FGF-signalling in the differentiation of mouse ES cells towards ...

More documents

Recommendations

Info

epithelium; Cdx2, expressed posterior to the pancreatic region. Foxa2, expressed throughout thegut tube, was used as a marker for DE-derived cell types (see also Figure 1-3; (Grapin-Bottonand Melton 2000; Jorgensen et al. 2007)).In the embryo, endoderm cells are patterned by signalling events within the endoderm or fromthe mesoderm. Activin has an anteriorising effect on both endoderm formation and patterningwhereas WNT3a has a posteriorising effect on PS-formation and cell specification duringgastrulation (Grapin-Botton and Melton 2000). Dessimoz and co-workers showed that inchicken embryos, FGF4 also has a posteriorising effect starting during gastrulation andpersisting through the early somite stages (Dessimoz et al. 2006). FGF-signalling is necessaryfor restricting anterior expressed genes and for establishing midgut gene expression. Retinoicacid (RA) is implicated in the development of tissues in all three germ layers. In mES celldifferentiation, it is often used to induce cells of a neural type (Okada et al. 2004). In ES cellaggregates, RA has been shown to induce Pdx1-expressing cells (Micallef et al. 2005), and inendoderm patterning towards pancreatic cell types it is used in both mouse and human ES cellprotocols (D'Amour et al. 2006; Micallef et al. 2007; Borowiak and Melton 2009).Materials and MethodsWe cultured and analysed cells as described in Hansson et al., 2009. Below are additions to themethods and materials described.Cell culture and differentiationWe used the following mES cell lines: Sox2-LacZ (Li et al. 1998) and Pdx1-GFP (Holland etal. 2006). We added KAAD-cyclopamine (Toronto Research Chemicals) and FGF10 (R&DSystems) to the differentiation medium.RT-PCRRT-PCR was performed using the primer sequences: Pdx1F_AAATTGAAACAAGTGCAGGT, R_GACAGTTCTCCACTGCTCTC; GAPDH F_CGGTGCTGAGTATGTCGTGGA, R_ GGCAGAA GGGGCGGAGATGA.ResultsWe applied a 2-step protocol for the patterning of our DE:‘Step 1’ – DE induction: 5 days in 30 – 100 ng/ ml activin, seeding density of 2.000 cells/ cm 2‘Step 2’ – Pdx1 induction: 3 – 5 days in a combination of growth factors and inhibitors50
Figure 4-2: WNT3a and FGF4 in Step 2 induce anterior gut tube cells. Sox2-LacZ cells differentiated for 5 daysin 100 ng/ml activin (Step 1) and 3 days in 5 ng/ml WNT3a + 10 ng/ml FGF4 (Step 2) were stained for β–Galactosidase and imaged under 10× objective.Figure 4-3: Increasing the FGF4-concentration does not result in posterior foregut-type cells. Flk1-LacZ cellsdifferentiated for 5 days in 100 ng/ml activin (Step 1) and 3 days in 25 ng/ml WNT3a ± 10 or 100 ng/ml FGF4(Step 2) were stained for FOXA2, SOX2, and PDX1. 20× objective.FGF4 and WNT3a alone induce cells resembling anterior or posterior gut tubeThe first attempts to pattern our DE into cells of a pancreatic type was done by addition of 0, 10or 100 ng/ml FGF4 and/ or 0, 5 or 25 ng/ml WNT3a to the basic medium for 3 days.51
Page 1:
PhD thesisCand.scient. Janny Marie
Page 5: ResuméSukkersyge er en sygdom der
Page 9: Table of contents1
Page 12 and 13: ICMinner cell massIdInhibitor of di
Page 14 and 15: cell mass regenerates probably thro
Page 16 and 17: Figure 1-1: Early embryo developmen
Page 18 and 19: Figure 1-3: Regional expression of
Page 20 and 21: The pluripotent stateThe pluripoten
Page 25 and 26: There are four membrane-bound FGFRs
Page 27: 2. AimsThe aim of this study was to
Page 30 and 31: Developmental Biology 330 (2009) 28
Page 32 and 33: 288 M. Hansson et al. / Development
Page 50 and 51: Figure S2Figure S2: A subpopulation
Page 52 and 53: Figure S4Figure S4: Expression of T
Page 54 and 55: Figure S6Figure S6: qRT-PCR analyse
Page 58 and 59: Figure 4-4: A high FGF4-concentrati
Page 60 and 61: Figure 4-6: A 3-step protocol does
Page 63 and 64: 5. Paper IIFGFR(IIIc)-activation in
Page 65 and 66: AbstractProgress in embryonic stem
Page 67 and 68: variants in their Ig-like domain II
Page 69 and 70: Cell count and proliferation assayC
Page 71 and 72: influence on the numbers of Sox17-G
Page 73 and 74: undifferentiated cells, we found th
Page 75 and 76: FGF4, 5, FGF8b and FGFR1, are expre
Page 77 and 78: with EdU-stain (blue sample); and w
Page 79 and 80: Olsen, S.K., J.Y. Li, C. Bromleigh,
Page 81 and 82: FiguresFigure 1: Screen for FGFR-is
Page 83 and 84: Figure 3: Activation of FGFRb or FG
Page 87 and 88: Opposite, Figure 6: In the absence
Page 89 and 90: 6. General discussionEndoderm diffe
Page 91 and 92: Overall, the multitude of FGF-signa
Page 93 and 94: transplantation is the spread of an
Page 96: AcknowledgementsThe work presented
Page 99 and 100: Chambers, I., D. Colby, M. Robertso
Page 101 and 102: Hawkins, V.J. Wroblewski, D.S. Li,
Page 103 and 104: Nishikawa, S.I., S. Nishikawa, M. H
Page 105 and 106: Tanimizu, N., H. Saito, K. Mostov,
show all

FGF-signalling in the differentiation of mouse ES cells towards ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?