10.07.2015 Views

Package 'ChIPpeakAnno' - Bioconductor

Package 'ChIPpeakAnno' - Bioconductor

Package 'ChIPpeakAnno' - Bioconductor

SHOW MORE
SHOW LESS

You also want an ePaper? Increase the reach of your titles

YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.

16 enrichedGOArgumentspatternsequencesDNAstringSet objecta vector of sequencesValueTotal number of occurrence of the pattern in the sequencesAuthor(s)See AlsoLihua Julie ZhusummarizePatternInPeaks, translatePatternExamplesfilepath = system.file("extdata", "examplePattern.fa", package="ChIPpeakAnno")dict = readDNAStringSet(filepath = filepath, format="fasta", use.names=TRUE)sequences = c("ACTGGGGGGGGCCTGGGCCCCCAAAT", "AAAAAACCCCTTTTGGCCATCCCGGGACGGGCCCAT", "ATCGAAAATTTCC")countPatternInSeqs(pattern=dict[1], sequences=sequences)countPatternInSeqs(pattern=dict[2], sequences=sequences)pattern = DNAStringSet("ATNGMAA")countPatternInSeqs(pattern=pattern, sequences=sequences)enrichedGOEnriched Gene Ontology terms used as exampleDescriptionUsageFormatEnriched Gene Ontology terms used as exampledata(enrichedGO)A list of 3 variables.bp enriched biological process with 9 variablesgo.id:GO biological process idgo.term:GO biological process termgo.Definition:GO biological process descriptionOntology: Ontology branch, i.e. BP for biological processcount.InDataset: count of this GO term in this dataset

Hooray! Your file is uploaded and ready to be published.

Saved successfully!

Ooh no, something went wrong!