Jul-Sep, 2011 - Indian Journal of Pharmacy Practice

Dear Readers,Indian Journal of Pharmacy PracticeijoppEditorialGreetings of the season!As we all know, community pharmacy is the last and important point of contact for the patients and hence is agood medium through which patient awareness can be brought about regarding rational use of medications.Although community pharmacists are still traders in most parts of our country, there are atleast few of themwho are providing patient care services like patient counseling and drug information.ADR monitoring has been initiated and carried out by few community pharmacies in India.Any change in the system can be brought about by public awareness and change of regulations. Since,creating public awareness is in our hands, our PG students can take up projects in community settings, sothat patient community will be made aware of the concept of pharmacovigilance, drug interactions and soon.By the time this issue reaches your hands, some of you might have returned just after attending FIP,Hyderabad, the world congress, a mega event this time organized in our country. You can share yourexperience of FIP and benefits of attending FIP congress through “letter to editor”.With APTI convention also coming up in October, it is a good opportunity for academic researchers tointeract with the other co-researchers. ijopp will also be giving best paper award for two articles publishedone each in the area of clinical pharmacy and community pharmacy for the year 2010. For the details of thewinners, do attend the APTI convention and await the release of next issue of ijopp!With warm regards,Dr. Shobha Rani R Hiremathwww.ijopp.org | ijopp@rediffmail.com

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaIndia's Progress towards the health related Millennium Development Goals–Malaria and Tuberculosis1,2,6, 1,2,6,* 3 4 1,2,5,6I. Patel , J. Chang , J. Srivastava , I. Patel , R. Balkrishnan1Clinical, Social and Administrative Sciences, College of Pharmacy, University of Michigan at Ann Arbor, 428 Church Street, Ann Arbor, MI48109-1065, USA2Center for Medication Use, Policy, and Economics, The University of Michigan, 428 Church Street, Ann Arbor, MI 48109-1065, USA3E.W. Scripps School of Journalism, Ohio University, 220 Scripps Hall, Athens,OH, 45701-2979, USA4Patel Hospital, Somnath Park, Panchavati, Nasik, Maharashtra 422003, India5Department of Health Management and Policy, The University of Michigan, 428 Church Street, Ann Arbor, MI 48109-1065, USA6Center for Global Health, The University of Michigan, 428 Church Street, Ann Arbor, MI 48109-1065, USAA B S T R A C TSubmitted: 19/7/2011Accepted: 2/8/2011Malaria and TB are two of the key diseases being targeted for prevention and eradication by United Nation's MDGs. Prevalence of thesediseases in India has a strong impact on overall prevalence of these diseases worldwide; India contributes to around 30% of TB casesand around 74% of malaria cases are reported from south east Asia with India being the most populous in this region. These diseases have beenthe target of domestic and international heath initiatives since a long time and the positive impacts of these initiatives are reflectedin the decrease of prevalence rates in these diseases. However, new challenges are also being faced in form of drug resistant strains, lack ofaccess to some vulnerable populations and possible inaccuracies in reporting and measurement of prevalence data andeffectiveness of previous campaigns. This study reviews the health initiatives and the environment in which these initiatives are executed,analyses the results and data from these campaigns, and provides recommendations for future initiatives in light of the observations from theseanalysis.Keywords: malaria, TB, DOTS, MDGs, India.BACKGROUNDAlong with HIV/AIDS, MDG 6 also aims to halt and reversethe incidence of malaria and other major diseases (esp.Tuberculosis) by 2015.Malaria:Malaria is endemic to India, and anti-malaria programs have1been implemented throughout the country since 1953 . Overthe past half a century, management and containment of1,2malaria has improved rapidly . The indicators selected tomeasure this target were measuring the prevalence and deathrates linked to malaria and % of people in malaria risk areas3,4,5using malaria prevention and treatment measures .Address for Correspondence:Chang J, Clinical, Social and Administrative Sciences, College of Pharmacy, University ofMichigan at Ann Arbor, 428 Church Street, Ann Arbor, MI 48109-1065, USAE-mail: jochang@umich.edu, isha@umich.eduPast measures:Also, according to the 2005 MDG Report, the annual parasiteincidence per 1,000 persons has decreased from 2.57 in 1990to 1.75 in 2004. Although the incidence went down, thedeaths increased from 353 in 1990 to 943 in 2004, and thedeath per 100,000 in the population also increased from 0.05to 0.09. One possible explanation is that strains of theplasmodium have become resistant to Chloroquine, the drugof choice to treat patients with malaria6,7. In one studyconducted in 1996, the researchers found that P. Vivax did notrespond at all to Chloroquine. Additionally, P. Falciparum is1now Chloroquine resistant . This corresponded with anincrease in both the incidence rates and deaths, with theincidence reaching as high as 3.48, and deaths reaching 1,151,between 1995 and 1996. It appears that the drug resistantform had huge consequences on treatment, incidence, andmortality.However, since 1995, new prevention andIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 1

Patel I - India's Progress towards the health related Millennium Development Goals –Malaria and TuberculosisDengue infection further complicates the management of the8,11,14vector control program . According to the 2005 IndiaMDG Report, 95% of the country lives in areas were malariais endemic, and some of those areas are extremely rural, hillyand difficult to access, if accessible at all. This has been amajor health challenge in the past and will continue to be anissue in the future. Additionally, obstacles to educating ruralcommunities exist due to lack of technology such astelevisions and radios. Other future issues include lack ofearly diagnosis, increasing and timely access to care, poorlyinformed healthcare practitioners, ineffective primaryhealthcare system and proper management of all vectorbreeding areas. Presence of structural barriers likedisplacement due to dam constructions, slum evictions,unplanned expansion of irrigation might lead to waterlogging, vector breeding, creation of new water bodies andincreased risk of malaria in areas previously unaffected by the3,14,15,16, 17,18,19disease .Recommendations:Recommendations of where to focus future work includestrengthening the strategies being used by the health systemon multiple levels rather than focusing on one, focusingdirectly on the challenge of vector control in both urban andrural settings, and creating more effective educate methodsfor rural communities. Procurement of more effective andnewer anti malarial drugs has become urgent in the wake ofemergence of resistant strains causing malaria. Efficienthealthcare system with adequate funding needs to be in placewhich enables early diagnosis and community based rational20,21,22,23treatment of malaria .Tuberculosis (TB):According to the MDG report of 2005, tuberculosis (TB) wasnot monitored nationally before 2000, and only regionalsurveys were conducted. As a result, there is limited dataabout TB between the 1990 and 2000. However, according tothe MDG mid appraisal 2009 report, India accounts for thelargest number of TB cases in the world amounting to about30% of the global TB burden. TB infects about 2 people every3 minutes and about 2 million people every year and accountsfor about 4,00,000 annual deaths. The total number of patientssuffering from pulmonary TB are estimated to be about 1724,25,26million . The indicators selected to measure this targetwere measuring using the directly observed treatment short3,27course (DOTS) .Fig. 3: TB incidence, prevalence and death rate in India:finding from 1990-2008Past measures:The National Tuberculosis Program which was introduced in1962 considered TB as a problem of suffering and integratedits treatment with the general health services. Hence thesuccess of this multi sectoral program was largely based onthe success on the general health system. The NTP could notachieve the targeted success due to more focus on othergeneral public health programs like family planning and theimmunization programs (8,14,28). Additionally, India begana trial run of DOTS implementation in 1993, and then began3implementing it fully in 1997 . More recently, the number ofTB cases have decreased from these initial estimates. A morerecent study conducted by Khatri & Freiden (2002)demonstrated the true success of DOT in India. Theseresearchers found that with the implementation of these newpolicies and measures in 1993 there have been standardizedreporting methods, improved diagnosis techniques, and29increased resources availability . Additionally, the programhas increased the number of people who received treatment.For example, 3.4 million people were tested for TB, and about800,000 received treatment and had a high success rate.Present measures:The MDG country report for 2005 shows that 85 diagnosedTB cases were found per 100,000 prior to the year 2000,however, between the years of 2000 and 2005, this decreasedto 75. According the same report, India is currently using theDOTS program. Since the last 12 years, the Revised NationalTuberculosis Control Program (RNTCP) has also beenadopted. However, with the advent of 23 million new TBcases in the past 12 years, only 10 million cases are beingtreated under RNTCP. The major reasons leading to thisIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 3

Patel I - India's Progress towards the health related Millennium Development Goals –Malaria and Tuberculosisunder treatment are lack of awareness among the patientsabout the availability of services covered under the RNTCP,treatment diversion towards private sector, lack of access toinformation among physicians and lack of training amongphysicians leading to disparity in proper disease management8,14,30.Fig. 4: TB management in India over the years: 1994-2007Recommendations:Multiple areas require focus in the future. The increase inMDR and XDR TB can be attributed to improper prescriptionadherence on the part of patients; therefore, part of the focusshould include education of the public about the importanceof proper drug regimen. RNTCP also needs to provide easyand subsidized access to care for MDR-TB patients in order toprevent the patients from seeking unaffordable care from theprivate sector and preventing further emergence of theresistant MDR-TB or XDR-TB strains. HIV/AIDS is linkedto TB which increases the overall disease burden. Eventhough the cure rates for TB are improving, many people aredying due to lack of access to high quality care and lack of8,10ART . Additionally, there needs to be better access togeneral healthcare, and general expansion of the program,31,32,33which will require increased funding .CONCLUSIONDonor role:Many of the programs used to treat TB in India are funded bythe World Bank, as well as Danish and United Kingdom basedagencies. Specifically, the Global Fund finances programs tofight against AIDS, TB, and Malaria worldwide. Thesustainability of India's current programs is heavily29dependent on the continuation of international aid .Major challenges:Although the programs have showed high initial successrates, there are multiple challenges in the future. The successof the DOTS therapy has recently been questioned sincerecent studies have shown that people without permanentaddresses and migrants who really need care are being giveninappropriate care or are being denied treatment under theDOTS program. So it is possible that the success of the DOTSprograms is largely based on the selection of “better” patients.Due to the lack of regulation among private providers, there isno standardization of TB treatment regimens in the privatesector (16,27,29). Multi-Drug-Resistant TB (MDR-TB) andExtreme-Drug-Resistant TB (XDR-TB) are increasingthroughout the world including India- threatening the successrates of current treatment methods. According to the 2007data, India has about 1,31,000 cases of MDR-TB which is thehighest in the world. The current short course treatment isineffective in case of MDR-TB with only 60% success rateand about 10 times more expensive compared to the current11,14therapy .The review and discussion presented in previous sectionshighlight the need for consistent effort on both medical andadministration/delivery front. Drug resistant forms for bothMalaria and TB indicate that drug development has to be anongoing process which also needs to focus oncost effective product development. To be aware of the newforms of diseases, the drug development initiative needs tohave a liaison with the campaign administration arm so thatresponse time to new drug resistant forms can be reduced. Atthe campaign administration level, better measurement ofprevalence and effectiveness data is required so that moreefficient allocation of resources can take place. Anothermeasurement related key issue is study and recording ofdemographic and behavioral aspects of highly vulnerablepopulations which may help in making the campaigns moreeffective.REFERENCES1. WHO Regional Office for South-East Asia. MalariaC o u n t r y P r o f i l e : I n d i a ( 1 9 9 5 - 2 0 0 7 ) .http://www.whoindia.org/EN/Section3/Section128.htm[accessed 30 March 2009]2. WHO. WHO Report 2007: Global Tuberculosis Control( S u r v e i l l a n c e , P l a n n i n g , F i n a n c i n g ) .http://www.wpro.who.int/media_centre/fact_sheets/fs_20060829.htm [accessed 20 December 2010]3. Central Statistical Organization (2005). MillenniumDevelopment Goals - India Country Report 2005.Government of India http://www.mospi.nic.in[accessed 18 March 2009]Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 4

Patel I - India's Progress towards the health related Millennium Development Goals –Malaria and Tuberculosis4. Thakor HG, Sonal GS, DhariwaL AC, Arora P, & GuptaRK (2010) Challenges and role of private sector in thecontrol of malaria in Indica. J Indian Med Assoc 208,849-853.5. Arora P, Sonal GS, Thakor HG, & Dhariwal AC (2010) Asuccess story: sharing experiences Of implementing theglobal fund supported intensified malaria control project(IMCP). J Indian Med Assoc 208, 846-848.6. Dua VK, Kar PK & Sharma VP (1996) Chloroquineresistant plasmodium vivax malaria in India. TropicalMedicine and International Health 1, 816-819.7. Sonal GS, Thakor HG, Joshi C, Arora P, Gupta RK, &Dhariwal AC. Epidemiological status of malaria andscaling up of interventions in india. J Indian Med Assoc208, 840-843.8. Central Statistical Organization (2009). MillenniumDevelopment Goals- India Country Report 2009. Mid-Term Statistical Appraisal. Government of India.http://www.mospi.nic.in [accessed20 December 2010].9. Wada Na Todo Abhiyan (2007). Measuring India'sProgress on the Millennium Development Goals. ACitizens' Report. http://www.endpoverty2015.org/en/asianews/india-citizens- report-mdgs-released/07/jan/08. [accessed on 20 March 2009].10. United Nations (2008) The Millennium DevelopmentGoals Report, 2008 United Nations Department ofEconomic and Social Affairs. New York, 2008s.11. United Nations (2010) The Millennium DevelopmentGoals Report, 2010 United Nations Department ofEconomic and Social Affairs. New York, 2010s.low%20res%2020100615%20-.pdf. [accessed on 20December 2010].12. Kumar A, Dua VK, & Rathod PK (2011) Malariaattributeddeath rates in India. Lancet 377, 991-995.13. NVBDCP (2009) Directorate of National Vector BorneDisease Control Programme. Government of India.http://nvbdcp.gov.in/malaria-new.html [accessed on 20December 2010.14. Wada Na Todo Abhiyan (2010). MillenniumDevelopment Goals in India,2010- A Civic SocietyReport. http://asiapacific.endpoverty2015.org/files/mdgs-report-finaal.pdf. [accessed on 20 December2010].15. Bompart F, Kiechel JR, Sebbag R, & Pecoul B (2011)Innovative public-private partnerships to maximize thedelivery of anti-malarial medicines: lessons learnedfrom the ASAQ Winthrop experience. Malar J 10, 143.16. Shah NK, Dhillon GP, Dash AP, Arora U, Meshnick SR,& Valecha N (2011) Antimalarial drug resistance ofPlasmodium falciparum in India: changes over time andspace. Lancet Infect Dis 11, 57-64.17. Goodman C, Brieger W, Unwin A, Mills A, Meek S &Greer G (2007) Medicine Sellers and Malaria Treatmentin Sub-Saharan Africa: What Do They Do and How CanTheir Practice Be Improved? Am J Trop Med Hyg77(Suppl 6), 203-218.18.Breman JG, Alilio MS, & Mills A (2004) Conquering theintolerable burden of malaria: A summary Am J TropMed Hyg 71(Suppl 2), 1-15.19. Nájera JA (2001) Malaria control: achievements,problems and strategies. Parassitologia 43, 1-89.20. Lal S, Lahariya C, & Saxena VK (2010) Insecticidetreated nets, antimalarials and child survival in India.Indian J Pedatri 77, 425-430.21. Nájera JA (2001) Malaria control: achievements,problems and strategies. Parassitologia 43, 1-89.22. Kmietowicz Z (2000) Control malaria to help defeatpoverty, says WHO. BMJ 320, 1161.23. Das Gupta RK, Thakor HG, Sonal GS, & Dhillon GP(2009) New perspectives of malaria control in Indiaunder World Bank Project. J Indian Med Assoc 107, 870,879-80, 882-3. 24: Dye C, Bourdin Trunz B, Lönnroth K,Roglic G, & Williams BG (2011) Nutrition, diabetes andtuberculosis in the epidemiological transition. PLoS One6, e21161.25. Lal SS, Uplekar M, Katz I, Lonnroth K, Komatsu R,Yesudian Dias HM, & Atun R (2011) Global Fundfinancing of public-private mix approaches for deliveryof tuberculosis care. Trop Med Int Health 16, 685-692.26. Kelkar-Khambete A, Kielmann K, Pawar S, Porter J,Inamdar V, Datye A, & Rangan S (2008) India's RevisedNational Tuberculosis Control Programme: lookingbeyond detection and cure. Int J Tuberc Lung Dis 12, 87-92.27. Murali MS, & Sajjan BS (2002) DOTS strategy forcontrol of tuberculosis epidemic. IndianJ Med Sci 56,16-18.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 5

Patel I - India's Progress towards the health related Millennium Development Goals –Malaria and Tuberculosis28. Sheikh K, Porter J, Kielmann K, & Rangan S (2006)Public-private partnerships for equity of access to carefor tuberculosis and HIV/AIDS: lessons from Pune,India. Trans R Soc Trop Med Hyg 100, 312-320.29. Khatri GR & Frieden TR (2002) Controlling tuberculosisin India. The New England Journal of Medicine 347,1420-1425.30. Frieden TR (2002) Can tuberculosis be controlled? Int JEpidemiol 31, 894-899.31. Ogden J, Rangan S, Uplekar M, Porter J, Brugha R, ZwiA, & Nyheim D (1999) Shifting the paradigm intuberculosis control: illustrations from India. Int JTuberc Lung Dis 3, 855- 861.32. Wise J (1998) WHO identifies 16 countries struggling tocontrol tuberculosis. BMJ 316, 957.33. Sandhu GK (2011) Tuberculosis: current situation,challenges and overview of its control programs in India.J Glob Infec Dis 3, 143-50.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 6

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaChemotherapy-induced Nausea and Vomiting and Its Management*Hitendra SM , Shivsagar RR.C. Patel Institute of Pharmaceutical Education and Research ShirpurA B S T R A C TSubmitted: 6/8/2011Accepted: 11/8/2011Nausea and vomiting remains a significant adverse effect experienced by 70-80% patients receiving chemotherapy which can result insignificant morbidity. Chemotherapy-induced nausea and vomiting (CINV) adversely affects patients' quality of life, often leading to poorcompliance with the treatment regimen and serious metabolic complications. Several drugs are available to prevent and treat CINV. Olderagents include antihistamines, phenothiazines, corticosteroids and 5-HT3 receptor antagonists. Recently the nk1 receptor antagonistaprepitant was introduced for use in combination with other drugs. These drugs can prevent acute emesis where as prevention and treatment ofdelayed and anticipatory emesis remains a challenge.Keywords: chemotherapy, nausea and vomiting, emesis, antiemetics, cancer chemotherapyINTRODUCTIONChemotherapy induced nausea and vomiting (CINV) remainsa significant side effect, has been shown by most of patientsreceiving chemotherapy. The symptoms vary from slightnausea to protracted vomiting. Nausea and vomiting thatlasts long time can cause dehydration and may lead to low BP,muscle spasm, cramps. There are number of patient related1and other factors which affect the emesis . Studies havedemonstrated that CINV has serious impact on the dailyfunctions and quality of life of patients.Patients treated with chemotherapy may experience acute,delayed and anticipatory emesis. Recent progress has beenremarkable but CINV remains to be a major problem sincemany patients experience the side effects. Preventing CINVis more effective than treating it. Recently there are number ofantiemetic drugs are used to prevent CINV. Generally theantiemetic therapy should be selected on the basis ofemetogenic potential of the chemotherapeutic agents. Thechoice of antiemetic therapy is vital for preventing thesesymptoms and enhancing the patient compliance.Factors affecting emesis:Ÿ Drugs given: Cytotoxic antineoplastic agents vary greatlyin their potential to induce emesis and in the severity of theAddress for Correspondence:Dr. Hitendra S Mahajan, Department of Pharmaceutics, R. C. Patel Institute ofPharmaceutical Education & Research, Near Karvand Naka, Shirpur-425405, Dist: Dhule,Maharashtra, India.E-mail: hsmahajan@rediffmail.comside effect. Different investigators have categorized specificcytotoxic chemotherapeutic agents as having a high,1moderate or low potential for inducing emesis .Generally an agent that causes emesis in more than 30 to 90%ofpatients are considered to be have moderate to highemetogenic potential, whereas those with less than 30 to 10 %are considered to have low to minimal potential.Ÿ Patient specific factors: An individual patient shows thedifferent degree of emesis, after receiving the chemotherapy.The patient's specific factors play an important role inpredicting the risk for CINV.These include –Ÿ Age: Patients younger than 50 years old are morelikely to have emesis with the same agent or agents.Ÿ Sex: Women experience more chemotherapy inducedemesis than men. The reason for this is uncertain; it may bebecause women are more likely to receive combinationchemotherapy particularly in conditions like breast cancer.Ÿ History of alcohol use: Patients with light drinking habitare more likely to become nauseous from chemotherapy thanpatients with chronic alcohol intake, particularly with highlyemetogenic agents such as cisplatin.Ÿ Motion sickness or anxiety: The patients which areprone to motion sickness or anxiety have greater risk.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 7

Hitendra SM - Chemotherapy-induced Nausea and Vomiting and Its ManagementHigh risk(>90%Frequency)AltretamineCarboplatinCarmustine2(>250mg/m )Cisplatin2(>50mg/m )cyclophosphamide2(>1500mg/m )DacarbazineDoxorubicin(oral)MechlorethamineProcarbazineStreptozocinTable 1: Emetogenic potential of antineoplastic agentsModerate riskLow risk(30-90% frequency) (10-30% frequency)AldesleukinAmifostineBusulfanCarmustine2(

Hitendra SM - Chemotherapy-induced Nausea and Vomiting and Its ManagementFig. 1: Responsible neurotransmission pathways for CINVChemotherapySerotonin release fromenterochromaffin cellsGI tract5- HT NK13,CTZ activation5-HT , D , NK1, M3 2CortexNucleus tractus solitarius5-HT , D , H, NK1, M3 2Activated vomiting centerIncreased efferent outputto CNS centers: SalivateryRespiratory VasomotorCINV receptors5-HT 3 = serotonin type 3H = histamineD2= dopamine type 2NK1 = neurokinin type1M = muscarinicAbdominal musclesDiaphragmStomachEsophagus1. Chemotherapy stimulates CTZ directly.2. Chemotherapy stimulates enterochromaffin cells in theGI tract to release serotonin. The released serotonin activates5-HT receptors in 3 areas: vagal afferents in the GI tract,3NTS and the CTZ.3. Dopamine (2), histamine and neurokinin-1 receptors arestimulated and impulses feed into the VC.4. When threshold is reached in the VC, nerve impulses arecarried by efferent nerves to stimulate emesis.Types of chemotherapy-induced emesisClinically there are three distinct forms found in patientsreceiving chemotherapy. There is difference inpathophysiological process and inciting events of each form.Accordingly specific treatment strategies are appliedAcute emesis: chemotherapy-induced emesis is consideredacute if it begins within first 1 to 2 hours after the start ofchemotherapy, it may persist up to several hours. Theneurophysiology of acute emesis is often characterized bysingle or multiple episodes, with brief experiences of nausea3prior to the vomiting .Different chemotherapeutic agent shows the difference in2severity of acute emesis. Cisplatin in doses of 50-120 mg/m ,shows peak emetogenic effect at approximately 4 hours afteradministration. The release of serotonin from theenterochromaffin cells has been demonstrated because a peakin the urinary metabolites of serotonin (5-HIIA) occurs afterCisplatin administration. Cyclophosphamide in dose > 1,500mg/m2 causes peak effect approximately 10-12 hours after4administration and can last up to 72 hours . This may bebecause of the conversion of the cyclophosphamide tometabolites that have emetogenic properties.Mechlorethamine induces emesis within 30 minutes ofadministration suggesting that this agent is directly stimulates4vomiting center .Prevention is better than treatment:The prevention of acute emesis is more effective thantreatment of established nausea and vomiting. There can be asignificant lowering of the incidence of severe acute emesis,by giving antiemetic drugs prior to chemotherapeutic agents.But it is very hard to stop nausea and vomiting once theybegun. Once the acute emesis is prevented or minimized,ultimately there is decrease in the incidence and severity ofboth delayed and anticipatory emesis. Currently availableantiemetic drugs achieve great success in preventing acuteemesis than delayed and anticipatory emesis. The standardtherapy for acute emesis is shown in the table 2.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 9

Hitendra SM - Chemotherapy-induced Nausea and Vomiting and Its Managementcaused by agents with high potential for toxicity. (Cisplatin6based regimens).In addition Corticosteroids used alone are effective inprevention of emesis produced by agents with low orintermediate potential for toxicity eg. Cyclophosphamide7based regimen. . The adverse effect profile of corticosteroidsis consider being acceptable and includes insomnia,indigestion, headache, agitation, increased appetite andweight gain. The last two effects may have some therapeuticbenefit in cancer patients who have lost their appetite or whoare loosing weight at an uncontrollable rate.Nk1 receptor antagonist:Substance P is a potent tachykinin which acts at theneurokinine-1 (NK1) receptors. NK1 receptors aredistributed in large number on GI tract, the CTZ and the NTS.In combination with other antiemetics it is indicated for theprevention of acute and delayed emesis associated withhighly emetogenic cancer chemotherapy including high dosecisplatin.Aprepitant is unique drug in this category, which act onvomiting center to prevent nausea and vomiting due tochemotherapy. It blocks the action of substance P, whichtrigger nausea and vomiting reflexes. Adverse effects withaprepitant appear to be fairly minor including headache,abdominal pain, dizziness and hiccups. No adverse effect hasbeen noted in clinical trials of aprepitant when added to aregimen of dexamethasone and ondansetron compared with acombination of ondansetron and dexamethasone alone.Aprepitant has effects on cytochrome P450 enzymesparticularly CYP3A4 and CYP2C9 so it may interact withdrug which acts as substrate for these isoenzymes. Inparticular, the dose of dexamethasone, CYP3A4 substrateshould be reduce by 50% when co-administered withaprepitant.Benzamides analogs:Metoclopramide is the most commonly used benzamideanalog. It appears to have an antiemetic effect due to itsantagonism of central and peripheral dopamine receptors. Athigher doses it acts as a 5-HT 3 antagonist, howevermetoclopramide is not effective as monotherapy in thetreatment of acute and delayed emesis.The combination ofdexamethasone and metclopramide has efficacy equivalent tothe ondansetron monotherapy. Adverse effects associatedwith metoclopramide include sedation, acute dystonia andakathesia.Phenothiazines:Prochlorperazine is the most common phenothiazines, usedfor the management of acute emesis. Phenothiazines blockdopamine D and 5-HT receptors in the CTZ as well as having2 3weak antimuscarinic and histamine blocking activity.The phenothiazines are moderately effective in emesisresulting from chemotherapeutic agents. Side effects ofphenothiazines are similar to those caused bymetoclopramide and are mainly exrapyramidal effectsincluding tardive dyskinesia.Butyrophenones:Haloperidol is the main butyrophenones and is used in thetreatment of acute and delayed emesis. It acts by blockade ofD2 receptors in CTZ and has similar adverse effect profile asthe phenothiazines. The efficacy of haloperidol is less ascompared to the metoclopramide.Olanzapine, an atypical neuroleptic, is showing promise inthe treatment of CINV in patient receiving moderately andhighly emetogenic chemotherapy. Trial using olanzapine incombination with dexamethasone and 5HT3 receptorantagonist have demonstrated the effectiveness of thiscombination in controlling both acute and delayed emesis.Olanzapine has a mixed activity at the dopamine, histamineand 5HT3 receptors.Benzodiazepines:Lorazepam and midazolam can be particularly useful when asadjunct treatment in certain circumstances. Lorazepam isoften added antiemetic regimen for its antianxiety effects,minimizing anticipatory emesis in chemotherapy patients.However it does not demonstrate sufficient antiemeticactivity to be used as monotheropy. Therefore, it is oftenadded to optimum therapy to improve the management ofagitated patients.Cannabinoids:Nabilone is the only synthetic derivative oftetrahydocannabinol, used for CINV. The mechanism ofaction is thought to be action at the Cannabinoids (CB 1)receptor, modulation of 5-HT3receptor activity in the CNSand substance p release from the spinal cord.Several clinical trial studies shows that Nabilone is moree ff e c t i v e a n t i e m e t i c s t h a n p r o c h l o r p e r a z i n e ,metachlorpropamide and haloperidol but potential seriousadverse effects even short term orally or IM are likely to limit8their widespread .Other drugs:Propofol: The study was carried by Corey S. Scher et.alshows that the use of propofol is effective in prevention ofchemotherapy induced nausea and vomiting in oncologypatients. It has been speculated that propofol may haveIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 11

Hitendra SM - Chemotherapy-induced Nausea and Vomiting and Its Management.4intrinsic antiemetic properties A bolus of 0.1 mg/kg followedby a continuous infusion of 1 mg/kg per hr. is effective in both9prevention and treatment of CINV.Antiemetic therapy for acute chemotherapy-inducedemesis:Management of delayed chemotherapy induced emesis.The currently available therapy for prevention or treatment ofdelayed chemotherapy induced emesis is unsatisfactory sodelayed emesis presents the greater challenges to theclinician.The exact etiology of delayed nausea and vomitingis not known. Several hypotheses for delayed emesis havebeen suggested including the drug metabolites or cell death bya product which stimulates sites responsible for emesis.The agents such as carboplatin, cisplatin, cyclophosphamide,10and doxorubicin exhibit a consistent delayed emesis effect.Cisplatin has most pronounced effect of nausea and vomiting.This is especially when given in large dose ofmulticomponent regimens. The corticosteroid such asdexamethasone is effective in managing delayed emesis by asunknown mechanism. Further corticosteroids potentiate theeffects of serotonin antagonists in the management of delayedemesis. Serotonin antagonist such as Dolasetron,Ondansetron are generally prescribed with dexamethasone.Recently Aprepitant shows promising effect in preventingdelayed emesis, particularly due to highly emetogenicchemotherapeutic agent such as cisplatin.CONCLUSIONNausea and vomiting associated with cancer chemotherapycan result in significant morbidity, adversely affect a patient'squality of life and lead to poor compliance with treatmentregimen. Treatment of CINV remains a challenging aspect ofmanaging chemotherapy. Different studies prove thatpatients receiving chemotherapy should be treatedpreferentially with the highest therapeutic index from threeclasses: 5-HT3 receptor antagonists, corticosteroids and NK1receptors antagonists. These agents are effective, have fewsignificant adverse effects and can be administered safely incombination. The low therapeutic index drugs includephenothiazines, butyrophenones, benzodiazepines,benzamides and Cannabinoids. These drugs are not effectiveas that of the high therapeutic index drugs, but they are usefulin the management of chemotherapy-induced emesis.REFERENCES1. Lonnidis JP, Hesketh J, Lau J. Contribution ofdexamethasone to control of chemotherapy-inducednausea and vomiting: A meta analysis of randomizedevidences. J clin oncol. 2000;18:3409-34222. Gralla RJ, Grunberg SM, Carolyn M. Coping with nauseaand vomiting from chemotherapy. www.cancercare.org.3. Bhatia A, Sharma M, Tripathi KD. Efficacy andtolerability of ondansetron verses metoclopramide bothcombined with dexamethasone, in prevention ofcisplatin-induced delayed emesis. Indi J Med Res.2004;120:183-193.4. Scher CS, Amar D, McDowall RH, Barst SM. Use ofpropofol for the prevention of chemotherapy-inducednausea and emesis in oncology patients. CAN JANASETH. 1992;39(2): 170-172.5. Develin J, Wagstaff K, Arthur V, Emery P. Granisetron(Kytril) suppresses methotrexate-induced nausea andvomiting among patients with inflammatory arthritis andis superior to prochlorperazine (Stemetil). Rheumatology1992;38:280-282.6. Tomioka S, Kurio T, Takaishi K, Nakajo N. Propofol iseffective in chemotherapy-induced nausea and vomiting:A case report with quantitative analysis. Anesth Analg.1999;89:798-799.7. Tramer MR, Carroll D, Cambell FA, Moore RA et al,.Cannabinoids for control of chemotherapy-inducednausea and vomiting: quantitative review. BMJ.2001;323:1-8.8. Neese RM, Carli T, Curtis GC, Kleinman PD.Pretreatment nausea in cancer chemotherapy: Aconditioned response? Psychosomatic Medicine.1980;42:33-36.9. Naveri RM, Kaplan HG, Gralla RJ et al,. Efficacy andsafety of granisetron, a selective 5-HT receptor3antagonist, in prevention of nausea and vomiting ininduced by high dose cisplatin. J clin oncol.1994;12:2204-2210.10. Kimberly AN, AOCN. The impact of chemotherapyinducednausea and vomiting on the daily function andquality of life of patient's Adv. stud. Nurs. 2005;3(1):16-21.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 12

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaPharmacoeconomics – Indian Scenario1 2 1 3Binai K S , Suja A* , Lakshmi R , Sarawathi R1Amrita School of Pharmacy, AIMS Ponekkara PO, Kochi2Research scholar, Karpagam university, Tamil Nadu3Al Shifa College of Pharmacy, Perinthalmanna, KeralaA B S T R A C TSubmitted: 28/7/2011Accepted: 5/8/2011Steady increase in the number of diseases and the number of treatments has increased patient sensitivity towards cost. This has necessitated amethod that can effectively compare the cost and the consequence of a treatment method, has led to the introduction of Pharmacoeconomics.Pharmacoeconomics is a description and analysis, of the costs and consequences of pharmaceuticals and pharmaceutical services and theirimpact on individuals, healthcare systems and society. This should ideally form the basis of the Hospital formulary system, and is often used as atool by insurance agencies to decide on what to fund and what not to. Globally, Pharmacoeconomics has been making strong inroads in manycountries, where healthcare spending is governed by economic considerations. International Society for Pharmacoeconomics and OutcomesResearch exists to spread the word and to encourage more countries to embrace the analytical technique, which would reduce their spendingon healthcare. Pharmacoeconomics is yet to make an appearance in India where majority of healthcare spending is done by patients out of theirown pockets, unlike medical insurance policies in most developed countries. It is important that Pharmacoeconomic researches should beintroduced strongly in the India and should be performed from the clinical trial onwards so that the government can ensure that money spends inthe right direction and also reduce the financial burden on patients.Key Words: Pharmacoeconomics, cost analysis, cost effective, Indian scenarioINTRODUCTIONTo provide quality patient care with minimal resources is achallenge for healthcare professionals in today's costsensitiveenvironment. Most of the strategies focus solely onthe least expensive one rather than the alternative thatprovides the best value for money. Clinical economics isfocused on the principle that choice must be made accordingto the best available resources and the decision making inhealthcare should consider both cost and health benefits.The concept of Pharmacoeconomics is based on “Qualityhealthcare system at optimum price” which focuses on bothpharmaceutical sector and healthcare services. It is aninnovative method which focuses mainly on healthcare costin order to optimise the patient therapy. Pharmacoeconomicsis derived from health economics, which is developed in1960s. The perceptions of Pharmacoeconomics wereintroduced in 1970s itself by William McGhan, Rowland andLyle Bootman. Cost benefit and cost effectiveness were theeconomic analysis methods used to evaluate the outcome atthat time. Sometimes later in 1986 Ray Townsend publishedAddress for Correspondence:2Suja Abraham, Research scholar, Karpagam university, Tamil NaduE-mail: suja_srmc@yahoo.co.inan article regarding the need of research activities in this1,2area .The Indian chapter of International Society ofPharmacoeconomics and Outcome Research (ISPOR) wasconstituted in 2006 under the chairmanship of ProfessorRanjit Roy Chaudhury at Delhi as Society ofPharmacoeconomics and Outcome Research- India (SPOR-INDIA). This facilitates to provide a platform for knowledge3sharing among researchers .About 27 countries across the globe have well establishedguidelines for Pharmacoeconomic evaluations. The UnitedKingdom follows a system of paying for only those drugs thatare proven to be cost-effective. Cost-effectiveness analyses oftherapies are conducted by the National Institute for Healthand Clinical Excellence (NICE). In Germany, doctors are heldresponsible for the total cost of all prescriptions. This makesdoctors more sensitive to the economic consequence of theirprescriptions, and also makes them consider economic4alternatives .The importance of pharmacoeconomics increases now a daysbecause of the evolution of newer treatment options and alsoincrease in healthcare cost. The number of treatmentsavailable has been steadily keeping pace with the number ofIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 13

Binai KS - Pharmacoeconomics – Indian Scenariodiseases. As newer therapies appear, patients are exposed tomore treatment options and newer medicines may be costeffective. By using Pharmacoeconomic evaluations, a5reproducible decision can be taken .Currently, there are very little applications ofPharmacoeconomics in India. Economic considerations areoften part of patient noncompliance, which ultimately lead tofailure of a therapy. By introducing cost-effective treatmentmethods, overall patient compliance can be improved.Indiscriminate prescribing practices and prescribing by brandnames shows the lack of concern for economic consequences6,7of prescriptions among practitioners .As much as 77% of the health care spending in India is in theprivate sector, of which about 86% is borne out-of-pocket.The penetration of insurance schemes in India is very low,estimated at about 10% of the entire population. This signifies8the importance of economic considerations in health care . Itcan be used in drug therapy evaluation, for selecting the mostcost effective drug while preparing the formulary, to take adecision on individual therapy and customise patient'spharmacotherapy. It also helps to evaluate the value of anexisting service and to estimate the potential value ofimplementing a new service.With the recent development in pharma education mainlyfocused towards M. Pharm. (Phamacy Practice) and Pharm.D. programme, Pharmacoeconomics became an emergingarea with lot of scope for research activities. However, there islimited expertise to highlight the applicability of this field. Ithas becoming a promising area in the healthcare system andpharmaceutical industry too. The awareness onpharmacoeconomics is very less in India when compared toWestern countries. Now suggestions have put forwarded toincorporate pharmacoeconomics in the second year9Pharmacology of medical undergraduate curriculum . Thiswill help the medical students to consider the cost ofmedicines while prescribing in future. Studies/Researches inthis area are very much appreciable and relevant in presenteconomic scenario.At the outset, the government has to makePharmacoeconomic analysis a mandatory component of thenew drugs approval process. The National List of EssentialMedicines (NLEM) should be prepared based onPharmacoeconomic methodologies. The government alsorequires ensuring that only drugs from the NLEM areprescribed, and that prescriptions are issued for Generic10names and not brand names . By using generic names inprescriptions, the patient gets the opportunity to select analternative that costs less than a branded product. In order toincrease the sensitivity to economic consequences ofprescriptions, clinicians should be imparted training onPharmacoeconomics. The government should constitute anew body that looks into Pharmacoeconomics of new drugapprovals, and also issues specific guidelines for treatment ofcommon conditions, in the line of the UK's National Institutefor Health and Clinical Excellence.CONCLUSIONAs a developing country, India needs to ensure that the moneyspends on healthcare goes at the right direction. By usingpharmacoeconomic methodologies, the country can ensurethat it pays exactly for what it gets. By the use of costeffectivetreatments, there would be better patientcompliance. Thus money saved on each patient can be usedfor other purposes elsewhere. The government should make apolicy of promoting generic equivalents over brandedproducts. Concurrently, doctors should be encouraged toprescribe only generic drugs. This would let patients chooseeconomical alternatives, which would affect their economy ata much lesser magnitude.REFERENCES1. Drummond MJ, Sculpher MJ, Torrance GW, O'BrienBJ, Stoddart GL. Methods for the Economic Evaluationrdof Health Care Programmes. 3 edition. New York:Oxford University Press. 2005.2. Bootman JL, Townsend RJ, McGhan WF, eds.rdPrinciples of Pharmacoeconomics. 3 edition.Cincinnati: Harvey Whitney Books. Available at:http://www.hwbooks.com/pharmacoeconomics3ed.ph.3. Pashos CL, Klein EG, Wanke LA. ISPOR Lexicon. 1stEdn. International Society for Pharmacoeconomics andOutcome Research 1998.Princeton,NJ.4. Pharmacoeconomic Guidelines Around The World.International Society for PharmacoeconomicsO u t c o m e s a n d R e s e a r c h . Av a i l a b l e a t :http://www.ispor.org/PEguidelines/index.asp.5. Arenas GR, Tosti A, Hay R, Haneke E.Pharmacoeconomics – an aid to better decision making.JEADV. 2005; 19 (Suppl 1): 34-39. Available at:http://post.queensu.ca/~aj17/pharmacoec%20article.pdf.6. Patel V, Vaidya R, Naik D, Borker P. Irrational Drug Usein India: A prescription survey from Goa. J PostgradMed. 2005; 51: 9-12.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 14

Binai KS - Pharmacoeconomics – Indian Scenario7. Jana S, Mondal P. Pharmacoeconomics: The need tosensitise undergraduate medical students (Editorial).Indian J Pharmacol. 2005; 37: 277-278.8. Yen-Huei T, Shanlian Hu, Isao K, et al. Health-CareSystems and Pharmacoeconomic Research in Asia-Pacific Region. Value in Health. 2008; 11 (Suppl 1):S 1 3 7 - S 1 5 5 . A v a i l a b l e a thttp://www3.interscience.wiley.com/journal/119414410.9. Kulkarni U, Deshmukh YA, Moghe VV, Rege N, KateM. Introducing Pharmacoeconomics in medicalundergraduate curriculum. African Journal of Pharmacyand Pharmacology 2010;4(1): 27-30.10. Drummond M, Smith GT, Wells N. Economicevaluation in the development of medicines. London,Office of Health Economics,1988:33.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 15

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaAssessment of Adverse Drug Reactions Reported in a Tertiary Care RuralHospitalMahendra KBJ, Ramanath KV, Santhosh YL, Naveen MRClinical Pharmacy Department, SAC College of Pharmacy, BG Nagara, KarnatakaA B S T R A C TSubmitted: 11/4/2011Accepted: 28/7/2011Adverse drug reactions are underreported and consequently are an underestimated cause of morbidity and mortality. Recent epidemiologicevidence estimates that ADRs represent the fourth to the sixth leading cause of death. The present study aimed to assess the adverse drugreactions (ADRs) reported in a tertiary care hospital. The present study was carried out at Adichunchanagiri hospital and research center. TheADRs reported to the department were evaluated in the department of pharmacy practice. The Naranjo's scale was used for the casualtyassessment, Modified Hart wig for severity assessment and Siegel scale was used for preventability assessment. A total of 22 ADRs werereported to the department, out of which most commonly associated class of drug with ADRs was antibiotics (36.36%).The causalityassessments of 12 (54.54%) reports was observed to be probable. The severity assessment revealed mild type 13 (50.09%) reactions formajority of reports. The studies conclude that ADR reporting awareness has to be created for health care professionals for the better therapeuticout come.Keywords: Adverse Drug Reactions (ADRs), Reporting ADRs, Pharmacist, Rural hospital.INTRODUCTIONSafety monitoring of medicines in common use should be anintegral part of clinical practice. Pharmacovigilance is thescience and actions relating to detection, evaluation,understanding and prevention of adverse effects or any otherlikely medicine related problems. The main aim ofpharmacovigilance is to improve patient care and safety inrelation to the use of medicines and other interventions.According to WHO an ADR is "A response to a drug that isnoxious and unintended and occurs at doses normally used inman for the prophylaxis, diagnosis or therapy of disease, or1for modification of physiological function". India has morethan half a million qualified Doctors and15, 000 hospitalshaving bed strength of 6, 24,000. It is the fourth largestproducer of pharmaceuticals in the world. ADR monitoringand reporting helps in detection and prevention ofreoccurrence of ADRs. The factors such as poly pharmacy,age, gender, race, genetics, multiple, and inter-current2diseases can cause morbidity and mortality. Adverse DrugReactions are fourth to sixth leading cause of death among*Address for Correspondence:Dr.BJ Mahendra Kumar, Professor and Head, Department of Pharmacy Practice, SACCollege of Pharmacy, B.G.Nagara, IndiaEmail: bjmahendra2003@yahoo.co.inhospitalized patients and it occurs in 0.3 per cent to 7 per centof all hospital admissions. The incidence of serious ADRs is6.7 per cent.The epidemiological importance of ADR is justified by itshigh prevalence rate – they cause from 3% to 6% of hospitaladmissions at any age, and up to 24% in the elderlypopulation; they rank fifth among all causes of death and,3moreover, they represent from 5 to 10% of hospital costs.Factors contributing ADR are Multiple drug therapy, Age,Sex, Poly pharmacy, Intercurrent diseases, Race and geneticpolymorphism. It is fast emerging as an important approachfor the early detection of unwanted effects of the drugs and totake appropriate regulatory action if necessary. This may4ensure the safer use of drugs. In the recent past, pharmacistsand pharmacologists have been encouraged to participate inand contribute to the ADR monitoring and reporting programs5in different parts of the world.Pharmacists have a central role in drug safety by contributingto the prevention, identification, documentation, andreporting of ADRs. In contrast to Canada or the US, where themajority of the reports come from pharmacists, somecountries, such as France, Ireland, Malaysia, New Zealand,the Nordic countries, and the UK, have the largestcontribution of ADR reports coming from physicians (TheLearning Centre 1999). Hospital pharmacists can play aIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 16

Mahindra KBJ- Assessment of Adverse Drug Reactions Reported in a Tertiary Care Rural Hospitalsignificant role in ADR reporting. The most serious ADE(adverse drug event) occurs in hospitals. Since Pharmacistsare directly involved in patient care, and they could actually1help in substantially reducing the ADR incidence rate.MATERIALS AND METHODSThe materials used for the study are ADR notification form(yellow forms), ADR documentation form, Alert cards,Naranjo'scausality scale, Hartwig & Siegels severity scaleand Modified Schumock & Thorntons scale.ththAll the ADRs reported from 16 November 2009 to 10November 2010 to the department was assessed. Yellow cardsand ADR documentation forms prepared by the departmentwas used for the documentation of the ADRs. All the ADRsdata from the documented forms were evaluated for causality,severity and preventability assessment according to therecommendation by the WHO Uppsala Monitoring Center.Physicians, Post graduate students of M-Pharmacy Pharmacypractice and Pharm-D students were involved in reporting anddocumentation of ADRs. Students in ward rounds and OPD,where when ADR found, should first notify to the physicianand after with suitable investigations, documentation ofADRs was made.The causality relationship between the ADR and the drugtherapy was assesses for each report by using Naranjo'scausality assessment scale as highly probable, probable,possible, doubtful. Severity was classified into 4 categories:fatal; sever (directly life threatening and/or more than 1month in duration, associated with organ system dysfunction,reduced life expectancy); moderate ( some but not all of themild criteria and none of the severe criteria); or mild (uncomplicated primary disease, no treatment required anddrug discontinuation not necessary).RESULTSA total of 22 ADR reports were received by the department.Out of 22 ADRs females dominated with 12 ADRs (55%) asshown in table 1. Among the total 22 ADRs 07 occurred in theage group between 21-40 years followed by 10 in 41-60 yearsas shown in table 2. Among the total ADRs 17 (77.27%) werereported from general medicine department followed by 4(18.18%) from department of dermatology as shown in table3. Table 4 shows ADRs majority belongs to the class ofantibiotics 08 (36.36%), followed by respiratory agents 03(13.63%).Pharmacists reported 16 (72.73%) ADRs and followed bydoctors 06 (27.27%).The causality assessment revealed 12 (54.54%) to beprobable, 09 (40.9%) to be 'Possible' and 1 (4.54%) to be'Highly Probable' related to the suspected drugs. The severityassessment revealed 13 (59.09%) ADRs to be of 'Mild' and 9(40.9%) ADRs to be 'Moderate type'. The preventabilityassessment revealed 12 ADRs (54.54%) to be 'ProbablyPreventable', 8 (36.36%) to be 'Definitely Preventable' and 2(9.09%) of 'Not Preventable' type as shown in table 6.Table 1: Gender wise distribution of ADRGender Number Percentage (%)Males 10 45%Females 12 55%Table 2: Age wise distribution of ADRAge in years Number (n=22) Percentage (%)60 05 22.72Table 3: Comparison of number of ADRsfrom different medical departments of hospitalDepartment Number (n=22) Percentage (%)General medicine 17 77.27departmentDermatology 04 18.18departmentSurgery department 01 04.54Table 4: Adverse drug reactions based onpharmacological/therapeutic class of drugsClass of Drug Number of PercentageADRs (n=22) (%)Antibiotics 08 36.36Cardiovascular drugs 02 09.09Diabetic drugs 01 04.54Respiratory agents 03 13.63Antidepressants ’ 02 09.09Antimalarials 01 04.54Anticholinergics 01 04.54Opiods 01 04.54Steroids 02 09.09Vaccine 01 04.54Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 17

Mahindra KBJ- Assessment of Adverse Drug Reactions Reported in a Tertiary Care Rural HospitalTable 5: Detection and reporting of ADRs by the Healthcare professionalsDetection methodBy DoctorsBy ClinicalNumberPharmacist%of ADRsNumberNumber%%of ADRsof ADRsSpontaneous System 19 86.36 06 27.27 16 72.73Chart review 03 13.64Table 6: Causality, severity and preventability of the reported ADRs (n=22)Features Parameters No. of reports Percentage (%)Highly probable 01 04.54Casuality Probable 12 54.54Possible 09 40.90Doubtful 00 00.00SeverityMild ( level1) 03 59.09Mild ( level 2) 10Moderate( level 3) 07 40.09Moderate( level 4) 02Severe( level 5) 00 00.00Severe( level 6) 00Severe ( level 7) 00Preventability Definitely preventable 08 36.36Probably preventable 12 54.54Not preventable 029.09DISCUSSIONA comprehensive ongoing ADR program in a hospital canhelp to complement organizational risk managementactivities, assess the safety of drug therapies, measure ADRincidence rates over time, and educate health careprofessionals of drug effects and increase their level ofawareness regarding ADRs. Periodic evaluation of ADR datafor incidence and pattern is essential. Dissemination of thisinformation to the health care professionals helps in6promoting drug safety in institutions . This study shows thatfemale population 55% experienced higher incidence ofADRs when compared to male population 44% which is7similar to the results obtained by Aline Lins camargo et al.Incidence of ADR among the adults above 40 years wassignificantly higher in the present study which showedsimilarity to the results obtained by the study conducted by8Palanisamy S et al . The present study showed the maximumnumber of ADRs was reported due to the antibiotics (36.36%), which was very much similar with the study reports of9Chan et al . This study shows that the maximum reporting ofthe ADR was done by the clinical pharmacist 72.73%followed by the physicians 27.27%. But this result showed10difference with result in the study conducted by Rao et alwhere 64.6 % of the reporting was done by the physicians andnurses and 34.4 % were reported by the clinical pharmacists.According to Naranjos algorithm probability scale most of thereactions belonged to the probable category (54.54%) whichwas similar to the results of other studies by Ghosh et.al where1154.71% of reactions were probable. Considering the severityof the reactions, majority of the reactions were mild in naturefollowed by moderate which is similar to the results obtained12by Jimmy Jose et al.Preventability assessment scale shows that 54.54% of ADRswere probably preventable. Alert cards issue is one of theimportant measures of prevention of future ADRs in thepatients who have already encountered an ADR once, hence atotal of 4 alert cards were given to the patient for easyidentification of their ADR towards the drug. In this studythere were no reporting found from nursing department, thismay be due to lack of awareness among nurses on ADRmonitoring. The numbers of ADR reports received were lowand hence may not be extrapolate our findings.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 18

Mahindra KBJ- Assessment of Adverse Drug Reactions Reported in a Tertiary Care Rural HospitalCONCLUSIONThe present study made observations on type of reportedADRs and their assessment by various scales. The studyfound that the incidence of ADRs in females were higher thanthat of the males. Incidence of ADRs was found to be high inMedicine department. The most common class of medicationwhich causes adverse drug reaction was antibiotics.Preventable adverse drug reaction was more compared to notpreventable adverse drug reaction.Education and training of health professionals in medicinesafety, exchange of information between nationalpharmacovigilance centers, the coordination of suchexchange, and the linking of clinical experience of medicinesafety with research and health policy, all serve to enhanceeffective patient care.ACKNOWLEDGMENTSAuthors are thankful to the Doctors for reporting ADRs,Medical superintendent and Principal of AdichuchanagiriHospital and Research center for their co-operation andsupport. Also thankful to Dr.B.Ramesh, Principal of SACCollege of Pharmacy for his encouragement and also thanksto Mr. Satish Kumar BP, Mr. Kumarswamy M, Miss SowmyaMathew and students of Clinical Pharmacy department. Wealso extend our special thanks to Dr. Jimmy Jose.REFERENCES1. Edwards RI, Aronson JK. Adverse Drug reactions:definitions, diagnosis, and management. The Lancet2000; 356:1255-9.2. Lazarous J, Pomeranz BH, Corey PN. Incidence ofadverse drug reactions in hospital patients-a metaanalysis of prospective study. JAMA 1998; 279:1200-5.3. Onder G, Pedone C, Landi F, et al. Adverse drug reactionsas cause of hospital admissions: results from the ItalianGroup of Pharmacoepidemiology in the elderly (GIFA). JAm Geriatr Soc 2002; 50(12):1962-8.4. Adithan C. National Pharmacovigilance program. IndianJ Pharmacol 2005; 37(6):347.5. Rao PGM, Jose BRJ. Implementation & results of anadverse drug reaction reporting programme at an Indianteaching hospital. Indian J Pharmacol 2006; 38(4):293-4.6. Levy M, Livshits TA, Sadan B, Shalit M, Brune K.Computerized surveillance of adverse drug reactions inhospital: Implementation. Eur J Clin Pharmacol 1999;54: 887-92.7. Camargo AL, Ferreira MBC, Helneck I. Adverse drugreactions: a cohort study in internal medicine units at auniversity hospital. Eur J Clin Pharmacol 2006; 62:143-149.8. Palanisamy S, Arul Kumaran KSG, Rajasekaran A. Astudy on assessment, monitoring, documentation andreporting of adverse drug reactions at a multi specialtytertiary care teaching hospital in south India.International Journal of PharmTech Research. 2009;1(4): 1519-15229. Chan ALF, Lee HY, Ho C, Cham T, Lin SJ. CostEvaluation of adverse drug reactions in hospitalizedpatients in Thaiwan: a prospective, descriptive,observational study. Curr Ther Res Clin Exp 2008;69(2):118-29.10. Rao PGM, Jose BAJ. Implementation and results of anadverse drug reaction reporting programme at an Indianteaching hospital. Indian J Pharmacol 2006; 38(4):293-4.11. Ghosh S, Acharya LD, Rao PGM. Study and evaluationof the various cutaneous adverse drug reactions inKasturba hospital, Manipal. Ind J Pharm Sci 2006; 68 (2):212-5.12. Jose J, Rao PGM. Pattern of adverse drug reactionsnotified by spontaneous reporting in an Indian tertiarycare teaching hospital. Pharmacological Research 2006;54(3): 226-33.13. Groothest ACV et al. The role of hospital communitypharmacists in Pharmacovigilance. Research in Social &Administrative Pharmacy 2005; 126-133.14. Kourorian Z, Fattahi F, Pourpak MZ, Rasoolinejad,Gholami K. Adverse drug reactions in hospitalizedchildren in a department of infectious diseases. Journal ofclinical pharmacology 2005; 45(11):1313–8.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 19

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaComparison of Serum Homocysteine and Serum Vitamin Bwith Pure Vegetarian and Mixed dietarian Habit.*1 1 2 1Ingle PV , Nawal UR , Dighore PN , Surana SJLevel in Adults1Department of Clinical Pharmacy, R. C. Patel Institute of Pharmaceutical Education and Research, Shirpur- 425405 Dhule, Maharashtra, India.2Indira Gandhi Memorial Hospital, Shirpur-425405, Dhule, Maharashtra, India12A B S T R A C TSubmitted: 23/6/2011Accepted: 6/8/2011This study was designed to compare the serum levels of vitamin B12and homocysteine in vegetarians and mixed dietarians and the effect ofvitamin B supplement on the homocysteine level in pure vegetarian subjects. A total 41 subjects (26 vegetarian, 15 mixed dietarian) were12enrolled in this study. Fasting serum homocysteine and vitamin B was measured in these subjects and the serum homocysteine and vitamin12B in the pure vegetarian subjects were measured after 8 weeks of vitamin B supplement. The homocysteine level in pure vegetarian group12 12and in mixed dietarian group was found to be 39.82 ± 18.55 and 21.75 ± 10.56 (p = 0.0013) respectively. Vitamin B level in pure vegetarian12group was 186.56 ± 114.57, while in mixed dietarian vitamin B level was 266.75 ± 141.82 (p = 0.0550). After the vitamin B supplementation in12 12pure vegetarians group the homocysteine level was found 13.88 ± 3.51, P < 0.0001) and vitamin B level was 510.41 ± 175.83, P < 0.0001). This12study shows that pure vegetarians had higher level of homocysteine in association with lowered vitamin B level as compare to that of mixed12dietarians. The oral vitamin B supplement was more effective and convenient as compare to intramuscular route. The result also shows that12hyperhomocysteinemia was associated with the BMI, and sex (male – female). Hyperhomocysteinemia was seen in the subjects with purevegetarian dietary habit because of insufficient supplement of B group vitamins.Keywords: Homocysteine, vitamin B , vegetarian, mixed dietarian.12INTRODUCTIONHomocysteine (Hcy) is a sulfur containing amino acid whichis an intermediate of methionine metabolism. Excess Hcyproduced in the body is excreted out of the tightly regulated1cell environment into the blood . Liver and kidney playsimportant role to remove excess Hcy from the blood. In manyindividuals with inborn errors of Hcy metabolism, kidney orliver disease, nutrient deficiencies, or concomitant ingestionof certain pharmaceuticals, homocysteine levels can rise2beyond normal levels and lead to adverse health outcomes .Hcy is either converted methionine by remethylation ormetabolized to cysteine via the trans-sulfuration pathway.Remethylation primarily occurs when a methyl group istransferred from methyltetrahydrofolate (MTHF), by amethyltransferase enzyme requiring cobalamin (vitamin B12)as a necessary cofactor. Another remethylation pathwayoccurs primarily in liver and kidney cells, with the helpAddress for Correspondence:P. V. Ingle, Assistant professor, Department of Clinical Pharmacy, R. C. Patel Institute ofPharmaceutical Education and Research, Shirpur-425405, Dhule, India.E-Mail: umesh.nawal@gmail.com, prabhu4ever2000@rediffmail.comtrimethylglycine (betaine) as the methyl donor. The transsulfurationpathway requires two enzymatic reactions,requiring the cofactor pyridoxal-5-phosphate, the active form2-4of vitamin B6.The dietary source of cobalamin is only animal products suchas meat and dairy foods and milk. The minimum dailyrequirement for cobalamin is about 2.5 µg. About 3 to 6 yearswould be required for a normal individual to developcobalamin deficiency if absorption were to cease abruptly in5comparison of normal dose . Hyperhomocysteinemia inAsian (Indians) has been attributed to relatively normal6plasma folate and low vitamin B12levels . Moreover nonvegetariansin India also consume much less animal derivedproteins in comparison to usual Western diet. The strictvegetarian diet has been reported to be deficient in cobalamin.Daily requirement of 1 mg cobalamin would fulfill by about 1liter of milk or milk products, not generally consumed by7most vegetarians . Vitamin B12deficiency is more common inthe Indians so there may be increased levels of Hcy in Indians8. So we performed this study to assess the impact of vitaminB on homocysteine level.12Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 20

Ingle PV - Comparison of Serum Homocysteine and Serum Vitamin B12Level in Adults with Pure Vegetarian and Mixed dietarian Habit.SUBJECTS AND METHODSThis study was carried out in 45 healthy subjects (30vegetarians and 15 mixed dietarians) at the Indira GandhiMemorial Hospital, Shirpur, Dhule. (MS) India. The studysubjects were recruited over a period of eight months. Afterenrollment of subjects the night fasting blood sample wascollected and centrifuged to extract serum. This serumsamples were stored in freezer at 2-8˚C then forwarded toThyrocare Labs. Pvt. Ltd. Mumbai to analyze biochemicalparameters under freezing conditions. The subjects who had9 10the habit of smoking and drinking (alcohol consumption)were excluded from study. The pure vegetarian subjects weretreated with either oral vitamin B 12 (1000 mcg) or11intramuscular vitamin B 12 (1000 mcg) supplement . The12vitamin supplement was given for the 8 weeks .Amongst these 45 subjects 30 subjects are pure vegetariansand 15 subjects were mixed dietarians. From these 30vegetarians subjects 4 subjects are further excluded due tofailure to follow up.Results were expressed as mean (± Standard Deviation (SD)or Standard Error Mean (S.E.M.) using Microsoft Excel2003/2007 program. While obtained results were analyzedseparately using unpaired student t- test and one wayANNOVA by the use of computer soft-ware program, GraphPad Prism five.RESULTSAs the protein, mineral, vitamin content of each and every dietsource is different. So their might also a difference inconcentration of these factors in each individual depending onits diet source and diet consumption pattern. The Hcy level, inpure vegetarian group and mixed dietarian group at baselinewas compared and found to be significant (p = 0.0013).Vitamin B level in pure vegetarian group and mixed12dietarian at base line was found (p = 0.0550 non significant).(Table 1) After the vitamin B supplementation to pure12vegetarians group subjects the Hcy level was significantlydecreased (P < 0.0001) and vitamin B level was significantly12increased (p < 0.0001). (Table 2)The vitamin supplementation in pure vegetarians group wasgiven by two routes i.e. Intramuscular and oral route. In thisstudy, both route leads to significant decrease in Hcy level andsignificantly increases vitamin B level but oral group has12slightly better results than oral route. (Table 3)From out of 41 individuals 21 were male and 20 were female.Amongst these 21 male subjects, 13 subjects were purevegetarians and 8 were mixed dietarian. From 20 femalesubjects 13 were pure vegetarian and 7 were mixed dietarians.The effect of diet on different ethnic group was also comparedin this study. (Table 4) Hcy level and vitamin B level in male12and female subjects of pure vegetarian group at baseline andafter vitamin B supplement was compared. (Table 5) It was12found that female had low Hcy and high vitamin B level than12male subjects. As lipids and Hcy levels are interrelated, theHcy level was increased in obese > normal > underweight.DISCUSSIONPure vegetarians had increased level of Hcy associated withvitamin B deficiency so there may be increased chances to12Table 1: Effect of Diet on Homocysteine Level andVitamin B12LevelGroup Vegetarian Mixed dietarian(n=41) (n=15)Vitamin B12186.56 ± 114.51 266.75 ± 141.82( pg/ml)Homocysteine 39.82 ± 18.55 21.73 ± 1.56(µmol/L)Table 2: Effect of Vitamin B Supplement on12Homocysteine and Vitamin B Level12Group Vitamin B12Homocysteine( pg/ml) (n=41) (µmol/L) (n=41)At baseline 186.56 ± 114.51 39.82 ± 18.55After vitamin B12510.41 ± 175.83 13.88 ± 3.51supplementTable 3: Effect of Route of Vitamin B 12 Supplement on Hcy and Vitamin B 12 Levels inPure VegetariansOral route (n=13)Intramuscular route (n=13)GroupAfter vitamin B 12After vitamin B 12At baselineAt baselinesupplementsupplementVitamin B12194.68 ± 143.45 561.84 ± 159.74 178.45 ± 86.54 458.98 ± 180.20( pg/ml)Homocysteine 45.66 ± 20.71 15.36 ± 2.30 33.98 ± 13.36 12.42 ± 4.14(µmol/L)Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 21

Ingle PV - Comparison of Serum Homocysteine and Serum Vitamin BTable 4: Comparison of Vitamin B 12 and Homocysteine Level in Different Ethnic GroupPure VegetarianMixed dietarianGroup Sub group Vitamin B 12 Homocysteine Vitamin B 12 Homocysteine(pg/ml) (µmol/L) (pg/ml) (µmol/L)Sex Male 192.32 ± 138.9 48.64 ± 18.57 165.88 ± 70.40 28.64 ± 10.25Female 180.80 ± 90.43 31 ±14.28 382 ±109.95 13.83 ± 1.24BMI Underweight 197.9 ± 126.43 18.35 ± 5.96 346.37 ± 52.59 16.68 ± 6.16Normal 197.25 ± 19.85 41.57 ± 19.34 232.0 ± 149.41 23.73 ± 11.48Obese 104.11 ± 27.27 41.86 ± 6.65 410 14.85Table 5: Effect of Vitamin B12Supplement in Pure Vegetarians of Different Ethnic GroupAt baselineAfter vitamin B12 supplementGroup Sub group Vitamin B12 Homocysteine Vitamin B12 Homocysteine(pg/ml) (µmol/L) (pg/ml) (µmol/L)Sex Male (n=13 ) 192.32 ± 138.9 48.64 ± 18.57 541.87 ± 167.67 15.96 ± 2.52Female (n= 13) 180.80 ± 90.43 31 ±14.28 478.95 ± 184.80 11.81 ± 3.16BMI Underweight 197.9 ± 126.43 18.35 ± 5.96 527.51 ± 136.95 9.75 ± 1.72(n=12)Normal 197.25 ± 119.85 41.57 ± 19.34 523.46 ± 181.21 14.42 ± 3.43(n=21)Obese (n=3) 104.11 ± 27.27 41.86 ± 6.65 407.68 ± 175.51 12.89 ± 3.6212Level in Adults with Pure Vegetarian and Mixed dietarian Habit.13-15develop cardiovascular disorders . Mixed dietarians werealso had hyperhomocysteinemia but have low level ofhomocysteine as compare to vegetarians. Vitamin B 12 levels inmixed dietarians were towards borderline. In this study it wasfound that Hcy level in female subjects was low as compare tothe male subjects. While there were no remarkable deviations6, 7, 16, 17for age between men and women . The female have lowhomocysteine levels because of estrogen. Higherconcentrations of homocysteine are a source of hydrogenperoxide, a harmful free radical, which in turn damages18-20endothelium .The relation between BMI and homocysteine is also clearlyunderstood by this study. It was found that the underweightsubjects had lower Hcy level as compare to normal BMIsubjects. Obese and overweight subjects had increased levelsof Hcy as compare to normal and underweight. In case ofobese there was no much difference in the value of Hcy ascompare to normal BMI subjects. This result also resembles7, 21, 22with the other studies conducted by Mishra et al in theirstudy of an urban population of North India have observed anassociation between hyperhomocysteinaemia and low intakeof folate and vitamin B 12. There are many studies, which show1higher homocysteine levels with low intake of vitamin B 12 .Many factors have been associated with mild and moderatehyperhomocysteinemia, one of them important factors are23group B vitamin - folate, vitamin B 6 and B 12 .In this study it was found that vegetarians had low levels ofvitamin B12in than mixed dietarians. As there is no muchdifference in vitamin B 12 level but there was high difference inHcy levels of pure vegetarians and mixed dietarians. (Table 1)This may be due to vegetarian diets contain restrictedamounts of animal products, which are the primary sources ofvitamin B 12. The purpose of this study was to assess andcompare the status of Hcy and vitamin B12betweenvegetarians and mixed dietarians. Vitamin B 12 is conserved inthe body through enterohepatic circulation; thus it would take23years to develop a vitamin B deficiency .12In this study the subjects were treated with vitamin B 12supplementation by two routes i.e. by oral and intramuscularroute to compare the effect of route on vitamin B12concentration in body. It was found there was no much highdifference in the vitamin B 12 levels in the subjects by oral andintramuscular route. (Table 1) The oral supplementation ofvitamin B 12 is safe and effective way to treat the vitamin B 1211, 24deficiency .In this study it was found that 69.23% (18/26) pure vegetariansubjects were vitamin B 12 deficient while 40% (6/15) mixeddietarian subjects were vitamin B12deficient. But all (100%)(26/26) pure vegetarians were had increased levels of the Hcywhile 60% (9/15) mixed dietarian subjects hadhyperhomocysteinemia. The pure vegetarians hadhyperhomocysteinemia with very high concentration Hcy inblood as compare to normal range (39.82 ± 18.55 Vs.15µmol/L).Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 22

Ingle PV - Comparison of Serum Homocysteine and Serum Vitamin B12Level in Adults with Pure Vegetarian and Mixed dietarian Habit.Vitamin B supplement via the oral route had 2.89 fold12increase in vitamin B level 2.97 fold decrease in Hcy level.12Vitamin B via intramuscular route had 2.57 fold increase in12vitamin B level, and 2.74 fold decrease in Hcy level.12CONCLUSIONIn this study it was found that Hcy level in pure vegetariansgroup was very high, associated with vitamin B deficiency12as compared to mixed dietarians; so conclusion had drawnthat hyperhomocysteinemia was directly associated with thedecreased levels of vitamin B . Vitamin B supplement by12 12oral route had better results to some extend to treat vitamin B12deficiency as compare to intramuscular route. Oral route isalso convenient painless and safe route for administration ascompare to intramuscular route which increase the cost oftherapy. The female subjects had lower level of the Hcy levelsand higher level of vitamin B as compare to the male12subjects. In this study it was found that obese had highhomocysteine levels than normal, and normal had higher thanunderweightREFERENCES:1. Hung CJ, Huang PC, Lu SC, et al. Plasma homocysteinelevels in Taiwanese vegetarians are higher than those ofomnivores. The Journal of Nutrition 2002; 132:152–158.2. Guilliams TG. Homocysteine a risk factor for vasculardiseases: guidelines for the clinical practice. The Journalof the American Nutraceutical Association 2004;7(1):11-24.3. Chai AU, Abrams J. Preventive cardiologyhomocysteine: a new cardiac risk factor. Clin. Cardiol2001; 24:80-84.4. Prasad K. Homocysteine, a risk factor for cardiovasculardisease. International Journal of Angiology 1999; 8:76-86.5. Kasper DL, Fauci AS, Longo DL, Braunwald E, HauserSL, Jameson JL. Harrison's principles of InternalthMedicine. 16 ed. McGraw-Hill Medical PublishingDivision; 2005.403-406,601-604,2334,2376-2378,2400.6. Carmel R, Mallidi PV, Vinarskiy S, Brar S, Frouhar Z.Hyperhomocysteinemia and cobalamin deficiency inyoung Asian Indians in United States. American Journalof Hematology 2002; 70:107-114.7. Misra UK, Kalita J, Srivastava A, Bindu IS. A study ofhomocysteine level in North Indian subjects with specialreference to their dietary habit. The European e-Journalo f C l i n i c a l N u t r i t i o n a n d M e t a b o l i s m .2007;2:e116–e119.8. Yajnik CS, Deshpande SS, Lubree HG, Naik SS, BhatDS, Uradey BS. Vitamin B12 deficiency andhyperhomocysteinemia in rural and urban Indians. Japi2006;54:775-782.9. Stein JH, Bushara M, Bushara K, MCbride PE, JorenbyDE, Fiore MC. Smoking cessation, but not smokingreduction, reduces plasma homocysteine levels. Clin.Cardiol 2002;25:23–26.10. Sakuta H, Suzuki T. Alcohol consumption and plasmahomocysteine. Alcohol 2005;37:73-77.11. Robert C, Brown DL. Vitamin B12 deficiency. AmericanFamily Physician. 2003; 67(5):979-986.12. Hirsch S, Delamaza MP, Yanez P, et al.Hyperhomocysteinemia and endothelial function inyoung subjects: effects of vitamin supplementation. Clin.Cardiol 2002; 25:495–501.13. H e r r m a n n W , O b e i d R , J o u m a M .Hyperhomocysteinemia and vitamin B deficiency are12more striking in Syrians than in Germans: causes andimplications. Atherosclerosis 2003;166:143-150.14. Sacco RL, Anand K, Lee H, Boden-Albala B, Stabler S,Allen R, Paik MC. Homocysteine and the risk ofischemic stroke in a triethnic cohort: the northernmanhattan study. Stroke 2004;35:2263-2269.15. Mezzano D, Kosie K, Martinez C,et al. Cardiovascularrisk factors in vegetarians: normalization ofhyperhomocysteinemia with vitamin B12 and reductionof platelet aggregation with n-3 fatty acids. ThrombosisResearch 2000;100:153–160.16. Panagiotakos DB, Pitsavos C, Zeimbekis A,Chrysohooub C, Stefanadis C. The association betweenlifestyle-related factors and plasma homocysteinelevels in healthy individuals from the ''attica'' study.International Journal of Cardiology 2005;98:471– 477.17. Cappuccio FP, Bell R, Perry IJ, et al. Homocysteinelevels in men and women of different ethnic and culturalbackground living in England. Atherosclerosis 2002;164:95-102.18. Dimitrova KR, Degroot K, Myers AK, Kim YD.Estrogen and homocysteine. Cardiovascular Research2002;53:577–588.19. Jacques PF, Bostom AG, Wilson PW, Rich S, RosenbergIH, Selhub J. Determinants of plasma total homocysteineIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 23

Ingle PV - Comparison of Serum Homocysteine and Serum Vitamin B12Level in Adults with Pure Vegetarian and Mixed dietarian Habit.concentration in the framingham offspring cohort. TheA m e r i c a n J o u r n a l o f C l i n i c a l N u t r i t i o n2001;73:613–621.20. Marinou K, Antoniades C, Tousoulis D, Pitsavos C,Goumas G, Stefanadis C. Homocysteine: a risk factor forcoronary artery disease. Hellenic Journal of Cardiology2005;46:59-67.21. Sanlier N, Yabanci N. Relationship between body massindex, lipids and homocysteine levels in universitystudents. j. Pak. Med. Assoc 2007;57:491-495.22. Misra UK, Kalita J, Kumar G, Bansal V, Kant U.Relationship of homocysteine with other risk factorsand outcome of ischemic stroke. Clinical Neurologyand Neurosurgery 2009;111:364–367.23. Huang YC, Chang SJ, Chiu YT, Chang HH, Cheng CH.The status of plasma homocysteine and related b-vitamins in healthy young vegetarians andnonvegetarians. Eur. J. Nutr. 2003;42:84–90.24. Butler CC, Vidal-Alaball J, Cannings-John R, et al. Oralvitamin B versus intramuscular vitamin B for vitamin12 12B deficiency: a systematic review of randomized12controlled trials. Family Practice an international journal2006;279-285.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 24

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaRole of Telmisartan in Controlling Morning Blood Pressure Surge*Raghu KV, Srinivasa RK , Mohanta G P, Manna P K, Manavalan R.Department of Pharmacy, Annamalai University, Annamalai Nagar, Chidambaram, Tamil Nadu, IndiaA B S T R A C TSubmitted: 27/6/2011Accepted: 1/8/2011Patients with hypertension, effective 24-hour blood pressure (BP) control is essential to ensure protection against the early morning surge in BPand the associated increased risk of cardiovascular events. Angiotensin receptor blockers (ARBs) represent an important therapeutic advancein the treatment of hypertension. They are extremely well tolerated, which has significant advantages in terms of improving the poor complianceoften encountered with hypertensive patients. The objective of the review is to emphasize the role of Telmisartan on early morning bloodpressure surge. The angiotensin receptor blocker (ARB) Telmisartan has the longest plasma half-life, highest lipophilicity, highest receptorbinding affinity, and slowest dissociation of any ARB, making it particularly suitable for sustained 24-hour BP control. In clinical studies,Telmisartan provides 24-hour BP control superior to that of the ARBs losartan and valsartan, the calcium-channel blocker amlodipine, and theangiotensin-converting enzyme (ACE) inhibitor ramipril. This agent is particularly effective during the last 6 hours of the dosing interval when theother antihypertensives tend to go down in effectiveness. Finally, when applied to daily clinical practice, these qualities of Telmisartan mayoptimize 24-hour BP control, including the critical early morning period.Keywords: angiotensin II receptor blocker, cardiovascular disease, hypertension, renin–angiotensin system, Telmisartan.INTRODUCTIONIn human beings, regular diurnal variations in blood pressure(BP) levels occur that are associated with changes in the risk1-3of cardiovascular events. In patients with hypertension it isimportant to ensure BP reduction over the entire 24-hourperiod and to provide protection against the morning BP[4]surge. BP levels start to increase, and at around 06:00 thisincrease accelerates to produce a sharp rise in BP that is2, 4known as the 'morning surge'.This early morning blood pressure surge is caused primarily5-7by orthostatic changes. An antihypertensive agent's durationof action must be sufficient to control blood throughout thedosing interval and, ideally, if the next dose is delayed or8missed.Angiotensin II, which is generated by the renin–angiotensinsystem (RAS), plays a pivotal role in hypertension andcardiovascular disease. Thus, pharmacologic regulation ofangiotensin II is central to the control of blood pressure andprevention of its pathophysiologic effects on the9cardiovascular system, including the kidney and the brain.Angiotensin receptor blockers (ARBs) represent an importantAddress for Correspondence:Srinivasa Rao K, Department of Pharmacy, Annamalai University, Annamalai Nagar,Chidambaram, Tamil Nadu, IndiaE- mail: k.srinivasraopharmd@gmail.comtherapeutic advance in the treatment of hypertension. Theyare extremely well tolerated, which has significantadvantages in terms of improving the poor compliance oftenencountered with hypertensive patients. Some of theseagents, have a duration of action of 24 hours or greater and canbe prescribed for once-daily dosing without compromisingBP control at the end of the dosing period.The objective of the review is to emphasize the role ofTelmisartan on early morning blood pressure surge.DESCRIPTIONAn extensive literature search was done in differentdatabases like Pubmed Medline and Medscape. Differentmesh terms were used in search strategy like Telmisartan,Angiotensin receptor blockers, hypertension, and earlyMorning Pressure, The study included all articles retrievedfrom 1978 onwards. Exclusion criteria included an underagepopulation, as well as prevalence studies of hypertension for adisease-specific population.Telmisartan offers unique pharmacological propertiescompared with other agents of its class.Pharmacodynamics:Telmisartan displays insurmountable, but reversible bindingto the AT 1 receptor, and it has the highest binding affinity for10this receptor among available ARBs. As well as providinglong-term blockade of the AT1receptor, telmisartan hasIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 25

Raghu KV- Role of Telmisartan in Controlling Morning Blood Pressure Surgeminimal affinity for the AT2receptor or for acetylcholine,catecholamine, dopamine, and histamine, serotonin, or11imipramine receptors.Pharmacokinetics:Telmisartan is also highly lipophilic, which facilitates oralabsorption and benefits tissue and cell penetration, asdemonstrated by its large volume of distribution of12-13approximately 500 L. . Unlike other ARBs, which are14-15excreted to varying extents via the kidneys, more than1690% of Telmisartan is eliminated in the feces. An importantdistinguishing feature of Telmisartan is its long terminalelimination half-life of about 24 hours, suggesting a long13duration of action.Patient compliance and sustained Blood Pressure control:Hypertension is well recognized as a major risk factor forcardiovascular and renal morbidity and mortality. Patientscompliance can be increased when a drug is administeredonce daily, usually in the morning, when it is more discreet17and easier to maintain a routine. With the newer generationof ARBs, such as Telmisartan, we now have drugs that have anextremely long duration of action, which provide smooth BP18-20control over a 24-hour dosing period. We can be confidentthat once-daily dosing with Telmisartan will not compromisethe patient at the end of the dosing period, whenantihypertensive protection is often most needed.DISCUSSIONŸ Telmisartan against other ARBsIn Japanese hypertensive patients, home blood pressuremeasurement confirmed that telmisartan reduces blood21pressure more than other ARBs. At the lower doses typicallyused in Japan, once-daily telmisartan 10 to 40 mg taken in themorning achieved greater blood pressure reductions in theearly morning than once-daily valsartan 40 to 80 mg,candesartan 2 to 12 mg, or losartan 25 to 100 mg. Comparisonof the morning effect on blood pressure versus the eveningeffect on blood pressure showed that, in particular, the effectof losartan did not persist for 24 hours. When compared withvalsartan 160 mg (8.1 mmHg SBP and 5.8 mm Hg DBP),telmisartan provided sustained anti-hypertensive efficacy (12 mm Hg SBP and 7.8mm H g DBP)and superior control of22, 23blood pressure during the early morning period.Ÿ Telmisartan against ACE inhibitorsThe antihypertensive effect of telmisartan was examined in adouble-blind comparison of Telmisartan 80 mg andPerindopril 4 mg. Both agents produced similar reductions in24-hour men Systolic BP/Diastolic BP at the end of the 8-24week study. However, Telmisartan provided significantlygreater reductions (2.2 mm Hg) in hourly mean Diastolic BPin each of the last 8 hours of the dosing period.Telmisartan is better tolerated than ACE inhibitors.Comparative studies have consistently shown that incidencesof cough were lower with Telmisartan than with Perindopril,24, 25 26 27, 28Lisinopril or RamiprilS.No Common Adverse Reaction Of Telmisartan1 Syncope2 Headache3 Uncontrolled hypertension4 Hypotension symptoms5 Diarrhea6 Vomiting7 Nausea8 Atrial fibrillation9 Hyperkalemia10 Renal impairment11 AngioedemaŸ Telmisartan against beta (β)-blockersThe superiority of Telmisartan was also demonstrated in an 8-week open-label comparison of Telmisartan 80 mg and29Atenolol 50 mg in 58 patients.The SBP reduced by 12 mm Hg and DBP by 3.2 mm Hg intelmisartan group compared to 8mm Hg of SBP and 1.2 mmHg of DBP reduction in Atenolol group.Ÿ Telmisartan against HydrochlorthiazideTelmisartan has been shown to provide more effective controlof high blood pressure than Hydrochlorthiazide . In an 8-weekfactorial study comparing Telmisartan (20, 40, 80mg), 3 dosesof Hydrochlorthiazide (6.25, 12.5, or 25 mg), Telmisartan 40and 80 mg resulted in greater reductions in Systolic BP andDiastolic BP (20mm Hg/4.6mmHg) than Hydrochlorthiazide3012.5 mg. ( 12 mm Hg/ 1.1mm Hg)Ÿ Telmisartan against calcium channel blockers20When telmisartan 40 mg and amlodipine 5 mg werecompared, Telmisartan, however, was superior to amlodipinewith respect to the reductions in Diastolic BP at night andduring the early morning hours: reduction in DBP in the last 4hours of the dosing interval was 3.4 mmHg greater withtelmisartan than with amlodipine.PROBE study compared Telmisartan 80 mg with valsartan 80mg after treatment for 8 weeks detected a significantly greaterIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 26

Raghu KV- Role of Telmisartan in Controlling Morning Blood Pressure Surgereduction in the last 6 h mean Diastolic BP in Telmisartan-31treated patients (7.5 mm Hg vs 5.2 mm Hg). After a misseddose, the 24 h mean DBP was reduced by 7.2 mm Hg withtelmisartan compared with 5.5 mm Hg with valsartan(p=0.0004). The reduction in 24 h mean SBP after a misseddose was 10.7 mm Hg with telmisartan and 8.7 mm Hg withvalsartan (p=0.0024). It was also observed in one of the twostudies that there was a notable trend for greater bloodpressure reduction in the telmisartan group compared with thevalsartan group in latter part of the dosing interval on the day22on which a dose was missed. These data indicate that the32 33longer half-life of Telmisartan compared with valsartanconfers more sustained blood control, especially at the end ofthe dosing period, and preserves efficacy in poorly compliantpatients in the event of a missed dose.Telmisartan is probably the longest acting, and has a half-lifeof about 24 hours. It may be particularly relevant that thereappears to be a biphasic pattern in the elimination of this drug,possibly reflecting secondary release from tissue-binding34sites. In comparison with another ARBs, losartan, and withthe long-acting calcium channel blocker amlodipine,Telmisartan (40-80 mg given once daily in the morning)produced greater reductions in blood pressure the followingmorning. Although the differences were small(approximately 3/1.5 mmHg) they were nonethelessstatistically significant and would be expected to have a34clinically significant impact on risk reduction.In clinical studies, Telmisartan provides 24-hour BP controlsuperior to that of the ARBs losartan and valsartan, thecalcium-channel blocker amlodipine, and the angiotensinconvertingenzyme (ACE) inhibitor ramipril. This agent isparticularly effective during the last 6 hours of the dosinginterval when the other antihypertensives tend to go down ineffectiveness. Telmisartan is, therefore, a highly appropriateantihypertensive for sustained 24-hour BP control, especially35during the risky early morning hours.Goose conducted a similar review on blood pressure controlduring the early morning hours and stated that telmisartan 80mg controls the early morning blood pressure surge moreeffectively than ramipril 5-10 mg and, thus, may have agreater beneficial effect on long-term cardiovascular risk. Theefficacy of telmisartan 80 mg monotherapy has beendemonstrated using ABPM, with superior reduction in meanvalues for the last 6 h of the dosing interval compared withramipril 10 mg and valsartan 80 mg. In addition, telmisartan80 mg provides superior blood pressure control after a misseddose compared with valsartan 160mg. When combined withhydrochlorothiazide (HCTZ) 12.5 mg, telmisartan 40mg and80mg is more effective than losartan/HCTZ (50/12.5 mg) atthe end of the dosing interval. Furthermore, greater reductionsin last 6 h mean systolic blood pressure (SBP) and diastolicblood pressure (DBP) are achieved with telmisartan/HCTZ(80/12.5 mg) than with valsartan/HCTZ (160/12.5 mg) inobese patients with type 2 diabetes and hypertension. Thissupposition is being tested in the ONgoing Telmisartan Aloneand in combination with Ramipril Global Endpoint Trial36(ONTARGET) programme.Sharma AM. found in high-risk, overweight/obese patientswith hypertension and type 2 diabetes, Telmisartan/HCTZprovides significantly greater BP lowering versusValsartan/HCTZ throughout the 24-hour dosing interval,37particularly during the hazardous early morning hours.Telmisartan, an angiotensin receptor blocker, is one of thebest researched drugs worldwide. It has been studied inclinical trials in more than 50,000 patients. Its positive safetyprofile has been confirmed also in a market exposure of 34.5million patient years. Convincing safety data for patients witha high cardiovascular risk were collected in the three longtermoutcome trials ONTARGET, PRoFESS andTRANSCEND which followed some of the patients for up tofive years.CONCLUSIONThe pharmacologic features of Telmisartan enable it toprovide greater and more sustained antihypertensive efficacythan many other antihypertensive agents, and compared withother antihypertensive in other classes, Telmisartan is welltolerated. With its proven tolerability suggest that Telmisartancould be considered as a potential treatment for patients withvascular disease or high-risk diabetes, irrespective of whetheror not they can tolerate ACE inhibitors. Telmisartan has thelongest half life among ARBs class Antihypertensive duugs.The powerful and sustained BP control apparent in Clinicaltrials, together with cardiovascular protection, duration ofaction of 24 hours, can be administered once daily withoutcompromising on BP control at the end of the dosing makesTelmisartan preferred option for patients with Hypertension.Finally, when applied to daily clinical practice, these qualitiesof Telmisartan may optimize 24-hour BP control, includingthe critical early morning blood pressure surgeREFERENCES1. White WB. Circadian variation of blood pressure:clinical relevance and implications for cardiovascularchronotherapeutics. Blood Press Monit 1997; 2: 47-51.2. Millar-Craig MW, CN Bishop, Raftery EB. Circadianvariation of blood-pressure. Lancet 1978; I: 795-7.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 27

Raghu KV- Role of Telmisartan in Controlling Morning Blood Pressure Surge3. Anwar YA, White WB. Chronotherapeutics forcardiovascular disease. Drugs 1998; 55: 631-43.4. White WB. Cardiovascular risk and therapeuticintervention for the early morning surge in blood pressureand heart rate. Blood Press Monit 2001; 6: 63-725. Stern N, Sowers JR, McGinty D, et al. Circadian rhythmof plasma renin activity in older normal and essentialhypertensive men: relation with inactive renin,aldosterone, cortisol and REM sleep. J Hypertens.1986;4:543–55.6. Casiglia E, Palatini P, Colangeli G, et al. 24 h rhythm ofblood pressure and forearm peripheral resistance innormotensive and hypertensive subjects confined to bed.J Hypertens. 1996;14:47–52.7. Leary AC, Struthers AD, Donnan PT, et al. The morningsurge in blood pressure and heart rate is dependent onlevels of physical activity after waking. J Hypertens.2002;20:865–870.8. Iskedjian M, Einarson TR, MacKeigan LD, et al.Relationship between daily dose frequency andadherence to antihypertensive pharmacotherapy:evidence from a meta-analysis. Clin Ther.2002;24:302–316.9. Atlas S. The renin-angiotensin aldosterone system:pathophysiological role and pharmacologic inhibition. JManag Care Pharm 2007;13:S9–S20.10. Kakuta H, Sudoh K, Sasamata M, et al. Telmisartan hasthe strongest binding affinity to angiotensin II type 1receptor: comparison with other angiotensin II type 1receptor blockers. Int J Clin Pharmacol Res.2005;25:41–46.11. Wienen W, Hauel N, van Meel JC, et al. Pharmacologicalcharacterization of the novel nonpeptide angiotensin IIreceptor antagonist, BIBR 277. Br J Pharmacol.1993;110:245–252.12. Wienen W, Entzeroth M, van Meel JCA, et al. A reviewon telmisartan: a novel, long- acting angiotensin IIreceptorantagonist. Cardiovasc Drug Rev.2000;18:127–156.13. Stangier J, Su CAPF, Roth W. Pharmacokinetics of orallyand intravenously administered telmisartan in healthyyoung and elderly volunteers and in hypertensivepatients. J Int Med Res. 2000;28:149–167.14. Brunner HR. The new oral angiotensin II antagonistolmesartan medoxomil: a concise overview. J HumHypertens. 2002;16(Suppl 2):S13–S16.15. Burnier M, Brunner HR. Angiotensin II receptorantagonists. Lancet. 2000;355:637–645.16. Ebner T, Heinzel G, Prox A, et al. Disposition andchemical stability of telmisartan 1-O-acylglucuronide.Drug Metab Dispos. 1999;27:1143–1149.17. Bailey BJ, Carney SL, Gillies AH, et al. Hypertensiontreatment compliance: what do patients want to knowabout their medication? Prog Cardiovasc Nurs.1997;12:23-2818. Meredith PA. A chronotherapeutic approach to effectiveblood pressure management. J Clin Hypertens. 2002;4(suppl 1):15-19.19. Mallion JM, Siché JP, Lacourcière Y, et al. ABPMcomparison of the antihypertensive profiles of theselective angiotensin II antagonists telmisartan andlosartan in patients with mild-to-moderate hypertension.J Hum Hypertens. 1999;13:657-664.20. Lacourcière Y, Jacques L, Orchard R, et al. A comparisonof the efficacies and duration of action of the angiotensinII receptor blockers telmisartan and amlodipine. BloodPress Monit. 1998;3:295-302.21. Nishimura T, Hashimoto J, Ohkubo T, et al. Efficacy andduration of action of the four selective angiotensin IIsubtype 1 receptor blockers, losartan, candesartan,valsartan and telmisartan, in patients with essentialhypertension determined by home blood pressuremeasurements. Clin Exp Hypertens. 2005;27:477–489.22. White WB, Lacourcière Y, Davidai G. Effects of theangiotensin II receptor blockers telmisartan versusvalsartan on the circadian variation of blood pressure:impact on the early morning period. Am J Hypertens.2004;17:347–353.23. Lacourcière Y, Krzesinski JM, White WB, et al.Sustained antihypertensive activity of telmisartancompared with valsartan. Blood Press Monit.2004;9:203–210.24. Nalbantgil I, Nalbantgil S, Özerkan F, et al. The efficacyof telmisartan compared with perindopril in patients withmild-to-moderate hypertension. Int J Clin Pract.2004;58:50–54.25. Ragot S, Ezzaher A, Meunier A, et al. Comparison oftrough effect of telmisartan vs perindopril using selfblood pressure measurement: EVERESTE study. J HumHypertens. 2002;16:865–873.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 28

Raghu KV- Role of Telmisartan in Controlling Morning Blood Pressure Surge26. Neutel JM, Frishman WH, Oparil S, et al. Comparison oftelmisartan with lisinopril in patients with mild-tomoderatehypertension. Am J Ther. 1999;6:161–166.27. Williams B, Gosse P, Lowe L, et al. The prospective,randomized investigation of the safety and efficacy oftelmisartan versus ramipril using ambulatory bloodpressure monitoring (PRISMA I) J Hypertens.2006;24:193–200.28. Lacourcière Y, Neutel JM, Davidai G, et al. Amulticenter, 14-week study of telmisartan and ramipril inpatients with mild-to-moderate hypertension usingambulatory blood pressure monitoring. Am J Hypertens.2006;19:104–112.29. Alcocer L, Fernandez-Bonetti P, Campos E, et al.Clinical efficacy and safety of telmisartan 80 mg oncedaily vs. atenolol 50 mg once daily in patients with mildto-moderatehypertension. Int J Clin Pract Suppl.2004;58:35–39.30. M c G i l l J B , R e i l l y PA . Te l m i s a r t a n p l u shydrochlorothiazide versus telmisartan orhydrochlorothiazide monotherapy in patients with mildto moderate hypertension: a multicenter, randomized,double-blind, placebo-controlled, parallel-group trial.Clin Ther. 2001;23:833–850.31. Littlejohn T, Mroczek W, Marbury T, VanderMaelen CP,Dubiel RF. A prospective, randomized, open-label trialcomparing telmisartan 80 mg with valsartan 80 mg inpatients with mild to moderate hypertension usingambulatory blood pressure monitoring. Can J Cardiol.2000 Sep;16(9):1123-32.32. Stangier J, Su CA, Roth W .Pharmacokinetics of orallyand intravenously administered telmisartan in healthyyoung and elderly volunteers and in hypertensivepatients. J Int Med Res. 2000 Jul-Aug;28(4):149-67.33. Markham A, Goa KL. Valsartan. A review of itspharmacology and therapeutic use in essentialhypertension. Drugs. 1997 Aug;54(2):299-311.34. Michael Schachter. Diurnal Rhythms, the Renin-Angiotensin System and Antihypertensive Therapy; Br JCardiol. 2004;11(4)35. McInnes G.24-hour powerful blood pressure-lowering:is there a clinical need? J Am Soc Hypertens. 2008 Jul-Aug;2(4 Suppl):S16-22.36. Gosse P. A review of telmisartan in the treatment ofhypertension: blood pressure control in the early morninghours. Vasc Health Risk Manag. 2006;2(3):195-201.37. Sharma AM, Davidson J, Koval S, LacourcièreY. Te l m i s a r t a n / h y d r o c h l o r o t h i a z i d e v e r s u svalsartan/hydrochlorothiazide in obese hypertensivepatients with type 2 diabetes: the SMOOTH study.Cardiovasc Diabetol. 2007 Oct 2;6:28.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 29

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaCharacterization of Resistant Isolates of M. Tuberculosis1 2 3 4 5 2Taha N , Muhammad HR *, Abdul H , Bashir A , Javed AQ , Haroon SK1Faculty of Pharmacy, University of Sargodha, Sargodha, Pakistan.2College of Pharmacy, GC University, Faisalabad, Pakistan.3Department of Microbiology, Quaid-e-Azam University, Islamabad, Pakistan.4University College of Pharmacy, University of the Punjab, Lahore, Pakistan.5National Institute of Biotechnology and Genetic Engineering, Faisalabad, Pakistan.A B S T R A C TSubmitted: 30/4/2011Accepted: 5/6/2011The present study comprised of 172 clinical isolates of indigenous Mycobacterium tuberculosis collected from Tuberculosis diagnosed patientsof 17-67 years of age group. The specimens were collected from six different sources and comprised of 84.9% sputum, 10.5% pus and 4.6%bronchial washings. There were 70.9% male and 29.1% female patients with 84.30% pulmonary (sputum, bronchial washing, pus) and 15.70%extra-pulmonary (pus and bronchial washings) specimens. The clinical isolates were collected from cultured growth over Lowenstein Jensenmedium supplemented with pyrazinamide at optimum concentration of 100µg/ml. The Specimens were treated to determine the sensitivityagainst pyrazinamide by standard drug proportions method. 47 pyrazinamide resistant Mycobacterium tuberculosis strains were further studiedat molecular level to elucidate the genetic basis of resistance. The genomic DNA of Mycobacterium tuberculosis was isolated by mechanicalmethod and used to detect the pyrazinamide resistant pnc A gene. The three fragments of 217 bp, 179 bp and 215 bp were amplified throughPolymerase Chain Reaction (PCR). The Single Strand Conformation Polymorphism (SSCP) analysis was conducted to detect mutation in pncA gene. Molecular examination indicated the activity of pyrazinamidase on basis of the hypothesis that mutation in the pnc A gene is a reliablemarker of pyrazinamide resistance.Keywords: Mycobacterium tuberculosis; Clinical isolates; Pyrazinamide resistance; pnc A gene; Polymerase Chain Reaction; Single StrandConformation Polymorphism.INTRODUCTIONMycobacterium tuberculosis is capable of getting geneticmutation to develop resistance. Combination therapytherefore carried to overcome and prevent emergence ofresistance. The recent increase in the incidence oftuberculosis (TB) in certain parts of the world and theemergence of multi-drug resistance has urged the need for its1rapid diagnosis. Delayed identification and failure to isolatecontagious patients had helped much in the transmission ofresistant Mycobacterium tuberculosis.Genotypic analysis of Mycobacterium tuberculosis is used toconfirm outbreaks of tuberculosis and investigate itstransmission in communities, identify cases of exogenousre-infection, confirm cross-contamination in the laboratory2,3and study the clonal expansion of strains. Various molecularmethods have been developed to rapidly detect mutations inAddress for Correspondence:Muhammad Hidayat Rasool, Assistant Professor of Microbiology, College of Pharmacy,GC University, Faisalabad, Pakistan.E-mail: drmhrasooluaf@hotmail.comthe Mycobacterium tuberculosis core region, including the4line probe assay, Single Strand ConformationalPolymorphism (SSCP), Polymerase Chain Reaction (PCR)5and real-time PCR. Automated DNA sequencing is the mostcommonly applied technique to characterize mutations.Keeping in view the antibiotic resistance problem intuberculosis patients in the country the present researchproject was designed to elucidate the molecular basis ofresistance in clinical isolates of indigenous Mycobacteriumtuberculosis against first line anti-tuberculosis drugpyrazinamide using Polymerase Chain Reaction (PCR) andSingle Strand Conformational Polymorphism (SSCP)analysis.MATERIAL AND METHODSCollection and processing of samples:The study was conducted at Department of Microbiology,Quaid-e-Azam University, Islamabad and National Instituteof Biotechnology and Genetic Engineering (NIBGE)Faisalabad, Pakistan. Pyrazinamide was obtained from theIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 30

Taha Nazir- Characterization of Resistant Isolates of M. TuberculosisSchazoo Laboratories (Pvt.), Lahore, Pakistan. A totalnumber of 172 Tuberculosis (TB) diagnosed human patientswere selected from five different sources. The patients wereselected regardless of their age, gender and previoustherapeutic profile. The samples are collected from 122(70.9%) male and 50 (29.1%) female patients. Three differenttypes of samples i.e. sputum, bronchial washing and pus werecollected from all patients. The specimens were treated todetermine the sensitivity against pyrazinamide by standard6drug proportions method. The pyrazinamide resistantMycobacterium tuberculosis strains (47) were further studiedat molecular level to elucidate the genetic basis of resistance.Isolation and Quantification of genomic DNA:The genomic DNA of resistant Mycobacterium tuberculosisisolates were extracted by mechanical method. Eppendorfmicro-centrifuge machine was used for centrifugation ofmycobacterial suspension at 13000 rpm for 15 minutes. Themycobacterial cells were disintegrated mechanically in aMickle Apparatus and centrifuged for 10 minutes at 13000rpm. The supernatants were collected and transferred to neweppendorf tubes. The gel estimation and photometricmethods were used to quantify the isolated DNA. In gelestimation method, 3µl of bromophenol blue was used asloading dye to load 10µl of isolated DNA on 2% agar gelusing 90V current maintained for 1 hour in 0.5 x TBE bufferto run the sample and then observed on UV transilluminator.In photometric method, 1µl of genomic DNA was analyzedquantitatively by spectrophotometer at wavelength of 260nmand the concentrations of nucleic acid in all the samples werecalculated.Amplification and Identification of Mycobacteriumtuberculosis genomic DNA:Mycobacterium tuberculosis isolates were identified throughPCR by using the primers homologous to the specificmycobacterial insertion sequence IS987 TB-1 and TB-3, 20bases primers corresponding to bp 105 to 124 (5'-GTG CGGATG GTC GCA GAG AT-3') and 626 to 645 (5'-CTC GATGCC CTC ACG GTT CA-3'), respectively. Briefly, a 16 µl ofabove mixture was added into 0.2 ml PCR reaction tube. A4µl of isolated DNA of each sample was added alongwith 4µldH2O as negative control into corresponding tubes andmixed thoroughly. For the detection of PCR product, theamplified 10µl product and 2µl of 2 X loading dye wereloaded into each well of 2% agarose gel in 01 X TBE buffercontaining 1µg/ ml final concentration of ethidium bromide.The gel was run with 50 bp marker in 0.5XTBE. The fragmentof 541 bp was visualized and compared with marker by UVtransilluminator.PCR of the fragments of pyrazinamide resistant pnc Agene:The specific primers were designed and synthesized toamplify the 217 bp, 179 bp, and 215 bp fragments from thepnc A gene of pyrazinamide resistant Mycobacteriumtuberculosis using PCR. The specific primerP1 (5'- GTCGGTCATGTTCGCGATCG 3') andP2 (5'- TCGGCCAGGTAGTCGCTGAT 3') for 217 bp,P3 (5' - ATCAGCGACTACCTGGCCAGA 3') andP4 (5' - GATTGCCGACGTGTCCAGAC 3') for 179 bp andP5 (5'- CCACCGATCATTGTGTGCGC3') andP6 (5'- GCTTTGCGGCGAGCGCTCCA3') for 215 bpfragments were used, respectively. The conditions for PCRwere optimized. Each reaction mixture consisted of 4µl (20-50 ng) of isolated DNA from the samples in 16 µl of reactionbuffer containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5mM MgCl , 0.01% gelatin, 0.2 mM deoxynucleotide2triphosphate (dNTPs), 10 pmol of each primer and one unit ofTaq polymerase enzyme. All the samples were mixedthoroughly, spun and shifted to thermalcycler. For thedetection of amplified products, 1 µl of each PCR productwas mixed with 3µl of dH2O and 1 µl of loading dyebromophenol blue. The electrophoresis was carried on a 12%non-denaturing polyacrylamide gel in a folding pageapparatus at 160 Volt for one hour and silver stained to see theamplification of 217 bp, 179bp and 215 bp fragments frompnc A gene.Single Strand Conformation Polymorphism Analysis ofpnc A Gene:The Single Strand Conformation Polymorphism (SSCP)analysis was conducted to determine the mutation in pnc Agene of pyrazinamide resistant isolates in comparison topyrazinamide sensitive Mycobacterium tuberculosis. Theconditions for SSCP analysis were optimized using differentpercentages of polyacrylamide gel, TBE buffer and DNA,starting and running voltage, buffer temperature and runningtime. A 4 µl of the PCR product was mixed with 6µl SSCP dyeand kept at 37°C for 1hour. The samples were denatured at98°C for 5 minutes in thermal cycler and then immediatelychilled on ice. The samples were electrophoresed in a 20%(39:1 acrylamide: bis-acrylamide) non-denaturingpolyacrylamide gel (80 X 80 X 1 mm) and 1.5 X TBE bufferin a cold room (4°C). The starting voltage was 25 V whichwas reduced to 15V as the sample entered in the gel and thenmaintained for 4 hours in folding gel apparatus. The SSCPIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 31

Taha Nazir- Characterization of Resistant Isolates of M. Tuberculosisbands were visualized by silver staining techniques. Themobility of SSCP bands in normal control DNA wascompared with the mutant bands in the samples.Fig. 2: Amplification of 217 bp fragment of pnc A gene frompyrazinamide resistant clinical isolates of indigenousMycobacterium tuberculosis by P1 and P2RESULTS AND DISCUSSIONThe samples were collected from six different local sourcesand comprised of 146 (84.9%) sputum, 18 (10.5%) pus and 8(4.6%) bronchial washings with 145 (84.30%) pulmonaryand 27(15.70%) extra-pulmonary specimens. The studycomprised of 122 (70.9%) male and 50 (29.1%) femalepatients out of total 172 clinical isolates. Gender comparisondepicts greater percentage of tuberculosis in male than theirfemale counterparts. These findings are in conformity with7Uplekar et al. who also reported an excess of seventy percent(70%) cases of tuberculosis in male globally each year. Thereasons for this difference is yet unclear. The findings of thegender comparison in this study are also in agreement with8Haq et al. who have reported 68% male and 32% femaletuberculosis patients.The Mycobacterium tuberculosis genomic DNA was isolatedand amplified (Figure 1). The three fragments of 217 bp, 179bp, and 215 bp from the pnc A gene of pyrazinamide resistantclinical isolates of indigenous Mycobacterium tuberculosiswere amplified using PCR. The results of amplification areshown in Figure 2,3 and 4, respectively. The Single StrandConformation Polymorphism (SSCP) analysis wasconducted to detect mutation in the pnc A gene on the basis ofits mobility pattern. By using the SSCP analysis, we obtainedmost diverse pattern in 47 resistant strains. The 30 (63.83%)pyrazinamide resistant Mycobacterium tuberculosis showeddifferent pattern than sensitive samples which indicated themutation in this domain, while 17 (36.17%) did not show anydifference in mobility in comparison to sensitive samples.Fig. 1: Amplification of 541 bp fragment of IS987 fortypical and atypical Mycobacteria with TB1 and TB2Lane 1= 50 bp ladder; Lane 2= Negative control;Lane 3 = Positive control; Lane 4-11 = SamplesFig. 3: Amplification of 179 bp fragment of pnc A gene frompyrazinamide resistant clinical isolates of indigenousMycobacterium tuberculosis by P3 and P4Lane 1= 50 bp ladder; Lane 2= Positive control;Lane 3 = Negative control; Lane 4-7 = SamplesFig. 4: Amplification of 215 bp fragment of pnc A gene frompyrazinamide resistant clinical isolates of indigenousMycobacterium tuberculosis by P5 and P6Lane 1= Negative control; Lane 2= Positive control;Lane3-7= Samples; Lane8 = 50bp ladderLane 1= 100 bp ladder; Lane 2= Positive control;Lane 3-5 = Mycobacterium tuberculosis isolates;Lane 6-8 = A typical MicobacteriaIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 32

Taha Nazir- Characterization of Resistant Isolates of M. TuberculosisThis indicates that although there is no obvious mutation inthis region but it needs to be further confirmed by sequencing.9These findings are in line with Sreenvatsan et al. whoreported that pyrazinamide sensitive strains ofMycobacterium tuberculosis had normal pnc A genes, whilepyrazinamide resistant strains had mutations in pncA genes.This finding also suggested that there might be some otherresistance mechanism involved in addition topyrazinamidase activity. Our findings are in line with the10work of Riska et al., who investigated the up take ofpyrazinamide as a possible resistance mechanism inMycobacteria. They found that an ATP dependent transportsystem is involved in up take of pyrazinamide. Theyinvestigated four naturally pyrazinamide resistant species ofMycobacteria as Mycobacterium tuberculosis. Findings of11this study are also substantiated by Stephen, who reportedthat the most pyrazinamide resistant organisms havemutations in the pyrazinamidase gene.12Our findings support the work of Lemaitre et al. whoreported pyrazinamide as essential in producing the activepyrazinoic acid derivative, and mutants are unable to producean active drug. These findings are in conformity with Hirano13et al., who reported that pyrazinamidase negative isolateshad mutations within the pnc A gene. They also described thatin vitro selected pyrazinamide resistant mutants werepyrazinamidase positive and showed no change in the pnc Agene, which indicate the involvement of some additionalmechanisms in pyrazinamide resistance. No mutations wereobserved in all of pyrazinamidase positive isolates whichindicate that the mutations in the pnc A gene is involved in theloss of pyrazinamidase activity. Therefore sequencinganalysis of the pnc A gene could provide rapid diagnosis ofpyrazinamide resistance.CONCLUSIONThe data of this project indicate five time higher prevalence ofpulmonary than extra-pulmonary tuberculosis. Because ofthis pyrazinamide resistance, the patients should be treatedeither by replacing or modifying its combinations or exploresome other effective procedures to stop the mortality andmorbidity. This is the first ever attempt to elucidate themolecular basis of pyrazinamide resistance in clinicalisolates of indigenous Mycobacterium tuberculosis. The PCRand SSCP analysis of isolated and amplified genomic DNA ofindigenous pyrazinamide resistant Mycobacteriumtuberculosis showed the mutation in pnc A gene. Thesefindings also confirmed the hypothesis that inhibition ofpyrazinamidase activity is an indication of mutation in pnc Agene and is a reliable marker of pyrazinamide resistance.However, it needs to be further confirmed in future bysequencing the different fragments of pnc A gene ofpyrazinamide resistant clinical isolates of indigenousMycobacterium tuberculosis.REFERENCES1. Nagwa K, Amin MN, Zagloul MZ, Girgis SA, Shetta M.DNA sequencing and bacteriophage based technique forrapid detection of rifampicin resistant Mycobacteriumtuberculosis. Egypt J Medical Lab Sci 2004; 13:203-209.2. Mokrousov I, Narvskaya O, Otten T, Vyazovaya A,Limeschenko E, Steklova L, et al. Phylogeneticreconstruction within Mycobacterium tuberculosisBeijing genotype in Northwestern Russia. Res Microbiol2002; 153:629–637.3. Van RA, Warren RM, Beyers N, Gie RP, Classen CN,Richardson M et al. Transmission of a multidrugresistantMycobacterium tuberculosis strain resembling“Strain W” among non-institutionalized, humanimmunodeficiency virus seronegative patients. J InfectDis 1999; 180:1608–1615.4. Beenhouwer DH, Lhiang Z, Jannes G, Mijs W,Machtelinckx L, Rossau R et al. Rapid detection ofrifampicin resistance in sputum and biopsy specimensfrom tuberculosis patients by PCR and line probe assay.Tubercul Lung Dis 1995; 76:425–430.5. Torres MJ, Criado A, Palomares JC, Aznar J. Use of realtimePCR and fluorimetry for rapid detection of rifampinand isoniazid resistance-associated mutations inMycobacterium tuberculosis. J Clin Microbiol 2003;38:3194–3199.6. Nazir T, Hameed A, Akhtar MS, Shabbir E, Qureshi JA,Malik A et al. Pyrazinamide resistance ofMycobacterium tuberculosis strains isolated fromhuman patients. Pharmacol Online 2008; 3:948-957.7. Uplekar MW, Rangan S, Weiss MG, Ogden J, BorgdorffMW. Attention to gender issues in tuberculosis control.Int J Tubercul Lung Dis 2001; 5:220-224.8. Haq MA, Khan SR, Saeed SU, Iqbal S, Shabbir R, MagsiJ. Sensitivity Pattern of Mycobacterium tuberculosis atLahore, Pakistan. Annals King Edwards Med Univ 2002;8:190-193.9. Sreenvatsan S, Pan X, Zhang Y, Kreiswirth BN, Musser,JM. Mutations associated with pyrazinamide resistancein pnc A gene of Mycobacterium tuberculosis complexorganisms. Antimicrob Agent Chemo 1997;41:636–640.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 33

Taha Nazir- Characterization of Resistant Isolates of M. Tuberculosis10. Riska PF, Jacobs WR, Alland D. Molecular determinantsof drug resistance in tuberculosis. Int J Tubercul LungDis 2000; 4:4–10.11. Stephen HG. Evolution of Drug Resistance inMycobacterium tuberculosis: Clinical and molecularperspective. Antimicrob Agent Chemother 2002;46:267–274.12. Lemaitre NW, Sougakoff C, Truffot P, Jarlier V.Characterization of new mutations in pyrazinamideresistant strains of Mycobacterium tuberculosis andidentification of conserved regions important for thecatalytic activity of the pyrazinamidase pnc A.Antimicrob Agent Chemother 1999; 43:1761–1763.13. Hirano K, Abe C, Takahashi M. Mutations in the rpo Bgene of rifampin resistant Mycobacterium tuberculosisstrains isolated mostly in Asian countries and their rapiddetection by line probe assay. J Clin Microbiol 1999;37:2663-2666.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 34

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaImpact of Pharmaceutical Care Services on Medication Adherence Behaviourin Geriatric Patients of Old Age Home Settings*Ramesh A , Sandeep SKDepartment of Pharmacy Practice, JSS College of Pharmacy, SS Nagara, Mysore – 570015A B S T R A C TSubmitted: 18/5/2011Accepted: 14/6/2011A prospective study was conducted to assess the influence of pharmacist mediated pharmaceutical care services on medication adherencebehaviour in patients living at Old Age Homes (OAH). Brief Medication Questionnaire (BMQ) was administered to assess the patient'smedication adherence behavior at baseline and at final follow up. During the study, pharmacist developed an individualised pharmaceuticalcare plan and provided tailor made medication information to the patients during the follow-up periods at days 15 and 30 from baselineassessment. Out of 83 enrolled patients aged > 60 years, 75 patients completed all the follow-ups. Overall prevalence of medication adherencewas found 13.3%. The prevalence was high in the age group of 71-80 years (50%), male patients (90%), and those who completed the universityeducation (40%). Patients with one co-morbidity and patients receiving 3 or less medications were found more adherent (50% and 40%). At theend of the study, pharmacist provided pharmaceutical care demonstrated a significant (p

Ramesh A - Impact of Pharmaceutical Care Services on Medication Adherence Behaviour in Geriatric Patients of Old Age Home Settingsmedication reminders, blood pressure measurement andcapillary blood glucose measurement. Patients are at libertyto choose any combination of services offered or receive noservice at all.Patients of both sexes aged more than 60 years, having at leastone chronic disease (eg. hypertension, diabetes mellitus,stroke, etc.) and receiving medications and agreed to give theinformed consent were enrolled in to the study. Patientsreceiving alternative system of medications (Ayurvedic,Homeopathic medications etc.); and with hearing / cognitiveimpairment were excluded from the study. The study wasapproved by Institutional Ethical Committee.The study was conducted over a period of six months fromJuly 2008 to January 2009. After the enrollment, the studypharmacist reviewed the patient source data and recorded thepatients' demographic details, drug usage pattern and selfreported adherence behaviour information in data collectionform. To assess the medication adherence behaviour in thestudy patients' a self reported Brief Medication Questionnaire(BMQ) was used. Patients participated in the study wereasked to complete brief medication questionnaire (BMQ) atbaseline. The patient reported data was compared with theactual prescription of the patient to determine the adherencestatus of the patient. After baseline assessment, thepharmacist developed individualised pharmaceutical careplan and provided tailor made medication information to thepatients to improve their medication adherence status.Patients were followed at day 15 and day 30 from the baselineassessment. Verbal education was given to all patients alongwith a patient information leaflets (PILs) during the follow upperiod. At the end of day 45 (Two weeks after the lasteducation session) BMQ was re-administered to the patientsto assess the impact of pharmacist provided education on thereported adherence behaviour.Patients were grouped gender wise into male and female.Enrolled patients' age was sub classified into different agegroups with a difference of 10 years in each group. Patientswere also classified based on their education level. Theeducation level was classified in to five groups (Illiterate,Primary schooling, secondary schooling, pre-university anduniversity education). Number of patients with no comorbiditiesand with 1, 2 and 3 co-morbidities wasdetermined. Respective percentage proportion was calculatedfor all the patient characteristics.Number of medications used by geriatric patients' wascategorized into six groups (1, 2, 3, 4, 5 and ≥ 6 drugs).Number of patients falling in these groups was determinedand their respective proportion of all patients who receivedmedications was calculated.Impact of education sessions by pharmacist on medicationadherence was assessed by calculating self reported mean andstandard deviation (SD) in both baseline and final follow-upin various screens of BMQ.The regimen screen measures self-reported adherencebehavior. In this part of the questionnaire, questions wereasked about the medication taken in the past week. Patientshad to recall what and how much medication they had takenand whether they missed any pills. Patients received a score of1 if their initial or spontaneous response indicated potentialnon-adherence with the current regimen for the targetmedication. Zero score was assigned if their responseindicated adherence. Indicators of potential non-adherenceinclude failing to mention the target medication or reportingany interruption or discontinuation because of a late refill orother reason. The score range for this screen was zero toseven.The belief screen identifies patient concerns about theefficacy of a given medication and possible concerns aboutunwanted adverse effects and short- or long-term risk (scorerange, 0-2). The recall screen identifies potential problems inreceiving a multiple dose regimen and difficulty inremembering all doses (score range, 0-2). The access screenidentifies patients' difficulty in paying for medications andgetting refills in time (score range, 0-2).Statistical significance of adherence was assessed by usingChi square test. p-value less than 0.05 was consideredsignificant and 0.001 was considered highly significant inChi-square test. The statistical analysis was carried out usingstatistical package for the social sciences (SPSS, version17.0).RESULTSEighty three patients aged > 60 years meeting the studycriteria were enrolled in the study. Of them, 75 patientscompleted all the follow-ups, eight patients were consideredas drop outs as they were irregular in their follow-ups.Baseline characteristics of the patients who completed allfollow-up are presented in Table No.1.The mean age group of the study patients was 75.5 (SD, 8.4)years. In addition, majority patients were female patients57.3% (n= 43) and 69.3% (n=52) patients were literates. Onaverage, each of the subject had 0.85 (SD, 0.82) comorbiditiesand were taking three (SD, 1.9) types ofmedications. The four commonest disease conditions forwhich medications were used were hypertension (29.3%),hypertension with type 2 diabetes mellitus (16%),hypertension with asthma (9.3%) and, type 2 diabetesmellitus (6.7%).Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 36

Ramesh A - Impact of Pharmaceutical Care Services on Medication Adherence Behaviour in Geriatric Patients of Old Age Home SettingsTable 1: Baseline Patient CharacteristicsCharacteristicsNo. of patientsn=75 (%)Age60-70 (Young old) 21 (28)71-80 (Middle old) 36 (48)≥ 81 (Old old) 18 (24)GenderMale 32 (42.7)Female 43 (57.3)Education LevelIlliterate 23 (30.7)Primary school 18 (24)Secondary school 15 (20)Pre-university 6 (8)University 13 (17.3)Co-morbidities0 (Nil) 28 (37.3)1 33 (44)2 11 (14.7)3 3 (4)No of Medications1 15 (20)2 21 (28)3 19 (25.3)4 7 (9.3)5 4 (5.3)≥ 6 9 (12)DiseasesHypertension 22 (29.3)Hypertension + Type 2 diabetes 12 (16)Type 2 diabetes 5 (6.7)Hypertension + Asthma 7 (9.3)Miscellaneous 29 (38.7)In our study, at baseline 10 (13.3%) patients were foundadherent to their medications. The middle old group (aged 71-80 years) patients were more adherent (50%), and theadherence was high in male (90%, n=9) patients. The greaterself-reported adherence was seen in patients who completeduniversity education (40%, n=4). Patients having one comorbidityand patients receiving 3 medications were moreadherent (50%, n=5 and 40%, n=4) respectively. Theadherence status of enrolled patients, for all demographicalvariables is presented in Table No. 2.After classification of patients into medication adherent andnon-adherent categories there were no statistically significantdifferences found between the two groups with respect totheir baseline characteristics with exception of female gender(Table 2). Factor that is shown to be associated withmedication non-adherence is female gender (P < 0.05, OR=16.43; 95% CI, 1.96-137.97). However, (1) university leveleducation (OR=12.0; 95% CI, 1.24-116.18; P=0.021); and (2)receiving five type of medications (OR=16.0; 95% CI, 1.22-210.6; P=0.04) are found to be protective factors formedication non-adherence.The mean BMQ scores in various screens at the baselinesuggest that the patients were non-adherent to theirmedications. Pharmacist provided pharmaceutical caredemonstrated a significant (p

Ramesh A - Impact of Pharmaceutical Care Services on Medication Adherence Behaviour in Geriatric Patients of Old Age Home SettingsTable 2: Comparison of Medication Behaviour at BaselineCharacteristicsNo. of Adherent No. of Non-Adherent Odds Ratio P-valuePatients n=10 Patients n=65 (95% CI)Age60-70 (Young old) 2 19 - -71-80 (Middle old) 5 31 1.53 NS≥ 81(Old old) 3 15 1.9 NSGenderMale 9 23Female 1 42 16.43 0.0015Education LevelIlliterate 0 23 - -Primary school 2 16 4.24 0.22Secondary school 3 12 7.39 0.07Pre-university 1 5 8.0 0.14University 4 9 12.0 0.021Co-morbidities0 (Nil) 1 27 - -1 5 27 5.0 0.132 3 8 10.13 0.063 1 2 13.5 0.19No of Medications1 0 15 - -2 1 20 1.52 0.623 4 15 5.0 0.154 1 6 4.57 0.275 2 2 16.0 0.04≥ 6 2 7 6.0 0.15DiseasesHypertension 1 21 - -Hypertension + Type 2 diabetes 2 10 4.2 0.28Type 2 diabetes 0 5 1.83 0.55Hypertension + Asthma 0 7 1.3 0.63Miscellaneous 7 22 6.68 0.06Table 3. Comparison of Mean Bmq Scores at Baseline and Final Follow-upScreens No. of Baseline Final Follow-up P-value*patients Mean (SD) Mean (SD)aRegimen 75 1.51 (0.92 ) 0.28 (0.56)

Ramesh A - Impact of Pharmaceutical Care Services on Medication Adherence Behaviour in Geriatric Patients of Old Age Home Settingspatients compared to female patients. In old age homes femaleresidents are financially dependent on their family, and haveless knowledge towards their medication, hence non-adherentto their medications.Majority study patients were literates (69.3%). The level ofeducation in literate groups was primary education (24%),secondary education (20%), pre-university education (8%)followed by university education (17.3%). The level ofliteracy correlated well with the level of patients' medicationknowledge and adherence to their medications. Illiterate andless educated geriatric patients (primary schooling) werefound to be less adherent to their medications and wereunaware about the usage and usefulness of medications theywere receiving compared to their counterparts who were moreeducated.Similar observations were found in studies conducted by18 20 21Spiers et al Mangasuli et al., and Mini et al. However, in a22study, conducted by Burge et al. education was negativelycorrelated with adherence. Previous researchers have foundthat poor health literacy resulted in deleterious effect onhealth outcomes, medication knowledge, and medication23,24adherence. . While we did not measure health literacyspecifically in our study, it was expected that low educationand trouble in reading labels would have interfered withadherence.In our study, more patients were constituted with one or moreco-morbidities (62.7%). No correlation was observedbetween number of co-morbidities and medicationadherence. However, a local study conducted by Karibasappa25et al. reported the correlation between presence of comorbiditiesand adherence level. Our finding shows thatelderly patients with one or more co-morbidities have equalmedication adherence status compared to patients withoutany co-morbidity. This may be due to both groups having lessknowledge towards their medication therapy. Pharmacisteducation session has significantly improved scores inregimen screen and adherence in all patients, but not in otherscreens.Majority of our study patients (80%) were taking two or moremedications. A nonsignificant increase in adherence wasobserved. The number of different medications prescribedwas not correlated well with medication adherence. This was22consistent with the findings of Burge et al. While ourfindings were not similar with that reported in previous local20study by Mangasuli et al. or overseas studies conducted by5 8Col N et al. and Lam et al. These studies showed a greaterproportion of non-adherence as the medications increases.Difference in our study result might be because of observationin smaller sample size. In our study, a significantimprovement (p

Ramesh A - Impact of Pharmaceutical Care Services on Medication Adherence Behaviour in Geriatric Patients of Old Age Home SettingsPractice for the support and valuable suggestions during thecourse of study. Special thanks to all the participants for theirtime, support and for providing the required information.REFERENCES1. L Furniss. Use of medicines in nursing homes for olderpeople. Advances in Psychiatric Treatment. 2002;8:198-204.2. Fick DM, Mion LC, Beers MH, Waller JL. Healthoutcomes associated with potentially inappropriatemedication use in older adults. Res Nurs Health.2008;31:42-51.3. Col N, Fanale JE, Kronholm P. The role of medicationnoncompliance and adverse drug reactions inhospitalizations of the elderly. Arch Intern Med.1990;150:841-5.4. Furniss L, Burns A, Craig SKL, Scobie S, Cooke J,Faragher B. Effects of pharmacist medication review innursing homes. Br J Psychiatry. 2000;176:563-67.5. Clayson M., Lam TH. A review of repeat medications ina local nursing home. Work Based Learning in PrimaryCare. 2003;1: 48-55.6. Lam PW, Lum CM, Leung MF. Drug non-adherenceand associated risk factors among Chinese geriatricpatients in Hong Kong. Hong Kong Med J. 2007;13:284-292.7. Helping older people to take prescribed medication intheir own home: what work? [Online]. 2005 [Cited2 0 0 9 J a n 1 8 ] ; 1 - 1 6 . Av a i l a b l e f r o mwww.scie.org.uk/publications/briefings/files/briefings.8. Gurwitz JH, Field TS, Harrold LR, Rothschild J,Debellis A, Seger AC, et al. Incidence andpreventability of adverse drug events among olderpersons in the ambulatory setting. JAMA.2003;289:1107-1116.9. Krueger KP, Berger BA, Felkey B. Appendix D.Medication adherence and persistence. In: NationalQuality Forum. Improving use of prescriptionmedications: a national action plan. Washington, DC:National Quality Forum, 2005:D1-D41.10. Maack B, Miller DR, Johnson T, Dewey M. Economicimpact of a pharmacy resident in an assisted livingfacility-based medication therapy managementprogram. Ann Pharmacother. 2008; 42:1613-20.11. Opdycke RAC, Ascione FJ, Shimp LA, Rosen RI. Asystematic approach to educating elderly patients abouttheir medications. Patient Education and Counseling.1992;19:43-60.12. Lowe CJ, Raynor DK, Purvis J, Farrin A, Hudson J.Effects of a medicine review and education programmefor older people in general practice. Br J ClinPharmacol. 2000;50:172-175.13. Krass I, Taylor SJ, Smith C, Armour CL. Impact onmedication use and adherence of Australianpharmacists' diabetes care services. J Am Pharm Assoc.2005;45(1):33-40.14. Vik SA, Maxwell CJ, Hogan DB, Patten SB, JohnsonJA, Slack LR. Assessing medication adherence amongolder persons in community settings. Canadian Journalof Clinical Pharmacology. 2005;12(1): e152-e164.15. Spiers, Mary V, Kutzik, David M, Lamar, Melissa.Variation in medication understanding among theelderly. Am J Health Syst Pharm. 2004;61:373-380.16. Kennerfalk A, Ruigomez A, Wallander MA,Wilhelmsen L, Johansson S. Geriatric drug therapy andhealthcare utilization in the United kingdom. AnnPharmacother. 2002;36:797-803.17. Mangasuli S. Study of medication knowledge andadherence among patients on haemodialysis – role ofclinical pharmacist [M.Pharm thesis]. Mysore (India):Rajiv Gandhi University of Health Science;2004.18. Mini KV. Evaluation of medication adherence behaviorin HIV / AIDS patients. [M.Pharm thesis]. Mysore(India): Rajiv Gandhi University of HealthScience;2008.19. Burge S, White D, Bajorek E, Bazaldua O, Trevino J,Wright F et al. Correlates of Medication Knowledge andAdherence: Findings From the Residency ResearchNetwork of South Texas. Family Medicine.2005;37:712-718.20. Kalichman SC, Rompa D. Functional health literacy isassociated with health status and health-relatedknowledge in people living with HIVAIDS. J AcquirImmune Defic Syndr. 2000;25(4):337-44.21. Kalichman SC, Ramachandran B, Catz S. Adherence tocombination antiretroviral therapies in HIV patients oflow health literacy. J Gen Intern Med. 1999;14(5):267-73.22. Karibasappa MV. Assessment of medication usageknowledge and medication adherence pattern of ruralpatients with chronic disease. [M.Pharm thesis].Mysore (India): Rajiv Gandhi University of HealthScience;2007.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 40

Azizulla S G - Study of prescribing patterns of antibiotics used in the management of various infectious diseasesIndian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaPathogenic Isolates of Wound Infections and their CorrespondingSusceptibility Patterns: Diagnostic Center Based Retrospective Study1 2* 3 4 5 6Manik CS , Utpal KK , Subrata KB , Moni RS , Farjana K , Asish KD1Coordinator – In-Patient Pharmacy, Pharmacy Department, Square Hospitals Ltd, Dhaka, Bangladesh2Assistant Professor, Pharmacy Discipline, Khulna University, Khulna, Bangladesh3Assistant Professor, Department of Pharmacy, BGC Trust University Bangladesh, Chittagong, Bangladesh4Assistant Professor, Department of Pharmacy, Stamford University Bangladesh, Dhaka, Bangladesh5Lecturer, Department of Pharmacy, East West University, Dhaka, Bangladesh6Associate Professor, Pharmacy Discipline, Khulna University, Khulna, BangladeshA B S T R A C TSubmitted: 120/7/2011Accepted: 6/8/2011Wound infection is one of the major health problems causing death especially in the developing countries. This study was aimed to find out thesignificant clinical isolates of wound infections and their antimicrobial susceptibility patterns for better understanding of therapeuticmanagement. A retrospective review of culture sensitivity assay data of 207 patients from log and resister book of Medinova Diagnostic Centerlocated in Dhaka of Bangladesh over six months period and the data were analyzed statistically. The study revealed that majority of the infectedpatients (59.42%) was male. Microbial assay confirmed that 38.46% of the isolates were Staphylococcus aureus which was the most prevalentpathogen. Other common isolates were Pseudomonas sp. and E. coli representing 23.19% and 20.77% respectively. Antibiogram conformedthat Imipenem (94.3%) had the highest sensitivity followed by Meropenem (89.8%), Colistin (88.1%), Netilmycin (86.5%), and Amikacin (82.3%)against all wound isolates. Conversely, Amoxicillin was the most resistant antibiotic followed by Cephalosporin and Ciprofloxacin. Antibioticresistance is now a global warning issue in the medical care due to changes in microbial genetic ecology resulting from indiscriminate use ofantibiotics. This study demonstrated most vanguard antibiotics are getting resistant against invasive wound isolates.Keywords: Wound Infection, Antibiotics, Antibiogram, Wound Isolate, Antibiotic Resistance.INTRODUCTIONWound infection may be defined as the presence of pus in alesion followed by other general or local features of sepsis1including pyrexia, pain and indurations . Wound infection isone of the health problems which is originated and aggravatedby the invasion of single or multiple pathogenic organisms indifferent parts of the body causing death of large number of2people in developing countries . Studies have shown that S.aureus, Klebsiella species, E. coli, Proteus species,Streptococcus species, Entrobacter species, Pseudomonasspecies and Coagulase negative Staphylococci are the mostcommon bacterial pathogens isolated from wound2,3,4infections . Wound infections often result in prolongedAddress for Correspondence:Utpal Kumar Karmakar, Assistant Professor, Pharmacy Discipline, Khulna University,Khulna, BangladeshE-mail:ukk146@gmail.comhospitalization about 6 – 10 days more augmenting hospital5, 6, 7cost almost doubles for the management of the patient .Increased resistant of microbes of wound infection havedeteriorated the condition thereby throwing immense2, 8confront of the effectiveness of antimicrobials worldwide .The situation is getting serious in developing countries due to9irrational prescription of antimicrobial agents . Thusmanagement of infected wounds is a challenging one in termsof rational antimicrobial use in the presence of wide array of10antimicrobial drugs .Present study was aimed to find out common bacterial isolatesof wound infections and its' corresponding antibiogram.METHODThis is a retrospective study where culture sensitivity recordsof 207 wound infected patients were reviewed randomly same11as the study of Shill et al. Data were collected from log andregister book of Medinova Diagnostic Center, Dhaka,Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 41

Manik C S - Pathogenic Isolates of Wound Infections and their Corresponding Susceptibility Patterns: Diagnostic Center Based Retrospective StudyBangladesh from July 2009 to December 2009. Culture5records showing bacterial count more than 10 cfu / ml weretaken into consideration.Fig. 2: Allotment of pathogenic isolates of woundinfection (in percentage).Antibiotic SensitivityProceedings have confirmed that antimicrobial susceptibilitytest was made by the diagnostic center on Mueller-Hintonagar as per the standard disc-diffusion method recommended12by Clinical and Laboratory Standards Institute (CLSI) 2007against Amoxicillin (10 μg), Amikacin (30 μg), Coamoxiclav(20/10 μg), Cefotaxime (30 μg), Ceftazidime ( 30μg), Ceftriaxone (30 μg), Cefuroxime (30 μg), Cephradine(30 μg), Chloramphenicol (30 μg), Ciprofloxacin (5 μg),Colistin (10 μg), Gentamycin (10 μg), Imipenem (10 μg),Meropenem (10 μg) and Netilmycin (30 μg).Data AnalysisData were analyzed statistically using Microsoft® Excel112002 (10.6854.6845) SP3 software.RESULTSIn the study total 207 wound cases were analyzed. It has beenobserved that 59.42% (n=123) of the cases were male and40.58% (n=84) were female. Age group 35 to 49 representshighest number of cases followed by 20 to 34 and 50 to 65 agegroup. Detail information showed in the Figure No. 1Microbiological test confirmed 40.58% (n=84) isolates asgram positive and 59.42% (n=123) as gram negative bacteria.Among the gram positive bacteria Staphylococcus aureus andEnterococcus sp. were evident where as gram negativebacteria stated Pseudomonas sp., E. coli, Klebsiella sp.,Acinetobacter and Proteus sp. Considering all the isolates,Staphylococcus aureus was found to be prominent (38.46%),followed by Pseudomonas sp. and E. coli. More informationdepicted in Figure No. 2Fig 1: Distribution of wound cases in different agegroups and sexStudy demonstrated that Klebsiella sp. showed 100%resistance against Amoxicillin whereas fabulous sensitivitytoward Colistin (100%), Meropenem (94.7%), Imipenem(94.4%), Netilmycin (92.3%) and Amikacin (90%). E. colishowed similar pattern of sensitivity. Again Acinetobacterwas 100% resistant to Amoxicillin and Cephradine thoughexcellent sensitivity was observed with Imipenem (100%),Meropenem (88.9%). Alternatively Colistin Imipenem andMeropenem exhibited most sensitive response towardPseudomonas sp. while most resistant against Cephradine,Amoxicillin and Co-amoxiclav. In case of Staphylococcusaureus, Amoxicillin showed the highest resistance howeverNetilmycin and Chloramphenicol demonstrated superiorsensitivity. On the contrary, most of the antibiotics conferredenormous sensitivity against Proteus sp. while Enterococcussp. accomplished 100% sensitivity to Imepenem,Meropenem, Amikacin and Netilmycin. Detail of theantibiogram illustrated in Table No.1Overall sensitivity of antibiotics, considering the entirewound isolates, Imipenem (94.3%) was the highest followedby Meropenem (89.8%) and Colistin (88.1%) Moreinformation presented in the Figure No. 3.Fig. 3: Downhill positioning of antibiotics based onoverall sensitivity against wound isolates.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 42

Manik C S - Pathogenic Isolates of Wound Infections and their Corresponding Susceptibility Patterns: Diagnostic Center Based Retrospective StudyTable 1: Sensitivity pattern of antibiotics against wound isolates (in percentage).Klebsiella E. coli Acinetobacter Pseudomonas Staphylococcus Proteus sp. Enterococcussp. sp. aureus sp.(n=20) (n=43) sp (n=9) (n=48) (n=80) (n=3) (n=4)% sensitivity of antibiotic(s) against pathogen (s)Amoxicillin 0.0 7.0 0.0 4.2 13.8 66.7 75.0Co-amoxiclav 44.4 45.0 0.0 8.9 78.4 66.7 25.0Cephradine 10.0 9.3 0.0 0.0 65.8 0.0 25.0Cefotaxime 45.0 19.0 12.5 6.3 53.4 100.0 50.0Ceftazidime 42.1 37.2 11.1 57.4 48.7 100.0 50.0Cefuroxime 40.0 16.3 0.0 0.0 61.0 100.0 50.0Ceftriaxone 40.0 18.6 22.2 8.3 54.4 100.0 66.7Ciprofloxacin 50.0 23.3 12.5 46.8 41.3 0.0 33.3Chloramphenicol 57.9 65.8 0.0 13.9 91.3 33.3 50.0Colistin 100.0 94.1 50.0 94.1 77.8 100.0 0.0Imipenem 94.4 100.0 100.0 88.2 66.7 100.0 100.0Meropenem 94.7 100.0 88.9 79.5 66.7 100.0 100.0Gentamycin 60.0 52.4 22.2 45.7 81.6 100.0 33.3Amikacin 90.0 90.7 33.3 79.2 0.0 100.0 100.0Netilmycin 92.3 86.4 83.3 78.3 100.0 100.0 100.0DISCUSSIONCurrent study illustrated male and female ratio of 1.5:1 which13is similar with the study conducted by Aizza Zafar et al. ,while other study carried out by Kaabachi et al. and Jamali etal. demonstrated male: female as 1.6:1 and 1.7:1 respectively14, 15 . Ayliffe GA et al. in their study showed that the infection16rate was lowest among patients between 20 and 40 years old .Again D. J. Byrne et al. illustrated that higher incidence ofwound infection rate with increasing age in the in-hospitalcohort whereas the incidence of outpatient wound infections17declined with age . Our study showed most prevalent woundinfections cases reside in 35 - 49 age group.Aizza Zafar et al. showed 49.54% Gram positive and 50.45%Gram negative isolates while most frequent organism was S.13aureus 41.28% followed by Pseudomonas sp. 18.35% . Ourstudy also provide similar trend of occurrence of isolates.Other study performed by Fantahun Biadglegne et al.demonstrated that Staphylococcus aureus was thepredominant isolate 69.7% followed by Proteus species 9.5%18and Kelebsiella species 5% .Muthukrishnan Srinivasan et al. illustrated that Ampicillin,Cephalosporin, Ciprofloxacin and Gentamycin were 55% to19100% resistance to S. aureus . Again Syed Asad Ali et al.showed that Penicillin derivatives, Carbapenem, Quinolones,Aminoglycosides and Glycopeptides were the most effectiveantibiotics against S. aureus while Cephalosporin(s) and20Macrolide(s) were ineffective against S. aureus . El-Astal Zin his study observed that Amoxicillin (73.2%) was thehighest resistant antibiotics whereas Cephalosporin(s)(approx.13% to 19%) were the moderately resistant21antibiotics against S. aureus . But our study has revealedAmoxicillin as the most resistant antibiotic to S. aureusfollowed by Ciprofloxacin and Cephalosporin whileNetilmycin, Chloramphenicol Gentamycin and Coamoxiclavperformed sensitivity.Muthukrishnan Srinivasan et al and Parviz Owlia et al. in theirstudy confirmed that Cephalosporin, Ciprofloxacin,Gentamycin and Amikacin were the most resistant antibiotics19, 22to Pseudomonas . Other study conducted by Syed Asad Aliet al. stated that Penicillin Derivatives and Carbapenemserved 100% sensitivity against Pseudomonas followed by20Aminoglycosides . Similar findings coincided in our studyregarding Pseudomonas sp. with few exceptions.Study showed that Quinolone (50%), Carbapenem (100%),20Co-amoxiclave (88.2%) were most sensitive to E. coli .Again, other research focused that Ciprofloxacin,Cephalosporin and Gentamycin were most resistant to E. coli19. Our study reveals that Imipenem, Meropenem, Colistin,Amikacin and Netilmycin are the most sensitive whereasAmoxicillin and Cephalosporin are the most resistantantibiotics to E. coli.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 43

Manik C S - Pathogenic Isolates of Wound Infections and their Corresponding Susceptibility Patterns: Diagnostic Center Based Retrospective StudySyed Asad Ali et al. in their study pointed up that Carbapenem(100%) was the most sensitive and Quinolones were fair20sensitive to Kelebsiella sp. . Our study provides similar trendof antibiogram of Carbapenem and Ciprofloxacin toKelebsiella sp.CONCLUSIONWound infection is an ongoing problem worldwide especiallyin the developing countries. This study confers an insight ofprevalence of pathogenic isolates of wound infection inDhaka, Bangladesh indicating most of the profound woundisolates are developing resistant to frontline antibiotic whichshould be immediately taken into consideration.REFERENCES1. Shija JK. The Incidence and Pattern of Sepsis amongGeneral Surgical In-Patients at Muhimbili Hospital, DarEs Salam, 1973 – A Preliminary Report. East AfricanMedical Journal 1976; 53 (3): 153 - 1592. Mulu A, Moges F, Tessema B, Kassu A. Pattern andmultiple drug resistance of bacterial pathogens isolatedfrom wound infection at University of Gondar TeachingHospital, North West Ethiopia. Ethiop Med J. 2006; 44(2): 125-1313. Enweani UN. Surgical Wound Sepsis in CleanOrthopaedic Procedures: Bacteriology and SensitivityPattern in a regional Specialist Centre. Orient Journal ofMedicine 1991; 3 (1): 1 - 64. Otokunefo TV, Datubo – Brown DD. Bacteriology ofWound infections in the Surgical Wards of a TeachingHospital. West African Medical Journal 1990; 9 (4): 285 -2905. Anyiwo MD. Nosocomial Infections Still a Danger inHospital Practice. Orient Journal of Medicine 1995; 7(3/4): 28-326. Plowman R. The socioeconomic burden of hospitalacquired infection. Euro. Surveill. 2005; 5 (4): 49-50.7. Zoutman D, McDonald S, Vethanayagan D. Total andattributable costs of surgical-wound infections at aCanadian tertiary-care center. Infect. Control Hosp.Epidemiol 1998; 19: 254-2598. Onyang D, Machoni F, Waindi EN. Multi drug resistanceof Salmonella enterica serovars Typhi and Typhimuriumisolated from clinical samples at two rural hospitals inWestern Kenya.J. Infect Developing countries.2008; 2:106-111.9. Shears P, Antimicrobial resistance in the tropics. Tropicaldoctor 2003; 30(2): 114-116.10. Sule A.M. Olusanya, O. In-vitro Antibacterial Activitiesof fluoroquinolones Compared with commonAntimicrobial Agents against Clinical Bacterial Isolatesfrom Parts of South Western Nigeria. Nigerian QuarterlyJournal of Hospital Medicine 2000; 10 (1)11. Shill MC, Huda NH, Moain FB, Karmakar UK.Prevalence of Uropathogens in Diabetic Patients andTheir Corresponding Resistance Pattern: Results of aSurvey Conducted at Diagnostic Centers in Dhaka,Bangladesh. Oman Medical Journal 2010; 25 (4): 282 –28512. Clinical and Laboratory Standards Institute (CLSI)guideline M 100 – S 17 for determining bactericidalactivity of antimicrobial agents. Villanova, PA., 200713. Zafar A, Anwar N, Ejaz H, Bacteriology of InfectedWounds - A Study Conducted at Children HospitalLahore. Biomedica 2007; Vol. 23 (URL: http://thebiomedicapk .com/ articles/124.pdf)14. Kaabachi O, Lataief I, Nessib M M, Jelel C, Ben-Abdulaziz A, Ben-Ghazhem M. Prevelence and riskfactors for postoperative infection in pediatric orthopedicsurgery: a study of 458 children. Rev. Chir. Orthop.Reparatrice. Appar. Mot. 2005; 91 (2): 103-815. Jamali AR, Mehboob G, Majid A, Bhatti A, Minnas S,Raja A, Cheema G. Postoperative Wound Infections inOrthopaedic Surgery. J. Coll. Physicians Svrg. Pak 2001;11 (12): 747- 9.16. Ayliffe GA, Brightwell KM, Collins BJ, Lowbury EJ,Goonatilake PC, Etheridge RA. Surveys of hospitalinfection in the Birmingham region: Effect of age, sex,length of stay and antibiotic use on nasal carriage oftetracycline-resistant Staphyloccus aureus and on postoperativewound infection. J Hyg (Lond) 1977; 79(2):299-314. (PubMed)17. Byrne DJ, Lynch W, Napier A, Davey P, Malek M,Cuschieri A. Wound infection rates: the importance ofdefinition and post-discharge wound surveillance.Journal of Hospital Infection 1994; 26(1): 37 – 4318. Biadglegne F, Abera B, Alem A, Anagaw B. BacterialIsolates from Wound Infection and their AntimicrobialSusceptibility Pattern in Felege Hiwot Referral Hospital,North West Ethiopia. Ethiop J Health Sci. 2009; 19(3):173 - 177Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 44

Manik C S - Pathogenic Isolates of Wound Infections and their Corresponding Susceptibility Patterns: Diagnostic Center Based Retrospective Study19. Srinivasan M, Uma A, Vinodhkumaradithyaa A, GomathiS, Thirumalaikolundussubramanian P. The MedicalOvercoat – Is It a Transmitting Agent for BacterialPathogens? Jpn. J. Infect. Dis. 2007; 60: 121 - 12220. Ali SA, Tahir SM, Memon AS, Shaikh NA. Pattern ofPathogens and Their Sensitivity Isolated from SuperficialSurgical Site Infections In a Tertiary Care Hospital. JAyub Med Coll Abbottabad. 2009; 21(2): 80 – 82 (URL:http://www.ayubmed.edu.pk/JAMC/PAST/ 21-2/Asad.pdf)21. El-Astal Z. Bacterial Pathogens and Their AntimicrobialSusceptibility in Gaza Strip, Palestine. Pak J Med Sci.2004; 20(4): 365 - 67022. Owlia P, Saderi H, Mansouri S, Salemi S, Ameli H. Drugresistance of isolated strains of Pseudomonas Aeruginosafrom burn wound infections to selected antibiotics anddisinfectants. Iranian Journal of Pathology 2006; 1 (2):61-64Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 45

Azizulla S G - Study of prescribing patterns of antibiotics used in the management of various infectious diseasesIndian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaDrug Utilization Study in Cataract Patients from South Gujarat Region1 2 3 4Bhavikkumar HS *, Bhavin V , Divyesh JV , Jasmina SS1Herbal Drug Technology, M.S.university of Baroda, Vadodara, Gujarat.2Maliba Pharmacy College, Gopal vidyanagar, Bardoli, Surat, Gujarat.3Torrent Research Centre, Ahmedabad, Gujarat.4Bhagvan Mahavir Pharmacy College, Surat, Gujarat.A B S T R A C TSubmitted: 9/4/2011Accepted: 27/6/2011Cataract is a clouding of the lens sufficient to reduce vision. Most cataracts develop slowly as a result of aging, leading to gradual impairment ofvision. The formation of cataract occurs more rapidly in patients with a history of ocular trauma, uveitis, or diabetes mellitus. It is important torealize that inappropriate use of drugs represents a potential hazard to the patients and an unnecessary expense. Thus present study wasundertaken to assess the pattern of prescription and drug utilization by measuring WHO delineated drug use indicators that will help to identifypotential hazards and cost effectiveness of the treatment in cataract patients. This study was conducted in the South Gujarat region.Prescriptions of the outpatient were collected from the area of Surat, Bardoli, Valasad, Vapi and Navsari. Total number of prescriptions analyzedwere 317, in which total of 733 drugs were prescribed. Analysis of the prescriptions showed that average number of drugs per prescription was2.31. The number of antibacterial alone prescribed was 349(47.61%) out of these, 315(90.26%) antibacterial prescribed in the form of drops and34(9.74%) as orally. The number of steroids alone prescribed was 148(20.19%) out of these, 85(57.43%) prednisolone as eye drops and63(42.57%) dexamethasone as eye drops were found. Number of encounters with combination of antibacterial and steroid were 41(5.59%).Others used were mydriatics, lubricants and miscellaneous eye drops 195(26.60%). The type of dosage forms were also recorded andclassified. Our study showed a remarkable control on prescribing pattern that helpful to avoid polypharmacy and provide facts for costeffectiveness and frequently used drug in cataract by physicians.Keywords: Cataract, uveitis, mydriatics, Drug utilization and PolypharmacyINTRODUCTIONWhat is cataract? :The term cataract refers to any opacity of various degree ofcrystalline lens, which is normally almost completelytransparent. With normal aging nuclear lens proteinsaggregate and are chemically modified to producepigmentation, decreasing transparency. Changes within thelens nucleus are usually accompanied by changes in otherparts of the lens. Aging causes nuclear, cortical and posteriorsub capsular cataracts, each to varying degrees. When thesechanges cause a cataract in the lens, the patient mayexperience visual impairment, loss of contrast, and dulling1perception of colors. Most cataracts are related to aging.Cataracts are very common in older people. A cataract canAddress for Correspondence:Bhavikkumar H Satani, M.Pharm, Herbal Drug Technology, Shree G.H.Patel Pharmacybuilding, Donor's plaza, Opp. M.S.university main office, Fatehgunj, Baroda, Gujarat, India.Pin Code: 390002.E-mail: satanib1231@gmail.com, satanib_mpc@yahoo.co.in2occur in either or both eyes. The risk of cataract increases asyou get older. Other risk factors for cataract are certaindiseases (such as diabetes), personal behavior (such assmoking and alcohol use), patients with a history of oculartrauma and uveitis and the environment (such as prolonged2, 3exposure to sunlight).Symptoms of cataract:2The most common symptoms of a cataract are:Ÿ Cloudy or blurry vision, Poor night visionŸ Colors seem fadedŸ Glare, headlights, lamps, or sunlight may appear toobright. A halo may appear around lightsŸ Double vision or multiple images in one eye (Thissymptom may clear as the cataract gets larger)Ÿ Frequent prescription changes in your eyeglasses orcontact lensesŸ These symptoms also can be a sign of other eye problemsIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 46

Bhavikkumar H S- Drug Utilization Study in Cataract Patients from South Gujarat RegionDiagnosis of a cataract:Cataract is detected through a comprehensive eye exam thatincludes: Visual acuity test, Dilated eye exam and2Tonometry.2Treatment of a cataract:The symptoms of early cataract may be improved with neweyeglasses, brighter lighting, anti-glare sunglasses, ormagnifying lenses. If these measures do not help, surgery isthe only effective treatment. Surgery involves removing thecloudy lens and replacing it with an artificial lens.Two types of cataract surgery are phacoemulsification orphaco and extra capsular surgery. After the natural lens hasbeen removed, it often is replaced by an artificial lens, calledan intraocular lens (IOL). An IOL is a clear, plastic lens thatrequires no care and becomes a permanent part of your eye.Light is focused clearly by the IOL onto the retina, improvingyour vision.Post-operative treatment after cataract surgery:As with any surgery, cataract surgery poses risks, such asinfection and bleeding. Before cataract surgery, patient needto temporarily stop taking certain drugs that increase the risk2of bleeding during surgery.Problems can include infection, bleeding, inflammation(pain, redness, and swelling), loss of vision, double vision,and high or low eye pressure. With prompt medical attention,these problems can usually be treated successfully.Sometimes the eye tissue that encloses the IOL becomescloudy and may blur your vision. This condition is called anafter-cataract. An after-cataract can develop months or years2, 4after cataract surgery.Chemotherapy of microbial diseases in the eye includes usageof following category of drugs:Antibacterial agents, Antiviral agents, Antifungal agents and5Antiprotozoal agents.Such a large number of medication used depending ofconditions. That requires control over the prescribing tocontrol drug interactions and polypharmacy. It is important torealize that inappropriate use of drugs represent a potential6hazard to the patients and unnecessary expense. Study herewas carried to identify the potential hazards in terms of polypharmacy and patient compliance of outdoor patients of southGujarat region. It was also focused to check which drug inwhich form is being frequently used by physicians. Lake ofawareness about latest knowledge might come out withinferior quality of treatment so one more question have alsobeen taken in to account is/are there any drug(s)/combination(s) required to be replaced by latest drug(s)/combination(s)?Objective:Study was carried out to find out current prescribing patternamong the practitioners in south Gujarat region and alsoaimed to find out utilization of number of drugs perprescription which reflects on possibilities of druginteraction, patient compliance and cost effectiveness oftreatment. Study was also projected for most frequently useddrugs by physicians in cataract post-operative treatment.MATERIAL AND METHODSData were collected from the prescription of the out patientsvisiting Out Patient Department (OPD) at clinics locatednearer to Bardoli, Surat and Vapi during period of January2010 to September 2010. Data were recorded in writtendirectly from patient's prescription with prior permission ofpractitioner and patient. For the collection of data patientswere either approached to their residences based on dataprovided from the hospitals or data were collected whenpatients came to hospital for follow up. Patients who were onpost-operative treatment were selected for our study. BothMale and female patients included in study having 1 to 6months of track record in particular hospital. Patients whowere at pre-operative stage of treatment and having any othereye disorders associated with cataract were not included inthis study. From one patient prescription was recorded onlyfor once. Once prescription had recorded from patient'srecord then the same patient had not been considered twice forprescription data. All the selected patients having age ranged50-65 years, body mass index ranged 22.7-27.0. All selectedpatients were Indian and from south Gujarat region. We havenot performed any activities on patients but only data havebeen collected so ethical committee (EC) clearance were notsupposed to require. However we have taken permission fromphysicians and patients.Prescriptions audited were 317.After collection allprescriptions were classified according to number of drug/sthat it contained. Database was prepared for total number ofprescription and total number of drugs found in allprescriptions. Using these data average number of drug/s perprescription was calculated by dividing total number of drugsfound in all prescriptions by total number of prescriptionsaudited.All the drugs found in all prescription were then classified onthe bases of pharmacological classes, such as antibacterialalone, steroid alone, antibacterial and steroid in combinationIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 47

Bhavikkumar H S- Drug Utilization Study in Cataract Patients from South Gujarat Regionand miscellaneous. Drugs from each class was also divided infour groups based on their dosage form (i.e. eye drops, oraldosage form, ointments and injections) and reportedwhichever is applicable.In the same way, each class was studied for variouspharmacological agents of that class and most frequently usedagents were reported. Here all the data is reported in numbersas well as in percentage of total of each class.All the drugs prescribed were recorded for its dosage formand route of administration. These records are then analyzedin different ways to find out other agents and dosage form ofdrugs.For all type of data processing we have used Microsoft excel2007.RESULTSTotal numbers of prescriptions analyzed for study were 317and total numbers of drugs in 317 prescriptions were 733.Number of drugs per prescription varied from one to five withaverage of 2.31 (Table 1). Antibacterials alone were349(47.61%) in all found 733 drugs (Figure 1), out of these349 drugs, 315(90.26%) antibacterials were prescribed in theform of drops and 34(9.74%) antibacterials were prescribedas oral dosage form. Mostly fluoroquinolones were used ofwhich gatifloxacin was prescribed widely (Table 2) followedby Ciprofloxacin, Chloramphenicol, Gentamycin,Sparfloxacin, Cefadroxil, Moxifloxacin, Amikacin,Sulfacetamide and Tobramycin. Steroids alone from 733drugs were 148(20.19%) and out of these 148, 85(57.43%)prednisolone eye drops and 63(42.57%) dexamethasone eyedrops were found. All these steroids were prescribed in theTable 1: Data Representing Drug/s Per PrescriptionMaximum No. of No. of TotalDrug(s) per Prescriptions No. of DrugsPrescription X N(%) (X*N)One 90(28.39) 90Two 90(28.39) 180Three 97(30.60) 291Four 28(8.83) 112Five 12(3.79) 60Total Number 317(100) 733Average Numberof Drugs perPrescription2.31X represents number of drug(s) prescribed per prescription. Nshows total number of prescriptions in which X number of drug(s)prescribed with percentage in bracket. Last row shows averagenumber of drugs found per prescription [(X*N)/N].Table 2 :Different antibacterial drugs found in prescriptionAntibacterial No. of Encounters N(%)Gatifloxacin 120(34.38)Ciprofloxacin 63(18.05)Chloramphenicol 46(13.18)Gentamycin 40(11.46)Sparfloxacin 23(6.59)Cefadroxil 17(4.87)Moxifloxacin 17(4.87)Amikacin 11(3.15)Sulfacetamide 6(1.72)Tobramycin 6(1.72)TOTAL 349(99.99)N represents total number of different antibacterials found in totalnumber of prescriptions with their percentage in bracket for each.Fig. 1: Percentage of different category of drugsobserved in prescriptionIt represents different categories of drugs found in prescriptionswith their percentage contribution towards total number ofdrugs in all prescriptions studied.Table 3: Miscellaneous drugs found in prescriptionDrug or Category No. of Drugs, N(%)Timolol 29(14.87)Latanoprost 11(5.64)Dorzolamide 11(5.64)Acyclovir 23(11.79)Hydroxy Propyl Methyl 23(11.79)CelluloseLubricants 98(50.26)TOTAL 195(99.99)N represents total number of counts found for miscellaneous drugsin total number of drugs indicating percentage in bracket for each.form of drops. Dosage forms containing antibacterial incombination with steroid were 41(5.59%) out of total 733drugs and others were 195(26.60%) of the total drugsprescribed (Figure 1). On investigation of miscellaneousdrugs found in prescriptions we found Acyclovir was alsoprescribed for viral infection in the eye. Lanatoprost wereIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 48

Bhavikkumar H S- Drug Utilization Study in Cataract Patients from South Gujarat Regioncommonly used anti-inflammatory drugs. Remaining werelubricants, mydriatics or miscellaneous eye drops (Table 3)purpose of all these miscellaneous drugs were discussed withphysicians and confirmed why they have been used inprescription. All drugs were prescribed in four differentdosage forms. Eye drops were most commonly prescribed494(67.39%), followed by oral 108(14.73%), ointments91(12.41%) and injections 40(5.46%). Maximum numbers ofthese drugs were given for topical use in the form of eye dropsand eye ointments.DISCUSSIONAs most of us are located in central and south Gujarat,accessible area was selected for our study. Results from thisarea may reflect the prescribing pattern of whole state. Drugprescriptions form a very important point of contact betweenthe health care provider and the user. Average number ofdrugs per prescription is an important index for prescriptionaudit. In our study average number of drugs per prescriptionwas 2.31. Other hospital based study in India reported 3-5drugs per prescription which was found to be higher than our7, 8, 9study. It is preferable to keep the number of drugs perprescription as low as possible since higher figures lead toincreased risk of drug interactions, adverse effects,development of bacterial resistance and increased cost to the10patient. Antibacterial Agents used to prevent blepharitis,conjunctivitis and keratitis. Amongst all antibacterial wefound that fluoroquinolones were highly used because of itsbroad spectrum of activity. We have also found that more thanone antibacterial was prescribed in the form of differentdosage form in some prescriptions. Instead of using more thanone antibacterial one can reduces number of drugs in5prescription by using broad spectrum anti bacterials.Antiviral Agents to protect from Herpes simplex keratitis,Herpes simplex conjunctivitis, Herpes zoster ophthalmicus,5Herpes simplex iridocyclitis and Cytomegalovirus retinitis.Antifungal Agents to avoid Yeast and fungal blepharitis,keratitis, scleritis, endophthalmitis, mucormycosis, and5canaliculitis.In prescriptions we observed use of timolol and dorzolamide.Use of Autonomic Agents and diuretics in the eye is alsorecommended to reduce intraocular pressure after surgery(example- dapiprazole, betaxolol, carteolol, levobunolol,5, 11metipranolol and timolol).Patients treated with prostaglandin analogs (examplelatanoprostor bimatoprost), ketorolac and diclofenac may12decrease postoperative inflammation. Anti-inflammatoryagents and pain relievers are also used for treating cystoid5, 7macular edema occurring after cataract surgery.Dexamethasone and prednisolone were from the steroids.Topical steroids have been the mainstay of treatment ofpostoperative anterior segment inflammation, such as12iridocyclitis.Antiprotozoal agents for safety against protozoal infectionsinclude Acanthamoeba and Toxoplasma gondii (examplepolymyxinB sulfate, bacitracin zinc, and neomycin sulfate,clotrimazole, miconazole, ketoconazole, chlorhexidine,polyhexamethylene biguanide, pyrimethamine, sulfadiazine,folinic acid, clindamycin and trimethoprim-5sulfamethoxazole). In this study we have observed usage ofdifferent category of drugs like antibacterial, antiviral, antiinflammatory,mydriatics and lubricants. After cataractsurgery patients need prophylaxis against infections,inflammations and high ocular pressure.The surgical incision and its closure are only as reliable as thecorneoscleral tissue substrate for wound dehiscence.Particularly for large incision, wound healing may be delayedor incomplete in the setting of profound systemic illness andmalnutrition. The most obvious presentation of wounddehiscence is a wound leak that occurs in the first several dayspostoperatively is due to inadequate suture closure and alsodue to trauma, loosening or breakage of the suture or tissue4 1melting or necrosis. Its management can include following:ØØDecreasing or stopping systemic corticosteroid therapyProphylactic administration of topical antibiotic andØ Topical administration of aqueous humor productioninhibitors (β-blockers). Results of study is so correlated withthis fact.Most of the drugs have been prescribed topically to minimizesystemic side effect. Parentral dosage forms were also used incase of antiviral and antifungal agents. Lubricants wereprescribed to prevent irritation. Itching and mild discomfortare normal after cataract surgery. Continuous irritation leads2to inflammation so it requires stopping irritation. Our studyshowed a remarkable restraint on prescribing and anawareness to avoid polypharmacy.CONCLUSIONOur study showed that a remarkable restraint on prescribingsystemic steroids in cataract patients, as postoperativesystemic steroid exposure may predispose to dehiscence oflarge incisions and may also delay wound healing. Our studyshowed a significant restraint on prescribing and anawareness to avoid polypharmacy though average number ofdrugs per prescription should be kept as minimal as possibleIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 49

Bhavikkumar H S- Drug Utilization Study in Cataract Patients from South Gujarat Regionyet for patient compliances. We have also concluded thatinstead of using multiple antibacterial in different dosageform, prescriptions should abide single but broad spectrumantibacterial.ACKNOWLEDGMENTSI am gratefully indebted to both institutes for providing mesufficient facilities. In particular, I would like to thanksfollowing peoples:Dr. Manoj Gujarati for guiding me during data collection frompatients.Mr. Vaibhav Patel, Mr. Hardik Gandhi, Mr. Akash Patel, Mr.Pradip Patel, Mr. Vishal Patel, Mr. Chintan Chauhan, Mr.Bhavik Chauhan and Mr. Shyam Mistry for helping me inprescription data collection.REFERENCES1. Steinert Roger F. Cataract surgery: techniquen dcomplications and management. 2 edition.Philadelphia: Elsevier publication; 2004: 2.2. National eye institute (USA). Facts about cataract.Maryland: National Institute of Health; 2010 [cited 2010Aug 30]. Available from: URL: http://www.nei.nih.gov/health/cataract/cataract_facts.asp.3. Horton Jonathan C. Disorders of the eye. In: Harrison.thPrinciples of internal medicine. 16 edition part-II,Section 4. USA: McGraw-hill medical publishingdivision; 2005. 171.4. Steinert Roger F. Cataract surgery: techniquen dcomplications and management. 2 edition.Philadelphia: Elsevier publication; 2004: 500.5. Sayoko E Moroi, Paul R Lichter. Ocular Pharmacology.In: Alfred Goodman & Gilman. The pharmacologicalthbasis of therapeutics. 9 edition, section XVI, chaptor 65.USA: McGraw-hill medical publishing division; 1996.6. Hawkey C J, Hodgson S, Norman A, Daneshmend T K,Garner S T. Effect of reactive pharmacy intervention onquality of hospital prescribing. BMJ 1990; 300: 986-90.7. Kutty K V G, Sambasivam N, Nagarajan M. A study on adrug prescribing pattern in Madurai city. Ind J Pharmacol2002; 34: 361-62.8. Maini Rajiv, Verma K K, Biswas N R et al. Drugutilization study in Dermatology in a tertiary hospital inDelhi. Ind J Physiol Pharmacol 2002; 46: p. 107-10.9. Sharma S C, Uppal R, Sharma P L et al. Rational use oftopical corticosteroids in dermatology. Ind J Pharmacol1990; 22: 141-44.10. Sharma D, Reeta K H, Badyal D K et al. Antimicrobialpriscribing pattern in an Indian territory hospital. Ind JPhysiol Pharmacol 1998; 42: 533-37.11. Georg Rainer, Rupert Menapace, Oliver Findl et al.Effect of a fixed dorzolamide–timolol combination onintraocular pressure after small-incision cataract surgerywith Viscoat. J Cataract Refract Surg 2003; 29 (9): 1748-1752.12. Reddy M S, Suneetha N, Thomas R K, Battu R R.Topical diclofenac sodium for treatment of postoperativeinflammation in cataract surgery. Indian J Ophthalmol2000; 48 (3): 223-6.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 50

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaRisk Factor Assessment Study for Bronchial Asthma among the Rural PeopleKabila B*, Sankar V, Sathyaprabha G, Jayakumar N, Suthanth T, Dhanalakshmi M*Department of Pharmacy Practice, PSG College of Pharmacy, Coimbatore. 641004A B S T R A C TSubmitted: 27/6/2011Accepted: 24/7/2011Information on epidemiology of bronchial asthma among rural Indian people was insufficient to conclude its strong association with risk factors.Our study aims to estimate the risk factors of bronchial asthma in rural area of Coimbatore and to screen the people for its possibility and severityby pulmonary function tests. A study was conducted at rural health centre through a uniform methodology using specific and sensitivequestionnaire. Asthma was diagnosed if the respondent answered affirmatively to (a) wheezing, or chest tightness, or breathlessness (b)worsening of symptoms in morning or night and (c) having suffered from asthma, or having an attack of asthma in the past two months, or usingpast medication for respiratory problems. Besides demographic data, information on smoking habits, alcohol consumption, occupationalinfluence, and family history suggestive of asthma was also collected. Data from 62 respondents (29 men, 33 women) were analyzed. Morepredominant risk factor is dust. Our study concludes that keeping the house clean is the preventive measure undertaken by most of the people.According to the reports of pulmonary function tests, 35% were found to be normal and 20% had symptoms with normal pulmonary function.15% had mild restriction asthma, 5% had moderate restriction asthma, 5% had moderate to severe restriction asthma, 5% had moderateobstruction asthma and 15% had severe restriction asthma. Based on PFT reports, patients were directed to physician for complete diagnosisand treatment who were appropriately counseled by the pharmacists.Keywords: Asthma, Rural people, Risk factors, Pulmonary Function Tests, Cost analysis.INTRODUCTIONOver the last 30 years, advances in asthma research havechanged the lives of millions suffering from the condition.Around 300 million people worldwide were affected byasthma. The global prevalence of asthma ranges from one to3eighteen percent of the population in different countries .World Health Organization (WHO) has estimated that 15million Disability Adjusted Life Years (DALYs) are lostannually due to asthma representing nearly one per cent of8total global disease burden . Annual worldwide deaths fromasthma have been estimated at 2, 50,000. Infants of motherswho exposed to smoke are four times more likely to develop2wheezing illness in the first year of life .12The majority of patients with asthma live in rural areas . Aspoverty levels are higher in rural areas when compared tourban, it is imperative that primary health care providersshould focus mainly on preventive rather than curative care ofthe disease and should focus on adopting the guidelines forthe treatment and management of asthma.Address for Correspondence:Kabila B, Department of Pharmacy Practice, PSG College of Pharmacy, Coimbatore-641004.E-mail: kabilab08@gmail.comObstructive lung disease is defined as an inability to get air outof the lung and is identified on spirometry when the ForcedExpiratory Volume (FEV ) / Forced Vital Capacity FVC1(amount of air forcefully exhaled in 1 second/ total amount ofair that can be exhaled during a forced exhalation) is less than70% to 75%.Restrictive lung disease is defined as an inability to get air intothe lung. It is best defined as a reduction in Total LungCapacity (TLC) but is suspected when the Forced VitalCapacity (FVC) is low and the FEV /FVC is normal.1Information on epidemiology of bronchial asthma amongrural Indian people was insufficient to conclude its strong1association with risk factors . Different Pulmonary FunctionTests (PFTs) are used to evaluate the physiologic process ofthe respiratory system. Physiological abnormalities can bemeasured by pulmonary function tests which includesobstruction to airflow, restriction of lung size, and decrease in5the transfer of gas across the alveolar-capillary membrane .Potential uses of pulmonary function test includes theevaluation of patients with known or suspected lung disease;the evaluation of symptoms such as chronic cough, dyspnea,or chest tightness; monitoring the effects of exposure to dust,chemicals, or pulmonary toxic drugs; risk stratification priorto surgery; monitoring of the effectiveness of therapeuticIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 51

Kabila B - Risk Factor Assessment Study for Bronchial Asthma among the Rural Peopleinterventions; and objective assessment of impairment or4disability .There is very limited information on prevalence of asthmaamong adults in India. Even with most rough estimates, in apopulation of over 100 crores, about 2.38 crores ofindividuals (including children) are likely to suffer from13asthma . Further, asthma is a lifelong disease. The morbidityin terms of absence from school and work, hospitalizations14and emergency room visits is very high . The economicburden of management of asthma is likely to be huge both forthe patient's family as well as for the state.Patient counseling is the part of revolution of the pharmacist.As pharmacist's responsibility has evolved from dispenser toa disseminator of information, patient counseling has becomea cornerstone for pharmaceutical care. Research has proventhat medication adherence ranges from 20% to 70% for9chronic conditions, such as asthma . Pharmacist-providededucation for the patient can improve their adherence rate andknowledge towards medication use.The National Asthma Education and Prevention Program(NEPP) recognize the need for pharmaceutical care andrecommends that asthma education be integrated throughoutasthma care. Even though patient education is perceived asimportant by pharmacists and other health care professionals,in a 1990s study researchers reported that between 40% and67% of patients do not talk with their pharmacist about their7medications . Even though pharmacists are specificallytrained to provide drug information, patients may lack anunderstanding about the expanded counseling function thatpharmacists possess. Because patients lack awareness of thisskill, it is up to pharmacists to open the door ofcommunication when providing counseling about asthmatictreatments.METHODOLOGYQuestionnaire Development:The questionnaire envisaged for use in this study had threecomponents. The first part of the questionnaire was aimed atcollecting information on patient demographics whichincludes gender, age, occupation and education. The secondcomponent was aimed at collecting information on possiblerisk factors along with respiratory symptoms and pastmedication. The third component was aimed at assessing thepreventive measures undertaken.People who registered for screening asthma were interviewedindividually according to the questionnaire. Then, the personwas sent for pulmonary function tests. The filledquestionnaire and reports of pulmonary function tests wereassessed by physicians and diagnosed respectively. Thepatients who were confirmed diagnosis of asthma wereprescribed medicines and counseled by the pharmacists forbetter compliance and better quality of life. Highly prescribeddrug and its cost were also analyzed.RESULTS AND DISCUSSIONDemographic profile of the study population was segregatedaccording to their gender, age, occupation and literacy. Datafrom 62 respondents (29 men, 33 women) were analyzed.About 25.86% of the study populations were between the ageof 41 and 50 years. Among them 30.64% of the respondentswere house wives. Most of the respondents were illiterates asthe study was conducted in a rural area. (Table 1).Potential risk factors to be studied were categorized based onthe information available from the questionnaire whichincludes family history, social habits, allergy history,respiratory symptoms, and attack of asthma within last twomonths along with past medication. About 27.41% of thepatients had family history of asthma. So if any person in afamily was diagnosed to be an asthmatic, it is suggestive thatall members of the family must be screened for possibility ofasthma attack. Among the social habits, smoking and alcoholconsumption was equally present in 20.96% of the patients.More predominant risk factor was found to be the dust whichis then followed by change in climate. About 58.06% of thepatients came with the respiratory symptoms of cough andphlegm which is then followed by wheezing (56.45%) andshortness of breath (53.22%). (Table 2).Among the anti-asthma drugs, ipratropium bromide andsalbutamol were prescribed to most of the patients which isfollowed by prednisolone and montelukast. Also the cost ofhighly prescribed drug was analyzed (Table 3).“Keeping the house clean” is the preventive measureundertaken by most of the people (30.64%) who hadrespiratory symptoms (Figure 1).According to the reports of pulmonary function tests 35%were found to be normal and 20% had symptoms with normalpulmonary function. 15% had mild restriction asthma, 5%had moderate restriction asthma, 5% had moderate to severerestriction asthma, 5% had moderate obstruction asthma and15% had severe restriction asthma (Figure 2).Asthma is a chronic condition requiring lifelong drug therapy.Pharmacist can play an active role in counseling the patientregarding self monitoring of drug therapy (Table 4), other lifestyle modifications (Table 5) and usage of specialized dosageforms such as metered dose inhalers, dry powder inhalers,spacers etc.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 52

Kabila B - Risk Factor Assessment Study for Bronchial Asthma among the Rural PeopleTable 1: Demographic profile of the study populationSI.No Demographic factors Percentage1 GenderMale 46.77%Female 53.22%2. Age in years60 25.80%3. OccupationHouse wife 30.64%Labour 24.19%Agriculturist 16.12%Student 12.90%Unemployed 9.67%Business 3.22%Textile 3.22%4. EducationLiterate 41.93%Illiterate 58.06%Fig.1: Preventive measures undertakenTable 1: Demographic profile of the study populationSI.No Risk factorsPercentage1. Family history of AsthmaYes 27.41%No 72.58%2. Social HabitsTobacco 14.51%Smoking 20.96%Alcohol 20.96%Nil 64.51%3. Allergy HistoryPollens 17.74%Dust 58.06%Danders 00.00%Climate 37.09%Cockroach 11.29%Polluted air 17.74%Nil 22.58%4. Respiratory SymptomsWheezing 56.45%Chest tightness 37.09%Shortness of breath 53.22%Cough and Phlegm 58.06%Continuous cough 22.58%Worsening in morning 27.41%Worsening at night 34.00%Nil 22.58%5. Attack of asthma within last two months 56.45%6. Past Medication HistoryYes 76.00%No 24.00%7. Medication TypeTablets 35.48%Inhalers 11.29%Aerosols 06.45%Home remedies 09.67%Ayurvedic 04.83%Fig.2: Pulmonary Function Test reportsKHC – Keeping House Clean, WPM – Washing Pillows,Mattress etc., APS – Avoid Passive Smoking, KFC – KeepingFoods Closed, PY – Practicing Yoga, NAPIH – Not AllowingPet animals Inside Home., NPU – No Preventive MeasuresUndertaken.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 53

Table 3: Cost analysis of highly prescribed drugsSI.No Category Generic Name Highly prescribed Cost analysis1 β-Agonists Salbutamol Salbutamol Cost per Cost ratio Cost rangetablet inShort acting: Levalbuterolrupees(differentPirbuterolbrands)Metaproterenol2mgLong acting:0.360.130.113.27 0.25Salmeterol4mg0.562345FormoterolCorticosteroids Methyl prednisoloneLeukotrieneAntagonistsMethylXanthinesAnticholinergicsKabila B - Risk Factor Assessment Study for Bronchial Asthma among the Rural PeoplePrednisonePrednisoloneBeclomethasoneBudesonideFluticasoneTriamcinoloneMontelukastZafirlukastTheophyllineAminophyllineIpratropiumbromideTiotropiumPrednisoloneMontelukast5mg10mg20mg4mg5mgTheophylline200mgIpratropiumbromide300mg200 metered doseinhalerRespirator solution15mlRotacaps0.180.160.410.330.360.770.940.641.501.145.676.216.596.657.227.940.971.252.201.041.581.19153.01125.81158.9029.9429.5042.6640.25Cost Range = High cost – Low cost, Cost Ratio = High cost / Low cost.3.501.241.201.320.400.080.130.361.16 0.921.19 1.292.27 1.231.52 0.541.26 33.091.01 0.441.06 2.41Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 54

Kabila B - Risk Factor Assessment Study for Bronchial Asthma among the Rural PeopleTable 4: Monitoring of drug therapySl.No Drug category Counseling1 Beta receptor agonists If you experience tremors or muscle pain, discontinue the medication andconsult your physician immediately.2345TheophyllinesAnticholinergicsCorticosteroidsLeukotriene AntagonistsIf you experience vomiting, increased or rapid heart rate, irregularheartbeat, seizures, skin rash consult your physician immediately. Do notcrush/chew the sustained release preparations. Avoid drinking or eatingfoods rich in caffeine, like coffee, tea, cocoa, and chocolate.If you experience dry throat, nausea, headache, blurred vision, andpainful urination discontinue the medication and consult your physicianimmediately. Dont use more than 12 puffs of ipratropium inhalationaerosol in a 24-hour period.Medications should be taken regularly and should not be stoppedabruptly. It needs dose tapering before stopping. Gargling of mouth isbeneficial after the use of inhaled medications.Should be taken at least 2 hours before exercise . If you experienceswelling, rash, aggressive behavior, unusual dreams, hallucinations,depression, sleep difficulty, restlessness, or tremor consult your physicianimmediately.Sl.No1 Keep your house clean and dust-free.2 Always keep away from allergens.3 Avoid passive smoking.4 Washing pillows, mattress etc.5 Not allowing pet animals inside home.Table 4: Monitoring of drug therapyLife style modifications6 Have magnesium-rich foods like papaya, which helps in immunity against asthma.7 Reduce intake of processed foods, especially those that contain soy or corn oil,which exacerbate inflammation.8 Have a glass of warm water before you sleep.9 Take regular breath exercise twice daily.10 Ideally, diet should contain a limited quantity of carbohydrates, fats and proteins which are 'acidforming'foods, and a liberal quantity of alkali-forming foods consisting of fresh fruits, greenvegetables, sprouted seeds and grains.11 Avoid foods which tend to produce phlegm such as rice, sugar, lentils and yoghurt.12 Avoid fried foods, strong tea, coffee, alcoholic beverages, pickles, sauces and all processed foods.CONCLUSIONWith the perspective of improving the quality of life amongthe rural people who were at high risk of asthma attack werescreened and assessed for asthma severity. Based onpulmonary function test reports, patients were directed tophysicians for complete diagnosis and treatment who wereappropriately counseled by the pharmacists. Our studysuggests that pharmacists, being active members of thehealthcare team can play an important role in providingpatient counseling so as to improve patient compliance andhence the therapeutic outcomes and quality of life byimplementing the pharmacoeconomical aspects.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 55

Kabila B - Risk Factor Assessment Study for Bronchial Asthma among the Rural PeopleREFERENCE1. A.N. Aggarwal, K. Chaudhry, S.K. Chhabra. Prevalenceand Risk Factors for Bronchial Asthma in Indian Adults:A Multicentre Study. The Indian Journal of ChestDiseases & Allied Sciences; 2006; 48: 13-22.2. Burke W, Fesinmeyer M, Reed K, Hampson L, CarlstenC. Family history as a predictor of asthma risk. Am JPrev Med 2003; 24: 160-9.3. Burney PGJ. Epidemiology. In: Clark TJH, Godfrey S,Lee TH, Thomson NC, editors. Asthma; 4th edn.London: Arnold. 2000; pp 197-223.4. Burney PG, Laitinen LA, Perdrizet S, Huckauf H,Tattersfield AE, Chinn S, et al. Validity and repeatabilityof the IUATLD (1984) bronchial questionnaire: aninternational comparison. Eur Respir J 1989; 2: 940-5.5. Chinn S, Burney P, Jarvis D, Luczynska C. Variation inbronchial responsiveness in the European CommunityRespiratory Health Survey (ECRHS). Eur Respir J1997; 10: 2495-2501.6. European Community Respiratory Health Survey.Variations in the prevalence of respiratory symptoms,selfreported asthma attacks, and use of asthmamedication in the European Community RespiratoryHealth Survey (ECRHS). Eur Respir J 1996; 9: 687-95.7. Global Initiative for Asthma. National Institute ofHealth. National Heart, Lung and Blood InstitutePublication No. 02-3659.8. Gregg I. Why study the epidemiology of asthma?Thorax 1988 ; 43: 1024.9. Jindal SK, Gupta D, Aggarwal AN, Jindal RC, Singh V.Study of the prevalence of asthma in adults in northIndia using a standardized field questionnaire. J Asthma2000: 37. 345-51.10. Masoli M, Fabian D, Holt S, Beasley R. Global Burdenof Asthma. Global Initiative for Asthma (GINA).Wellington, New Zealand, Medical Research Instituteof New Zealand;Southampton, United Kingdom,University of Southampton. 2004.11. Peat JK, Haby M, Spijker J, Berry G, Woolcock AJ.Prevalence of asthma in adults in Busselton, WesternAustralia. BMJ 1992; 305: 1326-9.12. Sunyer J, Jarvis D, Pekkanen J, Chinn S, Janson C,Leynaert B, et al. Geographic variations in the effect ofatopy on asthma in the European CommunityRespiratory Health Study. J Allergy Clin Immunol2004; 114: 1033-9.13. The International Study of Asthma and Allergies inChildhood (ISAAC) Steering Committee. Worldwidevariations in the prevalence of asthma symptoms: theInternational Study of Asthma and Allergies inChildhood (ISAAC). Eur Respir J 1998; 12: 315-35.14. Viswanathan R, Prasad M, Thakur AK, Sinha SP,Prakash N, Mody RK, et al. Epidemiology of asthma inan urban population: a random morbidity survey. JIndian Med Assoc 1966; 46: 480-3.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 56

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaA rare clinical presentation of Carcinoma Cervix – Ascites1* 2Damodar G , Rao AY1Department of Pharmacy Practice, Vaagdevi College Of Pharmacy, Warangal, India.2Head, Department of Oncology, KMC/ MGM Hospital, Warangal-506 007, (A. P.), India.Accepted: 5/8/2011A B S T R A C TSubmitted: 28/7/2011A case of carcinoma cervix – III B, histopathology of moderately differentiated squamous cell carcinoma in 2010 is explained. Few months afterchemotherapy patient presented with white discharge and left lower limb pain. On examination, infiltrating ulcerative growth is present over thewall and right parametrium is hard and fixed. FNAC was done from right parametrial disease which was found as metastatic squamous cellcarcinoma (? Lymph node). Detailed work regarding this case was included and patient was started salvage chemotherapy with Cisplatin and 5-Fluorouracil. Later patient discontinued treatment after receiving one cycle. After the gap of three months patient presented to our O.P. withdistension of abdomen and poor general status in the month of January 2011. Since then patient is receiving supportive therapy and palliativechemotherapy. The purpose of presenting this case is ascites in cancer cervix is rare and our case showing prolonged survival time with ouraggressive supportive therapy.Keywords : Squamous cell, Parametrium, Salvage chemotherapy, AscitesINTRODUCTIONOver 63 to 89 percent of all cervical cancers had regional1diseases at the time of presentation. The common mode ofcancer failures are local level and distant level (liver, lung,bone etc), but failure as presentation of ascites in carcinomacervix is a rare clinical presentation. Ascites means anaccumulation of fluid in the peritoneal cavity, also known asperitoneal cavity fluid, peritoneal fluid excess,hydroperitoneum or abdominal dropsy. Cancers accountsupto 2% for the causes of ascites which is very less when2compared to the major causes like cirrhosis (85%). Ascitesexists in three grades. Grade-1 is mild and detectable onultrasound or computed tomography (CT) and Grade-2 isdetectable with flank bulging, shifting dullness where as3Grade-3 is directly visible with fluid thrill.ascites with over 4200 ml that developed after salvagechemotherapy for locally advanced cervical cancer.CASE REPORTA 45 year old female, widow consulted the department ofoncology at Mahatma Gandhi Memorial Hospital (MGMH)on January 2011, with chief complaints of distension ofabdomen and bleeding pervagina since four days. Fig 1. Shewas diagnosed with metastatic squamous cell carcinoma ofcervix – III B on basis of the results of a pelvic examination,cytological smear microscopy, cystoscopy, urinalysis andbiopsy from cervix. Prior to palliative chemotherapy, shereceived one cycle of salvage chemotherapy with CisplatinFig. 1: Photograph showing distension of abdomenby massive ascitesFour out of five patients with malignant ascites is caused bycauses like ovarian, gastro intestinal tumours, as well as by4breast, pulmonary, uterine and cervical cancers. Patientssuffering from malignant ascites have a poor prognosis which5results in a median survival time of 1-4 months, and the five1year survival rate is about 48.7%. According to presentreports, this is a rare case that presented massive serousAddress for Correspondence:Gaddam Damodar, C/O M. Devender Rao, H. No: 2-4-1336, Ashoka Colony, BehindI.T.D.A. Office, Hanamkonda, – 506 001, Warangal (Dist), (A.P.), India.E-mail: damodar.mph@gmail.comIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 57

Damodar G - A rare clinical presentation of Carcinoma Cervix – Ascitesand 5-Fluorouracil. An ultrasonography examinationpreceding salvage chemotherapy revealed ill definedhypoechoic mass lesion in cervix, large cystic lesion withnodular thick wall and mild ascites. Further abdominal CTinvestigation revealed a bulky irregular cervix with wartedlesion, left parametrial involvement upto pelvic wall andabnormal mass in lower abdomen with uterus enveloped 14-16 inches size. Fig 2. There were no intraoperative traumas tothe surrounding structures or events that could have causedmassive ascites postoperatively. There were no abnormalfindings in the liver, gall bladder, spleen, pancreas, aorta,kidney, urinary bladder, uterus, and ovary.Preoperative laboratory studies revealed the followingvalues: Hb, 12.8 gm%; red blood cell count, 3.4 million/cmm;white blood cell count, 11,500/cmm with 66% Neutrophil,22% lymphocyte, 10% eosinophil, 2% monocyte, adequateplatelet count and normocytic, normochromic. The results ofthe other investigations, including liver function tests,urinalysis, renal function tests revealed no abnormalities. Theresults of the chest X-ray and Serology/ Immunology for HIVI and II Ab were normal. Microscopic findings revealedhyperplastic stratified squamous epithelium with invasivesheets and nests of dysplastic squamous cells withhyperchromatic nuclei, moderate nuclear pleomorphism.Few atypical mitoses are seen. Intervening stroma is fibrotic.Before starting second cycle at our hospital Hb was observedto be 8 gm%; this was lower than the previous cycle i.e 12.8gm%. On the palliative chemotherapy visits a pigtailparacentesiscatheter was inserted into the peritoneal cavityfor the drainage of the ascitic fluid inorder to relieve thedistention. The amount of ascitic fluid obtained from the draininserted into the peritoneum was 150 ml, 200 ml, 400 ml pereach month respectively. The fluid was yellow or strawcolouredand serous in nature. Fig 3. After removal of thedrain from the peritoneum on fourth month, the amount offluid drainage rapidly increased upto 1000 ml per month. Bythe fifth month we counselled the patient to minimise salt andwater intake inorder to suppress the production of ascites,following which abdominal distension developed. Cytologyand laboratory investigations of the ascitic fluid revealed thatthere were no organisms on gram staining, acid-fast bacilli(AFB) staining, or on culture. Ultrasonography revealed noabnormal findings in other organs. From the fifth month, theamount of ascitic fluid drained was observed to be 1200 mlper month; thereafter, it was decreased steadily. Now thepatient is getting somewhat less burden by the ascites ofcarcinoma cervix.Fig. 3: Collection of yellow or straw-coloured ascitesFig. 2: CT abdomen showing bulky irregular cervix pyometraDISCUSSIONThe most important cancer among Indian women is the cancer6of cervix over the past two decades. Malignant ascites is theabnormal accumulation of fluid in the peritoneal cavity as aresult of cancer which causes discomfort and distress to manypatients in their advanced disease stages. Large amounts ofaccumulated ascites can cause increased abdominaldistention with troublesome symptoms like pain, dyspnea,loss of appetite, nausea, reduced mobility. Involvement of theIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 58

Damodar G - A rare clinical presentation of Carcinoma Cervix – Ascites7peritoneal cavity is very uncommon in cervical cancer.Pathophysiology of malignant ascites is incompletelyunderstood. It may result from obstruction of lymphaticdrainage by tumour cells or alteration in vascular8,9permeability. Hormonal mechanisms are also involved.Ascitic fluid can accumulate as a transudate by increasedpressure in the portal vein (8-20 mm Hg) or an exudates byactive secretion.As the patient has complaints of discharge pervagina anddistention of abdomen, she has undergone investigations likepelvic examination, cytological smear microscopy,cystoscopy, urinalysis and FNAC (Fine Needle AspirationCytology) from cervix. An ultrasonography examinationpreceding salvage chemotherapy revealed ill definedhypoechoic mass lesion and mild ascites. From theinvestigations of the ascitic fluid it was confirmed positive formalignant cells. Imaging studies, including ultrasonographyof whole abdomen, computed tomography (CT), and chest X-ray did not reveal any abnormal findings except for ill definedhypoechoic mass lesion in cervix and ascites. Ascites was notattributable to cardiac or hepatic causes. We ruled outtuberculosis ascites on the basis of the negative results ofacid-fast Bacilli (AFB) stain of ascitic fluid and a carefulreview of the patients past history. This patient had no historyof radiotherapy but had received one cycle of salvagechemotherapy. Till now there are no reports regarding ascites10caused by chemotherapy. On the palliative chemotherapyvisits the amount of ascitic fluid obtained from the draininserted into the peritoneum was 150 ml, 200 ml, 400 ml pereach month and on fourth month, the amount of fluid drainagerapidly increased upto 1000 ml per month. Patientcounselling will be very useful for such patients regardingdiet and fluid intake.For recurrent or metastatic disease, the role of chemotherapyin cervical cancer is merely palliative to relieve symptomsand prolong life. The chemotherapy given to the patient on herfirst cycle was 5-FU (1000 mg/ D1-D 2) and Cisplatin (60mg/D1-D 4). In second cycle patient was unable to copeup withthe treatment which she has been given. Later in the secondcycle 5-FU was withdrawn and only Cisplatin was given as itis the single most active agent for squamous cell carcinoma11(SCC) with response rate of about 25%. Mean while thepatient was treated with fluid therapy and intermittentalbumin replacement. Nearly Ninety-five percent ofsquamous cell carcinomas of the cervix contain humanpapilloma virus DNA. There are many types of humanpapilloma virus (HPV) like 6 and 11 which usually causegenital warts, while types 16, 18, 31, and 33 which usuallyresult in high-grade squamous intraepithelial lesion (SIL) andcarcinomas. Major risk factors of carcinoma cervix includeearly marriages, early intercourse, early child birth, havingmultiple sexual partners, multiple pregnancies, illiteracy and12low socioeconomic status, familial predisposition. In thisparticular case as revealed by the patient, she got married atthe age of seven years old, given first child birth at twelveyears old and her husband had multiple sexual partners. She isa poor, illiterate, having less knowledge about personalhygiene. All these factors contributed to her cancer.CONCLUSIONAbnormal accumulation of excessive fluid in the peritoneumresults in the distention of abdomen which causes healthburden to patients. Ascites production by local level failure incarcinoma cervix is a very rare phenomena. Most of thecervical cancers preventable and curable if they were detectedat early stages. Proper knowledge about the risk factors canprevent its occurrence. Research should be focussed on thetreatment modalities of cervical cancer. Patient counsellingregarding proper salt and water intake, dietary and life stylemodifications should be done in parallel to the chemotherapyand symptomatic relief procedures.ACKNOWLEDGEMENTSWe would like to thank our patient and her family membersfor their valuable cooperation.REFERENCES1. A. Nandakumar, T. Ramnath and Meesha Chaturvedi.The magnitude of cancer cervix in India. Indian J. MedRes 2009; 130: 219-21.2 Runyon BA, Montano AA, Akriviadis EA, Antillon MR,Irving MA, McHutchison JG. The serum-ascitesalbumin gradient in superior to the exudate-transudateconcept in differential diagnosis of ascites. Ann InternMed 1992; 117:215-20.3. Moore KP, Wong F, Gines P, Bernardi M. et al., “TheManagement of Ascites in Cirrhosis: Report on theConsensus conference of the International AscitesClub”. Hepatology 2003(38): 258-66.4. Abenhardt W et al.: Manual: Supportive Maßnahmenund symptomorientierte Therapie, TumorzentrumMünchen (Munich Tumour Centre) 2001; 169-178.5. Spratt JS, Edwards M, Kubota T, Lindberg, et al. CurrentProblems in Cancer: Year Book Publishers. Inc.,Chicago, 1986; Vol X, No. 11: 558-84.6. Shanta V, Krishnamurthi S, Gajalakshmi CK,Swaminathan R, and Ravichandran K, “EpidemiologyIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 59

Damodar G - A rare clinical presentation of Carcinoma Cervix – Ascitesof cancer of the cervix: global and national perspective”,Journal of the Indian Medical association, 98(2) (Feb,2000):49-52.7. Pretorius R, Semrad N, Watring W, Fotherongham N.Presentation of cervical cancer. Gynecol Oncol 1991;42: 48–52.8. Garrison RN, Galloway RH, Heuser LS. Mechanisms ofmalignant ascites production. J Surg Res 1987; 42:126–32.9. Oolopade OI, Ultmann JE. Malignant effusions. CA CancerJ Clin 1991; 41(3): 166–79.10. Ablan CJ, Littooy FN, Freeark RJ. Postoperativechylous ascites: Diagnosis and treatment. A series reportand literature review. Arch Surg 1990; 125: 270-3.11. Bonomi P, Blessing JA, Stehman FB, Disaia PJ, WaltonL, Major FJ. Randomized trial of three cisplatin doseschedules in squamous cell carcinoma of the cervix: AGynecologic Oncology Group study. J Clin Oncol 1985;3: 1079–85.th12. Beck, William Jr. M.D; “Obstetrics and Gynecology”, 4Edition, Williams and Wilkins; Philadelphia, 1997.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 60

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaNeuroleptic malignant syndrome associated with withdrawal syndrome ofLevodopa: A Case Study1 2 1 1 1*Ramesh K , Indira R , Shobha Rani R H , Mahvash I , Ramjan S1Department of Pharmacy Practice, Al-Ameen College of Pharmacy, Bangalore2Department of Medicine, St. Martha's Hospital, BangaloreA B S T R A C TSubmitted: 28/7/2011Accepted: 5/8/2011A clinical syndrome termed as Neuroleptic Malignant Syndrome (NMS) has been described in patients with parkinson's disease (PD) whoabruptly stop their Levodopa treatment. The sudden withdrawal of the drug is known to cause an acute deficiency of dopaminergic transmission.We present here a case of 78 year old male who was admitted to hospital with complaints of sudden onset of rigors and tremors all over the body.0Patient was presented with temperature of 108 F and altered sensorium, unconsciousness and tachycardia which are suggestive of NeurolepticMalignant Syndrome. Since the patient had a history of parkinsonism for past 8 years and was on Levodopa treatment which was stoppedduring the Transurethral Resection Prostate (TURP) surgery, NMS was suspected. NMS is an uncommon but potentially fatal illness, promptrecognition and early institution of appropriate therapy are necessary to minimize the likelihood of morbidity or mortality.Keywords: NMS, Levodopa, Parkinson DiseaseINTRODUCTIONParkinson's disease (PD) is defined as the progressiveneurodegenerative disorder characterized by tremors,rigidity, akinesia and postural changes. It is principally due to1deficiency of the neurotransmitter of brain-Dopamine. PD isa clinical syndrome consisting of four cardinal features ofbradykinesia/hypokinesia, resting tremors, impairment ofpostural balance leading to disturbance of gait and falling, andimmobility.Parkinson Disease results from a reduction of dopaminergictransmission within the basal ganglia. The pathologichallmark of Parkinson's disease is loss of the pigmenteddopaminergic neurons of the substantial nigra pars compacta,which regulates the action of dopamine on D1 & D2 receptorsin the striatum.EpidemiologyPD is the second most common neurodegenerative disorderafter Alzheimer's disease. Two main measures are used inepidemiological studies: incidence and prevalence. Incidenceis the number of new cases per unit of person–time at risk(usually number of new cases per thousand person–years);prevalence is the total number of cases of the disease in thepopulation at a given time. The prevalence is estimated atAddress for Correspondence:Ramjan Shaik, Lecturer, Department of Pharmacy Practice, Al-Ameen College ofPharmacy, Opp. Lalbagh Main Gate, Hosur Road, Bangalore- 560027E-mail: ramjanshaik@gmail.com0.3% of the whole population in industrialized countries,rising to 1% in those over 60 years of age and to 4% of thepopulation over 80. The mean age of onset is around 60 years,although 5–10% of cases, classified as young onset, beginbetween the ages of 20 and 50. PD may be less prevalent inthose of African and Asian ancestry, although this finding isdisputed. Some studies have proposed that it is more commonin men than women, but others failed to detect any differencesbetween the two sexes. The incidence of PD is between 82and 18 per 100,000 person–years.How does Levodopa and Carbiodopa workLevodopa which is levoisomer of amino acid dihydroxyphenyl alanine, crosses the Blood Brain Barrier (BBB), whereit is taken up by the neurons of the substantia niagra parscompacta (SNpc) and converted to dopamine by the enzymedopa decarboxylase. The dopamine is then stored, transportedand eventually released to act on dopamine receptors in thestriatum.Carbiodopa (α-methyldopa hydrazine) is a reversible,peripheral dopa decarboxylase inhibitor that does not crossthe Blood Brain Barrier. When administered in the absence ofcarbiodopa, levodopa undergoes significant gastrointestinaland peripheral metabolism to dopamine which istherapeutically undesirable as dopamine cannot cross BBB.With the addition of carbiodopa, levodopa's bioavailability isdoubled from 50% to almost 100% and its half life is extended3considerably.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 61

Ramesh H - Neuroleptic malignant syndrome associated with withdrawal syndrome of Levodopa: A Case StudyNeuroleptic malignant syndrome (NMS) is secondary toParkinson Disease. Chronic condition of Parkinson Disease4,5occurs due to excessive dopaminergic blockade effects.Muscle rigidity with myonecrosis; an altered mental statusresembling catatonia; and autonomic dysfunction withhyperthermia including diaphoresis, tachycardia, and a labileblood pressure and elevation of serum creatininephosphokinase constitute the principal manifestations ofNMS.It can be precipitated due to abrupt withdrawal ofantiparkinson (dopaminergics) medications such as6levodopa , bromocriptine, ropinirole and pramipexole or bythe overdose of the antipsychotic drugs such asphenothiazines, haloperidol, prochlorperazine,metoclopramide.CASE REPORTA 78 year old male was presented in the evening to emergencydepartment of St. Martha's Hospital with complaints ofsudden onset of involuntary movements involving whole ofthe body along with restlessness and tremors. He alsoexhibited altered sensorium, temperature of 108˚F whenbrought to the hospital. On enquiry with the patient's relatives,it was revealed that the patient was hypertensive since 1 yearand had a history of parkinson's disease since 8 years and wason a combination drug (carbidopa 25 mg, levodopa 100 mg)twice in a day. On the day of admission to our hospital, in themorning (at 6:00 am) patient had TransUrethral Resection ofthe Prostate (TURP) surgery at another hospital. Till eveninghe was asymptomatic. At evening, patient had 2 episodes ofvomiting and after that had sudden onset of rigor and tremors0involving whole body, with increasing temperature of 108 Fand altered sensorium and mild sinus tachycardia followingwhich he was brought to our hospital. He was shifted toIntensive Care Unit and was started on hydrocortisone.On admission, his vitals revealed a BP of 130/70 mmHg,0Pulse of 118 and temperature of 108 F. He was drowsy andrestless having tremors but showed normal pupils.Cardiovascular examination revealed sinus tachycardia. Hehad pallor but there was no evidence of clubbing, cyanosis,edema and lymph adenopathy.Preliminary investigations revealed that patient was slightlyanemic with a Hb of 10.9mg/dl. Other investigations relatedthat hematology was normal. Routine urine analysis showedincrease in the number of pus cells and RBCs. Biochemistryinvestigations discovered a high value of Blood UreaNitrogen (BUN) of 48 mg/dl and Creatine Phosphokinaselevels 2390 U/l. Liver function tests were normal. The bloodHgas values were: P : 7.4, PCO : 26.2 and PO 88.5.2 2:Evaluation was done for NMS and withdrawal ofantiparkinson medication “Syndopa plus” was considered asthe cause. Patient was treated with tapped sponging and Tab.Syndopa plus was restarted. Patient was given the treatmentwith, i.v. Imipenam 500 mg in 100 ml of NS every 6 hours, i.v.Pantaprazole 40 mg, Tab. Trihexyphenidyl Hydrochloride,Tab. Nebivolol 25mg and Tab. Crocin 500 mg. Subsequently0patient's temperature reduced to 100 F and patient wassymptomatically better, same treatment was continued foranother day after which patient was afebrile and was stable atdischarge.DISCUSSIONNMS, a rare but potentially fatal syndrome is characterized byextrapyramidal symptoms such as parkinsonism, muscularrigidity, dystonia and akinesia; autonomic dysfunction, fever,tachycardia, diaphoresis and blood pressure lability; alteredlevel of consciousness; and abnormal laboratory findingssuch as leukocytosis and elevated serum creatinephosphokinase (CPK) levels.Usually NMS is attributed to a dopaminergic blockade atstriatum, hypothalamus and brainstem level, the NMS-likesymptomatology following a withdrawal is probably relatedto a dopaminergic “imbalance” or dysregulation, as opposedto an excessive dopaminergic blockade. A dramatic change indose may cause “imbalance” in the dopaminergic system,7contributing to the appearance of the syndrome.Dopaminergic receptor blockade is believed to be the sourceof extrapyramidal symptoms, such as tremor, shuffled gait,and bradykinesia. The classic tetrad of NMS consists ofaltered mental status, hyperthermia, muscle rigidity, and8autonomic instability. Muscle rigidity is typically the firstsign exhibited by patients with NMS. Altered mental statususually develops slightly later and may range from mildagitation to stupor or coma. Autonomic instability maymanifest as labile blood pressures, profuse diaphoresis,tachycardia, or urinary retention. Renal failure may occursecondary to severe rhabdomyolysis caused by intensemuscle rigidity. Laboratory findings are non-specific buttypically include an elevated serum CPK level, hyperkalemia,and increasing serum sodium secondary to total body waterdepletion. Death may result from any number of causesincluding dysrhythmia, renal or respiratory failure, orcardiovascular collapse.Sudden withdrawal of levodopa or other anti-parkinsoniandrugs is the most common cause of NMS as reported by the9various studies. Although withdrawal of levodopa mostlyleads to Neuroleptic Malignant Syndrome, discontinuation ofany other anti-parkinsonian drug can also trigger NMS. A caseIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 62

Ramesh H - Neuroleptic malignant syndrome associated with withdrawal syndrome of Levodopa: A Case Studywas reported where a patient with PD who developed NMSafter the discontinuation of amantadine HCl. Poorcompliance and poor absorption of levodopa is anotherimportant precipitating factor.Approach towards treatment of NMS is aimed at supportivetherapy. Maintaining an adequate airway and ventilation arevital especially in the face of neurologic decline. Rigidity ofthe chest wall can also lead to hypoventilation and respiratoryfailure. Supportive measures such as i.v. fluids should10be initiated to stabilize the patients' blood pressure. Carefulattention to electrolyte balance, urine output, and renalfunctions are also important considerations throughout thetreatment course. Steps to lower the core body temperatureshould be taken immediately. Cooling blankets, ice packs,and muscle relaxants such as dantrolene and diazepam haveproven functional.CONCLUSIONRapid discontinuation of antiparkinsonian drugs is thepotential risk factor for the occurrence of NMS. It is a lethaldisorder unless appropriate treatment is instituted as soon asthe diagnosis is made. Clinicians ought to be careful inconsidering the possibility of NMS as a life-threateningcomplication of abrupt neuroleptic drugs withdrawal.Awareness of NMS and of its treatment modalities willdecrease the morbidity and mortality associated with thissyndrome.REFERENCES1. Mizunoa Y, Takubob H, Mizutac E, Kuno S. Malignantsyndrome in Parkinson's disease: concept and review ofthe literature. Parkinsonism and Related Disorders 2003;9:S3–S9.2. http://en.wikipedia.org/wiki/Parkinson's_disease3. Herfindal J. Text book on Therapeutics, parkinsonism,thChapter 08, 10 Edition, Page No.:318-4304. Haradaa T, Mitsuokaa K, Kumagaia R, Murataa Y, et.al.Clinical features of malignant syndrome in Parkinson'sdisease And related neurological disorders.Parkinsonism and Related Disorders 2003; 9:S15–S23.5. Sechi G, Manca S, Deiana GA, et.al.Acutehyponatremiaand neuroleptic malignant Syndrome inparkinson's disease. Pmg. Neuro-Psychopharrmcol. &Blol. Psychiat 1996; 20:533-542.6. Duen SM. Neuroleptic malignant syndrome-like, ordopaminergic malignant syndrome-due to levodopatherapy Withdrawal. Clinical features in 11 patients.Parkinsonism and Related Disorders 2003; 9:175–178.7. Stanfield SC, Privette T. Neuroleptic malignantsyndrome associated with olanzapine therapy: a casereport The Journal of Emergency Medicine 2000;19:355–357.8. Amore M, Zazzeri N. Neuroleptic malignant syndromeafter Neuroleptic discontinuation. Prog. Neuropsychopharmacol& biol.psychiat 1995; 19:1323-1334.9. Young CC, Kaufman BS. Neuroleptic MalignantSyndrome Postoperative Onset Due to LevodopaWithdrawal. MDT Journal of Clinical Anesthesia 1995;7:652-656.10. Hashimotoa T, Tokudaa T, Hanyub N, Tabatac K,Yanagisawad N.Withdrawal of levodopa and other riskfactors for malignant Syndrome in Parkinson's disease.Parkinsonism and Related 2003; 9:S25–S30.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 63

Indian Journal of Pharmacy PracticeAssociation of Pharmaceutical Teachers of IndiaManagement of Alcoholic Liver Disease1 2 3 4Jeewan R , Alexander DS , Dixon T* and Padmanabha YR1 2PharmD Candidate, RIPER, Anantapur, A.P., Surgeon, RDT Hospital, Anantapur, A.P.3 4Assoc Prof, RIPER, Anantapur, A.P., Principal, RIPER, Anantapur, A.P.A B S T R A C TSubmitted: 24/7/2011Accepted: 5/8/2011Alcoholic liver disease (ALD) is the major cause of morbidity and mortality worldwide. Death rate for cirrhosis with superimposed alcoholichepatitis is worse than much type of cancers. There is no US Food &Drug Administration approved therapy for ALD. Specific treatment wasgiven based on specific mechanisms. It is clear that lifestyle modification, with abstinence, cessation of smoking and weight loss are beneficial.Nutritional supplementation is of benefit as most of the ALD patients are malnourished. Patients with alcoholic hepatitis that is relatively severein nature, but not complicated by issues such as infection or gastrointestinal bleeding, appear to benefit from steroids. Pentoxyfylline appears tobe beneficial in patients with alcoholic hepatitis, especially those with early hepatorenal syndrome. A variety of other agents suchpropylthiouracil, lecithin, colchicines and anabolic steroids are probably not effective. S-adenosylmethionine (SAM) is an alternative medicalagent is of great use. Results of ongoing National Institute of Health studies evaluating agents such as specific anti TNF's, milk thistle and SAMare eagerly awaited. Transplantation is clearly an option for end stage ALD in patients who are abstinent.Keywords: Alcoholic liver disease, hepatitis, transplantation.INTRODUCTIONChronic and excessive alcohol ingestion is one of the majorcauses of liver disease. The pathology of alcoholic liverdisease comprises three major lesions, with the injury rarelyexisting in a pure form: (1) fatty liver, (2) alcoholic hepatitis,and (3) cirrhosis. Fatty liver is present in >90% of binge andchronic drinkers. A much smaller percentage of heavydrinkers will progress to alcoholic hepatitis, thought to be a1precursor to cirrhosis.Etiology and pathogenesisQuantity and duration of alcohol intake are the mostimportant risk factors involved in the development ofalcoholic liver disease. Social, immunologic, and heritablefactors have all been postulated to play a part in the1development of the pathogenic process.Pathophysiology:Alcohol is readily absorbed from the mucosa of the mouthonwards, down to the stomach and small intestine. It cannotbe stored; 90% is metabolized through oxidation. The firstbreakdown product is acetaldehyde, which is produced byAddress for Correspondence:Dixon Thomas, Assoc Prof, RIPER, Anantapur, A.PE-mail: dixon.thomas@gmail.comthree enzymatic pathways: alcohol dehydrogenase(responsible for about 80% of metabolism), cytochrome P-450 2E1 (CYP2E1), and catalase.Acetaldehyde is converted to acetate by mitochondrialaldehyde dehydrogenase. Chronic alcohol consumptionenhances acetate formation. The processes generatehydrogen, which converts nicotinamide- adeninedinucleotide (NAD) to its reduced form (NADH), increasingthe redox potential in the liver. This replaces fatty acids as afuel, lowers fatty acid oxidation, and allows triglycerides toaccumulate, causing fatty liver and hyperlipidemia. Theexcess hydrogen also promotes conversion of pyruvate tolactate, which decreases glucose production (hypoglycemiacan result), causing renal acidosis, reduced urate excretion,hyperuricemia, and thus gout.Alcohol metabolism may also render the liverhypermetabolic, causing hepatic parenchymal hypoxia andfree radical-induced lipid peroxidative damage.Undernutrition depletes antioxidants, such as glutathione andvitamins A and E, which aggravates such damage.Acetaldehyde initiates much of the inflammation and fibrosisof alcoholic hepatitis. It stimulates transformation of thestellate (Ito) cells lining liver blood channels (sinusoids) intofibroblasts that develop myocontractile elements and activelyproduce collagen. The sinusoids narrow and fill, limitingtransport and blood flow. Local circulaation of gutIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 64

Jeewan R - Management of Alcoholic Liver Diseaseendotoxins, which the impaired liver can no longer detoxify,lead to production of inflammatory cytokines. Acetaldehydeand lipid peroxidation products recruit leukocytes, resultingin production of more inflammatory cytokines. This elicits avicious circle of inflammation that culminates in fibrosis andloss of hepatocytes.Fat is deposited throughout the hepatocytes, a result ofincreased input from peripheral adipose tissue, elevatedtriglyceride synthesis, decreased lipid oxidation, and reduced2lipoprotein production that impairs fat export from the liver.Treatment of alcoholic liver diseasesLifestyle modificationsAbstinence, cessation of alcohol consumption or asignificant reduction in alcohol intake improves histologyand or survival of patients with any stage of ALD, thereforealcohol abstinence is the cornerstone of management forpatients with ALD. Treatments that aim to reduce the alcoholintake in alcohol dependent patients include psychologicaland pharmacological approaches.Psychological treatments such as cognitive behavioraltherapy and motivational enhancement therapy have beenshown to reduce alcohol intake. As an alternative, somepatients may derive benefit from pharmacological therapy.Both acamprosate and naltrexone have been shown to reducedrinking days. Disulfiram, an inhibitor of acetaldehydedehydrogenase has been used for many years but hascatastrophic effects when ingested in conjunction with3alcohol.Obesity along with alcohol leads to steatosis, steatohepatitis,and cirrhosis and also is a major factor for the progression ofALD. Hence weight loss down to ideal BMI (body massindex) is beneficial.Cigarette smoking aggravates oxidative stress whichaccelerates the mechanism of alcoholic liver injury. Hence4quitting smoking is beneficial in ALD .Drug therapyCorticosteroidsThe effect of steroids on polymorphonuclear Neutrophilsfunctions, their ability to inhibit important pro-inflammatorytranscription factors such as activator protein 1 (AP-1) andnuclear factor-êB (NF-êB), a reduction in solubleintracellular adhesion molecule 1, and their beneficial effectson pro-/anti-inflammatory cytokine levels are thought to bethe underlying mechanisms of action leading to benefit in5,6patients with severe ASH (alcoholic steatohepatitis).Studies show that unusual infections and precipitation ofglucose intolerance are undesirable effects of steroids therapy7in alcoholic liver diseases.PentoxyfyllinePentoxyfylline, a hemorheologic agent (it lowers bloodviscosity ), has been shown to decrease hypertension and tohave an inhibitory effect on TNF and other inflammatory3cytokines. TNF is one of the key factors in hepatocellulardamage and causes vasoconstriction that could contribute torenal insufficiency. The benefit of Pentoxyfylline appears tobe related to the significant decrease in risk of hepatorenal8,9,10syndrome and renal failure.Anti TNF therapyAlcoholic hepatitis was one of the first disease states in whichderegulated inflammatory cytokines were identified. Chronicalcohol use has been shown to increase gut permeability andi n c r e a s e e n d o t o x e m i a ( t h r o u g h g u t d e r i v e dlipopolysaccharides) which activates NF-êB to produce TNF-5a-mediated proinflammatory cytokines.PropylthiouracilThe putative mechanism of propylthiouracil to produce abenefit in alcoholics is by reducing hepatic oxygen3,11consumption by hepatocytes.Nutritional supplementsS-adenosylmethionineElevated methionine and decreased methionine clearancerepresent a possible therapeutic target for ALD. In humanstudies of alcoholic hepatitis and cirrhosis, abnormal hepaticgene expression in methionine and glutathione metabolismoccurs and often contributes to decreased hepatic S-adenosylmethionine (SAM), cysteine, and glutathione levels12.AntioxidantsOxidative stress is thought to play a key role in thepathogenesis of ALD. Alcohol mediates oxidative stress in anumber of ways including lipid peroxidation, the productionof reactive oxygen species, and depletion of endogenousantioxidant capabilities. On this basis, it has been theorizedthat aggressive antioxidant therapy would improve outcomesin ALD.Vitamin E deficiency has been well documented in ALD.Vitamin E has experimentally proven hepatoprotectivecapabilities including membrane stabilization, reduced NFêBactivation and TNF production, and inhibition of hepatic5stellate cell activation.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 65

Jeewan R - Management of Alcoholic Liver DiseaseAnother antioxidant, Polyenylphosphatidylcholine (lecithin),is a lipid extract obtained from soybeans. It has been shown toprevent alcoholic liver cirrhosis in baboons and appears tohave anti-inflammatory, anti-apoptotic, and antifibrotic4effects.Liver transplantationLT for alcoholic cirrhosisLT for patients with ALD remains controversial, principallyas a result of concerns about the risk of post transplantationrelapse and its effect on outcome and public opinion at a timeof increasing donor shortage. These issues, coupled with aperception that these patients are more likely to havecontraindications to transplantation, either as a result of extrahepatic complications of excessive alcohol abuse or anassociated lack of self care, have contributed to a continuedreluctance of many centers to offer LT to patients with ALD.Outcome of LT for ALD several studies have demonstratedthat the survival of patients who undergo transplantation forcirrhotic ALD is comparable to patients with cirrhosis ofalternative etiologies, with 5- and 10-year survival rates5lying.Somewhere between those of patients transplanted forcholestatic and viral hepatitis–related liver disease.Furthermore, there is no evidence that patients with ALD havea higher frequency of postoperative complications orresource use compared with patients transplanted for otherindications, despite undergoing transplantation at a more13advanced stage of disease.CONCLUSIONWorldwide, ALD remains a major cause of liver relatedmortality. The diagnosis and treatment of the wide spectrumof hematologic conditions associated with ethanol intake ischallenging. Pentoxyfylline should be considered analternative to corticosteroids and it appears to especiallyeffective in ALD patients with renal dysfunction/hepatorenalsyndrome. Biologics, such as specific anti-TNFs, have beendisappointing and should probably not be used outside theclinical trial setting. Future areas of research include thesafety, efficacy, and ethical considerations of liver transplantin severe ASH for patients who are not responding to medicaltherapy.References1. Kasper L. Dennis, braunwald Eugene, Hauser L.Stephen et.al. Alcoholic liver diseases, mc-graw hillsmedical publishing division, New Delhi: harrision'sprinciples of internal medicine, 2005; 16:1855-1856.2. Merck Manuel, Alcoholic Liver Disease, (Accessed on0 4 / 0 3 . 2 0 1 1 ) , A v a i l a b l e a t :http://www.merckmanuals.com/professional/sec03/ch026/ch026a.html?qt=alcoholic%20liver%20disorder&alt=sh3. Shinde V ashok, ganu V jaysree.current concepts intreatment of alcoholic liver disease: biomedicalresearch, 2010; 21(3):321-325.4. Brave ashutosh, khan rehan, marsano Luiset.al.treatment of alcoholic liver diseases: annals ofhepatology, 2008:5-15.5. Thomas H Frazier, stocker M Abigail, kershner A Nicoleet.al.Treatment of alcoholic liver disease: therapeuticadvances in gastroenterology, 2011; 4(1):63-81.6. Louvet Alexandre, naveau Sylvie, abdelnour marcelleet.al.The Lille model: A new tool for therapeutic strategyin patients with severe alcoholic hepatitis treated withsteroids: hepatology, 2007; 45(6):1348-1354.7. Arantes vitor, michieletti pina, Cameron Rosset.al.Unusual infections complicating the use of steroidswith severe alcoholic hepatitis: can J gastroenterology,1995; 9(2):81-84.8. Bouneva iliana, abou-assi souhail, human M.douglas.Alcoholic liver diseases: hospital physician,2003:31-38.9. Tilg Herbert, Christopher P day. Management strategiesin alcoholic liver diseases: gastroenterology andhepatology, 2007; 4(1):24-34.10. Stelios F Assimakopoulos, Konstantinos CThomopoulos, and Chrisoula Labropoulou-Karatza,Pentoxifylline: A first line treatment option for severealcoholic hepatitis and hepatorenal syndrome; worldjournal of gastroenterol, 2009; 15(25):3194-3195.11. Fede G, Germani G, Gluud C, Gurusamy KS, BurroughsAK. Propylthiouracil for alcoholic liver disease,Cochrane Database of Systematic Reviews 2011, Issue6, Available at: http://www2.cochrane.org/reviews/en/ab002800.html12. Rambaldi A, Gluud C. S-adenosyl-L-methionine foralcoholic liver diseases, Cochrane Database ofSystematic Reviews 2006, Issue 2, Available at:http://www2.cochrane.org/reviews/en/ab002235.html13. Christopher Paul Day, Treatment of Alcoholic LiverDisease, Liver Transplantation, 2007; 13(11):S69-S75.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 66

Indian Journal of Pharmacy PracticeInstructions to AuthorsAssociation of Pharmaceutical Teachers of IndiaIndian Journal of Pharmacy Practice (ijopp) is official journalof Association of Pharmaceutical Teachers of India (APTI).Indian Journal of Pharmacy Practice, a quarterly publicationis devoted to publishing reviews and research articles in thearea of Pharmacy Practice. Articles in the areas of clinicalpharmacy, hospital pharmacy, community pharmacy,p h a r m a c e u t i c a l c a r e , p h a r m a c o v i g i l a n c e ,pharmacoeconomics, clinical research, clinicalpharmacokinetics and other related issues can be sent forpublication in ijopp. All manuscripts should be submitted intriplicate along with 'Authorship ResponsibilityUndertaking', signed by all the authors of the paper to,The Editor,Indian Journal of Pharmacy Practice,Association of Pharmaceutical Teachers of India,H.Q.: Al-Ameen College of Pharmacy, Hosur Road, Opp.Lalbagh Main Gate, Bangalore- 560 027.Authors should retain a copy of all materials submitted to thejournal; the editor cannot accept responsibility for loss ordamage to submitted materials.Manuscripts will be subjected to peer review process todetermine their suitability for publication, provided theyfulfilled the requirements of the journal. After the review,manuscript will be returned for revision along with reviewer'sand /or editor's comments. One original copy of the finalrevised manuscript should be submitted for publicationwithin one month after receiving the comments. It is alsodesirable to submit the final revised manuscript on a CDprepared in MS word version 6.0/95 or a higher version.Submission of a manuscript to ijopp for publicationimplies that the same work has not been either publishedor under consideration for publication in another journal.Author/s publishing results from in-vivo experimentsinvolving animal or humans should state whether duepermission for conduct of these experiments was obtainedfrom the relevant authorities /Ethics committee/InstitutionalReview Board.Manuscript preparation:Manuscripts should be concisely typewritten in double spacein A4 sized sheets, only on one side with a 2 cm margin on allsides. The manuscript shall be prepared in Times NewRoman font using a font size of 12. Title shall be in a font size14. All section titles in the manuscript shall be in font size 12,bold face capitals. Subtitles in each section shall be in fontsize 12, bold face lower case followed by a colon. The pagesshall be numbered consecutively with arabic numbers,beginning with title page, ending with the (last) page offigure legends. The length of an Review/ Science Educationarticle should not exceed 25 manuscript pages to includefigures, tables and references. No abbreviations or acronymsshall be used in the Title or Abstract acronyms, except formeasurements. All the references, figures (Fig.) and tables(Table) in the text shall be numbered consecutively as theyfirst appear. No sentence shall start with a numeral.Abbreviations like “&” and “etc” shall be avoided in thepaper. There shall not be any decorative borders anywhere inthe text including the title page. The entire MS Worddocument with graphs and illustrations pasted in it shall notexceed 2 MB. Manuscripts must conform to the “UniformRequirements for Manuscripts Submitted to BiomedicalJournals” http://www.icmje.org/. The Content of themanuscript shall be organized in the following sequence andshall start on separate pages: title page (including author'sname, affiliations and address for correspondence), abstract(including atleast 4 key words), text (consisting ofintroduction, materials and methods, results, discussion,conclusion and acknowledgements), references, figurelegends, tables and figures. Titles should be short, specific,and clear. Beginning with the first page of text, each pageshould be consecutively numbered.For the Review Articles, the author(s) is absolutely free todesign the paper. The Abstract section is needed for reviewarticles too. The article should not exceed 15 manuscriptpages including figures, tables and references. References,figures, and legends shall follow the general guidelinesdescribed below. For all other Articles, the followingformat shall be strictly followed.Title Page. The following information should appear: title ofarticle (A running title or short title of not more than 50characters), authors' name, and last name. The author towhom all correspondence be addressed should be denoted byan asterisk mark. Full mailing address with pin-codenumbers, phone and fax numbers, and functional e-mailaddress should be provided of the author for correspondence.Names of the authors should appear as initials followed bysurnames for men and one given-name followed by surnamefor women. Full names may be given in some instances toavoid confusion. Names should not be prefixed or suffixed bytitles or degrees.Abstract: The abstract is limited to 250 words, and shoulddescribe the essential aspects of the investigation. In the firstsentence, the background for the work should be stated; in thesecond sentence the specific purpose or hypothesis shall beIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 67

Instructions to Authorsprovided; followed sequentially by summary of methods,results and conclusion. No references should be cited.Introduction: A brief background information on what hasbeen done in the past in this area and the importance of theproposed investigation shall be given. Introduction shall endwith a statement of the purpose or hypothesis of the study.Material and Methods: This section may be divided intosub-sections if it facilitates better reading of the paper. Theresearch design, subjects, material used, and statisticalmethods should be included. Results and discussion shall notbe drawn into this section. In human experimentation, ethicalguidelines shall be acknowledged.Results: This section may be divided into subsections if itfacilitates better reading of the paper. All results based onmethods must be included. Tables, graphic material andfigures shall be included as they facilitate understanding ofthe results.Discussion: Shall start with limited background informationand then proceed with the discussion of the results of theinvestigation in light of what has been published in the past,the limitations of the study, and potential directions for futureresearch. The figures and graphs shall be cited at appropriateplaces.Conclusion: Here, the major findings of the study and theirusefulness shall be summarized. This paragraph shouldaddress the hypothesis or purpose stated earlier in the paper.Acknowledgments. Acknowledgments should appear on aseparate page.Tables. Each table should be given on a separate page. Eachtable should have a short, descriptive title and numbered in theorder cited in the text. Abbreviations should be defined asfootnotes in italics at the bottom of each table. Tables shouldnot duplicate data given in the text or figures. Only MSword table format should be used for preparing tables. Tablesshould show lines separating columns with those separatingrows. Units of measurement should be abbreviated and placedbelow the column headings. Column headings or captionsshould not be in bold face. It is essential that all tables havelegends, which explain the contents of the table. Tables shouldnot be very large that they run more than one A4 sized page. Ifthe tables are wide which may not fit in portrait form of A4size paper, then, it can be prepared in the landscape form.Authors will be asked to revise tables not conforming to thisstandard before the review process is initiated. Tables shouldbe numbered as Table No.1 Title…., Table No.2 Title…. Etc.Tables inserted in word document should be in tight wrappingstyle with alignment as center.Figures, Photographs and Images: Graphs and bar graphsshould preferably be prepared using Microsoft Excel andsubmitted as Excel graph pasted in Word. These graphs andillustrations should be drawn to approximately twice theprinted size to obtain satisfactory reproduction.Specification of Legends/values in Graphs Font Arial,size- 10 pt, Italics- None] Diagrams made with Indian inkon white drawing paper, cellophane sheet or tracing paperwith hand written captions or titles will not be accepted.Photographs should be submitted only on photo-glossy paper.Photographs should bear the names of the authors and the titleof the paper on the back, lightly in pencil. Alternativelyphotographs can also be submitted as 'jpeg/TIFF with theresolution of 600 dpi or more' images. Figure and Tabletitles and legends should be typed on a separate page withnumerals corresponding to the illustrations. Keys to symbols,abbreviations, arrows, numbers or letters used in theillustrations should not be written on the illustration itself butshould be clearly explained in the legend. The complete setsof original figures must be submitted. Legends should be inthe present tense (e.g., 'Illustration shows ...'). Subjects'names must not appear on the figures. Labels should contrastwell with the background. Images should be uniform in sizeand magnification. Illustrations should be free of allidentifying information relative to the subject and institution.Written permission for use of all previously publishedillustrations must be included with submission, and the sourceshould be referenced in the legends. Written permission fromany person recognizable in a photo is required. Legends mustbe double spaced, and figures are numbered in the order citedin the text. Color prints shall be submitted only if color isessential in understanding the material presented. Label allpertinent findings. The quality of the printed figure directlyreflects the quality of the submitted figure.Figures not conforming to acceptable standards will bereturned for revision. Figures should be numbered as Fig.1,Fig.2 etc. ; Figures inserted in word document should be insquare wrapping style with horizontal alignment as center.Resolution: Drawings made with Adobe Illustrator andCorelDraw (IBM/DOS) generally give good results.Drawings made in WordPerfect or Word generally have toolow a resolution; only if made at a much higher resolution(1016 dpi) can they be used. Files of scanned line drawingsare acceptable if done at a minimum of 1016 dpi. For scannedhalftone figures a resolution of 300 dpi is sufficient. Scannedfigures cannot be enlarged, but only reduced. Figures/Imagesshould be submitted as photographic quality scanned prints,and if possible attach an electronic version (TIFF/ JPEG).Chemical terminology - The chemical nomenclature usedmust be in accordance with that used in the chemicalabstracts.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 68

Instructions to AuthorsSymbols and abbreviations - Unless specified otherwise, alltemperatures are understood to be in degrees centigrade andneed not be followed by the letter 'C'. Abbreviations should bethose well known in scientific literature. In vitro, in vivo, insitu, ex vivo, ad libitum, et al. and so on are two words eachand should be written in italics. None of the above is ahyphenated word. All foreign language (other than English)names and words shall be in italics as a general rule.General Guidelines for units and symbols - The use of theInternational System of Units (SI) is recommended. For meter(m), gram (g), kilogram (kg), second (s), minute (m), hour (h),mole (mol), liter (l), milliliter (ml), microliter (µl). Nopluralization of symbols is followed. There shall be onecharacter spacing between number and symbol. A zero has tobe used before a decimal. Decimal numbers shall be usedinstead of fractions.Biological nomenclature - Names of plants, animals andbacteria should be in italics.Enzyme nomenclature - The trivial names recommended bythe IUPAC-IUB Commission should be used. When theenzyme is the main subject of a paper, its code number andsystematic name should be stated at its first citation in thepaper.Spelling - These should be as in the Concise OxfordDictionary of Current English.PAGE LAYOUT GUIDELINES Indian Journal ofPharmacy PracticePage size Letter Portrait 8.5” X 11.0”Margins All Margins, 1”Page numbersIndentFooter / HeadersTitleTextTablesNumbered as per the assigned page /Absolutely no break orMissed sectionsNone, Absolutely, No TabNone14pt Times New Roman, bold, centered followed by a singleblank line.12pt Times New Roman, full justification1.5 line spacingbetween paragraph. No indentationAt the end of context with rows and columns active; tablesshould have individual rows and columns for each valueexpressed. All text should be fully justified.Please put all primary section titles in UPPER CASE letters(Example INTRODUCTION, MATERIALS ANDMETHODS, RESULTS, DISCUSSION, ACKNOW-LEDGEMENT, REFERENCES) and subheading in bothUpper and Lower Case letters (Italics). Do not number yoursubtitles (for example, 1.0 Introduction; 2.0 Background;2.1.1 are not acceptable). Do not use the tab key to indentblocks of text such as paragraphs of quotes or lists because thepage layout program overrides your left margin with its own,and the tabs end up in mid-sentence.ReferencesLiterature citations in the text must be indicated by Arabicnumerals in superscript. Each reference separately in theorder it appears in the text. The references should be cited atthe end of the manuscript in the order of their appearance inthe text. In case of formal acceptance of any article forpublication, such articles can be cited in the reference as “inpress”, listing all author's involved. References should strictlyadhere to Vancouver style of citing references.Format: Author(s) of article (surname initials). Title ofarticle. Journal title abbreviated Year of publication; volumenumber (issue number):page numbers. Standard journalarticle (If more than six authors, the first three shall be listedfollowed by et al.) You CH, Lee KY, Chey WY, Menguy R.Electrogastrographic study of patients with unexplainednausea, bloating and vomiting. Gastroenterology1980;79:311-4.Books and other monographsFormat:Author(s) of book (surname initials). Title of book.Edition. Place of publication: Publisher; Year of publication.Personal author(s)Eisen HN. Immunology: an introduction to molecular andcellular principles of the immune response. 5th ed. New York:Harper and Row; 1974.Editor, compiler, as authorDausser J, Colombani J, editors. Histocompatibility testing1972. Copenhagen: Munksgaard; 1973.Organisation as author and publisherInstitute of Medicine (US). Looking at the future of theMedicaid program. Washington: The Institute; 1992.Conference proceedingsKimura J, Shibasaki H, editors. Recent advances in clinicalneurophysiology. Proceedings of the 10th InternationalCongress of EMG and Clinical Neurophysiology; 1995 Oct15-19; Kyoto, Japan. Amsterdam: Elsevier; 1996.DissertationKaplan SJ. Post-hospital home health care: the elderly'saccess and utilization [dissertation]. St. Louis (MO):Washington Univ.; 1995.PatentLarsen CE, Trip R, Johnson CR, inventors; NovosteCorporation, assignee. Methods for procedures related to theelectrophysiology of the heart. US patent 5529 067. 1995 Jun25.Indian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 69

Instructions to AuthorsChapter or article in a bookFormat: Author(s) of chapter (surname initials). Title ofchapter. In: Editor(s) name, editors. Title of book. Place ofpublication: Publisher; Year of publication. page numbers.Electronic journal articleMorse SS. Factors in the emergence of infectious diseases.Emerg Infec Dis [serial online] 1995Jan-Mar [cited 1996 Jun5 ] ; 1 ( 1 ) : [ 2 4 s c r e e n s ] . Av a i l a b l e f r o m : U R L :http://www.cdc.gov/ ncidod/EID/eid.htmWorld Wide WebFormat: Author/editor (surname initials). Title [online]. Year[cited year month day]. Available from: URL:World Wide Web page McCook A. Pre-diabetic ConditionLinked to Memory Loss [online]. 2003 [cited 2003 Feb 7].Available from: URL: http:// www.nlm.nih.gov/medlineplus/news/fullstory_11531.htmlAbbreviations for Journals For More information on medlineindexed journals : Download list of medline journals:ftp://ftp.ncbi.nih.gov/pubmed/J_Medline.zipAmerican Journal of Pharmacy- (Amer J Pharm)Analytical Chemistry- (Anal Chem)British Journal of Pharmacology and Chemotherapy- (Brit JPharmacol)Canadian Journal of Pharmaceutical Sciences- (Can JPharm Sci)Clinical Pharmacokinetics- (Clin Pharmacokinet)Drug Development and Industrial Pharmacy- (Drug DevelopInd Pharm)Helvitica Chimica Acta- (Helv Chim Acta)Indian Journal of Medical Sciences- (Indian J Med Sci)Indian Journal of Pharmaceutical Sciences- (Indian J PharmSci)Journal of the American Chemical Society, The- (J AmerChem Soc)Journal of Biological Chemistry- (J Biol Chem)Journal of Organic Chemistry, The- (J Org Chem)Journal of Pharmacology and Experimental Therapeutics- (JPharmacol Exp Ther)New England Journal of Medicine- (N Engl J Med)Pharmaceutical Journal, The (Pharm J)PharmacologicalResearch Communications- (PharmacolRes Commun)AUTHOR's CHECKLIST FOR SENDING PROOFS TOEDITORIAL OFFICEIn order to maintain quality and consistency in Indian Journalof Pharmacy Practice, we ask you to perform the followingitems prior to submitting your final proof for publication:Include the original, hard copy of Author's Transfer ofCopyright signed by each authorThoroughly check the article for typographic errors,format errors, grammatical errors, in particular: spellingof names, affiliations, any symbols, equations in thecontext, etc.Provide graphs and figures in excel format, Pictures arerequired as high resolution images (300 dpi).Provide laser printed hard copies of all figures andgraphics in black and white or scanned copies can also besent to ijopp@rediffmail.comSubmit a proof corrected with RED INK ONLY.List out the corrections made in typed format in aseparate page with the proof.Send the Corrected Proof, Copyright Transfer Form, with covering letter in a single envelope to the Following AddressAuthors are required to send their contributions or manuscripts through post or courier services.Dr. Shobha Rani R HiremathEditor, Indian Journal of Pharmacy Practice (ijopp).C/o. Association of Pharmaceutical Teachers of India (APTI),H.Q: Al-Ameen College of Pharmacy,Opp. Lalbagh Main gate, Hosur Road, Bangalore 560 027, Karnataka, INDIA.All enquiries can be made through e-mail: ijopp@rediffmail.comIndian Journal of Pharmacy Practice Volume 4 Issue 3 Jul - Sep, 2011 70