FGF-signalling in the differentiation of mouse ES cells towards ...

epithelium; Cdx2, expressed posterior to the pancreatic region. Foxa2, expressed throughout thegut tube, was used as a marker for DE-derived cell types (see also Figure 1-3; (Grapin-Bottonand Melton 2000; Jorgensen et al. 2007)).In the embryo, endoderm cells are patterned by signalling events within the endoderm or fromthe mesoderm. Activin has an anteriorising effect on both endoderm formation and patterningwhereas WNT3a has a posteriorising effect on PS-formation and cell specification duringgastrulation (Grapin-Botton and Melton 2000). Dessimoz and co-workers showed that inchicken embryos, FGF4 also has a posteriorising effect starting during gastrulation andpersisting through the early somite stages (Dessimoz et al. 2006). FGF-signalling is necessaryfor restricting anterior expressed genes and for establishing midgut gene expression. Retinoicacid (RA) is implicated in the development of tissues in all three germ layers. In mES celldifferentiation, it is often used to induce cells of a neural type (Okada et al. 2004). In ES cellaggregates, RA has been shown to induce Pdx1-expressing cells (Micallef et al. 2005), and inendoderm patterning towards pancreatic cell types it is used in both mouse and human ES cellprotocols (D'Amour et al. 2006; Micallef et al. 2007; Borowiak and Melton 2009).Materials and MethodsWe cultured and analysed cells as described in Hansson et al., 2009. Below are additions to themethods and materials described.Cell culture and differentiationWe used the following mES cell lines: Sox2-LacZ (Li et al. 1998) and Pdx1-GFP (Holland etal. 2006). We added KAAD-cyclopamine (Toronto Research Chemicals) and FGF10 (R&DSystems) to the differentiation medium.RT-PCRRT-PCR was performed using the primer sequences: Pdx1F_AAATTGAAACAAGTGCAGGT, R_GACAGTTCTCCACTGCTCTC; GAPDH F_CGGTGCTGAGTATGTCGTGGA, R_ GGCAGAA GGGGCGGAGATGA.ResultsWe applied a 2-step protocol for the patterning of our DE:‘Step 1’ – DE induction: 5 days in 30 – 100 ng/ ml activin, seeding density of 2.000 cells/ cm 2‘Step 2’ – Pdx1 induction: 3 – 5 days in a combination of growth factors and inhibitors50