic sediments to the west of the town of Devin.Its delivery rate is insignificant 0,020 l/sec and the temperature is 16,5 o C.219

AGRISAFE Budapest, Hungary, 2011The thermal mineral water field covers an area of about 20 km 2 which overlaps thenarrow valley of the Devinska River to the water catchment near the fish farm. It is aclosed system consisting of highly confined nitrogen thermal water accumulated mainlyin breccia conglomerate and tufogenic-sandstone formations of the Paleogenicsediments.The supply of the thermal mineral field is more or less provided through infiltration ofrain water coming from the surrounding cracked rhyolite massifs. The main supply isprovided by means of a vertical transfer of thermal water along a network of faults fromthe foundation of the graben. Considering the geological cross section and the presenceof water in the fissure, it can be concluded that the field is of a layer-fissure type as theestablished high pressure has been formed as a result of strong tectonic pressure of thePaleogenic sediments covered with a thick rhyolite layer (50-700 m).The slightly permeable clay-sandy deposits covering the sandstone and the bracciaconglomerates significantly impede the natural draining and the emergence of waterfrom that system. The thermal water from the field is mainly discharged through thesoundings.The permeability and the coefficient of piezo transfer have been calculated based on therelation S/Q ÷ f(t) on the grounds of Tays’ equation in a logarithmic type. The values ofthe calculated parameters are the following (Dobreva D., 1984)Т =20m 2 /day; а = 4,8 х10 5 m 2 /dayThis characterizes the field as slightly water abundant (Т < 30 m 2 )/day) and highlypressurized.Thermal water is not only accumulated in the Paleogenic sediments but it is also formedthere. It falls into the category of nitrogen thermal water. No substantial difference hasbeen established in the content of the water from the individual soundings and the watersamples taken from one and the same sounding during different flows.The study of the geothermal conditions of the field shows that when the depth increases,the temperatures rise relatively fast until we get into the thermal water bearing zone. Thegeometric step varies from 11 to 20 m/1 0 С and the geothermal gradient is within therange from 5 to 6 0 /100 m. There is certain logic in the change of the geothermal fieldhorizontally. The temperatures rise from the east to the west, i.e. from the periphery tothe inner areas of the Devin graben. What is important for the formation of thegeothermal conditions of the field is the natural thermal flow and the hydrogeologicalfactor – the upward movement of thermal water.Sounding№Ql/sT 0 С рНGeneralhardnessmg,,qv/lTable 1. Chemical composition of thermal waterMineralization g/lDryresidue at105 0 С g/lCations, mg/l Anions, mg/l H 2 SiO 3K N Ca Mg F Cl SO 42-5 16 42 9,4 0,1 0,24 0,22 0,6 60 2 0,3 4,8 4 19 65 33 0,2 535 16 42 9,5 0,2 0,24 0,23 0,6 61 3 1 0,1 4 20 54 37 0,22HCO 3-CO 32-HPO 4-Sounding№Table 2. Micro-component х 10 g/lAl Fe Mn Pb Ga W Ge Mo Cu Zn Ba Sr Ti Li5 0,11 1,1 7 - 1,6 - - 22 2,2 - - - 2,2 16220

Budapest, Hungary, 2011AGRISAFEAs a result of the analysis of the water samples taken in order to determine the chemicalcomposition of thermal water from sounding No. 5, we established the following:- the water is clear, no colour, with a faint smell of hydrogen sulphide;- the general hardness is 0,1 – 0,2 mg,,qv/l, which is typical of very soft water;- as regards the concentration of the hydrogen ions, it shows an alkaline reaction;- the total mineralization is 0,241 mg/ l, which classifies the water as fresh;- as regards the ion composition, the sodium and the hydrocarbonate anions,respectively the carbonate anions, are the main and the most important. Theircontent is 60-61 mg/ l for the sodium anions, 54-65 mg/ l for thehydrocarbonate anions and 33-37 mg/ l for the carbonate anions.- The sulphates are within the range of 14 to 20 mg/l, the content of chlorine aswell as the content of calcium and magnesium cations are low.- The content of the meta-silicium acid is increased to 53 mg/ l, which is typicalof nitrogen baths.- The water also contains a number of rare and dispersed elements. Al, Zn, Sr andCu have the highest concentrations. What is indicative is the presence ofgallium (Ga), which is typical of water that has deeper circulation.- Based on Kurlov’s formula, the thermal water from sounding No. 5 is alkaline,fresh, hydrocarbonate, sulphate and sodium.- Based on the radiological and microbiological indices, the water from thesounding meets the requirements of БДС 14947-80 (natural mineral water) andalso the requirements of БДС 2823-83 (drinking water).ConclusionsFor the purpose of establishing the local natural resource of the sounding, experimentalwater pouring was conducted with a maximally opened stopcock for 36 hours. Themeasured delivery rate was Q = 16 -16.5 l/sec and the temperature was 42 0 С.When comparing the chemical composition of the water from sounding 5 during theperiod of observation and the chemical composition of the water at present, a slightchange in the chemical indices is noticed. The quantity of N, CO 3 , HPO 4 is reduced. Thequantity of Mg, HCO 3 , SO 4 is increased and the quantity of Ca and K remainsunchanged.It was also established that in the area around sounding 5 there are no sources ofpollution.Due to the nature of the catchment, the presence of a guarded sanitary zone and alsobased on the conducted monitoring, no anthropogenic pollution of the water wasdetected and its properties remained unchanged during the period of observation.ReferencesDobreva D. (1984): Report on the hydrogeological study of thermal waters in the town of Devin, Asenovgrad.Ministry of Environment and Water of Bulgaria, 2011. Balance of the resources of mineral water up to03.01.2011.Ordinance № 1 dated 10.10.2007 concerning the study, the usage and the protection of groundwater. Ministryof Environment and Water of Bulgaria, 2007. (promulgated in the State Gazette, copy 87 dated30.10.2007.)Petrov P. (1999): Final report on „Re-evaluation of the resources of geothermal energy in Bulgaria”. Sofia.221

AGRISAFE Budapest, Hungary, 2011CALCIUM DEPENDENCE OF COLD REGULATED GENESI. VASHEGYI 1 – Z. TÓTH 1 – E. SEBESTYÉN 2 – V. SOÓS 2 – G. GALIBA 1,3 – B. TÓTH 11 Department of Plant Molecular Biology, Agricultural Research Institute of the Hungarian Academy ofSciences, Martonvásár, Hungary, e-mail: tothb@mgki.hu2 Applied Genomics Department, Agricultural Research Institute of the Hungarian Academy of Sciences,Martonvásár, Hungary3 Research Institute of Chemical and Process Engineering, Faculty of Information Technology, University ofPannonia, Veszprém, HungaryAbstract The role of calcium in plant abiotic stress responses including cold stress has already been describedin model organisms such as Arabidopsis and alfalfa, but little is known about the calcium dependence of coldacclimation in cereals. The present study investigated the effect of calcium on the cold acclimation-dependent,acquired frost tolerance in winter barley genotype ‘Nure’ and it was found that reducing the calcium levelusing the calcium channel blocker lanthanum or the calcium chelator EGTA significantly decreased the frosttolerance of ’Nure’ seedlings following rapid cold acclimation. The calcium dependence of the CBF-COR14bpathway was investigated at the gene expression level. CBF genes were originally characterized in Arabidopsisas transcription factors that activate COR (Cold-regulated) genes, whose proteins play a structural role inconferring cold tolerance to plants. Significantly lower COR14b cold induction was detected in treated plants,suggesting the role of calcium in COR14b-dependent cold acclimation. Further experiments were designed inorder to determine whether CBF transcription factors played a role in the calcium-dependent COR14binduction. The expression levels of several CBF genes were compared following cold induction in barleyseedlings using Real-Time PCR. Although the CBF9 and CBF14 levels showed a rapid increase following coldinduction in ’Nure’, calcium depletion did not change their induction, suggesting the role of other pathways incalcium dependent-COR14b induction and the related cold acclimation. Microarray analysis was alsoperformed to select calcium-dependent, cold-induced genes.Key words: cold, calcium, barley, signal transduction, acclimationIntroductionCereals are widely distributed under different environmental conditions. Thus, theirability to adapt to different abiotic stresses is critical for their survival. The capability offall-sown varieties to survive winter is often referred to as winter hardiness. Wintercereals are planted in the fall and, if they have adequate tolerance to survive winterfreezing temperatures, usually have higher yield potential than spring varieties plantedlater in the spring because of their longer growing period. Although varietal differencesin winter hardiness have been documented, breeders have made limited progress inimproving this trait in wheat and barley (Limin et al., 1991). Winter hardiness is acomplex trait involving tolerance to freezing, desiccation, anoxia and ice-encasement,resistance to diseases, etc. However, tolerance to freezing temperatures (frost tolerance)is considered as the primary limiting factor in most regions. Frost tolerance can bedefined as the ability of plants to survive freezing temperatures, prevent damage to thevegetative tissues and minimize other negative effects of freezing temperatures on futureyield potential. To survive freezing temperatures, many temperate plants use low, nonfreezingtemperatures before the first frost as a signal to increase their ability towithstand the subsequent freezing, a process known as cold acclimation or coldhardening. It has been estimated that the expression of hundreds of genes may be alteredwhen plants are exposed to low temperatures (Fowler et al., 2002).Materials and methodsPlant material: Seedlings of frost-tolerant barley (Hordeum vulgare cv. ‘Nure’) wereused in the experiments. The seeds were kindly provided by Nicola Pecchioni.222

Budapest, Hungary, 2011AGRISAFEReal Time PCR experiments: The cold treatment (3 o C/3 o C; 16h/8h day/night regime)was performed on 7-day-old seedlings for a period of 48 hours and samples were takenfor RNA extraction from the crowns of the seedlings at different time points. Eachsample contained three seedlings and the whole experiment was repeated three times.The RNA extraction was performed using TRIzol and RNeasy Plant Mini Kit. The realtime PCR reaction was run on ABI 7500 Real-time PCR system using SYBR Greendetection. The data were analysed by relative quantification (ddCt method) using betaactinas internal standard.Frost test survival: One-week-old seedlings were pretreated with 1 mM lanthanum or10 mM EGTA for 24h, which was followed by one week of cold hardening (3 o C/3 o C;16h/8h day/night regime). The plantlets were placed between two layers of wet filterpapers and were frozen at different temperatures (-6, -10, -12 o C) for 1 hour using aliquid freezer. Frost damage was determined in a regeneration test by sowing theplantlets into soil, cutting back their leaves, keeping them under normal growthconditions (20 o C/15 o C; 16h/8h day/night) and monitoring the shoot length growth everythird day.Results and discussionA rapid frost test protocol was developed to determine the frost tolerance of youngbarley (‘Nure’) seedlings. This system was used to test the effect of the calcium channelblocker lanthanum or the calcium chelator EGTA on the freezing survival of theseedlings. The LT 50 was found to be -6 o C using this test and lanthanum or EGTApretreatment was observed to cause significant growth inhibition after the freezing test,suggesting the role of calcium in cold acclimation (Fig. 1).800% of shoot lenght before regeneration70060050040030020010003 days recovery6 days recovery10 days recoveryControl La EGTAFigure 1. Expression level of cold-induced CBF9, CBF14 and COR14b following pretreatment with thecalcium channel blocker lanthanum (1mM) or the calcium chelator EGTA (10mM), determined by real-timePCRAt the gene expression level the calcium dependence of the CBF-COR14b pathway wasinvestigated. Significantly lower COR14b cold induction was detected in treated plants,suggesting the role of calcium in COR14b-dependent cold acclimation. Furtherexperiments were designed in order to determine whether CBF transcription factorsplayed a play role in calcium-dependent COR14b induction. The expression levels ofseveral CBF genes were compared in barley seedlings following cold induction usingReal-Time PCR. Although the CBF9 and CBF14 levels showed a rapid increasefollowing cold induction in ’Nure’, calcium depletion did not change their induction,223

AGRISAFE Budapest, Hungary, 2011suggesting the role of other pathways in calcium-dependent COR14b induction and therelated cold acclimation (Fig. 2).% of untreated control6005004003002001000La EGTA La EGTA La EGTAcbf9 cbf14 cor14bFigure 2. Frost test survival of seedlings pretreated with lanthanum or EGTA. The LT 50 value was found to be-6 o C and lanthanum or EGTA pretreatment was observed to cause significant growth inhibition after thefreezing test, suggesting the role of calcium in cold acclimation.In order to identify the calcium-dependent components of COR14b-related coldacclimation, microarray experiment will be performed to compare the cold-inducedgenes in control and lanthanum or EGTA-treated seedlings.ConclusionsThe involvement of calcium in cold signal transduction in plants has been documented inmodel plants. Monroy and Dhindsa (1995) reported that cold-induced calcium influxplays an essential signaling role in the cold acclimation of alfalfa. The present resultsproved the role of calcium in the cold signalling of cereals, but further experiments willbe is needed to refine our knowledge on the role of calcium in these processes.AcknowledgementsThis paper was financially supported by the Norway Grants and the Hungarian ScientificResearch Fund (NNF78866), and by the Agrisafe project (EU-FP7-REGPOT-2007-1No. 2032288). B. Tóth is a Bolyai fellow of HAS.ReferencesFowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that multiple regulatorypathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell.14, 1675-1690.Limin AE, Fowler DB (1991) Breeding for cold hardiness in winter-wheat – Problems, progress and aliengene-expression. Field Crop Res. 27, 201-218.Monroy AF, Dhindsa RS (1995) Low-temperature signal transduction: induction of cold acclimation-specificgenes of alfalfa by calcium at 25 o C. Plant Cell, 7, 321-331.224

BREEDING TOOLS FOR BIOTIC STRESSRESISTANCE

Budapest, Hungary, 2011AGRISAFEBIOTIC AND ABIOTIC STRESS-TOLERANT PLANTS WITHELEVATED ANTIOXIDANT CAPACITYB. BARNA 1 – A. BITTSÁNSZKY 2 – O. VICZIÁN 2 – L. KIRÁLY 2 – J. FODOR 2 –G. GULLNER 2 – T. KŐMÍVES 2 – Z. KIRÁLY 21 Plant Protection Institute, Hungarian Academy of Sciences, 1022 Budapest, Herman O. 15. bbar@nki.hu2 Plant Protection Institute, Hungarian Academy of SciencesAbstract It is well known that the harmful effect of reactive oxygen species (ROS) is counteracted byantioxidants and radical scavengers. Consequently, plants exhibiting stimulated antioxidant capacity may bemore resistant to infections and different abiotic stresses. Paraquat, as a ROS-producing agent, was used for thein vitro selection of plants tolerant to ROS. Paraquat-tolerant (PT) tobacco (Nicotiana tabacum cv. Samsunplants, selected in vitro) showed enhanced resistance to necrotrophs, such as Alternaria alternata, Botrytiscinerea, virus symptoms, fungal toxin, heavy metal, freezing and heat stresses, as compared to a non-selectedparaquat-sensitive (PS) cultivar. The senescence of PT plants was slower and both the protein and chlorophyllcontents and the levels of phospho- and galactolipids were higher in PT tobacco, as compared to the controlplants. PT tobacco had higher superoxide dismutase (SOD) and catalase (CAT) activities than PS plants,indicating increased antioxidant capacity. Accordingly, an in vitro selection programme was started forgenerating paraquat-resistant grey poplar (Populus × canescens) and potato (Solanum tuberosum) plants,leading to the development of lines with elevated tolerance to biotic and abiotic stresses. Furthermore,experiments are in progress to create stress-resistant transgenic tobacco and potato plants over-expressing theSOD and CAT enzymes.Key words: biotic, abiotic stress, antioxidant capacityIntroductionIt has been known for a long time that almost all kinds of abiotic and biotic stresses areaccompanied by a rapid accumulation of reactive oxygen species (ROS) (Király et al.2007). This oxidative burst can damage many cell constituents including membranelipids, nucleic acids and proteins. In non-stressed plant tissues enzymatic and nonenzymatic antioxidants are able to neutralize the harmful effect of ROS. In addition, highantioxidant capacity of the plant may overcome the harmful effects of ROS, in otherwords, cultivars exhibiting high antioxidant capacity would be resistant to necroticdisease symptoms. Earlier we found that in vitro selected paraquat tolerant tobacco ortransformed tobacco plants containing the bacterial ipt gene responsible for enhancedcytokinin production proved to be more tolerant to various pathogens, like Tobacconecrosis virus (TNV), Alternaria alternata or Botrytis cinerea (Barna et al. 1993, 2003;Pogány et al. 2004 ). PT tobacco showed delayed senescence as compared to PS plants(Barna et al. 1993). On the other hand, leaf senescence is suggested to be accompaniedby a decrease in the antioxidant capacity and a subsequent increase in the production ofROS (Leshem, Y. 1988).Our aim was to determine the effect of senescence of PR and PS tobacco leaves on theirantioxidant enzyme activity and to produce stress resistant grey poplar and potato plantsby in vitro selection on paraquat containing media.Materials and methodsParaquat tolerant (PT) tobacco (Nicotiana tabacum cv. Samsun plants, selected in vitro)and non-selected paraquat sensitive (PS) tobacco plants were grown in 10 cm diameterpots for 4 weeks and then transplanted to 25 cm diameter pots. All plants werepropagated in the greenhouse at 25±2 o C under a 14 h light period during experiments.To measure SOD activity, leaves (0.5 g) were ground at 0–4C in sodium phosphate227

AGRISAFE Budapest, Hungary, 2011buffer (0.1M, pH 7.8; 2ml), containing soluble polyvinylpyrrolidone (40g litre -1 ) and 2-mercaptoethanol (5mM) and the homogenates were centrifuged (12000rev min -1 , 20min,4C). Aliquots of supernatants were run on native anodic PAGE in a vertical equipment.Polyacrylamide electrophoresis (10 % native gel) and specific staining for superoxidedismutase (SOD, EC 1.15.1.1.) and peroxidase (POX, EC 1.11.1.7.) enzyme activities werecarried out as described earlier (Ádám et al. 1995), while catalase (CAT, EC 1.11.1.6.)isoenzymes were separated and determined as described by Barna and Pogány (2001).Activities were evaluated by a Shimadzu CS-930 scanner.Paraquat tolerant lines of Solanum tuberosum cv. Russet Burbank were selected in vitroon MS media containing 1.5 µM paraquat. Plants showing paraquat tolerance developedfrom calli after 4 months. For enzymatic investigations samples were taken from shootsof the same age and the same leaf level. For in vivo examinations leaf segments of thecontrol and selected plants were inoculated with 4 mm diameter discs cut out fromBotrytis cinerea grown on potato dextrose agar for 5 days.Nodal segments of poplar (Populus × canescens) clones were micropropagated andmaintained in aseptic shoot cultures in vitro according to Gyulai et al. (2008) andGullner et al. (2005) using a two step protocol. Nodal segments were cut from asepticshoots and incubated on selective WPM basal media containing a serial dilution ofparaquat (0.004; 0.04; 0.1; 0.4; 1 and 4 μM). Cultures were incubated at 25C for sixweeks in the light (40 µE m -2 s -1 ). Auxiliary shoots developed from nodal segments at thesublethal (0.4 μM) paraquat concentration were transferred onto hormone-free WPMmedia with the same paraquat concentration for a subsequent selective cycle, followedby micropropagation and rooting of PQT plantlets.Herbicide treatments. Old yellow leaves with petioles were detached and putting intoparaquat solution. Leaves were incubated under continuous light (200 μmol m −2 s −1illumination). Paraquat was dissolved in distilled water.Time scale characterization. Digital photos of petiole cultures were taken in every 15minutes and joined into a video file. Photos were subjected to image processing todetermine the increasing ratio of necrotic (brown) and yellow areas of leaves counted inpixel by histogram tools of Adobe Photoshop. (Adobe Inc.).Results and discussionParaquat tolerant tobacco showed enhanced resistance to necrotrophs, such as Alternariaalternata, Botrytis cinerea, necrotic virus symptoms, fungal toxin-, heavy metal-,freezing- and heat-stresses, as compared to the nonselected paraquat sensitive cultivar.As compared to the control plants senescence of PR plants was slower and protein andchlorophyll contents, as well as levels of phospho- and galactolipids were higher whilefree sterol content was lower in PR tobacco (Barna et al. 1993). As is known, the highphospholipid to free sterol ratio is a characteristic of young plant tissues and isassociated with cold tolerance.As it was expected, delayed senescence was accompanied by elevated antioxidantcapacity, young PT leaf extracts had the highest antioxidant enzyme activities (Figure1.). There was a striking difference in SOD and CAT activities of young and old leavesand less between PT and PS tobacco extracts. Interestingly enough the uppermost SODand CAT bands (probably isoenzymes of the largest size) from young leaf extracts of PTplants had larger electrophoretic mobility than those from old leaves or young leaves ofPS plants (Figure 1.). Although young PT leaf extracts had the highest POX activity, the228

Budapest, Hungary, 2011AGRISAFEdifferences between the various leaf extracts were not as large as in the case of SOD andCAT. It is noteworthy that the strong CAT band of young PT leaf extract showed someperoxidase activity as well (Figure 1.). Botrytis cinerea infection caused small necroticlesions on the selected paraquat tolerant potato leaves four days after infection, while oncontrol leaves water-soaked spots and mycelial growth was observed already two daysafter inoculation (Figure 2.).PT PS PT PS PT PSO Y O YSuperoxidedismutaseO Y O YCatalaseO Y O YPeroxidaseFigure 1. Superoxide dismutase, catalase andperoxidase enzyme activity bands after native PAGEand specific staining of extracts from old (O) andyoung (Y) leaves of paraquat tolerant (PT) andparaquat sensitive (PS) tobaccoFigure 2. Control and paraquat tolerantRusset Burbank potato leaves infected withBotrytis cinerea four days after inoculationTo measure the dynamics of the effect of paraquat (10 -4 M) on poplar leaves, a timescalecharacterization of the tolerance of paraquat-tolerant clone was carried out ascompared to the wild type. The percentage of the areas of necrotic (brown) and greenparts of treated leaves at different times after the initial exposure to paraquat is shown inFigure 3. Wild type leaves showed significantly less tolerance to paraquat.Paraquat stress reaction of old poplar leavesWild typePQ tolerant120%Percentage of brown leaf area100%80%60%40%20%0%0 3 4 5 6 7 8 14 24 36 48 60 72hourFigure 3. The percentage (%) of necrotic (brown) and yellow leaf areas of detached old leaves of a paraquattolerant grey poplar (Populus x canescens) clone as compared to the wild type in petiole culture containingparaquat (10 -4 M) for 72 hoursIt is noteworthy, that similarly to our results with paraquat tolerant tobacco and potato,enhanced activity of antioxidant enzyme catalase in broad bean leaves was found todecrease endogenous H 2 O 2 generated by Botrytis cinerea infection and associated withthe inhibition of both cell death and fungal development (Khanam et al. 2005). Likewise,229

AGRISAFE Budapest, Hungary, 2011stimulated activities of superoxide dismutase, catalase and peroxidase were negativelycorrelated with Botrytis cinerea infection in harvested apple fruit (Yu et al 2008)Conclusions1.Abiotic stresses or pathogen infections induce rapid accumulation of harmful reactiveoxygen species which can be neutralized by antioxidants.2. Elevation of antioxidant capacity of plants could improve their tolerance tonecrotrophic pathogens and abiotic stresses.3. In vitro selection of plants with tolerance to reactive oxygen species is an effectivetool to obtain crops with elevated resistance to abiotic and biotic stresses.Recently our other experimental approach for obtaining crops that display elevated stresstolerance is to produce transgenic plants with high antioxidant activity by incorporatingSOD and catalase transgenes.AcknowledgementsThis paper was financially supported by OTKA (PD75169)ReferencesÁdám, A. L., Bestwick, C. S., Barna, B. Mansfield, J. W. (1995): Enzymes regulating the accumulation ofactive oxygen species during the hypersensitive reaction to Pseudomonas syringae phaseolicola. Planta196, 240-249.Barna, B., Ádám, L. Király, Z. (1993): Juvenility and resistance of a superoxide-tolerant plant to diseases andother stresses. Naturwissenschaften 80, 420-422.Barna, B., Pogány, M. (2001): Antioxidant enzymes and membrane lipid composition of disease resistanttomato plants regenerated from crown galls. Acta Physiol. Plant., 23, 273-277.Barna, B., Fodor, J., Pogany, M. Király, Z. (2003): Role of reactive oxygen species, and antioxidants in plantdisease resistance. Pest Manage. Sc.i 59, 459-64.Gullner, G., Gyulai, G., Bittsánszky, A., Kiss, J., Heszky, L. Kőmíves, T. (2005): Enhanced inducibility ofglutathione S-transferase activity by paraquat in poplar leaf discs in the presence of sucrose. Phyton – Ann.Rei Botan. 45, 39-44.Gyulai, G., Tóth, Z., Bittsánszky, A., Szabó, Z., Gullner, G., Kiss, J., Kömives, T. Heszky, L. (2008): Gene upregulationby DNA demethylation in 35S-gshI-transgenic poplars (Populus x canescens), in GeneticallyModified Plants: New Research Trends, ed by Wolf, T. and Koch, J. Nova Science Publisher, Inc., pp.Chapter 8, 1-22.Khanam, N. N., Ueno, M., Kihara, J., Honda, Y., Arase, S. (2005): Suppression of red light-induced resistancein broad beans to Botrytis cinerea by salicylic acid. Physiol. Molec. Plant Pathol. 66, 20−29.Király, L., Barna, B., Király, Z. (2007): Plant resistance to pathogen infections: forms and mechanisms ofinnate and acquired resistance. J. Phytopahol. 158, 385-396.Leshem, Y. (1988): Plant senescence processes and free radicals. Free Radic. Bio.l Med. 5, 39-49.Pogány, M., Koehl, J., Heiser, I., Elstner, E. F., Barna, B. (2004): Juvenility of tobacco induced by cytokiningene introduction decreases susceptibility to Tobacco necrosis virus and confers tolerance to oxidativestress. Physiol. Molec. Plant Pathol. 65, 39-47.Yu, T., Zhang, H. Y., Li, X. L., Zheng, X. D. (2008) Biocontrol of Botrytis cinerea in apple fruit byCryptococcus laurentii and indole-3-acetic acid. Biol. Cont. 46, 171−177.230

Budapest, Hungary, 2011AGRISAFEMONITORING TYPES OF THE ORDER DIPTERA, PESTS ONVEGETABLE CROPS - CABBAGE, ONION AND GARLICY. DIMITROV – N. PALAGACHEVAFaculty of Plant Protection and AgroecologyAgricultural University, 12 Mendeleev Blvd., Plovdiv, Bulgariae-mail:palagacheva@abv.bgAbstract During the period from 2007 to 2010 the emergence and the development of the cabbage root fly –Delia radicum, the onion fly – Delia (Chorthophila) antique and the garlic fly - Suillia lurida were monitoredusing standard entomological methods – an entolomological net and food baits.Under the given weather conditions, a relationship was discovered between the main ecological factors –temperature, humidity and the requirements of the pests for these factors. The results will be used to makemodels, which will be important for prognostication and signaling.Key words: cabbage, onion, garlic, Delia radicum, Delia antique, Suillia lurida.IntroductionOne of the main problems when growing cabbage, onions and garlic is the damagescaused by the flies. The most widespread ones in our country are: the garlic fly – Suillialurida Meig.(Suillia univitata von Roser), the cabbage root fly – Delia radicum L. andthe onion fly – Delia (Chorthophila) antiquа Meig., which in cases of a mass attack arecapable of destroying up to 80-90% of the crops. (Baharien et al. 1992, Lecheva etal.2003).The flies lay their eggs at the base of the stem as they usually prefer well developedplants or the surface of the soil. The hatched larvae bite into the plants, which later fallbehind in their development, fade and wither.Under the conditions in our country, the garlic fly - Suillia lurida Meig produces onegeneration per year and spends the winter as an adult insect. The activation of the fliesstarts in the early spring, February and March, after the thawing of the snow. It preferslaying its eggs on plants that have two leaves and a height of 10-15 cm.The cabbage root fly – Delia radicum L. and the onion fly – Delia (Chorthophila)antiquа Meig. have similar biological characteristics. They spend the winter as pupasburied in the ground. The flies from the generation that has survived the winter becomeadult flies in April and start flying during the blossoming of the morelo cherries.According to Szwenda and Wrzodak (2009) the temperature, the humidity of the air andsoil as well as the duration of the day have certain influence on the lifecycle and theharmful activity of the flies.Considering the secluded life of the larvae, the fight against the flies has to be aimed atdestroying the adult insects before they lay their eggs.In relation to this, it is necessary to determine the time when the flies appear in spring inorder to fight them successfully.The purpose of the study is to establish the dependence between the temperatures andthe times of the emergence of the adult insects of the three types of flies – the garlic fly,the cabbage root fly and the onion fly.Materials and methodsThe study was conducted within the period from 2007 to 2010 in the region of the townof Plovdiv. The emergence and the distribution of the flies were observed by means ofstandard entomological methods – an entomological net and food baits. The surveys231

AGRISAFE Budapest, Hungary, 2011using an entomological net were conducted once every 7-10 days. The time when theflies started flying was determined using food baits with molasses or sweetened grapejuice.The collected flies were taken to the laboratories of the Entomology Department wherethe analysis was performed on adult flies.Results and discussionThe emergence of the garlic fly in February comes as a result of the influence of thepositive temperatures and the maximum temperatures as well.After conducting the analysis, we established that there is dependence between thenumber of the positive average 24-hour temperatures and the detected maximumtemperatures over 10 о С among them.TypeTable 1. Emergence of the flies during the period of observationObservationsPeriod of emergence2007 2008 2009 2010Suillia lurida –Garlic fly 15.02 21.02 12.02 25.02Delia antiquа -Onion fly 23.03 24.03 03.04 31.03Delia radicum –Cabbage root fly 23.03 24.03 03.04 31.03In 2007 and 2009, since the beginning of February there were 11-13 days with positiveaverage 24-hour temperatures, 8 of which were with maximum temperatures over 10 о С.In 2008 and 2010, the number of the days with positive average 24-hous temperaturesprior to the time of flying was 15-16 days, 5-6 of which were with a maximumtemperature over 10 о С.Number of days1615141312111098765432102007 2008 2009 2010number of day with positive temperatures number of days with maximum temperatures over 10 ºCFigure 1. Number of the days with positive and maximum temperatures during the period 2007-2010 for thegarlic fly232

Budapest, Hungary, 2011AGRISAFE2010212009222008212007200 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22number of the days with average 24-hour temperatures over 6 º CFigure 2. Number of the days with average 24-hour temperatures over 6 о С during the period 2007-2010 for the onion and the cabbage root flies.Unlike the garlic fly, which spends the winter as an adult insect, for the cabbage root flyand the onion fly (spend the winter as pupas) there is dependence between the average24-hour temperatures over 6 о С and the emergence of the adult flies in the field (Figure2)During the four years of observation, it was established that from the beginning ofMarch to the initiation of the flying period there must be 20-22 days with average 24-hour temperatures over 6 о С (Figure 2).These slight differences can be explained by the combined influence of the abioticfactors.ConclusionsOn the grounds of the conducted examinations we can draw the following conclusions:- the flight of the garlic fly is determined by the permanent warming of the weatherduring the first half of February. When there are 11-13 days with positive average 24 –hour temperatures, there must be only 8 days with maximum temperatures over 10 о С.When there are 5-6 days with maximum temperatures over 10 о С, there must be 15-16days with positive average 24-hour temperatures.- the flight of the adult insects of the onion fly and the cabbage root fly is preceded by aperiod of 20-22 days with average 24-hour temperatures over 6 о С.ReferencesBahariev D., B. velev, S. Stefanov, E. Loginova (1992): Diseases, weeds and pets on vegetables, Zemizdatpublishing house, p. 254Lecheva I., St. Grigorov, Y. Dimitrov (2003): Special entomology, PublishSaisSet-Eko publishing house, 234.Szwejda J., R.Wrzodak (2009): Phytophagous entomofauna occurring on onoin plantations in Poland in yares1919 – 2007. Vegetable crops Research Bulettin, 71 (71), 5-14.233

AGRISAFE Budapest, Hungary, 2011TOLERANCE OF MAIZE HYBRIDS TO EUROPEAN CORNBORER (OSTRINIA NUBILALIS HBN)IN SOUTH EAST ROMANIAE. GEORGESCU – L. CANA – C. POPOVPlant Protection Laboratory, NARDI Fundulea, Calarasi department, N. Titulescu street, nr. 1,incda.fundulea@gmail.comAbstract European corn borer (Ostrinia nubilalis Hbn) is one of the most important pests of maize. InRomania ECB is found in all maize areas. The damage caused by this species may be direct, throughquantitative and qualitative yield losses, or indirect, because the larvae act as a vector for Fusarium sp. or othermaize diseases. To test maize varieties and hybrids for tolerance to European Corn Borer under field conditionsit is necessary to rear the insect under laboratory conditions to obtain eggs batches for artificial infestation ofthe maize plants under field conditions. This paper presents results on the tolerance of maize hybrids toEuropean Corn Borer under field conditions in 2009 and 2010. In 2009 a total of 109,843 egg batches wereused for artificial infestation in the field, while in 2010 this figure was 203,253. In general, infestation washigher in 2010 than in 2009, because the climatic conditions were more favorable for larva appearance.Key words: maize, European Corn Borer, attack, resistance, climatic conditionsIntroductionEuropean corn borer (Ostrinia nubilalis Hübner) is the main maize pest in Central andSouthern Europe (Saladini M. A. et al., 2008). In Romania, European Corn Borer isfound in all maize areas and produces higher damages after panicle emergence (Rosca I.et Barbulescu Al., 1997). Yield losses produced by European Corn Borer attack can getas high as 60 %. (Muresan F. et Mustea D., 1995, Barbulescu Al., 1996, 2001). Forbreeding and plant protection research is necessary the existence of a uniform and heavypest attack which usually do not happen every year in natural conditions. Therefore itwas developed a method for maize varieties and hybrids tolerance testing at theEuropean Corn Borer attack. This method consisted in rearing the insect into thelaboratory and then obtaining the egg batches which were used for plants artificialinfestation in field conditions (Barbulescu Al., 2001). At NARDI Fundulea thoseresearches have started in 1973 with the testing of different types of artificial diets andmass rearing systems (Barbulescu Al., 1980, 1996, Popov C. et Rosca I., 2007).European Corn Borer is the first pest species grown in laboratory conditions on artificialdiet (Barbulescu Al., 1980, 1996, 2001, Popov C. et Rosca I., 2007).Materials and methodsExperiments were made at NARDI Fundulea, Romania between 2009-2010. In 2009,there were tested 15 maize hybrids and one year later, there were tested 20 hybrids.Maize plants were sowing at the end of April in both years. Egg batches are obtained inlaboratory conditions, in continuous flux at temperatures of 24-28 ºC, air humidity of 60-90 %, with permanent ventilation and light, except places where egg batches are storedwhich require permanent dark. A diet, based mainly on bean flour, after a technologydescribed by Barbulescu Al. (1980, 1996, 2001), was used for insect rearing. In June,egg batches obtained in laboratory conditions were used for artificial infestation of themaize plants in field conditions. The infestation was realized when maize plants were inBBCH 50 stage which is 10 days before panicle emergence. From each variant therewere infected 20 plants, in three repetitions, with 20 egg batches/plant. Egg batches usedfor artificial infestation are in phase of “black head” before larvae emergence. Attack234

Budapest, Hungary, 2011AGRISAFElevel was analyzed in autumn after the end of the maize vegetation period. Maize stalkhas coped in twice and there were determined two parameters: number of alivelarvae/plant and cavities length (cm). Based on these parameters we appreciated thehybrids tolerance at the European Corn Borer (Ostrinia nubilalis Hbn) attack.Results and discussionFor testing maize hybrids resistance at the attack of the European Corn Borer, artificialinfestation of the maize plants with egg batches was made in field conditions every year.From table 1 it is clear that in 2009 there were obtained over 109000 egg batches and in2010 over 203000 egg batches in laboratory conditions. Generally, the femalepercentage of total moths is around 45 % and the average number of egg batches/femalewas of 1,9 in 2009. Very good results were obtained in 2010 when we had an averagenumber of three egg batches/female (table 1).Table 1. Data regarding mass rearing of European Corn Borer (Ostrinia nubilalis Hbn) on artificial diet forobtaining off egg batches used in maize breeding field testing, in period 2009-2010Year 2009 2010Number of rearing boxes 248 329Total pupae obtained 131242 150937Average number of pupae/rearing box 565 505Total moths 131041 150758Total female moths used for egg laying 59058 67922% female moths 45,07 45,05Total eggs batches 109843 203253Average number of eggs batches/female 1.9 3.0Weather conditions in June were different in 2009 and 2010 at the period of the artificialinfestations with egg batches of Ostrinia nubilalis Hbn (figure I). In last 10 days of June2009, the precipitations sum was 65,2 mm and the total precipitations registered was103,6 mm. In last 10 days of June 2010 there were registered 79,4 mm precipitations and125,8 mm precipitations for all month compared to the multiyear average ofprecipitations in this period which is 72,2 mm. Average air temperatures registered inJune-July was higher compared to multiyear average (figure 1).In the year 2009, it was found an attack frequency of 16,67 % for experimental variants13828A-08 and F 211-06 and 75 % for variant F 224-06 (table 2) in artificial infestedmaize plants. Variants with high attack frequency have the biggest values for the cavitieslength/plant (Octavian with 2,6 cm and F 224-06 with 4,5 cm). Average number of alivelarvae/plant was subunit, higher values were found for variant F 224-06 (0,8larvae/plant). Hybrids tolerance was especially measured related to cavities length/plant.In 2009 variant F 224-06 was very sensitive at the Ostrinia nubilalis Hbn attack, variantOctavian was sensitive and variants F157-05, F8-08, F211-06 and 13828A-08 wereresistant (table 2). In 2010 there were tested 20 maize hybrids in field conditions. Attackfrequency was 15 % for variant F 376 and 80 % for variant F 53-08. Heavy attackfrequency was registered for variants F 475 M (65 %), Olimpius (60 %) and Olt (60 %).As for the average length of the cavities/plant, it was found that for most of theexperimental variants the values were close or bigger then 2 cm (table 3).235

AGRISAFE Budapest, Hungary, 2011Table 2. Inbreed maize hybrids with different values regarding tolerance to European Corn Borer (Ostrinianubilalis Hbn) attack, in artificial infestation conditions of the year 2009HybridAttackCavitiesLarvae Appreciationfrequency (%) length cm/plant no./plantOctavian 66,67 2,6 0,4 SOlt 25,00 1,1 0,3 PRF 157-05 33,33 0,8 0,1 RF 22-08 33,33 1,2 0,2 PRF 8-08 20,83 0,8 0,1 R15289-05 29,17 1,2 0,1 PRF 228-06 29,17 1,0 0,1 PRF 211-06 16,67 0,6 0,1 RF 224-06 75,00 4,5 0,8 VSF 125-06 33,33 1,2 0,3 PRF 53-08 29,17 1,0 0,2 PRF 1145-05 25,00 1,3 0,2 PR13828A-08 16,67 0,6 0,1 RF 341-08 41,67 1,6 0,3 PROlimpius 33,33 1,2 0,1 PRR-resistant; MR-medium resistant; PR-partially resistant, S- sensitive, VS-very sensitiveFor variant F 53-08, the average length of the cavities/plant was 4,6 cm. In the weatherconditions of 2010, maize hybrids F 22-08, F 376, Palatin/Star and F 425 M wereresistant at the European Corn Borer attack, under field artificial infestation. The hybridsF 53-08 and Olimpius were very sensitive (table 3).Table 3. Inbreed maize hybrids with different values regarding tolerance to European Corn Borer (Ostrinianubilalis Hbn) attack, in artificial infestation conditions of the year 2010HybridAttackCavitiesLarvae Appreciationfrequency (%) length cm/plant no./plantF 223-06 50,00 2,9 0,4 SOlt 60,00 2,6 0,4 SF44-03 50,00 2,1 0,4 SF 22-08 20,00 0,5 0,1 RF 8-08 35,00 2,3 0,4 SF 947-05 45,00 2,2 0,3 SRapsodia 41,18 2,5 0,6 SF 376 15,00 0,5 0,1 RPalatin/Star 30,00 0,7 0,2 RF 322 55,00 1,1 0,2 MRF 53-08 80,00 4,6 0,8 VSF 475 M 65,00 2,6 0,5 SF 341-08 35,00 1,9 0,3 PROlimpius 60,00 3,5 0,7 VSMilcov 45,00 2,2 0,2 SOituz 25,00 0,9 0,1 MRPaltin 20,00 1,4 0,2 PRGranit 35,00 2,0 0,2 SBrates 25,00 1,9 0,4 PRF 425 M 35,00 0,5 0,2 RR-resistant; MR-medium resistant; PR-partially resistant, S-sensitive, VS-very sensitive236

Budapest, Hungary, 2011AGRISAFE3014025120100average temperature °C20151020092010Multiannual averagePrecipitations (mm)80604020092010Multiannual average5200April May June July August Septembermonth0April May June July August SeptembermonthFigure 1. Temperature and precipitations during maize vegetation period (April September) at NARDIFundulea, in period 2009-2010Table 4. Comparison of the results regarding maize hybrids tolerance to European Corn Borer (Ostrinianubilalis Hbn) attack, in artificial infestation conditions, in period 2009-2010Hybrid 2009 2010Olt PR SOlimpius PR VSF 8-08 R SF 22-08 PR RF 53-08 PR VSF 341-08 PR PRR-resistant; PR-partially resistant, S- sensitive, VS-very sensitiveConclusionsGrowing the European Corn Borer in laboratory conditions for obtaining the egg batchesused for artificial infestations under field conditions for maize hybrids tolerance testingat the ECB attack is a method with good results in plant protection and breeding researchin Romania. In 2010 there were obtained in laboratory conditions over 203000 eggbatches used for artificial infestation of the maize plants. Generally the attack was higherin 2010 compared with 2009 especially because of the weather conditions during larvaeemergence. Six maize hybrids were tested both in 2009 and 2010. Hybrids Olt,Olimpius, F 8-08 and F 53-08 with different degrees of resistance in 2009 at the ECBattack under field artificial infestation conditions, become sensitive one year later .ReferencesBarbulescu Al. (1980): Mass-rearing of the European Corn Borer (Ostrinia nubilalis Hbn.) on artificial diet,Problems of Plant Protection, 8, (1)1-12.Barbulescu Al. (1996): Data obtained in period 1990-1992 concerning mass rearing of the Ostrinia nubilalisspecies on artificial diet, many successive generations. Problems of Plant Protection, 24, (1) 1-12.Barbulescu Al., (2001): Data obtained in period 1996-1998 concerning rearing of the species Ostrinia nubilalison artificial diet, many successive generations. Problems of Plant Protection, 29, (1) 33-40.Muresan F., Mustea D. (1995): Results obtained in controlling of the European Corn Borer-Ostrinia nubilalisHbn. at SCDA Turda. Problems of Plant Protection, 23, (1) 23-34.Popov C., Rosca I. (2007): Technology of European Corn Borer (Ostrinia nubilalis Hbn.) mass rearing, incontinuous system and successive generations. Entomological Research, 37, (1) 126.Rosca I., Barbulescu Al. (1997): Research concerning marking of the European Corn Borer (Ostrinia nubilalisHbn) with „Calco Red Dye”. Problems of Plant Protection, 25, 199-206.Saladini, M. A, Blandino, M., Reyneri, A., Alma, A. (2008): Impact of insecticide treatments on Ostrinianubilalis (Hübner) (Lepidoptera: Crambidae) and their influence on the mycotoxin contamination ofmaize kernels, Pest Management Science, 64, (9)1170-1178.237

AGRISAFE Budapest, Hungary, 2011MOLECULAR MARKER-ASSISTED SELECTION IN THEWINTER BARLEY BREEDING PROGRAM FOR BYDV(BARLEY YELLOW DWARF VIRUS) TOLERANCEI. GUINEA – L. VASILESCU – M. CIUCANational Agricultural Research and Development Institute Fundulea, 915200, ROMANIAionica_guinea@yahoo.comAbstract Barley is an important crop with many uses in human nutrition and animal feeding. Barley yellowdwarf virus (BYDV) is a serious threat to winter barley all over the world. For economic and ecologicalreasons, it is better to cultivate resistant/tolerant barley cultivars. In an effort to obtain such cultivars in thebarley breeding program, breeders used the Ryd2 gene coding for BYDV tolerance, for which various PCRmarkers are available. The study included the examination of 132 barley genotypes (cultivars, DH lines andpre-breeding lines) to identify genotypes with the Ryd2 gene, using marker-assisted selection. The resultsshowed 59 homozygous genotypes for the Ryd2 gene and 6 heterozygous genotypes. The use of PCR markerssimplified the detection of the BYDV tolerance gene in the breeding germplasm and could thus accelerategenetic progress in the barley breeding program.Key words: BYDV, Ryd2 gene, barley, Ylp markerIntroductionBYDV is associated with the appearance of yellow colour, dwarfism and necrosis of theplants vessels, leading to the most destructive symptoms among diseases of barley. Theluteovirus is transmitted to plants only by aphids through five known serotypes (RPV,RMV, MAV, PAV, SGV). BYDV infection can lead to serious yield losses, influencedby the serotype, development phase of host plant genotype and environmentalconditions. For certain economic and environmental reasons, choosing less expensiveand less environment damaging control methods are beneficial. From this point of viewthe incorporation of resistance and/or tolerance to BYDV remains one of the best waysto control this disease. The use of molecular marker technology can help in obtainingcompetitive results in winter barley pre-breeding and breeding programs.The NARDI Fundulea barley breeding program has been introducing genes of toleranceto BYDV, such as Ryd2, and other genes of tolerance/resistance. The breeders have alsohoped to identify new sources of tolerance/resistance to BYDV.Barley has natural tolerance/resistance to BYDV. There is two charachterised tolerancegenes: yd1(yd1) and Ryd2 (Yd2) and two genes for resistance to BYDV: Ryd3 and Ryd4(Suneson, 1955) so far. Kosova et al. (2008) identified a recessive tolerant gene yd1(ryd1) in Rojo variety, but due to low efficiency, ryd1 gene is less used in breedingprograms.Ryd2 (Yd2) gene was isolated in spring landraces of Ethiopian barley (Rasmusson andSchaller 1959, Scholz 2009). This gene is located near the centromeres on chromosome3HL (Collins et al. 1996, Kosova 2008). Ryd2 gene provides tolerance of barley croponly for serotypes PAV, MAV, SGV (Baltenberger et al. 1987, Scholz et al. 2009). ForRyd2 gene there are molecular markers that allow identification of barley genotypeswhich contain this gene. In 2000. Ovensa et al., using two molecular markers, provedthat the marker YLM (Paltridge, 1998) gave results only for spring barley and Ylpmarker (Ford et al., 1998) for winter barley.Ryd3 (Yd3) gene was described in line L94 of Ethiopian origin (Niks et al., 2004). Thisgene is located on chromosome 6H and causes significant reductions of BYDV virions,indicating a real viral resistance, more likely than tolerance to BYDV. In 2009, Margaret238

Budapest, Hungary, 2011AGRISAFEScholz et al., discovered Ryd4 gene in Hordeum bulbosum which confers complete anddominant resistance to BYDV.In this paper, we report the results of marker Ylp assisted selection for Ryd2 gene,involved in BYDV tolerance, used in barley breeding program.Material and methodsThe studied biological material was represented by 132 genotypes of winter barleyvarieties, lines and pre-breeding material created in the Laboratory of Barley Breedingand Cytogenetics (NARDI Fundulea), sources of resistance offered for testing by theInternational Center for Agricultural Research in the Dry Areas (ICARDA GermplasmProgram, Syria) and various foreign varieties. The biological material obtained atNARDI Fundulea was established by pedigree and biotechnological “bulbosum”methods.For DNA isolation we used embryos and a protocol based on CTAB (Cetyl trimethylammonium bromide) 2%, proteinase K treatment, and ethanol precipitation. The purityand integrity of DNA was checked by electrophoresis (0.8% agarose gel in 0.5 x TBEbuffer) and with spectrophotometer using a spectrophotometer Life Science - BeckmanCoulter DU 730.The amplification reaction – PCR – was performed under the following conditions: finalvolume of 25 µl reaction mix containing 1x reaction buffer, 100-150 ng DNA matrix,dNTPs - 0.2 mM, primers Ylp (Ford et al., 1998) – 0,4µmol, 1U Taq enzyme (Promega),1.5 mM MgCl 2 . Amplification was performed in an Applied Biosystem termocycler9600, according to the following protocol: initial denaturing 94 °C – 3 minutes(denaturing: 94 °C – 1 min., annealing 60 °C – 1 min., extension 72 °C – 2 min.) 38cycles and a final extension: 72 °C – 10 minutes. Electrophoresis of the PCR productswas performed in 2% agarose gel using ethidium bromide stain. For visualisation thephoto combine Bioprint has been used.Results and discussionsKnowing that in the last years climate has changed in Romania, the last months ofautumn were characterized by higher temperatures which favoured an intense aphidsattack of seedlings of winter barley.These aspects determined an increased emphasis in the winter barley breeding programfor obtaining new barley genotypes with tolerance/resistance at BYDV and with superioragronomic traits. Because of the difficulties in conducting artificial infections, the use ofmolecular marker technology can greatly facilitate reaching this objective.The Ylp marker used for molecular analysis was applied for 132 genotypes (cultivars,DH lines and pre-breeding lines). Results showed the Ryd2 gene presence in 64genotypes, out of which 6 were heterozygous (Table 1 and Fig.1).We consider that the Ylp marker is very usefully in the breeding program, foraccelerating the process of obtaining new tolerant cultivars.ConclusionsOut of 132 genotypes (cultivars, DH lines and pre-breeding material) analyzed using Ylpmolecular marker, 59 winter barley genotypes presented Ryd2 gene in homozygouscondition and 6 were heterozygous.239

AGRISAFE Budapest, Hungary, 2011Tthe tolerant pre-breeding lines will be used as sources for creating new tolerantcultivars.Selection from the heterozygous genotypes will allow the exploitation of the Ryd2 gene.Using PCR marker we have simplified the detection of BYDV tolerance gene inbreeding germplasm and this could accelerate genetic progress in the barley breedingprogramNr.Crt.Table 1. Genotypes with tolerance to BYDV, based on Ryd 2 geneGenotype Ryd2 Nr. Crt. Genotype Ryd2CULTIVARS1 Dana + 9 Merle +2 Madalin + 10 Palinka +3 Sistem + 11 Dai 197 +4 Maresal FD + 12 Veturia +5 Univers + 13 Kelibia +6 Andrei + 14 Tiffany +7 Compact + 15 Violetta +8 Laura + 16 Cervoise +DH LINES17 DH 264-16 + 27 DH 262-2 +18 DH 267-36 + 28 DH 252-3 +19 DH 267-47 + 29 DH 254-13 +20 DH 267-108 + 30 DH 254-14 +21 DH 253-3 + 31 DH 254-18 +22 DH 254-22 + 32 DH 94-4 +23 DH 255-5 + 33 DH 99-12 +24 DH 258-1 + 34 DH 267-121 +25 DH 260-16 + 35 DH 267-85 +26 DH 261-8 + 36 DH 267-64 +PRE-BREEDING LINES37 F8-43 + 51 60106 - 2 +38 F8-41 + 52 60110 - 4 +39 F8-42 + 53 60001 - 1 +40 F8-9 + 54 60004 - 1 +41 F8-110 H 55 60004 - 3 +42 F8-2 + 56 60006 - 1 +43 F8-3 + 57 60110-3 H44 F8-7 + 58 60103-5 H45 40214 + 59 60008-1 H46 40209 + 60 41214 H47 40218 + 61 60004-2 +48 60105 – 1 + 62 60004-4 +49 60105 – 4 + 63 60011-1 +50 60106 – 1 + 64 60001-1 H240

Budapest, Hungary, 2011AGRISAFEFigure 1. Electrophoresis profile obtained with Ylp marker (R – tolerant to BYDV, presence Ryd2 gene, S –susceptible to BYDV, H – heterozigot)AcknowledgementsThis study was supported by the National Project-PN09-25.01.05ReferencesKosova, K., Chrpova J., Sip, V. (2008): Recent advances in breeding of cereals for resistance to barley yellowdwarf virus – A review, Czech J. Genet. Plant Breed., 44 (1), 1-10.Niks, R. E., Habekuβ, A., Beckele, B., Ordom, F. (2004): A novel major gene on chromosome 6H forresistance of barley against the barley yellow dwarf virus, Teor Appl. Genet, 109, 1536-1543.Ovensa, J., Vancke, J., Kucera, L., Chrpova, J., Novakova, I., Jahoor, A., Sip, V. (2000): Genetic analysis ofresistance in barley to barley yellow dwarf virus”, Plant Breeding, 119, 481-486.Scholz, M., Ruge-Weling, B., Habekuβ, A., Schrared, O., Pendinen, G., Fischer, K., Wehling, P. (2009):Ryd4Hb : a novel resistance gene introgressed from Hordeum bulbosum into barley and conferringcomplete and dominant resistance to the barley yellow dwarf virus, Theor Appl Genet, 119, 837-849.241

AGRISAFE Budapest, Hungary, 2011IMPACT OF CLIMATE CHANGE ON WHEAT/PATHOGENINTERACTIONS AND ON BREEDING FOR HOST RESISTANCEM. ITTU 1 – L. CANA 2 – G. ITTU 31, 3Breeding Department, National Agricultural Research Development Institute Fundulea,1 N. Titulescu Street, Fundulea, Romania, e-mail: ittum@ricic.ro2Plant Protection Department, National Agricultural Research Development Institute Fundulea,1 N. Titulescu Street, Fundulea, RomaniaAbstract In the last 21 years, continuous changes in the temperature and water regimes as compared withlong-term means has been revealed at Fundulea (South Romania, 67 m above sea level, 44.4º latitude, 26.1ºlongitude). In particular, less favorable conditions have constantly been registered during the optimal periodsfor the development of wheat rust diseases (March-June). Consequently, the natural occurrence of rusts hasincreased and the phenotyping of host resistance toward Puccinia pathogens using artificial inoculation in thefield has become much more difficult than before. In order to prevent a breakdown of the resistance ofcurrently efficient resistance (R) genes, a preliminary characterization of Romanian wheat germplasm for adultplant resistance (APR), race non-specific, partial, slow rusting to leaf rust (Puccinia triticina Eriks.) has beeninitiated at NARDI-Fundulea. In artificial field inoculation trials, the resistance of 15 Romanian, three Austrian(Capo, Antonius & Pokal) and two Swiss varieties (Forno & Arina) has been analyzed by visually scoring leafrust intensity, recorded at 30, 40, 60 and 70 days post-inoculation (d.p.i). The results, expressed as the areaunder the disease progress curve (AUDPC), suggest that the Romanian varieties Izvor (AUDPC=92.5) andFaur F (AUDPC=167.5) could be classified as slow-rusting compared to the susceptible control(AUDPC=2750), while Capo (AUDPC=37) was the most resistant variety, but further validation withdiagnostic molecular markers is necessary.Key words: climate change, wheat, Puccinia triticina Eriks., Lr genes, adult plant resistance (APR), partialresistance, area under the disease progress curve (AUDPC)IntroductionMany of current cereal pathogens, air transmitted (rusts, powdery mildew, foliar spots)and both, the seed (scab, bunt, smuts, ergots) and residue (tan spot) borne ones, mayproduce major economic constraints, in terms of maintaining crop diversity, food supplysecurity and food safety. Among these, air borne obligate pathogens, with a highevolutionary rate, able to migrate over long distances from origin to the new infectionsites, were identified as the main causes of yield losses, via reduced grain-fill, lightinterception and radiation use efficiency.Introduction of high-yielding, dwarf and semi-dwarf varieties have resulted, in anincreased susceptibility of them to new diseases and/or pathotypes. Similar effects wereregistered via deployment of host resistant (R) genes, particularly of oligogenic type, thatimpose a strong selection pressure on the pathogens and becoming unefficient afterintense use. The application of fungicides, basically economically profitable have causedin time selection of fungicide-resistant pathogen strains, nontarget effects on beneficial fungiand aquatic life, that became additional reasons for basing fungicide use, much morerationally (Weisz et al., 2011).Curent models and projections of climate change on future food production and foodsecurity highlight, as the main challenges with regard to rusts of wheat: 1) evolving ofnew virulent strains and their rapid spread, 2) more frequent overcoming of rustresistance, 3)new hosts (i.e. triticale for yellow rust), 4) overall increased loss (Singh etal., 2005, Chakraborty et al., 2010). A prove that rust never sleeps and the demand of anaccordingly approach, is the occurrence of Ug 99 (syn. TTKSK, Pgt), a new race withbroad virulence of stem rust, that due to its successful control was a silent disease for242

Budapest, Hungary, 2011AGRISAFEmore than 30 years. Under increased climate variability, among others, necrotrophic andsoil-borne pathogens may become also more damaging to crops.Having in mind that the most effective and environmentally sound means of combatingwheat diseases is through the use of host durable resistance, necessity that breedingtargets will need to better reflect the changing importance of these pathogens underclimatic change is strongly emphasized. The main tools in this direction are: i)permanently forecasting the potential local shifts that could occur in local pathogenicpopulations with detrimental impact on host resistance and ii) search of alternativebreeding procedures aimed to enhance the durability of resistance.In this respect, race non-specific resistance from the slow-rusting, APR class supposed tobe more durable, represents a valuable alternative to deployment of efficient resistance(R), genes usually short-lived in nature (Kuhn et al., 1978). The partial resistance, multipathogenseffective, induced by genes with different levels of resistance andchromosomal locations, Lr 34/Yr18/Pm38, Lr46/Yr29/Pm39 and Lr 67/Yr29 have beenlargely documented and diagnostic markers for marker-assisted selection have beendeveloped (Rosewarne et al., 2008, Spielmayer et al., 2008, Lagudah et al., 2009,Hiebert et al., 2010).Similarly to other wheat crop regions, a continuous change of temperature and waterregime has been revealed at Fundulea (South Romania, 67 m above sea level, 44.4ºlatitude, 26.1º longitudes). As a consequence, declines of natural occurrence of rust fungihave been noticed. In such circumstances, phenotyping of resistance toward rustpathogens under field artificial inoculation, become rather hazardous (leaf rust) or muchmore difficult than before (stripe and stem rusts) (Ittu and Ittu, 2010), while breeding ofresistance, remains a target of major concern in the national wheat breeding program.The aim of this study was to investigate the perspectives for phenotyping of partialresistance from the slow-rusting, APR class, in bread wheat germplasm obtained atNARDI-Fundulea, as a base for diversification of current sources of resistance andapproach of markers assisted selection for this type of resistance in the future.Materials and methodsClimatic parameters: evolution of mean temperatures (MT°C), total rainfall (TR, mm)and relative humidity (RH %) in the interval March-June, critical for development of leafrust infection, have been analyzed according to data registered over 21 years (from 1990to 2010) at the Meteorological unit of NARDI-Fundulea. Data were expressed asdifferences from average over the last 50 years these being 13.3 °C, 213.4 mm, and 75%,respectively.Plant material: a set of 20 European winter wheat varieties, including the Romanianvarieties, Izvor, Faur F, Dor F, Delabrad 2 (DLB 2), Alex, Gruia, Glossa, Boema 1,Ariesan, Crina, Dropia (DRP), Flamura 85 (FL 85), Fundulea 4 (F 4), Albota, Fundulea133 (F 133) (susceptible control) and five varieties, released in Austria (Capo, Antonius,Pokal) and Switzerland (Arina and Forno), have been assessed for partial, slow-rustingadult plant resistance (APR). The Romanian varieties were previously known as carriersof at least the APR resistance gene Lr 34, separately validated by molecular analysis byLaszlo Purnhauser (Szeged, Hungary, personal communication). Arina and Capo werepostulated as carriers of Lr 13 or Lr 13+, respectively (Park et al., 2001).Resistance trials: artificial inoculations were performed in seedling and adult stage,following the procedures previously described (Ittu and Ittu, 2010). Scorings on leaf rust243

AGRISAFE Budapest, Hungary, 2011intensity were recorded at 30, 40, 60 and 70 days post inoculation (d.p.i.) and AUDPCwas calculated.Results and discussionDuring the critical period for development of leaf rust (March-June), an increase ofMT°C, associated with TR, mm and RH, %, as compared to the multiannual averagesregistered for these parameters, have been revealed over 21 years at Fundulea (1990-2010) (Table 1). More relevant change of these climatic factors, were observed in thesecond decade (2000-2010), when corresponding deviations of 0.97°C, -25.9 mm, and -6.3%, respectively have been detected on average.Table 1. Mean temperature, total rainfall and relative humidity from March to June over 21 years (minimum,maximum, differences from 50 yrs averages)Parameter 1990-1999 2000-2010Average Differences Average DifferencesMean temperature, °C 13.4 0.08 14.2 0.97Minimum 12.1 -0.73 12.8 -0.53Maximum 14.2 175.0 15.6 228.0Total rainfall, mm 220.0 19.5 189.1 -25.9Minimum 143.9 -71.1 78.3 80.6Maximum 455.8 240.0 295.6 -137.0Relative humidity, % 70.4 -4.6 73.8 -6.3Minimum 64.8 -3.0 53.0 -0.5Maximum 78.8 -10.3 76.3 -175Seedling and adult plant resistance: in seedling test, all varieties displayed an infectiontype (IT) of 2+to 3+, whereas only IT’s of 3+or higher were regarded as compatible. Alarge variation of responses to leaf rust, in terms of AUDPC was registered at adult plantgrowth stages, with values ranging from 37 (Capo) to 1400 (Arina) in European entries.In the Romanian varieties, AUDPC ranged from 92.5 (Izvor) to 2600 (Albota). Datasuggest that Romanian varieties Izvor (AUDPC=92.5) and Faur F(AUDPC=167.5),could be considered as from the slow-rusting class, in comparison to the susceptiblecontrol (AUDPC=2750) and the most resistant variety Capo (AUDPC=37). Low valuesof AUDPC, ranging from 370 to 390, were displayed also by varieties Dor, Delabrad 2and Alex (Table 2).According to the close correlation found in this trial between early scoring of response toleaf rust and AUDPC (r=0.91, P=0.1), it could be concluded that a slower rate of rustingleads to acceptable levels of protection to rust infection, disease intensity of suchvarieties not exceeding 50% (data not shown). It is expected also that this level ofresistance to be more durable.Further validation with diagnostic molecular markers for Lr34 and targeted introgressionof Lr46/Yr29/Pm39 and Lr 67/Yr29 into the Romanian adapted germplasm is necessary.244

Budapest, Hungary, 2011AGRISAFETable 2. Seedling and adult field response to leaf rust under artificial inoculation in 20 wheat varieties[ averages (infection type-IT, intensity of attack-IA % and area under disease progress curve-AUDPC )]OriginResponse to leaf rust inoculationsVarietySeedling, Intensity of attack, % at d.p.i. AUDPCIT (0-4) 30 40 60 70Control (S) Romania 4 0 60.0 100 100 2750.0Capo Austria 0 0 2.0 2.0 37.0Antonius Austria 0 0 2.5 10.0 110.0Pokal Austria 0 0 16.5 7.5 228.8Forno Suiss 0.5 1.5 17.5 40.0 538.3Arina Suiss 0 0 55.0 100 1400.0Izvor Romania 3 0 0 5.0 5.0 92.5Faur F Romania 2+ 0 5.0 5.0 5.0 167.5Dor Romania - 0 0 20.0 20.0 370.0Delabrad 2 Romania 3+ 0 5.0 5.0 30.0 380.0Alex Romania 3 0 0 5.0 40.0 390.0Gruia Romania 2+ 0 0 40.0 40.0 740.0Crina Romania 2+ 0 5.0 40.0 40.0 815.0Glossa Romania - 0 5.0 40.0 50.0 900.0Boema 1 Romania 3 0 14.0 40.0 60.0 1120.0DRP Romania 3+ 0 8.0 70.0 8.0 1500.0Ariesan Romania - 0 40.0 50.0 50.0 1525.0FL 85 Romania 3+ 5.0 50.0 80.0 80.0 2237.5F 4 Romania 3 0 60.0 80.0 90.0 2465.0Albota Romania - 0 70.0 70.0 100 2600.0ReferencesChakraborty, S., Luck, J., Hollaway, G., Fitzgerald, G., White, N. (2010): Rust-proofing wheat for a changingclimate. Euphytica DOI 10.1007/s10681-010-0324-7.Hiebert, C.W., Thomas, J. B., McCallum, B. D., Humphreys, D. G., Depauw, R. M., Hayden, M. J., Mago, R.,Schippenkoetter, W., Spielmeyer, W. (2010): An introgression on wheat chromosome 4DL in RL 6077(Thatcher*6/PI 250413) confers adult plant resistance to stripe rust and leaf rust (Lr 67). TAG: DOI10.1007/s00122-1373-y.Ittu, M., Ittu, G. (2010): Unele aspecte ale ameliorãrii rezistenţei grâului la rugina brunã în contextulschimbãrilor climatice. Analele Institutului Naţional de Cercetare-Dezvoltare Agricolã Fundulea,LXXVIII-2, 18-24.Kuhn, R. C., Ohm, H. W. and Shaner, G. E. (1978): Slow leaf-rusting resistance in wheat against twenty-twoisolates of Puccinia recondita. Phytopathology 68, 651-656.Lagudah E. S., Krattinger S. G., Herrera-Foessel S., Singh, R. P., Huerta-Espino, J., Spielmeyer, W., Brown-Guedira, G., Selter, L. L, Keller, B. (2009): Gene-specific markers for the wheat gene Lr 34/Yr 18/Pm 38which confers resistance to multiple fungal pathogens. Theor. Appl. Genet. 119, 889-898.Park, R. F. Goyeau, H., Felsenstein, F. G., Bartoš, P. and Zeller, F. J. (2001): Regional phenotypic diversity ofPuccinia triticina and wheat host resistance in western Europe, 1995. Euphytica. 122, 113-127.Rosewarne, G.M., Singh, R. P., Huerta-Espino, J.,William, H. M., Bouchet, S., Cloutier S., Mc Fadden, H.,Lagudah, E. S. (2006): Leaf tip necrosis, molecular markers and β1-proteasome subunits associated withthe slow-rusting resistance genes Lr46/Yr29. Theor. Appl. Genet. 112, 500-508.Singh, R. P, William, H. M., Huerta-Espino, J., Rosewarne, G. (2005): Wheat rust in Asia: meeting thechallenges with old and new technologies. Proceedings of the 4th International Crop Science Congress,Brisbane, Australia, 26 Sep.–1 Oct. 2004.Spielmeyer, W., McIntosh, R. A, Kolmer, J., Lagudah, E. S. (2005): Powdery mildew resistance is associatedwith durable leaf rust and stripe rust resistance genes Lr34/Yr18 and maps to a single locus on the shortarm of chromosome 7D of wheat. Theor. Appl. Genet. 111, 731-735.Weisz, R., Cowger, C., Ambrose, G., and Gardner, A. (2011): Multiple mid-Atlantic field experiments showno economic benefit to fungicide application when fungal disease is absent in winter wheat.Phytopathology 101, 323-333.245

AGRISAFE Budapest, Hungary, 2011PHENOTYPIC ASSESSMENT OF RICE (ORYZA SATIVA L.)GENETIC RESOURCES FOR ABIOTIC AND BIOTIC STRESSTOLERANCEM. JANCSÓResearch Institute for Fisheries, Aquaculture and Irrigation, Szarvas, Hungarye-mail: jancsom@haki.huAbstract Rice is one of the major consumers of irrigation water worldwide, but water for agriculture isbecoming increasingly scarce. In Hungary, aerobic rice was grown not only to save water, but also for thediversification of agriculture with an environmentally friendly method.In the experiment, phenotypic assessment was carried out on 29 gene bank accessions of rice for drought andblast tolerance. Among the genotypes, Ábel, Tünde, M 488, Cigalon and Banloc were found to have goodtolerance of aerobic conditions with A/F ratios of 98.6, 93.8, 90.3, 90.4 and 93.4, respectively. Thisdemonstrates the effect of breeding for unfavourable environments, since Abel is one of the new varietiesdeveloped for aerobic culture.Blast is a major biotic constraint of rice growing worldwide. The blast resistance of rice genotypes wasevaluated on the basis of infection types on the leaves of rice plants under two different growing conditions. Itwas found that flooded conditions accelerated the spread of the fungus via higher humidity in the leaf zone.Shimokita, Unggi 9, Biroyza H, Apo Nisc RC9 and IRAT 109 were found to be resistant at both sites.Key words: blast disease, drought tolerance, gene bank, Oryza sativa, riceIntroductionWater for agriculture is becoming increasingly scarce worldwide and rice is one of themajor consumer of irrigation water. Worldwide, 79 million ha of irrigated rice isestimated to receive 34-43 % of the total world’s irrigation water (Bouman et al. 2007).And it is also estimated that, by 2025, 15-20 million ha of irrigated rice will suffer somedegree of water scarcity (IRRI 2009).In Hungary, first steps of scientific research on aerobic rice (Oryza satvia L.) cultivationwere begun in the 1940s. The pioneer experiments were carried out to find appropriatevarieties for the sandy soils of the Great Hungarian Plain and not to develop watersaving technologies. The second phase of aerobic rice research was started in 1984 at theformer Irrigation Research Institute and a new water-saving rice growing method(SANORYZA) was patented in 1992 (Simon-Kiss 2001). New varieties (e.g. cv.Sandora, cv. Ringola, cv. Auguszta, cv. Janka and recently cv. Ábel) and newtechnology were developed for the special conditions. These varieties had good overallabiotic stress tolerance, like HSC55 which was used for cold tolerance testing (Bodapatiet al. 2005).Among all, leaf rolling, leaf drying, harvest index, biomass yield, relative water content,panicle length, grains per panicle, grain yield, root/shoot ratio and root length offer highscope for improvement for drought tolerance by way of simple selection technique(Manickavelu 2006).Magnaporthe grisea (Herbert) Barr is a major constraint of rice growing worldwidewhich causing rice blast disease. In the 1950s it was become epidemic in Hungary too(Simon-Kiss 2001). Magnaporthe grisea is a pathogen fungus can infect all rice tissuesover the water surface, including leaves, stems and panicles (neck blast disease) (Ribotet al. 2008). Resistance to blast disease is controlled by independent major resistancegenes and breeding is considered the most effective way to control yield losses, but afterthe commercialisation of new varieties, resistance was not stable and in a few years newraces of blast broke the resistance of the plants (Correa-Victoria et al. 2004).246

Budapest, Hungary, 2011AGRISAFEIn our experiment, phenotypic assessment of gene bank accessions (29) in rice fordrought and blast tolerance was carried out.Materials and methodsRice genotypes (29) from the gene bank of the Research Institute for Fisheries,Aquaculture and Irrigation (HAKI) and from the Research Centre for Agrobiodiversitywere chosen for abiotic (drought) and biotic (blast) stress tolerance experiment.The selected accessions were grown at the Lysimeter Experimental Station (Szarvas)under the modified SANORYZA system (Figure 1.) parallel with the conventionalgrowing at the Galambos Rice Research Station (Szarvas). The growing technique wassimilar at the two sites except irrigation. Drip irrigation (220 mm) and fooding (1000mm) were used for the SANORYZA and conventional rice culture, respectively. Thesource of irrigation water was the oxbow-lake of Körös River for the both sites. Naturalprecipitation was 513,7 mm during the season (April-September).Small-scale experimental plots (3 m 2 ) were used in random block design with fourreplications to explore the effect of water limited condition on the phenotypicalparameters (plant height, blast tolerance) of different rice genotypes. The ratio of aerobicand flooded performance (A/R Ratio) was calculated to estimate drought tolerance level.The plant height was measured continuously during the season, while blast tolerancecategories were evaluated on the basis of symptoms. The infection types were scoredusing the method of Roumen et al. (1997).The data were statistically analysed in the SPSS programme version 13.Figure 1. Aerobic culture of rice with drip irrigation at the Lysimeter Research Station, Szarvas, Hungary,2010Results and discussionWith the application of water-saving rice growing technique, 78 percent of the irrigationwater was saved in 2010 in comparison to the conventional flooding. Comparing to theresults (15-18 %) in Asia (Belder et al. 2004) the water saving was higher. In the formerexperiments in Hungary, average of water saving is varied between 50-70 percentdepending on the natural precipitation.Ábel, Tünde, M 488, Cigalon and Banloc were found well tolerant to aerobic conditionswith the A/F ratio of 98.6, 93.8, 90.3, 90.4 and 93.4, respectively (Table 1.). It is showedthe effect of breeding for unfavourable environments since Abel is one of the newvarieties developed for aerobic culture in Hungary. Under our temperate conditions, themost susceptible varieties to drought were Apo Nisc RC9, Mangala and IRAT 109 withthe A/F ratio of 56.9, 60.9 and 71.4, respectively.247

AGRISAFE Budapest, Hungary, 2011Table 1. The effect of limited water supply on the plant height (cm) of different rice genotypes, Szarvas,Hungary, 2010GenotypeFloodedAerobicRange Mean SD. Range Mean SD.A/F RatioMarilla 103.5 114.5 108.0 5.50 72.0 89.0 80.7 7.33 74.7Ábel 77.0 82.0 80.1 2.07 74.5 87.0 79.0 4.73 98.6Bioryza H 88.0 107.5 96.1 7.30 70.0 89.0 81.9 7.23 85.2Sandora 89.0 116.0 103.0 11.02 82.0 94.5 86.1 5.02 83.6Unggi 9 86.0 92.0 89.4 2.90 71.0 80.0 75.3 3.38 84.2Oryzella 103.0 114.0 108.6 5.22 76.0 99.0 89.7 9.95 82.6Fruzsina 92.0 108.0 100.0 6.16 74.0 86.0 79.0 4.47 79.0Tünde 87.0 104.0 95.9 6.37 78.0 98.0 90.0 7.87 93.8M 488 76.0 90.0 82.6 5.08 61.5 81.5 74.6 7.75 90.3Janka 88.0 98.0 93.1 4.36 73.0 90.0 83.5 7.75 89.7Bertone x IV15 100.0 103.5 102.4 1.39 78.0 98.0 90.0 7.87 87.9Balilla x Sesia 75.0 98.0 89.2 10.48 57.0 85.5 70.3 12.29 78.8Szarvasi karcsú 109.0 117.0 112.0 3.56 90.0 95.5 93.3 2.80 83.3Kákai 203 98.0 118.0 107.2 7.20 73.5 94.5 87.7 8.28 81.8Delta 76.0 102.0 87.8 13.16 62.5 78.0 67.8 8.81 77.2Cigalon 64.0 72.5 66.9 3.47 51.0 69.0 60.5 6.67 90.4Yung feng 90.5 97.0 94.1 2.56 52.0 83.5 70.0 16.22 74.4Cody 220 mut 105.0 109.5 106.7 1.99 72.0 87.5 78.6 6.66 73.7Mangala 78.0 84.0 80.3 2.64 45.5 51.5 48.9 2.53 60.9Banloc 97.0 98.0 97.3 0.58 80.0 99.5 90.9 7.12 93.4Jirasar 280 93.0 96.5 94.2 2.02 82.0 84.0 83.0 1.41 88.1Shimokita 68.0 87.5 77.5 8.22 58.5 65.0 62.0 2.47 80.0Bega 87.0 107.0 97.7 9.43 68.5 84.0 74.2 5.92 75.9Opal 82.5 95.5 91.8 5.37 77.5 88.0 81.9 3.90 89.2Italica livorno 94.5 105.5 100.0 4.43 87.5 98.0 90.2 4.42 90.2Tzjao-bu-zschi 97.0 112.0 107.0 5.86 88.0 99.5 92.6 5.19 86.5Rajado de PontaEscura 104.0 110.5 108.0 3.50 85.0 102.5 91.9 7.39 85.1Apo Nisc RC9 82.0 93.0 86.7 5.02 43.5 56.5 49.3 5.12 56.9IRAT 109 87.5 95.5 91.6 3.34 59.5 76.5 65.4 6.60 71.4Table 2. Blast resistance (BS) of different rice genotypes under different growing conditions (flooded - Fl,aerobic – Ae) Szarvas, Hungary, 2010GenotypeBSBSBSGenotypeGenotypeFl Ae Fl Ae Fl AeMarilla MR R Bertone x IV15 MS MS Jirasar 280 S MSÁbel MR R Balilla x Sesia MS MR Shimokita R RBioryza H R R Szarvasi karcsú MS MR Bega S MRSandora MR R Kákai 203 MR R Opal S MSUnggi 9 R R Delta MS MS Italica livorno S MROryzella MR MR Cigalon MR R Tzjao-bu-zschi S MSFruzsina MS MR Yung feng MR MRRajado de PontaEscuraTünde MR R Cody 220 mut MS MR Apo Nisc RC9 R RM 488 MS MR Mangala MS MS IRAT 109 R RJanka MR MR Banloc S MSConclusionsFor the long-term sustainability of rice production, it is important to use wide geneticresources for the development of new varieties with good tolerance to abiotic and bioticSMR248

Budapest, Hungary, 2011AGRISAFEstress factors. In the past decades, the rice breeder in Hungary had noticeable resultsunder unfavourable climatic conditions which can be also used for further developmentof genotypes and genetic studies.AcknowledgementsThis paper was supported by grant from the Hungarian Ministry of Rural Development.The author thanks to the Research Centre for Agrobiodiversity (Tápiószele, Hungary) forsome of the gene bank accessions used for the experiment.ReferencesBelder P.,. Bouman B. A. M, Cabangon R., Guoan L., Quilang E. J. P., Yuanhua L., Spiertz J. H. J., Tuong T.P. (2004): Effect of water-saving irrigation on rice yield and water use in typical lowland conditions inAsia. Agricultural Water Management, 65(3), 193-210.Bodapati N., Gunawardena T., Fukai S. (2005): Increasing Cold Tolerance in Rice. RIRDC Publication,Kingston.Bonman J. M. (1992): Durable resistance to rice blast disease-environmental influences. Euphytica 63, 115–123.Bouman B. A. M., Lampayan R. M. , Tuong T. P. (2007): Water management in irrigated rice: coping withwater scarcity. Los Baños (Philippines): International Rice Research Institute. 54 pCorrea-Victoria F. J., Tharreau D., Martinez C., Vales M., Escobar F., Prado G. (2004) Studies on the rice blastpathogen, resistance genes and implications for breeding for durable blast resistance in Columbia. In:Kawasaki S. (ed.) Rice blast: interaction with rice and control. Proceedings of the third international riceblast conference. Dordrecht, The Netherlands: Kluwer Academic Publishers pp. 214-227.IRRI (2009): Introduction to Coping with water scarcity. Rice Knowledge Bank, Los Baños (Philippines):International Rice Research InstituteManickavelu A., Nadarajan N., Ganesh S. K., Gnanamalar R. P., Chandra Babu R. (2006): Drought tolerancein rice: morphological and molecular genetic consideration. Plant Growth Regulation, 50(2-3), 121-138.Ribot C., Hirsch J., Balzergue S., Tharreau D., Nottéghem J. L., Lebrun M. H., Morel J. B. (2008):Susceptibility of rice to the blast fungus, Magnaporthe grisea. Journal of Plant Physiology 165, 114-124.Roumen E., Levy M., Notteghem J.L. (1997): Characterisation of the European pathogen population ofMagnaporthe grisea by DNA fingerprinting and pathotype analysis. European Journal of Plant Pathology,103, 363-371.Simon-Kiss I. (2001): Six Decades of Rice Cultivation and Varietal Improvement in Hungary. HungarianAgricultural Research, 10 (1), 4-7.249

AGRISAFE Budapest, Hungary, 2011EFFECT OF BENEFICIAL BACTERIAL STRAINS ISOLATEDFROM WILD PLANT ROOTS AND RHIZOSPHERE ON THESEED GERMINATION AND PLANT GROWTH OFCULTIVATED CROPSÉ. LASLO 1 – É. GYÖRGY 2 – É. TAMÁS 1 – Z. BODOR 1 – S. LÁNYI 21Politehnica University of Bucharest, Faculty of Applied Chemistry and Material Science, Bucharest, 060042,Splaiul Independenţei nr. 313, Romania,e-mail: lasloeva@sapientia.siculorum.ro2Sapientia University, Cluj-Napoca, Faculty of Sciences, Miercurea Ciuc, 530104, Libertăţii sq. nr.1, RomaniaAbstract Most of the bacteria present in the rhizosphere establish a beneficial relationship with the plants intheir environment. The growth-promoting abilities of two bacterial strains on seed germination and seedlinggrowth and development was assayed in corn (Zea mays), pea (Pisum sativum) and bean (Phaseolus vulgaris)under laboratory conditions. The symbiotic nitrogen-fixing bacterium Rhizobium leguminosarum 6G/2 wasisolated from the root nodules of Onobrychis montana ssp. transilvanica from the Ciuc Montains, a specificgrassland habitat in Transylvania. The plant-associated Pseudomonas fluorescens TP1 strain originated fromthe rhizosphere of Carex sp. from the Borsáros Raised Bog Natural Reserve. The seeds and seedlings weretreated with a suspension of Rhizobium leguminosarum 6G/2 and Pseudomonas fluorescens TP1, bothseparately and in co-inoculation. Inoculated pea plants had a greater root system than plants not treated withthe plant growth-promoting bacteria. Bean plants inoculated with Rhizobium leguminosarum 6G/2 and withPseudomonas fluorescens TP1 showed better development. Corn plants co-inoculated with the selected strainshad an improved root system.Key words: plant growth-promoting bacteria, inoculation, root colonizationIntroductionThe recognition of the multiple beneficial traits of microorganisms is an alternativestrategy in sustainable agriculture. The application of these plant growth promotingbacteria as biofertilizers contributes to the reduction of the use of chemical fertilizers(Adesemoye 2009). These microbes improve the nutrient availability for plants with thesolubilization of insoluble phosphates, production of iron sequestering compounds,siderophores, and nitrogen fixation. With the production of plant growth regulators suchas auxins, cell division and elongation can be stimulated (Kaymak 2010).The role of phosphate solubilization is the transformation of the accumulated insolublephosphates in the soil into soluble forms, available for plant use (Jones et al., 2011). Thesiderophore compounds contribute to the uptake of iron from the soil. With the bindingof iron the proliferation of pathogen microbes can be prevented; it also promotes theacquisition of nitrogenase metal cofactors (Yeoman et al., 2000).The ability to fix N 2 plays a central role in the N 2 reply of most natural ecosystems. Thebacterium consortium of two nitrogen fixing strains Azotobacter chroococcum andEnsifer fredii with plant growth promoting characteristics enhanced pigeon peagermination and improved the grain yield (Kumar et al., 2010). It was showed that theuse of symbiotic nitrogen fixing bacteria for non leguminous plants from the Poaceaefamily, in pot or field experiments have a significant effect on plant development. Thebeneficial effects of the bacteria were detected not only in the increased plant biomassand nitrogen content (Bhattacharjee et al., 2008). The co-inoculation of wheat seeds withAzospirillum brasilense Sp7 and Rhizobium meliloti DSMZ 30135 resulted higher grainyield and mineral content as compared to non inoculated plants (Askary et al., 2009).Pseudomonas fluorescens, a potential plant growth promoting bacterium, is widely usedfor bioinoculants both single and in combination (Sarma et al, 2009). The application ofPseudomonas fluorescens with Rhizobium leguminosarum on Pisum sativum L. cv.250

Budapest, Hungary, 2011AGRISAFECapella resulted not only in root colonization and nodulation but also in higher shootheight, root length and dry weight (Kumart et al., 2001).The aim of this paper is to study the effect of beneficial bacterial strains, from wildplants root nodule and rhizosphere, on the cultivated plants seed germination and plantgrowth.Materials and methodsBacterial strainsSetting the study of biofertilizer development as the target of our research, we assayedthe effect of two plant growth promoting bacteria on seed germination and plantdevelopment separately and in co-inoculation.The symbiotic nitrogen-fixing bacteria Rhizobium leguminosarum 6G/2 were isolatedfrom the root nodules of Onobrychis montana ssp. transilvanica from the CiucMontains, a specific grassland habitat in Transylvania. The plant associatedPseudomonas fluorescens TP1 strain is originated from the rhizosphere of Carex sp.from the Borsáros Raised bog natural reserve.Characterization of the bacterial isolatesThe two bacterial strains were characterized by cell morphological (Gram stain,determination of the presence of spores), and cultural characteristics (gelatinliquefaction, growth in thioglycolate agar) and biochemical tests (glucose, lactoseutilization, oxidase test, nitrate reduction) (Dunca et al., 2007).Also we determined the beneficial traits of the used bacterial strains like ammonia- andsiderophore production and inorganic phosphate solubilization.Seed inoculationPea, bean and maize seeds were surface-sterilized in sodium hypochlorite solution (6-14%). Seeds were then washed several times with sterile distilled water and germinatedon water agar (4g/l) for 48 h on 28C. A part of the seeds were inoculated by soaking inbacterial suspension (in suspension of Rhizobium leguminosarum 6G/2, Pseudomonasfluorescens TP1 and the combination of the two bacteria.The 24 h cultures wereinoculated in sterile distilled water and cell density was adjusted to 55% transmittanceon a Biolog turbidimeter) and germinated in the way described above.The treated and untreated germinated seeds were soaked in the bacterial suspension, thenthey were put in tubes containing 10 ml of water agar (4g/l) and added 0.2 ml ofbacterial suspension. The planted seedlings were incubated in Saltorius Certomat BSTincubation shaker with illumination, 12 h in the light and 12 h in the dark for a week.During the incubation time we added 0.1 ml of nitrogen-free Crone solution to the plantsevery day.For the evaluation of the effect of applied bacterial inoculants on seed germination andof biomass production in maize, pea and bean, we determined the shoot length, the shootand root dry weight, as well as shoot and root fresh weight of the seven-day-plants.Root colonization assayWe evaluated the root colonization by the assayed bacteria of the five-day plants’ roots.We determined the number of the Rhizobium leguminosarum and Pseudomonasfluorescens from the surface and interior of the inoculated plants roots. For thedetermination of the roots’ interior bacteria we washed and surface sterilized the roots insodium hypochlorite solution (6-14%), then we washed them with sterile distilled water.The surface sterilized roots were mashed in mortar and a series of dilution was prepared,251

AGRISAFE Budapest, Hungary, 2011then they were spread on King B and YMA agar plates. For the evaluation of the rootsurface bacteria, the roots were washed in physiological solution and a series of dilutionwas prepared and spread on respective agar plates (Naher et al., 2009).Results and discussionThe two bacterial isolates are Gram negative and they do not form endospores. Both ofthe used bacterial strains have plant growth promoting traits. The Rhizobiumlegumnosarum 6G/2, beside the nitrogen fixing capacity, has the ability to producesiderophores and mobilize insoluble inorganic phosphates. The Pseudomonasfluorescens TP1 strain has the ability to produce ammonia and solubilize inorganicphosphates.The applied plant growth promoting rhizobacteria for the seed and seedling inoculationpromoted maize, bean and pea seedlings growth (fig. 1.).Shoot and root weights (g)0.80.70.60.50.40.30.20.10MCo MCoS MPsS MPs MR MRS MShootfreshw eightRootfreshw eightShootdryw eightRootdryw eightShoot and root weights (g)0.40.350.30.250.20.150.10.050PCo PCoS PPsS PPs PR PRS PShootfreshweightRootfreshweightShootdryweightRootdryweightShoot and root weights (g)32.72.42.11.81.51.20.90.60.30BCo BCoS BPsS BPs BR BRs BShootfreshweightRootfreshweightShootdryweightRoot dryweightFigure 1. The effect of the inoculation on biomass production in maize (1), pea (2) and bean (3) (M= maize, P=pea, B= bean, Co = co-inoculation, CoS= co-inoculation of the seeds,R= Rhiz.leg., P= Pseud.fl. RS=inoculation of the seeds with Rhiz.leg, PS= inoculation of the seeds with Pseud.fl.)The maize seeds and seedlings inoculated with the Rhizobium legumnosarum 6G/2 hadsignificantly higher total plant weight. The maize treatment with Pseudomonasfluorescens TP1 and seeds with co –inoculum resulted significantly increased root dryweight. In the case of pea plants inoculated with Rhizobium legumnosarum 6G/2produced significantly higher total weight than the untreated plants. In contrast to theuninoculated plants roots, after ten days, both on the co-inoculated pea roots and onthose treated with Rhizobium legumnosarum 6G/2 root nodules could be observed. Theco-inoculation of the beans seeds and seedling resulted higher shoot and root weight.The bacteria used for inoculation colonized the root surface of the plants and the interiorof the roots. The colony forming unit (CFU) of root colonized bacteria were relativelyhigh after five days (Tab. 1).252

Budapest, Hungary, 2011AGRISAFETable 1. The number of the root colonised bacteria on five-day-plants rootsRoot surface bacterial population(CFU/ml)Rhizobium Pseudomonasleguminosarum fluorescens TP16G/2Root interior bacterial population(CFU/ml)Rhizobium Pseudomonasleguminosarum fluorescens TP16G/2Bean roots 4.5*10 7 2.1*10 8 1.4*10 7 1.8*10 6Pea roots 1.9*10 7 3.9 *10 7 2*10 4 4.5*10 3Maize roots 1.2*10 7 4.7 *10 7 9.4*10 5 9.5*10 4ConclusionsThe two isolated rhizobacteria from specific places possess plant growth promoting traitssuch as: nitrogen fixation, inorganic phosphate solubilization, siderophore and ammoniaproduction. The two bacteria strains applied for inoculation established beneficialrelationship with the plants, colonized the surface and interior of the roots. Basing on theresults obtained, these bacteria can be used for the development of biofertilizers.AcknowledgementsThe work has been funded by the Sectoral Operational Programme Human ResourcesDevelopment 2007-2013 of the Romanian Ministry of Labour, Family and SocialProtection through the Financial Agreement POSDRU/88/1.5/S/60203.ReferencesAdesemoye, A. O., Kloepper, J. W. (2009): Plant–microbes interactions in enhanced fertilizer-use efficiency.Appl Microbiol Biotechnol., 85, 1–12.Askary, M., Mostajeran, A., Amooaghaei, R., Mostajeran, M. (2009): Influence of the Co-inoculationAzospirillum brasilense and Rhizobium meliloti plus 2,4-D on Grain Yield and N, P, K Content of Triticumaestivum (Cv. Baccros and Mahdavi). American-Eurasian J. Agric. & Environ. Sci., 5, 296–307.Bhattacharjee, R. B., Singh, A., Mukhopadhyay, S. N. (2008): Use of nitrogen-fixing bacteria as biofertiliserfor non-legumes: prospects and challenges. Appl Microbiol Biotechnol., 80, 199–209.Dunca, S., Nimiţan, E., Ailisiei, O., Ştefan, M. (2007): Microbiologie aplicată, Ed. Tehnopress, Iaşi.Jones, D. L., Oburger, E. (2011): Solubilization of Phosphorus by Soil Microorganisms. Soil Biology, 26, 169–198.Kaymak, H. C. (2010): Potential of PGPR in Agricultural Innovations. Microbiology Monographs, 18, 45–81.Kumar, B. S. D., Berggren, I., Mårtensson A. M. (2001): Potential for improving pea production by coinoculationwith Fluorescent Pseudomonas and Rhizobium. Plant and Soi,l 229, 25–34.Kumar, H., Dubey, R.C., Maheshwari, D.K. (2010): Ensifer Fredii and Azotobacter Chroococcum ConsortiumInhibits Growth of Macrophomina Phaseolina in vitro and Enhances Growth and Yield of Cajanus cajanL. Academic Journal of Plant Sciences, 3, 108–114.Naher, U. A., Othman, Shamsuddin, R., Z. H. J., Saud, H. M., Ismail M. R., (2009): Growth Enhancement andRoot Colonization of Rice Seedlings by Rhizobium and Corynebacterium spp. Int. Jour. of Agr. & Biol.,11, 586–590.Sarma, M. V. R. K., Saharan, K., Prakash, A., Bisaria, V. S., Sahai,V. (2009): Application of FluorescentPseudomonads Inoculant Formulations on Vigna mungo through Field Trial. Int. Jouor. of Biol. and LifeScien., 5, 25–29.Yeoman, K. H., Wisniewski-Dye, F., Timony, C., Stevens, J. B., de Luca, N. G., Downie, J. A., Johnston, A.W. B. (2000): Analysis of the Rhizobium leguminosarum siderophore-uptake gene fhuA: differentialexpression in free-living bacteria and nitrogen-fixing bacteroids and distribution of an fhuA pseudogene indifferent strains. Microbiology, 146, 829–837.253

AGRISAFE Budapest, Hungary, 2011IDENTIFICATION OF FUSARIUM HEAD BLIGHT PATHOGENSIN HUNGARYUSING CLASSICAL METHODSE. LÁSZLÓ – O. VEISZAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, HungaryAbstract Numerous Fusarium species have been associated with the Fusarium head blight (FHB) disease ofwheat, barley and other small-grain cereals, reducing world-wide cereal yields and, as a consequence of theirmycotoxin production in cereal grain, having an impact on both human and animal health.The year 2010 was extremely favourable for Fusarium head blight pathogens. Over a hundred wheat headsexhibiting symptoms were collected from various geographical regions of Hungary. Fusarium spp. wereidentified morphologically from a total of 100 diseased kernels. The aim was to determine the diversity of theFusarium species infecting winter wheat ears.Key words: Fusarium head blight, classical identificationIntroductionThe genus Fusarium was established by Link (1809) for species with fusiform, nonseptatespores. Since the development of pure culture methods for the identification ofFusarium, the presence of fusoid macroconidia with a foot-shaped basal cell has beenaccepted as the most defining character of the genus. The species are arranged insections, which are based solely on the similarity of morphological characters (shape ofthe macroconidium and of the basal cell of the macroconidium, presence or absence ofmicroconidia, shape of the microconidium, presence or absence of chlamydospores, andlocation of chlamydospores).The fungal cereal disease complex Fusarium head blight (FHB), also called Fusariumscab of small grain cereals, has been extensively studied over the last decades (Xu andNicholson, 2009; Wagacha et al, 2007). Epidemics caused by FHB pathogens result insevere yield losses and a decline in cereal quality. Furthermore, infection by thesepathogens leads to the contamination of grain and straw with a wide array ofmycotoxins. These fungal metabolites pose serious threats to human and animal health(Wu and Munkvold, 2008).The FHB disease is caused by a complex of up to 17 species, of which F. graminearum,F. culmorum, F. avenaceum, F. poae and Microdochium nivale are predominant(Brennan et al. 2007, Leonard and Bushnell, 2003). Airborne spores released from cropresidues are deposited on or inside florets, where they germinate and cause infection.Anthesis is therefore the most vulnerable growth stage for establishing successfulinfection.Materials and methodsDisease assessment and field samplingFields in 4 locations (Martonvásár, Kisújszállás, Lippó, Szeged, representing the mainwheat growing regions in Hungary) were evaluated for the presence of Fusarium spp.symptoms between 1 May and 10 July 2010.In order to obtain a representative picture of the FHB population at each location, headsexhibiting symptoms were harvested randomly during the disease assessment period.Two seeds with distinct symptoms were isolated from each ear.254

Budapest, Hungary, 2011AGRISAFEStandard mediaPotato dextrose agar (PDA) was used for observing colonymorphology. Syntheticnutrient agar (SNA) was used toidentify the typical, morphologically uniformmacroconidia (formed insporodochia) of the Fusarium species.Naturally infected kernels were sterilised in 70% ethanol, in order to kill bacteria andsecondary causative agents, and then placed on SNA. When observing fusoidmacroconidia, single spores were transferred onto PDA and SNAplates.Growth conditionsBoth the production of macroconidia and pigmentation are favoured bylight thatincludes ultraviolet light. All the Fusarium occurring on cereals favour a temperaturerange of 20-21°C. PDAdishes were placed underdiffuse daylight and one set of SNAplates was kept under black UV light, while the other set of SNA plates was kept in thedark.IdentificationMorphological identification was based on Nelson et al. (1983) and Leslie andSummerelll (2006) (Fig. 1).formmicroconidiafalse headschainsidentificationnon SNAconidiophoresmonophialidpolyphialidmacroconidiaformchlamidosporespresenceFigure 1. Morphologicall markersMicroconidial production and conidiogenous cells were viewed in cultures 4-7 days old.The way they were formed (false heads and/or chains), their shape and the nature of theconidiogenouscells (mono- or polyphialides) are importantcharacteristics.255

AGRISAFE Budapest, Hungary, 2011Macroconidia were examined in 10–14-day-old cultures and the general shape was noted(which is a key marker for species in the sections Arthrosporiella, Discolor, Gibbosumand Roseum). Chlamydospores tended to form in older cultures (3-4 weeks old).Formation may vary between isolates of a single species and even successive cultures ofone isolate. Thus, while their presence was a useful criterion, their absence was not. Thegrowth rate and colony morphology were observed on PDA plates (Fig. 2).Figure 2. Colony morphology on PDA platesResults and discussionIn order to determine the pathogen composition, 100 symptom-exhibiting kernels wereselected for the morphological identification of Fusarium spp (Table 1). Out of the 84isolates scored, two were identified as F. sambucinum, one as F. culmorum and one as F.verticilloides. 95% of the species identified belonged to the Fusarium graminearumspecies complex.Table 1. Origin and number of Fusarium spp. isolatesOriginSpecies Martonvásár Kisújszállás Lippó SzegedF. graminearum 49 2 10 19F. culmorumF. sambucinum 2bottom surface bottom surfaceF. verticilloides 184 isolates identified out of 100Fusarium graminearum prefers higher temperatures, whereas F. culmorum, F. poae, F.avenaceum and M. nivale tend to dominate in cooler regions such as Scandinavia and theUK (Doohan et al. 2003; Lukanowski et al. 2008). F. poae was previously reported to bethe predominant component of the FHB disease complex in Hungary (Xu et al. 2008).The present results, in contrast, indicate the dominance of the F. graminearum speciescomplex in 2010.AcknowledgementsThis paper was financially supported by the AGRISAFE (EU-FP7-REGPOT 2007-1 No.203288) project. Special thanks are due to Dr. Marc Lemmens for providing us with thephotographs.ReferencesBrennan, J.M., Leonard, G., Fagan, B., Cooke, B.M., Ritieni A., Ferracane, R. (2007): Comparison ofcommercial European wheat cultivars to Fusarium infection of head and seedling tissue. Plant Pathology,56, 55-64256

Budapest, Hungary, 2011AGRISAFEDoohan, F.M., Brennan, J., Cooke, B.M. (2003): Influence of climatic factors on Fusarium species pathogenicto cereals. European Journal of Plant Pathology, 109, 755-768Leonard, K. and Bushnell, W. (2003): Fusarium head blight of wheat and barley. APS PressLeslie, J. F., Summerell, A. B. (2006): The Fusarium Laboratory Manual. Ames: Blackwell PublishingProfessional 388 pp.Lukanowski, A., Lenc, L., Sadowski, C. (2008): First report on the occurrence on Fusarium langsethiaeisolated from wheat kernels in Poland. Plant Disease, 92, 488-488Nelson, P.E., Toussoun, T. A., Marasas, W. F. O. (1983): Fusarium Species. An Illustrated Manual forIdentification. The Pennsylvania State University Press, University Park, PA, 193 ppWagacha, J.M., Muthomi, J.W. (2007): Fusarium culmorum: Infection process, mechanisms of mycotoxinproduction and their role in pathogenesis in wheat. Review. Crop Protect., 26, 877-885Wu, F., Munkvold, G.P. (2008): Mycotoxins in ethanol co-products: modelling economic impacts on thelivestock industry and management strategies. Journal of Agricultural and Food Chemistry, 56, 3900-3911Xu, X., Nicholson, P. (2009): Community ecology of fungal pathogens causing wheat head blight. AnnualReview of Phytopathology, 47, 83-103Xu, X., Parry, D.W., Nicholson, P., Thomsett, M.A., Simpson, D., Edwards, S.G. (2008): Within-fieldvariability of Fusarium head blight pathogens and their associated mycotoxins. European Journal of PlantPathology, 120, 21-34257

AGRISAFE Budapest, Hungary, 2011AGROBACTERIUM-MEDIATED TRANSFORMATION OF COMMONWHEAT (TRITICUM AESTIVUM L.) USING MATURE EMBRYOSR. MURÍN 1 – L. LÁNG 2 – Z. BEDŐ 2 – K. MÉSZÁROS 21 Department of Botany and Genetics, Faculty of Natural Sciences, Constantine the Philosopher University inNitra, Nábrežie mládeže 91, 949 74 Nitra, richard.murin@ukf.sk2 Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, HungaryAbstract The use of immature embryo explants of common wheat seems to be the most successful forregeneration and transformation. An alternative explant is the mature embryo, because of the low cost of donorplant production. The main goal of this work was to find less time-consuming transformation protocols, so thewhole process of mature embryo transformation in the varieties Bobwhite (GB), Astella (SK) and Mv Csárdás(H) was optimised. The best callus induction medium for regeneration was MD 0.5, but the addition ofpicloram to MS callus induction medium also gave high regeneration and a higher number of shoots incomparison with other auxins. The use of zeatin in combination with 2.4-D auxins led to better regenerationability and shoot formation. The highest transient and stable gus expression was detected in cv. Mv Csárdás onMD 0.5 and 2,4D-CIM callus induction mediumKey words: common wheat, Agrobacterium tumefaciens, transformation, mature embryosIntroductionCommon wheat (Triticum aestivum L.) is one of the most important crops in the world.The human population is still growing, so it is necessary to increase wheat production.Genetic transformation is one possible way of doing so. The first successfultransformation of wheat was reported by Vasil et al. (1992) using the bioballisticmethod. Several transformation methods are available, but nowadays Agrobacteriumtumefaciens-mediated transformation seems to be best (Bhalla et al., 2006). Severalauthors found that immature embryos were the best type of explant in terms ofsuccessful regeneration and transformation (Bhalla et al., 2006), but other authors usedvarious types of explants, such as mature embryos (Delporte et al., 2001), leaf bases(Wang and Wei, 2004), shoot tips (Viertel and Hess, 1996), inflorescences (Caswell etal., 2000), pollen cultures and microspores (Ingram et al., 2001). Mature embryos couldbe an alternative to immature embryos, but transformation methods for this explant havenot yet been fully elaborated.The main goal of the transformation experiment was to find alternative explants to theimmature embryos mostly used nowadays and to reduce the time and cost of theAgrobacterium-mediated transformation protocol. The effect of three different auxins oncallogenesis, regeneration and shoot number was studied.Materials and methodsOne spring (Bobwhite, GB) and two winter wheat cultivars, Astella (SK) and MvCsárdás (H) were studied in the experiments. The seeds were surface sterilised in 70%ethanol (5 min) and 10% Sanosil (Sanosil Ltd, Hombrechtikon, CH) for 20 min. Matureembryos with the coleoptile removed were isolated. Then 30 explants were placed in theinoculation medium (IM) (Table 1) in Petri dishes (Ø 10 cm) in six replications. Fourdifferent types of IM and callus induction media (CIM) were used for each variety. Twodifferent regeneration media were used: RZ1/2 Cu after MD 0.5 and REG after all typesof CIM. After isolation the explants were kept in the dark (25 ± 2°C) and transformedtwo days later with a suspension of the Agrobacterium tumefaciens strain AGL1containing pAL154/156 plasmids, which included the bar and gus genes under thecontrol of the Ubi1 promoter (Jones et al., 2005). After transformation the explants were258

Budapest, Hungary, 2011AGRISAFEtransferred to fresh IM for three days co-cultivation, then placed on CIM supplementedwith antibiotic in the dark (25 ± 2°C) for 12 days. The explants were then transferred toregeneration medium in the light with a day/night photoperiod of 16/8 h and a lightintensity of 40 μmol m -2 s -1 for 18 days. The frequency of callogenesis and regenerationand the number of shoots were evaluated. The transformation efficiency was measuredby histochemical gus assay. Transient gus expression (GUS 1 ) was recorded 5 days aftertransformation and stable gus expression (GUS 2 ) after 10 days. Five explants from eachdish were used for the analysis. The results were statistically analysed using the ANOVAmodule of the Breeder program.Component2,4D-IMTable 1. Composition of the media (/l)Inoculation (/l)Callus induction (/l)(IM)(CIM)D-IMP-IMMD0.52,4D-CIMD-CIMP-CIMRegeneration (/l)RZ1/2CuMS Macrosalts 200ml 200ml 200ml 100ml 200ml 200ml 200ml ― 200mlL7 Macrosalts ― ― ― ― ― ― ― 100ml ―L7 Microsalts ― ― ― 1ml ― ― ― 1ml ―MS FeNaEDTA ― ― ― 10ml ― ― ― 10ml ―L7Vitamin/InositolCaseinhydrolysate― ― ― ― ― ― ― 5ml ―1.0g 1.0g 1.0g ― 1.0g 1.0g 1.0g ― ―Myo-inositol 0.25g 0.25g 0.25g 0.1g 0.25g 0.25g 0.25g ― 0.11gGlutamine ― ― ― 0.75g ― ― ― ― ―Proline 0.7g 0.7g 0.7g 0.15g 0.7g 0.7g 0.7g ― ―Asparagine ― ― ― 0.1g ― ― ― ― ―Thiamine 1mg 1mg 1mg 0.1g 1mg 1mg 1mg ― 0.5mgPyridoxine ― ― ― 0.5mg ― ― ― ― 0.5mgNicotinic acid ― ― ― 0.5mg ― ― ― ― 0.05mgMaltose 40g 40g 40g ― 30g 30g 30g 30g ―Glucose 20g 20g 20g ― ― ― ― ― ―Saccharose ― ― ― 90g ― ― ― ― 30gAgNO 3 ― ― ― 10mg ― ― ― ― ―2,4-D 2.5mg ― ― 0.5mg 2.5mg ― ― 0.1mg ―Dicamba ― 2.5mg ― ― ― 2.5mg ― ― ―Picloram ― ― 2.5mg ― ― ― 2.5mg ― ―GA 3 10μg 10μg 10μg ― 10μg 10μg 10μg ― ―BAP 30μg 30μg 30μg ― 30μg 30μg 30μg ― ―CuSO 4 1.25mg 1.25mg 1.25mg ― 1.25mg 1.25mg 1.25mg 1.25mg 1.25mgAcetosyringone 40mg 40mg 40mg ― ― ― ― ― ―Zeatin ― ― ― ― ― ― ― 5mg ―Cefotaxime ― ― ― 150mg 150mg 150mg 150mg ― 150mgpH adjusted with 1 N NaOH to 5.7-5.8 then filter sterilisedAgar 8g 8g 8g 8g 8g 8g 8g 8g 8gAutoclavedREG259

AGRISAFE Budapest, Hungary, 2011Results and discussionCallogenesis ranged from 100% for Astella on 2,4D-CIM and Mv Csárdás on D-CIM to62% for Bobwhite on D-CIM (Table 2). The weakest reaction was observed forBobwhite (average 75.6 %), although it was significantly better (P=5%) on MD 0.5medium. The best reaction was observed in the case of Mv Csárdás (average 95.7%).Table 2. Frequency of gus expression, callogenesis and regeneration and number of shoots recorded for threewheat varietiesVarietyCIMGUS 1(%)GUS 2(%)Callogenesis(%)Regeneration(%)Number of Shootsper explantBW MD 0.5 40 28 93 * 37 *** 1 ***BW 2.4D-CIM 44 40 88 1 0.2BW D-CIM 12 12 77 0 0BW P-CIM 48 16 62 0 0Astella MD 0.5 44 44 90 70 ** 1Astella 2.4D-CIM 36 36 100 8 0.8Astella D-CIM 36 40 92 9 2.6Astella P-CIM 32 40 98 46 * 5.6 ***Mv Csárdás MD 0.5 52 48 96 85 *** 1Mv Csárdás 2.4D-CIM 52 48 96 7 0.6Mv Csárdás D-CIM 12 16 100 4 1.2Mv Csárdás P-CIM 20 32 91 11 3 *Level of significance: * P

Budapest, Hungary, 2011AGRISAFECIM medium for Astella (P=0.1%) and Mv Csárdás (Table 2). The highest transient andstable gus expression was detected in cv. Mv Csárdás on MD 0.5 and 2,4D-CIM (52%and 48%, respectively).ConclusionsThe best callus induction medium for regeneration was MD 0.5, but the addition ofpicloram to MS callus induction medium also gave high regeneration in comparison withother auxins. The addition of picloram to callus induction medium based on MSmacrosalts also led to a higher number of shoots. The use of zeatin in combination withsuitable auxins led to better regeneration ability and shoot formation. The highesttransient and stable gus expression was detected in cv. Mv Csárdás on MD 0.5 and 2,4D-CIM callus induction mediumAcknowledgementsThis paper was financially supported from the project APVV LPP-0125-07.ReferencesBhalla, P. L., Ottenhof, H. H., Singh, M. B. (2006): Wheat transformation – an update of recent progress.Euphytica, 149, 353-366.Casswell, K. L., Leung, N. L., Chibbar, R. N. (2000): An efficient method for in vitro regeneration fromimmature inflorescence explants of Canadian wheat cultivars. Plant Cell Tiss. Organ Cult., 10, 69-73.Chauhan, H., Desai, S. A., Khurana, P. (2007): Comparative analysis of the differential regeneration responseof various genotypes of Triticum aestivum, Triticum durum and Triticum dicoccum. Plant Cell Tiss. OrganCult., 91, 191-199.Delporte, F., Mostade, O., Jacquemin, J. M. (2001): Plant regeneration through callus initiation from thinmature embryo fragments of wheat. Plant Cell Tiss. Organ Cult., 67, 73-80.Ding, L., Li, S., Gao, J., Wang, Y., Yang, G., He, G. (2009): Optimization of Agrobacterium-mediatedtransformation conditions in mature embryos of elite wheat. Mol. Biol. Rep., 36, 29-36.Ingram, H. M., Livesey, N. L., Power, B., Davey, M. R. (2001): Genetic transformation of wheat: progressduring the 1990s into the Millenium. Acta Physiol. Plant., 23, 221-239.Jones, H. D., Doherty, A., Wu, H. (2005): Review of methodologies and a protocol for the Agrobacteriummediatedtransformation of wheat. URL: http://www.plantmethods.com/content/1/1/5Mendoza, M. G., Kaeppler, H. F. (2002): Auxin and sugar effects on callus induction and plant regenerationfrequencies from mature embryos of wheat (Triticum aestivum L.). In Vitro Cell. Dev. Biol.-Plant, 38, 39-45.Vasil, V., Castillo, A. M., Fromm, M. E., Vasil, I. K. (1992): Herbicide resistant fertile transgenic wheat plantsobtained by microprojectile bombardment of regenerable embryogenic callus. Biotechnology, 10, 667-674.Viertel, K., Hess, D. (1996): Shoot tips of wheat as an alternative source for regenerable embryogenic calluscultures. Plant Cell Tiss. Organ Cult., 44, 183-188.Wang, C. T., Wei, Z. M. (2004): Embryogenesis and regeneration of green plantlets from wheat (Triticumaestivum) leaf base. Plant Cell Tiss. Organ Cult., 77, 149-156.Yu, Y., Wei, Z. M. (2008): Influences of cefotaxime and carbenicillin on plant regeneration from wheat matureembryos. Biol. Plant., 52, 553-556.261

AGRISAFE Budapest, Hungary, 2011CLIMATE CHANGE AND PLANT DISEASE DEVELOPMENTJ. POSTIC – J. COSIC – K. VRANDECIC – V. TADICFaculty of Agriculture, University of Osijek, Trg Sv. Trojstva 3, 31000 Osijek, Croatia, e-mail:jelena.postic@hotmail.comAbstract The climate changes at the global level and influences many aspects of our lives, obviously orsilently. It is a term that has been mentioned very frequently in the past few decades and people are more orless familiar with it. The climate changes due to an increase in greenhouse gas concentrations in theatmosphere, and the main cause of that increase is human activity, like burning fossil fuels, clearing land foragriculture, industrial activities, etc. Agriculture, together with plant pathology, is directly influenced byclimate change, due to the fact that plants are mostly grown in open fields. The most important environmentalfactors for plant growth are: air and soil temperatures, amount and frequency of rains and relative humidity.Each plant pathogen has an optimal temperature and relative humidity for its growth. In intensive agriculture,where agricultural plants are grown in large fields, almost nothing can be done to control climate.The question is: how will climate changes influence plant pathogens and plant producers? The best answer isthat both sides of this biological chain will have to adapt.In Croatia there are several examples of diseases which are problematic or which were not registered beforeand might be related to climate changes: Sclerotinia sclerotiorum on sunflower, in 2005, Ramularia collocygnion barley in 2009, bacterial leaf spot (Pseudomonas syringae pv. aptata) on sugarbeet in May 2010. Inthis paper an attempt is made to predict how climate changes will influence plant protection and diseasepathogens and what can be done in order to prepare plant producers for this.Key words: climate change, plant disease, plant pathogens, hostsIntroductionClimate changeTo put it very simply, climate changes due to human activity. Almost 7 billion peoplelive now on Earth and the number continues to grow rapidly. By 2050, global foodproduction must increase by 50% to meet the projected demand of the world’spopulation. (Chakraborty & Newton, 2011). It is logical that more people require moreresources, more food, more energy, especially according to the standard of moderncountries. Therefore population growth is a major factor causing global environmentalchange (Camill, 2010). The main reason for climate change is so called „greenhouseeffect“ – warming as a result of trapped heat radiating from Earth towards space. Thereare certain gases in the atmosphere which contribute to this greenhouse effect. watervapour, CO 2 , CH 4 , NO, CFCs (chlorofluorocarbons). The level of CO 2 increased, mostlydue to burning fossil fuels, deforestation and other land use changes, causing the effectof greenhouse around the Earth, what leads to rising global air temperatures or warming.Warming causes rise of the sea level, draughts, wildfires and affects all living organismson Earth, especially plants and animals.Global climate change also induced climate changes in Croatia. There is an increase ofmean annual air temperature and in the 20th century it was between +0.02°C per 10years in Gospić up to +0.07°C per 10 years in Zagreb. Precipitation showed a downwardtrend in all areas of Croatia.Climate change and plant diseaseTogether with world awareness of climate change, its influence on environment andconsequences it has on mankind, rose the concern of agricultural producers and scientistshow is this going to affect agriculture as a whole. Plant pathology is one of theagricultural disciplines that is directly affected by the climate change. Coakley et al.(1999) reviewed the implications of climate change on plant disease management. Theypointed that there is not enough research that has been done in that direction, and that262

Budapest, Hungary, 2011AGRISAFEexperiments considering climate change effects include only one or two climatechanging factors, are performed under conditions different from those in the field and aregenerally short-term experiments. They agreed that climate change could influencedevelopment of the pathogen, host resistance and host-pathogen interaction. In theiropinion changes in human activity related to land use, plant protection and breedingmight be more important than changes in plant disease management. Davis et al. (2005)discussed adaptive responses to climate change and concluded that research must bedone to have more information on differences in rates of adaptation among organismsand answer questions like: Does adaptation explain why some species survive as tinypopulations and other shift to different latitudes? Why some taxa persist and othersbecome extinct? Garret et al. (2006) agreed that there should be more connectionbetween empirical and modeling studies. According to them the experiments should startat the smallest scale of plant gene expression in response to different stressors. Thesefindings would than have to be used for larger modelling systems and field experiments.According to them the first direct impact of climate change on plant disease would bethe balance of the encounter rate between pathogen and host by changing rates of thetwo species.Environmental requirements for plant disease developmentThere are three basic requirements for plant disease development: 1. presence of avirulent pathogen, 2. susceptible host and 3. the proper environment. If any of these threefactors is missing, the disease will not develop. The optimal temperature fordevelopment of plant pathogens varies significantly: for viruses it is between 20 and 25ºC , for bacteria it is from 25 to 30 ºC, for fungi it is usually between 18 and 22 ºC(genus Pythium has the optimal temperature from 15 to 35 ºC, order Erysiphales around20 ºC, genus Botryotinia 15 – 20 ºC etc.).Relative humidity is very important for spore germination, multiplication of bacteria andinfection initiation. Plant pathogens usually prefer high relative humidity, from 80 to95%.Examples from CroatiaIt is very difficult to be certain and say that changes in disease incidence, plant pathogenor a host are directly related to climate change. However, we will give examples ofseveral diseases in Croatia that were not so significant in the past and might becomemore problematic in the future.Bacterial leaf spot disease of sugar beet (Pseudomonas syringae pv. aptata) is found inmany areas where sugar beet is grown and it usually does not cause significanteconomical damage, only in some cases (Arsenijevic 1992, Whitney 1995). We noticedsymptoms of leaf spot of sugar beet in May 2010 at several locations of Eastern Croatia.The disease is probably present in Croatia for a several years now, but it did not causesignificant damage. Cold and wet weather contributes to disease incidence becausefrequent and abundant rainfalls assure dispersal of bacteria. There are no adequatetreatments of this disease in the field.Ramullaria collo-cygni is wide spred plant pathogen in Europe and in the world where itcauses quick dry up of leaves, stalk and spikes of winter and summer barley. First reportof this disease on winter barley in Croatia was in 2005. The disease still does not haveCroatian official name. This fungi was recorded for the first time in 1898 in Italy andfrom the 80s of the last century producers of barley in Europe began to have problems. It263

AGRISAFE Budapest, Hungary, 2011has become recognized as an important pathogen of barley over the last 15 years and thereason for this change is still not clear. Pathogen favores warm and wet weather.Sclerotinia sclerotiorum is a common disease of sunflower, but it can also infectnumerous plant species. In 2005 significant loss in yield and quality of sunflower grainwere reported in Croatia. The disease spread due to weather conditions: it was wet andcold for that part of the year (Simic et al, 2008).ConclusionsAnthropogenic processes such as increasing trade, air pollution and urbanisation arecausing global climate change. Climate change is not an issolated issue, but it isadditional to many problems already faced in agriculture. There are various scenarios onthe consequences of climate change. If the annual number of days of active vegetation(with temperature above 5 ºC) within the 100-year period will be increased, according topredictions, plant producers will have to start their pesticide protection earlier than in thepast or to increase the number of pesticide treatments. Probability of droughts in summermight put the pressure on pathogens who require wet conditions for their development tomove to areas with more precipitation and higher relative humidity. Shifts in plantspecies distribution are inevitable and together with them pathogen migrations. Pathogenmigration would cause additional problems to plant breeders, since it would bring newplant diseases to their breeding area. It is important to make experimental models foreach of climate change components. Information obtained from climate change studiescan help us to predict which diseases are most likely to become more problematic in thefuture.ReferencesArsenijevic, M. (1992): Fitopatogene bakterije, Naučna knjiga, Beograd.Camill, P. (2010): Global change. Nature education Knowledge, 2, 49Chakraborty, S., Murray, G. M., Magarey, P.A., Yonow, T., O'Brien, R. G. (1998): Potential impact of climatechange on plant diseases of economic significance to Australia. Aust. Plant. Pathol, 27, 15-35Chakraborty, S., von Tiedemann, A., Teng, P.S. (2000): Climate change and air pollution: potential impact onplant diseases. Environ. Pollut, 108, 317-326Chakraborty, S., Newton, A. C. (2011): Climate change, plant disease and food security: an overview. PlantPathology, 60, 2-14.Coakley, S. M. (1995): Biospheric change: Will it matter in plant pathology? Can. J. Plant Path, 17, 147-53Coakley, S. M., Scherm, H. (1996): Plant disease in a changing global environment. Asp. Appl. Biol, 45, 227238Coakley, S. M., Scherm, H., Chakraborty, S. (1999): Climate change and plant disease management. AnnuRev. Phytopathol. 37, 399-426.Davis, M. B., Shaw, R. G., Etterson, J. R. (2005): Evolutionary responses to changing climate. Ecology, 86,1704-1714.Garret, K. A., Dendy, S. P., Frank, E. E., Rouse, M. N., Travers, S. E. (2006): Climate change effects on plantdisease: genomes to ecosystems. Annu. Rev. Phytopathol, 44, 489-509Simic, B., Cosic, J., Liovic, I., Krizmanic, M., Postic, J. (2008.): The influence of weather conditions oneconomic characteristics of sunflower hybrids in macro experiments from 1997 to 2007. Proceedings ofthe 17 th International Sunflower Conference, Cordoba, Spain, 261-264.Whitney, E. D. (1995): Bacterial Leaf Spot. In Compendium of Beet Diseases and Insects. APS Press, ThirdPrinting, St. Paul, Minnesota.Walters, D. R., Havis, N. D., Oxley, S. J. P. (2008): Ramularia collo-cygni: the emerging pathogen of barley.FEMS Microbiology Letters. 279, 1-7.264

Budapest, Hungary, 2011AGRISAFERIBONUCLEASE ACTIVITY OF UNINFECTED AND INFECTEDPLANTS OF BUCKWHEAT VARIETIESY.R. SINDAROVSKA 1 – O.I. LOZOVA 2 – L.V. YUZVENKO 2 – L.F. DIDENKO 2 –N.Y. SPIVAK 21 Institute of Cell Biology and Genetic Engineering, NASU, akad. Zabolotnogo str., 148, Kyiv, Ukraine,e-mail: sindarovskaya@ukr.net2 D.K. Zabolotny Institute of Microbiology and Virology, NASU, akad. Zabolotnogo str., 154, Kyiv,Ukraine, e-mail: lozova17@mail.ruAbstract Ribonucleases (RNases) are present in base-level amounts in intact plants, but this level may increasegreatly under stress conditions. The possible cause for such an increase is protection against plant RNA-virusattack. The correlation between RNase activity and the sensitivity of different buckwheat (Fagopyrumesculentum) varieties to buckwheat burn virus infection was analyzed. It was shown that plants of a buckwheatvariety having less sensitivity to virus generally demonstrated higher RNase activity.Key words: ribonuclease activity, buckwheat, Buckwheat Burn VirusIntroductionPlant virus-resistant mechanism is a complex process that includes interaction of thecomponents at different levels. For instance, abiotic or biotic stress changes typicalprotein profile and triggers synthesis of pathogen-related (PR) proteins.Nucleases are group of enzymes that hydrolyze nucleic acids. Ribonucleases (RNases)are present in base-level amounts in intact plants but this level can increase greatly understress conditions. The possible cause for such an increase is protection against plantRNA-virus attack (Lusso and Kuc, 1995). So the RNases activity can serve as a criterionfor estimation of plant virus resistance.Buckwheat burn virus (BBV) has negative-sense RNA genome and take intoconsideration its structural organization BBV can be included into Rhabdoviridae family(Yuzvenko et al., 2010). BBV is a very virulent pathogen that affects many importantcrops from different families. Among them are buckwheat, potato, tomato, pepper,tobacco, pea, cucumber and others. The virus causes the major damages to buckwheatfields, decreasing their yields for up to 80%. Selection of the buckwheat varietiesresistant to BBV can greatly increase the crop production.In our study we analyzed the correlation between RNase activity and sensitivity ofdifferent buckwheat (Fagopyrum esculentum) varieties to BBV. In addition, for the firsttime this work reports about changes of RNase activity in plants infected by plantrhabdovirus.Materials and methodsWe used two buckwheat varieties with different sensitivity to BBV: “Kara-Dag” –known for its injured by virus, and “Roksolana” – with slightly injured by BBV. Plantswere grown in green-house conditions and infected by 0.5 mg/ml BBV withcarborundum. The mature intact leaves of buckwheat were cut and used for RNaseactivity assays every three days after infection. 1g of leaf tissue was grinded in liquidnitrogen; proteins were extracted in 1 ml of 50 mM Tris-HCl buffer (pH 7.0). After 10minutes centrifugation at 10000g and 4°С, supernatant was collected and used to analyseRNase activity. RNase activity was measured as described (Galiana et al., 1997). TotalRNase activity was detected by decreased adsorption at 260 nm. Purity of RNA wasverified by the ratio of absorbance 260 nm/ 280 nm. Reaction mixture with total yeast265

AGRISAFE Budapest, Hungary, 2011RNA only was used as negative control. Reaction mixture added with 5 μg RNase A wasused as positive control. We used Bradford method for measuring the content of totalsoluble proteins in leaf extracts (Bradford, 1976).Results and discussionDifferent buckwheat varieties have dissimilar sensitivity to buckwheat burn virus(BBV). Some varieties have severe damages if infected BBV, but others only slightlyinjured by virus. The possible cause is different RNase activity of varieties. So wedetermined RNase activity uninfected and infected plants of two buckwheat varietieswith different resistance to virus. “Roksolana” is a slightly injured by BBV buckwheatvariety and “Kara-Dag” is more injured by BBV buckwheat variety.RNase activity of protein extracts obtained from uninfected control plant leaves of twobuckwheat varieties was studied for three weeks. Total RNase activity was determinedas the decrease of adsorption at 260 nm relative to the control without protein extract.We measured total RNA absorption at 260 nm after incubation reaction mixturecontaining yeast RNA with plant extracts. So the more active plant RNases were the lessintact RNA remained in solution and the less values of absorption at 260 nm wereobserved.It was noticed that the base level of RNase activity in “Roksolana” variety was highduring two weeks and slightly diminished in next week. But in most cases RNaseactivity in “Roksolana” variety was higher than corresponding parameter in “Kara-Dag”variety. RNase activity in leaf protein extracts from “Roksolana” buckwheat variety wasclose to the one of purified RNase A. It is remarkable that in control and experimentalreaction mixture was added with equal quantity of total proteins, but control mixture wasadded with purified RNase A only and experimental reaction mixture was added withtotal soluble cell proteins. Thus we can conclude that some plant RNases have greaterphysiological activity than pancreatic ribonuclease (RNase A).BBV is a virus with slow speed of spreading along the plant and the symptoms ofinfection on the upper uninfected leaves are visible after two weeks.Infected plants of “Kara-Dag” variety demonstrated instability of RNase activity duringexperiment. Significant decline in RNase activity was detected on the 7th day postinfection with subsequent gradual increase in RNase activity. At the first days virusesbegin the replication. So decline the RNase activity during the first week could promotethe virus replication and, therefore, increase the number of virus particles. Greatnumbers of virus particles can more successfully spread throw the plant and causesystemic disease in spite of subsequent increasing of RNase activity. The highest level ofRNase activity in leaves of “Kara-Dag” variety was observed on 16th day (Fig. 1).RNase synthesis may be activated in response to development of systemic infection. Butthis does not ensure prevention the infection of upper leaves. At this time the symptomsof disease were visible. Unstable levels of RNase activity in infected buckwheat plantscan be explained by insufficiency of virus-resistant mechanisms that determines themedium sensitivity of the variety to BBV.266

Budapest, Hungary, 2011AGRISAFEAbsorption, А2601,61,41,210,80,60,40,20negativecontrolRNase Auninfected plantsinfected plants4710131619Days after infection of plantsFigure 1. Comparison of RNase activity of uninfected and infected plants of “Kara-Dag” buckwheat variety.Total RNase activity was determined as the decrease of adsorption at 260 nm relative to the control withoutprotein extract.Both uninfected and infected plants of “Roksolana” variety demonstrated high activity ofRNases during two weeks. We supposed that high active ribonucleases promotedestruction the virus RNA, especially during the first week, and thus interfere withspreading of BBV into upper uninfected leaves. On the 16th day the level of RNaseactivity in infected plants decreased comparing to the control one but on the 19th day itincreased again (Fig. 2). Despite transient decreasing RNase activity on the 16th day theinfectious process is very weak. Symptoms of disease were slightly visible on the upperuninfected leaves. In this way gradual increase in RNase activity in the leaves of infectedplants helps to limit the infection process, preventing virus dissemination.1,61,4uninfected plantsAbsorption, А2601,210,80,60,40,2infected plants0negativecontrolRNase A4710131619Days after infection of plantsFigure 2. Comparison of RNase activity of uninfected and infected plants of “Roksolana” buckwheat variety.Total RNase activity was determined as the decrease of adsorption at 260 nm relative to the control withoutprotein extract.Additionally we carried out the protein electrophoresis in 12% SDS polyacrylamide gel.Some new protein bands were noticeable in extracts from leaves of infected plants“Kara-Dag” variety (leaves collected on the 10th and 16th days post infection). Also we267

AGRISAFE Budapest, Hungary, 2011observed some difference between protein bands in extracts from leaves of “Roksolana”variety.ConclusionsIt was shown that buckwheat variety having less sensitivity to buckwheat burn virusdemonstrated in general higher RNase activity than buckwheat variety having moresensitivity to buckwheat burn virus. Thereby we assume that RNase activity level can beused as a test for sensitivity of different buckwheat varieties to virus infection that mayfind its application in selection process.ReferencesBradford M.M. (1976): A rapid and sensitive method for the quantification of microgram quantities of proteinutilizing the principle of protein due binding. Analytical Biochemistry, 72, 248-254.Galiana, E., Bonnet, P., Conrod, S., Keller, H., Panabieres, F., Ponchet, M., Poupet, A. and Ricci, P. (1997):RNase activity prevents the growth of a fungal pathogen in plant tobacco leaves and increases uponinduction of systemic acquired resistance with elicitin. Physiol., 115, 1557-1567.Lusso, M. and Kuc, J. (1995): Increased activities of ribonuclease and protease after challenge in tobaccoplants with induced systemic resistance. Physiological and Molecular Plant Pathology, 47, Issue 6, 419-428.Yuzvenko, L.V., Serdenko, O.B., Didenko, L.F., Varbanets, L.D., Shevchuk, V.K., Spivak, M.Ya. (2010):Physico-Chemical properties of viral burn of buckwheat. Reports of the National Academy of Sciences ofUkraine, 1, 170-174.268

Budapest, Hungary, 2011AGRISAFEINFLUENCE OF FUSARIUM INFECTION ON QUALITATIVEAND QUANTITATIVE CHANGES IN WHEAT PROTEINL. ŠTOČKOVÁ – J. BRADOVÁ – J. CHRPOVÁCrop Research Institute, Prague, Czech RepublicAbstract This work was aimed at analysing changes in the wheat protein fraction caused by severe Fusariuminfection. Changes were studied in a set of five winter wheat varieties planted in two years. Artificial Fusariuminoculation during the flowering period was used to enhance the effect of infection on the grains. The levels ofdeoxynivalenol in the infected samples ranged from 51 mg.kg -1 to approx. 100 mg.kg -1 and the ratio of scabbygrains ranged from 61% to 91%. Quantitative RP-HPLC analysis proved that the amount of gliadins increasedby 55 % on average and the amount of glutenins decreased by 45 % due to the infection, while the amount ofalbumins and globulins remained at the same level. No significant correlation was proved between quantitativechanges in the fractions and the deoxynivalenol content or the ratio of scabby grains. The SDS PAGE resultsrevealed the destruction of protein compounds with high molecular weight and some qualitative changes in theprotein electrophoretic spectra of infected samples.Key words: wheat, protein, Fusarium, HPLC, SDS PAGEIntroductionFusarium head blight (FHB) belongs to most common biotic stresses in wheat and othercereals under the climatic condition of middle Europe. Secondary metabolites ofFusarium fungi are mycotoxins deoxynivalenol (DON), zearalenon (ZEA), T-2 toxin andHT-2 toxin and many others. DON is considered as a marker of Fusarium infection dueto the fact that most common Fusarium species in the area of central Europe (i.e. F.graminearum and Fusarium culmorum) are strong DON producers (Botallico et al.,2002) and a statistically significant correlation between the intensity of head blight andDON concentration has been proved (Mesterhazy et al., 2008). EU legislation considersDON as a risk for consumers and limits for the DON content in wheat grains and otherfoodstuffs have been established (EC 1881/2006).Beside a decrease of a hygienic quality, FHB is connected to the changes in grainstructure and lower baking quality. It is proved that the infection causes the decrease inthousand grains weight and the “scabby” grain effect. Many studies proved that grainswith higher content of DON showed worse baking quality (Dexter 1996, Cumagun2004) although there are some papers that did not confirm this fact (Antes 2001).The lower baking quality should be caused by structural, qualitative and quantitativechanges in storage protein fractions, i.e. gliadins and glutenins, as gluten is the crucialfactor regarding the use of wheat for baking and quality of gluten generally depends onnumerous properties of wheat protein complex, but it is determined mainly by optimalratio of storage proteins (Hoseney 1994). Water soluble protein fraction - albumins andglobulins – that consist mainly of the function proteins should respond to the infection inqualitative and quantitative changes as well. It was presented that Fusarium infection donot significantly influenced the number of disulfide bonds (Prange et al. 2005a) butanother study concerning samples with similar DON concentrations proved thequantitative changes in storage protein fractions (Eggert 2010).Only small quantitative changes in albumins and globulins were reported (Eggert 2010).Nevertheless, albumins and globulins are responsible for defense reaction thus somequalitative changes connected to this reaction is expected.269

AGRISAFE Budapest, Hungary, 2011Materials and methodsThe analyzed sample set consists of five winter wheat varieties with different levels ofresistance to Fusarium infection (Bohemia, Secese, Briliant, Seladon, and Iridium).Samples were planted in years 2009 and 2010. Infection was carried out according toalready published method (Chrpová et al., 2007). Briefly, spraying of conidialsuspension of highly pathogenic F. culmorum isolate B was used for artificialinoculation. A bunch of 10 spikes was sprayed during flowering (GS 64) and theinfection was supported by irrigation.The percentage of Fusarium damaged grains was calculated from all seeds in sample andDON content was determined by ELISA kits Ridascreen FAST DON (R-Biopharm,Austria). Electrophoresis in polyacrylamide gel (SDS PAGE) was used for overallqualitative analysis of wheat proteins (Laemmli 1970). Quantitative analysis of proteinswas carried out using modified Osborne fractionation that divided proteins into threefractions: albumins-globulins (A-G), gliadins (Gli) and glutenins (Glu) following byHPLC analysis according to Naeem and Sapirstein (2007).Results and discussionThe artificial inoculation ensured intensive infection (expressed in DON content andFDG, see tab. 1) in all samples analyzed. Quantitative RP-HPLC analysis of proteinproved that all the three fractions changed due to the infection. Quantitative changes inwheat storage protein fractions were even more massive than already published results(Eggert 2010). The variety and the year significantly influenced the extent ofquantitative changes (ANOVA, p = 0,05). The amount of gliadins increased in allinfected samples by 55% on average and the amount of glutenins decreased overall by45% on average due to the infection, while there is no trend in the change of albuminsand globulins, though the changes occurred in every infected samples comparing tocontrol. These changes corresponded to those observed on samples with much lessintensive infection (Eggert 2010). Any statistically significant correlation betweenquantitative changes in fractions and the deoxynivalenol content or the ratio of scabbygrains was not proved.Table 1. DON content, Fusarium damaged grains and relative concentration difference of protein content insamples (by HPLC) infected with Fusarium and control samplesYear Variety Δ A-G (%) Δ Gli (%) Δ Glu(%)Δ Protein (%) DON (mg/kg) FDG(%)2009 Bohemia 5,4 57,5 -38,9 1,65 56,7 75,16Secese 17,2 79,3 -33,7 16,39 64,9 79,95Briliant -15,8 37,7 -37,8 -0,59 82,7 89,7Seladon 16,1 68,2 -51,6 9,82 99,3 86,6Iridium 69,5 68,0 -51,7 5,20 64,5 86,62010 Bohemia -9,7 19,5 -60,2 -16,95 51,1 61Secese 26,3 75,3 -12,2 36,14 94,17 56,31Briliant -16,2 62,6 -54,1 10,64 55,6 55,34Seladon -3,6 18,9 -57,0 -9,71 84,09 91,83Iridium 31,5 74,0 -66,8 23,15 44,48 83,7270

Budapest, Hungary, 2011AGRISAFESDS PAGE discovers the destruction of proteincompounds with a highh molecularweight that was uniformin every infected sample (see fig. 1). In the lowmolecularweight area of electrophoreogram, qualitative changes presented by three extra bendshave been noticed (see fig. 1, each extra bend is marked by asterisk). These extra bendsoccurred more or less inall samples and they probably belong tothe fungal proteins. Thetotal destruction of the high molecular weight proteins that was observed only in theSDS PAGEresults (not in RP-HPLC patterns) canbe ascribed to the effect ofthe fungalproteases during the extraction. SDS extraction was carried outin water solution whereFusarium enzymatic activity can be maintained while HPLC extraction is carried out in50% propanol which causes a degradation of enzymes. This situation was alreadydescribed by Nightingale et al. (1999).Figure 1. SDS PAGE analysiss of wheat proteins from Iridium variety. (A, C - infected samples, B,D – controlsamples; 2009, 2010 – harvest years)ConclusionssThe results of the study confirm that FHB is connected to the qualitative as well asquantitative changes mainly in the storage proteins and the infection shouldeventuallylead to thedecrease ofbaking quality. Nevertheless, correlation between quantitativechanges and DON content was not proved. In orderr to explore such relations larger set ofsamples with different intensity of infection shouldbe analyzed.Albumins and globulinsshowed mainly the qualitative changes. Several new proteinswere observed in lowmolecular weight area in SDS patterns and the newly createdproteins should be theobject of sequel studies anther to confirm or refute the fungal origin. The discrepanciesin SDS andHPLC analysis of high molecular weight proteins was (accordingto alreadypublished results) caused by different extraction procedure inboth methods but thispremissionshould be proved experimentally.AcknowledgementsThis paperwas financially supported by the Ministry of Agriculture of Czech Republicproject no. 0002700604and QH 92155ReferencesAntes, S., Birzele, B., Prange, A., Kriket, J., Meier, A., Dehne, H.-W., Köhler, P. (2001): Rheological andbreadmaking properties of wheat symplex infected with Fusarium spp., Mycotox. Res. 17 (1), 76-80Bottalico A. and Perrone G. (2002) Toxigenic Fusarium species and Mycotoxins Associated with Head Blightin Small-Grain Cereals inEurope European Journal of Plant Pathology, 108 (7), 611-624271

AGRISAFE Budapest, Hungary, 2011Chrpová, J., Šíp, V., Matějová, E., Sýkorová S. (2007): Resistance of winter wheat varieties registered in theCzechRepublic to mycotoxin accumulation in grain following inoculation with Fusarium culmorum.Czech J. Genet. Plant Breed. 43, 44–52Cumagun, C.J.R., Miedaner, T. (2004): Segregation for aggressiveness and deoxynivalenol production of apopulation of Gibberella zeae causing head blight of wheat, Europ. J. Plant. Pat. 110, 789–799Dexter, D., Clear, R.M., Preston, K.R. (1996): Fusarium head blight: Effect on milling and baking of someCanadian wheats, Cereal Chem. 73, 695–701.Eggert, K.,Wiesner, H., Pawelzik, E. (2010): The influence of Fusarium infection and growing location on thequantitative protein composition of emmer (Triticum dicoccum). Eur. Res. Food. Technol. 230, 837 – 847Laemmli, V. K. (1970): Cleavage of structural proteins during the assembly of the head of the bacteriophageT4. Nature, 227, 580-585.Mesterházy, Á., Bartók, T., Mirocha, C. G. and Komoróczy, R. (1999): Nature of wheat resistance to Fusariumhead blight and the role of deoxynivalenol for breeding. Plant Breeding, 118, 97–110.Naeem, H.A., Sapirstein, H.D. (2007): Ultra-fast separation of wheat glutenin subunits by reversed-phaseHPLC using a superficially porous silica-based column. Journal of Cereal Science 46, 157-168Nightingale, M.J., Marchylo, B.A., Clear, R.M., Dexter, J.E., Preston, K.R. (1999): Fusarium head blight:Effect of fungal proteases on wheat storage proteins. Cereal. Chem. 76, 150 - 158Prange, A., Birzele, B., Krämer, J., Meier, A., Modrow, H., Köhler, P. (2005): Fusarium-inoculated wheat:deoxynivalenol contents and baking quality in relation to infection time. Food Control, 16, 739-745272

Budapest, Hungary, 2011AGRISAFEMOLECULAR AND TRADITIONAL APPROACHES FORCOMBATING MAJOR DISEASES OF WHEAT INMARTONVÁSÁRG. VIDA 1 – M. CSÉPLŐ 1 – G. GULYÁS 1 – I. KARSAI 1 – T. KISS 1 – J. KOMÁROMI 1 –E. LÁSZLÓ 1 – K. PUSKÁS 1 – Z.L. WANG 2 – Z. BEDŐ 1 – L. LÁNG 1 – O. VEISZ 11 Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary2 Northwest A&F University, Yangling, Shaanxi, P.R.ChinaAbstract Among the factors which determine yield reliability an important role is played by disease resistance.One of the breeding aims in the Martonvásár institute is to develop wheat varieties with resistance to majordiseases. The winter wheat varieties bred in Martonvásár are examined in artificially inoculated nurseries andgreenhouses for resistance to economically important pathogens. The effectiveness of designated genes forresistance to powdery mildew and leaf rust has been monitored over a period of several decades. None of themajor resistance genes examined in greenhouse tests is able to provide complete resistance to powdery mildew;however, a number of leaf rust resistance genes provide full protection against pathogen attack (Lr9, Lr19,Lr24, Lr25, Lr28 and Lr35). In the course of marker-assisted selection, efficient resistance genes (Lr9, Lr24,Lr25 and Lr29) have been incorporated into Martonvásár wheat varieties. The presence of Lr1, Lr10, Lr26,Lr34 and Lr37 in the Martonvásár gene pool was identified using molecular markers. Valuable Fusarium headblight resistance sources have been identified in populations of old Hungarian wheat varieties. Species causingleaf spots (Pyrenophora tritici-repentis, Septoria tritici and Stagonospora nodorum) have gradually becomemore frequent over the last two decades. Tests on the resistance of the host plant were begun in Martonvásárfour years ago and regular greenhouse tests on seedlings have also been initiated.Key words: wheat, resistance, fungal diseases, marker-assisted selection, breedingIntroductionOn a world scale wheat is attacked by 200–250 pathogens and pests. In Hungary thereare 5–10 diseases which occur frequently and may cause significant economic losses incommercial wheat production. The most environmentally sound, low cost method ofcontrolling wheat diseases is to breed and grow resistant wheat varieties.Wheat powdery mildew [Blumeria graminis (D.C.) Speer f. sp. tritici Ém. Marchal] iswidespread on wheat throughout the world. Although 59 genes/alleles conferringresistance to the pathogen have been identified so far (McIntosh et al., 2010), the vastmajority of these genes have been overcome by the pathogen (Szunics et al., 2000).Improving resistance to rust fungi (leaf, stem and stripe rust) is one of the major tasksfacing wheat breeders all over the world. In Hungary the greatest damage is currentlycaused by leaf rust (Puccinia triticina Erikss.), which can be expected to infect wheatfields every year. The various strategies that can be applied in breeding for leaf rustresistance can be divided into two groups. The first is based on the use of designated leafrust resistance genes (Lr genes), and involves the incorporation of effective, previouslyunexploited or underexploited Lr genes into varieties with a favourable agronomicbackground, and the combination of such genes at the plant or population level. Thesecond group of strategies involves methods utilising horizontal resistance (Winzeler etal., 2000).Efficient protection against Fusarium species could be achieved by growing FHBresistantwheat varieties. Only a limited number of FHB resistance sources are currentlyavailable to breeders. At present spring genotypes of Far-Eastern origin, especiallySumai 3 and its derivatives (e.g. CM82036), are considered to have the best resistance(Bai-Shaner 2004), but the agronomic traits of these genotypes differ greatly from thoseof the winter wheat varieties cultivated in Hungary.273

AGRISAFE Budapest, Hungary, 2011As other fungal species attacking the leaf area (powdery mildew, rust fungi) have beenmore effectively tackled, species causing leaf spots (Pyrenophora tritici-repentis,Septoria tritici and Stagonospora nodorum) have gradually become more frequent overthe last two decades. Tests on the resistance of the host plant were begun in Hungarynearly ten years ago and in addition to field experiments, regular greenhouse tests onseedlings have also been initiated (Cséplő et al., 2004). The results achieved up to nowhave indicated consistent differences in the resistance of individual wheat varieties.The use of molecular markers in wheat breeding programmes is on the increase. In thecourse of marker-assisted breeding, effective resistance genes can be incorporated andpyramided into wheat varieties with the help of PCR-based DNA markers (STS, SCAR,CAPS and SSR) and resistance genes can be easily identified.Materials and methodsA set of differential cultivars proposed by COST Action 817 and two additionalgenotypes were used to test the effectiveness of 18 Pm resistance genes and genecombinations (Pm1, Pm2, Pm3a, Pm3b, Pm3c, Pm3d, Pm4a, Pm4b, Pm5, Pm6, Pm7,Pm8, Pm17, Pm1+2+9, Pm2+4b+8, Pm2+6, Pm3f and the susceptible check) between2006 and 2010.The field leaf rust resistance of the plants was evaluated in an artificially inoculatednursery. A backcross programme was started, aimed at the transfer of effective Lr genes(Lr9, Lr24, Lr25, Lr29 and Lr35). Martonvásár winter wheat varieties (‘Mv Emma’, ‘MvMadrigál’, ‘Mv Pálma’ and ‘Mv Magvas’) were crossed with resistance sources. The F 1plants were backcrossed to the recurrent parents. BC 1 plants were selected by means ofmarker-assisted selection from different backcross generations and these were againbackcrossed to the recurrent parent.The presence of five leaf rust resistance genes (Lr1, Lr10, Lr26, Lr34 and Lr37) wasanalysed in the Martonvásár wheat pool. Molecular markers WR003 for Lr1 (Qiu et al.,2007), ThLr10 for Lr10 (Feuillet et al., 2003), IAG95 for Lr26 (Mohler et al., 2001),csLV34 for Lr34 (Lagudah et al., 2006) and SC-Y15 for Lr37 (Robert et al. 1999) wereapplied using the published PCR protocols.Field experiments artificially inoculated with Fusarium culmorum were set up in fiveyears on 98 populations and lines of old Hungarian varieties, together with two controlvarieties (Sumai 3, resistant, and GK Zugoly, susceptible). Conidium suspensions wereused to spray-inoculate plants at 50% flowering, and the inoculations were repeated twodays later. The spore concentration applied was 5×10 4 macroconidia·ml -1 . Mist irrigationwas applied. As a measure of FHB severity the ratio of Fusarium-infected spikelets wasdetermined by visually scoring the inoculated plot on the 26th day after the firstinoculation.In studies on Pyrenophora tritici-repentis greenhouse experiments were set up first on49 varieties, breeding lines and genotypes with known genetic background, and then ona further 43 breeding lines bred in Martonvásár. The genotypes were inoculated with anisolate of tan spot (Pti 2) developed on V8PDA medium. The inoculum was sprayedonto the leaf surface when the plants were in the 1-leaf stage. The genotypes wereevaluated from the 5th day after inoculation, scoring the lesion types on a 1–5 scale (1 =resistant, 5 = susceptible) (Lamari and Bernier 1989). The area under the diseaseprogress curve (AUDPC) was calculated from the lesion type values recorded at variousdates (Shaner and Finney 1977).274

Budapest, Hungary, 2011AGRISAFEResults and discussionThe virulence of the wheat powdery mildew population to 18 Pm genes and genecombinations was analysed in five years (2006–2010). In the seedling test, none of thegenes examined was able to ensure complete resistance to powdery mildew. This wastrue even of the Pm3b gene, for which only 24.8% of the isolates exhibited virulence.Less than 50% of the isolates were able to infect differentials carrying the Pm3d(33.0%), and Pm3f (40.2%) genes. In the case of varieties bearing genes Pm4a, Pm8,Pm5, Pm3c, Pm2, Pm6, Pm7 and Pm2, the virulence of the powdery mildew populationdid not differ significantly from the value observed for the susceptible control (100%).The field resistance of wheat genotypes carrying designated Lr genes has been tested forseveral decades in order to determine the efficiency of major leaf rust resistance genes.Each year ‘Thatcher’-based near-isogenic lines, each carrying a different resistance geneor allele, are sown in the experiments. The results indicate that eight of the near-isogeniclines (NIL) carrying a single Lr gene or allele are still not infected with the pathogen, oronly to a negligible extent. Wheat lines carrying the genes Lr9, Lr19, Lr24, Lr25, Lr28,Lr29 and Lr35 had excellent leaf rust resistance in Martonvásár, averaged over the last 8years. Moderately susceptible (30-40MS) and susceptible (80S) reactions were detectedin 2009 and 2010, respectively, on wheat genotypes carrying the Lr37 gene in theirgenetic background, although there was no sign of infection on them earlier. The lineexhibiting the greatest degree of infection was the NIL carrying gene Lr26.A marker-assisted backcross programme was set up to incorporate leaf rust resistancegenes into four Martonvásár wheat varieties. Up till now lines in the BC 4 -BC 6 generationhave been developed for various crosses. Since the use of Lr genes singly increases thedanger of genetic vulnerability, combinations of lines carrying different genes weredeveloped in order to pyramid the genes. The aim was to create genotypes carryingseveral resistance genes simultaneously, in the hope that these would have more durableresistance to leaf rust than those carrying a single gene. To date, a number of genecombinations have been developed for the four Martonvásár varieties. A doubled haploidprogramme has been set up based on anther culture in order to stabilise the genecombinations.Designated leaf rust resistance genes were identified in Martonvásár wheat varietiesusing molecular markers. The Lr1 and Lr10 genes were assumed to be present in theMartonvásár gene pool, but this was the first time it could be proved using molecularmarkers (11 and 15 out of 74 Mv varieties, respectively). During investigations aimed atdetecting designated resistance genes, a reduction in the proportion of varieties carryingthe Lr26 resistance gene was noted among wheat varieties registered in recent years. Asexpected, the Lr34 gene was found in many Martonvásár varieties (12 varieties). TheLr37 resistance gene can be detected at high frequency in the genome of WesternEuropean wheat varieties, but only one Mv variety (‘Mv Vekni’) carries this gene.The results of analysis of variance demonstrated that the mean field FHB infection of oldHungarian wheat varieties and lines was significantly influenced by the year. The mostsevere infection was recorded in 2004 (45.3%), followed by 2007 (37.3%), 2003(36.4%), 2006 (28.6%) and 2005 (21.6%, LSD5%=4.7%). Significant differences werealso observed between the lines. The FHB infection of the wheat lines and varietiesfluctuated over a wide range (‘Sumai 3’=2.8%; ‘GK Zugoly’=86.0%) averaged over thefive years. The FHB infection of old Hungarian wheat varieties and of the lines derivedfrom them ranged from 10.2 to 62.5%, with infection rates below 20% for 11 lines. A275

AGRISAFE Budapest, Hungary, 2011line of ‘Bánkúti 1201’ origin (‘BKT9086-95’), which had proved resistant in FHB tests,was crossed with the moderately susceptible wheat variety ‘Mv Magvas’. The 219 SSDlines developed from this combination were then tested for Type II resistance. Theinfection levels of the lines, parents and control varieties ranged from 5.0 to 72.3%.Under greenhouse conditions it was found that several varieties and advanced lines bredin Martonvásár had reliable resistance to race 1 of tan spot. Correlation analysis revealeda significantly positive moderate correlation (r = 0.4–0.6) between the greenhouse data(AUDPC values calculated on the basis of lesion type and severity %) and the field data(AUDPC values calculated from the lesion type and severity % on the flag leaf). Theextensive analysis of breeding lines could contribute to further improvements in thecomplex disease resistance of future Martonvásár wheat varieties and to an increase inselection efficiency.AcknowledgementsThis paper was financially supported by the AGRISAFE (REGPOT 2007-1-203288),BioExploit (FOOD-CT-2005-513959), DTR_2007 (OM188/2007) and OTKA K49080projects.ReferencesBai, G.H., Shaner, G. (1994): Scab of wheat: Prospects for control. Plant Dis. 78, 760–766.Cséplő, M., Vida, G., Bakonyi, J., Veisz, O. (2004): Studies on the resistance of wheat genotypes to twodifferent races of Pyrenophora tritici repentis (Died.) Drechsler. In: Genetic Variation for Plant Breeding(eds. J. Wollmann, H. Grausgruber, P. Ruckenbauer), Proc. of 17 th EUCARPIA General Congress, 8-11September 2004, Tulln, Austria. pp. 185–188.Feuillet, C., Travella, S., Stein, N. et al. (2003): Map-based isolation of the leaf rust disease resistance geneLr10 from the hexaploid wheat genome. Proc. Natl. Acad. Sci. USA, 100, 15253–15258.Lagudah, E.S., McFadden, H., Singh, R.P. et al. (2006): Molecular genetic characterization of the Lr34/Yr18slow rusting resistance gene region in wheat. Theor. Appl. Genet., 114, 21–30.Lamari, L., Bernier, C.C. (1989): Evaluation of wheat lines and cultivars to tan spot Pyrenophora triticirepentisbased on lesion type. Canadian Journal of Plant Pathology, 11, 49–56.Mcintosh, R.A., Dubcovsky, J., Rogers, W.J. et al. (2010) Catalogue of gene symbols for wheat. In: Komugi -Integrated wheat science database. [Available online: http://www.shigen.nig.ac.jp/wheat/komugi/genes/symbolClassList.jsp. Accessed 25 Jan 2011]Mohler, V., Hsam, S.L.K., Zeller, F.J. et al. (2001): An STS marker distinguishing the rye-derived powderymildew resistance alleles at the Pm8/Pm17 locus of common wheat. Plant Breeding 120, 448–450.Qiu, J.W., Schurch, A.C., Yahiaoui, N. et al. (2007) Physical mapping and identification of a candidate for theleaf rust resistance gene Lr1 of wheat. Theor. Appl. Genet., 115, 159–168.Robert, O., Abelard, C., Dedryver, F. (1999): Identification of molecular markers for the detection of theyellow rust resistance gene Yr17 in wheat. Mol. Breeding, 5, 167–175.Shaner, G., Finney, R.E. (1977): The effect of nitrogen fertilization on the expression of slow-mildewingresistance in Knox wheat. Phytopathology, 67, 151–156.Szunics, L., Szunics, Lu., Vida, G. et al. (2001): Dynamics of changes in the races and virulence of wheatpowdery mildew in Hungary between 1971 and 1999. Euphytica 119, 143–147.Winzeler, M., Mesterházy, Á., Park, R.F. et al. (2000): Resistance of European winter wheat germplasm to leafrust. Agronomie, 20, 783–792.276

Budapest, Hungary, 2011AGRISAFEPROPERTIES OF BUCKWHEAT BURN VIRUSL.V. YUZVENKO 1 - O.I. LOZOVA 1* - O.Y.KVASKO 2 - Y.R. SINDAROVSKA 2** - L.F.DIDENKO 1 – N.YA. SPIVAK 1 - V.L. SHEVCHUK 31 D.K. Zabolotny Institute of Microbiology and Virology, NASU, akad. Zabolotnogo str., 154, Kyiv, 03143,Ukraine, *e-mail: lozova17@mail.ru2 Institute of Cell Biology and Genetic Engineering, NASU, akad. Zabolotnogo str., 148, Kyiv, Ukraine, 036803 Kamianets-Podilsky State Agro-technological University, Shevchenko str., 13, Kamianets-Podilsky, 32300,UkraineAbstract Virions of buckwheat burn virus (BBV) have a bacillus-like form and dimensions of 75-90 nm ×230-270 nm. It was shown that BBV has a single-stranded negative-sense RNA genome, six structure proteins,lipids and carbohydrates. According to its morphological characteristics and structural components BBV canbe attributed to the Rhabdoviridae family.Key words: Rhabdovirus, buckwheat, Buckwheat Burn VirusIntroductionA viral disease was discovered at the fields of buckwheat in Khmelnytskyi region. Thedisease causes considerable harm to this valuable culture reducing its harvest up to 80%.Primary symptoms of viral disease occur in dwarf plants, necrotic spots formed on theleaves, leaves wither and seem as burnt. These symptoms have determined the name ofthe virus - buckwheat burn virus (BBV). At the end of vegetation the plants remainstunted with underdeveloped generative organs, which lead to significant loss of yield. Inrecent years the prevalence of buckwheat damage increased dramatically. BBV isconsidered to be one of the most widerspread and detrimental disease of buckwheat inthe main Ukrainian cultivation areas (Alekseyeva et al., 1988), as well as in Belorussia(Shevchuk and Kobrinskaya, 1985) and Russia (Iodko and Gorina, 1976).Materials and methodsBBV was isolated from infected Nicotiana rustica tissues using polyethylene glycol -6000 and differential centrifugation (Mandrica et al., 2007).Morphology of BBV was studied by electron - microscopic method. The viralsuspension was applied on the sieve with formvar film - substrate and contrasted by 2%phosphor volframe acid pH 6.8-7.0 and examined in electron microscope JEM-123(Mandrica et al., 2007). Electrophoretical separation of structural proteins of BBVcarried out by Laemmli’s method (Laemmli, 1970) in 10% sodium dodecile sulfate(SDS) polyacrylamide gel. After staining proteins were scanned on the machineChromoscan "Joice Loeble" at a wavelength of 620 nm.Quantitative and qualitativeanalysis of fatty acids composition was identified by a chromatomass-spectrometricAgilent 6890N/5973 inert system. (Vasyrenko et al., 1982). Carbohydrate analyzed aspolyol-acetates in a chromatomass-spectrometric Agilent 6890N/5973 inert system. Thecolumn PB225mS had parameters 30 m × 0.25 mm × 0.25 μm; the carrier gas, helium,was flowed through the column (1 ml/μm). Identification of monosaccharides was madeby comparing of retention time for different polyol-acetates of samples tested andstandard ones using the computer data base Chemstation. Aminosugars were determinedusing an amino acid analyzer KLA-5 (“Hitachi”, Japan): a column (0.9×15 cm)containing “Ostion 0803” cation-exchanger in sodium-citrate buffer, pH 5.28, at при 55°С (Didenko et al., 2008).277

AGRISAFEBudapest, Hungary, 2011Results and discussionElectron microscopy method showedbacilli-like viruses with dimension correspond 75-90 nm × 230-270 nm (Fig. 1). By its morphology the virus can be attributed to theRhabdoviridae family.200.0 nmFigure 1. Electron microscopy of Buckwheat Burn Virus particlesRNA genome of BBV was isolated and its size was determined by electrophoresis in0.8% agarose gel. It was determined that RNA has 11575 nucleotides (Fig. 2). Theresearch revealed that viral RNA didd not infectious, which is typical for genomic RNAof Rhabdoviridae.bases115751 2bases126.0 kDa1 2116.0 kDa60004000300020001500100050066.0 kDa48.0 kDa45.0 kDa34.0 kDa24.0 kDa66.2 kDa45.0 kDa35.0 kDa25.0 kDa18.4 kDa14.4 kDaFigure 2. Analysis of BBV RNA on 0.8%agarose gel and detected byethidium bromidestaining:1. Markers2. BBV RNAFigure3. Analysis of BBVprotein composition in10% polyacryleamide gel:1. BBV2. MarkersProtein composition of viral preparation was investigated by SDS electrophoresis in 10%polyacrylamide gel. Polypeptide composition of the BBV contained proteins with thefollowed molecular mass: 126 kDa, 66 kDa, 48 kDa, 45 kDa, 34 kDa, 24 kDa (Fig. 3).278

Budapest, Hungary, 2011AGRISAFEOther structural components of BBV: lipids and carbohydrates were also studied. Thedominant fatty acid of BBV is palmitic acid (33.5%). The trans-oleic acid (14.4%) ispresent in a considerable amount, to a lesser extent - the cis-oleic acid (2.4%),hydroxymyristic acid (9.7%) and myristic acid (2.2%) (Fig. 4).palmitic acidxtrans-oleic acid3-hydroxymyristicacidmyristic acidcis-oleic acidiFigure 4. Fatty acids of BBVThe structure of BBV also includes carbohydrates: analysis of the monosaccharidecomposition of BBV showed that the dominant monosaccharides were mannose 30.0%,arabinose 20.5%, ribose 18.7%, xylose 17.0%, ramnose 13.8% (Fig. 5).ramnoseribosearabinosexylosemannoseFigure 5. Monosaccharides of BBVConclusionsVirions of buckwheat burn virus have a bacillus-like form and dimensions 75-90 nm ×230-270 nm. Buckwheat burn virus contains single-strand negative-sense RNA genome;six structure proteins, lipids and carbohydrates are present in capsid coat composition.BBV according to morphological characteristics and its structural components can beattributed to the Rhabdoviridae family.ReferencesAlekseyeva, E.S., Shevchuk, V.K., Shevchuk, T.E., Kalashyan, Yu.A. (1988): Harmfulness of the viral burn ofbuckwheat and initial selection material for resistance to it. Reports of the Lenin All-Union Academy of279

AGRISAFE Budapest, Hungary, 2011Agricultural Sciences, 10, 4-6 (in Russian).Didenko, L.F., Varbanets, L.D., Sabirova, T.Yu., Serdenko, O.V., Brovarska, O.S., Spivak, N.Ya. (2008):Monosaccharide composition of rhabdoviruses infecting animals and plants. Microbiology andbiotechnology, 1, 18-22 (in Ukaine).Iodko, I.I., Gorina, E.D. (1976): Symptoms of display, distributions and harmfulness of viral burn in BSSR.Ways of increasing field crop capacity, 6, 131-133 (in Belarusian).Laemmli, U.К.(1970): Cleavage of structural proteins during the assembly оf the head оf bacteriophage Т4.Nature, 227, Issue 5259, 680–685.Mandrica, T.U., Serdenko, O.B., Didenko, L.F., Varbanets, L.D., Brovarskaya, O.S., Vasiliev, V.N., Spivak,N.Ya. (2007): Description of bacillus-shaped spot sweetflag virus. Microbiologichny zhurnal, 69, Issue 5,49-58 (in Ukrainian).Shevchuk, V.K., Kobrinskaya, N.N. (1985): Susceptibility of different buckwheat types to diseases dependingon the cultivation conditions. Genetical bases of selection and seed-growing of buckwheat. Collection ofscientific labours KSEI, 104-109 (in Moldavian).Vasyrenko Z.P., Chernyavskaya E.N., Openko L.V. (1982): The fatty acid composition of lipids fromprovidencia alcalif aciens and providencia stuarti II. Microbiology, 51, Isuue 1, 54-59.280

INTERACTION BETWEEN PLANTS ANDENVIRONMENT

Budapest, Hungary, 2011AGRISAFEEVALUATION OF SOIL QUALITY INDICATORS FOR SOILCONTAMINATED WITH RED SLUDGE IN THE KOLONTARAREAT. ALSHAAL 1 – É. DOMOKOS-SZABOLCSY 1 – J. KÁTAI 2 – L. MÁRTON 3 – M. FÁRI 11 Department of Horticultural Sciences and Plant Biotechnology, H-4032 University of Debrecen, Hungary2 Department of Agricultural Chemistry and Soil Sciences, H-4032 University of Debrecen, Hungary3 Department of Biology, University of South Carolina, Columbia-SC, USAE-mail: tarek_alshaal@yahoo.comAbstract Soil quality indicators can be used to evaluate the sustainability of land use and soil managementpractices in agroecosystems. The objective of this study was to evaluate the environmental effects of red sludgefrom the environmental catastrophe in Kolontar on soil properties using chemical, biochemical and biologicalindicators. Composite soil samples (0-30cm) were collected from Kolontar village as follows: normal soil(KNS) as a control, contaminated soil (KCS) and industrial sludge (KIS). The total counts of bacteria,Actinomycetes, fungi and spore-forming bacilli were higher in red sludge than in the other soil samples. Theaddition of sludge to soil increased the total counts of the main microbial groups compared to those inuncontaminated soil (normal). The same trend was observed for free-living nitrogen fixers, microbial biomassnitrogen, dehydrogenase activity, soil electrical conductivity (EC), pH, C/N ratio, available phosphorus andnitrogen. The problem with red sludge was high pH (8.92 in KCl) and EC (3.44 dSm -1 in paste). These mightbe encouraging results for the planned phytoremediation efforts in the red sludge-affected region, aimed at theestablishment of biomass plantations.Key words: soil enzymes, main microbial groups, soil chemical properties, red sludge, soil qualityIntroductionSoil quality is a composite picture of the condition of a specific soil to function for aspecific use. Pierce and Larson, (1993) reported that, soil quality encompasses twogeneral points of view: (1) an inherent property of a soil; and (2) the dynamic nature ofsoils as influenced by human use and management decisions. Biological indicators oftenrefer to the amounts, types, and activities of soil organisms. A large, diverse, and activepopulation of soil organisms may be the most important indicator of a healthy, highqualitysoil. Yet, soil biological activity may be the most difficult indicator tosatisfactorily measure and interpret. Labile forms of soil organic matter (SOM),compared with its total content, are often more informative in evaluating soilsustainability over a short-term period of time (Six et al., 2004). Biochemical indicatorsoften refer to soil organic matter which is a relatively stable parameter that reflects theinfluence of management and crop type over periods of decades and is of essentialimportance for soil quality. Because of the crucial role of SOM in influencing many soilcharacteristics and processes that are important for soil functioning, it believe that SOMcan be considered a suitable integrating soil parameter indicating soil quality (Pullemanet al., 2000). Soil is a living system where all biochemical activities proceed throughenzymatic processes. Mixing soil with sludge is of considerable interest and importancein sludge utilization (Chandra et al. 2008). Fast growing tree species can be benefitedfrom sludge application, though much research has been done on the use of sewagesludge as crop fertilizers (Labrecque et al. 2006).Materials and methodsThe soil samples were collected from Kolontar village, Hungary at December 2010.Representative composite surface soil samples (0-30 cm) were from each normal andcontaminated soil as well as red sludge and divided into two parts: the first part was air283

AGRISAFE Budapest, Hungary, 2011dried and finely ground then stored in plastic bags for physicochemical analyses, thesecond part was taken directly for determination of the total microbial counts and theactivity of some soil enzymes after sieving through 2mm screen. Hygroscopic waterpercentage were determined by drying the soil samples at 105ºC, then all obtained valueswere calculated on oven dry weight basis.The technique described by Louw and Webley, (1959) was followed to determinebiological parameters. Organic carbon and total organic matter were determined by wetcombustion of soil using Walkley and Black method, (Page, 1982). Microbial biomasscarbon was determined by fumigation- incubation methods proposed by Jenkinson andPowlson (1976). The methods used for the determination of phosphomonoesterase,Saccharase, Urease, Catalase activities are described by Szegi (1979). and thedehydrogenase activity by Schinner et al., (1996). Available nitrogen was extracted byKCl 2N and determined by using the conventional method of semi-micro Kjeldahlmethod according to Page, (1982). Available phosphorus was extracted with 0.5 Nsodium bicarbonate (Olsen et al., 1954) and determined colorimetrically by ascorbic acidmethod. Available potassium was extracted with ammonium –acetate EDTA extractionmethod and determined using flame photometer instrument according to the methoddescribed by Jackson, (1973).Results and discussionMicrobiological indicators: Table (1) showed that there were big differences in totalbacteria counts among samples. Where soil was contaminated with red sludge 9.56 x10 7bacteria were recorded, followed by industrial sludge where 1.47 x10 7 while inuncontaminated soil 0.54 x10 7. . These results indicated that addition sludge to normal soilmight be stimulatory for the bacterial growth. The same trend was found withactinomycetes (x 10 6 g -1 dry soil) where in contaminated soil 4.78 x10 6 was recordedfollowed by sludge (4.11 x10 6 ) then by normal soil (3.37 x10 6 ). While the highest valuesfor spore forming bacilli, Azotobacter sp and Azospirillium sp were found underindustrial sludge 1.04 x10 6 , 1.04 x x10 4 and 2.46 x10 4 respectively followed bycontaminated soil (Fig. 2). The highest counts of total fungi was also found incontaminated soilTable 1: biological indicators of different samples.Samples Bacteria (x10 7 ) * Spore forming bacilli (x10 6 )Actinomycetes(x10 6 )KNS 0.54 0.66 3.37 0.83KCS 9.56 0.84 4.78 0.89KIS 1.47 1.04 4.11 1.04* x10 n g -1 dry soilAzotobacter(x10 4 )On the other hand, concerning important soil enzyme activities, values fordehydrogenase, phosphatase and catalase activities 55.21, 0.532 and 46.1 respectively(Fig. 2 and Table 2) the highest values were recorded in the contaminated soil samples,while the highest urease activity was found in red sludge and the highest sucrase activitywas found in normal soil. Since the highest total fungi count was found in thecontaminated soil, the catalase activity was also the highest because fungi are knownproducers for catalase enzymes. The urease activity was also the highest in the redsludge sample because of the highest Azospirillium sp number where increaseddehydtogenase activity was detected as well, cooccuring with the highest total bacterialcount.284

Budapest, Hungary, 2011AGRISAFEFungi ( x 105)Dehydrogenase (µg g-1 soil)3.00Azospirillium ( x 104)1000Urease NH4+ mg/100g2.502.001001.501.00100.500.00DGS DAS KNS KCS KISName of samples1DGS DAS KNS KCS KISName of samplesFigure 1. total fungi counts and Azospirillum SpFigure 2. dehydrogenase and urease activitiesTable 2. biochemical indicators in different samples.SamplesPhosphatase (mg P 2 O 5 /100g/2h) Catalase (O 2 ml/2min.) Sucrase (Glucose mg/100g)Mean SD. Mean SD. Mean SD.KNS 0.447 0.0210 11.0 2.483 23.76 1.871KCS 0.532 0.0778 46.1 1.724 17.51 1.126KIS 0.224 0.0219 4.3 1.450 5.39 0.208Biochemical indicators: Fig. 3 shows that the highest values of both soil microbialbiomass nitrogen as well as organic nitrogen were measured in the industrial sludge(1.098 and 0.554 mg kg -1) )followed by the contaminated soil or in the case of soilorganic matter achieved the highest value 4.39 % under normal soil, followed by thecontaminated Kolontar soil (3.99 %) (Table 3). From the above results, it could beconcluded that high microbial countsresulted in high microbial biomassnitrogen and soil organic matter in redsludge.Chemical indicators: As expected, thehighest pH was found in industrialsludge 8.92 measured in KCl and 9.80in distilled water, as expected, the pH ofthe red sludge contaminated soil wasless alkalic (7.26 in KCL and 8.24 indistilled water, Table 3 and Fig.3 and 4).Samples1.4001.2001.0000.8000.6000.4000.2000.000SMBN (mg kg-1)Org.-N (mg kg-1)DGS DAS KNS KCS KISName of samplesFigure 3. microbial biomass nitrogen and organic nitrogenTable 3. chemical indicators of different samples.pHAvail.-N Avail. P Avail. K CaCO(Distilled water) * SOM (%)3(mg kg -1 ) ( mg kg -1 ) (mg kg -1 ) (%)Mean SD. Mean SD. Mean SD. Mean SD. Mean SD. Mean SD.KNS 7.86 0.01 4.39 0.50 0.654 0.01 5.48 0.14 280.0 0.00 13.64 0.00KCS 8.24 0.04 3.37 0.08 0.712 0.01 6.49 0.10 213.3 2.89 6.03 0.28KIS 9.80 0.03 3.99 0.34 0.761 0.00 21.44 0.71 900.0 0.00 7.16 0.36* pH measured in (1:2.5 soil water suspension)The same trend was found as expected in electrical conductivity where the highestvalues were found in sludge followed by contaminated soil 3.44 and 1.82 dSm -1respectively. However, calcium carbonate was high in normal soil may be because thissoil is a fluvial soil. Interesting data was found in red sludge regarding the mostimportant macro-nutrients (available NPK) The sludge contains huge amount of thesenutrients as shown in Table 3, 0.761, 21.44 and 900.00 mg kg -1 respectively, this finding285

AGRISAFE Budapest, Hungary, 2011may encourage the use this sludge as a fertilizer, but the high pH and EC have to betaken into consideration. There was no detectable amount of nitrate-N in the red sludgebe caused by high pH; The highest value of ammonia-N as expected was recorded insludge (0.214 mg kg -1 ) followed by contaminated soil (Fig. 5).10.008.006.004.002.00EC (dS m-1)pH (KCl)0.3500.3000.2500.2000.1500.1000.050Ammonia-N (mg kg-1)Nitrate-N (mg kg-1)0.00DGS DAS KNS KCS KISName of samplesFigure 4. Electrical conductivity and soil pH (in KCL)0.000DGS DAS KNS KCS KISName of samplesFigure 5. Ammonia-N and Nitrate-N in samplesConclusionsFrom above results, the following conclusions can be drown: the contamination of thesoil with the red sludge enhanced most of soil quality indicators such as biological,biochemical and chemical after a longer period of rest under the local naturalenvironmental conditions. The results showed close correlation between differentindicators. The contaminating sludge simulated bacterial growth followed by highactivities of soil enzymes like dehydrogenase and catalase and the high number ofAzospirillium sp caused high activity of urease. Chemical indicators showed increasedamount of soil organic matter and also available macro-nutrients (NPK). Theseconditions indicate fertile, non toxic soil conditions , encouraging results for the plannedphytoremediation efforts in the red sludge affected region which can be used for theestablishment of biomass energy plantations until food crops can be grown again.AcknowledgementsThis paper was financially supported by the University of Debrecen, Centre for Agricultural and AppliedEconomic Sciences, Faculty of Agricultural and Food Sciences and Environmental Management, Institute ofHorticulture.ReferencesAbrecque M, T. I. Teodorescu, S. Diagle (2006): Effect of wastewater sludge on growth and heavy metalbioaccumulation of two Salix species. Plant and soil, 171(2): 303–306.Chandra R, S. Yadav, D. Mohan (2008): Effect of distillery sludge on seed germination and growth parameters ofgreen gram (Phaseolus mungo L.). J Hazard Mater, 152: 431439.Jackson, M. L. (1973): Soil Chemical Analysis. Prentice Hall of India Pvt. Ltd, New Delhia.Jenkinson, D. S. and D. S. Powlson (1976): The effects of biocidal treatments on metabolism in soil. V.A. method formeasuring soil biomass. Soil Biol. Biochem., 8, 209-213.Louw, H. A. and M. Webley (1959): The bacteriology of the root region of the oat plant grown under controlled potculture condutuions. J. Appl. Bacterio., 22, 216-221.Olsen, S. R.; C. V. Cale; F. S. Watanabe and L. A. Dean (1954): Estimation of available phosphorus in soil byextraction with sodium bicarbonate. USDA, Circ., 939.Page, A. L. (Ed). (1982): Methods of Soil Analysis. Part 2: Chemical and microbiological properties. (2 nd ed) Amer.Soc. Agron., In: Soil Sci. Soc. Amer. In, Madison, Wisconsin, USA.Pulleman, M. M.; J. Bouma; E. A. van Essen and E. W. Meijles (2000): Soil Organic Matter Content as a Function ofDifferent Land Use History, Soil Sci. Soc. Am. J. 64, 689–693.Schinner, F., R. öhlinger, E. Kandeler, R. Margesin (1996): Methods in soil biology. Springer-Verlag BerlinHeidelberg. Pp. 93-98.Six J.; H. Bossuyt; S. Degryze and K. Denef (2004): A history of research on the link between (micro) aggregates, soilbiota and soil organic matter dynamics. Soil Till. Res., 79, 7-31.Szegi J., (1976): Talajmikrobiológiai viysgálati módsyerek. Budapest. Mezőgazdasági Kiadó. Pp. 234-259.286

Budapest, Hungary, 2011AGRISAFEPHENOLOGICAL AND PLANT MORPHOLOGICAL TRAITSFOR OAT GENOTYPES UNDER ORGANIC ANDCONVENTIONAL GROWTH CONDITIONSM. BLEIDERE – Z. VICUPE – Z. JANSONEState Stende Cereal Breeding Institute, Dizstende, Talsi reg., LatviaE-mail: maara.bleidere@stendeselekcija.lvAbstract The objectives of the present study were to compare oat genetic material according to phenologicaland plant morphological traits under organic and conventional conditions. The field trials in two managementsystems (plot size 10 m 2 , 3 replicates) were carried out in 2010 at the State Stende Cereal Breeding Institute.Twenty-one oat genotypes from the breeding program were chosen for this experiment. The phenological (fieldgermination (growing stage/GS10), tillering (GS21), stem elongation (GS30), flag leaf emergence (GS42-43),panicle stage (GS50-52), maturity (GS92)) and plant morphological traits (growth habit, canopy height (GS31-32), flag leaf angle, flag leaf length, flag leaf width, plant height (GS80-85), coefficient of productive tillering)were determined. The significant genotypic variation noted for most of the evaluated traits indicated thepossibility of selection for these traits in oat. As the t-test indicated, the oat genotypes grown in organicconditions had significantly (p

AGRISAFE Budapest, Hungary, 2011organic agriculture (Przystalski et al., 2008). The comparison of oat genotypes inconventional and organic systems has not been carried out in Latvian conditions.Breeding strategies for organic agriculture have also to consider that a high genotype byenvironment interaction can be present between organic and conventional environments.Climate change, fertilizer crisis and increasing costs for energy will adjust conventionalagriculture to lower inputs (Wolfe et al., 2008). Przystalski et al. (2008) pointed thatcombining information from conventional and organic trials would be the optimalapproach for selecting varieties for organic agriculture.The objectives of the present study were to compare oat genetic material according tophenological and plant morphological traits under organic and conventional conditions.Materials and methodsThe field trials in organic (O) and conventional (C) management systems were carriedout in 2010 at the State Stende Cereals Breeding Institute. The experimental design wasa randomized complete block with plot size 10 m 2 , 3 replicates. Twenty one oatgenotypes (20 oat lines and check variety ‘Laima’) from breeding program were chosenfor this experiment.The soil at the both management systems was sod-podzolic Albeluvisol (Eutric), thehumus content – 35 (O); 24 (C) mg kg -1 , the soil pH KCl – 6.0 (O); 5.9 (C), the contentof phosphorus P 2 O 5 available for plants – 119 (O); 119.8 (C) mg kg -1 , and potassiumK 2 O – 146 (O); 111.5 (C) mg kg -1 , the pre-crop in both growing systems were potatoes.The fertilizer level N48P48K48 was used for oats and in the conventional trial, weedswere controlled by herbicides. The organic field was certified for organic agriculture. Noagrochemicals and fertilizers were used. The oat was sown with a compact trial drill‘Hege 80’ in a well prepared seedbed at a rate of 550 germinating seeds per m² in bothgrowing systems. The yield was harvested by a combine ‘Hege 140’.The phenological (field germination (growing stage / GS 10), tillering (GS 21), stemelongation (GS 30), flag leaf emergence (GS 42-43), panicle stage (GS 50-52), maturity(GS 92)) and plant morphological traits (growth habit, canopy height (GS 31-32), flagleaf angle, flag leaf length, flag leaf width, plant height (GS 80-85), coefficient ofproductive tillering) were determined.The obtained results were statistically processed using methods of descriptive statistics,correlation analysis and t-test paired two samples for means.Results and discussionPlant development, and, thus, the phenological phases, usually shows great interannualvariability and also large spatial differences. Individual (e.g. genes, age) andenvironmental factors (weather and climate conditions in the micro and macro-scale,soil-conditions, water supply, diseases, competition, etc.) influence plants differentlyunder organic and conventional systems (Przystalski et al., 2008).As the t-test indicated, the oat genotypes grown in organic conditions had significantly(p

Budapest, Hungary, 2011AGRISAFEcrops. Competitive ability is usually not attributed to single characteristics (Hoad et al.2008; Pester et al. 1999), but the interaction among a series of desirable characteristics isimportant (Mason and Spaner, 2006). The minimum and maximum values showed rathergreat difference between oat genotypes in the both testing growth conditions indicatedpossibility of selection response in these traits. The highest difference betweengenotypes observed for growth habit, canopy height, flag leaf angle, and flag leaf length,as well as the plant height.Table 1. Comparison of phenological and plant morphological traits for oat genotypes in different growthconditions, 2010Organic growth conditions Conventional growth conditionsTraitMean Min Max Mean Min MaxPhenological traitsField germination (GS 10), days from sowing 13.1a 12.0 15.0 13.2a 12.0 14.0Tillering (GS 21), days from germination 27.0a 23.0 29.0 20.4b 18.0 24.0Stem elongation (GS 30), days 39.0a 34.0 43.0 32.1b 30.0 34.0Flag leaf emergence (GS 42-43), days 43.9a 41.0 49.0 40.3b 36.0 48.0Panicle stage (GS 50-52), days 54.0a 50.0 58.0 51.6b 47.0 58.0Maturity (GS 92), days 92.8a 89.0 95.0 91.9b 89.0 94.0Plant morphological traitsGrowth habit, scores 3.8a 3.0 5.0 3.8a 3.0 5.0Canopy height (GS 31-32), cm 34.5a 37.4 38.9 47.5b 42.0 54.7Flag leaf angle, scores 2.5a 1.0 5.0 2.5a 1.0 5.0Flag leaf length, cm 16.5a 13.2 18.4 21.8b 16.5 24.6Flag leaf width, cm 1.3a 1.1 1.5 1.4b 1.2 1.5Plant height, cm 77.7a 69.5 86.2 99.1b 89.1 113.4Coefficient of productive tillering 0.92a 0.8 1.06 0.93a 0.80 1.01*trait mean values in each comparison between growth conditions with different labels on superscript aresignificant at the p

AGRISAFE Budapest, Hungary, 2011showed the highest canopy height (38.3 cm), horizontal orientation of leaf angle (5scores), comparatively longer (18.4 cm), and wider (1.3 cm) leaves.Oat genotypes do not rank similarly in both growing conditions. The results indicatedsignificant (p

Budapest, Hungary, 2011AGRISAFEMITOGEN-ACTIVATED PROTEIN (MAP) KINASE PATHWAYS:KEY PLAYERS IN ENVIRONMENTAL SIGNALTRANSDUCTION IN PLANTSR. DÓCZIPlant Cell Biology Department, Agricultural Research Institute of the Hungarian Academy of Sciences,Martonvásár, Hungary, e-mail: doczir@mail.mgki.huAbstract As sessile organisms, plants are constantly exposed to a wide variety of environmental conditions.Mitogen-activated protein (MAP) kinase cascades are well-conserved signalling pathways in all eukaryotes,and play a central role in the intracellular transduction of external stimuli. Activated MAP kinasesphosphorylate an array of substrate proteins leading to altered substrate activities that mediate a wide range ofresponses, including changes in gene expression. The genome of the model plant Arabidopsis thaliana containsgenes encoding 20 mitogen-activated protein kinases and 10 MAPK kinases. MAP kinases evidently play acentral role in environmental stress signalling in plants; however, our knowledge mainly comes from results onthree MAP kinases and their immediate upstream activators. Further studies on downstream substrates andconnections to specific signal receptors are required to elucidate their functions in specific signal pathways.Key words: environmental stress, signal transduction, MAP kinase, Arabidopsis thalianaIntroduction: Architecture of MAP Kinase CascadesThe mitogen-activated protein (MAP) kinases, discovered approximately 20 years ago,together with their immediate upstream regulators, are among the most studied signaltransduction molecules (Avruch 2007). They function as the most downstream membersof hierarchical phosphorylation cascades known as MAP kinase cascades. In a canonicalMAP kinase cascade signals are transmitted by sequential phosphorylation events:kinases at each level are activated by phosphorylation and in turn phosphorylate (andthus activate) their downstream counterparts. A canonical MAP kinase cascade consistsof three types of enzymes: the MAP kinase (MAPK or MPK), a MAP kinase kinase(MKK), and a MAP kinase kinase kinase (MAPKKK or MAP3K). MAPKphosphorylation cascades are conserved signalling modules in all eukaryotes and knownto have pivotal roles in regulating ubiquitous processes such as cell division, growth andstress responses. In plants MAP kinase pathways have been shown to play a major rolein stress signalling and their roles in various aspects of plant development have been alsoexplored (Colcombet and Hirt 2008).This review highlights the central role of MAP kinase signalling pathways inenvironmental stress signalling in the model plant Arabidopsis thaliana. TheArabidopsis genome contains 20 genes encoding MAP kinases. All plant MAPKs areclassified into four groups (designated A-D) based on sequence alignments. MKKs lieupstream of the MAPKs. They are the least diverse members of the plant cascades andare therefore thought to act as points of intersection and integration between convergingsignals from upstream MAPKKKs and divergent outputs to downstream MAPKs.Sequence analysis has placed the plant MKKs into 4 groups (A-D) (Jonak et al. 2002;MAP Kinase Group 2002).The MAPKKKs form the largest family of MAP kinase components, the Arabidopsisgenome encoding 60-80 putative members (Champion et al. 2004), but very fewmembers of this family have any assigned biological function. They contain differentpotential regulatory domains outside the catalytic domain, which means they can beregulated by a variety of upstream signals and then selectively activate MKKs.291

AGRISAFE Budapest, Hungary, 2011MAP Kinases: Key Players in Stress SignallingPlants adapt to environmental stresses by changing gene expression patterns, leading toappropriate defence responses. MAP kinase signalling cascades have been implicated inplant responses to many types of stresses. An overview of the major stress-signallingMAP kinase pathways is presented in Figure 1.In Arabidopsis, cold, low humidity, hyper-osmolarity, salt stress and wounding rapidlyactivate MPK4 and MPK6 (Ichimura et al. 2000). Further genetic and biochemicalstudies revealed a cold- and salt-stress signalling cascade consisting ofMEKK1→MKK2→MPK4/6 (Teige et al. 2004), while MKK2 and MPK4/6 are alsoinvolved in disease resistance (Brader et al. 2007). MEKK1 has also been implicated inthe activation of MKK1 in response to wounding signals (Hadiarto et al. 2006). It alsohas been suggested that MEKK1 may constitute a MAP kinase signalling cascade withMKK4 and MKK5 as well as MPK3 and MPK6 in response to flagellin, a pathogenelicitor (Asai et al. 2002). Accordingly, MPK6-silenced Arabidopsis plants arecompromised in resistance to different pathogens (Menke et al. 2004). MPK4 is alsoactivated by flagellin and recent genetic evidence suggests that MEKK1 is upstream ofMKK1 and MPK4 in flagellin and reactive oxygen species (ROS) signalling (Meszaroset al. 2006; Nakagami et al. 2006; Su et al. 2007; Suarez-Rodriguez et al. 2007). MPK4is also required for jasmonic acid-responsive gene expression (Petersen et al. 2000).In a remarkable example of host-pathogen co-evolution, Agrobacterium hijacks theMPK3-regulated nucleocytoplasmic shuttle system of VIP1 to transfer its own T-DNAFigure 1. Overview of the major stress-signalling MAP kinase pathways in Arabidopsis. The canonical MAPkinase pathway is shown on the left. Arrows indicate signal flow-path, question marks indicate unknownfactors.292

Budapest, Hungary, 2011AGRISAFEinto the plant nucleus where it can integrate into plant genomic DNA (Djamei et al.2007).The plant hormone ethylene is produced in response to various stresses, includingpathogen attack. Accumulating evidence supports the association of MAP kinasecascades with ethylene. However, there is an ongoing debate regarding whether theiractual role is ethylene signal transduction or the regulation of ethylene biosynthesis inresponse to stresses (Hahn and Harter 2009).Emerging data on phylogenetically more distant plant genes show further involvement instress signalling: for example, MKK3 of group B and MKK7 of group D MAPK kinasesparticipate in pathogen responses (Doczi et al. 2007; Zhang et al. 2007).Few Kinases, Stresses Galore: The Problem of SpecificityAlthough our understanding of plant MAP kinases has increased significantly in the pastdecade, most of this knowledge comes from studies on three MAPKs: MPK3, MPK6and MPK4. Noticeably, these three kinases are involved in almost all stress signallingand in some developmental processes as well. It is unresolved how signal specificity canbe maintained if the same components are involved in so many different processes. Thefact that these MAP kinases are activated by reactive oxygen species (ROS), which arecommon secondary messengers of all stress input signals, may at least in part explain thephenomenon. Alternatively, a MAP kinase could theoretically be a common mediator ofseveral signals if other members and targets of the pathway are expressed in specific celltypes, at particular developmental stages or under certain environmental conditions only.Furthermore, it is well-known from animal and yeast systems that scaffold proteins andspecific docking sites facilitate the recruitment of specific activators and substrates,thereby facilitating specificity.At present it is difficult to conclude whether being involved in many signalling pathwaysis a common feature of all the 20 MAPKs or if it is specific for the three wellcharacterisedMAPKs. Therefore, further studies are required to discover the biologicalfunctions of the majority of the plant MAPK repertoire. While individual gene functionsare best addressed by functional genetics approaches (i.e. studies on mutant lines),intermolecular interactions that constitute the network of phosphorylation cascades canbe mapped by biochemical methods. In order to identify potential MKK-MPK modules asystematic pair-wise yeast two-hybrid analysis was carried out to find interacting MPK-MKK partners (Dóczi unpublished results). This work revealed a high degree ofconnectivity between group A MKKs and group A and B MPKs, and between group CMKKs and group A MPKs.In comparison with animal systems very few plant MAP kinase substrates have beendescribed to date, and basically nothing is known about how MAP kinases are connectedto upstream stress sensory mechanisms. Future work aiming to characterise the networkcontext of MAP kinase cascades will undoubtedly shed more light on the problem ofsignal specificity and cross-talk.AcknowledgementsThis paper was financially supported by the European Commission Marie CurieEuropean Reintegration Grant (ERG 256554).References293

AGRISAFE Budapest, Hungary, 2011Asai, T., G. Tena, J. Plotnikova, M. R. Willmann, W. L. Chiu, L. Gomez-Gomez, T. Boller, F. M. Ausubel andJ. Sheen (2002). MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415: 977-983.Avruch, J. (2007). MAP kinase pathways: the first twenty years. Biochim Biophys Acta 1773: 1150-1160.Brader, G., A. Djamei, M. Teige, E. T. Palva and H. Hirt (2007). The MAP kinase kinase MKK2 affectsdisease resistance in Arabidopsis. Mol Plant Microbe Interact 20: 589-596.Champion, A., A. Picaud and Y. Henry (2004). Reassessing the MAP3K and MAP4K relationships. TrendsPlant Sci 9: 123-129.Colcombet, J. and H. Hirt (2008). Arabidopsis MAPKs: a complex signalling network involved in multiplebiological processes. Biochem J 413: 217-226.Djamei, A., A. Pitzschke, H. Nakagami, I. Rajh and H. Hirt (2007). Trojan horse strategy in Agrobacteriumtransformation: abusing MAPK defense signaling. Science 318: 453-456.Doczi, R., G. Brader, A. Pettko-Szandtner, I. Rajh, A. Djamei, A. Pitzschke, M. Teige and H. Hirt (2007). TheArabidopsis mitogen-activated protein kinase kinase MKK3 is upstream of group C mitogen-activatedprotein kinases and participates in pathogen signaling. Plant Cell 19: 3266-3279.Hadiarto, T., T. Nanmori, D. Matsuoka, T. Iwasaki, K. Sato, Y. Fukami, T. Azuma and T. Yasuda (2006).Activation of Arabidopsis MAPK kinase kinase (AtMEKK1) and induction of AtMEKK1-AtMEK1pathway by wounding. Planta 223: 708-713.Hahn, A. and K. Harter (2009). Mitogen-activated protein kinase cascades and ethylene: signaling,biosynthesis, or both? Plant Physiol 149: 1207-1210.Ichimura, K., T. Mizoguchi, R. Yoshida, T. Yuasa and K. Shinozaki (2000). Various abiotic stresses rapidlyactivate Arabidopsis MAP kinases ATMPK4 and ATMPK6. Plant J 24: 655-665.Jonak, C., L. Okresz, L. Bogre and H. Hirt (2002). Complexity, cross talk and integration of plant MAP kinasesignalling. Curr Opin Plant Biol 5: 415-424.MAP Kinase Group (2002). Mitogen-activated protein kinase cascades in plants: a new nomenclature. TrendsPlant Sci 7: 301-308.Menke, F. L., J. A. van Pelt, C. M. Pieterse and D. F. Klessig (2004). Silencing of the mitogen-activatedprotein kinase MPK6 compromises disease resistance in Arabidopsis. Plant Cell 16: 897-907.Meszaros, T., A. Helfer, E. Hatzimasoura, Z. Magyar, L. Serazetdinova, G. Rios, V. Bardoczy, M. Teige, C.Koncz, S. Peck and L. Bogre (2006). The Arabidopsis MAP kinase kinase MKK1 participates in defenceresponses to the bacterial elicitor flagellin. Plant J 48: 485-498.Nakagami, H., H. Soukupova, A. Schikora, V. Zarsky and H. Hirt (2006). A mitogen-activated protein kinasekinase kinase mediates reactive oxygen species homeostasis in Arabidopsis. J Biol Chem 281: 38697-38704.Petersen, M., P. Brodersen, H. Naested, E. Andreasson, U. Lindhart, B. Johansen, H. B. Nielsen, M. Lacy, M.J. Austin, J. E. Parker, S. B. Sharma, D. F. Klessig, R. Martienssen, O. Mattsson, A. B. Jensen and J.Mundy (2000). Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. Cell 103:1111-1120.Su, S. H., M. C. Suarez-Rodriguez and P. Krysan (2007). Genetic interaction and phenotypic analysis of theArabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity.FEBS Lett 581: 3171-3177.Suarez-Rodriguez, M. C., L. Adams-Phillips, Y. Liu, H. Wang, S. H. Su, P. J. Jester, S. Zhang, A. F. Bent andP. J. Krysan (2007). MEKK1 is required for flg22-induced MPK4 activation in Arabidopsis plants. PlantPhysiol 143: 661-669.Teige, M., E. Scheikl, T. Eulgem, R. Doczi, K. Ichimura, K. Shinozaki, J. L. Dangl and H. Hirt (2004). TheMKK2 pathway mediates cold and salt stress signaling in Arabidopsis. Mol Cell 15: 141-152.Zhang, X., Y. Dai, Y. Xiong, C. DeFraia, J. Li, X. Dong and Z. Mou (2007). Overexpression of ArabidopsisMAP kinase kinase 7 leads to activation of plant basal and systemic acquired resistance. Plant J 52: 1066-1079.294

Budapest, Hungary, 2011AGRISAFEVARIABILITY OF YIELD POTENTIAL OF OATS UNDERSLOVAKIAN CONDITIONSD. DVONČOVÁ 1 – P. KOVÁČIK 2 – P. HOZLÁR 11 Plant Production Research Centre Piešťany, Research Institute of Plant Production, Research Breeding StationVígľaš – Pstruša, 962 12 Detva, Slovakia, dvoncova@vurv.sk; hozlar@vurv.sk2 Slovak University of Agriculture, Tr. A. Hlinku 2, 949 76 Nitra, Slovakia, peter.kovacik@uniag.skAbstract The object of the study was to investigate the influence of variety, year and fertilization on the yieldpotential of varieties of common oats (Avena sativa L.) and naked oats (Avena nuda L.). The trial wasestablished in the years 2007-2009 in the potato growing area in the centre of Slovakia in Vígľaš-Pstruša. Thefield treatments were set up under natural conditions without irrigation with four variants of fertilization.Nitrogen fertilization was applied before sowing and foliar nitrogen application was performed in the growthphase at the end of stooling (BBCH 29). The grand mean of yield in the experiment was 5.63 t.ha -1 . Higheryields were obtained for common oat varieties than for naked oats (6.93 vs. 4.33 t.ha -1 ). The variety Vendelinproduced the highest grain yield (7.15 t.ha -1 ). Nitrogen fertilization increased the yield of oats. The negativeinfluence of a particular year was confirmed in the year 2008. The average thousand-kernel weight in theexperiment was 36.63 g for the common oat varieties Vendelin and Zvolen and 26.02 g for the naked oatvarieties Detvan and Avenuda. The effect of variety on TKW was highly significant. The year had a significanteffect on thousand-kernel weight. Applying fertilization before sowing and during vegetation had a nonsignificantinfluence on the TKW of oats.Key words: yield potential, oats, variety, year, thousand-kernel weight, fertilizationIntroductionOat is a crop with an important European history and tradition. The high value of oat inhumannutrition, which is unique among cereals, is widely recognised and confirmed byhealth claims issues in various countries (Hermann, et al., 2010). The use of oat in foodprocessingindustry in central Europe still has a weak tradition. While the annual oatconsumption per person in Finland reaches 20 kg, the figure in central Europe is only0.4-0.8 kg (Prugar et al., 2008). According to Prugar et al (2008) the technological(milling) oat quality varies in quite a wide range, depending on a variety, climaticconditions during vegetation, used agrotechnical measures etc. The participation of oatin the world production of cereal reaches 2% and since the year 1970 to the year 2000the change in the world yield recorded the increase in 16% (Strychar, 2010). Despitethis, according to Beuch (2010), eastern Europe (Poland, the Czech Republic, Slovakia)nowadays tends to show a dicreasing yield, even if the oat production is stable. If welook at the development of the previous season (2010) in Slovakia, it signalizes problemswith the commodity of dense-sowing cereal. Enormous precipitation at the end of thevegetation period caused not only decrease in a cereal yield, but also caused problemswith qualitative parameters (Adam, 2010).The development of the last year (2010) does not have to be exceptional in the followingyears; that is why we should now think of the dynamics of the oat yield potential whichwas also the objective of our study.Materials and methodsThe fertilization trial was established in the years 2007 and 2009 in the potato growingarea in the centre of Slovakia in Vígľaš-Pstruša. The common oats varieties (Vendelin,Zvolen) and the naked oats varieties (Detvan, Avenuda) were sown in this experiment.The sowing was implemented in a sowing succession after red clover with the crop areaof 10 m 2 in four repetitions and the sowing of 5.0 million germinant grains per 1 ha. The295

AGRISAFE Budapest, Hungary, 2011soil type is pseudogley (Mražíková, 2008) with an acid soil reaction and the averagesupply of phosphorus and potassium. Its agrochemical parametres are shown in Table 1.Table 1: Basic agrochemical soil parametersSoil Analysis Year 2007 Year 2008 Year 2009pH KCl 5.12 6.35 5.28Nan (mg.kg -1 )* 15.4* 14.2* 11.9*P (mg.kg -1 ) 55.9 72.5 47.0K (mg.kg -1 ) 130.0 119.5 105.8Mg (mg.kg -1 ) 226.0 242.5 295.5Ca (mg.kg -1 ) 1625.0 2437.5 2197.5Humus (%) 1.03 1.52 1.19pH KCl -(potentiometrically in 1.0 M KCl extract); Nan- [numerically as the sum of N–NH 4 + + N–NO 3-(N–NH 4+colorimetry, Nesslerovo reagent and N–NO 3-colorimetry, acid phenol 2,4-disulphonic)]; P-(colorimetry,Mehlich II 2007; Mehlich III – 2008,2009); K, Ca -(Flame photometry, Mehlich II - 2007;Mehlich III –2008,2009); Mg-(atomic absorption spectrometry, Mehlich II - 2007; Mehlich III – 2008, 2009); humus-(asoxidizing carbon, Tjurin).* - the content of Nan in soil in spring just before the experimentTable 2: Fertilization variants in the experimental in the years 2007- 2009VariantFertilizationReal amount of fertilizerapplied in year 2007Real amount of fertilizerapplied in year 2008Real amount of fertilizerapplied in year 2009N P K N P K N P Kkg.ha -1 kg.ha -1 kg.ha -11 N0 - 24 96 - 12 96 - 12 962 N1 47 24 96 54 12 96 56 12 963 N2 35 24 96 40 12 96 45 12 964 N1+15 47+15* 24 96 54+15* 12 96 56+15* 12 965 N2+15 35+15* 24 96 40+15* 12 96 45+15* 12 96N 1,2 – nitrogen applied before sowing * – nitrogen applied during vegetation at the end of the stoolingThe results were statistically evaluated by Analysis of Variance in programSTATGRAPHICS Plus, LSD test.Table 3: The meteorological characteristic of experimental place in the years 2007-2009I. II. III. IV. V. IV. VII.30 years average of temperature -4,1 -1,3 2,9 8,3 13,0 15,8 17,40Average of temperature in 2007 ( 0 C) 2.83 2.79 6.11 10.54 15.14 18.47 19.97Average of temperature in 2008 ( 0 C) 0.10 1.78 3.97 9.67 14.51 18.41 18.74Average of temperature in 2009 ( 0 C) -4.40 -1.20 3.40 11.50 14.40 16.10 19.8030 years average of precipitation 30,0 31,0 31,0 46,0 68,0 88,0 61,0Average of precipitation in 2007 70.80 35.40 53.50 0.80 95.80 106.5 20.30Average of precipitation in 2008 29.90 19.90 49.60 36.30 64.20 59.40 117.5Average of precipitation in 2009 39.20 40.20 49.40 11.00 62.80 96.40 34.20Respecting the content of inorganic nitrogen in soil, different doses of nitrogenousfertilization were applied with the identical phosphoric and potassium nourishment at thesubstituting fertilization level (Kováčik, 1997). Phosphoric fertilization (in form of296

Budapest, Hungary, 2011AGRISAFEhypercorn 26% P 2 O 5 ) and potassium fertilization (in form of potassium salt 60% K 2 O)were applied unrepeatedly in the autumn. Nitrogen in form of amonium nitrate (27% N)was applied before sowing on planned yield 4 t.ha -1 . During vegetation period – at theend of the stooling period (BBCH 29) we foliarly applied nitrogen on the crop area (15kg.ha -1 ) in form of DAM-390. Nourishment variants used in the experiment are shown inTable 2.Results and discussionThe influences of genotype and climate conditions are other significant parameters tosecure production of oat with a preferred and constant quality independent of usage(Holtekjølen et al., 2010). The average reached oat yield in Slovakia in the last ten yearsproved the value of 2.04 t.ha -1 . The oat yield in our trial varied from 2.55 – 8.40 t.ha -1 .The questions concerning fertilization and its influence on a yield and productionquality are getting more urgent nowadays; mostly in the period of a decreasing tendencyin the applying of industrial fertilizers in Slovakia. According to Moudrý (2003), thenitrogen fertilization participates in an oat yield by 15-45 %. The results have shown thatall levels of nitrogen fertilization with the observed varieties positively influenced theyield in the average of the years 2007-2009.It is well-known and confirmed by agricultural practice that all naked oat varieties reachon average lower yields than common oats varieties. We found out that the difference innaked oats yields and common oats yields was on average 2.60 t.ha -1 in all observedyears (2007-2009). The highest average yields was reached by Vendelin variety (7.15t.ha -1 ), while the lowest yields were confirmed with naked Detvan variety (4.08 t.ha -1 ).With all of the cultivated varieties in the trial were confirmed statistically significantlyhigh difference in a grain yield.Table 4. The yield and thousand-kernel weight (TKW) of common and naked oatsAverage yield of oats in the years 2007-2009 (t.ha -1 )Variant Fertilization Vendelin Zvolen Detvan AvenudaAbs. Rel. Abs. Rel. Abs. Rel. Abs. Rel.1 0 6.91 100.0 6.46 100.0 3.86 100.0 4.48 100.2 N1 7.30 105.6 6.69 103.5 3.99 103.4 4.53 101.3 N2 7.22 104.6 6.76 104.6 4.28 110.9 4.65 103.4 N1+15 7.17 103.7 6.70 103.6 4.10 106.2 4.53 101.5 N2+15 7.15 103.5 6.97 107.9 4.17 108.1 4.68 104.Average 7.15 - 6.72 - 4.08 - 4.57 -Average TKW of oats in the years 2007-2009 (g)Variant Fertilization Vendelin Zvolen Detvan AvenudaAbs. Rel. Abs. Rel. Abs. Rel. Abs. Rel.1 0 37.79 100.0 36.17 100.0 24.25 100.0 27.71 100.2 N1 37.54 99.3 35.50 98.1 24.67 101.7 27.75 100.3 N2 36.88 97.6 36.08 99.8 24.75 102.1 26.83 96.84 N1+15 36.83 97.5 36.67 101.4 24.50 101.0 27.33 98.65 N2+15 36.08 95.5 36.75 101.6 24.50 101.0 27.92 100.Average 37.02 - 36.23 - 24.53 - 27.51 -HD-p-0,05 yield: variety 0.20963, year 0.181545, fertilization 0.234374HD-p-0,01 yield: variety 0.276355, year 0.23933, fertilization 0.308974HD-p-0,05 TKW: variety 0.577779, year 0.500372, fertilization 0.645977HD-p-0,01 TKW: variety 0.761684, year 0,659637, fertilization 0.851588297

AGRISAFE Budapest, Hungary, 2011The significant influence of the year on the yield potential of both naked and commonoats was confirmed with a yield as well as with TKW. In the year 2008 we found out thelowest average yield (5.27 t.ha -1 ) in the observed varieties and the lowest average valueof TKW (28.78 g). The year had statistically highly significant influence to the yield andTKW of the observed varieties. Common oats (Vendelin and Zvolen) reached theaverage value TKW of a trial 36.63 g, while the average TKW of a trial with naked oats(Detvan and Avenuda) were 26.02 g.TKW as a significantly genetically conditioned feature did not manage to influencesignificantly the fertilization applied before sowing and during vegetation. Unlikefertilization, a variety statistically significantly influenced TKW of the observedvarieties with the highest average TKW of common oat variety Vendelin (37.03 g), thussurpassing the next Slovak Variety Zvolen by 2.2 % (36.23 g). The difference betweennaked varieties was more significant, variety Detvan fell behind variety Avenuda (27.51g) in TKW in 12.1 %.ConclusionsThe trial confirmed that the variability of an yield oat potential is significantlyinfluenced by the year. Choosing of a good and reliable variety enables us (referring toour results) to influence yield formation oat parameters unlike the influence of the yearwhich is impossible to be influenced by a man. Agrotechnical measures, e.g. appliednitrogen fertilization, can partially increase an oat yield. The question is the effectivenessof applied fertilization with the current tendency of increasing fertilizers´ prices. Theinfluence of fertilization on thousand-kernel weight was not confirmed with our trial.In conclusion we would highly recommend to choose varieties and seeds of high qualityto increase technological quality of oats. These varieties of high quality are noted for ahigh range of plasticity thus being able to adapt to the cultivating environment and alsoto climatic conditions during vegetation.ReferencesAdam, Š. (2010): Úrody oproti minulému roku zaostávajú o pol tony. Bratislava SPPK. (stiahnuté 16.9.2010)Dostupné na internete: http://www.polnoinfo.sk/clanok/1915/rozhovory/rastlinna-vyrobaBeuch, S. (2010): Oat breeding for Europe-Impossibility or Challenge In More Oats. Ystad. Sweeden, 2010.Hermann, M. H. et al. (2010): Nutritional Quality in Oat Genetic Resources a European Initiative (AVEQ) InMore Oats. Ystad. Sweeden, 2010. 30.Holtekjølen, A. K., Uhlen, A. K., Åssveen, M., Sahlstrøm, S. (2010): Quality of Oats as Influenced byGenotype and Climate Parameters. In More Oats . Ystad. Sweeden, 73.Kováčik, P. (1997): Rozbory pôd, rastlín, hnojív a výpočet dávok živín k poľným a záhradným plodinám, SPUNitra, Katedra agrochémie a výživy rastlín, ISBN 80-7137-358-9.Mražíková, M. (2008): Stabilita pôdnych agregátov v pôdach SR. Dizertačná práca SPU – Nitra, 57Moudrý, J. (2003): Tvorba výnosu a kvality ovsa (vědecká monografie), Jihočeská univerzita v ČeskýchBudějovicích, ISBN 80-7040-659-3, 167Prugar, J. et al. (2008): Kvalita rostlinných produktů na prahu 3. tisíciletí, Výskumný ústav pivovarsrskýa sladařský, a.s., Praha, 2008. ISBN 978-80-86576-28-2, 133-141.Strychar, R. (2010): Food and feed markets for oat. In More Oats . Ystad. Sweeden298

Budapest, Hungary, 2011AGRISAFEDEFENSE RESPONSE OF SOYBEAN EXPOSED TO CADMIUMDEPENDS ON NITROGEN SUPPLYI. GOLOVATIUK 1 – B. BÉKÉSIOVÁ 2 – I. MATUŠÍKOVÁ 3 – N. TARAN 11 Department of Plant Physiology and Ecology, Institute of Biology, Taras Shevchenko Kyiv NationalUniversity, Volodymyrska Str., 64, 01033 Kyiv, UKRAINEgolovatyuk.yevgeniya@gmail.com, tarantul@univ.kiev.ua2 Department of Botany and Genetics, Faculty of Natural Sciences, Constantine the Philosopher University,Nábrežie mládeže 91, 94901, Nitra, SLOVAKIA, bpirselova@ukf.sk3 Department of Molecular Biology and Biotechnology, Institute of Plant Genetics and Biotechnology, SlovakAcademy of Sciences, 95007, Nitra, SLOVAKIA, ildiko.matusikova@savba.skAbstract The interference between nitrogen nutrition and Cd toxicity was investigated in soybean seedlings inhydroponic culture. It was found that the combined effect of nitrogen nutrition and Cd contributed to the plantdefense system. Moreover, the alleviation of Cd toxicity in soybean depended on the nitrogen supply and couldbe achieved by low concentrations of this nutrient in the environment, as demonstrated by root growth and thelipid peroxidation of cell membranes. Protein extracts of soybean root tissue separated on PAGE and stainedfor chitinase activity revealed that there were isoforms with opposing regulation under different stressors andtheir combination.Key words: heavy metal toxicity, nutrition, plant defenseIntroductionStudying of inducible plant resistance would help to elaborate and improve approachesfor its enhancement to wide scale of stress factors. Contamination and consequentialaccumulation of heavy metals (HM) in soil and crops due to anthropogenic activities areincreasing. Among HMs cadmium (Cd) is highly toxic for plants as well as for humanand animal. This toxicity for plant is a consequence of metabolism disturbance (Sanita diToppi, 1999). It is known that in HM-detoxification nitrogen-containing compounds andmetabolites play important role since in addition to providing nutrients also take part insignaling pathways (Sakakibara, 2003). Besides, N factor contributes to plant toleranceto oxidative stress caused by abiotic stressors (Polesskaya et. al., 2006). Hence, studyingof possible regulatory effect of N on plant adaptive potential to HMs appears to be ofspecial importance.Materials and methodsUniformly germinated seeds of soybean (Glycine max L. Merr.) cv. Ustya were exposedduring 48 hours to Cd ions (5 mg l -1 Cd 2+ ) under different N nutrition rate (1,2 and 24mM of N). The chemicals used in tests were Cd(NO 3 ) 2 *4H 2 O and NH 4 NO 3 .Lipid peroxidation (LP) level was determined by measuring the amount ofmalondialdehyde (MDA) according to Dhindsa (1981).H 2 O 2 level definition based on oxidation of ferrous to ferric ion in the presence ofxylenol orange was performed according to Nourooz-Zadeh (1994).Callose deposition was identified on a cross-sections stained with fluorochrom anilineblue according to Stone (1985). Stained slides were analyzed with microscope Axioplan2 (Carl Zeiss, Göttingen) under UV-light.Proteins isolated according to Hurkman and Tanaka (2003) were separated on sodiumdodecylsulphate (SDS) containing polyacrylamide gels (PAGE) (Pan et al., 1991).Separation under native conditions was performed according to the method of De Bolleet al. (1991) for acidic/neutral proteins and to the method of Reisfeld (1962) forbasic/neutral proteins. The gel contained 0,01% (w/v) glycol chitin as a substrate. Gels299

AGRISAFE Budapest, Hungary, 2011with separated proteins were stained for chitinase activity according to Pan et al. (1991).Gel images were analyzed by Scion Image software.Statistical analyses by Student's t-test were performed on data obtained from three to sixreplicates. In the graphs are indicated standard deviations from means and the level ofstatistical significance: * – p≤0,05, ** – p≤0,01, *** – p≤0,001.Results and discussionThe effect of Cd on plant defense reactions varied depending on the applied N regime.The effect of N on root growth appeared to be dose-dependent (Fig.1.). Low Nconcentration (1,2 mM) had favourable, while its excess (24 mM) revealed negativeeffect (p≤0,05) on soybean root growth that is obvious as far as concentration 10 mM ofN is believed to be threshold for some plant species (Benton Jones, 1997).0,1m, g FW0,080,060,04**** ****0,0200 1,2 24ControlCdFigure 1. Fresh weight of soybean roots under additional nitrogen supply and Cd-treatment.The presence of Cd resulted in stunted growth of all stressed soybean roots that isbelieved to be general stress-reaction to HM-treatment (Metwally 2005). Besides Cdrelatedgrowth inhibitory effect was alleviated by low N conсentration in medium (by12% p≤0,05). On the other hand cultivation on 24 mM of N resulted in same growthsuppression as in seedlings that were cultivated without additional N (p≤0,001). At thesame time high dose of N and combined with Cd application resulted in strong negativeeffect on both root growth and fresh weight. In the Cd-stressed plant tissue increasedlevel of LP was observed that correlates with results of other researchers (Romero-Puertas 1999, Sandalio 2001) (Fig. 2.). At the same time change in the level of H 2 O 2 wasdetected, opposite to observation previously represented for pea under Cd-treatment(Romero-Puertas 2004). The obtained results could be explained by activation ofantioxidant enzymes which detoxified harmful H 2 O 2 molecules (Dixit et al. 2001).40C, mM** *MDA content, nmol/g FW3020100controlCd0 1,2 24С, мМFigure 2. Malondialdehyde accumulation in soybean roots under additional nitrogen supply and Cd-treatment.N supply was founded to reduce the rate of LP triggered by Cd. It is well known that oneof the first defence reactions of plant cell to stress factors including HMs is thickening ofcell wall by intense synthesis of callose (Kauss, 1990). After 48 h of cultivation on Cdcontainingmedium there was a callose deposition in rhizo- and exodermal cells ofseedling’s roots enhanced, that testified to barrier formation against heavy metal intake300

Budapest, Hungary, 2011AGRISAFEin Cd-treated plants. In control plants modification of cell wall was observed mostly inendoderma and primary xylema. However, the researched concentrations of N separatelyand in combination with Cd did not obviously affect the cell wall structure in the givenexperimental system (data not shown).Focusing on defence-related enzymes – chitinases – almost all isoforms detected afterseparation in PAGE were responsive to HM-stress (Fig. 3.).SDS PAGETotal protein detectionNATIVE PAGEAcidic and neutral chitinase isoforms0 1,2 24 0 1,2 2412~kDaChitinase detection0 1,2 24 0 1,2 243Basic and neutral chitinase isoforms0 1,2 24 0 1,2 2436,53025abc21,5ControlCdFigure 3. Detection of total protein profile and accumulation of chitinase isoforms under additional nitrogensupply and Cd-treatment using SDS-PAGE and native-PAGE.The obtained chitinase band patterns indicated that there were isoforms with opposingregulation under different stresses and their combination. At least 6 chitinase isoformswere detected in protein extracts from soybean roots. Seedlings supplemented withadditional N did not show any significance difference in accumulation of chitinaseisoforms. In spite of invariability of total protein profile in condition of high N supplyactivity of one of the acidic/neutral chitinase isoform was significantly decreased(p≤0,001). At the same time addition of 1,2 mM of N to the medium caused significantlyincreased (p≤0,05) activity of one of the basic/neutral chitinase isoform. That mightindicate importance of this enzyme in forming some adaptive reactions to misbalance ofN in environment or indicate chitinase activity as N-dependent (Delpin, Goodman,2009).Presence of Cd in medium affected protein profile in root extracts of soybean that pointto activation of plant defense. Chitinase isoforms with molecular weight ~25 and 30 kDawere present in control roots and roots exposed to 1,2 mM of N. Protein detection usingnative-PAGE showed 5 of 6 isoforms, which were Cd-dependent. However aftercombined treatment with 24 mM of N and Cd the activities of all isoforms were lower,while supply with 1,2 mM of N did not show such an effect. Previous researchesconfirms that combined effect of N nutrition and Cd contribute to plant defense system(Sady, Kowalska, 2004, Mihailović 2010).ConclusionsThe obtained data allow us to conclude that the dosage of N in the growing environmentinterferes with plant defense responses against HM-stress that was depicted in alterationsof root growth, LP level and synthesis of defense enzymes. It was shown that alleviationControlCd301

AGRISAFE Budapest, Hungary, 2011of Cd-toxicity for soybean depends on N supply and can be performed by lowconcentration of this nutrient in the environment. In addition our results confirm thatchitinase are possibly included among defense components in HM-exposed plants(Békésiová et al., 2008). Their role and mechanism of action in the plant cells stillremain unknown, but are apparently more diverse and complex than expected.AcknowledgementThis paper was financially supported by the National Scholarship Programme of theSlovak Republic for the Support of Mobility of Students, PhD Students, UniversityTeachers and Researchers.ReferencesBékésiová, B., Hraška, Š., Libantová, J., Moravčíková, J., Matušíková, I. (2008): Heavy-metal stress inducedaccumulation of chitinase isoforms in plants. Mol. Biol. Rep., 35, 579-588.Benton Jones, J. Jr. (1997): The essential elements. pp. 30–32. In: Benton Jones, J. Jr. (ed) Hydroponics: Apractical guide for the soilless grower. St Lucie Press, Boca Raton, Florida.De Bolle, M. F. C., Goderis, I. J., Terras, F. R. G., Cammue, B. P. A., Broekaert, W. F. (1991): A technique fordetecting antifungal activity of proteins separated by polyacrylamide gel electrophoresis. Electrophoresis,12, 442–444.Delpin, M. W., Goodman, A. E. (2009): Nitrogen regulates chitinase gene expression in a marine bacterium.ISME J., 3, 1064–1069.Dhindsa, R. S., Matowe, W. (1981): Drought tolerance in two mosses: correlated with enzymatic defenseagainst lipid peroxidation. J. Exp. Bot., 32, 79-91.Dixit, V., Pandey, V., Shyam, R. (2001): Differential oxidative responses to cadmium in roots and leaves ofpea (Pisum sativum L cv. Azad). J. Exp. Bot., 52, 1101-1109.Hurkman, W. J., Tanaka, C. K. (1986): Solubilization of plant membrane proteins for analysis by twodimensionalgel electrophoresis. Plant Physiol., 81, 802-806.Kauss, H. (1996): Callose synthesis. pp.77-92. In: Smallwood, M., Knox, J. P., Bowles, D. J. (eds.)Membranes: Specialized Functions in Plants. Guildford: Bios.Sci.Publ., Guilford, UK.Metwally, A., Safronova, V. I., Belimov, A. A., Dietz, K. J. (2005): Genotypic variation of the response tocadmium toxicity in Pisum sativum L. J. Exp. Bot., 56, 167–178.Mihailović, N. (2010): Growth and ion uptake in maize plants exposed to Pb, Cd and Ni depend on NO 3– +/NH 4ratio. Botanica serbica, 34, 15-20.Nourooz-Zadeh, J., Tajaddini-Sarmadi, J., Wolff, S. P. (1994): Measurement of plasma hydroperoxideconcentrations by the ferrous oxidation - xylenol orange assay. Anal. Biochem., 220, 403-9.Pan, S. Q., Ye, X. S., Kuc, J. (1991): A technique for detection of chitinase, β-1,3-glucanase and proteinpatterns after a single separation using polyacrylamide gel electrophoresis or isoelectrofocusing.Phytopathol., 81, 970-974.Polesskaya, O. G., Kashirina, E. I., Alekhina, N. D. (2006): Effect of salt stress on antioxidant system of plantsas related to nitrogen nutrition. Russ. J. Plant Physiol., 53, 186-192.Reisfeld, R. A., Lewis, U. J., Williams, D. E. (1962): Disk electrophoresis of basic proteins and peptideson polyacrylamide gels. Nature, 195, 281-283.Romero-Puertas, M. C., Rodríguez-Serrano, M., Corpas, F. J., Gómez, M., del Río, L. A., Sandalio, L. M.(2004): Cadmium-induced subcellular accumulation of O -2 and H 2 O 2 in pea leaves. Plant Cell Environ.,27, 1122-1134.Romero-Puertas, M. C., McCarthy, I., Sandalio, L. M., Palma, J. M., Corpas, F. J., Gomez, M., del Rio, L. A.(1999): Cadmium toxicity and oxidative metabolism of pea leaf peroxisomes. Free Radic. Res., 31, 25–31.Sady, W., Kowalska, I. (2004): Effects of nitrogen form or solution pH on cadmium content and quality ofspinach. Acta Hort., 700, 133-137.Sakakibara, H. (2003): Nitrate-specific and cytokinin-mediated nitrogen signaling pathways in plants. J. PlantRes., 116, 253–257.Sandalio, L. M., Dalurzo, H. C., Gomez, M., Romero-Puertas, M. C., del Rio, L. A. (2001): Cadmium-inducedchanges in the growth and oxidative metabolism of pea plants. J. Exp. Bot., 52, 2115–2126.Sanita di Toppi, L., Gabbrielli, R. (1999): Response to cadmium in higher plants. Environ. Exp. Bot., 41, 105–130.302

Budapest, Hungary, 2011AGRISAFEStone, B. A., Evans, N. A., Bonig, I., Clarke, A. E. (1985): The application of Sirofluor, a chemically definedfluorochrome from aniline blue for the histochemical detection of callose. Protoplasma, 122, 191–195.303

AGRISAFE Budapest, Hungary, 2011CALLUS INDUCTION FROM MATURE MAIZE (ZEA MAYS L.)EMBRYOS - EFFECT OF PLANT GROWTH REGULATORSM. JAKUBEKOVÁ 1 – Ľ. UVÁČKOVÁ 1 – A. PREŤOVÁ 1,2 - B. OBERT 11 Institute of Plant Genetics and Biotechnology, Slovak Academy of Sciences, Akademická 2, P. O. Box 39/A,95007 Nitra, Slovak Republic, e-mail: miroslava.jakubekova@savba.sk2 Department of Botany and Genetics, Faculty of Natural Sciences, University of Constantine the Philosopher,Trieda A. Hlinku 1, 94901 Nitra, Slovak RepublicAbstract A maize callus induction system was developed using mature embryos of two maize inbred lines(A18 and A19). A series of experiments were conducted to test the composition of the culture media,particularly the effect of the growth regulators 6-benzylaminopurine (BAP), 1-naphthaleneacetic acid (NAA),and kinetin (KIN). N6 medium was supplemented with different concentrations of 2,4-D (2,4-dichlorophenoxyacetic acid) (1, 2, 4 mg l -1 ) in combination with the plant growth regulators BAP (0, 0.2 ,0.5mg l -1 ), NAA (0, 0.5, 1 mg l -1 ) and KIN (0, 1, 2 mg l -1 ). It was found that the plant growth regulator BAP didnot promote the induction of primary calli in N6 medium in either genotype, while the addition of 1 mg l -1 2,4-dichlorophenoxyacetic acid with 0.5 mg l -1 NAA in N6 medium was optimal for callus induction in bothgenotypes. The reaction to KIN was different for the two genotypes, as genotype A18 initiated calli on mediumsupplemented with 2 mg l -1 2,4-D in combination with 2 mg l -1 KIN, while the response of genotype A19 wasless pronounced than that of A18.Key words: 2,4-dichlorophenoxyacetic acid (2,4-D), 6-benzylaminopurine (BAP), 1-naphthaleneacetic acid(NAA), kinetin (KIN), maize (Zea mays L.), callus induction, mature embryoIntroductionMaize (Zea mays, L.) is the third most planted cereal crop after wheat and riceworldwide. The production of this crop is on the decrease due to increased population,limited land, environmental and biotic stresses. Over the years, conventional breedinghas been used as a tool to overcome these constraints.Plant regeneration through tissue culture of maize was first reported by Green andPhillips (1975) utilizing immature embryos as the explant. Since the successful plantregeneration has been reported from callus initiating from different tissue source (Ting etal., 1981; Rhodes et al., 1986; Conger et al., 1987). The ability to regenerate maizeembryo derived from callus cultures has been reported to be dependent on the genotypeused (Lee and Phillips, 1987; Obert et al. 2010). Maize immature embryos were mostwidely used as a source explant for regeneration (Lu et al., 1982; Vasil et al., 1984). Butbecause of the inherent difficulty of supplying those a year around, the focus has beenshifted towards mature embryos recently. The use of mature embryo from dry seed hasseveral advantages: mature embryos are ease to handle, no time limitation, and areavailable in bulk quantities. In the absence of the possibility for developmental cellmigration and due to the need for continuous organogenesis during their postembryonicdevelopment, plants maintain organ-forming cell files, the meristems. The formation andactivity of meristems are highly dependent on environmental, as well as hormonalfactors. Thus, the ontogenic program of plants is highly flexible and this is linked to thereversibility of the differentiation state of somatic plant cells. Under extreme conditions,these cells have to change their fate: either they have to die (apoptosis) or dedifferentiateand divide, depending on the needs of the organism and conditions. Hormones are themost likely candidates in the regulation of developmental switches. Auxins andcytokinins are the main growth regulators in plants involved in the regulation of celldivision and differentiation. The influences of exogenously applied auxins, preferentially2,4-dichlorophenoxyacetic acid (2,4-D), on the induction of somatic embryogenesis are304

Budapest, Hungary, 2011AGRISAFEwell documented (Dudits et al., 1991, e.g.). Auxins promote, mainly in combination withcytokinins, the growth of calli, cell suspensions and organs, and also regulate themorphogenic processes. At the cellular level, auxins control basic processes such as celldivision and cell elongation. Since they are capable of initiating cell division they areinvolved in the formation of meristems giving rise to either unorganized tissue, ordefined organs. The purpose of our studies was to optimize conditions for regeneratingplants from mature embryos of maize in cultures.Materials and methodsA maize callus induction system was developed using mature maize embryos. Twomaize genotypes A18 and A19 (Barnabás et al. 1998) were used in our experiments. Allseeds were surface sterilized with 70% ethanol for 5 min, and with 40% SAVO for 20min. Sterilized seeds were rinsed three times with sterilized distilled water and soaked insterilized distilled water containing 4 mg.l -1 2,4-dichlorophenoxyacetic acid (2,4-D) for72 h. The swollen mature embryos were removed from seeds with a scalpel..Figure 1. A vertical view of split-seed, showing arrangement of tissues and organs (Al-Abed et al., 2006)The callus induction medium contained N6 (Chu et al., 1975) basal salts and N6vitamins, 2 mg.l -1 glycine, 690 mg.l -1 proline, 1 g.l -1 casein hydrolysate, and 30 g.l -1sucrose and was solidified with 8 g.l -1 agar. Various concentration of 2.4-D (1, 2, 4 mg.l -1 )were added to the induction medium to test the initiation of callus in combinations withplant-growth regulators BAP (0; 0,2; 0,5 mg.l -1 ), NAA (0; 0,5; 1 mg.l -1 ) and KIN (0, 1, 2mg.l -1 ). The pH was adjusted to 5,8 with KOH, prior to adding the agar, and the mediumwas autoclaved. Mature embryos were incubated on the medium at 28 °C in darkness.After 3 weeks in culture on induction medium, the percentages of embryos producingprimary calli were determined, and the primary calli were subcultured. The subculturemedium contained N6 basal salts and N6 vitamins (Chu et al., 1975), 20 g.l -1 sucrose, 2mg.l -1 2,4-D, 25 mM proline, 1 g.l -1 casein hydrolysate and 3 g.l -1 gelrite.Results and discussionCallus initiation from mature embryos was observed within 7 days. The inductionfrequency of primary callus ranged from 23,8% to 60% depending on the 2,4-Dconcentrations. Two types of callus were formed. One type has been represented by soft,watery, brown non-embryonic callus, the other one appeared as compact, friable, lightyelloworganogenic callus. The organogenic callus regenerated roots and shoots. Thefrequency of callus formation varied depending on the combinations of applied plantgrowth regulators 2,4-D with BAP. Concentration of BAP in medium resulted in a305

AGRISAFE Budapest, Hungary, 2011decrease in callus. 2,4-D alone stimulated the formation of callus better (2 mg.l -1 2,4-Dfor A18 and 1 mg.l -1 2,4-D for A19) than in combination with BAP. The combinations1 mg.l -1 2,4-D and 0,5 mg.l -1 NAA were the most effective out of all tested, with thehighest frequency of callus formation for both genotypes (47,6% for A18 and 58,7% forA19). The combinations of 1 mg.l -1 2,4-D and 2 mg.l -1 KIN was the most effective, withthe highest frequency of callus formation, but only for genotype A18. For genotype A19concentration of KIN in medium resulted in a decrease in callus. 2,4-D alone stimulatedthe formation of callus better than in combination with KIN. Initiation of callus washigher for genotype A18 than for genotype A19. We found that adding plant growthregulators to the medium generally promoted plant regeneration. Immature embryoshave been frequently used as an explant source in maize tissue culture, but it is usuallydifficult to obtain immature embryos throughout the year and their suitable stage forculture is also strictly limited. This is in contrast to the ready availability and abundanceof mature embryos from seeds. Auxins and cytokinins are the most important factors forregulation growth and morphogenesis in plant tissue and organ cultures. Previous studieshave shown that 2,4-D is an important factor in the initiation and proliferation of primaryand embryogenic callus from immature embryos of maize (Carvalho et al. 1997). Theoptimum 2,4-D concentration for the initiation of embryogenic callus was 1 mg.l -1 . Highconcentration of 2,4-D reduced the percentage of embryogenic callus formed suggestingthat 2,4-D had inhibitory effect. Although many methods have been developed forgeneration of plants in maize callus cultures, the frequency of regenerated plants is stillrelatively low.Table 1. Effects of 2,4-D and BAP on callus induction from mature embryo of maize genotype A18Plant growth regulators and concentrations (mg.l -1 )2,4D BAPCallus Shoot Root0 21 (35%) 12 (20%) 2 (3,3%)1 0,2 29 (48,3%) 13 (21,7%) 1 (1,7%)0,5 23 (38,3%) 13 (21,7%) 6 (10%)0 36 (60%) 13 (21,7%) 3 (5%)2 0,2 26 (43,3%) 11 (18,3%) 3 (5%)0,5 26 (43,3%) 14 (23,3%) 1 (1,7%)0 32 (53,3%) 20 (33,3%) 4 (6,7%)4 0,2 25 (41,7%) 20 (33,3%) 2 (3,3%)0,5 21 (35%) 13 (21,7%) 5 (8,3%)Table 2. Effects of 2,4-D and NAA on callus callus induction from mature embryo of maize genotype A18Plant growth regulators and concentrations (mg.l -1 )2,4D NAACallus Shoot Root0 29 (46%) 19 (30,2%) 7 (11,1%)1 0,5 30 (47,6%) 16 (25,4%) 6 (9,5%)1 27 (42,8) 22 (34,9%) 8 (12,7%)0 28 (44,4%) 19 (30,2%) 10 (15,9%)2 0,5 26 (41,3%) 9 (14,3%) 3 (4,8%)1 28 (44,4%) 14 (22,2%) 10 (15,9%)0 28 (44,4%) 18 (28,6%) 7 (11,1%)4 0,5 28 (44,4%) 17 (26,9%) 5 (7,9%)1 27 (42,8%) 6 (9,5%) 1 (1,59%)306

Budapest, Hungary, 2011AGRISAFETable 3. Effects of 2,4-D and KIN on callus callus induction from mature embryo of maize genotype A18Plant growth regulators and concentrations (mg.l -1 )2,4D KINCallus Shoot Root0 25 (39,7%) 4 (6,3%) 01 1 22 (34,9%) 4 (6,3%) 1 (1,6%)2 28 (44,4%) 6 (9,5%) 00 21 (33,3%) 20 (31,7%) 3 (4,8%)2 1 30 (47,6%) 14 (22,2%) 1 (1,6%)2 29 (46%) 20 (31,7%) 2 (3,2%)0 21 (33,3%) 8 (12,7%) 3 (4,8%)4 1 22 (34,9%) 3 (4,8%) 02 23 (36,5%) 2 (3,2%) 0ConclusionsOn the basis of the results and discussion, a protocol to initiate callus from matureembryos of the specific maize genotypes was developed. The induction of callus frommature embryos was successful on N6 medium supplemented with various concentrationof 2.4-D and with combinations of plant-growth regulators BAP, NAA and KIN.AcknowledgementsThis paper was financially supported by the grant VEGA 2/0114/09 and APVV-0115-07.ReferencesBarnabás, B., Orosz, A., Obert, B., Kovács, G. (1998) Comparison of anther culture characteristics andspontaneous genome doubling in androgenic plants using maize (Zea mays L.) hybrids with varying DHline parentage. Acta Agron Hung 43: 217–224Carvalho, C.H.S., Bohorova, N.E, Bordallo, P.N, Abreu, L.L, Vaicentle, F.H, Bressan, W., Paiva,E. (1997):Type II callus production and plant regeneration in tropical maize genotypes. Plant Cell rep., 17, 73 – 76.Conger, B.V., Novak, F.J., Afza, R., Erdelsky, K.E. (1987). Somatic embryogenesis from cultured leafsegments of Zea mays L. Plant Cell Reports, 6, 345 – 347.Dudits, D., Bőgre, L., Győrgyey, J. (1991): Molecular and cellular approaches to the analysis of plant embryodevelopment from somatic cells in vitro. J. Cell Sci. 99, 475 – 484.Chu, C.C., Wang, C.C, Sun, C.S., Hus, C., Yin, K.C, Chu, C.Y., Bi, F.Y. (1975).: Establishment of an efficientmedium for anther culture of rice through comparative experiments on the nitrogen sources. Scienta Sinic.,Proc. Symp. Plant Tissue Cult., 18, 659.Green, C.E., Phillips, R.L. (1975): Plant regeneration from tissue culture of maize. Crop Sci., 15, 417 – 421.Lee, M., Phillips, R.L. (1987): Genomic rearrengements induced by tissue culture. Genome, 29, 122 – 128.Lu, C., Vasil, I.K., Ozias-Akins, P. (1982). Somatic embyrogenesis in Zea mays L. Theoretical and AppliedGenetics, 62, 109 – 112.Obert, B., Preťová, A., Šamaj, J. (2010): Somatic and gametic embryogenesis in maize: Cell biology andapplications. Kumar, A., Sopory, S.K. (eds) Applictions of plant Biotechnology I.K. InternationalPublishing House Pvt. Ltd. ISBN: 9789380026939, pp. 468-481Rhodes, C.A., Green, C.E., Phillips, R.L. (1986): Factors affecting tissue culture initiation from maize tassels.Plant Sciences, 46, 225 – 232.Ting, Y.C. , Yu, M., Zheng, W.Z. (1981): Improved anther culture of maize. Plant Science, 23, 139 – 145.Vasil, V., Vasil, I.K., LU, C. (1984). Somatic embryogenesis in longterm callus cultures of Zea mays L.(Gramineae). American Journal of Botany, 71, 158 – 161.307

AGRISAFE Budapest, Hungary, 2011EFFECT OF CULTIVAR AND CLIMATE ON WHEATPRODUCTIVITY UNDER DIFFERENT ENVIRONMENTS INBULGARIAK. KOSTOV 1 – G. RACHOVSKA 2 – K. KUZMOVA 3 – Z. YR 31 Dobrudzha Agricultural Institute, General Toshevo, BG 9520, Bulgaria, e-mail: kostovdzi@abv.bg2 Institute for Introduction and Plant Genetic Resources K.Malkov, Sadovo, Bulgaria3 Agricultural University, Plovdiv, BulgariaAbstract The investigation was carried out in 2006–2008 on twenty-seven common wheat cultivars at fourlocations in Bulgaria: Dobrich, Selanovtsy, Radnevo and Ognyanovo, which belong to four different climaticregions. The main indices of wheat productivity were monitored: absolute weight, number of productive tillers,duration of growth and grain yield. Simultaneously the agro-meteorological conditions during the main stagesof wheat development were recorded: autumn growth, relative winter dormancy, spring and summer growth.Air temperature and rainfall sums were considered as the main climatic factors. The comparative analysis ofthe agro-meteorological conditions by year and region showed that 2007 was very hot and dry, but wasnevertheless very humid during wheat maturation. This affected the end product, i.e. grain yield, which was 45% lower than the yield obtained in 2008. Dispersion analysis (ANOVA) was performed to determine the effectof meteorological conditions at the respective locations. Regardless of the cultivar and the climatic region, apositive correlation was found between yield and the amount of rainfall, which, however, was expressed to adifferent degree at each location and at different stages of wheat growth.Key words: wheat, productivity properties, agro-meteorological conditions, climate, climatic changesIntroductionThe main purpose of each breeding program in wheat is developing highly productivevarieties. It has been shown that yield is an index controlled by a complex polygenicsystem, which is strongly affected by the growing conditions (Rachovska et al., 2003;Kostov et al., 2010). The recent climatic changes due to the general global warmingconsiderably affect the grain yield from common winter wheat (Alexandrov, 2002;Kuzmova, 2009). Slavov and Moteva (2005) estimated that as a result from the climaticchanges on the territory of Bulgaria common winter wheat production will significantlydecrease during the next century and yields will drop down with about 17 %.The aim of this investigation was to study the effect of some climatic elements and of thecultivar on the productivity of some main Bulgarian wheat cultivars.Materials and methodsThe investigation was carried out during 2006/08 with 27 main common winter wheatcultivars included in the official varietal list of Bulgaria, which were divided into groupsaccording to their grain quality: 7 cultivars were of high quality wheat 1 Grade, 12 werewith very good quality 2 Grade, 4 were of moderate quality 3 Grade, and 4 were highlyproductive with low quality. The cultivars were tested for grain yield at the regionalstations of the national Executive Agency of Variety Testing, Field Inspection and SeedControl (IASAS), within the post-registration field testing of cultivars.The respective locations were situated in four different soil-and-climatic regions ofBulgaria, as follows: location Dobrich – north-eastern Bulgaria; location Selanovtsy –north-western Bulgaria; location Ognyanovo – central southern Bulgaria; locationRadnevo – south-eastern Bulgaria.To determine the effect of the cultivar and the year, two-factor dispersion analysis wasperformed (Lydansky, 1988). Air temperature and amount of rainfalls were consideredmain factors of climate and served as a basis for calculating the main agro-climatic308

Budapest, Hungary, 2011AGRISAFEindices. The hydrothermal coefficient (HTC), a complex index of temperature andmoisture conditions of the environment, was used for evaluation of the moisturizingconditions (Selyaninov cited by Kuzmova, 2003). To find out the correlations betweenthe respective parameters, correlation and regression analyses were done (Lydansky,1988).The statistical significance of variations was determined by calculating the coefficient ofcorrelation significance (t) (Zapryanov, Marinkov, 1978).Results and discussionThe results from the dispersion analyses showed significant variations between both thegenotypes and the year (Table 1).The genotype x environment interaction was significant, i.e. the ranking of cultivars byyield changed according to the year conditions.Table 1. Dispersion analysis of grain yield variation(27 common wheat cultivars investigated during 2006 – 2008).№ SOURCE OFSQ df SVARIATIONF кр.F оп.P 0,05η 2 %1. General 11536737,81 323 - - -2. Genotypes 2277485,06 26 87595,57 14,6529 1,54 19,743. Environments 6091348,37 2 3045674,19 509,47 3,03 52,794. Interaction 1715242,12 52 32985,42 5,51 1,39 14,865. Errors 1452662,25 243 5978,03 - - -The data on the grain yield from the investigated 27 common wheat cultivars dividedinto groups according to their grain quality are given in Table 2.Table 2. Grain yield from divided into quality groups Bulgarian wheat cultivars (t/ha), 2006 – 2008Grain quality YearLocationgroupDobrich Selanovtsy Radnevo OgnyanovoMean2006 9,38 8,09 6,30 6,18 7,46High quality 2007 6,55 4,32 3,43 5,40 4,92wheat, 1 Grade 2008 8,25 6,37 7,37 8,80 7,69mean 8,05** 6,26 ns 5,69** 6,79 ns 6,69Very good qualitywheat, 2 GradeModerate qualitywheat, 3 GradeHigh-productivity,low quality wheatSignificance: P-5% (*), P-1% (**), P-0,1%(***)2006 9,13 8,22 6,14 6,65 7,532007 6,39 3,97 3,89 5,13 4,842008 8,36 6,64 7,43 8,83 7,81mean 7,96 ** 6,28*** 5,82** 6,86 ns 6,732006 9,93 8,61 7,12 7,04 8,172007 6,31 2,99 4,42 5,49 4,802008 9,06 7,71 7,13 9,60 8,37mean 8,42** 6,44* 6,23* 7,38 ns 7,142006 9,86 8,51 6,77 6,57 7,922007 7,15 3,43 4,42 5,74 5,182008 9,28 7,14 7,17 9,98 8,39mean 8,76** 6,35* 6,12* 7,43 ns 7,16The performed correlation and regression analyses indicated that, on the whole, theamount of rainfalls in April (i.e. before heading) was the factor determining the highproductivity of the investigated common winter wheat cultivars. The mathematicalcorrelation obtained was highly significant and was represented by a first degreeequation (Figure 1). Its correlation coefficient was comparatively high (r=0.7099). Withthe increase of rainfalls up to 60 l/m 2 , grain yields from wheat considerably increasedtoo, reaching an average of 8.08 t/ha; if this limit is exceeded, however, yields dropdown.309

AGRISAFE Budapest, Hungary, 2011Figure 1. Relation between grain yield and sum of April rainfallsy = -0.0379x2 + 7.3995x + 500.1212.00R 2 = 0.50410.008.00yield, t/ha 6.004.002.000.000.00 50.00 100.00 150.00sum of precipitation April, mmThere was a narrow correlation and regression with the hydrothermal coefficient (HTC)for April as well, which is a complex index of temperature and humidity (Figure 2).These correlations, however, had different expressions at the different locations. InSelanovtsy a determining factor for maximum productivity of the investigated cultivarswas the complex index HTC for the period April – May (r = 0.7515) (Figure 3), buttemperatures (mean, maximum and minimum) and the amount of rainfalls during Apriland May were both decisive for the expression of all indices (r>0.95). Radically oppositewere the results obtained at location Dobrich, where the determining factor for grainyield was the complex index HTC during the entire period from April to June (r =0.8250), but the mean and minimum air temperatures in May and the precipitationduring this month were also decisive (r > 0.95). In Radnevo HTC for April – May wasalso determining for grain yield, but the influence of air temperature was insignificant.The determining factor was the amount of rainfalls during April – May (r > 0.95).In location Ognyanovo HTC for April – May was also the determining factor for grainyield (R 2 = 0.860) but the rainfalls were not a limiting factor for yield there. The airtemperature in April was the decisive factor (mean, minimum and maximum), (R 2 =0.6837), as well as the maximum temperatures in May during the grain filling stage ofwheat development (R 2 = 0.8094).Figure 2. Relation of grain yield with hydrothermal coefficient (HTC) for April12.0010.008.00yield, t/ha6.004.002.00y = 125.68x + 550.21R 2 = 0.47440.000.00 1.00 2.00 3.00 4.00Hydrothermal coefficient (HTC), AprilTable 3 presents data on the wheat cultivars of highest productivity divided into qualitygroups.The following cultivars demonstrated highest and stable productivity regardless of thelocation and the quality group to which they belonged: Todora, Gea 1, Aglika, Petya,Kristal, Slaveya, Katya and Iveta.310

Budapest, Hungary, 2011AGRISAFE№ CultivarHigh quality wheat, 1 GradeTable 3. Common winter wheat cultivars of high productivity (t/ha)LocationDobrich Selanovtsy Radnevo OgnyanovoMean1. Aglika 8.73 6.69 6.18 7.44 7.262. Iveta 8.53 6.45 5.85 7.30 7.03Mean 8,05 6,26 5,69 6,79 6,69Very good quality wheat, 2 Grade1. Slaveya 8.80 6.50 6.00 7.09 7.102. Katya 7.84 6.33 6.37 7.65 7.05Mean 7,96 6,28 5,82 6,86 6,73Moderate quality wheat, 3 Grade1. Gea 1 8.76 7.07 6.20 7.34 7.342. Petya 8.38 6.18 6.35 7.64 7.25Mean 8,42 6,44 6,23 7,38 7,14High-productivity, low quality wheat1. Todora 8.80 6.57 6.96 7.91 7.562. Kristal 8.73 6.25 6.16 7.37 7.13Mean 8,76 6,35 6,12 7,43ConclusionsThe following conclusions can be drawn on the basis of the investigation carried out:The year (η 2 = 52.79 %) and the genotype (η 2 = 19.74 %) had a significant effect on theformation of grain yield from the common winter wheat cultivars; Common winterwheat realized most fully its production potential under the conditions of the Easternclimatic region of the Danubian plane in Bulgaria; On the whole, the determining factorfor high productivity of the investigated common winter wheat cultivars was the amountof rainfalls in April; The following cultivars demonstrated highest and stableproductivity: Todora, Gea 1, Aglika, Petya, Kristal, Slaveya, Katya and Iveta; they canbe included in the varietal structure of wheat related to the breeding purpose of the enduseproduct.ReferencesAlexandrov V., (2002): Climatic changes on the Balkan Peninsula. Ecology and Future, 2(4), 26-30 (inBulgarian).Kostov K., E.Penchev, G.Rachovska, V.Dochev, (2010): Study on the effects of the genotypes x environmentalinteraction of new Bulgarian wheat varieties. 8 th IWS –June 1-4, 2010, St. Petersburg, Russia. Pp. 379.Kuzmova K., (2003): Agrometeorology, Agrarian University of Plovdiv Academy Press (in Bulgarian).Kuzmova K., (2009): Effect of climatic changes on the agricultural production in the Republic of Bulgaria.Climate, ecology and agriculture of Eurasia (Proceedings of the International Workshop on the 75 thanniversary of Irkutsk State Agricultural Academy, 25 th – 29 th May 2009, Irkutks, Russia) 38 – 46 (inRussian).Lydansky, T. (1988): Statistical methods in biology and agriculture, Sofia, Zemizdat, p. 375(in Bulgarian) .Rachovska G., Bozhinov B., D. Dimova, (2003): Evaluation of mutant common winter wheat lines for grainand stability. Proceedings of the 120 th anniversary of agriculture studies in Sadovo, vol. III, 64-67 (inBulgarian).Slavov N., M. Moteva, (2005): On some characteristics of drought in South Bulgaria. Breeding andagrotechnology of field crops, part II, 369 – 373 (in Bulgarian).Zapryanov, Z., E. Marinkov, (1978): Field trials with biometry, Plovdiv, H. G. Danov, p. 248 (in Bulgarian) .311

AGRISAFE Budapest, Hungary, 2011ROLE OF LIGHT IN THE DEVELOPMENT OF FREEZINGTOLERANCE IN WHEATI. MAJLÁTH 1 – G. SZALAI 1 – V. SOÓS 1 – E. SEBESTYÉN 1 – E. BALÁZS 1 –R. VANKOVÁ 2 – P. DOBREV 2 – I. TARI 3 – J. TANDORI J 1 – T. JANDA 11 Agricultural Research Institute of the Hungarian Academy of Sciences, H-2462, Martonvásár, POB 19.,Hungary e-mail: jandat@mail.mgki.hu2 Institute of Experimental Botany AS CR, Rozvojová 263, 165 02 Prague 6, Czech Republic3 Department of Plant Biology, University of Szeged, 6701, Szeged, POB 654, HungaryAbstract Frost tolerance is the result of a wide range of physical and biochemical processes that allowfunctioning at low temperatures. Even in frost-tolerant genotypes a certain period of growth at low, but nonfreezingtemperature, known as frost hardening, is required for the development of frost hardiness, although ithas been shown that keeping plants at normal growth temperature with high light intensity may also increasedthe freezing tolerance. Frost hardening at low temperature under low light conditions is much less effectivethan under normal light conditions. The effectiveness of hardening, either at low temperature under low lightconditions or at non-hardening growth temperature with elevated light, is more pronounced in plants thatpossess a higher level of freezing tolerance, indicating that there is a correlation between the freezing toleranceacquired after hardening at low temperature and that induced by elevated light. The aim of the present workwas to discover what other changes in the regulatory processes were responsible for the light-enhancedfreezing tolerance of wheat plants.Key words: cold hardening, frost tolerance, plant hormones, signal transduction, Triticum aestivum L.IntroductionLow temperature is one of the most important factors that limits the growth anddistribution of plants. It is well known that even in frost-tolerant species, particularly inwheat plants, a certain period of growth at low, but non-freezing temperature, known asfrost hardening, is required for the development of frost hardiness. In wheat plants thiscold acclimation includes changes in a wide range of physical and biochemical processesthat allow functioning at low temperatures. It was shown in winter rye and wheat plantsthat frost hardening under low light conditions was much less effective than undernormal light conditions (Gray et al., 1997; Apostol et al., 2006). A certain level offreezing tolerance could also be induced by high light treatment without lowtemperature. It was also shown that the induction of certain cold-stimulated genes inwheat is correlated with the relative reduction state of Photosystem 2 rather than withgrowth temperature or growth irradiance per se (Gray et al., 1997). The exact mechanismof the contribution of light during the hardening period to the enhanced freezingtolerance of cereals is still poorly understood. Using wheat genotypes with differentlevels of frost tolerance, answers were found to the following questions: 1. Can onlywinter genotypes be frost-hardened with elevated light at non-hardening temperature? 2.If not, how does the “normal freezing tolerance” acquired after hardening under lowtemperature and natural light conditions correlate with the freezing tolerance induced by“dark cold” or elevated light at non-hardening temperature. Besides demonstrating thepositive influence of high light intensity during growth on the freezing tolerance ofwheat, the aim of the present work was to discover what physiological and biochemicalchanges were responsible for the enhanced freezing tolerance when hardening takesplace in the light.Materials and methodsSeeds of wheat plants (Triticum aestivum L.) were germinated in wet filter paper for 3312

Budapest, Hungary, 2011AGRISAFEdays, then sown in plastic pots containing loamy soil and sand, 3:1 (v:v). The plantswere grown for 10 d in a growth chamber with a 16 h/8 h light/dark period, at 20/18°C(day/night) with 75% relative humidity and 250 mol m -2 s -1 (control, normal light)photosynthetic photon flux density (PPFD) at the leaf level. Low temperature hardeningwas carried out at a constant 5°C either under the light conditions of normal growth(light-hardened plants) or at 20 mol m -2 s -1 PPFD (low light-hardened plants). For thehigh light intensity treatment the PPFD was approx. 500 mol m -2 s -1 . The measurementswere carried out after the 12th day of hardening. The fatty acid composition, the salicylicacid content, and the antioxidant enzyme activities were determined as described earlier(Janda et al., 2007). The glutathione-S-transferase activity and the poliamine contentwere measured according to Szalai et al., (2009). The microarray analysis was carriedout using an Agilent 4X44K Wheat Chip. Levels of abscisic acid and indole-3-aceticacid were determined using two-dimensional HPLC according to Dobrev et al. (2005).For visualization of NO an in situ dyeing method was applied (Kolbert et al., 2008). TheACC and MACC contents were determined according to Tari and Nagy (1994).Results and discussionIt has been shown that not only winter varieties, but also spring wheat genotypes can befrost hardened by growing them under elevated light conditions (Szalai et al., 2009).Using wheat genotypes with different levels of frost tolerance, it was shown, that theeffectiveness of hardening either at low temperature under low light conditions or atnon-hardening growth temperature with elevated light is more pronounced in plants witha higher level of freezing tolerance, indicating that there is a correlation between thefreezing tolerance acquired after hardening at low temperature and that induced byelevated light (Figure 1).LonaMv 4Mv EmeseNadroFigure 1. Freezing survival of winter wheat (Mv 4 and Mv Emese) and spring wheat (Lona and Nadro)varieties after 1 day freezing in the dark at -10 °C. Before freezing plants were grown for 12 days at 20/18°C atelevated light intensity (500 mol m -2 s -1 ).Using the thermoluminescence technique and measurements of P700 relaxation kineticsit has been shown that growth at low, hardening temperatures in the light increased therate of cyclic photosynthetic electron transport, which may contribute to the higher frosttolerance observed after low temperature hardening in the light (Apostol et al., 2006). Inthe next set of experiments the lipid composition, the antioxidant activity, and the313

AGRISAFE Budapest, Hungary, 2011salicylic acid content were investigated during frost hardening in winter wheat MvEmese. The saturation level of hexadecanoic acid decreased not only in plants hardenedat low temperature, but also, to a lesser extent, in plants kept under high light irradiationat normal growth temperature (Janda et al., 2007). Growth at low temperature may alsocause an excessive excitation of the electron transport systems, possibly leading to anincrease in the concentration of reactive oxygen species (ROS). If the plants are not ableto control the intracellular ROS level, the membrane lipids, proteins and nucleic acidsmay suffer damage leading to the death of the cells. Low temperature hardening mayinduce the activity of certain antioxidant enzymes (Janda et al., 2003). Several studieshave been conducted on changes in the antioxidant activity in plants under stressconditions. However, only a few data are available on changes in the antioxidant activityduring cold hardening and very little is known about its role in the development of frosttolerance and the endogenous signals controlling these processes. The greatest inductionof the enzymes glutathione reductase and ascorbate peroxidase occurred when the coldtreatment was carried out in normal light, but high light intensity at normal, nonhardeningtemperature also increased the activity of these enzymes. The catalase activitywas also higher in plants grown at high light intensity than in the controls. The greatestlevel of induction in the activity of the guaiacol peroxidase enzyme occurred under coldconditions with low light (Janda et al., 2007). Salicylic acid is an endogenous signalmolecule, which may play a role in plant responses to various kinds of stresses (Horváthet al., 2007). Exogenous salicylic acid has been successfully applied to increase coldtolerance of plants as it was demonstrated in maize (Janda et al., 1999) or wheat plants(Tasgin et al., 2003). The bound ortho-hydroxy-cinnamic acid, a putative precursor ofsalicylic acid, increased by up to two orders of magnitude in plants that were coldhardened in normal light. Both high light intensity and low temperature hardeningcaused an increase in the free and bound salicylic acid content of the leaves. Thisincrease was most pronounced in plants that were cold treated in normal light (Janda etal., 2007). Changes in the polyamine contents during low temperature hardening showedmarked light dependence; however, these changes differed in the spring and winterwheat plants. The putrescine content showed a substantial increase in the winter wheatMv Emese and a significant decrease in the spring wheat Nadro when cold hardeningwas carried out at under normal light conditions. The spermidine content did not changeat low temperature in the dark, but increased in the light in both genotypes. Thespermine content only increased in the spring wheat Nadro after low temperaturehardening in the light or in the dark. The hardening-induced increase in the cadaverinecontent was most pronounced in Nadro plants trated at high light intensity, and in MvEmese plants cold hardened in the light (Szalai et al., 2009). Low temperature hardeninginduced a similar level of glutathione-S-transferase activity in both the winter wheat MvEmese and the spring wheat Nadro; however, this induction was more pronounced in thelight than in the dark (Szalai et al., 2009). Microarray and RT-PCR analyses showed thatthe light intensity during the hardening period significantly affected the expression ofseveral genes that may have a role in the development of frost hardiness in wheat plants.In order to obtain more information about regulatory processes during the cold hardeningperiod, changes in the levels of plant hormones were also investigated. While theabscisic acid level was lower in cold-hardened plants in both winter and spring varietiesthan in the control, unhardened plants irrespective of the light intensity, changes in thelevels of plant growth regulator cytokinins, the signal transducer NO, the ethylene314

Budapest, Hungary, 2011AGRISAFEprecursor ACC and proline showed a strong dependence on light and variety. The resultssuggest that temperature and light regulate the development of frost hardiness in acomplex way.ConclusionsDuring the frost hardening of wheat plants light intensity is a key factor in thedevelopment of frost tolerance, and several processes, including lipid metabolism,antioxidant activity, polyamine synthesis, and hormone-related processes may alsocontribute to enhanced freezing tolerance. The results suggest that there are at least twotype of receptors, one cold- and one light-dependent, which induce signal transductionprocesses leading to freezing tolerance.AcknowledgementsThis work was supported by grants from EU-FP7-REGPOT 2007-1 (AGRISAFE No.203288) and the National Scientific Research Fund (OTKA K75584).ReferencesApostol, S., Szalai, G., Sujbert, L., Popova, L.P., Janda, T. (2006): Non-invasive monitoring of the lightinducedcyclic photosynthetic electron flow during cold hardening in wheat leaves. Z. Naturforsch., 61c,734-740.Dobrev, PI, Havlicek L, Vagner M, Malbeck J, Kaminek M (2005): Purification and determination of planthormones auxin and abscisic acid using solid phase extraction and two-dimensional high performanceliquid chromatography. J. Chrom. A, 1075, 159-166.Gray, G.R., Chauvin, L-P, Sarhan, F., Huner, N.P.A. (1997): Cold acclimation and freezing tolerance. Acomplex interaction of light and temperature. Plant Physiol., 114, 467-474.Horváth, E., Szalai, G., Janda, T. (2007): Induction of abiotic stress tolerance by salicylic acid signaling. J.Plant Growth Regul., 26, 290-300.Janda, T., Szalai, G., Tari, I., Páldi, E. (1999): Hydroponic treatment with salicylic acid decreases the effects ofchilling injury in maize (Zea mays L.) plants. Planta, 208, 175-180.Janda, T., Szalai, G., Rios-Gonzalez, K., Veisz, O., Páldi, E. (2003): Comparative study of frost tolerance andantioxidant activity in cereals. Plant Sci., 164, 301-306.Janda, T., Szalai, G., Leskó, K., Yordanova, R., Apostol, S., Popova, L.P. (2007): Factors contributing toenhanced freezing tolerance in wheat during frost hardening in the light. Phytochemistry, 68, 1674-1682.Kolbert, Zs., Bartha, B., Erdei, L. (2008): Osmotic stress- and indol-3-butyric acid-induced NO generations arepartially distinct processes in root growth and development in Pisum sativum L. Physiol. Plant., 133, 406-416.Szalai, G., Pap, M., Janda, T. (2009): Light-induced frost tolerance differs in winter and spring wheat plants. J.Plant Physiol., 166, 1826-1831.Tari, I., Nagy, M. (1994): Enhancement of extractable ethylene at light/dark transition in primary leaves ofpaclobutrazol-treated Phaseolus vulgaris seedlings. Physiol. Plant., 90, 353-357.Tasgin, E., Atici, Ö., Nalbantoglu, B. (2003): Effects of salicylic acid and cold on freezing tolerance in winterwheat leaves. Plant Growth Regul., 41, 231–236.315

AGRISAFE Budapest, Hungary, 2011IMPORTANCE OF SOIL WATER CONTENT TO CORN (ZEAMAYS L.) PRODUCTION FOR SEEDM. MARKOVIĆ 1 – J. ŠOŠTARIĆ 1 – M. JOSIPOVIĆ 2 – H. PLAVŠIĆ 2 –R. TEODOROVIĆ 31 Department for Plant Production, Agricultural Faculty in Osijek, Universety of J. J. Strossmayer in Osijek,Trg Sv. Trojstva 3, 31 000 Osijek, Croatia, Monika.Markovic@pfos.hr2 Department of Agricultural Technics and Melioration, Agricultural Institute in Osijek, J. predgrađe 17, 31 000Osijek, Croatia3 HANA d.o.o., Sokolska 49, 31 500 Našice, CroatiaAbstract Four-year research (2006-2009) was set up in the trial fields of the Agricultural Institute in Osijekusing the split-split method with three replications. Irrigation was the main factor, which was applied asfollows: A1 – control variant, in which the plants were rain-fed, A2 – soil water content was kept between 60%and 80% field water capacity (FWC) and A3 – 80% to 100 % FWC. Nitrogen (N) fertilization was the subfactorand was applied as follows: B1 – control variant without nitrogen (N) fertilizer, B2 – 100 kg N ha -1 , B3 –200 kg N ha -1 . The hybrid was the third or sub-sub-factor. Four genotypes were tested: C1 = OSSK 596; C2 =OSSK 617; C3 = OSSK 602; C4 = OSSK 552, all created at the Agricultural Institute in Osijek and allbelonging to a similar vegetation group, from the end of FAO 500 to the beginning of FAO 600. The climateconditions were quite different in all four years of research with two (2007 and 2009) years unfavourable formaize production. The yield of maize grain for seed production varied in all the tested years and mostlydepended on the available water content and nitrogen fertilizer.Key words: irrigation, soli water content, maize, yieldIntroductionMore than half (65.3%) plant production in Croatia goes to cereal production (CentralBureau of Statistics, 2010). As highly represented cereal on arable lands in Croatia,maize covers 298 929 ha (average from year 2006 to 2009) of sown surfaces. Averageyield in four years of research (2006-2009) was 6.7 t ha -1 (6.5 (2006); 4.5 (2007); 8(2008); 7.4 (2009). Those yield variation among years according to Kovačević et al.(2007; 2009) mostly depends on weather conditions, mean air temperatures and amountof precipitations. According to Dóka and Pepo (2007) annual yield fluctuation isprimarily determined by the soil moisture content in the month July and the watersupplies in May. According to several authors maize yield is mostly influenced byavailable amount of water and nitrogen (N) fertilizer (Josipović et al., 2010; Josipović etal., 2007; Dóka and Pepo, 2007; Dağdelen et al., 2008). Minimum yield was obtained byapplying the lowest amount of irrigation water (Josipović et al., 2010; Josipović et al.,2007; Khan et al. 2001). Water is required for nutrient utilization (Dóka and Pepo,2007). When fertilizer is applied to an unsaturated soil, wilting may occur under thiscondition. On the other hand, when there is excess soil water, applied fertilizer may beleached out of the root zon (Quaye et al., 2009). Dry periods reduce nutritientavailability in soil (Kàdàr, 2007). Maize is a crop sensitive to appropriate nutrient andwater supply. Optimum water supply is especially important in periods critical for thegrowth, development and yield formation of maize (Pépo et al., 2008). Aim of this studywas to evaluate the importance of available soil water content, irrigation practice andresistant to drought to achieve high yield of maize grain and avoid water stress.Materials and methodsFour years research (2006-2009) has been set up as split split-plot method in treerepetitions at trial fields of Agricultural institute in Osijek. Irrigation treatment was in316

Budapest, Hungary, 2011AGRISAFEmain plot, while N fertilization in second, and maize hybrids in third plot. Soil type ontrial fields of Agricultural institute is eutric cambisol (Soil Survey Division Staff, 1993),silt clay loam texture, shallow gley, pH in KCl from 6.5 to 6.9, P 2 O 5 content is from 22.6to 26.4 mg per 100 grams of soil, K 2 O content is from 30.4 to 36.5 mg per 100 grams ofsoil. Planned plant density was 58 309 plants ha -1 (spacing between rows 70 cm anddistance in the row 24.5 cm). Irrigation regime includes three different variant asfollows: A1- control variant without applied water, plant where having water fromnatural precipitations; A2 – variant of irrigation in which soil water content wheremaintained from 60% to 80% field water capacity (FWC), and A3 – variant of irrigationwhere the soil water content was kept at highest level from 80% to 100% FWC. Maizehybrids where sprinkler irrigated with “Typhon” linear move system. Soil water contentwas measured by method of gypsum blocks which were set up at two soil depth, at 15cm and 25 cm. Water content was measured every second day with “Watermark” sensorwho works on the principal of electrical conductivity of moist gypsum. Electricalconductivity strongly depends on the water tension. Four maize hybrids where testedwith similar vegetation group (end of FAO 500 and beginning of FAO 600) created atAgricultural Institute in Osijek: C1 = OSSK 596; C2 = OSSK 617; C3 = OSSK 602; C4= OSSK 552. For the analysis of the weather conditions, dates from Osijek WeatherBureau have been used (2010). Analysis of variance, an ANOVA was carried out withthe General Linear Model (GLM) Statistical Software Package (SAS, 2003) procedure.Weather conditions in four years of research where quite different regarding climateconditions with two (2007 and 2009) dry years with unfavourable weather characteristicsfor maize production.Table 1. Distribution of irrigation water regimeYear N 2006 mm N 2007 mm N 2008 mm N 2009 mmA2 2 80 3 120 2 80 4 200A3 3 120 5 200 3 120 6 240A2 – 60% to 100% FWC; A3 – 80% to 100% FWC; n = number of irrigationtreatments, mm=amount of irrigation waterAll four vegetation seasons (2006-2009) where characterised by mean air temperatures(2006-18.9 o C; 2007-19.7 o C; 2008-19.3 o C; 2009-20 o C ) above the 30-year average(17.5 o C), while amount of precipitation where below 30-year (368.3 mm) average inyears 2007 (301.7 mm) and 2009 (230.8 mm). Water content in soil was reduced in dryperiods parallel with the increasing of the temperatures and the reduction ofprecipitation. Therefore it was necessary to irrigate.Results and discussionAverage yield of maize grain influenced by irrigation treatment (A), interaction ofirrigation and N fertilizer (AxB) and interaction of irrigation treatment and genotype(AxC) as well are presented in Table 2. Irrigation treatment had statistically verysignificant (

AGRISAFE Budapest, Hungary, 2011water. This results is comparable to previously study of Dağdelen et al., 2008; Josipovićet al., 2010; Josipović et al. 2007; Khan et al. 2001; Yang et al., 1993. The highest yieldwas measured in year 2007 (10 778 kg ha -1 ) and 2009 (11 657 kg ha -1 ) at A3 (80% to100% FWC) variant of irrigation, although those two years where characterised as dryyears with unfavourable weather conditions for maize production. Irrigation treatmenthad reduced water deficit at both level of irrigation (A2 and A3)Table 2. Impact of irrigation practice (A), interaction of irrigation and N fertilization (AxB) and interaction ofirrigation genotype (AxC) to yield of maize grain (t ha -1 )Year 06 07 08 09 X Year 06 07 08 09 XA1 8.5 8.4 8.2 10.3 8.88 A1C1 8.1 7.6 8.2 9.5 8.4A2 9.3 9.2 8.9 10.6 9.48 A1C2 8.6 9.2 8.3 10.6 9.2A3 9.6 10.7 9.2 11.6 10.3 A1C3 9.2 8.5 7.6 10.9 9.1A1B1 7.3 8.0 7.1 9.4 7.97 A1C4 8.2 8.3 8.7 10.3 8.9A1B2 9.0 8.0 8.5 10.2 8.94 A2C1 9.6 8.2 8.8 10.3 9.2A1B3 9.3 9.1 9.0 11.4 9.72 A2C2 9.4 9.6 8.8 10.8 9.6A2B1 8.6 8.9 7.7 9.3 8.65 A2C3 9.4 9.5 8.6 10.9 9.6A2B2 9.2 8.9 9.7 10.8 9.67 A2C4 8.6 9.2 9.4 10.3 9.4A2B3 9.9 9.6 9.4 11.6 10.1 A3C1 9.6 10.5 9.0 11.5 10.2A3B1 9.0 9.8 8.3 10.7 9.47 A3C2 9.7 11.1 9.5 11.8 10.5A3B2 9.2 10.8 9.5 11.7 10.3 A3C3 9.9 10.6 8.9 11.9 10.3A3B3 10.6 11.6 9.9 12.4 11.1 A3C4 9.2 10.8 9.4 11.4 10.2F-test values LSD test (A) A1=control; A2=60-80% FWC; A3=80-100%Year A AxB AxC 1% 5%2006 ** ** ** 214 1612007 ** ** ** 237 1782008 ** ** n.s. 208 1572009 ** ** ** 169 127FWC; B=control; B2=100 kg N ha -1 ; B3=200 kgN ha -1 ; C1=OSSK596; C2=OSSK617; C3=OSSK602; C4=OSSK 552; **=

Budapest, Hungary, 2011AGRISAFEresearch. Interaction of irrigation treatment 80-100% FWC (A3) and 200 kg N ha -1 (B3)resulted with yield increasing as follows: 31.15% (2006), 30% (2007), 28.78% (2008)and 24.34% (2009). Meaning that with each N level, yield increased as soil watercontent increased. Results are comparable to results of Quaye et al. (2009) who reportsthat maize response to the applied nitrogen was influenced by availability of water in thesoil, and that the application of fertilizer can be done when soil water content is close tofiled capacity. Dóka and Pépo (2007) revealed in their results great influence atfertilization on the yield surpluses of maize at every irrigation treatment. Interaction ofirrigation practice (A) and genotype (C) was statistically very significant (

AGRISAFE Budapest, Hungary, 2011STUDY ON THE PARAMETERS OF THE YIELD – IRRIGATIONRELATIONSHIP IN APPLEA. MATEV 1 – M. GOSPODINOVA 21 Agricultural University, Plovdiv, Bulgaria, e-mail: sa6_m@abv.bg2 Fruit Growing Institute, Plovdiv, BulgariaAbstract The field experiment was carried out from 1980–1982 in the region of Plovdiv. The aim was to studythe relationship “Yield-water” in particular “Yield-irrigation depth”. The variants in the experiment wereirrigation with 0.6, 0.8, 1.0 and 1.2 of calculated evapotranspiration and a control variant without irrigation.The methods of Davidov and Varlev were used and the results showed that both methods gave very goodresults and could be used in practice. The curves approximated the experimental data with high accuracy andR>0.9.Key words: evapotranspiration, irrigation, yield, water deficit, apple.IntroductionYield – irrigation relationship is a private case of yield – water relationship and it wasstudied in a big number of the field crops and in some vegetable crops. On that basis thefollowing statements have been formulated: 1) In most cases (over 80%) the results ofthe experiments on the relative yield – irrigation rate relationship were averaged withfully satisfactory precision (R 2 = 0,86 – 0,99) by a square equation (Varlev et al., 1999,2008); 2) According to Davidov (1982) the yield – irrigation rate relationship wasexpressed more precisely by a function with a variable exponent, which depended on thecharacteristics of the crop and the year.The aim of the present research was to establish the parameters of yield – irrigation raterelationship in apple grown in the region of Plovdiv.Materials and methodsExperimental data of a field trial with apple were used for establishing the relationship.The experiment was carried out in the period 1980 – 1982 in a palmette apple orchard inthe region of Plovdiv (the territory of Brestnik village). Redgold cultivar was used, thetrees being grafted on M106 rootstock. The planting distance was 4,5 х 3,5 m. The soilin the region is alluvial-delluvial, medium to heavy sandy-clayey, possessing a goodwater-retention capacity.The experiment included variants with compensation of different percentages of thecalculated evapotranspiration, as follows: 1) non-irrigated; 2) 0,6 ЕТ; 3) 0,8 ET; 4) 1,0ET; 5) 1,2 ET. As a result of that, different irrigation rates were maintained in each ofthe tested variants. Water consumption was calculated by the bioclimatic method, thevalues of the coefficient Z being valid for Plovdiv region and they were establishedexperimentally in previous studies (Dochev, 1979).Additional irrigations were applied at the beginning of vegetation for reaching the waterholding capacity in the active soil layer. The first irrigation was applied at 20 mm waterdeficit of the layer 0 – 60 cm. The calculated irrigation rates were corrected by areduction coefficient according to the crown diameter of the experimental trees.Irrigation was done during the whole vegetation, including during flowering andharvesting. Yield – irrigation rate relationship was established in two directions:Total yield – irrigation rate relationship, which can be presented in the following twoways: 1) By a regression analysis of the experimental data Y = – ax 2 +bx+c, where, Y isthe relative yield and с – the relative yield without irrigation; 2) By the second-degree320

Budapest, Hungary, 2011AGRISAFEequation of Varlev: Y = Yc + (1 – Yc)(2x – x 2 ), where Yc is the relative yield withoutirrigation and х – the relative irrigation rate; 3) By the degree equation of Davidov(1982): Y = 1 – (1 - Yc)(1 – x) n , where n is the exponent.Additional yield – irrigation rate relationship, by the degree equation of Davidov (1982):Y = 1 – (1 – x) n , where Y is the relative yield, х – the relative irrigation rate and n – theexponent.Results and discussionThe parameters of yield – irrigation relationship were significantly influenced by theyear. Concerning precipitations, the years 1980 and 1982 were average (Р = 47 and 56%, respectively), the former being moderately cool and the latter – average withprobability of Р = 77 and 48 %. The second year was humid (Р = 85 %) and as for the airtemperatures – average (Р = 63 %).Year198019811982Table 1. Yields and irrigation rates by variants and by yearsIrrigation rateAdditionalRelativeYieldRelativeVariantkg.da -1 yieldadditionalkg.da -1 yieldmm M/MoyieldNon-irrigated – 0.000 1728.6 0.0 0.614 0.0000.6ET 105.3 0.500 2870.4 1141.8 1.019 1.0500.8ET 140.4 0.667 2737.5 1008.9 0.972 0.9281.0ЕТ 175.4 0.833 3245.0 1516.4 1.153 1.3951.2ЕТ 210.6 1.000 2815.6 1087.0 1.000 1.000Non-irrigated – 0.000 1991.8 0.0 0.454 0.0000.6ЕТ 174.6 0.500 3780.1 1788.3 0.861 0.7450.8ЕТ 232.9 0.667 3472.6 1480.8 0.791 0.6171.0ЕТ 291.0 0.833 4270.7 2278.9 0.972 0.9501.2ЕТ 349.2 1.000 4391.5 2399.7 1.000 1.000Non-irrigated – 0.000 1511.2 0.0 0.412 0.0000.6ЕТ 166.5 0.500 3072.0 1560.8 0.837 0.7230.8ЕТ 222.1 0.667 4070.4 2559.2 1.109 1.1851.0ЕТ 277.1 0.833 4096.0 2584.8 1.116 1.1971.2ЕТ 333.1 1.000 3670.4 2159.2 1.000 1.000The source data for establishing the parameters of the relationship were summarized inTable 1. On the basis of the calculations made by the respective formulas, curves wereobtained approximating the experimental points. The final results about the relationshipvalid under the conditions of the experiment were presented in Table 2, while Figures 1– 4 showed the precision, with which the respective formula averaged the experimentalpoints.Figures 1 and 2 presented the total yield – irrigation rate relationship by regressionanalysis of the experimental data and by Varlev’s equation, respectively. Concerning theprecision with which the respective curves averaged the experimental data, it wasslightly higher in the regression analysis, the maximum of the calculated yield in the firstand in the third year being obtained at 80 – 85 % of the maximum irrigation rate. In fact,however, those rates corresponded to compensating the biologically optimal 100 %water consumption of the crop. The experimental data were also calculated with highprecision by the second-degree relationship of Varlev and according to it in all the threeyears of the experiment the maximum yield was obtained at the highest irrigation rate.The curves by years, calculated by the degree formula of Davidov, showed a goodprecision (R>0,94) and clearly differed from those calculated by regression and by321

AGRISAFE Budapest, Hungary, 2011Varlev’s equation. Despite that, again the maximum yield was obtained in the variantwith 100 % compensation of ET and the yield did not decrease with additional increaseof the rate up to 120 % of ET.Fig. 1Fig. 3Fig. 5Fig. 7Table 2. Parameters of yield – irrigation rate relationshipTotal yield – irrigation rate by years1980 Y = – 0.7104x 2 + 1.1308x + 0.6125 R 2 = 0.9021981 Y = – 0.2782x 2 + 0.8135x + 0.4603 R 2 = 0.9341982 Y = – 0.8748x 2 + 1.5271x + 0.3964 R 2 = 0.932Total yield – irrigation rate by the second-degree equation of Varlev1980Yc = 0.614 R = 0.8651981 Y = Yc + (1 – Yc)(2x – x 2 )Yc = 0.454 R = 0.9391982 Yc = 0.412 R = 0.926Total yield – irrigation rate by the degree equation of Davidov1980Yc = 0.614 n = 2.9 R = 0.9441981Y = 1 – (1 - Yc)(1 – x) n Yc = 0.454 n = 1.4 R = 0.9651982 Yc = 0.412 n = 2.6 R = 0.958Additional yield – irrigation rate by the equation of Davidov1980n = 3.77 R = 0.9161981Y = 1 – (1 – x) n n = 1.37 R = 0.9641982 n = 2.83 R = 0.940relative yield1.21.11.00.90.80.70.60.50.40.30.20.1198019821981experimental data 1980experimental data 1981experimental data 19820.00.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0relative irrigation rateFigure 1. Yield-irrigation rate – squire relationshiprelative yield1.21.11.00.90.80.70.60.50.40.30.20.1198119801982experimental data - 1980experimental data - 1981experimental data - 19820.00.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0relative irrigation rateFigure 2. Yield-irrigation rate – squire relationshipby Varlev’s equationThe best way of evaluating the effect of irrigation is to use the additional yield –irrigation rate relationship. It could be established by the degree equation of Davidov andwhen changing the exponent the calculated data could reach the maximum precision forthe experimental conditions. Figure 4 illustrate graphically the relationship by thatformula by years.322

Budapest, Hungary, 2011AGRISAFErelative yield1.21.11.00.90.80.70.60.50.40.30.20.10.0198219801981experimental data - 1980experimental data - 1981experimental data - 19820.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0relative irrigation raterelative additional yield1.41.31.21.11.00.90.80.70.60.50.40.30.20.10.0198019821981experimental data - 1980experimental data - 1981experimental data - 19820.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0relative irrigation rateFigure 3. Yield-irrigation rate – by degree equationof DavidovFigure 4. Additional yield-irrigation rate – bydegree equation of DavidovConclusionsUnder the conditions of the experiment the three formulas used expressed with almostequal precision the total yield – irrigation rate relationship. A similarity was observedbetween the curves of the relationship, calculated by regression analysis, and those,calculated by the degree formula of Davidov. The latter enabled reaching the maximumprecision of the calculations thanks to the variable exponent (n = 1.4÷2.9). Varlev’sequation also showed a high calculation precision (R>0.86) but the effect of thecharacteristics of the year on the course of the curves was less expressed.For evaluating the effect of irrigation, it is recommended to use the additional yield –irrigation rate relationship. It could be established by the degree formula of Davidov at n= 1.37÷3.77 (by years, n = 2.5 – in average for the period and n = 2.2 when averaging allthe experimental data in total, R>0.91).ReferencesDavidov, D. (1982): On yield-water relationship. Hydroengineering and Meliorations, Part VII.Davidov, D., St. Gajdarova (1994): Computer programme for calculating crop yields with and withoutirrigation for a series for past years. 17 th European Regional Conference on Irrigation and DrainageICID–CIID, Varna, Bulgaria, 1, 255–260.Dochev, D. (1979): Studies on irrigation of apple. VІІ. Parameters of the irrigation regime of fruiting palmetteorchards of Richer red cultivar. Horticultural and Viticultural Science, Part 7.Varlev I. (2008): Potential, efficiency and risk in maize production in Bulgaria, Sofia.Varlev, I., Z. Popova (1999): Water – evapotranspiration – yields. Sofia.323

AGRISAFE Budapest, Hungary, 2011ENZYME POLYMORPHISM OF SEVEN ENZYME SYSTEMSIN MAIZE (ZEA MAYS L.) SEEDLINGS UNDER HIGHCADMIUM ION CONCENTRATIONSP. MÚDRY 1 – B. OBERT 21 Department of Biology, Trnava University, Priemyselná 4, 91843, Trnava, Slovak Republic2 Institute of Plant Genetics and Biotechnology, Slovak Academy of Sciences, Akademická 2, 95007 Nitra,Slovak RepublicAbstract The effect of different concentrations of cadmium ions (0, 15, 60, 240 and 960 µmol.dm -3 ) on thepolymorphism of seven enzymes: acid phosphatase (ACP), alcohol dehydrogenase (ADH), isocitratedehydrogenase (IDH), malate dehydrogenase (MDH), 6-phosphogluconate dehydrogenase (PGD),phosphoglucoisomerase (PGI) and phosphoglucomutase (PGM) and their fifteen polymorphic loci, was studiedin the coleoptiles, leaf blades and the central parts of the primary root systems of 14-day-old seedlings in twoself-pollinated maize lines and their single crosses. Analyses of enzyme polymorphism showed that thebiological material was homogeneous. The self-pollinated lines had homozygous constitution in each analysedlocus and the hybrid had three loci (Acp1: 2/4, Idh2: 4/6 and Pgd1: 2/3.8) with heterozygous constitution.Cadmium ions negatively influenced seedling growth and development. A cadmium concentration of 960µmol.dm -3 was toxic and stopped the further growth and development of maize seedlings after five days ofcultivation. The enzyme fingerprint analysis of selected enzymes confirmed their genotypic, organ andontogenetic stability under high doses of cadmium ions. According to the results this group of enzymes did notexpress changes in polymorphism after treatment with cadmium ions and thus cannot play a bioindicative rolein this respect.Key words: maize (Zea mays L.), cadmium concentrations, self-pollinated lines, single cross, starch gelelectrophoresis, molecular markersIntroductionMaize (Zea mays L.) is one of the world most important crops, ranking third after wheatand rice. From this point of view the research of xenobiotics, mainly the group of socalled“heavy metals” as Cd, Pb, Hg, Ni, Zn, Cu and other ones on plant production is ofhigh importance. Cadmium is a non-essential element in plants (Verkleij and Schat,1990) which has been recognized as one of the most potentially hazardous of all metalpollutants since it is extremely toxic to plants, animals and humans (Cieslinski et al.,1996).The changes of enzyme activities induced by Cd concentrations in early stages of maizedevelopment were widely studied (Lagriffoul et al., 1998; Široká et al., 2004; Chaffai etal., 2006) on the other side, the attention to biochemical and ecophysiological role andthe meaning of multiplicity of key enzymes of bioenergetic pathways are studied verypoorly.Our research is oriented to study the effect of cadmium ions on maize seedlings. Themain aim of the present study is to reveal effects of different cadmium ionconcentrations on enzyme polymorphism of seven chosen enzyme systems - acidphosphatase, alcohol dehydrogenase, isocitrate dehydrogenase, malate dehydrogenase,6-phosphogluconate dehydrogenase, phosphoglucoisomerase and phosphoglucomutasein different maize organs and evaluate possible changes of enzyme polymorphism asbioindicators of high cadmium concentrations.Materials and methodsIn our experiments we used two self-pollinated maize (Zea mays L.) lines 3098 (♀),3150 (♂) and their single cross (Sc 3098 x 3150) of Slovak provenience (SempolHolding Inc., Trnava).324

Budapest, Hungary, 2011AGRISAFEMaize seeds were surface sterilized with 10% H 2 O 2 for 20 min, rinsed many times withtap water (Chaffai et al., 2006), germinated and grown in thermostat for fourteen days onwet filter paper in Petri dishes under dark at 25 °C and 98% RH. Experimental variantswere represented by seedlings cultivated in 12.5 ml of full Hoagland solution with andwithout of addition of cadmium in form of Cd (NO 3 ) 2 .4H 2 0. Concentrations of cadmiumin experimental solutions were 0, 15, 60, 240, and 960 µmol. dm -3 . The samples wererepresented by one coleoptilar section (11 mm long) after five days of maize graingermination, fully developed leaf lamina and central part of primary root system afterfourteen days of cultivation from each variant.The standard technique (for coleoptilar section) of horizontal starch gel electrophoresisdescribed by Stuber with co-workers (Stuber et al., 1988) and recently published in ourworks (Múdry and Juráček , 2001; Múdry and Kraic, 2007; Uváčková et al., 2008) wasused for analysis of polymorphism in acid phosphatase (ACP, E.C. 3.1.3.2), alcoholdehydrogenase (ADH, E.C. 1.1.1.1), isocitrate dehydrogenase (IDH, E.C. 1.1.1.42),malate dehydrogenase (MDH, E.C. 1.1.1.37), 6-phosphogluconate dehydrogenase (PGD,E.C. 1.1.1.44), phosphoglucoisomerase (PGI, E.C. 5.3.1.9) and phosphoglucomutase(PGM, E.C. 2.7.5.1).Results and discussionFrom our visual evaluation of maize seedlings the toxicity of cadmium ions treatmentsnegatively influenced organ growth and development. At the highest concentration afterfive days of cultivation growth and development of seedlings were stopped and rootbrowning as well and leaf red-brownish discolouration were observed (Figure 1)similarly as published by Arduini et al., (1994). Our observation confirms fact that maizebelongs to plant species very sensitive to higher concentrations of Cd than naturallyoccurring in Cd polluted soils (1 µmol.dm -3 ) and concentrations nearly 1 mmol.dm -3 Cdcauses acute stress (Sanita di Toppi and Gabrielli, 1999).Figure 1. Maize seedlings germinated at various concentrations of cadmium.The group of seven enzymes which were chosen for our experimental work representsthose which are very frequently used by many laboratories in the world for checkinggenotypic variability, identity and homogeneity of most of plant species. For thesepurposes mostly standardized methods for enzyme polymorphism analysis are used toavoid undesirable factors affecting the results.Results of the effects of cadmium ions on enzyme polymorphism are shown in Table 1.All experimental genotypes of maize were homogeneous on the basis of enzymepolymorphism, self-pollinated lines had homozygous constitution in each analysed locusand hybrid had three loci (Acp1: 2/4, Idh2: 4/6 and Pgd1: 2/3.8) with heterozygousconstitutions.325

AGRISAFE Budapest, Hungary, 2011Table 1. Enzyme polymorphism of three maize (Zea mays L.) genotype organs cultivated under differentconcentrations of cadmiumGenotype Days of germ. EzymesConcentr.Loci and allelesOrgan of Cd ACP ADH IDH MDH PGD PGI PGM(µmol.dm -3 ) Acp1 Adh1 Idh1 2 Mdh1 2 3 4 5 Mmm Pgd1 2 Pgi1 Pgm3098 (♀) 5 dayscoleoptile 0 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 4coleoptile 15 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 4coleoptile 60 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 4coleoptile 240 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 4coleoptile 960 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 43150 (♂) 5 dayscoleoptile 0 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4coleoptile 15 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4coleoptile 60 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4coleoptile 240 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4coleoptile 960 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4Sc 3098x 3150 5 dayscoleoptile 0 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4coleoptile 15 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4coleoptile 60 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4coleoptile 240 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4coleoptile 960 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 43098 (♀) 14 daysleaf lamina 0 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 4leaf lamina 15 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 4leaf lamina 60 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 4leaf lamina 240 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 43150 (♂) 14 daysleaf lamina 0 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4leaf lamina 15 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4leaf lamina 60 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4leaf lamina 240 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4Sc 3098 x 3150 14 daysleaf lamina 0 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4leaf lamina 15 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4leaf lamina 60 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4leaf lamina 240 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 43098 (♀) 14 daysroot system 0 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 4root system 15 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 4root system 60 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 4root system 240 2 4 4 6 6 3 16 12 12 M 3.8 5 4 9 43150 (♂) 14 daysroot system 0 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4root system 15 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4root system 60 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4root system 240 4 4 4 4 6 3 16 12 12 M 2 5 4 9 4Sc 3098 x 3150 14 daysroot system 0 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4root system 15 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4root system 60 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4root system 240 2/4 4 4 4/6 6 3 16 12 12 M 2/3.8 5 4 9 4The coincidence of constitutions in all analysed loci responsible for enzymepolymorphism expression supported their genotypic, organ and ontogenetic stability at326

Budapest, Hungary, 2011AGRISAFEhigh doses of cadmium ions. According to our results this group of enzymes did not playthe bioindicative role by means of changed polymorphism as response on highconcentrations of cadmium ions.ConclusionsOur experimental work confirmed that cadmium is an element strongly phytotoxic withnegative impact on maize plants growth and development. The obtained results suggestclearly that ions of cadmium had no effect on enzyme polymorphism in analyzedenzyme loci and hence the enzyme polymorphism in analyzed organs also showedontogenetic stability in our experiments.AcknowledgementsThis paper was financially supported by the projects VEGA1/3489/06, VEGA 2/0109/09and VEGA 2/0114/09.ReferencesArduini, I., Godbold, D., Onnis, A. (1994): Cadmium and copper change root growth and morphology ofPinus pinea and Pinus piaster seedlings. In Physiologia Plantarum, 92 (4), 675-680Chaffai, R., Tekitek, A., El Ferjani, E. (2006): A comparative study on the organic acid content and exudationin maize (Zea mays L.) seedlings under conditions of copper and cadmium stress. In Asian Journal ofPlant Sciences vol. 5 (4), 598-606Cieslinski, G., Van Rees, K.C.J., Huang, P.M., Kozak, L.M., Rostad, H.P.W., Knott, D.R. (1996): Cadmiumuptake and bioaccumulation in selected cultivars of durum wheat and flax as affected by soil type. In Plantand Soil, 182 (1) 115–124Lagriffoul, A., Mocquot, B., Mench, M., Vangronsveld, J. (1998): Cadmium toxicity effects on growth,mineral and chlorophyll contents, and activities of stress related enzymes in young maize plants (Zea maysL.). In: Plant and Soil, 200 (2), 241-250Múdry, P., Juráček, Ľ. (2001): Modifikovaná štandardizovaná metodika analýzy polymorfizmu jedenástichdruhov enzýmov – molekulárnych značkovačov kukurice siatej (Zea mays L.). In: Biotechnologickémetódy v šľachtení rastlín BIOS 2001. Zborník referátov zo VII. vedeckej konferencie s medzinárodnouúčasťou Nitra, Slovakia: SPU, Nitra, pp. 68-73. ISBN 80-7137-915-8Múdry, P., Kraic, J. (2007): Inter- and intra-population variation of local maize (Zea mays L.) populations fromSlovakia and Czech republic. In Czech Journal of Genetics and Plant Breeding, 43 (4), 7-15Sanita di Toppi, L., Gabrielli, R. (1999): Response to cadmium in higher plants. In EnvironmentalExperimental Botany, 41, 105-130Stuber, C.W., Wendel, J.F., Goodman, M.M., Smith, J.S.C. (1988): Techniques and scoring procedures forstarch gel electrophoresis of enzymes from maize (Zea mays L.). Technical Bulletin 286 North Carolina,USA: North Carolina Agricultural Research Service, North Carolina State University, Raleigh, pp. 1-87Široká, B., Huttová, J., Tamás, L., Šimonovičová, M., Mistrík, I. (2004): Effect of cadmium on hydrolyticenzymes in maize root and coleoptile. In Biologia (Bratislava), 59, 513-517Uváčková, Ľ., Múdry, P., Obert, B., Preťová, A. (2008): Enzyme fingerprint analyses in tissue regeneratedfrom anther culture of maize. In Acta Physiologiae Plantarum,. 30, 779-785Verkleij, J.A.C., Schat, H. (1990): Mechanisms of metal tolerance in higher plants In: Shaw, A.J. (Ed.) Heavymetal tolerance in plants: Evolutionary aspects. Boca Raton, USA: Boca Raton CRC Press, pp. 179-194327

AGRISAFE Budapest, Hungary, 2011EFFECTS OF CADMIUM AND SALICYLIC ACID TREATMENTIN MAIZEM. PÁL – T. JANDA – G. SZALAIAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungarypalmagda@mail.mgki.huAbstract The heavy metal pollution of the soil is a serious problem nowadays. One of the most toxic heavymetals, cadmium (Cd), causes several physiological changes in plants, such as growth and photosynthesisinhibition, changes in the water and ion metabolism and in enzyme activity, and the formation of free radicals.Maize is the third most important crop in the world, so the changes induced by Cd in maize plants are a causefor concern. The examination of compounds capable of enhancing plant stress tolerance is of great importance.Salicylic acid (SA), as a signal molecule, has a role in defence mechanisms against pathogen attack, and alsoprovides protection against certain abiotic stresses. The effect of 0.5 mM SA on Cd-induced stress wasinvestigated in young maize plants. The F/Fm’ chlorophyll-a fluorescence induction parameter decreased inplants treated with 0.5 mM Cd, indicating the damaging effect of Cd. When Cd and SA were appliedsimultaneously, the damage was less pronounced. It was also found that SA treatment inhibited Cd uptake inthe roots. However, SA pre-treatment itself also caused oxidative stress and induced damage in the roots. Sowhen the SA treatment was applied before the Cd stress, it accelerated the damaging effect. It was found thatthe leaves and roots of maize plants gave different responses to Cd treatments. While Cd induced oxidativestress in the leaves, no oxidative stress could be observed in the roots. It was established that the ratio ofunsaturated fatty acids with longer carbon chains increased accompanied by a reduction in the amount ofsaturated fatty acids with shorter carbon chains, especially at lower Cd concentrations, particularly in themembrane fractions of the roots. The effect of Cd treatment on the content of Cys-rich peptides, namelycysteine, -glutamyl-cysteine (-EC), glutathione (GSH) and phytochelatin (PCs), differed in the leaves androots. Cd caused an increase in the in vitro phytochelatin synthase (PCS) activity in the leaves, while in theroots the in vitro PCS activity decreased. Due to Cd stress, the glutathione reductase (GR) and guaiacolperoxidase (POD) enzymes were activated in the leaves. However, the induction of antioxidant enzymes couldnot be observed in the roots. It was found that Cd increased the levels of free and bound forms of benzoic acid(BA), ortho-hydroxycinnamic acid (o-HCA) and SA in the leaves. In the roots, only the 50 µM rate of Cdcaused changes in the free o-HCA acid and bound BA content.Key words: cadmium, maize, oxidative stress, phytochelatin, salicylic acidIntroductionIn plants cadmium is one of the most readily absorbed and most rapidly translocatedheavy metals, which explains why it exerts such strong toxicity even at relatively lowconcentrations (Seregin and Ivanov, 1998). Cadmium interferes with many cellularfunctions and causes many toxic symptoms such as the inhibition of growth andphotosynthesis, the activation or inhibition of enzymes, disturbances in the plant waterrelationships and ion metabolism, and the formation of free radicals, with subsequentmembrane damage due to lipid peroxidation (Pál et al., 2006a). In an analogous mannerto general stress theory, mechanisms leading to heavy metal tolerance can be dividedinto two groups: avoidance strategies and tolerance strategies. Avoidance mechanismslimit the uptake of heavy metals, thus excluding them from plant tissues. Plants withtolerance mechanisms are capable of accumulating, storing and immobilising heavymetals by binding them to amino acids, proteins or peptides. Plants synthesiseantioxidant enzymes and molecules, such as GSH or PCs, that may prevent heavy metalinducedcellular damage (Sanità di Toppi and Gabbrielli 1999). During the last few yearspolyamines (Pas) have also been reported to be efficient antioxidants and it wassuggested that they function as metal chelators (Liu et al., 2007). GSH, as an importantcomponent of the ascorbate-glutathione cycle, plays a role in protecting plants fromoxidative stress. In the biosynthesis of GSH, the first reaction leads to the formation of -328

Budapest, Hungary, 2011AGRISAFEEC from glutamate and cysteine, after which GSH is synthesized by the ligation of -ECand glycine. GSH is also a precursor of a group of heavy metal-binding peptides, thePCs synthesized by PCS (Grill et al., 1989). SA, which may act as a component of thesignal transduction system important in defence mechanisms against pathogen attack(Hayat et al., 2010), may also provide protection against certain abiotic stresses, as wasshown for example in the case of chilling damage in maize (Janda et al., 1999).Exogenous SA confers heavy metal tolerance, and heavy metal stress was found toenhance the SA content in Cassia tora and in barley (Yang et al., 2003, Metwally et al.,2003). It is a well-known fact that the quantity of unsaturated fatty acids in themembranes usually increases as the temperature declines, and in many cases the degreeof unsaturation of the membrane lipids is correlated with cold tolerance (Nishida andMurata, 1996). Membrane unsaturation has been shown to be closely related to heavymetal tolerance in a number of plants (Maksymiec, 1997).The aim of the present work was to discuss the effect of SA treatment on Cd stress, andfurthermore to summarize the effects of exposure to high Cd concentrations in maizeseedlings grown in hydroponic cultures.Materials and methodsZea mays L. (hybrid Norma) seedlings were grown for 10 days in hydroponic solution ina Conviron PGR-15 plant growth chamber under the conditions described by Pál et al.(2005). In the 1 st experiment the plants were divided into five groups plus a control. Thefirst group was treated with 0.5 mM Cd(NO 3 ) 2 for 1 day before processing (1d Cd). Inthe second treatment 0.5 mM SA was added at the same time as the Cd, and the plantswere again processed after 1 day (1dSA-Cd). The third group of plants was treated withSA for 1 day, then the roots were rinsed and Cd was added to the nutrient solution for 1day (1d SA+1dCd). The 4 th and 5 th groups were treated with SA alone for 1 day, afterwhich the 4 th group was processed immediately (1d SA) and the 5 th group was grown fora further day in SA-free solution before processing (1d SA+0). In the 2 nd experiment 10,25 or 50 M Cd(NO 3 ) 2 was added to the nutrient solution for 7d, after which the plantswere processed. The Cd content and the root viability were measured as described by Pálet al. (2002). The chlorophyll fluorescence was determined using a pulse amplitudemodulated fluorometer (PAM-2000, Walz, Effeltrich, Germany) as described by Janda etal. (1994). The total chlorophyll content was measured on the third leaves using aSPAD-502 chlorophyll meter (Minolta Camera Co., Ltd, Japan). The enzyme activitieswere measured as described by Janda et al. (2000). The in vitro PCS activity and in vivoPC2 level and the contents of thiols and Pas were measured as described by Pál et al.(2006b). SA and its putative precursors, benzoic acid (BA) and ortho-coumaric acid(oHCA), were measured according to Pál et al. (2005). The lipids were extracted and theGC-SIM-MS analysis of fatty acid methyl esters was carried out according to the methodof Pál et al. (2007).Results and discussionCd is usually accumulated in the roots, but it is also translocated into the shoots. The Cdcontent of the roots was significantly lower in plants which were pre-treated with SA for1d before Cd treatment, or when SA and Cd were applied together. Root viabilitydecreased drastically after 1d SA or Cd treatment. When both SA and Cd were applied(either together, or consecutively), the decrease was even more pronounced. Cd329

AGRISAFE Budapest, Hungary, 2011decreased the F/Fm’ chlorophyll-a fluorescence induction parameter, which was onlyslightly affected when Cd was applied simultaneously with SA. SA alone (1d SA) didnot cause any change after 1 day, but after a second day (1d SA+0) the F/Fm’parameter decreased. The most dramatic changes occurred when the 1d SA treatmentwas followed by 1d Cd treatment. The PC2 level in the roots only increased in the 1d Cdtreatment. The PCS activity in the roots decreased after all the treatments. SA causedgreater inhibition in the activity after a second day than after 1 day, both when it wasapplied alone and when it was followed by 1d of Cd stress. SA and Cd treatment, eithertogether or consecutively, caused a greater decrease in the activity than Cd treatmentalone. The PC2 level in the leaves increased in the 1d SA+0 treatment and also when SAwas added with Cd (1dSA-Cd) or was followed by Cd (1dSA+1dCd). The PCS activityincreased during the treatments, especially in the case of the 1dSA-Cd treatment,compared to the control (Pál et al., 2002).In earlier work it was found that 7 days of 10, 25 or 50 M Cd treatment induced stressresponses (decreased chlorophyll content, increased malondialdehyde content, increasedactivity of glutathione reductase and guaiacol peroxidase) in the leaves of maizeseedlings, but not in the roots (Pál et al., 2005). The fatty acid composition ofphosphatidyl glyceride and phosphatidyl ethanolamine changed in the leaves and that ofmonogalactosyl diacylglyceride, phosphatidyl glyceride, phosphatidyl ethanolamine anddigalactosyl-diacylglyceride in the roots during 7 days of Cd treatment. It wasestablished that the ratio of unsaturated fatty acids with a longer carbon chain increased,accompanied by a reduction in that of saturated fatty acids with a shorter carbon chain.This was followed by a rise in the double bond index and the unsaturation rate,especially after Cd treatment at lower concentrations (Pál et al., 2007). It was alsodemonstrated that Cd induced the synthesis of phytochelatins (PC2) and polyamines(spermine and putrescine) in the roots. Although Cd treatment had little effect on thecysteine and GSH contents of the leaves, it significantly increased the concentration of -EC. In the roots, there was also a rise in the quantity of -EC, but the GSH contentdecreased drastically (Pál et al., 2006b). It was found that the control leaves initiallycontained little BA, SA or oHCA either in free or bound form. Higher cadmiumconcentrations triggered an approximately 3-fold accumulation of free and conjugatedBA and SA, with a higher amount in the bound form. The accumulation of free andbound oHCA was also observed in Cd-treated leaves. Among the phenolic compoundsthe highest accumulation was found in the case of bound oHCA in the leaves, where theincrease was 5-fold. Although the free oHCA content increased and the bound BAcontent decreased in response to 50 M Cd in the roots, Cd had little effect on the freeand bound SA concentration (Pál et al., 2005).ConclusionsThe present results show that SA treatment inhibits Cd uptake by the roots. However, italso decreases root viability, the PCS activity in the roots, and the F/Fm’ chlorophyll-afluorescence induction parameter, thus possibly accelerating the damaging effect of Cd.It was found that the leaves and roots of maize plants gave different responses to 10, 25and 50 M cadmium treatments. While Cd induced oxidative stress and activatedantioxidant enzymes in the leaves, no such oxidative stress could be observed in theroots. It can be concluded that Cd stress altered the lipid composition of maize plants,but exhibited different effects in the leaves and roots. These changes in the level of 18:3,330

Budapest, Hungary, 2011AGRISAFEDBI and unsaturation suggested that at smaller concentrations Cd may induce defenceresponses and increase membrane fluidity, but may cause damage at higherconcentrations. The increase in polyunsaturation may reflect an increase in membranefluidity, which may be responsible for the rapid absorption and translocation of cadmiumin maize. Alterations in the lipid composition are likely to be associated with the toxiceffects of Cd rather than defence mechanisms. Cd induced the synthesis of PCs and Pas,and also caused changes in the thiol content in the roots, which may contribute todefence mechanisms providing protection against heavy metal stress. Endogenous SAlevels in the leaves of maize seedlings were found to increase with the degree of Cdstress, which may be associated with the oxidative stress observed in the leaves of Cdstressedplants, suggesting a role for SA in the response of maize to cadmium. SinceoHCA has been demonstrated to have antioxidant properties (Foley et al., 1999), theseresults suggest that the increase in the oHCA content was induced independently of SAbiosynthesis, but may play a role in the antioxidative response to cadmium.AcknowledgementsThis work was supported by grants from EU-FP7-REGPOT 2007-1 (AGRISAFE No.203288) and the National Scientific Research Fund (OTKA K68158).ReferencesGrill, E., Loffler, S., Winnacker, E. L., Zenk, M. H. (1989): Phytochelatins, the heavy-metal-binding peptidesof plants, are synthesized from glutathione by a specific -glutamylcysteine dipeptidyl transpeptidase(phytochelatin synthase). Proc. Natl Acad. Sci. USA 86, 6838-6842.Hayat, Q., Hayat, S., Irfan, M, Ahmad, A. (2010): Effect of exogenous salicylic acid under changingenvironment: A review. Environ. Exp. Bot. 68, 14-25.Janda, T., Szalai, G., Antunovics, Z., Horváth, E., Páldi, E. (2000): Effect of benzoic acid and aspirin onchilling tolerance and photosynthesis in young maize plants. Maydica 45: 29-33Janda, T., Szalai, G., Tari, I., Páldi, E. (1999): Hydroponic treatment with salicylic acid decreases the effect ofchilling injury in maize (Zea mays L.) plants. Planta 208, 175-180.Liu, J.H., Kitashiba, H., Wang, J., Ban, Y., Moriguchi, T. (2007): Polyamines and their ability to provideenvironmental stress tolerance to plants. Plant Biotech. 24, 117-126.Maksymiec, W. (1997): Effect of copper on cellular processes in higher plants. Photosynthetica, 34, 321-342.Metwally, A., Finkemeier, I., Georgi, M., Dietz, K. J. (2003): Salicylic acid alleviates the cadmium toxicity inbarley seedlings. Plant Physiol. 132, 272-281.Nishida I., Murata N. (1996): Chilling sensitivity in plants and cyanobacteria: The crucial contribution ofmembrane lipids. Annu. Rev. Plant. Physiol. Plant Mol. Biol. 47, 541-568.Pál, M., Horváth, E., Janda, T., Páldi, E., Szalai, G. (2005): Cadmium stimulates the accumulation of salicylicacid and its putative precursors in maize (Zea mays L.) plants. Physiol. Plant., 125, 356-364.Pál, M., Horváth, E., Janda, T., Páldi, E., Szalai, G. (2006a): Physiological changes and defense mechanismsinduced by cadmium stress in maize. J. Plant Nutr. Soil Sci., 169, 239-246.Pál, M., Horváth, E., Janda, T., Páldi, E., Szalai, G. (2006b): The effect of cadmium stress on phytochelatin,thiol and polyamine content in maize. Cereal Res. Commun., 34, 65-68.Pál, M., Leskó, N., Janda, T., Páldi, E., Szalai, G. (2007): Cadmium-induced changes in the membrane lipidcomposition of maize plants. Cereal Res. Commun., 35, 1631-1642.Pál, M., Szalai, G., Horváth, E., Janda, T., Páldi, E. (2002): Effect of salicylic acid during heavy metal stress.Acta Biol. Szegediensis, 46,: 119-120.Seregin, I. V., Ivanov, V. B. (1998): The transport of cadmium and lead ions through root tissues. Russ. J.Plant Physiol. 45, 780-785.Yang, Z. M., Wang, J., Wang, S. H., Xu, L. L. (2003): Salicylic acid-induced aluminium tolerance bymodulation of citrate efflux from roots of Cassia tora L. Planta 217, 168-174.331

AGRISAFE Budapest, Hungary, 2011ASSESSMENT OF MYCOFLORA ON PLANT RESIDUES OFWINTER WHEAT (TRITICUM AESTIVUM)M. PASTIRČÁKCVRV Plant Production Research Institute, Bratislavská cesta 122, SK-92168 Piešťany, SlovakiaE-mail: uefemapa@hotmail.comAbstract The occurrence of microscopic fungi on plant residues of winter wheat (Triticum aestivum) wasmonitored in Slovakia. The mycoflora spectrum contained parasitic and saprophytic fungi. Abundant darkpigmentedpseudothecia were observed in dead leaf and stem tissue. Most of the fungal genera isolated fromwheat plant residues caused diseases of leaves and ears during the growing season. The major components ofthe leaf spot disease complex were two fungi: Pyrenophora tritici-repentis and Phaeosphaeria nodorum. Allthree species of the genus Septoria were found on wheat leaves. Only Septoria nodorum (teleomorphPhaeosphaeria nodorum) and S. avenae (teleomorph P. avenaria) occurred with high frequency on winterwheat ears and leaves. Pseudothecia of Mycosphaerella graminicola, the teleomorph of S. tritici, wereobserved on leaves. The species Gibberella zeae (anamorph Fusarium graminearum) was one of the mostfrequently occurring species of parasitic mycoflora. The group of fungal saprophytes, including Alternaria sp.,Cladosporium sp. and Epicoccum purpurascens, was also isolated. All the ascomycetous stages of these fungipersisted and spread from infested wheat plant residues from year to year.Key words: wheat diseases, Pyrenophora, Gibberella, plant residues, SlovakiaIntroductionLiving fungi exist on plant residues in a number of physiological states – activemycelium, dormant hyphae, various types of resting structures and spores. For thegeneral soil ecologist, the active mycelial state holds greatest interest; however, for manyworkers studying soil-borne pathogenic fungi, knowledge of the spore content of soiland of the biology of resting structures is also of great importance. Fungal plantpathogens are among the most important factors that cause serious losses to agriculturalproducts every year. A wide variety of techniques can be used to evaluate the presence,types, and activities of microbes as populations, communities, and parts of ecosystems.Many methods have been used to assessing the prevalence and severity of root diseases,e.g. by assigning roots to disease categories or giving numerical values (Salt, 1979).Direct microscopic examination of root segments or decomposition leaves has been usedeffectively by several research workers including Waid (1957), Parkinson and Kendrick(1960), and Dickinson and Maggs (1974). It is the only methods for recording obligateparasites that cannot be isolated on agar media and is also useful for recording other rootand stems parasites that have distinctive morphological features by which they can beidentified. Direct examination avoids the selective effects of nutrient agars and surfacesterilants but not all the fungi present can be recognized. The aim of our study was toinvestigate fungal abundance on winter wheat (Triticum aestivum) plant residues bydirect microscopic examination.Materials and methodsThe samples of plant residues of winter wheat (T. aestivum) naturally infected withmicroscopic fungi during growing seasons in 2006-2009 were collected at 40 selectedlocalities in Slovakia (Table 1). Fungi on the plant residues (leaves, stems, roots) wereviewed with a binocular microscope Olympus SZ61 and collected with a sterile needle.Fructification structures of fungi were examined microscopically (Olympus BX51) bymounting them in water or in lactophenol-cotton blue. Pathogenic fungi were determinedon the basis of macroscopic and microscopic characteristics with reference to standard332

Budapest, Hungary, 2011AGRISAFEtexts Domsch et al. (1980), Sivanesan (1984), Seifert (1995), and Kiffer and Morelet(2000). The fungi were photographically documented by digital camera Olympus SP-350. Representative materials have been deposited in the Mycological Herbarium ofPlant Production Research Institute in Piešťany, Slovakia.Results and discussionDirect microscopic examination was used to investigate fungal abundance on the plantresidues of winter wheat (T. aestivum) in Slovakia. Spectrum of mycoflora on wheatresidue tissues contains parasitic and saprophytic fungi. Wheat residue mycofloraconsisted primarily of Deuteromycetes and some Ascomycetes. During study period, 18genera and 20 species of fungi were identified (Table 1).The mycoflora on root system of winter wheat didn’t differ among studied localities. Attime of maturation several species of Periconia were most abundant and sterile brownfungi dominated in the fungal population. A number of other fungi as Alternariaalternata, Bipolaris sorokiniana, Drechslera sp. and sterile white mycelium were alsofound. In diseased stem tissues Pyrenophora tritici-repentis, Gibberella zeae,Gaeumannomyces graminis var. tritici, B. sorokiniana, Ophiobolus graminis, Pleosporasp., Colletotrichum sp., and Alternaria sp. were the most common. At the end of thegrowing seasons in the field, P. tritici-repentis was the predominant fungus (> 80%)observed on stems at the studied localities. This species was found at several localities indifferent stages of ascomata development. Tan spot of wheat, caused by P. triticirepentis,is the major leaf spot disease of winter wheat in Slovakia. The ascomata werealso found on discoloration glumes of the ears. The fungus produced black pin-headsizedfruiting structures (perithecia) on the wheat residues. Asexual spores (conidia ofDrechslera tritici-repentis) were found on the stubble and older leaf spots. Both kinds ofspores were carried by air currents to developing wheat plants in the same or nearbyfields. The species G. zeae (anamorph Fusarium graminearum) belongs to the mostcommonly occurring species of parasitic mycoflora. The perithecia were also found onstalks and ear glumes of wheat. Gaeumannomyces graminis var. tritici was found oncrown parts of stems with the 22.5% of occurrence. The fungus spreads from residues toroot-tips and cortical cells of root surface and from one root to the next by growth of‘runner hyphae’ through the soil.The analysis showed that in average 50% of leaves of winter wheat plant residues wereattacked by two leaf-fungal pathogens. The dominant fungi occurred on leaf residueswere Phaeosphaeria nodorum and Blumeria graminis. A number of other fungi as A.alternata, D. tritici-repentis, Didymella sp., Ascochyta sp., Phaeosphaeria sp.,Microdochium sp., and Colletotrichum sp. were found. The survey showed that theincidence of leaf spot diseases had the least similar mycoflora among studied localities.Septoria and/or Stagonospora diseases can be found in nearly every wheat field inSlovakia. Three species were found on leaf residues: Stagonospora nodorum(teleomorph P. nodorum), Septoria tritici (teleomorph Mycosphaerella graminicola) andStagonospora avenae f. sp. triticea (teleomorph P. avenaria f. sp. triticea). It affectsgermination of seeds and causes seedling blight on wheat (Brokenshire, 1975).In Slovakia, Stagonospora nodorum is most important foliar pathogen, but occasionallyS. tritici was found in some localities. According to Champion (1997), S. nodoruminfects seed and is seed-borne. It is known that these fungi survive on wheat and grassresidues (Shipton et al., 1971).333

AGRISAFE Budapest, Hungary, 2011Table 1. The occurrence of microscopic fungi on wheat plant residues in the SlovakiaMicroscopic fungi*Locality 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20Alekšince x x x x x x x xBratislava x x x x x x x xČachtice x x x x x x x xČaklov x x x x x xČečejovce x x x x x x x xČuňovo x x x x x x x x x x xDevínska Nová Ves x x x x x x xDrienovská Nová Ves x x x x x x x x x xJalšové x x x x x xJarovce x x x x x xKalnište x x x x x x xKapušany x x x x x xKluknava x x x x x x x x x x x x xKostoľany pod T. x x x x x x x x xKubov x x x x x x xKuková x x x x x x xLada x x x x x xLeopoldov x x x x x x x xLevoča x x x x x x xLúčka x x x x x x x x x x x xĽubotín x x x x x xMalý Šariš x x x x x x xOlcnava x x x x x x x xOponice x x x x x xOslany x x x x x x x xPetržalka x x x x x x xPodhorany x x x x x x x xRišňovce x x x x x x x xRusovce x x x x x x x xSečovce x x x x x xSpišská Belá x x x x x x x x xSpišské Tomášovce x x x x x x x x x x xŠtefánska Huta x x x x x x x x x x xTopoľčany x x x x x x x xVelčice x x x x x x x xVeľké Bielice x x x x x x x xVeľký Slávkov x x x x x x xVranov nad Topľou x x x x x x x x xZemplínska Teplica x x x x x x x xŽelezník x x x x x x*Microscopic fungi: 1 Alternaria alternata, 2 Ascochyta sp., 3 Bipolaris sorokiniana, 4 Blumeria graminis,5 Cladosporium cladosporioides, 6 Colletotrichum sp., 7 Didymella sp., 8 Drechslera tritici-repentis,9 Epicoccum purpurascens, 10 Gaeumannomyces graminis var. tritici, 11 Gibberella zeae, 12 Microdochiumsp., 13 Mycosphaerella graminicola, 14 Ophiobolus graminis, 15 Periconia sp., 16 Phaeosphaeria avenaria,17 Phaeosphaeria nodorum, 18 Phaeosphaeria sp., 19 Pleospora sp., 20 Pyrenophora tritici-repentis.At the end of the growing seasons in the field, G. zeae and P. tritici-repentis were thepredominant fungi (> 55%) observed on winter wheat ears at the studied localities. Thehigh frequency of records of these two fungi on ears is consistent with observations that334

Budapest, Hungary, 2011AGRISAFEthe pathogens are transmitted by infected seed. The species A. alternata, Cladosporiumcladosporioides and Epicoccum purpurascens belonging to common saprophyticmycoflora were found on wheat residues at all localities.ConclusionsThe number of fungi inhabiting plant residues greatly exceeds that of fungi causingmajor diseases but little is known of their activities. There is sufficient evidence tosuggest that the role of minor pathogens in mixed infections is an inviting field for moreresearch, linking biological control of major pathogens on the one hand and diseasecomplexes on the other. Twenty species of fungi were found on wheat stubble and strawthat is on the soil surface. Wheat residues as leaves, stems and ears residues with seedsplay important potential risk for spread of pathogenic fungi from year to year.AcknowledgementsThis study was financially supported by the Ministry of Agriculture and RuralDevelopment of the Slovak Republic, Grant No. 2006 UO27/091 05 01/091 05 11 andby the Science and Technology Assistance Agency under the contract VSMP-P-0056-09and VMSP-P-0047-09.ReferencesBrokenshire, T. (1975): Wheat debris as an inoculum source for seedling infection by Septoria tritici. PlantPathol., 24, 202–207.Champion, R. (1997): Identifier les champignons transmis par les semences. INRA, Paris.Dickinson, C. H., Maggs, G. H. (1974): Aspects of the decomposition of Sphagnum leaves in an ambrophilousmire. New Phytol., 73, 1249–1257.Domsch, K. H., Gams, W., Anderson, T. H. (1980): Compendium of soil fungi. Academic Press, London.Kiffer, E., Morelet, M. (2000): The Deuteromycetes. Mitosporic fungi, classification and genera keys. SciencePublishers Inc., Enfield, New Hampshire.Parkinson, D., Kendrick, W. B. (1960): Investigations of soil micro-habitats. pp. 22–28. In: Parkinson, D.,Waid, J. S. (ed.), The ecology of soil fungi. Liverpool University Press, Liverpool.Salt, G. A. (1979): The increasing interest in ‘minor pathogens’. pp. 289–312. In: Schippers, B., Gams, W.(ed.), Soil-borne plant pathogens. Academic Press, New York.Seifert, K. A. (1995): Notes on the typification of Gibberella zeae. Sydowia, 48, 83–89.Shipton, W. A., Boyd, W. R. J., Rosiella, A. A., Shearer, B. I. (1971): The common Septoria diseases of wheat.Bot. Rev., 37, 231–262.Sivanesan, A. (1984): The bitunicate Ascomycetes and their anamorphs. J. Cramer, Vaduz.Waid, J. S. (1957): Distribution of fungi within the decomposing tissues of ryegrass roots. Trans. Br. Mycol.Soc., 40, 391–406.335

AGRISAFE Budapest, Hungary, 2011THE EFFECT OF SMOKE-DERIVED KAR1 ON SEEDGERMINATION AND ITS INTERPLAY WITH THEINHIBITORY COMPOUND 3,4,5-TRIMETHYLFURAN-2(5H)-ONEV. SOÓS 1 – E. SEBESTYÉN 1 – A. JUHÁSZ 1 – M. E. LIGHT 2 – L. KOHOUT 3 –M. POSTA 3 – G. SZALAI 4 – J. VAN STADEN 2 – E. BALÁZS 11 Department of Applied Genomics, Agricultural Research Institute of the HungarianAcademy of Sciences, H-2462 Martonvásár, Brunszvik u. 2, Hungary; soosv@mail.mgki.hu2 Research Centre for Plant Growth and Development, School of Biological and ConservationSciences, University of KwaZulu-Natal Pietermaritzburg, Private Bag X01, Scottsville 3209,South Africa3 Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the CzechRepublic, v.v.i., Flemingovo nám. 2, 166 10 Prague 6, Czech Republic4 Department of Plant Physiology, Agricultural Research Institute of the Hungarian Academyof Sciences, H-2462 Martonvásár, Brunszvik u. 2, HungaryAbstract Smoke released from burning vegetation functions as an important environmental signal promotingthe germination of many plant species following a fire. It not only promotes the germination of species fromfire-prone habitats, but several species from non-fire-prone areas also respond, including some crops. Thegermination stimulatory activity can largely be attributed to the presence of a highly active butenolidecompound, 3-methyl-2H-furo[2,3- c]pyran-2-one (referred to as karrikin 1 or KAR1), that has previously beenisolated from plant-derived smoke. A related butenolide, 3,4,5-trimethylfuran-2(5H)-one was also identified insmoke which inhibits germination. Several hypotheses have arisen regarding the molecular background ofsmoke and butenolide action. We demonstrate that although smoke-water and KAR1 treatment of maizekernels result in a similar physiological response, the gene expression and the protein ubiquitination patternsare quite different. Treatment with smoke-water enhanced the ubiquitination of proteins and activated proteindegradation-relatedgenes. This effect was completely absent from butenolide-treated kernels, in which aspecific aquaporin gene was distinctly upregulated. In photoblastic lettuce achenes, KAR1 stimulates lightsignal transduction-related genes while the inhibitory compound shuts down these pathways and fuctionsexactly the opposite manner as KAR1. Our findings indicate that the array of bioactive compounds present insmoke-water form an environmental signal and may act together in germination stimulation. It is highlypossible that the smoke/ KAR1 signal is perceived by a receptor that is shared with the signal transductionsystem implied in perceiving environmental cues (especially stresses and light), or some kind of specializedreceptor exists in fire-prone plant species which diverged from a more general one present in a commonancestor, and also found in the non fire-prone plants allowing for a somewhat weaker but still significantresponse.Keywords: Germination, KAR1, transcriptome, microarrayIntroductionSmoke released by natural fires is a major environmental cue in fire-prone habitats and awide range of species show enhanced germination responses after exposure to aerosolsmoke or smoke-water (for review please see Light et al., 2009). Being a very oldevolutionary development, the responsiveness to fire cues remained active even inseveral species from non-fire prone regions and major crops also. Besides, smoke canalso positively affect the post-germination growth which results in increased seedlingvigor (Soós et al. 2009a). Efforts to identify the active compound from smoke-waterresulted in the characterization of 3-methyl-2H-furo[2,3-c]pyran-2-one (KAR1)(Flematti et al., 2004; van Staden et al., 2004). Currently, at least six analogues ofbutenolide (referred as KAR1-KAR6; Flematti et al. 2009) can be found in smoke andinterestingly enough, an inhibitory cue was recently isolated (Light et al. 2010). It wasshowed that a related butenolide, 3,4,5-trimethylfuran-2(5H)-one is responsible for the336

Budapest, Hungary, 2011AGRISAFEinhibitory effects of smoke-water, and showed that it significantly reduces the effect ofKAR1 (promoter) when the seeds were treated simultaneously (Fig. 1.).Figure 1. The chemical structure of KAR1 (3-methyl-2H-furo[2,3-c]pyran-2-one) and antiKAR1 (3,4,5-trimethylfuran-2(5H)-one).The positive and negative germination cues represent a diverse suite of chemical signalsprovided by the environment to signal germination. These compounds may fine-tune thegermination response, and it may be possible that together they would compose a distinctsignal to accurately locate the germination niche of the seed. It is of great interest thatthe tri-substituted but-2-enolide ring is a common structural feature of these butenolidecompounds. This leads to the speculation that the inhibitory compound (PyrobutenolideA or antiKAR) may somehow block the action of the promoter KAR1, or may interactwith a possible receptor related to the action of KAR1. The molecular basis of the effectof smoke may be related to the diverse binding affinity of the active compounds to theproposed receptor and the consequent effects exerted on the changes of gene expressionpattern. There is currently little knowledge on the molecular background of smoke- andKAR1-stimulated germination and the observed increase in seedling vigor. The studiespublished to date have typically been physiological in nature, investigating similaritiesbetween the effects of smoke and other plant growth regulators, such as gibberellins andstrigolactones. Deeper insight into the molecular background of smoke action and pilotstudies have been published more recently (Soós et al. 2009a,b; Nelson et al. 2009). Wereported that application of smoke-water to maize kernels yielded seedlings with highervigor and resulted in the induction of stress-related changes in the global transcriptomeof young seedlings (Soós et al. 2009a). Thus, it appears that the ‘hardening’ effect ofsmoke is similar to that caused by abscisic acid (ABA). Former results and microarrayexperiments with maize suggest that the KAR1 (as an environmental signal) is perceivedby a unique signal transduction machinery which shares similarity with the ABA-actionand stress-related events. The exact mechanism and the chain of events during KAR1and Pyr A exposition, and the genes orchestrating the effect of both cues are still elusive.However, the identification of the active butenolide component in smoke presentsenhanced opportunities for elucidating the mode of action of this compound in theabsence of artefacts and confounding influences caused by the additional compounds insmoke. We conducted in-depth molecular biology studies on the interaction of thesecompounds in order to add a further dimension to the emerging picture on the effect ofsmoke on seed germination and environmental sensing. Our study substantially extendedour current knowledge of transcriptional regulation by KAR1 and Pyr A exposure andprovide valuable insight into which aspects of smoke- and KAR1-induced germinationand increased seedling vigor should be the focus of further studies.Results and discussionsSo far, at least six active butenolides are known to be present in smoke (KAR1-KAR6;Nelson et al. 2009; Flematti et al. 2009) and other active compounds are suspected to337

AGRISAFE Budapest, Hungary, 2011exist in the smoke (Light et al. 2002; Light et al. 2009). The activity of relatedbutenolide compounds is different in terms of the relative expression level on selectedhormone-related genes and, the bioactivity of the derivatives depends, not only on thechemical structure, but also varies with the dormancy state (Nelson et al. 2009). It waspreviously reported that smoke-water has a ‘dual regulatory’ effect on germination, sincehigh concentrations of smoke-water were shown to inhibit germination, whereas lowerconcentrations had a promotory effect (Light et al. 2002). The assumption, thatinhibitory cues may also present in the smoke, was recently supported by the isolation ofa related butenolide, 3,4,5-trimethylfuran-2(5H)-one, that results in an inhibitory effecton the germination of lettuce achenes (Light et al. 2010). The study indicated that thiscompound is responsible for the inhibitory effect of smoke-water, and showed that itsignificantly reduces the effect of KAR1 (promoter) when the seeds were treatedsimultaneously. Microarray study on smoke and KAR1-treated germinating maizekernels revealed substantial differences in smoke- and butenolide-induced geneexpression (Soós et al, 2010). Treatment with smoke-water enhanced the ubiquitinationof proteins and activated protein-degradation-related genes. Smoke-water applicationyielded the formation of high molecular mass ubiquitin conjugates before theubiquitination signal or degron appeared in the control and butenolide treated kernels.The observed levels of ubiquitin conjugates, detected by immunoblotting using antiubiquitinantibodies suggest an intense involvement of the ubiquitin-mediatedproteolytic pathway during the smoke-induced germination. Presumably, application ofsmoke-water accelerates protein turnover and affects the assignment of proteins to bedegraded by proteasomes and this eventually leads to the enhanced germination andseedling growth.This effect was completely absent from butenolide-treated kernels, inwhich a specific aquaporin gene was distinctly upregulated. We applied two knownaquaporin inhibitors, mercury chloride and silver nitrate, on maize seedlings todetermine the involvement of aquaporins in butenolide action. Both treatments resultedin a reduction of the growth parameters of the seedlings. Treatment of the seedlings witha combination of butenolide and silver nitrate showed an alleviation of the adverse effectof the silver nitrate, whereas simultaneous treatment with both smoke-water and silvernitrate show no such reduction in the effect of silver nitrate inhibition. The obviousdifference between the smoke- and butenolide-responsive gene lists clearly indicates theinteraction of other germination-active cues in the smoke which together form thephysiological response towards smoke treatment. This is to be expected considering thenumber of active compounds found in smoke and smoke-water. The presence of morepotentially active compounds in smoke, the concentration-dependent activity of theinhibitory compound, and their possible interactions implies that no two batches ofsmoke can be regarded as exactly the same. For this reason, using crude smoke to studyits effect on the molecular events during germination should be avoided. Instead, asimplified model system was used which simulate the interaction between the promotingand the inhibitory cues. Among the known germination-active butenolides, the KAR1 isthe far most active, and in our proposed work, the molecular background of KAR1action and its interference with the Pyr A was extensively investigated. The comparativeanalysis of different smoke-responsive plants showed that the Lactuca sativa ‘GrandRapids’ is one of the best object for KAR1 research, as butenolide treatment can replacethe light requirement of germination in this cultivar. We designed a novel lettucemicroarray on Agilent platform consisting more than 28000 features consisting of DFCI,338

Budapest, Hungary, 2011AGRISAFEUnigene and other NCBI records. The preliminary microarray analysis of the treatedplants 2, 12 and 24 h after KAR1 or antiKAR (the novel inhibitory compound in smoke)exposure showed that KAR1 and antiKAR1 treatments induce exactly the opposite geneexpression patterns. We found that antiKAR1 has a quite opposite effect on thetranscriptome, namely once a particular master gene is switched on in the KAR1 treatedsamples, then this gene is downregulated in the antiKAR exposed germinating achenes.24h after the exposure different light signal transduction related genes were distinctlyaffected (HY5, B3 TFs) clearly showing that KAR1 acts by eliciting light responses viaan phytochrome-independent way. The detailed in silico evaluation of the data isunderway.ConclusionsConsidering all the knowledge accumulated to date in terms of smoke action we canassume that these physiological events represent only the ‘tip of the iceberg’ and thesecan be regarded as the executers of smoke and KAR1 action. As far as the nature ofsmoke and KAR1 perception is concerned, it is highly possible that the smoke ‘signal’ isperceived by a receptor that is shared with the signal transduction system implied inperceiving environmental cues (especially stresses and light), or some kind ofspecialized receptor exists in fire-prone plant species which diverged from a moregeneral one present in a common ancestor, and also found in the non fire-prone plantsallowing for a somewhat weaker but still significant response. These major integrators ofenvironmental signals, stress and hormone responses, could be potential targets forfuture research.AcknowledgementsThis work was supported by the Generation Challenge Programme (GCP), theHungarian-South African Intergovernmental S&T Cooperation Programme, theHungarian Scientific Research Fund (OTKA F16066) and the National ResearchFoundation, Pretoria, South Africa and the IOCB project Z4 055 0506, Czech Republic.VS and AJ were granted Bólyai Scholarship.ReferencesFlematti G.R., Ghisalberti E.L., Dixon K.W. & Trengove R.D. (2004): A compound from smoke that promotes seedgermination. Science 305, 977.Flematti G.R., Ghisalberti E.L., Dixon K.W. & Trengove R.D. (2009): Identification of alkyl substituted 2H-Furo[2,3-c]pyran-2-ones as germination stimulants present in smoke. Journal of Agricultural and Food Chemistry 57, 9475–9480.Light M.E., Burger B.V., Staerk D., Kohout L., Van Staden J. (2010): Butenolides from plant-derived smoke: natural plantgrowthregulators with antagonistic actions on seed germination. Journal of Natural Products DOI: 10.1021/np900630wLight M.E., Gardner M.J., Jäger A.K. & Van Staden J. (2002): Dual regulation of seed germination by smoke solutions. PlantGrowth Regulation 37, 135-141.Nelson D.C., Riseborough J.A., Flematti G.R., Stevens J., Ghisalberti E.L., Dixon K.W. & Smith S.M. (2009): Karrikinsdiscovered in smoke trigger Arabidopsis seed germination by a mechanism requiring gibberellic acid synthesis and light.Plant Physiology 149, 863-873.Soós V., Sebestyén E., Juhász A., Pintér J., Light M.E., Van Staden J. & Balázs E. (2009a): Stress-related genes defineessential steps in the response of maize seedlings to smoke-water. Functional and Integrative Genomics 9, 231-242.Soós V., Sebestyén E., Juhász A., Szalai G., Tandori J., KohoutL., Light M.E., Van Staden J. & Balázs E. (2010):Transcriptome analysis of germinating maize kernels reveals substantial differences between the effects of smoke-waterand the active compound KAR1. BMC Plant Biology 10, 236.Soós V., Juhász A., Light M.E., Van Staden J. & Balázs E. (2009b): Smoke-water-induced changes of expression pattern inGrand Rapids lettuce achenes. Seed Science Research 19, 37-49.Van Staden J., Jäger A.K., Light M.E. & Burger B.V. (2004): Isolation of the major germination cue from plant-derivedsmoke. South African Journal of Botany 70, 654-659.339

AGRISAFE Budapest, Hungary, 2011RESPONSE OF WINTER WHEAT GENOTYPES TO DIFFERENTENVIRONMENTAL CONDITIONSV. SPANIC 1 – G. DREZNER 1 – K. DVOJKOVIC 1 – S. MARIC 2 – V. GUBERAC 21 Agricultural Institute Osijek, Juzno predgradje 17, 31 103 Osijek, Croatia, e-mail:valentina.spanic@poljinos.hr2 Agricultural Faculty in Osijek, Trg Svetog Trojstva 3, 31 000 Osijek, CroatiaAbstract To obtain information about the reaction of winter wheat genotypes to different environmentalconditions, experiments were set up with 18 genotypes of winter wheat in four replications at four locationswith different soil types. The genotypes Felix, Soissons and Ilirija formed an adaptive group with high meansaccompanied by a moderate positive interaction. During 2009 and 2010 the test weight varied from 68.7 kg hl -1(genotype Soissons, Osijek 2010) to 85.0 kg hl -1 (genotype Lela, Osijek 2009). The 1000-kernel weight rangedfrom 22.9 g (genotype Soissons, Osijek 2009) to 54.4 g (genotype Ilirija, Osijek 2010). The results of theresearch during 2008/09 and 2009/10 indicated the importance of multilocation experiments to obtain reliabledata on the quantitative characteristics of a particular genotype.Key words: environment, wheat, genotypes, quantitative traitsIntroductionYield and grain quality are the most important quantitative traits of winter wheat(Triticum aestivum L.), whose expression is largely influenced by environmentalconditions (Drezner et al., 2006). Drezner et al. (2007) report that trials over the yearsand several locations are important in selecting the best genotypes. AMMI analysis isuseful in the adaptation and selection of certain genotypes in different locations (Gauch,1997). The aim of this study was to observe the stability (depending on grain yield) of 18winter wheat genotypes. Values for test weight and 1000 kernel weight were alsoincluded in this paper.Materials and methodsThe survey was conducted during 2008/09 and 2009/10 using 18 genotypes of winterwheat (Felix, Zitarka, Seka, Ilirija, Srpanjka, Katarina, Mihaela, Aida, Lela, Divana,Alka, Golubica, Renata, Lucija, Zlata, Pipi, Sana, Soissons). The experiment was set upas completely randomized block in four replications at four different locations withdifferent soil types (Tovarnik-near Vukovar, 45°10’N, 19°09’E, Osijek, 45°27’ N,18°48’E, Pozega, 45°20’, 17°41’E, Slavonski Brod, 45°10’N, 18°01’E). The fields werelocated in the main wheat growing region in Croatia, and represented different types ofsoil (Tovarnik-black earth, Osijek-eutric cambisol, Pozega-pseudogley, Slavonski Brodamphigley).The climate conditions during growing season significantly differed in theamount of rainfall and average temperatures at different locations and years (2008/09:Osijek=368.6 mm, 10.8°C; Pozega=528.1 mm, 10.2°C; Slavonski Brod=507.9 mm,10.6°C; Tovarnik=430.6 mm, 11.2°C, 2009/10: Osijek=846.0 mm, 10.3°C;Pozega=829.5 mm, 9.9 °C; Slavonski Brod=863.5 mm, 10.2 °C; Tovarnik=759,3 mm,10.7°C). Area of one experimental plot was 7.56 m 2 . After the harvest the followingtraits were analyzed: grain yield (dt ha -1 ), test weight (kg hl -1 ) and 1000 kernel weight(g). Analysis of variance was calculated using the GLM procedure of SAS 9.1. StatSoftwer at the level of significance α=0.05. Software IRRISTAT 5.0 (for Windows ©Irristat, 2005) was used for AMMI models.340

Budapest, Hungary, 2011AGRISAFEResults and discussionAnalysis of variance of grain yield for the AMMI model showed statistically significantdifferences between first three AMMI components of G*E interaction (Table 1).Table 1. Analysis of variance for grainyield for AMMI modelTable 2. Analysis of variance for test weight and 1000kernel weightSource DF s 2Genotype 17 3175.88***SourceDFTest weights 21000 kernelweightEnvironment 7 31157.0*** Genotype 17 1340.34*** 5965.04***Genotype*Environment (G*E)119 3935.85 Location 3 1600.05*** 7355.50***AMMI component 1 23 1710.23*** Year 1 1240.81*** 8715.78***AMMI component 2 21 907.370*** Replication 3 38.56*** 91.26*AMMI component 3 19 520.354* Genotype*Location 51 451.95*** 861.23***AMMI component 4 17 286.801ns Genotype*Year 17 283.47*** 377.93***G*E residual 39 511.100 Error 483***,*,*=significant at P0.05)AMMI I biplot for grain yield of the 18 genotypes at 8 environmental conditions ispresented in Figure 1. Genotypes Felix, Soissons and Ilirija formed an adaptive groupwith high mean accompained with moderate positive interaction.Figure 1. Grain yield grouped by genotypesand environmentsFigure 2. Stability of grain yield grouped bygenotypes and environmentsThe highest yielding ability in average at five locations and two years had genotypeFelix (71.00 dt ha -1 ). Figure 2 gives the AMMI II biplot for grain yield. Distribution ofgenotypes points in the AMMI II biplot revealed that genotypes Seka, Katarina,Golubica and Mihaela scattered closed to the origin, indicating minimal interaction ofthese genotypes with environments.341

AGRISAFE Budapest, Hungary, 2011Table 3. Test weight (kg hl -1 ) of winter wheat genotypes at different locations and yearsGenotype Os08/09 Poz08/09 SB08/09 Tov08/09 Os09/10 Poz09/10 SB09/10 Tov09/10Lela 85.0 83.0 83.4 82.6 80.7 80.0 81.5 81.2Felix 83.7 80.8 81.9 80.5 79.5 78.2 81.0 78.5Žitarka 82.9 79.0 80.5 78.7 78.0 74.1 81.5 75.4Seka 80.5 78.6 78.9 76.8 77.4 77.0 78.1 73.6Ilirija 84.4 80.7 83.3 81.7 76.8 81.3 80.8 76.8Srpanjka 82.3 79.2 80.1 78.1 76.6 74.0 77.4 73.9Katarina 81.8 76.6 80.0 78.5 76.9 77.0 79.1 74.9Mihaela 80.4 78.8 78.1 77.3 75.8 72.3 77.8 73.5Aida 82.1 78.8 79.9 77.9 75.6 78.5 80.4 72.2Divana 82.1 79.7 81.7 80.5 75.2 79.8 80.5 76.8Alka 81.9 78.7 79.7 78.6 75.2 77.6 78.8 76.1Golubica 84.0 80.5 81.9 80.1 74.9 78.5 80.6 74.9Renata 83.7 79.9 80.6 78.1 74.8 75.1 79.1 73.8Lucija 81.4 78.2 79.2 78.4 74.8 73.5 78.2 75.9Zlata 82.2 79.2 79.2 76.8 74.6 73.2 77.5 71.9Pipi 83.0 80.6 81.0 79.0 73.9 75.7 79.0 72.9Sana 79.9 77.8 79.3 77.0 73.0 72.6 78.1 74.1Soissons 82.3 79.2 80.1 77.3 68.7 76.7 78.3 70.2Average 82.4 79.4 80.5 78.8 75.7 76.4 79.3 74.8Lsd 0,05 0.72 0.62 0.70 0.80 1.71 1.55 1.27 1.95Table 4. 1000 kernel weight (g) of winter wheat genotypes at different locations and yearsGenotype Os08/09 Poz08/09 SB08/09 Tov08/09 Os09/10 Poz09/10 SB09/10 Tov09/10Divana 39.5 38.4 41.2 41.4 48.7 46.5 48.3 43.6Ilirija 36.7 43.9 48.0 40.7 54.4 50.2 51.2 50.9Seka 35.8 35.1 39.2 33.7 48.6 44.4 44.3 38.8Žitarka 35.5 33.1 40.5 37.4 49.2 45.7 46.2 42.7Lela 35.5 31.2 38.9 37.2 47.6 47.0 44.4 41.4Felix 35.4 34.4 39.5 37.1 48.8 44.2 43.7 40.3Mihaela 34.5 32.9 37.3 36.3 51.5 45.6 47.1 43.9Sana 32.7 30.7 41.2 37.4 49.0 47.8 47.2 42.6Alka 31.8 33.3 41.7 34.8 46.6 40.0 45.5 40.4Renata 31.3 30.3 39.3 35.3 50.7 48.3 47.6 43.1Golubica 30.2 33.0 37.8 34.2 46.3 42.3 42.1 40.0Katarina 29.6 28.5 34.6 32.2 44.2 44.9 42.1 38.1Srpanjka 29.0 28.2 36.0 31.8 43.4 42.8 43.3 38.1Pipi 28.9 32.0 38.1 28.2 45.8 40.2 42.7 38.2Aida 28.2 31.0 38.5 27.5 46.7 44.6 41.1 36.1Lucija 27.2 29.0 35.3 35.6 46.0 39.5 42.2 40.4Zlata 27.2 26.3 33.6 26.7 42.6 38.8 38.8 34.6Soissons 22.9 30.5 34.8 27.4 41.7 40.3 39.7 35.2Average 31.8 32.3 38.6 34.2 47.3 44.1 44.3 40.5Lsd 0,05 2.19 2.14 2.04 1.59 2.31 1.44 2.92 2.40342

Budapest, Hungary, 2011AGRISAFEStatistical analysis of obtained data revealed highly significant differences betweengenotypes, locations, years and interactions genotype*location and genotype*year forthe test weight and 1000 kernel weight (Table 2). During 2009 and 2010 test weightvaried from 68.7 kg hl -1 (genotype Soissons, Osijek 2010) to 85.0 kg hl -1 (genotype Lela,Osijek 2009) (Table 3). Highest average 1000 kernel weight was obtained at locationOsijek in 2010 (47.3 g) and the lowest 1000 kernel weight was obtained at locationOsijek in 2009 (31.8 g) (Table 4). 1000 kernel weight ranged from 22.9 g (genotypeSoissons, Osijek 2009) to 54.4 g (genotype Ilirija, Osijek 2010).ConclusionsBased on the results of research during 2008/09 and 2009/10 it can be indicated theimportance of multilocation experiments to obtain reliable data on quantitativecharacteristics of a particular genotype. High mean accompained with moderate positiveinteraction had genotypes Felix, Soissons and Ilirija in AMMI I biplot. Minimalinteraction with environments had genotypes Seka, Katarina, Golubica and Mihaela inAMMI II biplot. During 2009 and 2010 the highest test weight had genotype Lela atOsijek, 2009. The highest average 1000 kernel weight was obtained at location Osijek in2010, and the highest 1000 kernel weight had genotype Ilirija at location Osijek, 2010. Itcan be concluded that certain genotypes of winter wheat Agricultural Institute Osijekhave high and stable grain yield.AcknowledgementsThe work presented in this paper is part of project ‘073-0730718-0598’, which issupported by MZOŠ RH.ReferencesDrezner, G., Dvojkovic, K., Horvat, D., Novoselovic, D., Lalic, A., Babic, D., Kovacevic, J. (2006): Grainyield and quality of winter wheat genotypes in different environments. Cereal Research Communications,34: 457-460.Drezner, G., Dvojkovic, K., Horvat, D., Novoselovic, D., Lalic, A. (2007): Environmental impacts on wheatagronomic and quality traits. Cereal Research Communications, 35: 357-360.Gauch, H.G. (1992): Statistical analysis of regional yield trials: Ammi analysis of factorial designs. ElsevierScience Publishers B.V., Amsterdam.Irristat for Windows © 2005, Version 5.0, International Rice Research Institute DAPO Box 7777, MetroManilla, Phillipines.SAS Institute Inc. – SAS® 9.1.2. Qualification Tools User’s Guide. Copyright © 2004 SAS Institute Inc.,Cary, NC, USA.343

AGRISAFE Budapest, Hungary, 2011EFFECTS OF GENOTYPE AND SOWING DENSITIES ON EARYIELD AND SHELLING PERCENTAGE OF SWEET CORN(ZEA MAYS L. VAR. SACCHARATA)J. SRDIĆ – M. SIMIĆ - Ž. VIDENOVIĆ - Z. PAJIĆ – V. DRAGIČEVIĆMaize Research Institute, Zemun Polje, Belgrade, Serbia, e-mail: jsrdic@mrizp.rsAbstract The objective of the present study was to determine the effect of four sowing densities (40,000,50,000, 60,000 and 70,000 plants ha -1 ) on the fresh ear yield and shelling percentage of four ZP sweet cornhybrids over a period of three years (2007, 2008 and 2009). The observed traits significantly varied over theyears. Significant variations in fresh ear yield were observed for different sowing densities, but the latter hadno effect on shelling percentage. The highest sowing density gave the highest yield of sweet corn, and thehighest average ear yield was also recorded at the highest sowing density (9.73 t ha -1 ). The hybrids differedsignificantly for fresh ear yield and shelling percentage. In general, it can be stated that these sweet cornhybrids should be cultivated at sowing densities of 60,000 and 70,000 plants ha -1 , when the most favourableyield parameters and the highest yields can be obtained.Key words: sweet corn, sowing density, ear yield, shelling percentageIntroductionSweet maize is used as food in form of fresh ears or for industrial processing 18-24 daysafter pollination, so the product’s quality and its appearance is important as well as theyield. The importance of the traits of interest in sweet maize depends on the marketdemands and the purpose of processing (Tracy, 1994). Favourable traits for the hybridsthat are used in industrial processing are uniformity of ear, proper kernel rowconfiguration, depth, width, and high shelling percentage (Pajić et al., 2005).Sweet maize growing practices differ, to a certain extent, from cropping practicesapplied when hybrids of standard grain quality are grown. Sweet maize under ourconditions can be sown from the beginning of April till the mid July, depending on thematurity group and cropping systems. The sweet maize plant habitus is smaller andpoorly developed. Different response to a sowing density is associated to the size of theirleaf area, which is a genotype feature (Moris et al., 2000; Rangarajan et al., 2000; Simićand Stefanović, 2007). Factors driving yield loss varied among sweet maize hybrids -more competitive hybrids established canopy dominance, restrained weed growth andexperienced less yield loss (Williams et al., 2008).From 1970s, when sweet maize breeding and selection was initiated at the MaizeResearch Institute, Zemun Polje up to now twenty nine sweet maize hybrids of differentmaturity groups have been released. In order to obtain high-ranking and high-qualityyields, it is necessary to provide the most suitable cropping practices for these hybrids.The objective of this study was to determine the effect of four sowing densities in fourZP sweet maize hybrids on fresh ear yield and shelling percentage.Materials and methodsThe trial was carried out on slightly calcareous chernozem in the experimental field ofMaize Research Institute, Zemun Polje, during 2007, 2008 and 2009. The three-replicatetwo factorial trial was set up according to the RCB design. In this experiment four sweetmaize hybrids were observed: ZP 424su, ZP 462su, ZP 504su and ZP 521su. Manualsowing was performed in one day, between 20 th -23 rd April, depending on the year. Theinter-row distance of 70 cm was equal for all sowing densities, while the within-row344

Budapest, Hungary, 2011AGRISAFEplant distance was 35, 28, 24 and 20 cm, by which the following densities were obtained:D 1 - 40,000 plants ha -1 ; D 2 - 50,000 plants ha -1 ; D 3 - 60,000 plants ha -1 and D 4 -70,000plants ha -1 . Harvest was performed 24 days after pollination. Yield of the fresh earswithout husk was measured from the elementary plot and shelling percentage wasdetermined on a sample of 10 ears. Shelling percentage was estimated as a ratio of kernelweight to fresh ear without husk weight.Obtained data were statistically processed by the three factorial analysis of variance,where factor A was years, factor B – sowing densities and factor C – hybrids. Thedifferences between means were tested with the LSD-test.Results and discussionResults of the analysis of variance showed that investigated factors had significantinfluence on the observed traits. The year as the factor significantly affected both freshear yield and shelling percentage, indicating that different metrological conditions in theinvestigated years had significant influence on the yield and quality production of sweetmaize. Effect of sowing density produced significant variations in fresh ear yield, but didnot affect shelling percentage. Significant differences among hybrids were found alsoboth concerning fresh ear yield and shelling percentage. The effect of year x hybridinteraction was significant in both traits, while other interactions did not producesignificant variations (Table 1).Table 1. ANOVA for fresh ear yield and shelling percentageSources of varianceDegrees offreedomFresh ear yieldMean squareShelling percentageYear 2 203.42** 1026.71**Sowing density 3 24.90** 6.52nsHybrid 3 10.75** 70.14**Year x Sowing density 6 2.89ns 7.74nsYear x Hybrid 6 3.81* 154.12**Sowing density x Hybrid 9 2.20ns 12.68nsYear x S.density x Hybrid 18 1.67ns 12.557ns*, ** - significant at 0.05, 0.01 probability levelns – not significantIn 2008 highest average yield (10.36 t ha -1 ) was achieved, and it varied from 9.36 t ha -1for hybrid ZP 504su, up to 10.98 t ha -1 (ZP 424su). Year 2007 was the least productiveon average (6.64 t ha -1 ) and over hybrids (6.23 – 7.33 t ha -1 ). Hybrid ZP 424su had thehighest average yield in that year, too.Table 2. Effects of year, genotype and their interaction on fresh ear yield and shelling percentageYear Fresh ear yield (t ha -1 ) Shelling percentage (%)Hybrid2007 2008 2009 2007 2008 2009ZP 424su 7.33 10.98 10.03 66.13 62.09 69.83ZP 462su 6.65 10.58 11.30 67.32 61.16 67.48ZP 504su 6.36 9.36 9.58 70.19 58.28 77.11ZP 521su 6.23 10.51 9.26 65.55 65.81 69.72Average 6.64 b 10.36 a 10.04 a 67.30 b 61.83 c 71.03 a345

AGRISAFE Budapest, Hungary, 2011Average shelling percentage significantly varied over years (61.83 % - 71.03%), and inthe most productive year 2008, the lowest shelling percentage was recorded (Table 2).Hybrid ZP 462su had highest average fresh ear yield (9.51 t ha -1 ), and it was especiallyproductive in sowing density of 60,000 plants per ha (Table 3). Sowing densitysignificantly influenced fresh ear yield, and the higher density was the higher yield was.Hence, the highest average fresh ear yield (9.73 t ha -1 ) was in the highest sowing density(70,000 plants per ha). Similar results were obtained in the previous research thatencompassed two year research (Srdić et al., 2008), the only difference was in theposition of the first two ranking hybrids.According to the results of Morris et al. (2000), the sowing densities of sweet maize inthe northeast USA are quite low, hence sweet maize cultivation in the densities of 49,400and 59,300 plants per ha resulted in significantly higher yields. Rangarajan et al. (2000)also found that the higher densities were the higher yields in sweet maize were.Table 3. Effects of sowing density, genotype and their interaction on fresh ear yield (t ha -1 )HybridSowing densitypl ha -1D 140,000D 250,000D 360,000D 470,000 AverageZP 424su 8.44 9.58 9.86 9.91 9.48 aZP 462su 8.11 8.89 11.09 9.96 9.51 aZP 504su 7.80 8.07 8.59 9.27 8.43 bZP 521su 7.72 8.01 9.14 9.79 8.67 abAverage 8.02 b 8.64 b 9.67 a 9.73 aSignificant variations in shelling percentage over sowing densities were not recorded.Highest average shelling percentage was found in density D 1 (67.17 %). Hybrid with thehighest shelling percentage was ZP 504su (68.53 %) and its shelling percentage in D 1(70.28 %) was the highest among all genotypes and sowing densities (Table 4.).Table 4. Effects of sowing density, genotype and their interaction on shelling percentage (%)Sowing densitypl haHybrid D 140,000D 250,000D 360,000D 470,000 AverageZP 424su 66.00 65.40 66.18 66.46 66.01 abZP 462su 65.80 65.64 65.77 64.06 65.32 bZP 504su 70.28 69.33 67.73 66.78 68.53 aZP 521su 66.61 65.46 68.25 67.79 67.03 abAverage 67.17 66.46 66.98 66.27346

Budapest, Hungary, 2011AGRISAFEConclusionsBased on the results of this research following conclusions were made:Observed traits significantly varied over years indicating that different metrologicalconditions in the investigated years had significant influence on the yield and shellingpercentage in sweet maize.Sowing density significantly influenced fresh ear yield, and the highest average yield(9.73 t ha -1 ) was observed in the highest sowing density (70,000 plants per ha). Sowingdensity did not significantly influence shelling percentage.Hybrid ZP 462su was the most productive (9.51 t ha -1 ), and ZP 504su had the highestaverage shelling percentage (68.53%).Observed ZP sweet maize hybrids could be cultivated in sowing densities of 60,000 and70,000 plants ha -1 , so the most favourable parameters of yields and the highest yields canbe obtained.AcknowledgementsThis paper was financially supported by the Ministry of Science and Technology,Republic of Serbia, through Project TR 31037.ReferencesMorris, F.T., Hamilton, G., Harney, S. (2000): Optimum Plant Population for Fresh-market Sweet Corn in theNortheastern United States. Hort Technology, 10, 331-336.Pajić, Z., J. Vančetović, M. Radosavljević (2005): Hibridi kukuruza specifičnih svojstava za industrijskupreradu. PTEP Časopis za procesnu tehniku i energetiku u poljoprivred,i 9, 18-21.Rangarajan, A., Ingall, B., Orfanedes, S.M. (2000): Impact of Plant Population, Nitrogen, and Variety on EarlyFresh-market Sweet Corn Quality. Hort Science, 35, 439-440.Simić, M., Stefanović, L. (2007): Effects of maize density and sowing pattern on weed suppression and maizegrain yield. Pesticides & Phytomedicine, 22, 93-103.Srdić, J., Simić, M., Videnović, Ž., Pajić, Z. (2008): Yields of ZP sweet maize hybrids in dependance onsowing densities. Genetika, 40, 293-301.Tracy, W.F. (1994): Sweet corn. In: Speciality Corns, CRC Press Inc., Ames, Iowa, USA, 147.Williams, M.M, Boydston, R.A., Davis, A.S. (2008): Crop competitive ability contributes to herbicideperformance in sweet corn. Weed Research, 48, 58-67.347

AGRISAFE Budapest, Hungary, 2011PIGMENTS, PHENOLIC CONTENTS AND ANTIOXIDANTACTIVITY OF BUCKWHEAT SEEDLINGS UNDER IN VIVOAND IN VITRO CONDITIONSO. SYTAR 1,2 – A.M.M. GABR 3 – I. SMETANSKA 2,3 – A. KOSYAN 11 Department of Methods of Food Biotechnology, Berlin University of Technology, Institute of FoodTechnology and Food Chemistry, Königin-Luise-Straße 22, 14195 Berlin2 Department of Plant Physiology and Ecology, Taras Shevchenko National University of Kyiv, Faculty ofBiology, 64, Volodymyrs'ka St., 01601 Kyiv, Ukraine.3 Department of Plant Biotechnology, National Research Center, Cairo, Egypt.Abstract The antioxidant activity (AOX) and total phenolic and pigment contents were studied in the leaves andstems of 10-day-old buckwheat seedlings cultivated under in vivo and in vitro conditions. An antioxidant activity test(DPPH) showed higher AOX in the leaves than in the stems under in vitro conditions. At the same time AOX inbuckwheat plants was lower in vitro than in vivo, especially in the stems, where it was 44% lower in vitro than in vivo.The total phenolic content was 25% lower in in vitro leaves than in vivo. On the other hand, in the stems the content ofphenolic components tended to increase in vitro compared with in vitro stems. HPLC analysis confirmed a highcontent of chlorogenic acid and other phenolic compounds in in vivo leaf extracts, with high retention times forethylgallate and epigallocatechin gallate. Caffeic acid, catechin, gallic acid, coumaric acid and quercetin were presentin in vivo leaves in lower quantities. In in vivo stems extracts, high contents of caffeic acid, catechin andepigallocatechin gallate were found. The contents of catechin and caffeic acid in the stems was lower in vitro than invivo. Nonetheless, the content of chlorogenic acid increased by 78% in in vitro stems compared to in vivo. A tendencyfor pigment contents to increase under in vitro conditions was observed.Key words: antioxidant activity, phenolics, anthocyanins, pigments, buckwheat, in vitroIntroductionBuckwheat seedlings are recommended for their high antioxidative activity as an excellentdietary source of phenolic compounds, particularly rutin (Kim et al, 2008). Recently, thebuckwheat sprout has been reported to possess high radical scavenging activity (Watanabe andShimizu, 2004). In particular, tartary buckwheat seedlings have higher content of anthocyanins,rutin and flavonol glycoside compared to common buckwheat, which results in a lowered heartdisease by including the sprouts in the diet (Kim et al, 2007).Plant in vitro cultures are able to produce and accumulate health-promoting secondarymetabolites. Many of them are antioxidants, which can be used as food additives inhibitingdetrimental changes of easily oxidizable nutrients. Many different in vitro approaches forvarious medical plants have been used for increased biosynthesis and the accumulation ofantioxidant compounds in plant cells (Matkowski, 2008).The aim of this work was to study the biochemical composition of the leaves (cotyledons) andstems of common buckwheat (Fagopyrum esculentum Moench.) during the seed germinationunder in vivo and in vitro conditions.Materials and methods1 Plant materials: Seeds were obtained from buckwheat of the specie Antariya (2009 year)and germinated under in vivo and in vitro conditions. In vivo seeds were germinated in thegreenhouse for 10 days in 24 hours light at 18°C at 65% humidity. In vitro seeds were surfacesterilized by washing in running water with soap for 20 min, under aseptic condition in laminarair-flow cabinet rinsing with 70% ethanol, immersed for 20 min in 30% sodium hydroxylsolution. Afterwards, the seeds were left to germinate on the basal MS medium (Murashige &Skoog, 1962) under a 16/8 hours photoperiod and 25± 2 °C.348

Budapest, Hungary, 2011AGRISAFE2. Determination of pigments :For estimation of photosynthetic pigments plant material (100mg) was ground in chilled 80% acetone in dark. After centrifugation at 10,000 × g for 10 min at4 o C, absorbance of supernatant was taken at 480, 645 and 663 nm. Chlorophylls and carotenoidcontent was calculated using the formula given by Arnon (1949).3. Determination of antioxidant activity: We have used the method for determination ofantioxidant activity developed by Molyneux (Molyneux, 2004).4. Determination of total phenolics: Total phenolics were determined by using Folin-Ciocalteau reagent (Singleton et al, 1965).5. Determination of phenolics composition with HPLC Analysis: The chromatography wasperformed using a Dionex Summit P680A HPLC system with an ASI-100 auto sampler and aPDA-100 photodiode array detector. The separation was performed on a 2x10 mm, 5 µmol C16silica columns (DIONEX) with an injection volume of 40 µL and a temperature of the columnoven 35 ºC. The eluent flow rate used was 0.4 mL/min. A 45 min gradient program was usedeluent A and eluent B with a gradient elution of 100% of A mobile phase for 10 min, andisocratic elution of 68% and 32% of A and B eluents respectively for 35 min. Peaks weremonitored at 254, 278, and 330 nm.Results and discussionDetermination of pigments The photosynthetic pigments not showed significantlydifferences in buckwheat stems under in vivo and in vitro conditions (Fig.1). In buckwheatleaves under conditions in vitro the contents of chlorophyll b and total chlorophylls has beenhigher on 43% and 24% compared to in vivo.AFigure1.Pigments of buckwheat seedlings in leaves (A) and stems (B) under in vivo and in vitro conditions.Antioxidant Activity (DPPH) Antioxidant activity test (DPPH) showed 64% higher AOX inin vitro leaves of buckwheat sprouts as compared to the stems (Fig. 2). At the same time AOXin in vitro plants was lower than in in vivo plants, especially in in vitro stems it was 44% loweras compared to that in in vivo stems.BAFigure 2. AOX (A) and total phenolics (B) of buckwheat seedlings under in vivo and in vitro conditions.B349

AGRISAFE Budapest, Hungary, 2011Determination of total phenolics The total phenolic content of the plant materials investigatedin study for the buckwheat in vivo leaves was 5.00 mg ml -1 (Fig. 2). Under in vitro condition thetotal phenolic content of the leaves was 1.20 mg ml -1 lower as compared to the total phenoliccontent of the in vivo leaves, also in in vivo stems the content of total phenolics was 1.10 mg ml -1lower as compared to in vitro stems. In in vivo samples were presented chlorogenic acid,caffeic acid, catechin, gallic acid, p-coumaric acid, and quercetin in the average amount (Fig. 3).The same phenolic compounds were indentified in in vivo stems but their quantity has beendifferent as compared to leaves. In in vivo stem extracts the contents of caffeic acid, catechin,and epigallocatechin gallate were found in higher quantity as compare to leaves. Theconcentration of caffeic acid in in vivo stems (24.17 µmol/ml) was 10 times higher than inleaves. Among the flavons, the highest concentration was recorded to be that of catechin forstems 9.26 µmol/ml.AFigure 3. Fractionation of the phenolics extract of buckwheat leaves (A) and stems (B) in vivo by HPLC at 330 nm.Peak numbers: (1) caffeic acid RT 2.1 (2) catechin RT 3.9 (3) vanillic acid RT 4.4 (4) epicatechin RT 7.17 (5) gallicacid RT 7.50 (6) p-coumaric acid RT 9.59 (7) ferulic acid RT 10.70 (8) chlorogenic acid RT 12.6; (9) RT 14.37; (10)ethylgallate RT 15.71 (11) epigallocatechin gallate RT 17.15 (12) quercetin RT 27.01The profile of individual phenolic compounds in in vitro and in vivo buckwheat seedlings wasthe same, but the quantities of individual compounds were different (Fig. 3 and 4). However,the quantity of identified compounds in in vitro leaves was lower as compared to these quantityin in vivo leaves. The content of chlorogenic acid in in vitro leaves was 19.5% lower ascompared to in vivo leaves. The content of ethylgallate and epigallocatechin gallate was 7.8%and 47% lower respectively. The content of querctin decreased 31% in the in vitro leaves ascompared with in vivo.The significant differently results were observed in in vitro stems as compared to in vitro leaves(content of nearly all phenolic components increased in in vitro stems). Especially increasedchlorogenic acid, its content in in vitro stems was 78% higher as compared its content in in vivostems. The content of compounds with RT 14.37 min and ethylgallate has been increased 90%and 91% as compared to in vivo stems. The content of epigallocatechin gallate, catechin andcaffeic acid has been decreased on 67%, 50% and 79% in in vitro stems as compared to in vivostems, respectively. Kim et al, (2004) reported similar results with high content of chlorogenicacid in the green sprouts of common buckwheat (Fagopyrum esculentum Moench) and showedthat chlorogenic acid content was high in seedling. Yao et al, (2004) suggested that theformation of more highly oxidized flavonoids is accelerated by natural light. It gives evidenceabout the light effect under in vivo conditions on the acumulation of phenolics compounds ingreen buckwheat leaves in our experiment.In buckwheat in vivo stems, there were high contents of caffeic acid, catechin, andepigallocatechin gallate. In in vitro stems extracts, the quantity of catechin and caffeic acid waslower compared to in vivo buckwheat stems, but the quantity of chlorogenic acid in in vitrostems increased by 78%. Catechins possess rather potent antioxidant properties (Bronner et al,1998) and we confirmed low content of catechins and AOX in in vitro buckwheat stems. GoliszB350

Budapest, Hungary, 2011AGRISAFEet al, (2007) detected epicathechin, catechin, gallic acid, chlorogenic acid, quercetin, and rutin infield-grown buckwheat plants at the full-flowering stage. Our results show that quercetin,catechin, epicatechin as well as chlorogenic, caffeic, vanilic, p-coumaric, ferrulic, and gallicacids, were identified in the leaves and stems of the 10-days buckwheat sprouts.AFigure 4. Fractionation of the phenolics extract of buckwheat leaves (A) and stems (B) in vitro by HPLC at 330 nm.Peak numbers: (1) caffeic acid RT 2.1 (2) catechin RT 3.9 (3) vanillic acid RT 4.4 (4) epicatechin RT 7.17 (5) gallicacid RT 7.50 (6) p-coumaric acid RT 9.59 (7) ferulic acid RT 10.70 (8) chlorogenic acid RT 12.6; (9) RT 14.37; (10)ethylgallate RT 15.71 (11) epigallocatechin gallate RT 17.15 (12) quercetin RT 27.01ConclusionsThe synthesis of phenolics in buckwheat seedlings differs in in vitro and in vivo conditions.Especially in in vivo stems of buckwheat the content of chlorogenic acid was very high (836,36 µmol ml -1 ), while in in vitro leaves only 654.67 µmol ml -1 of sample was extracted. Theprofile of the individual phenolic acids was the same in in vivo and in vitro cultures, but thecontent of individual compounds differed between the two cultivation systems. In vivo leaveand stem extracts were characterized by higher AOX, total phenolic, as in vitro, which could bethe evidence of the dependence of phenolics and anthocyanins biosynthesis on light (24 hoursin greenhouse). The obtained results confirmed our suggestion about the dependence betweenthe content of phenolics and AOX.ReferencesArnon D. I. (1949): Copper enzymes in isolated chloroplasts: Polyphenoloxidases in Beta vulgaris , Plant Physiol,. 24, 1-15.Bronner W.E., & Beecher G.R. (1998): Method for determining the content of catechins in tea infusions by high-performanceliquid chromatography. Journal of Chromatography A, 805 137-142.Golisz A., Lata B., Gawronski S., & Fujii Y. (2007): Specific and total activities of the allelochemicals identified inbuckwheat. Weed Biology and Management, 7, 164-171.Kim S. J., Tomoo M., Mohammed Z. I. S., Shigenobu T., Chie M. E., Hiroaki Y., Yuji M., Kasuichi S., Naoto H., TakahiroN., Tatsuya S. & Tatsuro S. (2007): Identification of Anthocyanins in the Sprouts of Buckwheat. J.Agric.Food Chem., 55,6314-6318.Kim S. L., Kim S. K., & Park C. H. (2004): Introduction and nutritional evaluation of buckwheat sprouts as a new vegetable.Food Research International, 37, 319-327.Kim S. L., Zaidul I.S.M., Suzuki T., Yuji M., & Naoto H. (2008): Comparison of phenolic compositions between common andtartary buckwheat (Fagopyrum) sprouts. Food Chemistry, 110, 814-820.Matkowski Adam (2008): Plant in vitro culture for the production of antioxidants-a review. Biotechnology Advances, 26 (6),548-560.Molyneux P. (2004): The use of the stable free radical diphenylpicrylhydrazyl (DPPH) for estimating antioxidant activitySongklanakarin. J.Sci.Technol., 26 (2), 211-219.Murashige T, & Skoog F. (1962): A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol. Plant,15: 473-497.Singleton, V. L. & Rossi, J. A. (1965): Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents.Am.J. Enol. Vitic., 16, 144-58.Watanabe, M., & Shimizu, H. (2004): Composition of flavonoid compounds in seedlings of tatary buckwheat. Tohoku Agric.Res., 57, 267-268.Yao, L. H., Jiang, Y. M., Shi, J., Tomas-Barberan, F. A., Datta, N., & Singanusong,R., (2004): Flavonoids in Food and TheirHelth Benefits. Plant Foods for Human Nutrition, 59, 113–122.B351

AGRISAFE Budapest, Hungary, 2011SOAKING SEEDS IN SALICYLIC ACID MAY IMPROVE THESTRESS TOLERANCE OF PEA PLANTSG. SZALAI 1 – I. MAJLÁTH 1 –V. SOÓS 1 – E. BALÁZS 1 – L. POPOVA 2 – T. JANDA 11 Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungaryszalaig@mail.mgki.hu2 Acad. M. Popov Institute of Plant Physiology, Bulgarian Academy of Sciences, Sofia, BulgariaAbstract Salicylic acid (SA) may be a promising compound for the reduction of abiotic stress sensitivity inplants, since under certain conditions it has been found to mitigate the damaging effects of various stressfactors. However, the background of this effect is not known. In the first set of experiments the possiblemediatory role of SA in protecting plants from cadmium (Cd) toxicity was investigated. Seed pre-treatmentwith SA alleviated the negative effect of Cd on growth, photosynthesis, carboxylation reactions,thermoluminescence characteristics and chlorophyll content, and led to a decrease in the oxidative injuriescaused by Cd. The data suggest that the beneficial effect of SA during the early growth period could be relatedto the avoidance of cumulative damage upon exposure to cadmium, thus reducing the negative consequences ofoxidative stress caused by heavy metal toxicity. The effect of soaking pea seeds in SA solution on agronomicparameters was also investigated. Preliminary tests suggest that SA may improve the yield of pea. In the nextstep the distribution of SA in young pea seedlings grown from seeds soaked in 3 H-labelled SA solution beforesowing was investigated. The most pronounced changes in SA levels occurred in the epicotyl and the seeds.Radioactivity was only detected in the bound form of SA, the majority of which was localized in the seeds, andonly a very low level of radioactivity was detected in the epicotyl. SA pre-treatment increased the expressionof the chorismate synthase and isochorismate synthase genes in the epicotyl. These results suggest that theincreased level of free and bound SA detected in plants grown from seeds soaked in SA solution before sowingis the product of de novo synthesis, rather than having been taken up and mobilized by the plants.Key words: cadmium, gene expression, Pisum sativum L., salicylic acid, seed soakingIntroductionSalicylic acid (SA) has been known as a signal molecule in the induction of defencemechanisms in plants for a long time (Raskin 1992; Shah 2003). Recent studies point outthat it also participates in the signalling of abiotic stresses (Horváth et al., 2007).The results suggest that SA could be a promising compound for the reduction of abioticstress sensitivity in plants, since under certain conditions it has been found to mitigatethe damaging effects of various stress factors (Horváth et al., 2007). Several methods ofapplication (soaking seeds in SA prior to sowing, adding SA to the hydroponic solution,irrigating or spraying with SA solution) have been shown to protect various plant speciesagainst abiotic stress factors such as heavy metals (Krantev et al., 2008), hightemperature (Dat et al., 1998), chilling (Janda et al., 1999; Szalai et al., 2000) or salinity(El-Tayeb, 2005; Szepesi et al., 2009) by inducing a wide range of processes involved instress tolerance mechanisms. SA was also shown to influence a number of physiologicalprocesses, including seed germination, fruit yield, flowering, ion uptake and transport,photosynthetic rate, stomatal conductance, etc. (Raskin 1992). It may induce heatproduction, due to the enhanced activity of the cyanide-resistant or alternative respirationchain. However, SA is part of an extremely complex signal transduction network, andseveral questions about the mode of action of SA are still unanswered. First of all, it isnot clear whether the effects of exogenous SA are direct or whether they are connectedwith that of endogenous SA. Furthermore, many related compounds, especially itsputative precursors, exert similar effects. It has also been shown that pre-soaking seedsin SA can protect the plants against abiotic stresses (El-Tayeb, 2005; Szepesi et al.,2008; Popova et al., 2009), but the background of this effect is not known. The aim ofthe present work was to investigate (a) the effect of exposure of pea plants to Cd during352

Budapest, Hungary, 2011AGRISAFEearly stages of their establishment after SA pre-treatment; (b) the distribution of SA inyoung pea seedlings following SA pre-treatment of the seeds, and the changes inducedby SA pre-soaking in certain metabolic pathways (polyamines, antioxidant enzymes),which could be a part of this increased stress tolerance.Materials and methodsSeeds of pea (Pisum sativum L.) plants were soaked in distilled water, or in 0.1 or 0.5mM SA (100 seeds in 100ml) for 24 hours, then sown in trays containing 3:1 (v:v)loamy soil and sand. For the labelled experiments radioactive SA (ring 3 H; 296 kBq/100ml; SA concentration 0.5 mM) was used for soaking. For Cd stress experiments theseeds were germinated for three days on wet filter paper after SA pre-soaking, afterwhich the seedlings were grown in Hoagland solution. The plants were grown at 22/20°C with 16/8-h light/dark periodicity in a Conviron PGR-15 plant growth chamber forseven days. The photosynthetic photon flux density was 340 µmol m -2 s -1 , provided bymetal halide lamps, with a relative humidity of 75%. Shoots, epicotyls, seeds and rootswere collected for analysis. Photosynthesis parameters were measured according toPopova et al. (2099). SA content and gene expressions were determined as describedearlier (Szalai et al., 2011).Results and discussionSeveral papers have been published in the last decade demonstrating the role of SA invarious physiological processes, especially in stress responses. The positive effects ofgrain soaking in SA have been reported under Cd stress conditions (Krantev et al., 2008,Popova et al., 2009). Pre-soaking of pea seeds for 6 h with 500 mM SA before exposureto Cd had a beneficial effect on growth, photosynthesis, carboxylation reactions,thermoluminescence characteristics and chlorophyll content, and led to a decrease in theoxidative injuries caused by Cd. Although SA participates in the development of stresssymptoms, it is also needed for the adaptation process and the induction of stresstolerance. Most abiotic stresses increased the plant concentration of SA, which points toits involvement in stress signalling. SA is a direct scavenger of hydroxyl radicals and aniron-chelating compound, thereby inhibiting the direct impact of hydroxyl radicals aswell as their generation via the Fenton reaction (Dinis et al., 1994). The high levels ofSA observed after treatment with Cd may act directly as an antioxidant to scavenge thereactive oxygen species and/or indirectly modify the redox balance through theactivation of antioxidant responses. According to Guo et al. (2007), exogenous SAinduced Cd tolerance in rice by enhancing antioxidant defence activities. Evidence hasbeen presented showing that not only SA but also other related compounds, such as o-HCA, could induce protection against abiotic stress (Janda et al., 2000). On the basis ofthe ability of o-HCA to quench singlet molecular oxygen, it was suggested that it mayplay a role in the antioxidative response (Foley et al., 1999). Several explanations havebeen suggested to account for the positive effect of SA in attenuating Cd stress in peaplants: i. SA prevents cumulative damage development in response to Cd. Thissuggestion is supported by lower root Cd level in SA-pretreated pea plants. Similar datawere reported by Szalai et al. (2005) in maize. Cd is usually accumulated in the roots,because this is the first organ exposed to heavy metals in the soil, but it is alsotranslocated into the shoots. Obviously the lower root Cd level in SA-pretreated peaplants reduced the harmful effect of Cd and exerted a beneficial effect on growth and353

AGRISAFE Budapest, Hungary, 2011photosynthesis. ii. SA alleviates the oxidative damage caused by Cd. The values ofMDA, electrolyte leakage and proline content in SA-pretreated plants were lower thanthose in plants exposed to Cd.Studies were also made on the mechanism of the protection provided by soaking seeds inSA before sowing. A concentration-dependent increase in both the free and bound SAcontents of the seeds was observed (Szalai et al., 2011). It can be assumed that theincrease in the free SA form in the seeds originates at least in part from the SA used forthe seed soaking procedure. However, radioactivity could only be detected in the boundform of SA, not only in the seeds, but also in the epicotyl, indicating that the absorbedSA was converted to the bound form. The level of radioactivity detected from bound SAin the epicotyl, on the other hand, was far lower than expected based on the increase inthe SA quantity. So what is the source of the increased SA level in organs other than theseed, especially in the epicotyl, where the highest level of changes was detected? Largequantities of both free and bound SA accumulated in the epicotyl, but a low level ofradioactivity was only detected in the bound form, suggesting that the free SA in theepicotyl did not originate from that absorbed by the seeds. To confirm this, theexpression of the ICS and CS genes was analysed. The SID2 gene encodes isochorismatesynthase (ICS1), an enzyme in the SA biosynthesis pathway. Mutants with a defect inSID2 contain strongly reduced levels of SA, suggesting that, in Arabidopsis, SA ispredominantly produced from isochorismate and from not phenylalanine, as previouslythought (Mukherjee et al., 2010). Pre-soaking the seeds in SA solution induced theexpression of the CS and ICS genes in the epicotyl. This gene expression pattern wassimilar to that observed for SA accumulation.ConclusionsSoaking seeds in SA was found to have a protective role during Cd stress in pea plants.The evidence could explain to some extent the defence mechanisms induced by SA inthe photochemical activity of chloroplast membranes and photosynthetic carboxylationreactions. The results also suggest that the increased level of free and bound SA detectedin plants growing from seeds soaked in SA solution before sowing is the product of denovo synthesis, rather than having been taken up and mobilised by the plants.AcknowledgementsThis work was supported by grants from EU-FP7-REGPOT 2007-1 (AGRISAFE No.203288) and the National Scientific Research Fund (NKTH/OTKA K68158).ReferencesDat, J. F., Lopez-Delgado, H., Foyer, C. H., Scott, I. M. (1998): Parallel changes in H 2 O 2 and catalase duringthermotolerance induced by salicylic acid or heat acclimation in mustard seedlings. Plant Physiol. 116,1351-1357.Dinis, T. C., Maderia, V. M., Almeida, L. M. (1994): Action of phenolic derivates (acetaminophen, salicylate,and 5-aminosalicylate) as inhibitors of membrane lipid peroxidation and as peroxyl radical scavengers.Arch. Biochem. Biophys. 315, 161–169.El-Tayeb, M. A. (2005): Response of barley grains to the interactive effect of salinity and salicylic acid. PlantGrowth Regul. 45, 215-224.Foley, S., Navaratnam, S., McGarvey, D. J., Land, E. J., Truscott, G., Rice-Evans, C. A. (1999): Singletoxygen quenching and redox properties of hydroxycinnamic acids. Free Rad. Biol. Med. 26, 1202–1208.Guo, B., Liang, Y.C., Zhu, Y.G., Zhao, F. J. (2007): Role of salicylic acid in alleviating oxidative damage inrice roots (Oriza sativa) subjected to cadmium stress. Environ. Pollut. 147, 743–749.354

Budapest, Hungary, 2011AGRISAFEHorváth, E., Szalai, G., Janda, T. (2007): Induction of abiotic stress tolerance by salicylic acid signaling. J.Plant Growth Regul. 26, 290-300.Janda, T., Szalai, G., Tari, I., Páldi, E. (1999): Hydroponic treatment with salicylic acid decreases the effect ofchilling injury in maize (Zea mays L.) plants. Planta 208, 175-180.Janda, T., Szalai, G., Antunovics, Z., Horváth, E., Páldi, E. (2000): Effect of benzoic acid and aspirin onchilling tolerance and photosynthesis in young maize plants. Maydica 45, 29-33.Popova, L. P., Maslenkova, L. T., Yordanova, R. Y., Ivanova, A. P., Krantev, A. P., Szalai, G., Janda, T.(2009): Exogenous treatment with salicylic acid attenuates cadmium toxicity in pea seedlings. PlantPhysiol. Biochem. 47, 224-231.Raskin, I. (1992): Role of salicylic acid in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43, 439-463.Shah, J. (2003): The salicylic acid loop in plant defense. Curr. Op. Plant Biol. 6, 365-371.Szalai, G., Horgosi, S., Soós, V., Majláth, I., Balázs, E., Janda, T. (2011): Salicylic acid treatment of pea seedsinduces its de novo synthesis. J. Plant. Physiol. 168, 213-219.Szalai, G., Pál, M., Horváth, E., Janda, T., Paldi, E. (2005): Investigations on the adaptability of maize linesand hybrids to low temperature and cadmium. Acta. Agron. Hung. 53, 183–196.Szalai, G., Tari, I., Janda, T., Pestenácz, A., Páldi, E. (2000): Effects of cold acclimation and salicylic acid onchanges in ACC and MACC contents in maize during chilling. Biol. Plant. 43, 637-640.Szepesi, Á., Csiszár, J., Gallé, Á., Gémes, K., Poór, P., Tari, I. (2008): Effects of long-term salicylic acid pretreatmenton tomato (Lycopersicon esculentum Mill. L.) salt stress tolerance: changes in glutathione S-transferase activities and anthocyanine contents. Acta Agron. Hung. 56, 129-138.Szepesi, Á., Csiszár, J., Gémes, K., Horváth, E., Horváth, F., Simon, M. L., Tari, I. (2009): Salicylic acidimproves acclimation to salt stress by stimulating abscisic aldehyde oxidase activity and abscisic acidaccumulation, and increases Na+ content in leaves without toxicity symptoms in Solanum lycopersicum L.J. Plant Physiol. 166, 914-925.355

AGRISAFE Budapest, Hungary, 2011GENOTYPE BY ENVIRONMENT INTERACTIONS FOR GRAINYIELD OF WHEAT CULTIVARS GROWN IN BULGARIAN. TSENOV 1 - D. ATANASOVA 1 - T. GUBATOV 21 Dobrudzha Agricultural Institute, BG-9520, General Toshevo, Bulgaria, e-mail: dai_gt@dobrich.net2 Agronom I Holding, BG-9300, Dobrich, BulgariaAbstract The aim of this investigation was to find out the nature of the interaction between the grain yield of agroup of cultivars distributed in production under the environmental conditions in Bulgaria, as well as to selectappropriate criteria for the adequate evaluation of their stability. The genotype x environment interaction forgrain yield was significantly high and non-linear. Significant variations were found between the growingconditions at the respective locations regardless of the year. The correlations between grain yield and therespective parameters characterizing stability showed that some of them can be successfully used for reliableevaluation of the combination between high yield and ecological stability. Such parameters were [Ysi],[HARV] and [Х-bi]. As well as for grain yield, the investigated cultivars also differed for their stability underchangeable environments. The cultivars Todora, Enola and Aglika, and the newly released Zlatitsa and Slaveyademonstrated high production potential and yield stability, exceeding the cultivars used in mass distribution inthe preceding years.Key words: wheat, grain yield, cultivars, genotype x environment, stabilityIntroductionThe stable expression and wide adaptation of the cultivars with regard to yield and thequality indices has been the objective of many breeding programs (Aminzadeh, 2010,Parveen et al., 2010, Sharma et al., 2010). According to the Canadian researchers Yanand Hunt (1998, 2001), the analysis of the genotype x environment interaction issignificant at all levels of the breeding process. It is worth mentioning that high yieldstability and other traits are often related to their low level of expression, and vice versa(Atanasova et al., 2010; Tsenov et al., 2004). Breeding under equal conditions does notprovide advantage under changeable conditions (Tarakanovas and Ruzgas, 2006);therefore the study on the effects on the genotype x environment interaction would helpdetermining the breeding directions, selecting the most suitable testing conditions andmaking optimal varietal distribution. Numerous statistical methods and procedures havebeen developed to facilitate breeders when interpreting the genotype x environmentinteraction and assessing stability and their interactions (Annicchiarico, 2002, Crossaand Franco, 2004, Pacheco et al. 2005, Purchase 1997).On the basis of such researches, anumber of specialized statistical software were developed for evaluation and breeding ofcereals and other crops (Ukai et al, 1996, Yan and Kang 2003).The aim of this investigation was to find out the nature of the interaction between thegrain yield (GY) of a group of cultivars distributed in production and the environmentalconditions in Bulgaria, as well as to select appropriate criteria (parameters) for adequateevaluation of their stability.Materials and methodsThirty-five Bulgarian bread winter wheat cultivars were investigated; they are includedin the National Varietal List of Bulgaria and have been grown during the last years inmass production. They have been grown in eight locations of different soil and climaticconditions during two successive years. At each location the trial was performed in 4replications, the plot size being 15 m 2 , after predecessor sunflower, which is the mostcommon previous crop in Bulgaria. All trial fields were treated prior to sowing with 200kg ha -1 ammophos and were fertilized in spring with 200 kg ha -1 stabilized ammonium356

Budapest, Hungary, 2011AGRISAFEnitrate during both years of investigation in accordance with the mass production. Theprocessing and analysis of the primary data was performed with XLSTAT 2009. Theanalysis of the genotype x environment interaction was done using statistical programGEST (Ukai et al, 1996). The following genotype stability parameters were calculated:mean value, coefficient of regression [bi] and stability variance [S 2 ], ecovalence [W 2i ]according to Wricke (1962), residual MS about the regression [σ 2 i] according to Shukla(1972), environmental variance [S 2 i] and coefficient of variation [CVi] according to(Francis and Kannenberg, 1978), yield-stability parameter [Ys i ] according to Kang andMagari (1995).Results and discussionThe analysis of variances for grain yield revealed interaction between all environmentalfactors (Table 1). According to the values of F index, the effect of the location washighest, followed by the year, and the direct effect of the variety was lowest. There was asignificant interaction between the three main factors: the interactions between cultivar xyear and cultivar x location were almost similar. This implies that the grain yield of eachcultivar is the result of complex and specific combination between all environmentalfactors, including the presence or absence of stress.Table 1. ANOVA of the genotype by environment interactionSource ofvariationTotal(G) Genotype(Y) Year(L) LocationInteractionsG x YG x LHeterogeneityBalancedf 559 34 15 7 510 69 279 34 476F 13.6 21.2 180 2.86 2.75 3.11 6.83 2.58p 0.0000 0.0003 0.0000 0.0024 0.0019 0.0021 0.0008 0.0022The effects caused by the linear character of the interaction (Heterogeneity), as well asthe non-linear interactions (Balance) between the cultivar and the environment were wellexpressed. In this case, when the non-linear interactions were predominant, it wasinteresting to follow the response of each cultivar to the specific environmentalconditions. Such data would be useful for proper assessment of the suitability andnumber of locations for testing, and for evaluation of the economic traits of each wheatcultivar.Table 2. Spearman correlations between GY and statistical parametersVariables bi X-bi SV HV s 2 σ 2 W 2 Ysi HARVTotal GY -0.452* 0.971 -0.454 -0.505 -0.392 -0.381 -0.673 0.874 0.995Low GY -0.575 0.882 -0.671 -0.671 -0.912 -0.858 -0.858 0.548 0.996High GY -0.244 0.924 -0.325 0.271 -0.228 -0.033 -0.233 0.854 0.813* Values in bold are significant at p=0.05X-b i -index of general adaptation (GY-b i ); SV-stability variance; HV-variance of heterogeneity; s 2 -stabilityvariance; σ 2 -residual MS about the regression; W 2 -ecovalence; Ys i -yield-stability parameter; HARV-Heritability Adjusted Relative ValueCultivars with high yield potential combined with good adaptability should be used forproduction of winter wheat. To evaluate a cultivar for such a combination, appropriatechoice of one or several parameters should be used as criterion for assessment. Therefore357

AGRISAFE Budapest, Hungary, 2011the correlations of grain yield with the values of each analyzed parameter (Table 2) werecalculated for each cultivar.According to the correlations of yield with the parameters, these parameters can beconditionally divided into three groups: 1) with significant and positive correlation: [Хbi],[Ysi], [HARV], 2) with significant but negative correlation: [bi], [SV], [HV], [σ 2 ]and [W 2 ]; and 3) with insignificant high correlation with grain yield: [s 2 ]. The observedpositive correlations are logical because the parameters themselves were thus constitutedso that their values give a compromise evaluation between the levels of yield and itsstability.To avoid any uncertainty in the choice of parameters as criteria, the correlations of twogroups of cultivars were calculated, involving 10 cultivars from each group with thehighest and the lowest yield. It was found out that parameters [Х-bi], [Ysi] and [HARV]were in very high correlation with the productivity of the cultivar. In the group of highyieldingvarieties, however, the observed negative correlations with some of theparameters were low and insignificant in contrast to that of the entire group of cultivars.The presence of high and negative correlations with the stability variances [SV],heterogeneity variances [HV], the coefficient of regression [bi] and the ecovalence [W2]were an indication that they could also be considered criteria in the negative sense whenevaluating a cultivar. The correlations between the parameters in positive relation tograin yield [Ysi], [Х-bi] and [HARV] (data not given) were also high (r= 0.85*** – 0.95***). Therefore, when evaluating and distributing a new variety, it should be comparedby the values of some of these parameters that would exactly determine its position inthe group, together with the cultivars already distributed. Most convenient is the index ofgeneral adaptation [Х-bi], which requires the calculation only of regressions.It is worth mentioning the performance of cultivar Slaveya which, according to Tsenovet al. (2010), is an excellent combination of yield, quality and stability and whichrealizes high yields (Table 3).Table 3. Values of analyzed parameters of cultivars with stable and unstable grain yield(yield standard – Pryaspa and stability standard - Sadovo 1)Variety GY X-b SV HV σ 2 W2 Ysi HARVTodora 5.37 4.30 1.97 1.93 3.41 1.91 29 112Slaveya 5.26 4.24 2.38 1.49 5.70 3.13 30 110Aglika 5.11 4.15 0.72 1.97 0.95 0.59 25 107Zlatitsa 5.12 4.17 1.48 1.90 1.59 0.93 26 107Enola 5.12 4.17 1.38 1.70 2.44 1.39 22 107Pryspa 5.07 4.08 3.57 1.45 3.62 2.05 20 107Sadovo1 4.86 3.88 1.41 1.47 1.34 0.80 13 102Miryana 4.24 3.06 3.76 5.43 9.62 5.22 0 92Laska 4.18 3.01 5.29 5.46 7.72 4.21 -9 91Prelom 4.11 3.02 6.01 2.43 10.17 5.52 -6 89Murgavets 4.02 2.84 10.89 8.53 17.91 9.64 -5 88Lilia 3.93 2.80 2.66 2.98 14.50 7.82 -10 86The high rank of cultivars Slaveya and Pryaspa is due to yield; the values of [CV] andthe ecovalence [W 2 ] were high, while for cultivars Aglika and Zlatitsa stability washighest (CV and W 2

Budapest, Hungary, 2011AGRISAFEConclusionsThe genotype x environment interaction for grain yield was significantly high and nonlinear.Parameters [Ysi], [HARV] and [Х-bi] can each be used as criterion for evaluationof the value and stability of grain yield under a wide range of environments. Thecultivars Todora, Enola, Aglika, and the newly released Zlatitsa and Slaveyademonstrated high production potential and yield stability, exceeding the cultivars usedin mass distribution in the preceding years.ReferencesAminzadeh, G.R. (2010): Evaluation of seed yield stability of wheat advanced genotypes in Ardabil, Iran,Research Journal of Environmental Science, 4, 478-482.Annicchiarico, P. (2002): Genotype x Environment interactions – challenges and opportunities for plantbreeding and cultivar recommendations, FAO Plant Production and Protection paper, 174, pp. 145.Atanasova, D., Tsenov, N., Stoeva, I., Todorov, I. (2010): Performance of Bulgarian winter wheat varieties formain end-use quality parameters under different environments. Bulgarian Journal of Agricultural Science,16, 22-29.Crossa, J. and Franco, J. (2004): Statistical methods for classifying genotypes, Euphytica 137, 19-37.Francis, T. R. and Kannenberg, L. W. (1978): Yield stability studies in short season maize 1. A descriptivemethod for grouping genotypes, Canadian Journal of Plant Science, 58, 1029-1034.Kang, M. S. and Magari, R. (1995): STABLE: A basic program for calculating stability and yield-stabilitystatistics. Agronomy Journal, 87, 276-277.Pacheco, R.M., Duarte, J.B., Vencovsky, R., Pincheiro, J.B., Oliveira, A.B. (2005): Use of supplementarygenotypes in AAMMI analysis, Theor Appl Genet., 110, 812-818.Parveen, L., Khalil, I. H., Khalil, S. K. (2010): Stability parameters for tillers, grain weight and yield of wheatcultivars in North-West of Pakistan, Pakistan Journal of Botany, 42, 1613-1617.Purchase, J. L. (1997): Parametric analysis to describe genotype x environment interaction and yield stability inwinter wheat, (Ph.D. Thesis), University of Free State, Bloemfontein.Sharma, C. S., Morgounov, A. I., Braun, H. J., Akin, B., Keser, M., Bedoshvili, D., Bagci, A., Martius, C., M.van Ginkel. (2010): Identifying high yielding stable winter wheat genotypes for irrigated environments inCentral and West Asia, Euphytica, 171, 53-64.Shukla G. K. (1972): Some aspects of partitioning genotype-environmental components of variability,Heredity, 28, 237-245.Tarakanovas, P. and Ruzgas, V. (2006): Additive main effect and multiplicative interaction analysis of grainyield of wheat varieties in Lithuania, Agronomy Research, 4, 91-98.Tsenov, N, Kostov, K., Gubatov, T., Peeva, V. (2004): Study on the genotype x environment interaction inwinter wheat varieties. I. Grain quality. Field Crop Studies 1(1), 20-29. (Bg)Tsenov, N., Atanasova, D., Stoeva, I., Petrova, T. (2010): Grain yield, end-use quality and stress resistance ofwinter wheat cultivars Aglika and Slaveya. Agricultural University, Plovdiv, Scientific Works, 55, 27-34.Ukai, Y., Nesuma, H., Takano, Y. (1996): GEST: A package of computer programs for the statistical analysisof genotype x environment interaction and stability, Breeding Science, 46, 73-81 (In Jap).Wricke, G. 1962. On a method of understanding the biological diversity in field research, Z. Phl.-Zücht, 47, 92-146.Yan, W. and Hunt, L. A. (1998): Genotype-by-environment interaction and crop yield, Plant Breeding Review,16, 135-178.Yan, W. and Hunt, L. A. (2001): Interpretation of genotype x environment interaction for winter wheat yield inOntario, Crop Science, 41, 19-25.Yan, W. and Kang, M. S. (2003): GGE biplot analysis, CRC Press, New York.359

AGRISAFE Budapest, Hungary, 2011EFFECTS OF WATER SUPPLY AND ATMOSPHERIC CO 2CONCENTRATION ON THE ROOT DEVELOPMENT OFSORGHUM AND MAIZE PLANTSB. VARGA 1 – R. MANDERSCHEID 21 Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary2 Johann Heinrich von Thunen-Institute, Federal Research Institute for Rural Areas, Forestry and Fisheries,Braunschweig, GermanyAbstract The best way to investigate the effects of elevated CO 2 concentration and other environmental factorson crops in the field over the whole vegetation period is to use free air carbon dioxide enrichment (FACE).Using this method the development of plants can be followed in the field, while numerous parameters can bemodified, such as the water and nutrient supply. The present study was carried out on three FACE rings andthree ambient plots in the Johann Heinrich von Thunen Institute in Braunschweig, Germany. One maize (Zeamays, cv. Simao) and two sorghum cultivars (Sorghum bicolor x bicolor: cv. Bulldozer; Sorghum bicolor xsudanense: cv. Inka) were grown under different CO 2 (380 ppm, 600 ppm) and water supplies (wet and dry).Root length density (RLD) and specific root weight (SRW) were calculated from samples collected fromdifferent soil layers between 0 and 80 cm. RLD and SRW were significantly influenced by the water supplyand genotype. A significant interaction was found between the soil layer and water supply, but a genotypeeffect was typical for the total investigated soil layer. SRW was the most variable parameter among all the rootparameters analysed. Water withholding had a significant effect for all the varieties, but the water supply andthe CO 2 concentration played an outstanding role in the case of Bulldozer. Water shortage resulted finer rootsin Inka, while both water deficit and CO 2 enrichment led to thinner roots in maize in the complete soil profile.Key words: FACE, elevated CO 2 , root system analysis, root length density, maize, sorghumIntroductionFree air carbon dioxide enrichment (FACE) (Lewin et al., 1992) is the best way toinvestigate the effects of elevated carbon dioxide concentration on the phenological andphysiological properties of plants (Erbs et al., 2010; Manderscheid et al., 2009; Weigelet al., 2005). Many results have been published on the above- and below-ground biomassresponses, photosynthesis and water use of sweet sorghum (Sorghum bicolor) grownunder FACE conditions (Cousins et al., 2003; Derner et al., 2003; Matthew et al., 2001;Prior et al., 2008) but very a few results are available on the effect of CO 2 on thedevelopment of the root system (Chaudhuri et al., 1986, Pritchard et al., 2006). Theadvantage of this method is that the development of plants can be followed under realfield conditions over the whole vegetation period. FACE analysis supplemented withrain shelters makes it possible to investigate the interactions between drought and CO 2effects. Roots are often stimulated to a greater extent by the CO 2 supply than the leaves,stems and reproductive structures (Kimball et al., 2002). According to earlier studies in aCO 2 -enriched environment, the roots become more numerous, longer and thicker. Theroot system of CO 2 -enriched crops is often highly branched (Chaudhuri at al., 1986),especially in deeper soil layers, as found for wheat under elevated CO 2 and droughtstress in the field (Burkart et al., 2007).Materials and methodsThe present study was carried out in the Johann Heinrich von Thunen-Institute inBraunschweig, Germany. Six rings (20 m diameter) were arranged within anexperimental field based on previous results from soil structure analysis. Plants weregrown in three control rings (ambient CO 2 concentration: 380 ppm) and in three FACErings (elevated CO 2 concentration: 600 ppm). Each ring was divided in a northern wet360

Budapest, Hungary, 2011AGRISAFEsemicircle and a southern dry semicircle. The dry conditions in the southern subplotswere achieved by using rain shelters, which excluded 176 mm rainfall during summer.Crops of maize and sorghum were grown according to normal agricultural practice. Inthe present study maize (Zea mays, cv. Simao) and two sorghum genotypes (Sorghumbicolor x bicolor: cv. Bulldozer; Sorghum bicolor x sudanense: cv. Inka) wereexamined. All the varieties were bred by KWS Ltd.In each of the six semicircles a soil core sample with 10 cm of diameter was taken foreach cultivar from a depth of 0-80 cm depth was taken per plant cultivar. The wholesample was separated into three subsamples: 0-40 cm; 40-60 cm and 60-80 cm. Theupper soil layer was separated into two equal sub samples, only one of which wasanalysed. The soil samples were collected at points a quarter of the row distance (0.75m) between the plants. The soil samples were dried and sieved with differentperforations (2*10 -3 m and 10 -3 m) to segregate the roots. Subsequently, the roots werewashed with distilled water and frozen till the determination of root length and dryweight. Root length density (RLD) (m*m -3 ) was determined from digital images madewith a high resolution CCD camera using the IMAGE P2 software package. Specificroot weight (SRW) (mg*m -1 ) was calculated as the quotient of the root dry weight andthe root length of a sample.Results and discussionRoot length density was influenced by the CO 2 treatments and by the soil layers atlimited water supply as well as by the characteristic of the cultivars. Differences werefound between the genotypes on the basis of the reactions to elevated CO 2 and watersupply levels. The water treatments did not influence the RLD between 0-80 cm atelevated CO 2 concentration, but water shortage decreased the root density of all thevarieties at ambient CO 2 concentration (Fig. 1). Water withdrawal increased RLD in thedeep soil layer (60-80 cm) by 484 m*m -3 for maize and by 316 m*m -3 for Bulldozer atelevated CO 2 . Elevated CO 2 concentration resulted in a more developed root system forboth maize and sorghum, but significant differences were found between the varietieseven at greater depth. The CO 2 effect on RLD was strongest in the case of low wateravailability. Elevated CO 2 increased the RLD of Bulldozer by 21 % (wet) and 52 % (dry)and that of maize by 9% (wet) and 26% (dry). For maize the RLD in the middle layer ofthe soil was increased by CO 2 enrichment to 804 m*m -3 (wet) and 638 m*m -3 (dry),respectively. Water withholding also caused a higher RLD level (233 m*m -3 ) at ambientCO 2 concentration. Higher RLD values were observed for Bulldozer. Both CO 2enrichment and water withholding decreased RLD at the depth of 40-60 cm, whichmeans that elevated CO 2 resulted in higher RLD in the upper soil, while both CO 2enrichment and water shortages resulted in RLD increases in deeper soil layer. Decreasein RLD was 18% at normal water supply and 34.1% in the case of water deficit. RLDwas outstanding high in the upper soil in the sudan grass compared to the other plants.Water withdrawal decreased RLD by 25% in the upper soil at ambient CO 2concentration but this tendency was compensated for by CO 2 enrichment (the decreasewas 6.4 % at elevated CO 2 ). The RLD of maize decreased by 25.3% and 18.1% inresponse to limited water supplies at normal and elevated CO 2 , respectively. ElevatedCO 2 resulted in higher RLD values at both water levels, with values of 38.3% and 47%.Specific root weight was the most fluctuating variable among the root parameters, beingdependent on both water supply and plant properties. Watering had a significant effect361

AGRISAFE Budapest, Hungary, 2011for all the varieties, but for Bulldozer the outstanding role of both water supplies andCO 2 concentration was determined.Figure 1. Root length density between 0 and 80 cm Figure 2. Specific root weights between 0and 80 cm[ww: well watered, ws: water stressed]In the case of Inka water shortage resulted in finer roots in the complete soil profile. Atlow water supplies SRW was significantly influenced by the interaction of CO 2concentration and soil layer. Bulldozer developed thicker roots than the other twovarieties regardless of the water and CO 2 treatments. At normal CO 2 concentrationdifferences were found only between the varieties, but the water supply had a significanteffect at elevated CO 2 for all the varieties (Fig. 2). For Bulldozer CO 2 enrichmentdecreased the SRW in the all soil layers, especially under drought conditions. SRWreduction was more intensive on the FACE plots, which could be attributed to themodified water use of plants in a CO 2 -enriched environment. The SRW in the upper soilwas not influenced either by the soil water level or by CO 2 concentration in Inka. TheCO 2 surplus resulted in thicker rots and water withdrawal in thinner roots in the middleand deep soil layers in the case of sudan grass. Maize responded to water shortage andCO 2 enrichment with thinner roots in the complete soil profile but in the case of sudangrass decreasing SRW values were observed. Sweet sorghum developed thinner roots inresponse both to water shortage and increased CO 2 concentration. The CO 2 treatmentincreased SRW at depths between 60 and 80 cm at normal water supplies but decreasedit under dry condition by Bulldozer. Water shortage only resulted in thinner roots atelevated CO 2 level (55.7% compared to the well-watered plots). A decrease in SRW (-58.6%) caused by water withdrawal was also observed in the Inka at elevated CO 2concentration. In the middle soil layer CO 2 enrichment resulted in an increase in SRW inmaize (95.2% and 106.7% compared to the ambient CO 2 concentration at normal andlimited water supplies) and water shortage also caused higher SRW values (153.6% and168.7% compared to normal water supplies at ambient and elevated CO 2 ). Elevated CO 2concentration increased the specific root weight in Inka (63.9% and 84.6% at the twowater supply levels), but water withdrawal resulted in finer roots with a decrease inSRW of 52% and 46.3% at ambient and elevated CO 2 , respectively. In the case of sweetsorghum both water shortage and CO 2 enrichment resulted in finer roots. No CO 2 effectwas found in the upper soil layer. Limited water supplies increased SRW to a moderatelyextent (21% and 44.5% at the different CO 2 concentrations) in the case of maize but inBulldozer a decrease in SRW was observed (22% and 28% at ambient and elevatedCO 2 ).362

Budapest, Hungary, 2011AGRISAFEConclusionsInvestigations on the root development of sorghum and maize plants revealeddifferences between the reactions of individual genotypes to modifications inenvironmental factors. Significant differences were found between the cultivars in theirresponses to water supply and particularly to CO 2 enrichment. Higher root density wasfound for maize at elevated CO 2 concentration in all the soil layers (0-80 cm) while inthe case of sorghum CO 2 enrichment decreased root density in the middle layer (40-60cm). In the case of maize drought and CO 2 enrichment resulted in thicker roots.However, sorghum had finer roots at elevated CO 2 . According to the results of thepresent study, it is possible to select cultivars which are able to adapt to aridenvironments through the modification of the root system.AcknowledgementsThis paper was financially supported by the AGRISAFE (EU-FP7-REGPOT 2007-1 No.203288) project.ReferencesChaudhuri, U.N., Burnett, R.B., Kirkham, M.B., Kanemasu. E.T. (1986): Effect of carbon dioxide on sorghumyield, root growth and water use. Agric. For. Meteorol., 37, 109-122.Cousins, A.B., Adam, N.R., Wall, G.W., Kimball, B.A., Pinter, P.J., Ottman, M.J., Leavitt, S.W., Webber,A.N. (2003): Development of C4 photosynthesis in sorghum leaves grown under free-air CO 2 enrichment(FACE). J. Exp. Bot., 54, 1869-1975.Burkart, S., Manderscheid, R., Weigel, H.-J. (2004). Interactive effects of elevated atmospheric CO 2concentrations and plant available soil water content on canopy evapotranspiration and conductance ofspring wheat. Eur. J. Agron. 21, 401-417.Derner, J.D., Johnson, H.B., Kimball, B.A., Pinter, P.J., Polley, H.W., Tischler, C.R., Boutton, T.W., LaMorte,R.L., Wall, G.W., Adam, N.R., Leavitt, S.W., Ottman, M.J., Matthias, A.D., Brooks. T.J. (2003): Aboveand below-ground responses of C3-C4 species mixtures to elevated CO 2 and soil water availability. Glob.Chan. Biol., 9, 452-460.Erbs, M., Manderscheid, R., Jansen, G., Seddig, S., Pacholski, A., Weigel, H.J.( 2010): Effects of free-air CO 2enrichment and nitrogen supply on grain quality parameters and elemental composition of wheat andbarley grown in crop rotation. Agric. Ecosyst. Environ., 136, 59-68.Kimball, B.B., Kobayashi, K., Bindi, M. (2002): Responses of agricultural crops to free-air CO 2 enrichment.Adv. Agron., 77, 293-368.Lewin, K.F., Hendrey, G.R., Kolber, Z. (1992): Brookhaven national laboratory free-air carbon dioxideenrichment facility. Crit. Rev. Plant. Sci., 11, 135-141.Manderscheid, R., Pacholski, A., Frühauf, C., Weigel, H.-J. (2009): Effects of free air carbon dioxideenrichment and nitrogen supply on growth and yield of winter barley cultivated in a crop rotation. FieldCrop Res., 110, 185–196.Matthew, M.C., Kimball, B.A., Brooks. T.J., Pinter, P.J., Hunsaker, G.W., Wall, G.W., Adam, N.R., LaMorte,R.L., Matthias, A.D., Thompson, T.L., Leavitt, S.W., Ottman, M.J., Cousins, A.B., Triggs, J.M., 2001:CO 2 enrichment increases water-use efficiency in sorghum. New. Phytol., 151, 407-412.Prior, S.A., Torbert, H.A., Runion, G.B., Rogers, H.H., Kimball, B.A. (2008): Free-air CO 2 enrichment ofsorghum: soil carbon and nitrogen dynamics. J. Environ. Qual., 37, 753-758.Pritchard, S.G., Stephen, A.P., Rogers, H.H., Davis, M.A., Runion, G.B., Popham, T.W. (2006): Effects ofelevated atmospheric CO 2 on root dynamics and productivity of sorghum grown under conventional andconservational agricultural management practices. Agric. Ecosyst. Environ., 113, 175-183.Weigel, H.-J., Pacholski, A., Burkart, S., Helal, M., Heinemeyer, O., Kleikamp, B., Manderscheid, R., Frühauf,C., Hendrey, G.R., Lewin, K., Nagy, J. (2005). Carbon turnover in a crop rotation under free air CO 2enrichment (FACE). Pedosphere, 15, 728–738.363

AGRISAFE Budapest, Hungary, 2011INFLUENCE OF LIMING AND MINERAL FERTILIZATION ONSOIL CHEMICAL PROPERTIES AND ON THE GRAIN ANDSTRAW YIELD OF WINTER WHEATV. ZEBEC – D. RASTIJA – Z. LONČARIĆ – Z. SEMIALJAC – M. MARTIĆFaculty of Agriculture in Osijek, University of J. J. Strossmayer, Trg. Sv. Trojstva 3, HR-31000 Osijek,Croatia, e-mail: vzebec@pfos.hrAbstract The aim of this paper was to compare the impact of liming, eight years after application, and ofmineral fertilization on soil chemical properties and on the grain and straw yield of wheat. The soil wasdetermined as a dystric luvisol with low pH and low nutrient availability. The field trial was set up in arandomized block design in three replicates in Zelčin (45°36'45.48"N, 18°22'4.74" E) in eastern Croatia. Thetreatments were: 1. control, 2. liming (10 t ha -1 carbocalc), 3. mineral fertilization (160 kg N ha -1 , 150 kg P 2 O 5ha -1 , 200 kg K 2 O ha -1 ), 4. liming and mineral fertilization, 5. liming and double mineral fertilization (240 kg Nha -1 , 300 kg P 2 O 5 ha -1 , 300 kg K 2 O ha -1 ). In the vegetative season of 2009/2010 the research area had 924.4 mmof rainfall, which represents an increase of 83.9% compared to the long-term mean. The monthly meantemperature was 9.9°C, which is an increase of 0.36°C compared to the long-term mean. The results show thatliming increased the soil pH (KCl), while mineral fertilization acidified the soil. Mineral fertilizationsignificantly increased the soil-available phosphorus and potassium. The significantly lowest wheat grain yieldwas achieved in the control treatment (2.14 t ha -1 ). Liming significantly increased the grain yield (0,68 t ha -1 ) intreatments with mineral fertilization, but non-significantly (0,43 t ha -1 ) without fertilization. The winter wheatgrain yield was significantly increased by mineral fertilization (1.7 t ha -1 for fertilization without liming, 2.38 tha -1 with liming), while double mineral fertilization decreased the grain yield (0.48 t ha -1 ) compared to standardfertilization. Mineral fertilization increased the straw yield, which was not affected by liming or doubledmineral fertilization.Key words: liming, mineral fertilization, winter wheat, soil chemical propertiesIntroductionThe actual wheat production quantity in Croatia (2010.) amounted to 610 thousandtonnes with average grain yield 4,2 t ha -1 , which was by 35% less than the last year’sactual yield (Croatian Bureau of Statistics, 2010.). Acid soils are limiting factor of thefield crops yield in the Eastern Croatia. Heavy application of mineral fertilizers, basecations leaching and removal with harvested crops lead to soils acidification andresulting in reduced field crops yield.(Rastija et al., 2007.). Liming is one of the basicagromeliorative procedures on acid soils, because through neutralization acid reactions itallows proper supplies of micro and macro biogenic elements to plants (Ćurko et al.,2009.) and also significantly improves plant mineral composition (Karalić et al. 2007).Kovačević et al. (2010) have found considerable residual effects of liming on wheatyields because on unlimed plots wheat yielded 5,04 t ha -1 while liming effects were upto 42 % (range from 6,85 to 7,14 t ha -1 ). Combined application of fertilizers (NPK)increased yields of crops sensitive to soil acidity in plots receiving lime by 23% incomparison to crops grown on unlimed soils (Jankauskas et al., 2004). Also, resultsfrom the four decades experiment on acid soil in India (Sarkar et al., 1998) show thatconsistently higher grain yields were obtained by applying lime and NPK.Materials and methodsThe field trial was setup in a randomized block design in three replicate in Zelčin(45°36'45.48"N, 18°22'4.74" E) in the eastern Croatia. Soil was determined as a dystricluvisol with low pH and low nutrients availability (Table 1). The soil pH (H 2 O and MKCl, 1:5 v/v) were determined according to ISO (ISO 10390: 1994(E)), plant availablephosphorus and potassium by ammonium-lactate extraction (Egner et al., 1960),364

Budapest, Hungary, 2011AGRISAFEhydrolytic acidity by Na-acetate extraction and soil organic matter content bysulfocromic oxidation [ISO 14235, 1998(E)].Table 1. Soil chemical properties (0-30 cm) in 2002pH (H 2 O) pH (KCl) P 2 O 5 (mg kg -1 ) K 2 O (mg kg -1 )Organic matter(%)Hy (cmol (+) kg -1 )5.37 4.09 70.1 182.2 1.45 3.92In the autumn of 2002 soil was limed with 10 t ha -1 carbocalc (total Ca content 344 g kg -1 ) on the soil depth up to 30 cm. Following seven years plots were fertilized with threedifferent nutrient amounts what resulted in five different treatments (Table 2.)Table 2. Different liming and mineral fertilization treatments0 (control) Ca NPK Ca+NPK Ca+N 2 P 2 K 2nolimingliming(10 t ha -1 carbocalc)nolimingliming(10 t ha -1 carbocalc)liming(10 t ha -1 carbocalc)nofertilizationnofertilizationmineralfertilization(160 kg N ha -1 ,150 kg P 2 O 5 ha -1 ,200 kg K 2 O ha -1 )mineralfertilization(160 kg N ha -1 ,150 kg P 2 O 5 ha -1 ,200 kg K 2 O ha -1 )double mineralfertilization(240 kg N ha -1 ,300 kg P 2 O 5 ha -1 ,300 kg K 2 O ha -1 )The plots size measured 70 m 2 . The harvested area of each plot was 2 m 2 (4 x 0.50 m 2 ).Grain yield were calculated on 14% moisture basis. Statistical analyses for all data wereperformed by analysis of variance using PC applications Microsoft Excel and SAS.Results and discussionIn a vegetative season of 2009/2010 the research area had 924 mm of rainfall, whichrepresents an increase of about 84 % compared to the average value throughout the yearsbefore. The mean air temperature was 9.9° C or for 0.36°C higher compared to the longtermmean. (Table 3)Temperature(2009/2010.)Rainfall(2009/2010.)Temperature(1985-2004)Rainfall(1985-2004)Table 3. Weather conditionsX XI XII I II III IV V VI VII ∑11.1 7.6 2.9 -1.2 0.9 6.8 11.8 16.1 20.0 22.8 9.970.7 63.0 87.9 99.7 86.7 38.3 68.7 164.0 201.3 44.1 924.411.3 5.5 1.0 -0.2 1.8 6.3 11.5 16.8 19.7 21.7 9.5452.5 35.6 26.3 23.3 32.3 50.8 26 57.6 98.6 99.7 502.7The results of soil analysis (Table 4) show considerable liming effect even seven yearsafter, what is evident from pH alteration, as the highest value was obtained on the limingtreatment. On the other hand, mineral fertilization (NPK treatment) acidifies the soil andincreased soil phosphorus and potassium. Continuous fertilization of trial plots led tosignificant differences among fertilization treatments regarding phosphorus andpotassium availability. This is especially noticeable on plots where each year appliedlarger amounts of mineral fertilizers (N 2 P 2 K 2 Ca treatment).365

AGRISAFE Budapest, Hungary, 2011Table 4. Liming and mineral fertilization impact on soil chemical propertiesTreatment pH(KCl) P 2 O 5 (mg kg -1 ) K 2 O (mg kg -1 )% OrganicmatterHycmol(+)kg -10 4.24 b 48.0 c 165.2 c 1.54 a 4.51 bCa 4.94 a 56.0 c 142.0 c 1.71 a 3.12 cNPK 3.95 c 147.0 b 325.3 b 1.53 a 5.66 aNPKCa 4.82 a 148.0 b 318.4 b 1.76 a 3.66 cN 2 P 2 K 2 Ca 4.47 b 247.0 a 399.6 a 1.92 a 4.70 bMean values followed by the same letter within each column are not significantly different at P≤0.05The lowest wheat grain yield (Figure 1) was achieved on the control (2.14 t ha -1 ). Winterwheat grain yield was significantly increased by mineral fertilization (by 1.7 t ha -1 and2.38 t ha -1 on NPK and Ca+NPK treatments, respectively), while doubled mineralfertization decreased grain yield (0.48 t ha -1 ) comparing to standard fertilization. Thesimilar results reported Loncaric et al. (2006.) and Rastija et al. (2007).Figure 1. Liming and mineral fertilization impact on wheat grain yieldThe mineral fertilization increased straw yield, while liming and doubled mineralfertilization didn't affect it (Figure 2). The lowest wheat straw yield was on control (3.17t ha -1 ) while the highest yield was on liming and doubled mineral fertilization tretmant(7.47 t ha -1 ).Figure 2. Liming and mineral fertilization impact on wheat straw yieldConclusionsResearch area had a significant rainfall increase when compared to the average valuethroughout the proceeding years. The residual effect of liming was evident seven years366

Budapest, Hungary, 2011AGRISAFEafter carbocalk applying, as liming considerably increase soil pH, while mineralfertilization acidify the soil and increased soil available phosphorous and potassium.Liming with mineral fertilization increased grain yield significantly. Winter wheat grainyield was significantly increased by mineral fertilization, while doubled mineralfertilization decreased grain yield comparing to standard fertilization. The mineralfertilization increased straw yield, while liming and doubled mineral fertilization didn'taffect it.ReferencesBenediktas Jankauskas, Erasmus Otabbong (2004): Combined N, P, K fertilization and liming maximises cropproductivity of acid loams in Lithuania, Acta Agriculturae Scandinavica, Section B - Plant Soil Science,54, Issue 2 May 2004, 60 – 66Croatian Bureau of Statistics (2010): First release, Published and printed by the Croatian Bureau of Statistics,Zagreb, Ilica 3, P. O. B. 80, 27 October, 2010, NUMBER: 1.1.13.Ćurko, J., Špicnagel, A., (2009): The efficiency of limestone material Agrocal granules Ca to change the pHvalue of distric brown soil Ličkog polja and the yield of oats (Avena sativa), Proceedings of 44th Croatianand 4th International Symposium of Agriculuture, Poljoprivredni fakultet Sveučilišta J. J. Strossmayera uOsijeku, 49-53.Egner, H., Riehm, H., Domingo, W. R. (1960): Untersuchungen über die chemische Bodenanalyse alsGrundlage für die Beurteilung des Nahrstoffzustandes der Boden II. Chemische Extractionsmetoden zuPhosphor- und Kaliumbestimmung. K. Lantbr. Hogsk. Annlr. W.R. 26, 199-215.International Standard Organisation (1994): Soil quality, Determination of pH, ISO 10390International Standard Organisation (1998): Soil quality, Determination of organic carbon by sulfochromicoxidation, ISO 14235Karalić, K., Teklić , T., Vukadinović, V., Bertić, B., Singh, B.R. (2007): Mineral composition of alfalfa(Medicago sativa L.) under influence of liming and manure application, VI Alps-Adria ScientificWorkshop, 35, No.2, Obervellach, AustriaKovačević, V., Kádár, I., Drezner, G., Banaj, Dj., Rékási, M., (2010): Residual impacts of liming on wheatyield, Proceedings of 45th Croatian and 5th International Symposium of Agriculuture, Poljoprivrednifakultet Sveučilišta J. J. Strossmayera u Osijeku , 801-803.Loncaric, Z., Rastija, D., Karalic, K., Popovic, B. (2006): Mineral fertilization and liming impact on maize andwheat yield, Cereal Research Communications, 34,. 1, 717-720.Rastija, D., Lončarić, Z., Vidaček, Ž., Bensa, A., (2007): Liming and fertilization impact on nutrient removalby maize and winter wheat, Cereal Research Communications, 35,2 Part 2; 985-98.Sarkar, A.K., Lal, S., Dev, G., (1998): Balanced Fertilizer Use and Liming Sustain High Yields in Corn-WheatRotation on Acid Soil, Better Crops International, 12, No. 2.367

CROP PRODUCTION FOR SUISTAINABLEAGRICULTURE

Budapest, Hungary, 2011AGRISAFEIDENTIFICATION OF LOCI AFFECTING GRAINMICRONUTRIENT CONTENT IN CEREALS USINGASSOCIATION MAPPINGA. F. BÁLINT 1 – F. SZIRA 2 - A. BÖRNER 21 Quantitative Genetics and Gene Mapping Group, Department of Plant Molecular Biology, AgriculturalResearch Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary, balinta@mail.mgki.hu2 Department of Genebank, Resources Genetics and Reproduction, Leibniz Institute of Plant Genetics and CropPlant Research, Gatersleben GermanyAbstract Cereal-based foods have great importance because 50 % of the food produced worldwide is made upof cereal grains. However, their grains often contain very low amounts of micronutrients; thereforemicronutrient malnutrition is a serious problem worldwide. The traditional strategy is the fortification of foodwith minerals artificially; however, it is also possible to breed cereals with better nutritional value. In this casethe first step should be the identification of loci affecting grain micronutrient contents, and the second the useof the markers determined for the marker-assisted selection of favourable genotypes. The aim of the workpresented here was to determine the loci affecting the grain micronutrient contents (Fe, Mn, Cu, Zn and Se) inbarley and wheat in long-term experiments (three years) using the association mapping approach. A total of 96winter wheat and 116 spring barley genotypes were screened for grain nutrient content, and genotype withoutstandingly high nutritional value were identified. Diversity Array Technology (DArT) markers were used tofind markers associated with traits of interest and the markers showing the most significant association will bepresented.Key words: wheat, barley, grain micronutrients, human nutrition, biofortificationIntroductionTo maintain the healthy function of the human body, the continuous uptake of 22mineral nutrients is needed. Cereal-based foods have great importance in humannutrition because 50 % of the food produced worldwide (in terms of dry matter) is madeup of cereal grains. However, their grains often contain very low amounts ofmicronutrients, especially iron (Fe), zinc (Zn), manganese (Mn), copper (Cu) andselenium (Se) (Salunkhe and Desphande, 1991), so micronutrient malnutrition is aserious problem worldwide. Some 60-80 % of the world’s population suffers from irondeficiency and 15 % from Zn and Se deficiency. To protect human health themicronutrient content of food must be increased. This could be achieved by increasingthe nutrient concentration in the grains of the major cereals, such as wheat. Classical andmolecular breeding methods can be applied for biofortification. Previous studiesrevealed great variability in the grain micronutrient contents in wheat (Bálint et al.,2001), and loci affecting the shoot micronutrient contents have been mapped (Bálint etal., 2007). The aim of this project was to determine the loci affecting micronutrient (Fe,Zn, Mn, Cu, Se) contents in the grains of barley and wheat in long-term experimentsusing the association mapping approach.Materials and methodsA total of 96 winter wheat (Triticum aestivum ssp. aestivum) varieties and 116 springbarley (Hordeum vulgare) varieties and landraces were used for the experiment. Thewheat population was previously genotyped with 525 DArT markers, and the barleycollection with 703 DArT markers (25 and 100 markers per chromosome on average,respectively). Grain samples were collected from field-grown and phytotron-grownplants (3 independent replications for wheat and 4 for barley). Micronutrient contentswere determined by atomic absorption spectrophotometry. Association analysis was371

AGRISAFE Budapest, Hungary, 2011performed using DArT genotypic data and with the software TASSEL 2.1. Four differentstatistical models were used for the analysis. An effect was accepted as significant if themodel delivered a significant result in three out of four cases.Results and discussionBased on the screening of micronutrient contents, significant differences between thespecies were identified (Table 1). Generally, the wheat varieties had higher Mn contents,while the barley genotypes had higher Cu, Fe, Se and Zn contents, though the highestCu, Fe and Se concentrations were determined in barley accessions and the highest Mnand Zn values in wheat accessions. No significant differences were observed betweenthe micronutrient compositions of wheat and barley, so their nutritional value is more orless similar from the micronutrient point of view.Table 1. Mean, minimum and maximum micronutrient concentrations in wheat and barley grainsCu (mg/kg) Fe (mg/kg) Mn (mg/kg) Se (mg/kg) Zn (mg/kg)Wheat mean 4.4 35.5 31.4 0.106 33.2Min. 2.4 19.8 5.5 0.050 16.5Max. 9.7 75.9 56.2 0.227 72.5Barley mean 6.0 45.8 19.7 0.118 38.7Min. 3.2 16.7 7.3 0.071 22.3Max. 15.9 106.8 35.4 0.279 61.5The results revealed that several lines generally had higher micronutrient contents thanothers (e.g. wheat: ‘Bezostaya 1’, barley: ‘Matnan 01’). Such lines could be used ascrossing partners to introduce this trait into breeding material or to create a mappingpopulation by crossing cultivars with contrasting characters to map the loci with higherresolution.In the present study hundreds of significant loci affecting grain micronutrient contentswere identified in wheat and barley. However, the effect of the environment is huge:most of the loci identified were determined only in one independentreplication/environment; less than 20 % of the loci were found in two independentreplications and less than 5 % in three or more.As can be seen in Figure 1, 44 loci were identified as having an effect on the grain Cuconcentration in barley. However, only 8 of these were found in two environments, andonly one in three. None of the loci were found in all the environments investigated.Previous studies indicated that the micronutrient contents of wheat shoots was undermultigenic control (Bálint et al., 2007). This was reinforced by the results of this study.Unfortunately, multigenic control is associated with low heritability, so the effect ofgenes affecting grain nutrient contents is generally low.372

Budapest, Hungary, 2011AGRISAFE1H 2H 3H 4H 5H 6H 7HCuCuCu CuCuCuCu CuCuCuCuCu CuCuCuCu CuCuCuCu CuCu CuCuCuCuCu CuCuCu CuCuCu145 cMCu147 cMCuCuCu143.0 cM CuCuCuCu160cM166 cM181 cMCuCu190 cMFigure 1. Loci affecting grain copper (Cu) concentrations in barley.The positions of the loci are designated by ‘Cu’. Loci designated Cu were identified in two independentexperiments, while the locus highlighted in grey Cu was identified in three independent replications.ConclusionsThe results indicate that significant differences exist between the grain micronutrientconcentrations of wheat and barley varieties and landraces. This genetic variability couldbe used by breeders to biofortify wheat and barley grains with micronutrients. However,only small improvements can be expected because of the multigenic character and lowheritability of these traits.AcknowledgementsThis work was supported by the Hungarian Scientific Research Fund (OTKA PD72080).Fellowships for A.F. Bálint and F. Szira were financed by AGRISAFE (EU-FP7-REGPOT 2007-1 No.203288). The research headed by A.F. Bálint was supported by aBólyai Fellowship. Thanks are due to N. Csabai and A. Horváth for their technicalassistance.ReferencesBálint, A. F., Röder, M. S., Hell, R., Galiba, G., Börner, A. (2007): Mapping of QTLs affecting coppertolerance and the Cu, Fe, Mn and Zn contents in the shoots of wheat seedlings. Biol. Plant. 51, 129-134.Bálint, A. F., Kovács, G., Erdei, L., Sutka, J. (2001): Comparison of the Cu, Zn, Fe, Ca and Mg contents of thegrains of wild, ancient and cultivated wheat species. Cereal Res. Commun. 29, 375-382.Salunkhe, D., Desphande, S. S. (1991): Micronutritional efficiency in crop plants – a new challenge forcytogenetic research. In: Current Topics in Plant Cytogenetics Related to Plant Improvement (ed. Lelley,T.) WUV-Univ.-Verl. Wien, Austria, 91-101.373

AGRISAFE Budapest, Hungary, 2011LONG-TERM EFFECT OF CROP PRODUCTION FACTORS ONMAIZE PRODUCTIVITY IN DIFFERENT YEARSZ. BERZSENYI – T. ÁRENDÁS – P. BÓNIS – G. MICSKEIAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, HungaryAbstract The effect of fertilisation, sowing date and plant density on the yield stability of maize wasinvestigated on the basis of several decades of data from classical long-term experiments in Martonvásár. Indry years the yield dropped significantly, by around 30%, and changes were observed in the yield responses tothe treatments. In these years lower rates of fertilisation were more efficient, and both farmyard manure (FYM)alone and the joint application of FYM + mineral fertiliser enhanced yield and yield stability. Sowing at datesother than the optimum caused reductions in both yield and N fertiliser efficiency. In dry years both theoptimum plant density and the yield were lower. In favourable years the highest yields and best yield stabilitywere recorded at the 160 kg ha –1 N fertiliser rate and a plant density of 70,000 plants ha –1 . The clarification ofyear effects is particularly important in relation to the possible effects of climate change.Key words: maize, long-term experiment, stability analysis, sowing date, N fertilisation, plant densityresponsesIntroductionIn recent years there has been increasing interest in long-term experiments all over theworld, as it is only such experiments that provide satisfactory indicators (yield trends,parameters characteristic of the agro-ecosystem) of the sustainability of production andthe effect of climate change. The long-term experiments set up in Martonvásár by BélaGyőrffy between 1959 and 1961 are now over 50 years old and represent classical longtermexperiments. The sustainability of crop production technologies, best indicated byyield stability, is studied in long-term experiments (Árendás et al., 2010; Berzsenyi,2010). This paper discusses the effect of various crop production factors (fertilisation,sowing date and plant density) on the yield and yield stability of maize in different years,based on data series collected over several decades.Materials and methodsThe N fertiliser response of maize hybrids was studied in a long-term monoculture withN rates of 0, 80, 160 and 240 kg ha –1 (N 0 , N 80 , N 160 , N 240 ) and uniform P and K rates of160 kg ha –1 . The effect of farmyard manure (FYM) and mineral fertiliser on maize yieldswas studied in a long-term experiment set up in 1959, in which half or all the NPK activeingredients of 35 or 70 t ha –1 FYM, applied every four years, were replaced by NPKmineral fertiliser. The Latin square design included seven treatments: 1. Unfertilisedcontrol, 2. 35 t ha –1 FYM every four years, 3. 17.5 t ha –1 FYM every four years +supplementary mineral fertiliser (N 1/2 P 1/2 K 1/2 ), 4. NPK mineral fertiliser equivalent to theactive ingredients of 35 t ha –1 FYM (N 1 P 1 K 1 ), 5. 70 t ha –1 FYM every four years, 6. 35 tha –1 FYM every four years + supplementary mineral fertiliser (N 1 P 1 K 1 ), 7. NPK mineralfertiliser equivalent to the active ingredients of 70 t ha –1 FYM every four years (N 2 P 2 K 2 ).The effect of sowing date and N fertilisation on the grain yield of maize hybrids wasstudied in a long-term N fertilisation experiment between 1991 and 2009. In the threefactorsplit-split plot design, N fertiliser represented the main plot, sowing date thesubplot and maize hybrid the sub-subplot. The N treatments were 0, 60, 120, 180 and240 kg ha –1 . The sowing dates were early (10 days before the optimum date), optimum(around April 24 th ), late (10 days after the optimum date) and very late (20 days after theoptimum date). The maize hybrids represented various maturity groups. The effect of374

Maize grain yield t/haMaize grain yield t/haFrequencyBudapest, Hungary, 2011AGRISAFEplant density on the grain yield of maize was studied in a strip-plot design with nineplant densities ranging from 20 to 100 thousand plants per hectare in increments of 1000plants ha –1 . The effect of year and plant density on the yield and yield stability of maizeis presented for an annual average of 20–45 hybrids on the basis of data for 1981–2002.The stability of the treatments was examined using the single-variable (regressionindexes) and multiple-variable (AMMI model) methods of stability analysis. In theregression method of stability analysis regression between the treatment and theenvironmental index was calculated. The environmental index is the mean of all thetreatments in a given environment (year). The AMMI (Additive Main Effect andMultiplicative Interaction) model is a combination of analysis of variance and principalcomponent analysis (PCA). A biplot is constructed, with the main effect means on the xaxis and the PCA I values on the y axis. The greater the value of PCA I (whetherpositive or negative) the greater the contribution of the treatment (or environment) to theinteraction, i.e. the smaller the yield stability (Crossa, 1990).Results and discussionAmong the technological factors, nitrogen fertilisation is the most important factor inincreasing maize yields. Under Hungarian conditions, however, water deficit stressregularly limits plant yields and nutrient utilisation. Averaged over 30 years, the quantityof rainfall during the maize vegetation period (Apr.–Sep.) is around 330 mm, while theaverage for dry years is around 100 mm less. The effect of N fertilisation and the year onthe maize grain yield was investigated for 14 dry and 26 wet years between 1970 and2009 (Fig. 1). When comparing the wet and dry years it was found that in wet years theyield increment achieved in each N treatment was as follows (t ha –1 ): N 0 : 1.567, N 80 :2.616, N 160 : 2.764, N 240 : 2.74 (Fig. 1a). There were considerable fluctuations over theyears in the N-fertiliser responses of the maize hybrids (Fig. 1b). Analysis of variance onthe 40-year data series showed that the significantly highest yield was most frequentlyachieved with the N 160 dose (Fig. 1c). Ex ante data that form the basis of farmingdecisions can only be obtained from long-term experiments.The effect of farmyard manure and of mineral fertiliser with the same active ingredientcontent on the maize yield in 19 dry and 32 wet years is illustrated in Figure 2a.Averaged over the seven treatments, the maize yield was 3.959 t ha –1 in dry years and6.250 t ha –1 in wet years, i.e. the yield increase in favourable years amounted to 2.291 tha –1 .Maize grain yield t ha -1108642Average yield in different yearsDry yearsWet yearsMaize grain yield t ha -1108642Scatter plot of yearly grain yield dataDry yearsWet years30252015105Histogram for N optimum rates000 80 160 2400 50 100 150 200 250080 160N fertiliser rate kg/ha-1 N N fertiliser rate rate kg/haha -1 N fertilisation N fertiliser rate kg/haha -1240Figure 1a. Effect of Nfertilisation on maize grain yieldin dry (14) and wet (26) yearsFigure 1b. Scatter plot of yearlymaize yield response in dry andwet yearsFigure 1c. Histogram ofsignificant optimum N rates375

Maize grain yield t/haMaize grain yield t/haMaize grain yield t/haIPCA scoresAGRISAFE Budapest, Hungary, 2011(1970-2009)Maize grain yield t ha -1765432Wet years (32)Dry years (19)2.01.51.00.50.0-0.5-1.0E32E28E24E19E23E35E21 E42E36 E25E30E3E45 E10E4 E49E20 E34G2G7G6E27E31G4 E38E39 E47E40 E41E43E48E50E11E22E12E26E7E46E17E33E51 E8E18 G3 E29 E16 E14E37E6 E15E5 E13E9E44 G5E2E11-1.5012 3 4 5 6 7Treatments-2.0G12 3 4 5 6 7 8Genotype Genotype and and environment enviroment means means t/hat ha -1Figure 2a. Effect of FYM and mineral fertiliser onthe yield of maize in dry (19) and wet (32) years in amonoculture (1959-2009). Error bars: LSD at P=0.05Figure 2b. AMMI diagram of the average yield and1 st principal values of the 7 fertilisation treatments(G2-G7) and the 51 environments (E1-E51)Based on the AMMI model (Fig. 2a) the G1 (unfertilised control), G6 (35 t ha –1 FYM +N 1 P 1 K 1 ) and G7 (N 2 P 2 K 2 ) treatments made the greatest contribution to the interaction(i.e. these had the lowest stability), while G3 (17.5 t ha –1 FYM + N 1/2 P 1/2 K 1/2 ), G5 (70 tha –1 FYM) and G4 (N 1 P 1 K 1 ) were the most stable. The stability pattern of the treatmentswas similar in dry and wet years, but in dry years the lower level of fertilisation hadbetter stability (N 1 P 1 K 1 vs. N 2 P 2 K 2 ; data not shown).12Dry years12Wet years1010Maize grain yield t ha -1864200Maize grain yield t ha -1Sowing date4Sowing dateEarlyEarlyOptimum2OptimumLateLateVery lateVery late060 120 180 2400 60 120 180NitrogenNitrogenfertiliserfertiliserrateratekg/haha -1 NitrogenNitrogenfertiliserfertiliserrateratekg/haha -186240Figure 3. Effect of interactions between N fertilisation and sowing date on the grain yield of maize in wet (12)and dry (7) years (1991-2009) Vertical bars = ± S.E.The sowing date × N fertilisation interaction in 12 dry and 7 wet years is illustrated inFigure 3. It is clear that in both types of years sowing later than the optimum date led toa reduction in N fertiliser efficiency, which was more severe in the dry years. Averaged376

Budapest, Hungary, 2011AGRISAFEover the treatments, the yield was 2.553 t ha –1 greater in wet years than in dry years. Indry years the yield was highest in the early and optimum sowing date treatments (7.083and 6.880 t ha –1 ), with a significant decrease when sowing took place 10 or 20 days later(6.273 and 5.925 t ha –1 ). The yield was highest at a rate of 60 kg ha –1 N, decreasingsignificantly in the N 240 treatment. In wet years the yield was significantly higher for theoptimum sowing date (t ha –1 ): early: 9.312, optimum: 9.5, late: 9.131, very late: 8.431.The optimum N rate was 120 kg ha –1 ; at higher rates there was no significant change inthe yield. The greatest yield stability was recorded for sowing at the optimum date or 10days later and for N fertiliser rates of 60 or 120 kg ha –1 (data not shown).In the plant density experiment, the maximum grain yield, averaged over the years, was8.21 t ha –1 , with an optimum plant density of 80,000 plants ha –1 . By contrast, averagedover the dry years the maximum grain yield was 6.65 t ha –1 and the optimum plantdensity was only 50,000 plants ha –1 . In dry years above-optimum plant density resultedin considerable yield losses (as indicated by the increasing distance between the twocurves; Fig. 4a). Under the given experimental conditions, the yield was most stable at aplant density of 60,000 plants ha –1 . When the environmental mean was less than 4.6 t ha –1 a plant density of 40,000 plants ha –1 had greater stability, while a plant density of80,000 plants ha –1 could be expected to be more stable at environmental means of over7.9 t ha –1 (Fig. 4b).Maize grain yield t ha -110864202Wet yearsDry yearsYw = 3.35+1.295x-0.0849x 2Yd = 3.83+0.869x-0.0702x 246Plant density plant m -2810Maize grain yield t ha -114121086420Plant densityplant m -2 Y 2 = 1.429 + 0.577X R 2 =Y 4 = 1.194 + 0.825X R 2 =0.977Y 6 = 0.102 + 1.062X R 2Y 8 = -1.117 + 1.217X R 2Y 10 = -1.757 + 1.264X1 2 3 4 5 6 7 8 9 10 11 12Enviromental mean t ha -1Figure 4a. Effect of plant density on themaize grain yield in different years (1981-2002)Figure 4b. Yield stability of maize hybrids at different plantdensities in the period 1981-2002 (average of 20-45 hybridsyearly)ReferencesÁrendás, T., Bónis, P., Csathó, P., Molnár, D., Berzsenyi, Z. (2010): Fertiliser responses of maize and winterwheat as a function of year and forecrop. Acta Agron. Hun., 58 (Suppl.), 109-114.Berzsenyi, Z. (2010): Significance of 50-year-old long-term experiments in Martonvásár in improving cropproduction. Acta Agron. Hun., 58 (Suppl.), 23-34Crossa, J. (1990): Statistical analyses of multilocation trials. Adv. Agron., 44, 55-85.377

AGRISAFE Budapest, Hungary, 2011INFLUENCE OF AGROMETEOROLOGICAL CONDITIONS ONPHONOLOGICAL DEVELOPMENT OF TWO WEEDS,COMMON AMARANTH (AMARANTHUS RETROFLEXUS L.) AND(AMARANTHUS HYBRIDUS L.)M. DIMITROVA – C. MOSKOVA – K. KOUZMOVAAgricultural University – Plovdiv, BulgariaAbstract The study was conducted in the period 2003-2005 at AU-Plovdiv. The phenological development oftwo of the most widespread annual weeds (Amaranthus retroflexus L.) and (Amaranthus hybridus L.) and thestart of the phenophases: germination, appearance of true leaves, blossoming and the appearance of ripe seedswere followed. In parallel, changes in the agrometeorological conditions during the vegetation period of theweeds were followed. The following basic climatic parameters were taken into account: air temperature,rainfall and relative air humidity. A number of correlative and regressive dependences were established, whichwill be used to predict the appearance of weeds in fields sown with cultivated plants and for weed control.Key words: weeds, Amaranthus retroflexus L., Amaranthus hybridus L., weather and climate,agrometeorological conditionsIntroductionAs a result of the increased instability of the climate, over the last few years there has been agreater need to study the biological characteristics of weeds and their requirements concerning thevarious conditions of the entironment.The different types of amaranth (Amaranthus spp.) are weeds that grow fast and have a largenumber of viable seeds. They are characterized by polymorphous growth as a result of the variousenvironmental and genetic factors (Costea et all, 2003; 2004).A number of authoirs state that the seeds of A. retroflexus L. grow late in spring whenthe temperature of the soil is over 20 о С and ripen during the period from August toSeptember while the seeds of A. hybridus L. grow under lower temperatures - 8,5 0 С(Kovachev (1967); Kostov et all, 1999; Nikolova (1999). The green amaranth is a fastdeveloping type (when the weather is warmer and the humidity of the soil is suitable, itgrows faster).The purpose of this study was to make a comparative description of the influence of theagrometeorological conditions on the phenological development of the weeds of thetypes Amaranthus retroflexus L. and Amaranthus hybridus L., which will serve as a basisfor making a precise prognostication of their growth on cultivated areas and raising theefficiency of the figth against them.Materials and methodsThe research was conducted during the period 2003-2005 on the experimental field ofthe Agricultural University in the town of Plovdiv. We followed the phenologicaldevelopment of one of the most common types of amaranth - Amaranthus hubridus L.We observed 40 marked weed plants (10 from each generation) sown among sunflowercrops. We observed the occurrence of the following phenophases of the weeds: growth,the appearance of the first leaf, blossoming and formation of mature seeds (ripening). Inaddition to this, we also observed the changes in the basic meteorological elementswithin that period of time.We regarded as basic the average 24-hour temperature of the air, the relative humidity of the airand the rainfall total, on the grounds of which the main agroclimatic indices were established. As a378

Budapest, Hungary, 2011AGRISAFEbeginning of the phenological observations we accepted the date of the steady rise of thetemperature of the air over 5 0 С in spring - Hershkovich (1984). The steady transition of thetemperature of the air above the aforementioned temperature limit has been established using themethod of Goltsberg - Kelchevskaya (1971); Gulinova (1974).In order to make a more detailed description of the conditions of humidification on which thedevelopment of the weed depends, we used the Hydrothermal coefficient (Selyaninov’s HTC),which is a complex index characterizing the temperature and humidity - based on Kuzmova (2003).The evaluation of the agrometeorological conditions was made for the separate interphase periodsand for the overall vegetation period as well. The statistical processing of the experimental datawas performed on the grounds of common methods used in agroclimatology for processing datathat has been collected for many years - Kelchevskaya (1971); Gulinova (1974); Hershkovich(1984). The agroclimatic indices have been established in accordance with the significance and theinstability of the main elements of the climate that allow us to distinguish between the maindifferences and peculiarities in the development rate during the separate interphase periods. Thedata has been processed using specially developed and Exel integrated programmes for processingphenological, biometric and meteorological data - Kuzmova (2002).Results and discussionBy summarizing the obtained data on the influence of the agroclimatic indices for theperiod 2003-2005 on the phenological development of the two types, we can make thefollowing conclusion.The type Amaranthus hybridus L. has a shorter vegetation period (121 days) and growsunder lower temperatures (9,6 0 С) unlike Amaranthus retroflexus L., whose vegetationperiod is 143 days and the temperature during its growth in the spring is (10,3 0 С) – Table 1.Similar data is also reported by Kostov (1999), Kovachev (1967) and Fisyunov (1984).The summarized data shows that the first period of the phenological development of the twotypes of amaranth (from the steady transition of the temperature of the air to its growth) is themost changeable one as the lowest temperature necessary for the growth of Amaranthusretroflexus L. is 9 0 С and the lowest temperature for the growth of Amaranthus hybridusL. is 8 0 С. The duration of the period for the common amaranth is 59 days under anaverage temperature of the air of 10,3 0 С and the duration of the period for the greenamaranth is 52 days under an average temperature of 9,6 0 С. The most unstableagroclimatic index for both types is the rainfall total (44,3-45,1 mm) and it varies duringthe years of testing. We established a close relation between the duration of the periodand the sum of the average 24-hour temperature of the air (r = -0,98 and r = -0,97).What is typical of the second period of the phenological development of both types ofamaranth (growth – first leaf) is that it lasts 8-10 days under an average temperature of17,1 0 С – 17,4 0 С. There is a more significant difference in the temperature sum which issmaller for the common amaranth (132,5 0 С) compared to that of the green amanrath(166,3 0 С). There are substantial differences in the rainfall total, which is 17,2 mm forAmaranthus retroflexus L. and 6,3 mm for Amaranthus hybridus L. For both types ofamaranth we established close correlations and regressive dependencies between theduration of the period and the average temperature, the sum of the average 24-hourtemperatures and the rainfall total (r = -0,91 до r = 0,99).During the third period of the phenological development (first leaf – growth of theweeds) there is a substantial difference in the influence of the agroclimatic indices. Thisperiod lasts 29 days for the green amaranth and 43 days for the common amaranth, i.e.379

AGRISAFE Budapest, Hungary, 2011the period is 14 days shorter – Table 1. The temperature sum is much lower forAmaranthus hybridus L. – 517,2 0 С, while for the Amaranthus retroflexus L. it is831,9 0 С. The approximate date for the inititation of the blossoming phase is 23 rd June forthe common amaranth and 5 th June for the green amaranth, for which we have alsoestablished close correlation dependence between the duration of the period and theother agroclimatic indices (r = -0,96 to r = 0,99).The fourth period of the phenological development of both types of amaranth(blossoming – ripening of the seeds) lasts 30-34 days and is shorter for the greenamaranth. It requires a lower average temperature (22,2 0 С) and a smaller temperaturesum (663,2 0 С), which determines the much earlier date for the initiation of the ripeningphase – 5 th July. For the common amaranth this date is 27 th July. The most unstableindex is the rainfall total and it is shortest (less than 30 days) when it is dry with only1mm of rainfall for 24 hours.The entire vegetation period of the common amaranth lasts 143 days and this indexsignificantly varies over the years – from 112 days (in 2003) to 187 days (in 2004). Thevegetation period of the green amaranth is 121 days (22 days shorter) and it slightlyvaries over the years – from 105 days (in 2003) to 138 days (in 2004).The necessary temperature sum for the entire vegetation period of Amaranthus retroflexusL. is 2369,6 0 С and the rainfall total is 244,2 mm. These indices are much lower forAmaranthus hybridus L., where the temperature sum is 1845,1 0 С and the rainfall total is193,7 mm (Table 1).Table 1. Agroclimatic indices affecting the phenological development of the types of amaranthAmaranthus retroflexus L. Amaranthus hybridus L.Periods of thephenologicaldevelopmentDuration ofthe period (days)Averagetemperature ( о С)Temperaturesum ( о С)Rainfalltotal (mm)Duration ofthe period (days)Averagetemperature ( о С)Temperaturesum ( о С)Rainfalltotal (mm)1 st periodFrom the steadytransition of thetemperature of theair until the growth2 nd periodThe growth of thefirst leaf3 rd periodFirst leaf -blossoming4 th periodBlossoming – ripeningof the seeds5 th periodFrom the steady transitionof the temperature ofthe air to the ripeningof the seeds59 10,3 610,7 45,1 52 9,6 498,4 44,38 17,4 132,5 17,2 10 17,1 166,3 6,343 19,4 831,9 87,7 29 17,7 517,2 81,734 23,4 788,4 94,2 30 22,2 663,2 61,3143 16,5 2369,6 244,2 121 15,3 1845,1 193,7380

Budapest, Hungary, 2011AGRISAFEConclusionsThe analysis of the obtained results shows that all the interphase periods have asignificant influence on the duration of the vegetation period of the types of amaranthbut the influence of the first period is crucial: from the steady transition of thetemperature of the air over 5 0 С in the spring until its growth.Amaranthus hybridus L. has a shorter vegetation period and growth under a lowertemperature unlike Amaranthus retroflexus L., which determines its earlier growthamong the crops.The values of the temperature sum for the entire vegetation period of the green amaranthare 1845,1 о С and the rainfall total is 193,7 mm. For the common amaranth these valuesare 2369,6 о С and 244,2 mm respectively, which determines the fact that its developmentamong the crops is 22 days longer.ReferencesCostea M., F. Tardif (2003): The biology of Canadian weeds. 126. Amaranthus albus L., A. Blitoides S.Watson and A. blitum L. Canadian Journal of Plant Science, 83 (4): 1039-1066Costeа M. et all. (2004): The biology of Canadian weeds. 130. Amaranthus retroflexus L., A. powelli S.,Watson and A. hybridus L. Canadian Journal of Plant Sciene, 84 (2): 631-66Hershkovich E. (1984): Agroclimatic resourses in Bulgaria. Sofia, Bulgarian Academy of Sciences, 115Kostov, K., D. Pavlov (1999): Coursebook in feed production. PlovdivKovachev, I. (1967): Using the anatomical signs for distinguishing between the different types of the genusAmaranthus L. AU, Scientific works, volume XVI, book 1.Kuzmova K. (2002): Agrometeorological conditions for growing fodder peas in Bulgaria. Doctoral thesis,PlovdivKuzmova K. (2003): Agrometeorology. Academic edition of the Agricultural University, PlovdivMoskova, С., К. Kouzmova, М. Dimitrova (2007): Influence of Agrometeorological Conditions onphenological development of Amaranthus retroflexus L., Agricultural University, Plovdiv. Plant Science,44, 344-348 SofiaMoskova, С., К. Kouzmova, М. Dimitrova (2007): Influence of Agrometeorological Conditions onphenological development of Amaranthus hybridus L. Agricultural University, Plovdiv. Proceedings ofII nd international symposium “Ecological approaches towards the production of safety food”Nikolova G. (1999): Late spring types. Plant protection, 5, 15-17Гулинова Н. (1974): Методы агроклиматической обработки наблюдений. Л., Гидрометеоиздат, 151Кельчевская Л. (1971): Методы обработки наблюдений в агро-климатологии. Методическое пособие.Л., Гидрометеоиздат, 215Фисюнов A. (1984): Сoрные растения. Колос, Москва381

AGRISAFE Budapest, Hungary, 2011EXAMPLE OF SUSTAINABLE CROP PROCESSING,PROVIDING MITIGATIONÉ. ERDÉLYI – D. BOKSAIDepartment of Mathematics and Informatics, Faculty of Horticultural Science,Corvinus University of Budapest, Hungary, e-mail: eva.erdelyi@uni-corvinus.huAbstract Does the carbon emission of food products affect climate change? Is it possible to reduce nascentcarbon emission during plant production and processing? Research on the effects of crop production on theenvironment is a very complex challenge. The present study investigated what aspects and what types of dataare needed for each step in the carbon footprint calculation methodology, presenting an example of a cerealproduct. The PAS 2050 standard (How to assess the carbon footprint of goods and services) was applied incooperation with a Hungarian company (Biopont Ltd.) producing a wide assortment of organic food. The paperfocuses on products which are processed using crops produced in the central Hungarian region.Carbon footprint calculation requires a huge amount of data, including the identification of all materials,activities and processes that contribute to the life cycle of the product. The process map also includes all stagesand potential emission sources from any activity that contributes to the delivery or use of the product, includingthe production of raw materials. Carefully checking boundaries is also very important.Collecting data is the most difficult part of the process and depends on interviews. It focuses primarily on themost significant inputs, such as production, manufacturing processes, storage conditions and transportrequirements. The quantification of the total amount of all materials into and out of a process is referred to as‘mass balance’. The mass balance step provides confirmation that all materials have been fully accounted forand no processes are missing. The equation of the product carbon footprint value is the sum of all materials,energy and waste across all activities in the product life cycle multiplied by their emission factors. Sustainableagriculture and climate-friendly thinking in processing leads to sustainable consumption and climate changemitigation. Attention is drawn to the possibilities that crop production and processing offer in improving foodsafety under changing climate conditions. The idea of the Low Emission Product is introduced, which could beused for the comparison of the same foods with a different history. Labelling products could help producers toshow their environment-friendly thinking, and also encourages environmentally conscious consumers to buythese products, giving them information about how energy use has been reduced. This study provides examplesof the calculation methodology for a wheat product: the extruded wheat germ organic product ‘Bulata’. It isintended to extend the calculations of carbon footprint to other cereal products as well.Key words: climate change, organic food, process map, product carbon footprintIntroductionCarbon footprint is used to describe the amount of greenhouse gas (GHG) emissioncaused by a particular activity or entity, and thus a way for organisations and individualsto assess their contribution to climate change. The carbon footprint is a measurement ofall greenhouse gases we individually produce and has units of tonnes (or kg) of carbondioxide equivalent. The term ‘product carbon footprint’ refers to the GHG emissions of aproduct across its life cycle, from raw materials through production (or serviceprovision), distribution, consumer use and disposal/recycling. Calculating the carbonfootprint is the first step towards reducing it. A product carbon footprint could givebenefits for both companies and product-level supply chain emission assessment.Quantifying the carbon emission sources will help to understand what impact everyparticipant is having on climate change. It helps manage the carbon emissions and makereductions over time, furthermore it helps find and identify areas for reducing emissions,which will often result in cost savings as well. The functional unit of product carbonfootprint can be thought of as a meaningful amount of a particular product used forcalculation purposes. The cooperation with suppliers is important for understanding theproduct’s life cycle and for gathering data. Supplier engagement should be built into theoverall project work plan, with roles, responsibilities and milestones clearly defined and382

Budapest, Hungary, 2011AGRISAFEunderstood. A British organisation called Carbon Trust is a private company set up bythe British government in 2001 to help UK businesses lower carbon emissions andreduce energy costs. It is taking steps to help consumers better understand the carbonfootprint created by their food. Their carbon footprint label, clearly marked with theamount of grams of CO 2 created by the product, measures a product’s emissions fromsource to shelf. The Publicly Available Specification (PAS 2050) was commenced inJune 2007 at the request of Defra (Department for Environment, Food and Rural Affairs)and the Carbon Trust. It contains BSI (British Standards Institution) Standards Solutionsmeeting method for measuring the embodied GHG emissions from goods and servicesand is used as a basis of product carbon footprint calculations.Materials and methodsBuilding a process mapThe first step for preparing the calculations for a chosen product is building its processmap. The goal of this step is to identify all materials, activities and processes thatcontribute to the chosen product’s life cycle, including the production of raw materials.Developing a product process map starts by breaking down the selected product to itsfunctional units and focusing on the most significant inputs first, then identifying theirrespective inputs, manufacturing processes, storage conditions and transportrequirements.Includesprocessesrelated to rawmaterials.Table 1. Process map steps for products, ‘business – to – consumer’ (source: PAS 2050)Raw materials → Manufacture → Distribution/Retail → Consumer use → Disposal/ /RecyclingAll inputs usedAll steps in disposal:at any stage in All activities All steps for Energy transport, storage,the life cycle. from collection transport and required processing.of raw materials related storage, during theto distribution. retail storage usageand display. phase.Energy required in thisprocess and directemissions due to it.Checking boundaries is important, and means that the methodology does not to includeimmaterial emissions sources (which represent less than 1% of total footprint), humaninputs to processes, transport of consumers to retail outlets, and animals providingtransport.Data types and collecting dataTwo types of data are necessary for calculating the carbon footprint: activity data andemission factors. Activity data refers to all the material and energy amounts involved inthe product’s life cycle (material inputs and outputs, used energy, transport, etc.).Emission factors provide the link that converts these quantities into the resulting GHGemissions: the amount of greenhouse gases emitted per ‘unit’ of activity data (e.g. kgGHGs per kg input or per kWh energy used). Activity data and emissions factors cancome from either primary or secondary sources: primary data refers to directmeasurements made internally or by someone else in the supply chain about the specificproduct’s life cycle. Secondary data refers to external measurements that are not specific383

AGRISAFE Budapest, Hungary, 2011for the product, but rather represent an average or general measurement of similarprocesses or materials (e.g. industry reports or aggregated data from a trade association).Mass balanceThe quantification of the total amount of all materials into and out of a process isreferred to as ‘mass balance’. The mass balance step provides confirmation that allmaterials have been fully accounted for and no streams are missing.Calculating carbon footprintThe equation for product carbon footprint calculation is the sum of all materials, energyand waste across all activities in a product’s life cycle multiplied by their emissionfactors:Carbon footprint of a given activity =Activity data (mass/volume/kWh/km) ×Emission factor (CO 2 e per unit)The calculation itself simply involves multiplying the activity data by the appropriateemission factors.Results and discussionIn this work we give an example of an organic wheat products carbon footprint. Weintroduce the calculation for a sample product “Bulata’, an extruded wheat germ(Organic, 200 g), which is a popular organic snack rich in B, E-vitamin, phosphorus,potassium, zinc and magnesium. First step of calculations is taking farming emissioninto consideration (as the production of raw materials). In this case it is wheat productionemission, which we got from the EMAK emission factor database.The next step of calculation is based on the transportation of raw materials to thelocation of production (mill), and then to the manufacturing place. Next steps of theproducts life cycle are packaging and transportation to storage centre and stores. At theend we have to bring into consideration the emission factors of retail, disposal andlandfill decomposition. The results show (Table 2. and Figure 1.) that farming is a verysignificant factor in repartition of the carbon footprint with its 51%.Table 2. Footprint analysis of Bulata (data given in kilograms per CO 2 emission per tonne Bulata)RawmaterialswheatmaltBulatapackagingmaterialFarming Transport Technology Retail Disposal Total500 45.64.5784.19940 (milling)35 (malting)25 (extruding)53 (packaging)225 0.00150.0223Total 500 98.369 153 225 0.0238 976.4All the values were evaluated are given for a tonne of Bulata. We took into considerationas many factors as possible.384

Budapest, Hungary, 2011AGRISAFEDistribution of the 'Bulata' carbon footprintTransport10.073% Technology15.664%Farming51.214%Disposal0.002%Retail23.046%Figure 1. The repartition of the carbon footprint of ‘Bulata’ (percentages are percents of the total emission)ConclusionsIn this study we were searching for answers of whether it is possible to abate the nascentcarbon emission during the production? Analysis of the EIPRO Study defines differentproduct categories according to their environmental impact. The greatest impactproducts are food, drink, private transport and housing. Together, they are responsiblefor 70-80% of the environmental impact of consumption (only food takes 20-30%), socutting food miles by taking benefits of local growing is important but not enough. Wehave to be careful about where and how to produce the raw materials of food productsfor saving the environment and enable processing of Low Emission Products, thushelping people be environment and climate friendly by consuming them.AcknowledgementsThis work was supported by the "Research in excellence of Corvinus University ofBudapest" stipendium, the „Research Assistant of Corvinus University of Budapest”fellowship and the TÁMOP 4.2.1.B-09/1/KMR-2010-0005 project.ReferencesBiopont, http://www.biopont.hu, http://www.biopont.hu/en/products/biopont/organic_snacksCarbon trust, www.carbontrust.co.uk"Csináljuk jól füzetek” Energiahatékony technológiák alkalmazása a malomiparban, Legjobb Gyakorlat (BestPractice)módszerkiadvány,http://www.undp.hu/oss_hu/tartalom/kiadvanyh/kiadvanyh_body/csinaljukjol/szam04.htmEIPRO Study, Environmental Impacts of Products, Analysis of the life cycle, environmental impacts in relatedto the final consumption of the EU-25, 2006 p.139http://ec.europa.eu/environment/ipp/pdf/eipro_report.pdfPAS 2050 - Assessing the life cycle greenhouse gas emissions of goods and services,http://shop.bsigroup.com/en/Browse-by-Sector/Energy--Utilities/PAS-2050/The Carbon Trust: Product Carbon Footprinting & Labelling,http://www.sustainablebizness.com/PkgForum_Ana09/CarbonFootprintingLabelling.pdfTolimir, M., Veskovic, M., Komljenovic, I., Djalovic, I., Stipesevic, B. (2006): Influences of soil tillage andfertilization on maize yield and weed infestation. Cereal Res. Commun., 34, 323–326.Tuba, Z., Csintalan, Z. (1993): Bioindication of road motor traffic caused heavy metal pollution by lichentransplants. pp. 206–215. In: Markert, B. (ed.), Plants as Biomonitors – Indicators for Heavy MetalPollution of the Terrestrial Environment. VHC Publisher Inc., Weinheim, New YorkWalkers, Taking steps to reduce our carbon footprint, http://www.walkerscarbonfootprint.co.uk/385

AGRISAFE Budapest, Hungary, 2011POTENTIAL ROLE OF CHITINASES IN THE PROCESS OFSOMATIC EMBRYOGENESIS OF PINUS NIGRA Arn.L. FRÁTEROVÁ – I. MATUŠÍKOVÁ – J. SALAJ – T. SALAJInstitute of Plant Genetics and Biotechnology of the Slovak Academy of Sciences, Nitra, Slovak Republic,P.O.Box 39 A, Akademická 2, 950 07, nrgrfrat@pribina.savba.skAbstract The aim of this work was to detect and compare the activity of chitinases in cell suspension culturesof embryogenic cell lines of Pinus nigra Arn. using the SDS-PAGE method. The activity of chitinases ofsecreted extracelullar proteins was investigated in four embryogenic cell lines with minimal (E235) and high(L14, E323, L71) embryogenic potential. Embryogenic lines were cultivated for 8 or 16 days in DCR liquidmedium. In the embryogenic cell line with minimal embryogenic potential a total of 4 isoforms of chitinasewere detected, whereas 8 isoforms were detected in the three embryogenic lines with high embryogenicpotential. The chitinase profiles of the three lines with high embryogenic capacity were identical except forthree isoforms with molecular weights of ~23, 20 and 19 kDa. Chitinase isoforms with ~53 kDa molecularweight had comparable activities in all the cell lines examined. On the other hand, the isoform with a molecularweight of ~33 kDa was only detected in lines with high embryogenic potential. This indicates that the givenchitinase isoforms may play an important role in the process of somatic embryogenesis in Pinus nigra Arn.Key words: SDS-PAGE, chitinase, suspension cultures, Pinus nigra Arn.IntroductionFor plants, in vitro cultivation represents definite stress. Therefore, most plant explantscultivated under in vitro conditions secrete proteins into culture media, which proteinsare connected with their defence mechanisms. It is supposed that these extracellularproteins are important also in activation or inhibition of somatic embryogenesis (SE)(Quiroz-Figueroa et al., 2006). During process of plant SE several types of extracellularproteins were characterised, e.g. peroxidases (Cordewener et al., 1991), phosphatases(Ciarrocchi et al., 1981), arabinogalactan proteins (Kreuger & van Holst, 1993), lipidtransferases (Sterk et al., 1991), zeamatin like proteins (Egertsdotter 1996), chitinases(De Jong et al., 1992) and glucanases (Dong & Dunstan, 2000).Chitinases and glucanases play an important role in the development of somatic embryosof angiosperms (Helleboid et al., 2000; Tchorbadjieva & Pantchev, 2006) and alsogymnosperms (Dong & Dunstan, 2000). Generally, it is indicated that induction ofchitinases is often coordinated with induction of specific β-1,3-glucanases (Meins et al.,1992; Beerhues & Kombrink, 1994 etc.). Helleboid et al. (2000) observed changes in theprotein composition of embryogenic cultures of chicory, which were related to inductionof SE. They identified except β-1,3-glucanases also chitinases and osmotin like proteins,which were accumulated in the media of embryogenic cultures to a higher level incomparison to cultures of nonembryogenic variety of chicory.Process of SE was induced in various conifer species, e.g. Pinus roxburghii Sarg. (Aryaet al., 2000; Mathur et al., 2000), Pinus nigra Arn. (Salajová & Salaj, 2005), Pinusbrutia Ten. (Yldirim et. al. 2006), Pinus kesiya Royle ex. Gord. (Choudhury et al.,2008), Pinus bungeana Zucc. ex Endl. (Zhang et al., 2007), Picea abies (Von Arnold etal., 1996) etc.In Picea abies, a model system for studying the regulation of the development of conifersomatic embryos, it was detected that somatic embryos derived from different cell linesreached various developmental stages, which was reflected in the composition of presentextracellular proteins. Proliferated embryogenic lines of Picea abies were divided in twogroups based on morphology of somatic embryos and their maturation capacity. GroupA consists of well developed somatic embryos able to mature whereas group B contains386

Budapest, Hungary, 2011AGRISAFEembryogenic lines with poorly developed somatic embryos in general incapable ofmaturation (Egertsdotter 1996). Secretion of proteins into culture media is characteristicfor both groups of embryogenic lines of Picea abies (Egertsdotter et al., 1993).Aim of our study was to detect and compare chitinase activities in an embryogenic cellline of Pinus nigra Arn. with minimal embryogenic capacity and in embryogenic lineswith high embryogenic potential.Materials and methodsWe tested for chitinase activity in suspension cultures of 4 embryogenic cell lines ofPinus nigra Arn.: E235, L14, E323 and L71. After 8 and 16 days of cultivation we tookaway the liquid medium containing the eluate of cultivated cells – we centrifuged for 20min at 14 000 rpm at 4°C. We froze the supernatant in liquid nitrogen and stored thesamples at - 80°C. Extracellular proteins contained in the supernatants of variousembryogenic lines were separated by electrophoresis using denaturated polyacrylamidgels (Laemmli, 1970). Into separation gels we added 1% glycolchitin as a substrate forchitinases. Electrophoresis was run at 8°C and 18mA current. After reaching separationgels, the current was increased to 24mA. We loaded 30 μl of protein sample to eachwell. After electrophoresis, proteins were renatured by slow oscillation in 50mM NaAc(pH 5.2) and 1 % Triton X-100 overnight and subsequently in NaAc without Triton X-100 for 1 hour. For detection of chitinase activity, gels were stained with fluorescent dyecomposed of 10 mg Fluorescent Brightener, 50 ml 0.05 M Tris HCl (pH 8.9) and 50 mlH 2 O (Pan et al., 1991) for 15 min by room temperature. We detected activity ofchitinases after illuminating gels with UV light, whilst positions of chitinolytic activityresponded to dark spots on fluorescent background. After detection of chitinolyticactivity, the gels were stained using a solution of 0.05 % Coomasie Brilliant Blue R-250,40 % methanol and 10 % acetic acid. Molecular weights of separated proteins wereestimated by comparison with protein marker MARK 12 TM (2.5 – 200 kDa).Results and discussionIn our study we induced production of embryogenic tissue from immature zygoticembryos of Pinus nigra Arn. After testing for maturation capacity of embryogenic lineswe identified lines with high as well as minimal embryogenic potential. From suspensionculture (after 8 and 16 days cultivation) we loaded aliquots of protein samples topolyacrylamid gels and detected protein fractions with chitinolytic activity. In theembryogenic line with minimal embryogenic potential E235 we detected 4 chitinaseisoforms globally, whereas in the embryogenic lines with high embryogenic potential 8chitinase isoforms. Chitinase profile of the three highly embryogenic lines was identicalwith exception three isoforms with molecular weights ~23, 20 a 19 kDa. Chitinaseisoforms with a molecular weight of approximately ~53 kDa had comparable activitiesin all examined lines. On the other hand, we detected an isoform with ~33 kDamolecular weight exclusively in lines with high embryogenic capacity, not in the linewith minimal embryogenic potential. This indicates that this chitinase isoform may havean important role in embryogenic processes of Pinus nigra Arn. Similar observation wasreported by Domon et al. (1995, 2000) in suspension cultures of Pinus caribaea, whoidentified chitinase like proteins ionically bonded to the surfaces of preglobular somaticembryos. Egertsdotter et al. (1993) detected correlation between extracellular proteinssecreted by embryogenic lines of Picea abies and morphology of somatic embryos.387

AGRISAFE Budapest, Hungary, 2011Moreover, Mo et al. (1996) confirmed a close relationship between the presence ofspecific extracellular chitinases and morphology of somatic embryos of Picea abies.Presence of specific chitinase isoforms could serve as a marker for embryogenicpotential of embryogenic lines. Other data supporting the hypothesis that chitinasesregulate the development of somatic embryos, come from experiments withembryogenic cultures of Picea abies (Egertsdotter & von Arnold, 1998; Wiweger et al.,2003) and Picea glauca (Dong, Dunstan, 1996).ConclusionsOur results indicate that in the chitinase profile of embryogenic cultures with high andminimal embryogenic potential there exist quantitative and also qualitative differences.Presence of an isoform with a molecular weight of ~ 33 kDa is apparently related to highembryogenic potential of embryogenic lines of Pinus nigra Arn. To confirm thisrelationship – with the aim of identification of a suitable marker for embryogeniccapacity of embryogenic cell lines potentially available in biotechnology programs –additional experiments will be carried out.AcknowledgementsThis paper was financially supported by VEGA 2/0025/08 and MVTS-COST 871.ReferencesArya, S., Kalia, R. K., Arya, I. D. (2000): Induction of somatic embryogenesis in Pinus roxburghii Sarg. PlantCell Reports, 19, 775-780.Beerhues, L., Kombrink, E. (1994): Primary structure and expression of mRNAs encoding basic chitinase and1,3-beta-glucanase in potato. Plant Molecular Biology, 24, 353-367.Ciarrocchi, G., Cella, R., Nielsen, E. (1981): Release of nucleotide cleaving acid phosphatase from carrotcells grown in suspension culture. Physiologia Plantarum, 53, 375-377.Cordewener, J., Booij, H., Van Der Zandt, H., Van Engelen, F. A., Van Kammen, A., De Vries, S. C. (1991):Tunicamycin-inhibited carrot somatic embryogenesis can be restored by secreted cationic peroxidaseisoenzymes. Planta, 184, 478-486.De Jong, A. J., Cordewener, J., Lo Schiavo, F., Terzi, M., Vandkerckhove, J., Van Kammen, A., De Vries, S.C. (1992): A carrot somatic embryo mutant is rescued by chitinase. The Plant Cell, 4, 425-433.Domon, J. M., Dumas, B., Laine, E., Meyer, Y., David, A., David, H. (1995): Three glycosylatedpolypeptides secreted by several embryogenic cell cultures of pine show highly specific serologicalaffinity to antibodies directed against the wheat germin apoprotein monomer. Plant Physiology, 108, 141-148.Domon, J. M., Neutelings, G., Roger, D., David, A., David, H. (2000): A basic chitinase-like protein secretedby embryogenic tissues of Pinus caribaea acts on arabinogalactan proteins extracted from the same celllines. Journal of Plant Physiology, 156, 33-39.Dong, J. Z., Dunstan, D. I. (1996): A reliable method for extraction of RNA from various conifer tissues.Plant Cell Reports, 15, 516-521.Dong, J. Z., Dunstan, D. I. (2000): Molecular biology of somatic embryogenesis in conifers. pp. 51-87. In:Jain, S. M., Minocha, S. C., (ed.), Molecular Biology of Woody Plants. 1. Kluwer Academic Publishers,The Netherlands.Egertsdotter, U. (1996): Regulation of somatic embryo development in Norway spruce (Picea abies).Agronomie: Plant Genetics and Breeding, 16, 603-608.Egertsdotteer, U., Von Arnold, S. (1998): Development of somatic embryos in Norway spruce. Journal ofExperimental Botany, 49, 155-162.Egertsdotteer, U., Mo, L. H., Von Arnold, S. (1993): Extracellular proteins in embryogenic suspensioncultures of Norway spruce (Picea abies), Physiologia Plantarum, 88, 2, 315-321.Helleboid, S., Hendriks, T., Bauw, G., Inze, D., Vasseur, J., Hilbert, J. L. (2000): Three major somaticembryogenesis related proteins in Cichorium identified as PR proteins. Journal of Experimental Botany,51, 1189-1200.388

Budapest, Hungary, 2011AGRISAFEChoudhury, H., Kumaria, S., Tandon, P. (2008): Induction and maturation of somatic embryos from intactmegagametophyte explants in Khasi pine (Pinus kesiya Royle ex. Gord.). Current Science, 95, 10, 1433-1438.Kreuger, M., Van Holst, G-J. (1993): Arabinogalactan proteins are essential in somatic embryogenesis ofDaucus carota L. Planta, 189, 243-248.Laemmli, U. K. (1970): Cleavage of structural proteins during the assembly of the head of bacteriophage T4,Nature, 227, 5259, 680-685.Mathur, G., Von Arnold, S., Nadgauda, R. (2000): Studies on somatic embryogenesis from immature zygoticembryos of chir pine (Pinus roxburghii Sarg.). Current Science, 79, 999-1004.Meins, F., Neuhaus, J. M., Sperisen, C., Ryals, J. (1992): The primary structure of plant pathogenesis-relatedglucanohydrolases and their genes. pp. 245-282. In: Booler, T., Meins, F. (ed.), Genes Involved in PlantDefense. New York, Springer-Verlag, Vienna.Mo, L. H., Egertsdotter, U., Von Arnold, S. (1996): Secretion of specific extracellular proteins by somaticembryos of Picea abies is dependent on embryo morphology. Annals of Botany, 77, 143-152.Pan, S. Q., Ye, X. S., Kuc, J. (1991): A technique for detection of chitinase, β-1,3-glucanase, and proteinpatterns after a single separation using polyacrylamide gel electrophoresis or isoelectrofocusing.Phytopathology, 81, 970-974.Quiroz-Figueroa, F. R., Rojas-Herrera, R., Galaz-Avalos, R. M., Loyola-Vargas, V. M. (2006): Embryoproduction through somatic embryogenesis can be used to study cell differentiation in plants. Plant Cell,Tissue and Organ Culture, 86, 285-301.Salajová, T., Salaj, J. (2005): Somatic embryogenesis in Pinus nigra: Embryogenic tissue initiation,maturation and regeneration ability of establish cell lines. Biologia Plantarum, 49, 3, 333-339.Sterk, P., Booij, H., Schellekens, G. A., Van Kammen, A., De Vries, S. C. (1991): Cell-specific expression ofthe carrot EP2 lipid transfer protein. Plant Cell, 3, 907-921.Tchorbadjieva, M. I., Pantchev, I. Y. (2006): Secretion of chitinase-like protein in embryogenic suspensioncultures of Dactylis glomerata L. Biologia Plantarum, 50,1, 142-145.Von Arnold, S., Clapham, D., Egertsdotter, U., Mo, L. H. (1996): Somatic embryogenesis in conifers – A casestudy of induction and development of somatic embryos in Picea abies. Plant Growth Regulation, 20, 3-9.Wiweger, M., Farbos, I., Ingouff, M., Lagercrantz, U., Von Arnold, S. (2003): Expression of Chia4-Pachitinase genes during somatic and zygotic embryo development in Norway spruce (Picea abies):similarities and differences between gymnosperm and angiosperm class IV chitinases. Journal ofExperimental Botany, 54, 393, 2691-2699.Yildirim, T., Kaya, Z., Isik, K. (2006): Induction of embryogenic tissue and maturation of somatic embryos inPinus brutia TEN. Plant Cell Tissue and Organ Culture, 87, 67-76.Zhang, C., Li, Q., Kong, L. (2007): Induction, development and maturation of somatic embryos in Bunge´spine (Pinus bungeana Zucc. Ex Endl.). Plant Cell, Tissue and Organ Culture, 91, 273-280.389

AGRISAFE Budapest, Hungary, 2011PROTEIN, FAT AND STARCH CONTENTS OF SPRING ANDWINTER OAT (AVENA SATIVA L.) CULTIVARSIN CENTRAL SOUTHERN BULGARIAT. GEORGIEVA – P. ZOROVSKIDepartment of Plant Production, Faculty of Agronomy, Agricultural University,Plovdiv-4000, “Mendeleev” str., 12, BulgariaE-mail: tonia@au-plovdiv.bg; plivz@abv.bg;Abstract Four winter (Dunav 1, Ruse 8, Resor 1 and Line M-K) and 5 spring oat cultivars (Obraztsov chiflik4, Mina, HiFi, Novosadski golozarnest and Prista 2) were tested for protein, fat and starch content during theperiod 2007–2009 in Central Southern Bulgaria.The crude protein content of winter oat cultivars varied from 7.45–14.3%, in terms of dry matter, for differentcultivars and was influenced by the agro-climatic conditions of the year. The cultivar Ruse 8 had the highestaverage for the period. The starch content was in the range 34.89–43.2% for different cultivars and years, andthe fat content ranged from 5.35–7.77%. Cultivar Dunav 1 had the highest fat content, and Line M-K thehighest starch content.The spring cultivars tested had high protein contents of 10.57–19.38% of dry matter for different cultivars andyears. Average over the years, the highest protein content (16.94%) was found for the cultivar Novosadskigolozarnest, followed by the Bulgarian naked oat cultivar Mina (15.21%). The fat and starch contents werealso high in Novosadski golozarnest.Key words: oat, Avena sativa L., cultivars, protein, fat, starchIntroductionAmong the compositional components of oats, protein concentration is often rankedhighly in importance because of its nutritional significance. Oat grains contain from 12,4to 24,4 % of protein and have the highest level of nutritive substances amongst the restof the wheat cultivars (Peterson, 1992). Studies have shown genotypic andenvironmental effects on oat protein concentration (Forsberg et al., 1974; Saastamoinenet al., 1989). For example, in the studies carried out by Zhou at al. (1999) significantdifferences were found out between the cultivars and the regions they were grown in.Considerable variability is also recorded in relation to the growing conditions during theyears (Martinez, 2010). Influence of the agro-climatic conditions upon starch was notrecorded during the course of the conducted studies.Oat grains are relatively rich in oil compared to other cereals and can vary from 3% to11% of grain weight in different cultivars, with lines containing up to 18% (Frey andHolland, 1999). Most oat cultivars have about 5-6% of oil and 55-60% of starch in thegrain (Welch, 1995; Doehlert et al., 2001). Higher oil content is negatively correlatedwith starch content (Peterson and Wood, 1997).According to some authors proteins have negative dependence on fats (Brown et al.,1966), and according to others there is no consistent relationships between theseparameters (Forsberg et al., 1974; Youngs and Forsberg, 1979; Saastamoinen, 1987). Inthe mean time, Zhou at al. (1999) found out that grains from the sites producing highprotein concentration had low lipid concentration, indicating that growing conditionsfavourable to the synthesis of protein led to the reduction of lipid synthesis.Materials and methodsFour cultivars of winter oats (Dunav 1, Ruse 8, Resor 1, Line M-K) and five cultivars ofspring oats (Obraztsov Chiflik 4, Mina (naked oat), HiFi, Novosadski golozarnest(naked) oat and Prista 2) were studied during 2006-2009 in an experimental field of the390

Budapest, Hungary, 2011AGRISAFEPlant Production Department at the Agricultural University of Plovdiv, Bulgaria. HiFicultivar is American (McMullen at al., 2005); Novosadski golozarnest oat is a Serbiancultivar; and the rest 6 cultivars together with Line 1 are from the Bulgarian selection.The field test was repeated four times as the winter cultivars were sown in mid-October(with 500 germinating seeds per sq.m.), and the spring cultivars - in mid-March (600germinating seeds per sq.m.). The fertilizers used were N 6 P 8 K 8.The laboratory analyses were carried out in Central Laboratory for Research at AU –Plovdiv. The analysis regarding the presence of raw protein was carried out under BDS13490, for fats – under BDS 3412 established for wheat cultivars. The amount of starchcontained was measured with the help of the polygraphic method. The statisticalprocession of the test data was made through SPSS V.9.0 for Microsoft Windows.Results and discussionThe agro-meteorological conditions for the oats development are crucial not only fortheir growth and productivity, but also for their grain quality. The vegetation periods ofwinter and spring cultivars take their course under dissimilar conditions, whichinevitably influences all economic qualities of the grain yield.2007 had its unfavourable conditions for the development of oats until May, and thedownpours following this month (May and June) caused extension of the maturityperiod. 2007-2008 vegetation period was more favourable for the development of oatsand highest yields within the test. The last test year (2008-2009) characterized with mildwinter, normal temperatures and regular rains in spring, which are favourable for thevegetation of winter cultivars. Spring cultivars, however, lacked rain and thetemperatures were high during the phases, which are crucial factors for yields.The different conditions in the years influence the grain quality both in winter and springcultivars. The biggest amount of raw protein gathered in the grain in 2007 was averagely12,09% for winter cultivars, and 15,60% for spring cultivars. This fact is related to theheavy precipitations in May and June of 2007, which prolonged the maturity phase andcaused accumulation of more proteins.In the most favourable year for high yields – 2008, the proteins were 10,8% for wintercultivars, and 12,5% for spring cultivars. In 2009 spring cultivars had higher percentageof raw proteins compared to the winter cultivars.Form the data provided for in tables 1 and 2 it can be seen that there was a cultivarspecificity regarding the content of proteins. The Novosadski golozarnest oat cultivarwas proved to have the highest content of raw proteins – 16,94%, followed by theBulgarian cultivar Mina - 15,21% (from the naked ones) and Prista 2 cultivar (13,26%)from the weeds. The content of raw protein in winter cultivars was lower compared tothe spring ones. Averagely for the period, Ruse 8 cultivar had fairly most accumulatedproteins (11,83%), followed by Line M-K (10,87%), Dunav 1 (10,76%) and Resor 1(10,29%).Fats in winter cultivars varied from 6,02% to 6,50% averagely for the period for Resor 1and Dunav 1 respectively. The spring cultivars which proved to have the highest level offats were the naked cultivar Mina – 6,63% and Novosadski golozarnest cultivar – 6,80%.HiFi cultivar had considerably lower level of fats (4,82%), which (together with otherimportant qualities of the grain – high level of beta - glucans (Georgieva et all., 2010))makes it quite appropriate for the preparation of cereals.391

AGRISAFE Budapest, Hungary, 2011The starch in the tested cultivars varied from 36,78 to 38,65% for winter ones, and from38,45 to 40,16% for spring weed cultivars. The naked cultivar Mina and Novosadskigolozarnest had significantly higher levels of starch: Mina – 52,1%, and Novosadskigolozarnest cultivar - 55,27%.The analysis of the correlative dependencies between the tested characteristics of grainproved the assumed positive correlation (+0,578**) between the raw protein and starch(**Correlation is significant at the 0,01 level). A similar dependency was reportedbetween starch and fats (+0,524**). No correlation was reported between raw proteinsand fats.Table 1. Content of raw proteins, fats and starch in winter and spring oat cultivars, 2007-2009 (% from theabsolute dry mass)Cultivars Absolute dry mass, % Row protein Fats Starch2007Dunav 1 86,82 14,30 5,56 34,89Ruse 8 87,51 13,00 5,83 36,19Resor 1 86,71 12,81 6,16 34,94Line М-К 87,64 8,25 5,35 39,27Оbraztsov chiflik 4 88,83 13,44 5,00 39,52Mina 86,42 16,38 6,82 52,58HiFi 89,24 13,94 4,83 37,03Novosadski golozarnest 86,62 19,38 6,70 54,85Prista 2 86,84 14,88 5,00 39,642008Dunav 1 89,78 10,52 7,77 39,89Ruse 8 87,89 11,71 6,67 39,53Resor 1 89,25 9,81 6,38 43,20Line М-К 88,38 11,17 6,77 39,28Оbraztsov chiflik 4 89,58 11,94 6,33 37,93Mina 88,92 13,22 7,25 54,22HiFi 89,38 10,57 5,29 40,06Novosadski golozarnest 87,54 15,48 7,56 58,74Prista 2 89,46 11,13 6,16 43,112009Dunav 1 88,99 7,45 6,19 35,60Ruse 8 87,89 10,78 6,14 37,62Resor 1 89,25 8,26 5,53 35,50Line М-К 88,38 13,19 6,02 37,41Оbraztsov chiflik 4 89,05 13,34 4,92 38,67Mina 87,19 16,03 5,81 49,50HiFi 87,59 14,97 4,33 38,27Novosadski golozarnest 87,90 15,95 6,15 52,23Prista 2 87,60 13,76 4,22 37,74392

Budapest, Hungary, 2011AGRISAFETable 2. Cultivar influence upon the content of raw proteins, fats and starch, averagely, 2007 - 2009.Cultivars Abs. dry mass, % Row protein,% Fats,% Starch,%Dunav 1 88,53 10,76 c 6,50 ab 36,79 bRuse 8 87,76 11,83 bc 6,21 abc 37,78 bResor 1 88,40 10,29 c 6,02 abc 37,88 bLine М-К 88,13 10,87 c 6,05 abc 38,65 bОbraztsov chiflik 4 89,15 12,91 аbc 5,42 abc 38,71 bMina 87,51 15,21 ab 6,63 a 52,10 aHiFi 88,74 13,16 аbc 4,82 c 38,45 bNovosadski golozarnest 87,35 16,94 a 6,80 a 55,27 aPrista 2 87,94 13,26 аbc 5,13 bc 40,16 bConclusionsThe agro-meteorological conditions in the vegetation year and period had stronginfluence upon the quality of oats. Spring cultivars accumulated a higher percentage ofraw proteins, fats and starch compared to the winter ones.A specific cultivar reaction and influence of the genotype on the content of proteins, fatsand starch were reported. Novosadski golozarnest cultivar had the highest level ofproteins (16,94%), followed by Mina (15,21%). Both cultivars had the highest level offats and starch. From the winter cultivars, it is Ruse 8 which accumulated the highestpercentage of proteins in its content. HiFi cultivar was proven to have lower level of fats,which made it the most appropriate one for the preparation of food.Positive correlation was proved between raw protein and starch (+0,578**) and betweenstarch and fats (+0,524**). No correlation was reported between raw protein and fats.ReferencesBrown, C. M., Aleksander, D. E. and Carmer, S. G. (1966): Variation in oil content and its relation to othercharacteristics in oats (Avena sativa L.). Crop Sci. 6, 190-1.Doehlert D. C., M. McMullen and J.J. Hammond. (2001): Genotypic and environmental effects on grain yieldand quality of oat grown in North Dakota, Crop Sci. 41, 1066–1072.Georgieva, T., P. Zorovski, P. Taneva, V. Gotcheva. (2010) :. Grain β-glucan content of oat grown in SouthBulgaria. I. Oat grain β-glucan content as affected by genotype and year, Scientific works of AU, т.LV, 1,225-230.Forsberg, R. A. Youngs, V. L., and Shands, H. L. (1974): Correlation among chemical and agronomiccharacteristics in certain oat cultivars and selections. Crop Sci. 14, 221-4.Frey, K. J., Holland J. B. (1999): Nine cycles of recurrent selection for increased grain-oil content in oat. CropSci. 39, 1634-1641.Martinez, M. F., H. M. Arelovich, L. N. Wehrhahne. (2010): Grain yield, nutrient content and lipid profile ofoat genotypes grown in a semiarid environment. Field Crops Research, 1-2, 92-100.McMullen M.S., D.C. Doehlert and J.D. Miller. (2005): Registration of ‘HiFi’ Oat, Crop Sci. 45:1664.Peterson, D.M., (1992): Composition and Nutritional Characteristics of Oat Grain and Products, in: OatScience and Technology, H.G. Marshall and M.E. Sorrells, eds. Am. Soc. of Ag., Inc. and Crop Sci. Soc.of Am., Madison, WisconsinPeterson, D. M., D. F. Wood (1997):. Composition and structure of high-oil oat. Journal of Cereal Science 26,121-128.Saastmoinen, M. (1987): Oil content and fatty acid composition of oats. Annales Agriculturae Fenniae 26,195-200.Saastamoinen, M., Kumpulainen, J., and Nummela, S. (1989): Genetic and environmental variation in oilcontent and fatty acid composition of oats. Cereal Chemistry 66, 296-300.Welch, R. W. 1995. The chemical composition of oats. In: Welch R. W., ed. The Oat Crop. London: Chapman& Hall, UK, 279-320.Youngs, V. L., and Forsberg, R. A. (1979): Protein oil relation in oats. Crop Sci. 19, 798-802Zhou, M., K.Robards, M. Glennie-Holmes, S. Helliwell. (1999): Oat lipids–A review.JAOCS.79:585-592.393

AGRISAFE Budapest, Hungary, 2011RESEARCH ON THE ORGANIC AND MINERAL NITROGENFERTILIZATION OF WINTER WHEAT ON FOREST REDDISH-BROWN SOIL ON THE ROMANIAN PLAINŞ. GIGELNorthbridge Management, Polonă street, no 95-99, district 1, e-mail: gigel.stefan@northbridge.roAbstract The aim of the present work was to monitor the effect of different organic and mineral fertilizers onwinter wheat yields, in order to establish the optimum mineral nitrogen dose for this crop, as well as theresponse of winter wheat to the application of organic residues (30 t/ha manure or 40 t/ha sugar beet leaves andtops). The experiments were conducted in the experimental nursery of the Faculty of Agriculture, Bucharest,Romania. Geographically, the region is situated on the Romanian Plain, which has an annual mean temperatureof 10.5ºC and 560 mm annual rainfall, while the dominant soil type is preluvosol (forest reddish-brown soil).The study was continued for 3 years with the following crop rotation: winter wheat-barley-sugar beet. Thewinter wheat seed used in the experiment was Dropia, bred in the Fundulea Research and DevelopmentAgricultural Institute. The experiment was bifactorial: factor A: organic fertilizers (a 1 unfertilized, a 2 30 t/hamanure; a 3 40 t/ha sugar beet leaves and tops) and factor B: mineral nitrogen fertilizer [b 1 unfertilized, b 2 N 60 ,b 3 N 100 (60+40) , b 4 N 150 (80+70), b 5 N 200 (80+70+50)], with three replications. Data processing involved thedispersion method of factor analysis. The experiment was laid out in a split-plot design with a plot size of21.72 m 2 . Tillage was applied in accordance with the system recommended for the area: plowing at 25 cm andtwo disc harrow runs in autumn. The results showed a very significant yield increase after organic fertilizationwith manure or sugar beet leaves and tops. After nitrogen application the winter wheat yield increasedsignificantly up to the 150 kg nitrogen/ha dose; at higher rates the yield level decreased, so it is recommendedthat mineral nitrogen doses of less than 150 kg should be applied under the given climate and soil conditions.Key words: bifactorial experiment, organic fertilizers, mineral fertilizers, winter wheat, yield levelIntroductionThe researches were developed within an experimental field occupied by reddish brownsoils, supplied with medium nutrient elements and low humus content; as a result of that,it is suitable for mineral and organic fertilizers application, providing adequateconditions for obtaining high yields, when modern technologies are applied (CristianHera et al, 1987). The quantity of manure to be administered with good results in termsof residual effect for winter wheat crop, generally oscillates between 20-40 t/ha (Al.Ionescu et al, 1985); based on these considerations, a dose of 30 t/ha manure has beenused in this experiment. Leaves and colets of sugar beet have been used as organicfertilizer, due to the rotation that has been practiced (wheat-barley-sugar beet). InRomania's weather conditions, the wheat absorbs large amounts of ammonia nitrogenwhich is exploited at a rate of about 30% in case of grain production and 21.8%, in caseof straw production - a rate which translates into over 50% use coefficient of activesubstance (Cristian Hera et al, 1987).Materials and methodsThe experiment has been placed in the experimental field of Faculty of Agriculture,Agrotechnics and Soil Science Department, as part of University of AgriculturalSciences and Veterinary Medicine Bucharest. The experimental period was developedduring 3 years period. The experience was bifactorial: with organic fertilization, bydirect application of organic fertilizers (factor A) and mineral nitrogen fertilizer (factorB, in three repetitions). Factor A had the following graduations: a 1 - unfertilized, a 2 -retention of 30 t/ha manure; a 3 - 40 t/ha sugar beet leaves and colets. Factor B had thefollowing graduations: b 1 - unfertilized with mineral nitrogen, b 2 - N 60 , b 3 - N 100 (60 +40),b 4 - N 150 (80 + 70), b 5 - N 200 (80 + 70 + 50). Doses of 60 and 80 kg mineral nitrogen were394

Budapest, Hungary, 2011AGRISAFEapplied in autumn, as basic fertilization and were incorporated with a disc harrow intothe soil. At b 3 , b 4 , b 5 variants, 40-70 kg mineral nitrogen dose of active substance/ha hasbeen applied, in spring time period and before wheat plants vegetation start. In b 5variant, 50 kg N/ha were applied during plant bellows phase. General reserve ofphosphorus and potassium supply was assured by applying 70 kg active substance/haphosphorus, incorporated into the soil during plowing. Data processing was madeaccording to dispersional analysis method. The experimental scheme was bifactorial,arranged in conformity with subdivided parcels method. Plot size was 3.62 m x 6 m =21.72 m 2 . Tillage system in the experimental was the appropriate one recommended inthe area: plowing at 25 cm in autumn and 2 disc harrow works. Simultaneously withplowing, phosphorus and potassium fertilizers have been incorporated. Disc harrowworks facilitated the incorporation of nitrogen fertilizers. Dropia seed variety, Basebiological category, treated with Yunta FS 246 (2 l/ seed tone) was used for sowing.Sowing date: 25 October. At sowing, 230 kg seed/ha was the necessary quantity; sowingwas performed with U-650 universal tractor, associated with SUP-29 planter.Results and discussionRegarding the influence of organic fertilization on winter wheat yield, a growth of yieldin three years rotation was registered (table 1). This can be explained by the 30 t/haresidual manure; the yield in this case is 25.7 q/ha, with an increase of 7.6 q/ha, verysignificant statistically. Also, by application of 40 t/ha sugar beet colets and leaves theyield obviously increased (with by 6.8 q/ha), compared with the control plot, reaching a24.9 q/ha level, a very significant yield growth, statistically. When the last twofertilization variants are compared, the variant where 30 t/ha manure was applied in theprevious year and the variant that received 40 t/ha sugar beet colets and leaves, it appearsthat the first one achieved a higher yield level, ensuring a production increase of 0.8 q/ha,unlike the variant were 40 t/ha sugar beet colets and leaves were applied.Table 1. The influence of organic fertilization on winter wheat yield in case of reddish brown soil, in threeyears rotationVariantYield Difference(q/ha) (q/ha)SignificanceOrganic unfertilized 18,1 MtThe remanence of 30 t/ha manure 25,7 7,6 * * *40 t/ha sugar beet leaves and colets 24,9 6,8 * * *LD 5% = 1,242 q/ha; LD 1% = 1,792 q/ha; LD 0,1% = 2,507 q/haTable 2. The influence of mineral nitrogen fertilization on winter wheat yield in case of Moara Domneascăreddish brown soil, in 3 years rotationsVariantsa 1 - organic unfertilizedYield (q/ha) Difference (q/ha) Significanceb 1 -N 0 18,1 Mtb 2 -N 60 28,5 10,4 * * *b 3 -N 100 40,8 22,7 * * *b 4 -N 150 43,2 25,1 * * *b 5 N 200 38,3 20,2 * * *LD 5% = 1,358 q/ha; LD 1% = 1,846 q/ha; LD 0,1% = 2,472 q/ha395

AGRISAFE Budapest, Hungary, 2011Regarding the influence of mineral nitrogen fertilization on winter wheat yield, the 3years rotation have seen an obvious increase in yield, even in the absence of organicfertilizers (table 2).In case of mineral nitrogen unfertilized variant, yield was 18.1 q/ha. The application of60 kg/ha nitrogen active substance led 28.5 q/ha yield increase, so the yield growth was10.4 q/ha, very significant statistically. In case of b 3 and b 4 fertilization variants, were100, respectively 150 kg/ha nitrogen active substance have been applied, the yield levelswere 40.8, respectively 43.2 q/ha, an increase of 22.7 q/ha, respectively 25.1 q/ha, highlystatistically significant. In b 5 variant, 200 kg/ha nitrogen active substance was applied,resulting a 38.3 q/ha yield and providing an increase of 20.2 q/ha, compared to thecontrol plot, also very significant statistically. However, an application of 200 kg/hanitrogen active substance, although it provides a very significant increase in yieldcompared with control plot, still the yield decreases comparing with 150 kg/ha nitrogenactive substance variant and the loss of yield in this specific case is very significant - 4.9q/ha (table 2). Due to this fact, it is recommended a maximum dose of 150 kg/ha activesubstance mineral nitrogen applied to winter wheat crop, in this area climatic and soilconditions. Regarding the influence of organic and mineral nitrogen fertilization onwinter wheat yield, there is an obvious increase of yield (table 3). In control plot theyield was 25.7 q/ha, were no mineral nitrogen fertilizer was applied and was only theorganic remanence effect (30 t/ha manure remanence). By 60 kg nitrogen activesubstance/ha application the yield increase was very significant, reaching 32.4 q/ha,ensuring an increase of 6.7 q/ha, compared to the unfertilized control plot. In the b 3variant when 100 kg of active substance/ha was applied, a sharp increase in yield levelwas registrated, compared to the control plot. The yield was 44.0 q/ha, ensuring a verysignificant yield increase, of 18.3 q/ha. In b 4 variant, by applying 150 kg/ha mineralnitrogen active substance, the yield has increased up to 47.6 q/ha, ensuring a yield levelincrease of 21.9 q/ha, considered as very significant. In the last fertilization variant,when 200 kg/ ha nitrogen active substance were applied, the yield was 39.4 q/ha, a verysignificant yield increase, of 13.7 q/ha. So, in case of organic un-fertilization, it isrecommended that the maximum mineral nitrogen dose to be no more than 150 kgmineral nitrogen active substance/ha, when we deal with 30 t/ha manure remanence.Following the effect of mineral nitrogen application, taking in consideration the reserveof 40 t/ha sugar beet colets and leaves, it has been observed an increase of yield withincreasing the dose of mineral nitrogen dose, up to 150 kg/ ha active substance.Table 3. The influence of mineral and organic fertilization on winter wheat yield on reddish brown soilMineral nitrogen fertilization influenceAgroon winter wheat yield (q/ha) at different levels of organic fertilizationmineralreservea 1 - organic unfertilized a 2 - 30 t/ha manure remanence a 3 -40 t/ha sugar beet colets andleavesYield Dif. Signif. Yield Dif. Significance Yield Dif. Significance(q/ha) (q/ha)(q/ha) (q/ha)(q/ha) (q/ha)b 1 - N 0 18,1 Mt 25,7 Mt 24,9 Mtb 2 - N 60 28,5 10,4 *** 32,4 6,7 *** 31,4 6,5 ***b 3 - N 100 40,8 22,7 *** 44,0 18,3 *** 44,2 19,3 ***b 4 - N 150 43,2 25,1 *** 47,6 21,9 *** 46,9 22,0 ***b 5 - N 200 38,2 20,2 *** 39,4 13,7 *** 39,5 14,6 ***DL 5% = 1,358 q/ha; DL 1% = 1,846 q/ha; DL 0,1% = 2,472 q/ha396

Budapest, Hungary, 2011AGRISAFEThe control plot yield was 24.9 q/ha, were no mineral nitrogen fertilizer was applied. By60 kg/ ha mineral nitrogen active substance application, a yield of 31.4 q/ha wasobtained, a significantly increase, compared to 6.5 q/ha of the control plot. In case of b 3and b 4 variants, when 100 and 150 kg/ha mineral nitrogen active substance was applied,the yield increased very significantly: 44.2 q/ha, respectively 46.9 q/ha. In b 5 variant,when 200 kg/ ha N was applied, on remanence of 40 t/ha sugar beet colets and leaves,the yield was 39.5 q/ha, with a very significant 14.6 q/ha yield increase. In this variant,even if we get an increase of 14.6 q/ha compared to the control plot, application of 200kg/ha N is not justified, because there is a decrease of production of 7.4 q/ha, so themaximum dose of N (when soil remanence is 40 t/ha colets and sugar beet leaves),should be 150 kg N/ha.ConclusionsThe organic fertilization (in case of 30 t/ha manure and 40 t/ha sugar beet colets andleaves remanence) caused very significant yield increases, without very distinguishelements in between. Mineral nitrogen fertilization determined the increase of winterwheat yield, up to the dose of N150; over this dose, the unilateral application of Ndecreases the yield. As a result of that, it is recommended that maximum dose of mineralnitrogen applied to winter wheat crop to be 150 kg/ha, in the case of this specific soil andclimatic conditions. The application of mineral fertilization when there is an organicfertilizer remanence in the soil has increased the overall level of yield, up to 150 kg dose.ReferencesGuş, P., Săndoiu, D.I., Lăzureanu, A., Stancu, I. (1998): Agrotehnică, Editura Rizoprint, Cluj Napoca.Hera, C., Burlacu, Gh., Mihăilă, V., Toncea, I., Petre, M., Crăciun, V. (1987), Cercetări privind folosirearaţională a îngrăşămintelor, Analele ICCPT Fundulea, Volumul LV.Ionescu, Al., Ionescu, Jinga, Ştefanic, Gh. (1985): Utilizarea deşeurilor organice ca îngrăşământ, EdituraCeres.Roman, Gh. V., Axinte, M., Munteanu, L., Borcean, Gh. (2003): Fitotehnie, Editura Ion Ionescu de la Brad,Iaşi.Sin, Gh. (1987): Cercetări privind asolamentele, lucrările solului şi tehnica de semănat, Analele ICCPTFundulea, Volumul LV.Ştefan, G. (2003): Cercetări privind influenţa fertilizării organice şi minerale la cultura grâu de toamnă, solulbrun roşcat de la Moara Domnească, Lucrare de Diplomă, Universitatea de Ştiinte Agricole şi MedicinăVeterinară Bucureşti, Facultatea de Agricultură397

AGRISAFE Budapest, Hungary, 2011PRELIMINARY RESULTS FROM A COMPARATIVE TRIAL ONFRENCH BEAN GROWNUNDER ORGANIC AND CONVENTIONAL CULTIVATIONCONDITIONSA. GYÖRGYINÉ KOVÁCSResearch Institute of Nyíregyháza CAAES RIF University of Debrecen, Nyíregyháza, HungaryAbstract Organic farming meets the concept of sustainability. The use of environmentally friendly farmingmethods not only provides healthy food, but also plays an important role in retaining the local population.The present study examined the yield characteristics of French bean varieties produced under organic andconventional cultivation conditions. The questions raised were as follows: Which varieties can be growneffectively with which growing methods in a given region, considering the yields obtained for varieties withdifferent growing methods? Are there any differences in the yield parameters of the same variety with differentgrowing methods? What conclusions can be drawn on the effect of growing methods based on the averageresults of the varieties examined? Which varieties can be cropped successfully in the given cultural landscape?Seven varieties were tested in the experiment, two green-podded (‘Buvet’ and ‘Paulista’) and five yellowpodded(‘Bodor’, ‘Carson’, ‘Minidor’, ‘Paridor’ and ‘Sonesta’). Crop processing was based on 20 plants. Theplants were harvested continuously and the pods were categorized as standard, non-standard, diseased andoverdeveloped. The distribution of these categories was analysed for the full crop and per hectare. The resultswere evaluated statistically with SPSS and Excel software. No difference was found between organic andconventional cultivation in the rate of the overdeveloped and non-standard categories. However, there wereimportant differences between the diseased and standard categories. The varieties gave different responses togrowing methods. Considering the yield per hectare, four varieties produced more under organic cultivation,two varieties produced more under conventional cultivation and one variety exhibited no great differencebetween growing methods. In the year tested, yellow-podded varieties had higher yield than green-podded. Theyields of ‘Sonesta’ and ‘Minidor’ were equally high using both cultivation methods. According to the results,the profitability of organic farming is a function of cultivar suitability. For this reason, it is necessary tocompare the performance of cultivars in different growing regions. To make a sound conclusion, several yearsof experimentation are needed in the forthcoming years.Key words: French bean, yield characteristics, organic and conventional cultivationIntroductionOrganic farming meets the concept of sustainability. The use of environmentally friendlyfarming methods not only provides healthy food, but also plays an important role inpreserving the local population. According to references in the first year transition oforganic field, the yield is lower than in conventional culture. Later there is not significantdifference between growing methods (Radics, 2001; Theuer, 2006; Tabaglio at el.,2008).In present study we examined the yield characteristics of French bean varieties producedunder organic and conventional cultivation.Materials and methodsSeven varieties were tested in the experiment, two green-podded (‘Buvet’ and ‘Paulista’)and five yellow-podded (‘Bodor’, ‘Carson’, ‘Minidor’, ‘Paridor’ and ‘Sonesta’). Theplots were located randomized in two replications. Crop processing based on 20 plants.We made continuous green harvesting. We categorized the pods as standard, unstandardised,diseased and overdeveloped ones. We examined the rate of categorieswithin full crop and product per hectare. The organic field was transitioned at least 10years ago.398

Budapest, Hungary, 2011AGRISAFEResults and discussion1) Results of the same variety under different growing methods:Variety ‘Paulista’: Yield per hectare was more by 23% under organic cultivation thanunder conventional cultivation. In the standard and overdeveloped categories were notimportant differences. However, rate of the diseased pods were 37% under conventionalcultivation, but under organic cultivation was only 5%. The standard yield wasappreciable under organic condition (59%), while under conventional cultivation was29% (tables 1-2).Table 1. Plant per plots and yield resultsPlant per plot product per hectare (t ha -1 )standard andoverdeveloped product(t ha -1 )varietyconventionalorganicdivisionconv=100%conventionalorganicdivisionconv=100%conventionalorganicdivisionconv=100%Paulista 85 87 102 3.04 3.74 123 1.08 2.75 255Buvet 84 77 92 3.07 5.51 180 1.30 3.16 243Sonesta 74 67 91 8.05 10.89 135 3.89 7.96 205Carson 125 132 106 8.26 6.22 75 3.58 4.97 139Bodor 88 89 101 4.56 4.82 106 2.86 3.49 122Paridor 79 100 127 5.48 6.50 119 3.75 5.25 140Minidor 176 156 89 12.87 8.97 70 4.07 6.34 156Table 2. Division of yield advancement categorizes by growing methods (%)varietyStanderd-organicDiseased-organicDiseasedconventionalStanderdconventionalUn-standerdisedorganicUn-standerdisedconventionalOverdevelopedorganicOverdevelopedconventionalPaulista 59 30 5 37 22 23 14 10Buvet 43 19 8 22 35 30 14 29Sonesta 57 33 5 11 22 33 16 23Carson 25 25 0 27 21 34 54 14Bodor 67 45 3 13 25 20 5 22Paridor 65 42 0 13 19 19 16 26Minidor 48 14 0 43 30 26 22 17average 52 30 3 24 25 26 20 20SZD 5% 9.9 12.54399

AGRISAFE Budapest, Hungary, 2011Variety ‘Buvet’: Yield per hectare was more by 80% under organic cultivation thanunder conventional cultivation. In the un-standardised category there was not importantdifference. The rate of the diseased category was more triplicate under conventionalcultivation than under organic cultivation. The rate of overdeveloped category wasdouble than under organic cultivation. Accordingly under conventional cultivation thegreen harvest was made later than at optimal state. Examined the standard andoverdeveloped categories together it was found that the rate of two categories were 48%under conventional cultivation and 57% under organic cultivation.Variety ‘Sonesta’: Yield per hectare was more by 35% under organic cultivation thanunder conventional cultivation. Under organic cultivation the rate of diseased pods washalf than under conventional cultivation. Under the conventional cultivation the rate ofoverdeveloped and un-standardised categories were higher than under organic ones. Therate of the standard category was 57% under organic cultivation and 33% underconventional cultivation. Rate of the standard and overdeveloped pods together were73% under organic production, more by 30% than under conventional production.Variety ‘Carson’: Under organic cultivation the yield was less than under conventionalones. In the rate of standard category was not important difference, but under organiccultivation the green harvest appreciably passed the green mature state, because the rateof overdeveloped pods was 54%. Under organic cultivation we did not found diseasedpods, under conventional cultivation 27% of yield was diseased. The rate of the offstandard category was 21% under organic cultivation, and 34% under conventionalcultivation.Variety ‘Bodor’: The yield of two growing methods was about the same. Regarding theun-standardised category there was not important difference between growing methods.The rate of diseased pods was appreciably lower under organic cultivation (3%) thanunder conventional cultivation (13%). Under organic cultivation the rate ofoverdeveloped pods was only 5%, under conventional cultivation was 22%. Accordinglythe rate of standard yield was 67% under organic cultivation and under conventionalcultivation was 45%.Variety ‘Paridor’: Yield per hectare was more by 18% under organic cultivation thanunder conventional cultivation, but plant number was more by 26% than underconventional cultivation. Under organic cultivation diseased pods were not found, whileunder other cultivation 13% of yield was diseased. Regarding the un-standardisedcategory there was not difference between two growing methods. Samples werecollected after green mature under conventional field which can be seen from the highrate of the overdeveloped pods (26%). The rate of standard category was 42%. In thecrop of organic field the rate of overdeveloped pods were only 16%, however that ofstandard ones was 65%. When two categories were examined together, it was found, thattheir rate were 81% under organic field while 68% under conventional field.Variety ‘Minidor’: Yield per hectare was less by 30% under organic cultivation thanunder conventional cultivation. Under organic cultivation were not diseased pods, whileunder other cultivation 43% of yield was diseased. The rate of un-standardised andoverdeveloped pods was the same under both fields. The rate of standard category wasbetter (48%) under organic cultivation than under conventional field (14%), where themajority of crops was diseased (43%).2) Difference among varieties under same growing methods:400

Budapest, Hungary, 2011AGRISAFEUnder conventional cultivation: The highest rates of diseased pods were producted by‘Minidor’ and ‘Paulista’. Less diseased pods were on ‘Sonesta’, ‘Bodor’ and ‘Paridor’.The rate of standard and overdeveloped categories was the highest in ‘Paridor’, ‘Bodor’and ‘Sonesta’.Under organic cultivation: The highest rates of diseased pods were producted by‘Buvet’. Diseased-pod was not found in ‘Carson’, ‘Paridor’ and ‘Minidor’. The rate ofstandard and overdeveloped categories was the highest in ‘Paridor’, ‘Carson’ and‘Paulista’.The yield between varieties under different cultivations:Under conventional cultivation the ‘Minidor’ variety had the higest yield (~13 t ha -1 ),then ‘Sonesta’ and ‘Carson’ (~8 t ha -1 ). The least yield was produced by ‘Paulista’ and‘Buvet’ (~3 t ha -1 ).Under organic cultivation the ‘Sonesta’ (~11 t ha -1 ), then ‘Minidor’ (~9 t ha -1 ) producedthe highest yield. The least yield was produced was by ‘Paulista’ and ‘Bodor’.The yield based on standard and overdeveloped categories:Under conventional cultivation the production capacity of ‘Minidor’, ‘Sonesta’ and‘Paridor’ varieties were the best. The both green-podded varieties produced the less.Under organic cultivation the yield of ‘Sonesta’ was prominently great (~8 t ha -1 ), then‘Minidor’ and ‘Paridor’. The green-podded varieties produced the less, as well.3) Conclusion based on average of 7 varieties:The results were evaluated with pared t-proba using SPSS program package. Nosignificant difference was proved between growing methods concerning the rate of theoverdeveloped and un-standardised categories, but significant difference was proved inthe rate of diseased and standard categories.The rate of standard category was on the average more by 73% under organiccultivation. The rate of diseased pods was on the average 3% under organic cultivationand 24% under conventional cultivation. The varieties gave different responses togrowing methods. The rainy and cool weather was very favourable for fungal disease.ConclusionThe differences depended on varieties. The rate of diseased pods was significantly lessunder organic cultivation. Four varieties produced higher yield under organic cultivation(‘Paulista’, ‘Buvet’, ‘Sonesta’ and ‘Paridor’), The yield of two varieties were higherunder conventional cultivation (‘Carson’, ‘Minidor’) and the ‘Bodor’ variety had notimportant difference in the yield between the growing methods.This year, the yield of yellow-podded varieties was better than that of green-poddedones. The ‘Sonesta’ and ‘Minidor’ varieties produced well under both cultivationmethods, but their higher yield capacity can be expressed under organic cultivation.To make a sound conclusion, several years of experimentation is needed in theforthcoming years.ReferencesTabaglio, V., Gavazzi, C., Nervo, G. (2008): A comparison of organically and conventionally grown vegetablecrops: resilts from a 4-year field experiment. http://orgprints.org/11502. 1-4.Theuer, C.R. (2006): Do organic fruits and vegetables taste better than conventional fruits and vegetables?www.organic-center.org. 1-19.Radics, L. (2001): Ökológiai gazdálkodás: Általános kérdések, növénytermesztés, állattenyésztés. 59-62.401

AGRISAFE Budapest, Hungary, 2011SUSTAINABLE WHEAT PRODUCTION IN A CHANGINGCLIMATEN. HARNOS 1 – É. ERDÉLYI 21 Agricultural Research Institute of the Hungarian Academy of Sciences, e-mail:harnosn@mail.mgki.hu2 Department of Mathematics and Informatics, Faculty of Horticultural Science, Corvinus University ofBudapest, e-mail:eva.erdelyi@uni-corvinus.huAbstract The dependence of winter wheat production on spring temperature and precipitation was analysed onthe basis of historical meteorological data. Production was found to be a linear function of temperature, soincreasing temperatures resulted in lower yields. The dependence of yield on precipitation could be describedwith a quadratic function, and the yield decreased above the optimal precipitation amount. The results ofregression analysis are presented using 30-year data for Fejér County. Simulation modelling was used toanalyse the suitability of future climates for growing winter wheat in Hungary. The locations chosen wereheterogeneous in terms of meteorological conditions, but were all relatively flat and of great importance forHungarian winter wheat production: Győr-Moson-Sopron County in W. Hungary, which is well supplied withprecipitation, Hajdú-Bihar County in the east, where the weather is warmer and drier, and Pest County in themiddle of the country. Evaluations were made using the Ceres-Wheat model and a modified version ofAFRCWHEAT2. An analysis of the simulation results revealed that agricultural productivity is close to theupper limit of what can be achieved using conventional methods, so decreased yields and an increase inproduction risks are probable in the future in all three regions.Key words: wheat production, temperature, precipitation, simulation modellingIntroductionHungary is located at the junction of the Atlantic, Mediterranean and Continental climatezones, all three of which influence weather conditions, which are consequentlyextremely variable. Despite the frequency of extreme weather events, however, theconditions are very favourable for agricultural production.Climate change scenarios for Hungary generally predict a mean rise of 1°C for the springand autumn months and 2–4°C in the winter and summer months up to the middle of thecentury, rising to 3–5°C by the end of the century. Changes in rainfall sums may differin the western and eastern parts of the country. They are likely to increase in the wintermonths, while rainfall in summer may drop by 20–30% in the eastern regions (Bartholyet al. 2007). Among the agricultural effects of global climate change, variability in thequantity of rainfall during the vegetation period is likely to have the most limiting effecton yield reliability.In the present work a long-term data series was used to examine the closeness of thecorrelation between winter wheat yields and the temperature and rainfall sums in spring,and a simulation model was used to describe what changes can be expected under theclimatic conditions of the future.Materials and methodsRegression analysis was performed on the mean winter wheat yields recorded in FejérCounty over the period 1981–2008 and on daily temperature and rainfall data.The simulation was run (Harnos and Erdélyi 2008) using a modified version of thepreviously tested and validated AFRCWHEAT2 model (Porter 1993), designated as theAF2MOD model, and the Ceres-Wheat model (Ritchie and Otter 1985).The effects of climate change were examined on the winter wheat yields obtained inthree geographically and meteorologically diverse regions of Hungary: Győr-Moson-Sopron County, a wetter region in the west, Pest County, representative of the central402

Budapest, Hungary, 2011AGRISAFEpart of the country, and Hajdú-Bihar County, an important agricultural area in thewarmer, drier region of Eastern Hungary. In this way the effects of climate change couldbe examined at approximately the same latitude from west to east.The climate change data series used for the simulations were downloaded from thehomepage of the Department of Meteorology, Eötvös Loránd University, Budapest forthe 2070–2100 period (Bartholy et al. 2007). Two data series were used, both of whichincluded a control data series representing the last third of the 20 th century. One of thedata series was compiled by the Hadley Centre (HC) and the other by the Max PlanckInstitute (MPI). The control runs (1960–1990) and the A2 scenario (a composite of 16model runs) were used from both data series.The means of the results obtained by running the control and scenario data series werecompared using the t-test and the deviations using the F test.Results and discussionAmong the meteorological factors, crop production is influenced to the greatest extentby temperature and rainfall. The dependence of the winter wheat yield on weatherconditions is illustrated in Figure 1, where the mean yields recorded in Fejér Countyover a period of nearly 30 years are plotted against temperature and rainfall data.7 0007 0006 5006 0005 5001985198419896 5006 0005 50019841989 1985Yield (kg/ha)5 0004 5004 0003 5003 0002 5002 00019932003R 2 = 0,486620071996 freezingheat wavewinter62 112 162 212 262 312Rainfall sum for Mar.–Jun (mm)R 2 = 0.3684Figure 1. Winter wheat yield averages in Fejér County during the 1981–2008 period as a function of meantemperature and rainfall quantities in spring. Years with exceptional yield averages are highlighted. Thecontinuous lines represent curves fitted to the points: with the exception of 1996, the winter wheat yieldsexhibited a linear correlation with temperature (R 2 = 0.36) and a quadratic relationship with rainfall quantity(R 2 = 0.48)The data indicate that a third of the winter wheat yield depended on the meantemperature from April to June and half on the rainfall quantity from March to June.Extreme weather conditions intensify each other’s effects, in both a positive and anegative direction. In 1984, 1985 and 1989 favourable temperatures combined withrelatively high rainfall sums resulted in high yields, while in 2003 the exceptional lack ofrainfall combined with high mean temperatures caused considerable yield losses. A veryhot spring and summer (2007), rainfall deficiency (1993) or a very cold winter (1996)may in themselves result in yield declines.5 0004 5004 0003 5003 0002 5002 00019931996droughtfreezing winter2003drought200713 14 15 16 17 18 19Mean temperature for Apr.-Jun (°C)403

AGRISAFE Budapest, Hungary, 2011The use of simulation models demonstrated that winter wheat yields are likely todecrease in the second half of the century, assuming the present growing conditions(technology and varieties), compared with the present situation, taken as the control (Fig.2). In terms of yield, the HC scenario of the AF2MOD model did not predict reductionsin Pest County, but in all the other cases a drop in grain yield was predicted, which wassignificant for both climate scenarios in Hajdú-Bihar County and for the MPI scenario inGyőr-Moson-Sopron County (Fig. 2). The Ceres-Wheat model simulated significantyield losses for both the climate scenarios.The risk of yield losses rose significantly in Pest and Hajdú-Bihar Counties comparedwith the control.yield (t/ha)76543210** *** ** ** **HC MPI HC MPI HC MPI HC MPI HC MPI HC MPIControlSc enarioAF2MODCeres-WheatAF2MODCeres-WheatAF2MODCeres-WheatPest Gy őr-Moson-Sopron Hajdú-BiharScenario/Model/CountyFigure 2. Mean values and standard deviation of the wheat grain yields simulated by the Ceres-Wheat andAF2MOD models using the HC and MPI climate scenarios *, **: Differences significant from the control atthe 5% and 1% probability levels, respectively.ConclusionsThe success of agricultural production is reduced to the greatest extent by unfavourableenvironmental effects, the most important of which is water deficit. The negativechanges predicted in the quantity and distribution of rainfall serve to enhance theoutstanding significance of the water reserves stored in the soil and available to plants(Várallyay 2008).Unfavourable economic effects may be modified by the increasing concentration ofatmospheric CO 2 . Differences can be observed in the ability of cereal genotypes toexploit surplus CO 2 , primarily to increase the grain yield, so it may be possible to selectgenotypes capable of adapting efficiently to altered conditions (Varga et al. 2009).The greatest variability can be detected between technological factors, indicating that theoptimum balance between complex interactive effects can only be achieved with greatexpertise and care. If soil and climatic conditions or the production technology are not ofa very high standard, it is not advisable to choose varieties capable of record yields.Varieties with good adaptability are able to produce good yields even their requirementsare not fully met. Yield reliability can be improved by growing varieties withsatisfactory adaptability, whose yields exhibit less fluctuation. The primary task facing404

Budapest, Hungary, 2011AGRISAFEtoday’s breeders is not to increase yields, but to improve yield quality and reliability andto develop varieties resistant to extreme weather events.To achieve adaptability to climate change it is thus necessary for experts in various fieldsto promote higher, more stable yields by developing drought- and heat-resistantvarieties, by choosing optimum sowing dates, and by applying water-saving technologiesand optimum tillage, and to investigate ways in which carbon dioxide can be moreefficiently exploited.AcknowledgementsThis research was funded from the AGRISAFE EU-FP7-REGPOT 2007-1 project (No.203288 ) and by a grant from the National Scientific Research Fund (OTKA No.K63369).ReferencesBartholy J., Pongrácz R., Gelybó G. (2007): Regional climate change expected in Hungary for 2071-2100.Applied Ecology and Environmental Research. 5, 1-17.Harnos N., Erdélyi É. (2008): Alkalmazkodási stratégiák őszi búza termelékenységének fenntartásáhozszimulációs modellek használatával. (Adaptation strategies for the maintenance of winter wheatproductivity using simulation models.) In: Harnos Z., Csete L. (eds.), Klímaváltozás: környezet-kockázattárasadalom.pp. 309-328.Porter J.R. (1993): AFRCWHEAT2 A model of the growth and development of wheat incorporating responsesto water and nitrogen. Eur. J. Agr., 2, 69-82.Ritchie J.T., Otter S. (1985): Description and Performance of CERES-Wheat: a User-oriented Wheat YieldModel. US Dept. Agric., ARS, 38, 159-175.Varga B., Bencze S., Veisz O. (2009): A szárazság és az emelt légköri CO 2 hatása az őszi búzaproduktivitására. (Effect of drought and enhanced atmospheric CO 2 on the productivity of winter wheat.)In: Veisz O. (ed.), Hagyomány és haladás a növénynemesítésben. XV. Növénynemesítési napok(2009.III.17.) pp. 517-521.Várallyay G. (2008): Extreme soil moisture regime as limiting factor of the plants’ water uptake. Cereal Res.Commun. 36, 3-6.405

AGRISAFE Budapest, Hungary, 2011INCREASING BIOGAS YIELD PER UNIT AREA USING A NEWTYPE OF SILAGE MAIZE HYBRIDSZS. HEGYI – ZS. TÓTHNÉ-ZSUBORI – J. PINTÉR – L. C. MARTONMaize Department, Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, H-2462, Brunszvik u. 2. e-mail: hegyiz@mail.mgki.huAbstract Nowadays more than half the energy used in the European Union is imported. In Hungary this ratiois greater than 66%. The production of biogas will not only replace fossil fuels, but will also help to achieve theobligations laid down in the Kyoto Protocol. Experiments have been underway in Martonvásár for many yearsto develop leafy silage hybrids, which have a greater aboveground mass than conventional silage hybrids. Thebest hybrids for biogas production would be those that produce a large quantity of biomass and are rich instarch. The chief characteristic of leafy hybrids is that they have more leaves than normal hybrids. Due to thisenhanced leaf area above the ear, the vegetative period of leafy genotypes is shorter, while the grain-fillingperiod is longer, which has a positive effect on both yield and grain quality. The results of the presentexperiment show that during the anaerobic fermentation of the silage, leafy hybrids produced more biogas (640l per 1000 g dry matter) than conventional hybrids (606 l per 1000 g dry matter). A strong positive correlationwas found between biogas yield and the starch content of the silage, and a moderate positive correlationbetween biogas yield and the sugar content. The correlation between biogas yield and the lignin and proteincontents was negative, in accordance with other literary data.Key words: silage hybrids, leafy, non-leafy, biogas, quality, biogassingIntroductionThe existence of biogas has been known for many centuries. Shirley discovered marshgasin 1677 and Volta revealed it to be combustible in 1776 (Bai, 2007). The greatestadvantage of biomass-based energy production is that it is a renewable energy source,which can be reproduced year by year. Biomass for energy purposes may originatedirectly from agricultural crop production, such as maize or potatoes. A common featureof energy plants is that they contain granular starch, which forms the raw material offermentation. Maize, especially silage maize, could be one of the most importantrenewable energy sources, because it has a large dry matter yield, high protein andenergy content and good digestibility, and the dry matter content at harvest is optimal forfermentation (Carter et al., 1991). A higher ratio of leaves in the total plant dry matterand greater carbohydrate content in the leaves above the ear in leafy hybrids (Andrews etal., 2000, Pintér et al., 2010) have a favourable influence on the quality andfermentability of the silage. The range of chemical components that need to be analysedis wider in the case of silage maize than for grain maize. The crude protein, crude ash,crude fat and crude fibre contents of the whole plant are also important for forage.Instead of starch content the water-soluble carbohydrate content (including mono- andoligosaccharides) is measured for silage. This influences fermentability to a great extent.Examples from other countries show that biogas plants based exclusively on silagemaize are justiefied because the raw material production can easily be integrated into theexisting agricultural system (Rácz et al., 2009). The results of experiments on silagemaize hybrids show that leafy hybrids produce more biogas than conventional hybrids(Hegyi et al., 2009). The objective of biogas production is to achieve a highconcentration of methane in the fermentation end-product. Good quality biogas containsat least 60% methane (Herrmann and Taube, 2006).406

Budapest, Hungary, 2011AGRISAFEMaterials and methodsAn experiment on leafy and non-leafy silage hybrids was set up in a randomisedcomplete block design with four replications in Martonvásár, Hungary in 2009 and 2010.The experiment was sown with 80.000 plants per hectare. During August one row ofeach of the four leafy (Mv Limasil, Mv Dunasil, Mv Siloking, Mv Massil) and four nonleafy(Maros, Mv NK 333, Mv TC 434, Maxima) varieties was cut, and choppedsamples were prepared from the whole aboveground part of the plants. Part of eachsample was used to analyse biogas yield in the BETA Research Institute inSopronhorpács. Biogas formation consists fundamentally of two processes, fermentationand methane formation. During the phases of fermentation (hydrolysis, acidic phase) thelarge-molecule organic matter is decomposed with the help of enzymes and fermentationbacteria. The other part of each sample was measured by NIR spectroscopy and analysedusing the “INGOT calibration of maize silage” software for chemical composition traitssuch as dry matter, ash, lignin, fat, starch and protein. This technique is also suitable formeasuring in vitro digestibility. The NDF (neutral detergent fibre), WSC (water-soluablecarbohydrate), NDICP (neutral detergent insoluble crude protein), ADICP (aciddetergent insoluble crude protein) and lactic acid contents of the samples were alsodetermined.Results and discussionThe biogas production of leafy and conventional hybrids was studied over two years. Itwas concluded that, during the anaerobic fermentation of silage maize, leafy hybridsproduced more biogas (640 l per 1000 g dry matter) than conventional hybrids (606 l per1000 g dry matter) (Fig. 1).biogas, l/kg dry m.8006004002000MarosMvNK333Mv 437MaximaMvLimasilMvDunasilMvSilokingMvMassilnon-leafy2009 2010leafyFigure 1. Specific biogas yield from leafy and non-leafy hybrids (l per 1000 g dry matter) averaged over theyears 2009 and 2010The difference was statistically significant. In both years the lowest biogas productionwas recorded for the same hybrid (Mv NK 333, 546 l per 1000 g dry matter), while twoleafy hybrids (Mv Siloking, Mv Dunasil) produced the greatest biogas yield (Fig. 2). Thebest quality biogas contains 60% methane. Biogas fermented from leafy hybrids had ahigher methane content than that of conventional hybrids. The process of outgassingtook three weeks and the rate of outgassing was 87%, averaged over years and hybrids.407

AGRISAFE Budapest, Hungary, 201160070,050060,0biogas yield, l/kg dm.40030020050,040,030,020,0%10010,001 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21daysl/kg sza. CH4 (%) CO2 (%)0,0Figure 2. Specific biogas yield from the maize hybrid Mv Dunasil averaged over the years 2009 and 2010A strong positive correlation was found between the biogas yield and the starch contentof the silage, and a moderate positive correlation between the biogas yield and the sugarcontent (Table 1). The correlation between the biogas yield and the lignin and proteincontents was negative, in accordance with other literary data.Table 1. Chemical composition of the silage and correlations with biogas yield averaged over the years 2009and 2010Non-leafy Biogas Starch Protein Lignin ADICP NDF NDICP WSCMaros 601.50 36.56 8.80 4.44 4.13 53.60 2.42 5.41Mv Nk 333 546.00 32.93 9.70 4.24 4.22 53.40 2.40 5.48Mv 437 633.00 34.33 8.50 4.15 4.17 54.48 2.28 5.36Maxima 642.50 35.60 9.70 4.23 4.20 53.00 2.48 5.75Mean 605.75 34.86 9.18 4.27 4.18 53.62 2.40 5.50correlations 0.59 -0.36 -0.23 -0.34 0.17 -0.04 0.31Leafy Biogas Starch Protein Lignin ADICP NDF NDICP WSCMv Limasil 629.50 36.18 8.90 4.27 4.17 54.75 2.35 5.04Mv Dunasil 630.50 36.50 9.49 4.02 4.07 54.80 2.38 5.57Mv Silóking 640.50 35.40 8.82 4.21 4.20 53.17 2.51 5.95Mv Massil 659.00 37.50 8.87 4.07 4.06 55.36 2.28 5.60Mean 639.88 36.40 9.02 4.14 4.13 54.52 2.38 5.54correlations 0.61 -0.48 -0.32 -0.40 0.26 -0.38 0.41ConclusionsIn Western Europe areas removed from cultivation have been utilised for the productionof renewable energy sources, which also has the effect of preventing rural migration.408

Budapest, Hungary, 2011AGRISAFEHungary is poor in fossil fuels, but has good agricultural potential. Nevertheless, thenumber of families living chiefly from agriculture has gradually declined since EUaccession. Nearly half a million people have had to give up growing food crops. Theproduction, harvesting and processing of energy crops for the purpose of biogasproduction could provide jobs for these people, making it unnecessary for them to leavetheir homes and land. For a number of reasons, biogas production occupies a specialplace among renewable energy sources. This method of biomass utilisation is able tosatisfy consumer demands in a complex manner, being suitable for heating, refrigerationand vehicle fuel purposes, while also resulting in valuable by-products (biofertiliser,carbon dioxide).Official statistics show that the area sown to silage and fodder maize in Hungary hasdeclined from 350.000 hectares in 1983 to 89.000 ha in 2008. Growing maize for biogasproduction could open up new prospects for this sector. especially if leafy silage maizehybrids are grown. which produce a larger quantity of biomass per unit area and havegood fermentability. resulting in higher biogas yields. In the present experiments thebiogas yield of leafy hybrids was significantly higher in both years than that ofconventional hybrids.AcknowledgementsThis project was funded by the European Union with co-financing from the EuropeanRegional Development Fund. Project number: * GOP-1.1.1-07/1-200*8-0080*Applicantname: Bázismag Ltd.ReferencesAndrews, C. J., Dwyer, L. M., Stewart, D. W., Dugas, J. A., Bonn, P.(2000): Distribution of carbohydrateduring grainfill in leafy and normal maize hybrids. Can. J. Plant Sci., 80, 87-95.Bai, A. (2007): Biogas. Száz magyar falu könyvesháza Kht. Budapest.Carter, P. R., Coors, J. G., Undersander, D. J., Albrecht, K. A., Shaver, R. D. (1991): Corn hybrids for silage:an update. p. 141-164. In: Wilkinson. D. (ed.): The 46th Annual Corn and Sorghum Research Conference.Chicago. IL. American Seed Trade Association. Washington D. C.Hegyi, Z., Tóthné-Zsubori, Z., Rácz, F., Halmos, G. (2009): Comparative analysis of silage maize hybridsbased on agronomic traits and chemical quality. MAYDICA, 54, 133-137.Herrmann, A., Taube, F. (2006): "Die energetische Nutzung von Mais in Biogasanlagen - Hinkt die Forschungder Praxis hinterher?". Berichte über Landwirtschaft, 84(2), 165-197.Pintér, J., Pók,I., Rácz, F., Hegyi, Zs., Hadi, G., Marton, L. C. (2010): A leveles (Lfy-) hibrid kukoricák.Agrofórum Extra 37, 48-49.Rácz, F., Hadi, G., Szőke, C., Tóth-Zsubori, Z., Hegyi, Z., Oross, D., Marton, L. C. (2009): Biogas productionusing silage maize hybrids bred in Martonvásár. In: XXI. International Conference Eucarpia "Maize andSorghum Breeding in the Genomics Era". Bergamo. 21-24 June 2009. p. 132.409

AGRISAFE Budapest, Hungary, 2011SUSTAINABLE FARMING ON A SANDY SOILI. HENZSELUD CAAES RISF Research Institute of NyíregyházaAbstract Changes in the phosphorus and potassium contents of a sandy soil were studied along with records ofpotato yields in response to different methods of nutrient supply. The studies were conducted in the long-termWestsik crop rotation experiment. The soil of the experiment is an acidic light sandy soil, low in organicmatter. The nutrient treatments applied in the various crop rotations were green manure as main or secondcrop, farmyard manure and straw, with or without the addition of mineral fertilizer. On sandy soil, it is possibleto attain good soil phosphorus supplies with the use of 26.1 t ha -1 farmyard manure without using phosphorusfertilizer. Available phosphorus can be increased using low rates of phosphorus fertilizer on a sandy soil low inphosphorus. In this experiment, the soil phosphorus supply was classified as “good” in treatments where 94 kgha -1 phosphorus fertilizer was used together with straw and green manure every three years, and as “very good”if phosphorus fertilizer was combined with farmyard manure. The soil potassium supply is not significantlyincreased by straw or green manure either alone or supplemented with a rate of 84 kg ha -1 of potassiumfertilizer every three years. Both the fertilizer potassium and the potassium in green manure or straw is used upby the crop to produce extra yield. Farmyard manure is efficient in increasing the potassium supply in a light,sandy soil. A medium level of potassium supply can be attained with the use of 26.1 t ha -1 of farmyard manure.Lupin plays an outstanding role in increasing the fertility of acidic, light sandy soils. If lupin is included in thecrop rotation it is possible to attain a potato yield of 20 t ha -1 , even when the soil phosphorus and potassiumsupplies are low, irrespective of whether lupin is grown as grain, fodder or green manure. Leaching of nutrientscan be reduced by the use of straw and farmyard manure, along with the application of low rates of fertilizers,as well as with the use of green manure crops with different sowing times. Thus, this experiment gives anexample of how farming can be performed in an environmentally friendly way. The experiment also providesan example of soil protection. Cover crops provide good protection against erosion. In certain treatments of theexperiment lupin as a second crop is only ploughed under in spring, so plant residues provide protection fromwind erosion.Key words: crop rotation, nutrient management practices, organic manureIntroductionIt is a difficult task to farm profitably on a sandy soil. Sandy soils are low in clay,inorganic colloids and organic matter. Buffer capacity is low, and therefore these soilsare highly exposed to various stresses. Soil deflation is also of concern. Sandy soils areeasily penetrated by water, since both the water holding capacity and the available watercapacity are poor. Natural nutrient supply is low, fertilizer nutrients are readily leached(Várallyai 2002). Because of these unfavourable characteristics, fertility of sandy soils ismuch lower than that of chernozemic soils.Increasing the organic matter content of sandy soils is of crucial importance in order toimprove fertility, as Westsik (1951) put it. He studied different forms of organic manure.On sandy soils he considered leguminous green manure of the same importance asfarmyard manure, or even better. He also obtained good results with the use of strawmanures.Antal (1999) also found green manure beneficial. Green manuring is an efficient tool toprotect the soil from deflation. It will reduce leaching of nutrients from the upper, fertilelayers. Green manure crops with a vigorous root system take up nutrients from the lowersoil layers and make them available to the following crop.In this paper we present different methods of fertilization, which over a long period ofsustainable agriculture. The objective of the present study was to find out the effect ofdifferent ways of nutrient supply (I) on the available phosphorus and potassium contentof a light sandy soil and (II) on potato yields.410

Budapest, Hungary, 2011AGRISAFEMaterials and methodsThe long-term experiment was established by V. Westsik in 1929. The experimentconsists of different crop rotation regimes, as treatments. There are a total of 15 rotationtreatmentsin the experiment, 14 of which are of three-year-cycle (three sections) andone treatment is of four-year-cycle (four sections). Rye and potato are crops that can befound in all of the rotation treatments. In each particular year, all the sections of theexperiment are sown in different rotation treatments. The crop rotation experimentdisplays different ways of nutrient supply. Variants are: farmyard manure, straw manure,green manure as main crop and green manure as secondary crop.The soil of the experimental site is an acidic light sand, low in organic matter.Soil samples were taken from three replications in 2008. Each composite sample wasmade by combinig discrete samples from nine different points at a depth of 25 cm. Datawere evaluated with the software MS Excel and SPSS 13.0. AL- P 2 O 5 and AL-K 2 O weredetermined according to Hungarian standards (MSZ 20135:1999).ResultsValues for AL-soluble P 2 O 5 in the soil samples are shown in Figure 1. Lowest values ofplant-available P 2 O 5 were recorded in rotation treatments I (no nutrient supply), VII(straw manure with no industrial fertilizer), and XV (green manure as second crop withno fertilizer). Available P 2 O 5 is higher in rotation treatments of straw manure and greenmanure with fertilizer complementation. No benefit of either straw or green manure canbe established over each other as regards available P 2 O 5 . The values of AL- P 2 O 5 instraw manured treatments (IV, V, VI) are of the same level as in treatments with greenmanure as second crop (XIII, XIV). AL- P 2 O 5 is slightly higher in treatments with greenmanure as main crop (II) and as second crop with early sowing (XII) as compared towhen the second crop green manure was sown after the harvest of rye (XIII, XIV). Theform of straw manure did not influence the value of AL- P 2 O 5 . Similar values wererecorded in treatments with unfermented (IV) and fermented (V, VI) straw manure. AL-P 2 O 5 is outstanding high in the farmyard-manured treatment with fertilizercomplementation (XI). It is interesting to note that AL- P 2 O 5 records are higher in thefarmyard-manured treatment even with no fertilizer complementation (X) than in thestraw manured and green manured treatments where fertilizer was applied.300250120100LSD5%=23,4 mg kg -1200mg kg -1150100LSD5%=35,7 mg kg -1 080mg kg -1604050200I II III IV V VI VII VIII IX X XI XII XIII XIV XVcrop rotation treatmentI II III IV V VI VII VIII IX X XI XII XIII XIV XVcrop rotation treatmentFigure 1. Available phosphorus content of the soil inWestsik’s crop rotation long-term experimentFigure 2. Available potassium content of the soil inWestsik’s crop rotation long-term experimentSoils are low in AL-K 2 O in most of the rotation treatments with the lowest valuesmeasured in treatment XV (second crop green manure with no fertilizer). Among the411

AGRISAFE Budapest, Hungary, 2011green manure treatments the higher AL-K 2 O was measured in the main crop greenmanure one (II). As for straw manuring, the fermented straw manure treatment (VI) wasslightly higher in AL-K 2 O, but the slight difference may only be considered as atendency. The highest AL-K 2 O values were recorded in the farmyard manure treatments(X, XI) either with or without potassium fertilizer supplementation (Figure 2).Of the crop species studied in the experiment lupin has the most vigorous root system.Rye is a shallow rooted plant and potato is not deep rooted either. Lupin is the mostefficient in taking up nutrients from the deeper soil layers. We wanted to find out if theobjective of cropping lupin had any effect on available soil P and K. No difference wasfound, since similar AL- P 2 O 5 and AL-K 2 O levels were measured when lupin was grownfor fodder (IX), for grain (III) and for green manure as second crop (XIII, XIV). Higherlevels of AL- P 2 O 5 and AL-K 2 O were measured in the treatment where lupin was grownfor green manure as main crop (II).The reason why AL-K 2 O (and to a lesser extent AL- P 2 O 5 ) is lower in the green manureas second crop (XV) treatment with no industrial fertilizer than in treatments I and VII isthat there is no fertilizer input in treatment XV. The source of plant-available phosphorusand potassium in this treatment is the weathering of clay minerals and the mineralizationof root and stem residues and of the lupin green manure sown every three years. Nogreen manure is used in treatment VII, but fermented straw manure is applied everythree years at the rate of 26,1 t ha -1 . It turns out that over the 80 years of the long termexperiment the amount of P and K mobilized by lupin from this sandy soil low in clay, islower than P and K applied with the straw manure (26,1 t ha -1 ). There is no nutrientsupply in treatment I, but there is a fallow period once every three years to restore thesoil. In this treatment any crop is only harvested only in two years out of the three, whilethere is a harvest in each of the three years in treatment XV. More nutrients are exportedfrom the land with the extra harvest in treatment XV which is why plant-available P andK is lower.Potato yields in each treatment are shown in Figure 3. as the average of the past tenyears. Potato yield in treatment with no nutrient supply (I) is below 10,0 t ha -1 . Averageyields range from 10 to 15 t ha -1 in the following treatments: straw manure with nofertilizer (VII), green manure as second crop with no fertilizer (XV), green manure asmain crop (II), lupin for grain (III), unfermented straw manure (IV). Average yieldsrange from 15 to 20 t ha -1 in treatments with straw manure (V and VI) and in treatmentswith green manure as second crop (XII, XIII, XIV). Potato yields exceeding 20 t ha -1were recorded in the treatments of farmyard manure with no fertilizer (X), lupin as eithermain or second crop (VIII) and farmyard manure with fertilizer supplementation (XI).302520t ha -1151050I II III IV V VI VII VIII IX X XI XII XIII XIV XVcrop rotation treatmentFigure 3. Potato yield in Westsik’s crop rotation long-term experiment (2001-2010.)412

Budapest, Hungary, 2011AGRISAFEComparing treatments with no industrial fertilizer (I, VII, XV) it can be seen that intreatment XV potato yield is similar or higher than in the two other treatments despitethat AL- P 2 O 5 and AL-K 2 O is lower (Figs 1. and 2.). This is due to the fact thatsymbiotic bacteria on the roots of lupin are capable of fixing atmospheric nitrogen whichcompensates for the lower supply of P and K. Beneficial effect of lupin is furtherverified by treatment VIII in which lupin is inserted twice during the rotation cycle bothas main crop for grain and as second crop for green manure. Among treatments withlupin, treatment VIII is one of the lowest in AL- P 2 O 5 and AL-K 2 O. However, potatoyield is one of the highest, only out yielded by treatment XI with farmyard manure.ConclusionsSoil fertility can be maintained and increased on the long term with the culturalpractices, methods of nutrition and the production of leguminous crop used in the croprotation experiment.ReferencesAntal J. (1999): A zöldtrágya, a zöldugar és a zöldtarló szerepe a tápanyag-gazdálkodásban. In.: Tápanyaggazdálkodás.Szerk. Füleky Gy. Mezőgazda Kiadó, Budapest. p. 262-268.Várallyai Gy. (2002.): Homoktalajok vízgazdálkodásának korlátai. In: Tartamkísérletek, tájtermesztés,vidékfejlesztés. Szerk. Láng I. – Lazányi J. – Németh T., Debreceni Egyetem Agrártudományi Centrum,Debrecen, p.83-90.Westsik V. (1951.): Homoki vetésforgókkal végzett kísérletek eredményei. Mezőgazdasági Kiadó, Budapest. p.140.413

AGRISAFE Budapest, Hungary, 2011ORGANIC AGRICULTURE IN BULGARIA – CURRENTSTATUS, PROSPECTS AND CONSTRAINTS TO ITS FURTHERDEVELOPMENTA. KAROVADepartment of Agroecology, Faculty of Plant Protection and Agroecology, Agricultural University, Plovdiv,BulgariaAbstract Organic agriculture was introduced in Bulgaria in the end of the 1980s. It started with the efforts of afew scientists and farmers who began to discuss and criticize the negative effects of conventional agricultureon the environment and human health and who established demonstration farms for organic crops andlivestock. Later on, national standards were developed based on the IFOAM Basic Standards and the firstEuropean regulation on organic agriculture. In the 1990s a few NGOs focused their activity on the promotionof organic farming methods in Bulgaria. In 2001 the first national ordinances fully harmonized with EURegulation 2092/91 were published, and the system for control and certification was established. The approvalof national control bodies and the opportunities for financial support through the SAPARD Program and theBulgarian Rural Development Program in the following years resulted in an increased number of organicfarms. Nevertheless, there are some serious constraints to the further development of organic agriculture inBulgaria, including the lack of adequate information and education. More research is needed and more detailednational legislation should be developed based on the EU Regulations and according to the specific soil andclimatic conditions of the country.Key words: organic farming, organic legislation, sustainable developmentIntroductionOrganic agriculture is a production system which applies a scientifically substantiatedand complex approach for activation and management of its separate units in a way thatthey support and complement one another. The entire farming system is regarded as onestructure, as a living organism and the interference in one unit shall be evaluated in termsof the effect it will have on the others (Karov et al, 2007). There are several reasons whythere has been a significant increase in the agricultural areas managed in accordancewith the organic method worldwide and at the same time there is greater interest inorganic food: the numerous scandals related to the safety of food throughout Europe, thedemand for technological and economic alternatives by farmers, the substantialsubsidies, both direct and indirect, which are given to organic farmers. We must notunderestimate the efforts of the first scientists and farmers who started to emphasize thenegative effects of the intensive conventional agriculture on the natural resources,including environmental pollution, the presence of residual quantities of pesticides inagricultural products and food, the reduction of biodiversity.Development of organic farming in BulgariaThe development of organic agriculture in Bulgaria started in 1987, when a group ofscientists at the Agricultural University in the town of Plovdiv established the Centre ofAgroecology as a structure where scientific and educational activities would beperformed for the purpose of introducing, popularizing and developing organicagriculture throughout the country. Since 1993 the centre has been a member of theInternational Federation of Organic Agriculture Movements (IFOAM) and since 1994 ithas been functioning as a Demonstration Centre for organic agriculture, whose premisesare used for training students, teacher, farmers, agronomists and specialists in the sphereof organic production (Karov, 1997). A number of international project have been414

Budapest, Hungary, 2011AGRISAFEimplemented in cooperation with leading Austrian, Dutch and Italian universities andconsulting organizations.In the beginning of the 1990s, the development of organic production in Bulgaria wasinsignificant. The first farmers who initiated this transition were either part of pilotprojects or acted as subcontractors and suppliers of companies from the EU Memberstates,where organic agriculture was already well developed. Despite this, at that timethere were no favourable prerequisites for organic production in Bulgaria, a number ofobstacles existed such as lack of suitable legislation, lack of trained agronomists andconsultants, lack of a certification system as well as an impeded access to the Europeanmarkets. There was also lack of financial support for organic farmers. The overcomingof some of these obstacles is related to the further development of organic agriculture,which has several stages of increase in the production areas and the number of organicfarms:- in 2001, when the first ordinances for organic plant-growing and stockbreedingharmonized with Regulation EC 2092/91 were adopted. These ordinances established aset of rules for building a national system for control and certification. By that time,certain foreign control bodies recognized in the European Union already existed inBulgaria;- in 2006 when although significantly delayed, the application of an agroecologicalmeasure was initiated under the pre-accession programme SAPARD in which 160beneficiaries participated. Up to that time in Bulgaria there were three approved nationalauthorities for control and certification of organic production;- in 2007 when Bulgaria became a full member of the European Union and Bulgarianorganic products can be freely traded on European markets. This was the year when theprogramme for development of rural areas 2007-2013 was initiated. It is intended toprovide subsidies to organic farmers.Current state of organic agriculture in BulgariaIn 2009, 12320.75 hectares of cultivated land were farmed in accordance with themethods of organic agriculture (based on the information of the Ministry of Agricultureand Food). Almost equal shares constitute the grain crops (2758.07 hectares) andorchards and vineyards (2688.42 hectares). The third place was taken by the meadowsand pastured covering a total area of 2316.71 hectares, followed by technical crops withan area of 2102.37 hectares, which includes oil-giving crops, aromatic and medicinalplants, the oil-giving rose. Smaller areas were covered by vineyards, fodder and othercrops. 4955.47 hectares of the total area survived the period of transition and theproduction obtained from them can be classified as being organic, while 7365.28hectares are still in the process of transition to organic agriculture. Based on the officialstatistics and the registers maintained by the competent authority, over the last threeyears there has been an increase in the number of organic farms. In 2007 their numberwas 267 in 2008 it increased to 311 and in 2009 – to 467. Organic husbandry has slightlydeveloped with the exception of bee-keeping. Up to 2010, 272 heads of cattle, 104 pigs,5831 sheep and 2732 goats were being kept in organic stockbreeding farms in Bulgaria.The main ways of selling the organic production is through supermarkets and thespecialized shops selling organic food. The specialized bio-shops are located mainly inthe capital city and also in some of the major cities like Varna and Plovdiv. Most of theorganic products that are sold are delivered by other European countries like Italy,415

AGRISAFE Budapest, Hungary, 2011Germany, France, Hungary, the Czech Republic. At the same time, most of the quantitiesof raw materials produced in Bulgaria are exported abroad.Legislation and financial supportOne of the main factors determining the development of organic agriculture in Bulgariais the country’s accession to the European Union, which led to the direct application ofEuropean legislation and provided Bulgarian farmers with access to the funds. As an EUMember-state, the organic agriculture in Bulgaria is implemented in accordance withRegulation EC 834/3007, Regulation EC 889/2008 and the subsequent amendments andadditions. The two ordinances for organic plant-growing and stockbreeding adopted in2001 and amended in 2006 have not been repealed yet. But what is applied of them isonly the part concerning the conditions for improving the control bodies and theestablishment and maintenance of an official data base for organic seeds andreproductive materials. A new ordinance is to be adopted. It will regulate theadministrative aspects and will probably stipulate certain rules concerning theproduction, which have been generally formulated in European legislation. As regardsthe control system in 2010, in the country there are 11 control bodies that have beenaccredited in accordance with Standard EN ISO 45011:1999 and have received a permitfrom the Minister of Agriculture and Food.The protection of natural resources and environment in rural areas is one of the mostimportant national strategic goals of Bulgaria for the period 2007-2013 and the operativeobjectives related to the development of organic agriculture are the following: increasingthe number of producers of organic products and also increasing the areas cultivatedusing the organic method. In order to support organic agriculture, a National plan for thedevelopment of organic agriculture in Bulgaria for the period 2007-2013 has beenadopted. It stipulates five main objectives, namely – development of the market fororganic products, 8% of the cultivated land to be farmed using the organic method by theyear 2013, establishing effective legislation for the development of organic agriculture,practice-orientated scientific surveys, education, training and consultations in the sphereof organic agriculture, creating an effective system for control and certification. In orderto fulfill all of these objectives, a total amount of 164555000 levs has been provided.The implementation of this plan is provided using the measures of the programme for thedevelopment of rural areas 2007-2013, which has stipulated certain amounts of money tobe paid for organic plant-growing and organic bee-keeping. On the grounds of theagroecological measure, two types of payments have been stipulated (for organicproduction and for crops in a period of transition), as follows: for field crops 155euros/hectare (181 euros/hectare in transition), for meadows and pastures – 82euros/hectare (82 euros/hectare – in transition), for orchards, vineyards and oil-givingrose – 418 euros/hectare (505 euros/hectare in transition), aromatic and medicinal plants– 267 euros/hectare (340 euros/hectare in transition), vegetables – 357 euros/hectare(483 euros/hectare in transition). In organic bee-keeping the amount of the providedsupport is 11.5 euros/bee family regardless of whether it is organic or is in a period oftransition. In addition, organic farmers can receive support under Axis 1 of theProgramme for development of rural areas for the purpose of modernizing the farms andestablishing organizations of the producers, giving advice and consultations in the sphereof agriculture.416

Budapest, Hungary, 2011AGRISAFEConstraints to the development of organic agriculture in BulgariaIn Bulgaria there are excellent soil and weather conditions for the development oforganic agriculture. Over the last few years, a number of problems have been solved –we established a new system for control and certification, which now functionsefficiently. We also implemented a number of projects for popularizing organicagriculture and organized seminars for training farmers, agronomists and consultants.We developed technologies for the production of some economically important cropsand also initiated a measure of the Programme for development of rural areas. Despiteall this, there are still some constraints standing in the way of the process of transition toorganic agriculture. They are mainly of financial and administrative nature (Karova,2010). The farmers are not well informed of the existing technologies for organicproduction and the developed rules for Good practices and plant-protection methods.The capacity of consulting organizations for providing technical assistance and supportto the producers is still insufficient. As a result of the implemented agricultural reform,which ended in 2001, and the following voluntary partition, the agricultural land hasbeen significantly fragmented. The inability to establish the rights of use for most of theareas is the biggest problem that Bulgarian organic farmers are now facing because itdoes not allow them to obtain certification and subsidies as well. Although in accordancewith the National plan for development of agriculture and rural areas 2000-2006, under aspecial EU programme for accession in the sphere of agriculture and rural areasSAPARD certain subsidies for organic production were stipulated, the significant delayof three years discourages most of the producers and they focused their attention to theProgramme for development of rural areas. The lack of specific legislation concerningthe approved fertilizers and soil ameliorators caused some confusion and led toinequality between the producers as a result of the different requirements of the privatecontrol bodies.ConclusionOver the last decade, there have been favourable conditions for the development oforganic production in Bulgaria. The potential of our country as a producer of organicagricultural products and food is substantial. We have all the prerequisites for achievingthe objectives set in the National plan for development of organic agriculture and theexisting obstacles can be eliminated. This has been proved by the increased interest inthe trantisition to organic method of production and the respective increase in thenumber of organic farms.ReferencesKarov S., Paraskevov P., Popov V. (1997): Organic agriculture – basic principles and prospective for itsdevelopment in Bulgaria. Agroecological centre at the Agricultural University. Plovdiv.Karov S. (2008): Guide to organic agriculture. IK VAP, Plovdiv.Karova A. (2010): Control and certification of organic agriculture in Bulgaria. Proceedings of the VIII thNational Conference with international participation Ecology and health, 19.05.2010, Plovdiv, 73 – 77.National Program for the development of organic agriculture in Bulgaria 2007 – 2013. (2009): Sofia.National Program for rural development in Bulgaria 2007 – 2013. (2009), Sofia.417

AGRISAFE Budapest, Hungary, 2011TESTING OF WHEAT PRODUCTIVITY USING DIGITALIMAGERYT. KAZANTSEV – I. PANASInstitute of Plant Physiology and Genetics, NASU, Vasylkivska 31/17, 03022, Kiev, Ukraine. antarsih@ukr.netAbstract Digital photo-images of plants can be an alternative instrument for assessing the chlorophyllphotosynthetic potential (CPP) in wheat crops, which determines plant productivity. The current work analyzedthe relationship between the chlorophyll concentration in wheat leaves and the parameters of images of plantsmade at 2 different levels: 1. Images of separate plant leaves obtained with a scanner; 2. Photos of separateplants taken with a digital camera.All the images were originally obtained in the RGB (Red-Green-Blue) color model, after which they wereconverted to the HSV (Hue-Saturation-Value) model. Multiply regression analysis was applied to findrelationships between the components of both color models and the chlorophyll content. It was shown that bothcolor models can be used as an information source for the estimation of chlorophyll content. For both modelsregression formulas were composed allowing the estimation of chlorophyll content in the range 0.5-8 mg/dm 2with an accuracy of about 0.5 mg/dm 2 . The formulas were stable to variations in photographing conditions.The proposed approach is destructive and time-consuming due to the necessity of sampling and photographingseparate plants. However, it is faster than biochemical analysis and allows the limitations present in remotesensing methods to be avoided.Key words: digital imagery of plants, chlorophyll content, plant productivityIntroductionAssessing productive potential is one of the most important tasks being suspended tomonitoring of wheat crops. Plant productivity is related to foliar chlorophyllconcentration: dynamic of total chlorophyll content in plant (CPP: chlorophyllphotosynthetic potential) at several growth stages can be a measure of the productivityand used for yield prediction (Dudenko et al., 2002). Biochemical methods of CPPestimation is expensive and time consuming. Remote sensing methods have limitationsin testing crops with many chlorophyll-containing leaf layers. Beside this, bothbiochemical and remote sensing methods require specific equipment and can not beapplied everywhere.As an alternative method one can use digital photo images. They can be considered as“rough” variant of spectral data: while in modern spectral sensor reflectance is measuredin 50-1000 channels (spectral bands), in most digital photo devices three broad bands areused corresponding to red, green and blue spectral ranges. Digital cameras and scannersare cheap, widely available and easy in use.Successful using of digital imagery for plant testing is described in literature (Pagola,2010; Majer, 2010). Nevertheless differences in used plant objects, image devices andproposed image parameters complicate selecting the most proper algorithm of imageprocessing. Also the optimal algorithms may vary among different plant species andmodes of image capturing. In current paper we conducted a concrete task: to find bestalgorithm of estimation chlorophyll concentration in wheat leaves by digital imagesobtained by scanner and amateur digital camera. Data on pigment concentration togetherwith leaves area (easily estimated by images) would give possibility to test CPP and as aresult plant productivity.Informative potential of two color models used for digital imaging were studied:1. RGB color model (Red, Green, Blue). Color of each pixel is described bycontributions of three simple colours – Red, Green and Blue. Information is represented418

Budapest, Hungary, 2011AGRISAFEin three channels containing luminosity values for these three colours. RGB is the mostwidely used model.2. HSV color model (Hue, Saturation, Value (Luminosity)). It is also 3-channel modelbut here color information is divided on Hue, Saturation and Luminosity.Materials and methodsFor experiments we used plants of two weed crops grown in field under three differentlevels of mineral nutrition. Plants were sampled at 5 different growth stages. In such waysignificant variations in chlorophyll content and leaf structure were achieved. Plantswere photographed in laboratory with natural illumination with amateur digital cameraOlympus C310. After this leaves were cut from stems and scanned by MustekScanExpress 1200. In both cases images were obtained in RGB color model in JPGformat. Then chlorophyll content in the leaves was determined by extracting in DMSOand spectrophotometrical assessing by Wellburn (1994).The images were processed in Adobe Photoshop CS4. Mean RGB values of imagesfragments corresponding to leaves were recorded. Based on these data HSV values werecalculated by formula used by Majer et al, (2010).All measurements (2 cultivars, 5 dates of measurements) were combined in the totalsample. For scanner images it exceeded 86, for camera images – 59. Data processing andmultiple regression analysis were performed using the software package Microcal Origin7.0 Pro.Results and discussionFor both types of images and both color models dependence between chlorophyll contentand values in separate color channels was observed. (Figure 1). Both models appeared tobe highly sensitive to chlorophyll content. The highest correlation was detected betweenchlorophyll content and Hue value. However the correlation parameters varied betweenscanner and camera images. Beside this, other channels also revealed rather highcorrelation with the pigment content. It followed that using Hue value alone is notenough for accurate chlorophyll estimation; other channels must also be used.Multiply regression analysis was applied to create formulas for chlorophyll estimationbased on values of several channels. Three types of dependences were tested:1. Chlorophyll content is a function of R, G and B values with different contributions.Chl = f (a×R+b×G+c×B+d).2. Chlorophyll content is a function of ratios B/R and B/G with different contributions.The ratios were used to normalize color parameters of objects with different luminosity.Chl = f (a×B/R+b×B/G+d).3. Chlorophyll content is a function of H, S and V values with different contributions.Chl = f (a×H+b×S+c×V+d).Regression parameters (a,b,c,d) were calculated by multiply regression analysis.Accuracy of the formulas was assessed by correlation (R) and standard deviation (SD)between real and calculated values of chlorophyll content.419

AGRISAFE Budapest, Hungary, 2011Figure 1. Dependences between chlorophyll content in wheat leaves and color parameters of their digitalimages made by scanner and camera.All formulas revealed rather high accuracy of chlorophyll estimation (Figure 2).Maximal accuracy was provided by HSV formula for scanner images and RGB formulafor camera images. Normalizing RGB values appeared to be useful for scanner images.The formulas were created separately for scanner and camera image processing. Hencethe regression parameters were close for two types of images.420

Budapest, Hungary, 2011AGRISAFEFigure 2. Correlation between chemically estimated chlorophyll content (real chlorophyll) and chlorophyllcontent calculated by formulas using different color parameters of digital imagesConclusionsWe have developed algorithms of digital photo image processing for estimation ofchlorophyll photosynthetic potential in wheat plants that may be useful for testing plantproductivity. The proposed method is stable to plant aging and cultivar variations. BothRGB and HSV color model can be used for accurate chlorophyll estimation but usingvalues of one channel is not effective, at least for wheat leaves; all three channels of themodels must be used.Scanning leaves is more accurate method than photographing because of constantillumination. Nevertheless it doesn’t lead to significant arising of accuracy in chlorophyllestimation. The only important advantage of the scanning over the photographing isgreater convenience in leaves area calculating.The proposed approach is destructive and time-consuming due to necessity of samplingand photographing of separate plants. Hence it is faster than biochemical analysis andallows avoiding limitations present in remote sensing methods.ReferencesDudenko N. V., Andrianova E. Yu., Maksyutova N. N. (2002): Chlorophyll photosynthetic potential in wheatstands in dry and humid years. Rus. J. Plant Physiol., 49, 610-613.Majer P., Sass L., Horváth G. V., Hideg E. (2010): Leaf hue measurements offer a fast, high-throughput initialscreening of photosynthesis in leaves. J. Plant Physiol., 167, 74-76.Pagola M., Ortiz R., Irigoyen I., Bustince H., Barrenechea E., Aparicio-Tejo P., Lamsfus C., Lasa B. (2009):New method to assess barley nitrogen nutrition status based on image colour analysis: Comparison withSPAD-502. Computers and Electronics in Agriculture, 65, 213-218.Wellburn A. R. (1994): The spectral determination of chlorophylls a and b as well, as the total carotenoidsusing various solvents with spectrophotometers of different resolution. J. Plant Physiol. 144, 307-313.421

AGRISAFE Budapest, Hungary, 2011AGRONOMIC PERFORMANCE OF DURUM WHEATVARIETIES GROWN IN THE THRACE REGION, AS AFUNCTION OF THE NITROGEN FERTILIZATION LEVELH. KIRCHEVCrop Science Department, Faculty of Agronomy, Agricultural University, 4000 Plovdiv, Bulgaria,E-mail: hristofor_kirchev@abv.bgAbstract A three-year field experiment was carried out in the experimental field of the Department of CropScience, Agricultural University, Plovdiv to determine the agronomic performance of durum wheat varieties.The experiment was conducted in a block design with 4 replications with sunflower as forecrop. The studyused the varieties Catervo, Colosseo, Concadoro and Simeto, created in the breeding company PRO.SE.ME.,Italy, which were grown with two levels of nitrogen fertilization, 60 and 180 kg.ha -1 . The dependence of thegrain yield, yield components and grain quality parameters on the variety and nitrogen fertilization level wasdetermined.Key words: durum wheat, nitrogen fertilizationIntroductionThe durum wheat (Triticum durum Desf.) is the second most important and widespreadtype of wheat in the world after the common wheat. This is as a result of its specialapplication in the production of pasta, which is due to its specific qualities because of thepresence of gluten. The main shortcoming of durum wheat compared to the common oneis its lower productive capacity. For that reason, one of the tasks set before modernselection of durum wheat is to create sorts with higher productivity. One of the mostpowerful agrotechnical factors increasing the yield of crops is the nitrogen fertilization.Its correct application when growing wheat is the main way of obtaining higher yieldDelibaltova (2008); (Delibaltova et al., 2010); (Ivanova et al., 2007); (Ivanova et al.,2010); Kolev (2005); (Kolev et al., 2010 a ); (Kolev et al., 2010 b ); Mohammadi and Amri(2009); (Semkova et al., 2007)The purpose of this survey is to establish the sort specifics of durum wheat regarding itsproductivity when applying two rates of nitrogen fertilization.Materials and methodsThe experiments have been carried out in the period 2008-2010 in the experimental fieldof Department of Crop Science in Agricultural University – Plovdiv located in theThracian region, Southern Bulgaria. Four varieties of durum wheat were studied –Catervo, Colosseo, Concadoro and Simeto, (PRO.SE.ME. S. R. L.) and they were grownunder two rates of nitrogen fertilization – 60 (N1) and 180 (N2) kg ha -1 nitrogen, appliedonly once in the early spring. The experiment was conducted using the block method infour replications in total adopted agrotechnics culture after predecessor sunflower. Theinter-phase periods were identified according to Zadoks scale (Zadoks et al., 1974):Sowing-Sprung (00–10); Sprung-Tillering (10-21); Tillering-Stem elongation (21-31);Stem elongation-Spike emergence (31-59); Spike emergence-Maturity (59-95). Thegrain yield, (t ha -1 ) was determined by harvesting plots 10 m 2 . The following traits wereinvestigated: Plant height, cm – PH; Number of productive tillers – NPT; Length of mainspike, cm – LMS; Number of grains per spike – NGS; Weight of grains per spike, g –WGS; Test weight, kg – TW; 1000-grain weight, g – TGW.The analysis of the variances of the individual factors was performed with the softwareSPSS 16.0.422

Budapest, Hungary, 2011AGRISAFEResults and discussionThe inter-phase periods during the autumn and the early spring (sowing-sprung, sprungtilleringand tillering-stem elongation) are characterized by a number of differenceswhich are due to the different dates of sowing as well as the different temperatureconditions during the three years of the study. After resuming the permanent springvegetation, the inter-phase periods of stem elongation-ear formation and ear formationmaturityoccur at almost the same time during the three years.The grain yield from the tested sorts of durum wheat depends on the year of testing andis largely influenced by the tested rates of nitrogen fertilization. With the first testednitrogen rate, the yield of all sorts is expectedly lower during the three years compared tothe higher nitrogen rate of fertilization. During the first and the third year of the study,the lowest yield was obtained from the sort Catervo – 3.32 t ha -1 and 3.52 t ha -1 , andduring the second year – from the sort Colosseo – 3.33 t ha -1 . The highest yield afterapplying the first rate of nitrogen fertilization has been obtained from the sort Simeto –4.20 t ha -1 in the year 2008 and during the other two years the highest yield was obtainedfrom the sort Concadoro – 3.80 t ha -1 in 2009 and 4.26 t ha -1 in 2010. On average, duringthe three years of the study, the sort Concadoro gives the highest average yield of 4.04 tha -1 and the least productive sort is Catervo – 3.43 t ha -1 . The differences in the averagegrain yield between the various sorts for the first rate of nitrogen fertilization have beenstatistically verified. This makes us draw the conclusion that when low levels of nitrogenfertilization are applied, the studied sorts show a distinct difference in the absorption anduse of nitrogen for the formation of the grain yield.Table 1. Grain yield, t ha -1Year 2008 2009 2010 AverageN level N1 N2 N1 N2 N1 N2 N1 N2Catervo 3.32 a 4.53 b 3.47 b 4.65 a 3.52 a 4.79 a 3.43 a 4.66 aColosseo 3.89 b 4.55 b 3.33 a 4.69 a 4.02 c 4.87 a 3.74 b 4.70 aConcadoro 4.06 c 4.64 b 3.80 d 4.59 a 4.26 d 5.10 b 4.04 d 4.71 aSimeto 4.20 c 4.38 a 3.60 c 4.53 a 3.87 b 5.18 b 3.89 c 4.70 aLSD 5% 0.14 0.15 0.12 0.14 0.15 0.17 0.14 0.15*Values with the same letters do not differ significantlyWhen a higher rate of nitrogen fertilization is applied, the difference in the grain yieldbetween the sorts of durum wheat is less obvious and in many cases it has not beenstatistically proven (Table 1). During the first year, the lowest yield was obtained fromthe sort Simeto – 4.38 t ha -1 and the other sorts are very similar in terms of yield and canbe united into one statistical group. During the second year, the quantity of the grainyield is similar for all sorts and in 2010 they were divided into two groups. On averagefor the three years of the study, the calculated grain yield from all four sorts of durumwheat is very similar unlike the results obtained after applying a lower fertilization rate.This necessitates uniting the four sorts into one statistical group, which defines them asbeing similar in terms of productive capacity when applying higher rates of nitrogenfertilization.The differences in the grain yield obtained from the different sorts of durum wheat canbe defined as substantial when applying low rates of nitrogen fertilization. If the nitrogen423

AGRISAFE Budapest, Hungary, 2011rate is tripled, the sorts become equal in terms of productivity and the differences in theyield are not statistically proven.Table 2. Differences between the main productivity componentsIndices PH NPT LMS NGS WGS TW TGWVarietiesCatervo 76.2 b 1.8 b 5.9 a 36.7 a 1.8 a 79.6 d 50.3 aColosseo 83.9 d 1.6 b 6.2 b 43.7 c 2.0 b 79.0 c 56.1 cConcadoro 78.4 c 1.7 b 6.8 d 46.4 d 2.2 c 77.0 a 53.2 bSimeto 75.4 a 1.4 a 6.4 c 39.6 b 2.0 b 78.2 b 53.5 bYears2008 77.8 b 1.4 a 6.4 b 42.3 b 1.8 b 79.4 b 53.2 b2009 75.2 a 1.4 a 6.1 a 40.2 a 1.6 a 78.3 a 53.6 b2010 82.5 c 2.0 b 6.5 b 41.5 a 2.4 c 78.1 a 52.9 aFertilization levelN1 75.8 a 1.3 a 6.1 a 40.2 a 1.7 a 78.3 a 53.0 aN2 81.2 b 2.0 b 6.5 b 43.1 b 2.3 b 78.7 b 53.6 a*Values with the same letters do not differ significantlyThe main structural components directly influencing the ear formation and theproductivity of the different sorts of durum wheat can be viewed separately as factors –sort, conditions during the year and nitrogen fertilization (Table 2). The height of thestem varies depending on the sort from 75.4 cm for Simeto to 83.9 cm for Colosseo. Thedifferences between the four sorts have been statistically verified, which confirms thethesis that the height of the stem is a genetically determined sign. The influence of theconditions during the year has been proven for all three years of the study. It has beenproven that the higher rate of nitrogen fertilization leads to an increase in the height ofthe stem by 5.4 cm. The formation of productive shoots is one of the main factors thathave a direct influence on the productivity of the crop. The quantity of productive shootsvaries for the different sorts between 1.4 and 1.8 shoots per plant. However, thesedifferences have been proven only for Simeto and the other three sorts can be united intoone group based on their productive shoots. During the first and the second years, equalnumbers of shoots were formed and in 2010, when the largest grain yield was obtained,the forming of shoots was the highest. The length of the spike and the number of thegrains on it have been statistically proven to be different for the four types of durumwheat. The longest spike having the largest number of grains is formed by the sort thatgave the highest average grain yield – Concadoro, based on which we can draw theconclusion that these two signs are of primary importance for the productive capacity ofthe certain sort of durum wheat. Despite the genetic predetermination of these signs, byincreasing the rate of nitrogen fertilization, we can positively influence their values. Theweight of the grain on the spike is the highest for the sort Concadoro and can beregarded as one of the main indicators for obtaining higher grain yield. The influence ofthe conditions during the year and the nitrogen fertilization on this sign is obvious andhas been proved differently during the three years of the study. The test weight424

Budapest, Hungary, 2011AGRISAFE(hectoliter mass) and the 1000-grain weight are the indices characterizing the quality ofgrain. The test weight is influenced by the sort and the highest values of this index areobserved for the sort Catervo – 79.6 kg and the lowest test weight is that of the sortwhich gave the largest grain yield – Concadoro. 1000-grain weight is less influenced bythe tested factors. The differences of this sign for the two fertilization rates are small andnot proven statistically.ConclusionsThe different dates of sowing and the temperature conditions during the autumninfluence the phenological development of durum wheat until the shooting phase. Whenthe permanent spring vegetation is resumed, the differences in the phenol-phases overthe years are eliminated. When lower rates of nitrogen fertilization are applied, the testedsorts show a clear difference in the use of nitrogen for the formation of different grainyield. When the nitrogen rate is tripled, the sorts become equal in terms of productivityand the differences in the yield are not statistically proven. The length of the spike andthe number of the grains per spike are the main indices determining the productivecapacity of a given sort of durum wheat.AcknowledgementsThis study was financially supported by the project BG051PO001-3.3.04/17 “Supportingthe development of young scientists and postdoctoral researchers in Agricultural studiesand similar to them”. It was headed by Assoc. Prof. Dr. Maya Dimitrova and financed bythe European Social Fund 2007-2013 under Operative Programme “Human ResourcesDevelopment”.ReferencesDelibaltovа, V. (2008): Investigation of the predecessor and fertilization influence on the productivity of winterwheat variety Aglika. Plant Science, 45, 437-441.Delibaltova, V., I. Zheliazkov, H. Kirchev (2010): Influence of predecessor and nitrogen rate fertilization onthe grain quality of the common winter wheat variety Prelom. Plant Science, 47, 434-440.Ivanova, A., N. Tsenov, H. Kirchev. (2010): Impact of environment and some agronomy practices on theproductivity of the new wheat variety Bolyarka in South Dobrudzha region. BALWOIS 2010 – Ohrid,Republic of Macedonia, Vol. II.Ivanova, A., M. Nankova, N. Tsenov. (2007): Effect of previous crop, mineral fertilizationand environment onthe charactersof new wheat varieties. Bulgarian Journal of Agricultural Science, 13, 55-62.Kolev,Т. (2005): Effect of Fertilization and stand density on the productivity of Saturn 1. Proc. 2 nd Balkanscientific conference, June, Karnobat, 448-450Kolev, T., Z. Todorov, L. Koleva (2010 a ): Influence of nitrogen fertilizers and sowing norms on theproductivity of durum wheat Karus. II International Conference, Irkutsk, 120-124.Kolev, T., Z. Todorov, L. Koleva (2010 b ): Productivity of durum wheat varieties in the ecological conditions ofCentral South Bulgaria. International Conference 65-Years of Great Country War, Irkutsk, Vol. I, 42-47.Mohammadi, R., A. Amri, (2009): Analysis of Genotype x Environment Interactions for Grain Yield in DurumWheat. Crop Science, 49, 1177-1186Semkova, N., Z. Terziev, I. Saldzhiev, H. Kirchev. (2007): Comparative research on productivity of newTriticum durum Desf. Varieties under increasing norms of nitrogen fertilization. University of AgriculturalSciences and Veterinary Medicine of the Banat, Timisoara, Romania. Scientifical Papers, Agriculture,XXXIX, part I. 47-52.Zadoks, J. C., T. T. Chang, C. F. Konzak, (1974): A decimal code for the growth stages of cereals, WeedResearch, 14: 415-421.425

AGRISAFE Budapest, Hungary, 2011DERIVATIVE VEGETATION INDICES FOR MONITORING OFWHEAT CROPS: POSSIBILITIES AND LIMITATIONSK. KUZNETSOVA – T. KAZANTSEVInstitute of Plant Physiology and Genetics, NASU, Vasylkivska 31/17, 03022, Kiev, Ukraine. antarsih@ukr.netAbstract An analysis was made of the information potential of derivative reflectance spectra on wheat crops inrelation to foliar chlorophyll content as a main indicator of plant status. The most accurate derivativevegetation indices for chlorophyll estimation were sought. The possibility of testing chlorophyll content inseveral leaf layers was studied. Of all the possible derivative ratios, the indices D 713-714 /D 866-891 provided themost accurate chlorophyll estimation in wheat crops in the 680-750 nm range (D = derivative value; subscriptindicates possible wavelength range in nm for calculating derivative value). The highest correlations werefound between the indices and the chlorophyll concentration per leaf area and the total pigment content in thetwo upper leaf layers. Lower leaf layers had no significant effect on reflectance derivatives, though D 713-714/D 866-891 revealed a considerable correlation with the total chlorophyll content in the three upper layers. Theresults indicate the possibility for the remote testing of chlorophyll photosynthetic potential (CPP) in wheatcrops.Key words: derivative vegetation indices, chlorophyll photosynthetic potential, remote sensingIntroductionRemote sensing of vegetation canopies by means of their reflectance characteristics ispowerful approach for fast control of agricultural crops. It allows quick contactlesstesting of territories. Main plant parameter that is target of the remote sensing is foliarchlorophyll content. It determines plant growth and productivity and can be used asindicator of stresses. Modern hyperspectral equipment including ground-based sensors(i.g. FieldSpect), airborne (AVIRIS) and satellite (Hyperion) devices give newpossibilities in accurate and effective chlorophyll estimation. One of the perspectiveapproaches is based on using the 1-st derivative of reflectance spectrum instead ofsimple reflectance curve. It allows to avoid effect of light fluctuations duringmeasurements and gives possibility to use relative reflectance values. Indices calculatedin such mode are called derivative vegetation indices (DVI). Currently several DVI(Stagakis et al, 2010) including the one, developed by us (Kochubey, Kazantsev 2007),are proposed for chlorophyll estimation. It is not clear which one provides the maximalaccuracy in different plant species. Another challenge is interpretation of data obtainedfrom the whole crop, containing several leaf layers varying by area and chlorophyllcontent.Current paper represents results of researching the most effective DVI for chlorophyllestimation in wheat crops. We also studied the information, which is depicted by DVI inrelation to chlorophyll distribution in several leaf layers. For this purpose, reflectancespectra of wheat crops were measured and compared with chemically-estimatedchlorophyll content in different leaf layers of the crops. Correlation between chlorophyllcontent and all possible derivative ratios in 680-750 nm range was analysed.Materials and methodsFiled reflectance measurements were conducted on winter wheat crops grown in a fieldunder the natural conditions in Kiev Region, Ukraine. To achieve higher differences inchlorophyll content 6 variants of crops were tested: 2 cultivars × 3 levels of mineralnutrition: normal nutrition, 1 extra dose of sulfur, 2 extra doses of sulfur. In addition,measurements were conducted for 5-6 times (dependently on cultivar) during vegetationperiod.426

Budapest, Hungary, 2011AGRISAFEA Field hyperspectral spectrometer designed by us together with Arsenal ConstructBureau (Yatsenko et al, 2005) was used for measurements. The spectrometer is doublebeamdevise providing reflectance spectrum in 530-800 nm range with spectralresolution 1 nm. One measuring covered crop area is 0.4×0.4 m in size. Just after eachmeasurement 5 plants were sampled from the tested area and chlorophyll content in theplants was estimated chemically by extracting leaves in DMSO (Wernon, 1994)separately for each leaf layer.Spectral curves were processed using Microcal Origin Pro 7.0 software. The spectrawere first smoothed using Fast Fourier Transform (FFT) procedure and thendifferentiated using Savitsky-Gollai method.Results and discussionReflectance derivative spectra were superposed to chemically-estimated chlorophyllcontent in different leaf layers of crops. All data (2 cultivars, 3 modes of nutrition, 5cycles of measurements) were combined in one sample. 680-700 nm region was tested.This region is the most sensitive to chlorophyll content and at the same time it isresistant to contribution of other pigments e.g. carotenoids and anthocyanines. For eachspectrum all possible double-band ratios of derivative values in mentioned region werecalculated. Total number of the ratios (with excepting of the ones including similarwavelengths) was equal 4970.Coefficients of correlation were calculated between each ratio and different chlorophyllbasedcharacteristic of the crops:1 – Chlorophyll concentration in the upper leaf layer, mg/dm 2 , (C 1)2 – Mean chlorophyll concentration in 2 upper leaf layers, mg/dm 2 , (Mean 1, 2);3 – Mean chlorophyll concentration in 2 upper leaf layers, mg/dm 2 , (Mean 1, 2, 3);4 – Total chlorophyll content in the upper leaf layer, mg, (Sum 1);5 – Total chlorophyll content in 2 upper leaf layers, mg, (Sum 1, 2);6 – Total chlorophyll content in 3 upper leaf layers, mg, (Sum 1, 2, 3).The maximal correlation (R 2 =0.81) was observed between derivative ratios and meanchlorophyll concentration as well as total chlorophyll content in two upper leaf layers(Fig. 1). Correlation with chlorophyll content in 3 layers was less but still high(R 2 =0.76). The ratios that provided the highest correlation coefficients can be distributedin 3 groups depending on wavelength used in numerator and denominator:Group 1: 701-704 nm; 697-700 nm.Group 2: 701-704 nm; 686-691 nm.Group 3: 713-714 nm; 686-691 nm.An advantage of Group 3 over the other ones is the largest spectral distance betweenwavelengths used that leads to larger differences in numerator and denominator in theratios and as result to their higher sensitivity to chlorophyll variations and wider range.427

AGRISAFE Budapest, Hungary, 2011Figure 1. Coefficient of determination (R 2 ) between derivative ratios and different chlorophyll parameters ofwheat crops. D 1, D 2 – wavelentghts for derivative values in numerator and denominator of ratioo; R 2 isrepresented by color intencity.428

Budapest, Hungary, 2011AGRISAFEConclusionsCurrent investigations allowed to find the most effective derivative indices for testingchlorophyll content in wheat crops. Among several selected groups of the indices wepropose to use the group that can be in general represented as D 713-714 /D 686-691 , wheresubscript indicates spectral range for taking derivative value. These wavelengths aredifferent from the ones proposed earlier. The proposed indices are stable to conditions ofmeasurements, cultivar specificity and growth stage. They can be used for assessing bothchlorophyll concentration per area unit and total amount of chlorophyll in plant leaves.We have not noticed significant effect of more than two upper leaf layers on thereflectance derivative values. Nevertheless the proposed indices revealed rather highcorrelation with chlorophyll content in three leaf layers that may be explained byexciting relationship between chlorophyll content in different layers and lowercontribution of the third leaf layer due to its smaller area. Three upper layers in wheatcrop contain the main chlorophyll amount of the plant. Thus it seems possible to applyDVI for testing chlorophyll photosynthetic potential of wheat crops and as a result toassess productive potential.ReferencesKochubey S. M., Kazantsev T. A. (2007): Changes in the first derivatives of leaf reflectance spectra of variousplants induced by variations of chlorophyll content. J. Plant Physiol.164, №12, 1648-1655.Maire G., Francois C., Dufrene E. (2004): Towards universal broad leaf chlorophyll indices using PROSPECTsimulated database and hyperspectral reflectance measurements. Remote Sens. Environ., 89, 1-28.Stagakis S., Markos N., Sykioti O., Kyparissis A. (2010): Monitoring canopy biophysical and biochemicalparameters in ecosystem scale using satellite hyperspectral imagery: An application on a Phlomis fruticosaMediterranean ecosystem using multiangular CHRIS/PROBA observations. Remote Sensing ofEnvironment, 114, 977–994.Wellburn A. R. (1994): The spectral determination of chlorophylls a and b as well, as the total carotenoidsusing various solvents with spectrophotometers of different resolution. Journal of Plant Physiology 144,№3, 307-313.Yatsenko V., Kochubey S. M., Donets V. V., Kazantsev T. A. (2005): Hardware software complex forchlorophyll estimation in phytocenoses under field conditions. Proc. SPIE, 5964, 267-270.429

AGRISAFE Budapest, Hungary, 2011RESEARCH ON THE PRODUCTIVITY AND QUALITY OFFORAGE PEA VARIETIES TREATED WITH GROWTHREGULATORSN. MINEV – H.R. YANCHEVA – N. POPOVAgricultural University – Plovdiv, BulgariaAbstract The aim of the study was to estimate the influence of the growth regulators RENI, RENI+boron,Bormax, Mn chelate and molybdenite on the quantity and quality of forage pea yield. The experiment wascarried out from 2007 to 2009 in the Plovdiv area (Bulgaria). Two Bulgarian varieties of winter forage peaswere used: MIR and VESSELA. The variants of the experiment were: Control (untreated); Treatment withRENI at a concentration of 0.5%; RENI+boron at a concentration of 0.5%; Bormax at a concentration of 0.4%;Mn chelate at a concentration of 0.6%; Molybdenite at a concentration of 0.2%. The tested growth regulatorsled to changes in the grain yield. The increases in the Mir variety due to the use of RENI was 23.4%,RENI+boron – 20.9% and Bormax – 15% compared to the control sample. The response of the VESSELAvariety in relation to these regulators was less pronounced, with yield increases of 8.0 and 6.2%, respectively,after treatment with Bormax and RENI+boron. The use of molybdenite and RENI+boron in the Mir varietyincreased the content of crude protein by 6.0 and 3.4%, respectively. The Vessela variety reacted best totreatment with Mn chelate, molybdenite and Bormax, with increases of 13.3, 7.5 and 6.7%, respectively.Differences were observed in the total content of essential amino acids. For the Mir variety, the growthregulators RENI+boron and RENI showed the greatest effect, while in the Vessela variety, RENI and Bormaxwere more efficient.Key words: forage bean crops, crude protein, amino acidsIntroductionOne of the important problems in agricultural production is providing high productivityand plant quality by maintaining soil fertility and protecting the soil from pollution. Thatproblem could be solved by optimizing the fertilization rates, as well as by better use ofthe biological potential of the plants.Agaev (1989) and Huset et al. (1991) accept that the leguminous crops could meet theirnitrogen nutritional needs only from the atmospheric nitrogen, for which favourablefactors are necessary to stimulate the symbiotic nitrogen fixation. Some syntheticsubstances and preparations with regulating functions could also play the role of suchfactors, as well as some microelements – metals that activate the enzymes of the nitrogenmetabolism.The question about the regulation of the biosynthesis and activity of the nitrogen fixationenzymatic systems in leguminous crops by regulators of those systems (microelements,phytohormones and other growth regulators) has not been thoroughly studied. At presentover 30 Bulgarian and foreign methods, including preparation mixtures, for which it isadmitted to have an effect on the enzymatic activity, are being applied in our country(Genchev 1997 and Kerin et al., 2001).The aim of the experiment was to study the possibilities of applying different productswith regulatory properties in forage peas and to establish their effect on the yield and onthe content of crude protein and essential amino acids.Materials and methodsA two-factor field experiment was carried out in the period 2007-2009 on the Trainingand-ExperimentalFields of the Agricultural University – Plovdiv, using the block-plotdesign in 4 repetitions, the size of the experimental plot being 10 m 2 . The followingcharacteristics were studied: factor A – 2 winter forage pea varieties – Mir and Vessela430

Budapest, Hungary, 2011AGRISAFEand factor B presented in six variants: treated with RENI – 0,5%; treated withRENI+boron – 0,5%; treated with Bormax – 0,4%; treated with Mn chelate – 100g/da;treated with molybdenite – 0,2%. Treatment of pea was applied at the stage of buttoning– beginning of flowering and the analyses were carried out after harvesting the pea grain.The products used in the experiment were RENI (Popov N., 1995) and RENI+boron, aswell as the commercial products Bormax, Mn chelate and molybdenite.The pea field was established and grown following the conventional technology.The total pea grain yield was reported by variants, the crude protein content in the peagrain was established by the method of Keldal and the proteinogenic amino acids – byamino analyzer after hydrolysis with 6n HCl (Mashev et al., 1994).Results and discussionPea grain yield is an important characteristic for establishing the effect of the studiedproducts. Data about the grain yield (Table 1) showed the variety response to thedifferent preparations. The highest grain yield of Mir variety was obtained aftertreatment with RENI and RENI+boron. In average for the period, the yields were higherthan the control by 23,4 and 20,9%, respectively, the differences being statisticallysignificant. Vessela variety showed a poorer response to the treatments with growthregulators. The best statistically significant effect was reported after treatments withBormax and RENI+boron, when the yield exceeded the control by 8,0 and 6,2%,respectively, in average for the period.Table 1. Forage pea grain yield of Mir and Vessela varieties (t.ha -1 )Variant2007-2008 2008-2009 In averaget.ha -1 % t.ha -1 % t.ha -1 %Mir varietyControl 4.33 100.0 2.05 100.0 3.19 100.0RENI 5.07*** 117.1 2.66*** 129.7 3.87*** 123.4RENI+boron 4.77*** 110.1 2.70*** 131.7 3.74*** 120.9Bormax 4.74** 109.5 2.47*** 120.5 3.61*** 115.0Mn chelate 4.49** 103.7 2.44*** 119.0 3.47*** 111.4Molybdenite 4.42* 102.2 2.15* 104.5 3.29** 103.4Vessela varietyControl 5.32 100.0 2.74 100.0 4.03 100.0RENI 5.30 NS 99.7 2.86 NS 104.2 4.08 NS 102.0RENI+boron 5.49* 103.2 3.00** 109.2 4.25*** 106.2Bormax 5.44 NS 102.2 3.12*** 113.7 4.28*** 108.0Mn chelate 5.03 NS 94.5 2.38 NS 86.8 3.71*** 90.7Molybdenite 5.38 NS 101.2 2.66 NS 96.9 4.02 NS 99.1GD5% *; GD1% **; GD0.1% ***; NS – No statistical significanceGrain quality was determined by the content of crude protein and amino acids. Proteincontent varied by varieties and by variants (Table 2). In Mir variety an increase of theprotein content was observed after treatment with molybdenite and RENI+boron and Mnchelate. Vessela variety responded more strongly to that characteristic and higher valueswere reported in all the studied variants compared to the control.The content and the ratio of essential to total amino acids are important characteristicsconcerning the biological value of the protein contained in forages. The effect of thegrowth regulators on the content of the different essential amino acids was presented inTable 3. Data showed that an increased content of such important amino acids likemethionine, phenylalanine, valine, isoleucine and lysine was established in Vessela431

AGRISAFE Budapest, Hungary, 2011variety after treatment with RENI and Bormax. The content of amino acids in the peagrain of Mir variety also changed in result of the treatment. Increased values of thecontent of methionine, valine, leucine, phenylalanine and lysine, which are quiteimportant in feeding the agricultural animals, were also established in that variety. Thetotal content of the essential amino acids changed significantly after treatment withRENI+boron and RENI.Table 2. Crude protein content in forage pea grain, Mir and Vessela varieties, %2007-2008 2008-2009 average:Variant%%%%%crude proteincrude proteincrude protein%Mir VarietyControl 23.00 100.0 19.38 100.0 21.19 100.0RENI 21.94 95.4 18.13 93.6 20.04 94.5RENI+B 23.81 103.5 20.00 103.2 21.91 103.4Bormax 22.81 99.2 16.13 83.2 19.47 91.2Mn chelate 22.81 99.2 20.56 106.1 21.69 102.7Molybdenite 23.90 101.0 21.69 111.9 22.35 106.0Vessela VarietyControl 21.75 100.0 17.19 100.0 19.47 100.0RENI 22.00 101.2 18.94 110.2 20.47 105.7RENI+B 21.88 100.6 17.94 104.4 19.91 102.5Bormax 22.63 104.0 18.81 109.4 20.72 106.7Mn chelate 22.81 104.9 20.94 121.8 21.88 113.4Molybdenite 23.88 109.8 18.06 105.1 21.24 107.5Table 3. Content of essential amino acids in forage pea grain (% to absolute dry matter)Variants/amino lysine phenylalanincincinninnineleu-isoleu-methio-valine threo-totalacidsVessela varietyControl 1.665 1.057 1.686 0.975 0.048 1.140 0.723 7.29RENI 1.685 1.351 1.594 1.004 0.136 1.173 0.721 7.66RENI+B 1.641 1.234 1.472 0.986 0.130 1.170 0.715 7.35Bormax 1.648 1.461 1.495 0.988 0.076 1.196 0.706 7.57Mn chelate 1.708 1.087 1.657 0.995 0.042 1.186 0.734 7.41Molybdenum 1.638 1.026 1.628 0.951 0.083 1.175 0.671 7.17Mir varietyControl 1.649 1.403 1.602 0.857 0.050 1.169 0.732 7.46RENI 1.678 1.447 1.793 0.906 0.051 1.259 0.719 7.85RENI+B 1.749 1.467 1.746 1.056 0.095 1.204 0.775 8.09Bormax 1.652 1.388 1.342 0.840 0.160 1.220 0.679 7.28Mn chelate 1.512 1.061 1.563 0.969 0.040 1.142 0.744 7.03Molybdenite 1.665 1.144 1.526 0.979 0.015 1.118 0.705 7.15The results about the effect of the growth regulators on the grain yield and quality,obtained in the present study, corresponded to the results of other research studies(Popov et al., 2010; Tsyiganov et al., 2009; Bora et al., 2003).ConclusionsTreatments with the studied growth regulators had a positive effect on the grain yieldand protein content in both forage pea varieties.The highest grain yields were obtained after treatment with the products RENI andRENI+boron for Mir variety and with Bormax and RENI+boron for Vessela variety.432

Budapest, Hungary, 2011AGRISAFEThe protein content in the grain of Vessela variety increased in all the variants, while inMir variety only treatment with molybdenite, RENI+B and Mn chelate induced positivechanges in that characteristic.The application of growth regulators had also a positive effect on the content of essentialamino acids in the grain of both varieties. The greatest changes in the total content of theamino acids were reported after treatment with RENI and Bormax for Vessela varietyand with RENI and RENI+B for Mir variety.ReferencesAgaev V.А., V.M. Simeonov, Sokolov, О. А. (1989): Agrochemistry, No. 8: 124-137.Bora, R. K., C. M. Sarma (2003): Effect of plant growth regulators on growth, yield and protein content of pea(cv. Azad-P-1). Plant Physiol., 8, 672-676.Genchev S. (1997): Growth regulators in vegetable production – state-of-the-art and problems. AgriculturalScience, 35 (4), 13-36.Huset, D. E., D. A. Schneble, J. L. Kugler & M. A. Peterson. (1991): Crop. Sci. 31.Kerin V., М. Berova (2001): Growth regulators in crop production. S.Videnov & son Publishing House, 59 pp.Popov N. (1995): Means of reducing the content of nitrates in vegetable and other crops, Innovation Patent No.60674.27.05.1997. Patent-Issuing Authority, Sofia, Bulletin No. 12.Popov, N., A. Dzimotudis, S. Krastev (2010): Varietal differences in the enzymatic activity of nitrogenmetabolism in garden peas treated with RENI regulators, Plant Sciences, 5, 446.Tsyganov А. R., О. I. Mishura. (2009): Application of micro-improvement, bioproducts and growth regulatorsin pea production. Plodorodie, Belarus Publishing House, 4, 15-17.433

AGRISAFE Budapest, Hungary, 2011INFLUENCE OF ALGAE-RHIZOBIUM INOCULATION ON THENUTRITIONAL VALUE OF GLYCINE MAX L. MERR.O. V. PATSKO 1 – V. A. TRETYAKOV 1 – N. Y. TARAN 1 –N. A. VOROBEY 2 – S. Y. KOTS 21 Department of Plant Physiology and Ecology, Faculty of Biology,Taras Shevchenko Kyiv NationalUniversity, Volodymyrska str. 64, Kyiv, 01033, Ukraine, e-mail: patsko_lena@ukr.net2 Institute of Plant Physiology and Genetics of National Academy of Science of Ukraine,Vasylkivska str. 31/17, Kyiv, 03022, UkraineAbstract The reactions of soybean Glycine max (L.) Merr. were studied when inoculated with combinations ofthe rhizobium nodule bacterium Bradyrhizobium japonicum and the blue-green alga Nostoc punctiforme. Incertain combinations the inclusion of blue-green algae in inoculation suspensions of rhizobium and their Tn5-mutants can stimulate protein accumulation in seeds. It was shown that the inoculation of soybean seeds withrhizobium-algae combinations also improves overall productivity and the biochemical amino acid compositionof the seeds. The results of inoculation on the growth, development and productivity of soybean plants showpromise and do not exclude the possibility of complex bacterial preparations based on cyanobacteria andrhizobium, including their genetically modified strains.Key words: rhizobium-legume symbiosis, algae-rhizobium combinations, protein, amino acid compositionIntroductionImproving of plant nitrogen nutrition is one of the main factors enhancing theirproductivity. Investigation of using of microbial products in crop production showed thatmost bacteria can significantly stimulate plant growth and at the right tools ofbiotechnology to provide yield increasing and improving its quality. For increasingplants productivity under the influence of nodule bacteria and their association withother microorganisms it is necessary to combine favorable conditions for theirdevelopment and physiological activity.One way of solution this problem is to strengthen nitrogen-fixation activity of noduleson the roots of leguminous plants in the soil rhizosphere by bacterial preparation.Bacterial inoculation of legumes seed does not only raise their productivity, but alsoincreases protein content in seed and top, changes amino acid composition.In many laboratories in the world detailed researches directed to the studying ofphysiological and biochemical peculiarities of formation and functioning of differentsymbiotic systems formed on the basis of autotrophic and heterotrophic organismsstarted.A new step towards enhancement of plant productivity by biological products requiresup-to-date knowledge about the effectiveness of nodule bacteria Bradyrhyzobiumjaponicum and blue-green algae Nostoc punctiforme composition for the formation ofrhizobium-legume symbiosis and its effective functioning.However, that needs to resolve several problems: the compatibility of partner organismsin artificial associations, elaborating of effective way of their introduction in plantrhizosphere, choosing the optimal proportion of nitrogen-fixing microorganisms andqualitative composition of consort.Materials and methodsSoybean, Glycine max (L.) Merr., cultivar Maryana was used in experiments. Forinoculation of seeds slow-growing bacterium Bradyrhizobium japonicum - strain 634б(commercial) and Tn5- mutant 646 strain of B. japonicum - T66, T118, T17-2 - nitrogenfixingmicroorganisms from the collection of the Institute of Plant Physiology and434

Budapest, Hungary, 2011AGRISAFEGenetics NAS of Ukraine (Kyiv) were involved. These bacteria were obtained bytransposon mutagenesis as a result of conjugation with Escherichia coli (pSUP2021:Tn5) (Reznikoff W.S., 2003) and selected for improved symbiotic properties from othergenetically-altered nodule bacteria.Blue-green algae Nostoc punctiforme (Kutz.) Hariot from the collection of the Instituteof Hydrobiology National Academy of Sciences of Ukraine, which was grown untilstationary phase of growth on Fitzgerald nutrient medium in modified Zehnder andGorem (N 11) (Svircev Z., 1997), was used for creation a binary compositions ofnitrogen-fixation culture of microorganisms.Research was conducted in model vegetative experiments. Each 6 plants were grown in15 kg Wagner containers, which were previously sterilized by 20% solution of H 2 O 2 .Washed river sand with Helrigel nutrient mixture was used as a substrate. Before sowingseeds were surface sterilized in 70% ethanol for 15 min. Then, depending on the mode ofexperiment seeds were performed for 60 min inoculation with trained suspensions ofrelated strains B. japonicum, blue-green algae N. punctiforme and binary compositions ofthese strains of diazotrophs in a ratio 1:1.Study of protein content in soybean seeds was performed by Lowry method (LowryO.H., 1951). Plant protein extraction (500 mg) was performed with hot ethanol. Theconcentration of protein in the test samples was determined by using gauge design, builtwith serum albumin.The quantity and qualitative composition of amino acids in soybean seeds wasdetermined by ion exchange liquid chromatography with the use of automatic analyzer(Zubay G.,1998).The statistical analysis of experimental data was carried out by conventional methodswith the assistance of special software package Microsoft Excel `00. Probability ofdifference between variants were assessed by Student's criterion and significance levelP≤0,05.Results and discussionAfter preliminary laboratory studies the most effective strains of microorganisms foralgae-rhizobium compositions were selected. The most effective ratio of inoculationpartners was identified, also its stimulating effect on germinative energy, seedgermination, increasing of the length and number of formed shoots, the dynamics ofaccumulation of vegetative mass and increasing of nitrogen-fixation activity was shown.It is known that nodulating bacteria and other rhizosphere-living bacteria can synthesizesubstances that can stimulate (phytohormones, vitamins) or suppress (rhizobiotoxins,antibacterial agents, antibiotics with herbicidal effect) development of host plant (SimmsE.L., 2002). Including of algae in inoculation suspension with nodule bacteria led to adecrease of nitrogen-fixation activity of developing nodules or at the later stage ofontogenesis causing no significant impact on this index. Application of algae-rhizobialcompositions for seed inoculation did not lead to significant changes of grainproductivity of plants that is believed to be an integral index of interaction efficiency ofsymbiotic partners. However, crops in variants of inoculated seeds with monoculture ofresearched strains of bacteria and their composition with N. punctiforme were moreeffective and even exceeded non-treated control by 11,9-42,1% (Table 1).Table 1. Grain production and protein content in soybean seeds, inoculationN. punctiforme, strains of B. punctiforme and binary compositions based on them435

AGRISAFE Budapest, Hungary, 2011VariantCropg / conteinersThe gain in crop comparedto control (withouti l ti ) %Proteincontenti% tomonoinoltiControl without inoculation 25,2 ± 0,4 - 30,2Nostoc punctiforme 28,2 ± 0,8 11,9 33,8Strain 634б 33,6 ± 1,0 33,6 38,9Strain Т66 35,6 ± 0,4 41,2 39,2Tn5-mutant 17-2 33,5 ± 0,8 33,1 38,5Strain 634б + N. punctiforme 34,1 ± 0,9 35,6 42,1 108,2Strain Т66 + N. punctiforme 33,0 ± 0,8 31,0 43,2 110,2Tn5-mutant 17-2 + N. punctiforme 32,0 ± 0,4 26,9 43,5 113,0NIR 0,05 2,2 - 1,54 -It is known that qualitative measure of effectiveness of rhizobium-legume- symbiosis isthe protein content in seeds or in leaves, that confirms the determination of establishingsymbiotic relationship between plant and nodule bacteria (Plazinsky J., 1997). Totalprotein content in all experimental variants with mono- and binary inoculation rosecompared to control. Although no significant difference in terms of grain productivity ofsoybeans processed with mono- and binary cultures of microorganisms were admitted.The most effective options for seed inoculation were binary compositions T66 + N.punctiforme and 17-2 + N. punctiforme, that resulted in higher protein content insoybean seeds by 10,2 and 13,0% compared with the corresponding variations aftermonorhizobium processing.The main criterion of biological value of proteins is their amino acid composition. It hasbeen shown that bacterial mono- and binary inoculation positively influenced thequantity and quality content of amino acids. Compared with the control treatment ofsoybean seeds nitrogen-fixing microorganisms led to increase in both total amino acidcontent (Fig. 1) and content of each of them separately. Significant difference in the totalamino acid content between mono- and binary inoculation was not recorded. However,lysine content that is known to be the most limited essential amino acid, in variant ofbinary algae-rhizobium inoculation increased in comparison with control and itsmaximum reached 34,5% in the variant T66 + N. punctiforme. The highest content ofamino acids that limit the rate of protein synthesis was also observed in the binaryversions of inoculation: content of arginine increased on 26,7% for the processingcomposition 634b + N. punctiforme; histidine - on 21,4% for the treatment of T66 + N.punctiforme (Fig. 1).However, estimating the total content of essential and replacement amino acid (Fig. 1)showed tendency to increase the number of essential amino acids in seed in variant ofbinary algae-rhizobium inoculation (options3,5,7) compared with control. In the soybeanseeds the amount of replacement amino acid also increased, which confirms theeffectiveness of binary compositions for balancing amino acid composition of this plant.436

Budapest, Hungary, 2011AGRISAFETotal content of amino acid,mg / 100 mg damp substanse191817161514131211109876543210essen…repla…Control 1 2 3 4 5 6 7Variant of experimentFigure 1. Total content of essential and replacement amino acids after using algae-rhizobial diazotrophscompositions. Variants of experiment: control (without inoculation); 1 – N .punctiforme; 2 – 634б B. japonicum; 3– 634б + N. punctiforme; 4 – T 66; 5 – T 66 + N. punctiforme; 6 – T 17-2; 7 – T 17-2 + N.punctiformeConclusionsThese data suggest a positive effect of bacterial mono- and binary inoculation on thenutritional value of soybean seeds. In our opinion results of complex research can beuseful for agriculture and food industry, because many soybean products contain highcontent of protein (Colebatch G., 2002). Moreover, soybean proteins are used indifferent food products with the purpose to enhance its protein content. Application ofeffective algae-rhizobium compositions can significantly improve food and feedtechnologies for increasing protein output.ReferencesColebatch, G. (2002): Symbiotic nitrogen fixation research in the postgenomics era. New Phytol., 153, 37-42.Lowry, O.H. (1951): Protein measurement with Folin fenol reagent. J. Biolog. Chem., 153, 265.Plazinsky, J. (1997): Nitrogen metabolism of the symbiotic systems of cyanobacteria. Cyanobacterial N 2Metabolism and Environmental Biotechnology. Narosa Publ. House, 95-130.Reznikoff, W.S. (2003): Tn5 as a model for understanding DNA transposition. Mol. Microbiol.,47, 1199–1206.Simms, E.L. (2002): Partner choice in nitrogen-fixation mutualisms of legumes and rhizobia. Integ. Comp.Biol., 42, 369-380.Svircev, Z. (1997): Co-cultivation of N 2 -fixing cyanobacteria and some agriculturally important plants in liquidand sand cultures. Applied Soil Ecology, 6, 301-318.Zubay, G. (1998): Biochemistry. The McGraw-Hill Companies Inc., 920.437

AGRISAFE Budapest, Hungary, 2011CHANGES IN SOYBEAN AND WHEAT YIELDSUNDER OPTIMAL IRRIGATIONV. PETROVA 1 – Y. KIRKOVA 2Institute of Soil Science ”N. Poushkarov”, Department of soil physics, Sofia 1080, 7 Shosse Bankia, Bulgaria.vera_zamfirova@abv.bgAbstract Soybean and wheat yields vary even under optimal irrigation. For soybean it ranged from 286 kg/dain 2007 to 340 kg/da in 2006. In the very wet year of 2005 the yield in the optimal irrigated variant was a littlebelow that achieved with no irrigation, because 140 mm rain fell 3 days after the irrigation.The wheat yield ranged from 575 kg/da in 2005 (rainfall in the Oct–Jun period was 376.5 mm) to 711 kg/da in2006.Relationships were found between yield and rain + total irrigation water and between yield and number of dayswith T>30°C (R 2 >0.8).Key words: plant stress, infrared thermometer, canopy temperature, irrigation, soil moistureIntroductionAccording to Shtefania Mala, 1987, the quantity and wheat yield stability in Slovakiasince a lot of years depends from precipitation quantity and their regularity ofdistribution. There 27 % from sowing with winter wheat plots (in the areas, where theprecipitation quantity is lower from biological and agronomical crop requirements) areirrigated. The highest are the yields when the soil water regime is optimised during allvegetation period.25-year experiments on wheat irrigation provide average yearly increase of yield with 36% by 2-3 autumn and spring irrigations (Kosturski, 1987).According Slavov and Georgieva, 2005, must seriously to think to provide for wheatirrigation water, because at natural moistening to the end of the present decade atchernosems has a big probability to decreased soil water reserves under optimal soilmoisture 70 % of FC.According to Nikolov, (1987) the regimes 70 and 55 % of ETM are economic interesttheyincreases the yield with 28,8 and 22 % respectively and are suitable for regions withlimited water resources.Shete, (1994), concluded that as available soil water (A.S.W.) increases yield of wheatincreases when dry land farming and two irrigations farming are adopted. In this study itwas found that the yield of wheat remains constant for any variation in A.S.W. when fullirrigation farming is practiced and that dry land farming is economical when A.S.W. isequal to or greater than 150 mm/m.Oliveira, D., 2002 uses the combine method with estimation canopy (Tc), air (Ta)temperatures and vapor pressure deficit (VPD) to determine ET of soybean, winterwheat and other crops showed good results- no significant difference between thismethod and Penman and FAO- Penman- Monteith method.Maarten et al, 2004, conclude that Canopy temperature difference is relatively highlycorrelated to grain wheat yield under optimum irrigation production conditions (R 2 = 0,74).Numerous are the studying for the soybean water consumption and its relation withirrigation regimes under water deficit conditions, precipitation impact, soil waterreserves, air humidity, critical periods about moisture requirements, which have actualtheoretical aspect, water consumption and practical applicability (Georgiev and Matev,1998; Georgiev, 1999, 2000, 2004; Slavov and Georgiev, 2000; Georgiev and Sabev,438

Budapest, Hungary, 2011AGRISAFE2003; Allen et al, 2003, Muhova et al, 2005; Matev and Givkov, 2005, Tchervencovaand Matev, 2005).Under optimum irrigation air humidity exerts significant effect on soybean yield. Thecorrelation dependence is between yield and the number of days of low relative airhumidity (below 55, and 65%, respectively), (Varlev et al .1990).Materials and methodsSix-year field experiments (2004-2010) with wheat Bulgarian variety Sadovo 1 andsoybean variety Daniela in rotation were conducted on leached meadow- cinnamonicsoil in the Experimental station of the “N.Pouashkarov” Institute of Soil Science inTsalapitza, Plovdiv district(East Middle South Bulgaria).For the wheat was applied sprinkler irrigation and for soybean- furrows irrigation.Different irrigation variants were realized, all in 3 replications.The relationships “Yield- irrigation depth + precipitation; “Yield- number of days withT>30 o C” and “Yield- number of days with T>0 o C” were determined.Results and discussionClimatic characteristics of the experiment (2004-2010) are indicated in the previousreport. The influence of climate on yield under optimum irrigation is shown in Fig.1 Soyand Fig.5 for wheat. For optimal irrigated wheat on the base of the difference dT= Tc-Ta, the average coefficient of variation (Cv) is lower (10, 66%) than non irrigated (33,10%). For optimal irrigated soybean variant the average coefficient of variation is 11, 49%, higher than this shown from Varlev et al, (1990), what probably due to the climaticyears variability.yield kg/da; total watercontent l/m26005004003002001000Tzalapica, 2004-2009, soybean, irrigated variants2004 2005 2006 2007 2008 2009454035302520151050total water content yield number of days T>30 numbrs of days dT>0sum of daysYield kg/da400350300250200150100500Tsalapica 2004-2009, soya irrigated variantsy = 1E-05x 3 - 0,021x 2 + 12,294x - 1915,9R 2 = 0,7462300 350 400 450 500 550 600Total water l/m2Figure 1. Yields and climatic parameters for thedifferent experimental yearsFigure 2. Relationship “yield- sum of rainfall + irrigation water”The relationships relationship “yield- sum of rain fall + irrigation water” (fig.2) iscurvilinear as received from Givkov and Mladenova, (1994).yield kg/dka360340320300280260240220y = -1,7482x + 360,04R 2 = 0,86782005 10 15 20 25 30 35 40 45sum of days T>30degFigure 3. Relationship “yield- number ofdays with T>30 o C”. Tsalapic soyYield kg/da400350300250200150100500Tsalapica 2004-2010, soya irrigated varianty = -5,1135x + 307,35R 2 = 0,55440 2 4 6 8 10 12 14Numbers of days dT>0Figure 4. Relationship “yield- number ofdays with T>0 o C”.439

AGRISAFE Budapest, Hungary, 2011The Relationship “yield- number of days with T>30 o C” after exclusion of extreme yearsis whit R2=0, 87 (fig.3), the same is true for Relationship “yield- number of days withT>0 o C” (fig.4).1000Tsalapica, 2004-2010, wheat irrigated variants30620600yield kg/da; tatal watercontent l/m2900800700600500400300200100252015105sum of daysYield kg/da580560540520500y = -0,0034x 2 + 2,471x + 140,47R 2 = 0,605802004 2005 2006 2007 2008 2009 20100480200 250 300 350 400 450 500 550total water content yield number of days T>30 numbrs of days dT>0Total water l/m2Figure 5. Yields and climatic parametersfor the different experimental yearsFigure 6. Relationship “yield- sum of rain fall +irrigation water” 2004-2010Yield kg/da8007006005004003002001000y = -14,559x + 653,09R 2 = 0,74340 5 10 15 20 25 30Numbers of days dT>0Figure 7. Relationship “yield- number ofdays with T>0 o C”.yield[kg/dka]720700680660640620600580Tzalapica, wheat, irrigatedy = -8,0554x + 694,45R 2 = 0,8110 2 4 6 8 10 12number days T>30 oCFigure 8. Relationship”yield- number of dayswith T> 30 o CThe relationship receive from the experiment with wheat are similar to those in soybeanFig. (6; 7), the data shown in Fig.8 are from various forms of irrigation at dT = -1; 0; +1.ConclusionsAs a result of the significantly variation of the climatic parameters (from very wet andcool 2005 to very warm and with very irregular distributed rainfalls) during four yearsexperimental period is obtained the significantly yield variances under irrigatedconditions. The coefficient of yield variances is significantly higher than the previousstudies, when not so severe climatic conditions, but significantly lower than the sameunder non irrigated conditions.When eliminate the data from so extreme years, the correlation between soybean andwheat yield and climatic factors is better- coefficient of determination (R 2 ) increased andis usually over 0, 8.Irrigation of the crops in suitable time and irrigation depth can increased significantly thegrain yield, especially in extreme years: the yield of the optimal irrigated soybean is 1.9times higher than non irrigated in 2004 and for optimal irrigated wheat is twice timeshigher than non irrigated in 2007.This confirms the conclusion that in our country must change the wheat agrotechnics andprovide resources for its irrigation, in otherwise can have a problem with populationfeeding in dry years.ReferencesChervenkova, Z., Al. Matev (2005): Soybean evapotranspiration, growing in Sadovo region, forming andefficiency coefficient, Scientific papers of Jubilee Scientific Conference, September, Pavlikeni, p. 260-269). (in Bulgarian).440

Budapest, Hungary, 2011AGRISAFEGeorgiev, G. et al (1999): Soybean production Technology, Sofia. (in Bulg.)Georgiev, G., Al.Matev (1998): On the growth and yield of soybean, cultivated under irrigation conditions,Scientific works of the Institute of hydrotechnics and melioration, Sofia, v.XXV, p. 256- 261.(in Bulg.)Georgiev, G., V.Sabev, Studi of irrigation efficiency of soybean, Plant science, 2, 130- 134.Kirkova et al (1991): Papers of IV National Symposium with International Participation “Physics- agricultureproduction, 1, 237- 248.(in Bulg.)Kosturski, N. (1987) Irrigation and results from intensive wheat canopies, Papers from Jubilee ScientificCession, September, Stara Zagora, p.26-33. (in Bulg.)Maarten, Van Ginkel et al (2004): Can Canopy Temperature Depression Measurements Help Breeders Yield inWheat under irrigated production conditions, 4-th International Crop Science Congress, Brisbane,Australia.Mala, St. (1987): Possibilities to sustain high yields of winter wheat by irrigation, Papers from JubileeScientific Cession, September, Stara Zagora, p.21-25.(in Bulg.)Matev, Al., G.Givkov (2005): Water deficit and its influence on on the soybean productivity, growing underPavlikeni conditions, Scientific papers of Jubilee Scientific Conference, September, Pavlikeni, p. 134-140). (in Bulgarien).Muhova, R. et al (2005): Soybean productivity, growing under irrigated and non irrigated conditions in cropcrop-rotation link, Scientific papers of Jubilee Scientific Conference, September, Pavlikeni, p. 126- 133.(in Bulgarian).Nikolov, G. (1987): Optimum effect and prognostics of durum wheat irrigation, Papers from Jubilee ScientificCession, September, Stara Zagora, p.34- 44. (in Bulg.)Oliveira, Dalziza (2002): A new method to estimate crop evapotranspiration from an empirical canopytemperature and energi balance, Dissertation, University of Nebraska- Lincoln.Peev, B. et al (2000): Unsuitable changes in North Bulgaria climate, Plant-growing sciences, 8, 558- 651. (inBulg.)Shete, D.T. (1994): Effect of available soil water and farming practices on yield of wheat, 17 th EuropeanRegional Conference on Irrigation and Drainage, Varna, v.1, P 1.12, p.101- 106.Shete, D.T. (1994): Effect of soil moisture, farming practices and emergence date on yield of wheat, 17 thEurpean Regional Conference on Irrigation and Drainage, Varna, v.1, P 1.13, p.107- 113.Slavov, N, B. Georgieva (2005): Many years fluctuations of soil water resources and climate changes in North-West Bulgaria, Scientific papers of Jubilee Scientific Conference, September, Pavlikeni. (in Bulgarian).Slavov, N. and G.Georgiev (2000): Future climate change and its influence on the Bulgarian agriculture, Plantgrowing sciences, 8, 554- 557.(in Bulg.)Slavov, N. and G.Georgiev (2002): Evaluation of the soil moisture resources for thermophilic agriculture cropsproduction in Bulgaria, Journal of Mountain Agriculture on the Balcans, 5, 380- 387.Stoianov, I (2001): Study on the soybean productivity in crop-rotation pairs with maize and soybean, phD,Russe.(in Bulg.)Vurelv, Iv. , N. Kolev, Y. Kirkova (1990): Changes in maize-and soybean yields under optimum irrigation,Plant Science, XXVII, No1, Sofia.441

AGRISAFE Budapest, Hungary, 2011ESTIMATE AND USE OF LAND IN THE VILLAGE OFSAMUILOVO, SLIVEN REGIONR. POPOVA – E. VALCHEVAAgricultural University, Faculty of Agronomy, Mendeleev Str. 12, Plovdiv, Bulgariaradapopova@abv.bg, katiavalcheva@abv.bgAbstract In modern intensive agriculture, soil fertility is assessed from the indicators that have the greatestinfluence on the development of individual crops: the output of the humus horizon, the humus content in A andB horizon, particle size composition, texture coefficient, soil reaction, groundwater level, etc. This paperinvestigates the suitability of soil for growing crops in the village of Samuilovo in the Sliven region. For thispurpose, four soil profile research areas were chosen. The soils were analyzed in terms of particle sizecomposition, pH, humus content, and total carbonate content of digestible forms of nitrogen, phosphorus andpotassium. The analysis revealed that the soils could be classified in the good and medium good categories(categories 5 and 4) according to the classification of degree of suitability of the soil. With satisfactorytreatment, the fertility of these soils increases significantly and they can be used to grow many agriculturalcrops such as wheat, maize, sunflower and vegetable crops.Key words: soil, estimate of land use, soil propertiesIntroductionThe district of Sliven encompasses areas which belong to the districts with temperatecontinental and transitional continental climate, resulting from the influence of theMediterranean Sea. It is characterizes by short winters and cool summers.The territory of the District of Sliven is part of the sub-Balkan fields of the transitionaland continental climatic area.The most widespread in this region are the Cromic Cambisols, which are formed ondelluvial and delluvial-alluvial deposits, Pliocene and Quaternary sandy clays, clayproducts resulting from the weathering of marl limestone and others.The second most widespread in the sub-region are the Gleyic Chromic Luvisols and theMollic Fluvisols, which are formed on sandy clay and sandy gravelly Quaternarydeposits.The purpose of this research was to study the suitability of the soils for growing some ofthe most common crops in the region of the village of Samuilovo, district of Sliven.Materials and methodsFor that purpose, we took samples of 4 soil profiles from the tested region. The soilsamples have been dried to an airy dry condition and have been prepared for analysis.The laboratory analyses of the collected soil samples were conducted as follows:• particle size composition with a photosedimetograph of FRITISH• рН in Н 2 О – potentiometrically• humus content using the methods of Turin• determining the total carbonate content using the Scheibler methodResults and discussionThe morphological description of the Cromic Cambisols showed that they have wellformedgenetic horizons. The humus horizon has a capacity of 45-50 cm and thetransitional and illuvial horizon is about 7 cm. Regarding their mechanical composition,these soils are medium heavy sandy clayish soils. The quantity of the physical clay is thelargest in the upper section of the illuvial horizon.442

Budapest, Hungary, 2011AGRISAFEDue to their heavy particle size composition (Table 1), the soils of this type have averageto very good water permeability, significant water retention capacity and favourable airregimen. The humus content in the fallow land is between 1-1,5%. The quantity of thetotal nitrogen is 0,083%. Carbonates are found on the bed rock and because of this thesoil reaction in the surface layers is acid and in the C-horizon it is alkaline (Table 2).Horizons,depthcmLoss inHClв %Table 1. Particle size composition> 1 1-0,25Size at particle - мм in %0,25 0,05 0,01 0,005

AGRISAFE Budapest, Hungary, 2011quantity of soil components and the physical clay, they change irregularly due to thelayer structure of these soils (Table 1). They have high water permeability, averagecapacity for water retention and comparatively good aeration.The humus content in A horizon varies from 1.36 to 4.48%. It gradually decreases withthe depth of the profile. Carbonates are found on the surface, which determines a slightlyalkaline reaction (Table 2).Table 2. Chemical propertiesHorizons, Hygroscopic Humus Total nitrgen CaCO 3 ,depth cm moisture, % %%%pH (Н 2 О)Profile 12Chromic CambisolsА 1 plow 0-22 4,15 1,54 0,083 - 5,9В 1 35-45 4,68 0,87 0,027 - 4,6В 2 58-68 4,37 0,74 - - 5,3С к 100-100 4,49 0,60 - 6,65 6,6Рrofile 14Chromic CambisolsА plow 0-32 1,97 1,14 0,059 - 5,4В 1 42-52 3,14 1,00 0,047 - 5,4В 2 70-80 2,21 0,56 0,33 - 5,2С 1 117-127 2,24 - - 0,00 5,1С 2 142-152 2,01 - - 7,31 7,3Рrofile 63Gleyic Chromic LuvisolsА 1 plow 0-22 2,56 1,89 0,097 0,0 5,2АВ 34-44 4,02 1,42 0,080 0,39 5,7В 1 71-81 4,40 0,11 - 0,24 6,2В 2 107-117 4,23 0,79 - 1,14 6,8ВС к 134-144 3,58 - - 5,78 7,3Рrofile 726Mollic FluvisolsА I plow 0-10 4,48 3,68 0,25 7,48 8,10А II 16-26 4,35 2,18 0,14 ,645 8,30A III 40-50 5,12 1,89 0,12 1,78 8,10II layer 60-70 1,82 1,06 0,07 1,78 8,10Due to their generally favourable physical and chemical properties, these soils areamong the most fertile on the territory of the municipality and are suitable for all typesof agricultural crops, especially for vegetables and fruit trees.CropsPhysical,clay %< 0,01mmА horizonPhysical,clay %< 0,01mmB horizonTable 3.Indicators for bonitet of Cromic CambisolsDepth ofhumushorizon,cmDepth ofprofile,cmcoefficientof textureрНH 2 O%humusLevel ofundergroundwater, cmValue 32,9 36,6 52 152 1,11 5,4 1,14 250Wheat 80 - 100 100 100 90 70 100 91,43 70,4Vegetables90 - 100 100 100 90 80 100 94,28 54,68Vineyard - 180 100 100 95 80 80 100 105 81,36Peach tree - 100 - 100 100 100 - 100 100 85Maize 100 - 90 100 100 90 70 100 92,86 38,07Soil balField bonitet num-ber444

Budapest, Hungary, 2011AGRISAFECropsPhysical,clay %< 0,01mmА horizonPhysical,clay %< 0,01mmB horizonDepth ofhumushorizon,cmTable 4.Indicators for bonitet of MoDepthofprofile,cmcoefficientof textureрНH 2 O%humusLevel ofundergroundwater, cmValue 57,6 60,7 50 130 1,05 8,2 2,55 200Soil balField bonitet num-berWheat 100 - 100 100 100 80 95 100 96,43 74,25Vegetables100 - 100 100 100 90 90 100 97,14 56,34Vineyrd - 40 90 100 95 100 90 20 76,43 59,23Peachtree- 40 - 100 100 20 - - 65 55,25Maize 100 - 90 100 100 80 95 100 95 38,95ConclusionsBased on the conducted soil analyses and the bonitet assessment of the lands (Tables 4and 5) in the region of the municipality of Samuilovo, district of Sliven, we can draw thefollowing conclusions:The soils fall into the category of medium good and good lands (5 and 4 bonitetcategories) according to the classification determining the degree of suitability of thesoils.When taking due care, the fertility of these soils will significantly increase and a lot ofagricultural crops such as wheat, corn, sunflower, vegetables, fruit trees and vines can begrown on them.ReferencesGeorgiev Bojidar (2008): Relative valuation (bonitet) of agricultural land, SofiaGjurov G., N. Artinova (2001): Soil Science, Makros, PlovdivPenkov M. (2006): Valuation of agricultural land in Bulgaria, SofiaTrendafilov K., R. Popova (2007): Manual for Soil Science, Agricultural University, Plovdiv445

AGRISAFE Budapest, Hungary, 2011EVOLUTION OF FIELD CROPS PRODUCTIONIN ROMANIAG.V. ROMAN – L.I. EPURE – V. ION – M. TOADERDepartment of Field Crops Production, Faculty of Agriculture, University of Agronomic Sciences andVeterinary Medicine Bucharest, Romania, Blvd. Marasti, No 59, sector 1, cod 011464,mirelatoadervali@yahoo.comAbstract Apart from the common evolution determined by increases in average production and changes inmarket demand for agricultural produce, there have been several political and social events in 20 th centuryRomania which have resulted in sudden major changes in the agricultural production sector. Thus, the periodof economic upsurge between the two World Wars marked the beginning of a decrease in cereal cultivationareas and an increase in rape, soybean, tobacco, and potato crops. After World War II, communism led to acentralized economy and the concentration of agricultural lands in large state-owned agricultural concerns orin co-operatives, in parallel with the limitation of foreign commercial relations and the almost exclusiveconsumption of domestic agro-food products. Thus, the cultivation of cereal crops decreased, in parallel withan increase particularly in the cultivation of technical crops: sunflower, soybean, rape, oil flax, fiber flax,hemp, sugar beet, rice, potato, tobacco, peas and beans. The overthrow of the communist system in 1989-1990, followed by the beginning of a transition to a market economy, the return of agricultural lands to theirformer owners, and the reintegration of Romania into worldmarkets marked a decline, and in some casesalmost the disappearance, of several agricultural crops (oil flax, castor-oil plant, fiber flax, rice, sugar beet,tobacco, soybean, peas, beans). Consequently, the crop assortment has become extremely poor, leading todifficulties in establishing correct crop rotations, yield utilization, and profitable agricultural activities; at thesame time, the capacity of processing factories lies idle, while the competition from foreign products ispowerful. It is considered that, in the near future, in view of Romania’s integration into European Unionstructures, the national agricultural policy should use economic tools to encourage the cultivation ofagricultural crops which suit the specific natural conditions, the Romanian agricultural system, living andfood standards, for which there is a suitable processing industry, and which have marketing prospects on theEuropean market.Key words: field crops, evolution in 20 th century, trade in agricultural productsIntroductionThe major political events which have taken place in Europe, and particularly in theEastern part of the continent, in the 20 th century have influenced the economic and socialevolution of Romania, including Romanian agriculture. The changes in the assortment ofagricultural crops best illustrate the evolution, and they are reflected in the agriculturalsystems and their efficiency, in providing the necessary of agricultural produces forconsumption at the rural, urban and national levels, in the import and export ofagricultural produces.Materials and methodsThe present study is based on data from the official national and international statisticalreports existing in the libraries of the Romanian agricultural universities and researchinstitutes, of the Romanian Academy of Agriculture and Forestry Sciences, etc. Thedata have been processed, systematized, and completed with information collectedfrom specialized literature (books and manuals of Field Crop Production, AgriculturalEconomics, the Great Agricultural Encyclopedia of Romania, agricultural journals,etc.).Results and discussionApart from the common evolution determined by the increase in the averageproductions and the change in the market demand of agricultural produces (changes in446

Budapest, Hungary, 2011AGRISAFEfood and its diversification), in 20 th -century Romania there have been several politicaland social events which have resulted in important sudden changes in the assortment offield crops (figures 1-5).Figure 1. Evolution of cereal crops area in RomaniaFigure 2. Evolution of pulses area in RomaniaThus, the period of economic upsurge between the two World Wars marked thebeginning of the decrease in the cereal-cultivated areas (from 90.5% of the total arableland at the beginning of the century to 84% in 1939) and an increase in rape, soybean,tobacco, and potato crops.447

AGRISAFE Budapest, Hungary, 2011Figure 3. Evolution of oil crops area in RomaniaAfter World War II, Communism led to centralised economy and the concentration ofthe agricultural lands in large state-owned agricultural exploitations and in exploitationsof co-operative type (the process ended in 1962), in parallel with the limitation of theexternal commercial relations and the consumption of agro-food produces almost onlyfrom national production. Thus, cereal crops cultivation decreased to 69% of the totalarable land, in parallel with a particular increase in the cultivation of technical crops:sunflower (up to 600 thou ha), soybean (420 thou ha), rape (70 thou ha), oil flax (80 thouha), fiber flax (80 thou ha), hemp (47 thou ha), sugar beet (275 thou ha), rice (37 thouha), potato (292 thou ha), tobacco (39 thou ha), peas (95 thou ha), beans (169 thou ha).Figure 4. Evolution of some industrial crops area in Romania448

Budapest, Hungary, 2011AGRISAFEFigure 5. Evolution of fibre crops area in RomaniaThe overthrow of the Communist system in 1989-1990, followed by the beginning oftransition to market economy, the retrocession of the agricultural lands to their formerowners, and the reintegration of Romania in the world’s free commerce marked thedecrease, in some cases almost disappearance, of several agricultural crops (oil flax – 3thou ha; castor-oil plant - 1.5 thou ha; fiber flax - 0.3 thou ha; rice - 1.8 thou ha; sugarbeet -20 thou ha; tobacco - 4 thou ha; soybean - 66 thou ha; peas - 14 thou ha; beans - 20thou ha). Consequently, the crop assortment has become extremely poor, leading todifficulties in correct crop rotations, yield utilization, and profitable agriculturalactivities; at the same time, the processing factories are not used, while the competitionfrom foreign produces is powerful. As a result, the exports of agro-food products havebeen drastically reduced, even of the products for which Romania was an importantexporter, with traditional partners and markets (cereals, sugar, vegetal fibers, soybean,vegetables and fruits, vine) and for certain products Romania became dependent ofimports.ConclusionsIt is considered that, in the near future, in view of Romania’s integration in theEuropean Union structures, the national agricultural policy, by economic tools shouldencourage agricultural crops which correspond to the specific natural conditions,Romanian agricultural system, life and food standards, in order to be profitable, forwhich there is a suitable processing industry, and which have sale perspectives on theEuropean market.ReferenceBalteanu, Gh., Barnaure, V. (1989): Fitotehnie. Ceres Publishing House. Bucharest.Filipescu, C., Filipescu, R.C. (1940): Great Romanian Agriculture Encyclopedia. Bucharest.Maior, G. (1899): Fitotechnia. Maior Publishing House. Bucharest.Roman, Gh.V., Axinte, M., Cernea, S., Morar, G., Robu, T., Stefan, M., Tabara, V. (2011): Fitotehnie. Cerealsand grain legumes. Universitara Publishing House. Bucharest.Saulescu, N. (1947): Fitotehnica. Cartea Romaneasca Publishing House. Bucharest.Zamfirescu, N. at all (1947): Fitotehnie. Agro-Silvica Publishing House. Bucharest.*** Romanian Statistical Yearbook (1990-2009).449

AGRISAFE Budapest, Hungary, 2011INFLUENCE OF ENVIRONMENTAL FACTORS ON SOILGENESIS IN AN AREA CORRESPONDING TO THE EASTBUCHAREST PLAIN, ROMANIAC. STEFAN 1 – G. BELENIUC 21 Field Crop Section, Academy of Agricultural and Forestry Sciences, Bucharest, Romania2 Faculty of Natural and Agricultural Sciences, Ovidius University, Constanta, RomaniaAbstract The aim of this paper was to study the influence of environmental factors on the formation andevolution of soil cover corresponding to a plain area in Romania, located on the eastern side of the capital. Inorder to achieve this objective, field research was carried out in the area, consisting of a detailed analysis of allnatural elements that have contributed to soil type and subtype individualization in this area. Thus,observations were made and conclusions were formulated on the following components of the landscape:geology, in terms of soil formation deposits, relief, vegetation, surface water and groundwater, climate andanthropogenic factors. A series of maps were drawn (relief map) and soil profiles were morphologicallydescribed during the field research. The results indicated that all environmental factors contributed to soilformation; however, among these, the relief (micro-depression type), rainwater and deposits of soil formationhad the most obvious influence. Thus, the landscape has a special character: although it is a plain, apparentlyuniform, it is characterized by the presence of numerous saucers and depression areas, which make the rainwater accumulate and stagnate for considerable periods of the year, thus dictating the direction of soilformation processes. On these land forms, luvisols (typical, albic and reddish subtypes), as well as stagniccambisols and planosols are the characteristic soil types. The influence of geological deposits and climate onsoil formation is also obvious in the region: warm periods at the end of the Pliocene, associated with loamyclayeyparental material, led to the appearance of chromic luvisols, the most extended soil type in the area andlocated outside the depression sectors. Chromic luvisols represent about 70% of the total surface in the studiedperimeter. Other soils encountered are eroded ones, located on 12% inclination slopes and corresponding to thestream valley, and also gleysols, in the meadow area, where the groundwater has had a decisive role.Key words: soil formation factors, influence, plain area, soil coverIntroductionPedogenesis factors represent the expression of soils formation and evolution, the mainkey to understanding the appearance mechanism of different soil types and subtypes in acertain area. The analyzed perimeter is part of a more extended region, of approximately2100 hectares surface, which includes land with different categories of use and utilities,such as: arable land, pastures, forests, utilities, roads and railroads, drainage channels,non-agricultural areas with hydrophilic vegetation. 2/3 of the total surface is representedby Voluntari urban area and forests (Creţuleasca, Pantelimon, Andronache andPusnicul). Soil cover is represented by chromic luvisols (forest reddish-brown soils) –the dominant soil type of the region, luvisols (typical, albic and reddish), planosols,stagnic cambisols, calcaric gleysols and eroded soils; on small surfaces luvic chernozemsare also spreaded. Due to its environmental diversity and agronomical complexity, theregion was the subject of studies for specialists of different concerns (Canarache A.,1981 - 1982; Gogoaşă T. et al, 1959; Lăcătuşu R. et al, 2000, Murgoci Gh., 1957).Materials and methodsIn order to enunciate considerations on the aspects of pedogenesis, a field stage wascarried out in the area, consisting of monitoring the influence of each environmentalfactor on soil cover formation. A special attention was given to relief and lithology,which left a stronger mark on soils. Soil profiles were opened and morphologicallydescribed, according to current methodology (N. Florea et al, 2003); the description hastaken into account the profile dominant features (color, texture, structure and specific450

Budapest, Hungary, 2011AGRISAFEtraces) for each profile horizon. Relief and degradation processes map was also drawnduring the expeditionary research. The fieldwork phase involved dealing with specificissues concerning soils, like moisture excess, associated with imperfect texture andprecipitation regime, as well as the behavior of the existing drainage system, dated fromthe 80's, partially un-functional at the present-day.Results and discussionRegarding the relief influence, much of the studied region shows a flat uniform relief(figure 1), with altitudes ranging between 60-100 m. However, a distinctive feature ofrelief is represented by the presence of numerous depression areas and saucers, mostvisible in early spring and autumn when, generally, the field is free of crops. They are0,15 - 1 ha surface and show the tendency to merge (due to rainwater that collects inthem and generates an extension of saucer), forming larger depression sectors thatoccupy about a few acres. Saucers total surface in the region is about 190 hectares; theyare 0,75 - 3,50 m below the topographic level of the area, a difference that translates intothe formation and evolution of soils: so, unlike the flat field soils, in case of saucers soilsthe dominant process is represented by hydro-morphism. Their influence on soilformation is a very complex one; in the saucers area luvisols are found, easilyrecognizable by their upper horizon specific white color (a sign of stagnant rainfalls),while on region flat portions, chromic luvisols were individualized - the most extendedsoil type of the area - easily recognizable by its very specific reddish color, due to theaccumulation of iron oxides.Figure 1. Map of relief and soil degradation processes in the studied areaThe analysis on lithologic factor was based on soils profile observations, both for thenatural opening soils encountered and for those carried out in the field (like the onepresented in figure 2, in nearby of Pasărea railway station). They have shown that thewhole region lies on loess deposits - a particular type of loess, of medium-fine and finetexture. For instance, chromic luvisol profiles in the area generally have 2 - 2,5 m depth,451

AGRISAFE Budapest, Hungary, 2011a value that exceeds common control section, compared with chernozems located in theproximity of the studied area, with no more than 1,5 - 1,7 m depth, which are developedon sandy texture loess. We can conclude that there was an initial deposit of loessparticles (when large amounts of material that covered the primary forms of relief weredeposited); an important step in the evolution of these primary deposits was theinstallation of tree vegetation, which has caused changes in sediment textural state, thatproduced reshuffling of primary materials. Texture became fine and medium, themineralization has led to transmigration-accumulation processes and primary loess wastransformed into fine texture loess.Ea (w)0-20 cmEB (w)20-40 cmsandy clay soil material, with grainy-granularstructure and 10 YR 4,5/3 color (dark yellowishbrown- brown-yellow/ brown) at soil wet conditionand 10 YR 6/ 2,5 (light gray-brown / pale brown) atsoil dry condition, with isolated orange - red patches,brittle, numerous grass roots, gradual transition to thenext horizon;silty clay loam soil material, with granular structurewhich makes transition to small angular blockystructure, 10 YR 3/3 (dark brown) in case ofmoisturized soil condition and 10 YR 6/3 (pale brown/ dark brown) when dry, with visible pointy shapediron and manganese separations, gradual transition tothe next horizon;Bt 1 w40-60 cmBt 2 w60-85 cmclay loam texture, with columnar-prismatic structure,10 YR 3,5/3 color (dark brown - brown/dark brown)at soil moisturized condition, with distinguishreddish- yellow spots and 10 YR 4/3 color (brown/dark brown) when dry, same iron and manganeseseparations as above, very compact and lowpermeable soil material, partially wet, with gradualtransition;same clay loam texture as in case of Bt 1 w horizon, 10YR 3/3,5 (dark brown-dark yellowish-brown) at wetcondition, with orange-rust background color, a resultof stagni-gleyi process, with columnar-prismaticstructure, very compact, low permeable andmoisturized material, with gradual transition.Figure 2. Stagni-albic luvisol profile (LVab-st) corresponding to saucers area of the region452

Budapest, Hungary, 2011AGRISAFERainwater and groundwater are also responsible for soil evolution in the region.Observation on soil cover (to which traces of gleyi and stagni-gleyi processes werefound within profiles) indicated that rainfall water and groundwater have played a majorrole in the pedogenesis of the region, significantly influencing the formation of soils.Thus, as regards the influence of rainwater, the following aspects can be enunciated: dueto microrelief depression and soil low permeability - a consequence of clayey texture(figure 2) - waters have accumulated and stagnated considerable period of time; stagnantwater generated clay migration on the soil profile and the occurrence of soil texturaldifferentiation, causing bad air – water regimme. Most soils corresponding to depressionareas evoluated under the influence of this process (such as typical and albic luvisols).Along with rainwater, groundwater stored in clay deposits influenced pedogenesis, aswell. Where groundwater is at 1, 5 – 3 m depth, soil feels the increased hydric influenceso gleyi process is quite visible on the profile and marked by the presence of orangereddishspots. In the northern part of the plain, groundwater level was intercepted at the1,17 m; here, stagnic cambisols were formed. On Pasarea valley, where ground waterlevel varies between 0,5-1 m, gleysols appear. As for the vegetation aspect, the regionrepresents the limit between steppe and forest; decades ago, forests were highly spreadedand soils were formed and evoluated under the influence of forest vegetation (conservedhumidity at surface let water to percolate the soil layer causing the salts washing).ConclusionsSoil cover corresponding to this region is the result of interaction between relief,geological factor, vegetation, water, climate and anthropogenic factor. However, of allsoil formation factors, the most influential were parental material, relief and hydrologicalfactor (rainwater and grounwater). Those dominant factors generated the appearance of asoil cover characterized by textural differentiation of the profile, due to migration of fineclayey particles, coming from the upper layer and following the accumulation ofrainwater. As soil profile characteristics have shown, textural differentiation is moreincreased in case of luvisols where, along with stagnant water, generated severeagronomical restriction. The gleysols located in the meadow area are out of theagricultural use. Chromic luvisols, however, remain the most pretable to agricultural use,as they present less agricultural limitations; still, in order to increase permeability,preluvosols require deep loosening at 3-4 years.ReferencesCanarache, A. (1981): Însuşirile fizice ale solurilor afectate de exces de umiditate şi diferenţierea lucrărilor deprevenire şi eliminare a acestuia, Rev. Prod. Vegetale - Cereale şi Plante tehnice, nr. 12, Bucureşti.Florea, N., Oancea, C., Conea, Ana (1964): Solurile regiunii oraşului Bucureşti, Comitetul Geologic, StudiiTehnice şi Economice, Seria C, Pedologie, 12, Bucureşti.Florea, N., Munteanu, I. (2003): Sistemul Român de Taxonomie a Solurilor, Editura Estfalia, BucureştiFlorea, N. (1982): Solurile din România afectate de exces de umiditate, Analele ICCPT Fundulea, 3, BucureştiGogoaşă, T., Cucută, Al. (1959): Cercetări pedologice în partea estică a câmpiei Vlăsia (raionul Snagov), D. S.Com. Geol., vol. XLII, Bucureşti.Lăcătuşu, R., Râşnoveanu, I., Kovacsovics, Beatrice, Lungu, Mihaela (2000), Poluarea cu metale grele asolurilor din partea estică a municipiului Bucureşti, Rev. Ştiinţa Solului, XXXIV, 1, 121 – 134.Murgoci, M. Gh. (1957): Discuţii asupra crovurilor din Câmpia Română, vol. Opere alese, EdituraAcademiei,Bucureşti.Şerbănescu, I. (1955): Cercetări asupra vegetaţiei în regiunea Bucureşti, D. S. Com. Geologic, vol. XLI,Bucureşti.453

AGRISAFE Budapest, Hungary, 2011USE OF AN INFRARED THERMOMETER TO INVESTIGATESOIL AND PLANT WATER REGIMESG. STOIMENOV – Y. KIRKOVA – I. POUSHKAROVSofia, Bulgaria Institute of Soil Science “N. Poushkarov”, Sofia, BulgariaAbstract A field experiment on wheat and maize grown for grain was conducted on a meadow-cinnamonicsoil in the ISS “N. Poushkarov” experimental station in Tzalapitza, Plovdiv region. The experimental variantswere: non-irrigated and 5 irrigated treatments with relative irrigation depths of 0.3, 0.6, 0.8, 1.0 and 1.3 in threereplications. The soil water regime was evaluated twice a week using gypsum blocks and tensiometersdesigned at ISS “N. Poushkarov”. The water stores (WS) in different soil layers and evapotranspiration (ET)during different growth stages were computed using the balance method on the basis of soil water content(SWC). An infrared thermometer (IRT) was used to evaluate plant water status by calculating the difference(dT) between canopy temperature (T c ) and the ambient air temperature (T a ). The temperatures were measuredat 2 pm every day. It was concluded from the results that the measurement of T c by IRT can be used to evaluateand control soil and plant water regimes. The method was non-destructive, quick and cheap, and is suitable forautomation.Key words: infrared thermometer, canopy temperatureIntroductionIrrigation is a significant means of raising production in agricultural crops. It is oftenused to increase crop productivity in semiarid and humid areas. As a result, newmanagement strategies have been proposed based on controlled deficit irrigation toensure low water loss with minimum yield reduction. Plant water status from the wholeplants or canopy of the field plants is the best information. The used methods would bequick, simple, cheep and allow automation of the measurements. The irrigation increasesthe plant water needs and that’s why the next irrigation decreases the values of theparameters that evaluate water deficit of the irrigated plants, (Rubin, 1968). Infraredthermometry (IRT) is the satisfied method of this conditions. IRT can be used as waterstress indicator and a sense for the beginning of irrigation (Olufao et al.1994, Ledore atal. 1999). Jensen et al (1990,) suggest crop water stress index on the base of difference(dT c ) between canopy temperature (T c ), measured by IRT and the temperature of theambient air (T a ). (Idso et al 1981, Fontes at al 1994). Berliner (1984) found a linearrelationship between T c – T a and LWP (leaf water potential). Bhospinterale et al (1996)write that the dT c is correct parameter for the crop water status. Ehrler (1973), Ahmed atal. (1990) use thermo couple, (Saha (1984) Y. Kirkova at al., 1999, Stoimenov at al.2001,) use the infrared thermometer. The canopy looks like a leaf, (Tanner 1963, Tannerat al., 1968) and to measure the canopy temperature is possible only with IRT. There area lot of methods to determine the beginning of irrigation: number of days without ofirrigation, meteorological measurements, soil water status and growth stage of the plants.Gravimetrical method, neutron soil moisture meter (Rawitz 1986; Kolev N. At 1989),tensiometers (Carter et al. 1990, Ledore et al. 1994, Kolev, N. V. et al 1985) electroresistance sorption transducers (Rogers at al., 1994, Kirkova,1984; Abraham et al 1999),thermometric soil moisture transducers (Phene et al, 1971; Kolev N. V. et al 1992) wereused to evaluate the soil water status. These methods produce point information thatgives poor indications of the overall status of the field concerned (Jackson 1982). Directmeasurement of leaf temperature has been related to crop water stress based on the factthat under stress-free conditions the water transpired by the plants evaporates and coolsthe leaves. Conversely, in a water-deficit situation, little water is transpired and the leaftemperature increases. (Idso at all., 1967).454

Budapest, Hungary, 2011AGRISAFEDuring the 1960s, infrared technology advanced rapidly, and instruments that could beused for agricultural purposes became commercially available. Now, lightweight, handheld,portable, and battery operated infrared thermometers (IRT) became available.Infrared thermometers can rapidly measure canopy temperatures over large areas.Canopy temperatures were effective in monitoring plant stress during the canopydevelopment. Bockhold, D. 2003.Automated irrigation systems have a lot of advantages: smartness, more effectivelywater using, no human mistakes. A reliable automated, real time irrigation schedulingand control system has obvious advantages that include lower labor costs, lower plantstress levels, and lower water useAutomatic irrigation using threshold canopy temperature was more responsive to plantstress and showed the potential to outyield manual irrigation based on 100%replenishment of crop water use Evett,S et al, (1996).The aim of the conducted our study was to obtain relationships between the plant waterstress indicator temperature difference (dT) = canopy temperature (T c ) – ambienttemperature (T a ) and the parameters that determine the irrigation scheduling.Materials and methodsField experiment with wheat and maize was carried out on meadow- cinnamonic soil inExperimental station near to Plovdiv (South Bulgaria). Every experimental plot was 44,8m 2 and all variants were in 3 replications. Furrows irrigation was realized. Soil watercontent was measured by gypsum blocks Kirkova, (1984), installed at 20, 40, 70 and 100cm depths on the soil profile and digital device Kolev,N. et al, (1983). TensiometersKolev et al, (1985), installed at the same depths, were used to evaluate soil waterpotentialThe canopy and soil surface temperature and ambient temperature weremeasured at 14 o’clock. Infrared thermometer was used to measure crop surfacetemperature (T c ) and soil surface temperature( T s ) every day at 1 o’clock p.m.. Thedifference dT = T c -T a at 1 o’clock p.m. The difference between canopy temperature (T c )and ambient temperature (T a ) and difference - soil surface temperature (T s ) and T a at 14o’clock and soil water content were calculated.. Irrigation was realized when gypsumblocks and tensiometers show that it is necessary and T c – T a = 0.Results and discussionThe coefficient of determination of the relation ship between the difference soil surfacetemperature (T s ) and canopy temperature (T c ) measured by IRT at three o’clock and theambient air temperature (T a ) and soil water reserve (SWR) or soil water content (SWC)of the different soil layers of the profile were shown on the table 1 and 2 respectively.Table 1. Corelation (r ) and determination (R 2 ) coefficients of the dT s and dT c ) and SWR for maize during theperiod “12 -th leaf – tasseling”Relationship hour r R 2 Relationship hour r R 2dTs-WS 0-0,2 13 0,86 0,74 dTs-WS 0,4-0,7 13 0,81 0,66dTc-WS 0-0,2 13 0,90 0,81 dTc-WS 0,4-0,7 13 0,84 0,70dTs-WS 0,2-0,4 13 0,83 0,69 dTs-WS 0,7-1,0 13 0,85 0,72dTc-WS 0,2-0,4 13 0,89 0,80 dTc-WS 0,7-1,0 13 0,77 0,59R 2 were over 0,6 with exception at the 0,7 – 1,0 m depth because the maize is in theearly growth stage. During the next stages they are over 0,6 too (Kirkova, Stoimenov,2002). Three irrigation depths were realized in the variants of maize canopy where the455

AGRISAFE Budapest, Hungary, 2011water necessary were determined by gypsum blocks measured by digital alternativecurrent bridge(fig. 1). The soil moisture at the four irrigations were near to wilting pointbecause GB were measured once in a week and the moment to irrigate is missed.Maiz e, irrigation after meas ure with G B, Tzalapi ca, 2001Maize, irri gation afte r measure w ith tensiom eters , Tza lapica, 200 12010 0158060100100W t%1040mm80608060520W t%402040mm000207.23 8.2 8.12 8.22 9.1 9.11-207.23 8.2 8. 12 8.22 9.1 9.1 10дниirrigation rain 2040 70 rainirrig ation rain 40 70 100Figure 1.Figure.2.In the variant when the moment to irrigate was determent by tensiometers were realized4 irrigation depth (fig 2) and by IRT – five also fig.3dTmaize, irrigat ion after measure withIRT, T zalapica 2001510008.15-58.25 9.450irrigat ion rain dT0mmFigure 3. Figure 4.In 2008the wheat was irrigation in case of dT=1, dT=0 and dT=-1, maximum yield were,when irrigation was in case dT = 1 fig. 4,ConclusionsIRT could be used to evaluate soil and canopy water regimes. It can be indicator whenhave to irrigate. The results were close, but the IRT measurements were easier andquicker. IR thermometry can use in the agriculture experiments and practice to increasewater use efficiency and to obtain stable and economically profitable yield.IRT is able to use for automatic irrigation system. The canopy temperature is useful todetermine crop water stress and the correlations dT c -WS, dT c - ET can use to calculateirrigation depth. This algorithm can use to make an intelligent irrigation system. Thistype of irrigation system is the best for to increase the water use efficiency.AcknowledgementsThis work was supported by the Ministry Of Education And Science Of BulgariaRepublic – Contracts Nr HS – AS204/2006.ReferencesdT water content wheat "Neda" dT=1, Tzalapica 2008Abraham Noble , P.S. Hema, E.K. Saritha, Shinoj Subramannian Kelappaji (1999): Irrigation automationbased on soil electrical conductivity and leaf temperature. College of Agricultural Egnineering andTechnology, Kerala Agricultural University, IndiaAhmed, M., Misra, R.D. (1990): Manual of Irrigation Agronomy. Oxford and IBH Publishing Co. Pvt. Ltd.,New Delhi, pp. 121 – 122, 272-282Berliner,P.et al (1984): Evaluation of the infrared thermometer as a crop stress detector, Agricultural andForest meteorology, 31, 219- 230.WC3530252015105021.4.200828.4.200805.5.200812.5.200819.5.200826.5.200802.6.2008420-2-4-6dTprecipitationirrigation20cm40cmdT 14h456

Budapest, Hungary, 2011AGRISAFEBhospinterale, A.M., Jadhav, A.S., Bote, N.L., Varsheya, M.C. (1996): Canopy temperature as an indicator forscheduling irrigation for wheat. J. Maharashtra Agric. Univ. 21 (1), 106-109Bockhold, D. (2003): Application of canopy temperature for irrigation scheduling in humid environments[M.S. Thesis]. Columbia, MO: University of Missouri. 81 p.Carter, C.E. et al (1990): Effects of Exess Soil Water on Sweet Corn Yield, Transactions of the ASAE, 33,1203 – 1207Erhler W.L. (1973): Cotton leaf temperatures as related to soil water depletion and meteorological factors,Agron. J,. 65, 404-409Evett, S.R. et al (1996): Canopy Temperature Based Automatic Irrigation Control, Proc. International conf.,San Antonio, TX.ASAE, St.Joseph,MI, Pp. 207- 213Falkenberg, N., Piccinni, G., Owens, M.K., Cothren T.: Remote Sensing For Site-Specific Management OfBiotic And Abiotic Stress In CottonFontes,J.,I.Alves and L.S.Pereira (1994): Infrared Thermometry for Irrigation Sheduling of Corn, 17-thRegional conference Europeen of ICID, Varna, 1, 191-201For irrigation scheduling. In Proceedings of the 1995 Beltwide Cotton Conferences, Jan.Fuchs M., Kanemasu E.T., Kerr J.P., Tanner C.B. (1967): Effect of viewing angle on canopy temperaturemeasurements with infrared thermometers. Agron. J., 59, 494-496.Fuchs M., Tanner C.B. (1966): Infrared thermometry of vegetation. Agron. J., 58, 597-601.Idso SB, Baker DG (1967): Relative importance of reradiation, convection and transpiration in heat transferfrom plants. Plant Physiol., 42, 631–640Idso, S., B. R.D. Jackson, P. J. Pinter, R. J. Reginato and J. L. Hatfield (1981): Normalizing the Stress Degree-Day Parameter for Environmental Variability, Agric. Meteoroly, 24, 45-55Jackson RD (1982): Canopy temperature and crop water stress.Jensen, Burmnan and Allen (1990): Evapotranspiration and Irrigation Water Requirements. American Sociectyof Civil Engineers manual and reports on Engineering practice no. 70Kirkova, Y. (1984): Design and investigation of sorption soil moisture transducers, thesis, Sofia,(in Bulgarian)Kirkova, Y. G. Stoimenov (1999): Leaf water Potential and Infrared thermometry under different irrigationregimes, Koriљtenje Tla I Vode u Funkciji Odrћivog Razvoja I Zaљtite Okoliљa, SarajevoKolev et al. (1992) Thermometric sensor for soil moisture and temperature – analize and metrologicalparameters, III-th National Seminar “Metrological, Sozopol”Kolev, N.A., Stoimenov G. (1987): Ein radiometrisches Bodenfeuchte- und - dichtemessgeraet mit digitalerMesswertanzeige. 4. Tagung "Agrophysik",30.3-Kolev, N.V. et al (1985): Physical methods and technical devices for evaluation of soil moisture, InternationalAgrophysics, 1, 107- 114.Ledore F., B. Itier (1994): Resultats de Redement suite a l'application direct de criters de Stress Hidrique desIrrigations, 35-46.Olufayo, A. et al (1994): Relationships between water stress indicators and grain yield of irrigated sorghum,17-th Regional conference Europeen of ICID, Varna, 1, 69- 75Phene C. J., G.J Hoffman and S.L.Rawlins (1971): Measuring Soil Matric Potential in situ by Sensing heatDissipation within a Porous Body: I Theory and Sensor Construction, Soil Science American Proc., 35Rawitz,E. et al. (1986): Irrigation scheduling using microclimatic and plant parameters, Procidings: 4-thInternational Conference on Irrigation, Tel Aviv, 22 - 23 Sept., 133 – 145Rogers H. D., Sothers (1994): Scheduling Irrigations by Electrical Resistance Blocks, Cooperative ExtensionService, Manhattan, KansasRubin B. A. (1968): Plant physiology, 542стр. (in bulgarien)Saha, S.K. (1984): Remote sensing of crop evapo transpiration using plant canopy temperature. Saha et al.(Eds.), Proceedings of the Seminar on Growth Condition and Remote Sensing. IARI, New Delhi, India.Stoimenov (2001): Evaluation and control of plants water regime by electronic devices to avoid water stress,thesis, ISS “N.Poushkarov”(in Bulgarian)Stoimenov G.,Y. Kirkova (2001): Soil-Water-Plant Relationships In A Sunflower Field, 7 th Intern. Meeting“Soils with Mediterranean Type of Climate”, Bari (Italy), 23-28 September, 422 – 424Tanner, C. B. and Fuchs, M. (1968): Evaporation from unsaturated surfaces: a generalized combinationmethod. J. Geophys. Rs., 73, 1299 – 1304Tanner, C.B. (1963): Plant temperatures. Agron. J., 55, 210-211457

AGRISAFE Budapest, Hungary, 2011NEGATIVE INFLUENCE OF ECONOMICALLY IMPORTANTWEEDS ON COTTOND. STOYCHEV – M. DIMITROVA – D. DIMOVAAgricultural University - PlovdivAbstract Common amaranth (Amaranthus retroflexus L.) and rough cocklebur (Xanthium strumarium L.) arewidely spread and highly pernicious weeds. The present research included data from 3-year field experiments(2007-2009) on cotton cultivar Chirpan-539, including variants with different densities of Xanthiumstrumarium L. and Amaranthus retroflexus L. Amaranthus retroflexus L. is a major rival of cotton plants forthe macronutrient nitrogen. As the density of the weed increases, the quantity of nitrogen in the surface parts ofthe cotton plant is reduced from 33% to 47%. Even if the density of amaranth is only 1 plant/m 2 , the quantityof this element in the cotton plant will be reduced.The presence of Xanthium strumarium L. also caused slight reduction in the quantity of nitrogen in the cottonplant, ranging from 14 to 16%.Key words: cotton, N, P 2 O 5 , K 2 O, Xanthium strumarium L., Amaranthus retroflexus L.IntroductionWeeds are some of the basic harmful factors in contemporary agriculture. The negativeinfluence they have on crops and the efficiency of the production is diverse - Dimitrova(1995); Topalov (1986); Bukun (2004); (Vencill et all, 1993). The main types that can befound among cotton plants belong to the group of annual late-spring weeds: Amaranth,Solanum nigrum, Chenopodium album L, Xantium strumarium, Portulaca oleracea,Hibiscus trionum and others - Dimitrova (2002). Over the last few years, there has beenan increase in the density of Xanthium strumarium L. and the common amaranth(Amaranthus retroflexus L.), whose morphological and biological properties determinetheir substantial biological and economic harmfulness. In our country there have been anumber of studies on the influence of some economically important weeds on the yieldand the economic indicators of the cotton fibers – Topalov (1986), Dimitrova (1995);(Stoychev et all, 2008; 2010). Up to now there has been no data about the content of themain nutritional elements in the surface part of the cotton plant which competes with themain weeds. That was the purpose of this study.Materials and methodsDuring the period from 2007 to 2009 in the experimental field of the Cotton and DurumWheat Institute in Chirpan, we conducted two micro-experiments with the main types ofweeds forming the late weeding: Xanthium strumarium L. and common amaranth(Amaranthus retroflexus L.). The experiments were made using the block method in fourreplications and the experimental field covered an area of 1m 2 on leached chernozemvertisol with pH of 5.8 and humus content of 3.12%. The cotton of type Chirpan 539 wasgrown with a density of 16500-17000 plants per are, without any irrigation and afterpreviously grown durum wheat on the same area. Every micro-experiment included fivetypes with different density of the respective weed – 0,1,2,4 and 8 plants/m 2 . The densityof the weeds was maintained throughout the entire vegetation period of the crops bymanually removing the extra germs and sprouts of other weeds.We established the quantity of the main nutritional elements: nitrogen, phosphor andpotassium in the surface parts of the cotton plant and the weeds – N - (Kijeldal method),P – (Colorimetrically) and K – (by phlame Photometrically) – (Tomov et all, 1999). Thedata was processed using the method ANOVA (Dimova et all, 1999).458

Budapest, Hungary, 2011AGRISAFEResults and discussionXanthium strumarium L. and the common amaranth (Amaranthus retroflexus L.) developstrong stems above the ground, with a deep root system and a large number of seeds,which turns them into dangerous rivals of crops. The conducted three-year experimentsconfirm this fact regarding the cotton crops.Table 1 contains the results from the performed dispersion analysis concerning thecontent of the main nutritional elements – nitrogen, phosphor and potassium in thesurface parts of the cotton plant, which competes with the weed Xanthium strumarium Lwith different density.During the blossoming stage, the cotton plant which grows without any weeds in thezero control sample, extracts with its surface mass 2,76% N, 0,52% Р 2 О 5 and 1,37% К 2 О(Table 1).Table 1. Quantity of the main nutritional elements in the surface parts of the cotton plant and Xanthiumstrumarium L. in % (on average for a period of three years)VariantsN % Variants P 2 O 5 % Proven Proven1. Check - free of weeds 2,76 9. Xanthium strumarium L. 8 pl./m 2 0,84 ++6. Cotton with density of X. str. 4 pl./m 2 2,40 ns 3. Xanthium strumarium L. 1 pl./m 2 0,83 ++4. Cotton with density of X. str. 2 pl./m 2 2,38 ns 7. Xanthium strumarium L. 4 pl./m 2 0,72 +8. Cotton with density of X. str. 8 pl./m 2 2,35 ns 5. Xanthium strumarium L. 2 pl./m 2 0,69 +2. Cotton with density of X. str. 1 pl./m 2 2,33 ns 8. Cotton with density of X. str. 8 plants/m2 0,62 ns7. Xanthium strumarium L. 4 plants/m 2 2,13 – 6. Cotton with density of X. str. 4 plants/m2 0,54 ns3. Xanthium strumarium L. 1 plant/m 2 2,01 – – 2. Cotton with density of X. str. 1 plant/m2 0,54 ns5. Xanthium strumarium L. 2 plants/m 2 2,01 – – 4. Cotton with density of X. str. 2 plants/m2 0,53 ns9. Xanthium strumarium L. 8 plants/m 2 1,77 – – – 1. Check - free of weeds 0,52LSD P 5% = 0,48, LSD P 1% = 0,67, LSD P 0,1% = 0,92 LSD P 5% = 0,17, LSD P 1% = 0,24, LSD P 1% = 0,24VariantsK 2 O %Proven9. Xanthium strumarium L. 8 pl./m 2 2,40 ++7. Xanthium strumarium L. 4 pl./m 2 2,09 +3. Xanthium strumarium L. 1 pl./m 2 2,06 +5. Xanthium strumarium L. 2 pl./m 2 1,92 ns8. Cotton with density of X. str. 8 plants/m 2 1,74 ns2. Cotton with density of X. str. 1 plant/m 2 1,59 ns6. Cotton with density of X. str. 4 plants/m 2 1,47 ns4. Cotton with density of X. str. 2 plants/m 2 1,46 ns1. Check - free of weeds 1,37LSD P 5% = 0,66, LSD P 1% = 0,91, LSD P 0,1% = 1,25In the presence of Xanthium strumarium L., even if it is only 1 plant/m 2 , the quantity ofnitrogen in the cotton plant is reduced by 16% but the difference has not beenstatistically proven. As the density of this weed increases to 2, 4 and 8 plants/m 2 , thenitrogen content in the cotton plant is reduced by 14-15% but again there is no provendifference compared to the control sample.The content of phosphor in the surface parts of the cotton plant with different weeddensity varies from 0,53% to 0,62%, which exceeds the values of the control sample by2% to 19% but the difference is not substantial. What should be noted is the fact that as459

AGRISAFE Budapest, Hungary, 2011the density of Xanthium strumarium L.increases to 4 and 8 plants/m 2 , the transfer ofР 2 О 5 from the cotton plant also increases. Similar dependence can be observed regardingthe content of К 2 О, which increases by 0,1% to 0,37% in the cotton plants although thedifferences are statistically insignificant. Unlike the cultivated crop, the content of thisnutritional element in Xanthium strumarium L. increases from 0,69% to 1,03% as thedensity of the weeds increases. Such a relation is to be observed regarding the content ofphosphor. But the quantity of nitrogen in the surface parts of the weed is reduced as thedensity of the weed increases. It ranges from 0,63% to 0,99% for 8 plants/m 2 ofXanthium strumarium L..Table 2. Quantity of the main nutritional elements in the surface parts of the cotton plant and Amaranthus retroflexusL. in % (on average for a period of three years)VariantsN % Variants P 2 O 5 % Proven Proven1. Check - free of weeds 2,61 7. Amaranthus retroflexus L. 4 plants/m 2 0,80 ns9. Amaranthus retroflexus L. 8 pl./m 2 2,27 ns 5. Amaranthus retroflexus L. 2 plants/m 2 0,79 ns5. Amaranthus retroflexus L. 2 pl./m 2 2,07 ns 3. Amaranthus retroflexus L.1 plant/m 2 0,77 ns3. Amaranthus retroflexus L. 1 pl./m 2 1,91 – 9. Amaranthus retroflexus L. 8 plants/m 2 0,77 ns8. Cotton with density of A. retr. 8 pl./m 2 1,76 – 4. Cotton with density of A. retr. 2 pl./m 2 0,74 ns7. Amaranthus retroflexus L. 4 plants/m 2 1,75 – 1. Check - free of weeds 0,664. Cotton with density of A. retr. 2 plants/m 2 1,53 – 6. Cotton with density of A. retr. 4 pl./m 2 0,65 ns6. Cotton with density of A. retr. 4 plants/m 2 1,44 – – 2. Cotton with density of A. retr. 1 pl./m 2 0,55 ns2. Cotton with density of A. retr. 1 plant/m 2 1,38 – – 8. Cotton with density of A. retr. 8 pl./m 2 0,54 nsLSD P 5% = 0,53, LSD P 1% = 0,90, LSD P 0,1% = 1,24 LSD P 5% = 0,17, LSD P 1% = 0,23, LSD P 0,1% = 0,32VariantsK 2 O %Proven7. Amaranthus retroflexus L. 42,74 +plants/m 23. Amaranthus retroflexus L. 1 plant/m 2 2,71 +5. Amaranthus retroflexus L. 2 plants/m 2 2,66 +9. Amaranthus retroflexus L. 8 plants/m 2 2,57 +8. Cotton with density of A. retr. 8 pl./m 2 1,70 ns6. Cotton with density of A. retr.. 4 pl./m 2 1,57 ns4. Cotton with density of A. retr. 2 pl./m 2 1,55 ns2. Cotton with density of A. retr. 1 pl./m 2 1,48 ns1. Check - free of weeds 1,40LSD P 5% = 0,99, LSD P 1% = 1,37, LSD P 0,1% = 1,89The analysis of the data shows that on average for the three-year period of the study, thecotton plant which competes with the Xanthium strumarium L. reduces the content ofnitrogen by 14%-16% but increases the quantity of К 2 О by 7% to 27% and the quantityof Р 2 О 5 by 2% to 19% depending on the density of the weeds. The highest values in theconducted survey were registered for 8 plants/ m 2 of Xanthium strumarium L..The results referring to the content of nutritional elements in the surface parts of thecotton plant which compete with the common amaranth (Amaranthus retroflexus L.) thathas different density are presented in Table 2.In the control sample without any weeds, the following quantities were detected in the cottonplant: 2,61 % N, 0,66% Р 2 О 5 and 1,40% К 2 О.The presence of even 1 plant/m 2 of common amaranth leads to statistically proven reductionin the content of N in the cotton plant. As the density of the weed increases to 8 plants/m 2 , its460

Budapest, Hungary, 2011AGRISAFEquantity in the cultivated crops is reduced by 33% compared to the clean control sample.The analysis shows that the content of N in the surface parts of common amaranthranges from1,91% to 2,47% and when the density of the weed is 8 plants/m 2 , it slightlyincreases.The content of Р 2 О 5 in the cotton plant is insignificantly reduced with the different types ofdensity of the common amaranth and the difference compared to the clean control sample isfrom -0,1% to 0,08%. The weed contains larger quantities of this nutritional element(from 0,77% to 0,8%) but the differences have not been proven statistically. The datashows that the content of Р 2 О 5 is almost the same in the types with different density ofthe common amaranth. Such relations have also been established concerning the quantityof К 2 О in the surface parts of the weed, which has been confirmed to be biggercompared to the control sample – with 84% to 96%. The difference between the varioustypes of density is not substantial – up to 5% for 1 plant/m 2 and 8 plants/m 2 ofAmaranthus retroflexus L. When this weed is present, the cotton plant increases thequantity of К 2 О in its surface parts by 0,08% up to 0,3%.The obtained results from the conducted survey show that on average during the three-yearperiod of the study, the cotton plant which competes with the common amaranth reduces thequantity of nitrogen in its surface parts from 33% to 47% and the quantity of Р 2 О 5 from 2%to 18% unlike the quantity of К 2 О which is slightly increased compared to the clearcontrol sample without any weeds.ConclusionsAmaranthus retroflexus L. is a big rival of cotton plants regarding the main nutritionalelement – nitrogen. As the density of the weed increases, the quantity of nitrogen in thesurface parts of the cotton plant is reduced from 33% to 47%. Even if the density of theamaranth is only 1 plant/m 2 , the quantity of this element in the cotton plant will bereduced. The presence of Xanthium strumarium L. also causes slight reduction in thequantity of nitrogen in the cotton plant which ranges from 14 to 16%.Both weeds do nothave a negative influence on the quantity of potassium in the plant. Slight increase hasbeen registered but it is mathematically unimportant. Amaranthus retroflexus L. reducesthe quantity of phosphor in the cotton plant from 2% to 18% unlike Xanthiumstrumarium L., which does not affect its quantity negatively.AcknowledgementsThis paper was financially supported by the project BG 051PO001-3.3.04/17ReferencesDimitrova М. (2002): Journal of Plant Diseases and Protection, XVIII,141-146, StuttgartTopalov V. (1986): Doctor’s thesis, SofiaStoychev D., Dimitrova M., Dimova D. (2010): Harmful influence of Xanthium strumarium over the yield andthe quality of the cotton fibre. Journal of Environmental Protection and Ecology, 11(3), 875-878,Constanta, RomaniaStoychev D., Dimitrova M., Dimova D. (2010): Competitiv interactions between the weed species Amaranthusretroflexus L. and cotton, 65 th Anniversary AU-Plovdiv, Scientific works, LV(2), 171-174461

AGRISAFE Budapest, Hungary, 2011NATURAL ALTERNATIVE SOIL FERTILIZATION: ANALYSISOF THE PLANT GROWTH-PROMOTING ACTIVITY OFSELECTED SOIL BACTERIAÉ. TAMÁS 1 – GY. MARA 2 – É. LASLO 1 – É. GYÖRGY 2 –L. KÉMENES 1 – SZ. LÁNYI 21 Department of Chemical Engineering, Faculty of Applied Chemistry and Material Science, PolitehnicaUniversity of Bucharest, Spl. Independenţei, 313, Sector 6, Cod 77206, Bucharest, Romania, e-mail:tamaseva@sapientia.siculorum.ro2 Department of Environmental Engineering, Faculty of Sciences, Sapientia University - Cluj-Napoca, PiaţaLibertăţii, 1, Cod 530104, Miercurea-Ciuc, RomaniaAbstract The main aim of the study was the development of bacterial biopreparations based on organicnitrogen- and phosphorus-mobilizing microorganisms. In the present work the plant growth-promoting activityof the selected strains was analysed on wheat (Triticum aestivum), maize (Zea mays) and pea (Pisum sativum)under laboratory conditions. The results showed that the strains promoted the growth of the tested plantscompared with the control plants.Key words: bacterial biopreparations, plant growth-promoting bacteria, wheat, maize, peaIntroductionMaintaining and increasing the fertility and biological activity of the soils in a real needin the agriculture that can be achieved through using local adapted cultures as soilfertilizer bacterial inoculants. For this reason the compatibility and the adaptability ofthe inoculants to the natural ecosystems is necessary. The soil fertilizer inoculants helpthe growth and development of the plants by influencing the physiological state of theplants by phytohormone production, nitrogen fixation, and absorption of mineralelements, antagonism against the phytopathogens, siderophore production, and inductionof protective mechanisms of the inoculated plants (Raja et al., 2006).Because the mineral elements are bounded to the soil particles, the availability forseveral plant species is restricted. Some groups of microorganisms are capable todissolve and make these elements available for plants (Antoun et al., 1998, Barea et al.,2005). Several researchers widely analysed different enzyme activities (protease, urease,sulphatase and phosphatase) in the soil environment. These enzymes play important rolein the degradation of plant, animal and microbial residues, by these play an importantrole in the recycling of the mineral elements and their availability to the plants. The mainsource of the soil enzymes are the microorganisms (Rodríguez and Fraga, 1999).Studies of plant growth promoting bacteria were performed using a wide range of hosts,as cereals, legumes and trees. These bacteria can stimulate directly the plant growth byproducing phytohormones, can increase the nutrient uptake or also can induce systemicplant resistance. In our work we tested the effect of selected bacterial strain on earlygrowth development of pea, wheat and maize plants.Materials and methodsBacterial strains37 bacterial strains were isolated from different mountainous regions from Romania. Thestrains were characterized by their lecithin degradation ability (Lü et al., 2005), cellulosedegradation ability on carboxymethylcellulose (CMC) containing agar plates (1 g/LNH 4 H 2 PO 4 , 0,2 g/L KCl, 1 g/L MgSO 4 .7H 2 O, 1 g/L yeast extract, 26 g/L CM23 and 3g/L agar, dyed with 1% Congo red), phytate degradation ability (Sarikhani et al., 2010),and we measured the alkaline protease (Adinarayana et al., 2005) and alkaline462

Budapest, Hungary, 2011AGRISAFEphosphatase (Wu et al., 2007) activity. Six strains were selected with high decomposingability of organic matter (Table 1). These strains were identified as Pseudomonas sp.12BS, Pseudomonas sp. 19BS, Delftia lacustris 6BS, Delftia lacustris 17BS, Serratiaplymuthica 9BS and Acinetobacter lwoffii 4CZR.Table 1. The selected strains origin and decomposing ability of organic matterBS - Soil from the Borsáros raised bog natural reserve, CZR - Rhizosphere of Zea mays (Cristuru Secuiesc)StrainsLecithinCelluloseAlkaline AlkalineFitate degradation,degradation, halo degradation, haloprotease phosphatasehalo zonezone diameter, zone diameter,activity, activity,diameter, mmmmmmU/mL U/mL6BS 0 23 5 2,1404 3,11229BS 11 7 0 1,4381 3,647212BS 20 28 0 0,2260 1,099217BS 0 7 0 2,8090 019BS 25 31 0 0,8080 04CZR 0 0 0 0 14,7256Effect of strains on the growth of pea, wheat and maizeThe inoculums for each strain were prepared by resuspending the cells from 24 hourcultures on King’s B agar, in sterile physiological (0.9% NaCl) solution. For the tests, 48hour germinated, same sized seedlings were selected. The seeds were surface sterilizedand were submerged in 5 mL inoculum containing about 10 7 CFU/mL. Uninoculatedcontrol seeds were suspended in sterile physiological solution. Seeds were planted in0.4% agar containing 0.25 mL of cell suspension and 0.1 mL modified Crone’s plantnutrient solution (Orellana et al., 1976), containing peptone and p-nitrophenol phosphateinstead of inorganic nitrogen and phosphorus. The plants were grown in SartoriusCERTOMAT ® BS-T incubator at 28⁰C, 4 days, applying 12/12 light-dark cycle. 0.1 mLmodified Crone’s solution was added to the test tubes every day during the experiment.The end of incubation the plant shoot, raw, dry weight and the shoot length weredetermined. The tests were carrying out in 8-15 replicates for each plant. The raw datawere analysed by the Past statistical program, using the Permutation t test (two samples).Results and discussionIn the case of pea plants a significant differences were obtained for the shoot lengthbetween plants treated with 12BS and 19BS bacterial strains and the control plant (Table2, Figure 1.A). The root wet weight were significantly high at the 6BS-, 9BS-, 12BSand4CZR-treated plants and the root dry weight showed significantly high values at the6BS-, 9BS-, 12BS- and 19BS-treated plants (Table 2, Figure 2.A). No differences wereobserved between the total, shoot wet and shoot dry weights of the control and treatedplants. As can be observed, some bacterial strains were promoting the root growth anddevelopment the pea plants compared to the control samples.Figure 1. The average of the shoot lenghts of the A.) peas, B.) wheat and C.) maize control and treated plants463

AGRISAFE Budapest, Hungary, 2011In the case of wheat the total weight and the root wet weight were significantly higher incase of 6BS-, 9BS-, 12BS-, 19BS and 4CZR-treated plants. The observed root dryweights were significantly higher for the 6BS-, 9BS-, 12BS-, 17BS and 19BS-treatedplants (Table 2, Figure 2.B). No significant differences were observed for the shootlenght, wet and dry weight compared to the control plants (Table 2, Figure 1.B). We canconclude that almost all of the bacterial strains promoted the root growth in wheat.Figure 2. The average of the shoot and root wet and dry weights of the A.) peas, B.) wheat and C.) maizecontrol and treated plantsIn the case of maize plants no significant differences were resulted between themeasured values (Table 2, Figure 1.C and 2.C). These can be due to the fact that themaize exhale phosphatase enzymes through the roots which hydrolyzes the p-NPP.Table 2. The p-values obtained from the Permutation t test for the treated plants compared with the controlplantsPlants SamplesTotalShootRoot wet Shoot wet Root dry Shoot dryweightlengthweight (g) weight (g) weight (g) weight (g)(g)(cm)6BS 0.9316 0.0339* 0.826 0.0304 0.7011 0.74639BS 0.6379 0.0012 0.9536 0.0033 0.7442 0.9134Pea12BS 0.6344 0.0482 0.836 0.0844 0.2057 0.046517BS 0.6438 0.0752 0.4768 0.2185 0.3103 0.629719BS 0.7444 0.1238 0.9259 0.803 0.8702 0.0424CZR 0.3962 0.0063 0.2729 0.1246 0.3412 0.08666BS 0.0232 0.0274 0.3717 0.0067 0.142 0.08269BS 0.0125 0.0014 0.5001 0.0044 0.2103 0.0687Wheat12BS 0.0102 0.0165 0.2425 0.0049 0.1727 0.055117BS 0.2966 0.0832 0.1639 0.0042 0.0873 0.009419BS 0.0016 0.0001 0.0463 0.0001 0.0003 0.00014CZR 0.0001 0.0003 0.6521 0.0001 0.0273 0.11346BS 0.3666 0.361 0.5717 0.9006 0.2768 0.61119BS 0.9221 0.8492 0.9754 0.9519 0.0673 0.2421Maize12BS 0.9627 0.9377 0.9381 0.7961 0.1209 0.355717BS 0.3452 0.6737 0.3126 0.9036 0.2435 0.73919BS 0.9891 0.6569 0.6358 0.7516 0.1725 0.4514CZR 0.4342 0.5405 0.2699 0.9149 0.0455 0.1085464

Budapest, Hungary, 2011AGRISAFE* the italic marked values are significant higherConclusionsThree bacterial strains as follows: 6BS, 9BS and 12BS increased the root development ofpea, whereas four bacterial strains were able (6BS, 9BS, 12BS and 19BS) to the rootdevelopment of wheat. Our data indicates that the above mentioned bacterial strainswere able to colonize the rhizosphere of the pea and wheat plants and also developedplant growth promoting effects.AcknowledgementsThe work has been funded by the Sectoral Operational Programme Human ResourcesDevelopment 2007-2013 of the Romanian Ministry of Labour, Family and SocialProtection through the Financial Agreement POSDRU/6/1.5/S/19.ReferencesAdinarayana, K., Jyothi, B., Ellaiah, P. (2005): Production of Alkaline Protease With Immobilized Cells ofBacillus subtilis PE-11 in Various Matrices by Entrapment Technique, AAPS Pharm. Sci. Tech., 6(3), 391–397.Antoun, H., Beauchamp, C. J., Goussard, N., Chabot, R., Lalande, R. (1998): Potential of Rhizobium andBradyrhizobium species as plant growth promoting rhizobacteria on non-legumes: Effect on radishes(Raphanus sativus L.), Plant and Soil, 204, 57–67.Barea, J. M., Pozo, M. J., Azcon, R., Azcon-Aguilar, C. (2005): Microbial co-operation in the rhizosphere.Journal of Experimental Botany, 56, 1761–1778.Lü J., Li F., Chen S., Li J. (2005): The secretion of lecithinase of Pseudomonas alcaligenes S2 was via type IIsecretion pathway, Chinese Science Bulletin, 50(16), 1731–1736.Orellana, R. G., Sloger, C., Miller V. L. (1976): Rhizoctonia-Rhizobium interaction in relation to yieldparameters of soybean. Phytopathology, 66, 464–467.Raja, P., Uma, S., Gopal, H., Govindarajan, K. (2006): Impact of Bio Inoculants Consortium on Rice RootExudates, Biological Nitrogen Fixation and Plant Growth. Journal of Biological Sciences, 6(5), 815–823.Rodríguez, H., Fraga, R. (1999): Phosphate solubilizing bacteria and their role in plant growth promotion.Biotechnology Advances, 17, 319–339.Sarikhani, M. R., Malboobi, M. A., Aliasgharzad, N., Greiner, R., Yakhchali, B. (2010): Functional screeningof phosphatase-encoding genes from bacterial sources, Iranian Journal of Biotechnology, 8(4), 275 – 280.Wu, J.-R., Shien, J.-H., Shieh, H. K., Hu, C.-C., Gong, S.-R., Chen, L.-Y., Chang, P.-C. (2007): Cloning of thegene and characterization of the enzymatic properties of themonomeric alkaline phosphatase (PhoX) fromPasteurella multocida strainX-73, FEMS Microbiol Lett. 267, 113–120.465

AGRISAFE Budapest, Hungary, 2011CHEMICAL COMPOSITION AND YIELD QUALITY OFPSEUDOCEREALS UNDER ROMANIAN AGRICULTURALCONDITIONSM. TOADER – G.V. ROMANDepartment of Field Crops Production, Faculty of Agriculture, University of Agronomic Sciences andVeterinary Medicine Bucharest, Romania, Blvd. Marasti, No 59, sector 1, cod 011464,mirelatoadervali@yahoo.comAbstract The object of this paper was to study the chemical composition and yield quality of pseudocerealspecies: amaranth (Amaranthus cruentus, A. hypochondriacus, A. caudatus), quinoa (Chenopodium quinoa),and buckwheat (Fagopyrum esculentum), grown on the South Romanian Plain. Analyses of the chemicalcomposition and yield quality of different Amaranthus species gave the following values: for Amaranthuscruentus - proteins 15.37-15.80%; starch 60.87-61.70%; lipids 6.00-6.14%; fibre 2.22-2.24%; minerals 2.61-2.68%; for A. hypochondriacus - proteins 15.84-16.95%; starch 61.32-62.02%; lipids 5.41-5.56%; fibres 4.13-4.68%; minerals 2.80-3.67%; for A. caudatus - proteins 14.43-14.60%; starch 59,97-60,50%; lipids 6.24-6.50%; fibres 3.16-5.55%; minerals 2.9-4.76%. The richness in proteins and lipids should be noted for all theAmaranthus species, the contents being higher in comparison with those of cereal crops. For quinoa grains, theaverage chemical composition was as follows: proteins 14.70-16.71% (superior to cereals); starch 60.40-65.44%; lipids 5.31-5.80%; fibres 2.11-2.18%; minerals 2.09-2.89%. The chemical composition of buckwheatgrains was: 14.32-16.03% proteins; 63.56-67.87% starch; 3.18-3.95% lipids; 9.84-10.37% fibres; 2.08-2.58%minerals. It should be pointed out for all pseudocereals that the protein contents (over 14.3%, and over 16% forthe best variants) were superior to those of cereals (10-14%) and that the lipid contents were also higher (over5%) by comparison with cereals (1.5-2%).Key words: pseudocereals, chemical composition, nutritional value.IntroductionAt present, researchers’ attention is focused on the exploitation of alternative crops orunderutilized species - pseudocereals - for different uses. These crops have an importantrole in the development and diversification of agricultural products and food, and for thedevelopment of a sustainable agriculture which is a priority trend for RomanianAgriculture in the context of European and world agriculture.Pseudocereals belong to other botanical family as cereals: amaranth (Amaranthuscruentus, A. hypochondriacus, A. caudatus), to Amaranthaceae Family, quinoa(Chenopodium quinoa), to Chenopodiaceae Family, buckwheat (Fagopyrumesculentum) – to Polygonaceae Family, but the utilization of their grains is the same asfor cereals.These species requirements for growing conditions, are not exigent (for fertilization,tolerance of pests and insects), and so they need low inputs. As they can survive andproduce in areas of less favourable conditions, these crops can be a solution for organicagriculture. Their high content in proteins, essential aminoacids, and minerals leads to animproved dietary composition of the processed products, and their nutritional value isbeneficial to human health. Either alone or as mixture with other cereals, they canimprove the technological or use qualities. Generally, they have promising nutritional,economic and industrial importance for a variety of purposes for humankind.Materials and methodsThis research has been focused to determine the chemical composition and yield qualityof some pseudocereals - amaranths species, quinoa and buckwheat by comparison withtwo major cereals - wheat and maize. All grains come from Moara DomneascaExperimental Field of the Bucharest Field Crops Department situated in the South Part466

Budapest, Hungary, 2011AGRISAFEof Romanian Plain. Chemical analyses were made in the Yield Quality Laboratory of theField Crops Department, Faculty of Agriculture, University of Agronomic Sciences andVeterinary Medicine Bucharest, with a spectrophotometer NIR, Instalab 600. Thisequipment uses the infrared technology for determination of different chemicalcompounds of grain product. The calibration of spectrophotometer was effectuated bythe Metron Group Laboratory from Novi Sad. There were performed following chemicalanalysis: starch, proteins, lipids, fibre and minerals.Results and discussionTable 1 shows the chemical composition of pseudocerals regarding main componentscomparated to wheat and maize grains. Some components are higher in content thatthose of cereals species, of which wheat and maize are given as the main reprezentive.Nutrional value of pseudocerelas is thus very high.Table 1. Chemical compositions of amaranthus, quinoa, and buckwheat compared to wheat and maize(% dry mass)Crops Starch Proteins Lipids Fibre MineralsAmaranthus 60.87-61.70 15.37-15.80 6.00-6.14 2.22-2.24 2.61-2.68cruentusA.61.23-62.02 15.84-16.95 5.41-5.56 4.13-4.68 2.80-3.67hypochondriacusA. caudatus 59.97-60.50 14.43-14.60 6.24-6.50 3.16-5.55 2.9-4.76Chenopodium 60.40-65.44 14.70-16.71 5.31-5.80 2.11-2.18 2.09-2.89quinoaFagopyrum 63.56-67.87 14.32-16.03 3.18-3.95 9.84-10.37 2.08-2.58esculetumTriticum aestivum 60.45-63.31 12.01-12.20 1.37-1.39 1.85 – 2.09 1.21-1.68Zea mays 65.4-67.77 9.17-9.57 3.78-4.14 1.10-1.22 0.69-1.77The carbohydrates are a source of energy for human and animal organisms. In thepresent research, starch content was found in the following values: for winter wheat 61-63%, for maize 65.4-67.77%, and for pseudocereals: amaranth 60-62%, quinoa 60-65%,buckwheat 63-65%, therefore, the content was at the same level as in the cereals grains.The protein content for pseudocereals was over 14% and over 16% for the best variantsby comparison with cereals content, 12% for winter wheat and less than 10% for maize.So, the protein content of pseudocereals was higher than cereals species. But importantis the quality of the protein too. In this respect, as other research reported pseudocerealshave an higher content of some essential aminoacids by comparasion with cereals (i.e.lysine, over 5%) (Koziol, 1997). On the other hand, as they contain only a very lowamount of prolamins in comparison with wheat grains, pseudocereals are suitable for thediets of persons suffering from celiac disease (Berghofer, Schoenlenchner, 2007)Pseudocereals are richer in lipids than the cereals. So the values of the lipids contentwere about 5% for quinoa, 5-6% for amaranth, by comparation with 1.8-2.6% for wheat.In additions, the minerals (Ca, Mg, K, Fe) of pseudocereal grains have a higher valuethan in cereals grains (i.e. pseudocereals 2-10%, respectively, winter wheat and maize 1-2%).ConclusionsAs a consequence of our research regarding of chemical composition of pseudocereals,following conclusions may be emphasized as important:467

AGRISAFE Budapest, Hungary, 2011There are remarked the superior values of the protein content for pseudocereals - over14% and over 16% for the best variants, in comparison with cereals (9.17-12.20%). Thelipids content was higher (over 5%) by comparison with cereals (1.37-4.14%) and, also,the minerals content of pseudocereals was higher too (2.08-4.47%) comparated to winterwheat and maize grains (0.69-1.77%). In this way, in a more wider vision, they cancontribute to food nutrional value and may become more attractive for consumers.In conclusion, the pseudocereals may have a positive contribution by increasing the foodnutrional value, the diversity of the farm's income base, spreading out risks, reducingweaknesses in the farm system, or broadening the base of operations.Pseudocereals species, strongly promoted by scientific trends which support biodiversityand organic agricultural system may contribute to the diversification of agriculturalcrops and agroalimentary products, with a source of food rich in proteins, lipids andminerals.ReferencesBelton, P.S., Taylor J.R.N. (2000): Pseudocereals and Less Common Cereals – Grain Properties and UtilizationPotential. American Association of Cereal Chemists. USA.Berghofer, E., Schoenlechner (2007): Pseudocereals – on overview. Book of Proceedings. 5th InternationalConference LCA in Foods. Gothenburg, Sweden.Johnson, D.L. (1990): Cereals and pseudocereals. In: Janick and J.E Simons (eds), Advances in new crops.Timber Press, Portland, OR.Koziol, M.J. (1992): Chemical composition and nutritional evaluation of quinoa (Chenopodium quinoa Willd.).J. Food Comp. Anal. 5:36-68.Roman, Gh.V., Toader, M. (2007): Alternative crops - Pseudocereals. Ceres Publishing House. Bucharest,Romania.Toader, M. (2008): Research regarding the chemical composition and yield quality at cereals andpseudocereals, under influence of natural and technological factors. PhD Thesis. Faculty of Agriculture,USAMV Bucharest, Romania.Toader, M., Roman, Gh.V. (2004): The chemical composition - a determining factor for quality of cereals andpseudocereals. Scientific papers, Series A, Vol XLVII Agronomy. USAMV Bucharest.468

Budapest, Hungary, 2011AGRISAFESAVING LAND RESOURCES BY INCREASING DIGESTIBLEDRY MATTER YIELD PER HECTAREZ. TÓTHNÉ ZSUBORI – C. L. MARTONAgricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, HungaryAbstract The natural and economical facilities of Hungary are very favourable for agriculture, especially cropproduction. It is necessary to save our land resources because urbanization and the improving infrastructurerequire more and more territory. It is a big challenge for agriculture to use the decreasing crop area effectively.The proportion of cereals and industrial plants within the total crop area is increasing at the expense of foddercrops. The number of livestock, including ruminants, can only be increased if enough forage is available. Thiswill require optimal land use, aimed at producing good quality, effectively digestible forage with high energycontent. The main objective of silage maize production is to maximize green and dry matter yield per hectare.One way to improve yield is to grow more plants per hectare or to improve the canopy of the plant byincreasing the number of leaves or the size of the ear. However, plant density and modified morphology do notguarantee good forage quality. The chemical composition and digestibility of the plants must also be taken intoconsideration. In the silage maize breeding program in Martonvásár, studies are made not only on themorphological and agronomical traits of the hybrids, but also on the chemical quality, digestibility andmetabolizable energy content. The results show that, among the chemical components, higher protein contentimproves digestibility while higher fibre content impairs it. The correlation between lignin content andeffective degradability is strong and negative. If more digestible organic matter per hectare is to be produced,the protein content must be increased and fibre and lignin content decreased.Key words: land, silage maize, yield, digestibilityIntroductionSilage maize is the most important forage for ruminants. The volatile fatty acidsproduced during its digestion are the basis for milk production. One way to improveforage yields per hectare is to apply higher plant densities or to grow taller hybrids withlarger ears or more leaves. Modifying the morphology of the plants through changes inthe ratio of different plant parts does not itself influence the silage quality. It is importantto improve the chemical composition and digestibility of each part (Verbič et al., 1995).The ear, particularly the kernel, contains the most nutrients, so the main task is toincrease the ratio of the ear in the plant dry matter. Among plant parts, this fraction hasthe best digestibility (Tang et al., 2006; Estrada-Flores et al., 2006). The digestibility ofthe leaves is also very good (Sun et al., 2009; Tang et al., 2006) and they contain manynutrients, such as protein and minerals (indicated by crude ash content), so increasing theproportion of this fraction is also favourable for good digestibility. Breeding leafyhybrids (Shaver, 1983) can benefit from this. According to literary data, cows fed onsilage made of leafy hybrids produce more milk with better quality compared to thosefed conventional hybrids (Clark et al., 2002; Thomas et al., 2001). The stalk has theworst digestibility of all the plant parts, especially the below-ear fractions, since theycontain the most lignin (Boon et al., 2008). This can be compensated for by raising thecutting height, but this is only effective in the case of leafy hybrids, which still haveenough dry matter due to the larger number of leaves compared to normal hybrids(Lewis et al., 2004). The other way of producing more nutrients per unit area is toimprove the digestibility of the forage. This requires improvements not only in thechemical composition of the whole plant, but also in the proportion of the different plantparts and their digestibility.469

AGRISAFE Budapest, Hungary, 2011Materials and methodsThe aim of this work was to study the yield, chemical composition and digestibility ofthe whole plant and the different plant parts of silage maize hybrids bred in Martonvásár.Eight hybrids of different types with different maturity periods were tested in anexperiment set up in Martonvásár in a randomised complete block design with fourreplications during the years 2002-2004. The sowing density was 80,000 plants perhectare. The same technology was applied every year, including irrigation. During thevegetation period data were recorded on the morphological and agronomic traits of thehybrids (data not shown). The crop was harvested 40 days after flowering at the silagematurity stage, at an average dry matter content of 35%. The fresh and dry mass of thewhole plant and the different plant parts were measured. The chemical contents of thesamples were determined by means of Weendeii analysis, according to the officialHungarian standard. Effective and potential degradability were measured in vivo infeeding trials on fistulated sheep. Statistical analysis of data was performed using thesoftware “Agrobase”.Results and discussionThe proportion of the leaves in the total plant dry matter was found to be greater in theleafy hibrids than in conventional hybrids, and the proportion of the stalk below the earwas smaller due to the lower ear attachment height (Figure 1). The yield of leafy hybridsdid not differ from the average, because these two effects compensate each other. Thestalk makes the greatest contribution to the dry matter yield (Lewis et al., 2004). Thehighest fresh and dry matter yields were measured for Mv 2, which had the largestproportion of the stalk. The ratio of the ear fraction was more than 60% for all thehybrids, which is a very good result (Józsa, 1981).350300Dry matter yield (g)250200150100Ear (with husk and cob)Leaves above the earLeaves below the earStalk above the earStalk below the ear500Mv 1 Mv 2 Mv 3 Mv 4 Mv 5 Mv 6 Mv 7 Mv 8HybridsFigure 1. Dry matter yield per plant and the proportion of the different plant parts in the dry matterThe chemical composition of the different plant parts was studied in detail for threehybrids. Differences between the hybrids were smaller than those between the plantparts, as reported by other authors (Masoero et al., 2006). The lignin content was lowestfor the ear fraction, while the crude protein and crude ash contents were greatest for theleaves (Table 1). This corresponds to earlier literary data (Estrada-Flores et al., 2006;470

Budapest, Hungary, 2011AGRISAFEThomas et al., 2001; Bal and Bal, 2009). The crude fibre content was the greatest for thestalk, especially the stalk below the ear. Digestibility was mostly affected by the lignincontent. A negative correlation (r=-0.35) was found between the two values, as reportedin the literature (Riboulet et al., 2008). If the lignin content is defined as a percentage ofcrude fibre content, the correlation becomes very strong (r=-0.91). There was also amoderate positive correlation between the crude fibre content and digestibility. Nosignificant correlations were detected between the other chemical composition traits anddigestibility, but the hybrids with the best digestibility had high crude protein content.Table 1. Chemical composition of the different plant parts (g per 100 g dry matter)Stalkbelow the earStalkabove the earLeavesbelow the earLeavesabove the earEar(husk and cob)Crude protein 2,79 2,85 8,83 8,03 5,09Crude ash 5,08 5,10 10,50 10,03 2,03Crude fat 1,03 1,12 2,96 3,00 3,51Crude fibre 31,36 29,57 28,80 23,17 7,50ADF 39,22 36,17 32,43 29,00 8,60Lignin 5,37 7,90 3,40 3,00 0,97The hybrids Mv 4 and Mv 8 had the best effective and potential degradability values. Thehigh-yielding hybrid Mv 2 had the poorest digestibility, resulting in a lower digestibledry matter yield per hectare than that of Mv 4, a hybrid which produced lower yields buthad better digestibility (Figure 2). The greatest effective digestible dry matter yield perhectare was recorded for Mv 8.Effective digestible dry matter yieldTotal dry matter yield25Dry matter yield (t ha -1 )20151050Mv 1 Mv 2 Mv 3 Mv 4 Mv 5 Mv 6 Mv 7 Mv 8HybridsFigure 2. Total and effective digestible dry matter yields of the hybrids per hectareConclusionsDigestibility was affected negatively by lignin content and positively by crude proteincontent. The leaves had the highest protein content. The lignin content was high in thestalk below the ear and low in the ear fraction. This means that decreasing the proportionof the stalk below the ear in the total dry matter and increasing the proportion of the earand the leaves could result in better forage digestibility. The digestible dry matter yield471

AGRISAFE Budapest, Hungary, 2011per hectare depends not only on the dry matter yield, but even more on the digestibilityof the plant.AcknowledgementsThis research was financially supported by the project FVM 159-a/2002.ReferencesBal, M. A., Bal, E. B. B. (2009): Interrelationship between nutrient and microbial constituents of ensiledwhole-plant maize as affected by morphological parts. International Journal of Agricultural Biology, 11,631-634.Boon, E. J. M. C., Struik, P. C., Tamminga, S., Engels, F. M., Cone, J. W. (2008): Stem characteristics of twoforage maize (Zea mays L.) cultivars varying in whole plant digestibility. III. Intra-stem variability inanatomy, chemical composition and in vitro rumen fermentation. NJAS-Wageningen Journal of LifeSciences, 56, 101-122.Clark, P. W., Kelm, S., Endres, M. I. (2002): Effect of feeding a corn hybrid selected for leafiness as silage orgrain to lactating dairy cows. Journal of Dairy Science, 85, 607-612.Estrada-Flores, J. G., Gonzalez-Ronquillo, M., Mould, F. L., Arriaga-Jordan, C. M., Castelan-Ortega, O. A.(2006): Chemical composition and fermentation characteristics of grain and different parts of the stoverfrom maize land races harvested at different growing periods in two zones of central Mexico. AnimalScience, 82, 845-852.Józsa, L. (1981): Kukoricatermesztés szilázsnak (Growing maize for silage). Mezőgazdasági Kiadó, BudapestLewis, A. L., Cox, W. J., Cherney, J. H. (2004): Hybrid, maturity, and cutting height interactions on cornforage yield and quality. Agronomy Journal, 96, 267-274.Masoero, F., Rossi, F., Pulimeno, A. M. (2006): Chemical composition and in vitro digestibility of stalks,leaves and cobs of four corn hybrids at different phenological stages. Italian Journal of Animal Science, 5,215-227.Riboulet, C., Lefevre, B., Denoue, D., Barrière, Y. (2008): Genetic variation in maize cell wall for lignincontent, lignin structure, p-hydroxycinnamic acid content, and digestibility in set of 19 lines at silageharvest maturity. Maydica, 53, 11-19.Shaver, D. L. (1983): Genetics and breeding of maize with extra leaves above the ear. Proceedings of theAnnual Corn and Sorghum Industries Research Conference, 38, 161-180.Sun, Z. H., Liu, S. M., Tayo, G. O., Tang, S. X., Tan, Z. L., Lin, B., He, Z. X., Hang, X. F., Zhou, Z. S., Wang,M. (2009): Effects of cellulase or lactic acid bacteria on silage fermentation and in vitro gas production ofseveral morphological fractions of maize stover. Animal Feed Science and Technology, 152, 219-231.Tang, S., Tan, Z., Zhou, C., Jiang, H., Jiang, Y., Sheng, L. (2006): A comparison of in vitro fermentationcharacteristics of different botanical fractions of mature maize stover. Journal of Animal and FeedSciences, 15, 505-515.Thomas, E. D., Mandebvu, P., Ballard, C. S., Sniffen, C. J., Carter, M. P., Beck, J. (2001): Comparison of cornsilage hybrids for yield, nutrient composition, in vitro digestibility, and milk yield by dairy cows. Journalof Dairy Science, 84, 2217-2226.Verbič, J., Stekar, J. M.A., Resnik-Cepon, M. (1995): Rumen degradation characteristics and fibre compositionof various morphological parts of different maize hybrids and possible consequences for breeding. AnimalFeed Science and Technology, 54, 133-148.472

Budapest, Hungary, 2011AGRISAFESTRESS-RELATED VARIATION IN SOD AND POX ISOZYMEPATTERNS ASSOCIATED WITH IN VITRO ANDROGENESIS INMAIZE (ZEA MAYS L.) AND BARLEY (HORDEUM VULGARE L.)Ľ. UVÁČKOVÁ 1 – T. TAKÁČ 2 – B.OBERT 1 – A. PREŤOVÁ 1,31 Institute of Plant Genetics and Biotechnology, Slovak Academy of Sciences, Akademická 2, P. O. Box 39/A,95007 Nitra, Slovak Republic, e-mail: obert@savba.sk2 Centre of the Region Haná for Biotechnological and Agricultural Research, Faculty of Science, PalackýUniversity, Šlechtitelů 11, 783 71 Olomouc, Czech Republic3 Department of Botany and Genetics, Faculty of Natural Sciences, University of Constantine the Philosopher,Trieda A. Hlinku 1, 94901 Nitra, Slovak RepublicAbstract Microspores or young pollen grains can be switched (under stress conditions) from normal pollendevelopment towards an embryogenic pathway, a process called androgenesis. This represents an importanttool for research in plant genetics and breeding, since androgenic embryos can germinate into completelyhomozygous, double haploid plants. Recent proteomic analyses showed the upregulation of H 2 O 2 degradingascorbate peroxidase (APX) after 3 days on induction medium, suggesting a putative role of antioxidantdefence in androgenetic development. Stress-related variation in the SOD and POX isozyme patternsassociated with in vitro androgenesis in maize (Zea mays L.) and barley (Hordeum vulgare L.) wasinvestigated. Anther cultures of the highly androgenic maize genotype A 19 (Z. mays L.) and barley genotypeAmos (H. vulgare L.) were investigated in different stages of cold pre-treatment (9°C, 12 days for maize and4°C and 10 days for barley) and during the first days of cultivation on induction media (YP for maize and MN6for barley). Results for induction and regeneration were statistically evaluated and compared in correlation tobiochemical studies. Superoxide dismutase isozymes in anthers at different stages of cold pre-treatment andduring the first days of cultivation on induction media were compared and correlated with the untreatedcontrol. Androgenic induction was achieved with an induction frequency (percentage of induced structures) of7.4 % in barley and 77.36 % in maize. Five SOD isozymes were expressed in pretreated barley anthers. A newSOD isozyme (Rm 0.28) was expressed 2 days after transferring anthers to induction medium, and its activitycontinuously decreased. These results will be correlated with maize enzymatic antioxidant mechanisms.Key words: androgenesis, maize, barley, superoxide dismutase, ascorbate peroxidaseIntroductionIn stress conditions microspores or young pollen grains can be switched from theirnormal pollen development towards an embryogenic pathway, a process calledandrogenesis. Androgenesis represents an important tool for research in plant geneticsand breeding, since androgenic embryos can germinate into completely homozygous,double haploid plants.In stress conditions microspores or young pollen grains can beswitched from their normal pollen development towards an embryogenic pathway, aprocess called androgenesis. Androgenesis represents an important tool for research inplant genetics and breeding, since androgenic embryos can germinate into completelyhomozygous, double haploid plants.Anther cultures of barley (Hordeum vulgare L.) cultivar Amos and maize (Zea mays L.)cultivar A 19 has been investigated in our experiments, focusing on biochemical analysisof anthers after different cold pre-treatment and during first days of cultivation oninduction media.Number of anthers with induced microspores and number of structures originated frommicrospores were statistically evaluated. Protein spectra of peroxidases (POX) andsuperoxid dismutase (SOD) isozymes in anthers at different stages of cold pre-treatmentand during the first days of cultivation on induction media were compared and correlatedwith untreated control.473

AGRISAFE Budapest, Hungary, 2011Materials and methodsAnther culture: The donor plants of barley cultivar Amos and maize cultivar A 19 weregrown under the field conditions. Spike and tassels were collected when microsporeswere at the late uninucleate to early binucleate developmental stage. To enhance theandrogenic response cold pre-treatment was used 4 °C, two weeks for barley and 7 °C,10 days for maize. Anthers of barley were cultivated on MN6 induction media (Hunter,1988) 30 days in dark at 24 °C and maize anthers were cultivated on YP induction media(Ku et al. 1978) 30 days in the dark at 28 °C. Culture responses were evaluated after 30days of cultivation.Isozyme pattern: Anthers of barley were collected at 0, 4, 8, 12 and 14 days of cold pretreatmentand after 1 and 2 days of cultivation on induction media MN6. Anthers ofmaize were collected after 0, 6, 12 days of cold pre-treatment and after 3 days ofcultivation on induction media YP. Frozen anthers (200 anthers per sample) were groundto a fine powder in a mortar placed in a liquid nitrogen bath in the presence of 0,1 M Naphosphatebuffer (pH 7,5) containing 1mM EDTA. The extracts were centrifuged for 20min at 15000g at 4 °C to collect the supernatant. The protein content was determinedaccording to Bradford (1976). Isozymes of SOD and POX were separated on 10% nativePAGE and were visualised with nitrobluetetrazoliumchlorid (NTB) according toBeauchamp and Fridovich (1971, for SOD) and Benzidine-HCL (for POX).Results and discussionAndrogenic induction (Figure 1) was achieved with induction frequency 7,4 % for barleyand 15,6 % for maize.Four SOD isozymes were expressed in pre-treated barley anthers (Figure 2) and in pretreatedmaize anthers (Figure 3) as well. We observed, that the activity of isozyme withRm 0,61 continuously decreased in barley anthers (Figure 2). H 2 O 2 inhibited all SODisozymes, showing that MnSOD was not present in barley anthers.In oposite, in maize anthers we detected an MnSOD isozyme (isozyme 5). Moreover, wefound that its activity increased mainly after the transfer of the anthers to inductionmedia as shown in Figs 3 and 5.Thirteen POX isozymes were expressed (Figure 4) in maize anthers during the cold pretreatmentand cultivation in induction media. Four new isozymes were detected after 6days of cold pre-treatment. An intensive increase in activity of isozyme with Rm 0,23was found after the transfer of the anthers to induction media.ABFigure 1. Induced structures of barley (A) and maize (B) after 30 days of cultivation on induction media474

Budapest, Hungary, 2011AGRISAFETable 1. Anther culture response of barley genotype Amos and maize genotype A19 after 30 days ofcultivation on induction mediaNumber %Anthers Induced anthers Structures StructuresBarley genotype Amos 5500 853 407 7,4Maize genotype A 19 1000 293 156 15,6Figure 2. Isozyme pattern of superoxide dismutase in barley anthers during cold pre-treatment and on few dayson induction media (MnSOD - inhibited by H 2 O 2 ) (0-14 days of cold pre-treatment; I-II – days of cultivation)Figure 3. Isozyme pattern of superoxide dismutase in maize anthers during cold pre-treatment and on few dayson induction media (MnSOD - inhibited by H 2 O 2 ) (0, 6, 12 days of cold pre-treatment; III – 3 days ofcultivation)Figure 4. Isozyme pattern of peroxidases in maize anthers during cold pre-treatment and on few days oninduction media (0, 2, 6 days of cold pre-treatment; III – 3 day of cultivation)475

AGRISAFE Budapest, Hungary, 2011Figure 5. Quantification of SOD isozymes carried out using Quantity One gel analysis software (BioRad)ConclusionsDoubled haploid technology is an important tool for breeding in cereals. Role ofperoxidases (POX) and superoxid dismutase (SOD) isozymes during induction phase ofthe androgenic induction is not clear yet. Identification of isozymes and their activitiescan bring more light into induction and process of in vitro androgenesis.AcknowledgementsThis paper was financially supported by the projects VEGA 2/0114/09 and APVV-0115-07ReferencesBradford, M.M. (1976): A rapid and sensitive method for the quantitation of microgram quantities of proteinutilizing the principle of protein dye binding Anal.Biochemistry, 72, 248-254Beauchamp, C., Fridovich, I. (1971): Superoxide dismutase: Improved assays and an assay applicable toacrylamide gels. Anal. Biochemistry. 44: 276-287.Hunter, C.P. (1988): Plant regeneration from microspores of barley. Ph.D Thesis. Wya College, University ofLondonKu, M.K., Cheng, W.C., You, L.C., Kuan, H.P., Huang, C.H. (1978): Induction factors andmorphocytological characteristic of pollen derived plants in maize (Zea mays L.). In: Proceedings ofthe symposium: Plant Tissue Culture, 1978, Science Press, Peking, pp 35–45476

Budapest, Hungary, 2011AGRISAFEANALYSIS OF THE CONDITIONS REQUIRED FOR FLAXREGENERATION IN VITRO VIA ANTHER CULTUREZ. ZÁČKOVÁ 1 – B. OBERT 2 – A. PREŤOVÁ 2,31 Department of Biology and Ecology, Faculty of Pedagogy, Catholic University, Hrabovská cesta 1, 03401Ružomberok, Slovakia, zackova18@gmail.com2 Institute of Plant Genetics and Biotechnology at the Slovak Academy of Sciences, Nitra, Slovakia3 Dep. of Botany and Genetics, Faculty of Natural Sciences, Constantin the Philosopher Univer., Nitra, SlovakiaAbstract In agriculture, homozygous lines are used for the effective breeding of flax. One way of producingsuch lines is to induce plant regeneration from haploid cells e.g. immature gametes. The conditions for flaxregeneration via anther culture were optimized in the present work. The responsiveness of anthers cultivated invitro was highly influenced by the environmental conditions during plant growth, particularly the airtemperature. It was discovered that the immature pollen grains: microspores developing from pollen mothercells after meiosis, were asynchronous. The most effective induction medium was IMP2.3, which contains 2%sucrose, NAA (1 mg/l) and BAP (2 mg/L). RMP1 medium supplemented with zeatin (1 mg/L) was used forregeneration. Plants could only be regenerated via organogenesis. The origin of regenerants was analysedkaryologically and also using isozyme fingerprints (ACP, PRX).Key words: anther culture, flaxIntroductionFor the first time successful anther culture in flax was published by Sun and Fu (1981).The most considerable publications with improvements in flax anther culture appeared inlast ten years (Chen et al., 2002; Chen et al., 2003; Rutkowska-Krause et al., 2003; Obertet al. 2004a, b; Bartošová et al., 2005; Burbulis and Blinstrubiene, 2006; Obert et al.,2009). Flax is still an interesting research target due to its utilization for simple cellculture techniques and other favourable characteristics exploited for human benefits.Materials and methodsIn our experimental work the seeds of flax (Viking), linseed (AC Emerson, McGregor,Szegedi 30) and the new line (PRFGL 77) were used. Cultivation of flax plants wasrealized in field conditions during four periods. The amount of raining falls and theaverage air temperature were measured in cooperation with the SlovakHydrometeorology Institute. The soil was fertilized with nitrogen granular fertilizerNPK beforehand. The seeds were treated with Previkur (for its antifungal effect). In wetdays we used fungicide Topas to treat the plants. At first we marked 20 plants withflower buds long 2,0±0,1mm, in such buds pollen mother cells were present inside theanthers. We measured the length of the buds in 10 plants at 10 am and 4 pm every dayand in 10 another plants the developmental stage of the microspores was analysed withacetocarmine staining at the same time. The anther culture was prepared as writtenpreviously (Bartošová and Preťová, 2003). The objectives in this study were:comparison between four vegetal periods: late spring1, 2, 3 (April-July) and earlyautumn1 (August-October), analysis of the pollen ontogeny, screening for responsivegenotype to androgenesis, optimization the cultivation conditions and identification ofthe regenerants. The ploidy of regenerants was determined karyologically (Bartošová etal., 2004). We analysed the spectrum of isoenzymes in the true leaves of regenerants(AC Emerson, PRFGL 77) as mentioned by Bartošová et al. (2005).477

AGRISAFE Budapest, Hungary, 2011Results and discussionAs we found out the most effective cultivation of flax was in period spring3. Theaverage temperature when the material was collected was 15-21°C (precipitation 2-3mm). The hottest months (June, July) were in the spring1. The driest month was inJune2, when the precipitation was only about 1,55mm. Flowering of flax was quite fastin high air humidity. We started the observation of the pollen ontogeny when there werepollen mother cells in the anthers (2-2,5mm buds). Then they fragmented and the callosewall appeared around each cell going through microsporogenesis. At the end of the daythe tetrads of microspores has been formed in the anthers. Microspores have beenliberated from tetrads in 1-2 extra days (3-3,5mm buds). After that strong vacuolizationstarted in microspores, and the early, middle and late stage microspores could beobserved (Fig.1, 2). About 150 microspores developed in each anther.Microsporogenesis followed and later three-celled pollen grains appeared. In this stagethe flax flowers opened.Figure 1. Pollenmother cellsFigure 2. Late uninucleatemicrosporeFigure 3. Symmetricdivision of the nucleus inandrogenic microsporeFigure 4. Callusgrowing inside theresponsive antherThe genetic predisposition of selected flax genotypes to calli induction derived frommicrospores was measured as the responsiveness in %. The genotype was anindependent variable. Kruskal-Wallis test: H (3, N = 24) = 9,331738, p = 0,0252Table 1. Examination the differences between the genotypes (

Budapest, Hungary, 2011AGRISAFENext we analysed the effect of high temperature and the cold pretreatment to inductionof the anthers using descriptive statistics. As it is shown in the table 2 there weredifferences between two pretreatments. Using combination of cold and hot pretreatmenthas led to abnormal divisions. Further we have focused on analyzing responsiveness ofthe anthers (AC Emerson) cultivated on 5 induction media (Bartošová, Preťová, 2003).The most effective media were IMP2.1, IMP2.3, which contained 6% sucrose. Themedia IMP2.2 and IMP2.4 contained combination of 6% sucrose and 6% maltose.Figure 5. Callus induction on the anthers cultivated on media with different sugar content.Induced calli were transfered to regeneration medium and after several subcultivationsthe organogenic shoots and embryo-like structures were observed (Fig. 8, 9). Inducedinduced green shoots were put on the surface of the rooting medium (Bartošová andPreťová, 2003). Karyology showed that there were 5% haploid plants (Fig. 6). Otherregenerants were diploid (2n) as can be seen on fig. 7. Haploid plants differed fromdiploid ones in their overal habitus, plants were weak with short stems and smallerleaves. In diploid flax regenerants very probably spontaneous diploidization occurredduring microspore division, or it also could be a result of somaclonal variation in vitro.For final identification of the regenerants we used molecular markers of codominantcharacter. We identified the alleles that proved the origin of the regenerants, but alsoepactal alleles as a result of epigenetic modification of the enzyme expression and theintravarietal variation (Bartošová et al., 2005).Figure 6. Haploid cells(n=15chromosomes) of themicrospore derived plantsFigure 7. Dihaploidcells (n=30 chr.) of themicros. derived plantsFigure 8. Shootregenerating callus.Figure 9. Histology ofcotyledonary embryolikestructure479

AGRISAFE Budapest, Hungary, 2011ConclusionsThe responsiveness of flax anthers in in vitro culture is affected by the complex ofspecific conditions. Well prepared protocol for anther culture studies is a prerequisite forfurther research effort such as the studies of plant-pathogen interactions, the behaviourof microspores cultivated in vitro, ecological implications of flax breeding etc.AcknowledgementsThis paper was financially supported by the VEGA project 2/0005/08 (Use of proteomicand cellomic approaches to study embryo development in higher plants (Arabidopsis andflax).ReferencesBartošová, Z., Obert, B., Takáč, T., Kormuťák, A., Preťová, A. (2005): Acta Biologica Cracoviensia SeriesBotanica. 47/1, 173-178Bartošová, Z., Preťová, A. (2003): Induction of callogenesis in ovary and anther cultures of flax. Proceedingsof 10.sc.seminar. VURV. Piešťany. 25-28Bartošová, Z., Preťová, A., Masár, S (2006): Flax plants regenerated from unpollinated ovules cultured inovary segments. Acta horticulturea, 725, 869-871Burbulis, N., Blinstrubiene, A. (2006): Comparison on anther culture response among Linum usitatissimum L.cultivars and their hybrids. Acta universitatis latviensis. Biology. 710, 131-138Chen, Y., Dribnenki, P. (2002): Effect of genotype and medium composition on flax Linum usitatissimum L.anther culture. Plant Cell Reports, 21, 204-207Chen, Y., R., Lin, S., Duguid, S., Dribnenki, P., Kenaschuk, E. (2003): Effect of sucrose concentration onelongation of shoots from flax anther culture. Plant Cell Tiss. and Organ Cult., 72, 2, 181-183Obert, B., Bartosova, Z., Pretova, A. (2004a): Dihaploid production in flax by anther and ovary cultures.Journal of Natural Fibres, 1, 3, 1-14Obert, B. – Dedicova, B. – Hricova, A. – Śamaj, J. – Pretova, A. (2004b): Flax anther culture: effect ofgenotype, cold treatment and media. Plant Cell, Tissue and Organ Culture, 79, 2, 233-238Obert, B., Zackova, Z., Samaj, J., Pretova, A.(2009): Doubled haploid production in flax (Linum usitatissimumL.). Biotechnology Advances. 27, 4, 371-375Rutkowska-Krause, I., Mankowska, G., Lukasziewicz, M., Szopa, J. (2003): Regeneration of flax (Linumusitatissimum L.) plants from anther culture and somatic tissue with increased resistance to Fusariumoxysporum. Plant Cell Reports, 22, 2, 110-116Sun, H., Fu, W. (1981): Induction of pollen plants in flax (Linum usitatissimum L.) and preliminaryobservations on performance of their progenies. Acta Genetica Sinica, 8, 369-374480

Budapest, Hungary, 2011AGRISAFEESSENTIAL AMINO ACID CONTENTS OF WINTER ANDSPRING OAT CULTIVARS (AVENA SATIVA L.) GROWN INCENTRAL SOUTH BULGARIAP. ZOROVSKI 1 – T. GEORGIEVA 2Department of Plant Production, Faculty of Agronomy, Agricultural University,Plovdiv-4000, 12 “Mendeleev” str., Bulgaria,e-mail: 1 plivz@abv.bg; 2 tonia@au-plovdiv.bgAbstract The main purpose of this study was to investigate the content of essential amino acids in 4 winter(Dunav 1, Ruse 8, Resor 1, Line M-K) and 5 spring (Obraztsov chiflik 4, Mina, HiFi, Novosadski golozarnestand Prista 2) oat cultivars grown during a period of three years (2007-2009) in Central South Bulgaria.Thehighest contents of lysine (4.19 g/100 g protein) and leucine (8.01 g/100 g protein) were reported in cultivarDunav 1, while Line M-K had the highest contents of valine (5.20 g/100 g protein), threonine (3.80 g/100 gprotein) and phenylalanine (5.60 g/100 g protein). The spring cultivar HiFi was significantly superior to theother cultivars in terms of lysine (4.21 g/100 g protein) and valine (5.24 g/100 g protein).Key words: oat, Аvena sativa L., essential amino acid, lysine, methionine, leucine, valine, threonine,phenylalanine, isoleucineIntroductionOat cultivars are an important source of proteins in the foods people eat. However, theirquality is relatively low because the content of essential amino acids in them is limited,especially the one of lysine. Geneticists are facing the challenge to increase both the totalamount of proteins in the grain and the essential amino acids in their content. Lysine andmethionine are of special interest (Shewry, 2007).For example, the studies of Mitchell at al. (1932) show that the first amino acid, thequantity of which is small (limited) in oat protein is lysine. The author also adds that toestimate the nutritive qualities of oat proteins it must be found out which other aminoacids are limited in quantity. In another study, where seven cultivars had been used wasreported that the levels of amino acids in oat proteins are not enough to influence thegrowth (Hischke еt al., 1968). According to the authors, lysine is an essential amino acidof significant importance for the oat protein. The shortage of this amino acid influencesbadly the growth of the organism. Therefore, lysine is considered to be the amino acidwhich has been mostly studied in animals' food compared to any other amino acid(Baker, 2007; Biel at al., 2009).Each of the 8 essential amino acids influences human and animal organisms in a uniqueway. The genetic identity of their quantity in oat proteins provokes many studies withdifferent cultivars and lines.Materials and methodsFour cultivars of winter oats (Dunav 1, Ruse 8, Resor 1, Line M-K) and five cultivars ofspring oats (Obraztsov Chiflik 4, Mina (naked oat), HiFi, Novosadski golozarnest(naked) oat and Prista 2) were studied during 2006-2009 in an experimental field of thePlant Production Department at the Agricultural University of Plovdiv, Bulgaria. HiFicultivar is American (McMullen at al., 2005); Novosadski golozarnest oat is a Serbiancultivar; and the rest 6 cultivars together with Line 1 are from the Bulgarian selection.481

AGRISAFE Budapest, Hungary, 2011The field test was repeated four times as the winter cultivars were sown in mid-October(with 500 germinating seeds per sq.m.), and the spring cultivars - in mid-March (600germinating seeds per sq.m.). The fertilizers used were N 6 P 8 K 8.The laboratory analyses for the content of tested 7 essential amino acids have beencarried out in accredited laboratories through automatic amino analyzers – T 339 Munder the Moore and Stein Method.The statistical processing of the test data has been implemented by using SPSS V.9.0 forMicrosoft Windows.Results and discussionDuring the years of studies lysine has limitedly varied – from 4,05% in average for thecultivars in 2009 to 4,21% in 2008 (Table 1). There were not any statistically proveddifferences between the cultivars, yet the tested winter cultivars (Dunav 1, Line M-K,Resor 1, Ruse 8) tend to synthesize more lysine (Table 2). The spring cultivar HiFi,despite the tendency, is reported to contain the biggest amount of lysine (4,2%). Thesame cultivar characterizes with other important nutritive components (beta-glucans),which makes it especially appropriate to be used for food by people (Georgieva at al.,2010).Most methionine is synthesized in grain in 2007 - an average of 1,85 percent, while atleast - in 2008 – 0,63%. The Novosadski golozarnest and Prista 2 cultivars areconsidered to be best from the tested cultivars. Cultivars which contain the least amountof methionine are Obraztsov Chiflik 4 and HiFi. There is highly expressed negativecorrelation between the content of both essential amino acids (r= - 0,555*)(Table 3).The highest percentage of raw proteins in all cultivars (winter and spring ones) has theamino acid leucine - up to 8,08% averagely for HiFi cultivar, and 8,07% for ObraztsovChiflik 4. The leucine amino acid correlates positively with lysine (r=0,443*), andcorrelates negatively with methionine (r= - 0,824**).Valine has limitedly varied during the years of the study – from 5,04% in 2008 to 5,23%in 2007. The cultivars with highest levels of valine are HiFi and Line M-K, and thelowest level - Resor 1 and Mina. Valine has been proved to have positive correlationwith methionine.Averagely, the quantity of threonine amino acid in the different cultivars varies from 3,5to 3,8%. Line M-K and Mina top the list. Threonine and methionine are proved to be innegative correlation.Even thought the content of isoleucine does not differ a lot, cultivars have been provedto diverge. The cultivar assumed to be better than all the rest is HiFi – with 3,71%.Obraztsov Chiflik 4, Resor 1 and Dunav 1 are in the same category. Isoleucine andleucine are proved to have a positive correlative relations.Phenylalanine is also limited to variations - from 5,29% in Prista 2 to 5,61% in HiFi.There aren't any proved differences between the cultivars.The percentage distribution of essential amino acids is different for the cultivars. It ismainly defined by the genetically codified potential of the cultivar. These results confirmthe studies carried out by other authors who have used different cultivars (Pecora et al,1951).482

Budapest, Hungary, 2011AGRISAFETable 1. Quantity of essential amino acids divided by years for winter and spring oat cultivars forthe period of 2007-2009.Essential amino acids, g/100g proteinCultivars Lysine Methionine2007Leucine Valine Threonine Isoleucine PhenylalanineDunav 1 4,06 2,18 7,51 5,34 3,75 3,54 5,44Ruse 8 4,0 1,68 7,50 5,37 3,79 3,52 5,59Resor 1 4,09 2,77 7,55 5,21 3,66 3,53 5,13Line М-К 4,12 2,00 7,50 5,54 3,77 3,62 5,46Obraztsov chiflik 4 4,09 1,11 7,81 5,18 2,93 3,49 5,43Mina 4,08 1,83 7,43 4,90 3,73 3,22 5,21HiFi 4,36 1,49 7,90 5,42 3,18 3,68 5,56Novosadskigolozarnest 4,00 1,83 7,45 4,95 3,86 3,33 5,11Prista 2 4,04 1,73 7,41 5,19 3,25 3,49 5,242008Dunav 1 4,20 0,33 8,29 5,00 3,80 3,59 5,27Ruse 8 4,30 0,25 8,31 5,03 3,82 3,58 5,32Resor 1 4,13 0,59 8,27 4,93 3,78 3,66 5,52Line М-К 4,33 0,33 8,14 4,99 3,95 3,56 5,18Obraztsov chiflik 4 4,19 0,39 8,35 5,17 3,73 3,59 5,55Mina 4,23 0,73 8,04 5,27 3,88 3,59 5,33HiFi 4,19 0,50 8,21 5,20 3,59 3,71 5,57Novosadskigolozarnest 4,07 2,06 7,24 5,02 3,40 3,34 5,57Prista 2 4,25 0,44 8,38 4,79 3,87 3,32 5,222009Dunav 1 4,32 0,34 8,23 5,08 3,73 3,63 5,61Ruse 8 4,15 1,45 7,51 5,01 3,39 3,58 5,39Resor 1 4,27 0,43 8,03 4,86 3,87 3,60 5,53Line М-К 4,08 1,40 7,40 5,06 3,69 3,35 6,17Obraztsov chiflik 4 3,87 0,50 8,06 5,07 3,82 3,75 5,45Mina 3,95 0,62 8,13 4,84 3,80 3,44 5,40HiFi 4,07 0,32 8,12 5,11 3,80 3,73 5,69Novosadskigolozarnest 3,99 1,80 7,74 5,35 3,51 3,45 5,24Prista 2 3,74 3,10 7,73 5,40 3,33 3,54 5,40Table 2. Essential amino acids (g/100g) for oat cultivars - averagely, 2007-2009Cultivar Protein, Lysine Methio- Leucine Valine Threo- Isoleu- Phenylalanine%ninenine cineDunav 1 11,42 4,19 а 0,95 а 8,01 а 5,14 а 3,76 а 3,59 аb 5,44 аRuse 8 11,83 4,15а 1,13 а 7,77 а 5,14 а 3,67 а 3,56 abc 5,43 аResor 1 10,96 4,16 а 1,26 а 7,95 а 5,00 а 3,77 а 3,60 ab 5,39 аLine М-К 11,54 4,18 а 1,24 а 7,68 а 5,20 а 3,80 а 3,51 abc 5,60 аObraztsov chiflik4 12,91 4,05 а 0,67 а 8,07 а 5,14 а 3,49 а 3,61 аb 5,48 аMina 15,21 4,09 а 1,06 а 7,87 а 5,00 а 3,80 а 3,42 bc 5,31 аHiFi 13,16 4,21 а 0,77 а 8,08 а 5,24 а 3,52 а 3,71 а 5,61 аNovosadski goloz. 16,94 4,02 а 1,90 а 7,48 а 5,11 а 3,59 а 3,37 c 5,31 аPrista 2 13,26 4,01 а 1,76 а 7,84 а 5,13 а 3,48 а 3,54 bc 5,29 аFAO/WHO/UNU 5,8 2,5* 6,6 3,5 3,4 2,8 6,3***methionine + cysteine; **phenylalanine + tyrosine;483

AGRISAFE Budapest, Hungary, 2011Table 3. Correlative dependency between essential amino acids for oat cultivars for the period of 2007-2009.Essentialamino acidsLysine Methionine Leucine Valine Threonine Phenylalanine*, **Correlation is significant at the 0,05 and 0,01 levelIsoleucineLysine 1,000 -0,555** +0,443* -0,194 +0,178 +0,018 +0,200Methionine 1,000 -0,824** +0,515** -0,422* -0,152 -0,380Leucine 1,000 -3,17 +0,363 -0,035 +0,494**Valine 1,000 -0,372 +0,124 +0,343Threonine 1,000 -0,073 +0,040Phenylalanine 1,000 +0,208Isoleucine 1,000ConclusionsThe genetic uniqueness of the content of essential amino acids in the grains of oat wasconfirmed through our study. Dunav 1 (standard for Bulgaria), from winter cultivars,contains the most amount of lysine (4,19%) and leucine (8,01%). The new Line M-K'scontent of lysine (4,18%) is close to the Dunav 1’s amount, and it is the cultivar withhighest level of valine (5,20%), threonine (3,80%) and phenylalanine (5,60%).The American HiFi cultivar is the leader from the spring cultivars as regards the testedessential amino acids. It has the highest level of lysine (4,21%), leucine (8,08%), valine(5,24%) , isoleucine (3,71%) and phenylalanine (5,61%).Novosadski golozarnest cultivar has the highest level of methionine (1,90%), and theBulgarian Mina hulless cultivar has the highest level of threonine (3,80%).Strong positive correlative dependencies have been reported between lysine and leucine,methionine and valine; and leucine and isoleucine. Negative correlation have been foundout between methionine and lysine, methionine and leucine, methionine and treonine.ReferencesBaker, D. (2007): Lysine, arginine, and related amino acids: An introduction to the 6 th amino acid assessmentworkshop 1-3 . J. Nutr. 137, 1599S-1601S.Biel, W., K. Bobko and R. Maciorowski. (2009): Chemical composition and nutritive value of husked andnaked oats grain. Journal of Cereal Science, 49, Issue 3, 413-418.FAO/WHO/UNU (1985): Energy and protein requirements. FAO/WHO Nutrition Meetings. Food andAgriculture Organization/World Health Organization, Report Series 724.Georgieva, T., P. Zorovski, P. Taneva, V. Gotcheva. (2010). Grain β-glucan content of oat grown in SouthBulgaria. I. Oat grain β-glucan cntent as affected by genotype and year, Scientific works of AU, т.LV, 1.225-230.Hischke, H., G. Potter, and W. Graham. (1968): Nutritive value of oat protein. I. Varietal differences asmeasured by amino acid analysis and rat growth responses. Cereal Chemistry, 45, No. 3, 374-378McMullen M.S., D.C. Doehlert and J.D. Miller. (2005): Registration of ‘HiFi’ Oat Crop Sci. 45,1664.Mitchell, H., and D. Smuts. (1932): The amino acid deficienceies of beef, wheat, corn, oats, and soy beans forcrowth in the white rat. 263-281.Pecora, L. J. , and D. B. Smuts. (1951): Nutritional improvement of white polished rice by the addition oflysine and threonine. J. Nutrition, 44: 101-112.Shewry, Peter R. (2007): Improving the protein content and composition of cereal grain. Journal of CerealScience, 46, Issue 3, 239-250.484