FGF-signalling in the differentiation of mouse ES cells towards ...

More documents

Recommendations

Info

For analysis of cells stained with antibodies, cells were fixed in LILLY’s fixative (Bie &Berntsen), and resuspended in 0,1% BSA in PBS. Cells were stained in 0,1% BSA in PBS for 2hrs at 4°C with Flk1-PE (BD Pharmigen, # 555308) and EpCAM-PE-Cy7 (eBioscience, # 25-5791-80). Or cells were permeabilised in dilution buffer (0,3% Triton X-100 + 0,1% BSA inPBS), unspecific binding sites were blocked by 10% Normal Donkey Serum (JacksonImmunoresearch Laboratories) for 30 minutes at RT and stained for Brachyury (R&D Systems,# AF2085) for 2 hours at RT in dilution buffer, followed by a Cy3-conjugated secondaryantibody (Jackson Immunoresearch Laboratories, # 705-165-147) for 1 hour at RT. Cells wereanalysed by FACS Aria flow cytometer (BD Biosciences).Cell sortingCells were dissociated by 0,05% Trypsin-EDTA (Invitrogen), washed and resuspended inN2B27 medium before sorting by FACS Aria flow cytometer (BD Biosciences).Immunofluorescent stainingCells were grown in 9 cm 2 slide flasks (Nunc) coated with 0,1% gelatine (Sigma) and fixed inLILLY’s fixative (Bie & Berntsen), permeabilised in dilution buffer (see above) and blockedfor 30 minutes at RT in 10% Normal Donkey Serum (Jackson Immunoresearch Laboratories)in dilution buffer. They were stained ON at 4°C with primary antibodies: mouse anti-Oct3/4(C-10), goat anti-Foxa2 (both Santa Cruz Biotechnology), goat anti-Brachyury (R&DSystems), rat anti-E-cadherin (Zymed/Invitrogen), goat anti-Sox17 (R&D Systems), and 1 hrwith Cy2-, Cy3- or Cy5-conjugated species-specific secondary antibodies (JacksonImmunoResearch Laboratories) and 4′,6-diamidino-2-phenylindole (DAPI, MP Biomedicals).Slides were mounted in Fluorescent mounting medium (KPL). Negative controls, where theprimary antibodies were omitted, were included for all stainings and showed no unspecificstaining of the secondary antibodies (data not shown). The slides were analyzed using an LSM510 META laser scanning microscope (Carl Zeiss).qPCRCells were harvested in Lysis solution (Invitek), supplemented with 10 mM dithiothreitol(DTT). Total RNA was isolated using the Invisorb Spin RNA kit (Invitek) with DNAsetreatment (Promega) following the manufacturer’s protocol. cDNA was prepared from 250 ngRNA using MMLV Reverse Transcriptase (Invitrogen) with random oligos or oligo(dT) 12-18primers (both Invitrogen).qPCR was performed using the standard SYBR ® Green program with dissociation curve on theMx3005P (Stratagene). PCR reactions were run in duplicates using 10 µl Brilliant ® SYBR ®Green qPCR Master Mix (Stratagene), 1 µl cDNA, 1 µl 20 µM primer-mix and 8 µl dH 2 O.Quantified values for each gene were normalized against the housekeeping gene TATAbindingprotein (TBP). Statistical analyses were performed using Student’s two-tailed, paired t-test. Primer sequences are: FGFR1c F_CCGTATGTCCAGATCCTGAAGA,R_GATAGAGTTACCCGCCAAGCA; FGFR2c F_GCCCTACCTCAAGGTTCTGAAAGR_GATAGAATTACCCGCCAAGCA; FGFR3c F_CCCTACGTCACTGTACTCAAGACTGR_GTGACATTGTGCAAGGACAGAAC; FGFR4 F_CGACGGTTTCCCCTACGTACAR_TGCCCGCCAGACAGGTATAC (all from (Woei Ng et al. 2007); FGFR1bF_CTTGACGTCGTGGAACGATCT, R_CACGCAGACTGGTTAGCTTCAC (Nakayama etal. 2007); FGFR2b F_AACGGGAAGGAGTTTAAGCAG,R_GGAGCTATTTATCCCCGAGTG (Yamanaka et al. 2000); Sox17F_GGAGGGTCACCACTGCTTTA, R_TCAGATGTCTGGAGGTGCTG; Cxcr4F_AGGTACATCTGTGACCGCCTTT, R_ AGACCCACCATTATATGCTGGAA (Kim etal. 2008); Sox7 F_GGCAGTGCAGAACCCGGACC, R_TGCAGAGGCGCTTGCCTTGT;Tdh F_ CCTGGAGGAGGAACAACTGACTA, R_ ACTCGAATGTGCCGTTCTTTG(Wang et al. 2009); TBP F_TCTGAGAGCTCTGGAATTGT,R_GAAGTGCAATGGTCTTTAGG.62
Cell count and proliferation assayCells were fixed in LILLY’s fixative (Bie & Berntsen) and counted in a NucleoCassette read bythe NucleoCounter (ChemoMetec A/S) according to the manufacturer’s protocol for countingnon-living cells.As a proliferation assay, EdU-incorporation by the Click-iT® EdU HCS Assay (Invitrogen)was used (Salic and Mitchison 2008). Cells were incubated for 15 min in their respective mediacontaining 10 µM EdU. Cells were washed, fixed and stained by the Click-iT reaction cocktailaccording to the manufacturer’s protocol, using the Alexa Fluor 488-conjugated antibody todetect incorporation. Stained cells were quantified using the FACS Aria flow cytometer (BDBiosciences).StatisticsMean % of the cells of interest ± standard deviation or standard error of the mean (S.D. orS.E.M.) was calculated and statistical analyses by Student’s paired, two-tailed t-test or Ratio t-test were performed.ResultsExpression of FGF receptor-isotypes during definitive endoderm formationRecently, we and others have shown that fibroblast growth factor (FGF)-signalling in mouseembryonic stem (mES) cell cultures is necessary for the differentiation of definitive endoderm(DE; (Funa et al. 2008; Morrison et al. 2008; Willems and Leyns 2008; Hansson et al. 2009)).These studies are based on a general requirement for active FGF-signalling during early mousedevelopment where FGF3, 4, 5, 8b and FGFR1 are expressed in the epiblast to post-gastrulationembryo (Wilkinson et al. 1988; Haub and Goldfarb 1991; Hebert et al. 1991; Niswander andMartin 1992; Ciruna et al. 1997; Guo and Li 2007). To elaborate on the observed dependenceon FGF-signalling during DE formation, we made a thorough investigation of the expression ofisoforms of FGFRs during the 5-day differentiation period by quantitative RT-PCR (qPCR).We used a Sox17 Gfp/ + reporter cell line (Kim et al. 2007) and sorted cells into Sox17-GFP Hi andSox17-GFP Lo fractions, in order to isolate RNA from the forming DE and the non-DEpopulations of cells, respectively (Figure 1A). In general, FGFR1c was expressed at high levels,FGFR2b and 2c at intermediate levels and FGFR1b, 3c and 4 at low levels. During the 5-daydifferentiation period, FGFR2b and 4 were up-regulated in the unsorted and Sox17-GFP Hifractions while their expression was either unchanged or down-regulated in the Sox17-GFP Lofractions (Figure 1B). FGFR1b was down-regulated in both the unsorted and Sox17-GFP Lofractions upon initiation of differentiation, although not significantly different from theundifferentiated culture. These data confirm findings by other groups, showing that FGFR2band 4 are expressed in endodermal epithelia such as the definitive endoderm (Stark et al. 1991;Orr-Urtreger et al. 1993; Elghazi et al. 2002). FGFR1c was upregulated in the Sox17-GFP Lofraction alone, peaking on day 5, whereas FGFR2c and 3c were up-regulated in both Sox17-GFP Lo and Sox17-GFP Hi fractions, upon differentiation by activin (Figure 1B). In summary,FGFRc-isoforms are highly up-regulated throughout the cell culture or in the Sox17-GFP Lofraction alone, whereas FGFR2b and 4 are up-regulated in the Sox17-GFP Hi fractionspecifically, suggesting a role for especially FGFRc isoform-activation during DE formation inmES cells.FGFs activating specific sub-populations of FGFRs differentially activate PS and DEmarkersSince FGFs activate specific FGFR-isofoms, we speculated that certain FGFs were likely tohave a more potent effect on expression of PS and DE markers in a culture system aimed atinducing such cell types. We chose to focus on FGFs that are described to have a functionduring gastrulation and in the development of the DE and based on which FGFRs they activate63
Page 1:
PhD thesisCand.scient. Janny Marie
Page 5:
ResuméSukkersyge er en sygdom der
Page 9:
Table of contents1
Page 12 and 13:
ICMinner cell massIdInhibitor of di
Page 14 and 15:
cell mass regenerates probably thro
Page 16 and 17:
Figure 1-1: Early embryo developmen
Page 18 and 19: Figure 1-3: Regional expression of
Page 20 and 21: The pluripotent stateThe pluripoten
Page 25 and 26: There are four membrane-bound FGFRs
Page 27: 2. AimsThe aim of this study was to
Page 30 and 31: Developmental Biology 330 (2009) 28
Page 32 and 33: 288 M. Hansson et al. / Development
Page 50 and 51: Figure S2Figure S2: A subpopulation
Page 52 and 53: Figure S4Figure S4: Expression of T
Page 54 and 55: Figure S6Figure S6: qRT-PCR analyse
Page 56 and 57: epithelium; Cdx2, expressed posteri
Page 58 and 59: Figure 4-4: A high FGF4-concentrati
Page 60 and 61: Figure 4-6: A 3-step protocol does
Page 63 and 64: 5. Paper IIFGFR(IIIc)-activation in
Page 65 and 66: AbstractProgress in embryonic stem
Page 67: variants in their Ig-like domain II
Page 71 and 72: influence on the numbers of Sox17-G
Page 73 and 74: undifferentiated cells, we found th
Page 75 and 76: FGF4, 5, FGF8b and FGFR1, are expre
Page 77 and 78: with EdU-stain (blue sample); and w
Page 79 and 80: Olsen, S.K., J.Y. Li, C. Bromleigh,
Page 81 and 82: FiguresFigure 1: Screen for FGFR-is
Page 83 and 84: Figure 3: Activation of FGFRb or FG
Page 87 and 88: Opposite, Figure 6: In the absence
Page 89 and 90: 6. General discussionEndoderm diffe
Page 91 and 92: Overall, the multitude of FGF-signa
Page 93 and 94: transplantation is the spread of an
Page 96: AcknowledgementsThe work presented
Page 99 and 100: Chambers, I., D. Colby, M. Robertso
Page 101 and 102: Hawkins, V.J. Wroblewski, D.S. Li,
Page 103 and 104: Nishikawa, S.I., S. Nishikawa, M. H
Page 105 and 106: Tanimizu, N., H. Saito, K. Mostov,
show all

FGF-signalling in the differentiation of mouse ES cells towards ...

Create successful ePaper yourself

Delete template?

Save as template?